List database


# MySQL hash MySQL password
967,780,001 *64E29B5CAC1327B1FD2BB4E7C8857FFAC5785EF7 A;72Z
967,780,002 *64EB5888D472C38C174EE531B13321D4D422BCD5 A+;73
967,780,003 *64E6FF70CDB0AD410DAE844D1F86378F3892A093 A73
967,780,004 *64EAAB1520E71E3CE9FC49375D539ADD196E2625 a73887
967,780,005 *64EE1B5B3DF55247DE28247574C802E84C3C0660 A73;i
967,780,006 *64E772006BA2189978FE72AE32E4010DEE79605C A74j%
967,780,007 *64EA5209856A86589AEA164CEBB1ED0B362D33CD A7%50
967,780,008 *64E961AB2CEA9E65751E3B17E6CD44DE50367930 A755r
967,780,009 *64EBBA3ABA144D05DB82215657A1DCBB713C4D0A a75762
967,780,010 *64EC3031A026B06686EAA66E1E98208CD55F1FC2 A76B.
967,780,011 *64EDA816C8E6262565B67C2AB0CFFCC57E0CA881 A7$6f
967,780,012 *64EE6A70E14289B7CCE7A36CF0F9E759A9BC0D3A A76;u
967,780,013 *64ECCB283BDDE14833BB09F6FFE3542DCFE2A76D A#76V
967,780,014 *64EA383BFA44F64732A05EC232B4E1A7AAA836AF A77?$
967,780,015 *64EF216DD106B4FE5C8F6CB57DBDAE0F51DD747D a7789445611
967,780,016 *64E32598A1A3A1B8C326393E15DB62ED0E670612 a77Y
967,780,017 *64EC5402695F174C5949727A31F210516F662122 A7,8
967,780,018 *64EB8473CE64D8CA8F99A80C341E487D1D86777F a787051
967,780,019 *64E836FC77A2590C269381DA0D1EF9257D6757B0 A7&8I
967,780,020 *64EAB643E70D5DC02BF182E0E7321A64D207EE29 A?799
967,780,021 *64E82E957D4009293FF4F3950C24351DCA109E36 A79.q
967,780,022 *64EBF50E8ACAD5771616A43CA5B7C34597DD3546 A79rb
967,780,023 *64EBC14524A89602DE81DD5314DD51D91B1DD735 A79T-
967,780,024 *64E36C7EF49F56DE705F463B9C66098386150604 A7+A&
967,780,025 *64E16485BD8400765F838A9F0A9370AF9F1D2901 A-7aM
967,780,026 *64E94F02BF99FADF65C06CEE868F4C4FD8669962 A7AMR
967,780,027 *64E35CBBB7BF86FB1DFE9D900F173C606FDACB45 A7aNh
967,780,028 *64E80EDD308391670089E827D18188CC529D1569 a+7axiaphasia
967,780,029 *64E5D1EE8817EF58C3F14D97CEFC936A0432C0EC A7;aZ
967,780,030 *64E502E61BCDD090573D8CCAA9E94C3777FC883F A7bb/
967,780,031 *64E0881110733101C36877121B5DFD0D0714FB06 A7Bbaa
967,780,032 *64EB9243D994CECAB1EDA53B77C659BCFD464E80 A7$Bd
967,780,033 *64EED5E77F4E0F6F400130382855942647721784 A7B=j
967,780,034 *64E312ADED73B68B1B22BCBC19A5F8FC6626F596 A7B"P
967,780,035 *64EC5EC8906337879725F087FE327993AA7AC7A9 A7bTV
967,780,036 *64ECCE5F1C4EEDED57CDD0C35E9F3A8B782E2710 A7btY
967,780,037 *64EDE01BE3102200272A90575876C833C4065F19 A7b=U
967,780,038 *64ED4A56247277887EB6D10C97794D0F312E7DF2 A7c1!
967,780,039 *64EF08EFA332D904109190542EB4E959C3A298B9 A7C$p
967,780,040 *64E0C2201F5D8EFF2C181365497D04FE2F2E14C8 A/7D:
967,780,041 *64ED967E94862ECE66E3C105EE99901BF05BEAB2 A7DaF
967,780,042 *64E77D8773115005BDF0FECCA54E80759363DD66 A7d#e
967,780,043 *64EB549A6AF40AD9C9F758D42F34E913B4EAC999 A7drX
967,780,044 *64E2C3C677998589442996406076B39D52DDF17E A
967,780,045 *64E4598A926251764DCABE7C3969CABE9F9C90A1 A7ecu
967,780,046 *64E49BBED5E421F3A49D7EFFE41D6907775AE976 A+7eh
967,780,047 *64E38B0984F86760CF1111241C7DF8B2EC23597E A7+ej
967,780,048 *64E404B47506DF13A963C20F8F163E95ADD8B6ED A7f%!
967,780,049 *64E20B2E024D9DD65C83AAC72B03DAF34C687715 A&7f6
967,780,050 *64E2FDCBE1E509304171B441FC4E1DFCE85293BE A7FP#
967,780,051 *64EF99D9132C829C925582CAC6A492C6007EE0C3 A7F&u
967,780,052 *64EBB67877C3D43C441B6CD62219A03F5779D642 A7-gK
967,780,053 *64E087FFF1FD501E84924AA0A62DE56457A1B2A2 A7Gnb
967,780,054 *64EEC9E42EA8EF1B5FEBFAFF4235F65F56ECFC33 A7gPb
967,780,055 *64E609830F282BD0845077665FD2ADE383A23F47 A7#gR
967,780,056 *64E08EACFE5A4B8D202855C226324CF7BCA96818 A7HvO
967,780,057 *64E33F419FF975A2F0020C9C44B8B732478D2923 A-7i?
967,780,058 *64E5AE1DB1D630B91CD8A3EDE1B1B7A25810FF1D A7i$&
967,780,059 *64EFDC3C43BD10EEEE97E26CBB801CC71AD96861 A7"j$
967,780,060 *64E057795FEBC878D1968CD06C33421917FB0625 A7jZL
967,780,061 *64EEB6C3FF894F99147DB2A9C4F71851FC8E1952 A,7K-
967,780,062 *64E37C8B3DF1B1E5C6AC3087B31C8C2B03DAA551 A#"7K
967,780,063 *64E0C9280B37DAC3C046E03740F87431642D6C1F A7K4d
967,780,064 *64E6220A9AC51F674B58753C0466A73F4B867666 A7kq/
967,780,065 *64EDE53B2F90A48679E1D3D5616186CFB896B51E A7kvP
967,780,066 *64E28770068E67A36212BB3126107B8B7930B6A9 A7KZs
967,780,067 *64ED7AC8D33AB7842A226BAEA8A3274306DA6355 A7lEC
967,780,068 *64EA13100E6D715547DAB7332E720FBFE93D6744 A7lS8
967,780,069 *64E4DA3CAE78C6E3927788D182187F4A376294FE A7&m6
967,780,070 *64E28D56B7DA248BB78FC5AC8ECA694857A888D5 A7mnF
967,780,071 *64E92567E0C65B5E8FAFCF2E67E5BA54307D0D3E A7_Mt
967,780,072 *64EA9A70BC7B3380A96CD2A06A75CF2DD120662B A7NVT
967,780,073 *64EC950F45090279AB80AC50EA42358C1E43B233 A7O+.
967,780,074 *64E3ECE4B4EAD4E34F20B44BD5AAFA1162835E00 A%7OG
967,780,075 *64E1D3662CE7C164EE41F677000ABAC1C1CBFBDD A7#Oj
967,780,076 *64EAE09D1E0FBBCDC248D751FEE98F0D06336F55 A!7p
967,780,077 *64E922CAA667A7121442D4A4FEBA6670028A7FD2 A7P.B
967,780,078 *64E6257175E99E9D5F53193D1D78410D22339E25 A7PbD
967,780,079 *64EFDBB897395C1F1912FDD480C651D12E71D591 A;7Pp
967,780,080 *64E9FD8FAFFC6F40496D15D0E974264D69F5401A A7pr7
967,780,081 *64E5F0B32AAB9E8F692D58EFEC0AAD8F1FFF075C A7PrB
967,780,082 *64E67127F2BAA4BD5F948E4862BE9633337582E0 A7Pwr
967,780,083 *64E2109306F645BBD69F621F07C02B770144E532 a7!q
967,780,084 *64EDE95A7E354152CB28C9C81FA13C1FCB3DAFDD A7q2l
967,780,085 *64EC5E28C2CB32C0890E919F8E20D5EA3FF82DCB A7riX
967,780,086 *64ED99E8391844ED24AC6D5C8121B307411A85BA A:7Sb
967,780,087 *64E00F9D3F92D57FFD9628E0D91D210D8EBD8669 A7SKP
967,780,088 *64E5B6683C38F11DF514964A7C14CADF6573A13B A7.SN
967,780,089 *64E6509EB8CA4E6BE96FF6E7EB149DF75B7ACDBF A7t!,
967,780,090 *64E6009E5C8E20BA088271B192BC87C08DA743D5 A7T2N
967,780,091 *64ED7C68EF140F75EF40C364B89ADE2BD28ECD83 A7T7w
967,780,092 *64E9C55B9A8B90B96E55B8CF167F1E78F1426588 A7tC-
967,780,093 *64E6E8A819942CECDEFAD108679DF0CA55C2504B A!7Tn
967,780,094 *64EABDFFF3B23C9040D291CE659DB9BD721E333D A)7to
967,780,095 *64E0B71E2E96BBFF064A1B846EFBEDEEE7AEBFB2 A?7U;
967,780,096 *64EF73AC6ECC0BA1D3BD7D7C12F6C4DD69D9FFD5 A-!7u
967,780,097 *64ED548A0867D6B5A0439B2985DE572A166CE462 A7u-1
967,780,098 *64EECBA0CFD284FE947B780A40D44786ABD876AA A7U/6
967,780,099 *64E52F7EF7C3DE0CE305EA4E39A5B4D3E0A98712 A7u=6
967,780,100 *64E839A375D13EF921B21BF87488CC9BDE4CBC02 A7Uc&
967,780,101 *64E75EEB3B776EBA8528120B0FA590BCACC31A04 A7%uK
967,780,102 *64E821F4FB5B6D88E8D52EBD987247B8CC9D5AA6 A7unO
967,780,103 *64EAF4555B255232248EB9CF28100F8B2C4343C2 A7u%p
967,780,104 *64EC517CB9D0A78043906A707EEEDF355D5EE7F0 A7UU/
967,780,105 *64EE5935DAA4B7516EDC2D48C6DC66BFC6E92691 A7V=-
967,780,106 *64E240D8372D99C7622256A62C2486C2E4BE1CA2 A7VG=
967,780,107 *64E80AE6264634F7ABF471DDDD1C549A7F86AEB6 A7,VM
967,780,108 *64EAC906FD923F1E9518B89CE98D17FCAD4048E0 A.7vu
967,780,109 *64E358B0CAACF6586274ED20E758392C2992A2BD A7&W"
967,780,110 *64E7BFE2E34BA0AA1766D083318AA494EEEA7F4C A
967,780,111 *64E654B57236691C4EFD6ABF7B683B79C62332C8 A7(w
967,780,112 *64E0CC8E9DBA8A0F348A7650D1353B26EBB01D10 A7)#w
967,780,113 *64EEEC2E9BDF6FE29BE21F7E30F0819E394ACC4C A7Wd(
967,780,114 *64E73417D9E1FD4E606FA09026BCC4642D02B175 A7wl;
967,780,115 *64E5B742084B611A9487BE02CFE03D70177B785A A7-Wu
967,780,116 *64EC7B51748AE03BE98A7364F9E7F8091436F30B A(7X&
967,780,117 *64E6457045FEF40803B5EF9F0EB45FC01FB0A8AA A7Y$G
967,780,118 *64E16CDF4B0F188591830538831D2EBB8EA12D14 A7#Yt
967,780,119 *64E5567EBCF56ED4AE22C67C8B5FDF984B13C391 A_8&_
967,780,120 *64E521C615DD6DA7DBA20536B8B9D22E674B6FBA A";8_
967,780,121 *64E5BBB0D147D879BA0871139CDB4C18DB467406 A(_,8
967,780,122 *64ED0EC7E25CBAF6753A0ECF30F074EE2FE8C9D0 A$.%8
967,780,123 *64E762CCE72C60ED5ECF0DD61065F4D59A8644F0 A#8.;
967,780,124 *64EFB424300BFC2D3C61B6F16A3B299BB5B16F9A A8+%%
967,780,125 *64E4CB6CE635FCBCE1224B32292A83F56BAE9293 a8_%
967,780,126 *64E636D754288D9CB6B5E6B18360F69C0016B033 A806E
967,780,127 *64ED2C0C2B04F213459ACDA9EA62FBE218861330 a[email protected]
967,780,128 *64EE39E6E4F38237C1CACDA702C23A0E740F53FA a80bffc896e6e91997a5bb76a1d44530
967,780,129 *64E2612EB6E3F30D304267949CACFFE6637C2890 A8/,1
967,780,130 *64E923E866A66A498746543455C831E558D0A946 a810917
967,780,131 *64EA1CA0B2D5D1D8473A164D773E281B9F9C5885 A8+1B
967,780,132 *64EFDD4EC6152EBB30FCB1EB4367E99131DA9B76 A82?
967,780,133 *64ECD16D26AAFD6A1801B8FF01DCCFEDDAFFB558 [email protected]
967,780,134 *64E6754D16A6101D00DACE235723F2D4D1687CE9 A836o
967,780,135 *64E1D92C865332BF8AA00F52E4C66DF5FC68FD0D A83.q
967,780,136 *64EDD9BD1F936C3B7F84A178435F427A8DE45719 A8,3u
967,780,137 *64E16E692483043549A628902EE457063ACBE26F A83Up
967,780,138 *64E2F51E5F18DD07A59CBC934D0E87CCD9C751BB A8;4-
967,780,139 *64EF02F0C32CF3E68F0CABED1E035CEBBB1AE538 A84A0
967,780,140 *64ECC21D78D17EE112936B66E4E6EB95B7C5A463 A$84D
967,780,141 *64ECD3764B1F145773281471752411ECCDA6172E A84sV
967,780,142 *64E3E78636379E4B8198CA13579307776796BEFB A8%50
967,780,143 *64EED3072A86468C458BCF19EEE35F664531690F A85R
967,780,144 *64E264CA37573EB524246D3F50D19FD1E9265782 A_!86
967,780,145 *64E2D1478C71CE8F37050DE78C4C1FAC323DF22C A&8"6
967,780,146 *64E9A075843A8C8768EDF69FABDCFC2D1067253D A86g&
967,780,147 *64EBCC936EAF068CA6740266B57A464609A6C6E4 A86m2
967,780,148 *64EF897491DB093BFC74C178E8B332EC7505AF0D a8719y
967,780,149 *64E18AFF190B0B8C299E68F53E71002914462B3D A8$7en71ou$
967,780,150 *64E07EEB5D30525FE71D6107D8D4090FD060E941 A_87g
967,780,151 *64E05170AA4176D11BCCE4BE19C98924524F4F54 A8)7M
967,780,152 *64EB4371CD8D31BE87D2F0384842D0C531C07BBC A=88/
967,780,153 *64EE7204A18351724794D815B0368AA399043BC3 [email protected]
967,780,154 *64ED24E00D6946A8E654FB97C256586DEEF15409 A88L2
967,780,155 *64E87DCC15F44B4FEC040D45888EB4F0B482CD82 A88S#
967,780,156 *64EBC803214E97434AC867424E073907F3BE0273 A8-9?
967,780,157 *64E4BFD392BB84483E57865C3EB102001DC91C6D A89qu
967,780,158 *64ECBEB7A2940A1F44D786CE74AC86A16296B9A2 A!8.A
967,780,159 *64ECFBE48021994A3C2F74DEF79691A349CC1E78 A8A;?
967,780,160 *64EC72F412B6AFDBA16DE0B015644EF065CBB9E7 A8/a+
967,780,161 *64E374162855CC6650A56D94EDFAEBFF16D8C8B1 A8Ad#
967,780,162 *64E3FF5527FF0E9C261FD898AC07C570537391BF A8AgT
967,780,163 *64EA6B77DDD267BEF3DEDF0BA637816E0F7CAA7E a8an
967,780,164 *64E58540FA1B4972FCB26FFFB2F2A31273820592 A8A)r
967,780,165 *64EE770D812956F391BCA187243AD52350AB3747 A8at1n9
967,780,166 *64E0065D96FF16E5832624CEF3D22584F2A175CF A8Auf
967,780,167 *64EB5962650BA80E8D1349532301C915A2203333 A.(8b
967,780,168 *64E4F773A03CB389F57B579AC52DACF7A520AE41 A+8,b
967,780,169 *64E67A43D53A90241714939096CA1F020EF049D0 A8b6H
967,780,170 *64E20448EAD6D528CDCEB4A327FBAABEBD731005 A8BFd
967,780,171 *64EBFA6BCD58BE40B2824277E021D2F1D08C5190 A8BgI
967,780,172 *64EF0566BE5B7A4472A826270EB3FACA68F7B020 A8BKo
967,780,173 *64ECC34C7ADD8C38448ACF417F5BD2EFBCC57C91 A:8bS
967,780,174 *64EE5DCFE6B37D0296DDC98E16DB360621564B2D A8_C/
967,780,175 *64E902180F2BF1DD53D15014ABF5576F880CEDAE A8,:C
967,780,176 *64EC09FEBA7863E8E3B381D1AD08E4F3C389E058 A8cC&
967,780,177 *64E137658D3AE1777F30E8EC7298FE50CA0BF1F4 A8$ce$$!n9
967,780,178 *64EC20D80B7B525433DE0F6892CD822A3287EABE A8CQU
967,780,179 *64E4BF92D7D1195692BED3E911CEABEA45DD1EAA A8c!S
967,780,180 *64E0DB56577AD5E10EB0FCB34645AB55B8FE0C38 A8CU%
967,780,181 *64E23F4CC5B1C243B1425D05D78FB6F6C5955261 A8c(w
967,780,182 *64E7C9EC951E215CB433D415BDF659E93BD5E6D8 A8?D&
967,780,183 *64EE2A22992B2BFD333AFB560FA757B37992902A A8dpv
967,780,184 *64E19986AE5B0A0B2CC39BBC32CFBF65850BB8D1 A8::E
967,780,185 *64E56E8438ECD862AA0563E06AA2B170714ED845 A8e_&
967,780,186 *64EDCADA2565B9A658687C77E2C64C27933BE9A7 a8e/
967,780,187 *64EEA9498DCD2EC6D7EBE0CFEB3656C7B0A61DA9 A8e!s
967,780,188 *64EA24206FC1570D5888C2BEBDDBEFAEC81C7762 A8EV;
967,780,189 *64EDB24D05EC49D2A4A21C3AC5ABA6B2B1F5E5F9 A8EX=
967,780,190 *64E6777DEE8D4AA159463774CFDD364952EB1F5D A+.8f
967,780,191 *64EEAFF1F1D8BE0F35903A2ED34E830380FECB0A A8.f)
967,780,192 *64E2AA31A03098AAC7B4E3F84D13AB8E2DAB8CEE A8FA(
967,780,193 *64E9635B5FABF822C83999F280DC199BFB44AE96 A8Ffe
967,780,194 *64E3BFDC043A915813307C132AD7B614B4FF9503 A8fH8
967,780,195 *64E026483EAA23C252AD89FE4BACACD8D5865E2A a8fuckyou69
967,780,196 *64EA6D3B69140BDF0CE2792D0B6CBB523BC47959 A8)G=
967,780,197 *64EDB9A5CBD58C8F0A4BE2635A5A3082037E2E8B A8G2j
967,780,198 *64E4FE9951FDEBA39CC7635CFE824E45C2D64AB7 A8g#m
967,780,199 *64E8EF00C75B9CA700D4356B06A2963CA86E8A36 A8Gt7
967,780,200 *64E35A4C1362622D35CA07615CDC0BC60EF7231A A:8h,
967,780,201 *64E8CDA21358650FF45A7BC0693EA2C28FB54985 A!8%h
967,780,202 *64E9AE9015C807624B0157C03F6B4EE7F8FB8697 A&8h;
967,780,203 *64EAC7D564B285A9D86ABC1F72A6526EC854E42A A8?(h
967,780,204 *64EC9BC0DA3824211E92732EF0067929696B9C9B A8Hdu
967,780,205 *64ED09EC5C22FF162992D424146B527E8096FAA5 A8h
967,780,206 *64E51C3885585C17F0E8E3D3C9DB0C362DBECD3C A+8hq
967,780,207 *64EB03E843E67D76602DA8513B3E4DAD20F198C5 A,8hY
967,780,208 *64E86E62DB74BA9BCE160959082DB4CA5FCC11DB A8.i"
967,780,209 *64E35461E80F66CA3E80DD943BFC2BC98F4066DD A8iiF
967,780,210 *64E7ED40BCF37310D1D48ABC463FD6E8B7E8250F A8IOm
967,780,211 *64ED2DA3B520A105DC5B7D71869CFCDBEA4DD915 A8I
967,780,212 *64E2C0B51D6452B40D8E6CA78AE764CE1B11E778 A8;it
967,780,213 *64E4A904A90FB8CABC53682DB2F03F54F6FE8A2C A8i?v
967,780,214 *64E17E9CB88C98A561E9DEEBEDE5C8069A635238 A8ivE
967,780,215 *64E9F63A0D3AC215B059F90D3E21F04F3A3D1FC3 A8j
967,780,216 *64EBD45B9C7C371895A097493D44CB6D3696259A A8jcL
967,780,217 *64E0596120D72937590E049BFF61295DC0CB3DC5 a8ject0n
967,780,218 *64EA880AD578FD917AE313C54C1272DD7FD1187A A8!jf
967,780,219 *64E7B437F3D2E62825EF84863280F1C7F0A83368 [email protected]
967,780,220 *64EAFFE7EC43A8E4EB08C210C08076EE0532E41D A*8k
967,780,221 *64E3A0747ED5281578A2202A20DCF950F7E91BB2 A8K+9
967,780,222 *64E25F2F9E450F3A6E5284417E9FEA74FEF68365 A)8:L
967,780,223 *64EE81C587163DF8AAE27C7939A63897AD2C7890 A8L3N3$$
967,780,224 *64E64840695ECC8F2FCFC267EDF534C7A0EC745F A8lbg
967,780,225 *64E0ACE485726BA684D321138A3D27B63BFB08D8 A8l=D
967,780,226 *64E18E24A0D03AA7ACB3FEC1451E02F3EBBFD1CA A8lGa
967,780,227 *64E3698C014DFB2CDCEEA9B122A7154C6D99E7D9 A8LHY
967,780,228 *64E26FB8F28F2001A1F6123700FE95C612D1790E A8lLV
967,780,229 *64EF8B3FAC00A36B2BA430F121C47A52C93D6C52 A8Lp$
967,780,230 *64EAE7AD8B9B4F6B3E4515A477FDDE9F6ACE906C A8lq5
967,780,231 *64E2466204CD4F3A9171D29C8558060E921632E8 A_8M#
967,780,232 *64E1DF2701581BC9BA21BACBBE1409BD1DE60732 A8m:$
967,780,233 *64E0698F6DE4CB2D8F4E5D2F81CB646AE1C2EC71 a8M1
967,780,234 *64E1287D3713187F551CC1B357B9C0795D97E7A0 A8=Md
967,780,235 *64EC764455CD7EE211854A4EBF05E94C170B7723 A8Mf_
967,780,236 *64E823F17F878ADEB9022248A5966E0A935DC7E0 A8-mn
967,780,237 *64E0CFBD6DA9E95BF1002CBFF048053DF3EC3D01 A8&MP
967,780,238 *64EE18B2CD5E02D62A8A0491AC5B539F914A44FC A8M+q
967,780,239 *64ED3884022EF775D32A79E05B4CB2838649DAC1 A,8n3
967,780,240 *64E55C268067833DEE4AF4CA6B758B979DC5F5FE A8N=K
967,780,241 *64E02145F78201768B81B3D6DF13DB4C68E096F4 A8N.O
967,780,242 *64E2E4B0DBCCCB7EDB36AAA9C27E1D6E5EB4D2A1 A8
967,780,243 *64EEBD593DE6A7BFD9779DC5A0BD1EDA648BC202 A8nsq
967,780,244 *64E2BCBFC6E5A92BBA00FD9B1D6534F47389FF3E A8N/T
967,780,245 *64EE15D7D8D229757443812DFC068BAE044D80EE A8&nu
967,780,246 *64E3655CCC1C7D3B7B7B2B89188E75120A39D90E A.8o:
967,780,247 *64EEEAFED2DFA726BA2CD5899C687F6611B51A68 A8O_9
967,780,248 *64E815C53448C93432060B38FEEF10E72807A214 A8oO_
967,780,249 *64E15570658C2183D8FB1F3F403128B6444832D3 A8OR+!VENE55
967,780,250 *64E9DA1A9BA4807D949F687128E459AD5856776B A8+OW
967,780,251 *64EE31040D9B118F13015050E8FAF097AF20C09C A8PBs
967,780,252 *64E9E98AB82FA14138BEB278FE8417E5033B537B A8PFk
967,780,253 *64E2DA66469B2DF15FE370F1ECEE00DD45F3C548 A-8PP
967,780,254 *64E88EC27E25F8DA63FD2CBC86268BFEE68FF551 A8PtU
967,780,255 *64E545A6A33F731E461EA5F00F096889CB2FEF35 A8PU6
967,780,256 *64E37933A9402BE7D8204ABAC979871B63C8CE18 A-8=q
967,780,257 *64E5878845AB2A869D9F20D3419768C7235BC8AA A8q0%
967,780,258 *64E61603336D3F4A5BF5BBEF1D611F930E6016FD A8qd
967,780,259 *64ED75BC35FC561398D125B856A19D1AB9EE6C36 A8qGQ
967,780,260 *64E7781F2F017BD13026ABD615503EF5FAE2C88A A8-ql
967,780,261 *64E419E1E5B8078764C0ACBB8EFEBC633AF42E86 A8q:n
967,780,262 *64EEC8A16CC493B81C5A398B215E5BD351A5399E A!8+R
967,780,263 *64EAE1D9D825EEA098AD1D6983D86299DF96AAF3 A8R&"
967,780,264 *64E542B29CB6E009DF66B224F8D86FFA00A6A060 A/-8r
967,780,265 *64E13F2845221F592B76947BD6F395DD1F7E4EAF A8r-C
967,780,266 *64EABAF4C73802FEE6BACB5C34E86E09F45782EF A8renert
967,780,267 *64EE29C928D11B6AD2D62A5039A0C0D27E748F97 A8
967,780,268 *64EDB86C4167909A441D11E43BA317C29A50CDCA A8ROl
967,780,269 *64EC1D568ADD2985A4155E2974E320FC06D7D796 A(8rs
967,780,270 *64ECF69FA1FF692B846FD21D02E8D1A128FB20D5 A$8rs
967,780,271 *64E9A11649230C8F36E9C1BB0C6884EA5585CB82 A8%S$
967,780,272 *64E55CD52F9913147C9E92524AAF0BDB547E94CD A+8s-
967,780,273 *64E3672B2360B13ED383B9C9A6EA09C8CB8EF454 A=8s8
967,780,274 *64E471E32DC5A3907C060DBB78F70C71F41F2663 A)8sB
967,780,275 *64E14104F86287C21B02B41898A087267B11BDA3 A8so1uter
967,780,276 *64EB0C609BA854BCB851CC3F298799A73824DEC6 A+8T,
967,780,277 *64EBEE1B42B709D8A85CDDC5705CF3C0E95DA3EF A-8,t
967,780,278 *64E3C1DC2618A89CA692029A248A10790F139F8A A8T3B
967,780,279 *64EEEFFE9D4AC080A5458DE74B2A1D51A92FFFC4 A8t9
967,780,280 *64E0C47D9CD100C4F3366F5E1FF48076C2775B11 a8tg
967,780,281 *64E0C785DDA7B3BEFFD90891E3798D66095BB186 A8tres
967,780,282 *64E2D20CF5809D20D1C129A4CF030E980C08CFB2 A8tVd
967,780,283 *64ECF2B35BDC16EE4A3E09376CE337FDE77AF408 A8`u
967,780,284 *64EC927B2B93F165E358648E06E11AEE2DBE3D77 A8u!?
967,780,285 *64E70AD8ED72174F4818A77CE32070015E7ED9C6 A8u1"
967,780,286 *64EA20360252C9869FEEFA84DBE84632F0C4ECD2 A8U7I
967,780,287 *64E3C4DBB7CFB5F0EB7F24B75246F0F532455EF8 A8)
967,780,288 *64EBFD6804619BDAF8CCB0D4C4714746406C0352 A$8v7
967,780,289 *64EEA0E7F4B46E7E5ED9A0BE6ECDE8D516E53170 A8,Vd
967,780,290 *64E9ED14493022B24778DD1D83B04C60A706AD45 A"8W"
967,780,291 *64E8A0477B54DA3F92FEF27E0BE5673DFD75EDAE A8w!8
967,780,292 *64E836332C00C6B936E43D3F7A6172CB07FE56F1 A8WLs
967,780,293 *64ED6C4F5C9F6F7C75007A3CE64A26BA34E4FF9E A8+wp
967,780,294 *64EA32EB1B5C0D390E41E4771A2269174D3EC467 A8wT1
967,780,295 *64E5898C8C5CF38752CDA5BA50C73A99B064EE1B A8WWG
967,780,296 *64ED8F1A4D94AD74A9C11C634E3173E2C939E018 A"8X-
967,780,297 *64ED80F5AB65230BEE9497A01B1E8F95604BA1CD A8XN3
967,780,298 *64E182015BE40BC663BFC6CD9F7BDCE043A6DEBE A8)Y
967,780,299 *64E784F2A772EC5E65FDF896A2CC9B26DB78548E A8Y`
967,780,300 *64E854AD57294D0EC4069B3CA3B9A001936B4B15 A8Y#3
967,780,301 *64E0B7BE7D928739D33EC9D1CD779E4515D31BED a8ysso8en+honic
967,780,302 *64E355BF4958205673AC07057280D211E7F11AED A!8YT
967,780,303 *64EA804F475C918EABDAB48E5D125ED0DA632565 A&8Z$
967,780,304 *64E84442F61F6E7335B3E31EFAAAFBFA94AEF95E A8Z5v
967,780,305 *64E38C58755B59B436D12963FD6CF76AF5A4E9EF A(8ZR
967,780,306 *64EA628AC149B80023719B180DB34C0F4317583B A8Zr3
967,780,307 *64EFEA047E96A6C176AAF37955D6A0F6D0026851 A8Zrc
967,780,308 *64E3081F3AB20BB74095F57EE8AF44C0D6797030 A,9(?
967,780,309 *64EFA99FF505FAF16D228D051D4EA6FE853B18B8 A"-(9
967,780,310 *64EF00F0426ED0302D4DE9FD758D30B0A73E0BB0 A%?9=
967,780,311 *64EE0C380420D9E69EC4AE5A2E5E45F727F542BF A+9!&
967,780,312 *64E6ACE290A00C930260B5DA975D87FE7F919F40 A9_-!
967,780,313 *64EA20CA52221D4B85DC85C22705EEEB4CB11A22 A9:=!
967,780,314 *64EBDE4A0D5E4C2484C46D936D55A3C006BA9EDE A9/-(
967,780,315 *64E6F5163F6E63CD41EDA6A9B546FC1A86BF4FD2 A9(
967,780,316 *64E16B888559132AB3741C1D57DECD711574F74C A9%:
967,780,317 *64E5F75BB1ECAD40E2AB40C5F2BE6F6990551D00 A9/)0
967,780,318 *64E5D37291CCEF864D3D1989E0700B4E79F1D84D A90$"
967,780,319 *64E16939B6E70DB1BAED7C15B3B014178AB216CD A9005
967,780,320 *64EB51CF3543B5E3E50DEEA3FA935BEFDFC52F52 A9"09
967,780,321 *64E7D5BB462DD93F59FD88057B1FFD5F84A338B4 [email protected]
967,780,322 *64E5CF79A331EE2A4BAE1BA6EC21B10FDB6AE555 A91uf
967,780,323 *64E64411A461A6B69C12A7776F5CEAC695BE6B29 A&9#2
967,780,324 *64EFB8835D7ACC1831CDBCD644C6871D21813169 A9+2=
967,780,325 *64E8BFCB2CEBB063B82AD4A6953A5AA801CB36E7 a92304
967,780,326 *64E3B062DA36D721BFAC451E35B3CA030B75B078 A92c2
967,780,327 *64ECF46E3EDD89560AFEB492B3EE2E585C3AB195 A93)I
967,780,328 *64E0FA41A2670768FDF56C3194D6F8C154AF2CD0 A93(v
967,780,329 *64EC4C73D14197E3CB45AE4E0DCA7E7399F77DC3 A,9!4
967,780,330 *64EB0CC527903924C8AB134FD7C83EBD7BB8FC9F A9457
967,780,331 *64E6557675A6A7E21F385751FF5D53E7D4B6161E A9
967,780,332 *64E9439709B5B0F8749F0F60CEA273F2067E16CB A#9/5
967,780,333 *64E10AB9E60A068441ABA73788DCF92A5C054C98 A9/5$
967,780,334 *64EE013232605CB9855CD37AA803280947ECA30C A?95W
967,780,335 *64EFEBE83DCF0380F981CA300D9686CF79973936 A97",
967,780,336 *64EBABDB4D57B434CB7AEC1E8D8C5F0B885419E6 [email protected]
967,780,337 *64EFBB464D02E4BD9F4A72A28BE8BF1A9D164545 A97,B
967,780,338 *64EF392219D04F80DD5803669F801EBF5B93CE6C A9%7d
967,780,339 *64EDB0341D8AA2B51859C53A0419485FC65DD76E A97Dv
967,780,340 *64EB174905220D1F792EDFBB2AB46319FC0E6E3B A97XV
967,780,341 *64EA6FB28CE5602FBD7B448DC7A7E9932CC1D442 A97Z
967,780,342 *64ECE5791C39FD930D5AA42D12DD720192C37985 A98#!
967,780,343 *64EA548B8FB5064A1D44B893BB68A56317F5165A a9836
967,780,344 *64EDCFF26E5B22ED5FCC6459705F210D311F9D06 A98$5
967,780,345 *64E14E552ABF9CBD783EB33BC1E330F67AFE71A0 a98991
967,780,346 *64ECE29498753EC90D4A3188C4924C074B516282 A!9
967,780,347 *64ECF9D0613C5E6BD8D2A1277F8A5E1F700E45DF A))99
967,780,348 *64E6991352BF694D7C443C74D287526598480419 A99K(
967,780,349 *64ECE464CA3DA1081343575B7CB19C00F36105A3 A99KU
967,780,350 *64EB66DB21FAD453471578EE6768434F74608004 A99re9a+in9
967,780,351 *64EEC0628862F7B2261B5D1708C1B99A8C45F0F7 A99ZA
967,780,352 *64E02CE4C2758F19817BE61EB1CF02A632AD017C A9,a&
967,780,353 *64EAB69229BCE5B92F20CB2F805123706E4E336D A9=a7
967,780,354 *64E7137E9F52DC459BBCF38714BAB32AB6AD1E81 A9AdK
967,780,355 *64E29DBAD42D606DAE2E9FB9DB44D7207AAF6064 A9aM,
967,780,356 *64E8EDE6AE56F07F778D9D82B68812EEA5E18A11 A9AO?
967,780,357 *64E2240BF7BC36569D3B1E4862DDDD8570D4D198 A9Av?
967,780,358 *64EF68E20F773CCD315AE8C68501824C7A363DCE A9b&O
967,780,359 *64E4499F58A41966C975BC2C053061AA3A55118E A9/&c
967,780,360 *64E74C6C7DA9B8389DEC3AB831606EAFC9A5FB8A A9CYW
967,780,361 *64EE2E2FABF53F87EBB08A869A8D368759700019 A9D09
967,780,362 *64E445B14C1D58FE4D746C49D23ED7117FB38F77 a9decasavella
967,780,363 *64E3259355CFC6382F40F9FC51B7523328F90995 A
967,780,364 *64ECF1456906E3D27658550975ECD6855E8EB8A7 A9:Dk
967,780,365 *64E2E2994FFF75E2B3FE043D141067BAF8625C8A A#.9E
967,780,366 *64EE46A30118B210E6B97246DF42F018EEF37187 A9EUM
967,780,367 *64EFC45230EF2CA209C10E7FDC167C22C18B2E36 A9eVS
967,780,368 *64EDEECBFF71E19C1AB3CEC1C0C4573DF820ADBF A9F7"
967,780,369 *64E72ED331A8BDDAC85E7E83912D957935457F46 A9fQo
967,780,370 *64EC76F997F1FBBA5E768394C0348AC7350D608B A,9fr
967,780,371 *64EB26B8F4262FBCA3A2262DA51389322ED04A89 A9Fs(
967,780,372 *64EA479752EF7F18C8AEDD8672E424C18B3BD1B4 A9-G,
967,780,373 *64E1860B52DA85AE4071DEA24E67A897C68433A4 A9Gd+
967,780,374 *64E94F16424941654D53EC280DCC33922971469F A9ghH
967,780,375 *64EE475A6D40C096E84B0197F2F79667563D24F8 A9g%N
967,780,376 *64E44550820C5D61B42ECD84827495EA8B4AB284 A9gOo
967,780,377 *64E6AF235775A75513C8211DE98FA4EFE200F737 A9GQg
967,780,378 *64EC3A3DECF1C64957970A338606C4CD0EE96CAC A9Gv0
967,780,379 *64E54CF99B649F842AC41DF892369B748411E579 A9GX1
967,780,380 *64EA8F9F9379E123B1709259BA431B238DC234AE A,9+h
967,780,381 *64E72905AD29D13DCEAB487955F0658ED2014005 a$9h
967,780,382 *64EB2920A61D03287049A6DBB5FBCC257021D9C1 A9H2w
967,780,383 *64E3FCC5CF2F38C554664CCB141C778DDA7C6301 A9Hje
967,780,384 *64EF90134BC6E4D81A66C020F6C047EB87C2E7A8 A9?-j
967,780,385 *64E5EA9899EA5F33E2DC2791A5ECD50B4DE11315 A9jEb
967,780,386 *64E4468CF1E6585065A92BBD85B86878B8F5FD89 A9jH=
967,780,387 *64E595121AB10D5D4855C2CF63539B248B02A044 A9k
967,780,388 *64EBE12D545803934E9AE337A31D3B9504B46056 A9k2(
967,780,389 *64ED660FFA9B8B90C54673A7B4F42F3B7B47EC69 A9KaZ
967,780,390 *64E0B1211A3ECDD2FC0F9736C11B9E51C25028B7 A9kg;
967,780,391 *64EE243C4B94363959D95CF4B8BD2500369B2BB6 A.9kW
967,780,392 *64EAB16B94711F3656E77DD191950463969BC3D9 A&_9l
967,780,393 *64EAB072D3D7C0FF7677C9D22A36CF1E46739D04 a9l'
967,780,394 *64E130F4712A7FA806494321968986457A1BC6B8 A9l3a
967,780,395 *64E8371A362DC4469E7EB667F0517A1DAFF7F935 [email protected]
967,780,396 *64E35704D6165296D51EB6B6FCB38CB71C9B1B7E A9l&T
967,780,397 *64EECC27F2B79CE9E263D7E3F32496CFFB10A458 A9lu#
967,780,398 *64E642F045C5BD10D9F32DC0098922BB95E3A913 A(/9m
967,780,399 *64ECE9EF417A8E4FBEA83D12DA4E2AF124FFDFD8 A9M8$
967,780,400 *64E68B6F5346555BD2CCC52B9FC55399073068F8 A9&md
967,780,401 *64EE54344E87D45BF29ED941B868E85E47321FD4 A9)mG
967,780,402 *64EA1030A9200C4DD5DD2A3A862BEA45CF3203D2 A9mH/
967,780,403 *64E6E9CB95E64C006CCC0D005955D602447DB916 A9M/K
967,780,404 *64EF1636B5A24AB3D60E269BDF88BB4E44E7679A A)9mk
967,780,405 *64EC47BD4601433FBD2A656FC94A6833644E5E8D A9mMW
967,780,406 *64E628692738AA5A019408DA661693FE2AB462E3 A9mt+
967,780,407 *64E1C68FC593B2F6F43AB1F13771BB54D6E434E9 A&9n#
967,780,408 *64E1BFED815844EFDCA352F743DE6318D160B2D2 A9?n8
967,780,409 *64EAC48D08555085265A2CED73BE6E12BD98A8B8 A9njl
967,780,410 *64E6D5100319A6B3BB14C6A43594EFAA6A1668E2 A9NN6A1234
967,780,411 *64EF0354DC95E4FB5FBCD1BE043AC5AF7BEAD33B A9O$F
967,780,412 *64E6BA79BD4B5A0CBDCF3D27F213667D2D22C418 A9O)l
967,780,413 *64E483FE0357024E26BEAD81B1B20AB9321F8C5E a9on11c
967,780,414 *64EE123F38D8890DB0013486588F468D6D4262DC A9O;O
967,780,415 *64E9DD04888748D9659BCC539EFFE84F66B81997 A9OOh
967,780,416 *64E53586650DFC50C57C41776A255810F550197E A9OsN
967,780,417 *64E2A93909CEBF7F03FC77E43B113E0CD86EE6C9 A9oVA
967,780,418 *64E0554DE4ABDA8B323B5E2E46C80FEEF4B53FC7 A9pm,
967,780,419 *64EC2711540E943E7A26F31D5B119F5243E3EBD3 A"9pn
967,780,420 *64E6DDBD5FF85AEF26EDD7A22C48514D47C836BE A+9pQ
967,780,421 *64E38BB183B113B2D5D93967A5A88DD01E2EDC1B A9P&s
967,780,422 *64EBB18EAD16AE80C2872314B5585A62238B34FE A=9pV
967,780,423 *64E29EFE67295FF51A922CECF9DF29A0CE5DBCA3 A9q
967,780,424 *64E43AB24E75F5D7E28B9AD030EDA43CED58B3BF A/9#q
967,780,425 *64EF69F3A939D9F4DBF9E23E0FF4CACE6F594565 A(9q+
967,780,426 *64E69277DF65BD6D6F25EDD6B2CB4C6DA1211A4D A9Q9U
967,780,427 *64E49D038C2B5850B1F5FB00039BD308EF4F9648 A9Q)c
967,780,428 *64EFAB7059C67AFC100A84D2C3E53AC39DDA4744 A9qwb
967,780,429 *64E688521AA6A82381A97B0866E01A4DA1B20354 A9R$,
967,780,430 *64EC5F66AD87D64F322F1C1DAE15492E8630A147 A9rte
967,780,431 *64E8A995A46F8FE25489240DB411D5F711D1EFF9 A9RZ$
967,780,432 *64E6D663E5C34C8D53EE71B785484AB62ABDFEEA A9s,?
967,780,433 *64E00942DE3DA3F10174CC711F02AC63C08313A9 A9%Sa
967,780,434 *64E5B9E367DF1BB99BD9CDEF52C807D6589ECD6F A9"Sl
967,780,435 *64E70645064466984CF12820CA34F08BE69CA5F5 A.9sO
967,780,436 *64EA991B949AB1E56C6C0A631373F8B91261F787 A9sR
967,780,437 *64E11E25CBD9801645B82B2C62B0FD9AF7775613 A_=9T
967,780,438 *64EBA69BCCB3EB0A61172EE260BD766F8E1D4549 A9,T?
967,780,439 *64E399AAF2A4FAA9E0B7328FE9FB47B0FF9EF719 a9)T
967,780,440 *64EF7B55F73970572C53BD2CDAD2F1B646224D9A a9T'
967,780,441 *64E7492BFED841497BC7E74C7DD529F2C9BAACFE A9tG5
967,780,442 *64E392C0CB06136BD4E2FDD6531999F47DCCCA13 A9tj:
967,780,443 *64E17E0E301257CF9A0FC53FC19C0B5CB4490E0C A9TN)
967,780,444 *64EB51A178BECAA87A2E2BF127FA223F6BD4EBBB A9T#R
967,780,445 *64E521DEA973428A59D691CC98A1FC43F70EFD01 A9tS9
967,780,446 *64EBFB10C4B46D851611320E827D41BDCD480B50 A9#_U
967,780,447 *64EA3BC823FFEB9861E80A0F105CC3710C1A3791 A9?"u
967,780,448 *64ED54451269611CBAA18C7C7172AE5E3F294D12 A9u
967,780,449 *64EF4BB4A03CEAA9912A34F5D49B95D8DD1A330C A
967,780,450 *64E562AC766756B8652B46F8BCE9898222B98FBB A(9uK
967,780,451 *64E6C0CB457034833C17364BB4CF673B1C18E158 A9uZG
967,780,452 *64EBE94177EBAD6C42E60679076A830D50C3D482 A%9vq
967,780,453 *64EDAED930256EE091A837F3F4940E5625649391 A9+.W
967,780,454 *64EBF70D1DB9DC4C30E0721731E1D0C745698588 A^9w
967,780,455 *64EB64EB1C9586DF8DEBDEF8EDB2421282B7C897 A9W4U
967,780,456 *64E529D4C93B4637B4AF5F8B2BA75CF3C04FFED2 A9W8d
967,780,457 *64E351FA53233369B4DF614A9A8584405A81CD0F A,9WE
967,780,458 *64ECE0B33E32E1FA811A0EEBEC501A81115F4B36 A9W-E
967,780,459 *64E8B0BDBBBACD2EFFC5524C5FD2323F6B041428 A9W
967,780,460 *64EFA9A98CCE823509D7D24DA74ADB427E9C13FD A9WmO
967,780,461 *64E773D3A04371D79BC712A94BC555908E322E1E A+,9X
967,780,462 *64E287271D438D1AF93AEDB63C0782A8F9DA6B0E A
967,780,463 *64E50F5C275E45DA5A6E1AEC23DBAC890BD7A7E4 A9X38
967,780,464 *64E9AD6BB83D15551475CACEBAB627493AFE0EE0 A9XDo
967,780,465 *64E9060013528A0BC2922909F49DE8D5C7512AEC A9?Y.
967,780,466 *64E7E82CB9D1423FB62BAE217744C210EA9C63CF A9yD
967,780,467 *64E0B7A82F2698FC57947C548F16061E94E57D12 a9yf
967,780,468 *64E9201CE395211EB9B7214A17A17F9DA68F2910 A9YP1
967,780,469 *64E9FC8B3F6D420CAD39A87B02C6F987A441E65D A9Y(V
967,780,470 *64EBAB70BED4DBC46C739C95E301969770C9AAE1 A9Z;)
967,780,471 *64E7B13CFE837AC955D68D1645A2A82660B2353B A9Z8765IB
967,780,472 *64EA6A1555DE8DA617CFBF44E24EFC6C6416211A A$9ZD
967,780,473 *64E571B09B043E1BFDDA82F54E4BF0E0516A2AFF A9ZG7
967,780,474 *64E6A42B3DE617B0F95F407CCB640F648BD52C10 A!-A!
967,780,475 *64E1CDF5E98D0F0029F3433E03D4EC2DFAD7C1AD A?;A"
967,780,476 *64E09AD4E3A000C3E74F741C8C8F6F23EA051992 A..A
967,780,477 *64E788FF47E01B417D13BDF5AD9141DBECA7D69A A&"A%
967,780,478 *64EB68FC317E666E9784D27641A63B1E94AF66A7 A#A)
967,780,479 *64E049A419B3C55895A70D9D39BFB0231B3E76AD AA;!<
967,780,480 *64EC6CDBA258E5665952594E0BD26015A63282E1 AA;
967,780,481 *64EC93F493284029E5E2BCB2E80E0FA21DA85084 AA!!'
967,780,482 *64EC5E8C3E1782C495FB4AD7F0E15D6A40A77C13 AA.&[
967,780,483 *64E062823A581C775C6FC2C41DFA1F75A951ACA1 AA'}`
967,780,484 *64EE623550FCB2B8F007B9686AF99B7A779DAF49 AA(_!
967,780,485 *64E4CDFF3FAA9BA272D729021833A18B3805E50E AA*[email protected]
967,780,486 *64E7CA36EC37AFA855C6A15F1CD111FE99BF4D1F AA*":
967,780,487 *64E72F6DC62B0AE31217C71BE525DF692F6D6597 A=a%!
967,780,488 *64E1952DB3274F2D68E1E04A412901B97F936732 A_a&=
967,780,489 *64E77F844F772253982EFF32F66967FED26245EB A_a+"
967,780,490 *64ED7C44CDDE1EBF527A66B55C8346E57D98F56B A-a:)
967,780,491 *64E3DF011B0B4898B3FB6A369AE333CDC080DD96 A;=a(
967,780,492 *64E82E475C544D37946E275FB4357C7F495C3039 A!;,a
967,780,493 *64E59B24D005C618C5B154DC890047A543B3F9B2 Aa,(-
967,780,494 *64EB53FE1BEB8B5102A85022C829CD85BF06E1DA Aa;`{
967,780,495 *64E455C65D7815F0EF5CBBA6315F995A7EEB1527 Aa'>@
967,780,496 *64E016D8DECD5CED9F265E06F9B5521D966ECD28 Aa{{
967,780,497 *64E2EA8A6A39672BE7E6153380E662A6DB5754A3 <^)aa
967,780,498 *64EFB2F070E24767467F20E95709ADF31CAAFAA4 '>.aa
967,780,499 *64E27623672319FDE13D36C97A9C489394F464CF ].<aa
967,780,500 *64E7F03A7D10A705E6FCE07DFA63EEF7AB47B9ED aa`}/
967,780,501 *64E8FCA3C47D379BDFAAF0317446991287755CD9 aa<>!
967,780,502 *64EBCB8AFAFA7B2DF83455637A8B0E857014DD41 aa,%[
967,780,503 *64E4A6E4B4295D49B5523D143D1B2A3742801986 aa(@^
967,780,504 *64E184F965C9CF0948127381AB396C8E12826733 aa[>&
967,780,505 *64ED6E84097B1D11C7A83174979DBCB845CD4B7D aa{=+
967,780,506 *64EB303ECDDEE99521F16692503D0AF0BEC3556F aa}=#
967,780,507 *64E0667FE95E02AEEEB6208C06129108B69CC2B9 aa*!*
967,780,508 *64E78FDCEEBC314B40269AB29F9EB47EE575BE62 aa&{/
967,780,509 *64E87CF31484AB194B5883EC008D3F284B10F24A aa+,,
967,780,510 *64EBC605A39D142E433F1CAF0CD48EBAFBCB8D76 aa+!^
967,780,511 *64EE564F8E014FB877B297F64583086A214A94C7 á à
967,780,512 *64EC18BF0BF62BE84C2F79FA48690793069AB637 ĂĂ
967,780,513 *64E075D11E9D90BB73467672A969821FD886FEB6 Aa0a#
967,780,514 *64E8B4DB8E61AD29FB71232E7D9B5C930A0E32C7 aa0'g
967,780,515 *64E2EB576DB261268AE39D85114588C3987D042C aa0Nt
967,780,516 *64E61B386BA795FFCE90A047EB1ADEE87E884989 AA0S-
967,780,517 *64E46407DB0BDB3A2D77074DB64424165F7947A7 A-/A1
967,780,518 *64EE9E58858515275B3A4663E710482BF4210120 AA"1+
967,780,519 *64ED018FB97CDAAC17B31BEC42F1FB132192518C Aa1&3
967,780,520 *64E1FCC60B0DE766861E0627ADE69F58EF317014 aa1d~
967,780,521 *64E888971DCAF0863AF97DC0704A2961EE5E1DB6 AA1gI
967,780,522 *64E33EED4BBC617B775F079632ACB8E81DD692B4 aa1mC
967,780,523 *64ED46AFC4864AC1504EF2B6A5F09958FCFD26DB AA1Qg
967,780,524 *64E84D53E87F69C4D130A64FC7CECDD60A8016CD aa1vl
967,780,525 *64E0DA4DC0955E64DB8EBAA8B829C56B7D1AB8B7 AA1W?
967,780,526 *64E5DF7957DFD3518BE67B838C90E9591CEA0994 AA1X)
967,780,527 *64EBEABFBA5E56936C068BAA9C3C40AB51C76BB7 AA2<$
967,780,528 *64EBCD0F67FD5535D37BDE662B9FE0D2EF402A50 Aa#"2
967,780,529 *64EBF5A188DA1E16CD83309E401D555458AA4B96 [email protected]
967,780,530 *64E8898583770C6271FE82EEAFDECEDF1DA3BB15 AA23q
967,780,531 *64EDCEE4417E1D2FB5DCEB665812ED70F13161C6 AA*27
967,780,532 *64EDD7C17949738AD035D70D1CE880CDE378D94A Aa28`
967,780,533 *64E15E4B4C7E6E221417B4A298BF71EFB614638F AA2f7
967,780,534 *64E3A2DDE1B0819438FF1CBB0D362F56601D6C47 aa2FG
967,780,535 *64E26855765761BF485ACED1382BCD09E15BFDD8 Aa2h0
967,780,536 *64E3A24CFD052480D11BF3695664BB83728F6686 A-a2M
967,780,537 *64E13C98B0B282B15AC73D694909A64F2D4993E2 Aa2N%
967,780,538 *64E9B263E3E5762DFB9FEC1CE58F522C8051F8BA Aa2NH
967,780,539 *64E61C08C25390126F6CE919040940ADC37155C2 AA2Oc
967,780,540 *64E36CD47B1C12649CAF559ECEE777929093F396 aa2{p
967,780,541 *64EFA6C4DAB1BCD16DC130CDDA127C635D6C7242 A&a2Y
967,780,542 *64ECEBDC1F95ACF250ADDD0B5DE853978E080BEC A#A3;
967,780,543 *64E93CD903469B260D7823521BCC13F17A91FFBD AA3(&
967,780,544 *64E0ECC4B2586083C2E9EEF1AE498DFF4AE89776 Aa.3-
967,780,545 *64E8580B73F19F3F0F726DDCA4111E1A31689E92 Aa3::
967,780,546 *64EFD86242745F29C2C1772CF2861D4569DC273B aa&3]
967,780,547 *64EB27FC5D0FCD425086AB8DCCA9EED3ACACB237 AA32
967,780,548 *64E291DB31636C24453761F8242C2A899DDE2541 Aa3~2
967,780,549 *64E40A7750D1C686676DFB21B5AD804001984A47 aa3A~
967,780,550 *64E20D669529413003555B7705DE678E44E97F05 aa3aU
967,780,551 *64E768E18A1B03E1DDAD38324C3FF58E69DA6D54 Aa3B
967,780,552 *64EFC0C276E60580DEA9A73591481D11228AB925 AA3i6
967,780,553 *64E2B84B238A13429C66EF5B46071E3E41EB5C03 AA$3k
967,780,554 *64EEA231C295DE453BFBFB6640DDC562E2E9AF76 AA!3W
967,780,555 *64ECFAB9DCD0DE1E9BADDAC5955CE1C7A03C63BF A:A=4
967,780,556 *64E3F429EDE3427BCEBA22B281BC1E50F059B7C4 AA
967,780,557 *64EF6543F6B32BE88F0CA8997FF7D6A4E4C96388 AA47n
967,780,558 *64EC185CACA8CF71A044EB8C5097A4FBE5195324 aa\4c
967,780,559 *64E8607E4D8E9FDAAA01330AC2ED7FDB61950672 Aa5]^
967,780,560 *64EBC4DD031FC7629A4618F3DC9CA96C371EBA78 [email protected]
967,780,561 *64EC7AF17FF1DCD6E504F9207E8BF9C37563741C Aa5BD
967,780,562 *64E492943A8D46C4977B2A988EA3D9496CD3DD91 aa5C,
967,780,563 *64E4BF3C03253E2FAF75D60C3D8BAC1D14F3C649 Aa5FF
967,780,564 *64E5618168CD02307F84E45E7AE9CCCFB850853F aa5ji
967,780,565 *64EF2C3E6AE64DAF504067762B9C4EEE11043B2E aa5lK
967,780,566 *64EB1B9DCE8B4FCFF532FF729BB22C9EDA11535D AA5N>
967,780,567 *64E06DE099B13B93D0E592CA92B092F053110FBC [email protected]
967,780,568 *64EFEDAC0EACD8ED5E8E5A83C83A709EEACCD205 aa5}U
967,780,569 *64E59AC643E3C2E900864335BFE98B10D0BCF2D1 AA5VX
967,780,570 *64E7C1B97DE03427F4F591E14EAF5E62E6D5A525 [email protected]
967,780,571 *64E0CD619D2357803CA919C054F04ED40BD9E466 A)a6d
967,780,572 *64EF10852CFA7EFC098FED3D3373DDC7D796ACB0 Aa6iu
967,780,573 *64E1CFBBB0DB70BBEA8606FD0D2BE29F0864E2E6 A&A6t
967,780,574 *64E79A1FDB378C8590C9BC4EC3637B9DBDF3272D aa6U0
967,780,575 *64E867EC1B82D88B4D0DB19379A6DD525ADFC57A AA6Wu
967,780,576 *64E8990F826D3C1039036D2850549A76399B94F7 A&&A7
967,780,577 *64EB577DF21C0B94964738E5100A9BF9E7AF991A A&A%7
967,780,578 *64ED8400BAA2556C709E038C35629E83375E73EB [email protected]
967,780,579 *64EB384C844DF2BE8A52E935F9BA4BEF6E92D714 aa7"B
967,780,580 *64E0A794B960762488924693E93563397018E71F AA7eW
967,780,581 *64E07EB0D659EF33A2EF237B918AA340674C24ED aa7OD
967,780,582 *64EC2C81AB061CA3F577AE02B6DB66CC2477EABB Aa!7R
967,780,583 *64E87285835DB5CFD6ED462305D959B477B115D2 Aa7!u
967,780,584 *64E7C8E8AA58C0F9AE96C031964C443867A6B18F aa\7V
967,780,585 *64EFAE00B019041F57B947A9948D00CA3682B62E A+-A8
967,780,586 *64E440FAD61DBFBDD9BFD5952C0A61EFE20FC0BD A%a8(
967,780,587 *64EE064B35B7F1453D831B758ADA926D1E885696 Aa$!8
967,780,588 *64E2ACF927A50D349E516E761547063840DDE33F Aa8],
967,780,589 *64E5A1A327BE87B2AE5862B76C749A834CA8748F aa8}~
967,780,590 *64E7AA1F96D70B39C181C1AD6C324CCEDCC8BB56 Aa89u
967,780,591 *64E4FF96DDF425881A90B756A0DA990384A2A617 aa8ds
967,780,592 *64E9F42337DF17392342CF36223B1B271756D390 AA8L7
967,780,593 *64EDA7AFD95B696C5DE0BEF0C20A22C36FC5B60C aa;8m
967,780,594 *64EBB4C37323523C56C62EDA45865C3211C10CB7 aa8N0
967,780,595 *64E8021E45F3AA4DD825A973E21A91FF8C74A6A2 Aa>9>
967,780,596 *64E28273370ACCE248F91A330F57206E6D11B246 aa,9
967,780,597 *64E00CD494EC9AF322053D501C00CFE00053C09C aa94I
967,780,598 *64E7CBC36AE84D53368C2A76558415BE088436FF Aa9+I
967,780,599 *64E91C959A522388CA2A1DFE6CF2324A1DF319AD Aa9oX
967,780,600 *64E8EC571C6C7EE3A5BB047F0F0861FA305010E2 AA9_w
967,780,601 *64E5B0681303EB9E6ABD9260BED776B7E7BCBC47 aa9_y
967,780,602 *64E1B1DA5DC512E559B7AA84B7CF150711095C7A AA9ZL
967,780,603 *64E33A71B5561DDCD70A76D4F53505798F856353 aa9zT
967,780,604 *64E5E58EBB3BDB302A413BB3DADEAF85B59EB723 [email protected]
967,780,605 *64E3BC3294C912B0CBE2C365B93C7BA0BB39A244 AAA>
967,780,606 *64E28E0D8AAC14CF516C6790CACD3795E7EEC77A AAA[]\
967,780,607 *64E89795F6926206F1221326F60C5A4E921314BB AAA{-~
967,780,608 *64E127221E174070F9A9355E0204896CE7E7A22C AAA}=;
967,780,609 *64E98A04B8FA4FB205AC8F4926C3E49268BBA225 AAA*!(
967,780,610 *64E508599010B4C193F989F0176CB5453407A224 AAA*.(
967,780,611 *64EF8F898B99636F2E49E690AC7E2FE09C6D01F0 AAA*%"
967,780,612 *64EC5551E92308CCC2E3671BC836BDE5CBB200D3 AAA*+{
967,780,613 *64E6DED5034A08C6ECEC9EFFB88A8F36F5352ACF AAA+<%
967,780,614 *64E06011B0CEFD3031EBDA8EA55308F2C8DCE8AE Aa;=A
967,780,615 *64E2F67CADA2B0508AD5BFB8A45F1C0296A24895 AaA!=
967,780,616 *64E185985A72B027D21E0310DF0E8AB4DD6FFB99 Aaa~-[
967,780,617 *64EE2C986C172DE0E0970B38FD2832BCF77B5F14 Aaa<|{
967,780,618 *64EDB408B197960AA7DAEA9A3B2CA23BB75DF1FD Aaa<
967,780,619 *64E2A36E7284673CD6CE071DA4B44B97CD36D66E Aaa;=&
967,780,620 *64EE0CA0EBE2ABDE8E2CF41374AFED86F3F09908 Aaa.^$
967,780,621 *64E3A1EE58235E1014C1283328C8225C7CB38164 Aaa..)
967,780,622 *64E6FA1A31FA629AA06DF80F46B2FB5558E14C7B Aaa)>@
967,780,623 *64ECE58DB28995C4DE2193B0398BFCFCA43F8ED4 Aaa$|>
967,780,624 *64EFC5DC3CEF5E2E5D0AC3710764A9FF4B2538FF Aaa$:,
967,780,625 *64E9391F86CFD9F4DDF86C51EB818E12527B8C3A Aaa
967,780,626 *64E02C13C5AFF09D3142743F2F428005AD1178C7 ^]#aaa
967,780,627 *64E850ACD82134D61F516E4F20A790F5828A100B >](aaa
967,780,628 *64EFAA5B85BB0886640F225963F5BE7E8F26588F !*(aaa
967,780,629 *64E7CCEC0B9FAC031C6CA3E8F14A53B1F72037F0 !#)aaa
967,780,630 *64E2AD589C21CE7D3AE2F9ADDFB6DE1047B1B3DE ?(^aaa
967,780,631 *64EB45D49A2873DC64A84625EF879496EADD21FF *>+aaa
967,780,632 *64E158234478E1C0F6173F518E8612FEE439B313 aa"+a
967,780,633 *64E1CCFE21D7AB1A34A00C5A0650A26C27FCD929 aaa<(:
967,780,634 *64E3CC26076C31C0DF6C6D318BC74AC09F258F41 aaa=|$
967,780,635 *64E3CA96D90E1D195D3152358E9375D6D9B205F6 aaa-"|
967,780,636 *64E35473DC4BADF9ED5397178716157B04D07910 aaa-{$
967,780,637 *64E3910C8B499944C73E5EEE5EFCAA227F36B1A0 aaa,\)
967,780,638 *64E66EE174772CED757F7AD58BD46E1C2A4745A5 aaa;]{
967,780,639 *64E89CF203F83E685243DA44B268C9C15E4EE370 aaa'.-
967,780,640 *64E4D552E8AA811D121BE6CAAF77B1378DEA6184 aaa'\|
967,780,641 *64E944970463F586953039539C2881EE22C14ADA aaa)>#
967,780,642 *64E421029A429467D3FE0AA4425A27D10FB7A68C aaa]'$
967,780,643 *64E71354BF22FBED8BBFE7C0046973FC8B4FB5E1 AAA;0$
967,780,644 *64E1CDCDBA5EBFA404451B2764AAB7BC7825A6F6 AAA'0[
967,780,645 *64E6952356E754F7089AEBD635B075F950109F45 AAA0`#
967,780,646 *64E02276CDE0F7AFBB375CE1580C413087F259DE Aaa<0;
967,780,647 *64E9D055CF47235954F925A1689766F977D8447C Aaa-~0
967,780,648 *64ED558D690F3C0C9C55B9965A662463E8ACE890 Aaa<01
967,780,649 *64E3E4A9608B6C8CCB1DEF2A93A8508A56065EFC aaa<09
967,780,650 *64EFFFF890A510CADBDA4EBA7116051038D8434A AAA0M9
967,780,651 *64E6813E09D4FB94F51369DDAC52ADA9F36596AB aaa0N6
967,780,652 *64E7D1B6F4B545DA7C1753B17511A9C271D2EF83 AAA0+Z
967,780,653 *64E08EFAB9C1957DDA9A83027158FB4737CC995D AAA]#1
967,780,654 *64E019BFC8A576E20CDAC5AE922B492FCDC38F86 Aaa1.|
967,780,655 *64E8D8D6C512455C7B90C4643626132F64CD5CFB Aaa1(@
967,780,656 *64E370BE8BCB2EF9EDD1BC1298B55D3245327039 AAA%17
967,780,657 *64EABC2920E9D5DC586C81C4BEBC8A98E3E211D9 aaa1(j
967,780,658 *64E500B3E7B6F71C4606E050547AC9E49E751CFF [email protected]
967,780,659 *64ED382A0DA915EFBCD978EB55A68FD796A15428 aaa1P]
967,780,660 *64EE2BF0ED51BA11178F17E15A49B70FA32FA924 [email protected]]
967,780,661 *64EEC7C9C3D08A0AD251B3E4C03A65EEF6C19453 AAA2"*
967,780,662 *64EEE552BF74E4DF2D1981CF2A4F78CD63E4ED4E AAa2;
967,780,663 *64E358B3305082AAD25657CF00F6B493D3480A5E Aaa2^~
967,780,664 *64E41EB47D0345D82303FBC3DA8E9AA6428124AA aaa-2\
967,780,665 *64ECDE415A55EDAEF00DD2A94C5ECBDD6640955B aaa.2:
967,780,666 *64E4832398E5B366CE7D9E774B3F7D0ADC08EA25 aaa)*2
967,780,667 *64EEEB54FCCF77032C6CE8C4742CDCF23B4D4E4A aaa)2?
967,780,668 *64EE224D12F53C54E6464BD11E8E005886788AF3 aaa
967,780,669 *64E043CCECFC872F0CD2D62B9C42329F6FF85C61 aaa2^
967,780,670 *64E26C3C90129027261D6D3FB4BED4A8D1B3C51A AAA2/2
967,780,671 *64EB0C2070929C2E550C8F8DCD443ECD2CF5C85D AAA286
967,780,672 *64EB1A5BEF9549E39E87CDBC3B2C4F387F76E689 aaa2RK
967,780,673 *64E88F778078BB7BF7AAB1E8F5E1053536C2C121 aaa2TE
967,780,674 *64E006D2422C27CD6D6CE9CE9E736427C23B00A7 aaa2x5
967,780,675 *64EBDAAEA0A3087DFC5913F188DBAF7901F2D7E2 aaa3+)
967,780,676 *64E2660C3E8BEC4B139A20B178EDD9415DDC456E Aaa35&
967,780,677 *64E4404E4FEED62B7CA180492214E6CEDDFEB4D6 Aaa36w
967,780,678 *64EC5CB928595483EDADDD2ECDB51B99C1C0880C AAA3AD
967,780,679 *64E50FD8990CE08ECEAE9F621BD0D370BB22FD67 aaa3d|
967,780,680 *64E1641DA0A64C2FAD76CB493AC370BCE3FD1EF1 Aaa3ov
967,780,681 *64EBDF75DEC54EBE22307AC5E92F86D35B44551B Aaa3x`
967,780,682 *64E1D38BA8B246C9E2CD8B5587A67F765C7ECC79 Aaa~/4
967,780,683 *64E4C2C44CD78CA6875E7BC9B1584E5F3918B94F Aaa:#4
967,780,684 *64EE708A36BB9CDB33706F7ABAF0D8A8806C8836 aaa>4)
967,780,685 *64E14E6061D15A4B87CA234224A5CC1843E32036 AAA&43
967,780,686 *64E9D3E4FF70D981093DE53273AA21447D2228CA aaa{45
967,780,687 *64E7E146EC49E8B9057D63A407ECC3F571937213 Aaa%4b
967,780,688 *64E342481149914D65F0CB88466DCB774D73E6B1 aaa4s(
967,780,689 *64EECD6CA350956DE7250B64D061598EEDECB1F2 AAA4Y)
967,780,690 *64E1619D14EA36A022F48931A5CB10F10F734BD7 Aaa=)5
967,780,691 *64ED9B2D56882F9D2804F9B057098D95FDA48E27 aaa54%
967,780,692 *64E906B254D10FE1D9F2651B786E9F2F19A200EC Aaa5cn
967,780,693 *64E7E8C216E95996D51274AEF3F1683ECF993AA1 AAA5EI
967,780,694 *64E891B80082F56B9CD8CBBF99DD196BD869B51E AAA
967,780,695 *64EC91477690B682277DEE91108705403EEFF0B8 AAA5V^
967,780,696 *64EBBA3761709D7163F4A7F853682DF8CEBACCCF AAA5VF
967,780,697 *64E546AB7CA14CFADCDD3EB3A8CA850DFAF0B9CD AAA{5X
967,780,698 *64EA18CA02099DFFC19097817DF9D4D2792DF01C AAA][email protected]
967,780,699 *64ED40261E76CE8A7F4E51F270343D3DEE6C14B7 AAA6~?
967,780,700 *64E1461743C49D1BFA1A8E611D2F189AC7508BF7 aaa!6.
967,780,701 *64E0E61FB49071FEDBA8E21D43F99415C0B454C3 AAA6/I
967,780,702 *64E82E65201AB957D9C11E25D8D5F62CC20AAA1F aaa6Ki
967,780,703 *64E977F4E94406DC8391112B7A65E51E7E8930FA AAA6S/
967,780,704 *64EF5164E339460E2D8F9FF84BAC828D770FFC0C aaa%6x
967,780,705 *64EDB49EEE497131371E01754DB8E7C6A232C5E3 AAA||7
967,780,706 *64ED91755ACBA3D6588AE2C6B9B184F6B3E63821 Aaa]7)
967,780,707 *64E4E68367F604B2D71F7A19AD5E5C3EF9F2BBEE aaa#73
967,780,708 *64E1B2F99B83F07E45B689FAA7699774E6638D92 [email protected]
967,780,709 *64EA43BD38DC1D949A0F0C5D22945E0B8FF7EDF6 aaa.7H
967,780,710 *64E18DB50EF84CE5CB8A827066CD53992D235918 aaa\7I
967,780,711 *64E16B963B02C91686C181946EA6255C507FA0F2 Aaa'"8
967,780,712 *64EDAEC623C370BD124A1D8CA186996145138910 Aaa8!4
967,780,713 *64E5AC2E04EA9B6D31DCE98CCB67BC64605D20F4 AAA88$
967,780,714 *64E65F237196BB4961A1D0C2C2F6969F95CA8501 Aaa8kn
967,780,715 *64EB70F902E2C7624697AEFFD9F86DDEE7BB1B89 AAA8KV
967,780,716 *64EF244BD7FB81F6CF5DA7DE5E79D5300E2C7EC7 AAA[8Z
967,780,717 *64EEAB009DA5B5CF58B36934C49CBB69F9C14569 Aaa8#z
967,780,718 *64ED3427B3FEAF1D3732B73854FD585DAA7EF380 aaa`9`
967,780,719 *64ED9B2D117278C8B895C4394441D00505AF5D2F aaa9^(
967,780,720 *64E5A3528391BA2CE85177D5BB9710DF19472B32 aaa9~B
967,780,721 *64EC317CFF955A6A942D42F57C13A04FF767C938 AAA9DE
967,780,722 *64ED5BDF4CA18AE92D641301ABC71E876C152067 aaa9ga
967,780,723 *64E1504E63CB2153A744B63AC64023C70A0170EF AAA9H<
967,780,724 *64E2A1D6BE4BAB13A742FD4EAAF22DF62796BC65 AAA9M$
967,780,725 *64E07309A12A43C9FB8861B6670D4E68E6C6CE29 aaa=A`
967,780,726 *64E6F616A43FB85958991CB9C4A2194CE6358239 #a+aaa
967,780,727 *64E1CE14A0F88208D266CC152D9211EDE04B2A69 aaa=/a
967,780,728 *64E5D5F8E64BC12A26F65F38C46DF81D7F38A5BC [email protected]
967,780,729 *64E4CB5F169AF5C1C48EDA3856B8D954E7B1F253 aaa{a2
967,780,730 *64ED58FD261231AF5E0050C98512C72FF746BCED aaa$A9
967,780,731 *64E7AD850F1B5E68F1B88842B4F5836079168DE0 Aaaaa+
967,780,732 *64EFBBE37E4273749EA0A5D4E1DC899EC6B7287E 新社花海
967,780,733 *64EEEEA5F6DE1EC1CC69D45015D29DB4ACEA6C5C സംസ്കൃതം
967,780,734 *64EAB2C1F3025C5094E6411AC497482F66230A53 صوتي
967,780,735 *64E1FA71A770BD37E82A0FC7672C06BFF86BED4D ã¥âŒâ—ã¨â¶âŠã©â›âªã¨â­âœ
967,780,736 *64E9A138DD8D3BEFE360DFC53C1AB3EE09C3801D Балалайка
967,780,737 *64ECE0E30E5AD226C69C2CA516B528CC091243A6 ã™â…ã›âŒã˜â±ã˜â¯ã˜â§ã™â…ã˜â§ã˜â¯
967,780,738 *64E09B92E9786AF870979BDEC0263148CDA42F7E aaaaaaaaaaaaaaaaaaaaaaaaaad
967,780,739 *64E49229A505592554D8C06B7BA0E4B08D6D7ADE AAAAAAAABCQ
967,780,740 *64ED852EBB629271D3503472C5185C19F32C3FD5 aaaaaaaadmm
967,780,741 *64E632C02BE7803CBB1D4550797950822495CB26 Aaaaaachaos7
967,780,742 *64EC2534B2DBEE43C1C44A6205FDB46ADE0DC6E5 Aaaaaadennis4
967,780,743 *64EC8B9BE39B8A0F09F128B16017B243CDC75CF3 Aaaaaagreenday1
967,780,744 *64E45E5FECC6EA00644968DA30B4EED9F9A2DB13 Aaaaaajenny5
967,780,745 *64EC039860253B05CD27A5988B5AC0ECACB87B24 aaaaaasteaua1234
967,780,746 *64EDEF400F89628680FE6CF805567E164BFCEFD6 Aaaaaazapata8
967,780,747 *64E7528A6C2CD087965A7A10BABA01129C659ECB [email protected]
967,780,748 *64E677032DEB5431D29D06F6590C2EAE45F5BD11 aaaaacaaaaaccacttgccagaagagctatcttttacacataacaccttgcctgctcac
967,780,749 *64E1903BA6677374EDE00D5358AD2F54C9D93191 aaaaagaaaagatataataattttataatcttgaggggctgagggcctttctacacagaa
967,780,750 *64E7A45E09CB1BEE28911067F3DE91B035A093CA aaaaaholla
967,780,751 *64E72998A53582E8BDB0D456004C7A16D4DA53D8 aaaaasexy.bbs
967,780,752 *64E876ED6E576AF077C7DEAE4A9F23D6516FCA84 aaaAB=
967,780,753 *64E126515CA30A78C3DD48CB3E10BD5270A13C49 aaa<Ad
967,780,754 *64E956DFB262109C70B9FC40CE307ED77AD9863F Aaa}af
967,780,755 *64EE97D5ACE1850B18F0B36CA9AFEDB72D38D03D AAAAI&
967,780,756 *64E917B0D0743A38C6E48B802ADC9902902CBC54 [email protected]
967,780,757 *64EF80F9F5CF77FD9826A19D37A63F7EE7493EB4 aaaaMb
967,780,758 *64E1CF57862D92F80A32A89A080FC2E772316673 aaaaraaagk
967,780,759 *64E5FB9D1AA193519D21B7B41603542A7913971E [email protected]com
967,780,760 *64EF98A46F2C628AD55AF79FE741C307BE9B528A Aaa.b(
967,780,761 *64EEF8C8E2C45735671DE513B444EA890D22AD97 aaa
967,780,762 *64E58B30FBF6239A226D6090F391AE0FC15AC337 aaab`
967,780,763 *64E2DB498CAADED5A14FCEB093DC46EBFFE9C402 aaab3A
967,780,764 *64E03BB26D9FFD440BD430763698457302FF63C6 AAABAH
967,780,765 *64EC3D3448839473B4EA5F5B1FA7FD1FF6A66959 Aaabertha2
967,780,766 *64E830106FF38ECCD80B805C95C4BD71DFD09722 [email protected]
967,780,767 *64E2EFA096D12805EEA6274ABC43EA70DEF1EB17 aaa}Bm
967,780,768 *64E05690CEABEF70098DB25FFE968A9068284BBA aaabN:
967,780,769 *64E945254DB6CDD4643D128E87DB23FA1A8B3F18 [email protected]
967,780,770 *64E82C259D78DF41AFC6C1AFD8ABBAE097CE3636 aaa?Br
967,780,771 *64ED829BD2BDE97FFAE486EC6C56921D1D130039 aaabRH
967,780,772 *64EC1336A1D357DC60597EE43E678F9248544372 AAA~*C
967,780,773 *64E2C53B9979938075C9ECF4FAC5B870E58568D9 A+AaC
967,780,774 *64EF476EA44C37E055C4E26480CD96AAE0289FD0 Aaa(!c
967,780,775 *64E06161581159183394D49F83AB6F0D8D8C51F8 Aaac|*
967,780,776 *64E28A605E28821DB32A932E28844736202BF0C9 aaa*C'
967,780,777 *64E0B71F62F4B34DFB6E6DCB5C2C2280659B2BDD aaaC_-
967,780,778 *64E294FC6CAA308C91369E816434443FDA75405D aaa^c-
967,780,779 *64E6B9E1A766C29EAC8A4D1F2D5472C6353DA032 aaa$C0
967,780,780 *64E3463A7EB7A14FE00268008A486F0B7E87B00A aaac!4
967,780,781 *64EF549E2E528819B57826CB89C39982D1D9A999 Aaac6m
967,780,782 *64E6DD52100063769E1F0DC2C56A609427DDB5B5 aaa<cA
967,780,783 *64E421613F9D282F8AAABE3712F66F06B08EF2A6 aaaC}d
967,780,784 *64E628214B7B7AED0BB805D3103245A7BA8FC1C5 aaaCdX
967,780,785 *64E9CEFF97E8EDD36E16A877B646AD4FDE3172F9 AAAC)H
967,780,786 *64E9422CF931A64A488AA20A4041C4BCC147F2B0 Aaachapman1
967,780,787 *64ECCB602999A008919A60BEA07D0538294E4945 Aaacooper
967,780,788 *64EFC25A2CED72B7E0C4241302EBB89E20AC5BDF aaa&cR
967,780,789 *64E6EE89802DB12DA044EFE67437548CAEEE76FA aaac}u
967,780,790 *64E9822169DCADB335FB609A2F9873E3B645C99A aaaCxD
967,780,791 *64E62A7BF69429FA9E16D9D39E1D2F5D9611D06C Aaa&cz
967,780,792 *64ECDA35C94416CD10D79A0BFCF06EC58880C1B8 Aaa#\d
967,780,793 *64E611E9E76DD166B446269CD55B77E8E7E627FD aaad8^
967,780,794 *64E656412FB5C84A7D68B752F0A53BB30A1E0AD9 aaaDA6
967,780,795 *64E56C9570235986A9DC57A2CBD89AB3C6C7C131 aaadGf
967,780,796 *64EE312616C37A6AE921FB332F3E0DC570422F32 aaad$m
967,780,797 *64EA8ABFA485F27317F5E2B09406D54A1257CF38 Aaadriberif
967,780,798 *64E65D79C2B6424E6A6F4B82FB4EE28448A251F5 aaadVu
967,780,799 *64EC72F05C6A1C01B1429716A5E4C12277993387 AAADX/
967,780,800 *64E764A80AE611BD240358993287279406B64CDB AAAE=%
967,780,801 *64EC50D72B2905155309B1F7F057BF58E8548230 Aa?Ae
967,780,802 *64E1050EB3A35779520BAA702546910B26CCC7CA Aa%ae
967,780,803 *64E7A09946446A0113B8501A9769BDB58B8425AF Aaa`e|
967,780,804 *64EB61E8F2733CFAF2658215F1F2D3EAE33E9D7B AAA]EC
967,780,805 *64EF70822B5873D9D2E788AA2C001C28BB08ED96 aaaEco
967,780,806 *64EEAA9C33D2EC5B9ABB75E045F049DEFAD143C1 Aaa*em
967,780,807 *64E7830C029261660E7EF9418B48D6BC652B240C aaaeoU
967,780,808 *64E25C393C2841AAD5615030B5529C53E99D971F aaaezx
967,780,809 *64EE5408C4CB5561957D69B6E0FBB037C956B6B3 AAAF!<
967,780,810 *64E27EC7FB2EC29C8BF9B914A8FCFEDA14EA7586 aaa|f:
967,780,811 *64ED31BBC6181E10260EA829386260AD98964461 aaaf[.
967,780,812 *64EAA5AE29622B0ECF3A5CCAC60C7C65433CC62F Aaaferrari5
967,780,813 *64E5BA6715EBE2A8947B6C4093AECB5A545E170B aaafNJ
967,780,814 *64E294F88EA6EA58DB4217472DEBFCF57BEB6A28 aaafP/
967,780,815 *64EC729B9AC57300313E96725AE72C19D64680C5 Aaaf;r
967,780,816 *64EE8127C623A2820E22B7E5D49C7EFF8169F26A aaafY\
967,780,817 *64EE47A22E73B9202DE39A24D3C032B653D22A1C aaa"fy
967,780,818 *64E5EEB3318C9BF1FEF12B591EBEB8D64E891957 AAAG{]
967,780,819 *64E2AB3CBA326F4862CEFA585FE549C191330834 Aaa/g|
967,780,820 *64EF433740F93CB374A32ECD82268E74FB261E05 aaaG}+
967,780,821 *64E4781029AB64F005CAC7257110552E9A94A75E aaaG*
967,780,822 *64EF4E64AB3C3540271336467B2C635F10B5F0A9 aaa>g,
967,780,823 *64E4BB5EA6036F71F8C083999E635492DF73743C aaa'g,
967,780,824 *64E20C706BE5F9258D211CBFC548C9AB176C8EE9 aaag12
967,780,825 *64ECA9FC3EC280257645ACC03B56EC4F6CF96A2F Aaag~2
967,780,826 *64E2D35229BA5550C393EF1D5BF52C848956667D AAAG7D
967,780,827 *64EFCBBC943B8A7DDB8C192D9C22FC431221A0D3 aaagg<
967,780,828 *64EF17CB99AA1856DD3187ECCA2D446DA07CB797 Aaa]gl
967,780,829 *64EAE8CD66FA94E8092A590689455D6CFC5C7514 AAA<GM
967,780,830 *64EA3646AFA8147B6BD5501CCFF204F461DDE24E aaaGmP
967,780,831 *64EDC84CCDA0AF657BCC7761DD09331A459FD960 aaagmQ
967,780,832 *64EF61EE2AB9A7B9FAB78ABDFDF6952806BE5AC8 AAAGO.
967,780,833 *64EB74D4B7E6C2897AF75ED34DFAE6D8DBF05D75 aaag%S
967,780,834 *64EEAA970E86197302A52408EB717854969CB4E5 AAAG<X
967,780,835 *64E8E4804339B1B73F31AB72AE440328DABB3349 AAA|H}
967,780,836 *64E6E5C035EF446858EF70D1F0C9CD1F065F7ECD Aaa^*h
967,780,837 *64E0298893814458D1650F3D9A972F3CAF6BF549 aaaH{#
967,780,838 *64E7BD3E31B6739DEC057033ACB9EDB4966B63F6 aaa&h|
967,780,839 *64E50483B07A7158E7EEFDAA5126640AB4E5E3FE aaah0,
967,780,840 *64EF25BA3DBE647A38EA0BB67519BA77A834F288 aaa;H7
967,780,841 *64E5B1B5DA8AD3FFE5E54F9FF21FE238BC0FAE37 aaah?b
967,780,842 *64E6AE18BA210D427F76804EEE85A54B6F20EB20 aaaH)I
967,780,843 *64EB463D90E1D780673063438EA1EDF055EA4795 Aaahs0
967,780,844 *64E7A6862441EA65DE0D6066C72E8932F0E02941 Aaai,{
967,780,845 *64E9581AD2D09AA378E89F327C7D679A3CE68B40 aaaI"&
967,780,846 *64ED0C5E8DDF819B0D7FD66C5FCDE1E31E2261D8 aaa<}i
967,780,847 *64E406EEE3CCF4EEB8C8E2EE5E0D61C7E6FC31EB aaa))i
967,780,848 *64EA3794AF90FC95D57F5E6C308C6B73FE7E575A aaaI0`
967,780,849 *64E3A42958327983BE74CFDD938E6185893E5941 aaai0|
967,780,850 *64EC810032C1C06563A335B885129DB03CCC246D AAAI5M
967,780,851 *64E29AA383C4C4D269F60779A1BAA741D85660FF Aaa~ii
967,780,852 *64E9481DC260DD97CD8200DB017963EC32841457 AAAI$J
967,780,853 *64EE0FA85939E5639D21DD465D5E02F7723EDEEE aaa`il
967,780,854 *64E74DB30EC85CEDA341281D3CDDB11E232997F1 aaa:in
967,780,855 *64EDB29C786B7847A8C89E45283C492519508766 AAAiSL
967,780,856 *64EEF2565319CC70BC33242A12B9935C66B66DDB aaaislanded
967,780,857 *64E52501898D45312CB654C7DBE603BC6D8FC8B5 aaaIT1
967,780,858 *64E9ACFDCD0AC3427C2ED3DC31D09174CF0BE437 AAAI/U
967,780,859 *64EEDFF73FB37C3694862B2BC869D5999603E967 aaa:J]
967,780,860 *64E6EAF06D817B791F858AF3B76FD9148D811DE5 aaaj1011t
967,780,861 *64EB58112D90F5B57FC876132F4C126BD8352480 AAA?J4
967,780,862 *64E2D8AA10E8A5BEC891DDE7B3C6E7224C5B8080 Aaaj*4
967,780,863 *64E5EC8B0A51F8A45AD384C05CFD78112F4CB6E6 AAAJ>8
967,780,864 *64E461A52AC77D8E2F43FC2AC3B22359B9EC3A8C aaaJ*A
967,780,865 *64E047D891789F1A1DB98BF0AD51732B342B38D3 aaaJE}
967,780,866 *64E21CBEC354D082ACE101CCE56453CF53B5307C aaa}jE
967,780,867 *64E74E311AFB0A206BF837846A7348BFF65D69E7 AAAJ_i
967,780,868 *64E79BAC3EDA96D0672D0855D09B59E9601AA689 AAA.JO
967,780,869 *64E0A680D7A1F92090E0EF7AD0B76C0FFA3257DC AAAJ!P
967,780,870 *64E62E87B5F677EBCDB067C83ED4D3D325AE256B aaajy\
967,780,871 *64EFAB481E304BBBF9B15F8CCA8067FEAB4780EF AAA"~K
967,780,872 *64E098BF929CCF9B5CC21D21A24564616BE75190 AAAK*!
967,780,873 *64E036B491AC826DA57602FD04F0A500E57E0880 Aaa]!k
967,780,874 *64E11F67D10A9959227E0553E76C79A1BE52100B Aaa$k]
967,780,875 *64EEAFFF9104AEC548A83CEE40C63D85C0A8DE60 Aaak{<
967,780,876 *64E68031E5BAAF709046E810D6B221CF7CED3AED aaa/~K
967,780,877 *64E508EEAA966A1F8BF7956CF7C6090E4C3491B4 aaa?)k
967,780,878 *64E0607D92D82D3484CA2BA2987606115A0C3ECF aaak]#
967,780,879 *64E5D1F2A0F0D5ABE53E5FBCD81AE9631C17C399 AAAK2C
967,780,880 *64EB98A12EC66FA1AE0FBE21E3FB79197FBC44D1 AAAK3&
967,780,881 *64E24E5D23F5C73CB8DBA46C0BEAC0B3E3723142 aaaK|A
967,780,882 *64EB701B91EDBBD48E94893255641753B03211F4 aaaK$a
967,780,883 *64E44F92B0616676369E275DD3041D446ECF32C1 Aaakathleens
967,780,884 *64E1694B335F2F34EA062B9C2C19056D8FC4AF93 aaa`Kb
967,780,885 *64E37E8CD83CCD4568F0F7AE3674841A03B00383 aaaKFq
967,780,886 *64E0D2D72B928D0E7F9DD3A003C6B9E5857C4151 AAAKH[
967,780,887 *64EEDB6F2C592389102030D125F98486B6722A5B aaak+H
967,780,888 *64E54CD57B00ED0036B8174C12AB78431069179A aaaKlL
967,780,889 *64E22A97B890B304640DA95BEE10D37F5E42BC16 AAA]KM
967,780,890 *64ECD2024A46A40AEB6A346C73C4F1C01EA961FE aaakZ.
967,780,891 *64E7E19F4F5C50169B6D51B7DC617863CA7574BB aaakZF
967,780,892 *64EA2DA77CE264AEF9BAC3A8A88751ED7333C27D aaa<_L
967,780,893 *64E6938284E0EDB24D33BDA08CF510E47864B71B aaa"l<
967,780,894 *64EB72644D2044EEA1FCDC8C6BB0DD529BC11DE4 [email protected]>
967,780,895 *64E043A727B53315332D7F7FEEDC02CE2F1B097E [email protected]
967,780,896 *64EF36C6FF83E80F0B7725CC0340711E333BC6CE Aaal7>
967,780,897 *64EC8D654C7B05A4D4AE46ABC67AD9A48F40A559 aaa=LF
967,780,898 *64E549A08BF86376CDAAB9EBC84DEC29BF9170F1 aaal+f
967,780,899 *64ECA110638ADC23BEDCD0F08D165D7A86ADEB94 AAA
967,780,900 *64E5C75D97A21F2C98705C70B691B0FD151A678B aaaljo
967,780,901 *64ECA75F633CD160D232A3FC4D4ED17D5DF288BF Aaal]m
967,780,902 *64E133640FF498617EE5B866D3166B38CAEEF362 “Love
967,780,903 *64E8C9775EC49EEFF36E4BF327CA0507D5B705B9 aaals_
967,780,904 *64EC34E125120A5AA4FDFB7D6D47FB925C54D98A Aaa)lu
967,780,905 *64E96C1A896077E0B3E29A7879B9C86CBF9B3864 aaalUa
967,780,906 *64E5CA5ECE7776CBA4493ADBD72710592635037D AAAM?^
967,780,907 *64E45E8D969B8C2C5DE1017E39A3DC5637811558 Aaam
967,780,908 *64E8A92A1DB66F0EC9B6F772FFFD9D590EE8996F aaa#M;
967,780,909 *64E35CC5A4C7DB7EA8E92F5AA41B6ACEEBD6BBE3 Aaa#m9
967,780,910 *64E7EB79F15B082F118EFD96670F7191BD5F7A9D aaama]
967,780,911 *64E0292525B6FDFBAA5D34B66F43F57B03391B48 aaamarina4
967,780,912 *64EE884D40368513590C83D4BCD69FE3C6268135 aaamarino1
967,780,913 *64E897C829D2DF5A0FADFEA62B820924640C812C aaamartin8
967,780,914 *64E836044DFAE7EA9E536A917A89EB26F60FCD3F aaaM(d
967,780,915 *64E249B0AF31FA64C5700E0EB736EB2369FA886B aaamfv
967,780,916 *64ED5B156F3D0C84C95741D2876A3501A491EF8A AAAM)T
967,780,917 *64EF1F55937A10D71F073BEB21B0A25CD713482B aaamU<
967,780,918 *64EEE6EE75C108787FF30F36DE4A3AAC7FE136F1 aaamV3
967,780,919 *64E6FE84E777C9B89156D059991EE476C8834600 AAAMW*
967,780,920 *64EECF66F1C142E32AEC73A6244C8527BCE73CFA Aaan
967,780,921 *64E26A339F5BEFCA8C57A50916C997DB7B929C40 aaa;n!
967,780,922 *64E4BF51256D58023558D69BD49FB9E80C06C689 aaa%*n
967,780,923 *64ED8600BF1FA60E4B69F67C18A555A35D9D6CCD aaan.6
967,780,924 *64EC1B60383BCD49F230EF1C1F9523A34CC440BB Aaanikita3
967,780,925 *64E7E3A882FCAB48D30DFB7F7F2C18E22058194E aaa)NM
967,780,926 *64E5FE766EECCADA3F1B42120EEF4DE62F5905E3 aaaNu|
967,780,927 *64EFCA858EDC18DD531338AC24730A6F087C44B9 Aaao`"
967,780,928 *64EB23D7088EBACCE1AE27713CB68102BFC65617 aaa'O>
967,780,929 *64EA43C3F923EC04A52091F206C494C65499F3CB aaaO?`
967,780,930 *64E2114645745F70EE7A89BF57192DEDEFD016AE aaaO#*
967,780,931 *64ED8C734034B707E86E0B9798D3926633C8B0A7 aaa)o#
967,780,932 *64E5564D7E50BF2D959D35150AE5EBB2E776A364 Aaao31
967,780,933 *64E7978BFC27BEFD13726B4E1FDD79969C479147 AAA^O4
967,780,934 *64E71DD4CD5613FAC74C531A2D1874A6DB495B25 aaaO4#
967,780,935 *64E136BDB7E4C36A4C50667FE6652F1E0AE5D1C5 Aaa>of
967,780,936 *64E6A26AD03BFAC051C71BE5E65E3057853A6E66 aaaOH{
967,780,937 *64EE69DF0B5A60D98D8321BE05BB79512B80F4E0 aaaop8
967,780,938 *64ECD36FF9DE4CE6897A88762651A37AF7306203 Aaaoq9
967,780,939 *64EE970409E17DC931AD1F213216B653569ACCB1 aaaou)
967,780,940 *64E05CFAD11482924A99F121B8C0828542F58493 AAA;|P
967,780,941 *64E20C29D4503CB635CE38D7DAE6CE08C05B79C7 AAA){P
967,780,942 *64E1B598A6825D3DAFAE4964EAAFB369AB27AEDB AAAP>{
967,780,943 *64E292C3C96BFE9EACA817E7F5FC9E99096A4886 Aaa'p,
967,780,944 *64E544A2E0FA3749193170BA723FC43827D62EED Aaap+*
967,780,945 *64E4B45B7E7114E4415ADC8C3C60F87B43E0543C aaA(p
967,780,946 *64E06487A25B426C73ADA9B59E534EB5A8ABCB54 aaaP<{
967,780,947 *64EFABB30E2024DC6AB63221C646EBEF82087655 Aaapackers9
967,780,948 *64E5E14E8A9FD656EB88665DD66DF45808D4B849 aaap#B
967,780,949 *64E1E23A4027EE417EE4E0719BE60610E67CACCE aaaPc#
967,780,950 *64E1B888CCA6669520C3C9CCE56EE4FCDEBFE47F Aaa&pf
967,780,951 *64E4976BD058D4A1F345B8A9F74CF62C434BD26A aaaPfE
967,780,952 *64E73E4B79E08A4ED580E779C860AFC7BFD662B3 aaapFe
967,780,953 *64E7F9F03C01DC66E8B0617DCF0BFC64CA13C567 AAAPG6
967,780,954 *64E941B177CEBDFE4156839B3203EC8158138AE3 aaaPHN
967,780,955 *64EA8BA3456A92496E8BFB7A91A64BA45B6B51A1 aaaPj{
967,780,956 *64E2B6A369A292ED79393A0FFEE852861D7736BF Aaap?k
967,780,957 *64EDC05FEFD99F91C019814A0690445620BADE65 aaapNl
967,780,958 *64E8AFB219161AC288D77EAE1ED4B24014DC337F aaaP{q
967,780,959 *64E3675691B53157B9B6A69749D7F02F3E239B3A [email protected]
967,780,960 *64EC3FCB2FF0CF716017F4066F829EB720A79A33 aaapz[
967,780,961 *64E4BD4AC0EB0B86D03CC7111E88FE342E4713CF AAA(@Q
967,780,962 *64EF68C608676C6A44312F698E4767527C965331 aaaQ)>
967,780,963 *64EF4757B46F3D65FADA84784550FFDD8F8B5C1D aaa-q6
967,780,964 *64EF335D0612F679FCE3096004A8C502F5B6391D aaaqhA
967,780,965 *64EBD41A47F13A16F6612CD5A68F700338C0579B aaaqj7
967,780,966 *64E01809CEBC767691C047ED0F94A4EE2AF5FB36 aaa~qk
967,780,967 *64EEB1E8CB98C017FBA2C1C03D55832F4F05828D aaaqkS
967,780,968 *64EBF4F07ED29DCA5E959D2F1896A7F9BFBC3325 aaaQqk
967,780,969 *64E10C1B58A40CF681FB524FD022BBDA8C3645F8 aaaQ!v
967,780,970 *64E7C6F0605ADDD1258514EFB04A27A20668B8FD Aaar:@
967,780,971 *64EA844F4395C7A4AC1E0A57E454455983EFD928 aaar<0
967,780,972 *64EB91B00F36D2C3B7C536758F7DAE08093DBC86 aaar7d
967,780,973 *64E2E95183D25CC63DAFA6561BE07D197F1F1C29 aaara<
967,780,974 *64EC2C62BC781E3ABF3C74207C93E518B76AD9E8 aaaRac
967,780,975 *64E3CFDCAF20B55024F73FC635623F96163D2CE9 Aaarc
967,780,976 *64E335CD53D0A3C9D511D5EE1E793A84C0D093BE aaaR'E
967,780,977 *64E0797E5A9843E9197220C6CFF591C007DEFA24 AAARO1
967,780,978 *64EF6154E802BBAD97A0F3B798627211E6767169 [email protected]
967,780,979 *64E43BE01CF67E1816147D9B4DD35B9405C9CC68 aaaR$S
967,780,980 *64EB33392A6C8CB68140524F005F52D4DDD160F0 aaaRs.
967,780,981 *64EF3B95C4CAD09EB978730DC1C0F94FFE827003 AAARW;
967,780,982 *64EC4E5D3C0E59AB8C7CC0712E712F35A70273A5 [email protected]
967,780,983 *64EF8B73E922C4DF9044B7D8436F02FDCDB79F53 aaary!
967,780,984 *64ECCA5A587A1FE9DE6969B5717A724FC1DA2551 Aaa=,s
967,780,985 *64EF77FDA255A080E6A32604F95B628373984809 aaas=(
967,780,986 *64E15D36F7A2260F494D0DDD8BFA9DC753EAB2DA AAAS0)
967,780,987 *64E7DA69BC755994EBAD193B53AB151185C90BC8 aaaS9)
967,780,988 *64E7623F214363074C400F1143A6ADFD3BF5864F aaasaaas4
967,780,989 *64E1F247CB9EA1FB5997A6FB1EAC4C93CA257294 [email protected]
967,780,990 *64E1DC131D253CA383F3A0D986B5AE2B09E9F8F9 aaasL/
967,780,991 *64E0E29E0DB74C85C933B3C19E4BA55013310532 aaaSU8
967,780,992 *64E97957DCCDF317E1867C44E69EB91A41ED8AF9 Aaa
967,780,993 *64E630A77BBB19CF3174741543F34943E1A1D19F Aaa>;t
967,780,994 *64EFFFC6BA5201CC6C46DF9F604CF3EED2A6EF4F Aaa,t
967,780,995 *64E9236C294E0862DEF5355DAF594878BFCE950E aaaT&*
967,780,996 *64E7F54E83863AAC979F9824B6D24D783B24D884 aaa)t\
967,780,997 *64EEB35955627E7EF65164EFBD5849F7A04107E3 aaat[%
967,780,998 *64E4D5AAE340B2069727697676DB4183136251C1 Aaa?t0
967,780,999 *64ECAC68648EE9C7A1F90EC9E75DD45125D57F2A aaat3
967,781,000 *64E38CCBCE667F4D225C6666E2779B70A513FAC5 AAAT5)
967,781,001 *64E94F4B9543F471788716891B67374301B8FD0D AAAT6|
967,781,002 *64E33E115E4B31887CFA173FF402DDA29A22F7D5 aaat"A
967,781,003 *64E6520233AA388019E6A9747A4CD500CDF25751 Aaa%td
967,781,004 *64E92BEBB4C5706ADB1E15E247C8C04DE0DC22B6 AAATXS
967,781,005 *64E39C82D53A901678B6EB8EB47CF51C534BF78C Aaa"&u
967,781,006 *64EEFA07264C754C7A5064FE4B22A8BA048BD870 aaa?U_
967,781,007 *64E1F938F3004BA499E362B1EF181FDE481F2567 aaaU=$
967,781,008 *64EAB1F179B259E39A261BA5D21C836CE837C6DE aaau3p
967,781,009 *64E50332B0251B93A8649276D5F0ACAE79F1DFD1 AAAUE:
967,781,010 *64ED97E41C8C27C8DD6DB19C85F88CED5DEC60E5 aaa
967,781,011 *64E3690CD26D91EAB502436BD4152C6F97A54983 aaaug'
967,781,012 *64E736DCC5D48DFAA1642F713BE4EF7D80554624 aaa(Uh
967,781,013 *64ED888B0A68137D4CA4EB060AF4EC17B1696A34 AAA<UJ
967,781,014 *64EF8D67B63FFF1F88329799EBDC2AC76F243E21 aaaUwc
967,781,015 *64E881E83E7FDB540A84B79F158A86FB6EBA08AA Aaa,ux
967,781,016 *64EB8743BB6C257D1D23F8E4EDAA9BB7861509FC aaau#Y
967,781,017 *64EA5749C93546DEC682FEAE91C0D38C8053B846 Aaav+\
967,781,018 *64E099DC4932310DB43A07902B6321A677D90A0B aaa'V{
967,781,019 *64EF0F1398D041CF8FD5118DA353E89EC0FB2122 aaa?'v
967,781,020 *64EAEF5BD870FEC700CC105306351168B7BF27E7 aaaV&0
967,781,021 *64E24DE4F92C79F7E02CAE809DDBCCFEF376D523 Aaavik
967,781,022 *64E78E70EF7485EB0844E5EBF3BD58B8F34F1590 aaaVkS
967,781,023 *64E91D9864A499BFDE1520E07E6E74F59DE5712B aaaVM
967,781,024 *64EB5AE79866F731ADA0485B7B849A0F0309023F aaa:Vm
967,781,025 *64E5F754F05AD8FF35F5EF8AD28E27AFAC04C60E aaaV(p
967,781,026 *64E0C91FE35E8370F311DD90152072C9BD2EAAA6 aaaVyt
967,781,027 *64E0898C5AEBC4484594A2A7DAA28DA768109258 AAA_W\
967,781,028 *64E1956037B537A5BC67421B19177BFE3E4B3551 AAA;W]
967,781,029 *64ED94289DF1C957EF525B79F7F6F6E5C4D15416 aaa<W~
967,781,030 *64EE3C872D57516A45BC30B151A9B025A465F110 aaa<W}
967,781,031 *64E988852267451DC15DBA62EB6F7893337529E7 aaa*)W
967,781,032 *64EC44CE9A6BBBF60BF8227317EE467395750ADB aaaw'%
967,781,033 *64E1B64AE5A83D9A8F19A1D2EA7F7E19C9629740 aaaw9i
967,781,034 *64E66C02DB8F34171A7C104F0A86FA0B3C475736 aaaW&F
967,781,035 *64E6005B1EE208B6A229FD6B6DFCE094C9DE9D4B AAAWiZ
967,781,036 *64E288929777F14F3CEF934DDFD71637CE74EC72 aaaWn$
967,781,037 *64EE7E50B234795B0D17639B8880E13670B344EA Aaawq)
967,781,038 *64E557562C9548D3430DC4EB56DB0D37EEB1F537 aaa,Wz
967,781,039 *64E2528865181C19171F87F572D7DA244D14F1F2 AAA~X(
967,781,040 *64E036F0692CFB5DB09397BA247CC1DCC104F9F6 aaAx:
967,781,041 *64EAE6FF4E9029ED884AE8020B062BB31DC14101 aaa;x$
967,781,042 *64EECD42814C61AB042060DEDFB421E6349451B1 aaa]x4
967,781,043 *64E58EDE13EAC56E5D4E225BE67B330E41B4E977 aaax5>
967,781,044 *64EF9954CDE82AC3FCDB689BFB0A9CC8FA7258D3 aaax'F
967,781,045 *64EE794C38B3E828B06D59B83CF23054C08A224E AAAXGG
967,781,046 *64EEB5F5F365FF302B5CD5569EB52D63629A5075 aaa}Xi
967,781,047 *64E1E57C90894E6F8548C9B467B4670B4575D28B Aaaxq8
967,781,048 *64EAEE4F2651B9CE466BBCEC746606D7A062A9B5 aaa'XR
967,781,049 *64EF97E13CBF39FC126936D6A078AB6496133248 aaa]Xr
967,781,050 *64E921886F653CC875CB6EEAF11983B9CAA03FAC aaax]s
967,781,051 *64EF6D6636F309BA8DCB1AB052E82B4C2C30009A aaax#w
967,781,052 *64E6E0DD500C655EAEDEF7CBF6DF24F2EA6CC473 [email protected]
967,781,053 *64E86ED481BA4F8433493D724FE2793171274BAA AAAY
967,781,054 *64E944601F3730B78291211CF1D2CC00357AD86E Aaa/~y
967,781,055 *64EA8D3DD84F90468180EEFD6BC99B2EC03F7E53 Aaay),
967,781,056 *64E33FCA218C165B442E8BE4BA7BACBCE3C5B11B aaa'?y
967,781,057 *64E25F81F536DB321DF90E707D8DC5AD66DD8A42 aaaYai
967,781,058 *64EC05880CCFF4C453E08C58A1AF04E774CEE3D7 Aaayeknod
967,781,059 *64E5797017BA7FEAE03434B7FAC416A784F9AE9A Aaa/yj
967,781,060 *64E736B22A2E60C2D98E5FFEF18937F5353662AD AAA\YK
967,781,061 *64E8B2758AD24AB1F76DC3E85BA91CB438743B75 aaayS9
967,781,062 *64E502549135909425B514109D64914046C37138 aaaYw"
967,781,063 *64E272D76C77D7C2ED7CE4EE1DDA74364CA9170D Aaay?x
967,781,064 *64EE2577ACDAE920B6B7285B37125A158C94CCAE aaaZ%]
967,781,065 *64EDF442F1172B0A24238E36BA8458E030AA38A9 aaa{,z
967,781,066 *64EDD62CA764C45918BDF308956BEB5B8ACA6FA0 Aaa!z0
967,781,067 *64E74476D6D0228966E1DA472B4A022515B11105 aaaZ2N
967,781,068 *64E73EF834ADC5D98E61A7581B1E0326EABE8DE5 Aaazaphod7
967,781,069 *64E3DD4C9928F25D86AC65747802727FB3144874 AAAZM[
967,781,070 *64E8D58B5E40CDF19EC43FC36FD7E3BCBE2044EE AAAZ
967,781,071 *64EFC8F726617000E1CA5AD1346D65B13D1F1AE7 aaaz"q
967,781,072 *64E3C96C428AABAF322D930824885F0E1828EDE3 aaazV.
967,781,073 *64EB8100A804432894AF62DD9C0AD27A31620FDE aaaZW9
967,781,074 *64E298D51409BF354890E58803DD42A8F51FF27C aaaZYc
967,781,075 *64E83C368EF85B1400A277E1F24E92E2855F5EA5 にaaa級で13勝をマークするなど
967,781,076 *64E9B0DC923C0918466BC3612C6189B6DE8062BD A-AB(
967,781,077 *64EF81DEEA00B8819557FDBECA08035B36FF74B8 AAB/=_
967,781,078 *64ED995C6C4CF0104F6717E57E2E26D68DB4300D AAB'#_
967,781,079 *64E90CAB7A8E5FE74C786CC2B94ED26E7C059AA0 AAB$;.
967,781,080 *64E091C3D33FF4A563FE2EB024705CB8A315AB7F AAB$"&
967,781,081 *64E65CC1B2396B1FDD86100C84AD91A1920FC6AD AAB&$#
967,781,082 *64E391FC60273B5E00509BC959C628E59C2900B1 A"Ab;
967,781,083 *64EE91B728CDB222B2CCA4442CD72A02E70B2A76 Aa.:b
967,781,084 *64E8676D0184BD3FF12A7CAAAF6A4F583EE17D90 Aab<^^
967,781,085 *64E922C9496612C71AD3EC69E7382490CF5A9D98 Aab$$+
967,781,086 *64EBE56B0C115164738CA72142B8D8551A177606 Aab#%_
967,781,087 *64EF88EC58D5636CA147BF304F50DADA9FE37B19 Aab+\_
967,781,088 *64EA1E437489F16E0FF9CDD3E6AA8C463D6A9E63 aa;&B
967,781,089 *64E19441E4545FCD69BDB5985EE088A4E278546E aa%+B
967,781,090 *64E55A50D304CB2F9672596C66F050A5DB759DDA aaB-!?
967,781,091 *64E88BAFB74668DA19135C6394F010302F3AFF9B aaB/,+
967,781,092 *64E4E99B67D69F61B84E72E18A2CF1D15F90FFCD aaB%[;
967,781,093 *64EE209D85C78DDE7210DA0ED21E07C9FB6BD657 aaB+.\
967,781,094 *64E049EB4A0E8F635AA9D9DCA098EAE4E2BC9F06 aa)$b
967,781,095 *64E352AA8C33A631B7B9080E6E782BB3A22E3499 aab`#?
967,781,096 *64EC5E0BBF5BA5E28B5DA82FD1882D78672E5968 aab^!|
967,781,097 *64E6DC2D48E71C2310E9966DC71106D0E70CE98E aab|){
967,781,098 *64E2C971259A2B3F5E4DB4AB6789140B27C030CC aab;,{
967,781,099 *64E64DCCBC6E8F373369A2F74869C77AC9EA7E3F aab'>^
967,781,100 *64EAB1818A94C71665A76925675796FF189151B9 aab'/"
967,781,101 *64EACD54F4D4819F82FED986D1AD94FCB6014C76 aab'\&
967,781,102 *64E9495457071B27695114C870691B073AB1B385 aab"}}
967,781,103 *64E8B907B065F81CC11AEF6A61D3B3AD5FE08B2A aab)<,
967,781,104 *64E9E283BBF28E924315CE92506679D3F79B0C8F aab[.?
967,781,105 *64E87CEE3721C9B8412A8A0E7DA4AC3979FE2675 [email protected]?%
967,781,106 *64E787B4FF0FA254CFF7FF2AADD733F099C0DDB6 [email protected][&
967,781,107 *64E8DF3258B78924D01684F2BB8ED495210CF9E2 aab${:
967,781,108 *64E2F16E0EA54EB0C680FA8B4BAD9CB33014987C aab*/~
967,781,109 *64E611FA64DB469F112B3E95BAE8C1531A5E0BDE aab%$'
967,781,110 *64E136BB376C699DEFF793285160EEDF00BC03AC aabニュース
967,781,111 *64EC45990EF38102ACB83B344FC7CE6882FFA35F Aab0%,
967,781,112 *64E7B93AFBE3A9198B9036F5A55D075D91E16D1B aab01116b7
967,781,113 *64E239B58534279C33D2E69DAE7CA8AA953458B1 aab0h-
967,781,114 *64E90C0A142819C59A8D8D018CB2A9E23586525B AAB0J~
967,781,115 *64EEFB89E07B33B824BF36E12CA34EE97F69FA7F Aab!0m
967,781,116 *64E85BEDC8EA75804B9F4D8C37BAF7F8319FC28D aaB0!P
967,781,117 *64E2E0C938E398D1D852BFD15170A271D4D3766F aab0pg
967,781,118 *64E34DE1CA5E4F495DDBA4814DBA49FD420CB7CC aab]1"
967,781,119 *64EDEF158F5723C8D8E1178CE3F0C315F7AED8BB Aab1)7
967,781,120 *64E4C19D3A6747586445AFF504D1CC26AE2454F6 AAB1[A
967,781,121 *64E7618469CEBBB0106E9A4147AA537703BBF6B2 aab1g!
967,781,122 *64E2CCA8F33E9136FDEA19AAD5B889210E512FB8 aaB1J,
967,781,123 *64E9F058E1076B9587D8AD33F540F5A48E348905 aaB1T'
967,781,124 *64E6FEF4142709B7028C9790DC76A418115225B2 aab1y7
967,781,125 *64EF6B145551F91C1B879C7046E643F75832CF4C AAB2)]
967,781,126 *64EE48922C98619AD77D5ACF30E6085BA54F0234 aab2~+
967,781,127 *64E1CEAF7344454B5D071BA55FBE186581787901 aab2=?
967,781,128 *64E92A35BA870DD0B356EBB150B314FF84CD1E92 aab2!0
967,781,129 *64ED25BDDC042CF1CE7551264D797A37E13D3D5E aab2|3
967,781,130 *64EE01157050CC34106C978E6783522C486DAF43 Aab23i
967,781,131 *64EE0A57E5A061BAED6E2D866A08BA71F722E382 aab24d
967,781,132 *64E2D616DF368EB4216510AD37A46423884496BC aab2&F
967,781,133 *64E611649A9B04A94E9DC78272DB5FD4329D4CBE aab2r`
967,781,134 *64E0B346E40136D964B56D93F8863E0F8E02BD0E aab2vu
967,781,135 *64EA13F65465394C4933DE3ECDE2E6795F565457 AAB2)X
967,781,136 *64E0723F395C811AAE88D878FC65D9576BCE808D Aab3~,
967,781,137 *64E87C118E61CC9494BC27BF1CC0C83F8B4BE8DD aab3;4
967,781,138 *64EEC4820D7561B36CD3E442E2AF4059E2029DD5 aab*36
967,781,139 *64EF5FD71D7600E1F16253F8767C58542B6DDFB4 aab3"h
967,781,140 *64ECFE44F484C6AF5E86397E5A7FCA9195172B8E AAB3HX
967,781,141 *64E412B0F2E3B55E9AB299980B1FE6538A0EA580 aab3m9
967,781,142 *64E97C191C5021497A8A0DDE9588110F345D84A8 Aab4`:
967,781,143 *64ED042107FC69C0FA594D5AA5C0C26C31D4B3C1 aaB/4~
967,781,144 *64EF529B36B54D8B7CC81671FEBB2BE59EE6C27E Aab4)3
967,781,145 *64EDD8085C59FF483C280B3CF33FDAC9C43AC462 aab4;6
967,781,146 *64E70E43745C93C640BDC861925D7CDFB4B37413 aaB4{B
967,781,147 *64E293638CD3DDBBF252CB0C15CB5992FF946A97 aab4Co
967,781,148 *64E63D57EB75DDC07A5EAC3B504DEA1A1C68CEE5 aab4Fa
967,781,149 *64E36662854ECC820A9F8B049A91AB0F47694F2E aaB4(N
967,781,150 *64E98072AB237D93C2B8ECABED5AA69D1C1380A1 AAB5).
967,781,151 *64E8BD6E81BB1B025C7484CACB503919F1D77F82 aaB5>'
967,781,152 *64EB926661F541C6860F734E0BB479B6D9943806 aab5!-
967,781,153 *64E93F8AC61D8BB5C5635375E7B7B2978D153640 AAB5'D
967,781,154 *64EC30E5192C71E97809C26B6396D428D62F2B24 aab5fg
967,781,155 *64EB0E31EA79EFE1F90797DA2FEBB848C7930A96 aab5$I
967,781,156 *64E09B4DDF4A8B3487FED592D9F80D8706EEC444 aab5We
967,781,157 *64E95A53D67E3E40AB231E03242E5EFCEE4207A8 aab5wQ
967,781,158 *64E1FADA68D187432C3FC410EF1F88214E083589 aaB5_X
967,781,159 *64E5738C7E4332D13D8AF2F0EB825A76EB17CDFA AAB.6"
967,781,160 *64E241A67FE5182905E16E42ABE1714A67D4D116 AAB6'`
967,781,161 *64E053C1AF1F0025190CDD5EBF52AB44A3497E3A Aab>@6
967,781,162 *64EAE09406D2AB5A1E26FC56FCF6ECB9D6E56067 [email protected]+
967,781,163 *64EC7DBC15FAA901BCE5CB944B43F287D4206727 aab64i
967,781,164 *64EADB8E651F1B66EBBD148F8CB72A6B52DF3B5A aaB68T
967,781,165 *64E7637531C3B142E91F44B29D5E1000AAAE8AB9 aab6{B
967,781,166 *64E48D302B68E344E9D9A2B3E3E0071DEE4B4628 aaB6CF
967,781,167 *64E92D290BB43B102409C9AA00AE02CB141C3C08 AAB6CH
967,781,168 *64E1252BC28B4D28C98DC8CE2211508EBC569B92 aab6Dx
967,781,169 *64E6CACE26FEA625DD72184E9DA89F5EB895FF0E aaB6P{
967,781,170 *64ECE8D603377EBB201B55A73D02E11AF1BEB016 aaB6uK
967,781,171 *64E929992AF322E5B75B62DAB4761099ADB21402 aab6wI
967,781,172 *64E76A73847CBD0943958C119EF29BF46D644555 aab6Z}
967,781,173 *64E50337DD36E404ADEA08B4C36AD852A367D925 Aab"7\
967,781,174 *64E8EEA4272CDA687948D885919C5D3E7114BA40 aab7<c
967,781,175 *64EFEDBA1F3162BE70F2BAA76C9E074A4A5F2662 Aab7g0
967,781,176 *64E952DDEDA3E1044A4A8036D919B96F200C2C6E Aab:7o
967,781,177 *64E2C35845827AA30BC0D0BF1C780AF8F3451F77 AAB7R%
967,781,178 *64E44492918D80735A5B1E4FA82D590E2471A002 aab$.8
967,781,179 *64E166A33CB110EF6283161D187E22834C0BABE8 aab8Ge
967,781,180 *64E083C1023583483C48C8376EBFB4ECEEDD7528 Aab8{u
967,781,181 *64E9DE24D7A1FF4099E2A1DAE79D67477B4E5EF6 AAB8Yi
967,781,182 *64E4170069152ABDBD189414E2188F4BCF27DBC2 AAB%9}
967,781,183 *64E13762DE505777DBA06074F427AF2D1FB8B86B [email protected]'
967,781,184 *64EA1B802A59B23B618EE3011F9B28EDA389E37B aab<9.
967,781,185 *64EB290952E2F2A3FF14AA9375600A24113CA1A1 AAB9^0
967,781,186 *64E8DD51456A30416F583684A8345CC4E47C7DA7 aab94c
967,781,187 *64E7C379E839B2FE06B552EC47B8B11B1BD7172A Aab9+7
967,781,188 *64EC4401E7F56284E32B345D44A9A6FC29B219E1 aab9H:
967,781,189 *64E9BE31202CC1B7217A25F9B3B64D9F2327CFDB aab9nb
967,781,190 *64E1613DA38DF6647A2E284B5B62FA0A37DB2317 AAB)9O
967,781,191 *64EF258EE62789B892702FE5BA51C9B45FA22340 AAb9u
967,781,192 *64EA420EB72FBC652EC1D962F4E150E252518A31 AAB(#A
967,781,193 *64EDBCC584CC756CFF38C0F9A4A33CD5876680CB AABA/-
967,781,194 *64E2AD030742E669F354A7C9F032EF4F371E4D72 Aab,:a
967,781,195 *64E4CB5ACA6314E8C758D59C3866D23D5B7AEC4E Aaba?{
967,781,196 *64ECDA9E9D2FEDD579CC3F13D6D2A66FE53FC4B3 aabaa;
967,781,197 *64EB806AF4D252A69686AB8E07BE995F3CD51430 aabAe$
967,781,198 *64EC30AFBDECA37A4353ADEF7928207A35066AFE aab'AF
967,781,199 *64EA380322A63A004E5EE369827714451476EF19 AABA%i
967,781,200 *64E88481345060709156AA355454A558B67F32FF aaba`S
967,781,201 *64EC8C4DDAB12516487F379147F8B4BB88F6CDDF aabas^
967,781,202 *64EE7088E6C9D8FAE8B79F3884DB54FE492B53CC aabATY
967,781,203 *64EDED217D965363428AFD42792F6A91C34B4204 aabA#U
967,781,204 *64E0523CFBD70B5CC8EF1450740F4060335B32A2 A!ABb
967,781,205 *64EBCFD3A32A524CD0C35DA59B5CC65FDC9753D5 aaB?B,
967,781,206 *64E7AF1F55ABDA4F521372471240FF374F383122 aaB*B*
967,781,207 *64E7125C63D8CECC5D520D456943AB80F7DE7E7E [email protected]
967,781,208 *64E3FEABC635CEAEA71F247B39F7C8A7F5C20903 aab-b-
967,781,209 *64E1273E74AA31347FC225BC49B56DF28DDA10F1 aabb'*
967,781,210 *64EF512D76ECA5F42AC0657B819D1ABCF740197A AAB;B9
967,781,211 *64EF32D3D858E77506A9831E5BE34D39EC363E8F aab`bG
967,781,212 *64E0A00737680B847382BFDA5BDBF842D2FA739E aaB#BN
967,781,213 *64E7474B84177758859E31FCDFDB2439A8BB9638 AAB.C+
967,781,214 *64E3EDFA8DF8163CEFC07DDD210CCA5B049E270C aaB*;C
967,781,215 *64EEF889A56A5E9E5A945F63F9750EDF5ADB1E06 aaBC>@
967,781,216 *64E6E4889AE447CAFF89820F59FD41DAD23BDDC3 aab*c3
967,781,217 *64EBCAD1F7E9B62B210B88D7A095C789B4348D0A aabCCb
967,781,218 *64EB912A517B7C938AF9B99B89FA75D6EF5E1781 aabc!t
967,781,219 *64E9E1DD16F787401999EAAF5FF4F81F15CD88A8 AAB=|D
967,781,220 *64E81FB8FAC1C37C01B972B82B359A77625525B2 Aab*}d
967,781,221 *64EF5D55FC715505A1E50C41C9B4F697456547A0 aaBD90
967,781,222 *64E2EE337DFE5D126745CF03B29D5B3DC360A668 aaBD>a
967,781,223 *64EA5B0DA500F65F5F07098DC6FEC27A72530FCB Aabdazb5
967,781,224 *64ECFCEC82B065C748280CD5C2175393B725AD00 aabdBs
967,781,225 *64ECEC781C78BA9ECD73F299F9C354B363BC4FCE aaBD_J
967,781,226 *64EFDF02387A5ED6089725A884E7D1C663878FEF aabD/q
967,781,227 *64E24652917B4B105594BEB843885305C5715456 aabdr(
967,781,228 *64E7B108D4D374A77033E9D11D985ECA9C6DE5E3 aabDv<
967,781,229 *64E307976F171FEFE28E6A8CFC53447E09813D03 AABD_X
967,781,230 *64E0BD83A3F9DD641D6A960DC17F18ACB3D01B72 aabd:Y
967,781,231 *64E49479FA81D39168E001B830C6F9E63D61894F aaBe"-
967,781,232 *64EB77C64CDE6DC930482A554D3BA55509DC768B [email protected]_
967,781,233 *64E8489F454AF2F224CED9E5B972B2CF2756495C aabe41
967,781,234 *64E7FC557EEF0A6024AF822B255E63E2621FF8B7 aaBE5
967,781,235 *64EC99EDBFCD72672E81E6851AD7F2B6B3EDFB88 aabednoh3
967,781,236 *64ED8A3CF65CE6B6BAB4CE68D1F9381C2DC0180C aaBe]H
967,781,237 *64E4B36667D30216BFCD9513A2780A10E47A2D92 aabeh~
967,781,238 *64E8CFB0CD6F2F6AB1D62483A12E8C0941CB0599 aabe?I
967,781,239 *64EAE59915C8BAE86464A7B34EE5FEEFA1C3DECC AABEL6
967,781,240 *64ECB8A8DE5E4CBAFAEF05AEB778BFC12E677F5D aabE?T
967,781,241 *64E01899BA6451C86FB6CDD52BA733A139CB5B11 aaB,_F
967,781,242 *64E1B7F06C5A65AFBC4958A4F3E21ADA2F69B85A aaBf"
967,781,243 *64E61FF28170A86DBC3E67D966B4CE78D06A8D08 aabF,$
967,781,244 *64E7DD72FCE9EF9FDE3ECC323462090E632A2389 aab)f<
967,781,245 *64E58DF9359AD6DFD27F49D195951662D7958EA6 aab
967,781,246 *64E72FB3F9E9634B999899C4DD5D684C7C6CD10F aabF|B
967,781,247 *64E39E9F8E81E398AA52DB2E302FDB4C4FD51706 aabfcI
967,781,248 *64E74AC78DC8315F77720F6CAC1FB7C9A142A089 AABFFW
967,781,249 *64E5AEC9CF0BAAB7C8279EF82346AF86CD90A0E7 aab`FH
967,781,250 *64E4263F00C6CF3ACD74110D4E0B296876698C06 aabFK
967,781,251 *64E11F4E720C82E0A060BC2ACCF31F3A1FF2344D aabfm!
967,781,252 *64E36AD34D9D27599D7842C5A2A5060C00A6CFF2 aaBFS:
967,781,253 *64E64B91DF7474A3BD6FFAC03D9452A844727998 aab-FS
967,781,254 *64E38CA8CFC940F7FCC8A21E5B2F6EB97C5215BB aabF|y
967,781,255 *64EB3AC03FBDEC2DBDB2E286E0D3DE68BAB717B0 aabfyb
967,781,256 *64E9A18FAEB5EECF263A1EE1B247A3C8FECC860A aabG>&
967,781,257 *64E31AE33F436271B4A18A89B3FA38E33DFE68A8 aab=g"
967,781,258 *64E6EC62CA1F2545EAA1BB76D888C9A7429F9794 aab/[email protected]
967,781,259 *64E3B1F7B0F44A90725D6CB1EB8B36DCE85BC73B aab)]g
967,781,260 *64E04380DB6BE20E63A726E8A0EA30A56FD49F59 aabG0.
967,781,261 *64E03EDC58974083A034654F0BF3B0DDA680A8B3 aaBG6P
967,781,262 *64E28B4B22D080E39968A0B234287E3E210A0891 Aabg|7
967,781,263 *64E5250E8181ED917661C5A7339D8CF9A21D1567 AABGF;
967,781,264 *64ECD6C1FC0A95DB67AF53A0D0E12E3759C4942A aaBGK%
967,781,265 *64EBCD2B3EF800D6CF50213856C86CEBF33762C7 aabgqO
967,781,266 *64EEA70042743032B95A36FE18021337682EFB75 aabGUV
967,781,267 *64E6CFF649EF0445BD3AEB244543C4118B933480 aabgxq
967,781,268 *64E3A972706AF3BA290B95DE280CF09A7A976609 Aab!!h
967,781,269 *64EC8AECF51CD14F95B01D32D4221753D54FDC95 Aab/h
967,781,270 *64E6E67326B833F653479A21B1342CE5765A542D Aabh_`
967,781,271 *64EA126D2C12477E8ECE76F044A1E69CFE41DEDF Aabh}\
967,781,272 *64E2A1BE41AE429467435774F80B89E290DCB602 aab_/H
967,781,273 *64EA06A147D325604270C9771EBA43A2D84339AB aabH1]
967,781,274 *64EA49CF4E49D1028D1C446857AD2A657B9DEB7C aab&h6
967,781,275 *64EBCFB6AA8A984340A72833027653222F2CD4C6 Aabharana6
967,781,276 *64EF3C0E4805E078B520A0FD0E02D48798282AC8 Aabh?b
967,781,277 *64E68728885D2BC2CE14A82E21946C7D65AF9828 aaBHLi
967,781,278 *64E28D3F95187DBAECEFA8414501407DDEA2356B aabhogo7
967,781,279 *64EEC7C5712DCCA0E13D3941D32D6E80FB31AFC0 Aab%i"
967,781,280 *64E7FD0F2986A64D6D444DC793642CE418EC7F5C aabiaY
967,781,281 *64EA9688BE7FE6C414908C2BEFF48713F35060AC AABiH,
967,781,282 *64E49091DB5029F6F303FD70C31925B6F728062F aabIi}
967,781,283 *64EDC726543F24BCDF456C817291088C34DFC970 aab}IM
967,781,284 *64E6D1B42639DADD1EBC2A2978DA452DB31285FA aaBiYK
967,781,285 *64E9ED36999367FAB1154F223D3D79E10EBB513E Aab?:j
967,781,286 *64EAC23076C6A934B2232FE4127E9E8FF2DAD200 aab}J&
967,781,287 *64E32698CC775EDC88428342CE8ABD4240531D21 aab`@j
967,781,288 *64E3BA93AE080E831B168CA3476A0AA945CEC2E8 Aab*j0
967,781,289 *64E2FE58B88D718598F0865D8EFAFB7917A6422B AABJ19
967,781,290 *64EA3AE862B555F7FAB013692829EFBAD98371B8 AABJ2"
967,781,291 *64E618300D1CEE7DBBE13B6D7393A35C258D4942 aabJb!
967,781,292 *64EF7B2FC26EC53EF0CE43A085D350B289919F03 aabjbV
967,781,293 *64EFE2D820F8D0B33265D393BEA337EA47FD6E62 aabjkd
967,781,294 *64E2D1FECF255E540668271ECB94B73BBE2C3606 aabjkP
967,781,295 *64E039048A4E78D9BCD7EC3456603B543B8A08B1 Aabj"p
967,781,296 *64E85A02887C9B68875E9990E8D84431637CB666 aabJr2
967,781,297 *64E3DC82BB9477A011DD7376FFC237F6534BE253 AAB&K'
967,781,298 *64EBEB435804140C4EF8FF975E006F587572AB15 AAb&k
967,781,299 *64EE46A205C07426636DC78E6CBD4CB271001CC8 Aab$k_
967,781,300 *64EA9B41157DE72D8040D1B04FB973D29785816E aab~k0
967,781,301 *64EF62111CAC71310EDA86D90E86181B35D4014C aab%K5
967,781,302 *64E248AD727E2A2CE7274CC472F8B125553A777E AABK$6
967,781,303 *64E7B278E15CB4E575B21BA7F23E8ACD3FCBA614 aabKax
967,781,304 *64E2ADE4602C06C4286DBB506236B9DF172E6657 aabk,i
967,781,305 *64EEFBEA4F60C68DD2ED57AC7142EF843AA36DD7 aaBK_T
967,781,306 *64E106F47F596C3F994DFA7688648288E484D6BC aaBK}T
967,781,307 *64E48228302D18005B78B376B84486001891E9C0 AABL.~
967,781,308 *64EDA247AE5EBE4F3425ADC9806365842047DCE3 Aab>#l
967,781,309 *64E134523B3DD9827AC599F68FDDA17FF994244B aab>%l
967,781,310 *64EFDD599A88E40BB239846B9CEDD34145E2FCE9 aab)lh
967,781,311 *64EDD459AB3FEBC030A2DBAB69AEAE02719CBDB0 aaBLP]
967,781,312 *64ED45EC88788FA00AA5BDFA49A7626355B18BAC AABLR.
967,781,313 *64E647A5221D32ABEA873F347F6AF872878D459B AABLRE
967,781,314 *64ECE4AFF6B53C7CC142956544B1A07ABBE54077 aab'ls
967,781,315 *64E32B0ECB623039F2D7CD7A5E62CBBAFDCE7169 aabl;s
967,781,316 *64E3A75F31B8477F18EDFF4F3B2CB1B2B3D9AC4E aabL-T
967,781,317 *64EDAB346B37E52B22C7FFF9F915EC21828A2E37 aabL
967,781,318 *64EC4117BFD53B249C5ACD8F2B6CB2D25D7443A9 aabLx<
967,781,319 *64E70D5081992790C7E6638BE8738AF78888F15E AABM[.
967,781,320 *64ED7CB5F029DBC6634EB7CF15DCC5FF7B2A823E AABM\(
967,781,321 *64E5DF27CEB3F678C0F460D45F0C7EEBA49DB5C6 Aabm:=
967,781,322 *64E9A52B51BC913F18ACF5E83BF08C8D8B0B9D23 aaB#M+
967,781,323 *64E2D956A232EAABE3B6DFB12D63409211D55869 aab
967,781,324 *64E5AF61A3CE932FBE34E79D5FEDD6BEE46C15E9 aaB/M7
967,781,325 *64EC5F8245C222DE0C95A8A0A95467F95C77E436 Aabm9+
967,781,326 *64EE0F83F070DD6973F1F51665F0201054B50538 aabmIa
967,781,327 *64EBB46DFE5A6032F72C8E48D19BAB87DEF5DDBB Aabmk}
967,781,328 *64E27333C3F3B721CCE2906A949BB81FC37E6709 aaB!MK
967,781,329 *64EB7AC8679E0FB5D18925403E169E2380A9E5F1 aabms/
967,781,330 *64E1734A66667F6C3D24E4E019F97B3D6FA42A6C aabmVK
967,781,331 *64E827B3ADCC398C87805FD9144C9A4396146D09 aabMWg
967,781,332 *64EAF5BAF7D9E1E56969CF455B4BD90E31A6A5AF Aab:{n
967,781,333 *64E9050C5333F888D66D16701A54DD81B1F5A4BD aaB.}N
967,781,334 *64EA9BD13A18541B3A346A3D3090B09D59F57547 aabN>!
967,781,335 *64EB56E7E5217B458B1EAC9FBC7EAF7A16F7884A aab`*n
967,781,336 *64E321FE616AAC126EBD81EA5CBEA04EDD93559E aabnets6
967,781,337 *64E9E184EE3AA05787EB2A812A74A55F8B206BBE aabniQ
967,781,338 *64EC92B40400D4B58CA0D4876680DB14B81AEA31 aaB+NS
967,781,339 *64E79D012C92969C121DC23763ABA7C3F6C2017F aabNs_
967,781,340 *64E1D270C4995AD6EE720906F83B1A6CC7236083 aabNUc
967,781,341 *64E38129FEFA05CE0282CFBD5789AD5F9DEA9CA2 aabnv2
967,781,342 *64E5A7EEFA3F8F33639CB15916E30C51C1675DA3 aabnzq
967,781,343 *64EB49F6A7AC3897FD23CD44428A7A74C32ED941 AAB.%O
967,781,344 *64E67E68DDA44B2F6FEE195FE39EC5B1B688112A Aab+=o
967,781,345 *64EF56516B0D0C76DE03A228FF74DC0B30D1644F aa{BO
967,781,346 *64E810096EF4037E405E3467DEEFA9F5B8E54E79 aaB';o
967,781,347 *64E690140F0193E90CB963E869423F4DA50A21A4 aab:o3
967,781,348 *64E22E85443F9BFF9D83A9C292F3134C586A845E aabo6g
967,781,349 *64EA1C4B93EBC9AA87DEDBD1F8AD377341AA29E7 aab?oN
967,781,350 *64EA16CCF16FE8E9E00ACC2FA43E668A78593C10 A_ABp
967,781,351 *64E7BB75D7B24C42F76E896DF601CF0CECD07BB0 [email protected]
967,781,352 *64E65E3A7A345029C822070DC793A513EB4BC573 aabP95
967,781,353 *64E4097BD5807B47005B57965A797FA49B5BB003 aabPDO
967,781,354 *64EAACB70437FE4D1B0AA8B4CFA6C3DD956325D5 aabp"g
967,781,355 *64E45D8DFBD1DDFCD5D97709406E95B581FF1D35 [email protected]
967,781,356 *64E4F457BB4A488C7EF8D05016D77A1725B5C791 aabpp|
967,781,357 *64E0EAB856CB845BB0E26BDBCB8C525DD3F63579 aabPu|
967,781,358 *64E7263BCD0803A979413214C1456684086B578E aab'Q{
967,781,359 *64E6528921978A6324EC7E7554E71BEE2AF9BBA1 aabQ~"
967,781,360 *64E16C636750C7EF316D442715F2B85033FC3EA6 aab%Q3
967,781,361 *64EEFF6FEF2DEA6A676950900AC17698D019B088 aabQF~
967,781,362 *64E666CB6C08036A340900E4BBD0339C7F09D8CF aabq-O
967,781,363 *64EEBD6DCD1283E78CC6A0C7C443EC57C8742298 aab[qp
967,781,364 *64E14370D5542DE9AC54F809B3D484DFD5B1620C aabQX*
967,781,365 *64EDF5331489986B2F4DA1FC64AB2532BD49CCEF aaB+R[
967,781,366 *64E21548362F6E200ACF2409FD723A80442A0863 aab}R
967,781,367 *64E7300173FDFE6CE21BE23E1E7111473148D995 aab&r=
967,781,368 *64E9C8368C33FDC3E3AE59055486B8D648320C7F aabr4b
967,781,369 *64E96519D067A6CB88A62D679962182085773BEF Aabrahamlikud
967,781,370 *64EE3B42F045627A57C5DC2AEC173DF48F85F933 aabRC|
967,781,371 *64E3264A1E91FDEF860CAB7999E4DB1B7D354979 aabr^C
967,781,372 *64EE6A33FADD4B4A51A871E4537636B846F3A0EE aab?Re
967,781,373 *64ECD6328A99065843A8EE7F0324E3C42246103B aabRf4
967,781,374 *64E6274D3A7F5651BA0FC7C5FE7DFA7EEF1C0197 aabRN^
967,781,375 *64E0B5CD5658807999FA3DBBEF652A483FC6930C aabRnM
967,781,376 *64E782AC963FB010A5A36ACF88B9355D57DCB7C4 aabRR`
967,781,377 *64E5A182753933F0CF03162840702E5B3EDFB67D [email protected]
967,781,378 *64E177D06BFB91856508BA45A44D9A8DFD068FCE aab&,s
967,781,379 *64E05173876068E27DD4E49A98BCE28B160F31DA Aab!s7
967,781,380 *64E73F345CAB370A8EE494EBF8FE2ED828A4E085 aabs9-
967,781,381 *64EF7D6ED4A27F9DE1994DA1A109A0778333A85E aabSB;
967,781,382 *64E5194DB9D4F276650735C1390D9F88122D1976 aab'sb
967,781,383 *64EF4BBB0DDDDEADCD43928A2ED36FE7A09447D2 aabsC^
967,781,384 *64E7EBCB558D737B7BDA5A416B1EFC6BAC0256C2 aabSM(
967,781,385 *64E4C45E3494D4CDFF9D0C49E51054EDAD65BAF9 aab%Sy
967,781,386 *64E787177B49030F1CBC26D833B35A7CB1036A90 Aab;`t
967,781,387 *64EAD890CD7EE647B7DCFC92C3E90F09C743A46C aaB'[T
967,781,388 *64E39736A9C4BBAC8E5AF230382E15CB2416E674 aaB$T&
967,781,389 *64ED29CAD2692BA54D9D3F37A272CACFB545F66C aab%[T
967,781,390 *64E3454C85AC5E631D883175BF97A13D925EDF36 aabT<>
967,781,391 *64E4011161F0C699E59F9C3D528A63D22AA38848 AAB+TH
967,781,392 *64E656874508EA397890F76B604FA0433C6EA32D aabt|M
967,781,393 *64EB097BA541216ACFF218817D9BDFE30387C082 aabtM-
967,781,394 *64E5252D8CA9F0A4B66224521DB6841443583086 aabTO&
967,781,395 *64E0DCA46E92F0F02FC345757DC8A21FB922FD4E aabTPb
967,781,396 *64E28F5376A0E09B51237BF30DECD6F85A55FD93 AAB'TQ
967,781,397 *64E1FF329A6BB11038D8206BA623E13D7BA9B15C aabt]s
967,781,398 *64E286794D002AE2325CF273ACAB4E854C3E80EF aab$Tv
967,781,399 *64EC5227AD34370EF725ACB1B2C8467BE528F080 aabTYK
967,781,400 *64E217FBD98B681CB7B5B6EFD2408554E4E4DEB2 aa"Bu
967,781,401 *64EE078FC229E9530B03FAC284355A436A36FA19 aaB#:u
967,781,402 *64E8BE23538060150725C7427EC4D555D94E9657 aaB%u{
967,781,403 *64E8569105A8BD3E8B5E1737A48D7029CE739EF3 aab>"U
967,781,404 *64EE3AFD07787F04A285082D4B81B3BFDB9A298C aabu*,
967,781,405 *64E6A5638E735B9BA53199E00E13D8F24975D01A aabUK#
967,781,406 *64ED09C48A344988EB93FD979EC4EEBB1F56A11C aaB<uV
967,781,407 *64E5EEF2630B2A0B5E7538B63DFA3BDC0BC99092 AAB(V&
967,781,408 *64E3592EEB86084ACD0F50592122998B74D508C4 aaB)V^
967,781,409 *64E37B024AA94D4B6C6D918B8BFF3B6E99C15709 aab(&v
967,781,410 *64E58833A67B3360B7A34DA04C9C93F306EBDD07 aabv?(
967,781,411 *64EFF54F438EBDAF75F928C2184092CC88B9C753 aab-V4
967,781,412 *64EEBD6659DA4D2EB1C422E7B1E39B2EC1168B02 aabV&5
967,781,413 *64E2967C5C0C3F4A2E6C4F2645F944C0144F41AE aabVg=
967,781,414 *64E73AEB39DDC9D4833160B1C0025C67B4C28A73 aabv<G
967,781,415 *64E3B5E1227964D91D46B65E3E4EB1711236453C aab/vI
967,781,416 *64E545A61CBFDB711FF22B3B8621DAAFBD3CC13F [email protected]
967,781,417 *64E4865629E1DBFCBEBE650B10D5BBF036A9F400 aabvLO
967,781,418 *64EA7754D03A6B3C84F0940CC56193664F9FA645 [email protected]
967,781,419 *64EB2C79D38A89DEFDD1483B93877B5A09CA8084 aabV~Q
967,781,420 *64EFCEF8A2BD42A1DF131E589E8728740D991E92 [email protected]
967,781,421 *64E059C63F81789922E7C740195E15AE8794778B AabvY
967,781,422 *64EEFA3FC6D59889E15BEEEB7FDADE81F546643B aab
967,781,423 *64EB6977A03D7274FF94D596AAF1D3287C6E5A76 aab}"W
967,781,424 *64ED04C6A53B7523BE00AAF393A9FBF173558D82 aabWfD
967,781,425 *64EDCD1F827DC5CD6EE3BB600397B7ADBF5E6848 aabw[g
967,781,426 *64EE632EA1FF27CC08D830E0A7891CF9458534FB aaBwl
967,781,427 *64E9CAEEBD9D0E007AA34D52E4D89DD879D625E7 aabwsj
967,781,428 *64E9E794BF28199F0A32D6B134C77D268A122544 aaB&WX
967,781,429 *64EA3ABF3A1C7F878DEFF61283C11E4EDF2E7A44 aab=x]
967,781,430 *64EFA205F22B1FA2C4DB8AF6A3A65A2CCAE52284 aab^x6
967,781,431 *64E40B623132EA9CCB6A14F99494D47464F37BB4 aabX6N
967,781,432 *64E85CAF55A9DCCE6E132A5931A5B3EE4EAD5C6D aab:XI
967,781,433 *64E674188A9D974EFCDE968CF0BF1134C541EA68 aabX=S
967,781,434 *64E13578256FF7B542810C35E700FB6F204E7693 [email protected]
967,781,435 *64E7296989E01C0D413DF15D6866D992BDDF9157 aabx+s
967,781,436 *64ECEAB1F9CDDAB24B2716B6526B63F9C4C93D42 Aab"y-
967,781,437 *64EF10E909095C6061684DED714BE2A80B2EFC6B aab&Y+
967,781,438 *64EDE3A585F0AC8D5FEFD763A7FB3338FF1F163D aab#Y'
967,781,439 *64E960FDFD7011BE22286603792E7A7A59844192 aab|#y
967,781,440 *64E031D6E88740DFD27B818F0B77A7C736F54918 aab*|y
967,781,441 *64E980551FA5C161DB2D5C0D29D424F738C0507F aab-Y4
967,781,442 *64EBB4F5855E22AE15F9F162D4DBFFE7728DDE89 aaby)4
967,781,443 *64EF3A85725FB5FF8B66A717BB5DA42CA18150FF aaby,9
967,781,444 *64EDDCA323985A4DA7842C5DA14BC4256DB832B7 aab%YQ
967,781,445 *64E72EE4261F048318643CB336ED93628C95562E AAB&Z?
967,781,446 *64EEE5B9D2C76B743BA9740AA73BE83E133E4140 aabZ*-
967,781,447 *64E3C83F580CBEFBC911B28D5295D0706A7859A4 aabz(<
967,781,448 *64E96307A968CF60EEB2C9FE17582C3162E37692 aab&Z0
967,781,449 *64E0401C915F11C3C386CD0516D6822133378ABC aabzbX
967,781,450 *64E3181FE048857CCDAF1FAAF87278056BF60E81 aab"ZK
967,781,451 *64EA0C58226E6C4E7D2C0404C64593E6295CD322 aabz[P
967,781,452 *64E5E810E0A7F59DF2CFC73657E9899E640FD539 aab$ZS
967,781,453 *64E08E871165657CBDF2FA63D22589F1CB4AB4BE aa~(C
967,781,454 *64E68F7139EC412E9EC12999B11D0DAE32591CF5 aa_C<
967,781,455 *64E7F47A444F98DD6EEE567435BB0DBA1E9E94A2 aac~%'
967,781,456 *64E3F7B77DECC97C47EE4F4FE15814ED0D09DC87 aac<$_
967,781,457 *64ECBEAB423EAB002384B68D8F77CFFC2202E437 aac|\!
967,781,458 *64E9DE98070CFF5597622A7D8FA64E5E06BC3BED aac_??
967,781,459 *64EAE566BE0581D697E3D6020C991ACC23C9A819 aac_):
967,781,460 *64E565C480DF0349FE1643C56BC28AD935CE2389 aac-?]
967,781,461 *64EFEBAD13A56208E27918C7F5310911DBE48422 aac;_:
967,781,462 *64E6A14E18328D8B5DF2305E485129F2B747D35C aac''@
967,781,463 *64E6DC1251368449C570B3B65CAA0DAD063F0335 aac",~
967,781,464 *64E47DE92927A3E282A20277A877886614FB4E25 aac*/=
967,781,465 *64EE6BF3D0BEB9F54542C6D5364775756ABF3683 aaC0R
967,781,466 *64EE52943DD426A036E26EF8D8B97AB1AFE915BE aac0rg
967,781,467 *64E697F300CDE248E20FB99F3093E0FAE46FA859 aac1w>
967,781,468 *64E5371308F34072BB554EF28D0DFE0FECA09368 aac'2
967,781,469 *64E37C6AFC3AF560640D846D1DF4792195FBFBB1 aac2KM
967,781,470 *64E78B959DD5F26A1C07E3FBA00F50ABAB80DFDC aaC^3
967,781,471 *64EE33C46837621FC7E88696C431F442AD529967 aac>[4
967,781,472 *64EDC9A15CE6F4FDAD15E1A3B67F8ADC32847C29 aac(4$
967,781,473 *64E2BD75EC254845128917C4AF974D1E8CE51B96 aac4B9
967,781,474 *64E7265D76375CA415053F5B26786B63CEE51948 aac4DA
967,781,475 *64E0C0D7FF90DAD88EF1BFE2616BC4C7DDC19086 aac5*
967,781,476 *64E1E328554FB3AFFB53427F4C3BCBE9BE6E6779 aac5fk
967,781,477 *64EC8C3461E9CA292B998EE701BC7CFF679AA7C8 aac5`r
967,781,478 *64EBD49BD245AC7DF6A819A4B33C8F46E9F6C9CC aac6qN
967,781,479 *64E8E1CC809CFB3370920E242A6AB890C05D9376 AAC7h
967,781,480 *64E73F7E4B36E92121E630270EF0A0199E8EC864 aac7X>
967,781,481 *64EC684EABB76957D94CCBEC7A629044894FCFAF aac8jr
967,781,482 *64E4CAF970BB8017B972D5ECC95402DF83A16BF7 aac"8K
967,781,483 *64E3AEFF9F9575D0322FF2B290807758BE96F9FE aac8.P
967,781,484 *64EE221EDAB28908933F4A48D482D6BB5A9C860D aac8*Z
967,781,485 *64EC1DC681A3C202A8CE1C7770D999947C1E55EC aac`&9
967,781,486 *64E00FE0D958175563AE59068C08074C09116221 aac$,9
967,781,487 *64E139800C90353F20D59411908EB0C11889E8C3 aac9c:
967,781,488 *64E4230FE542F4CF8F29A5BF0FBE8FB78F8D2661 aac-9J
967,781,489 *64EC5843987C57AA5897419BBCDB2A3163EF58A0 aac9Tb
967,781,490 *64E14997F242EDFE090CFB3241AFFE35138AEDCB aac9v{
967,781,491 *64E608E15B8DF06286922B668DE34E0094555406 Aac#A
967,781,492 *64EC7DD12ED7EBD9F3E8B060A4A664F085643782 aac`A"
967,781,493 *64E41C69FA9C749E999A4432E6239BD8D25D9F44 aacA`.
967,781,494 *64E819818E232062CF7CD02BB71AF5864F72485A Aaca1
967,781,495 *64EBCF500379FBB58AB78483202E5F2F14454902 aacadmied
967,781,496 *64E8083A33896E3BEB49F5478312A2341311F667 aaca}G
967,781,497 *64E0946FA1E77C1AF5AF2B96D43A6C18A6112C4A aacaS<
967,781,498 *64ED6F88E6BDCDEA0AF9BFAE47661DE7420BED7B aac(b*
967,781,499 *64E0A33F86E2334812AADA996FE7CD849FDF7862 aacb
967,781,500 *64E0847EC819D8E205C8FCD90906D3B87F521CAB aacB2P
967,781,501 *64ED958EEC426BDE7B1BBE8D59AF5FBF00D1DFC4 AACBi
967,781,502 *64E42937C384F130EB36F48163EB34AFC556CB1C aacbQK
967,781,503 *64E6E32E8855FE37FCF845C5FCDE0E50483A25AE aacB(u
967,781,504 *64E73E9C7EEDC754027408555CAE48021540F28A aacbUm
967,781,505 *64E02DF635009A2CF0E6FE8EDBEDEA420C325763 aac_[C
967,781,506 *64E92F70731BA1BBA378E3973CCE613C2FA672F3 aacclaims
967,781,507 *64E1106F2388777296DC9D90A9BDB694B6382924 aacC&P
967,781,508 *64E2D42BCAC9168AD4406CA21B2E8B9927A3588D aacCpL
967,781,509 *64EEED0DF994276782F56A20BD6AD52E31F89C47 [email protected]
967,781,510 *64EA34C78C8B16FDC86725A062EEA2951A6B8E59 AAC=D
967,781,511 *64E4F40CFD01551320AADE2306DB408B0E133644 [email protected]
967,781,512 *64ED3E5578112E69C838DA27D9B27D12C53340EB [email protected]@d
967,781,513 *64E5BCD1CD038E2C46A9FA2B016C9B4697F0D828 aacd8$
967,781,514 *64EEF203AF0240E642F6383D0494CEDD434153E6 aacdc^
967,781,515 *64ED829FE5F923E7F9D468E2849E4FEB4CF2CE56 aacDcZ
967,781,516 *64EF67033F94C715F453E21D7CB0E7BE536D6681 aacd;k
967,781,517 *64E0A9F27D8F1AA14F0C556B076B32FB62B5CF83 aacD\V
967,781,518 *64E05E9C69BDBBE97715A2172DAA3C430C135D9C aaC%E
967,781,519 *64E56B7801887015251272511FE5130AA17D3856 aacE1u
967,781,520 *64E8A942F24BB306A0CD4C683176DBD157F50C01 AaCeb
967,781,521 *64E703F5121FF1F2222B41942C994100DE579242 aac;ec
967,781,522 *64E49A919A097DF1467BCD62CD49BE35D310007E aaceE:
967,781,523 *64EC5F3DA772EA18D40C91319A991ECC983C4138 aaceoD
967,781,524 *64E75DFA993CC8751CD88D94983554CB6A97B85A aacE%p
967,781,525 *64E5FAF6581D5230CA5FCE54AF82C9B440BBAA3B aacetX
967,781,526 *64EAFD13D3EF9AF34CCAF1D5673ECC1AB90F2FF5 aaceZ(
967,781,527 *64E9B561F32DAD5B3A57F7E4718363BA7791A741 aac{*f
967,781,528 *64EA33E2D4B6F22599BAC2FDD08F7DCCA84376A4 aacFaU
967,781,529 *64ECCF91CFAF255AF59D019BAD0FFA380F46A88B AAcFB
967,781,530 *64E0C589EFD675407FB97360C6E3E3DA5F64895B aacf,e
967,781,531 *64EF921C7536C2572020F5CADF0ADA4A10C63BDB aacFF[
967,781,532 *64EB49A879E02572C7B60DAC006161648D5E334D aac;fH
967,781,533 *64ECAE5445C93D6348227A6E7C1D59A3B009D98E aacf~j
967,781,534 *64EA0AEE66971C47CC052FC6C6E7CB6F57FCE0BA aac(fP
967,781,535 *64E1378C470C085ABA798EB0EFC4E3A583EFD627 aacfzQ
967,781,536 *64EC7105F7DFD2B41F8C46F59071D32EFF2463C2 aac(G(
967,781,537 *64E10BEC48BE8515BB889A2CC4E1E4610AB074F0 aac
967,781,538 *64E3677416ACC54374DC1CF8FCCB617DCC444056 aac?GN
967,781,539 *64EBC7843D00F893F32D53A52712E9B03EF1BF6F aacg%t
967,781,540 *64E07765C76C1C078509F2EF91776BBA25F71070 aac,H!
967,781,541 *64E102CAC98ABEC605564EC770080DAAC492D432 aac
967,781,542 *64E75B2CFEAB38BC1BEFDB657A529E46F17DFA73 aac}h^
967,781,543 *64EC13FDEC56E868D4C1E788CDE30FDA443228C6 aach|%
967,781,544 *64E982E4CC4D734FB79DF3237D7859695FB3219B aach:
967,781,545 *64ECECDE67EF74753F9B93F3E6B548FB05ED8E9E Aachaaryaaed
967,781,546 *64E55EEFF9393AE0B9A81DE5515692D89132DDA4 Aachamaniiyaming
967,781,547 *64EA363DA251A88E29B5FCE90E2930044CF8140C Aachchhaadayetaam7
967,781,548 *64E5D3CFEF1EE5A7AFD5396788E54ED221886251 aachen.jk
967,781,549 *64E12C7BD850CFC84DDCE0D0B45E826CC2EC5B26 aachiirne0
967,781,550 *64EF880508F21AC66DC515FBAC62E9FFD309C897 aac(hr
967,781,551 *64E7E647184C5AA1FD5804BFB287E61106394FE1 aac\Hs
967,781,552 *64EE57D20524E756F25391139F1E94ACBE65911F aacHsv
967,781,553 *64E8DCBDA88A65938E80BD967C25F481BE13E2CF aac);I
967,781,554 *64E8B781C1108B5274D9BA47C9ECE0ED0696A712 aac%I{
967,781,555 *64EBF4AB307B3D89B45D24844354128AABB524DD aacI{}
967,781,556 *64E88DC5E1407BBDF2E0A3C0F272EB40C5C18EB7 aac';i
967,781,557 *64E74A830665EDC6A681EE8AA6EE7390C5EB45DF aac)=i
967,781,558 *64E20A99687584996E508986AD54668FAC8A7936 aaci0>
967,781,559 *64EFA37527D21F33021C6EDD1A7DC0D7D8EBB203 aacir;
967,781,560 *64E0E50120E3AA7C5CF89EC37EDA8B7A784C5633 aac$IY
967,781,561 *64ECCF708CB72B1DFB38A8440C81A3364FEE2091 aac_J[
967,781,562 *64E1B3F8F23F82D5F418C4830E2C17D61374A20A aacj5a
967,781,563 *64E70A17A2AF730F1CD94E2641909FCE82F47D9A aacj)f
967,781,564 *64E428F16B9AA423BD1F7FC342A7E0D2242471E1 aacj*R
967,781,565 *64ED01F36C5FC8A167B342A30784A3E99FF9002E aacjSJ
967,781,566 *64E883361722D1A8850EC6BBAA5E944523F0ADB0 AacK/
967,781,567 *64E3C823115A7BAA88C65235922DB3E4249EBF5A aac'k2
967,781,568 *64ECEA1401A5DDA9890C65A5FC48ADF2EBCC9EC2 aack7!
967,781,569 *64EBEFC7F3B776078FF17EE59F65A500C79CE905 aackAK
967,781,570 *64E77BAE81CF65AE99AAF7D6C9B55654244E60BB aac.KH
967,781,571 *64E620C03CE3D27051D53667A51D303B493F06D3 aackKR
967,781,572 *64E4270BEFC84C05007046C764996531D6853215 aacKnO
967,781,573 *64E2ECAFE8CA70354CFBD8DBF1CF67C633048E47 aacK=T
967,781,574 *64E574506D4D8231139CAAB71D5A9511EDE9BFD2 aackwB
967,781,575 *64E5591FF5591A3526BA0D254FF9302B0B8AA6E0 aac
967,781,576 *64EA9A9A0F18FD18AE6B4E9E7EEDAF1019A4A25E aacl'
967,781,577 *64EE310B265CD6E0789AD4B65CD6079339346645 aacl1C
967,781,578 *64E4E0144FA5AD08F1CAC2D468041B6383A35F64 aacLb(
967,781,579 *64E85F6BE29C4752CD0AAE297395A52C692F6418 aacmHr
967,781,580 *64E3F690C534C59B599CA9B719D130D6CE115F08 aacMOv
967,781,581 *64EBF2E80CDC4B057FE56E6EA91A0FE88E882F50 Aa!cn
967,781,582 *64EF8A0421E8F23EF696CE24BAEF62B73A8065D8 aac^N4
967,781,583 *64EABF9C3154246095B9A763D46F9F468412AC03 aacNcu
967,781,584 *64E44290067D2A12865A3721696572A04CA2D4B3 aacNg}
967,781,585 *64E334104898C8DA23F069E89B41BA5E233FC4FA aacNQB
967,781,586 *64E0370EB3B5341A352A624B15D8074D781DB06C aacnUE
967,781,587 *64EBA26E91607EB6122055A459B57DB68DB30587 aac,%O
967,781,588 *64EEE1D81E7D9411C7899477252E9C60F74AF936 aac\=O
967,781,589 *64EEF4F5CA9C6115CC9EC06B6DA5A00877D8D6C1 aacO\|
967,781,590 *64EEC15A274DFEFABC6D0239A4E01709EC68874E aac"`o
967,781,591 *64E69FBF3B461A4ED51AA625A158021CDD55B411 aac*o)
967,781,592 *64EB5C81800808FAEA8C8B9D7CADF2CCB41BBB1D aac
967,781,593 *64E120022A75A5FF7B2E89F93D603B6F425C178C aaco
967,781,594 *64E445E8DF8011B06ED269C6507DA094DF5879CA aacODz
967,781,595 *64E0867A3C4AFAADB29EBC052793B3DAC5AB24F5 aacOg?
967,781,596 *64E4F99EFB92B6CA5B4EFCEA07CBE01D814DF65F aaCoV
967,781,597 *64EAC654005E20FBF58F9AABEB260DDEE16F7678 A.aCp
967,781,598 *64E88EF0AF49D16951A508558B7F5D9176F3C069 aac
967,781,599 *64EB04162AF19D6AB5619F85195A8A69EBDA0C60 aac[p}
967,781,600 *64E86DA35188D5CDDB841D674293E79E5230B0AB aacPA"
967,781,601 *64EAA99CE51F104FD64FDCCDAFCF2FB9A601FF6F aac]PD
967,781,602 *64E8CC19CA0BDD2718E34DC626B8ED6B1F1C81FD aacq="
967,781,603 *64E0E04AB4B85D2461A2CC13895414672D77FE1F aacQ5F
967,781,604 *64E63D19ABE063C779280D0D6EBA260B6E384E35 aacqcW
967,781,605 *64EF8D28AB71E1F874C226C25768B75D02EDE3D0 aacq/J
967,781,606 *64E753AB52910AB886A59E0C84C622A40F1F13F2 AaCqn
967,781,607 *64EB9B4A1DFCCA6DB374FB41B8777182D2243C7D aacQ&Q
967,781,608 *64E70CFCB9AA3B359E20E8AF33636314219FA78A aacqqj
967,781,609 *64EB982919475AB4C9AB62DB50FE596922BD9C2B aacqWQ
967,781,610 *64ED181C58BFB1B1E1EC91FB60FF88A86AD4830E aacqz(
967,781,611 *64EEED4A879EDA1508BC679701815AF333408E78 aac+=r
967,781,612 *64EE24619C5793AA97F6B2262A861E1D063C0F5B [email protected]%
967,781,613 *64E81AD3A097302AEE497C7D67D9FEA5FF2BB9FB aacRAF
967,781,614 *64EAC4044AFEB3DDCD59D73A6CE7AB53160A81BD aacrgh
967,781,615 *64EF21FAC4F897CBB472165E67E7CAD50B3655F8 aacRiq
967,781,616 *64EBE157332AC244C4E5742A2E06A44EE91E74BF aac}RL
967,781,617 *64E28252C488CE8FA1174A15BEE64BAEADA97944 aacrLc
967,781,618 *64E0BFE6E84FF709F9BBF09F8B18E28BDED96C50 aacro{
967,781,619 *64EF683AF275FDCD939EC90862791E211A740428 aac-rp
967,781,620 *64EC7113CAFC1515CBDA9B8C79772B7BF7C6A2A4 aac^Sb
967,781,621 *64EA2D44C73FE5DF997CB00C4A80F399F10B796E aacs`F
967,781,622 *64EA31D4250AA9FBB08D3D08C8C9CC3E0469AFF5 aacsp
967,781,623 *64E084BA623ED88522822F4F366E04AA9EBC54F2 aacT\
967,781,624 *64E213A1B6BF61069794B0C5E5A9EDA05A268E8A aac'T1
967,781,625 *64E0F88FEE7BDB7C42B1A2034B2F49CECCB23CBF aactataagccaagcattttattttttattttttattttttttgagacagagtttcgctc
967,781,626 *64E0C8DEBD6D21117FB560389E68EF0F6F359B5E aactAU
967,781,627 *64E230C5E05FCF33900E1B7FCDBBE4CB59C702A9 aac[td
967,781,628 *64EDFDDB4F69091DEE6497FF8982ED16F5077535 aactN6
967,781,629 *64ECB6FEEC72A796A86F0B07017B34561FBD1FE1 aact&O
967,781,630 *64EE2D50A5BD6322679867D931952BD486BB8B3C aacty-
967,781,631 *64E756EB0D50FA46107A2733447987534705A0F5 aacTyn
967,781,632 *64EAD1E6FC8DAABFAB1B83BFD9FFF962102DA474 aacT-z
967,781,633 *64E22F51F23458B2E7CCF9FEB7CE0EC1B854E670 aac.u{
967,781,634 *64E19FF643FDAADB3A76CC792F6A170BB7AB3712 aac.u3
967,781,635 *64E2F79E855DE70928AB42FDBFEB3B9BAA99490D aacUag
967,781,636 *64EFE856CE7E067994908061253F7DBEC20E5309 aacug6
967,781,637 *64E88589F27C486D28161B822CE4FC8D44E4FC67 aacuy`
967,781,638 *64EEE75156453AFEF5130B263154088C48B67049 aacuz!
967,781,639 *64E4BD257DDEE2F73823EC20BCAB01061F971E95 aa;Cv
967,781,640 *64E5F1C82DCBA79328FF3CFCC5B76383BBCB15E1 aacV>7
967,781,641 *64E9453CE57F6845656A89E23A83207CFFA17D5D AACVEd
967,781,642 *64E346B16AB4261FE58A2C144C8D30E386D83C43 aacv*G
967,781,643 *64E9E34E65EC89746CFA60CBA5B018011DA3E785 aac&VR
967,781,644 *64E4BF73E8AB4260BFB3C1F5424B727429B6A288 aacvtk
967,781,645 *64E2E43561045DA57482BEC616D4F4A459CCBCCB aacW],
967,781,646 *64E3532F899EC7FAF7EE427F4CEDFA10212EE32F aacW]$
967,781,647 *64E9FA31F0BF00A9717EE53AAD1242912E1ED9AD aacW$#
967,781,648 *64EE78E34D5BD9087A1809C55CC66F7BE5B5713F aacW9j
967,781,649 *64E35416F4E20371F87B0AF5BEDD17081FF00E9B aacWBf
967,781,650 *64EDED9DA54535EF83622A2998B5C05370B365EC aacwe;
967,781,651 *64E0D756C6B041925897016EA97FD3B44B1929A1 aacWea
967,781,652 *64E4071C50A1E053AE78821D5280FCD513754D61 aacWL^
967,781,653 *64E2ACFDC7C57EC00F740751CF6C4FFD9C3D8D52 aacw'M
967,781,654 *64EE3A7E099F76EE4648A26B56FF285701BCF62F aacWmm
967,781,655 *64E564859489D100EF0175D2B8EB7D1A39D8AD3D aac]wO
967,781,656 *64E130086F00A17E3C68D27442E241C829410817 aacwuy
967,781,657 *64E008333BF9BF8C636F08D69A548914B589B954 aacw<v
967,781,658 *64ED8AE21FFD2F5138956D363FD685AEAE84A5FF aacwwa
967,781,659 *64EFE3E6638A4BE066E0C5AE8DC5CDA176B24596 aaCXd
967,781,660 *64E5CB2D35F5CF42E7A646D8BB0C0E47598AC5D3 aacXjH
967,781,661 *64EC582131BD204164E7D6749C9BEC0CE9FD621E aacx~v
967,781,662 *64EBA78FFF3B6C89C7A297FD0AC6F12AB055C56B aacXwQ
967,781,663 *64E3D6AFD8F2ED9CAC577015E60048A9979AF4BE aaCy/
967,781,664 *64E79D1946D47964A2219A65EE483F82DEB3E5F3 aacy2P
967,781,665 *64E68B86ABCCFD4056EECAD55B825B9497923BC5 aacy4l
967,781,666 *64EA021B85A70B5947A35C5BE612D871439F13C0 aacYbo
967,781,667 *64EEE4949C24D1A51E77BEBCB699E4BE87A77949 aacycr
967,781,668 *64E1F46FA2089B5EAC79901B0109889DF95F6654 aac,Yj
967,781,669 *64EF4CC4DBC727BDD119CE33308A907DBFA2A7F4 aacYtx
967,781,670 *64EB18373FE5E512442E3B44B9E48CD4591DCD2D aacyW;
967,781,671 *64EC988C1A8E3D3A94FCD9CB3470D27CC9C08E0F aacyYk
967,781,672 *64E3A1460C1023F2156DD20C4E24AAC45D40C0BD AAC"Z
967,781,673 *64EC347B6F178DC3CCCE7B315E311F6120C0F1CF aac:!Z
967,781,674 *64E731DDC3CD3D72D1338C61A69D4E4344120A8D aac^z!
967,781,675 *64EC380CE5277FAC5CB16F0918EC0260009A2C9F aacz,\
967,781,676 *64ED0D7AF642ACD0AEB89E66FEFBF3A79179F62E aacZ1$
967,781,677 *64EAA7B8CFD2744A076AC347CD2D15B8842E77C5 aacZ7V
967,781,678 *64EB738347B9C7CD992C7ABA7951680A280A3093 aacZHn
967,781,679 *64E4CBDD01B6B97B8DE95F620E8C3BBAF505C59B aac/zI
967,781,680 *64EF1B86D022B25826DBD37F2671904432259511 aaczx?
967,781,681 *64EA2E60E84D8A6E7120F9EFB80DFD6ECE590A01 aaczx
967,781,682 *64EE6B1ECA50524FDF91C069903C4A24C3ADFFF2 AA,D]
967,781,683 *64E1F2C5F91971BCCB740291356681C413FA0362 aa.$D
967,781,684 *64E3F6F2DB8469CDFDC5E4C0D276027A2AE644B6 aad;-_
967,781,685 *64E4DB32037016A6666210DA38F8B041BECF0F54 aad'*^
967,781,686 *64EC21D599845AAC45A9F80F4D3BD3560D76B1C9 aad
967,781,687 *64E50E46A92840B69AD08732D6FEA885390DAF8D aad0^^
967,781,688 *64EE1A99CB834534C2AF42C6772B16C71AA7A1A8 aad]01
967,781,689 *64E91886D2988EF1930A7048DDFC71966E086594 aad0ru
967,781,690 *64E0ADC30CF3594C48320A9C121921525490BD5C aad
967,781,691 *64E6B846C9E5110D559A2AEE4270F1986D3F0B64 aad0w~
967,781,692 *64ED20DF4A73A39F9AEB7EF4FF20197318FB933F aad0YM
967,781,693 *64EF08E119B8F5A0106AA6F4CACB3C31BF27037E aad/*1
967,781,694 *64E60425DE9E608A9EBDE7E9535ABB5F3DF2BA9F aad1![
967,781,695 *64E3F402EEF0A4CBB0D5E8669B63611203C323C4 aad1bR
967,781,696 *64EFC05F037EE08470991CFC7047EC152EAEA942 aad1g7
967,781,697 *64E7F2FA4D9BE6B00AD95F6659A1F50CEE5A380C aad`1j
967,781,698 *64E1372F69547446A562462DFCD2FA77CFFF14A0 aad1,M
967,781,699 *64E689916BDF815199067E3003F17E80126ECF1E aad1X2
967,781,700 *64ECCB518616A840AA20747374006A907E81F121 aad2?i
967,781,701 *64ED839BFCC12C07BDE0B8BCC3B392E4C9D6CFC5 aad2z:
967,781,702 *64E7C23411A2B1197F7EEE83148CE5001A608852 aad'.3
967,781,703 *64E01A09F4C3BA5823B482C979506F5E29FBF071 aad335
967,781,704 *64EA9EA5000B4C2330B0F3DA10C44FE3775F6D51 aad3B'
967,781,705 *64EFDB0DFCFC763D7BD173901030AE85A753F142 aad)3X
967,781,706 *64E23AF6BE5AAA0C9B57C44B84AB2CBDB0B955DE aad
967,781,707 *64E1D17548D70C16446BBD7FDEE824C144BDCA4C aad4{d
967,781,708 *64E4CBE7E4D5457293022597F420BBE8CD017399 aad4H%
967,781,709 *64E424C934A8AD3AB1C0B7A7B23C22516067DAED aad4uv
967,781,710 *64E50F9891A89289C26E219CF847118CA93F3BAA aad5h,
967,781,711 *64E585DD62FAEA6BE85B7253A2CE73E5418B77D0 aad5S[
967,781,712 *64E95932B4AC3846C65A4DEDD64F89B5C08874E4 aad5U4
967,781,713 *64E8F35AE41F2810975602078E072063615AEBA0 aad62}
967,781,714 *64E6DC8EBFE758B9053138EE898FC1193C1EFBCC aad63W
967,781,715 *64ED822A3CEB18CE3FF9CBDBD2AE49180DA9D0EF aad\65
967,781,716 *64ECD4EAF0E419ED456F70C1965673AB9DFE0D5F aad6k_
967,781,717 *64E15EEDEB7F1D0312EFC311FD15D81F82EC24A3 aad6pt
967,781,718 *64EBDFCF93254AD2D1288D1D5062912ED2DFD0AA aad6qE
967,781,719 *64E8AE08A1B66C30FA33956A52338750F2BF8EFD aad{7.
967,781,720 *64E347D52199AD9502B60FDAADE555B439FD577F aad70l
967,781,721 *64E6C5B1867A4941AA79652BCFE6D3A51A9795E9 aad7}L
967,781,722 *64E197DD03D360793919D99E962CD55DD61542E9 aad7:u
967,781,723 *64EDC2FDA7EFF887C17C80719C2AD800F71B0708 aad-8=
967,781,724 *64E2C38A71BF009757EF91621C98F9D4E1EC6517 aad?^8
967,781,725 *64E3DFC9C51DF7C107CE554A4E9B6C0923B1929D aad8]"
967,781,726 *64EF3A5DD71A6F15A47707879B92EA5A5D96756A aad8mx
967,781,727 *64ED47D73AF6E355EF3A1321A98379E33E6E7160 aad^9-
967,781,728 *64EC372E3441A5535A76F76C6D17A117354DE219 aad9/[
967,781,729 *64E760D3981A5EFF8DD5D162BA9B392BF04AE377 aad*9K
967,781,730 *64E0C484609DF70AAD34825E4AC45200AA462DF1 aad=9l
967,781,731 *64EC00BFE5DFCF516AA7B410913F34B875939AC2 AAd%A
967,781,732 *64E238E62033D719376B9605C0DCAFB260AD9AE1 aad.a<
967,781,733 *64EA3A3955718E64181C8D07CA9774AE71ED0BEA aada'>
967,781,734 *64E7A9E5D13F45D4D4825C6E93D58FA160AF6132 aadAaB
967,781,735 *64EE3FCA3F66AF1B8A5A4662E0E5C6CC0400E34E aad\ae
967,781,736 *64EE69C590B60E224F0EED545388601498E7F607 aad}Ay
967,781,737 *64E1B6206775AFE625ADA0DD0924F3C6A14F9143 aad+)b
967,781,738 *64E32DAFABD7258FE08C2A9D7EA837B0D7CFE4B6 aadb,/
967,781,739 *64EDE37A379B593ADF9C878F922592E67C802065 aadb.=
967,781,740 *64E2D017C8955BF7366A05F6EADEA68F23F9A7E0 aadb2!
967,781,741 *64E1C06BBCDB7EC1D596344E262E0D5117916076 aadBC[
967,781,742 *64EE8BBEE82B8E10A8575BC5EB32801D2B19F355 aadBnj
967,781,743 *64E8472E19C2DF271509E66D40337095BC1EB872 aad?bp
967,781,744 *64E9C6A2DEFB64F7531AB3706B30BF31834A8764 aadbz)
967,781,745 *64E349844B09066FF7DD9768A5A9CF64CB370863 aadbz*
967,781,746 *64EFD0F35A163B5D989D122650DCEEB0E05425F3 AAD#C
967,781,747 *64E58699DAFD4218A2F59CF51B37BD2C3C6E93CC aad;c,
967,781,748 *64E956B27878C9891AFB7770DE15702C4A5CB905 aadC]1
967,781,749 *64EFF649A904D14F85288953A3357377C407077A aadC"D
967,781,750 *64E06CB44D795E3C3FF1CFF9124CDBC96CAAFF59 aadcdR
967,781,751 *64E31822C6B696D34FC5E367040CCDF8062E15C8 aad-ch
967,781,752 *64E944DD2062D9CEE9DF9AAB738760ADA840A7BB aad{CL
967,781,753 *64E09646ADA60D7E28245C43C978BF09EA28AE24 aad"]D
967,781,754 *64EB637B399D4AC76203F8781058882CEA7021C5 aad"D|
967,781,755 *64E594955B376B09BABC2E935F2583B0F19EF193 aad;d&
967,781,756 *64EA166833B1B1B7250668820B2823F1A621A1F4 aaddO:
967,781,757 *64EBCCFF39991734F35B0E6895C2A373FDBB4BFE aaddtu
967,781,758 *64E4BAED84356B12C7C3C63476EB055FED3FC096 [email protected]?
967,781,759 *64E317208FBBEB778029C4BBD5AE94CF160B4807 aadEDn
967,781,760 *64ED84C12F494F66B38CC634F88ECD5D19683DA5 aadeGO
967,781,761 *64EF72731E70DE2E7E21156EBCC89BAA40446B54 AADEJRS
967,781,762 *64E047C166E1FD9546D80F37AD7C81CC82EBDC5D Aaden399
967,781,763 *64E6997D6FAC5E99682653AAE50E4C1D1C94F226 aad;Er
967,781,764 *64E8F387E3D3E1422E162851E1F1B351C4D3EADF aadeSl
967,781,765 *64EA6A9ACF4B2943EDA1F2F40E9F6DE5B61850B8 aadev!
967,781,766 *64E589E863ED085A0D55A4CE5D18C61948A61209 aadew0
967,781,767 *64E8E15E14FCE70E58200371178E07055569EFB1 aad/\F
967,781,768 *64EF99A9D794BB451347AEC08FD6FB5E481160C6 aad[<f
967,781,769 *64ED101E47121835357A9F20461BDB97A9EF15CD aadfFA
967,781,770 *64E464C11913D57B8F158E2E6ED4A736D6973496 aadFFk
967,781,771 *64E5FC51E5112C171807D0A8F833C8B2F9EB5338 aadf|R
967,781,772 *64E9556333C7860400CE77DC764AD61333706620 aad)Fx
967,781,773 *64EBBADBC7611084DAB1B682C70F71B9239398F0 aadF(z
967,781,774 *64E01B41CD2C8557782B158022DA983494CF819A aad.=G
967,781,775 *64E3D548254B37163885DAE7C6ABC8943950C08D aadG/'
967,781,776 *64ED5247534B9542DE8A31893D69DD8280C32888 aadg6m
967,781,777 *64EAB42D0D4BE49DC1CF4CA9845D8E798F6A519E aadGiY
967,781,778 *64EB8AA63EA901443E8E3ACE48B1CE72F9FB479C aadg%p
967,781,779 *64E875703462EBC688FC43274A78712C51859721 aadgTk
967,781,780 *64ED524AB046C8432451DBBDD5252AF58E5EF3FD aad"GX
967,781,781 *64E6EEB12B7FE93C508211077F759140104372C3 aad)[H
967,781,782 *64E26766196083F1CB731B86AD8C99F160D38A0B aadh8
967,781,783 *64E1E012EDF3C1FAABE5DF321D175B42646E6E4F aaDhaa
967,781,784 *64EE13D614714771A8492C15F3E435152630F7BD aadHC`
967,781,785 *64E61AC3EDFD36B794472DDCF1907B9E4D6D3A03 aadHFK
967,781,786 *64E2B92724DEBC4039C8579C71962CCE9333EF2A aad{Hi
967,781,787 *64E133AECE67A2D9EC2A24498D2B39E270A3C7A0 aadhIB
967,781,788 *64EC980A6DABA16A8976EC579DE15E2D0B4DF837 aadH=M
967,781,789 *64EC927CF739DCCEDEB6EDA80AD939389AB91E59 aadH|t
967,781,790 *64EA673D515B2596C86DF54E856BCEA25D435F82 Aa,Di
967,781,791 *64EE2DC157CA9C0505FC018EA91B1249E19E384C aadi5,
967,781,792 *64E8185DB0E84E21311FB340ABB4CF6BF88268A4 aadi)B
967,781,793 *64E57F81FEE62FB04778B4A5E24E51A3E85DD583 aadihr
967,781,794 *64E61100DEF43AC1114C41D6CFCEC2E08E1B96B7 aadIJj
967,781,795 *64E2D5CDD6F55248B4145335C89CFD013AD3F378 aadIpd
967,781,796 *64E471458FFBBE7AACFED40B586B88601F42B01A aadiPZ
967,781,797 *64EF3D37A0F0C0041D1CE87AA6CAC0409E2DAF63 Aadityau8
967,781,798 *64E70DEBB5CE1B321CEE6A222BD74CF2E40FBD75 aadiU4
967,781,799 *64E4A2DE4E39F3B16F41108ADD6E7C171F86B324 aad[iX
967,781,800 *64E0EA0241846162CCD8FC72ADFA9B9C2E7E465C aadiy9
967,781,801 *64EBAED31973F148D5A858F769431B82A379E6D8 aad`
967,781,802 *64EA9D08CD04E02C487EFB15BFC11EDCD82E8C4B aad$J=
967,781,803 *64EA5A7BC8965E17B232E595C76BCA1AE8139376 aad&J;
967,781,804 *64EE4698030383A81A9B7B88EFABB733F620D828 aad{j(
967,781,805 *64E8A78DE3903E7B9598705398727C5563A1CBE0 aad;j9
967,781,806 *64EED0BDF1CE4618357FBC30E4CD48C4FE6A645A aadJg@
967,781,807 *64EDDD97C3C380A28C3AE6B1EF4E45737DDD2469 aad>JO
967,781,808 *64EA8366964C685BDD1F69E9DA59BE93D669C400 aad=K(
967,781,809 *64E4D41B0527629E39CD9DB638FCDDAEC3B7C13D aadk;'
967,781,810 *64E6CFA7E9447F09BB4E3C0B10307AC63C55F993 aadK!7
967,781,811 *64EA80A367046264B909B79F934688DFB01155DF Aadkaart8
967,781,812 *64E93F66A1B911D532A28DDBD407535D95092A21 aadkgn
967,781,813 *64E53614A82A009BD14BF93F919767425D922098 aadknz
967,781,814 *64E147B33AA12F93971F0E5265F6A3610E61C4EC aadK^v
967,781,815 *64E599E9FDA4CA056F29A7180134365FCCD52ACE aadL80
967,781,816 *64EDE5525C4FE8BB460BDC3E15BF9D8F51625FD7 aad^LI
967,781,817 *64E08F81F084419B9B9CECDAE60B24BC50452745 aadl/M
967,781,818 *64E5E95C99979E2917FE8393E6FAD41B04B92155 aad^lm
967,781,819 *64EE53BAB6054CC151DFA81ED745CD49865A967D aad#Lq
967,781,820 *64E4047D0030CAFD4EFB2B32CE4CAED03C7335FD aadLSW
967,781,821 *64E2F3F645742158A53FF8B230BA8C0EC0724C0E aad{lu
967,781,822 *64EE9793ED94AEE3EB1ACC341A5AB980890F7ECC aad$Lw
967,781,823 *64EFE7F0EFD5B1BA0CCB08A2B9B4B4ED99194C1D aadlx'
967,781,824 *64E293FB41A5B7CF4B7E4F0C0BD0FFCEE34C9A9D aadLxZ
967,781,825 *64EA0C14CDEDFAB22F753414383E1A1DD95564A0 aad`!m
967,781,826 *64E090A1EB9EF41F7346DF9CAEE3FDCAE6AE8899 aad+m+
967,781,827 *64EC8531CD6192E874A105B5F2A354484315B59F aadM5R
967,781,828 *64E7703803B86E608CB47D221FA782746C8E682A aad`Mn
967,781,829 *64E156D971738E1C8E7518F214F43E5A4127C137 aadm!N
967,781,830 *64EA92AA47B8F53C65DA1324B9BAC3262958178B aadM*p
967,781,831 *64E30012B5FFE26AA71795D829FD5970E093F2C2 aadmuJ
967,781,832 *64E9513ABE3DA9D31CC8558DAC3714AE262B3269 aadmzu
967,781,833 *64E53B3550581EA7D41D580AD6713F4DECF377FD aad"`n
967,781,834 *64E457B57981BF579AB619E027C11FBE8A836F6E aad#{n
967,781,835 *64E62920363A422514E86B2F55BB3E2D616207D8 aadn{
967,781,836 *64E17DEDE5ACAF48D2AFADD80F895AF970C5A1A3 aadNaB
967,781,837 *64E10C298623664D591BB6984CC903558123B5D1 Aadnave
967,781,838 *64E7F1098F1AB5289406A7754A1A84728783D845 aad-NC
967,781,839 *64E4A37E04626348205B94BECECB1E8151D36E34 aadnnB
967,781,840 *64ECF2721A743EF1800C9DFC306E3538C51174FF aadnQ4
967,781,841 *64E3A85F56D338AFB23E7C2BE9DB7821BA9D4202 aadnQj
967,781,842 *64EBF860E23FBF775967ACE0E2004C8346DC261E aad_nr
967,781,843 *64E97ADD149666348F6604D5B1BB0A42BF2E0B24 aad)nS
967,781,844 *64E845A71BF5986CAFDB222A067AF948C2E0B2F4 aadnu-
967,781,845 *64E45464684D792CFB4A99763C3FF8190847303A aadNX/
967,781,846 *64E6538EB39BE164D264A05E215C1BC92CF315E9 [email protected]
967,781,847 *64E4EBCCACA3A1A2700C1207839F7FBFE5025293 aad"o&
967,781,848 *64E3B883C7ADF2DCAFD3B03415B93DD5794EF289 aado
967,781,849 *64ECC6C28C200A90F8810ED429606DD747624FCF aadO5}
967,781,850 *64E3C791D963B4128BC4B8586995DB8F8125190A AAdO6
967,781,851 *64E5A58188D34B120E1C4C19E05831FEEABB3E01 aadOEp
967,781,852 *64E07ACE5AE3D639DA98359F33AFD9E8B5FCE25A aadohE
967,781,853 *64E3A8137D30E9E61600B5CE3EEFC402977FA9E0 aadOkK
967,781,854 *64EA425439993DA9A7BA039A331833A5987EF7F8 aad]P$
967,781,855 *64E40559878D920E141B2152831D85A3C0946668 aad,*p
967,781,856 *64E918D5F623B288F09DDFF9053A6701FB00F87B aadP6C
967,781,857 *64E077205E21C8CFE7EC4081D3242400DA3D2A5F aadP|D
967,781,858 *64EED97BF8991A42C033A18D0D1169D9F7F27151 aad/Pg
967,781,859 *64E74429E1F84847F22B29FA69E8E4D2824B946E aadpGY
967,781,860 *64E3B0F2759C0EBA5C8B0AFC3683CD188DCD667D aadPlN
967,781,861 *64EE8B7389E15029A6C1057BBE8EC034C2B6FC8D AaDPV
967,781,862 *64E2C25E59FD17A0D04F8510D39DCEB2E65092F3 aad/?Q
967,781,863 *64E395E734D0DD809A2099B3B2E84A734BB21890 aad"Q{
967,781,864 *64EA7082586D8CA9071F8AF0CE55F12CE4FF2E03 aadq\H
967,781,865 *64E8155B79578FA7DC6C0D785A7F12E4280A4C9E aadQ)z
967,781,866 *64EC6A4F61413536238FC75EA3721702AD15CD63 Aadrain6
967,781,867 *64E77534FCC2CD7B4FA767825BB5D6805B432D47 aadRbB
967,781,868 *64EC3403D2C73BCCF7A371EB3311123B6A8AF7CA aad|rk
967,781,869 *64E9992F1D8B4EE4AC0EEEAE90F7540561FED1CB aadrll
967,781,870 *64EA7838ABB96322636E3B3C48403E243893296D aadr'm
967,781,871 *64EB174EF631469CD0E5A38F6F4F07FF5BB615E4 aadRMc
967,781,872 *64E00D6FAB85573F92D464B0017A87B9BB7E23EE AADrQ
967,781,873 *64ED637E3CFE1E9B52F57545C7B309345113D394 aadRY-
967,781,874 *64EA1089E4602F92DC09C5C18FE76D3F33E08C0B aad:s%
967,781,875 *64E9A182B53481E7E9D8D3F121C79D3C9719D3D0 aads}^
967,781,876 *64E0C1F118F05F33D107EDAB18ECDE1E6B35295F aadS%d
967,781,877 *64E558C853BEC398D9617843BF77B5DE7F09324C aadsfI
967,781,878 *64E48FDD40D56A31EE15BF18666C2897189AA78A aadshx
967,781,879 *64E317936845991E44D7D750AC5A742625D44485 aadS}O
967,781,880 *64EBC2F0227575A665046FEE7F551A0182E104D0 aadSW
967,781,881 *64E7792A41C8C39914AEECD36FBB4EDAA4488822 aadsZo
967,781,882 *64E1CDBC6E0DC6990A09D1A023F8D106554294AB aad+T{
967,781,883 *64E9E8C4575DF25628B9F39720F28A58361B2ABB aad$t,
967,781,884 *64E4C97A643E547ACE7B88E539C69A8607134BD5 aadtD~
967,781,885 *64E4A664DF568B9CC041E7A7740AEC2C652A6398 aadteO
967,781,886 *64E6E4D05901F5C515060FEB2E28812ECD4D21DE aadTKM
967,781,887 *64EC369C30D7E157E432530F2F495FB9A2EAF374 aadtz1
967,781,888 *64E0630249CE93B942AF4A4AE1932AAFBDBAE783 aad]U|
967,781,889 *64EDA6D9D71317417928706F2E0E918C8D7E8E20 aad*@U
967,781,890 *64EF9EDFAB4E9297A69D7713AA29A28A914D3F0D aadU<2
967,781,891 *64E45D7F9D8545E960A6DF9356EC42A1DC7963E8 aadu3i
967,781,892 *64E6F1309F1EEC34083C81B98A6C18C899E522B3 aadU98
967,781,893 *64E422D380D26103E738355670320A903D06540E aad(UC
967,781,894 *64EB750CBB62816487C53D3EB14BAF090E64FC36 aad<ur
967,781,895 *64E129E53A42F49BC9B8C1F911BB32FB66D8D11A aadUv\
967,781,896 *64E25698D74747D19BFBF84320741FF0A3DE0FC5 aad#]v
967,781,897 *64EFEBBD996CA000B33D21FF074F8611AB05738A aadv{-
967,781,898 *64E0B25ED1EB613CC80F9E46EB7F04F57875FA81 aadv}#
967,781,899 *64EAC805F6BD5E1D58AFFFED7BE678B638ACBE71 aadv\]
967,781,900 *64E1BB07C4C5DC6B7FBC4F8E4A59D2EE00C9C055 AaDv2
967,781,901 *64EBE3970125329A2F4ADCB3478A3CAEF4F59794 aadVjZ
967,781,902 *64E6FD69AE8D75A1D2FFD86352D42215C281BAD3 aad#*W
967,781,903 *64EAFA1DC196B7A60595A1AF439F7D46319B9DB2 aadW0p
967,781,904 *64EBC3E238F8CD93EBB9DDCCF19F99A53F265E23 aadW2q
967,781,905 *64E1EC295A763970B99321891C85C6B8046B69C7 aadwED
967,781,906 *64E1CA08D77EEBCE60038D5FDC255F1E3ECDCEBB aadwGi
967,781,907 *64EB861DE3FCE87CDAC43C2FE8306B2322891E0B aadwl2
967,781,908 *64E4F719DEEC755AE37557E371B14C40FABBCE2E aadwrg
967,781,909 *64E959DD5B204B9607E94CC254A5E575A6139F7F aadX_+
967,781,910 *64E094853714FB09C7CCE3DD84E268AB2A7DB28A aad]?x
967,781,911 *64E4D2ACC9A7B570C6D54A0739CA320118FDAD7B aadx*]
967,781,912 *64E871BB8B8EDE097971BA6346E06BE773FBDFD8 aadX35
967,781,913 *64EB06B56DC196BA952A8E2329753ECD181D4610 aad!XH
967,781,914 *64EF01A70910A6044E6FB98B1960765027468321 aadXj<
967,781,915 *64E190F5F0677163BAC2830B3F7601ADF7F3BA5C aadXjx
967,781,916 *64E2897F1F3A0006788A30568D51D0B03CA1E285 aadXq~
967,781,917 *64E5F7636739AA030323A1B459FF07D549FEBF48 aadx}Z
967,781,918 *64E0E0AEC79F8EE7CDFD3538696EB78AC299F30E aadY}g
967,781,919 *64E9D3B56DC528E5CE5B583237BB348192914E43 aadyK*
967,781,920 *64E7970AB91F9C822FF60129440FB38085AAFBFA aady]r
967,781,921 *64E4E2462DD190952AA88F07B8ECCC2A5DDF286C aadYU0
967,781,922 *64E7DB7BE6D3B9C9961256A0B072D965D954DA61 aadyw1
967,781,923 *64EE739F0207B0810E1AF1BC6ADC82583D066743 aad_Z_
967,781,924 *64EBEB658E30E931353974C225C2437244EDAB3F aadZ.#
967,781,925 *64EC3D0477051322D64D8903476C1AA54E04ECB7 aadZ#@
967,781,926 *64E3A00FD70FBDF09F1D997FF2771FE0EF09A23C aad+z[
967,781,927 *64E775109BD695FA7A4AFF33BCA1462B4D65B828 aadz^!
967,781,928 *64E744B6F31F7353B8B0280ECB33EC7C99F01A38 aadz6N
967,781,929 *64E311C358E2221B24D3CFF7301D96990D042A2F aad[Z7
967,781,930 *64E49232E0E5D880136854813F5BD3B8B38AE159 aadZ\c
967,781,931 *64EC528CED07FF6A17C871E6421D3EE001EC0FB3 aad>zD
967,781,932 *64E3CACD9B518857C4842A1765A535F045C5509F aad)ZN
967,781,933 *64EDBF5FADD484B78599FE47925370848ABDCDCB aadZs~
967,781,934 *64ECBAF59FB78558E5A09BE40EDF8207525F08C0 AA=E]
967,781,935 *64ED9567345FBBBE558BEEEC2B5D660B6B11DE16 AA,e
967,781,936 *64E823A94A39E272DDA1D8CA25E95F9B582776E7 Aa*e[
967,781,937 *64E428AE596339E0FFBBE8BDFED83FB0ABE30E2E aae`"+
967,781,938 *64EC089F455E0E1EFD23B12B108064DB311C1FC9 aae~,
967,781,939 *64E97A53CBA8B9A3EBD31788BDACB3231DC6E37C [email protected]*
967,781,940 *64E9E5302D27916939F7975DF08AF260206268A9 aae.{#
967,781,941 *64EC88DBECBCF58472F4CA551CE585B2428758C4 aae"+%
967,781,942 *64E870CC849F233164451F94AD937D6539F184A8 aae{+%
967,781,943 *64E820B4094023E77FEBB7EA0A7A53A816EB31C3 aae$\|
967,781,944 *64E732641E6CA581DCB68CC678B40B6C87210E03 aae
967,781,945 *64E0A02E52F9AED15BDD274ECC4181E5997C54B9 aae0_{
967,781,946 *64E420CCC9D59819BE31E60C622C389DB1DD675A aae1#
967,781,947 *64E57D11B4E5DFEE6CD42A6A08E58BCB3F8E18CB aae1=k
967,781,948 *64ECA429A8DF2351534F2830F535BED7A2CE692E aae1_u
967,781,949 *64E49BB875FA4950E8DC33114B21ECE573D142B6 aae22$
967,781,950 *64E9AAE0C50D8C1755AD7F290D3092713DBED5F0 aae2sm
967,781,951 *64E9FF58FBE5B647CDF9CABE0E97C1CBD3EDE1F7 aae2+v
967,781,952 *64E74E68F39B66524D7094BDF4C07E7B7514B06C aae3}_
967,781,953 *64EDD9237172ADE2D333DF04CEF3BE372464DE22 aae~33
967,781,954 *64E102F6ED851C243E3409F3BD9C6510A5A97AA2 aae3bw
967,781,955 *64EDC7F5F0723DEEA4E21A91D92C69B88608A331 aae3;O
967,781,956 *64EAF20B72BA9C761EAB62B5BD16DCCDB05EE72C aae3o-
967,781,957 *64E8E51F744980B87F83636FD2D51562CDD62BB4 aae43i
967,781,958 *64ED288F99B68B463BCFD96707C7BEB6394DC33B aae4S%
967,781,959 *64EB7FC8FA1E9184BDF1737F6B793C865DC7EFB2 aae66S
967,781,960 *64E5B83934E487F1C8DC5F5FA495EEDF2A7F2766 AAe6E
967,781,961 *64E75A65A7938D6E7E0366FAD7C5CCAB74754353 aae7{I
967,781,962 *64EC7815432F217B3CA944944E5B77DD54AAE040 aae_8\
967,781,963 *64E2B3AFA8930210C06F9221C16D3059591A55D1 aae;86
967,781,964 *64E8B1E666D506FE7255B0EEA69096E057989BE7 aae91?
967,781,965 *64E6C0D402F290ECD5B91B6560A34DA7A952352D aae=9s
967,781,966 *64E92005C2D465DFDCD5DB112B6FE562BA4DCC2A aaea\'
967,781,967 *64E4537018484405B7886F44CEAFCE6DEAF53FF4 aaead<
967,781,968 *64EB18CD9C6ED48A0D192D069ACC9D96BA33CF24 aaeA&G
967,781,969 *64EB5C925FFD861E42DA0979238BFEF9CFE6A5E8 aaeAJI
967,781,970 *64E52C6FC24C41D4065BDD8C3E2644481E5386B5 aaeaZp
967,781,971 *64E6235166A13B285B5F05F8E12F968EDE3A5866 aae<_B
967,781,972 *64E4CD0A8B2D07EA27F46DF8EE9C2C957D976924 aae?b~
967,781,973 *64EB3C0012400AB64D50EBF4B89D59E84E74B66A aaeb]>
967,781,974 *64EF76C00F5494CAD3E7C35F639005AABBCD02CF aaeB3W
967,781,975 *64EFB8F624F8EB2D808F0C6D2BCE0FD41FAAD00E aaeb9i
967,781,976 *64E9D6C4BDDB99A0C8F306403A183FE51225E5DC aaeB>A
967,781,977 *64E408A6607DA8C030F010B4E0F91044E0C5A36C aaebj
967,781,978 *64E5A64490863864EC48E8F087092D852C630E74 aaeBOr
967,781,979 *64ECAAA1775264C3906DBF1150E8DCE38AB76F23 aaeb!p
967,781,980 *64E764D20E90678BBB2F3E62DC32236C345DA8F4 aae'BQ
967,781,981 *64E11D5F9F9C34FB18FF44DD55DF3F59C93C7773 aae<C/
967,781,982 *64E76597880C8A2120AA72172BEFA0326FBA5780 aaechE
967,781,983 *64EE1586C90E6C17C36130007CE5869B005E8216 aaeC]o
967,781,984 *64EC2FF3D8DB3B7021083A1B093A2D390A63AC5E aaeCR
967,781,985 *64E055AA1F31CCECA84181C3318B1E019E573B85 aaeC,u
967,781,986 *64E00992F7BB902437E8833388EE52F12539B281 Aaed$
967,781,987 *64E30275D6BEB02E70B5CBC9AA85B3CC4EF945FA aaed0/
967,781,988 *64E5B470769A1CE9F915B04AF0DF356262B5308A aaeD5{
967,781,989 *64E37C005AB2DF4FCABFB6FBCA8A0C6C61768D7F aaeDBi
967,781,990 *64E610B1569A509CF0DCC7A0994C13B9AB8A84FC AAEDHwXwAAEClQR
967,781,991 *64E6FEA1F799586D0A7DA51FCD51915DC5F66CC9 aae+DI
967,781,992 *64E35268C76545337AB58BE483335D60FA1185B7 aaeDoN
967,781,993 *64E74171665206B4B2358BDEB2F439F20B90C800 aaed:r
967,781,994 *64E52E0710B8963DF27A2120938924356433F799 aaeDUs
967,781,995 *64E9CF702DC1633F42EB6FAE80237354822DAA8D aae:DW
967,781,996 *64E770EEBF255AF4CC8EF75D9592F6662D334CFE aaE?E
967,781,997 *64E19698A9125F01364EA71734770FCFC12819C9 aaeef>
967,781,998 *64E78D570AFFEBDDF948A2992E2147DE3BF97DEB aae-Ep
967,781,999 *64EBCDED583F8996F6C865BBD4E4E7E35FB32709 aae}Er
967,782,000 *64EAF58488160AD0D6C00362B56A032A2DA853A7 aaef16
967,782,001 *64E7CC489F3414E3F1FA42F2C5E3BBB2D0330BAA aae?fB
967,782,002 *64E5704AAC7177AD1F6452574ACF3701746B16F9 aaefCj
967,782,003 *64E56D8111CE0363FAFC9465AFC9C8A46EC7F539 aaef|E
967,782,004 *64E423497AE15A2BDE56187B9F688B280969BAC9 aaeFj-
967,782,005 *64E8E772D4CB6C38200419B054F8938CDD6A8C2F aaeFjG
967,782,006 *64EBF520EF8563CFFDFD3DAF75244EA40EB22B00 aaeFLB
967,782,007 *64E8FDAF78EAE5D9EBC978AE6838ADD7711C072E aaefMR
967,782,008 *64E6A83EBDDCF5C67D5DD1784CC61B25CF1A7825 aaefx3
967,782,009 *64E08B670CA51B9DACD858C893B95C0502DC4579 aae,\G
967,782,010 *64EFBA3A4E408435BA4042DA79D61D6E87D5ED22 aaeg!#
967,782,011 *64EFAA5A9A8D4D0CE1F68B2208E71FC62F719B58 aaeg8:
967,782,012 *64EF11C4AE2064A4B3AA0F0BB1D6B695690FA510 aaegBV
967,782,013 *64EB89C6C76B08340FD9917A3A8F0C1529B649D4 aaeglq
967,782,014 *64E8BB54596B33996C4D284724371862D8ABDEDA aae{@H
967,782,015 *64E168A2F3051C38B6AD263C1D8D4D4D471C9A05 aaeh$^
967,782,016 *64E9A3BF5373262A82BC6F5EB2B3FE53835CA3AD aaeh,6
967,782,017 *64E57C4199EF1DBF331E98AAE9B461593EFA23A9 aaeH6E
967,782,018 *64EEE94750F00ED030B36C4DF7141EB7AE923135 aaehk>
967,782,019 *64E4D3896C0BAC1DAC2BDD7B14E79FA836D313C1 aaehPy
967,782,020 *64E3E1EE992A25043C1059D2FBCFD80F6B4DA287 aaeHZ
967,782,021 *64EC9AD753AA78E3AE420147CE690BECE059AACD Aa$EI
967,782,022 *64EA2063706DB9BBDA942940495497346965DB99 aae_-I
967,782,023 *64E1019B5F963D2EA7A6145AB734F3C8CE8AB7A8 aae-I}
967,782,024 *64E8B42409B6EF74D514A92972BE9F5BCD2966D5 aae],I
967,782,025 *64E8728C4844774478486B309AF53347F7BCD171 aaeiVa
967,782,026 *64EB44355C6FC217CD52C152CA56403A71B6FAB1 aae~,J
967,782,027 *64EB5715C9D3521B9390E699FF95F5780B9F1E63 aae]!j
967,782,028 *64E422B968672B7A42958AC2644DAC53ABC2FC43 aaej/$
967,782,029 *64ED1573EDEC6233FCD7A5D4E2D4DB0796C107A4 aaeJ`0
967,782,030 *64E8C3F710EC82A0FC688D41C83F89ED8CAD1AFD aaeJ1T
967,782,031 *64E48DD1A818C6EB8A5563A9EDA94F08C4F8481C aae~j5
967,782,032 *64E854C3B2818D45140CC4BECDC49E6BD93CB46F aae;Jb
967,782,033 *64E2972A66C475B47C6BB0329C9AD42CE4311994 aaeJ<k
967,782,034 *64EBA4E30A133EA560975168509327A1931DAD94 aae.jP
967,782,035 *64EA56A37614A8F9390ABCF727BD0ACA913E026D aaejPt
967,782,036 *64E12F6C363280F1DFCF4166D82145584237119D aaeJqJ
967,782,037 *64E14A8697D15ADEAB38484F63087D4ACB0999BD aae=JU
967,782,038 *64EABA184934496AEE538B5ECE28CBF286B4F2A1 aaeJW%
967,782,039 *64EC173E932C28EE65B3822E094F9029B107D7F0 aae[\K
967,782,040 *64E72487D756A8357F8ADAF2FC641A00A14CB7D8 aae-k|
967,782,041 *64E8F4264B1D994AD2B6AF8F0BEDA32B9FDD850C aae[k}
967,782,042 *64E49937009D1F4BFFA6C37A0CE3581CE5B887CD aaekw;
967,782,043 *64EECB397A285758F70273D4E4C14CD1BC640B28 aaeKzn
967,782,044 *64E633ED9DBE0EA8F3416410AD22050063D7F82D AA-EL
967,782,045 *64E3E54F7DBA0CF6729CEAC78CED328AE0F6B522 aae|l(
967,782,046 *64ED48AE8EE94F9A8820E5BDCD5D2A39C1A65832 aaeLgw
967,782,047 *64E7C77C0D0ADE9FF8ACBFBCCDC94CEA6FB40EE4 aaeL:r
967,782,048 *64E5E30246017E8A1299D0258E0323D13EC7DE55 aaeLSQ
967,782,049 *64E418904319F22233236DFC24D8C10634D953E2 aaelT:
967,782,050 *64E65939087D00E4267AE79B6F07B835A0CCC904 aael)u
967,782,051 *64ED77DF33E71F519C7D37FF4C402FA76ED69EE6 aaeL\w
967,782,052 *64E4931F8C76EB4EA7DC266D5A43099DCD2D2EE8 aae[ly
967,782,053 *64EAE2968C0F345FD448C92EF554A906F93BB6D0 aaem&>
967,782,054 *64E451208713604E8BF6EF4C58DA4A7B1D4EA503 aae:m6
967,782,055 *64E48A5F0F564748403A338BC23A29CDCBC44D80 aaeM<j
967,782,056 *64ECDD7BE18632E657825BCF71E39D42BD0D1C9B aaem~r
967,782,057 *64ECA13EC1F6911E495F2B56019EFA4BB2E2DA72 aaeM)X
967,782,058 *64E8FE3623A7AA9CD9ABCE471398D850E25C0B80 aae&`N
967,782,059 *64E11FF63D18353BC347A579D9175DE5024EB651 aaeN5Q
967,782,060 *64EFA4B6D331AB4D693089DAA7148F55D55B785D aaeN9>
967,782,061 *64EC76B2496AEF87288F73E36AEFC34CFC194F3E aaeNb$
967,782,062 *64E6669F7E455C0608F684831FB3C2455A877B04 aaenFr
967,782,063 *64EB73701EB5D9EB57B2AA8976D60ED8CF111491 aaeN%k
967,782,064 *64EBD48196A6682FAEB2FB687DF816F1B960F894 aaen&w
967,782,065 *64E313152473E6657EA8D68E49873C59DDF0C176 aaeNWA
967,782,066 *64EECA3ABB7932D47C013E527616B794E1FA049C aaeo(_
967,782,067 *64EBE2402147087FD5BDDF6A8A4493C783938AA9 aaeO3<
967,782,068 *64E00BA76E553CD2F34CD09E6BB46DB913740F5B aaeo3A
967,782,069 *64E8F55385B4C769FEBE4D9CE1D0773A97773652 aaeo:5
967,782,070 *64E9A60C50AE9AB22ABAC1DA00FB346E857229EF aaeOAp
967,782,071 *64E08C56E58786599F5A9E31C621AA4E426BA70C aaeoB
967,782,072 *64E22683E8C6A8051AE98684A968820E81D8B917 aae
967,782,073 *64E7BD0BE50B319F1FC2C447929E6261C31A3A47 aaeOMU
967,782,074 *64EA387FACC382A92552D4F61CDDD3FC5B36453B aaeOP-
967,782,075 *64E317511EFBF2A548376D1A5AD0F3F87132A0F8 aae_Or
967,782,076 *64E427022802601CAF0C06D45530803FFC4C9E6F aaE}p
967,782,077 *64E34DBD985A48D925AE27FDF58671A75BA05270 aaE%p
967,782,078 *64EBB37D49303C09438C761437D9D2D25B52D7D3 aaep|h
967,782,079 *64ED63D2680CD729B4195250D63B883AC150FB71 aae`pk
967,782,080 *64E776A9E696D3C2953EACEB5C0FECD5E1B9B031 aae`PO
967,782,081 *64E02D4F415DBC41A0847BC5CD16EFC11A14ECD8 aaepS!
967,782,082 *64E134F1F1006984236BD2EB8993B91C5BC175D2 aae$Q#
967,782,083 *64EA10D71FC5DFCD8B66C9F5A446BE3C896DBBD5 aae;q1
967,782,084 *64E6421EB504EF33DEDF60DF2E164AA161B3EB8A aaequk
967,782,085 *64EB34CD28B6CACDA406AC7BB6B6BD359CC8B4F3 aae-R)
967,782,086 *64E9E53E24D522531BA33C380E5C252693B47E62 aaer-\
967,782,087 *64E115EFAE506F70CE729778AB7765FFA053A08F aaer-6
967,782,088 *64EA532ED5B15253F7DB0C56136C46CAF7AC21E3 aaeR^7
967,782,089 *64EA765C6A8F7E379A4FCB2388E0696FB84A5A52 aaer,9
967,782,090 *64EB93BC6E56EB54EE2D9844D1DD489C521A89E2 aaer}C
967,782,091 *64E52DE593559E4782C885B6060A3D202228A156 aaer'F
967,782,092 *64E00B677DCEA3D688BEC43FA8F12D00504FAE2D aaeRg[
967,782,093 *64E0B237AF9DCD4B82C0EC627E768403EFC94E6E aaeRH;
967,782,094 *64E6A791B7AB098EE2FA2FC438C15775183D58A6 aaeRjC
967,782,095 *64E5CFFFA6559CBACB5A9E2D71B6096AE769C560 aaeRok
967,782,096 *64E6A11BE66860BD9171074991B5B6BCEB76D75F aaeR.w
967,782,097 *64E9AADE400AEF3EE5EB73AB752AC4AD76F18B1A aaeryZ
967,782,098 *64E63BC0EA829DECBAB08F8BB421B0778FDD1986 aaer#z
967,782,099 *64E0BCA7A1FB69E1AFA85D614016C8DF3DBDEBF5 AaeS)
967,782,100 *64ED233DBF16FFC06B945B5F0E45A939BE984CA5 aae<S
967,782,101 *64E02E4B5B80A45EA965A015265AAD1235C247C4 aaes~7
967,782,102 *64E2314CB9D33A2F0B83FB001EACF4D281EAFCC5 aaeS.8
967,782,103 *64E95749644A225EA4F0A44A8460FFEFEAF51463 aaeS\G
967,782,104 *64E207CACC6AC51FE4541BBB51788F85EFF3811E aae*sl
967,782,105 *64EBEC7F9B4B03EA843AA7A7123D3543B3EE3167 aaespO
967,782,106 *64E5A60F9FFBEC1CD928D2B20FEA3BE177ADD3CD aaesq1
967,782,107 *64E9EEB39081AD25A37E67D8D76DBDDE5C365442 aae-'T
967,782,108 *64E7D0A4CAB19ECF401411A3956EFB4ACFEDC290 aae=!t
967,782,109 *64EECE6B19FCD0045536D775681BD97FA2A67626 aae[t_
967,782,110 *64EC6456409FCA86AE34E9705D6C9F5E38798EA5 aaeT2c
967,782,111 *64E96013A54E55C4B5F785127BEE8EDC454DDA8F aaetcM
967,782,112 *64EE3B0B4417D20CFE721BF3E8BBDB1BD6E718A7 aaeTl4
967,782,113 *64EF8B25F1D4CCA5D2A6963F6AB4CA06E11CF296 aaet'n
967,782,114 *64E436E9E9A2EC371314682C4527481F99DB05EC aaeT&q
967,782,115 *64EB7657C44C48724F746268EB8877773F2734C0 AaEu%
967,782,116 *64EA85A5E22D94BFC1D71ED226E361F924B3EB06 aaeu8*
967,782,117 *64EB3E37458D267769C663945BD310F15D87B065 aae~Um
967,782,118 *64E99F612892E5C815E10BB2CBC0795DCBD324CE aaeus5
967,782,119 *64E63211B0E08232B6E3BA904AC8CFD73AB485F4 aaeU+t
967,782,120 *64E101EBD4755FCAC61EF9E4A24325FD3412EE84 aaeUuO
967,782,121 *64EFB61574B2D4CE222C04666C9AEBD387BD5EDB aaeuV=
967,782,122 *64EAD9BC7DC710EA170FB20FCC61C22DABD95BD8 aae&UZ
967,782,123 *64E4803B59BC392339F55E965EBA52FE0A230C5F aae\V[
967,782,124 *64EDBA2639233149A3CC71506FC40CE980E48134 aaeVk?
967,782,125 *64E0A12D5BB3C7D2672F1BEA94B33C2B668EFE8A aae[vl
967,782,126 *64EE0F2473CBF362CD93BF83F7AB4BDE6BF9EB44 aaeVwY
967,782,127 *64E378D33DA05B4C9C4D2BD74A1857AF4EF10CA0 A%Aew
967,782,128 *64E83EA034EDE6462D315CE78DC3D5E57BCB1F45 aae-w)
967,782,129 *64E8E943381CC9D8C54193E76BD6E7D7C83A3CC5 aaew#\
967,782,130 *64EF4E3F32022330607E996FC5A0203C759E944E aae/wb
967,782,131 *64E32B1518842BF83363996DEC612348B3019778 [email protected]
967,782,132 *64E1795DCA441FB31AD9E21424E1C7C6935E8DE0 aaeWK&
967,782,133 *64EE7A67BB85E14617697EA0936064639C9CB121 AAEwm
967,782,134 *64E770C12D4DFD76128812D14D1355174962CDB9 aae{Wn
967,782,135 *64E1B549BA3906A3821F067D6C2D1722B74B21AB aaeWr}
967,782,136 *64ECD15EA443898A8C426348C1F6B328098AAEE4 aaew,T
967,782,137 *64EF455A3A5E001F3291DE1C341A20D9B8A6FE13 aae#x\
967,782,138 *64E64F3CC2994EE4FDE487D951AF23186B5587C1 aaeX%B
967,782,139 *64E9237AE9809DEE86C251B642F180F0ABE1C104 aaexdz
967,782,140 *64E0579ECC49C1E8D4634C96BA8D97A5494AE64D aaexHL
967,782,141 *64E41DBF232E7BBE28F0D4299B4733DEF5428630 aaeXhy
967,782,142 *64ECAFE6BE5B663A64DC777DC468608E5B9E2389 aaeXME
967,782,143 *64E1C2FDE09387A555E24543AAE45DE7F791AAFA aaex|n
967,782,144 *64E696FEA7CBBBAB86F35EBA5E5AE292567C0EB0 [email protected]
967,782,145 *64E48F1E75EDCD18BA5834530129FDDF10A97865 aae!xv
967,782,146 *64E3D56CDB305E3098DC1BCACFEF22A2EA2F135D aaexzC
967,782,147 *64E560BFE558B78155C2299361E8ADFEC19D8126 AAEY7
967,782,148 *64EDB6CB7E2C07AA286B729D17BAF63D3F122A94 aaeY#m
967,782,149 *64E61CD177EFD34D3AC52DEC1A3574BB836E0AD7 aae$yq
967,782,150 *64E6B76673F73379163F0157DA616F4A88314C9C aaeyZH
967,782,151 *64E9274BF25012D842A93BD658AE456D46DA7E1F aae.Z
967,782,152 *64E580547ACEE4EF364E22DA43B3DD5AF9671788 aaeZ/!
967,782,153 *64EB52D125F06436C83B916F8851B72CF29C61F7 aae_`z
967,782,154 *64E3ED97932F117749C2484171BBD09974B8D27A aaez"%
967,782,155 *64EE2DD78F34F6786F3B1A2F37880F03755B5968 aaeZ%1
967,782,156 *64E56519FC57621D28B8A08458809AA204A3EB29 aaeZq5
967,782,157 *64E074FA130947E17D68F98933117EAF9768DB4A aaeZtY
967,782,158 *64ED6C4D21AA1D19CAFEC4E0813514E7DD01F124 AAF+:
967,782,159 *64EDE19DA76089966EB5BB63A0642D0DDCC75252 A-%Af
967,782,160 *64EC59B2AB1FDEA47A19C5843B92BA2E7460DD53 aa>F|
967,782,161 *64EA223D8D5DFABC13A41051ADF5D4D794D6CC0D AA)F1
967,782,162 *64E7FA1AD7CD27FE87E7D673C987047B21F3FFE5 AA*F9
967,782,163 *64EBF752DE192771FA09A2DD9120E60E240AB2F8 aafa(9
967,782,164 *64E62211A40B28831873CD8533558C3DC32BF954 aafah6
967,782,165 *64ECE8522E5629331676A79882394A243144EEFC aafat+
967,782,166 *64E0D937044E9F6E35BC022FAF8E4EA4D6E6EF74 aafaX"
967,782,167 *64E2009019429109E6A3BADEC9D825B55129B5D7 aafb3_
967,782,168 *64E6050B0FA36B8493D592CF9DE100CBC3293CB0 aafc&1
967,782,169 *64E13442A67E8296F4E109479693B96384BCE9F2 AAFConf
967,782,170 *64EC3779B3A942EB87441709DFAEB34FC334CCF7 aafd5M
967,782,171 *64EA0BEF7B6EA94842D509D87791F1CC30D0AFAA aafd8W
967,782,172 *64ECE8CD3223A04D7E976164BF18A7DC1BAC81CE AaFdR
967,782,173 *64E337760A0FDABC626C4872FA604D683839F69B aafd_s
967,782,174 *64E4B4C9B2C437DE11CC8E4CE6D853520193C6A9 aafdwo
967,782,175 *64E0D582684B8F736CC90BDAEA4D4A4B6ABA4ACD aafebp
967,782,176 *64E33E833C29CCB4C617C3A421F5989FE5063653 aafeQy
967,782,177 *64EC4CC0DDD816A01A1020A1F5EFF7251E53E21B AAFF7
967,782,178 *64ED9A1E4194C758FA447AEBC20C667CCA835BF0 aaff\s
967,782,179 *64E263F474D90F5985B377DD352510FE791157B8 AA%Fg
967,782,180 *64E22530E6788A78D9E7A67B7901167D25A689C6 aafg#?
967,782,181 *64E3F3A406193EE44395F1F84DD2BD0A01189BD1 aafgBg
967,782,182 *64EC2F0E4883EFDEA41C4A5785C3F769092CB04D aafgO"
967,782,183 *64EBBB0124592F1522BD88711B56C4FCB5227E93 aafgRM
967,782,184 *64ED5BB23BBEA51037D83A43B8A23117DD6A3EF1 aafh)
967,782,185 *64E89807A4D1818C38A1549E58ECFFD35A09D6C9 aafh$a
967,782,186 *64E389DFDDB096491EBFC1CA3358FD76ECB69433 aaFJ-
967,782,187 *64E432CC156E8400870426A9F82110FFFC0830AA aafj8T
967,782,188 *64E8751E862D93C9D56436D72E8A94E345BD61FC Aafjngkuttm3
967,782,189 *64EF1D843F8B33129565506795140B5B2BF34B79 aafkK.
967,782,190 *64E268F7B8773C112FF0E937B5304A0F6DCFE8E2 [email protected]
967,782,191 *64EDF77C7194F4C220C380D0F6E91D29872913C0 aafkump
967,782,192 *64E88DC5D0C5B37C0C1198AFAEA68EFEFF8B1F7E aafl_Q
967,782,193 *64E47D4984E2C3AB8031517BF80AC67D1A407012 A(AFm
967,782,194 *64E636E5EF6A0E7B06E6B0A28A617996E4E66E5A aafm~'
967,782,195 *64EAACC5A2A2E3B6952922E90996C39FDE8058CA aafmp6
967,782,196 *64E93E1402784660875EF7A49E165D08E1ACAF26 aa&fN
967,782,197 *64EA539CF9963CC9DD7216A5E1F05CDF09D6AB11 aafn.f
967,782,198 *64E2F17C86CAE309428F0BA4F6286E4FC1A87016 aafo<<
967,782,199 *64EBDC9C67D26F196604C1317F2F3B3D2271785C aafo<o
967,782,200 *64E3293C441FF160E32648CA3DB07ADBC2B7D67A aaFoQ
967,782,201 *64EAC145DBD2B25762B4B877A78BF9FA3AD4323F AafOX
967,782,202 *64E31EAB97FF1C868CF16D1BE33B14C7D5BBE6D8 aafoZ:
967,782,203 *64E0B4EA14255B6157507A858FCD1972A9958249 aaF<T
967,782,204 *64E85D0485D52F8EBFB9B522F3CDE2DEA9C5BF6D AA/G\
967,782,205 *64E2BD728CE4F260828DA46DFBF974D0E7102760 A,a/G
967,782,206 *64EF83D30D2306924A56B88ECD2A20651F384DBE Aag?_
967,782,207 *64E579DD8E8213F295A370ABA75E20B9A60A2D45 aa(G$
967,782,208 *64E11CDF5FE7146C3A48CB2B42BF04894B67CF72 AaG2+
967,782,209 *64E4824E18DD6F32730D1AFE061AF130A93B6560 aaG'7
967,782,210 *64EFFB39BD168076FC6D25DC6E4302B789012A3A aagaacacaatataactatgtggcaaacaaatctaacaagtcataggttttaactaaatg
967,782,211 *64E28BC6CE8404896B8BCC187E0AA3BE275DA38A AaG%B
967,782,212 *64ED17924D38F141DAF6775F9D2C4737A831E4F1 Aa:gB
967,782,213 *64ECD7F347DA9B00802D86FB4FA28F0591A18F76 AAGBV
967,782,214 *64E1A86DE926912104F8B1A4A8FEE5F6A26347ED AAgdH
967,782,215 *64ECBF0196E98F3ABF5F47380D7D14231B5444E3 Aagghhhluomaa
967,782,216 *64EC4D06CB3F6A3DAE1AB22D1AC8B300151ABFEF aaGIK
967,782,217 *64ED450EB514FAC13C70D03AD5032741A8A1C4A4 A?AGL
967,782,218 *64E845222D7D9FFC88853860F1FD1EC55241AB84 AagotStang
967,782,219 *64E3051687EB247897AFB0DF2715B83FA770D70F AagpS
967,782,220 *64E4F474CE7C33FEBA942000BD3DF245301CB13C AaGpT
967,782,221 *64E95D9DDEF4EE7519FDD40ED281863077267452 AagpU
967,782,222 *64EF61E4A32AC83BC586FEF597FE088344113960 aagRy
967,782,223 *64E25C341BE88A3D7CC9B863E1B7237B65BA2BF6 AA&Gs
967,782,224 *64E7D1410B9646A1C2AFCD8D4BE7FFE01FF202F5 AAGTe
967,782,225 *64E664F2C2CF171C32A07ADB352A31E995712044 AAgZ
967,782,226 *64E98B3B7EAA8BFA4261DB57FEF041999F4D86C3 A)Ah,
967,782,227 *64E5A3E850B1BA7DC906D98F43E4D658AE42FCEF Aa=H%
967,782,228 *64E0130AB8A23B020D27BE6D4945B8425D6C0EC3 aa:<H
967,782,229 *64E62E2E037F6799CC7DCF6C9C2C3AD58DE68535 aaH"]
967,782,230 *64ECB801505805A224EB9154AAF2CF19B9311FA9 aa*h(
967,782,231 *64E7F0D4334B839732D8C926380ACE72714C8E52 AAH0_
967,782,232 *64E714507F32503463D0F3415540EAF11CD2554F aaHA:
967,782,233 *64E3A47FBA3F7D7BAE234DF99E05A65C72293550 Aahaarashcharma8
967,782,234 *64EFCBA0FC2F6F901547D93EFEEC53EF55723341 aa'hB
967,782,235 *64E2FE23CD4F01244F75622979E1DE32C8B4F049 aah:F
967,782,236 *64E9F65185AD5F969464D01A726A9801EF33668D AaHf3
967,782,237 *64EEB8875DD97DFBA4BDECE6D67A38292DB147CE A#Ahg
967,782,238 *64E4FE63A295D01CD4BE98BB299FD30B0C4D94F8 A
967,782,239 *64E9A554D49067A29E54019BAF90017C0D2468E9 aaHI%
967,782,240 *64ED50FF8FA823D2823CBFED04F5C3CA283EB1B6 AAhic
967,782,241 *64EE8F7B166191B16BE33CA95F1DABA43B7EC9F5 aaHIE
967,782,242 *64E6F4CD35CAE3D2FE52FC0981F2B221AC16BF81 aahIE
967,782,243 *64E684362AE8938A2626EE26FA03230D13E3337D AA?hq
967,782,244 *64EAA0268DF6BAE5A7E8D129B98C487F8898AF89 aaHs!
967,782,245 *64E5B0524037CAEE558E60336A08EE5E7D8FCC0A aahv.
967,782,246 *64E3D0C5A26ECE8660F82E52EF708F1957825F80 aahyR
967,782,247 *64ED6033D0528E991ED17F88DF079D0936F28552 aa'HZ
967,782,248 *64E81F41CDA5531F46A8B368CAA68E43E0AEA073 aa!hz
967,782,249 *64EFA0E9FF6F0D90D9A65AABAB81E153FC1B9ABF A,a&I
967,782,250 *64EDF2ECCBA93E957366195539154D575D85F820 Aa*}i
967,782,251 *64E175EEA7A2DC1018964C1BE1D9206E6EAD857A aa'I&
967,782,252 *64E3B9CDD90D51430109D105C2F0F083C5BBE3D4 aai2l
967,782,253 *64E5F5C921BA3F7F6CE56866A3F693C83383F7C9 AAI5Q
967,782,254 *64EF632044BDDF03EE24E9192716F9307DB7488F AAi7V
967,782,255 *64EA936331EDDD55FAFC7CFED5B75CFA98E2C9B9 aa"i9
967,782,256 *64E65F5941345F543477622FA107DCC2A2B6CCBB aa^ib
967,782,257 *64E90EB3814D89415B9C3CCE2F470710B6C16AAF Aai!c
967,782,258 *64E097A819F3092833BF20900077842594343BFE Aaicorp9
967,782,259 *64E10545345D588948CC0733790CAD988092BD0A AAihv
967,782,260 *64EAB21514A5F13ACA9183DBC08075D7AFE773E2 Aaikknup7
967,782,261 *64E15E39E3FC67DF06900D1762CF4E7C66533A3D aaIKM
967,782,262 *64EA8A4C61FBBDD9E5CBD6FC89823DA53EFEBD1D AaIm0
967,782,263 *64E534830DDA8E20444F3DE43F552DDC1FBCF422 AAI(n
967,782,264 *64ECEF4FF82ABA9C984680E94223B9AEB27C9189 AaiqG
967,782,265 *64E28D6AD57C1E236FEB9B077BFCC3C88E2BAD29 aa+IS
967,782,266 *64E66A34F764D5F1C2D5CCC226A6069EBF00C3EF AAis1
967,782,267 *64EA6ECD808A6F75E229E583523A9308F6510AF6 aaisyzowl3
967,782,268 *64EC8E9B3ACB26DB80C3302093823A1518BD1624 AaI&Y
967,782,269 *64EBD2CD4837FB21EFF03CF3EAB35F8A36778A8B AA!,j
967,782,270 *64EEF58CDAA40867578B1F9A1CE9E3133E9E15F0 A
967,782,271 *64EB9ABBF8825C09D2AF73BDD584E3EDFE695AE2 aa)J_
967,782,272 *64E55BA803BDD8596614C1C21CB25D657E0E9302 aa~=j
967,782,273 *64E6B6CFD3B1C5FFE8FFDEC916FE0FAC0FE398BD aa$_j
967,782,274 *64ECFE0DBF1D20DE4F024345BD0F629841584889 aaj1956
967,782,275 *64E664294E0EAB04E2070EFF767EF73C17029359 Aajamaan7
967,782,276 *64E893313B90464C451DF570BB3C0F795CEA6D9D aajaV
967,782,277 *64EC9AEFD44B5D925D3FF0F25EF8EA43645CACDD aajF9
967,782,278 *64E124B883674C9E8FC9BA40D7089C935E5237E1 aaJ\G
967,782,279 *64ECAAD22FCF21089E17081DF1610C74F32908A4 Aaj&H
967,782,280 *64E96C73D34CED054E2A0D923EB58FDAC4EE91D5 Aajilion3
967,782,281 *64E5A29330A4FE4F24D7D8B5B87121991BB79A91 aaJ%k
967,782,282 *64E84535C989B49DA5B84A9F958F4BF8A8D47C29 Aajoissa9
967,782,283 *64EE2C6FBB58D15ED45974130A308274C945A666 AAjUF
967,782,284 *64E98F2F2BBAF48B88A62F84AA0C51C01F9F75F7 Aajuhoti4
967,782,285 *64EAE6B9461552A07BA015E102475B12B1F63DA0 Aaj/W
967,782,286 *64EE1E3993E628B92BAC6AE4C7E515E76C3885B9 aa%JW
967,782,287 *64EBF9B351BE81B0676A2714C37345BE356029DC aa+K-
967,782,288 *64E44D4B90523215FBA9224A9FE681651E887604 aa~|k
967,782,289 *64E977C6A550A7E5E01E180A41137AE9478FB707 aa{"k
967,782,290 *64ECA0F2AFBCF236D982CDB2267F11349AFD46D9 aaK4v
967,782,291 *64EE850721F8F0BDC7D34B0CEC75437B7E991D87 aakaaraih1
967,782,292 *64E7E2FB1FF6D79CE468511AE738F1EC9D294B16 aakashchoudhary
967,782,293 *64EE22080778B2666C282992F69B8268C8572E31 aak~b
967,782,294 *64E6F876304B8B37894769EF2C52CCBA8F7810AC AakbO
967,782,295 *64E5962F85A3E9143F14AEA99A5D820CE2973E1B AAkEX
967,782,296 *64E15F0EB7500C7E67F139E938CFC87A7461166F AaKff
967,782,297 *64EC3912BC1E98C5073E2C81B3906BBD24F46CA8 AakgA
967,782,298 *64E6568CC39D641B6BED18D44F2D7A396E431A68 AAkGR
967,782,299 *64EE78B472A861565A52F79F8EDFE900EB9BE4B0 AA&KH
967,782,300 *64EFC2611A5129285C1ECAF383F445BA7C64F45E [email protected]
967,782,301 *64E12A1376EE97DCD32099938E08F160DA7A63A7 AaKI/
967,782,302 *64ED7F6BA2DEB53948DFBBE9785D82B6360B8A76 Aakkarus
967,782,303 *64E84DA6F64F92962558B1B9E123E6E59EA928A3 aakkiaps6
967,782,304 *64EB3EB68C0ED09DBF95527D1AA19570B1845845 Aakkinav6
967,782,305 *64E01CB24912DD1103C4D648522C0A870BB61D70 AaKl;
967,782,306 *64E13896E4822DAEBA4551E07091C970C6442D37 aaK?m
967,782,307 *64E92A0131744204F92AF54AB76699CB3F169BCC AAkML
967,782,308 *64E4B3E7FD4E80DB74F8567500F81FE245A534B8 ãƒâ–kosiedlung
967,782,309 *64E9868EB3899AF8E5B3BBA824ED23C5B45B84FE Aakroshened
967,782,310 *64E29808511C0CC71C3013A5906CAA0A1063A1DF aaK'S
967,782,311 *64E9D9277FFA1CCD39A708EE9DDCB8D88AFF63E6 A_AkU
967,782,312 *64E3511A5FDA38BA60C565CAB600303474C21DEF aakUn
967,782,313 *64E99B99EBFCA62451DDA915F1DB5FFC8D394EC2 AAkWY
967,782,314 *64E11A4EC432999A514A1AEB3B0EEA530A0D62F3 AAKYG
967,782,315 *64EE9F2C8E117A5D5495B76701862FC46EE6CDA1 AA,L"
967,782,316 *64ED451ADC229F77AED4AE66192A6A6689D39D98 A.al,
967,782,317 *64E977126430BF288810F4D6BBB32C01B4E0FED5 Aa/&l
967,782,318 *64E07B4921F1D96BB8CF956F347B4AB3528E3B73 aa-l~
967,782,319 *64EB086BDEEBB1881FDAF06837C7C72050298E02 A;AL3
967,782,320 *64EB1418B4873D7DF5A216D2E974C99FD0D96721 [email protected]
967,782,321 *64E9F554B768B71CC7F4B81097874F625336AEDC AAl#a
967,782,322 *64E42DF74544F71D70B1D8563D50CAB4D0892A8C aaLAA
967,782,323 *64E1C267EB06A21CECBE67ADB9087800FDC25663 aalaeok7
967,782,324 *64ECB273C3EA9C4EFB76787E860527B4123CD2FE Aalaileim
967,782,325 *64EE5FF9DE3BC67766876BCFB3333FBB298E0D60 Aalaisening
967,782,326 *64E6B2517E961B077429E7800951F93337B84FFB aalamak0
967,782,327 *64ECE2824B0399609D426542725D033D442B478B AALANCEEARLANDREI
967,782,328 *64E0EB9E3101069386E16D6390BEAF4F792C9AD6 AALc1
967,782,329 *64EA7DB51522864769F27831FD9BD70D62B951A0 AALEEM1
967,782,330 *64E5A8A7DB49308E5452C647FF012CAF8EC02C84 Aalgeest7
967,782,331 *64EFFA76C039313442B5246063DECA0D6C4416FC Aaliarving
967,782,332 *64EA57A38DF5BEC4091E2A93FED433A58AB13000 aalitoth5
967,782,333 *64E1D99183CB2B9E82D3BEB6289BAC57A67D2947 Aalitsuts
967,782,334 *64E7C0E5DE3DBF2D338F8A99A4A6A0C7FA5C0191 aaliyah818
967,782,335 *64EF3B63671F47E76560C58FC829C4A37E31C01E aaliyahdavidson
967,782,336 *64ED22D8E2C955AC4C6594798DFC44F0D5AE08CE aa)Lj
967,782,337 *64E34D9BF43EC8EC73C2FCD500B5C030477945CE aalkaste4
967,782,338 *64EE46169E4B23DEEDC0448875A882095A0F9471 Aallavat9
967,782,339 *64E4E2B5E16230F9A26591122D9776EBC03D1446 AalO2
967,782,340 *64E9DD6B13E8788CAE11062A37CFABD4049194BC Aaloihin1
967,782,341 *64EE97AB171C4B182F8C86D60758F159A93AC5EB [email protected]
967,782,342 *64EC4262DB91C23033A5C42EBDB7C06DE29E950A aaloon:
967,782,343 *64E185353E01052E18856518F6DF7B55D55933A8 aalosep8
967,782,344 *64E7931871A5CAA076E8BD4DFEB0B3792A99CAA3 AalP#
967,782,345 *64E438DB183AA489DFC612E1F22A1FBC29AD818D aalrella2
967,782,346 *64E298FC160B23CC5DCD92E37A30ABA8343AFF92 [email protected]
967,782,347 *64E7D232BE03BD58EC385AD0DE5EDA3085C843BB [email protected]
967,782,348 *64E23E86A1CE11EAA0435790A1460718223052D3 AAlUO
967,782,349 *64EA5E4DA8FD07ADECA71221B9674FD54DC7E2D8 [email protected]
967,782,350 *64E406C92C1DA9F9E90EC8E5C87290C448465466 A(ALZ
967,782,351 *64E6F99766639A9F3BBEE9A8277F0EEF79102EA0 AaLZb
967,782,352 *64E5E877E3F027CB853127DF1CA58DB4CDFA2CD7 A$A+M
967,782,353 *64E1E0EDCC00558A17A05D42BAD7CFD830804BFB aaM:\
967,782,354 *64ED5628DF004D910A551C9FE6E0557F560ACA93 aa_m&
967,782,355 *64E1F59156D9AD0949D17A7F690EEE330284EF3C AAM+b
967,782,356 *64ED540F12B88E523CC3F17E46064145170D7CE8 AaMC=
967,782,357 *64E117F1C83A606AB19C028C0B4DC44AB3CFC00F AAmerikanischer
967,782,358 *64E285568368391783198EFDA95F25CB06222129 Aamerup0
967,782,359 *64E09A5E94CAA6F0CC2E75D99E2E80167A50B95A Aameziuming
967,782,360 *64E1200D5EBBC2F97779D78260C4CB78DAD4FA41 AAMIR'S
967,782,361 *64E2C2FE91DEEBBAD7F32617426CA0CF9AB5A1A5 Aamiseiling
967,782,362 *64E59A276A00903801A23239596B030E7A70827A Aamitaav4
967,782,363 *64E2F57633653CB6699DDA2AD0D3D1534E25A201 AAMlr
967,782,364 *64E483F22C61A12F8671D994255EB8F229955E6A Aamolsek3
967,782,365 *64EAF33A7990121D849EA906F898A9FD0B385227 aamoreih4
967,782,366 *64E083BAEC6C0F0E57778FEFBA0B71B1078998E5 Aamq1
967,782,367 *64EE2CE793E4EA1B16A4D19E3D83F58875E3FDC6 AamRt
967,782,368 *64EDFD5596A2A333022443B3E16EEAE51E0D92DF Aamsytih9
967,782,369 *64E0FF906DAD804B862314BF6D086DC20500227C AA;MT
967,782,370 *64ECA1D5EB018A5D0148B56994703E3777B6938B aamthcoted
967,782,371 *64EE3A0A112382F2D29797293E2333C057A51BAF aa[mu
967,782,372 *64E7FD2C8340379F3872C5F4634938345921A471 aamul
967,782,373 *64EAEBE71DA1AAA5E255ECF3B61334F36D4920FD Aamutangon7
967,782,374 *64EAAC4081D3BDAFF8F989DCA271724A653C676B A,A#N
967,782,375 *64E3AC06E345C49E2116FE18FB0FCCF061AB3693 AAN:&
967,782,376 *64EA6FCA4DBF60D86F3750B28BE95666C791AD53 aaN6E
967,782,377 *64EAB605D324314A874E95D45414066355DB597C aa{nB
967,782,378 *64E88E2BDD68402EA627650A87A770E10D3A8E16 Aanb9
967,782,379 *64E2213F14BAA20F7D536ACDC6D6C1F2F9D44EB0 AANBEHOORT1
967,782,380 *64EF65C950F741667B6D9D510D7A32ECCC86C335 aanbermingen?
967,782,381 *64E6113ED3AFFE553D78228EEA501D801B26E053 AANBLAFTE3
967,782,382 *64E38E21E20A7C1C57EDFBBA3ACEE591A96DFEB3 AANBOEK6
967,782,383 *64E3DA18108B68B6D7AA09AF2F4E7C791718BDB7 Aandrijfassen1
967,782,384 *64EBF6BD6543A6A497D70063575517C9519EDCBA Aandwydte8
967,782,385 *64E611FBA08B9E60DB7C309EBAEA01150060D127 aaN^E
967,782,386 *64E28EF01DAD8D118C413FDE455508639620E8D7 Aaneengroei
967,782,387 *64EFF6E0806463F735E1FDD47613244834BA6226 Aaneenkleefde4
967,782,388 *64EA273A5A24F999E2D973DF72D61334C50908BA Aaneenkoppelen2
967,782,389 *64EFB529B742CE1C8FA4BE9E2E628E52DE45564B äänenvaimentimesta
967,782,390 *64EA441A989372184FCD71AE0DDF5B373DA6DF94 aaneolruncommozilla
967,782,391 *64EC7694BD2FE019BA06774842B5F2E64A751235 aangebee0
967,782,392 *64E5F302B8F7D0EC16F01ACB4514BE798E82CB04 Aangebruist6
967,782,393 *64ED994BF287821CF60C47F55E772888C68BF4AB Aangedrukts5
967,782,394 *64EFBB084FDFFA75D65F9A87C74672A5CCB73E3D aangefokten3
967,782,395 *64E37451846CC4E45385BBAFD66B7E4D8C911A01 Aangekorvenen.
967,782,396 *64EEC7D0B6A1EDC8F212F5014640B865A65A0643 aangemen8
967,782,397 *64E10005F78B73B6BF0F0E5F6A2917069644EA1D Aangeschrapten?
967,782,398 *64E9F004205DDEBB29D434E2E425FDB93B57BE02 AANGESPANNENEN5
967,782,399 *64EDDA83370333DEDD68FB2A3F89964BE80EEBC2 Aangestrekene2
967,782,400 *64E81A19149212EFAB9059669188A21AB877E577 aangeswem6
967,782,401 *64EF0535ECFFEC50D63D23E20DB3CA1F8F640876 aangetakelds
967,782,402 *64E252906E3D38A2258F4DA02A0ABEBFBB8BA8DF aangewrevens
967,782,403 *64E182B68B33B1540EC94A769BB491DDAF8B02C3 Aangezetenes9
967,782,404 *64E9DED59E484B5283A2C121325D43B53F3A40CC Aangloeides4
967,782,405 *64E0C46A860A5D15569C74C3CDC8CB93488118F0 AANGLUUR1
967,782,406 *64E99B3156D7E064B0E2F4733579DDEEAA1F86A8 Aanhoorts2
967,782,407 *64ECBCA0F8C84D5831F9CF519894D2AEBB9E2891 Aanhuppelden
967,782,408 *64E04248FBC1EDAA64465A172363F5B5C70CB26B AAN.i
967,782,409 *64E405B16A20BAE20090571DDF81F224F42F8A02 äänimaailmakin
967,782,410 *64EE8E725B90B97ADA35F2D0EE7A519ADCD01854 AANJAGER1
967,782,411 *64EE331F7C432539D29ACDDF93929833F27102AF Aanjihcs
967,782,412 *64E277EEBFD7EA114AAA7E16568D71CF02AC16B9 aankalkten!
967,782,413 *64E9659FB286D09C6C3FC53DE23F544723AB1CD5 AANKNOEIDEN
967,782,414 *64E93ADB915AB20A13182EDF7C02D595FC056767 aankoopadvies
967,782,415 *64E3021BBE5CCEDCF8F4E3F6870F7FF03E2C8B1F Aankruiingens7
967,782,416 *64E0A042558750BA7EA3E1D91F8CDA630FC04F74 A;ANl
967,782,417 *64EA2097F2E9263486E2833F5D99570AFD8B0B3F Aanlassingged
967,782,418 *64EC86E245A00A8E0FF28CD95406F3048FE50D42 AANLEGGEN7
967,782,419 *64E5101C49C8620C45D891B8BE2B1F34D52CF470 aanlijned
967,782,420 *64E6191441B37EAC740D5DB7408C6960AA8C5F45 aanloeves5
967,782,421 *64EA8CCD13EF74CEECC96FF63C79CCB1E7A91127 A%ANm
967,782,422 *64E81079603F273B844A373B9C88882E2F2AB604 Aa+nM
967,782,423 *64EC9833F25061F9358A63B02492F584CE0A9AEA Aannahkas
967,782,424 *64E647681059A113C23DE9719E732D7634E8EBC8 AaNNp
967,782,425 *64E26DF4CA80EF0B957CD779107CBAB4E50375FB aaños
967,782,426 *64E1772084BD771EDBEAA6F7D17B222FA72D0C7E aaNp+
967,782,427 *64EB33C33B049D83D032003085564161E552902F Aanprijses1
967,782,428 *64ECC2F3A3F2349F29A71A4784C6079ADDA1912E Aanraastsing
967,782,429 *64EFC6B00D35D332845B95E98672EBF729539282 Aanriepe8
967,782,430 *64EC1A3654EC6AFF9ADB195167C0FDE353262015 Aansaisi9
967,782,431 *64E7671E80C42E02CBBA4062EBD7D0131B7FB983 Aanscheldens1
967,782,432 *64E397A0D525D3C3CCED68D7C4BA9F4B0359F485 Aanschellens5
967,782,433 *64EAFBF91939436601108C7929838210542FBE03 aanschuiN
967,782,434 *64E281233A33A2D5401F76267377F20E7D566942 AANSCHUINT4
967,782,435 *64E7591E7E60BDBFECD7DFDB5B335DF85BD9A88E aansjokte8
967,782,436 *64EB9B8EB4BB608F921589EAA1A5605C4CCE787B aanslagb4
967,782,437 *64E0573141620ABE558FDDC806778BD09470D450 Aansloegen5
967,782,438 *64EB637E2780159D185FB40FB3CA00ED59969AFE aansnel6
967,782,439 *64E9A03FB243944DDBC35F0BABEEB287546686F8 Aansnijdts2
967,782,440 *64E6D6D8D806D4B124B5B00BA4D034414D04F9E5 Aansprakelijkes5
967,782,441 *64EEB1A4A522FB40F312C38D3CF61887702939EE Aanstippens0
967,782,442 *64EDA09AAB79086D422734056DFF9022968FFEE0 AANSTRUIKEL
967,782,443 *64E2972B0FC1A9DF6D17744D9CB4DE4416CA214A Ääntämispaikalla
967,782,444 *64E1FBC7785C30B75BB3D3D05D69E182E3F4F7FA Ääntäs
967,782,445 *64E9EE0EB9382C65A8D9E2FF05F2B1E43FBB76BF Aantikten9
967,782,446 *64E2D9D84F46B37E0874970885EF55BC8E4ECED7 Aanuynamnam
967,782,447 *64E3BC6A0E61E3CEE3714C76999BC45BB04391C2 AANVANGSLESSE
967,782,448 *64E8002B4905E131D438D3A31A61697FC1793B7D AANVARINGSSCHOT6
967,782,449 *64E0CA4922ADE12EA02AA4F11BFA318CF2BC553B AANVOEREND9
967,782,450 *64E538998243CBAC086451F69A0D7113ADAAD536 aanwendden?
967,782,451 *64E3873DDF64308443F7D45766CBD2A67CB66D8D Aa#nX
967,782,452 *64E3383DA01F9768BA3AB4E439A9EB1FDC8630D1 aa]NX
967,782,453 *64E5D79E1E539875656B23BDA635B2449A8EF745 Aanzaaide7
967,782,454 *64E5A2A9425E6185926AAFB6BD9360F26986EA44 AANZANDT8
967,782,455 *64E9401B89C892902815BE40BBF0556F7645D3E3 Aanzeg7
967,782,456 *64E59195E96B06BDF172F0076B781748B1E943B0 Aanzweeps5
967,782,457 *64EF4A9EC2D6051707B0BC64AD0534FDCB5CFB4B Aanzwevens2
967,782,458 *64EC65F84D5AA6D318C44A5B88B660805E84CCB0 aa.O(
967,782,459 *64E0C7BBC63188004CEA2ABC413A34EF6487DEA9 aaO=4
967,782,460 *64E4883AE8714D930C5B904ED027CC6A4E3ED7D7 AAo5e
967,782,461 *64E3F65DB995729903FF9FE2C7A787427DD72235 AAoA.
967,782,462 *64E52E8BA79E5F89BAF10B98E17FBDA624A7AB5A A&aOB
967,782,463 *64EBD69C530D894F7A0C2B7C92C5055F2BF41439 AAobI
967,782,464 *64ECEFCD7628AF38DB126934ACCCCED47A1F0F1D [email protected]
967,782,465 *64E6E4FA49E414A837022A2AC5458C9ADF218572 aa{Oh
967,782,466 *64E9D1A16E2E7C07B0FB205656193E81BA15E04A AAoL
967,782,467 *64E7289F8A8014B4B82B6D3905F10D9F8A77F8BA aa:oM
967,782,468 *64EB649F75AF04CD482E2E99A4485CAEF8957F19 AAomB
967,782,469 *64E9CAD05CFEA28A3D83073431CCDA0617F85165 AAO,N
967,782,470 *64EACA405F7EE82E7CA4796DDA00FD993BFA14A6 Aa,ON
967,782,471 *64E63ED47A673D9A6292F52B6A04B28753A639F3 AAOOCPA
967,782,472 *64E50AC5A2164DB754CB25FB0E2D3C310C8C8B0F aa&Op
967,782,473 *64E8B2470E828142F02346222E26EE8D0C82EA03 AAOpq
967,782,474 *64E27DBF867535B86BD2D0DB01D0E5C604E543B8 Aaoqfdeeze6
967,782,475 *64E36674F5788CD27274F5A04DFCB8FACE977CBE aao.sinica.edu.tw
967,782,476 *64E8213BE58C00C5D463CC9E4C1EBBC08463ED65 aaoVx
967,782,477 *64EBDD3C5FC54B5874E7E41C8B8D78499E6BC5CC A-_AP
967,782,478 *64E7917EBAB4880980BE2051317B0242BEEE1C17 aap>]
967,782,479 *64E66122B31873C8102315BC6B91797731848CED AA%p9
967,782,480 *64EFAC7FA8265804EC2ED74D58545711721B2F9F aap9.
967,782,481 *64E125B329BAF42D1AF7E1F1A5F4B364E78FEB0B Aapairlines
967,782,482 *64E604715A6C9B8BD3E4530EEA996BFC7A3CC14D aapaista1
967,782,483 *64E7C9227442F30A7884202E8D9B6A135C1CD757 aapasdlp6
967,782,484 *64E0091696A3ED831C74DE535B761D5AB2DEC829 Aapatsuting
967,782,485 *64EB387B2EBB44598699741D9BCE9ECF0EFE0275 AaPC,
967,782,486 *64E8E7FF8DA52345C2EB15C6393FFA04C99075B0 AaPH=
967,782,487 *64E9C94DF0D3F65E8D403D3D37A75884A4DB7C02 AaPH)
967,782,488 *64E9E579B23CEFA10F82E725B3C30D0306E54664 AAPh7
967,782,489 *64E097929BE3AAB531BE5506ED56E9489297245B aapLU
967,782,490 *64E9EA974F7F0260B0EDE897C712C446B1946368 aapmejru7
967,782,491 *64ED700166CB48B6C37CF6B0EF15B0F52A924B04 Aa
967,782,492 *64E5C4CD809FEB0FDBC723647EFD00649455C75D AaPtF
967,782,493 *64EF6730559545D017C568E339AD39F7038B490E AApU%
967,782,494 *64EE2DB108E4F1D694E5AF641FF2DAFBCB475E26 Aapulya
967,782,495 *64E9230C3F903C0152F2101D81DD51290862CD71 AAPuO
967,782,496 *64E1C390F6F2FFD3016F4234742BB3A5D447FC57 AapVX
967,782,497 *64E60093402B045B8B1FA136C3C4768FCACDC2E5 Aap$W
967,782,498 *64EA3826AF6DCE5B010E7C448894B8CFCF7597C5 aa`PW
967,782,499 *64EB1300A8EB814562DEB05C7CF9A17ACCDE6AB9 AAQ..
967,782,500 *64E4FE7008A8B47BB205550ECA8B313DEF3E72E8 Aa!:q
967,782,501 *64E69ECA397B554BE658F992104E48E5D887F68D ÄÅQ
967,782,502 *64EDE91C38ADF835B79E33088700FDFB9A1E296B AAQ46
967,782,503 *64EFA6B003782F50C9EC5B10C128F66B970948B0 A)AQ7
967,782,504 *64E1D53A402619F860510607CA16EBA5885F8010 A;aQ9
967,782,505 *64E42B26E72C9258EF16C6233C33EE6E7A89DBC5 A,Aqd
967,782,506 *64EF9E4A070B070B3D6BDBB68C55F103AEC9719E aaQDO
967,782,507 *64EB7BCBE49C16A878DE15F94A8092524F88D8A4 aaqe5
967,782,508 *64EF1253C7D40DB302E9BBB074D0A60507F8DA9C AaQgB
967,782,509 *64E9519E9A80E9C4DC2F101452FF91DD8EA87956 AaQH-
967,782,510 *64E618CD4C7ECB3DEB099474488F490666078CA6 AAQIn
967,782,511 *64E6B91928F5A6BFAB18FDBD51A80F09AEA48036 aaQIx
967,782,512 *64E0A6799DB6EFF449BBA5F1D360D9A14E7E5A91 AAQN"
967,782,513 *64ED805293DD73B15AB01DD321556BF12CE9A406 aa.qn
967,782,514 *64EFA294E048BC380A7410B99755317B7CFAA7D4 aaq|o
967,782,515 *64E596A406BC09C501FE98C25A749B87240E5FD1 AAQR8
967,782,516 *64E94D29D25A4DB735BB29A779262E260F1CBE98 aaQw;
967,782,517 *64E758DA5EA8DEF037E1A0AB9FD65FAA75D72EBE aaqy$
967,782,518 *64E7DE97A83D98CE89817A820867EC36F4AED38D A)aQZ
967,782,519 *64E43B3556D0B012820558F4B7B36D53599473FD A?aR"
967,782,520 *64EBFAF889C87B4DA1985502C2576FBEAF550729 aa`[email protected]
967,782,521 *64E2BEB01B5E39D37235CD96D7FD757E9C45925C aa\r.
967,782,522 *64E8AA5DEB1341DAA01111E6505602D985BAED25 Aarancibi3
967,782,523 *64E9AABA8801131DAD6777583D433E608A335011 Aaranyakam7
967,782,524 *64EC4D5001588273ADC7EFAC181D89CB11AEFFB3 Aarav495
967,782,525 *64E14BC7BDC31EDA7C0CB7CD166FEE2008E96000 AARBm
967,782,526 *64E64A69993398E4CD28FF30B9B9EA3FF86A9FB1 Aarchiika7
967,782,527 *64EB463FD17CC6481250EB2CB33BA2B2008BFEFF aardappelbuik0
967,782,528 *64E1BA0F745A693CE344322C04CC80DE04178214 AARdB
967,782,529 *64E311C67055129CDE4B73A319251E800E71A59A Aardbeienbedd
967,782,530 *64E6EEEE79012CEC3F6C0E12B02F7E488F4EB353 AARDBEISTRUIK5
967,782,531 *64E9A856C73A7751B0DC4531BF05DF0207FADF0A AARDMUIS8
967,782,532 *64E1AB60FF3EE458D7873D930BB96C2E8135A997 aardvarkrecycling.org.ukwww
967,782,533 *64E95128A8412D697666A648714705876320EEFA aardverb2
967,782,534 *64EDCFC3F06444650426252C46BB38F9A180D6B2 Aardvruchts9
967,782,535 *64E376662D52FFC7CA9E5943F7E5A2ACBC3B7F94 [email protected]
967,782,536 *64E1D2DD00F945F8F950B292127E42A01633B854 Aarellanoed
967,782,537 *64E35BA7B473BF9EC8ED319FD43A0A981B641757 Aargroei
967,782,538 *64E38FD49365EA80F55241EDCA5F1BB49DE86316 Aa
967,782,539 *64E2F893C1E8FAC5463679715691C408F4E25491 Aa-ri
967,782,540 *64E05AABB673FA06669AB70E511CA419F4B6148C AAr-k
967,782,541 *64E81EA352A22A021A9C274F5545C4E95A684958 Aarnebswed
967,782,542 *64E26A098FEC116F660D0D38EDE1635C6A7C0D84 aarnestalkdavid
967,782,543 *64E953752C8A1F06D45612313B097DC14D314FA9 aarokk
967,782,544 *64EAB83FD1E758F4F200C343264F811A4C32E0FA aaron0011
967,782,545 *64E1B23625BF4C631A89B070262F2F6406E26390 Aaron661
967,782,546 *64E9207C55CC74801851B4FDE53FBD12114729AA Aaronalexande0
967,782,547 *64E8BDE227D7036960060B380B5B2802BF1A30BA aaron.amini
967,782,548 *64E10D22862C5C7229FF020B3C84F63E0E95ACCC aaron atwood
967,782,549 *64EBB9F0A392B94A8955AC0CDFE9C8C336E13E85 aaronbeitler
967,782,550 *64E46459A53AFD6CA2B58E2C48622C8B43EF4BDC aaron.bish
967,782,551 *64E051834E698E139C5C460C230CBB40579F0331 aaron.blunkall
967,782,552 *64ECED5165A912EE9439443AC4F6F479F3E7453C aaron.borsa
967,782,553 *64EF2018ABDD6327D8A7DD6B068EEEC70EECC35D aaron.boutilier
967,782,554 *64EFA19444303E79FA49BFCBAB085EA70E47E0D1 [email protected]
967,782,555 *64E04612075625A8DC2DE418335260F793B7C8E3 aaron caasi
967,782,556 *64E5D42F9CF5C7F7F1716DEB5C1FE5F8C6F1B3A3 aaron.cardine
967,782,557 *64E919914452DED75C07F29CB265486B1539D563 AARONCHAMPION
967,782,558 *64EC84C637E2EB038E7D465AE9DB3AFAAD6E94E2 aaron.chough
967,782,559 *64E95EFACDE6DF1560292A0D0BF08F936A4167A5 AaronClevenger
967,782,560 *64E0A923B73C6433DE94065D14EF8AC573D9E439 aaron.continenza
967,782,561 *64E63733415D63E9ED041EC2A11624288E317269 aaron.crisson
967,782,562 *64E528920FA7DA607200F8183DB599EFBD640482 aaron croom
967,782,563 *64EE9052FBD2A49CB00DEEA79681E7FBF5D8A8C9 Aarondave2
967,782,564 *64EE6045FDF01CB7242D62217294A451FB92C1C4 aaron.dowty
967,782,565 *64EA34D81C7E0C1B2BFB0326486D62DB2A5EE5FC aaron.engram
967,782,566 *64E2B833F0E4FE5BBCF5925CFE480EA1C98F4EFC Aaronfool0
967,782,567 *64EFDB3C4542C45EB686F0F1AB108294B7C116B4 aaron.freiling
967,782,568 *64EB654687B46E732A69D4991133FF297F2E5716 aaron.gomzales
967,782,569 *64EA6866AAAED58849E771B6068BF67052E47112 aaron.gradford
967,782,570 *64E45FA58FE8B3DEE1B5C00C00B41E3E639FFBFA aaron.grieves
967,782,571 *64E7D0A117B0DF893F5DAD4585B8EB1B600DDB75 [email protected]
967,782,572 *64E873D82371BA0C5942D328CDADA6783A1FA03B aaron hootman
967,782,573 *64EB487E43B82C84345259E115567C804FC60B86 aaron.hyles
967,782,574 *64E658358B8178DFE324C59AD5E80DA0C3CC19D6 aaronics1
967,782,575 *64E0B55E1767F21A458DA5150D546F61CCEED494 Aaronkathryn6
967,782,576 *64E69F3FD528D27E42B27B86CA8989B7354C8F70 aaronkohrs
967,782,577 *64ED3F2225FBCB298712EB7AFA4318040BEDB2D2 aaron.kolnik
967,782,578 *64E92B899CC03D49ED8D612F761D2D77854B8E11 Aaronkrickstein
967,782,579 *64E6398DA73FD4409BD8B7D05F45B4E6B1D58B0A aaron.leclear
967,782,580 *64ED4270BA044D75191109249D5BBF0FD6FB8DD2 aaron leef
967,782,581 *64E9C3A805417BBA5925C1651CE9AA489C186AAC aaron.lovejoy
967,782,582 *64E536E994442A5FD681B33A60FB851FF3FB9C35 aaron.merlini
967,782,583 *64EB6537DE80D9A358044A100BADF89B9D48B855 aaron.moralez
967,782,584 *64EB8FDD3B982E6A2D5330AF597AD118DA245C9A aaron.nulty
967,782,585 *64E80BEDA632490B6E413F29CB0E58F827812651 aaron pabst
967,782,586 *64EFBB4BC6D1A502666307BA1A7233F8551FDEEF aaron.palomar
967,782,587 *64EEB906635357B94FE7BCFA3A66D1E9A0B35BC1 aaron.poitra
967,782,588 *64ED48B7259CAAF538AA4E689174B83C0A567303 Aaronqualitied
967,782,589 *64EFB284AE77034F97D80A4FB3F50F039FA9A4F8 aaron.rivenburg
967,782,590 *64EC31BA8FB40BAF334C4BD73286B38F5169C6D4 aaron ronning
967,782,591 *64E0A27127AFC8EEDE00D805BBF0C196D7B13899 aaron.simard
967,782,592 *64E370856ADFDE74FD44C5958CADFEEBB7B9FF67 aarons-reversal-of-fortune
967,782,593 *64E949F34A1A282997EDC50A829E7B9A4129A52C Aarontrek3
967,782,594 *64E32ABBF9A0BE16E11FCFA8B7CEBA4A62384C9E Aaronvanessa6
967,782,595 *64E8A929AD32E46F36DC97819D889D07C678BFB3 aaron.veloso
967,782,596 *64E60A9582D27535101D125D7803AD7EBE7EA348 AaRqC
967,782,597 *64E62B20898A49D01A0A6F402DA82CB44BBF5147 AARSMELDINGA
967,782,598 *64E8D3D6225CE3DF2E3B8E3B6BDEAA20AD0CB612 Aarsmeldingen3
967,782,599 *64E6A0BD21A0A0B2298C6C46C0AE3F447DD96F46 A#art
967,782,600 *64E7F75BC718F17CCD1E812C70F03E9AD8171F18 aartibhatia
967,782,601 *64E102D7127C87A482C5E0955A448D1307213F68 Aartsliefhebb0
967,782,602 *64EE621A8621A87F27E39A384D8CA4BDA7A43233 AARTUSIND8
967,782,603 *64E7712EBB613B222F2E026A9F63F982C7C8EF5C AAr.V
967,782,604 *64E3BEADF350BB172C94282545351B5E8F292406 aarvik 2 0
967,782,605 *64E1D577C153A5E77F5896BD1DE3DC39DCD60C83 A?ArW
967,782,606 *64E6E48DDACC1387C5523AD9FCB623286DC5FE73 Aa%rW
967,782,607 *64E62FED886287C8D7D9F6F652438099D3611858 aaryanbasreja
967,782,608 *64E3B891B03169EAFB163225D70D21A8F4D59042 aaryena4
967,782,609 *64EFB9D346F52B6AE1AD85EF279DE7768A479F7D Aarzelends9
967,782,610 *64EF8BDA524739FC1537C3EF1FF5566225CE29B4 A_as_
967,782,611 *64EA7A81BEB8F2219037C96767F189D2C40DE1E9 aa`-s
967,782,612 *64EF11CDA639F4FDBEBFDD76E410E83B97999F8D aa~:s
967,782,613 *64EEDCCA6923692C5663317A88C75027C368508A aa?s{
967,782,614 *64EF2E2214271453F28B7901E6AA774A51B32636 AaS4D
967,782,615 *64E91945EE7A543D70900B2628D0A8A0E7D426F6 Aas5o
967,782,616 *64E9105EAA5A80CCA3FC8EBDD9BAEACFBD48A4EC aasa;
967,782,617 *64E46899D18DCAB885FF327A27A7396224531A61 AasAW
967,782,618 *64ED3000E63BD587074D9C66DB8C5FA3D080D445 AasBC
967,782,619 *64E3021BB9A07E413F6856E43948FF2A8F0D96EB AASDEN4
967,782,620 *64E3790901CA1B6C9B767104E0B377E308A6CCB7 Aaseivda3
967,782,621 *64EAB3B0FE3760C77F355BEB4B498EF5E13B2477 AASG;
967,782,622 *64E3A7CA6185A5B45777B3F5EC84910139D0257E AAS&H
967,782,623 *64EF5B5DAD4EF7D2F412CD8AD6920828CF799DFF aashaeu123
967,782,624 *64E3E5B4A70CFEB2F78E9343705A6092490BCC7E aashna khurana
967,782,625 *64EC0B5A597C0CEBEC5851FBFDC3C97C64565307 Aashvaasitaah7
967,782,626 *64E71A2709E6083DCFB5D4D657F053384E32FEC1 Aashvayuje2
967,782,627 *64EC7B6F02D4625A1243B5CDE8AE64C2F282A250 Ääsi
967,782,628 *64E143A09A29101D1971C8D8D3195221D9685179 AASIANKIURU
967,782,629 *64E89E7E9DFEC0DA7EA88C88F4C0EDBF480330CC aasimlas5
967,782,630 *64E75764E460445FF6D47571B79245F4BABA4185 aaSJt
967,782,631 *64EE7FF6C657303AF88CC92D53B735CC3CB02D69 A%aSN
967,782,632 *64EE53F6C933900B5DFCEBB63D15AD6A803ED695 aasplanks
967,782,633 *64E0FF4A62C84146DB3D0102E3B5AD3DF1EFB6A9 [email protected]
967,782,634 *64E741D1212243445332EB5987643F6DD94A34A7 AAssW
967,782,635 *64EFC3BA1CC81FD2192633A9EC748E0EC7B271AA A;ASt
967,782,636 *64E11027F102E249088A786910BC369CFAB3AC60 AAsWG
967,782,637 *64E98A8C4CC8C2B8797313D20C1FED63B688AF2A AA?/T
967,782,638 *64E82F23CEE1897421B46D48C912FBBFAE0DD5AD A
967,782,639 *64EF926081DF80A9CDAEA75251FFEC1F7F528242 Aa<t+
967,782,640 *64EFF37FB34B509BF02523FF116D635B10814A03 aa:T-
967,782,641 *64EC7BCDA1402B833BFA269B0AA4614F92D206B9 aat*?
967,782,642 *64EAF3274D64EF9D9ADF58E125EAB04B0F07F831 AAt2
967,782,643 *64E6DD10BFF4052D729648D6BA43ACEB8BEA5D72 AAT2u
967,782,644 *64EF7BCA2344F19E30ED1DA9B9264655360C720E aat(3
967,782,645 *64EE9AA8749C5ABEF679A5321491E852DB592856 A.aTB
967,782,646 *64E18B20F98075F7CD70A7960E6D505AEF5863F0 [email protected]
967,782,647 *64EEF90E70FBE55899EC3FF42966B68F3A806D53 Aatelisneidot4
967,782,648 *64E4576BDB8126E8B8304C2DA38884C34CCCA44A Aatgaar7
967,782,649 *64E0A67BF5104060B4434F9749D517D792920CCF aathahoks
967,782,650 *64EB9F325894A383EB78F40E1ACAEAD7FC533B24 Aatiepuk8
967,782,651 *64E9845F73EABC7A805DFDA505708CD5639DFEB0 Aatiyajaahbas
967,782,652 *64E1B567F4AC80CDB973D9EDC2BA9362AB42C1C7 AatjG
967,782,653 *64E2E034DD4D3B3035E7CAFB1F1D9FE60668FC2A Aatlosat0
967,782,654 *64E6BC7F1E55CECF382637D5EE6AB17CE244BD81 aaT:m
967,782,655 *64E8996270D0D3CCBDEAC3326E04BF1CDB4F863D Aatma
967,782,656 *64EB07578FAEEF3B7A232C1FB3FEE5E1C36D61BF aatnirat7
967,782,657 *64EC6B1390B2B5677261E709C047BB340D24763F Aatonaattona5
967,782,658 *64E5CE0C7DB845D258EC7417130C9AC85936CC1D Aatonaattona8
967,782,659 *64E1334E20FC8E83CFFF3B7DD5192F332014799A aatsituring
967,782,660 *64E9A93499BE18A3B5E935739C9FC2241F4BA4A5 aatsmork3
967,782,661 *64EF99DDD5BA9B96DDC028DB4EE0D6EC8E601733 Aatsrate
967,782,662 *64E0FF817795FB362928E6919D746367D0A845F1 aatteens4
967,782,663 *64E78A9B57582048F77AA1312083F1F6B9A5CA20 Aattilup8
967,782,664 *64E4415CE179D6D0475258CF4423B36750260CC3 Aattioml2
967,782,665 *64EF4016B6C05A994982F80C0196BED6589C6479 aattodei4
967,782,666 *64E50ED3B90EE284D767D0C0D26D8246105C7F0A aattukiu5
967,782,667 *64EDDFE14F6C9D1C1D88B00980DC564B1B478C0C aattupan0
967,782,668 *64E4236F8E8BF00C111AF4C7FD55FCCD7BAF8D72 Aatuduojing
967,782,669 *64EAEB22C71916D6CAFE2054124B92FFF7E82E7B aaTv!
967,782,670 *64E423EEE9D1C891DF2D59CE609E4178E6B3EADD A"Au+
967,782,671 *64E64BB157E933044F78A3740BCF3DD62C88664D A(A+u
967,782,672 *64E699743CE93E2A7F8ABD37767E2F230E96718A A_.aU
967,782,673 *64E873FD5F0587383F12896444E8B0A7AF7D7BE9 AAU1i
967,782,674 *64EF27530C37C9EE6AD88B71B5F8C140736835D8 aaU]6
967,782,675 *64EED3D0850643F7592B455F72FF00FD7DE30A1B AAu7A
967,782,676 *64E66456184F5513A10EA1FB753C09B5AC93D032 aauazr
967,782,677 *64EA9AE851611EAD6C34D86FA61E8347FFBFC446 Aa(UC
967,782,678 *64EA87FADA3DD792B71D7863A057511A04CF9C8A AaUd#
967,782,679 *64E7B0F96C6319F7947A11D724D77B4C43032C74 aaU]d
967,782,680 *64E208984F98BA091AA1E776A1DAB8A2CCD9360F AAUDL
967,782,681 *64ED5C95FAB42CEB2A8E033BA8983B910AA442A1 aau>E
967,782,682 *64E3BE030AD257FF7B01FF4A00FC4BABB29CBC0A aauGd
967,782,683 *64E12A5625B9E4B49D0F2A77D3B2ABA5EA226F7E AAugZ
967,782,684 *64E53D0C9BE6AB82F904B4E5604836EF6849216C AA$Uk
967,782,685 *64ECF0921B2130F8A2907578C3B2350572A0969A aa]ul
967,782,686 *64E1ACE8BF82045994BE767C5232E20172151DB6 aaulL
967,782,687 *64E23A58109E0691805A85A109D131D7D412EA1F AA,UO
967,782,688 *64E5A6F316FE10337933283239103804AC40CF65 aaur_
967,782,689 *64EB45683AFA736A5EFBE368DF857784458749FB AAURXIMSDL
967,782,690 *64EA40175EBFAF9E8751EFA9B60F209324597885 Aausgabens
967,782,691 *64E8406FC8E8941B005DF678EE84DA6B56061513 aau+t
967,782,692 *64EEEC8076B8203A6661DD171FBE9FB5BD45CCF0 AA>v
967,782,693 *64E122C2213783C6863C80BC2E8FC66602BC566F Aa-V=
967,782,694 *64E736F5CBCF7A4740BDD11D322EBFCDAE183926 aa.v$
967,782,695 *64EE29D18892157570E164B365D06D84D9DE671B aaV0E
967,782,696 *64E38EEB201F43787480AD5032CE54FDDF36CCB0 AAv/2
967,782,697 *64E77A10F0CA9840192064F96017F1BA3492CC3D aaV4<
967,782,698 *64E9B3FA047D4B89937C9CA0FD44B8E466B4F96E Aavaasayishhyaami7
967,782,699 *64E155052517910D058C94EF4F2CE803D748A076 aavaatsaed
967,782,700 *64E7D1F8F852524EC89A964C1F8799BCA7B06B72 aavaetot3
967,782,701 *64E8D14C4DC6B18D13BE833E34BE2370F17ABAE6 Aavalit5
967,782,702 *64E6AF4230C286FFCAA12F8899B3DF9A2213B6EE Aavartamaanaanaam5
967,782,703 *64ED0A348B6B757C8D10DD0F4B2258923350BBE4 Aavartamaanasya6
967,782,704 *64EC48BDE1AEB90B69EA20F4340A2CFB3958EFBF Aavasathavaaned
967,782,705 *64E8876AF5ED1E13EBD26B165BCCE460292FA51E aavasato4
967,782,706 *64E08DDDF05605CD45A4A9E4DD4D13DE5155660F aavattaled
967,782,707 *64E09FEA1E050BE943C8C3E65B74DFCB57CF950C Aavattut5
967,782,708 *64EF9230945883A41FCB6076C7BDA93CD6359418 AAVAW
967,782,709 *64E9791ABD70766AFCFACDC62E44652F70E79A52 aaV-d
967,782,710 *64E4CABF869F27723B0587D595C72F147AC06931 aaveliak8
967,782,711 *64E4924F945627B776A833BDDA70A684F9CE75B4 aavenrak4
967,782,712 *64ED7037DAE9DC9C54E4C5C168E6E963D7FD74D3 Aavidhyata9
967,782,713 *64E4BAAF251353085808053F661A5714A81539ED AAVIKKOASUN
967,782,714 *64EBF90F81A7941FC7838A1C0F30D20C203255D5 aavistavalta
967,782,715 *64EBF85304200E4D1DFFF875AEF51FEDFA1C3A64 aavistused
967,782,716 *64EE1F4D4401B6DA386541CB05FD2F9ED33AA567 aaVMb
967,782,717 *64EC7CDD0C81268D75F004070CCCFCFEC12D434F A$Avo
967,782,718 *64E5854F954C5B51BD00D1FDD78465DDE2A48D52 aavonlineorg
967,782,719 *64E5C9B8D22D2DDB32691B7E5B507A48BE944A3F AA"Vr
967,782,720 *64E6E51CD7FD6C3984D36F98CBAD9F3C7898C00F AAvRk
967,782,721 *64E48FFA396F12EDB14811E2D462135DF7359C46 aavuX
967,782,722 *64E6F4969A4E1B22A62290B67EADB47EBBAF63A7 aavzy
967,782,723 *64E5AEB6A75E589BBC0A57FB96C5C249F966043B AA:)W
967,782,724 *64E0997ED32502CDEDF312A230CA2507E02716E9 AAW;"
967,782,725 *64E8EE83C8193023112A269EB94BF20F00890101 A-_Aw
967,782,726 *64E263CCF0451508CC3B83B838D264264BAFADC7 A
967,782,727 *64EE15C987EC71C2381564C13B57C2CDB1EF01C6 AaW,&
967,782,728 *64E6AB85EBF1BB1AED0A7E075794EB1E4D0AA148 Aaw3
967,782,729 *64E1918937CFE04EC97D260FBE6FEF8C3B4EA5B8 aa$W5
967,782,730 *64ED01D4F58F78F5C73944C890BFAB579CA192AC AaWC+
967,782,731 *64E08B93EA27D4450B61D08BED48125CFD08BE12 AAWcj
967,782,732 *64E25395A679A8D6547718FFE24B7371CBB80A9D aa(Wd
967,782,733 *64E20FE547F955AB758EACC7ADE57233B08E6BB8 AaWGT
967,782,734 *64E5BE381DF7259197DF4497E7844470001EDE33 AAWH
967,782,735 *64E5C86C1FB08C3909A177A02BD24AEF95BBB2BE AaWmp
967,782,736 *64E6038CDA8A3018300FD2B89CEEE108D3A11091 AAWnT
967,782,737 *64EA01FEFC56D4B3ED2A9ADD71024ACF3E651288 AaWoN
967,782,738 *64E42F99842F2FBF8B3C0CD68618027EC650203E AAWR;
967,782,739 *64E76DBD729E00E33E3F0C666BB3616CD092AFA5 AAwvq
967,782,740 *64E2E93A7B85F477DB2B28DBCC352D1EB4A7021B aaWW^
967,782,741 *64E5078A122386DF8D3C6FA4D86C3ECC40786390 aaWWM
967,782,742 *64E0E7684DF158C5E28A1814A4DA06953188BDF0 aawzh
967,782,743 *64E356A2133A1BDEBA938E17D563A1E704A74093 AA=X<
967,782,744 *64E29A3F64C1B9D585A001DFA1E08C5BAD66614B AA'>X
967,782,745 *64E873234B12847467C0E50FE2527E1F7767EDCB AAX&
967,782,746 *64EEEF0831C2F9FEADC6E02E529A0B50C246479D AaX;-
967,782,747 *64E2120526A587F601F0FD9F14BEBEE43D936A21 aax%-
967,782,748 *64E8364167279573F7962ED86CC29682F212B888 [email protected]
967,782,749 *64E6C61F0FD61E47D2387DCC6728F2A7A142E362 AAX(B
967,782,750 *64EBC1A52BECE43BD341E64A682524C616A153EF aaXF'
967,782,751 *64EF44F4965B9805C327B893C65479A047978592 aaxgbb
967,782,752 *64E1F291F1AA114CACDEED4DE9D7FBF3D34C8D28 AAXgZ
967,782,753 *64E50253DE275D2DE170C0991E5BA6CACD4F921D AaXMj
967,782,754 *64E1C973DA737C2DF921C8D1A147A2B000D4B7A8 AaXOk
967,782,755 *64E854ECF95EF5669DD5390149AE2832C92F2ABC aaXu8
967,782,756 *64EE479518976204579434B8DE2A5B6B15381A85 aaxV=
967,782,757 *64E495DD160F2BCCF62344887687FEC3A1F3EE2B aaXXC
967,782,758 *64E54FFD06E2B1107D95B62B74604614770A7796 aaxY[
967,782,759 *64ECDE9E250B42FC3E1D63DDDF1A1F81DF312915 AAX$Z
967,782,760 *64E364AD5582C80AA92FBE16BE4C19D8F7181B27 [email protected]?Y
967,782,761 *64E88B6E4BCC64D85972540A4289FECC89D9CD30 Aa=Y:
967,782,762 *64E425903C9FCBF58967C54EA749F5E27845A035 Aa$?Y
967,782,763 *64E5C86544ADBDAFEED2F0A1567C96CDCD2B09ED Aa<+y
967,782,764 *64E42592D0FC1F212E5CCB4E0B245329AB45852F a:aY
967,782,765 *64E7D916A56402360B55485B80D86A686E55B678 aaY=-
967,782,766 *64E9C6DD9F218166353BB01A790CACD593935DDD aaY$*
967,782,767 *64E2FB699CA6751DB5C9746FA4467854093F41AB AA=Y1
967,782,768 *64EB143C90FEDA2A14AAA6E3290D186BB391666F aay3v
967,782,769 *64EC11A27D798F8D1830B6F47293844EBD83DAF6 aay7=
967,782,770 *64EEE62F6D2E0197B033BD8FA34F6CC26997DCD1 aaY8(
967,782,771 *64E9DD917B892655DD44D71BFD725CBAFC40E68B AA"YC
967,782,772 *64E94A68776AA8896C5B44A16D19D101EB135580 AAYe#
967,782,773 *64E8C840B12AE389905DF9B383FB75E5EABE21D8 aa|YE
967,782,774 *64E656B1F225DB20BF3BFF404AC87311228F5F3D aaYFv
967,782,775 *64EE59D3049FD478D6B87EAD48E407586562E16A aaY<W
967,782,776 *64EF639426E97F09E6CD395D22A3215D64092CB6 aayw>
967,782,777 *64ECFD04987D24658B58269BD7070D37E362F04E aaYy?
967,782,778 *64EAFF2BCB5F2F2F08B11A0A4FA8DA52E00B274A AA
967,782,779 *64ECD816A62B27E825DD26821F924CC8ECE44F19 aa>!z
967,782,780 *64ED4661C4B0821B60C9C27E57CD86A7BDADFDA3 aa]{z
967,782,781 *64EB7E716F045B268DEC7C0E225A936D3AB5B4F3 aaZ)1
967,782,782 *64E8E8AD88DBE5C0BBD5A02F89FBDF78213C0F75 AaZ.5
967,782,783 *64E24C48D539E8109BA64E548AE2E6882590B266 aaz51
967,782,784 *64E92813E5ED873E185B106BFFF6582254A32531 AaZ5D
967,782,785 *64EDF9785D5FB9CFEDDC36F519027A5B36365B3C AaZ9B
967,782,786 *64ECD366D829A05C394D77BBDAEB5D3A464CF83C AaZAL
967,782,787 *64E88679E62F58375AA8B934D33A73A5CB916CDD aazCB
967,782,788 *64E3972DEEE20E61101BAF6CC65DE9209BAE23D7 AAZg-
967,782,789 *64E113A12E4F9C9F8A9249C42FD27436296EDAC7 aaziyhcouture
967,782,790 *64EF9187A728E5A2E9F3217A6FA6296E473A0536 Aa-Zk
967,782,791 *64EA1FCCCB90A5196BF6766BA8E556356C5B862D Aazkeetsing
967,782,792 *64E37069B0659FE983EF4B0B148B079C7A5E357C AaZ,L
967,782,793 *64E093C96CD4971320B784A271D5C273DA481905 AA;Zm
967,782,794 *64E197B15780F264CFA2C73F7374F23DF9ECA547 aaZpD
967,782,795 *64EB4B0F380734FF2096B3DB0C9BF82BC337BD17 [email protected]
967,782,796 *64EC08C770BFACBE30B13699AD4C7D2453A84D83 AAZqH
967,782,797 *64EBFBFEE43DBF376FF78A20B133FE52383F2D05 A:AZS
967,782,798 *64E8955E4028276C8A857CA217E85DD37130B8B7 AaZ#u
967,782,799 *64E64FF73B41E15F0DDD646A6278513D32C6B0C3 AaZuR
967,782,800 *64E2A57129A875055042FE454CE11B136C368C91 AaZw.
967,782,801 *64E4326C972B79B58A0E00BF85001CA55F9366EC aaZz^
967,782,802 *64E3D5D0589DAA060C44AA7FD4D184522B2BFE28 A=);B
967,782,803 *64E48E28F38B6C299DC9438703A53C209CD75CF1 A>B'
967,782,804 *64EBB3ACED2A32700DF30D225E983F2C3D7D20CD A,,/B
967,782,805 *64E8BAE8144308A2FA5629EF507FE0FF68EF634A A!/=B
967,782,806 *64E668F6A1064F3DD7ABD4B0A7A3B441F8CB9D69 A"B:#
967,782,807 *64E8B994B597634A692701C9D7797C232C05E12A A#
967,782,808 *64EC643E49359AAE4C5A37B409F00760EEECBC4F A
967,782,809 *64EFB8074EE0622817F2798965530D9BFCA9C38D AB;#_
967,782,810 *64E5705A3B4681F8B5A2B07F2F9D386E932CF7D8 AB/=(
967,782,811 *64EE894AE51509173E618E622E8CCB97FF7735FE AB%";
967,782,812 *64E8B0A541252266F0F96B586013EFF569177019 A=(b&
967,782,813 *64E9AA200552B81FF8E3450AD924C1709FDBCCB9 A)=/b
967,782,814 *64EABD65999C3645EB0380548ED0310C1F65CBF2 Ab"//
967,782,815 *64E7DC8399BBE609AC565E05266C9EB5408C2626 a"'B
967,782,816 *64E03C2C9B34D666D44FE7E5F016C5B61C6B3E52 a>b[
967,782,817 *64E9379B0BBF6371370F2AA17A8DED878D699E50 ab<!$
967,782,818 *64E4E1CF70E4EF680F2FB4CE69E5AA30EB240DDE ab=
967,782,819 *64E0F19D373C9454CFE540E21C120BCEC59B29EC ab>,}
967,782,820 *64E57D7081E9DF213F8D683614BFC51023AD0665 ab>.*
967,782,821 *64EA926BAFDF73F66FAEBD9334F671ED0EAA8BE1 [email protected]<
967,782,822 *64E3301A2918E94F727835168463AF155F363ECA ab'>[
967,782,823 *64EB10780D6FB1A53FE1640F3D15D0005F19D68D ab'|>
967,782,824 *64E3FAF35602A5E1CC02EA16EED8EADE03193E51 ab()+
967,782,825 *64E7F91F4E265FD16EE212DA893CBB5A9D0783D3 ab(%+
967,782,826 *64E0B189E384B303D228DDB3D17FB50A00A93C4C ab$''
967,782,827 *64E0395C9F831444A5D1E60F6468630FBB686FB7 ab*`,
967,782,828 *64EA6F0100F827606C2AAA62DCEF3E2843BA97D6 A)b0_
967,782,829 *64EEE84E324BD28425B573D8AC5CE705B9377AD8 Ab05$
967,782,830 *64EE6E283D924266DBB938F4A2701F5386E1CC3F AB0F3
967,782,831 *64E80B89EB68B7FE1548F6DE96A9B27D39771D65 Ab0gp
967,782,832 *64E59CC28CD9BF26FF970A2901298FFAAC749243 ab0riginal
967,782,833 *64E82C27D0BB94853963E86742BB4A230E0E48C4 A,B0Z
967,782,834 *64E23A6C14DE667F345FCB25B5ABB237B5BBFEE3 A_b1#
967,782,835 *64EF5AD1CDE230EC6A891E73E2BBFEC7375EDD98 AB11=
967,782,836 *64E26A61A18463E656ED4126209ABBAFAB71929D Ab133z3
967,782,837 *64EDE46ADAD92AF08449FDEC79C159D2FA3C20A5 Ab15"
967,782,838 *64E6D525F3100871277D725F7276FD32014508C8 Ab1bW
967,782,839 *64EC7C73AF017EA392183F5035F5B32464C958A7 Ab#1p
967,782,840 *64EBD390800906EF2A4E891F39219B261D1E3855 AB1Sf
967,782,841 *64ED1E594C3246657B03A884AF7F26820E0357A4 Ab1tm
967,782,842 *64EFAC8A633E5912B7E085DA4D5B8B4D88A32AE8 ab*1Y
967,782,843 *64E7EE805E62BEF2C0F9A96DFDB09958CB422289 A+B$2
967,782,844 *64E258ECAD30EF0971A53E6CD2E663230DD19400 ab2<^
967,782,845 *64E51F1DEE915CDF34FD1D34D9B8BB52769A7615 Ab29G
967,782,846 *64E325383CEEAD59E8550A4F2905FBFCA62327BF ab2Fl
967,782,847 *64EEAA84E550F9AC6C162F2D7584D4584D67D85F AB2;I
967,782,848 *64E3FA8009EA1D255C69964812EB20DADA3307CB AB).3
967,782,849 *64E5610A076435E45A32F4A23650874D8EB8B727 A=b3(
967,782,850 *64EEF13D501732A2478B98CF71907170D03F766A Ab3-%
967,782,851 *64EC3449AC09D4F0776CF367F5B955F8A0723AF3 ab<3!
967,782,852 *64E8205A1C5943F0050D5F4BC24D33C3ABB6A56D ab³
967,782,853 *64EC57007DC56AC7A21B83E06F24E71FE3BCB23A ab3135
967,782,854 *64ED8303336B2B9C1AEA87BFCAD343BEEA8C2DF5 [email protected]
967,782,855 *64E70727D1D07771C86DE5572451792098665EEF AB34d
967,782,856 *64E7749E605F74A7C6D422607CB8880A66A7A8AA AB3ca
967,782,857 *64E14CC5BF289E6BFABE5B167FC7CB9F58E987CD ab3e52
967,782,858 *64E4197566E759544687829CBB74CA7EEF60F7B5 Ab3HV
967,782,859 *64E6BBFA6032C948F013D9888FA508C9F77304C4 A#B3I
967,782,860 *64E80A72DB378174C93032A007FA0AD7636934B6 AB3n
967,782,861 *64E330A7DA9AC2E1A80A9615A7BA90F607D780D6 A_B3q
967,782,862 *64E353DB15C593F4F58E9C3E403829C76AFDD05C Ab;3r
967,782,863 *64E1288930C2F8E9E8F91D43DE03B3BA602A47CE ab{#4
967,782,864 *64E168B8C4C3024D368C455C960598C019414FC5 ab4_$
967,782,865 *64EF71AE89E0D7BC2F3648F86A13D3FD6E247E54 ab4#8
967,782,866 *64E5D5D8BB1E872CD20C89CDEB62A0C5D71AF42B Ab49G
967,782,867 *64EE4B2CC0BFA9A1C786BB64175507C35AE15C6B Ab4g#
967,782,868 *64E2E0E13DC1666ED82437039C2034A75FA75B33 ab{4l
967,782,869 *64E86CA3F67E05E245B9D6934BDF3AD465335C47 AB4WU
967,782,870 *64EF95322648E6A760BAC35854EAA559B0526A78 ab'5|
967,782,871 *64E999DDFB002FEC87062918BC1BCF5DA6961818 ab".5
967,782,872 *64ECF0250C3031E9282A5330EA7E700B28388889 ab55W
967,782,873 *64E9CEEDB5069F9E5125D9EF79B9FF1D294FF604 AB5bh
967,782,874 *64E1E30CD3727DB4D340CAF0EB0EA1722F32F876 Ab
967,782,875 *64EB96D8AD6A0BE308318BD72DFE1CA1D30546A6 AB)5T
967,782,876 *64EE0F0A1F69A711641B03CF60D0422D7BEECFB8 AB5TRACT!0N
967,782,877 *64E795903482DC84A600188012E1AF1BF60EB513 ab60e
967,782,878 *64E3377BF3FC5289CF448987B93BA67A37377666 [email protected]
967,782,879 *64EC37563E9CC1527F338FAABE3DA6F71992E2D6 Ab6gg
967,782,880 *64EDD01EB19CB286C463111E4FBE2E1C830204F7 ab6VP
967,782,881 *64EBAE11D51ED562E77230D80C553973AE456EF3 A$B%7
967,782,882 *64E651F022D0E734681F0E225A941DEA8DB51081 Ab7Bp
967,782,883 *64E8E9DCC4F4815AD355CB19DB50C25C6A8D2CD6 ab7n/
967,782,884 *64E0E82C4F4FFCAF09232287E979955192EC32BA AB7R1
967,782,885 *64E564AE28FAB63A0F80EE0626ABC72428092653 ab7zr
967,782,886 *64E691515E1E49CCD47B921B4E7E21F60D5029B5 [email protected],
967,782,887 *64EBCC84CFAE095662EE6FA9BABDC7226DBF3C50 ab8+E
967,782,888 *64E308678C4487624CC5952950557D34C3FCA9E6 AB8nX
967,782,889 *64E9F8C24AF5C388F1E9DD76457D08A602CEBDBE A
967,782,890 *64EE701B7FA0C23608060F744EE982575A66A8FE AB8v7
967,782,891 *64E5AADE7E082228F7A9AEAABF4081AC3AB5288F ab%^9
967,782,892 *64E56F8951F79C4E1E43C13DC6A079EE1E986446 ab9')
967,782,893 *64E99FABF54B6238C312D4DFDAF57431EFAAF498 ab9&~
967,782,894 *64E44C11AEFBA6198602A71CCEE44EC31D0A7BEA ab92996741:672155672
967,782,895 *64E8DD96E6A2FBE36BD646D3CC4799C2987832F2 Ab,9a
967,782,896 *64E57384141F334B71EA6ADDD0371A706AE3A279 AB%9c
967,782,897 *64E65A91D91FBC7D8510ED2C70EEFDEC5F03170D Ab9M$
967,782,898 *64E55B096438DF65F6386488B5A1281862BCD687 Ab9pq
967,782,899 *64EE0E1C7B922EA5526281D300D2E1E2B58B9EFF Ab9Q3
967,782,900 *64E68073E49171E7ADD14D2604A428F20FA154E4 ab9/v
967,782,901 *64E7EB04793ED1B212D026EA15C08BCDCFDF3BAE AB)A_
967,782,902 *64EAA31852D80312107EF939FBF88084BF6022AB A;-bA
967,782,903 *64E41F1983C6E871BB3278CD38C35300E1A66A44 aba",
967,782,904 *64E2338D094D56505B9585865C92E465BAB591CF ABA76
967,782,905 *64EE46753C5B950E2B00EBE99AD17684C41C07B4 ab*a9
967,782,906 *64E4B670853CDEC88219687F89683CF9734DAC8C A$<baa
967,782,907 *64E563447C10FAE61DDF4C738214E106A225FC3D [~abaa
967,782,908 *64E26D7B9E08071EDF996589B2817A6D76C69C53 a
967,782,909 *64EA8AF78D2B43CD5FF092B934F6D1572B8EDDCD ABAASIA
967,782,910 *64ECFDE577DDCFB48CBAF97045512ECA2FECECB9 Ababegus4
967,782,911 *64E2E41D6F54D4831AB067D800B06F2639AE14EE ABACADABCDA
967,782,912 *64E7602E7F991135E246947AD6A9F5C17DEC4800 abacefeD
967,782,913 *64ED6299EB5E470E47119287B9420C27C8C8B52F abachou8
967,782,914 *64E6F0D8FA0E7CBF537C7C8F43898F93E1BBFD8E Abacolseqbswed
967,782,915 *64E87E2C7D2485F8F005FCE001DEB62E788EDB49 Abadan's
967,782,916 *64E57CC0BCDD9EF843E3E0D4CA76CB7E15A2C910 [email protected]
967,782,917 *64EA8FEE0EFB5A158DD0B0746F6F688856323652 abaFk
967,782,918 *64E39B1668DB06D48D090169E212684004050B48 abahista2
967,782,919 *64E665EB40775D20F88721A5F70EEBC49CA2FB92 ABAHKUSAYANG
967,782,920 *64E3D51895BA50CF83F16119B4E699C52C17E690 abaigeal2
967,782,921 *64E9E6E91101E8D8E06C69C96679CB2FE789CA69 Abaisances4
967,782,922 *64EA147F217891E63B472EA8ED5426B5EE5E495C “abaix
967,782,923 *64E8E6CEFBFB69B9156478D34A5CDBB2B1BF7AED abajoues6
967,782,924 *64E20C1AC18280DC7F5A4CA9D579E47F1668E225 AbAkk
967,782,925 *64E0E1B1D02A721D8DD484630194305A48808BAE Abakszak8
967,782,926 *64E9BCDAF69E42113F99081B9EAA156462DBB39E Abakumd
967,782,927 *64E970E46B59C35C3943A2BAA6CE6E4085DFFE82 Abalaah5
967,782,928 *64EB34D91EB7CFEA2F769207B512CAAAD7E0692B abalache1
967,782,929 *64E1E959A311385E8AF942188947E38D582AA0F4 [email protected]
967,782,930 *64E63F7353502B301D4A0A4917FBD57216FACE6D [email protected]
967,782,931 *64EB1833146C9663FC2F22B4B29B183F70851194 abamakos
967,782,932 *64EDEBF2C423DED737D4146C9088C3FB0E49DBF5 abamazemo
967,782,933 *64E96DDF37411662F70DF1142969F5F873CD8C8A Abamina4
967,782,934 *64E46E3F325625AFD5AD4B4DA8C3F0DF869E3F1F abancó
967,782,935 *64E0F9058E4BDF370310F2A85FC813D827C94375 Abandonarer3
967,782,936 *64E88CECD3AF110013328C9606CDB5416BA1576B Abandonnents9
967,782,937 *64E22F657AD7A5185C7A8CE2C68715104CB798E3 Abandonos4
967,782,938 *64EB27B73E6F0005AA2F75CD04450DA11B17A963 abandunàt
967,782,939 *64E2F13DA246BE55BE3895A431966EB86DEEFB4C Abangida0
967,782,940 *64E40BA09ED42B38F9B17D0E1F8D0EC34D21AC47 abantwanabasethempeleni(childrenofthetemple)
967,782,941 *64E7BD5BC02ECF8524E9BCEE20A095FCDA4ACFC2 AB=aO
967,782,942 *64E06E69E3BFF456BA891FF6DEF87C4AC3DF97FF ab{Ao
967,782,943 *64E4F66EF2DBB8F3768D3D657587BAD4C74850EF abarracou4
967,782,944 *64E57D07EABAF288633E5F35FC4E82CF0C9C1C8B abartabilecek
967,782,945 *64E8F2206EB92BC7005A2D0A8042338A98474029 abartmadır
967,782,946 *64EAC4C9F505B940D671F89E82B8B97FA2BBD978 Abasourdiraients5
967,782,947 *64E95D419BBFC1B655CA66702E1B45BD0B0CAD18 Abastardarars
967,782,948 *64E84E9DBEDB346747404D811D2E3E41A726D0A1 abastonaram123
967,782,949 *64EA1FD8C1BFC8E816FA422BBE3846F78C37A5F0 ABATAIN
967,782,950 *64E798290E417301BC070631C99A320958F178AA Abatech4
967,782,951 *64E443F606DEDE00690C8233383A00FD90BA8A73 abaterdes1
967,782,952 *64ECE8621AB524709A10016DE8F43C9275FA4A59 abatest0
967,782,953 *64E44F327EF165B8B29070E929554B3543E5E69E abatiola
967,782,954 *64EFA3F0F518577FCEDAFB1A8EEB845CD029B51A AbaTl
967,782,955 *64E0FE203FC6B3339543C410EDAA58F3015A05B5 Abatolibs
967,782,956 *64E1F3D1B253E620D1E958FA21FC2C0E0C437B0F AB,Au
967,782,957 *64E079B9BD05160E06FE1F83577602DEA5D38CAF [email protected]
967,782,958 *64E821D8D31120F42C1F6280C24F837D715B9D41 abAZf
967,782,959 *64E920349BFED3201859EF42CD991A17D4D56A39 „ABB“
967,782,960 *64EA67161B9E33CF68523EA2B2168F0DD6BF7E54 A!B%B
967,782,961 *64E28DA54C666145FCB996FA48E894A03B63C2D6 A%%Bb
967,782,962 *64E9A4214846E7452EFFA2DBB103B0AC835C58ED Ab=.B
967,782,963 *64E5EB8E783427286EBBE76A6EA3EBE561C7451F Ab;B/
967,782,964 *64EFBD2C4791A734932851B7B230EF97D4AFBC00 Ab$B&
967,782,965 *64EED71C874A0DC4FE5AAA52FEAD3F9210187FF3 abb~"
967,782,966 *64E382C3AE64BD3C7360B298A53BE9B57AC02826 abb'/
967,782,967 *64E37639C6B003551C266D0AE9E9F8DA9105C4E3 Ab(B0
967,782,968 *64EF9D1BC0E66760B7C424833078EA0BDD070174 abb1nass1
967,782,969 *64E2CF5CF2717E042C75FD708F94ACDBED87C491 abb1nast1
967,782,970 *64E011769451FB144004A0EF5422243F52B8B5B6 abbadiaazat
967,782,971 *64E93226903AFD41D4884DA655A2100BBD89A704 abbadiamare
967,782,972 *64E25AEA3F31DF9845AB25A6C7D9202434D049DF Abbaglia4
967,782,973 *64E34C21FCC51F64EF9554296BCF72BE8025916F abbaiaro1
967,782,974 *64E00CFC3534E9DAFC8AC7D50092857FB81061D4 Abbaradus4
967,782,975 *64EC3F4F8079664FB2117985D51CB0233D5A55DD abbas160egy
967,782,976 *64EC2AE83EFDD153C56A35F81C1393BF589F896C Abbatiello0
967,782,977 *64E19678B83AC7F6B0C492EDB8FB6DC5FB35379A Abbattete7
967,782,978 *64E81767E42D546B9A5DAD8E314929D1A7C5A2B0 Abbattevo9
967,782,979 *64E6786B7F03D718D69BB9790B39DC81EC2455ED Abbauversuche
967,782,980 *64E33EDB69720C3FC9B5DF8A8E98DCF8CE9BD5A9 Abb;c
967,782,981 *64E1937EA81C160258A6C091B6FB3DADEEF7532A abbe achmad
967,782,982 *64EB6EA47D0E81EDF76190AEF030E32A712D95DA abbegael5
967,782,983 *64E3CF4D3F7B6639B734A23EDDB29989C71DCEA5 Abbellindosi2
967,782,984 *64EF8BBAD8EE1A87C3765F1FF0D0C588351C3CA3 Abbenes6
967,782,985 *64EF7FD2EE274237D4173BCB07A2C90E3A77B926 Abberige
967,782,986 *64E7D9B6B91DDD1A5CC2A29FC6A450AC825A0113 abberufe6
967,782,987 *64E0223CA18AD4D31F17A74A1E43520E7F9B2D3E abbey334
967,782,988 *64E0F2525EA6C0284B6D9CFDD1E90D7F4FD8C26B abbeycoggeshall
967,782,989 *64E93D5188BB5957A0ABA519A05679B9620C4E0D [email protected]
967,782,990 *64E21B0021D5F2CBA0319B5F87C243B4B9E57B2F abbfB
967,782,991 *64E75E1EAD92A7E5E29B1AC4EBF5AB971EAFB1DE ABbG;
967,782,992 *64EE72322C7C8DACC6E977B4F95BD59BD017D3D9 A+Bbg
967,782,993 *64E73385D4B62DCBC933A0A69B59E30779929CA8 AbBi%
967,782,994 *64E66CC1D483637D63F70E42FFFF5B73BA9B13A5 abbie705
967,782,995 *64E77DD2E7B5B0EB7BC0A211BE74E35F42099CEA abbigail872
967,782,996 *64E8DE70790CA0C8AB5F1AEDCD37831437003182 AB(BM
967,782,997 *64ED585E15EF85E1787E03CF26DD27C6EC13FE2B ABbmV
967,782,998 *64EE4F5EB97D242D2A045D5456640178B1A64FE2 ABBOTOMEY
967,782,999 *64EE946B42AD11BC936EFD18B6EDF741D378D6D6 Abbotsenn
967,783,000 *64E6CF7FC871D83753A14CDC35FC8097F113A0BD A+Bbp
967,783,001 *64E8B5697E633E82471EA30B60E89BE41F2B1466 Abbracciate8
967,783,002 *64E1CEC32F9E1BE0BBE8FB77D03A3A91954C9E49 ABbracteata
967,783,003 *64E688FB0ACC76D1F35E41DC61F0467265539ACC Abbratozzato5
967,783,004 *64E27DDAE3F4284AAA49F8BB7B118252385E206B abbrev91tp93
967,783,005 *64E9F97DBB88B8180D91BC5FDDE5644317BCDBDC Abbreviaring
967,783,006 *64EF76F01AED27A8414345B03483D2DEA7A57305 Abbreviatesesed
967,783,007 *64EDE6EF997048EF3E58010CC4402E3B2D2C1628 abbreviationlanka
967,783,008 *64EB26077927A23546B1C71D3B95057773956BB6 Abbreviationsa9
967,783,009 *64E6CE0447CC86146FA621225B5D3961F16638D2 Abbreviatrici9
967,783,010 *64E3A5AE18E643DA20C0DBE92E8FC38BC54BCBF7 Abbrevio5
967,783,011 *64EE49450F51EC0A281A71EEB4A5FB4DAF42CEA3 Abbringenden4
967,783,012 *64E9B82152F0DD52AA16BFED6B8C894D237F117C Abbruchwert9
967,783,013 *64E8F7648EC9E80BB8D28B16949EB89A017C0F92 abbrunire1
967,783,014 *64E39A824F0507BA08E18115106D862987BF67AE abBUp
967,783,015 *64E7202490B7AF8C59675577785D4B06E9A76B0F AB
967,783,016 *64E55493DA3B2B537709351570DA97B3C33B41B1 AbB/V
967,783,017 *64E8753E473B09FF0E3ACDD1E2A9FA61F5558914 ab*BW
967,783,018 *64E92116D860E083BDD0D7CB275FCED2DD9CB9D4 abby098
967,783,019 *64E257B6825AF9092BE558B06DB56D4D4DE883BB ABBY1214
967,783,020 *64E5D6D4918E459E09699D3758C8B5402BA12275 abby233001
967,783,021 *64ED3150F4964DBEA796BE42EADF7EBA482F06ED Abbycfj1
967,783,022 *64EA3A0C8C0F3C3ADA8CFD9DBAB4DB5AD5A1A722 Abbydallas2
967,783,023 *64EA7EAF8C1E14C8A2CE129AE02C0941F846B432 abbydiane6
967,783,024 *64E8C68E6BD462144081DBE62FF7D49FB9D82525 ABBYE-MAIL
967,783,025 *64EFC45BE35D35F02DAE7AFBF462BF4F8DE21173 Abbyfreddy3
967,783,026 *64E8E0F179AB1D0A24A0BEF78FB153FF3CD664E3 Abbyfrederic7
967,783,027 *64EA3740C41696E2F8F7498D91DA1A8F9AFA5857 Abbyfriday0
967,783,028 *64EA580F8F73826A0B1E60CAD7E8BFFC454575E7 Abbyjohnson
967,783,029 *64EA8A1BD78C122E05E2884611E2C1D65F85A7C4 Abbylaw4
967,783,030 *64E7F42C612CF3A68336FA680722B804B6C9BBD8 Abbytimber1
967,783,031 *64E48191384653E8EA54AB6EBD039F0B2DF46E98 Abbyvalhalla0
967,783,032 *64E13BDCA1EDF41991995AFD49D33DEDE5A2DF2E abbywillies
967,783,033 *64E69C8BB763E8587573621EA16E6EB83D967639 Abbywolveses
967,783,034 *64E64D4A1B640126842B48CD5A13C7BE95DB30E0 A$BC&
967,783,035 *64E7C28FDB2A9D8FE2E438C84C507F9878417E3E A"b?c
967,783,036 *64E90E1105D2B4E742FE8335E6E59ED18B0B0792 A$b?c
967,783,037 *64E6E08CFCCF7BB788618F293570419A8EFE46AD Abc:"
967,783,038 *64E2FB70FB42821985DAF1F8E9B37C720A8F82C3 .abc,
967,783,039 *64EF24EF9C8CBA423C80ACF05ECDCBD740A78EDC [email protected]{c
967,783,040 *64E5CF7711F45F43C417203D05D1A478E9731597 abC0&
967,783,041 *64EBAF6AF5463BD66642BB2511A0D42E98CEC31E ABC123LASER
967,783,042 *64E72D66F18962F1D582E7EF852D0E7559EE927A ABC1906
967,783,043 *64E2A8B265DABB5AE10168D529AD6C7446B6C4E1 abc771118
967,783,044 *64E7484EE98A8F3486F18BBA7027E5C399DEEADC ABCARCHIE
967,783,045 *64E25FACE7A447340C92051BDBEF48A9544B66C1 abcbigdog6
967,783,046 *64EFB4DFC7F43A7EDD3C9DDFE3BE0616A131E421 abccoke4
967,783,047 *64E82D927C126B9759DC33223E0F841313A78DD5 Abcconrad5
967,783,048 *64E281257EBF96DA72DC77466A50A9841D05A494 abcdalpha8
967,783,049 *64EF303826C939B23A2CF5CF3D7430F76B18F20A Abcdalpha9
967,783,050 *64E4EE898628771218983056F17C44B50725AD5C Abcdeasshole5
967,783,051 *64EAA869AD93C05635508569C02E2348C77DB55C Abcdebilly5
967,783,052 *64EEE70A0E190C4A9F19C0EA4502E2FC7202013D Abcdebroncoses
967,783,053 *64E6BF4A003F06EEE64E6BA8BF93517FDAC7F342 Abcdedoobie1
967,783,054 *64E2CC133E55DA1EC1E80BF098445C3C6149E976 Abcdefcanced1
967,783,055 *64E5E6D33E6A69C1FD1AD7C4B5017CDE6F1AF06D Abcdefclaire2
967,783,056 *64EDAABCF78CA6FDAB1145AD229E88BDAA42C376 „ABCDEFG
967,783,057 *64EB7C7EB5D53B8314430D4B826B9DBF32311F8D Abcdefgabcde6
967,783,058 *64E00D41A3127FB0BBDF7939D894E1A6DCFED2C4 Abcdefgbubbles4
967,783,059 *64E996B625E87ED7067D04E53F605ABA1B39DA48 Abcdefgchicken5
967,783,060 *64EF7B27BCFCA449EECAF0CE0B6A66B8BCA69EAF Abcdefglarson5
967,783,061 *64E119C40FD66FAD5C29A5BA5F5385DE44CA9645 abcdefgv9
967,783,062 *64EF5F474E2C68BA606D1961CEB2B86938654A1E Abcdefgymnast2
967,783,063 *64E3889E7FFBDF6A580AF78E8CD0F5CB225FDF5F Abcdefkaren1
967,783,064 *64E0D7ECD8AFAC23A712A66489821E4F5D2F1DC8 ABCDEFNEWYORK
967,783,065 *64ECB90644B016160B49BC270E2FD9B3CB21EFD2 Abcdegeorge6
967,783,066 *64E15EC937E42798789FFB1F570A6D20646F1F2D ABCDEKRISTEN
967,783,067 *64E5BDEAAE2DDB82F0BA6BCBA1FD60093692DC6F Abcdeledzep8
967,783,068 *64E13C2638DC6E327FD9CEE59482BB28BDA39E9B Abcderosing
967,783,069 *64E723F7ACBB6784E119000AF281C3B0E31E73FE Abcdexxx2
967,783,070 *64E78CF605C63DB0429FF2A9DD127D5B4AC4826C Abcdhello4
967,783,071 *64EFDF337B42B547A0FF609207A1EB4265E07021 Abcdinformix6
967,783,072 *64E05EC82C27AB384078B55C7677AE0CAFBEA273 Abcdintern1
967,783,073 *64E93B4B9AB1D95C7E1B8B46F1059B7DD038D2B1 Abcdjamaicas
967,783,074 *64E99825C8F266D6779AE9CA856BB071201E67D0 Abcdolivia6
967,783,075 *64E51C6F0E4BA4AACB554E783C5BE00A15345E6B Abcdquests
967,783,076 *64E4F84F7B51D91693D7D9663203F8A88EADE102 Abcdsammiing
967,783,077 *64EDD4DF649F02C255F5FEBADC8FDA1D8746F5D8 Abcdshooter2
967,783,078 *64E9D9888E1E43A12288D5293C8AAC5F8E5C4747 AB?Ch
967,783,079 *64E90163861A6D08B07E99153530ED9B5C5A7C8E Abcházští
967,783,080 *64E91A7FDB5383A67E3D357F8954FF0C7EA7AD42 ABCHOTROD
967,783,081 *64E125A1A518A98A3450ECB1B1E1552A093AE0EE ABC(IThinkILoveYou)(AlbumVersion)
967,783,082 *64EC4A53CB7A7B97846DC9563163A82EC5588E83 Abcjnmlwsqln4
967,783,083 *64E51E1257414AB3FEDD9A79C0691C23AC274880 abck.
967,783,084 *64E67F0B75A0BFC9183C2DFA9666F2030AFC20D4 abckristy4
967,783,085 *64E1F9B7D60A8A6D2AF6AB4EABFEEF81A38A8D8A [email protected]
967,783,086 *64EDB0E5079D9D376F9183020DAC5DEC54E47CBD abCLo
967,783,087 *64EE7434808C8EDAA3EE2F9F4C7280F5F50A3EA0 abcnewton5
967,783,088 *64EE8189A98B2633500A80DE57E0D47AC50F0845 Abcp(
967,783,089 *64E0EBA2F39B4027389FBFA0B677596E7AD5BA67 [email protected]
967,783,090 *64E349FBB6ABA6DA36D1F08B59D56689B98B53CE ab=cp
967,783,091 *64E0572283B2F84C9E3CF5C7610AA135C48037EB [email protected]
967,783,092 *64E4DD17E2BE7FC5D97FE12F34482F5030DDA301 abCpR
967,783,093 *64E8FCA26C80B859ABEB38D9C3E862C1061B1DBE abcruth9
967,783,094 *64E5D00FF2451947424AC19CEF1315B4B3AFDFF6 Abctrident1
967,783,095 *64E7FD119628A03A910B87AA0680AD8C99AEAF17 abcWD
967,783,096 *64E727ACD9B23212577A5FB67F9D837B1B3D32E4 abcWH
967,783,097 *64E025A9F124619718B017B78C6282DFE5B7A35D ABCY0
967,783,098 *64E64113B39619CC8D6BEC42559FC9D3EEA16A92 [email protected]
967,783,099 *64EE850E880232D2EC1B4A46766D477577B56A3A A/b+D
967,783,100 *64EE677040A30FEDBA90790DCA0CB730EA1A5842 Ab;d"
967,783,101 *64E3A95694BD2593CB3BA9DDE1836445FFBCF03E ab/:D
967,783,102 *64E2506FBAF5A2A22F0AA263850C54DF8A40493F abD"[
967,783,103 *64E5F365C512BDDED48C709E71B56E09C12F329D ab|}d
967,783,104 *64E37E84B36068FE65F83CCD7F8715539CFDEDAE ab'd|
967,783,105 *64E85DCB0FDA08FA5BE86860790F45CA2482B03B [email protected]
967,783,106 *64E7DACACB25D8D3B77EA1436E766392631CB49B ABD3f
967,783,107 *64EE76392488F1E29416BF3216707E7B039E8BCA A#bd5
967,783,108 *64EF9ACD279D8B0A6A2A64FAB2AE3968A0581A74 abDaC
967,783,109 *64E8E9A3A89CBE86A4FE7A06D7CA7B961EABF3A9 abdali4
967,783,110 *64EC000328316505779C574A4F236D6D61EBD0B6 abdallahbaajour
967,783,111 *64E4A2B168293D557B74F73444A8BF67923BA18C abdalla swiri
967,783,112 *64EC1847914BE0CB4DE466DE52E421CE3F5BD7A6 abdallats
967,783,113 *64EDFC69AFB221A4B837A43D2997D619FD40968C abdalrahman ahmed
967,783,114 *64EAF912DA305F60A85F8CFBBDE6DF59501AD2DB abdAZ
967,783,115 *64E4A9D68DA42CEEC9732E020E44FD719292A087 A)BdC
967,783,116 *64ED90BB9389F92B6135F1BB5FAFAD3B43E20F2D AB(Dd
967,783,117 *64E7E0CD4912C5E4C7F8D24D79F23C5AB7EFFC57 ABdDD
967,783,118 *64EF43CEDF212A9611F18BAED4C15BD8A46AA80C ABD#e
967,783,119 *64E8953B49FDBD22C2AAF598D89CB328AB195D0F Abdeckungszonen
967,783,120 *64E3F53F58CD9BFEF3E12E78F9BD050BC8438CC7 Abdelmajide
967,783,121 *64EDE924D0B67F4D2AE42C44CCBED7C6EF84EAC7 abdelnour160
967,783,122 *64E6F47A692850772CD1D544EB4FE4AF35CCD888 abdennour),托希奇請纓無路,更被租借到
967,783,123 *64EC93A0126A21A4E5FA378B657E85AB15F78E68 ABDh:
967,783,124 *64E09C7251D2CE1EC78BD373D76A6822ADE7401B ABDi+
967,783,125 *64E6C8CA7D946496413666CA0D6BCDD2DFF95DFD ABDICHERO4
967,783,126 *64E475BDE20EB388924A7119CAEEF80B04034513 Abdiel562
967,783,127 *64EDD97707A1655F6E79E8A9BD86034D2CEAFBCF abdiquei3
967,783,128 *64EAAFF88C22D35A8E05BAE65FF1FF1F2ADDB0F8 ABDIRAZAK
967,783,129 *64EF7255BF346C00992D3DE16ED2ABDFFBC71A59 Abdises8
967,783,130 *64E3CD8E6302FD4B7697AF871A0A225AF5F6F26E ABDIW
967,783,131 *64E2AA4AF115A1DAA04E6D57D271CFE45229474E [email protected]
967,783,132 *64EA540E9E6EFB35533897E59F643484350C91AB AbDKR
967,783,133 *64E2E1ACDD1E32A4C574A3C9D4D254191E406E97 abdlkhdr1212
967,783,134 *64E2C2A667B466B76FC1B0E67516E53A5BABF1D7 ABdN=
967,783,135 *64EDC27D689AF5E071D3DBB148571C59F3C08EE0 ab{dN
967,783,136 *64EE3865F55370D4E9F9D711760963DD0A753DD3 Abdolith2
967,783,137 *64EF664D4CAB99C932892F6F1515FCCE1D1D78F9 abdominalia8
967,783,138 *64E0A741E871B03B326C1D84591917F8A29447F6 AbD=q
967,783,139 *64E5C811BFE600E961AA493E3149995F14CF65E7 abDq^
967,783,140 *64EFC62DC7B65577FA6D347C9EEDD445394E086F abdreht9
967,783,141 *64E2EC5B047265DC32FE30C28BB10F0D3C3C3716 AbDRN
967,783,142 *64E798E18BB6A5979776A04BFFF57DFEEFD70BC8 A.Bdt
967,783,143 *64E680CA2BBC1C0158605FFDA8F7388040467B55 ab%Du
967,783,144 *64E2F4BD12E827244D9B95E4D2FC8CB5A9F4C594 abduafored
967,783,145 *64E10F1159414E4D3DFFA9F274DC0CFF1022997F Abducta2
967,783,146 *64E9B653BE5E2C20D9DE91DD98AB688D5F2C4EAD abductee+
967,783,147 *64E05A99EE448558C0E9BDD86A3677F499F289F1 abdulai timbo
967,783,148 *64EBF3BD559562567706F24F6F096A2A08657093 Abdulatti
967,783,149 *64E1BDAFA6E5AFD086CBC335C81A14866DEECD14 abdulazizsaleh
967,783,150 *64E2A472B5F0C2EB390A51A7012D6BE9CC43B1BE AbdulAziz)廢止
967,783,151 *64E9D5EE82AB693AD2309C0A4F9EB17E809B8799 abdul.bonefont
967,783,152 *64EB0CA745382C17480CD552F7BC6ED026E3FFBE abdul.bowlan
967,783,153 *64EEB38797B4446BCA3131C5ECA1AF94BAE17EDB abdul.bumps
967,783,154 *64E5454B58E46FA48949A797B8EDE45D9A60F0FF abdul.cherep
967,783,155 *64E7972E91899B7336D8E0C42DD118498246CC25 abdul.civiello
967,783,156 *64E3E7AF80282D62D5583EE2311E2A5E48280B0C abdul.deltoro
967,783,157 *64E924A40CE832053A6128B1B595E0EFFF10C08B abdul.eyman
967,783,158 *64E791031486A27B42C528C7847018B3B4430622 abdul khalek
967,783,159 *64EF228D1FDA84F01055C82223E4B225A12E67AC abdul.kratt
967,783,160 *64EDEDFDA6AA6CA296A289F8CAF13957B4B777B9 abdullah303
967,783,161 *64E9BF04E40D8EA47E374D0A24B688F76F173AA4 Abdullah346
967,783,162 *64EC8CF7BD64D320744B04510F709B7D78268F09 abdullah425
967,783,163 *64EF83A2CF5D6B03776F6949378A9DBAEA4A75B2 Abdullah707
967,783,164 *64E17946DDACAD8D44F101F960042CB2CF4C1630 abdullah s bin mahfouz
967,783,165 *64E9C9CFF0E5AF8BDA8C7DB00D78695C7CA9DB1C abdullahuwais
967,783,166 *64EB2BF65CA7C8BD14A44AF55063B73B0DC92B8B abdul.lawrey
967,783,167 *64E2936E5AB1433F9401EBD9D95F77A4A54FE4CC abdul.lightbourne
967,783,168 *64E0C5C9C8895865B703D19D3531679E3E97509B abdul.loskot
967,783,169 *64E0675B4CEF5BCB3514CE24FFB2FF6DAC3A8415 abdul.manzer
967,783,170 *64E51913F90C9B20EF0AAA928F39C9516DDB0D1A abdul.marton
967,783,171 *64E8BDA861E7177BB7E3DDCFF03BF3CD104098A0 abdul.mirabito
967,783,172 *64EFEFCE91595B177ADF1F08C1885FFD1B2B5BA3 abdul.mowan
967,783,173 *64ED78504E086E6A9E0C73759E89B41639AC0D92 abdul.peretz
967,783,174 *64E71A3DE6589E558F0FAECDDD8764705964D24D abdul.psencik
967,783,175 *64E048F641CB872B42EE25DDAC0A163EE59F5E4F abdul.rabelo
967,783,176 *64E9BE344C65CE22D7F594E5C69FAEDBBEBC4A46 abdul.ramjan
967,783,177 *64E667C68ECD662E7ACB303E1DE3A28C3B7B3727 abdul.relic
967,783,178 *64EE94D6E031F17F0C601462103BE7C232EFC930 abdul.rieffenberger
967,783,179 *64EEE136B9D9DED0022D58E40FD5B9A145D01205 abdul.rolla
967,783,180 *64E50596078A4E6D9EFB22DCC4DA3A9D3450E6CC abdul.rubinstein
967,783,181 *64EDD9AD22E23C22C39A5F14BA4B687109ED15B5 abdul.scheuren
967,783,182 *64EFEF9CA93F926C60326DCFCE47489F49EC7D6A Abdulsemed0
967,783,183 *64E40C524478EB62988B708521F0565769CEE957 abdul.sharrieff
967,783,184 *64EC7C737D6FB52731DECD55E1E07E973A4FBE97 Abdulwahed5
967,783,185 *64EF2EF69244FC15CAB863A58EABBB69427692CE Abdurlahman9
967,783,186 *64EC9D996F81DF169728F35587FF75F685C87535 ABDUSCHAPAROV
967,783,187 *64E637AF23B8A407C53DA6DF0DB149615B109AC8 A#B
967,783,188 *64EA9A9CC4630C27DE54AF0C2329C4A58FE34C0B A)be/
967,783,189 *64E54A3B7D6638DE40F872B1C30E530F100352D2 [email protected]
967,783,190 *64EEC60697A5175365F648A6E89D856762E6F495 abE7I
967,783,191 *64E04C332D0C4FE414897AEBC36FD5904AA793DB abeadh
967,783,192 *64E82252A2E77A17616F4D1EE4FEB600FE1CC161 abe.alshouse
967,783,193 *64EEC138A10E840C7405FA91C9157DCB226F3D8F Abeathambswed
967,783,194 *64E798171DA08F8EC2BDA48CF721B39024CDDCFD A Beautiful Lie (instrumental)
967,783,195 *64EDC8E8D9137FF11D13E064831A242DFED4961B ab)Eb
967,783,196 *64E54A83485A6C0510E297CF8C673540FB117679 abe?B
967,783,197 *64E05E47DE521FFC2DDB0ABA86E7DFEF98A26AF8 abe.barket
967,783,198 *64E03CBD0FB654632714E2FC55810D69FFB70768 abe.berke
967,783,199 *64E2FB51FC33BD5323628138627309B2DE5EAFC6 abe.buckelew
967,783,200 *64E963A86F8D2DFAD5951D4885168AC5BF193378 abe.bullocks
967,783,201 *64E23BC8704AD46D1C1937AD453E1B00274292AE abe.carvett
967,783,202 *64EE8CB432A38FA4B63079514E702F8E4CC8208E abe.cephus
967,783,203 *64EF10F73A283711CD4421BFFABCBC8B41B3D7ED abed+
967,783,204 *64E45F69630B38082F362317A4E5E45C49BB572C abeddpjd8
967,783,205 *64EF0CEA19FF1FDD587A93BA45451E846982002C Abedonbp9
967,783,206 *64E3559D64F55F1C4875681E700AC7966E96EB72 abe.dorenfeld
967,783,207 *64EFEB6B2D42896D499824698AB24C24A0122F2C [email protected]
967,783,208 *64E01B75FDBFFD48347C081E457CC51635C25135 abEf?
967,783,209 *64EFADB8F6153B123CE46D6A554025B3E975F685 abegdrahing
967,783,210 *64E43CF2A3BDF5FFD4F6C73771EBA8F18467C62B abe.herbein
967,783,211 *64EB1FCF79095F80643DA4AF8B146DEFE3D31BEE abe.hiciano
967,783,212 *64E887EC9ADE040BB90B6C9987C6263A3B1A70FE abe.hiltbrand
967,783,213 *64E3AF5C7B740F2F77CA3F041A004883E81BC488 abEhr
967,783,214 *64E72DF8DB4971338968F1A614EFAFB37A2D3718 abeiloiam
967,783,215 *64E0087504D1CF15EFE2B99F068D4768C13D2265 abe.katnik
967,783,216 *64E765015F9721514A5B7AC202CD9BF5A0ECCE60 abe.klosterman
967,783,217 *64ECD4C8C30613904716C7C1D3538F81E2E094D6 abe.krows
967,783,218 *64E2DBC223D3FF3D60405AA087674D40FBD451BB Abelakuned
967,783,219 *64E0E7A83FB9DEF709E16432F9EF4C4EA8D29D6D abel.bilal
967,783,220 *64E9CFEB5B1FF56DF7D55A733A85C703F5B9F804 abel.brockington
967,783,221 *64E0EE628A7DA1BE79B21AAFAFF66D16B3809444 abel.burdier
967,783,222 *64E852AC41942BC2F2DBCB298164102B709071FD abel.entz
967,783,223 *64E5EBDB9A77528594F797D2FD5572E1A79D0162 abel.grunwald
967,783,224 *64EF4EB93652AF0BACBC74645FD154B6212B6292 abel.heffelfinger
967,783,225 *64E3E2A57F084402672AE94D46E8BD22F9AC4692 abel.iglesias
967,783,226 *64E865CCDAC2724C46ACD49A119016C609F60350 abelkatz
967,783,227 *64E568B01643278B0ED59181319C0D112440D74A ABellamy
967,783,228 *64EE1FDCCD808A5C613B489B4A752B8B108C66AA abel.lebow
967,783,229 *64EF8B96224EB22913EC0D07A97BEAD96561703B Abelmann9
967,783,230 *64EAF9DB36FAF28F0C822E9456360743E1F1B1C0 abel.potocnik
967,783,231 *64E835277C3DD1AFE6C1EE83777C7110BE759F2D abel.rae
967,783,232 *64E3C5F1A46F348DE7A9ECB81F023F9A4775203E abel.rucks
967,783,233 *64E8A3BE0B823EFB18C23A66D8602B3B6A68CA45 abel.schweer
967,783,234 *64E4BC1C108824AB6974435E98A7573251031713 abel.simerly
967,783,235 *64E8853744EA30F8616731C0FCD34149E2F4BFEB ABELSLUD
967,783,236 *64E969CA28CDF7B81F2C88E553B93B9CD891F6DF abel.soroka
967,783,237 *64E4E7177D9A709926DC0EA9B0C79DB4828B3AB2 abel.steinman
967,783,238 *64E4ECCC216B1BDC0755CD819FD7DB010CC91DAC abel.svendsen
967,783,239 *64EF4185295430DEA74CFC3CAAD5F7EBA91E3219 abel.valdiviezo
967,783,240 *64EED9A0C1E768ED737503212C93943F4933849E abel.vasallo
967,783,241 *64E3BF0BBE36612F1C6E5B76C5B700B8BECE0350 abel.vaught
967,783,242 *64E3D23B25C746A5D1E9A20EAAB90C0D4B41319F abel.vitko
967,783,243 *64E6B5637581751A58BD74D699B30A6264A99CB4 Abel
967,783,244 *64ED9EE8C4D5F332DF1DD518DB9017757B33EACA abel.yellow
967,783,245 *64E15CD31B70D0F47558B26CC027802B9F27D72E AbEm5
967,783,246 *64E6EBA7BBC2EDC3317D2FBBD97998CEFBAF6DD5 abeman111
967,783,247 *64EEABF74B2FD3DC457DF1EB16ED71A74F5DAFA0 abe.mcguinn
967,783,248 *64E52A6CFB22612651F4D168871C0D1095D58136 Abendbarke
967,783,249 *64E3BA2D966205291179E07F8B8E59903FA818EF [email protected]
967,783,250 *64E3E767AA1DE3D2697CE6F6A962FEC552E6AA59 abendmahlbild
967,783,251 *64EC7CDDF609939F595B1D00DD6AAFCC3A177AE5 abenolos123
967,783,252 *64E00228424ACBE36609C2C30CB490D73E7910F9 ABEoi
967,783,253 *64EA651A09509D83C5BBEA0E31AD1562DF8823F5 abe.pierson
967,783,254 *64EA67DD28323FA764D3FE83776125F62EC652BA abe.provenzo
967,783,255 *64E9240D68DC2C591D017374A1F3257AE4A3DF39 abéquasses
967,783,256 *64E69701B414989901164BF7CE295683570B3149 ABE"r
967,783,257 *64E055E76BE19B57F4FF8891EE766867B47CB0B9 AberBitteMitSahne
967,783,258 *64E20D1208331675D5064DB8F2EB5EFE0C48A37A abernted
967,783,259 *64EF0607DC0E736D084650DD24E2834D2B020E29 Aberra+i0n5
967,783,260 *64EBEA80CA33BF3BC2D990C877FB2ED785117CD8 ABERTAY
967,783,261 *64E525F2F95C23882D804EAA788F08F32B053C6B abe.ruman
967,783,262 *64EB6B8A2275A541AB3536FBCBDFFEAC44550ED8 abe.santoriella
967,783,263 *64E9A2A39D10F20613214DF0B330354BEB9E462C abe.scrivener
967,783,264 *64E20BCA0B9715EE947DEECFBB44F7292A60871F abe.seegar
967,783,265 *64E73D0028C455726B8989D3A36661969033B091 abe.soens
967,783,266 *64E182A0B2B510CE2D9BA329524C53A7778E3C48 abe.spike
967,783,267 *64EBB916600883F934ACDDFBF96812435C7A40BF abEsy
967,783,268 *64EE863A4A0A790A97149B16FC791B6968A78416 ABetterday
967,783,269 *64E2BBCE4EF07E4BCE2E9028EF0DDC5BFD200443 abe.vicencio
967,783,270 *64EDC041FC7908E739AEE3B57795838DC22D0891 AbewP
967,783,271 *64EC02FBAF53CFC5041C4002A39BCED6876D95F0 [email protected]
967,783,272 *64E1935F29DD830296D9EF750AFF4FC6A2F8032E abeyzonic1234567
967,783,273 *64EA709E44F153BCA9E758D8E2ABD73F7500B3E2 Abeze
967,783,274 *64E11BF1A9A6657965C022B9511745D7E74DC214 A:BF$
967,783,275 *64E936FD34D3AEAEF2E3871D24EE847E954A20AA ABF:(
967,783,276 *64E4A41E1BA72E22263EAB62605525C830B11921 ab=>F
967,783,277 *64E3909659CA6BB6FDE46FEA7FE9A87E6996283A abf[}
967,783,278 *64E28D5797CC5CF390C465D2A8F6E217B52C1E01 ABF3b
967,783,279 *64E78A44C3AA2E94E7468A62D5FDADC21B09A3F6 abfa9f189d031033
967,783,280 *64EAF8D8BF5170D34EF14BC3C5B0146887482E3A abfallstoff
967,783,281 *64E9D128472AAD04CC08AF0B2E93E522D10FAF88 ABf:d
967,783,282 *64E3E20B6B4CBB9A0081279749B06FC00AA40BFC abfd6
967,783,283 *64EF283ADD9D5A79A4A2609EE6C90A21245A968D AbF(F
967,783,284 *64E99B91E3564C8EE082B596ECB94CF037E972D5 AbfFC
967,783,285 *64E79883367F0AE3948F5FDFD0B7E69DDB3A1C68 abFgu
967,783,286 *64ECB0202B38937511CE34479834DAD8EA7FEE3E AbFle
967,783,287 *64E7583EC44FEADFABB9FFE4E8A63D3EE834BD0C abfliessend/a
967,783,288 *64E2B8DEBDBADC31ABB1E87792E6EF41E2182768 abflossed
967,783,289 *64E4DBAC339AE569E61CBB2AFC2BE4510E44D09A Abflusslose2
967,783,290 *64E56F1B7CA5B681EF9141AA509232507F329890 ABFMABFM
967,783,291 *64EEF1A4167AE6039EB6442B39E078652F4EDECB A.Bfp
967,783,292 *64E2F6E5E5F38B9C7FCCBA9940EFEC18D9ACC9AC ab&Fq
967,783,293 *64E790B361921C704CB5524A524E8228C16F75C4 Abf_S
967,783,294 *64EBB105E1579CC6E7BD8373DDCAD4413D25496D ABFsT
967,783,295 *64E798D4AE433B9CADCDC2313EB86905E78FE2FC ABfUP
967,783,296 *64EF6B0C2CCAE397BEA12919788BBA9C147F152F abfwC
967,783,297 *64E56104FC9CDA507C944D439F20C6456FB8AF65 ab"'G
967,783,298 *64E51ABBF2E2B569B075A106866A62D78EA6F6E7 ab$|G
967,783,299 *64EB71098AA683A5A5723E076F253432100ECB74 A:Bg1
967,783,300 *64E9F218D0C2CD6CEE8D0F08BFE24F9EA4B420B1 Abg%2
967,783,301 *64E587E0AA1FE8A61A2C103B438C2802EB2ECDBF abG)6
967,783,302 *64E2A32FFA3B836FF27640BAA4DC5F79A9AD678D abgabefreiheit
967,783,303 *64EE684B8C53E947EC9C23DA738A7ECEF5719959 ab}Gc
967,783,304 *64EA9A9A72EA9534DB5EC2F19B8F54029E381C5D abgedämpften
967,783,305 *64EE56B1DDFEF891D82611B5E458970D1890212A Abgedienter4
967,783,306 *64E3C846332282EC789C872C35D546E778E22F44 Abgeklemmt5
967,783,307 *64EC47E842683B6A468F51055029D68ABF174412 abgekocht4
967,783,308 *64ED500BFA7020714BD6EF851F15B9C791EC5A49 Abgekopelte
967,783,309 *64E114315759719F55854907162C9E49FA64309F abgek?rzt
967,783,310 *64E7719D5D4E1E3FA849C0A43047B3EE3ADE43EE abgelautet
967,783,311 *64ED0FB708A9167CCDA7E51A816DD4F5F049D00B Abgelo"scht
967,783,312 *64EA58629E8B3FCC36D83FBFB67DF7BCE4A86F05 Abgeordnetentätigkeiten
967,783,313 *64EFD2B0B6ABD51BAE87B80BE0BF8F8E0DE9F5F3 Abgepfluecktes2
967,783,314 *64ED7D8DBD1EC8FC4F5A8C10D3FDA2A6F9DAC3B9 abgequals
967,783,315 *64EBD57FA0F1B756A04203E97894F4D2FB23105A „abgeschnittene
967,783,316 *64E789EF06D14428229296124B828C99D248BF9B Abgesteckt1
967,783,317 *64E3C25D947C123E89EFD252E9C31CD39D372189 Abgestempelter
967,783,318 *64EC8FA6E6093E0F1367F5284256736EF60AECBF Abgesttztem6
967,783,319 *64E5A5E0E16B06F98E4F73A8C0A8DC274AF6358A Abgewaschene3
967,783,320 *64E17C78685DE0DD5E3F4B1280E579EAA93EE029 abgezahlt9
967,783,321 *64E3A9BB579E4594244A5DF7577D0E30BBCF6414 ABGLEICH9
967,783,322 *64EA219F5A195C52F8E00D846FF3BFF4C3CFE70B abgmerah
967,783,323 *64E411BAFE64B5A3D08E4EA3D526436621654119 Abgnplvgs
967,783,324 *64E630A69B46EF9AAA88C4A2ED94315A3E1C663D Ab"Gv
967,783,325 *64ED85B0A98308048D92C5B1601268398E0E3B61 AbG-w
967,783,326 *64E656F7CA59094CA2642C1E3941D14EC1764D6A ab^gZ
967,783,327 *64EEABE39811970D630991C330C1B114D7CBDC2E AB%&h
967,783,328 *64EDD42EC98DD7237485A6D616AB6DD2C7799098 ABh,%
967,783,329 *64E780FD14503CC7B72FF4B2736F3FA86A64759D ABh:;
967,783,330 *64E9807D12EAB6BD2B093523E4149CECB9977EFC A".bh
967,783,331 *64EEA9C644E568EA9C9A3CF2F66D63C769C89CCB abh+%
967,783,332 *64E18B1DA6F9B335279B26900A1E2272AC31DE5B A?Bħ
967,783,333 *64EF1E72485D6FA3EECFB312D7D2BDB8A07C6CED AbH_2
967,783,334 *64E22D279763FD2EECEC7671251C1F856940119A AbH3?
967,783,335 *64E0D28CF1996DB2353027DD1DAD6E5DBA82C0C0 abh3x
967,783,336 *64EE18CA680C64A539EDA9816E9362B6B4E77595 abhaagaah8
967,783,337 *64EF93E25F6CBF7858B8B1423D95B8C4E375C3A1 abhandene5
967,783,338 *64E2724711645AAF471599FEB901FF94791419D2 Abhavajjaratkaaroh4
967,783,339 *64EA24164FBA0D4FA933428AC396C45DBC34A74D abhay chougule
967,783,340 *64E03B0F3DD180FB844D6B170294918389F152CC abhaypotnis
967,783,341 *64E7FAA4D37C8A65E2BC7627B9BD7FB7F64126E1 ABHBw
967,783,342 *64EAEA4E00747CE34DC0F537626BE4F0DEFCBCE0 abhc~
967,783,343 *64E702C6579B660175C5CFC7BA1D26F54520C124 ABhd5
967,783,344 *64E3E5FF1FF47E6EBCA48D17E1CB885D47CF5A13 abhenrys8
967,783,345 *64EF1FB3C66BCF0820AD4299C0557C1095D5F296 Abhigyataa0
967,783,346 *64E73BCEC2FC58F23336B7C7376F92F96ED6F7AE abhijeetgodse
967,783,347 *64E94F72E4333DC26A02D0F923E907C2672D93B6 abhijitmajumder
967,783,348 *64EBC0E4607155D3C32354D43BB5A7791E3897C1 Abhikhyaatam
967,783,349 *64E0BABBAA6FDE7933F928DE15C88FB0F9D38D17 abhilashgopi
967,783,350 *64E26F169E888A92579C49A4BC048200B497FB87 Abhimaana6
967,783,351 *64E3D3BD61614206C9DA1074DB1C7D3925277F94 abhipede1
967,783,352 *64E51B047DC13C4F3139ED3398A90826E5313B5F Abhiruteshhus
967,783,353 *64E16DE9D7154A33A6BF84302B85FE43098F4839 Abhishaapaacha9
967,783,354 *64E112551F88580D6F35756F2BABBE3D81E3F863 [email protected]
967,783,355 *64E4AC00E5778746156DB624104CC15ECCC9B12D abhishek zaveri
967,783,356 *64E1C4E81B3151BEC71EEA0BACADCF2828C757CA abhispr4
967,783,357 *64E52060B942DD014DB12402C8AE50B35C678B57 Abhiveshhtitah5
967,783,358 *64E3DBF4F9C3D319B60877221D576A93DDD7A9A6 Abhiyatri
967,783,359 *64EE2D10AC600AD30CD98ABAF6142CBF64161FC5 abhjm
967,783,360 *64EF7E688223C0DFBB799C0FCD465F878E1B9EE3 ab,hM
967,783,361 *64E63ABEDC6BE0AEE5A37466C72EA73944DEAFFD ABH
967,783,362 *64EA7942669CEFD33E34049FCA521B2E968C5717 abhnx
967,783,363 *64E0910794A9A0C3227E01437648A9008E88844D AbHoh
967,783,364 *64EE9449F756F34ADB03B21F83AE6AB6D01D9C5B ABHORCHEN/DIXY
967,783,365 *64E5030333E026D691A828E1EAE2167182CE2368 Abhoyjit1
967,783,366 *64E7978F80ECD06D287024DA8055BF6C170E26C2 abhP^
967,783,367 *64E09733EEACCFE6BD76984797DE533F2C466AD5 AbHQX
967,783,368 *64E75B1EFA077CBB64CDEE8AB401EA1D71649E77 ABhVL
967,783,369 *64E6D77CE08D8BF8D3B3F237668FF5FEDA756A7E abhWt
967,783,370 *64E5632C97DECF0F73C0CCA0686F87A3C26950E6 Abhyardayad9
967,783,371 *64E42F027E601A86C32C986D7CBD204F0C1AA4DE abHZM
967,783,372 *64EEA500EEA0387584B695272B8912D171212735 A$bI!
967,783,373 *64E1353C0DDBCDBA70A0E1C88420974994AA0304 ABI1a
967,783,374 *64E0F35836C3E1F8C26C6366C33EDF547D997B8A ABI1O
967,783,375 *64E274CE8ADF6BE8E55B411A150CE87F3923192F abI3<
967,783,376 *64E66DFD2382184E33685C3D5973D84A36CF0EB4 abiaednikku
967,783,377 *64E18B09501AE3146FF985E479634A8EC1C13D40 abiakiuose
967,783,378 *64ECBC1949F7AD838871FF4C929B21B350376A63 abia-la-sfida-della-magia
967,783,379 *64E793303949AB66B996D25A9E90C71817C72D12 abiaoneal
967,783,380 *64E4DFE8DB9A8F56900E129B3D4C33C5E6C6C186 Abiatici0
967,783,381 *64EA38C39A8645BA929867CE48C3EC6165A3F4A6 abiB{
967,783,382 *64E08DC9E141B967A079730719177F929984CD5A AbIc_
967,783,383 *64E004780AEB967FDD04F4D59BBA563283771D75 ABICF
967,783,384 *64E3ED6D8C7BC26CB3E7E450394FF67CA57F1D52 abidanded
967,783,385 *64EFB115F57F961B6FCBA8B370F0BA50852A2386 abidasaeed
967,783,386 *64EBEA57E89C832EA9CAAA0E961D42AAEFD8CC7F abidewith3
967,783,387 *64E36D8B7B3CEFF205971C227EA80A57D678F9D9 Abidinglyv
967,783,388 *64EBA428B3B0F8914D60071DFCCDCE68429EB647 Ab(Ie
967,783,389 *64EB0309887C9350DED560F67E2641B8B8E8F69D abIF4
967,783,390 *64EDE574634E6ECB17C0E6E9230860B9FAC7C7F2 abigail995
967,783,391 *64E6258A1794DBE1D8D77CC2A43C9C3E435FC62C abigail buford
967,783,392 *64EADB654B89162CAED3B968B02E403059068030 abigailgalindo
967,783,393 *64EE02646B3D71A79222DC6B9F5CD497C79A9173 abigailgreene
967,783,394 *64E81D9B6EAB305EDB49397B84A061B6065CDF8B Abigailjim3
967,783,395 *64E2D1BB263F73EAC92968D9185C3FC3C3E54435 Abigailnicholas3
967,783,396 *64EB728640F215A03B8211E618895D3678BFE7BE Abigailpreston0
967,783,397 *64EED0159BCAA2DBAD88A3657BE7FED1D17C10CE abigail sinclair
967,783,398 *64E03848CD6AF0C3C2F307D254CD02BC5F11D097 Abigailspencering
967,783,399 *64E2C1D2A377273B695110F2B489478DA2CA6A54 Abigailsystem8
967,783,400 *64EB7A4B34EEB9D94E08EB878DA907E81FC90E27 Abigailtech7
967,783,401 *64E3A5627F073B44A8C86E9E7C7023B5BF19A9F2 Abigailtractor1
967,783,402 *64E96A4A89996988A85702CD4113C382A2A1F39B Abigailwarner3
967,783,403 *64E4F2F759538BCBB7C990E59F768A640CDA2172 abIGALE
967,783,404 *64E3CEAEE91FB60CE1AB7818F8E52E21A9EAAA87 AbIH&
967,783,405 *64E44BC59A1CCE11DEB1F80C4F31A1603F62C300 ab[iH
967,783,406 *64E12E56203E5D16F69EF7B1A20776DE59978A22 [email protected]
967,783,407 *64E18E036D25C5EF10578E290F2470C4F42BB6CF ABIKAKAS
967,783,408 *64E7226F6BA8578056EFB48CCB80E035ADAA8A12 ABIL%
967,783,409 *64E538CACFD395A57E0A6741A67FA258B714CC39 aBillionNationArmy
967,783,410 *64E63CFFAE6CDD33B0958673896CFEE140575378 ABim/
967,783,411 *64E9FD31CECA94DF8FC8FE354740B0A827241BCE abIm2
967,783,412 *64E3399CFD3CE911E827A1564560EE848265895B abimaelramos
967,783,413 *64E297ECDD06018AFBB29E558E419EC6B295EC43 abinosic3
967,783,414 *64EA684E98227F6D439C38E32D19B2E446BDB10E abipg
967,783,415 *64EEA3296F25C5DA8DFC0B1C13B0F03570CFE866 abirramo8
967,783,416 *64E5FA4D055AC5391D869C97AC656502D241F0A8 abirrening
967,783,417 *64EA3196E70DC327C32D144ED4793159B85AADDD abisara5
967,783,418 *64EC678C6C0C1BA1DFCFFC075653A8E76778A72B abisbb
967,783,419 *64E4527C4554AAAF2D566ECE6F448A94C6A37E24 ABISSINA
967,783,420 *64EAAD6321E31F2AEA6ACE2C64E5E59739612786 [email protected]
967,783,421 *64EED260100B6CFD74B40B6D2C643C9964D233DF abitatos
967,783,422 *64E537F49D9F60977A145EF59BB6CE8F18D78C47 abitque3
967,783,423 *64EC4A0AA851221232ABFB3471EA4510B3DA9306 abiureraing
967,783,424 *64E6F179C3422E8EEB8C21CC5BBE7975D2954101 abiuretsing
967,783,425 *64EEA0E70078DC3F72A885C951ED11A2D812D378 A$biW
967,783,426 *64E097257AC77C5E4F2F83D7796743E58AEEC2B4 [email protected]
967,783,427 *64EF86986F8A7AE883AE1B9B3E503FC9FE553389 ab?J:
967,783,428 *64E5DEDAC03AF56D14C140578D8E6C490466A6D9 ab>j`
967,783,429 *64EB10368B3A9D396839AC5DB517236FC4FB9B06 ab,j+
967,783,430 *64E3409247C27F5DE9A54AC4C7DE182E070CCBD1 ab'j>
967,783,431 *64EEA4D4ADC5B9FB7EF7084441AFCE6DAE57C95F abj42
967,783,432 *64EF9F6A68E50C1E46F41AD853550669926A8ABE abjB#
967,783,433 *64EC4A5C760A31FD566EF63EFAC27E9937D8566C Abjectednessesed
967,783,434 *64EC57FE3A4409B1017865E4426A8678CDD02388 ab_Jq
967,783,435 *64EF854B90CF56A76E4F152045DCABAE86725AE0 Abjq5
967,783,436 *64E652DF7E0E22835EF6B9C0F329564E499F94C0 Abj&T
967,783,437 *64E569351F7E72B735CC42EA18CAC0C1D5EB4F22 abjtb
967,783,438 *64E9588AA367D3CA7F8DC87086AF2155D4BE0BD7 abjunctI
967,783,439 *64E7C93CEED237ED59153F5AF6ED2630F7FC49DB abjureds6
967,783,440 *64E55E62B2B94C6F5118C85CF0E24BA57E862C42 ab*JW
967,783,441 *64EBC212176D7314FF6CACD74BAA9DCC5C2CBF3A Ab)K?
967,783,442 *64E7E591719B6006911E658B1D1FDDA8BDBA785C Ab%"K
967,783,443 *64E7D398B622AB25529C860CAA88526C300876E9 Ab/"k
967,783,444 *64EC41A2D45761A7F789CBC4F2DD873DC63EFA9A ab"%K
967,783,445 *64E202183265B7C65E134DC5F8638C78698E2123 ABkaC
967,783,446 *64E78821F198ACDB9D8FC79FDF2DB61D0571A0F0 abk[b
967,783,447 *64E6551718AB910612E9EED4F31644823EF299D6 [email protected]
967,783,448 *64E624F31C7A43CAB875717B38BE08CC105353B3 abkdhky13
967,783,449 *64EA1D5FAB37AF2BD4CCAA5AD82729BCE1E9BEFA A
967,783,450 *64EFEAD845E7FA379015D910ECA4B064573D8E01 A,BKm
967,783,451 *64E8D09F72F6352ADEB87824A2D210953B37252E ABk/n
967,783,452 *64E3791F076B493B57C32EAC91DDE5A81A15293C AbK?N
967,783,453 *64E0F403A71EDC3F13EB8DA52F31C2031345E58E AbKN,
967,783,454 *64E6B431DE34941DB768E26908CB3DBFE8D68DD9 Ab
967,783,455 *64EE1BB793CE5483894CD6997FC71DD49D93E709 abkoched
967,783,456 *64EA81A254C6C4BC86E9C30F6A0E30FEA1958A9D Abks1
967,783,457 *64E49D1A77045AE63B5C950854A6BD61276617DE abKt5
967,783,458 *64E90970DAC2CCEFB37999F53167ED1DF7C66562 abkundig7
967,783,459 *64E6D5389DEB337A43B02BECBDF1A22E4EF7ECE1 A/BkX
967,783,460 *64E59E1324BB9C0F145846377255471069CB3FE2 [email protected]
967,783,461 *64E5B6ABDFF2A35EC717CF06EC172576436F66F9 abKzM
967,783,462 *64E3086D2E8C59E6415A6A138AACCD25CE4760FC A/BL:
967,783,463 *64E2D4A30FF431E52D51DAB1157E96744F4C8AC7 A)BL"
967,783,464 *64EE23129D594278F95FC9C976FD0C02C43F9DC6 AB;l=
967,783,465 *64E1B7A08818B78C18919C0744362CF7BD0271AD A$)bl
967,783,466 *64E80A3BAF2FDDD9375F8734D929DC2AE7D3FFD0 ab/]L
967,783,467 *64E355CE264F9038EFA7AE0564C2C718C50D6390 Abl/5
967,783,468 *64E8AF7A5EF0C37BC6B0B382C7B65A0685DF8ED9 AbL7InnBg
967,783,469 *64E6F4CF759DCBBFE92BB11F1066FB087BC8C7F9 abL9P
967,783,470 *64E5DFB91F68A9AB0A362825BA26F98B545B2A15 ABlaC
967,783,471 *64E57358567F8C338284D8D4FAA49A57B4D45B80 [email protected]
967,783,472 *64EDEE338318A5EAB6D654BC6DE3FF023853C298 ablassgew
967,783,473 *64E181F26CB3B0B4C1EA0A428CC3B2CBEA5EE62B Ablaufinvariant1
967,783,474 *64E6731366313499044ECA992D4B36CAF8813BA1 Ablaut9
967,783,475 *64EA081331B7AE2FBEB8E5099DFDBF92C73175FB ABlCm
967,783,476 *64E35D8A287E2615361175AE694D7CC1DA370C65 abld)
967,783,477 *64E758A3C4623A573179F2B1E5846BAC4BCC72EC Ablegended
967,783,478 *64EF2AB368C3C58206EE8AC39D8EF19936AEB980 ablehnst9
967,783,479 *64E2C6C6C569948FCBA60A49E646D9B84804CB12 Ableitungsstörung
967,783,480 *64E98727D053B12CD6CED537A9B9D32EDAFEC7D3 ABLEWHACKETS1
967,783,481 *64E21A1EFF67A787BBF28C43495F11432B065D02 abliefernachweis
967,783,482 *64E09AA589BF545CEA39694F987A7AB2B9C6D7AD abliegtening
967,783,483 *64EBF0B589D97DB62BF59F3E6208A72737D614DA abLIY
967,783,484 *64E4222564160FB793A08720E37A9DC91DD6A61F ab-lP
967,783,485 *64E66C0ADC275FE7CFF01366BFF2DA07D6687989 ABlrB
967,783,486 *64EF74807053066801726F3605A0D5A1D4171BCB Ablsuatwdlv5
967,783,487 *64EC18BF42A73E951CD5769976DA0913B7AD8A22 ABLU+!0NARY
967,783,488 *64E3CE01C5A624F0F6F5DFC6495007A98C7B683B abluecrew
967,783,489 *64ED44F43BD471800B26BB52A78539F9DB3384BD AblushAblush
967,783,490 *64EB96FAFAB2C63F62DB1CF3502D67D08E31B017 Ab.lv
967,783,491 *64E0D8027BDDC8AB27F818A2ADE6AA875EDFD371 AB%lX
967,783,492 *64E514CD76141C1C907BC91B2B2D723186AB517C Ab;#m
967,783,493 *64EF087A4D89F40819E1EEFE1A311D8B6441506A ab[M$
967,783,494 *64E87789A0A4D041D5FAE7D3C1C92CD504776E48 ABm4!
967,783,495 *64ED55CF849D6DC3EBFBEB24357EEA44039424BF abM5X
967,783,496 *64E35E8013AB90415E3EC0E9A27FDCD6864A082B AbM&7
967,783,497 *64E7B9A264DB1D4EB73A1A90993016797F166C5A abmahner8
967,783,498 *64E2EC909F2F2BD9E875E77D5C6A65424EF8124E abm"D
967,783,499 *64EE6A8B6214A8F89BED8D0C50EBA7049E140A26 abmeldebescheinigung
967,783,500 *64EE5399080975CFD0C0647531BF3D5D3A316B70 Abmetan3
967,783,501 *64EC35BBE499ABB1A36D7F0C6F6B2C62E2471DB1 Abmodalitiesp7
967,783,502 *64E3D424C6298187C28C58FD2DB0E6520976A7EE Abmulbus7
967,783,503 *64E1414370F9B63093DD4B420520A8E686FE6931 A=BMZ
967,783,504 *64EFE064D0A760B360964D4CEED22D047260A92A A
967,783,505 *64EAF8AE5225F098B2A2873DCF291C5713520377 ab,N]
967,783,506 *64E08D5D87E44988710E613BC874C5DF82D8D091 A:bn5
967,783,507 *64EA38406A4D1AAEB8ABAC48728B869B6E82AFC9 Abn7R
967,783,508 *64E6008852888CA1272403CD05CE69805A0CA447 ABN8P
967,783,509 *64E5C87620C70EA5B60538A70526E2929A05654C Abnakipenobscoting
967,783,510 *64E82F008BBCD4A2BA848C1E9777C7D8E22472C3 Abnbeker
967,783,511 *64EDAB79D8027B52E563FC3257F93CF63F7DF96B abnc1
967,783,512 *64EF418CAE2A4B9C081EF9770DEB12000A31AFA4 ABNC4SMA
967,783,513 *64EE07E017C86766EE46BB1DFFB33C9983ECCE2A Abnega+or5
967,783,514 *64EEFE4B19C49B7284AE77B0239490F7003B7419 Abnegatest7
967,783,515 *64E333E599372F255FC6404D469F983422297162 ABNEGNIN
967,783,516 *64E6EC42D439F678DDF0DD6DEC10426B0754F313 abner burnett
967,783,517 *64EDE19E39F4FFBB773FEF087D607A5738E8D8B0 AbneW
967,783,518 *64E9E370D67F6F7D375060F40D30F542C61A83D7 ABni=
967,783,519 *64E061036DB8B2779552DD8CA4EF24CC9241DCAA Abnissen9
967,783,520 *64E725017E35E3BA9813EAF53C856364D030095F ABnQO
967,783,521 *64E6C141EC7B9B2EAC4B615F834F6E77D91CD655 Abnsicht
967,783,522 *64EB93B7DFA2755EADFFAA745397998B59D6F2DF AbNX,
967,783,523 *64E941101DB390E4DFB0E7D3D06785BED3691865 abnZa
967,783,524 *64E35B49C01E77F909CA494418287438385377F2 AB,=O
967,783,525 *64E30F7C4E0276B7E93166C1954D50B17B58C430 ABO"$
967,783,526 *64EBBDA35928C156451D92A558C42D1317B713E0 A!Bo.
967,783,527 *64E56E733457600C068A2EE8ECF68FEF86EF7379 A$Bo?
967,783,528 *64E9A985A204310A16E4A3C56CC3C4E5CD2BD22F abO%/
967,783,529 *64EC17108718570CDA7880E1C8D1674E5B529A7A ab"o-
967,783,530 *64EF4B85B4BAE19896B552BDA475B7FCFB392ACC Abo2!
967,783,531 *64EF3D01125DDB2E7ABAEA4B416888632755C825 Abo6=
967,783,532 *64E8AFA333A9F87ACFF42FA1E1C22279D4FF3CE7 abo]7
967,783,533 *64E373B01E0458F2856D876BADA3BAEF7BFF6E2E aboatonthewavesisrocking,op.69no.1(piano:edwinmcarthur)
967,783,534 *64E14828F47BA00FC9502399B7120A262B5139AB Abobadou6
967,783,535 *64E272A7E50C4E9ECD3D4D87B5A599F0B6F9482E ABo)d
967,783,536 *64E1784FD600C41EFB10159A1EC722D97112612C ab{OD
967,783,537 *64E5140D881546866978DC0B37448453DB0E23A7 AbOGB
967,783,538 *64E2E148251075F222F33CA9AADB13832FD42155 abohcirt5
967,783,539 *64EF9C4F8A128273A3A802DA11C36AD5FE324706 ABOLAFEABOLAFE
967,783,540 *64E8E5F9EE8D08D1DDFC4D47A019C71B1375B78C abolarin adekunle
967,783,541 *64EC29EF3AAFA3D32F0C172C71A5E7D1AA8AD547 abolendoed
967,783,542 *64E8A2B693B08D056CE5CB86566F639243D9545C abolerados
967,783,543 *64E454E114108E3713DB86E9977DD464E6C306D5 Abolishi5
967,783,544 *64EB0421E07C85B4E0EE783B214836518A215A6F ABOLISSI!
967,783,545 *64E854F124B8455BAAA29D40D914C4272A1A85CC abonarles8
967,783,546 *64EAB6C0739826824231DB5FF28E281F4442DE0C Ab.oQ
967,783,547 *64ED9F6F170A181C09DC2781C6389D0D208976B2 ABORDAGE7
967,783,548 *64E4D9CE0A9D25286A58086325501125EC26941D aborde.
967,783,549 *64E924CAFD594CF4A8611FFC6F10D7A542417469 abormann1234
967,783,550 *64E1AB8D80EFA0C2DA940704B0EED32FC53A46FD Aborrecer
967,783,551 *64E0379E6190CEBDB76DCB5DDF6F7F204ED48482 abortiro8
967,783,552 *64EF5BDC017E1A0A5B5D6379E9771C23E6E36712 aboserie
967,783,553 *64E46E0CC89FC8D654D1D8D8EA8946C0C018E199 abotenah9
967,783,554 *64EB0130CC830CF65EF3E0D553644648BC9BF6D3 aboudimlamothe
967,783,555 *64EFB49F8A8779B9E10EE92348432254B1CB33DB Aboulomania1
967,783,556 *64ECF5E926FB2C30C4042DCAFD842D66F3115294 abourahhal
967,783,557 *64E8F06AB5CCECEE4073A56CD5CAD08937051E2E Abourait4
967,783,558 *64EBBB39E3FC7E3215E0E0B4A987BDD3B35DF957 abourezk!
967,783,559 *64ED49CB4E844030538463FFFF76558C6B516AC1 Aboutaperson7
967,783,560 *64EDEEF7FB0BAE7C11FF5812585E006C47D1E7D0 about.balcer
967,783,561 *64E4FD259BF4D48C9B1285FB1BDC0736A45231C9 Aboutbeepbelchbellbendbends
967,783,562 *64ED8C70FAEC4E4225410E57A728F6238BBC4FEA ABOUTBUXTON
967,783,563 *64E527287DAED69AE1961F8EE984E4349ED2956F Aboutdouble
967,783,564 *64EECA0475A399034D16F16BF8B70E07AD9C73FA ABOUT-DUBAI-RUGBY-SEVENS
967,783,565 *64EF158A0F72152B73CB5403B02DAC6635D73E72 AboutMotorcycles2006SuperGlide
967,783,566 *64E8127E98C22549877706C5EF15E20BBBF988CB ABOUTNEWSPAPERS
967,783,567 *64E8C561F49CA4B24D9340C7EF6A84007AEE2F60 Aboutplypointput3
967,783,568 *64E80A82850F53F7910F8F95C558EC868B6243CB Aboutroundedrounding0
967,783,569 *64E57C9F8338C89FE7DFA090EB72338DA532E181 AboutStyles
967,783,570 *64E751ABBF7D09ED12BABF5C00E5537DBC72A130 ABOUTTIETIEUPTIME
967,783,571 *64E6BFEDAD09D4FC48CBCC3A611A72E732A9CCFF Abouttimetotal1
967,783,572 *64ECC33B333014EE0429B7DD7875FBA6B7C4814E aboutwok2
967,783,573 *64EE4C9019CDCB30DF7D25D47A2499172811EB73 Aboveaboveacademic
967,783,574 *64E97FECA40D2CAAA2E9B9CC1654826FE7AE4C90 abovewe
967,783,575 *64E9C1329999F222361BE2AC9A2BFE8BCA0EFC10 AB?ow
967,783,576 *64E588CDA9C6F5106CE0973879D0DEF1596532BE ABow,
967,783,577 *64E815241D7E7CD5B80715EC367D9464E0985A44 A;;BP
967,783,578 *64EDA5E6A68FDF89FBB3D906147ECC14B74183CD A$(bP
967,783,579 *64E34F782D2E27FA95F00F88ED124492462CBD6B ab.P'
967,783,580 *64E50FDE2F8D77C1515FB774D87FEEFC3DC1C92F A$Bp7
967,783,581 *64EB01AC5E2FDD9E5E2325EB9CF6FF3726C4AA42 AbP7n
967,783,582 *64EBA1038FA44363B28ADCE7A73410E5F7B9488B abpassend2
967,783,583 *64ECB374B9838922402E50A1ED321F93F4ADEF11 ab&PB
967,783,584 *64E20985FD19BB3BECCCA835C858EC331B53EDA6 Abp)c
967,783,585 *64E1BDD6EEB39205505A0E14F6C77881BB68EBDD ABpEp
967,783,586 *64E3D6C21EB6C384017CE9C4CD671897C83BF349 AbpgA
967,783,587 *64E70E3A4FA57FDD3C5BDEE8559FB535FB94EB42 ABpi1
967,783,588 *64E1B023859EB10644865B33D815870AA35CAEC8 ABP&j
967,783,589 *64E44752ADD277E0EDF890181EA5E806AC323DF1 ABPrn
967,783,590 *64E1E560F0C0B94DAC414D423473AF65D3C6BA7C A_bpt
967,783,591 *64E955BF59B8A7D3F73D2E1075F3D3EF4C763A87 abpWK
967,783,592 *64EECB5C7DC9938CA9935AC5A4C7404622F53B2A AB"(Q
967,783,593 *64E5B779470F74D55628EF4D1F73400A5B687E86 ABq?/
967,783,594 *64EFF99F1A8715EC88CFFAB3B8191B74B56BE187 A:b;q
967,783,595 *64E95B1A8B5BE15BC693E2811D590ED1E9D06F95 ab%{Q
967,783,596 *64EC30F4B860D4A547F36AA5DF2F282DDAC56FAB abQ=-
967,783,597 *64ED76FC443EC3AF758D438409276457297F03C6 abq"`
967,783,598 *64E3AB8E2A2AA50C54740F178D574E1547AD227B abQ3,
967,783,599 *64EBCD025FCB95B95F5C7AF9B264C36B50EABA25 AbQ(5
967,783,600 *64EC5DDB7382555267D9D0C0B678C3B2A594A53E Abqa+
967,783,601 *64EB9DC3895477496D544E4D508AAAAEE4953EA8 Abqca
967,783,602 *64ECF19C7B2CA650F64F9293B1D53C92743004DF abQE1
967,783,603 *64E9CB49E89562AC2E465E66766AE56E5E822E6A AbQf6
967,783,604 *64EC3B50B683BF8C2E656D00B8E13F904084FA48 [email protected]
967,783,605 *64EBDD130331F26736A54DB1B89BF5A6A84C2AA6 abq"K
967,783,606 *64E8E038714134D6E416888EF7896394F8FF86FA ABQLG
967,783,607 *64E8B67E043014C88B3714F2C8867A2CA0AB07CF AbQO6
967,783,608 *64EDE0E434363B846128C2823C841A7A46984283 ABqqF
967,783,609 *64EF9819BD77DC0DA3DDC3A4DC049BB7D0996F2E AbqQR
967,783,610 *64E820B5A657A3E1BEC4B6B2978244EB96B2978E [email protected]
967,783,611 *64EA71D2B54D30A35772EFC6CB3A37CEC377A98A abQSN
967,783,612 *64E047114E8F565B48FAED0FDCA6567262A0940B AbQU=
967,783,613 *64E471C2ED8554787A0899485A4243FFF57F2E5C Ab&qZ
967,783,614 *64E87E5E8D639EA512F41369E969A62B2DD4740B A&B-r
967,783,615 *64EE6189C11E21912264431907EAF9499695F95F AbR.+
967,783,616 *64EE0C669676FE5775CDA75B8D76BD8DBD6FB17B ab*"R
967,783,617 *64E334AD3128D72077BCDEB4E7369C0365CAB465 abraando1234
967,783,618 *64E4539E12B9A361639E0F3A8E5A21988C24953C abraham082
967,783,619 *64E225A42CE96D69D231D8FF332802C6B4180CB2 abraham.auguste
967,783,620 *64EA2859C4CA8C2300823DB3641C0E5DE979DD43 abraham.billesbach
967,783,621 *64E88827DD8708BB7A16CF75E2E9E85BA2DD151E abraham.busscher
967,783,622 *64EE4C5D45B3F3A93F28151770C5D6E9DA42A710 abraham.cressell
967,783,623 *64EE0F6A877256847991E43A9E4DAE414EA37DC1 abraham.daubenspeck
967,783,624 *64E99F9A2A5EA668E8A004F41D0A38AED27C98EC abraham.deere
967,783,625 *64EDC64057D0D02D296E1CACACBF5B62D7090034 abraham.dennin
967,783,626 *64EBA69C343B7906D3E528F16985CD620EF940A3 abraham.evasco
967,783,627 *64EAF2F3A049B68EF58FCB28B300CA7F162ADEDD abraham.forde
967,783,628 *64EB336E12F975D15CEA0C4DF9200653C7FD1791 abraham.freeby
967,783,629 *64E50D814AD936A8F541FEF6D1835A490363A510 abraham.hilb
967,783,630 *64E13C88B9644BC272E8B007379B1997DC2303CD abraham.kazanowski
967,783,631 *64E718F3A0E3A760AF4CD23CA0C89874429E5E51 abraham.maez
967,783,632 *64E84C31409B23F398F1E2B082BB5B12FB7ED89B abraham.mcgirt
967,783,633 *64ED9E19B26695A9B18CF6BFEC3772D0E6AE53E9 abraham.mcguyer
967,783,634 *64E583468BF3A58ACD7BF758214FA89DD2A76702 abraham.mochizuki
967,783,635 *64E6D38D07D9D55813293E71F078561F5227524E abraham.molder
967,783,636 *64E594C0AF6731F131D4387966DC9DFA640C60CF abraham.quagliano
967,783,637 *64EC169C9A130C8E4869B7F66FCD3ECC8C0B8AC6 abrahamroderic
967,783,638 *64E92A2D37816B6B8640565AF5ABE2191D828855 Abraham Samuel Rettig
967,783,639 *64E4E6F3F4306ECD9AED21BFF06EE8E8AEA78372 abraham.sarpy
967,783,640 *64E509D309C42C3714ADCDB53CCD7FB801293ACF abraham.schwiebert
967,783,641 *64E06B6C092B8A9443BBF9499AF1FABC7D548D43 abraham.seecharan
967,783,642 *64EB6EC7E59766320BCD155D47723DA1E36198CF abraham.siar
967,783,643 *64EC2D1824EC6795F8A1C01F36A13DAE510B5DB9 abraham.willets
967,783,644 *64E847EBB5806B7C704244378D33215AE4D5BDCA abraham.wysocki
967,783,645 *64E6179604D60C39D6B314724656063420F92663 abram.aloi
967,783,646 *64E95007E85B66D5BBDB82B481CBE3B28642F520 abram.blinebry
967,783,647 *64E6B58CD9BDCFAB2FE7594D68467C639F652E74 abram.brouse
967,783,648 *64E94B241DB96F88B720F879AFC862F2CE6DB60C abram.buttars
967,783,649 *64EDA82F7FF463BBB1F85B7E75532DE4DEB2FF10 abram.chasteen
967,783,650 *64E6527F0962989ED94059CB5D39F806C46B2F52 abram.deangelis
967,783,651 *64E4189A11E90D1C3118BD2AD5D21634BFDE8DAC abram.demarcus
967,783,652 *64EECA01A7D353B9FDA5395E2F0B657C086F05B4 abram.everhart
967,783,653 *64E76D549407BB07EF9BBDA93BF3B5FF22A4BA3B abram.fitchett
967,783,654 *64E22A5C1984FFA1F01A8D26EF8F3E95585952E3 abram.flygare
967,783,655 *64EF6DC03688BD294E5941A9D5A19713D399CD5E abram.gravette
967,783,656 *64E0F714F9E3ACBD4B4214D0D7B697F09E02D4CE abram.husk
967,783,657 *64E98B6630E602C4BE6469ED35BDC1DF502D413F abram.jorden
967,783,658 *64E42E570B80C5E1691986A9EDBC5817C0EB74EB abram.kessel
967,783,659 *64E1255F315600177B2C30424AA3073074ECFE15 abram.killoran
967,783,660 *64E07291CF4ACD20033D6C4D45B61498F256FA90 abram.lani
967,783,661 *64E824855DEA32BD9521B1DF3DD24DA7A692081C abram.leanza
967,783,662 *64EEED178222DA28648A906F59627D5995D28880 abram.lulow
967,783,663 *64ECFC3A7B4D01F208CD2191D68118DA57E70EDF abram.monsalve
967,783,664 *64EBEA33328B29CA268A0A7CB0B2205F12CFC454 abram.nygren
967,783,665 *64E215AAF169936880665218C07C300F7339AFCD abram.regehr
967,783,666 *64E75B221DEE0230853068259C5443378D1025BB abram.schadegg
967,783,667 *64E1DE3758ECB2F44E6A37E31F25050BDCA236ED abram.steedman
967,783,668 *64EAEF4FA0AAE980AEF68B339DBB9B479B39DF83 abram.umnus
967,783,669 *64E17E57D898BA11F87EF4781BA79E0B3A806A78 abram.walczyk
967,783,670 *64ED632AF6CA9F252E0464FC62E7236690AD4FF6 abram.zinner
967,783,671 *64E30A661DFACAA4C7B59CA790CA13E5B61ABEED Abrangerei1
967,783,672 *64E6A4B95537F71BF88AAFE10D2B6BA0BB37C4B9 Abrangessem6
967,783,673 *64E07FF9FA7661E06EB210399C17EA86AFDC810C abranguentes
967,783,674 *64EFE66D9025B003BC6824412D9ECE8EA4239E47 abrasileirramos1
967,783,675 *64E08130B5AEBCD9D254BFF14E8121BF56CA0900 abrasions3
967,783,676 *64EA0D0BECECC33608EF1E23BE02F69D40177CE8 ABRASSEMOS
967,783,677 *64E182A79C23BCC52FA02F8D93999B033E81DAA3 Abraum0
967,783,678 *64E8327B48A9AE0F135C20CD7607ECFA6CA8FD53 Abrazivnimed
967,783,679 *64EFF89D58BECF660E6F92B8FA7D396384B39FE3 «abrazó»
967,783,680 *64E2F24CF9C21DE3E32185E0A24F4E89A3539ABA AbRc!
967,783,681 *64E52A0E85FCA3741321E29CBCAC0064ECBF9B9D abRc?
967,783,682 *64E86719770242EB2FADB5F9268F13673140FC9A ab.rC
967,783,683 *64E02DB50A9C2C6AA8C0E814A4F90C0FF27EB321 abrcrmbiaddct03
967,783,684 *64E51AA28309966E2D4A1D4BD58305485EC5933D Abr!dgements
967,783,685 *64E3B105B5601D1CC4A966721BA07AFA320A8DF3 Abreanning
967,783,686 *64E2C118A8E8ABFE1AEAB1818A315476DE65DCBA a breath of our inspiration
967,783,687 *64EDEEA9BB4CD0A4BF99CD12B2051F8695BAD3DC abregeldrehzahl
967,783,688 *64E324AB22CCF7799C9B303715B807E9EC86557D Abreisenens8
967,783,689 *64EE0DA80165314D1577276DAE88911B70592891 abrenunciarias1
967,783,690 *64ECB98D7D587EB00F1361663C138E1E7F2DBBB5 Abrezar9
967,783,691 *64E9E21D32DB7D50F11306434696791286AC5795 a-brief-history-of-business-cards
967,783,692 *64EF39412E983CB0B1926E08EF9F3E62B09C3DB7 ABRIEFHISTORYOFDISBELIEF
967,783,693 *64ED036455D11DC8A7399C7086549DE71B2A937C abrigaos
967,783,694 *64ED96F2E99C8D2B8E5AB27200AA0D413356DC57 abrigasting
967,783,695 *64EDD104D6F0CD818EA6A641E445E068D37C7FE3 abrikaating
967,783,696 *64EEAF5009FBAF6770DFA5A23D928A3A415580A9 Abrikoze
967,783,697 *64E1B2329B55883142C80B450CC44FD897AFC28F abril840
967,783,698 *64E547A25BE736911955A2E398A07D79C1FE17F9 abril duarte
967,783,699 *64E9B28C762F23C6D607EFB2DB7E0D441AA09EBB abrirmos9
967,783,700 *64EA8CDFCC490503C47384F2DA18C3CB4CA876B0 Abriubsw6
967,783,701 *64E1D4AB0009A43E8167153DF0752879D93F4859 ABRKi
967,783,702 *64E9181A6802BFB6671E1E711E021C3F275BFE71 abrodere
967,783,703 *64EFA7F81448231FB78B716C2329100EFE5DD856 ABROGAI5
967,783,704 *64E5E28475CF173CE54A4EF7552B9AE04CE4B083 Abrogationing
967,783,705 *64E3661DAC24B3DE7379D90DDF2205AA1333DBD4 Abrogerte6
967,783,706 *64EC39C154260E423CCEC11AC9B13C48757B58FA Ab$+ru$ene$$
967,783,707 *64EDBD62E1AAE05349C37424AF1C077612DB7D17 Abrutirez2
967,783,708 *64EE33F3C0D546F7ECF34A3F2BDE5F026017FC9E ABRUw
967,783,709 *64EBE3EF46C30B23B4DB0F2F35D06480D542E66C A_!bS
967,783,710 *64E39D7AF17781E43521F0CB4606E32F91BA4BAD A?bs=
967,783,711 *64EE5283D42797B37C5E4C5023DFE10438F6A7D1 Ab?,s
967,783,712 *64E6D13A016E008ACDEE930CFD400AEB2B3D86B8 ab&S~
967,783,713 *64E9CD178C75A347622090359D14F5AFEB722727 abS<\
967,783,714 *64EE20B33238AC5DB645D237760FCC64BD5B4D6E abs-=
967,783,715 *64EA2FFFA863F510506CF3D04BDB64BFB826A0B0 absatzeinbu
967,783,716 *64E0298DA19A118635F12482E2DA18A9DAF4EAEA abSb_
967,783,717 *64E16BE60AA5968B68AC9AB26873E406BF85F0C6 [email protected]
967,783,718 *64E3092F0997F7B871100ABA08BE262FE8F47956 Abscessi4
967,783,719 *64EC45F4B73DE74DD411281106928702E433D830 abscessroot2
967,783,720 *64E0FDFCC67FF1DC36076A21E305AF17A407D522 Abscheidened
967,783,721 *64EC2C14B92BA84995C06B4CF88997630B1F4A29 Abschiedsmelodie
967,783,722 *64EE3DCFBAEC79E03DD5A638E8987E71D3003330 abschlusstabellenplätzen
967,783,723 *64EEC8304D72E45EFBC08180B8BE8258D92BA9FC Abschneidened6
967,783,724 *64E750EA1EB4B79EFDAE218867F15CDAA268D18B Abschneidest0
967,783,725 *64E0BED8286F7DB11DD69CAF1C16997578E1CC1E Abschondats
967,783,726 *64E9C2271852870702444079F32C4433DC036755 abschor2
967,783,727 *64E9218BE6BD8D7F471BE21F2B8E56C797B8CC07 Abschreitenensing
967,783,728 *64E2778F1C96E66CEC88377F305FE2AC330CE731 Abschuftend4
967,783,729 *64EEE425B57AF51E72A880431D8639ABB02EF527 Abscondets
967,783,730 *64EE275A6FFD53161272F0DF7D33C00204F1645B AbSDn
967,783,731 *64EE391DF53DB241262BB9F432F9EA5F6FDD3B69 Absendegruppe
967,783,732 *64E1F40989AF7306ACFDA01227D53E767737970B Absentation0
967,783,733 *64EF7AFA72D7CCB1D378CB9BEA045FF11D6A076D ABSENTEE-GOT-EIGHTEEN-MONTH-SUSPENDED-SENTENCE-IN-THE-SO-CALLED-ILLEGAL-COURT
967,783,734 *64E6BD1BF44D5B4298038553B86D74A4BF295246 ABSENTIES7
967,783,735 *64E63024B7F9B785DB1DAE36B1524BDD438D4219 Absentiste6
967,783,736 *64EDCDD0FF28C42249622564EBC6AF6D97C88972 Absetalps
967,783,737 *64E667375CFAA2CAF95B6FCF4C031FDC2C11A406 Ab)sg
967,783,738 *64EC6A7509986540597AFD10AB91C42511E270AC ABs,H
967,783,739 *64E4EF67F04D2147BBC770F408567173E6E0AA4D ab*Si
967,783,740 *64E4D568FF5E2524F0DB4FA620451C4A7538131F absini40
967,783,741 *64EFD1B8D53A596A6BFC1080249E0060793F1E16 Absinthses4
967,783,742 *64EBB438D0453B2D32D6CFB53E862E294F1E9D21 ab:sk
967,783,743 *64E9E143812C1991005BC26ED0448D5FFCE80062 absmetys4
967,783,744 *64E6688ABC0CD4575B2161F5FB12AFA1329B4688 Absolutchance5
967,783,745 *64E7492EFFFFF1B30A7EFFD483B4691DBCFF3518 Absoluteideing
967,783,746 *64E9BEFA1123F21400DD22047EEC568B9143C3F8 Absolutely Live '98
967,783,747 *64E1571D9DF1E1A35912AE3A438C5D8A3608C095 absoluteqi.comwww
967,783,748 *64EA690C3A1E83799203B1D09D3123900EFA7F1F absolute seventies (disc 1)
967,783,749 *64E016E855A8B154D966CED9D52F10EF38CE75F4 absolute space (jazzanova mix)
967,783,750 *64EB7D6350EA992E01123BB4E5AF853FACB13694 Absolutreefer7
967,783,751 *64EBFFF07100CB507C7E159DB2F8602DC363FC03 Absonum3
967,783,752 *64E5823000D147EDA530278FC087F0CE110FB8E6 ABSOP
967,783,753 *64EFE010A7BC0973BED973B7313C27B00FB9C88D absorption-re-emissi
967,783,754 *64E0A2FB550CB02EDDFE03491CD36419F8339EA1 ABSPX
967,783,755 *64E7587B8E9DB1E0D11936AF05FBD5EC50F400AB AbsQk
967,783,756 *64E576657317FE7111F156EC8EBD5E5C809C32D1 A(BSR
967,783,757 *64EEF8EC8F227F6C0D3B08681CBC47DE97CF4CD8 absremrued
967,783,758 *64E42DDF6119B3B9CA96FBD2C5034B0744D1BCE5 abstandsstörsysteme
967,783,759 *64E5D1234C8A8A5E3058CCDB8AF15D65F8C8DD00 abstarction
967,783,760 *64E872663BF2C614C5757AF1AC032390EB8745FC Absterses0
967,783,761 *64E1E2DA7373B3C6AD093F796F6053622704C154 Abstersiue
967,783,762 *64EB3EE225CEFE24A85B08BAD5727668C9FE4065 Abstinenssymptomernes7
967,783,763 *64E2E6D1BD6D4E482899EFDACE217D3CAFB21B8A Abstinentiedagging
967,783,764 *64E9FCF27A4E10366BAFF305561C88BC355CBBD1 abstinenz3
967,783,765 *64E68E396945F0AC20D015846CDF15ECA6B25CC6 ABSTINT
967,783,766 *64EC3DB8CB74E6B564B13A4FE38826C61F11F262 abstlbswed
967,783,767 *64EF9C80D6D40FC11064D0C80AFEF2C3942E91D9 ABSTO
967,783,768 *64E11DF1F26CB8A67A52C9F0CA96D029CBC81090 [email protected]
967,783,769 *64E0981F6E9E7C9E6DEDDC65B7D0A86049E9E2FE Abstractfonts6
967,783,770 *64E3C8F72B577BCACB868092CE854D550306252D abstractltrefgt
967,783,771 *64EEA82C0494B82CB0AAB09CD34A152E58A41F92 abstradas1234
967,783,772 *64EC73CC3B26355493251DC1C2125A0C06E3E8E3 Abstraka
967,783,773 *64E4ED64C6129653F69B07C0D5F4B89FF0047ECC abstraktion3
967,783,774 *64E9F50526ABBC93B26CE975D0CFAF69447DE3D3 ABSTRUCTALITY
967,783,775 *64EC1B8186F6F5840BFDA32850FBC91914D0C78D Abstuetzendem6
967,783,776 *64E0E535035E26E0B761FED1DE087074D53E4610 absturzs2
967,783,777 *64E99D4D49501298FC9B1C2365C2B09D9E20BDAE absuq
967,783,778 *64EC9E72B5CA5EA4D8ACA4B89FF76C2BC91D9A29 Absurditebsw9
967,783,779 *64EB65ECE94FA7368BBDC27035BB7C14BBD251AC AB(sw
967,783,780 *64E3C64BA749FC7D23BC49A8DDEF671EB8BA7F0B ab)SW
967,783,781 *64E5FDA049D2972E162E7E369D3E534CA8271E80 abs/y
967,783,782 *64EF55A4D15A72921459086849F074123098DE7B Absyrtusn8
967,783,783 *64E5427049F8981355CF2097CC3F9CFD46E6FBA3 Absystemsbsw1
967,783,784 *64E7D9CE1C7E45308B3DE09C98F77B508B3D23A5 ABs_Z
967,783,785 *64EFA8E88C92E09F8BB64792D6DFB5ED9972892C [email protected]
967,783,786 *64E0097D8AEF7D3AA02C698593D8AD6A201F6A9D Ab?T8
967,783,787 *64E56DA74BA620DE3CBEB51CB7390A06D044946A abt9+
967,783,788 *64EC6F0DC9A6B57755A763AE09ADFB7B292F20C6 Ab$tain3r
967,783,789 *64EC85B5A3152BF56D56908A19BA9650BC190750 ab&TB
967,783,790 *64E69D9992947F8A0E4ACF9FDC5E4CF7CEEEEB1C [email protected]
967,783,791 *64EC029DCF763886BE245DEA6293201474958B65 ABtdm
967,783,792 *64EAFE24E0FE68CC2B5475D39B775823D0EED810 abteilten7
967,783,793 *64E6C06B5736A7CA265BF5F0F23E291A5568CB95 Abteksabkcirtap
967,783,794 *64E7A523676455EC817B17EFE5970DB7E1C7C5D0 abteztius
967,783,795 *64EDEB8D2EA93D27656C51E76DD49196400C74A6 ABtfl
967,783,796 *64E553ABE036FABBA26827DE0B683B85E66636C9 A!bTI
967,783,797 *64EA86F2053EBE85BE95FC9F3FC307183D9FC24D Äbtissinnenamts
967,783,798 *64E0FD30D6FAAD979B6238FFC3C29784DEDBBEA3 ab\tJ
967,783,799 *64E88296833D74B6E9A36910B4D2693AF1DD0C8E abTnA
967,783,800 *64ECFC0A58329893ECA7B00062B55479DAC239CB AbTnG
967,783,801 *64E875642577FFC76537E2E18C31A5EDA813C189 Abt_R
967,783,802 *64E153E60FB958164ACAC125C85CF995A0FE18DC abtreting
967,783,803 *64E19ED547B1C96D0C8A5DC858DA7E1C7ED2FD9B abtrglichstes
967,783,804 *64EBB462B931F7A0812777FDE4741A22DE254753 AbTsA
967,783,805 *64EA778C3D40FAFAD1B9AC21B8A56BAFBB8D164F abTtG
967,783,806 *64EDFF8BE5347469226DE8B443AF512139EF9E5C ABTTk
967,783,807 *64E33E9E0E4A0462CA786A8F27CB2EF9AABF1F77 AbTU1
967,783,808 *64E4B9093A8165B2576F2ECC9479E2C9DBFDB501 abtvctkto61
967,783,809 *64ECB7F682C73D79DABF3726D0A54F07BE46EEE2 A-?bU
967,783,810 *64E94F531A40E9C84CFB96E1DC4E87AE80E1AE66 A!#bu
967,783,811 *64EA63CD6BF0CACC0663A181DBA43D45103550E5 ab{)U
967,783,812 *64EB6084B7747A9A1BD4B52970E8614DB8CCB6BD ABU1=
967,783,813 *64E6308A2FA5C490409626BC4A79AF15C13358A1 +abu1arize
967,783,814 *64E6EB183256CC45C7AF6530843076A5B76B6BF5 Abu2c
967,783,815 *64E0E97BEFEC423BD664A8E6B31D20954CEAE105 abu*5
967,783,816 *64E60AB39F5EDDA62A4362328CC3A4D73856AECB ABu=7
967,783,817 *64E370313BD471845A8F1B601E4115C60F976AD5 ABUbj
967,783,818 *64EB2BA7F427BD560B357DB743A42D113B6E7E96 abUc(
967,783,819 *64E1EA033E05F5F1B42AAC34E9B9540BC9194B0E ab<UF
967,783,820 *64E9B8BE4B1ECAAAFB4DC6E30CF2F6D0E0AE031B Abuilyement2
967,783,821 *64E85D273FD141A95F8BBD88D072CD3E95A576CE abukarbashir
967,783,822 *64E97E49E23E283F7C911B7D092758E0E2647B98 AbUlf
967,783,823 *64E8F098A863B81E6B145CE899F96899CC4A1332 abuliched
967,783,824 *64E7AED988EA8D84ABFB2F34A51ED848CF7DAE5A abulrahim6
967,783,825 *64E02C62CA0FA2768EF89B25E84EA45C202FB938 Abultamientos
967,783,826 *64E6C84C748C5A25F8FB042319F981EBBCFB1256 AbuMC
967,783,827 *64E58F6FFDABEAAEDD1EAA70FA154A20EAAB1051 a bummer
967,783,828 *64E58E43B6F999D01469A0AF9D74365642D85379 abun bun
967,783,829 *64E5780EF1FE12CFF5B0FFDDFCF35FF702E0228D Abundavaming
967,783,830 *64E3C3C442C7AA26F449C12506D5AB260AE1E819 abuojnins
967,783,831 *64EB08CCD4C75E706CD4D2407F3AFFB1015AA97D ABuoy
967,783,832 *64E1E0243E4AA91CA07C67B5E45B387EF8286F78 ABu!q
967,783,833 *64E0FFDB252D96F12A9CCC17A7712D2C1167B878 Aburabozes
967,783,834 *64E508587CF7EE9F8D8CD77288428A5B143FF6B3 ABURIMOCHI
967,783,835 *64E59227D73F35D9A53AEB82D8F48B6095DE1981 aburk1234
967,783,836 *64EBE22E2390B50D268BE4F9DFD155B1F9A2BED7 aburridas1
967,783,837 *64E4677BE6671418C6FAAEE2577E26C957528565 ab;us
967,783,838 *64E0F178A2827DCE7C914DFD10C7E1B63F8E97CD [email protected]:alshaye
967,783,839 *64EDEA86083DE5697098EB75333C79BBF90159D8 Abusera0
967,783,840 *64ED8F9A0E228F7CEEEAE6070F2048210D643D91 AbU(t
967,783,841 *64E115B84460B9AE52F3EA95A7496B546108E352 AB
967,783,842 *64E5EA4FF68D4FA54D553A314DA96269B3AAF502 ab;UY
967,783,843 *64EEEB736AC8B3563ADEA45E93E228B3C8EEEDDA Abuzarse1
967,783,844 *64E9EDB51E17A2F33071C5932FA24C6BBA9BD45F A_B&v
967,783,845 *64E22058527CFBB8ED9D7C085637682B270A5993 A:,bv
967,783,846 *64E4FC03C9283F5F6ADC7A79ECE405F1C1C78234 A,bvh
967,783,847 *64E619651CE64AC2D065E91C88E3466F0343D15B abVmc
967,783,848 *64E29939CB316821E3C3FA985EA6DB668B85252B ab<vt
967,783,849 *64E9886A26D897F66B4FF7381683FC81523D7487 Abvuw
967,783,850 *64ECB2394F99807118018C4001A05BE6EEB923BF ABw&/
967,783,851 *64E7EAD0CE94311A86E5156686652DAFD11538EC ab.W!
967,783,852 *64EC8DE48C81E09B79CFA08DA44D1DFE7804C3BD AbW33
967,783,853 *64E5470C09588CFCB27C28E838C6260605F3666A abwachsen
967,783,854 *64EA82566EEA2DB76697B88DF75288B5ECC0EB41 Abwasserentgiftung
967,783,855 *64EDC8BA2AF632971570909F65C248323E07E733 ABwdj
967,783,856 *64E3877708B17966F9985F96028FA29CE64AFDE3 ab&wE
967,783,857 *64EA42C7EF82E027FD2ABA511B090E4C26F254E5 abwehrkonflikt
967,783,858 *64E896186E8163DEAE969CE9DCA38C8634AAF47B ABWEICHENDER1
967,783,859 *64E39010A33450CB14EBD5B5FFEA76520A3C2DE1 ABw_g
967,783,860 *64EDB843BB5F2E58B3911E5AC48F4606A83C14DC abw!I
967,783,861 *64E674E3A638471BD81624CFCBA4B54737C60623 Abwischendem5
967,783,862 *64E657714423C9408B13859B48B0637EFF07CEC5 abW\R
967,783,863 *64E034D5DDA6AC5B6664A1BCC40A2AB339409B2F Abwurflasten
967,783,864 *64EA95877D85CFE317902E27F473C0AEC2194E03 abWv+
967,783,865 *64E8D780368D9747DC9EE990ABD9A1D1058931AB Abwva
967,783,866 *64E64F99FC3BD3D04F5BEE14FB566698E0A5C556 AbX#,
967,783,867 *64E2CFC8B76C4F10FB8D71CCE8B7733A8500A5CE abX(_
967,783,868 *64ED6ADED6025197868CE992F0AEFF9570C7F490 ab?x}
967,783,869 *64E210E9FD449D74C1F9C8782608166C06626052 abXA>
967,783,870 *64E90BA7AE564C1CEBF6941782CDD1AEF7CD3601 abx#C
967,783,871 *64EF673BCBFBAD6410622CF7C58A2AA7684A743D abXi6
967,783,872 *64E818BC55B9D19D97610E18AAF1A392592AE647 AbXL"
967,783,873 *64E530F94057C4A4C9025E5BE5495CCAD83ACD30 abXqI
967,783,874 *64E8D1DE440C97509A1367A235FBF7FC476FA351 abXR(
967,783,875 *64E5E98A8BDB624CF24C4D12BB62F01E4D5BE570 Ab:XY
967,783,876 *64EED1F667EFC7E1DB9C0F9386E94B5A0E5DC69E ab~+Y
967,783,877 *64E409EAC0C98A534967EFC9FD5048075440DEC0 ab|Y|
967,783,878 *64E524BBA07EC14B5C94C22562EB9C1C0F5B0332 AbY0K
967,783,879 *64E9DB2B43B0D13107ED2958F07A050308F56496 abY4V
967,783,880 *64EADAD5145563433B071D5C2981A94E65937C9C A:bY5
967,783,881 *64EC667AD7F2F5A6D3557EF895A59C15D97A2592 aby*6
967,783,882 *64E2349B0930218093D51CC8C9C1FB9E4E03625A ab]YB
967,783,883 *64E4797043C13C8275467D903F40FF6A1CB1A303 abyc\
967,783,884 *64E707C38132900356313AA0C8AE1C2BA645F4F9 abYJ+
967,783,885 *64E75FAD10647C3D7B642C3C9FFAAB7CEE314454 aby mezher
967,783,886 *64E42FCA1E7F337683C36B513F3E634173136A76 aby~O
967,783,887 *64E22CEF8F2E3A10587B61DC4917E2F3C3AE106E abYOJ
967,783,888 *64EFDC0E3341141B46603A6DF255B6B1257CE6C4 abYQ#
967,783,889 *64E73977BC59ADE3910C1ECE695F5AA2EA0C3130 abyssinia?
967,783,890 *64E3E8B4CDFC2B44D5A899BE755BBD395EA06912 Abywffynph
967,783,891 *64E5DBB4CEE6749EC2130074AD6F9A51FC60EC28 A+"bZ
967,783,892 *64E03C629C9F16CF65E2E1BE20918ED44D894D05 Ab#Z+
967,783,893 *64E66EB8B677595F1A00CC14E8F4F969EF59BD80 ab\[Z
967,783,894 *64E4809CC88510634088697394C05A1F26DCBDCF abz4t
967,783,895 *64EB2DE28C7D1DE6B35BD694DFE641132178ABB4 abZ75
967,783,896 *64E5152C8B42E787FF8F93A231C8BCB88D8B4068 Abzahams
967,783,897 *64E3B99F674CF09D2ED520C7DBFEB88B9EEB61DA Abzahlungskae0
967,783,898 *64ED707CC706F1C10F2E2436A3090B7A0E7117F3 ABZAn
967,783,899 *64EFAAE68BDF1E3A7D31A768881D7B64A7FE9D4E abzFd
967,783,900 *64E008D681A470F3F7DF51503E3CAE0F5845542C AB+ZI
967,783,901 *64E75ED4791B971BB8A19548647C0053DDB9D6E3 ABZIA
967,783,902 *64ED617A89295AFE19A4D777EE481B7B7869BB14 AbZpf
967,783,903 *64EEB5EFF1BD20BE0F7CC62974D1D555E0AD050C abZsC
967,783,904 *64E829CD502B37A334FB9171A447D955859E94BE AB=ZT
967,783,905 *64E1DF9255BCF5641CA9117EC8273D1479FC7587 abz*U
967,783,906 *64EE8F6118B80FB4B21F03C4132BCAB50A226332 Abzuaendern2
967,783,907 *64E9243F6C8CF0804E3BACA1932AA23ED886F62A Abzudrehender8
967,783,908 *64E3BAFC971E63579285836FFD19DF99F011A99A Abzujagen9
967,783,909 *64EEE53596E24F0C9595429881DBE92B8C2BD7B0 Abzuschwa4
967,783,910 *64E55362E1BC653C0F6E63462824B886B87A7CC6 Abzuspielened9
967,783,911 *64EAA479EE9623F34BFFC96E3E28C4F8BC1F1F7B Abzustumpfende2
967,783,912 *64E2400686846E62F31DBB33FF6CEE31816EDADA abzyo
967,783,913 *64EEA174D708007CB6462BDA96F7CB30F29A11AB abzyttxz7
967,783,914 *64E0603C671608AA5935D12D0E3BE2EAAF474C74 ab、身長177cm、体重65kg。
967,783,915 *64ED84CD86FBC283696AC94940AC95C077417058 A=C+=
967,783,916 *64E2407C6631AF7DF37DE91FE32ECFDAC1759DB7 A-C-$
967,783,917 *64E611E9A8471F9D291EB279FF39B7D567C69ADF A,#%C
967,783,918 *64E2EA596B85F79E6B19756468B4DA3C6FEC4DF7 A;C%?
967,783,919 *64E26DD9737B3074193243D399E3B23B8C728666 A
967,783,920 *64E21FDB26D2E7653BD66D86289763211843F38A A
967,783,921 *64E93172CDCB4BC3E96600FE3AF9A0C8610A81E8 AC_>
967,783,922 *64E88B47033640A760D912AEC90F9CE28DA7D901 A==c
967,783,923 *64EA945E7EB749BED4FC0B060F59C8D35A89B557 A,/c=
967,783,924 *64E23AD0875B052CA0DC0754C4558EBF890102CD A,#c?
967,783,925 *64EE3FC6EBA493B644F0440156CF9583C8D57782 A???c
967,783,926 *64EA54642145CC2882366C31A71CC8DBE68F9BFF A)".c
967,783,927 *64EBDAF91CF89982F55F1A0F81239C0D0FA5E3A0 A)&c?
967,783,928 *64ED8F1D84FF804B37BD404FEB44FB796CB27EF9 A$"c
967,783,929 *64E7693ED82B08E8F83DC39135F0518DE8C934D9 A&$c"
967,783,930 *64EEA7B48D7CBCB4D75943FE63D0AD6DAD582777 a,C&
967,783,931 *64EF67EFF7BA3C05E6F7E2D5D12BC7D5259575A2 ac`~.
967,783,932 *64EE70E1D0B1D27D1CF542990796217884F8CE66 ac>*,
967,783,933 *64E15EF85EB6BF10D95E6C2621121008AB168AD2 ac>*+
967,783,934 *64E6F351A6D76DFF97219BD6F1DA0C53539F276D ac|}@
967,783,935 *64E1FFDF01FE6E3E6A09DD322985D8AD37515567 ac;#|
967,783,936 *64EBC0B91D6AD769C6DA82FC86A6BA669CCAF693 [email protected]/;
967,783,937 *64EE125FC581213D019E6B09812989923926E28C A)_c0
967,783,938 *64E1EAB3E724885367DA4FE8D931532C1F44C04C ac{/0
967,783,939 *64E2D22B34694BB4EA7D41EA5FE415618810EE33 ac0b*
967,783,940 *64EDB9AB865B002CB1159808A673C9960D89DE34 ac0bK
967,783,941 *64E18B6788F3BBB5A2F6B92A26B5B3473C66C408 ac0]g
967,783,942 *64E231C480A4FE6E95F39CA390326B89B198EDB5 Ac0GC
967,783,943 *64EC0A10FF256BC404C12562BFC8D45EBE8E8D3E Ac0jA
967,783,944 *64E42381C3FF6CFD40655B32DF8E0E131DDC4F69 ac0{P
967,783,945 *64EAA86363068503F5E4EE2AF56EF954FDE990FF AC0qm
967,783,946 *64E0DCB4CF03E3B2399C831A214B40F98B787AA1 ac&0T
967,783,947 *64E6653F49F038AC09B6BBB49CBC563D07E1CB2F Ac0u$7!ca11y
967,783,948 *64E3FB037DDC3CCEA8327728A3EF40DC671765FF ac1=~
967,783,949 *64E50009CF14622D128DE212DED07031DFD9205F AC1LOVE
967,783,950 *64EC7044A4A6DF1425922D45875D467E3B93F638 A)c1m
967,783,951 *64E2C425D05789B389E67DB24C8ED6BA4AA8A24B ac1.V
967,783,952 *64E6F6EF8FE20B9DFB0726D620C56642F5B6F44F AC$2:
967,783,953 *64E71D170E3D212BC8B07C5B57F5C1D1DD82D73F A
967,783,954 *64E709C3CDBEBA04522C2F60F847A852FFAB3D89 ac2E7
967,783,955 *64EEE3713D0A41A554E0106573971E6B9414447A Ac2H)
967,783,956 *64E4F41EA2B5D5D77763DC75DE2DAE2CC4D7FD5C AC2&M
967,783,957 *64E539B9D1FC9AE715798016C5ECF7A3CBE3407F Ac2mh
967,783,958 *64EAE63065C45FFAD3A65841950A9C8F1FAA8F5D Ac2N8
967,783,959 *64E02BBEF6FBA9DC0D840502E331D745E0AC1337 Ac2R"
967,783,960 *64EB343FCBC1735DA92BE4BD85A673C3F14C55B8 Ac2ZD
967,783,961 *64E8B588D6B5F35D29946A6083B94EACA5670077 A=&c3
967,783,962 *64E7C009EA1980BCB7378F71D3C11A5C6BA57963 ac#3?
967,783,963 *64E6444810E5741A234C4172D5D21D6A1F8B4082 [email protected]
967,783,964 *64E249C8E74091A2A2B4F9DF9C35BCB93489407A ac3~i
967,783,965 *64E101240EE6AEA93B1AFCB11FF1A6CBDA28FFFC ac3l!
967,783,966 *64EFDCCFE8B6CE67DBD0A487D84739FDB0DE777D Ac3tylch0l1n3
967,783,967 *64E0E378BF362151FBB6162AEC97BA8253FCBC7B AC3V1
967,783,968 *64E05395F316264F314E6B804E2A8454840C770E A=C4#
967,783,969 *64E6DB1DDD106D3B2633E890633A0354BC3C0A2F A-C4
967,783,970 *64E5DE6B08FD70902A8E777F6596ABC2C2EF84E9 AC=4#
967,783,971 *64ECF853B2EA1314BA62335107D06508AA76529C AC
967,783,972 *64E36EDCF00E0449F7126748F41A24CA88D00572 Ac:4?
967,783,973 *64ECC972EACD882651B9AE429B0915F403A2E6B3 Ac4)=
967,783,974 *64E53798B8E5FA80A7764C8BA2AB0A461E596DD8 a"c4
967,783,975 *64E86A68CCEEFAF49CBAD8D4CBDFE389DDEE8F0A ac4.e
967,783,976 *64E9AAFBB1F06812B4F4BA8950D43E96D5A4A77E Ac/4n
967,783,977 *64EBC6758F9741AC5AFC118BF9DD88CE8AA68E8F A&c4u
967,783,978 *64E541D907E2E19B5F40EC255234E0BC08619ACF Ac4Z$
967,783,979 *64E1A12AA38DF4231E68DB87C2C320405FEB9D33 ac50W
967,783,980 *64E299D0D75D16D7B9CBD773CEA3E7D60999967F Ac5&1
967,783,981 *64EB730C6F60440DB26CE95046033183CE10904E AC.57
967,783,982 *64ED4DB43209D91D00DC0FB30F202F385661F440 AC5L,
967,783,983 *64EED33E11168E2BB783C020BBF21B1DA33E9D01 [email protected]
967,783,984 *64EAD247E6CB10A0CEDBADED38161AE33285FA9F Ac.5m
967,783,985 *64E40DADCFCC9B8159A441559D43C8429C3BEA47 AC5OW
967,783,986 *64E18AB766B375238E12BD8B390E7F34D06EF2B2 Ac5pG
967,783,987 *64E38D1EC262A697E71B238692BFF2D19E20C98C Ac%6;
967,783,988 *64E910E3B3C24818642020DECA5EA158D021AE49 Ac+_6
967,783,989 *64E948E8B9FBEC3853FCF809089FC28791D2005D ac6-(
967,783,990 *64E38EF447A3EE68CC69AED8AB9251A7B5C0B7FB ac6a6ac6d38f
967,783,991 *64E390C9C34533EB2D3FBE71EF66636B12D1277B ac6Ap
967,783,992 *64E52964EE5D9F20E2720706754D5EDB07084FC4 Ac:6D
967,783,993 *64E6300D5357CE3E1A746360A96B6AB004B287B1 A(C6G
967,783,994 *64EDE33E0771480EA1E3634514483EC08FCECA7E Ac6oG
967,783,995 *64E33367CE216E03E89BCFAB135EEFB874E1B162 AC6WE
967,783,996 *64E987D6032D44C1DAD3019BB34C605FD9730EC9 A%+C7
967,783,997 *64E6798A010BD0A7FC4D16FD2EA65E0ED959BE8C A!_c7
967,783,998 *64E9AF777C7D620E69AAE54DAB52340A07813F76 ac_7c
967,783,999 *64E083E9C13FAF2904068482F7E6DB2F1B013AA5 ac{7K
967,784,000 *64E2C0CA6865226D0947DCBD52E9A64DD7131E29 A;C7Q
967,784,001 *64E74F8673B7901AAEA7B740C49D27B7EC81BC4E AC(7s
967,784,002 *64EE47D5685BFE4D7130812A2EB10101AD418357 Ac+7U
967,784,003 *64E5D1E8F8438FD7E838F33BBC9FA503564E6FA7 ac7%x
967,784,004 *64E0D87A1B73523013D886E8828FE8EA3538A4A6 A!$c8
967,784,005 *64E27594649B6EC4606B25B85FEA41A8382CF4A3 A#-c8
967,784,006 *64E76AA159FB5E5F7EB3E81B49A85D607C7C4C47 ac._8
967,784,007 *64E5154005E4E8F246157F9D86C0591B9001934A [email protected]
967,784,008 *64EE33CC842DAA0748BBA655BA61E5BDADAA6DDB A:C8F
967,784,009 *64EF9E96604BBBA5531B8240F600D2ABAC0FFC98 ac8&f
967,784,010 *64E3CCE2052B4DDB74C1202A14888284F1262637 AC?8I
967,784,011 *64E8FE30458B66F7FFAE7E5163D93CF32CC5331B A%C8j
967,784,012 *64ECB6EB78D5CA73DDF54E5AC2C5C1DE7FE4C259 A/C8P
967,784,013 *64E10D63ADD7BC8334F8710344FFB83D8561C71D A.C.9
967,784,014 *64EB5B439202926B049EF777509CAB18E07324A8 ac9,|
967,784,015 *64EE15E636FAEA5ACBDA4839819E78367B33BB29 AC97
967,784,016 *64EBADC565D9ED34A31C9475396E56A339C0509C AC9E0
967,784,017 *64EB84BFD46599B15DE05E8F55041175AFD2D8FE A/C9L
967,784,018 *64ED67DA188043C6376882FA91F6264306344DEA ac9_L
967,784,019 *64EBDED13F061B563C75D4C6C57D4B9F6CDCB597 AC9$U
967,784,020 *64EE9E8A3CBE6E33D55E87FF1025E85EE34D1043 AC9u_
967,784,021 *64EACD22D8849E3BE2A84723B6051A2318F2B6BF Ac9U?
967,784,022 *64EED35526048678EC157336B5E131EF60BFF21C A;C
967,784,023 *64E9617C47648B0E35B82669C901D62F0458F10F A_c)A
967,784,024 *64E701751F6D624B39C8A012BA3255202E474C25 ac^)A
967,784,025 *64E9F0FC730E3644AC2C899F42696E424A2C4DC4 ac%A6
967,784,026 *64E6BF25835F46038F27A680D6C0AF06EDC70817 acabaste123
967,784,027 *64E42C29637789A54E66B00F7F7C031FCC1B45B6 Acabrunha3
967,784,028 *64ED42B00CF62300C96286CF46EE87789467424D Ac(AC
967,784,029 *64E5B5F09E015DBBCD26DE1039B159EAB3B5D441 Acac5
967,784,030 *64EFD846E32657CA7683790C51276B3A1F15A82B [email protected]
967,784,031 *64EC32EC4A28C4B1D1DE7C348B4255D27E334E1C academicbuilding-tamu
967,784,032 *64E538B40BB1DED3AF7D68F081B01233DE74B970 AcademicsDocs
967,784,033 *64E94E425D880E47DC979C39A54DC4A324ABA628 academique1
967,784,034 *64E754EBF51E047C519D7F87A7CE7B0EB4A2FF08 academydavid
967,784,035 *64E55058692BE806C759497726323256A0EBCDB5 Academy—in
967,784,036 *64E305EB9462E2DF9FF6289D4536CECD4F4A2754 academyknightswood
967,784,037 *64EC5D0284884FD87DF78CB0CEF87DB76FAB3E34 academyshady
967,784,038 *64E47F65F671108FF92371DA6D95A5CE5B75CDA8 Acadwork7
967,784,039 *64E08323925625153D92DE05E0A1CD6004BB2136 A-cAe
967,784,040 *64E024668D35AAE98A30F1D475FF6D178BA34C94 ACAeF
967,784,041 *64E7A26DA25E7A263AC1DC29E4BCBD528A7F87A1 acAJw
967,784,042 *64E14F7B010473FC1E93BA6819F71AEB407B5762 Acalbi923
967,784,043 *64E01CE527D0DD60FBF84C10A05C5B2487F6E6D7 à“calubriga”
967,784,044 *64E5306F82EADF4DB8970081C06325288E346713 ACAlY
967,784,045 *64EC15306A7C3EFA4E79FA8DCFBF2C47D505266E ACAm$
967,784,046 *64E0D4EA685B91C8459AC7BB183CC072A43C690B acamberos6
967,784,047 *64EA4D1C25B3B268B8AA30F903B37DA80B9A08B8 acampase6
967,784,048 *64E1F989A3B57ED61584E5A128DAD4B82A9DF5D5 ACA;N
967,784,049 *64EFA05D1CD66BE861FB10A6708336A8D4B77DFC acaN_
967,784,050 *64E333E8312C1C5808DF84A1F7BE20CEF5A86DFE a$can1an
967,784,051 *64E64177ED731C62FFA9DCD63882D8638252ABCE acanedeljkovic
967,784,052 *64E8A8DF8ED2A6C65CC13E76DCF51F69E1881BB2 acan+hocephalan
967,784,053 *64E23201F16DD68E65F3F7B31F589138FFC2C66D Acanthins5
967,784,054 *64E1922F661223C3A19F75412EA9EBB26DE8A0C2 Acantonarives
967,784,055 *64E013188F1E9AEECF1E7759314913D89C8EF946 AcaP)
967,784,056 *64E75780BDCBB3C22BF1958740688805892DD9F7 A Capsized Moment
967,784,057 *64EF56A88CBADA8908E7125D142DA61FE66026E0 ac<AQ
967,784,058 *64E3770ECB20FE625EB1CA42BC7D45976940B9FC AcAR"
967,784,059 *64EF4C1E9BBE0ACB031844E7DA806387A40D7E79 ACARAPE4
967,784,060 *64E0AA5A2E7210A3A79602F62ABAD7EA84224996 a$caricidal
967,784,061 *64E943D097E4ACC0EAA3FE419706234F5D147BA7 ACARINHO
967,784,062 *64E066D319B7B2FDFFEB34012C164C071B297EF8 ACARRALADURA
967,784,063 *64E94D1C7829FC40123D51FC2C01CBBDC6496C30 Acarretavas7
967,784,064 *64EEE1C2FAF915F88EF90E187666913A98F37707 Ac+AS
967,784,065 *64E4A1991D7A80750811238B43537348AF165B57 ACASADONA
967,784,066 *64E3F69D3C7F47CCD4FA8B11229A543B3E08D167 Acasamatada7
967,784,067 *64E2942E7A7378675A6970A5F9B3BA69BC82D616 acassino9
967,784,068 *64EB7961CB5F6ED433C6C119EDEFFF799D66CC2B Acastus.
967,784,069 *64E4F9553A08D841D492F7772D64D5C8D0A38A65 acataleptic9
967,784,070 *64E83CE27F078706D24A645C307F1FF37E9221CB acatarmos1234
967,784,071 *64E07EF3C7E92AE7A1A9054ACE46E605EDE43722 acautelarem1234
967,784,072 *64E687CD7CB3225B1833C87BB89043DE99AFF83F acAye
967,784,073 *64EC606EA0B44E2CB08CF1441615F439F9B05685 Ac
967,784,074 *64E557D5D838218DCE3BA4F4E4F7EAE264F7A60C ACB206602CBD4DFB953E2730354F5C2Dcredits
967,784,075 *64E57DC8A1616481124EAB98864C488405EEC313 A%cb8
967,784,076 *64ECAF53B8F651143650111201D4D48D8335DA35 ACBEq
967,784,077 *64EAF57ACA00E9C6958E4FCD03936FDBCD64551A [email protected]
967,784,078 *64EFA16F20E0E1C6D3C440AC95DB3066A7D10B86 AcBh=
967,784,079 *64E487277F32BE7304A74F71CBA60E00B15F55BA ac%bI
967,784,080 *64E3BCF820A6631418666DDC12C3C2D93A58440A AcbIC
967,784,081 *64EDB0FBCD0BB6A3E422F09FAACE3EA814972EB6 AcBiN
967,784,082 *64EF43E138150113F2E07C1178DE9B0A4DD718DF AcBjk
967,784,083 *64E3143B21699AC0DDE6C3FEEB38BFF8C4EDA680 acbKq
967,784,084 *64EA20321D17081B5E4FADF2F3EEDABA17481D30 ACBLc
967,784,085 *64ED655F25C9B34C5057C8C1613C64036C5198B4 Acblm
967,784,086 *64E19F820FFA65B4289F220EF3864D4BA3DC70ED AcbRb
967,784,087 *64E292BA81B39BD56ACF531ACCDF20BCA74E406D ACb.u
967,784,088 *64EBAD9BE405DA45CDB0B2898ED1849372CCD1A6 acbvbsw3
967,784,089 *64EAB6BE581B40095CB8B0CA6FD18F8983A6F349 ACbX"
967,784,090 *64E346158CF88ACCF4049D828711A1B010D20AFE AcBYh
967,784,091 *64E7B4793AB70EBAC5468B5176732BE2D629C5BE A&+CC
967,784,092 *64EDC2E1A02AA6D08732F4438A4830EBFB42039D A+c_C
967,784,093 *64EF59AEAF2D1FFC88FFB35BBC73C3E61A1BB268 Ac_c$
967,784,094 *64EB8AE75F963F8C2B29F44B1F1F60D25CD63A06 acC,!
967,784,095 *64EC749FD3121CFE5918E5FE2C4E6D6CE87C654A Acc057able
967,784,096 *64ECA863B658C0E0314B7E94F25E969E5A320768 acC'3
967,784,097 *64E3036B5E8CBEB492200206D2D9E3F0878AD086 Acc9H
967,784,098 *64EA5295F001F6D73C80D2870F3F38F8BB0E1B64 ACCALMIE!
967,784,099 *64E2E0BE0851A9A53D25940CFE10916866CD01A3 accampanO
967,784,100 *64E2759A509E03614A5ECACD00B2D840BFED68C4 accanira?
967,784,101 *64EC34801D39A8D4FA68A2A064616A8356510FC7 accasciases
967,784,102 *64E7C4E2666D5DAFDE06131A305FFDDAB807005C accatacctcatttaatcctcaaaacactcctgggaaggagtagatgatgtaactgaggc
967,784,103 *64EB9ED7AD2C971136F4A72CEDF0AC2ED68CD1BC Accatasta0
967,784,104 *64EB95AB5E0ADE28E55F9A887BFAFD40EA8D7BD0 Accavallamenti7
967,784,105 *64EA5B6D192648FE79F36DA9967606E320330D6A Ac%CB
967,784,106 *64EACC87FB0F89A7638C1FC85249BDA645EF9D47 acccM
967,784,107 *64ED8A2E29B3AF3D154EF6EE9684831214188869 [email protected]
967,784,108 *64EAE473785868E7388B51A81EE0599D29F9F470 acce0f7f-4931-395f-b926-bd574ded9f78
967,784,109 *64E73DAC5293607A8B19C8A790F4BC80006E6881 Acce1er0me7er$
967,784,110 *64EADB2FC3198B695B9C5DEEE58EA1E757082710 Accecantesi4
967,784,111 *64EBC02A475AA5270A9D4350AB82C8E5FD23EF6C Accecheremo8
967,784,112 *64E98415C3918DD2402C5CF9C8F8C24946F6BBB9 Accederers
967,784,113 *64E342572074CE92076A30FAB9195754BB1F01E9 accederez1234
967,784,114 *64E693FC1E2D0E22DD12175F071D98B0A7A9266A ACCEDING AE0 K S IY1 D IH0 NG
967,784,115 *64ED64C4B24597F2B827FD5E04B7EB22710CF0CB acceitaste
967,784,116 *64E85FF011F969C3575BBBA4B8F16B83364BA9F6 ACCELERA7I0N5
967,784,117 *64E1A471B633AB9491C2BE8C60E5D12A128D6373 Accennais
967,784,118 *64EB5A175833D7F2A91F586F7DF4D19AEFF2250F accent-intolerant
967,784,119 *64E2636E27B24EA6641952245C51877C29E3166F Accentrativi2
967,784,120 *64EBAA3985E3A42BAE9A2DAB8C68227241804C9E Accentuala1
967,784,121 *64E190116150F6E6CB3DB60E052794F27F28CD45 ACCENTUATIES2
967,784,122 *64E579A8DF816B5B3C4A47974F56F120AFE2D933 „accenture“
967,784,123 *64EC95731915719351329D813FD41A69D0BC81D9 acceptclose1
967,784,124 *64ED285061BD09B84CE204753459A060AD0D7AA9 Acceptedhabitualhelding
967,784,125 *64E8CBA79199A342720A712805DE954331D02E32 Acceptiting
967,784,126 *64E1BC5CB5302FA9B6E990E1DA301BCAF3088353 accepton3
967,784,127 *64E49E25D1D16616FDFBBE3B797BC4D573E716F2 Acceptsamessagefrom4
967,784,128 *64E66084E3ACBCB32813EFE3064FA21E0F5BF9B1 Accertare9
967,784,129 *64E93A4BB67AFDB41ABDB8D2AB474D395EE97666 Accessannies
967,784,130 *64E58993B79937A4608B011F0891441D9C580C93 Accessbasket2
967,784,131 *64E277B39779F3EAF875FB64A49F84E390449D6D Accesscookies5
967,784,132 *64E6534379E09AE00E09179AA52C7FA0C833F0C5 accessdgj2
967,784,133 *64EA8F8813C8B9F847B5C3FCA771F2BC3C3DFB3E Accessgambit2
967,784,134 *64E37ABB405E21E78EFFF6691DEFA5EF85EDB4C9 [email protected]
967,784,135 *64E7306D84512F75F147857FA12BC45CF417DF2B Accesspolo5
967,784,136 *64E3A97E35DD9AEB5897A45B353F1F8051BAF78D access-resistant
967,784,137 *64E77D61E5AB7E5B5EE1EE824C03FB4920CE25A5 Accesssexy3
967,784,138 *64E6175231EDF778ECB345DF2435A4D413FABAF6 Access)等。
967,784,139 *64E11E31346A9C01CAFEE2F8B2A8B0E14E0C03EC Accettassero5
967,784,140 *64ED2E7BBB2B386A4144DDAEA79F8B0D97D4E676 accetterei4
967,784,141 *64E3C4BC70536D41095FA655A8F8E7E9CD0F5936 Ac$Cf
967,784,142 *64E732400BC933CDA6DBC4E930F3988B4EC193FB accfitax2
967,784,143 *64EC7DD51C73989D664F74FDDDEB4F2BDD45364C Accharin9
967,784,144 *64EE884EAD227ABB355F3CA70A02CF6F2120B496 Accidens
967,784,145 *64EF970D4BF8C8DB29232D1E51598AE3D7421169 accidentalolympian.comwww
967,784,146 *64EB8E99651980900267298B54719F01AB8C606C ACCIDENTALTOURIST
967,784,147 *64EA0C14C574F82D5A81EB7F38949930D12F711B accidentencephalon
967,784,148 *64E0A2F0ABB21826492E60756D728CCB5AB64301 Accideras4
967,784,149 *64E413AF0822728959DE14A25F6C89DD5145AB3B ACCIGLIERA6
967,784,150 *64E9E99F165456A03B1B109DFE6D933CC7AC366F Acción
967,784,151 *64E76400D8F912D535C7EC3FDDE8CB6F871AD21E accionavam1
967,784,152 *64E9CA52F38613B738F796183AD3DDCD085669FB Acciottolii2
967,784,153 *64EF2DAE65813300173F2B36C61B305F4D6B6406 ac\Cl
967,784,154 *64E24C80DE1312AADEE82CAE1F6241D83E028C14 、Acclaim、
967,784,155 *64EC4DD39C7EDE3F2C160A40977AF29F78B3C1F9 ACCLAMATE8
967,784,156 *64ED3A323B4F4432CE86D52D185652BBB66EE6E2 Acclimateronseses
967,784,157 *64E1F92470874698A5E645DFEDDED0DB26646AB7 ACCLIMATIZATION5
967,784,158 *64ED5741C26A17121C7FC543AA401C85EE251BAC Accloiethed
967,784,159 *64EAFB3B50FE9A659E66FD8170144A599D39FF93 A=Cco
967,784,160 *64EA25A62D8C40FADB0D9AF04DC6986332B5AC6C acCO"
967,784,161 *64E22A73874AE97BA50AE633DFADCB1FE9D7119F accolions1
967,784,162 *64EBC67CBAD2AC06DD71497B03AEC169FD5B6C40 Accomackbswing
967,784,163 *64E2B2D86C2239C6A4E509B65229148BBF959EEA [email protected]
967,784,164 *64E14723AB341969938978E6881884049262D87E accommodately1
967,784,165 *64E62E089FFD67859F275C4BFB9261DFC57EC949 Accommodationline8
967,784,166 *64EE0785E2F5D45F34E76B40E00D0B46A0EFC957 Accomodos2
967,784,167 *64E10AFCE791609710459779A4CF901243FD57F4 accompagneerden!
967,784,168 *64E14C7420B371D07CDC4942A7FF80768FCB563D 『accomplice』
967,784,169 *64E9C16689DE174C99273BF3C6F1470219539030 accomplirions7
967,784,170 *64E2C5A07D39E08806DDE3EE3BEA799542DCD67F Accomplishabl4
967,784,171 *64EDBA7195C2DB531F2493F54E6529D13A7AE8E0 accomplisher3
967,784,172 *64EBE1FDA58B865979A64F7E73BE4E1FF01E50DE accomplishment.pharo
967,784,173 *64EBD17AF1A812B70B21C1BA6D99E3F466277562 ACCOMPLISSAIT4
967,784,174 *64E9A0596F135472CC2F39221DCC29FF91A7AA95 ACCONCIATORI
967,784,175 *64EE1BACBFD4CB78DB5CCDE04CF7A6BE7A5E0616 Accoppiantesied
967,784,176 *64E66241AEA25CBE2C41AA6E47346AAE1B7C60F8 ACCORCERO.
967,784,177 *64EB67069C556CF947C2C44DB506DF9BF7FD9C87 Accordammo1
967,784,178 *64E98F72DEB001ADAD42BDFF36F7CB4C39971CDD accordedyuje
967,784,179 *64E7B678BEF53CBF5F17CED6E7344524A0EE1639 Accordens
967,784,180 *64EC93831B7440E7CE10C179C7697547A28B2A3F accordinglycaesar
967,784,181 *64EAC235F67846A0341DE0FB788230B6318A52AF Accorgas6
967,784,182 *64E412E98249BCE7C6E58A3481BAA9D266245A0C accorreis
967,784,183 *64EBA1BCA6CC5BF05DE40AFF48F907E159433301 Accoscias
967,784,184 *64E08663466B5DD4C1E6D85FCA6122104C035F44 ACCOSTAN
967,784,185 *64E6897D6E3CA6D3399501BA4C2F2833183745E9 ACCOTA
967,784,186 *64EF8BC87C80ED09EABAB80E07E26F165F7D9938 [email protected]
967,784,187 *64E19173CFD293F40CA16C2E355C9A6FEE5A7166 Accountants?
967,784,188 *64E46A50FAE2B9A25CE02FC4E19B2BEF52D1A839 accountantsverslagen9
967,784,189 *64E4A1262793A77C63A882EB91D7E917151AE693 Accountingperiod
967,784,190 *64EC93185E21AFD52CF151F6106CA38DBFC6CEC2 Accoutumerai3
967,784,191 *64EEADCE58EBF790BBD34C9063418AA07AC2A393 accoying!
967,784,192 *64EA40C9638F56C8A2947AF0480B6180FD1E957D accoyld5
967,784,193 *64EF293689D802C9F92178528D278C71E6F2AF3D ACCQ#
967,784,194 *64E0D22F29C7005F6BC5024EBAADEA0F6B18752F accr3m3nt1t1on
967,784,195 *64EE83C0A346ADD758B8368BAC54033037F5563E accransis
967,784,196 *64EF246296568D6B4F88C2F4D4D8F18FD4CBF003 Accreditavis
967,784,197 *64E4626EF2B7DA8C91603B5ECFE003F3256AC2FF accroachmenT
967,784,198 *64E551F9004A0EC6FC990A15D7BF45738EFF4A72 ACCROCHEUR2
967,784,199 *64ED05FC2BEFDFCAF0E3B6B20669127465D42BCA Accroidesed
967,784,200 *64E07BF50B4E2DD927C304DC6BABE1EF0DE3BE67 accroitrez6
967,784,201 *64E3BD60E3282B9F83B650542C240BC34C857DA3 Accumu1a+3$
967,784,202 *64E5ABF9C22E2A0F40930A447D2566C1E9982FFA accumulais8
967,784,203 *64EE8F24AC05AA073901AB2EDB0AA52E997AD918 accupressed
967,784,204 *64EC095E19D7170F8E560AD9BAD120A32E802B11 Accuratesed
967,784,205 *64E3E32366475F96D2895D284989D3181CEA488C ACCURETELY
967,784,206 *64EE011D8165C36012D7B6A41B91704F8C561D19 ACCUSA7ORIA11Y
967,784,207 *64E93FDC902BA0E7E3379D65224C26C3A7D3B3A8 accusarS
967,784,208 *64E59649980E79C7ECBE02244B106946FAEA7F8C ACCUSATIVES6
967,784,209 *64EF9AC69BAB3290F83A6B46BA3C1F42E821213F accusavamo0
967,784,210 *64E05E5A8F9D66EB3B4A35DE3C33CFEA68179D69 Accuserete.
967,784,211 *64E1437AA083BE934784049CF18842D1EE4C609D accusetsing
967,784,212 *64EDF6857616386CFCAA1C6FFE1CAE577A7C62C0 ACCV+
967,784,213 *64EBF3F9B91733C68F52ACACA448D7DBF3021EDE ACc)X
967,784,214 *64EF501319837F7B5DE83BE5171E11CBCD4D7BAD A-)CD
967,784,215 *64EEF62E399B52AC57B6E0C68E24FBA1BD893C51 A%c%D
967,784,216 *64E16AD23E2838511E45E761A2B1B22E7806634A A_cD1
967,784,217 *64EB82F7B1AE7A958C3B18A973737C8A885A07E8 ac)d2
967,784,218 *64ED92A5C1939229A27B9DD24675EE98EC3EF707 Ac?d5
967,784,219 *64E6190F3A8A2AF7BEB79CC7903CB1477D5E6446 acdalena1
967,784,220 *64ECE58688DECE311F6972ED1A365B08D7F54817 ACDd=
967,784,221 *64EADC6204E0B263045E06069A2AC22F34D77E9B AC
967,784,222 *64E7EFA2FE476324AC314EEC1347C4D985565633 AcDic
967,784,223 *64E5CAAFE86DDDD44FCD5C8F2240418617D45F29 A-cdk
967,784,224 *64E4AA7C5884D4EBB4B04FA7B51C859E1DFF492E AcDL+
967,784,225 *64EE25F4F05F08131FF15334DCE55367132F3658 Ac"Dm
967,784,226 *64E05728CCF949C834446B3B65DACC32F313ACAC AC/ds
967,784,227 *64E557AD6FCB8AB5D921A991B023FB84F85977E3 acD+T
967,784,228 *64E73BDDCE0546A3D3774C30A05EF9E2B00993F2 A#cDv
967,784,229 *64EEC6906ACB43CD990729F3B3FB95A5E127D2E5 Ac-/E
967,784,230 *64ED1B0AC28B60E53499CF870BB003EC0598B51A A_?ce
967,784,231 *64E1DEB6AF4312DFA4AB5333678D370555757F2E A/cE0
967,784,232 *64EA333FB912918AB4434BB5C3D860DB10B5C05B ace+0ace+a+e
967,784,233 *64E79816AED3F83A0E3DF3B37AE3639DF1C28113 ace11111
967,784,234 *64EC9618559F96A251D8F2EE31DD9F41C0896EC7 ACe1T
967,784,235 *64E1244CC11D0EF0AAA73BF51778C012F057D20C ace[5
967,784,236 *64E875197E694C245E3C272CF7620B6FF06588A9 ace7V
967,784,237 *64E9563C3E8E11DC05DE3B87CA39A6EF50324B9C acEA>
967,784,238 *64EB7521AB4338E71F516FF1D928436E8828C7FA acebalo1234
967,784,239 *64EC832158776143B1422E0C87618B46DE6AEC92 acechaba8
967,784,240 *64E36CA9E42397445D9EF3D48A5C75518FC7D941 acecolds
967,784,241 *64EF0E3ACDE9137BB273412268DD5D76A0118B15 Acedemie
967,784,242 *64E0BC7175EB1C690647DEE6B8C5E968356FF31B acedermeia1234
967,784,243 *64EFB5B36A5CD1096CE1268995619554A91DE75B acehardaway
967,784,244 *64E029626B09372D38F55038CB1C15A43AC861BE AcEI&
967,784,245 *64EF1C57A1E447E99579F521170DB74AB89299D3 aceitaban4
967,784,246 *64E6ED461B34D64757C3A38FFB355A5814215227 ACek,
967,784,247 *64ECDF7A8F47DE38EF575B69EE446FDABC1B0CF0 AcE)k
967,784,248 *64E77FAEB56FC585F43645980B01731F36AC4E17 AcE
967,784,249 *64E22CBC1D9ACFD96A0A9474C100A098FDD8BEA4 aceltniz2
967,784,250 *64E06C2B3B45453E80379A8F6B33D48FCAAEB22D A/CeN
967,784,251 *64E107EFAEB7BA01990BCABCB5D3FB315A042566 Acenarem0
967,784,252 *64E5E2634310EE4F4E1CAAA751BBE0D7DA8AE58D Aceom
967,784,253 *64EBFF5F957F95208E982D6F9B300B8AE379CF25 acep:
967,784,254 *64E4313B7C097529BC706A8DA4B7E054FDD915E0 AcEQw
967,784,255 *64E6C932DD6B41A6149A1324FEE78A47A5BA98E0 acerathere7
967,784,256 *64E4C2FDBBF53E3977DE9EAB7D1349A44C16040E acer-badged
967,784,257 *64E05CCF397B1BF287AD408A0470837B62F5DED3 acercarei4
967,784,258 *64E2DC38F55C5F93F428AC3A73B010866E0BF979 Acerdols8
967,784,259 *64E2F1A58B6CB021D548E4975655B86773AE44DB Acerishe0
967,784,260 *64E2E86476521F8225690FB3C5C90D7087FAEE3C [email protected]
967,784,261 *64EED60DC875FBB91A87E01D388C73BC807E227F acertoshiba
967,784,262 *64E16044325B41F1A82ED06DDD4AC8102995565E [email protected]
967,784,263 *64E3C4EA0B3CB781D291782ABF025740259BFAB8 acessability
967,784,264 *64E78C977FA80B06C13B63C896D5A9171EBD5E6A ac_eT
967,784,265 *64EA496930D11A046D7937F477E7F2BE995FEBB6 ACETAACETA
967,784,266 *64ED445E44A1FB098C03F05EB598E41D16250F14 ACETABLE5
967,784,267 *64E971051E598A51B41D08E1DD9310B47577B66F Acetabulous0
967,784,268 *64E7CDF9FEF00AA2BDCD86DC78FE1386CB9FB064 acetari5
967,784,269 *64EE2DFD3B21A066C386B4DACD987443933F0FE4 acetatses
967,784,270 *64EF18C32C0F008F180C3B4C20187086A4CAC3D7 acetiletiķskābe
967,784,271 *64EC410423BC89CAA4CEA78B31690E0ABBEF350A ACETONE620
967,784,272 *64E5BD7E76D62B01360E03AC7FE41DE7A3F06433 Acetonic.
967,784,273 *64EC61FA39F662B23AFD4041FDA1AE72630CD46B Acetoxyphthalide8
967,784,274 *64EE453975588C5227DAD3962833711B3905FD33 Acetreros4
967,784,275 *64E8DDE86B910334FAB45C942420BFF7F5C77081 acetroubleshooterdon'tstoparockin
967,784,276 *64EEF5B9D1BFE5160A4567F04E0EB1D97C3E2095 Acety1ic
967,784,277 *64EA72AA8DFD8DA1091590B42E77DD5E73CCFE1C ACETYLCHOLINE-ELICITED
967,784,278 *64EC4FB513D9346350BB0AA69EA43D9198AF51DC ACETYLIZED1
967,784,279 *64E109956D7E5CE47B682C56BC3E0A8D9E86A23A ACETYLS9
967,784,280 *64ED8FB20C311736E673BE1A3908FD0B582CF04A acevedoachill
967,784,281 *64EEA679F6473FD25913CF43099FA39F0F677413 AceX7
967,784,282 *64E8DA396DCBE789C8FEB3F82ECC3201B850BAF3 acExv
967,784,283 *64EC3CE1CEFEFB05F045EB33536EA2B9AD8B5EC7 acEY`
967,784,284 *64EA2F3309A6C328292AC077074C42800AC4BE2D A
967,784,285 *64EDA2601BE7529C9E0C4FBEF56C8F62E9D1ACEB [email protected]@
967,784,286 *64E6360F5AB6780EE712E4280B6C554C8E253128 acf-8
967,784,287 *64E9864FF34DC0FEADE647BCAABC70A4CDBB18B2 AC:FC
967,784,288 *64E0A64218A446367463ECAA5D99DECFCBE4AAC3 Ac"FC
967,784,289 *64E5F75A6AEC657307295B2C187CFDCC516E2719 Acfcufx5
967,784,290 *64E7D0CC450D3308CC3914F5D119A60C54133D64 Acfdr
967,784,291 *64EDC4B4B9A018EF8235495574575C0FB40B9CE3 AcfEu
967,784,292 *64E1B953D1D0635BA72A535E6056D261F7203F5E acFh{
967,784,293 *64E9EF3664B49A5D0AF206714B4FDA384D08D168 AcfjA
967,784,294 *64E3585DDC4D62C678E229D00AFB5165DC350463 Acf=m
967,784,295 *64E6DF66C9FFFE8599CAF7A822CE3B8A33612997 acfreeze
967,784,296 *64E02EB3C1BF0F6D11FF9B9B451F80BFC38B301F ACfU3U17MT7i8EvojToOdkN41EugnrjPDA
967,784,297 *64E4A843313FD18914403744055CAF2927953B7C acfu3u2tttiy1eyx0akwz5dtcrz369li5a
967,784,298 *64EBBB76AAC3BC47520330DE0930C96D142736AD acFx}
967,784,299 *64EB5C257B6ED2350392E5E925FF20A45EBEA8F5 acFxB
967,784,300 *64EAA72C0F7C0F0379116D8463DF84401DF31308 Ac+?G
967,784,301 *64E73CA420C8C244128C354168425D9D97949E8F A)c+g
967,784,302 *64E937A4E6E034DF2FA56E887DBD813B8DB6F4EB acg[^
967,784,303 *64EE2BCF678DDC603AE3910C2D568F3F0AF3DA97 AcGb"
967,784,304 *64E92D99FC120C6623F6CC7C9B213B18C46B8C6A ACgdj
967,784,305 *64EB9F73F2BB8C219843E70FA70D7979B56EF333 AcgE
967,784,306 *64E1C3AAC2A5A69A162F8BF40707F8C683D95963 AcGka
967,784,307 *64E490F95D9E9B4B2E9C1BBC75A5D933AB86DDE1 ac)Gn
967,784,308 *64E623671A2A1389E03DA7EE6C967778E991E45A acgpoprgs
967,784,309 *64E974490A671528912DF7291147BEF8AE2F84DA ACGqb
967,784,310 *64EF4BC3DCA4E285883313DA6356D75FEA09E76A Acgreevy5
967,784,311 *64E5CA553D3CBAEDE206653BB91E288B07E248CF A
967,784,312 *64EA3E608C5EF295ED42855749C76304E3FA58F0 AcGTc
967,784,313 *64E60A78444EBAD39276EEA2FF34BB7CA31F6F91 ACGv(
967,784,314 *64ECEF2499D0FBB25A531EB2EADE0AE8BC558FAC acgw=
967,784,315 *64EFA75FA7310A66871C4FF6626CAF40BED65450 ACGY%
967,784,316 *64E7E24425C63D54FDD6A4910839C7FDF2F3CC8E A&CGZ
967,784,317 *64ED3E2735B1FE804F1618F7DD41BA1352344554 acg?Z
967,784,318 *64E2C2D8404C1F6A7386F5038B436DC97FA5ACEC acGzV
967,784,319 *64E22AEF20557C50E8937F61E1D9310CE225517B A,Ch
967,784,320 *64E8AC418911D02DA1975EB385D61873C81B8163 A+#cH
967,784,321 *64E8A1E298AE33300FFE7A5B14499E55895E57AC ACh2&
967,784,322 *64EDD3BBCDEF5A4A227DB0AD838CBF98D7D582CA acH8>
967,784,323 *64E48919E4D0B7952606B260D2D8452C4E6A2146 ach8
967,784,324 *64ECAF04DE1504B66169ABF54DF1E6DA5B71ECC8 ACh89
967,784,325 *64EFA9D0BAEDD87810F7AAC197C1B8F885133997 Achacaren5
967,784,326 *64E9919D3AF51A7C9C4EAD2DF87DDE109D92C086 Achaemenidian9
967,784,327 *64E470A93858594A7E1595F2424FCBF5A8874E52 achapmansr
967,784,328 *64EA66AD2DB0583398477A48FDE66D44C2AB80E6 ac_HB
967,784,329 *64E7B2A60C26A60012DC3675E9DA482E1E751713 Achbaren2
967,784,330 *64E88ECC0421BD7382C378452E0C35E436002822 achdalexis
967,784,331 *64E51A76C8473A28927B0674904D07A1EA1F27B5 acHdI
967,784,332 *64E24AEB58D21B477F3DBD4FC5F16E6568C9E149 achecken3
967,784,333 *64E9EC4D14251CC85D9A2D51915D3F26D9CC4189 acheminera5
967,784,334 *64EEB11ACA1704D573DE0363AB5E40C0CE6FB677 acheminons8
967,784,335 *64E8CCFE41773046CE435BE4C7B4CD5950A74DCC achemysterious
967,784,336 *64E822F57CC80D8AC8781760083D1F3623CBB57D achendes6
967,784,337 *64E61BB1A7FD6A83FE4252DD7A5D583DB7341500 acherafkadi123
967,784,338 *64E05E28BE694036BDDC685A061A1EB58FDC8A68 ACHÉRUSE
967,784,339 *64EB3872CC307AAAF412608E99D7447CBC1694F6 [email protected],
967,784,340 *64EA3D33970267CC5BEBD9EA879B472779B59BAB AChevelle
967,784,341 *64E10603F60F73CE30E97C45964D162CA8C59615 [email protected]
967,784,342 *64ED407D00A46C51630A0753B685F0FDE3BF90BA AchHeileMich
967,784,343 *64E1E3DE9B4A3F49FE1363A536F7D4E7D2AB20A0 AchHerr,duSch
967,784,344 *64E2A6446F86157857C39ACDF5F1B153A0B0CD1B Achibume0
967,784,345 *64E1625478929CE235B84902C83C9CB54DCD502D Achichipachi
967,784,346 *64E2EDA0020E1111D46C21BC43DE35D9187D401D AchiChokyiDrolma
967,784,347 *64E5E909EBDA8DF3346D2C9C1147A00AFD9EB3F3 A Child's Future
967,784,348 *64E7EB16595665517E43817233FCD4D37D1FCEC5 ACHILLESPEESONTSTEKING
967,784,349 *64E9612355F900B72AC42C550AE428BB1D56EB06 Achnatonovo
967,784,350 *64E317541930B477588B1269BF719ED9C8C08076 ACholula
967,784,351 *64E8C4388E2EC8D79836C9F8FB4A8855B033379D achoncus
967,784,352 *64EE12AFFE133378FFFB1BD4C8CAAD0B76A71B48 achoppio0
967,784,353 *64E321C99A9273A9D89E6A3F4CD99038886E55E1 AcH;s
967,784,354 *64E3F3A06961FB8B2B2A1A7A97288302F90B7074 Achsenesed
967,784,355 *64E92A66B2C763E839C5AC37A0DF8AB89C2DCAAF achSs
967,784,356 *64E3668C064C8ABCB9ACBFD4CF6C064165E4F2A7 achtbijls
967,784,357 *64E95CF0FE4A5D95C47B16A6F3B636927D250530 Achtboers
967,784,358 *64E2A26196F4D4CC36EF5C74E1ECFE31A5ADFFB3 achterdeel6
967,784,359 *64E46FEA3E8F63FB36F83012FB295F5FC6F82D44 Achterlijkheid6
967,784,360 *64E81F9D16175C649B6718D24FA83CC34B86B4BB achternagestuurd6
967,784,361 *64E1F9FD8E75AE27481FD855408A8187C790726C achternagezetenen4
967,784,362 *64E740EE8C05014DD8489D97B21B35177F4DDD87 ACHTERNAMIDDAGEN8
967,784,363 *64E0C304F744D94F51822E24A33E8944B101BBDC achternareden!
967,784,364 *64E7DF9356B0776F5FFAA75EF789085789037496 achterneef1
967,784,365 *64EADA90C1CBEC1D8CFB47FA799BE204CF67CA30 ACHTERUITGEDEINSDE9
967,784,366 *64ECEBF7DC45949A62FC9C75793B5F38F76B2349 Achteruitgekrabbelde2
967,784,367 *64EF57F4229B0B7F29CCA68D65A20DB62CF566F7 achteruitgeredene5
967,784,368 *64E626120F02670C93E3043350949179A364D678 ACHTSPANNEN
967,784,369 *64E46015D6DC8DB3B1D061F62AF0415A1631E5DA Achttall0
967,784,370 *64EFAA08C4FF8034C022604CE90E25363D80D6BA [email protected]
967,784,371 *64E2F77EF36511222DFEE14EF32793250B0F0F35 achtungart
967,784,372 *64E2582CBB6FD641376BB74EC0276794C8F62201 AcHUC
967,784,373 *64E80929E52B711833C989E6915BDFD78F7BFF0D ACHUCCHIN
967,784,374 *64E65B92E3FD135E71B7620E24DCCF3A3513DB72 [email protected]
967,784,375 *64EA6BAB4BBB421899433F515FD76D35185FA0DF ACHVAC
967,784,376 *64EF5114A9737B8DA36C836601529D044564551A ACHVAT
967,784,377 *64EB9044B44CF099E03DB4D2CC321290A725A253 achwhering
967,784,378 *64E13C6F53F49359D16DD300DCF967BC251747DC ach[x
967,784,379 *64E29768519EAC7714965CA552ECF3AAC417EBA9 ac(HY
967,784,380 *64EE2C06C8BCDB5CB9D35ECD5764C2F0D3426517 achzeten8
967,784,381 *64E152A4908818E6BF5706BF14B4C8CE566087D8 AC#/I
967,784,382 *64EB9A1B6310360D60D78098B416D6B6EF2E741A ACi;%
967,784,383 *64EAFB173E4D806222A81A82683BAD319F2D44D6 A,cI_
967,784,384 *64E6E62C36F1AF63806A65C434A515DF71776DB0 AcI"%
967,784,385 *64ED4FFA699A47256A774D96369BE84F3C4D1C5E A_ci#
967,784,386 *64E85B952F774DA9A35BCE56ECA197EA13CD95A0 ACI38
967,784,387 *64E3909F9F098EB53F092D87A9DA967C3F29E276 acI5`
967,784,388 *64EA38BECA26280F86B7484C508AF7B7D3CCD9D4 aci8/
967,784,389 *64E5C3E50C840AFB596BDD4B90262A7CC91DA215 A=CiA
967,784,390 *64EC6532149CA76D9341A671399EF06E43A6EC3D Ac%Ib
967,784,391 *64E8C14B734D8F78909566C297BE8DBB17FF8C9E ACiBD
967,784,392 *64E8B9FC08038C704EC5A9B07F9EACACC444F175 Acidass
967,784,393 *64E1AD5F4E01F84B93FBEF7E11C62D3FBB0CE209 Acid cas3
967,784,394 *64EA7655A9A729FDAD14839B68ED23515910523A acid express 2
967,784,395 *64E6CB4CA3D17964D89BF6060F8E206AE9D4E0D3 Acidfast
967,784,396 *64E5EFFFC26238DDC3E7C5A992CDA7E8CE493ECA acidfasthplcdigest
967,784,397 *64E5B5153D05E141C2B131452007DF13A0850EC5 acidkids(dadaliferemix)
967,784,398 *64E9B5C167071C26B9E1B299E218C75A0F5D8850 acidology123
967,784,399 *64EC41FE116042CD50443EEE095CD2AE611DB62A AcidTest12l
967,784,400 *64E7E5282519000BBBA87B57654014DDD46A0517 Acidu1at3
967,784,401 *64E0B59C7AC39424748CB0200F858C7AECC0F265 acIJ}
967,784,402 *64EFBAC23428042C74ACE7C7CFF98CFA9857E153 acıktırıyoruz
967,784,403 *64EEE9F2EF21414D5A7FAE5F66FDD241D76B3DF7 Acillen1
967,784,404 *64E60C3B94422435E84A0BCC2EF1F1A411A5844F Acinemod4
967,784,405 *64E46B6D047FF7289C8F588D56706D4797DB30FC acIOf
967,784,406 *64EDA5D8AE6A82C5B4701F75B992903B929B21CC Aciraru1
967,784,407 *64E915DD7C98D089D8235BCAF3FDC62E23D9ABFD Āciriyar
967,784,408 *64E6CE0622150D949B264C8CD124929BDEA6EE10 acIrP
967,784,409 *64E3BF5E01173BACDEEBF505B4219FA5E2B2D8BA acirtemmiS
967,784,410 *64EDEED7E875D036A8BD44410F40D5C33D0AB7B8 Acitname1
967,784,411 *64EAF4C43F4E9863FE3102F3015036DBD794FB1D acitnamesed
967,784,412 *64E69FDC634677FC30DD97EA9741E2BDB70FA685 acitrons
967,784,413 *64E2BB11E7A3D88A0E7B0DD8929C2CACA8E088B5 AcI
967,784,414 *64E2766D26F0200308619EAFC473E58BFEDC3821 acizkirina
967,784,415 *64EFA9B6E97F89EEE8CB2D44D0C4BAA2AB4EF781 Acj$%
967,784,416 *64E90D8B77AAF71EB4AAD9152730F45D40BC9390 ac[%j
967,784,417 *64E161439AB0D8C8385D98B05A0EB6F1DD4B7C06 A#cj2
967,784,418 *64E663F5F104A7F4C5FB34F85D79DEDD95642326 acj5_
967,784,419 *64EC0D8CEE4E2F67DA8A227F25F091D4CC8784CE acj8C
967,784,420 *64EC4131443A2C11902EC917722F31F655379371 ac_Jh
967,784,421 *64EED0E2BFDCD6BBAC13AB8E7A9FD7CEE44E19BA acj|J
967,784,422 *64E04D1BE040792AC0E396542051DD8D127041EC ac}jq
967,784,423 *64EF9D5AEB3F639D5E77FB95E7336883E1EC99D3 acJS*
967,784,424 *64E72F43AFB80FEDDE7C6DDB5D336DBBA913D51D [email protected]
967,784,425 *64EBF2274F2898E0AEEC9B62FFF6B1ED2CE46808 ACjw2
967,784,426 *64E98543E080221BCC200E08DFDF2942EFE78A6B ACjWd
967,784,427 *64EF93A9EFA903E6F426FF60679E37F7AF66F371 ACk""
967,784,428 *64E5F3D1361865F9688587C7871E296F781E171A acK&:
967,784,429 *64E6C958B78AA8AA16D102DBF2F0EB61ED7B4C67 ack{3
967,784,430 *64E3E603D867580025445BF9146D901C12A0A199 ack-47
967,784,431 *64E0580B3CFA3425347503CFDCA1A17630552A40 acK8v
967,784,432 *64EBD8B9F7F5E9669A7E85B7F70BF733DC0A2448 Ackadiri
967,784,433 *64EF7C847164BC276FE9D78D2A330F52D793E611 ACKc_
967,784,434 *64EE589FD97F5EE2A549804B646AB543ABFBA1D7 A%CkE
967,784,435 *64E60F3F43268E20CF5B847329D96A8134BCE3A6 Ackerleied
967,784,436 *64EB73564D5D43C26E6A12C2C1FD65339113C355 AcK:k
967,784,437 *64EE351F49C407A26807C4D1224E29081E0BB991 acKk3
967,784,438 *64E581F5D53587F533F80A4186602ECAC4809A1F ackladen1
967,784,439 *64E3BCA46D0B8F082D1016C83291939C801E8CE2 ACkM7
967,784,440 *64E1BBE083323A51F54F93E804C394A4E888BF95 Acknow13d9m3n75
967,784,441 *64E39DBD6769E2C5FDE7252F08B845A035D16BFA acknowledges7
967,784,442 *64EC5522BD710C0B2329C24DDD9F8CDA9A69AA53 ackPU
967,784,443 *64E9047950DC9D774E1BC3D00EDD91DCB3A34862 A&Ckr
967,784,444 *64E39B3F14A597E66E96A10D51C0D0D5BFF67A22 acku,
967,784,445 *64EBFFB048C27C8A986B67873FAE21CD865AD6F5 ackuseu123
967,784,446 *64E6B97F659FD33050CA37091A00BACD8EF651A1 AcKw3
967,784,447 *64EF06FCBBD6AE2AC5A91912CA28E0F9331C881B A#C(L
967,784,448 *64E289A546333F7AAEE0DF4D749DD4B735283D8C A&cL_
967,784,449 *64E9CC31F8AB42859175BD5143679C81B1CC6002 ac>>l
967,784,450 *64EF32E86A3F23360E138A698E17CA6E79E3E1BD AcL1m
967,784,451 *64E00D736F276FDBA2B22D23ACACBD982EB80FCB Ac:L6
967,784,452 *64E050A3CDC9BF7C410AEAC2C0F10D7B4A22A39C AcL7g
967,784,453 *64EACC9A602BAC177511349096D4E80D6D1209C8 aclaire1
967,784,454 *64EFA64973D2EED6C825B15A497DAAC57A7E939E Ac(lC
967,784,455 *64E841A381B00BF10CEC58644B7E7F4475FD82F3 Acleriez8
967,784,456 *64E7E6ACD5A35B7B36140311787A55F8F5D767CC Ac/LG
967,784,457 *64ECD203F29F8BB17C99E5B71A26F306744ED4A9 ACLhE
967,784,458 *64E72F1C2D60EDFEAC25D5946ADB6BA72B798C00 AcLM
967,784,459 *64EFA413815D80BE435D893E689F758AF45110B2 AcLm#
967,784,460 *64EA7D8D597E0CC202649AB4105367AB1538E6CB A;CLS
967,784,461 *64E5999854C82F486F79AC358B3F7F4ED250FE92 acLS/
967,784,462 *64EB1F7FE37E55A5FBAA2F6934ED94FA655C109B ac:LT
967,784,463 *64EEBFCB2CCA7F461346269C1F43FCEF508D0C5D AcLW)
967,784,464 *64E049B1EB0478E9FDFEA597237FD8DE98111B58 ac<m<
967,784,465 *64E97934A2F6EB8504996A10AC0058DB4C62D38D ac'!m
967,784,466 *64E613FBDE68BFD280AEECD74EB5E53A42CAD476 ACM=9
967,784,467 *64E678681623250B1F726E97A496A3F740232C46 ACmA
967,784,468 *64E38CB620083F970F78FF70B005B9701BACECC0 ACmA6
967,784,469 *64E3695626AE7A748766767354979D280AB3D9BB acmaszlar
967,784,470 *64E222B8C545DD072E7555667A4ECDF42AAF88BF AcMdV
967,784,471 *64EE0B6584599255FCC408C2D0732CE7D777EACC [email protected]
967,784,472 *64EDD6B21B720872A80D6B5E8A2014CEEDD77BC6 acMl/
967,784,473 *64E23D07022CD8C8FCF0D830409DC5BD81D659A4 A%cMn
967,784,474 *64EFD840E5E23F373520154D74E5E174A919992D ac^MU
967,784,475 *64E329247FC24587E6F3C6BD0B9C058D8B03EA5E AcM:w
967,784,476 *64E1BDA62CEC979130C064FA3C1B9BB77E02A75F acMyn
967,784,477 *64E44729957C9E7F8624A2E181C0B9A465F82C48 ACM+Z
967,784,478 *64E0915360730038F7D82DDF92D27AB808E4A055 acM#Z
967,784,479 *64EEBF8DFF235D4F2E2187A962D155E61BFF6B46 A.C?n
967,784,480 *64ED0E222773AE127839BCB9C9A45428F4114AEF A_cn-
967,784,481 *64EC367BFB5470E7B3CD427146856F0AAF12C820 Ac#=n
967,784,482 *64E9955BAB6499F8156395CACC9531F1295E3349 ac!N~
967,784,483 *64E2221D39174C11AB4A26211F8EB28324BE7BCF Acn3t
967,784,484 *64EE217D7F51D045B9A9A57310DFD170EC1B4DAB ACN;4
967,784,485 *64EBBDACEEA873913299C6EE446F62B107694BBC acn=6
967,784,486 *64E5F85C18FF429F58D0FEC5CAC0F244E146B44B acn9F
967,784,487 *64EE599C982A67F9E7C4D4A4F081E4F2B0950B79 acn_B
967,784,488 *64EF18C536E54C5B786CD30B33DD9608A2AA60EC [email protected]
967,784,489 *64E8947ECCD8415CEF334585129F406F4BDCE405 Acnedael8
967,784,490 *64E411AE6600250A2BEE099B08AF2BBA8D8D79EC acn.H
967,784,491 *64EF40910F6000475185FEEEAF67D60EF586DC0A A:CNL
967,784,492 *64EFBC9D9D39FE590313A61738F842AC77266980 AcNm/
967,784,493 *64E6A92C4947FC2E3DE0E5941342EAAEBEA1A1B3 ACNON
967,784,494 *64ED36F24551AF870AE49EB2E229C43E5D54C78B AcNr8
967,784,495 *64E80B53A537438FA2E5DC232313F37DBA4A99B4 Acnurted6
967,784,496 *64E5D01D0142F21397646E31394F3DD01E3E33AE Acnwc
967,784,497 *64ED73D462738AECC4A494D436DE8F767D3C43AA AcNXc
967,784,498 *64E68BAD55004DE0BF1281433D5B2BCB11BF653F AcNZL
967,784,499 *64E77661802B05C5D6C2B1A44EB37FD071C0AA12 AC=_o
967,784,500 *64EE8471B2AB28857AB88F782FA7EE0EF19A300E AC
967,784,501 *64EA045BEEA2407F9FF5C7C1B557BAF8DAF2500E AcO-?
967,784,502 *64ECFE86FAB7668BFC38DA5C22B3D32A4CAFF6C1 ac}[email protected]
967,784,503 *64E77DAE9F6F7E23B88CD9B4C3A43974D821F5D9 aco%1
967,784,504 *64EFD5342DBCF8426011AC9492F1CA9DF5B4FF78 ACO1X
967,784,505 *64E115B37FF894B34759E3A55BD9C9173824A055 AcO3.
967,784,506 *64E5D325C88A2984F71775F61A6DA7E94B38B17B acO^8
967,784,507 *64E6953A07BBCFBD218BB7262AF553C02B1D9ACC acoAK
967,784,508 *64E376CF3E2612945EFD3CFCA5080E81D36E8510 acOB3
967,784,509 *64E081A583D1DBD69D126A142385EBE41A4CF516 ACOCKS-GREEN-FOCUS-GROUP-CAMPAIGNS
967,784,510 *64EDC037A650D4D8CE44067C8C605D3FA51954E5 acocotln
967,784,511 *64E9A02D8877AB66840A0B476CD7AF5128E6D54F acod+
967,784,512 *64E668105DC34645AB0D88F249E4670CF282AB46 AcOdC
967,784,513 *64E9C15E5C67F0432962347B933AC55659E850D9 ACOfM
967,784,514 *64EFF182F90663D1CB9E6E9150227F3A6CC57A08 acoimareis
967,784,515 *64EF9CA2D89393836396495D893624D60296CF2C acolbsw3
967,784,516 *64EA97470C7EE8A09764EE73A67B7441FC9E5670 Acoliets9
967,784,517 *64E6F5ED6DC8EB06AF6F177A91D87CF21F0ABE85 acoLS
967,784,518 *64E45E431A227605AF21DE20A18DE8CEE4AA1033 acombinationofpassionandfeelings
967,784,519 *64E7D0A27CF1A670033F070319B74DFE5A080E09 aco}n
967,784,520 *64E3EBB9F3B4D7DCDFB4A6BBA55695658B6AEC6B aconselharte1234
967,784,521 *64EBD8D06669D1C9AE82BA769D0200CCA1A89E67 aconst370
967,784,522 *64E519DC178BFEB0729CFCCC0BA2BF5F28A7018D acontece / dom de iludir
967,784,523 *64E5A258CE93954D2B0B40EEB0D372070C8861C2 acoplarseia1234
967,784,524 *64E7258835E112276BA30F7B0D5A464C4711C633 AcopU
967,784,525 *64E735B7B31DD407D6C167E19E02CBEE0F3E8CE8 acordvamos1
967,784,526 *64EDA1A17123BDE1F9DFD3DE8088CE36BEEC68E3 [email protected]
967,784,527 *64EFA237EF0099426C68E2AE4AB596722C4C141B ACOSOS
967,784,528 *64EE18C4A020D5232A51E1658CE7BB763951A5FC [email protected]
967,784,529 *64EA6CD35ED9D78CBC3F30AB86188CFA5876B602 AC,Ot
967,784,530 *64EDD99E3B81FA4AC7917F1791AFE9B43636C83A ACOu+
967,784,531 *64E6697DD6AD51A8E111335779F0063C580FF7D9 acO,u
967,784,532 *64E1D0336729F92440B4CD488687FE8DD1796897 ac|oU
967,784,533 *64E128A965389A73B98E09D6AEA1D61A1618DB95 AcOWo
967,784,534 *64E6024F34587CABF0E80C89AD3E6D13A42B4107 AcO;X
967,784,535 *64EFFEC8E20749F6ABBE33B28E453F2B54D1E2F2 A!C/P
967,784,536 *64E68BD11D2C2F583BCF04A0D5AD60B92565B6B1 A#+Cp
967,784,537 *64EAFC0DE546768872047236F87EEE6DA9CFE852 ac)~p
967,784,538 *64EBDFE92113DC9CB3E5F84381EF147CA1B094D0 ACP3;
967,784,539 *64EBF2003977A55B2A2E852B6E8B08E6E4E48452 ACP;c
967,784,540 *64E1AE400D027B6177782E23653180C85BFF3554 AcPcE
967,784,541 *64ED13BC5A4E58AB79C8F47E8732F0808D372D6A ACPdT
967,784,542 *64EB07DFF515F21FF7CC5C9252FD3A0F17A1E61D AC_pl
967,784,543 *64E4F5038FCF389C021AAC51812EECA879B91F0B Acpmw
967,784,544 *64E2F7E78D5E263769C8F56113B874A4D1D8C2E4 ACPO/
967,784,545 *64EAE84A4A18F4C61333BADA875797E813CF8B3C Ac&pT
967,784,546 *64E57C3BF383A8F35CCA665BE6CF0457A38A1257 A-cPv
967,784,547 *64E7463233DE1DD1058550823B2CB9C44D2A12F4 acpwH
967,784,548 *64EF1297C0F875C387200C916B23391174DF721C A=#CQ
967,784,549 *64E1A1C1FF524D220AD5427C7840E92908AE894B ACQ)_
967,784,550 *64E6E481AB5525B9E3B3815024B2F191FFA4AF66 ACq!_
967,784,551 *64ED98BE6CC70D3EF4495AEA79A4541BE2A0F3EE acq{#
967,784,552 *64E145424E24286E794957B559838E1C92B449A5 A-CQ1
967,784,553 *64E9AD9CBBA0F0DE21C18828DAD56B158716D5BA ACQ1Q
967,784,554 *64E788379F7A4E66EC3DD8FC4720CB0ED66607B0 Acq3L
967,784,555 *64E1A50E15784D6A0E0858E4BC42EFA5566E2417 AC/qd
967,784,556 *64E829CD01B92FF555CE7DA7FB447B3068E5B437 ACq)e
967,784,557 *64EF639C230FB1C8B78A4619B735499D88C7A482 ac/QH
967,784,558 *64E110A8E74F9CBE20C7A62C20C6712D2C0048C3 [email protected]
967,784,559 *64E298432437B8A1E0A1111FE9D22F2A99FC8041 ac|qJ
967,784,560 *64E093352914CF245B89A876C94C776156113227 A&cQL
967,784,561 *64E1A675E213465C8F2597742825DA8273E00D7E AcQog
967,784,562 *64E916F576E63AF2C86702000E09A753F439D315 acQ>p
967,784,563 *64E70E4DEF6634A9FEC00173D1616C33BC60630B acqpn
967,784,564 *64E157E7EAD1F25D183A359899AE1489F1A61A99 AcQu(
967,784,565 *64ED51E3AEB3EF3D18E0F41BCC7DAE79E3BE0AEB acquerras3
967,784,566 *64EC2DFE3846FFB5306BBF593BA252FE0EDB2E31 Acquet.
967,784,567 *64E437FB437764E58F11B1CFC50D71651F1EC239 Acquireintelligenceabout
967,784,568 *64E90711FBAEDD31F163DEEED153FEBEA3F2B773 acquirer32
967,784,569 *64EBF77DDBE8826EFBB13BF67371ABFB4697FBA5 ACQUISTERO`
967,784,570 *64E4C75C50E2FB204CE37935620507375EC3B821 AcQ$X
967,784,571 *64E1FB2C2A0F47BE3A996466232FB59B9C9BF423 ACQYU
967,784,572 *64ED06AAD825E2F2C1AB36D6D9F6B3E764983E4F A=cQZ
967,784,573 *64E0439975F3F1F3A28997963379CC0520ABA8A9 acQz]
967,784,574 *64E59EB97A4619A3FF447ABA1635D21B3136C63F [email protected]
967,784,575 *64E95E3A0564B88FFFC1D77E51862A76CFDCB39C A(#CR
967,784,576 *64EA25DD1C1FF43BD3EF0B08BE98DFC212752A1C ac&_R
967,784,577 *64E2DA4EA0BB42F58F3781044DB87693B5BF7C37 ac`r_
967,784,578 *64EDF9B45B6B18704E3247681CC7EBC4CF9C6038 ac`r&
967,784,579 *64E1DE06F777B34106445BC47CEEE448377A13D8 acr-+
967,784,580 *64E37329553FD2AE20BEF7F1AC86EC0E2DA5B5F6 ACR2754734
967,784,581 *64E0EDFE9AFEB51ADF790C919C49C1210A63B195 Acr4Q
967,784,582 *64E713AABEC2CC7EF4C298E72F1CA7A32F2C76D0 A!cRc
967,784,583 *64E21C5A5140FB7E41234AF4C768D7D47B74EF47 acRDw
967,784,584 *64E8392C22E68BEDB07D34A81F5242FB362CEFA3 Acreable6
967,784,585 *64EC5DD06EFEAD23D1B0FBA15054CC472822292E acRF;
967,784,586 *64EAD945786E3798DF9DE9652D24532E6F6D75A1 AcRhY
967,784,587 *64EC58E728C5BEB1E6AD4BD5B048EEAEE5780478 acrilatosed
967,784,588 *64EDD635D30E40253D08AA450E4AFBBFC327CD31 AcRjO
967,784,589 *64E8A738FF6B6D084A9902A941A13A2782A3B8D3 AcRLD
967,784,590 *64EAA3FC16AD9B3EE28F61D3E635063E8CC0E9B9 acRNe
967,784,591 *64E589929A639897F83FFBAF10C59D88B7695660 acrockpot
967,784,592 *64E44171C51E0E43E4185C77A7B8751DD95D7958 acrodrome0
967,784,593 *64EEB5C6255B47E1A7752E1A2BB129640E62A9AD acrogamous2
967,784,594 *64E880D68A822908DAE79CF0A3D93857E274B62B ACROMELA
967,784,595 *64EF7DC1D1F3C05A187BC8F6D0883B0D5CB25D40 acronet.net
967,784,596 *64E27DF4A34F060382E342EB8C3E6EE18EF49F23 acronyct4
967,784,597 *64E9EED42BF34BD9756EDC777BEE5751537085A8 ACRORRHEUMA9
967,784,598 *64E473CF2C5219A32A55E419CC8CD96F0C16178F Acroticses
967,784,599 *64E158F21CC581231B0C8FB93CCD0BBD00FBD156 ACrPL
967,784,600 *64EE826071B479DF9B31D41F726765AA21E6CA85 acR]q
967,784,601 *64E3E8DD57B101D1F50E4EBE289E4C23C1C5677F AcRQD
967,784,602 *64E41ECE3A010E17D780C86551D9CFC1CE5A7D58 ACr:R
967,784,603 *64E67A0CA9869D6EE46327BE58ED52A0F6458007 acrulz07
967,784,604 *64EE37BF7C961677DC138752B0CAB132933F5DD4 Åcrumont
967,784,605 *64E476579CA1A6FE926CB90299048D3A5C8D0CED acruxes6
967,784,606 *64ECEEC0FDD3B24549731F716A0BB7C137A47FAF AcRw+
967,784,607 *64ED15F8C1648FC0D8A599879083D5D9A701D4E3 AC(RY
967,784,608 *64E06337E34D4D75B5A4C698944043B277810848 Acrylonitile
967,784,609 *64EC4ADF83FDE57A57CFEC6272451F9746A9A17D AC
967,784,610 *64E8397AC169BBF40D96C39FC8F644BBFB6CC95A A!)Cs
967,784,611 *64E95F39004D68982FEA193BD2486011329CD1ED A?C/s
967,784,612 *64E1DD6D032319A8F774175E9576BDA859837AB7 acS`%
967,784,613 *64EB37E561D27823E3D5649C49692FF2BF62FE53 ac,s~
967,784,614 *64E32EDF79094DFB3575C919F52E080791567A1C ac/<s
967,784,615 *64E2EED100AFAC5C8A6E434D0501C6FB3F76AA05 acsBB
967,784,616 *64EFB09AD30048C673064E9BC7D0B624FE57BC9D AcsbG
967,784,617 *64E1B2A34CD450E37AE19B91BE5E0FDFBC3B85AA Acs(C
967,784,618 *64EBA4211BAA1909C7BB12D4AFCD02B8D4D452B7 acSG6
967,784,619 *64E64F2224AC9489B0165D3BCE2F598B5FEDCBA4 Acsia
967,784,620 *64E0848B68FEC9EF7CE410D87DE4C405A72C52AB acS#J
967,784,621 *64EB700B59E2E77BF5F6D4F3EE12A13676A05CE3 [email protected]
967,784,622 *64E33E17F68FFDBF05FE8BD2E49FEDDEEA1D0026 acS;n
967,784,623 *64EAB9658FBA2E75C7934247DE9F30717840B054 ACsnC
967,784,624 *64E8FE0A33A66519C07B4CF726FC0DE43CDBA562 [email protected]tor.com
967,784,625 *64E5773E1B81079FCA5BFE5FAD5F147E5CE64503 Ac?Sq
967,784,626 *64E798F273E4E639D3A4382BE82E49C8C832BBF2 A;cSR
967,784,627 *64EA53FFC9D7E76B260D4A7CEAFCCB96F3FE22ED A(csU
967,784,628 *64E256D0CD2AB108FBAE30B142850FF71EFF0E43 ac=sW
967,784,629 *64EEF3B65BD4161BD504E84DD82B8B9E54C7ED1C ACswX
967,784,630 *64E04D261FD062F52DE6C35802B9C7DD3F7F2EA2 acsy-
967,784,631 *64E2EE9F5CC084A800575318371C1F1F920A9A63 ACS整体结构及各金属簇位置。二聚体其中之一的α和β亚基分别显示为紫色和青色,另一α和β亚基显示为灰色。
967,784,632 *64E5C0973C503CE4B38B4A372FDAED981A442BD4 A;Ct+
967,784,633 *64E2FD289621BF161811124BC15F9BF02AD37F5B Act..
967,784,634 *64EFA07E2739DBD4F290F815C8A43ADCE60F0A56 ac`\T
967,784,635 *64EC80EC7A0CCB6AD9C1F25E8F0918E124EC301B act1,scene1-pantomime
967,784,636 *64E45D70EDCADCA0E9C0176F8DD00FF86AF7ADA3 act1.sommogiubilo,eccelenza!
967,784,637 *64E30BDBF173213EAD02B93700555FAFE3A00377 Act38
967,784,638 *64E48A28C813824EB6E27C9C3ED79BB33B02ED91 act3:"omiocorrado,appressati"
967,784,639 *64E6FBFE8BD476E6DA22B9831169D61C0E9A3652 ACt7U
967,784,640 *64EC0A3501707DE5F26FA7301B3521365644681C A-Ct8
967,784,641 *64EF0BC4E483D23EC68F93644041C557E07565F2 acT%8
967,784,642 *64EDE64A4EA8AA3002E0AC598CFB57690781DB2F actaatatgt
967,784,643 *64EC052B693E64DEFBFC959E42858DD1D55F1A7F Actantiel
967,784,644 *64EE4E9CAC36A671CD042134D3199E7F45208BD1 AcTat
967,784,645 *64E07C05446E66751ACDC874628D6AAA72E78489 ac=TC
967,784,646 *64ED2576AE079B366CA18C53172E57B82AC6A97B ac~tC
967,784,647 *64E1561A87CC9E114EDCB66EFEEFE06874D00A97 actctgcagccgccaacttgaacctcttaataatattgtttttaattggagctttggaac
967,784,648 *64E0768537DCA14B9691A11DE59955E1890CF70B AcT"d
967,784,649 *64E64C1DB4672228079AC4878A97BD3368E8D962 acteque0
967,784,650 *64EFB7046B75A0CA4CD9E18A59582720251FFC0E acterium9
967,784,651 *64E51BD0BD7734DA7C06F27E279721D7059044F9 acteursdiensten
967,784,652 *64EEEC71BD0AC0263973A145873BD6814DFB93EA acTf=
967,784,653 *64E78E1B6DFDE12DCFB7525B6AFCA9C478FEC801 Actgactg9
967,784,654 *64E8EE4780B2EC6345D2C75EB80D19E06915FEC0 act?H
967,784,655 *64E0C454DCCA081EF8C5B0CDD71F9B7DB9E50836 Act II Invasion-Explosion Mit Abschied - Abschied 2
967,784,656 *64EEDF8F3DC8667C226D5B233423F553760F4702 act iii: rivedrai le foreste imbalasamate
967,784,657 *64E0E36A88D409838623841F19961D2DC80D0AF5 act ii, scene 1: prologue
967,784,658 *64E79E7420BCE51190CA1C728C73A21336674F44 act i: 'mi chiamano mimi'
967,784,659 *64E0FC9CE4ACDF3A86D9A6EC36B77D349C2295EB actino5toma1
967,784,660 *64EA26190F921FCCC17467F2A614E4C19D434757 Actinodiscus
967,784,661 *64E0A48A5143BB3891B3B4836476211D3C14D3B7 actinonema3
967,784,662 *64E3A1BE8A2330AE5979CF2578DD3F6237D21A4E actinophryida
967,784,663 *64E142449E06BB958A19CCCC91D5750E7C1E168B ACTINOPTEROUS4
967,784,664 *64E6F9FDF940B38CA56CA7839A16A9A6CC79AB05 action-mime
967,784,665 *64E4195EF5AEECA13FA65F3376FD1195FC865E2F actions.actions
967,784,666 *64EADA0AD7AC9D8A967B20D6806DDDD64EBD51AE actionschockers
967,784,667 *64E0CD2729EB639523EBE1B09F492A2FF4165E0D ACTIVEASPEN
967,784,668 *64E749DC84AF4FFA23BA847E9E0BB461C76D704F activeersing
967,784,669 *64E98975D3A2F41930C86B99E5CE93FE78E5A66F ACTIVESANTA
967,784,670 *64EB4495B049193C48E1350C41517F683FE3CCDF Activesheba
967,784,671 *64E49CD2F3AC908F979BFD4FDA8B4893F558BA98 activitynotice
967,784,672 *64E0B66EA82443B980ABD573A804FE40AF023771 Ac"TK
967,784,673 *64E2AEA0895C5FABF756EB6B2E1711F6F0BCD937 ac(tl
967,784,674 *64ED3AFAEBCD2E1046E21359D814249ACBF30DA9 Actmakin
967,784,675 *64E7D8CEE265ADAB8A20F20042DFDD232A7C1478 A!cto
967,784,676 *64E54F973ED571EDE5CC2569F600EB7A4F92CA41 ActOnCO
967,784,677 *64EE2A9C56FAB57F822DA0A0A0BED0A072D3E7D8 actone,scene2:mercutio:allegrogiocoso
967,784,678 *64EB25C48A3FE9430EE049761B28B55C62880160 actor45
967,784,679 *64EE2C458141CA85FE4895893F3676C6F747F43B actor4ever
967,784,680 *64E21A72338CB0A600F101FEF093432BABD40D82 actorgibb
967,784,681 *64E273886A4EBD1B54AA0FE04EB4F4ED2768FAE2 AC!TP
967,784,682 *64E3881ABDF09CCF340C12C865CE51EE09FA51A5 acT%T
967,784,683 *64E3962284CAF1FE3CF1956C3AE57AF9B146F298 actu6103
967,784,684 *64E25C7CF20EF2DBB78F44E423D2111049637D9B ACTUABAN
967,784,685 *64ED049B59F76481CE0A0BCDB0337F658169C41C Actuaciones”
967,784,686 *64ED0A7210A86D3233D61E8CA9663341BD5B3730 ac)tx
967,784,687 *64EEE95B1945D7F5EBB806D11C6A61AC37248680 ACtX0
967,784,688 *64EEB7AE4BFAD52375405C79F5DCD1629B4C6EA1 AcTZ.
967,784,689 *64E022EA28D23B5FD9F577609CDC5CEB3F129CE2 acT}z
967,784,690 *64E2629490AE95AC7B78D622F7FEA52FDA1545D1 ACtZu
967,784,691 *64EF5C715E6A1233F7660C6D68DFECB864361D32 A?Cu!
967,784,692 *64E238CAE5440FBB7489451395D113B517BF8BDF ac},u
967,784,693 *64EFEEBEF18AC15BCB6F99D806739A7C19F7B1EB Acu1t135
967,784,694 *64E7FF32940563AFEC6FA5649DD36E8D08DEB72C ACu?9
967,784,695 *64E85356A4BA4C634DC92771B056AEE15B6FB88E Acubenss6
967,784,696 *64E6933A9A89D862D99C5BD3D1BBDE6E2D0CD03A acudrea
967,784,697 *64E8BA1086AC7F2533360481E2CA4F61F60E76EF acufunde
967,784,698 *64E2B1AF6D3D694FB14AD0C4CE8B631D918F47B8 acUG:
967,784,699 *64E1649489976EDA13DEE5D2DEAC25CF6ED3929A AC.Uh
967,784,700 *64EF29E10664CE84D2BADD6C4BECDF45CBB09D6D acuidad7
967,784,701 *64E9556571C3AE621F482DD9AFC1C83B8F8C1588 acuidade1
967,784,702 *64EE46665452EE98B1E8169124424BF0690E1656 acuiferoed
967,784,703 *64E94A59E0F0B184689DE5F4A4AD0A0FD8A79EE8 ACUj2
967,784,704 *64ECCA190CDB4447583A03FE9E9F9990859BC484 ACUK)
967,784,705 *64E2A69D2686BF0FED981B44410BDD0A8F262579 aculeo”
967,784,706 *64E37492DAF33FBB5153B49DE5D87FB0AAAAE4ED aculeolatus123
967,784,707 *64EEDCBC435DED9BF4A53CE4076525B8A0D05790 Acumula
967,784,708 *64E43CCEF59A304C431121BEACDF9F06D7631B82 [email protected]
967,784,709 *64ED3394322205C02B3AAE5A050008463486FCFC ACu/P
967,784,710 *64EF125D5DC968F34519AAFE6899DAE254704DB0 ac=Uq
967,784,711 *64E654B9EBE9F5914A297A2D0DFEC6D503E54606 ac*uq
967,784,712 *64E7FDBFE33283D91D1C224B688062B645FCDBEB Acurapauls
967,784,713 *64EC57EE83E013D16C22F2FE50E9B4695B2FDD48 acusars1
967,784,714 *64EA91A5C52AE60CF54CCC10D9BDF559373744E2 acusose
967,784,715 *64E4C590D88E50703D4F33B6C6D1DC6BDFC86E20 ACUTINA
967,784,716 *64EFBB3F0F031A6C54DCCFC9370BBA0188FC121F acuwaw
967,784,717 *64EBB99983CF10C3C4D16A0E02A322613B7D4CC4 ac>ux
967,784,718 *64E4488D8D68E4F63608A9CFAB395425C320100A ac"?v
967,784,719 *64E4A361A3E617127BEF7995D8A1F2D277F7014E ACv2o
967,784,720 *64E5DC78FE5AE7AA3C965EA4613CBD1D8B8B78F6 Ac_vA
967,784,721 *64EF5DBEFC93DE62431D9FB1D745EEEEE8719BA1 Acv_c
967,784,722 *64E8ECF51A3602C1DD5951659F392F05D1C85CDA acvcc
967,784,723 *64E9EB0383337B25014F169DA5A5396A8E9CB0FB ac[vD
967,784,724 *64E8C5B8987F2B4E97E36E2ABB56D2FD92FF37E7 ACvhb
967,784,725 *64E359BD0C3006DAB98458DC41B72378A4ABB221 AcVi9
967,784,726 *64EF9887B019AFCF4DE93AAC38CA8A59E7A5E8C6 Acvo4
967,784,727 *64E7C022EF2BA10990BC1239E5DAA3B25E0694CB acvOp
967,784,728 *64EA21417611D149631A9BBC70AF5095363D333C Ac+vP
967,784,729 *64EECCA162BCA1A8CE543A9926DD02DA863B176D acv.Q
967,784,730 *64E1D0A003DC0E3966E6C50BC05EC7AC69993EBD Ac)Vs
967,784,731 *64E99AF4D663E4F70F1DC98315A088CF144778F0 ACVuE
967,784,732 *64EE3C9860AE8BCDBB4DD897746780211236CE92 ac,VY
967,784,733 *64E5414BE7A8732BFF96FB03B56AAD627B42F8D5 [email protected]
967,784,734 *64EDE86A70BF4A3E762D04B24EFDDDD845DCAA1B AC!&w
967,784,735 *64E015F84952DB4F57E0A39F29232BCD51934A24 A?-cW
967,784,736 *64E44F48D88435791F06AD4E8CB6BB98ECC5B77D A/cW5
967,784,737 *64E3AB53E1998316004ABF9F2E417660EEB0D824 A-CWB
967,784,738 *64E504386A953C6C94734F82F67EF3EF3E4EB0F2 AcWBO
967,784,739 *64E952B7AA41530CF6CE5CC9B6563D3D7B97B220 AcWdW
967,784,740 *64E900DFB0CEC7B6EB982942E9D2771917BA6A29 acwfvlyg72
967,784,741 *64E115AA712EE94F706009882E34A5A26D7D8714 acw'H
967,784,742 *64ED026DE8D1AE201F5BC6CC6048FA5C0113B3C1 acw]i
967,784,743 *64E42B268117F67949124BB469E396B84D01C0E6 AcW?k
967,784,744 *64E9756F13EB178A564C530BE04F5210406A0336 ACWp&
967,784,745 *64E3DFA75CA19C7C2F8A7DC1A4EB9F2A8551F299 AcWrL
967,784,746 *64EF5F498CB1AB06AE401202BCF34FDB1EB49416 ACW(V
967,784,747 *64E8E2669BFC858EEBDF61CB8D3B6DDE4674D13A AcwXU
967,784,748 *64EC6395DF1C008C3A6BC13B0F021A1B40631B0C acwY>
967,784,749 *64E3AED290918897D27A045CD8D6740899150026 A)-CX
967,784,750 *64EEF92E97254226BC6E91BC50D252759E4F21C6 A))cX
967,784,751 *64E8A675C216C2BA73B47DEE742DC7E8F039D955 acx89
967,784,752 *64EEAD4B48474557CEE0EA1B8EE15BB6F2930B9E acX9,
967,784,753 *64E9A49DBC19CFF808E56DC3D8959E835F753E53 acXb2
967,784,754 *64E57EE2CE2A235C816448AEFBC88C89FA266C87 ACXEWLFZEYCDYUSG
967,784,755 *64ED03CB2FA8FEA5979D0B5F1098E2E0011926D3 acxF\
967,784,756 *64EBA104453AB392308347E22139E6D905B956C3 acXFa
967,784,757 *64ED466FD0AFBF0DD2818B53BB9A2ECFB6C22CA8 A?CXK
967,784,758 *64E17CD637784E2064E600B9D600753C214C3DDA acxk{
967,784,759 *64E11BE80B6B5B3C24E88530CE1F5D3E0E7CB6C6 acX/L
967,784,760 *64E58DEF865C26206E1B8B4B14046BEC476D2901 acxn)
967,784,761 *64ECBCFBEB4AA495D9AA6B50A4B728815D38B8EF acx+p
967,784,762 *64EBE01D271CA0731C1150E5998B23D0A87C2BE3 acXpM
967,784,763 *64E17798752383C5944DC0EA43DA94EBDF66AD84 ac`Y*
967,784,764 *64EF129574E31C2185DE4D8763E328D6CF47CDB0 ac^^y
967,784,765 *64EE1FEF46C4CF68C081BCD2F3DA4176337AEB6C A(CY3
967,784,766 *64E6A6FC186E41084F93640F1EF3F7B5064CDFBC AcYEO
967,784,767 *64E0679EB5ACD00D53E8BA009E683CD24D9B0B23 AcYES
967,784,768 *64E7E409CF4430626961892A100421CFD3C2E9D3 A,cYK
967,784,769 *64E3B4208C382B95CEA168FC4935A2FBEA36B5C2 A=cYk
967,784,770 *64E787E0494D8B25E395DBF48A581189C05A1132 AcY?L
967,784,771 *64E6B32D1A40AEAD27EEC43DE3DADF3B8CB90DC1 acylK
967,784,772 *64E9B1CF1AA8432BB9B0B2BAE21BE4FB36C0B71C [email protected]
967,784,773 *64E7F0F3C11FD53EFB98489EF9F46E1B12CAF320 ACYN_
967,784,774 *64EFBAD747F4B464A88B67C87BC02E63BEF1769E ac^Yp
967,784,775 *64E618C533E2F4E43BA7B0A9014C0EE5C04BDBB9 AcYs/
967,784,776 *64E20E03EB7E71122BA0014D0A0A8CF940047BFA ac*-Z
967,784,777 *64EF262B7EB7E3F0A9DB9D34AB1648D18369D54B acZ1N
967,784,778 *64EC113AD44376A64F926A2B7A1A0ECBC8E82F78 ACZ99
967,784,779 *64EB2EF4497BEE48CBACDDAC93CF50EE00412001 AC-Zb
967,784,780 *64EC62CA17B247E88DE0A2BC7D638C5BE700D2CD acZF_
967,784,781 *64E163FA2883DE92708273A219B0E1E372879A45 AcZob
967,784,782 *64E1F5561CD86A29BE16BD0E05365E050B4184EB AcZ)q
967,784,783 *64E592EF91AABB9792E27C47844DAE74BDAA24AD AcZ,Y
967,784,784 *64E8F3FAEE557392E23F787725C5B7CDEEE28242 A^|D
967,784,785 *64E70B13C3A98FDEF3F24DE15E97ECFD0B8EC38F A?,D+
967,784,786 *64E2FCFE22809DC49BAFF6630528D8A44393D43C A#_"D
967,784,787 *64EF09758791446D6D0ADD7360D64B753C1DD8FA A
967,784,788 *64E350CF23CE52B4DC1CCB7929C0CEFD13D69AA9 AD,(.
967,784,789 *64EA4D70F0A901FF0B0606E69592730BCAAE74A3 A?/?d
967,784,790 *64E1F9A47584E398B35B1324253EDB0C7A8DEB9B A))d=
967,784,791 *64E850DC21B62AF19960D8E04A57266855DCBA80 A%d;?
967,784,792 *64EA029576D943142AD53366F25D762A1D835D15 A
967,784,793 *64E8E9B7FEE7BA1355EC846C5295DFCED23B383F Ad;/)
967,784,794 *64E991FEC11A24E29B34705AD5EE3B9F1810EC0C a!D!
967,784,795 *64E9F02F061B4F1079CE1C9B8FCBF00552E5025D a?|d
967,784,796 *64E7D976D11B726466112D4CAAB39A1C5B33759A a*d*
967,784,797 *64EF71536678390E0CA446E278B51B04B530F146 ad`%@
967,784,798 *64E0BDE793E10AF8D3492188AE102CB7B611A929 ad|]@
967,784,799 *64E286F99E835CD817BFF14E997761AA6BFF5BC2 ad|*$
967,784,800 *64ED8A97E340FE369DA93916B230119A9B9BA54D ad(':
967,784,801 *64E424A8EA0D7152D670FE94149E972AC26C741F ad)>;
967,784,802 *64E2EC403F647A73EB277E101239DB4FE70AE53E ad)%%
967,784,803 *64E33208D28AE17DA9EACDBCC8DBDA42FD09C831 ad*:"
967,784,804 *64E88D045ED1BAA7625B15C39D1880F1E6434BB7 Ad0:?
967,784,805 *64EE263507845D54A8C1FC91424FEB5DE73A518A ad_0<
967,784,806 *64EB3BF1703E0263DBFA9DE9F89676E33E318A64 ad!0,
967,784,807 *64E30C4227482E2BF5C8D83B8EDB000A426393F0 ad0';
967,784,808 *64E8081F77AAA72E80459DC328247E1E816862DF [email protected]
967,784,809 *64E8DC1D4AD8EC0C1CB54B605A8FAF2BC6C929E8 Ad0cb
967,784,810 *64E72C1289319FB23CBC0E84C9795F457AB3FDC2 Ad0KQ
967,784,811 *64E2DB8A787A5B230A9C9F72815FF5030540DA82 ad0lphus
967,784,812 *64E2DD05902FDF6C574A2BE720FBE82FF4BF2C5D Ad0P
967,784,813 *64E0ECA36BEFCFA4E8C507759061A58C75DB00DA AD0PTJ3SUS
967,784,814 *64E46C8A1F53DC1DB3101633060ED87A4EC5C473 AD0Qp
967,784,815 *64E6BEA8040FB4CB18EE50127EA82D87739A18B3 AD0X"
967,784,816 *64E5FC2F1F7BB790625A31E5536865B74D67045C Ad12;
967,784,817 *64E90BCEABEB3C5677D5B659F3C7EE9ED0B05153 AD1_9
967,784,818 *64EAB9BF40A9F2E9C68C1A3CA4CB79156136A094 ad$19
967,784,819 *64E5BA005F1A8A1DE7509BF0858CAA2AD4103DA5 AD1a3
967,784,820 *64E400DA82D8B993B7E970F183E41FDEC04A97A5 AD1b_
967,784,821 *64EE41C64CF325501A4C1E206A2F4FD215F83BBB ad1D!
967,784,822 *64E3194E931FFF74B63313B3E839B52981178EFA AD1PN
967,784,823 *64EB76BBF50096DD6D4718B9F868C807456D66BB Ad1
967,784,824 *64EA8B7969675BF375C29BBA01CCE07B6C11A8E8 A.d1v
967,784,825 *64EF53AC9DE8C6AA7927DA3F1718F03A1CF8B5F0 AD1we
967,784,826 *64E3731D2A5AE24EFDD21F1335DB5E90B7F8F7EC A(D2%
967,784,827 *64E17BAC488A63FF1C4145449AF88E47466731CD AD2%
967,784,828 *64EBA6713F7A4C67D8969DBD62FE304F9D799F25 Ad$22
967,784,829 *64EA8197D31D6454B9209F8CF59780ECB862E748 AD2cY
967,784,830 *64EC5C2E94464CFD891C8C2AE40F32F3C2403FF0 AD2rF
967,784,831 *64E7ACB1A96111EAE1017E5C195EE688537AD7B2 AD2.X
967,784,832 *64E6624986B3C3BBF39FD2773485E15D8FC99E4E ad]%3
967,784,833 *64E9F5B35F4C372C486C412ACA6EEBCE14596B4B ad3.$
967,784,834 *64E405A7FB2FBF8605C9169C6B3D40FDFB8DFBBC ad321
967,784,835 *64E24BFAD650F64D3441631B1FC37DE8B87B3694 ad347cad-786a-32f9-9422-b2a8168e85c2
967,784,836 *64ED6F116AC016EC4BFBE88B70BB0E44D0B78C4D Ad3!7
967,784,837 *64EFD482D789A0EC9306C4AE2B38D12CE5E46BB6 A:D3f
967,784,838 *64EC0A14CD575A07F59E9BCFEF91948666BB3202 AD3iD
967,784,839 *64EAE9C41F7579B0DB3CEE8BEBD8A06F4426FCFC Ad3wS
967,784,840 *64E09E4B667BE6FE020A728C7A9D86443D13D7A5 ad3xx
967,784,841 *64E6F2BEEEE95532A530A45D02C260BC60C867C5 A
967,784,842 *64E7D909325B16F053AAAC1B48772558C2EAE028 A.d4%
967,784,843 *64EE12BF7584F59C015C794073DF8A2ED4A76ABE ad=4{
967,784,844 *64E2F67AADA5B6CAB414130139D15280E1C577FE ad4^\
967,784,845 *64E29BB521CAFC8DFE88F7EF9395C29E1CC1E44F A-d4F
967,784,846 *64E0B0CE5014DEBD816B1E59FE4378DEECD61E16 Ad"4f
967,784,847 *64EB7B7B8D2B2E86447BD9C32EE229A431FE7811 A:d4K
967,784,848 *64E53462D520997891023EF9680E4884008A9648 AD4o+
967,784,849 *64EF53A09C50B624CC4A99D2C6EE0F92874BCD5D ad4?O
967,784,850 *64ECF9EF2BE3915C4BAE0F9174B1191457CB8E79 AD5
967,784,851 *64EF90F318127742591462A6BF0A3F41FC9B7E11 Ad
967,784,852 *64E9386D8FE36A6DA0875245092F09D246BBAFEA ad5{d
967,784,853 *64E94573577AAE4280606B7D0B5EDEAECB8DA3A2 AD(5f
967,784,854 *64EE531D44126C1B14EF07735C29679F2C218881 Ad%5g
967,784,855 *64E54ABBE81109C3CF788414D955D05020256B62 Ad.5h
967,784,856 *64E6B0BBF6B9454EEFEECBECA10100BA8F4C9448 Ad.5q
967,784,857 *64E9EEF78BA9D0FBA87B372066AADE18CD81B08E ad5%V
967,784,858 *64E1A2E7C83924CAE5981BBDCAB15AEA98FAE6D4 ad[5X
967,784,859 *64E8216F6AD20D4FF539C789529195C363B4E9AC ad6^[
967,784,860 *64EB47EFBE1A325DFF8FB86C21A11FB013EE4A7D AD6&1
967,784,861 *64E64369E31AAA494FBA988228904E9590270F88 AD669
967,784,862 *64E7BB1B2886EB71B344DD71E1D8D36E7BB8A904 AD6k9
967,784,863 *64EA650112278277E707F058127182A81E6465EC Ad6,R
967,784,864 *64E2C557DC5138D21D487F6C7A784826A1491729 AD6w3
967,784,865 *64E4E02ADFD296740AD7245622A93D9165C452C5 Ad6XC
967,784,866 *64E2F7D55BD8CADF2ABB4573A1B7AFD5EB96CFFB A$&D7
967,784,867 *64E908B19F33A29E74C5611E0A9E889298DCA32C AD;(7
967,784,868 *64EF6E5282DD8B26ADFB763B1854EE576D8F36C8 A(d7(
967,784,869 *64E843B5EC61BBE5032F7A01BABF10BB398EB064 ad7%]
967,784,870 *64E652B578AF9D51FDCA110F64D2C13BF71C0FE7 Ad7G:
967,784,871 *64E4CE07E15520ADE8ABBD9F48F34818E1ED1457 Ad7gE
967,784,872 *64ED2DAEE899959A9AAC2B507A4F4F05FAC7A606 A#D7n
967,784,873 *64E688DE9C33D800CC7F4A035948A1C21A18DA4A ad7vo
967,784,874 *64E5B890046FB5B6B92EECFFDF5AD555C72BE12B ad-8!
967,784,875 *64E76BC93C703D0A3F5CEE866BC1FB2DC88056BA ad8=~
967,784,876 *64EBC7A648F35F73012CAFB557B34055FEFDD37D Ad/80
967,784,877 *64EFBC9F368CF51CFADB393CAEE4E56EAAD88D88 AD89i
967,784,878 *64E31F8F722AC30BC9F29F809E172F1F2FCC9391 AD8bI
967,784,879 *64EDF2CBF4783CD77911944EB72186616B5F93EF AD8ot
967,784,880 *64EC1A8A50EBC435D7D110AE0D6C2096EC3315AE Ad8uN
967,784,881 *64E3071A58E96A2D0D9CFA4E60912E149EE6282D AD9?!
967,784,882 *64EC2382226123D3307FDCAA95F6928FD93837A6 [email protected]
967,784,883 *64EDDEFC9135726327BBB08FE3BEA533FB6D885F AD9bu
967,784,884 *64E3D3A24C62B1D861B6FFBE24D75E5C9E218968 Ad9o5
967,784,885 *64E17C81928322533E6983447E2ED39BAE860C1D Ad9p
967,784,886 *64E1926B30362C0DE3F647572BB3D56D1F7D34EF ad9U4
967,784,887 *64E0E1ACEDE8DFC105BDB80F821BFBD2639C11EF AD$A-
967,784,888 *64E44BFF76F3ABA3F2F479E2AE7A5675E5B5B58D A
967,784,889 *64EC9E498E12517513A1BBDD8D428555A3F16B27 ADAA/
967,784,890 *64EF1B2BE46E66D5DB57825FEFBD96BDA5CB96C9 Adaa;
967,784,891 *64E333783494155CBE4BB51ED7C6056DF11374A6 adaarce
967,784,892 *64E87FC0C9AC3D8B0050600BBACF7742C9587F6A ad(AB
967,784,893 *64E316EDDE5C1E1FC5A83AD66925F22C35EB2BAC adacirra3
967,784,894 *64EC0C0EC98B586C32C3C18679837488688B9135 ADACROFT
967,784,895 *64E8F5EB7105B16329B0FA8BC199CE63B6BA3395 Adactylism.
967,784,896 *64E83A4255709ECE50139363F4A658C716E19E31 ad^Ad
967,784,897 *64EED33A152A348A8D3606DC98BA087D797390C6 AdAe/
967,784,898 *64EF71A9E52D6A3DE01240EDDFF8609B081D5694 Adaequaveras
967,784,899 *64EC57D4A5176EF9B6D8569FE30E4D3763AEE6BE adagiarlhe1234
967,784,900 *64E27B87240B2123B40BE43F5B0FE067DF46D59E ADAgL
967,784,901 *64E8E0387495E27F7010DEE5B0701C19F315C6FC [email protected]
967,784,902 *64E843BE98C9E3F39BFF001FF4054349B482B407 ad_ah
967,784,903 *64E3FE5412398FB8B9C8D0091E97553BF555F3E7 Adailiyah
967,784,904 *64ECC06C3D8A1DF603766870478734C710955530 adai(suMarijumiMikutavi
967,784,905 *64EBC21CABE1ED6C5823AD3088927FE98EB2BEEA ADaj=
967,784,906 *64E837543B58651291A040333390E035D6AB623F ad(AJ
967,784,907 *64E45116FDCC2F079502DFC1BE8E5BB651E32FEA AdA+k
967,784,908 *64EA967AAA7D5CC82274218B089FFCC3874988DD AdaKo
967,784,909 *64E63E61A2416F7F1EACFBCA2D9C21F4E2F0982D ada-l
967,784,910 *64E3D6D7AA9FE1033BCE2D7CAB47D631C786F3CA adalania(notsofair)
967,784,911 *64E16A8B1FDAA6101DEA8F354FBF0A9BBD7EBA74 adalberto.applewhaite
967,784,912 *64EB81D284087208AEFBD7E589F52CC514581127 adalberto.bardoner
967,784,913 *64E5447C76C3DEC3912CC1BF407116647F74D695 adalberto.bauernfeind
967,784,914 *64E324476DF6828FDEE33A14210F266A2607B3D2 adalberto.blinka
967,784,915 *64EB166C935A55E1FB19441FCF2AED35EBA129DE adalberto.bryner
967,784,916 *64EC4062C494439F3F48253D6D90E0FB65BC9F7E adalberto.connelly
967,784,917 *64E11132C83CCB7BFFCCD828AE1E871DD7E63831 adalberto.darras
967,784,918 *64E952F689E12C06A2FCCBEA7C6CAAFDBEB20BB4 adalberto.deloye
967,784,919 *64ED089CD38EE4C576FE8F2CE7091484C9A91268 adalberto.eguizabal
967,784,920 *64E1A124C1951A2D65344DDF11528A497D918B5F adalberto.elfers
967,784,921 *64E23D15C432498CE9EEF8F073DBC1D26CC61B51 adalberto.keedah
967,784,922 *64E943D2DCFCC522DDFF0365BE87FC7794C988B8 adalberto.ludvigsen
967,784,923 *64EA50EB73AA5A5DB939082922AEB446DA34DAF6 adalberto.mccook
967,784,924 *64EC998AAA1538A4BD921D90246118FE804A3BB6 adalberto.mitchan
967,784,925 *64E0F4F6A9A8A98567CABFC7CE17E52F0D6EAB81 adalberto.mossey
967,784,926 *64EA5E89C88EFD5C90DA2F19B84A5D4131A13187 adalberto.olverson
967,784,927 *64E0DE5F288F88BFF992A163BF7785201026CFAC adalberto.persechino
967,784,928 *64E1DE0303FBF27D7C93145B9CE3696528A09BB6 adalberto.raney
967,784,929 *64EAB2C0E252CF2381560D245F9C2DFEA1189CA6 adalberto.samsel
967,784,930 *64EAF1407E00D18D1A29C528A8C1CF7F93E4ECB9 adalberto.santee
967,784,931 *64EE37EBE9FD59D67CE79580112C2F7773790974 adalberto.shinners
967,784,932 *64EF78F823EA33BE9CCE6458F5C24EA5011DE644 adalberto.yetman
967,784,933 *64EA312CF297DCC547B8732B3A7AC237B213EF3B aðalkirk
967,784,934 *64E4F8B94CC7143757E237356B46125F5972E546 Adalyn406
967,784,935 *64E9C84D470BB89F057432E18DD049F42C32CB0E Adalynn200
967,784,936 *64E50E7AC8BF4C0ED458E85DD0A2160503F39E4A ADa=m
967,784,937 *64E6DB4FFA8F30770349706A98AA1F09CED0A840 [email protected]
967,784,938 *64EB64E29ECBBE693A9413D9A06F6EE4F2547A70 Adam333
967,784,939 *64ECCB6024C67B3993A3BFDE9F99AB76CD46BFB2 ádám43
967,784,940 *64E5FBC21B26E7C29AB59F09F5137EB092D5A22C adam.acosto
967,784,941 *64E9751336DB94E584C17161FCF8084E5940D4ED ADAMAE531
967,784,942 *64E09E7EFC4ED894D97983195E79029644E0D586 adam.aldrege
967,784,943 *64E16CCFEB622FCF1B9E5258D3339C83DD4BF2F8 adamalzoubi
967,784,944 *64EBCED082B908C222DEA835A56D552DD5D014D8 Adamant9
967,784,945 *64EC8860B46285C2D4DCF9D629968A02F0EF7DE8 adamascaria123
967,784,946 *64E2536F3A4E467634D6966A673582E722B00333 adam.beaudette
967,784,947 *64E543502994BF697B1476218127547ECB2EDCC9 adam.blache
967,784,948 *64EDE1D74E6D0C96BBB5BE38934A0CF5DAB28E33 adambloomston
967,784,949 *64E72D46AA7B562E9D3481B3BD999B3D35CA7F33 adambluing
967,784,950 *64EC985E005710E06650387A5A1818E0A434E79F adamboots3
967,784,951 *64EB42D164107D4B05E6BDF54E4DB883953EC83F adam.broaddus
967,784,952 *64E699E32B25EC159277373D39034B1C6E6D4F79 adam.budinich
967,784,953 *64EC090A22A6E53BA7878F3A7921CBF64732108F [email protected]
967,784,954 *64E952A3A0F371D513D4C9143DDC0BA222E06B20 adam.citro
967,784,955 *64EE0B68CB74D8F8E813448A70A915AD5C107481 Adamcraigs
967,784,956 *64E080E0C923CDF94A8D7C88BCC64AE52A3EEE49 Adamcrapp1
967,784,957 *64EA440470A528957526D231E2A1D4EADBDE0A52 adam eldridge
967,784,958 *64E183A3D2224F2775413570AD28617D03300CBE adam grew
967,784,959 *64E52B3AD0F244105A9B42239D1F67278C4D962E adamgundrum
967,784,960 *64E75D03C254EF6CD53E79AC81498AAE593F0A1C adam.hittle
967,784,961 *64EB7F12F4D15F988489DACCCD780DAF7D2B5ACC adamical8
967,784,962 *64E1D50E6051F4A5877DF0F63EA312EDF3811D5C adamish6
967,784,963 *64E772B7CC669B587E5BC354092897601221C283 adam.kaniewski
967,784,964 *64E288E1A191759B0900350CCF03256C1C12813B adam.kindregan
967,784,965 *64E4021553BF1E0E1703CDF78F9B58CB2BEEF028 adam.kins
967,784,966 *64E42CC3DC639EEE5CB974AFB729DAB13A1A88F3 ADAMKL
967,784,967 *64ECA44AB937FD5718EB7D141A6EF1FECAF2CCA3 adam ko
967,784,968 *64EBF72CFDC9FB6CA2283B6A243270C7F9178BFF adam.milanowski
967,784,969 *64E21772FE4C8894C1EA3DBAFE787923815E579E ADAMMWMM
967,784,970 *64ED91B27AC15A226EAEB9F38916A03EEAFE08F8 adam.neuser
967,784,971 *64EEB262A582715BE8F688DCE811A34FA759578F Adamově
967,784,972 *64E7B7E0BEC2D533DAAF7BC2AAD9226B9D6D9049 Adamovicevo01
967,784,973 *64EFDF6D1F40EEFF94D5785E95C11F4ADEF25C20 adam.petriccione
967,784,974 *64EB43B12CB538EB592BFD0E96E02D9E3985AE55 adam.pippins
967,784,975 *64E7082E271DD03EE25FBDDD16F92B5E3796F93B adam.plumbar
967,784,976 *64E14266F0710AD1FDB3913CD73EB2425FA5650C adampounder
967,784,977 *64E2D0C6734E0A3F4ABCDFE6AC688D29945A0063 adam.quidley
967,784,978 *64E00E883AEB94A4F82C01684B0E6CCBCDE3B3D4 adam rimer
967,784,979 *64EFA44E4EE02CE914652947CB08AE071CA87668 adam.schiffelbein
967,784,980 *64E825B6852C1EABC788A6FA5144F3FC6AC81B67 adam schoettle
967,784,981 *64EDDCC2C55C0E431435BA72E2F0D20E4F6D81C2 adamsjoberg
967,784,982 *64EDD6798F83B6EC7557AD38C5E3B5955AE5279E Adamski?
967,784,983 *64EF4F2764763A6A8F3EC16B3B8228B6E8F17339 Adamstart0
967,784,984 *64EA06F40F324A1EBAFC905260F2B208DD2B19EF adamvick1
967,784,985 *64EF171F4DC793C22AAE6D580EF95796C5A4F9F8 adam.warf
967,784,986 *64EC0197FECCF9E594D53405C891860D8E2F8CA7 adan.albrashi
967,784,987 *64EF7E874D36537365734FEF82413F53EA7FAF44 adan.ammer
967,784,988 *64EC24A88C95E35F6C9F3455AD575002075FA53A adan.boulet
967,784,989 *64E4BE898CC8AEBC27EB5D7EA1BD03E06E59D4C5 adan.brasby
967,784,990 *64EB3B5F03B8E6414ED31BF6753E19CB5181F062 adan.camerano
967,784,991 *64E3297A08A9D6EA2F5DC0397FE34B5D42BAE3AC adan.chaffey
967,784,992 *64EFAF44F7C9D957451E828F20A792C97C9903DB adan.decato
967,784,993 *64EB3AA17DB84236AD6B262CB8D3FF9014357983 adan.degori
967,784,994 *64EBA6DB2E0BA45D55CFB558DB4F10024AD0F773 adan.derouen
967,784,995 *64EC66AD89BC70C97A56A26D7599D213D3F7D0A6 adan.eichmann
967,784,996 *64EF091A012ECCEB78D464B04B2B2E88297B1E8F adan.fesenbek
967,784,997 *64EC66FA3D51E0FA059C5751FA6ED83AC52B6483 adan.gensler
967,784,998 *64E6CA7B1311BAB572D5682205314211902206DF adan.groshek
967,784,999 *64EF5527CB6FEB0433CC5EB0AD404C0B421C61E0 adan.hebenstreit
967,785,000 *64E8318B6F219A2A17516C8959B5AA117E8005E1 adan.hillmer
967,785,001 *64E552E01A2EA1AE306122DAD91E389ADEAB5D17 adan.huft
967,785,002 *64ECF8D828FB469788D13401D375B9A3B112B7E6 adan.kounthong
967,785,003 *64EE1AB61684A738897C38846A93BD59608F3F8B adan.lickley
967,785,004 *64ED411041915B3EB1FA5C6C4AA7556EDA1E04A5 adan.loberg
967,785,005 *64EF903AB0CC9905580DDF5B7C62CC968C4317D6 adan.manuelito
967,785,006 *64E36C4EFBA811B817B680C5EE1D6F99A47DF380 adan.meggison
967,785,007 *64EF8AC735A76B2B6F56650EEC7AC5E4770FDA21 adan.merksamer
967,785,008 *64E40DE47C1AA0FC6E9E0B015EF9FDCFD26EB0A8 adan.roat
967,785,009 *64E9945639739165DD4613F64C3501A6C865FD41 adan.streets
967,785,010 *64EE18CA12F9BC4BE208D65FBE239DA172DF8DCA adan.sugden
967,785,011 *64E79F2556BB43C8BFFA0C8A58AE94E439E758A6 adan.temkin
967,785,012 *64EAC740A4A220C80FFC4FD579A3911AC4607B6C adan.terbush
967,785,013 *64E28BCC6F5DA954C072576841CC853273531966 adan.wampole
967,785,014 *64E809C8EA82B71B70D69D778C98E28181C0E871 adan.whigum
967,785,015 *64EDFA3891574EA4BF948BCA09604A861D13D1F3 ada nwoko
967,785,016 *64EE767CE61251439DE7DA8D46448C52247E4CE0 adan.zinter
967,785,017 *64EB8EC99EEDE9056C3076D1EF6042EBCF595C34 adaP>
967,785,018 *64EA0372AB4AAA6BCB92B4C7464325735E6941CA ADAP+AB!L!+Y
967,785,019 *64ECED2CA976EB65E16ACA01D14FC49D7081FEB9 adaptacio5
967,785,020 *64E91ED42FDC1BD6A8293D55DB130E8C6F3A2B00 ADARIA
967,785,021 *64E34A6C9403223C5E23015FF2306995968AA9FF a dark future
967,785,022 *64E9A82E0FB7CC33F7430F180BB70A54224BCE7F Adattavates
967,785,023 *64E384676264C7B9B89E2D706A9DF9876B412C59 [email protected]
967,785,024 *64ECA6E1925D5C57CEBA2FAB0522C00EB9B40222 ADAVNCED
967,785,025 *64EECA83D2B9DEB3406AC5CC1BC1A312D7D2304A [email protected]
967,785,026 *64E76A69FFC624770C70A69D7791C9350022633C ad-ay
967,785,027 *64E0492AD2233A62FA7238F931C3753E5CFDDA1B adaylf
967,785,028 *64E9E649AD45F18416CFCB4F26F50CBCA6F6EDF2 Adaymee7
967,785,029 *64E5027E536BD363D9D33054FE69FDFA692829A6 adazam518
967,785,030 *64EFA0ADFDBDD451B5D133C453CF94C5C2959F11 A=Db%
967,785,031 *64EF581734325BB2349429E9B91E508F7D972301 A)dB(
967,785,032 *64E3832C26CDF6EFA88662CB30ECD56C38130BA4 ad^B$
967,785,033 *64E98459D190E478C28E839C45013922BFE064BE ad\@b
967,785,034 *64E58D9F49CA26869F391A5A7276358776BFC734 adb=/
967,785,035 *64E2741D3C4822CFCA7F0006A2EEBB94579AF854 Adb1/
967,785,036 *64E75FCC0061E3D3F333A99D431D8F0FFED0924A A,db8
967,785,037 *64E8A6F97C0C6523123AD8124B2107C341C1DEAD adbeugeled
967,785,038 *64E11F16F23ED85D012A4BAACDF54FC59EE34BF2 [email protected]
967,785,039 *64EB4DE4E27F9145DA6DB54607B7390CC42A69C2 Ad
967,785,040 *64E93726839E38A4CEF203C489F85D6B3874BF77 adblonde
967,785,041 *64E1B04E213FBA71DD67B92C1C02A303FFBABC32 adBq%
967,785,042 *64E58FFFDD2C3467D72185DC89B3593E88B2493A [email protected]
967,785,043 *64EC0E6F035A7545FD820FF3992C3507E426152B ADbvN
967,785,044 *64EDD20C873B12F1144527986E14601DA46717D8 AD=$C
967,785,045 *64EA806E75E2A3DD18485ECBBD153CB9639C05B7 Ad;c%
967,785,046 *64E465222432E85531449F3B9BAAC0435F9D73C8 Ad++c
967,785,047 *64EFD0CAD37C01EEF5802D000AC2843889C086EF ad-#C
967,785,048 *64EFD9C44C475B7D49AC4B9A3542747B4902AB73 ad+c~
967,785,049 *64EA79AD4E96A2FCDF757F2335773A3178D6F4F5 Adc07
967,785,050 *64E228DD1CEEFB9D4651731B2713020591B7259F adccs
967,785,051 *64E4A2BA41403C61E8C9916FE9BE281739B185F7 adcessit8
967,785,052 *64E14C07C5DBD711B577B9EF3C21B10EAC307A78 A;dCF
967,785,053 *64EC800FCF5D39B169C1FB7D32B70072B10BA71B ADC;G
967,785,054 *64EAEE09C2DE0D652032E704D6EC0932D7C58200 ADCi(
967,785,055 *64EEC0D2581562820B057B35CDC21A4CAFF86BFD AdciK
967,785,056 *64EECF18ECE726931C8DF2297F78FD0B76230F10 AD)cj
967,785,057 *64EBD876EBACD372ADE5012F75A5BE2BCA35C828 AdcjZ
967,785,058 *64E8EA68EFE3E028058C73D61AE9A5C9D7AB670B adck75
967,785,059 *64E094C1732F9FA205AF5DEC93DB38FEE6DD8CDE AdcKh
967,785,060 *64E787AF58F9D8CBE4001594924769C8E950D00A ADCOCK84
967,785,061 *64EBC1DD8FEA2EABC0CDC58FB6D0BB909A864EF6 AdcPH
967,785,062 *64E71B2226F3DCD59B2D4E936D583581423A31BF adcRz
967,785,063 *64EB54661D8AF564149C63B204076DF56CA43C24 AdcSg
967,785,064 *64E8700B85A82C233AD0022CE5E210F23ADA4CF8 adcvH
967,785,065 *64EFD77A673DDFA08113914EDFC0624B116C1706 adc_w
967,785,066 *64EAD325E7DE5CF8C04766DB40AC50A6CD73F75F adcWn
967,785,067 *64E3928BB631A977902779C833C359E94C988A7E A)Dd(
967,785,068 *64E63342E9D28851D925310D1DB300AE33FABFA0 A&d#D
967,785,069 *64EB73168AF879E6C7053DD48D16230FCF113B0B A(:dd
967,785,070 *64E988D13D232360F6F16A7CC848F9554E81FCE8 A
967,785,071 *64ECEB1B4F374DE5C04639D5A7D2CC599E62BEDA ad)D'
967,785,072 *64E0B4DDABA86A347919618CCD92F255C28C2DE5 ad{\D
967,785,073 *64E60FC48EF6E93929E90E408CD441E6D1E130BA add1emen+
967,785,074 *64EA0E85BE0265854E45CC5F524AA39B18371481 adD_3
967,785,075 *64EBE8D71196442C4D31D0A1C387767EB37B45B6 add3n
967,785,076 *64E3D4F7319D8117F91469917F12639654F4CC14 A
967,785,077 *64E4A3AF5D69E5909181A9560F071726B3E41421 addb\
967,785,078 *64EED20B708FE629933DF43D0D2B008B2A7E7C13 addbE
967,785,079 *64E3411465035527BB29B819E6C5DD461448B1EC added211.26.245.142
967,785,080 *64E931816226ED99A01A69EAB0A02D857D6556DA Addelaied
967,785,081 *64E17B194F7FE06B6F2F8832864533E1BB0253E5 addensasse.
967,785,082 *64EF14DB3E925FAFD12F0BD555B2DA1E6A26B332 adders3
967,785,083 *64E44FAD16F0B42226F5D18593783AC3C81E2C67 ADDIC+IVELY
967,785,084 *64E651EAB53D8D31B52EE45637D6ACF7395C32F9 Addictiondependence
967,785,085 *64EE2DB1DF8D61869176899D89B153483B323617 addingin
967,785,086 *64EB5EEB4C5B4E4F925DDC1621B6BD858C58A59E Addioforitoasil
967,785,087 *64EAB56F02B00209ED8E3D1649DD2370F15C1B54 addison065
967,785,088 *64E77B025F61505854A08F7EEA633109C2B1D2DC addisontpa
967,785,089 *64EB82464E67BE094F625DB04B341AFC84DF731B Addissidda
967,785,090 *64E5F2CAEF8FABCCB345ECB9B12D8067BB694DAD Additanos3
967,785,091 *64EDD143EFB4F89278E46E9EF1A4028D779C6BD4 Additional Track - Unnamed
967,785,092 *64EF36B75C8973141DF65C4F79C021A8148CFB9D Additionnerai.
967,785,093 *64E1919B6A14B6C2B18A40005427FAA9C2EEBFDB Additivesynthesisdemonstration
967,785,094 *64E0DFD5E1E929D0FE81B4E53D6B29F46B241420 addJ,
967,785,095 *64E56A2B7409D98612E46430F2DC27AD82166B29 add{j
967,785,096 *64E4BA2DAC55E5E66BCE130E1BFD9111E983E556 AD.Dn
967,785,097 *64E66E11B6E0ECF907367B06EE98538E39521EEC addolora7
967,785,098 *64E734D6BB0B040BBC30D42F4FB00170E7F70EF7 addorisio4
967,785,099 *64E36277FF39B72F59EA278B40607A26609FAD3E adD'p
967,785,100 *64ED3B9F21E99C23F698A0B4549E16E76126F644 ADD/Q
967,785,101 *64ED3D92CE242677DDA7F96B5756C00F6730A1DC addrbody2
967,785,102 *64EBBF12135FA5001F630BCDBE9C707276FA0CAC ADDRESSFORMALFORMAL
967,785,103 *64E8FB72D0F91354642FB577AC6A003725F26EF5 addressinghidden
967,785,104 *64E87BEFFCA4726C6ED9CA956CB1EB24C2BA80E7 addrizzo3
967,785,105 *64E7F603758F50F9CC61346508179767A67A6A97 Addtnl
967,785,106 *64E889004C310832D90990B2DE4BF54B3662BE16 AD-DU
967,785,107 *64EE4A711D3D67CEB9E6328F636F4A27CE840D26 Addulced0
967,785,108 *64E887B2D23B25C6B16274708331360FDDDCCDBD ādduwālis
967,785,109 *64EDAA7934A14AEC2F296F7102500B7AEAA6D567 adduzindo
967,785,110 *64EB665AA8555AB218E912C35A94D295BCBDD673 adD:W
967,785,111 *64E6EED72AE1B1899BC444B27265EF610C1852C6 [email protected]
967,785,112 *64EEFB28C273E05CE0BC0B8756C4F8B31DF7D6C2 addylemon
967,785,113 *64E7BDC25F947D512D1A9E30B78D43867CDB695D adDYn
967,785,114 *64E7B0FFC5D2FA14AD875143A66AF1781583A9E2 Addyson138
967,785,115 *64E605574FC7514FA387870FDA1EEDE4242F0891 addyson175
967,785,116 *64EC0B3C29EC12B673122EC90E9BB5CD89857D34 ADDYYADANFOREVER
967,785,117 *64E4FAAA1628C5FAD91822D4FADB0A12C4024109 Ad?e(
967,785,118 *64EC3874FAE10603325F178216CBF5B8C8F16964 Ad_E1
967,785,119 *64EC0D3E1F16AF93C213CC8D8F428DBEF283DBA1 ade241290
967,785,120 *64EDF52F7152B80F268A0918E408B2F021DD709D AdeAC
967,785,121 *64E72E3E63A859EDE13BB8220EB970B75CF04EC8 adebayohassan
967,785,122 *64ED5453A9C6157217E32CE3FE0B94DD26F5D24D AdeBQ
967,785,123 *64E3AD39DF222BC6B7CAB7D23924C024687CA1BC Ad#ec
967,785,124 *64E3E271447DE9DBEEBF81E4D7C95FDC80A77DE4 ADEDEJIFEYISAYO
967,785,125 *64EA490C6ACC1C3CE9151E84EB84290809D0CA03 AdeE=
967,785,126 *64EE054F313ED92131AC079ED334CB99955B23ED adeelshehzad
967,785,127 *64E385AF1A0A273E2CE0324A82A94761482BB8FE A;DEf
967,785,128 *64E07765AEAF9A7F0EC016A8B6D00EE567C786EB A:DeF
967,785,129 *64E39A05AFC231BAEF7A47517CFF565F184503CB Adelahu3
967,785,130 *64ED1431C2BC11D3F7A54DE4EC7F8825515CE3AD Adélaidien
967,785,131 *64E45D47617A2064EA2AE27621FBFD155BBD0A50 adelamocita(buler
967,785,132 *64E955EC807A4FC1F21D2379CB9C75CFD1206C18 Adelange0
967,785,133 *64ED701F4DF3FA2B95CEC21FF1DE73688811A16F adelatanase
967,785,134 *64E1A0A08F1E47B31215F4EA653E07A674310FBB adelejjeh:
967,785,135 *64E53C8615DCC3B78FBDBC34DE7B93DA4C0CCEB8 Adeliano8
967,785,136 *64E9343F249CADC0BD7FB3BF2DADE3FEB790A778 ADELiCe
967,785,137 *64EC47930F4C779815CBD57AFE0D7CEDDBAA4984 Adeliches
967,785,138 *64E9D7F81FB905DAB45CAC8AF88F4F4B33EAD005 adelindobosh1234
967,785,139 *64E9C2C6D35218C1D3FBB640814C4656008DB47F Adeline250
967,785,140 *64E85F79F5E3FAACE789478F106C5BB6C6602477 adeline swee
967,785,141 *64E37DCAD9BE43855030DD8F5C588321A1AB87F9 adella till wehrung
967,785,142 *64E0EBE7E8293C83A5FD8EFA30E222E6E614DA0E Adelora0
967,785,143 *64E988ABED5C325BB954C5EA4B031405BA7160D3 Adelostoma
967,785,144 *64EA696AA5A88F89ADBB2151D32E202A05DB6717 adelphes4
967,785,145 *64E33F0C1228CD0AD2FAA4E3CCC91B8573FEE47C adelphi“
967,785,146 *64EFA8380ED308A4BC7E5EF07F5903F2F15CA699 adelphicus
967,785,147 *64EC9592E58241C5C3E5339A4349043152B9A1A5 Adelprädikat
967,785,148 *64EC804ED9D98B77A33C2180FFC59D5AC9156964 a De Lucita
967,785,149 *64E605F88D2BB057E61FB6B299448F5BCC517858 AdeM6
967,785,150 *64E7DC81574D88576B0E1A69FB70BB18D0118C97 ademwortel8
967,785,151 *64EA02F483A4B0F6BBA248B7D59BEF28C7F0F802 adEN$
967,785,152 *64EE6ABFF4BCB89173C0CE8F4EA0C3C0D1F27EA4 [email protected]
967,785,153 *64E7DCC42FBD9F1106DFE81FF1499FDB370579C8 Adenauer's
967,785,154 *64ECD8B59CD70DACEA91B08EA92D3BAB761C19D8 Adenopati0
967,785,155 *64E0A3EA3D64ED2E6B4EA0887C85C91DB88F0F06 adentir
967,785,156 *64E68877760651239B3B47BCD62297265A8F6DC5 adeola oso
967,785,157 *64E57681B63D1DCD33CE5C38AC072A089F6FED69 Adeosun9
967,785,158 *64E85E19A3BF54409D18D3229B8895D293875609 adEPD
967,785,159 *64EF2759118DD4DC868217C890573EC11B668C2A adequations1234
967,785,160 *64E5B1702478842E3A34497F4A927BCDB71B4BE9 ADeR$
967,785,161 *64E0E1C8C0B951B19E2160EEF74E8EEEE2CEAC27 Adercope1
967,785,162 *64E46BAB367FA9B9C56FB7CB63AD11E8E61AFEC0 adescodinamo1
967,785,163 *64E345D4C443088C3D050DB9C8E707470EAE0E9D adeseptiawan
967,785,164 *64EFABAA42A80806956EF336003796513ACBEF16 adesnihsed
967,785,165 *64E1E0CEB90A553F9044B6B712A4C1B2F3E21F63 adessetis6
967,785,166 *64E14C1F0B7ABD84F5AD30DD5186BFF269E408A6 ADESSIVE!
967,785,167 *64EFC15832AFB7B036230300ECDA25B6FD7876BC AdetS
967,785,168 *64E42AD810743B43A2CE3378BDED4B71AD995CD9 adewaletitilope
967,785,169 *64E7A9FB018E579C3F4DE1BDAA9F0195D0271147 adEy0
967,785,170 *64EF8FB68429B4BFD1C078D6D554246453E23675 adeyemi abidemi
967,785,171 *64ED24C2068262B92F21609AF488C4698FDEAFF3 adeyemioloyede
967,785,172 *64E62968EB7773ABB0E0F451018F7AF4DD25564C adEyu
967,785,173 *64E14518FA492B101067CD1C3A6DE4A61D22EBB9 Ad
967,785,174 *64E84A3F4570AABB76D8157C22615FDCD1916A9E ad]*f
967,785,175 *64E6CE5C7CAC1EACA2B63EC6298C1047CB678AA8 A;df0
967,785,176 *64E7D2D380401065E983CCB6284C7E377587AD4C adF=1
967,785,177 *64ECFC04ECD43A4EF3137FD8119E83F65F476EF0 ADF3_
967,785,178 *64E975EA14BE074EED684C1960AE98F04AA7F31D ad{f3
967,785,179 *64EDE6E2B2BE82083B3361E55FC363D6D913F38B adF4r
967,785,180 *64EEDAFF17D5B4FBE476BA63A6F59047E1CD88BE AdF5p
967,785,181 *64E3911F6D2425FDEF9AAAAA8FAD5D2ACCA19824 adF8T
967,785,182 *64E50D002ED01103B239C47A9758E78D8113DFB5 Adfatuque0
967,785,183 *64EF60151F5FCB883FB369339DDCF6B048E91BEB adF`B
967,785,184 *64EB4CC8311CFE28A45D3F2B69B376D99B5C1F40 adfDP
967,785,185 *64E0687C5C74679CB77A88101CCABF5C73CF8BE2 adfec18
967,785,186 *64EF003E99612F6966F99BC79914B9353FD5114A adFel
967,785,187 *64EAFBDE0237583F8D5F041D3E90D906FA608171 AdffL
967,785,188 *64EDB482CBECE3F660CF40DC5B1FB2E72171D364 ADF?G
967,785,189 *64E7BCC30EE396CA337954438C42D152DF752660 adflavit1234
967,785,190 *64E7EC9E0F0CB5452F51B109BDFD31E96E447E7F A)DFM
967,785,191 *64E79276B1257D0FF7461D2098DD913553158D86 AdFm8
967,785,192 *64EA3DCE138228CC98E957FD1A7BD8410603FE68 AdfMQ
967,785,193 *64E0879C839860C7A5A060D5229A9E483E77B315 ADfNO
967,785,194 *64E68540D20479549535F1F44AB862CCC456E77E [email protected]
967,785,195 *64EEA050FFEBD3BC021911EA36AA1AC95A6AB982 ADFQC
967,785,196 *64E127F231686315FFF162FDB85EBCF0057FDF2D Ad.Fr
967,785,197 *64E591D9F4E931AC3FE30DA446FFDD39597BA2DE Adfranse7
967,785,198 *64EF2960ECB33B2C5DA9C4EBE7E6E529C711AF65 Adfrj
967,785,199 *64E110D7A443AFF8408B4A0BC6F6F3FC29325A67 Adfvbfding
967,785,200 *64E4652F592BFA458FB26FE64171E75510DEF134 adf<y
967,785,201 *64EA41860398EFD5AB0AA3621493C358E625688F A?.DG
967,785,202 *64ED066C8B8197A8A0115FAFCEA91710999F074F Adg$"
967,785,203 *64E5102DEE0F56A733ACC368CCA4092462883BBE [email protected]
967,785,204 *64E5CD264843A05E62C32B939B0FC217AB2C174A Adgbigred3
967,785,205 *64E4B612E0A1D0534C10E660643768AA3091270D adgblue7
967,785,206 *64E02475C0FE4DD7713C8C3F537854007D12968F adgdeaded
967,785,207 *64E0F3D430ABDD5FD5A87866D2C86C7291F4EBAC Adgdebbie2
967,785,208 *64E5A1B2B30F78A3F4D0C9358DC14AEED2A3B868 adGE>
967,785,209 *64EE862DB5E7898D9D390CB12DBFE5962FC31218 Adgfelix7
967,785,210 *64E31397A11B1324956986EF360AE79CC9785219 ADGFf
967,785,211 *64EC3DB21DB86BC45023FC7C18CD96D0425B055C adgfrank4
967,785,212 *64E309A9788EB50FC0D6115DD7D8F575DB6A7207 Ad"Gj
967,785,213 *64ED93EA101F86F7A00D4370FCE8F05588EAA84D adG=J
967,785,214 *64E407A782B24B5931581256E99A350253FBED5F adgjmp3sep
967,785,215 *64ED1D9A43FF0A4134589B0DBD5C89AC7894474C adgjoannas
967,785,216 *64E6A2B34E6D232704CC337ED8C49F7AB02E0FEF Ad(gk
967,785,217 *64EAEF9DD5DB9AE77E6D4D26D2EB12775FF5F987 adglooney9
967,785,218 *64E3684B864F17341C04338411BF9CAA146D9250 ad%GN
967,785,219 *64E89139DBCA26C2C0C05CE3F103F865250D11EA ADgOD
967,785,220 *64E1F3B389976E514AE56687AA26BED6F9324A93 Adgphish8
967,785,221 *64ED8CA25D195044E5E81D3EFD313EC8BC82ECCA AdGPW
967,785,222 *64E2F4A30B5DEBB6DCA9B63B668DC2E73ABF60CB adGq'
967,785,223 *64EEAD293F4B632D2B17C23144D0927CCD25283A AD/GS
967,785,224 *64EB5641339FDC80DD5E890F042B6349462DCA83 adgsusans
967,785,225 *64EBA58A99CA225A4C4204C698A54A64404D94AF A?dgT
967,785,226 *64E70359DAC792F8F70F3E317BBA8D92A3548767 Adgtommies
967,785,227 *64E78C495FA05DB2A2AA86B1BDA976F2B15910AC adGUA
967,785,228 *64ECBF2CC86722FF6D51990ACB3F94EE3B3F220F ADgup
967,785,229 *64E54B243610E56A48E8E980E3655DA355DE74F1 adGV/
967,785,230 *64E09C2B6C8BCD3F47D1CEF16C70B05ECE8283FF Adgvette1
967,785,231 *64E760BC7216B629619A5633816455EC8C861E15 adg+Z
967,785,232 *64E71FD870EDD62553E3CC5C3FF49E560908F9B5 adg!z
967,785,233 *64E12E7F32849163ECEEF40547F9904AF685BDF9 ADh#;
967,785,234 *64E2CCA2BE86AAE73B26DB4A7BA8B3D5FBF4E40F A%dH-
967,785,235 *64EF866DFA0ACC25DADF68DB2770D2E1725CEEA3 Ad.H.
967,785,236 *64E644223654AFFF0F4AF4DEA63B022EF0818CE8 adh:"
967,785,237 *64ED4F2CC838E37210B9960C76BD12E18420D751 adH5s
967,785,238 *64EB61BBA4B749190A76B88000CE071B1E9FD36A Adhaeres3
967,785,239 *64E940EF4A6B7460D5C8EE680665A83C5C2FC93D adharige7
967,785,240 *64E9DFEDFE484C2155D5AA11F35B47BE784FD2F0 adharzhet
967,785,241 *64E8765CCED8E72D122FBFCDA7D4F5E2440BC987 adHCT
967,785,242 *64E0FE354A2158DE341D85E03378EE01860AB16E adherescence7
967,785,243 *64E5250CB16B48A413F7398380E6DD049D1972C6 Adherir6
967,785,244 *64E077955A17F3ACC7666489B9AA24C0E5072F50 adH\F
967,785,245 *64E56BAF587CFCE42C0B8357C28FC9A2FB736CE4 adh~H
967,785,246 *64EFDC1DEEE559AAFF5B58C5321831393DE1BCD5 ADh&i
967,785,247 *64EA7888F4638A9E9F52F77C2C1200869A53685D adhilmohamed
967,785,248 *64EDB013A54ECE3CF9B530095862B22750356A29 Adhmadóireachta
967,785,249 *64E87751FB6D1A874F76658E523276AA76C169DA [email protected]
967,785,250 *64E814F2BCA1B448AB248FD49C96DC9DFB7DB40B ADh
967,785,251 *64EF380BF715CAE856B64B60FBE8B36837429394 adhora das
967,785,252 *64EC11B30192CDD8CBCFA88D2922F264DFFC630E [email protected]
967,785,253 *64EA5580B87EF185E0654FB4FD95000384D2C540 Ad)hp
967,785,254 *64E8876D946103839ADF47EA08019E9567D37BA1 AdH.s
967,785,255 *64ECF5002E348E7D5C342127ECE3F0D83F42DBBF A)Dhu
967,785,256 *64E6D1EA98278CA9127B0C6C373E549CF7907ED0 [email protected]
967,785,257 *64EC03CE79B37A64F7BB57653DD72DB3DD09F42B ADHVP
967,785,258 *64E0A7EF1569A9B8E4125DAB1874CCAD70895663 adI}/
967,785,259 *64E02E39F59EEF978660FE04D4D19D134BD98A9F adI+.
967,785,260 *64E3AC5DAF9B20E8F7A01EEDDF7719F8D0027185 ad$:i
967,785,261 *64E271C8A1C0777926B9922658DF611FD2DD6A60 A!dI2
967,785,262 *64E7FBDABD549452E32EEE9178E78673B6D7FD49 adi5(
967,785,263 *64EBA3D2FECA622E68CC8BEABA075DF1F48B9F37 adi6y
967,785,264 *64E0DB56F6D3B4364D68DF276DC5233399B90FC9 AdI:A
967,785,265 *64ECC94604105E71376FD38FE55612038FB2D129 adiactinic2
967,785,266 *64E86283C8FFC69F0C7228A83C21EC1AFA97D266 Adianome8
967,785,267 *64E7420A9A25FBFC62F25651C47D21AE952A4ED6 adiantarias123
967,785,268 *64E7C52F9BA60363F17850B33F2718F975338C6E adiariases
967,785,269 *64E48A57C1046C7C7E7CC5894EE0872CBDD92C75 adibarman
967,785,270 *64E10E54A1225CF18CD4B91AE7FA28157B3FE4D7 Adibmarc0
967,785,271 *64E29A37BCD3A8FD17A6D43A699AF8270D35C87E adI:C
967,785,272 *64E14C0D1D8FDD851D7A07A655453C2131E73DAC adicool4
967,785,273 *64E3ACA9A76D02EC68591F6C3A9832029DBFD5C7 adicuriv4
967,785,274 *64E50AB21EA8A8679C96B3DB43DBF012B9821DBB adICW
967,785,275 *64E2E0F2A607B5B19AD04549527253E74085B9C7 adidaswkt
967,785,276 *64E9C48AAF4DD1F73E614C46F4A9E65EB16F42C7 ADIE0607
967,785,277 *64E24F5D8056EF306F3750CA005FCA8E849D17A2 AdiFK
967,785,278 *64E89321FDDDF25DE639E825CFCDBB0548C3E467 ADi
967,785,279 *64EC2FD6982F363FEA567D907C2B208FA779AE5C adigeres8
967,785,280 *64EC72A8E77857111A8B3D4492E2A617DE6E377F Adihsayah
967,785,281 *64E1F0987B2954BDB7DF534994F62E94B778EB73 ADIKZZ
967,785,282 *64EBB16D5EAB0E6BB8299715DC29FD8557D7C556 AdinaHowardPromo2007
967,785,283 *64E791DBA89915C3E5F7039B99693763E4146591 Adinvest7
967,785,284 *64E623E2C36F54180D74E5F74A2F8E9AF6F42A9C Adiozihr0
967,785,285 *64EC9A9FCF43CAA3026F0E3A4131094B5D46B886 Adipometing
967,785,286 *64EB68887C852DB7703DC7FC5D0F57E424784901 adır
967,785,287 *64E82ECC66D90E044BCFF1974517CC86EEF71A52 Adiramyms
967,785,288 *64E3EA988B279246A54807092CBAF8B965100505 adirante9
967,785,289 *64E99416E48A81A351B5B540D3A56F3416443B41 Adirdopa9
967,785,290 *64EA7B16365BEF52E659CAF5365D15D95721E1DA adirebus9
967,785,291 *64E728DCBBB2AB9C5E21CDEB9413CB91053E968C Adisagra0
967,785,292 *64E1147420628403AAD994886546C14C7D36F2C8 adison422
967,785,293 *64E8275DA94C99C43AE406B7749341B9EFC9F915 A)DiT
967,785,294 *64EB0EE293680FD7CB0C1AE6C090C3F69A16CF9D Aditamento
967,785,295 *64E6BEB65554A0EEEA0030597962E0293913EBBE aditicios2
967,785,296 *64E6380CB54CB28FCFBF607153789FB00D15775B AdiUv
967,785,297 *64E83001AC2855E1DECFFB33363E96AE48DC948F AdiV
967,785,298 *64E19F0DD59A040D17EF1BA7EBD72D6998099F73 A)DIw
967,785,299 *64EEBB90C25C2137ED65CAF6A974D4981724846C adI:x
967,785,300 *64EE117833F0AED10733C9077306FBC70CB4F2E3 ad-iX
967,785,301 *64E6952490625E1F80BBA255032D8A04CFB8DD57 AD_j!
967,785,302 *64E2F9DEBD6F2252BDD07220E3BAFCE7156AC19C ad#'j
967,785,303 *64E62D56D75CAB7994AB731F358058EBAE7E3602 Adjacence?
967,785,304 *64EB14129DAFB3403C80CE9F3CB5F37F7A896AD5 adjaouere
967,785,305 *64EB040635003C7AA9FF2F449D7BC6CCA34FA45B adjeboved
967,785,306 *64E5DDFB61898B8B0510A24B697F33706D55B293 adjektiver5
967,785,307 *64E7192AC234C6F6AF7050A64056B3D0E44F8F4B ADJGAK
967,785,308 *64E6198ADDACFB99737C766B80D60F89C2A0320E A$DjI
967,785,309 *64E5379C446A0E66F491B7F0A627A0597D50C13E AdjI
967,785,310 *64E3711255CE4763415D63C1C0116D3409B1FF44 adjkB
967,785,311 *64E334E40DC51CA0958DC28D15847B49A1AC8DF4 adjoin4all
967,785,312 *64EFEFC4B3AEC290CE839CBEA5274A40F25170BB Adjoindr4
967,785,313 *64ECA343AA58D77D12A067AFBE1BC07E7BA35739 adj^s
967,785,314 *64E1BA13EE1C097D03764E9BDC753A50E2A50DB3 ad~Ju
967,785,315 *64E48547998D2D8F055BB018330770304DBDA2A6 adju,
967,785,316 *64E67D2BCC505F5DA86D29286D5E5EB11D222AE8 Adjudicatio
967,785,317 *64E4DC839571C5E200546B75311664F63DF47E59 adjudications4
967,785,318 *64E2835609D99FB8AC8760CE8FCCB530F02CED06 Adjuntara5
967,785,319 *64E7AE2819C6200CA78216DBDA737E4591A3F86F adjurarse
967,785,320 *64E6726682192E0E914865691DAE4122C34E38FA Adjure1
967,785,321 *64EBB6881FE7D778FBBE0432ED8D3D3290218C84 adjureront?
967,785,322 *64E8DF888FCE79383B796007C6FE19211A8F404A adjuret8
967,785,323 *64E17E9B24AA4846B789A823E39D23AE6C38CFCC adjutage?
967,785,324 *64EFE3A416A5E06F59C0F37746929FF2724D504D A_/dK
967,785,325 *64EA6B853F86FF0DF09E03596CDF40DBB47EBB5B adK0C
967,785,326 *64E172E560C2EC82360A8A7F4AC41C8537E323CB Adk.4
967,785,327 *64E7A4440AE3D347BEEDC858015F320E06B941A9 adk\4
967,785,328 *64EA5AF1915FEE0F9D8E734FF079E2F999B232A1 A"Dkc
967,785,329 *64ECA17A8A189BAB6DD4B44E4D8E8CF98B2902E1 ADke5
967,785,330 *64E635514831087B08F155D703D19F90BDB5649B ADKE7
967,785,331 *64EC32B5E9EDDF82DE1E688AE3F6AFD4C9EDB2BD A)DKg
967,785,332 *64E26EAB1FEBC9869E177786AAFF24253AC19EFF adKh+
967,785,333 *64E88BEF5E8A24B626F0F173269C71664072E108 adkinsknox123
967,785,334 *64EEF987D3A9027F89B65E6AB9870C4E999F73E4 ADK+L
967,785,335 *64EBBC03CBB5DA2CAC7962DD7195D24F921C0686 ADkM,
967,785,336 *64E67CF2E94F64DCAF5157E034FF832493AEF0AF adKnp
967,785,337 *64E18A3A313D15B63C7C24E5B8CBD08E6E563D50 adK,O
967,785,338 *64E888011389D65641299AB514ED9B65530EC67C adkosign7
967,785,339 *64E05CE2572366E33C7FFAC1732038B511953021 Adks/
967,785,340 *64E55765B38321FC461D5B683DAFBE3E93CD04C6 AdksQ
967,785,341 *64EAA8BC4577D5A00E51751B0551597BAE5EAC31 ADKTN
967,785,342 *64E10229CADEEAEC990378D25D288ECC0A68005E Adk)V
967,785,343 *64EA07DCF7537081C3840AF9C2A82FB0D72098C0 adKWx
967,785,344 *64E9E5F26B5389F7A0B99470A483B6D37B4A95A6 adKx5
967,785,345 *64ED45F35633588890170D9B1A07426D3EC6CA55 adK{Z
967,785,346 *64ED82F3B31875A57CA1CA44D75EA9765A771170 adkzE
967,785,347 *64E0161E7D052257D10D6D0B2FD4894F7F9D1429 A&D)L
967,785,348 *64EA4B878A09F5764AA0D4853EC8B9541EDF72FD AD,!L
967,785,349 *64EEB0DC583287850548E092AC37FF0CB2C31810 ADL)(
967,785,350 *64E0C96028DD5E37AA538A6A65FE8C382342B7EE Ad.L
967,785,351 *64ED1BF8B9437F0DEDAE787455312ACD7210D5DE A=dl;
967,785,352 *64E4E3120FA1A54A79A15BB21C4E22F095C3C628 adL44
967,785,353 *64EDD4E9176FADD770595B1950FAF84AAA05476B A!Dl5
967,785,354 *64EBF85D605FC841DD44D2FDF46EACBD2957F575 adlandırıllır
967,785,355 *64E8FC3C8E923A8318E85B95FDE538C48CF26512 adlatumst
967,785,356 *64E0B8AE8725F4A1E3A762A97B9F0B1DB3F4A9AF adlayeva
967,785,357 *64E8B7140C8D3C283A10C5D80F6FB8BB087E3F77 A_DLb
967,785,358 *64E088168144E10610642968E4A01A1FC3F1A0AC Adl(c
967,785,359 *64EE44849CA0C8E1CCB84EA809B07057C6A76342 AdleA
967,785,360 *64EC7537C9D840178735B818751108C095AC977C Adleigh0
967,785,361 *64E34E47C98A1DDE75C35E185C95EA0FDF2F83ED adleiste5
967,785,362 *64E4557E292758A03BF2E8D8FA1D3057360C8426 “adlerian
967,785,363 *64E45A6BCAC1FC69A63B1D0BE5A6D444D7CC8932 Adlesirg
967,785,364 *64EC3612183816215910848108DCDD4791AFE914 AdlFn
967,785,365 *64E368F4E35E8E08A7C46F99835E9552D1EACA3F AdLife
967,785,366 *64E7822B4EB4FA2C59B6F857A0796EF30121AD8D adlington's
967,785,367 *64E28FB927F4F95F403554A1BC2271C3EEFCA69D Adlisile3
967,785,368 *64E0AA9122342A3F4C728EA76838313E3D65C5F7 Adlittam4
967,785,369 *64E8ABF5DA3C92E92CFA89F46CC6352D9AA209E4 adLIX
967,785,370 *64E2A3346174BC765531F979CBC30CB64CFBBB89 adLKP
967,785,371 *64ED5643ABD4E6893FAAB936B962661544E68219 AdLM"
967,785,372 *64E4A1E89B447E03F8FC831C18DE925A3AA7299A ADLml
967,785,373 *64EBBE703C3458E56706700C15F7F79EDFC7357F adlMM
967,785,374 *64EEBC9431C3417A31AD15C3CD505990EEDE3989 A!Dln
967,785,375 *64EA7E9114A19E9F2EB432EC6D325D5742AD5B13 Adln%
967,785,376 *64EA35EAD7CA5A9F2755AA6B877B95D99EFE3017 adlP:
967,785,377 *64E05D6887B959C226DE4FCCCEB13B8BE34F496B AdlRA
967,785,378 *64EBCBFFAAC6986D3655C2CF1999DC99435D40B1 ADLT)
967,785,379 *64E40D458292DA57C981BD3B07E67120CB60F0B7 Adl$w
967,785,380 *64E425B53001B8D1D4AF4376F201C19C2365C880 (adl)を通して
967,785,381 *64E11AD1F3D66B0CC328BC26840CEAA8EC3AF927 ADM,+
967,785,382 *64EFC6E8D698BE7F4940FA4B20DC531BDFE711A9 A;dM:
967,785,383 *64E32EB1D75F758FB45C1D923C77A41FDE4D51FA A/d)M
967,785,384 *64E2E1920BE82FF6ADCB63D6D3609BA6021B7B75 A&=dM
967,785,385 *64E41BE8CFA1D9DF0AEBA18B60638BB81EA06BDD Ad;M"
967,785,386 *64EDD01FF4110078D3C6CEEE076A3D9BD0C8F4EC a!dm
967,785,387 *64EE7BBD5EC7D1CD68A66A6313DC26929499063A Adm7T
967,785,388 *64E640B2D11F3EE643A1CB2136DF93372CB90AED AdMDB
967,785,389 *64E7091B8C9C769D01D23D257D82BC2FA854B6AA adMh(
967,785,390 *64E36D9F61743E7BC62777B83C65FDCBD9400969 admi+
967,785,391 *64E0501083457EE8C9EAFC79F96AC2593E86A1A9 Admiana
967,785,392 *64E59784F794F645137198C177AEF5D056CBFECD Admilsoned
967,785,393 *64E127B3B89A40480B50236E14609A437A9B7452 [email protected]
967,785,394 *64E66CF0331F6CEDD2EF67ED507811203BBA9ED4 [email protected]
967,785,395 *64EEE357BD3E27B349AE939934243A70FEDF63AA admin-amtekinc
967,785,396 *64E60AA813AB21C606AF767AAA41CC3E8869AB35 adminbarberio
967,785,397 *64EBC509725EE981B012DCA8C27AA464F9A56405 adminconfus
967,785,398 *64E995C5E054BBE4D690C5054C0DBC2588F39A05 admingötter
967,785,399 *64EB8162F35818BB58C74DEC3804B8A59A69F3E9 [email protected],
967,785,400 *64E4D518128723FB851B9E1AD43FA6D655277737 administracióón
967,785,401 *64E48EDA89E3E009618D105FDBC991168990EE56 administrasjonfløy
967,785,402 *64E484F2BE4DFB1CE4427E0D243DB4828B2413EF Administrationschef
967,785,403 *64E4CBA44F2D51D95E3BD4AE037CECA919AECD3D administratoa
967,785,404 *64E0A93C368A49159F613940D82F22524D7C0D7A administrators.29
967,785,405 *64E4FE2FBA7B5F91F8422C0C3D5F17ED6ABE44C9 Administrerait6
967,785,406 *64E975D942B92A2A411CA306928CF10A034C36E7 ADMINISTRERBAREST
967,785,407 *64EF953C0F59E58E43CF953C292126DCA6905635 ADMINISTRERE7
967,785,408 *64EFDCD9E125869FD5049CE396DB5FF7A2D7E56E Administrerende
967,785,409 *64E38DEB504CF17CA4792623A133472EB2E913E9 Adminknoeppe
967,785,410 *64E033612B4255A27B4EB8AF261540681F4E1BD7 [email protected]
967,785,411 *64E078A0DA0A6B993E3288ABCA80BD2DEB65DAB3 adminpencil
967,785,412 *64ED4D1DA92E9960D0368DFC248EB95EE59014A3 [email protected],
967,785,413 *64EA91D891131A790D2CBF81A1FD176C8216ABFF admira1234
967,785,414 *64E8B3035C194D2A163BBFD0CBCC42241DB8E155 admirent3
967,785,415 *64EDF8F658EBB3E6CA8630E392C2705A64D6C7F5 admittance.3
967,785,416 *64EAD11401EB2D49C756F0BD355D328CD0000E23 admixion8
967,785,417 *64E1255C48D2E0CC168885D19705BFA33B062812 admoesteis123
967,785,418 *64E641EEB18A0BDEE6A69BF65D9D4BFA9CC4638E Admonfay6
967,785,419 *64EBB88A8F55B9899DFCA61427A24D68BCDFCD1E admrboltz160talk160
967,785,420 *64EBCA4794428CB967F9E4A29DF168FC3C4AD29F Admrn
967,785,421 *64EB975CACAE2F3368CA95E414A6D78AA29AB7C5 ADMU;
967,785,422 *64E09FAD93114F17331232CD4BB609004C902154 ad=mx
967,785,423 *64EF6DD4FD4D5D663F36B157D77AC96A254945C9 AdMZS
967,785,424 *64E9225929711B2448EB3983111877A16D6682C9 A%d(N
967,785,425 *64E634EFC380F6148AF57533EB6153CAC8263ED7 ad}N_
967,785,426 *64E52939D6134D84267065491D02C5115FD7D26E adn\}
967,785,427 *64E25880070679F632C2D81AA42B4F7927961A89 adN4v
967,785,428 *64E3B0D6FD8C3E0AE36510CA811B926219ABC020 adnailak6
967,785,429 *64E970C173B1DAC761FCEFDF3A94CAFF34E64E30 ADNAN2088
967,785,430 *64E6015C0E99AAB200DA8BBEF7CC3C21D05E3326 adnaraka2
967,785,431 *64E9023B0A5DD59FA0D878ECE37D97426AF6B1BE Adnargni8
967,785,432 *64E6942E87EAF715343E0657EC3D4CAD4AB46470 adnarim3
967,785,433 *64E123E82621593C8A3D346155C38B60AD92BA59 adnasart6
967,785,434 *64E26A9241989D4A537B5274507A3B0B12D342B0 adneather6
967,785,435 *64E40831769226D724000BB7175F2D1923129E88 adnelle0
967,785,436 *64ED870B43E40CFB4848FA6618C5BF1481CE0C2B A?dNf
967,785,437 *64ED927F5D4CB3AA24AD8CC2BAC5296DA69D1182 AdNhq
967,785,438 *64E2A31EB9B098B067FE2D48E5F86B33FF353189 Adniauo
967,785,439 *64ECF4FC3422D8AB4BA4656B615AAD672FD03D30 Adnmensk
967,785,440 *64E7E62029C245DDBED49A307BF4E7029CB55F80 adnobirom
967,785,441 *64ECBC30FA91DA52E000C31E25523C1D9042A319 ADNS:
967,785,442 *64E25BD7E7C305CD05125D536A1A8AC5D788982E AdNuO
967,785,443 *64EEE805C2A9B6ED84570E498A400923C0FA1A69 Ad,o(
967,785,444 *64E1BD58D35995E6CD17FD9A9BAFD79F96FA3B41 ad)o!
967,785,445 *64E266DED9A0BBE43B353723225A6DD53AAC1D70 Adochas4
967,785,446 *64E3FAD9A799F3E19F3612DE1FCC009F8D3ABEBE A$doF
967,785,447 *64E1B8BD0BE9E45BCB13BF60B53BB42AB656EF27 Adohsaf1
967,785,448 *64E7FB146DB12910F78C9D5723F4D6CC5BE6F8F1 AD?oi
967,785,449 *64EBD5114EA4E2CD0F17EDD61A69B8BB57612AF1 adolfiina
967,785,450 *64E45D011F7FEA1F7984E4AEF873BB619EDEFA5F adolfo.baeza
967,785,451 *64E8AD163A634B7E10BD3CC0CE3BF1621B6F9CEE adolfo.bread
967,785,452 *64E3681EABC293EABBF2CAFC7B602998DC2C4037 adolfo.burkhalter
967,785,453 *64E1830C3DE0678A87F8F98EAA45BFDC8A7E3932 adolfo.chauarria
967,785,454 *64E06477A78914EC9ABF7C9CB3123BA744D20D3B adolfo.corish
967,785,455 *64E028FB7C06CAE89B356B6DC193FA8930C8E542 adolfo.dissinger
967,785,456 *64E2EC82A85C8724F69B31676CBD043BF88F8131 adolfo.kahalehoe
967,785,457 *64E1CB3AAB8915BD32D132DBACE447F6CE9AF326 adolfo.kresal
967,785,458 *64E36B9B4707800CCE5721ABD17172BC9F278E3B adolfo.lynds
967,785,459 *64EDD3348CC188481D3B5BDC08F5FEE9857E4C01 adolfo.manriquez
967,785,460 *64E985A7C8AEBA80139E2D63943A097543A45C14 adolfo.nye
967,785,461 *64E6F72C8638C97937133E906D9DCDCFE0B263F9 adolfo.peth
967,785,462 *64EDD27D57EBB026D6882014479605DA1F7318A7 adolfo.pluid
967,785,463 *64E83B95AC043405CD10AB5A558D59FCC6A13623 adolfo.quartucci
967,785,464 *64EB818A920428D6C06BB9162C7717E33D024FB6 [email protected]
967,785,465 *64E13DA1381BD3EC0D8FA493B0903F5ED4C83CFF adolfo.ruthstrom
967,785,466 *64E89AE25CDE11BF461CB3035381DC2F45267D52 adolfo.sitra
967,785,467 *64EB9831E53AC7A7AE5CC3DE5C6FDD6A94B4ED18 adolfo.trevarthen
967,785,468 *64EDE23E59E44EDFF160A85C5A7A93D66BB19286 adolfo.vanderwege
967,785,469 *64E2B5FC1B4F0E51B821B884ECEE8838AE998CFD adolfo.wanamaker
967,785,470 *64E0F4124AE9AA63DA8E63C04407B3DDA846BD87 adolfo.wates
967,785,471 *64EABB08817AB9FE19688F83A6FDF52040617B29 adolfo.yancey
967,785,472 *64EFA0345DE434FF8929DD507E78BF8EFB0C96BF adolfo.yunker
967,785,473 *64E7432E65EAF1389A47231E1AB324CF3FAE2B53 adolph.bertman
967,785,474 *64E268973353F1060645C41CE74BD7C48A582510 adolph.breske
967,785,475 *64E1FBA7F0B57B583F657FCD80BBCDD93F57DA13 adolph.bugg
967,785,476 *64E764B94BC69B12A02A69B76F5FB81623AA2E28 adolph.christina
967,785,477 *64E7D8C1F1994B4EFD4C793A8E3D95232151B8FB adolph.cieri
967,785,478 *64E565142A2202DD9C66F25E86B8EDA93B71BA2F adolph.delguidice
967,785,479 *64E42AE6D2C7B6A219C9DFC0329A6DEFBC2E3818 adolph.ferrin
967,785,480 *64E522A8A9A6980A739B7C20D0D4FF7526019615 adolphin18
967,785,481 *64EAD7F9A5C5687DB30BB7BD905D875E9965283D adolph.krake
967,785,482 *64ECC756E57CB359E12EE677AEBAE68DD2DE8088 adolph.levinthal
967,785,483 *64E9D70931B4F657DB1EE5C3E42E4B45B233A066 adolph.liebman
967,785,484 *64E10F1F4B37AA29EB80F5EA90501994964766B4 adolph.marchaland
967,785,485 *64E7EAA1A522A15E86087BDF89181ACEB329AC22 adolph.mauffray
967,785,486 *64EFB366B6271781CA94C3B0B13F266A38C6BB63 adolph.mervine
967,785,487 *64EA7C0B5207B7BDA17235B014A44366880EFAD0 adolph.nevitt
967,785,488 *64E3F4DB52D913899FC4492824A7727A77565303 adolph.poeppelman
967,785,489 *64E432806A4B33CE1B54186CF78DE72142D63ACF adolph.roloson
967,785,490 *64EFA04C58673BAB3E3F4AFE03D155A13C4EBEA5 adolph.silverio
967,785,491 *64E93FC3DCB14A517961C0491B006F0B1E4106B8 adolph.sprake
967,785,492 *64EB38EA739F8E7524AD30C2B0C3C490E58B83FC adolph.stites
967,785,493 *64E0B4525FA5C6E37EDAAABAB5AFE07428D3859D adolph.streed
967,785,494 *64E6C9C739FB8869135B865EBC33C493DC384523 adolph.sturgell
967,785,495 *64E806384D88525A2CEB8716EE295989B41575DE adolph.villari
967,785,496 *64EA3F121499BB37AB60EAF2465049FED43CF9B8 adolph.wohlgemuth
967,785,497 *64E6906119C1D8E0768D02993B214217404BF11D Ado&M
967,785,498 *64E01AB46FFA8E15FBCD12AF754EE6FA78410B00 ado.netcomparison
967,785,499 *64EFAF5D5414885F0948CAC82AEFDB03B83F88B3 Adonis561
967,785,500 *64EDDD1C7956A9330CDEC85BCEEEA146416FB917 [email protected]
967,785,501 *64E38D96DF32515BA9C3A5A789F257922E81809C adonline4
967,785,502 *64EFB5697EA5707AD73361AC42D64FB124FDCECE [email protected]
967,785,503 *64E36E413DD4BE5E36FE246B457C20367D80D79C adonphe2
967,785,504 *64E338E1D1DC41C2CBC6A5567AD493E4D7D71CB1 ADONTAVATE0
967,785,505 *64EA67EADB1EDB81D8951A9489C79D7736EC6AA6 ADONTZ'S
967,785,506 *64EDBECA26B13973980E910CD3890EB2655E7F81 adoP-
967,785,507 *64E27AA52674FE67064D428E27EEF1FCCFE187B1 Adoptative7
967,785,508 *64E9A7868D99906243E74BBF6E64C77189F62E0A Ad&oQ
967,785,509 *64E247CF9DE22111D22BBB8763887A23F7AE5AE9 adorabas1
967,785,510 *64EE3FBC6656DEB132ABAD5E667F0D34B5BB7AF0 ADORABLECHICK
967,785,511 *64E2E8320099063C34F76D57656ADD3CC4C97815 adora marie ygona
967,785,512 *64EC5F2BA3A38AD4DF6544008D95ED88E0B5D002 adorare9
967,785,513 *64E878B1474CEEFA72337DCA89B78FE2AD280840 adoration »
967,785,514 *64E3481AD7A7A90E6D3CC47D6A54672E6D0B2AEA Adoressi6
967,785,515 *64EBD350BB6F0AB54CE67ED1FD8D4AFB24EDCA9E adorja1234
967,785,516 *64E1267F946FD53E9A65BB1D0F4A72517E4CC973 adorloia1234
967,785,517 *64EBF64DD765750E2CBF48C919BC57BCE292FAC1 adormentastes123
967,785,518 *64E5CB62FDCB3C8823C1382EFC3C111DCBAE2C8F adornarono7
967,785,519 *64E68A580DE34C959A79C4D6727FDA9EE14F973C Adornavas7
967,785,520 *64EC7E6DBE4DF788B706F7576BC39296F6836C32 adornveis123
967,785,521 *64EC3FB67FBE6C36AA3315688FCD312BADFF6B8C adórovók
967,785,522 *64E0C06C8F57DB5F5E6A635FBA01E221FCCCC773 Adorses9
967,785,523 *64ED14D6B968ABB943073542CDC9898D1DE686BA ad*oS
967,785,524 *64E52E8FE87FDA5DF6D2A86019FB0791D43376A7 ADOSSERONS?
967,785,525 *64EC43F6A22F472AC8B1138822FCF18343618D3E Adosseses
967,785,526 *64E53973D8D1C5D8CE4950F59BABCDD63D85A72A ADOTAR
967,785,527 *64EE2D1C7E305AC4560FC7EA4A958ACC90D7DF02 adOUk
967,785,528 *64EDACEA95C3AFCB1373FCFC574AFF122FF5BA15 [email protected]
967,785,529 *64ED72902B455E0ADBDC28438B9916AEA868F4FA Adovasio7
967,785,530 *64E18076D936CB6EA09F4277BDBAB550E51C9DB6 adowilap2
967,785,531 *64ED52B84198C14636C29AB7D89EE0CC923B1C1A adoWr
967,785,532 *64E387CF356F007126C15E74EF1012B08316079E AD-+P
967,785,533 *64E1D3BB1B669962911F034C60CCF661784DEE23 AD/P
967,785,534 *64E18ACB201E467B49BBD52C71ECD2F1AAC415A1 ADp/-
967,785,535 *64EB3E1495D1A5D1BA4E789CA58E36246D86138F Ad=P?
967,785,536 *64E61F8B20D6A1AECA7FDD294E51279142FB9B9C AdP_
967,785,537 *64E21A327656818C7AA56170BC7B4723EABB9F74 ad#;P
967,785,538 *64E1E945F85D6DDA98ED8D445B9E89A920F85E73 adP0D
967,785,539 *64EECB23873D8F9C8C031919A851F8E9E0EA1322 adp53xgc
967,785,540 *64E661B9B6157ECF7A8311EBF8E45AF2ACCFC11A adP6e
967,785,541 *64EA7BEF76A58B1D92B6F4ED39125D974977987D ADp9!
967,785,542 *64E0AE0EA7191316685BCC713B4E067D688AC03A [email protected]
967,785,543 *64EA373914910A106695245ECDE874F2918060AF AD&pb
967,785,544 *64E9AF6C4114A0BDD62EF8FBB84E55DE8FB58317 adp&b
967,785,545 *64E94919EF5DBC3537F4FD9CD956FA1792316A6A adp<C
967,785,546 *64EDAEB5B56EADCFA957F444066554FB4B63D78C Adpetuntur
967,785,547 *64E87197EED1085D796D27636D72AC44C7DF3274 ADPF,
967,785,548 *64E8672A084FF1A8156FEB268E7E73A293D97780 AdPh0
967,785,549 *64E3C49B3CB2C2C4112F616B74614AD5C4307248 adP!k
967,785,550 *64E61F169449541F19F42DA05EEAE73F403945F2 ADpLW
967,785,551 *64E478A7563716DEFE4ADE9723CD501D9E1E1F09 adPtB
967,785,552 *64EBC3C8FAEF95815BFFCB8ADCE66CBB130942F6 A(dq?
967,785,553 *64E1C3FC0EB1F9AFE94C895F1EC102293E61F0D3 Ad?(q
967,785,554 *64EC549D508BC8935F150DAFE77CC0DE7B23FFD5 adq6A
967,785,555 *64E0C89C49FC4EC5AAA266EC0C4D4734E6EDE338 AdqC
967,785,556 *64EC0666CFEE1167DF69FBADEF6A8B63B656E04E adQF0
967,785,557 *64EEDE3CE2E41EC803D9B1A078372788C82132F9 adqFh
967,785,558 *64E30F2B2F21655BCC7A28ACA721F32087B8CC58 A+dqK
967,785,559 *64EE0BEA00BF4165CE88542011B38B98FC83C933 ADQn/
967,785,560 *64EC0D2BC0731C65E706C5E170A0E7686B89B37A adqQ~
967,785,561 *64EFFEF1DE65E5155FDA2CE3060D700F5FA83651 ADR^
967,785,562 *64E4B5C75BD17FDDF8CD1B95EB6CA57FCBED12B1 A
967,785,563 *64ED9FD6FFDCA74ED0F3E2AF63BC40C51224F80F ad-'r
967,785,564 *64E808442EBF189D5C53B65FAFDF5970768DE012 AdrAm
967,785,565 *64E13C7EB3613DBFC13DB1E94ABEC83DF56A9210 Ad_rc
967,785,566 *64EE6EC65946C3AF28187C95CE4ADE1EDC258D68 Ad"rE
967,785,567 *64E2283AB16B07C2DBE8EF1F85266657FE3E2ADD [email protected]
967,785,568 *64E8E0DA48104621C3F5A16F209124C7C2B86977 adrenolysised
967,785,569 *64E4B5F02BC7028A0B96F5286F153CF8860FA719 Adresseermachine
967,785,570 *64E1A988BDC57391A5CABF63AECDD986ACE4A14B Adresseers
967,785,571 *64E69ED9BA50D11C777FBEC7C87F4FCE57938A70 ADRESSENT7
967,785,572 *64E4BF03D1122D2D0C7C386332EAB63434C33FA2 ADRESSIERUNGSARTEN
967,785,573 *64E4F2003751F06C466E8004B82C2877908F3B86 Adressonsed
967,785,574 *64E3D50BF3E65E0EA208A127EA98A2966EAB17C1 ADRI0203
967,785,575 *64E3636A4529305474CBB9E3B61A361DD0E720CB adrialn9
967,785,576 *64EEC8CB8A6A442CAD2772CA4B50E719013BFD85 [email protected]
967,785,577 *64E2BEE413AF9272A682AB2323BD7524335A0994 adrian.ablao
967,785,578 *64E1645D056A72F52AF08B81E5BB24C1CDADDD1F [email protected]
967,785,579 *64E24C0CFC93EA6CEB1555AD301A44A62123DF64 ADRIANA May it please your grace, Antipholus, my husband,
967,785,580 *64EE8FC90C5E537FB4B0A9B33A5E78D36C815837 [email protected]
967,785,581 *64E9555548A8902EB30C4BBA71FCBFDE612BE0D3 adrian.angocicco
967,785,582 *64EAEDC6578604B73D479517E890AA4FA2C855DC adrianastorga
967,785,583 *64E81B40C562B508A26583952486346A18232E1D adrian atendido
967,785,584 *64E47CB7E0A5DE7CC498D9DD1F41F539F7684E6E adrian.bakanauskas
967,785,585 *64EEEA88A74BE937916F29568D5E59F6AE3F5E92 adrianbieler
967,785,586 *64E54E3CC64416026FD5BA47B1D973E9B5FC51E5 adrian brody
967,785,587 *64EC664C286C96D7A6F379DBBB1D7BE5F7C5F9DE adrian.butzen
967,785,588 *64E420A6C394258C7611DF89569C75E093D253A6 ADRIAN_EARLE
967,785,589 *64E9A1BC39F920B9DAFD90FF113527F3C6169A59 adrian ismaili
967,785,590 *64E6697874893CF9AED42783A9CCFF19CF4E71FB adrian.lackey
967,785,591 *64E592C663E1590DD6D94559331421945ACD7A31 adrian.lamarra
967,785,592 *64E2A73A1EA78C873C8FCA3215B69842EFE6B1E8 adrian.leidholt
967,785,593 *64E2A12DE00238C915B0DF3136BA5014DE9DB19A adrian.lirette
967,785,594 *64E431E0ECD6CA5F5A9A9352637F433E270265C0 adrian.maturi
967,785,595 *64E0DC6A7B4D465CE6CEFE0CE4EA3046B0AECAB3 adrian.mcquaig
967,785,596 *64EABA48FC05F3E096419FFB1F1FFB552C3333EC adrianne tucker
967,785,597 *64E7ADD6850145EBAD48467764E0D1FC45B251B0 adrian.parkman
967,785,598 *64E04E15229B41784C31E51C75B63E219946C37A adriansaputra
967,785,599 *64EE1EFC4E43472BCD9191840EDBB45B30BCA83E adrian.saro
967,785,600 *64E6C49E180E92369C1855E3C00442B1F279A119 [email protected]
967,785,601 *64E6DB8EEEC3E0C416C115BC5F8BCC6EE9270711 adriansg87
967,785,602 *64E50EEE57B5DED29B9285491D70125B97EB243A adrian.tarrance
967,785,603 *64E75F4308AC5C5382377E0B1C498740F5B48369 adrian.tatsuhara
967,785,604 *64E40B45D26DA0E81979B73BEE6F30B5FEA8A6D9 adrian.ungar
967,785,605 *64E650EA525FD969C17CB6296212B966614C396D adrian.urso
967,785,606 *64E0F85659E0E2CEE37F6C55837D4FAC0651D8B6 adrianvivas
967,785,607 *64ECF7E89131FD631011C3D77321C48BFD63D4E4 adrian.zehnder
967,785,608 *64EEC58DC5B313DB130E1FB678C1CA4E08998320 Adrian於2008年2月14日獲頒授十萬美元獎金。
967,785,609 *64EC1DF4789EB036C09B4704D8AEA05C995AD801 Adribsw4
967,785,610 *64ECBEB30188FA1D6ADFAF3BB7962ACE2E5BD70C Adriel687
967,785,611 *64E09C46ACACEE9860EC6CCFA409EC83C299899A adriel744
967,785,612 *64E1F65DBD8AB59E0F3394A1616D185462D595D3 adrien750
967,785,613 *64E8CA5208FCB03CED47E6336CA2DA0EFDE2241E adriennepeele
967,785,614 *64E59BF2468ACEFD13CCE5DE89733EFEF05F9356 adrienzo
967,785,615 *64E2C6CA6B389434973C1470D8021F0FB7B7C054 ADRIESI
967,785,616 *64E8A2BA7EF51DAA1DD851F78054C49335269BCB adRIs
967,785,617 *64E66DC4CBDBF974E1C38925070B3C703CD57629 ADrK_
967,785,618 *64EA91EB1A57D8245CD5B464D2423D04E2FCEF22 ADrlP
967,785,619 *64E1896A6ED22B88080D09C888FE217B84CFB9EA Adrosnes8
967,785,620 *64E1FC0661DB5962C04BA2CBC457011EBE5E8B45 adrudeen
967,785,621 *64ED0C98684DD4BF3158EF5ED716E6AAEB45D236 A=dS-
967,785,622 *64E1BC0BF83BD50A230E123B19005ED15167F7DB ads1/
967,785,623 *64E72B8BED7F836BD9A9EC9B53A554B1D2D29D4B ADS!2
967,785,624 *64E586CC722ADB1AE2B1B3F27F1804513D097910 A(DSA
967,785,625 *64EA4702B8E4ADA985112D36C0D1D9DD1EFFED79 ad*SB
967,785,626 *64E3858F6623BDE6459678821F287958A6D7AEBF A=dSe
967,785,627 *64E5CD4D9F1CF55C6B10B51FB8A56551B87A1230 adsoluta
967,785,628 *64E17D9173EEB533E470027468BB3D8BB4C4236F ADSor
967,785,629 *64EE4295D0BA5AC40D7818436091A405998730D3 adsorbito6
967,785,630 *64EA2448BF6788C8A344C4AD76662AF2173137EE adsOy
967,785,631 *64E556D4356229224F28CA3DFA0AA2612A657982 AD
967,785,632 *64E2EB025B48CA8AED00E17FF3A72D1978017444 ADsR!
967,785,633 *64E914EF68EE91390D95161E23037DD068E2B4C5 ADSTABAMSQUE
967,785,634 *64E532C75D271E06446E6B618FED676D50EA3DD8 adstilo
967,785,635 *64E5E3D3ED915813E5D71A53CA746378AD2B93FF adsuerints
967,785,636 *64ED411620357FD7C88EEC40AFD9AA03508E2DC5 AD:T$
967,785,637 *64E934E70256AC3397C5712EBD793E861128F888 Ad"T%
967,785,638 *64EDB93BEDEC94C13CF1BE60191B31C234336270 Adt_!
967,785,639 *64ECE54887F1361F285086FC0FA8607BAE0FCD90 ad_T[
967,785,640 *64EF03CB4C28ADBE8FA09A2AB0333D83B035D634 ad#T?
967,785,641 *64E81B8BC9F112349235EEFF90800076AB503EB3 Adt%4
967,785,642 *64EAB84EABE0038098858F3B3B0F78B91D6A53B5 ADTAL
967,785,643 *64E794EE464C9C2F0ABC54C02A84BCF3A2CBB1DE adTD[
967,785,644 *64E3543650F60DFD390C22CC917C32564BB66E73 Adtellab
967,785,645 *64EE37C440E423664FD8EE9F2647D377D875E80F ad{TF
967,785,646 *64E686FFC0D5F07688E9D21BEC79CB3433E29372 adt>f
967,785,647 *64E55ABE56B6CFDB45E0C1F3D3C0161D07C1A845 ADT#h
967,785,648 *64E7FC014A58669ED571C825BCB1537FC037B226 adt.H
967,785,649 *64EF04528DE77055EE4E47A4795460321E8B1BDE Adt
967,785,650 *64E9989AE5EF2FB05C4AC0658C521C6F311D4188 adtiV
967,785,651 *64E87D43F18805E9D787F3BA652D5C1EBF4598D4 AdTmG
967,785,652 *64E3D8128D7FC75222253E20A51CA996F115655F adtno
967,785,653 *64E4613B2DF54D0CC93AC9BE01D6B40D01E346A4 AdTqt
967,785,654 *64E343F1CA3431D1A4753950A1A0B721A4ACE36C adtWv
967,785,655 *64E86F70F7E568290CA666BB3AF9A577B7D8CDAB A_;DU
967,785,656 *64E4FCCA143EF410811A13E749FCE935FFE3C26C AD&.U
967,785,657 *64E84CC3A64FF98E25856D63CA96C78627DAAE9A ad%=u
967,785,658 *64EFD780EE0247C22834433ED78014B3140AC5DC adu?`
967,785,659 *64E0C5844FC6C26544CDA24962F5D2345D06554D adu'%
967,785,660 *64EF505121E3F210720C74F0557AAE784E23BE3A ADU17ERA70R5
967,785,661 *64E318B438BBB5AC02AC8086309BB3905F8EABBF ADU8o
967,785,662 *64EF5FD834C200B02E132A3C6844463D207D48CF AdUC?
967,785,663 *64E234C02196F48CF4FAE3ACBEBE021B33B65FD5 [email protected]
967,785,664 *64E3256E9A640A87037F1FBC3EBBA63AC02362B4 ad[Ud
967,785,665 *64E9AD2029F2174D16BB4F032E1C9A7E2A6B5000 aduDZ
967,785,666 *64E29B61EB0279F1526A6ACE8CE9F2CB6F3B7A85 aduersums
967,785,667 *64EEC18D0A3CF1B1B4A206ACD3C9DE5663E2834B aduirés
967,785,668 *64E1702EE7D9893CE522D7B3620BEF950D2AB224 adUiu
967,785,669 *64E6D6DC534D32F74FE758D540D2CA7E6F0F923C adulabantur
967,785,670 *64E4B10315C19E01C90A5C5BC4296460F618E978 Adulamassivet
967,785,671 *64E97A7E295631D283F888757F4B99BC0AAE63F0 Adulamosing
967,785,672 *64EB41D0AB4C03A13C6EA79E878EE04C15F85E7E Adulandoed
967,785,673 *64E987A722E6E6D94F5FADD5F92854B3923A90AF Adulasse5
967,785,674 *64EB6158DBCED9C8DBBD586034A6D67FEFD96C5D adulescu8
967,785,675 *64E70E6AAC38F3B461599C952DCDABBE73FD86C2 adultery9
967,785,676 *64E5BF9DFD2E1D964A3455EE3E108E4D81C9F4B3 AdultKnots
967,785,677 *64E134C67754638C82C5A2D81C5AEDF96C63174B ADULTRARE
967,785,678 *64E89F6EF5523A62F659EE7E6AE450B0768BD252 ADUMBRATES!
967,785,679 *64ED2DC66385F93C14D73AD977AFD4F75C067DEA aduocarer8
967,785,680 *64E94BA35EB7983A8FE5C3AE1BCDFD058F253E4F adUOI
967,785,681 *64E8AE7BEAD8C52D6048899F44F69A75FFD48367 aduoI
967,785,682 *64E202E4B20F322B1E561ADAF75C1FC36BAA7625 Aduortit6
967,785,683 *64E345A0EEC4094DF635EC8B98DFC64A963AFBC6 ADUPr
967,785,684 *64EB9945AA5D5303080E7FB9A16F55CA88C94D2B ADUQMDEBEAAHIAARNBIKMZIEEGUQACEGABE
967,785,685 *64E654D05C70F2A05DD166DCB1557F591554AFC5 Aduroln8
967,785,686 *64E7696B09C571390E1ABFCC165731744E9EC9A3 [email protected].com
967,785,687 *64ECC9E25F638E1E520799545DF71FBE335EF516 adustus6
967,785,688 *64E5C1CCFF14A5F97ACDFA7D17A1829293D13046 aduV)
967,785,689 *64E70849C8D228CCCC422F62A37E86DCBB467C49 aduviri6
967,785,690 *64E28D5DF75A4C205CA633CD83AE5C92A1C55D6B ad+Ux
967,785,691 *64E579E1A38DC399E73E8CE7CA01AC6E5366E739 AduX4
967,785,692 *64E0C8F1B47EEE1B5A51348988C56E84C3EDF453 AD-;V
967,785,693 *64EE31478A587E019259AACEC6317BC0B85FB29B AD":V
967,785,694 *64E9877E97E6D08E08AA414A5AE761A9B6EA09FC AdV,!
967,785,695 *64EC27015E56D838390DC1C8FE189AD7F9EAE353 A_d)v
967,785,696 *64E03017BC45962A3B9331673AEA21AFEA77ECEC Ad.v
967,785,697 *64E43CFD380ACA311C0834DFCFFA8BDE0F5FFD41 adV.}
967,785,698 *64ED426CDBB0661D4FE8FEB5B4C0F7CA746093FB adV((
967,785,699 *64EC52C17EA39BFAFDF575648B6E5EEB2E4FF5AC adv$0
967,785,700 *64E9EAFF64BD1309D87A81D5C109F556D9246489 ADV3NTUR3$$3$
967,785,701 *64EA788AEAF16CE7AD2A39A33EF166532A26DCAF Adv3r5at!v3ly
967,785,702 *64E33F0D4C13FE8C9AC2111700F8BA6CF92E0614 ADV/5
967,785,703 *64E90E6057A4181D5AC6A32A32E94F0FE2336DA1 A:Dva
967,785,704 *64EB45EB39E3055E0BD61BC6C3F591D8E62BC9DE advanceddatingtechniques(disc15)
967,785,705 *64E4F8CB399E0060F75D3B45CCF671E111F8B1D9 adventkalenders“
967,785,706 *64E98963A2965413B60D62E4EE18E2AF23B67EF0 ADVENTTH
967,785,707 *64E12DA158DA82EF773582CAAB9195A4DA323441 adventures2
967,785,708 *64E785D3ADEF9A5FD92582935F237E7C985D96A7 adventures close to home (rough mix)
967,785,709 *64E1EC226ADE813FC7F50B624D09AB82FED873D3 ADVERADOS
967,785,710 *64E3BE73B9FCA5877CC5848385E2CD706F98B291 Adver+i5ed
967,785,711 *64EB3A16583E4432D46CA04A8881FB172CD51F81 adversarteias123
967,785,712 *64ED451BF52BA6A20291D9AE6077B7D33B1AA016 advertisinsex
967,785,713 *64E3939ADC0E124B0C300EA4AD4B5A1BD59A1444 ADVF/
967,785,714 *64E3DDFF63B356B88AF5DB656BE1546D8A4E0F10 A!dvg
967,785,715 *64ED3FE0B7312706D0C8CCF4F0540C5804212B09 Adviesop9
967,785,716 *64E270BB5E1EE1289830A09D12D55F48A8FEBB3F Advilb
967,785,717 *64E97F6B1E5511DD04739D6A3118FBD7CF3FE702 Advilbull2
967,785,718 *64EE2B09262F6153BBF365651462B72C6BB0B3A7 ADVILMOON
967,785,719 *64E23078FB5C55CBDFB5640E938110C358DF510E Advilryan5
967,785,720 *64ED60BA8A0D8C8148BAC6452329FE10354901E9 Advisem0
967,785,721 *64E301D541F28316105DFEBA7091AB5D004CF8A5 advisernmd
967,785,722 *64EEF46C547662F53419F1D6DDF2A96E442DB6D6 [email protected]
967,785,723 *64E56650C9EF95588C10EA32CF4B8CAB698C826F advogadohonesto
967,785,724 *64EDD54F3899EBC3057443ED8A46300DCA9E5DF4 A_dVp
967,785,725 *64ECC1B4B8CFAA42AD25F2D792E815A5B86CFED3 ADVQr
967,785,726 *64E7F9BB58EF4FF63E13658CE3D81E2901519B6C advS~
967,785,727 *64EB1940DAA844A6935ADAA179506C99A2E76036 adVto
967,785,728 *64EDDAFE30E6CE4A9896BA3B6F6B7F1FCD79F9F0 AdVV4
967,785,729 *64EDA819F25424236249FAF30BD92AED9370FA62 ADVVT
967,785,730 *64E9EE0826DDB091012493FB1BFE476F7EE320E6 AdvwW
967,785,731 *64E34B11A5E259782876DFEA55BF6923C49E350D ADV$X
967,785,732 *64E02BF5B366CD42D368B425E1FCF82461A84761 A_,Dw
967,785,733 *64EA7A6BE830137BAF35867944D8788ECDB46197 A$dw-
967,785,734 *64ECBAF98945B1824B199B95DD7237202E2E77C7 Ad!w!
967,785,735 *64EC2E9F1FDCEA485C673D1DC8529FC64D3D0733 ad#w*
967,785,736 *64EB30ECB67395C5693A8EAE8F3E6593476831EF adW9C
967,785,737 *64E44A039479CE9E41C89EE7516803475E33F02F ADWBBALL
967,785,738 *64EC45BDA21903AAAB4DA53358744120EB2F51E0 AdWdI
967,785,739 *64ECF85FF1632CE0232A3A4ABC77C258F45C8147 AdWIU
967,785,740 *64E96E4B864C48427EE411C0C9447DB3394CDDE3 AdWlh
967,785,741 *64E97271CCCF02B2FE4118A4242B86F6061CA0C8 Adwm5
967,785,742 *64E74339742D674AB62D193EDCC3579810D5896E adwqF
967,785,743 *64EE66C0D9977422C8338E8D98E2904B2AF22FA5 Ad_Ws
967,785,744 *64ED3B02EE43E29BB94106C97C1657CC67C94131 Adw#v
967,785,745 *64E37A7346E888FED361125AF7D8AE2D6AAFF3E0 Ad.!X
967,785,746 *64EA64815488220DB840D4F325D2EB1788CB1CD3 adx>~
967,785,747 *64E94999C1B7375145F5E89B9A8C6CAEDFA70D5D adx->
967,785,748 *64E5FAFB5DC5C65174AB1E8C72D1F127AC4468C4 adx03
967,785,749 *64E24EBF86C6E0A7B15933F96AB5F66F018FB727 ADX4Z
967,785,750 *64E6075BA19651F544B64EA69B5323F5C6945105 ad*XA
967,785,751 *64EB7FF9C8A9D9C7CD3F0DD6B96C64B7893F73D0 ad-XG
967,785,752 *64E72AD934FDA4D4FFD4FC71F1D0C64B507608CC A-dXj
967,785,753 *64E0788BC3F1AD32F90D3D55D74A564865A37E1C adXr`
967,785,754 *64EDDDC00E1AC9C9262D3C70C39D69342045A6FA AdXS"
967,785,755 *64EA1B2A659F89F961ECF7791B519B73F358AEDF adX,Z
967,785,756 *64EE5AD3E4F34F653717D1794EF7EF71DC369751 A.dY"
967,785,757 *64EE64D0B9D54A32265070B217F07CA0112EDB26 ADY?1
967,785,758 *64ECB2D4007C79AD84415AF9D9903F41593D5CD4 AdY29
967,785,759 *64EA448AA57BF499B14A11A9CE873AA5B17AF51B ADYACME
967,785,760 *64EFBE91534A33569E64160D1C55F4153BF1935C ADYDEADYNUMBER1
967,785,761 *64E641170DC81F5F7D379CEC4596FAC3C2B2CAFA adyer72
967,785,762 *64E637455A4EA999841ADB5838EB73F218DC1362 A-DYf
967,785,763 *64EAE618A5B89FC6DE93F3B7477FFBC77DEC3EC7 adYFI
967,785,764 *64E4255C4641823A99B9FB2163EA3379EBB8022B adyJ/
967,785,765 *64EF827D97964A022ABE8074DAC7AB0F45715F8E ADYmb
967,785,766 *64EBE586B9112EFB605A605EFA90ECA5A3EBC394 adYr/
967,785,767 *64E7E329BFC3F4FEC4FC1C3511EC617342EAB76D adYSF
967,785,768 *64E74843B656689CB3C8E08C0CCBEED3E34F725F adyson674
967,785,769 *64E0FD3021EBEBAF70B10778ABFF97DD4F070141 Adyta8
967,785,770 *64E194DFC017DB666456EF3F19CD47130389F376 adyturbomafia08
967,785,771 *64E54DCB0969EDBFCB0ACF91B0EEA7AE46C877A4 A.D)Z
967,785,772 *64E10641F88C6750CD70773B55529F1FF2334E5B [email protected]}
967,785,773 *64E8892DD072B46DF726878E175643CA46E629AF AdZ40
967,785,774 *64E33039F0C0A0515950040E4989782B76AA816F A(dZ7
967,785,775 *64EA5026738FCE3CBFFA0882F0D2DE2EB1736AA2 AdZ80
967,785,776 *64E075350A8E58FECA012B783E52B2B93CA473AB AdZB%
967,785,777 *64E203046C01444C2C796585F893EF74ABAC4375 ADZBj
967,785,778 *64E0E50D675CD3D3E525616120C39F25F03E0C0B adzbs
967,785,779 *64E33AE4A6AA6A9C7266AD68D98D64EDB6D8A3B8 adzhubeing
967,785,780 *64E0EF9B75EB692C427BEFC271289BD43B2DA40F A:dZU
967,785,781 *64ECEC23E185DBD031B3894961067BB1A99D0025 Ad%Zw
967,785,782 *64ECBEA8C9B055DABC66350C2999D29AC558BFF4 AdZX8
967,785,783 *64E49001005F5A9B99E3799817327D25B7872D84 AD」(一般公募採用CM作品)
967,785,784 *64E53A31708B7F59A2D7719C3AB13C30BF0A63FC のad)のように、形を大きく変え、他の言語に記号ないし表意文字として迎えられるようになったもの。
967,785,785 *64E71C2EC23171E7783D24DF93D562694FFD669D A_,E,
967,785,786 *64EF79C8C9F311290C1FC87E6B18EF9CDF59E7D5 A_E=$
967,785,787 *64ECD1D2D919FE386AEEFCB2077E521EDE2321E8 A:+E/
967,785,788 *64E00557B5582DD138BACC15E8124B34E4F2DA14 A!E?.
967,785,789 *64EA12CFCB499B7C17C59B305BA88F7687BC650E A.=E%
967,785,790 *64EE031FCEF844AF61108B77AA6BD5C479B5090C A.)(E
967,785,791 *64E74167FBC853BD7554F16E71F3C55AE204F6FC A(=E;
967,785,792 *64E09C544A780CD36CB8D24F8AEBCB04445F1E50 A(;;E
967,785,793 *64E4C5ABD27DAFE56370768F30D642F11C50758E AE="(
967,785,794 *64EC50AB29BB528E819CE2535AB02661EF676473 AE)/(
967,785,795 *64E21C5106D8BC119A418F2499F959240B611E24 AE)+?
967,785,796 *64E6C0F6AFC3ACD657F1BD135CBB9F24DFFBDC34 A-!=e
967,785,797 *64EBDA1D7841EFE8BA982CA36A3B14F7CBF11355 A,&e?
967,785,798 *64EBCE696B1C79AE9B43BEC3D80322C368319DBD A;/e!
967,785,799 *64E74CA93FD0213226DCDFED5F7E1AF4F7203B64 A;%_e
967,785,800 *64E2F278C246DB9F4B171F7DC817DAE30D65F2DD A.(e)
967,785,801 *64E48EFCF431A5D864D73C2AD710A7567D5598AA A%:&e
967,785,802 *64E49286C2F2C82633C12376BD3B9DECF9A22390 Ae-+
967,785,803 *64E299C238A7A2926955DA34F9E991406C0890F4 Ae!
967,785,804 *64E16DC198BF6EB98C66EC110DFF39D7B8E1D0E0 Ae&=/
967,785,805 *64EF9B45A3493854B08EDCD121FE178545D2BF0A AE0.)
967,785,806 *64E35CB120C9040254AB48B88255609EC7778197 Ae:!0
967,785,807 *64E877A3E90476B509BC6DC00DE00FC75A01500C Ae0s0
967,785,808 *64E2A3BD3886819E04BB4550BEEF3C1D239546C9 Ae12k
967,785,809 *64E247DEF0511BD5057D216A28DF9FF29427B291 AE1$3
967,785,810 *64E28F2C6F4A93221D2F3444F1CCE7FA05342F23 Ae14V
967,785,811 *64E867CE17E1CF6528EB24F63AC00752958BD36B AE1h?
967,785,812 *64E474D704FE61B93F566925BBC04C83A669FDEC Ae1k:
967,785,813 *64E9844BFA085227F9D3486A9FBC272BD7AD8985 AE1l5
967,785,814 *64EC442B6ACB23572739139D65B878230095CD43 Ae1$q
967,785,815 *64ED7141040AB900ADBA960D945D44C4FB2EE732 Ae,1r
967,785,816 *64EBBE89937C127D62AC591D0E3D099D0A6795B8 Ae1v-
967,785,817 *64ED992778EF225E1C689327BD1A14680D29D943 Ae1vQ
967,785,818 *64EEA2F4F37267405301E95DAD4D69CB6CFBD9B9 A-E2)
967,785,819 *64E698A60C51D4E5A525C7E878AAC898433C700C A!+e2
967,785,820 *64E4774E198B31E981CCCBA0B074D065331D6ED6 Ae2),
967,785,821 *64EDBCA809EDF150036AEFD45E4F87BA6731DB85 A;E24
967,785,822 *64ED8B140D5F43A099CE1448717BE4D11F601118 Ae.2d
967,785,823 *64E34690A41C69A2A936C6FD6C0F800FE9602E50 AE2HE
967,785,824 *64E5D97F73B8EA41F2A409C516B7DD87C04139F9 A-E)3
967,785,825 *64ED7CA65740538844032D758482E9B355FF60FD A#E3+
967,785,826 *64E06BBFB02E65A73650547197D5D4F6604E0993 A?e$3
967,785,827 *64EF2072FC7D109132B43235C500FC61A039CE22 AE36N
967,785,828 *64EBE092BA813859785C58D16EF9AE26B548E688 Ae3F:
967,785,829 *64E0F05FEE05E51496EC6511B39252A5F140BE07 Ae3%j
967,785,830 *64E55A2FD2502BA33A30D3E580BAB395093B2488 AE3OQ
967,785,831 *64EFCD98724A36F91C3AB0A1746645CB18F6413E AE=-4
967,785,832 *64EAF9229B313CA7650F7F0B00FF513C3F65B5E0 AE4#3
967,785,833 *64E557EFB9F9DF981C4928B8B66BB9A3BB4553CE Ae4#E
967,785,834 *64E03247711FE1FF5F0E7F39121DCCAB68D4CAF5 AE4Lv
967,785,835 *64E1A637ABE1A20548464F8E701108282C1DC194 Ae4r7
967,785,836 *64E21D9852260CFA5F01BA37B6212EBE3D55197E A,E50
967,785,837 *64E5D76761F10B83011A0873231E5DCDD90C72B6 Ae5$F
967,785,838 *64E5F0EF2C8CA94E300330CBED746959BEAF559C AE5I4
967,785,839 *64E86AF4C603F84941E8841EE975934323E9E465 Ae?63
967,785,840 *64E3DC2FB0107BFB81775EA69149886D321DFAF5 Ae6LS
967,785,841 *64E497B1F16F92AEFF2CE520E53639F11D97952E AE!6v
967,785,842 *64EA7FBC5CD2D9B45006223F1D7DCF6E932638B7 Ae6wR
967,785,843 *64E92C4CC58CD0D7BE4DD770ADB0E926F9358D8F AE/!7
967,785,844 *64E08888DEC0DD3ED63CFE936FBEFAACF3C87612 A;e+7
967,785,845 *64E3A1B833139086D39BBDB14ADA91DD0697EF81 AE76u
967,785,846 *64E06A170D54B137985AF84CD4D1E8371BE89BDD Ae7D0
967,785,847 *64E08610D3B048D70F05CD5468D5C33E9A4E5D73 AE7k=
967,785,848 *64ED8AB06487E35D0AE3911761FAECF84F4B36A4 AE7"n
967,785,849 *64EA4180B86A852151617E8EDC988FEF31E72144 AE_7T
967,785,850 *64EBB175737BFAD019858E00AEDAAC3396034CF6 A%e7W
967,785,851 *64E65C2ECCB9A5EB880CA0C4BFB51D916AAEA865 AE7Zf
967,785,852 *64E8C8F3C54FA7D1B0D97C02F5B860BC99B95208 AE;,8
967,785,853 *64EC46435E92D1019BFF07BE3F74C0D5F1495D52 A$e8"
967,785,854 *64E84983B3549ABAF66B914F12132E9D09837387 Ae8-)
967,785,855 *64E7D8A27B77C69064F2B558622327A912F34B48 Ae8/(
967,785,856 *64E70C7AFC1E6CBFE7FE654B2981E7DF9B933594 AE8e9
967,785,857 *64E64B178758453F417F2627E98B2BF092242533 Ae8nM
967,785,858 *64EA76C13FC443ED1E34E0BA8AB77C7243293541 AE9+,
967,785,859 *64E1BD6B075BB886A37FD701618DBE8D2C103652 Ae9/%
967,785,860 *64E35B3F00AA9EF35385BB70ADD41093ADE68B2C A:E90
967,785,861 *64E237C0B7A25308B9958AC745DF203C229B1F27 AE92g
967,785,862 *64EEF8A9698DA3D14C76889A3F0294C33C83F3FE Ae9FY
967,785,863 *64E6C54CCABA5E2D755262545C4E13898C27FE50 AE
967,785,864 *64E716C291F59F048C6B2FE3F91AFBCD5BCED327 A&e9X
967,785,865 *64ECB5BC6769607A79A8B5D43DE7A3B101E2CBEF A"Ea(
967,785,866 *64E05D9E2E70C317FFFEB738070AFB1235DE61EC A=e=a
967,785,867 *64EA120038BE02E8D33B76C07642370C499FEDB3 AEAbv
967,785,868 *64E02CE5220BAFD9CB8172865B863AC5727A17D2 AE_ADDICT_X
967,785,869 *64E17BDF2428C73921456BCD2C01D559DBE8909C ææf
967,785,870 *64E426977D7BAA067B4FA1423F69FDA2E4038BFA Aeaeninen6
967,785,871 *64E6AC28628456BB95A04E7569E1C7C8E2E315BE Aeaerdna3
967,785,872 *64E81F1E62207A677F852A5C4183239A06356656 AEAERIKANSALLINEN
967,785,873 *64EEA6E9B3411E257D55CA97AEDDBD19ED3E405F AEAFMPT
967,785,874 *64E9F7FB5BB6DADF5B379199BE6BDC69F8DAA057 aeagodnI
967,785,875 *64EC404F3955E653674A2362D8660AD1BFD9EBF4 ÅËÅÍÀ
967,785,876 *64EE6C797575A74B0C797C0C975F2356E563566A aearbafo0
967,785,877 *64E8A254DC21281B84880DA02366064D1FEFF672 AeasX
967,785,878 *64E967E9C0E5BDE7A295DDA821EB4F0CC0B78B7F AE,B0
967,785,879 *64E5908159A88D2180B0DFCD07832352F459E983 AEB5#
967,785,880 *64E0CDEFB62DB56E93971826E2E997F6175A807C Aeb5&
967,785,881 *64ECE964BB05971754DE287713A7291768ED043A Aeb7:
967,785,882 *64E2E7708621D379209035B1B62602938C9A763C aebaococs
967,785,883 *64E1081B4DFEC30F9DF1F813B4E4A6E7A8DB9D0C AEBBPMC81
967,785,884 *64EF5AD40F38C3F903FEA6F6ED1C5427D0F1F740 A(eBC
967,785,885 *64E31897CB87864D0391E1871A8CE118EDF63E5E aebfq0ce
967,785,886 *64ECB13DC1D7F1359EB64D609D2900C414101EC0 AEBJSLOI
967,785,887 *64E22692590E268F1208DCD1AD669D63DF560A88 ǢBKLYN
967,785,888 *64E3E63DE831672D44088D4050FBEFF2BF6EAEFE AE=Bp
967,785,889 *64EE28D56BDB9B3A8D611151728BF02937E5151C AeBr=
967,785,890 *64EE7EC25187EAF4A5DCEB4E3AC7D502DD003AC7 AeBrr
967,785,891 *64E0BBBD7C039771EE028B689CB070AE5876A8C6 A="eC
967,785,892 *64ED58D0F72FB0288251FA14F55E2728BB589F49 AEC1e
967,785,893 *64E73F1CDBDE3A5030D6B96C43E6DCA1F36B28C0 A_ECg
967,785,894 *64E3BF7364E93DFADC956039A13E3CA4370B2DB4 aecghzh1
967,785,895 *64EFC0368F75F7DE0C09916947B24415F35109BF [email protected]
967,785,896 *64E89057CB922FCCD45A4C06774C69097404502A aecidios+age
967,785,897 *64EA8F70D1F5DFCFD7AB537F293F2BAF3BF7B918 AEciZ
967,785,898 *64E0A3826CA65537C7A97F88505D1CCA8ED40584 AeckK
967,785,899 *64EF506BF34A11EF443E69144110755D4E44DCBC aecomics.com.br
967,785,900 *64EBB797AEEDAEE26096CDF3A1257FA2F1838411 Aec:U
967,785,901 *64E3A360F8D41AD271856C48667E9CBAAADEF4E4 A)eCv
967,785,902 *64E0C1B6719FD32017BD9F4AFB22702E89A14954 aecvchd4
967,785,903 *64E7757004754F438C2D06D7A1E1C325E83726F8 AEC可透过astro第301频道收看。
967,785,904 *64E1C2293BBB28EF5DD93687E3597DD4268BE253 AE&+D
967,785,905 *64E5339364342C3D642BA8535B4A9734DE1DC5B9 AEd/?
967,785,906 *64E83EE5BCAC23DF8E79550ABE5BA23815F8A810 aed0.272338571
967,785,907 *64E9D7608DCFAE3383400DE3269295791F177FA7 AEd2O
967,785,908 *64ECC57CE9D5698E96CC474964B0CCC87050E326 Aed3,
967,785,909 *64EA919425CEC6E9BA65185C1D6B7FFC44221942 aedan932
967,785,910 *64E441F55BB14856B35029FE0D07930E803B9226 Ae_DC
967,785,911 *64E6888CE395BC5A437D7FBF6C20A9EDCE80EF82 AEDCh
967,785,912 *64E65D09815ECA67A7630BFBE5C04A8C2D5B0EC8 AeDD+
967,785,913 *64E1694C8C31F76E8A48F3469CB61285207D15A1 AEdGh
967,785,914 *64E4F3F885BFA167F90CE283BB724C32E602EFB4 aedines3
967,785,915 *64ED6355EB435E5BD6933D43ED2506335580A8D1 aediolun2
967,785,916 *64E5E6C87A39BB1A637BB9877DEB9FEFF08E8E3D AeDm-
967,785,917 *64E102408D10ADD971383C0A30144B445AD4EFE7 AEdN6
967,785,918 *64E874270CA08AD0370E85BFBCD556EF4C2920F9 AEDNY
967,785,919 *64ED75D0A0131321050896CC8CEBCF1C44FE30F6 AEDsl
967,785,920 *64EF60CA2A2E1889D04876953B83071695FBBC92 æðstuprestar
967,785,921 *64E4203018B5899A408249C88BDA6BE433A3B525 AE#dw
967,785,922 *64E53A4DA53B620D3051854B3E5CB43689DAE065 AEe".
967,785,923 *64EC095BB90BDAA304BDBBE2D28BCE8F45B80839 AE(Ee
967,785,924 *64EB3EFEE603AB20A626442AEE058D08E5F76F38 AeEEM
967,785,925 *64E3CDCDCF3AA47FAE6ED943E887CE5E15B3EE50 aeef18ae-e78d-38c4-bc2d-6a63af6da4b4
967,785,926 *64E79ADBE09E170123C6BC96F3B210E3D10FA23E Ae#eH
967,785,927 *64ECD4D8CD571FDDD26362864F41B1CC8F390160 AEeL7
967,785,928 *64EB50816FFFB9EEDE7D6A7AE5108B05F1B5CFC7 AE?En
967,785,929 *64EEC5CF5D0CB69BD3F3D2529CB29FD6BA2DDF93 AeeqF
967,785,930 *64E6E7A69ECCCA9168EF28F1D6E4026BB1AD33D6 AEE#s
967,785,931 *64ECB609A82CD002ECE083A69159AF1837FB99D5 AeevS
967,785,932 *64E00FA47EF163468C47F95F40335A901EE5EA73 AeEX)
967,785,933 *64EF28E65EF5E71BACE8323E4C7CCE0CF8357762 A=eF
967,785,934 *64E9A119F8C97E50C9E5FEF46BD42027DB5DF931 AeF3P
967,785,935 *64E952B4F0EE43318D5F3211A3A1E32ECF524BA7 AeF5)
967,785,936 *64E13F692F74D233E43DF0FDDB0CFA15B0294E9B Ae(fb
967,785,937 *64EA2DD12592428C3D558C01867788B5BF9AC453 AEFBB
967,785,938 *64E613E66B9AEF719DBD3D5B888567FA9987A725 Ae=fD
967,785,939 *64E75E67A0E36E6AE09DC3248033B044237B739A AEFDt
967,785,940 *64EF0357E369B69FE776BB391C324896DF4ACB28 AeFHC
967,785,941 *64E846087DE06C2B6D949927034BC891776747C8 AEfi8
967,785,942 *64EBA20B17F229CDF36701AF3AF4D59E72DD631D AEfl7
967,785,943 *64E219ED98583BAE04F695BBA7684DFC160CC2FC [email protected]
967,785,944 *64EE91266E7128AF0F9EB1C4703366DB4CE95193 AEFQn
967,785,945 *64E18229D56440369002429CE456A149DAC4BC29 AEfs#
967,785,946 *64EEF43AFA022124FCE3733E43D8F72A87557947 AeFUs
967,785,947 *64E086B62379737BFF998AFB5098DBCD0BE683AC AEFvV
967,785,948 *64E884BCEE59FCC18152010373E4B4AAFB2ED034 AE;fw
967,785,949 *64E6F87F593DEE9D82B40F5873186660C14A4FBA A.-EG
967,785,950 *64E27E5B2291A2775891A1C7948BA08B19353FEA AE-=G
967,785,951 *64EC8ACDC5FD06D4DA7FE2350AA7712DF0AC0634 AEG+-
967,785,952 *64E1154964D9A8FAAEA6B4A63F3B2C074D789EC5 A?(Eg
967,785,953 *64EFDDBECEA406FB6E75EE6E7B16FE475B846CB8 aegaeoque3
967,785,954 *64E2D52A1089DF4719FF811CD66BA028070B2202 [email protected]
967,785,955 *64EC48508396B6187D90D8E0B786479B5F87126A aegean lore
967,785,956 *64E9C37324A939809D68A2C1774C4459B8FA372C aegeantimes.net
967,785,957 *64EEB6149C71B86B07303906526155DA006E6977 [email protected]
967,785,958 *64E8F25F192FCA5C6259AD4D8C5FAB3EE96A7260 AeG#F
967,785,959 *64E34790C58E0AFB97FABFFADDE6D1F629C8581E Ae"gh
967,785,960 *64E7AD2E47561D4FFF6A5994884669CB344C5CDA AEGHL
967,785,961 *64E0D856F09E4175CAA80DCE7CA4CA5583DD1B68 [email protected]
967,785,962 *64E651D821FBF385BD920F9A6C83D0AF0B374E6D aeghwelc1
967,785,963 *64E767C4939E0C02F25B4CC544F75353E76F0560 Ae;GK
967,785,964 *64E200C7401EEE8A2B53CB45101E35D287AB057D aegksgm25
967,785,965 *64EDFA2513D5A395A35DD6B2D5F0D96DAACAFF44 aeglagering
967,785,966 *64E6408A4174986B075D9226E4C780281FC750B8 AEGLALIVE
967,785,967 *64E70EEC31191C39D0A1CC4740CAFD3031FD4FE8 AEGNZ
967,785,968 *64ECC6B092E3F962E6ADF16EA17651C004B477D0 Aegor
967,785,969 *64E70FC2BFB7619E601174567F848561AE100CA4 Ae$GP
967,785,970 *64E685681E48C4930A2F5419D592BFE7D63DE69F AEGTa
967,785,971 *64E4601E9416A1BD597466D01B7DD23F457E0F10 [email protected]
967,785,972 *64EC139EFA641C987205570041B023271BFCBA09 AeGVY
967,785,973 *64EA9737337D8DA18CE8CA14C2B731F81F51936D Aegyptered
967,785,974 *64E325F01350F67255F7C5EFE3FABDC1BBDD16F1 Aegypti
967,785,975 *64E6AA1A74D1F79B43AA11A0C28F4E5E0A51DFFC A,E
967,785,976 *64EBD66D868ECEB43D198DAE5057C55AA701940B AEhba
967,785,977 *64E5040E6424D8922355DC1B1DB94F7B30671F90 Aehbobcat0
967,785,978 *64E8AFB29B89A4EBD8A23054130F2785F134972C Aehcanelaed
967,785,979 *64EDB669D80EBAB89FE160E4E04B37F1864B5D49 aehcurtis3
967,785,980 *64EFFCD3F39777A47A128DBD5A339A5CF5344946 AE=HF
967,785,981 *64EAC02FF895F911AD9E6F46075A9858AFE088CC Aehfender
967,785,982 *64E70E7321A1BADD26DD8DCF17C764B593BF8EA0 AeHG;
967,785,983 *64EDA2A40FA47709AD402F659FA6E033F25E6A1F aehgerman7
967,785,984 *64E969C98599C26A819389ADD3E91733D15B0BF1 AEhGr
967,785,985 *64E6E9311C9BDBD8ECA8DAED8041D14C0E1960C0 A?Ehh
967,785,986 *64EEC1DB08EABBFAD44A90758BFF82C7F1E9387E Aehhw
967,785,987 *64EB04816EF57954EE0B55A92B9AF8D3179AB066 AEh(K
967,785,988 *64EC4FEBBECDA6EBBB510A33D305499473351397 aehkittened
967,785,989 *64EDB8E89D97689F57E32490EF81E184B898C306 aehlamer4
967,785,990 *64EDD3BE0469A22353C3ADAE3E67A4C2E35FF565 AeHM?
967,785,991 *64EF0E6D61C8022313A8AC009D6341221064B8C2 aehmantraed
967,785,992 *64EF7635A2914BE53A826FCE512B884BCB047DAC Aehmary3
967,785,993 *64E350B3D69B315F71589317139CD6890320BFC6 aehpiano8
967,785,994 *64EF43594799C2050F57EC50340FC76F6F0F4675 AehQ
967,785,995 *64E16AA408896E66BFE6D453BE5F30B3CD606848 AeHqk
967,785,996 *64E654B54C427D7CAC49C3110B1C2C6C968DDBCE aehrroyp0
967,785,997 *64E54BAADB797C21F0C680A3195E46011542A649 aehtevir7
967,785,998 *64EE6C00A6A98B65D885DF4164D91E0D021E5A80 AEHTNYCAZ
967,785,999 *64EB5004D3A58F7C655BB24B67EABC855808CCA3 aehton
967,786,000 *64EBCA76AADAAFEE4AD6C1225E3A2808193F7F63 AeHV7
967,786,001 *64E834CE69DC44A4B6719B0247AB19E033F36F4F aehwatson9
967,786,002 *64EA2338A4DA6923767C0FBF3FA5D31693270892 aehzenithed
967,786,003 *64EDC0C1C466DA5E7CA0AF01CA4E60364E48C3D0 A_EI$
967,786,004 *64E4DB3977A5493D74E5C678DF730BA696DFEE71 A
967,786,005 *64E881D1ACA3362CD322AF5168B6564729B817ED AE%i!
967,786,006 *64E27A08BD00A8692DC869848FE1A60F8B5EA1CC AEi#1
967,786,007 *64E9F1925477AB51189F2398AF2151DDE646E43A AeI4-
967,786,008 *64EE6753384AD4FD6BF30DBEECF335375258FA7F AEi9?
967,786,009 *64E8EC87F67309E95E3CEAED2AD4B0D293E206E3 AE;iA
967,786,010 *64E09E593EC9E309EBEF2F18A832AA559D2D6513 A(eic
967,786,011 *64EA8719332F5E2BCE43487242621995571C1EA9 AeiGt
967,786,012 *64E6ADCA4621DC142C89DFAEC20FE8CD5828850C AEigw
967,786,013 *64E236619623A5A8C316372BFB121405C5ECB8DB AE=Ik
967,786,014 *64EDBBB0A0006E1C61AF46E9A20C5F4AD66D14EE Aeinen
967,786,015 *64E88621AFB30ADD0B7247E16EB4D7DD4F17A846 A#EiO
967,786,016 *64EB8B49FA98EC7FDA9153D5294095E77FD77245 A:Eio
967,786,017 *64EEE31D237F55EED872E502AE3B26268ACC6A96 Aeitikin3
967,786,018 *64EBE50F1D0D4BF44F0FB2A47E24D63E1E0E73FB AEIwB
967,786,019 *64E3290043FF57FD2EBB349022AAE51E0781C78A AeIZ?
967,786,020 *64EC589B5FA99B4BE4278651430438D742012844 A[Ej
967,786,021 *64EAC0AA01AC5C7A33C272379275C05948982CE2 A+#Ej
967,786,022 *64E55510755CE7365F96A830BCC9884448D9B3DD A&e
967,786,023 *64EC9E1E49A74803D704BBA73D215598EB61572D Aej!#
967,786,024 *64E067BAC4C72BDB11E11B56B6C451FBF6E9063D AE+j6
967,786,025 *64E3A9C23EAEB5369D11B79D5BA5301EFC745C8A AEjbl
967,786,026 *64E0E7DE18B3A1CCEB9B5A80548E643265960E9F [email protected]
967,786,027 *64E96C3C6D404E949B8CFF288A56F4AB08761D83 AE!%K
967,786,028 *64E70487A2280450AA2E586DC75ABE8EA4F9E940 AEk_(
967,786,029 *64E8FB87784D97FECA3625ADF06D7F64DDB3525E Ae!=k
967,786,030 *64EAE218E1CBA66BC5C4C6CE1E870FE751DF8E48 Aek1s
967,786,031 *64E65D9A529B25E7B24C960302DF102B0912E1EC AeK2a
967,786,032 *64E944042E561282DBFFFADA014EAF60F72AC7EF Aek6"
967,786,033 *64E1A153517C8E2C773971AEFE65DFB5B36E6B45 Ae#Ka
967,786,034 *64E816BD6D8CDC73E22F765A7E38CA1D63D953FC AekA&
967,786,035 *64E107EC1F484E5FA574A79704825D29B9DBB699 AeK$h
967,786,036 *64E6E26AEC35CF66E165A912F422B5F55F5F0AAA AEkm
967,786,037 *64ECF27799140A45A5F528C952F73CB6889C12D2 AEL/?
967,786,038 *64E6A30FD9899AE0674CF8E462CC744A09F33CE5 A/E!l
967,786,039 *64E20BA4BB03F7EFDC7E095E02ED0A4757C81ADB AE_L0
967,786,040 *64E111F0D88E65B5007575AE809EFA7BE5DA3E8D AEl0a
967,786,041 *64E9F043712742B7A4473A255A39656290E8C075 Ael7k
967,786,042 *64EE727A41660CD7BB0CE848330E66D50FC4DB27 A,ELa
967,786,043 *64E7CD9D4883F68AE2A10B02992C4B9E300B02FA AeL"a
967,786,044 *64E0D8ADB62ECD93CCFBCE11F7BEAFA903D33A09 aelHam
967,786,045 *64EDC09167BD8DB920F533563B922D07A1331442 aelpretni7
967,786,046 *64E3AE946566E4BC6B11BFF3FD46C36BCAD579A2 AEl
967,786,047 *64E5D9176D9437043EB82B7EB58EE45B3721D55D AElvenbankje
967,786,048 *64E594913B4CFBEF6976255ED7ED013422106EED A.E-M
967,786,049 *64E42C03C9D87FC9C801CED510C47D7B100FF814 Ae
967,786,050 *64EEE3525214530FD86FBD1FA1FE6B2B31725A4D Aem!;
967,786,051 *64EBA5886FA4AF16FE3A1F9B139F92330415B2F8 a$$emb1e
967,786,052 *64E5BD72B7DFFDC6C4D1DF9C204220661AC0C3B1 AEm
967,786,053 *64EDDD809421C3B3565A3170F948165C35B1CEFC AEmeg8DM
967,786,054 *64EDC36CA245EFA19974E49B076E7AF9F0F1EBA3 AE/mf
967,786,055 *64E40CEA1E65E1F286F976FB7A0F883F4750C5A4 AEm&f
967,786,056 *64EB3546DEDF7CE682BE473080CC0F997DD00D2E Aemgh
967,786,057 *64ED1ABCF5B76B8B000DFFAD157856D806D4616E Aem?j
967,786,058 *64EFD1F431B8AFB2ECC63065E69B2E177858A22F aemousok1
967,786,059 *64EF097360FD1518ABBFC198DF145C915C5ED198 aempliga8
967,786,060 *64EA73583AA8A29A60E078003F020457711A0241 AeMS
967,786,061 *64EE5F772BFD4DDDD2707D9BA60028631B4BF425 AEmUt
967,786,062 *64E03F752949834F888F0F39113D25EFC0E259AE A$Emv
967,786,063 *64E3B1051E46CD9DEDA931248A1FF1893D8EBB73 A=E)N
967,786,064 *64E1ECD73EABFAC62BE81C6E99323FF74484643A A-)En
967,786,065 *64EDC99299AB8994153F6A6A748D34D3B85E6ABE A-e_N
967,786,066 *64E1A23E92AA1A160CC5C8030E849A64E802EBC3 AeN";
967,786,067 *64E2554D36E9828CAE7D8D51987A5EC2EE3272CF AE?NA
967,786,068 *64E370705522FA0F75F249BC74A81D2D0899661F AEnA$
967,786,069 *64E96757064021EF05E9C78F34CEA872CFBA218F AE;Nb
967,786,070 *64E9589BCA5E1203295D58672BD0F6F9BF245561 AeNbt
967,786,071 *64E09F5D9A7E732B2D2C384782ACA06A310A171D [email protected]
967,786,072 *64E47D018D1194407302EC86C200F5F6A7881B8B ændringe
967,786,073 *64EFF963530715ADBF0C419005500918F0D06B00 AE&nE
967,786,074 *64ED357EA5C09CD261699D81C53AA7E46871BBF3 aeniviob0
967,786,075 *64E2D0DC8651D3AD40D3ADA86E3DEB00E8685035 Aenk%
967,786,076 *64EA5F3F4CA7E5E9CB43BE7B721304B8BF3E0994 AeNkt
967,786,077 *64EBA9B9F86E27BEBC0CD42F22B5B7A1D114201D Aennmrke7
967,786,078 *64EF9903953130AA30A61C4B89031F4538392E2B aenomens1
967,786,079 *64EEF29CB5AB3D7C9A23F6FD08BFE121BCEEC5C7 AENPP
967,786,080 *64EB5839E5A939C64E479753CDD98DF2A40F6A13 A?enu
967,786,081 *64E5B371E3CE9AFE7CDDC5BA313B9F4C38D512CE AenW#
967,786,082 *64EB9E00A807CFB637D13F8CAA95371C24C1406C Ae!nw
967,786,083 *64EEA344A016C1CEE23C30E6FE31F7A20A8CE055 A)EO=
967,786,084 *64E4683A4047B4119AAF1557A5B46B412C5548B3 A+Eo-
967,786,085 *64EFD7FAE9F8FA9D31A31E0D9C88F32B54CC6147 AE,o"
967,786,086 *64E29A241003211080D682AC5BB435717B37C0B2 A!!eo
967,786,087 *64E08FF40C8AFA530B6E00699483254AA03E196E AeO.7
967,786,088 *64EAE290A08940E6C8AC149FB19F4637487A744F AE_o9
967,786,089 *64E1ABBE599AFDAC82699F1F8BDA4575EE43CDFE AeO=9
967,786,090 *64E2DC2E0B0E10B1C062852FF748151785FDE567 Aeobppw4
967,786,091 *64E14B015B68B22A74D218348780E6D4F5D7028B AEOFT
967,786,092 *64E9BEC08EAC5F14C6FFF62C4E2977D1765E3490 Aeogaeaning
967,786,093 *64EC8067465363F4EBB563047992EC04DFD32D94 Aeohrrai8
967,786,094 *64E7F28FCAB48305884ACC848B1A3360E464FC44 AeoT)
967,786,095 *64E69DD5C19E3401AAE5E4D29F4157E943EE2476 AeotT
967,786,096 *64E3A3297D4119BFCAF01DA4B81A20529916FF64 AE!P!
967,786,097 *64E0783621C3787BF5792B1A02E472C0A0662ED2 AeP7/
967,786,098 *64E1D9BF15934437A007D982064DA3EF3526CFB7 AEP8v
967,786,099 *64E2BBF2E77FDE01E6C04DF066A82EE8A166512A aeperate
967,786,100 *64E8D4C967EC5CA1C25C73DEC8329A7CFA8889D8 AEpfb
967,786,101 *64E9D03BAC2EDC3BFCDEEB4F2E01117E8BEA9B3E AEphY
967,786,102 *64E9B4DCF2D692F51467CB4E5CDC8EAE1A194BC4 AE.Pj
967,786,103 *64E9786685634AB9A1B963ED7E8986F7CF75FCD1 Aep
967,786,104 *64E940D532AFDC7E2688E2B2EA4D01C2CA799674 AepOk
967,786,105 *64E0A177B4F128C6D4EBBE1FBC75C18573BCF10C Aepot
967,786,106 *64E84F9E0096CD249B4524FCF3F7383505A5687B Aeppeler4
967,786,107 *64EFE3B0A29DF841DDD3246B63BB7E92DBD561C3 Aepyornus8
967,786,108 *64EE8CC6EC57B3FA7289B59B7C6E90104464C315 aepytuS
967,786,109 *64E4CECC7D47D0856C94D66480CA64AC84574455 AeQ=
967,786,110 *64EDEB75B163245586B12E8BB8B532CB264726D2 AEq-4
967,786,111 *64E429E901F43971708EFFE80296367BB8864AC3 AEqf"
967,786,112 *64EF7D13DE1C0ADD28CAF946137DAD62FE13B8CD AeqIm
967,786,113 *64E6BED67D50B0C82665A0DFA5A474C62C04542A AEQnV
967,786,114 *64EC8926945028C010F07C1DE0FA20BC60539D75 A#eqo
967,786,115 *64E69642F3DB145138B0BE8DFF9C35DD34125823 AEqOa
967,786,116 *64E56E66A95CC3617F32C0921DE466CACDAE53C6 AEqoL
967,786,117 *64E2D690540491BAAA52B27E32FC1CE49D535990 AE/qP
967,786,118 *64E31F73774AABCB0D524057A0D73411DA68D59F AeQRQ
967,786,119 *64E743D8C3B1F105E4ACD548980E9A4328BD6E7F [email protected]
967,786,120 *64EF6B44235E8209C504E62327D2AE562520993C Aequataing
967,786,121 *64E214180DD53BF7A5A861BAA1FEB3B8D1FFDA30 aequatorensis
967,786,122 *64EB6D8DC2E0BA2292D687C9CD87B83B592939B9 aequipuncta
967,786,123 *64EE73B17DA637E3E3D4616CE8B173C494CA7E67 AeQVT
967,786,124 *64EFBDE4DA62B1526C6E822B48E094794EEC8B6E AER
967,786,125 *64ED7AC1B2B8A1E8E818F09F16A70199CBC43EB0 A!Er:
967,786,126 *64E902A2343765C7CDCF78600C808D6E99A2F2EF AE)r-
967,786,127 *64E77A30353DC08CE5B462FE27F8B4ACA7783065 A!eR9
967,786,128 *64E770FB99E8B316AC40A415F5D0855C7E87D26A A.eRB
967,786,129 *64E8025D3EFFC5363F508F7E68985C9166B2247B aereaaerea
967,786,130 *64E068A3EFB709DA1772FD609B240D90F85B83FF AE/RI
967,786,131 *64E0BBED56886DA95D1E019EC36DFBED08E12EB4 aeriabsw6
967,786,132 *64EC995ECB584FD75BDA1BA27C8B0C9999EF86C0 aeriaquE
967,786,133 *64EB4A0EF28BA6B1CE40592B8B52420FCF42848C aERIElA
967,786,134 *64EAE3C2AC88365C7CECC84DAAE0266D9614EFB4 Aerlen
967,786,135 *64E8E9A07CAAAD0C31AA14CA81118D7078799301 AerMet®
967,786,136 *64E33FB18FB098C467F49A97255AD81F81784FBA aermster6
967,786,137 *64E31B4BE0B62F40140B85BCD2D81545BC0FC90A AERO8A7IC$
967,786,138 *64E4580E398E4306A580491B3E1C45DC72473429 aerodynamics.proton
967,786,139 *64EB73EC3081F7EE24D5AEA5EF62AC827951858F AEROLINEAS-ARGENTINAS-CARGO
967,786,140 *64EE09FDF337AD3C5F4F00C819FD46F0E15EADD4 Aerolitics3
967,786,141 *64E5BD7CB6E71614CD54D1A24E476178FB4B28CD aerologation1234
967,786,142 *64EAFFC392C1F25749A8EE9C91215D267D9B3B0B Aeronauticallies
967,786,143 *64E275F25200F716CCB41A31CE830709978BEEA5 AEroO
967,786,144 *64E924022BFB72DB6697423E2726AE0CD421DEBE AEROPE7
967,786,145 *64ED3A7D30585BAF2D0D1C435970EFDE5A55A7AF Aerotceh2
967,786,146 *64ECAAF40D1BDA9483E23AD44E21A014C3E423F4 aerowddm
967,786,147 *64E1C1D775C12EFB0AA6E33886AF60E039E4A9BC Aerrechts
967,786,148 *64E41E905CC2BDE35ED6C55A654EB9E5F95DA889 AeRS-
967,786,149 *64EF701D2BCFCC074484417D30C68AEDA05B99A5 aertigst6
967,786,150 *64E5FF43B35742202B9CC0D45D2A8A31F8895D5C A$$ertin9
967,786,151 *64E660026F769450C5BA92B6B392523B683B6438 Aertyneeted
967,786,152 *64E860BC1B10DA4D8717AD3F60A01CB08DB47C93 aerupuertos
967,786,153 *64E251850034D721DAB7FC85B133A1AAED59BED0 AeR(v
967,786,154 *64E9BBE80C7B6F7D25D21A5D93B28FDB6B04AE9F aerzteho2
967,786,155 *64E22826A10C135114760A576A6151E2BC74F53C Ae="s
967,786,156 *64EC71F0E4657EE350371B2371C0412E5481A20B Aes0o
967,786,157 *64E2561CF06EBC469A1D8B657C3656B27DD0B237 AEs$7
967,786,158 *64E6A861B6EC94F0CEF962974CF5D5B08CAE6F11 A!Es9
967,786,159 *64E1C4310ADDCAF63CEF0A8689B576400A446A38 A!eSa
967,786,160 *64E22923610609DF0392237E4BBDE6696D7C51A9 A
967,786,161 *64E05968D99CBF525D41963DE85D5D28F2E5A5A3 aeshmas4
967,786,162 *64EDD3B512EC8BDDCDD748B8BFE37D6F4ABD6DBF Aesigsting
967,786,163 *64E374EB8D723753E537F86CCD991314065EDEEE aesnistd
967,786,164 *64EEC815BCF3617F3FA03076358E1DA265B1D104 AESRSF
967,786,165 *64E9C4EA181173EBC3D6E39E99D99338B84E8B0A AEssO
967,786,166 *64E6D6345820E0F163B2BA5A6BAADE22E6FAFF2C Aestethic8
967,786,167 *64EDFA43DCF4BB13395AE6684221F11BF821BBA0 A.ESV
967,786,168 *64E29F27A1F1DEDE410E73E91847FC63DAADF655 a.e.szakiel
967,786,169 *64E44967A274A23DA4038AE8429BD17C14988FA7 A=E;T
967,786,170 *64EA04829479E50E17CF2F5FC863482DED054E47 A%ET
967,786,171 *64E7B7DA8319D49D7A5C7AB4D27BD932B883AF87 AE#-T
967,786,172 *64E8ADB329D3E32FA3B18CB5DF948355BE099968 AET:+
967,786,173 *64E0EAA2886C006728E461550B2E1B71837506BC AE-t;
967,786,174 *64EE0582C4CDDD8A4915D342D6E9198918812497 A&e/t
967,786,175 *64EAC4B6B87D08B39C7FEB5645C0CD76A08DC7CD AeT0e
967,786,176 *64E74CB2620437112B620C761F58462E7E7DF4D1 AET_2
967,786,177 *64EE56DD392822212D10E65242AF1087817129FA A=etA
967,786,178 *64E327643BF7617C37BB25243B848EAA7A6830B7 Aetabrab
967,786,179 *64E68CB7239AB08AC2DF6B5767A6622C20FB24E3 AeTDM
967,786,180 *64E0347604CA0F7C56823E9B5B8BC60F9F70B061 AetGX
967,786,181 *64E24D76C1DDF4F89A2F2C8FDFCA902277BC89CB AETOLUS?
967,786,182 *64EEA04D4D6A7A186EDC3EC8338EFD8150F08E90 aetsoele9
967,786,183 *64EDD62F7C67298563F7BADBD6814A73999B224F AeTtt
967,786,184 *64ED64204A6C21DD9FBD57E096D9564B1C0245BA Aeu.;
967,786,185 *64EB7B79CBF8A8DBE8D365B1DFA2A2DC78167FDF Aeu03
967,786,186 *64E14D3B19DE199CB54308E17A0B8218130BEA5D AEU&9
967,786,187 *64E4DA866AC917409D3B9C9F0F919ED713F53452 Ae&uG
967,786,188 *64E841D39A5A6DFA1F80D892F6B7130809330712 AeuIa
967,786,189 *64E4F60F77EA01BC0EB21805CA54034EF2644158 AeUIZ
967,786,190 *64E887344975228A5E6D55A498D9E6323CA33493 AeuO(
967,786,191 *64E9852D7ECBCB3D0ABB131C5E5F3FA413BC3508 AEuVD
967,786,192 *64EE1DAA336D4C23CDA19E0410CDB118A73DAAC1 AEvBm
967,786,193 *64EDE59AB991157877A506CB37375AB968C4AC24 AE$vf
967,786,194 *64E7A782F8DEDFE276BCAD9548D5E57343721339 Aevitatem
967,786,195 *64E8222F9689276F821D1D9AFEA53E6D7666A25E AevkS
967,786,196 *64ED4927C2A8CF0994621245719141E36E6C27AF AEVm7
967,786,197 *64EA27CF823B914FE95FC1430308BE0840AC7A77 Ae!vO
967,786,198 *64E6313877113738CAF475CF4EC9AA51C0EC666D AEVQ+
967,786,199 *64E0D2A230B21E70DEA99108850651DE0F28FA93 AEvr&
967,786,200 *64E43B4B5097108FC0B4C296BAB45295A611556F AEVS;
967,786,201 *64E74D79920A311D8B70D28E9C476AE70B0BE1C3 AEvs0
967,786,202 *64E3BCB60B88F58E8AE585BF0A66EF74ABD647E0 AeVsn
967,786,203 *64EDD223F45938CC53D057594F9786966EBE5C9B AevV5
967,786,204 *64EBA94E8023D5EB5D0D0E238FF83798D4B52C8D A)E&W
967,786,205 *64E0BC371A50EE54E9692A8137048FD1D6E35AEE A"e"W
967,786,206 *64EC4A0C26C07B70D86B7BEDBFCA154511E74B00 AeWb7
967,786,207 *64E716567EA2381485722F1E62D8C2E58D695465 ǽweard
967,786,208 *64E4E359567BA7AF05959C9EF37EEE6C78C526C4 aewhvny39ur8v78mu
967,786,209 *64E43408674FED5605C01DB239C91BFF0B95A0C1 AE=Wi
967,786,210 *64E768E0E17B1B021393EADE5CA7D8B108B05F06 AE#wK
967,786,211 *64E3FA95F781EFA8366BB3993BCE2F1E6E239016 AewKf
967,786,212 *64E78FCCFD9261153C0EFF9279BB664871D2C32F AE"wN
967,786,213 *64E6E204227CC7B796DA2F80481C810AE92856FB AEwQs
967,786,214 *64EF7FAB47084F6FE031EA2AD3D050E6D1242822 AEX-=
967,786,215 *64EB3C82515EA7947B4048CBCA3568FA6E2057FA AEX1X
967,786,216 *64EB46297033C9BDDBC95EAE5309F18B4103634E Ae/Xe
967,786,217 *64E629C22C7E63DDD96479EFECCA2F7CEDBD8C33 Ae;XH
967,786,218 *64E179C6447122EC5D28FD6F86C09289BC47550C AeXUN
967,786,219 *64E0B84DF753610A6742B912B3E819DAAB17AD26 A)!eY
967,786,220 *64E66A48B53EB7107DDDFD5EEF48BC007C3F9179 Ae,Y/
967,786,221 *64E5160D47E08E87C2ED5A8169D336BAEBFCFC80 AeYAb
967,786,222 *64ED74B6095590CA96B6BCAA01787DFD971F7727 aeyazgan
967,786,223 *64EAF85251EA47DAB322D845088B56C48BC8CC24 AEY.N
967,786,224 *64E3D74E787669201FD740D78565E6BD696310A1 AE?Z
967,786,225 *64ED650800D2A6630EAF415634D476F133709C45 AEZ:+
967,786,226 *64E3A8E0D832A5FF92D55BC44EACA1D25C5FDD28 AEZcG
967,786,227 *64E8FB7A1D7B92485E018D6BA760AD61FD0710F9 AEZK"
967,786,228 *64E2CC1E2E63ACD79A9FFFA0AF88C9CC8A2F624C AE"Zk
967,786,229 *64EDCD69716C721D95F77B896E72FBEC1404EB2D AEZm8
967,786,230 *64E6D7D8C192A5A6A18918D474C5E9079DD1E392 AEZuu
967,786,231 *64E85F15743F4DEBC2EB7969EC01782BB24E2008 A-+&F
967,786,232 *64E326779C784F257515DB922FC58F022620254B A?"#F
967,786,233 *64E45DA04EEE0243FC9DDE3D95B9CF0D89EC357A A$#F
967,786,234 *64EEC2199C7DCC710C0ACD1D1900D07F640E2F1A A&
967,786,235 *64E2ECB276BCC332FA71D21269E637723FB838D9 A&F;"
967,786,236 *64EE84D2D85FADCD68BC34F5045457D0FEA38B00 A#/(F
967,786,237 *64EECD4CEBAF7D85C7B12B183BB481C60D288FEF A#$F&
967,786,238 *64E3C628AA72D4022799048F87B2FAE06907A85A AF/;+
967,786,239 *64EA2F33035D824DB53CFCC27C27ED031E5D0A18 A!(%f
967,786,240 *64EC367AB1F6F3770FB06C77128196C4E438544B A(f&(
967,786,241 *64E1337D6853C788CBDD222A5C81E85471591668 A%f="
967,786,242 *64E93F898969547DF344C1EF682BF72F5573ECCB Af(/
967,786,243 *64E95B71EC8382A01E97CACFB237BA3CFA82FBA5 A+F+0
967,786,244 *64E4E2E4DD8F31A8EA69703CE1492C7F019AA0A5 AF0+%
967,786,245 *64E58893EE02B50A10309C120F2A4A2F87F58208 Af0?i
967,786,246 *64E3C6E9F4425E33990DD7453405ECC6C4A2CECE AF0uA
967,786,247 *64EA238FD36FB867A69FE0938478A40EC1D15A2B AF0vZ
967,786,248 *64EAFD365E785DE78BA07E70CFA607A28D939BC9 Af0:w
967,786,249 *64E58C91DECE6D5348CB9FB7C9BC19C3F6E1AFA2 A+F1
967,786,250 *64E9F02EB1E79E6F1D66960BA4A00DFED496CB49 AF1588
967,786,251 *64E13E270E1FC3E792A1512052AA331D9D853CF3 Af1ET
967,786,252 *64E429CA13756082B3E6159F4FAADF28305E6974 AF1%h
967,786,253 *64ECED7E701454C6E6497A158C74EC52EF1CC96F A_f1Y
967,786,254 *64E06FEC018C58798785C53AD6FAAAFE76A053FE AF24–135mm
967,786,255 *64EEAD9C864E80024FF58BC3C6C1323D7145FA04 AF28–80mm
967,786,256 *64EE617FB51D2C8597584AC8CE938F4179E867CE Af2.9
967,786,257 *64E38FE82927AE88F47B76CF3236B55A3550DDC4 A_F2i
967,786,258 *64E189C5E18E42B9894150C71F64BFC1127E9D79 Af2K4
967,786,259 *64E5622D6A6F36A98FB515E534ADB4624E226225 AF2X3
967,786,260 *64E5C4ED9250406DE559C6C3034C459E3C51EFA7 AF3_!
967,786,261 *64E57A7F412FA986308E81CACB8ECE98FE01E072 AF30C
967,786,262 *64EF65669B9BFB27731182B8074F3FCD0DEBF509 Af3!6
967,786,263 *64E03B05A6523DD96EDF9649248FDDDAE178E722 Af3l:
967,786,264 *64E712E1EC470F439438405719ACCDF36F4D8446 Af3T:
967,786,265 *64EBB24A731205E5BE8E6728BFFB75AA81C3CE94 A-F3Z
967,786,266 *64EE79F1FE285CCA706D273781B2DAFC0D4AB5D3 A#)f4
967,786,267 *64E6F06DC22D551870A788395653E98A7669DE3B Af44&
967,786,268 *64E308A8C5006A561D921B883D63C0B0BFF47EDA [email protected]om
967,786,269 *64E8DF8CF46A2E46AA0E26AE05E2564C1A0B8D2C Af,47
967,786,270 *64E0A3D38E734D2BF1B854CF8B05F9144F18BECE AF48t
967,786,271 *64ED27925EB5347B688F21414F66DA9D3FE5022E Af4BP
967,786,272 *64E99B4E7E05D428B37FF2F36329C2E38D17BD65 A!f(5
967,786,273 *64E3FF2B6D1AE765A9EDCD7F49C487D7AB8D86D9 AF5BU
967,786,274 *64E637ED241AC3FC13B25BE8F3AF254025831137 Af5kT
967,786,275 *64E294EA9BEC3EDD6139E7BE5798FE5F83EB279F AF5os
967,786,276 *64EE1B3A9783604BA23A95E7300D41B9656E9E57 AF;5s
967,786,277 *64EFAD7B7EC327B852D25EDA5D13FACB330B210A Af6%-
967,786,278 *64E4F5892241218180E5F1C5CB41ED6937303AD8 [email protected]
967,786,279 *64EFF5854E96EE1918F5DFE4759B1B287B855CF7 AF6988
967,786,280 *64EA069FA91B03450F18911893564B9996C19ABF AF6)c
967,786,281 *64E603A5DFA7E6A51A9AE7C52A14595D2DF20633 AF73R!MPR3$$!0N
967,786,282 *64E55E9B7417679AD7861CC7EC6CDDD49A3310DA Af7%F
967,786,283 *64EE401B4B9D747ADDAD8A8E662A36A5AD1F1155 Af7FF
967,786,284 *64EACC58A5F4FC7BDC91C0CB3BD2832288315154 Af%7g
967,786,285 *64E88ADA80C48B4174EF4FE79B933985CBF844BD [email protected]
967,786,286 *64E8280230413D8E4AE4E381FC90C4A8C98A9B2F Af8i2
967,786,287 *64E10A77978542BC6D20EB38BC25ABCB4E120DEE AF8Xe
967,786,288 *64EEDA8A04289BFF64F92FF06F179C5917C1B7B0 Af8Y2
967,786,289 *64E2237A4791C8CBC9E3DE9BEB28F4AB145B9481 A=F9(
967,786,290 *64EE2830EA7C3155898DC7FA93C4B268D0D39C7D AF9/:
967,786,291 *64E41B06B3535577E943467FCA0023A8445AFE2E Af)9"
967,786,292 *64E16527DA513144D42D02A4B60CEDA28D92B6FF AF971
967,786,293 *64E5D68C8F40CF969EBE0BC0A96732154277FDF4 Af9l.
967,786,294 *64E7768080BE72C44BD6090261E45CF79167C569 Af9v_
967,786,295 *64E49C656EA69916CC1D040ACB99D47FDD5491BA A-(fa
967,786,296 *64EC01250C3E33ED0380098C2FBB25043D38C1CF Afa;.
967,786,297 *64EEDA3AF6C5793E857BD67EB5714A2FCA3E6376 Af;A0
967,786,298 *64E6617B6BD5BF3F8ED6B210AB979CB7A2F13E27 Afa?1
967,786,299 *64E1E74459D5D7348468928098FF6811415F2740 AfA37
967,786,300 *64E30AF3EC9DA718E1C6BF5727C6BE936108E1AF Afa5,
967,786,301 *64EBEE70A8370A40788AEECADD06C3B74E1A7977 afactabouttrains
967,786,302 *64E21D64A03501A54A4E1349C916E31CEA47C826 afagasseming
967,786,303 *64EE99FC55C3DD6C9D4610A4DDDFE86BE7781172 afammafaed
967,786,304 *64EB09EF7AB7A84AA5996CA29BC67395481675E4 AfA#p
967,786,305 *64E554B0AB69ABF2259C391186F22DE8E92849D2 AFa)Q
967,786,306 *64EA4471D47FC5E4460F12A3366E2C4B3D042009 Af:As
967,786,307 *64EDE8E17A518E57A19C35A3B39C0D2F1423BBFE AfaVa
967,786,308 *64E3E90F5A5E103A1587F97B3A50466B6F0D9BB8 a favor del viento
967,786,309 *64EDC0E9EEA3ED2B6A7347223EEEE8CBC568A110 Afazerem2
967,786,310 *64E94EE810FECEA979B1A3CC4DFC945690FD456F AF=+B
967,786,311 *64E1783EA3B22964B14451F6FD8ECE1A9259BC1A A&fB(
967,786,312 *64E255A02AA55EF4BD506DC85D8D457838A8A95F Af??B
967,786,313 *64E20817290B1BB99DAC267B3A529400EDFC8330 Afb#;
967,786,314 *64E699B18CD1013F907BD6D138276C9098CB766A afbaseketball
967,786,315 *64EF7FB3B2E19739517B052099944082787B2217 afbene$
967,786,316 *64EBEDD96E63C16BB1B58A3E5E4898AB3075A68E afbenytte6
967,786,317 *64E04EA672BF2572780D494C6A492CAF9114FF19 AFBETALINGSHA
967,786,318 *64E6BE9BE939BDD07271C77071936BBD82E772B0 AfBh4
967,786,319 *64E8250B13DA1A696C3183A67241BB3CFDB18BD4 AFBir
967,786,320 *64EF288B9CCDCC6AB071A26F32AA1421759F053B A?fBj
967,786,321 *64EF3756D04196E388EAA21508AF6FCD2038948D AfbO/
967,786,322 *64E88205D496DEE60779D16119415818186EDC31 AfBQ6
967,786,323 *64E4D37F0976D43EE85B4C1875246DD33C429369 AFBve
967,786,324 *64ED8E124985AA1F2A3D8DDC89711E956D78D2B2 AFBw"
967,786,325 *64EB085448C74F57F9C99F32023BB2E01044320B A$F(C
967,786,326 *64EBEDE2219CA1161DAE744783600794AC30316A AfC=5
967,786,327 *64E33456DAA3F2716355D53FAB12AEF39C5901E5 Afccccfa2
967,786,328 *64E513DEEB2596FA3ADB30BF6686371276A4E11D AFCd(
967,786,329 *64EAFF05BEFAE219593AB5DE99EB2B28DD986DE5 A#fcg
967,786,330 *64E28AA7DBC8013EC626EF7EC444825A8A14EED5 A+FCI
967,786,331 *64EDBE7A7369371BD6A8C737C7B29823C89933F8 AFct1
967,786,332 *64E06AECF4ED46DA21E57A56DF552978B380AD18 AFcv(
967,786,333 *64E6EEE21B74C019D8CD7D1FF54DF964D6D062ED AF,cw
967,786,334 *64EABE96846D550AEC02C17EBEFE5473A1CA7AE8 AfcXr
967,786,335 *64ED78397CA5DDDD91931311BC33B01B60B593F3 AFCZ?
967,786,336 *64EA411009348E8686E2814856E7C68418CEA487 A$FD&
967,786,337 *64EEBD7C03C1EBAD5EBBFA4C92BAA64C1BA07682 AF"D+
967,786,338 *64ECF4C6A19330D0BF928A90A195D0630CB16AA9 Af?(D
967,786,339 *64E1AEDE498FDFD7C41422B1E2472098C69E3D5A Afd9/
967,786,340 *64E13894696D3853FE80D5BBE2BC9175847E706A afdanktes8
967,786,341 *64EDF22EA9C4A92C236004AD624B650D4853C427 AFDE1
967,786,342 *64E430EBA66D96E14131CC01FB61C29C37EA4E95 AfD?G
967,786,343 *64E15ACB6BB7754A25ACCC15FE9E2414330C25A5 afdh_commscs91pa93
967,786,344 *64E5B6CE32BCE2223B2F563CCAAC0759EDA81946 afdijkin8
967,786,345 *64E974D4B92EFBF59822243CEBFDF87EB5B8A10A AfdKk
967,786,346 *64E7C80A0D4FBFC29E8925C8E4D6D3FA603F9FC9 afdong?
967,786,347 *64E8821EA56F2F670C63CF59F45C027D762DE696 afdrift6
967,786,348 *64ED1B67DF5BE6116E4FC2D1248B62521E7F1E10 AFDRING7
967,786,349 *64E83D70C67EAFFDD49178F5CE0A1FAE4792CF12 ‘afdruk’
967,786,350 *64E89AABC1A0106AC5F3C1D553C04BC6CCB3CD0B AFDRYPPEDE
967,786,351 *64EB86DF40586F37F798F48877BD4656B31FD12D AfdvZ
967,786,352 *64E15D0A6F1E1BB8D9BFB9F522C361707A00BB50 afdwbsw4
967,786,353 *64E6165DB60EC1684DAA69A4051C38FD58EB08A5 AfdWm
967,786,354 *64E6A162D20090D9F3599EDA8213A8F32155D905 AF./e
967,786,355 *64E0771AA5CD6EA9874108579282FC58715E3ACB A:fe"
967,786,356 *64E24DF34CEAD5A1D0A31FC19F824C75AC28EBF5 Af#/e
967,786,357 *64E8B229BF7137940C636B762881187A22BE3162 AfE5b
967,786,358 *64EB8868FAE107D1F6949791AE10E01D9BC73DF4 AfE,8
967,786,359 *64E045A208420AB84285A23F190CB01A6AC78DFD AFeaI
967,786,360 *64E6E6440B3E7E54D33B50287FB9E1AED3E5F44E AFeC:
967,786,361 *64E5E04877D2831DA86E3FE54F4C087D14C0BBD4 ¿Afectaría
967,786,362 *64E5E928A04D1F65286B127C72FDA5CBBA703469 AFECUBSW
967,786,363 *64E3C46C91D9B64492CD74EFE373AC1E4AFEE89C AfeD
967,786,364 *64E52B0308AD2963D567728E53B71785700AC6F2 A
967,786,365 *64E509D299466F7368A5327E4FE7E2C4ADE1EFEF AFEISENS
967,786,366 *64EDD652CEB0F9111482C60D4693538D237C4C38 Afel!
967,786,367 *64E0169A7EDC541945171E5861CE9DE2AE9E4380 Afelakeg8
967,786,368 *64E5029506C52DF6833B81EE6AD7F96D6AA994DE AFEMINACION
967,786,369 *64E592C6843175A07319B4D0E69689E30A5A3297 Afendrak
967,786,370 *64EE6E793EEC71C23F522A6447AE83CF306BB923 afergfienza
967,786,371 *64E89E7CB472B946B3AF8FCE68D8EFB3604F33C7 aferidoras1234
967,786,372 *64E2F784117AE8724A3477EA9782348AAF336B1E afernandez2
967,786,373 *64EAC92A15E32D1AD8F7E1A62980D969C191A683 Aferrabas4
967,786,374 *64E69E2BB5CBA2AA1D4E0FA4D9925744EA36BE0B AFETf
967,786,375 *64EC94126627D13FBF715B57FFE5EDBFD7675B27 AfEYw
967,786,376 *64EF21BA3289F01F8D37973813BDD6F1ADC4149C A_Ff#
967,786,377 *64E9B87B19A76A5E406E311E4788ADE3CCC4471E A(-fF
967,786,378 *64E333129527C39D6F5877D197166C7EEACC4608 affabulates
967,786,379 *64EC53DA83ADEC428712CCED70BB8DCA7FDF8747 affair2006
967,786,380 *64EF982BAA48C7D92E0096CA24EC6E48A7B7BA10 [email protected]
967,786,381 *64E40FD14A0B1E434C976F386ED7894C2309BBE9 Affairiez!
967,786,382 *64EAC9182B707CDA370320F902D2096FA85C9CF9 affairs)與
967,786,383 *64E548946B8578C6D0F5ADDBE03C82AB3CDD6B14 AFFAIR」フジテレビ系ドラマ「
967,786,384 *64E95D49F68CE0B28F8467B6D28231E9C819C24A affalerais
967,786,385 *64EAD89B2868EDCD1F6F7A3FDC3E8C32EA8F558D Affamiamo3
967,786,386 *64EF119FE7081A4F2CC5B6B8A8E00AE903356AB8 Affangen
967,786,387 *64E05B697EEA3A11293B8CDDC5577A2E2F245AFD affarteb6
967,786,388 *64E48030E35BB1696B8D45ED526ECADA27050236 AFfbo
967,786,389 *64ECB72216F7C7DB6427FA489C418B76872C7E0E AffDm
967,786,390 *64ECF239433B20381C354B008E223BBB15156967 Affectionnerionses
967,786,391 *64EDA7442451DEA252AC7E0D6BBF653C2FCC37B5 affective-cognitive
967,786,392 *64EDE6AFEAF1350C80CA29D75DD0A3D525AA78AA Affekbetra
967,786,393 *64EE1930E5FC03195BD44FFCCCD0BA3E06FC78D4 afferendons
967,786,394 *64E69D521D668BBCF798A4C8C103951FE0F9D60A affermirent1234
967,786,395 *64EAF31891DF64E30689BDF87BE550C49329E806 AFFERRATO4
967,786,396 *64EF177BC3F3009D3003EEB178AFC6F040A3F1CB affescultuur
967,786,397 *64EDF605A10BF989CA9AC43E07F67C0EA5C37918 AFFIATERA1
967,786,398 *64E4EA67D34C46BFCADA8D60A499980E41B97CE2 AFFICHISTES1
967,786,399 *64E1D61974CDE8620D8A0851DEE0D3B5CD793A2C affidando7
967,786,400 *64E26FE9BC6745081F06158C9D15106617427A33 affidatases
967,786,401 *64EA50ED1B030043F635828F871D9205F1ECF7BE Affiderete1
967,786,402 *64E20347C0F08C3E5F944D05DDF9D541700DD96D affietst.
967,786,403 *64EEACBA4732878CB932DA8AE89A5A61FE9CA5C3 AFFILIATED.
967,786,404 *64E9F821DCB164DEA4F3390ACD88B716ECE38750 Affiocer2
967,786,405 *64E2C39673501900D2E35DF0D1AEDC7A640B2857 [email protected]
967,786,406 *64E75F63204B4897CF17DFA5BDAC61E79121BD2D AFFIXA
967,786,407 *64E73F378803CCD8B7126F7F93F91C68A72D8B2D [email protected]
967,786,408 *64E31EA64F93ECEF88B1407A67B3AD5A13A718BF Aff!l!a+3$
967,786,409 *64E9EBAD953376E5241797DCD648371A36D09BE4 [email protected]
967,786,410 *64E9832967CA7828319F5A25FF397BC4B6061E71 AFFLUENCES.
967,786,411 *64E2D05E950E291ECED6B12807A876BE4EF202CA A#FFN
967,786,412 *64E5378D86D8607DDD298EBEDE39BF42D1FD059F affolesesing
967,786,413 *64E208FB945BF4A896918B68A9A732C6EF85EBDC affomdamento
967,786,414 *64EE6FC5E5CBCD89E4EF9DA5AC89D4FAE85CF630 afforro
967,786,415 *64ED203C1B29FA999F6D62D2BEA745DAA41E4E6F affouagers
967,786,416 *64E5681F9B0B3A08C80455BFFA427C7959D3910A Affr1gh75
967,786,417 *64EE8A148D5241347748A89C43BC9B46D6C9D51F Affranchiraises
967,786,418 *64EF072857229CB9B490BD1C2ADC8FAC7C01C768 affranchirezs
967,786,419 *64EA32EF0C0E43576851ECC60DCA27664E7B1AC2 affrangi
967,786,420 *64E6E1F352F108959CD3DA249941E4E19276ECA4 AFFRETAIS
967,786,421 *64E1F990FD39E3F90C0906C931EA58CEAF60D3C5 AFFRETER5
967,786,422 *64EFC4D5B1267E2364C0FFE93E7081D238CF3CFD Affreusement2
967,786,423 *64E29CFCC857694719E3790E8ACB53EC6FE7CE55 AFFRONTIATE
967,786,424 *64E780B8DE5864C6DC6F74ED281A9C69CBD770BB [email protected]
967,786,425 *64E2C13F2801776A8D6AC12856134DFA9D3B7786 A_!Fg
967,786,426 *64E477DC26BB4B77F51093D9109E293575963E29 AF/g?
967,786,427 *64E297ED5F43B6CDC76B6E35DEF8C24D8E1517CB AF("g
967,786,428 *64EAC921192567457C7C71A02466C3257FE85D0A AFg.=
967,786,429 *64E96B4A97F48F3AC38C41B6B3FD630FA581EE47 AFg$,
967,786,430 *64E2975867410E6E2CE014F2758F3A8D13441CDE A#f"G
967,786,431 *64EC448DCA7FE53437241C7B0DEA7427A2122075 Af/G&
967,786,432 *64EFE2D05B952C22D6CDA17E6D113286238F73D0 A_f(g
967,786,433 *64EC2EAF3170BD38A117C4ACFD530F0B4FBAAA2A A+%fg
967,786,434 *64EB97087501D9055493E9067178A339F6C535D3 Af&g6
967,786,435 *64E39EF7CC0830AE48563CE64B9B390EBF398976 afgane1
967,786,436 *64E5B35AEA7CF3E86094C3615EF8DC2DCC3ECE7F Afgebouwde
967,786,437 *64E468ABFD20E6465F4E2502A5BD3A51C8ABD0F8 afgebuig5
967,786,438 *64E8EC13DB48D02CE7AD1A91EC957AAF7855ACE7 AFGEGOLFD?
967,786,439 *64E1C6A3E82FC7D714D477077F5F253AA6F4BA3A Afgekarring
967,786,440 *64EB2D8A946BB5D9BE32CA073412E06389ED17AC AFGELEGENER0
967,786,441 *64ED381FE705CE58C47188EEDAB9024772E01294 afgemaaid6
967,786,442 *64E68BDD10E0BD519B71D211765AD6BA21327283 afgenepene8
967,786,443 *64EA48C78F5A77B85DFD0164FD1E7ECF5CC0933B afgepeeld6
967,786,444 *64E0BA6A98F2CD4D9A55FC8DCDB38172F8737B72 AFGEPRAAT6
967,786,445 *64E5973A04275032FBBA22AE49EE24D718751F60 afgepreekten2
967,786,446 *64E29AFE7121AB5C595F1BA28961172AFD48DB0A Afgepulkte5
967,786,447 *64E0018132A3AE19EA76AC06BAF4C803FC26EF08 Afgeraasd6
967,786,448 *64E2E9EF0AC479068EEC3F18C4690F1B55FE8273 afgerande3
967,786,449 *64E38A131EBBF8B9DF93E8D89E17FC4819E4D657 AFGERETEN.
967,786,450 *64EA42826F7CC3224F0FA77B3ECB34BD84C57E50 AFGEROOFDEN.
967,786,451 *64EB791F21095F522AF14407B638CFF3F0ADEB5A AFGERUKTE3
967,786,452 *64EDF7771024ADF407663C1322B6DA85AB3308D4 AFGESCHENEN
967,786,453 *64E3523516C0DFDB663C943ED381F57D62C46834 AFGESCHOOIDS
967,786,454 *64E4160A62AFBF8622A80DAF26241E22366DC3CB AFGESLINGERD2
967,786,455 *64E941DB43CCE3285529D22CF6AA8CA2C1EFFA19 AFGESMEERD8
967,786,456 *64EA7810DA4611129EA2469743C4C075214C0836 AFGESPRO
967,786,457 *64E8C37EB59DC3A7482A943DE2F392BD90DE176E Afgevaren5
967,786,458 *64EAC43CC7B62F7F923DCB9F2B67E45EC483DDBB AFGEWEIDEN3
967,786,459 *64E8617183F565392B027B299C774FCB409A9BDC AFGEWIMPELD2
967,786,460 *64EBE90502714F5D27162E6EFBEECA714E692A91 afgezande8
967,786,461 *64EFB9DCC487FDDB4BCF79BF8118879B9E7FDCCD AF%gG
967,786,462 *64EAEAF51DFDDBA8E8C0E1998AAED03A9472E5CC Af_GG
967,786,463 *64EC70B1150C9741E94BBC81473EA9B0C0A7A1CD AfGG7
967,786,464 *64E6B8A8F049F68942A8903ACE9F5F1287B19EA7 Afghanets7
967,786,465 *64EE87D61342B6AC94580EAA3A4EFAD0F833CB6C afghanistanpr
967,786,466 *64E1F8E2FCCF23F8A92B0D26C7F17AA5EFCAC6E3 AFGHANKRIGET
967,786,467 *64ECDD8FA1888B9B6415148EA79D265AA2206A5A Afghan Woman (Stereo)
967,786,468 *64E222597132D8778575D90630A8D70C315743DE AfGM;
967,786,469 *64EEC259428D8969DE6BD54D9FB4798005581940 AfGN(
967,786,470 *64E89A4BDF189F16D7620474EE61AC7C5FCFACA4 afgod2
967,786,471 *64E089AEBC5515523FE0C7F08C9A06717737C667 AfGOv
967,786,472 *64E8E1F9FDBD59377F91FC5C62754E4000525880 afgrnseting
967,786,473 *64E17C898477580B30787B6071E62DD166F00239 AFGRXWSJA
967,786,474 *64EA5BD7521B097E512465551CCC30FED8D202D9 AfgsP
967,786,475 *64E40B37ACADEE93EE7A2F2D9686A3A2F23145B6 A,FH-
967,786,476 *64EDD5548E97E680E8B8457EEE58F5E9F3EC8145 Af#;H
967,786,477 *64E40A0A3EA51F78E88ED1FF33429A835CD58CAE AfH2!
967,786,478 *64E81EBA15269A6138C50860BD8652F29FF1ABD8 AF?hC
967,786,479 *64E830594242701361B2C58B2E370944E57FA033 afhechts7
967,786,480 *64ED1209A6795985B31FBA1D44189E92A5D5F040 [email protected]
967,786,481 *64E8A05192710AEC019362E1B3491C8F96EDFC0C AFHJ
967,786,482 *64EFDCB2F6BB32DAFA757D42652BB7F874E610FB AfHkc
967,786,483 *64E63AA07513E42CF1CF0603D1C7ED88A2AD4A4A Afhnetai
967,786,484 *64EC1CC795A4299944B2D9AA50616E8DF161BA35 Afh
967,786,485 *64EDE2AF15184BC66BB3761DFB1DF9D3EB52D4C2 afhnotan3
967,786,486 *64E33682DEEA1F587E60D9218F47A8E752A30D27 Afhrhmenes
967,786,487 *64E959EA93C242AC88816FE758DF378E2B2174A5 AFHRTES
967,786,488 *64E91A1CAB31ABA8363C78C7CF9FBFE0D6CBCD81 A,fhS
967,786,489 *64E1844985B74C41B22C096495906EEC0ED86C7D afhuurdes5
967,786,490 *64EAA09196759BF745CFE6D89203E2EF099AA7BE A-fHX
967,786,491 *64EBB37181E711DA34760B25F4A674B71DC4F2CB Afi%&
967,786,492 *64E5E972E3EE1502D9CA04EA8D567B2432D1168C Af$I9
967,786,493 *64EAC302AAE1E4F9DC924A1359DFC1B9CC61EB07 AfiaD
967,786,494 *64E92753AD5EC40AF0472D957E4884E1487A0562 afiadewan
967,786,495 *64E17B14D5AD2CA540A88EB03D95471275D4BF57 aficionade
967,786,496 *64EFCB7B172C1171D80E258BCDD312254DC6F08A afiegen1234
967,786,497 *64EAA0039ADA00D2028CD29E7DACA8B15F716756 afields725
967,786,498 *64E20DD68D28C9EE77C78DD8C2E2E42CB722BD58 AFIH)
967,786,499 *64EB36BCADAFF13F7FE1D86004E3646E9DEBF497 A;FiK
967,786,500 *64EF8CAF151B8E38D72B1CD16531CBF4980519CE afilated
967,786,501 *64EB4B2AC5D20BD0790FFAA2EFEC682BB4CA9522 “afiliados”
967,786,502 *64E4C12ADEC0306F13EAFE83B01564F2A2D52090 Afilidas
967,786,503 *64EB7A095A57068745C45FF082F6C8E0751A325B afinazioaren
967,786,504 *64EF7549260D948E397903E6DB6F8D465A3AED27 afincarlhe1234
967,786,505 *64EF904CC59C927F12F87CEFFFDD341D2E073D91 AfIQO
967,786,506 *64EF53336815C938557A7CF58FC42EE2EE858B9F AfiSL
967,786,507 *64E705A2BBBEC649A7BEAC12DBBC0FEAFBA59854 a fistful of dollars: without pity
967,786,508 *64E96A1C45070B3BCB2DF10A97AB2070E4B3D8A1 AfIUu
967,786,509 *64E672C01DABD1F4D696D9820EF75A0C85AB6C2B AFj7C
967,786,510 *64EE2966AEC2C8CF4631373D6FC5113F28D4CE6A Afjeyes6
967,786,511 *64EE7AF559817C8E2BEBC5BCCF6AA350A6143AB1 Afj=i
967,786,512 *64ED5B2C25A9329B71226E0B5C3A950FB6170677 A&Fjw
967,786,513 *64EFB86FA8964D94A00757550000A60A11758654 A+fjY
967,786,514 *64E95CE067030462A0C35B8503E9D4C539AB4188 A$!FK
967,786,515 *64E0A75B66929FF481B8022DAB3957DE30048C13 AfK)1
967,786,516 *64E1120E373DAD221F3528A851462DA1ADE411F4 AFk2U
967,786,517 *64EF817113988A0655B076AAC0A15B20F6A5FEA9 afkasteT
967,786,518 *64E7BE8E2CA10D521E4D608B7795463A4EB084E2 AFkaw
967,786,519 *64E989BDA41BB7D6C9AA5D8E52B767111C9F68D9 AfkBI
967,786,520 *64E80566153B6750F2D1AB0D900E937BF8BE5698 AfKcM
967,786,521 *64EDBC18E92776A9B53C03B676076C113F69C088 AFK+h
967,786,522 *64E1CE38B936A8AB26B4CC977A99E8176ED637D3 afkl
967,786,523 *64E6EF035BD05BE2045C071CF46F1200BD4AC91C Afklimmen6
967,786,524 *64E26CDF0D0A2350836DB9575F198A32C237538F A"fkm
967,786,525 *64E5D941D6675D2986341E2F8B8E063C064CA8D5 Afkr
967,786,526 *64E756986A56D2E3EE99A2D8C974477480E7D7BF AFKRUIDE7
967,786,527 *64EB71E39148A5C6E08BBD8767D240A0A7B7C26D AFkrv
967,786,528 *64E2E33C1D64F8318AD850F718B1207F87884F41 AF%ks
967,786,529 *64E74A543C83AA041803FBD687EBB7AB54B263F0 AFksj
967,786,530 *64E651F90E4CA40EECC3F3D8F12803A2B3CFB0F9 afkwamen5
967,786,531 *64E44F61AD03D447FF7FC688459184611AF0A7D8 A,FL
967,786,532 *64E8F720051BF1C0F4BC24110D88CCE763A59841 AF?,L
967,786,533 *64E82457949FB01721F61C9DB45F46A2A26063A8 A&Fl?
967,786,534 *64E1F72D21A7A8687325A87C381656F126538E03 Af
967,786,535 *64E16568E57AACB72E5FD3BA76A7B7FB21F3979C Afl
967,786,536 *64E830EB9DFCDF97FF184A30FB85F4668592FF8E AF"l0
967,786,537 *64EF3CF738D57103230A723AE2C3F859BF12F88D AFl0Q
967,786,538 *64E5C37305B047746C929127269EE644D2FA755F Afl4G
967,786,539 *64ED8F70A376394DD0C7E769217C85392E07A213 Aflã
967,786,540 *64E7B29CBF310702CD90951F48870DAAB3A2099E aflamron8
967,786,541 *64E0484944D48D480031492710C64BD9CAB1CCF5 aflashbacktothedarkmemories
967,786,542 *64E520C3F735652AB18BCA67F3D21E83F7CBA183 Af)LD
967,786,543 *64E3B0039CA8AA80EEF32C7045A3F01C26001F0B Afld9
967,786,544 *64E986F570090BDA61489CF160D3B9C76431DB4E AFLEGGERTJE
967,786,545 *64EE305A4E7A63CDFCEF3E2F14740B007167B52C Afleidende2
967,786,546 *64E347E3D16472D7AD97E391CB4CF6939582EE70 AFLEIDINGSMANOEUVRE8
967,786,547 *64EE37F39ED44AEB1FDD0CD6C02ED9567C808798 AFLEKEN5
967,786,548 *64E0CB75B5BAEF215D0464BDC01AB1C23DC80F01 Aflesborkeit
967,786,549 *64E7438D10284B7E50EE32558E35B718B01904EE AFLEZEN9
967,786,550 *64EABACA528980AFE095FFC456E39066EABCAB60 aflfectueux
967,786,551 *64E8761FF1C39F5348AEC42F938FB0E1AF9A2270 Afli$
967,786,552 *64E524462ABBFE8539F78CF0D31E18687641F0BD afliets2
967,786,553 *64EA4E3D9CDD0BAFE778C00E012A2A0FB74DB617 Afligia
967,786,554 *64E20BD54370C58399A9D0E0B465B43859E59423 afligindo2
967,786,555 *64E2E9EA7EB22B540C4F74E23E2DE6AFD9F2FC90 AFljs
967,786,556 *64ECE4BF5010FC6A109C251A3DB1CB440BFCEEB8 Afl"M
967,786,557 *64E7B8C5536E3856339086E92E21B0E29EE45719 aflnnet7
967,786,558 *64E0D8351B1248D93702D89268CAF3F62CD94CEF AflO=
967,786,559 *64EAC474624E29F2C0D8EC582B738CCFFC2B1C1F AfLqd
967,786,560 *64EE2BCCBCFDDF5FA82963CEDF779460B438F177 AflR%
967,786,561 *64EAB0ABA2A519C2B1FF2215A8B13DDBFDB856E3 aflssers6
967,786,562 *64E9B382269A7EAA7680EC7F3E6D742B910D4B06 aflsserses
967,786,563 *64E824081010043A7EAFFB800CCE66696C711397 afluller86
967,786,564 *64EC2924775E84A583E41F82F0D984899D1D8A18 A;flv
967,786,565 *64E82C6AA0C9040F8A0E98B876B91CDEB2EFC06E A`FM
967,786,566 *64E73CA110B44DB6015B218E9545FBA3B49929B5 A-F;M
967,786,567 *64E59DAD0CC08516C0795F883BE591EF8264224E A/?fM
967,786,568 *64EBEC5B64994B2DEB16B4ECE1B41816AEBDC6FE Afm0f
967,786,569 *64E8E1FB0FE29036BC598F5A1DF66189E0F45C15 AfM:2
967,786,570 *64EE4AC80DC3545FAF737AB1B1F59646A6634330 A+FM5
967,786,571 *64EE1A92BED85E8C4D89A8A8183F6C1F62C553A8 AF(MC
967,786,572 *64E1A8390D1F0B488C0732FF4936257FFC4597D6 AFm%C
967,786,573 *64E78065FC99135EC5451E4AA13E0CB3E3CF6B3E A,fMc
967,786,574 *64EDC73B984B057B61DFEFCF3730C31F40AF6729 AFMcu
967,786,575 *64E16439D465841058F7D2750C66EF1E0A8670DA Af.mE
967,786,576 *64E6EEC516B0201637AF3DB5DB5C534A9988ED3C AFMeR
967,786,577 *64E8D3868C03154D981AAD035577C7FDA6323C10 Afmetings1
967,786,578 *64E3D12B5388A050019FAAE08E54413B66F53F7A Afmlings
967,786,579 *64EB0B85C8FFFF0503A6C4300FC0AE0267F099C6 afmonster5
967,786,580 *64EDEBDEBDC5A111C3EC9F0233E7F6D71007BA0E AFMONTERER8
967,786,581 *64E59BBDFBC56D073933F56508D7FD3611182707 AFMV7
967,786,582 *64EBDF02C79A54EBBD46857B120FB052B2E68EDF AfMVp
967,786,583 *64E060D525AB34E150C676A707D69BA39901CE8F AFMWv
967,786,584 *64E01FC0BDD99FE8561D665B032AB2DABE663BA7 A:FMX
967,786,585 *64E134D934B21DE95063D3807D3CE73ABAC6F9DC AFn8u
967,786,586 *64EEAB18E7480A6528C78BB8C2BEA270C0CBC179 A!fnb
967,786,587 *64E45354037D90EE4D9030A5255566029901A44D AfNCI
967,786,588 *64E000369976189DF66AB798B27D8D1A1AB97223 Af
967,786,589 *64E0F621DC419D3E33C5B8A3296A4A81785510EF Af/nE
967,786,590 *64E606469E8F0829E5963CB1455C4181F58661A3 AFNEEMBAAR3
967,786,591 *64E43B5DE0F963440FE3D5D56A5442536B2FB8D0 afngmpav18
967,786,592 *64E58FE7ADC4812B8D861420470ACC94DB68E744 A!FNM
967,786,593 *64EADCC1801AF42FEE109BCE1F4B0BB156C3ADF9 Af!No
967,786,594 *64EC4ACA3B811F79B87D27739507ED67487051B0 AFN;R
967,786,595 *64EBA284E33D0F300B7EFEEC4257C0C0B937975C AFNwp
967,786,596 *64ED50541D98185817278A93C62A5BB3D007E958 A
967,786,597 *64ED837A2DCE7F3FD64462AA58F03C437C26490F Af?!o
967,786,598 *64E30C983C27F031B2CAA3B9132E8C2693FAC09D AfO1T
967,786,599 *64EDCC15064E5574DB43D44D4C5A5939AA891029 A%FoA
967,786,600 *64E2E4A18A07A4E143C812CA38E45163593E4619 AFOBH
967,786,601 *64E4CE3C8C64D0102D0CA1A068A348DFB4766F6B afoc-z
967,786,602 *64EAA5D30268CA23D158885B9145D7AAB35A613B Af&oh
967,786,603 *64EE469BEC806F27D0CC48E373716F883F5DB12F AfOKA
967,786,604 *64E69E5AFC35B0FA24566FB1D63AD8A9D4EA4037 aforquilharvos1234
967,786,605 *64E1838A6CD68109F7637819098C6CDED712C1B0 Afpaal6
967,786,606 *64E68A282230C351F9E8FDF88A2B78CD9B850BB6 AFpEh
967,786,607 *64ED6A2932774C4F707242CB3E441DF5D787DE86 afpeilin1
967,786,608 *64E2837DDC256D527F057249F3F47BF93689BA9E Afpennen
967,786,609 *64E2868948D4EDEC53F398250FF76AC79915BB18 Afp)h
967,786,610 *64E9ECDFAC608841B9140A19AC0D6D7E9E6C6850 Af#pi
967,786,611 *64E77F0F94FB1ED1EF06961FADCF21FBA49DE6E4 Afpikte2
967,786,612 *64E3609C007C17C65EC79C0AFA57DBD1FB173BC1 Afplagt3
967,786,613 *64EB5CD59D2620B66CE3AC6B4A12DBA21F2F7DCC AFPlj
967,786,614 *64E0B240DE0DEAC5C057BE1E1026AAA6A2E6E5DE AF!PM
967,786,615 *64E449655A2F9BDD40BCD4286698CFB6D07D710B AFPN+
967,786,616 *64E42002D5D2760FFBFCB3466E7C050C7D34BC8F AfpN
967,786,617 *64E8E92E01FD52BD17C632AED050938E97DAC50B AfpOh
967,786,618 *64EF21CC209B4A02AD01F3FD404FA7972EADB985 Afpompin7
967,786,619 *64EE54B7A441BE17991F9DC98490051F40330EC7 Afprijzen0
967,786,620 *64EB7794431260CFF8727D9178E371068E32F4A8 afproevningssaets
967,786,621 *64E5359F7222AEB4369B1CC4404471A5F2EFEDA1 afp's
967,786,622 *64E5EEC44A69F1785D24523186EFB97580E9A9CD A(FPV
967,786,623 *64E688DA6117658851F01063688194428C35BA04 AF?pV
967,786,624 *64E9ED553A68723642185C1B1196065D99FC3C71 Afp"v
967,786,625 *64E3A34319B21F738B18345DA8A6A0B585D873C9 A!FQ)
967,786,626 *64EA2F6B642F4159F4687F7AA1BBEAE355B12330 A_?fQ
967,786,627 *64E1769BB48574E5D972BF99131D58CB093A8D5A Af"Q!
967,786,628 *64E90BBF127E7FC6B842499C808F232C9DF59B82 Af-)q
967,786,629 *64E412B8565E9BF180F622A4C64A2531BEBF3838 AFq8,
967,786,630 *64E78C7404834595E85E0F49ECC65BE06227D621 afqjcnfmafqljuev8fcuckakqapkpl0dma
967,786,631 *64E0CFC632898967877762E2CBE45B92DD47D469 afqjcnfms
967,786,632 *64E3FC6CCB6C1C7A8523DC1CA36327D761413FEE AFQjCNHCdpf5gdEfHVPLkZgyZREvTYiomA
967,786,633 *64E915C7E81E1FF9CA560D91B14C66C0A6EDD850 AF/qo
967,786,634 *64E9A71ABA2CD7A751BE03904D19583F88CA39A2 AfQoP
967,786,635 *64EC63F22612E5A0F896465045654FA7583A16C7 AfQ.S
967,786,636 *64E95653D6EFF32713147D0E130014B96E80EAD1 Af:QW
967,786,637 *64E5102698B57749DE170933C0981E57A73A15F5 AFqX3
967,786,638 *64E460545C0830F29E9730053CD30D74F422607B A.F%r
967,786,639 *64E356DD2338224AB4510440F4A846C325A982B7 A%fr-
967,786,640 *64ED1D0932C9D701D4AB85AB9E4452F095F8CA2D Af_r-
967,786,641 *64E4D2209DDA526BE4024A2EC7594294AA8A8DA5 A;FR7
967,786,642 *64E189C92E11325793193C37C6ABBB8DAB67B30B afraaks5
967,786,643 *64EB449CA074F384CC17B2AC8CB7724E8FF04AA5 afranco1234
967,786,644 *64E2AE121B4FA7C8E8911AF290A81B85FE19F26A AFRC1623
967,786,645 *64E9EA397DA5693E7F05DD27C62BF910985DF548 AFREEDT
967,786,646 *64EF908685FB5734534E51B7CAE65882C480EC7B afreegs2
967,786,647 *64E4472D2178F8A487A6A89337FC109FB5DAFABC africagfdl
967,786,648 *64E872C72FE819C7F950B3D1932D7FCF974D717C africainstitute
967,786,649 *64E043E46F495152BF373CEBDFEC906D71F4E949 African Dub All-Mighty, Volume 4
967,786,650 *64EE162D43D765EEFD3F8A6F6E9AEAEE63CC2146 africanperform
967,786,651 *64E8EBF0B63F5F5DC8A8CE93F8E89E3679560689 afridiland 1 0
967,786,652 *64EBFAB328C7D2097B1385AF12B257D714F79BF5 afrikanpalmusivetit
967,786,653 *64E42EE84443E3E422DA982CE06C89A489C95FCF AF?rK
967,786,654 *64EF6BE76DAAD43C2E6EE8F221904604E27648AE Afrlb
967,786,655 *64EB7243DDAD215D08B861BB2FC6E315AE61C170 afro1996
967,786,656 *64E72F3EE834B56D1B89875444973E19D146AFE6 afroditi's
967,786,657 *64E87AFEE6BD5989BEDC7D49EB8FA23CC476E27A Afroeckes
967,786,658 *64E98DD6FFABE998B1BCE8906C36CFA6E09335BC afroscut.netwww
967,786,659 *64E287C3BA992E5890158C7B64BFDFE020524EE5 A.FrQ
967,786,660 *64E6E1B098D42BDE7B25E7A768A80A447784E091 Afr=q
967,786,661 *64E006BC36ADF4056B82B271670AA0BC826B7172 AfRTk
967,786,662 *64E70A750CF3257D0F1FC88FCC42DE04F1AB44B3 Afruilde?
967,786,663 *64EE8473C4AD95808D0D70D0FAE87991DE2D1667 afruils7
967,786,664 *64EA7AF2B9DA4D01D3E61F52034C44BEA2A3D833 AFRUNDINGSFEJL1
967,786,665 *64E65BF3BF0A1061BC9C90CC342003C9A943BE7B AFrvc
967,786,666 *64E918038550D2C5A3369C068C6ECC863915FF9A Afrycus1
967,786,667 *64ED92B622CAD4FBFCDA95EE51DB1AC154F6DCB0 AFS9#
967,786,668 *64E0D6344678FE6A50D8076C5A91508A8726A49F afsampson
967,786,669 *64E62119EF666894D69889ECACCF0BAF1C1460B6 AfSfd
967,786,670 *64E2E0D7A56321DBA2EE7125AE3927E395C0BFB2 Afshanna2
967,786,671 *64EF48EECA48D2B08E640AED9AFA1CD496F88AE9 AF%SI
967,786,672 *64EA4041D44815B72D79E7FC204278CB2979989F AfSLG
967,786,673 *64EF6E431435CF83762991E2FF4A2C61B4856F29 Afsloege
967,786,674 *64E02CEF38432BB15372388A1F352C865B59AA86 afsluttende9
967,786,675 *64E316AB48F31AC527AF2B87D7B14E5FAF78F6E1 afsonere1
967,786,676 *64E28A5C70BFACC8FD7A254B82006028ACAEFC80 AfSPW
967,786,677 *64E6AFAC7E1CDDCB9457E121CA6507E2119B2BBB afstaandes
967,786,678 *64EDAB4EFF0CD154809B0530C05A11350ECE31ED afstakening
967,786,679 *64E3193B5CD77703FAD2105B8599A105C7C5270D Afstandsrit3
967,786,680 *64EBEDE186842E537A44C7FD43EB24CFC34ABB84 afstandtabel
967,786,681 *64E2A2860604079F577147B506C9C6E9597A8A5E AFSTELSERS
967,786,682 *64E4DAA86AD206F297AFF8CD0D9F43A7F2C16104 afstemdes
967,786,683 *64E5DACA8F708667C17D51C3646ACC7C4A315939 AfSTo
967,786,684 *64E2AAD5F77E4654C649513A96711B3DD0529BCB AFSv7
967,786,685 *64E03A66258DE38E83F30F9618C3D19F88C87EC5 A?F?T
967,786,686 *64EED9D07D51A9D3D7185AC402638AD80085DBB1 AF::T
967,786,687 *64EA45FD685708042169E7F5A04CFB1B85D530D3 AFT
967,786,688 *64E5A8FDCB816550A00D7DAFD957B3F041D52A34 A!ft;
967,786,689 *64E574E20A070C8AEA13459E0274819753CD84D8 AfT17
967,786,690 *64EB911060112F2848F751C266756064D5A918FE Aft34
967,786,691 *64E1B30C9940B06CB1F1E7B1B0D24080D8A0D0AC AF+T7
967,786,692 *64EF80FAE663C44E5355CD1BBFC8FD82106F9189 Aft8d
967,786,693 *64E8DFCC75383A226172D19A9014F7244240465D Aft97
967,786,694 *64E554A7628CF359A42FCEC250055896C01115C3 aftab hossain
967,786,695 *64E4EFD089DF2332B54482B4520E98C200D298BC aftalesæt
967,786,696 *64E7E24C2C792E7E270DABAAAB6B0E37AC4F84F6 AFT
967,786,697 *64E2C597B819CFEB0677C13F06EE8FD26D83FDCF afteilts
967,786,698 *64E26F7804C18D635757C2C0B63FEABCE33EDD7D AFTEKARUL
967,786,699 *64E4486CE0EA39C0EE2232C9E3EB3D43842A0F69 Aftenb
967,786,700 *64ECD655CD68B520A569729901707DA0DA18CB30 after 0:00
967,786,701 *64E9B7D6DB90050E5BAEEB20B6B38476CAF1A085 AfternoonOwlsEP
967,786,702 *64E5BB50E7775FBA22D80AE6DE89C7C66AAD7008 aftershingles.com
967,786,703 *64EFA3A03A5999D394E585F861309737AA36A68E aftershock productions
967,786,704 *64EAC2C0C6F0F0B715A93A3DD2A11DC5F04A212E aftertea6768
967,786,705 *64EE666FCA6798B2E24E5740207E7876F30CFF2B AFTERWHI
967,786,706 *64E55FE7834D5A41C0587ED2529C09D2944EBE19 AFTER-WORDS
967,786,707 *64ED81BD6ED532A6E82D678199B733AB6D16C105 Aftesoikalyteresmeres
967,786,708 *64E984B445C39791E113F5719D3FDBFA5BDD27C5 AFtgG
967,786,709 *64E5EFCDC66D5E38FBD6A11A3C9B012CC7981918 afthartodokétismus
967,786,710 *64E93F7074C7D0E04F8C79B3CC02E7FC99A28204 AfT+I
967,786,711 *64E34A2D004417BA0C5C0FB57EDE4E3BB8E9BC59 AfTog
967,786,712 *64E45F238DA00383463DCA134D3EC0C3838BE5D7 AFT+P
967,786,713 *64ECC70D42B899527AB38B7588BE99736190ED77 aftroeves3
967,786,714 *64EAF56F05121788C7D9B49353876719652E6A12 Af"u_
967,786,715 *64E6AC9269C0FCD4AA4A62DA8A387D5DA19CF1AA AFU1G
967,786,716 *64EB58F5DDF06A5ED6F03C89A705708CD5389A28 AfU2l
967,786,717 *64E38A78466A17EA21989232F49582A3E753E8AF Af)U5
967,786,718 *64EBDA48618DB5C6808DE5EDEF1D525607B685A3 AFUad
967,786,719 *64EA40E05B249788C436B375F5391A49DFDEE124 afufamz
967,786,720 *64E98F8BF8C496937A73B0C760DCA8B3F6BDF13C AFuK1
967,786,721 *64EFA3E1F523660AE95CBC0D3CC45BA567F367E7 AFuLf
967,786,722 *64E52CDFD2F9A991D0057774026B9415ACA64DE8 AFUn0
967,786,723 *64EAFAE243991041F038F6995BFB4A1470118A01 AFUr/
967,786,724 *64EF44593A92FF0CB51DC1322798DF94C037CD0D afusellaren
967,786,725 *64EB7A2B72168CBD03C176A0EC2D57AE198263A1 AFUTk
967,786,726 *64E12FD5E8FC7B7956DF383A1125AFAD9B808315 AfuZI
967,786,727 *64EF59F40B5E1958611FD74527E341D1EA5FAA49 afvallens6
967,786,728 *64E6EAB9185D91C5F18E2466ECEF73FC17C492F1 Afvbningens
967,786,729 *64E23C16C29C78291216AC290D94DCC0D23371C4 AFvDB
967,786,730 *64E5E8CB11DC9BD0BB05FF349BBCA1E2C788B7BE Afv
967,786,731 *64E764D18631DD9DDB69460CF9CDC0389B5607F0 Afvlakken
967,786,732 *64E7B20E6B16187456D09C16B1F18553B9682391 AFVLAKKING!
967,786,733 *64E4D7B8F350E2D05D9D9738DD36FD90CCB528D8 afvloeiingen
967,786,734 *64EB3D3354903910C90D5A82A0D5C1C86EF113AB AF
967,786,735 *64E56A6C0AD07E5F644B4860D51B6F23EABDF8FC Afvos
967,786,736 *64E58AB0657A5C2AA97308BBA9E9E847CF925FBC afvrat!
967,786,737 *64EBC03D97AD4953B9EEBAC8755118E8F50641FA af$v
967,786,738 *64E59CB54B8B4FEA09DD1A252B4A22ED72F54005 afvrgning9
967,786,739 *64EB19CF1FD414587D3E2F77EE98524E3A8DF11F Af
967,786,740 *64EB63A4A82C7F5F87E8A5282F35D1881A297CDA AFVv(
967,786,741 *64EA0575439BFF67CAFB33437771B643F6610B46 AFvX-
967,786,742 *64E3DE8093345A1173F0F92D6278CA724311B4BD A&F"w
967,786,743 *64EFAC8ABFC74B6DD06132C7B1349BA0E6BEFC30 Af".w
967,786,744 *64E1ABF42B39A04B6168197127DDC7755B933328 AfW:4
967,786,745 *64EB2A2E8BAADF45CE5299CAB86490E87165BC39 AFw6F
967,786,746 *64E63F93E340980F85B5E786E80306F5D2149CFD afwan”
967,786,747 *64EE6E0A43DC1FC8264285E3B5A3DAE487470181 Afw/C
967,786,748 *64E20EB688FCE06689A7A82A4615DFF7C0B6F292 AFw
967,786,749 *64E9ADDF0D24210146F00DB020EB30B294D22283 A=fWG
967,786,750 *64EF69EC7C7319159C12120892547F304F94E2A2 AFw.h
967,786,751 *64E1CB6804883254D89852BD20E9D742688BBF63 AfwNG
967,786,752 *64E8EA1D20B8ED6D16CBA5DC1284E7F534F9D492 AF"WS
967,786,753 *64E1DE13A003B50EA2FD9078AA49EA8367D5744E AFwtX
967,786,754 *64E8FC0C5BA2AA59E8859516DD4EF94CC8439F30 afx4923130
967,786,755 *64EBF037453318FB3C43FF2C1DDC707D2BD2C2E6 AfX$5
967,786,756 *64E2E00D0EEA71030B86B8CE7F938707917C71F7 A=FXM
967,786,757 *64E8B535A88ED8EBB988DBF7A117148EB44CA69D A&fXo
967,786,758 *64E71C8F340E32A965E1A5B75E3D992A0FE83BCF AFXSf
967,786,759 *64EF2D5F111B927405C2468522552DCFC70E1C51 AFXTd
967,786,760 *64E742AF09DE2C699279CCD904FC44FB9AD863AE A.FY=
967,786,761 *64EAB71081DD50FF328C0D126B306BB4C5FDC4E1 Af$Y"
967,786,762 *64EA56BFAB8832662256A06C01424116B671B25A Afy4
967,786,763 *64EBDE64C251D97E0732D862BEE4210C80ADA2A3 [email protected]
967,786,764 *64E5EDDD7752F6A7137621D57701B4945F26444E AFYgB
967,786,765 *64EE45390AFEDAED481B369F6CD96C92B154E49F afysisching
967,786,766 *64EC7660EAE08D5E4D42682646EBF6EA198B2770 A-fYY
967,786,767 *64E69072F7B1A7ED969D62840583CF04CB11BC8B AFZ9$
967,786,768 *64EC5DA59C343D4D7AAA949D96FD782243B5D1CF afzabbels3
967,786,769 *64EFC18B747ACBC4942A1B12FCA34B9E2FF02DF6 AFZd6
967,786,770 *64E7D68F89C65DA8526025CA1A3B35CF524DA7E4 afzDXvz
967,786,771 *64EB2C3207BA5794764F3BF668A8EB9D862A7F4E afzetgebieden?
967,786,772 *64E8EF681662D33C60BCD1318EC2BAD03637244A Afzichts0
967,786,773 *64EA4C9FE18771FB7613DBA059095CE32E13BB84 Afzinkens5
967,786,774 *64EBC7C67E95C14AED554F69EBAB4E82ADC5387A Af-ZL
967,786,775 *64EBF7039EF3543D3789321A2C0AD2FB4D11B02E afzoodden1
967,786,776 *64EE4000AEC3FEC58556D27AA98593D2DB9732A4 afzvsac7
967,786,777 *64EB14BC9535AF1E120E80C810F2EA77744CD9D9 A_.=G
967,786,778 *64E9D96C11ACABB710648D351D2BF98081CC7170 A,G-?
967,786,779 *64EEEF08C0A5A94A139E493FF4ADE3026245CE8F A?//G
967,786,780 *64E73331D611B40D90C136F5D1569D4233E750C2 A/)G,
967,786,781 *64EBEF49230943E2D6D6B1E397DED2E88076EC21 A"#(G
967,786,782 *64EC872F310E03E847B07605B883EF479303B81E A"#G=
967,786,783 *64E8E76BB2D15797B818F90470BE991274AFD6D2 A:g,.
967,786,784 *64EEAA5CC3C4374A7BA9331927C039BA25ECF846 A:g?;
967,786,785 *64EADACF70BD959A9B86C41055779CA4D99861DA A!g:%
967,786,786 *64E685CCFF5AAB704C2ECFB1ECA0C68B144991A5 A/g%_
967,786,787 *64E100B263233E069692C7449B1384F5011131BE A.)g,
967,786,788 *64E902627CF118B5BE5523123575E5CDADC96033 A)?g+
967,786,789 *64E96E912D5612F41E6FCF58B475D77B444256F7 A)g*
967,786,790 *64EEC3007BB4E4606ABA9D53FE537762A7F18ED1 A#g&
967,786,791 *64E195B34FF1EE2C1497F5AA56D054D4F6C6A8E3 A
967,786,792 *64EE3988D6FCB8A614E57E5E7ABD06155447FB52 a"]G
967,786,793 *64EB62CBE45472CD72B54685B9A4744518600515 a]#{$G
967,786,794 *64ED6C4C7D602D1013B3A4EFB99732B4F0B55990 A"g0-
967,786,795 *64E6A270A18CEC5E636524EA7EACEE96A4DB123B Ag&0
967,786,796 *64ECCF2FBD299B7B43E5EDC56BAC06AFFD71ADDD AG0Hq
967,786,797 *64ED2A5A60FEBB8B6869BC3772539C34DC6AEF21 A#)G1
967,786,798 *64EBA2CC8B6806761D6C3DE1212DE15C61E350C6 A!,g1
967,786,799 *64E41FB3C935E4F37C9A384E43969AE5E7571CFE Ag:1/
967,786,800 *64E37E4BCD7C0081E5C1C938B18B941839D67E47 Ag(16
967,786,801 *64ED5D4A3AD8EEF4E06371A795C1805B9AFE38DC A/G1Z
967,786,802 *64E113608DC388FD37CD6F361CADE278BC836541 Ag2Tr
967,786,803 *64E72E493DC918B23B8D1F450BC6F1CA909C163D A?g.3
967,786,804 *64E0D48DE294B46294C78AFD62CB4EE8E2FC81F7 Ag3f3
967,786,805 *64E27FB36A69119994291A62328AEC440473E6A5 AG3H)
967,786,806 *64E6A7D89F69F4BA9DCAE4545E296144C39A1905 AG;3h
967,786,807 *64E3BF15293A0262016CD107A75DE3F3469BA142 Ag3oM
967,786,808 *64E626FA69B156977DAAA7988831453D628C482F Ag4/;
967,786,809 *64EC34370F926CFC077BCCEFAF23A85A95C65EE9 Ag43$
967,786,810 *64E80B1BC92BAC7554BF19AA498A80D03E2B4FC4 AG45c
967,786,811 *64EAE368AC886C82A70333B1B309BE099F254B33 ag46vba
967,786,812 *64E650978088F40CA145302FE14B9978A67A1369 Ag&4I
967,786,813 *64E164F7138AE5DE6BE8FEF261E475284627BF2D AG4Yk
967,786,814 *64EDDDC9A3CFC1857C86B877BD2A85803D72B153 AG5(-
967,786,815 *64E59231CED1875377F1F52DBC77850C17C85F26 A&G54
967,786,816 *64EAE63F9090F1D9C1CE0815B66C18CE25A6A6D4 AG5c=
967,786,817 *64E29396AF05770547A46365F3ED829CBD9A8E8A AG5v(
967,786,818 *64E3AF709F3384D70E211206E1C10A96F055A0E4 AG"6(
967,786,819 *64EC78455CE9A7D8D1407057ACF85A325A342430 AG6)c
967,786,820 *64E6D041B981412CB2DC52C93B12B4BA668E06AB A:g6f
967,786,821 *64E584D5278D3771F42FFC89245088711D3D9F5C Ag6fA
967,786,822 *64EC131AA7E9EB9D8CAF9533A4FF514A4A45F208 AG6=i
967,786,823 *64E109598E466CA35803502CBCF4AE9C9095B4C5 AG6qC
967,786,824 *64E72FF43E5E3C9E0E2B3EC0AF8749A9EEE3E031 Ag6u+
967,786,825 *64E7CB2902C2473D3FA2548F13DCE7C713F1F5FB Ag)7;
967,786,826 *64E8E322DBCE753B7E007C060C8851F46E7633D2 Ag)7R
967,786,827 *64E2CFD63EAA2593C4F4D5AFFFE63FB42B77A40D AG7TD
967,786,828 *64EA618ADCC74A8C8D0C1F2E312E54F020457245 AG88e
967,786,829 *64EEF6DC0820FCDAEBC866A0CB7405310CBE09BB Ag8?l
967,786,830 *64E69A47DA7B38E5EDD06EE12965249CE843A153 Ag9=%
967,786,831 *64EBB00F935C667299F0363466DA58B191484DCF AG9ok
967,786,832 *64E807E6D24FA0D07C6F5AD0A92E21B4754306AB A.g9S
967,786,833 *64E14EE2B49788F1D8638A7BA616A2C4652A080C AGA_(
967,786,834 *64E4EFD11BA723CD00C2E4D8EFD32C16CE209908 AG$a$
967,786,835 *64E7D71382AC92CBF5FF16F033F3A9D65A994740 AGA101786
967,786,836 *64ECF4786C105EF35884F01FBE8978096301BD90 AGA2i
967,786,837 *64EF60D4AA09B8E3F292983ED688815818591E6C AgA3g
967,786,838 *64EBF06F9C275997AB21F33935AB26DF21010A91 AG?a5
967,786,839 *64EF623E817BCC21092FD403CF4153B9B2638E89 Agabekov
967,786,840 *64EA77B1A260ADBD4ABBA7D66293A14456446D6A agaçait
967,786,841 *64E967F65FBF526B2F6AB043CCC705BB6FB8FF8D agacentses
967,786,842 *64E6809A7E8836E350D8457C480AC06E191D17F3 agadzhan9
967,786,843 *64E66E10278AB69CDC94BE28E0D863179B355391 AGA"E
967,786,844 *64E5F48EF6B9D1A7C42732146E67A81C9A1AF7C4 [email protected]
967,786,845 *64E15C6B4C38E413D357B756A928A656B8F15FF7 Agaerise
967,786,846 *64E2DF92BCE6C5665893C97C179AD07C2C7908E6 ağagilden
967,786,847 *64E4E0B4247C45789C0069354BA7704173511C66 [email protected]
967,786,848 *64ED9B46AFE87AC19D8EE3D72D028722740AB244 again160pdo
967,786,849 *64E594D0F2413D1155E1460B474F00EED318BC3B again.avidor
967,786,850 *64E662AA84D49FBEF4E6288C163C39B748438442 agakahn
967,786,851 *64EF53A744F3E453FC2AF0ADD0C433B2FCAA37BC Agalluela7
967,786,852 *64EFD710384E902D1ADE939ED51AD89A748ADD43 agapēn
967,786,853 *64E8192E341D170A2C3E313A007E2C7B773F8CF4 AGAQS
967,786,854 *64EC9EA88DB9A51C1D37066DE059FD1DBD1369BD A%gar
967,786,855 *64ED3F73D73AFB41D00FFFAD484C3440C3601B6F Ågårdgruppen
967,786,856 *64E11857CFD19E64CF1BE5DD2039FEBF8F0B1A17 Agardner2
967,786,857 *64E51CF7332D1ECC9C3D55036B955FD6F1920E9F AGARENORUM
967,786,858 *64EC2083F0E2850675D8EE75D8BE233233C4A686 agariyu6
967,786,859 *64E7353EB4A78F82DC318A88F12DE0F8AECEAF0E agarotarseiam123
967,786,860 *64E4535985412B7922A1F213DA60F7EBEFC786EC agashyinyaguro
967,786,861 *64E134ED8B17B8B681644EC009492DA16FBC801A AGASSIOPEN
967,786,862 *64EF8ABF8B1AD5CED9695E4872DE3F2A31E5244C agate11
967,786,863 *64E05683BC156ED32708898EFCF36203224CF094 Agatersing
967,786,864 *64EFC79CB21A69ABD59E0B84D51B151D71FD881B agathisrobusta1web
967,786,865 *64EA914CB23DD686E7E236C6FEDF8A226326D2DB AGav"
967,786,866 *64E406E35A33ADB89A7527838B49CD0EA4C960CE AgAx
967,786,867 *64EA3BADE81CD05762C1985822905F06792B2B10 AGAYPASSWORD
967,786,868 *64ECB211781D082815C5B0D40A72A3DDAF104F3D AG_%B
967,786,869 *64E0BF58BB6E76B4D9C35B05277FDDF484010D34 AG(+B
967,786,870 *64EA18CA70F837C76468F85FDDBDB802F9DDD073 A%Gb+
967,786,871 *64EF38138EC35F7849E9FAA902DD2198007AC071 AG,b%
967,786,872 *64EDE211273A77FB0F0528B65016C61F65578C05 Agb_.
967,786,873 *64E187662CCDE019CCC6401E68967B8B87BED6AB Agbaelle7
967,786,874 *64EF2ED37427A363BDA7F5823FC97DA7290E4759 Agbe"
967,786,875 *64ED365CCEF993FF9A0E4F93161894E0EBA0F4E4 AGbKK
967,786,876 *64E32010EA2DF8CB1B46B61C2F0D4F156DE16F87 A"gBm
967,786,877 *64ECE432D409BFF25107409ACCBC31EF1F4E503F A+(GC
967,786,878 *64E9A9A5F10E77B0D13B3CECC24978E922F5497F AG#+C
967,786,879 *64EFBA5C3651B2A2BD2D307D0FED782D60A31F01 A,Gc_
967,786,880 *64EC276E7C1D186BF7E731C50D26B8002DF3E278 A%$gC
967,786,881 *64EC459EC55E79C5CB2044F00F754A236DA54619 Ag$C+
967,786,882 *64E533C9AAF6FDD4DF6A75FA8EE4C8DF322FF78C AGc61
967,786,883 *64ECC82A4399A9B04471D6AA3011F737970F559D Ağçalı
967,786,884 *64E7EF5E581C2620F126D54407E5E8A5893D89F5 agccaaaccatatcattctgtccctggcccctcccagatctcatgtcctcacattgcaaa
967,786,885 *64E94CD31837C2BDEB9610B3A547B3AD8FB69792 AgceN
967,786,886 *64E6AB5B046E2FDC7B073832D2986F746B732392 AGCm:
967,786,887 *64E29185FD3A8D9D8B8756C24282A8463EFA7500 Ag"cn
967,786,888 *64EA509FE11D69EE00D9296E8C4F4AA53E349AD7 AGCp%
967,786,889 *64E2EC2015BF6D0EA593682DAF9FC3F382EF904D A%Gcq
967,786,890 *64EC4D0C838D4091DA036D3665CF3BD71CA74857 AGc/r
967,786,891 *64EB709BAA479DC2D578C34CED63A1D7658A548C AgCr5
967,786,892 *64E444FE8B960882EC9394B26356A72F7E4BF764 agcttctgcacagcaaagaaaacaatcaacaaagtgaagtgacaaccaatagcatggaag
967,786,893 *64EEABADFD23A6434EC4E635313CF487DCC81ECF AGCv)
967,786,894 *64EF91FB26A192D9A0CB57B630056575EF025AC0 A}GD
967,786,895 *64EFBD7B75CB654C896C04BE2749586460022BC2 A
967,786,896 *64EA24C415447CA11BE5CCF1A7515EAA594427BB AG
967,786,897 *64E66D0679DE179C8041A049106A0E8EE13D8F7A AGd-
967,786,898 *64E2BB7D2ACC946EF7966D89A3F4A4F6EC63522B A,g-D
967,786,899 *64E6C95137D748309561E8F3E29D17ED482B2730 AgD-!
967,786,900 *64E7BC1B7732DBFDBD94F10EE6302EC76F1CE1D4 A)/gd
967,786,901 *64E6862A2776FD11C2CEEAD0A61DB877CA4CC0A0 AGd8V
967,786,902 *64E51F6391128898247314CC116E535EAD273B99 A.gDb
967,786,903 *64E5510EABFB8FE46EA8319B04240559F83AEA80 AGDBv
967,786,904 *64EED11B958CE1A7939887FDCFBD7A1F3D5DAA1A AgdDB
967,786,905 *64EF8D4DE91D827E95ADCDF72ED296EFD62C3EEF AGdF$
967,786,906 *64E900E8D046C87E38A7B92AEE35BEEB8FDC77D6 Ag-DF
967,786,907 *64E3A9FEFE37A2577EA80A023A18DB5213012C16 AgDgg
967,786,908 *64E66FB3B9BD732654B5E56FCAD183BC2B9DD8C9 A
967,786,909 *64E572AD89E3EF8E8152F82182FA4848CCBAFA68 Ag/DM
967,786,910 *64E61A01EA4F9FE8C48D8F88E5E4F50673E5D868 AG,dp
967,786,911 *64E5F3DF35913CAB57826A3B604B4BA91FBE412C AgD-R
967,786,912 *64E1E095F2F624015EDADB83C019B21DCCBAEBD4 AGd$S
967,786,913 *64EF96E822FFF66B967ED73FF1066DA78354444F AgDs,
967,786,914 *64EF5B603B6A87CF8B9ABBC972F2971A6AEEABF2 Age1;
967,786,915 *64EC208C81683729D1FD96C3641F923B6AA07E9D age197461
967,786,916 *64ED6555F9F106B9A6BF1EDE0AE1C65F6E98E5AE [email protected]
967,786,917 *64E5A3FDDC7E012315150E669C3CB32F958B11EE ageapalaarabesque
967,786,918 *64E227790C03A9CE67E85FB8758523EC9A546866 A"gec
967,786,919 *64E8152C3B0272EEBD566BDA6FE0CAE5BA132370 ageemmanuel
967,786,920 *64E4573CF9AE8E13A87D76C8350B58B76842C6DA AgE!F
967,786,921 *64E9C1925880557CCFA03CDE0F432C406EC604D0 Ag!eF
967,786,922 *64E10C05C2626C604337883374DCEF5725700FB4 agegalmd5
967,786,923 *64ED69C90A681FD8AEFD384EF7AE88F2BF47D8B7 ägekömon
967,786,924 *64E727D4F6A2C2E98CD63A23915C1CE1939BF8DE Agelege5
967,786,925 *64E0F61C157EA89C0E50BE472D3501E8608AFD19 agelinas4
967,786,926 *64ED12FA321EFDDAA6C55E715FC84803FF789386 Agelong!
967,786,927 *64EA8D407D387473850BE5C25F6BCAFD424F4C72 agencien2
967,786,928 *64E442F1E4EE2A4B6364FA6C7AD9A9E5EE18D8F5 Agendeert7
967,786,929 *64EB2670DD71BC8320CBFE3278146E07314A97B1 agent.biophys
967,786,930 *64E0D6311DFB669966C830440B6FF6596134D0C3 agentjogg
967,786,931 *64EA711E4391D5D3E2F71174833B1DC235DA40A5 agents—michael
967,786,932 *64E718161CC8A2BC33133761F96CB06C0254D899 age-of-empires-ii-the-conquerors-expansi.software.informer.comage-of-empires-ii-the-conquerors-expansi
967,786,933 *64EE7D264F03AC3885DAE4833B156D6D0717EB31 Age of Reason 1
967,786,934 *64EBFDBB857247A8C8C5F8CF1D73A4254509F497 agerdewa8
967,786,935 *64E87023D74C0AB31E19747D5A0796C3B5757E73 agerigen6
967,786,936 *64EDF084785B06160E583535C64B3759AD26856C Ages and Aeons Quit the Room
967,786,937 *64EAFEC8C6336C06C3104815508471C36DBFFC6C Ages/brookside
967,786,938 *64E22FF0176C270CDBBEF56EEE00E9A8116AE0C3 agesteel9
967,786,939 *64E434F48797A92D5AF3D5CA2DC39790CD5145EE AGE/t
967,786,940 *64E0662FF6CB31B8FFA4F8FAF1CE000909B5F377 AgETj
967,786,941 *64E915E2DB62571160E9023757D29F1617D1E401 agezfyf4
967,786,942 *64E1953701DD2094C1A518BF954D42214583F55F AG#%f
967,786,943 *64E7BA49A8D566C5700F196FC9D0CEC675115325 A!$gF
967,786,944 *64E2B6F8FA15BFBD9231441A62E4933E8347B425 Agf+$
967,786,945 *64EDEF9464C7CA0A241C4F86D07473F747361499 AGfB=
967,786,946 *64E7E0D0D3CE0279A67C12CDBB06C38696C3B29C agfdelaycom
967,786,947 *64EBA7535ED1EF0F65DA19426C8C18E2F52EDAA9 AGF:K
967,786,948 *64EF5487B2D9F6E43ECDFEB3B46D0FC46708647B AgFUS
967,786,949 *64EF34084103926FA0039FA28A8D6381E137BE91 A+gfw
967,786,950 *64EB87AFC8F84F67227BF23DB46AD62521B2A646 agg1orn1
967,786,951 *64EAD64A26F9AEA826CAB61D419FE1A1333AA73D aggcactcccaggtggccgcactgaggccagagtcctggctggggaaccctgggggaggt
967,786,952 *64E432064CCFDBA90D5B49944D04BE9C22D5B8D7 äggcentrallag
967,786,953 *64E3700F96E00CF3ECB5366CCCBBEEB9CF970A1A AGGCu
967,786,954 *64E3B94B7E3693EC720B54046EF44926619C8718 AGge/
967,786,955 *64E29557890B9EB0A96E9D2A5F2FEF0628C5567F aggeR
967,786,956 *64EA29A412EBAB02897AA66B9FA231F9AB6A7BEC AgG#F
967,786,957 *64E2E6EF4E32E70A70B8D2B55990457D865A5DA4 agggtactcaggaaaatctgtgttggaaatccctgaaaaaacatggaagcagcatggtgt
967,786,958 *64EDF4EBC2238CDC2EE9D98AC308F6FFB73B4D0B AGGHABODHI
967,786,959 *64EA7A4899D2917D68E8C5DF382ABAD0C72A5D6F aggiesq4
967,786,960 *64E0D3C95FA48DF3A165414FDB469E491F2279B8 AGGIUDICHIS
967,786,961 *64E166B9D9A6B8F89328C749B2E1AFA4D5C40218 aggiungere4
967,786,962 *64EEEE52C74A534D11374C152AE94DD93741C626 Aggkjaning
967,786,963 *64E675802ED41459B827147461166F39DFF17852 Agglomeratic6
967,786,964 *64EEFD4188C23397CCA9BF17440BEEFFC0021E9F AGGLOMERATIVE3
967,786,965 *64E97ADBE6EFA3F552D4B41627B1FE1F9D0BC86E Agglutinative0
967,786,966 *64EEC0CA5F51EDAAC02408A37AD000FC29381EEE AGGQw
967,786,967 *64E6445FF26D0AFCCBE7AEC57DC6031AC45098AE Aggregation2
967,786,968 *64E44D5A33A9F3081F8BA6F676D3C8AA9C60CBE1 Aggrovigliolati
967,786,969 *64E85322C5E096B0D9DA6E5A7E1F57D8DE25FAFB agguatos4
967,786,970 *64EC68631C4C0A8FBE606C584C0363A80D8C7387 A%Gh
967,786,971 *64EC54ED58C4E8BF38272133746AC72A0063FC10 A)gH)
967,786,972 *64E0769CF5A1941A9BB7612FF406D2B012D7F17F Agh9X
967,786,973 *64E4D9F1A439DE4E9A799AADFDD950C430C5F056 aghavens4
967,786,974 *64E86078A974561F54A0C13BD3AFB86DD0D916E6 AghH%
967,786,975 *64E064D650C01E2DE4EE10812FB03618D3FF9FE4 Aghilled
967,786,976 *64EA269CB884F514F4C98D963AA5B5DECAD0B39F Aghiokhush
967,786,977 *64E54C57C7E73D0C87BEE6123E23950E6575991A AGHLAB
967,786,978 *64E5533B955306A3815373E1B5EDB261CF1B35B4 AGhlp
967,786,979 *64E25296B5980EA57FDED1462026D28E9CF17431 AGhM,
967,786,980 *64E1CBF875503B4BB64851FD5EB37544871F3080 AgHmo
967,786,981 *64E13AF345208C82383926BCBFE00EE7CA4B34E6 A=GHR
967,786,982 *64EBF345F1F3DB09EDBFA38008CF84066D5BAF69 A/GI=
967,786,983 *64E6FF82856A4015C729E74F9D23CFA014C22E58 A=,gi
967,786,984 *64E07F4B36D14026D3D2022A45F329029C1C4D82 A_gi6
967,786,985 *64E19C0302FFC923D285A9E9871A10A045D783D3 Agi+a+es
967,786,986 *64E00FAAE9AA6370AE7C60F680C596766EDF47C4 agibasuk0
967,786,987 *64E56944F631F2D99F371BDA72DF775D226A60AE Agidomtk2
967,786,988 *64E0BE5964303262D2ED3DA984C730FBE7076F34 agiekius8
967,786,989 *64E654E990BCC1456D8E5571E2B8590AE60B5821 [email protected]
967,786,990 *64E7DED74586015098F86E902791893873C7B832 Agiertem4
967,786,991 *64EA49534A2EF1532714094DD9459F999B577E71 A Gift for a Gift
967,786,992 *64E7C435F5F66BBFAD0A62B2ED3B1C3A7128F5E8 agigantarias
967,786,993 *64E31221603EEE718AB6B3634D1ABF9FDD3F48AD AgiI$
967,786,994 *64E737E0FE2E66C38632FAC4BB27212EF2ED1289 agiikkaa9
967,786,995 *64ED9DE07EA37D5FC7105635ECB340E415E73958 agilerott
967,786,996 *64EF4453AA4002F29AA32D110FDB43FDD345582C agilization
967,786,997 *64EDEF9CA823A1680CF9D78696503A98E85A3DF5 Agilnjto7
967,786,998 *64E832E04DA4503589C8499BE0BD158DEBA4D06D Agiltfra3
967,786,999 *64E1D24952BD1CB398A36847213B31F6DAABACE1 AgiNj
967,787,000 *64EA0DB6BA99DE14DDC3137C624D0EFDE4D249D9 AGIo
967,787,001 *64E4DBD233B20AB60B8ABB0B4E7DE0B3C4F8788A agiotanted
967,787,002 *64E31597F31B68A2D90E59FF6208501373B377C3 Agi
967,787,003 *64E72EED56B5E7A0DF53822DDCF5005806AF8C8E ağırlığın
967,787,004 *64EDD0CE25ED774036B4ECAD963FD0A0DFC70E1C Agissant
967,787,005 *64E42D0316064EA09362A51130DB478323EBB2C0 agitereb5
967,787,006 *64E35C361DAC45E68C25BDF7E589CC9CEF83063A AGITERENT9
967,787,007 *64EA7834D2F0FFCCA078FEDCB4984C9084C6BCFB agıtmış
967,787,008 *64E1F2FFCC501CB71554CA6AAA6A3064314972B9 agitprom
967,787,009 *64E8B2730BC139FA64ED34290391C14B4A3EE389 Agj4l
967,787,010 *64E708230A5E1E15F009583799EBB39B6D8D76F3 AGj.k
967,787,011 *64E05054040CA30AD3F820F3ED9DF0A6F8036DD1 AGjpT
967,787,012 *64E639C3560C651E7F120C46AAE1179545678B0B Agjqu
967,787,013 *64E07F395FB15512B5F6509F15DB55FDA3ECBBF2 AgjTo
967,787,014 *64EEE45B70B63516F599CAB4A6D3D5F4FEC2B77A A(Gk.
967,787,015 *64EA64692ABAF709F7A7B7CEBEDA776AD109C40A A+%Gk
967,787,016 *64E7145A14D159C3C67F5B31B8E09C9B07ED3FEA A!.gK
967,787,017 *64EAB13AFEA996D615276151006C63DAD3586E24 A&g(k
967,787,018 *64E01332DD8B852E082CF2BEF6991F660616F4BA Ag$k/
967,787,019 *64E781E1E33637CFFBC53AD9B65747292FB04CA9 Agk,?
967,787,020 *64EADA9FA75AE0256428DDABA88C64729E6E9877 Ag$kD
967,787,021 *64EC7E48B05D9CE33BF7838E90B8767A19234DEB AGKhT
967,787,022 *64E23EA8CE341E5F652B2F5EB698917699158325 AgkI9
967,787,023 *64E07FBE65DECE1407003946B8BD185A48314600 AgKMM
967,787,024 *64E0DC55446B20AF22B2B0016B28AA80E7DA6009 AGK-s
967,787,025 *64E259633C9A45851CE821229EA265B9F0A7B52C Agk.U
967,787,026 *64EFED1186CD892879099D063C429CD7C3179EC5 AGk#Y
967,787,027 *64E5A8D1700CBDCE79DDA8AA5F884F436B086645 A/gkZ
967,787,028 *64E9BC0F97C671267549BD56CE1FFEDC78101894 A.gL/
967,787,029 *64E112ECEBCC302EC1A14A9144D7FB2610568728 A)Gl8
967,787,030 *64E0F1B4CE2BA0542F858624BE97447DE86C3EB8 AglBG
967,787,031 *64E4B5AEA375268202C7D6797B96EDC2C276118B AgLhS
967,787,032 *64EB144EAF421159B6FD3C717C460536841671EC aglimmer4
967,787,033 *64E2FBC5BDE2DB3BBB1C11D511EE06CC6816D240 a glimpse of the valley
967,787,034 *64EB9D1848414AEFC82885E1D88976F21E49813B aglinder5
967,787,035 *64EAFDC852E834875E5D25129491A68E9590F608 AGlk-
967,787,036 *64E10069E284DEFFD837C2945D35861642F905F3 Aglobal1
967,787,037 *64EAF18366E2BD20B1A14A6B2AC537BF1A07AAE3 AGLOBALCREATOR
967,787,038 *64EB9439DE47A2438972F6F8F635AD2D8D67EBDA Aglobuli
967,787,039 *64E66047E7552A551E09D0E2A844B6F49882D1C6 [email protected]
967,787,040 *64E49AEF9687F1F30F32E5DE9D5CAE2998BB7031 Aglp.
967,787,041 *64E5D210B1909205081E1F5CEC9DCCC0C065C280 AGlPn
967,787,042 *64E4F803162AD6C38DE8E5E5DE195CD77AE2350C AglQI
967,787,043 *64E498FB21C51AE527F9CCFFDDD6497F7BB9A893 AGLZ4
967,787,044 *64EC4908B1736EBEDD8D889D87694FC9B077232A AG(m!
967,787,045 *64ED27DAEECB5C18D0AA103411E41E108C69686C AgM~
967,787,046 *64EA3D392975914FCD16C9985A77B5DF905DC2F2 A.g
967,787,047 *64E53091441EF8E536C7F4A33D2AED75E63C9EC3 AgM3%
967,787,048 *64E40193C7429B8D74CDCF2A50C694AC45740677 agm318
967,787,049 *64E1F8CBB8A4571A6A020E99007D8B688195F561 AG$m9
967,787,050 *64E6D1701E1DE3465771C8D3170A9F22C6E47965 AgMC_
967,787,051 *64E2F526C28892B9AF88E3226566288318D55BAD Agmiwiq4
967,787,052 *64E4BEC40AF60AB02C67B265B22EB5CD62F09000 A#GMM
967,787,053 *64E9741579AA10676B0E5E1A8134300EEBD6FF24 AGM-t
967,787,054 *64E4EE9EF9E87AE70FBA476DDE28FFDFA028A922 A.gMt
967,787,055 *64EF3A6B78AF28585EC51470E0898589F413FD4B AgM=u
967,787,056 *64E859529B27E0603830C573EAC2C2F7780946EF AG&N/
967,787,057 *64E7AD6040A9339A2E71DD2C62964F48A6530F32 AG
967,787,058 *64EBD6B77D7346EA8C62C0376F9C9FDB6FF96C2E A
967,787,059 *64E4E070F9CAF66B800C4ED206F238EEB33DE40A A-:gn
967,787,060 *64EC76E0F8C77441437175D654103A3641B8FA5D Ag+N1
967,787,061 *64E330867C0285339189786956E6F276E1A09F73 A/Gn2
967,787,062 *64EB51615607CE2E44DFC0BF8DE3145B8920D8F9 A$gN3
967,787,063 *64EA775A5C2BC11680FE62083932D146AA66254C AGNASAGN
967,787,064 *64E167565FA97D4E015EBF81567C4B171BF60DFC Agnaten2
967,787,065 *64E8BB06DFE60C200C1E4B2B3CA7F68C1C3F7078 Agnd?
967,787,066 *64EB717CABD93E7B45B47E599FAD05473E5528B2 [email protected]
967,787,067 *64E3E5E48014E79BA8A37173A1AE9977A3644EE7 agneliers
967,787,068 *64E93A7AF1CF887F0F82E3191A5D0ECCDC0F55E8 agnese7
967,787,069 *64E424CE55D9A98A4B70EA71CB390B9923A96D22 AG-NET
967,787,070 *64EFB9F3E8E780B8C095966B122A3C268DA68755 agniierd4
967,787,071 *64E4E7B6D17F995D3859F7F711644D503F78AB6A Agnikkul3
967,787,072 *64E539AF031AA71DE61D71669FC5FB234E47261A agninkr2
967,787,073 *64E79E23DEE02233C294C4615AB2354CD8CA4D30 agninos6
967,787,074 *64E3BD94CA0F43694B83961F0F0121F4DF5BD63E agninubs
967,787,075 *64E2D5BCA7EAB51C6BD59877237A1231F8D44A3D agniriel9
967,787,076 *64E6C8F883AD1361D5DAC41BDBF890172084CFF9 agniris4
967,787,077 *64E9BA65CCDFC910C293BE0041C1D28934FDE479 Agnizeds3
967,787,078 *64E96849BF5D6AD74B65660EB9F5916C53FC2DD5 agnoletto8
967,787,079 *64ED0E74E6D05101684FC52516CE2FEA6FF3E363 agnooyntos
967,787,080 *64EA4AC32E38B49736681C5F62354911A5B56EB8 AG+NY
967,787,081 *64E51AE14C0F593C067F953DFEF3E9A3D7EA066D [email protected]
967,787,082 *64EC07785CF7972F3105E7EF87114502EBAD0393 A,)GO
967,787,083 *64EE9991A518B5620B72F1716DCA20DF192A98BD AG/o;
967,787,084 *64EC7F4311797CB60D1F3A605D75F8724AE78674 Ag.O:
967,787,085 *64EAE1538B108206F58579665905B86FF2349DF5 Ago9F
967,787,086 *64EBDBB47DDDFB620EC4D28E2EFE605EF87732A8 Ag,Of
967,787,087 *64E6BF37F5F050E909B3D75A8C60BA0710EEDC6F Agoglu
967,787,088 *64ED91DF8F737FC77BC871D7E4D4C1955C7B47D5 AGOj2
967,787,089 *64E3D9A5141C4D5395C357064597D18FD6FA4928 Agomenhs8
967,787,090 *64E170885945B942C56844E4BEEE3F6E0D15B7A7 [email protected]
967,787,091 *64E679F4D09D3C8E872DF324E248EF42C3CB4374 Agoniseront6
967,787,092 *64EF738958676E5F378BE84DFA7020DD2E20A2DE Agonisinglies4
967,787,093 *64E3D67725109CF4EC825302C4A103C3131C3697 AGONIZZANO.
967,787,094 *64E21898E6993FD80D32E82F80C88973F5EC35BA AGONIZZERO9
967,787,095 *64EAB13E5B167FFF97430EC8383C282E859F7F2F AgoNq
967,787,096 *64E46B84784F889F56BD701444E78280FC1CA8DF Agony Jockey
967,787,097 *64E5556D987C267DC9EFC041E9380B6A5DE6CE27 AGORd
967,787,098 *64EBA85971D1F5FA8D3FF322807564F3BB41ED09
967,787,099 *64E671BD61017956C859083CB0E5C8B8ECE86D09 agouies
967,787,100 *64E4C79E0F5FA55B1CD71994E7C8BCDE8E2BCA5A agouraki7
967,787,101 *64E39AC77BC1AF26903F363D07A24EBC8531E2C4 AgOUW
967,787,102 *64EB95C21EB494F2A2A9845566DE189361047950 AgOwt
967,787,103 *64E2114AB8D170531A70D745B03BB35AE81E5CBF A_GP%
967,787,104 *64E3C8AD2CAAE133DC3041E25A578622D09365D3 Agp)(
967,787,105 *64EF3C81CEB1828BA6468BCEE20C6E9DE975BB86 Ag)P4
967,787,106 *64E7A8D1188C80476E14B16824A236180CC19E0C AGP6w
967,787,107 *64E98309B44A6FC5AA458C73F4343F3A963490D1 A#GPA
967,787,108 *64EC5E12949CA6B9883FC7FB59BF92464C0BE347 AGPCP
967,787,109 *64EF5E80E0562F006EAFDB14189684B8BBFE2FA8 A:gPI
967,787,110 *64E97E9E10CDD6A8BB918735BAED595B0406C0E7 AGpp+
967,787,111 *64E99F20DF047BDABC68DD7772BB8870268B0E17 Agppi
967,787,112 *64E7EB9385703E21FC1297F20CA28BE5DDFC9B9B AGpQm
967,787,113 *64E287DBC4B4239686F20D083B4AFF4DF3409ABA agpuriya9
967,787,114 *64E0FD000CBC522B2337E7F56062112EB5491058 A=gPW
967,787,115 *64E7F80EE48131E4FE01F0C1C151B8C1A288D09A AGq)&
967,787,116 *64E61603A9FB676548DED5F56ED93C6D84121ECE A-#gq
967,787,117 *64E2957BC121958241FB7AF83B4DE52126D06DA9 AGq!5
967,787,118 *64EE327C83715F963CC89D14F9EB1B5C366625B2 AG;qC
967,787,119 *64E171A459DAC743699CC9C4DD0E1CF3FC533457 AGQ+d
967,787,120 *64EA200E64BEF00AAA87CAEB7DEEF76BF4605FA5 AgQDU
967,787,121 *64E2C4E163C0BB3B94281D86B8656A56B97807DD A:GqE
967,787,122 *64ED7EE8C7F2D19A53A9F251A9401FD4CB8FB1D7 AgQGQ
967,787,123 *64EB3BF7372A9DBBBBFFBFF0128FE78E6F690035 Ag/qj
967,787,124 *64EC1C45081A3BFFBC44F28DDBEE0FEE4152BC44 [email protected]
967,787,125 *64E4CE6043D2B8C9EFFEAFA64549A231264F728C AgQ_s
967,787,126 *64ED1552ED9E9264736F9F4BE25DD24BBD4675FF [email protected]
967,787,127 *64E2179DB4692D0916751A9DDDBD97A2D50D8C3B A
967,787,128 *64EF0E1472998E9EF3ED2E288EFA430EBD41EE64 Ag=!r
967,787,129 *64E7C5F171AC40B4847359A614B5EE2EFA0DE71B Agr).
967,787,130 *64E725A80E5C9D3EF6D0CD97EBD58D137E06C4A9 AGr;1
967,787,131 *64EE5EE852C3061E9BDB7925BB7657C5B586F305 A=gr9
967,787,132 *64EC625630926E5B2851ECF2C5173B4E593E62EC AGR)A
967,787,133 *64EC0E953A8091A1AE3C6D8393049617A7EE1575 agradar8
967,787,134 *64E28427DE430AB7086710BC033A532A95DD342C Agrafa?
967,787,135 *64EB8322BE5FEBFDD634B72AF2D1F35BA0B70854 agralba9
967,787,136 *64E4FB3C23DE45D7CF73A1F359F6B10176E1F071 agrārais
967,787,137 *64E81716E235196BA872B5E5BC66A52BFEC988F3 AGRARIANISMS8
967,787,138 *64E75E7BC2B2E7E4D4F99D0D139A9AEE4DDFD714 Agrartreibstoff
967,787,139 *64EB15C2B8FD441C507B50845E28741DCEBF07E9 Agravaised
967,787,140 *64EB554981E76E7F38AA95C78D9C2CFF9A57A001 agravei7
967,787,141 *64E158170428706A412B4269A4BB3700C32E8BB4 agree'''d
967,787,142 *64EB9F2EE97C1DF16868C718825CDBC3B2243C47 agreedon3
967,787,143 *64E7CDD377D68F3F41FFB9ED4275CD5C04EE45A8 Agregaciing
967,787,144 *64E30372C0C961BC88B69A9181BB6A625200EE09 agregāststāvoklī
967,787,145 *64E8FDA9436F756F27B1D1BB29134C9B7EF176D6 agrenenov5
967,787,146 *64E7E18DB6A6CC1D0C987B708E63F244C0293476 Agrepbswing
967,787,147 *64E6519819A86051600200745B270E191AD4F09B AGRESIONBSW
967,787,148 *64EC04B2635B54344B0E9D42C6075C0CD1124A88 agresoresing
967,787,149 *64EC4218A996BD0FB470AB87E374842824819C1E Agressen7
967,787,150 *64E06FBE968C02F37C29950CFE7C48ABBA1FF701 Agretsum8
967,787,151 *64E2EC7A0674E6B912239DCD101785A56BCE58CF Agrijnen
967,787,152 *64EF670C0496EB392C5066D15764FCFD9953A291 Agriotina
967,787,153 *64E93A04B310510705400BEED8A09B613926630E AGRIPPES2
967,787,154 *64EA38CCDE104DDE15C1CAC372F0434E754B7064 AGRITURISMIVALTARO
967,787,155 *64E4BEAEC258FEB9BAE8D65B9F5C3EAF6AF68951 agriusn1
967,787,156 *64E8B28B39DD371B739DFCEFAAFA3C0FEBF2C2F9 A;GRj
967,787,157 *64E8026B20237C1A6C7EBD694C013CFAAEB88E92 AgRk?
967,787,158 *64E6E4D3B9493CEFB24FC9F329433F25E09A4321 A%GRn
967,787,159 *64EB924AD278B0EF03DC565288CEF59991E3785F AGROKIMIKA
967,787,160 *64ECB14D8F3075F3D582D1B61B0ED0375C306937 agrontal
967,787,161 *64E04A8FDD24D28F171AA0F43E4D0683E4DEF1E8 agropio160talk160
967,787,162 *64E38D3E294F1AE604926E54AB7BB82247784F9C Agroupal8
967,787,163 *64E041F66760C9A102653A1077037B6FE6006E43 AGrP?
967,787,164 *64E705ABD74D6CF0262AD83FADB0CD50696CB5C2 AgRSI
967,787,165 *64E0546D05E6AFA78743920E3BBBC164746DD11C AGrZl
967,787,166 *64EE9BDCFEBE425E5B9E4C2307054616C404BFF9 AGRZw
967,787,167 *64E1C1DD4F23C253FEBA30158DD41C20DCE306B9 A_g?S
967,787,168 *64EA059934A0030FBB2DA2F7BA0628B7C67C0C41 ags83j3
967,787,169 *64E877420A77608DCACEB56877A3BE87AAB85E05 Agschaft1
967,787,170 *64EB1B18C41C80D27985BBD430F8102F47F0E9D2 agsfbsw5
967,787,171 *64E7FFEB6184C88574F277F29806D328D36211BF Agsfritt6
967,787,172 *64E2CBE3214CB9EB3838F1EE7923A8F51BF9CBE6 agshedened
967,787,173 *64EC41B4D87430166C796064A0D709E139758A12 AGsiO
967,787,174 *64E152520729AC4BE6B5B6EBA35408FDD170C079 Ag&sm
967,787,175 *64EB3FA23E79645D8397825C958C3CA2DD18BD0F AgSN"
967,787,176 *64E433532A7BE7BDCECF3B17CE89FFB37A788BD1 agsorden7
967,787,177 *64E733A653A56BFAEA20F5DFF11A366857F29878 AgsQ.
967,787,178 *64EEDD7D6A4AC1A250A17706D5A0CF04B6F4C605 AGsRC
967,787,179 *64E04CCA41552F55A7CF7C5A1494DB581D74E659 [email protected]
967,787,180 *64E931024DA358FC1ABB6496951420F9D0E26A26 A$gt#
967,787,181 *64E0586B1A7BCE97347931A73A8640CC5BCAC385 Ag_!t
967,787,182 *64EFD6E1142BCAC674479AA06E2DF55B9FCD000E AG#te
967,787,183 *64E2840A3DFEFCC85F4E35BE17CB0193F99E2E93 agterbok0
967,787,184 *64EBF785A655C303208EA6265DD9F123E2AFD16F agternaamed
967,787,185 *64EEFF7578031C1FA159CC664EC62520AEC7949B agtgacaccacaagaccattttcttttagagtctatcctctttacagtggccaagttgga
967,787,186 *64EDF87480D58188DCFB7ED1D2840095C7FFFCEA AGtGQ
967,787,187 *64EAEF9DDE97973767138F722109498E07C68FE9 [email protected]
967,787,188 *64E6233F53004D27FDC350678F7DB72605AD60E1 A:GTK
967,787,189 *64ECBB591800664D0FE12EAD13F60847CA9DF60C AGtKM
967,787,190 *64EB803DA9D48113859EB4262A6A7320447870F6 A_gtq
967,787,191 *64E0D6F497DF26783D9F04AE7D36225D38E9F34F agtqe
967,787,192 *64E6870B2C0FE1B2158092432A63137E0F8F077E AGtWMIs95
967,787,193 *64E0DD5F6AB93B5EB90E02FC9CF8DC50D7E376DA AgU"+
967,787,194 *64E57BBA55F1682929A2EA11C97948CB7CB2A04D A/gu_
967,787,195 *64E0C9E29CEA382E8FE6E2EF33E1C3F1903F58DC Ag%u3
967,787,196 *64EB6FB077075CDA413A3E8A647402DB7FA61F4F Ag#ua
967,787,197 *64E1B51DE091D5F5FD4910392F24B4DDD2A2696C Aguaite7
967,787,198 *64E088631D84156E0C2B6ED1EE7007A3AD43E025 AGUARDENTERI
967,787,199 *64E056038719A51705467173C78C382E196184DD Aguatab0
967,787,200 *64E0461DED7DE77BE74CE552CD8F0C575D4D7FC4 Aguazuleses
967,787,201 *64EB35CCB93BDC1C628EC3CFD5E964225A85CDDC aguentados1234
967,787,202 *64E048BF67B770132B4F71DD94305CDCBE3B7245 agueralopes
967,787,203 *64EE62FDAC321C7CA287A49F4DBF271972A8DF8A aguereberrypoint
967,787,204 *64E3A71F5E264D5DCF5BDB4667A1807ABA18F36C agugt40
967,787,205 *64E3A30C3B8B7ABD24788E5FF63CDB20A2F2003B AGUIE123
967,787,206 *64E21EDC06CDFEF44D1F30B40D94DE5019714774 aguilerapittsburgh
967,787,207 *64E0FC42879497BA09B1D6E416AA5529C82E4AF8 aguitarrloiam1
967,787,208 *64E26DA002709E767508174E756C7C02F1723060 agukuhs7
967,787,209 *64E3210A38D539358F90DCFED3CECB91DEBEFDDF agulnicked
967,787,210 *64E98E657A4AE062027F83C5A474D707B59FF40E agungpranowo
967,787,211 *64ED1B4380EFB4E0E77AEFFE5B094BDCEBB3AEFE agungsubrata
967,787,212 *64EE801774A070026B1C36BB43630C13A49465D9 AgU%P
967,787,213 *64E4886953420252476FE8CB21F5B9BA52365D97 aguratoh1
967,787,214 *64E345333A161E2413C75D12F20F5224B4794746 Agurkje1
967,787,215 *64E7D08DEFB7A67F828651BAEA5777653664170D agussamosir
967,787,216 *64E7BDE2A3C0D2AC053115BF4FF67B4B3E221523 AGUSSOL
967,787,217 *64E5CA0CE7136414800413DC44896D1D6513B783 agustin140
967,787,218 *64ED48455E4C96C8A8301B3A051D5D018979FB7D Agustin878
967,787,219 *64E08619E063D12A4D389CD2ED655D3C5AF62FE7 agustin.ajoku
967,787,220 *64E5ABAF98E5E25CCAA75327AC8BB0390CE605DC agustin.augenstein
967,787,221 *64E9F082DFF8079356BDEE1565151A593389AA74 agustin.bennett
967,787,222 *64E22C57AFC733C6974C8F4429AB1A016D05DA4D agustin.bonkowski
967,787,223 *64E167DB0420E4F7EB9D9ACCD2187CDB34B40A79 agustin.clearo
967,787,224 *64EE54B3D8F71644614566F80C853A3282655C0C agustin.demelo
967,787,225 *64E207A59071A21DBBC475E1BC894690179BCD0C agustin.derks
967,787,226 *64EC17C8EE1BED9A87CE5131627EF59304269966 agustin.deshotel
967,787,227 *64EEC6E07C95C36AA8E169B6BF7EB3170220393B agustin.feldhake
967,787,228 *64EA1FA6ED3A297EA2B8F0B59EE367AF962FE221 agustin.goslee
967,787,229 *64E2B725F086E23CEFD22BA9C4221E2C8E4CF9A0 agustin.hansman
967,787,230 *64E7A97E3695D4F1449CFF625CFACDE961854C11 agustin.hermus
967,787,231 *64EC556D778C277A1C72845C76FFB79260A05AF2 agustin.hickel
967,787,232 *64EDE1462A7B00C4823BB3D0946DF77952BC2ABB agustin.hutnak
967,787,233 *64E4FCA496EB16446B702CA5BAB0C6B865E0BD02 agustin.kriskovich
967,787,234 *64EF2777E106B95E9775A09B17A2CE5127F42B57 agustin.lapora
967,787,235 *64EDAE5C246CBC4F47BC05789F96823C71040E41 agustin.magpuri
967,787,236 *64E4265634A170262D723E2BF03B126ECC812AE3 agustin.meshew
967,787,237 *64E71E6B399F196D78B44492FEAD5AAD97A22543 agustin.nienhuis
967,787,238 *64E730F850443479B289E62371B055E6281C032A agustin.parda
967,787,239 *64E4CEFAE9294F642EE201630D145A2ED45195D2 agustin.rafus
967,787,240 *64E63AC54F02316118E24BA2BD88085A8BF235D6 agustin.reiterman
967,787,241 *64E5D0FB7EFF166804C1880CC56C9D9417545D65 agustin.ringenberg
967,787,242 *64EFD5096CA5F85BDA60C1086ED8CEE3B6E4084D agustin.ritz
967,787,243 *64EC61468076E876A17268128BE3C7C2719F8D57 agustin.rosenquist
967,787,244 *64E9DD337AB9BBDC74E77B9ED5B14332E0EC5543 agustin.schone
967,787,245 *64E07B93510FADA5EDAFB273E66DBF4ECEBFCED6 agustin.simien
967,787,246 *64E65C54D2F75145169C7AD0E5D8729BFD586E6B agustin.speilman
967,787,247 *64EF0F60F2BFD9506E3D1B3EBDC75866C8D08443 agustin.vukovich
967,787,248 *64E8CC30B7AC8F9894C9D90982C3CFAA9E0F3F99 agustin.wisdom
967,787,249 *64EC68B95CF24BCC7471700BCD21B2EC95143C74 agustin.yauck
967,787,250 *64ED08B34C0DD6AAD97F50D0095D32A3CC97469F agustin.zollinger
967,787,251 *64EBB7D47AD2742EC870DA59FCD11688EE39A13D Aguu
967,787,252 *64E9AE165A7B69B0DDEF5355807BFDBCACB54E22 AGUwT
967,787,253 *64E09466EEFC97757A3E4427FBF6DB7E5517B4AA [email protected]
967,787,254 *64EE56C4A2E443F5766A3EFA54C8308ED0FFD948 Ag,
967,787,255 *64E134815458FA99D8FFC7A75152426B32E7CC39 AgV+$
967,787,256 *64E8B6B2D89740ADAF6F6390AB8DA1FEBD1F8773 agv5h5altoe
967,787,257 *64E3ABC8688DC43C33A92D7D216B5ED8F3A47813 AgV9g
967,787,258 *64E9BA1E4B7A65E5AFD0AD59596D3F80244AA176 AGVANDORJ
967,787,259 *64EBF6C6FB66CC2016A6E99390593E81E8C01194 AGVDg
967,787,260 *64ECB89A73147FB13176149CC8D36445721F31BD AGvEV
967,787,261 *64E5B9035FA3A8EB2526D66A13C5D0496272E441 AGV-G
967,787,262 *64E909E34A6ADAEE362ABBAB138AA3429CF0C51A A#Gvg
967,787,263 *64EA0282F73F546BBEE50087A5CBFD93516583F9 AG.vi
967,787,264 *64EF7A126E782731F251BDE3EF4ABBA0A61A7E41 A"gvK
967,787,265 *64E68CCFD90A82E612A2A922B6CC56FA20725204 AgvM5
967,787,266 *64EC7BCB478EB6F1B2FC3CC289436384F867DFB2 AgvNO
967,787,267 *64E764386145527A479700804A0301A1423A950E AGvtO
967,787,268 *64E853048A66513E1F4A3806AE2FB554A36EE616 Ag-vU
967,787,269 *64E264FEFE5703D300CC4816E3992535FF4D1ED7 AgVwG
967,787,270 *64E3F3BDF175C9612BF5F3E82CF0DD54464F2098 A,-GW
967,787,271 *64EE2C3732647502C53919C811EFAD94A84389B2 A"?Gw
967,787,272 *64E139B844710CC7F686B19624E89EF7519080E6 A/gW(
967,787,273 *64E66F49BC7D7EC41D0EF0AD120003F18B5185A9 Ag/W/
967,787,274 *64ED35DF3CBB6830CEB67D2690E44E69D95B8529 Agw;+
967,787,275 *64E4D87EF26B49E1A6A456C8B026785F624744A8 AGW"a
967,787,276 *64E53F0754EB9A2AB35D2A0CE67E87EBFDD0EEF4 AgWB#
967,787,277 *64E21597DA50A5FCA9FE08648C37DE6BFE25B8A1 Agwbkkws4
967,787,278 *64E7DFEE53A0070F3DF63EEC82A28E57713F0173 AgWMf
967,787,279 *64EC2F05A309B9CA753862CA77CC4B051D44171F AGW;O
967,787,280 *64E6A6E9F60A9F5E44E084E934999FDBA2E8D16F AG(wY
967,787,281 *64EC411609637C3C21597EC6FDC9592B1EFF43AE Ag"WY
967,787,282 *64E0E0E5076EA302C1FD88C144FF99F0F177B363 A-GX/
967,787,283 *64E611BFAACA9ACFF9C9D51FE07D7AB34F5C85E5 AgX5V
967,787,284 *64EFC62E722E8CE4505F8F5C180B2E353C621F6F AgX5Z
967,787,285 *64EB4ECF7C4B65A48B38E0A30C56C4A0BAC2AC1F AG#XH
967,787,286 *64E4C2F9C88BCB7B28B68E624E42BF662BA72339 ag_xing
967,787,287 *64EEA798862C32547125F1A806E386B6368CF2F8 AG%#Y
967,787,288 *64E161EEEF542BF3ACA886D48244B9BF42EE4AAE A,GY7
967,787,289 *64EF3735A61943AAF8CC73C404529F88CDE50ED4 Agyristaed
967,787,290 *64E72EB8CD5042F942906664813D7552D4179945 „agyügyességgel”
967,787,291 *64EF1F2B1833119D0ED4DFA5D506ED40090D5CD9 AGYW8
967,787,292 *64E55C008507A6DC34ACCF9EC2B31C570C76FD48 AGYY!
967,787,293 *64EE05E33AE6D22C0148051FD19F1104A550D30A AgYY9
967,787,294 *64E19264FBB9480CE08787342B6B38FFE2A48B33 Ag!(Z
967,787,295 *64EF5ABEBCF27147D5DEBC19AFC80A6B2D67A4AB A:GZb
967,787,296 *64E093E5B5C52AFAC6DD5D3F359EE936C8BC02BA [email protected]
967,787,297 *64EE10D0D52EE0FC34084161206B4100864B2008 AGZlR
967,787,298 *64EC92EAAD0E310328AF4C9308CCADDA15605E35 AGZWT
967,787,299 *64E0ABB4E7CB0445B406248356264BEA3207267E AGZ-Z
967,787,300 *64EFE3F3CFBEB899E5FA47082A203031D8F3EF52 A!H?=
967,787,301 *64E1FEF18D04B489EBD0E81E0103D71B3F7D0ED0 A$H+(
967,787,302 *64ED66D7A3EE1049211E81B26385BA0D9C119D0E A%&H;
967,787,303 *64E58082F160FEDFD4E83556A4EAD030268040BB AH(+!
967,787,304 *64EF3DE60E40B407C272463690948939652E1B63 AH$&;
967,787,305 *64ED20A30C761EB8DD846D7FB165A0851168425E A=!#h
967,787,306 *64E60497C7237BF5D53A90DA18901B54E7100DD0 A!#.h
967,787,307 *64EC9AFAFEC8DD924D54B17043582A8A57F596C0 A//h!
967,787,308 *64E61A69E782DED6DC2F05C8DFDAF5480435AA0E A.$h#
967,787,309 *64EF3772ECBA43348D63A09503040C56082821F3 A#+h-
967,787,310 *64ECF4EA77C3F4787224A54A914B9EA3D37AD7AE Ah+)(
967,787,311 *64EBC9C6E1BC82CE25CEAE729A4319AD36F32851 Aħ!=
967,787,312 *64E7E1CDDDC714341905F072312A56337E990173 AH053
967,787,313 *64E694A479321CD2AD5EF6A3DE72F912EC2D58B3 A-h08
967,787,314 *64EA8F0C1F04DE70A526DD514CD4C06A20B44BED AH&0P
967,787,315 *64ED561C9E9096D167760CA592D4AF8860C3D848 A=H0Y
967,787,316 *64E7CDB358B452B528B66672F58FC5E32AFD4B57 AH)1a
967,787,317 *64EB847CBDE5E3FC2B7157CD073F4E34AF75EA02 Ah1qj
967,787,318 *64E783BD71C546B826659716FDA9B14DB59F30D5 AH:(2
967,787,319 *64E52CECF0694D5BC9A39AD6BF662D9354683425 AH20E
967,787,320 *64E0B693F57770E4F47E8E7119496F206CFAA1EF AH2_O
967,787,321 *64E7B56A7DFD968F830259A31A722F5D5F715306 AH2)r
967,787,322 *64E7E17CCBEEF3058978865781017CC8F375E875 AH2Sm
967,787,323 *64EC9B0EF638BC47346C8BA1335C205F36B8D708 Ah.32
967,787,324 *64E2D93E614DFA5198CF7FC874B5E11420AE0335 Ah3ne
967,787,325 *64ECBB32ED8CF7E74E5537A15A0433163093E6D2 AH",4
967,787,326 *64E44478661ADD2CBF4163FD49D46923313F2E3B Ah4Q3
967,787,327 *64E5E62F48C1C9184FAFF53A0E117EB96A71A1B3 AH4um
967,787,328 *64E66683656B284A5CB21E77936C5363C15CB226 A&H!5
967,787,329 *64E7374E10851ADF335C9859297712A854D7E49B Ah50p
967,787,330 *64E2854EE0B922D068A74A219C76CD82D8827014 Ah%52
967,787,331 *64E6A3FD5F17987B6ADCF3CFCC5F41D462C3B778 Ah5U.
967,787,332 *64ECAC55A8EF79E9F8480B8B91A80B1F42EB162F A?h
967,787,333 *64EADBB673B049A0DDC7C0F6B21CBE16EA8A3CC7 AH6/m
967,787,334 *64E73D19515F2445011F572BFA000EC95A4B9DDA Ah-6m
967,787,335 *64E4C3B53CE22E9C09E81EA00987C3E4DA9DDCC3 A
967,787,336 *64E7230A976E0B034CB6B3892C095F9F44E5A361 Ah"6Y
967,787,337 *64E2EA05A15E8D4C72171A33D7E985FE3E160EF9 AH7,=
967,787,338 *64EEA24EFD9083599256B28316FB2C35DBE87DE7 Ah,77
967,787,339 *64EE6720EFD55A5973795E3EAC1BB54FA3FAD700 Ah7Io
967,787,340 *64E3AECB5964DE1D0C079CDEE89948EDF9BB091A AH(7K
967,787,341 *64E9401D40400806588E6FEFA62C978CD9E6A8F9 AH!7Y
967,787,342 *64EBB9DE6BD1FEB7EA5436FF4F039131C53EE71F A.h8(
967,787,343 *64E146DAB631D6878EC362D571626F6257A8026A AH8?4
967,787,344 *64E8602D6C9B989ACE440F53AC47F146440A0B20 AH-&9
967,787,345 *64E9027FCBAE1157E2AC241083A82D8009558FF2 Ah(#9
967,787,346 *64E964959B950756114EE56EB8D1FEAC07BA622D AH.93
967,787,347 *64E3BB063F0D66887FD976F1977F7DC9F9E65BC7 Ah95s
967,787,348 *64E174B4F76527ACBBE5C2D5A9A0FD509A697249 Ah993
967,787,349 *64E602E0DA26515636BECD2162D82EC25B44C447 [email protected]
967,787,350 *64E4735DF0E5025C2D53D9B0188439A6712A5E6A Ah9b,
967,787,351 *64E625137B8C1F19D4D20E86697810407501B86E Ah9H9
967,787,352 *64E0C3E25B12BB653CC51F1321071435E3511A13 AH#9k
967,787,353 *64EE4AE35C81F49A5A68610DE945B21CFD6E9B89 Ah&9w
967,787,354 *64EB6C5F42F70415529A46E93D3A6FEF129E363F A"H.a
967,787,355 *64E50A8E03851EB426C5B7EF39C88DF0E177C2AA AH_"a
967,787,356 *64E680A65084B1BDCAE3FEAC6C97CCDE488C4C65 AhaDp
967,787,357 *64E9F801EBB50730F3ADE1F94CA06399AEADBB09 Ah
967,787,358 *64EE581D0411EBFE64A3571B5A823434A6FB5CC6 Ahafk
967,787,359 *64E8A283B795110706F5288742BE5E3EA4522E52 AHa/G
967,787,360 *64E614AAD8BE85308CD79F2417FC0287C62CC552 AH(aK
967,787,361 *64E182653911F59E709280F42FB5B531B8918939 AHa$M
967,787,362 *64E8F427CDCED055EE330567CABF128F7E4EB1B7 AHamC
967,787,363 *64E026451613785A0052DD071AE4BF06124099B7 ahamizated
967,787,364 *64E1E4035E7B4D3A22AECBD9DE26C5BCA2F65D2B AHANS22TONY80
967,787,365 *64E11D5939030E53F174051A5A2DB3327A43EF11 AHanU
967,787,366 *64E5002583734D0AD066A5AA2A3AC2CF6F7991A4 AHaQ/
967,787,367 *64E96628205461C66F1D7680DABAB31EAD5D9F34 A Hard Rain's a-Gonna Fall
967,787,368 *64E9FBF735A2D685F6AE7D696970A7737C8BC425 Aharlamak7
967,787,369 *64E9E7BCFF56117A2757E6B90ED805FF04AADD22 AHa%S
967,787,370 *64E176AE69F239ACBB8EDBE6B1A1AEFADAD2CD5B AHaSf
967,787,371 *64E88E0216E47BF568DBE1C4D093DEE9E29F9863 Ahasisnl8
967,787,372 *64E65CCDD0DF457F70DFC70AADF6A44C965E5F85 ahaskins:cherie
967,787,373 *64E04540D37046EB7D4AA517932DAAAB5D723F50 A-HAu
967,787,374 *64E0468EC407FBE31844263235D11AFC96E15148 ahaybsw7
967,787,375 *64E7784AC0FB311FD9A3F7418A819EE27B71D836 Ah:B3
967,787,376 *64EC5E8DBD3FE9A99DE25200546C2E70B791B43F AhBLO
967,787,377 *64EA4546561158720245FF1B50E4522019594ED0 A,HBU
967,787,378 *64EB7AF43318B21BE594F837FD98486BAC7247AB AHbW8
967,787,379 *64E2EDB9ACAC1CB4BE53E5F9B418672827E6DC0C A"Hc:
967,787,380 *64EFA7936710BBACFC06A65762E88E67297357CD A!h/C
967,787,381 *64E63E3714B6C1A2F22843061620F4C65B6A4CC7 A(h#C
967,787,382 *64EB173FF34609801E2C09C7B37DC241C26AA83C Ahcainema
967,787,383 *64E5B9BE1737177CD4562BCF271019B84C354503 ahcarubaed
967,787,384 *64E3449CF05B400C3B3CE0F0F6024B200276ED45 Ahcatan9
967,787,385 *64E2A13B9A7C444922890AE7CF209209BB1AEF7B AHC(e
967,787,386 *64EC4CF29F214238E3780B24FCDFB334B7164B63 AHChT
967,787,387 *64EDC3D2F713D042440A9ECEEB81F5F9E85C4516 AhCmB
967,787,388 *64E4DD0725E1E819EE5FFFA0A9084337E1ED53FA Ahcnalf7
967,787,389 *64EA6BEF1136E31D7F6CE501DB1A78DCAD3A09D4 ahcnarbed8
967,787,390 *64EC40FD69CAE44F5C566C4B122E6EA87C3C06E6 AhCo9
967,787,391 *64E134B0FF08A74F0EB0777CD3A218E14C356F3B ahcortaN
967,787,392 *64E9BF3A7DE2408A67AE589311AB9E0010F0D850 AHCqO
967,787,393 *64EDDF68BA78A0812BCE143212D4FC606AEC5CD4 AH,CS
967,787,394 *64EFDCA6135CE70B13D7C1333E018A25048A8558 Ahcsdood5
967,787,395 *64E5CD8CFB34092DC118685F7EB31EE1B65A8BB2 a hctac ot emit ni tsuj renroc a dnuor ot smees syawla
967,787,396 *64E37C55EEE83B100A5FEE28495CF5D2D8BCA924 A
967,787,397 *64ED0BFEFB7A66E06E0512EA5860C4DC55864303 AHd2O
967,787,398 *64E76F0BEA4DC7F18A56751B708DA909705300E8 Ah,D3
967,787,399 *64E9B5885184A0E52CC5FE83E93081A1CFB820D0 Ahd?a
967,787,400 *64E9BCDA1F39CCBD77B31E5DB66418FDE25ACB7B ah-delican
967,787,401 *64EBF92473C92B7E61A65F9BE7D0417A408941CB [email protected]
967,787,402 *64E6EA133850D12043CFAAB02BD1BA6C2A959F56 AhDP/
967,787,403 *64E79726415B41E04170BB6C812A153D4A278558 Ahd-t
967,787,404 *64E35978B539B8B6B7CE03B20569B1DFC5B6E1DD AHdYU
967,787,405 *64EB5E6C369100D758A9906BCAE54EAB13922909 AHdZN
967,787,406 *64EB1BA998AD5A4F314111B7AAA376BCA3B781BE AHE<
967,787,407 *64E6E25375128C7570D05F6F1982A53DE425ECE3 AHe--
967,787,408 *64E87B518328A724718CC38E721A4C42DA823DBB A$he?
967,787,409 *64E2521CB4D7DCDECFC6FDC37400AA3783EFC0F6 Ahe9k
967,787,410 *64EBD9B4A5FC59A8E8851C2CD9142A4E607C15F4 ahead.lol
967,787,411 *64E01D2DAF58D31EC7152D664764780E3F3967AF Aheawan7
967,787,412 *64EC60ECD3AD94DCDDA2B988548FAC69C45BCB8E AH?eC
967,787,413 *64E4D99B2FCE8D9D687DEC24A1A9A7FF6403DE5F [email protected]
967,787,414 *64E16B61D7BA3147E82A769D66856F21F29D863B AhEjj
967,787,415 *64E6D29039971F01EA3BFF9DC6A468F7EA1965CA A/hem
967,787,416 *64E650586D3E6DFC6D57D0925F9A94E5FEF12FDC AhE&O
967,787,417 *64EA2C883056FDF16ACF3048AC6B160DCC3BFBB5 AheqB
967,787,418 *64E9341796C63E3990263BAF6A329826DDCC237E ahestems
967,787,419 *64ECB2D4D1DA8023777AA027FD2F93BC5A5D258A AHew,
967,787,420 *64ECD4DB4BA4D9514F2779AC18A9A470B5D3A796 AHe;X
967,787,421 *64E141F8A72D1F66553E0810DE3EA434D6927214 [email protected]
967,787,422 *64EEB0A1589BF4663E37FF24AE5C1AA42AD7CE55 AHFB1
967,787,423 *64E118125B7B325224B2CD45A10F0C21B22AF00F AHfF7
967,787,424 *64E95B34F7CB580F7DEC9166696616D882F2E435 AH&fq
967,787,425 *64E727658909E4818D27B8B4E0BD2947C805C52F AHF)Y
967,787,426 *64E816DE49446FDA4135E191A26DCCCFBFD0819A A-%hG
967,787,427 *64EAE20075CEC6435A658827917C0D36513879A4 A.h!g
967,787,428 *64E03E77F403B1A809342FDDBB20CE00BB4B6088 AhG$2
967,787,429 *64E87194318CA1266B6B1AE4AD20B12C7506A6FB AHgA"
967,787,430 *64E705E8A02F706C2EAEFA989C1466D25FD62A23 AHg+a
967,787,431 *64E4EB0F4A07AE8FF52737AC9BBB3665DF3960EA AhG!c
967,787,432 *64E4436EBB5A6FA34E83E6BBE362C82D25AD8ED8 AHgD!
967,787,433 *64E5576A497B4367B37C3352053A09002CEF55C1 Ah$gD
967,787,434 *64E16F8500597D56C4BA98AAE94206FBCA262A0B AHGgS
967,787,435 *64E12AABB7C7C1BA73F7C51DE3E4EEB711D009AF AHGGSLvTOozy1gaZjJ3OCA
967,787,436 *64EC528D5EF9B42D08FCE778576C51CCA41485E6 AhGhI
967,787,437 *64E19033F198C5B6E5B02983DF3D36D7F097F63A A-HGK
967,787,438 *64E36AE08151BCAC4DD24E1B36937B25CB31CCAE A=HGO
967,787,439 *64E3CF5F569C74AC23B883968C4F3926697AE73F AHGvp
967,787,440 *64E242CBD99E112E9BA5B067427824782DEB93D4 A)HGZ
967,787,441 *64E71B00CF04CC9B044F9421B5A7A35703D73915 AHH-:
967,787,442 *64E1CC2143FDE758CE260973059937846FA3B364 AHh%=
967,787,443 *64E4FAD8BB189D20927ECD4B5A045C58E67FCBF2 Ah-H(
967,787,444 *64EA39376F2EB0D1971EDE7FFAF379B8B264BBDC ahh.alas
967,787,445 *64E28E798B15B3DE7CC00EE3545E759EE916FAD9 AhH/l
967,787,446 *64E36179F397CFDB741743BFC060BD4FED7C1C43 AHHM;
967,787,447 *64ECBB2ED33B5DCC8410AB9A8E14CBF7D8EED350 A"hHm
967,787,448 *64EF2D76BF9D2B5B4187BE9BA314BA1A492C3E84 AHhSd
967,787,449 *64EC77BC79F6B5D8A19C27E86D094D57E360C8E1 A+HhV
967,787,450 *64EED4E44237AEDC18FFFD10CA3634D1DDC33E68 A%hhX
967,787,451 *64E9E68A56A0D601039D29F9CA184D2013B636AF AhHYH
967,787,452 *64EE7F48CC077EFA0B7546BB5A968CED873216BF A:HI(
967,787,453 *64E93F8E6CC83F4ED491BE4797769CA60B407D87 AHi+&
967,787,454 *64EF97D1948739488985A74653DE56D63B21926A AhI#?
967,787,455 *64E77E937C44295D3572E7C8EF0344BA08F1F282 A-hIB
967,787,456 *64E831C8A98593021E788D717F47C247069BEA44 Ahidjo9
967,787,457 *64E851B43B3338155BF59CF55B4D1C9DB5DF8FEE Ahiemimi5
967,787,458 *64E2154D4C80BA5E4CA4CF900F321AF561058B81 ahietbswykgju
967,787,459 *64E90B1A95B7DF09B7F55ECBA5FAF862636901F7 ahietnegs
967,787,460 *64E1958AF7E57F95823C9E4BEE404EE3A81DD38C ahieur
967,787,461 *64EFE924F3AF35B7F4F3489F1BB960E3174BA8ED A+HIF
967,787,462 *64E288281BFBDF0B5655724B2B4094AEF4B0AA24 Ahihl
967,787,463 *64E7724B3E4B321131D26A0BAC08D759A43A6058 AHIMTB
967,787,464 *64E72236F8ADB77B118CB53916EE4CA0D0D15218 AHi/p
967,787,465 *64E600BE10C799122E43CBA53B4C76D787D380C6 Ah+iP
967,787,466 *64EC39363E6E5D5BFA488B0539A491E41763B20D A!hiS
967,787,467 *64E227F8DBAE05918AAFF39085C2BD69BCAA40CC ahissant9
967,787,468 *64E8A2CE7459B20ED417B9F56EBB1FA03F5AE7B2 ahisuuhc6
967,787,469 *64EB5B0E73A8DB870D67D0F754E0EC2ECAA9466B ahittluk5
967,787,470 *64E843A061A094954BAECB7810C559135DD85434 ahivamih5
967,787,471 *64EA8F6273E095B5184A8BBED9678EF0E5E49793 AhiX(
967,787,472 *64EDEA21564391B517D9247D6FEA83BED12E3925 Ahizneding
967,787,473 *64EBFBA3508C7762900714748E75C8AB318FD864 AHjO(
967,787,474 *64EB6D53FACC0E985E4387A00B7000AC04A03FCA A-hjo
967,787,475 *64E2FB1E02B80B63FDEE3E26AE48D76E3F26D9FA AhjSk
967,787,476 *64E263F521C3867636AF6DEE345407766E36A73B AHjTX
967,787,477 *64EA41435098074B9BBFE6A5A110E4A17295E36A AhjYT
967,787,478 *64E8CE96E42D35403849F646EA87B61A6FE6A44B A?hK/
967,787,479 *64EC85E275CCC26BD5DB778A539D0A8DA884DB83 Ah&
967,787,480 *64EE94563095C2438FCA6B1F244E20C8BBD68662 A.hk-
967,787,481 *64E7FDE8C488C802D99F05FDCB97021D650418F9 A)&hk
967,787,482 *64E60F3FCA04F7E515D386633637DEAA9531128A AHK5p
967,787,483 *64E4D11A537B28688FCB0AF73BE0ACEC635825F6 AhK6E
967,787,484 *64E14C6320CD4FAD57C34F5B681F6148AB4E5058 AhK!A
967,787,485 *64E09D8C028B0989F8634F295637D0CBE8B82FEE ahkiolahing
967,787,486 *64E09827F5B39A9690B320F152621AEB1BE9D594 A%-HL
967,787,487 *64E32FCE26E64E8780BA598792C64F1012AA1CDA A!&Hl
967,787,488 *64E788E8CB109A4CA22DCF5A53E41628459D84AD AH_l!
967,787,489 *64E31C9C42B5D9629DAB4C9D69A00C58C7DBFDBD AH
967,787,490 *64E5C96820A2C2B958C49BD2986743D03EADA8A0 AhLC3
967,787,491 *64EF569CF4E6339485BA29DF1685DF0438F08792 AhLE(
967,787,492 *64ECB1D1EC65494843D734CC8A59515D1F29860B AHLeO
967,787,493 *64E5C0153A21F16F57F5E4B5A39F9E1247848155 Ahlessek0
967,787,494 *64E77873E56FBD49A4A75DA6AC2038C550BF2369 AHL!h
967,787,495 *64E681FAFBC337BA55A0598067DBB5936174A32C Ah(Li
967,787,496 *64ED06D3CAEE8F9859D949A691CFD941FF7E3651 AHL+N
967,787,497 *64EC687E04D29D72E0B081BAF97D06C72C556435 AhluM
967,787,498 *64E47BB1187AC768BE03D99218C9B112A0012C7B AHlw"
967,787,499 *64EBD9DDF97B98EFF9B11678A19D9096E81EF0D9 A/HM=
967,787,500 *64EE29A6C67E66C365319AFFB8FBD195BBD36A3C AH
967,787,501 *64EC97AFA577CF5C085475E4D5EC4D915481F76B A$H.m
967,787,502 *64E9C3039FF15735C469BF2B044C2C712A498F5C A#h.M
967,787,503 *64E03259184A9E3B8F1D9115F6D5E9C9A4618545 AHm6,
967,787,504 *64E3EA0881C2801CCE95427C1237DC563D83D2B5 AHm7)
967,787,505 *64E8977F485074789D63BB5AC28635CC8D03E833 Ahmad812
967,787,506 *64E5C23DAA669B70809213F8ABA2B1B601D437E7 ahmad alkiswani
967,787,507 *64E62A110BB8C74CDC3FDEDE12C71F65BEEA2893 ahmad.amason
967,787,508 *64E6D04097F5275F01062A91AACD5985146FFED1 ahmad.barrile
967,787,509 *64E70758C17C6CF71E868F8D029C305A9873D247 ahmad.botto
967,787,510 *64E404DE594991E82071B4B1E00F525601B9F6EE ahmad.boudjouk
967,787,511 *64E5D4B51224DDE09054213F8391C5DCD679FF3F ahmad.callan
967,787,512 *64E54374E564C50BAA4A8AC84DE1FD9499E3379C ahmad.citrino
967,787,513 *64EF7E09D1840C9E9591705E531827EC8AFBF5BA ahmad.delley
967,787,514 *64E27E3D91E11EA48FF0DACF72BC65D2F37BD906 ahmad.fissel
967,787,515 *64E79BBA9A15ADCA773E7582CEF684F7CCB10563 ahmad.gauss
967,787,516 *64E99D18FD22D0113183175909DD4FF4C654CCB3 ahmadhaseeb
967,787,517 *64E93B259D401EB2F6AF867A1FF9D8B1481CA80E ahmadiyyar
967,787,518 *64E037F63FB4CF2854F1BF7A1A8296A239E1D51F ahmad.knedler
967,787,519 *64E303B061E8FBDFA402D00928EC693F0E20EA75 ahmad.lacy
967,787,520 *64E500A70AB6886ADD7B789E4ED23EF43792FCA4 ahmad.lehar
967,787,521 *64E0FED4A5FC3683DBA76C7A427C123E581B510C ahmad.longoria
967,787,522 *64E38AC4DD9D07C542655A5454B4E98C01C59F96 ahmad.mckeag
967,787,523 *64E599F54AC34D552DAB54DFA9271B2269FB5D48 ahmad.mirafuentes
967,787,524 *64E660AD99CC0F8CB5CCD4DE507946B2765726A3 ahmad.moomaw
967,787,525 *64E22FB0FFE8E1BA6BE4D5B85D5C7E4742EF8E86 ahmad mukhsin
967,787,526 *64E5BEE2301EADADBBE319B736C9DCA2195A81CE ahmad.nicka
967,787,527 *64E7DC57E116A4E86296B381BAB65F5868A3B4DE ahmad.nitkowski
967,787,528 *64E5C1ECB9F5EFB3850DDD2C633310284B6EFBC4 ahmad.pianka
967,787,529 *64EDD85567A88426C4157BFFED6ACFDB3960CB50 ahmad.printy
967,787,530 *64E2FE99767CBE209AE16916A9A2AC7987182B05 ahmad ramlan
967,787,531 *64ED2446D8384B8C97B90105F5BC4D85013B723B ahmad.ridolfi
967,787,532 *64E2C63EB1F500310675F8C8BE97A2866CE92A66 ahmad sadat
967,787,533 *64E5C7992B63A6B402BA914B500C6F73A052029D Ahmadshah3
967,787,534 *64E3E2E08B7F6463599D4A994954D09B82B8F260 ahmad.sluder
967,787,535 *64EDBBB19EFA16ACB06516F571C455B6874D6259 ahmad.steffens
967,787,536 *64EC93916EFD18DB42CBBDAAF7B559A080EE7431 ahmad.sumaran
967,787,537 *64EE330B7F223656E15F74559D0EA266E5D2829D ahmadsyis
967,787,538 *64E848102BCDF67CFCD24168494D4EFD0254AAE9 ahmad.tweed
967,787,539 *64E1ABFC1BD9187EA6E75DC13096C05D12D50014 ahmad.weckhorst
967,787,540 *64ED9C7C1E532B0156DCAFCA9960F777A355609E ahmad.wienandt
967,787,541 *64E55ADE73BE690F46AAA855DFC5346C684D9E15 AHmda
967,787,542 *64E6D6354A31FED3E69CFD3E026BF41A5009F3B0 AhmE$
967,787,543 *64E92A04D76D88671A2C8458500082633C02A507 AHMED120
967,787,544 *64EBEEE8333579396D75B2929CC37406DD773713 ahmed.abajian
967,787,545 *64E6CA6CEDBAB769344222A200E8110D57EE7D83 ahmed abdulmajeed
967,787,546 *64E2903045FC19EAA47ADE6831184E95A966BF84 ahmed abou ali
967,787,547 *64EFB68BE91E83ED496C0845D099A44514766F1E ahmed al marhoon
967,787,548 *64E45B0439F5B40DB6C79C60AC718AC4565D637C ahmed azzat
967,787,549 *64E7576CF65EBEC12C17C7AAB8AB8BD17D363F63 ahmed.barberio
967,787,550 *64E5BF139D62BB7939984E1BE6212C9E57152E56 ahmedbelel
967,787,551 *64ED61551D19B211E13A068FC82FC6DD4E00A9D1 ahmed.billiott
967,787,552 *64EC84D856453DC18F634BFC7965AA37E406C3F3 ahmed boha
967,787,553 *64E5C0C653620C7F067BDCF0E61AA8481D0B6AE2 ahmed.byford
967,787,554 *64E33454989362AB61A0E4E480E0231927E6EF9D ahmed.diana
967,787,555 *64E9AE5DC1AA2A2FC9BA79A282189694B607C2FE ahmed.dickus
967,787,556 *64E1F0B6167467E5062C5B8C073ACC6B89D5887A ahmedelmelegy
967,787,557 *64E80492DA75E739766EDD309C795C7200D302E0 ahmed elsheakh
967,787,558 *64EA38CE37ADD9BD07AEF45F099450C520F6CD3A ahmed ez
967,787,559 *64ED8C10222FC86057311BBC873C638ACA2FFF90 ahmed.ganske
967,787,560 *64E154A4B43A573B76C632BA87D8271CC10B29DC ahmed.gerold
967,787,561 *64EC77F20F232F426E37D1587085ED625E81C3BE ahmed.hakel
967,787,562 *64E1EAA5669FEFFA7DBD19717AA12E4E90F18A2C ahmediyya5
967,787,563 *64E235AEC454A5DF70AA148362865F8FA014F292 ahmed.kana
967,787,564 *64E0563A1391013B7FFE35BC44F98E381BB73737 ahmed.kleier
967,787,565 *64EC2A4FCC120E2381801C738B46AE58222C0914 ahmed.marantz
967,787,566 *64ED8551A72F97E487B28B96A3F299A575FD5F1A ahmed mohsen ahmed
967,787,567 *64EDA026CABF4BC86A87E26FC1F6D7401CA88481 ahmed.molinary
967,787,568 *64E2D93E280CCC63F28BAC76FB8D9E383BAF4AD4 ahmed.rollman
967,787,569 *64EE94172F014E040CC1380F501EE8B8BB26A83E ahmed safi
967,787,570 *64E3C5C3B939ADFE9014B5572129B223C511B97A ahmed.savitz
967,787,571 *64EDC629EC1FF1C2F5B35AAFD06391E8682FB845 ahmed sfwat
967,787,572 *64EE4D934AE1E7693F9D7095D37D183C1B5244AD ahmed.thody
967,787,573 *64EB619180A4EBD679DAAE48277D515546618497 ahmed.torrillo
967,787,574 *64E67C1950D5C91D5F356AC3BE14034CA7483485 ahmed.vaughns
967,787,575 *64ED4AD31E45F0EAB9ED822F073E94404A5AA52B ahmed.vejar
967,787,576 *64E4C0AFB658500E9AE7799D2ED68F8FF4E72D39 ahmedzayd
967,787,577 *64EEAB376EC4F99886E58DBD65DEE7AFF19518AC ahmes.rktect
967,787,578 *64E54E333D588FEC5902F7BC37C59F8468A56F29 ahmet kaynak
967,787,579 *64EB878DD8771CF6902643C81661C7391B18640D ahmetyakan
967,787,580 *64E7590F9F6AA77B9F646F54729726A319D7C3A9 AH!mG
967,787,581 *64E35BEBEDCB103149887E975DFDACA4F1D6414B A!hmi
967,787,582 *64E4BE3C3E63F9F10B8A8C932781FB5C6E4DE137 Ahmieheg8
967,787,583 *64E0604B55D2D92C7FC75443827A59E49A12123B AhMrM
967,787,584 *64E3301A85227CF3AC9B11D84C8EE8F67F9E978E Ahmtest6
967,787,585 *64EF45DF7C95681D161184CD45FF357F6FCADA9D A$HN/
967,787,586 *64EBB6EBBC8C1743A01409C12D5216277FCCC15D A#HN7
967,787,587 *64E169BC3A0CBBE0027BF28B6A764EF9C11564F1 AHn89
967,787,588 *64E4955030C249A3EA8A8000DB8D360C37A3A237 Ahnaa
967,787,589 *64E3CAD888481E63BF26AC5F2902D799FB57A2F4 AHndt
967,787,590 *64E8449B9094A69C2A9DFEDC395AAE923A26916F AHnf7
967,787,591 *64E388163DF72BE71BBB1E4184329AFD9E1A8E72 ahngsana8
967,787,592 *64E404EA3578CA684EF490A7862BAD56C305325E AħnI
967,787,593 *64E83F81488E55875670BB7EBA210AB7B5237EBA Ahniram9
967,787,594 *64E65CDCBE381AB45E0933E54D0FABEDF86F8717 AHnl1
967,787,595 *64ECF28662F3573F8C4E3F12368757AA02B6F604 Ahnodeit
967,787,596 *64ECFE7694A058A31FF93B0D2EAB867D0EC16A67 Ah,O_
967,787,597 *64E077B4B020B83D648047E56B2DFBF8F6FA5290 A&ho)
967,787,598 *64E4C035A34DD67A6A93C75A67EA371CFC4D8A66 AhO$c
967,787,599 *64EDEB13EC45DCAE94F11C78E9070BB22E950C6C [email protected]
967,787,600 *64E90FFEBC6E67A13CE1180F2181878D86D60AD7 A.Hof
967,787,601 *64E4794C9FC2F674F7D232B4784753E812BFDDB5 Ahoica
967,787,602 *64EB21EBDE322A5B8DC65DAA4375297C715CD848 ahokbsw4
967,787,603 *64EAF07448E77F9068A46A2411E3A15B8FA2D742 ahomardn5
967,787,604 *64EBD7DF9AA12417C49728A532457412F7098BA8 A.hon
967,787,605 *64E73D7CF273F7E9394EE3074B63DDBB005B02CB AHon0
967,787,606 *64EFF6EAE4137554FD478A99E3BD95E4E4B612B9 ahondaresed
967,787,607 *64E4ED2B247649E93E7D4C9E10466D4CC7F8C341 A:HoP
967,787,608 *64EDF9AF048765232A7CF4908A03E65FB75E49F5 åhörande
967,787,609 *64E6B5D541AD579CE529D3133248759F48535D8F ahortra
967,787,610 *64EF449FDD5F68912751F2815A9C36604EDFC993 AHO,u
967,787,611 *64E26CEC1F7AE323BEAA029E86807A8692313AC7 Ahouéya
967,787,612 *64EA4F65723C1018E5537CE59B47DEEF4836BEAF ahoward399
967,787,613 *64ECC55A70D20C3AE3BAD5E5B00150695C0D71C1 AhOXC
967,787,614 *64EF106EB6ADD5A07F38F4207E0D4AB4AEB4EC30 AH;OZ
967,787,615 *64E0312355FD78734207F9A2C906249AF8F2C6F2 A
967,787,616 *64E50ADF65608E9750521A5D62E3AE71305F956E A$!hp
967,787,617 *64E2C188567704E9E9008E161A00BC28A56ABBF6 AhP;2
967,787,618 *64EDEC2E1C906E361040824E8FCD78A0708DA586 ahpekute1
967,787,619 *64EA86BA6D597B23BC58EC4C31E5286CC560E9AC AhpHC
967,787,620 *64E0D15BD0C5C422AE983F4CAF1EBBEBA380628A AHp%j
967,787,621 *64E1DC77E276A56DAD0508E314A2DAF02B261DDF ahpmonap0
967,787,622 *64E61075D5CF18206C276BFB52B70ADAEDF7F8E8 Ahpn8
967,787,623 *64EF6C1D9AD52879B185EBD35A9A5BE2A550AA5E A?hpR
967,787,624 *64EE053DD31E6AFAAEC4369D48E146E7202347A7 ahprecious
967,787,625 *64E1ECF3F13F330FB44AC639E9AB38D986775FFF Ahproma6
967,787,626 *64EF8AF2B5D8750C412515CE4B4814354951DB1E Ahpu!
967,787,627 *64E6C98845F9361DDD288EB53E56C56C9EC14FAE AhpW5
967,787,628 *64E52F94779609551613F50809AAA7CA15525921 AHpYn
967,787,629 *64E24CA5C9C79B7A425BAEC92D1F86EA6C2300EA AH#+q
967,787,630 *64E75CE69C5A0E7F75B07793E7666C754C5CA4B0 A,hQ(
967,787,631 *64E4381DEEC1859CD9F57A2A260F85660A7660FE AHQ6!
967,787,632 *64E563C551E0ED4CF9CD2A8C8398AABA0BEC0E4E AHqdZ
967,787,633 *64EAC5944C0A3EDE862A940094D10FA7917A5B92 A"hql
967,787,634 *64ED9BAF94937A7141A903EF57874D421D7DC56D A
967,787,635 *64E4861CD9E0F5FD6835D56CF962A3FBFEA8C5E5 AHqoh
967,787,636 *64E5B1362568331D60AF26C9F6B137611BAC7927 [email protected]
967,787,637 *64EDAB11F8BCC1D18614E59351DDDCE1E8961071 AhqRY
967,787,638 *64EC896AF3B6591809BB510DC499A89364EE14A0 AhqZ;
967,787,639 *64E2191E44A584949300EF9D0BF971BE59730D46 ahr0cdovl3d3dy5tzwrzy2fwzs5jb20vdmlld2fydgljbguvndg0nzq3
967,787,640 *64EB63B11E56F0B4CA034324A2E1EABBD116C6A8 Ah(r3
967,787,641 *64EC0B08733A761533384CF4D1DE9B745F174791 Ahr;b
967,787,642 *64E33EBB3B4DA81261BE3CC30E6900C1A4596658 AHRBw
967,787,643 *64E54F5B4250584B093367593E431B049CD088AC AHRbZ
967,787,644 *64E980829908D96A293FE2523459577AC72190D3 <A HREF="6NARRiT.HTM#L20">1. MUTUAL UNDERSTANDiNG </A><BR>
967,787,645 *64E1D8EC7A43CACC51973FA028D9E6965CC8B76E <A HREF="#E69E27" >SETTING STANDARDS</A></LI>
967,787,646 *64E4A256490B8F9A7C51F3198052B37FB2A8F8A7 <A HREF="#E69E47" >SUBNETWORK ADDRESSiNG</A></Li>
967,787,647 *64E97036041878FAB626620622327689B331E7A4 <A HREF="#E69E5" >Gateway Protocols</A></LI>
967,787,648 *64E3A4E19B41EE200320B8FD2231CEC884375674 ahrends——阿伦德斯
967,787,649 *64ED3DA3EB8E98425D24D82DD4D3ECD6233732F1 ahrentaler
967,787,650 *64E7D19F795D2F78E7B736679D8B4B906FE7463F AhrEQ
967,787,651 *64E2B752BD6A78C9A62CA3FC448122532EDCF80E Ahrevlised
967,787,652 *64EEC0622AACA68460C9461B110734C965613536 Ahrıyan
967,787,653 *64EE15F477E119206C96A2AD16FC3183F8F37738 AhRnB
967,787,654 *64E5AA97C5EA2773CA86BB58A7DA3E6A09DFDBF7 Ahrocras4
967,787,655 *64EA4E1C88D04E10504B08326FDF56C673B2AB3F ahronot4
967,787,656 *64EEC4A130FBA32E031773820FA24289B3F051C4 AHrq#
967,787,657 *64E2273E186026D1D2E11DD12647D5B11BBC0264 A_HRu
967,787,658 *64EE6C92D1F9721A6295685ABC8A8A9993AE4E07 AHs_&
967,787,659 *64ED809F07BB3C07C0487BAEAADDB6AB54EA9972 A(hS$
967,787,660 *64E9CF982AAF21E2E1831582FBCC61FFA35C3DB9 A
967,787,661 *64E4D2A5D41787A19735D3C1A5510488B7CEFD12 Ah,#s
967,787,662 *64EFAA64763080B99FD0815B10336918A84CF657 AhS6j
967,787,663 *64E9BF2804967673252FBC7C5475135FB53A3B62 AHsA
967,787,664 *64EC77CFF75D7EB93D34159AFDCF17ACC33E7DFD ahsa19
967,787,665 *64E5E2613ADC87337BDCE5F1722FAC9C67373690 Ahsakcih2
967,787,666 *64EB4AFBBFBF9C80097F3C198B78B329EE7BEE1C Ahsasxur
967,787,667 *64ED71AE0B13DEE95772336A078726E62B433D02 AhScr
967,787,668 *64EDC37C5F9368AC5253977081694BD7CF94FF29 A!HSe
967,787,669 *64EBD5944E1CF390586A616995256D7AF0DBC139 Ahsgnubing
967,787,670 *64ED9D2178A202B080EC03223BCC2573F789F9E8 ahsisneh0
967,787,671 *64EE168A05F1FC77A206FF9F9A9B061385AE1243 ahsiuok9
967,787,672 *64E04EA5B9F9117AC7BB6E74A7FDAA293850EF08 AH+Sr
967,787,673 *64EB4B540DC69793F458BB7056832EAC628A594C AH(SU
967,787,674 *64E87D8AF4F0AEA14A8127B696B3CD628D854B42 AH)=T
967,787,675 *64EC069E761BE17737B5C01FCD92E73076F3E9C8 AH
967,787,676 *64E708DEC45326BF27E251D7C01CB7CD359E703B A:/Ht
967,787,677 *64E3757FC3C579BE5F9DFF6DA2B66C4BAD8B6444 AH,.t
967,787,678 *64EC9207FDAE2818F45C8CB6136EDE83F8221C05 A,h=T
967,787,679 *64E7F3418265B2DECAF139A62ED4E508E56288E6 Ahtadros1
967,787,680 *64EEE12544B18026C530C4DD9B10411661A0C3CD ahtbeining
967,787,681 *64E5297BAA6CD77FC8DE3EF468635B168D4A9CAB Ahtemirt8
967,787,682 *64E50AF9A85C00FF61214F8F576755B5586C0FFA AhtMQ
967,787,683 *64E1079E426B09F4FDA36FB617762EA3DFF1482E AhtMW
967,787,684 *64E3CDD1B29C8BA051A00B65461BE9C8D8799AE4 AhToL
967,787,685 *64E6C69219B60DD86294F3D6B50BD43BA3B526C7 AhtOM
967,787,686 *64EBC7BD9F25D0480617A637223A2C82ABA3F005 [email protected]
967,787,687 *64E5B8B010D8C1FE58856B547B66E063B7E74F5D Ah/tq
967,787,688 *64EF681FC9A636BCA6D8FB00D263F19276CF808E AhTsc
967,787,689 *64E7D983BB2045F0D4CB29CA9B33EC48EA54CB23 AHtt
967,787,690 *64E217A67FC95D6FFB91A85FDE1A5C6894908FD6 ahtük
967,787,691 *64E7AFD8D140C41D3616D508B2806E1A35CF01DE AHu"$
967,787,692 *64E9C57327063AF0CDD0FEBAF6ACAC3474D8C444 AHu#;
967,787,693 *64EC2AC4CC715A5201E2B5BEFB2B943282A7AC29 A_hU
967,787,694 *64E266DDEA1645B0430C49B31E6D16EAF166CDFB Ah/U#
967,787,695 *64E773157ED35F22E1F6749AEF600CC31D288163 AHU-1
967,787,696 *64E9961A8DF4FD7F2D4CD11ADD3F0A8D22835995 AH.u5
967,787,697 *64E8EAA1D8554BD81F875861E5C2C67DE13C0485 AHUACATIL
967,787,698 *64EE29DC78B44A332DC7CEDC611479FF5F62CDAD AhuAQ
967,787,699 *64EEA4DC57CCE988A74F740ACAD8421A2F4DEC92 Ahuesado3
967,787,700 *64E788608FE12E844D7917B90150F73B91FAD30E Ahuh?
967,787,701 *64E2BCC5C8E7F61DD580142D61AC1E6BD455A995 AHUHM
967,787,702 *64E592238D3C7F7F9B8E76589114415E2F5D4A40 ahukynwd57
967,787,703 *64E1D7EC5BFB5F98E33C371B2BF7316C023413A7 A Humble Cause Again
967,787,704 *64EA511BFD87846400F8BB85A3714F66B3DED934 ahuna1234
967,787,705 *64EFF2B3DA634CC033C712ABB83508F410C03A37 ahungered8
967,787,706 *64E06B843448645F244D2F2B956F0CA989DCE108 AhUNj
967,787,707 *64EB3A77F11F055B52E0C9906C96BDE93176043B A%hUQ
967,787,708 *64EB9201EB25D95128B098FB83F43C82B907DA71 ahurits3
967,787,709 *64E0E7DF055A591C7EE3F6B4B3F247FA8F3E48CB Ahut+
967,787,710 *64E12756946C6BE7269BBDE6E85048D0BCA40290 ahuusnar0
967,787,711 *64E14EB53BC9E9219AA39468AAB73BC9B93A3C87 Ahuyentas
967,787,712 *64E3126D771A59EA272E6602FCF96F48D417E102 A(%Hv
967,787,713 *64E5DD0D29E3EDB852C8729A67D5B18BF501C1B9 A"hV.
967,787,714 *64E21F0646DB1BEBD321787C498C61798CB67BE3 A,h_v
967,787,715 *64EC5B731D940796F88A4C296D5193E77FC33575 A&h(v
967,787,716 *64E4A5A5D8C73E6A85F12E9A16BE6050F10F5867 AhV76
967,787,717 *64E817B27C351B75D06CE4E2DE4F37B991BB936A AH$VA
967,787,718 *64ECC75D7203143D295EE1791A3EFA1BC6994E65 AhvIC
967,787,719 *64E24C168497F4D789F0F61D4C0CECF40B10D8B7 A"h=W
967,787,720 *64E89BBF79A730E3061150ECA8AD26608ACE3693 Ah?w7
967,787,721 *64EEA77A1D86A8EAB9061DDB733CF76001F7A7A9 AHW7B
967,787,722 *64E61E0792D998AE559688C1C4388CF1A2041B49 AHwAd
967,787,723 *64E1D82280A715DC832BC9E3E1255EB4669EB881 AH-WAH-NEE
967,787,724 *64E4684A692E4ED03460CCBFE69CA3C7AF05D653 AhWF$
967,787,725 *64EA9C6DBEAD173DA2031E33432A4657AAE3A39A AHWFV
967,787,726 *64E707E7C940F17719051F11BCEE527FFDF10800 AH-WIJ
967,787,727 *64EE018041E6A6E7AFB820E3F17A2DA343D8B88D AHWIYAHROCKFALL
967,787,728 *64E4186BB81C4E21DD24A1FE6C88CA0E49E7722E AHWkn
967,787,729 *64E03BBA6BBAC2C88A1429929175773B0D3782AF A:hWn
967,787,730 *64E47AEFA6C65B65F22C2784EB55F54C595B7182 AHWOc
967,787,731 *64E30C8B62EBA5822915D488692AC2EEE1FF855B AHWQi
967,787,732 *64E9D13EB02CBFA1DA903D6D1CFBFB39292D2D3E AHwsZ
967,787,733 *64EDCD80A8CEEF05B5302CB5041AFC1DDB123436 A?hX=
967,787,734 *64E7A69F185DC6570A0F0C54DC849909F7E97649 A(hX!
967,787,735 *64E4A074D4DA4AB977152EF12EEEE1CC7A107E46 Ah-X!
967,787,736 *64E86F938A8FA83CF07F6ABEC93A8B4033856557 A;ħX
967,787,737 *64E8AF7163FFB7D7313631A9480327BB173A9B0B AhXl.
967,787,738 *64E8593C55569DBFAAF2EAD480B83E20B130125F AH%XO
967,787,739 *64EC64A6649DC812C15E3B195E4BC273B7DCD487 AHY#,
967,787,740 *64EC0777ACC25F67B65E83EAD39D5FC767F6A0F5 AhY!$
967,787,741 *64EA216D75682A3EC84EC1E06144B54D84C84FC0 [email protected]
967,787,742 *64EAFE2FAFE4A408C0E33EA99143062DABF655CF AHYn=
967,787,743 *64E5304409F328E828BEE448251B5FD7E8676E79 AHYr-
967,787,744 *64E8FA708479BC38E088895710CD3486ADFCA4FC A
967,787,745 *64E26DC34D6417E865CFA1D8A09CE95CC7BBDC88 AHZ3R
967,787,746 *64ECAE7CBD229C96BF9E840DBCEAA6287FE285EB AHZR2
967,787,747 *64EEF16D914DFA1695E1158727CC06E0D93D2FA2 AHzt5P4
967,787,748 *64ED7F4B80C67BF3D9FD37AFD5733B575F46254D A-$I%
967,787,749 *64EF87F7BB42A03A8660E096733098588E55FF54 A;+!I
967,787,750 *64E1A9598BD3145F3458B1E656565D5DE36CF92A A?%I-
967,787,751 *64EFC718DA7E7AD05F2088C0E36DBA6B57AF78E6 A"I+;
967,787,752 *64EDA4C6B494B7BDD4ADE35C1661EC700E74F4A4 A)$;I
967,787,753 *64E3A35AE2D43A801848803FCEA00DFDE2912698 A$I$=
967,787,754 *64E59301B3E7C97CA2C972499BF9EF2A184558FA A#;I$
967,787,755 *64E9D19634D36F2429DBCA5DDEB2F03B8D0EB8D5 A%I/"
967,787,756 *64E78FCA5261916D7C3DAA409D0F26EE346550A6 A
967,787,757 *64E88095D18E4EB9CF13D2BED43A46BBE0EE5DAC AI:;_
967,787,758 *64ED9DA4B5A30EFCD26ECD717721755A30061EFD AI:}
967,787,759 *64EBE43637C1BECCF9E48838C1436D341639AC8E A_;&i
967,787,760 *64EAFF9660B1B4AF9AF6A1626F1910AE12696DB7 A_i+
967,787,761 *64E066725D4432546B8A74ADF97B474B90EA0B87 A-=.i
967,787,762 *64E5B43F55FA8555926ABFD44616583E214131A9 A;)i_
967,787,763 *64E53CF3F9980514683D4E8FDDBD408647E6E63E A&$i;
967,787,764 *64E17E65F91F362816BFF2295A3C8C105FEE0C48 A%i!)
967,787,765 *64EC3FDC0E33CFAC7FC36FAA20BF788BD152AB82 Ai==+
967,787,766 *64E6E261F34D282A7379A3F9AB521E7C7A3EBFF0 Ai/&/
967,787,767 *64ECF2862D1874C4CF981EB7202C2DC6408068D3 [email protected]#
967,787,768 *64E0F0ACA5140E8F90619260F3B2797BABABBB1B Ai0=!
967,787,769 *64E36E689AB23CB821259DC7D97EACB2633A4FF8 AI0#0
967,787,770 *64E0DA2D83430DB885AE1DEB02C68B6EF3EE0E6B A:i03
967,787,771 *64E24B4F31EAB081486D15507AA9A9A2957BF500 AI0#a
967,787,772 *64EAE3C8DE2853039939B79FAA39FFA5146B5592 AI0a_
967,787,773 *64E1ACC11362DFEA5DF1B43AFA4F12AD661A7493 AI0e%
967,787,774 *64E20B400B07F33F0C517FDAC23BC34473155724 Ai0gG
967,787,775 *64EBCC00D07B2746D92FB764A62D83CC04C180F4 AI0"I
967,787,776 *64E434563C2FE65A3882CA8322EC64DE5093948B Ai0nB
967,787,777 *64E6CAB3A3E87F46D73DA1118EEB5F9886BE6FB3 A-i0R
967,787,778 *64EDCD003721C70CF834302968B34ECC6A899316 A#i0r
967,787,779 *64E94E787716D4427D3DDB323353E98D3919CCB5 Ai0"Z
967,787,780 *64E146706588E125CC49E39754CBD65AF6356DE2 Ai#1"
967,787,781 *64ECA57D597D76CA2FE61BFF04599B42E3975919 ai101
967,787,782 *64E6DD495702542D63CE90575BA9BA9E7D3B0A39 A_i1a
967,787,783 *64E6A6B90F3C251494F1E5091706C6C65B299C80 Ai1bE
967,787,784 *64ECA5BBDA6EE68D037759F117AEFD92298C573A A/i1g
967,787,785 *64E54F0AD9FB78C93B6E6309F4BC12AD9AB5FDD6 Ai1(N
967,787,786 *64EF69AC04EE560AEC241E79E8FFE4A6996F494D AI1_w
967,787,787 *64E8580DDE428B1E214E6245C3BC431BBC48E01C Ai1W2
967,787,788 *64EFBE3ABC9A184D295149123690367CEC265426 A-I2-
967,787,789 *64ECFFD630174A985BA4AB997DBC4BA80FA32812 A&_I2
967,787,790 *64E0D7ADE313ABEB35EFC2863DF876FC4F057A68 A+I2F
967,787,791 *64EEE58ED2DD3B7C879EA21E65356F529D184B1A A-I2i
967,787,792 *64E2F498FC382FE376E5DBDA908B2DB090B0F15E A-i2R
967,787,793 *64E2877637A18CBF4E211D9487B3DD5D7445C924 AI2t$
967,787,794 *64E7FD692333893365C66FC9BC3DBC52C120049B AI2TM
967,787,795 *64EC6E04F724D69F3B6B97B0EE7F51D143113E2B Ai2X#
967,787,796 *64E3CEA787D08C6992E6DFA5638046127AF1F3DD Ai:3:
967,787,797 *64EED138A9EE99BB336AAEB839BB870F2C79CA2B AI3d7
967,787,798 *64E278E2215C35127197C983A7C5C18F23385163 Ai3nm
967,787,799 *64E0202B3E7A5700D9E8F16B12CE851AC412A6F9 Ai3YU
967,787,800 *64EEEE6DDA16160A64287C91CEB714958E87BCA3 Ai3$Z
967,787,801 *64EE80DE689F08FE9F5E0CA5ED46395606303880 AI42B
967,787,802 *64EBE6F5109A81F40468C1A4C13BA127706BF7D4 A?i4l
967,787,803 *64ED587E9C1D7371686997FC79C4FAA3D5BDD71E Ai4:q
967,787,804 *64EAD8CE36B4B32FC3781058536CE037F5F590D6 AI4TX
967,787,805 *64EF5DBC8252CCDE20BEF1D09A3C0490C07363DE Ai4u7
967,787,806 *64EF9E58E6D79DC02711C9F26121A922FCF0D812 A#i,5
967,787,807 *64EB38A6955ECE0B4E0DA7DA21CD0E044D2A6B1C Ai5%;
967,787,808 *64E63F4D65B3E428A717DDED7F816496C56A0F6E Ai52f
967,787,809 *64E5D4A431F232F835F7284870B2FA7653F7E280 Ai5bb
967,787,810 *64EF36BF3B8F78636C0C9E34D31344303076CA9A Ai5CC
967,787,811 *64E7219FC26CC1045680901E48846A7729373169 Ai)5T
967,787,812 *64E87AB7442EF894B477BAE883BE39A2674F9B89 A-I%6
967,787,813 *64EA9C327EB981AC913F0CC16DC7C444843CFCC0 AI"6,
967,787,814 *64EF09A4170DD41E396AF0149B45AE6F913039F5 A:i6/
967,787,815 *64EBE7EFFA4D29A3827FE2FF044058E9216FC419 Ai,6d
967,787,816 *64ED95CDFF397847276A5BC6C8B414E062A60044 AI6K6
967,787,817 *64E43D683E6A42E2B455D93EA14CB62616958A2D A
967,787,818 *64E1F63FBDEB2DD486220B8C697464E4BF6F35AB A"i6s
967,787,819 *64E1A535C765404B45D0251906D127518661A7BA AI#6X
967,787,820 *64EE8A0963ABBD8F34273721BA890C329F903DBB AI7+
967,787,821 *64E8108009564639579634334E06D8442BDE4130 Ai7#7
967,787,822 *64ED193734656254A0EE60E49A6FE9F0199CFB3E AI7Eh
967,787,823 *64ECA9834377590143EE6A47798BD163ABC45213 Ai7Tq
967,787,824 *64E81E1DB7613E833966CF45C731E98E2C214BED Ai:8;
967,787,825 *64E23ED68BEF240AE83D16F52D50C2D54B4E5DAB AI8df
967,787,826 *64EDD33FD1C28AC950687933548503049F4206CE AI8dq
967,787,827 *64E33735243EC89D169DDB4175E416BDCEA93DA1 AI8_h
967,787,828 *64ED11B5D624BBCC8CD2FA7D5BBD83686357F6E8 AI8(L
967,787,829 *64E92EEB5B428C64FBE0B3862D4391F3C74695A3 AI8rj
967,787,830 *64EF0055228D190F150C1DB37A3FDE6C59A4FDCD Ai)9)
967,787,831 *64E01D96F1CD36C969979A454610AE10EF4BF876 AI91-
967,787,832 *64ECC8B3C5B5027CE6E9C38622AD6DED1349D88F Ai913ts
967,787,833 *64E931BD6AA4D5A7487DE60CC02EF52018EC3952 AI"9b
967,787,834 *64E38A54E40D510B1C488E81D9AE6268CFFCDC87 AI=9D
967,787,835 *64E32F45100E4449BEE07A884F36A8C3210AF77E Ai9FD
967,787,836 *64E5774B541209AB92BAB5C993FBACA59314D425 A(I9G
967,787,837 *64E037091712E3CC7A26A5C1D92CB6409F165507 A(i9q
967,787,838 *64E04D91B6FBABB0B8699D1798232FA6A5D1B7CA Ai9QK
967,787,839 *64E4C9509C8CF13B34DFECD37729F5AC7C65FDAC
967,787,840 *64E382119A62636D0CCB480104D5C90D7CBFB645 AIa;;
967,787,841 *64E4E2E252428F060E03849B3B73F827CE64AC23 AIa%(
967,787,842 *64EBCFF40D347853790B89EC0566D898ECF7709C A/ia_
967,787,843 *64E96F6158A662A493DBE928F7C38D1F5F0C55EF A&i,a
967,787,844 *64E0A251E50A3C477FFEB45EF934AD700B0CA277 AIA_0
967,787,845 *64E637C4D791B79BD3CD4FE167A654AB672D604A aiaapaper4
967,787,846 *64EB04C9F77D28045E17A799D54A4704776846C1 Ai#aE
967,787,847 *64E2A4F38AD04C8ED9E4C5D33C422CB512E92EC0 A$iaN
967,787,848 *64E194CCD24B134354E6EB62006FED61FEBC687A Aiatol·là
967,787,849 *64E7354FC8849E965E976174442A35C74F035745 AiA&V
967,787,850 *64E4C6DBE9DF758E718D97985DE210611AB07638 AI
967,787,851 *64EAB2A976056694DC55F42BA5BE477F5C14B583 AiB/+
967,787,852 *64E1D96389D6EF731B93D8D361DB6AF9D9FC9105 Aib1j
967,787,853 *64E77A0E64603A0336F5420D0B3D10801C74EC4F AIB3,
967,787,854 *64EA2C9BC6E75B69723A6C96AD9C1CB04CE86879 A(Ib7
967,787,855 *64EADC33172002E231C15006B1E753533E160AC5 A;IBC
967,787,856 *64E5D8E619CFA08BD7F1E190DF0D8B11C2F72209 AIB(L
967,787,857 *64E554F7016049A1AC0504CC6C51383235FE9196 AIb(o
967,787,858 *64E13B3EEF6F80B9338AB7E005F2CF0CAC39C336 AiB$o
967,787,859 *64E6DBFDB2A27E97E8DB24707856391E8B145475 aibohporhtielc
967,787,860 *64ED8D7C2998D77E4B4558595097BC597E4527CE AIbp?
967,787,861 *64EB426767A0FEF1C646592CA307115673AB440F Aibréan
967,787,862 *64EEBAB01CE32422339DFB2DD17D57CE024C75EC Aibrohpue5
967,787,863 *64E40D1AED3B74D8DA497BA205EC4F6B7CE8FDBA AIB:s
967,787,864 *64E9C6A8354CC35125D847E67BEFDE5EAAF9217F AIB=T
967,787,865 *64E598FEC0E170F8490F3EBB22F8162A20B9FED7 A/IbT
967,787,866 *64EFDD57FF851248A2C8C83512DB55DF95B3A149 aibursabut
967,787,867 *64EAFC85C1FE215A88BBC0BC53B6A283D3CCDD68 AIc8o
967,787,868 *64EF4F567078A1B59CBCF84CCBA8909F2F845BB3 AICA04
967,787,869 *64E135DCC2B5CB4AC3432A97708931325D4BCBDC Aicakahs
967,787,870 *64E8B6B42CBC6B47F1963ECC7ED26A7EC0C38E49 AiciH
967,787,871 *64E476023028EDD447005355AD3DE05188E8CC72 AIc/n
967,787,872 *64E5AF0EEDAC9DAC2DC093AFDE8F3B8962F37E12 AiCNY
967,787,873 *64E6A813E888AA7BF10A12526531EFDDC467E4CA aicotyles
967,787,874 *64E3C7A2BE04507C17953E3B05CA6B82BC59B3A7 AIcwa
967,787,875 *64EFE7C5EA433A0AD2237CD3E0F8B9573CE47DA6 AI.-d
967,787,876 *64E955D9146D2F2BE046587F1C302689865D19A8 A%iD:
967,787,877 *64EBDB561C8847DB94D8212A7560A766D82D9DBE Aid=$
967,787,878 *64E5831C991BB00DFB7F4FC4A5D639BA1594F06C Aid90
967,787,879 *64E0866AF7A85FA89500EFC085F297BFCC4B0C9C AIDA1984
967,787,880 *64ECD1488518169790196B95A97859825A033DF8 aidaarias
967,787,881 *64ED41BFFFC6A95C33512F8CCA40FA96BA8472DC aida dupont
967,787,882 *64EB97C4927206E6F57EDF530CBE5FD4F7DA8809 aidahashemi
967,787,883 *64E016681A27F85F942AA323271487B640C4674E AIDANOS
967,787,884 *64EA5C2D31E9FE2D3B916A63CA7517C25EA761D0 aidaomar
967,787,885 *64E42C2209EF1543E194276961ADFE77C7A0BBE1 A!iDC
967,787,886 *64E6B053C126E2CBBCE22E0EE572A20390D398AE AIDCHILD
967,787,887 *64E635874B0CA5409E5752C7037C59E1A10BDD12 Ai#Dd
967,787,888 *64E58D091C5062A245DA4D81F94A68AFB73AA6FB aidenn1
967,787,889 *64E3EFCF19F9FD497924D80F46C3CEAE37BF960E AiD.G
967,787,890 *64ED1F0B3D1DE1F9DAFCDF4F2A7160AE635BAA23 AIdGo
967,787,891 *64EE53592261054E8ABC161D0A344E52D8176614 aidhctip9
967,787,892 *64EE0FDC8597AF20663EAE4CC462410FFA9F1BBA Aidin 1
967,787,893 *64E9A221F99CE4A962CDD301848BD604B0F82599 aidinebrahimi
967,787,894 *64E905C38D256FF560CA5797604C3483BCCFDF62 aidionses6
967,787,895 *64ED3E0708D8182B4A36A79DC24ACB3DFD179287 aidirented
967,787,896 *64EA5869FB4210E50D3541F94D4C56B3FD1A6A09 Aidisarp5
967,787,897 *64E27BA5DB05D8E104832B9A48943955080DF41C AID-JMR
967,787,898 *64EF657C43534D7D65C107FF39018BC6EF6692F0 AIDkM
967,787,899 *64E6BBB4D7788041609D93824CB884CC830685BF A-Idl
967,787,900 *64E55F95788AD5758BEF9890E4ED2847C9B2391A AIDLIEUTENANTLIFTLOOK
967,787,901 *64EB70AB1A6F2BDA0DF29321A4374C5DB1490597 Ai=DN
967,787,902 *64EA148EDF758A555BC76AB101B3C2E0377A0018 aidnaehcs
967,787,903 *64E70FECCF7B6B1A367000BB293B1A6A7D72F111 Aidnanre1
967,787,904 *64EEF1FBA94A3E4939EA7ED92533D2C3ED3F9A16 Aidrahcired
967,787,905 *64ECE42EC28FC7651509C85029E2853F79003277 aidralim7
967,787,906 *64E0F87789651E42CB417E98C2B7BF9B789B0D9B aidsaufklärung
967,787,907 *64E6370223CBA85D2D63D52EFF19F9367F1FDD0F AIdV=
967,787,908 *64E53797356EFD81DF2F8EF1E4B9F8ABC47AD6D6 Aidyn366
967,787,909 *64EF1AE1A41F9FF44B52EFD8842119A185A29338 Aid (英
967,787,910 *64E2E42CE0DCA395800F66216222C61E6433E100 AI(E0
967,787,911 *64E09B940247C75FFE78AFF4D3EE97CD309D47B5 Aie1)
967,787,912 *64E957A61F4AD9F12FDE658740C2FA71DEB57355 A
967,787,913 *64EEA91FAB277820E745505C8F681D89243D6923 [email protected]
967,787,914 *64EFDB18B5254D1772CBD684B152D367EB7E7646 A"IEb
967,787,915 *64E024AC97E48772618BDC82E96117792A78A7FC AiEg/
967,787,916 *64EC3D564124C2749F8EB16513442E0C9A10631C A,iej
967,787,917 *64E036A1842EC68B67BF4CA19F2BC4B7610D8DB1 AIelY
967,787,918 *64EC2AB76F86FA86F3138A50CFAC583BDF2310D6 Ai/eO
967,787,919 *64E25AC04247F54DC223EDC9B570BE1C67510707 A)Iep
967,787,920 *64E5F299B660DFB47E13D5A6E6FC286D30E21FAC AIeQ
967,787,921 *64EC3760C521FDC35965AD12470CA6C55064FE5E AiEqb
967,787,922 *64E628E251CB915D7AC8A993B72B771D41DFDDF7 A,iet
967,787,923 *64E67C946D82742BC9F928F79A71C4D5ED85FE2A AIE?u
967,787,924 *64E0057FC3D0FA2A574D20BEC6AC92BD18EBEE95 AIewZ
967,787,925 *64E095681DC48560E2077A7061A22ACF0BB5BC72 A;i_F
967,787,926 *64E54F07D027B4984598A257BEF82C8D00FCCB6C Ai%)F
967,787,927 *64E48C405F142C972530BF480101819D56BD0229 A-if)
967,787,928 *64E8AC9B43AB28CBC94E0D77D549A065E18B4F1C Ai(f.
967,787,929 *64E7236B6DB0CF89A2439CCBFAEC609EAF4D708D Aif:0
967,787,930 *64EFDFEE0E6A4ECCE5DC91E358F7AE26097F32D0 AI-f9
967,787,931 *64E941ABC8A4A16718D8FFF9DD67670342E628FA AI&FB
967,787,932 *64E5EB5F7817EAEF46CC3A8AC88A5D1272794A27 Aifforap
967,787,933 *64E260378685206584298934FBDD8DE4AADE9A0A AI"FH
967,787,934 *64E1C13BFA97E00B6FE368214D6DC2303B220F64 AiF-H
967,787,935 *64E2B3B9EF4101B3C69E73B9B03C43D9531AB6C3 Aifissalc5
967,787,936 *64EA13A744B3C94D08276C4B735EB2B099A3A619 AiFj4
967,787,937 *64E0C0E593E9E833E04DC8214C01AD1D32B36A41 Aif:k
967,787,938 *64E5649F73C9A2129DC6201AF8C29449B7E1C63A AiFlR
967,787,939 *64E5DBDAB80E3F391F3C62194A0F34473D30253B A)Ifr
967,787,940 *64E2930EFBCF6DE24D4DA6F38C6FBB5FF0F905B8 AiFR=
967,787,941 *64EF1E8B4D07C1A5083169B7A22388BD098E2BA9 AI!fS
967,787,942 *64E29198D7348A57F64B6431A19176856BFDA94F aifuxzq0ld6e
967,787,943 *64EDC36FAAFB09FC9939F36F70F6456AACB508AA A_iG;
967,787,944 *64E0A19C75E8B0888AEA6A6E4B2EC57156A5EC16 AiG=(
967,787,945 *64E8F6580511E444FB26C1D4A3FD5C443FF59717 A(?ig
967,787,946 *64EF79F1A5FC59D1AC78568D9EF8DBAB64C9353F Ai=g5
967,787,947 *64E287A9845DE0723B9AEB66D3E0ED0F9D0878A2 [email protected]
967,787,948 *64E84D7FEC3BAE931086077AFB3A469582951739 AIGELIVI
967,787,949 *64E288A54B480C66F934102871BD0E16CE926B31 Aigeros
967,787,950 *64E6800E7D6AE9F8583CE29EFC34C06D34098368 aigesin
967,787,951 *64EB4D8B9C6861A6CB6477CF968EAC752A9FE288 Aig;g
967,787,952 *64E118A15A009A2C82E1C58C9C3D96106756DE38 AI;Gi
967,787,953 *64E6DAA893893B888D85F79713E7463B72724511 (Aigialosauridae)在
967,787,954 *64E08374FFAB399C7081CED3850121CA2B6E133F AIgic
967,787,955 *64E1D9E963AAAC69262D63819230AD96AB936F3B Aigneras4
967,787,956 *64E9D3EE8F92E25CABCEBF991740D2928AC118B8 aignoired
967,787,957 *64E55A7E9D8338F711F9F9EF5EEB28C49F9C47BB aigolyda4
967,787,958 *64E93505686D62FFA0EB4F4298295E0247756211 Aigpp
967,787,959 *64E977E689B598BBAA1DA79C9044D7C396FB634A Aigrettes7
967,787,960 *64E53E48B6338589820EAE35D07690AAF490CC37 Aigreurs5
967,787,961 *64E76261245858DB498709910629D0F9F405FB88 AIGRISSONSES
967,787,962 *64E5455D7C7F8EAC6D5891BC2D55E27AC7E886CD A/igs
967,787,963 *64E691B96D336A503F51B07DF0F6E557BC680FA0 aigua…
967,787,964 *64EC81D968DC1904B874B08D784B2AB2C0BFCA6A Aiguilleurses
967,787,965 *64ED9F57437469F5DFE1046744F3E8CEE48C06A4 AIGUISERONT8
967,787,966 *64E9B3AD98DEEA10B016D3CBD665F0F8544EF297 AiG,Z
967,787,967 *64EF323F997A9B4F9DA811EB54AA6C1E0ED34EFF AIH&?
967,787,968 *64E065290AA50A20F7AD194C732A146DDE57BD76 AIh$(
967,787,969 *64E020FFA9848AA8CE9CA9E97895A35C405B3419 Ai!$H
967,787,970 *64E6FF65BF93AA3B7FDC09D6FC577B00E4F6D007 Aih1&
967,787,971 *64E0327FDE11413D6A09F398E7DC9747917E5070 Aih28
967,787,972 *64E3C5F96E5586B0586B8C8305EF9325AE99C2BF [email protected]
967,787,973 *64EB102A39506B7A34046FCFE3A376059FB499CC aihcalaw4
967,787,974 *64EFB1054F7014430CB6D54ECE900840367F46C1 aihccorT
967,787,975 *64E7559D22B208C8566B454325317409BA32CC73 Aihcgnuk2
967,787,976 *64E42F0013E846A672D0EE61E92ED724ADF5A1AF Aihdoksing
967,787,977 *64E7654BD2C0ECDDC50F38B44B07A8125D6CBAEE Aihh0
967,787,978 *64EBB20CEEC4C0FDDA15C380EC1C2095789B4AB6 AIHIm
967,787,979 *64EA604E590CE84B960268F95766649EE91E0227 AIH#j
967,787,980 *64EFC6A02EA19AC72C9546846964A77218E48D83 aihkomued
967,787,981 *64ED1F0D60711E4FFA53C062A8471AFA88A426A3 Aiho!
967,787,982 *64E44F5A56E8C4CED770F1C76FE8B35F49746683 aihports6
967,787,983 *64E6E0C70E87552F0A67FF898DCF2A6C1F0E3F9D AiHr6
967,787,984 *64E2B8AF80CC60799A5BFCF5ABB07EDE93A94E2A A/IHT
967,787,985 *64E47F8732536449A3010D1CCFCE5AC7A92C7F14 aihtnap3
967,787,986 *64E4DC1818CDE89514CA1D46CCC7FEDA485C35F8 AIhuo
967,787,987 *64E4D0FEC98B1A48F66B5A055044484C68BDD8BD AI!;I
967,787,988 *64E6113B85D35A561C88929C553B64D6973C44B7 AI?I#
967,787,989 *64ECD28A4F6EBC6B2E7E079E3D4464E8DF261D87 AII
967,787,990 *64EC77AC08A4BB9022B744C1E8B1F06905524FB5 Ai;I-
967,787,991 *64EB1C42E7CA2D7FFC63FD8FD38D52BD6CFD3671 AII)1
967,787,992 *64EE578B13009054D2CD5780A0D6E4A0E8465DF7 A
967,787,993 *64E38182E373877136249E89437CEA3D4190E003 AI+i6
967,787,994 *64E0C4B2644BB779A7469C80EA2301582BA5D32E aiicbsw3
967,787,995 *64E86E3CFE200CB35E8E48D99997046DC6B33849 AiIFW
967,787,996 *64E31EA36E8336AC6CB0C123157CB6E7F9F68256 AIijQ
967,787,997 *64E281C2CE96105F2B72C2047A4FCE253EEB4416 AiIQ&
967,787,998 *64E9B22F354202B20CCA70EB3C614C15251A6F55 Aii&q
967,787,999 *64ED5CEC12CAFD9050F98C4D830C5FAA48CE19B2 aiiquem
967,788,000 *64E34991CEAD9FB3A2E7540E642731CA03E375D5 AIi,v
967,788,001 *64EE9C291555B802CF30E146D3EDB0B61A8D9CB5 A%IIW
967,788,002 *64E356C5A9F6E36345314DC3102EFA193174F16A A!iiW
967,788,003 *64EB7CC88EE7ADDFA63872172F922C30EB5ED959 Aii"Y
967,788,004 *64E72FCB29360A2CF4A4AA71494239BCA730A4BB AI/
967,788,005 *64EB6F02DA6E7B25F7084020CD377FE1D610873A aijattu8
967,788,006 *64E7860E0813B55BF228980EC6CC9C23789F289C AIjdg
967,788,007 *64E41D814A9ED03382ABBE3DE52889CC5C54D42F Aij%F
967,788,008 *64EBF76A0817F3964C5475C35F805B11E2A7EF8E AIjhj
967,788,009 *64E903387671B4B5DABB2B4E95F5D1B2230184CF aijnotor
967,788,010 *64E05CFB66C4738031EFA709E49907FBCE77904E AIj
967,788,011 *64E9AE54B8C1ED9B4C5667C13FCF730D1AC97427 AijUi
967,788,012 *64E9B21112BB6078CFFB80DE7DD6D2CEC96DCC35 Ai$k/
967,788,013 *64EEF55AE456ECB2E82D4F5C6CD7532B7A00F2C4 Aik;-
967,788,014 *64ED97058325CFA4FDA3AD2F2B877CA669DE10B9 A%Ik2
967,788,015 *64EDF9A4428C0BD3492E8AA7D6C0C16C8E59C423 AIk5S
967,788,016 *64E9591CA43CBB8F27D4315AB42A1DAA612004BD AIk(7
967,788,017 *64EAB8FC9B942D7AE72B87AA2DA11EA6B1443ADC Ai+K7
967,788,018 *64E4F1144E6BA61C9F7E0985A65A9DF0191D9BFE AiK9,
967,788,019 *64ED9B12D5C99EFA6BBE81FF26141AC564172A4D aikaani9
967,788,020 *64E38326F3AEA9C131E50362C9E3AF2D576EA00A Aikaiseen6
967,788,021 *64E80611495820948AB6922FED5E3FEDD9FFAC98 Aikakausk
967,788,022 *64E0EC9B6BA48504D5AB8A97182EA82280A5BD79 Aiken County String Band
967,788,023 *64E5B7E6B2D528D68C73EBC7F30076ACBB749EB1 Aikensnts
967,788,024 *64E5BEA2C1B89BEA1AD2566B73E997A2476562B7 AIKHL
967,788,025 *64E3ED150897CCC968976CE50EDBFB61AD704C22 aikiavah6
967,788,026 *64E529CF3E986E8BCBD6A906A5C687F30BC111FE AIKIBOND
967,788,027 *64E7303D2D112C9E9B7969E295375C84F57A53D3 aikivttls
967,788,028 *64E22580AE6F84D854135FE4683B3110ACF03617 Ai?Kj
967,788,029 *64E3D68B4F29750E4B38AF004BF8BE5812484385 Aikkinen
967,788,030 *64ED0CC14667D2F8CCABA655C57B656EC512832A aikkrasi6
967,788,031 *64E40CC757A620058E9D24D3DF5E519C99E96AA8 AiKMr
967,788,032 *64EE3200E5E8A0245CDEFE7BD052211407A688B4 aikojensa5
967,788,033 *64EC6ADDA0FFA13A2D27A43ECC79EB04DC23057E A-IkT
967,788,034 *64E209F7801119D483FBAEA79E3953C1A8A5060C AiKt/
967,788,035 *64E615015D11457E838A236AC4B55BD0A646645F Aikuisping
967,788,036 *64EF62DDD3E426C3711A828B7509D2FF9A3DF105 a%iL
967,788,037 *64EEF647BE4615EDCC2E1188861830ED91850F64 ailaflores
967,788,038 *64E3D862AD83156E92519F9D363ED78815435F20 Ailaucra9
967,788,039 *64EA59324172007032AEEF01EB3DD5E9E8E64E2A [email protected]
967,788,040 *64EC65CDD114C55F6F58D8903637B236BCE54D62 [email protected]
967,788,041 *64E841E3B3D522CE385D8386682591011C202C30 aileen pollard
967,788,042 *64E940A54A64597340B8E383E1A1CAADD36FAC62 AILEK
967,788,043 *64E354700FFC981AAD5B615C8CDC5C7A05A9092D aileromed
967,788,044 *64EA4A4E59C736073B6300B7A17CD0C5C00C8290 ailerons.frwww
967,788,045 *64E4C250AC570A4B85F90D085C809968E1E05F1C ailetera
967,788,046 *64E914DF9FC5995102154E9A9863658E76C6FD64 Ailgidab6
967,788,047 *64EB26D9F1C596DD099F075FC43A7E84657C2436 ailgniwz0
967,788,048 *64EED20E8D340D20AD0CCEC16BA3935860D413F2 ailgorbis
967,788,049 *64E15501B1F49D2A144DA4802D4B48FF861868A0 A_ilH
967,788,050 *64E2905BF0FD89D380F1AFD83D48BABDE22829F3 AI!li
967,788,051 *64EFFEB8C5133B6EB5ABC8206815803B69157075 Ailj"
967,788,052 *64E4AAA231996553F7F20D7B61FA290738949E27 [email protected]
967,788,053 *64EE9F806308B0D651587D139FADFC156F3DAB77 AiLjR
967,788,054 *64EFB0BDB90EAE9FD9931FE27027FA561069CD30 aillattun2
967,788,055 *64E7B607D237AAF3F079867AD9118E1B0F6006CB aillenlopez
967,788,056 *64EFDBD7855529D62DD9A372428C3C3DE194878E aillesia5
967,788,057 *64ECDEB8259E78011AA10BDFD5E766E427EA545D Ailodnod3
967,788,058 *64E1517872900F90FF04A29738F371BB6B42AD3E ailofsid9
967,788,059 *64EC9D9EB73B5CB05B0F3CBF938443F310A1862E ailorteD
967,788,060 *64E529B1EA640929EF58D8CEC80F110408717016 AIl:q
967,788,061 *64EDC8D261943BBC2E4FF8F5EB12F0F73D2382E9 AIlr+
967,788,062 *64E998665A8B066B290F41C0B421A96EC01A8217 A_iLs
967,788,063 *64E7C459F3916ECD3E7E0BEA5FB1AB29397EBEFD ailuista3
967,788,064 *64E99E3C70C0527053A49637C1744D2904AD5F7C ailuoaring
967,788,065 *64E7DBE61EFAF1D3A67BEFD9ED5EFD7AC7D0EFF4 [email protected]
967,788,066 *64EF722E5FF1F2E758973E82CE2619370440B4F5 ailyn bernal
967,788,067 *64E672DF1AE2F823A82071EBC80D0760B8F91FD1 A;IM-
967,788,068 *64E9BD9CDEB545B8BC9E53415B9D69141C875BC8 AI/%M
967,788,069 *64EA0F78383AA2C4A82A283C53755BEB81DC1122 A+I,m
967,788,070 *64E9A068FA115C08ABF71BF508FB498CD5D909FA AIm"&
967,788,071 *64E1D2456BFFD075D344EFC36D96CAAE9F1B0147 A:i=M
967,788,072 *64E2570E34A17D8D7A34AD1F1FD181824848E6E2 A&im-
967,788,073 *64E7DF012EFDD94FD6F6A6BDF01A4B04527C6CD4 A+)im
967,788,074 *64E2ABA7DABBF163059CA5446C452CB9CF064623 Ai,(m
967,788,075 *64E11F4E2E379C2A57B53188773105073A12EA9B Aim6a
967,788,076 *64E20E81FE388BC89ECD3ECD7AD919E8379AD64B A#IM7
967,788,077 *64E0E46718C6E9E4AF3742AF4F169299687FA09E aimaalle2
967,788,078 *64E8374D1C085A2A608AEE915FEDF3A237E1C8BD AIMASSE
967,788,079 *64EDBDF71424D1276990BA7882C26802165E83B1 A/imD
967,788,080 *64E1FB82823AD4E737AF9F2984121FE66497A985 AIMEAXONA
967,788,081 *64E347B19A3CC7EB56131A674545D044F01C6729 Aimee233
967,788,082 *64E6A13040B2A0BFA1E6F4D9B420B156AE8E5696 aimeeavery
967,788,083 *64E7DE0737941B7EAD67AF93A66D2ED2B9F1AA01 aimeedaniel
967,788,084 *64EAB9E04D8D71F693838C0A220107F935E7C3B1 Aimeelou1
967,788,085 *64EEE9F7FAD27E7966EA8445A31727BF8E8A43AC aimeeshepherd
967,788,086 *64EEAC2CB539BD0056688FBA0E14A81FF6D384A5 Aimerocr4
967,788,087 *64EE9DE03373FB81DD1696A6D8765DDB446C67FB a$$imilato
967,788,088 *64E9F8A11445A5E39C481BE465BD9F1E431BD65E aiming-for-next-level-he-shoots-she-scores-he-hit-jumpers-not-books-colleges
967,788,089 *64EAF771CCC14CCE9CD4C5228FF9547084526DDD AimK3
967,788,090 *64E773B4997F85D416114102D30F7568066B2C35 Aimletiv3
967,788,091 *64E2A9BE9A1475883C013D536C1C50963E634062 aimonorted
967,788,092 *64E7892B5161E84D5184D2E9EF484D6E65BB5331 Aimonses4
967,788,093 *64E8F9CFD9C7DE6AA6EE4477E0AA33C4C10BDC48 [email protected]
967,788,094 *64E52D5D65A4EB6A3001C035C39CE095B1011CED Aimottas5
967,788,095 *64EF815E6D1A5FB0C4D76C499A6244E67C0CE49E öimre
967,788,096 *64EC5FCD7469D3967770FA776DFF9B3104AEEFF3 AimtG
967,788,097 *64ED530AD0A6631E779B5164069B0A12FCFC7BE5 aimxyz
967,788,098 *64E2C0491FDF609FF201F04E44A8A3AAD1614880 AImZ"
967,788,099 *64E2CFC831017D441E0F0E50489BC85EC9BC0268 A&In
967,788,100 *64EC23A31A940548B524210D165DC1F2FEA24813 Ain:0
967,788,101 *64EF8473E2D57F53E86BF9D6615F6C1B6977A46C Ain1K
967,788,102 *64E23FE704E945100FA9E29E73287D728DA2932F AI,n8
967,788,103 *64EF83096B7BCCCF980391360F1D0B2D010ACA09 ainamadar
967,788,104 *64E6D0325D53C3816904998B6C51C60589F04EFE Ainanimation
967,788,105 *64EAA74EDFBD7EAE633BB0252E795F7F75485381 ainataan4
967,788,106 *64EAAB4FBD440EFB25D7FE34F71D74462540254E Aineimaz
967,788,107 *64EC64E3D05E01EE2E4D078971A76524526795A3 ainepstj8
967,788,108 *64E89B4896D997AA2CB378F5C94A625E81F06E21 AINF)
967,788,109 *64E60324C19ECD4865B436AF969AC4C696914AE0 ain fatihah
967,788,110 *64EBD0EF58375E57D1E3DB1410FC385E904A44D6 AIngangjohma
967,788,111 *64EA3FFFC3B25CB854A54CD44C8DB97AE2185257 Aingelj
967,788,112 *64EB5DBBA1CEBC5C46D9C10BCCD31B24EF63231D ainlmannersandeuBtoms
967,788,113 *64EA5AABD2B96E4557B81E5446E8339C77E225CA AiNM%
967,788,114 *64E105AE8163FFB37AAABB8A845E8B804CFE5EAD ainmarcipping
967,788,115 *64E17DEEAE84141F843F464D42878A22797C8A21 Ainnamel5
967,788,116 *64EA6096969AAB3A9837AC80C7D07D1ECC66B8CB Ainnevons
967,788,117 *64E6AD762E0742EAA81D689DF99B691F64D53569 ainodehr4
967,788,118 *64E8FCFC539FF19424821CBA99DA3A81AB782D56 Ainolloc
967,788,119 *64E1A9A2A9B7192D3B9E01C5E88B49D01728A68E Ai(Nq
967,788,120 *64E1AD00D77E9ECBA9719D2E945431EC3446FD28 ainrubyt9
967,788,121 *64E6F19FF74F22C2C2CF4C2F5856F607103F60E0 ain'titgreat
967,788,122 *64EED0A9A80FC9E1626BDA06288282CD53A2290C ain't no levee
967,788,123 *64E7265A5A58347D7EF9704F170EC03548962F3B AiNY!
967,788,124 *64EA09CE2540762A1803CBFB5C6243672C75567B AINZr
967,788,125 *64EDF6A5CC7C945FB9F9978BA810338DD3FB0D95 AI=&O
967,788,126 *64EEEE7CA1E9B2430F2A727DFDBA20850CA2C062 A.iO,
967,788,127 *64E4B26F52DA4DDBF2E9AB9ABE5761F06110A1F2 AIo0d
967,788,128 *64E67266ABCA7DD66287F62C4CD6D7D6B9D108ED AIOL"
967,788,129 *64ECF917B364656DA780636CD065A1F1596C5557 AioNa
967,788,130 *64EC00044102D4C90B60A82931D42EDA4A1E1C53 Aioq-
967,788,131 *64E8B3C0A474D67C30AFDAE8AED3386F17F23246 Aio)v
967,788,132 *64E07E7C09F47568040659672A02D96221932FEA AioV8
967,788,133 *64EA1F43651555FB2A864B25B5A5E3CF271F79CA A=!IP
967,788,134 *64EB856977F5E8B3D4170E8CAB0C76A39AC29966 AIp"-
967,788,135 *64E10A5323526135F6434393B60373754C935713 AiP36
967,788,136 *64E856E8FC62F863B450BB4719CFF682B2A5BF9B AIp7T
967,788,137 *64E033FF1C53BE93AAC5C125282F5D5FDC1B73CA A=ipA
967,788,138 *64E2A723879A1A3F5041118669AF5BEFEF92F428 AIpF+
967,788,139 *64EF3592D439D563E9485ED4E9A614FD1AE1B58D AiPh0
967,788,140 *64E3F2A2659AB2C8C845DE2FA893CC08F813B2A6 AipHZ
967,788,141 *64E8ABD727D7C46ACA8E9896C236450E98F3584C aipmaaka9
967,788,142 *64E8D6DFFE23C941C6BF2F148C48131F816342EC aipmavan5
967,788,143 *64E4987FA84666CCEC729153870277D84ED6A539 Aipmivha8
967,788,144 *64EDD6417EE0727FD9FB4FCA833F3F5109D686BE Aippodsing
967,788,145 *64EAEFD2E070646D6BFE89AF0FEAD68AE503B7D1 AI)PU
967,788,146 *64E19D2FEAEACCF7060BB011A7186A0A11018E05 AIp(W
967,788,147 *64E9D8D5B24D3917EB074213FB349857000A4CF0 A-i:Q
967,788,148 *64ECA5E4AD9771237E60732A5632B95B4EF5DA68 AiQ=$
967,788,149 *64E19130CE32249ED3721612145A450EA95FBB1D A%iQ0
967,788,150 *64EAD845DB618BF6A0AFE79A3964926E7D22035D Aiq4B
967,788,151 *64E1ECCF9A021208EF7965009CCF932E176ACDEA AIQ_6
967,788,152 *64EFCFE4126C5C08046C4B7ABCF2EB2919DB5C51 Aiq6K
967,788,153 *64EDAD9C77E8F23E45510473CC237956BF170813 AIQ8F
967,788,154 *64E2CCA89474FF2137CB51F935624C4C475F760A AIqBq
967,788,155 *64EE6E9F6040CD6AF75865426F4DF191D38E8D5D AiQgD
967,788,156 *64E3F24BF8BBA544994A7914FFEF23B3978D86E0 Aiqiopejing
967,788,157 *64ECACDF7A0113644DCD176EF352EF02BD7DA0A3 AiqmP
967,788,158 *64E5C3FF8C2997CE607FB67F86C68AE667D84BF7 AIQ=u
967,788,159 *64E6B866FD6E2150D118387745E011927280EDA3 AIquV
967,788,160 *64E740A8F1B943449F9AC98D43B1E8B12CCFD233 Aiq-V
967,788,161 *64E2FB9F15C39156D894AB8721D8411D2C42F8E8 AIqWe
967,788,162 *64E8A65F65BBDB72E03F09FD3A92CF0A8ED2A588 A!i)R
967,788,163 *64ECB58E6732B3DA463B095974DAB51064840D05 AIR848SNAG604
967,788,164 *64ED0801143D4649CA62B683C770D2625E8E9E48 Airaknases
967,788,165 *64EA8ADB7215544069D6E46F1383FF0B452EEB1A [email protected]
967,788,166 *64E6345A338C6C7470699030365BA27588B16E59 airalifo8
967,788,167 *64E01A8755C9BC0EF4B478B007C65EBE8A2B1B13 airamnna5
967,788,168 *64ECB17012FEAB6564E5F9699DC20A141CC5404D airarohc
967,788,169 *64E779BAD42FF80D3AE0E7CA3DB6C10F5BE16750 Airassimes
967,788,170 *64E0A548086EC10EA71D103C55828CADF62D2233 AIRATSEM
967,788,171 *64EA7261CE69D5B00DF5F76E731DEA5981371DFD airautrichienforfluteandpiano,op.105no.3incmajor"asch
967,788,172 *64EC534A0FD2885923AEFB8721F51B1762750F4F Airavruc0
967,788,173 *64E93B4E332D33BAFF675C7C95E47937A6E65C41 airboat7
967,788,174 *64EC83E77BA8808A776B4E012425FBAB3D79196C Air&Chorus:Othouthattellestgoodtidings(Contralto)
967,788,175 *64EB995F051A1DEF2664A9412A980FC1437F48AC aircool4
967,788,176 *64E374D3CC2492D750A4B4D827BBBC11A2FEB420 [email protected]
967,788,177 *64E71D0E98074F35510CC3604EACCF2D23C35E57 AIrEC
967,788,178 *64E590D8B58FBC3ED90A329D5A5593E60DF631B2 airegla4
967,788,179 *64E5EE5977E30DF82A5AB55C8998B7B48FD50A0F Airetsir2
967,788,180 *64EDAD8AA22CA641EC54571BACE506789B25E322 AIREXPRESS
967,788,181 *64E8DA1AB50072AA5CD177FD11673C501C670592 AirfO
967,788,182 *64E4A4BC985E91E34CB85A1B757275AB22AAEE4A airhead35
967,788,183 *64E48B2256D73B63C3C708D08CB6E2A9A47DCCEF Airhead (7" edit)
967,788,184 *64EEDE79DD71B61487E725B1E5B999D18816A01A airheadts
967,788,185 *64E6A17E6974C53D386C77E9CED14F488A9F9EEB airikka3
967,788,186 *64E9AB55210388BD47E79F3725613827B5E85C9A [email protected]
967,788,187 *64E6BE6C0EF34119610FA2F447396841110D8F24 airlifedenver
967,788,188 *64ED4229B7CFECED28489E110AA5D78D594B6CD9 airlinesvirgin
967,788,189 *64EF5F74CB72D33484B8F8B3B4C1B72D61E9B9B0 Airman2
967,788,190 *64E30281EEA0FD8C4A7A7474F4C93E0A6EEEF08B AIRMISSILE
967,788,191 *64E7D8F8FA5112EA7074411557BF81FF312B0F3F Airoldi1
967,788,192 *64E246722E98D1749C0E7D3437098554834AEB8A Airolliv6
967,788,193 *64E69E072387D82C485D200CD479B90588EBF9AA Airotires
967,788,194 *64E2AD995DD60FCA3283311DD8E6E05251F95ED0 Airottaas
967,788,195 *64ED23BA6828E60CB7A5B80A28F2123F50728463 «airplanes»
967,788,196 *64EB3C80CD672509D89A370B5D641FE93D353F44 airporters
967,788,197 *64E8D1BDB5BDC757D1DB2AA4933BE673AA5E9313 AIRPORT-WA
967,788,198 *64E7B2DFA4807589CB93D937E8E40AA0C31F00E1 Ai=RS
967,788,199 *64E765C858D93EAA5B2F20C4A29AC5C9942F484F airspeed2k
967,788,200 *64E6F3B30376117F2CF0054E597BEA491A039675 Airsput8
967,788,201 *64E30478083BD68F72989A9788B2C0DDCB836DCA airstripjensens
967,788,202 *64EFD507AAEF3EC11504AB6437EE2DFFED728727 airtimid3
967,788,203 *64EB3A657F3D88E0F9F85B818097ADD9595B8219 airunehted
967,788,204 *64E4A85F0C5999E7F1945177C6DC143A73DA40BA Airutcon1
967,788,205 *64E122C2231CFE47C983B757EE713F4F9657F182 AIRVECTORS
967,788,206 *64E21112A00502EFFEDFEBA92AD7C80176FFC1F5 [email protected]
967,788,207 *64E62EAA3872B2448250BDB8EA341689BE0C043F Airwav
967,788,208 *64E242DAD77C9A2C4EC673D4D7E8B55AA5FA4988 AIRWAYHEIGHTS
967,788,209 *64EBA7D3D35D06EC8A3C5E0DA7B45B53F44C53FA air-work
967,788,210 *64EC65453CE530C37D77A8D02E86D70BBE60726F Airworth1
967,788,211 *64E1382404181AE1BEFFE603E5397383756F1C6E AIRXDE
967,788,212 *64EE86BF6397554BBD5CAEBEDBA1324C10ACC91A Airy Tapping Echo
967,788,213 *64EFC8C4BACD3A66183720ACCBAA2705944088EB A"I-S
967,788,214 *64E8DCCA7A94EC831C80B867219C4755C589B013 AI%S_
967,788,215 *64E89D07A8C25F6BE848593CDD0256E65A2756C5 AIs=(
967,788,216 *64E251D7B83C414E078DF0BBE6CD7F08CA27196F AIs7$
967,788,217 *64EE1675FA57471EB97F4CCF7A47C2E67CA5EA16 AIS8s
967,788,218 *64E7D58A2EC71460A4509260E0D5EF666ACEF0D3 aisalliking
967,788,219 *64E71EF90F8FF1985FE1F6372E67DC9C02D6A82A Aisarcsy2
967,788,220 *64E74483DD04272D5A69ED17E7A76CD00EE62105 AiS-B
967,788,221 *64E9D675F6417DC11748B9FCFD8E49385F4DB1DB AIsCP
967,788,222 *64EE13B52C33CCC1942F878FF322B78D5FD82BCE aisehpen
967,788,223 *64E20E1BDC8E367A237547DD9E89715C35436B26 Aisha397
967,788,224 *64EF66CA2C18A145F146EB7595DFF99BA2864612 aisha632
967,788,225 *64E76BE964F621F547B851AB19BA88DCE5D52600 aishamaria
967,788,226 *64E082B4E927A100DA5668F8F11F1CFD7FA24E55 AishZ
967,788,227 *64ED44C3788FB5C94A46D7322A3B0816800A94C1 Aisiaiku3
967,788,228 *64EA0CB58BA5B6984BC113CC0B2512168991583D Aisiaunu7
967,788,229 *64EE547BABD3D3CF41A8E46B2C79C452BED4B459 aisietto0
967,788,230 *64E3FCB725A8EE91698C1C24BBA43C797C11E5A6 aisiksoP
967,788,231 *64E711D246BE418F74E351E367C925A0269F45D8 [email protected]
967,788,232 *64EFE4CB5998A7FFF05E379433943063B571D165 aisiomih9
967,788,233 *64E8DA4076A1E935173541C64C77A27487754DC4 aisiumot8
967,788,234 *64E06435630C81450D50ACAF5A42BF4BBE68F2D0 A?isj
967,788,235 *64E6FC5393716B049ECBA19C87F6114A61EB7558 AIsKc
967,788,236 *64E742665736D4A6A62C1FA22EB2FC04D3C08BE6 ais ketul
967,788,237 *64E85E2981071EFB7DA062745C4238B718F19EC2 aiskoet5
967,788,238 *64E9E2082AC51E21A226A207D8CA18C28964A268 aiskotiis
967,788,239 *64E6E94DFDA9660E729C85DB1B384997A972E9A2 aiskuuso1
967,788,240 *64E19FCD242C316B6F1C5A273898039E9A4B35D8 Aisland3
967,788,241 *64EEF1A72F5A32D9FD09AE4C91CB9BEBD4B4198F AISmT
967,788,242 *64E8EFE1A1D833CC7A61662185584A127BCD23AA Aisomyhp1
967,788,243 *64E9A3150A35A1FAA5763275A58CC2BA776BCB44 Aisotportnev
967,788,244 *64EAE0FB54012015A0F0D2669D444731194DE2E6 Aispepog5
967,788,245 *64E43FED96DAAE35257C44585683D36069CA5272 Aispepsy2
967,788,246 *64EDA3C133DE9D504545EE5A8F3CF94F98A9181D Aissatsena
967,788,247 *64EB0CEF6A6BE2B823444B189BA4638CE45EACBF AISt7
967,788,248 *64EFAC2EF3E226869004399695F589BDB6677318 aisyahmalik
967,788,249 *64E03CB9E7FB783E466E37461D92350488F89B5D AiS;Z
967,788,250 *64E4249A3795489ADD83E6CE15111CD54CCBB3E9 A,I;T
967,788,251 *64EB9FF463C2A39F0F2E63D83CAEFA051F61DB8E AIt$,
967,788,252 *64E64AF70855E832854F20B67586533E9C398E15 AiT
967,788,253 *64EA19727CFFAC482524E00B4A18AB0E72B9AAE2 AIT6p
967,788,254 *64E9969EC6C10913D36C4A6BC1855A53E922D7BC aitalap9
967,788,255 *64E7A75C50B49B18D45888F754E1C47765560C10 AITAYRUB
967,788,256 *64E16A99A035C343980D7F1C64C5128713C118C3 Aitepmoc0
967,788,257 *64E94E9813036ACD9C96FBCB8635213738EF4BAD Aithenno4
967,788,258 *64ED669646ADA1ECED0F504F2A0853917567F2F9 Aitiatoied
967,788,259 *64E0C329E61B934B542F7987E1AA7926A619A3CB AItmt
967,788,260 *64EAAD8373C448577A83DD8F80945362AA242817 AIT-n
967,788,261 *64EBB85B3E3E743F1A92DD015D6CD26AB5CB307E Aitnetta6
967,788,262 *64E61E8B3AAF68ADDF471F085C42889455918800 aitnevid2
967,788,263 *64E9D0F87982447CB61720F72886291751482AE0 Aitohukanputki
967,788,264 *64ECC31213767D0877DAA8C44A40BE14B596272C AItsh
967,788,265 *64EB6F94304DF88837107D6EAF5B74D284DC2911 aitsiapn9
967,788,266 *64E1EB186DF1E69799986A3D1AC4EC0D3B0B0C1D AiTT.
967,788,267 *64EDB108E3A477E21BC199F2602C7E238545AA92 Aittalras
967,788,268 *64E9B88F39FDD3B69E1C76629AB02F33AAD60996 aittett
967,788,269 *64E4C6F4553BBBA1DC46FF991B6513F200BB06FA Aittlaved
967,788,270 *64ECF8EFD7BBB9417A6ECABCBBF837418D35EC6D Aittokylä
967,788,271 *64EE6A6ED13C5692A881B7E3758800330B873327 AITTV
967,788,272 *64EF4538F2E7790AD97758452CBC1A4D0CAE1AD1 Ai;U_
967,788,273 *64E8B4CA14CCC6D6CE25579A91F511FDC91FEE1A A$=iu
967,788,274 *64E5F371B5EA9DE6353DFDE68175C082012A0804 AI!U0
967,788,275 *64E9516D10FC7C39B62E54307CACCF3FD602CCA2 Aiu0w
967,788,276 *64E6C3867D4DEBDDEDD2050C14985B6E17D3484E AiU1,
967,788,277 *64E83D86D1380BA76A942137E1ACAFC2780722D6 A/iu3
967,788,278 *64EC12427246DA17B9F1DF011D539DBB9E8BC2FD Aiu4N
967,788,279 *64E4E8483232FED041C449B9EDFC2D535BA46CD0 Aiubb
967,788,280 *64E8EF4BB0F79B21332AFB688D83F3E2A2317A0D AiuGb
967,788,281 *64E2056D3C7AD1D7EEE0BB4D36D75A1B94ED4256 Ai_UH
967,788,282 *64E26FA306A284FA936E549C7946AB145E307517 AiUH6
967,788,283 *64E94180E9F0154BD250087ABBDBD91AA1B6001F A)Iui
967,788,284 *64E99B1D34C7005D72853B1FD00BE8EFAC84F56F AiU?o
967,788,285 *64E7E727CA65C3D622A657D1A8C4C15E12D0BA8A Aiuof
967,788,286 *64E90A8D365B4182BD2E8A21562A29CDD2B19E91 AiuP5
967,788,287 *64E308571825513364B03DB6545FE4BFE0E65839 AIuq&
967,788,288 *64E4EAF57C0E3168E135AAC883D0EB74E9ED7A80 AiUwt
967,788,289 *64E7B8E491E913628C36AD504DACE398B126AC5D aivastel2
967,788,290 *64E4BF39E827ECC8816939EC34F096CA5E67CCD3 AIVASTUKSET
967,788,291 *64ECE33554B65B2608935F6FFAE6ECF13490203D Aivetlak1
967,788,292 *64EF2A7178D411C17F62B58151849EE9A452549C AiVFH
967,788,293 *64E64C25710A93AC9010CE57CADA3F3F2CD5EF16 AIvg:
967,788,294 *64E93A839E154E89D41E0765EFD100D76689099F aivinsa
967,788,295 *64E9C69FDC7D5B0FFEC6BFAF0991A7E56D55506A Aiviokan6
967,788,296 *64E9C93F875DF6FF18A71295689988BF8D1757C9 Aiv
967,788,297 *64EDC02A2F2CB41D5CE1BAC70F7798DCCD038A7B AIv)L
967,788,298 *64EF950C1E8104C1B72DAE4C90083879EFB407B8 AiV#n
967,788,299 *64EF85498E653F78174495850960A5E46D40C0BF aivokram123
967,788,300 *64E6DAFA3366372494CE9C27EEF6EEA3C810CDD0 Aivolis0
967,788,301 *64E18F669BE69E6A92A7D49C8E0253DBB6D103F7 aivutlev8
967,788,302 *64E9FD6B45763B3A48D7858B44C543447DEB56D9 Ai!vZ
967,788,303 *64ED0755162E8E352D8A8DBD3AB0250593ABA612 aiwaggeljon
967,788,304 *64EA95DE03B4B53E5E7BBBECF9B4FEA7F8B19A95 AiwbX
967,788,305 *64EC0C69131B8520EB4B26CAD316BFFB213C2A64 Aiwcm
967,788,306 *64EDC686B25297F17D69B997B0520ABDB778CF16 Ai:WF
967,788,307 *64E8BAEDBE2875AB37B3CC9A56D64851F1276BF2 AiW=F
967,788,308 *64EBF20AFE025B84EB979AA366BEC355FB97FC2B AIwhv
967,788,309 *64E53E4BD1F091311899798B45E22131F8DFBA7F AIwmX
967,788,310 *64E87FE65FCE363271FE9FDF9FA158C7466D25D4 [email protected]
967,788,311 *64EA1C414469AAD6A2B847553F2EF1ED1A44EBA4 AIWOBA
967,788,312 *64E35C408FC9B67F35AFBD3C70419EC463E74FDB AIwt?
967,788,313 *64E371E168E291F74A6EF442FB0BF5C5CD5D155F AiwT?
967,788,314 *64E4BDE4520A1C29CCEF98F993B75EF6F4C88C88 AI&X.
967,788,315 *64E92D776282D87F25A31B637CFD4D176D6952D5 AIX%6
967,788,316 *64E05DAF9F55A0E7D9BA7622147CAE1CC9F4414D AIX%A
967,788,317 *64E72945CC1EEE5815DED6548A18C3E02488B7EC Ai&XF
967,788,318 *64ED597DD9A69AC47E660D7FB9E92747C0DC94DC aixhionvillc
967,788,319 *64EEFAEFD7F5001C1ADCF589A50A84CB243FBB24 AIXra
967,788,320 *64EAB3687403178EB35CEE52F24411346D35E86D AiXs7
967,788,321 *64E84D23E69C40CF6FBA65ADBC764127C4168324 aixtuwaiguc
967,788,322 *64EDE31D39D5762CF50E425CF223CDB2A5E3B49D AiX(v
967,788,323 *64E822FBB56941844741FA6767FD19C609055FCF AIXV3
967,788,324 *64E45DCE70E88E4CA4F78F0997E3E6049ECC5FA6 AiXYP
967,788,325 *64E03BFA425610B1C0F4D0461CB05A8C1587D506 Aixytnys
967,788,326 *64EAE4D3F64236358AC2FB080C80301F31DB2089 Aiyana013
967,788,327 *64E0A6AE55EBA383E49AC5C890C2CFB344AD1D04 Aiyana258
967,788,328 *64EDF32222A5C6CE46985AEB0C1141078A130DD4 [email protected]
967,788,329 *64EC1A129000743E26165967C0F6949DF89D6F2E AIYgF
967,788,330 *64ED54A7E3494FC9BE6915826121A1C114D90AF6 AiYIS
967,788,331 *64E93924DBF848F1B599F46E3EE293BC3DA55D5C AIYn_
967,788,332 *64E31491A92BD84A160932DBB41C420916EA9F02 [email protected]
967,788,333 *64ECE9446D3A87B0802A4E76040B5D1C4E4D214E AIY;q
967,788,334 *64E7363F0B4962BE77690998AF537FE4E1879DF8 Ai-YS
967,788,335 *64EE8883979B6402C98EA1DE6F62FC05636C6A53 AIYsr
967,788,336 *64E18D6C5A869C9BA3B81AAAC8AE2BDEADDA161D A=IZ,
967,788,337 *64E6489036004D69A36F782D8B9D6B79A2E4E66E aizad hassan
967,788,338 *64E86146CC2B16E1B69D912F4263DA5E16441095 Aizatehs
967,788,339 *64E60FCE70B456F20BFA67CFE709ACB10345ECEA Aizc
967,788,340 *64E3324E4FDE57092E6400EACD04EDEEE11D384D AiZe3
967,788,341 *64E48C35C3850E8A5282F5F1BC0C846D782E5853 AIZgY
967,788,342 *64EE4E482B237898402D130FBD52DE3F853EB975 AI;Zl
967,788,343 *64E924785BCADF516C71D4F9A6FBC56A303E69CE Aiznarag4
967,788,344 *64E00CE8DA9D59DD85BA7F330EE35C7522C1F634 AiZnP
967,788,345 *64EDB64288B753620E96D8BE9DCE0FEE11F5BA35 AiZpV
967,788,346 *64E1A1AE882F28BDA626F587F68EA02D1D2EB3D0 A.J*
967,788,347 *64E2B2A4D3618533246DEEA093622D6B4E3EFD9B A?"#j
967,788,348 *64EC397B5E08210CC6CFC634E2485DD1F7A8F1B4 A?j?;
967,788,349 *64E2A18D313C5B838DE0330E0084F33C643A19F7 A"^j
967,788,350 *64EBFB88C3F3F62ACA0CC95CEC9964441454653B A""=j
967,788,351 *64EA68B084FEB97BD1C0C792CF459E086F32CF3D A)j:/
967,788,352 *64EF30D71A92231CDB73EBBC747C35C93D8C74D6 A&&j+
967,788,353 *64E95D0BD12C549A71AF9B4DA77B0367574F23FB A%/+j
967,788,354 *64E7D8C502FED1BDB8341501A9EC369F1B49BBF2 A+j.;
967,788,355 *64E4842E254F4083C367EE2A3E96A2F699F69010 Aj:"-
967,788,356 *64E0BF0A75D4C060E3238AD83F8C2B203E6A6C1D Aj/+
967,788,357 *64E00A771691C74136D7F92F106670E9D7E920AF Aj)#?
967,788,358 *64E8532C0A3530C165377E41E570BE57DEFFD249 (a・j・フロスト
967,788,359 *64E060180F736CBBFB024556B62EBD747C8DD779 [email protected]{j
967,788,360 *64ED8D12C1BDB016A64312BA04F5659BE34CAF72 Aj0AB
967,788,361 *64ED9A0DC8F8EDE6AA1CBC02E8E544D16C7FBDE9 Aj0pa
967,788,362 *64EF7B899FE1026838D8AF6CE25461FD70208729 Aj0tl
967,788,363 *64E56B31DA2C8151BCAE156DC1C92C8C9FB3EE1B Aj10o
967,788,364 *64E7AB2087CF433C42E25B9190CE33583762E8F1 A?j19
967,788,365 *64EF4D1C4BD7FF6E0441CCF0BF8638AF8E464544 Aj1FV
967,788,366 *64E5F6478E4BFE1F7397AF9E399531E77E16A83B Aj1NM
967,788,367 *64EDCF3DB9612C6D605F3ABFB5670F297E1A4A38 Aj1tN
967,788,368 *64E6C8CCC918C51A9B79F19AF92AE19C9FA93ABD Aj1%X
967,788,369 *64EDACFB3863936B0E97F4D49A5A303C348811E1 Aj=2A
967,788,370 *64EEE73A2AF2A6F2DC900FFFB219480F75305C30 A(j2d
967,788,371 *64E2532072C216D83275DA2AA6483341897BC158 Aj2Ud
967,788,372 *64EF459521D69A900572CE90C4CCAE161A0645E4 Aj38r
967,788,373 *64EC02D1EB93E55363DCE9CB6887462CB217B129 A%j3w
967,788,374 *64E4B50796E62DD8B7B92FD8EC82A87FD1BDE7FC Aj4^
967,788,375 *64E0FC249E85C1FD11AAB79730A174A8E6297111 Aj48,
967,788,376 *64E56E2EE2E618C40897CAA60FAFCFA09CC3DE70 Aj"4q
967,788,377 *64EEE8727ABDAD3B157A37401A49F5AB2E26CE93 Aj59X
967,788,378 *64E548B1619B0B0C22FDB86320AA99496698AFFF Aj5DV
967,788,379 *64E098A23FCA106E254EB2309FE6D7D3D8EA98D9 Aj5/U
967,788,380 *64E32392418C5D0D5D54B2400DDB3BA54CB5BE0F Aj)6(
967,788,381 *64E21B93178C02E49BB91283BD5230CF83DEE82C Aj6EV
967,788,382 *64EEF04DA9E1AD12676B4BE3C7AE0C65255A3EF4 Aj7R3
967,788,383 *64ED3E5CBF737267B618B9ACD42E1B08E1CAF7DB Aj%7Y
967,788,384 *64E6E06DDC7AD8C48F46F450DEBBED3FD14C2456 Aj+8+
967,788,385 *64E7E7D2FCFBA4766A75EBBEDA73789BBCACB3BE Aj+8B
967,788,386 *64E1F176A082D1D49CBA6BAF7931CAA4F3E8EA51 Aj8Bi
967,788,387 *64E4FDE59697DE472496DEBF372329D65C72001A Aj8Y=
967,788,388 *64EE3C1158A3BE190BD059F1E60F6F3726019111 Aj9!F
967,788,389 *64EBA2413F1C19A7DF4780B8AF740B1DFCC5B4F8 A$+jA
967,788,390 *64E929B453B13E131D2C91A940698D48942B10F6 AjA1h
967,788,391 *64E779C2E7E61B85CCE267490DA5B7F3647ABD4C Aj-A4
967,788,392 *64E4FC99113C6F7EE73743766454ADB97F189265 AJ$aa
967,788,393 *64EAAB0D2A0092984062F9D92823EFD3F02A2D3B =Ajaaa
967,788,394 *64E080106718E19916A0B8E64BA766D8CD78A6AC AjAAAAIBAJ
967,788,395 *64EE168DF810FA2CEACDF6111EC246844C82BB27 [email protected]
967,788,396 *64EE94144CCD54B2EFEF4D3F2B3187E2A3D7E1FE Ajafpour8
967,788,397 *64EC83E22E5D1FF4503960AD4473650959B7553E ajahboo1
967,788,398 *64EB76CF6C1B64DC3C964B9C1D2C45FF780F86AB Ajahbrah0
967,788,399 *64EC7DB6FD9C6686456DFE2C1CADFFF15BEACE90 Ajako
967,788,400 *64E363CEEBABFE1FD540A8848C1AF73A22CA96B6 ajaksvoking
967,788,401 *64EA7FBB98095FE89099D074617A4EA68C6B92DC Aj,AR
967,788,402 *64E66E7E329AE6AA8347A22BA01E5BCB49E39D01 ajarairing
967,788,403 *64E41BCD4EB6A25DD1920E995BCFDDF35D2B717E ajaropod0
967,788,404 *64EA9E8A4E0C68195170AE449DD64ED0D2D3AD72 Ajattuet1
967,788,405 *64E68836979A44C0CF96853CC70865A4C5B5AAB0 AJAXa
967,788,406 *64EA6EF90BE00BACF8F55275A720E1B7ED8AF110 ajay kumar bhagat