List database


# MySQL hash MySQL password
961,950,001 *64496705A11FE71406EEC40B5E2CC9E7B62D26F4 Bosbeekje
961,950,002 *644D78FB54FC2C18BAE179B23A10B5B188033AF0 boscaiuval
961,950,003 *644F93A91E25C7F12E09D35A35DAE155044AF074 Bosch and Ferras Exited the Front Door...
961,950,004 *6446078BE07F5D1A074710483AEDB9FFE542FFEF bosefsking
961,950,005 *644D67EC02A1618BB20FE1412CD6CD45139D7319 boseggia
961,950,006 *6443B4CD7A383AD25440E282713BB4D27BEB4DB1 bosence8
961,950,007 *6445E48733A799F36F27F7F5449DBC4D57FA74E2 bo.sequra
961,950,008 *644C2D0C66B0A2AA3F6D221161CAC4C994CC2109 bosetnings
961,950,009 *644FE4046EB77CDAD495A61BDAB4B62719F244AA bosexploitatie
961,950,010 *6447C65DD9F652F27B7CD667C1DEC0DC2657AFD8 boshamvillage
961,950,011 *644B58E3F966FA4E0E39F5D998D1F7F8D1D9EAC7 boshboked
961,950,012 *644EF3DFA519801B42AB5CEB12915AE5DE33AB85 BosHc
961,950,013 *644FFA26A0716991F3C43FA1427D340C8E919BD4 Bosiljev8
961,950,014 *64415D4327412154F64CD85A3E22959A58B718F4 BOSLELIE4
961,950,015 *644DDEC12003D0DD6855ABA613B24C5C8CED95E8 BOSNA26
961,950,016 *6441D3A264C7319B6553075D7E59FCD5713C3860 ˈbosnisə
961,950,017 *64483047A3B27921CD916632D768CC3493B06E6E BOsnT
961,950,018 *644C941B339C3383319A13D081EE8C6D89AC964B bosonožského
961,950,019 *644763D8D15BB3A07D2640A141B7490C5B83D31C Bosporius1
961,950,020 *644A4178B392679800C652ECEF52D1620E76BA3B bosrevdisc
961,950,021 *64452BFBDA1246D0B29760C480A6C8C2A85B9017 bossa4
961,950,022 *6444BE4BE815751964A0F767CD0AED77794F7865 Bossanger9
961,950,023 *644445F1E0106611A8B12C8B757315058EEB9635 Bossa Note (Jask's Deepjazz Excursion mix)
961,950,024 *64418DD7E304DBE1AD420EE0B83314CB4F68EA5C Bossbuddies
961,950,025 *644788640AFA7AD3B7674B6BC99310A9C3DED418 BOSSCARS
961,950,026 *644516F273F9DE103141A22B77BDBF0B151A504E Bosselering
961,950,027 *6440E96255F0132D8C1FA5AF93D49BB1E5A88C69 BOSSHAND
961,950,028 *64480E5D6AF752CCE6B3B65DC452E5C13AC10DD5 Bosshollied
961,950,029 *6446517E677005FDEF4D9F8B13B85EA108F1C57D bossiella
961,950,030 *644D099688930310D039173F3D84B4E0F56BBEC6 Bosskeith1
961,950,031 *644C09739E632358959AE4612A7DCFBDD6132FE4 bossman2004
961,950,032 *6444C0C4979A21804B9B59011B6C9162F6A74F03 bossroo
961,950,033 *644766F87ACF45184422FAB12A0F36A6BA17943B Bossroxy7
961,950,034 *64448609DA87294741C854112BB2C6F94453A451 bossruby3
961,950,035 *64435799E1F06A0E335027E86FF31B1EB4D41353 [email protected]
961,950,036 *6447ABC13F76BCB6D806F65E014DF132D8558D9A bost3l
961,950,037 *644CC85BD4391E05024B1DD9384EEE04A48033AE bostanci0
961,950,038 *64451A2061B7D9D953F070686C6B37206F735AA3 Boston286
961,950,039 *64497C2B1A5ED6B4BCEB9BD7C97209BD2DF14C55 BOSTONBUNNY
961,950,040 *64412B31B51EE5EEBF66F1016D4C2BA772D70D1D bostonits
961,950,041 *644105C87E6064826A1656CFA51190AD708AADFE bostonj4
961,950,042 *644EB72D70A0B7F9A507C688DFEBE81628B7F77C bostonsandboxers'-'bostonsandboxers
961,950,043 *6448BEA00FC7C7A7DE7F81EB6AED9C39040F2C69 BostonUBasketballCoach
961,950,044 *6449E2F0B01932C87B169E69A387DF8CFBFA8EBB bostra)と改名され、
961,950,045 *64456AEB9DDCD986BF01CAC93800B4EF95511CEA BosTw
961,950,046 *644D698AEC550505F73CD2EE8847CE2B6D843057 BOSUIL4
961,950,047 *644B1E3C8C4F73E1085F40272DE0CBAB3E8C351E bosvarke5
961,950,048 *644546CE9F72CC8CFF42B207FA48809352EEAFC9 BOSY"
961,950,049 *6442D3E21559CB99FF87CB006D52AA5033734C57 BO))t
961,950,050 *644911565AA4CBA81C5F3A6CCF9A77EADFE9CBD3 Bo;t0
961,950,051 *6445A9815174E510A3B9FBD9EBD4874439105DA4 B%Ot4
961,950,052 *64467CD1D33C7AFA3D8DE7A2D47A129C074CA7E7 BOTADUN
961,950,053 *644A12AAAC478ED7DA73AD4A381696B551104C90 Botadurases
961,950,054 *6443E0F612EEF80D5D91777C97FDE645D7B97579 Botanicheskiy
961,950,055 *644C84680876E8B60AC5BF0716593C041E2DA3BD botaniğin
961,950,056 *6444B105503016B8CD807707483577D0CDBF108F [email protected]
961,950,057 *644A340527342D8E39EF728A71A5D0EE05D86531 Botarates9
961,950,058 *644802B1BE3FEC2479551FE27B2E6B690CB36091 BoT-B
961,950,059 *6446FF4476C769D5C06518F668CDEB4507E916DD Bo"tB
961,950,060 *6445DE43EEA59822C855F8A64E132C3C27E097D0 Bot.d
961,950,061 *64425AA70F77AACC0D034EC5D598CF983887498F B.O.T.E.(Murslessoriginal)
961,950,062 *644D1451DAD7D9D0C08265FB48B68FB849A36988 boterbeestje
961,950,063 *6440A15FE15DE7F5F2A3A69092A383C839BC889E Boteuses4
961,950,064 *644AAAD95B3A58EDF9DFC8FFFB43569BECCDB4EB bothellfootball
961,950,065 *644393B18257AAA578E6A1C214FF8CD844719BD7 [email protected]
961,950,066 *64440C8AADDBCE922ED9D0E0C4561AFF4EF9A729 bothr1olep1$
961,950,067 *644B6A9B842E9E823C3334AC432237A366279B1B bothrideridae
961,950,068 *6444EA4DD76819B1F3F0A87009DEE60FD804E33F BO)tK
961,950,069 *6445A61EBB8D37577A83E9F9DBBADAE6DC15137F BOtM/
961,950,070 *6445BAD8DF8AE41B9535330FFDB2BBA8DA9FFB48 Botniai
961,950,071 *644070E24EB9B97A50EE94B70C976D37ECC8DE3B BOT
961,950,072 *64495DFCB4BEE5A4CDAAE263BC8049FED5045D95 botoaniclrai
961,950,073 *64460D869FBDA04F7D9431D30479306AF3A300C2 botoanirchii
961,950,074 *644965962944DCA9D9B16971424B0DA571BCD458 BOTOCHEM
961,950,075 *6448BE51EDE0DC290F178140DB3C3DF96C3C398D BoTQ:
961,950,076 *644BD5A2FBA2D0806C28CFACB10B25615F20353D BOTRYOLITHE
961,950,077 *644DE471831F142D53C8F53F3BD8B7E0A24113D4 Botschen8
961,950,078 *6447DDDF811680C8EEC93EDCB48BA0C4D5155B27 Botswan7
961,950,079 *6445CF1F498FC662109416DDBC222D47EAE64861 botswana“
961,950,080 *644338357BCE4CD31E3AFF77A8D3B3FE7ABDF20E Bottell3
961,950,081 *644DF9AD7792CAEED5EAD6FA2631D94CF6451EF8 Bottello2
961,950,082 *644084298D3FF994D897E66CECBAA45A788E5CA5 Bottendligastes
961,950,083 *6442908DC3AF0B87B146C0BDE39AD61ED537CAC8 Botter-en-brood
961,950,084 *64475178423AED1DB09F125E635329C76B6D8D24 botterpapier1
961,950,085 *644EFA99EBE7A2B8FE8A56D5E163F33AF48C6F7C Böttich
961,950,086 *644321541EC22687DDF4038F298661D16DB1D541 bottl3mold
961,950,087 *6447589F2ADD130E0E79DEE34AC20DEC805A8F19 bottlemaker1234
961,950,088 *644EF6B02A90D68A4BA58F09FFDD3B5C4BA6CEFB BottleRocket(live)
961,950,089 *644762E0E64DE35F5C4169FBFE64EF0F82AE3BD6 Bottolvsen
961,950,090 *644F2733528E9A4AC049EED303858025B428C00B bottom-right-most
961,950,091 *644B9FFA3B338FFA8C9B3570A15C9E9CC20B4D68 Bottomryings
961,950,092 *6447EB12FB828FC41D81F14FC9A2830790AD680B BOTULINUS?
961,950,093 *644FADE2B5AF1CB1865D0D22D219998E759A8C9C Botzinniger9
961,950,094 *64444E75B55547E7957094AA9CF452A015B46220 B?O+U
961,950,095 *644D2F3D598DF46FA8941801951FE61DC8C8CD41 B,/oU
961,950,096 *64456BCE83E557D50C6B2351688166B7D1F5F3FC Bo(U?
961,950,097 *6449499F87427DA3EA726A4702262A9B578E09F5 B+ou)
961,950,098 *644E57558E398D44215F8E28233931BF86A5AB29 B=ou0
961,950,099 *644CE08FFA7F510BF9A924628E66D9765F893D52 BOu,1
961,950,100 *6449762189899D71A2823D1AE7ABF47335D45B05 B(OU5
961,950,101 *6447A7BEC4E445BA2BFCDDCDBDDB7D35B0566AC8 BouAk
961,950,102 *6441869AEDDC2EE10F65A3C2FB38688955B59A45 BOU
961,950,103 *644AF81EEF380A872F2B134EB2C597841D5220EE BouCZ
961,950,104 *644E3BAFD36F07D3981B56E4B73F7D43ED1FB5A9 Boudaient3
961,950,105 *644E5B7580F768C9ED43F08CAB433572B67846B6 Boudanam
961,950,106 *64493C1F6C0E9754F48ECC3EEE3B52EB7BD1A412 Bouddhisme…
961,950,107 *644E24E51F6B073E97ADB161143473048422DB32 Boudier1903
961,950,108 *644668B706D7410ECEC35DB5204D3FC70A585D93 BOUDON-MACHUEL
961,950,109 *644930008976CCE360F40D16F2813366BD1E46D3 BOUDRET
961,950,110 *644D6A95E2F229449B2D14C93245241869325220 BOUFFANT2
961,950,111 *644948C0840C7C417ADA2F3F0ECA1AD122AF0DF7 BoUffE
961,950,112 *6445217DE22C4E4D21647F58F22CC4158D58537F BOUFFES-PARISIENS
961,950,113 *6443239B213705AF7771D185F59C10D0E8BDED2C BoufO
961,950,114 *64460282B2053A682AC421B28F904FBA73325B4E bougcjdaqlkbqh
961,950,115 *644928E456532D1CAB0B177CC46C143870D86388 Bougherra)
961,950,116 *64490D887B7AB1D03673A7C99E41CA7DC10E0579 BOUGHHGUOB
961,950,117 *644A64D5EE80B26757167CD5E1FD83CDDA8EC6F5 BOUGOM
961,950,118 *6448E127D4C21DBF0E3BFE766BBAF88135A91583 BO.uh
961,950,119 *644AFC64D6089D087372631868DA1C1E81696D36 Bouhhaning
961,950,120 *644ED17E25A0A623B0E20172E01713FE0429F8C5 Boukarī
961,950,121 *6447A591387FF4D8A970224C0B78CD01E9FA2123 BOUKOEL
961,950,122 *644C106C490CF08B9EF7F14CFF1BEEEC6C72D367 BOULBET
961,950,123 *644BE5650FE54A257F13212BD3835B3A629D7957 boulerand
961,950,124 *644DEBB004E7BFD0EAAE38835CDDF865F0CA90F8 bouleuse
961,950,125 *64427CC5AA178DBAD099C05C4DD2C7D4D79862FA Boulgarophygon
961,950,126 *644EFB9E75625F12F904F7B6D3ECBF147654919F Bouloua
961,950,127 *644B3902E66EE938B1ACD1EFD9F884D3C0885B8C BOULTERSCUTJULY
961,950,128 *6449B775F32F2922D35413E986A154A754FE623B boulterst
961,950,129 *6442D32B09E5B9A0E6D3D03633833526CD7D3EC3 bouncedc
961,950,130 *644A5690660F29E7A7ACC71E7BBAE482756E985B BounceMart
961,950,131 *644F213E28B726C8E8720D1E8B21F87786A49997 bounce (ozinga)
961,950,132 *6442780649B0DA22560DF853AB2AF3ED540BB5E8 BOUNCER1888
961,950,133 *644F5DBA3E8D1E712C28F2AD7FC9A0CFD601E85A ...bound
961,950,134 *64491D08EADF31E6D34E529892EDFA864E4A6949 boundarieswa
961,950,135 *644AF4E41F696EECB38D2499B43EE3346C358E9D bountith8
961,950,136 *6448071E738D280F8FE1F1ACFF25D29CB480A117 Bountyfed0
961,950,137 *64436265F2AA4B7EA18A74CDB19DBFED7C02C678 Bourbers9
961,950,138 *64439366B3924CE308CC5AF00A96CB0F06027456 Bourdaudhui
961,950,139 *644A15E02C837618752486D1A094B34AADD54436 bourdeloise
961,950,140 *644393880B6F90EF9C247CAD5759B6697CB32C42 ”Bourdieu
961,950,141 *644EEB6604916EA2BA20B738EC37FB72D7E4EEE0 bourgeois kitten
961,950,142 *644F85EAC8810D48CB8117A677228354048922CC Bourseer9
961,950,143 *644C60514D0E55599992737FC0216B60EC4AD9E0 bourserai?
961,950,144 *6442167F72576324C92D74EAB335C809FDFEDC25 boushes1
961,950,145 *644D8409FAEE53D63492005AFFAEA010BEF2DA09 Boutdrum6
961,950,146 *644620FECC52CB0B674B0C9B0B613C58C8F6972A boutlaw7
961,950,147 *6444D3389567F009A400D1D1495D19D55F17FDCB Boutonnee3
961,950,148 *644E21FFDF9DEC1E42D359616B88AAB452078E24 Boutonnees4
961,950,149 *6441D317D83D03F40351F0B6BEED872C217AEA60 boutrosmakhlouf
961,950,150 *644385EC7C1A68601AA3E7340B1A195ED0B78D8A boutsbramantinoludov
961,950,151 *644691179AD4C6FD6E7F734A6DECA878B13DBB6E BOu=v
961,950,152 *644837E68C3DEA754798AD32EF51B291A75B4666 BouV3
961,950,153 *6445E5DBD21FB40CF4BC1FA4A3B48BFAE7916D0D BOuVE
961,950,154 *644A15B7C0646F5EC0001240D78122BF7741503C Bouvines.
961,950,155 *644DD4393DF20A9E217D2E784876F4ABC641FEE9 bouwerswanepoel
961,950,156 *644DA82777FB3005B3FB1F6E81FD815007238FE1 BoUXu
961,950,157 *64495FF2E66A1FB36C47E81DAB15AB156A759C15 B-/Ov
961,950,158 *6441B1F068A7E325A922069496CFB237CF61C732 B;O&v
961,950,159 *6448675FBD5AAC4E50091D363B7728BE719A1604 Bo.+V
961,950,160 *644DF0CA5C111009F7F25F80B7FEC1B5D6AF4C41 B:,ov
961,950,161 *644D54015DA51A967DF6AFE656F65C01BBC34ACA BoV2T
961,950,162 *6443383B2941EAEC65A595F490F2E85FD4DED2D9 BOV6b
961,950,163 *644CA2FED27951D018C242FAF4A8D92D099338B4 Bova%
961,950,164 *6446B44D9D1D0BED8370D122A8927CCCACCAB3C9 bovarri6
961,950,165 *644BDFF4CD37F89C5F6E81CD1C463897FF7DCB92 bovblge
961,950,166 *6444313512D7EA372CE1729E7D9C492689E5DFDA BOVENDEEL
961,950,167 *6445AA3C008E6F0CFB9F496A848EF07626A1D10A BOVENGEDREVEN!
961,950,168 *644D95ED6391A2698FD46443AC6BFAAC01E2BFBB BOVENKOCHT
961,950,169 *644F1CA61DF412FAB9E354824437A7B0E0F24996 bovenmatige8
961,950,170 *64448444D092A99BF3D507AED2DB860BF334212D Bovensten9
961,950,171 *64471AACB9C40B7980D3CA60F68027C03A6273E7 Bovenstes7
961,950,172 *6441683967D2EA3A3CD6DAE63B836E17DE1FE9D5 bovensts6
961,950,173 *644B539FB4FE8594F835406A970AB7073F73ED05 bovenvlakken7
961,950,174 *644DD507E734C2BF338708A1A944FC5F33536811 Bov!g
961,950,175 *644A6BED433C90D7A4AA8CE3937CD512DD4E2A50 BOvhf
961,950,176 *64424C57D4130A1A2844AB24EFAB658CE6FE339C Boviam
961,950,177 *6444FB107AB2261ED30F7B368613FB821CA9212D Bovline6
961,950,178 *6446A512E27D56E2BAA610B6064C06EDE010CCF2 BoVlK
961,950,179 *6441730E8427D935EFF94AD264336E472D4F4899 B/oVO
961,950,180 *644857DD293A0CBE7345CE8CC808DB9D76E69873 Bovovaccine8
961,950,181 *64427057A0421D4E40398891B98722982FF72809 BOvp3
961,950,182 *6440AF10934180CBF53211A66089BDB6E5786679 B?oVs
961,950,183 *644ACBA2FA5B8CB15910B5F93E5781978BA132CF BOvU+
961,950,184 *64465947B454CD19DB3332B4ECA49307C706AA3A BO:W&
961,950,185 *6445F44D7620CCCBC8A3C64B42EFC673CA1350B1 BoW1Y
961,950,186 *644FA7C6963696EC51CB4FB5404047984E33575B bo-wat-h
961,950,187 *644B3D797E927E57480CE12B287A25E849DF28A6 BowCast
961,950,188 *6447891DFE4C44727D12D7853CE63C45768C2BEE BowDe
961,950,189 *644A72228E95CA0DABCF3BC3023CF31586373EA6 Bowdichia3
961,950,190 *6448D6F5B387AE3F7E821703F08881CD4B921A5C [email protected]
961,950,191 *6444E310D303284F91EC06B2EA0C8C84345A8E14 bowdrie nelson
961,950,192 *64494970EFD9FEEB0313727E322BDAD7C8ABB99F Bowermannshof
961,950,193 *644B728A0F84E3B600BFD363B7C0FAF06268C071 BOWhU
961,950,194 *644E9243558EE5042819645CAD5C844EF87759CF Bowitsch5
961,950,195 *644360E5A0097BE9FBE608BE9B0FDE1FBBB6AE2F [email protected]
961,950,196 *6442815A8521C51AE3B82BA3D8986631F1F3AFE2 bowlingk6
961,950,197 *644B1E9095D36303CA5215B2C32F0087BDA5A2A3 BOWLINGROOSTER
961,950,198 *644C851E605A44D157A385F7CF8A300814F6D7A9 bowmanrcs
961,950,199 *644E921AFD4B1987480903FAB3FCB8FFE874D01C [email protected]
961,950,200 *644B2E126142E72E79120C8DC062821994F82D0B BoWoW
961,950,201 *644CBAAD4DF3BBB8CF1D2DD951CDC51DD98D5586 BOwX6
961,950,202 *6448C0F6B6E1D8E2BFA4A81BB5808404FF128796 B-oX=
961,950,203 *644CDFE07519D17EA3BEAC2090185E49D54A6856 Bo?X=
961,950,204 *6446FE6E78BF36EE3BB3D008EEA05389C8282521 [email protected]
961,950,205 *6441FD243E1103B22DEF6B4F2E9B0D12780CF97C BOX=6
961,950,206 *6440BC2263A5E26F93242622E99234D10BBDAE16 Boxaronis
961,950,207 *64400A47F6072B33C5E9ED699A49EFB4F2D01FEB BO_XC
961,950,208 *644908CE679AC25ABEA3DD1EE3D8CBE9275588E0 boxcar15
961,950,209 *6443054C1C027B56D94B263B47E19DCF4136E4AD [email protected]
961,950,210 *644B105BC03991FE91D2BF1D54E5A71FFEE7F4FE B
961,950,211 *6449164E882848F46F850F4AB20CF0D3E184BEF7 bOxFulS
961,950,212 *6449F023E839295E0B54E3C504C8FFEA6B39C7B6 boxHow
961,950,213 *644E6CA9D1355D41F563E0F9AC04D49897185138 boxibsw9
961,950,214 *644A68D3D14AF92E75554F735A6DCBF16E180D49 [email protected]
961,950,215 *6446779B8D307726C6FCC06E3E979E8BA3D71A54 Boxingin
961,950,216 *6443A8A4E22378CEA4EFD9BB167F1C60BEF7155F BOXINGRING
961,950,217 *644BB91835ADCCFF2224BD79BDBD0271B0955E9D Bo-Xl
961,950,218 *64407D50DB0E9C9EEB82135A38F37CF54E9C75CA box-nai1i
961,950,219 *644AF923E221C237147165863E29C57E7CFC847B boxpacked
961,950,220 *644768AD4CDB143268DB561209B3BBE58E559B09 boxrectemplateargent
961,950,221 *6447D948592EDC0C48D6DBC95CD3A39F9FE5112E B.oXS
961,950,222 *64443258D6E60E39F3466A09D20E9E9DDE3129EE boxsoft9
961,950,223 *644F780255904B5A554B8D304EDDBEF97344FEB9 B:OXX
961,950,224 *644B791016B156585DC39FC1009EC8418EECC5CF boy«
961,950,225 *6448BC04A153D98AEA5D6CA50EAC2532607C3689 boy007ok1
961,950,226 *644D244D2A314A29D91E917FE6D0F43AC14D716B BOY」では、テンポ220にした曲を収録したが、テンポを300にした曲を製作したエピソードがある。
961,950,227 *6447595533A57C95E3722B889DD0D730BA4D101B [email protected]
961,950,228 *644FAFEEA3CC2B7E8466F691BC24E667BA3E95CE BOY_3
961,950,229 *644C62837F59300EDBF5ACA8A7D083C550CEB49A [email protected]
961,950,230 *644B0F4B556C2727DDC4962D9C9629D0ED66EB96 boyarism1
961,950,231 *644DAE6FC1869E9A46559D9376C443D4A556672B boyauterai
961,950,232 *6446892B50441B150B029DB0BB1BFA83BB6B7F26 boy bro
961,950,233 *644F57FBF35C6A95062D8AC7E814F9CBF2BB1BDE [email protected]
961,950,234 *644C64A1E15A72188A8F2C7EB2242C5752F049A2 boyce.artiga
961,950,235 *6447681BFDFB7CF979115A50BB1433691AF68BB1 boyce.capasso
961,950,236 *644F2D9B1DE503170D6AADCE34043001D88975D4 boyce.chittum
961,950,237 *644A5625CAB46B0F25AF7EA001A050E72FC61031 boyce.eichner
961,950,238 *6440751230BED7FBC1B964EE9FB3BCE0F6D874E3 boyce.ferrill
961,950,239 *6449218B235B21C70E901182A54474D86F0D3BCB boyce.hano
961,950,240 *6443AB33550D0A6B76FFEE6A90FF1D48A9016364 boyce.hoth
961,950,241 *64410FAEA6186BEA9A2F137FF52F53C9DB95ABCD boyce.janosik
961,950,242 *644001B618B49045FB47A6FF9C87E56D8DCFD88F boyce.katzenberg
961,950,243 *644537B8048737789DDF5996BFDA7FC6D6DF810F boyce.mihaly
961,950,244 *6448FCA9D1199EFC34350379878D1D2DFCB28569 boyce.milhoan
961,950,245 *6445F45DA7D89E1E5C028B61DC9F1C7679763A7D boyce.nickel
961,950,246 *644B0A568D248F7A75E0F5DC5D8AA77F4292DDEB boyce.odonal
961,950,247 *6441056536AEF1E83A7FFD6B2B01E385F65CE4DD boyce.orszulak
961,950,248 *6440E84AA53D118EF994BC486A4595F6D21CC690 boyce.pekar
961,950,249 *644F7AE2A74917F0DC3F85412D1D6ED41B730E6C boyce.pelligrini
961,950,250 *64458F872CAB8EB647ED10A011C53749DA07E826 boyce.rinn
961,950,251 *6443A9BA0FA3829D45D343FCC43C8BBBC6B5B5E8 boyce.schroder
961,950,252 *644941120E22CAC98D6715ECBD0D0443E8DC90CB boyce.simank
961,950,253 *644AF8D91C1F922B2BF9B66F8F59EE0428DEE22D boyce.warshauer
961,950,254 *644791624AC94604E0CEF86E1A60FDE311589E88 boyce.wingerson
961,950,255 *6447BA69453EED3A109D6F05C8CCE4D148D607C8 boycey44
961,950,256 *644C5D163C2F4E9D37285A2DB6E3AED8FA04EE5D boyd.adkison
961,950,257 *64473238B6CF70A54A7CD56840C02CC7740F6F20 boyd.bagnell
961,950,258 *644AE7456F09B2D1362B4B61E219A3CB9FE4FFB1 boyd.bason
961,950,259 *6447067296ABD0DA204C06196BB266CE0121E932 boyd.broda
961,950,260 *644556A7EE9141B4BDFEC4E8363E4F90C4014B8E boyd.heiskell
961,950,261 *644EEF8B42506C708ACD24E1F402F33E9B2D9A8A boyd.heroth
961,950,262 *64461E184ABA6B6A6C577005DB7EBFCB1340639D boyd.hubertus
961,950,263 *644AD2179FD5DEA76110E925A47D33664F8ADF54 boyd.kuca
961,950,264 *644ACD9B7585C4121994131678DC4790A821820E boyd.kuhlmey
961,950,265 *6448DF528FA6955D021B01241EF65B29C149B5C1 boyd.lamery
961,950,266 *644BF1406CCC85D6B12D4551846E039A005578D5 boyd.lenhardt
961,950,267 *6441FE39D6E1669E696E06DA191C3A36D86D5D1C boyd.lett
961,950,268 *6447A9EA5C679AB12887F92EE177110E5219642E boyd.masaki
961,950,269 *6442BE63ED05BD4617BC8302B1879956FC298A8C boyd rice & coil
961,950,270 *644E28302C6146E78A49B8562B5668778A7E0D67 boyd.suazo
961,950,271 *6442FE3D8AEA1EA355769C33FD435EDA16E389F8 [email protected]
961,950,272 *6446B2FB3693E5483AF9B2D8A58A1F75C90BD394 boyd.vieths
961,950,273 *6448550969D109D01A2E4E9161EDA265E6F91BE4 boyd.wolters
961,950,274 *644D9FA534E609E5BBF6F4FF39D216057C714F35 [email protected]
961,950,275 *644D6FB6624D885A63AC1188AD1D9C6F8C2E3514 Boyerizas3
961,950,276 *644C48256E3CE54539A32C7D90268ECD3C7A6C02 boyertown’s
961,950,277 *644F97E4434565982B237414AC537602B9C386F3 BoYFS
961,950,278 *644C552A7E45014165584A0928C2DE384DD1F4FC [email protected]
961,950,279 *64407E64D5D0F2BFD96F875B39383A9AC74053F8 [email protected]
961,950,280 *644E1DE94A6669E6556E7171F82C74954D3B74AE [email protected]
961,950,281 *6440027687DEAAA9E63DFABE7503E9CC01BE921B boylston2k
961,950,282 *644CF29FCC394636FD687BB9464EEAE047787169 BoYM1
961,950,283 *644B0F418D8B2AB7F90D183D0D9C03D2D452D418 boyneedlove
961,950,284 *644A26C7545F31380EA3EFC4CC315F83509EBAF0 Boynkbsw
961,950,285 *644C2D5A9DA66DC30B7A9B497BE16A27E9857AF5 boyoscar
961,950,286 *644D4A779ADA5AB8C37B16245FCD46026E66AC2B boyswalkin
961,950,287 *644AC9E0E49BB0A6272059C6FE4C924EB40ECE51 BOYt&
961,950,288 *64472AAFD314445AFDD757073A004D780AAE01D0 [email protected]
961,950,289 *644468FFB6A468D8058AFCC95AF45E12BD93630E Boyunca4
961,950,290 *6447657FE0B0880DB38D940BCE641279F241285A Boyzdykan
961,950,291 *6447B9FD7C5DE9E6D5AAB08377F42ADEDA1FF728 BoYZH
961,950,292 *64485CFF20F9B62A8341D234D35BDCB9A4DEF10A BO-Z+
961,950,293 *64474CA963D9A266F879E75B11700657D82181FB BOZ$;
961,950,294 *644A07F954E812B969A93E35470026602FD99521 B$o.Z
961,950,295 *6441EBCC792436728EBF9A3EB31305B07562EE49 Bozadmin4
961,950,296 *6441D60810B499E41CD3C9C73F82AAF944B0EFB5 Bozalos
961,950,297 *6443B3C621B89486C9511972D90D172E8F5F243C Bozanna3
961,950,298 *644A8F7F603CF712374C7C0AEF32913F395F531B Bozoadgging
961,950,299 *644AC308B8C78CEAF86FBA373C746F0EC11E7096 bozobfi7
961,950,300 *644EDF7FF44F2A4D9C938EEAA6A6C66CF60F033B Bozoboris5
961,950,301 *6443628EA90E53F4718D65358BD28B9CC075B19B bozofgh0
961,950,302 *64442ABF5BE4AF282F6DC72CC50F02F57A29230F Bozorocky3
961,950,303 *6443C72D321054759E5CE0580FBA525E950FD8FD Bozótkenguruk
961,950,304 *644771040BD26E32E92D6578C998A09E615D2BC7 BoZsl
961,950,305 *6443D176022E7F33362B3D3B505ABDAD1E6793D1 Bozzola8
961,950,306 *644A54BC99A96A1943E217E74033DBA97F3E31BE Bozztowning
961,950,307 *644EDC28C7215D795EE840DA93CA9CAC0F435764 B_%+P
961,950,308 *6447F15F50370D05261717066C67C318397BCA45 B_P#+
961,950,309 *644B2BBA8A9B67F82E8FC9D22B547945ACBD0524 B-P_-
961,950,310 *6441A21532380286D185BAAFB5D7EB3B9D52355C B,P-)
961,950,311 *64408771918F914A7BF36CF65CD53B77AA6150B2 B;$+P
961,950,312 *6447A3C4074FEDB3F24D70DD16480F4076FC903A B!)_P
961,950,313 *6441486BC90B5AA37A6B1AF074B9BB64DF6E3686 B!+&P
961,950,314 *6449B065B03A186F3F9DD50A958F9C4674808C9D B"-?P
961,950,315 *644B5463C541454FC627962227C128E106B99540 B$P!=
961,950,316 *6440243BE7C346F91878DDE26EA397B5EF9E812F B#&_P
961,950,317 *6445F18983C9C9E578D80BE228A77DAF5FC2CF40 BP:%:
961,950,318 *64411D18549DCBBEF69390F4C4FD0A390EC14E13 BP+,)
961,950,319 *644F59FA32BFA30292651B81CBD9F08618067410 B,!=p
961,950,320 *644ADA4D841AC3D15AF46574FA6DEB9D44A62DE5 B:/%p
961,950,321 *644B6E4253FBBF56CFF056C07E49BAC2BFB6F7E4 B.+p?
961,950,322 *64414F3F2723172159CFC08498C55F35F5B142E5 B(;p
961,950,323 *6447732FE154BAEAC7B8091311B3260088777BBE B]*p
961,950,324 *644C5E17DE22AA55C4838207E2A85C8A0A09D650 B"p0&
961,950,325 *64431FA1F83E4D98898F40F6766A4911CD457CF7 Bp0Ev
961,950,326 *644956A281E345733843CBD807C86E1645971239 Bp0f6
961,950,327 *6446E2F3737512E0F17D986649DF0B535A19E57F BP0mn
961,950,328 *64457AFBD34781BB3086E6EE8DF775173A8720AF B_p0s
961,950,329 *644A5675FB0A0ABD9195FE583A0C23DF1B3974FD B,P!1
961,950,330 *6445B34A6A4202C62791B195057F3E969EFA2CDB B;p:1
961,950,331 *644044E20FC40504CE31815A111EE452C0A464DE B.;p1
961,950,332 *644F3BB1332AE0BED37599B244629FD912F822C4 Bp18K
961,950,333 *644391A3AF03227AE54E11E1CA5C72F4FE5CCADC Bp1AY
961,950,334 *644DF1F5E3A38DBFDBE1A7E0E1BE50A3F5917C94 BP1;d
961,950,335 *644A2D897AA973915A9A5222C738B0E46E798271 Bp1EF
961,950,336 *644546B13A271AF699A93F51AB244A69939254A9 Bp:1i
961,950,337 *644B4AA65CE9544818AC5E925EA38170E1436540 BP?1k
961,950,338 *644502A38EC05578A2632B7A5179B12DD7D713D6 Bp1l
961,950,339 *644DAE3A22F941AB84F9D53615A46821C7459444 Bp"-2
961,950,340 *644D1FB74F6429BC70AB9FA6A731E1A4B7FC18AE Bp2&0
961,950,341 *644A3BE064C3E3038A9141FD17BFD8229DD8B819 BP2GE
961,950,342 *644B5FA37AFFBA60A7254E03687291DC9AC36158 Bp2Hc
961,950,343 *644C7AB527A12F1CD5FA238333C95C610FFE4E54 Bp2%O
961,950,344 *64454524CAB96A09B76D2B1DF33EF0084DA21E90 Bp2_P
961,950,345 *644AD98E8CFC4110282C1AA49EB4E492A8C7C59C BP2UU
961,950,346 *644F8ED77984984425C1083B977AC3E328FB9DAE BP2XL
961,950,347 *644F20A452A96BFF2405B7033F14C04F01262312 Bp#38
961,950,348 *6445D56C1EEC96A7990C8B76F74EEA9E3BC5C4C9 Bp3p6
961,950,349 *64481B6A849F7830C95C222F06788495302162D1 Bp3sV
961,950,350 *644C99AD13EA0672E4BD803993DC79445496B885 Bp3,v
961,950,351 *6442ADF4EBC747A0EBE7A537D4FA90A6FD64FD4E BP4gv
961,950,352 *644A30C55041EC83EDFCA69D86327A23097C2AD2 B=p4h
961,950,353 *64408AD6734B412982BE26BC401B53CE05A35E3D B-p4N
961,950,354 *644A8FDECE991DDD3EB16F863CEB4A3A03B69FF7 B?p4R
961,950,355 *644BDD326EF0B17382B3A4770010B4D303EE6B6A Bp4rl
961,950,356 *644B80D66FA784B5415852A577472ADBB05DFF6D BP4,S
961,950,357 *6446AA0D580C5D575D65829BA077798240A812C7 Bp590
961,950,358 *6447586165002B8B0BBC9AFAC037F0363F42F652 Bp5ek
961,950,359 *644DEC2628E095656DE28247E4121B8CD9B43C7A B;p5L
961,950,360 *64445B9E640F7DE85C5D68D992D33C35D71957FC BP5XU
961,950,361 *644605517E982E68AF3EB6F6072BE67B66353462 B-;P6
961,950,362 *644C60F87241B6AFC5C35677833F525B1C955004 B;P=6
961,950,363 *6449C895C29565924C9E1AF78716173F83C67E82 Bp=6K
961,950,364 *644D180F01195BB939006D1F4782AF1836E16C3F Bp6Ku
961,950,365 *644E707FA86C54F60CCF91383FC41742C009A7DA B,P
961,950,366 *64452A6DE4C9C0A7B8AAD78679795E5B08400DE8 BP7!I
961,950,367 *64499414035B9A24DBE7CC748241C1653CF70BCE BP7kM
961,950,368 *64401971A58A2BD9CF9598DC0238D371D3132709 Bp7OO
961,950,369 *644947CED7D7FDD89F03EB0C4472CA441F610846 Bp7Y;
961,950,370 *6442F2680562707EE307ACFD9AECC1414EBDED1B B!;p8
961,950,371 *644538F4576B58ED2894B70DBC714547B26BB2AC B!P8G
961,950,372 *644D3F149F28EC17540CFCEF447F3FEB24078E00 BP.8q
961,950,373 *64456970B5957368D06B21900EA5F601DD44B97D Bp8v.
961,950,374 *6445C96D5E8E49C43FB807EA4F0B4199D4224A57 B!=p9
961,950,375 *644641904A5DDDCFC36F1C62CCA79E047818429C Bp?=9
961,950,376 *644107C7A9ED518113B30ECEF25302CDB49718D2 Bp918
961,950,377 *64420E2C00276EA591FF555FA5BCED6C29DD8C77 BP)9E
961,950,378 *644BBB94E8D9024DC8B12AF840F39F95ECAE7FD1 Bp9_p
961,950,379 *6449F64825D44B5D6DF6BE0650A5E24626C522F6 BP9Qp
961,950,380 *6448B664495437BB0F5CC13AC8F21BEE1684EA80 B)+Pa
961,950,381 *644C4CBB307A81AAF598C05187D5A05C6070C33D BpaFd
961,950,382 *644341FD58837656E557CC7A419E3B6D2A6311A0 BpagM
961,950,383 *644E32E9AA07F5771C9BA8CCDEF558499EF90AB4 b.panic
961,950,384 *644D5B6D492FDDBC8074227586C08B619EDA5B50 BpaO.
961,950,385 *6441D812111B7ECFDCF5D57D1510B45DA4E9110C BpAQX
961,950,386 *6440FB0B1B873A55E5C117F443CC4ED27FB69D9C BPau;
961,950,387 *6442C50163584C2760588156FC868F14F3D67B6E Bp!Av
961,950,388 *644CBD4FDBBD19CF8E6FF35A46ED116BA7FF6015 BP"B
961,950,389 *644EC6189A39C2295ED29BE443D90DD84D19AA51 B#=pb
961,950,390 *6447BC0F7A3695476C055E23936EFDD22E40D232 Bp+b8
961,950,391 *64497661D189C76027DB7A75CA70712CC15A0774 Bpb(b
961,950,392 *6440E8F485BAADD8B56EA747606862D9531EBBB3 BpBIh
961,950,393 *644E3DC3B99B979DB3293B970AC556ECF7B98808 BPbpP
961,950,394 *6443CCA19E33FB9C1799AD0A9A0D1A731070A017 B#PBT
961,950,395 *644694720BB8270D3429DBF014F4FFD7A71F2E7B BpBTH
961,950,396 *6444C31B98209CE3F72105B940588945AD3D93B1 BpbUl
961,950,397 *64446C085C10442A2A6E915AC2CBF9E901C2AD95 BPbW&
961,950,398 *644ECEC38CCFC8CD374C2FEFD9759CFFA9FB226E [email protected]
961,950,399 *6449E5C8EBB8D8218049CEB2B9AF7388B82F60F1 B,_Pc
961,950,400 *64445F5EFA024A2FACB69C189C27C1BF21C7A39A Bp
961,950,401 *644CA831ACCED5D8D482D7B14954AC89E298C2A6 BPC2n
961,950,402 *6445C890478EC2F33F2BEC146933A4ABD77CDA38 BP!Ce
961,950,403 *6443CDF33AD874C0A394A011072BA0D13885624C BPClU
961,950,404 *6448FB028907267B2EB0C20A00B572A2CDD6B511 BP"CP
961,950,405 *644374D2701518DAE83D0C93B4D9CCB1855F5B8F BPC"R
961,950,406 *6442BB9E98215BCC726C6E9F5006E448710EBE03 BP&d/
961,950,407 *644548983E49CE3C2A9E2C5585A61C8DBC710578 Bp!/d
961,950,408 *6441A8BDC52B6482843C049E65A6524511D7D402 Bp/-d
961,950,409 *6444EC3180D53F2B92EDF7D450BA6B82E7F6FFD7 BpD37
961,950,410 *64499EBBC2E3C1E46E141A145E8C85B2135CF1D5 BPDD=
961,950,411 *644672239F9D770F3B8CA862EFA200B716FCC9C6 BPDFj
961,950,412 *6447F5C04C297E359B822ACEFADD39CB580492D6 BPdh#
961,950,413 *644D6C2AB53813BB9BCDF838BBCB7DEA82D10B61 BPD,i
961,950,414 *6444A469982997ADDDC84D873A240921E85030B6 BPdQ"
961,950,415 *644FE0EED4827B8336943009B990307702FAD082 BP.e)
961,950,416 *644EC5FBE2A9D31B8F2ADD1F4FCCCC2429519D4E Bp:!E
961,950,417 *64426B3713C76D3EA6EE07790D420D4AB0A58A95 Bp):e
961,950,418 *6445A67131C069154E1B36298ED58D1DFEA15D5E BPED(
961,950,419 *6445BC639A5BEAFDD43EFFC8465A2045068DDB04 BPEE:
961,950,420 *644E86D3D221E7FE06C3D9B70CEECEB9349D6F47 BPE+e
961,950,421 *644B780E4971E6A65758F0DE895FB8D019B32D0F [email protected]
961,950,422 *64402A980B871F0B6AA53F4B80E97191C551DA28 [email protected]
961,950,423 *644E67AE98076BCB94F3C7DC919C3EDB1C4F6396 BpeR&
961,950,424 *644BECD1C6E4F6A49D57314B02CCF008F75754AC bperegoy7
961,950,425 *644B186EAF57DE7DB9659A8DEA557419CA0FE218 BpeS=
961,950,426 *644D9EC169B0ACC576D59653EA7A83AA1ED3E63B BPet_
961,950,427 *6449C5A5669CEB85CBC4D0938B7AAF6623E87D67 BPE?v
961,950,428 *644EDC3F0392806D42853101703E7E8EA941E7B8 B&PF:
961,950,429 *644A811154346368F740906B416A4D811D3F68CE BP;=F
961,950,430 *6445FAB6552DE9173E9F81DCE8BEB2E0E2E3F876 Bp#F(
961,950,431 *64427BE7A7494431FD1A766FEAD070B832612899 Bpf6(
961,950,432 *644D70CB049129B00170F7168204204EAE4D7075 BpFau
961,950,433 *64463A41846F059D34694832B2722B11D35013C6 BPfcX
961,950,434 *644992EBD8768EF1101C4156743F19E7AA61ED66 BPf_h
961,950,435 *644F6C468A30B968E51999CD458034B4E8EFD4C3 BPFI)
961,950,436 *644F379D7E760638D69166FD0F098E1F85B62BF4 BpFk/
961,950,437 *64432B127F838D8F8C2DC1586F7F28081B61BCFF BpFkb
961,950,438 *6443E540D678E4B8CA6C91B202EB0AB0D96E5DC0 BPfRM
961,950,439 *644F193A5CE4FF8114449AD25CCBCF6BFD396A54 BpFtm
961,950,440 *644B03AF765D32592FE7279101CCB3F35AAC9315 BpfW-
961,950,441 *6444610995EBF1797277D0DE3A761119514C5086 B_;pg
961,950,442 *644573D190E88BFA3F314960F19DB6AF4E330B2E B$pGb
961,950,443 *6443CA27D4A6DC0C9C871F5DC2999FA900DA9133 BPgcI
961,950,444 *6448A1789A4F865A7567EBE022ADD8E9A2A47EC3 BpGhY
961,950,445 *644FAA86B1694CD2C831A625BE66805DFCDCAF42 BPg)K
961,950,446 *644CCA151660FAAC5F5B19E53AB71C65BF08CFB6 B
961,950,447 *64403DBE05B24B9BB8787634796EF45E23AE4B13 B+PGV
961,950,448 *644F91343B81C22B593459AE6113304D6786A520 bpgw
961,950,449 *6449ED106AB98B4B477690C1553996C414BB9202 BpgYG
961,950,450 *6443C5409A913D20299ACDA6244D7433521E1794 BPh.,
961,950,451 *644BE85C5E64C893475785062F992E378F61DB2E B:p/H
961,950,452 *644949C9D228C034D7816487B1BA85701E6C90DA BpH;
961,950,453 *644885402E34B53FC623593D845B31C956C9E1D5 Bph:;
961,950,454 *64431B31C2A5B61E85813CCBA68492050F769466 B?pH4
961,950,455 *644B1FCA26DCF0AC67BC66E800DDDF5130060A73 Bph%a
961,950,456 *644E3EA406357D651D6C18F7307CE2BAAD2A1E62 BphBs
961,950,457 *64409A3715ED8BFA63651906CE38BB8B426BF4A1 B
961,950,458 *644EB60EFC2C2AC20FC549C88E71B7C223C85901 BPhkm
961,950,459 *6448BCC1BD5C6E3314149DDDDAE752F311D767C5 BPH=n
961,950,460 *644A96E7C7EB14BA3A7DFD86DA6D4283ED7EDC6F Bphsc
961,950,461 *64477CDFBBB6C9158121C487B69A1B51CCAD8EA4 BPHWu
961,950,462 *64497E836AE5AC7B7FA52233D0C97FF304EFEC46 B(p-I
961,950,463 *64429384AF84839EA0C6919B742E345D2755FF83 B%pI$
961,950,464 *6448FBAC802D595AA3E53144CB1DB1C54AC653CF Bp"-i
961,950,465 *644CED835EC42AF35CFAEA1CC1C62824698C4CCC BpI"2
961,950,466 *6441FAC61EDC863E7319FC56712324D32B0B0B19 [email protected]
961,950,467 *6445FF665D008AFC96577A2E10B7BF87C230D114 BPi&O
961,950,468 *644A37E5F7FE89E523FA604A403560DC87D6522F BpIW;
961,950,469 *6447083C2BE44D4FAE1D28309A924A8F2ECCF723 B&pIX
961,950,470 *6443BF74E2DED1704E57F6D27609D798E034CD1C BP:"j
961,950,471 *644BFA9EDD96C036D8ED6CD575D4E907CCA44C7E Bpj65
961,950,472 *6442BB19983C69886B64A03E3858B81ED946D908 BP)ja
961,950,473 *644E6B243FEB40838C52FB975DAECA66408F5CC9 BPjDo
961,950,474 *644032AE3BBB8DEE8F76654F91C09030F40A5865 B&pjf
961,950,475 *644B7B183001293D0BE4693DA1433AB6366766D8 BPjhf
961,950,476 *644B3DABC3CA1680EF988777FCE52BB37C70F315 B?pjM
961,950,477 *64408A6D516458520512602B4D4237147A02F6E8 Bpj
961,950,478 *6446CA493A5AA22F83F2C960647D1B3FEA771C40 B-pK
961,950,479 *6442E5B9A6B8A35FF2E6E34C987ED3C3CBD4D0F4 B;pK.
961,950,480 *644878D8867399CCEE3E9D3C3E361F04615CBCE1 bpKbnH3BkOA
961,950,481 *644538672905B94D7D03EDF23CB9997EDDC648FF BpkCr
961,950,482 *6441BBC5E89D31B5769EBCA08FCFF702BC89DAF2 Bpkde
961,950,483 *6449BDFFD05FDBD651FFBB87BDD39C5E1B95DB4A BP)Ke
961,950,484 *644DFA85C958D0E71367713E27102177A031E5EA Bpke;
961,950,485 *6442AF54A106BE608318C212C3A776E19EE12DE6 BpKES
961,950,486 *644A9923051AB8921228172523D8ABABF04A4B28 B$PkF
961,950,487 *644108E4FF523BFE05840DE98D1F14FA0F6FC6CA Bp/KG
961,950,488 *644C8177FECF367AAEECAF6F39DA08AB1C00A072 B&pkH
961,950,489 *644383EF7BA00C9C30BFA0A72D0CB337539694A0 Bpkh9
961,950,490 *6445E3BD1B418AAA619A375C72C76504336DA562 Bpki(
961,950,491 *6441395A97C380647A65F732FC7542910F762401 Bp"kj
961,950,492 *644235B96848D851B53FB5F5617B12D3083A62C2 BPKoo
961,950,493 *6443F5714439F72E1B5D3DE457E27E46A4B9D486 [email protected]
961,950,494 *6446D75A90A1EBE118E7CE246F84E6C020531464 B/PL$
961,950,495 *6442C21C10D1CDBF07699D35F5677E0A62DB315C BP-/L
961,950,496 *644F81ACB76BCEDF3E9EEA387833C3CEB32AD906 B"Pl"
961,950,497 *644FC015464D1CAE0616757EA12F79C691030BF0 B
961,950,498 *64474F905EB0DCCE43534F19B3B3266F6D2681D3 BP_L1
961,950,499 *6441AECD066A4B1DF3A643752B6B0519617ED319 B+Pl3
961,950,500 *644E9D28F1EB233E20AAA0D39123B1C089447792 BP;L5
961,950,501 *64412D98FD213F603B25AEB46A8EED8449C1A501 Bp#Lc
961,950,502 *644F02F762830DA8214EAE8A7E7D2D13A2AFEAF4 BPlcC
961,950,503 *644458A3F7C12995E305CD874F8F782C5EB39EF8 BPLe#
961,950,504 *6441CC728201BB1A9737DEF284FECBC1FE7A884F Bplkj
961,950,505 *644E5F010D3B36FE622B9A91058E0C23134D4871 B$PlP
961,950,506 *6447A76FF350D5FEC1A80F9EBFE58B1C6697E272 BpLp)
961,950,507 *644CD50F7CA1FC5A4EE13061C35C5958E6FB335C BP-Lq
961,950,508 *644BE1377C82231867B9205EFC42654731C94587 BplSM
961,950,509 *64430EF5C3C1590A9618764121F4B41DBE301D03 BP
961,950,510 *644DC55CCC0ADC399955BAF22BD2491C454CBB96 Bp"
961,950,511 *644FA23B72916635F94EE948F50A17DBBC0D848A BPM02
961,950,512 *644B6F0F6822BC6970C947B80C847DA0F1F6E064 B"pm4
961,950,513 *644E1FD244AF374E1FEEDD75F870F4E4324B764C Bpmk2
961,950,514 *6449320533BFB8AE307DF29CA2017056D9B0E25B BPmR(
961,950,515 *644509FE41EF6AB32F50025888B594C9B99FC4E8 BPMRO
961,950,516 *644A2372FC62D3246E0FDC85CF1319AC0092EBE7 Bpm
961,950,517 *6444659318582EC02923664E93AFDF372A0BCEC4 BpMv"
961,950,518 *644762F7A0145DC703BAA2FF60D51F58F9D92D81 BPmVI
961,950,519 *644E0DE83B41E6D1A1E7E2807E07FAA86D9B07D4 BpmX8
961,950,520 *64481D326BC2A14F61E5D01E9B9F0EC6F5B9CC99 BPmYX
961,950,521 *6444D540D86707153E5F4253FA52F1142572DBD3 B-P-n
961,950,522 *644DE421956065337B93CBA2A1DD7ECFBF53485B Bp?n7
961,950,523 *64465BCF09EF275CBF6D7A028E176883B46B3F9D Bpn8h
961,950,524 *644B950C4DCFD19186640047EC460001B3CDEE8C BP&Nb
961,950,525 *644C4AC3A5575A2E30BD8103FE604129A4516B4B BpN-h
961,950,526 *644ABB171588144B35577CDE7EAAF26F06294F5D BpNh"
961,950,527 *6447DC341A59357A1BA4FC1E2A9ADDD2EB2DB8AD bpnnfrm0
961,950,528 *6447E0E197FAF8867F1691CCB53E8F4F21958BAA BpNPW
961,950,529 *644F23C0AB22285ADC1412C26BA4F3FC2717CD6C B"Pnq
961,950,530 *644108450D089A9A4E1B45BE5EBAD0DC75249C66 B?Po!
961,950,531 *6441F458C58CDFC75C6F21B4B144D754C4F14D8A BPO1e
961,950,532 *64447CF743134CFBBD1D0F8ECE5B59F7E83D027C B-Po6
961,950,533 *644980F8AB0CF4D91331D51C3C6723419E78EE67 Bp%OF
961,950,534 *644CAECAF6E17854734680BC8750D5F54A130CB7 BpO$f
961,950,535 *64468BCED4E2153025ECBF886410DD4FA610F84C BPO+k
961,950,536 *644F1165869E2A2B4067F5842B27CA66FFF95E87 BPo;P
961,950,537 *6449B776492D7B460D3B352460799D682A9AB888 B_pOQ
961,950,538 *644237D2A058BA3042CB295062A8489361F1C29E Bp-oT
961,950,539 *6445B68CE74021A2E6CF3A4CD0E3343E07364DB3 Bpo,u
961,950,540 *644390759B134B7D86FB7933F4D4728B7E1BBDDE BpOVL
961,950,541 *6447F10B5156A28454FFBFEAB1F6A697156FEF5F B:P!P
961,950,542 *6443A471952F7931D2402D07A783D92212D17457 BP/P_
961,950,543 *644CAF8070BF90B96FEAE8F4B0B606DB4A9C4FBF BPP3V
961,950,544 *644C96EF399D3BF8624EA52DAFA135F413164E50 BpPds
961,950,545 *6443128940953E382A3CE483A7021AF6ED3ACC9B B-ppf
961,950,546 *6447D5F6605FC774939A816309E492198D7AC473 BpPgt
961,950,547 *644744694CDA7F0031DD2C3E83F6311B4F89BFE0 BP)PH
961,950,548 *644DC4F9D010A253E45118F988F645D83C965E24 BP:pL
961,950,549 *644A3CCA7D191EEE332042FAF3CCD177686CC620 BPPPN
961,950,550 *644A61A8D66DA751D99FC514E2562885D0823678 BpppQ
961,950,551 *6448549086783F11E20CBCC172A82304E0BFC39F B$pPR
961,950,552 *644DE1070820D7FC414C4194BC71F4E9DBA807C3 BPpsC
961,950,553 *644F523D076C10BFB98D29BD6BD6D2A13D972BFF BPp(t
961,950,554 *6443C44B2EBDDD8AC29AAD921B31171FC1045330 B%Pq!
961,950,555 *64489013C47D95215EE286A034E387CB56253C81 BPq#6
961,950,556 *6446B2F09065C25D75373A18F34FC700C91A0106 BPq8c
961,950,557 *64413026FD6C42D59C02158A592FEC548616EAF7 Bp-qe
961,950,558 *64478369F245C7FEEDE5517C503345E8C36E7D23 BPqe5
961,950,559 *644E40807DE745DA52875E1A23A663866CC09E49 BPqk4
961,950,560 *644572E62CA2D1A0698009AC0D45FB4750C361CA Bp&qn
961,950,561 *644DA03BF20C1D79EBEA8DB985E699321E5BA93A BPqqf
961,950,562 *644AFC3F30F1BCAB2D0495ED505D6D086087EFAA BpQwM
961,950,563 *6449A3BE7625834B7A21892718B9FBAD073AD104 [email protected]
961,950,564 *644DC6077747644FDD9F0F909D5AA9A9F2A117A3 BPRATT22
961,950,565 *6449F9B54798F5B38381FD6E8F17AA0D4DDB079D [email protected]
961,950,566 *64415591451A6F21C4B02B781D0D424AB027A471 BPRECIS
961,950,567 *64447D6DBB2A642B3030B5FFC54337581C7AB171 [email protected]@l
961,950,568 *64462814C0C9C556E1550F14A5EEFF50FAA1F0C3 bpressa.irk.ru
961,950,569 *644477FFD1B6D01B0C50CCBB08F88BB9576B64C7 BPrG"
961,950,570 *6446B6C1498CBD7BB6A358792FF6D288189AD4C7 BpRiI
961,950,571 *644C5B91041822004D5D3645EC452B4180BA0446 bprisonlaw
961,950,572 *64401551DBA40B8CBAFE3DF3DB307665012FF6F4 [email protected]
961,950,573 *64485B98054484CF9973DB21BF667C1CECB64369 Bp.RO
961,950,574 *64435AB07F1B61C9B54826F2DCFE4F8DDB3AF179 BP/S=
961,950,575 *644D01B2CC36172D905AE63B808DB76E2ED97616 Bps6G
961,950,576 *6440205F017B40F2617B3CFCDEA48C9EC49A36F4 BpS9C
961,950,577 *644140432EBA1BC9D85033E812AA505B78A33F33 B
961,950,578 *644AA562934325B87D0F8B75FB71D872E4B016CB BpSgW
961,950,579 *6448F74932300DE40B6DBBB3023F02B97B1E47C7 BpSq
961,950,580 *644229F9E4B1CA62C016B35BE412195DAF8663EB BpSr(
961,950,581 *6445551962E6A7FE345FC1CAC1558827E1DA8A00 Bpsssspb0
961,950,582 *6443081E96A1EC537054C6DBD2CC609C2BDAB340 B/pst
961,950,583 *644DAAC8D326E57ED86DD2B15E0D47F49F759901 B=P
961,950,584 *644A669E95B7BE07B05627B23CFF35A7426D12E4 BPT./
961,950,585 *64421986C9B9A68ED67E4796513D17617A2CB019 B)pt"
961,950,586 *644637C215C468B2A10A166A4D69DF2A5CB26DBE Bpt4w
961,950,587 *644F901E546BFFB9A9049262FF91BF38649DE138 bpt6k205345z
961,950,588 *6440CBB1F009DC4676AC87D2E1730A9743C794AD bpt6k36597m
961,950,589 *6440742133AE7E7223816E6A228C5A9E01786CB1 bpt6k4022z
961,950,590 *6441B65E1BADD49B14B87B1B9D36062C6FB16EDA bpt6k548574
961,950,591 *64419AD5E016D8042DACAD7B029EACD74419123A Bp;TC
961,950,592 *644B5731D75CE922736B60D2002E34583D253A81 Bptg=
961,950,593 *64473F0BD102E557D49AE74D19623ECFF2D0F3A2 BP&Th
961,950,594 *6442D51A7D07452FF2A29B520EF2539AE9767B0C BPtp;
961,950,595 *644F6DC145E533223B59D84C0A5A5C0E809C7268 BptS)
961,950,596 *644FFA24FCB42BD9C5B67415DCAAF2AF4BA9A6C8 B(PU)
961,950,597 *644A36CB53E9073F01231C06D67440FCC911CEC9 Bp
961,950,598 *644E9D1C0A83CE96210F34EE24E0EEA11E91108B BPUa2
961,950,599 *6448D7121B859C0B592FD3D417FD3E8AF4D6839F BpuF7
961,950,600 *644FE990CC5B174DE19043EEE4ED9409466B11DC BPuHl
961,950,601 *644D1718CE8B5AB17E5E28E9D8035912542E5CEE BPU=I
961,950,602 *64497D939C9C1EBC7B0232385B236E808A1A61F4 B&PUM
961,950,603 *644AFCDC96EE457668060CF71A4908B70AA3D551 BPU=N
961,950,604 *644D1C0ABB0FE2FC31F861DF16BC060574C3A0C7 BPuv
961,950,605 *644EEEFCE51ACC57BCA0058F818D040F74AA4E13 B:Pv+
961,950,606 *6449B4267DDE6E8FE5824BADC31D9D4AF8537FBA BpV
961,950,607 *6446FD71F586BD199FCD828D89165371D866689B Bp:v+
961,950,608 *64441848C384224544C5A946F66590E429F3F1E1 BPV&0
961,950,609 *6448EFE849E3FC9CA276BA53E5B04D4E9C1F52C6 B+pv6
961,950,610 *644D286051E9AEC10A997D3911AD825E8629B99A BPVa-
961,950,611 *64454A160A9C30BBDF1A21FCA1A756A8AA745E32 BpV)j
961,950,612 *644EA1406354F903157446B5E6DAEC7A387E9BA8 BPv&U
961,950,613 *64492C7B185BF54FC3F3D25C255350E9819C65FA BpV:v
961,950,614 *6449100868FD110DB7F5978C5BC444CF173AAE43 B
961,950,615 *644E846C71DC66EEBD458DDB16734D6D55FEF5A9 bpw065
961,950,616 *644A567DEE2B3E9B3F43B78FFDE9E9041A744678 Bpw7!
961,950,617 *644663648396E74ACA716C61EDFA18AD0C545C0F Bpwb6
961,950,618 *644537FDB9AA07515966041FD55B7FE84A9296F1 BPW.d
961,950,619 *64402B04D065B193956F6ACB0BE07335C3BAA428 Bpw,E
961,950,620 *64493C2DB46E940F3592691C5F947ED9FCC89E9D BPwFf
961,950,621 *6441C135F9EFA7C6F354F2202FCE6B71DCE9DB9B Bpw!H
961,950,622 *644C43266951F18E2AED33A2CBB332DB688D33F7 Bp(WQ
961,950,623 *6445F3F9A8A76C3FCEDE3587ADBF1BBFC319D7C1 BPw_t
961,950,624 *6442AEBA410F3B449FB3C3FF82A9CAAA79B7925A BpWT1
961,950,625 *6445574D956C9EE6F9D855D9AB91FDA85D76C03C BPwU"
961,950,626 *6443B1D7B9DA0ECB03537C162D710C77B9DF6738 B+pXG
961,950,627 *6447410F9C2B5C3F5795378D567A1C3B95B08749 BPXkB
961,950,628 *644039052DE6C0BBD228B2553C5169E9B552636D Bp&Xn
961,950,629 *64455ADDE53D77F1A5BEA18D8E439CFDE7E94C14 BPX
961,950,630 *644B336C89A154F253C1765DAA54A8FA068871FC BpXY=
961,950,631 *644F9B9929E6AEAB83C2E411A5AB47499C77361E BpY_(
961,950,632 *6446D3857BBFAAF627F899D96D75F5D998824701 B.pYh
961,950,633 *64476EF8487AAD5C7587EFCDB6C59CBC1F08D3C9 BpYKB
961,950,634 *64445EF49A00218D78277B9342C0C95BA72CFA3A BPYTq
961,950,635 *64496CD4DED071424252D27F098CAAA928820645 BPYuY
961,950,636 *64452518C908C28E62E8CC962BEBA6C6936E3EEA B"pZ5
961,950,637 *6446C93064532765B9DD4F4B0B3CCD1D94D43EE2 B_)?Q
961,950,638 *644A01F4BBB9D36BF0851C5AAA78705663133CB4 B"Q.:
961,950,639 *644ACFFD6ED87AD8416C4ABDE7D82477B5D1277D B(;(Q
961,950,640 *644CA1023946F8F08ECCDFE3BAAB258FCB9CFD62 B%=Q$
961,950,641 *644FC9247796FC9A835F0F7AB2409F912983978A B%+!Q
961,950,642 *644870B6634E1C17FA0A697CF93AA811E2371D21 BQ|)
961,950,643 *64493780878D33285774D66A1902AB5B64481807 B+=_q
961,950,644 *64493125C30270C521D1FEE0D5A59B55E32333A0 Bq/_+
961,950,645 *644D9038DA3C5B28322FDD794B08846845CF7DED Bq&.(
961,950,646 *6442C81935E3BE9088F8A14221428953AD97F3A3 Bq
961,950,647 *644F5F4A440089C98D27DA304813A6C041A27BEF B&Q0_
961,950,648 *644A2B8B5556FF86B76CEE2600D9F24D4300E1E2 B
961,950,649 *644DD0FA03F1AE7068E56D4995DF2FAF1631DA1D BQ0MQ
961,950,650 *64496EC55641277819C3B4D4D5DD2545B1BC8784 B&q1D
961,950,651 *644DB0AC7CFCA5E3F2E420195852A0EEBA9C448B BQ1DU
961,950,652 *64416321F89586448ED973EA5EA950C576175693 BQ1hp
961,950,653 *644961473F0F0F065DDD1B216F26C94D6A0D96C3 Bq2RF
961,950,654 *6446EFE88D1AA1F0528FEB13CB70DB41BFB3C576 Bq2?v
961,950,655 *644F3F6FC4A63BA587E395ED5F109754F24EA9C6 BQ36R
961,950,656 *644B7A18852AEB7799CC51EFB333082070357A62 Bq3a.
961,950,657 *6443F3C9C596AEC02BF8F0D73E3D3BD0DB9A31F2 Bq3BU
961,950,658 *644F2D81BA7821B3AD63000AC70775E0E35DB509 Bq3dB
961,950,659 *6444F2F07369A94DF626C67A260E43E789D4E27F Bq3jo
961,950,660 *6443F5961A7F8D20860BBF3A22A0696E0D26ACC5 B:Q!4
961,950,661 *64423CF79B78526A165EB7CBADAC422C441FE2C3 BQ?4/
961,950,662 *6445EF36BE17CA18C632A1C58AEC2A922C030198 B#q?4
961,950,663 *64468600FABD4F7A35104EE5361C779AC446FA0D Bq4B=
961,950,664 *6441CE1C863238268853D95C0D56EBA2FD7BC21D Bq4)c
961,950,665 *644D6D557D082BD9D2DADB69C195EA16607EAEA8 B)q4l
961,950,666 *6443B50B861FA191A5FCC296D2450A9467F28C32 B)-q5
961,950,667 *644CEA089DCC53127E552312542ABDAF2663071C BQ51
961,950,668 *64455F97862DAE40C1B7F025A39F923DD9DE32AA B.Q56
961,950,669 *644E9C89C7B2911035BF52A4E2CFEE3FB77AEF00 Bq5Om
961,950,670 *644582E1C99F2EFA81BA7B7068407D3BE32659FF Bq-5U
961,950,671 *6445131B857A3B4486E847F92DF0EA4A993C1CA5 B;Q"6
961,950,672 *6443A86E5C77811D933D7D9308E1A201A48BFBBE BQ6FO
961,950,673 *644A2363551CDE1941E6B5136E071A135095D422 B(Q6p
961,950,674 *64458C92F550B33CE9F3BC39055E2D41D4660CA3 BQ6ZD
961,950,675 *64426C1B92EBEFAA1C4522E142D2AC79562F5990 Bq7=$
961,950,676 *64435A5A43A402060B5145E50F68550741B39D8C Bq7Zm
961,950,677 *64443175693043B0F121B3831EA3F7A2EB594B8E BQ>8
961,950,678 *64470B818A2A27524C7654756A608CCF160AF333 B.+q8
961,950,679 *644234080AB3DE67B51C9D1FD0094AA422F9838C BQ8"H
961,950,680 *6448301F52B72AE889B8F9BA849EFC46C8937A89 BQ!8P
961,950,681 *6447AD8A3DB59389C8E2F5325D8F49223BA6B558 B?q8w
961,950,682 *6446CE28B875D0A9962D82300F67EAC52442CA75 BQ8w6
961,950,683 *64416CE33BC193A979FFA2A24E5B49AE61494D12 Bq-9b
961,950,684 *644CC691D199D1DD631E2EBF7A1596B9883133DC Bq&9L
961,950,685 *6444CA0FA368442BA6BB425ACB118C4837B81A1E BQ9rR
961,950,686 *6449B1F324DE7957BAB44F256D3A7C91F82586A4 Bq.(A
961,950,687 *6442EB3478607A21BE8510FDCFDC929839DC9F92 Bq"a%
961,950,688 *644FEB86BE5F5D433BD1BF6CBCB80101CE41D07E B=qA8
961,950,689 *644720E1523262FFA8BFA1FFB63944CEF74C987E BqaAh
961,950,690 *644BE056E2DFED122C51AC8C81F228E8AC788E77 BQABr
961,950,691 *64491D36A8E6C26AB64139E0A10F5E5A054CEEB9 Bq,aC
961,950,692 *64436CC10A0FA396FF65AC54DC49765FA9C0F34E BqAc1
961,950,693 *644E5D484F938AAE07D761FC94CF438B888E2A33 BQAD5
961,950,694 *644B3006463DE2210DA4FA8C07A442CFD9978CB9 BQadr
961,950,695 *644923DEAF24CF2CE173B3347C133AA2B6E8421C BqaH"
961,950,696 *6448BDE1D56C9EC4229425D9327C8DF40AE5DC1C BQaK7
961,950,697 *644FAA93805605D6F17C2568ADE70389062A79D4 BqaMC
961,950,698 *644232D01028A4A88E4C0486A653FC86A7F0A851 [email protected]
961,950,699 *644EC5720F96C3954B6D9BC00396CD31D05D0DE4 Bqar7
961,950,700 *644627F5B01D9C7B6FAF514FF27424D13B7B6B47 B(QAU
961,950,701 *6441EAD89483520BDE04AB05D615881CB11577E0 B"QAX
961,950,702 *644BD20240332E5A8B6334DFBBFBB92F4159A222 B?%QB
961,950,703 *64423A1B48549B073317DE027E4B5E6C3531B277 BQb2N
961,950,704 *644416B863ABCB4A0EC6D264FE6CF62B619A9C57 B(Qb6
961,950,705 *644DD6D3D184E40FC20012AED9D77355AAFF3802 B)QbN
961,950,706 *64499EC8FF9C10F0FD221D80EE7A159858D40113 BQbRT
961,950,707 *644097A8267A662DDA10DAED391BDD577CE894D1 BQBuL
961,950,708 *6441BA8FF28D5F6378E368BA07D09538D6A04638 BqC(&
961,950,709 *644C85754A40AC205073E5CF3CBD802E0DB47B10 B#%qc
961,950,710 *644D7DFC4A3A7239EEE070D6C6669558D334114C BqC5q
961,950,711 *64418B6C1AFCB7E75B48CD74B7A07CD270881B7D BQCK0
961,950,712 *6444AA2917DEC66694E314FEDAB6E25B5708EB08 BQcL4
961,950,713 *644C1EE50BA90942C2640EB2AF3F8A66AB2F36D2 BQc;p
961,950,714 *6443F0FB9027A6E304362868A654F6EACEDC7137 BqCP=
961,950,715 *64417F5F57F353338CD2EC70B92B174B6B384ED5 BQ:CS
961,950,716 *644D469764158D827166084DF899C4EAF2E78E7F BQ_cv
961,950,717 *6441465BA20A86212869FF645D7E03ECD59AC5A0 B)QD)
961,950,718 *644243830D896F18745B4D8AD8203393F412DC8C BQ)d+
961,950,719 *644F407B05733DAF16668F2C1740295BF11211A9 BqD;(
961,950,720 *644F8E1D7C65C7A167A3785F54AE917A4B82692F Bqd0B
961,950,721 *6445FC4ED74099A469992E77E05280437BF31553 B%qdc
961,950,722 *6444F71A661626B73127383D906599AFF21C9454 BqdP;
961,950,723 *64460835105D3EFC967205ECEC4174B8ADFF2220 Bqe!1
961,950,724 *644AD556EA9789EF9C4AD76628692A5D496EB6F9 B+qe4
961,950,725 *644344D14E2327B41BC199C6FBD310C80D36C728 BQEDCKHD
961,950,726 *6444C2A4A43EC26B2BA7FF4C1FC2389CCA22BA6A BQeG"
961,950,727 *644905424357E9C1DFA1A43967AF46A77C134474 BqE)N
961,950,728 *64476D6A1CF7E4C7AAF695746A1A044ACDB5C25D BQENW
961,950,729 *6440FFA973BE9D11C6126287024CC6EBEF8F1577 [email protected]
961,950,730 *64467A6C9B6D45AF3DB0DC6115C69A983E710E51 BQeu2
961,950,731 *644F48615088AB81F3772D7DE81DB6B7479EF7F6 BqF;6
961,950,732 *6449E9F10DBB2BD5CC45221D9DEFFA48A94E63E9 B!qFi
961,950,733 *6449AA42468BA57E98D8BD8BAFBDF7F4B51BF2A0 BqF;i
961,950,734 *6447AC669C721A216DFB04EA7485327D8CA73F7D B:QFp
961,950,735 *64496B7AB1905D37F885470616752933227C8268 BqfPA
961,950,736 *644ACA9C200470EA2DEA033D2C8C1F17DEBE54BD BQfY4
961,950,737 *644C4452A2E18A1A50C278AE6FBB7F73A28DE975 B;Qg2
961,950,738 *64475D51D4D9F826FC2C2296E927637C5BF762EA BqG2+
961,950,739 *6445A313E1CA60E0CCA2623336B57984F85D8D85 BQgC
961,950,740 *64464BF1F55E65CC2D5F94B8EEC344CC6FA008E5 Bq
961,950,741 *644461B9C5FD3F323417C0E498123A85A255153A BQGe-
961,950,742 *6443B22F53CF9A5CF5C01B8E433C56381E201AEC BQgE%
961,950,743 *644747625800D62A869D8CCD3718E03EDE11AE84 B#qGI
961,950,744 *64475B7D6D866BADAE59EEAA7650598A62A1A203 BQGLW
961,950,745 *644D9028964959A0B4A0C84F744362C795656425 BQgnC
961,950,746 *6441E357BC285547CC254A13C460098BD9927B99 B=qgQ
961,950,747 *644BD2026868DE81DAD94605DBC96E0234B6A3FE BQgr-
961,950,748 *644FBCD3CFE05CC7ACFA91F6D89B8C9E0B08D5F9 BqgSr
961,950,749 *644F9CA0CE4F2BC7F38C671492BCB02D65FA00BD BQGZu
961,950,750 *6445ECA9DABD5AAF9745E0139F8B4EAFB9DB045E B/Q"H
961,950,751 *6441B36B99E0B8904F54A143E7200FA8498BF4C3 Bqh:G
961,950,752 *6447276A2ADF81824B0327E946D705E3BC9F5342 bQHistSu2Yo
961,950,753 *644B7202655EE16976D50EF5EADB67820A6F00B4 BQ"Ht
961,950,754 *64461FF8FECBCBB950C2FC05A70EEDEA151CDDF9 BQHuk
961,950,755 *64496CE168849624AF476646D109102BD5302B42 BqI$)
961,950,756 *644D8B0CD68228B7D0D41C0BE4C5CD3485332739 BQi4n
961,950,757 *644658CC22B9E6C02CD3E8D146C06A866649A52E BqI8O
961,950,758 *644B96979F2F415754B075507F6583DB8660D325 BQi8s
961,950,759 *6449D33E2E7BE2C084B049978EE8AF110CEFD79D B/qig
961,950,760 *6440FF4454BF04F5472D59A1DCD982A87B0622EB BQIGG
961,950,761 *644459BC6584E20FA1D5BC39B6C992A5FBF79B50 BQiGu
961,950,762 *644B0AEBCD4274FDA0D16F0DE43D0A94AF8E0DDA BQIi;
961,950,763 *644D397B4A4744A6385DBFF56D1B29EF05FB521B BQin8
961,950,764 *644D900102FA6A8E18B164833698F8FD228EB3F7 BQI)o
961,950,765 *6444A3C795D3F76546F8AED336CD54510849F7AD B&qiQ
961,950,766 *64441FCA9452F0E69894AA58F26F05674405EEDB Bqirq
961,950,767 *644EC05D0F1B3BCC2D2334723232E9617529A454 B$QiU
961,950,768 *644675CC13F21708A3DB7513A861D8378D704403 BQi(U
961,950,769 *644FD4951FCDB7DB6601E2CC8FA18E7633458427 B-qiw
961,950,770 *644EC5E017D581B65D07199D7D596F92FE18F499 BQIXO
961,950,771 *6449C8754EF7BA0E61B8165B444AC2D524C5B3E2 Bqj4!
961,950,772 *644E74EA34529E30063A9555783ABCAABD6AFEBC B;Qjg
961,950,773 *6441C611390500F40D23F3E9D95D3CCC12787FE3 Bqjk
961,950,774 *644D73CC2B31D7969E2932D1BDD5F115B98CA375 B;QjO
961,950,775 *6447F4734C0D74EF2262273E5EB82E2E54D44173 bqjsljux81
961,950,776 *644A0D166E117CD7DE1158CF739C397B954DBF25 BQK%1
961,950,777 *644069F5850080B20A6DDD60681E3045987D1AE3 BQK8a
961,950,778 *644D6FC66CE22AA29AAF06450B2D0BD77DB4A3F7 BQKCO
961,950,779 *644CD16ABBE602B0EB86D7DF1404FF89B6A859BA BQkE.
961,950,780 *644787F241010B6D0917DFFBEE9401D4AF3767AB B-QKn
961,950,781 *644AE490D43C2EB132CA9D88FF59E2A091490744 BqKu)
961,950,782 *6440506E7E1BE2529C9A7678AEA9854A0B0DE2EE Bqk-u
961,950,783 *644342ABFCB0082AA19E91331ADBAD0B129A5AEC BQk$v
961,950,784 *644E386212306E0879222C5CDA309C457668BF20 BQl1u
961,950,785 *644D25B83AAE80E0F3E5DBC477CE8D1134F79905 BQL6.
961,950,786 *644D44FEEBA680342CF8128696129FC7FE8321EA BQl7N
961,950,787 *644B235BE9C0278B008E3272B8F5BC9198B386BA BqlBq
961,950,788 *644690543C47550195402837B214BF5689C1C951 BqLdAjfNhDM
961,950,789 *6442420B978A79B27326372D8E223EB7A2009DFC BQ,Lg
961,950,790 *6444864F96C34839558E72C25E69A2F2CD0D7EBE BQlkC
961,950,791 *64467133158483D45158F33867EA50CADAFD8056 BQLRHXSD11
961,950,792 *644F47EA850658B7D0DC34FD8FAB679D7B3FBEA3 BQ:lt
961,950,793 *644E3748943BB2854DA85068E81CF8FC70E74646 BqLtr
961,950,794 *644A256CD1F08870B003F19EAE1E061F3039E8D5 BQlvE
961,950,795 *6441F9B754538345326B0C4B6B05CD86E13B7AFD Bql?X
961,950,796 *644890C90D7901CA705F4AA605590EE126D30C0D [email protected]
961,950,797 *6449B16E4F373B4E5F6FEC62729255CD98E6179D BQm$b
961,950,798 *644DCF2D23D63B1DB741C8FDDAF6D304C4249530 BQ+Mg
961,950,799 *64445D32F53D4A76DE23A405EC7045FA302AF580 BQm/h
961,950,800 *6449C2FC6386A21340F3F36006ABF56C1220D11F B#qML
961,950,801 *644769A5A0A894C14BCC8F034899FED0F684134D BqmVP
961,950,802 *644495E10D4782F25A287A3893312B28ABA67CE2 B;
961,950,803 *64470BF5D5138BB6669EA8E45CF18DCAEBC7BE6C BQ"_N
961,950,804 *644CCAFABB18B0B9957FD8D707B30667622D237D BQN%,
961,950,805 *64456F3CC367DA0F682EA4D3B70565137C15FC07 Bq/N)
961,950,806 *64444B23E5E08CF8B2E4E11DC06FE68627D236EF Bq%n%
961,950,807 *644E29E60FC0F242A4B7A7EB100E8EE719B032B8 BqN2H
961,950,808 *644C33EC200ABC8A54A2B460F847C616B5BC9556 BqN3?
961,950,809 *644DC054EFD10438444D2514E8F473FF1D683CDD BQ,N9
961,950,810 *644E09892D26823DB04E36B207088ABC7425A3C5 [email protected]
961,950,811 *644E2A450BCB6E7C16490C509E11321F70C7E231 BQnm)
961,950,812 *64464C889D4B9B778D2C865AEA5B10B2884985EC BQ)no
961,950,813 *6447571AF8D64FD8487C511504C296AFE89B8125 B(qnO
961,950,814 *64468DB7F8E7CBAF9AA0615BBE60EB06BC521AB1 BqN#S
961,950,815 *644C0028E350544F2FF7E4C94BEB2DBB3C75EEBF BQ;nu
961,950,816 *644C470DF42A67F730E319EC8EA17997DF18B970 Bq/nX
961,950,817 *644B398AC1E25C16CEE2E41C876C32136ACA6661 BQO&!
961,950,818 *6444A7F1926810F44AB616528BD5B671041E31B6 bqo62
961,950,819 *644CBF65105E7F5247F50CFF5021E8092D712A49 Bqo9S
961,950,820 *6447029A54E45BC86F114D9D055B24FA924FB2E6 BQOC4
961,950,821 *644FD1F0DC5BE56D0C47BEE5E7F703763BB993DB BQocn
961,950,822 *64497E812242185938D2C73FC257F90D7940259B BqOEE
961,950,823 *644C6B8FEF4A07AF92CA6F7ECC4C3BFF1EBA63EF BqOFF
961,950,824 *644F8199CB52311BFA85EBB49833775A810109E6 BqOFf
961,950,825 *6448B363818666F0F327ABCB36FEB5C41E9FD935 BQOg=
961,950,826 *644402429D65C1012718DDFC687CC244F078CC95 BQoH&
961,950,827 *644AAFB369FA551322244E2F921B4A7539173EDE Bqo:H
961,950,828 *644815DAF0C4255DB4BE0B466C23FDDBCEB794E4 BQ%oN
961,950,829 *644D27BD9BC9156C4AB911A23E1DED925B441D0E BqoP)
961,950,830 *64419532D4DAFA6F16707E4828FDD36BB0E8B1C4 BQ!P:
961,950,831 *64433235AD580CB07F7F0A92F5E89C437CE534D8 B_q_P
961,950,832 *64435C34C5355EE5CECD47F6E7F794E07B4BAC89 Bq,+p
961,950,833 *644911E6188150766637459406F5F71D4DBA675C Bq
961,950,834 *6446C671E99C757ED2259082366DA7A21BCC515D BQP9o
961,950,835 *6449F2BA74DC8E6DEC40A6059431BD7412553CAA Bqp?h
961,950,836 *64484DE9406B54D1D35B0209AE9E5B9C7EC16248 Bqp&V
961,950,837 *6443A1E24EA96BB53C6F91494132DFCE56006442 B:;QQ
961,950,838 *6446B4B95D349DC34E3AA18B424B9660A4E82072 Bq+q/
961,950,839 *644B1F94833AAC20185D281C15C1FDA3F65BCF22 Bq+q$
961,950,840 *644AE1F263FC9015E6EA0720A9336A91B815B93C B-QQ3
961,950,841 *64476972341D8D690104C56323D17A018D924DD9 BqQ5r
961,950,842 *644C2CDAAE9DFAA0E0D034FBC618578F4A36E390 B)Qq8
961,950,843 *6441F2A9A28A9EB60A7A2704E56468DA3F3B067E B(QQB
961,950,844 *6449A53C08072C1828292CDBB131D734BB63AFA8 Bqqbs
961,950,845 *6447CC5132A36354DE823063847491217E1150A9 BQQG3
961,950,846 *644D1734331FDC593E52D7A2539B8D4EE43BA597 Bq#QW
961,950,847 *644CF85FCBD0DDC8385920A5CFFD8FC511C47F72 B,;Qr
961,950,848 *64411571DA2447C3536E735C17255644E6E60FFD B!Q_r
961,950,849 *644C68192ED8F867ACCBA942BF99E5EDBE4EE594 BQR4c
961,950,850 *644E5B0BDEB0BFAD3BBE6E853E2A37136257F7D7 BQr_7
961,950,851 *644DA23ACC786054D453AAC844F9945B75D0111D Bqrgc
961,950,852 *64424943E489D7E699D71432A11E83E62BE52EA1 BQR?h
961,950,853 *6446DD3637B53AFE024E7A0634EB8004930FD937 BqRpk
961,950,854 *644C39806B217475738247D6D80BE71972261C81 BQrQ.
961,950,855 *64477884E2F647154DE60095F530943BE94332C7 B"qRr
961,950,856 *6449C6DE46B0281159A4E956DDEF830A4C3A3B59 BqrZG
961,950,857 *6447843CE031DA1473645DD105433BF1D0148574 B-,qs
961,950,858 *644E5E13F11DB3506CD9CF587A5720A6F1CBD50B BQs0=
961,950,859 *6445209B8C6641AE19328456ED65D48C1C08EC07 BQ:sb
961,950,860 *6443483128C761B922EA6BF995B549D75514444E BQ-Sc
961,950,861 *6443079B8FB87048676A4A85568013757E5A4BD2 BQS$d
961,950,862 *644F7935BC40A2F76E66C90F7FE10EADA1466F92 Bq#Sd
961,950,863 *64460EFBE9C4BAF4A8809B03E2A12C2637F9DE7A Bqsf)
961,950,864 *644706B052C688DF4F4F292EE90F6B19EA8F8290 BQSFL
961,950,865 *644B0EC5428CBC353C9DCE197E94430E4505577A Bqsh#
961,950,866 *6442DB6CF95D0823CF7FB797F9FB21FFE8AA54C7 BQSHO
961,950,867 *6442FB5E9FF0C88F6BC0482F8020614F09F2C005 B;;Qt
961,950,868 *644FB22849357191AB71D4F52F7D12A205E5B459 B%q&t
961,950,869 *64451EA5F1FFA485F935E0C20D52EA1FE7712D9C B)qt4
961,950,870 *64422A3194807C829E4621D1784E236964A07541 bqt4me
961,950,871 *6441834D60D3B04810974D56BDBDFD8ED375664A B(QTa
961,950,872 *64453BA4C39938AA26BFC9B755166E937C25D12B B/QtI
961,950,873 *644ADCFAE6E61DEA0E93B2C06235F41CA70D764F BqTj
961,950,874 *6443938A90752E1B1CBF821A362ECA356435D1B0 BQtQG
961,950,875 *6446B3204FB2ED7BF0BE9E3BC468B8066457A4B9 BQt
961,950,876 *64420F1A89184E6DDFB22403A98791AD3B7506CE Bqtt8
961,950,877 *644DFBB47765FD3E6D23691C703A7CBD4EB0DA1A BQTtt
961,950,878 *644C12D79552A99E49911FFCA5B27C04C75CA4E7 BqT"V
961,950,879 *6446B117C9E0B292E327B7C778A6B8240695E260 Bq.&U
961,950,880 *644307BC0870A669E47B301D71ACE137ACAD9F54 B,qu.
961,950,881 *6442F5C11E27E76568635D3DDEF9EF88CF3D58B2 BQUD"
961,950,882 *6441A0C58F75F5477DD9F721686AA0E3F191C700 BQUM-
961,950,883 *644E939587DDE83245424014C6AC66D86430BE2A Bqum8
961,950,884 *6448CF22D66F4A6FE6ACF52E113BF27D2294A44D Bq_UW
961,950,885 *644D17B10C071A3C2191D9D72CB611F85BE89CF5 Bq=,V
961,950,886 *6442F187D72FDB63A600412AFD9748E2BF11E162 BQV0h
961,950,887 *644018D342E49DF962FE9C25D62DA61A477B6F54 B#qv6
961,950,888 *6446DB1CA85511D3D501DDA01674CCF3B0E4B6DB BqV9!
961,950,889 *64490C2363477130E67629AAEC7A59C395A9DFC2 BqvdB
961,950,890 *64417B8C29017E427C8BAEA8C72C0B53E19B32D8 BQvvd
961,950,891 *644C7E56A3E44365834EA6FD83B6E2EF990F16F7 BQ.W/
961,950,892 *6449783C879826EB2D9A13ACB21A3D1B4DFAD366 BQ"+w
961,950,893 *64476F4776CA5A2F84CD7C5946E68C0516797899 B)q$W
961,950,894 *6449B906075B094CB4123CC84EEBDF8A9B263372 BqW55
961,950,895 *64473F8AAC8BD877E4F161231E890C1FCC80D00F B?qwa
961,950,896 *64426EC1F331558F576D1C7505F8DFBAB54147BF BQwcj
961,950,897 *6449E9C83318E41B0D6EFE3BCE053AAC45519100 BqWR0
961,950,898 *6446C01691B2EF7897DF4D6428EACB7B513DF3FF BqWtA
961,950,899 *6444712B88D3A5B0CD4322E18DCFE1D9286C824D Bq;WU
961,950,900 *6444FBADFBDEBDB155E22129E9B94F67D7A8840A Bq#&X
961,950,901 *64467F70A271A649D7ABB47935352C70FC968BAF BQXH/
961,950,902 *644F0E9C6552CE2A0B0A5AEEF808526AB2316059 BQXOD
961,950,903 *64468825ED383783C24D456EFF77A21B20452CDD BQXT"
961,950,904 *644E6CB58F98372D090A19C424005E2A3268D5E0 B&QY)
961,950,905 *644A873522D4C5BBAF8D6B378777E1D861A857C2 B!q-Y
961,950,906 *644A12E6E04CB2C00D2E0F0A25C679D599404DE6 B%qY#
961,950,907 *6442CB6C5ABFED0AAD053CFE0AD56E87E2124117 B,qYB
961,950,908 *64423E079FE29FE846EBE2D368FC087A9FEB65CA BQYDZ
961,950,909 *644A0C5B459B403FD97F0F65A6FF77F06C7F3045 B+qYh
961,950,910 *6444BFC6A99FFCBCF98C948FC1C0EB6A71BEE2A2 Bq#Yp
961,950,911 *64449704C8FCAE89182A057EB4D51FBF84C5A4E1 Bq,Yq
961,950,912 *644DE429732A3A680D16F2E83385175189702950 BQY$R
961,950,913 *64488A5E1933D95010AE95633F6E1F2339BF827D Bq:Yv
961,950,914 *644062A09EAEE06799B6705265A45C1F4450F926 Bq#+Z
961,950,915 *644D0C73776E249249A2CFBCA98E9FB251F9EAD7 Bqz-
961,950,916 *644858A58CEC00702D314F32957D74BC82DC9F9D BQZ$5
961,950,917 *64447BE909A34AA64ABDEB93C515257A209F8A92 B-QZI
961,950,918 *64487B6538A8428427C502A71986D4A7653DB116 BQ)ZW
961,950,919 *6444F592D30630D6EAF2A900AE35ED151428218B BqZXv
961,950,920 *644BA0C02770779DE25F0BE8837F9D8E5CFA4EAE B,#/R
961,950,921 *644540E188651593D94DCC08F643263462E6FBB8 B;$R$
961,950,922 *644C1AE5385AE507C37C04570A3277E9B993228A B!.R.
961,950,923 *6445CF789412AFFDD39A2E311DF8545530D8AFA6 B?-$R
961,950,924 *64495CE5FE52C2BD275DD8EC8AE5E899ECE7FFA9 B?)=R
961,950,925 *6446C526839C811218A13728741681CAF1F184DB B/R{
961,950,926 *64466040C61252E5A5ED7A93F102656E702A332D B$,+R
961,950,927 *64410C1A039C32CA65632B47817DA81373A6C9B6 B+?;R
961,950,928 *644A0372BB5882743EC65AEF81F17D60B1C6408E B=&=r
961,950,929 *64435E29FB00E98C3EEB16524F20366A1FDA38D3 B;r_%
961,950,930 *64404BD52E3C2F6E08FD2666EFFEF36EAA578DA8 B?r=,
961,950,931 *64407061253D9D5CDB5D0E1E4AC6C3696BAE31A9 B)-r"
961,950,932 *6442682D8C48DBF70C156800EC87C22F00239B01 B$
961,950,933 *644469E35BF89FF0DDEE8E0FA9758DBF94914576 B+"&r
961,950,934 *644DA9C6D3EF623488B8C8359D298AB012243F57 Br)-%
961,950,935 *64427F74D06593944797B90D668128FD8EA20095 BR0;:
961,950,936 *644DE2BF7C54C984142286B4AD84188DA7025452 B_r.0
961,950,937 *6442E46E3E984C4619B26B396C036E9BABB69F74 br007583
961,950,938 *6445A5113B75E7C469F7C0BC13285D431797F2A5 br053
961,950,939 *6446BB50FB513CE6BB5EB11C77C5A41E9F0F203F B!R07
961,950,940 *64409174A493AC9439C24468E9FC94E4EE649379 br0743291568
961,950,941 *644A49ACAF5EE5270BA4E54B55E8E444E72F4901 br0adcas73r
961,950,942 *644E0D5659CB6BD1C6B52A26852E21D59528D214 BR_0i
961,950,943 *644B9420F489ABDC63F51CE04296D603994BCCD6 Br0mide p
961,950,944 *644CAE1543F8FD52367EA68FA7DDD5E5AF7AE6BA Br0ov
961,950,945 *64486585E513DED2EA6E510D0BA0FF0D50DE697D BR0uO
961,950,946 *64430670992E9EDF381073EEDD48EE591413DD10 br0wn1e$
961,950,947 *6444C095B4CBD9D63313F452985DE2CD6E1622CF Br0XC
961,950,948 *644FCB45EEF9849811CC52687595330CB166AC7F Br11114nce
961,950,949 *6447493A3D48ADF5F48F8E7EE6D5A98FF8243AF9 Br1dg3h34d5
961,950,950 *644967582C12F89C001AA584730B4D8BE34C1117 BR1R!
961,950,951 *644668C0DD7BDFABB30C466DB1251EBFECE635A5 br1tt1ngh4m
961,950,952 *64472123D9948A122596877210EB14D6CCBC5E79 BR2)(
961,950,953 *644C2808758A7807953C08C27108636DCFA6E2F4 B+R2e
961,950,954 *64482D2080C9BC7A26720C014D82039FE627C331 Br_2g
961,950,955 *644619CF55C17701732A6A99C60DCC84D6D2FD1C BR2hj
961,950,956 *6449F87694642013A237377BC3A60D1599842706 Br2HO
961,950,957 *6444CDB8BF0EAED2FD7A02D9F2451F0307A56D45 BR2n%
961,950,958 *6445A4BEF919D0E2FC7C571E7C17072DB9926751 BR2U4
961,950,959 *644A29715EF425C6BD1C5EBF134942BED0697222 Br=2W
961,950,960 *6446D38160EFC74FC2B24B4FF86C9BD4A1ECAC6D B.R#3
961,950,961 *644A7580E83CAF1CA68578E9C7DDAA8C7540DDA0 B=r3(
961,950,962 *6446CC733091601D92AC64311896816FE53D0928 B)r3:
961,950,963 *64404F04DA09D7E08CAAE9836AB2DBC3C240837F br34k 1in
961,950,964 *644361027F1ACD2E3B4553276A841568890E69CA Br34th1355
961,950,965 *64400E3A2B34B6865EFE1E1D9CEE0CB77239A2E9 Br3akthrou9h5
961,950,966 *6441665933AFAA1D72A391F1D38D2B9AC9622D2A br3g1tt45t34u4
961,950,967 *644F5A3DC30D20830EC532E820C1E7E4E7BDD288 Br3Hp
961,950,968 *644D335D66358C629DE77684087CAB98B3514D41 br3j3ir4rm3i4
961,950,969 *6443B373814B2D01155FB6C5B1B4122C15928C00 Br3Nt
961,950,970 *644A3A091831095E9ECC2A2E0FAFCC6DCEACCC83 B(r3q
961,950,971 *6448F257E06704D8C5B889382728D379826C624E BR3SR
961,950,972 *644A8858524D8489CE0D86A77087D0EB252BE593 BR3Uh
961,950,973 *6441B999C1E70D3AD767374C5DF47CDF6B222EA4 br3w3r69
961,950,974 *644053658A5E4AFEE1F83F92C3657A36717F43C5 BR(+4
961,950,975 *644C4B95F4FF48BB91D9691ED41B51477515CA02 Br408
961,950,976 *64472B633089800F715C767EA97B24F1C469FDB8 Br46W
961,950,977 *6448FAF16D6D89A38EC462592574004486251631 Br4Aj
961,950,978 *6443AA887C5E9F27487A190AB08990035E372CB8 Br4ch!47e
961,950,979 *6449FB0A99A06565381AACFAAA5FC6CDCC318EF2 br4cket1ng
961,950,980 *644C3BB71168B66F23A16E35A522FFE0B223E649 br4dm4rbl3
961,950,981 *644DF543629C77D9201DA8C1485BC1EC4ACBC03E br4g3n3$
961,950,982 *644117EC4BDD23042043F5137000B4172267B2FB Br4Hf
961,950,983 *644AD04E29DB36A608AF42E54F75BD6A4BEB819C Br4le55
961,950,984 *644E100FD10BDF260AAB26E2BDB9B5DA14308633 Br4mbl!3$7
961,950,985 *644A0B9DB50F1F4C7DB6ACB1B2D4A180F5B931D0 BR4MBLIE5+
961,950,986 *64423AF149E609252D2703E1167B764DACE1D772 BR4p)
961,950,987 *6449B746A02AC0A496F7DD96490E8B4A8638A90B Br4$$-pl4
961,950,988 *644EC39B020C894E3DBC55A8AB04E13B20F257BE BR4sh
961,950,989 *644E253DC8441FD2E5A213DFD2BFF31FB13759A6 BR;5)
961,950,990 *64448D559A5DDEEEAE88CE0EC692F12F56331D2D B!,r5
961,950,991 *644B7CD0CDB930018EC07194B788F1DBC6B1F6FA Br54B
961,950,992 *6441BC522C749116728A5B1DA965E63B8D067DA9 [email protected]
961,950,993 *64494BDD1ACC1F8BD82B3A7DE60C008AB1EFA4A4 br555
961,950,994 *64444766C62A2396BBD979B975C69BB98C392955 [email protected]!5H
961,950,995 *6445C82B194918B08693BF33ADF89BB23201C6C5 BR5-B
961,950,996 *644779F08E410975DF9A6653A2D8F66F30A339E8 BR5m0
961,950,997 *64413F25A7FA84CA67461BC64E20E962DA409991 B/R5t
961,950,998 *64402913840E1E95D5D64074410505BDA4CAC3D0 BR5uk
961,950,999 *644D7E1C17DF7DDEFA60E86489E65C09E61457D2 BR637
961,951,000 *644F961D6347CE5035D8AA58CD2CC80513974B3C BR6A8
961,951,001 *644320AD40087217B00AD364067DBA89C4067F71 B/R6d
961,951,002 *644B2AA18DCB56985220D316E8A93898F6EF895E Br6NX
961,951,003 *6442786480720FF28E9DCBEA2C486C4AC11D8F28 Br6tC
961,951,004 *644C0CE4C29498B64F304AD0A98D45A3089B7A66 B!R7D
961,951,005 *6442A86394BF8837D24D3A73F281CA7AF2D4FEA1 br7eiipxxr
961,951,006 *6447E700DE5AF8D3FB958DF26793D4028879246B Br7G&
961,951,007 *64436D5C79AD34F7ACB2222174A9F37DD2431702 Br7)n
961,951,008 *644917014526CDEC1F245451999F1D0F681DFBEF BR7Qc
961,951,009 *6446B4DCE11614853E0E19403A5BB54D2974972B B-R7u
961,951,010 *644AA1BFCA0714E2AD6D43E240CBC0BDE52E61D5 B#"r8
961,951,011 *644681B1326D93FCF48C31E29021BB63435B4895 br8461
961,951,012 *64435AACC4092DA1C12E0F4971CD54642CB83723 BR876
961,951,013 *6446218E58D40DDC67B1656AD22386D8781FBD5B B.R8d
961,951,014 *644C383D443B91BB6DAA69C3F2E3221D8C620041 B:r8F
961,951,015 *644D7D0EDAEB94EF0D1210AD60EADA26E560948C Br8ju
961,951,016 *6447CBD98945E2807476AEBBABE837752E2F50AC B$R8n
961,951,017 *644C31A243425EA127A3E92154122C05A59EFAAB B.R9,
961,951,018 *64428FB76180B8C84D86857E867C043A02EB9E40 Br:9
961,951,019 *64488CD1F17992B8208827F0E36E1321783A1469 Br93k
961,951,020 *6448E404C970768869695FE1E25102B723071E1A Br9:s
961,951,021 *6449D5A1598154BEE269615BF35AE51A669D2654 B:"Ra
961,951,022 *644B9C24430E1E0F6E7AA170711D5A9F8DFABA22 B%r_A
961,951,023 *64433FECB8BBF5A78B3C6551072DE8C58CB262CE Bra)?
961,951,024 *644CD07F61D851AE73CA04E0E8971216FEC36F6E brabantbuntbarsche
961,951,025 *64497C83E6E6C8E10BB6D7095B4E4BFE2EA7D41C Brabbeln5
961,951,026 *644FE0CA802194CF02554BF3B10A8601A65D5170 Brabeutai6
961,951,027 *644B0356494F8FE6A93E4EB049546A24722A171C BRACE1E7$
961,951,028 *644A2DF7B411FA83D20FA8369B9F1B88E3938B62 BrAcEROs
961,951,029 *644D2A7E4E78DFECE70BF55724B74A64CA927A77 Brachezed
961,951,030 *644A5B444AA574F52487B923362789BF23B97A43 Brachies3
961,951,031 *644821FAD2E2F67654B99EAA9D1911EBC51FD4D5 BRACHIOGANOID6
961,951,032 *6447435DB6DC91ED49A42ED2C6567545F3CAC83E Brachyaxis5
961,951,033 *644A5BFF3BFE4D6F01B64C58408FE42CC32A6199 brachygraphiced
961,951,034 *644A3FD56A3BBD62B34E48E5FC5B208A4A623481 bracken.livejournal.combracken
961,951,035 *644A73687F64827629F307F22E099A21D51065BE brackiesed
961,951,036 *6444738007248498F64A2C8D89BE6AB394A5B247 bracks160
961,951,037 *64488D6832D74DC43910E65841E450FBC53A0494 Bracorina
961,951,038 *64423DF46FAB85D60EC6FE27F6A5823474D4907F [email protected]
961,951,039 *644F318691D9F734A3EE43AAEA1BF05E8C53EB29 Brad4200
961,951,040 *644E99367515A34BBBD4C8966F3EE79E1DA593BF brad.ahrent
961,951,041 *64458341204B2BAF2D4F87C25384DC7F332E52C9 BRADaWls
961,951,042 *64478B725329310EBF2B2218A608BB3BEA562950 brad.balasubramani
961,951,043 *644DA50ED5808197B24A21301AD2286DB8EE18C7 brad.belliard
961,951,044 *64460502C83CD71E63C01E35CC66B2A14073217B bradcc1234
961,951,045 *644F9098F2B7ACA2E9AC530115510F859AC2AFEF brad chin
961,951,046 *6446DFE3D528A0A8AA856719844E5BEEF0F52354 brad.dolinski
961,951,047 *644583CF1ACED75864215879F564D1CAD2D0D93B brad drawdy
961,951,048 *644F2AC93FE942D3118D664F83E5EA135A9A8916 [email protected]
961,951,049 *644C10843D10FF709CC86DBA4468A92A8C41C5F0 bradein
961,951,050 *64444FA0298C34648A513728E5ECA81545C848CE braden frank
961,951,051 *644C18A6579C602756C34F7C4EB87B6B011DC67A brad.enrico
961,951,052 *644A7F485EF05F8D67143F334F23591A78494A3F bradford.ascenzo
961,951,053 *644EA4204B164CFE25924D8935B08BDF1BCED30B bradford.aybar
961,951,054 *64491F444DFB1EAF54E7BAD4627163E2121D47A4 bradford.bagnaschi
961,951,055 *64497772277935DA771D45CDC8EEAEB59E499800 bradford.bahl
961,951,056 *644BF792527B75210B86AD15F4E776F612DF0F3F bradford.bennett
961,951,057 *6447E7A50CA3BCD2629AD002B58F089CE1677F3B bradford.chojnowski
961,951,058 *644F8E0E8ACDAA2B932A084E57BB08F74C770D7F bradford.christinsen
961,951,059 *644766F963C35BDEF7AA6E265F5CFD095BEE98A6 bradford.demayo
961,951,060 *644D651440FC0E53233A47C8260D3EF6ABD2CA27 bradford.ducos
961,951,061 *644DC16F1DE65DC75B50A1355F0AB173F0DB030F bradford.edwards
961,951,062 *64468A5A98FE0940C7D526892BAB78AFFB5C9551 bradford.favorito
961,951,063 *6440DBBA459C62A77AFC99D3C698D05E1D230BEF bradford.helphenstine
961,951,064 *644E29F719544F07180852A32784C895AE2D8B11 bradford.hynum
961,951,065 *64471A57B3392E2809D4954F19F0ED819CC6588F bradford.kanduth
961,951,066 *644E7F219E11C986BE1D3DF89687C1FAA0F80054 bradford.linzan
961,951,067 *644452C2C1787BE28485B59E199E80968B81F8B0 bradford.mccown
961,951,068 *644F8EF278E0A5762F7BF86E19F1484EA2BC2AAC bradford.mcdonal
961,951,069 *644EC114BD913EDBB0DF45C6680F4E6087B85CDB BRADFORD-METHOD-COLORIMETRIC-PROTEIN-ASSAY
961,951,070 *644D9FD433B4BCA5EF14CE0E2A6784D0EBA18221 bradford.orloff
961,951,071 *6440F05CA331D7DED115868723A58A88FEFC3DAB bradford.passaretti
961,951,072 *6448CF8235324C3CEF0E2AA558FADFE8312276DB bradford.raczak
961,951,073 *64476AE8A93C325B317F218CE55D05BE7C1E19ED bradford.raviele
961,951,074 *6441B67D217FA92D8DD64D2B33535537235A05E7 bradford.scarpati
961,951,075 *644F0BA84D6FB6F554FF0434699D9D9ACD2F7234 bradford.stichter
961,951,076 *644F79E11F1D233035B958551394A6CEAF2305C0 bradford.stocking
961,951,077 *6447C3A71F2BB701FB71F00C2E720DF6B968D1F6 bradford.trancoso
961,951,078 *6442B97FB0EAC5C74D32323F15B6715D7CC1D776 bradford.twigg
961,951,079 *644969B323E9BCFAFDF9EA166D180E53BF889C98 brad.geathers
961,951,080 *64418DB8E6F9F58B632480AF27999445E3B0C42B brad gelling
961,951,081 *6446324FED023AD49F5C6439941FEB6C28E6C25A brad.goodell
961,951,082 *644466A055A4F23929E304F2F669860909155514 brad.haecker
961,951,083 *644F569C39CDF3B5A1670A73E9EBC03C54DA5455 brad.harnes
961,951,084 *6445B1B1E3A575EECFC43347DC0FFF22AEE0F496 brad.hermie
961,951,085 *64404B44169E8D32D2DAF817BAA1F499BFB282B6 brad.hornbaker
961,951,086 *64409784F2AD4A6177984ECA3E5D372A5B498199 brad hurdle
961,951,087 *644C8148D567D5AEAD2232732CFBE3518119FD21 brad.kapler
961,951,088 *6448EBA670D6B8B2F028444016BFB0534C5C1209 brad kennett
961,951,089 *644CE5BBDCE870AD374523B4637B7DF2FC48150B brad.kerss
961,951,090 *64464A40A40132ABF5E77D3EE313B7783D46AC7B bradleejoseph
961,951,091 *6448E9FCE8963ADEB132E539146755CC9EE74E8D bradley.achter
961,951,092 *6444496AF58D8E1F96A7E0304149B3122837C7B7 bradley.agerter
961,951,093 *64434258DC160516A0BB8139847672BB13EE5906 bradley beauchamp
961,951,094 *644729FEF0FD6A3A5FCD482A3E200F7208FB34EA bradley.calaycay
961,951,095 *644BF0340D33D88294AFD9E50B7E14C6BCA3D046 bradley.cham
961,951,096 *6446149AF3AFD6A3DB3B03F77009C6AA73E2E38F Bradleychipper
961,951,097 *6446AE80C3A9E230CD9CA3ED6AA4F990165EC835 bradley.chisley
961,951,098 *644F4EA1A7783699561C19C0ADE43B83643D2046 bradley.depasquale
961,951,099 *64432D72D61DEBD942175D45DFC7A9D65F91DB69 bradley doan
961,951,100 *6441732B740B285D93788C3AED0C7EC2BB0253DF bradleye6
961,951,101 *644A5A843F6FCE05056EBC1FBE8DFB04FEEEFAE1 bradleyellingboe
961,951,102 *644AEE071B236CE1641016DC504D749755FCE879 bradley.keaser
961,951,103 *644C98ADE2F5055AC284B245EA0A0347E1950834 bradley.kijowski
961,951,104 *64457CFEDE939EC6769B3520D1AFFEDE38FEBED4 bradley.koplin
961,951,105 *6448BF0C0FB897D622A496977571264A5A4AA715 bradley.loman
961,951,106 *644641DE5558027E71A096A3026F483ABC4C95B7 bradleymeagan
961,951,107 *644C1844C80D05642F8CB6C62C920BE6EC6E990D bradley nilsen
961,951,108 *64446B333027C4C1BB1FDF1B6BE6DD6CF5B2837B bradley.noonan
961,951,109 *64489191C56A497FF2C604449EA79E51DA35723F bradley.roylance
961,951,110 *64401F47AFFC6E7F9646DCB2AFA06CCE178B75E9 bradley.sandoual
961,951,111 *6445ECBB5537422DEF59BC199CE97D1B6D74C579 bradley.sankar
961,951,112 *6443ED208454E7D339B47F37C05004A9DE743F57 bradley.siurek
961,951,113 *64407EBC6024F10E2E244AF48A09070B8A2C692A bradley.sterlace
961,951,114 *644360D08D49ED03EF8A331595558B414F04E29D bradley.tusing
961,951,115 *644C1B63EDF8FD9FD596314CDE26FC63B537F5EF bradley.washpun
961,951,116 *644A5F30EA8751709961B6F7FE0CE50913D047D2 brad lueders
961,951,117 *6443309AAF9E305C6A5A3FF02266380194731F80 brad.luehrs
961,951,118 *6442441AE7FA124F5109A4AD1A9602A89286E569 brad.luttrull
961,951,119 *64475C549DAA7555339542EBBA5D1610DCD29364 bradly.buysse
961,951,120 *644951CB8A704AE48F74294D1132349364C7EB36 bradly.carbal
961,951,121 *64443E4993E9D4ECA9B2C707C49AD07E0D1DFE2F bradly.carvill
961,951,122 *644A3FE2E6C04031555EAD6BCB8BD8C0A0240A77 bradly.dickel
961,951,123 *6444FD0AEFEAB5A55FEECD19C8005F6A6684F0D0 bradly.elerick
961,951,124 *64483778BFBA48462F53495CACCC362B5BDECABD bradly.ferrise
961,951,125 *64446B576359CCCD0623351BE1CC96E5D3131AB4 bradly.fleschner
961,951,126 *644CBA8189B5CEC72E19B4428099F4FBAFF395E3 bradly.gathje
961,951,127 *6443CC5124D8DE47242FFABA7448AA41CAC2CBEF bradly.gorden
961,951,128 *6444FBC41504103A2781F6E3E5D0136CA9EE2C35 bradly.hysong
961,951,129 *6442D8DDB2A037E3847923BE6EAC65C4F51D64D4 bradly.mackler
961,951,130 *6444B1E0BD4061614CFFA3211B0F7FEEF64D1F2A bradly.pinkley
961,951,131 *64466BF2A597D59353D0B25B9223623E95EB1E4E bradly.rathgeber
961,951,132 *644A79B381C8FFF431226354E4EC9297B3343291 bradly.rispoli
961,951,133 *644BCDEF885A7A0CCC54D18BAD49C7ADFCF2F78D bradly.robicheaux
961,951,134 *64407D3F039A7333C8F483EF0AA2189234E82CC5 bradly.tebbetts
961,951,135 *644636287ADEF995F7E59D6BFE422B1D80453E99 bradly.vereb
961,951,136 *644DDF9D62169CB14C95DFF44F5CA2592F3365F3 brad.maceda
961,951,137 *644D927ED169B5768A9A99A31EB202AC1ACACF2B brad.moustafa
961,951,138 *6443C0F185DFFF1CFD59F34A8C3FD04C3362B22B brad.najarro
961,951,139 *644F5DF3639B82B424789EAAE3A8D7D70333D5D3 brad.nicar
961,951,140 *6449CAEA1CD3203FD2158DAD1CCB1F4A26B8DC3A bradpassfield
961,951,141 *644E4619C1A1314225D05ABEA1F23CCB8C029C32 brad.pomo
961,951,142 *6449F5030BF5710FFF4CD75663811ED92768F8E5 brad rorie
961,951,143 *64473F6BB79F12FB489E94A4A9609870091B801A brad.ruiz
961,951,144 *64439D3771276BE36A1D2D08359D2812374D2714 brad.sachar
961,951,145 *6440D7076AA70B97E9211071B34EF6D2932BA0D2 brad.scheel
961,951,146 *6447863C1ABAB2447FA94442A1DE80FD1DDD3F77 brad.teagues
961,951,147 *6441F2B6643BA6F5F1C906899FF300DE8DDA230C brad van damme
961,951,148 *644FFC90AE1DA3E3A851CAB84F84FD8F9CAF32D9 bradvandenberg
961,951,149 *6446F20E7ED1CCB9DD03FBCDAA6BC3C477449DDE brad.wakayama
961,951,150 *6442C34516D0EE3E17340188FAAB5E8D50F340A9 brad.watahomigie
961,951,151 *6442CE5D342BDC4F42AA8915FDEBDA2E589E44BC bradwelled
961,951,152 *6445B89B54D1B6631F121411CA96DCD0DE63BD81 bradwieler
961,951,153 *644767FE41A7E797CEC26EC3439781F816316A4C brad.wuitschick
961,951,154 *6440608B20CA44E907C39AE3C0DC4D9A9A52BC62 bradyacou5ia
961,951,155 *644EA56941142B76783E863E726B1FFAB4550B5A brady.amick
961,951,156 *644F69585BB7A2321E4312E3F4EDCA7C43EDAABF brady.bissen
961,951,157 *644D3AF16408AAD4C9D0D583FDC7BD11D1FD5657 brady.buehring
961,951,158 *644343ECEF124C06CD7DBCACA5173ADFAC06FF04 brady.casselberry
961,951,159 *644469B6D70079CE7CB0197E2569562F73582D90 brady.coghlan
961,951,160 *644866E87F771616F659630D1ED71B3ED5FF3460 brady.crouse
961,951,161 *644FAEBA3CDDB0EB4E627DB43171940D24FBE0ED brady.dible
961,951,162 *6443C25F75EFF4B25C8DADEB6A8C51A03096C357 brady.etcitty
961,951,163 *644A6B83D0A5959E53B74F6249C9718AA9283BB9 brady.feagans
961,951,164 *64446652407226ACEF2E03F46459BB7902D55FBB brady-handy
961,951,165 *6445138265CE06E73F8B3803F91D44429AF02161 bradyk1ne$1a
961,951,166 *64412E830C602331B59FC439ABD938EFBF3D042E brady.kashani
961,951,167 *64419C71B7195BC3EB6495B33C444857B77C096C brady.katterjohn
961,951,168 *6444422C058E77AC3A7D9E9E60C2331AE6A44469 brady.kennan
961,951,169 *644F3E773FD45ADC102F28392C5D8CCB5337DE6E brady.kins
961,951,170 *64426D7AECB986EB33FA9C8AFD5D4FA433EDD9B5 brady.macdougal
961,951,171 *644AC9289FCE6EA0750D43A537837B310BD79396 brady.mcclamma
961,951,172 *644D6920057239966072AB9F78C80DD18C38C9A9 brady.metsker
961,951,173 *6443389E7DE47FBD27D65D043115CC99F9BD5B97 brady.ok
961,951,174 *644A3FEA9A61946AA415CE2CADB8706EE710EFF1 BRADYPNEA7
961,951,175 *6444764F5407A998660D78D512A4C3784B1BB015 brady.rask
961,951,176 *644DBBC67511CAA51678AAFD37CA10F1D5A269B9 brady.ruggirello
961,951,177 *644B01919969AD593BA39806D3E74E1B1EDFEBEE brady.saieva
961,951,178 *6444070FC455149BC3BAB8A793108D3A5FA09836 brady.santulli
961,951,179 *64440212D6202E827413F44DBF36CC382CEF99AC brady.schmatz
961,951,180 *6443CE4A08B7B04FCDFD9F2EEA415A9B09FC60F4 brady.seagle
961,951,181 *644BBC37B01A6AB4592C2B946913BDA301222F4E brady.szaflarski
961,951,182 *644ABE7BCCE0A89ADD5697644684DC21D1ADFC29 Bradywhataworld
961,951,183 *644178BDD6073B8FFEE5801C72A35DF88AE688E3 braeden hall
961,951,184 *6441B6DE43059F26EFFC2D926E6514CAC42EAA5E Braeunig?
961,951,185 *644345CFCB0F0D07A9AFA3F0CDCAFAA7822FC741 BRAGANZA-VALIENTE
961,951,186 *644E6D3D92C00C58AA391ADCD5F34341DB93EB50 Braggio1
961,951,187 *644C08D7B26D30D65BCAC74B8AB5293AE153914D Braggmil7
961,951,188 *644EB8B4EAFD8ECDF1FF9887F063DFDE6B437B39 Bragozzosed
961,951,189 *644E332934149C91BE495685A9619CDCB6AC2ABB brag.sourceforge.netbrag
961,951,190 *64434163126958D5E37A9074A85B997B14208764 brahem's
961,951,191 *6441D49029148ADBA67B31285E5BCDA763336160 Brahmacharitva
961,951,192 *64426DC8BCB08FCF3A681FA8BA9008F5504DC53D brahmacom
961,951,193 *644097C49AA0465B9A3D15B470EAE47C6D8DBF1F brahmanaj
961,951,194 *64435D226136EA8CDE707E5D2B60E9BC116C7E7F Brahmanyatvam
961,951,195 *644BA237B6014B5EC16ED7C0462816A10F37827F brahmaprisajja
961,951,196 *644365A4A663F99EB7B1FEE6705DB75BEB1BD5CB brahma-vishnu-mahesha
961,951,197 *644FBEF836EEC444FA036BD0F28B6D9967646F1A brahminami
961,951,198 *644AE389CFAA968F8529E24067D05804B18BC3CC brahms / hungarian dances no.17 - andantino
961,951,199 *64432CEF37A52239899FE8A665975FB32720EECE braicks6
961,951,200 *644E1345F9F450058C17D923D0F2A63C30B6C79D Braidei6
961,951,201 *644B9B57B3A983BCBC6EF201E9BE8738570C3D6A Braiden201
961,951,202 *64412F6004B51BB5AFDDF1684B8BC68B9E269629 BRAIENS
961,951,203 *6441F7DEA639CB276E109BA74EDB43BAFCE4DE57 brailey0
961,951,204 *644EC7D66F4D872885BDFB5C5A315477BEC7F879 brain.adkin
961,951,205 *644F3398B7637D3B42EAF97A19DB9976EB33F68D brain.biehn
961,951,206 *64496F09B6E01BB09E63AC900833FCD350D66937 brain.bonello
961,951,207 *644A209443753A923C70D060ABEC8B23F6AEEF05 brainboxjames
961,951,208 *644613CC81BA0F77F452FB5B6F9E67915CE99649 [email protected]
961,951,209 *644D1F6FF0489FC8CAE4B8CF6ED7A23E80F4D581 brain.cupelli
961,951,210 *64415BEE378C5ABE8DCB18974A6EC9A8FE925C39 braindamage33
961,951,211 *64412B53FE11AD65A6FAB75F5D8B34E443075676 brain.daven
961,951,212 *644D0070BAA478F90206C6785B28C5600DC6767A brain.deruiter
961,951,213 *6448F1CE1355F73BE955C1C993C8D4227A567149 brain.divens
961,951,214 *64487B643E0D5F87D3EAAB503D902BDB3731865C Brainfire0015
961,951,215 *644D5E3F85EAC97CCAEDDA997DD7C90AD06D6BE1 brain.grabe
961,951,216 *644B63F163D7048D06C4B126BDB6139D90617259 brain.halberg
961,951,217 *6449082B498C0BEE44076346911451B13B4A3C45 brain.henneman
961,951,218 *64451BCE81BA73383F406A376ED1223892725C30 brain.huenink
961,951,219 *6442E88AF0F391515C5BC0BC350320DD9F09B66C BRainIER
961,951,220 *6442677DC5546BD1ECD06AC27B0CF0A10DB86014 brain.kopatz
961,951,221 *64494909221B17C6927413A0272B59D02D2B5168 brain.lincourt
961,951,222 *6444CEA3B7EFC47810746A4EC0EEB22CBA5F534B brain.michaeli
961,951,223 *6440A278110DE946862CE04F213F6E52103EEE6A brain.monarrez
961,951,224 *6443D00ADB8395E317A02DDBABA2ADD2EED76253 brain.pettis
961,951,225 *644C23C5FECD823A845E8B82E1437D29C607A93E brainpool_companyhas
961,951,226 *644B421AFBD91313A9C21AA9B9656A3678C4B411 Brainstr1
961,951,227 *644D9B4E5E470C9121B9120AD3D704CA5C90EC89 brain.ullum
961,951,228 *644D565D8FEA404F5E61CCA3E035638AD24BACE3 Brain Washing (Version)
961,951,229 *644D3ABB78D16BB3C066FEC5FA2DC461D426FF72 brain.waskom
961,951,230 *6441510AF4FCD998F78A14E89163F6399945AC1E brain.whitenton
961,951,231 *644BE21E1EF8D57CFC6E254B31A706FB7AB5F66B brain.wielgosz
961,951,232 *644A7089CD545DFC2245F85EFB0DA0DD2154F920 brain.winborn
961,951,233 *64446226AF55643FDC4DEC09FA4C2BD2F82FAA75 brain.wyly
961,951,234 *644FD6EC95844BA68B3EB4E0CFC05FE547E08F07 BRAINY0XT
961,951,235 *644CFECA2C3229B2FE0CA8D16F669142D9F7DFE6 braisedskullwithrockmeat
961,951,236 *644B5CFBDBA03D5421F355108F72518500430A5A brak1
961,951,237 *6440CE280C4FA9947E45C90A2D0713AA71E5AB73 BRakE
961,951,238 *644C888F054562FE4123E6174EF0C23FA39E8179 brakmark4
961,951,239 *644556201443CB11CF7221E3DC7426264F9676A7 Brakplek4
961,951,240 *644E761A0B401CC10B86064549605246064BA804 Bralhats2
961,951,241 *644C4DFDFACA3981C6385A6028AFF57B0386B043 Bramabas2
961,951,242 *644533C256A162BA5E077C548B416D6B2C8C53A5 bramador9
961,951,243 *644FEB77D2D8AAC361F6EFF12B8783C639EB9299 BRAMASANGUE
961,951,244 *644CF251A7D2D985346C155B8C6BBE1D2C71AD10 bramase9
961,951,245 *6447DDE5B12806DEDABE5C23153AECA1FE71A1D8 BRAMERS
961,951,246 *64441718FD35D3CCB414D2FCCC845108B95C5B77 BRamk
961,951,247 *6449D9899107F9CB7369B9AEDF3C9E5C158C6B73 [email protected]
961,951,248 *6444866FDF51EC959701D8A471BDD64762042228 [email protected]
961,951,249 *644F99CB12B5B83E817EA185B32AA9966C9C07BD BRAMWELL6
961,951,250 *64432E2EF811112723E152900D6403EF5E2D6F0B BRA!N5T0RM!NG
961,951,251 *644862ABFDC117EDEDEB34592E7AA0E5D7B55B27 BRANBAY228
961,951,252 *644EF35CF3D09EFE4589727CFF17B893A7575597 Brancardiers8
961,951,253 *6442FEA23FF6F2447BA7104A9B035EB44423C6EF branchenset
961,951,254 *6443B113F170772F428095EA7E01A07181175513 bRAnChes
961,951,255 *6446E74ECAE6EE65F10C816DA662EECA66A6781A Brančíkom
961,951,256 *644643764FE417E54C2616A1FD20073CE3B2E80B brancoveanu2
961,951,257 *644C21F4EF6AE132A99BF3CFA59E5FAE1C60F180 brandee9
961,951,258 *6443E9BEF89D885210F13F945EBAACB16979CFB1 brandeemiller
961,951,259 *6440FB8086A16D368888B5F8A7AA70323DC1645B Branden125
961,951,260 *644A176169FA2C23287AFE648951051BA6DF0CDF Branden233
961,951,261 *6441DC3143EDFD42D6D1968AC02612B37944C333 branden.baoloy
961,951,262 *6449EC59EA76F6C67EA099FE889A6FE04230500B brandenbrunner
961,951,263 *644C9DCA397D8D470325FFB946A30AC65363E71C Brandenbuger
961,951,264 *6444910136077A657860D78DD904A9388BC57A62 branden.bullman
961,951,265 *644FFB3ECB1ABE6C87727F556047795DFD93FBDE branden.deaton
961,951,266 *64495317312E92335E0040B08DA5D14E79D138F4 branden.hallada
961,951,267 *64476DE912509188F7F5C5663251CF864D32CD23 branden.kluss
961,951,268 *644B577927ABBD55E3D67C96CA821F6E615D3A08 branden.krzeczkowski
961,951,269 *6441996EE90848438F8DB59A5A94473C82F2B234 branden.leriche
961,951,270 *6449CA097CDD0B66441600C3610BEA3CC8FDDA4B branden.moutoux
961,951,271 *644BDC6CDBFF941D2516F4EF9DAAD3979EB6CFDB branden.rigel
961,951,272 *6449F820F7CB102249A5269C9485612729BC4428 branden.savakis
961,951,273 *644F01D14272EDC9A46E54044F715B2C8E88622C branden.wagganer
961,951,274 *644F7D89EAB0CD73D2C86910CE1D44C50412F66F branden.wesselhoft
961,951,275 *6440C028E976272DE0F84449BDB4679954539FF6 branden.widhalm
961,951,276 *64452814E006F08855B2A874496529CD5D403303 branden.wienecke
961,951,277 *6442684B3DAB5A0E6BB99C698DC64839348325FC branden.wilkers
961,951,278 *644BBFB166D0412018D493949CE90EE4D5A379B2 brandFullName
961,951,279 *644FD068295458C0C3DE2ADD1DB9F9F49A7006D5 Brandger4
961,951,280 *6440FC428FC6C5DE99762008F6A5F4666DA6C367 brandi59
961,951,281 *644CBA97CC0DFCC5A85E1379D3EBCAEC776B29BE brandi999
961,951,282 *644DCD1DBBA27FC6116ACE049CE9A3EC2A50C2D0 brandi_hanan
961,951,283 *6444D82349E6D637C03171C93034F8FB8EB95387 brandi hoffpauir
961,951,284 *644965DE368CBD8775D1247B8F74123CF4A3F376 brandilocklear
961,951,285 *6449F7AC6EF59E4ACD1BCC1E3E6E7F3F6CF154B3 bRAndInG
961,951,286 *644430E939966171290B472610497019B5FAA59C brand in mijn verstand
961,951,287 *644366E064A298E12F798B20EE8402B2E90FF4F2 brandi renner
961,951,288 *6444AFB7D0EF434196EF7C1F674ACBB480AACD0C BRANDISWHIERE
961,951,289 *6441BFDC8848663FC49E53EDE273B78EDEE5E554 brandi trussell
961,951,290 *644FC0C5764E46227A521858578FD5458DAC1761 brandmks
961,951,291 *6445F2CF0318484763AEA76EAA96143C6F6EEEBA brandon.arntson
961,951,292 *644EB451090AAF83692EEFA4621D5A2BF1C1D22F brandon bertoli
961,951,293 *644EBAF19E6CA4898D6A739DCA97D301BAA43428 brandon.bicklein
961,951,294 *644F0BF889CF4B1E5EFBF3CEC12CFE4155CFA2B0 brandon boyd
961,951,295 *644A202D123DDF0ED1A4F55D1DEB7F2DD3B21F2D brandon.broglie
961,951,296 *64467C1CAFE7036B91BA0A9AD5AC7FAA0E9BCC1E brandon creager
961,951,297 *644993C8326C49AB358E370DF45A55E27A853B3A brandon.daer
961,951,298 *64480A6274C9A8BAD2C16D704212CB5A6257EBC7 brandon.desko
961,951,299 *6440F84998D4B088F327BEE38E15514F6DF9C10C brandon.duesterhaus
961,951,300 *644437E1DD2F7CD87707E53E308E8C73244147B5 brandon.engl
961,951,301 *644301B44FF1F79F5F77E82AE12B809DE37CC37F brandon.ertl
961,951,302 *644A863438093003018A958663D801196DC42367 brandonfeltz
961,951,303 *644AD3C0FF8AB34D514B8D7B65F0B2B8B5263571 brandon.giallorenzo
961,951,304 *6445B364926A4D37EB77D2C5E25752E4B7595A48 brandon gift
961,951,305 *64413E54B315592F1CB6392EE64749CCDB905126 brandon.imes
961,951,306 *644CEA7623F8ADD7666389DB3985A98613C89E9F brandon lucarelli
961,951,307 *6442CE9E37217EE5C7A0C9695CE0426E66580913 brandonmarberry
961,951,308 *6449B43E0508FA3B5E5D6DAEEFF541AFC8F795EC brandon.measeck
961,951,309 *644A9AD68518335D7716A8D357FFF3A8B238C2EF brandon.micco
961,951,310 *6447989190634226E58E81E800DF22E5BFBD9C94 brandon.minchella
961,951,311 *6441FDF03CBD92858EF6AE4679F3B75C012B803D brandon.omary
961,951,312 *6443F3C85CA93016091AB3474365554827D349FB brandon.osterhout
961,951,313 *6443FCFBBF216335DA25DCDC74C7AD7C69C4440C brandon pecha
961,951,314 *644A5DFAB7378C138B38D26958E77D1DFE6F8063 brandon.ptomey
961,951,315 *644662EAC78D33F8919C8F582E5757FDACFF3233 brandonsaltmarsh
961,951,316 *6448C8D2875D473CBD895B65BE59F25A64E239D3 brandon.staple
961,951,317 *644B4F3451445BE3DA61912AA969557AA9C1F88B brandon.stoermer
961,951,318 *64400B8639569702B4D846C6AFB0F3AFFB64B34A brandon.velez
961,951,319 *644F62EF3B253EFC9AE16032B55DC3C43DC3BE29 brandon.waldenberg
961,951,320 *644606ABF7EB8A92B6499E6B8984ECB9B7550C4D brandon.woodie
961,951,321 *644F7963011FED7D7B52E6FA8799AFC53A7E4500 brandonzfitz
961,951,322 *6449C0CFCB456B32BDB4096A6808417B3FD796E9 Brandsdetail
961,951,323 *6441FCD57211B180FCCF3F8594B73F5C95675E62 brandst3r
961,951,324 *64401E8693A8447F8C140FDAC4D1CC378CDC969C brandy1104
961,951,325 *6441D396E0E7AB304068CB71525EE4D33F2F7518 brandy burkhart
961,951,326 *644F224399156F1A0ECC027A500657EBD9292DBF BRANDYJULIE
961,951,327 *64465FD839A4DB015D80E28087E1107B69F6AD92 brandy losh
961,951,328 *6441BC9F97B9E9C297C1204A851A9A90D65D6BA7 [email protected]
961,951,329 *64488B1AEB2DC2DE8FB21A2ECD60BCB0D3F7B42C [email protected]
961,951,330 *6446B290F6D0E68100451CFF67EF56F319D3E424 Branioci4
961,951,331 *6443B25466E04B4983111B14698C724CCF6CB80D BRANN-LEGEND
961,951,332 *6443DE69D9B1B682B26C298374AFCFD3A34AE5CD brannmar6
961,951,333 *64462367B5E9DC0F9AE8E66F4E0807C1783DAAF1 brano002
961,951,334 *644658D909E246EE0665B1E8CBDD8DA71CF5526F branquilló
961,951,335 *644FE121457569F6438E1D5BB7E0A2E893A5226A Branquio
961,951,336 *644D433128F70DDDA9883FB9B7338A4CFA87D285 Bransgore6
961,951,337 *644B0EEA452CE524160BD2A9E31F2FD4C3824A70 brant.dominique
961,951,338 *644D98C944C5284B5C3817B6C8D809AC086E9D25 brant.eager
961,951,339 *644F8A52653F26B519B860F7D0B3652C1A45197C brant.eshbaugh
961,951,340 *644D4DAB027AA5012F3A3A70B8A9AB6B2581DE5B brant.fahrney
961,951,341 *64409D9B765300BA25BCA329C9E9AD4ADA897685 brant.faville
961,951,342 *644BF3DC12252A98B00BFDBC36E6542EC4626C8B brant.fulks
961,951,343 *644818065FC502061281F5EE0CA131FD7949BC64 brant.gal
961,951,344 *644383E72CD8E26D9E0118F6294EA6BD235808ED brant.haga
961,951,345 *644E90C41ECCB18B37F99DE29EEC4D5B81CDACC1 brant.haubrick
961,951,346 *644C235EFE73519BEC0590C7388BED982BB9B917 brant.hausrath
961,951,347 *6448813CDAE2BC46617D1E2BD9E8D4EEA02F7E24 brant.hogy
961,951,348 *64409CFC664890E4BD10BA2F48936E03190B784E Brantio
961,951,349 *644E709E1A154F17F87E75065ACA4D9129837155 brant.kraig
961,951,350 *644A0AF623D1C431A6B6AA6E1BF7DF80C109C07A brant.laguerre
961,951,351 *644AC0ACD68DA14C807CDD1E80A1F54D6CFE7049 brant.lavear
961,951,352 *6448C6AF23C8C4D5F78E666B03A41EFE01CC8EAD Brantles0
961,951,353 *644BF5037B71ECBCC30E9ADDC7831AA68B521749 brant.madlem
961,951,354 *6443E62ECAECAB7369A891FF2DFAB007194906F7 brant.manfredi
961,951,355 *644A7F1F06939973C30013E839F706FD6D5CC2B6 brant.minasian
961,951,356 *644F64AA7C1C95D92423135A3744F190733A79CB brant.quandt
961,951,357 *6442AFF2EEDD89E14B38FAA23E0A0D18361E15F8 brant.rondell
961,951,358 *644A6644888884F483BF7F202A0B91724ABFADDB brant.schaner
961,951,359 *644CA1256A93A7BC9AF1B04F2C479AAE3E0DDBA2 brant.shurley
961,951,360 *6444B2DFDE66CD43A8F742CA6717B56E69DC6B05 brant.stolberg
961,951,361 *6441686F431B68FC967E3B8FB438DD95F2E61C96 brant.takai
961,951,362 *6443FE3550B06108EF766430D487F4E92E1A01A3 brant.tarkowski
961,951,363 *6446D76132B887AACDFDA9D2F3A5B79AB2A5CEA2 brant.tonsil
961,951,364 *6445C5F06ECF06358ACC937A373361C9611A758C brantuas1
961,951,365 *644EC5D968DED5D60066B9491C5EA5DA51B67D04 brant.yadao
961,951,366 *6447D2A18AE045C95CCCA2CBAF2989102ADEAB44 BrAqo
961,951,367 *6442CC008752AC517043C38D89263028213805A5 braquípteros
961,951,368 *644D6946756D6226876A0F99EF475C31B3C21A9C brarbsw4
961,951,369 *644C8FADDBDCFC69BE28D95FAF8E9B056B30C32D brashnesS
961,951,370 *644151D757CE6AE7069AE2542DAF6DD34D33FFC3 Brasilnew7
961,951,371 *64460C1EBCB9D1ABA49159A58F8749947743893B BRASS07
961,951,372 *64406278B27770D0C685B877F79AFEA16833249B brassa93
961,951,373 *644CCAEE56DA1CE149B85F9E0D16F4514B6869D0 Brass: Let There Be House (Oven Ready mix)
961,951,374 *6445083C419C8097F4315D99734BD9ECCA6417AD brassua
961,951,375 *6445DFC23F4349F0E492843DE99FD47893A193BD BRASYM
961,951,376 *6440BF0372FF970083AC8E149CD44300658C5399 brat.25
961,951,377 *644C669D0CF2D5EC2A82E8691B70C5309E4F0A9F bratsthose
961,951,378 *644B2AFBC71F3A25B52FD704CE75A4C50009E57F bratvas
961,951,379 *644B6DCA255C2AC3F287141F736D3D63645DF4E2 Brat」にて初ロケを敢行。
961,951,380 *6447165885F4A458E4C8BC89B915C696F337CC85 Brauecke
961,951,381 *644195510CB834037348A48EE797D542C93E56E6 braunkohlem
961,951,382 *644DA04FCD4F0C604B81E4C9B3B4AF486F80AF39 braunkohlenplanungen
961,951,383 *6440E3D9206DD8A38BBE0A2BFF8A40EAEF97157B Brautpaarmarsch
961,951,384 *644A5EE209D563E0AFE38918218AF3B307B32C09 brauwissenschaftlers
961,951,385 *644AAB9E604DBCD9F07897043B8F1106C0FE2CC7 BRa;V
961,951,386 *6440549279AD843AD4597BB38C99968F758C65C3 bravaisgitters
961,951,387 *644D9D9B8CEB790B43A940903CE3D002EA305669 Bravara5
961,951,388 *644E0AEF88155E4548D44760127BD88DB85D0CD9 bravehe237
961,951,389 *6441807A072E8C496D2211C9DA275A4B7F60BA33 bravehea5
961,951,390 *644F0C8C9DF75A1C3C993822D29A1F88BFAB2204 braveminded
961,951,391 *6446241770A358C02E3CE5C60EF3407EB932FC8A [email protected]
961,951,392 *644D2F3D78F5A07B1E584CDE9CECC3CB8E0886CC bravermankaren
961,951,393 *644BF2CF58D97F49F93B9B3D392A80E8E3D780EE Bravocos
961,951,394 *64470E652878B1A8B2AA77F8EA51700AE37B5A25 Bravoings4
961,951,395 *644D229618A6EA9F44C6B6A339A90FA1FE883EE5 [email protected]
961,951,396 *6442F21DE4D535EBCA597AB66DC42B374A04894A bravuurinsa
961,951,397 *6440599C1A20FE95657C8427AE8D48B58A9B53CD brAWlers
961,951,398 *6447F253FE452DE6C53F2F1B2B7035F1A1F09002 brawney4
961,951,399 *644D29F31CAB79F09ABF43AE2C3602634FCADBA5 Braxfielded
961,951,400 *6449B88B2E5DC803A8F73EB8558F9D3DC470C6EC braycand
961,951,401 *6446AE814DF2D082AAA083D449DA55EE3DC29A7F brayden854
961,951,402 *6440B6373F2989591F78CD80166368AD66978EC8 BRAYJOEY5
961,951,403 *644958C867E89F782BA972F39B1E266C9F5EC83F brazen-f1
961,951,404 *6448BE368AAE07E86C770325BDAAA9C145E9F98D bRazeNs
961,951,405 *644A066F7C15C3C540C389F2A470B2A2313CCBFD Brazil1924
961,951,406 *644B65D55F17B8BB748F241506C535B017686A38 brazil—architecture
961,951,407 *6448136D58A5FA6BEB2C91103768FC76FE4884C2 BRAZILBUTCH
961,951,408 *644F1D26EC88785C0504D3670BC18C01FCCBB174 Brazilcindi
961,951,409 *644042EBEB4DB50C38810B98228E5FE9E40A4CEE BRAZIL-FRANCE
961,951,410 *644E5069C2610A7A760A5C4037D89EFE6740B0D2 Brazilianite.
961,951,411 *644D8C4C61386AA4C8E5E381316D51E1CE2939EF BRAZIL-PEOPLE'S
961,951,412 *6440F7DBB0EEEA60E0EEE9489B04A78CA6E0C4E6 BRAZILV
961,951,413 *644E437CBF2666AB56D2A9F7623F10962DF50A60 brazzaville_conferen
961,951,414 *644D3407FAA6BCADB304C18079AA8D594D0E7D3A B"R%B
961,951,415 *644EFAA2CF79BC6886A40ADE58D18DAA5CF7D16B BR&B?
961,951,416 *64452049C926B93D33CDFEE859339C61A3A20C8D BRb#,
961,951,417 *64420BEB0BC412391AFA1262F56033650E90706B B"/rb
961,951,418 *6449236371661B042D39BC26F258A61D9F5240F2 BRB2W
961,951,419 *6440E1AF1019152DBB43C82CA09418F72BFA9AC7 [email protected]
961,951,420 *644E8CE55110FCFE5A455F8F0E21392E4A4D73B7 B/rBE
961,951,421 *644BF22EBE1D656B8AC1C65D6B93E3B2D0898270 BRbGT
961,951,422 *644CF3F2E77A804093078537242E184781BDF724 BRBKa
961,951,423 *644019C3A7C652E1F9EC14DBA3CF61C7FC6DB6B7 Brblader2
961,951,424 *64496EA2DACCD51A3A98205297144639F07CF4B8 Brbllrns6
961,951,425 *6445F6E15C90A37780647C872176F701AF113E3D BR-BM
961,951,426 *644E379DD14F304364FA0570B1F37FBAFA6F1414 BrBP
961,951,427 *64453B6B48E37EB454DB7773D10500E9C279447B B.RBq
961,951,428 *64470CB788F8096C6D9FB05DBEA5249E62B49078 B?R%C
961,951,429 *644501B31936138D0308A449828C1C64935CE873 BR:c8
961,951,430 *6444138DC4F4AD3EFA54815145126CA70AC6240A BRc(G
961,951,431 *644463DC894652AB6BB29E94B2BDC4990D086C3D BrCgI
961,951,432 *644803CDD5648CC538C067D8FB7D45CBE71E9CA5 BrcH5
961,951,433 *644327EA1943725194DD116EE6420A3C950B338A brco2000
961,951,434 *6445284B321A535F382D6618810BEF51352F5F03 BrCPX
961,951,435 *644B922D2D49E3E2371AD09AE89564DF49D21933 Brcrtsr5
961,951,436 *644F58905754B6CFEB3A9A52BECCE37C42941160 B?RcY
961,951,437 *6442C4A4BC4AE67D7C1EA44F93E358B396AE2251 Brczqqding
961,951,438 *6444ABF983C627AA6610205FA459466F048A690E B$RD&
961,951,439 *644488845527EAB0AD9D58F9E0E821B094F424CF BRD$+
961,951,440 *6447F12C9FFF4245394B630F0109EB1C4ED498A4 BrdB7
961,951,441 *644C7855CCF31D0C67C2595B267ECCEB6E59EF0E BRDC1
961,951,442 *644E2AAA0C17EA28527C69C01B846CC621618ECE Brdcstrs2
961,951,443 *644AC56EF036E0EA132C56371AB3854037D4614D Br"DE
961,951,444 *644073B9D3FA31B125245490912DB9D3B06DD37C brdellr
961,951,445 *64457AA1F7707EDE81EA646BDE953E55189949A7 B$rDF
961,951,446 *644F808E61659B0FB2B785FB4170D1EBF72A749B brdflovt
961,951,447 *6444E37949B930649A05CB746E5D1698D12957F8 Br!dg3h3ad5
961,951,448 *64406664A121E1F75C8E662680DA17B4CE830265 BRDkr
961,951,449 *644AA74461ED775D19D2355EAA2B363B99353BE8 Brdmbsw9
961,951,450 *6448A82686E99D45908DB9C9EC44868AA048FD61 brdndgr7
961,951,451 *6440F1A613632DD23ECD31D79E217E951B240118 [email protected]
961,951,452 *64449189DB3C31053505F05219D3C474C28E1380 [email protected]
961,951,453 *644F486E92D70A789F3DD4EE8CC99EAE1FF7E70E BRdWl
961,951,454 *64412B33763A88DD46A72C629011790E611F2278 [email protected][email protected]!z!ng
961,951,455 *644AAB706F3AF676F08CD2486CCB61F75F5D860D BR!e
961,951,456 *6441197BA6713C278A5CEA860E03689F79F81650 Br),E
961,951,457 *644B0DCF2E47339D8AFDEBA12CD94D42A2F3EB76 Bre5j
961,951,458 *6447492B0F37D530B5080F026B2A3607A8FCE735 BrE5V
961,951,459 *6446E9DFED3A19A7DBCE64E77E5EC8EA800D2F7B Br+e9
961,951,460 *6440550494B3B7EEC3F643939DB1F8C8F08E3EE0 breacher$
961,951,461 *644E09FC19DF179FD70F74F49C1ECDB02F382CC6 Breadboa2
961,951,462 *64464E702652E7F2691F7E2AC4C8DA1114A5063C breadcrust3000
961,951,463 *644CBBEDB3815637CABBB911ABEBC42383FC3E77 Breadde6
961,951,464 *644B5A8905DDB7D614E0F4974090DD02FC2A57A1 breadlines1
961,951,465 *644B21012761EBA1B371F4FE041451C0F41DC6BC Breadmen2
961,951,466 *644DDC2AA81B192259E9232955CC0D7B9EE7EC2A BREADNESS0
961,951,467 *644F272D042F7C4FAAFEFA460A832B45C85FCDD1 Breadwill3
961,951,468 *6445ADA3FAA9753D276B1191B6BB7FD6E6C15EF2 breakadawn (feat. daniel merriweather & alpha.)
961,951,469 *644028B991890E87625A71853D31CEAEBAD00F3C breakaxe7
961,951,470 *644C2AFDB27CD40564BD1E462C6079D80F6A061D Breakdwon7
961,951,471 *6440BD7361FF7745C094BDB0CC831DAFC468B3A7 BreakfastFeud(alternatetake8)
961,951,472 *644E360E6E589F9CBA71A171DB2793982B2CEC65 brEAKING
961,951,473 *644B2A67A3712015B2A5ECBF118CCF2AF9285F9E breaking-down-the-draft-scouting-gerrit-cole
961,951,474 *644BBA373FD43F07E474F1408C51BA8EE11E3FFB BreakingUpIsHardtoDo/BlowingAway
961,951,475 *6443FE285887E0AEBCEAC719CB53E8BD4D77DE0A breakpoint:
961,951,476 *6449F6645B1DBA36F8767E7D877E403B6C73CDBD Breakpoints9
961,951,477 *64418C9B2379EA7AF1D2DFE4B4B2A921B0357900 Breakthelaw
961,951,478 *6444E47999B7E35CFA2BE6BE3FC929F0383BAF35 Breakweather.
961,951,479 *6442B09C57907BB0A75FEEEC536B34CD2F1ED560 BREANNAM5
961,951,480 *6440D20A1726400D209713257D22F3B5A5823DC9 breannwhite
961,951,481 *644D368C3010418565CDBAB2F77E598160A4277B breastaugmentationbeforeafter
961,951,482 *6448D160B995C20763C709AADC9C64D541606E2C BREASTFE
961,951,483 *644706AEBF652A5D07158AB565751E5B19E7548B [email protected]
961,951,484 *6442CF26C94032AF2D4C1CD6DC82158266D12A43 breathingyourface
961,951,485 *6441B8B73F2FEADDCCE25F82AE0914C180934CDD breathofholies.orgwww
961,951,486 *644DCF225B2A2B20D5E9864382A4DF2927639276 BrEB&
961,951,487 *64462B8E90946CA83D53E65A4FBEAF295B1E58D0 Brebanes6
961,951,488 *64477AC815A2A16FB97F22FB8AAE62A24D60CA13 B:REC
961,951,489 *64470FD646C8EEF89D05452EF7A6100E31D41582 Breccan7
961,951,490 *64460B62E08A8A6DE80EE28A2E41AE6F513D97C7 brechprinzip
961,951,491 *6445A3F3AF091BAFE0ED54A5FF6C5E47BB01DEF7 brechtath
961,951,492 *64423DF14765F88F8D5A75DC562E7017C4B90A62 Breckenridge hills
961,951,493 *644B78619792511E4DC2A1648F632244584817D4 brecktjedinamo
961,951,494 *64439CEE23F41315829F01FEC76E058163E78718 [email protected]
961,951,495 *644BABE525C9F1EE39C80E453238F81325FA9068 bredesen-adams
961,951,496 *644B83EE7B07780594CCFE267F0CF059DCD88CA3 breeanneboyd
961,951,497 *64405BC2A6D73BF2C9DE128170EBA4AB8A233B2E BREED1N95
961,951,498 *64420FB8DF28BCADA369E8772FAA4E48A937560B BReEding
961,951,499 *6447F95EB9B47BADCA3597B6AAAC39295AE1E2AF breedingmating
961,951,500 *644C5F86866A6AF65B6D2E51E826160B29A55ADE bree mcclure
961,951,501 *6447CC10FB37F2A4142B8EF7371F48AB9045B18D [email protected]
961,951,502 *64479B70F5C902CFE64BF53ADB9B57F0AFB65AAA breezefued
961,951,503 *6441A77372DD079EF1FA9F5C2F47B6370EFD4F97 Breeziers9
961,951,504 *6449FAFB4F836E732A218A711F6FA852B4E64241 breeziness2
961,951,505 *6443165C6731E7837755D4F149125AA7609EC7C6 breezy2286
961,951,506 *6444D0A7CF1C76D4B43F679CCD35C56ADBC941A8 Bregante2
961,951,507 *644F00651E39B373E3B2903792122C4450E3E8CE B:ReH
961,951,508 *644549EE1DE4CEB11C2DFE3E63C8482DE05F8CAF Brehedaed
961,951,509 *6440CDE6EDBF23B7820D14623357EFDC33D1670F breibandsspektra
961,951,510 *6443472A49DFB8AD5A89007C7581C917C978DDA1 Breiflied
961,951,511 *6443AC33270B76173EDFA0BA2AD74744E959EFAF Breiktantsu
961,951,512 *64477AB4703037F6CA4E736B454E7F3E935DF6F3 breimach9
961,951,513 *644B4F43CE28DD72FE241F6F0F928CE2EB2463E2 breimøll
961,951,514 *6447D92943C377E0DA2FF78C5D4874EB41757C4F Breischo
961,951,515 *644D08D9799FFA33C4EAB1FD1DAADDCF258F11E8 breisky160
961,951,516 *644D48328D5AB049939D1BB2BF82252BC9F601A1 breitenlohnerBSW
961,951,517 *6443011F61F7CD1D807015276243697F955E87D2 breithornu
961,951,518 *644E4CECDD5B2AF92938E3CF4ACF883BD0854974 breitklappenbroschur
961,951,519 *64487725AFD31840F58C968696518A885FE24D90 (Breitspurbahn、広軌鉄道)とは
961,951,520 *644743476E03F5306E5D7A19C21717498A70AA93 brejeiro3
961,951,521 *644C5B484565013AFF38AB11A304F79F22B13EAC [email protected]@$71ng
961,951,522 *64493F48069A4CA54280E1568DE14CDBBFCA6F6C [email protected]
961,951,523 *64410C7BBD8F93DE038805D0E22719C77A19DA95 bremervörde–buchholz
961,951,524 *644822DD037720904903635B38F683557C284C1B bremskraftübertragung
961,951,525 *644CCC432961A56B4744325FC06480DB7A0608E6 [email protected]
961,951,526 *64471EFD2C6A2DB86C9766B648E9432A0143B4E3 brendaalberti
961,951,527 *6440FDD089E98ABCB333CABAB66107DD163D971F brendafredenberg
961,951,528 *644F11BAC89BEE0A8A91BD281107EA20388D11D2 brenda haines
961,951,529 *6440CE749E2CAF50D7D0608E6599C49DE1E8DFFD brendahaynes
961,951,530 *6440A592A9DE79338894A61F72D9EB31630CB3CC brendajuan
961,951,531 *64492FD85BF933CE4D27DD09253F47413967A8A6 brenda mccardle
961,951,532 *644B113BBA55F6D50E0A3670FE7F2EF9446272E9 brendan.addis
961,951,533 *6446186B41D4E0FAAD73E0D879D5156F30CCBCF4 brendan.boldman
961,951,534 *644BA7D5309B3CCD7CD7F6B4F2DA9228DABA41CA brendanchristopher
961,951,535 *64463E5BF95FA588BE460E1ECED92AA64ED8BCBF brendan.corrice
961,951,536 *644B021C9B780F6A55F583A23884F8D84BDB4B77 brendan.coyier
961,951,537 *644A2AEF8E81B4D857EBF05854080C348AD3411A brendan.crookes
961,951,538 *644D92E5485AF0CE76CCC1EEA7BE97A2A16D4181 brendan.delmolino
961,951,539 *644753D2E570B2BC1DC73EDCBD0C1782D8B10B03 brendan.fujikake
961,951,540 *6443EDA797125C45385AA22B9B5DE86639912953 brendan.gertz
961,951,541 *6442F25A4F8B19D1D67757B14FD09DC1FB40AE3F brendan.hamiltan
961,951,542 *644EE0974F82DAF6BA895B8942A115F90A0F70D6 brendan.hostettler
961,951,543 *644606985272011FF1BC794ACF6C12E9C66D1403 brendanjohnstone
961,951,544 *6446AC5EA9330E9752DD62C8F66F964AEB9D691F brendan.karo
961,951,545 *644F45DD039895FFD20B5E557125B238F8558B5F brendan.krukiel
961,951,546 *644E8216F8A1509F3A4906403DB3576F4B6A9FD1 brendan.ladewig
961,951,547 *644A3B4DD5DB29F05D50D6B4A91B46983E1B2B7E brendan.magil
961,951,548 *644ADF53B1098D76B8F8E7DFCE435755CDC85677 brendan martin
961,951,549 *6448FB8C0E9C98DAE2352496F8B2A6F3FAD66225 brendanmclarty
961,951,550 *644F229CA8AEB3D5F99D9AF78D2BADACC1FD5259 brendan.mussa
961,951,551 *6442FF205CA9AE2A37294F252AC9B459E75C25E0 brendan.ostorga
961,951,552 *644866BE6E33DECC71606DE4975CCE0BCC43E737 brendan.palumbo
961,951,553 *644ABF8F9F6DDE3BFDFFBFF3C229C5462FF77A61 brendanparent
961,951,554 *644C53F8AB97AA6146692C37F469668F680D3E5B brendan.petton
961,951,555 *6442B7D78BFB887A2F344CB73B1B49E548575E8B brendan.rickley
961,951,556 *644E5BA9CA97E3977F493A2670F16AF1FD804D45 brendan.rosenberry
961,951,557 *6447F44B6DF048BC964B180E23F7B545415D05ED brendan.solina
961,951,558 *6443004DFBA56D690A137B09A250A00ECBB431FC brendan.trimm
961,951,559 *644855BA6C51BC9A6E1333B7345CF343A33D875C brendan.volpi
961,951,560 *6446A698856E1812066B73FD3ED4F0015D470F6F brenda saling
961,951,561 *6442BA20A3D5DA9C72FF9B7FFED6C343E418BCA9 brendasteadham
961,951,562 *6440B3BD8243431D719D1AB87F105101AAFF26B6 brenda vanleeuwen
961,951,563 *6444EAE1C76E37C4E0E04CF57097F45915A2DEB6 brenden545
961,951,564 *64400B616BCB2D46BFFB07FFAFC2DAF3D9D85F8B brendon131
961,951,565 *644D16B47C46C431411FE154F4ABA7C84F3A2D37 brendon.antrim
961,951,566 *6441AD79EF79B9C742F247FC354A8A517FDD10C6 brendon.ballinger
961,951,567 *6444FEDAAE315AA2B736FA73F985047D5375178E brendon.couty
961,951,568 *644B08F52AB8E76E7DB730323685C0800F993296 brendon.dauria
961,951,569 *644D80A27E474DAFC7BA7464F019A6DB4897B056 brendon.deis
961,951,570 *6445CCB936398D18B728C34171B2A728E61D13C8 brendon.exon
961,951,571 *64427A6DE0B44B929E30D01FA9DEE7862CEB1561 brendon.goshi
961,951,572 *64481D9AC247FBD9FBE24F9A2574364753BCB35A brendon.heizer
961,951,573 *6445E288C7D895EA14605D933E94438D4F2AF853 brendon.kidane
961,951,574 *644612F0D8B82E80ABDC7756D26B4627D299A164 brendon.kurtz
961,951,575 *644A98E9CD556EBEA368DE5D10087C3A40DB1930 brendon.linza
961,951,576 *644CEB7EA2A0DE1F7F5D4C9D0A904869ED445C18 brendon.loudenslager
961,951,577 *644DECA2D607AAB1715C665E43A8FC3DBAE8F8E9 brendon.mihalco
961,951,578 *6447CC181AF9CA8F8DEC94641C57B1C001606BFB brendon.neumeyer
961,951,579 *644929D0F36B9D0A0A29D2650CD620F4865111E6 brendon.oullette
961,951,580 *6440CADD16F7DF6C9320426A090A8A8552BAD731 brendon.roethle
961,951,581 *6444F4A85F0707CB2E32CDF8C9433B5EC3DD8B87 brendon.rowbotham
961,951,582 *64414814511A26A0B39D5BCB5EADEFB87787D2C1 brendon.sciandra
961,951,583 *644091EB8B835DBEC509651982F6DC82E2212C03 brendon.seftick
961,951,584 *644A92BCAA80CA7888F62A0DA93C5E7B7EB7C9AF brendon.sheaks
961,951,585 *644B4D1BFCEDC3A96D8BE3829741AE1D60464863 brendontran
961,951,586 *64458FD1EC7DC714D58C1646F877414573E2326A brendon.wooters
961,951,587 *644A53CCB4A3D9F36F3F30F44FE0ADE728AF527F Brennan052
961,951,588 *64447956E042E617B3CCC566C3B4F40FDCF6F0E5 brennan pratt
961,951,589 *6444810F95535754D999E0D79D86EB193C208687 brennan-tyrone-can-stay-at-the-top
961,951,590 *6443B7FC981B34D624920E9647BC8E03A4B38950 brenna riley
961,951,591 *64451D14A2C1D160656A8467609DF22EF2FCC49B Brennen059
961,951,592 *644C7DB87DAFAC4C1B3AD6682123148AEDE55C90 Brennendere
961,951,593 *6447122AF2B79E7008A8F55FEEC957DB2FE65130 Brennhausen1681coa
961,951,594 *6445AE601CA7BB9840CCF8222EA56F87D534D849 Brennson0
961,951,595 *6447F9C6E0053F8E9680CB27594354069781F8C8 brent678
961,951,596 *64419BCD3ED2535F4862FC1A77424A8D7B05AF06 brent.barrer
961,951,597 *6449CE46B2E0ACC252EC86627FBCB62A9D168376 brent.beebe
961,951,598 *644E234A3A43B9844EACD51D43FB214034936BC7 brent.beltram
961,951,599 *64486FF5093A8CD4B36C053257428179069B025A brentcoan
961,951,600 *644B12E87C549DBBDB5BC26734590C93148D65CC brent.cohlmia
961,951,601 *6447FFE22A8392AF0596E5568CD75191CA3205B4 brentfordsir
961,951,602 *644677F3E8B72F04A05DB5CDC7670D6FB3868C99 brent.georgeson
961,951,603 *6446E16EF072919458CC44C9AC09E2A63569E4ED brent.harkleroad
961,951,604 *64452ADC73BC6680469E7B6A27B6A7A0E2C15238 brenthentschel
961,951,605 *64474CBA0B74ECB645F1276769DC56F16290F72F brent.hitt
961,951,606 *644FACAD1D9244EA4D5133328E963BD633C2C53F brent.howles
961,951,607 *644D42EBB78640893EDF3706194736EB2E5ACF87 brent.kalloch
961,951,608 *644965A2F217A651A5BE0436A1147E4BE64C4AFD brentkohn
961,951,609 *644D98F76EED6371C7EB091D5D2EDFAA208E6926 brent laughton
961,951,610 *644BBADDEFF016BAD6FECA12E392FF93005A7334 brent.manalo
961,951,611 *644993AD1E9AEB21BEB1780503FCC7594A827274 brent.maski
961,951,612 *644422E66175A3CE6D34FB3168C02F95E7A31BFE brent.mcerlean
961,951,613 *644B233AAC726177B00C10253D5B2AC573D51C75 brent.mithcell
961,951,614 *644F8ADFACA41074862FAC682BEE63404B9FA936 brent.nygren
961,951,615 *64437B6DCD76E2610C5479B8A9995D056468EB80 Brenton488
961,951,616 *6447DA9A617CBBDC136978FCA2EC9FB090A01271 brenton.czarkowski
961,951,617 *64489C0BC6BF35F646744B6B148664420DC9E7AB brenton.dibenedetto
961,951,618 *644E637F844A1C55DA8E865D6424F83511CB147C brenton.fandrich
961,951,619 *64403632DA857074C960FE3793D7126BED94962C brenton.fulmore
961,951,620 *64410A695F7A3E2E4EA0B78EDBBF539B71EC5C47 brenton.hallan
961,951,621 *644EF1497C622A18BBDC2032186BFE34D238C38C brenton.hantula
961,951,622 *6440526B15B5660EA8F3A6DD432C633A2523D1F1 brenton.kalland
961,951,623 *6449F57833B90175BBE8B12D6C890227DFD49C90 brenton.kristofferson
961,951,624 *6444B5439D02BB75374099DB91D185A02177F3E6 brenton.langton
961,951,625 *6440E56CB2C08B8C531FDD73B8D736B189CFEFF3 brenton.latif
961,951,626 *64451842E2EB29AAA207620E60E11E6C9E59E8E1 brenton.lerma
961,951,627 *64422DC3CF1D9AB101F3AB960AB2C120252982BA brenton.marksbury
961,951,628 *6445CC6E31575BBF6D18D8EE484C6C1603B5A455 brenton.mcclarty
961,951,629 *6447C88BA7A8AFE530FD7E8D933AA1393163709C brenton.meinhard
961,951,630 *644E252397FDD4321ACDEE36A4519933036F76E2 brenton.monticello
961,951,631 *644F2657F8DEC31D145C1D11BDD4E860AC3EBE6D brenton.murrain
961,951,632 *644BB439471A84DCEDC4F80C857AA422EB7DB3EF brenton.packett
961,951,633 *644008169630C7A3F9032DB47C70B75ADAEC84E6 brenton.rucci
961,951,634 *6449BE49358FD3CF919A561D9D8314232E950913 brenton.rutana
961,951,635 *644B9F1C03B56ACE6ECBB1BF7BC51CF52E6EEE8E brenton.saulnier
961,951,636 *644EAABED3D999A5FC77DBC8D281EA7060A10DB9 brenton.sawdo
961,951,637 *644A0AEBD9885B3289A6EF99090A88C7CFF8C9D6 brenton.schonert
961,951,638 *644B8B046EDC1DF4887428C090C5AB340893816D brenton.swist
961,951,639 *6443E7727E228B14A2C3BB8E7EAFF77EA38D41A8 brenton.trio
961,951,640 *644F95D3CB7511FFC98492AD2B1F5627E6C88C3B Brentrelling
961,951,641 *6441134D890072A9CB078662C6AA43E3685AD581 brent samford
961,951,642 *644F920BCB64AAD3E5DB2874AA0D72B17D095B02 brent.shimko
961,951,643 *6449881E38CD7499BAB9D6069E9D6CE115C40CD1 brent.stratos
961,951,644 *644404BF15A4504542F10F3747FE1C5112E58A5F brent.vore
961,951,645 *644F70280923D3E3DD879B430DDD23AC74DD7206 brentweil
961,951,646 *6443CACC272822F41749307EEE5624D752A15765 brentwood signers
961,951,647 *644473B98AB278D58C7035518CDE9481E1029A95 BreoW
961,951,648 *6444BE95EFBD1DB48EE6FC9AEC62C09356800E89 breretontalkbrett
961,951,649 *644809AB09ACC07E269D58F4132FE8CF5642BE3C BresenhamsLineAlgorithm
961,951,650 *644F39B1CD846E6F2F3EE8F1253310CC8D5E33AB bresill0
961,951,651 *644390AACFC2A8D73CF5CB75ACF9463D04426CB4 bresjen9
961,951,652 *644BD3EFD6D2203BF3A0FF6804078D48299C5F5E Br;et
961,951,653 *644B6F38DE233B11BD61E479AA1100C9D3D0BAEB bret.badolato
961,951,654 *644863A90D0FF7FA69C4D40FC548CE55C3715A26 bret.bernoski
961,951,655 *6445D7F86F83C8EF11C9021FC8293B36AA86FDDC bret.billigmeier
961,951,656 *6449638F8D369945B99E961BDFD3EED230D6501A bret.bones
961,951,657 *6443201C6662BCCA951111C03701A804DC4BD886 bret.cardamone
961,951,658 *644D975C6ADA678C3748D7BD279DE506324CB448 bret.deaver
961,951,659 *64427E85A7169E17813AA90F0A973AE20C53EC7F bret.dhamer
961,951,660 *644033C222945D133D3A7F4A21F7443F7265F418 bret.esposto
961,951,661 *6449D3F2163B9E507CB646D3488979951A92526C bret.ewoldt
961,951,662 *644B00C14D156A84D61C80B02D2DB230F3F6151F bret.ginnery
961,951,663 *64477435FC885C9D035FB8F16DAD9BB205D542EA bret.hermus
961,951,664 *6443A044B2D5A0629B9C7B8510949EFAF6311A3A bret.hoeffer
961,951,665 *644B105E32D6C21A3D4B6FC2E896792B53C76C9D bret.hozempa
961,951,666 *64423B24991DE8CBFFC59503E6556C23F204C12A bret.ljungquist
961,951,667 *64437D962FF3BA3D68DE352704EBDDBA23C043F0 bret.mcgeehan
961,951,668 *6440953B63A844826488CB988EAC88047B84D647 bret.meidlinger
961,951,669 *64403042A5E43B0F81AFC54E0FF45649CC4F99B1 bret.mikkelsen
961,951,670 *644D8D55A80A98EA2792406E87E28982E81EDACF bret.morlock
961,951,671 *644272CB941781A3136768B3FECF3BBE3803A9B8 bret.niemann
961,951,672 *644A5C93D4EE583413F4182F7A39849C8AF605E8 bret.nietzer
961,951,673 *6442373AFD568A61116E672C3D36D77490683BF4 bret.nikirk
961,951,674 *6443D2DF385B6D011ADBD737988F87025D13CBE7 bret.peatry
961,951,675 *64439C9629A2CEDFDD850EC33CCD240F7BCF134A bret.prag
961,951,676 *644932873F8DBE9A396B5ADB9733A9147D7CB9DC bret.scowden
961,951,677 *644FDC30208476CE7E960DB65991783CDAEE2668 Bretselling
961,951,678 *644C75DBE5B2472A6BAC91AF0B713FCB82B208D7 Brett11
961,951,679 *644B4F1866C5504AB294CFF0765949CD9C74E0E7 [email protected]
961,951,680 *64490DB07057E90FE1406EB31FB5D2964AC55C9F brett.aldaz
961,951,681 *64420EE938D8358985F4282A358E0D7C38018D17 BRETTANY69
961,951,682 *6445174955CF7B221EE873919E350F111D2BAEBB brett.birkenholz
961,951,683 *6449B49DBEF10922430515F264F2D700EB627617 brett.buchanan
961,951,684 *6449E200525E621B88CEDCCF6492FA03C0D59521 brettcann
961,951,685 *644E18440A320E97FF1D39B2249BA8F286E1639B brett.catenaccio
961,951,686 *644697BE6DE49157C8BD3612A0A23BBBBCEB08C1 brett.comiso
961,951,687 *644040C988F5FFE09816AD80B66F8B725C68006B brett.conable
961,951,688 *6446696EE01A2AB243B34CC76961B98EF3229D53 brettcowell
961,951,689 *644A5527341CB9455B65E25AB6EC60FF8870B50F brett.crosson
961,951,690 *644AFDE504CA778688560A7E0F200F29D526FDFE brett david
961,951,691 *644ECB1F247884B871F78FA91DB55E858F588187 brett.debarros
961,951,692 *644AF938D51A786D9D8CD6D019F07D5B111646AF brett.doeden
961,951,693 *644A675CC4886AA109E6DD0EAC3679E8D386F1AA brett.falwell
961,951,694 *644751C7C82060698A907ED2D4FFC014093DA393 brett.fay
961,951,695 *644FE0506ECBD665B8D11ECF64D1AF04C48AD362 brettfcblkbi123
961,951,696 *644A35F623955A2F2572BB8C840920DAFDAECAC7 brett.grech
961,951,697 *644609CBBD5A4E953C48ABBBB38E7E18453C5FC7 brett.hufstedler
961,951,698 *644AADB9FE24849493607DBD290B1AB1E60A64F2 brett katz
961,951,699 *644332FE4CA47F5A92EFD43A9029EECC704B6956 brett.kenneth
961,951,700 *644DF85CD7B6BFCB8BB83E907668B491B32A3837 brett.kesselman
961,951,701 *6446C8CA688A80C409778285865110A80066611F brett.laguerre
961,951,702 *644186EE49843F1EF1388B174992A23BE4C78D9A brett.maalouf
961,951,703 *64451479DCC37D18ADC24A91C60370CD2A18B3DF brett.magraw
961,951,704 *6449F6B5F4274377A9594732FD3028639FF24CAF brett malin
961,951,705 *6442ECE8EA21D50568C1B7AA38FEBBD284753BAE brett.matice
961,951,706 *644AA53ED73A3C74834236FCDA830024AE83E7EA brettmusic0410
961,951,707 *64457ACB755B78F3D359EA8BD027DC27AF6E5EDB brett navin
961,951,708 *64486BA24E556820A6498A220143E151930AE72C BRETTQB4
961,951,709 *644EA96D93DB512CA36ECE6C217D2232C58B497E brett.quincel
961,951,710 *64445EA584D95249C4E82152EDF0DA04C986910A brett.rhoney
961,951,711 *64400DCE962CC7FCA0365711FD80395DAB4324FC brett.sondelski
961,951,712 *644C1A3AB6E3CF7F6417899E5ED299B53D1878BA brett.stewert
961,951,713 *6442FDE3C7D6649CF1305CB5D034B5C72416B174 brett.tubb
961,951,714 *64402B088882D3FD59E79F20A86DF3E93021B48E brett.waxler
961,951,715 *64496C4E40EA36725CE142EC5275C5CAB64AE1B0 brett.yokely
961,951,716 *6444C2DD4148541472BFF1D8848712D1D9C43254 breuerdanny
961,951,717 *644578E0336AD95C554AD17FCE05F95B7F7278D8 breuilletons
961,951,718 *644412ED556F93FABFE1F02FA27277F66DB76D18 breuilom
961,951,719 *64431FCB2D48C2654C5F36A5A69D0637F621D146 Breukdee1
961,951,720 *6448B6882E5DB1D3D46E3D494D514568FBC12365 BREULJKU
961,951,721 *6447290AD36065A47ACE1C0BC5E35B4365DDC2A6 Breve77ing
961,951,722 *6448882AC02FE6F741A63B46F15C5350F9B8513E Brevetons?
961,951,723 *6444D83F12CC68A43C3CA1CD466490D7986E6487 Brevettano?
961,951,724 *644E5E91B8B408F4D914750B4D0FA904B69ABF43 Brevipila5
961,951,725 *644B02CC2A8249C914232D42813A2DF0D006726A brevititilana
961,951,726 *644DA70382D86F212A761AFFBE531985AC5871FD BrEW=
961,951,727 *64496043A9B39DE20CCC7EAA81F4D3F1FF70138D Breweries’
961,951,728 *64408D9FE06D6D477FFF83124888B3733EB69EDC BrEwI
961,951,729 *6445B6DFFC91197F17CB7D11E7856177E2F8FE91 [email protected]
961,951,730 *644E60FE9A2CF5EC66AEE4B189A8BBE6F9AD7A18 Brewstershirley
961,951,731 *644F8932B7906BE7F8F114FF16E41D9652C3C43B Brewyers7
961,951,732 *6449012CA357FDDECCE32251B7D29DE3631720B9 brezeanucarmen123
961,951,733 *644E8CE52D3C18CD3D583E4778E1F5FABF89EB6F BREZHNEVILISEN
961,951,734 *644D6D72A39CFEC86E59CD6C488F6F3841B8B246 B!?RF
961,951,735 *64438E6903E1725E86B69DECD0E79C22C3F9E518 B<Rf
961,951,736 *644FF48E382669B986055B53BD57ED1F85B2C680 BRf
961,951,737 *6444C46ED0DFFD8A3B9A6A05E30B51C9F8023425 Br!F&
961,951,738 *644187B51959DDDE2DE7AECC469E8762FD282079 B;Rf0
961,951,739 *644B87534751E560E5205C0B41CF2E05160C2CAD B/rF7
961,951,740 *644C6C907C65EDFD636C1BBD242B050556B18BCF Brf%9
961,951,741 *6443B4F4DB0E1A5B25AE9DC21FF9F056AC1792FD BRf+a
961,951,742 *6441D7DC5663A9F1FAED9A17A0312B1A989CFBF8 B,rFa
961,951,743 *6447096410160776C3B3971223598AD621C1202B Brf_R
961,951,744 *6445AD3C02047D179D38B19481A8C784E6FCB97B BrF,u
961,951,745 *644751E0A4EB7BF5C5B0123F0A8EF27656741A0B B;rfv
961,951,746 *644FB9D3F5108D257D85FC93D5B2692FB10D4320 B$+RG
961,951,747 *64412BD4394AE722B4BE7BFB4ABB8780FA242635 B%RG
961,951,748 *64446EB96533C5463337CF0F53F5F76281CFD72E B;?Rg
961,951,749 *6447E154BCCEB8DDC760F8A8F82762F9FF686185 B$Rg$
961,951,750 *644E42E23177A5BA52B8DEEB01827107D34057EF Br!G:
961,951,751 *6441EE7402C0961D385B66D7588D2D8429FEAB3F Brg5j
961,951,752 *64431290166FA16C59CD760DA3457CE33F42FF77 BRg6-
961,951,753 *6449AE6F04AF04264BA5576E7B2D4E2A36A5140E BRgG-
961,951,754 *644C67C1889C913E3F8A1BA79A6B8C574CAD5038 BRghW
961,951,755 *644FF83AAAD93BC46125BB27A09DFCA3AE57FED7 BRG)M
961,951,756 *6441A7700D0A22472EC7A606EB8DE7000BB07F81 BR$gQ
961,951,757 *644AD2D3C3B5C7D20DED7D1116643D6214285E35 BRGQX
961,951,758 *644366B672B46224D1F123FBE65471F5B393225B Brgrstts5
961,951,759 *644E8C1123EE400441C257513F0FB7C60010BC85 BrGrU
961,951,760 *6442EC6CD7DDF39E625515E39EBE318B8CB1F76C Brgründung
961,951,761 *644D22BA4FFE5441F98326ABE585FDA4F9A67D04 B/,RH
961,951,762 *64408E0E895D4C1BC68F6C38395B98FB37221605 [email protected]
961,951,763 *6446907B62F466FF3AC9B06AE870F8086B0A19F7 BR)hM
961,951,764 *644DD33601645C365273C3C79C852C3ACD1CC13C Brhmg
961,951,765 *6448306291A1EBDA49503B01BCE536EAB5310414 BrhMM
961,951,766 *64490F12178B5BC16DE014ECB9A83C5CCFD5EC03 BRhQf
961,951,767 *644D5633D2DF45014FE605C1788B94F18CCF87E1 B!R+HR!GH+S
961,951,768 *6447A16D969ABBE8DCDDD8C1597D38F2865516B8 BRhRH
961,951,769 *644CC20BD7BF0117A7DD445D6EB18B3D872C498E brht097
961,951,770 *64421CEA927E744AD02E6F87CE6BC80F8108113F Brh%V
961,951,771 *644DF6594EEDE95BDCF020D021AD35730263B032 B=ri_
961,951,772 *644C88327E0F074D62F423430B92E6E95EC6D729 bri11i4nts
961,951,773 *644D8383D170F6F1273A5BAA26128EE8CF999CB5 Bri2/28
961,951,774 *644FD2D25E15678430728F5539E74816344E19FC B_Ri4
961,951,775 *6442A9A24612E3C50E22E5BCA05CDAD28D1593F8 BRI62
961,951,776 *6449EF61B709D13947DB67259669355E55EEB729 [email protected]
961,951,777 *644F17EB472E3B3076306FABF60B8B90CA61ECCC brian190
961,951,778 *64417836D62C66DCAFDCADEE034EB0D5509E3E18 [email protected]
961,951,779 *644A9116689DCF74562D13328951A099B4EBF73E Brian55
961,951,780 *644988940E03D6FD71ADCDD7F53583367A622DED briana barresi
961,951,781 *644F7CAAA1520A088691E9CF411F4455F7D0A869 brianadammsp
961,951,782 *6443E2BCF71C2712944D1CA6BE5DAD6ED65DBE7A brianahayes
961,951,783 *6447A1638ACE0D0AA9F7E1089B014EF746DB52EB brianaltshuler
961,951,784 *6441EAA648C8404F4F6CB01767A3B51639C44F99 brian.amonette
961,951,785 *64489BA662E8B37F83D6F1087A1472F8A9F6ACAC BRIANBEYT
961,951,786 *644CFF3DACEFD824297258E42531A73E62D82948 brianbollom
961,951,787 *644EE03C97FE93620D60863EB9E4372693CE0FAE brian.bonardi
961,951,788 *64409869BC0CF77B7BA2DEA8D8955B763556053B brian.bushorn
961,951,789 *6441825C862A3F6928D352CE166AA469C5E70DEC brian catlett
961,951,790 *644B42313E641A85744B3530E4626B4461F2D430 brian.cherrez
961,951,791 *6440E0D88A89DA83FE5D2637E043B10E11E18C4E Briancl
961,951,792 *644BE5D4E9E43F5491898E126308174460FEDF77 brian clavijo
961,951,793 *6445D508DF90383B9EEFB7846088E343896A481C brian.colling
961,951,794 *6448FF5BC499969E8E3B0D360B0772823423087A brian.curameng
961,951,795 *644556AF9BEBD38A701810C0D837EB3A3BE6E430 brian.dehne
961,951,796 *644F3FC7EBC0C51F0A5B1686E931740B38D3AD19 brian.dial
961,951,797 *644DEB280B73C1347A3519C4843FF47AD6BAF6A5 briandowding
961,951,798 *644BBDE796B557088DD9BA0A34D1592FC719B438 briands6
961,951,799 *64427D29579ED5FF1AA09EF321EDBAB959AE8C16 brian.dunmore
961,951,800 *6443C45EE8C5E04FF6BD260EFB0989C5723F86A7 brian.emberton
961,951,801 *644FA6291C57094904D76923B3631679D99559F1 Briangabies
961,951,802 *644CC1739C464DE90BBEF03707A80C698AD99EBB brian.haggen
961,951,803 *6445254B503B31E17E4597F0940400CE118E6DBA brian haybarker
961,951,804 *64422B629F933B9AFF14AE31DBB0E25A495AD212 brianhibberd
961,951,805 *64415A9D9789BF9E87C8E82D5AF6B808271EC5F7 brian hinckley
961,951,806 *644CDAAA35800D5DFB320CFB3A1386B82B4A8CDA brian.hincks
961,951,807 *6448AAAF01945EE158480E7BCE72534A2819B4E7 [email protected]
961,951,808 *6447B1A1BE77CDAABB9773C8B1CEEA9C3DB0CFD1 brianhoar
961,951,809 *64476E6074C44C397245E0FA13C537F4E77037D0 brian.kamler
961,951,810 *64498081410608FD5563BA662A3C4F89336E6358 brian keiner
961,951,811 *6449FEE5C8006AC583ACD56AB892CA1EEE284448 brian lesane
961,951,812 *644CC8BECBCD4410690CB02C999AAA6A66AC8AB3 [email protected]
961,951,813 *64437E58992C8A4AE8CF614B35A1382D751BCDD5 brian markes
961,951,814 *644E5EEE070EFD50851A90FFCEDE62C7EA03FB45 brianmasayon
961,951,815 *644EC5A67E455DF4C57044599AFCE3EF9B3157D8 brianmcdaid
961,951,816 *6443D1D149173D2BC1447A008D324C0DA48554E4 brian mcgrade
961,951,817 *644E56471ACDFEC74CAEC7A6DFEA0441617F6547 [email protected]
961,951,818 *644AC696466215295E15CD1ADD361E1C2EE901DD brian.munter
961,951,819 *64469FD9D2AF2BF00005D1942E2264D8449F5936 brianna foote
961,951,820 *644C52730F3002DE15A598005C459DCED1CCD278 brianna wyatt
961,951,821 *644070DCCB408092487DC60BD922EC6779889AC2 BRIANN'E
961,951,822 *644C5998B8902E127085299553B6652635F1658A brian.nonroe
961,951,823 *64499BE872017955CD750A77FD9ABCF8A51A51BD brian.perico
961,951,824 *6449A6883FFBE3D78054D4CF4E164AA2632D3E41 brian.picerno
961,951,825 *644D06425D3A4D92EF9A060D27CB0024EC11081F brianpruett
961,951,826 *644638187EC628E7B2C4B237441766CDF7D8F914 brianps101
961,951,827 *644D18989642AA4E1460E3BD2999088959FB87A2 brian pulk
961,951,828 *644F608056204EA7212DAFC2652EAC4B87B0F747 brian.pusey
961,951,829 *644E78F56055C649043FD8A8C72EA9C0999A6E9E brian ramirez
961,951,830 *644B12ED5D5114FDDF2BAC12CEB4C8B02DE3C8FB brian.reio
961,951,831 *644D9086252CB7134E463451E3C6979C8D93A625 brian.rybowiak
961,951,832 *64459C3BEBD1B9313DAF10FC76E8F1A1DBEBB5E5 brian.scarfone
961,951,833 *644A916CDDA0BE1E25F2A2B7090074AFFC8D1F4E Brianscorpion
961,951,834 *644BA57FBF30F602306C2707A13878226674C723 briansharratt
961,951,835 *64436B6EFBACF7F4D37F9CFFA31B3F914DB6E278 brian.shintani
961,951,836 *644661BE740013BBF2007B515A6994CC9266D820 brian stacey
961,951,837 *644C6170DAF599C7631B7E32C4F200384A89A2FF BRIANSUNDAY
961,951,838 *6442B997E15484BEB578D855223A75E274321043 brian thuo
961,951,839 *64435873632CD0C3E1705B06727EA5BB48D552D9 briantimbers
961,951,840 *6440ED9BE44E58DD37D5F266AF40ED86EE5A0156 brian troutner
961,951,841 *6443CCC3DA8178F4E0D8D7CDD07B8452C93E5285 brian.trowel
961,951,842 *644B1ECB5A9FE09541C2A065C1552DC21FC3E122 brian.urzua
961,951,843 *644D0A9902A3DE8E4DA70A364D3F49F44ED1BE84 brian.winarski
961,951,844 *644FA7A0B9A659C97C6642FB35F0F38CD14AB917 brianzabiblioteche
961,951,845 *6441E2B90B57549DF41D1E5BD37E81446C33002F Briard769
961,951,846 *644ACD8A87657CC5124EB88A560E4140CB1A2E49 brice.albarazi
961,951,847 *6447FCCADD34DF7A74E0F21928D2387FB8D311EA brice.cassone
961,951,848 *644B2B15E069413DCFA73DBA5EF2D3235745C4F2 brice.castleman
961,951,849 *644FE377A89A797C8B0BFCC22C25461B4DBB0CAA brice.churley
961,951,850 *64495BE2D70B75FF1B5B0F803EADEEE79DE961AE brice.dalporto
961,951,851 *644A04807B73E0DBDD74D2E32B12055F30BEE899 brice.denlinger
961,951,852 *644E4792250FFA0A96412B9DD96156D76B4330CA brice.denmark
961,951,853 *64499B4AB2A1EC5E73AB73973B10CEB97A64EEBC brice.eull
961,951,854 *644C30B38092EDCAB4E53FB17B76EAAA84601D02 brice.farness
961,951,855 *644D9784539A6FF2883EAEBE252B11E651742755 brice.fleurent
961,951,856 *6440DDFAABAAAC2F7C50D217F4006939BA8E76F5 brice.freeland
961,951,857 *644592FF26DE224EB31F43EADF1842BA40B1B147 brice.graft
961,951,858 *644434214E8414BFFB24462C4A69BAB0DA7D1246 brice.gruman
961,951,859 *644BC306FC693ABCC5B51EDF3E3AC3E0371C1BD6 brice.hamberg
961,951,860 *64449192FC6DF17C9693BAED4331E41BC9E517CB brice.hammerstad
961,951,861 *6445A1BE1225625C53F3ED421ED34B1C355281EA brice.mounsey
961,951,862 *64433E3FB11566EA3905F3FC1A85B0294FEB0F42 brice.piacenza
961,951,863 *64483BA22A446B6DAF89E1375FF909BF0282A863 brice.rincan
961,951,864 *644205F643D9A9C4D5270FFC97A44CCB23602532 brice.sing
961,951,865 *644E2F55A9F98FE2A22B83B24504B93326B21D3E brice.symes
961,951,866 *6448B0F5B7DB31981AA50DF9C2DCF4033D5C2F64 brice.szuszkiewicz
961,951,867 *644A63A7B2C1148D543428C02788CD7225DA327B brickdelay
961,951,868 *64447E1A2A01118E0D1DA84ED03D5992856717A7 [email protected]
961,951,869 *644E89E9A07F289F13C57856AD41CF4EBA8FEC9B BRICOL
961,951,870 *644536FAADD138EDFBB65F04FA29D5780E79D937 Bricquebétaises
961,951,871 *644D5F823B2516D774E7A19F8C5D442E52B153F4 BR_id
961,951,872 *6445342AF0522ED99B7E125B38AEC800B1846F5D BRIDERIONS9
961,951,873 *6448C658CDC21E999C60229A591885589E265636 bridgend_rfc
961,951,874 *644E853A2F1C20F36C77A69EDCE9DF12FF42E9F7 Bridgeppp1
961,951,875 *644B43079E91E621FCF8733DA720253B8AFB9723 Bridges696969
961,951,876 *644FE5AD299F75A35785B5828D37726306C05298 BRIDGESMOOKIE
961,951,877 *6447BBEB34A47B3C9A0FEF6EBA0FA8FED2E4C804 bridgestokky
961,951,878 *6449D107B792333C46AB7A8A17BDDD834297E3FE BRIDGET05
961,951,879 *6441529756312F7FD185E3DBBB1AC5B6D9DF20DA bridget monroe knight
961,951,880 *644FF20A3C2969DE39391B546EC4E3AC8EA96E4A [email protected]
961,951,881 *644FB69E551D73EFE30347FB3FCF999C8661FA3A bRidLING
961,951,882 *6443E01C5B6CA6B1BBAD1B9DE31E671ECEDD6ECB BRIDZS
961,951,883 *64438FC0C402DCB6FA939B603FC0B6A0B4DD14AB [email protected]
961,951,884 *644AD740EB0D7432D7EB195A917DBFFB987792A5 BriefandenWeihnachtsmann
961,951,885 *644421C7DA5C09176A803DCE918DC37722D9D334 BrieFInG
961,951,886 *6445EFC12F410E4002E678ABF474F931C7C378DB Briefwegers!
961,951,887 *6444443005D250E9F6CB3D47CCB29D66B7D30407 brielsurbarse
961,951,888 *644F3C79DC1505AE41C0F4D0098F1775118E8D34 brienburke
961,951,889 *644E16AD8D39A08165308BD557B0B27191E8E508 briests5
961,951,890 *644280EBC7EFD965E849D48C1826DC14B9B43D2B brievengaarders8
961,951,891 *64475808AF84D5BDE4ECDA094D5722B387A86462 BRIEVEWEGERS!
961,951,892 *6440FB403783B13ED0B51BFDEE5F4DBFD851DC70 BRi$f
961,951,893 *644B52ECEF0B527A8F83E3034B3B25628E393AC1 BrIf!
961,951,894 *644C01F74765B19093A9C83719A75691F02F16CA brigadaret
961,951,895 *6444D0097D39F460A6D93C2652C066336ED87CC5 brigadescanadian
961,951,896 *6447E05EC8B98668559131EF734E07C561D86023 bRIGAeQf23
961,951,897 *6445BCCBC8E48E2D7BC3420555BC497CA9A28616 Brigante$
961,951,898 *644587E35AD8A60CEFDD20FEDBBB7E089876D16A brigbi20
961,951,899 *6448F21410AA34E8C642BA35F9A31C1A1C8487F8 briggsian7
961,951,900 *644AA1287E0B3034E82F9BF6863443FD8676A6B7 Brighidin Ban Mo Store
961,951,901 *644834ACD953435DD5F85B2804E3B279C94589FC BRIGHT912
961,951,902 *64459B59EC0CA1BB3DC06D4531795E238105A486 brightdaysinwinter
961,951,903 *6443580681A6D76FE32401ED476AC99383FC5D0B Brightk1
961,951,904 *644A496F6ED4C3E98636D2AA9819605489402C08 BRIGHTLY-BUTTONED
961,951,905 *644AE230AA892B91A982A40E48612C6EF2EA6725 brightnessoflight
961,951,906 *644812F9037927451279BAFDD173DE96D471084E brightstar(moonlightoveroceanblue)
961,951,907 *64437871C6E40A31E752E0305DAFCBBDB783D749 brigitte huber
961,951,908 *6449F19000ECF22315DF368627911222970AC906 brih-
961,951,909 *64415D1DA5BACD9B4BC04D2FAFBE335CD78B8223 Briiget6
961,951,910 *64462E72089EC4B5EBDAC72649C5CBC7D5E6BBAE BriiS
961,951,911 *644EC3B23F1994E1664C74A0E3DC57929E1A628A brijnens4
961,951,912 *644502319152A519827D0206F2D7FF8AAD1057DE [email protected]
961,951,913 *644F06E408AF2681BCF6A4DDDAF9A0DC86E919BD Brillavi5
961,951,914 *644C79FA422A5D39B1C0CE5A9EBB16D9EE95FA33 Brillehuizen7
961,951,915 *64463C2A8A8CD2B5486674186AE4A3A55D424F4F Brilleses9
961,951,916 *64428B1B3BCC78EF9333525AE4E221516728D4B4 [email protected]
961,951,917 *644BF3668119B99854699F090625DD8141ABF915 brilling3r
961,951,918 *644EBE7025A6380D89E26B80D52252343A78F6B1 brilunding
961,951,919 *64409762F41F73A0B9AA072D559FECC797234B29 Br$Im
961,951,920 *6443C6FFB3FFE361D4D9E5E907F2BE64FC2A01A5 brimangr
961,951,921 *644E150CAFB7AE02FD0EBC5D85C4A9238B4C7D8C Brimat
961,951,922 *64461968B9FCC4005861F8BA2E118BB8B4FB53A0 Brimful of Asha (Norman Cook original Full-Length remix)
961,951,923 *644F2E6B6282251D983D389F20574D3001692089 Brimmeli
961,951,924 *644AD4A3B04ECD118B288865316EDC12DCF761F0 bri mondragon
961,951,925 *644C6496E2224C12E90B5A80B0B2F96656025350 Brimstones innere Wende
961,951,926 *644E84E13A706EDCEFAFD3BF1FFCCE6606268F82 [email protected]++IN3SS
961,951,927 *644AC897C616722249DA945C665691DA0F4FD237 BRINCENI
961,951,928 *64472228638D23ACA08748414B359248F1DB874E brinc
961,951,929 *644DC92EBDE8863A995A60547BE5960A27E57039 brind4v4n0
961,951,930 *644A9C79416D3ABFCE918D5BA66BF28B4186F473 brindasse8
961,951,931 *64499F8CE7A7F55C55BD3294FD43D15E6483CA40 BRINDLES5
961,951,932 *644129D629D228F26EA2B1845875834DD77BE24A brinell
961,951,933 *644005417D54A1502C1193672286A55584DE3F17 BRINERJ
961,951,934 *6440307478A17574D673875A8DFDA409759DA2BF brINEs
961,951,935 *64430BBE848B6EEA594BFE25F963643FB0F7D5C3 .briney
961,951,936 *644CDE2A4C42781448517ABD95A45E9F3DF963D3 BRINGER-MEYER
961,951,937 *6440476927930DEA24F9C2F073903AA9603810CC Bring forward
961,951,938 *6445B3E333E34BB540F395A963D2A61C3304BAD6 Bringham1
961,951,939 *644549A59642AF426A63D309AB7ED5510E6DABD1 bringiton(solarcityxl12")
961,951,940 *644C5F76A036B875B631A4C31EB803DDAE1B6ADE bringourboyshome
961,951,941 *64462D789502A3BBDEB336DD1320ABEC966FE1AA brinmar8
961,951,942 *64499C44AC053FDBC2FAC71306CA6FFA3615BFEB brionday
961,951,943 *644FEF1EC9C2F535F0A44D3507A0994A5C6175BA briquínies
961,951,944 *644F39BA0B0317CC4A33967B234325478863CDE3 BRIRUTHTILL
961,951,945 *6441665D84A6E71ED5BDC23591D2392A64EC1033 bris71i3r
961,951,946 *6442F4529BF4D7063B08D1B96E9CB72A996780C3 brisa838
961,951,947 *644EA77D5A7C6B6B6A3FB92B13A4BD3B6FF4677E BRISBANECORRIDORCARATCUSTOMSHOUSE
961,951,948 *6443827CC91B4D1D3366698038239A87A743C060 BRISBANEEXPO
961,951,949 *644D4D06F7FE9597F291CCD56B718DD0F15260FD [email protected]
961,951,950 *644469D29916DA7CC24ABD35F3AF8242AC0975FC Brisiezs3
961,951,951 *6445D5FD845F44F9FC5343A757D65D90F430A16C BRISKULIN
961,951,952 *644501D35F6BAF39634501F1A02F52FEF42539D7 Bristear7
961,951,953 *64473C4319C331A368A2C6F2BD8D4455EA396289 brIsTLED
961,951,954 *644E39720C16C6D4C0B77ED95D7BE6EC2E2A4D06 [email protected]
961,951,955 *644CDD78005EA826B497B669472D10F58B1100E5 BristolRock
961,951,956 *644D89C974FB643C5DA4012D442B945250F17B47 bristolsw
961,951,957 *644BD90EDDFA11085D5217335345A5A1440B7ADB Briswizze
961,951,958 *6446F9464EA39A577909BAA6E97E371A570BF90C BRIT1015
961,951,959 *644B9E1C426FFB66FEECD514A1452D6095674ABC BRIT1995
961,951,960 *6446ABB3892D64FA0E08EB25F431D22B020FC86C britainsorchids.fiel
961,951,961 *64464BE05281F1BD65D0B1E89A5C9633257DCBC4 britaintalkliteratur
961,951,962 *6440D2F042620BF2EABD32C088C29005705219F6 Britaniyada
961,951,963 *6444D5DB47BFEAFDAC28BFFA94118DB5A1239E77 Britannicus5
961,951,964 *644993E2908D8673E3CC938CFA88C704BA2CBC0F Britannionem
961,951,965 *6447D8F695B9659A30B1791A7FF80BE2F8D39ACE britena2
961,951,966 *64421D2E36D5E9352C774F9E0F60E5D122AF9B63 Britille3
961,951,967 *64483BEB313F5B0F3851331CC474E0149EB946A9 BRITISHERS3
961,951,968 *64485C37A3C9BD8DBDAB273197C8A314695418C3 britishirishmaltese
961,951,969 *64444EB94EA316B0F68BA0CBC35DC119B9F9028A british.john
961,951,970 *64425E0BA931410ECD275FA6F9ED229EE08BBC44 British
961,951,971 *644A2192097F0BFF00A0786FC20A67F7D26BDA75 BRITISHSURNAMES
961,951,972 *6447E498F253B16EEDB23FE4B4F6C12AFE6B060E Britishto1
961,951,973 *644AF0F14E7A73982CC2693C2805532D4BA22653 britjames
961,951,974 *6443AA48B735832106E137329A3265C3966E8C4A britneylover45640
961,951,975 *64403881D21FE98A850ECF7443E891D97284647C britneys-circus
961,951,976 *6442D661CA2AE7EEED0321DFECA6D26D46D1FEB8 BRITs25
961,951,977 *644846666D1B56DAA165DBC269FF30F4B5043113 Brittanyasconstableof
961,951,978 *6442AEEE759B41605C6CFD7270F2A2CD10B6868E brittany lollis
961,951,979 *64452169C4453DF3A410F74855A0A78E79019A4A brittany nicole cornelius
961,951,980 *644FEAF9423C409AA98017A10E5B9B312743DC9B brittany rolle
961,951,981 *644380A109869DE7729F7E11DC51C9C9EBC1148E brittanyv32
961,951,982 *64465DE657CE328C4D733F0D4F21C4032E220E13 britt.berlinger
961,951,983 *644213B6745261D9D29DC01E939A78BC5A52A120 britt.biven
961,951,984 *644E51249640890735C74DF9E847DC196E9E73EF britt.bodenhamer
961,951,985 *64466BD30F4C65005167C064DE9E863F43FCB8FC britt.bonasera
961,951,986 *644153727B88AB5B59AEC886C21802FAF10C8B00 britt.bribiesca
961,951,987 *6445166DCCC3D29EDEA636F515AA671409D3F623 britt.coykendall
961,951,988 *6440CCE43A3A21D32EF64B8E103EF777F3180E96 britt.delgadilo
961,951,989 *644F9DEC11E7572ADE2655A5E5CDAE03F458854D britt.galban
961,951,990 *64489563F49C57FA8851F8D3068E42732C66EE53 britt.horstmann
961,951,991 *644809C29DBE52B212820349A051D8EB7ACC99DF BRITTIEN
961,951,992 *644CDB7D1AB3C857D8D6C64DAA959F6C02C05087 brittifumesse
961,951,993 *644388B4269FEAB2782F59B1EEB38E1B2765888A britt.jarrells
961,951,994 *644A5C5C8E66A41FF60C9C1263FF7D3CDCCDFF2B britt.kuroda
961,951,995 *644C952A6100DA2B12DFAD319DBBAF8FF7EEA7A9 britt.lendt
961,951,996 *644C4334A025515EE34345B9BFC34168824FC69B britt.morcos
961,951,997 *6449A07D6CF4CF900AFB43AB39497D38B57986AF brittney harmon
961,951,998 *6443941A104E6EB9B511E23464F76A67AAC8C22D brittsauve
961,951,999 *644144FE889061BCB54FAB48439C59176A26AC13 brittty
961,952,000 *6442A91011E73C55ED85793504318B9BE4D9059B britt.witherow
961,952,001 *64406FA5E61BC27F93A5860E9395567960360312 BritWres
961,952,002 *6441CC973EC415A15F2EDE88197F55ADC501818C brity-rostovsky
961,952,003 *644D6302CE07C2A6C525500DF260D19B37BE22C4 BR(IU
961,952,004 *6444C07CD94B5D447611C6663790A3541D32A7C0 BrIWn
961,952,005 *6449311F9EC715EBFF2060B2B6C2651ECC94BF01 BRIX&
961,952,006 *64425F42E5F42EDB58A4A3305E1C5E8949716A69 BRIZu
961,952,007 *644694D8F24EE8347F1B5872841483A35CDEBB60 Br$$j
961,952,008 *644B71D0A4AB4F9ED05F8E25B405D16F788F279D Br#jB
961,952,009 *644A912FAF7F8EFB731048DD7064813DCCC40A23 B,Rk$
961,952,010 *6443F5D0D995478BA12469A39AF11F0E70843537 B-r;k
961,952,011 *644D3C6A0D8F8154968C64AF5BA919BC1C45A5E5 B)r%k
961,952,012 *644700F604B4A2C8951C2AB3B553CDB4D955C8E4 Brk.)
961,952,013 *644B98E683050DAB698C23D3D94CFD6FFA063F65 brka160
961,952,014 *644EA34763EE7FDEB5C5F4C48BAE2268088FD66E BRKAX
961,952,015 *64485853929E8DF0F733159B02F33525A0B7D9E5 BR!Kb
961,952,016 *6440A526418F0E120B5F89BB38D786C513F01169 Brk?g
961,952,017 *644A15A649EF8CE80DC13B2233B955ADEC0F5E94 B
961,952,018 *644EDBC6A5A3FCBB46CD70F7219F98C0871274C5 B)RKj
961,952,019 *6445B262681949A31DD7C1076B9E87FC670BC4FA BrKj-
961,952,020 *64492201A61109E6D1E5716C9218B9E62888C7B4 BRKNr
961,952,021 *644E37E7B303002D7D7E488DC1144C46BA190821 brknspur
961,952,022 *644A23559C17F98E448580A8FB900428E3C11148 brksr
961,952,023 *644194D056455C61BD6D87EBCCD28841133B9666 B?Rku
961,952,024 *644DD527D4CB8DD462F383416E17C3AA2F4B6DA9 BR.!l
961,952,025 *6442EF03EFB3CBEB282CFF988734C108DBC91355 B(!rL
961,952,026 *644EAFEBA203A61F13A00B6FA57B363BCF393148 Brl$.
961,952,027 *6444A8EC26A3188B5A571B6ACFCDD7264423B57C Br
961,952,028 *6446C51C9315B001FAA0C5AF4312A0D9BA446D47 Brl,A
961,952,029 *644550C2109A26DFBC01AC01338EF760D4A66FEF B
961,952,030 *6446422E534E469D72082467B781ABC08F81B578 BRLJEVIC
961,952,031 *644F83DEEF3CB5B79AB9DB92881379198D426778 BrlQ=
961,952,032 *6445AF1567FB43D796AD5EE4B430B61DC7BC369C BR&ls
961,952,033 *6446EAE58A3312BD1D182995C8A5C2D484631150 BRL-SLIM
961,952,034 *64447C916AE33CAADC8B4CAEEDB0B7F0F1C934D6 BRlwV
961,952,035 *64441AE850869278F5468AC5FC2DFD494F5A3C3F B+R.M
961,952,036 *64442372B177F2EA0EEBCE115A000B32642B983A BR_m&
961,952,037 *644B1D5D7322B6B2B59EA14753092F325CC59521 BrM_:
961,952,038 *6441170E7FEBFA7EA5A64623106115DF9EEA2B11 Brm:&
961,952,039 *6447877D5BCB5D8324936EBC68FD09E1C2BE6D85 B-rM1
961,952,040 *644046B77B777096850FDE0A768ED6D064B117CC BR:m2
961,952,041 *6440239F40BEDF77F53A24041C9E99B9CAAF2E6F BRM2l
961,952,042 *644FA71DCED3EB3C11B378541A3A92B675373E53 BrmaT
961,952,043 *644E50298BA3B3100F1FCAFD5E9430651629DFE8 brmc7532
961,952,044 *6440F54BAF6F66E5EB03A6BE623FBA2B64C95FCC BrmD_
961,952,045 *644EE83F2C78702CBE88596278CE5A0112DC9446 BR#me
961,952,046 *644A42FBD17949FA846FF06C529355769ECBF461 brmgazks
961,952,047 *644141754EB895E8AC0C5B133AD399014C28BE78 BRm/i
961,952,048 *644EF7639B607E609BF0B7D07F9E0197D804B694 BrML5
961,952,049 *644E2FFA18D5E9928A56C50766962FB6704E28B6 BRMmn
961,952,050 *64475C1E03494217938CA8737214A1E410088972 brmnsch8
961,952,051 *64430332154960037335BB8D114286703D455DE4 B_;Rn
961,952,052 *64411CC79E0AA0AF94117467A723ABAFA9736F17 B:Rn$
961,952,053 *6440A90026219424E532DAE1B4BB3AC54C1693CB BR&n+
961,952,054 *644423C323E0A3A94D58DDC4022EDF35F97B30E7 B$rN(
961,952,055 *64473EF5895BFB310FEF3C9A65CC2EC1541AB420 [email protected]
961,952,056 *6448497355BC4180A1CA20BEBE1A11819B9B107E BRNDFORURENINGENS
961,952,057 *644DDF11719E842A896FB8DA4DC0E3F020E2CC4B BR=NE
961,952,058 *644900D705860B59070D08BBBE38B3B63375849B B
961,952,059 *644FE230C1E863FE92F8949351BB374C6D53B3C0 B
961,952,060 *6440133DFB9F39C92DC116A95ACD43A357FA0D95 BRNESKO
961,952,061 *644BBCF251299134EF64288664FE546018ACF218 brneyegir
961,952,062 *644F5BA77502A6A51EF251BEF2EE5CC0DA767642 Brnm(
961,952,063 *6447D13BBFEB26F35CEDE5405DD7F2B2CBEDAB86 brnnnmts3
961,952,064 *6448FAB1DA3561672ACACA73B31EC3851F8141E6 brnotalk1993
961,952,065 *6440D64A71CE865E3C2E1F66CA81C3773A629F46 BRNpf
961,952,066 *644B046D650FFDC01A23A71798D64E9433066FE5 BRNR$
961,952,067 *6443CF15E0D0404E4CA2C028D8290984339FB300 brnrbdrs3
961,952,068 *64404AFEDBFEC46748C85262BF320B85748B5950 Br
961,952,069 *644AC8A4693F6DE35EBFDA40620D7B992D8E585E [email protected]
961,952,070 *644E966E49633EB529F96E4867C170DFBE74E64E ˈbrɒnteɪ
961,952,071 *6445699DE84559800ABE722C86F66EE25475DFBE BRNto
961,952,072 *6442D089AA57058F865E736B96A58FB13FA2EB44 Brn?V
961,952,073 *644ABBE3B28D29B546E5CB8BF059592A03748028 BRN:w
961,952,074 *644D3FEF77482B56C93D14016693C221352B452D BRNYN
961,952,075 *644F10342B7786AF490B1FE91793D41C080E9FBE B")RO
961,952,076 *6442DE0BBDD5D96E7204DB154A7951484749D7D5 BR-+o
961,952,077 *64448E7B242D04D3CDB6BD89712A6EB8259ADB63 BR+o:
961,952,078 *64459AEC7F546B2CF6503AE75039A82ADD4C39F2 Br?o3
961,952,079 *644B93BCD55EA0DC9AC9CC6DDC5F35574A1473A3 B)rO5
961,952,080 *6441B5EE3083EA81B23B613778B495C482F90390 Bro6I
961,952,081 *644A9F967A57520DE70FC3BC9B9377BF473E846F broadca51n9
961,952,082 *644AA513483D59C0D8483ED59FA23384F4CACED2 [email protected]
961,952,083 *6448A2CB553CAC4BD0E071220003FFD689BCF83A broadloom carpet
961,952,084 *644B8F6EE0814594C225C923806F711EB35F7D98 Broadnaying
961,952,085 *644E21B3D5827EED12B0CE04885D9CE4112A0F77 broadripplebrewpub.comwww
961,952,086 *644EB86ED36010F8CB57988CDCC29C96D835C6B8 broadspoken1234
961,952,087 *644DB10B7DBD4F92E8857E82AEF758F4B28F663A broadwaydvdcover
961,952,088 *644DFDB3D11DD779234643A16360E1416D222540 broadway-short
961,952,089 *6445C36ED4754A2519DAC4CF63E45E15D4EFB0E5 broadwaysys
961,952,090 *6448B49AF0E9A58AF68D54644035DBBBAD0DC004 broadwickt
961,952,091 *64478931A77DB8D6BF0549A1FE7B92F7ECD182A1 brob3rso
961,952,092 *644A0E485964495534ED598D5E12F612855242F1 brobert7
961,952,093 *644F0CB90C80EE3F869B720F922BFC220A59CF0D bRocadES
961,952,094 *6441A18C8B899C421D6E8D32F7E93D3E88CCDDE4 broccloid
961,952,095 *6446A6BB58ACF89DB916E9BE60C20D02E37243D3 Broceso2
961,952,096 *6445B094EB0609B19952BD069585F1D97D649526 Brochured6
961,952,097 *6440D1718460FF2DB4111499480EDFD0B5ECC43C brock44
961,952,098 *64492C15EDC261F0B318FB04F069692CC1D4558D brock.amith
961,952,099 *644BC634231F29643561E864BCA3C2B7612D3C2D brock.bennick
961,952,100 *644FA10BDE58C9B68918942E9352A75D18898347 brockberry
961,952,101 *644ED6F25E9EC84C6DF65DF6398D20F07DB96350 brock.cicione
961,952,102 *644E1DD3B641D02676273C9DDCB43CFC0A92FE76 brock.curby
961,952,103 *644BB49FC3682DFC23B40537557828613BBA2DA2 brock.ehrlich
961,952,104 *644EE598B04D4C5855F35698B40497F0E8174D6A brockelsdorff
961,952,105 *644F22C32354F14ACC7D5F255F9142E362B301DA Brockenhaust
961,952,106 *644B0C0E5B16DD417F08A183D13592A5FFE2CB51 brock.fredicks
961,952,107 *6442001F9B0C34080C262C46928FBB6FE0FA61D0 brock.notice
961,952,108 *6447547661C17803ED41B687759CBA48CCF96D54 brock.panzarella
961,952,109 *64421CEF0A4244C47419780555136DB0EE43C338 brock.patchell
961,952,110 *6444D24622393C0AA45A8F6BA7D55EDD1DB87F61 brock.prosper
961,952,111 *64495315A57C745F7BC6360D52C7C0744D999061 brock.rhoades
961,952,112 *64491750341CABE5AB42EAD6359C8B6FF5ADA8B7 brock.romaine
961,952,113 *6443B7AA1AD4D867CC6FE4568E35DF523C434B6C brock.seuell
961,952,114 *64433CB37EFEDDB4ABAC76DB69C1B5FCDA53C7C8 brock.shelvey
961,952,115 *64430BAE34B2A1020BDBD0796C2FBA5845BD95E7 Brôco
961,952,116 *644C8C8270D66CDD62AAE4F7F89628A209893FB5 brocolli2
961,952,117 *644F2D8FDBE432DB0A1CDC53261CBD18C0082F1C brodbroding
961,952,118 *6443B707E9350B94AC0DD415E5EB5252CF8D9BBB [email protected]@$T1NG
961,952,119 *644447AEC9FA0BA71B072490A369318E201522D0 broderick.carasquillo
961,952,120 *644B82D14E88776292A3251ED0357ED97C403D2A broderick.carinio
961,952,121 *6448C0177B92D56DBAC3C0C8316E9A4F7EC598F5 broderick.cavins
961,952,122 *64420779B0B63AFEC2DF3B809B90D286648430DE broderick.chueng
961,952,123 *6441B7F152DEDEC96907C8FD9DA5576020B32F20 broderick.gehrig
961,952,124 *6449770D188856AF0D92F857C9EDC2FD7B61845B broderick.gemmen
961,952,125 *64400C42C5BFFFCC5B8B757B00A5D56D756D8049 broderick.gregson
961,952,126 *644009D3AC980879D023229AE336E4515BBF8B55 broderick.gutmann
961,952,127 *644C2547E8E0B8E2AE4902F34934FE3B1C957A6B broderick.haisley
961,952,128 *64424B12D8DD4FC04925090271179128B7E971CC broderick.harsin
961,952,129 *644DD019B41FBDAF1CDC6690D75C3BAAF7842B03 broderick.hawthorn
961,952,130 *64442A1E2C51FAC4C85159BF19923F44E2372623 broderick.helfer
961,952,131 *644899D7871FC4AB38586D12369C8D4EA65FF626 broderick.kershaw
961,952,132 *644FA36896FFEBF0A610CF3F59B436B485BA140D broderick.monden
961,952,133 *6447DAAD526129657D76FF09FC93C62F984FCEF0 broderick.nases
961,952,134 *64473FDF1001F6E865B5A3EB97DF3D2C41DF25EA broderick.ponce
961,952,135 *64449160A2021FD45B461A6F33E112ED5A7DE57A broderick.pultorak
961,952,136 *644E0939072E5171DCB00179CA84A22A3737E3A9 broderick.veiga
961,952,137 *644C1511CBF91E666BD710CEE1485E17DB0FB11A broderick.waldrep
961,952,138 *6442548AB04349036F6BE4AB3886F04AB4EE473F Brodeurned
961,952,139 *644372BE32318A56C91E4D7E6E7B6A5E87E65DFE Bródí
961,952,140 *6445EFE9F1F980228A39A48952A163E1B8FE5CD5 Brody911
961,952,141 *64441A354409ED09BEF2E466496C181E1FC786B3 B"roE
961,952,142 *644358E2A43CD2F625AF0DEE20F0A05C951AEDAF broedreactor
961,952,143 *644A2429A63763F106935A8EC820F35ACD2066FE Broedtijds
961,952,144 *6440AED59C677C5D8DC17061728A50806A7AC6DC Brogan543
961,952,145 *64468E615EFECD69AFF1CD4B8E96B25C4BC87880 brogets
961,952,146 *6441D7007AB7A7C1D525A8841072493FBCE0E8A1 [email protected]@phs
961,952,147 *6448B679260234E27D08D375C208D3E4250AE6CA brohtoning
961,952,148 *644BDB4258D813CFEC2064EB94FA6646CF1EF444 BRohw
961,952,149 *644001AA4A51EF7A9770B8077254F68EBB6C6213 broileripata
961,952,150 *644C10D221AD5ECF226EE34FE1348BAEA5E2AB0C broiLErs
961,952,151 *644A8D59B61E7F050484367F1CFBD3D10384B6B3 brok3nm
961,952,152 *64404E53281E09C0C95A93D3E4F15B1A2B8ED514 Brokateg
961,952,153 *644E1A393D3EE43DF1387E88C5201DA194FEE98B broken constancy
961,952,154 *6441FECB1E7696B4144F52C8B8EF11C880B078E8 BrokenEvil
961,952,155 *6441F7F3474719374C5BB6899BE24078B32BC094 Brokenhearted (Soulpower Groove mix)
961,952,156 *644CDB08F004AB59A8F3FAADFC1245B5AC768CEC Broken-HeartMachine
961,952,157 *6448C89B556DAEA9388D30848310DE9F3511EE53 BrO(l
961,952,158 *644633A23E49873A268CA3573B028351C9D809D7 [email protected]
961,952,159 *644EFBBCC079BCD3B32FCF08DFD8945FB0567076 brollosson
961,952,160 *644B7F4B817288AB67F2699E0B33E16EBCCA2821 B&ROm
961,952,161 *644B08BE485BFFA7888F27DBE3070CA15F9D8E17 [email protected]
961,952,162 *6444D8C13D073E2D34ADA957ACD4C03EE1226563 bromine 'br/oU/m/i/n
961,952,163 *644BC9C25C3109254B7DC9A9A1F72E61958AF377 Bromley7
961,952,164 *644419F58268CF85B073F1627FF2F65486E72FD7 [email protected]
961,952,165 *644D9821D99EE8C928ADB19CF10C8CFD7467EE14 Bromsverkan
961,952,166 *6446627F54E2F75E7D0E74D0A1C524D2794305A6 Bron6350
961,952,167 *6445C0D6907A9B9840705BE4C076C4C4CA460311 bronastodobno
961,952,168 *6445CCB2B5B7FF8EEF9A081E713889D8C9515BB9 bronceamagda123
961,952,169 *6442EF5E0AAF895DA626D01BEBA3173D53A0DF5D [email protected]
961,952,170 *644E49D0D9FA9D90D08DC98029E0282041616FBD [email protected]
961,952,171 *644097B90376D90ABF1DD83061C20D7EB76D7EF6 Broncholithiasis6
961,952,172 *64450B943C89A9DC0E805D56D94BEFFE708C71FF Bronchomucormycosising
961,952,173 *64428EFA60A699FDF0CD6E10683451E052CD8FEC broncobustered
961,952,174 *6443160BD152B4FB945283CF7CAC10FD535D6AFC Broncosdustin
961,952,175 *6442575932ECF0FF6342D7F3585DA029A8D3E969 brondós
961,952,176 *644F09A48AB9C26556BE1C0B550785D20B17A958 BRONDUKOV
961,952,177 *644A13269A9203FE173EA4B7829002EC7E8E2E4E BRONISLAW?
961,952,178 *644BF113255BFB438F52B8F35C6DCAA8B24CC664 bronivka
961,952,179 *644C590A24D1E0BDAF8835663CBA1EEC6BCBAC84 Bronnenopmaak
961,952,180 *644A4EE90DF87486B33951C90170CC93FCD86136 bron+olai
961,952,181 *6445E29F9D0308DFB3D5D6F2047FF928C8CC3276 [email protected]
961,952,182 *644C4FB6DACBD41869758CC7DA48B191D091D66A Bronson137
961,952,183 *644BD5C6FCCFCA59A69F469AA270F6C5FF13F619 Bronson589
961,952,184 *644BD8ADF42314B6CED9A0DDB27B07BE7D215158 Brontesq6
961,952,185 *64450D5981F84E5AFB525793FD615C85EDEB9A7B BRONTOLA8
961,952,186 *644636959EF394D5931FAADAF55BCFDE1DC382D2 Brontomancy
961,952,187 *6449A5E96B133239BE6E080725BA86AC3DE32DA9 brontstopford
961,952,188 *644C7643FABE1C30156F518E55A39C20DDADF71F bronwate8
961,952,189 *6444A2CC0852F26F74BA1FC292A2F52B7825FA61 bronxstage.com
961,952,190 *644789864F122FB55A21FE6503F19D10C90C44A5 bRoNzed
961,952,191 *644D796C42C3D73C44740D1BD37C69A653B55A7C bronzefarbige
961,952,192 *644227F2F6FF64BF267829D9B095984314C11D88 bronzeflecktaube
961,952,193 *644D86BDD4812BC70BA8ED65AAFDDFE8C50D527F BRONZEMOUSE274
961,952,194 *644B0D66E9394B62AAA99CB2E389652775C5BE37 BrOnZer
961,952,195 *64468E6EABC47948EFEB9BFD3E8B370F9B81B49A bronzi35
961,952,196 *644294ECBAD5C77E9582C7C345D59837299B4999 bronziškos
961,952,197 *644F1EA9CEAAD4194946677452E9E664B5759152 bronzra
961,952,198 *6445F7B3432A45F27D2B755F228251E3EAA39FB9 BrooDED
961,952,199 *644D6F1A09506F4CAE95CEE5C267D45E445A32ED BROODTROMMEL0
961,952,200 *644D15AD3745E6D719CEBF92D9A5F20E17C4CC92 brook anthony
961,952,201 *644311C61092D4C226BBF9CEFB49C635866DA5C4 BROOKEBABE
961,952,202 *644F14474830F3830E40D9E837FDDEB352673E65 brooke liebelt
961,952,203 *6441978CD69280C197BA83B730FB1936011AC170 brookeredding
961,952,204 *644178720632E3B577D52DC7BD60210D8D7EE110 Brooketristan
961,952,205 *644E4F9F3DF8DB392E3D1B7F81CDD3C769D53C21 Brooklyn692
961,952,206 *64447B6FE0EB14A7992A45B6CD981B0BC3ED9B62 Brooklynn582
961,952,207 *644BC54155582B455A7F46764122B6218F4B05E7 Brooklynn67
961,952,208 *6441EB63883A5E66C9121AB3F1123A6138381383 brooklynsaint
961,952,209 *6445B0B2E2DDEFA896F0EE561C98B34738398EDD Brooklynu“
961,952,210 *644D651A9529DBB7A284680BEFFFFB7DB9A5360F brooksailor
961,952,211 *644CD28C91689D9E6596C0919BCBF3741FFA4C0A brooks.athearn
961,952,212 *6443A840CBCB98693461D26CF65598D4C1CD7BF5 brooks.ballina
961,952,213 *6446AA48E462F31738E5C1B2AF78142D9766083F brooksbartlett
961,952,214 *644172802115A44E65824585D4625D98EC5460D7 brooks.birkland
961,952,215 *6440D9C03B57231E10CF5488560EAA3DE2F19794 brooks.buske
961,952,216 *64404915B2AA99D7C7D25185076227BF30E31819 brooks.butzer
961,952,217 *644B2ADB9F8B3B2255623D14F909352B15633313 brooks.cragg
961,952,218 *644D327D658F34CE6CE1C0CC994BEC482E430A81 brooks.daichendt
961,952,219 *6440620B2BC943403D430E08D0B49246E177B28F brooks.edmund
961,952,220 *6440C30350FD8D574F61AB5364664C3B09FB3DE0 brooks.engelhardt
961,952,221 *6447C2AF088193A338A06294B175B73586131BA4 brooks.ernspiker
961,952,222 *64473F0F0C073A286A0ADF29EA514EE83E4A2275 brooks.eversmeyer
961,952,223 *64401926EAB38FCE557B20936788D415D7F074AD brooks.gasquet
961,952,224 *6445CB20B0C58E465DD463356C7F0F6D3ED34CC8 brooks.gerwitz
961,952,225 *6442276DDDCC34286E850DF9ECF37018CD75D871 brooks.hakimian
961,952,226 *644BBB3F3227A3CEB448BCD5C0439EE164682523 brooks.huffstetler
961,952,227 *644C9B1F56B8EF00FEA98AF1DA9D4F7F540604CA brooks.hughey
961,952,228 *644F027EC75C0D8370C00EA1CD81CB5CC4110ABC brooks.maruscak
961,952,229 *6442AF1541F4061C253DD423C32F5F90BD930A26 brooks.orazine
961,952,230 *64491F2B91CD11E959EB88A87BCBC2E480D8CBEF brooks.raber
961,952,231 *6445AB4A56AC643731D619BB4A0E1DA7B97FD436 brooks.resper
961,952,232 *644DC3ED1E0F56B845A063C284ACEC80F89FA975 brooks.sandusky
961,952,233 *644E7D664BEDBB95D2B192251E15CB243C32EA0C brooks.sepulveda
961,952,234 *644EA18CD9C2EE441C5F11DFDF61750ABFB21E27 brooks.sleeter
961,952,235 *64475B5CC36D372081486A087C62083AC021B51A brooks.spyres
961,952,236 *6446C3687BB29126FA20AACD71B1DC18AEF147F7 brooks.stackpole
961,952,237 *64485D53D0C1ACAC12D9908538D015C12BF463E7 Brooktorp
961,952,238 *6449030041705123F0950167E1574C3D72F94BF7 BROoMy
961,952,239 *6442B7446E243256640128C14E7D740709206D30 BrOP
961,952,240 *64459667911D61B46D42E23C1C17A39C230AB1A2 Br&oP
961,952,241 *644C2DAD0981DCA75B41E81C5129F8CC6BD66A08 bropasseren
961,952,242 *644877A16112F724328AC9600A0EAB4B51778551 brossais5
961,952,243 *644989B90916EE45FA3699BB96C1CF53AB61FD69 Broszbsw8
961,952,244 *644507A288425A35C46925B84D0A85138ABB48D8 brotadas6
961,952,245 *644DA52F5C6E46E0FCA059EED7EC295B60139163 ‘brotar
961,952,246 *644FF772FD6EBEF10AA2DE298F9198B916F9A308 BrotAufStelzen
961,952,247 *644A793A41D500D1FD6AD7C36692BEA59638140D BROTHER-BY-MARRIAGE
961,952,248 *64428565E07D52F00697BDA1CB7E9CE7D0E8273F brotherhood)。
961,952,249 *644CC999DB7AAC3ADAECAE52C58DCED750318AC3 brothers--the
961,952,250 *6449149ABFE4811931880D8B4BD231DA5FE0F163 BROTH'S
961,952,251 *64466D2C9DAAAA22F02DEE19CE4B5E88B40C8A10 brottier8
961,952,252 *64481DA3FA7D3AB1C4C657F89DF113D787A1E8E5 brottsutsatte
961,952,253 *644405D9728B5E0AE648F9657CF4233C1A75B585 broughe0
961,952,254 *6442A32CC55F6C5013EAAD67A7203CCCC721EDAB broumant
961,952,255 *6444A6C1B67DEFE169EDB0D8DF657AB0DEE0B147 Brounalin9
961,952,256 *644061A82DC20B7E4A0DF8E627A8156123140D83 BROUSSAILLERONT6
961,952,257 *644E0C21175366A4B4DB926F3057CB10711704AA broussardsteve
961,952,258 *644C61433CE19D04B74B7C9F4F9C6CCBCE78C898 BROWBEA+1NG
961,952,259 *6440620A587DD033B7DFE309EDEBB16D846B6472 browda01
961,952,260 *64459456024752242D49E2DAF839D94F463F7CCE browegnA
961,952,261 *644D11997393944DB609E8D8C640B84A883F87BB Browis9
961,952,262 *644C422FE61073F03C88BD7A51AD15F74E0E0466 ´brown
961,952,263 *6449FFC4033BB864F1B736C6165E27A88FAFA740 brown-appoints-ministers-english-region
961,952,264 *644030CE1157E9C8F51BEE4D5EC688D6A06D9567 brownbearindulge
961,952,265 *6447AE2A524D6A2B3E3311A63D6E7C9F4107AA7B BROWNBO1
961,952,266 *6447C56F7BCA476543E300867C8AE55D409E1471 BroWnED
961,952,267 *6444F13B4240E787977A47BFC1F654117756D025 browniecake34
961,952,268 *644FDB3D9430DA3EABF3B728972BC85846085650 bROWnIER
961,952,269 *644CB968FEFD609BC98778629370192355317AE4 BROWNiEs
961,952,270 *64443CB91514568BA372D74B6D06C07C1AA8A4B2 brownlee.runcorn
961,952,271 *644BF69CBAFCDBD1488B2F667F8A6B2318B57051 brownrope6
961,952,272 *6447320577B7A06EA1CF81712807E9184BA6A59D BrownSimpson
961,952,273 *6446A9432DF833127FD5256330B59D04B5AF93CA Brownston7
961,952,274 *644297C5876E33B2E051AEAA2D4A8AF390185EDE Brown thrasher
961,952,275 *6447D3DA903BCF349D02D593ABE39779F1D5F368 BROWNTONER
961,952,276 *6447EED6846103333FA02EC4410DE61EA3AFEB7D brownwoo5
961,952,277 *644AB2162AA88FEA0E09046B41B1AC2C3BC25409 browser708
961,952,278 *644AF7D1F75A1076AAF69ED73958250FFD087B32 Broxobsw2
961,952,279 *6445C9EC740512D84E04AC07F7F43444F42F2182 broyais.
961,952,280 *644FF990332670F1B5B76DA5A31F4474FF8A76A3 broyalcreed.com
961,952,281 *6441C6F99212A09492061CA5AC09DAD95F0B9F0C Brozovic7
961,952,282 *644F710333023E7902BAED9EF6F7FB7F229E724B BROZZI
961,952,283 *644A2982C9C54A973F0506C3ADB6BB41EFE187C5 Br:;P
961,952,284 *64425FE22A2A96D43D8CD172F05135E9657EA0EE Br(p2
961,952,285 *6447E9709F6CD1D5B1F3B1C2771E14F5AFE77BD0 [email protected]
961,952,286 *644C926CB83253641DD970E4889FC6EC05A91A37 BRP8b
961,952,287 *644B4F8137961F0156CE1B035858F91C68151DFD BrpAs
961,952,288 *644994CF664C723EC75A20F402F29E7693C94E43 Brpdc
961,952,289 *644CC9667CC7B84ECB3F10EE789E36BFF042D05F Br%PE
961,952,290 *6442F714379BCB011242E286A861C6E581826039 BR_Pf
961,952,291 *644AFC700684DEB29B6D0E7A2B65DE711105226D BrPhA
961,952,292 *644EF8873FC1AF6911B6A47502479FCA160D75CE BRpHk
961,952,293 *644235CC576AA26B65E79363780E7D80EE3F5F5F BRp(n
961,952,294 *644AAC96C0F1FD9105743BF1A993FADB9E061672 B,rpn
961,952,295 *6449E64F18508FA1FBF612361ABCAFBDA457F37D BRPQ;
961,952,296 *6447C8D3DF375B67A442269A3CB7BDB0DBB1B733 BR=q&
961,952,297 *644FBDACD4D0B8DDA13D24453AB31E281054AF46 B&%rq
961,952,298 *644D91D9E267B5D074081A704064C6C2C9F7A8CE brq2yn
961,952,299 *6444649C8D39FF7FB0997B739E50E5C109753B93 B)rqC
961,952,300 *644E21004D3F50CACE559B7FF55200BBB7761A68 brqdford2
961,952,301 *644D8BA892A2FCDC66287E7FEFCE4D2D69B6C155 BrqiA
961,952,302 *644E88E07BC1441F17D0DE60649511E86CCA1033 BR
961,952,303 *644A12AC4A4613AB56BDE48FE3791095E3F8468F BRQTc
961,952,304 *644C1C8E7E9D26AF05813477E355F002E4FD868F BRR$$
961,952,305 *644AC3D5EADF4290E89F26F57D7305AC28ADB735 BR;r.
961,952,306 *64407867BC04B227189FE67EA8B104334D463191 B=rR)
961,952,307 *6444A1FAA17865C1193BE9376753C4390B0EFD8B B"?rR
961,952,308 *644F041FE8D44F4A7A8D00ECFF36932763DCA54C B,rr0
961,952,309 *644B0C6AD6A41DD40B74E76E382A9CEB60D705E9 BRR1T
961,952,310 *6440E255AC3D2FC48EEA50B6C01C39D0494E0807 BR"r8
961,952,311 *6446FD75673B37C64193BFD76F835D414CF6CDFE BRr9Z
961,952,312 *644853839EA0A2E6A180A535DE95C3FB063EEAA2 BR.rA
961,952,313 *644DFE3ADF95C8169D3E6F01492CCBAA2456C04B brrcdnsing
961,952,314 *644AFFEFB48E8E42732452888BF7628552B78698 Brrg-
961,952,315 *644E9694A6AA591D5EF96BE8B30BCA6D63884C3B B&rRL
961,952,316 *64470A087D74799033961AAD1D4F1F24877BA565 BRrmV
961,952,317 *644C3EE657E12ED586E8CEE31E842B45302B859C Br/-S
961,952,318 *644409D8B9F5BB71F9E30BCCDE4AE77C85EC2855 Br$S=
961,952,319 *644B0E76AD5F75AA93A159FD1D1C04F26E6C9578 Br!:s
961,952,320 *6444A421E70899CA2AF855BD06421F1F6187A5B5 Brs5N
961,952,321 *644302B2299B7E08B195F00763C8965AF1F77111 Br:S6
961,952,322 *6440197F473C81294DE7AFB81BE872BFF19E2DAB Brs7f
961,952,323 *6449EFC59F208E3D5E45FB886D72A1B68AF8198F BrS#A
961,952,324 *6449B334EEBE21B8FC43D6D1DE3DD79D442F820C BrSa#
961,952,325 *6446C2EF27B6796A312D099832B041F17D311E9C Br)sa
961,952,326 *64499721E07A6FCAD36B382543ED140850B6563D Brschts6
961,952,327 *6441E5FBDB2F90FB07AEAA382CBC683A51701740 B$RSD
961,952,328 *644B61C22E520627D127D413E3D32B45A16AAB02 brsdagen
961,952,329 *644BC1D4D5640683AF5C73A572A05F0F8BE2A64D brsemakerens
961,952,330 *6448CF83A5E8E20F85B4BDF779D0B75BB8962EB1 BrsF,
961,952,331 *64447682B182186EDAC001B4BF7D59879048FD7A BrSG&
961,952,332 *64486B02C26B9A130BBE9F0DD0877A8AB10816D6 Brsiliense
961,952,333 *644AA5897A393446E6D6113A7CC8629308223852 brsinep
961,952,334 *644B0EA28768507E894B7A6EBE22E51C5E099894 BRSJNKIG69
961,952,335 *644676F7C8907E3163B5F36A931EF9CEE2EC8A2B BRsmP
961,952,336 *644C1236542138CFBD6164793B1FA44D9C84C928 BrsN.
961,952,337 *644B74E74C50D0C9D3440459BBADC0CC0E323320 BRspn
961,952,338 *644BC9BCF473706507CC3DA7533EA442463CAD70 BrsQA
961,952,339 *644CE14F2BFADF07C9C8D80B27C825BE3939872B Brsrkrning
961,952,340 *6444D15BFDF1D5146D16B692CD62FF1ED3001487 B%rss
961,952,341 *64485EA6016A4CDA3644444EBA58B7E00444D01B BrsTd
961,952,342 *64471A387485F456B2A962140FEA3A9B10CC8672 Brstklrn1
961,952,343 *6442F5343E5C5646DC5D2D3647248F33F77FC27C BRSTLCNS
961,952,344 *644DBBF0EBFF4B18F947BAB669403D0CEA2D17B8 BrSYc
961,952,345 *6446FA8A0F8C4AD0468084FC422A0F0528957E88 Brsyuhm1
961,952,346 *64436737F6451FBF21F4B282E9D23EF4B1FBE45A 한국BRT자동차㈜
961,952,347 *644DDD0CDB6CF8D8061F328B7C9302D973793E1F B!rt(
961,952,348 *6440D3C9A3B4C7F36D3638512AA47F5217EF21C5 B!rt)
961,952,349 *644E8D542D2890E91CA558BC6FFBFBA098BB6C03 Br;t=
961,952,350 *644A02DFC12EE91F91E14CA67E969CE259040652 Brt$,
961,952,351 *644AE2D3904D08FE10412E9DDECF11A6E9688032 BRT(7
961,952,352 *644BED1BFC26269E1231E5F7738C63CFC537497F BrT8w
961,952,353 *64473CFD30224054D3BDA8099842E5199DFEFB0F brtebruken
961,952,354 *644620AFD98386D1844E5347D6607EBC9C4AFD6A [email protected]
961,952,355 *644C64EA928E46F322EAD4D362D6BA51520B46EC Brtftpsing
961,952,356 *64408A3C89C8BF0D2D6A4692A5578002A41EC445 Br)tG
961,952,357 *644D95FFDD2C49E705A248E166AE982B741CFEBF brtruch
961,952,358 *644F461401A18F936D991031D133BF35AF840349 brtslnd1
961,952,359 *644755FADB47A59DA20A847D017784B5B7A96BE0 BR,tt
961,952,360 *6443DC2C28B78B274D677A6AAD88689C39DCBD0E Brtt2
961,952,361 *644076AE66C6F6F8530420AEE294C20F7701D2D5 BRtZg
961,952,362 *64472B51D5EAB38F21ACC400CB3A205E36705730 B_r
961,952,363 *64434B2CB4B5025297850375ADF72FCA96DFBB9A B,r$u
961,952,364 *644DD7733DB6358C01DE275535124176383961A7 B&rU3
961,952,365 *644AD7F9065796B1C639BC37B132B056FF943789 BRU384
961,952,366 *64433824AC804C60465F729A0C55CB61853777D0 Bru7!$hly
961,952,367 *64441287F676329735C66A3BC47EDE4386F930F3 Br(UA
961,952,368 *644C7CE8CDA140A6FA5810031A3D302EDB153F3C bruce101:lisa
961,952,369 *6443916CE11930F731FA556D96EC844B738B8909 bruce805
961,952,370 *644CF0D89D1C2899F57DC060A7C693B117D0C31D bruceangle
961,952,371 *644EA04DF6CD7945885DC49AF01995FF42092A63 bruce.barkan
961,952,372 *644C00199FD8518441D057F21D626F296E2CB190 bruce.bradica
961,952,373 *644D0903FD8F2D8C953B7301164D9C24E2C0014C bruce.dalere
961,952,374 *644A8DC7527167B0AAFF818746B12D035BA61407 bruce.dalmoro
961,952,375 *6442DBA1A204A684FFFA401097123D7BCB331C8C bruce.dunderman
961,952,376 *6442D7FBE2B62C63688350862E0898815A1697E8 [email protected]
961,952,377 *6448E63362DEA640DD628D75CB45E3E40313B75C bruce.fefer
961,952,378 *644C5214A9B73C1779B6AF34A154A0A0A088B798 Bruce FitzSimmons
961,952,379 *6442C14278E40EFB597A1E3FAB0B9084B134190C bruce.gayoso
961,952,380 *6444CC11610305CF13B931854083F8E6551BFB4F BRUCEHARRY
961,952,381 *6442463CF2EEB3482D6089F1651168CC6406C52E [email protected]
961,952,382 *644C93F8D0EFD6A3EE120BF660DB6438E1D6F465 bruceL
961,952,383 *6449924BA1A79ADA1162228155BDAA2A2A076322 bruce.lanzoni
961,952,384 *6447EBEBC5F56BF08F7EDA85B0E38CFE3B52CE28 bruceledger
961,952,385 *64429F9B3CC3735888D34DE09ED69F2E8F63843A [email protected]
961,952,386 *64481D0782E9409867D96AB8A796F8E8A59775BD bruce.libra
961,952,387 *644AA2ACD6C147C614B34D738670BA49C35D34A1 bruce lie
961,952,388 *644227BC41950E871D5AC4B090D8D53D4B5B441F Bruce lietzke
961,952,389 *64470AB85269711C2F428FA4B2248FD6DB415153 bruce.mackinder
961,952,390 *6441AD33EDA330AECCA5A9E3C827AB2827B915C6 bruce.manginelli
961,952,391 *64436209974A4BD4603F152EDE35AD95C14D7F89 bruce.mewes
961,952,392 *644E49D4EB8A3ED5A979CBE32551F7CB3140D0BE brucenga
961,952,393 *644034D7A9AACE3B14C6F5728457AC49F4BD22FE bruce.pyfrom
961,952,394 *6445A5C8A109BD0DC1CA4C71DC2E3BD6060D6641 bruce.santalucia
961,952,395 *644ED91F2E3CAFCDB663A1245DA435C86680D4E7 bruce.sherfy
961,952,396 *644DA3E81476D2ACD42E5145064C97429DCDD3D6 [email protected]
961,952,397 *644CFDDD9716B29B08DFC72261271FFA6C42D10A bruce.soratos
961,952,398 *64496B1D12A2FBA51602B1F0C31C789CA85D8DF7 bruce.steckman
961,952,399 *644C0F6C2647934AB5954370DD9089EFA64F9176 bruce.tlucek
961,952,400 *644B9AC926584954DCD89BA373FCE40855598B41 bruce.tweed
961,952,401 *6440EA9424BE2DFD2DFEBE39E72EDFB6B4F3CD95 bruce van eyck
961,952,402 *644F0CCB20E57F9100EB3E15F1ABB373CA5ED17A bruchsal3
961,952,403 *6443E6293CC8B622465A22A1ECE5BF80F9F73F73 Bruchsteinstal
961,952,404 *6448C9FE8B0246FB99C4BF5EFA24E96D3A6BC770 Bruchuss2
961,952,405 *644A8DF4C05D64C196E1014302592717646E5A7F brude
961,952,406 *64464E798F47E1C41E67A34AFB84308ECEA892EE brudiakg6
961,952,407 *6443819058FA21FA65FC699F7E12FFDE86A3D4BC Brueggman
961,952,408 *644E8B2EBF7CDDE155C531886A8512CE40221908 BRUGERAKTIONERNES
961,952,409 *6446D93C3733EA7DBAC82A5D174E0F0B45A15797 BrugforDig
961,952,410 *6441D95BAD0CB8D5586565CB0502A36672B01C48 bruggemanfrdric
961,952,411 *6445BA0369E16A2A4A2170364135CE6069516D9E brugslagged
961,952,412 *644D90D2137B02B73AB0975EC6B457F6AF024747 „Brühltendenzen“
961,952,413 *644D3C21EA5BEC702CB3DBDA3CDEC0BCB3DA7EB4 bruiniss
961,952,414 *644D6FA22A0B4BB2A9390682E3DA71A5EA281BD1 bruinkunstlederen
961,952,415 *644958F4150D187ED5D73E5DAAE8A8CA459D186F bruiserbobsweetan
961,952,416 *644BDEC99A82A27F98D335B9581E9584408149BB BRUITERAIENT.
961,952,417 *644D6B3B4D44BA82EBB76729D84F14FAE424A823 bRUIteRs
961,952,418 *64418F80AD4E1EF9F282175A960EEF45A3896482 BRUITHWIR
961,952,419 *644117E0373835CE87B417A0D4BC212B81C5FD34 brujas66
961,952,420 *644C407F49A16E6B27CD59E1754694201C1B3311 brujasiin
961,952,421 *644AA35AC9F494E93975F74863989859A7382E77 Brujito8
961,952,422 *644A1594B29B808EB5EC81718DD5AE80EEA31D5E BrujQ
961,952,423 *644B267678827B3E007DE6DCE983AF50C4F793EC bruker
961,952,424 *644F165DE7B1483EBB4581E25D7EB289BCA9113F Brukselką
961,952,425 *644FFCD88D53C7026DB12587DAD09225F0C3C44A «brukte»
961,952,426 *644CEBAE47D508A5DA4D4E6E15DA9555D6BAED2B BRulh
961,952,427 *6447ED18EFCEA484C9C66F6A63A0F850964780CC BRulp
961,952,428 *6443950C08716AB1D2B21FD92B7F163A571D7718 BruLx
961,952,429 *644C7B326F017EAC844B3032BF325FB8026C4141 BRUMES5
961,952,430 *64407BE4AB1DF3D0200DD3D922BDBB223296D9E6 brumseying
961,952,431 *644877E7ED9122C9776A5A8D726595C4CC4E830B Brunan633
961,952,432 *6446F21F51B4443C6BED84FDA294046EB1938CFD [email protected]
961,952,433 *6441751C3158E7E75376B04F284DF6D4AB511451 Bründlweg
961,952,434 *64457E863F3AD23C05555970A2A65FC536F43995 [email protected]
961,952,435 *6446353929F4F9C9F22487F498939EEBC0F3C07D Brunendo8
961,952,436 *644463C31F2D30088A2F3801018CDB3A2D6C374D Bruneval3
961,952,437 *6446A36C5478A4A1B4AF99E5C371DBA46466CAED brunfarvet
961,952,438 *644D0611164A85160BE94DC18AF3BC948515C8D5 brunild
961,952,439 *644BE7622D499C407460BD7A8720717392FBFBD1 BRUNNE12
961,952,440 *64467B1D3B1CAEE33D13E326C86F93C800C4F184 brunnenabschluss
961,952,441 *644EEE5CF78E8C673DFA8F4A7E1EA6906689F807 brunnenlazaretts
961,952,442 *6447E5857FB8FB627BDAAE5A4744AC28ACD1F978 brunnenniveau
961,952,443 *6442B4AE11BCE32196596856366AE3A3146BA763 brunnshallen
961,952,444 *6443469C61E5EB3AD36D7219D090576A21496270 bruno015
961,952,445 *6449835EFB1786E02EFB9D255752572AB57BE94A bruno6637
961,952,446 *6441C343B3D88E976D6E515F2B4C51717B1EC73F bruno.barbarito
961,952,447 *644256982CAC1F1AA54B8EDC8792E3D19264CFEB bruno.bohlen
961,952,448 *64420F67577F58E95494A340342AE995D28C5D0E bruno.brazler
961,952,449 *644793F2ECFBA5704E6E989C4813D57C510F0A36 bruno.cardeiro
961,952,450 *6443E0F6044C95AC445082EDD1ACFFA51C8423BF bruno.dicicco
961,952,451 *6449EADE88EF3C31B969BEC044ED44BE2E298F17 bruno.dorpinghaus
961,952,452 *644F51AACC82D613433138EEB977FEA3D12E628F bruno.dunphe
961,952,453 *64462C2D9792C99F7BA5F34361F50F9AC6953BFE bruno.dupouy
961,952,454 *64417FC5B6D1E9A47A7B2F882A603178C44D4528 bruno.fonua
961,952,455 *6441A10E45820C35752E03F35AC6B65F53B396A8 bruno.gilling
961,952,456 *644338674B0700DCB5B34A02CCBF40E74BFDE997 bruno.handal
961,952,457 *64428EFA9DE817B45D8F164C9E1A2D640B105E26 bruno.klande
961,952,458 *644A89B7C7B7AD661272E7BE7CC6D86AA7562B6B bruno.korus
961,952,459 *644FA619C786E2FEAEE832EDBA675EC18B7ECB9B bruno.kratzer
961,952,460 *64416DF7FA52B17467F7A84AA653214124502F29 bruno.leso
961,952,461 *644C46E1E3D4538495A5D1F68838B96FFA56011A bruno.lutkus
961,952,462 *644688EBDB691E3C5A3E502020ECC4B6B80CBF52 bruno.mikowski
961,952,463 *6442BDB082F4A3613286FA230FCEA6289A8BC403 bruno.mounkes
961,952,464 *6444ABFF100C45105B4AF14ACD4CF3CAB6046059 bruno.nembhard
961,952,465 *644F9F0ED9732C52DDC79448C1F09AA68C431407 brunopal
961,952,466 *64419792B1285B8695705B4D2EE4B529E132C26E bruno.roefaro
961,952,467 *644AA349A47B5AE8282BA832F02831E03EFB5929 bruno.tomkowicz
961,952,468 *644FAF491211E445F7613EE5B13733831E8EB5F5 bruno.twersky
961,952,469 *644C881296C0AD2843052597E06D18B62774993A bruno.valone
961,952,470 *644944696E07A4B9232EBF812443DFBADED924F9 bruntres
961,952,471 *644B436A0B2FB8CDC744DE8FCF5F5B2542B40FC9 brureau
961,952,472 *644DD5BE7B658DB4A3EBE17322FCD7FCDA6A720D Br#us
961,952,473 *6448EAA89C0531558EBBBF1269B9FAE1E1FE72F7 bruschweileredgar
961,952,474 *644113A2ECA26020E4DBE95D7E0A0E928D68F93E BRUSCONI
961,952,475 *64454CF06955109B8C87867756EEBAC3DA610F94 Brusevold6
961,952,476 *644C8F1C3EB0FD0B4162FF31BE9438DE7E5E0BC6 [email protected],
961,952,477 *64412FAC39D48542223F4629B97B24C7D8F79535 Bruskruding
961,952,478 *6442CD32F56049C7EF6DF1DE00309DD85C46EAAB brusquez8
961,952,479 *644698AE256ABBB0D4B81271B1CFD5DBB006185D Brusquiezs
961,952,480 *644DFE8D6F115D2BEBB56BEFB14CD43417C766E6 Brustkorbkompression
961,952,481 *644F4D432F6BD0F0272C1F203ED8FC2E1D02B4FB brustkranken
961,952,482 *6449982994EA2BF2D41C94E93553267F55441286 brustkrebsbedingte
961,952,483 *644F685DDF38BF278A2910DC5A24EFF993C38312 brustus7
961,952,484 *6447B426A398A5CB6D4C4E559AF1802F50CE231C [email protected]$
961,952,485 *6444500F33AAA3CCBD1E3EC4DDAB83024448BDFB BRUTAALTJE.
961,952,486 *644F6A6E4721953FB409C5CF96106D7473B0E905 brutenis0
961,952,487 *6448F5297DE26D124FE42FE47E9248841B333CFF Brutexude
961,952,488 *64429CCE734F0B8F5BE586305E0130E82366601B BRUTILUS
961,952,489 *6440AEA1B7705AD0B8C70352BD1A9283E97C5D6D Brutowin4
961,952,490 *6445F27D796F14D6781A32905EC3B4107933F9C6 Bruttonationaleinkommens
961,952,491 *6449BDA99ED229D3639CA252C1C08A0D4BD8B2BA Brutusaeh7
961,952,492 *6443C211986C733B603CCD67D1494E7F70BA5DF8 BRUYÈRE
961,952,493 *6449B465417B3E4072E694F0D3E23AC2BE3C1912 BRUYLOFS
961,952,494 *6445BA8432C37F8E2B8D3762FB9ED30D1FD23DD9 BR
961,952,495 *64489DEB05821B429DE5B607DD6F3B3BDFE79D48 BRV$"
961,952,496 *6441EABC2F40AE0C5BC80035BF455AEC253149D3 BrV,,
961,952,497 *644C213ADEEADF6C89CDD3DF4790FA060DF3E446 BrV?!
961,952,498 *644A90B7E640513A75A125358A751292C1AFC32F B/rv%
961,952,499 *6446ACE5DD4D7BC74890F683FE59FBB59996D475 Br_V0
961,952,500 *644913F27686BC15B649D2A863C9938662B10F81 BRV6Z
961,952,501 *64496C9C5A4C889D1AB7C01BEA1696A504FCCE96 BRVh?
961,952,502 *6448A7C57AA79FC95CBFBD5A0391ADC522192610 BR
961,952,503 *644B1D20C53BAA983A619A18E1060D4EFC44A0FA BRvKY
961,952,504 *64450A8E3B2EEAD07F9181B7365F371E005892C0 BRv/p
961,952,505 *644FEA056E2C2ED6349AE4C0A6E61592D4E26533 Br$Vq
961,952,506 *644735B38941E28CB5BB2AD6C188E0E9A154CE29 BRvqv
961,952,507 *64417CF9AF6493C70EA2E1D36B2CDDE288DDE620 Br;vX
961,952,508 *64414F70F84D9105CFDCAFD3BD39798E4689B28A B,Rw/
961,952,509 *64471A91FA897AB943627BEA3E7A3A6CB65180F5 B
961,952,510 *644FD7F8632B14642378B6BE2E976CDE8BE1A660 BrwhR
961,952,511 *644512D86C191F3F1E2990AD3BA1304D4689E7FE B:rwj
961,952,512 *644137F8A887BA83B95EAD910A1DE52FC44DCA11 BRWJYIAHGS
961,952,513 *644CF903C3667106F7B29FD91961FE1F9C52A895 BRwKS
961,952,514 *644E5225405BE4A4137459FB6D1F674D27DCB8B7 BRwl)
961,952,515 *64443D0B255B3F1A386D3A7999D60E1DEFA22DED brwnprnt0
961,952,516 *6447AA7652084D962F3A70F6FABB613AB2E1EA5F B.RwV
961,952,517 *64488E4B1F151D99BB63FBF4117D4AC18D95EDB0 BRWw3
961,952,518 *644E4662789AC38BD38238B897C8E52C02337FFC Br;WX
961,952,519 *6443F11C712F176346FD9A4794308EAFFBB5BB44 BR$X?
961,952,520 *6441C64290E3A4EB674DB7BB445C4B9824486969 BRX("
961,952,521 *644754DAB13C4B08DD4854A0B1CBE9E61B49725D BRX6#
961,952,522 *6440E90153FE7B82D1844CA5BFD2FD7CF85209C1 BrX6X
961,952,523 *64415C129069EECF09657C38A923BA3EF856A63A BRX8?
961,952,524 *644FCE73C97EE9C07768D6A31F157572CAF4BA98 BrXBo
961,952,525 *644FA553EA130E4F7CBB6C963EF823A079409539 BRXc#
961,952,526 *64492F3723A1ABDCDC909C6296FF4BC9B86D7F85 BR$XS
961,952,527 *6445879C5EF9C557ED7B458C1D25E73B188E7445 [email protected]
961,952,528 *644778B1B17DD2460BF75F0E4D62C0D9D29719E8 B(.RY
961,952,529 *644357A0C3412069A9CFB604A644A308C791F4C5 BrY/%
961,952,530 *6443B0A3C0ECC345D6947FCD2F245284A59C149D BRYAMA
961,952,531 *6445767039BB431D2801871D3EB560665A2DE04D bryan0121
961,952,532 *644DBAF4CD8E29E0CCFBC2C47AD4BFA0ADDA6A29 bryan.beady
961,952,533 *644672EA9952D77AAEF110CF56F17B2C8A1638A2 bryanbeckert
961,952,534 *644A331EEC731A3885EDF21D5EF501BB4A36A7A3 bryan.dool
961,952,535 *6446B6F568C11594099A7B363BF708F47C5CD920 bryan.eppihimer
961,952,536 *644837465867B5E8A0D62893186A78D673DCC5B3 bryan.frontera
961,952,537 *644C63EEFC0FC6029A29C9C4E582237C725ECCDC bryan guadalupe
961,952,538 *644781ACBB8589C086B97F475D2432D1D38B3E5F bryangurganus
961,952,539 *644A118FA8FE7C546023F59CD26877776A785E44 bryan.haacke
961,952,540 *6449775824BD0D34004C44ECE5C0B8520A01A9C3 bryan harley
961,952,541 *64451F9B34D6A8713E56ADEA837A8D3066C619AB bryan.hinckson
961,952,542 *644DA187ABACBAF4D92581B0A9F65CDEAD6569FE bryan.ibara
961,952,543 *644305A9D9DB0C6C07726A3D9538332F71346A28 bryan.johnsen
961,952,544 *64424602090E780AE638B074E0E47EEBA2182C1F bryan.kutscher
961,952,545 *6447012829F4F9A6296FCD9071E9E315473AC608 bryan.lifer
961,952,546 *6444F985FFCFD7F60E4AD2195654DE659C957B9D bryan miccio
961,952,547 *644EBB2B1D76EC9BA88BA383FE7FD97A9C304F13 Bryanna87
961,952,548 *64467E7095C495680876B5220EF1D42E4DC67ED3 bryanoliveira
961,952,549 *6440823ADD5423C619E9055733824EB7BA49A2C9 bryan.pierpoint
961,952,550 *6440866D7BE50CCEB2123402170B7ABC3FE39D85 bryan reing
961,952,551 *644193F89D32B0259FEAE348E7E366BCD4B5AE10 bryan resch
961,952,552 *64417E03D5D57D9AE2AC733E0AC4F95B814D13CA bryan.robbs
961,952,553 *6446B18BAD26AD581EC83E8DD54B57408BE07F9F BRYANSARIDE
961,952,554 *6448E9C9254AB660A339857B1821A3515F8771B9 bryan.sauvageau
961,952,555 *644ACC4C171A60EF761C2CFBA914C8F06ADB57F3 bryant078
961,952,556 *64455B03232F61DD37F0DA77E052FE7C40A9DBA4 bryant346
961,952,557 *644E30BF9FF7E8066AB569944CE00AB7DDBB0C8C bryant.assad
961,952,558 *64424042D5EA59AB08B961F728FB4C740682F648 bryan taton
961,952,559 *644F69A1696FB3C4577851558DD3AE05804AE97B bryant.capas
961,952,560 *6443E16447923E0CE1C80CF6841B506B77FD3D6A bryant.duensing
961,952,561 *64475DE20BA256382E1C356F0AE73B28CED08402 bryant.enriguez
961,952,562 *64406AAF8B32C2C0BECCE605F3BA468D7FCF6FB0 bryant.grajek
961,952,563 *6442B384AA4D5BCFA0CA6C547D6A5FC43543CAF4 bryan.tharrington
961,952,564 *6446D331E69DA052756D388002B69432CDD3037A bryant.hohensee
961,952,565 *64412BFD5A88094BC73A5F3B250F39F6BB608849 bryant.linburg
961,952,566 *644D2A3C32D1D30173A1C8CB65C769250A0F2B4A bryant.matthees
961,952,567 *6446CE45A9F80979BBF2C5A9D693F1D349775BF4 bryant.meadows
961,952,568 *644D476CC77DB5EFC9DD67E207DB3CFE8B33D4DE bryant.negrin
961,952,569 *644ECCBF89529FFE23CF7954C04B41C2940D3FF0 bryant.pafundi
961,952,570 *644DC5E9B03B64A4C49C00333F983FBEFB8CF898 bryant.pawloski
961,952,571 *64486DB45DACD330CF59F6A2F5C939EB5336D9E0 bryant.prevatte
961,952,572 *644F5D9909721222C8B7FE0EAC43E98549E7F24A bryan.trueax
961,952,573 *64416B5D2D83A5D09054622AB67137154BDF3C09 bryant.sabaj
961,952,574 *644A20C12E52910B0B292C5AC4202455396E2E0C bryant.sanderfur
961,952,575 *644738B6D0B4A36C1083B3A42D178B5E79A3A225 bryant.slentz
961,952,576 *64418F7EF96F16A7821CFAD20CC857F5B80B45DC bryant.troff
961,952,577 *644ECBEE667F642CAEAEDAA6339C560C645DA875 bryant.trolinger
961,952,578 *644F2B4EBB5AA1E55400AD760D50A2B81447669A bryant.warton
961,952,579 *6440BAFDB5EF5C0AF12A7C0AE9D7BF9AFD5C5DE0 bryant.wyner
961,952,580 *6442AB441FF73721E72A422C3EB82136A1885A68 bryan.vertz
961,952,581 *6447B38F29C8C890FBB5D4BD2F684DA5AD979C7B bryan.yawn
961,952,582 *644660F505382D0ACA2C6B7DA18A90524704D0CB [email protected]
961,952,583 *644CB43EBA98D55C7A6DE8684701C8816622FA36 bryce662
961,952,584 *6449AF2B1069A8BDF2B7C1B25F7506E98CCF39CD bryce.bayon
961,952,585 *644A2D7F58223534B50E084AE8C1DF67E18DC843 bryce.celentano
961,952,586 *64489D8F9C59C524F6C648BDE676D5F866A50FB6 bryce.chalk
961,952,587 *644DACD6042A8149CAB4BA44135364A4247C069D bryce.coltrane
961,952,588 *644D61D5F96B4ADABE9BC73420019FC6AA3F97A3 bryce.favolise
961,952,589 *644E9D29DD17EBAA6FEDD729C01C4831A5AB7F6C bryce.freeberg
961,952,590 *644B5E1008B25616A14F8B34B468948CFC417A40 bryce.hammers
961,952,591 *644347E8577A592C1376C68DEC6EC42B74FCBAFB bryce.heptinstall
961,952,592 *644401E6D597D91295794D19413B9D76C66A26DA bryce.iglehart
961,952,593 *644E02C4309F6278FF40B2F4E666B7D09263B0D6 bryce jacobson
961,952,594 *64498BB2602D59C536FBADE4D5BB2AAA342788BE bryce.langolf
961,952,595 *644A6720A30B6B518A292883F0D8D3D7A3DC4683 bryce.mizzi
961,952,596 *64443C5C35939B2EC0DC4EE4FCD2E0098F90E79B bryce.montalvo
961,952,597 *6443DBFCA2E5E1BCF4142ABF772154BF0D6A7FA1 bryce.musshorn
961,952,598 *64466EA6CFAEF5002B8F38FAB350505A5902C178 brycen280
961,952,599 *644114DB0C44786E71B04960294E8BAD64E029CF bryce.stagger
961,952,600 *644F6DB8A5F40EA0DBBCC0216C8C36F7187E0D76 bryce.talleut
961,952,601 *644BA5AF9A32617C414842596BDFB6B4E857597D BRYLINN924
961,952,602 *6440E35B66FE141DD67586A6C94C306B4CBC1655 Bryngesting
961,952,603 *6443949E793FAE46FF77147287A1F26DA4BDED9C Bryngeting
961,952,604 *64478A6E61F2990600EA7E74811FC4EE877249BE BrynNE
961,952,605 *644F16F20E2C0DFB8C13719870C8512DA6ED28A4 Bryograpta
961,952,606 *6444655EEAA74DA1BF4246FD79DE342ADB0AF475 bryon.azevedo
961,952,607 *644C5CD4A87DDDD0A7ACD652ADECDF0D010046C0 bryon.baum
961,952,608 *644A507DB1BFBD4EE3D24DC5D3B5B9BC3DE47398 bryon.brunkow
961,952,609 *644033A7A093B61086DE605223D6C17C485ED273 bryon.byers
961,952,610 *644EA8E5DA6406AC16E3F11DB4ECCFCAA231F94E bryon.caris
961,952,611 *644779F0BDD92D43FAF20FD720EBDB82ED696D03 bryon.causey
961,952,612 *644C71BF27E3F7BC0C42B60B628D7BA62653BD7C bryon.chadburn
961,952,613 *644464432BA75BD3654A5D2A60813605057D79F3 bryon.deutsch
961,952,614 *644EAF6F741D5F267073D87620F996DA1743EC7E bryon.dubinsky
961,952,615 *644FCAC69EDE4AEF618DC00FEE53C3485A919FA3 bryon.kosakowski
961,952,616 *644AD92572EE73347501993ACAC36F1DF80AEBE4 bryon.kus
961,952,617 *6445BEBB595B2FE54B7DDAA7FE7B43FD2B33B7F7 bryon.lapora
961,952,618 *644215BEEB019BF1E120C40B34E1A9432FB01BE4 bryon.malito
961,952,619 *644755AD4A5652E8CB35B7999FAD6170D102D591 bryon.mcraven
961,952,620 *644CFDEADF6092F9FB867DD925E146567B1766AD bryon.morelli
961,952,621 *64487973AB034A58AC82F9240777923C189BAB50 bryon.mothershed
961,952,622 *644E0BF55146B8FD7489163ADD0AB8B59DF5C86E bryon.negrete
961,952,623 *644E9C02E0BC5AA9144E8434E7EACE86FFB156E7 bryon.overgaard
961,952,624 *644B8BEF3E6B91184C170B2EF9848929C5966D7A bryon.riddel
961,952,625 *644DDDAA054F2701C9ED301397CDC70C1E321F62 brysongibbs
961,952,626 *6447F372DC944C821E6B18F3B27C41769015D4D6 BRYTHNOTH
961,952,627 *644523677756C17405BA1EAA5B225E6A5B8C4CA8 B)r/Z
961,952,628 *6444E604B3802FD6E4FD677BAC040D6B6F02948A BRZ#b
961,952,629 *644EF9D331C5032ED9FE9A86A3CFB04867DDEF99 [email protected]
961,952,630 *644B48B889A188364FCBA8F341425EEAFA018CF6 BrZk=
961,952,631 *6448A9BB53B119EC5BB227FAD23D69C6A67A2A66 BRZUU
961,952,632 *6443BE1976C88307F667B1713698B8C68D9AA77D B=:
961,952,633 *644A5896B543A902674848549B39FC7727971924 B?($S
961,952,634 *6448B2549A837327D4E42153E4AA75A8AE9D9FD1 BS!
961,952,635 *6447742CE3F7D2E95E18CDF6C3EE74FBBDB8A8EA BS#
961,952,636 *64468E171051D34E5247A0BC399FC2D0858004A8 B^|s
961,952,637 *644D49225A11CFE748238BA8F7B9ACA61E21D18A B-$s&
961,952,638 *644BAF5C461D23D3A8532D75ABADE62613643DED B".,s
961,952,639 *644EC3DA75C5961C42DF0FB1A497C26FEA84E30A B("s;
961,952,640 *64484FF2E17B0F6D70765F500614E28B779D9580 B$,(s
961,952,641 *644D8F763A80BA87FE2C298FA1CCE36CFD96083D B
961,952,642 *64479E1A0C6F9F675A6997BF14CF46FBAEBAC62C Bs)&_
961,952,643 *64473E8AC38AE24375A42C808174F9C0A7281BA4 B+S0$
961,952,644 *644CE06366C1C1BE56958D9EF3657583C5E96EA7 BS0#+
961,952,645 *64439CF215B5BA2D2F6B1C1B43CB0B4CEBB23DFB B,.s0
961,952,646 *6444472599BD957A01CBE2B3C609999BD2709B92 Bs01_
961,952,647 *6445020F628DC4A0508742EB60457420C5B3BA34 bs024483
961,952,648 *644BA14174A9712391CB9F7CF359EC868EA91097 BS0Av
961,952,649 *644C1D290CDD26452E3A2F6ACC36EBAEE3718E2D B?S0D
961,952,650 *644BCF8B6791973851B22E47AD37307CDDD23B30 BS0gt
961,952,651 *6441DFFEAD74AB0A973DCC5D952AA2510CEE706A BS_0p
961,952,652 *6440ED8F701E0B0F640829F572680C0D55E75C6D Bs0t_
961,952,653 *6449C9E3C88D221CCC02B83CE72EC6799AC54CA7 Bs0U;
961,952,654 *64432B4273A8A466CD477163199FF26B06B9D3CA BS-11
961,952,655 *6444F77F070559C8A7F07F3CEF1CFF54120E956D bs16m
961,952,656 *644E56BEDDE49FD2990501904C1A7D39167C8FEF BS,2/
961,952,657 *644521858E300E1228DA2068FC4BC15B70586B2D Bs21O
961,952,658 *644A4C1D261EB1F4999A668209DFC0E6F0C2198A B:s28
961,952,659 *64409A691E06ECDD1DA1057F6AF5613880EE90AA B-s2C
961,952,660 *6449E1793B149F70AE4551B2F8F3816B1B26F1FD Bs2c5
961,952,661 *644B520FEA87CC79DDE3D1679817176FD877BD81 Bs%2i
961,952,662 *6449D514A46B9F2E3EA3EC5C17758DBD6B639FB3 BS2LL
961,952,663 *644592E6AC3F3EC3101016B04ED08D6703D618E2 Bs2SN
961,952,664 *64466428AF0C1D1576D90D0EB00C5B85AA73A9DE Bs2tM
961,952,665 *644B7D5B975039B4DE38C8F29C0436CB6E6A8516 B)s!3
961,952,666 *6449FDA1DE328273631CF3E8B4E1E6A6583A9582 B-s36
961,952,667 *64431B6EDC9D84C8CF45018FF45B2A16C0565082 BS%3u
961,952,668 *644F86DDBEEC471E8EEECBFDBFEDE020445C3722 B(S4,
961,952,669 *644E4FE3C44EECB75076869582C616D25F5843D3 [email protected]
961,952,670 *6447513448FBFB7DBF8A98B4BB792505252B6E81 Bs4%9
961,952,671 *644B31A074AA6F262749E20F7EF0F4B5CD54F67D B_S4c
961,952,672 *6446EAF71C4CCA9650DD0D11B9C46876472D9499 BS4r4
961,952,673 *644CDBF79A3995FA7146E8450363D7A465B35789 BS(5(
961,952,674 *6449D2816CEDBA8A2A46E716FA86DA1E2CD184EF Bs#5/
961,952,675 *644684A57B7F7FA8AFB18E99EA21A1BFBF63B64D Bs5h0
961,952,676 *644C7F77D27D42CFB14C0FD76225F6B86B36F2DC BS5qh
961,952,677 *644D827F74C7FCC84E0779CF13A599AFA0551F02 B/s6
961,952,678 *6446915D103F56B73098BF9A1167C7C3F088412D Bs6(7
961,952,679 *64400C51F13FC4836103BA55B96DD068D470AD5B BS%6B
961,952,680 *64465B6C0FD939DF76EE25F5111C696F5F70A185 B+s6F
961,952,681 *6447E15466BB72BA2F29F47E5D69ED25FEC8E475 BS6hr
961,952,682 *6443F711C3D00EEE79230207723BE99308ECC309 Bs6SB
961,952,683 *6449727605DA10008DE86C3E20D36D58CC3134B0 Bs6wm
961,952,684 *64466EC35E7C4586332FC8F5F2A8B0A7B8118709 B,s7(
961,952,685 *6444A1A79AB9ADEFD8FF6D10453EBA63094D726B Bs.7d
961,952,686 *6445CAC4926B4BC7A0173364F35B777E273D89B6 Bs7Q9
961,952,687 *644AE47ABF0A60DDB42853C3C40037467B8062CD B$S+8
961,952,688 *644060C65AFF146801D3FF956A7FA8246F31A671 Bs"88
961,952,689 *6442B5DA60E3C23E7AA94789854DB2A29DAB6614 B%s9j
961,952,690 *644AE193E491B6628FE5AE2200322AA4F7BF1129 BS!-a
961,952,691 *6442D40DA2EB0758AA304659A12188A129383D7D B!s!a
961,952,692 *64482324792E435A0262CE09C35416404D5CB824 BSae+
961,952,693 *644EA4CE04E5A8682FC36FBFAA349D7FC97FA1B5 Bs-aE
961,952,694 *644E92D991DB69AA388CEF1518015540A2F400D7 B&SaI
961,952,695 *64497A6498A0CEBCB7E223C4B6E89A329F58C78C B!saj
961,952,696 *64466205546E2E2906DC4F9D25E0DF9F6FBA29AD bsamvwgu123
961,952,697 *644519215CE1E74C99296063E417BAE7419A692B BSa&n
961,952,698 *64483054C2E6C323AC192D8833A31EFFB1AC8615 BS_AU
961,952,699 *644D04CF5F8CBE5898ED99C6CBC4B982885EC49F B;Sb%
961,952,700 *644A8B7FD0473135D4A40DD499F715EA244FDB95 BSb2T
961,952,701 *644EC2D75023C278898A4EEEE39640A21B108919 BSB5=
961,952,702 *644B5A750322CE57B018E2603AB1E46ADA6C8DED Bsb,a
961,952,703 *644C4147845D8EC1916208CBBA5D8432999CB734 BsBf5
961,952,704 *6441232FBB235C5A1DF4C51B875CBACBE65556E9 [email protected]
961,952,705 *644AF1770E28065AF9E0802D9CF24617EB2DD2CF Bsbk%
961,952,706 *6447F0A3085FE379668E9DDF5D30C3219C2A34F9 BSbkg
961,952,707 *6440892C8EFB8758585F88F7B3F9D8E60473179E BsBL#
961,952,708 *644056CF51F67BE05834A487A1C3B58E7709E14A BS!bN
961,952,709 *6441AC59176A2164580115104535E021FA058158 bsbpvmrv2
961,952,710 *6443654041D537A03D0B1A17A5A22F8746D28E80 B=SbW
961,952,711 *644579406D61AC5C5EC3B8587C06EBF1CE72865D Bs#C/
961,952,712 *644F65DADD7C5EFFFFDB406331531CC159E8F8E5 B-sc+
961,952,713 *644B8E1ABCF8B176F4651FB3DBA2AF5B09F11C5C BSC1)
961,952,714 *64473D0921341B011E8B7D5DCFCB1AF45A540F3C Bsc2n
961,952,715 *64429F769BCD5726DB05D77E137F521D09553E3B BSC3%
961,952,716 *6447A5FAAF62D458CEFF8D690ED897F5DA848EBD bscbcd
961,952,717 *644656F2F454230336DA1A1133588C91CC48551A bscdip
961,952,718 *6446FBEAB0F927F8730D8FAFF70D70EB95F764D2 Bs;CG
961,952,719 *6447D25D2E0F240C919974341920BCBBBA0548EE Bschlchs7
961,952,720 *64428B914D9274D5741245B4186E2B80943DCCFE Bschmml5
961,952,721 *64460001B60ED711F53CFA2BCC31243E788261C7 Bschrmgstn
961,952,722 *6441A9D4F2550800247459414FC9A630296A09E5 bschtbs0
961,952,723 *6440C3508EEB29779F58EBB28BD35D5B94122C98 [email protected]
961,952,724 *644817D04C9E172A99FD1FE4ADDDFF0CE28C8409 BSC_t
961,952,725 *6444FA524D807895262D3C3C7A688DD1ACDA0C05 BsC/T
961,952,726 *6440D80C86FFBC6E51095A99ACC580F26D174923 BSD&)
961,952,727 *6443EF18570FEE48CBE65A2B552E4105879127E4 BSdF%
961,952,728 *6447F4C8F3B608A9F0B8E6BA3D592EA3555975FE BsDg8
961,952,729 *644BAA63F7972744885826B616974FF050CF5C0C B)sDN
961,952,730 *6441501C373B6AF7109BDFF375885F76608664A4 BsDN5
961,952,731 *64493EE348CCADC9FB01298FAA083F4DA15D25E2 B_sDp
961,952,732 *644AFC739013A2D062295B6A80BA2BBAC4B2F7D2 BsdP?
961,952,733 *6443ACA9BA6EA47D87EF36B09C800A16FFA8247F BSDq6
961,952,734 *644519723BAB34C2C233F3B3263F8C3477562512 BSDQN
961,952,735 *644ECFF3BDF67C82CDCD08FA975E5C16D533D297 [email protected]
961,952,736 *6448FF73426B6108EE02C6E71DFD5FE536D4856D B
961,952,737 *6449B3B967E5D82D2F8E81034DB8A44B5514DDFA BsD_V
961,952,738 *644094163B59F315D51DCAEF2AB59E4D4DDE381C B",Se
961,952,739 *644E268D5475FE12CB077E19DFF606913BFD847C BSE2e
961,952,740 *644D92C75B0498A645FA90496F995D82845ACD23 Bse.3
961,952,741 *644212DD1687D1B1202BDBA4006C0B2B17BD0E72 Bs,eb
961,952,742 *644130E875DB76F29F00E8F630539987A461E080 BSeBl
961,952,743 *6447F414EACBE82670855F458ED844AAD2A5B41E BSe"i
961,952,744 *64494C279197821614E0A2A5AF6110B3A2B78BF3 B-sEI
961,952,745 *6445B418ADAF5ED53FE61422BF72ECDF7851783F Bse-k
961,952,746 *6448AC3B57BCE893CD6B4AC3C05AAB0A9914A3AB BsEm#
961,952,747 *6444B72D149BE9A0C543D1AB3A6ACBA179D70429 Bsem
961,952,748 *64446A9B29D4C1D8203BDEED82CEDE18872BE996 BseNT
961,952,749 *644ACDC4C3EF8793AE57450C35C8DE196AF0B05F BsEOg
961,952,750 *6448324D7056672413091279B4FAC6B19DACC54C BSe:R
961,952,751 *644D2F1A31197884719EA39B37085D19B3C3182E BSEXs
961,952,752 *644CFD79D5398825ACD5534095B384910B623D99 B?sf(
961,952,753 *6442028408DEE4F5A5CCDA0D76BA83C74B3371F5 BSf2d
961,952,754 *6443AC451C804CCD5B82D057B1D57297C48D5810 BsFi
961,952,755 *644A653E43C237D6C80012AE4827330435B66277 BsFn%
961,952,756 *64429BB53FFA4B89C46761EC19EF8FC5C1360039 B;SFT
961,952,757 *644746219075598B3F6B2915FBED6F2035B24EA9 BSf-T
961,952,758 *644AFC6AB9445E2F8B8D1A5CDC2AF9B239EAA843 BS_G=
961,952,759 *644067050E5E84D7D3001D13DCF02A3AFE90D704 BsGa=
961,952,760 *64498DE07AF5766471E9CA945BFA7170A9FCFBDF BSgeH
961,952,761 *6440626A1264B3D1B29DD86DF260C1DF768A9B11 BsGjn
961,952,762 *6444B35C896229ADB52DA4B7728A2FA7760AFE8C BsG
961,952,763 *6445109E1FEC822AF3DDC4BAE5B1DD5E21D5D3A6 [email protected]
961,952,764 *64434683DFD50A39DEFF59D0AF5AC3254832E09D B;sgU
961,952,765 *6446BD67DB152CDD50C16451C7C736FA7E2DD5BD Bsg!u
961,952,766 *644CB92CE9B6B49B309F1EF68A7041CDC20189B7 B:+sH
961,952,767 *6444C80957FF6F36CCA65A297BD7CAA36A02F075 BsH1U
961,952,768 *64491A6EDE60B86E273692A4BCA20227DF91820D Bshafer1
961,952,769 *644BFA58DF6BCD72356DF4714FC4AD4D90C4BE8F BShaW
961,952,770 *6447F7C7AE58511AE222E14BAB488EBD7888DFE2 Bshcrft
961,952,771 *644967AB9C90C846ACA60613E916609B23CC2CC9 B(shd
961,952,772 *644E0F49CB83B6DACB5CA6F5F234A2BC5662B12C BsH;G
961,952,773 *644E42EB5D044567220806A81377FD7C5CD048D3 BshQc
961,952,774 *644E4F12B95C1EA057BA04F4CD6F9A3F3D430470 BsHr:
961,952,775 *6441CD0DB6861434FABC040AEF1B48D284CEE1E8 [email protected]
961,952,776 *64416C0EF61E6C0CAD80793B85F2BC7D51A97B6A BSi:)
961,952,777 *644B6634D99347222796970A4EC1221072E74563 B
961,952,778 *64470B630FB4E5500E4B7068DA201FE6A23B26DA Bs;.I
961,952,779 *644DCA0E89326C139D9988632774956706AC3CF2 BsI3"
961,952,780 *644F89EF3A2B980804C4FC3858609D30AA57EEEC Bs_ID
961,952,781 *6446B42CBF0A17D2CE828277FA6F9D12B82B077B 'B' Side
961,952,782 *644309EA4AAC89E5511ABABB4981368F0E92336C bsilenting
961,952,783 *6442936F8A30D34F330025B751E79628C514C4E7 Bs(Im
961,952,784 *644D5E29BEF0393039C33CD4A613691114876527 BSio8
961,952,785 *644748C9EDC9F2D54D36C0BE045ED989C58ECD15 Bs"ip
961,952,786 *644F08611DF5FAE13D4715466EC44063D32367B7 BSIYR
961,952,787 *644E64F99353AAAD3AEA09458757CA382A41FD7F BsiZL
961,952,788 *644F805EDAA16585E87B1C22781E4D4B9A7972F3 B
961,952,789 *6443B50D5A4F84C980DFAA9844A45BE6AC069DC7 Bs$&j
961,952,790 *644D5461310AB4288ACE2D58C7B0E3E4050B9DFA BS)j8
961,952,791 *64412E55A6947516956A1C38633AC2A52878E63B B;Sji
961,952,792 *6440D096C531328D85D3BC3ACE8BC56648DB3FF6 B,Sjk
961,952,793 *6442B8F7512C911FC0E5D282DCDEEE2C0064F7C2 B=sjt
961,952,794 *64440A765D16155CA5BC130B0DE425E4EB4C2711 Bsjv7
961,952,795 *644E4019E90C165C237CF4D91CBDE3B7BD9AD919 BS+K+
961,952,796 *6446FD04BA2073E2C9954EBAA146024AD0695E1D B"sK;
961,952,797 *64421049D83839F7DEC1C8C51AC39DBF7EE1AA33 Bs<K
961,952,798 *644935FF3DE5CB5C1CA0679E495B1A6EBBC965C5 Bs;K!
961,952,799 *6446C0F87622708479F55DDFBAD2F26B75637B49 bsk160bora
961,952,800 *644A6E17366C7D9530E90CFA87FBDA084908A0FC BsK5-
961,952,801 *644CF7A81547903C2C65D96AFBE438A79550EEC9 BS+k7
961,952,802 *64419E122258BFA766971B10957F8ABE163064FF bskc64
961,952,803 *644D22858314E2E79D5863F77B8800FF563314E3 B-sKd
961,952,804 *6444D2EF5D43495E284DCCF719E20B18B55844E0 BskDL
961,952,805 *644B5A7EF1C86A48B197CA77B67EB95287647FF6 BsKGg
961,952,806 *64470933FADD04C54A4BB46B09301E78A7A364DA BS:Kj
961,952,807 *644BE523ECCA4741E4543F695C5A956C29FF5DF4 BsK&j
961,952,808 *644A3E616DECF7AF0742A52864311951B938D0E8 BskMC
961,952,809 *644B41D78FEF766AA1E69510C91EBD4F53E8479A Bskmf
961,952,810 *6444B953DD263FBB88C7BF767DB2D33372B38A46 BSk;o
961,952,811 *644FB51CDD11910DBC2C424FF6997FEEBF7D6B33 BSKWj
961,952,812 *6446432799260DFA34D794CA75B36B2A6DF90374 bskyblogo
961,952,813 *644ADC90D9F781ACC10756A50608EA1C225CEE54 BsK/Z
961,952,814 *6444FB806F6A019720C7EDA1F99698B8A2566A9A B_SL:
961,952,815 *6445AB991F04B7D26140F4CB85C8CFD38E59014F BS-L_
961,952,816 *644BB45663766BB3E17BF99906920BF85FD113DC Bs(L=
961,952,817 *64498F1032FF8DE14CA64273AA288408031A5DA0 BS/L3
961,952,818 *644F8A3A2FE7D617E8446B4B972B18C0EBBF97EF BSla_
961,952,819 *6443BF9E1FABFF62DA4344DE4125918478BAC795 Bsllq
961,952,820 *6447BB953EFB7400A2D82487C8840687B5D81508 BSLnn
961,952,821 *644B6CD6C02D2C93DF680359D2184D560426DB4F B.S#m
961,952,822 *644916126C73FD5C9A2CB3915D905471BE559068 BS"=m
961,952,823 *6444E0AC4DEBF1A1C9ECF5AC182350FE027FF9BC BsM-?
961,952,824 *6443B2F3A3D38CD229526E28510AA6563E06CB33 bsmeaa
961,952,825 *644E93194F96DAE1232AF7FAB31142312A13C413 BSm?I
961,952,826 *644FC16F5CB4D07B7A0A18352876CD459A8A18E7 B;smO
961,952,827 *644709EF7F4374D0921C503A2B38025C8931FF61 BSmSC
961,952,828 *644EF83D42D1C5095AEE390FCDC44B6BA65B901A BsmsC
961,952,829 *644C9A6E1D653BF8461CF38F7C40F3A8FC746C39 Bsmue
961,952,830 *644C3EE7B5E482F57E124A03C7128BEE666C8CC2 Bsm(w
961,952,831 *644E71558817563F392449F02954149B04FEE0E7 BS$MZ
961,952,832 *644217660DFF3E422ABEC1C1B1C139B7EE286E43 BS,;N
961,952,833 *64422CFFCCE7B323EC8F67C74929712700CB8B2A BSN&-
961,952,834 *6448AAFCB9725CBDA54A32DCDE31D39AF0063DCE B?Sn+
961,952,835 *64414EF5F71037A90C77081E379B2E7FC66B4E28 B.:Sn
961,952,836 *644844FB6603F84940BCBD53C7BBF021C112FFDE B#S#n
961,952,837 *64446CF562701C94F9C90C26BD7A7C6701122B33 B+S;n
961,952,838 *644B8E18E241453EF2802BE73520E71F33FB5078 BS
961,952,839 *64469E34B430696100F790D0E4B3441C86F44C7F Bs?N/
961,952,840 *644D03ABE761634BB3FB50FBB3E4B8EC0295CBB4 BsN")
961,952,841 *6440C2C34E9F7F9CCCDBCCAF40449EDF29DC6B60 B,s)n
961,952,842 *644AA51F41942470B0F615DC84139D5B475C227F Bs)n=
961,952,843 *64407867E4914156BBF285E520443DAF01D8B894 B,SNA
961,952,844 *6444E332D885194F1B1A911929559765A3DFA6F1 bsnfflt4
961,952,845 *644EFC781A791BDFE4E8BF1D516E2396089822C0 Bs-ni
961,952,846 *644A1F22E871FD1E88187F597B6C00BE64572667 Bsnjdnsed
961,952,847 *64478F5AB82136D31DD2117C19C89B3CBBEE058A BsNl.
961,952,848 *644F9357BBB6055274C534D85337825EA725737F Bsnnlls4
961,952,849 *644EBD2D9A720B56B1B656D47002B451756223E6 BsNp-
961,952,850 *6446C923CFA1857986898675F4E403465941126A BSNwN
961,952,851 *644ED0E10963AF52D084E446F70ED769E3AE77A9 BS&.O
961,952,852 *64473DC28F715EC88170952021B46680DD2DBE46 BS?o0
961,952,853 *6441132C6B83B66E116BE0D88306BA0B562BD433 BS&o1
961,952,854 *64427B5F12D4852EBD2819801EDE6DF89EF37D35 Bso6:
961,952,855 *644C94BFED5D79DBB716A9A8874BAA4583B75B53 Bso7Y
961,952,856 *644D53C15497C87BE8DF317D485996E678055B5E BS
961,952,857 *6448CB9262AB9CD40A2262A5579015E99D77E0DF [email protected]
961,952,858 *644C24E5C247329D17D5D3176C13E566F50A70E2 BSo?b
961,952,859 *644899FFF96455A0D3BE7D81639FC0339E638CD2 BS-oC
961,952,860 *6444880F03E16F0E2373B1699D51EB0E64E09571 BSOLINGEN
961,952,861 *644A923F12636AB75D02EA19D053EB1BD4C020B4 BsOPL
961,952,862 *644541DBACE91CB8A4C88D6FBA20ADB21A38C289 BSOTl
961,952,863 *6447E4D6336176DEE2FD4C9A23FCA752D82DD657 B&SP)
961,952,864 *64432EEEC6170BE4F00EB2CBA1E62E1B9FD83198 Bs!P"
961,952,865 *644A5EDB9093685133159DF7AB068496ACAACEEC BsP!=
961,952,866 *6441B83018C7F543BC3F2B9F04F5A03697606484 Bsp2E
961,952,867 *64427CC658BF3A98688BC263673B1C3B62ADE794 BSP$e
961,952,868 *64487769759F7263AB5B5D0EFFB3E831960A7F93 BspjP
961,952,869 *644FE0A69178DD93344E057744F06C4D9C8BFFFD BspST
961,952,870 *64435090FDC3B51C98EC646D2E1717F64042D224 BSPvi
961,952,871 *64447EDEF166698ED196F016B3FC87C8D8679B16 BSPYY
961,952,872 *6441B321C1497C269705931BACABD102991FE234 BsQaX
961,952,873 *6443A59C680BDF93DC04D4E237E52F0B169BF095 BS#qb
961,952,874 *644C21196EA099E4B10312F95A988AEAD519B229 Bs/qD
961,952,875 *644E00C0A0EF28992FB79040DDBBD40E049E0762 BSQ%o
961,952,876 *6441155C8A8D4C25C5AE9AC628912D8B9FFF544A bsquier57
961,952,877 *6448C7A9A5D7FE7E7C8392825768F814B2C7A0CB BSqul
961,952,878 *64427AB332518AAC8017548E4FA1726FE0408A5D B/SQw
961,952,879 *644706BF69B8759BE60A07ADE3D754CADAA1E487 BsR"-
961,952,880 *644013B200A95FA509C41413CC16A6CE62370799 B;s$r
961,952,881 *644CBC29D67B9B542B36118A3356548F3DF7F6C4 BsR9&
961,952,882 *6443F47AC6330B9C58A56C1F506C3543B652E891 bsrbrnt6
961,952,883 *6445DDF9D24ACC15E14CF75A60F6245789B16A62 Bs;rC
961,952,884 *6444EA4757CAB93B997686CD6F7D235EFA6E2FC7 BsRC4
961,952,885 *64487492FC9B9D071741AC0FA003CEDC59A86D9B BSRcV
961,952,886 *644979CCEE3BE04D2045734D041397780DD1E904 BSRDNSS
961,952,887 *6441EE421D7FC3F510268353961CA94B4836B505 Bs%re
961,952,888 *6443152AB1106C657DC089B9365A3DEF542CA699 BSRh!
961,952,889 *64451A5AB731286CB3D335596739846A99CE8CC1 BsR+j
961,952,890 *64402387F0EAA00EFE2B09E03E36DC65DEDE3304 BSr%m
961,952,891 *644DBC283FA10BADFA29B529E54D339C6719D768 BSRoW
961,952,892 *6448ADE5AD33EFC7B8BFEE5F482EB0404CA35B75 BsR"P
961,952,893 *64452BB67D0A8F94F35D6BE2FF86E7C746DEAC84 BsrPv
961,952,894 *644999AD977EE234BCBF45832B84F6AA76E2DA75 BsRsh
961,952,895 *6440A458D90E9727924C9E67F26E3632F9E553C5 BSRT?
961,952,896 *64480EC0128A5E21C95CE9E026B45DA2BD2D0BC4 BS!!S
961,952,897 *6444D1326C2BE56D54CCD1D8DA85CE4DB87D4EC6 Bssabssas
961,952,898 *64414D169BEABF1ED892D645DF17AC8CE2FBC3D6 BSscR
961,952,899 *644C7236E52908462D8F6164C51A0320CD1EC2C0 BSsd(
961,952,900 *644FEBC8EEFCF06051558B087F22AE57A5F093BE BSs!f
961,952,901 *64481D09AB211CCCB4B3A5C586D58CEEA001F42D BssfK
961,952,902 *644C184A0E32FC1C4970EB36508D42AE9AD57D47 B"sSn
961,952,903 *644AA4A084DB65A0297C0FD878A3E2C677CBED83 BSso:
961,952,904 *64485121CA4E51E4867DE71881C9CE40BFB579A4 Bs_)t
961,952,905 *6443A18F22918F2C6139E0FC747967A5E3DC9CF6 Bs?Ta
961,952,906 *64497F6E6995328D27E643772228DB0013CE0603 BSTbp
961,952,907 *6445C2A7F84B6ECDA80A47D29AB9BC062D8B6D50 [email protected]
961,952,908 *644A95BFC07A4F6DBECA8C28B7D3B5499027D210 [email protected]
961,952,909 *64402F90762F15B01BFFA364BB669FCC26E6BA9F [email protected]
961,952,910 *64461FBB28A86D1CDF04A0E59D91460EC0D6BE37 BST
961,952,911 *644FA1841BEB78895CA1F0A3D4096392170D62CF BS!tP
961,952,912 *6448D88306050F74D228C3119C876F7D606F40B8 bstreets5
961,952,913 *644F06BCE23780B7CA2FCA3E7C34F77B048E32C4 bstrprses
961,952,914 *644BB13B2DF6A39115C03D40CF76C92E42E250E7 Bs
961,952,915 *6446AE1A37103BFA4E1AEF1323F7832004B0BD21 Bsttdnssing
961,952,916 *6444701041037343A9515C7D2061516B6A8F2DD6 B#stu
961,952,917 *644F474DF03F3BEA69BB293306072A3799949AEF Bstuerze4
961,952,918 *6445A8B1641AFBA9DEFB5BC967E0E8513E475BF4 BSTY?
961,952,919 *644A5EEDB81D1801006511C53542B579C6D0FCFE BSUDDOTH
961,952,920 *644679CC6D7A6C55A7FCEA732C9D7CAF3040B5CE bsuedwind-magazin
961,952,921 *6449DFEB840004460ED312278AC21E22421129A2 BsUGS
961,952,922 *6445B9A8AB1CA1CDEFD8C8BCFF4BB703D1D876CC BsU?h
961,952,923 *6445C29BC7B91CE5A2E849C5FB29A475D055B4AB BSuiN
961,952,924 *6443EA23C726B5979CA2E1058855CDCB1D26688F BSUNBURY
961,952,925 *6448C979A1F4F0B62CA8C8E05BC851B6CFCCD95A B%suP
961,952,926 *644C88BF148EAE7F9C2F477DE40CEB0FDBAA8DFC BSUPTKJKALAFG
961,952,927 *64442D2129D14F4F7846C068937B04E3A16D1AA0 BsuQV
961,952,928 *6449D2143F5B7B47A5A39E51DAD24D432EE5025A B:!Sv
961,952,929 *6443BAF3AF76F67EB89EEBCC5DDE8DF0F83BE368 B:Sv(
961,952,930 *644D185C2702B8394F27719EC316809FAA99ADC1 B/S-v
961,952,931 *644B2A6E7E8DB44EF8CDBE9048095DE124EF07BD BsVa+
961,952,932 *6445695B9BF0AFC49E8776F3B246A9DC9F98B2BB BSVbQ
961,952,933 *644E84ACD7181E5BF25DE3A17727EAAC858F0925 BsVNB
961,952,934 *64456113A23EB22087D2DE7AEAE8815873BDC47C [email protected]
961,952,935 *6448A724BD5A0AEE89261227728365B1BFB537DC B_sw)
961,952,936 *6449E121E5F6FB15661385298BC3E79517DD8685 BSw1E
961,952,937 *6448D0D00859BE8B67B9115B8DF1B4B116BF13D7 Bs?W2
961,952,938 *6444F2F4B196743BF305D6764B54BB9CCB1B47DF BsW5;
961,952,939 *6448D13EC79A861C6299B422FCEB84F0CCA89628 BSWadddoctemplateBSW
961,952,940 *6449F8047EDD2EB9414FA491BF2CC4736A235A19 BSWadjtoshadBSW
961,952,941 *64421AD7592B5D2AAEC98940BB2406D57643132C BSWagroapis
961,952,942 *6448E9044BDF04A6BD295906E4463EBF3607CD71 BSWalfarano
961,952,943 *6449A7EB30E92100533FD17DF1F973D4DFF27E3C BSWantangotu
961,952,944 *644F20CFC0F3CE4FAE86BE2AEC284E5BE36E9CF7 BSWantsirananaBSW
961,952,945 *644C4D2519C5B52FCEE94DC52222B8BA58EF807E BSwaO
961,952,946 *6445B3F30DA13CC7BC59D34532862FE296414861 BSWapslBSW
961,952,947 *6445E5E6CE5CA699721186FB3D6F3C893DD5E57A BSWarbeitsverhaeltnisse
961,952,948 *644A33316753211F3C2D99E924BFCF3AF41218D5 BSWarchivefileBSW
961,952,949 *644CCEB25497DE46366B7D92914909B262C62708 BSWarsnBSW
961,952,950 *644D729A7377E51C16C5C0994E9D9AA4BE115AC8 BSWattachhashBSW
961,952,951 *6445EFBAA9CEB284100F288D4E4EC9AFED547F94 BSWatypeidBSW
961,952,952 *644C6FE61D03C6D47EDFF3925D2F551CF553F3C7 BSWautomedixBSW
961,952,953 *6442A06967BCD69DE79C410D9A7E64FF990217D0 BSWautorisantBSW
961,952,954 *6441FDEF185029DFF1745E606F4232C153F319EE BSWautronic
961,952,955 *644325A4452A4A50D0586C3A3C5B81196EAD08D9 BS:WB
961,952,956 *6448ABB9645E552E188DBA13B4AB0A5F0A2FE8DC BSWbachoBSW
961,952,957 *64410F09F928503FD975B1FBDB91E21AAD8FF1F4 BSWbaladiyahBSW
961,952,958 *644F251F0F677BAB577A0633C4831BB6EFC3AE97 BSWbamerind
961,952,959 *644FC59BE571FD49EDDFBF76C1A9ED81C798ACD7 BSWbasicemailBSW
961,952,960 *64414CB7B724721D9EBDD4701B68E296DFBD0DBD BSWbdmpBSW
961,952,961 *6441115EAD66E387E82B9F3DF836B905F0FA5F6E BSWbeispielsweiseBSW
961,952,962 *6440FC66BD1ACAF315BAB3A9568B6F335E95EF8E BSWbmarantz
961,952,963 *6445C16BF40B3ED08ECCCDE33DE18B645AD745F2 BSWboundedvalueBSW
961,952,964 *64428EBA5BDBCECFA7ED52C73B447D4B4D7B0C4A BSWBoyseBSW
961,952,965 *64432AD5EF687631ACAA56FE5298BC921D8F6C47 BSWchangemodeBSW
961,952,966 *64497D64DB08401C0771E060124073670BC3C935 BSWcheckwinBSW
961,952,967 *6447F82E707E45E3CA6C379B0076FFC18BC2C1D3 BSWchiabautBSW
961,952,968 *6445E5758848ABD41D070CBE37E7A12DAC6A890D BSWchunkelement
961,952,969 *644E95BC23D711D48F23667A8E289BD3CCC0C39E BSWchurbanBSW
961,952,970 *6440C696505272822BF2C51066ADF0E27AAB5E46 BSWcilobrepBSW
961,952,971 *6449FBCE590362374C8E947715A7820085E94E94 BSWclabecqlease
961,952,972 *644A37656EC0C858CE3570ACA56574C26520F606 BSWcontritiBSW
961,952,973 *6449AF043078127D386BF38A31A3E3143C5BC351 BSWcostituito
961,952,974 *6440D6334E0724C6967EAD74EFD7C72962565783 BSWcountiresBSW
961,952,975 *64402C60E904C716A17E9A6DCB14EFB9E4CBC8B0 BSWcrevitur
961,952,976 *6443FBD3C4B0B2BDAA20EF4D081E0051BF0C97F8 BSWcstaglientiBSW
961,952,977 *6440DB9FE2FED7090B309A59D236DE6D3774E504 BSWdaguerrotypes
961,952,978 *644A50DBD26C33E64C8054637AE8611571C61DE3 BSWdbylsmaBSW
961,952,979 *644FA86E70DD832B9956B7BE2F4030DB7D779300 BSWdemirbagBSW
961,952,980 *6444C75C2AF05A1B3F1CBDA3F93418DBD218680A BSWdiapBSW
961,952,981 *644D6243482B304E12D8969991C9806C024F3BFB BSWdiridonBSW
961,952,982 *644E471184FEABB89F1F15EAF6F078F9058484EE BSWdkephart
961,952,983 *644501F4D02D9C6DC6BFF3A2C65B0E842BE133A8 BSWdnuhshcaBSW
961,952,984 *644A53D6C6711C4C572473FEE0F93DB9C4C07720 BSWdrachmanBSW
961,952,985 *644EC0E2111E9672A1D019497A5DA24331A04307 BSWecnadiugBSW
961,952,986 *644BBDDC92DCEED522D60837B1BA79323C427CE8 BSWeiteljorg
961,952,987 *6443771F62054760B8B84EC4544D379C545E2570 BSWelieccktBSW
961,952,988 *64412B1A4B02E9182BAD4A8C1CF84F3E04349BEC BSWemdowlin
961,952,989 *644664A6A5BB04B5139B48B51C56039182EE3C2A BSWempsBSW
961,952,990 *64426C7EDC92CCDBAB8DBAF942AFA0E31431A332 BSWenirecyl
961,952,991 *644A37601955F67E311EDDE00DFA672B98241646 BSWenvirosource
961,952,992 *6446C15BBA50B5765B7BDE055B7CB3D6AD4FA5D4 [email protected]
961,952,993 *644488C3DAE366983EC9AC1FA62CA32F86963C59 BSWevitutit
961,952,994 *644A61C0A07401EE5BC65F713D62DE8E66E21D32 BSWfacilitiateBSW
961,952,995 *644FBD3D37F7A65F7C8C7DBB3EFD50F2500091A0 BSWfantasic
961,952,996 *6445C12DBD13F95D7760C828777EDB538D036FA6 BSWfaranahBSW
961,952,997 *644CC4160EA27AFD8F990A59C892A4FB8C14A5BF BSWfdminnqq
961,952,998 *64472982882B14917224B49780DF4F8D3219A2A2 BSWfgetBSW
961,952,999 *6445894CA58C26F75C3512A2B3E9461E4402A727 BSWfgxBSW
961,953,000 *64442CD92085884386EEBDE0288A93C69AFB0786 BSWfirstsector
961,953,001 *6447599FF148533665D5F04507DF776C062C6C35 BSWfmgBSW
961,953,002 *6448F02A0605F3D5297711D0B23AD5E35D5524AB BSWfoulplay
961,953,003 *644D03DF55818AD2A7CBA4B0AEDE16C2C0FC2812 BSWgadamsBSW
961,953,004 *6441314D993663F3458B785D2D7E6E1A3FAF9690 BSWgerogiaBSW
961,953,005 *644B40D16E4C836F9A211445E48FFE50DD1C57E9 BSWgetcpagesBSW
961,953,006 *644F6B73BDFE75DFEB49A06C2E0989726E9A9845 BSWgravelaine
961,953,007 *6445464136856042CA8CC23C461D9C2587AE22EC BSWguilander
961,953,008 *6449D2E6EBD6C3D078EE6D7B0864AA88F84AA345 BSWguittard
961,953,009 *6441D760D088DA4A4D3FB77730A1F9F5D2670A59 BSWhardaker
961,953,010 *64470B16EB3514EC1092306243507AC4B15A573C BSWHarraganBSW
961,953,011 *6449384B851343928511CCA159CE52DA348A1384 BSWhatzenbichlerBSW
961,953,012 *6440A5736254FC014C89D496AF06978819795132 BSWhemmeter
961,953,013 *6446B6D4F36661F330D2C93F3A5AC17CB63A5E75 BSWheterconnBSW
961,953,014 *6449E00BA1DB2F7951E87BBF7FD293341B923769 BSWhinrichsenBSW
961,953,015 *644A5FC2E6C0BB9A177060B95875C86FDB6D7EE3 BSWhiukanBSW
961,953,016 *6440802912381F16437AF4A98BDE8A71DF0E2C5D BSWhoroscoppe
961,953,017 *64434120C35F8E2585ABC961F2322C4361B5BE0F BsWhQ
961,953,018 *64495B2D5643E4D209E0D462795023A2080E7608 BSWicdbBSW
961,953,019 *64401F431E30EFA43254F2CE76BF01BFD26614E6 BSWifroBSW
961,953,020 *644C27DECA95CC9A5504BE794F5EBFF4E761C8E5 BSWiimoriBSW
961,953,021 *64455381E3D88FAD47EECF67C49B2F14676F08E0 BSWimportancia
961,953,022 *64488C5EA6CB5BB7C989B9E3F2C8B08C6C66E41F BSWindustrieslimited
961,953,023 *64451B269E9231198267454EE0D203EBC539531F BSWinfringment
961,953,024 *6448E1290AE2CB89A27CFC5E3676B371D4F9FC3F BSWinnfsvBSW
961,953,025 *644653121A17652C63E410B6EF9F535087756914 BSWinnrknBSW
961,953,026 *6444E577A60ACA611D5D9C81B06A8A0A1A7926EC BSWinsinuateth
961,953,027 *644B1D9FEFA5BD5331BF9CE898DF2C902D068D85 bsw-interview-questions
961,953,028 *6448DBAC4721E139C4174051AE1A441890D2958A BSWiradjBSW
961,953,029 *6449F863B27DC710EE3582D7BB7A68524000FF47 BSWitemsinstackB
961,953,030 *644C168963EB704F2D811CE0301D89A091B6FCA1 BSWjapaBSW
961,953,031 *6441FF48136DBAAEEC833EB4A0854D580AC0A247 BSWjcorffBSW
961,953,032 *644412B397DB9A32DB09B7670E2B20F65FAC65AF BSWjelundyBSW
961,953,033 *644F5F6E71D78E5337EDBEC2907E0694916D7BD5 BSWjmaclean
961,953,034 *6441CE4B00C2FE95AC67571BCB4D05521E16E592 BSWjpdavidcclBSW
961,953,035 *64457614EBE1457446D0296C90D6486830B5946E BSWkamalavathi
961,953,036 *644572B34789B54236837FEE0E3511BA18F7FBFD BSWkingstad
961,953,037 *64417DE18B01E4DC2DC2FEE5A306093FB297EB22 BSWkirsehirBSW
961,953,038 *644CB494DF35127A79DDA9FB47AD41FE0C9D0E7B BSWklingotBSW
961,953,039 *6443931411FFBD229C2DCE172BC5339A6CBBFBD2 BSWkrowkcolBSW
961,953,040 *6446206305386C6AA8B21E0C8EF50FEBE56BF748 BSWkwintney
961,953,041 *64495A8ED386881E263E156417D194F938A14EAE BS!wL
961,953,042 *6440C0FE7388D6F1EE69562CDE251A8E5C3F6FF3 BSWlabernBSW
961,953,043 *644058AF02E0AABA8DC0B2E7E08B8A8DDA70D551 BSWlanstrom
961,953,044 *644378DD69DCD69387397977D98CD7E2A266D38A BSWleaguresBSW
961,953,045 *644D93A5E4606A32FF95DD9FEAF0D9461B490C89 BSWlistloggerBSW
961,953,046 *644AA7660F4A54472A1869DB6C37076DA1D3D2E8 BSWmabinogiBSW
961,953,047 *64417C63CCFA130E5D7D6B281DA459E9E4A84214 BSWmarshlan
961,953,048 *644B9A2CC5BFCAEB36E0B1400A7AEA3F4D1E95DD BSWmazzotta
961,953,049 *6443EE896FF3052BD58AEBF339BA40FA69F09F26 BSWmboudour
961,953,050 *644754EDC6716A731EBD76AB03ABF5A8B08EED1D BSWmeasureableBS
961,953,051 *644CD2225CE10FC70C67D5E478656D966E8A2E3B BSWmenjadiBSW
961,953,052 *644C567A602CBA4D5F39345D69B5018782147E55 BSWmisbehavenBSW
961,953,053 *644DEFD1370C2B75369026A07ED25196C565F7B2 BSWmrssmiths
961,953,054 *6447FD1DD95FFDBA6D8D3122F431F0EF855A04E3 BSWmuhyiBSW
961,953,055 *644332CEBC0C13DA64D0EE1EE1C9F16AEA47F5B2 BSWmydirectoryBS
961,953,056 *644AC05441DFE0F742E368EAA0561EA7B5970F74 BSWmyshBSW
961,953,057 *644E55A5FB341DA10C01E8ADBCC950327495BD97 BSWnaclBSW
961,953,058 *644168D944B465369FAAF8340947046C5E0BC93A BSWnbitmapBSW
961,953,059 *644C3EDB8F240681707341C6894E706763221F9C BSWneedquote
961,953,060 *644E8F798C1C801A9F421CADE4249C3A6D993716 BSWngbarcBSW
961,953,061 *64446202F0D07CA0865916D42AE30FF465B00868 BSWniederkasselerBSW
961,953,062 *6445326B4E842FFE44453BFE0EF55C96CF64D518 BSWningunBSW
961,953,063 *644558A81D5E3F124D0003F10017A700FCC24EF1 BSWnmiBSW
961,953,064 *64496BD6F2FF937AA13C48BB20091B62B6F6FCEB BSWnoltyBSW
961,953,065 *644D84DEC7BA7019BB8C9BF2E6DA76D1540CEC3C BSWnonnestedBSW
961,953,066 *644F0FCA27421098D933932ADCED25377666C469 BSWnoweBSW
961,953,067 *6445F1E6067F7D1CB8D59DD8A18010645507951B BSWnxopenmemoryB
961,953,068 *6441B69F91D7058D3FEF82D9BA57D045F1A50596 BSWoeovdBSW
961,953,069 *64411CAF6503671BDE838645FA5813A540976E99 BSWonupdatepageB
961,953,070 *644E61D9ED022B89605FCB775F934768FC21E72E BSWopernpalaisBS
961,953,071 *644D1B04256F722EA35EDA7F3E3A51F00E3474CC BswP
961,953,072 *6447E90B80A7EA51CD70EA31F0BC20EF043884F2 BSWpctechBSW
961,953,073 *644CD7C2F8C1B0B42C3D1B2BABB96FD0CE13B393 BSWpeopletoolsBS
961,953,074 *64441C8D1A75F28F09C93105E05A81B10218F4FE BSWperreiraBSW
961,953,075 *64447DB43CE387641680AD96A8B196FACDF4A2A2 BSWpetrzilka
961,953,076 *644EDEE5B99E2964A4F2D44CB75D9615795D73D4 BSWpfrantzBSW
961,953,077 *64420AE453B7EFCC63CE52666A7E51869D0CCE91 BSWplattsmouthBS
961,953,078 *64448E61F3E1A67C8E8734CFE0836E15F02CEF2A BSWpmacdonBSW
961,953,079 *644C7D9328B6DF58516E169F4CA657D15D251B8B BSWprincipiosBSW
961,953,080 *6445310896AF85DCAD0B951055D7554432156E2B BSWprofertil
961,953,081 *64498C46EC3B08BE32AEED1D8CA6D3DD7309B247 BSWradiadorBSW
961,953,082 *644E7120C623E7081A074F916B86182B431BE0AF BSWrandersoBSW
961,953,083 *644F3FF41DEEF60A9552D48E197335917FAA41AD BSWrcvudata
961,953,084 *644D08753F32C05CCEAFA28FE554C79A41366833 BSWreadedBSW
961,953,085 *6447B998507CF6F31BF8D7C1F497D8477E4ADEFD BSWreidconBSW
961,953,086 *644755865DDC787858D770758D93625C006564D5 BSWremoveinstanc
961,953,087 *644472FDB298E9AB1772B7C456D3A670DF54EF93 BSWresumablyBSW
961,953,088 *644F230C8BA14F6CFD0A8B756115CA0F95D3FA31 BSWrifaiBSW
961,953,089 *6449B250C7333C35DA480DB48C475E30B509AA55 BSWrinascenteBSW
961,953,090 *644EF40F263FBA3F1BEC480F3DB7702C4883D6C6 BSWrobodialersBSW
961,953,091 *644290AD1197A8AA124FCF5EED2B193CEDE1B94F BSWsasabuchi
961,953,092 *644CCC92145443F32D2FFD27A246C0C245537EE8 BSWscppBSW
961,953,093 *6448E4274117188A6D1CEED70A03C20FB9D63890 BSWseicrBSW
961,953,094 *6442BAC9DE65FBF70D9C98C12E4ECB1D07088AE5 BSWsekitarBSW
961,953,095 *64488669CAE2F7DFB9C154E952026535612F30D9 BSWsetvideomodeBSW
961,953,096 *644A7EC9DFFB6681753795DDE630148458650EAC BSWshimeall
961,953,097 *644DE9722734BFD3B094D5BE24F4F4452F76ABBB BSWshowboatersBSW
961,953,098 *6443B49BB637DB2AE809AC8A97DF2F9E6AE65BBE BSWshrubsoleBSW
961,953,099 *6445B359E6A40C4A963433AA09A965511B35EBF4 BSWskhBSW
961,953,100 *644403935D8C633BB44C568025EA6CF11FF21649 BSWslhmcnetBSW
961,953,101 *644A7EF79E113355153899218382C19187F9EDD4 BSWslobodnikBSW
961,953,102 *644130C0985AFFAEDC899A535A1650DABD26FB6A BSWsltiuBSW
961,953,103 *644B8FD3BCDEA59F0CFD9C9F72CDA58415B674B8 BSWsnithBSW
961,953,104 *644F1398945C1A2F5DE10562143A6880125D753D BSWsoftcarrierBS
961,953,105 *644D36656A7D7F82AFD667DAA66FE509D3A8FC8D BSWsolpBSW
961,953,106 *6445E6EA9CCFC431CE9D42EEB29DF9C895BA9EC2 BSWsomplace
961,953,107 *644E666067203055ADA137D517361612D365743D BSWstaciBSW
961,953,108 *64417976B85A18863CE7092DCB3468F456CAEB08 BSWstrugatskiaBSW
961,953,109 *6448754404572BEFBDD9003F7D4E6CE320E68856 BSWsuspiscious
961,953,110 *6440CFC6E5AEDF4E0146F0299D64C219E2A48C70 BSWsysbackBSW
961,953,111 *644DBFE8A891BB19FBC7C2AF29502C4BCEDCE7C3 BSWtapojaBSW
961,953,112 *644CDF1B6AAB12101E574610EB44F71530FFE837 BSWtblnextBSW
961,953,113 *644F401B578763E98BC82289C9BFE35FEAA11873 BSWtcfBSW
961,953,114 *644339CB79C2D43F7886130F0F5CD92C26E88503 BSWtftpboot
961,953,115 *64459CC9EBFE5D32F4195D886BCAC66FAD194A69 BSWtheposition
961,953,116 *644328B55AFBF28DAAFE9498D84C3057038B5E1B BSWtnemgesBSW
961,953,117 *644115F7AA5CD2A78A6E2EF4947377103187BF3B BSWtneulfnoBSW
961,953,118 *644431C63ED47E5C4945D5AD5F68ACCA0E5D8532 BSWtoddmjBSW
961,953,119 *64433606AD29F93273AA7E003F58545F8E80DDDB BSWtomoBSW
961,953,120 *644F835F262C87FB1A0A4DA2CCD0FE860EB37C19 BSWtpxmitBSW
961,953,121 *64484C377E3A4E660E7264D7050252B568DD091E BSWtqmBSW
961,953,122 *644DEB79811CAAA842B03E4CEB41732F384950FE BSWtransisitionB
961,953,123 *6445A306C56E3ABB1441DD15904DD8214378F93D BSWtricklewoodBS
961,953,124 *644DAF9EB0F073D9DADA6E242C4484566720AC32 BSWudematikBSW
961,953,125 *6446D9686D97201447199FC855290F8078DA3B3D BSWulnelemsBSW
961,953,126 *6448C55DE13CBDD4FE72E49EACFFD4DB57777B20 BSWunanimitBSW
961,953,127 *6442010FF96535606F397F143AC0E402710A1717 BSWvalueholdermo
961,953,128 *644526A46831386EC84ACC16277407EDD3463CF0 BSWvirtualyBSW
961,953,129 *644E7A2F30BB873E9540EE41F8EA59600C5CC26C BSWwebriderBSW
961,953,130 *644100861BCB4DCECEA740E72E227108DB56BE56 BSWwillcutBSW
961,953,131 *6445D31CFFA555CE5884FE3D2D90D6F9CCE244A4 BSWwordprcessorB
961,953,132 *644E4FD426CE97B887BF29B5D4E91A79D5D507F7 BSWxassignBSW
961,953,133 *6444111CA7649882B65CAAA124B3C3B43638075D BSWxmautomaticBSW
961,953,134 *6441E051CD6A940C0EBBF47A529241A0B6655064 BSWxsendclientpr
961,953,135 *644FDCF18460BD12C0B0942817EA088BDC9E1297 BSWyelubandi
961,953,136 *644633C58B9AED81C57A927F76F272BFEDC72BB4 BSWymaxscreenBSW
961,953,137 *64444C284115B0B287131AABBD0D508F7449E1E9 BSWyolmlBSW
961,953,138 *6442C63E9EC8D603BFA6F6D1AD75D856F85E2511 BSWZeheBSW
961,953,139 *644369F16340C0CB16BA4195E8EC4DAB6BF59976 BS(X:
961,953,140 *644F75B52856A5DCF99AF8BB4876FC9582F072E3 B:%sX
961,953,141 *644D9BFC361B569BD1C352355F4A44C5058B91A4 BSX7U
961,953,142 *6440C179550AE58993D6D56ABEFBE6A223777FDB Bsxbtdming
961,953,143 *6443014A9F473794F986DD27B6157C937F6C3594 bsxc.hu
961,953,144 *6444A0C351092E930AB986FF966CCE2BF4E92900 BSX,E
961,953,145 *64483FD9A4A350E05652CFF0F3820DC988437DA6 Bsxllry3
961,953,146 *6449403EA833BEF2C85E750C85499E0CDF068745 B%SXX
961,953,147 *644575633C4EB729B42442CF875010FD4ABD0624 B+S,Y
961,953,148 *644233DCD1C25386D5EF41EF0D6EF7300D6AD5E7 BSYKd
961,953,149 *644C5A2DAC4A87EA57363D1594AF8D9C096B1EED bsymigreece
961,953,150 *6440975D56817F5EACC38B01DF94D2CF1E290CB3 BS!YT
961,953,151 *644A00680D2D0125E57490F464164D68DD47BA3F BSY+v
961,953,152 *64405F39DB2A3075A0D2BA0EF9EDD1B8253438C8 BsZb
961,953,153 *644A1F4BD1549C95A1632A92967B000EE8C66826 Bs
961,953,154 *6446DB5C5D531818D962DF87FD3268C5C829609F BSZgv
961,953,155 *644309783196E36AECAF0B7ABCE34007E51CBE38 BsZij
961,953,156 *644796083891743E0481F4605FBB161C7A35BE18 BsZS.
961,953,157 *6447C4894A1D516760E09B50BC30147CB9EF1331 BSZs9
961,953,158 *64425B0F23A17FF1180EC2BD13AB2133286BE805 BSZY#
961,953,159 *6442EC20FF08B581A4739370A964A8FE4DF6B051 BSZZ+
961,953,160 *644B5DAAB7AC5AD35FA1FDB6E466D025A9B2C7C9 B);T-
961,953,161 *6447D59CCEE6C88E66827F8D2B4BA4AF07549E54 B+.%T
961,953,162 *644A42B3C2EDCE937428309FC14054D58BF57174 BT:&(
961,953,163 *6444380E499751897EE259FFF42F62C21D5719D4 BT!;.
961,953,164 *6442986EC77B4964CE1C3C471601670DFB672809 BT?__
961,953,165 *6443A466C8D058F27820968A584B9B4888A54BDB B't%
961,953,166 *64432559B639617B89FEDE3AF7B809CB674E4F6C B"t):
961,953,167 *644B58B628A6E4B0384B21EFCA1E5469471558A3 B&"(t
961,953,168 *64412387AA324D9247411B87852A3C904AA91009 B+t!"
961,953,169 *644D3F10ECB9A8320D3949934734D1A85C0BB0F6 Bt?(
961,953,170 *64453712F7562279F28F602F88C750B8741E449C B:T0,
961,953,171 *644D0C35A41852E409541585F61740C74AFD80EF Bt(
961,953,172 *644C6D368DA604CE7582519F6B44E011F280AF31 Bt00R
961,953,173 *6443950CF16E3340695B5918747A35DB7B2AF9B6 B)T04
961,953,174 *644DAD943BCF84E3B02F0240A229378B53B7CADC BT0708SWRLCP02SWSP
961,953,175 *644920E30884FE5733F956A7EE29777451B5EBED BT0k.
961,953,176 *644579F73D252B191ADB201DA3139CCC2613B53B BT0Yf
961,953,177 *64430C397A98142023E42FA9348E8FABFAC47CB7 BT1+7
961,953,178 *64469AFAA142B63DE6800DFDE18A9CA09B507187 B#t19
961,953,179 *644C3005C65CE3DB6A57A65E72E7F00B7B9373D6 BT1bo
961,953,180 *644DD18D1A2FB5911AD983285EF0491971DB0827 BT1m$
961,953,181 *6443530F618589CB4E3FD1BC34ABBBCD96E39166 B=t1p
961,953,182 *6443A03E87EA5A65318B85504FEE47675BA224F0 B-T2;
961,953,183 *644D80DE06DF72D4F0DB333D740B6167C6E98563 BT2lS
961,953,184 *6442901D12775355F0C8E20234167B75B159943B Bt-3
961,953,185 *644DD022AA13D595D7FA02CE28FD14CF33AA83C2 Bt3m:
961,953,186 *644F2B20CE5851568581E39266DD33731752DCA1 BT3On
961,953,187 *644CBAAEF57B3AAEFD4E660B73BA882D5A595457 BT44A
961,953,188 *644998F7439881101649C40D0C67E45C3396002F Bt45U
961,953,189 *6443B972E174A2E6A97E809FAACCBCF0846DEBE8 B%T4a
961,953,190 *644BAB4D9DC21104D034EDEE33593804F0A8D2C5 BT4e$
961,953,191 *644404E8CEE84897EE7C0D831777D4C290EEBE1E BT4qP
961,953,192 *644E6A78CB9811660BB9D5C13E1DB89CE5E6CC09 B?T4t
961,953,193 *644FEB9B74E8580389BE72B059FCCE05DA3754AF Bt4tE
961,953,194 *64424B715C5F7A73D2DEF73431810E09B0E188F2 BT4YN
961,953,195 *644FC84724047521EB2B5B0CC78A9ECFA528C4F5 B$T5&
961,953,196 *644E4DB194773D26B1417CD64D0C5BBBF5ED6672 Bt53G
961,953,197 *64491E168947AEE48DA51AAA014F92E89644D04E BT5g(
961,953,198 *64468C659CFC244435613F35FC97F464B42B8000 Bt5&t
961,953,199 *6442275A8E1BD908D3128364E71E790CA30F5DB2 B!t6-
961,953,200 *6441A58DFDB26FF90FE96FA033473167323AF0FC Bt6#!
961,953,201 *644DC0A0C1F566884540EE9DA46D057B446C6D59 BT6#S
961,953,202 *6445066B5E906BCFFC83FF7F7B260F51541D80E1 BT6S-
961,953,203 *6448005C51ECD04CA247138089F85FE09978EA23 BT6t.
961,953,204 *644DB8F63128403200182D94B722B7961ECF86F0 B!T6w
961,953,205 *644DA68A2CAD792731E6FA2290DEB3C684377F29 BT6Wt
961,953,206 *644678E6C7B01922AFEFECD8773E5A2E7AAB244D BT%7#
961,953,207 *64465BB00C7456AE53C0926C775618C655D20DC1 Bt7-6
961,953,208 *644FAEF708EA1F4C8C91A4A7E91EBDB15189BD07 B
961,953,209 *644BA3F60BDAB7C2CBC6FB1A79A924582E0B020D BT7lh
961,953,210 *6446DD3D7CE37E0621BF753CC01D6C851D01BD60 B#t8,
961,953,211 *6445B8ED524CD443B3E0B730735B3C12721BD11F BT8&C
961,953,212 *644122DB9C4D9E7FF48D9F25DA43103194C27C31 BT8=j
961,953,213 *644B733C480F3F2AABF38EE6228B847219C570DD BT8ka
961,953,214 *64473224340DDE16061F2E4E35DA45D4025DA471 BT8;P
961,953,215 *644AB0C40EA66263829F878E115BDE39D5AF35E6 BT8/S
961,953,216 *644FE44344E137ED8EC6862CC5D443A57C66B7C4 BT8V?
961,953,217 *644BC5D2E5DD893231C3BF06FB6DBF38A556D980 B#T9/
961,953,218 *6449B5DCF2EFEBCF9F60B0EE92564DBE5FF32E64 [email protected]
961,953,219 *64466B0B3DEF2039050776A370C65A752D9C5E4C bt9900swrlch02smin
961,953,220 *6445B700EBD16647C96930BEEC16B112026DDFFB B)T9M
961,953,221 *644C2EF5AEB0AC839D00E57C6132BAAB36D04352 BT9tB
961,953,222 *644D5E955CBFA40D765FF527ED92C6486A98BB71 BT9XI
961,953,223 *6441988DA359D72BF90ECFA3776D68F35A976659 BTA?)
961,953,224 *644790B69A9EDCF6FDED945202D44B38BA074002 B&tA_
961,953,225 *6448288C32E1802B941DE10BD7AB447DA9CE64CC Bt<a
961,953,226 *644B1595D18CC8D68D31B84A177B7EF43DA03056 Bta4R
961,953,227 *644A7691AD2B7AEA03301E9F40B95E9B6C6D9179 BtADp
961,953,228 *64434C4D20BA32AF16CE7BD2246A9C96170BC975 BtA;f
961,953,229 *644F826E28EB6453D23DB655B65BA329854EAA74 BTAGO
961,953,230 *64456166B39B139DD4D44EE3058AA90A06C14A0D BtAji
961,953,231 *6440659F81BDA54FF4BFF8CA3F45600EE9588381 btan4m
961,953,232 *644C0470A01801534282DDFF1566DD9FD1EDFC7F B:TAp
961,953,233 *6449940E70AB7C1FBA48161DC03B276B12393FA2 B=
961,953,234 *64412D95C22B527784A8BBD7E347F985252ADF87 B=t%B
961,953,235 *6441E19D67D5032DCA25C39DA5532CF2B91C1D51 B?t=B
961,953,236 *64417EC93E9B3E195D8911AC0B0C456AB2221B4E Btb"&
961,953,237 *64475E583E02C623A5E35266B2CF343E9CC059F8 Bt
961,953,238 *644D6FC44D162EB8C7C146487F96AB847397E438 Btb:b
961,953,239 *644674B1758EF98EA403205FB3FE0E004D239FEB B+tbe
961,953,240 *644E2E030F3D37FDA5022949EB514888B6534243 BtBeV
961,953,241 *6447201CC942E98C9E116876F847B0EB01823BCD [email protected]
961,953,242 *6446E57B5B644C965A39F8297E6E0C62DDA158AE Btbm"
961,953,243 *6447E952BA0FDF0D9B810A537EC7883CC69E534B BtBOs
961,953,244 *644DFB8E2CFC27D57E56C5C8F81BBC2D407387AB BTbP%
961,953,245 *644F0BB0450483A980876C12D6A9E66D786BE223 Bt:Br
961,953,246 *6442CB68F08DDBD819C9B8186F6D046438720652 BTbRl
961,953,247 *64490A57C70C1F192893B5AA4ED6C4F52D976738 Bt/C3
961,953,248 *644A112A24B50F24E507FEB7D53C84BC704F5AED Bt_c5
961,953,249 *64471013DEB6D4080C2A54A45263E847C9C0402E B(TC6
961,953,250 *6442257F0DC9D1E5F9A3FD7E4BEE8D409FE8D666 BTcAn
961,953,251 *64489A1155E88C3EEC2518B3A2ACA59986ED58B1 BtcBe
961,953,252 *64429B3D30460C2C1FF6601EBD8A9997CEC3D88E BtCCa
961,953,253 *6445E9C956935D7098597B105D2CCAFA314A8081 BtcEw
961,953,254 *6442F91033231305D8DCC8C928DC784F38D9DA0B Btcj,
961,953,255 *6440A257A16673A9DB13CD22E01AB25789A69512 Btcj)
961,953,256 *6442286C91F0BE02FA89EAA3D8A324410896F134 Btcp8
961,953,257 *64413E140F65DD4CA7094E0D3C794986EA99310F Btcsbsw1
961,953,258 *64498DAFBDC4327A1A7EC049CD98802DCD537C63 BTcXH
961,953,259 *644AB6FB01D0FDEFCDEECC298537E8C650104BBE Bt.%D
961,953,260 *644DBF872C45DEE54D3EA42FEC6FBEA05603B3D0 BTd-I
961,953,261 *644CBBCAEB02870496A44E58038C205B5562B135 BTd(K
961,953,262 *6444F3720B9CB84B8852F92C72A65ED7B984994B BTdNm
961,953,263 *64440387CC74F44CA2BC0E2F2561712CEED36178 BTDQ5
961,953,264 *644CABACABCA888389CBC1342EC8355ACAB63515 BTDst
961,953,265 *644FF9640BA5CD5BC0720530E36C3B098181C663 BTD-Y
961,953,266 *6444F60E2A5380A20CAEA88194A154B23F19081D BtDYH
961,953,267 *644CD4EE05BA5E63A085E80786DB076623B7C040 bt-dyn
961,953,268 *6447B2B74CC93ED4E563D2E96452D6803095D300 B?TE,
961,953,269 *644CA2CDD56903EC8BA87087B06B4649E323798E BtE4j
961,953,270 *6440C4581691605CC3AE1D02429E97AFCC640FC7 B&tE6
961,953,271 *644A24460FFA235E4DC1D1CDC1AF53AAD1D61DF4 BTe97
961,953,272 *644AA8AE9E0C727A6045AA9960898A18985EAF03 Btefs
961,953,273 *6441410602208F60193B9B776F6118BE40B4217D BTEKHDGYB
961,953,274 *64472E9136C6EDC150C883E18644C1A40DC1C2F5 Btenions8
961,953,275 *644A0669962AE54E93F7A6D65582B0EAA8D021D0 BTep$
961,953,276 *644DA4E9BD5CC406C8AC869930B54C05A4F62552 BT
961,953,277 *644394F58CEEFF611E9C23DBC8F8E096120F136B BTeQ#
961,953,278 *6446957982709A489A4D5A1A31F41F263BF6B989 Btertrev6
961,953,279 *644D3DA13F40424395A146EE80D12FB3F790A89E B"=Tf
961,953,280 *644BBA212CF563A24787ECB4C1F1B9F3BD98A514 B.tF.
961,953,281 *6447D927ADBFAA1A7F220DDB10C934F281F1A354 Bt.$F
961,953,282 *644BBDD70FAB3AAEC3EA6EE5D5E325A6559D7404 BtF"(
961,953,283 *64478DF51BC53F935F5C3BF7DE63C344E6367113 B%t:f
961,953,284 *644047C372CBAEACAE3535DF41B02A30E72C4288 B.Tf4
961,953,285 *644AAE2F676C6733497B45DD62F82C021A0D1C56 B=tF4
961,953,286 *6440EF905E5FF31BFE22023772D3DFADF9DC4A56 BTf9;
961,953,287 *6447E7EF73DD414E5663F78AAADDC622E5581CC3 B:tF9
961,953,288 *644F18259EEFF9E46FA88A1B504663C194BC2BF0 Btf_b
961,953,289 *6445BAB632CF7AFD70ECAB893F01D3C53DE08897 BtfGi
961,953,290 *64412A62CD059BE4C62A617D70A3066C53A6E7E7 BTF(l
961,953,291 *6442B5D8DACF7116E6B47BA824AFE8577C4993C9 B&TFq
961,953,292 *644D482FD68AC7D208D3845F83BF20A4B7E73C34 Bt(fq
961,953,293 *644736789795F2F5D455B1B3B495F2E51DDA8455 btfqO3VN
961,953,294 *644A2759A0536CA89D74A75C189EC3091D252E71 B+tFR
961,953,295 *644E50D51B69FE4C7F399E306EEF72711CE77DD4 BT)#G
961,953,296 *64482AD724A575062B2972E67DC2E8CAB7DCC900 B!T/g
961,953,297 *6448282E7E4074CC56E5E3720A16930A1BF2F9CB Btg=(
961,953,298 *6444EF9F092A6E093F7F57EBB44459EEFBB48E61 BTG-4
961,953,299 *644E202A4ABD17BDC40810AA8634C9F4ECB433E2 BTg:b
961,953,300 *644D1F3D84EAA3A48562EA2DE99940B97AAF059F BTG&I
961,953,301 *6449DBD4A33867EA50E71B75D0817D0BD5F1B894 BTg(I
961,953,302 *64462AD6112A293CE3C2B61699E3DF315976D247 BTg$L
961,953,303 *644F5BE041E9DF54F0B95DB053CCA9CC763EFF0C B#tGq
961,953,304 *6440BE3D52380D91F17B2842E6B29B7018D4E99A BT:GS
961,953,305 *644E9BD2D8020B5D1226B2AC351D15D061FD2C5F BTgsl
961,953,306 *6440DE8C9E343B361DF1ED0C55C97BF3D47BED06 BtgwR
961,953,307 *6448A0E7FE6027AFABEEE4872087CEAC7674BC94 BTH=1
961,953,308 *644B75A82BAD226C651CD14C6313C80E8C72E86B BThbaa
961,953,309 *644AF7B61485C45D14131FB4733C62D32CC5D5AA BtHCq
961,953,310 *644814E4A40ADB6DD4B6E944919A123D9A6F2CE5 bthlthc6
961,953,311 *6442395176A77DF6F81BC46A2FC981831EC803D6 BTH:p
961,953,312 *6440862C4B279D3B80EE688320DAA81B658B222A Bt!;i
961,953,313 *644E6992F6E59C6B14F923A45C487768F4BBD286 BTI#7
961,953,314 *644294BB43827C4094A88B1A8DA222ECE18543DB BTI9c
961,953,315 *644E41E7B31902D1C65EAAE58F8470DD55DB2541 Bti9R
961,953,316 *644691EA0A8347D34716DC2CE765CFDDCBCF26A4 B$TIB
961,953,317 *644A9BFE2ECA2FC95B178C90E0ED20BA3C006134 B=tiH
961,953,318 *6444C323F04F9C8EFB5941AE7D39FEBACAFABD75 B
961,953,319 *6449C66F604D89E71189B43A216CE9F79D7E47FC btindog
961,953,320 *64464ABD985366B822635AC5F99A48B47C92BC4E BtiOA
961,953,321 *6440A84CB662CA367823F88408AD5D09795E4AE8 B;TIS
961,953,322 *644B8E60490C23B9E016E0C1C5F95743685CE6B5 BTITA11808196101
961,953,323 *644188C963D6567AAD7F06C80ABDD131CC44C17F [email protected]$te
961,953,324 *64471BC293159991F17D85158EE290A2BB0EA1DF Bt/IW
961,953,325 *644AE964D03E844A91F5643F48E4A0FCDDED1D7E BtiZh
961,953,326 *644873E3610D5556D9F99695AECFFD93FCCC0FF6 B!tj%
961,953,327 *644654F97E7B0E63965BD493B8B38B782831D382 BTj55
961,953,328 *6441EBFEC1A3B449959450747DB9E04A3CC9683E BTj)b
961,953,329 *6441611F360702F004C68387FA0B20A1C8479F21 Btje8
961,953,330 *644231E08E6911DB4EAF7A89EEBA7C5F85EDBA33 B_tjN
961,953,331 *64439BCD17C7887F2AE4685AB4BB66D39962913F Btj,r
961,953,332 *64495E30E95C1F13BC56A0071662EB1C0B541D63 B&TjS
961,953,333 *64455B4261778810BC1E9EB76E86A3B1DA637FAB B)tjW
961,953,334 *6446F5D3A6079A039D352907AADD1E5D4C376979 Bt&+k
961,953,335 *644A116D090ED7875D29A97D65001E9954C969A3 BTkd.
961,953,336 *644F53CEE7CB06949FF7B061D3FFA41ABFB2585E B&TKL
961,953,337 *64461ADBA1605BBCBA89DFF41173C39D1E517E70 B
961,953,338 *6449E7F56A08F87F49A3DC28E6994D886F523709 BT;kO
961,953,339 *644B369804E00D0E50B22193196D786D33AA6C9D Bt?Ks
961,953,340 *64424FC895C8AABA51142E332A891D35A0E3A075 BTK:w
961,953,341 *6445AD67E70C245DB71B02FE7DF3C085EB64A8FD B+TkX
961,953,342 *644A5E7B144EB9BA6F2F77260B9FAE8E178D9D4F B#TL+
961,953,343 *644A668E726BA45B6BF90F451ED40A85209DB7A9 B$-Tl
961,953,344 *6444516BDC53BDA770CB09B5F10A4C8497A3EF70 Btlf/
961,953,345 *644D0CF5DD75FE9821813D9D1DDD66C5F9477868 btlhbb
961,953,346 *6440C04CD959913A981F8E0629884612D151D892 btlin3
961,953,347 *6449B8677358357A96D4EA928E9F9434C607E7F3 BTLlO
961,953,348 *644122BC5375104285982C1658695D2100665467 BtLM8
961,953,349 *6443D2281EFC98D6DEE610938C43232A0772B07A BTl=O
961,953,350 *64481F8ED0934B3B2DA659671E3070EAE6BFB15D btlsbtlsing
961,953,351 *644C2284E5EBC7C04B120624FEDDFB7349376EEA BT:Lt
961,953,352 *6447D2AF41EBA2E032BBF56FF179DD32A0B522C6 Bt(LV
961,953,353 *644817F061427883A72057F9527206C19E4B6FAF BTLw
961,953,354 *644F9DE6B25DFA2CA59847A94EC960E140C62591 BtlX%
961,953,355 *64492505A283FE0BEE30A6C2131698120BC861DD B&T!M
961,953,356 *6446DFF5296AD49C576E92553F09E10308407776 B"t-M
961,953,357 *644222EA7CB7DA3ED4EEA41CC00B880D2BAE986D Btm_/
961,953,358 *644C81031D20E5E29887E60505FA74B30EE2B358 BtmA)
961,953,359 *6444B2340D757ACC4EB3ED3F6CB0B824229FAF37 Bt#Mb
961,953,360 *644BE60ABEE64CF8D20799783074B19B32F4F308 BTMcd
961,953,361 *644D0ED1CE5871C2C98719B6181D5F65728D1FD8 BtmCh
961,953,362 *6447DBDA467B084057BA09389C03FD1972A3CFA2 BtmD:
961,953,363 *644BD7C93FD19B3B6628C5CEAFDFA44D1707E6B6 BtMGm
961,953,364 *6449ADBC90F969772104B1E5567A5F5C22E82BBC BTMIn
961,953,365 *64428B4EE75A00E08EFB3C6D112C24B40D77300E Bt.MN
961,953,366 *6441E41FBEC14451831954429CFDC11593D1D6D8 BTMoo
961,953,367 *6440BFD455CDEACB22C95254CCCD712EF3396917 BTMpn
961,953,368 *644560EF8695F2B8D6A065C8DD6E4B665F21D4E6 BtmR!
961,953,369 *644E2D447C6A6AB3DD5643EFF4DCA8D949E25D78 BT#Ms
961,953,370 *644111B6C7629F2EB0D42B68897B02982695CACD BtmtW
961,953,371 *644B985FFD7F6DDCE5B6EDF048382D4B7D452465 BtmWM
961,953,372 *644F83650E318B0EE7F2AABBF922EE8174DEEF34 B,TN$
961,953,373 *6446CAAF733DDEF1A6B5984890A45CA01C0D1110 B/TN;
961,953,374 *6447452A96156744EF99D51A25AA85FB18654581 B&_TN
961,953,375 *644A71E10505853A125775D7C2FF7256BD242D78 B!?tN
961,953,376 *644D4AAE7284FFBC11CA068F832A26367AD8A6E8 B(t"N
961,953,377 *6449FC6776ACD1EC9644320048ECEFF51D117BA3 B%)tn
961,953,378 *64417DA4AA5804FDFE9503D747A23E19358DB0CC B
961,953,379 *644B715006E45131EDBFB0CD44A2722658523AF4 btndetay
961,953,380 *644467A230FF5AEA8A620D7690C5E762A97973DA B+tnm
961,953,381 *644537E598B0A41B3EE969779BA230A1491A9D3D B_tNS
961,953,382 *644AA9E1A824DB3B3FBEDF9E770C0A550299641A BTNwb
961,953,383 *644904131BABB04509CAB4872F09BFCC8B10E60D [email protected]
961,953,384 *64462EAAC1B720A23CC6651C90B01EAEFBFE2060 Bto2=
961,953,385 *644B6C15E73E3804DCBF5A9332963A4D75B77621 B:Tom
961,953,386 *644A5B4E3DEE64E950E3C3BD78E8FDA46821AD62 BT=ON
961,953,387 *6448E9DA3E4E69B49794057E6A1D4454F37E6183 B+Toq
961,953,388 *644FA2AA24F51DDCC110D2AAC8DA8A5FA652C002 BtOrl
961,953,389 *644742896D942FBF21A835FC524C49376E4C6066 Btosbsw9
961,953,390 *644531469CEA73E1B0C457DA65A266ADCA87B456 B+ToZ
961,953,391 *644036363080DD4D84D846EC7A32A5C957FF83FC BtoZ6
961,953,392 *6446C11475FD33821E20359BC7DD0B198B0FEBC5 BT"P4
961,953,393 *64402E6D591B1788372AFBF2AB1CB1874A46C636 BtP?A
961,953,394 *644D451E4378BB0BFC6484A5F7B690137A48C955 Btpħ
961,953,395 *6445AD3F2D1B0F904FB09AA491A43F3B221487E5 BtpiR
961,953,396 *64425AEB06A713D304C4DAFAFE48B48270369518 B&tPK
961,953,397 *6444412E79958A6D4BD5EEED96734FDD2CDAD45A BtpM)
961,953,398 *64474B3862F082C6295C730622C2D65B89B9042A BtP&N
961,953,399 *6444A2614C74D674185F2E6D70C30469B5723A6B B=TPQ
961,953,400 *6441F7BF5EC550928BF2F71665844B38ECCC250D BT$%q
961,953,401 *644369EB7F8680F530D7F3FFFC1A2642AC91EBB5 B?tQ
961,953,402 *644DF41B14447A5E160C9DDA87E6B5EA4270BCA4 BTQ21
961,953,403 *64460C2F41A082EF4C317AB99839BFBD042146C8 B/tQ4
961,953,404 *644987BB9A5166B74784027095836A5298F2F6C1 B+Tq8
961,953,405 *64425767F24A5FBAB2A70E8BFD9E0D205895EC9D BTQEd
961,953,406 *64491437B049C6C34F958975AEDBC271DD98D147 BTQJ
961,953,407 *644E1CDCBF31B9B5F481E6C0C9A459764C57B79E BtQK:
961,953,408 *64435053FDF0661AC0E76AA6F336CAC9AEC02B44 BTQku
961,953,409 *6448A0C37AEFC2A288967E4B333760494E6A25C4 Btqlt
961,953,410 *644CC59C4C5AB18715E21E38EDCF05EEFAF32F63 Bt!qr
961,953,411 *644901D0C8E7AB6B38618CCF779FD2392E4B518B BtR+,
961,953,412 *64448C8B1C75BD1C5C1EEB21C4C340B9296EC344 B&t%r
961,953,413 *644BF413E54289DF4DDADA115F39F4B76E22FCBD BTR.A
961,953,414 *644DBE40C9893C4045B91F46235B943106816356 BtRAC
961,953,415 *6445E4C3CE9D9CEA725DA7B9D44B5947E81AF7D8 B-TRAINS
961,953,416 *64426BE0E19953430F7104825C9BBD0E6CCDE597 Btrchtg6
961,953,417 *6444DAB42637FA0E9670470E6ECAD29DA243811E B/Trd
961,953,418 *644BC97EE9B821398D806E981AEEF7C09383AC71 BTrg#
961,953,419 *64467F97094339595E5F03B1B0EC7908E0E67DBD BTrLq
961,953,420 *644FB6E7D3DA536F35BFEA5985C4D6C2C2D0F546 BT"rT
961,953,421 *64425539AEE6F26BACA96B463C0E9E4B5CE22045 [email protected]
961,953,422 *644DA49449C1733E55B29DF1249182EEC8788086 BtrX_
961,953,423 *644E174930C62E01CECD874CE62EB5EF597DA3DB BtS0B
961,953,424 *6445FEBCE88C29D23645D765B4261CEF28615F0A BT)sA
961,953,425 *644FF8E7C05171EA628003F9FF18C5E7F163754D B;tSC
961,953,426 *644B1D47BB26343FD064FC7E6DD45FD30F7E867A BTSD+
961,953,427 *644BC7546287F133844FDC7E9D8D5291D61840F5 BtSdE
961,953,428 *6446789B7BC3E79632591C14E67EBA5A9BD58DC3 btsdemerde1
961,953,429 *6446DA396B69D028781B78B9FCBAF8F14720CF82 B(TSF
961,953,430 *6446E0A17F69084A529C976455848AA8C28A7ABF BTSJQVD48
961,953,431 *644DF26B423CCDDA428CEADF23FBC2C1A3063137 BTSmV
961,953,432 *6440A2AA426AAAE146A645B533BCB807A4C2423E BTS
961,953,433 *64480774E2A9D1A75E2E0F2D77B41A60DB160A8F B-tsu
961,953,434 *644E8DEECB859E07B37E56E0BD5C4CE16DA767C0 Bt_su
961,953,435 *644E57721E6BC478A855907DEA7EE729EB9D629D BTS-V
961,953,436 *6449C0A141B40B612F4FBB0455834F7A4FF0EA14 BtsvY
961,953,437 *6443271336C848758229D91FED000CFEDC9FAB67 BTS)W
961,953,438 *64489442D42F940C60676C653E183347D895C845 BTSWE11902198201
961,953,439 *644C72A6A7023D0D2E638849FC635609C4CF99E6 BTs"Z
961,953,440 *64489AF5D08BE87EC6B0F98765909D9BDF14E91A BT#t%
961,953,441 *644A5C38E272B8A0A639F8E68061841395B5A10D BTt_$
961,953,442 *644DCE8BDD5E7BE59825B7AB4BFDC105081AFAE5 B:,tT
961,953,443 *644D56DD4F8B44CB8C728D478D7AC089A5A53B58 BT
961,953,444 *644A318D5C12313CAA8DF3AEB6BA8D714112D7CF btt4
961,953,445 *644DCB9966519FE91809770B36C68788A8A825EB B_tT6
961,953,446 *644E223C2027D81102FCB5E9C28BEDD8B3609BD8 BTTAX
961,953,447 *644CE35E7114653094775B0A5A503A37490EDA72 BTtc&
961,953,448 *644F5728878E68F77AA1BAEAF0415180219FF1FD BTtF6
961,953,449 *644E1774AB9E610A390BC84C9455A2CA1D32A168 BTTl?
961,953,450 *644C58A468D3D7C1EDAFC76278DEAB73E035E9F8 BT.tQ
961,953,451 *6443A5F7F8DC0FE1DA97932CED4EE200CB601104 B,TTX
961,953,452 *644BE172BFBE343B55007406F6CD72E7C376F8FF B,)TU
961,953,453 *6449FC954EAD9D4217291047491155D2E5AE2C52 BT#U;
961,953,454 *644134EEF35117084F1A7ADFD3EF6C96829A10B3 BTU43
961,953,455 *644FE05A3BCD48D5A98769599A653C9619B7E47D BTu81
961,953,456 *64489FDA5702A8C0C38D49CBA830E66FDAAFFEA9 BTu/A
961,953,457 *644821776A6EF603A0E4529E6B2246AD08F268E4 BT#UP
961,953,458 *644144574CA0D3910155BF7A319BC131AAA3AA6A B
961,953,459 *644330EB00570E66D2F65323C356E75BFF8E8538 BtUQF
961,953,460 *644DDB6B3E9799B996B4669271B9CE9CD46E795E BT:V-
961,953,461 *644E3686EE50AF5B79CFB4DA4009DADBA9B6206D BtV=d
961,953,462 *64415C995EAEBAF8F0ADDAE10A28A989DAAB5C5E B,TvM
961,953,463 *6447C032666FEF2CA106C4C19CB8615234C263B3 BtVM&
961,953,464 *6443770DE6C0FA950CB7E1C640D2E5AF20E8EB42 BT,vN
961,953,465 *64449801360846938713364C6324DF13BB274248 BTvNL
961,953,466 *6443C450ECAABD24DD2E4F8B4FE6E34358C426AB BtVS%
961,953,467 *644806C0467AAA6F27193CB7E094571658110C85 BT-vT
961,953,468 *6442C6D4FB9E826FF4D74728282DA410F19A0200 BTvtO
961,953,469 *6444D283A14FE2FEFF0AE917E5E32C9665F6476F BT:VU
961,953,470 *644C88E98DDB92285A8921593E0B6F26742A0D04 BtV&U
961,953,471 *644673C60D7DC2759F91D052C64CF4FFFB7BD9AD B+TVv
961,953,472 *644814D44B755820F17AFF7564C1667D5656ED76 BTW.)
961,953,473 *644A0E1F9B4B4401E2D8968E9DE5A8FB481951E1 Bt$W;
961,953,474 *644CA3C5467CFE26E1CA222EEBFA54052B7D8F28 B#tW6
961,953,475 *644BDCE95574318032B7D3E90A2B9D49C4E61D99 BtwE&
961,953,476 *644AB2F5EDBC68FC5FB8F5232780A24A34F71A77 BT,Wf
961,953,477 *644FF547C9D26D34C2202B8CFF33CF1330C7C761 Btw
961,953,478 *6443E715EC90F56879BA3A472CBAB73BB38EDD96 btwjfldns
961,953,479 *644EC11C37366C3A52EABA966D9C610E3D50543A B.tWK
961,953,480 *64463950E9BA2AB9C7BEB9D316FD9CEB13697D7C BTw
961,953,481 *644429125CC051006C2E6344CB4672FE5C987DD8 B/TwM
961,953,482 *644D26C4CDA05EF43A29EBA4CE0FA4E979A2B18E B$TWT
961,953,483 *644FB4B46917E7F19C9FE595327769AFB0C056E8 BtWUb
961,953,484 *644022AB01C8E4691796D7A26775C1C366B313B4 BTwWS
961,953,485 *644F2C732C43EECC674C3E1F44F63149A7D25B33 BTXhM
961,953,486 *644E2FE7BAEE0972B53172A0B168A1236CBDA01D B+TXp
961,953,487 *64464A645A3609046B9ACE4412FD6DA4A6E55817 B:tXv
961,953,488 *644EE3CB81BD37F2550C6A45083602153899DF10 B)T:Y
961,953,489 *6441405F0CB4424F9501B1EB3E2A18F097091949 BtY0R
961,953,490 *644E7564D2CC44772C5C652EAD189E6ABC292F4F BTYKq
961,953,491 *6443D792136EA73155A5C4AB1C05F6AC4049841D BTYwB
961,953,492 *644F1E68C0D0585772B484513DAA8100E5328846 B/tYX
961,953,493 *644F1CB21F735880F51260D36CB4B8DFCE1D3296 B,tZB
961,953,494 *64468FD8F19D5D1FBEB369B755ECD21DAA2265BF BTZbB
961,953,495 *644A23AB05BCB3A179FF8BB34CC9D3EA076D0C77 [email protected]
961,953,496 *64447A5E25680D9962EC6A2DA34A345CAA34EA9C BT_Ze
961,953,497 *644EE772686E8B411C3306E06051812A4150CA2C B+tZe
961,953,498 *644F4EC1BB1BE6A1A25542C21727015F22698A84 BTZFL
961,953,499 *64403BBFFB13C4FB633BAD4FDC9D52AB015933CE BTZ%G
961,953,500 *644156C8441001165B8C52AE08EFC467C63B3A33 B.tZI
961,953,501 *644AC15801439E23C01BEFBC390DD3268C3727A2 Bt+ZP
961,953,502 *64420B7E78042BCF06FFCD0FA8CF17567D7C9EBD B=U%;
961,953,503 *6443F12CC3456DEA79F1C6C37DB7E3B15CA11639 B-#(U
961,953,504 *644D6D4332A08306DD403241561A73AB609D0489 B,U+=
961,953,505 *644B5F48E82F2BBEAEC8FA56B2549F33906FC655 B##
961,953,506 *644F63B2C9AA969BC0AEE29446A83BF978BE160A B!u-
961,953,507 *644B75907C6D928E278E8BBC83E9C08A0D77DB8C B./u/
961,953,508 *64492CE60E466E6B68DE62E53B4C95A65050906D B.#u-
961,953,509 *64493F8A298B4BE5E1979FB9613EF0D26A4E293D B((-u
961,953,510 *6443F0BAA9CB4D7FA3AC96FB29BD87BC0A5D65A7 Bu="-
961,953,511 *644E9F5FD2706734664E2EEBEC959A25E6B1B2C2 Bu$,-
961,953,512 *644DBFE9876342C1174DB612961DF418A009DFB4 Bu$&&
961,953,513 *644E66C09CF5590976613CEAB4A9F23D001B9008 Bu+";
961,953,514 *64413983409C50838BCCD7B89891A3E28511C665 bu$
961,953,515 *6444826F6969AE95BADB633193FA10AC17188280 Bu0"!
961,953,516 *64417A9E41185E9AC3EAC2D7A47DBB1B7177CE49 Bu0+0
961,953,517 *644EED80C914306200C4F46FAB793B9AC2729AF8 bu00180605
961,953,518 *64422B338FB3DA8D831117CD78E91AB9A0A912FB BU00580004
961,953,519 *6441D73C6AA19748063CB3394A53FC51D23D384F BU01411209
961,953,520 *6442F6AA663B2AF12F31C0002506AA44750B6FA2 bu01770407
961,953,521 *644BF493FD6D7045BBD21E13CA95FBA3B1DA7191 bu02282032
961,953,522 *6446458ACBB16DA5969B505C4403D65D31815F93 Bu0:3
961,953,523 *644D09E45CC7ED598C15034F0EC83D46E29A002C bu08240108
961,953,524 *644293E5D204A6B69ADD3324C85CBC0A733CB838 Bu0$H
961,953,525 *6441A4C45F24A07E017D1BD58F2768B5C4DFA5D4 B=u0m
961,953,526 *6441F24AF6D09AEA4C4708F1E78C5D8BDEBCB758 Bu0o
961,953,527 *644456A8BC27EA6F141D9CF6A19D7040DB7141AF Bu%0o
961,953,528 *644BB3C4711DA432DC3D65F50670A99C214B7774 Bu1!/
961,953,529 *64438D3C4D487113ECC96B6CB687EBC26920EAD0 bu17080500
961,953,530 *644AAC66206DB8C131F502946EF833C023E713C8 B!u1B
961,953,531 *6444626C9FC6F7276C854E729991931049B9D9E3 Bu1d5
961,953,532 *644B2384DEBD812A6A34D050C7254F3D5CAAA226 BU1jY
961,953,533 *6447DA841A9F58E537D5902D4778ED77146CE81D BU1rj
961,953,534 *644458DB94757CAA1F610EB57F91A04ABBD3CC4A bu1rush
961,953,535 *6443C12A6AF53474637C389A8ADEF8BDDE1BC476 Bu1tj
961,953,536 *6442A5A0E6F010C5C608C71F3ACF5FEFD58D36F9 Bu1v4
961,953,537 *6447C8097E3A4F2B929467D55BA6881C053EA972 B+
961,953,538 *6443E1C45AFC63800131BCA2782D3279E8B5C737 BU2hf
961,953,539 *644A12A48B368B29118DF6252B6E180F31B18956 BU2Hl
961,953,540 *64496ED37B2A23E97BB2BD72D1AA6F5D4F1B6CBF Bu2IK
961,953,541 *6441389D50B15EE5ADD8808E556ED58780B29F43 BU2q_
961,953,542 *6448EE5FE4300D327B5496ACDB6FF59C97C8F658 BU2S5
961,953,543 *644173CCBAE769D71153D8F3D77A16C4E3E00CE5 BU:3%
961,953,544 *644B8D5A961D942C7F72517090E65209C50E6926 Bu%_3
961,953,545 *6443E4EDA7EAAF5F637F93CD7CE68E0E7FDD1250 BU)37
961,953,546 *64455613AD534510CE92721F6B880C7477DE2DB7 BU393RZV
961,953,547 *64471F76CA8DA07F2985ED5B3999FF21D78780B7 Bu3fu
961,953,548 *644F2C0BCE7CF6F8B7F34C8DFC5D9386F1D26F92 BU3lH
961,953,549 *6442B0D0DAA989FDDE49129BFC0D4FE8C50EA3C5 BU++3R
961,953,550 *6442D093325AEF31BA4C57CA843A2C41E8C8C245 B=U4m
961,953,551 *6449F55B550DD95A4E22736187F894F89D621CD3 BU51X
961,953,552 *644123CFFC02244B6F7729E1B29C088E8060E868 BU$54
961,953,553 *64462C6CB4404621B886DA61CA27A0053BA4CE10 BU56)
961,953,554 *644696E526264B7C52EB4E98BC3DC98C34211F66 BU5f_
961,953,555 *644E28B3336DE44E498BB4001E046C285F2253B1 Bu5
961,953,556 *6449F459D69EFA9887CE7A354BB1411E8DEBB7FE [email protected]
961,953,557 *6444C519035F6F8F2FB928050E1515757CF1F487 Bu5+V
961,953,558 *644CE9456D0532BE83DA790A47F221FF5AD09ADF Bu5Y=
961,953,559 *6440C439B11919853CB33C7A4733AFFFAA088C97 BU5ZQ
961,953,560 *64412256F63D91AC0EEB13E241B966B4EADBD6F5 Bu6,q
961,953,561 *644B9B6FFE80C02B94A8EC0D75FBCFB519DFEFF0 Bu#6R
961,953,562 *644CBEB869339029ECBD527B94C87665190F6491 Bu6ZL
961,953,563 *64471FFDBCB0FCA8D4FF598AE1D453BFF3FE06C2 BU77ONHO13$
961,953,564 *64421D30529C43F23DB39F8D55F4D5BE1A852CCB B?u7b
961,953,565 *644D9A5EBA00F2469796A234DCA209F49DD367E6 BU,7c
961,953,566 *6444A958111CE2D2841A702882A121AEC1CE0238 bu+7chery
961,953,567 *644926B5B4F61A8710E3A5DB1F91E7501E564885 BU7jA
961,953,568 *6449790519D585F0F0E19C46DEB40FACFBD59671 B!U8:
961,953,569 *644C3F022D0A8FD9CB7FEE5012B6DDECA32510C9 B!u=8
961,953,570 *64423791C8BCB6A3FE56DCA94BE414AA8BE623EA Bu8/+
961,953,571 *6448337C723546D18AB2DAD31BC177D80981E4A5 BU8bi
961,953,572 *6442637D8B66BDE637DE153B70D1087FB8D11C24 Bu8qv
961,953,573 *6446F6E551FBC44F30CAF8EF4DADF0D23CB7A39B BU8UX
961,953,574 *644563901EC1E73A46ECCBE45152687B7C559E48 B(U9,
961,953,575 *644455908DA0A95675AC7CDAA4AA124DB25984C2 B:u"9
961,953,576 *644AFE8121E68D63E71A93465CFC4350FDE2E96F B&u9=
961,953,577 *6449D796C8023554D8F7E30A0D4F56383FFA15DB Bu9?&
961,953,578 *64425F9002C3AEB01B5DDA6138DE1F81D78FF998 Bu9
961,953,579 *644CF30A00156B6DB3569648E88DB9C8D3F73047 BU94e
961,953,580 *644C1D9D47FAFE6EB6A8DF65E02B0EEB953D10F4 BU969
961,953,581 *644CD02809A0DB05DA71FE7E7BB1DF32343DDF46 B!u9a
961,953,582 *644998BFD22A2255BD7FE0A658FFC1F6EF75D80A BU9hX
961,953,583 *644AC9047096B0B7C18887DF0CFCA9CFC75CCDC5 BU9i)
961,953,584 *64466C056A2BDECDD7E0592ECC452F2C96B54198 Bu9-r
961,953,585 *6441B9694DE1E92D2057B8D1C2E6D6CCA2644620 BU9Y8
961,953,586 *6441049DE1F48D348DAEE84EA31E7FEF66ACDEA6 BuA19
961,953,587 *6444D3DC675A008E7CDE70F7B21D89DE7FF4DBA6 Bu=A8
961,953,588 *644D231CAC86C634966765B37B5FADEF4F6AB440 bU:aa
961,953,589 *6442BE615ADB3BD474327211795F096C5EC14FAA BuA/b
961,953,590 *644A5B659379622B2387453C98504CB645C39E8C Buaboocha
961,953,591 *64487E84E4D6BEE1D40DE0838CFD852DF19C6957 B-UAi
961,953,592 *6447DCABB25187776198A38C52DA8D3430628D55 B-uam
961,953,593 *644DD89F52BC2E640B43E74D4FBA8342BEC8BCCA Buartiezed
961,953,594 *6440C9BDF83B85598AE3A0D715157C21DDFB24C0 buasta1234
961,953,595 *64487F146796E67BD038BB6D96010B6ABAC9B336 Bua:T
961,953,596 *6444F16C0255ACF4BE2A15028DE8EF558D789554 BUB:&
961,953,597 *64420B1590854464E12DD7146D4932D31F2499BB BUb+,
961,953,598 *644839A10A91E7C8429C3C557B8E3DAB5D759620 BUb?0
961,953,599 *64466B14600DD6C551F4FE4AD91D82024700122F Bub04
961,953,600 *6440B16FA5511A9BB30006673AEFA83B78D88155 BuB5+
961,953,601 *644A6ABF8E336BF75C091D35B4F94DE89F6458B8 BUB9h
961,953,602 *6440347BE594CC9390D45259CF181D098C9CE4BE [email protected]
961,953,603 *644EAEE3456635D577FD605A3A2EBED1C8A779DA bubamare1
961,953,604 *64487007E7AD2FFF29D0F79A26EDEEAC56311C79 Bubasmo1
961,953,605 *644E484CD9A1A3CD930E3F08751B17A5A4ED2783 BuBB)
961,953,606 *644BDF3688F65B902E58EFF1E4B6E933B69E107F BUBBA1FLETCHER
961,953,607 *644EB79735E4A8928F5B1471E8B491A5D358BEFC BUBBA1LOUISE
961,953,608 *6440946F8E94B7868426145D014E3FF40D038293 Bubbaholas
961,953,609 *6447383BC2F3B14A1463CAECA2600029FEB38574 bubbaones
961,953,610 *644BD0A171093F00302C4BFD978F7BE114F81CA7 bubbatrucks
961,953,611 *64480B5F3D35EE67AEBAFD168391DD01CC15B0F2 BubbleInfo
961,953,612 *64439DCF3B2FBA873C74FF73E64F0FE652BBACE7 [email protected]
961,953,613 *644E6AA0FF3AC3CF5E3C4C545ECB955DCBD25691 BUBBLES145
961,953,614 *6448ACE6B6B050D17BBB83A640D60AA5C6E901EE [email protected]
961,953,615 *644430AB5EABCEA0E4D848285C2C3FCC4AAE9A1A BUBBLESERIC
961,953,616 *64468314906EB44A7059128C877BB34488068D35 BUBBLESSAMSON
961,953,617 *644C4DE16E2D589FD5DB9B69CD87EE095E1DFA6F bubbly2004
961,953,618 *64420CB50835BF3BD169E007640191008F8F4BFF bubesz1234
961,953,619 *6446D95B47A44550DBC4E01FA5EE874B84F04C40 BUb,i
961,953,620 *64421D2023E25DE14B35D88EE017A269032959FB BuBK5
961,953,621 *6449AC18D9355D9DA6D9176529CEB430EEB3A463 Bubnjao5
961,953,622 *644066A756BA8979B3FB75DF04BF2E96643D11E0 bubolare0
961,953,623 *644DB0BC167CC542183C75B7D1C7301E83FD2A04 BUBONICLOU
961,953,624 *644068F8B9DAFD406D0F2209F0D222B43E0BE08A B#uBr
961,953,625 *644674E5744791EDC30C1A9DC174C3E862B1F16E B$ubS
961,953,626 *64409AE85A458A1BAE78B9384B7C242027A7EB89 bubu90272
961,953,627 *644A9E4C200DB671045716E7B44ED524DEF177E4 Bu"bX
961,953,628 *644DEB109EFB6A2955AD51626D937F17E5D571E5 BU=c)
961,953,629 *6442796EBFBEC6990E7643B3C58DC95863D57931 BU?(c
961,953,630 *644B0BB8A4F47F2941DB332BB32F6221D0ECD693 Bu=(C
961,953,631 *6444BECF55B1D7D1C1D86FD7D1F865F62E32AB75 B!uc
961,953,632 *64499E158FF376CE3595E92E52FEA15FAFF87442 Bu"&c
961,953,633 *6442EF047AE1EDBBEF0F6EEAFA67EE8E1B7587DF B$Uc0
961,953,634 *644A33907CFC19948016F09B3987C8D9C9A09B60 BUc21
961,953,635 *64485D78D6A12325F50E7175D6D909DAEA9B608E Buc5l
961,953,636 *6445FB8573F393205D1D0E7448D7EEC9C02D1289 bucadeva1234
961,953,637 *6447CDBC0CA82017CF863EC40B16E922ACEC6726 BUCAS101
961,953,638 *6443CC4B1A02C1674727AE932644C98A32EE74DB Buccleuchi
961,953,639 *644A6313C799FA85A0BD0A56641EE842CAEF7A95 BuCGw
961,953,640 *64457487953EF7E87A0945E38F54562A6FD80F9A buchami01
961,953,641 *6446B1C73329B4C0FB528E904DACE1D4C2A65B3E buchamma
961,953,642 *6443F5F0705EDC72029ECBFBF4A867540C46FE4A BUCHBERGER'S
961,953,643 *644317A6F140931B6A44568CFF1734108B65449A buchenklima
961,953,644 *644D2663C03D9BCD95C472618BF80D2E18E2A6FD buchhart3
961,953,645 *64482D4881EA061DEC9DAFC325B58D773FA71C24 Buchhop
961,953,646 *6446674C42D7F1145388FFDFA3FC4E2459152E02 Buchlas
961,953,647 *6447FB260DFD5F3A8A6A174C1E492B9FA1595404 buchleitengasse
961,953,648 *64407AC2459BCF9DD26C5164439719F6455C901A Buchmansed
961,953,649 *644A689B79AB88E4D984B0F7A5ACF39A978C75B9 buchraming
961,953,650 *644C59AEE48BE850E5F0D6CEF77B3F5DA810F532 BUCHY''ET
961,953,651 *644FAD9FD981DCD675BF99D3635B6136712BC9FB buck.aday
961,953,652 *64413E79D7EE78D40FC5DB274C7B796031504092 Buckagh3
961,953,653 *6446DF38BC90D700EDCA061CA118274129D45689 buckcgj9
961,953,654 *644227B06EDBE6F8AC7C57DE759C66C60DCA266B buckcooling
961,953,655 *6441393EF3E49E4ED80337835A828B5FE39E3B9F buck.cupelli
961,953,656 *64491FB21C07BAEEF8701A446B715730C645F5A0 buckcv67
961,953,657 *6448F0E5B6CCCF5543CF0EC52AE9D2F9F3D6F7D6 buck.davolt
961,953,658 *64470F09125F407D6428B092B196370F1C64B35E buck.debeer
961,953,659 *644FF64301A34641F85455C974721FE3B1743327 „buckeln“
961,953,660 *644D852303B0A3634F6817692E2AA9F621E34115 bucket 't'
961,953,661 *644DB4F2C9AD9878DA285B3BD2CF7E8BBFD6431D buckeyecablesystem.comwww
961,953,662 *64402EE887027D3D7547CE4094426BF8491475DE buck.gleiss
961,953,663 *64442D8235D662167F7DD85F62B6F48C5045DEF1 buck.gremillion
961,953,664 *6444070D39A8544EC3DB9DBAF14A737B62AC1D14 buck.heater
961,953,665 *644D39B10F8BF590A8A2455CADD97D0E400B8A84 buckhursthillonline
961,953,666 *64411720DC3E6466FB075C6D84CD0B5DC8D77641 bUckiNG
961,953,667 *644A7C05E04B91348C2EBE1A074FFD1F0673534E [email protected]
961,953,668 *64471684DBC8DB3C1F189559CD899620D8A5E33F buck.kapsalis
961,953,669 *64497F743CFBB16FF14DF6D94EE3D6652A517257 Buckkaren2
961,953,670 *64409A4F8A5C2DCB60B8D3E9665CC53335194E07 BucKl
961,953,671 *644ABD549F6A3AE4319FB285BED48A1FE5AB6C72 buck.lamond
961,953,672 *6448399FAEC93EF9CEB3B2B9EEA588C84C1689A8 buck.lashlee
961,953,673 *6441C318B517C5CE8ABDDF94A83DCE4F5B9F7D0D buck.lech
961,953,674 *6449B8DE2E6C3B845ACAD308ECB8488C543E8151 BUcKles
961,953,675 *6443D73748BAA0729CE14C7F775120A958C0555C buckleths
961,953,676 *644953CA180A5B1299A98BBFF52FBEA020FB78E0 buck.moree
961,953,677 *644200EF9F80671670035686E604D37845035E10 buck.munhall
961,953,678 *6444543D17C7983D01F18258B7B50CEC3567763D buck.offner
961,953,679 *64441D1710AD5CDCF06F685DF94522E709E7D894 Buckpeter6
961,953,680 *644DD31486DEDE8B1F38BA0E528F0E1EF0E5E292 buck.romar
961,953,681 *644BE0573796B54F66F22D672E52CFE9A4E8C26D buck.roots
961,953,682 *6441EB98AC633357C8E0AECC2780FCC59CC1D223 buck.rotenberg
961,953,683 *64487FA3713209DB747511CA3B58A389FFD859EA buck.rybka
961,953,684 *644DC369B86585D305D52BB54CA5EB24314A1367 bucks88
961,953,685 *6445EC8FBF1784ABBF1C40DDA55D59665BE2D66F buck.sark
961,953,686 *644B142DE8953850BC7D9DD263ED82BC85922935 [email protected]
961,953,687 *644E4D1F3D11E87391CE90E97D2B052ABBD83DEE [email protected]
961,953,688 *6444047B7843FED64C24D87B816E0111FC1322C4 buck.som
961,953,689 *644DEC175ED313DDD2EFC7C5FDDEB85992D0B470 Bucktho2
961,953,690 *6441816B100E0951E85E5F3356E4C74DCBAC4C38 buck.woller
961,953,691 *6445FA4F7FE0BBC290AF1F5993177F45DDE66F1B BUCKYY09
961,953,692 *6445D88FED79317897738B3C05CD417486AAC2C2 buckzeller
961,953,693 *644782FCF88B0F95151AD6BEB64BE139FFF0C8AB BU+CZ
961,953,694 *644AA1E5A3DD59F9B5ACDEC23C9F8D64972C4F10 BU/D)
961,953,695 *6447AF59489906C16C5B894EF5B983E6E18C8C96 Bu$D.
961,953,696 *644F9A2EC0C2284479069EE7B7E958FE4A99C95F BuD((
961,953,697 *6448311A2F01E479ADF8B554E783F11BF02E5C4B B.u"d
961,953,698 *6445B491565E42EF03E3B0303B24E117F64F7BBC Bud13ss
961,953,699 *644D39469F12FC113A17DC9D5631E5B7AA3487F0 BuD20
961,953,700 *6448FD847327D9753A954E63172258BB59C3B0BD BUD2w
961,953,701 *6441B1B8FC6E346A9BA97C31FB1893B855425A41 BU)d3
961,953,702 *644471F476B83FB4253FF539B35F0F4AB5A2E88D Bu.d3
961,953,703 *644ABE12493FCD1B039B3688E38E98A58197D9A3 Bud%7
961,953,704 *644428543A959B28D1B7CAABC148C1663934F5F6 budaes09876
961,953,705 *644D4D40EDBACAE9E771C88C81230D3B4FC13C93 budak gila
961,953,706 *644782B1F30DE7433D2BE7A765A8EB1B11D59D68 bud.allphin
961,953,707 *644E77CB135803C3DB17B1577508AAAA2903E12F BudapestDSCN3639
961,953,708 *644E4EA311C153908AA8AA173F7C55F05224F527 BUDAYBUBU
961,953,709 *6442294F9B4F5AD148A64709523EF1FA34DF7A6E bud.caneva
961,953,710 *6449900C96C5C7F6928831880B935D8F80AA6C31 bud.chuh
961,953,711 *644352001686F3EBF6F6E09742AEB43FBF67C658 Budd”
961,953,712 *644ACC7AEBF37A629BB6CE67168E066AE680FF2D buddahmicompo
961,953,713 *6448BE1FB909CB9CC5F57A0E608DBE240AF6A219 bud.destephano
961,953,714 *6448489388E3F323B6BD6ADDEEBD5CB72844C2AD BUDDHA10SNE1
961,953,715 *6443755A4A4F667E244DA1E575F043FD449AFA53 [email protected]
961,953,716 *64426C9B595007D00748E2E6E24DA1278879455E buddhaas
961,953,717 *64414C2BB9CBAB132DCFAAC538496A7000443578 Buddha Beats (disc 1: Joy)
961,953,718 *644865485B48021ABFD215609A432BFF5033C704 buddhadev1
961,953,719 *644396B99A4A0B3C19177B3DFFDE3D91EBF76A9A buddhistchaplain
961,953,720 *644A9719B5875C62B979FBDD8AB41C2150576CE6 buddy.ashlock
961,953,721 *64461EA044B288757ED3C1640C71B2BFA261DB33 buddy.ayotte
961,953,722 *6444B48F7415C10036205B15577984A4A7870052 buddy.bally
961,953,723 *6445FF301EE2121C1BEA766CAEBC8F9EE9C55A51 buddy.disque
961,953,724 *64471628A0F0FF0647951BB96BC8A61D0C196BA7 buddy.douglass
961,953,725 *644F9CA7A5DC1378E73DA8238616AED45370C896 buddy.dulemba
961,953,726 *644CBF9EB194609A45FCA848CC268B96CB2311C6 buddy.ebbert
961,953,727 *64437A30D2C42B0E595BA1BC10C889487A34689B buddy.espenshade
961,953,728 *644303AEC08F5E9AA403F32BC5FEEE58BA49EB1C buddy.galletta
961,953,729 *644F5E94742A47E1F85B43037869ED9698C24794 buddy.kaltefleiter
961,953,730 *64481A9D1488CFA83A281810EAEA553E4D328DEA Buddyladdie
961,953,731 *644C2D2431570AB3A2B30FD2C1C6626EB3E8DA64 buddy.lalli
961,953,732 *64472280441316A1562D8785C15B9B00D8E841FA buddy.minery
961,953,733 *64476384F1005FB047D2D53D81B945B56C47933D buddy.muscarello
961,953,734 *644CE3888BD3BB03B62D7D37250D8268EF5CF6AC BUDDYOFMINE
961,953,735 *644084C88ABB694522C5822312E9D0A51A53B21E buddy.podewils
961,953,736 *64488CB5926E1C2714A28B379CEEA46625A4F9EC BUDDYPOPE2
961,953,737 *6445739ABD36DA34B107EC9D273B5EE9B7CEA0EE buddy.posley
961,953,738 *644070DDBB851B6BF6556E4FD8B58E4A084045AF buddy.schuster
961,953,739 *6448228356921C4540B819B2C5F066D3EAF19EAF buddy.sherrock
961,953,740 *6440BA4F9F07279F8B0AB399A1D5D773B6608C12 buddy.strauf
961,953,741 *644F9ADCE844DE1F093201494C24B2997E4474DD buddy.sugar
961,953,742 *6445DD8C89A17FF31527DFEC8F9C4E24C9C37A2E buddy.szerszen
961,953,743 *6444943CFFC15F15B62B02D311EB18DA67CFFB90 buddy.utzig
961,953,744 *644F11F433BFE51A6BEE6C174A7C0AC79068D232 buddy.wesner
961,953,745 *644262A1B412E8740638D5EBF2774F6138A06031 buddy.zaritsky
961,953,746 *64449D7199747FC7CE49C993A71556C831EB67D6 budejovice–
961,953,747 *644623CCB34D22B2A0E78962D605D11EA0B3DAA5 BUDELLONE
961,953,748 *644E138B4A8310D64DC7D2ADE583E6EBD6A2A756 bud farmer
961,953,749 *644EF63996A14497C3D1EEFD6E9552EBC5418519 budgetisons6
961,953,750 *644DFAB501B8F8D0A00532526315C70090BF4A90 budgettalk2001
961,953,751 *64427CD448ECD319602A004622353D1E250B8007 budgieabc
961,953,752 *6446638957FBF2824951ECB220EC604BC6F15970 budgoods
961,953,753 *6445C0BC8C0521D1D87AD57268F93F740DB3698D «budh»
961,953,754 *644CA464C5D263F235F653323E4316412437D791 B:uDk
961,953,755 *644C60A49036892B9450F2069B85085E936D2507 bud.krell
961,953,756 *64423504E1F0DD7F739C1D91C980E94CE5186773 bud.lily
961,953,757 *644430D94E895600B173EFD26737FF7908BD7662 bud.muth
961,953,758 *6448310C6CB008F6D9BE09FAAC721134F721D6E8 Budowlanych”
961,953,759 *6442585694FF33ED275E7481C5F97E0D9CAAFE4E B
961,953,760 *644B79CEBD3557CEC485AF932E4EDD14F7B27BCD bud.poythress
961,953,761 *644DEB57E1A421287175A1DE24E485027DB4A91B bud.pro
961,953,762 *644D81D6DF7B852F714A942951058FF5686C2337 bud.rotering
961,953,763 *64474EF267FFED80D6CF394B931CFB981A84C089 budsjettspolitikk
961,953,764 *644F526385601DC7F381262AB06D8DE81DC00BE3 bud.stankus
961,953,765 *644846A726E02C851538360615534F26CE821014 bud.stouder
961,953,766 *644AD045C74710E746A94E1BE9AD88F4310DE669 Bu=dU
961,953,767 *64465267AFBAA024D56988AA90648ACF4FE14F78 buduil
961,953,768 *64442DA7FE7A7E9FAA0F6159BFAA5F89DA79799B Büdungsideal
961,953,769 *6442B0EB728BCF0A00AF4CACF813231DBDA534FB buduszczim
961,953,770 *64472406BE51B17B5E269F884079DE6955DDA850 bud.vadasy
961,953,771 *64422AFD011DAB8C4040AEBA90003CFBD8B8CEDC bud.vanschoyck
961,953,772 *6447A24C8B743B8EB37DFC46360A3A8E710E2927 budvaru5
961,953,773 *6448AE807A13241926C130183DE58729EF609694 bud.whispell
961,953,774 *644A06525E62D82EF5112CE018D8C7208C7473DB budwood.
961,953,775 *644C629B649F45EB0B4E55A8717015480410ECEC bud.wroten
961,953,776 *64468E5A2637B0CFBE3E1592699E1B16A522925F BU/dX
961,953,777 *6440120E9128714FC33B3D2A5575D5DAF3C3F8C2 BUDYF
961,953,778 *6440926FEF1659E8A37F1CD54543BCE0A6F7DBB0 Budzban4
961,953,779 *6448749414930921635306773FFEA9FBBE243BC4 bud.zebel
961,953,780 *6447FD683C5F426703FD24B64CDA6C15FDCC5FE6 budžedra
961,953,781 *644F8C63E9D3AE425DF1A1C55BBB262D91D6EAD2 bud.zitzow
961,953,782 *644038AB9CFAA249C674C99ABCB0D4A9E8CDC62C budzma
961,953,783 *644E3445E4EE9F73947C963C979019A9B09C427E BUdZv
961,953,784 *6447FC869270AB4028CBD6582658AE1116EE3863 B!UE=
961,953,785 *64416938C72E8A10854A1963EB3E6FDAE7C74367 BU()e
961,953,786 *6449B7CCCF31CCF6D4FFCF873F60ED0D107A2F0E B%u&e
961,953,787 *644D961F3C8CAB6378E8BE80C1AC20D89EB910B7 Bu(e:
961,953,788 *6441ADAE2C0638FD9873EB205A1D1647DC962CF7 Bue5M
961,953,789 *6449FB27746CBCC5D27FB8CD2FBBD1B0DFA6DF67 Buebi1963
961,953,790 *64473B50C1806EC81DC09AEA938D3A47D9E14513 buecherw3
961,953,791 *644F5066FE3ADDDBB8573D33476A0490D2BC6F4D buechnerpeter
961,953,792 *6449A9C0D49DAD555EC220F17302D427F725258A bueeses7
961,953,793 *64489401C79106733C658473653CA305B6243E38 [email protected]
961,953,794 *644A8D680B320A626E514EDFAB597B2AC1431B44 buejtiesdurrienjaevrie
961,953,795 *64491D85463F091F1EDF3F1E69A6EA6E48BE47E3 BUe.M
961,953,796 *64420C1BAA00D60D725B36624AA9698BDCCDC554 buenas noches, hija mia
961,953,797 *644098F46B0885F5EE0E99032020A6F3ACE68A5F BUENSET
961,953,798 *6448B4EB49BD85346A4C6309BBDAE98AE28B876A BUe!O
961,953,799 *644DB97B1989DC408D2D4957795FBA1DECA980D1 Buergern6
961,953,800 *644910AA95486DB3F06207F929E3072947CF3238 buergtet7
961,953,801 *644371DFA196D273F014038E7D0D430BC742AEE9 Buerokrated
961,953,802 *644E3A19F62938BFB99A904810172677F88479C3 bu++erwr1gh+
961,953,803 *644B30A1BD099F6E65F5129AFF3AF46F81B1D2E4 B"ueu
961,953,804 *644A75450DE845F0F36CF84F13C4BCEDC603EF9D [email protected]
961,953,805 *644487428834C1F6BA6DAF53BF31967159354DF1 B,-Uf
961,953,806 *644B949919F14495C8DAEB12938994EEDF50148A BUf)?
961,953,807 *64453CAD54951AC7402B1989E8751A391DFBF89D bufCG
961,953,808 *644C98F7A2114D4D5690373B0C646D479739F067 Bu!fe
961,953,809 *644A68056A7599EA8E7C4DD5E506779A591D6868 Bufenbarger
961,953,810 *644EC825AC21A5310300DE475DFBD9B44154BF05 buff[255],
961,953,811 *644EAA003F664B8993342BC5A9D51B462869B402 buff3r3r$
961,953,812 *6445652362A26AA6DC26894A41AE3590FD576381 buff4l0 c
961,953,813 *6444087D25905C400A2F39B1B77A8C83CE26C74E Buffaler9
961,953,814 *64435D9564A477FE67633D124AD7305A51CBC88C buffalo springfield box set
961,953,815 *6441F12077425219C397D8C6F772328C71F9D11B Büffelbauch
961,953,816 *6440F7EA2F02BFE081C736208BB59EACC2F0058E BUFFY88
961,953,817 *64405874A83441F8B8088C50EE792AABDA5944D1 [email protected]
961,953,818 *644D850DA348853D0C201F2E755C126232A4FBB9 buffydog5
961,953,819 *6441212B0DD8DB4E80890414D812935F1748F7F9 buffyisin
961,953,820 *644C7FE4F05C5ABC01411588930C9ADD69F630B7 BuFhf
961,953,821 *644331507413D0F6CCF73F1B6585337A69B94C81 Bu,Fn
961,953,822 *644B04F089F94CE43F84C9B0E0334DE94287219D buford.bernardo
961,953,823 *64440C1C0BC19EF70C66C6EB7530365D62475E93 buford.brasseaux
961,953,824 *644B134A45A018F6C9532DF400658D31B0847927 buford.brroks
961,953,825 *64473AE04E70ECE856EFC6DECE3925DDA03B8D1F buford.cassis
961,953,826 *6446C43C1721B8E7B98F35C2DE09342B878C4481 buford.christopoulos
961,953,827 *644DC324B3B16D2965E09A04D89BDD6390AEB23A buford.cusano
961,953,828 *644CA8C02526B2A6159156F1E3D849B81D586D8E buford.delgreco
961,953,829 *644960324A7AD1FA617975EBC0DB51436A2177AB buford.derx
961,953,830 *644AB205FAB9338A38345535048E2915E11C768F buford.eanes
961,953,831 *644767CE2CB627C49F65AC22DE52FC90ADE55579 buford.egel
961,953,832 *6449D299E5ABD26D62E177C249F91777739C8D30 buford.gitto
961,953,833 *644EAF29A161A887A096FC4151F06FF77213AD4E buford.hackler
961,953,834 *64471D7B5CD908AC1D35B6597819F0A129066E86 buford.horvitz
961,953,835 *64439376BB88F6ACEB68957239D9C82E5DCF031D buford.krysiak
961,953,836 *64412C874543C52AB1352EDCCE0BD64763B56228 buford.lich
961,953,837 *6443394C52876C048C23480A77B6F354D245B8AE buford.martnez
961,953,838 *6446A47000025AACC89D3B301635EB4EF0960184 buford.muratalla
961,953,839 *644D0BD12867CA8F9A6F517168FC0747C438DF00 buford.prado
961,953,840 *644005D29859D5AAE380559F54003D03AF16925E buford.przedwiecki
961,953,841 *6440B47E0F8F6D0D46F1B9F928D145AB71E35D7E buford.randleman
961,953,842 *644DCA1AF77CEA4EC45CBD09958F25379760DB7D buford.sance
961,953,843 *644679B5C94B217716AE1F063F442FBC8D9007B9 buford.scherbel
961,953,844 *644CF1FFB91BFBE60F6A4E4E2E230EC300600E0E BUFqC
961,953,845 *644C386BC1A976588FBF3023E2B8CCE2C3EA6815 BUfsC
961,953,846 *6449F51F5DB02841A120977B1659FE479360DDF9 BuFV_
961,953,847 *64449429F4AC1C7D1E5DAB206730735CC21FD7FA BuFVk
961,953,848 *64493588F5BF20E7331DCC7203A4945CD06C483B BuF%X
961,953,849 *644304F0C1B2251CA6F5DD94D0FC3D9E5C786B87 BU"-g
961,953,850 *644DA08FA69BD471C331F0306852B4510A3E535B B=u;G
961,953,851 *64470F2E31F808A1551E6FA6D4323CAFBCD56EDF Bu
961,953,852 *64414CD2B6A94BEDBB9DF249B25D981B647F154C BUG1717
961,953,853 *64455179DBAF9B6980923D63E68025C2E4D6E6A2 bug3256
961,953,854 *644CEFE13A2A20827696F4511560E370593EDB2B [email protected]
961,953,855 *644AA014FA08D2BA2B372922435B6861705514B7 BUGA9Q0DHN1
961,953,856 *644630F3E1A65BB5CE97B34C6AC1AA42C98310CC bugăt
961,953,857 *6448EC197EDD0F18312B875CEC220A9CE7AF1D55 bug batteries... according to military
961,953,858 *6445838904E8BC6FE6E69BA5A1C05EFE5E6D8952 [email protected]
961,953,859 *6445363B21E5ECA9858939DC2E8555872B4C0B1E bugdire
961,953,860 *644E87DB8B2B3DF7787778DECB66232DF639613E Bu Gece (feat. Demet Sa
961,953,861 *644F3B0F3E49D176FE65CF28F7458258E3583992 bugenvile
961,953,862 *644819970C052B82E1221B21256FB0E8A2264B11 bug.etcand
961,953,863 *6443494604A9F09FB3DDB80938AC975A18E4DC0D bugget1979
961,953,864 *644AC16E1359FA276E2EA1A5077CDB6228DEEDED [email protected]
961,953,865 *644D893E2079974C3947928E2751D8CA64D5A033 buggystable
961,953,866 *644021E19611EE5499CDD88C44EE9ED8FCAFBCEE BUGhC
961,953,867 *644E478BCCBAF9E97115173BDE42B460218C4874 bugheth2
961,953,868 *644FA8A985DA3A99C071F641ABB19CE69A4CC09A bugiardinfernalcolico
961,953,869 *644CBF3C256CB4259D10F8EDB27327C9FDB49315 Bugie1
961,953,870 *644BCA49545ACB0AF212FE7CD21A284414B8C475 BUgk&
961,953,871 *644BA3FCC17E2F87421A77BBC113C8F9683DE19A Bu!gK
961,953,872 *6448B46B0B125DAA819CDFCBA84C6EE46B0DB38A BUgL(
961,953,873 *644B0D40F5457D600AA46DD55AE1268AD400B788 bugladies
961,953,874 *64495DB9EDA8D94E04F9EC89D28521730D8D6324 BugleR
961,953,875 *644BECD6FE56BDC4F6811142227499726ADD40DD [email protected]
961,953,876 *644B4D9B7A4E113296D00DD40A26739CE705DCEA bugmonobook1
961,953,877 *64449DD402AD58793BFD70858EF9244E050696B4 BuGsR
961,953,878 *644E35B08B2EC47EA6C16F1773E8A747F68C02FE buGtr4Q
961,953,879 *644826242F6DE5AEABD610F805AAA678BCE75EAB bugwe
961,953,880 *644F8CEE00A2CA5805E4E473C7FEC827540F4149 [email protected]
961,953,881 *6442F36208CE6E305588C7AB3DBEDA3F88ACE273 BU=GY
961,953,882 *6440A6FAD160267B8AFC11A17181BCAEEFC15AF6 BUGZBUTT
961,953,883 *644E8E8639B279187422D3981275D79F5E20EF81 B(U:h
961,953,884 *6448F3DB7A1A5FB6E8E5FBC8AAAE302C39CDBDCF B)Uh)
961,953,885 *644E6C97CC4314298BC6A9E2DC4FBCD8401B5BEE Bu-H
961,953,886 *644FD2B76EC6DA49F41E5334C01B0588A95AB0A5 BuH1?
961,953,887 *644DDE6BF32F49374FC8013C7A22491AF21B74FE BUH/2
961,953,888 *644F6B99DA4C4F4B840F3A0DE863BA3690BB8A01 BUH9:
961,953,889 *644E9A9262957E0D5775F6CF209EDCC2B832AEA2 [email protected]
961,953,890 *6441FC12E7A7798E01A800B3E5E24B0C20DB5550 BUh(F
961,953,891 *644BBCD32779E96819C1572EB48936E561A56D73 BUHGM2910
961,953,892 *6441926E03B490ED621E4DA6E1FBE9B5C00FF7CB BuhH+
961,953,893 *644A314F62058D672003553BB9877E6A67006864 BUH:I
961,953,894 *64450FF0C8A04CE63EFB69421175593390E869CF [email protected]
961,953,895 *644D9C01C762A5848D0E98F874224C4380C0D19B Bu?hn
961,953,896 *644D8BA4C8B7AB072B3AB98246EE006C77E75EBF Bühnentourneen
961,953,897 *6446253FF5E7C0508D70563805BA26D9EAAB49D1 BUhp$
961,953,898 *6440472BAE76CB10FED4A0F64313DF5F7BEA0721 buhsbntjhbz
961,953,899 *64462C05F2FE4D81E048E93896AC61A8F85F457C Bu$h wren
961,953,900 *6444B3B6467AAC2E9CFD90719A43CCAEDEA8E189 B#U)I
961,953,901 *6447457C4A837F766E0539AB0A00C7E2003549B3 BUi#+
961,953,902 *64416B7B03AE4A1D81F5B1AB1C2A162F616DBFEC Bu(+I
961,953,903 *64410A485D0F0DBD4158C16B57A4D093C55E577B Bui88
961,953,904 *6444E3E2529A35CB7F60D29908FBF2EEACACF8B6 B!uI9
961,953,905 *6449B2CC6A325F10E9FDA258FA334BFDB3B84FED BUIb/
961,953,906 *64448A144860CA3232816CAD8103EDDA62086011 buick-lacrosse-breaks-cover
961,953,907 *644E575957AD8501AC63B9106230B60DC364DB23 Buidelrat8
961,953,908 *644899A0D5073BBF94D69857F1ACD4FB50208E3C Buigens3
961,953,909 *6440656BD2E6BA4AABF6BE4A38B801E5F11D9F4C BUILDING-CROPPED-SMALL
961,953,910 *64462DA27D6CECCB06C77881BFA67F985C2DF99C BuildingDemoA
961,953,911 *644B69617430857B417D6A9405BDC29B467BF760 BUILDINGMODULE
961,953,912 *644B0631F7C41F63895FAF724570124DE2691308 builkisteN
961,953,913 *644B20A96BAA4E9ED86E7F3EEFFE7823A20CE69C Builtmore8
961,953,914 *64454C0C86448DC209D6123C73156739F0ACE07F Builtwell7
961,953,915 *6447A69579BA8AADC9316141B94DA049864E5F65 B'''UI'''MKE
961,953,916 *64488CD7F38D7579A763D1EB17CCFF948E6DE1E4 Buinzahro
961,953,917 *644619F0338FC12570D0007A088AE16C3F7EE922 BuIP.
961,953,918 *6441332AC73601D308578EA7EBE3020B194D3E92 buiqbcfk8
961,953,919 *64465A06A7DF9511A6F658D712FCCBCEABF95C47 buis?
961,953,920 *6441533CF67E31A702B60C1A504053C1FB679431 Buisness4
961,953,921 *644B30CFD3B8EC40D1D888FEDBAEB4D28B92BD46 Buitelen5
961,953,922 *644C0B39B47457640E23F8EC899021C15F532ADC BUITENBOORD
961,953,923 *6446D170D7231B6D22440CC8800C0646B24BC827 buitenve6
961,953,924 *644FD4AB262163116855E8FB5E64B134D6A6B797 Buiteom
961,953,925 *64434B425C5D8F54C53F91A28D0567E1069AC83F buitron2
961,953,926 *644AFE0D369B1F8ECC6FEAF114ECFFDC78405547 BuI)v
961,953,927 *644C7DA94C6E82394F32DA7429A2D4AA8468C71C BUIVN
961,953,928 *6445D2A1CE675F804ECDA0E753AA84BE54376C54 Buje(
961,953,929 *644A8106AA159799E31F39578395122293EC61E4 bujieris
961,953,930 *644970BC84147D338C4ACE78D686CBED8E6FD1CB BUjMc
961,953,931 *644C10697927C45CAD9E6FB2201BD701584327B2 B#UjS
961,953,932 *644F860171AC81891108E4F19A63936F5DBCD847 Bujs%
961,953,933 *6440E65E9E4C22787A886AE8F4EB5E48458A7501 [email protected]
961,953,934 *644D791149481C53A5CB32794D924DB4F4491AD5 B("UK
961,953,935 *6442293ACF1FD9E7D5F9067C23A2270AB1FBD0B2 BUK+?
961,953,936 *644A83A1C21E69DC40BA4C125173803D01B97638 BU#k:
961,953,937 *644C8E828FE976F9DEB0015FD6FD176BE142C886 BUk'
961,953,938 *644A56F6E358CA81FCF41CE0532721220D784D4A Bu(K
961,953,939 *6441117AC94309368666DDB48B6B7D8BE32DDC70 Bu$K&
961,953,940 *6448B40DBC44493E80AF3B055B31525631584FFD BUK6W
961,953,941 *644688209B0E9EE99AF60A24BCFA1E759C800BD5 [email protected]
961,953,942 *644389EE7E16EF0CBDC23ED93F52C4374FDE60AA bukabising
961,953,943 *644476A9045A189526E127E6A85A2159B5F83758 Bukarest1953
961,953,944 *644A93D974F24F95B495BB5AF916E8A21B696FE7 BUKC=
961,953,945 *644A02FE6F74313B9D4E413B16A16BBB4980D0E8 bükelek
961,953,946 *6447677BD10385E259EEAE002FCEB42D9C355DA8 bukeneses
961,953,947 *644AC627E7F9F48CB60B4C56EB316CDA72D6761C bukhalaed
961,953,948 *644B046C73846502C536C9A451C5D1546655B012 bukhung
961,953,949 *644D0AC1D6DF3052115DF4B73ECD924AA26F48CF BUKjv
961,953,950 *644CEF0648D9384C1927D18AFBB250216F9721E9 Bukka's Jitterbug Swing
961,953,951 *644D476F9CFFE792F658ED3358D8F0847981BE77 BuKo,
961,953,952 *644D505D782C553D4E62D731AD97340C57D853CB Buk-q
961,953,953 *64402F0CF2AC4877C8A7453BC5DA8CA7AB91EBF2 Bukshkke1
961,953,954 *644757E58B75179AD0A1C85AE6A2677F0D5031A0 Buktende5
961,953,955 *644226357A3A0E4ADBD44E3F503234F4EF344ECD BUL>
961,953,956 *644CCF799D6F0F0AB1A375A3DB05C2C9D73E01C7 B=?uL
961,953,957 *644FCB66E82AB27BF4CEE0419EA459516ABA8058 B;u-L
961,953,958 *64400B0C6AA1BB85D9B269422C6825249AC8BFF6 Bu(L2
961,953,959 *6447DB24B6F5F23CCAE4536D39AD00716D84D6E8 B?ul9
961,953,960 *64450DA3192E9FB4EC232D1B47C9F1D153B895C1 bulabsws
961,953,961 *644BA2DEC2C36E87D0A20419A907C8CCDC789910 bulandsekhon
961,953,962 *6441387125A9613682C30675A4B00571A30B26B7 BULBEUX6
961,953,963 *64471E006123DA7DEE4B68D3CFDAB948E1D4E2E5 [email protected]
961,953,964 *64448FC5F262440F79B379A0B44651943B958F95 bulbophyllum8
961,953,965 *644B9FB481725F3F72F2B6B85C5A50DA8A250B20 BulbOUS
961,953,966 *644A15314569F99EB50E6462CEAB196826735162 BulbuL
961,953,967 *644925BA1F0DBF6EBD3384A88B34FA82AA8149CB BULBY1305
961,953,968 *644ABD003E5D59245647881F09AABAC21F88D8BE Bułczatow
961,953,969 *644515C104133A4BE9CB19DF03D271B5001D0418 buldoci8
961,953,970 *644EAEC707EFAD8D10BD9A13C4ECBD8F9BC62B3E bulentcoskun
961,953,971 *64429FBB104A3F136C912003F8EBAB3A08563CF7 BUlF(
961,953,972 *6449EE8B01F3E2F4BDB32343720106E69833B18D bulgarisztika
961,953,973 *6446A987005C547700F3887F80D8B8A59899A335 Bulgine4
961,953,974 *644723D9B242ED82447674B3893F5106304294C3 bulgnbicp
961,953,975 *6442EFEDB425060E66F10BF9D549BA4D9AEE73D9 Bu)LH
961,953,976 *64438C98327A52AED14766823760EF40AD2A83C1 BULIMIA-NERVOSA
961,953,977 *64414A7BFF6C14C85146AAADC2357BD0CE2EC8A6 bulimiform1234
961,953,978 *644399F5AD96C8105F5B3C52A9D58F0B93ADBCFA bulkaan
961,953,979 *6440171044CFC89A05C4B8830B652F6F4F9BCE04 Bulladmin
961,953,980 *6440D1306466D41098F2804B99CCBE478C32C746 bUllEd
961,953,981 *64414204B055065ACBF5133B2809103E4376533A Bullepees0
961,953,982 *64421FFB561AA68B6B01C88C1720C2EB92ED1A87 BULLETFREDDY
961,953,983 *644E680182F9C1B20592632381F27633FF91E6E8 bullfrogs0
961,953,984 *6442F88156FC8CB3FA14DF28588067339A17C4C3 [email protected]
961,953,985 *64466C5025543AF6B97291ED92FCBCE038B98B81 Bullimosing
961,953,986 *644D72764C8953AAC970A3C59C4C69DEA4AB2EF4 bullingt2
961,953,987 *644F3E88C79E575F2987E40521F9E840720E16FF Bullmarios
961,953,988 *6445077104A9212E7228E4D3941CD8D78A75252B Bullmastiff62
961,953,989 *644B2A012BDD999C8266B1001BD859D72FF019E0 Bullmaxing
961,953,990 *644BB344F112646C6F4B20CCA48524DC7A2CD5B9 BuLlNOse
961,953,991 *644A0CDF3B41C9E443C28F4A4F798879F02DFC7F BULLOCH2011
961,953,992 *644DD5BB9EA4CC9F32A5E99942C259D23CBCA133 [email protected]
961,953,993 *644427226E464AB857EB873B932CC7D8511A6D8B BUlLPENs
961,953,994 *644FB00A8A862C6B09FE96755B0E7619DAED9C5E [email protected]
961,953,995 *64400E31CA6D203B567AC425BDABD05A9D5BDB69 BULLSHITGREG
961,953,996 *64421250EF2A2D6E184A651F4F3D07238BEB20C0 Bullshit in the First Degree
961,953,997 *64480B3A79B31ED1FE7B7D0B8521E1390FB27C8B bully'sbliss
961,953,998 *644E797925E3C0101707DBB4E8A84527A5769BCE ¡bulma
961,953,999 *644E754B4F9AEC83ED2D096B56E7B78BBCC47BF0 Bulstred8
961,954,000 *64474B6CAF2BC674B257A2E43724C53F46E5B08B BULTACO'S
961,954,001 *6440D81E47402FB66218869707DBB862BDF44338 Bulutsusundaki
961,954,002 *64416D921C53098AF6C0FE4AAE2A046E825A6E4A Bulycheving
961,954,003 *644301AD83483307408A7ED95E8DB81AD5B1D98C BulZ5
961,954,004 *6445065308C3A194E97134E3DDACF137792535DD B%u(M
961,954,005 *64463421CFF90D63D63952631F1E90DB2F5866CC B=u&m
961,954,006 *644759E4B2AE318D740CEC8B6E805F9566D298A2 Bu/m(
961,954,007 *6443D1C7A79AC497FF7660B61894EC9D14FDCF71 BUMALOE
961,954,008 *644FE00C2A5E40A4E55437B7031F15C180274982 buman524
961,954,009 *6446FD0C495772F293A2E7E8D0A180613BE83ECA BUmbn
961,954,010 *644007BAD874F819AF96FD110A73930395708ACF Bum%g
961,954,011 *64420C8D1768700DFF877D249237F92D46F1D1BE bumiaa
961,954,012 *644DF65B454562C4C4C0893910FADB27120D6E2D Buminoid0
961,954,013 *6445BB5B450FC738E66FE45837B8D4580ABA18C2 BuMk-
961,954,014 *6446CA6466ED18116D0BE737DF1C1AE5A8DC2EDC BUmo1
961,954,015 *64420F72654BBFE922A93B79AB96F91B23DC3AFB B$uMP
961,954,016 *644055C2C54985219B537C2E9CA22F3A7BC5798B bumpious1y
961,954,017 *644B5B126E9649B3F39A2C20A9FDD3AD9A2A360A Bumpo1ogy
961,954,018 *64492E7B4E15801AEF2FF95F9E9CEC9014E553D9 Bumpology1
961,954,019 *64446F34C703F42EE48B23C535CF1F4AAA7FCA14 [email protected]
961,954,020 *644FC882CACC333A68C188CA172D83832C2A2D12 bumpsadaisy 1 0
961,954,021 *6449098575DD46376F64510D97A356F48BF30530 BUMti
961,954,022 *644BE1F8886F93F04F0CA456AFC797C84C40F3DB B"u)n
961,954,023 *644D05244DDF70AE59CD1F0D84FD91DBE1332B6A B%uNa
961,954,024 *6441885CB1486CDF31EF1E4C55917EB40BE72642 bunadseiere
961,954,025 *64453FCFC437B105D0B62EE109AFA5FE04CAD995 bunae-myeon
961,954,026 *6441B8060793F470E168FA55135A2F19DFF0CE8C bunatikarapid123
961,954,027 *644BE073D9986517CE7DDEFFD20996800266D8B9 BUnchEs
961,954,028 *64419993815652E2274AB78D7FF0DDC396320E8E bUnChInG
961,954,029 *6446F9B94B2F9D6A03B6B21C99C2A9395A863F31 bund3l5g3wy5
961,954,030 *644959E0C3681BA246076B000BC03C3A8A42EB90 bund3sbn4ks
961,954,031 *644115A1F1382E1655359ADA199AD733AC85FE81 bundaring
961,954,032 *644CA42C0890F6AA4249B1411C8F32A370459A61 Bundesausländerbeauftragten
961,954,033 *64420111D7735CE67878A25F4967B37DDF460FD7 bundesfachgruppensekret
961,954,034 *64480B71C22906496EC2649B5F261C57050DAB14 bundesjugendkonf
961,954,035 *644F13D6488402324F4D98BE5F3774BE3238A464 Bundesländor
961,954,036 *64400EFB43C428198CA97D3CD4020073D41FF801 Bundesth7
961,954,037 *64465648528D34E8AD229D97730CC7D322497373 bundesverfassungswidrig
961,954,038 *644AD38428AFFBE6BE06E6092166F3911F608F2A bundesversuchsstation
961,954,039 *644F22420E7E1C540C56AB1303C157692E408213 BUNDGRNSERNE
961,954,040 *644F12CB279ADA6359B46631D2A8BC26B061DEE8 Bundlerooted5
961,954,041 *644E509DFEE734641D4F316ED06729CC52AF4C2A BuNdLINg
961,954,042 *644E479A9490351BA0F4441C63878EF4E4D2CC62 Bu!NE
961,954,043 *644EB4A63375041611C707CF35E05CB604A8FBEE bungbanglulu
961,954,044 *644A873F1517900780C825C24F1303F167FBFD1A Bungomek5
961,954,045 *644C62DA5AB52E6CD507E4B51DD77AF7CF0E385C bunjatzade1234
961,954,046 *6446C7270C40E62022F2231AE0F2344E92DA1736 [email protected]
961,954,047 *6444CA13C79308A50215180FCE552CCC829EA89A BUNK23
961,954,048 *644CADD0A36FB3D1285F170735818F4634BB70E7 Bunkerde3
961,954,049 *6440183C6B47E3283C8902B808C44CAD43231308 [email protected]
961,954,050 *644A2CB10299A69D7CC36D53A87F811BEB0B5EED bunkermikaela
961,954,051 *644444B588680E69B976C1F66D3FF7FD4AB6AE89 Bunkkerien
961,954,052 *64408A8A03B2904B68728BD8C91DC389160E492E BUNKY777
961,954,053 *6442D59E6B058F78FD43AACBEE86A6100ECB4446 BUnl,
961,954,054 *6449997BE69615328E32AE3709965C222DE98442 bunn8age
961,954,055 *644101CDF3744ADE95FB1871EA2334859FF14431 bunn
961,954,056 *644CC4505AC8397647D59A11AB5CDF128F863714 bunny0331
961,954,057 *64486F311BECD6F66E428FD95B0189C7C8825744 Bunnyangie
961,954,058 *644260DE673D8E7DC0ED51C9FCCF2A4016A61A47 bunnybadboy
961,954,059 *644B121EED9005556874A78667E53127F4EEBCFB Bunnyhugs4
961,954,060 *644E50ABEE85213A33236FA55A124193D36BDAA6 Bunodonta5
961,954,061 *644430C8005B4BAA507BFE5D2BC5328B47C0B5A4 BuNpC
961,954,062 *644412F9FCCBF9E242F377B4523717BA5344FD6E bûnqm
961,954,063 *64489B4849B9D89862FE8A996E46C5CD64EA87EA BUNSEOK
961,954,064 *64488135A8A5DE29170832BFA44CFA6D4D1A77AE BUNSHINZ1O
961,954,065 *644CE9994CA12CA0F8995A16E4E8DD116DCE30B3 B
961,954,066 *64436F01D7731A54DCD9FF993BAE28A98E8986B4 buntglasarbeiten
961,954,067 *6442D6DA1C391A5E6E0C76BE408F4D8849DB4821 Buntowniczki
961,954,068 *6447FF2388C3431E277A00E197A542B65C2ACCED bunumbued
961,954,069 *6443E71934424E0EE484C10B1A2D221C036CA854 BunwE
961,954,070 *64427C9C4E1BCDF24F73E9C80AB572CD5887DA13 bunyancentre
961,954,071 *6440E0BD4E2C73998C2FE862C151A88599F5E0CE bünyani
961,954,072 *644FA3AE58943B65583C693E2D2775A83BFD3654 B+UnZ
961,954,073 *644B9D5200A9AF678A6492BD0092033AC105C62A bunzina0
961,954,074 *644D6CA754C861865F97C09A7DC467F7EC10A4AE bunzina4
961,954,075 *644F63891069DFDE7E79CC8AE8D8B00D9F52D1CD Bunzkin
961,954,076 *6448CA6684DE10E22AD48B352F473B08317EDE15 B;UO:
961,954,077 *6441D325D35A3A5B471D838F660934A1ECB53F80 BU("O
961,954,078 *644FF07FDC55A10722ACE08A21F38D24F322BBC9 BUoB:
961,954,079 *644739EED0039DA7E99CFAF75C88C4B5185F39FC BuoLi
961,954,080 *644C81855314ABBED4886C75102B8964F2D2FB4E Buonanno1234
961,954,081 *6440198084F90510D4A1AC722B2D0C631EE39B18 Bu?oP
961,954,082 *644913D5330B7E2EEDB924014D9914108F34D481 BUOW7
961,954,083 *6446187D007C1B669881A4F3419B4FDB7333A639 BUOX$
961,954,084 *644ACE694D86081123761F252A204D013C5C8192 Buoyanci3
961,954,085 *64420DF8385142ECB5F8367B5BF4066437B12C6A B
961,954,086 *6446212A2E1558873EF2B6458581A8C87A991396 BU?;p
961,954,087 *644CF0649F537CD02A69C426D5A4F46A18D08947 BU+p#
961,954,088 *6444251F7CE4ED16E91CA1758028E1316534D833 Bu;P
961,954,089 *644831D38ECF24AAC323192366EB4D366E1960C3 BuP-,
961,954,090 *644716A80BC3E76974873176E84A1EFC900AF1CC Bu-p#
961,954,091 *644E92CB03A74F39F91113893101CCA00FD603A3 Bu$p4
961,954,092 *6442559F96BDBFF89C89D6D8D3126122FF7405F4 BUPc_
961,954,093 *644EEF088E588F05ADA6A6ABF474803EF1D10130 BUp/F
961,954,094 *644943A8DB4709DCB3630D4F5526A8E49F17A2EA Bu/pg
961,954,095 *644FB8B571448A18DE49A67283832B4B995FF1F1 BUPjA
961,954,096 *6443DFF2684641450CE50166C896FF48B625105F BUpKG
961,954,097 *6444F57820A2234E6DECBD647EF0EEAA2CAFF169 B_u.Q
961,954,098 *644522DA5CA13784142B5FF8B8FF0AB2D0BD22AC B:uQ:
961,954,099 *644C39659231A780581045F5A6AFC7B3D1C38206 B(.uQ
961,954,100 *644A115F7C1F6B6D879524CAE96D3AE8C55E11D8 Bu##q
961,954,101 *6445F8B1B447BFE2EF51D284804DE44B0A59A9D7 BU.Qc
961,954,102 *644AD1DE3EA6A057352CF7C3BC19A7EBE1063F04 BUqI5
961,954,103 *6447B2C4C42384E3E81DC6F761E569CEC018BEBB Buqm_
961,954,104 *6440EB2B336CB01E42DC2A9993638416C4950254 BUq-N
961,954,105 *64410A2862DFFAA108927B3EFFA3EF49257C0B0F B$uqN
961,954,106 *644B3C506D57627A6AAB806FB4F17CA310A9255A B$uQP
961,954,107 *6444E344E7C75827C58E53C059BF957C03D17162 BUqR
961,954,108 *644646B7BA20152ECC91BE30E15E8F94E295B97E BUqV-
961,954,109 *6442D31B1C321A6256199A9AC4F0FB3A6778090C BUqXm
961,954,110 *644CEBDF373E45E2EE5212D89BFA38ACA9DB8918 B!U_R
961,954,111 *6447C7BE2B25DAD51C04DDBA4146DA9CA197A42E BUR91AR!OUS1Y
961,954,112 *6441379E7C39DEE95FD29B6679B4FE3D63C18B79 Bur93$$3$
961,954,113 *644B6D83EDF86891E528E7E2411BC6FCF10ADEC1 buráját
961,954,114 *6448D608875E78745DBA9ABDD69B99913D6AABB1 burb13$
961,954,115 *6447E5D8973B88E3C8086E54FE0BADDFEA405F71 burbur1nh4rn05
961,954,116 *6441BE047974B3D9CAC791FFEC3A88F15307E374 Burceva
961,954,117 *64459B6C50E0B0A49A683C0BC13E6BF920BE62CE burcheddie
961,954,118 *6444B9121E25521038266E26964A94DA7FEDA64D Burchio7
961,954,119 *6445444D3C810F92DA919DFAAB0BB6150E5EB7DB Burckhard9
961,954,120 *6447D637E8DA71691B6BB59226DFCCF3E775CFB1 burcualtintas
961,954,121 *64447F7D27125D0C73CACBA706B88A4C76C56386 BUR
961,954,122 *644E10AE78B4FD8647EA0F2C3C554FF02A3C53B0 Burdano
961,954,123 *6449ECE6F0157D4DB72435E42CEE33CB861A8DA7 Burdein6
961,954,124 *6447EFF6C935A4DE62CDB214D6D799448AA58FA2 bureaucratous
961,954,125 *644F6F7191F53C35E65A2BE532A3F01BE823F665 bureau_of_legislativ
961,954,126 *6442347ED8EEDF82F3CCE3DE81F7CB50E3D72592 bureau'[email protected]
961,954,127 *644ACA86C9E2DC6C7A2970DA1B4A8E4496A0B3C0 Bureaustoel8
961,954,128 *644A74A03D9F71FB607B62CC12915042AEEF4F6B buredesing
961,954,129 *64495E5B025FA4788D61C5119E0C47D833DA87CF Burg14r10u$1y
961,954,130 *64412294CF42D50051C2D9CB0AC0021854AD73BE BURG14R10U5
961,954,131 *6445AE9CAB9F8AB56B61E7D33104BCA5A1A6E252 burgaws8
961,954,132 *644969FDEEE429D70587DD0E5C178F36CE8B3329 Burgbryce8
961,954,133 *64485315F70BEDEA020ED281EE75E83218AAE4CD Burgerkommando
961,954,134 *64490BFEEA21F2566EAD62D37037F2D102D0E3A8 bUrgerS
961,954,135 *6446E7E48FAF983276AEC231A9CE202E0E681AD3 BU"RGERVEREINIGUNG
961,954,136 *644DAB85695094AEBC982CC73B5196F5992CD694 burgesssteven
961,954,137 *6446CCA9F3CB543F1D74F8F4479829FC7CC93FD8 Burggräfenrode
961,954,138 *644B9027F0CBD65B1C2383EBD2A49F5DA76101B7 Burglen5
961,954,139 *64417CC74C28B1E679E4FB9214B787CAD8E79D33 BURGOGNE
961,954,140 *64483073B0FF88ABD51796965BE2404DA39D70AF „burgschloss“
961,954,141 *64446A150FA0E05BEEEC2C41277A4017412CF8EE “burguesia
961,954,142 *6445CD1CFA2889183A7920122F4A644AB2146FEF B=Uri
961,954,143 *644B4C30A44F1868CEEE29DFE68AD1359C575CDD buri-burn
961,954,144 *644EB923A6DF446BC69E46448BDCA92B975F8A0A buried_alive11
961,954,145 *64474B2F404273D2C57D99EC22A9BD21772F34B1 Buried Alive-Raise The
961,954,146 *644EF8C1EE4E65F8D26D9F037DD86F2CEFBF101B [email protected]
961,954,147 *644708CE00910B1C4B749F6B4974A4CDDBA38DFA BuR(K
961,954,148 *644A3642BA6126F42F6E5CD1DF28DB867AF925C0 burke-savage
961,954,149 *64445DBDDBA36D678D6F922D4161799702C5CB20 burkolatépség
961,954,150 *64477B5EAFE1F9ABE3403554205AF7397113240E burl4v4
961,954,151 *6449D7B557E94EBDE4149C4B094C158321726F35 Burlaceses
961,954,152 *6444A4DC1F949B46C00008F41A3BDA486EC5DE41 burl.aljemal
961,954,153 *644D16EDA78AD1B8B58777E68A0C0B7D1B4C910F Burlanchères
961,954,154 *644D113F4D6D4BF035E29E8108C92AEFE03FE525 burl.arostegui
961,954,155 *6445B0387E875EF40639373E8440A6D95AED2E44 burlavano6
961,954,156 *64459ECFF5258E02A2581CA1E369C71728577932 Burlavas0
961,954,157 *64441710307A877F172AB861D1B58A81C19B5B50 burl.bilsborough
961,954,158 *644E276058E9A9D079019EDBF4A37C056915EDD6 burl.brizendine
961,954,159 *644803B8723C7244F6CE6471D4035AD8E7E83AF1 burl.clauson
961,954,160 *644E12EA77CD28C5AEDA0D7068FEA457D572B8BA burl.decasanova
961,954,161 *64446087EA150E6209A2F5A1C8F46E4BED0B6C9C burleighanson
961,954,162 *644C3673B1BC118E7710B677E24EA7897283722F Burleskn1
961,954,163 *644045AD07173109CABF9F4A0F24A90D0574E03D Burleyns
961,954,164 *644D05E856BFECB1EF6EFC96D1EBDFE6E08EF7BA burl.fenstermaker
961,954,165 *644B5D90E0D826DE20C7471AEE73BBF01656469A burl.grimaud
961,954,166 *64425B32D5E03A1179A0D5F70CF31D5C2DB782DA burl.guerrido
961,954,167 *6449E3856BADB8B2F51FC72C1F2E594F7CE22905 burl.kitchenman
961,954,168 *64454F07A1B5FCFFC5A1F321B9B815CADA829536 burl.kobryn
961,954,169 *6441468E7AE0C682AA451827D935FE9B6EBA6383 burl.lindloff
961,954,170 *6442B5ED6ECDEEAAF879531E472425DD3B14CC8E burlm0ky
961,954,171 *644F88E72C50D0E4DE930BB3456F81AB909A1927 burl.nicol
961,954,172 *6447756FA87BF0E36AA124408513BB176095FF06 burl.pardee
961,954,173 *6447B37681BA4A9E3DEF2D7C594B6AE3E0A8341B burl.pinales
961,954,174 *6440A89F5B6193E5B6779FD969BEE4A056725FB2 burl.potier
961,954,175 *64484B4A02966BFFECBD454BE133515884F2AAE1 burl.selesnick
961,954,176 *644AFFFF580BA7ADC696AC1A74FECF2C15D7409B burl.stakkeland
961,954,177 *644695B9170085569C554AB503BCA6CA5F67643E burl.wolgamot
961,954,178 *64494A7DB013A405D3DFC3D5F1AC082255BCF37E BURMe
961,954,179 *644A34FA989B44A4555A76F21EE51729B9D0DF3A Burnded
961,954,180 *644483F83A1E306C215E0A454817B9878D61E296 Burnellaed
961,954,181 *6445B4A2932BE245A5C66913FF22DF80BFDE0A1C burniebee7
961,954,182 *644DE83098414A20A2BB46C3A8D1EFBD126B69A7 BurningBesideMe
961,954,183 *64459ADFB6867B10ECA7EC224B196006B1CDE98F burninghearts:mostbeautifulsadsongs(disc1)
961,954,184 *6448397A85CC908FEE1CCFCEEA82A5A2D25F1E3C burningsaddles
961,954,185 *6449C1B6E1BE707313B6CC843EF5D8DEF7E4E652 BURNLEYFORDHAM02
961,954,186 *64447400B14CA332B7E7DFD7870EF203DFAEBF63 Burnnies2
961,954,187 *644C1466695C0CB4565C933130F7976605B51163 [email protected]
961,954,188 *644DC6B2CDEB587EBBA3BCD293F0120503F9B0B7 burnscoyjameson
961,954,189 *644D8F96FB27498EDEB4F1E0435F8EF727DC1053 burnsssm
961,954,190 *644773DC102E8B91BE121EB3CEDB0B242DFCAD3F Burnsy9000:Tincouch
961,954,191 *644291FE3F9AB1C31FCB03DDA927A74B6CFF6BFA burn this city down
961,954,192 *644400225312DD4F9D1D71FDD1DAC41A16DFCF45 Burnybsw3
961,954,193 *644E6A524A5E67DEFFDD75AA5E6122C960170D20 BURpI
961,954,194 *6446E480BE427D605A5A9DA14B024D59D81DF3C4 burr70
961,954,195 *64415263B51715A31089C1C1C45BF69635AB5028 Burrgrai4
961,954,196 *64452264FF03D800406DC1D2348FB6F4F6504CFD Burrheads1
961,954,197 *6442BD42BEC4E34A0B4DFD25FFF7AEDA3DD3A14B burrific4rs3
961,954,198 *644C4499178417B63F55AD06C136F304C71685E8 burrisadcock
961,954,199 *644CAE28A3900FFFB7352D07C6DB05087237D469 burrowan
961,954,200 *644F97667494B3371948648611D11D4BD480DDDB Burrows.
961,954,201 *64475F36564667605EB9BD4FAAFCD9999B7079FE Burrudarra
961,954,202 *6440E54C271E59E188BD5870F74FA553D1B5124B Bur#S
961,954,203 *64418471D9A4AB207EBA206190F2F3D64B3EC965 Bursaing3
961,954,204 *6441524EC20815EFB21D2603EE7A93F9BEED0466 Bursbridge
961,954,205 *64493164B1516E3A2B9C4072BFF5656E3610BE13 Burshin2
961,954,206 *6448818BBA8F658C181F53297BE5B9EEBC9257E6 Bursifor1
961,954,207 *64438C8616A0343819F89DBC43B3486CBB933117 bursjansk
961,954,208 *6446BDC51F2A313710EF0A3BD0E5CF8A8864D32F burstusp
961,954,209 *6440DF28D06F57D76CD1046086FBF02351D0CB19 burt.bemer
961,954,210 *6445D6EF23D42D5462C9C7F1C51C98F1512BCD68 burt.bidding
961,954,211 *6440E4DDB6A89EB5A082FC4E7E505C4D2CE948A3 burt.boin
961,954,212 *6449DDDD692CD994D26A5772075DDB1330829BEA burt.brannam
961,954,213 *644BA81BDADFBB8C6D1D1F6239E6FEC932426707 burt.brelje
961,954,214 *644DE1C0DFDD110ECD08D0A60F8B95A9AE77A9A7 burt.carmickle
961,954,215 *644524218A2B08FAFAFB1833749E138C78176398 burt.carroway
961,954,216 *644D9C03FC5176B1671B8794FC6E80EBE6BBFFE2 burt.degidio
961,954,217 *6442C85E1346E61F24BC7D9E05431194F2CBB1E2 burt.dincher
961,954,218 *644EF10A567FDB466DC17950767A1853D835C22C burt.gottron
961,954,219 *644D802BB9CB5916B2D08B2FC126713E73B5E46F burth、darryl
961,954,220 *6447FEBBBBFE1852D66E095698114F8406F5220D burt.hua
961,954,221 *64448219CA5C5E3545999FD8287433C037C98F60 burt.huseth
961,954,222 *6449207D4E321ADDE57BBFD4180E42C60BE379F5 burtina5
961,954,223 *644AD2BDD09D6899785D28DA1B636DC5F07C5F37 Burtiset2
961,954,224 *6440594E32703F0EA21E65172FC44C927F424793 burt.kingman
961,954,225 *6445BE1A04FC5512B7D3BD6C946BF9FC132091A9 burt.lampey
961,954,226 *644A5AAEDB071AF1AC83C0C9EC9A39A38975BE5A burt.mazzie
961,954,227 *644AE4598415615F722C02D23DC4B723C09B6582 burton.appling
961,954,228 *644386E5413A380E0BF08A188763344E8B13A288 burton.asmus
961,954,229 *644FEA819481B49B44D382C4C108842D0A3E5FD9 burton.azen
961,954,230 *6448C493C0AB2E63123D60E3D82433354985829D burton.bailado
961,954,231 *644973CCFE361BE366B911BF86A4353EB0606846 burton.behmer
961,954,232 *6441606FE8E2CB5EDBAE40A436577E2DD4E4D8F5 burton.brody
961,954,233 *644994179B8731452350BC85A837F14C0717FC75 burton.brozina
961,954,234 *644FD794EE1A7DC2CB10111E93970769654EC5A2 burton.chevas
961,954,235 *644C72E558EA5918EBD602BD02EB82E6C1E46F21 burton.eiselman
961,954,236 *644E7D7D2D56F45AA817B05AF867D6FC1F74DE5E burton.everroad
961,954,237 *6448131F9AC342D989B85AB3B6E8704D30DED797 burton.grove
961,954,238 *644EA2903CACEDC2D776C4BABDD8537EFA80CDCC burton.kurelko
961,954,239 *644C8C281A7D34DA23807D45E1EDECCC55161D17 burton.ma
961,954,240 *644D490181C7311D3FCDEB0F89688197AA889365 burton.manke
961,954,241 *644AC9B6136D0BD06092C47AD05D9DF697676EED burton.needs
961,954,242 *644DC75F279F4C233DF3B2B6B38A54016314B5F4 burton.olson
961,954,243 *644A252BB51F729E08B7BD1A47C13A3144249CDC burton.onks
961,954,244 *6442D7FFC3630B8ACA77A3BB07901F051BB760FF burton.revis
961,954,245 *644154F1A529DC9A10E271A3D1193E90180E412C burton.rudesill
961,954,246 *64428213467F66751C3C459894517FFB12D6C746 burton.rummerfield
961,954,247 *6448E9E5344D83176F3C9A50EDF270EB25FCE821 burton.sieverding
961,954,248 *64408EA8CA845D55E55000854B229DD6D5711AFD burton.sween
961,954,249 *6440E4473DFAFF490B6381A067952BFECBC3265B BURTONT
961,954,250 *644A92AC104A5E2C94EDE8866E2BF307CCBC1F27 BURTONUNITED
961,954,251 *64477F4F7E9FF7D6035B7BC2310175D4DC68CD07 burton.wintjen
961,954,252 *6446ACE42E16B9EC82716DD09953549B92E7276D burt.stoutenger
961,954,253 *644048C0DEBB7DA8AE526FA4BDEA43303F6FD937 burt.timothy
961,954,254 *644DE94A90E4F797EB1EF59FEFBA4943256021F7 burt.tlumacki
961,954,255 *6440DB6B8E9D26B9851B4CA9131CB6348DA2F3C4 burt.vaillencourt
961,954,256 *644FEC04892C316871651C11BCDC533FDF004FDC burt.youngblood
961,954,257 *6443459AA55D93B199B03460E794EE7B633CBBAF burt.zmolek
961,954,258 *6445A86EE24372FFD1C49A6EFDA45E7BD9F39079 BuRug
961,954,259 *644F67E37276535FFD52760EA1349C186ECAD7BC Burullus3
961,954,260 *6449A8EF9625FEEA9F07415724D3D4E72EB3975B Burunduruk
961,954,261 *6443D5B12CEE0B000BD2857095815E0CC6A4CD26 BUrvK
961,954,262 *644E7CDB22E5A35D482F4EC8245F59DEF4183139 Burw_
961,954,263 *6443F6273408DD43C927B2D6576E249D128E24FA burymeinashallowgrave
961,954,264 *6440759A4DDC83B1FC583DCE97F765DBB832B92C BuryYouinBrazil
961,954,265 *644A4038807AA01FCE03FB72B49084468EC52059 bury you in me
961,954,266 *644E5E99579AC2F0455A918E0E2632D4E5853B0C Burz
961,954,267 *64441B3CA0A7A3B4B02C463B652F2B2AD81BA132 Bu,s%
961,954,268 *6449C616AB1F376A528F6F66575EAA153B971F78 Bu!/s
961,954,269 *644C73DCC2E88CB3D8AFBB463013405C1EFDFC30 BUS1E
961,954,270 *644C901ADB155CDEC21578547CD6F904E04C44B7 BUs)3
961,954,271 *644909041604F4111442D667628948397106A482 B=USA
961,954,272 *6446122CAFF76E13CE5392E13F90BADF26D51534 Busansky6
961,954,273 *64431ADFF41DEE4457AE592F4588C9B87580F735 BUSARAWAN
961,954,274 *6442779EF5E53AE90BEF65248BB7D3FFD1403DA9 busayavalasa
961,954,275 *64407426CD993147AFD64AF7DDDD52D128774F60 Buscaba2
961,954,276 *64473DA4A3DB073903B932A215CD89665925CCD1 Buscalined
961,954,277 *644DC5E5798DDFF21BD10112786CAC58747A97C1 BuscandoG
961,954,278 *644C9DFFF000B4111BE4D0ADA3B058F02778A5E4 Buscarles8
961,954,279 *6446D516C1373AE23107413DE19F145BA340E5D3 büschelbogen
961,954,280 *6442F18F83CE4013FA55B69ECC0515A3EE688784 BUSCZ
961,954,281 *644F27B92183E3E2AC32CC08ACE16167652C1A7C BUSfu
961,954,282 *644FE3C9FC2B2944D43A7BC23D0276519B20FF13 bush1091
961,954,283 *6448EEAF91CEA992F1C3525200BB7E13F2DC739D bushaell
961,954,284 *64484CEACB458AC432CCB650922E8B9FB70B0F35 bushbabytrue
961,954,285 *644D03A024E8625617BD73E076AFB5404CB654A5 bushclark
961,954,286 *644AD69B8F5CC6EFD49C2EF9897B9296C9B15F97 bushcoat3
961,954,287 *644A76A0D3803BADBB50C062E46415E752E70714 BUSHELER1
961,954,288 *644E275A8FE5DF19E21F54BE2A6278F08B010EC9 BUSHIEST6
961,954,289 *644EF4C84673B85EECFDFFED9BE05A60B337C67C BuShiZhongGuoRen
961,954,290 *6449DB8590067BB754AC1547FF098DBC4278854F BUSHSUCKS2
961,954,291 *644442A9CADDD74F99280E2ECB18AAF3032C0FC7 Bushuyeva
961,954,292 *6444B17EAA7446E1CD0DFC0908A23CFAD9048DCE [email protected]
961,954,293 *644E3CE961028128889840D9C1726885EFE2BAB8 Busineks1
961,954,294 *644D91D71EB315DCFC54E9327561071E0A8536F3 businekselle
961,954,295 *6449682858067D8BDBC2C1E085558B221F5F5E14 busines2
961,954,296 *644B9BA0C77B86A69127B679C955233EC4C0B345 BUSINESSFUCKOFF
961,954,297 *6448B0F3DF3796BE50C77BE339C963B319E21DF3 Businessman8
961,954,298 *6440E9F3A234D745B940D2D0CD281E43697B01FE businessneweurope.eu
961,954,299 *64493DD7C4CFDBDBACD77910FC36D4B7F921F9C7 buskskvett
961,954,300 *644832069C5FE9AD74117654EF5F084E16C4777D BuSL3
961,954,301 *64496042510EEE608127EA5495D548783D503996 BUSLOAD'S
961,954,302 *6444CCA66A30D6C341B1CA8AF1A8F8F8AE188550 busójárás
961,954,303 *644649661E952725EE1F927B321C660B6E12F25F BUspL
961,954,304 *6448AA9171FC13B84838CD04B004827E7DEEA8A6 BUSRF
961,954,305 *644C4AB47C06268C50CEDD00BA0C316A806218C3 Busseihin8
961,954,306 *6443CAD7E2F564FADD7CCC616DAE14E78C7F88A7 BUSSII07
961,954,307 *64453515AB4C5AD98639606A77070FD3C2B14855 busspike
961,954,308 *644643B9B25F3DB072CC6F1B50B600A219941B05 BuSSu
961,954,309 *64450598D93C0B5F5E082E024115610FAC87EFC2 bussyoku6
961,954,310 *644191B95D180A498F9DC7985393504C84925478 bust...
961,954,311 *644A3C68CFC5DE17D9B3DBD6D5317EB36D25ACA5 bustadplanleggjinga
961,954,312 *644FD9CE780133B55E34236E05BC704CC03F2C1D Bustee1
961,954,313 *644E6A551BA5A9FE6D2EE1EE76C7ED1D551C637E Buster1939
961,954,314 *64462A2BABD40BEE9052DAF0C21E76EE49A9B9E6 buster.alewine
961,954,315 *64488DBC2DAA0C107D3AE73C90667C87EFFD9E73 buster.allerman
961,954,316 *644732A9A130DBF22DC59AE82A03FAB24A6F2BBF buster.arrocho
961,954,317 *644745B591871FF1B2D1799BD17E3D65013B007D buster.delisi
961,954,318 *6448075B85BD2058BB7B6BADE371EB56759E0A55 buster.guzewicz
961,954,319 *64453B38B2AD7EC18C3E76FA61BE2CACFB75AA51 buster.hayoz
961,954,320 *64472EEADEBE41B4EF56DEF1A9C264058A7F220D buster.hesson
961,954,321 *6446171AE89E06166E15DA6F0E27520DA2B20DBA buster.horka
961,954,322 *6446CADD270A28704340062FCAAEBECBA4D2F2CE Büsterich
961,954,323 *644CFA03D5A966717B9E665844FBAA3BB6036E0A buster.juluke
961,954,324 *644E647D6228B1F4B7E5AF9BBBE8AA5BC66B800B buster.khauv
961,954,325 *6441DAD30166CC1B4BC10DDBA91A335D407BE381 buster.kinville
961,954,326 *6444D193FA7CB87703672AB254D71401CE32700B buster.lantz
961,954,327 *6444BA583AF532392E6BD7ECA038E330E33EC80E buster.largin
961,954,328 *6445DCADD77A46C8956FD65AFE986A5A0C4FBBE5 buster.lofgren
961,954,329 *6448CC19DA5326BAB069160EA2D6DD6697BFB856 buster.lohoff
961,954,330 *644F540F8737D72A659FA12ECA9A9EAE70BED6CB buster.marcantel
961,954,331 *644B5109C43BA3D09CE9F05A8347B9F6D6FEBED1 buster.mccoard
961,954,332 *644F3899D8295A7CC36A481FE21D43085FCFCAE0 buster.napier
961,954,333 *644AC605F245267F36EA52A66EB3633FEA5A864E buster.payenda
961,954,334 *644EEE9DA4FD6C09ABA172526F4A0457BFD48958 buster.pounder
961,954,335 *644F171664DC6E19D0CCF3ABC8C4714D47D3B7CC buster.reppucci
961,954,336 *644D2F00AD6D21C11AEE562AC02E442DF2CDD656 buster.schlangen
961,954,337 *64476A0AC53A5EAA0D7F0899BAA8B879B784DEB0 BUSTERSCIENCE
961,954,338 *64407BDD8F3C8820597F82FF43E74F6919F14B7D buster.sweeden
961,954,339 *644C18993426879331748D4BEEA53C4910FF1508 buster.tauares
961,954,340 *6444BC223382A40B84061158F2AE4E9EE15813BA [email protected]
961,954,341 *644C0FAF1D6382D149EA5C7E1AF62EE72D3BBD08 buster.veitenheimer
961,954,342 *644A6176366943D62F9613D939E1863EACC35695 buster.viafara
961,954,343 *64438230C5A72B636A49CEF914C0BD3A47FA2F94 buster.waite
961,954,344 *64435B777172389A0E5E33F719EC82C349F3A0F0 buster.wins
961,954,345 *6448C2A8EA45508776BD7E91D11B023D5D0C00BD buster.zalesky
961,954,346 *644B64E633E85A3A3AC69FDEDA6AE0E8C37A2032 Bustill7
961,954,347 *64464642E86F89071BE65048910D83BB2F88CB63 Bustleft0
961,954,348 *64497CD5DF5EC06FE61E767A5549BD4483D9D8FA BUstler
961,954,349 *644B065C894D3E028DDA7DE596C69A5C961969F3 busubsw1
961,954,350 *6440BF17E024913FE8A1293A63CB6662A55BA05A Búsulni
961,954,351 *6446659C6DCDA75A2C1388609CC33F78439AAEF1 Bus_V
961,954,352 *6447F5D10B612C759BFC263ED52643B831EEDBF9 Buswagenparks
961,954,353 *644C7AF50FA9BB513E2280C687087C6C34147A1A BuSyNESs
961,954,354 *644EA9A4152245E03C7D2C47BAD9298FC1B1046C bus”豪华版,前转向灯为圆盘形,尾部的双转角窗被取消。
961,954,355 *64468F385EC1887FCE16768D1020C4064AE42A55 Bu!t+
961,954,356 *644A0761D9A5F64FB1F834A1095F534023FB2529 BUt39
961,954,357 *6440438E8C32A33B3DC7FCAC89121431955902F5 BUT9f
961,954,358 *644D955745B366783DB856F6C6582EE619095AAB BU=Tb
961,954,359 *6448A566D2E95D5843A76F0F43880C10C3FCD311 BuTBE
961,954,360 *644D38A9975C4FCB950C77D6DFBD6A09CD9044BF .butch
961,954,361 *644AC6357E32088839A5D36FB253AD1DB1AA7B3D Butchdawn6
961,954,362 *64486B5941CDEF35B2DD6F48ED27A07E2985F5A8 BUTCHDENALI
961,954,363 *64492B9B729C2D79BD3E11C4ACF8521953F38DC3 Butchdigger
961,954,364 *64493855BA2804162EB8DA4C525F70435E09EE4B BUTENWEG
961,954,365 *64486A2EE3CCCC2B4E20C5BEFB5E541297ED984D Bu$terne
961,954,366 *644F82CA99C23526B0711C398BF40D87F5442A3B butes7
961,954,367 *644D03DB5DB41E066923870AAA076E70336FEECA BUTETS
961,954,368 *644FAD4100C2B946915B7149EFCD236B4F8BCE96 ButGq
961,954,369 *64439A45C83B58C4E1F4D4F6DC23693D7FA4AC09 BUtGY
961,954,370 *64487860ADCE6717C8C9F47437B34F72AB2EE3CD Buthelezi0
961,954,371 *644A1980974665A2851F540B37231C91463CEC3A BUTLED?
961,954,372 *644ACED35EF1F5AA10D7F732A9FF4D5F03E83FB4 But Music Is Better
961,954,373 *644535A8A3DF9786B93BF9544F0092C8153335AB But old folks, many feign as they were dead;
961,954,374 *6446C64E345373AA0BDB7D415D1B528E93366F0A butonese7
961,954,375 *64449AB073B4F332E2E2A0425737F2093BD2B7F5 Butsuhok0
961,954,376 *644BFA4562EAF1EEA0C8A155764DEE4AF2577343 butsuki
961,954,377 *644079602D90D54D86D5CC48E4F17627DAF33E71 ButSv
961,954,378 *64430CA10E9375E2489C886E81CFEA3AE6EEDE6F butt3rfirkin
961,954,379 *644BEDA655D80C2957257D13115D7029FC889CAF butterbilling
961,954,380 *644C67C75F7851869D041A719C213B795C6FE39E BUTTERBREDLE
961,954,381 *64410281DB1040C05053867B89F6CA46CE5960B5 butterfly_aphrodite
961,954,382 *64402E10A8B5E04B7E998183DDA14EE2FA92FCCE butterflybeach.comwww
961,954,383 *644A70812FC47CE3005B109E93FE6812A4349086 butteriers
961,954,384 *6442D8E057DAB082AC76D377F7D5244E9741EF06 butterplatsch
961,954,385 *644AE5C08559B61CD9C38575E7E69E29DBDED47F ButtHEaD
961,954,386 *644C39E7053D3CA3638DFF92938E7D691E0B2985 Buttheadn5
961,954,387 *64497A67E64EC709CA0F14E38A00C2F3244175E6 butthedd
961,954,388 *644BBE94C112544E3C8DC7C111354038964D96B3 [email protected]
961,954,389 *64418B1291DD00C39660E0702BD5173522CD2252 buttonnumbers1
961,954,390 *644FB4AD4C8E110C9C33C016FA39873F7CE5CB00 buttons2003
961,954,391 *644A2A4A963735B8F408858F9084FA27FC763332 Buttreatto.
961,954,392 *644E4E65B3C8985BB0A8CA2269F14317DE48029B BUTTYFULVIXON
961,954,393 *644FD2F0EA9580444EAD8D81DEFA559A6D474244 buturige5
961,954,394 *644F6DB1DCDE423F6602D717F4CFE26C9565131C butylate6
961,954,395 *64436E42720A4ACB7C132CF4BC301238FF9B7145 butyne3
961,954,396 *64455A3D2F7E8F25E0037F4BD809D07215ABA15C BUT?Z
961,954,397 *6448B029A8F7F5704C0F24CF269DE9F0F714B8F5 B?UU/
961,954,398 *64417F4A34E86AB2AF1AED7050AC51F8CA8EC3DF Bu?U9
961,954,399 *644AD0C7DDA6A17020AE9D4C7CA6E47178E5A360 B$uuh
961,954,400 *644C23B158B6DF58959D04F66BCCCC04D530F897 BuUIB
961,954,401 *644FBF4AC77CDA1EB9B8F4A278571E89C79C0622 Buu)l
961,954,402 *6447640A978968057CB186F0C23273B08EA448DE [email protected]
961,954,403 *644F1E2176BD307269DA7CFC70353678AA0F7414 BuuO
961,954,404 *64440075F6F16CC4FA1002BBB1E3DF665C88926C buuurrp3
961,954,405 *6440E1C762531D02BF93F128935282DC0782D435 BU+%V
961,954,406 *6443A817079F537B8564533ECC2F98BF6AAB970B Bu
961,954,407 *64465EE81CC190177434AFEB04BBD0E59DBA90F4 buv347
961,954,408 *644E63332955A1ECD25250720E3A82AC74CC6565 B&UvA
961,954,409 *64478B6FA42C0D18CD9C7869205976579920F6EF buvarexpediciokzenta
961,954,410 *644E09850C14F5D759EBD0BE1DF0F012039F8F62 BUV-c
961,954,411 *644DFF83A6931521F7387C4D55D19888D0CFCEBD buvelots
961,954,412 *64445513C98059AEA1A695E1C8178980241DC5B5 BUvfb
961,954,413 *644E0D60343EB78F420C00AF25ED55C1F9D44A77 BuVlP
961,954,414 *644E486001430F24597542452B38231307AB4C1B buvoter8
961,954,415 *6449D3D7B010473A6DFF816E91F4B62CA22832F5 B,U)W
961,954,416 *6446BD111CA6ECBF2D93358F3C3666826A78D396 BuW==
961,954,417 *644E86563BAE63BF712CCD31CE40B92E4C3876D6 BUW6(
961,954,418 *6445A880A21883D02304B0E0AA7DBCDBA8C6EEDD BuW6!
961,954,419 *6445F78AF92DC0224BF5035D54E6B9FF33F8249D Buw6r
961,954,420 *6444D935F0B1A1C1E7A011013DB9752A8D1E3ED8 BuW=7
961,954,421 *644B968350609F5E519E55DC463E31B69322746C B+UwA
961,954,422 *6448EB895ACA186FC5CB5B025A6756F12C0DF31A Buw#s
961,954,423 *644D55736E229A0FEFB98C13F15DED096FD9D034 Buwus
961,954,424 *644C6478CE2598627464096EC10B6B7CE03E09AB B;+UX
961,954,425 *644FA4B0B0E86C77A2F287547FEF5CE861AD79B9 B$uX!
961,954,426 *6449749E72FABD0054D7309DFFE393A6893581E9 Bu/X4
961,954,427 *644B413AC0F19FD7D9BEF2CC66C47EE753E23339 BUX9.
961,954,428 *6448203D1A4CDE61C7CC37D911AAC04DBA22BFA6 BUXG-
961,954,429 *644C834A538B1A97BDA7D876C5F49E2278FF9672 Buxiycgw9
961,954,430 *644D048FF278547617B1007D995E3D2E2AE4A23B buxomed4
961,954,431 *64490D84C0DB3A5F3914831ADDE1BE5BFFF42E63 BuxtedStMargaret
961,954,432 *6441A3055FA9156FF169F0AFB4B5CE9478DEBB04 BUXtfaVEMbW
961,954,433 *644490DED9FDF4E4FA952B594D4921EEBA534A32 BUXuu
961,954,434 *644AA2483F7CFD8CCEDBE16AB68D0FD16A47E707 BuXXY
961,954,435 *6444BF9BE0CE85CD678AA3155D3F89C3D755E5A5 Bu/-Y
961,954,436 *644888F95FBCAB79D69C66EBB78CF97143F5C501 BuY__
961,954,437 *644F39B841B837E2CCB2097BC64167B9929EAD15 BuY9h
961,954,438 *6447A9CCF008D8F82FC5D7B4AD28A9664B23C791 [email protected]
961,954,439 *6449B89B391660F1BB581CB0EDABD11B7A4933BB [email protected]
961,954,440 *644F16D35FCAAF61C7002483E869F65DBE811CCB B(uYF
961,954,441 *6441CE2237A89B020CE15C6045B82224388C7F23 BuY+i
961,954,442 *644A1B4482627B0B60340C3C09695DD5EC0B1CF8 [email protected]
961,954,443 *644148E3A5F3B38F6F53A01BBED927C1A2FED9C3 Bu%YW
961,954,444 *644F2EAA88831A56DA6DB2CEC7E90A56491077E6 BuY(Y
961,954,445 *64446AB8C2F6D4398992433E38F2572D47B0C986 B&u$Z
961,954,446 *644AEA7320AE8A192EBEF6D0215BC1381E8DF5CF BuZBw
961,954,447 *644089C76C85F1196589E5C3AADB0ABB53AAD310 büzecekler
961,954,448 *6442081CAF1ED0FA66A1D67A03D853C5A92730D2 buzluktan
961,954,449 *6441270F13CA643D7EBF8244ECA500FDEF8C3897 B,UZY
961,954,450 *64471B89E0D5610BFFB0396D35D6425C4CF17ADC Buzzbruce1
961,954,451 *6442EF64CAC5D6B8277F4BEEC51BEFD78ECC1DC3 Buzzern0
961,954,452 *6446E76B9FE37D3B2DF496BF0E42E347718184DF buzzgone4
961,954,453 *6448B4DD1675FE82B05B134E5626C3C000DD68B7 Buzzkevins
961,954,454 *644CF9EB71BBD0EE3B2C8E71E4764801EDC2FE39 buzz kill a
961,954,455 *6441F5079995B1AF37D5AEC88F49026FE7287864 buzzusu
961,954,456 *6444A4040EEAE50103E1C2617E8C60B4D9AC55FC buzzxx
961,954,457 *6444376BBC08D0FD6DB86FE4AC60CAEA62A0B840 B_V]
961,954,458 *644CD6A3DFA95A5C5777BE295677267A9A65FB08 B$V&;
961,954,459 *644A032A49E5B157E7F5A1A5BD886840568E57C4 B%:V$
961,954,460 *644F64888D9160D6F18A06A33939174A261158D7 B%.!V
961,954,461 *644E104A7DB6C55F6E5AED5820430B112FE71139 B%)V!
961,954,462 *644C2A8051B09B288EE80BC04FEAB0B8D549478D BV&&(
961,954,463 *6444F0FB124E054D2DF5BDED63AD8A612D698841 B-#v)
961,954,464 *6444949F81944725E56FE6DF3D89FF403EE1FE95 B:?v
961,954,465 *64434F17DA4F513FB68F14B4A033732920E635D0 B?v)_
961,954,466 *644B33FC8151BACBD8F2D68B38AAE7AD3137B368 B\?v
961,954,467 *644A570CAD19C2591EB0761DB4DF2A60AFE3299F B&:;v
961,954,468 *6444BF6091EF34B0789A8F7401E1498641F44588 B#v$=
961,954,469 *6446BA265DE82BD1007B8EE182CB20F76EEF029B B
961,954,470 *64444A8694ADC02276084D5614563AB62888B010 B
961,954,471 *644A20A1AA2EAE772C1A8C5DD4BBD3C872F6488E BV0.
961,954,472 *64447544C1F784CB4792D96C0815536B3420B42A Bv0$4
961,954,473 *64472AD7087B4FC43DDA3583A3C4959AFDCB794B Bv0a%
961,954,474 *6441F91EE483A7248FDEA5024FE9BE797FBD84FC Bv/0I
961,954,475 *644566D3355CCFD33E55A2D5C69076306194C9BD B%v"1
961,954,476 *644B3B7683CC939DDB0FCD3F5D647F437B43D299 b
961,954,477 *644276895CF1B52B3974273A2D210EF21D8EE99C B/v1b
961,954,478 *644B7D3FD1BC50095D9EBD41D51778185527D58A Bv1:I
961,954,479 *644028584B824DA5806BE28064D706D2F65EC6AE BV1XT
961,954,480 *6447960143C653EC304ECECF1E85828F9046E08C Bv2+!
961,954,481 *64411869E71BB245C8981EE65C2CA4FE179A80E4 B-v2a
961,954,482 *6449F9C79C638761DA241A6594C66FC893B86384 Bv2=s
961,954,483 *64447D1CB5C7ED784652AFC66A1203A2282995C9 BV31N
961,954,484 *6444B71322CDB89314A8342E4801D9A2AB2D1338 BV3IR
961,954,485 *6442A5F4E1DA467504AA7E7BE8D9B1AE12561086 Bv;3k
961,954,486 *644003C9E3A22ED8A7260D179224D03F100FBC58 Bv3X-
961,954,487 *64440B9057FC889DB44323B31A648A375FD32326 B:v47
961,954,488 *644FE2D8F019DEB25A9FAFE8AFC8EDFACB4C8BCE B/v5-
961,954,489 *644AE310C92DBD641C0256468AE81E48BACB41F0 B#-v5
961,954,490 *644C6DA76C846B0FE4DA728BCD3CC9CEE9A0473C Bv!5
961,954,491 *6441067E5CABCE890560F28A780AAE1A4BEF8C3D Bv5b8
961,954,492 *644DB5A8F76CD57239FC9405A8B42BF987262BC9 Bv5Og
961,954,493 *644E31D3E897862EE2B8D00AC93258D2557FF1A8 B.v5p
961,954,494 *644711E30AE81B13736A8088CBCC45850B448303 BV%5s
961,954,495 *6441E7C4224B5DD1998C87BDE9112F2CA810EF39 B-V5W
961,954,496 *644E13A1CFB1518810A9B9F06CAD645E782FE475 BV6
961,954,497 *644E368E2B6FC382DE83FBD6FEFB34B74907B7BB B:V6f
961,954,498 *644B04906F36CB4613B2D71E481BC7F81EA96CA8 Bv6Q(
961,954,499 *64461993948565ACFC119A55C400DB4CCB735485 Bv$6Y
961,954,500 *644FBF16AC1DEE67675B62BB95708DF155445E81 B+v;7
961,954,501 *644E0E6B03657BCA22A905F14203D2CFDD1F522F BV:7B
961,954,502 *644DDD5F4CA144F36191EFDB279FA2BFA9C53D7D Bv7ms
961,954,503 *6449AFA76F5F5D6466B11F97962D482A790832B3 BV7Tf
961,954,504 *644038621EFCE27E6E075D60CE1AD42144E5DC30 BV=:8
961,954,505 *6441DEBA2264E55E1BBF5B308982B4178B7BBC7C B/v=8
961,954,506 *6447617E9905F299A2AC4B903AC0FFC3A331F145 Bv(8$
961,954,507 *6440215FCBF55490823EEB00A90C9127097355EE Bv8d&
961,954,508 *6447EB5957526333B69D608634F92DECC4540658 Bv8#I
961,954,509 *644C2FA347D18ED242E78F240CAAB6AB8B185369 BV8YG
961,954,510 *6441FC2C989BC66C4AB199B7260C8A30E3109255 B$v!9
961,954,511 *644B4330C394F14667AE2FC9780DD80D656157AE Bv9#$
961,954,512 *644F04E55DF51959AD7CE787D24FBC26E905945D bv937525
961,954,513 *644729C4663E0B69C543C441F10301B257C54F37 Bv9c;
961,954,514 *6444FEFA9B66F38A550E1679A602CFF0191C60D2 BV9$g
961,954,515 *64456065D4E305A783DB2C7CA819F4A9B1C693B2 B.V9H
961,954,516 *644BC0A7A3F6B62F109B9860D1707A842EE7B008 BV9:X
961,954,517 *644C8CA54E39DB03811EFBF5DE5BA41B68A7623A B&VA"
961,954,518 *64414754C6CC48152176E7C8A37F00A033C3FD14 Bv?a:
961,954,519 *6440BADB94342E56FFA482390B4FD99D7DE2073D BVa0X
961,954,520 *6446F84B2C1786773B0F8A8FC9F2656C4EE0762B Bv)AA
961,954,521 *64421293E48FE621CB311D967F81BE5D90A6E693 BvaC)
961,954,522 *64445DEC2EC4A5A53CBEE86FB803855263EA86D1 BvaI2
961,954,523 *64457EA9922B89D99472D6F4681A403C0DADCFC5 Bvaillancour
961,954,524 *644952DDD8CC51146FBD232E39422F3D9FE445C5 Bvaoe
961,954,525 *644ABE499D74247FF301A02277EF56A3C8F53945 BVa,s
961,954,526 *644A1DEEFD67AA073ED7F894A3857A48CF807404 BvAZO
961,954,527 *6448441FD65D0A476D1EE5D555F992D9816939C2 B(V#B
961,954,528 *64436D46ABE1CF16C8745501DD45BC36961635A2 B(vb_
961,954,529 *644111E6D8C8D1173C2E79D6EF72ADD3F38A5423 BVB3i
961,954,530 *64408407322130539E37AFBE4188E43AF812F7C6 BVBAt
961,954,531 *644078690426851A9B8A471ABFAEABE5F576C30E BvbAX
961,954,532 *64476894F73DED171D7B42DDBEA89466080C034E BVBESTI
961,954,533 *6448A5FC9ABA6E1E984CB689AA39F712D3FA5B64 B&vBM
961,954,534 *644A08593E34AC9DA6C66CABF07D8B1B557DEA09 BVBOW
961,954,535 *644E420B45DE26E2235E8A42FF8E08312844FEEA BvbP?
961,954,536 *644A622C33C7EAF2AB6AE1D0B07924D45412D019 BVBQt
961,954,537 *64460318A0BD01424814DA959C56385A7F7DBBFB BVbu/
961,954,538 *6448382C1F91973D846BBDB542BBD86BFCCD96B0 [email protected]
961,954,539 *6444FCAEFBF91DD7118AE158BC38F85850F94533 Bv=BZ
961,954,540 *6445BBDFF06DC99C6D59D2E7212853609460A78C B!v)c
961,954,541 *64421F12A84D79EF4F7140162110D1970623B6E7 Bvc;
961,954,542 *644A2D79F8A21513295C43BE9E5D9956D1035915 BV;c1
961,954,543 *644EF24A4AB358B1217878C4EDAD472784E1B816 BV_cA
961,954,544 *6440287069A00D41307D3E7F613EEFFAFE2AE9E6 BVC.b
961,954,545 *6444D960D243D7F639B3BA57D92E1000615FF1FB BV(Cc
961,954,546 *6448337E237896B5BD1BC052B15DFCA9D5F59680 [email protected]
961,954,547 *644C428A9024B59A09F253A07F940722F0AE9641 [email protected]
961,954,548 *64432A3E97B035812322463C8A81C15C2407F8D3 BVCE,
961,954,549 *6449F2F8F27F254479FF783A2870369C3175BA7C Bvc;H
961,954,550 *64471AB73A8259AEB539098496621A30AC273092 BvcHE
961,954,551 *644A60C3A139C81277BC2552E556B1527CA37E90 BVCMR
961,954,552 *6449A2C98C7F9C45EEEBD87CA5F03AE206DB63B3 B-VCr
961,954,553 *64450BC41F2B20DEA9990D23F61A0E7CC42BD1B8 bvcr-11109
961,954,554 *644A1F3EA9F52EE70B1E7152587AE3695266C742 Bv:CS
961,954,555 *6441E0ABDE3FAC2A16067198B67EA19EE28AAA16 BvCS8
961,954,556 *6449E8DBFE2768A31F47A4D547A2A6775C521678 B)vcv
961,954,557 *64425021AB1138D0F13BE069CCF2D2FA4E6736AA Bvd_4
961,954,558 *64461AFC95F72EC76C7B3D3B178ECCC3839CE652 BVD9!
961,954,559 *64464773FEC0F52B1700D839257FFDD7C35A00F5 B/VDE
961,954,560 *644B2C1D4489B50E04BABA2AA1EC94AFED8C4AE1 BvDW/
961,954,561 *64477DBB293FFDB465E615454AD508C7A807DDC9 BVD/X
961,954,562 *64444803F45697B7F37F2DDFC6AAB3C4C4708AD9 B)VE-
961,954,563 *6444A453FDE022DDC3D8A9577C3D904F60864B31 BV$!E
961,954,564 *644B53E45C8D2318D13F33DF3E1016E916CEB274 BV%;E
961,954,565 *6440CEE4F6E833D2EFF80269F5331CE13A4E5FDA Bv;=e
961,954,566 *644F6996137836F7A27EE0CA81E4F9B2E8AFFA80 Bv"?e
961,954,567 *64435A387EB375FC09DD46799935808F114C8C9B BV#eg
961,954,568 *644542B08D1FB5E55B9BCDEF03C3AB9512EFA5CC Bve;h
961,954,569 *644E58DC0EECA08F079E51161C01B8A873E1F424 B?VEK
961,954,570 *64474FA70BFD9DE09791AE3E5059211163C69648 Bv.eo
961,954,571 *6444FD686473D2568485E48282AB2B0A2A2F85D7 BveoC
961,954,572 *64440107A4BE7AA12F9D303907E533AFA1717E10 Bve?q
961,954,573 *6440534CE5D01BBBFF1F3D02FFEF7E96E416BE33 BVEu,
961,954,574 *64403763157EE6EE0D9808C4AD0AB136658659CC Bveuq
961,954,575 *644BD56DBFB8DB3B4A6D31483414086302D576D5 BVew?
961,954,576 *644AAC7B552AE3D7832ACD5AC6125D659C53C88A B%V=F
961,954,577 *6447DABFBED87A3DA831015855859E2F830432D5 B)vF;
961,954,578 *644A83B928ECB8A3D190D3548927135A7C634C8A Bv-F?
961,954,579 *644728CFFF9145CAAA71E478378AA8A53EDD8318 BV,f5
961,954,580 *6444C2F988064C0A6CD4A4577CBF8ECA533900F3 B!VF9
961,954,581 *644DC6698E2BAB3F29C30F7725DBF9001196E830 Bvfa8
961,954,582 *64471693D51B80EA475BE2DF1627A8C6F8DCA421 B/VFf
961,954,583 *6449D849208CACE4A94DA285C67E7DC11914FEC3 BVf-j
961,954,584 *644DAC6408166AD1A25BA8D7AA62FEA032930CC3 B/VFL
961,954,585 *644ECF58A22D44742F62F85483C1DF50FB0780B4 BvFNR
961,954,586 *644281255D76701D89B81467606597B61CE2F711 BvFoZ
961,954,587 *644E1FCA4BE7D5311AF8723FCE6FA65CF1902915 B$VfQ
961,954,588 *6442E629203C9F82C237589522C2047E4FD44DD3 BvfrX
961,954,589 *6446C5DE9A9C7209EAD420B2787D6971879BA297 Bvfv+
961,954,590 *64422E2ACF1962DA8D84EDF2DAF8B70D17F8D231 B.V%g
961,954,591 *644EED894994B1FBC8B3078216F6B2A453F24006 B)Vg$
961,954,592 *6442A325462A48512B6BAB2500C418E3D4E92707 B$Vg&
961,954,593 *644327EEA3B6028F75DCFEFC3A28D993E913854E BVg:$
961,954,594 *644A55E65426F875299A4012371D131479B256F6 BVG$0
961,954,595 *64457C88FE779636215FA6A8AC50A1D11FD41840 BVG3b
961,954,596 *6445633218C7FEF032E9AEAB0A6464900238EDB7 BVg6W
961,954,597 *64457F5AC802E0EB4E8CEC4FD1D35F92E1E97C5A Bv)g8
961,954,598 *64471C2498B51662651AA71008D9C7E0DA9B2254 Bvgag
961,954,599 *6448B23108B023AD0A6E3E014F6F7E61C11B3EB5 Bv.GE
961,954,600 *644691243071F15343FCB5017180A163F666780A bvgkccing
961,954,601 *64412FE8BCE2ADE26D9E4A26F446B5F8824C0CFB BVG:L
961,954,602 *6449FFE4A722D369ECA3FA25C03ED047A1979A04 BVGNp
961,954,603 *64413DDD82F1FE2D9E0967930A60AAE3C1236066 Bv%GR
961,954,604 *64418A0A7214D15ABDEF985AC975FEED37CB2329 BVgSH
961,954,605 *644A6262738301B0452A2D53C376CFE249289E85 BvGYj
961,954,606 *644560D1304E21A5E4413A3B93416ED6C690B99B B+V(h
961,954,607 *644BE665F472361324C771000366DFECCF374DEA BVH!c
961,954,608 *6441739D2A243E638C8734478E6D598E94B074C8 BvHi6
961,954,609 *644AFB35E3BEBB92685AA1BE04FCE57471FC088E BvHIF
961,954,610 *644A05BA0EED719AB0B205E751FA208A1C4FEDA8 Bv:hm
961,954,611 *644F783E4392EF12F73E958428D3F6820679D93D BvhMN
961,954,612 *644A049E9B803A1775A53E1F217791E4ECA23633 BVHn;
961,954,613 *644CD3EC4FBFE3C425FF7CDE2509B03FA9EFAD78 BVhW
961,954,614 *64403401859CB3FA1998CA374D63121A9827BB8C BV-hW
961,954,615 *644178B69B7BE9717E2F1EFD4FEF8ED060BE9E51 Bvhw&
961,954,616 *644E095DE3F299C735A017339A8CD548231D1A5D B=:VI
961,954,617 *644E7673E6BA0F51D24D4567FE4F1141A89D080D B#Vi,
961,954,618 *644EEE190AA9A0DB8690643AFA02E578C824581B B=vI)
961,954,619 *6440DB47A936A2DC1C5B69709270B12B1C0606ED BVI8-
961,954,620 *644FD80FFAE06BE29402D02B8896D8B157E1A7AB BVi)8
961,954,621 *6443787EE1BDDF69D44D71E858B84146449FF30A BvI9F
961,954,622 *6442989D957F2F04DE3F2B3E0AA9AF778373A48A BvI9T
961,954,623 *644FFA5CA41013D54FC68C549E9F920D2C97B325 Bv;iB
961,954,624 *6444789F505C8329E842D21282572E25078476DA BviNw
961,954,625 *6448AD5D52CC9F005A8C2804DB08CC3679800C83 BVIRk
961,954,626 *644A1F8CD383C019349E3086E9E6FFBA60059C41 BV(iw
961,954,627 *644CCA90C2758A8DA4EB619DC2DDCA2C2F3476FC B#v$j
961,954,628 *6447BDDFA89B4C75EA540617AC3C9DCF3410AB4B B,Vj9
961,954,629 *644516E1EF252513E919189FB67C1A50A8E75FDD Bvj"F
961,954,630 *6440AEF86799CED01094EB4C42C16EC5DCED773D BvjH;
961,954,631 *6441D399B377B0E116192D3778BD4A2D712185C6 Bv?jp
961,954,632 *644D3FDEA25ED6D5D0B72FD83F6E8DB5367B9ECC Bvjpi
961,954,633 *64406912A06C99548263E19EC34EC43B5CDF6ECC BVjq+
961,954,634 *644AF51DAE21071FCE596210879464E37CD2183F BV=KC
961,954,635 *644AD8D9280965E2FF08C3B2946596BB7C12F8CE BVKEc
961,954,636 *64424EB637202D6E348EE21B9C805277CC9DA652 [email protected]
961,954,637 *644F76E7639EA63A63C653A9296D687621479337 BV=L)
961,954,638 *6441D0DDE97FC3ABE36BC229BBB349515CAA0166 BV.?L
961,954,639 *644B3BDFBA39ADD2ADEB4DFB2EA131C055FA5231 B?vL/
961,954,640 *64456EFC48FE6FAFE13B1940D6C4C071AC93F12F B/-vL
961,954,641 *6445E52EC4BFD9D4384B3FCCF14DFB2A63E7BE8F Bvlaaa
961,954,642 *644141B8DB533672D676392A1A589DF3AD7E680F B$vlB
961,954,643 *644193026D92D926060F0C821A78FC22538E106C BvLbv
961,954,644 *64414BC70FB792FEF08FA5D523E988C41326F616 Bv;le
961,954,645 *6443267A4FF09F0FCE66B99ECEDC539C4E944081 Bv-li
961,954,646 *644EE02B7714E592458A626D25BAAAF92C332738 B;VlK
961,954,647 *6444B78FB91FFBE5EBAEAF787382E9F0D008356B BvLl6
961,954,648 *64477AF5A8B8D0634134654ACE54E81A9C672F37 [email protected]
961,954,649 *64431B5C96661688E219225A9EF797F50C00FF3D BV&lS
961,954,650 *644690E4D79AEF3BBC0743EBBA18784CE5C2CDC5 BvLTu
961,954,651 *64463032344C75629521E58A1122F11AE5D260EE B_VM.
961,954,652 *644CEB3028DD8F6E73A8D180F4534785CB350BDA B)V)M
961,954,653 *6447FA8D16588F042080624C857F996F391F6AEB BvM+
961,954,654 *64490F2915D5EC22507CC15B4E1B1A535A305DDB Bvm:;
961,954,655 *6448CBE9C488A1CA8E26768E66F2AB2F340BAC6E Bvm,3
961,954,656 *6443800318DB17E66B26B58F6B9FD5118ED9D0E1 BVM7J7T5cxkC
961,954,657 *64411CAB604505CEA33DB7A2B315C67F85B48422 BVMCZ
961,954,658 *64480ADC9C6F9A5BD93FC84C7532501FA2F75270 [email protected]
961,954,659 *6440E9E8FD8E08ECF89C7DFCD2B82349E219FBAD Bvmm?
961,954,660 *644BCDACAF3E25C4295AF4721DD8EAF0D5B36005 B#VMn
961,954,661 *64408750583A9D181726D11AEB1791332D012CC0 B,vMN
961,954,662 *644C2EE4BDC8735150E821F97D62815D712216A0 B:Vmq
961,954,663 *644D751907AF3D44DC1FA469E40591C8E80A7F44 BVmXb
961,954,664 *644F678BF039AAB00CB0C53509A4189FB6BE64D0 B!Vn
961,954,665 *644CFFBB0F40EC579CBD2CEE9A51260609A8F1A3 [email protected]
961,954,666 *6440FFE482CC5CE3E458DD90021043FA841CAED5 Bv(n8
961,954,667 *64430E35CC3091F6668550ABB5DE63F902100A33 BVnaU
961,954,668 *6446078EA466D5632C6CF7FF7C7873B56B052582 BvNgB
961,954,669 *644057385940368AB5CCE4FBBB88B81CCD35ED70 bvnhnds0
961,954,670 *644E18565278A33695B73DE15485B618BB78F5A7 BV
961,954,671 *644E77568D52BC0A401D3DC1B30DF90BD3BA2B53 [email protected]
961,954,672 *6449C9FF8AE6C1930CBE10B159D045938D123358 BvNNr
961,954,673 *6448D7B169FBCB9396FE769246E1862D43415E60 BvNq&
961,954,674 *6441025F3D21DF5A75749CF8100F3BE1F75DC809 BvNun
961,954,675 *644643AA42E7D27D4683ECC9464860C132EA9B69 B(VNV
961,954,676 *644D8F8DC42715B2685A7126F001C16638952F80 bvnvrmld9
961,954,677 *6442DC0CF0D6C27E692924292FBA122AF0EDB9AE B.V
961,954,678 *6444CAD9937547095CADF120C25AD749C2CAB7BC BvO8i
961,954,679 *644336CD7F237088DF714C601868959812DD152D BVO.C
961,954,680 *644362C7B9E01B8AEFD8DB5248A0882023F270FA BVoeC
961,954,681 *644194BC90A398FF034B1EAF824CED50FF8F9B16 BVO"i
961,954,682 *644BD461181A140331F764F51AD7C7F633C6ED65 BVOk9
961,954,683 *6449590E3CFD2E651F0A4A682F5F5C8A5FD850BB BVOn5
961,954,684 *64461924E489FD8791AF315E6987B8A2BE64807C BvO.v
961,954,685 *6447D1EC7D8E0CC7EF990F3E07E31C68131EA6FD BV-P%
961,954,686 *6441F483FD6AC7EA8AB1AB42AEB3DB7D4C1A30F3 B!v-P
961,954,687 *64410E36EA9C3EC9E4175BE870014E827CA0B708 BVp6i
961,954,688 *644C77EBD9053E89A2B797638DEBAE79E3FB15D3 BVP$b
961,954,689 *644880B4A5B28E0080BDC6141E30F9D567AE31C8 Bvpe8
961,954,690 *644C54D6DB0A0CD7E1F8FCA0E21D0F484D4F3A44 Bv+pH
961,954,691 *644CC0DADE04BA8315485C018921EC56CED24748 Bv&PM
961,954,692 *6446C285D277849BE16436614346746512B424AB B.VPN
961,954,693 *64477FF2594D9A09E61CC9924BA0A9831ACD43ED BvPt2
961,954,694 *6443589E4D0292A0549AAAABF026BA7219DB57F4 BvPTM
961,954,695 *64463E8FE1712D4CDEF1DF2FFCAC0936D71C7C31 Bv!q#
961,954,696 *64463FB9EA96AF242E9B032F4DA6261F5BF31D0A Bv$Q8
961,954,697 *6442899B1D14251403E1A2D3D35662D31346EFD1 BVQD%
961,954,698 *644FAAC5CD6619347B5BF51EA7D7990D82A7C081 Bvqie
961,954,699 *644B28A58CAA2883C3F2FE26FBCB6CC7CCE0B46D BvQjG
961,954,700 *64467EB7AAF818CBDFFD785FFB47BD8DBD90A300 [email protected]
961,954,701 *64468A7AFA32A1491E9E3DDACED8E7FCA5D95D11 Bvqpw
961,954,702 *644FE8993B0CDA044AE626DE6CA8E0DA061F8F3D B(VqT
961,954,703 *644136F66EB77A737855F13754FA431C7215AC23 BVQ,u
961,954,704 *64420CA305E52BCE5EBEEFF374DB387FD06AF5F4 B?Vr
961,954,705 *6443C5FEA2B38AE911DAF36F11BC4B57C63C4D65 BVR32
961,954,706 *64437D4039BCD39FB5EF592760E4A9EB75C23BBF Bvr&A
961,954,707 *64433B95304AB3888A08EED20A0FF3E06B07FAEC BvREj
961,954,708 *644C5330C50C28F46A73F12CDD5AC119EC97A73A B+Vrf
961,954,709 *644486D0798D443EC82503979A11B0A67FD0A8BF BVrFp
961,954,710 *644927CD51BCDCCFD6A85855038B0668CDC6758D Bv#Ri
961,954,711 *6444190FA0646F1DD8BE4958D3117E1EAFED0856 BVrNP
961,954,712 *644D0155C323D1FF6571728195856BEFCEB51F16 B:vro
961,954,713 *64425C5D603934B2EAEE3FF4F9C8531C0260DDA4 B:vru
961,954,714 *6440BFBA9300A554F9694C89154B05D76AEB742F BV&rZ
961,954,715 *6448290F4BD900CBB2822F51CAF4F24ED54EF63A B/V:S
961,954,716 *6443EF4E6A123FFA6CA3269288DE79ADBE4916DA BV%S4
961,954,717 *644C6B1681DF42A952D9D6A90BDC156560D69848 BvS8K
961,954,718 *64434C63860DA452DAEAD117542F9DFEE013A7D0 B_vSe
961,954,719 *644BE09A43EDE46B556AC4DADD7EE505BED62189 [email protected]
961,954,720 *6447DA897E78534C8864E7AD5F61B5200663F3AE Bv$SM
961,954,721 *644812D9A9840521DD869E2022597E131DCAAF26 BVsP"
961,954,722 *644E185AE6ED6C564CBC3E60CD2AC36F46F90287 BV"Ss
961,954,723 *644FD7CF104F8A4F46AC80D277108C9EB50DCE8D BvstQ
961,954,724 *6449B3D408E81301FF73DB045B7DA8483D43EE80 B_vt_
961,954,725 *6440279F434C13C787E918EF4BB1709C9A60E090 bvtauebivi2znqfiqmfcffoavcbqyiv0
961,954,726 *644DD28BD73633D377C04B35719BCB7502020D17 BVT#F
961,954,727 *644E8380800B94C59D54236BDE24B7B6F21D7F6F BVth&
961,954,728 *64496CA227AA666128CB994C7BD6D7061E1563EE BV!Tw
961,954,729 *6444CCBFB94AAFE898886FAEC019252CBC4EB044 B#?Vu
961,954,730 *64433AEE28B1983E576E072F2DA92274054619BB B(.vU
961,954,731 *644D2F3E30C0DBFB47054802A882A7EE9338B5B5 Bv,U=
961,954,732 *644E0AE76C657B7A580EFDB53628935AD87AE62B BVu4Z
961,954,733 *6443755F22E79F20310E5F7425F5044952B50C59 BVu+7
961,954,734 *644CE457095835264108035EF0E8419CEDFC2203 Bv+UB
961,954,735 *644840C37837FDE8B68AD6BEE59E6C9DA19ED9F4 BVuIB
961,954,736 *644413FD23C7470126AF1D4C0D601E3EE0ED6330 BVUin
961,954,737 *6444E13A26EC777DC542E3B3A82DA55E7E0DCE0D Bv/Uj
961,954,738 *644D07F25DA861A2EF2F13C1F872B74CC7C6F36C Bvuj,
961,954,739 *64446CB2A0BEFF415782D4B35539DDF00FB8DB92 BVUkB
961,954,740 *644208A69143CC8DFAF63000E4AF66210B4A972A BVULl
961,954,741 *644B73502F2376A07E4D29D1ED2286BDE319D0D8 Bvu_p
961,954,742 *644254DB6862E6B6CC4ECDF1588BC53DCFB12F73 BvurU
961,954,743 *644C6559008D35286995BB37568C1D68C5AB6CD6 BVu!Z
961,954,744 *644730F71075BE70BDEAF4F6192679ABBCA70A3E BV
961,954,745 *644C38DA81EF49CACD0EFFA0CF4A6DB8A5679917 B:%Vv
961,954,746 *64499F70B34026F963246E500EC1B28793A9C9B7 Bv::v
961,954,747 *644DC48DF07281A4B7435F956DE1FD38F4A56CC6 BVV6w
961,954,748 *644C4F6CF8FEED071BDE40DF18AA98557CF56404 Bvv7
961,954,749 *644236FAF17F724A87890FD3925C10400161779B BVV7c
961,954,750 *6447DA79D3C8FFB371135887C3718F2FDE4B8664 BVVaL
961,954,751 *6440FAC61EACF3FE06C2182E7F1F45C17EA100E7 B(vVe
961,954,752 *64450DDD458F85C9A54405AC67D1D60E3435A367 B=VVG
961,954,753 *644C053588A2C8D677705E6F2FE8AF6C0E57AEA3 BvVIi
961,954,754 *644AB406A5421B87086E404717EFEA52C7441C94 BVVjM
961,954,755 *644102DDFC93E25702CF9ADA83ECBB61D160A443 BvVKW
961,954,756 *64417FDCE7A35AF5943CC649B10BD1B831849229 BVVLBLF29
961,954,757 *644FA963F2786C34205B7666FDACEBD5DDB18CC5 B)/VW
961,954,758 *6442F64DA5E3020D4DCE94E6693AC72104B0C8BA BvWBp
961,954,759 *64495EEA55CDDC2A3671BADAFF75305175CB0FD4 BVWCq
961,954,760 *64433574D1839B151136D7753BF62FC6C093C54B BvW#D
961,954,761 *644EDB38BC23A71B21BBFCFC4FB2C64B9C6F2BBE Bv;wd
961,954,762 *644D13840A257F60C9DA87DE8049A56E8096A47D BvwFw
961,954,763 *64408EB37E8A4EAAA903641D6785E1621EDF93AD BV
961,954,764 *6440F3ADD13D853B2B823B3C7AFB5A0E135D46AE BVWp,
961,954,765 *6447D64BE05EECAF6692B4C0DFA98911F8300550 BVWPl
961,954,766 *6440BFD1D08C8346BE6D8592A2F08273B775AB15 BvwQ_
961,954,767 *6440B74FD7C9EB280965B3918A8CB6F24105245C BV$wR
961,954,768 *6445DC0618820D9CBC2C5A9C35AE26A2A8194DE9 BVwsA
961,954,769 *64458C4047F8AE8EBAC8CABD3B7A7C64DC8DBC22 B:vwU
961,954,770 *6448FFDBB40A6E7EBFC2968E830824CFF52F9AB1 B?V-X
961,954,771 *644A8E9E6AB33D3EDFE2D20863257223078BDDE8 B\VX
961,954,772 *644F3C6CDA7D0452BCEBEF9E2E88ACCE4831A2EA B&:VX
961,954,773 *644D5C0FA32FE06900F8495EFEB9CA7B01C186DB BvX(7
961,954,774 *644C3BDC8E76DB09A6204EF26FC85E182444C9C3 BvXX&
961,954,775 *644C16CF1099310D6BB5F339B2E30A19CDC92F70 BVX.Y
961,954,776 *6448862D4032EB0DD75CC2467C82B1AB215A7283 BvY2k
961,954,777 *6441A91F2ED882811C563DE68044010BE67AE69E BVYa5
961,954,778 *644558C392B308710867F2CF7AC02388960106D9 BvYD%
961,954,779 *6440CB7E352351A7C7B34F7A4D4DAF694D2348C7 BVYRD
961,954,780 *644CFF2EE794861B6EB34D2E9B95C46B7689ED0C BV+Z-
961,954,781 *644982D675F8074C237BCBE8CF63C7271AF66D4D B/$vZ
961,954,782 *64487A434CD78659EF4FADEBEF3255812B38C851 Bv]z
961,954,783 *6447C870495E0D2F157BB607083C5F4BAD371048 BVZ1S
961,954,784 *644D880885B34D0F73FCE2015F7F65351327CBA1 Bv(Zj
961,954,785 *644BF1151D685AD1654134EC778E2909332EC2F1 Bv_Zp
961,954,786 *64435113168CE5E6EE5A4991E486204072BB95AD BVZrO
961,954,787 *64416F3AC02A11006DD0291C98E6A746DEBD1708 B=:W,
961,954,788 *644AED7BDCE8FF8244D599E038EA3A574807CDA9 B=&.W
961,954,789 *644CE455B3AB0AA8873A5E215FF41935AF1FE4A1 B:W&
961,954,790 *6447C7EEFF96C5878FDECDB95659F75DD3E9637B B"W#?
961,954,791 *644F4AF64540E13D516F576E5C033D072600F779 B(-W$
961,954,792 *644218658EF3D9FE0A723A3A808D55B6F564505C B(W%,
961,954,793 *644FB4D4ECF616E02DB6BB51BCB61C23B798A0B2 B&.:W
961,954,794 *64491D36B2B6F9009EF86FBB6356A1C1AFA376DF B+;+W
961,954,795 *644441208C1D7BB522F89DED3C525CB3A3EA229E BW&";
961,954,796 *64403C71498878E11F27AFE69FB078BFA01A9127 B:(_w
961,954,797 *64420A0FF2006C102FD022558B563E9D0798EA5F B/w%?
961,954,798 *64433C5FCD40AB4F493A7A77CE43619F8613769B B)w+&
961,954,799 *644F46C27ECDEACD792096F412A52C010DA2A2CF B$w=:
961,954,800 *644FB7622456927E8618FDCC63D8B58BC0D5A05A B&`w
961,954,801 *6447065D92467C8F96C968869957DCBD91AB552E B%%w/
961,954,802 *644F2535289D0961DE9EB4049FF978567CBD5E52 B
961,954,803 *644B58D11CE234C9B9A126BD79EAD239C7583EB8 B"#W0
961,954,804 *6449CA1B90FFDD74D5F26B664F619B1A1CB2B908 BW,
961,954,805 *644E10829CD8D95F5E7B9DC51836C41897911E82 Bw0=1
961,954,806 *644CC0E8D1A3980466F9CC994A0DB6538614C8D9 [email protected]
961,954,807 *644EA58F23764571E38947972EA76C867F9FB9B4 BW0+N
961,954,808 *644CF2EBD3A9B5B240E786490856457F5BEE1008 Bw&1-
961,954,809 *644FC1A910277F359088123CB1A87E8354790F89 Bw11g
961,954,810 *644B93FBB297597ECB2CF31C1D0857913A19B0BD BW1$2
961,954,811 *64455E6B394CE232FFD1A6F1289BF5281A3CFE45 BW2-:
961,954,812 *644070D7A0D64017E150875F80A7BF00CB82D327 bw20070108
961,954,813 *64457B59130830C16E0A6A4832D4222A0CA5ADC8 B
961,954,814 *644F97054CD33ECB877B0B8C9AC0A2A50019A583 B$w27
961,954,815 *64400BF8B59863854AE2A574D2FA183255E4D41A BW2g&
961,954,816 *6441023254435765EB294930D496FFD72948188D BW:3_
961,954,817 *6441A73D6B1D807E097B90FC685EC10FF38D8962 B;_w3
961,954,818 *6446E8C26DD6F50830E4B40550D95B505F14C9F3 Bw316
961,954,819 *6443DCC64EAF514EA34C0503C65939F0F3BBF141 BW37F
961,954,820 *644CFB5FB498D47D56BA624B5C787A4064055AB8 Bw+39
961,954,821 *6440AF804C27147B5D63D4AB7C562F54AE62396D BW3CC
961,954,822 *644E0A4E06B568D9F9201D8D07737BDE43CABE88 BW3-O
961,954,823 *644ECD5FA31E1564EA20B2E8360DD0DAE8988F1B B:w4!
961,954,824 *64435CB7A4B4655120D2D69D45E6C99107D1E529 B($w4
961,954,825 *644532B85900C272AD5FDF645D6E4EBADEB888FA Bw()4
961,954,826 *64442ABA3B1C3775DEDC73EB9A40C41E58A37827 Bw&%4
961,954,827 *644F921EE910BFB8EFF321A541DFB5B071C54F92 Bw4e4
961,954,828 *644B544476224E892634CB792CA461A3EED33C44 BW4P
961,954,829 *644EFCDE177DF69B3B9A61C588D9D37E9569A207 Bw/5)
961,954,830 *6441E7862753D5241B707EF6E306D71AD174836A B-w53
961,954,831 *644AFFA834312BDCA22E01CA69ABF3F09085D14B B)W57
961,954,832 *6447AC0371364F3BF593BD4C9ABF9C90D75BDD71 Bw592
961,954,833 *6443E52395473B1A8D250410CECBE98881D86F88 Bw5T?
961,954,834 *644E607BE8BE9196F02DB531883E23D829A5BC22 BW5T4
961,954,835 *6449706EA2E80DFDF019B3E8C246F927395B2BC2 BW5Ud
961,954,836 *6440CABC374BB1E31B89EFD6740F2CDBDB8995EF BW6?.
961,954,837 *6443065B732AED56702CB79089F2732555348BB8 B=w+6
961,954,838 *6446727236466F4D454A5E69311B679CFDA788B4 BW60M
961,954,839 *644084631BBE2360359B96D17DAE8C3157E7975D BW6g(
961,954,840 *644FE800BC54A74C161AEC7C8BA47FE679482B7F BW6SR
961,954,841 *6445A430B927F36840E7C11F1F0E76F40BFBC7BD B%w6X
961,954,842 *6449C146F65565193D4BF3B42675C6ED3304CB96 Bw_6X
961,954,843 *64412DEA25805279795A2222DC9FE6BD40DA2B4D B,$w7
961,954,844 *64450684EDA87D054ED2904FD1B90D928B7BE781 Bw7"+
961,954,845 *6444B4C5688D035DF23AB653C946152596D2CE41 Bw727
961,954,846 *644312BD85C0847EA8948B029D2E4227C85E1A86 B?W7b
961,954,847 *6440B6489ABE71617DC12CD08C32ED3B9965992D Bw_7G
961,954,848 *6441BDFA46CC2FCE8D175D6FE0B6FA4894ACE140 Bw7k5
961,954,849 *644E93B7F0C4A904C50AEE0182F353407424868E B)w7v
961,954,850 *64495A3B36EB0056C09BE5A42C401563EE4F0DF8 [email protected]
961,954,851 *64422EDD6EC7A05FED7021423A43C974C8E6E447 Bw8fO
961,954,852 *6440C7CEAC2AE7FB9D7009AC3D377475FF5AA53F BW8=K
961,954,853 *6445A5BFCBBC839D2BE5604579BBC51221883196 Bw!8N
961,954,854 *64412DBB0A989AEB0B3E9D6B2E1E82760F6867E0 BW8Nb
961,954,855 *6447F678D5FFB2CB61977B4E8720A72299113E52 B&w.9
961,954,856 *644F718FCF11FF6F4EFD39F2011B137C23F1E9D4 B(W9B
961,954,857 *644DFE15EA83CDAE4F671B4514976A8218769101 Bw9gj
961,954,858 *644CE18A7076CD19E3B87AC9450DF1422663C2DD BW9IH
961,954,859 *6449C9B3B8EBE1E9079A4F02FB072E3E22F8C944 BW9NT
961,954,860 *6446E84BF47F4457AB314E4FF8588FB65FCB0BAF B;W9P
961,954,861 *64475FA242659240316A33962E8075F066013962 Bw!9t
961,954,862 *644E6FA2314F21D4D6C5E3EC737DA86BC2B0194D B-:WA
961,954,863 *6442A79B972E9080CBA58D12BEA32E4B43DC6DDD Bwa/-
961,954,864 *644B59F0F40E00209A68DF2CF8811D7E9F04BF11 BwA3.
961,954,865 *644B25CDFACEA6B781109B04F3D1ADCB3CF970F5 [email protected]
961,954,866 *64427DFD7B20F952DA06E96B223E3D73F163345C BwAD!
961,954,867 *644DB5E444EF7499D2A2574F694D89DC300CE8FB B!waE
961,954,868 *644C3FC895DF780FF353D94D3AF0D15F36BAA443 Bwallace1701
961,954,869 *644FF572D4759D9A7A1C007662045F37C47884B8 BWaLR
961,954,870 *644328BC7F1488ECB2712DBA2AEA2FB5BE774B5C BWAMAZON
961,954,871 *644D2F1CF0DF3F89138176F8F7CE39EF193D2E19 bware.gif
961,954,872 *64438054C14C74221AD8FA4E366DD12A2AE0AF66 BWaSU
961,954,873 *64490E695218D2FB828432859815A7488EF9412A BW;-B
961,954,874 *6443B6DE40FF9B7409EFE8CFA24D83CB7F7355CA B"Wb;
961,954,875 *6440C64A1B29E1F90B926C99E2FFDA7F90AB02AD BWb"+
961,954,876 *64491A751CA6F35BA7D6DD027403C8E63526F3B7 Bw(b,
961,954,877 *644372FC70CBB1A88DCCA22F3E09C33CCCF60DF4 B
961,954,878 *6444F41EFBEA5424BADFF450232B462FF54A731A Bwb;D
961,954,879 *6445539E0DC8CD7E7254F8B22C52FCEA750FAED4 BwBh;
961,954,880 *644B2257E37DEEEB95AE4747F7A8A441A696D60C BwBS;
961,954,881 *644313C7E8BDC3B525E4B46EA1CA59635397007A B&wBT
961,954,882 *6440930C42AF7F504551B9AA0CFBE735A5D9B8CC BwBz
961,954,883 *644D1C79C0E6D5E36C7ED13FB3A25352C855418D BW&c-
961,954,884 *644D1C3296243905E1BD633A8312BA7C8D62B44D Bw$C%
961,954,885 *64474E85CED86A4A6039E8F5D119AB08A9FFA269 BwC\
961,954,886 *6440EBC97BE6159FDFD7449B9A2E5DA38300CA78 BWc7#
961,954,887 *644D22EBF0C27D7B06B867C2995FF0D1E1AA0113 BwcC(
961,954,888 *64415723638C50C07AB1D94CDED05ECBC0825B56 BwcCR
961,954,889 *644C10A94E598175A20E3071E8E37AB01F3D16BD Bw"cd
961,954,890 *644DF8A9E7858B1C7B136558F553E8199D39D969 B(Wce
961,954,891 *644D0E255A9E682CFEB330E6A0EBC3833C48A201 bwchun
961,954,892 *644F6662B2DA57487F2E04A19CE222553966324F BwCl?
961,954,893 *6444A381F608F3D09C8311EAEFA460976AA4BDA8 BWCwM
961,954,894 *6443171527163BD1D9394EE9D66ED4E145B3B3F3 bwczvnhed
961,954,895 *644B74D005DDE3F555413B180F78CD94587A4F19 B%#WD
961,954,896 *64409B59DC9E4439D8025BDE1A8CAA69D8015346 BW%:D
961,954,897 *6448748A46AB44E334C5E54B4BE903A7CCDEC4E1 B/)Wd
961,954,898 *644C25C283EEE373B551847F6EB093F1DCE0A151 B.W.d
961,954,899 *6445C87D1FEE00CE8DE49CBF06D8C896B4532D95 BWd39
961,954,900 *64402F96880E6D9D16AA6A35B0D2B78F982612EB BwD7&
961,954,901 *64437092EB3352691A46B986C10BDDAB9F90C43E BwdcZ
961,954,902 *6441E6A518A2633BEDD074899D2FF6532697B6FA BwdLD
961,954,903 *644DE78F08849F98A9AD3330346BD3FDCF0D0F82 B?WDV
961,954,904 *64418AC484B365D1927A5D40671042D107A57C18 B?W)e
961,954,905 *6443720CBE3110CE7369878664B5C177292246BC BwE-#
961,954,906 *644EBF14F9771E5C3FF46A28EB8A1E272EF5C48A B/we+
961,954,907 *644C8B5B44E7D2CA656ABD961C1181071873347C BwE4F
961,954,908 *6444D4387143732A5E5452CA73CFB9D0E8DD6B68 BweDr
961,954,909 *6440809BA6D61242EFA979457C3DD09DD4302156 BW!Eg
961,954,910 *644A5B5D9E31E2AD4FE5CC05D4A3D3720F2F4997 BWEG4
961,954,911 *644391AAA26D3B71AD217B655A76EA797481546E B:wEO
961,954,912 *64445A5326FED0D1E63399C81D2067023B88EE65 B)wEo
961,954,913 *64487B44651C3FAEE67B02D0B547B4C6CC56EB05 BweRv
961,954,914 *644CD5FC486A0291766229A9C9D8751C6AC6C25D bwestonplace.ca
961,954,915 *644A9C14BFE547B491D7EC9B4C246AABF159034D BwETN
961,954,916 *64401C37A5726BF56DFFD69D62EC73661A6C05E0 BWE"Z
961,954,917 *644BF79499519153D27C826129D3547EE8B323D9 B%Wf
961,954,918 *64466B08DABF9E57CDDB37FA4B4EDE6C367D61AB Bw#-F
961,954,919 *64458E4DD5272DE16A16DA1507CFF753852912F5 Bw#+F
961,954,920 *64453C1B88BC4E5B17A7D43554DE29F6C5B36E2E B-"wf
961,954,921 *6449256D7923367612D22D1D940985EDAB61F166 B
961,954,922 *6444B018F448441B33EE5EAC90199FDC755BD4AD BwF,3
961,954,923 *6440FAFFF975E36D2AAE8FD7E62808487677C4F3 BwF3h
961,954,924 *64436B80566D33E05B602F2E9ADF1761287EEC1E bwfnegtl
961,954,925 *644BA83CC1DFC2EF190034516AA0113189A1A83B BwfO6
961,954,926 *64481D4BBF66D27D7B34907812F751373F2E19AF BwFRvHW99
961,954,927 *644A6F020DDCF0E452D324475B976277739F3060 B?wfs
961,954,928 *644281EEBE7F1A33714B245D8F289CB31FF335A5 BWFw%
961,954,929 *644D328273A081FD95CE480C2477238633308ADD Bwf$Y
961,954,930 *644110D42D07FED97A605F74D97DC56AD84655FA BWG/)
961,954,931 *644B4614AB9E393A96A31060C6E3E2A7F3499506 B?wG#
961,954,932 *6449C56353608E61F95953A1A217427D9E2DC2A1 B+w,G
961,954,933 *6447B0140FC4B5B3BF7FB14A3AECD1DB600FD8C7 Bw,g:
961,954,934 *64449C4FFA2A0BED4D3DB67907D8F8ADA6BC1BFC B/WGf
961,954,935 *64435AA39016E0814EF83E97404E0BD694BE281D BwgiO
961,954,936 *6441FF6C2739D8606727DDE6DB7B81F3046369D7 BWG.s
961,954,937 *64457A45726597C1A32DD80503BD8F710A95D7E2 BW=Gt
961,954,938 *64403AA1D9FED230244BC696114F7656575D8502 B?$WH
961,954,939 *6442172F2B942B940AD80098C484DE51776CE676 B)WH
961,954,940 *644C0832DD700ED58294F2D0879DFFB783683E5E BW!H,
961,954,941 *644E80D7B27772B7CFF13E58CDCAED98BE8F7C56 BW\H
961,954,942 *644F32AF2A652241FF9C3D33B70E062799D934A8 BWh_"
961,954,943 *644D54E7A680125C0470D9ED5810BE122121CF29 BWH2p
961,954,944 *644ACCD306637F97399EDB82181AB751097C069D BWh92
961,954,945 *644A6B0795D00E68D6D42C4ACF2FB1008D4C6658 Bwhb.
961,954,946 *64448259BAFE41B1525C31F662213CD46F0A0DE6 B%whM
961,954,947 *644754415C0603F7336B9983079E96395BDF1F11 Bw)hn
961,954,948 *644E52E099C60A14E49DFCB3F1E30D7A1D5EC6D0 BWhnQ
961,954,949 *644E5CD6E7A2BA1C7835C8656BCAEBA701805958 BwH?R
961,954,950 *6442B930715FDF43A529914E3BB2967D3882C60B BwhSk
961,954,951 *6448B0128F11C4601CAC84339C285F0D91F278AF Bwhsl
961,954,952 *644D126A307094144B65F868CF7ADA1846E7BEDD B/"wI
961,954,953 *644DE9E0FACE29A69852B4C9C7D79C8DB4F00684 Bwi,?
961,954,954 *6448344D1762996C17CDDA44DC6FB6D529439425 Bwi!!
961,954,955 *644CA78F032727E1FCC3D10C6100E08AE4F397DE BWIAK
961,954,956 *644CF436413C193A896D045EF52507505092BC47 BWI!B
961,954,957 *6441F393F85B99FCDA7D3861B4B6F25538E13436 Bwi+B
961,954,958 *64467292B1A3BDC6DD22EC70F228D69DA7CCEAEE B+wiF
961,954,959 *644D30C273B11FB826BFC0A1445D133878CEA489 Bw,ig
961,954,960 *644950420A3AB4555071DEE4AE12030621A289CF B/wIH
961,954,961 *644642A4F3B5530E8E3A3815B13EC5F4B4D9F3F5 BWIHIL
961,954,962 *644BB0361E44784DBDCA95E07F41F31252631924 BWIIG
961,954,963 *644EAD84BCB57F4CC4B593DC6DF83C9C84A27521 BW?ij
961,954,964 *644E645201443C4B6B0F9803918AE539B9238D1C BWI"m
961,954,965 *644AEF00B84A41A58EA1AF1FBC1FCD933146562F BwiNX
961,954,966 *644BA263FAAE5D01C3CF9F40BDA99B3967595721 BwI;R
961,954,967 *6446966252E15BDCB76C814F4F55B11882F533FC BWIU&
961,954,968 *64446E091AA72FE1E2D025BD84A8B22843C13B6E Bw/j#
961,954,969 *644C29A73E5E9A5EA4E51D2ED1452E2C054A82CE Bwj0P
961,954,970 *644AC0AF24F90DE9E674F9444E99472C4B48A7B6 B!wja
961,954,971 *644D8EF0CBDAD15B18E5F2071FF6540774AF1F74 BWjD4
961,954,972 *644C569F4D88C9DFFC3F2C99CBF51283CD5C7B68 bwjeng1234
961,954,973 *64494E04C02C689261F1A80F2A830B919903FAB7 [email protected]
961,954,974 *644BA18C8BA61CC9CB52E8A8BFE54506F2E88959 BW"K)
961,954,975 *6440CE88289BB6B19EE8E80BB0F539AC30FE796F BWK&:
961,954,976 *6442847A5F89AB24F2E5667431AAFB2BB3FAB3CF B!w
961,954,977 *6445F8B15B9C22D85D8E376C9C19CE2DE78543FB BWK9P
961,954,978 *6441965A5CC52AA3416B6B085C1170C978BDD9F2 Bw#KC
961,954,979 *64478AE76507E4CD9F0645DC7314164624013C41 Bw?ke
961,954,980 *64419B6C58A1FCCF87CA96257827D6E4CBCC655A BwKpa
961,954,981 *644D5A45AABCCF36D71EAF20C21492CBAF29EB68 B/WkU
961,954,982 *644353C35109E7071C99BFDBBAEA44CDBDCF59B9 BWkv#
961,954,983 *644FA9632E20D5FDB5B583863836627839F7904D BwL6&
961,954,984 *6447612EFC41C32369426A0348124BA371A35A51 Bwl7h
961,954,985 *644E56B0D11D4B0CC6587ADC2026BB078E393ADC bwled
961,954,986 *644A5C8F2578B5DA84E2D2C3355035015D7E98AA BWlEY
961,954,987 *64431F8D7F0740DFB2DCB6D0B7AED4E7CE68ADF9 BWLf_
961,954,988 *644BBAA732EF566F88D37567CC6AAB1D7A344BB5 Bw+LF
961,954,989 *644087DE5096336959E2B020EE139552584CEC21 Bw;Lg
961,954,990 *644362A9CBFE428CAC7D0A87C81D1AA0A19A16B9 BWlK$
961,954,991 *6449A6764E01BD82FC0E3533ADE556378F62A03D Bw:lm
961,954,992 *6443374D160E2DD3F0C048CF5D552309804B2614 Bw/Ln
961,954,993 *644202F14DE76E5C15E82BD0E5A51BFE5FDE4D5C BW;lq
961,954,994 *644F073B71EE6FBE01DD0B6487C3664C6FFCC615 BWLQh
961,954,995 *644B14B64787C247563F7F06CA95C742369F550F Bwl&R
961,954,996 *644314E5C0449C84EC177FD397B99065A6D9C962 bwl-ranking
961,954,997 *64475791BF4F10B01806C8C1F2B79F98A10A0D45 Bwlsp
961,954,998 *644787A3A6EF574C2AD59970DC3E5F0D93EFF179 B:"WM
961,954,999 *64436B9AB61B6410A81EB1A47E2B549FA7CFBA0B BWm__
961,955,000 *644E7D876FAB0F19BE082B59D3569563F0EEBC30 BWM0U
961,955,001 *644926848081FF560BA5B68E4BF7AAE8BCD324FA BWMeS
961,955,002 *6449AB90D499DE30D505AD4F044493B6EB84C895 B:WmG
961,955,003 *6444C99C36B250EC21EFDF5C78045A93E62C27FB [email protected]
961,955,004 *644B41CB9365E92A90A711218AFAF289F21C4966 BwMR_
961,955,005 *644C24F67533DAB61AFB098B09DD52BD4703329A B_Wn&
961,955,006 *644BD4783BA93A18F810F81BB7E49E2CBACF3708 B$_Wn
961,955,007 *644925F2CFBD82CE6FF0C8045C8765FD6DA12F9F B#-wN
961,955,008 *644F7C72BB54765173D0EB87E35E1D505FF50E31 Bw_(N
961,955,009 *644964644D7E19307452C464B641AF3F4AE9C0AE B!wn_
961,955,010 *644E2DA5E9E38968D2482306423462655EDBC882 B!wn$
961,955,011 *64473FCEE2BB45974E5636ADE9AB2B60676E0801 Bwn7)
961,955,012 *644C33CA4F53BAA9CBDC19B67EA1A8C222DDE40C BWnba
961,955,013 *64457B7459DD10BAB8965B69EC369AD426BCB676 Bw_NH
961,955,014 *644D4F5A4864A71AD9012AC88460C43F09086487 Bwni7
961,955,015 *644D62AF12A189CE51717D49EDA85F9547ED35FF Bwn-k
961,955,016 *644E1E48CCE46E51B13384BA80D389876599C183 Bw#NN
961,955,017 *6440471C9A5106DD83BBBD7EEA5D449C073E0744 B.Wnp
961,955,018 *644DD7D1CADDA5694FD95B6448F77FB397688F50 Bw,Np
961,955,019 *64410F08A7C1CC0B7CFA4B8F26AD2C9866F79DD7 B)Wnr
961,955,020 *644C1C58A01D068ACA947A0682BC7FBBD8C0A48F B)WNs
961,955,021 *644D77BD849D124979210E93B28180D38356D323 B,/Wo
961,955,022 *644D6F95BD32665AD27ECF535D67A11A94531AA7 B;?wO
961,955,023 *6444ED9C348FBCB7476CD458E6B18593E3679351 Bw_"O
961,955,024 *6442CE670866EE099AC10E992B39196958F5DA7A Bwo5s
961,955,025 *64428810B3CDD994FF631062C122E6254308799B BWO6v
961,955,026 *64424FAFA1C96E55A51682393499B4222B481EFA BwoA)
961,955,027 *644C61FC10EB2B65DED5B0FF7D032E089939D2BC BWoAG
961,955,028 *644A0A50FA9E02B45D91940FEA3D1FB6ACED6D73 BwOlv
961,955,029 *644BBEF19CAC63E7A2DCBCC647694DA2E305A34A bwompbeats
961,955,030 *6448F980A7C63D047ADBBF5B5B9ECE35E26BF448 BwOO&
961,955,031 *64472547EA77243090ADE209A17E79A19D469C20 Bwo=P
961,955,032 *6442BEF1468406D3A06A8D1ACECC889580EAE091 BWoRf
961,955,033 *64478D15C22352617BC25205553C407C61332D71 BWorX
961,955,034 *644EE1122D3DC283C53A8ED6ACD5D3B1990FB1F5 B/wp3
961,955,035 *644720B442B8F9DC74B67A559FB3B9474C42894A BWp7=
961,955,036 *6446213A37D207F1DECBF7306824B514E49B7477 B#wp7
961,955,037 *644A8A6E42A223D43D06E12B65B625C7A8BEAAC0 BWpBr
961,955,038 *644269D16FD58BF27EAED8355189F9C22190C2CF B
961,955,039 *644EC9E76CD7109EBACC49B4387B6B79639E2DB1 BwPGn
961,955,040 *64424B61A944A3DB8F663F62AFE3F9911C0C8784 BWPGX
961,955,041 *6447DB249005737066F68CE162752997505A7B73 BWpi3
961,955,042 *6449C115D204B5BEB6CE304320EBC47853FA2F45 BwPjA
961,955,043 *6443F84B5415E26AC1F195C274D6D362AA0D278C [email protected]
961,955,044 *6446FBB736FF03B9428AE2820589D10085FD161E BwPRl
961,955,045 *644D41D30878099514F7C53CF0C956F68741446E B)WQ(
961,955,046 *64493530B90AEF8D32AA72AA2144474C32B49741 B#Wq=
961,955,047 *644F958560696FA51BD2F3DD40B20D5F2F001D81 BW;;q
961,955,048 *644B42112DB881FB616521521ED6E2AF49E57BFB B!/wQ
961,955,049 *64497AADA1BF799CFBD7AA67E1FED2C46DB37C51 BWQ0r
961,955,050 *644CD84FDCDD9B854D12A6C7DBD0D47706EE7697 BWQ,4
961,955,051 *644D575C7D2CF738632249A2455B65BFF3D21847 BWqd"
961,955,052 *644A0C2DB4E35EF7967D3AC9F02178F5E84BDB20 [email protected]
961,955,053 *644C00AD83AF82D4489F6FA75C73B895F92F33A5 B-wqM
961,955,054 *6449FD30C58D337F7A7218D34883B7CAFEB78067 BWQO3
961,955,055 *644184C0647B9C44A4E02FAA081313879E544E43 BWqOa
961,955,056 *644ECEC02A0D7D44AC4C0EDA5F898645E785EE6C B?wQT
961,955,057 *644D06F52D936A2C02E0D80073F9E4CE835164F8 BWQTu
961,955,058 *64487ECC9D14FBA6E9A8BA0B0BD8529AB493DE97 BWQ,w
961,955,059 *644DA4E3683AFE3C110649340E0258A466F0F32B BwrbK
961,955,060 *6448E69A7694A560F161D1026339D3C6966994E7 B+wRC
961,955,061 *644EAB34DDF00877EBCC4554DB5725A557B7DB34 BWRI,
961,955,062 *64480A9EBC731C6BB9580D6060E1E7FE8AE013AB BwR_K
961,955,063 *6442716EC879D1DB99488E8DE43786E4512D9CAA BwrkR
961,955,064 *64405D7F3CD2FBFFE07AC0A8F7415942BB8C30D5 Bwrns
961,955,065 *644BE6CDFF420FA5601D101CC930589F464FE904 BwRRd
961,955,066 *6449CE0F7CAE410BF3185973C0DA067038EC91DC Bw.RU
961,955,067 *644898E5AE2ADB557ABE661CCA947F6D15DC2DAF Bw#!s
961,955,068 *64494C239E20CB4EE2C91AD834A2A6666EE04FC7 BwS$C
961,955,069 *64481A92603FACDEC35C76C777E245C4F16ADE39 BwsnU
961,955,070 *64491E76B883634056381996CEA8C9477CFA4993 bwssaa
961,955,071 *64428516926AE98A3D2F94010DC05BD782644FFD bwstaa
961,955,072 *64493F3E0252E07F96A39E66B6369DBC81CCE1FE BWsY0
961,955,073 *6445DAF958E9077AABE38FF03C618B4457EC00F2 BW!T+
961,955,074 *644FE6208AFF0871885B60F31A773913D10A66DD [email protected]
961,955,075 *644E31933D6F8EA2E33377DEA3DF0C0C4CAA1D43 BwT73
961,955,076 *644253935C90D5F0E6D4390E6819CE193003CA6C BWTm7
961,955,077 *644A7C7AC0EF8C8C52805013F54706B839AA28AA BWt:N
961,955,078 *64418CACA2D7BBE072E6A3F89766175DE52FF61A B)&wU
961,955,079 *64454F921522B790C929E809D2966039B66BA2E8 B+w+u
961,955,080 *6446742E77B4F260B8D76806A70318B62D3C992D BwU0q
961,955,081 *64440A227B2D096F751B74A3BD5F82B25C2F485B BW)Ua
961,955,082 *6448A2E9FFBE7D31EF22888C15DAAD4082A7660C bwugayefly
961,955,083 *6441FE508EF5F6C8F38784F27921C21B462DC7C5 Bw"un
961,955,084 *644F2AFDB9EBC754F268FB399987108000729FFF BwUVs
961,955,085 *6449C8BAEC781F2CF2DABB5EDB2ACF975E77EA7F B&w:v
961,955,086 *644E5127248E6FF91B76AC5876A2CAD425E96D59 B(wv0
961,955,087 *64485612531D9255F32A378A2969C47D5095C966 bwv1008-no.2-i.prelude
961,955,088 *644EFBBCFD75344DA261555367E79A89524FA061 bwv368
961,955,089 *6444232D2021458A085CFBEB2B3DF5D901E25261 BWVb.
961,955,090 *6440F7F97FC78C70AF93D49F55B3C79338C64C27 Bwv:B
961,955,091 *64494221A4EFC24ADAA87D243398EC0F2D3BB1EE BWVfc
961,955,092 *6444A23D9556AF2EEC078D94D8F0EF26E4B756FE Bw&vk
961,955,093 *6440F90688884287FC07991F894A5942866C0453 Bw
961,955,094 *64411B559BF14F9F23F779A555E8A7C1A7D7AB6C BwvmO
961,955,095 *6447A54F30B2CD0B727E0A80C9B9804944803B21 BwVp:
961,955,096 *64448A09BDDF128B5C60C2C5AB573B9FB32704D4 BWVq:
961,955,097 *644DEBBDC7F5522A89E5D5F012FBCDAFA293130C BWVTh
961,955,098 *644C20343FD72B1D40B78EA8570897B805401804 BwVZo
961,955,099 *6441981513E1A4D3D30807560B37470AEB803AF8 BW~W
961,955,100 *644D70048AEC9C8FA7513329359293D61F37EE27 B."Ww
961,955,101 *644CF683B126408DFDC89DFB11284086E63053AC B(Ww+
961,955,102 *644EEC2AF0226C57D68D9A4E43D985197E0331C4 BwW;)
961,955,103 *644557843CA238350A0AD28B61BEB9480FAA69EB Bww_(
961,955,104 *6443063FCE23763D084B1CE4C6573710C8DB6BB5 BwW7A
961,955,105 *644954B01E89DFBE93F9EC12DF10B00B4F109766 Bw=wA
961,955,106 *64487F25C520B0FE4A8730D726AF4CE2C107A98A BWwg/
961,955,107 *644D1A2BCB4D2A0F1EA6A469B9BF6A94A68CD6DE BwW,h
961,955,108 *644DCD2C52A012F13A0BE0A1B3BF0DDA7427EF08 BwW-R
961,955,109 *644C23268129E2ECF3E8293A7F514346BDB6AB22 Bw./X
961,955,110 *6446C70B7212574785D777F6A341D935250A269F BWXRb
961,955,111 *644FC198613A06FC0F419685110C710DE6E3ED74 bwxrg
961,955,112 *644AE7A6A2BEDF51237A9DAE04FD36E3D3E24457 Bw"Y"
961,955,113 *6440F152BA422CA01C39FB7BBCE95FA68928A9C6 BwY2n
961,955,114 *644F3231FAA7457BA385B79F9CC3923C9E85E54B BWYbZ
961,955,115 *64457AD9FE67A950C977965D8B56A10421FEEDE8 BW!Yg
961,955,116 *6442B9102F2ED0D1A2D40DC3A45DB42B7A1D05FF B.WYr
961,955,117 *6440C1B41AFD7132E7C7751EEE6531FE0F463666 [email protected]
961,955,118 *644AB5D8B533B8AEECB7D862805FCBA2862CEEC8 B
961,955,119 *6445320AF2CD171B2EDBBA90E6C524214F165E71 BWZ&f
961,955,120 *64421D19366E37310E7EBD3144B95B533356B8C6 BWZGQ
961,955,121 *644631DD703DBCDAAD66293710C150BF9C17585B [email protected]
961,955,122 *6443888BF80954C22F442DFD2C265122CCE99574 B,)X+
961,955,123 *644CD6B812F6D14281FE847BA7C794042E7357F0 B,X%.
961,955,124 *644A46901DE621CA33A61DDC5093A3E2371B4097 B"!.X
961,955,125 *6449A488AEBBD5DB9618015EB7DAC83E71EBDE32 B"$?X
961,955,126 *6445C99973389FBE9636A6D186BF9CBA9DFA41D0 B$X!#
961,955,127 *644B9880C3976D459B9D80842AEAA05EA2B1FC1E B#X,&
961,955,128 *644FF8B1CA26FF5C863DDC8D9DCD35D673704209 B
961,955,129 *644E82F86421DD336C279EF056C295A2669AD62C BX?#=
961,955,130 *644675E802D18A0BA767F2DBD322C4751BED41CB B,,X0
961,955,131 *644FE1490DC8989BF651BF04CFDBA4D16A9EC45B BX0(5
961,955,132 *6442C972561DA3F84346EDD79338EE01006FB723 bX0A
961,955,133 *6440052865A431558F44152943D0CD2E30460B32 BX2"q
961,955,134 *6442371F5E9714C0A74AC98FE18E3325AC2743FD BX2So
961,955,135 *644C9749F51E41B9B22E09FF364F86E553DE5B26 BX3-+
961,955,136 *64468360B9E4AB166CE17233ADCE1F529059F367 BX3i3
961,955,137 *644F20153F42E6902B722B29664FCE8DD9E74F81 BX$3K
961,955,138 *644BA472D4A1AB5A41F623FA6651C1B5ED384738 BX&3u
961,955,139 *64414D66CB63040CEFCC28AFCDDD285A9A5F9467 BX3UK
961,955,140 *64401C75C7B0B3F09AEE9B35B6C4C7A164FCDFD1 B
961,955,141 *644DB8DE24BCAFABF7924198DCBA702FB68ABBDE BX4Z
961,955,142 *6442033A2A48232544D671121591CF22C819958D B,$X5
961,955,143 *6447F45E42404CBA1AB5883F491ABB297162B77F BX5BU
961,955,144 *6445685CBAC2F65F91F52A397FBA045595C09535 BX%
961,955,145 *644FBA2BE450FA81FF99A9F7FD39000D59B7655E BX6GQ
961,955,146 *64467DC8F66A8C93AD34561EE58322689367BA5D BX6Y5
961,955,147 *644D30E1D344C2B4C036A61A384305CDD465ACEC BX7&F
961,955,148 *644EC2C2CF926878D99CF95BC7A7D49FC3244B29 BX7PG
961,955,149 *644F845E389E71B90C9EE633E817596523E0196E BX8Kw
961,955,150 *64401C9469E7CD3B309E9C68A49876F9268F2EC6 BX8oA
961,955,151 *6442409FDDBDEE95ED2905DFFB7833BBABD8B340 BX9TC
961,955,152 *644666A1C78DD9F427925E0E01F8C14ED3184981 BX9wQ
961,955,153 *64482FAFA2436B125A6224BA558700011D7E3256 BXA4L
961,955,154 *6441BE0CC5001062765A4FAA8B2F3BE77DDC40E5 BXaa"
961,955,155 *6440FDFCA14372F300E26FF49C88F53FFF98D41C BXAag
961,955,156 *64487070891FE9E5AA7EEACBB6141E8100AE04EE bxaanmde7
961,955,157 *6446ED8636868339E506DCAD9F4028649846D952 [email protected]
961,955,158 *644DCAD2251CDC23EB24762E0BA094818306C3A6 BXAlp
961,955,159 *6444A4CAE63E2EA0EF0AA8032F8EB70AA9FF0129 bxawp
961,955,160 *644A98DD95E1879AF4B5DDF43B212AFF88C70253 BXB0)
961,955,161 *644ED193AB4E50F34E174C1E60596789CDD8B1D5 BXbah
961,955,162 *64401790476B517D3832B778D8D4CB778F7DEB82 BXbDs
961,955,163 *64416D64BB67FD2AB15192BF18459A4D5F3632C2 BXbhb
961,955,164 *6448E74FF73B77588C69AAECB975DC29C812108E BXbhC
961,955,165 *644810E822C203F429EEB973FE8FB6748B8A3065 [email protected]
961,955,166 *64420DD921A3406ADE861196289C9BB3A4466ECB BXBle
961,955,167 *64491DCC8EFCC42EC553815B79295AA0E87F98D5 bxbsq
961,955,168 *644E6036244BC644E1A39FD872D96B20DBB833D1 BXBTt
961,955,169 *64491E721F5E60B0CBC96195AE9629001350D492 [email protected]
961,955,170 *644D77A86FD69FB623D197FC810C022A6153BF7D BXbYs
961,955,171 *6445F483CCD77BAED87256780CE82C45C68469B4 BX;)C
961,955,172 *644B9ED7D4CAC918B9844F55481A344A096DC362 B!Xc$
961,955,173 *64438F3352821E3C687C6E8324416726E9FD1C39 BX_c
961,955,174 *6444E629ADF3B132F53C9B60626A1E73F5FE75D3 BXCD+
961,955,175 *64437B61729CDA6D7C8EC903039709BE14132DA0 BXCi-
961,955,176 *64462DA0BF7731860E6C3AAF1F0092B69FFAB639 BX,Co
961,955,177 *64467B81A99AA7F3633F00F29A573EF256E295C0 BXC,p
961,955,178 *644C104962DD299A7A8D18DE3F2C44D2D94EDF1F [email protected]
961,955,179 *6444BDA2E1C49FD6282CB150894DA9C11C666609 BXcSm
961,955,180 *6440ECCC75EE787C752E2D420F0B80644879A213 BXDm%
961,955,181 *644BBD947EA1989256710C0D70970DADC57744EB BXDpr
961,955,182 *6448B0878B43A4B9963F78C4AACF054F190141F7 B-XEm
961,955,183 *644E2CA260926AFCD66E3E1F45537DAB8F879F66 B+&XF
961,955,184 *644EDADF272BC43580A399054194632723B75162 BX,F0
961,955,185 *644CD42C20203890ECD8B558CE994685275AE2DF BXf7I
961,955,186 *644A73FF4B778A7FE9944C176CC3DD1437C08C00 bxf8366
961,955,187 *64494974D74FDC472B044102E9952D012A18AD7C BX;FA
961,955,188 *64461F60864095D8706929D4DAD8B2FE825083E1 BXFB8
961,955,189 *6441920B00F3461DE5690BCCCD90EAD33D4453AF bxfnstprettyboy
961,955,190 *644390D17939A853567F5F94FD5305F4750CA59D BXFQw
961,955,191 *644539438913602360D8A6AA9F57DE7D28F400C5 B#XG1
961,955,192 *644BD2D370C8BDF408BDEF0EB219F54411F0CF4B BXG46
961,955,193 *644C5D9AFF7511F5AEB8FDAF39BFFF0704EDEB1B BXgFK
961,955,194 *644E532F5792671FCD66A6946A0934E83250ADE0 B}XgL
961,955,195 *644353B10F0C0EAB27D366A6F3A21B88A42F5DEC bxgny
961,955,196 *6446F29DF224CEE99CBA5DED6A5499FEBF043450 B/XH#
961,955,197 *644F0997518B96D05097282C5343628D8A945C58 BXH(/
961,955,198 *64403B18399AA91D6FB463CB5B673CE98C318A66 BXhA#
961,955,199 *64481D336E6DABC22830BEC9F367863CB67A2708 BXHC/
961,955,200 *64447B7C9FB65ECA0FE9B48035D3DC2D65FFF1CF B%XHg
961,955,201 *644D1E595CD92FE769E60AA2ACB93F563265A3A5 BXhk.
961,955,202 *644475E1B6A1DE516EEE452D70EE1CB002712380 BXhku
961,955,203 *6446679ED1817800F92BA888BD0B60B8EF84B2B9 BXhss
961,955,204 *644B7EFF81792F21A6C68A4CCEC9915848AB67A1 B)X&I
961,955,205 *6445DA4D231BEBF4FA7094BDDEFD2CD052E937D5 BX_=i
961,955,206 *644B86CF9796C2E42EBEDB15B05F0235C8CBA6F9 BX
961,955,207 *6449AE43930FF266D4D78E9422F7BF8395151288 bxicb
961,955,208 *644737EBC3336EA007D921083EB5F4C91D960D3B BXihG
961,955,209 *644D10EEA9C2394E15D3C081C46AD0A3070D0FD6 BXIn)
961,955,210 *644FC7F6262FE6711790099E5B5437FFDC71C04D BXIoT
961,955,211 *644D6022A5EC56177B9364118CE6DC16F567EED7 BX)IP
961,955,212 *644D6788B075C3FBFFCAAC4983F5162859293A53 B/XIR
961,955,213 *6449C6E821D2B1A8ABD2C545C0E04851425D826C BXir=
961,955,214 *64480F07E74733CA8698F10447CB5D291248597C BXj4R
961,955,215 *6442B8B54A686EDBF50CFCD1EA333315EBB57AAA BXjq&
961,955,216 *644CB599CF720648DF08154FF64D0059278F9207 BXk0c
961,955,217 *644B41BF04EBE224565FD406DE240A0D51EC84FE BXK#n
961,955,218 *644CCCCC0EAD1FEE1E5FF73864534DDA2C3D2A2A BXk$Q
961,955,219 *6446DB648073FA47DF77505481B117C3A66510DB B-XKw
961,955,220 *6444CAAF3FA0D801F11F4E0CED9182B7E358C456 B!Xl
961,955,221 *644A51BBAC645C67D75BAEAC7BE34A3BA4F56255 BXl&F
961,955,222 *644E040B93ABDA7EDBF41C252609C24CD9A7396A BXLFI
961,955,223 *644492C953018BD4D24132ADF93F0F2897E86DD4 BXLg
961,955,224 *6444432E4DCB6D563E07738D7D495EF4ADC9719E BXlNp
961,955,225 *6443A6A997ADE407F6CB8E2A8D162AD4685CEBB6 [email protected]
961,955,226 *644ED498F463F7496ED9250620E5B7D27E34E2A3 BXLwf
961,955,227 *644C1C4E78EDE17E54EA5FA2235D8B3440F202D7 B!XM_
961,955,228 *64475357A388FDF6357C46437C6DCFA1DEC787FF BX))M
961,955,229 *64429EF1170DB482CC1EC2CBBF514BDD530BF158 BXMbX
961,955,230 *644FD5DFF6628CD64C8BFD561B6931818C47CC4E BXmDw
961,955,231 *6449BBE9936607076837F61DD57A7BB2E9D025AD BXM+V
961,955,232 *644267CFFA795429F812F5598AD793BA6F106EA0 BXmXp
961,955,233 *6445759A956FE0D1AE0B617476786783DB012B7D BX,;N
961,955,234 *6445E34AEB371B701425CE7053A44CB16BBFE25B BX.n5
961,955,235 *644582F73CAE6520459D904C7EF1EC20856D0FA4 BXnR$
961,955,236 *644B14965D1D477AA55B801A6A975354C1EA62FC BXnSo
961,955,237 *6442E8C385A8F031822FC60E5E57A6FD6AE6EC7D BXo#U
961,955,238 *644E548B65F1CACA4145D0C0FFEC0B4693337484 B
961,955,239 *644A07883CE60087760FFA936C08059BC5B9DEC5 B?Xp4
961,955,240 *6444519AFACAA9F2013EF15E6C1F28A67FC588AD BXPaE
961,955,241 *644778C34DDEBFB8479B0A1D99853B7E8D934502 bxpay
961,955,242 *644C409EFDC262FF34A8704F4AB51EA7DD54F7C4 bxpdm
961,955,243 *6446F35B254B0DE397083C9D96161BCCEE692507 BXp?i
961,955,244 *64405410BC079255250AEAE38418B7E69058B82D [email protected]
961,955,245 *644C082303B91AAC9C59E2C8EF245C2F929AEB04 BXPwQ
961,955,246 *644C1AB40081609EBFAA05B238C777D5AF97950A BXQ(9
961,955,247 *64448123ACB8D92E104D49201A05F7A44F9AA6B3 BXqpq
961,955,248 *6448EAC7C7027DE834480B8DBFEE728A69DBEB77 BX,R_
961,955,249 *644F8C742D1C467C1720D1D459C83EED3B041F59 B/X/r
961,955,250 *644EB184ED2B20D9DA0EE1C6F65924A0E95419AF BX+$r
961,955,251 *644F3854C9478D44756E2D7A8E0048F4F2D5A882 BXR3d
961,955,252 *644908A2132F9E52576D94CEF3B81E96C244AE39 BXrcu
961,955,253 *6448494682D4DA435D6DE4B21D98F5CB69C9F006 BXrlp
961,955,254 *644D5AED7E315BD6EBAA22DDFEF729C4C9D0DFE7 B.Xrm
961,955,255 *6442CBD4D0F5A2950E615FF89A15C5C5BF803C9F BXRnr
961,955,256 *6445132AE0ABEA27DE9AA9D9C90BBFFBD887B3F5 BXRo=
961,955,257 *6448EFAA01BC73CF0D8D481C72E7FBC7F157311D BXr)t
961,955,258 *644FA946AB90D634C97AEAFA0FB92D1A21F41BCD BXRUp
961,955,259 *644CFC6F3351AEA917F5EC8127FEE54E6CF23CBD BX/S0
961,955,260 *64407CA20B847183A1E525E06F8126FAB2690CCB BXsK%
961,955,261 *64417DEE8515036D9CF15427699603D53E0936D4 BXs.L
961,955,262 *6440D5B335DDC30CA6A47356F245218676160120 BXsRG
961,955,263 *64460B3A6C5809B1AD40E0F792261E644C727D03 BXswD
961,955,264 *644F51386F79B481F13EDC5F6D02219E2D44312C B&X+t
961,955,265 *6446A28778DB2FD5A9323BCF6B803E02F4173615 B%#Xt
961,955,266 *644016E7ACCB32A0687C878590188CE09172DE78 Bxténue
961,955,267 *6446154AE117D07ED991C87A204604639340E515 BXTfM
961,955,268 *644E86C01FFB032FF0D0C06F5EDB81914A56498C BXt.K
961,955,269 *6440EDAD85E9D773759CF4ECC2FF662574AE3A9C BXt.n
961,955,270 *644D6EFEE3155EDDB2B72B49151A279416CFB633 BXt$T
961,955,271 *6443F0C1A199C298A5EB8C4E15FC0E604560B52F [email protected]
961,955,272 *644A5768D23E73893D92E1CDC38C486CD15EA7C3 bxtvy
961,955,273 *644B7F47E3523E917149FEA302DDAF450A3186FB BX$!U
961,955,274 *644B9CD2BD4F9EE7F718E8163AE3A4A7160E04BA BXU."
961,955,275 *6448B10F9A9D7855D05354705B24787758D2DC3D BX&!u
961,955,276 *64426DFCCD26C054826F8F304EC89EE04F898B77 BXuBO
961,955,277 *64473D2264B26B0531B8769C4BBB97A700F7E3D0 BXUe%
961,955,278 *644AAFFA243A1EDF64E44A5591FD0342F32A5832 BXUlG
961,955,279 *644DCD0D8CD16184214AE26F5FA6BB2D3AA9E692 BXUNW
961,955,280 *644DD1C2713C3A04AE68BF2A7EE5E59378D4048F BXuW6
961,955,281 *644643E25C6B87179A8173E9D1F0BF1D83AB8B17 B+Xv,
961,955,282 *644094238AEC02A46357F32CFCF07DD77D98D27B BXv;=
961,955,283 *64457E71168EA6F3D7884B98B62281BBD10CF36A BXv+1
961,955,284 *6441760020016D6918D54EBFDCD72CE03EFB38B8 bxvfi
961,955,285 *644255F006F42873F4C5F8044825D652C82F7A11 BXVH4
961,955,286 *64483DFE26D89772FBB3C71182642E2FC151E61C bxvih
961,955,287 *64412CD9B825C3AF8EA3E963D0FFDC09CFB9252C BXvjb
961,955,288 *6444D435B5316448A2ED93969613454A069CC3C0 BXvZY
961,955,289 *644F721C65B70F9A715D5032EFE7CB810566BDCB BX"W)
961,955,290 *644AB3F6938DB5D072B79E57F0ECBA9A36A04CD2 B"XWI
961,955,291 *6445A8E6979EB6378736AA490DD623FADAD20291 BXwR/
961,955,292 *644B4527091132021AA0F4C8A608609B7C9DBB97 bxwsk
961,955,293 *644EF687586D80E7F15A1B434512AE236121CF57 BXwuF
961,955,294 *6444963764B770B5582B663B15FACEAE6E82E09E BXXg
961,955,295 *644B68A81206B6096F1493B06E00E0A7BE1A63BE bxxxiiiciaccesscommozilla
961,955,296 *644AE3E955E2369243A29EF15740AEA2E366A66B BXXZk
961,955,297 *6441F7FC2F0FA19D81CD97A596277897969ED550 BXY:!
961,955,298 *64462F25689FE14A73AC6AB5F288321025F79C7D bxylo
961,955,299 *64416E58CDB6E5A664109EED6D7EC40B3EA5F39C BXY+W
961,955,300 *64439F42F6800DE87BC906A6C7F891A1B05E6231 BXZ,8
961,955,301 *64488F0B88377B73A4771892840813CFA5D0B0ED BXZjR
961,955,302 *644F85B8FF9B00113D405898DAB6D5CE2722A85B B?;+Y
961,955,303 *6442061EA4EF6EC6D5AED7A82E021730375C35B5 B?Y?)
961,955,304 *6447165D09BDCF797B5BD931FF014DB5E247DA6B B/;Y:
961,955,305 *6446071F24C80CBA292A3D884EBB11B149E5373F B("Y=
961,955,306 *6445EB2B4D04915034F761D4448A068C66152FF7 B&.Y"
961,955,307 *644F0B4C559E817B0813CAE891F7C3042C9C9A75 B
961,955,308 *64421E0C28C0EBFCA704DA2536E07B082B096983 BY#+.
961,955,309 *644B3E8C83F0C29A256C9C71ED5BC006BB26AAEA BY
961,955,310 *644238870DD59B471CA5002F3B2CA2E7A728E1B1 (By
961,955,311 *644EED149C20678DEAF3B4470CB7F892408D03F5 B_y}
961,955,312 *6445AB53D182B9B1F123A62118BC798AEDD85B20 By`}
961,955,313 *644FD83962524619E9B1E77D2D2547A47F1E8EA2 BY#08
961,955,314 *6441E9DF656E76BC2E5DEE70A5C442E4CEEA1F77 BY1)T
961,955,315 *64452C7BC566376DE0701AF3BBDA1056CFD6826C BY1u,
961,955,316 *644466A5CF3ECFEA2A292E41AC3CAEAACE8FC059 BY2eQ
961,955,317 *644A347C9A00C8213186A894D322EE524D2A1BF7 BY2-n
961,955,318 *64486F2FB07E07F825F50C4C86BAA758F2269EB1 [email protected]
961,955,319 *644D7D733C650358B9E1C7E0345F04FCD3A1C95F B-Y3D
961,955,320 *644D0820EEB4B0880957C4470887B37FF7FFC36C BY3)h
961,955,321 *644248F540CC1695F90E1BB6F0CC3667363AF5E5 BY3I%
961,955,322 *644C29CC4D96EE30D4D48E8F49CE40839184D47E BY3ia
961,955,323 *644B963B96DC90BDE2977EDEEC07D8C54845F234 BY3%P
961,955,324 *644A16E09A46043BE4C388644F307B10398D1AA1 B+Y4)
961,955,325 *6446E34CF7E7E2453C882EDA5F4728C48E546DF1 BY+4l
961,955,326 *64481C3EA9446B61D501315E84574E138F802583 BY-5$
961,955,327 *644CE872262AA74CDEBB8E26EB33F8C3E07DE5CF BY5Fg
961,955,328 *644701F6CE9AADF52DD3B5B86D929158686563DE BY5.W
961,955,329 *644966A5689037D8A009BC32D3BF4FD3A44F8AF4 BY$?6
961,955,330 *644491B73ADF12FDB814309DFBF1301D28067BA5 BY6/%
961,955,331 *644E3B662D40234976FEEEAC222B341E3064CF7F [email protected]
961,955,332 *644B999DB0612F463C835EEDD6440D4E060E8B7A BY6hq
961,955,333 *644434D276577BDD74D911E0DB906DE75FA62305 BY6-K
961,955,334 *64445536D6C46C66406D07022C4E8E0C6945C5E4 B+Y7r
961,955,335 *6440499E0051BB699937D8D4BA80F249642D0E2E BY)7t
961,955,336 *64461AAC23C097902A292F8B20624F0EDDCA7E35 BY8!t
961,955,337 *6447DD877FE04FEC65DCF78B52972AAEA653D7F2 BY;8V
961,955,338 *6446714B2EA84B044D53D7328A045B2633A24CCD BY9AU
961,955,339 *644897BF0AE75F460611ADE4E8491743295F99ED ByA^
961,955,340 *644CC57B6EAE0445C9D7B21549A4BA54DF2F5E0D B_YaF
961,955,341 *644A7AD01E24789915D45EC806352C8D03EA785E byafb
961,955,342 *64434FE375DFBBAC9D12ACF977EB76CBC8EFC7DF Byaluseeme
961,955,343 *64496AA5F866F5129235B19AB58458B7DAD76E6D BYAMMY2007
961,955,344 *644066F65FBD76FA399CF2FDAC0003A30443D308 byangsi8
961,955,345 *6440259CE44E192AB4880E6DAFA5D37438ABF750 BYA&o
961,955,346 *644DB724E3226DA7F846A5CDDF5F9DBFF4E40DF9 bybelstudie123
961,955,347 *64459DF93AE963549744C6D3F828B50D902DB9AF BYbLX
961,955,348 *6444B2438B79241C75AB0034377DE89E2793910D BYbrt
961,955,349 *6443ED804B9BE64C0A8F716F60B81F2517B7A654 BYC=%
961,955,350 *6449B62D5235E8A87E2EF4C716D363873C8C1916 BY&
961,955,351 *644A1B7CDC93CD00C5D039AF0A13D0CF23EC9167 BYC.a
961,955,352 *644B6F3928F6FDEC5F05F2485D762AC21B3CC632 bycinternational
961,955,353 *644A3F918BAE16EEEBDB79293631361AF7EAC37D BYCKX
961,955,354 *64426767DC9E7F48B250912EA8E51C1E6E747A82 BYcNL
961,955,355 *644A7A6B681C161AB890B85D623AE8B0EE8917F9 BYcnW
961,955,356 *64441AE174E0B11DDB982CB8BD4FD54C03949515 Bycttng0
961,955,357 *644C6F01C033E9894262E0C1718291ED0FB76BDA B,Y/D
961,955,358 *644059B4E18AAC142706B30024D354A5D72E302F BY%&D
961,955,359 *644154C0CBD8DAD3841496A41BFBEB81F0C72E2D bydderses
961,955,360 *64455358DC635BCC35EFCA4603AB44FCB9281CAA bYdUrU
961,955,361 *6445CF9DA004D762091FEBC4A08F82E87B792206 B;YE,
961,955,362 *644567EAB9BCF0D22BB5E5F266CB6F1FEEC937E5 BYE2I
961,955,363 *6443679F36E5846E1128EC93881DF41498265A71 BYe7a
961,955,364 *6448C4BCE25C506D0ED71E52E84918FCF2B858E4 BY-EIRIAN-EVANS
961,955,365 *644733BAE6EB3A59C20ED0F76B83DDBD1ABCFDF3 [email protected]
961,955,366 *644A132795F93A8F3EED7EC3C84ABFF3BA1624A0 Byelongging
961,955,367 *64493BCADFCEE2CB1D1BC3E05DD2BC72A89B2EC6 BYeNO
961,955,368 *6443A521729D6F94EBAF2FBE2B7EF0252930B0E2 BYEO0
961,955,369 *644734F6360F2EFD0018ACD6242C617679F84C15 byErp2UHLh2bQCY
961,955,370 *644DB5BDEE588913943C961ACFD00A5BB9C18520 BY!EU
961,955,371 *6442A992695C9D7A739B5CE07A37E2089ADFAB2F BY.Ew
961,955,372 *644F73B563A5195A9071DE2CFB4F43682343FA68 BY
961,955,373 *64436F4992C1AE45E1D1EA60BB0E77BB67F92855 BY/Fe
961,955,374 *64449A0F40773137D3013E8D8C52CA962AF88938 Byfestersed
961,955,375 *6444F7A184B574D84CD5851559BCEBF399656ED6 BYF:n
961,955,376 *644540E9A1AABDBFA4EF495EC70C64FA88184A34 BYfs=
961,955,377 *64434330235695F6874F0CFCDCBA7BFE7A03EB33 BYG"#
961,955,378 *6442182E522C2A6F45AE0B6A10A8831AC8FFC341 B!Yg.
961,955,379 *644E32A6F892132ACD3F68109A02FAF63E959612 BYGaU
961,955,380 *644BB5626FBCFA3DD948947E70027B6B94871144 bygde
961,955,381 *644B02C489CBB9FBD898BC07BB971D10BDB0DD32 Byggeri6
961,955,382 *64425D3035349BAB51E5EC5FB014B180FA0861D4 BYGGQ
961,955,383 *644D0B5D915C9B493B108A88B2229CEA2FBA72D6 [email protected]
961,955,384 *6443CB48300B5433B9D5799CD9E5EA5297F71C31 bygvangen
961,955,385 *6445CBE7985B50D95DF3431FBB3569B6CA4B71DC BYGX1
961,955,386 *644C44DD7271ABE0EE7BE522DF0303E8EB773F16 B-!YH
961,955,387 *644CC176CE6FB86469F94D3635DD3BD2423A1127 B,Y"H
961,955,388 *6441FCA666CFBDECF979AB25200B9D2FBF21B6B2 B(;YH
961,955,389 *6447A466EAAD90884966E2520665113092220DBB B#)YH
961,955,390 *644512CEFCF748CF80B028C2F92AE1C4751EE1E8 BY(=H
961,955,391 *6448655DB386BD581310EE3AFE8F6FD5C402A49A [email protected]
961,955,392 *644A10899AB1FCD831A9F2CA9657B722A051EA65 By his attorneys-general to sue
961,955,393 *64420D54D9923B7FFCDB570171DE9955F14FF423 byhsis3
961,955,394 *6445705D8147E1D88B7E7837D2149AEAF9AD2104 byhtak
961,955,395 *64416696E1D8918B55B35113C5307DE60E5B8A4A BYHuZ
961,955,396 *64454BA02BA81BF18199546E498F1BDC4B4130AA BYi;n
961,955,397 *644A7CEC2D0019EF72A6D4194FF6A3872DB93C5E BYIn6
961,955,398 *64495CCBCB96E9C592BA41A7766690E759D196F6 BY=Io
961,955,399 *644019032920C768A18D298304470F0975C4C61A [email protected]
961,955,400 *644C12A8E1873A7AA69A97C0FBF644DA460DA20E byirbqvezoflb
961,955,401 *644D687506608A084E24DE4CCBE4F8A9864E40F4 BYI#S
961,955,402 *644F402DD4377333A481C7847D9ECF85160D5126 BYiw
961,955,403 *644D242D961CEEC31CC24CBBF0E7EC7E059BD0D2 B=Yj)
961,955,404 *6447CA16F01837924C2B89D98035041E199C58B8 BYjjF
961,955,405 *64435B2F8EBAD82DEC0E5194F6DABA0232FA9B73 Byjjymmf3
961,955,406 *644B921B4A09675535B74E5D514D5F522EC90163 [email protected]
961,955,407 *644D9938CBAFF29B516A5DE2D2C9DAC98C4A8E55 BYjv1
961,955,408 *644F47E7E0DC05D47F713476035B21B0C21BCC82 BY")k
961,955,409 *644E4A3E97050E858A9BAC88286E17B2DA3BCDD2 BYkr;
961,955,410 *644E68AF9880D566C81821702E1C32EE82E1D988 ByL7
961,955,411 *6440850BECF77085D9FCBE11B8EBA9A3215D4495 B;Yl9
961,955,412 *6443BEBA786779B6E8D8789C40A1FE3E66CA59F0 BY&LH
961,955,413 *64402F69B0FB775A27BB8549BB5A2BFAC43184F9 bylina2
961,955,414 *644F9A622C4880DE9200FE124F13772C6DDB839E BYLInERS
961,955,415 *644A8C99BB6AC5E2D1AA11E94A25721A933BD92E BYLJ4556
961,955,416 *644369EC18765689AE84E8FE07AB83D303D25E44 BYLQ;
961,955,417 *644DE7EBD9AE7697F3177F7D1687FF4BDEFC2EE8 B!Yls
961,955,418 *64405B5D5AE77BAFD9B3EF6BD02A1027E2348CF6 Bylsteel2
961,955,419 *6443DBCEE5DC94F5517C2D1352BB0DABF8751A07 B%$YM
961,955,420 *644A5B47F51F16C25F27730908563C8FFD1BAA64 BY=#M
961,955,421 *644F2640D1AC4AA0B830F22714A18F50CA92319E BYm0%
961,955,422 *6440B46780E5997A68C6722F9AED4AECFA111363 BYM9U
961,955,423 *644E18D26A111BFBF181290A37D015E933C422F1 BYMGv
961,955,424 *6443C0473F39FE0F1F57EE1D5E645B53B56D2571 BYMH?
961,955,425 *644BF755D863F9DE5E8178DBDF618316487523CD Bymired7
961,955,426 *644A1C36301237821662DEEB6008BB4865B805D4 B_YN2
961,955,427 *6442F72CCA04DB7CC70F0EB9321C5DB456DD3F04 B$YN6
961,955,428 *644CF04516697A66D5134BCF77F75D271EE5BF4E BYn.7
961,955,429 *644AC80EFDBC9FE177DC0AEC6EA6E3C635E4BC20 BYnAA
961,955,430 *6446E3406C8F7B01B7F76585F602EE389A8CF7F1 BYNATHANIELDEARBORN
961,955,431 *644A5A3B817168E6CD4B2E5B099D13A96338D455 byndyng3
961,955,432 *644B7CCA0403343F1D34180E987153462F67A8A4 BY"NL
961,955,433 *644D899BDC600CBF90472357C85CABFC02E64309 B?Ynn
961,955,434 *644FFDB57DB51ED640CEAA7051DDAA52F4B1C37B BY!O!
961,955,435 *6442E90DF2FEACAF2BB2F57B05FA0825DFA07186 BY"o-
961,955,436 *644B5F0FE7DACDC38DE0184642DD691CBDD9F710 BYO4BNGW
961,955,437 *64485E998F523E25CBCDED7796FA51F4BE084D01 BYo6D
961,955,438 *6440BE38C2E46CC2558542E8438113DA3F912B70 BYO6s
961,955,439 *644C275852510A557A80B3020D7086789F027926 BY(oc
961,955,440 *6445A5CA394572A9EECFDC3DF5794051AE77C05C BYoGg
961,955,441 *644CDC4210EB20B6A84CD93E2F13838721C416E2 BYogX
961,955,442 *644F509DA355495CB7E54C6FCB0484CCB810B87E Byolanda9
961,955,443 *644B53E5E33B6D960D07FA1888509AE8EE658934 B.Yop
961,955,444 *64498648D14909EDC895BB583229CA7D87E56680 BY#.p
961,955,445 *64468013C9C1296F38DB0FE7E45C5E407E239CF3 BYP78
961,955,446 *644B4E3E170653AB16ECA12018FB9EF2871FE880 bypassproxies
961,955,447 *6440EF9E29EFBDF2F0A95604E334D4C3C1FD617D BYpCU
961,955,448 *644755557036ACDEBF028B8B8B0D845A063A6688 bypericifolium
961,955,449 *644E86F862DBFF5CACCE4C2B7AC2B7B95F10F36F BYPHILIPHARRY
961,955,450 *64417F861C24940E8F6D8D346A050C80F64F17F8 BYpNL
961,955,451 *644835CF5A49E85A7245C28302841D5627548FFA BYPORT
961,955,452 *644B7E73E4CE01EA03B4ED2F49BF2210A8EB8FAB BYpp.
961,955,453 *644B1B009A26DC625BF5A96521594783D5BCF223 byproduk6
961,955,454 *64426D0AB5CA85A634343142223E71A052C522D2 bypub
961,955,455 *644942924FC74FD2E03FAC3E0EED6521671F5A56 BYPX.
961,955,456 *64480EA3765B7ECF1DB237F5BDB721B2B05166DF BYq$n
961,955,457 *6449EA36161E6749B128F766DBA4AF8F7557AC10 BYqY
961,955,458 *64477DDA8290E27D6534AAF7A146595619C9C592 BY+:r
961,955,459 *64430D3A679FE19DD0A684913044AED3B4D3CBF2 [email protected]
961,955,460 *644729933027C685218B4310218580BBE6D9F843 Byrde5
961,955,461 *6440845A78AAC30CBEB60ED6A12C3D300EE4BB90 B-YrG
961,955,462 *6443A6D839620B667F9B6E1D2B679DE2EF6F1493 BYRgB
961,955,463 *644785BC3DDED2C14234E85AB2461E70FA2CFEDE BYrGu
961,955,464 *644CACDC94352B107EE911EFF1DD0D8E646C27FA [email protected]
961,955,465 *644E4A530D465AADDE07B0F2069DBB36278F44CC [email protected]
961,955,466 *644175DBB747602314E243155466D2138D07D95E Byrleta1
961,955,467 *644EBDA710A7FD0EA8F3304061AD1A0971F54CDF [email protected]
961,955,468 *6442924328B501D59BBDC7CAEE8FE1E5E38A7238 BYRO#
961,955,469 *644A0F57D275666A688C7BBA79F167081B42846E Byron14
961,955,470 *644B9FF4F7CDE125D389B6349A4C6F676E5D85E3 BYRON31604
961,955,471 *644A827A99CFF96AF050142B8B202304326E11D5 byron.amill
961,955,472 *64412B9F44A484BD5487E40820B98899D393561F byron.boller
961,955,473 *64498A38780FECEA6AE7D1F71927FB16E0939E96 byron.brislin
961,955,474 *6443AA18585DD31766FAF5BD20FBFDB1355A53B7 byron.bugg
961,955,475 *64430C788DF7495317F8D5924F1B3D34C07C850C byron.cappo
961,955,476 *644A053E799C7B210C1C28E25EBA4A46B6E88B3D byron.daneker
961,955,477 *6446E255E092454056A753347A41436E0F2AA573 byron.descoteaux
961,955,478 *6440410F0762607BF02B8693D76E7AE70F76891D byron.dieterle
961,955,479 *64495EB13CA1B9D87876F951F03B765E32B01F11 byronfletcher
961,955,480 *6442461A6123E83B042A0051F75EB55D2B9B64B8 byron.hauslein
961,955,481 *64488ED8012A088617E56BD4EDA392C5F57C4CA9 byron.ledford
961,955,482 *6445CA9C4867AAE0AC7B330436403CE4D32C704C byron.mada
961,955,483 *64403E6D8697F7C2CE9A5FC0462462C6D4768A12 byron.mckosky
961,955,484 *64443619E8764A734CBEEDC3920B56E83AF1C3F6 byron.mclavrin
961,955,485 *644FA711B11A95AE1ACC87A15A0689F587DD48B5 byron.oglesby
961,955,486 *644E1DF980440FB1F2FB6F52E98C1009484A7EAD byron.parilla
961,955,487 *64431A4902AEC636CF9234057B14C63DFBB7C4F8 byron.penatac
961,955,488 *6448A4B242B84370764A7463337453A4F2A44FF1 byron.santini
961,955,489 *6448DFB284D2075B377445F3F42C2032F689DA48 byron.skrip
961,955,490 *644A79841ECE1D11F96852082C7D2ADEB232A5FD byron.torkildsen
961,955,491 *6447B99C6A44D8B7F08ABC8C0E82DFE9D7B1568C byron.tyce
961,955,492 *644F5AC27745018A7846B8CC52859304C48B8200 byron.varrato
961,955,493 *644490F62DA137D5AA47C10BCF7EA429BC11B389 byrunis
961,955,494 *644E01CFDD36649D53696B335F431443679AE9D4 BY?rX
961,955,495 *6440A2ADAE098B1ACFDCB15991162C21779EF544 B,Ys;
961,955,496 *6446E46026FCA47A8E860E0307513088AB1DF509 B=Ys3
961,955,497 *644CD7C0008579C9BF79C26E3A26A89103C9E1FD BY.s8
961,955,498 *644720A234A60F7164F9A32BE15D5E306165270E bysection
961,955,499 *644A7A538511B2F4CF929DB2A2386BDDB00A057D BYskv
961,955,500 *6447BFA078D1C28E55C52FB8F30B74D38436F825 [email protected]
961,955,501 *644A3652785148481E7F86A4BD58069770E81DCD Bystndrs1
961,955,502 *644DA4E2201F7EC36190A34B7EE96F7C5B8B812E BYsW/
961,955,503 *644F5B93730E06208F887408324547F09609FA2C B&Y&t
961,955,504 *64462940938F246A7CAC74549B77ED301A648F8D Byteme911
961,955,505 *644A9A8392930684A7BE9C848B1C91A832EFCCCD Bytemecorrado
961,955,506 *644971FC5A134E9CBADA8F84374326F2A5A20ED6 BYTEMESKEETER
961,955,507 *644FBAFC2C9F64C032256DA843193CAAFB6FD38A [email protected]
961,955,508 *644917635BDB614E24C76AB3CF6398572A5BC87F bytespatrick
961,955,509 *6448D51F6B337C2BB235F3C652A0A11CD22FE162 bytestorleken
961,955,510 *644E9E57A37B5043D51F98A5672A4D799E445337 by-the-pricking-of-my-thumbs
961,955,511 *644DE0902B98D912E7FA53E3F0A21E5270683B0B by the sycamore tree / all of me
961,955,512 *6447FA7A991ADABB4453D489D29045304E49A677 bythetimemyheadgetstophoenix
961,955,513 *644B177DCACB79BA0ED66EAB4C8AD82831FF7815 [email protected]
961,955,514 *64405340C28802946B4BE5BFAEEB5E7290E77782 Bytteabo3
961,955,515 *644221C485841FDEF7C7A5FB8800131F5C84FCF5 bytymes4
961,955,516 *644EB229880B5A1DDE66F952124E07C4BFD2685C BYu7R
961,955,517 *6449892F811A25CB803E8AAA0C292E2A4473CA39 BYuC2
961,955,518 *6445BD785C46AFE8045648ADBD3D5E4ED69EBB93 [email protected]
961,955,519 *644F054D0AFF4274CD7D8CEE7DAF5A931B9647F5 B!YuO
961,955,520 *64402913474FEAA4F8DF158628E2D9E2D1ECC770 BYurk
961,955,521 *644CB44D88F054C4A7A086D5CF9D63200DAD7E8F byurolari
961,955,522 *64444EF1B541ED88DD256E53DCE47A5747613088 BY&=V
961,955,523 *6445787CB78FA98C4A0B926B56811BB1821D9B3C B%Yvb
961,955,524 *644D4655B4B50DC8C2B9F0DA456AC4323B58CF1D B#YvK
961,955,525 *644D7D0ACAB853D121A79C9678581B26A32146E8 BYvNA
961,955,526 *644B29E9A173F900B2CA318296D66BB77FEBECE6 BY.vT
961,955,527 *6443ABF7D8133F74CCB1DDC0720089A3E051AA9B byvxz
961,955,528 *644A643EFD976FA56989D1529F1C6734730268A9 BY(!W
961,955,529 *644EC39A5093ACDC7735F62BB5BA8B2C5EE29017 BYwac
961,955,530 *6448C47A3476E906BCDB0196C3D3CB606EB07322 B;YwD
961,955,531 *6448DA591BEF2D109BAA78E72C81D15DB04F2639 bywepte3
961,955,532 *644B9ADD8DD3348CC22ACDF9EB3525AD504AF99F BYwnF
961,955,533 *644A34877EF4B4B2CBB8E67E5C5D46FD847C4EC2 Bywoord7
961,955,534 *644AF133DFDC3F890CD0B3DEAF240D8319661C5D BYWPO
961,955,535 *644CC203EFA76BE5EA2559930594FB4CF47C981F bywrfjjn16
961,955,536 *64416007F6C9236DFE07E8B0B3455C1E0D63E5C9 [email protected]
961,955,537 *6449C36B4BA1B6613B0A8E9E80B169FD96396B5C BYXoT
961,955,538 *64427C2899673CDF29AE7AC4ECEA521F538B5058 B_YXw
961,955,539 *64419779C72E49D88C516315382438774969F221 BY-!Y
961,955,540 *6440BF0FA133A7D2725C0E51CEE8B5D0A591E2CD BYY0a
961,955,541 *6443D7D0E221BE8F88F81A7CD6621285C1382797 BYYC:
961,955,542 *6446DB471C8BB8EDB373B77E03479CD8F9511DC7 [email protected]
961,955,543 *644E94C86844C819C7DA8BD0354015C3B2BF6686 B+Y/Z
961,955,544 *6440A0CD4275D00731D1565BDC38C122C9F8EC1B byzantineempire867ad2
961,955,545 *6442E7E459B1D657A00C0219F7517E03BF81D1F2 byzantines.is
961,955,546 *64498CD573194CD6A48A5FC45490A826B5CA72F1 [email protected]
961,955,547 *6445E38921BCBBF0A0C08DCF38B41452154D957A BY)ZN
961,955,548 *6442DC02A04DDF6B77D7696208AD735604D81F60 byzntjns4
961,955,549 *644AE5430AFAB039C2FEBB9483F67E77D61759F2 B:/Z_
961,955,550 *6444D96E45B3D34E0250E4FF0A222641043AD8CB B""Z/
961,955,551 *644F941E4DA901B4C20F42CD707928E9335B3FCC BZ/
961,955,552 *64401A5D38606C944AEE33139A7B339E97122B89 BZ))+
961,955,553 *64450FA97FD395DF9F0408AD6AC48E569279E521 BZ&;0
961,955,554 *644C92D854FC7B6E15CE4958DAA7C42A86380F20 BZ+0
961,955,555 *6442EFD14D732F11F8D2319DDA86F1A8C7A3F601 bz17
961,955,556 *6443F2A1931709065A2E06C9DF3469B441B32AF6 BZ1al
961,955,557 *6444DBD9799CA018EC8B7223E6E8FFE282727925 B/Z1C
961,955,558 *644F9A214E7BE5F40AC2C69A43C63C159088B521 BZ1C,
961,955,559 *644B49689F598A69B70EC7DFB5B734E6D720149C BZ1Q.
961,955,560 *6440B994CF368F25829C347173788E728330C7B8 B;_Z2
961,955,561 *644ED03271C6FFC1D2D48EB070F977A41F2CC66A BZ21$
961,955,562 *6445860B9AC9B7CB1716C8BCE787232A7798C1C1 BZ+2A
961,955,563 *644CF72DA9B03B4D445D04EB9E0D2F440DC6A146 B=Z"3
961,955,564 *644213633B3710A3F9D48F94ED45EE278DD76314 BZ35I
961,955,565 *64437ECBE3D068D97F1423F4E99538D406F8E8C4 BZ3/n
961,955,566 *64414EF00C999A97265FADA5794E0ECFD2E71937 BZ4g2
961,955,567 *644400D30ECBE131D7B1E3A23C82DD89F653DBEF BZ4J
961,955,568 *6441C46BCD1DB0143275EC896748ED3237C8D11C BZ_4L
961,955,569 *644BA33D638488E6940B3799E0BF4BB67DF5279C BZ-&5
961,955,570 *6447DC22F4C899AFCBCC1DCD861BF8ABB7724C92 BZ5u!
961,955,571 *644FFDAB85DCE0B2AE089362468D382B6DA96474 B=Z?6
961,955,572 *644B076381E7379410F96388C43C91CA935E2157 BZ6c2
961,955,573 *64492A26B4CF85EFCCB73BD10F041F7354037D0D BZ6Xw
961,955,574 *64412BB0A3F9AB61AAF6D08185F5ED450BFE709A BZ.$7
961,955,575 *644AC782ECC47C0037EB9808CFDB2AD27B237E4B B)Z:8
961,955,576 *6446E8D8A36E4B09BFE169254284A3FEB2043357 BZ?8
961,955,577 *6441D0ACD4A229E987B7D10BBF99086F89A63ADF BZ8Il
961,955,578 *64489C0780CAE703554ACCB33821F9FE07845B8F B-Z8Z
961,955,579 *644C86F12DB44A67CA41D17AD0E2C8BBD949A0E3 BZ/9e
961,955,580 *6442ECDEC4C5E8B3BD0D942EF54E1A4AF79BB92C BZa8R
961,955,581 *644CB3ADC082A0C16D61D93BAC83D1BDA6F6818F BZAqZ
961,955,582 *64439579C8D3ED8E683E7C2AFA9BF3A49EAFA23D B
961,955,583 *64466C036BF16A09459DC778DCB4C8157A286608 BZaWi
961,955,584 *644E8F790A2DBEC2A1D67C45A1920323B5960661 B+"Zb
961,955,585 *6445C439D290045286823F9F905504FEEC7601F6 BZB5l
961,955,586 *644B8A0E15CC062277343516CEACFBCCDC353737 bzbhx
961,955,587 *6441CC2EE2989542A7D4CAD906B14234F0C0B6BB BZbRw
961,955,588 *644CEFB3EA1A43E35B5C1D83D752F7A56929546A BZbVf
961,955,589 *644325EEC7934F1D873749D86836E04DCC4028F1 [email protected]
961,955,590 *644883638B2C6A8B1EEAC1D5A6094F372E48010A bzbz.bbs
961,955,591 *64416E4EB76C2AE5B711FCAEC68C6CFDBD4BFDFA BZc0&
961,955,592 *6442AE0E48D5D58AB47D8FEAEDB248DBE97273C1 BZC7=
961,955,593 *64458ECFC683FDC5D7DDED89A0E0ABBBABB670C5 BZC/c
961,955,594 *6449F50AC36E8727E70396CB481D78CE8063DA6F bzchtgt0
961,955,595 *64428DF7ECFD5E04DC4A4BB16DB228FB583B05B2 BZcI2
961,955,596 *644FD0C2D1A3741E89DB5F2802B4FA324346AD4E [email protected]
961,955,597 *64415206DE67469FD46255ADF2EF6B791BD63320 BZ_cW
961,955,598 *6441B98654120A955C99CDB9E471CA1DAE2CEC69 BZCX1
961,955,599 *644E2881575DC3ED918F8E0ABED87F58149E27D7 BZdfg
961,955,600 *6444E88C26CE3FA04A873183A887242C93F74326 BZdK4
961,955,601 *64462D93F389308BB47854B3D816CEC449AC56FD bzdoi
961,955,602 *6443695630348236F45F6BBB6BD0EB921AC32087 BZD-p
961,955,603 *6441861155A5C8421AFEF3A7650D48144B6B1D84 BZdtc
961,955,604 *64498E062D0CBB2CA73568D1481313E17D4A55EE BZe$0
961,955,605 *644A8E256E815162287EBED813D8FD63C3324AA6 BZE32
961,955,606 *6440285329368809E6C3FF5052CF9A1B788DF8B5 B#ZE4
961,955,607 *6441D28BC5CBE99534C67D6247FA7C8FFA47653F BZe6e
961,955,608 *644BBDC66C0EF5BB5ECD4177B5CC3CA248C3F61E BZe$c
961,955,609 *6446BC3CE02079DF54B366F4BBD513E685C69C92 [email protected]
961,955,610 *6441258B36A39198E358EB74139B6AE1DE91F950 BZelT
961,955,611 *64444503A06BD2B69F1502D551DC38D6E4BBFE52 BZeq7
961,955,612 *644D23427B61AE22C5AA363871B7D889A59B8023 BZF
961,955,613 *64467B2A5B0245B4BB56D3E79BD78BDC3901349E BZf5/
961,955,614 *644515EACADB3E864F2212F7F833A51F0F14EEC4 BZf"E
961,955,615 *6448D0D2DE20F31C1192904637A183C7C99D1638 BZFEX
961,955,616 *644488ECB6286BB0A0FE36DB69734EEC6B1A89ED BZfhO
961,955,617 *6441EEED7BF1919F84911D5941B8177339549494 BZFnE
961,955,618 *644EF987AA9D0A0D1C84C3ECBE46F2E3449FD56E BZF_o
961,955,619 *6447BF6D2F9E22D1A8808A703BD9941895EAB0B2 [email protected]
961,955,620 *644814333A3315336C9C3EB69A818157C634EA01 [email protected]
961,955,621 *644C2436C04ADD2A2F209E8B9294478971D3F5D7 BZgF(
961,955,622 *6449510AD9ED3A3CD1A763A93FE9D24B3619C838 BZgK1
961,955,623 *6447FE3B1F2D6FC97FA1AF24F0A3547BA93A2AF1 BZGpV
961,955,624 *644698EE490B9F8948504A8DDE44CCDCE0D74156 BZGQH
961,955,625 *6440E20AF4BD1483CC0B90F15065878EDCC796DD BZgtG
961,955,626 *644C160C16F16E203F43638D32F3705E257EEE43 BZgUc
961,955,627 *644C67852A60B6B767D586B30760986391E5462B BZH2k
961,955,628 *6442B95954571777F716BD88C7891642E1BC5E18 B)ZH7
961,955,629 *644C13ED0510D2B689B5F2A91F9FC610643AAEA1 BZ(hQ
961,955,630 *6445A6E0430A9A845F0D691C3F1C00BD1E70577D BZhQR
961,955,631 *64430A671AE7CAB2427369046E8DB431D316FFF2 B}ZI
961,955,632 *6441CFCBACF139F2FC3D6843FD56FEF5932BB450 B+(ZI
961,955,633 *644D72C6EECC0A8B1CB8B97FD9DAF0D5AC685736 BZI6e
961,955,634 *6442D59068879BBC0AB88BFD09EB5364E9C52296 BZIjt
961,955,635 *64433BCFB0A79F8F4F0B267D6A31242B6CCC39C8 BZ-it
961,955,636 *6440B61C45C491F2E53082F94CA6C06E0E878142 BZi,U
961,955,637 *644A461B63C3E91F25083C83CAE576E0D4A4E3C8 BZj$_
961,955,638 *64402BAA159E0B9DFE3F2AE370A2B630334D4916 BZ
961,955,639 *644CF183CF58704074C7DC56FA070E32E3F86306 BZj83
961,955,640 *64445639C607FDDF6BFD05BFE162BA14D5A19D4A BZ"ji
961,955,641 *644312D781F26125040D693015F9C5A96DAC9730 BZjN
961,955,642 *64405298FC7F0DBA7569DA0988FC9648F85986ED BZ=jo
961,955,643 *644D3D0AB3CD799A000744A957DCDBA2EF71231A BZjQR
961,955,644 *64402F0283078D1473605F4DEF646D7AB4033E8B Bz~K
961,955,645 *644DA2484A5178A181DCFA44E338CD9AA5187F8A B&ZK2
961,955,646 *64455982D6E45B34DAB653E0C9993C1A9BE4EB0B BZk+2
961,955,647 *6448FCE02229CEA792BDABA7E521CA928D1C2D13 BZk?h
961,955,648 *644D6E471CCCC43D1EE9E2600EA025DA1A87EC73 BZkTI
961,955,649 *644B96044DC826D7223FEB4009A35CEA139F8903 BZk=W
961,955,650 *6441DDBEFF547752A675AF10673EAB4EAF4309A1 BZKYV65J
961,955,651 *644BA0BEE3F2F72F5598EAC52F49365B5DC48CBB BZ(L
961,955,652 *644C1D3D8836CEBF5DC694D0FB9FDB52751DB2D2 bzlchtgr4
961,955,653 *6441D6D5982D866EEE810099E89AE084CF05B3CB BZL"P
961,955,654 *6440C246EF2815592E0A7F8AA005CBC569505B7D bzlssob8
961,955,655 *644800F0B95159FD34FE82BA8DB6E1AAFE893E46 BZlWE
961,955,656 *6442FF0C51D550E5C579D58011753C96CCC2BB16 B*ZM
961,955,657 *64446D53A7E40C96D69B3EDF658826866CAF3952 bzmqo
961,955,658 *644282F58AD89122E477221632EE201E6C930521 BZ=Mt
961,955,659 *6441914D9856BAD808CF840BDF6B662A287CFF82 BZ+n/
961,955,660 *644444D3A0A6CFA4159128930749D66491D500A7 BZNbb
961,955,661 *644AA3843E296EB793247BA2D28BFE2D9EC7038F B_ZnC
961,955,662 *6449804A954EDEE2E1C4124028F00CA49A89BCD5 BZnFa
961,955,663 *64410B41A82FF8819F9F451B61E164AC9FE920D2 BZN:K
961,955,664 *644251655CC0AAFDB600544CCB0740E6EAC0F4A2 B!Z$o
961,955,665 *6447CE5C0CBCD9A89E3A3706F6B5102E6FA4F1C5 BZOQR
961,955,666 *64413C540F58B30D5D2975903AEE230568B3092F BZPdR
961,955,667 *64414A36CF6D1A412172DD55EC84ACB0706A13A5 BZPF!
961,955,668 *644621D66909002C23C2D010D57F1B8468A7CB43 B(ZPq
961,955,669 *64448E676984CA6271BF0ECBFED19318C479E797 BZ?Pu
961,955,670 *644241242C74897C36C5E1AA46C09A7B4DF02F08 bzpvi
961,955,671 *6446F8D308C56AEEC33288D71BAA5AA211E0681C bzpzp
961,955,672 *6449F08EA99520407389D4CD9F244B4196C65866 BZ-Q"
961,955,673 *644FC09B5DCCE927A85F1605537F63EA244D40FA BZqgs
961,955,674 *6441EE436404A67F204D9FF00F7E134883A392E6 BZ=Qo
961,955,675 *6441140957E6FB570BA7B8D9614F681EF3350393 BZqZ.
961,955,676 *6447AC8CF2FDE27757633EBB1232FFFA6C7A720C BZ!RB
961,955,677 *644B75D51C6B64A5D9F903EFC1890238DFCD287D B;ZRm
961,955,678 *644AFB85DE592E974EF7BB0FD00475C35793C69F BZrMS
961,955,679 *6447D36007C349328FFCB0A3DDAB83EBB73814F5 BZrNU
961,955,680 *6444E01DAEE2DB40F4D212CB8C473ED1F00EDF81 B_ZRP
961,955,681 *644BC84A4D164058ACF69620FFB3D7CA19A0C026 B(;ZS
961,955,682 *64414DC1162291DDF2FF92C1FD1901633D0ABBB3 BZs%!
961,955,683 *644AA778D392851FA1221F254355F61EAB0D7F16 BZs
961,955,684 *6449A6EB4026E3C9DFBBC36D297E497AB8BBD78B BZSA:
961,955,685 *644F44B96FC7D66522EE5BFA81A79ADED8818675 [email protected]
961,955,686 *644371E34E62637C23059BD0378FE2C66CAAB5C3 BZ,T0
961,955,687 *64464C7B3B4A82C27D20EC68EBD227676B0460A9 BZt1X
961,955,688 *6442BFF7F9A2D87D114C3ADBC606EF72D700347B BZT2!
961,955,689 *644DF491E0C13FE444D28A4616E3666F2282160D BZt3_
961,955,690 *644371AEF94020690819CFDDB850BDB3FE3AA7F4 BZT.6
961,955,691 *644FD9C6D60B4DFEEB24F945F6067DE75E072952 BZ+T9
961,955,692 *64410E38B992458AF94EC3342532BB5BB2E7D0A7 BZt)f
961,955,693 *64489BA3395B875EF102DA1BBDC400886C53CADD BZti#
961,955,694 *64415DEC0DF69735DAD4E40E5F9C9F5B255E0424 BZ&tq
961,955,695 *644EF527EE873ADF42642DDF9E5B5A3851ACEE91 BZ}U
961,955,696 *644C007F177F0AB51A47D33AD3FDA6D8FC5779B3 BZU/7
961,955,697 *644C84353FD523825A8CD5AA06B3C29DED49FF59 BZ"u7
961,955,698 *644DF6C6F594E17A34EDFA5ED5D7992763090F5F BZU_a
961,955,699 *644550ED164C3EC4A65425ACCA70B06D13E6FB04 [email protected]
961,955,700 *644F269C1C18CB619DA92C0AB1D3A1D0AAE8906F B=Zuc
961,955,701 *644F3D807F80F542DFD924EE4B708A7D5B8B5BE0 BZUfO
961,955,702 *644CD5EBEE81CF38E8B5E4363B1C07D05A28498D BZUss
961,955,703 *6443602AF97DC2E4938AE47687813D7498569AE2 BZ
961,955,704 *644D2FDFCB72F819D4A334A51CC9643F7DF38B81 BZ?v:
961,955,705 *644A7A2132EDA0439707180DFADC72A94ADAFC94 BZVbW
961,955,706 *64463ACB1A152EA9141D3EF48DF71BAC64F71B5A BZ_Vm
961,955,707 *644768B7AB65B24C05DA2D5A40CA980CE398469B BZvns
961,955,708 *6444061DA228B3B57B9AC626E905AFD1C57BC5B1 bzvnw
961,955,709 *644340DB0A79C8D9277DA4A64E0B9F416E34F35E [email protected]
961,955,710 *6443338BA0BAE89BEF9CC0F4DB4DA20D858C56CD BZ"?W
961,955,711 *64487AEC10600A1CD54FBDAF50B1804C839089F5 BZwdt
961,955,712 *6444677C6CA34E73D0FC48C6A965A10DB086BA2F [email protected]
961,955,713 *644A43472CCC620D557838E2DA533C3A9DD9B7A1 B#ZWe
961,955,714 *6440BD0FD00C4DE26917EE057F60263DD5BE101B BZWea
961,955,715 *64441E0825A172BE0C6EB1E4BEEB04BCB545265F BZWL$
961,955,716 *644AB62DFE57A5598A7C3E29C964CE3ACF6E8F26 bzwnamensverk
961,955,717 *6445AA54292BA6E676273F6B6343739060A9BB6B bzwnet1234
961,955,718 *64494D216B7437120C8C5AEA2BB72AAA50700F6A B="ZX
961,955,719 *6445CB12F237D0FAD39FCFDEE22E4D1C5944E433 BZ"XB
961,955,720 *64488FF92BAD2FD3C30BF7B3BDB99F9D9A1B690D BZXhQ
961,955,721 *644650D248D7C738D7D6AC819A9970F737F5BE2D BZXWT
961,955,722 *644C7BD4910F733245ADB6977D7EA7E31C405FA0 BZYcG
961,955,723 *6444C140C05CC194F11A4FD5BC1D36A9E8B57D52 B;ZYN
961,955,724 *6444FA1B5C8D43EF09BC420892D73161C95FFF57 BZZb(
961,955,725 *64400B21985E38AC87C9989518094F9ED2AB1B83 [email protected]
961,955,726 *6442E7DA79ADAC60E97067068E6FF84E99119519 Bのマレー式機関車に軸重14
961,955,727 *64426636EDB6668ACC6971766FAC4FE75DD2D89A bの特徴は車体がaよりやや小さくなり、後輪サスペンションがド・ディオン式となり、乗り心地や操縦性が大きく改善されたことである。
961,955,728 *64422CB32C2383507BCDEC23EAA28EC314DCFF47 B級戦争犯罪人
961,955,729 *644FE1C1C5E7A0D1E72AFACCD4FFEA10B7D9FBEA C`"^
961,955,730 *644B591BA7A0E469FFF969DD6917C2BD3AAE1B24 C`%;
961,955,731 *644EB659445DF330833B51B851AF2E2E2CC231ED C=,/:
961,955,732 *644CB63C1ADF6066E3E43CE9F28646BBC141611B C|-%
961,955,733 *6448CBEB3A81AF9164DBC7483CCA63EEE1FBF087 C|@]
961,955,734 *644FDF1F89FEFDB71C1E005D75E9A361AAF7A9A9 C___
961,955,735 *644BAECB4F6FF1C4D1A8F82A34F97FC98F2D75CB C_,=
961,955,736 *64456FB46E094A31001A6C43352C1FAFC0D2A1CA C_!;?
961,955,737 *644FB7BA4B770A77D4D112A3974476D12FAE2F25 C_!+/
961,955,738 *644E31FD84950DFC4E90D90FDF96ED2F4D4D95E4 C_%_)
961,955,739 *644F390E3B07477A6B68DB03FF1DE4612DDBC735 C_%&
961,955,740 *644B15EAE9EE89AFD250817B8964FFAF0C741678 C-:(-
961,955,741 *64459D469C23918E249050C58C8F9AB4DFA765DC C,#))
961,955,742 *6447883C5D95755CA07B92D6C35924AACA4E50C6 C,#[
961,955,743 *644EEFA2848A95D73E9C401890133A34D4FA23EA C;>{
961,955,744 *644A7CC38CCBC89C956C9EF274F0CB45C9EE9DF4 C:;%)
961,955,745 *6449E0B2EB9EF90643B4F8107DE9123CF0A26907 C:/)-
961,955,746 *6442745F2368C0A8416E7E08EF3D3C15D01B5025 C:&"=
961,955,747 *644D85C00DB3477A8B568C7CD02FBA09707405D2 C!?]
961,955,748 *644F4707FAE2471E3B64929DC806C01C9F9F46A7 C/;_/
961,955,749 *6445879354C4EB22252BCCCE7C5FDE36DB654FC6 C/";=
961,955,750 *64460120FE509A584268D1ACD3FEBF7D47AC1325 C./-+
961,955,751 *644DEF38833C180F808DBC93F8579B70789C1B37 C"".,
961,955,752 *644317A834050428931DDA06F5F534A67933A04D C"(;_
961,955,753 *644E6EC87233E786070732D01D6FE6771A4FB920 C"{@
961,955,754 *6440D588B1DBDDF57FCA8E965EA72D25D3660A37 C"+
961,955,755 *64438D5C203660921E0D7559DC798E7D9E539649 C(?#.
961,955,756 *64419E409C2719C2BCF0675CA19BCEE1E9DDEECE C($"+
961,955,757 *64480EBD24B86FCAC0A9C3CDBA6B5DD8B268F591 C)=",
961,955,758 *644813BEA6E75FF9EB7018559D153066E0459865 C):+_
961,955,759 *64404BB1472B7F12E03DA5AC680E5DAEB0AF2AA9 C)!:=
961,955,760 *644D07FA0336A744024E96C0D5E9C8BA391B5D9C C)#/"
961,955,761 *64432057AC27F3D0076E0A3BCF53DD069F33CD0E C$!;)
961,955,762 *6444769B5E008E6F884DE99186DFAA5EE801D0ED C$(
961,955,763 *64476B207EB942EA283B316ABA36306A7BB0F674 C$+!/
961,955,764 *6443F8E723B9F8BEB3A4002117F7CB1EFF5593DF C&,&
961,955,765 *644E650AE64B2373D2EF448B10025532D7261F1F C&/.,
961,955,766 *644D0A8A526C2C7B9A07576C6449AB3D1067E359 C#!!&
961,955,767 *6442B634F4813993E58DD6201025FFA118FA55AF C#?_$
961,955,768 *644BF0A08A34B8023E29743C772154F93ADD67E2 C#.
961,955,769 *6444A6837D530459450E9A5F7263D0C51709C40D C%;%:
961,955,770 *644DF4DDA5BD909E85C6CD051D604CBB145B0B77 C+:/%
961,955,771 *644F2B874EFD6B06678204DBAED4B1B2BF020850 C
961,955,772 *6443C2BF6137C53ACB8FC33ACA88CBC221CC6992 'c{'
961,955,773 *644DA7805F014C6DDD3342ABD7D43AE341243D74 c`=:
961,955,774 *64423601EA02EAB6F1E25777F8DDBF5FBA1CF63E c=<?
961,955,775 *644ABDE900B8FB911E41A19CBFB8A22F95A2E7C7 c=:{
961,955,776 *644A90AA31DF7CE589CCE401189EBB79D1098134 c:]`
961,955,777 *6446ADD8A4B2E77F2A3D1346F74869B80B538064 c!?<
961,955,778 *6445844D7B5FAE72636B9F3A1ABF63DE1A25643C c?/)
961,955,779 *6444EECF99D04098E0C5F2CDB7345EDBC2049D78 c.>(
961,955,780 *644481B7E7D5D39AA2F2A5A7063091265A564A61 c.|
961,955,781 *6447894002D8399AB353F8A1C181AF355128ED7B c{;(
961,955,782 *644AAA516F684FA5A67A8846399335071B550938 [email protected]}%
961,955,783 *644B330A272EE91B84E93BACE000DD89C268EF58 c%,=
961,955,784 *644E8394FD3F72D094462DB1DCF2E3503F7F731A C_"%0
961,955,785 *64460728DDCBC4FF36F32881C0046EBD400D41B8 C,0
961,955,786 *64467F681E55D8F0427BE5330D72C237D255F9FD C,0?$
961,955,787 *6440304CA745E42B5AEF9443679670762B691DD5 C:
961,955,788 *64434C53255A0E9B0B904EF308B7B9AD627465E1 C''0
961,955,789 *644C93F9206DF371A973A48C3B6264FEC6762EA3 C0--%
961,955,790 *644B22609D01489144E8E93603C622BF9E403484 C0!$;
961,955,791 *6446BA91EDB2AA74E8E4FF7859C89C4891DA3D30 C0?:.
961,955,792 *644A78D5950A14D4CAA18A08152A4B24C3743232 c[}0
961,955,793 *6440F6368C9C545D08040A0B07B01DC125EA0949 [email protected]
961,955,794 *644A3E43C1EDA039E2D9011F766BCC93D34897F6 C001I$H
961,955,795 *644103302A675521A136722B81479B3218A62E6B c007f007
961,955,796 *6445E875BE36C95F62C7D78420585B2064D5916A C00e+
961,955,797 *6446EF27A9C63CB4F72A55FCB573201762615A79 [email protected]
961,955,798 *64448F54880223F1B23211A6F510A4AF807D8DE5 c00lch4t
961,955,799 *644DB260DC6BCE6D870A3CDA9F0391017AA6E451 C00P3RAT1V31Y
961,955,800 *644F1E132D80B06EFB4CEF8CA7E506982E162A53 C010570m!e5
961,955,801 *644D6D273BCB87B0D25405A697F9F422053BD279 C010n!z3
961,955,802 *644F7117E9907824D1DA1C8B37E7BC0F751D0CE7 [email protected]
961,955,803 *64456BCB90578DD1E5F05E61F8AEF9FEA1B36CA8 C0114PS1NG
961,955,804 *64401C1EC375BD591E6E3DE3F92F8A1ED7C1C47F c0114r gi
961,955,805 *644DDF5422A9A12F69C3B3CFB31FE09FF28862CA C011a80ra710ns
961,955,806 *644AE0EDF3D56A4FC3F9B882DB31986BD21344E9 [email protected]
961,955,807 *644BB2D2DC0DDBA3AA3CC07AD2B38EF38B8AF4DA C
961,955,808 *64401F38B2EB0C85812621C2941461799A48519E c013m4n'$
961,955,809 *644CFDCC44AB28665EDA957CAE5CF15D785CACC5 [email protected]
961,955,810 *644FE4B45EE86C55E6EE352C2D8E3A861AE052D0 [email protected]
961,955,811 *64445FF195916D6970785C72CC93C77CB1F216A8 c01c33m05
961,955,812 *644969B9A29661C7BCF07BB6A5B54DBFE73424C4 C0.1G
961,955,813 *6445F5F196EACBAC179B27CDA81D811658861267 c01ns
961,955,814 *6447042DC3EC7E6733E436CD9231BF7B819D48B0 C01T0PH0B14
961,955,815 *64464226423E1DD177B72D35094D0B2EE9055872 C01umbid
961,955,816 *6440CE31C7A85FB03F361EE7EC25062594D0A86E C01umn 14
961,955,817 *644A946D5A4627E966FB596FA01BB818B86B467D C027$
961,955,818 *6444C08FE2A6EEA0A17D76B04F5E73B84E1AE859 C030B0
961,955,819 *6442F03F31197B4B0013133168D44DBB83D8646E c031f03e39
961,955,820 *644D4291606D96731124E28E67CCFB28218287AB [email protected]
961,955,821 *6446308D63F331465F8C362230089B9BC39FC592 c03l
961,955,822 *644351E3620D5FA289B1D42C1330059B7811C6ED c03t3rn1d4d35
961,955,823 *644EB091B607B26869F87203A02D7A98F5CE3283 C03x3127
961,955,824 *6446783EF57DBCF8226827B066458A5DD48BC2B5 c03xt3ns1v31y
961,955,825 *6444B7EFD3BE16F9AB234223ECD8FB6FD97CD6E4 c03z1un3
961,955,826 *6442902B3AB15325E49AA1E650BC59CE6F83D158 c_0412208843
961,955,827 *6448E4B3195792DF77CF5E150ED139F02F7533C7 c04dmir4t
961,955,828 *6447BC04E4529DB20DFD813BF25F3CD63D36B007 c04mbu14n7
961,955,829 *6448D4E50E3D4558FC4C65FA145AEB52811959DC c04tt41l5
961,955,830 *644CE2BA9EEF89DD493B788AEA5362916EEA3EF8 C0)51
961,955,831 *644AA10777BA297C72DA8325F7AB0691BFA48F6B C051j
961,955,832 *64482BF734DD8D6FB523137D0F73EA0225865AF7 c05484
961,955,833 *6447C862F89DAEB9320C8D36E7CB66D8DE7E35A6 [email protected]
961,955,834 *644D128E68BFFD5D5C7CC4822A8D3BC443017BB8 C05m0p01!7an5
961,955,835 *644F2F8F3A56D09034DE846A7A342F1ED83A0834 C05+UMIER5
961,955,836 *644EB54D7684F1BD91355DF48BB982D29CCBE086 C05v:
961,955,837 *644A78EA3633A66F4D3A560770D0A29DEE6B19BC C05vW
961,955,838 *644233FB5C4EB9C8E281914C4D2152600245211B C-0)6
961,955,839 *644B55915B805A27664C6289E3A7438A1DA94B4B C063XS53S6I6P841FT717R64VA
961,955,840 *644CA6328682F3DE9B4528D8EBF44644A56C0C09 c06afcf1dafd5010vgnvcm1000001a01010arcrd
961,955,841 *6446D0E01DC6F5ED754257DA77D317102181F917 c07.320.450.670.130
961,955,842 *644BEAC606C9377F7D26DE0105F907685AC82FB7 c078011
961,955,843 *6449B07BD6712D49428398F8D47AC1C5D96D3ADA c07e07
961,955,844 *64425B144706EAFF6C4E9836EEEA1AD8C47FC6FD C07gC
961,955,845 *6448A59C91ECDD6ED8645F84F845197AB017C599 C/07N
961,955,846 *64494C46148244924920DE9EEBE6144F13C87355 C07WK
961,955,847 *6449F1336638728E8B579B06A95FFB31F2C5EC5D C0:8a
961,955,848 *644880BBD8405D88ECB7EDED2AF4540E97039B5F C08!b
961,955,849 *644B7492BF04CBEA7C4C330B5601D65731C01EA0 C08o%
961,955,850 *6442C3E957B2F880B06D858B05B64A246B744DA1 C09!/
961,955,851 *644165F60E172A796E2616B26691F4EF80A206B1 C090i
961,955,852 *644BFBD40CCABAA8CCCB9D5AFA49EC1AF62F1C31 c09281
961,955,853 *6448EE7758E69F9D9E7C33F67ED6CB9185111377 C09i+a+0r
961,955,854 *644BA0EF8873C6F9BD56638454378ED850A965C4 [email protected]
961,955,855 *644C95DA21DD1896AAF30F2EAF05B64886C95A12 C09nH
961,955,856 *644694CBFA28BF59787986FAE7AA025412C4AE4E c09nizanc3
961,955,857 *6448A43809B0AEFE6DFD918255BCF47AC252A6B1 C09N!Z3RS
961,955,858 *644275D5C563C934AF7980F6C35759CC3E482603 C0A13
961,955,859 *6449C70E51126709BE739730C07FC0972C71901E C0a62
961,955,860 *644889D9D150732F812EAA93FE6F442D7536667F C0aeva15
961,955,861 *644CFD5FF7C3D4CEC767BCDC91D38C9F97E0BCF3 C:0am
961,955,862 *6442D16B237EC310D29CA5087D27DEAB13F18B96 C0AXA
961,955,863 *644EDD667CF6F78AB996940812F32626E132D96E [email protected]
961,955,864 *6445187B7570561774E693F54270E50C18FEF021 C0b01'$
961,955,865 *644EF013A6FDEAE6888C051568ADE70118AF4AB0 C0b15
961,955,866 *6442B2955A0FFCA7E6B2CC2376656BAD2B6A5922 C0b4g
961,955,867 *64405F9B5721640E42AA5DD9B0EBA2920B35A4A1 C%0Ba
961,955,868 *6443521697E109C7ECC627128BDF863800A1502E C0bb11ng
961,955,869 *6444CF434815D85F7AF43F8DE6CEC1DDC194040A c0bbly
961,955,870 *6440FCD408B35080EEAD38D075A184386A053ADF C0bcI
961,955,871 *644CEECA48087FAD84EA80E08427808DF3A12763 C0BlG
961,955,872 *6445586246D5DE015CDE93A4E685F2215650490A C0BNm
961,955,873 *644E5D20C1B0D99D1F64B1E04C1156DF2982F6A0 C0bp_
961,955,874 *6440CF5789D1AB345412D430F91940D574970B50 C0bRT
961,955,875 *644F26768DD67DE63B8E5D93281CE7DC238F4B25 C0C23E
961,955,876 *644831125DE463E53814194BC2277E95E5D60A70 C0c2O
961,955,877 *644E71ACE23CBE100B3ABEDE5EDA9EE906E4E4EF C+0C4
961,955,878 *644E5EC1BB4979321B8296602E8BD1D9DBE6E3F7 C0C52
961,955,879 *64446FECBD42C9B91A945A5C0D4E5E50AF5A8F3B C0c6g
961,955,880 *644AEAAD0DD8379EAE4A6B2678575825E63F5E90 c0ccinell4
961,955,881 *644B5F472CB29727E9CEC91C3DFCD40BF42A3DE4 [email protected]
961,955,882 *644611927134718C0EE89AD16CA883794060FD91 C0ch3134t
961,955,883 *6443364DE54913B29DA2627496C1C3CCCC2733DA C0Cp/
961,955,884 *6443E88D459B1B4F9486FCB4809079EEE14276A8 C0cpI
961,955,885 *644393A99DA67755EBCB5C15399F09F7C30A22B9 C0C!Y
961,955,886 *644F9CB911F1F44DDA1AF0BB898FE2D924467895 C0D1!NG
961,955,887 *64464B518F5C80BBA26AE7847A06B305947C99B5 C-0dh
961,955,888 *64434997B01190393E87A61ECE1F504C4E488DED C0dn_
961,955,889 *644E3910F6D03FF200A9E00665E8F3845817A8E8 C_/0E
961,955,890 *64425F0DF04E0FACE5F14807B08E77002457B559 C0$E1
961,955,891 *64484DB4FC5B48F8BAFD136EE3A0302DA63CFAA8 C
961,955,892 *6449B27FEC10FFF1EF9FA58E100C008367268749 C0EC1
961,955,893 *644AE678B4BE06FAA9F998F63A0D7461EDADAA6A C0e%D
961,955,894 *644BB39F594CDD14EA7D58E27B9DE5F9A93781AA C0ek-
961,955,895 *64437434A8FFDFD37E199BA6679B477244F36AE7 C0e?L
961,955,896 *644B0FCFEEC5D92487FABA44AEED6BC53DA89267 C0EX!575
961,955,897 *644D3C265C873B82988697BFFB31C4D514BDEA24 C0&?f
961,955,898 *64478E5E842BB7AD09599818CC617F071C9460D5 C0$Fd
961,955,899 *6441D072F0188D325A31F0978624FC745776B61D C0Ff:
961,955,900 *64404ECB28B3A21A05D5659C5B8EBF926C9F5B62 C0fLR
961,955,901 *644FD04DEF3769B3105BB0A034636EB000B62907 C0FS4
961,955,902 *6441FA3583C70DF787CEAC2B6F2F6AFD5CF63895 C0GE=
961,955,903 *6447EC3843FF1CAD5F478CC0D9A8C7FDE03F9B33 c0gh1e
961,955,904 *6443A8FD7CD19D4B1E28138E33BA6A9D492085DE c0gitated
961,955,905 *644FE841B9B4E04F1B8EF1E82288736C16B68CDE C0gLd
961,955,906 *6447D808A2E9A56D1A9F31F1BE8532003C52D80D [email protected]
961,955,907 *64457E77D5B6474493D5A913C47640A0EB201DE5 C0gnE
961,955,908 *6440CB4BDC0851423AE81062D65F836EC6C20895 C0GN!SABL3
961,955,909 *644C3F79E6D9DB0274D50FC79414FEA6AB2E6CC2 C0gsb
961,955,910 *644DC13D7E0C4652005D866954F969C307E41263 C0+Gt
961,955,911 *644178B3A7D8FF602E3E3EBD9EF010029132415B C(0H&
961,955,912 *644A4A5777E30F16B790857825763E3A79E22FDC C#0H=
961,955,913 *644D55A30291E9B394B7994C966B27DAD06C568C C0(#H
961,955,914 *644EEBCC26BF21397BE051AAF4BF7E0535AA1E64 C+0h$
961,955,915 *644D41F9FBEB14F7753C42E2C552A70456BF3747 C
961,955,916 *6449C940608FCEF25F4517E4F29AFBFEF179F22C C0h9S
961,955,917 *644556AF4428FF5CB2678D864C654BEC2FAE62C2 C0hC$
961,955,918 *6446F28F6A155990C1787B407F2338863DDB428F C0-I!
961,955,919 *64458BDBFF9C7BC0CF1620FAAE227A027555B012 C0i"L
961,955,920 *6440095495C5BB7128112CA957DC304968FA0B5D C0ina935
961,955,921 *6449A7AE1C95C4B0625691657298C576F8C9B125 C/0IY
961,955,922 *644CB9094850F202C1819F74AEC6C214150EF354 C0IY7
961,955,923 *6443B7AC4E944CA840A446B75E97B56199E3FF21 C:0$j
961,955,924 *6442C74C54600842463626074AA600036D13B7FA C0)jw
961,955,925 *6447A4D75C80E1009FAE95AE8E59B880D48BACF2 c0jw
961,955,926 *6441FB21883DC369FD2BC3C59EB5DD98F35F2986 C%0KA
961,955,927 *644517A818231B5B7A3C27F2C9DE578AAFB7B934 [email protected]
961,955,928 *6445ABFE047119CAB6093E253070EE12540FF98B C0)KM
961,955,929 *64403F68BDEBE6939A0A7606B0B34C20511D8F3E C0Kn1
961,955,930 *644D108C4C2DE68B90637371C81B11DDB8F36B94 C0krh
961,955,931 *644AC75DCC583944BA5F19FF8BE437F98E66516B C0KsM
961,955,932 *6448E840FE20CCE40F1852B791D7A6819456DA99 C0KVO
961,955,933 *6446A149C0750FA91B55E74EF089161556251084 c0l0n0pathy
961,955,934 *6444141E0324CF7D2A9D04654DC0D7EA1558F76F c0l0nel$h!p$
961,955,935 *6448CD602639712357767D797F615645EF2D6B40 c0l0r4n
961,955,936 *644C2443F352F26BB90244AB5C15406A734BE1C4 c0$+l1n3$$
961,955,937 *6444733758F99A2226FFBC67336193092DF5FADF C0laC
961,955,938 *644DA5C343A127255E81669115E7D23C80556EAF c0ldsoregerri1
961,955,939 *6449A8C729F4E769BBE558F9E4F9A85BEB8DE85C C0L&F
961,955,940 *6444E4B1CCF79553AAB86BC28FAC5FD8268AF7A6 C0lkN
961,955,941 *6441A148FEC587362694AA5D63B396315E81A6E6 c0ll0ped
961,955,942 *6440A718ED94EB6111BB3D7D6AE86F543AC24A93 C0LL0QU!4L!$M
961,955,943 *644C1E97C586D79A0F64E7AFA52B3E7A7A5AD2C8 c0ll480r4t!0n!5m
961,955,944 *64441C45F5855F7DABF18B034069C96B5CCB0DDD c0lla73ral!z!ng
961,955,945 *6445106A0D0E42B5DA518D85271C66D8201BA911 C/0Lq
961,955,946 *6441DC3D8F1BDD2383787DB11C70C37CBAC10C80 C0lumn1st
961,955,947 *64472B1F114682739827930F50F5D72CEA4F253B c0m3nt4r1u
961,955,948 *64483656B97CFF396F97AC655CAB76EFA5E77715 c0m8a771ng
961,955,949 *64415A620E373565E7EE22ED5D61071D0E24E980 C0m8u5t18135
961,955,950 *64430221B8E2075D073763507FD2DBDFD1D33BEC c0mbu$t
961,955,951 *644F99DA30B5B2C6408D581B4908AD1B18FC3F23 C&0mf
961,955,952 *644EF008CEE0EDC6493AA665FEFC095A5C9A064A C0m#i
961,955,953 *644654212FE940F07B5518BE8BED91BD692E0C7D c0mm0n41+ie$
961,955,954 *644FBBEB394A3B8BB13D8601F5BB2C80DDC8C420 c0mm0na1!7!e$
961,955,955 *64440AB8202A31AFA1047442F83C4A9BD5C5EFD8 C0MM0NSENS1CAL
961,955,956 *644523285504D8E1BE21C9AA50E61017C27FBE43 [email protected]
961,955,957 *644F22AF646338E146565FA70BCDC35023863F45 c0mm3n7a70rs
961,955,958 *644D793B1AC4F8CF6DAA732D4E7D1C94286026BD [email protected]+!0n
961,955,959 *64400FB368936767491CBDF067849151147E84F0 [email protected][email protected]+!0NS
961,955,960 *6441B89A583814CAFA83D057EDA742E1EC0FCD22 C0MMI$3R4TIV3LY
961,955,961 *644302B861CFEE4C83291344F442BCCAAEDFB6D4 [email protected]+0ry
961,955,962 *644450D69FFAEF24811B9371B30C275BBCDD8AA8 [email protected]@nt$
961,955,963 *644AD477C2A07863BEEDE774E21E1507B36DA4F2 C0MMUN411Z3
961,955,964 *644844A051D116446573C5B168B5A00510ED6D5E c0mmunic4+i0n
961,955,965 *6445CE389D703C98FD0A555DBBAD7831E1D98F97 C0=MN
961,955,966 *6440E73FF440A967677DD70F1C36E5C26E20E667 c0mp0und3dn3ss
961,955,967 *64440C4EAA181A8A86A60D104B371338360E2239 C0mp11c4t10n
961,955,968 *644DDBD4D89EB7730BC787B1911B7A678338A5B9 C0MP1EMEN+4R1NE$$
961,955,969 *644D4CD2AC8332AF22F81BF9710A91CD668DFD0F C0MP1IC4+I0N
961,955,970 *644646532E87B6CF77E4A90FD8E959FE34991930 C0mp1ici7ie5
961,955,971 *644BFE91D2E8F4062C4031D7336A516A114CD5A6 [email protected]+10n$
961,955,972 *6440303C39F95D3A1DCD05D2B0F32CEC1C7F5BEF c0mp4i8iliie5
961,955,973 *6446ACD2D57576E4294913AB038FD200ED223F92 C0mp4n!3d
961,955,974 *644E294E90DAA64E1A382E91F64B95F4F69CA36E c0mp4rmen411y
961,955,975 *64417451582C766E47232343875EE3DF0E59D734 C0MP4TIBI1ITY
961,955,976 *64419811E013DD678AA2B40683EE911904994BDE C0mpati8lene$$
961,955,977 *64449BFA2CCD20FC4026358C21EC4E1364481AAA [email protected]+10n$
961,955,978 *64464B1514C208B6CED7A58FD7889E64430A968B C0mpet!t!0n$
961,955,979 *6445707B9111EF69ACA38BE29D0455C46452AAC3 C0mpl4iner5
961,955,980 *6440618E9497236AB108191053EFD90939C82AF4 [email protected]+35
961,955,981 *6442002FB9886F10B66989B27DC24EFF57EDD0A1 [email protected]
961,955,982 *6442B62B904B912477076345D995D2DA37432FB0 C0mprehensi8i1ity
961,955,983 *644AB8BAF2AE2893B7E331289119B1B0DFF4CD18 [email protected]@t!vene$$
961,955,984 *644F1B7054C1120362762EB22CDCE1CD7F6FE6B0 C0mQ0
961,955,985 *644CE42953622F7063D7D26889674B23EECB5EA7 C0Mr%
961,955,986 *64427214CEE3A8CE19E0F37CB9663D833AE3C582 C0M%Y
961,955,987 *6447CD4EEF48E4B7F624E620B87C9257896FDA5E C-0,N
961,955,988 *644855E2FED8766BE98C45F0597880D7493F6E3D C0!n0
961,955,989 *644AA88629E728B808A3F8C23FA78FD5488E6493 c0n0l1d43d
961,955,990 *644A9D44FC7D16324E7E05F76C6A4922DD64C4A4 c0n3rvati0nal
961,955,991 *6443547EA75F3DB66E5624E2C3AB41C47E3AE081 [email protected]
961,955,992 *644A096568A7352C45D144B38D98999F4DD7104B c0n4t1ve
961,955,993 *6441D439F27F63957E839B9BE361510A16FA4309 [email protected]
961,955,994 *644F67D38E4804E94EFEED51F6A5B2A7C7DC16B0 [email protected]+y
961,955,995 *644D548734EA0C4D48BE64CEC42E615226716CC4 C0N574BU14RI35
961,955,996 *644EDAED2B878B56645E7B7CE0B48358F662403C c0n57i7u3nci35
961,955,997 *6441C8A14E4D055F757041FF1E1A2C25C63CBD3F [email protected]
961,955,998 *64476AFB0126DD4B60C44ECC09AFB722AA4D1FE0 c0n5cr1p+5
961,955,999 *6448D11BAB43E2E4A6E20BA60834D2F4E696E89E c0n5ell410n5
961,956,000 *6447B4E72F378BC15D5530393A9A4C5DFF102353 C0N5IGNMEN7
961,956,001 *644E3BE54BCBCB466C270AD4C280EBB8B47A00C8 C0N5P1RER
961,956,002 *644F966F78A1F6E378B87D65D2B116E0D5AA4E92 c0n5ula0ry
961,956,003 *6440421308D49C8C9B033C0B5DC5FB76013CCB4D c0n5ulain9
961,956,004 *6449CFC78D4013C1963F87EF18704DBAE7CD0B43 [email protected]!N9
961,956,005 *6448203B73050B221F1F72A8FFD4E7A381EA0D0C C0n71nu4nce
961,956,006 *644AD3B861E3DADB8ABAA5FDB251E3E7760DCECD [email protected]
961,956,007 *644EE6E3D86FB3CF9EF684285310EC3D372CA436 [email protected]
961,956,008 *644FE5B9B472EEA46C6415F2C8A480CE8C94BD33 c0n7inua7i0n$
961,956,009 *6441442051A97771E6C1F3887FD0A54FDB843825 [email protected]
961,956,010 *64414913EAF2FA7C91003F962A02845DCEC518AD C0N$C1EN710U$NE$$
961,956,011 *6445E09A06F9BFFA757B7CD5B53E4C7580289E74 [email protected]
961,956,012 *644090AE2492BFE07C11113CDE254B54E520ED25 c0nc3pt10n$
961,956,013 *644BA170A86D55D75FD30236BFB0382CDEF2A835 c0ncav1t13$
961,956,014 *6441E5FD7D44C7C6470956A6D8FAB05A493ADA5C [email protected]
961,956,015 *644F3382D84EC6D0673A9B7BF99434E6087E4EF1 [email protected]
961,956,016 *644E4479164043783C6CF209CE024DDCDB4CA0C1 c0nd0tt13r3
961,956,017 *644B8CBC460789326A3313A4155E45580AF9283F c0nd1c10n4rlh0
961,956,018 *6443BC77A9D497A1473ABD21A03C19CFFAECCDF7 C0nd3mna7!0n
961,956,019 *644408E92D419D6D498213CE84BB3578E6DBD150 C0ndemn47i0ns
961,956,020 *644BA976507119EF9ED150B146E563BB7F6A34EB C0n$equent1411y
961,956,021 *644AF5D26D90747AEB25047017136AB34BBB7A95 c0nf0rma710n5
961,956,022 *644F22D047235945EEEC768937F5614076EA2C66 c0nf15cl05
961,956,023 *644458E3C9F068D9C53C511C32F892ECBC65A13D c0nf1nemen7s
961,956,024 *644EE6CBA9EEC997848DA2D0F81B2A6A46351090 C0NFERRER
961,956,025 *644906A87B921A3E5F12BF64D8F9DD3CFE4F038D c0nfi5c4735
961,956,026 *644830A096F53F8009EBC1D36CA2AD5C1A4DA065 c0nfi5ca0r5
961,956,027 *6444AD411E26D99DA2A7B106F717B9F88B71F1F0 C0nfigurati0ns
961,956,028 *644A65DDC738E2FFE04D1FADDE94CB9A651C1DFF c0nfl1ctu3l5
961,956,029 *6442BDE18C1219F3B4989CDEFBA2297FBDE7C560 [email protected]
961,956,030 *64433DA1B320C15598BE5B228E55A3A07BB47F71 [email protected]
961,956,031 *644FB989F9DFB8CBBF33E10983CB8CF596BC4377 c0n$ignin
961,956,032 *6448698392D3F9D2E8DC6A9537D9D296B56B5694 [email protected]+e$
961,956,033 *64438D672EED3EC8660D2F28FE50855E33AB89E9 c0n$i$tin
961,956,034 *64455040B965AD4ED055154D3A7E7808C81832F7 C0njunctiv3s
961,956,035 *6442418CBB385545E0742EF61D2BFFF7D1AAE6B7 C0nn1pt10n
961,956,036 *6445681506F46432ED17F45FA9327D4FD613D6EC C0NPp
961,956,037 *64402720C5E6D3E6B6A4F8F368720CA5B04D26D9 C0n+r0v3r5135
961,956,038 *644FE3E1BA36782E12D34581D95ED19FC459E0E8 C0NS7RA1N3DLY
961,956,039 *644CC84853B01BEC207A65970DB730B1341CAE99 [email protected]+1ve
961,956,040 *64415FDEFCE9A33E30CBFEEC5C82458E0F84111D C0NSERV4TIVES
961,956,041 *644091E473AC0BD2279856BEB37A13CEBD1AB264 c0ns+ra1ns
961,956,042 *64490534ED09B42038052EBAD03BE773DBA45B76 [email protected]
961,956,043 *64481AD77DE37132D0D514C2885A9214C658B261 c0nstituti0nals
961,956,044 *644BD5F5A0FDE94809C221AE0CCCB4423AAEA5D2 C0NSTRUAB13
961,956,045 *6442C5CD4C5CA336DEAC6E8A92CC2F87E3867FDC C0nstructs
961,956,046 *644092840DF4D5BCD2D18DDA0CD3742A8AF6172B c0nsu3tud
961,956,047 *644252159D44CDB45A08585131CD3D0BF8A6EC55 c0nt0rc14m
961,956,048 *64491684FB30C84D00EFB12CAC4227C323C14440 C0nt3nt!0us1y
961,956,049 *64405E1DC6F9D644A019027C630A232C726CA85F c0ntentavi
961,956,050 *6449B4A5DCF26C392409F886D8094B4010FC9198 c0ntr0ll4bl3n355
961,956,051 *644AFC753330341242B6C2BB69EB1700A961C3A4 C0NTR4CT1LE
961,956,052 *64498BAAAE304CBCAE125D6D0443A4A38C4C36D4 c0n$trainm3nt
961,956,053 *644EC93E3738F22EAC703F1DABCB172704E1A396 C0NTUMAC!0U5
961,956,054 *644BF1391D7CA266F1BC92DCB94ECD06D1EC3EE8 c0nv3r53r0n5
961,956,055 *6449D002B4AEEDF193F5BC495B1C21A15D672EC0 C0nv3r$at!0n$
961,956,056 *644A310D8FE63D32095817F71A42847A1ACFD62A c0nver$0
961,956,057 *6445404C885C41444C028BEA4068279D2F9888AF c0nvmlh45
961,956,058 *644600F712D9044D20E0C719B83540E8675CF3BF C;0O/
961,956,059 *6444411AD4B16348EC4F3960E9D7CF879F956C8E C!0$O
961,956,060 *6444A2CBEE3A55E91E3C6F3E991C4BA633984DC0 C0:O_
961,956,061 *6444F0D477DB3DCD1318AD67D9F43BF0765D51FA C0O!0
961,956,062 *644A6419AFF7FBE13E6F11F23622A2590549522E [email protected]
961,956,063 *64496E00686673CA5D8C5153BF861674EF33E4CC C)0od
961,956,064 *6447A907E9DCFFFF3148546FD838D623B8195BC9 C0oD9
961,956,065 *644738EA0794DA3B0FF350AC7B2F856F978F9A91 C)0Ok
961,956,066 *644C7017C3B4590C17989B41D764BD7947AC01C9 C0(@<[email protected]
961,956,067 *64460A4A13462721C6C1361BC5F0EF0482CAF82F C=0OR
961,956,068 *644C08AEDD87BA83BE03647FEAD43505626E6746 C0_Or
961,956,069 *644839E187A428192796AEE972522532DC53D008 C0OUg
961,956,070 *644838AE83DDCBC0D4A40818772E97EA9D84B954 C0oXF
961,956,071 *644CB623A87CE19836692E4E34BD7C7F2EDAF40A C/(0P
961,956,072 *6442A17286D0CE4D1956D7451EF527139F06E676 C0P0LYMER1ZA+10N$
961,956,073 *64401E962A975D8929E349E70CC3DEF504230DCA [email protected]
961,956,074 *644C393DB683E5709561169B530F07C571DFE7A2 C0?P8
961,956,075 *644C2CAD4E87CA921BB3448F5F13B1A99D7BE836 C0P%g
961,956,076 *644F8CDC2BEBC4435B5D70EC6F25744686C9EFC0 C0pul4t10n5
961,956,077 *6448AAAE5F4B718EDE4C14F4D88E5035AF648E26 C0pyr19h+s
961,956,078 *64406C0D6DC96A0CE61F049F1B493517EC1ACB14 C#0Q!
961,956,079 *6443F6F42CD8359B81D39F1A72C7B2163E13BA3F C0Qq#
961,956,080 *6443683DA656AAFA4EFA46B85D583EA5BD45E1A5 C0#QR
961,956,081 *644218CAE8CF3E46E813A4ECFF646E97A34851DC C:0,R
961,956,082 *644C241A14505E1F7E9536900552CC79892DCD61 C0,R
961,956,083 *64442154BE7C5EDB2189733D6532C3843E99C4A3 C%_0r
961,956,084 *6443707079710570B35CFC4A07F3E36EEEA38A22 C#0r0
961,956,085 *644B74493EFE235644D4D640B235CB8D9CF755B1 [email protected]
961,956,086 *6444754E422581ADE09023D29553C351E158BB41 C0r;B
961,956,087 *644326C26DA58A8DE57D81AB10F166BD62A08B99 C0RD!735
961,956,088 *644DF5A47B687F27391700C8E8AE7F8DBB532A26 [email protected]
961,956,089 *644264E720220BD151A8F8EE6A0F0C3E2B5EA64B C0RNST4LK
961,956,090 *64416CC61F60C2848031FD14B98E865158CC058E c0rnuc0pi
961,956,091 *64405099343B67623D6E8DF4688D98C290D625E2 [email protected]$
961,956,092 *644A01984303698AC385D11808210EC2E12FB92F C0&rT
961,956,093 *644E10AF83B31EC4240FD2ABD3AC3AD348D2C7BC c0ru5cant
961,956,094 *6447CBC33A994DFA3A31D078F5E23C4392E80748 C0Rv/
961,956,095 *644E8564BEAA4014B0F726E0A8F13AFD6A409321 C0:S%
961,956,096 *644B52E00DE4069EED2427DC898202F8CACC8A37 C0%S/
961,956,097 *6443980203D52526458AC408D29F384703B3B826 C0S&%
961,956,098 *64468030A93C8805777D7D22BACDC1329EAF6C8C C%$0s
961,956,099 *64419C7ADC0A5054DD8C6F8E5EEBB5FAD048C468 C0sDJ9h3RaLrbaDDYjwPRlg7cq1s4gaZhIcd5ky4XTXFPS3RloVzt8
961,956,100 *644BA4AF85683D6478F338CB3DF49F4BD2AAFCCD C0Sg4
961,956,101 *64470D7592F50A38E63B93DBB75AFFCE734FA855 C0SM0L09IS+
961,956,102 *644049C3DF12FF65179567054C4153A484445F0B C0SM3T01091ST
961,956,103 *64459987FB200D888EEE30060BB5DD41DC76925B c0s+ruisca
961,956,104 *6449EA0FDCC3FD2807D273B37060EB76BECA7755 c0st3anin
961,956,105 *644C27FA6FF8F1F155BED3A83EF50159B5A1EC96 C0stW
961,956,106 *64406641FE9D5624577FC9753E21B45D24F6282C [email protected]
961,956,107 *644DAA53A68E1C6133F45CE0905CBB66A93B8326 C0tbN
961,956,108 *64409C15343C48454181BC5CEDC555E8332EB3CE C0$tipu1a
961,956,109 *644BD196D9157255DEF1597D11D3A90327B1F22F C0%Tl
961,956,110 *644A5B00ACD62B6749A3452377F1B5D2BBF19597 C0t;u
961,956,111 *6444923587D491AF80F1254C6D5C053E1B6681A3 C0u/H
961,956,112 *644860F402D35A682FF49781713EA9C0406B5037 C0U)M
961,956,113 *644BED576B6B2D8B76A0AF5B1F840B961D697BD0 C0UM-
961,956,114 *64416ECD14111A5A068700F50615ED0F10977761 C0UN73RR3V0LU7I0N4RY
961,956,115 *644ECC70AF224FA6F606FFACEFBA1729B452453E C0unter!n$ur9ent
961,956,116 *644B2BF51FE3F45394EB6D60B65265169E8602CB c0unterva11ati0n
961,956,117 *6441956FA63389DB0DBD6F784109BE672D63ACB1 c0up33r
961,956,118 *64451DBDD3472683E8ECF82E9347D52383A501FE c0ur4g35
961,956,119 *644474DA42302BCA36B864B0E8DD0830E9CB18A0 C0ur7l!n3ss
961,956,120 *644ED4D65D310C5D1017874CA8D8845B1CAC5A76 C0us
961,956,121 *644559ECAD0C6462AE1DC72B8610DF36D68DA08C C0UUp
961,956,122 *644F2CCC97317EBCAD507C07053D550E7430E57C C0u+ur!3r3s
961,956,123 *644F340EB8A8A751E96C37E77069FC60E30EEF2D C"0v=
961,956,124 *64483849ABD0A8346F425F389CBE4C3E180BAFFC C0V#f
961,956,125 *6447F0D3BD5CAE882BD5BE46C4C71725082D8B19 C/0VH
961,956,126 *64482C6EBE12D0F5586377540FCAA426F9C1B18F C0-Vl
961,956,127 *64460C95AD753C49D81A89DB0737002A8F3AC90E [email protected]
961,956,128 *64435B604EAC6296078B78697E8DE14EF172CB89 C0vpb
961,956,129 *6444767873584A6BC2BF12CAFB38AD5338584F52 C0VQa
961,956,130 *644D6E758E64924EA7BC612ABBF1C54A0E41F087 C!:0w
961,956,131 *64449F799AAD668D13A6EE5B5217D315AF9E9764 C0:w1
961,956,132 *6445325C00B9DA061859CF39CAC496D142CF5A1A C0Wjo
961,956,133 *64433CF5CE01D0172E7735CEC352F7C80C12AA4C C0wop
961,956,134 *64458AD128CB014853026A40BBD4DE41939AD103 C0w;X
961,956,135 *6445F479F9AD6D69CA403347598CAA03D3F9D5C2 C0Xhd
961,956,136 *6441C99987AB1B7562CE3668FAC5465FFDA38B50 C0Xi-
961,956,137 *64413EA312EE9046D4E287FCEBA07DA880A8D671 C0,XP
961,956,138 *644E1DCD5B34EF11978062D5F6E8523A695D2BEC C0Y9Y
961,956,139 *6449108D40B1C48F05B7A390831A6279155DDA23 C0YGv
961,956,140 *644AB3ED35F6340D100075BAF758E75A6761953B C0Yls
961,956,141 *644FD4410541DD366EF00852A66022FCE555CD31 C0Z!3S+
961,956,142 *644EAA1830A4A7BADFE518CA78CC902467A96902 C;.:1
961,956,143 *644B34F0C029503A51623FE7EE499E34B33FEAD9 C1!%:
961,956,144 *64420E46DC57D0FEEF4ACC4B330144A3F48C17A5 C1/,+
961,956,145 *6447BE879B8EA6C7C64AF0D1CCF2B59407324C08 C1+/&
961,956,146 *64486860FC0D6D2907C91C7B721F4B9616F038FA C1053t!ng
961,956,147 *644EA47D9021C0F96DCA3C234D3A2C31E4BF4900 c107560
961,956,148 *64405FE40509924A6EFEA5702E0D048A446A66DF c109214
961,956,149 *644DA537643F5A6B009740BC97477462F9F515BE C1099135+
961,956,150 *644A2298DB3005F71DE081C769712889BE531E4E C10BW
961,956,151 *64445B3A63DB4A53BD69016E180953983A92F5AF C10se-ear
961,956,152 *6448679C564FAFB542E5168E327826161F9A2AC7 c10v
961,956,153 *6440C198A907D23B099B821A4612C545813C1AA2 C10WN3R!3S
961,956,154 *644429880A9B649A6305900621A53970218EF8F9 C1_/1
961,956,155 *6440456896852DB1998A587D1EAB480D476EA139 [email protected]
961,956,156 *644D6FC2126051163938DB85E1239837509994A6 c114ntr0s
961,956,157 *644E7EB2A091FD42943EB4EB3078D71D8BB6D0C4 c115969
961,956,158 *64481437FD5EDB9970289B2B41A290A1150558EF c1181990
961,956,159 *6444F6992E9137C70D4D1107DE754785E4DBE98E c1184b1091
961,956,160 *64431A205C52E3DBBFEABED9724A0579343B7D49 C11ck3rs
961,956,161 *644391B2C04B8C741B33F643E62E096E22A26C94 C11H13O
961,956,162 *64427E65D8B5AE24A3CFA5DAE47248713671B1BB C-11K
961,956,163 *64408A615F870909C1E9F7E2D43108A3C641E03D c12101989
961,956,164 *644292C3BEBB74825D27572659BFB9B147D5CECE c121524
961,956,165 *6449CE659E309938CC16376D5483A58804C65EFE [email protected]
961,956,166 *644621B9CC02C1138ECF1E3EA9706EF431EE43E2 c124833
961,956,167 *6441032B2894AA72C2EC1CDBFE1E07DE99F05879 c12h25och2ch2o9
961,956,168 *644BA403C14B328FC196D8BEDB45C3BD1A08DD89 C12i;
961,956,169 *6449B89778263D587318B93194FC08B3B54D88D4 C1.2q
961,956,170 *64407181895E0309DF28556CD5FDC39F6D0D5E43 C1,?3
961,956,171 *644ED552D621958377335D335EFF1136D5BC4BF5 c130622
961,956,172 *6446C9EFC5669BB236AD6795300FFBA0B2B278C6 C131t
961,956,173 *6445441785A7F731794908F189CAFEC5BD3A3335 c134411
961,956,174 *6441BC197753D3D000E79838E107A2ABAEC1D17A c13540
961,956,175 *644FA1B647A862831837F91B40BB62AC72490A7F c1380547374
961,956,176 *644B9D8F4A7C0E39D752947CAC6A8087DE869B82 c139990
961,956,177 *6446AE2CF3DAD1DBBB88CBB08526DF9F2DAD9AC4 C_14=
961,956,178 *6441A3D889A611202184197A3928AB36479C6842 C14.#
961,956,179 *64498076ECF9307B908CC7D0335BD2A51694F13D c141m1n9
961,956,180 *644EB6D09EBEB396707569BF721F3478681CB3F0 c143188
961,956,181 *644752E261EB827CD3C918D7CEFEA8313918AF49 c145926
961,956,182 *644617CFA6052B435A8D2346020067104994C4B6 c147827
961,956,183 *644C4D4DF2AEF8ED61CF357D0FD0D06DA6646EB3 C147X
961,956,184 *644C35304FE7542BDA844BE1BDA088C998DA42E2 C1+4C
961,956,185 *6447F5F2229A40F4C1A87F9F97A8F032E988E35A c14i1y
961,956,186 *64481BEBE6C3DAA3D15D725ACB470264F65A90ED C14ndes71neness
961,956,187 *644C229ABCB4A7B7565C7AACC6ACB219E8A7283F C14QY
961,956,188 *644D8BD4BC10630668C570003C08A370C2F4C5A2 c14rine++i$+
961,956,189 *6444E20369D1539AF3BCAFD1B607E2575A661031 C(15&
961,956,190 *644A8883225BCAB1451E6BCDE786621F080E7B80 c151412
961,956,191 *6440A8E7ABE3116FD1FF2DC38E6863246EF55419 c157741
961,956,192 *64462E1516F04AC8BBC7C22455B61AE81C7AA11F C15BV
961,956,193 *6441EC555D188DD9CCFC06889F0E02C021015D3F C15orf6
961,956,194 *64435340D07F752B921846A55DEAFF69806B4266 C
961,956,195 *644777B824345ABAE45B9BEEE9A04C080DB667B0 c161416514
961,956,196 *6448EAFCA0426778D58A56DF6925BCECAB64A2AD c16281676
961,956,197 *644B2C4C3936DCE586A2CC6D5C8CE8B8719CFFFE c165022
961,956,198 *644B480D3A3C0FCA8A5C2C1AFA607F083F3F9131 C16H24Cl2Rh2
961,956,199 *644D753DEE0F7C3C27FD3AE909FD9CC428D26D9A C1?6k
961,956,200 *6440A070A7FDC122B107C1CD3B98C8264C91B734 C1_?7
961,956,201 *64430B64B47CDCB155F405C3CF0999E533B1FA46 c170209
961,956,202 *6448C0A6A7CF4AD9DEBEFA52146287D516FF9563 c17.800.794
961,956,203 *644761AA0C8C476521972C72D85568A9666D6A38 c17836
961,956,204 *6444F285C96009DC4D9237912B47CDE1FFE6B88C c17rullus
961,956,205 *644EBFCD734457A908491EEDAF35EFF426161919 c18.452.284.100
961,956,206 *644B2BFB5456B3A0BA1A7F8B4B7D847C833F3E0C c.185021
961,956,207 *6441AC37BF241A82DEB6BD80C14100E561614A79 [email protected][email protected]!ng
961,956,208 *644FB7E7CF7CD2FCE76F93F3F045445F6BE73681 C=1.9
961,956,209 *644D74BA9807D46E122354328233EFDDB6BE94DB C:)19
961,956,210 *6441D13EA319F1BA4A3D7BEF3C39A42329F00D3C C:19!
961,956,211 *6449DA26A70748C32E43EBB3B752724DF9CAD72C C191BFA4E673E661DDE753EC8DCB32F4
961,956,212 *644B1C8B28DF1AFAA655BF3713433E2A70FFBFD6 c191bfa4e673e661dde753ec8dcb32f4
961,956,213 *644E52BB6E6F5B71FEA9904EE58624041201ED2C C193g
961,956,214 *644173B6CD4CE252EE74F4CB294941E08BED8982 [email protected]
961,956,215 *64421E8654BE3F83AF07546AE00F7F06390EDCD4 c1991-1993
961,956,216 *644CB48A4C63F6F9AA77B304B4B03ADDFCD5C098 C199487048
961,956,217 *6442B292ACEAFE08E4EAB7E5378D9D2ABAF649D5 C:19s
961,956,218 *64486974DBD1FA216D0A2BE3D29D44FBA6215842 C?$1a
961,956,219 *6443665C41DA58EA99A90BE8D2C30BB0CAE2559A C1&_a
961,956,220 *6449F18B15355A0AC6F01F6F9DFAE6049ABB19A7 c1a2f3
961,956,221 *64440018FF4CFC5E9620C44ABA701B5D44EF5F39 C1a=3
961,956,222 *6443897EADC528414CB0362306E5A325A5919CFF (c1aa
961,956,223 *64432FEE0F9DB8A34D3F173CBE03A48EE4F9327D c1air$entience
961,956,224 *644BD88E47261110F179FEEB5A49153F3C052874 C1a$p!ng
961,956,225 *644A8E2468BECE97CDB817467AA8A3A6932641B0 c1ar!ne77!s7s
961,956,226 *64427886F7DC3BBD72D6696DFFC5D67EA949BD14 C1aSq
961,956,227 *644A09B0A3B5760960AE0CD591CE9E86F238E988 C1atL
961,956,228 *644B64538EA9B5CEDE6F41086BCD3CB14100C787 C1awk
961,956,229 *6449B4A1EAD112C8D7E386E507DFAE3C974F88B5 C1ay1ng
961,956,230 *644EAC50DA35A7CFD4A45C6E7BF0359395EA4287 C1B=b
961,956,231 *644A2FFCA3140EF2F45C4B0F742103AA587AC5E8 C1;Bf
961,956,232 *644971BE109D79D4BE7B2941A7FE40C3DE3C8875 C1Bna
961,956,233 *6443691407DF03CAE5A1FA9854C03CCB41E24BFA C1?BR
961,956,234 *6447C236531AEE11AEBC5830F58AE1F23BC35ACC [email protected]@[email protected]
961,956,235 *6442BEA2E5891459673BE7BF27057C02D60C80E2 C1%Bv
961,956,236 *644C7E14CF7C916E054E2CF488B4F131B5026154 C1cd
961,956,237 *6449CD8944ED0F705AFE27633C486492D896F5D0 C1cIA
961,956,238 *644F8AD8499A47651C7755B97FB24BFE36C4AEF8 C1c_N
961,956,239 *644CA6960BDD47EAD8A72D541CCD669AF27B4EFE [email protected]+r1xes
961,956,240 *6441BF5E44BB8AB1585052D6D7DC2C697AFD0488 C1cS8
961,956,241 *6441CB285F56112E495B0DF3BBB1B0A788DD5264 C1Ctr
961,956,242 *64490A22878E7F4E34134CCCC9D11B2E9F9F49CB [email protected]@710n
961,956,243 *64481339C1B5857F8DA00E40191AFE2386C27550 C
961,956,244 *6440146FE99944C5CF74A076CB4C7305A58B4D20 C1D=m
961,956,245 *644206A9E74F5C3BC291116CA3D88E293284E749 C1e+D
961,956,246 *6441C9BB381EA9E0C0C83FEBE39CDEE4E8FDA4F1 C1Efp
961,956,247 *64480D7CE250B478426B74868B2053C1B95EC57D C1EK(
961,956,248 *644FDA3E793B937CBB26C67DB16DE0759B6E2CDD C1ekM
961,956,249 *644C56ABCD7C7DAC9CB81F5538AF5083583A0AA1 C1el
961,956,250 *6444000F195AFBA180875EB7EE0D5955E1526C86 C1eLB
961,956,251 *644D86D9B61CAC9D06716C380B37AB9D14CFA017 C1EmL
961,956,252 *644CEB0FDDFD5DD28A5FF21CBD09DB05456580A8 C,1%f
961,956,253 *6443C127F26F3475685E023CEA4B5AF8ED417721 C;1f(
961,956,254 *6446B0613A380654F80BFA6F219665BDE70E2715 C1F3-
961,956,255 *644DA9E09FC1F2CE1FFF54864E0C97B0989B06C7 C1)f4
961,956,256 *644027A961058A148049594669DCDC1BEFBB2B1B C1f
961,956,257 *64439B5608E7F729EBDF25586545E8110B813020 C1;Fg
961,956,258 *6446BA1BA5AD34764C94BD5A88BE0E677B322C67 C1,FI
961,956,259 *6441F1727052DAB50C16EE77DCB7E53366A1FFAD C1fif
961,956,260 *64482B49932E3777118CE05F8ABFEA96FAF7BF45 C!1fK
961,956,261 *644403BB2D929DBC109870720E0520CEA102631B C&1G$
961,956,262 *6447B541C888BA4FE8CBA65CFEB211AEAE775E08 C1
961,956,263 *644E451EE70181407EC0D71465115B7BC35E349F C!1&g
961,956,264 *64432AC424CBF64EDF083D89357FDC5A4DEDDD08 [email protected]
961,956,265 *6440D6D5C13C83F489C55A09702A9C647947AAF0 C1GdP
961,956,266 *644C9305B16F818CC68CC571F348C4E8F483C6F3 C1GVY
961,956,267 *64469627ABE507E36AFC57AB9C577B3E821B5573 C.1H?
961,956,268 *644C6A96E96A46FD73915510428133A2FD68F0AD C1H!?
961,956,269 *6442F99DECFFA7897C2288E5BEC94B9B35EB4462 C1?.h
961,956,270 *644C35FAC15E9761DD09533A9003F7E764548BDE C1Hcd
961,956,271 *644C951834C9903D94DE77A2662BF248AF26E7D7 C1hD"
961,956,272 *644801B777D9E85308CC4A1021C8D34BEE529487 C1Hp:
961,956,273 *6444AD52027E98229B967C80EA8C4983A1C4ACD4 C1HQA
961,956,274 *644F3AE247BB8DD1C4A59C221B24EB5957AC077D C=%1I
961,956,275 *644AB01087B8AD0CF0C361CCC3586370C1A4FD4C [email protected]
961,956,276 *6448B3F6922188DC0A95258D4A39ED181F6F29DF C1IdS
961,956,277 *64480E4582A54AB6FD9547C9014FBC0CA3C6D669 c1iqued0m
961,956,278 *6445F4F60FB2A678A19ED0E89B99AD42A2755381 C1it0rid3an
961,956,279 *644B9AF1E7C78DB133E6696613720CE0E418C30D C1IXO
961,956,280 *6442FF5815C9D1D99FEEF68D158DBB779DDA0B9A C_,1K
961,956,281 *6448A57E3B75D5C397C8C144A11EEBCB7360CBBF C&1,K
961,956,282 *64498891070F889DA1528891B1F7674AE3A7585D C1ki5
961,956,283 *644FD88D28ECB5CBA641A38E247CA7C19318C1AD C.1KR
961,956,284 *64415A4FA55E8FB2FB7BBA898DAE8894AAEC326C C1kSW
961,956,285 *644B059FEFD2C5532C9B1D765DA18CDA44896774 C1KTn
961,956,286 *644CB564E1D9474C654C1FBABD96476EB78A1341 c1Kx
961,956,287 *64426EC471EDE85028BADFBA9C44C8BDCB880DB0 C1%=L
961,956,288 *644188E9EFDD243944939BC3A066B5F2B2D70729 C./1l
961,956,289 *6441783EC56C8C422AC5CA34E2EA0AA6306494D0 C%1l#
961,956,290 *6440E06661F3148D9CB3DEB538813150AA8EC76C C1)LB
961,956,291 *644896FB638721161CB27B7864C93012B09195FC C?1Li
961,956,292 *6441BF91879FAFC1E72D0C330806214EB3A55EB7 [email protected]
961,956,293 *6446FE54FCEC31A946583D3275B5A31D3FFCB79C C1Ln:
961,956,294 *6443B99993729B252908EBCE66799F530F35B15C C1lu)
961,956,295 *6440F55CE146DA4E40998DE77C9628AE19C3872A C$1M
961,956,296 *6445ED314CD374495457691D87093E7CA96D2C46 C1&m)
961,956,297 *6449AA8C71851D6FF0255965F5F5C20D4D42481F C1mnq
961,956,298 *64427622B7C388BA5F950A3EF4DCCA15EE10B8BC C1mo=
961,956,299 *644D5592429A14F564BA56F349658858E38CB8FE C1M"P
961,956,300 *644887592FE8963BA6490A3D8C8723473AE0FBC7 C1/N&
961,956,301 *644A71D7F22960309D90846B9363E7697D72F179 C1$N+
961,956,302 *644BE5FD91D79274EE2B7F94B63F6939E3761E12 c1n15qu3
961,956,303 *644ECA75A92F7D010BC0A7428809A02B27DF2972 C1;N8
961,956,304 *6446763C77EE16DE72EA9CF27B582EEE898B0E20 c1ngoclinh
961,956,305 *6443813DC060A21A9853F864CE78DE1F24B12949 C1n+H
961,956,306 *6441DF015C9D56E07CCF12DC77A04276D1816865 C1:ni
961,956,307 *644C706C810179A7F81CAD66DA8734B7276BC81F C1;Nk
961,956,308 *6442C0946C6483717BD3A5241E182CCC818A8221 C1n%k
961,956,309 *644A91EDA9183B80B647EDAB7230C51C050E4B68 C1Nmw
961,956,310 *644B36928C3C498F3FC3C221440747963143556D C1+NU
961,956,311 *644E380F6F6439F1308192E3F0BB2AB4F0C2319B c1O[
961,956,312 *6444407F1BE75514E1480C702624CE92919ED63B C1O59
961,956,313 *644DA1119C8235D897BF9D966403649BD7383B31 C1O7H3$PIN$
961,956,314 *644A3AB7FE65765494480D982671BFDF5A573F67 C1OG_
961,956,315 *644CE0A79D9EEF313618BCB6E344B870D2FF925B C1OI5+ERING
961,956,316 *644BF1F9A5FF3C9CAC68DE9CC05835E3EB08CA2D C1"OU
961,956,317 *644FFF7CD0E33B27EA199BDE65298806A657B733 C1OuN
961,956,318 *644CF45EE4A232E74D37C5342301CBC6111B7EE4 C1o$urin9
961,956,319 *644FCC9D147FC96CF67CA97621E4FBF51208AC75 C1P]
961,956,320 *644EFDE96C5A103436E231F090AEAEE7314D6C92 C1Q+(
961,956,321 *644CAA3B8A677A974CADD7F7C3725A199C41253A C$1q"
961,956,322 *644BA4996658BDED29D6630CB3A3545320BF5F37 C1q.C
961,956,323 *644C3866E6FA82DEB68B753EB40A8E7AF7C8B9BA C/$1R
961,956,324 *64428D98A890514AE37834740AEAF913791FAFDB C,1?r
961,956,325 *644774553227EC91D45A144CA692EB5A51F99E51 C;1_r
961,956,326 *644314354E8C886C125A478B5C84AEB44ACFEACB C
961,956,327 *644E305392936FE1F9997843DA6AC6E661E3DAA0 [email protected]
961,956,328 *6446C6E0C5F7E404B74B98782A9D7D2C8678E307 C1r&3
961,956,329 *644183C9E55E4EE0C46ED21714D61C413CDD334B C1%r5
961,956,330 *6449EE2FA355F0EF408A39F8F6409E9DC2BB7779 [email protected]+1N9
961,956,331 *64425B406C6B1F62816E6F8CA8969C1E20BFCA0A c1rcumfuse
961,956,332 *644BEA0E05AE8FD927E481D1A0E1CE13DBFB372F C#1re
961,956,333 *644700B436580F89FF55471515E3AD49E80A380D C=1rg
961,956,334 *644083E8D5C7BB3AA1736A2803379CA0157BC768 C1RwC
961,956,335 *644D288AA176C6CD4A9DDE0135BF716CB0C81DF5 C_1.s
961,956,336 *64436B77C96388501DCEE5A37D222A6F2480F5BD C1!s$
961,956,337 *644EA767B318D60F34BBA5EF50C422A40A0C6062 C#1s6
961,956,338 *64476C1C711521BC3CCF704DB5A050EA7BC375EB C1S:b
961,956,339 *6446933B3AE9A58CD592347473E458DBDE70E96F C1Sd)
961,956,340 *6442CEF8D9B9AB23E5345EF700F5E209C20408B2 C1SdY
961,956,341 *64496B6AF6C0BBAF078C290A75480F9ECCBC270D C1Sm7
961,956,342 *6448731D00B25296BDED5583347BD60D30CF4D97 [email protected]
961,956,343 *644DB8AA9E3930A315F7E3BD81EDCAA4F0A4D986 C#1St
961,956,344 *6442E3CB4BB779A0607AC1A364DEBF04C190BE0F C1sZH
961,956,345 *6442CD5AE59A1260A7780E27B59A443D852CF00F C)1T0
961,956,346 *6449B2E2C7E2EF5892B1FC97AEE56EC2CE8A7112 C1ta8l3
961,956,347 *6440775545FF9A371FA2138133965338EDD5D5BC c1tchick
961,956,348 *644574E323A55B317C620B13DAAB3D18A98977A5 C1=U!
961,956,349 *644E9385B88C635E49874557971A2DF97B016B2F C1?u$
961,956,350 *6445BBFA9810ECAEA05FCCD1B85FFDFC92A19A14 C1$-u
961,956,351 *64400AB5185FD9F9A7124A021243FAB53D4EC658 C1U88I3R
961,956,352 *64427D14E92BB947547C394ED32762FAF97C25B4 C1uIT
961,956,353 *6447FD85E090BBC180E047DB193A29F751A1A93B C1UMS!NESS
961,956,354 *64482B0654E850A979B6B442EA895F94C3F497A9 C1u-t
961,956,355 *64443579494E8FD5671860415751F1CC37DCAA32 [email protected]$trophob3
961,956,356 *6441F8C88FD3C2EF1025D66329D7014B8E62D0AE C1utW
961,956,357 *6440E5927942D8A4F2E5DFE2F726D512F595A975 C1Uwd
961,956,358 *64496793A6CD4DCC4B3EDD435688DF735C0A326D C1V_d
961,956,359 *644B99D25A7EAABC98E2B604E728D739B2470D72 [email protected]!ER!5T
961,956,360 *644FDCEDA86AC30D20F896214F43CF03E94F1969 C1VOi
961,956,361 *644E3FA0C0312E182C20525015501290E05ED9C5 C;1/w
961,956,362 *644A412AE344973512469C14EF7064CE91B44678 C1w2A
961,956,363 *644E2121313F7CB5D98E1BA2C2977A3E61961CF0 C1w,F
961,956,364 *6441AC4261DABC69363D65C16D53DE04A072BC19 C1W+O
961,956,365 *6440441FD9736039D84FB572E24B996DB8BDBFDD C1=wr
961,956,366 *644B9F883EFA47E2D34CBEEF4BF928EDBB42ABFA C1w&S
961,956,367 *64459A4F5D70CCD5FF95DA41C7986D5FA8FC1BD4 C1wUf
961,956,368 *6448A12A8B7B1EC97684172EE2A663B3151AFDFC C1wY&
961,956,369 *6449272C18A63009C5F2B6E5E1302A450FD7C173 C+1XH
961,956,370 *644B47687AF7355D6DA2EE2D5F567BBE8480502D C1:Xm
961,956,371 *64464024C4F99AEDFC04C5554DB1EE755C12DC69 C1X)t
961,956,372 *644E8FC4CF0F25876D3A0CC95136EF5E47A6382F C1(Ya
961,956,373 *6444A309D0C1A0A270203BFECDAE6F55168D0D44 C,1Z_
961,956,374 *64442C9DAA94BBE02E0CCA7039103A03DC4DE5EE C!1$Z
961,956,375 *644758D5A10D1E1FAFD12831434041B718930C49 C1ZUX
961,956,376 *644DB2620B036639E7ECCD6D76BC6C4DCED02599 C?
961,956,377 *64435F168449AF47064172067C17BE23993DE092 C/-"2
961,956,378 *644B95A5CC2B6D1704AE8919DD89821877A5444B C/2#"
961,956,379 *6449E9B65781BB078000ECDC4BA4494D415CD038 C.2!
961,956,380 *644B8C79A5C4B0B2C3AE309699D8261E334DBB62 C(.2(
961,956,381 *644FC174DCA714858004D4EA077E45462720868F C).2,
961,956,382 *644F9C63242375CCEAE97ABBD8A62F3F124B3F11 C)2,&
961,956,383 *6446CD516DC898FF2911D22DDE1C521E4899FB93 C)2;"
961,956,384 *644F196B0B2337C687CF14295929810F6EE3CF63 C+?2+
961,956,385 *6448196B5E1B0B446A68119F5C3178CA06E20C98 C
961,956,386 *644C4B701CBF6DA1539B825ECFA984A3DE233683 C200904060132A
961,956,387 *64421F8AAB126985C0C45730AD4A0FE0762AB386 c207694
961,956,388 *6443CBC1FA8E6F51116E5BA6B07308C961CD33AB c20960
961,956,389 *644A4A909574149DEE45F546FB6B5E3EE783587E C20CU
961,956,390 *6446478FFB95808FD478F428DB51BFD6FE8D40FA C20$F
961,956,391 *6441828D3B7CDDF31D8F1742C84B9DB08BCCA4CD C218A
961,956,392 *6442DCC093BBFDAA793C5EB8C81FC8AA10A8A7AC C2.1Q
961,956,393 *6443AF9EEFB090E6269114F966126A529C62F064 C21RY
961,956,394 *6447A8AE526D3DCEA28D72F192F4820F67BA87DA c22.196.090.660
961,956,395 *6445CA2A802E326DC5B9736370283A1E6CBFC4FD c226460
961,956,396 *6442B3DCCBB0CA04FE6C6204A9DA270D817AF4D4 C22dD
961,956,397 *644D62CCE70E9F093428DED4EC1DE2AC9C576848 C22=O
961,956,398 *644885F562097C3DFF28A26BB3DF7CB67F31BAFE C22!q
961,956,399 *64468E3723D1FDAF87F67309B16A087B7C5BCF2F C22RV
961,956,400 *6445D9B72CF7D8503F7832AA155CB6296FA115B9 C(244
961,956,401 *6441112513634FC5504FD8E53414B192A1BFF3C7 c246894
961,956,402 *644E44EC7EBE6B9479653AFD517854C8F71BCAD6 C2480613
961,956,403 *6442190592627AA1AB6D0CBD592EFADE3CFDF1C9 c248876
961,956,404 *6443E474F96DBCDDEFFFB14B7C8D5A4EDC398C7F C24WG
961,956,405 *6440368C5B77E4811A699A288A64EE66FD8DB804 C,255
961,956,406 *6440286BF8C28D68D8854ABDFB4EBC18E5D5CA58 C?258
961,956,407 *644FF7CDF0F21BD644AF6EEB5F5A1287FF6716F2 C25&V
961,956,408 *644CC1DBDC69DAB8D30A2D36475D0DF4D81BEB4D C"?26
961,956,409 *644189D133F93D381F06DE3EA910D9C3A44D9699 C26Ca
961,956,410 *6445D5890A276124E73004D9FA3E122444319963 c270999
961,956,411 *644E28113D92DBA1234CA8CB25EA75C2C1089B8E C2,72
961,956,412 *644CBC3DBB19339D3BFF37A0B94B9A0CC864333A C27_D
961,956,413 *644AD6E304E60D514C9E92DB1B80D90D7A45ADEF C27)j
961,956,414 *644B96C39D5C2645D1CBBCF02F4995B315CFFDC2 C27r
961,956,415 *644CF7140BE215885D388686ADA716F8AE6B6BC8 c28209
961,956,416 *644AF1528DF7932AD6EE2D8C65A2356512FDF07D C28kj
961,956,417 *6440664202E951C4DD6E2235F01322B03BA7DF76 C28/Y
961,956,418 *64495DB2DD6E6B4A7C8987451C12AC68826D33A7 C$2/9
961,956,419 *6443E57DE96F380A66610FA51807C5B1F5627542 C29h6
961,956,420 *644C3624E73F425C2A6C06B593B8497B1E2E1E03 C29og
961,956,421 *644D2AED04AE237B6703A00D8BF3BD224EAD7A1F C&2A(
961,956,422 *644603FDE8217D55232C3936AD639F140CDFF794 C;2-a
961,956,423 *644DB1CD6682E0B5EF9ED1F4B89C7525E4FE23F9 C=2aA
961,956,424 *644858831AD7B0E215E1AA49A1C23F8F7AC68A68 C2AGq
961,956,425 *644D9F047D07C8CD5CA42E0E1D60A29314881F3C C,2AL
961,956,426 *644C5D1CB784B6B8462817A5D0E6B5CD330DB934 C2amN
961,956,427 *644DDD32BA3A73B7CBCAD77D493039AA575C88BA C2b2a
961,956,428 *6449EC47019D1F3CE26731B5611946724217D5F6 C2#bA
961,956,429 *64458D9A8F26BC9868758DF88A123124FB26E725 C2BGX
961,956,430 *64424A20DD43512D8D39107AB577F866C9DFC83E c2c4dd9f-56ec-34dd-9dfe-2b8d4e752d92
961,956,431 *644B39AE099811F7DA268EFD2D0E9A24E698E78A C2c%b
961,956,432 *644D66FF4832D908DA1E91C2E31B6180605A6959 C#2cv
961,956,433 *644548D2D82B63400C69CE2B2C3529C6CF227676 C2C!Y
961,956,434 *64408B4B6F5035AD23EBD7598087C1880E283F90 C2_d%
961,956,435 *644019A2D7711ED4DE60A226B40566BF71E16520 C2?d:
961,956,436 *644A991731150901D71BDBE728FCAAE2AB01F21A C2Da
961,956,437 *644EB847F4CB33B2B46528478D405D9064D826BC c2dL
961,956,438 *6446ABC830F79A9607CAA73284FB5F945FC5ECFC C2DS+
961,956,439 *644D304F658ED32AF5C389F5A504415F678F9956 C2dSV
961,956,440 *644061AA7ECDF24F42AF19B60C9D5A91B6B7F8A0 C2DY6
961,956,441 *6443705CC339262C81EAE4C0F009C570D42A4CED C2e6V
961,956,442 *644D83310BB2F3FF58F29AA08C34A090211D42BF C2eBG
961,956,443 *644FEE325DD97A579599B9415F2B66A62629FFCC C2Ed5
961,956,444 *644AC4F50E1AE0607D8238FF0E46AF393D6CD632 C2e_H
961,956,445 *64456B46B17201FCCC8FA6A18B85B8652A85B784 C2eiX
961,956,446 *644CC0A0D71675AC204FC2450F1FC92A250EB9B9 C2:f/
961,956,447 *6441DC8E050DCED3A1FAD6A918538E8DF91601C9 C2f"6
961,956,448 *644DF642842453D585A68204E0B89FE80BB0723E C2Fb4
961,956,449 *6448D5ECB24A1E8FC82F0410CBB4717853F68F6B C:2FR
961,956,450 *64439AF7CCFE2CC4332A6CFB766FBC0750D4EB1B C2fTB
961,956,451 *644DB0D715BE17D79B09F27299E2CD650A420742 C2FwE
961,956,452 *644453670F304CEF35B5A503AE03F21FE4A23EAC C=2g%
961,956,453 *644CAC399A5D35370DA76DAEF747019BCC78B3AC C2:g,
961,956,454 *644B39F3527A2BD78EE6CDDFA08BFADEA9AF3A4E C2g+1
961,956,455 *6441C1D657D6B435A61E0C809F96174391002EBD C2.Ge
961,956,456 *644B87C56184AFCD9AC615C459483F8A41FAB8FE C2GG.
961,956,457 *644EA2482DB7CE838907EDDCD3B6FE275685FE86 C2GRv
961,956,458 *644D03FDC64DF8E76C0B80C3B9067278E945EA4E C2gs9
961,956,459 *644744490DA6334DAF5C338DF48EC3E3C05F3EEE C/2.H
961,956,460 *6446BA77688F53DC8AB4CF0ED582D1903ECA0B04 C2Hb7
961,956,461 *644C380CB8AE423E7A6B194446589970918071E9 C2Hm4
961,956,462 *644DB56D24EA3710213D193244184BDD2E99317A C2H"o
961,956,463 *64401230635BE371F03957AE62B710DEB0C96F5E C2hsp
961,956,464 *644570970AAF1999D013681ECB4BDACBCA1F0EB2 C2Hw#
961,956,465 *644BB236282055767085E2372D98830BD11E498E C-2i)
961,956,466 *644BDE33E53FA0A725E710AA62DECB5738123528 C2iKD
961,956,467 *644E4BE65C2B199F81BFABAFFE13FD7F2B64C654 C,2iN
961,956,468 *644FC034D444A8F73EE206FAA5DB69B91790B7C4 C2j55
961,956,469 *6449F25CDABC73929D87B36D8AC04E76431A6C29 C2Ja
961,956,470 *64485E4526C2755484654A743B0E3F94C9057C0F C2j=H
961,956,471 *64463B07846BFF61D14AC5C2D8F5C72A76246E74 c2justin94
961,956,472 *6440764EFECC00285A7A0C3DD215C0B4F7747CF5 C2)%k
961,956,473 *644D2B3B89ADB6E334EED5190FFA32E0A6A8679E C:2k9
961,956,474 *644369E175CFA30F5A4BBFB4AFEAE48544146093 C-2kC
961,956,475 *64430EE47A63EA939BE06EC1F98342815B9356EA C$$2l
961,956,476 *644013B45041EFB022DB0FD0FE1FCF4697A32A8F C
961,956,477 *644F58AF3AF17F17698F4FE4923B76E5533B2500 C2-l-
961,956,478 *644AE64703E3DA540C48B2F4581447F4460C6280 C2l%L
961,956,479 *644862B5247BE0919F0A4790DDA692BAF63DFB4F C2LX?
961,956,480 *644D67F16D6FEC0513AE29029E6C4BB3D5E6EBE6 C2LXD
961,956,481 *644C6ABF019E81D0E7E825EA99340F00A88538B3 C2,?M
961,956,482 *6449AAEC373BCE4416D728F2C922EC92ACCBCD6A C2"M_
961,956,483 *644E066BC1E2B9C27DD3D37D22EF8443BEA99361 C2M17
961,956,484 *64474022EE4CCAF001E5C3C00B07B4ABA77D11FF C:2mO
961,956,485 *6449A29CAD31F4417E88FE158C730AB1041252AF C$2:N
961,956,486 *644876CF826B8F0335753A1CFFC17246459DFDCD C2n
961,956,487 *644DBC6CA5926F74170D789CD3AD7F0DBBB7E551 C2n0C
961,956,488 *644C8D74265FD0FE33CC42F5CEB993AA3648AE81 C2nNQ
961,956,489 *644036F01C0A119E26677F979298AD5C20A06EDD C2NPv
961,956,490 *6447316087681AC432556D8D09E6B67892402B96 C2.nr
961,956,491 *64414EB32C400686BE1A6F05EA5D6C05193FFFC1 C2+
961,956,492 *6448AC552B76D1960ADEB58F38218E16DD10E3DD C2O2N3H5
961,956,493 *644457C7966C65DE0DCCABAC8CAEC071EB64C811 C!2Oe
961,956,494 *64427FC172D6397F2BD9A02AE7AB8CC641FB311E C:2p#
961,956,495 *644C9ED900B015FC15762AA551FED55C83945361 C2P7o
961,956,496 *64491F9C9D863BA3A3358272E8EFE065EEC3247D C2P.Z
961,956,497 *644FC7DF8AF917E22CEFCB1BFA67C55981402431 C2=q$
961,956,498 *644129C0A3C7D44B907D23147CAFCA5B38C700D4 C2"/q
961,956,499 *6444E6A7B4C23F04BAA1F9F3F5A05F269AB5BAFD C2qRb
961,956,500 *644B0ED83EDE4E76937B8A3FAB8B408DA6D1A129 C2qZP
961,956,501 *6440BD964796D1D2782995C25904108D186B6CB1 C2R?
961,956,502 *64466A49D06F3A64B45978CAA4AD6172863CC2BA c2Rb39Q8
961,956,503 *64420DEE31C2A1BB95164BDCCC5878A12B7CCB61 C2R_H
961,956,504 *6443A65C05F2F04E07C2F0C2198467851738FE62 C2=rM
961,956,505 *644520D2CCC75BAB70BFDEED9E0EBB14C02D74B4 C2SM!
961,956,506 *6448F929F363FE18175831DA3D96C2A1AF12E2D1 C2#sw
961,956,507 *64460CF0B9C36C2CCFCFCCA0CC61535F59DC7C8B C2%t$
961,956,508 *6443218A9972BEFCE7D160DF3BABACD6F449F635 C2t4L
961,956,509 *6443536AADCC7A64587CACA5665C3608F7C46577 C2T5!
961,956,510 *6444A1C19E616226D59B4E2CD37537D0719CD878 C2t,b
961,956,511 *644102D9BC543E6E3713F52F3ABC66EA483A88B0 C2TBj
961,956,512 *64435C4F140B806393C17C37B133E0696E86943C [email protected]
961,956,513 *644CF944A04C5A0EF86C19F94A61DEC1A075BA52 C2(tN
961,956,514 *64440F1818B41719813B0090474630D7236B1DE1 C2TnF
961,956,515 *644313FFE24E0CCFD286256E20651CF92639EDE3 C2
961,956,516 *64497D3F51807C3197D0F16C8866501212204ECA c2trill
961,956,517 *644D7D064713FC95907ECCA43330BBE613368A44 C2;)u
961,956,518 *644F6A60CC51C9265F3171C2109C50CF45DE609B C2uFP
961,956,519 *6445BF3CE88BC2BBADCB96D73B5E3E87B458E18F C2uIR
961,956,520 *6444F0699283A089057B80726097AEA0F359B7CE C2;um
961,956,521 *64430C5CF1F361DA3547FF97C0A249ADDF8D09C4 C2u#s
961,956,522 *6442324907B4FF282D20B066F366CD5ACF9CA103 C2USk
961,956,523 *644ED3AA2FAC3CD4DFD535F11FE9468FE258F459 C/2/V
961,956,524 *6449EAD15364CE6D614BE62FD2576A623AF7E5C3 C2v2H
961,956,525 *644B916AA18C1A04AA50AEF1F6F1EF860BD1C914 C)2Vh
961,956,526 *64462346367D0DD93767B7EC00A985627754C80C C2vKl
961,956,527 *6444F6ED4C8EB4A8FE854F1B94716356690D391B C2!Vp
961,956,528 *644CA2768A84192A4E5808646BEFED006827CBE8 C!2VQ
961,956,529 *644D16CD030A73AB913D75F3AFEBC59314B4D89D C2vue
961,956,530 *6440AC93F8454F31BCBEC092E23B7B4C8264A88D C2,W;
961,956,531 *644A1D355219756C6342BC9CBB73991E772A5DA2 C2W;&
961,956,532 *644CB4F110CA0D921DB7E48B526CF7EE99A45670 C2)!w
961,956,533 *6444B3EB52AFE43EC729A0C77919A6BF3D2D8548 C2#W6
961,956,534 *6443F36B434A89DD9E9CC9D798FE3ED4D4779ADC C2W6b
961,956,535 *644E08C7F0D7AA5EF0442C1B2775384E5C2B9F85 C2WAF
961,956,536 *644F4096D3322418FC176A17E2B62F20264C980C C/2Wb
961,956,537 *644F382064823ED2709F1C9C2648B8DF433CA368 C2W_C
961,956,538 *644D85605B0D8A320179DB7CC68074165970CC79 C2%wd
961,956,539 *6444A0D8D881892EB2B52B9DF5C0EBC531072284 C2W/n
961,956,540 *644FD517E4B965E5B7E46F4E59B83D87869946BC C2-ws
961,956,541 *6443FA43E1D905E7216E1AD611E6FAB9AAAE27FF C2wvF
961,956,542 *644A4197A668AE4B62BF65A36AEE87F3D4D56592 C2WVP
961,956,543 *6446E00498D3DD6141B9D323FF8CA01DD2EF290F C2YY:
961,956,544 *644A7138E345AE86C0D7383653DD8CBB51594A15 C2YZZ
961,956,545 *644B35A3B4FF3F7091A4A7E86A703A2E6CDF4898 C,2Z:
961,956,546 *644BEAC54BDB8A580CDAEC466FE8A84605E254B4 C2%)Z
961,956,547 *6446DAF7AF0A73F6AF31179D3F23B278D97D75A1 C2Z&U
961,956,548 *644AFE1FAC13A798587E3DC66BDF5582B8146FA2 C2ZuZ
961,956,549 *644D00C1198C9393B376BB31DC88DFFCD25E310D C;3;/
961,956,550 *6441E02ED47CF789FAF66B934C36270F43D3D70F C":(3
961,956,551 *644C96C1B8D73F1D58DB86FBDC82757DFF7AE780 C);#3
961,956,552 *644C27F559ECD2BF7984AC8B34DC4BF9F6BA9E70 [email protected]
961,956,553 *644C35AE6D9FEE05B033C28BE3B717D2B8FFC1E0 C&.3.
961,956,554 *6449F02772C0C181C06B885D001B5B07DCA4020C C%=3/
961,956,555 *644ED87FE7F3E0E6DA0279220491E45DB4C93854 C%3#"
961,956,556 *644BD627955736B5E0F3800FA2C78BD8D56E3E73 C3==+
961,956,557 *64435D295F6DCD69A3307A9FF8304BAD0AF0F7A2 c[#3
961,956,558 *644F8430BB11223332C3F567F3C488C375AD767A [email protected]
961,956,559 *644EAFCA4EBA1AA8BE034FC31801C3F142768574 c30475
961,956,560 *64462CB81925A1F04EED7F8D1D7353533C4D2704 c30683663
961,956,561 *64442ADB2216F3D5C9FE52B77FBAA7F44DCA5DD7 C3#09
961,956,562 *644C36E8C011AEE9F8B6D412784E137472B4621C C30F,
961,956,563 *6448C16517D71437C27ECFD368975890B9142F19 C30tX
961,956,564 *644FB8F404608840C6F303E01A4D2EB4F82B5523 C-%31
961,956,565 *644653D6394DBDCBC3AC28B1E588DE7D7BBD441F C311arin9
961,956,566 *6444E70D71806377AC652F9EFD7283AEB50D3AEA [email protected]
961,956,567 *6447A6F61B663756A05AC5A67A27B6BCE212BD3F c3138ra10n
961,956,568 *64494C57BF344434CF8F2C637C8C369C42ADFE86 [email protected]+3s
961,956,569 *644E943AC7010CB064B77AE354A51BF9A76E6CC4 [email protected]!0n
961,956,570 *644A50F8A9FF7A1C06AFC0D6233AAF6D52A71649 c313brat!on!s
961,956,571 *64472921A422900FB33D78AA8F41CE8C835F1946 [email protected]
961,956,572 *644051C6016D053251038E1DB23A1F954016103D C31P9
961,956,573 *64416C57E6CC8B25DD5A85F45C783013D741DF7C C31w"
961,956,574 *64464342C56739B064C4EEC4566328928C47C26F C3/2H
961,956,575 *644C3B0E87C849AAA45667461271DAD68F6BF44F C32q_
961,956,576 *644FEE6AA26A35006BA28CE5AF42032CA349C028 C(32v
961,956,577 *644A94EE607FA2DE0DE132DF5A0317F36C54AB8D c3392
961,956,578 *644C52368624A186D41D36C5A3C6A7FD8A3EFE58 c33c11dcb61a9d4a1506f6bdc14c20d6
961,956,579 *6443A54A2753711E067C75FA1080163F0266F89E C33XF
961,956,580 *644DE77B5D5F4B92A88CE5012884C89401CE95C9 C,34A
961,956,581 *644C14D0E15C606192BE86CAFF650B5028E2AC11 C34Ar
961,956,582 *644EB92C9A0DEB9C4B713A179D278BB81774FFC4 C34bm
961,956,583 *644EF8ADB97C097F0AD17483268019D5EC013085 C3&4I
961,956,584 *6447BE34583C35D240EBB6AEEF21EDEDEF4B4952 C34O6
961,956,585 *644A27AC0C349EDE651C961B209E626717AA0505 C
961,956,586 *644C4D6E3A27D75E17528A13F6D4AE6D06AE32E3 C3-&5
961,956,587 *64405599CFA68D30BB7AE069A6D1A7A12A7DA1E4 C350X
961,956,588 *64445150352E387BA61742649F879664704EF6EC c3516541234
961,956,589 *64424DF2196E01748F66A17A1F70A7A1CAEE5889 c35998
961,956,590 *6441E21B057D373B8FC14244A4452A63CD8EB52A C35r;
961,956,591 *64469A59D5164A2BD5127AA513EBF594D4021BC1 C36/o
961,956,592 *644A619A0D3E269514BA83135B9CAF0730571C18 C38:4
961,956,593 *64449B295F5ED3983A4C5C4604A5BF6A23D31BF5 [email protected]
961,956,594 *644151A5E263E7664126CAD5C24F3918174A3048 c39083
961,956,595 *644AA09D0DC58D39CBDF086AD3AE0D553AAC26DC C3+93
961,956,596 *64414FEF701C175E20B07C6F435BA9E14359775A C3_A)
961,956,597 *644C7241DB6F99648B1EECF359407E0FF9C01467 C3a,-
961,956,598 *644677091F8EFB84FADE3F63FD4838538C681127 c3a0addd-dcff-33b6-8990-18dfd80dfe75
961,956,599 *644B726E175B64DD8B11B10B4DF5B4F2C7ACB1EE 米哈伊尔·戈尔巴乔夫
961,956,600 *644A525675819FBA524117D582905CCBC0FA3A23 C3Ak
961,956,601 *6448FF8D6D2AEE572F7DD9EE81D7E99D01268737 C3)AP
961,956,602 *644B8B2C9B927B33D77B49AE1F8D586C69588AAE C3aXP
961,956,603 *644661831355DA53B4B50B68BC42ECAC0902F21C C!/3b
961,956,604 *644733108FF05242422CB40B7C1D8BFCE4E19507 C3B/5
961,956,605 *64451382534D3CE9F22061C8D352E5F3C82CD873 C3b:K
961,956,606 *644E0B129222911DA5216A04D26E8C5CB97082BB C3bmY
961,956,607 *644B12671348103A295232C95A588646DBDEE149 C3C!%
961,956,608 *6445DDAA72D0BCB7A0DE05C9DC8EE30609F00323 C3c
961,956,609 *644FDCD61017D8E517D96DA7F0E50FE419C8C41C C3cf.
961,956,610 *6448AA7DB9653FF2478C90D7CDE1C97010BC3361 C-3cI
961,956,611 *6447F83B82C4F630E45B143514E4D29CCA2A6AF4 C3cKF
961,956,612 *644619A8FC04000C618DD118E5DCD77436337A43 C3CR
961,956,613 *6447256B35F0BD32A8BC4321D67D919D041C8DB4 C3c#U
961,956,614 *6447E89D3F67E7A7048D23191CEFC1840C5C7F12 C:3dh
961,956,615 *644249079ACF9C66A401C1704CFE1C9D5FE3974E C3d%t
961,956,616 *6447E9006DABBCB5225D5A53A7CFBBA008EAE278 C3D)u
961,956,617 *64490D4C4ABF86EDFE1775D98CCD0D7A57127C46 C3&E$
961,956,618 *644E232BAE48A367F1F23BFDF018522FC388076E C3%,e
961,956,619 *644672B67B7E092905143AB315A3C63C2CE741D6 C3"e9
961,956,620 *6441C565DA6967476BC4ED94345C055929B19817 C3eB/
961,956,621 *644A94659DC1004F160E2B6F21F6AB6367FDF165 C3eoN
961,956,622 *64470C247F5A306CD86098B9C075E915CC71BC22 C3eu&
961,956,623 *6441148BEAE7892438384030EFC46CEAEAF029BD C!3eW
961,956,624 *6443C6750CBC5E4C41CE6E70E7CA8F6162A56068 c3f4ci
961,956,625 *644258254DF0F70AFE803E1279F74D99E0870C56 C3FeK
961,956,626 *64487FEC07A105772BAE5BE8F7CF020C6C1B4C37 C3fgS
961,956,627 *6447FB9E9E14CE1644BC5E56F1ECB83BAD92A707 C#3fI
961,956,628 *6444146BB3FD197FE15213883C98CC10FBD0D057 C3FNA
961,956,629 *6440D91605F3898F6BF9D22458CB6686EC0A012F C3g=/
961,956,630 *644A4A7E706366E6C1E89BBEE82B8FDD5EAB0EA6 C3g5+
961,956,631 *644BC4E21BF30027F40ECD9C31F8424861C40E8E C3g$E
961,956,632 *6449C44258B08E5E9FBEAA5AB975507C707BE62E C3gIP
961,956,633 *6445817B1B8F707B355E88C3531F557B770E77D0 C3g
961,956,634 *644D82EBC36E2F4F9CAC2413798A318F89167EB9 C3gSH
961,956,635 *644B9138A420754F0A83A08E424142658E897223 C$3H
961,956,636 *6448CA89691A53C5DABB6E91FA3F1068461DF6F0 C3H5M
961,956,637 *6441D6146D0C818E56B438E3C6E20AB51083FC09 C3h(k
961,956,638 *644704AEF99A3E306BD8D45133A7A45543A6538A C+3hU
961,956,639 *644E420C0AD7606B098B6739C56E09FC81404292 C3hu2
961,956,640 *644AA1B214A923C0D87F1C184A4DD77197DFE871 C3i7P
961,956,641 *64490D3BD246111FB9B19E77D01033CFE9883F21 C#3iD
961,956,642 *6444FF91C0AE341FC9287E533A847CEE0FEC44AB C3iHR
961,956,643 *644261945B5100B6549162F1B71D00BB79BE068D C3I&I
961,956,644 *64458E4FD0B8430A25F41C1FD8EE4305C28DB705 C/3iN
961,956,645 *6449235B05DE37F212B18E884F6ACAF637D0EF14 C3Io%
961,956,646 *64458FA6D2076AFB3ED3B23C8E0E476F8AE58E2B C3IY80LT2ZAAII45NH88754
961,956,647 *644573A9343E95A8DBA801572BB940F587919B49 C3"jc
961,956,648 *64418CE0A97C5E260FD043BB2A7CB08AE3AD0AB6 C3jFD
961,956,649 *6447AA9DF491DECC2CF90864DF3C74CF39B41BF5 C3jla
961,956,650 *6447186163420FF9FA55E897ED1F0E455E5F18C0 C3jNk
961,956,651 *6447EA0742B7F314E63F9E20A2EC6CC7E31E4F21 C3jws
961,956,652 *6442E15034D0FABC8329DEE8F89732FBD4FD89DE C3/K,
961,956,653 *6448CCB9068DECF4726E44B76C71B22C2CB671B3 C3Kgk
961,956,654 *6445F00FA86EEED066D210C702101EF04F0F35EE C3kW:
961,956,655 *6448C4D43085368DB6758E68437DB8D598411E3D C3l2"
961,956,656 *644537EF4EE6DBE9E993E5E4EE434476B2DE4F4E c3l38ri+i35
961,956,657 *64429D9420D5D3E5BFABC4962612A11268AD64EF c3l3b35
961,956,658 *6442547F2E19543FD20EDB175D3D2F29C54AC6FE [email protected]
961,956,659 *644BBAC1F2B3A78A50B531F236939A26AB314C0E C3l67
961,956,660 *644269654225EB38E9709257505C7E461E60B950 C3LDQ
961,956,661 *644F8685861F999C7D0A9F28A4CA685CF553A615 C3LPd
961,956,662 *6445F6A28D733FDB6807711612BD335724B668EC C3LPp
961,956,663 *644A9E1C8B74B47228B6013E9D6A6A585B9C89CC C3mo3
961,956,664 *644C35928065B31635FDDBDC26AA24FE49C7D395 C3mPD
961,956,665 *64480206D145E917D543A4F24D82B387FED76E1C C3$%n
961,956,666 *6447F62EECFD1AFED3DC2EC5164E51E8FEF417D1 C3N+3NN!AL$
961,956,667 *644DEFDDF020EDDB5ABEF2A9D058F353E9B25BF8 C3n+3ring
961,956,668 *6444900C23159EC6E86868F421F6C6DB52E7D056 C3n4=
961,956,669 *64475D098C9123367B710B7DFAC7C49C00A9EC91 C3N7RAL!7Y
961,956,670 *644241A98FAB12BD8CFD56997BE9B7FAA4180ADD C3nFM
961,956,671 *644F454CA4A8F4F308CBBD846990BA480A8B0EA0 C3nhv
961,956,672 *64464A5CC37BCE2854C90966272CDDEE4080CD5B C3!nn
961,956,673 *644DD00BCF14C8E61A59BFF39AA43D3419320686 c3nt1m3s
961,956,674 *6445299EEF5C6738BA7010F78FF5EA0DD4880A0B C3n.W
961,956,675 *64401708ACB8BC0A38E59B6683A05257B2391D57 C.3O=
961,956,676 *6442CC8FC7C00FACCFABA213B0020711D7DF5077 C3_O
961,956,677 *64482F205E4B5857C4D38C6FED675F56EBC27C60 C3oNo
961,956,678 *644C460F1378049A1A716D384113E589C966C032 C3oOM
961,956,679 *64493FE9C299AE1FA8B1C9BC0541ADE9414D6932 C3O:q
961,956,680 *64446E2ECEA9DDFCAB08D2FBD419B6EBC8C58CB0 C3oro
961,956,681 *644B4CBAC090631AEB5CC056152795B20D8986C7 C3oSC
961,956,682 *6447F43E90DAE64BDF618077C02683CC6ABD30DA C3OX+
961,956,683 *64439B6FAA1A07C4BC48057D1D4DA84DAFAAA74B C3_&P
961,956,684 *644D4BA33EDF16274193D11AC11B75BFDD0F90C2 C3p9&
961,956,685 *6440350E6A20FDA9D01BF43266980CCE595E2FA4 C3PFU
961,956,686 *6443AFEDA12D76E649AAB01B646830331348207D C3Q6r
961,956,687 *64463DB76CB70E405456FC809C4C6939D33274D0 C3qWX
961,956,688 *644EF8959C4DC20F984C61B2AEE74E5D1C233D07 C3&;R
961,956,689 *6445AA1E3B61EAD02FBD89C9617F4AE79BBFF03E C3r173$
961,956,690 *644BA257E0E49DC7AF02206AEF973228823DF497 C3r3m0n1a11s7s
961,956,691 *644F75F401D72B4CF1126541DE3D375F9D2A0C98 C3rn_
961,956,692 *644FD335090D93FB25CAA33A07723B7E2A682F82 C3r=X
961,956,693 *644216D368878C4E4D4553ADF6ACA7412C38AD3D C3s0)
961,956,694 *644CA4154475854A11F38C0C27650214E22B8828 C3S31
961,956,695 *64418E90DFB0BA294FB50BD622D9EC9054BAE3AB C/3sb
961,956,696 *644FEF7B43D0745453FD53D683BA6459A5627996 C3sB2
961,956,697 *6443175AB1A089726D2CC37D80A49C2064517B2E C3SR;
961,956,698 *644092DFB2A31CC6B06EDE0E30C59F32DC135128 C,3T(
961,956,699 *644F7C0D6635D054A9514D807ABFD536DFB86320 C3:.t
961,956,700 *6448D3B5FF19A509EDE152A611236E9D1B0F70BA C3t.;
961,956,701 *6448F5AB50B2AABD3C89EBDDF9EB289B1ED36F10 C3t$?
961,956,702 *6440C76F7453F4BCF1935648AEAE57FEF829836A C3;Tg
961,956,703 *644F41AA3FFB43DE73FCFF907ACA92E486C4A0A5 C3tPs
961,956,704 *644B5F03A2A4E5609249ED9432CFFE79E3D28CF2 c3tq
961,956,705 *644E5DC86F2C11A4D1C3C8A5CA48FDF37E45D428 C3TS(
961,956,706 *6445A081C8893B9979A5A7D506F8CF7A89FBB0ED C3T?s
961,956,707 *6447445F5F4CCF32E977B78BD035D39B5D420AA4 C3ttV
961,956,708 *6441DD35953B33A3A3F7B037EBDFD40DAB160120 C3u90
961,956,709 *6449EDB100DBD0ECECB7E96D10D3808BC4B09254 C3-Ue
961,956,710 *644823208583FD970AC855A5C6CB7C8C5D25853A C3ut#
961,956,711 *6443C7D70459299C9B895166CBF44AA5989A75D0 C3u!U
961,956,712 *644C483FD60AD99FA30200D5BD1BD99890A7C8F5 C%3uW
961,956,713 *644EA62A37657D9FD0998D51B10C78D91D8E531E C%%3V
961,956,714 *644211E87A93CAD40BD4CE2B83EAA58D08821676 C3V4T
961,956,715 *6441C2F819A8D9B722B1F62700EDDB4BEB63C751 C+3v8
961,956,716 *64495EC2FF44459547BCCE3DAC51F5B0753D5E57 C3VF.
961,956,717 *644C11F77D16DBE3BACB489408482B13CC961829 C3vk-
961,956,718 *644F7CC38FAE29129F8BC69D0BD76E5E65F47540 C3W8S
961,956,719 *6442D5645F526977B0075743DA474E5137074FA9 C!3wk
961,956,720 *644CD9B660F0AC535A46CC8EA27F6960CBD8F58F C3WLN
961,956,721 *64408D975ED9A47FFB6926C3560390066AA5B2FA C3Xj(
961,956,722 *644EDFD72A07747855B10CAA1F5B1D51BAD37212 C3-Y#
961,956,723 *644A7D9A1E0F2C8CDBEA94D75BA7E164C313A852 C3!Y
961,956,724 *644292B6C866D3CFBA6AB5FE047F314C97F0DD1B C3YrO
961,956,725 *644E3A5C6BA6A09D1E2744084B5AA125DCF7BD22 C3
961,956,726 *644E7BBDA6501A8C500122E0DAD1D7BCC2A51625 C3ZS?
961,956,727 *644A90D9B9540B36075F4A6D72C0A78F69F0023C C3Z(U
961,956,728 *6443FA2F7996546863D595BEEDD818EB596B5A0D C=
961,956,729 *6442BD890829D341F37E5D7677F1C0A0156DD146 C|4]
961,956,730 *6448FB7E2228C1EE15C64F9D177877BE3424C3E8 C?#(4
961,956,731 *644F4D6D556F98B3729CD26F080A76EA10DE17DE C.=4&
961,956,732 *644A7D2379BB4980BC1CACD80EB6D16A7676DDD3 C(=4(
961,956,733 *6446C862D2794899603D4E747BD5DB16FFD3550F C)
961,956,734 *6441BACC5140D433A62225A62556B91CEAB7B157 C)4$!
961,956,735 *644F801037F27F9668A53D31C2DA14D1C69FD46D C4"?%
961,956,736 *6449ED7AFF692E1EAF8A277F4EA78082F0A1530D c4+-
961,956,737 *644B0666E3A48212137E34F82D5AB8935949352F C=,40
961,956,738 *6440E8CB5A9763210EBB5961D8CFBF3E62CEC0FC c401b6df-7e28-34c7-a62d-0f50be70d4d4
961,956,739 *6444B11A1C9AAFA546349600CD95913C6C9255C4 C40c=
961,956,740 *6447D9BD28CB639AB751B2E252D4D98EA831947D C4(0E
961,956,741 *6446A0B4AFE7F2715A73938A78BEAB33503E829C C40Hn
961,956,742 *64446614063ED293D7E706DA7E658687BCA7861B C40m"
961,956,743 *644B374EF0BF66F65EAE017BA3B2EA70F7604EB9 C40Os
961,956,744 *644F0BF9CCE03D8E14C584FD0A438163306FA354 [email protected]
961,956,745 *6449D8EAA20DACF643F8EDACCA5417AC2BCC62B8 c41c4r3ousn3ss
961,956,746 *644D6203A3F2D7CE2DCACC8ECBCBA9B273B92240 c41umets
961,956,747 *64458226C5F481D660CA6168401689C9BB853BFE C/4?2
961,956,748 *64428A6EFC4129DD12EF1353BC98312D25510E5D C-4(3
961,956,749 *644684EE9BDF3B155B8B39480DEC3B0E27F367B8 C4(/3
961,956,750 *6449B703FAE1CBF36B0299804B887161BC6A1C75 C4%/3
961,956,751 *644488E23325F93AE1EA6E7DD83B4FC82E482ED4 C4+3!
961,956,752 *644E85A2EB444429F939E4316A4D196A64E6E64A c439144425
961,956,753 *6446D266632ED428FC176B530DF21A9F221844B7 C439K
961,956,754 *64413EB63B3845A6E3F0DA689164D8CD2C9E5373 C4-3H
961,956,755 *64481B97E5FE42EFDE6BC8135B4A3C43DD506D11 C43uC
961,956,756 *644A7B0A57A547A612A4722E2AC0F27E5C60A4B1 c4481873
961,956,757 *644A1018D0DF25E439696F84C826521E390FD3FD C44m.
961,956,758 *644FFA57239B0A078777C4601E5DFDBDEDB588BC C44Tm
961,956,759 *6441F95B364936534F1D693C66B62E6FF19727D0 C4!54
961,956,760 *644C216F4392DE20F486D6D987B1734FB25CB7DB c45qu1lh4r14m
961,956,761 *644EB73C87B1C486FD4C53D9243B2E82288FF383 C4
961,956,762 *6446593C59F982F3854029B8F9BE433C184EB763 C4741o9
961,956,763 *64490256EE75B1B085B323E0FE6D3DD5BEE07A8C C4741o93r$
961,956,764 *6440A04F2829067DB6A782581EA841DB00443814 c474s7roph!c4lly
961,956,765 *644B604B1CFC910476F398F49BC37EF02E6BE8AB C47E90RIC41NESS
961,956,766 *64409C6CDEA6AF0B41F8F0CFD5997F6499B08F84 C4_!8
961,956,767 *644BF3616B18A688AA3FCAFA8EA0A7C7E9884B41 c48ri013+5
961,956,768 *644B6A993C733AA112FB11C699A35D85A3EEB39E C&49M
961,956,769 *644BE1013D67C02D3284C399DB3AC4B4CA97F809 C/4/A
961,956,770 *6447F9D0854B22A111379071C1FB8708DE1CFF8A C4;A,
961,956,771 *644DAF213A15BCE31B6881641041C2FBD1678ECF C4.A+
961,956,772 *6447D9D88C736D619D054475FB3EE12E91C9E3DB C4A;
961,956,773 *64439D912061D425F17ADE9442C4191F2122DD7A c"4A
961,956,774 *6446E89BC86247C21807C615D193B7C879C81DF8 C4A"3
961,956,775 *6441D3EEE0499025B9CF59C728446B9369EE5016 C%4ak
961,956,776 *644030920F8683EB31F7EAC5D24B9DB22B6B5F6D C4ams
961,956,777 *64454DDE2008D106CBB65E0954077C8BBB3E3B6B C4aoK
961,956,778 *64459A3E15D779C4CC0698F5AE915CA63C1D6FB2 C4A%q
961,956,779 *6441DD4F47A79DD625C6BBC2E60E2E8EA8D24344 C4A!U
961,956,780 *644313237ABA7BCE97339EC524FABE860FE626FB c4b0t5
961,956,781 *644A122C77A5139BE8723C0E3098C98077E542EE C4Be_
961,956,782 *644E538B1F0D5DF82C02925F9545F3577D2A5B02 C.4bl
961,956,783 *644F8B1BCBCEA4F349513512E851175A4ED90DAF C4BMY
961,956,784 *64475B5DB84C5833353C9503B8FF01D5EFE8D381 C.4C_
961,956,785 *6443A881F7774655EAE849FAF3E6B9883C54B0A2 C4C1v
961,956,786 *644E067B1CCB12E0EC7400176698483D7297D797 c4c+4les
961,956,787 *644440CDE307F3DE7BB2022E99960526BD8D8B2A c4c4r3j45t3
961,956,788 *644D0F42223C2869E07B4C7A37940391123AD320 C4!CE
961,956,789 *64447F8B6B4FE10BED394E937480436B16F4C706 c4ch34st3
961,956,790 *6442C19A7724C50E1B7623205C020DC4934C95F7 C4cX=
961,956,791 *644C7E734C6045BA500CED53DBEDF1146516818B C_#4D
961,956,792 *644C5F682CBAB03315DC197197205CD1F3DBBC8A C4-#D
961,956,793 *644B96EBCD83D7B3938BE212D0E087DE810DDEBB C4
961,956,794 *644543F2CB83302AB2F21B0CC0DD39033BA07DAD C4d1#
961,956,795 *6449543354A22CE35E80024B00CAD8970D2FC9D6 C4D"F
961,956,796 *644FB86B95C44B45CA5785D8481C4D235AE94737 C4DpB
961,956,797 *64432DD994F9BC1111D00A67A464835C033D7BCB C4E66
961,956,798 *644AC7745E94110E5AD3FD33B357C8E385B49CE5 c4+echizes
961,956,799 *644E4DE336F12536E9657510C1E85DBA63E5EEE4 C4ECs
961,956,800 *644A19CE3B4489AFF7E4B586E1716E0988127A71 C4eF$
961,956,801 *644C1096C204DF378917844E07BE9BA6CCC19373 c4egor1zers
961,956,802 *64445937E52BD18C34255B6418322974C47F2787 C)4EH
961,956,803 *6441E0485AB1F9C444F91E45F0A37389A03F8AFF C4eq4
961,956,804 *64410B6D8867A3207CAE5EE698AD940A16E672A0 C4ER&
961,956,805 *6443AEB93433E0160CD2BAEE8025E584A8481007 C4FGb
961,956,806 *64447F6B9174EBFA1C57B117EDF685E8E08DA47B C4f/V
961,956,807 *644EFC39575C734E5687780B34FB9B049C4174C3 C4fXp
961,956,808 *644EFB44963DEE9F20B2981FE7E64F8A8AD2FAF6 C4FZ!
961,956,809 *644695734FFFF3E5693F112AB5DA34EA42F5D2C0 C4(GU
961,956,810 *644600046C13A7532DD1450287E395FD337B4358 C?4Gu
961,956,811 *6447448E2806B38483E3FB58C6698EC3BB95D51A C4g_U
961,956,812 *6447C3EB5F9EF48BB22AE2A0634411C0B39E1F9D C.4#h
961,956,813 *644C746219B7068F8B00C1ADE8AB9524DBF2EFB7 C4+:h
961,956,814 *64487133E3D87EA43F1705F7164AFEA29576C90A c4h.
961,956,815 *64476B0EAC71622841FDD2A2C6374B8D5D8C7A0F c4+h011c5
961,956,816 *6440F5C8E4A4A6A4873E8835DCA8A31D6FEE583C C4H10N2Si
961,956,817 *644A098FA753D7F8297AB1B3BC77CA899266F784 C=4hC
961,956,818 *644971F16DD117AEC73E05C192460DDDA8CC2179 C4Hg0
961,956,819 *6449155B414734A42FF6A12DD89F7B51B7A85B59 C4hkY
961,956,820 *644C9F410556284F067104275E54893F18550669 c4hnoi1x
961,956,821 *644A6CAB24ED5D2BC3EB780FBC9A4B85A45BE1D5 C4$h r4il
961,956,822 *64484D09F1E3E9CEF18F463D3D003AB1E9AD36B6 C4:hs
961,956,823 *644DCE3BC19CA5B6259CF2C1028E9E3CB5670E36 c4i4rt33i
961,956,824 *6447800F646BAD4BD01962A66DF19BD7BBC25ECD C4"i6
961,956,825 *6447771D47D0B4C7BCB2C8734FFCEB372C28C8D9 C4I9P
961,956,826 *6440E28C87EA77758A24D0DE81E7DE98BEADD526 C?4Id
961,956,827 *644A5D96F5AD42F14DE39C614D270C60A8841D19 C;4ih
961,956,828 *6441216FFDE8A96FA977D21475AE37B49D5A1034 C4iIc
961,956,829 *64495777BDA81A381EE912F3FD5B176D609EC3FB C4ILd
961,956,830 *644D80FE864578C666A7994D5A1DBA0BB634CCB1 C4IlQ
961,956,831 *644B51E3A12115E4339C269A4D7D3B81DC678B28 C4j48
961,956,832 *6441DF20D7C800C40B31CB64FDFC5FB65B3B47B2 C4)jg
961,956,833 *6440BA9F41095F6DBBFC1AF4224193974CAB1C64 C4jhn
961,956,834 *644B60F5AD4BCAE939A13CF5DF0A7873F58065A6 C4jL2
961,956,835 *644A4F4BD10C4D6D4216F30053511782861F866B C4jMv
961,956,836 *644EA0D6A035776D422D54FB11C1D4D58E6FC4F1 C!4k.
961,956,837 *6449D11533A141BE09B4AAF17C9B9C05F7B6BFC4 C?4k=
961,956,838 *64464B26F22AF7A711348F5AFCE7E67506DD4828 C4K/2
961,956,839 *644141DB7FB422E78EE6E1A9B572272851059D9E C.4Ka
961,956,840 *64447413249711A4E4C3B68DB3941D4412F1AA17 c4keb0x
961,956,841 *644AEE986754DD5FCEB0A8DA9D87D806E95FD46A C.4kK
961,956,842 *644FB6D9B2ABD43C200D56CA5592F8056F250AF9 C4
961,956,843 *644613F2930ED2C77B38A7EA7FF44A7B8E012ED0 C4(kY
961,956,844 *644C0AD08C4B850311441D13DC393CAE0A4E9FFE C4L4M17OU5NE55
961,956,845 *644139A3C0BCD9597C23D06A36A82D4D325A7DFB C_4LD
961,956,846 *6444BA90D866D0811120251ECEE930AEBD14C864 C4lF_
961,956,847 *644E5475DE73225761D2D1C957A3B7D8E425E64F C4lg+
961,956,848 *644B9E7BE32D8A0CCDDA94C49D815BFB0E2AB595 C4Li,
961,956,849 *6442F25E5A012C7EF5DDF2BCBE524EF1C02EEF15 C4lk!ng
961,956,850 *6444B0D926FFFE715728E1351BF288F84E2BF780 c4llfr4m3
961,956,851 *64403DE8BE0C3318E6D6CC9D008BFA283A18A6CC C4Lsj
961,956,852 *64487AD6E86DF0A376D2AA5507298A1C475E1807 c4lve
961,956,853 *64490A836FD6E438C923D1F8F5556463612CD9CC C4LVI7IES
961,956,854 *6440FB510B748B43822CFD0983423704CE3895BD C4Lwl
961,956,855 *64428C0AD5FABA62AF4006C69200F866ED1D0739 [email protected]
961,956,856 *64457AB3653511C84EC8FA14EC81F39BBC7DA573 C4Mad
961,956,857 *644370465A83FE7F7E0A6A6F6C438F13A6EBDBE3 C4mMV
961,956,858 *644488EFA366739D95F78F9EB28DB2CC6ED8169A c4mp4igner
961,956,859 *6444F6BE43A09D9CEBACE213CC15C6C28EF194E4 C4mp5+oo1
961,956,860 *644101D4433E37CE89238B3E4BA9FF39DA640128 C;4N+
961,956,861 *644949D238703319B30725CCFF568FC0E86D2517 C?4N_
961,956,862 *644F873F6B4F31A5B05B977093237DAAFCA5CAAC C4.(N
961,956,863 *644CE043410863A81B5048D91AFB8258BAA2790D c4n0n1c4l1z3d
961,956,864 *644D7ACC0181767DEAE2EC0AEC2AEB15D7F825B9 C4n41153
961,956,865 *644BDC0E38D522B9F3A6F9A89DAB799976E88322 c4nd1d47ur35
961,956,866 *644A263179B6C345E88E8CDC7671045E3D7585D1 C4ndlewick5
961,956,867 *6447570B96AA8ED8A6B7E0B5ED235813200BF92F C4ndor'$
961,956,868 *644A76E9C42E06150C312B1B89955D2744D332E6 C4NNc
961,956,869 *644A5FE79D3228297AC72AFE89B0A7E2D0ED1604 C=4,O
961,956,870 *644D647E038403F0C159548768296ACE86726750 C4Oip
961,956,871 *644117B54AD06C0CEBF59783BE6B155874163F28 C#4&P
961,956,872 *644441DA7DCDFC6F6FD02A1C0D80C3AD18B46F9B C&+4p
961,956,873 *644C48D9D22F5D7C4638410E1BA6BCBB423599AD C4P3)
961,956,874 *6442EFF1B8D5791D157E0EAE1ED1AEB74BAD8A08 c4p4c1tor
961,956,875 *6448CBD83461D8460DB1D2D699CD7FACF77C72BC C4p!+4l!zer5
961,956,876 *6448AFB15631BC5D4F84E72FC839D2BF10F040B3 c4p54mm
961,956,877 *6442F7AB046DFA1B2717D8A1615F8A93FA06F5E0 C4paP
961,956,878 *644994C731DFF987CFD976FF8523E1EE0997AC4E C4Pd0
961,956,879 *6448E9E29D78E597609ED6E5275A8B8C2912703A c4pern4i+e
961,956,880 *6449C287F09529BC4EB066701C8F0CE0F0CC4C38 c4pit4lbunny
961,956,881 *644641DF3ECAE7108191610D8A6BDF592F9F8704 C4po+es
961,956,882 *6441D17868B829DBCDA23F47FE67E1036341F35D C4pr0my$
961,956,883 *64414FFD3D454A6C1870EEE1873726A33E29A1FF C4$pv
961,956,884 *64451101C2B3AA6626FDE70CC3F5F14B36E165BC C4Q?,
961,956,885 *644CC4C72866973A52C54D1AA8B7E6707DCAA3FC C:4!q
961,956,886 *64403AD93281CB4F731414C501527C0057C25230 C4qX_
961,956,887 *644DC2D7EAE2D5A7495D51033AC4E3F09436BF12 C4qXT
961,956,888 *644DCBF9C09F72E5791D5C8CCEDC89A7544730DC C#4qY
961,956,889 *644FB76A31CEC44082D7E7C302C52DA9FBD7C3F5 C4%R$
961,956,890 *644F35F33818BF9F937D5B58FBC9C624EB0CF6CC $c4r1et-c
961,956,891 *644E57990CD5422D9BADD2F716642D93672B223C C4R70M4NCIE5
961,956,892 *6448BF84A2BFAD96A30C10A32A2BE062BFAA2788 C4R74G3$
961,956,893 *6449506B0D71B586A42F19C8799A1B5DC614B39A c4r7obibliogr4phy
961,956,894 *6441131B24098E403700F851D8FCAD9E61137D2D c4rb0hydr4turi4
961,956,895 *644EBC6D56FFD432910BC0DD340111D07A614279 c4rd!0l09!575
961,956,896 *644E3E8E3C296A0FC31E444A56E773E4AD774C8F C4rjs
961,956,897 *6442B18D24835563EF3A873578F9AE410F6061C5 C4RN!V0RE5
961,956,898 *6443025175EF0D2550F3EDA5742576FB0D9F3EDC c4rp1d0r
961,956,899 *644695BF7823FBDDE68AF8D9D6052597B5E91FFA c4rto9r4ph3r$
961,956,900 *644BA5B8142F7E98CD3E1EFD72FB5115C5F94C10 c4rtonn3r4
961,956,901 *6441FFD99E4724DAB572E7DB29EAE017467D7F5B C?4Ru
961,956,902 *6446319701F065EB569C5CFF3A9DD07136B6E04C C.4s3
961,956,903 *644F4A4071BDE434CA2958699F83EE7CE7B49BF8 c4s4m3ntou
961,956,904 *6442E69A7DDED1C6C80876987C66FAEC4C3B428A C4s5%
961,956,905 *644C3616934A884DC44AA2A7918E725F7958B605 C4S56
961,956,906 *6446E00E20A20D9FCAE19C9986ABC14C848A8C44 C4SAB
961,956,907 *644F5BE765F1DD08EDA3276D43A417F6CB611FB7 C4&Si
961,956,908 *644C96F80BEE01D5888B940F531A4BB6E499F67D C4Sij
961,956,909 *644ECAD0030ACA9A436661CAF6574F8F2B3DCD7B C4ss0w4r!es
961,956,910 *644125A3E9A67B4D58FF721ADB4F91F568FFB3BB C4sU#
961,956,911 *64404187A38AD5FFD99DE1BC5B582B70F43A01DF C4su1s71c4l
961,956,912 *644842634C49DE67AC5ECC8653E359C20C37F11E C4%$T
961,956,913 *6449B2D9C57801DD0E957270323A1F4CDD40D762 c4t0l1c1zv4m05
961,956,914 *64429697078DD7C47383A7CE5EF2B7DFAEC76AD4 c4t4cly5m
961,956,915 *6449095E497221B3EBF94B581DFE9683E0FF6241 c4t4m1te$
961,956,916 *644D144BE611D9A18426920F0F5038ACE0761783 c4t4n3
961,956,917 *6443A5A4538EE279BFB478C2315053DDD0010395 C4T4T0NI4$
961,956,918 *644CF01BD653E2A9B722005D1CF467CD2E03F12F C4t6Z
961,956,919 *6441CD5FD79005DFBA5A725F884F7372A1F4A5DE C4ta)
961,956,920 *644E031791FEBAA25FCFDBFB51F369D954DC0C76 C4Tf?
961,956,921 *644B1D5701E03EDC6CB651E715C154A13D653270 C4th3t3rs
961,956,922 *644CD345FE5D31A8E7047B6716D1AB4BCC65715F C4"TQ
961,956,923 *644EF8FC34275724FA6575A7AFC20CEDF7B457FC c4tr4fil4
961,956,924 *644B895E60090DD09EDAA366384064F8A221E498 C?4U;
961,956,925 *644E30A957500A0297038CD0B865A1A07F707B49 C4U93
961,956,926 *6445323FC52491FC8666CE9A044C642002A6BE27 C4UCU$3$
961,956,927 *6444B68A98AC9F33B933E5B1093D9C106F6F5280 C4$UI$7IC
961,956,928 *644DE20DD3BCBFC295483C962AB6F7E53FC8C4D0 C4umG
961,956,929 *6443999B8E6573B4F2B18EF680F1A5DB485D9F86 C4uqV
961,956,930 *64432103DD9B6480CEC2B0D034F0E2EBF355CFB3 C4Uu&
961,956,931 *64438E964E477189A19F94F1D7D12D5C37D3746D C:4=V
961,956,932 *644477A080B5EA888BBB98428FB97E9060C7BD05 C4!v+
961,956,933 *644C61762BED3B3882ED638255FEEFBB8527A0A8 C4vac
961,956,934 *6445A5AF4E020F788219FA870BAAF08A2108D721 C4vS4
961,956,935 *64472255E9BF484E31E8BE73BC78B161208F9C34 C4WM?
961,956,936 *64499154C74ADF1323E432B9BE9D6D011CA4A1A5 C4:WQ
961,956,937 *644E32EF3EBA9425875792140DDA4E58E465A3E5 C_4wR
961,956,938 *6446C7871F9BAED3DAD464C498062DEDEC0D4FDC C4WTS
961,956,939 *6440D5034BE7999BAFD4B75E6F6DA67A7C667473 C$+4X
961,956,940 *644CC2CE1DF06077B32ED3E3CEC7AFB70521C1F4 C+4"X
961,956,941 *6446FA3B4EFB42304B7622FB5B77CA943B14A1CA C4Y9l
961,956,942 *6442094B0D411067FB3C6EB4B7CC281021F06257 C4!YT
961,956,943 *644D0AF129E9DC5230424163BBE4754523D6574F C4Yw%
961,956,944 *6442A33716A446DB8BCB52AAD57B343EC3E64ED5 C4Yw0
961,956,945 *6447C42D9DE32AE0D87C971E78FD478C80F9C839 C4Y)X
961,956,946 *6447293D005E2B882509ED3E46E2BBBAD13C0D64 C4&+Z
961,956,947 *64403F85E329C827F91806A793CBDA1013A44CE0 C4Zq3
961,956,948 *644756679B9A8EC44A32EC158E22F411D22B8085 C4ZTP
961,956,949 *6448AD2ABEE980119E5FE847618BC59D41056F5B C4Zun
961,956,950 *644B70370159D1CECF899935C1A821D12DDB859D /C5
961,956,951 *644861A28427EF64E05FD0E01A7BF9D73E9F321D C_(5!
961,956,952 *644E1E1E116BB0345F55D9C81768CF56B7E6556E C;+5&
961,956,953 *644E4E205504812E93894489047305C4D7208B94 C!&5:
961,956,954 *644037C0CE227E5D5D77E1B86611DBCB45EB3E1E C!5?)
961,956,955 *644BB16C265505617A6C3854F91D283406A5894D C$%5!
961,956,956 *644FA5FDF5D6E8CFBDBEE677C574F9A849494C50 C&_5&
961,956,957 *644656A51BEF2C2F2F2E619DB395AAF3466C1EED C5_?
961,956,958 *64486D7D8B2A8A032C21038328C3427B38CE2ECC C5;:
961,956,959 *644AF34AE1ABC19ADAF32C70E7DDD330E0066BF0 C5;#%
961,956,960 *6440B505E186F399791B1E9C6525AAD7237AE346 c/[email protected]
961,956,961 *644F454AE95583659774CCE7FE0D7D4927C76D44 c)5`
961,956,962 *6446FF1DD54C14D8D66EDC59739E1A69FF723AB3 C!5?0
961,956,963 *6442DEDC34832578248746599241C4157CB69BE0 c50748688
961,956,964 *644E51F63D84DE36FA70802AC1D8AC8DBAE69B03 C
961,956,965 *644FF3617E2618D596582CADC5FC42D90779298B c5080
961,956,966 *644D52D6D3E644EBB6457681F603355B97C43C2B C5/_1
961,956,967 *6446005352717A16F38CAB99459145478B4B4872 C51e9
961,956,968 *644BAB379A6885006C538041677BCDBDD5131D54 C51,i
961,956,969 *6442060E79758217295CF759EF68E219C15AAD9F C-52l
961,956,970 *6448FFC8F32FB58F180491C76FBC40F0DB917F3C C:)53
961,956,971 *644401A20E54CE0C8512156BCAF76EA3B9CEC323 C5$3)
961,956,972 *6442BA1FC8A7A826D71025C894CEC8533C74E87D c53534
961,956,973 *6445FFFAB30E61633FC5588559710A056BD0ABE0 C53R1
961,956,974 *6444220D17D2E1F2707A407E3DD5BF9816368BC9 [email protected]
961,956,975 *644CBB2CF79ECF4DA8AC42B94818693999DE7515 c545221c
961,956,976 *6444EA022C2EF8EF6B0B1A6B940EB37271627D60 C5+4A
961,956,977 *6448A9A12D69DA7B392A7977DE4802F6B6671BDA C%54c
961,956,978 *644D06BEB21787C7AFAC01FDFF29B5A40838F41E C54cC
961,956,979 *64420DE5233EF040AB016D1E9448BBC057B00046 C54EV
961,956,980 *6444E7D9426A735B5FC68CEC1C5C69A59FFC6373 C54?Q
961,956,981 *644F59D051D15A60D7D13ACDBF04DBF45C6DE3DC C5)5)
961,956,982 *644A37020A59751C42888EF8372849E6856A5E78 C55,&
961,956,983 *6446DF1EB97927E7F8B38C1E4D6ADD1EB210643C c550a5d2
961,956,984 *644C1A51FB058BD092E8775C1D1ED303AA52E6E0 c55464614
961,956,985 *64493A3E8FE745439C3CF0BB673F755E10CA6B02 c55478
961,956,986 *644EF8F1587BCEF3A7875664C9464FF29BB86FD9 C5=6+
961,956,987 *644C151A4A1AA2678A102C4A23C4B6BD46AEE044 C56rB
961,956,988 *644D8C195CAEE7DB714DBB130573A5B1DE7ED25A c57411312
961,956,989 *644DA41AAE7ACAC425CE0060A49254EB9C270477 C5#7E
961,956,990 *644FE14B306507B4D5F5D446C03F654CC02F2276 C58";
961,956,991 *644EAEC49407153E34E98CB7B63964825403023C C58Ke
961,956,992 *644B442C87F748469A0702F6203B9512DACB2679 C&59B
961,956,993 *6447B93B3A34EAA6D5A64AD82F26D5B65FDD571B C59E:
961,956,994 *644859FD69B5B15EB0CA74ABA45AE0917EA6F98F C5_9M
961,956,995 *644E5B3F086D0D78A2C0A9120C2A3DADBA24B72F C59NU
961,956,996 *644F0492E6101647EED12377D6CB4F568A5EDCCD C59RL
961,956,997 *644937FC7176510D53D27E8F4C1E6BA54B542F9F C5,a/
961,956,998 *644F1E994D13363494C5E7DEFF29DD1B155E680A C5Ala
961,956,999 *64416C3581C4C3B567751D0EF99BEEA665196928 C5AU=
961,957,000 *644947DA375B263AD0C92CA4E2118DF2CF7A02EE C5bhs
961,957,001 *6445ADAD11CAF6B7012536729BBE8579408C601F C5b&n
961,957,002 *644C8183EBF8325534CE634CB8290FD17B1E794C C5BR,
961,957,003 *6446EDBAE699BB21941639F1CC3676A1D1862BE8 c5c1151226506
961,957,004 *64479AC0026FD719777A95B348A88A55C757EB9D C5ceQ
961,957,005 *6443BEE1DCEFCFB76A814E742643528DBCFB1B91 C5cj#
961,957,006 *644AA30538FCAD6AB3F3166DC9BE91917FE20848 C5CLF
961,957,007 *6446C99504C717B59E23ABA36DAE9D23EC6585F9 C5cNV
961,957,008 *644B66B3B7964ED4B583C06A0DB6AA04B72D2DA0 C5cP
961,957,009 *644574EC8BB662CBF6A447B9D3D86AA7F73161DB C%5#D
961,957,010 *64488033F2366DAAD1064EBA266F5120AA3F8595 C5?&d
961,957,011 *644983D66B670931F113487898A8FBA9FB6C3B03 C5DCu
961,957,012 *644C55CF58D3B1F13562B98FE79E8F31D486D2E4 C5"Df
961,957,013 *644E20C6DAE3609859EBFFA4EF0148AE8540190F C5dH8
961,957,014 *644A44D5D41A22F7A95C42139DAC6F23AF6DB80B C&5Du
961,957,015 *644D7FA37899037889E72D01463706520F0CDA30 C((5E
961,957,016 *64455B29AC1977E00CE3C7B84C6E7E377B975FEA C5EA$
961,957,017 *6444FB79BFB8F2F7E84B0E48A174DD3FF8AC1CBE C5;Ed
961,957,018 *644E8593DB4FDC877758E1AB37C0F175D2B315FD C5EFb
961,957,019 *644BE12C5AE7E7291D4E5CE79726820285DC5D47 C5erX
961,957,020 *64460A29E9260171B119DDE8C9A8D6F236A5D2AD C5ewS
961,957,021 *6448F807206973CB0D1B1E6986AF466016EB404D C5;_f
961,957,022 *6446E402A2974F9265020DB0D0D3595D84E32677 C5fgS
961,957,023 *644AAFAEB985245646998BC8742BFB32CCA47C07 C5fgs
961,957,024 *6446F0D1BDD84B9F8744A5F62A807845A6130F25 C5:Fh
961,957,025 *644ED76C990D3E32FA07FF9D4E87A5925031FA0B C5fiA
961,957,026 *6440D5E8375248D2D2301E096505EC036E227FF6 C5fkh
961,957,027 *644B2373FFEAF7E91EFFEFE34337B8107AB673F3 C/5fL
961,957,028 *644EA1E8DFA43C6D9509DE1AD9FEFDB2D2BC9A22 C=5FO
961,957,029 *6446FCD3F291E1664CCA02CEE366C5F633850649 C5"FS
961,957,030 *64439B6D1A673B3ED8AFE8B75D1331AD207F32CB C5FUN
961,957,031 *64423CBCA6B12F7555A287134EF3A722C06C0CED C5fXP
961,957,032 *6449282090C5E02D548C932ABEBE623E47520E86 C=5:G
961,957,033 *64443E3493EC80E716E806134E89D441F4AE580A C5=g,
961,957,034 *644C278EF92BD00C90D8274109249CF9B9370847 C5&g:
961,957,035 *644E244A7E611882F03D13A59F5191E87A45D037 C5g(:
961,957,036 *6448E90A91925FC1352674D90947F8F5874DF0B5 C5$g2
961,957,037 *644DCD4DE0E684546EECE1A5ED3C036B7AB0FF8D C5ghi
961,957,038 *6445DB74BCC40DCDF8745DB9E9DCF969B93DC038 C5Git
961,957,039 *644D1ECDFCE17DB17F2D455F452E87B600D2FBBF C5(GW
961,957,040 *644055F1946293B0EA8AF4787E27729CFFC3C54E C5h==
961,957,041 *644923B130F2CA49255434BC95B4ADD53217DC9B C5HLu
961,957,042 *644D27E5F006864A988819CEADB36FC4C401918D C5h(N
961,957,043 *64430F6C0361C707E4998C66C3CC54F6D7BE5296 C+5hQ
961,957,044 *644D4BD95AADED1B9A6A132847BEE5018DDD4A5D C
961,957,045 *644CA1C22865CF31BFB8B528DAB9AF8E22A290C5 C&+5I
961,957,046 *644B32523BD334D7379AB592D5DBE2DBFA4B1BAB C
961,957,047 *644B376F886E043D3579E83E48B088DC437C9BC9 C%?5i
961,957,048 *644C06369CC3440F2029FE08F2A0A32BB17579FD [email protected]
961,957,049 *64456E674CC0BA4C18D9F93882F954FC3C228205 c`5i
961,957,050 *644BCA9BB3264078F7FAD8AB1D5E36694ECC2510 C5I3U
961,957,051 *64427B24D2F0413211EC80C3019B22DBBF5B1C16 C5Ibs
961,957,052 *644BBD20E7C2C75DDBC7F488AD113BF5B8E2A6CD C5IC_
961,957,053 *644BA350D5EE6F2AC31B893056D77AA39B6F0588 C5?IL
961,957,054 *6447A39DA1D21E0C7D55C7A4C249923558F4B8F6 C5Il:
961,957,055 *64433C5567EB4C21FAFDB18CAD14C03FAF40721C C5iXn
961,957,056 *6441B1D519C5437479BE8625E05C8E094A363CEA C5jT)
961,957,057 *6448A9B3C13C60DBA2AA05D1A665E44AAC0E1365 C5jW&
961,957,058 *64461CF35CF676A30C10273FB1E54154BDB2E7CB C5kE=
961,957,059 *644F0E64180FFE4252AD2DC27038C7E58C1F12DE C5#l7
961,957,060 *64410BDAF63D0D2EF90A33D7D3EFA75AA81A0105 C5l_B
961,957,061 *64473E5752D9C2B97554204170F7FB6C0F266A82 C5LH/
961,957,062 *6447DEE02AA37F52FF64259E248ADFFF03624164 C5lM9
961,957,063 *6446C9E4A0E4A21190C9CEE28F878A7F80EDB0A1 C5MC!
961,957,064 *644FF3FE68F547EFFBBEA114CB203B8D59CF960B C5Ml+
961,957,065 *64408EBE1C8F1845DE91CC74EBC3134C9D27EF6B C5mQq
961,957,066 *6446AF04E352A331906D2382FBD1342257724D56 C5mrw
961,957,067 *6449E27D0F8232997DFFDEC87B2FFD91DF3E623D C,,5N
961,957,068 *644182D339EE809014753E41FC0009532ECE6571 C(5n3
961,957,069 *644A87C7FC4F4080CD6A5106F27DA834A54FF989 C,5n6
961,957,070 *64418D70134B050C7656867DEDB3AAA2CE70B06E C5Nh0
961,957,071 *644D61A0985217576C9DE89B1EB7CCBAFFD53711 C5nNQ
961,957,072 *644E2DE6555A11B2D8D13013C47BFD82D1A3F1AF C;5Nw
961,957,073 *64431E0D267E9CB9D0CC8DA06610AB4D2307E23C C\5O
961,957,074 *64434BCD6C1B0EF9D92C518D7B329AF05A5984A1 C&5O?
961,957,075 *64432EEEB6696849060D64B3AE2AB0BCBC6FA55C C5?O6
961,957,076 *644D07B7F7DC626CB57C2EAF56C6BFCA3E4C2079 C5o95
961,957,077 *644FDB4DFE9EE0A9C1CA7323C949D8CB14CE542D C5/pA
961,957,078 *6447864A339A14DCAEA461AA23D5FBDBAB42478E C5pI:
961,957,079 *644A6A96B1DE309C4594ACAD678AF6B59F56B9EA C5PmP
961,957,080 *644D62A0B61D9B4E71E606C96F53630585E299B8 C5-Po
961,957,081 *6441D848F9FB385555F5D8630B03AF4CA31D07B7 C5Ps"
961,957,082 *64423E9805B66B5FB9616DAAA4219D059AF7B6C4 C&5Pt
961,957,083 *644EA0B42986859F87856615E72BC8E8D4853C1E C5,Pv
961,957,084 *6441A59653BA276CABE3E799377A898F7475A5C2 C5Pw4
961,957,085 *644CE2ED1C5A069E0BD5D3263C9DED8AF009B1F7 C(5q/
961,957,086 *6442DC64BD9312F5AE288CA61B292537CC996DC3 C5;q#
961,957,087 *644E3D44B1DF874F022951E178CF6FCBE51A3885 C5.)q
961,957,088 *6441FD2EA9C17B67C0D257DDBE139C0480034903 C5Qm5
961,957,089 *6445D59646316CFEAF6E78EFF8A5538B302D2E0C C5QQD
961,957,090 *64438BE6B34873D6F4E3B33D5474C2F2DFA83D16 C:;5R
961,957,091 *6445BC4696B66454262CEEB452CAC185BAF391EB C5r$%
961,957,092 *644A64441422FBB2F949AB557EB4B49D66DEC715 C5r.C
961,957,093 *64416E4D0198592531B9341CF6404F7B5F6738BC C5rek
961,957,094 *644B97BFB46F5C69A3B72B3F37F84C19D10E65BA C?5rv
961,957,095 *64468C653A0B9811D09128D1CDF6E4187E400061 C5;s&
961,957,096 *64481956602802B5A221CFD1B7A26411F4E5790E C5S3g
961,957,097 *6449AF09312D4F8A9EDB73C14ED526AE08AB85C3 C5)sh
961,957,098 *644C71A4B398807F3A94382F4AE699A503104159 C=5T
961,957,099 *644DFC69C25A82A8329C274CB71E026722403F87 C5t:%
961,957,100 *64402877B98BBF904DF4253E46D3BA9DCB3E3EE8 C5TQNWYF9N26NLN
961,957,101 *6443288DC29FA0CB9FF0F62CFAC1B9B60CDC2E8C C)5"U
961,957,102 *644294A4BA1B4719BAF2B9AF3846E35688BE3CDC C
961,957,103 *64472F4685A577F809363C1BE3AC6A2F66DDA6DD C5?U-
961,957,104 *644A12B3C3718DEC7076387A97983715F08E2A4B c5uh
961,957,105 *644DF8A09117F53DC1AF4BFF064DA6EC155F5F93 C5U?r
961,957,106 *6449E4D35EC26FF2843042D231DA0A8B2B8DE46C C5UTi
961,957,107 *64432628D7721F5D889814B1F9ECF805FE0A0894 C5UW_
961,957,108 *64423A65FFCC9178B6AAE6C7B25A1485C0545505 C(5"V
961,957,109 *6444DF28D45D59F9A939EC61C437B57CA991B246 C5v0f
961,957,110 *6448CF3CF681E7A56AAF2D668A0D48E04BC783A3 C$5v6
961,957,111 *644B537C9B8F5CDE5D70F5F064244882512E469F C5v#7
961,957,112 *6448323574E1589A017042760BDCBCDC1D4C1004 C5V9&
961,957,113 *644E910269E03B907C70F745C17A47135D55588E C5V;F
961,957,114 *6446509D2DB40F55B1CCEC54221C044ADA62FF78 C5V:F
961,957,115 *6441534BEEDEC59C6AFCDBD8212E29811FFD03FE C5VLi
961,957,116 *64474AA12FD36D138560D6B0768C19300C781EAF C(5Vs
961,957,117 *644FD60BFEE6D86500499F8D37C5270752E36A2A C5vwb
961,957,118 *644B8215961DAA27147CEAB96C7AA2B57CD1F4D9 C#"5W
961,957,119 *64469DFAE6FE8D38C2479FE9306225B0EDD0E15F C5WdX
961,957,120 *6441D21CFAD4054D012D4F4EBD8AFA82DBA93520 C5wI8
961,957,121 *644363EF3AE10A2D4EA4304B2F54F54CD8809B25 C5WMG
961,957,122 *644F000FBBE1BF24A812EC11DC9C30BF76CDF98D C5ws=
961,957,123 *6440B5A0F43DE1A7F81063C1C4C85CCB7486A566 C5wwt
961,957,124 *64499F2A6025375A2E7A3F78CBC94F682572212E C5_Y)
961,957,125 *6443C5C86AD7B5CBC32D66AA5EB4CE7CF4095512 C5,YB
961,957,126 *644E0FE491B077B56967DE354BECDFCB7A6CFD27 C5Z0H
961,957,127 *64400597B0957149E6C0DD9FFF2874ABEED32515 C5ZhD
961,957,128 *644E0B89CCC0EC382C1FF79F2BA647D8DBC46BF9 C5?Zi
961,957,129 *644CDA50C7EC50D4D7800E79197C3D5637BB75B2 C_:6
961,957,130 *64493C5F486859445AB2541DCC55B8D2A985EBE3 C_
961,957,131 *6447912F151C4A4BE5BF70483CAD14F99F72E403 C-_%6
961,957,132 *6445D892C785911083C10A27A411CA81319462F8 C-6
961,957,133 *6446C1B1FD4EE4AD13A322CC4E0D04B6147DB620 C/6!-
961,957,134 *6448E78D093F4AACE8B3603BA703D4FF44B0BFBF C."!6
961,957,135 *6441C06F585712C0E1668591B460157452EA71D9 C".;6
961,957,136 *6445402C6D8A5FAEA129B5ABACBD2C6EC90EFC83 C$=6
961,957,137 *64412AC62FE9DBA270AE7195EA27276A41126EE4 C$(6
961,957,138 *644D58CF26B6DDD20E7AC055AD7A8399564D16CA C&="6
961,957,139 *644F5C1426B605FEC57139CBBDBECABC6CB59B78 C6,,
961,957,140 *644C5C4CDBC6E6C1088F92177F7AA95B109C21AD C6?/;
961,957,141 *6446F80F5D285B6BE1BE54D9CECC1D6C11D0395E C6/:+
961,957,142 *64402B48FFD7438401D757263E5A23C60D39E1D3 C6%,
961,957,143 *644CE2352860F777664A4CB206D6B947EEDC30A0 ^c6$
961,957,144 *644A470FFDC353B725A52143C152B1AC714DCC52 c6\,
961,957,145 *6445537D496D5DD3D2E3705DBB0A3282DCCD80E0 C6.0V
961,957,146 *6446D681FE6EDF40D036A68A15FE161F8DC638EF C6-_1
961,957,147 *6447D5E480CADC6CE6F828446A761A8A01EC2329 C6
961,957,148 *644A169C8A50D48084E5D808E258A4F3D023BCD1 C&610
961,957,149 *644035650056C6CBA490668C483A6182BD3A922F C61!B
961,957,150 *6442DD5DBC4ABF51B51E84EC1D264936A9E7D434 C-6(2
961,957,151 *644DAC3EEAFB97FD7F5E0ED3776246DB3BA397C6 C/?62
961,957,152 *64434B82620C61012F5D3DAA01054F883EE7A890 C$62
961,957,153 *644DC25903F4B6DFD2A3E780FEA3486851327B15 c6274695c1
961,957,154 *644EADC6DC9BDBACBEA981C5511A366F7AA5FF29 C62hh
961,957,155 *644B6C57F1AA89ABF0D3872883BB19D5E5E5F92E C6&2s
961,957,156 *644695F5E7BCED9DB9997BB547346DFE1AE230B2 C62Ut
961,957,157 *644FED4B841DDBAAB4CE855AD15945600EC082FA c634dd9d-7642-3077-9c23-046666a9fc02
961,957,158 *64480671E5CF469D029BBDBE841355B4282EA8C1 C646Q
961,957,159 *64408A17971E59439BC105DEA0DE0F1577DA15C0 C6
961,957,160 *644A97DB8118C95DFB19D408AE4064E4787B85AA c64: back in time, volume 1
961,957,161 *6442B727A137A5FCB7BD93B2E63868B62B44235E C64K#
961,957,162 *644A3D23B383C1E1477B25454EE45B03F386F696 C6,5(
961,957,163 *6441902CF1F6EB6AEF00831CD83EAA2226DF711B C6/%5
961,957,164 *6443C51998A488D9A12A0E6C69B9974B192964C3 C65>
961,957,165 *644FD3362989111833A3E7AE645E661749EA53DB c651ab37
961,957,166 *644B8307B2C140F9ECA7DE8C9D30A1BA7F1E1534 C65ab
961,957,167 *644BE906EE403D3A9ADB2DF2E2FD02BC03CE3251 c66775
961,957,168 *644809A89C296BCFDE6DB78C7256B531EC7EBA86 C66e?
961,957,169 *6447571B195523F80918BF6BA2797CC605CD76DA C66Yn
961,957,170 *644CBF930714C301DC710C354F1BB70339D3193C C66"Z
961,957,171 *6441BCAA7E1DD00DB5B914D5FB1E74B4906A720D C#6?7
961,957,172 *644E4A09DFA008152A959ACFFC35FAD3DB5BFCAE C
961,957,173 *6448B74463D45BBA099C29C106DE9641AAC56631 c678e197-4662-34c9-b9c4-70cc534a643a
961,957,174 *6443A5E16FCBF06A4FAC7990697FD1888039753E C68A:
961,957,175 *644A5667C8035F0227D2991337A97D7ACCEEE0C7 C68Il
961,957,176 *644D2C063DFEF614583406DABB9127D3239BC322 C68q/
961,957,177 *64458EF504D40D4B499AC0A2165CBD7565B2E9E8 C68rN
961,957,178 *6446778D2953374C0176B087C0A085DA87A8F145 c692651d8a
961,957,179 *6443F499F0E368E39D7FE634A051D4DDDD2E61E0 C69?Z
961,957,180 *6441755481EF7D0215176F20B6023FDE4FA20D95 C6!=A
961,957,181 *64450D630AEB5F3F6767E75E17F18BC7CC2CDA10 C+6+a
961,957,182 *64432096DD00065F6E7118DF5F0903E6066B9688 C6aaE
961,957,183 *6440638813FDC89A4A9D5A3120743B6C7CDE2C6F C6A-B
961,957,184 *644A134B7D7E879A607178ACC573B6502F20F0F4 C6AKc
961,957,185 *6445778E4799722F2754193C5A41467BE76966BF C-6B_
961,957,186 *64480AB801A39BA55529DA4E823853756B547B27 C_6b!
961,957,187 *644B734700D22FD260BA8ED71D347459A204B371 C"6B3
961,957,188 *644C5815D30F4634FF5E40386D53C9DDADF01982 C6Cj.
961,957,189 *644CD65318478D9476674635172E7DCD2ECAF5EE C6!cq
961,957,190 *64469809B92CA38FC7BD4E60EE369C1385665E1A C6?CW
961,957,191 *6449DF9A6616695B615A3AD883E1F1E72EC6CBAD C,6cY
961,957,192 *6443579016EFD153DD7CC152F4A2474D8ADE152D c6dc094e-a4d5-3a3b-9cd9-ea439c015535
961,957,193 *6449C5DEB90E94B0C279D71CBD265463E90A2CC7 C_6dF
961,957,194 *644EAB41E3FAB00190E6B3F394534F9C442CD55B C6d(i
961,957,195 *644B2B24C49F06C80301570A10CB3E8D2F312A2F C6dR9
961,957,196 *644DE85C5A947213A67CBAA92F68F455EA129941 C6d+S
961,957,197 *644BFAFFA860C365FF593B7621AA97346E12D16C C6DsP
961,957,198 *644E3EBCF28CE93259969EA496E84D1A13F1904D C6#dU
961,957,199 *6441DEDBBA28AD0F3573B06D48D7B649C738DF5C C6.E.
961,957,200 *644740CE23ACB70CFEB5B4EECA95AC8A4A88EF1D C%6e,
961,957,201 *6443E9641F7010B18585ED077C46E01C1FA59AB7 C6eaU
961,957,202 *644922024B260240FAED289211D80AE2A98F8A0A C6Eke
961,957,203 *644952E677A6156A5E74E4390CA6BF1A5BB85869 C6EkL
961,957,204 *644CD2447DCB17FC5B9ACBC5DE4AFC6671FCEABC C6emq
961,957,205 *644E6F88275A59C3835881FBC8939058FB885EBB C6e?r
961,957,206 *6441416DB404C4D4EE3E3072443E3495177EE604 C6Eue
961,957,207 *644FBC502D736111A68C2CCF7D397E2E29E1CA9E C6+eW
961,957,208 *644936BC622097A04FAC33C679EBACDBF00E352B C6EYi
961,957,209 *64416E4DB8AEBB5DBDFB56937C66F89427F1DDFF C6#f)
961,957,210 *6444E9006310D43E6F23453C44458B48D514AEAE C6f6Y
961,957,211 *644CB935AA51CC2B5E0C962D4772A47677864AAD C6)fb
961,957,212 *644E0A7B73C005DCA857260971D94D943BDB4773 C6G1(
961,957,213 *644F6EC3A2201454DA587161D90263570A49F284 C%6gr
961,957,214 *6443F910A9C468C7A975BED94DB3501A9FF370FD C6gX#
961,957,215 *6446588281A6A7B499D719D74FC246DD0129FF94 C6H+G
961,957,216 *6449DB7CABF1235EFCAC2C60E4194D79FB9CA626 C6hIP
961,957,217 *6441D98009DD76E45FF7EB101CB9582B5658EC3C C6hRH
961,957,218 *644A6E475C564023B088062E37898176CF838D08 C6-i"
961,957,219 *644E6D5611D3BACF7CC13690785186A28219AC59 C6iag
961,957,220 *644BB163E941094145D469150964E289A0DA1578 C6ikq
961,957,221 *644B432E7A701460710243ADBCDB2F6E1BBE78ED C6IRo
961,957,222 *644F09A31C61A0DE999E4A9B62F6D38A42AB228E C:6j)
961,957,223 *6445F55321DF226666601063ABCB0E333B214476 C6jDg
961,957,224 *6447B0CE3E6F4152AD4261D96919B9ED1C4884D2 C
961,957,225 *6441F5BA05F9345FF6BA85DCA774A911DB0A1CC6 C6jqg
961,957,226 *644F3BC618309237F51DCD094CDC7CB72AD4C8A6 C6k!j
961,957,227 *6446741669E12C5E34616EF08E559927A7347035 C6KN_
961,957,228 *644594DB3EFA766E717D0D781D2A3F5405E597D1 C6ksR
961,957,229 *644EB66A8FC543C2FD2F990468EDD85209350097 C6(!l
961,957,230 *644E7FA8CA4F54103DE90DAAD74136CFADC6AB98 C6LgN
961,957,231 *64470A1BB7BC305E7088260928728523A9FCB6DA C&6Lk
961,957,232 *644C5331F650D18D7FB3EB25ED6F5F69C7E95D42 C6$ll
961,957,233 *6445351521E358400B42952C3C25FE2F0AD10AFD C6Lqm
961,957,234 *644C2B7332F549311FC30C15036B6B4B1AB50245 C6MT&
961,957,235 *644732BBC43FC9F2188352AFEE727E1636A4FEC9 C6,Mu
961,957,236 *6440FC505A1754CA93A0CC9E0D503F0BD33762CD C6mwW
961,957,237 *644082C23D6421BF77208C540B96CF47C4C87F89 C!6n2
961,957,238 *644AE33A89CD59923F225B3BDB00AF090491BDBB C6/Nc
961,957,239 *644C06A24E10715A3CD39AFEDE4940F06837D9D7 C6Nel
961,957,240 *644B3EC756495E6030FC7911A3550D44230907C8 C6"nj
961,957,241 *644E0EBA43DECA7E78B40A59B76AC72920F62A21 C6NN6
961,957,242 *644081AD098D4D2FF1BEC4B5E8416C20FA41EFD9 C:6;O
961,957,243 *6448CD7B43DC5B1FA26266A82F426450C69606AC C6O(3
961,957,244 *644EE54373D775023611FC077CF841B56AE201FF C6O3$
961,957,245 *64425DB1D2B41A62534548A2A8AAB0706D4E4A13 C6odv
961,957,246 *6448BA33D9D506622EBDF167D51DA97E537DAC48 C6Otf
961,957,247 *64469B0432118EBD1C7E109F37F09131E89AACCD C6OUZ
961,957,248 *644FD5BEEA39E627036F2458A989373EEA87E163 C6OX-
961,957,249 *644DA558C0BFB600F58629D2CD28D41495381856 C(6P,
961,957,250 *644B1A2B01422140CA87B327C51E02D5E6188262 C6pGK
961,957,251 *6442FD6053D993DF187EF5B25CC1E36CF8171361 C6P.H
961,957,252 *644EB0A9C34FD3D33BCEB7B97FB7206162BBF7DC C6ppj
961,957,253 *6442609AC80E4BB031D8C3270216AA7D38F7E35F C6pti
961,957,254 *6445AA13BA725635D26B32729103B3B0AEA62442 C6Q.e
961,957,255 *64407A92C4F468019A962D6CD7698028B7BFAC91 C6qHd
961,957,256 *6445C84B2196E06C12404E5D552F502C186CD4FA C6qhU
961,957,257 *644957D47C8115E5B268CF5624C6A70A929B5675 C6q?V
961,957,258 *644B9489194560E4911CE8C1FF08C9834CB0625B C!6QW
961,957,259 *644DE544278E48D8B9FFDD705D46635937CF1AFF %C6&R
961,957,260 *6442C913F9E78BF2704FC000E489E85314887755 C;-6R
961,957,261 *6441A7CB79D85DD12F2254006D695226F56D578F C#6r/
961,957,262 *64409B8181251E5F6600EF3C10DF49BAC95920CF C6RjK
961,957,263 *6448BE9650D0C28049D247B177D488FDD28E5128 C6r"K
961,957,264 *644AE6515FCB15BA841DE1A98E48942B55BDA3D5 C6rnp
961,957,265 *6448B1F3CF0E5525E62EED5071F4F119F9F22F72 C6-S:
961,957,266 *64447650089E0A5F1902C3D96475A7D3E47CFA68 C6T-7
961,957,267 *64463BC4E12537834DD6678636563B94F33B94B3 C6
961,957,268 *644FF23CED31E62F5616AA55D74B2C8D8BF2B0C3 C&6ta
961,957,269 *644A7113256F4F74BAA5CE400F34DFDDDB7697E8 c6tbfo45
961,957,270 *644F6EAD638F04A28E0B332D6F6027CF0F1F7B4E C6T(K
961,957,271 *6440AFD831E0CFA6E04A480719C5A903C44365CD C6t&k
961,957,272 *644D17C5C87433572DADD485D676045B4CE0329C C6twK
961,957,273 *6445BB8B4C6E89EFE98961397527ECD750190E19 C6U;;
961,957,274 *644C5AEFE9054668DE7EF4C809A10DFB3F3CA4F0 C6,U7
961,957,275 *644BB8D85A29E42B0660E7B4CBA340B0B990826C C,6uj
961,957,276 *6449F05CEAB18E9869BD5780D4F94C73B8B15E5B C6UVw
961,957,277 *64491DAA9B3BD1D592C813FA99AFF7A1EF943F5A C6(V=
961,957,278 *644F5701F922907E5554352D98BBE8DD8F9EB656 C6$Vj
961,957,279 *644A9B2DB22385853A1C6F2ED33D1A3FC3638142 C6V(Q
961,957,280 *644EE062EAD4FA1078DD829C9B04BDBDEAEE1CC4 C6v_v
961,957,281 *64451D5CC1274A8F61F9807FC96A1760B470E5A9 C6vVZ
961,957,282 *644DF84663D4A7B783808AB48AB71D76E92DC983 C!%6W
961,957,283 *644E9F062288AE0D0EEC1A6F368806683C0585F4 C
961,957,284 *644AFAA24F4D2C99CA28F38239F99A3D268FF8F5 C6)w9
961,957,285 *644E80EE30F17140E9F5CBA544F32310FB492BF4 C6+wB
961,957,286 *644039B60B5999117B8489C235713127BE678A1E C6WBm
961,957,287 *6441F4E09B5494E4872FE5A1B346849712E168DC C6#Wk
961,957,288 *6447F27206DF787372E23831E8B5FB3A786260F6 C6wT?
961,957,289 *6449218A7435A93591CCE4615067851088F17CD6 C6WVg
961,957,290 *6442AB01C9B42546126B5A802EFEF557907E31BC C6wZ2
961,957,291 *644B707C6E32F8F57C45C23F4A160C4A580FB3CC C6Xm
961,957,292 *644FFA4E948D0D0278830F5E9E2902C7AAE2FB81 C6Z-e
961,957,293 *644A26797C6729D73DBEAB5EA8A6A1FFB634F823 C6Z!l
961,957,294 *644CB9EDD0BB4AE966BB1CC590A41BA2222A4814 C/7$"
961,957,295 *6442AB5FD9FE178C23AEA8D9C83A3EEBEED37D0E C((=7
961,957,296 *644F5147B577DD35F49A7A619E606F59E58509A0 C(7_.
961,957,297 *64471F00182609C8020B1F4A638748ECC7401785 C#7
961,957,298 *64466D6B5E58B61A0D632E408898C5D1446A93AB C7;?"
961,957,299 *644CCBEE5CA7EBB92175C88AB7C452C4238C46A7 C7'^
961,957,300 *644FC84165F4435843B16A659C45657288C584D0 C70"!
961,957,301 *64487A8967E818982D7439B6F915985741BD8D3E C70{
961,957,302 *6445AA6904D70436D7479BFBC860321B859E88CC C700496
961,957,303 *6444D09B3EBE8194677D1488E611F568D1800B20 C70D+
961,957,304 *6441A3EC451288A1BB6DB17E2E6A9C1F4CAC3718 C711&
961,957,305 *644FA12B9063A5914336B744106C1E628CCA8E3A C%71X
961,957,306 *64478562DA07CD0E5FFFA2B7B5A3919CADE9A33C C(
961,957,307 *6441816CBBC8BC605DF939D623B7DDF510983B0A C7##2
961,957,308 *6440763B9747D6F30C2BF471ADF80982C23D9079 C72Gf
961,957,309 *644BDE66B2FFA8E90688D4D82E491A56C1F66373 C72.n
961,957,310 *64400F123A3104FB0BC6BF8EFF9F30B965971789 [email protected]!Z3R$
961,957,311 *64427A891BC441E6EBDBD8ECFF6803ACEB9E88B0 c73n01d31
961,957,312 *644DF9447F55A7140D18FF1CE054DF337BCEE635 [email protected]@ul!n9
961,957,313 *6441D33B9D86FBBC18E11A5AF21D42148B9DB396 C74(;
961,957,314 *64476FB38BAB9DE85B26B770A9D62AE415769E4C C74Cd
961,957,315 *6445F7D1829E15D7F7B54FFDD300A6EA30815A9A C74Op
961,957,316 *6445B2F58FF8776E6A16010C3711658C3BF629C9 C75p;
961,957,317 *64498D688EE766705DBC590B0EDB5A63FAA1D160 C75#r
961,957,318 *644F6B56272B07B8569B13838A37DADB7D92C279 C75u7
961,957,319 *6447B1AFBC158763DB4716F839DA7782FAD0C824 C
961,957,320 *6448BBA8EC6C12D72EEF18C8D9F7A0D192FC43D2 C76Bi
961,957,321 *644D9B8EB3B6DCC7471C0EC8D511DD4C7547A208 C778U
961,957,322 *644D0A076033D0EA30DD6C8764DB746329DC92AE C77oB
961,957,323 *644EC44A857BEB0E96D6E234212E79F96B888F7A C77sV
961,957,324 *644B558A808BA7A8AA53D21A511750A9937FCD74 c78d748da361ca05d161fa3c03526996
961,957,325 *644553260BF1F17CCB1CB4182F1B3BED5F401A1D C(78H
961,957,326 *644919280465E82C6D3DA7BC101CBEB57452D9FD C78
961,957,327 *644DF98F8DDB0D8D3FD0206E7D11A61E35244419 C7$#9
961,957,328 *6440023BF8508040E0A63ED847128BD3BB9FFA4D C79cm
961,957,329 *6441591E29FDE871F61154E2C00AB7B569EEAF9A C!79S
961,957,330 *644E21E23E4FB9DDD0473A05F994588BE19817A7 C&7&A
961,957,331 *64436E16B2A75548477991D5245F50DB2DA5535A C7a&
961,957,332 *644628F0AA8ED2D2D7EA3BC6376DA92DA4EE95F0 C7/ae
961,957,333 *6447AA7A2F0F2302003A6EFCC03047DD483E580D C7=(b
961,957,334 *644BE2E1A37ADD48EAB6B586C0ED975EAE00DFB8 C7$
961,957,335 *644203D10DE60F9F2E788183D14388789E13C4F9 C;7b2
961,957,336 *6448C9B2811D09085DBD170D46BAA17AB41A95BA C7b7r
961,957,337 *644F2B81E45ACE60DAAE8A229EF64C4C1B2AF64E C&7bF
961,957,338 *6445343A7A9823864B6DCB8A603F3D707715A291 C7BnG
961,957,339 *64451C667AC9EF78BB0553BC894A29B1BF3646C8 C7Bq&
961,957,340 *6448248D5730EBB5674FCE50BA3E67CB037D937D C7b_q
961,957,341 *64434BFA74849429FA1BF88B4AD3557376E4425B C7buu
961,957,342 *6442924D9740A5D043CC784AD437627558100E95 C7.BX
961,957,343 *64409EF9E7C74613850298DED6783C8CA402AFB1 C7bXc
961,957,344 *644851669A40AAF9D0B4EC6B5D73CABF5E9D0D4F C
961,957,345 *644221B9EDCFB826EA67320FD70E2DA855C903CA C7c3$
961,957,346 *6448327A64113197451ABC7E186EF2BB771F2931 C7Cb+
961,957,347 *6443F2101B747103401A4400D1F9857FFC0E6787 C"7cI
961,957,348 *64462345EA26B4B78E5D1A6B2778123EC451AF58 C7Cnw
961,957,349 *6448505B82DB67A53951C4A80B575CF1A969B7F4 C7COg
961,957,350 *64459A5CCF5C0178945B01831F6FC06E71FCDA61 C7-Ct
961,957,351 *6448B46F0C3D313898093D205F2E6D90372DC1F6 C7_CV
961,957,352 *644989DE2C158B3508EE4AB5FDBAA7859D8560C1 C7D3:
961,957,353 *6444C90D5FA115202C1A6DCDCEDDA87AF44AF1AF C7dF;
961,957,354 *64456D5306DA3B87270ACA1B67D9F3818EB58212 C7dI-
961,957,355 *64402F4320C77681BD308E1CFCB8E3BF0525C2B4 C/7dP
961,957,356 *6447BDA34B74A8663E373585C64895966CBF42AF C7dSA
961,957,357 *6444D3629DD3CD61FC5DEA324CE99C0DC137DACA C7DZ.
961,957,358 *644CD501891C0EE09C01AA50AD33E06888DD80FD C7E?(
961,957,359 *644526B20F1CF10371A6DBD94AFAE4A04CE7A8A2 C7E%,
961,957,360 *644CBF9C80CB40945C951F1A925EF4FB21E2273C C_7e_
961,957,361 *644A455BC9BDAA6C92565B26DA4F88A1B393E3A3 C7;(e
961,957,362 *644621EA4A0FF44056DF162D0A613F769D9B2B3E C7e-!
961,957,363 *6445164D15C037CD856B585CD793894EC9CBB97C C7e/5
961,957,364 *644DCA16E77903FF0D60F4A445C92EE1338DA5BE C7e6I
961,957,365 *64407A07E824825E28C631A8F56E89D80A4E9EBB C7eDL
961,957,366 *644208CFC7E23A8C03C86BED1FC359E22B07DCFC C7et0
961,957,367 *644A24EF2551E0FBEFADE11A5E4FDCEF31CA33A9 C7etO
961,957,368 *64489A63EA1E6E4E61D3C55D14ACD972095BCF03 C7eW"
961,957,369 *644F66076DB456F71E2F2B5247AEF84A6CF12C50 C7flD
961,957,370 *644A1DDC1A378B65571303F1D7109E3395CF39C5 C7"Fw
961,957,371 *6440B015F63B44ADE17C313FC7CB392470BE0ED9 C7G$?
961,957,372 *644DD014D5B22E5E3F65729ECBE6955BE3E4B333 C.7g.
961,957,373 *6441AF49A1E765CB5ECBFEAB112955A71143167B C7g-5
961,957,374 *644D20919689E8ED5622886B62F45316FE43EFD7 C7Gc$
961,957,375 *644E578334ACE9EBAB9C704EF875BDBF7081E288 C7g%l
961,957,376 *6441CFD89E084CA9A49031882EB5C7B6761BD419 C7g=u
961,957,377 *644D577F9B90EBF7C6AED936FC892785CD39949F C7gZq
961,957,378 *644297A7BE3CF005D3D3CE0BEBAA69F536807079 C7H7$
961,957,379 *64417F7AC88794653A2A43C909D235A8A52AD37F C_7hE
961,957,380 *644E69BB7076FBDF8417FB2FA4613D48E85E41B9 C7hSG
961,957,381 *6446D18A3B142AA7F6F7D1E43DCC232BB981874D C7Huw
961,957,382 *644E4FF4523434BF21D2394C6BA3D589553E9162 C7
961,957,383 *6447888534F6EB5DADB399A12821BDBF206D2001 C7hWq
961,957,384 *644E5E1ED2E62568D157E3404B7D84427F236988 C/7
961,957,385 *644146EAB81DC0487395BD4E7DA97B3E000057F0 C?;7i
961,957,386 *64487995691DED893A69BBEF33B6A697C9FACA3F C7i?;
961,957,387 *644F25194B0F4994F4A47BD6FD4311A7DB5220DC C7I"b
961,957,388 *644E3EEED812F2C8DA75F0F733FCFBF6A202C5AC C%7iO
961,957,389 *6449FE52535AB2610FBBE1DBE7FCD7579BFB2D2E C,;7j
961,957,390 *644EB20578C6A9BDB40D34699BFF07745460146F C7j0(
961,957,391 *6445EBEC79DA4E7E56260E4D81E09E75E27D82C0 C(7jC
961,957,392 *644A9E6733750B6FD57493060C56B72A1F56A3B4 C7jD;
961,957,393 *644C549B8BB4B6A62BF40DD563C96AC2C45029C2 c7jE
961,957,394 *644B61E335CBB3568BA5C8246D1B720BCE14C470 C7K;&
961,957,395 *6441ED29F21EC44A1078D99130AB31FF0CAC0035 C7K4q
961,957,396 *64411F8C2D8E3E58A9600F33E841BBF4BD3002A5 C_7KD
961,957,397 *64464261BE4C45C6BFABDA2D24EA9D31A0659A50 C7?kI
961,957,398 *6446372FA650B852576748FA89FA87EF40AA2672 C$7Ks
961,957,399 *6444C03451DA78827072BAE202374D30C295D1F6 C7ks;
961,957,400 *644AAC50BDEB4F2AD14865C01A25B6FF1B206911 C7kt(
961,957,401 *64420C8E6BDA674740A95E5CEE9A8FD7BC4D3496 C7#KW
961,957,402 *6443518937D6AF6A5A6DEC978AF0032825E8B609 C)7L+
961,957,403 *644B7D1D7D93749CBE688D27BE548F73416238F2 C7.L4
961,957,404 *644DB93D9C1F62E58EB9DEAA6CDE1E756732D018 C7lXw
961,957,405 *644F1AFB46338332DA141660772AB6147B0CFB81 C7M5A
961,957,406 *644B2F7BB239BD7952A0987207AEF54409760CA3 C7!N%
961,957,407 *644DCB8599933CA136C717EBC4BA678080265857 C7Ng_
961,957,408 *64422BEB4B374E2F574E5892A75B57B57752BB20 C)7No
961,957,409 *644CEB9A9B75DFCD8FEC7C0BAC33E4485D2A39B5 C_7OF
961,957,410 *644FC060CC9F02AFCA7B0591B544B353C1B5D53B C7OHP
961,957,411 *644D606E61B3B32101CFD28D9D675BC55384BF5D C7oKH
961,957,412 *6445868C2D6363AE6B96E208C09CBBDC8EDA9A8F C7o
961,957,413 *6442133D792068804A34B2E5815CDD55668F9052 C.7p;
961,957,414 *644B7D30F8C7AA7C4A0CE8CD0FC0F5E9AA1F8C7B C)7p=
961,957,415 *644E621FCD99D70D22324D82EE27C32FD7656169 C7/
961,957,416 *64426449AD8E16B6E5CE7858784A69BD79F545B8 C7.=q
961,957,417 *6444C264BFF1C415DB4A86447917CE3B7B0BC0AF C=7QC
961,957,418 *644E54F62366B35115F8CDE6B71C6EC6B9514C53 C.7qd
961,957,419 *6443F733DEF25368CBE588E5576FD80E27865737 C7QG/
961,957,420 *644C08E373051FFE0A6E5F8537D6B38C37037F27 C7q+j
961,957,421 *6445536EC085FDE19AD55F99612FC33ABBAE9692 C&7qV
961,957,422 *644F975E1818D1E8028FBD1E53AF11889F58F91B C
961,957,423 *64404BC0E7F4DFD32175ADC2B319D8321A3B52E2 C7r0D
961,957,424 *64472C7EEBF69024AC5D4588FB25E182792956CB C7rEj
961,957,425 *64424DD3C60BFD454B0FF4DF681027D0CB7D695E C7r?r
961,957,426 *64430DFBC7C3E8A0B1E745DA6A6D965A68B4A7C8 C7S2j
961,957,427 *64448A8D94E2400EDE8126890893A0C2BD8A126B C&7Sq
961,957,428 *644D43F6BD224FB0BAE4EB02AFEDAA7D597BC30C C7S$t
961,957,429 *6441DF9C999D55E09DFF96BEA5C448F28AF1497B C7t!0
961,957,430 *644FADDCFB66C0D8EDE78A32075D79ACCA51B765 C7tC
961,957,431 *644B9EB4D53C76B0B7C69B4E2CA1F6A15375507F C7TfV
961,957,432 *644B5412ECB448C5B406E8D0CDB7A0FD70536281 C7UK,
961,957,433 *6443F216AEAA687CB8CFDBF0E9766522B5011661 C7un3
961,957,434 *644DC5A3EB229F7AF6BC087C822F49CF610BDAD9 C!7V-
961,957,435 *6445CF6677273D7FE27F7684DB66B8C608DD6A13 C7v.9
961,957,436 *6447C892412C26EBDEDBF104B7723C555DFAA3C9 C7:vA
961,957,437 *644F9A18963BAD0BF34D2989C5083448004B99AD C7V)b
961,957,438 *644BD8C745356BFBE864F26875F47BE7158A856E C7VDA
961,957,439 *6442A8039A3D37EE5ADB9BE595C8201752ABAD02 C$7vE
961,957,440 *644123F64E396B40A78437FC7A90D1C0B243D5BF C?7Vt
961,957,441 *64402F4DF625D1A7AC8561030EC85127A34F6914 C7"w)
961,957,442 *64426DAF79A1CD50D0883F2619885092A5944716 C7wAK
961,957,443 *64498205F351A6AD6ADA9FA3D94654C65E24F3BB C7weV
961,957,444 *64414467E193F3C717F6BCCFF7A3363FD23A22F2 C$7WR
961,957,445 *64460EBED512F38A5FCA149F7BA2F95A91A052E0 c^7X
961,957,446 *644377A2993A48DD563937435CADDF6DA8F9A2C8 C7XkW
961,957,447 *6440991A223C84C5C560A158FDCEA61200A9D958 C7(Y%
961,957,448 *644ABAF47B6CC7CB2A3A6056D140E9539CB893F3 C7
961,957,449 *644F261EDF2F14E3FA122BAE004C233F077EDE2D C7Zl%
961,957,450 *644EA10E2802B505032E114E1B561B47F6AD3D07 C7ZNP
961,957,451 *644BCDE68F2A232B44C8962E86D8F0BB97BE5EFB c7zv7wex
961,957,452 *644DB3E1F6DBE6C6ECEC124AF56E7594FBCC0396 C_8!-
961,957,453 *644CC1B3EC9718BA9D63EE5122203C10B867547F C\+8
961,957,454 *6441CF9EBD9473E4BD19EEB1B2D2CAB8B011F970 C#.8)
961,957,455 *6443ED2095E166AFE5D8DEEF264A4E3FC12C9626 C#&,8
961,957,456 *644DDCE028EEC71D56E3771B2875E771DCD233D3 C80:#
961,957,457 *6444D59B6F2D7CD3B6EBF54C46EFC698251C3717 C80pK
961,957,458 *644AAE4F01407B6F5975E95E2EBCFBBB93134990 C#=81
961,957,459 *644A46A70C9279FFBCBFBD5FD7473EBF08E98251 [email protected]@M$
961,957,460 *6448138415DE2D49A01F99158D728CBD64FDF0F9 [email protected]@1!57
961,957,461 *6443C94933C601959A491FFADBBFFBC37B6D0206 C81CG
961,957,462 *644D1FB6BDAA334EBB03F4BA47E4AA4BD6EC6A1A C81Eu
961,957,463 *64456A5C0D096405316545348EB88125268C1C8A C81H3
961,957,464 *6449DE82953FD2EC6CA0B92173EAC1A909055ABF C81M)
961,957,465 *64492DFEF863B53931D20189846F1DF974BEED19 C8-1R
961,957,466 *644AE7EE9A14D6BE4A1C16FC0D73D9F8467E2BE0 C8/1S
961,957,467 *644484FBD47B4F64D076835648103D554FF0FAB7 C81t1
961,957,468 *644848EF05B7AD1B0565DB2E77C7146EE2B15C7B [email protected]
961,957,469 *644AD7CB4C1167962EB96CDC7E035664233A5874 C821(
961,957,470 *644C1D1C2E272F1271C5AE3ADABC11E3FEAFC218 c82416
961,957,471 *64445E9E26F2C719057D73C194A91EEA376EBA10 c83495
961,957,472 *644168EE7350CD4069E4FB1D15BC633AC28108D7 C83bO
961,957,473 *6442FF1C81F9BA6EDC4AD3A6BEB59B12B556AF4F C83E.
961,957,474 *644CB115E91F914A96524C68794C25C6BBB61FE8 C844.
961,957,475 *6443985E7B5A12264E08587AAFA48EFE25BF918F C#84f
961,957,476 *6442656B8504E10140314B27763D964F268EA31A C84Yg
961,957,477 *644D0A83E1FBB6D8911CF16F27E808EA55646BC8 C85h%
961,957,478 *644E50E3D94B3E8964370BB2A3C24DF117215E1F C8650608635
961,957,479 *6448D2C5B456F95099746DF90A87F026690D8872 C86%l
961,957,480 *64450F5311AA8CFC3047A584BB41AC54A9407BE7 C8)7$
961,957,481 *64424E39DDEF08D612C72F356643CFD214AB62CB C87UY
961,957,482 *64429895CBE6B78C52276DC5C26305382BA1321E C88$&
961,957,483 *6444FFE589DB352230DD54EDC21BCCE2266A07AA c88216
961,957,484 *64439DB60D10805B08812D362880DBAC8A12E2E8 C88ev
961,957,485 *64474E45AB226E039CB7A30EAFE29CAC043EB73F C8-8R
961,957,486 *6440AC4F852D1363AB7AFD65D96CEBAC01FB4A60 C8
961,957,487 *644C57C22111A9A14F3CDF21E87EF46FE26B3941 C89oK
961,957,488 *644082577CC505879641A0FB0D9347457C1F78A4 C=89r
961,957,489 *64419085922E29CBE1F3653F85B05BDAD97F4C8F C89&V
961,957,490 *644218E803F02AC2786A4E0D68354DE7BCCD1F0F C+8A+
961,957,491 *644355D23D6F06C00EE538004E4F31BBA4EF768A C8,a=
961,957,492 *64490EDAF883E0751399831A6FBA13186BFE6556 C8%$a
961,957,493 *6449D41A385D75A33CC2F4D3C5E89CB39A86429E 'c8A
961,957,494 *6447043A2A1F09858F647A2717695DB63E7D863A C8aI,
961,957,495 *644D723037A4EACC20954369A2143D300A3F008D C;8am
961,957,496 *6444869F658C8D4E2D6255D0E0DC25395B3C902C C8AM2
961,957,497 *644919AF816B4915A873449C2FD8CF6CB89F0003 C-.8B
961,957,498 *64429A19C1E4186D27221F76AD75BDF947904211 C;8:B
961,957,499 *6442DA16862F11898EBD8168017EF295432D6720 C8B3W
961,957,500 *6442D50BB20E5E8EB4F672446FB9F357E175DCC1 C:8Be
961,957,501 *6446D7E4683FEEFAA00719ABD735DACCF9331170 C8b"p
961,957,502 *64401A5062F2D42D17AFF276CB6D585EA4DB35D0 C!8bT
961,957,503 *644DA65D850A1426B220090E473203C75D42B233 C8C)
961,957,504 *644F781321AC41CDF7E1C92EA111BB7DF8DEA0DA C8C-K
961,957,505 *644D04C057A65E84EF1A4257AEF3F3D1875DA9A6 C)(8D
961,957,506 *6440220E3578DB0C63A308C7D8933E64F5B9A0F0 C%8&d
961,957,507 *6441E2147FF0EEA3C6B19DA3787C5142DF6C97DB C
961,957,508 *644F38FC2E16E7149CCF9F31C44A8D9A470363EA C8d8"
961,957,509 *644D130A4D67222FC62E16321C037C3B56022F82 C8dbo
961,957,510 *644EC0BFCABC40597C82B7EC2D342D7715AFD644 C8der
961,957,511 *644B436C87A773DE5970C7C0133794BDE21E688E C.8DI
961,957,512 *6443285E8C488C999F33C7A533D47FD7FAF6086A C8E7N
961,957,513 *64459C8B2BE8C4CFC8C9740D82AA5FEF888A5DAA C8-ec
961,957,514 *6441C30444F67B9E8FFFC469737AEF79D29E44FC C8EfY
961,957,515 *644421254640BBD528A62EF51E3C44C8B0EE478A C8e"m
961,957,516 *644336A9646D046B31764458E43E4A57CF19DC52 C8eOZ
961,957,517 *644386EB66908836EB9A3E16BD9CBF24813B900A C8Euh
961,957,518 *644EBCA570CF04FFAF04B14663F06129ADC9118A C8F6v
961,957,519 *64465BAE2A7A33BDC3D9802726DD1EB24BE50AFE C/8fc
961,957,520 *6443455E0D22EB6BF067A001E396A31208535685 C8Fe)
961,957,521 *644304515D960F5CB12B2F7F2351EFE391C2051E C"8fL
961,957,522 *64421D016336E99DF48B0906686EB0687C549878 C"8G;
961,957,523 *6448F31A23AE254E76CFE2B94DE61D626391FA53 C)8,G
961,957,524 *644F5EA69DB800A2B3ED0A07C7F10870325B551C C_8=g
961,957,525 *64436E951ABA6EAB44E94C51DAD13D1E57E8F043 C8:g5
961,957,526 *644DF0258450F4819EDE890681A2F65968ECC4EB C8gDi
961,957,527 *644BE519D7D1951059129550C44C64D73DC57A7A C8Gf_
961,957,528 *644430B1CD0247B8E6869408F5F19A5972C45BC6 C8guf
961,957,529 *644DB57BCC401ABAB7397608C0B5E05172AF84EB C8HG
961,957,530 *644579B37735030CCB966F32559BDA7FD7263A05 C8hn-
961,957,531 *64459FB13B0B5A802332B2DB6252A283A4F754E6 C8&ik
961,957,532 *6442DC72074B8967BC08C6B723927108306FC01D C(8is
961,957,533 *644B42C97A008525705E1086857CB93A41E5D081 C8!$j
961,957,534 *644DEFFBF66810C66E383217FC2B3BFAE2DEB998 C8!j0
961,957,535 *644E2B74F6D6504642C0DC19B380E3B03B2EE9D0 C8jF#
961,957,536 *644374062CEE1C3A31F37DA7DC5F5EBABDD9CD3A C8Jz
961,957,537 *6449E51C986694FC00A4BBABCE5B762708349610 C8k:&
961,957,538 *6443C6E788CD127E828D8955CB388B0EA6E326C2 C"8kd
961,957,539 *64411320C0F1C249B92026356ABA7560398FC905 C8k!K
961,957,540 *6448E82A6C720F4AC0E49408813F2744D41DC559 C8Kn+
961,957,541 *6440442AB9BB90FFE9475B65AF4CC96EA3A23C00 C8KNn
961,957,542 *644E9026DD88DDF3420FD65857C929C03E5E0C06 C%8=L
961,957,543 *64483AF23E4A87571AE7B4931DCD19494249D73E C8&,l
961,957,544 *644468F2D67D7DCE059C37E40505C57102337301 C)8l9
961,957,545 *6446E631672B94D6AB2ABB295CF934F1CB993CD8 C8L"C
961,957,546 *644815F19C385FACE0C28EFDED85DED351F10787 C8.ld
961,957,547 *6445EE781CF09E09B8EB32C00A7D5AABDB71AA7D C8+lO
961,957,548 *6449CE8BCC0BC50CEF2B6EB38876B8682CF09FC3 C8Lqw
961,957,549 *644BD41598B601A3CAC146178D93E734BF9EC372 C8m-4
961,957,550 *6442DD005D342D5B1E859647A0C3ED24149C0CE5 C8mjV
961,957,551 *644B2C5C211407A49E4BFBC7D19B7D956274B691 C8MM$
961,957,552 *644FD2DD8970EC8B5098C5E634327E1A6E66ABAC C+8mS
961,957,553 *644A4F40DC72CB40CF5026E8CF0FA21BB37EF6ED C8n.4
961,957,554 *6448FF5348F291596D8B5BF7719482C82B9941B7 C8nG1
961,957,555 *644CD5B09365DD3D260645FECBD4EAD115CA811D C.8Nl
961,957,556 *644E50ADC85DC1026722662C4D56D44BC6D8275A C8,_O
961,957,557 *64499DC5E9CCDA39D5767A9265E7D4E3BE0EBBB3 C(8?o
961,957,558 *644AE2DD3DF9CD9490235357A900C2D86F57BB6B C
961,957,559 *644EDDB013B92D9367CA55DC0661275E3ACF224C C8(o"
961,957,560 *6445F7C0B41C15696C6BC63A055E505001595D65 C8Od;
961,957,561 *64466BA167431741AA30B90F084A2824FC0AE0F9 C8od"
961,957,562 *64443AC125E3EC72700168ADB5027FEBA6B9AFC9 C8o!N
961,957,563 *6440CCADA74E1F3F0AEE1DC5ADD4F41F0233F731 C,8Ot
961,957,564 *6449D687555804EF6B3E06B249FDD064869D67B2 C8#ow
961,957,565 *6440FB17314975DE6441A253CC45AF68FF125422 C8:P5
961,957,566 *644788046E460C6F05EEE25D04D98262938C88C6 C8pDU
961,957,567 *6441E25415C8F32C8088D79CEB7A573D72615E1C C8P
961,957,568 *644DFA13B05A62C4E8AE5FA4D6F490830DA49B81 C?8Q-
961,957,569 *644DADEB80FE7ED091DA7D9E78CA0C12C386AFF4 C"8Q;
961,957,570 *6443984824AE5C3BB1BE93CC736D7D86A5BB3A97 C8QB(
961,957,571 *644D61B473BBD95F0D18A73675EFA1D39A895797 C8QnB
961,957,572 *644105E05B1A3F1EBF1F745BCE4C2359362C76E3 C8qpL
961,957,573 *6446ED82E96CE85DCE24A27123AF0982B8081B39 C8q_r
961,957,574 *644EFF56C11E4A63F054522383798271DA6C3FCD C!#8R
961,957,575 *6446BF7E021A75AA6976FB749FD0D8A75C45FF27 C8R-(
961,957,576 *644D81518D9D9DACE8E2C2D669E6E4F782FCF5CF C8r3D
961,957,577 *644C3C0E84F4D618FAFEF3C4484610B4A564D9C9 C8rA8
961,957,578 *644482ECACE702057B50EB0F70702C0259CFCAAA C8:rd
961,957,579 *64404023CFFDAA73FE86E38CF28AC2E35CB278DE C8RDr
961,957,580 *64444A79BBBF683E6D7303D1577853715E7D8E65 C8RHe
961,957,581 *6449226B6B823675C89A9F34220A569ACB166853 C8rK=
961,957,582 *6447E3BD16A9008ADFB4FA0022463BA033383DC4 C(8S1
961,957,583 *644343DCEDCE2D92306BE09683816C10DB01F22B C8Sig
961,957,584 *644A405527139879A9BC237FBCD6B1FFA730FCC5 C8swE
961,957,585 *6446D4B718336B697FC981608D5396D3841EAA72 C8SYq
961,957,586 *644728CA176D0F2DB1660CCA4D92972419A8AB54 C8;(t
961,957,587 *6444FB42D0886C4499A90E05F85FC878B7703A39 C.8ta
961,957,588 *64480A7DC40E928358175A515B55860BCF13BF72 C8+tK
961,957,589 *644C3B407DCD00E883B04CD9E787B9C45558F0BE C8;ts
961,957,590 *64499362754D0E3F1A1D13AF52FA0C8A8BFD7BB4 C8)u)
961,957,591 *64427D361857B16D44577ACDAA9ABF000FA826B1 C8u0s
961,957,592 *644B6270E1AD01EBD2FB3F0617CF4738BDCAF8A5 C.8UP
961,957,593 *64462FD8B1286835A999569D80DC879E99135FF3 C8uV
961,957,594 *6446620429D790272FA6D1307582BA5CF7B9483A C8)uZ
961,957,595 *644715A9020C863FB2CD8A8D6E295298DB5FAFF7 C#:8V
961,957,596 *644C9006CCBE681874C9920E812EDD3DE1806B95 C!8-v
961,957,597 *644A3CA008516B8F887C7F1F69514F98B20B40A4 C(8%v
961,957,598 *6449D0C0022623BD89F26654ECB2BCCABE94921C C8v4:
961,957,599 *64494047969301529F62C92A190E21C25A3E9F7E C8vG.
961,957,600 *644C32FFF2F1DBD13682E5877EFC1B899B726CC4 C8:vg
961,957,601 *6446068833410EC8C808D2D0A5295BFC3C06B28F C?8vOk}Q=yk($N5#~~1_ fWdi^
961,957,602 *6444F49C334990058B18A4637D8021F9B604A106 C8&W1
961,957,603 *644949B7B2EFBB8D4777E4804B63F64653412E1D C8WcF
961,957,604 *6448BF71A4969CF51CA97C3E35826E5C805D3DC1 C8-wi
961,957,605 *644D14E7556C28E6EC0D32B47C540A79967C555D C8XAs
961,957,606 *644FBBAE2C46D87283B88088C267BFF923DE1CE6 C-8ZM
961,957,607 *6444CB29A0FF69ED5E6EA865EE775CD013F09AE2 C8ZRg
961,957,608 *6449725CF700C227724962343C689597E56FDF1F C=;9%
961,957,609 *644DB708E3F0F96E5D752877CB33A18C163C25D5 C?:,9
961,957,610 *6444C4FB4DB43B71C44CF7029E0975B50A602BF2 C?:9:
961,957,611 *644FB71E3E5FAC6D157FF4E17705847A7F05BFC9 C/&9"
961,957,612 *64464BB8D967DD05351A206D6559D78DA1E31715 C%-9:
961,957,613 *644C7149AE90A76985A43149C49EE3E07C0D32F6 c.9{
961,957,614 *644CDDCFFDCE3CB662F3F3A6D36228CCB4156605 C(90&
961,957,615 *6448E517D7013D8FFEF44E43AF9DED15CCAEF1C2 c90599059
961,957,616 *644E9B2FE7E945DD0AA05FBD7EC101179B17FFC5 c90d8aa2-b1c4-32be-85ac-8745680bbd18
961,957,617 *6448948E8B8E61A91D836C853C72C4B73C82A878 C90$f
961,957,618 *6448D0658098DD81E1ABFA7537F68F106C364A2A C90Og
961,957,619 *644AA40D100D898F080B47FE82115DCC03D585FE C9;0Q
961,957,620 *644DA79D1382B00472944860BC8616A359716998 [email protected]
961,957,621 *64407287AC30835ED0D213CB6FA8A6BFF0FFFD3D C%91a
961,957,622 *644D480713785F0BB4A7798A53C4A9A5B321D2C1 C
961,957,623 *6440F9D47E0CB80DC18C07FBE71AD75E903E5853 c93592
961,957,624 *644C1538FCEBA18210C2CCF6A5691B6B39CD3C2A c937156
961,957,625 *644E0E1A06D0FD78730F49A8CE09F514C889F25C C9402
961,957,626 *644E0DC9C40DBDDF697807820036B9D7A1BA2B8E c9474
961,957,627 *6442AABA98DB048DEDE1C5303914CDFC050B15D7 C94K-
961,957,628 *64454E13B86BA94054F2A35D8E574D10739ABBE9 C95Kh
961,957,629 *6444FBF36BB7829A86B6EDBC58912207F0869E6F C95ki
961,957,630 *644DF2E17A3A54EB2C246AA922D3988B02FC3528 C9-6,
961,957,631 *644A2E03124233F576DBA12EE4358E5EC3990608 C9676885
961,957,632 *6447CED1155654CD84755B1452A01F7AB91D17F3 C/96S
961,957,633 *644511EC31808F6A9B7000A1484AF47910DF6937 C96(s
961,957,634 *644E45DD50FE2A719A52F8E387EA01DC79B3AE1D c97037
961,957,635 *644F247B94B30809C4ABDF308F8148AC830C261D c97912500
961,957,636 *644AEBAA5FFBA6BD998A63CB4C7DF352FB7B0725 c97e22648b789b5b395ca4df5a0d763e
961,957,637 *644EC5BA82187602E242A35193BF42CBA842E736 C97S8
961,957,638 *64470A17881E1B93C22616A969D94A1E3049A007 C:983
961,957,639 *644DF8BAD8BB00C4E53A5B6D83679925BB2FA693 C98Br
961,957,640 *6449F8A2F9938E05A0F82773EAB81A996067ED73 C99Ba
961,957,641 *644B921440D02B3DAC4852BB01AED61830A35348 C99fb
961,957,642 *64424C43E119F7878D11D02370B67246944D9F7C C&!9A
961,957,643 *6449ED301FC5BDF0BF13AC564E2DD1C467941D1C C9&(a
961,957,644 *644A0401284291B61E1001F934C9FCBEFF358954 C9a07
961,957,645 *6447602498E6F1995DABFD2C2F7D60E719481627 C9A9D
961,957,646 *6447E9D2A5ECDC1F0549E623C5F9DA16BB8AB8A2 C9aB=
961,957,647 *64457258D6CF6CEBAD65BF2BC1953A2EE0AFFE88 C9!af
961,957,648 *64433ADAFCB414602A21B17F5075D08AF4E805B4 C"9Ah
961,957,649 *644BAAB76FB4716B3F453797B0C9A3A979D12E5E C9Aq?
961,957,650 *644436025699FF50532F24A093B81BCB740CD076 C9AtO
961,957,651 *644F32FFA6B52E817D3BE284183A7816A38259B9 C9aUi
961,957,652 *6446A421CBCC9413BC6F2E45FAB2C172FCDB8571 C9a$Y
961,957,653 *644B8636CB82640DDD01846883BF9F9D2B23F8AA C9=b?
961,957,654 *644FBDCB6B8394FCB3348C38865318293566E6C7 c9b.
961,957,655 *644640951FAA8081BE945310F6A9155E747EDAC3 C9b9q
961,957,656 *644E1E85ECA94FB4878A2A8B055F00143A00124C C(9bw
961,957,657 *6446B25547FCD7008A4608D42CFC124068F509E2 C&9BX
961,957,658 *644A32E5F591393FB95F6372D21FF5573E5021A2 C.)9D
961,957,659 *6449102D1AD61593F2F1170993F81EF8D2666D6F C9D3G
961,957,660 *644E4DCBCE5BD8AF95583F1A77F1AB4BEB52E584 C9D4H
961,957,661 *64468E1C3B4086321297CAF5FF0193D37114E24D C9dpA
961,957,662 *6449E3FA8AF2FB588BB2FCC1DCF194BCB3F95D22 C9=Dv
961,957,663 *64408321426E716EB366735415B8A4DD1CC1BB6A C_9?e
961,957,664 *644255E346DC7884C0BCEF5934BAEBB27B18D545 C9e%
961,957,665 *6440A8711878ACF7F27F4B651CF7C328916EDA04 C9e13
961,957,666 *644AB5D905727FE30B8B8917C430D8E8EFD1DFA6 c9[f
961,957,667 *644A0C1FE3E242082A66DC3EA6B579AE97E419B4 C9,F8
961,957,668 *644DA992882DDB5E1D8C9072939FCE3B323ABB17 C9F/n
961,957,669 *6447CBE75BF472143679E3039B57EB2279BEC953 C9/fZ
961,957,670 *6441168758A65CA367F77B2F84D699817DE56B5A C+9"G
961,957,671 *6443898342B96919874389DE8870163BCF08C23D C9G04
961,957,672 *644EF5C8C89BCA1150A16B0A75E204D9B8B52CE1 C9=gG
961,957,673 *6440135DFD86264CB8698E1291EA98F6CB72B87D C9g"O
961,957,674 *644B022281CC42897C830A602117098524CA8900 C=9go
961,957,675 *644463CD6BE7E04AA9E9175BA798AAE771FD7F32 C9?gu
961,957,676 *64479803994562B4DF8FC0DFC63666F362693642 C9GY;
961,957,677 *644DEC5C31AAB3A2484839E52862743A1264462B C==9h
961,957,678 *644205E9BA39B6D808471DFAE51436A232FC0B59 C9H%f
961,957,679 *644FAC8666EBB29A8F6C9291DB95B6CB1A66EABB C9HM7
961,957,680 *644C9E6BC6DA2265D69E4A2EC396349F488EA428 C9ho;
961,957,681 *644130EA16CCA85B068E5302FB86B8CBB4719BEF C+9hY
961,957,682 *644E5D6DCF5C2550087A4D705A01FEC9180F9DB7 C9I.$
961,957,683 *64468CB1BF2C8E7DBFA389E35C6E58AE1A0EB370 C9I1S
961,957,684 *6444EA341D3A66B104066719349368D20F2411C9 C9IFm
961,957,685 *6446D64DE4731D01FDC40F6ACE6CECD285C1BB00 C9IXT
961,957,686 *64412F7CC5B929D449A56C2D29CAC4B5A098069D C9j=0
961,957,687 *644C874346E503508BC0751EC1498DA1A311B459 C/9jM
961,957,688 *644323CD0DBDE4A276C659E3414D0BD67E8B7286 C&9(k
961,957,689 *6440EF5C2DDBB099067CBDEB674890874F5576D2 C9K0l
961,957,690 *6442E84B84CDBEF73D637A152C7860849ABD8BBA C9K#V
961,957,691 *644B034CC43712B41A9BC44C991D72CD92A72C7D C9kw(
961,957,692 *644EF129E0C7A574E66B4879C9C97F55FDC473E1 C+9L+
961,957,693 *6449DE0AE64ABF337F8631BA6417AFCDE0AE0C97 C+?9l
961,957,694 *644F42223DB53E60352273147B9445B84BFFA9A7 C9LiI
961,957,695 *6449083E62D26F0803BC58D0AE16B32EF942B5C1 C+9LN
961,957,696 *644237BBCA72AC1DA6CE82BB0C991B30D71C50EA C9LOK
961,957,697 *6442F27D8F69F634BD285A1C7C02897426D1C2CB C9lQ9
961,957,698 *644511CBA93D2F4EDAA9E4C1CDF7431F8E8B913D C9l&Y
961,957,699 *6443B17629CF4ACE5495B0ACA9BAC89198C797C4 C9l$Z
961,957,700 *6442CF7C0AE97B06727914662A0F961B6CE6DA9E C,9M;
961,957,701 *644FCD257582FD320BB52342674F43B01DBEC7ED C9%:M
961,957,702 *644172892026D2C133DE9754A394EFC9543D4199 C9m1$
961,957,703 *644695F61C8A888B5B8C359AD7B6AD5D02D71FD3 C9mD5
961,957,704 *6442C9FEF387AADDF672A2E27BA94EA47B5255F3 C9Mgq
961,957,705 *644FD3DC6046E09DDE19F4F1BDF6462BD599B9D2 C9M%p
961,957,706 *644CE05868CAE4CB1F336C77A9F3E8FFA01663EF C9Mr)
961,957,707 *644367831E8B8B12B2FBCED4D50CAB8F08027835 C9msf
961,957,708 *644734F74D4BB894AD6B76C2C144A4A63A5A6EAE C9MXv
961,957,709 *644E6662BEB2E716769D2BCB1B0011F3CF052543 C9N&$
961,957,710 *6443341B489EEF222A4D09D30D089ED654E4E12B C9nD;
961,957,711 *644193ECEE49D47E81A00C7C3A62380FF2DC62E6 C9NdX
961,957,712 *644C99AF579A83AC9ABF1225D4CFBE4291C8438A C9Nmp
961,957,713 *644263536CCFE036B069E05A7C09894FFB02C471 C9NMv
961,957,714 *644FC9D96D0187CB6FF600AB1C11A255B6C6FC3E C
961,957,715 *64405082EF1DCFC3000EAED02B72C41BF0ED5DD1 C!9#O
961,957,716 *644F9BC6A7FAC2F87FF1DB886D889DAF7C7AEF58 C+9-o
961,957,717 *644C4DE7A8E1E693B8C44C95576644349123667E C9Oah
961,957,718 *644DAFEB77782CA6908B0BBA957BDCE2F4F32EBB C9OgM
961,957,719 *6443B40BE2D9B36EF9C76F7A0B80E609544B987D C9O.w
961,957,720 *644764E024FE219103F0D5E957776C3C17DA6095 C9oYp
961,957,721 *6448F357DE200E6DC2DA95E87DE0CEBF15C02756 C=9(P
961,957,722 *644407800B8AB003DF08025C299DF977CA744298 C9PB9
961,957,723 *6445ECDBB8610CC7C2C04FC8F013140710ED0380 C9pC6
961,957,724 *64442C90C4351CE09B2626E92944B2BD1E9D004B C9PoU
961,957,725 *64445904D88AD7298C78B7278081D940430F0861 C9&pY
961,957,726 *644586AB1905FA486E169CE1E3DCDE28248E8CA2 C9PZk
961,957,727 *64416433213ADEDAE05CA7BD6E9374E53E799B41 C9Q=
961,957,728 *644C717B4F08DAEEC63120D04C83C4DF7C86107B C9$&q
961,957,729 *644AD97571A6DA8CB8AA9A877922A58198F38FB4 C9q0+
961,957,730 *64439C3C636A9DC658A6E648B0D7BF3389DC0F37 C9Q1W
961,957,731 *644800C6BF089F2A9F9D10BFE8A44C0BB969EFEA C9Q5O
961,957,732 *6443DB3C7E76A3C661D5D28F8C6BD183815D31EF C9Q68
961,957,733 *6442BF2165FDE720ACE924F25834F1F1194CE6EE C9qF#
961,957,734 *644FD6E7101912CAA648D1E1B4DC82D6D696D63B C9QlN
961,957,735 *6448C245E03AC60301BF386EC95221C90027E84A C9R_n
961,957,736 *644B31B8A57637488B2E98863AAA82C8ADEBED95 C9S,2
961,957,737 *6442D5AF047E0B8E5D6589350C76719D6C010764 C9SFA
961,957,738 *64498BF8F62DAB02C27A4DF4D30A45A270F88044 C9sfn
961,957,739 *6440CB6028F25CE123ECC560E577EC8EA940439E C9SI.
961,957,740 *644134AC613AD3DE7D110466CF700CBA3068420D C9,SV
961,957,741 *644F01EAF477D9D98D090241DC9A4F8038AD28CB C9t4T
961,957,742 *6446376963C7615723CB70F0EBC33EF21AB0FF42 C9:#u
961,957,743 *644F9ED2DAE6E0918535B288DEB8D7EFFA9E0DDB c9U)
961,957,744 *6447E0FA19086E6C7FB955C5A989DA163C3DE4C2 C-9U8
961,957,745 *644521A26F519C014F9D7F91700640E71C876DC6 C9uEL
961,957,746 *6443614C1A5D86CACE1B28A49B75EF4D4E01C255 C;:9V
961,957,747 *644B256E953472A243F4F8227F424F4CB9A25F5D C#9Vg
961,957,748 *644B0546566910A6C01FE9E07870A70EA5081AEF C9V%h
961,957,749 *644F55739A431B60B9B864A394E1AC06F5EBCAA1 C,9W$
961,957,750 *64451A2E063221ED909035F966651222194F4EFA C9W?)
961,957,751 *644A8FEB4C993A1630B0467D5E85FE64CF1FEC47 C9wLh
961,957,752 *64487827E36DB4B0182730514BAB58E079AB0D8A C$9Wp
961,957,753 *644FD2C3CD2E2E98E347896494649E963ACD72B8 C9WX6
961,957,754 *644C2E9965FDECF045996A7044B5DE259B615394 C(9Xr
961,957,755 *644B857751054B1BBA99A0A24CBB2DBDF8198CA2 C:)9Y
961,957,756 *6443DF05888A278DF8A2E33CA69377B660152660 C&9Y&
961,957,757 *64403F99537FB0ABEC055193119CF7BDF5A5AB06 C9Y0H2PHA
961,957,758 *644A5355B5A8949EA41A2376E0DC6BDE0DBF8485 C9Y%5
961,957,759 *6440169A086D64F4EF952B8BF744AF08F58F9291 C9YM10
961,957,760 *6448355EA06962B60638CFABB6D8CE8708FA232A C9YZ?
961,957,761 *6448A3F9B30C0EEA7DF82E2FE5A287E485A65EC6 C_9Z7
961,957,762 *6442108D63D9FF8D4289D27B88747EBCDD9D9BDD C9Zqu
961,957,763 *644CC235EDFB27B279920E11FCF6F9873A920854 C/?#A
961,957,764 *644D19CDC2F829327E54EDC33E9CB1CE4EE6E13D CA|.
961,957,765 *644BCE362DCEE6BFB00791CE5AD356EFCDA7521F CA(_!
961,957,766 *644BE37457F8B3024B73AB32093492AE51109469 C`@a
961,957,767 *644BFA471DF2DBD3AED79ECCF37CFE424CB41587 C_-a?
961,957,768 *64492A2297F23BE45DA58F275B4134246491FD4A C,a!,
961,957,769 *644A74B34745E1DED2EE06D42D9E1EEC3385AFEE C/#a-
961,957,770 *644FEAFA4A62B03889F717DA2774DD1B1FBA7816 C((a%
961,957,771 *644D26954EA27858E98C43C1C0FB04116FC18AD0 C$a_%
961,957,772 *6444231F0AC113E9B2BEB0AB569C01C100C5EAD1 C+&=a
961,957,773 *64422250043E595CF96BE2DF6C89AAEEE4BF12CF CA0
961,957,774 *6444E416CC7540C792E1661EA65CDA370160C040 CA0lT
961,957,775 *6441D51D78F5597B28455C3C5E6EDF3665ADBE7E CA0N-
961,957,776 *6448821B26B08FCFD17FC420955F5255CC61746E Ca11owe57
961,957,777 *6446D69D2FA253F16943087CAC5449D6BA630E69 CA168417
961,957,778 *644F9DA0D8912821E1697739415EFE37F40EB976 Ca17m
961,957,779 *644BCEB1B8657B24B2C37E01C45C11D0BCC1D9B2 Ca.1B
961,957,780 *644776829C8FA45703194316752793D4C6F8D2CF Ca1cuttas
961,957,781 *6446AC020C7E4744552D3DD8309630AEE4F1A93F ca1!$+h3n!c$
961,957,782 *64496069872D0452B8E4F9F359A25CB8752FC897 Ca1ifa73
961,957,783 *644333EFC4D0C15038ACABA2CF63A348A9AEC699 CA1K3R5
961,957,784 *6440EAB840676B45C0413330DD0F498912D4980E Ca2An
961,957,785 *644648DCE4FF3ECE4FDFF53357009B8E84C49B78 CA?2k
961,957,786 *644C241A21577973E15BCE618C7595C640A11E3A CA2+q
961,957,787 *644162C5574050A4DB42C61363D4C818530EEE92 Ca2RT
961,957,788 *6449BCC82325B2B91E8DA53FE4445FA690099084 C(A2u
961,957,789 *6446714F2E521D75B257814D7462B3F198963CE4 CA&3?
961,957,790 *6447CDB5583354F64A3B72FB169F63B0F8CEC6E5 Ca"3;
961,957,791 *6448624810762FB7626F79B918FE4306F1B3447A Ca)3%
961,957,792 *644CB2D48111C123591B2B5BBFCA53C14811956E CA$3b
961,957,793 *644A9C32912EAF57D473CC2CFE2BD2AFC90DB283 Ca+3gor!ca11y
961,957,794 *644BC487389B718E07C9494474A56CEE3CDFC6CC Ca3pp
961,957,795 *644AD5C3EEAEF26FDCABD3EB012BE27C9B3742B1 Ca4dd
961,957,796 *644FF3E64236C7048C7348A6B7C1B3FE9EF095F7 CA.4F
961,957,797 *644E93C86D777694BD5CB9F26212CBD4C5EDEE83 Ca&4G
961,957,798 *644A59CFEC9E0C3AEBDF5622A37F66EE047DF337 ca4l21eb
961,957,799 *6440C2CF45657A79975A4F48F03882A611031DC8 C"+A5
961,957,800 *64458A16B0E2C08A8F0FCC4B3C099B251C57D087 CA5a(
961,957,801 *644593E28F5A7816F7ED231C02C7221A5A4C937F Ca5f"
961,957,802 *6447BF1FE66D713B061E30625169AA41CB9DDEE7 Ca5su
961,957,803 *644D4668EED8FBF38156DED196A52FC31DF882F3 CA5_v
961,957,804 *64414B4226216D0B3A35E85ECC6D8CAE68F2D16D Ca6&+
961,957,805 *644DCEA9D9B82CF1FD6FFC5A7652BEDA087F0144 CA6384012
961,957,806 *644A9F01EFBA6B1ADC47CEA8172BAF5245C87D0D C+a"7
961,957,807 *644F4B52105E7EB4A21B2297B07AAE84311F0E26 Ca$7?
961,957,808 *644F0F4AAB25EE7D7C49D2F2AEAF5E5655AB12FB Ca7ag0r135
961,957,809 *64492A32B69B32BC5899BED96606CC5F3587AD49 CA7HAR$E$
961,957,810 *6440417BA234D5473B8DF68F705C66BFF3D04145 [email protected]
961,957,811 *644341A7C9E1BE4570BE4AB61C5716E73D8393DC C,A8-
961,957,812 *644C378E2B9A32262DA1985E8DA5C475F3EC0677 C_A8a
961,957,813 *644171876F2E361B25020883ED18796994A91807 Ca8l$
961,957,814 *6444489081F0FFB66514C3C127FD8407D9C8FCDA CA8Td
961,957,815 *6447152A05433F2F92D5D76B2F491C9ADA3B7546 CA8v!
961,957,816 *6442084B514B2FE378F70CA05362F82783751CA7 Ca9ok
961,957,817 *644582FAEFBE79CDFA9D1443378A81DDDF882260 Ca9;P
961,957,818 *6449B4F10F5BBA000993321E5E09F2E5491E28E7 CA9VI
961,957,819 *64410BE68503DF83F63634D4C001477334D40887 C-A;A
961,957,820 *64451FA4A0A4B483A4427E4C6EA9694F18F84332 CA?
961,957,821 *6449189C91DA15FC5602CB8962749179AF83C7F4 C.a.A
961,957,822 *644AB0255D31A8160E4FBBCD7F6B9F0286C2EDC9 Ca-/a
961,957,823 *6442D2C563C51C4F19A1537DEC1911351BFFB5B3 Ca&a-
961,957,824 *6448594B1DD7F7C8C1B08808DF5188A38F49B011 ca+a13p5i35
961,957,825 *644BCD2383751E83D8347C8559F709D74D95B056 C;.aaa
961,957,826 *6443E718D3ADBF33AD771707F2D6A4B81F2C6E4D &>caaa
961,957,827 *644C4EB95D3FE5E66B92619E7EDE929C58428E6D caabasketballcoach
961,957,828 *644ACB126C3B8B9878BB69197DD929C6B0D0C1C4 [email protected]
961,957,829 *644F44DC9B0FD03F766A54A5162A182A9F31FB2E CAaf
961,957,830 *64450BD4913018FEE819D8552B6F635D903E88D4 caaggcaggctgatcacctaaggtcaggagttcgagaccagcctgcccaacacggtaatt
961,957,831 *644F476069190C1710C2E837D9DA1F1A847A553A Caaguas
961,957,832 *6441EE39845CBF70A13D332B68FD84A41340C5BB CAAn,
961,957,833 *64499C03B9C31ED589169C529DA4FE2C958E0383 [email protected]
961,957,834 *644971FD8EB2604A42005F1ECDACC372F0C70B9B CA
961,957,835 *644CD6026912032E5D9C3DD6CF58DB06AFE14C96 C
961,957,836 *644C4B531FC506EE276E70C81C8357D20D981430 caariyarathna
961,957,837 *6443EDCB8B563D2DFF9805A29642C566FBB4F069 Caasiybab
961,957,838 *644DFB4347F6BFE82EE23922D0FEAEFBA5B12622 [email protected]
961,957,839 *6445B933A8050EE8A819450417D98CDAF04E5A20 caataaagtagattgtcctccccaatgtgggctggtatcatccaatgtgttgataacaaa
961,957,840 *6443C7483F1E58C04BCEC4549A57A787359DE4EE caatgttattttaaaggtattttgggggtgggcagggagaagacagagagagaaagagag
961,957,841 *644BCA151AC2998A4966CFE815F899EC4663492D C_AaW
961,957,842 *644465B07E9129F1C40B48EC7395B1BDA4A929CF [email protected]
961,957,843 *644CDA5E0A8082874978BD80BFB5480DA7BA92E5 c(aB
961,957,844 *644E63F49C86368CE75B859BE139C274282BB0D6 CAB2.
961,957,845 *6444221DFD496CA03CB23670F1F7BD9A4F08EE88 Cab
961,957,846 *6441A6599A250A6A20871462D421A1F4B3290F94 caba1i7
961,957,847 *64404788BE73A5CD3DFC4DCD2C05CFB8F3074710 cababezacée
961,957,848 *644DF2B64EE495102B644355DD73E4302A29FFC2 Cabadesed
961,957,849 *64438FC739DFA590ACDE1F7EE32590EB5E624E9A çabala
961,957,850 *6441251C9CF215C9A3A9904949562A319012670E [email protected]
961,957,851 *6443D3AC4B5B2E7676E0B2EBA889AFD73729470F ca balance pas mal
961,957,852 *64475116CCAA7EB54EB91CE6ECE61AF83FCEA6A1 cabalhim2
961,957,853 *644FFC819E537E113B0E87222A948E4320DD35B1 CABALLER9
961,957,854 *6444CD8D84C9984397B823A792C72515375A4C12 caballerowilder
961,957,855 *644913B83B847944C85B1D13CCC3003D083E3AE8 Cabana123
961,957,856 *6440A19A6C9D67AA31614F07E75C6DEE357E2CC2 CaBArEtS
961,957,857 *6441F71D978DFCA13CAC75DBC8A6A9BF45D2F292 cab
961,957,858 *644C6958C02CD6398B40E0D58293C536B9BF7041 CaBBaLAs
961,957,859 *644D3D88D7C160A93EE185139992A46E39D0F779 Ca(BD
961,957,860 *644C7E8C14281622BD3CC593580B593878E2E836 Cabelcon7
961,957,861 *644BBFE64552ACC90EA6D39479EDC00DD8C152C7 cabelingBSW
961,957,862 *6444F04E0262E216E9D71BEC44291DF07C5F991E CAbhN
961,957,863 *6445D16533A5F86D7EA72B4563D2FCA8A1A2178F CAbI
961,957,864 *644B72F61D733C4F159AF993C38FE2FFA9B88993 cabidalhos123
961,957,865 *6441EF01AB4BB9F6DEEBE7A2F34759F8CE603597 CABILDOS2
961,957,866 *644EB3AFF460631A4494C675343FCCA25490DDE4 Cabillaud8
961,957,867 *644867888037EE587FA6C0175430AF97D3BE6126 CABINDA5
961,957,868 *64466DDCE415A3A23D6A9DC7078C8FA1FB6FE7F5 Cabinet0
961,957,869 *6443F1F26E273D287392EA2AF14B9F526DD5CCD1 CABINETMAKIN9
961,957,870 *644D5499F3693D3A668E326E0B8493B2B3363A89 CabInETS
961,957,871 *644A8BC5E27EF51C22FA3D19F0DE6F7D356EF416 [email protected]
961,957,872 *6441F191D0EF15C52EA286A03CAECF6C6AEBA699 Cabkcalb4
961,957,873 *6443B2C3AB7D4C26BBE0F82890688379115C00A3 cablecolor
961,957,874 *6443C8C662BC2B3E11898EFA3B15655115017E8F c able guy
961,957,875 *644BBF7A88F9F238F26431C5D6CFE5E6031C279B Cable's length
961,957,876 *6444884A5EAEC73ED1AC822B3B6C333DBDDA970C [email protected]
961,957,877 *6443174E25B4D5AF554586166CE448841B60ACC3 cablevisionpropietario
961,957,878 *644D6FE74F7CADE312E8D5B4635BB5C5858E693E cabling sending telegram
961,957,879 *64407CBA96019345C569EC86E8440F8C7C5E424E C=Abo
961,957,880 *644864C3081C67201289F8B24D61D3A7F206DB32 Caboulotses
961,957,881 *644CC69C7FEA3180BBA055BC23F524E43B28E067 cabourg9
961,957,882 *6445C63A342E445F2E9496347EA87AB7ECB67C4B cabrerencs
961,957,883 *6448D3B6470ADEF894FDC793D03305F00B2717E5 CaBU(
961,957,884 *64489BE1D30240FEA9CD40357D7A25D516E933A6 CA&C%
961,957,885 *644CB62491E6BD356F3D5B58C38F682E4235865F CAc%)
961,957,886 *644909E81F8691A7E85C204EBB8BED5331A4B399 C;a?C
961,957,887 *6444750E63DFA904723C5FBBA7DEB7A47B4A0303 Cac#=
961,957,888 *6442C2156160CEB6B89E88B221EB3D0FEFC92C80 cacabay5
961,957,889 *644870043865CA29E6AE2C479CB1C370526D973E Caçadores3562
961,957,890 *64411B63252B08988F9A4F2D350FEDD782BB5427 Cacahuamīlpan
961,957,891 *644F1AB5E6F3121729023C024E58B6766DF10E4B cacaotaling
961,957,892 *64423D171A8C1CFD3E133AEE722A1E8FECD66EDE cacaprout50
961,957,893 *6449251AB6B92B5B1CF8F491DD1F51D4399BDDB6 caccaaaagcaatggcaacaaaagccaaaattgacaaatgggatctaattaaactaaaga
961,957,894 *6441B3B2AE7028D18B111426F8E02DCE632670EE caccagcacactcatgattcacccgtctctcgggtgtctgaacaaaacgcgagtttttct
961,957,895 *644BDC2368ECA5A7368F68FC4590D286653CCE67 cacched6
961,957,896 *644362B090BE2147A9A16A4E66DE685F2193A8CD Cacciarne5
961,957,897 *64490B71AFE25DCE2E0BEE22970F24C6E98218E8 CAc_D
961,957,898 *644AC8EFEBC9F9B9C12B18800ABA8037094761B3 [email protected]
961,957,899 *6446839DBB6A1F51A232451BC65ABB42AC90E8AB [email protected]
961,957,900 *6444CE0D539B307B0F7C039DB10C88B2F2E2E48B CaCH+
961,957,901 *644883BC27597E376EE72E86366116B745AD2AD1 Cachcam3
961,957,902 *644FB520A78EDFAD762816CD5E5EE9CA2177E1E9 [email protected]
961,957,903 *6446FD6DE0A6CB32FE9E3D6035B90FE10A28DB5E cAchets
961,957,904 *644B9A33B839A03E1839087F3DD8C2F78CEF5056 cache valrey
961,957,905 *6440C972665E8C8405D17D4B37D3E49B6B1FAAA0 CachorrodeTierra
961,957,906 *644E7285EA0BA9120173AABAE44FB506EA64EA55 Caciabsw4
961,957,907 *644F853EA15CF0CD14336ED4BB4D492F2D25647D [email protected]
961,957,908 *644840CBE57AB7B695F3007F699DDED1C1C90663 cacjgdej
961,957,909 *64468FD2806189EFA866F11B27FAEDDB1789AF55 cacjgejc
961,957,910 *6442C1553D0BB5E154BC5E9568A3951122BF53D3 Cacjh
961,957,911 *6443B96ECEAD453C7F88FA01CDECA3F87C650048 C+Ack
961,957,912 *644DFBFD61406468FABF84CBBBE6212E07161F97 Cackanies
961,957,913 *64461B17F895F5BA1EAFCE01803D3DE12B9A5215 Cackaroni9
961,957,914 *644D27EB18407A9F1C7B464191FEF1DF26BF2D3C cacketh9
961,957,915 *64450D4D677CB9BD213BB08B6089108CF45D5D95 cacm.
961,957,916 *644548A3D978B8F84F67E9B6D696D9C3A27C909F cacobob
961,957,917 *644F484653ADCFEC9C25A58B60D1814B29125F86 cacochymical2
961,957,918 *64434D86690DE35D84CCB3EACA1BC3980B424809 cacodemoneiden
961,957,919 *6446876A0509A47A8F97B6BF8A37F061B707AAB0 cacoglos3
961,957,920 *6448E54BE99D11FA03EBDC2C99A177A977CC0F83 [email protected]
961,957,921 *644652DEC130D869565747F584CA830E5DA70E92 cacothes7
961,957,922 *6442F834CBEB37CC231ECAAC658F790CCD26175C CacPG
961,957,923 *644CAFE88977DEE7725246BF9B40A8401B7AC852 cactctttgctacaggtcagacctcacagtgggtactgcagtcactgaattaaggcacct
961,957,924 *644A33ED3F03D67C150CEDB093371FE083B6B633 CACTHES
961,957,925 *644AA6F24B5479CA037490954B10A5C4F66B8939 [email protected]
961,957,926 *6447DBE8A7A21D6DA37EEBF9EEC29B277618FF98 cactui
961,957,927 *6440DA7F72CF38C910D62C9FB220233B9F8989A0 CACTUS2003
961,957,928 *64430D580AAF4FF9BEC9BF5A7061BD9A522ED983 Cactuseddie
961,957,929 *644D859F1AEFCDF9B8D1D0263F4BF618A698F3FE Cactusgrandma
961,957,930 *6442FE27A751CBEDF2D68DA10A84403637B109AE CACTUSMANOLE
961,957,931 *6442612627907E0BBC133FCA667CC7B8B9B2D7BE cactusw178
961,957,932 *64452F75D7241BEB2E57F6D554856C64410DEE6F cacu945
961,957,933 *64422FB3AE23EB4C4526C24B747AD3B4A3761ED3 Cacuacos
961,957,934 *644720BF31D937EB1240A3812DAD8F0EE2C556B3 CacV5
961,957,935 *64492641A87CAD422A8F96FFC539BF13720C8501 CAc_Y
961,957,936 *644901DCD0D7B1DD39F3A26958FF1D2289F3BB0C CAcYD
961,957,937 *6445396E8FDD9BABB29F5FACB815743D9697D407 CA?=D
961,957,938 *6442D7C75EA1118D05A921AE4E81380188E556C4 C#aD;
961,957,939 *644873B3EAE7A63A616B3AB84762734FCF410854 C=a.d
961,957,940 *644DD66B6B0294988876B64D14AC1A110D1939A4 C?a;d
961,957,941 *6443DC06643A9A1D73422D31F453AD305FB35512 cadad-anan
961,957,942 *6445DFA9E2A1D18E9367AA80830B72777BC6E819 CADALAC
961,957,943 *64472B20D3D824DAEDCDB0424EF2CA93E162D1BD Cadaver3
961,957,944 *644C36B5D758041C076AC4BA4259E70B120BEB3D Ca+dc
961,957,945 *6449278780A3E060F11C626598E499F7C16C9635 Caddenhead
961,957,946 *644EE0C4417BEB91C3DCC0A2C8DDFC3AADDAA5DD cAddIEd
961,957,947 *64445A729F4B468889AF62173D033ECB30F8842C CADE22
961,957,948 *644093855B23BB0273D81C55B532CF0990BCA624 Cadebsw4
961,957,949 *644DE4FD55B22565D195BA0F143075A9ED160E21 cade franks
961,957,950 *644DB368DB6CEA61E8EE6CD69DA6D9157F7B9974 [email protected]
961,957,951 *644AC0244D4EA80F0734C2204E781037F37BA8B3 [email protected]
961,957,952 *6443FC50BF89681D09D61ABB3D35C0A2E924910C caDfh9Xee0
961,957,953 *644B82B1D6E5904DAB1032690FA0BF9CBE4293A1 CadillacWoman
961,957,954 *64457A2C647C25C194D4E6396834D5C30E187EFC CADjY
961,957,955 *6441A10933290D6D6D6F3E5229B11BF85AA6A453 CaDka
961,957,956 *64497F8AB76042487D55825A27D073C2D4F70DAE CaDm&
961,957,957 *6447B80FBD26D0EFBB81B0DF63A8F9FBB62441BD cadmīa
961,957,958 *644603A4C761C50E9D88B937AFEA16D003152CEC „Cadmium
961,957,959 *644EED2A4D6402E71F9F2B94CE2BD685F24008E9 cadowna
961,957,960 *644D2F068C187DE662E30AD2D30DB65E58ADD6A4 Cad-P
961,957,961 *6447DDDE8D0BF33937B302A64D4F3E4613EA4A47 [email protected]
961,957,962 *64470542A0AAE1B015922AE0925C1632C00100E9 cadreworks
961,957,963 *6440686EB12958E11CD506D9DCB2F362B0DBB4D2 Cadsa
961,957,964 *644DCE93425CEA69B8633EE7C11ADD42BF06B2F7 cadtq
961,957,965 *64498EEB6C9C2D69A5FD9EB44E82DF4DA8B7F487 caduceum6
961,957,966 *64461AA4153564C8F182120177E18D2C9A22FD1B CADVf
961,957,967 *6440EA18CB9AB26D4011D2FF5DD2D61BC9E1849E cadwallon's
961,957,968 *644EA4766D5426D8DD00AD0EEEB1B917D92FBEEB [email protected]
961,957,969 *6443EDFF45C3100CD58FD8E2544EC1B0A722C2CE cad部分を持たないために、データコンバートが前提となり、ポリゴン変換を行ってパス計算に利用するものが多い。
961,957,970 *6449B0818B6846363442FE32A36CA3447183E190 Cae6t
961,957,971 *644BA6749FC7802E8B555F98078D913BD4B4C093 CA,Ea
961,957,972 *644626213F4FF8FC89A5EDA9F2977910984AF3A9 CaeGl
961,957,973 *644B19E543FBD66704D14F76FA3710FA2A0B0D90 cael289
961,957,974 *6449F08FF4C7CB2C14F30AB079CC48C17CEF725A cael822
961,957,975 *64473096E9CF1D4CCF5F1FFBBEABA158DDAF4D2D CAELESTISSIMA
961,957,976 *64446140094E9B64CC08F9A12E5275AE4F54C52D CAeOa
961,957,977 *644F62441D27FF91E5F3A5767B645C73AB470733 caeoman5
961,957,978 *644A39BDDC42A42A6F43363224A2CCFBBEF25871 Caer!
961,957,979 *64485F4770473C4C9146E5347956566C0955ADA4 caerengracia
961,957,980 *644B7E1E37951FBEFD16B48D038A0C880F49BDD2 Caeretesed
961,957,981 *6448866784DEFAC9B0FD92D1609C8C7C9A5831E2 Ca+erpi11ars
961,957,982 *644C5BF327E13BB60FBC405422ACA0D8A5C5A407 caerthebear
961,957,983 *64409B0EF38F76041FD61BF44BDE05CCE0807469 CAESARSHOES
961,957,984 *644FC8AA373ED4223B7207C44EF0C144A921D8F9 caesarudung
961,957,985 *644DBC1E5695180EFD1E7B77BD607DA6AE6901A6 cAesurAe
961,957,986 *6447E8ED4FCCD113AEF23A42AF7ADEE394E925FE caeswa
961,957,987 *64453AA428789BBB5A60508891A79A17D1D9AA88 CAEU
961,957,988 *6444FF678853B51EB7A7E60F55B6FE1F4A6E9B16 C#AF,
961,957,989 *644E9FD5105684174553783D5B3D1CE70A80011F CAF:+
961,957,990 *644FD0530129778A433DBDD63C46ACA8C6BC0310 CA;.f
961,957,991 *644B2768019B23E52B9B850193141C127A8C1932 C#/aF
961,957,992 *6447BF5FE37425C0F6AF21F166E56D55DB630C4E Ca
961,957,993 *644C7449E1FFF872B175AC7981245B3E82C5CD62 C-AFB
961,957,994 *644D82F9D09A624626E8D1899BCD483B73A4DA2D Cafc!
961,957,995 *644450BDF5862C5F131B7A5F07457402EB2D32B7 C(aFD
961,957,996 *644681937A9923E85D5002CCE35738BAEEAF72CE CAFECZATZGIERZ
961,957,997 *644A5A65775818B40B9C9C7724C905807F5BDCBC cafedelabourse
961,957,998 *6444F1368E21EC121ED71527388B43FB7D5CEE5D Cafejyrt5
961,957,999 *644BEF4B5FD808BE553348FDD8142C001A7751F5 cafeterieejerne
961,958,000 *64429B7BD412A5351AC4F1EB3A55AB4BE25E070A Cafetero2
961,958,001 *644D3F513F819CF54BDF6D549EC7E5C8CE240067 Cafe-type
961,958,002 *644BC5A3810F6BC9EBC1975EBD20615F7EA3A340 Ca!Ff
961,958,003 *644D1D63015307EC23AC26689496EAE2435B6AF9 Caffès
961,958,004 *644F902D2802D8AD8910B709921C2D2C85609609 CaFGT
961,958,005 *64429C57542C44DB930ED1229146CFAF1ED4DE51 Cafhcafh4
961,958,006 *644474B03E46F019DA119618DB6EBD3D4566B9AE CAfi_
961,958,007 *6441F19662A48707A1F509154C3592A0DB0ADBD6 Cafirtiv
961,958,008 *644CAF03FDD93D78410D34383F45F5340A72A86E Ca(fK
961,958,009 *6449E3BA7F3482A6CD4C37B600FF071A9D33BD8E [email protected]
961,958,010 *644CBF594CC09F2833C2A3C9F190820C48B906C1 [email protected]
961,958,011 *644B9456F29C26B5008AA8C71B07BBAD78E64C66 CA(fq
961,958,012 *644A1E33D4BCD8E750B44283A3040E7F9504C26F cafundós
961,958,013 *644DC2D400A31C8C4BFBC0A3897B2B70D6837313 CAFwf
961,958,014 *644FB321A2ECEF33D6C292365A919435806FD1F9 CAFYQ
961,958,015 *644A229691E1CFAE924C1A1B6686F188A6C76F7A CAFYRIAH
961,958,016 *64492DF98DC8F9D3854777E3D5295D9C37C1E8F8 CaG&c
961,958,017 *6442F976A873701D4FB7D3C1FF78550359FB27FA Ca?gE
961,958,018 *6445FD9944B45BD10F7CD6EC77951FC1388745F0 cagescotch
961,958,019 *64421B2E93406346F90E0E30D7790D8093BF1064 [email protected]
961,958,020 *6447B9D9556C5E7A72AAFFD3D7E01B139E987526 Caggers2
961,958,021 *644008B75598200458F0287BA1771150968CE46A caggtctact
961,958,022 *644267DA616164661D804DC70F99CF1B418E4FF7 Cagingvs
961,958,023 *644DD68ACB673E2933163CEF365473E680887DFC Cagl;
961,958,024 *64476AE7F5F5B4E40F4FB3595D4909A227E60E48 čaglinu
961,958,025 *644908375BB66075FB72DA8BFBE9811A1D034BF3 Cagliostro1234
961,958,026 *644DFA3A56D844F6044611F19290EDAB8D0E9543 CAGNEUXES
961,958,027 *6447BDD010E4499C5118454181BB4E6715A22192 [email protected]
961,958,028 *644B313FE8CCF175DF0B95985FB1C2FCD9DC9E48 CAGoT
961,958,029 *644748F41E4386AC9C32B05587527A8D51628309 Cagouare8
961,958,030 *644B810F138D6ECC3B167D75FA8B117B0C3727B4 CaG;p
961,958,031 *6446DC8B42B499020525C32D3FA92B2AC9665F9C [email protected]
961,958,032 *6440D5E479BCD8A6C12189B3CDBCED94EC1505D3 CagrC
961,958,033 *644D804C5FD33FDE9E58AA6FB21963D5DF6DE43F CAgrG
961,958,034 *644C0136DAC9F67C227436B69CA5828575642EC0 CA.$H
961,958,035 *6445C68C81A2075606B250E33ABDFB66FF97B9DA C:a;H
961,958,036 *644AE0E8A80ED48A28BAE20E57E3178DBCD9B6DA Ca/:h
961,958,037 *644F29F4F96F6A11E0C8FAF61705AA51E8DECE74 Cah9G
961,958,038 *64429CFAF820A0A86A2AFDF2B45F15588E3CF959 C+Ahb
961,958,039 *64444C267028BF25E2C81020D09A58A8EE8C0B15 Cah(j
961,958,040 *6444ED5B73CCA85A614A2E25292C7C4B3277C345 CAhL$
961,958,041 *6444BCAAFDF0693767893A7B9535096625E6AF62 C&AHM
961,958,042 *6444D25764B099B1336F4AE9CB7495BA2B781DF0 cahokia mounds
961,958,043 *644B8BE17A903B88B7580BAF876F1942C764978F cahous3
961,958,044 *644E4F7636326823C770DD8C2997919CF4F5C678 cahssis
961,958,045 *644B6FE3CCEE0AD6467150E231A874D104A0CAF3 cahudoli1
961,958,046 *6443218BC28D212D07FB5736C3FF4DB531DBDC55 Cahute7
961,958,047 *6442B3CC9593FC5033B4799A06C7FE136D2E5093 C=$Ai
961,958,048 *6441CC3126FF5D66CD2952C56F3E93679CAFC7F4 Cai?.
961,958,049 *64477805AB7CA8E7E6F976698ACD20272E7057B6 cai01p4
961,958,050 *6449AE4DD80D3F98A0B99AA4F3FD785A39F2844A Cai27
961,958,051 *644831E9D19BE5A421A1F0DB727E10557ED15672 CAI7A
961,958,052 *64452DA8AF8AF2D2FB6F366E44F06E29D1FCED9E CAI9?
961,958,053 *644110A6D624132CDDB0F56E59FBC639595ACA11 [email protected]
961,958,054 *644985C4945446D73ED800B679D75F1B94548376 [email protected]
961,958,055 *644E1CC665413B61BE7334C08A2E400F0F5DE74D [email protected]
961,958,056 *644188CFB6D4EA4A20A2EEEF1D7E595BE276E585 [email protected]
961,958,057 *644674628DE7DEF50F0F8CB6578D44268E49677B CAIAragon
961,958,058 *6444E2B5D3F3666EA6B15BFDD31F52EEC6F19DEB CAIATO
961,958,059 *644F9670AA27F8404AB8CA2394566FB976856122 caibobv
961,958,060 *644D1BD038814AFA21E5A894CC41C4A81FEAF58B caicaoga
961,958,061 *6446450FFE42A4A3BB8763819C312175BC197584 [email protected]
961,958,062 *644F331DD5F2E32B8CF6A58BB56187560AD66C59 CAiE=
961,958,063 *644D3F21FD6052F2070E1A891AC637CB0E330772 caieex
961,958,064 *6441A721BD48D3BD8BE8F94691FC0701B37BF553 [email protected]
961,958,065 *6446A0601088C33FCC53F8DB15C2D7AF61BBB348 caielle
961,958,066 *644DCE7DA76EDCF0C5819C7BACE031D5B85B9C1B [email protected]
961,958,067 *6445BB13538902EC3C5DBAB4C24429497C330B29 [email protected]
961,958,068 *6446FF313686DDAEC3330C0970E4D2EB8E2F8D25 [email protected]
961,958,069 *6446F0451C1FE965111C2CD4E5C1ADB924CAE2E6 Caignala
961,958,070 *64430483943A676246E65939EAA8488F03D1A5DF [email protected]
961,958,071 *644EA789F1709363BC95531B002C55E091FD6F9C [email protected]
961,958,072 *6440FA7B1A2B54FA5DA03AA83BCB1CF7F5166FC2 [email protected]
961,958,073 *64442BF9E6673836AEACC30E29135A3555175106 [email protected]
961,958,074 *644FA5CF20F947E3B83F601732BA212BD8ED9A94 [email protected]
961,958,075 *6441CDEF46E248BF3F6429FACBCD19CC733097F7 [email protected]
961,958,076 *644C29EBD4467F68727DCC496F8EBD8E22FF9BC0 [email protected]
961,958,077 *644CFEC6DFAD252E303708F70B2DD1B706E2D9E8 [email protected]
961,958,078 *644F10890C9174DA3C29D314F3709F2CBF53B991 caijingyuan
961,958,079 *6448BB25E20FE3CC8E077F03C800B3DE50CED4D4 [email protected]
961,958,080 *644DC6789B7524BC227542D9FEDDF9CFBF68E456 [email protected]
961,958,081 *644C2C086F506E47DF339697F2A91CC3F234BD6F [email protected]
961,958,082 *644A60B3D32759D51A0E40C7259A9852DC13DB41 [email protected]
961,958,083 *64477350C03031706E27F920DEA9471CAA3D7FE2 [email protected]
961,958,084 *64427A9BCB9C95B6B1CFAFB833A97335863BFE98 [email protected]
961,958,085 *644AEDB40776D3069B912E6176D7A868B491FA0E caila098
961,958,086 *644C0294D8C87E79271B140E45BC22F503739114 cailanlun
961,958,087 *644DE44240EC41AAE74F167EF704BC53CAAA9CD3 [email protected]
961,958,088 *644D7AA039D3039A3D8F536DD6D0F86747D1371C caile219
961,958,089 *644F27647D600DE4697512D60A247B3E4A23BE92 cailope6
961,958,090 *644A6D7335951D51B1337BCC89C1FD0F19AE08A8 [email protected]
961,958,091 *6445271719E60748BF738C3B08A2661A5C59F4C4 [email protected]
961,958,092 *6445387E1DF7A08871C7ECBFAF78A187AA847E20 [email protected]
961,958,093 *644ABFEE685B59E1013EC3FCE46CB0AE8B485B2B [email protected]
961,958,094 *64489FCEC2854BA47F1507937556D135665DC37B [email protected]
961,958,095 *644AE8B3F7333782346A02D9ECF14C0CF8A6F8D0 [email protected]
961,958,096 *644E1047BE72AD5768DC64FD88A38BA87657D3F5 cain67
961,958,097 *644123BF418836B1DEBD33B7B2F0BCA56E788F19 [email protected]
961,958,098 *644CA7CAD07B25DAC0B2FAFDBA35C869A2C3004F [email protected]
961,958,099 *644935343ACBA9419FF24550A1681DCBB615791C caiocasasco
961,958,100 *64440EB988CCF04140BC0331F58224862F492C6E [email protected]
961,958,101 *6443EB565840BB3B9350DD368B368DD2858C2F4B Caiopaira6
961,958,102 *644B9A769EA6634333287F0C29DA9AE0797E22A0 caio salgado
961,958,103 *64439E722BAA54C643311814FDB470F7AE826A0C CaIOY
961,958,104 *644CAAD16BA6CE571F4CD13DC6DA142E43A27D88 [email protected]
961,958,105 *64439AFC4F3C71788ED6D6690C4DB08FEAEB8FC4 [email protected]
961,958,106 *644BAECD33E3746052001DF43830E9E7876F9E71 [email protected]
961,958,107 *644523980CAABC3B8DD6A6FEE2A70E73891201F4 Cai)q
961,958,108 *6445A5E898C90FEED9E1A4D72633C40DD8F15790 CaIQ4
961,958,109 *64467B135029BE3CAB3ED3FB9EC2BBE6C7D0D7E1 [email protected]
961,958,110 *6443568FC0F3F7BFCC0617DB7A6AE359E4EC5E83 CAir)
961,958,111 *644D0B533E15D1AC33FF693B9017B6E97FF27B78 [email protected]
961,958,112 *644D8D49D724E2F65C9EB16BED9BBE9818A0B5F5 Cairino2
961,958,113 *644CE7507820E548F054AC22C11C2D44A6FD4F72 Cairns5
961,958,114 *644E40492E761A20907809D9F5A57043E2C95B46 CAIRNSCROPPED
961,958,115 *6447FC029440AACCA370E100EDE33FA457379F93 [email protected]
961,958,116 *64406867D578E1E713DB88709873748A120EFB05 [email protected]
961,958,117 *6443791644BA9B5C56FB3E1C56C80B57F83783EF Cais-
961,958,118 *644F7CDD5C5A525E0A671D2F203A00383CF5FAE9 [email protected]
961,958,119 *6441F243026491E4ECE30091B2D173B642CE76D3 caishaner
961,958,120 *6441C2AB514630C2D2B249016E0806178E71CDF3 caissa?
961,958,121 *644755FFDC348A994687A108A2A57D46F2FB1E7E caissú
961,958,122 *644F0CBD0403D28C73A46D2B307229C27E65423D CAIT$$
961,958,123 *644F9655243CFD871011EE0FBD33883036E8BAB2 Caithlins
961,958,124 *6443D14F5A4947E4A40BE0DB6CB21FA198B14988 caITIFF
961,958,125 *644FD058B810199811417775A536C785EBC71D33 caitlinmccollum
961,958,126 *644B39339BCA52A3D0F0BAECCFC1C7B5CB1DAA89 [email protected]
961,958,127 *644B77033BAEADFF098F00BBE21D8096D3F11345 caivanoa
961,958,128 *644AE7BC62E0479626FE15990744E58342611EE4 [email protected]
961,958,129 *644B83D367FBFADEAC7739F633E4888ACCB0FD76 [email protected]
961,958,130 *644BBE8827D0253DE76AA60A40F4B8F4392A1473 [email protected]
961,958,131 *6440C6FA94C75BCE95A70AE5DFE5A07F1B2458A8 Caixanova
961,958,132 *64495A21E657729EDB8FE83D92BC3B341001123C [email protected]
961,958,133 *644E6A766DC9F997DC0A90B3275798188A6085E4 CaiYL
961,958,134 *6445851507F895EB1066D4AF32D8B7455C7F685F cajabu
961,958,135 *64499EE15462348C97D44BE5DDAE626BAEE6671D Cajackso4
961,958,136 *64469C54B35C7BBF3B1B1FAF174C741056A8913C CajEL
961,958,137 *644C7BB4ADD38BDA351FF5E988A6C0BEB0736505 cajeles6
961,958,138 *644567569CAD3B3A040E4C00C0898DAA840181CB cajohns9
961,958,139 *644B0200573A9F68BC65157E233D41D3065CB346 cajoLeRS
961,958,140 *644055E0B8AEBA6DB30C00397AEB855BC66C61E6 cajoneris
961,958,141 *6440535B6976EF67DF389EF6E08882ADD9C1D26D CajunCeili/BlackberryBlossom/TheMaidBehindtheBar/SallyGardens
961,958,142 *6447B9F7AD83EAB5219BBA8C9352FEEB83376EEB cajven
961,958,143 *644BCAE70E173194EF40DE835D52591715CA521B Ca=jX
961,958,144 *644F5525BA59BCF0DA085A2345E08089D058F792 CAk_?
961,958,145 *6449D33C5DDBE52FE80DEF9EB33265CDA8CC5EEF cak3t3d
961,958,146 *644FA16B0A9D414FBFBAABA9931CF9ADB04B36F8 Cak=7
961,958,147 *644EC5529BDEA1F1B1AD53E42D8477EF0505B4ED C+AKa
961,958,148 *644277B2D1E4E786E9814153D6B239398FB199A3 Cake & Ice Cream
961,958,149 *64459D5573B78C26A200CF8DB2F53E8E54303192 CAK
961,958,150 *64465DD2F0F69BAC25EA75315C172E15222AC259 çakibey
961,958,151 *6444EA157038DDAB875F9C6AA54FC496F9576B7E Cakil3
961,958,152 *6444D82C793C20F0C4CAC144619148B4149B63E3 çakıröz
961,958,153 *6444028F3563C6CB5CA41D77EE61BAC878A6A743 CA!KO
961,958,154 *644A0DE669F192C0A7705548230946EF86593434 cakonskí
961,958,155 *644C935181328DBA175A34608A60D9A9046D21CC Çakoの綴りを国外用に変えたものであるが、この映画以後その姓は使っていないので、その映画を見た人や
961,958,156 *6444568107EE357C22FDFF62703BF749BF08BCDD CA(Kq
961,958,157 *64482AACB3CE66FED87067D60277810141B5B3AE CA?kT
961,958,158 *64457839A05D11FDE173404D098DD3A99D0152A9 CA)ku
961,958,159 *644373C3B60C733E9E129481FB3EF55F05F777F6 CAKVEC
961,958,160 *644967A6C189DF902BA2D6235142EE71C65C545E CaKY+
961,958,161 *644AFAE9C5801199947E77368D9B1B037EB1C556 C;&Al
961,958,162 *644F9A790C22B0D0F6D3E0C6CEB1145B0F7E0C8F C-a+L
961,958,163 *6449AFA0E2BDA5C7EF81CA09D78CB1F734043FDB CAL4NIAGURL
961,958,164 *6446D24AAAFDD2DFA01432544BAF0C950F067C31 Calaalac5
961,958,165 *6441EDE16383E6A07076FE834A2003C679701E5D CALABRIANS0
961,958,166 *644A4C29A3045513E6CD989F3B8BE78719BEBF88 caladas1
961,958,167 *6447A0D1B3997D58238DA402CBF3A2ABE5BC2A65 CALADBORG
961,958,168 *644532F0DC2BF81D5FB61E0173F9F9A9EDA9AD6D cAlADium
961,958,169 *64476690B7B98BAFCB0DC7F2C91A19B490B68BDE Calainos5
961,958,170 *644899CCB011AF28F6A712D3B00911EACAB6184C Calaknab0
961,958,171 *64439C19F35107464C8D728AD07062326A246495 calamondin?
961,958,172 *644B9AFA01177670D1F8BFB42B0F422FEEC27C37 CALAND
961,958,173 *644F798D43F768CACD43F257A47E02E28E4DEEFB “Calandria”
961,958,174 *644E7F46AD135F8F314193546877EBA00F0E1776 Calandrites
961,958,175 *644BD5A2D45FD17D5A9DE1FE2E22901D7E36A4CE $calawagg
961,958,176 *644FEB66AAEC2642A90DAF29D89CFD7271363493 Calaycays
961,958,177 *6440E93183830981C05A6A9A9587807EFB787034 CALbq
961,958,178 *644A528D922D6E22D41A1ACC0204580DB09FF100 CA-LBT
961,958,179 *644C9450D53319EAA2847F1B28832EBD9CFF02BC Calcan3u$
961,958,180 *64451C22D2657E8FF63CAB932DE462DE4D26F853 CALCAREOSULPHUROUS7
961,958,181 *644C780AA79BD5673C71FFAD5129D2F8348226C9 Calcareous8
961,958,182 *644B25C465F1079B481DCD39A658D4AAF314AD2C Calcicludina
961,958,183 *644E6D7AF91E2AC8B54DA3F2AB99F8221572E59C Calcifiaient6
961,958,184 *644A0671616DDD5E4E1006AC5B5108F2FD3B330D CALCIO11
961,958,185 *644B12CF37B9A16B6ACE7BCF41EFE800DF840840 Calciumbisulphite
961,958,186 *644ECDA48A0F4E7EA010E9DCD1E669816179FBEF Calciumdiaspartat
961,958,187 *644D98A05A301020906955299497F11F21E76F08 calclen2
961,958,188 *644EB4C910C4F478A2B5F999F5D9EF8C73B41FA6 “calco”
961,958,189 *644A9E35EE08DABA5376290ACE452B469685F712 calcografreis1
961,958,190 *644017E1B503D0915DAC1BDBED7082CE0F692197 CALCONE
961,958,191 *6445F45B5672A69092509779D72AD6AD39BFCEB5 Calcorro7
961,958,192 *644E6F84044DB13CAFE27725CC1DF79A936186C6 CalCS
961,958,193 *6447CC214C5D31B53586389D26010796E87F77AC Calculou$
961,958,194 *6443C574DD1D6B15118548632A015D37C8F7FF3D caldeans8
961,958,195 *644EA41FEFD29DC463484D55BAEC31B31FDF205A Caldra
961,958,196 *64412670CBEAAD97022F915F71E61130527EC92B caleb.anglum
961,958,197 *6442DC33EF83CE2A77F1A9D2626A662F411D3593 caleb.baranowski
961,958,198 *6449BFA4298F166679FFA9B0DE721394ADE2275A caleb.barlett
961,958,199 *6447D931C60A0FD6F106A89119A99B8E57D565DB caleb.beshear
961,958,200 *644B50A4C8F1101E9F394C216EAC9E988AFCB758 caleb bracken
961,958,201 *6449ECFDD20C007EBC688D8C111463732ADB1ACA caleb.brandenberg
961,958,202 *64433BEEB20B5C06540A3BF8C10BDF3EEF76DF9B caleb.eckart
961,958,203 *644332317922B2890C7F3BB787B3C593AB980387 caleb.finner
961,958,204 *6449387021B7FAF3748A4C1D7D90319952C31339 caleb.gagnier
961,958,205 *6444850C034AAA96CAB731FD92F0A8C6BEBFB1B3 caleb.hard
961,958,206 *64493F7DB2DF1172BF45D58EB363BA30970CCED1 caleb.hughart
961,958,207 *6440B9CD16892DE27E65A27537DFF6BB4B52BF29 caleb.jumalon
961,958,208 *644AC10ED21130403AB5183BB7C244FEA6A7DAAD calebkiptoo
961,958,209 *644F3ED4C4B671AB4FF149A2C9DE53D2DAB048FD caleb.koso
961,958,210 *6447E08A5F365A4AB4B426365023B41428DEC22F caleb.mccowen
961,958,211 *644EF671C42641BB36569405403790E1F3732FA4 caleb.minus
961,958,212 *644DEA27E75B5A810BD5B7B8664FEA5F76C92C87 caleb.mottershead
961,958,213 *644A726E6488FBB9FE6EAF99DAF3B704E81394D5 caleb.newtown
961,958,214 *644797C815128B011DC0FDFC4507E39066A4C702 caleb.obleness
961,958,215 *64450B5CE1A6C3B294D0390227777FABE4AE88C9 caleb.patek
961,958,216 *6446487F75C80AB92D0453307356F11C87586F9E caleb.saleem
961,958,217 *6448C9B2F49E98B76749C0EBCFCE846D654B24F3 caleb.se
961,958,218 *6448D30BCBD2CAB77F512C5E7C962608EAB9CC91 caleb.silvernale
961,958,219 *644822CCDBC699417AF17C9E5F10FD10E2B24DB8 caleb.szanto
961,958,220 *6449D25B3FED380E4C82EAD6E048FFECDFA8C01C [email protected]
961,958,221 *644057AF94870AF8D3E8A02C262BD22EE4178ACF calendarioFeria
961,958,222 *6447B35AEB22C7A7C50925454FB768D9A22E73FD calender…
961,958,223 *64469DFD4C7481B36CECBAA59CF16C2D23BC35E2 Calepin4
961,958,224 *64401355751FE2BEAC9210FCC6A7A0D4358BF7D4 CaLEQ
961,958,225 *644E10A197AE768AA00FF8F2AE64B0A9BF4772F4 Calerbsw9
961,958,226 *644F5C09D6A0EFB830CAA536C3DC0AA9FD982787 caletrio4
961,958,227 *644BF7CDD372606B7C5CE3AAAA7A7F8E4912E1E4 Calezewk9
961,958,228 *64446AF7EEB5AEBA71141F24E1BD1FDE55BC771F CA:Lf
961,958,229 *644785D589ADA752DCEAC725387BB5C528BC1CCB C;Alf
961,958,230 *6443F582A18C81CD7A9762E949969EC92058AD74 Ca%LF
961,958,231 *6445AFDB39DDC71E9FE8261E3263793549511749 calfee.comwww
961,958,232 *644CDF45CB116A89D0A2DEA8CF0F26A3B2F5DDF9 calfeutrera0
961,958,233 *644FB0A6327749A35341C998FFB1D9390579B81F calgarycrowchild
961,958,234 *644FF40336E0291F60BC0A61F65BF4DBF5E0A973 CAlGw
961,958,235 *64418E170255F459B5524AE01D75B42991E7D848 Calhaan
961,958,236 *6449009DE73CEB3A94796BBED5D8E17DE6A55460 CalI-
961,958,237 *644EDDBF567812FEFB2125A000172FAA21B680B8 Cali1008
961,958,238 *644FB8FAEC5D905560767677BFCA227419B6510A Caliaco3
961,958,239 *644452618DFE66585CA38E7B96FB2EC67348BA19 CALIBRATIONS0
961,958,240 *644B3DF2B92214148DC8C8822074F573979BAED5 CALIDAE
961,958,241 *64419F3A6D1BBAFFD8E738EAA7E8BCA8E4E735F1 cALIfAtE
961,958,242 *644B5509B185491D87C881EDE231512A41404B1A Calificat
961,958,243 *644FBC3234644646CA6784095661BC29A44FD672 California1995
961,958,244 *644F74BAEEA480CB827B333EF9B77581EAF7D242 CALIFORNIACHAPARRAL
961,958,245 *644F5B5BD52CB1C974A6EDBA2AD9D95A217194E2 California Demise I
961,958,246 *644B581C3C60B2F698EE85B96B1B3378B68E714E californiadude99
961,958,247 *644F11B7E3AB29DF140681323F04E6F6C32AF4EE CALIFORNIANDON
961,958,248 *644B8C18CEC29A81A6DAE5077915B63C73BC2D9C CALIFORNIA-OHARE
961,958,249 *644035E85BDC914335CAB3D30E279475E3F443E9 CALIFORNISCH2
961,958,250 *644BF806B2225945FD6615262AB8E496FD909DDC caligrafado
961,958,251 *644A67F4B3CC039504853A3F079BB2D78A217C8C