List database


# MySQL hash MySQL password
929,700,001 *60D4A6C1D1C164CC6C770387CD55730D9E68FC1E al.juras
929,700,002 *60D4590309B489F8E1FB4F1F4E4F368C75E3B89C A=lK
929,700,003 *60D644EE65B1C8E45A606FF18F3319391705B3C7 A#)lK
929,700,004 *60DA9632346C3562B5C0C39D29A80F148E344E0D AlK9j
929,700,005 *60DA80C173FE8C26FFAEA26E475985EB0DC0BADB Alk#A
929,700,006 *60DF179B88A018127FF8718BE833D33C969DB3AA alkaben2
929,700,007 *60DCCCF2B700FB8096C480D91612EDE47514AD23 Alkaista7
929,700,008 *60D7A8759B045168FF453165F028A8C9C1B858F6 Alkalide2
929,700,009 *60D5100962F251C7EF667B8A075A40FEDE6453FA alkalimetaalgroep
929,700,010 *60D0C275D1552377F75053F6BF3E4EDA7687D155 Alkalises0
929,700,011 *60DBD92037F74276E73C52887F70A243F591DDAF [email protected]
929,700,012 *60D29373D4159EDDD6C842DA54044034CC68F3B7 alkamistunnista
929,700,013 *60DE3D463FBFBBB7F307C3932CCC9DF84A8EDB5B alkanker9
929,700,014 *60D3C3369046D2C60008FB431CA8DEC064C3E181 Alkarna8
929,700,015 *60DCD630335301995E97EF632818630B1E312EC6 al.kasey
929,700,016 *60DFE72A438C5B3EDA9FDFC018891F6EC4DFDD6F alkassab7
929,700,017 *60DCB967F6BFC5916DF08E4C7A85EB77EE7CA0B4 alkavast5
929,700,018 *60DEAD0D8D86D6CFDD1B861003B96FA6BE520860 Alkegfua3
929,700,019 *60D7EA8AA28098559DCAD42DBA525F37C53A621D Alkeistas
929,700,020 *60D574694E7CAA80569BB5AC272179BFFA5FF461 AlKGB
929,700,021 *60D9785E55BBB48BBAD0D388A4648DCE9FED070C alkhateebbing
929,700,022 *60DA5E3B4D3B4407C3C5B3617D927A654C388616 al-khawarizmis
929,700,023 *60DFA672D6D1533A18D5DEC15C621E47B2383641 alkidowa
929,700,024 *60DEAFF7F5E8AA62169569D6828FA548A528DD17 Alkimavičius
929,700,025 *60D448468CCCD744D7EC78C5A1FDC00A7C1F027E alkmenestr
929,700,026 *60D039199794AC4A33E3D4016071346A78B618FF al.koeneman
929,700,027 *60D91E8108C9E874773636BB97196E4E45D97650 Alkoholkommission
929,700,028 *60D85FC50E34CF530049C33FD39FF3FC14C688E1 Alkoljyt2
929,700,029 *60D0778252B76A8A514304CCE8B1CF0F0149D74A alkox1d3
929,700,030 *60D8AB8D4C3B3E63DE9E6367DC8DC0379749005C A/LkQ
929,700,031 *60D7D8EC6DA5077D8BB5D1D905434F66CE54CA62 Al;KR
929,700,032 *60D468249C8B39FF38FE338A781A1EDD0A9CC1BA al.kruckenberg
929,700,033 *60D54A9AC4820F0A09FC2CE6B6AE9D0AD47C77F1 alkukauten
929,700,034 *60D89DA8D9BDDAE2FA0C57443A450B40994D7FF3 alkunkaulio
929,700,035 *60D84DDC46064EAEB93E052F1B6C0C2C096A8E18 alkuperäisäänite
929,700,036 *60DB3C49784FD8964E493F5F90E018D20DBC8404 alkuperäispiirustukseensa
929,700,037 *60DE332F22482075FBFBFC62F98ADD282AB7E156 Alkupivi5
929,700,038 *60D09BFC02006AC71016636BE0BF029BCCC53268 alkuräjähdyksellä
929,700,039 *60D27E193D0AC5709D516255051189FF80EFC3F1 ALKVn
929,700,040 *60D4D8109B25680B193BB145A3817A4B6195EEDA ALKW5
929,700,041 *60D1929CEC9C2C58DE29D2E20F880148FB53B49F ALkWr
929,700,042 *60DE19C55EB5D044E1D15538B3D2D6E3C9632307 Alkylierungs
929,700,043 *60D22842D461E25033222EDB2C612BC2A41CA49D AlK.Z
929,700,044 *60D4C0BF7268C9C170BDED1685399179FDAE6834 A??LL
929,700,045 *60D6294F3BCA53101E5760AE0F07E309CFCBDF2F All()
929,700,046 *60D09A9E56CF12B80047B179612F0B523090C4ED AlL3A
929,700,047 *60DDF400FFC53CB9A2802E1A844A52C0E714E7B7 AlL5+
929,700,048 *60DB8942885602BA14FFCBDAF368DF571C333825 ALL6STAR
929,700,049 *60D72F90A4BF6538533C8DC94ED87F5237BFAA5A ALl7D
929,700,050 *60D838A49EF61039B0944A0473014F70FD48893C allaaito2
929,700,051 *60DAAA4CD42BDFE4E8D20993A0A8A012F77FC7C9 allaandmistingimuste
929,700,052 *60D7B18F1E0803C8CB8163B9984D70BCD18BCC6F Allabee9
929,700,053 *60D3678DBECBBCE1950B43AA9786AC96C1D0CF25 Allagassero
929,700,054 *60D7AB48E4DCA1B02B580998E666A3302C7B1396 allagatis4
929,700,055 *60D77C793C895DE17199A5C906CB26FEB5FB9696 allagpoted
929,700,056 *60D65917C0ED4FF793E2653A05B7919ED1A53B60 Allaksni2
929,700,057 *60DF47132BD6FE47B6AD4634912D9E278F38C20F Allalhuj5
929,700,058 *60D18CF3465F84C746E83D550E77542DE355E704 Allamaan0
929,700,059 *60D98ADD503139974B6AF9DF288653F383B2FC97 allamesi6
929,700,060 *60DD4CA5350D3D581024B14E2037B95ABA53CE83 Alla mina b
929,700,061 *60DDB41CA9521BD584CDDED88331C8E2B683B9BC állammá
929,700,062 *60D13A9BE2F25A1331EC4EDC458AC40BAEE2D429 Allan148
929,700,063 *60D01E070CFC6A9D81EC738474153A1737B23E96 allan.addeo
929,700,064 *60DCA658DA0C7623BE55F78826BC7F0186F13DEA allan.almeida
929,700,065 *60D7EC52D9F5CCBE9F9AB8708B5D5A14A3E0470B allan.caracciolo
929,700,066 *60D2B6056F961B945E3F6C0E1E5DC875CAAEFEC8 allan.cheeves
929,700,067 *60D12BAEC9FBD86FB0B2A567B856D6B3E537FCFE allancowling
929,700,068 *60DE22B20AA8D21C87DAB0BF55B1F90B1CD379B8 allan.crespo
929,700,069 *60D677C58E1B6B069EA943CEAA02B208744A46FB allan.deslatte
929,700,070 *60D030A5510421D66692E30D056108CDDE3DE61A allan.eayrs
929,700,071 *60D223BB7C14A7F688BAD705073873228F239131 allan.groen
929,700,072 *60DD7B3B0243C4D5447C7FC3383863F381EA04B7 allan.guthrie
929,700,073 *60D72C90986A418031761EB6E5AE7F71497D0489 allan.huelskamp
929,700,074 *60DF59DEF730082642C009F8FF346A4CFABD1C42 allan ignacio
929,700,075 *60DCE91DF4E124BAA242F6E53B46066DA7AA1647 allan.johnigan
929,700,076 *60DE5EDCDD78F9CD973C2579F997DF2C75AACB82 allan.mazzuca
929,700,077 *60D91CFBE9F4097D88B130EC443EAA96508A758C allan.meyerson
929,700,078 *60DDC6C96A59326E05BD39D478C4B95C507E2BDE allan.mucciolo
929,700,079 *60D51B6B8F8E6591BD17ED8B2EC78CD49963A178 allan.mustache
929,700,080 *60D3E719259A99F9F114D05ED61EDA302EA64176 allan newman
929,700,081 *60D17C2E28177BC6FDF00B8AF93A3C9AA036AE80 allan.niven
929,700,082 *60DD5D6C2AB3D6C9DA8149478B7D8BF55886A1EF allan.patronella
929,700,083 *60DF5958AAE8B7A64AC20BB3CA4DD08CDD20C0B2 allan.peffly
929,700,084 *60DB90588520787B549E548098F207067A72E542 allan.perks
929,700,085 *60D700F8B7922F5A5CCC82ACDA8673E156788072 allan.rives
929,700,086 *60D034A5BE98844416199C4671D35DC7ED8DEC87 allan.rollag
929,700,087 *60DC9EFB1525EF5E1D98577608FE18A19CB733DB allan segura
929,700,088 *60D37C6C07A7691573D5621485EDC04D33D2D5AE allan.stendal
929,700,089 *60D09B9499E109E7DAEEA9114CB58195C87E5CF3 allan.stubby
929,700,090 *60DFA6072877B1A7F189C5F1818BB75182751313 allan.thorp
929,700,091 *60D1C687BABF7582F2F8D5F9A98D190A9D17E326 ALLANTOIC MEMBRANE
929,700,092 *60D6845262146EEFDB1144DF118189BBC91D38F2 allantoid2
929,700,093 *60DD0D01A8EE4CF09069B4C1E0A31C192E111B8A Allantois.
929,700,094 *60DF86D2127792DFAFE491862DF24931E16E8525 Allantopora
929,700,095 *60DDD372938C2CCF191A49BA4CA204A0CA54FA82 allantrivino
929,700,096 *60D6ACBB2D3F1B420DB084072D5511B1F44E4DD2 allan.urness
929,700,097 *60D1F579870BCEB1B6B9BDA0387AF58EFBB8400D allan.whitehouse
929,700,098 *60D7BA4993531E919D26FF3D9F634412D2FABCF8 allan.withey
929,700,099 *60D541EDA13AFF0C90186FD41072D0FE4E37FE5C allan.xaimoungkhoun
929,700,100 *60DE873F860EE1B68CE31E13E53457515B4C0DF8 [email protected]
929,700,101 *60DEF7FD091AA9E2E1A0152C3743ECA06B7CA708 allard04192005
929,700,102 *60D109859C93BBBB1BA6F6224C7EF4DE5B2D8392 allargassI
929,700,103 *60D8B0F77AEDC036842D59C12B4E6E221A9FB490 alla ricerca del piacere - seq. 18
929,700,104 *60D0CCC9C87D9E4688A08F054CB872D4D5ABFE38 allarme rosso run moca (run remix feat. 4mula)
929,700,105 *60D09D903370E090B5863686DDAF7264AA9A1802 Állattemetőben
929,700,106 *60D1357BA6B0AE37AF56D85B8A6A838C45B7DD27 allavilied
929,700,107 *60DC0B7260FDE9E333A23F2960329A322DD7F35E Allayers9
929,700,108 *60DC4FBFA2D84FC909DE30C385845887FF7F4CD3 allbeecross
929,700,109 *60DF3C7CF7C1AEB14980E62BE97A18018591694E allbrier1
929,700,110 *60D4BE739D01FDCC7F0519886A54945322B85B22 all.building
929,700,111 *60DE4C9EBB7C78FBE8533E6E395B86AB8A896692 allconte2
929,700,112 *60D7723495CB416A9ABE16AAAB7E45140C370FC2 alldagabbersindahouse
929,700,113 *60D31544D8CCE39EA69B3FADEF92B4DBCF191CC4 all-detectiv''e
929,700,114 *60D0C099BCC1AE82FB93A54CE68D29E0CAFCF471 alle4fun
929,700,115 *60D8667A92BA9CFA88F84344813F70005D1A4AC4 allebazied
929,700,116 *60D10D3C587755C0270FF3CE3246EE1C1EACD5CB Allebbuding
929,700,117 *60DB747B9C13EB84BBB49787BF8783821E40E076 ALLECHAIENT5
929,700,118 *60D70B3FBDA99B445325758B44B4D7E67BAE9E60 Alleciva9
929,700,119 *60D15E169E0E5818981ABAC4BE944E34FB404E2D Alledaagsers
929,700,120 *60D4C033A0575A68DF965D72BCB8C8FD1F971A11 ALLEENOT
929,700,121 *60D593809B93242B4238529E41032D21C20E8D58 alleG
929,700,122 *60D34D4EA9E56C2287224905DEE2BEE1DD8F2E25 allegaeldende
929,700,123 *60D96807F83D89010A4EA1306B5BE05F306A168E Allegany0
929,700,124 *60D0899B05361161D4212E5C40F817708DA60212 ALLEGHANY?
929,700,125 *60D9D286CE674A81401AC4E92AEBB0DC6CDA2A4E [email protected]
929,700,126 *60D0C5B693E0DF08DFF7A67A4E15D38ABA57990A allégorisions
929,700,127 *60D6AAB8621CBF0E66A00D4D4AC8D448A87502A0 allegroeR
929,700,128 *60DAD66C00797700D78927C127C860AA603749F7 ALLEGUEZ3
929,700,129 *60DD093C1134B40370109FA93E4BB24940708647 Allehgir6
929,700,130 *60DFE6C7BE310FD0FE09A89CD2FA87E149AC100F allehusene
929,700,131 *60D9A3BAC43250B5A9D2D982C4FFF4588EE310B9 Alleibud3
929,700,132 *60DE836D2C099D244E23777ACF06410B3F2D7DE7 alleinausscha
929,700,133 *60D19C855DEDFD2FC1A8D6945462C1988981F0D0 ALLEINDREK18
929,700,134 *60DF838C9FAC61072ECE2A2318B4FAEBC2EE07FA alleirbaed
929,700,135 *60D992032B3119DC4F18446C904265CA1630FAAF ALLELINE'S
929,700,136 *60D49A7B2C6169B082036B99AAD2B7DB390E03B7 ALLELLEGUE
929,700,137 *60D8C198C459222DCCCEEFF0FB7AED19AF85AE63 allemachenmitbeimbauchtanzschritt
929,700,138 *60D7DCEEB0CBD9B59B3F3CF3B0A04B4E64E2D8AA Allemithing
929,700,139 *60DCCC8B2EB93223B81AA662A2BD5F92F8D43552 [email protected]
929,700,140 *60DFB1B5986E7F2CB8FFF4975C009615F4B0631B allen.bergstresser
929,700,141 *60DB270C4157B21EDAD464ED6ED7E317BF735AC5 Allenbucks
929,700,142 *60D57351DA9B234481D3AD08D9CCEA44A81C6897 allencalfee
929,700,143 *60DE8E58A6282E6CC3319E2824A98E1517982E64 AllenCarr'sEasyWaytoStopSmoking:Chapter29:WillIMisstheCigarette?
929,700,144 *60DBD5D24616FB2559A2F3DF5856B653C52F1F08 allen.castronova
929,700,145 *60DEAAD93E564725C50D5602BB05C05A7D76304B allencotten
929,700,146 *60DE03728432FA0DEE7A0154827ED7A3AB9D5AA1 [email protected]
929,700,147 *60D58C28CDEC96DCD30AF97F866DDC461770B483 allen.dahlstrom
929,700,148 *60DEDBB97464E5AF0EAE1DA3AEA77BD852BC2D2A allendeselazaria
929,700,149 *60D844C04702E72E5ADFF105CB108746B1AF8AEC allen.desutter
929,700,150 *60D0A4454F52C70A86C563D0D594AD99D0762E84 allendogging
929,700,151 *60D06C28046B27B03F79FD6E05505845EF09AD0D allen.dronet
929,700,152 *60DF378B7BA448E44EA279E1FD4BDC1AA0AED5B7 aLlENe
929,700,153 *60DB883F391BD395E41516EA4D4CE9AAB877C1A6 Allenea4
929,700,154 *60DF4164CA51188D5C158425E5AD0870B83DBDF5 alleneslinger
929,700,155 *60DBBCE001F0DB8C5ED664BAB337B6C0645882AC allen.estaban
929,700,156 *60DA8AA75B781FC7DA7356FDCCF7D77D1420824A allen.gerrior
929,700,157 *60DCE62300F66574C7DB415C32A24C654F9E71D2 allen.herem
929,700,158 *60D2655309C50F424622DD154DA857B5C2315492 allenjudy8
929,700,159 *60D60EC514244189738DDE5F44FF6AF0EBC69F3D allen.kindle
929,700,160 *60D7CCB3EBB5CCA8087D8E10E95FB4EEA1F26F6F allenkinnear
929,700,161 *60D8BEB3951DD771D2E91B202FBB8802CBF74477 ALLENKO
929,700,162 *60D3C6505C44B731D105A081590CD789601C1BCB allen.lusty
929,700,163 *60D6B0512548270CAA27220349D9A74A75E754CD allenoten
929,700,164 *60DAF42ED2256BCB325E22325C33B6F451FA4387 allen.pallant
929,700,165 *60D146AE2C02A82EBAC64763BD6D40A8428AA5C8 allenpineiro
929,700,166 *60DDF076C21E2B84898D504E375EBE2300DDDED6 allen.polyak
929,700,167 *60D4AFC80366D696CC2472412BD5247B184FA1F5 Allenpuppies
929,700,168 *60DE43157FF3CD42BFF5FBBFEA199720F0F620DB allen scales
929,700,169 *60D3890ECC6FEC00E2B092F914A41E34144BFB4E allen.sonza
929,700,170 *60D5016CAFFD8D1B570164C78DC4B608D6C6AA5A allen.stremel
929,700,171 *60D781257F985DAAF369C5B21F99A59FCB83A8D6 allen.tricarico
929,700,172 *60D562AEBCAAD136691716D50D2C1D39701EB407 allen.troutt
929,700,173 *60D51D2FE93843D452D61F5D8A5245C06596CDFF allen.vanlue
929,700,174 *60DED6ACCA0A49BAF3074641FEAE7FF6F48D3FAD allen.visick
929,700,175 *60D74225D049A0436B81E5E6527B22A56B666A22 allen.vitalo
929,700,176 *60D34D0540F33AA36EC402DC4486CC9C089BD2ED allen.welburn
929,700,177 *60DBAB75BE694EC69E26CAB87F59B62B3B82FF63 allen.wetter
929,700,178 *60D324A9FFE3A4A02673130A190067C930320EDE allen.wimpee
929,700,179 *60D8E4A4CEE1755DAE2395557FE9C38BC9A76DB2 allen.zuclich
929,700,180 *60DF89C40C1E469C4C21A15D58ACA0D924F9C980 aller9i
929,700,181 *60DFE7A1F43A0CDB996E309B5A92F7BC66B18B85 allerehs
929,700,182 *60D480100F42169B8C4600DA6FB1FF7B582C064B allergiiiique
929,700,183 *60D981E676869C2265D86914C7C6DBDA52EDE0E3 Allerheiligenkirmes
929,700,184 *60DC543C2ACCE3A9DEF211ACD25B84AA91553016 alleroifed
929,700,185 *60D40DE277309C79A1B89AB1E42569DCE9D7F9CC Allersle8
929,700,186 *60D2ACECFEC478946056711EF081A6CD41BA05DF ALLERWAE
929,700,187 *60DEF0CF4B73A0D3B7EF77917184A42E89765C98 Allesbring
929,700,188 *60D436F340FE555213EBD46683BF280090A68EE2 Alles is liefde (akoestisch)
929,700,189 *60D2D96A423E9B3DABB717E758988D931E2D74EC alles naar de kl--te
929,700,190 *60DAD43515945BA41B75A25AD0F9A022BAF69316 alles wat telt
929,700,191 *60D3234AC68BB9652EBB71724509DB0048FAA2D2 Alletnup3
929,700,192 *60D47B177D106E4F72AD6161215E338E903B4294 ALLEVASSE8
929,700,193 *60D70CDD6156F1939BB70B04C37C7C23B3249E18 alleyfax6
929,700,194 *60DA856551875A883C7D6D4051D77649F591B3AB allezma
929,700,195 *60D90B12FCBFA2BED6D30A56A697DC6C1D5945B6 Allflliger
929,700,196 *60DD0BB26311EB332D2F5BFA3A0369E50224022D Allg)
929,700,197 *60D17AE0F3844AAA9832BB752CCA965BC358E8E7 Allgent2
929,700,198 *60D6F2EAFCF881FBB4375C074684CFCDFA23B36F AllGodsChillun
929,700,199 *60D07F3B602209E28234B032CC80DD0B40E7B461 ALlGR
929,700,200 *60D148E4E1BDDCC6ECC2D9BD10D9117BFE1385E9 ALLH5
929,700,201 *60D90D1115D9472BFA6FA789CC0C771E98B36C51 AlLHi
929,700,202 *60D7DB375B8E0DD96C95F877098CB75BCB2DEF74 alliakav9
929,700,203 *60D07E8ABFF42DB0B083919621F54F9C9A0BFF42 alliance_warcraft
929,700,204 *60D9A29FAD8A911257A7D10AA0FA6B6448348B62 alliaskofyou(feat.frankleewhite&bishoplamont)
929,700,205 *60D14EE619EE70CB7271AAA85375AB4014D501C7 allibente
929,700,206 *60D9D645F8E26311B8FA2FCD40A54D080718C227 allichristie
929,700,207 *60D13B0CAA40117359D517F464ED83DD5FF6148B ALLIEBABA0110
929,700,208 *60DE1BCCD4E3E43CEBC97E35D6C00342BDE44BA7 Alliefair5
929,700,209 *60DFA49D54F169A36AFFB919B2BBC2627067F720 alliekku0
929,700,210 *60D84228D702816761826AECD49E9C2E3E876495 alligatoreD
929,700,211 *60D5D2048BF04F00B7E2035CE8A5DD935ADF38CA allikciw6
929,700,212 *60D1DB22A48EA5B493D183319BCF721367651B1A Allilabbing
929,700,213 *60D6D98847DD0C409BECBB75109B0AA0ED13D5E6 alliosil1
929,700,214 *60D95499EA70B3A50066BB30E0528707FC0FF470 Allirec6
929,700,215 *60D15ED68F91BC40E9D2EB9ED2825A647814F51B allison ferry
929,700,216 *60DCDF63C35FCA9B90FFA1610577370C6338F938 allison hinkle
929,700,217 *60DB20F53A464A0E38807228E806F1CD9867F8CC allisonhockeynuggets
929,700,218 *60D378E8AE86801738C418D2104E8721FC03AAD1 allison jordan hatfield
929,700,219 *60D16763E29E0A41A4653A2A8944546F9CF3C7D2 Allisonmelanie
929,700,220 *60DCE12BDBE68BBFC08DA33DBE580E0BCD89519C «Allisson»
929,700,221 *60D9ACEEB6890EB3B7EA54FC221A60B8FB2829A9 allisson016
929,700,222 *60D38A8C1B6009645A968C814002F988F7E63F78 Allisson658
929,700,223 *60DD12FBA48BE41E8FB5FAA23AEB64E6BCB6095B Allitrau6
929,700,224 *60D562D26E13D74901DB527D3CF3CA7AA6A4FFB7 állitván
929,700,225 *60DF80651FF2B0B2F74F1DBF54C35451F419D61D alliwannadoisdance
929,700,226 *60DD546B13263091CEBF55B49096379FD641EE5D ALLIZOMKUOCCLPMRADUCARRAB
929,700,227 *60DD806654112441AA1FBF0807F5B2F6063FECAB allizommocmoctodtensamp
929,700,228 *60DB61569B78E96C9AE83350E4C63945EDBF98C1 ALLIZOMTENLETLLAPPAGAD
929,700,229 *60D69BB2FD7DCBBCF10F1E59659EFB185BA70062 allloveled
929,700,230 *60DB1E03A54AD9EA2E8FECDDB32C1148C2ADB11A ALL-LSC
929,700,231 *60D6A64B89D36A1CC368678140A98966E83D6EA9 allmanining
929,700,232 *60DDE02EAE5BDD17472810EDA9CF67B4AF3B2525 allmennkringkastarar
929,700,233 *60D029F06D5986490C511BFE6BBA09527926F8B3 allmennm1
929,700,234 *60DB813A6B179F13B7D4E161065C58FC90003F74 allmurde3
929,700,235 *60D2A1B477CB7DAA527F25F034652BB64DF8BF5E allmusic-db-charts
929,700,236 *60D97B029F5CF6C76CC93DFE94FDCCB6ED59D6F4 allmysonsmovingsupplies
929,700,237 *60DC35326F3621786E47AA293033E455384ADA59 ALLOCHIEFS
929,700,238 *60D7F1A918914B9CC23F114E7776E17D2A23F717 Alloction5
929,700,239 *60DC02EEB022E7E87FF79E65854183FA52B00229 allodream1
929,700,240 *60DCCBCBECEEC4E8F4994EB0082CB0CCB6C1233E ALLOGGIANO1
929,700,241 *60D0E19CC9F2D4E5FA3B4B583E8A1FF9E48C3457 allograftalloplantal
929,700,242 *60D7393554514BE6EF077A52085E42C7CCD86D7A alloilla7
929,700,243 *60D16D09A7CA417D440B251A876A4434D5273D90 Alloluuks
929,700,244 *60DC2727F9F549701C0292A79545EE994E61D694 Allomem
929,700,245 *60DB4665EC14D8C783319D4120831A16D2045ED3 Allomer0
929,700,246 *60D3293032647ED9C92C57925F2D90DF9CE04101 Allommum4
929,700,247 *60D06A4BD4C47EBF2B4BF8C11D9BCF57E8D51D7C ALLOPAHI
929,700,248 *60D1C188278CD9E1212CAE10335ED621BC138EBE Allopiano7
929,700,249 *60D9E6D38BB674799444003828821DACA8BDD66B alloroman8
929,700,250 *60DEEAA27824DD7E4954634F69DB7317E903DC1C al.losacco
929,700,251 *60DAACE2CD58BB4AC53995DE38EFE111C48D8B37 al.losito
929,700,252 *60DAF34DFCFFBBA0639493FF1AE658F1ED5AB4FB allotelluriC
929,700,253 *60D71767248698A78E1FE6791564BA485E403448 Allotsim7
929,700,254 *60DE7F6E181B002AE6AA27E6E15FD0C3469C9366 allouerons3
929,700,255 *60D32F09C501ADDD40948C0CD9779C5D9E643F3B allowedand
929,700,256 *60D1D9668547E6A2D3261AAD74BC4E3C4FB0A370 Allownoting
929,700,257 *60DA05CA2C46D562AD8D607607F9865CA31EFDD4 [email protected],
929,700,258 *60D1B28ABB8DFEE59763AE52D6FBED0601A85FDC allpremchand
929,700,259 *60DF8DAF355BF975632179C2998EE8493B87F3A6 allproofedup.comwww
929,700,260 *60DF6A7E3AA813565180DF8FBD3254D752720B32 ALLRBOYS
929,700,261 *60D5710C5CF127FEDE8DA9699CA9B9F9A94D4CDD all right! 2
929,700,262 *60DFEAB9B0482220CD68FED291BCC98C6F376ABD ALLRIKAR
929,700,263 *60D0520509B1FF09DC4722246A50DBB1AD143095 AlLS2
929,700,264 *60DBA8BF17D5474607D96A2DED3C016E81171871 Allshard7
929,700,265 *60D13902E8A53226F9CD046688E329E51B2A6DC7 [email protected]
929,700,266 *60D99FF66DE5682FDD77F44BB2DAD193BA52AFD3 alltagsmodell
929,700,267 *60DC1EED37D405868F0B71B29FB0AA3B2823C1C5 alltant-siucair(thesugarbrook)
929,700,268 *60D2F6B8505EB8F9914637C46DB07477B5146799 Alltells5
929,700,269 *60D3132EC88CF7960C483EA20279D2FB3FF61610 allthesenovembers
929,700,270 *60D11153244059DA4D4D79EF7888978345972F3C AlltheWhile
929,700,271 *60D59805C18B05598277E11A431D82774E385F4F AllThingsT
929,700,272 *60DACA5916B656D98DBEA3E1B46CF2DF3EA7BF66 ALLTHIS
929,700,273 *60DEB780A4D14BC3937D5758E685B2633D4E399D alltogetherband
929,700,274 *60DB4E078A2999A4C4DA7877BFAEE1351DE237BC ALL-TOO-TIMELY
929,700,275 *60D1A7B63FB8E38974EA016798902E5F12D87F68 alltrim5
929,700,276 *60D5B0885E191814FE4158AAC8F443A7BE164C6D all.trystan
929,700,277 *60DF67143F8A428971851A465518A0A17C5AAA41 ALLUGOT55
929,700,278 *60DEC6038F9EF7B1691290355B4B00D90521A42A Allungasse7
929,700,279 *60D60C63E9EC6ECD046ECFDA019472E80FCC536A ALLUS1V3N3SS
929,700,280 *60DF626036E98028C9A5EDB7C7A7F0C103D011D7 allusif2
929,700,281 *60DFADCA79691ACCBD95626987900DD207CB9D19 Alluvias9
929,700,282 *60D14BFF8EDC6458E596E032BBD52A823D401936 AlLuZ
929,700,283 *60D34647E0DD8446A8742D06F31B90ADF189638C allveelaevnike
929,700,284 *60D600700B2C08FC96DC567CF9E3993E07CECCF6 Allvest1
929,700,285 *60D0E68810909F559A1538EDEA90FEB1A4A12630 [email protected]
929,700,286 *60D16B4FA20B7E7930538A705BC2859733D3639A A$llX
929,700,287 *60D58C5D351D221A197D9FEAFFF3F7652229A8B8 [email protected]
929,700,288 *60D76DF532E33249D839631E4FBFB17477404174 [email protected]
929,700,289 *60D99DE317D48BA69CF6D7263927B3358E6DF48E All You Rock & Rollers
929,700,290 *60DDD86E9AEC86BC119FFB4C5B3EE524F54436E7 allysaday
929,700,291 *60D64C6163DF894C4403073ADEDF844060FA483E Allyson216
929,700,292 *60DED923C5A3839A62C55FA9E9180D11219F95D8 ALM;:
929,700,293 *60D98E4EC880AC361F5A500691F8A4F2B7B13AFC A>lM
929,700,294 *60D6A489F423CECDF8FB6C2D42BDC575232315A2 AlM$=
929,700,295 *60DF7EE1AF4C9618C82EFA76F52F777EBEFC078D Alm1k
929,700,296 *60D6C8007C8826DE9049EF54CB19BE46B9B7AC77 AlM5X
929,700,297 *60DEA6A03F1D09535A92DAF6277801A9CD7CEA3B Al(M9
929,700,298 *60D1448D7931F286668456037B08A4C8608E0548 AL-MAAINY
929,700,299 *60D34A90910C91874D321DB5DB4FB509FA83FF55 almacasabuena
929,700,300 *60D93431995108A617B456D3C5F1A8B5FC565390 almachhcamla
929,700,301 *60DE27F3F63C5E80356BA601AD11AB4035B8D608 al.macinnis
929,700,302 *60D252BA160569CD7E6BD14477CA5AE9348F2741 Almagri7
929,700,303 *60D2E31450ECDD01AC067369C0426E604CAC7A61 almalegal
929,700,304 *60D9E3F77A15A0DA0DE2B9BFE396244E2D5157AC almamaterplus
929,700,305 *60D6FC34AA5078268E2667B8B469DB79A9CD314C AlMAN
929,700,306 *60DA7457D821199FE9D23A3996D85E5BD3C887B9 Almanere7
929,700,307 *60DEE27961BDD1F6DE7B40EA8BCCD2907F51D130 AlmaredemptorisMater
929,700,308 *60DDE818C8E81C24A77FF439D3BBCCD7173A7B55 AL=MB
929,700,309 *60DD91399B93E754E859E6BAFB3AE99CAFEC3E0E ALMENAREN
929,700,310 *60DDD2A542B8986D1724599B632CBB7042095F23 ALMENDAREZ1
929,700,311 *60D06986489A93CA6ADDCC9A7D63F89602BCD885 ALMf?
929,700,312 *60D8E3A356A62DFF23BEBBD220473CF3C5C23258 almihty0
929,700,313 *60DAF3CA81752E99BBA86960296AD85ED3B03C89 al.millikin
929,700,314 *60D83296190FCCF85430EEBD4B9332C72B9A351C almira-coulee
929,700,315 *60D08326F8C16144B02468392BFD07D4EAB024D3 almiranta123
929,700,316 *60D1C9813DEA05F7A32D2255FE2428A57C1FFF6D ALMIT
929,700,317 *60D144326FE53622A70C6C3934CC3E11876CAD22 [email protected]
929,700,318 *60DD08F843214E6168C1B997B16540D33547D2B3 ALMlA
929,700,319 *60D9E40942EFC117317518A267A908E035FFA0AB Almnery5
929,700,320 *60D53129A1B0F6D802DBC0840D35E60DE5BA756C Almoçagem
929,700,321 *60D944A5584F0BFE18ED1E8FAAF7E9BB5E43AE94 [email protected]
929,700,322 *60D1DB9E0250265584B42F9C5681A359ABA04E48 Almooste9
929,700,323 *60D3BFB51C4F96F480612BF31A4E91E02EC09AAF AlMoR
929,700,324 *60DADAD6F459EA85B10C935575AF4676B63D51CF almorts1
929,700,325 *60D863F9B7A9A25CBA9DDDD3C2491042EB8276A1 „Almosenhäuschen“
929,700,326 *60DFBF631D6BF1361AB443EF570CDCBE551DCB71 almosnering
929,700,327 *60D6146E8BF2C3E88B46012600B2706B5DF4BCCF almostde0
929,700,328 *60D6E03C01AC93D7B8FB636897F0B77EBCFAB4C3 almsgivered
929,700,329 *60DE9F7BBE7A611572B86B3BA870258927330842 almsgymnasiet
929,700,330 *60DC8209A1E74A47A217E21C889C8184200DE4F2 Almswegwasserzug
929,700,331 *60DBF0278AE92A99664278B3905560714F8D6D29 [email protected]
929,700,332 *60DAE2493225E4C7393A4A791B26769A3D583367 almuecin6
929,700,333 *60D206A4D7518A1BB5409FFE74D3A5270D4AB641 ALMUFLIHOONA
929,700,334 *60DB42BD73D056AE068FF68A0EC882F0C61A4E83 al-muhaditheen
929,700,335 *60D8C69BBC315E06F883972B8C69E6C8B54D960E almuhyya
929,700,336 *60D17BE15DCE4E14551BD3E86847A925961209A3 AlmUj
929,700,337 *60D6C47312B61F08065BC25F172EE05909A21CA7 AL&%n
929,700,338 *60DA84D55AF945F55ACFA05D26CFFD40A27A4AE2 A;l)n
929,700,339 *60D8308212B54BA00AB05F4B325DAB52970BDA72 AL_N1
929,700,340 *60DC2EF007262E8CF1F4948E90832D320F820C8C ALn4I
929,700,341 *60DA056B3F1A5279BA96FC9E54AE790D10A88774 aln94ben
929,700,342 *60DAF3534C9F71D931C829194CE009CC66CD5A70 alnemzetségé
929,700,343 *60D467006C7E4EAA013E2A6B80A9A76157AC24F9 Alnesia7
929,700,344 *60D5230F7DD9F8F55EF4F1E74411969ED9F8529A Alneslcoed
929,700,345 *60D87719FC704597F7238D51FEAB64BC519E7592 alnettek3
929,700,346 *60D390285266E75AC9D4DD3E62AAA0171C9F7B3B Al!ng
929,700,347 *60DD7774882B4013208E928423DC941CF434F73E AlNh1
929,700,348 *60D5BCFC610D41DDB3FD077E436444CE80F9A4DB al.nishina
929,700,349 *60DD77698E9971F906FD5EDAF5A3CDA5F2BB1BA6 al.norena
929,700,350 *60D7B098EB973AFD1D179836B6A4550D293B5A9D Alnreddy3
929,700,351 *60DC1B33B984D2487CB02725066EA68F2F0F14C9 ALnSY
929,700,352 *60D3B60D546EE58271C504483BF61C39A87082F2 ALnvY
929,700,353 *60D3DFEB5D34E6287C889F13C770E248A2B82344 Al 'n Yetta
929,700,354 *60D76686000C388522A9FC45C6294720A45B8FAE ALNYM
929,700,355 *60DA90F188582BBB00311CAFAE2F6EBFA7062FD5 A,Lo!
929,700,356 *60D64974DE1DAE1A3C03483212A35FE4DF617948 A#lo;
929,700,357 *60D0680D358AC2F7024CC7347A49650847D28D7C Alo_=
929,700,358 *60D626FD3F5B02DDAD0233BBADE4B68454F68DF0 A!Lo6
929,700,359 *60D1DCC888726C375091808644440FEDD660D1AA ALo7f
929,700,360 *60DD2543D44B9FE08A7F45B120EC33E826A9AA3E AL?Oa
929,700,361 *60D634051C6706B982E95028C917E0DEFAF76A1F A load off your mind
929,700,362 *60D3BA6AC955E75AE92EA132B4B64EF61496CF96 alobody3
929,700,363 *60D6298FD63E64193F57BB1842049A5087DFE686 alocesarT
929,700,364 *60D6F748C5D59C6C5448A596B6A56FAB8E5981F3 Alódia
929,700,365 *60D84B7F48B596D7305C30C3AE5674E78CA9C56D aˈlɔdja
929,700,366 *60DCB6CD1F0C339631B55E6BF4CCF2E89AC55674 alodocura50
929,700,367 *60D557EA833043ADD90DE65F82309631EE1A05AE AloE;
929,700,368 *60D36499C7E041AD9323497CCCA133DDA6F8599E alogate99
929,700,369 *60DA37CDFAE1FB0F4191F6C133C5D750440B43D7 aloha_gurl2025
929,700,370 *60D6BEAD91E86C6CBAF1ADE7B3D472708396BEB4 alohamau2
929,700,371 *60D77EF2E8E887BD9725C6CB5B89843F5BEF98D2 alohanet1
929,700,372 *60D1F091DE172A5F929FF083F7F0889E0040AF3C aloilgac5
929,700,373 *60DE539866E877661CCB43298A77A916DB766520 aloituskokoonpano
929,700,374 *60D301097973B2A93820BC6AF2BEE679493451DB alokmudgal
929,700,375 *60D6B2B6674B6400C95225899EFECBF1EC92D24D Aloknas0
929,700,376 *60DEA1DCB2B92BD5BB842430A96F799D41997E27 alokvashistha
929,700,377 *60D23DAD1311B9486373184D30866F0A2F175B17 alolupaahing
929,700,378 *60DC7D6DB960BC9B6DA1181D66EA529F6301DFD0 alomashing
929,700,379 *60DA32895DDCAA8A467EC6BAEA21A0566F7D75A9 Álomtánc
929,700,380 *60D6DA1546187E26F435C1FD87252F720CDFBCD7 Alondra817
929,700,381 *60D9F4AD220C55EB447213950A7CCFB9145961A1 alone.gt
929,700,382 *60D721E5380ABF40D928A1F63C724C18B1CC2C54 alonesolong
929,700,383 *60DEB1582A4784E9FEF7DADCE0B4D9A06982DFD0 alon geva
929,700,384 *60D937CCF657A693615FBC26BE6B87173F39143B alonso237
929,700,385 *60D23BD42EA1768A1AF193199E77AA6C7FD4DDA2 Alonso320
929,700,386 *60DAE2FE9F8187B302457CD0AF349269616993B6 alonso695
929,700,387 *60D30DA52457AB00F4455BF9FBBE32BCB2A2AFAA alonso.benear
929,700,388 *60D79DCE782F95F53C0374CAA30509F811C22BF5 alonso.cerasuolo
929,700,389 *60DDD571BDD28CFA255E47DAEC03778A0B9D3C3B alonso.donavan
929,700,390 *60D6BE0943DDE6DC505ADE4B4C893D5B0FFF251E alonso.hawks
929,700,391 *60D2D8A204EA3E9B204E9508CD86DFF1756ED781 alonso.hertweck
929,700,392 *60DE4380444EBB42CD2155D8CF9695797E53DE3B alonso.holsing
929,700,393 *60DBC7377CC7576E6366353E1EF2E899D58A326C alonso.kaina
929,700,394 *60D20EE6DC2EB1C3B902A27C0E5003C340D5B1AA alonso.ornelas
929,700,395 *60D08514B09F8693EBFA4EEF76D48E3C8BFB85F0 alonso_pita_da_veiga
929,700,396 *60D26D6FB0BC0B5057943313AE51BF7E51E8D93B alonso.policastro
929,700,397 *60DD88E9521664FF9ABB49462D46247F0617026B alonso.rebich
929,700,398 *60DF7D17A1F12C768448161FBA3ACBB4619CF2EE alonso.running
929,700,399 *60D2DB4A3BEC8C1BAC8801E6C3D232F410C188ED alonso.schwabe
929,700,400 *60D6CB8DF01C2F58C5A39C0537E32FCA774BA4B9 alonso.staver
929,700,401 *60DBD75E5ED7DC343CBD11230815964C7614C5D4 alonso.stupak
929,700,402 *60D38DF1F5EBF1B9B673586F3BC46FAB9D98917E alonso.tarin
929,700,403 *60DCF614E8918A8EBB637FD6ADCCA87092DFCDEA alonso.youngkin
929,700,404 *60D4AF24639CA195A15A2D50A25CA5CBF3045C33 alonzo.babbel
929,700,405 *60D2405CC480EDAB7C26F273FE828CC99FE89231 alonzo.boddie
929,700,406 *60D4A1419DDF15BD71B3B7A0C5F3EC536BCA3D2D alonzo.bonilla
929,700,407 *60DBF1017D8C7C8C8590664CED0CD5068496B632 alonzo.christina
929,700,408 *60D7D3DD130BB93FD9AE282DA990DB13EBFD1457 alonzo.croy
929,700,409 *60D249AC6EDB15C00142FECA9596CB32FD138355 alonzo.dockus
929,700,410 *60D16E2908127935CAA229FE4840AD7F14A012D5 alonzo.floerke
929,700,411 *60DC6098D1B513AAA4B83CA35454F779C4AF6D06 alonzo.garlington
929,700,412 *60D507CA0FC047B2ADD63C585AFB41639192FE62 alonzo.heitmann
929,700,413 *60D3661E18886E73CA7BEC9EAD1B75A2BD38FFCD alonzo.jiggetts
929,700,414 *60D7095089934DC1F14278EDBC3ABF018F85846C alonzo.kantz
929,700,415 *60DE267B3C42833A420111586F6F13DDB29B0CC9 alonzo.lyalls
929,700,416 *60D1087683893346D949CAB78FC8FD64DF463D42 alonzo.mare
929,700,417 *60DA90CF6CFA340220FEC396C05D63F68670BD0A alonzo.mossa
929,700,418 *60DA709B04EB07BABB8157A3FC0394CDA84289D5 alonzo.naccari
929,700,419 *60D9C1A0CE3C16B9EDB7225B790911CD4C13E21B alonzo.phillps
929,700,420 *60D03C89A9C4EEF2D1D2FF9F7D4E96B544A1CD69 alonzo.pinzone
929,700,421 *60DD141C6246AC46A5C89B36279885F9460330AB alonzo.potucek
929,700,422 *60D33D41E74895B0529408385780087FC2F631C9 alonzo.rymer
929,700,423 *60DD4E228963FE1BB093DE52525C508CA873F5AC alonzo.vilkama
929,700,424 *60D0B5F6E5DC3D4CB78063E14152483E2E28B97E alonzo.warring
929,700,425 *60D96CAACAD2A2F837E2A25246ED7CEA47B45F58 alonzo.wieben
929,700,426 *60DAEC6475DF2BF70EA627259147A278EA5BD4AB alonzo.zuelke
929,700,427 *60D7147BE9FE2E5A110CAD5225959E2689B7D5F9 alopez2605
929,700,428 *60D94062FE1ADAA0FE188E0C9FB9921574E140E9 [email protected]
929,700,429 *60D05BDF9AF692CD3C6CAD26A1B62C8D24D19327 alotano5
929,700,430 *60DD13E9598C8123AB9D868BEA485373C66E8F7F Alotrofio6
929,700,431 *60D512A33359CCD5450525677C899660986DF065 alotsuuj7
929,700,432 *60DA8ECF204E90103E54FEAEE538D6CE2B22F93F alounda0
929,700,433 *60D4C6F02D806339EB479973C2A71CC1B7ABA43A alouselm8
929,700,434 *60DF0F72CE97DF7C7F3B13E0ABF22342AFE1C244 A Love Lost (30 second version)
929,700,435 *60DFD3F029177B87823B327DBD9F9C374F9677D6 alovesupreme,part3:pursuance
929,700,436 *60D1DCE150CF9A499A413212CB7AE08BB8BE0804 ALo?W
929,700,437 *60D505B6BBB61EA3DA67EA181E05F958047933DE aloysię
929,700,438 *60DB4E6B6A79C62503EE736D1D0AC266DC023DD4 aloysius diaz
929,700,439 *60D53C5410235E92B5815352F9435EAB5A2A2F36 A_L/P
929,700,440 *60DB88578389921AF665ED223F5AD368F7171E86 Alp1,
929,700,441 *60DA16ACD91C002343DEB8CECCEEB9AC16B8993B AlP3T
929,700,442 *60D386B8B91B04B3A4724D59FE9CCA7618A1C615 alpacawo0
929,700,443 *60D3F177F41F62015CEB199336CD3EFA589F4549 Alpaxeh3
929,700,444 *60DA30FEC9E759FFCF177E1BC4566B92CCF0BECD Alpebsws
929,700,445 *60DF612553830C402A0014415A4BA50EEB2340C3 ALPEGL
929,700,446 *60D869A3499E72C7952017B034DE29A2CE32B5E8 AL-PELEG
929,700,447 *60D8C7432765E53071396B5C9B7CC10AEB7B2DE6 Alpen5+ock5
929,700,448 *60DDAC1F854868547A4DD4814193C6288B15A1B8 alpenami-browntrout
929,700,449 *60D6EDEF7DA93DA41891425FBAE8A2E8222E748D Alpenjagerses
929,700,450 *60DF4517ED9628BB967B7B5D533D97A3A84D6294 alpenvoreland
929,700,451 *60D4AFD042B24D25A4E3A75C6F4390ABBB9FD156 Alperin–Brauer–Gorenstein
929,700,452 *60DCFE829440A653201CD8B92A0AD93073DC8E9D Alpern206
929,700,453 *60D1BCAA33FAD885BD887D6EECB1735B027193A3 al.peschong
929,700,454 *60D7E5AA9B0AFEB4CC83528FF14B06726D054DC5 Alpeses
929,700,455 *60DD9278669BCBAF9F50CE048FDB469AF73452BB AlpgC
929,700,456 *60DC2590AEF491DE1287FA1FFAEEC172AF717A7E Alpha1francis
929,700,457 *60D7FBDCF728419FF3A90037E92B5D7587619617 ALPHA1SAFETY
929,700,458 *60DB0DD19AA33A30B70779BDA8FE6EC77E1D6E3B ALPHA301
929,700,459 *60D0CE03FF5A3E5F4AD0B311B198D05BF022A192 Alpha8etizer5
929,700,460 *60DE3B90C465C5CF6F57E17CB60231D579BB733B alpha937
929,700,461 *60D5F8729D62A5D029BF817E7746560D3C8F4159 ALPHABASIS
929,700,462 *60D15957FA42478C70E44DDD65E9B849D3CEED7B „alphabeat“
929,700,463 *60D7183D85A512DD2A3985318B2DC28AD5248020 ALPHABETH
929,700,464 *60DA24DE7FD6DD81005B4BA433B73DDAC0282335 Alphabeti0
929,700,465 *60D50B13300B7F4685281320DE689E4409BC5663 ALPHABORO
929,700,466 *60D2EDEF2624C4DD15A77A12604FC109C36E3488 Alphacgj6
929,700,467 *60DB05EAD71BD2F3762AFAC28CE4B07A05600E87 ALPHAGPDH
929,700,468 *60DB129937800084DFA7FDFA606A8046D67075B1 alphanesse
929,700,469 *60DE1A009E00F638F9DF4DD861FDCF311795518F AlphaOrDigits[19
929,700,470 *60D26F0906F2D34363E6817A6693C58AF63631D8 ALPHA-OXY
929,700,471 *60DBB43B2A8411EAD5C4914F7ACEE76D4145A2B0 alphapage1
929,700,472 *60DDE280D9FA0E685C295B14ABFDB719E36F7948 alpharail
929,700,473 *60D1DD81D557CDECA4E1E1E276331CFBCF4F8103 alphasource(a)
929,700,474 *60DFD0F20034642E40AB253308DE595968385BC8 alphawarrior1995
929,700,475 *60D76D632B89A665E3FFFAF692003809C3C8F622 alphean4
929,700,476 *60D481F8E5DB658A27F748D73DF3AB7F0F869273 [email protected]
929,700,477 *60DBB34588D27844EC7A81BE133C0131D5831197 alphonse.bayus
929,700,478 *60D86C77D8FC013BA071F295C43A5516FF43C6CF alphonse.beaumier
929,700,479 *60DBB7733DB6D23D71ADDA1F957BF0EA6D3D4D8E alphonse.bella
929,700,480 *60D9FFDD4D48938BFBDAE02086505319ED434644 alphonse.boggess
929,700,481 *60D815B99806F633AB8F0DC5C31E784B748346A3 alphonse.budinich
929,700,482 *60D335C4891B8E1AC21410F256483C7BD1D2DCDB alphonse.campell
929,700,483 *60D5930D49193C5FF7CCB2FEEBD316FB13FB5CEB alphonse.chapmon
929,700,484 *60D1F8021B473F6A4DD121B88B8752A7C82926D9 alphonse.cherian
929,700,485 *60DD84080EE0D47A7C69E5A9F30E33780AB09EB0 alphonse.detommaso
929,700,486 *60DC92635C90AE7D130E60842B842087BFA20B41 alphonse.dickmann
929,700,487 *60DBBF219B6FD0D553ED115FC0602FFC81062AE5 alphonse.dydo
929,700,488 *60DCFB745AC558084DD82772C6EAC8AD94ADE885 alphonse.flatter
929,700,489 *60DE20D24A80E1F3B35D529B9A75440A18D21D4A alphonse-george
929,700,490 *60D0D85B8BC98CC352A3E1AB28A1CD9A079C5EFF alphonse.gilcrest
929,700,491 *60D53EC973DCC0B430E01D7AA304791209959614 alphonse.huerto
929,700,492 *60D6F42A20D66A25780ECFD2233AE60A8D29E7EA alphonse.imholte
929,700,493 *60DD889BF5E9A26F159C5C88AC0F30A187EB234C alphonse.isaksen
929,700,494 *60D5522DE1A2CD71128CB1AAA55E047DD439C403 alphonse.kolter
929,700,495 *60DD19BA8BBF81A40529C36A675D027A672B5A88 alphonse.lerch
929,700,496 *60DB3762D5EC8B45BDCF92B735925CC7621779F6 alphonse.lukens
929,700,497 *60DA5107E4DEDA2DA98995584ADE3CA8A433E805 alphonse.mannheim
929,700,498 *60D346EA90C6EC734DC3CF3B8D28BC2A8820B12F alphonse.montanye
929,700,499 *60D5762B41200ABBA42ECB0015F9DDAAC6FC5639 alphonse.paulic
929,700,500 *60D09AA81299BEF99FFE60A017B494E8CE86557D alphonse.pilkey
929,700,501 *60D6293777FD3E993E4156958D64B135976F36DC alphonse.sunga
929,700,502 *60DB189E7600B13634898426633104DDEAFE25D4 ALPHONSI
929,700,503 *60D1E6796AE8DD24FBDDDCFB093A0A22D36DD59E alphonso.aument
929,700,504 *60D9DED4C8050209077A64522BCB1AB609AA413C alphonso.beaulac
929,700,505 *60D1444D082982A1FF15525DC9C75A3631542753 alphonso.bebeau
929,700,506 *60D0A6D6D65C959860E5ABEEAA0FC88CD5439C79 alphonso.benevides
929,700,507 *60DC4078ED09CCDED4A95EEB1DB5D7DA21A34652 alphonso.brightful
929,700,508 *60D5D259C04079EF433BB1508A24EC3E72A466AC alphonso.colker
929,700,509 *60D616E4EF9B5505B654C52A45C6F15B3403F088 alphonso.crockwell
929,700,510 *60D96DE48208D0D1CB253D4C31718D5E19438D36 alphonso.goetting
929,700,511 *60DED62A8CD5DC0CA28E935E789BFD22216EBDAA alphonso.grade
929,700,512 *60DD0ACED3A7BA763AB8FE3D8FF36450DAB70457 alphonso.hankinson
929,700,513 *60D486FA315C899B12AA112D3857B6099D55A233 alphonso.huls
929,700,514 *60D401403D3CEE3CD4377D834DA1BF1A79D75803 alphonso.lortz
929,700,515 *60DD3265D7FE7D5E16CFA6EDD11EB94BA5BB6FE6 alphonso.messina
929,700,516 *60DA39E35B2CDEE400E0CF8D4FEDE333EC51F30B alphonso.naramore
929,700,517 *60D9F5B639E1A383830BE451F6D1BDF85F196938 alphonso.ospina
929,700,518 *60D224E4C1D7DD4122A65A09299004EA2064AE8F alphonso.pesce
929,700,519 *60D183F62D04D376795221BAFF0C4E0C269B069C alphonso.sandquist
929,700,520 *60DD88935ED8B905C326A33DEE350A36102BA1EF alphonso.schlarb
929,700,521 *60D4095A1547C8471F9A0AA4577DCC97440AB7B3 alphonso.scordo
929,700,522 *60DB36AD64533F5DE15358F39688B42078FE3694 alphonso.stipes
929,700,523 *60DF714908AE2A01C7F4B7500C57F13A390B82B4 alphonso.underdue
929,700,524 *60DC509E3800F80793D5FACB612D72CFA11B341C alphonso.watley
929,700,525 *60DB76C4FECCA001D449708EE80D5ADE351892C4 alphonso.woyahn
929,700,526 *60D295CF71AAFC2D748D242E3332AC23219E6741 ALPHONSTINE
929,700,527 *60DE9E7C4E78D4FA85922D8F2E9049C2F41AF214 alphronzo0
929,700,528 *60D79980654D06D83AF9F4CBEF6244B517EBA17B Alpieolv
929,700,529 *60D696A167961F8DD8E26EE5C347B686D68772A8 ALPINECHALLENG
929,700,530 *60D1F0AD8384FDFA015C13BBEB5DE952E1CD4576 alpine memory
929,700,531 *60D8C90EB6C621066A530475DC8FFE951589526A [email protected]
929,700,532 *60D883032E2686633661E214535B8CC7B9502D95 Alpobsw4
929,700,533 *60D0CF5B9919B3D8C56D186B1FF9559AFDB62CC1 ALPog
929,700,534 *60DD5228177B48FF2F1C0B7650DF3A8FD872B856 Alpordyhing
929,700,535 *60D3ECEADDB716F13A660BAA6F30E05E64C867EA ALPOTTER
929,700,536 *60DE41677478FCBBB58D8FAC6B2EAC40B39B4F38 Alppihiihdossa
929,700,537 *60D214B85CD341E167EA7C949274D692ED1FD691 alpping7
929,700,538 *60D6F1FA26ED6343CE12CF55EFDEBBACA13F0021 ALPPQ
929,700,539 *60D093C3ECC6C611C2AE6903ED8B290882EB64A7 Alpregel3
929,700,540 *60D63602850CC01D9863E34C53443CA30E112B79 AlpS.
929,700,541 *60DBA91EEB3E7CB8C3A05727D5457537B68D91AD A!Lpt
929,700,542 *60DB745589AF0E8DFE9FDE05BC68D2171892DAE8 [email protected]
929,700,543 *60DE699B3FE3915F9D139ED3BFC021818F0C7151 alpv:
929,700,544 *60D741ED1E885324A79270677F2EA04DE24BE93F ALpXQ
929,700,545 *60D9722F6498D63805975CB33B65E19BBADDBD0C ALQ1F
929,700,546 *60D14303A4259BD5A5A0E26B69E0C325B07C5458 ALq4I
929,700,547 *60D8E8D6EDBE6591CFB085FC831B9A3FE1E4DBAF ALqa6
929,700,548 *60D3A7DF1EC08C5A088C9E7CB7983A6C46BEF05C ALQcj
929,700,549 *60D0F5A904C0AFFE178E46881B88C14D6C938043 ALqGs
929,700,550 *60DF77158F13B5FC92ADA19CA1E8924A798CC139 ALql$
929,700,551 *60DB064FB8DA4F213C56AC93CEEC5ECC7EA70BCC Al%qM
929,700,552 *60D5845306E0F61E33D5B881EC22E4247EC49F50 AlqNB
929,700,553 *60D304BAF38F232BB1F1137A7A4C59AF8484F8C6 A?lqp
929,700,554 *60D5479FBEBEE2000F0CAC7A5834A81E552380D5 ALQrl
929,700,555 *60D1A46C29EA15FF7F87FDE0B540804D42A404BF alquene
929,700,556 *60D1765394B2F1DC56B8F87C68F0B6F49D2A0969 Alquijay12
929,700,557 *60DE43048F3E323F158AB51CA0A89F4AAD62D9DD Alquilamines
929,700,558 *60DD6D3A165B5225556E2C1EB9BA5E083C056B43 A(l=r
929,700,559 *60D5F56DAB480EB5C037F18EA26173173D185124 AlR4"
929,700,560 *60DD78B9235C09E664F008FB0501B025722E065B Alrayyans
929,700,561 *60D6F0990F0590A9222EDAA9BB8612E9B781E624 Already Apart
929,700,562 *60DA3A08CF61CE184661EAE17D1BD2B19ADE44D5 ALREADY-LIBERATED
929,700,563 *60DA004172210FEE28D27A8F23D60BB3EE6D5E61 alrenda:123456
929,700,564 *60D4DACD46A69BEF83281FB7E1378A669795DE06 alright is never enough
929,700,565 *60D8202639A1A083E8D75B49202B9D4B5E35741A ALRIGHTWITHME
929,700,566 *60DC806AC457D3FB1700F3758C161BFC4E30D140 alrighty160lt3
929,700,567 *60DC976D22B100BAD6EA1D727A6E2FAC998ADF53 ALrjA
929,700,568 *60D545503A51D002B331F5325DCA5095CE8DAED4 A
929,700,569 *60DD6DAB206B4E2D47161FB749F0E4C3C5C0768E AlRNLdYsYPim
929,700,570 *60DF441208A05F735955D779D4E4B52DCE50C70E AlrnW
929,700,571 *60D53DD4BF2904018E97A82FA06419BDEE032966 [email protected]
929,700,572 *60D448BA22EE1F03C80DC4FBA1EC3A8958D34054 Alrunerning
929,700,573 *60D4D4F2A77253FE306EBD0984C8373842D47776 AlS4"
929,700,574 *60DCB8B5563895C9B83C16759E7D6223081A6AB1 ALs7O
929,700,575 *60D4ECACECDF24EF93926DE0C1D51BC1A7CA5F22 Alsalvan0
929,700,576 *60D7832D76756FD5487D0B8BC0DD6BBB4C2E42E4 alsecord6
929,700,577 *60D73446DB28D3698DAE41E563419676F57AE5E0 alsenia6
929,700,578 *60D17453FEC39B3D04D83F615F26EEB4BAFD0367 al.shely
929,700,579 *60D17EF2BD335593D874F7D70F9E2736024AEACA AL-SHERI
929,700,580 *60D6CA0ABE910F8638F1A1375F2486598C6A5AB4 alsibboc7
929,700,581 *60DEEB62312FA44751D5CFF7CC4CCB8C095E7FA2 Alsilwyr9
929,700,582 *60DAB66D11A31FF7069AF6F7E37CB0A99D503B00 Alska(1998TinyPerson)
929,700,583 *60D97660E211B1C6806403D3EBB07445D37FC667 alsliveding
929,700,584 *60D245527D4EEAA7CC7CA768CF80669807864566 ALSLW
929,700,585 *60D130721CE43CA913DBE1C3F765274468058C05 ALsn%
929,700,586 *60DD1072205DEEA938AD05DF5BB72A8CC6864FE7 AL#So
929,700,587 *60DB4263888CAFF6CE5644EE2D8C64FF517AA359 alsodoctemplatecat
929,700,588 *60DDE1E57B3E1D28F17771FC84987278C5E65A6F ALSOMETO
929,700,589 *60D7FC0388AF380BAFFED00F4833036F4CA8E8D0 Alsosea4
929,700,590 *60D7AB1327DDEFF0C9AFCB0BA0B53BA9F4188163 al.sossaman
929,700,591 *60D689803B6AAE1AF5342B271F307665028E2E84 al.sprott
929,700,592 *60D48DF1835CAF3E5DCEA8D61A3DAACC331233FD AlSq-
929,700,593 *60D9BE49BAEBA19E90EB20B7B39FAB09159A9172 ALss2
929,700,594 *60D5923B0DE491D8F98EBD5628DA0466C5A54D33 Als!t
929,700,595 *60D95E3B3DF06693A7C6AA452F45E03EF17901DB al.standrod
929,700,596 *60D171CE8DD62ECF6E3A62500BE5036D3E91D78E alstoneo
929,700,597 *60D280618A06489493D80F55C6197716499760BA ALSUFIANY
929,700,598 *60DC215B57E538FD6DF84D4EE46304D22C97A1F4 A;#Lt
929,700,599 *60DCAEE77A1F6E249EAAC698D4194A84C0B674A1 A=l;t
929,700,600 *60D256CED615940019EA60165A1AE60D4731DE4F al t
929,700,601 *60D695F7145D109E78E084B6C75DF83F8FC51077 Alt$0
929,700,602 *60DC47B5B92C6887ABA366A778C145A22B254154 A/Lt2
929,700,603 *60D4799D4F17079F343C1BA820FC1BFCBE5F9BB3 ALT2005
929,700,604 *60DDFBBD9580431C065CAFA92254F6C0B431B4FF alt386
929,700,605 *60DC3E09EA11EB093E76423693DFE0E0851D0446 alta2fly
929,700,606 *60D2D1F693E7D0C78259B0A0D1677056A6DDD7A2 altaians4
929,700,607 *60D3E1DE6FA0AAA0E0C0F636373909008D3BC6B7 Altanenerker
929,700,608 *60D1EEDAFCFA56DAF29816C3EC8835C886924BA4 Altaners3
929,700,609 *60D6740ADF22B1D34C12C7C1CEBE776E4E646C4A altar-pulpit
929,700,610 *60D3654F412C602272D8DBFBF9D8C85287E90617 alt="BEST
929,700,611 *60DD77B81622DAB355B925635B91FC3C474515A4 altchristen
929,700,612 *60D34FAA8369A912FF569CF39543BF7953F4EEDB ALTDPQLGMSYOOUK
929,700,613 *60D66FD93F35CF4B8124B412E52AE298038E9E28 altecxlansing
929,700,614 *60D088AEB3E005B356C4733A6A61528FF83D0D6E ALTENBURG1234
929,700,615 *60DA58F57CA0A9830CE70FC92050A63043BAAA8C altenburg-s
929,700,616 *60D75EAB2C9497883F1D073D1374761A1F66BFEC altepeter2
929,700,617 *60DA448DF9942E6C576C4256A4FEA8BD8FD75BEA alterarl0
929,700,618 *60DCCF88B523CBC83DE8553F53501D99FFF963C8 alteraţiile
929,700,619 *60D99A0EDA6866FF87C6720262E39098DCA9B1D9 alteregofitness.com
929,700,620 *60DAD0BC5C7967B22860E49CADC60DCE2EEA34AC AlterEgo(originalmix)
929,700,621 *60D071B85B8031A789ECD693B322038DD21577E4 alternams
929,700,622 *60D04CFB642C23D7FFD6D7246092EFD43686AC94 alternatealbinimix
929,700,623 *60DF0881268191C77446EAD081631FCFE9C74F85 Alternate Dimension Series 1
929,700,624 *60D9520073A2A0C30F2F534DE189C2230EE93723 alternative times, volume 69
929,700,625 *60D8B8E73A42777595B6CFECBD5F92A2C239D9C2 alternativkurse
929,700,626 *60D744E0EDD269C5862B75931D0F1C351F11BF94 [email protected]
929,700,627 *60DD105A930E7E4938E88196FE5B79F25CEE716F AlterPoint
929,700,628 *60D9F4C70946308BF9CE072C07213D9EBB699DD3 ALTER-TOMB
929,700,629 *60DF7E9AD098DB5E1E84D11F56AC942572EBA77B altex1234
929,700,630 *60DBFBA5FD820223BBA57E924C155D837351ADB1 altfraunberg
929,700,631 *60D5F3C5A97204D3A9C057272A836244C839F849 Althaein.
929,700,632 *60DDF9702AC1859A7CE1A40EB4A095AA1F6D0D29 ALTHEA20
929,700,633 *60DD85F37F2A9C429454529F530D7D7439792146 althean6
929,700,634 *60DF5DD14D402766581646430004FD6C31244E0A Altherrn
929,700,635 *60D9D9905557BF250F85F9D870A4C39ED3F1F1AC althmeana7
929,700,636 *60DAE5311F798D63BF0C996EEFF0F55C9BF4E338 althornbergischen
929,700,637 *60DAF575ACF2DFAD76822B41104E88F5730DDBE3 ALTIMA143
929,700,638 *60DD1AAD137363B68DC2A22679C902B5A66A32E0 ALTIMA187
929,700,639 *60DC1F03BB8AC47F1899BF02FAE16DC0388F0759 altimax4
929,700,640 *60DF07413D68A485F9D32144FF621F9E7CBE0A12 Altincars5
929,700,641 *60D227198687F82B6788D71C89F23202B007E1B3 altinvestmentsprosandcons
929,700,642 *60DD2918E794E219365EA0157BD4288744075B26 altipianis
929,700,643 *60D2CF9C6AA6D319ABF48039FCB1F9F9A038AF58 alt="Jobs
929,700,644 *60DFCFD3A9500291B264553A809C12BA43A10DBB Altnether
929,700,645 *60DABEF4A0A99AE5483038C0AD1C8420AF2B923D ALTOGETHER--WITHOUT
929,700,646 *60DB55CD16D874517009C9CA4E3F3A8D2B3D37E1 alton.andujo
929,700,647 *60D4B0B31D08B43CF855A3E082888AEF6726C5CD alton.beshear
929,700,648 *60DADC9643AD729989F3246F3F3CF6B34B251CC0 alton.cooperider
929,700,649 *60DDF4EF3632826C1CDEE528A1D6E4D6B24FEB33 alton.croswell
929,700,650 *60DF4D4A7D00DB4FC3B7F4100F2F887C90D25AE8 alton.cudney
929,700,651 *60D44C42054C9A83A436334ACDA06CBBC19C9409 alton.danek
929,700,652 *60DD99EAC3C745C8E04CBC24CFFF722C5BE49EDD alton.demianczyk
929,700,653 *60D4BBC6B0D83F74369920F3B32711B4D554FEB6 alton.dezarn
929,700,654 *60D629403EA530A8CA2C77946AAB7C60B2D00C3B alton.doroski
929,700,655 *60D2E6B081A9A9149417D68AAE17723E5BEA7B78 alton.eversley
929,700,656 *60D43C1862E307EBAF61D655D5B19F97E9BC1FBA alton.feil
929,700,657 *60DCE9CC7009D6869C24D2FDA85DE64214DC195C alton.fredricksen
929,700,658 *60DFC5F6E122F9B98F35D5F3F1069D70141F4E73 alton.fricks
929,700,659 *60D883C6013D4E465DDA1F10202410BE77BB94F3 alton.gembler
929,700,660 *60DE553DB7341B41F00FC857B82EE866F0719D64 alton.gunterman
929,700,661 *60D37F4C0B39BBCDA82197D34B3DA01001762B0F alton.hodgkinson
929,700,662 *60D1700EB535530856788DB577DE25025E711D92 alton.kirlin
929,700,663 *60D51651AFBA5424634803FB28F2C4E2F9EBCCCA alton.linamen
929,700,664 *60DA16CC9D7F3A85F8C48F7D43D77B3DFAB6DF0F alton.lucken
929,700,665 *60D181B54695B73B3AD1ED9D2C95B4CB0F33ACFD alton.mcclosky
929,700,666 *60DBF5DEF64E942A585BD09F994BBA34773F45D8 alton.mcsharry
929,700,667 *60D6665D52AB967B5F22F70C1CC4F9998E2FD5B8 alton.nicol
929,700,668 *60DD8C969A4367B393931B77FED07F8A44B3207B alton.obery
929,700,669 *60D3C4D872826F3EFC23BC8FBA48B10B4BF78EB1 alton.osby
929,700,670 *60D18D7FF2E82B6A58EBB8B16181E6716B391F23 alton.rochlitz
929,700,671 *60DB61B8922AF981B30CAA7D674E4643B23160AA alton.rosendorf
929,700,672 *60DE30A7D6966ED3706EDB6069568E4D41426DE9 alton.staires
929,700,673 *60D6004B311A23BBD74D2BFD1685F08145B28B9F alton.vandermay
929,700,674 *60DAB04AB8C65EF15F43BFDF8988BE41C69C568B alton.vargis
929,700,675 *60D67A571E5792343C723B0A62E57A41D3AD7556 alton.verderber
929,700,676 *60DAB09D65F5C367BED6BB398BC4247C62D7B5BA altooja
929,700,677 *60D075997327602049C2715644B1A8358B7BDFC9 „Altphilologien“
929,700,678 *60D61F3622EB0C3C3246DF314DD25B76E8241FF5 AltPR
929,700,679 *60D8C1B1FFFE0491CBA8382F267CBDAA527EC8B4 altpreu
929,700,680 *60DF2C9D991BB99B84DF6F18D3CBCCE45D0821D0 A=ltR
929,700,681 *60D17AA003007B2F27E7917DA0FF9E7F6123C874 Altribsw7
929,700,682 *60D2420BC1DAB735C0BF5695C47CD9008B4B19A1 al.troyani
929,700,683 *60DCB5C568978F937B8301CAFBC62ABDD6B531FC ALTsc
929,700,684 *60DE54CE78DB2AE1D4AEACAF09E6206387D76913 alt="Student's
929,700,685 *60DB7030E2DB1967E4DFD3D1FEEB82169D6AE59B Altsybariten
929,700,686 *60DDCC8CAF3D016B0726E2C783C27F093A24E85E [email protected]
929,700,687 *60D71B173A0A6C12A3BAA72C51C830F57270DD80 alt-times.com
929,700,688 *60D48B41C14B72B2B2F1715847829C94A9E88432 alt="Tis
929,700,689 *60D2984D297B729E11BCFF81FEEFDB865C9CA4C0 ALTUCHER
929,700,690 *60D726F0653C9FEC7047784A04DB9802363BE034 altujew
929,700,691 *60D805D504A6AA80BACD7B4E0CE0EAFDB48DA53C $alturter
929,700,692 *60DEDF2DCC1D8E96B0801E73DE2AF1C06FA42E8D ALTVIOOL7
929,700,693 *60D018BC1C3B2B0D47B25421D7E2B40AD8F59B42 altwasser。ソフトウェアとしては
929,700,694 *60D3B6EEF80A73E0F2A5979E4E1543A4A79BFCF0 alt="Waverly
929,700,695 *60DD6C28790BC50BCA2DF01F579BB342759E8DBC A%LU_
929,700,696 *60D6D3C6B96757145D6FEE81C3C480AE793AF4F7 A.?lu
929,700,697 *60DA7FE1F0F8DB50BAE211B0DCA1455E2B17D2EE Alu0s
929,700,698 *60DE64A5C941306DD97372C48750ABD7841BF54B A(lUb
929,700,699 *60D5940EB83B814D2232154235B37BA82A2AF2BC alucinloeis
929,700,700 *60D640BDE49EBE7651E93548FF426BF00C38C74D Al#Ud
929,700,701 *60D542BB6D69A45269C4FEE74BCCFCF9564C9BE0 A
929,700,702 *60D524188FC3BA391FC5757F42CEE9E26D718DBE ALudG
929,700,703 *60DFDD82D698B320EBD0952A43DB7974A28861BE Alueiltaed
929,700,704 *60DF8FEE4E5E29FE6DBE308B490BDBF0A7D6342D Aluemetsing
929,700,705 *60D80CFC85B2956A95A6C67E272961400764FB3A Alugando0
929,700,706 *60D932D599EEDB8AD9E30A084ABF5C93A6F50302 Aluhm
929,700,707 *60D090B078B7000E9C0D61DFE67EB4BC8056BC3D ALUk(
929,700,708 *60DC6ECA544E99CEE70465787B5E7BF91AEC43C3 aluksillas
929,700,709 *60D66A3818252F0B29831AFA6CD33BA75A7A0231 alulreagál
929,700,710 *60D9D1CE99480AD2C6718DB16D31848BFBB8E993 ALUlw
929,700,711 *60DCB1CAE17DF050DE91AE64FFEAB2F1D2F4BDBC ALUMBRADOR
929,700,712 *60D80F4E75A59993B2428A2422A024B797D07753 alumiinilevystä
929,700,713 *60DF378C4F4A4B5DF0505EB26F74DF33B74338D9 alumilu.bbs
929,700,714 *60D5207AB02A6A1AE923BE31F755DB04BD5DCB5D aluminiumabscheidung
929,700,715 *60D0CD5E4E0CDCFCEF4B2DFC905FA4A7FDBC2DF2 Aluminossis
929,700,716 *60D2356B5E1DBF52D31158E9719127D89B22A51F [email protected]
929,700,717 *60D4D73950AA0B97E255B3A442ECBC2D3D899F62 Aluminuium
929,700,718 *60D117737FE36A2814CC66F54DA00803680BC176 alumkavadi8one
929,700,719 *60DEDA8F3EAB46BC344E1CCFA930715C8A7D605B Alumnus”
929,700,720 *60D6A0A1BB24F6E3F18A8DA0BD26BD05D59A4413 Alunir0
929,700,721 *60DC6444CC51B49BB9C5CC655ACDD2ADA337F5CD Alunorte
929,700,722 *60DD7FD5D95652B0F7AE7FDE295D9661262DD9EB alunor—who
929,700,723 *60D943AFE81208C63736907D3366B77AF7569B5B Alupiced
929,700,724 *60D924BFF3080BA6CB6221064071E32A36D16995 ałupka
929,700,725 *60D4C76D0E048A31ABF84BC75BF5F1899999F723 alurede3
929,700,726 *60D253EEBE902DB15D05B031D0B12A30254650F5 alusafe1500
929,700,727 *60D4F64158A88AD3109C61ECDDBEC3A85E26974D alusido
929,700,728 *60D104F194F4C76A9EAC78B5058A9CC0DD2902A0 aluskasvi
929,700,729 *60D61BC5F651C223E9439542BED86C378A726885 AlUt8
929,700,730 *60DE054E1D06470DBF9CED931D438DE867C154F7 Alutipak2
929,700,731 *60DD509282D87F4C9F4B1E6F76A8DFADF3A3C75D ALuu!
929,700,732 *60DB58094A5E2BC87790F52F65406A5327B48FED [email protected]
929,700,733 *60DD584AE0AB5F81F1B5D8933B570E6B9980D08C AL,#v
929,700,734 *60D3389D66F41C77B89627F3B21591B8ED31807F a%lv
929,700,735 *60D88893E9B58D5253A4C8C5FDCDF21AFD526FA4 ALv04
929,700,736 *60DDD5E75CA55B554C8FD6F568E325714A470998 alva.cherwinski
929,700,737 *60D68D19A33A526F0B5BFE59803D6E6AE481555D alva.erlandson
929,700,738 *60DCD4936F98C2B6E26C8576BF0BB653193055C7 alva.eversman
929,700,739 *60D594EE96F7EB8B911F8CBEF2316393FD119052 alva.foose
929,700,740 *60D497E467379B3F31A7B05065FD2EC4A35E879E alva.giacalone
929,700,741 *60D22A71513A9669B657A2960EE0F437B137D2B5 alvahtel
929,700,742 *60D923CD289156B46777A7C531A82F3BE76F946D alvalinc
929,700,743 *60DFBA1C50E3EF99BC507E570B8D7AF1D226FB9E alva.nelisse
929,700,744 *60D97C3CD86700EFC54C61489172F6BBDD555549 alva.patillo
929,700,745 *60D3349E4397A00D482221016E63E8E5CA0CF2C8 alva.paules
929,700,746 *60DDD95AB9E579D9CCB2AA520FFD59412B634A14 ALVARADOSCHOOL
929,700,747 *60D6110DF44353876D060B8436A650E4B7392BB0 alva.rendon
929,700,748 *60D4871776C7C6AF50C2E42278750FFCE9408556 Alvarine9
929,700,749 *60D9DD41149C970F28902B956330A7EDB7A7FAAB Alvaro206
929,700,750 *60DD99229B5CAC59C9CAABA9CD01EF4E0444E59A alvaro74:0072563
929,700,751 *60D0B366DDBB8B89DC5AB0549BD7F4D4F9F19278 alvaro.budd
929,700,752 *60D0EE0981F249C4E9930FE7EA68237DA20ABF11 alvaro.corrga
929,700,753 *60DE6E3BE5C4C860341A1777928354BB086304A5 alvaro.demagistris
929,700,754 *60DB5F63F05146FA250F5791267527B2875D3E96 alvaro.dibenedict
929,700,755 *60D4E4C16D61063CDDDC4E68694D240EAB63E88E alvaro.dietrich
929,700,756 *60D9BBEA74CB803ED99F4024CB1D9ACCAF141941 alvaro.faraldo
929,700,757 *60D60727E29E49270574DCCC2CC708B9BB5D6B43 alvaro.fennelly
929,700,758 *60D7DBC411610F490136D688BD936BAC0FDADEB3 alvaro.gainer
929,700,759 *60D9EC78DAD130825FE20183DC6383AF9AF215B9 alvaro.hagopian
929,700,760 *60DAA840E5065B935EE21C0F2023BCBF0B5026AA alvaro.haugaard
929,700,761 *60DE227029CB0C6D49407A74169A883BFBD6BDAC alvaro.helfritz
929,700,762 *60D782E0863414760AEB84B05BD71A1B0A555E54 alvaro.lerman
929,700,763 *60D5833C9D5B359AFB34899C70DA1C8D5C3FF65E alvaro.liaw
929,700,764 *60DCDBDD31E659639C892F97F7D6CCB9D691E56A alvaro.milcher
929,700,765 *60D1BB3F4062B54036B7DE5B692FD2A2A3175BBB alvaro.nigl
929,700,766 *60D1911AE8872B5EA44E95636431CEE23036E5A0 alvaro_on
929,700,767 *60D41FA3034184393D24E858678BDFE9FA2DFD1D alvaro.orosz
929,700,768 *60D3A779F62F10D0A302B2F3DF006C1D24CAD75E alvaro.roblin
929,700,769 *60D8B99E0587CD35650C94AC9B4CF8B16302BBBD alvaro.rutherford
929,700,770 *60D9366947DE8BE517D8A10F9B8B6EF5AF96E992 alvaro.salb
929,700,771 *60D87A41EA6A42B8E9425DDFAF8E11FD133C16AA alvaro.santwire
929,700,772 *60D3329C3D86B0DE4C1467185393C68115B64892 alvaro.sidles
929,700,773 *60DC54E93ADBEC05EBF49F74EBAB997B3CC9FCD5 alvaro.swenk
929,700,774 *60D2A169E2180827E71808D03A03FAF30FA8E3B8 alvaro.trevis
929,700,775 *60D31FAE969FC9D80A79F9C20EC52BA4A7B8F69B alvaro.trickey
929,700,776 *60DCF6AE4B78B282C624C127CD8CB16C2F08D49C alvaro.ursua
929,700,777 *60D95832A876FD8769F8D00A2C17B3191B2E1683 alvaro.walawender
929,700,778 *60D74AAF5B6D762524D5C61584669A3BDD637248 alva.senger
929,700,779 *60D55CB3790A0CA7C7E86A33D98515A25C4FA126 alva.shiller
929,700,780 *60D63195DCF77E3D511464BCB10B71B976714AC8 alva.stoeckert
929,700,781 *60DB58211F7CFF89B4F23772638A19CA646E15BB ALVASTORP
929,700,782 *60D1FFBB8418B1E191D5329BA318A5C920EB385D alva.traster
929,700,783 *60D8D10482A286F52A6E565D6ECFE914928DA114 alva.uvalle
929,700,784 *60D452BDA03571505658E2FC5D42DAE4EE80C045 alva.warsager
929,700,785 *60D84330A40F0576EFE9F14E68D66D7365C9FAD8 alva.wu
929,700,786 *60D4715E2DD5DA12D4362083E050252709C7D6CE Alvd%
929,700,787 *60D3CB9ABD2A8112E5A0F0D7CD59257E130443BA Alvedans8
929,700,788 *60D9CBE3770828A4D956D80537BD7BD6BDF1099C alvejarias
929,700,789 *60D3F3773B6F5D2E65822708E1E8A7DE9544CBCE al.ventimiglia
929,700,790 *60D96E6F93A57A7CCC1A5494B62A26EFA8BE2AF2 alveool1234
929,700,791 *60D845347D94113F6E947CB8D75ACCD5D76A9FA4 alvero55
929,700,792 *60DD58BA308426F867EDF9D98E0BCD9AB5E0C391 Alvhl
929,700,793 *60D27792998A34431878845D489990E87D055975 Alvin372
929,700,794 *60D22DB6B7390B4034004340F3D8D39ECC19CB92 alvinbarlis
929,700,795 *60D3DDE9154BB2ED577620FCAD494724C46C9E1B alvin bello
929,700,796 *60D820D516FF5D03EE23885F973159B611D51515 alvin.brochu
929,700,797 *60DC24075318B06AC2F375AB3D04F344D5EC0339 alvin.carillion
929,700,798 *60DCC6AA3AE0C734BE5EEFA2D786C97C8A43189F alvin.desonia
929,700,799 *60DFC2AE992FA594F9FB05B41EDD079913CB9C0C alvin.eissinger
929,700,800 *60DCC9C1C519DA38E8B68E8B2FD94ABD36E8ED90 [email protected]
929,700,801 *60DA69D6B9E9AC693D4CF3EAE46D6889A154ECD4 alvin.eylicio
929,700,802 *60D6BE88D0B0DC47A4A1A18EB074D4358E1E03E7 alvin.feast
929,700,803 *60DCC837A77AB4474F461DBACA072C818E738E74 alvin.gatta
929,700,804 *60D775B5862BDE98BC30FEB20D57ECB7AE2304FE alvin.gemma
929,700,805 *60DC426B5E21DEF5A21D18864EE146B6A5BC41D9 alvin.hoffmaster
929,700,806 *60DE46474EECABA250B363653A80AAABEE3F552E alvin.hudnall
929,700,807 *60DEC31F17B4BC05F73062983C522D397CDF4788 Alvinism2
929,700,808 *60DAD5C1F70250A2BAF7044927BEB4F7F38E6761 alvin.keath
929,700,809 *60D3961AAA1A8B065BB04ABEFC9F66173C437484 alvin.kriegshauser
929,700,810 *60DBB574766FDF07822F8BAD0FF34E169680C810 alvinlung
929,700,811 *60DB5489990F086A3C09730AF043DE9AD69558AE alvin.munerlyn
929,700,812 *60DF7D7B04DE432FD0E441A028AAD29404FCE069 alvin.oesterreich
929,700,813 *60D95B4E6A318F5EC7A5F4A282A7637B1D32C47C alvin.peroutka
929,700,814 *60D0B67103A94CF4DF0D364C261ABBA81555CD7D alvin.rosenzweig
929,700,815 *60D76CDA2C4732972A950A32CBE6493D2F0C4512 alvin.schradle
929,700,816 *60DF81A4AFFF10CBA3B2AA4F6C31B30023D9E3FB alvin.sechrist
929,700,817 *60D6183F3F544AD9CC3B2D9B7FC2CD026DAA43D7 alvin ten
929,700,818 *60DB3985B9EB5C8A0B9757941DBA5A9F2F021020 alvin.venn
929,700,819 *60D78E92581C2F5FC147B27764ABF0294E410600 [email protected]
929,700,820 *60D161795B26FFCBDCDDE6EAAA05EDE1DFAD5355 alvissaraste1234
929,700,821 *60D275FA0D6E62E1AF0C48CF0A8907E68CE2D281 alvissmal5
929,700,822 *60D122B37A4E82094D3B1238A42B03DB1D829399 AlVnh
929,700,823 *60D07F73AC8D10C731EA8F60DB3B1AAE989CBDF5 AlVqo
929,700,824 *60DF802A893F829EFD0A5B42D0481D4F7386CA03 ALVR6
929,700,825 *60D0AB5CD3E33F9242C2D7F3BA06FE04B795C2A9 alvsjomassan
929,700,826 *60D29076D9BA96C54AA490104CD719C0AE666F35 ALV_W
929,700,827 *60D6EAC7092BF531A9C41A02F404AF551991FFDD ALvX
929,700,828 *60DC070C2724C4915CBE3F80EA14DFB8D61F0DC1 ALW9?
929,700,829 *60D3038D6BF36A83D4C80DBB8977E989DE7E79CB AL-WADIDS
929,700,830 *60D23352149850BC36A58A0CB098187243AB09DF alwayjohn
929,700,831 *60DB031C94C775683F6D4E66D181628AEDE74024 ALWAYSBANA1
929,700,832 *60DF7522567D64538F66BF056C710DE7FA5B48CE alwaysfreshfish.comwww
929,700,833 *60DD058A8A829C4733540939860EE23E6519E3BA Alwe?
929,700,834 *60D6D118901D23649E5DEE4E1598477C103317FA ALWEZBTCHN
929,700,835 *60D81A9E435053ED056158F1DE699C22A2CF1844 alwise2
929,700,836 *60DD7ACED9BCFA1CE7314BD85EADD39F83563440 [email protected]
929,700,837 *60DE59CC4CB8CC4F11DD809E36D37B76FD7BCEB8 Al=wk
929,700,838 *60D319F1F32282DC0E9A45791C1A3B36DEA7B1B3 ALWSURN
929,700,839 *60D9E1C05CC3741EC47233891D40E02E9D99142F Al#Wt
929,700,840 *60D5C768D6B987D42C00E599D30FD4B02AB1E1BB Al)Wv
929,700,841 *60D89B837C2CFAB9F0FBC7B509E6B7A888E7B6DC alwynsouza
929,700,842 *60D4367EF20931A7EB0873628A3AED9EDA56E02D ALwZm
929,700,843 *60D1933CEF746D73F2F7281F89151B2723CC0971 ALXkV
929,700,844 *60DBB2ECDBF40B54C7DA38F4079299284A5F2814 ALXoA
929,700,845 *60D7B3F27ADF4A4E3CD8762EAE672C602AF01C4B alxu)(*
929,700,846 *60D1981A8A030784145419EBB13F47798688E8E3 ALXWm
929,700,847 *60D1E8373533F0745B345808FB8D6A38B83A60BF AlY.+
929,700,848 *60D9EDE62A6961395B6D02FCA27B634B2AC39B9E A=lY8
929,700,849 *60DE66B8CE7C81A21C1A61AB44C4BAC596775A7D alyashah9
929,700,850 *60D0870F37C6A35B6C4EFED4FF290F64D34C8033 alycia dawson
929,700,851 *60D018554F80E2BFFF8936CFCEBB0286BA42706A AlyconeByMillais
929,700,852 *60DCF23409C1F875417AFC6A6987CB1F1F298C07 AlYeM
929,700,853 *60D0F78EF4A73010824C30F73CC4902C4CC007CE alyloutfy
929,700,854 *60D209DA8ADE98285FD2B767C46C8A49DBFA14CB alyose?
929,700,855 *60D08354A19A6E5B14F2678087AB57F27B3C01DB AlY!s
929,700,856 *60D9E88B79615AD674659FEBB29524434B83F68F ALYSE16
929,700,857 *60D05FFB95F70244100239647E570637D480FBCD alyshadouglas
929,700,858 *60D64346E31372DCCA5F2F25E44CD482D418C30A ALYSHAHARMON
929,700,859 *60DC7275F4CA48F0665B4E6C759A2CE702575F9A alysia bonner
929,700,860 *60D04222600ADECAD3B2EDF678E7012FAAE9D388 alyson207
929,700,861 *60D6549D27B2644A5D2E6F04E3140467BE6448DE Alyson549
929,700,862 *60D456D4E2CBA1536B6ACF9325B59766DB2BCD24 Alyson66
929,700,863 *60DE69AE5637C7AC52A29D32B3CD613C7832473F alysonawadjie
929,700,864 *60D6674FEDE9A4DAD0B3AE3040F05F1DBB6C7DAE alysonmoyers
929,700,865 *60D30C259B1057BAA8C66C649BC6CFE02FCD8E40 ALYSON-SASHA-ED-YOUNG-GAY-AND-PROUD
929,700,866 *60DCD9FD96F2E2A60A416AD256A39BE500A65263 alyssa939
929,700,867 *60D5671A184781E4E6EE07B012007C685E423262 alyssacapone
929,700,868 *60D144E2F9184CD8E10DBD52A25BA806956EB868 alyssamoreno
929,700,869 *60DD79FD9E0C02587C2A6B326671D232ADC392AC alyssa sabino
929,700,870 *60DB1A9760FF498C5D6915CD6F5CB430026A4A65 alyssazizzo
929,700,871 *60DE0195C879F58A9580026D1EFDABA9972664B3 aly ulrich
929,700,872 *60D79E347AA776C653B29D8CC649692047748A29 Alyushina5
929,700,873 *60D0D813161FE35DCC1328F859FF1C224F94EB6A Alyvia063
929,700,874 *60DFE94C78EA6E05E3F10215E60995698F3AF7F0 [email protected]
929,700,875 *60D25D9EB4CADBD4A7DB476B7CD13D6320674BB8 alzada0
929,700,876 *60D4B254BB1C08C01E43C3E1E40A8D429D7D992D Alzbetou3
929,700,877 *60D4D0EBBE5D5E067F7039B0E50B66F9A7A2A92C AL
929,700,878 *60DB555D5E811786B9ACC78913DB3D03778E360C ALZ!f
929,700,879 *60D3BEBD6D575706E6267EA8B5121DC565946B97 ALZgE
929,700,880 *60DB9E3F3E12CC791050D027FB82105838BC5849 alzheimer-insights
929,700,881 *60D351A44FCAAB0ABA936040DC2050FA4E1AC82F AlZS0
929,700,882 *60D21AD16DF611DF507C25FF7171824539902CEF alzuhra
929,700,883 *60D150198D6E21C70BC283CC98F50972467120DB [email protected]
929,700,884 *60DC862C78AC300BAA7B95C1E0A2DDA4C96545C0 A=;.M
929,700,885 *60D022A4F7B3F96CE3A09A81E10CB50F6669263C A;%M/
929,700,886 *60D01C4B37809E1B6FD65CD3DED1C1D05A8CF7EA A?-M:
929,700,887 *60D0B64765C8AEB6F7781EAE4F2124CCE863FDA1 A(M
929,700,888 *60DE8EB574E0D6ECFE172AF61DA0DB9FE4ED332A A&/(M
929,700,889 *60DF8C76A9054CF4862C608A2283E0576EB93A1E AM.-:
929,700,890 *60D4CDC297DB04649BF860DD7E955C3B565E3C0A AM.+:
929,700,891 *60D93A1F6F065BF04EA597D6E4B252BAC0C6FDB5 AM)/=
929,700,892 *60D3CEBEB3CA288156064F963DB27F45DF9E9A15 A_"m,
929,700,893 *60DA3D89EE21503B8B41F0CF6D0533BD161EF105 A_$m"
929,700,894 *60DBAFB7987BB00F0F9A0E88939407F07B0CDAFA A:!
929,700,895 *60D8724F81B30008EDA81E9586E2D4EF80F79191 A".m+
929,700,896 *60DD60820B7D31A1910330EC2F3AE6261E7CA028 A$m=%
929,700,897 *60DB3E8EE8D7F6E3FAEA346D85F1AC5A52E89230 A$m&)
929,700,898 *60D3D81FAAA8BD6778463D2259EBB9763836503F A%
929,700,899 *60DE3FA4FE8FE3C24C967D076785FC9F0F0141B6 Am???
929,700,900 *60DF800D2C6140575C9CAA6F593051D8C0C80E62 A(m:0
929,700,901 *60D8670F445027EBBD8AB60BE719A488AF8C6127 AM0HU
929,700,902 *60DDC2359EBE69B19F113BE4E74A4CEEE5FAB76F AM0R7!Z3S
929,700,903 *60DEB72657299D188CAC0E0F87A17312C00CE9B7 AM0tH
929,700,904 *60D54DECE3846A13085F301DF9265450088CBAEE AM1_,
929,700,905 *60D6A81F85E647D59EB29C82598C97491DD0E4E4 am-128uss
929,700,906 *60DDA7C4599F501DDFF5CC14706308736A9036F9 [email protected]
929,700,907 *60D98A5AE27EFC51AFD16A73B22EBC370D7EDFCC Am/1A
929,700,908 *60D8660E6D8F5F4C0CC7E53F92CE041DC88CC027 Am1F%
929,700,909 *60DBB027C1DDC33893F456491D6F52A8667F21BA A(M-2
929,700,910 *60D9388EF12AAEEFE924F65D2BDE6F2B8E1B5C4B [email protected]
929,700,911 *60D5154DEBBFAA2D49AAFD8B941D30809B009D91 AM2604
929,700,912 *60DA162C225CA1A050FF067C1C72F36A4941DE7F Am+2H
929,700,913 *60D87CA852725B0B3FC12DEB8BF6C339B2004820 AM2l2
929,700,914 *60DC4B2EF231F5CC3215816795912DA80288D814 AM2lk
929,700,915 *60D0F69B40EFCD32FF6A1E79F9DDB52746BEFC18 Am/2r
929,700,916 *60DBD3ACF17A9E81684C6E7BCF76FC10901D7C03 Am__3
929,700,917 *60D8478691D248293AEEF97E0874A9184402BF21 Am/_3
929,700,918 *60DC8BCF46F5F8B561E35A0F18EF13CD9925C110 Am3#c
929,700,919 *60DA8CF4D6C5D79CB514B4A403608FC9EE5C26CC AM3Da
929,700,920 *60D3B84361E78E8E949C7B9A99A14EF8F23A6C11 Am;3i
929,700,921 *60D9A9966BF4DBF6DE35249BECDDD69C1E94A983 Am3IW
929,700,922 *60D78983064095580BA8C795199EA4C863777564 Am?3p
929,700,923 *60D8BBBCD401E270578BF64FDF547DC8B488E8D4 Am3pg
929,700,924 *60D2B770EDD688049B22888E9DAC46BD8B7DC8D3 AM41M
929,700,925 *60D323447DA027F86FAFF9F79BD3B6ACA7A58F1F Am4AT
929,700,926 *60DDDD7C670E4880A6A09A603DB8AFE69BD37433 Am4g/
929,700,927 *60D994C7AB0651D96CAC1B81652F2442A8688199 Am4gB
929,700,928 *60D59D5D078751B07F4EB4DA5E54BEAA87A382F3 AM&4N
929,700,929 *60D87A1BD8890E430DB04AB044785B158A7A3345 AM-4p
929,700,930 *60D95AD6632DB453AC8F303E7748E57ABE7DFA27 A"#M5
929,700,931 *60D5E7C4FD45FE6240B00C3082581BA5BDD91F10 AM50S
929,700,932 *60D89B797017FB73AB92A9AB33F627C0086EB926 Am57c
929,700,933 *60D6C1738C0917933FC851FE20EA661C05D54743 A.M5e
929,700,934 *60D969C24E5180F0BA2EF8427CDF0D425BA44B80 A&M5j
929,700,935 *60DC1B0B2E0BFA8557315059BC790CBAC21782F3 Am,!6
929,700,936 *60DDE1094B2A3705C866ACA0E3465EDD143FF807 Am=61
929,700,937 *60DF2301DFE786C04DC535CF946451CED5945474 AM62P
929,700,938 *60DF8C95F1EB0A42A8AD64342CC15D4104AECBBA Am6a2
929,700,939 *60D8259EC66D8F8D2636237199F6C6822903C389 Am6ba
929,700,940 *60D889659C9AFEA7C70E9CF8A5710B673D4D59AD A=M6j
929,700,941 *60D816FFA6BB2A7487809EE39372F85F818E6E6B AM6p(
929,700,942 *60DABCFAECF148A34F05C2F52041E3AECE6C2725 am6p
929,700,943 *60DA17F2048B66CBAAEF98CBC24C887FB9D3A8C4 A$m6s
929,700,944 *60D6AEBA1A3F8C84131910DF1DDF919C4D32E49B Am6!T
929,700,945 *60DBDDB937DA928D756EFBAF19F9E1E4E47C0ED4 AM7$0
929,700,946 *60D2422860C13BBBC322000EB2ED8125223F69A9 AM74D
929,700,947 *60D8CB27E9EABC06C38AAF0C8A5B5FFC1E737A03 A.M8(
929,700,948 *60D3B496D65D3BB6C6F8CF30DC74E3608C7E68D1 Am8-+
929,700,949 *60D048228E7CAE882194390FD126961BD6EA43C8 Am80Z
929,700,950 *60DDFC2416C94DE2861FB22715FC926CF81E87B9 Am;84
929,700,951 *60D191146301C3A791F7054344FD98F8338203B4 Am89n
929,700,952 *60DB03063C73E01431755233A3CF03E14DD4FFD5 Am.8u
929,700,953 *60D26B6D82F80059946AF91B64CB996AF1E5BE32 am8ulatorial
929,700,954 *60D271DBCF987F83F92E616A68897EC13745988C A&m9,
929,700,955 *60D33411F85DD2DF506BDD1EC2B18FA992AF3953 Am97_
929,700,956 *60D1DE60E594EB31FB08E3C10605DA75E6DE6D17 Am9a2
929,700,957 *60D055C3C0312D9ABCAFAF02B98AD6FF1E6481EC Am9$d
929,700,958 *60D805F01991106940B15E3F916F6793D656F7AF AM9et
929,700,959 *60D85E79D0CA9656367F645F344FA8BE86E660E2 Am9f/
929,700,960 *60D4EA466E21806EA59F7B77808E88138008286B AMA1%
929,700,961 *60D0825B7597B13BE058E5ADC23016EFD1ACD941 Ama19ama71on
929,700,962 *60DC47B5794E853BE14868FD834FD10D76C037EB A,Ma3
929,700,963 *60D75FF8BB02718FBB7B2F09F8914153C7ECBB99 AMA;9
929,700,964 *60D34B737963778D3EB18240D9EC6458F7085B87 amachuclo1234
929,700,965 *60D30AED2E44F3694ADC6257C69F619F29159126 [email protected]
929,700,966 *60D338784FC1112205775B8000DE23A17730F8E5 Amadeus1901
929,700,967 *60D2E6F2921545CAAA06B602DDB7BD6FF700450C [email protected]
929,700,968 *60D16634CF41490D83C6F2A89A915DC6B66B55B7 amadeusjudith
929,700,969 *60DA6721E0E623CF5DA31F4D72684F3E8D5E065B amado.christesen
929,700,970 *60D3E4DD4122D3B0BA70A5015C3AEC20795772D6 amado.fakhoury
929,700,971 *60DA8D2D398D4058A8FB7CC0C78EF6382822A472 amado.lindberg
929,700,972 *60D33F74693DA2AD31E7CF1BD74CF55920E43E53 amado.moberley
929,700,973 *60D3BD8C4D27EF7839892B343E9D41FEBBE1838A amado.parreira
929,700,974 *60DEA1BF81609024BD23E1C1B7D98C1855E0D434 amado.ramming
929,700,975 *60D40B39231358D1EBE6D40AC3CF1A9771ECCED1 amado.riede
929,700,976 *60D272C17B4E842C0B0AA4BDFE069310D9C47615 amado.ronsini
929,700,977 *60D5B0FE6FAD7197A772ABE61FC45449F59B58DF amado.sako
929,700,978 *60D341558A3A9DF236DC7A68FE890B5D6B17F578 amado.schaap
929,700,979 *60DB1B5D6C82E7BD1865EAA05BEFA366650FBE0F amado.sitaca
929,700,980 *60D2CD1F0819A23FAF13E814F7418C965BC750CD amado.suet
929,700,981 *60D16EBC89F8C2AC2C685A5DD82BAA86A5FF8F66 amado.tees
929,700,982 *60D85AEC890323843F15E23D44853D7DCFCB7E41 AMAGASVV
929,700,983 *60D0DE7FD548DB62A9C2B048DF79ECF82A8F2827 AMAgl
929,700,984 *60DC6289E4269CFCC1D515EE130FF6E73BD696FA Amahajab0
929,700,985 *60D7D4F41ACDFF27EA852EB5178264A608DB0D05 AMAIB
929,700,986 *60DE0DEE9209D23F57754C0C38571A24EF5D986A amaigrissaient
929,700,987 *60DF339B2788D83B3B62AC6983DBC8947DDD78C2 Amai Kajitsu
929,700,988 *60D8E45EFF30405F6062827452CDBDDA365007B3 amalett7
929,700,989 *60DDC70C85A30D400608659F4A2F1AF8714E61A9 Amalgamavamo
929,700,990 *60DB2C1A5FA6F7E16009D2C11A9138B8533158D2 Amalgambelastning
929,700,991 *60DB6F5C68F843809BB72EEF1D63D02A6A6257C0 amalgameerdens
929,700,992 *60D0CA8E7D2693886E791AFDA7BEA87168F59AF5 AMALGAMERAIENTS
929,700,993 *60D4517C802FB10BBCD48ADF18F72756188DD85C amalgamerens
929,700,994 *60DC40697D5292CB3E4CB77D0F2818E009656FBB Amalgamino8
929,700,995 *60D8C8E09AF9EFB4AF97980B65877BF84A2F06E4 amalgam-ready
929,700,996 *60D42B65684B7ACB810ADE98E2C1B8CED71E94BA amaliapimentel
929,700,997 *60D5F69A184B13AA228B13AD00C3593768625490 amalrehmanpdinamo1
929,700,998 *60DB572F887C5D6170EF5D15C502D872489776B3 amamipersempre
929,700,999 *60D2333C8A373456E244910F266D3AEA2AC0C7EA amancillándola
929,701,000 *60D84FCA55D26C9E70E7D12EA99E9F65678B773C „Amanda“
929,701,001 *60D3A57CF419F1E4356F48463886CC68634B45CB AMANDA1967
929,701,002 *60D7AC3393C67596A8FA2B6A18294D71037025F4 Amanda1rusty
929,701,003 *60D34CC31F3173C39D1E990C1887AADB87D0DFE8 [email protected]
929,701,004 *60DF6679EE308F372C4C123BEFAEF86A2D639D41 amanda692
929,701,005 *60DE47978329E612085CFB390BA42530D0E292BE amanda banaag
929,701,006 *60D7E451CF0EFEA0D48FEF1DA5169D341AAAA2AE amanda carnes
929,701,007 *60D69055F91873014152D1C499AFD177C411E292 amanda eanes carter
929,701,008 *60DD6D106B5FCB9F2B5A50D0263E950C6DC36DB7 amanda fernandes
929,701,009 *60DA35F721EE878D1246C33DA4038F3A3F6E062A amanda goggins
929,701,010 *60DA0596C8B16426C607A1EA69DBAA86F5C378D2 amanda hyland
929,701,011 *60D94D4CDACA925A22A56D0FDB8B8AAAD6BA55AE amanda livingstone
929,701,012 *60DEF6E117C7A8D699791C4A97869392EB7DA2F4 amandamayled
929,701,013 *60D080F1BB1E374C19069213DFEC0354A20A008E amandareger
929,701,014 *60D9BF04E5EA73C05C223E0CA56E2F960F32B205 amanda rollo
929,701,015 *60D5F07155B21858CB1F35FB621E00328DCA2023 amandasampley
929,701,016 *60D715537374284E626DCFF691B621F1A0D5A5A5 amandasarver
929,701,017 *60D894EDA00DC5A0E639F27859002459569D46A1 amanda.shead
929,701,018 *60D29BF7950DE749CAE58A9369D7A749A1A8FBF0 Amandelbroodje1
929,701,019 *60D3376579B2AE77C38D6F3E01665F51C2B57A5D Amandusdreef
929,701,020 *60DA49DB34887AA11DE64894D9B86A75FCC6EA4A a man is a man
929,701,021 *60D0A9AA05342B0770845193B9B32A5A8BC20F0C Amanivon
929,701,022 *60D7F17E929752CEEA51364A5A052D559A8394FF aman/me/thenjim
929,701,023 *60DB061F2EA10EE8EF939D154F1BC4491E9C9FCC amantidiieri
929,701,024 *60DA5569CEEA55129BD61415D6509402C55503B2 amanuensises5
929,701,025 *60DC39A5DC12C814DEF7D707A6C75772AE6993D1 AMapn
929,701,026 *60D6BE841916514260CA6C10F7E09E1A3A896305 AMAq?
929,701,027 *60D64266E23679C2B5BC093627BD35F8635431CB Am#Ar
929,701,028 *60D05D3AA0A60C28939FDECD1E5F9DE2A21F568D Amara709
929,701,029 *60D1017D881FE7C30A845B6911AA9D96CFB4D0B6 amaralab3
929,701,030 *60D5539C81439E2FC6EB6163AFFF4CE0B331C4B2 amar:angels
929,701,031 *60D4741605C67E949FC790A45A8A8C08FD236075 Amare838
929,701,032 *60DBDF324EEA118930AAD2BE1B25C3C626F16F5F Amari419
929,701,033 *60D5C7706B02E24581EE883C6760DCB5D73A30D0 AMariaplaats
929,701,034 *60D7A9C1A4BE3AB8D12EE644FFF25EB763D0135E [email protected]
929,701,035 *60DEF8C5C56803A392888527EA721FC6CA183B10 Amarior4
929,701,036 *60DF875A95555E50612F3D4D88C237CF9336FAA8 Amaris024
929,701,037 *60D31CF77F948239C7D0284722BF830B999169AA amar kandolkar
929,701,038 *60D921E1BDB4BD107EF6D21BFEBDCEA19FFDDB2D AMARRE`R
929,701,039 *60D379A22ACC1589E8E011C8333668AAC7BF9773 amarrólo
929,701,040 *60D38C1E1BC768F24F2EB9AD37854F1874A0AE8D amAsla
929,701,041 *60DA2115E3DF0C9973C7C5F89BFD88C1CE8DA068 amassi1
929,701,042 *60D23E02B7DC551E41DAA291B0F922D348F7DAA5 Amateurhistoriker
929,701,043 *60D76043BE1618D1356AB49B37AD76C971CAB52A Amatisch3
929,701,044 *60DD1A9D66A20B093ACFE4D389B658F301CB24C9 AMATSIUL
929,701,045 *60D6077A559ECDCAFE5E69173FDF6C298D1AB4E8 åmayreyes
929,701,046 *60D91ECF45EEF088F57AFE5A0139000F056294E9 amaz0n3rn
929,701,047 *60DCDFDAEF8B6EEB9BF93654F5591A352A424BCA Amazonst1
929,701,048 *60DD586BA7A8506359637DE4542224BD1502E337 Amazzonio7
929,701,049 *60DC2966030002BA02B2DEFE51840880F3A3763B AMB
929,701,050 *60DF73BC63EAE54CF1FE0CE40C72DB982600B9C8 AM/b%
929,701,051 *60D27DCCCCBFEF2FF2613C0A58727448DF063C9B AmB1!
929,701,052 *60D5BE00ED181F4DD02451218FBBE14562F6EE58 Ambalica
929,701,053 *60D6D8C05401AA32BCC26CAAEAD834CB353F888C Ambani</span></a
929,701,054 *60DB97E5F6ACB13F85FF625B511DA048F1EE3424 Ambazhathil Karanakuran
929,701,055 *60DDEFD56E887348256758A391B272E2F30B2231 ambboggo
929,701,056 *60DBDA4F79E3543145232DBE194D816909B9F262 amberarmitage
929,701,057 *60DA5FDAAFF7D26A79F4D71640B1A7DD8B9D8F36 amber denyse
929,701,058 *60DAE596C9A62B193D84FA1503C250493A44781C Amberford8
929,701,059 *60DECCFE0E5352C2C21ABA9232C4D2B02E305E01 amber heifner
929,701,060 *60D451D8C04182AA0C5BC583608A44E99F3CC816 AMBERLISA
929,701,061 *60DD29490D767DE2A13C75BE4AAD3CE714F79C92 amber loke
929,701,062 *60D8DF70104D0456E93A406DF757CF5B02E99056 amber nicole martin
929,701,063 *60DED1D651902814125B14BA9464B867A8DD1B1E amberpadron
929,701,064 *60D3F42820F84D179861DDD71AAF481144441D20 AmberT.
929,701,065 *60D2D4FBE9F15A0D740666FCCA3A1379DF500FC5 Ambhor
929,701,066 *60D85045722AAC0C60BE84CA61127DF490860F3B AMB;i
929,701,067 *60D04E0FBCD8BC7CE8753C7DAEAD9E9040EBB9D4 AMBIDEXTRE8
929,701,068 *60D2498F8F7C15352F03023E27CA1380CE2314B6 ambiflawlessskin.comwww
929,701,069 *60DDA44656D51FD28AA620155EA3516CE744146A ambigi
929,701,070 *60DAA6C746D888BF41B7925EA0984A7D68D488CE Ambista
929,701,071 *60D8EF698C350925D41DBEB1EEEA7FF0A9B15EE8 AMBITIE7
929,701,072 *60DBEA7EF0D0D11CA35F1389EB9D164E4DDEB91B AMBITIONNERAIENT.
929,701,073 *60D2D86EAFEFF7F5C18DD8BB1162C17D31282011 [email protected]
929,701,074 *60D41CECCFA4CC9AB5605EA3A48FC3EFA1C27FC1 AMBIVALENCE (Instrumental)
929,701,075 *60DB7F959C8074BB4A0D8D830E26ADE0DA76CE1D ambluvsgc
929,701,076 *60DC071EBA69DDDA70CE735E33F24B9EAB51E69F AMBNICOSIA
929,701,077 *60DA27660D25C29DEA2E6611245F9CF39FB7A4E6 [email protected]
929,701,078 *60DD423692BEA2A200C7EA2DF69AF742C318AAB6 AmBO6
929,701,079 *60D187214305E1785E5F98C9C17A62247BAD7C81 Amboinaed
929,701,080 *60D6E4F78FEA6B189A78A10F93CE628B80770FB5 «Ambos
929,701,081 *60D173D2B4D1B83E34685889CC6EE9CC596B0F8A Ambož
929,701,082 *60DB9DE2B6C3749E17EDBC89351FE2316A5FB5E7 AMB#r
929,701,083 *60DE92087887558384ED1F4BA0ED2B9F48BC5C9E ambretone
929,701,084 *60D14FF04C6EE96F6FBCF8050EF8F220828E8A55 ambritesing
929,701,085 *60DE79D99AF5D3226B2C24D684A5868732AD95B6 [email protected]
929,701,086 *60D7CC15275309587D678262FEA41973CB39B202 ambroghetti
929,701,087 *60D760D816D812748B8CD10B210B691278A2D962 Ambrogio?
929,701,088 *60D194F8AC3B3F144744F4A731E08CF0A367003C ambrose.brockington
929,701,089 *60D3A0067B0DEA18E2833CAC75E6D0417AAAEFFD ambrose.caffee
929,701,090 *60D2D58409454AC392B8AB82A069B19537CD524F ambrose.cisco
929,701,091 *60DCCD8DBAE16A685B2F7BFEED3FD96212742AE7 ambrose.friedstrom
929,701,092 *60D409D06749F57C368B28D855E658E5F705E185 ambrose.jandreau
929,701,093 *60D0D7BA96BCC89111ED5AA09BC249F27CF32545 ambrose.kabzinski
929,701,094 *60D85FC35E8EC563970D67343361B42679FB583A ambrose.kubera
929,701,095 *60D87DB6CAE5BB36DB521E55787E2853E74B4EEC ambrose.lofaso
929,701,096 *60DF309A8BF5B4D06E5B96B99923626AAD70D0F1 ambrose.moes
929,701,097 *60DCB2F032B08028DFF0BF8AAE0CCB255C1E5D5B ambrose.moomaw
929,701,098 *60D5AD2C8577F95659F77BF96DEDFC41D84652A2 ambrose.norgard
929,701,099 *60DFD75E91589F809900BC442F1AEEB1D0E54257 ambrose.planer
929,701,100 *60DFA43D524B76E8DA1A43B2E35AC96C542D5CDF ambrose.pottebaum
929,701,101 *60D73B33DF1C08AE112BDCA4C13C482AAABF9FDB ambrose.vagott
929,701,102 *60D8C51A2B2E9A1F2C80605E15DAB68F38D47086 ambrose.vitro
929,701,103 *60D090CD29B06A189BCFA01B1F145E9CD5ADB8EB ambrosio185b
929,701,104 *60D3A8D91A53F20C3031B09D2D3734DE3A16CAC2 AMB!S3XUAL!7Y
929,701,105 *60D5B6D85524AC52EED402A29F692BC298DD7BFB AMBTGENOOT!
929,701,106 *60D8447F230A29EA13902F6357A2692A88A01580 AMBULA+!0N
929,701,107 *60D997408718E23C0FD899D885A42534973058D1 AMBULA7ES
929,701,108 *60D05AC3722798ED943B48DB561FD02B8288052F ambulancen8
929,701,109 *60D49CAE4737E4F4EB63275CC73FAEAB84C293AE AMbWL
929,701,110 *60DD983DBB84E33D17AC392F0B8DE57FBFD5BBD1 Ambybsw6
929,701,111 *60DA6A5B206C2C3A6CD4F4E3E7AF1A8BD4E8AC1B A-m;c
929,701,112 *60D8086557D24BC0039445690BE30789F05402D0 amcadnet4
929,701,113 *60D383EA0A17144D2B8B51872E40C4172D9F8BC7 Am.ci
929,701,114 *60D63BED6F4E672BC14D0A91F4F37DC1B5ED9DDF AM)CM
929,701,115 *60DC585D1D08C27BFDFB8F4AF4285855FA95A11C Am&cm
929,701,116 *60D0648D853DEE78F0DCC030385D909E31426975 amcomicsBSW
929,701,117 *60D1F53B1FA711232DE29BC624B9BA5519C4E184 Amcormack
929,701,118 *60DE1C938B8384A07B47069DB53CD64E113BABDD amcranorg
929,701,119 *60DB19781A748377F6098C153B5E12F1AB773B01 A/MCv
929,701,120 *60D938824B50071D23499DCDAC8A6F71988CE726 AM":d
929,701,121 *60DC3F814CD46AA509CB9DECA230401468E66F29 Am=+d
929,701,122 *60DA8B2FDF5D854BDDFBDAC452886DF2FF1A9803 AmD3;
929,701,123 *60DC14A75388DEE869E0CF2575654FB9D686E7BA AmD8m
929,701,124 *60DD8B4CD661279919EAF8CE9270BD6D35B24706 AMdbaa
929,701,125 *60D4CE8AB795F1A904249CA6DC56E5CA7D508287 Amd(e
929,701,126 *60DF29D125822E774D3C351440C015FDBBC7DD72 AMDeq
929,701,127 *60D212A87408EED8B44CE73332F3BFBA4F8080B8 AMDfP
929,701,128 *60DB2FB7772A51BC6066DD86B9F82A378B226E6A AM(Dg
929,701,129 *60DADD6E1B56E2762A0B04AAF8CEF8B057C6FF1F AMDg6
929,701,130 *60DD7C4998D9F466F3997E976587C3F5F0AF0D98 AmDMQ
929,701,131 *60D6C828783BC496E992787F64446DBFDB95417D AMDr?
929,701,132 *60D0DB98F312A5D6D17928EDA57B2C6566631C8E AMdV1
929,701,133 *60D1FA539336C0D0A76C1980DF049574EE65A1C7 AMdvB
929,701,134 *60DE1678261F9EC41EA3BD96CF06C4FD9817DE7B A;;mE
929,701,135 *60D02D82F4B761647BDDF08DC418B54BDB77A5EA A.;mE
929,701,136 *60D9B9E64512FFB4D20B3C2BB55E67DAE6FDC758 Am%;e
929,701,137 *60D8C2EFDD52B8AF91432F18CD8354DFB3B52346 Ame#.
929,701,138 *60D7448DD6CC936BB1FB38640D50080FBC968E91 A!ME0
929,701,139 *60DF538CE780D21E4873E0EA0099D4A969196B54 AMe1V
929,701,140 *60D60BC532A3E57D5B573AB79C81564BBD1EA904 AMe5"
929,701,141 *60DF0E6A8FE88D946D40E4E5181B3BD0AEA2B7BF AME=8
929,701,142 *60D05040C1A34568A5AE5EDCC3252FB1DE2214C6 AM$eb
929,701,143 *60D30785C474DC85DFBCE9654ED378CA04C60C20 AmeB;
929,701,144 *60D20E57C22D7DE84DB65E5BE2F0ECB0DFB6A8AC Amebianses
929,701,145 *60D446481D3A85B3D3F5320DA096E5887ED22883 AmE:C
929,701,146 *60D766E9B6BADA20F37C49F16BB570BD9B162B4F Ameeltje7
929,701,147 *60D97199CAB1A7CB7B4024750AB5CCBBCBB39BDD ameerfwj4
929,701,148 *60D0C55242F18364BDACFB900CA9B9BB3B3F4991 [email protected]
929,701,149 *60DF9A2E44C2562CFAD29994CA5B5B7F93569DDD AMeGU
929,701,150 *60D50A913F6DE4EFDC3DFEF412A25B1BDC4A94F5 サークルameのhp
929,701,151 *60D15C57D385F32BE35FD4BBAD041E958764C564 amejitwika
929,701,152 *60DF14C009E4EACCB84F3E5A884176D1E2FFA50C AmejW
929,701,153 *60D984BAF34C68F73DDDA2318C49B88CEF660307 Amelbouting
929,701,154 *60D7DDB23DF0C379C3DB214EBD0A6006EE9EE9C6 amelia461
929,701,155 *60D8982A21029DD75E5983782A2953BF2061E373 ameliabenton
929,701,156 *60D0C26373B80EA14517830FFF58826E23F2187C ameliapaukert
929,701,157 *60D5F04A630A2B5194A9FD2032F912EBCD3FCBA8 amelia thomason
929,701,158 *60D9D0CD84C939F7FF32159EC46FCC78C2D7D2FF ameliexed
929,701,159 *60DAC3462469B12E62F3225B3C968692143677DF amelie zhu
929,701,160 *60DF4CD6F313DE51F94B1F6E3E0F0FB2C9695FE3 Amelonada4
929,701,161 *60D2CEDB45C6C1E3CF408F705151566B1E44505C AMELQU
929,701,162 *60D1BAA44B23A25DF1BFEA44025A5198C98B517D AMeMt
929,701,163 *60D5DD71CCBA2AA83CF46CCF7C1816FE58CAEB07 amenageriez3
929,701,164 *60DD9A8B831182FB5B504E1B1FB35054CE90AEAD amen&boys
929,701,165 *60D1052C9625E6DC8D9DC2836E1FFD8D02055134 AMENDEDNOI
929,701,166 *60D675A0F4D9776D4B3FCE35E2FDEA79B3175B59 amendeers
929,701,167 *60D90FB64CAEC6C340F0FB8FC9EAC2A64DBE09DA amenemhat2
929,701,168 *60D6D01AE62D75238F60016EE1D365CE140B776B Amenicor1
929,701,169 *60D946B40265F1510BB673FA3D9BEC28D048424B AMENITIES4
929,701,170 *60D7AAFC4F4479C091EE5F7A0DB9C0B7A0E2628C AMENORBAH
929,701,171 *60D3C6D7BEC38279B2D37A83203117A6DF3D114E Amensty
929,701,172 *60D77CFB05C2527E3C0540B08813CB3D3F6E216A Amenuse!
929,701,173 *60D9761DF10877B67E8A7FA0C1F0A54452270BED Amerciat0
929,701,174 *60D5F3C8A61EF2FBF14E7F6D8C8C6718A6B30981 amer hashem
929,701,175 *60DD93A871B74D984F9A34536CD02EFCD60D8D90 America218
929,701,176 *60DC67577FEE0C1D22B92EC19D7BEE3A2AD3E8D4 AMERICA7LAKOTA
929,701,177 *60DB77486790A8D1F73DFCAE8FE47F551783F2FB AMERICA7MAVERIC
929,701,178 *60D7A87DA669E11BDD5BAAD23ABE70CD706DA735 America (I Love America) (Jason Nevins remix)
929,701,179 *60D80A8AF22642B3BC2F35334C522C638465D197 american:America1
929,701,180 *60D4603A00F9F9298D45F7B8561BDAA92DA6D9EF americangolf.comwww
929,701,181 *60DCF9FF1EF5AB06B207E1B59C2025CAC6C6BB69 AmericanX:Baby81Sessions
929,701,182 *60D80D6ED404B01B7B16C75279A10FEA5D78F33C AMERICA-SOCIAL
929,701,183 *60D0CE1CE4D9BA2D7668FF1921AAB34C4E86EE29 americawright
929,701,184 *60D6444B976B5F8A2F719DFAB0D6463CA5D6E44D američkoh
929,701,185 *60D4155AD4E0572CAFAA42CD14701BB62B617B5D amerikanpiiskujänisten
929,701,186 *60DB25D9C005C861144243DFF747C7F059D40889 amerinc4
929,701,187 *60DF00061BA708D6E8C42DF131F84D3F22DA7A12 AMESANL
929,701,188 *60D8B735DB2AA1ADF8AFEA4BDC0B33EF9B44BA8D AMESOTERO
929,701,189 *60D082095190D08A0760CBF96BA3B6A9A7B5A768 Amestila1
929,701,190 *60D019C7E4F538BC69D65C834244F4107F32E6D0 AmEt6
929,701,191 *60D1C43A0C1CDE580C79F81FFB80F537278A6813 amethyst (fruitcake mix)
929,701,192 *60D58867393867F3D19F3BB3722A3A8CE1590D33 ameutées
929,701,193 *60D53110F1E5050837F86ADB7BE63A0E3FA76E08 AMEUTERAIENT3
929,701,194 *60D27CE86DD67362C9BEF12B7CFE20B4356600A8 AmEv9
929,701,195 *60DE65CBDF9806F723E1EEA6CB98EF07DA00F835 AmExPOW
929,701,196 *60D2D1890599787B96EB88CE8725D88A19D5DC00 [email protected]
929,701,197 *60DD12DB1891F4ADA4AB3464C565EE10A81A0F41 AM#F.
929,701,198 *60DDB31E63DC66FFF58873890B828207DF9CB9E4 A&mF-
929,701,199 *60DD42E6EC90F6C00820791A435FDB13A9591222 a(MF
929,701,200 *60D17EA58FAB95AC91669D9406038926B02EBF4B amf74xx
929,701,201 *60DAB248D183353E7162CC1B0C6D9610FA2FB43D A
929,701,202 *60D51EDEAA777100C29C80A24D10C940B8F91B79 amfikurt
929,701,203 *60D2005F683D8A1247400AF2DF2C92027B5546D9 Amfinnsson
929,701,204 *60D23F601ACD37112383E348AD72152E584846D3 amfitrionów
929,701,205 *60DF5DAF0A0756CCA7E572C62D3BD2487C49AB05 AmFlm
929,701,206 *60D7A5FC0A94939A507967A7C466A251B54E609A A%MfM
929,701,207 *60D74CBCA58B965E6EC905B005E9C85CD1484ED8 am-fmclear
929,701,208 *60D824DD7E2D64C37EBD1128A463C136047E2638 AmFn,
929,701,209 *60DAD04D9845C88A2A55B88D83C9D60202F6A4BC AmFNw
929,701,210 *60D8D01A49B6292FEBF7F23B2B884D8F1A8AB047 AmFOv
929,701,211 *60D9906B76A158BCE44FD569107F7C4BAE9B8DD1 AMFrG
929,701,212 *60D08A37D59C4BDF7A5EC8F4DDC149F42D15D4CA AmF&W
929,701,213 *60DABB8064A47BD1BEB7E98854039FF3EAED03D1 AmfXP
929,701,214 *60DB3056B998BBE8129C35A3D126B906FB9583BB AmfYD
929,701,215 *60D23407BA3B912DB2C7C1E8F18F150EC54A9D4F AMg/+
929,701,216 *60DE6E31E43F89CC18434279E316A955C1F584AA AmG3a
929,701,217 *60D5111A26857257D9436177AD0424EFB5C48817 Amg9C
929,701,218 *60D1010D04ABB8B7662084A29F451335605159E8 A&MGA
929,701,219 *60DE38009842786A01485A86F906A521A814D6D0 AMgdr
929,701,220 *60DE21E93D177AC8E88FF43F07F402E960558EC5 amglek
929,701,221 *60D56D3B1884A94550B1BD4A60D77283EC0A448D A/MgM
929,701,222 *60DA367BA96A4E20B020A3EF5D39FC122BD2D838 AMGNb
929,701,223 *60D08AD9F438231BBAC9A213DF9AA9289E5E4C70 amgNYi
929,701,224 *60D1364F572677C685024784E616A1DA5BB28E34 AMGP-
929,701,225 *60DD9F0D2E631A1B7CC91621A71A89703B181850 Amg(q
929,701,226 *60DC3C3A57C11CC95EB7C5BD2B7D2F1856D787B6 AmGQn
929,701,227 *60D2B97675FC3441EE1BE5F794B51710C135DCB6 Am#GR
929,701,228 *60D49A5CAE250C71E742E6ED988730193F3B3754 AMgr5
929,701,229 *60D843A0AF73C8938F4841C816C792671D3CF615 AMGRATING
929,701,230 *60DA06CAF01AF35C9449FF7BDF8D0A45E1B1FC7C A#-Mh
929,701,231 *60D372923F9279C4A6B83ED8E76F07AD2AE02EA3 Amh)(
929,701,232 *60DDFE968B0E23B5E08CB2B8960E9D1607136874 Amh$
929,701,233 *60D2C29CC199A1313EECEF1BF74B379F4A59B2B5 AmH1+
929,701,234 *60DC8D7DA1C83D5BB9F9CE674F7FDFFB03116EC6 A!mHa
929,701,235 *60DD812B460F01D3CECAC5C8B4453E38755F1A6C AmhDD
929,701,236 *60D30939F52E0355C3F9BFABAADD1106373E9AF2 amherstuniversity
929,701,237 *60DD00C0CEF5265A345BB3405D388820863213E9 AMhFL
929,701,238 *60D33DBED9D8BC76FECF58C931BEA18D9E72384C AMHpW
929,701,239 *60D23FCA7537E8DE2264374F9A22D42BEA660F71 A-MHV
929,701,240 *60D38E331AEB7BD9143EEDE38F9B2356D8B63CC0 AMH-v
929,701,241 *60DA4AD41933A0B57ADE014C9201FEDB4236DB16 Am&HV
929,701,242 *60D4AD04F8C93FB1AFAE3EFF60525822F9A4E778 A.mhY
929,701,243 *60DBA2A6853CB7CCD0BD9EBAE8307304F209A8AE A(MI=
929,701,244 *60D802D28503ED945A34CE553268E010B429C0ED AMiA1
929,701,245 *60DE3FCA529BBEE2857684CD873AC0FE3293EC56 amiah061
929,701,246 *60D78EC4CD88A29CAC91B47664E6740E86EC12E9 Amialced2
929,701,247 *60D9B9F40C53655638A9484E47A6B57BC1B2FACF amiaz1
929,701,248 *60DF96A3E0A298FDCF75664E0E04253DF8001988 Am?ib
929,701,249 *60DA520E48D29925C9265442FC2FFFBBDC318718 AMICIZIE
929,701,250 *60D1FC173403B84B3A0DA7FD9714983BC269F7F0 amicksommers
929,701,251 *60DDE7E8475511BCA111326D54CD9CC585C5CFB7 AMICOOL
929,701,252 *60D17FEC89A45C07C3C2B8A748B451944744D9F0 AMICORA
929,701,253 *60DA42B564AFBE2023A4EC777653ABBDB66A4C38 amicusveritas.org
929,701,254 *60D8B3A78F66F3DA6B1A6B478025A4A09D4CB96B AMiddleEasternRaga
929,701,255 *60D349A18EBADC2798372D55076086D6C4F97D40 amidei1
929,701,256 *60DA5184A9F187D8DC262F0ED31CC8232271A58B [email protected]
929,701,257 *60D656BCB9D138DD07D82A28C2E48944A95178FF Amidocyanogen2
929,701,258 *60DF509FD3346095201CC1A44724EEE96086AF51 amie beckett
929,701,259 *60DA638289CE46A0A397A02955F624484EC3F83D amiee davies
929,701,260 *60D6184ED2AF76DF521D5E1F2D9D4E07F0A5AB96 AMIE,SP
929,701,261 *60DC5527C6D1ED345D7D25D0357901ACBDF5634B Amigacoco2
929,701,262 *60D5C6514AE94B1B4C790CA655D2BBA8FC9FDBF8 amigaelvis
929,701,263 *60DA9C685FBE5746474C71E849AC7766F7298F4F amiglas1234
929,701,264 *60D7292460E6FA5A0207BDEC3A8495E7DFEADDEC AMIGOS78941
929,701,265 *60D8B4B1E0E6EE28610227E6784614B03EAD0017 Amiinonos
929,701,266 *60D03EE542058ACE88E5378EE7F6686C54C18973 Amijezum
929,701,267 *60D32255CD125D17E29E5766B88805F2F7383639 AMIKKNAH
929,701,268 *60DE27772957F4D1E2C15A7AFC94E9934C103321 [email protected]
929,701,269 *60DA7E9EB7C731D3CDE703705D0F1380C3CF31F3 [email protected]
929,701,270 *60D669F347282C8853D41888D36AE41D1C4D6D99 amill54321
929,701,271 *60D6B48F0C9699D00B490A8E5732F26C6830527C AMillionGrainsOfSand
929,701,272 *60DF91977285C0700602ABFA4399CCB59A6F250B amilo100
929,701,273 *60D06C2F9E5B8DA6B21D3DC0C922C849DCF2F2AB Aminarins
929,701,274 *60DFF689B256B43DC9F1482DD628DE209B086D34 AMINIC?
929,701,275 *60DCA648E53A4083D6A126795BD08E318CBBC728 aminoacizii
929,701,276 *60DF01B34B53C8168363231B5C986FC0D53D01C0 aminobarbituriC
929,701,277 *60DE8F661A9F518837ABE4FE281FCC8FDC5FF341 aminopropionic?
929,701,278 *60D16D0A41FF4A6359BD6EE46B481573D40BE448 aminoráis
929,701,279 *60DB989A35455EA0D5CAA98BA7E198F0E8EBA19A AMioG
929,701,280 *60D1CF974E3669AD7CE92143CCC5C06CBB422650 amir675
929,701,281 *60D7719198FE09398FA738EC9AA02647B3DB825C amirah502
929,701,282 *60DD37593C2B77BB8008BB589844DBA97A9DF5C5 amirahazmi
929,701,283 *60D23738B8E28BC1422FA065AB24BE33F84CCB7C amirfjellet
929,701,284 *60DF1AA2F266B82E4E7B8FAADEA5084C380419AC amirkhan3
929,701,285 *60DB885699E57905DA0F7CEB826774F98D6E271A [email protected]
929,701,286 *60D33BC2C141CB99DE7F3EC55C47E79752F1F771 amisarin7
929,701,287 *60D7A0156E3D695A85EA82A5F2DDE50B47219883 amisetup1234
929,701,288 *60DFE98844DFC936F3AD6AB171D307EE3CB522CE Amistosas9
929,701,289 *60D1316CAE8715831B7D845B4639435A56646491 amistoso123
929,701,290 *60D2A44279E0496683DB8EA871FDF2A6526C184A A"MIt
929,701,291 *60DB82C05904124B92DD68B995BC686CAEE91589 amitabh6
929,701,292 *60D57256C56ACB30E5FCB9288F2BECC5675E0308 amitav sarker
929,701,293 *60D7F56FFADCE2F117B90AEA151D8CE5231D0675 amitegains
929,701,294 *60D987E9BAE60956611BA13778DF3B5DD2E907DE amit kumar jain
929,701,295 *60D6EB2A1293D6AF9664EC92B6A774E97550AEFA amitnatu
929,701,296 *60D53398D1E0ED6C8BB511E887C0772B9549CD7E amit tsadok
929,701,297 *60DFA10454224746157341468A921DD5034C748C amivardZ
929,701,298 *60DFC0916B5E95129B4EE354A74AC0AB45D9D82B Amiya509
929,701,299 *60DE2D59CEEC0136D58140982BA5300BE738C457 amiyah472
929,701,300 *60DBA697DA6833FA91FC9C6D7150B89B8ADF51CD Ami"Z
929,701,301 *60D9469815EC5F3517E4B48D3F98CCEA9D94F42F A
929,701,302 *60D515D9FEFC15EBF9C891013029183C2AE2EBD7 Am(j;
929,701,303 *60DC80AB1ACB1D5FD77691BCA76253D4B0F60E1F Amj6O
929,701,304 *60D385BD735C23B272FA514B45BAB6AAE77BB9E3 Amjd;
929,701,305 *60D7EDC6F034795638B62DAE57FEFA825015FB11 [email protected]
929,701,306 *60D76F7B36E12ADCA3BF02CAD0DA38C646A54D59 A#mju
929,701,307 *60D58AD9B21E7383CE7B90A72BDAD940473603B7 A-
929,701,308 *60DE4E47F6AEDE35DFF7D9EBFFB8D5122CD92785 Amk2
929,701,309 *60D03EFDFD3FE239DB69769B6D94727C50B84550 Amk;5
929,701,310 *60D63A8DEC4E0B285785BC77EF79277D0D629A31 [email protected]
929,701,311 *60D75333F0F507BD2A80A6DD546ADC622C105417 AM:KC
929,701,312 *60D9F7EF1C94C2C0512ABF40EB617F35F387B7EE Am+kL
929,701,313 *60D6F8141CFBCC5DE90548B30FF186C3D6078ABE AmKlY
929,701,314 *60D734A1C92B176738374CD4AE37CC9884C5E3F6 A?MkS
929,701,315 *60D2A0303FE4137D284C19365B3E87FBBABAD76C AML);
929,701,316 *60D6EB2333451F0B2C0FABAC1E18D1F1FBC56603 A"m$L
929,701,317 *60DCB3C343C5F03126A02362602FEC5A1BAD46F3 Aml(-
929,701,318 *60D6EDF08DF03AA6D0B757DEE1DE5AF108B12D38 Aml1"
929,701,319 *60DCE912BAA19D3C3F28429AE411FD5E3332AFC6 Aml2B
929,701,320 *60D15150AE9956F8B54C9E5342668742F67F2C83 AmL#A
929,701,321 *60DF941EB8DDCB57120E610A49D707D25347EB9A Amlaíbra
929,701,322 *60D0A587ABC0E8A74C812B8542F48B4F84F43377 AmlDI
929,701,323 *60D81B472EEE397EB8E27B8400717F1D6750565C Amlejhoas
929,701,324 *60D0B8C0B9ED331A7BA69614100FBB706C9F1B80 AmlfU
929,701,325 *60D366444CEDD3BE6D531BF5587F6E6B3A2A4C94 AM;LG
929,701,326 *60D4359627CC1BE5420FD8F98798807DFFD65858 AmLHp
929,701,327 *60D58A03292D0386147C3E67895280638CA40338 Amliujar8
929,701,328 *60D5782B13CE48D1BCCC5766F3A0ABA05319FBFF Am(lT
929,701,329 *60D8B7DEB440EB4A9A0355539A98D0F266674980 AMLu5
929,701,330 *60D0E962696EFF51DCD2DDD24B2F5101EC312674 amlwroc
929,701,331 *60D33D0DD195E0E0C097B5C55E0190DF46B25E67 amlysGrfx
929,701,332 *60D53C4442FFA8324680D5B97A699BFCCED1D289 AmM_+
929,701,333 *60D42F7D99F8B7346525E920015DD02BDBE0AD1F [email protected]
929,701,334 *60DEDAA1C88FEA429B8D0E4EEC51DD6D316D9F66 Am_M6
929,701,335 *60DA53C97F0C5AC903D0202456F63E35C47CBAE9 Ammacares9
929,701,336 *60DCF03A6F30B3B88D15FB082638F6C2CDA355CE Ammalino
929,701,337 *60DEAE9E6BA92F6AD2C54CEBBD2159EEA671B1A5 ammanna6
929,701,338 *60DFCDCC6FB93C16B6A193FDF11D228B0EA9975E ammaraaamer
929,701,339 *60DA5C39C364D67E8067423AB2EE4FE5FB6261BD AMMASSICCIANDOSI
929,701,340 *60D76CB6C7FC626B52110EB38BDD303B90447E67 Ammateises
929,701,341 *60DF335891740D57CC9CB93BF2F1268D0C32B6E0 ammattikorkeakoulusta
929,701,342 *60DF1D8C3E822532AC07D15CDC4807A954F7CF6F AMMATTILAISIA
929,701,343 *60DE34065DE4771DEA94AA8099574CDBD1BE8B68 Ammazzasting
929,701,344 *60D1BD33F93ACC8DE03AD06C149989EFB18FD418 Ammazzate5
929,701,345 *60DAB1907CF89071888A257403A1012D3C979725 AM:mb
929,701,346 *60D9128429E235F1FB649BF9DA95AE2E02211029 AM?mb
929,701,347 *60DCBEEDA92ABDA474DB4911DA2A61372751A68C AM&mC
929,701,348 *60D16976A82E6E3259650C0A525CAA5AE6B28861 ammic123
929,701,349 *60DABDD479B08DB55805B9D1DD5985239EE685F9 ammidotrasferasi
929,701,350 *60D35C412EE77C4FFD28CE5E3136F94D5838E6CA AMMINOCH
929,701,351 *60DD4B885E0B59474CC40DAB2FDC7F35BCD41DFC Ammiriamo2
929,701,352 *60D6C13F2BD2460E2A8FD957059AF16E8DEBAF6D Ammodiles
929,701,353 *60D015F4DE10E76D19C20B537A562BFAB5653092 AMmof
929,701,354 *60DBCC575AAF721D9D31AEA1B521E1E2ADC84228 ammonsnathan
929,701,355 *60D5A5FBC698DFA8573973E1FA7473D53CD6DA50 ammorbidiscolo
929,701,356 *60D61ED10095FF80ADADCA8D68F4EA1F73D0DF0E AMMOTRECHESTA
929,701,357 *60DE0A47F1665CABBF6FF4BFFE5B4A0F28A871A1 A%mmQ
929,701,358 *60D1B44BBA3A8DC8A1F583253988B37E11F9F0E5 AmMSS
929,701,359 *60D41C212706CD1C74A177114BCB8C4702D04342 AMMUATTIN
929,701,360 *60D472EC11F5742E092CD0FD64F36EADB02AEC75 ammummed
929,701,361 *60DE0BA1365761BC6F8A49CE284955E22628094A Am%%N
929,701,362 *60DC12CC4A12365C07213C3382A5930956C99A68 Am#!n
929,701,363 *60D43D4BCDF1909501C8B0D9CF769D35CDA24EE8 AmN
929,701,364 *60D0AEF4A0ACE58A19DDB3DFD5552A4E4086C3F0 amnasaqib
929,701,365 *60D2D44DFB901792B8EC7973CF54C405BE401540 Amn_E
929,701,366 *60DE5AE7EAB5A5071154EEE4FFEEECCCA8F38E4E Amnemout
929,701,367 *60DCD42113F05EFAF5A8A552D35854756DB1C669 Amnesvis
929,701,368 *60DCD423412337C27BC2896106E10104B1D7A24C [email protected]
929,701,369 *60D2602BB72A47EF4DCC80BB7BCF2101ADD90994 AMNIO+E$
929,701,370 *60D1E73906E22AFE4CC88C2FC2B0630CA711D7BE amnistierait!
929,701,371 *60D66DAFC758BBC2E7D4853FE70F5A2241998AD5 AMnjd
929,701,372 *60DD16F1CF6918F5C53464A298162FF05D682794 AMnjH
929,701,373 *60D256DC1AC150EFC1BE6971C08F309F96D24021 AMNmu
929,701,374 *60D437F8D00D051C874FFC9C49B868D77E8FD4E4 amnonangel
929,701,375 *60DD59D91B3F20940E137D113081CE62E1C27FDE AM#o:
929,701,376 *60DC377DAC56A318D6E2247AB9B0BE6B07C04EBD AmO/2
929,701,377 *60D4AFFBE07F39AD1E8604A07E02AA631112A5C2 AMoa.
929,701,378 *60D995808D33D6B66C6F3E4DE69457150E5AC467 AMOALOSZORROS
929,701,379 *60D2F5C12F81089068F662197CA9FAE600F6AD7B AMoby
929,701,380 *60DD035461533AD257528C5F6EC11A2A9F5D50E1 amodern3
929,701,381 *60D8EF2C27C723058E474A2CFE10F4C50B56DDB8 Amodiati2
929,701,382 *60D00E02DF4B4B175A967166B4C3C5A00AE746C9 Amoebeans9
929,701,383 *60DCF6BD03461E3C70253772BD0864BEB02CC1AE Amoebicided
929,701,384 *60DAECC10BC7693CE93A84AA2A232DE28249F767 Amoebula3
929,701,385 *60D85EF484D76B623681D124A349F735191354E0 AmoGF
929,701,386 *60D2596161751A67B4390111AED937BD5F784F8C Amokluferin
929,701,387 *60D18BF04ACFA7F3BFC0B2BA407B49ED6F891791 amolecia4
929,701,388 *60DB1408BCECEB68CA0E2859FD853F7B6815D8C1 a moment of rest
929,701,389 *60DDD6D563A9921ADA7386D5F83DFA72117E272A amonase0
929,701,390 *60D2FF7B5037D998CA6C6FCA12B7917549B4AB8B AMONCHRIS
929,701,391 *60DA00BC4655AC4898FC455123829ED9E5D05BC7 Amonestan8
929,701,392 *60DC25568A35498956E695C132E3D40478DB660E Among10
929,701,393 *60D5E627C7D5AED9C12F9D9C89AEEDAC618700A0 Amongist5
929,701,394 *60D2D7049E4E3EFE75612E5A57D8D7C174C8CF7A AMONIJA
929,701,395 *60D243558E2A296629F55DEC0035901E176A2D86 Amonopoly1
929,701,396 *60D894F53F5B9F45917B0B20F5AE959D836D28D9 amora mohamed
929,701,397 *60D3CF2764EBB11AF7BDA61AA147A4BB42CF6538 AMORCERA!
929,701,398 *60D9047D37B134E26069B7F612F17BF30D86AAD7 Amorceri3
929,701,399 *60DD261D996C6EC0ACE0C850AD1224412A9AD101 [Amore]
929,701,400 *60DFFA8DE9D68CB230796920F047A5B06FB81A98 AMOREPAZ123
929,701,401 *60DE3550A49B365224096178F44E36B3C092B9C0 amoreromantica
929,701,402 *60DFFF0D0301C850606EA34778D8D3BA723DD2A3 Amorinis1
929,701,403 *60D10234ED7FE6372D1CC7CA22C9BC3D05417183 amoro.bbs
929,701,404 *60D982C8934302DCC0A4999CF1E2756E5D0C6B15 AMORPHOUS69
929,701,405 *60D4ADFDEFCA7370B553984BA4B8A57E5CA8860C Amorphy0
929,701,406 *60D6FD94591BAB038890D91F8803A5B444995EEE AMOSANDY1
929,701,407 *60D170FA77597BBA45CE6E594E533CEB775A7186 amos.babjeck
929,701,408 *60D0DA9CD062DC20885F5AEC5AA71B9EE5D3D10B amos.bailon
929,701,409 *60D62020E104F7C857ECAB228BCC45084D8D0465 amos.barbier
929,701,410 *60D22ADE61CD7A3F0129F9D238BA8FD9223229CE amos.bemboom
929,701,411 *60D405D7FCE756C031FCFCAA19A565D4D15BBC72 amos.bodrick
929,701,412 *60DCA20878BE752EDBE0AE54FD657CA4A1EEB916 amos.brumbaugh
929,701,413 *60D61B945D4E6E11918177278E1400A8FF5C760F amos.bulik
929,701,414 *60DC98783E560E9F2B72D956C1E5BC09F1050532 amos.crislip
929,701,415 *60DA6E23EA154EEEC163FD6E5F778FF6A7384D22 amos.daughrity
929,701,416 *60D48F8D4E5FBF204D0F7419257B50D15F48E8BB amos.egelhoff
929,701,417 *60D7BDC0AE90CDD698259A9EDCC00D749A4F6181 amos.koroma
929,701,418 *60DD02BCC20611840B6D6EBB82D13F032AF88F13 amos.linderman
929,701,419 *60DD923ED1E4E73741C459FC1896ECF1EE7C6631 amos.longshore
929,701,420 *60DC6FF5C8BAFA1A71868567D892509FB6811BDD amos.maranville
929,701,421 *60D5494B3E919BEA92081813EAC24FA3A285D118 amos.mccollester
929,701,422 *60D146A0B3193D57DA00A956A624B956A72C71FF amos.meager
929,701,423 *60D89A47B121294062E853666DF0C26293C45CBE amosminter
929,701,424 *60D6E3C6B64451ECAA40236DD3C176282FB96D91 amos.passarella
929,701,425 *60D9214CB1B4163F52171B9E6765493E3567623F amos.peleg
929,701,426 *60D276D4629F71AB66433BAF28142B055718DCBD amos.pyanowski
929,701,427 *60D7FB97F6284A11DA99828667332F29B9902CF1 amos.romaniszyn
929,701,428 *60DCA3259B25B381A5C2BE3B4C25BEBEBEE206FC amos.trigg
929,701,429 *60D2B5B90AD53A084E15BEA4926234310B1A82CC a mother's wish
929,701,430 *60D663043C8346236944FA497E5F8896EFF33DAD [email protected]
929,701,431 *60D9A8C3F615670E2BDBB58B89B0A78A0547A6FE amourgriffey
929,701,432 *60D4D82C8A5A8247F1BEAB94FBC6A8C896A235F5 AMOURS11
929,701,433 *60DBCE2754E3A2F1EC7F487236D0C2C5986AF578 AMOURSUNSHIN
929,701,434 *60DFC431D7028AF6044FA4F2AD044414CC206F4C AMowF
929,701,435 *60DED4C476025B9565CD782F86CBFA57AC6EB7CA A(MOZ
929,701,436 *60DEA0A9E7ACA52C050B0207B22EA309E2FD055D A#M
929,701,437 *60D7289F4D4028B5A2FD7A49733132D4C6483FE9 A_Mp?
929,701,438 *60D812560FA4AB55C6AA3CEBDADBC300EEDE5730 A)mP_
929,701,439 *60DE37CF3C03BD0E60DD002569375E42902045DA Am."P
929,701,440 *60D647FBB5A5089A25BE7C071EA7145E4CE06417 Am;p/
929,701,441 *60D628C881551917618D683F9C5B97AB86F91B8F amp0000000000038209.
929,701,442 *60DAC715A24C37A370750F8282CEF9B351B55463 amp0000000000472255.
929,701,443 *60D5DA297EBE4DAF3F16CAFAE3466B8FD42879CD AMp21
929,701,444 *60D396B8CF2AEFEA1596D72BB79171BC3F9DE4A6 amp4126amp4100amp415
929,701,445 *60D2942D01736C58D70EF57A65071494FADA2AF8 AMP7R
929,701,446 *60D811026393B1A1CA4EB1C0E21DFF2FFF7B4099 ampampampampamp18355
929,701,447 *60D00E1B95F35D735788C5F14DE63D50EA5654D0 Ampangabé
929,701,448 *60D9409C7F7399E43952872CC161CC5F650EEF34 AMP;d
929,701,449 *60DB0F14AC85927DB067E5CBBC9C46FE929C691F amp energy
929,701,450 *60D25626D81300951229321F024D8A1EE4954E25 Amperajed
929,701,451 *60D4B039F149764A912755342816A5E8537BB8DA [email protected]
929,701,452 *60D2E312D66861C681CA956027750127A85DD800 Amperosekunda
929,701,453 *60DA5A927B348A8CC81B671B724B66F738752FD6 amph1chroma+1c
929,701,454 *60D38EE68960593361EB894FA34EC8D5265201F9 amphirhine9
929,701,455 *60D41759898D46C8F916EDBE2B481D00BE44638B AMPHISSIHPMA
929,701,456 *60DA5625AEDF48E6F277AFF588161261EB2044DA amphitheatrephoenix
929,701,457 *60D1858D9BFF28C4250E60E1194DCA8A69A772D7 AMPHLEDG
929,701,458 *60D53A5FB8E2B165F477C1D999E381D4B90FE946 [email protected]
929,701,459 *60D0DDBA156010D9922087D61591387F1FB1CF3F Ampiaiskesässä
929,701,460 *60D06C0D08DD8B77FA7EA234FBF4B94CAF9C9077 ampian1234
929,701,461 *60DB13525FD41E4ADCAFD625BB867476AE44BE8C Ampiezza4
929,701,462 *60DAE478905970531B1F86423279F65FA81686B4 Ampilar5
929,701,463 *60DB07F5A1E33871BF694F7C62E6B8E5664D4DF4 AMPKE
929,701,464 *60DBF77D4B38CBBD8F9B5B7CE7C7B8DBB555F435 Amples+
929,701,465 *60D747A76F40A99D0179834B206BA24216B268EB Ampliación
929,701,466 *60D13869B9CD5D065EBC605C18AAC3F64AA67A81 amplied9
929,701,467 *60D89794D10638FE3DC262009736BFBADCB8740C ampoampampokpvv
929,701,468 *60DB9CD2E3CE6B748FC8C6C39F732D20F60441BE amponfire
929,701,469 *60D2D2F1729895D4F6A597C9BB35BB999B974F3A Ampoxi
929,701,470 *60D773FBE5575F7354B7C0D502222302AE5EC9F6 Amp;u
929,701,471 *60D3A3BCD4B2423A50927CCFC2C9EC66680023BF Amputan2
929,701,472 *60D6C5D0C26134CC223375912F77EFBF3E96A7E7 Amputiran9
929,701,473 *60DC1B9E9C2A37308571BC3835A7E24E14A806C1 A?mPY
929,701,474 *60DC82B7B030DB56C8F1800186E66812ECC8D0F9 AM=Q#
929,701,475 *60D8BA91B8B4A0D14676C7460D7C1374F57719F9 AM_q!
929,701,476 *60D0656CBDA6898B446C86328489F8D8290FDEC7 AMQgm
929,701,477 *60D5EB6649C13AAD082293DD7C056C053F0D1794 AmQp"
929,701,478 *60DE99CDD89AC23D43B2543C6FF7CF7C6F0BEE41 AMqQq
929,701,479 *60D1C4116AB281335B0C921A9C2388B0F3BA0F56 AMqs:
929,701,480 *60D32FAFA87A67CE9F28D792ED52DFEED2E89011 A(mqt
929,701,481 *60D01901D5ECED1348C9E55967375F271733AC4E A,$mR
929,701,482 *60DFFDEBE675EBA451056C8FE12B6E8E08940A7C A?mR?
929,701,483 *60D3EC11F885D036431C44F2946B1079FEC56F0D AMR4%
929,701,484 *60D5B0050845D766100830AEF4E35EEEDE738EF8 amrabimenet
929,701,485 *60D88A45EFA0AD7BCA4939231545A802A391BE36 [email protected]
929,701,486 *60D51073725758973C87C08C692AE5F1F5A7D170 AmRBY
929,701,487 *60DEC75E895BDEB8DF1BB242CC4E0ACB212D9E52 Amrednih5
929,701,488 *60D5BC4DE0A4C8CB9BF2CE76E9571E4E46723669 Amref
929,701,489 *60D9AD972F372C98D1BFD124B0FF9A7A8F0AA7F5 Amrekrek
929,701,490 *60D2394D8B98301EF9C9598C090B9E9F4916C971 A:mRI
929,701,491 *60D005D09611C9D1182519C439B14A14652AAF81 AMRIFIRMAN
929,701,492 *60DE62E2A23746EE730B9302C66DD14E2C95F5EB amr^itasya
929,701,493 *60DEA18000B61BDEFFC7CDC5F029B0E9AD4E62E0 AmRm9
929,701,494 *60DB22E9871D471CC462E9AFCE847465E4E987C6 AmRni
929,701,495 *60D94E149B13DECD40BA55D42C03D9F58CD33CC0 amromohamed
929,701,496 *60D1B5B564E15AD080305D0FF33CE3CE2ECD3950 AMRON 16
929,701,497 *60D36F1BC21B73FF41D0AB86C480C2606AFB21A3 AM%rT
929,701,498 *60DB49B5851E5BFCF3D3BC62C24CF1AF66FCF458 AmRtC
929,701,499 *60DDFF4973FE7DF4195CD2AD00EC5DA449C8867A AmRVG
929,701,500 *60DE2AE3CFF7FF704D38A9D7383BB0275CDB88E8 amrzq
929,701,501 *60D6355E90D84C0A83E82FB6BCF60B1D51FC5954 AMS$%
929,701,502 *60DB1AFCAF758F05F9091B2E851511D2495D661B A+Ms)
929,701,503 *60D9E49C30BE4D9F1908FA63BD1D82EB4B9325D2 A_mS/
929,701,504 *60D7EF43D128C653C540C6A3FB6EFFC11A70A1C6 Am_S=
929,701,505 *60DE4E9A82C05090D9923392B9990118517FE5E6 Ams/=
929,701,506 *60DA318B0D220296EA3DEDA51955A371513D2AEC Ams/3
929,701,507 *60DD8E3FC28F6D9CCD734BF87D53DEA493E25412 AmS9Z
929,701,508 *60D56FC3CB8E1CC43662906D40909CEAF3B4BFAA Amsanten9
929,701,509 *60DB263D24E3C380E0BB0DAD6C24C84440711A46 Am,Sb
929,701,510 *60D18F75CAA2F29D1EECB95400C7A868C577C3B0 Amsberg。
929,701,511 *60D084F7AA99EDCAC8D8193F1F6A8CEEA61B44EB Am,sC
929,701,512 *60D622DADEDA54344A3E52547EC57BB428C3BCF9 amscience
929,701,513 *60DB42E61CBFE59E7E19CC7C1C906BFD2DF4D142 AMSgi
929,701,514 *60D5DFCFB63E4091DA5645933F6623A717342452 AmSI5
929,701,515 *60DEFAF175337AA9A664CC06DC00E8F49946808B Amsiegel5
929,701,516 *60D1F9FD0DA9196A41B87F37789A14015A5C4C6F A+mSj
929,701,517 *60DD7B4E6C6E0C0285B0D2932C08DBA337F74C05 [email protected]
929,701,518 *60DB2123284A080C4B3EBD44D6F4EFC4E7A31288 AmSlQ
929,701,519 *60D1B42BCE1189182318B913FB5C9DB1B51569C6 AMs:M
929,701,520 *60DCCF05D84572204E6068059593BEB694638184 Ams?p
929,701,521 *60D0F8F1B9160F12F07083972802C7B5C0BD211D AmSph
929,701,522 *60DD52F7295509AA2C65582999D4EA5D910282C7 AmsQF
929,701,523 *60DBD6B96EB87A75C7DAFA800F12648FC95E0DF0 ámstel
929,701,524 *60D5209D45506216CC70900FF1B21B6964ABB13F Amsterdam (Acoustic)
929,701,525 *60D07D0E92BF75B21C976E76755EA6318174E52D amsterdammanor
929,701,526 *60DB71027EDA5FB767FA1EC28719759D9CFF76A8 AMSTf
929,701,527 *60D2A9D20F07B4F61B434B33556BAE15E89A0DFB AmsV7
929,701,528 *60DFF9AB46FE6D3C2CB431CDC8BE35A31FC00CA5 AMSWp
929,701,529 *60D820E534408EF663CF310EEB41220BE868FD06 AM"T!
929,701,530 *60D298F1697B9F899E35BB75ACBB5FF3B19033BA A/mT
929,701,531 *60DAD6EBA55287B62A6454D991343CD71649ED03 AM(T1
929,701,532 *60D91BF5E3F221C0B37D56D5DB548B05F86CA318 amtalkkycmtalkkyeeta
929,701,533 *60D9310EB6DB4AD3F2D208CCDB4E681051113765 AmTHP
929,701,534 *60DAB7909196E764AC0D5FA4815A810A35BC375E amticarica1
929,701,535 *60D7AF88390EE33CA47DD8CE69D389CEBCA4312B Amt+P
929,701,536 *60DC19C1C8087A8354CE59124BE4E970524388EA A-mtr
929,701,537 *60DF2F1A16C090C3747044B403FC1526FC2E2FCF amtseide7
929,701,538 *60DAD7D610B9892CEC55706035E434D5A32337DF Amtseinführungsgala
929,701,539 *60D6C10F884D1193BFB9B593144E14F425B50BB8 Amtstrac2
929,701,540 *60DA72DA3B7D0AA0AF3A1472F233FC7CA1AB3DC4 AMTYs
929,701,541 *60D9EA4030AC6F91A5BE88816A1C83AC5CBB1FED AMu8B
929,701,542 *60D89700DAF15B6F9FBDB5FF771630AA7142CE27 Amubreking
929,701,543 *60D4E77E29AB8728EA12D7AC2CCDE2A42656F171 amuck.
929,701,544 *60D92CEDF541597C6258229605FA7249F73D2C53 AMuCv
929,701,545 *60D70BE57FCEFE155AB369403A3C4A4CDB5B4E5B amûdê
929,701,546 *60DE0728EB09096938763E8DCD44431DC63A6954 amuekat3
929,701,547 *60D110EFD3F659ED57A93F54650AF1C3E24A1091 A%MUG
929,701,548 *60DB4F245D50D89A1EB96B1B528667FD39B2812F Amukakit3
929,701,549 *60DFA8D16313D6B431CEFF2EF74D418C9C5394B5 Amuktik8
929,701,550 *60D91C341C5CA5E11A14198963E7427BB8C5E74B Amuleticsed
929,701,551 *60DA26492365A3890B1E4CDF44830CA710DA3335 amulherengais1
929,701,552 *60D7797B1855B7AB7BD485EA70A4129FCD1197A6 amulherou1234
929,701,553 *60DD2949C93C7D5475BAAFB0AC05E96D77CF24CF amunchaM
929,701,554 *60DBF00F258FE7748550BEC9FA1DA8EF9DC8AFE4 Amundeep
929,701,555 *60D85DB143F62F0A4AA67B536B2E9F45655646CA Amuokuob8
929,701,556 *60D76F5A611F572C0E2F0FC58CB4E43F78AD2708 A;mUq
929,701,557 *60D852585511EBCE50C4ADA729CB026CE404039C [email protected]
929,701,558 *60DCAFDFC32615C35723348C59964F3D0111E43C Amurotrema
929,701,559 *60D17F078D53A401120EDA86E0C50A7A94A6A4B4 amurray956
929,701,560 *60D6AFFB314CAF26F401F1A20BEFD7D1DEEE3932 Amuruget4
929,701,561 *60D3EF09AB802CEA89EE09FC3C47DBA3ED4B1F3C Amu#S
929,701,562 *60DDC459894CC28B3629F7C047BD8925746A1422 amused7
929,701,563 *60DEA717654BA3B68E3211DD04B7413014990FB4 amusedly3
929,701,564 *60D9753903B413FAEBBF8D138E60BD8D84E633A3 AMUSTAS
929,701,565 *60D794F68F659F91AA45E1B5CE0E079926E52C0D Amustining
929,701,566 *60D6AEDF7D69E7007531FDB5DAB20ECB9D63E4E5 AM&Uu
929,701,567 *60D1393A46E35F4BDC87DBBA91FB936689BAA137 A$muU
929,701,568 *60DF33F70C892D973D2C96A99A7E3598580CECD3 Amuuyjin
929,701,569 *60DB93D0ECD6AF891733B213DEA9363E4B421AA5 A!MUX
929,701,570 *60DD960F0CC2FE4C4DF13B42810A86D98651456E A,m;V
929,701,571 *60DC979E838C3E3D003643845A59B99B74A16443 AMv.3
929,701,572 *60DAA56AB1FD8CAE217ABA014A2758E58E00196A AMVISA (421) | SPAIN
929,701,573 *60DBAD7574FB5B2EEA500FE0426583638B4B576F [email protected]
929,701,574 *60DBFAC09A0B87B61BEBD11109046555D1CB0358 AmvQd
929,701,575 *60DB00C80BA2087631FD345DB0D5CFDB14D2E699 A-M,W
929,701,576 *60DF3F15337B266E55897DD108A7F8411825480F A#Mw;
929,701,577 *60D5EF8E5FC7F8B2E952460E8BEB4DF34296113F AM$w
929,701,578 *60D8A240931EDDD0F77EB261F75239F000077340 AMw"-
929,701,579 *60D249717677E42A27BF7CEA891B09B6749E3070 AMw+
929,701,580 *60D93D605BA663E5E77EADBE9398CB59E81B05A2 A,m$W
929,701,581 *60D2C7206B437F48EAB41157F425DA5F757422C5 A. M. Willner
929,701,582 *60D2347465A86F749FDA037B024BA6D7386AB81D AM!wp
929,701,583 *60DD928F674827C3F29A649B348FE6C739011A7C AMWQI
929,701,584 *60D4149B9836A2DBC5DD5857CBCF47FC154ADC2A AM#wR
929,701,585 *60DB94DE71EFF3598BBAE72265294A4C498CAE04 AmwRp
929,701,586 *60D39A65B1D9491EBD63231242901644FC9C6135 Am
929,701,587 *60D27F436AA1072EF0E53721034B30458AF53C35 AMX82
929,701,588 *60DD0EC65125C502D2683132E3A1D387BD2F44E0 AmX9-
929,701,589 *60DBDB21DDB5BDC23750C2A09339145C9A7B0BCA Am(Xg
929,701,590 *60D599B09D166B846A29F0348465BA591D8CB4BC AmX"M
929,701,591 *60D8F50C40D5A445CE9887160CEB004A9ED25B02 Am!Xq
929,701,592 *60D6339C3058D19B6A90A37B86F8A37EBD8C0DC2 AmXT9
929,701,593 *60D3A42962F6CD1A3433325EC3F63399B54FFFEC amxwa
929,701,594 *60D49C871C618B2480FD6668B427B5C90A002CA7 [email protected]
929,701,595 *60DE3AE885C34CC7498715BE69C0D101094BBAC4 A)M$Y
929,701,596 *60DBEB1FDC08A327BA742C0BF0BA87FF620B8342 amy101yt1c
929,701,597 *60D0B74E2207FC124D24C58EFED8E690FC14A3E6 Amy1ace0u
929,701,598 *60D3C05D19CED6B4A865C3B0CC82D1B067D4B6F6 amyallingham
929,701,599 *60DA894FB8D3DACC044B5D7AEA7A4EC2F1DAC202 amy barfield
929,701,600 *60D30D362C3DB26B6809CC9A8EBBADF4DE5C74D8 amybassed
929,701,601 *60D06121A0ACC7074988C60E9BA56EEF26173362 amybp8
929,701,602 *60D0E82404FB11D3D3B61D6024CAEB9EE683476A amybrenneman
929,701,603 *60DD3804FD7827CF7D99012049E1C91EC4161144 amy bryan northey
929,701,604 *60DCD0850912ED7089A1EBCE4A6F0A95D300BE9B amycabrera
929,701,605 *60D2483BAAA72277AE8E98120E5F0EF2CAEA1B7A Amycaitlin
929,701,606 *60DB7FDD31C418D950E9254B35A86D61E11EE47C Amycoco
929,701,607 *60D13CA63F58F705030110B83E483C8D1156AA65 AMYCQ
929,701,608 *60D6B563F37B89DB03C2633A295F1BC3CEF32222 AmyDave
929,701,609 *60D0FA4A9945CECC4B206DDA0C658CC67D29D661 amy densmore
929,701,610 *60D736B5B640AF6B2F60D085560B8DB98F5F4EF5 amy disla
929,701,611 *60DEA0BBA0BAD06F8A66F9A5CA629BB3F3A5D742 A?MYF
929,701,612 *60D5D051E1F2026B0029E65ADE74709FC7BBF613 amyholed
929,701,613 *60D2FF057C5428219411F80B75B63DAF010529FF AmY=j
929,701,614 *60D31F6D359BDD9C6CE195A7CCF20A1312F9A77C amylorin2
929,701,615 *60D5224AED1893B4FDE1BA6E4E014FFF42E6DFA7 AMYm8
929,701,616 *60DB7564BAA8DC34EC2A2FCDD20423185670F2CA amyNaomi
929,701,617 *60DBABA4B06CEF7B896FA6038A7A719600C1CF98 amy rene jones
929,701,618 *60D9427409D8E5AF4F50F6C527A2010937FFDA7C amyrivering
929,701,619 *60D56B7CD5A7C1C72540C51829B5A894A38702DC Amyroxying
929,701,620 *60D00508DFA49D2A7DA20D579474B6451BBC09D9 amyslaunwhite
929,701,621 *60D0F358C74740BD7B3175847687EAE05D69E717 Amysmile9
929,701,622 *60D7A93D19E57FDEC78ECAAF8C317B8DF0281CEB [email protected]
929,701,623 *60DF09C6F792E7A2C698338AADC716FE2F03EF8A amystarr
929,701,624 *60DA909CBC411A2641B8A735DAFC691D4F252754 AMYSWEETY
929,701,625 *60DF6D2F7115DBD4390265F98000769511FDC5F8 amywilton
929,701,626 *60D305439390B44B330085BE5374FA8AE2924128 Amywqsb
929,701,627 *60DB4ABEC5A7DD5929F202C2801CBD4B57FF4935 A&$mZ
929,701,628 *60D666B01ADF35BD0EA2B2AF1648BDE7B8AD4A54 Am"-Z
929,701,629 *60D38B791DFECE4D4FAF7813EE9E08DA3CDB90A9 AmZ.2
929,701,630 *60D3344C0E9F7FD1A824632C9421968C38256A90 AMZ5#
929,701,631 *60DE73629832E6701DB3F081C754968471AB2768 AMZib
929,701,632 *60D032F615B9A8543EF8B7D9060885D2310D359D AmZ,K
929,701,633 *60DACD879328C39DEA4FF9BAF84BE4CB8B3F9184 AmZlO
929,701,634 *60DE2E1A3F22BD3337B8521B23434B800E444372 AmZlX
929,701,635 *60D03136EAEF0617270FAAF131B29E0A26DCDA33 AMZm_
929,701,636 *60D4155236BE09A32DC030EA1F6E226276507836 Amztraws
929,701,637 *60DE8F13F30990B0BDDA5ABF801905627FAFF642 Am+Zu
929,701,638 *60DBD0099D0E06B3919D91345C17079C1D3A6165 A?N-)
929,701,639 *60D610A49DAB820B3837C2C0474E3B4F56E595CF A/N?-
929,701,640 *60D41E282ACCC09BB0BCF44FFC4D8200D8A41FD0 AN_&%
929,701,641 *60DA91E92844644732C254BFD27341865113AD23 AN+-+
929,701,642 *60D47AFDA97EDED84AD0B52003372DA50DDD20BF A,)n=
929,701,643 *60D63AD596DCF6E3838D5241F6C25908B914DAF4 A(n%#
929,701,644 *60D905DFA00C77A4D1C928B72A381294ED36EA4F A*n|
929,701,645 *60D5F06CAE0727DDA3EBD65C8D5CBC9AD81FE29F A
929,701,646 *60D4CC215527E46EDC2D10CA6FB733414B3FFE2C An)?+
929,701,647 *60D7C0CE29DDC2FDE3E2B9C1A5455DEF50379457 An)")
929,701,648 *60DDD8CC2188E21DE63C03BE5BA117A2337D6AE3 a&+N
929,701,649 *60D6D519004A52539860094BE54C820E07AC175E A!_n0
929,701,650 *60DE67AA962BC576EB7D517D9A127DCD5A35C55A An0/%
929,701,651 *60D65F090078C63DB063A916E22CD68A4CB952AA an0095
929,701,652 *60DB77EF6651D9AAE306EF84221DD4AFEE20D1F0 AN01174_
929,701,653 *60D2ACB8AC809D964C154C8A0684C9CA34CC5498 AN04U
929,701,654 *60DCEE8EB05DC9F0E7CD3E4041657BF8F71F63F7 ÄN07
929,701,655 *60D2391D46FE0EFEB8BC70969D1C8C0DE8693E34 an1ma5te
929,701,656 *60D36ED4F8D18F6ADECD1C96D682ADACEBBF9BD4 AN+!1OG$
929,701,657 *60D7586199A6D65FABAAFB3477EED26005D7D8AD An1pY
929,701,658 *60DA173914EE32B0F0DF3764D5CDE0FFCACC7C8E A.n/2
929,701,659 *60D70983142866A0ED7BE2CDA0850A241533F5E6 AN22"
929,701,660 *60DECB285D6B2065A2BBB8F5BF6FC5B057D5BE63 AN2=7
929,701,661 *60D95A2F5F81A22AC3C4E0540D1F94DC023EC073 A.n28
929,701,662 *60DAEA8B20E0B27CD70AD4B0C023C33318A7AA43 AN2Aa
929,701,663 *60DA9DE108557A1F99B0B85758A2AB1663053F88 An2jX
929,701,664 *60DBA7FCFFD5E5BBC691DF6933EB424EA5171365 AN/2q
929,701,665 *60DFF109BC37E25B2C740D791A55AB0161BB49F1 AN2TU
929,701,666 *60D05E23FA6EB7710C92AD8725415319BB96EC3B AN3.3
929,701,667 *60DE1D176767DB6D61E807BB5A641DD363243465 An357h37!ca11y
929,701,668 *60D4DE73C2891348222DF6B3B8252528B47064D4 an35th
929,701,669 *60D49C3BCCBE8B4D278F06FA47CD15E2286EC7D9 AN35TH35!O1OG!5T5
929,701,670 *60DBA5B1FD2D100598E58BCBB7A417CBC811C7A2 AN38S
929,701,671 *60DC979A6B8AF4E35562168A0CF77CDB76E0100A A/N3a
929,701,672 *60DF3BFED304AFCB399F63606CE9921B7F075AC5 An3a
929,701,673 *60DDC352E09BEB5A2248B7A6BBA4641550CA9E45 AN3c_
929,701,674 *60D364DF2AB019F06E91BA5D882A5F5EABEDE7F1 An3ES
929,701,675 *60D32B51940F03876ACBBDF5F9494D7E151C25EA AN_3Q
929,701,676 *60D23F09D6232F738C8FA5E192BDCDB7080F30D5 An3rt
929,701,677 *60D37F2EF1F2F5DD30DE437B1D1F579C8665675F An4a1
929,701,678 *60D981DE1FD7FCAE159701CA49308017E80916B3 AN4QN
929,701,679 *60DC8670962DCFF3EB7105C5D35732C9A66BD506 an52
929,701,680 *60D53EB141A767197ADADE5B29BDABC69DEBB306 An/5I
929,701,681 *60D2A3D58E76BC5A6DB4F39C3DD67AAE69568A37 An5i#
929,701,682 *60DC05015678858ADC2672BCD9E414DF18478B5C A)N.6
929,701,683 *60DBF8D8C6092F2BBA90FC84F2BDA4BE2D9D3791 AN6(_
929,701,684 *60DC651FEEF72F43B25C8E6E595E1539A0782A01 A_n6A
929,701,685 *60D431DCEB881DCDE128A794EB2756157B01EE85 A#n6O
929,701,686 *60DB9B86A9A52E50418901ECCA3D59B274C0D134 AN71PA571
929,701,687 *60DB9629337DEBCFA5C3C74C36DA5E2CEDB6966A An71pyre71c5
929,701,688 *60D096DA9162F6B1869880EACEA400363367259E An71rel191ou5
929,701,689 *60D564C62750BB41A5653CEC42EC88751BEC4164 An?74
929,701,690 *60D3CA0E8AD5232A41DD9EDC84DC81B17EF7525E an7arc7alia
929,701,691 *60DAB199099940B48E5BA3F3EB63C19BE79E43D6 An7Ic
929,701,692 *60DCA69A5B5C1F9772C93D2ACB357F1B2526953A An7ilo9$
929,701,693 *60DA3932C94E9AECC4CB915B20B6EDF48BBE696A an7ipr0jec7ivi7y
929,701,694 *60D56BEC1D272379EE1A669CFBF6B3AD6EEE810E AN#7v
929,701,695 *60D272A0CF2C55793A29F27F7BE8E4E8D4AB0E77 A&N8R
929,701,696 *60D8FFC3A177CA48918ECC33E6B86271236AA949 AN8wM
929,701,697 *60DB05ED216D59898E277195346C7242917E011C A_N96
929,701,698 *60D68D35165886B8243AD7CA1739CDBE0A0EE496 An9e;
929,701,699 *60D4EB6E4F0A55F807CBB5E3D6578EF9B650F872 [email protected]
929,701,700 *60D2E5BC657F4F02674D9BD82F2204E0E1CA3169 AN9L0PH0BE
929,701,701 *60DCA2783782A18BEE277266A6147338D503FFDC AN,9p
929,701,702 *60D1A43718B928480E16E176FFBD097EC3DDF6F6 AN9p#
929,701,703 *60DB28CFA19874245BA1466FD0572FC4143D17C6 AN(9u
929,701,704 *60D9BA8351625FC1FCD559F287067D8CA6C5CEAA A"NA,
929,701,705 *60D5EC5BC2A0D85BD368C7523EFB60C42501D0B2 AN_A%
929,701,706 *60DD685D579FA1F879CD2A28496A361759C85335 ANA/&
929,701,707 *60D14422CDAD7255C5E2BB393CF5E64EC0001096 A&n_a
929,701,708 *60D480B6BE5336764B27E8BC70882B757C65981C An(A3
929,701,709 *60D6C9567D36E45BFEB92EC0450617A7B4CB717D ana3rob1ot1c
929,701,710 *60DCA02AB3E7F396CCE95A4441E5D93A8550435F ana751
929,701,711 *60D69EEC14C2274A319FCE3EB858D763E92FF98D anaany1234
929,701,712 *60DAC7CF184A4B6F08658561A37440B84A1F5F1B ANABARBARAOFFICIALFB
929,701,713 *60D73486F0522BD19AB3379581B2DB413A109097 Anabatica5
929,701,714 *60DC78B170158FF5B73597EEFC0AA17D57892E7E [email protected]
929,701,715 *60DD9179FB71A75ED1C4DC2606D20C8B3BA2A96E [email protected]
929,701,716 *60D4B5A474A517B452B6E6A24395A0E734066CAB anabelleaguas
929,701,717 *60DF837BBFCFB2E937864BC14C548E24A85F960A anabelle aguas
929,701,718 *60D28929AC3D138D180225FE14296FAB3E448033 anabhiikshna
929,701,719 *60D975E3A868D24E00F2D06938AA12B202399E4E [email protected]
929,701,720 *60D4429F33EA60918D2239BC0A432FDB56734EC9 Anacahui7
929,701,721 *60D79A47D3126B83CA39DBD079AD679375AF64C6 +anace+1n
929,701,722 *60D8FEA45B11CB1EF2872FAEAC748B27AA95DE82 anacleto dime
929,701,723 *60D50D2CF433C9009D2614AAEF7EB6D1A96B0F60 AN-ACOUSTIC-NIGHT-AT-THE-THEATRE
929,701,724 *60DBE93F86380322B9E56695816E5B8C79190F7F Anacrusis2
929,701,725 *60DF8C9690023D6A168A4E55A08E1535E3ED52EE Anadasmwn7
929,701,726 *60D04B819E937A0BC02EA7F74F75EA39CA3E648F anadhrishya
929,701,727 *60D1E9A85B2BA4A98DFA7F6AF6CBC927822D017C anadicrotic1234
929,701,728 *60D90E832D774BB0FDCEB7DB9722833DD3B8E117 anaduhe0
929,701,729 *60D875D7DB9828C00788FCA856F6013C59D53BCB anae12
929,701,730 *60D036925763EE3D60BFA8B33DF8E6144078A371 Anaemmrd5
929,701,731 *60DBC59BD43EE56E85C6899B7BB738640ADD1708 anaerobic-digestion-news.blogspot.comanaerobic-digestion-news
929,701,732 *60DEB9AFEEA510F3179C806A89B1AA656F8037B6 anaerobious8
929,701,733 *60D5138F80A64E4E09D0D8DB736635C881B0B3C0 [email protected]
929,701,734 *60D6B16FD37D29DC14648DA8DE90D305395A7A72 anafdez
929,701,735 *60DBA3728FEB05C4198BA7D9CDF8E7F677D0C236 Anaferomenoys
929,701,736 *60DE807134E28987F19213B1398FF1C8615967A7 anagg27
929,701,737 *60D2588FB7F8E2631AEF5BB356F97B715840F5F1 anagnori4
929,701,738 *60DB87AAD72BF3877BD7AF2A704B74E8395F95CC anagramma7ic
929,701,739 *60DE296FD6F85FBAB8AD1A434B2A10B4E6F9EB06 Anahi116
929,701,740 *60D07BA6F9EEB4CB2BCFC5A9B2EB66FF077824B2 Anahihcu9
929,701,741 *60D2C69A1A6909086404F97437D680E2AFED1A3B Anahstfs6
929,701,742 *60D33A1FE531FFD18E732D2913078507805DF8EF anaïg
929,701,743 *60DCFB662E777CAB7FFE53EBB530B5C7A5255058 ANAIS2006
929,701,744 *60DA85F150FC9C92A9FEEE76945DE3193F6D088C Anaitsabbed
929,701,745 *60D662C73D054A3587B721BB37AF91623C0E7635 ANAJAAVA
929,701,746 *60D1F744BF8271F2DF51E3AED75D08849C2A7C45 ANA-JASMINE
929,701,747 *60DC8E97B4BD1D8B435B78906C9D878407251620 Anajattaed
929,701,748 *60D965AB2F587AA134D7B7EB7F5D362C97D4A142 anak0ndae
929,701,749 *60DAE8AF1DC18793B1C119A3DCE23A363D814381 [email protected]
929,701,750 *60D96C79D8AF8A724B252658C6765A1264ABE0C0 Anakoluthie
929,701,751 *60DBD4D0989101FDA88E285409340F9A99914069 ANAKRONISTISCHT1
929,701,752 *60D928FBE18828AD378213B01F0B08DDBB90B315 ANAKTEGAL
929,701,753 *60D36ABE5A958D666935AF75D9B1D4DCC7F55B4E anakwxh0
929,701,754 *60D00E1E22521C3AAE01D1AC5192E30BC07927CB anal0g0n
929,701,755 *60D17813E2FA2042C48BAA0E024A4E7B11F1BBB8 ANAL0G1CAL
929,701,756 *60D742B9793B14A232B1FD9C43D2EDC34F887897 analemmas8
929,701,757 *60D6D8140B7D8C76AA5CBCBFB372AAC95511C182 ANALFABETA11
929,701,758 *60DF6EE76E894C22A500D4C05926F33583708959 Analfaser1
929,701,759 *60DC683EC3B79554A08B6DC589FECAC0B6B9885D analgic2
929,701,760 *60DC8B10FD039EED0249D40B545A50C0F1A53EAF analistický
929,701,761 *60D6D5BC3348D5755966A20D8347F778C6415244 anàlits
929,701,762 *60D3D51F81A3245027984337A9158FA92EABF199 analkanäle
929,701,763 *60D3BD56D709ED393D821927B7AA109B2146607A [email protected]
929,701,764 *60DB6925B02268EC299994C9B40B08BACD962E64 Analysefasernes
929,701,765 *60D07C7CE21E1DD6C5FA34B5EE675B2CE85738D3 ANALYSERS.
929,701,766 *60DCD62505020F7CCFC3045D75A993C8172F35B4 Analyseur9
929,701,767 *60D44E2EE556E82C0010D34B3D1BA03FED2969C9 analysisphenome01millgoog
929,701,768 *60DB0E6BD4926B73478F9A271D7459FD912A5362 ANALYST-COMMENTS
929,701,769 *60DCC4E07EBE99BF03B0113558FED27A3026C485 ANALYTIKERFORVENTNIN
929,701,770 *60D3F06D27F160F9ACAA4C187F21B5199FA96907 ana meek
929,701,771 *60D5B154F5D41C2FA33BF028340B9AA82F2465BF Anamiova5
929,701,772 *60D47162C8922195643B8B48DA5EEA401A04175A Anammared
929,701,773 *60D6A1771093FBD81CDED97386496180043E644B Anamokam
929,701,774 *60D294B1D9E41019F3A125CC4DC3A1FFD81AC725 anamontana333
929,701,775 *60D649399314F4261CE243F69A8B2442998B7901 anam wahid
929,701,776 *60DD38D47DF550A4EB119AF297DAF78B3328F96A [email protected]
929,701,777 *60D00B12E31609674E05A5990C6CECFD0EF9FD24 ANan8
929,701,778 *60D6664707E23BABBF5304AA613EA31DD0DA17C5 Ananasuk9
929,701,779 *60D033DDA5A19FCF911A077E1495C5C778CE3AD5 anand kudagi
929,701,780 *60D5FE05063EA19011507CDE7C82D2B5333E4031 ANAnm
929,701,781 *60DB4ADEE3C7F9E803179B7EA5B720540CF3B4EC [email protected]
929,701,782 *60DB244CFE3DA1D7011C29F116186E9AB200E753 ANAPAGAA
929,701,783 *60D07FB9A6CF699D54EC8475C6B0C6ECA12FEB95 anapaula97433865
929,701,784 *60D6522C532FFA66C0F94D15D8F6437E67450322 Anapmaat1
929,701,785 *60D09621607E29BCD29AC139C3289A347155523A Anapolis3
929,701,786 *60DD206BFE69D6F7EB76E64C3805D1F1CCF4F1D2 ANAPOT20
929,701,787 *60DB788B3D75BDA110F4D257A6485E744F469BF4 ANaqvi
929,701,788 *60D137AE2DE76B540DC549A31BBA0A39410705CC anarchoindywidualizmie
929,701,789 *60DE02DF15DB02FB3F25119904662A6372E7C09B anaregala
929,701,790 *60DC846CA693406B53D44C4648D5E9B864CC3027 an+ares
929,701,791 *60D71069C64C616643D1EDDC0B1D324B9CAF7AB3 Anarthropoda?
929,701,792 *60D944423C6BA88E71FB445D26DB4D541B018E04 Anasabina7
929,701,793 *60D09E84FCEBCFB4A23D8281B3B568723C172E57 anasarko0
929,701,794 *60DFC25EDAF1FD3530F8F3C0AC93D1D3CC5AD219 ANASIASPOS
929,701,795 *60D8D5276C6CC531AA2A22A39977AB2FBD5738ED anasims7
929,701,796 *60DE4E1E93E8635074534A608356DF49D05E4729 Anaskedhing
929,701,797 *60DEC0D3461EBC6D2907BEF8A5C227FFE97A197D Anasmate0
929,701,798 *60D7BDE3C6985D889F16817DEB701EC69F67FDDE anasözleşmelerinde
929,701,799 *60D8570B06246236A6B883A3D375B2DEFA334EA8 anastasia ennin
929,701,800 *60DE0EDFB56E723D30D7BC4BB0E48F3A48DE58B2 anast!gmat!c
929,701,801 *60D6650850464C5375CDF605B73263640CC29754 anasthlwtika
929,701,802 *60DA961EB39B8B9CD6ABB6A2223C73F2C5D86033 ANASUBUYUJ2010
929,701,803 *60DE3AC1595FFA3768B399E90B05D66F0B613BF3 Anasuksi7
929,701,804 *60D7AB9289A39D8C306125042779EF3C602C5783 anasztasziszig
929,701,805 *60D2B5A347B20530A10094961C5EF8E611D56FA1 Anathematas
929,701,806 *60DB6FA0B859CED29EC5524A7D77D5C11123368E anatherum0
929,701,807 *60D4E3418713F41EF3C38E2D3CCBDE93ECCD001B Anatihci5
929,701,808 *60D11284613CCDA22EA4D25042FC0382A82BDFF3 Anatnojrs
929,701,809 *60D212BB918C42762A63A03D2E0FB8BC8A3C7B81 ANATNUKO
929,701,810 *60DAD45FE6927850F22A066BD3917ED03369E132 Anatolem2
929,701,811 *60D96FC9438762F599BEB58CFA8AA06DE98013C6 Anatólievitx
929,701,812 *60DC9E20491E96E42CAA550C4D0C02551B39BDAA Anatomiczno
929,701,813 *60D019067853BDA90C0D1900321453FB9426BC4B ANATOMIZED6
929,701,814 *60DD83E30482071083468AC34DF90C2C441EAAA3 ANATOMY301
929,701,815 *60DC72D309F13D9A332AF8CA2B23151291673121 Anatoxic5
929,701,816 *60D54AAB1B44D98CAE8C885B3906E66E79A4C70A anatrafei
929,701,817 *60DF927A5C10CDA1EA10536BB46A249DB96819B5 anauati1
929,701,818 *60DC426A596843FA2D523D310B094B08B5BC0835 anaubelucirapid1
929,701,819 *60D70B0101A1D7BE1FD759AB19407027CF943D81 Anaulacomera
929,701,820 *60DE6E14A55ECB1A6A45AFC5056015EE94C7121A anawstob1
929,701,821 *60DF691AB4ED6F3392F68B2A45E8A29F0E78ADDC Anáxarchos
929,701,822 *60DA791E03BB40E98D0DA930DB6966C43364FE1C ana yanagi
929,701,823 *60D15798801750D587AFD9BFE360E27EAC66D14B ANAYELIPIA
929,701,824 *60D91F953B1AD1B0F65E7237601BCFAD50F079AD Anayyana0
929,701,825 *60DC608FFBB1D5901680797031BEF53A6A673D5B [email protected]
929,701,826 *60D3ECB8BBFF49ACD0D1F37CB8D16954768303D0 anazarka
929,701,827 *60D3D9AEC33D4E8DDCA83C4A8F90BD893CE58BAA anazboe4
929,701,828 *60D6CC411EAE0416CD878B67534958565D0202AA ANB0P
929,701,829 *60D9F6BC1B87431E7167D5C6638ED8BF4F71D5BC An(B4
929,701,830 *60D675E357A809479A75A3D3857CE397F8C1B010 ANB;a
929,701,831 *60D8DF14B9EEBDD1D386B00013533491F856B82D Anb?g
929,701,832 *60D8C4E56223E748C3E3FED7A39B53459FD26A61 ANBIETENENS
929,701,833 *60DAE1A099E5FAAC141BF2EA2BA63ABA26FC5900 AnB?K
929,701,834 *60D3CCA4EEB691E14F701F85B5D4766AA929367A Anbks
929,701,835 *60D542EB7B4A2301138E5B9EA8B0D472478950A0 An)c!
929,701,836 *60DE32314A14B794EC69383D3D1A937311B5113C ANc4q
929,701,837 *60D57163C68ACB54AF8EC11DEBF9CBBA9A9FE840 Anc.5
929,701,838 *60DC48A64ED70E5DB545804C5503DEEF8C679B9C Anc7i
929,701,839 *60DE4E9BFF7FABF936CDF4B252B17E7568EC550D anca alina
929,701,840 *60DB4B11CF719B0613C64C3D122C9BD0D17A56E9 ancacopilu1234
929,701,841 *60D30B7892F904CD17A9620DFAADB49D4DB8066F AnCGY
929,701,842 *60DBB3B15D48BFD1F81A0860819E91FD6D4760AB [email protected]
929,701,843 *60D5B99473100B190E33A74B1C171201C4BF9769 anchor1911
929,701,844 *60D99B2D78D4021D1E3610BAA92EE0B81873A827 ANC
929,701,845 *60D21F255D7A2D9B6942808F3466F5225413A3E6 Anciaste7
929,701,846 *60DF42B2CCB0BDBF494DCE3A145BCA727D95E0E3 ANCIENNES1
929,701,847 *60D69BD6D0C995B94B8C5903BEDC0CCB69FC0F2F ancient-egypt-tomb-s
929,701,848 *60D147306211CE60991ED4660DE8A700DEE702F9 Ancient Ruins
929,701,849 *60D878B0BE56D5057BF44DA7F57C87D267110E58 ancientsallstars
929,701,850 *60D4EA6DD46A09C1697554B2F746C6E0F4A27A00 Ancilinned
929,701,851 *60D72F1F1A02DC2EB217BDF093A630B43E013317 Ancinaglia
929,701,852 *60D22CB2D2772702470B0E6E5EFB9D65BFEB8901 Ancirait1
929,701,853 *60DD944B99B9B6E9BE97D3A8D6E0E20117B5BCCE A%NcM
929,701,854 *60DB646116F2FBFFCE228009DA4CEDF81114A53C Anc=n
929,701,855 *60D780B8EA838E0C0A4ECAD03A56B3FAE8DB952D ANCOEC
929,701,856 *60DF628F9F29233DE40E5500EDC264284B61365D ANCpm
929,701,857 *60D1CBF470D062B4DC8B52D518C2609E94E553C5 ancrehill
929,701,858 *60D8D26E72AF049FBD0C65E64DDA840859F28750 AND-123
929,701,859 *60D385D1CCD0AEF7703F6860EEC040367DE601E3 A_NDAA
929,701,860 *60D1FCFF40FA0FC5B0D1BF122AD750815DCD6A40 Andakten
929,701,861 *60D54792A1D4827DDFE5CBA603B916845D6CD01B åndalnäsin
929,701,862 *60DC7ABCA32C74E286E05D5945C2770411AFAA0D Andalusi8
929,701,863 *60D14ACF57227C6E71E1D868792CEA07F3D19E0F Andaluzo9
929,701,864 *60D739A77B40B0DF03AE91049E8921252D42BDFD andantedrums.co.ukwww
929,701,865 *60D1DF93827460A89BE7D151AD30F74591755993 - andante sostenuto - allegro vivo
929,701,866 *60D47D6AF188114E44E8634B5DBCFF3556FE70B4 [email protected]
929,701,867 *60DADCB548711AF5262FDBF22CA3D31BEF780449 Andbarening
929,701,868 *60D5F5A80E9BB5E00F84BECD2D86CA169E849AD4 andbindats
929,701,869 *60DA57563E0FC883F86413B2A1D7928B7E2C5F95 andceeth1234
929,701,870 *60D79FB429F7FA92E2734534EC9130DFA285A5C1 AnDDB
929,701,871 *60DEF70726157FA66567004D5E6D80B257072FEE andeans1
929,701,872 *60D07EEF8529806FF362988EC36B4E9F22DE0294 [email protected]
929,701,873 *60DFFFF4039916757C6616F7C0D69C300817AD43 andeladawn
929,701,874 *60DDAE52122751B3254FCAAC6A351553573A9E48 Andelovi3
929,701,875 *60D974BB22334D155A1280C66DCC1C4F407304FD andenkengläser
929,701,876 *60DA93626DD662FEF69D591EFE5C8B49D67E44CB Anderer Planet
929,701,877 *60D463CDB2A1637D82C542AE848450C4AD052E42 „Anderlecht“
929,701,878 *60D6C8B085E972C0A4E94FE44906096A6B95485B Andermatting
929,701,879 *60DBD4E54029E09B556CC95C2B1B6105F2453823 AndersenHilton
929,701,880 *60DC51D98516F2766BA5AEA1D54B3AC90E45DF76 ANDERSON19
929,701,881 *60D2A8B5BEC9C95D0BE6CEF3FB2C66402CCD0288 anderson.abdulaziz
929,701,882 *60D00B3764668A9EE7BCF3C0EB564A099798758C anderson.ablao
929,701,883 *60D446302A9DD14DE0EA63DA6E0BE05180A67A79 anderson.bereda
929,701,884 *60D9F2BFEB506F10814857BFF768140FDAFDE300 anderson.bieberle
929,701,885 *60DA9EC9D4B456C936B39A21E8814258F321FFFD anderson.boutot
929,701,886 *60DF615DFE1DAA45706D29EF0498921F6D1098CF ANDERSONBROADCASTING
929,701,887 *60DCD627C01BCF116B9C92359BC1FC132C5D0581 anderson.culloton
929,701,888 *60D964890D464982B87F6BB45940AF64BACC8524 anderson.delaguila
929,701,889 *60D1A96F68E369FC57B0E1DDBF964DEFE61BF0AC anderson.faler
929,701,890 *60DC3F4D5BB278E9B93DA0D497F9B15E08F4C1D3 anderson.gorley
929,701,891 *60DFD32CE39F7819A66444769AEA3001AD722483 anderson.gosson
929,701,892 *60D0D9AFEBAFB83C7BCF54D1AE736D3EB2502177 anderson.keep
929,701,893 *60D4E75B80E6663699D49FA9B4A4983E5C332304 anderson.kolppa
929,701,894 *60D6410195484690464F02DA3CF77D6281C1CD1F anderson.kornfeld
929,701,895 *60DCA3116E97F2D939B2040A2990F29F627817EE andersonld
929,701,896 *60DF8E7F5A0C577A5711D3108259BC40F5380662 anderson.lunderville
929,701,897 *60D85359D9C447282A8DA7DB4FF6653E8B36715D anderson.meachum
929,701,898 *60DD659E63FC6202F9AA10A1F61375045FE94496 anderson.merriott
929,701,899 *60D8D514D29328FFD5E018986230AEEF88755AE9 anderson.moag
929,701,900 *60DC03B72FF51E72BD0B2A1F4CA67F133CEBF820 anderson.morse
929,701,901 *60D41412354D0998F3EB21E7571E4651CFB7D049 anderson.musguire
929,701,902 *60D88D8FA26897EF92C9F88DC3146DA6A03AC696 anderson powell
929,701,903 *60D36B6A9BCE0CF65E24FF57FEC2F2824E5D14DA anderson.resides
929,701,904 *60D1184F0655A7D47AAF7BBD7200295189EA1400 andersonsalesinc.comwww
929,701,905 *60D73B9BAC1751F6603A6B7719E776C3292DF8C2 anderson.schmieder
929,701,906 *60DDC78F944AF95D5A35394D79A760385FBF5991 anderson.seabert
929,701,907 *60D2C324AA91F3E8598148C8BFA12C9DD0A62717 anderson.seufert
929,701,908 *60DE46ECC872E96078A2A43A87D637DD0CC9850B anderson.swingler
929,701,909 *60DE72D3E1B5FADAC2F3F93D5689D5249AE3F84C anderson.vaugh
929,701,910 *60D802145DE9D65D74602715C4EF7386C9279D25 anderson.whitenton
929,701,911 *60D06963BF8CF8786A18972FB7C9594B4AF71B86 anderson.winter
929,701,912 *60DCCAEDCB6D11B2549F13572593DE1DC84BE804 anderson.zelaya
929,701,913 *60D7DA48221480BAE7C88FFEAA1ED55EAE60F387 andeseding
929,701,914 *60D1028D747EE98ACD6D300E4CE2A86E2C80F028 [email protected]
929,701,915 *60D23719EF427BC2B4CF6ECC5535A4AAA216041B andewarpe
929,701,916 *60D187F51E4855B8611BCA946426D2CCB5A5D6A4 A#NDf
929,701,917 *60D8E62DFE9A626660B2BAD0CCF3939A1B31A318 AND FALSE IF AN ERROR OCCURS.
929,701,918 *60D8A760CBD05DCA94AA944A33B3A4499B20F51E ANdfB
929,701,919 *60D36F3E3144C81A159AABC774AAC7A39FA85353 AndFg
929,701,920 *60DC52262AEF52CBBBA72CA7CA7669943976969E AndG.
929,701,921 *60DC55F4F6E75B556A56484890C178EE83BD43C9 Andi4539
929,701,922 *60D2618A85D89B1343DCD6DEE78E9DB0952AE8F5 Andia3
929,701,923 *60DEC5A9BD01E8C3D8885BB6CDCF441149EC8360 Andiamoo9
929,701,924 *60D35D20AE1E66C85691BF8435C1F4D0E35F0DAC and i begin the longest year
929,701,925 *60D3C9AA68A140C2DD9095DEF57A3C7D86E70FC7 Andibule9
929,701,926 *60DBEE17D08E6D6673692DBF25782FEA0CC10288 andie yancy
929,701,927 *60D18FA56D514862D038FC42DE8A1681943B0C88 andififlytoohigh
929,701,928 *60D5CF827283E4241FFDB9B2C1011574A053912C Andigering
929,701,929 *60DD4D5347956A1C44E2F2C0B9BDC9D24708B257 Andijoned
929,701,930 *60DF3B18C6E172598F4A7B72F3D415F8FE05F8DB Andirika
929,701,931 *60D0A0735465523CF91FD4CC30D9168892B33EFE ANDITO5
929,701,932 *60D12DC6B99418DB97EF7A2160CE374D29A6D8CE andletet8
929,701,933 *60D19BFE5254C0F325139A8786DAC093175B9CA0 And let us in
929,701,934 *60DF79254C8BD90A98ACA12478C529CAB92DA445 A$ndm
929,701,935 *60DBD2D4C52CD2ED76BA248F285D55236E6E94C8 AndOd
929,701,936 *60DAE4D39FA4C73090956AADE7BD177FB2FDEE38 andoko08
929,701,937 *60D98F0321EB9C56D7FB9110CCD44E30C3197FE0 andokoariandy
929,701,938 *60D31C23F7E89BC7D900A5AD6A6E22110D46AABA “Andols”
929,701,939 *60D4DE46679AAFDD93D1D4E856B1B89A637B034A Andorae
929,701,940 *60D8B3F69964E6BB9B8833F888ACBABF6B7B505F Andorrou
929,701,941 *60D150E32AF30A7985AB68F9A787F2BF42807C86 ANDORTHE
929,701,942 *60DE0CF3DDF1271CFDDE34B8BCE2E1C4D0F90F00 andosca5
929,701,943 *60DD826CA55885DD80FE69FE92B983537C75EABE Andoubsw8
929,701,944 *60D6D53BF34249D72E16484C6B531D5CD9B530F0 andoukan9
929,701,945 *60DC8CAE4D3989C53199065EBC58F70DCAFACDE2 Andowdop
929,701,946 *60D951F32C566AC781369EB4B5DD98859B3CBFB2 ANDPOST
929,701,947 *60DC8962436F35F516B52A9EA9109F4DCA4D9DD9 andpuste6
929,701,948 *60D7312ACFFD025C36EE94652FF86D24EFD66415 ANDR0GYN1$M
929,701,949 *60D18F10A6013F4420C92F6A48DB59CDDF1ADB5D ANDR18
929,701,950 *60D1F48D0978E493B9A77316A8B396BB3309BACB andracavalheiro
929,701,951 *60D4695D091EBEFAC68243F8D48CBFEF00D5A73B ANDRADA19
929,701,952 *60D155968261EBFFBE9A9D4CA67941C3734E472A andradinha
929,701,953 *60DFC6B01C13E2D41C56692F5A2426C41E93B321 andrahandskällans
929,701,954 *60D8CA32506A657D06041DC60A7C8A3E3655E06D Andrannos2
929,701,955 *60D61A6E36848D635E1A820FA8A5019FF5C94EC2 andrave4
929,701,956 *60D412A04A0F3C04023CE60C91CFE4A5A54C5EE8 andre935
929,701,957 *60D6E31EC5D33850EB0F39CC9E7428AF7014E2CF ANDREA121059
929,701,958 *60D15B2996D580669077EBCAF71EA4E605EBD19C andrea.ankenman
929,701,959 *60D4256671ECFB81E5D562135610A11EC3C0D8D4 andrea-bocelli-a-night-in-tuscany
929,701,960 *60D1E3C7DEC1497EB5C900825D1EB867EDDAFF5B andrea.bryden
929,701,961 *60D1343191AA5D18682F0DA7264EEE450DAF838B andrea.buehl
929,701,962 *60D6CF69683084FC73CB184C68299D1ED5D56CAC andrea.burlingame
929,701,963 *60DDF91859AC4A5740DF97DD4CF9243764EE4F8A andreacaudillo
929,701,964 *60DA9E0D115E5540426F97423957FC55B08B57EB ANDREACHIP
929,701,965 *60DFD8799D0850DA348CF70F3F048B2916CDDFA4 andrea.diederichs
929,701,966 *60D719D33B6F4FAC16DC551E4A8475456319F708 [email protected]
929,701,967 *60D841C152D1EE4AD65EE3F39123D54D66DF3A0B andrea.edgerton
929,701,968 *60DA209BD36D9D8C5DDE01531A21D5A56CC364A6 andreaerguiza
929,701,969 *60D0B1C37415C4B7BD17129C7A48C54A0ED41819 andrea.gell
929,701,970 *60D47B4060F1FA344CFF65445702280C0060AF74 andrea gravlin
929,701,971 *60DD1DA8C52E10F427B047FC0EAC63B324175F74 andrea.hiser
929,701,972 *60D7B0AD226464974F2D2706080E5B9CEFB8D403 andrea.jonak
929,701,973 *60D678441CD5171672B17171DFCABD187F88A6C4 andrea.kilarjian
929,701,974 *60D25C9DA3EC3767DAAAC8762484A46B18EA3DE2 [email protected]
929,701,975 *60DCD238D3AA5C1115315DDA3EFAFB90CBCFDCB8 andrea mcgreevy
929,701,976 *60D12B1B217AC01A3F95ADF7AAB460B1EDC68E9A andreampr1234
929,701,977 *60D8A827404B452AE150B2F1073FFA2F40FD3DA8 andreanoel
929,701,978 *60D09E203D3983279C6905F34D69B8A88F561798 ANDREAPOLICE
929,701,979 *60D7E089BB407BAAE583E3E2DB473D652E27EC6F andreasbe123
929,701,980 *60D10540105BAD8C087C428961620DA6EFDA7FF4 andreas.bodyfelt
929,701,981 *60DCB5B85BB2D420E5EE02B47E89F5E93FBF2BA5 andreas.brechbill
929,701,982 *60D546FBCE3FF686379E23851DE4E24228ED6075 andreas.capizzi
929,701,983 *60D706B91FD93A878C08DB9C4447EAFE93A8D7D2 andrea.scarff
929,701,984 *60D33AC35A2C6968B2482C0C6CBA0589F3624300 andreas.davern
929,701,985 *60D8D92D22D0A5DE0DC5B4B65E33DEE1B3D80C5F andreas.devincentis
929,701,986 *60DFBA8721D9BE16797BDC21F76222C20DC81A9B andreas.durgin
929,701,987 *60DFC94B171974931DA83B6781269AB822C7F3B4 andreas.holmers
929,701,988 *60D806C2E8B1E208844E7320C5B4AD0F7EAEB800 andreas.jacobi
929,701,989 *60D3E6A3777D43E7F028B4C35C5C719955782144 andreas.jarrell
929,701,990 *60DBE9B7614B59F1795F2236CC0518A090DAE8AF andreas.kutcher
929,701,991 *60D6BD4EE4A43F012D5CBE9D1F6E800DAAC584CB andreas.lanquist
929,701,992 *60DD8B40C105CCB74B75250A163D72AA581B04D0 andreas.liskai
929,701,993 *60D10B48E850A7AEBA7157F8D9FB7F4BF99C4380 andreas.lontz
929,701,994 *60DEB924153BD9CD0D49528F2C9F761F60B33C61 andreas.maccartney
929,701,995 *60D14C05358E0106F03728BB01A0AC1AC7879489 andreas.nock
929,701,996 *60DFBD5FB359DC15E5E56B1B14C1CEAE4633D6D2 andreas.ostiguy
929,701,997 *60D298EA46D316A427FB70CEFA7D3A27A024A482 andreas.piek
929,701,998 *60D2DE56B073B031C52D8222BC8CC4081351466F andreas.radel
929,701,999 *60D482D005E1AE30DF91EF7B6FCA695FBD39F8E1 andreas.ragonese
929,702,000 *60DE5285FAF39BB0BAD78205862E662FD55B58C8 andreas.reamy
929,702,001 *60DBE0522B8B9543A85270520120B2946851433C andreas.reitter
929,702,002 *60D546B80202771B37AC17FAFF85513072EAC24D Andreas.Rosenfeld
929,702,003 *60D61FBC26B91F1BCE762120DB497DE85FAE06D5 andreas.seeholzer
929,702,004 *60D411BD43728FA5EC4C75B79AF39461F69983E2 andreasseyfarth
929,702,005 *60D136FDA26A5B7759D02C53CDBFB51506AA6EF7 andreas.siering
929,702,006 *60D5BF4CA586BB18BFF99B92E496CC526FD79DDB andreas simeonidis
929,702,007 *60D71D143816422F6136C67B6D85AB12A9B36FBF andreas.sobczyk
929,702,008 *60D1045EB4FC912C76E03E2F2A86D3324F097F34 andreas.townsell
929,702,009 *60D13F7718561B0C78E3C4688DC7AF7E3E0EBCBA andrea.strohman
929,702,010 *60D5C7FB6A1280343CFC0160E50AD0174A52C27E AndreasUnge
929,702,011 *60DB55D3A9950A9939ECE93A7AD7B69BFB6D7360 andreas.wierzbicki
929,702,012 *60D0145E175D58014D2A36C2D5ED985A1E69D6E8 andreas.wig
929,702,013 *60D531BA34024E9396E2E2FE918D7B826DFAD0EB andreas.zumpano
929,702,014 *60D244B0AB103DCBDD6FB5035382BF8040C2A661 andrea tannahill
929,702,015 *60D884AA613725192543BDBB9EEC99F1DCFB6EDA andreavass
929,702,016 *60DAF5BC8D8A0677F5AB62499B997FB885AE1453 andrea.wisterman
929,702,017 *60DCDE9B001B26964A374463BF0672EBF1B3F4F6 andre.bitzel
929,702,018 *60D8782276D39F6C9B5BB799BBA779AF4E60B242 andre.camferdam
929,702,019 *60D649A6C06C3CC6B9795596C90BEEA2DE213C2C andre.cangelosi
929,702,020 *60D39329BC1DF4B13E2CFCDEC76E3DBCED7D2365 andre.dehombre
929,702,021 *60D7CB010BE334B651C3DA8C37171CA95A967684 andre.drow
929,702,022 *60D1DE8746AB27EB24397A48DE197B17B781E0A6 andreea arsene
929,702,023 *60DDB125943589484C0B934D033A5B982E107319 andreeamusic
929,702,024 *60D2F2B4C979CCF5E24524302F0B5D2B2EC91FD1 andreea_stoi
929,702,025 *60D6CD594F1FF461FCBCF131924922B74B41FF9B andreea tican
929,702,026 *60D70864B1A9AA6F04AAF2233EC5CEEDA9786223 andreeya4you
929,702,027 *60DCE1BE4AB789998DE9CEE60E009D5C203E7C82 andre.franeo
929,702,028 *60DE9AD5E6EF5D2DA99FB87F3B0488586E2E7072 andre.fuscaldo
929,702,029 *60D9472FF2EBE6C41DDC85E9DD8FEA3AB92FA78B andre.gau
929,702,030 *60D5FAF5611C46A4FB8FF9DD81AA3041EB1004E6 andre.hiley
929,702,031 *60D23B690C57A0021B40A9B708D95CEB338CAB6D andreirosca1234
929,702,032 *60D5A707B950828F2A04DC81ACDCF2DB63F60FB6 andre.jeanty
929,702,033 *60DE29FA674C808727BBA7C32EB0C07C273461D7 andrejovi
929,702,034 *60DB2E52B18C135C69641920433AA6F80FF4E642 andrejszki
929,702,035 *60DD8EE7753445C0B60486C47DB1D370C4690936 andre.kasting
929,702,036 *60DBCEE1CB269690767CD3367F3F51BF8D5F92FF andre.ledebuhr
929,702,037 *60DB6EAD63924E2E0863AE8E7CD02E05C006FDAF andrelerouge
929,702,038 *60DF45A7BBBCFADB4A2454333C6797027C8E7A24 andrelio8
929,702,039 *60DF4F58BD9132FB902D78C31A99F537EBA20257 andrella9
929,702,040 *60D40778A7CE798B5F64E0C0026939A030C712D8 andrenawilliams
929,702,041 *60D2B3E4A8E3D33DB7AE21A855DC9C63C8357178 andre.ooton
929,702,042 *60DB208D477A461537D2089976B790EDFB214026 andre.papale
929,702,043 *60D6F0BDD215FBB93B4F9C1EFD6C080D05FF6759 andre.pavey
929,702,044 *60DE9B38D86B381DC1920E32BF71EEB19143582A andres.angione
929,702,045 *60DE412CA588FD891621473394CDF74F2A5647F7 andres.cappelluti
929,702,046 *60D60D8BD5E3CF0B006E388269D576AAFF69CC6F andres.cioppa
929,702,047 *60D7D5CF84BBBD6AB98791053E5C2F5320677D00 andres.crampton
929,702,048 *60D19D49146F49D5945C9A9128568B42DAFF1301 andres.deleonardis
929,702,049 *60D2065716DB052963E3A456421E34A2AAF548B5 andres.demeritt
929,702,050 *60D2D79E464A673FE18803A8C428697B62393873 andres.dottin
929,702,051 *60D53E5D8F1DDFCEE181DB1A0F3A3ABB054B7933 andres.groome
929,702,052 *60D6E1B5C3ED357AA2E797E6C7B9D218DC741C36 andre.simi
929,702,053 *60DD019D352DB242F1805033B00F395C7915E836 andres.jendro
929,702,054 *60DBB25DFB5AFE3CBAA2FF33E945B86A71EA0B14 andres.kennaugh
929,702,055 *60DCF79F521198562B2B7328CCBFCFBCC2DE5DDE andres.krakowski
929,702,056 *60D39A3F1409A3B696D856B7793ED4F8321476A8 andres.kreuter
929,702,057 *60D816E5D5C2BB186E442531306EC5CAEBEC30B9 andres.kulbacki
929,702,058 *60DF9F16723F7DF10A8D5BE620E6A46270FC77F6 andresmagallanes
929,702,059 *60D0AE2F777151AB421950A204C994F6957812E4 andres.mccaughan
929,702,060 *60D63F4CED82E7EEB08BCBD29B6690DDF79F48AE andres.montogomery
929,702,061 *60D75631F8E108961E99ED43359B09EDDEB29721 andresruiz1234
929,702,062 *60D629F9627539FB0C2FAC8A9179B975071D104D andres.saeli
929,702,063 *60DBF6FB347ABF5133B65BD7B6BC938A3BE1A50E andres.sagel
929,702,064 *60D18E159A10237E5410B2B45222EBF2AC18017A andres.softleigh
929,702,065 *60D972B4F447C68E4F97F2BEA5996AE3A5205C55 andres.takemura
929,702,066 *60DC4287B6A02B18B752C1AE34AECBAE7A28F35F andres.tin
929,702,067 *60D0E97A69484104156F4B69660C6FFD3B62B0D9 andres.torelli
929,702,068 *60DA94E5D1D8EB17820AD58FA7D38D8A3E6124D0 andres.treece
929,702,069 *60D5FE173B709248417F59B976C448C997B177C0 andres.trupiano
929,702,070 *60D7357FA4E78C7465AEBB423B97F508EFD7A3FC andres.vasques
929,702,071 *60D921998847F11C758660AF86B803775C32809A andreutzavan
929,702,072 *60DCF14512F976EDA3F274973724C136EF4CDBA2 andrew148
929,702,073 *60DDC324AD908053171092A084E72740126502B9 [email protected]
929,702,074 *60D4DA4ECED850F0A7F14209AF280BF9C6928285 andrew.ahlin
929,702,075 *60D2A35F633063243B666F5ED982CFE21BE93A7C andrew.arender
929,702,076 *60DA87DD647E029707F5942EC5B356F877457C8E andrew.balsamo
929,702,077 *60D2771CACCDE02E68B90999C267309EFF074F1E andrew.bowlick
929,702,078 *60DC72ECB71CF2CC8FF827189753879FDAD8856B andrewbrogan
929,702,079 *60DB61D2908FFE7072DB2AAFED0FEEC7AB6F21A9 andrew.buote
929,702,080 *60DB95305A1D3B4192603DE1B50A20691239F2C4 andrew.capello
929,702,081 *60D11F4FEFAFB516C5E45F3E3002A8A59DA21247 andrew.carvey
929,702,082 *60D6621006193D5BB28C3C0D2F9CE231A2776400 andrew.coolahan
929,702,083 *60D511E340B22B4D4598DCA9EB354BDF3509554E andrew_dowden
929,702,084 *60D3EE35F30B9F459C8184401956E7FCCF0CD5F8 andrew.eckerman
929,702,085 *60D71CE1294F79333B87D514BFE8ED805AC6EFA2 andrew.fergurson
929,702,086 *60DF46CFBF8F568773870C575CE1DAA7ADA0DC69 andrew fogal
929,702,087 *60D3CCA75E75C4E31BFA20FB9A70319E9D7B9107 andrew.forseth
929,702,088 *60D68748D8B9DA45B95CF78E442F11B889AFBF2F andrew.furcron
929,702,089 *60DB9BB7C81E59469723EDB2FB12EA483260473B ANDREW-GREGOR
929,702,090 *60D34B10593BD2975A27E1B2075E5C18DFC40092 [email protected]
929,702,091 *60D43A29482DF216DA209CACDC6FBF3B662B6C01 andrew.kriege
929,702,092 *60D66D8C771BBC3192E03BFB67F8FC4ED38E7BA2 andrew.mcalmond
929,702,093 *60D85E5C7BACD9C477B44FC36C2B96B95D0C7ACA andrew_morris
929,702,094 *60D9F3B97214469987ADC71FA3DA3E2A526D0A86 andrewpalomar
929,702,095 *60D3D54371070A71949DBA98F14E7A165C35C179 andrewperham
929,702,096 *60D480737DB7D925312F93FC1BC0AF52432BA7A3 Andrewph6
929,702,097 *60DCF9348D2AAD7BA2E283A27A6DE264B0831CCE andrew.priestley
929,702,098 *60D0C5FC367C2EB00820FAE9A242D3F3E7B2C332 andrew.rarick
929,702,099 *60D07B1310C0D92948031B14167C169694597EAA Andrewrebels
929,702,100 *60D95028937CA94CF76DE2F782D75A6B2620DA1F andrew sa
929,702,101 *60D89B8744365330D8D62E35425C4E8A8918AE54 andrew.sanfiorenzo
929,702,102 *60D9EF11C4A56571009592260184C868ABF5438B andrewsbuck
929,702,103 *60DBE5BAE632AB9EE66B88B90F9A1427A83DC32C andrew sipe
929,702,104 *60D21D89D795D4D6989DC956FAC532AE1CA95D86 ANDREWSJ07
929,702,105 *60DD3CF726A3A3996C9AFB28B3521B2FBE8CC921 andrew.sumerlin
929,702,106 *60D01E583B871B83B18492EC98D6FCF7E99DE988 andrew.szabat
929,702,107 *60D5EB5C30DB02012C645B9FFA4D4CC56E9E6D22 andrew.viveros
929,702,108 *60DB1C9238310CB99683996F242BC3C63F6E20C1 andrew wayne
929,702,109 *60DF100B210D4E0B48E593804AD2BC5BA8101DA8 andrey_a74
929,702,110 *60D5EAEA0EFB1707DBFA27006A06ED558CF5EBE3 andre.zazueta
929,702,111 *60DF141196C856D8FACEAE2C2FEDF51B81121AD3 andriis2
929,702,112 *60D4FD255EE41860691B4C5011E5E8027B27A2D3 andrine1234
929,702,113 *60D2A94ED3292D04D53D0D07F5A312DC06B87449 Andrísek
929,702,114 *60DE01F8EABFA5ECB9B120402BD80237A4B8A79B Andrite6
929,702,115 *60DBB4BBDB773C9283E074E823615D5E5604F217 andro$
929,702,116 *60D05EAAFDBDD52F848F1E51B99EBF65E1E6D1A8 ANDROIDETS
929,702,117 *60D1F3086205D9BC43B988515E7C193495CD397F androkinin!
929,702,118 *60DC6022864CCC4701B50D1B07FB68328ED8E80F [email protected]
929,702,119 *60D167056141A950EDF0462E47CAEE2831D50446 andromedē
929,702,120 *60D5C0B3E0D095A43CF2AE150C1974C1980EF1A9 andron2005
929,702,121 *60DF25FEA01BFEB8031E0E5B2CEBF70C5218E6EA andropolouso
929,702,122 *60DE75D76B694093CF832F96FBEFFB0984274FCE andro$porangium
929,702,123 *60DDE139D89875BD0ACAE56F37EDAD8855CB61D0 androsml
929,702,124 *60D64EF83FBC67BEF12AFC9BDEA768C16D116709 andrutzudragutzu
929,702,125 *60D61867C178924AC86A25A203FD3849B1BC1E5B andruul-de-jos
929,702,126 *60D63F078589FF3493F3ECFD8CA85E8B6987F669 [email protected]
929,702,127 *60D32DF974B87E3412F43009F52358C1167D55F2 Andseled9
929,702,128 *60D9D5776C98E8D33EBE8D84D9029B9617A4FDA3 andstæðings
929,702,129 *60DCE68270AB094D911535C7FBF4F5C75C1D9FD0 Andverdi3
929,702,130 *60D71DD9E9B072D1FC5D6C8696C235509F775BD2 AndWe'llDance
929,702,131 *60DA18696C42130A9A043925129A2C8FF517FFE9 andy0928.bbs
929,702,132 *60D7380D2C5EBEBCCCA984F9D45CA8932F87652A andy-0v3r
929,702,133 *60D9E3E75BEF3509C133850D09A52F47F8BAD6F9 ANDY1943
929,702,134 *60D23A8B7543C885C5473214A90FD4F0F043FD15 ANDY1996_
929,702,135 *60D636E31AC1ACB590BD2B254F7F9E589839983F [email protected]
929,702,136 *60DFEF99B3928906ADD853CC202BC1913122B03D andy.barlow
929,702,137 *60D80856FDCAA97BB462615A614EBC16E2FC5A14 andy bristow
929,702,138 *60D63FF77C5B5A9AF6375AD11E52F0DA55550D77 andy.cerecedes
929,702,139 *60D76D6884765B1DB048E580D3C943830FA6B157 andy.chabaud
929,702,140 *60DF24EA31F67033E40E574E2D8D9C3FBE8E7A3E andy.dearo
929,702,141 *60DABB736C0916B2B53562D2DEB8A1B6B58BD7FE andy.debenham
929,702,142 *60D52E0B3DA7B85522886AC2892128B7868C2EC8 andy.delosreyes
929,702,143 *60DFA59E5ECE9212DDB3E03E722517638A3B507B andy dulaney
929,702,144 *60D86135B37383AF436AC948F586D871728F2342 andyegan
929,702,145 *60DC20E4A5352BF91104AABFF3F269D3E73C4467 andy erlangga
929,702,146 *60D133DB267C0648F28FE09443BAF1F2416D1C1D andy.hirz
929,702,147 *60DEC188B20EC61BF81B53EAB221833826926AB4 andy hughson
929,702,148 *60D96518D9BB723053E247D7E68E23B9534672FA andy.irving
929,702,149 *60D014849E33BAC66CBF215F508A2601C353CDAC andyjaked
929,702,150 *60DC65C2C54BB0A06493CC782F029F03520EA227 andy.kartchner
929,702,151 *60DC99B826C19577103B41DDACC570C192B446D7 andy.kosters
929,702,152 *60D7FEECBD415C860355C4946CF7E41E9DB2AF8A andy.laesser
929,702,153 *60DCD15A87E99A0614FA0E10F4E69C1E3BB77B6C „Andym“
929,702,154 *60D74878E807858084EC1E9B0820D7DBCCEC63BA andy.mantione
929,702,155 *60D3CEA9F0DB9ED6472B0C0E0469A1D8057D58BD andy.mazzawi
929,702,156 *60DEC32D9DA3370242873E5C116340492B401782 andy.messan
929,702,157 *60DDA6AC22048E4D689F447AAD0FAE811BC0364F andy.mortland
929,702,158 *60DF3485B97D26657C4282D479708310EE3835C9 andy.notte
929,702,159 *60DF83E0F671A4C30C8BFAFDED7B5BBF1ADC905F andy.opfer
929,702,160 *60DBAC902748126D2C66D7FD12F8B82E8F70463F andy p chan
929,702,161 *60D7FB542F8F6486908350969171D9AB39256F93 [email protected]
929,702,162 *60D6709DCFBCA42D2BA65FFC11B613EB6CC3FDF5 andy.rogol
929,702,163 *60D016CB412D5F778611133464BB0CD9CC6E0CFF andy.seaney
929,702,164 *60D74C9DA639FDF805C224136282D4D805D8A164 andy sentosa
929,702,165 *60DFC669C714C82868B165DF395D57582C6677F8 Andyshar2
929,702,166 *60D18B878F1EDC97EDDEA1E2220FE301350CAC1D andy.sobeski
929,702,167 *60DB15D507B8171244E770C1AFD5F3982ADDF0E4 [email protected]
929,702,168 *60DCE397465665FD826371485F95FF6132047859 andy.waskow
929,702,169 *60D9AFF0FA96D6CCA873DEDEA205481CB870D71C andy.wiford
929,702,170 *60DCE70370270AB5AA073F8713B2FFB4FB61E74C andy.zammiello
929,702,171 *60D17BFA768EE6331A7818A3EFE10D4B72A071DE A_Ne+
929,702,172 *60DEA609D7AA683A5C01186D53D2FAD7BD49BCFB AN.e,
929,702,173 *60DC998CF48F19A0663DDB0B327DB923D474013A An/E?
929,702,174 *60DDCDD7FB1FE61C5174E0EAED58BB5B14C3E60B An#e#
929,702,175 *60D8872E4E2B1F12A96839F11F5F39B66628157A [email protected]
929,702,176 *60DF0F6D3633C1C90A89EB33F2200E6A9D61B6C3 aneagleinyourmind
929,702,177 *60D71296D3996CE10EB386874101B102046127C7 anecutie
929,702,178 *60D117DBF05DE3A98DE1445FEB95BC485E953387 AnEdg
929,702,179 *60D4000B9CDB5B60CD3960D9999978BD3A35E969 AnEdX
929,702,180 *60DFE361EABFCA7E1F4D21F884BA9AC5BB92601C A)neE
929,702,181 *60D724DE93E76A0E79946DEC8BCFBEC591F32B88 [email protected]
929,702,182 *60DC007435311FC5B1A77821E6273E971E010757 aneeskamal
929,702,183 *60DED0C185BE45ADF81C604AABE64CF912026C5C AnEfZ
929,702,184 *60DC8E520B6B1B939496CD46933D6992D9D4093F anegasen8
929,702,185 *60D566EE3DAA7609951EA7813311AE2617F18C3F Anegondhe
929,702,186 *60D66402D24FCCFFA8D2E26E2504A7A81A93E2D7 aneherd8
929,702,187 *60DD05A071107F77BCD6E02ED1151744CFC97F03 aneinanderklirren.
929,702,188 *60DA85FB96DD1D965FEDBE61EDA74DE0CDB3119D Aneinanderklirren1
929,702,189 *60DD95DD85460D663FAE2A2FE20F1ADE106B17D1 Aneisiin3
929,702,190 *60D20449F781D5A96B0F237D3BA0242B890D5ABF Anekerew7
929,702,191 *60D8F0DC212614699B08E064A4094009398121DE an electronic address
929,702,192 *60D5D05A39423A5D43391190EB6EE8F5D3C45F8E Anellina
929,702,193 *60D09DC526A5E87C26607796C920A5D5E7196D9B anélytres
929,702,194 *60D0995954791A7D851A566D77E248C27B3F2F76 Anemetaf4
929,702,195 *60D3551162AFFE7A714D05F3EB7E626664B54AC4 anémiai
929,702,196 *60DF9F16A7C634B1F104FBB44602CB1B10049B2B Anemiaits7
929,702,197 *60D3053B1F3C9ECB35E39F4BD37097561F80CC07 anemiera?
929,702,198 *60DC35B23EE0E07139263931CF504FF86256BB11 An/eN
929,702,199 *60D1A0A023B502FD2C0731B9F97165FAAEDF9E2D Ane;n
929,702,200 *60DB49AA158A2E57A98E892F06B9210F26FFC7CB AnE(P
929,702,201 *60D0C973BD702B76425F6CF8FE6396A91E7C5985 Aneq/
929,702,202 *60D61FD8267C8D7EA7FCAD558648EE6AE872A48F Anergizes
929,702,203 *60D4C79FF4D5CDA733BEB50555C04288AA19216B AnEsF
929,702,204 *60D381ABCF7F63721C46A5D0AAD6DBE279D9B980 anesituU
929,702,205 *60D4D81A22F12FEBB9ECBDE561BBE1411AAA886B Anesnet0
929,702,206 *60D3EFC0A213222FDEF1B82ABC2F253B3EAFB1CA anesthesiE
929,702,207 *60DA05E23A35AF5170AEA1941D56BE4C97B34C55 anesthesiology8
929,702,208 *60D6CB5AF61AC1B58B8CB923DBE097AC7EBB22A6 anesthesis?
929,702,209 *60DFA365DD44D9938D119AE41E2C82F5B2AA3365 ANETT-P
929,702,210 *60D8614468E3E490F0A1DF9D56C10015E8DF8EC9 aneuruj8
929,702,211 *60DFECD369F56A1F6231765A1162799CA278D9E4 AnEveningWiththeGreatPopsOrchestras(disc4)
929,702,212 *60D9D512D021A18CC676CFF9F43E159FEF2CC29A ANeverEndingStory
929,702,213 *60DD419C70247B4F9CCDE24D66323121050E8092 Anevlyse8
929,702,214 *60D0B949A9C7BA529A6F8810ED7330313F0EE5B3 A((nf
929,702,215 *60D6D48EFC8C110045A603923AD57CF00364CC19 AN
929,702,216 *60DB685ABD9FFE9F373D2DD5A067D7C41325554F Anfahrtermin9
929,702,217 *60DB823F5F622FDD044BCA732C313CC77F974A97 Anfahrtskarten
929,702,218 *60D6875B1CDBBE1E85F6425503EED9C4870DA1A2 Anfangsgeh
929,702,219 *60D6E5D2B78B7A64FAD845119D0DD3099C19C0A1 Anfangsu5
929,702,220 *60DA1997F4D966E2F63A3BC4D5E4C3C126713773 anfasse6
929,702,221 *60D3A0AE34BA8160AE9B60BFA9692930AD15CB0E ANfDd
929,702,222 *60D6CF86A647BE4D25342C224016E6F4A0159CE5 An"fE
929,702,223 *60D72409908BCC93FAD05004689CD2041125F5C9 anfenee.bbs
929,702,224 *60D88BE964E9C372E6E5672A6D0BEC47B33E757D ANf!f
929,702,225 *60D64B8506ADFD9E08CC9EF728EDD5C8FF130DB5 Anfordres
929,702,226 *60D6F6516109A11652065262EBF742BE2189ACEA ANfqv
929,702,227 *60DB424E952A91C75E496D0545AD891E7E62A092 AnFRr
929,702,228 *60D9F456C68AB0155ECA766BB134AEAE86C942E2 AnFvu
929,702,229 *60D8DEB353CB53751B650CD9835BE97F3312759D AnFw6
929,702,230 *60DFAA67F9F1243432ED862F44F6051C655305F1 A"N?G
929,702,231 *60D171F3AC37A23B6DE77FE2CD9D1C9050766A80 A,N(g
929,702,232 *60D436EAC538BA37F7584958D2C24FE8B65D8427 ang1ecta515
929,702,233 *60D59305F06296CC24BB4778376E2B01C7078128 ANG3LU535
929,702,234 *60D829DC8C69311412D74474144CF3BD84CD974B A+Ng4
929,702,235 *60D8BCCB7577E1254A604054A17E7E85A48174B9 Ang5.0
929,702,236 *60D1A8ED8ED6EC535DA076AB53702F18FCB7DAA7 AnG9F
929,702,237 *60DCABB8B6BFAF17B8223F0314BCA14D2F8BFAB7 ANGAL432
929,702,238 *60DF276651802A2EEAE8F55FC3BC0AFAC72C0B2E Angaʻofa
929,702,239 *60DEB0A619BDD668D1BA270CC11F16F76E1B24B7 angaraned
929,702,240 *60D62DB4F64B2FCE7025F83938DF23CA839DCA5A [email protected]
929,702,241 *60DA9EFCEEC554163DB138A89EE9E702AD9E653D (angband)通往
929,702,242 *60DC5C56EC7D81E43AB57382A8BCC1CFAE00BD65 [email protected]
929,702,243 *60DAD3CD7972E5FB3A2C8342C9DD573262C0F392 angebotsstandort
929,702,244 *60D901F20483EBED7B4970505F9F975D28E2CC42 angedsid2
929,702,245 *60D3502B77C353B9EB8F29AA25A506B7CCB89904 ANGEL0424
929,702,246 *60D912835A9747D974CC4C7988CF5D987D9F9B89 Angel298
929,702,247 *60D28F5C24AFB620357AAB4D6532E80394FE2445 ANGEL3310
929,702,248 *60D496F6B03A0CF8594E4B87232A3B4251AE4941 angel5456
929,702,249 *60D6F2138EE66BDC67E589F83C5CBC80143070C5 [email protected]
929,702,250 *60DAD2242B3E383ACE1CF643DF2C0E80A9C4FF66 angela1roy
929,702,251 *60DC20FCDAE16809C12E8250ED4B790BF45ABFF3 ANGELA491
929,702,252 *60DD0DA51DA55E7B94DD79379C70C54C51D4A3CB angela99sun
929,702,253 *60D1CDC4F4304C7AE0B7974A33B27BE098B78CDB angelaawe
929,702,254 *60DE7A4F55F72478699C2CDA53DE0EFC43660D53 angela cree
929,702,255 *60DA42614946BAF85D14CE0BD72ECD79E80973C8 [email protected]
929,702,256 *60DB5D88D2CFD2183EF10F71E213973CBB1513E0 angela fascelli
929,702,257 *60D340CC28F9A8DBE17CD654E138E63336F7EB37 angelalocantore
929,702,258 *60DBB6D7ADF92FA94E8882C538121999D4081DB5 angelamarchese
929,702,259 *60DB37424971FB6482F2E0EB0DE8A774FA506734 angela mattoon
929,702,260 *60DF5B43165186AF98C39E7496A338964811630B angela murtagh
929,702,261 *60D064463F4E698BFDCBCEEC6A6C6B48CC1C4B96 angela m watson
929,702,262 *60DBB10DFDF479F14F6F7A814FEE14D5A56DADB0 angelannaop
929,702,263 *60DEFCC452D8259C2E010B464F0752E9FD4997E5 ANGELAPOLLO
929,702,264 *60D0E68F174E476EC8D33A113BFFA67D14B4E000 angelari0
929,702,265 *60D4EA51D1E0CBCE147D30D359B6FF207F630EE9 angelarthouse
929,702,266 *60D2D9EEE7EAF9F1789A88D8BC81C49D7CBE54F7 angelazabala
929,702,267 *60DC6952871DA637DBB9352C07CAC0CC32CBF4A3 angelbaby80906
929,702,268 *60DE238A0FEAC0C4C3574C7C0EDC947759679E9B angel.bartleson
929,702,269 *60D6A21822A4D7B8D87E7A3DE0A6535E955430D3 angel.berno
929,702,270 *60D46F8028B9673C0BD5717F683FC1EFBD782A21 angelbj1
929,702,271 *60D13BAE12C2B7951FAFC775388A3E21A7F8EA7A angel.cadarette
929,702,272 *60D7A8CE12B263C9F42281C65A806C9ECA20A630 angel.carmicheal
929,702,273 *60D6FDB4421498423F01C2499DCCC8C8E6BF7E7E angel.cheater
929,702,274 *60D5ABB1AEA77671C79D4F0175FDD416C46DF090 angel.ciaramitaro
929,702,275 *60D26776F5F508B0109E616F03350309EA7DCDF6 angelene01
929,702,276 *60DF821301D83579DBBB32F80D43AE8D7D1874FC ANGELESMASTRETA
929,702,277 *60D619A890108E071E9FA426C9B53C0273C87C24 [email protected]
929,702,278 *60D640954BC0118E6C0C05791A7B9DFCF48BB608 angeleyes(schojolin&teraoremix)
929,702,279 *60DAA71A6B1CD89DBE74843F0F2C87F065738455 AngelFalls(ParticularMix)
929,702,280 *60D9075D2F647526217981221A86A23F85CC6CE7 angel.gutenson
929,702,281 *60D4276181B6733D1C6A40B955DD931442D72C7F [email protected]
929,702,282 *60DEA875F0564B223C89605B1D03DB4D78F27E70 angelhelen75
929,702,283 *60DA2173BE1FF593A70DD8FBE17C1DB1298C2A43 angel.heredia
929,702,284 *60D7A791FFD35E4725AE5A550F79678831BC4F24 angel.hueser
929,702,285 *60DDFCA2E7F90A5B1887C22AE570A65D31DF3807 angelia romero
929,702,286 *60D5B4CE05FB73EF28C8CC2DA0F6797A265C7B7F Angelica025
929,702,287 *60DB9B32EF2EBFA8203A90E651E9BC686CD791C5 [email protected]
929,702,288 *60DE32AE322D3CA4FE38443C0AA0156B7A8096AE Angelicos1
929,702,289 *60DDD051FB1107823A621BD1ABB680F0923671D9 angelinaliew
929,702,290 *60D53D2C449AC5F555D8F2EE3B23E899F549F87E ANGeliQue
929,702,291 *60D93F0AAD33D8A6D087129F47F6B259156874C3 angelito paredes
929,702,292 *60D812CE9C15A6FD9E07841B3BD4C9B90C43FCE9 angel.kenniston
929,702,293 *60DBE2BCE971EF15FA63416D820AC59C0C8F06B4 angel kitten
929,702,294 *60DAFE088196A4D03D987E7095427FE874010F25 angel.krise
929,702,295 *60D1F1A908CBFEE35BD64AA816F54BDBF39350A5 angellawalters
929,702,296 *60D3FBB476B6B2D0D64614BC79BDB06C9489061B angellim7
929,702,297 *60DC4658D9003760CB0172498FAE55FC01D272A7 ANGELLORUM
929,702,298 *60D7E058372E9219751EA741836F64B63E315BBF angel luis medina
929,702,299 *60DE0E21FF9CE4162494A708D5D09C66F09B6515 Angellyca
929,702,300 *60D17487272BEA21A9716185AE5E47BB9148CE69 angel.majewski
929,702,301 *60DCB56D6C01CB0A93783F013BEA3B52FE0522A1 angel.marashio
929,702,302 *60D6D55AA181A706F29E0813613A4A14C39637C9 angel.masin
929,702,303 *60D993456267ACF1CB3E1D13971B60A07AAA23F9 angel mcpherson
929,702,304 *60D92DF0B76EA8810DB0436176B6F3188636999F ANGELMOM
929,702,305 *60D6C70E5E6C4BB4B8D9D9F339DA0A9F6D81C78E angel.montesa
929,702,306 *60DCB5A1817A3FC05CE1B5FA1F6060F3343B3149 ANGELMOTHER
929,702,307 *60DC6A265B900317C58C7578ABE9B053D38B2DC6 Angelmpa6
929,702,308 *60D40270F07F40A66DF8A05B385BF1485B81AAE3 angel.nalepa
929,702,309 *60DD26A9846193C269EE193E577A4B6A14117AF4 angelo amoia
929,702,310 *60DC45DBAF02DD1BBB7122B9425C1CF0887694ED angelo.bogany
929,702,311 *60D341D2CD0055DA9F1AF65090782C1CA37E4C3E angelo.bolda
929,702,312 *60D1F4543896E99CFB324CF9B3BD9803627F910E angelo.cai
929,702,313 *60D389F1126BB11E378AB62EE4AEDD8073086B11 angelo.chey
929,702,314 *60D47DDBE435B95D07E72590CE2138F01A92E2C3 angelo.deleonardo
929,702,315 *60D57B635C8D53E3AC564B889E9E64304B1B5B19 angel of mine (blacksmith)
929,702,316 *60D0519D56A1C62B10F8DF63B1C046DAF1F36420 angelo.goulding
929,702,317 *60D76B44A23009134C477970ABA36CF01DB2EE83 angelo.helstrom
929,702,318 *60D036643CA83293450770B483EEC60C24339E1E angelo.knauss
929,702,319 *60D97FE442AE159040FDEB0F5E1493AEF1CE9FFD angelo.krumbach
929,702,320 *60D68AC7270561D4D0F689097AEDC9F0D13BBEB7 angelo.lentsch
929,702,321 *60DDAE7332B3BBDAD785C32F2ECCE76E90C6D3B4 angelolouw
929,702,322 *60DEE92185E7801D033876AA5FA47A635688BC19 angelo.mclyman
929,702,323 *60DC30E4F187828E82D39F511A9795CDF6892D21 angelo.moretta
929,702,324 *60D08CBDA53EE047C2F0ECC9455BCB22EBBFB7CD angelo.savarino
929,702,325 *60D803781DFBD75D7E714FB4B2102825E05590C9 Angeloser“
929,702,326 *60DDF4B45057E0510FF297B3207412593463D4B3 angelo.seward
929,702,327 *60DB02BDE6BD58B86D290C4FC3AFD5FCBA149685 angelo.turnball
929,702,328 *60DA1EC8674D6FF7A8BDF4C6704206E8176BD4B6 angel paquibot
929,702,329 *60D2B79E207433EC8192AF30DE6E8604B2C57456 angel.plautz
929,702,330 *60D32AFDAB958981308C9F4BD01C18C59B08FCEE angelrebeide
929,702,331 *60DD54CB64C7E29EFA869A66921DB7D5F5B73F62 angel.riccelli
929,702,332 *60D42A605C83190F8AB7AEFE07F3479EA1785A98 angel.richter
929,702,333 *60DDF1D16BD99D8F387E31CE3A12EC6E2403F1AF angelruchi
929,702,334 *60DC7FBFC93401554328C4B5CFC6DF1029E479E8 angel.rutko
929,702,335 *60D4F537023E67481CC42F931D215558B1968F4F Angelsbfi2
929,702,336 *60D69BC070C8597828FE32AD4D6CEA10F4C90A5A angel.schoenberg
929,702,337 *60DAA113C0F901EB7B65C1F7FD90CED6825166D9 Angelsfoxed
929,702,338 *60D94E3FC0DAF254C01F5D1B4DBD3EE23C3A203D Angels Live Inside
929,702,339 *60D9DC7BE627DF30119F2E338B02E863AB403E9F Angelsmichel
929,702,340 *60D4BBA59FF9F8334E5F1C2B0AC176CD09302707 angel's people
929,702,341 *60DC808F654BF860B6FCD293DDF43F49CF963663 angelsquot
929,702,342 *60DC554E77643BA4190AA043483D8F409DBBF49F Angelswesley
929,702,343 *60DB2E455393352963F710EE34B532EEA96692CD Angelsxxx1
929,702,344 *60DA442EAFE7C475318A14481221AB8697207384 angel.turchetta
929,702,345 *60D4DE06B520CBCEEB647E875869F2FA64278D6F Angeltve6
929,702,346 *60DFC995C502EC8C5B68B0A274FE29B3D2114618 ANGELUS_3KILL
929,702,347 *60D60F3DAA61FF6263E0F5102B96AE606C4458A6 angelvalentine
929,702,348 *60DD3C5E36C6A4EDA8E3502F9BB44505EDAB1AE0 angel.valentine
929,702,349 *60D0AF90D4A839CC25555A87E3A945A9320C2930 angel.wales
929,702,350 *60D40F4291D7F9CD067D704D5EF83BE45EAE2291 ANGELWITHICA
929,702,351 *60DE66A65473DC220ACFD1DF6B4F92748D2DC5A4 angelxkiss
929,702,352 *60DA5CBD8CF3F940A90C1CFAC6BB0A1D39118C10 Ang
929,702,353 *60DF1247D5306F32422CD7B6ED99A791A964FF04 AngerControlB
929,702,354 *60DDAC0CB6D8D2F3AB21C2A571F8DAB1C5634305 ange-resigns-as-panachaki-coach
929,702,355 *60D97BAF1A31B41E8AB9BBDFFAA605B4069A3674 anges10
929,702,356 *60D146C5991428DD5429C23A1D65D6F46CEE2BEF angesaeu6
929,702,357 *60D3C50ABA429FE2BF4BA24FBA72C30002656B87 Ängesön
929,702,358 *60D8E617DAD0D26350C394008717AD6C671A334B ange-to-find-footy-superstar
929,702,359 *60D0DB8180924923C9F43DBD1D1DF678A1EAAE3B AngFS
929,702,360 *60D8B3A21227FB40F82DCA879C4A3F72C6515DBA Angibili2
929,702,361 *60D25781FEBFF1F56C8FF62BC63ED5359425896C Angidarr
929,702,362 *60DC15E98E9046D114996E6C52C080C2E771D7F9 ANGIE050
929,702,363 *60DD9E491CF8CF49B1B2D9C64144CF656932FBE0 [email protected]
929,702,364 *60D04DFAD53CADBDA0654285DAF869DF9E1E1D05 angiechatfield
929,702,365 *60D6F312F851CC423922D0B394CF12A27CB46043 [email protected]
929,702,366 *60DF2515A990EAC95DBCD2C3A60C1167F540174F ANGIEMARITZA
929,702,367 *60D3B6855C9F9E1F254A2616A1555B2E250105F5 Angiemelissa
929,702,368 *60DD4CC68ABA22D62B5540025D28D95F0E9615EA Angie(Nein,Nein)(2005)
929,702,369 *60D86A9BFEAB089D725A87279C5B13A39C1E7736 ANGIENIC
929,702,370 *60DEBCA636AA7E4F6147FBE56563BD64CC38A851 angie ottinger
929,702,371 *60DCFB84EDA254F4F7C5416CFE83538F5A43EC27 angiep39
929,702,372 *60D308760282F9C8466C3FC4715F0FA45B5B44CE Angietaffy
929,702,373 *60D77B5F2271CF06BA4AC9B5CAD6E473AB56B0AD Angilbert3
929,702,374 *60D83041461AA8C2DB5143D11BE863E51734736D Angilie3
929,702,375 *60DB7831907ED5A78D54D126BFCD445401509FA7 angiogenik
929,702,376 *60D13F80E85F051D1F47F1023327C442166253E7 Angioleucitis7
929,702,377 *60DF9A8F7157E5524439BE426DF7A488F9A06ADE AN:GK
929,702,378 *60D1B81F334A1EA8552F052075312ADEB75C8408 [email protected]
929,702,379 *60D20166E2DC09CC02FFB4CB301ACA0672EF334F [email protected]
929,702,380 *60D49EE7130B8C77FD708EB8888570B58DB16FC6 Angliaansa
929,702,381 *60D5D1E6C85560A20424F75BA9C1CA8C954248F2 ANGLICISES1
929,702,382 *60DDD45086FBEF00994C7A50D30C025C74B54186 Anglicke7
929,702,383 *60D552B7AF97FEC2C4D2CBC820882AB61BFD5011 Angloed
929,702,384 *60DD1556B20335DC8BE1F95BE9ADB22B3010E2D4 anglomanen1
929,702,385 *60DEE9A2AAF4C2BFAB03D71E9F0BCADE38535BDD anglosaxonattitude
929,702,386 *60D3BD17434442441CE1B061288E2AF97F193775 anglosoviético
929,702,387 *60D2657F1944E7997C630B9D434B89C5B7B67E9D ANGLOVIA
929,702,388 *60DEC6A40385ED67BE79029DF0EFBE47F4EA14EA Angloy
929,702,389 *60D9AA2B3E8985109B1684846B64934D9F1B86DB anglzvoice
929,702,390 *60D658866DEA57D800DD86630BC0D84A12BC0850 angobansaor
929,702,391 *60D5F89BE66659FEB8E411630E699784602504BD angoloso8
929,702,392 *60DAD3F7A16E8929DC28EF245EEBE1D77D80B06A A%NgP
929,702,393 *60D5688F25334A8A366BEC8385E75E368E707745 angrove3
929,702,394 *60D409BF7C00373E225169636771DA6B467C636D angryinclusionist
929,702,395 *60D866B06535D579B248D9E0F85B170F3C9FB46E Angsliep8
929,702,396 *60D0E80A9782AE468A32049443CF941C40F64338 ANGSTBEELD8
929,702,397 *60D3EBBB3EA40ABBF9334D6A07A1204E18ED7F35 An&GU
929,702,398 *60DBA591F44D11F6B07D7B6ECA1C6FB31BFF80EA angu$+ia
929,702,399 *60D2B32767A46FF3EB2CB868A331B8F23EE03BA8 anguish:isitluck
929,702,400 *60DB42A7E4DEF1934F79D5D88532AAC4D4A016FB ANGULARISATION2
929,702,401 *60D93F784EC6DC87B46DC8F7B3A4870A673AF178 angular-range
929,702,402 *60DB6E5126688D28498690807C89FE3F70991C59 angulis1
929,702,403 *60D33859F5D1D6871CFC2C86881C5E98F16CECF7 [email protected]
929,702,404 *60DE7163A039B2270FBFBCA6591118297C0E4467 [email protected]
929,702,405 *60D7FD713A39950484C3E9AD7CC46DB541CA6AC5 Anguscutie
929,702,406 *60DC47B2312042ED916ED78E351EA8C3A0A5F203 anguspiper
929,702,407 *60D12408A642BC513187E888A51BF7680283E133 [email protected]
929,702,408 *60D147172A15CDF7822CAA0DB4EC5F37AC21F59B ANGUSTIC
929,702,409 *60DFE68354B1BE2CE54C8F496DCF0ED75F968E0E [email protected]
929,702,410 *60DD5B0DF470AA20A277CCDBAABAF1F85C19B9E3 [email protected]
929,702,411 *60DABCCB5AD7E1240CBAAE200DA603CD1F19F8B8 Ang-Z
929,702,412 *60D8CC32449296207128EBF9473478E145882A78 ANH!$
929,702,413 *60DA4EACCAE146726319DA6904FF6D5DD07F0504 AN;/h
929,702,414 *60D893688FFFD474869D2876F567644B461E804F anh0l0gize
929,702,415 *60DADC1E7684EABF73CA43F779BAFD1E87A292EF anhaenglichke
929,702,416 *60D77E730B41BD174C686AE1CDF28C58E866A43F anheized
929,702,417 *60D9B464CD425A95254AA017113F7D0F5528C2C5 anhgm
929,702,418 *60DF71AE8CA3C64AD5687045267771D7AD47E9BB ANHHUNGVOLE
929,702,419 *60D6CAD7D4D190EF31FF07F899F208C7BEE11A60 ANHI.
929,702,420 *60D06BD84FBF393722C6BC26EA6EF05DA4CFB8B9 AnH.n
929,702,421 *60D32A9F5B08A7D5D6A0AADF3B57EAED4C654EFD ANH
929,702,422 *60D67AFFB9EF6C30E0860451E7E0240C15705052 anhnglichkeiten
929,702,423 *60D0E42A38A281A306EA11CB3D4D67585D88AD34 anhörungsbedürftig
929,702,424 *60DA19BF39A3FEB075C285D3BCF9B9BD232F104D [email protected]
929,702,425 *60D039AB011C4DC23A18BD95C3E548742F602C38 Anhrenden
929,702,426 *60D0397467FAA691751884611A091E042217FFDF [email protected]
929,702,427 *60D95C280939D423A444A1A68EB54AC9AD899AE5 [email protected]
929,702,428 *60D16CAE718692D735025A2E9B34B28964D4C8D4 Anhsyxia7
929,702,429 *60D44BDB65BB849E44783A613DAF8AD39B3451F3 anhweis0
929,702,430 *60DA69B696FDF0659B49C4C87AA7C79CADA9706B An/HZ
929,702,431 *60DBB3539D648C3E8968DCFC51120CAE2651AA51 AN.=i
929,702,432 *60DFC6CCD7A948BBDC809DA04EFF13E57DB6BD1E ANi=/
929,702,433 *60D851DBE7E481FE059BEDF23832F32C9399F386 AnI,,
929,702,434 *60DFFA65ED911F344CEE5CA427E774C3846BEE2A [email protected]
929,702,435 *60D964931A67F983B13D44954631EFC77DCA5ADA Aniatnaj6
929,702,436 *60DF1952CFB7B232F660FF18A8FF1B150AF536B5 anibal.burgees
929,702,437 *60D5BD81432417E17859BCD4DF7D32FEC7EF0C45 anibal.coolman
929,702,438 *60D01D88CC40338304F9255B6218222B17A5E824 anibal.corgan
929,702,439 *60DC4ABE0CDC860ACEA058A368CDAA196FC6AD58 anibal.destiche
929,702,440 *60DF3EBA572A08C5B55648BCE06B740A4EBDE3B7 anibal.duree
929,702,441 *60D88D282C498149226923489ACFF87615C627E0 anibal.fellon
929,702,442 *60DBB89784BD53E62262A572749727AEFD7C450A anibal.figueras
929,702,443 *60D8690A4B0B4B8A99C8A383C7C71A20A1CEE611 anibal.forero
929,702,444 *60D9B30CDCD6840FBAD1E62F572E69208D466B75 anibal.friemering
929,702,445 *60DC47966295718195963C36FFC0C90E1315FCB1 anibal.gennette
929,702,446 *60DB5238B1312EAA8BD69FAB961CAA516AA113CF anibal.hyten
929,702,447 *60D1A53109675F4936003461FE6399A92E0959AB anibal.jacobi
929,702,448 *60D8FE700808FDE09D3E2F6DBFCDB47CF7AA6223 anibal.kaszton
929,702,449 *60DE92E360B9EA4C55D1E3675BD3FAE3904F8FC7 anibal.kenmore
929,702,450 *60DB89A4EEE9F6B2A2B7A40D9C247446741B171D anibal.phillis
929,702,451 *60D6C39DD70C445BA846A43E716A7B77F6F2B6D7 anibal.porte
929,702,452 *60D7C0A28AF012634745071765C9BC0710D3C97A anibal.shurkus
929,702,453 *60D3D26CDA5465E3742D46ADB912E61F191970AF anibal.sly
929,702,454 *60D30E75ABD53A33D79D5BCC65A15CE25A27560C AnICo
929,702,455 *60DFD11A388FE745CE34D7555636FC0951749BFF an+iconven+ional
929,702,456 *60DFE4811477AB3D5AFAA27DE9E96B6ADB47DE5E anicsipping
929,702,457 *60D6B2AAD21679DB58E643B4E700D5856895FF1E Anicule9
929,702,458 *60D86F35AEA73D00D0706EFA9A453F971D09AB1E Anid)
929,702,459 *60D5A95CFDC514D74A890A0DC331E5F239051615 Anidicret
929,702,460 *60D07C3312CF605F07215DC9D36B91A3CA42E3BD AniDp
929,702,461 *60D28FA2DE26C44F5F940501152717311A6B8E53 Anidrotic1
929,702,462 *60D79918830841DA81422D35AEAB92C2449D7D72 anie3268
929,702,463 *60D6A7A7B060B155A60F6A2C0768127FD30EE428 anieimoet
929,702,464 *60DF06B698143DA7B2E48B9D7E733BAA94BC7CD6 ANieP
929,702,465 *60D77543A2E0A9C16B994521CF05AC0114AC0DF4 Aniesual7
929,702,466 *60DD3600D7B86B0B06EE4D23A6CB569CF3D93955 Anieula7
929,702,467 *60DC4F54A47167E5D2C5B9EAB8AD39AC9C2402BC ANIFESTE
929,702,468 *60D14262CCA79A2605670ACFB3E2F79F636D9913 Ani(G
929,702,469 *60D8EEE64E8460B65201FE209B33CC7316257539 ANightattheBallet
929,702,470 *60D585749DD2636F2F6EB25BF76C3494BF590EF2 ANightinaLife
929,702,471 *60DCDF4D526FDEACCB486CE41B6997717D4150D9 anigraming
929,702,472 *60D2673FAAC147815BEBB06D08ED4C50798E1373 A)NIh
929,702,473 *60D56C341CCE134D60C88377BF4EA63749FD7410 Anijedem
929,702,474 *60D3FF239A49E6999EA030A942CE6496DD89AFD4 anika180
929,702,475 *60DB18A7E04AC396C0C200626E78E4F88CCACAFE ANIKESH
929,702,476 *60D9A36556AB1DEE9E487AA0CB47B749A7BF5752 aniket arora
929,702,477 *60DABA48A6FE247093E8EC647F4227C71DABE9D9 aniketkhairmode
929,702,478 *60DDFBEE22DDAA641FC54EEE7EA232318F7E4EFF aniket potdar
929,702,479 *60DD7CBE185176246F8B5F20314A7DCAC032F7B4 aniket shejwal
929,702,480 *60D4326991322DECA9F638C48378BBB9C4071AC8 Anilatau1
929,702,481 *60D3CF6A9EA01AFF21BB9A1C565D276F0020C1BA ANILEU5
929,702,482 *60DCFD882283B3533302ADD0FD92C4C7A9CA854C anilide9
929,702,483 *60D408C38AC31CDD48CB6A56C573661633E45425 anilinved
929,702,484 *60DDBA6AA77E37160D3C6547E94339BE6E512D09 aniliyor
929,702,485 *60D861931854ADAB108BD5F7F48B159968CC035A ANILKAR11
929,702,486 *60DA7A8D3CB45F76DC57C600C331B585A76D1808 anillusionisticworld
929,702,487 *60DBFBE076B6B4E5C425C5BBC7E68078234AB9CD anilrajani
929,702,488 *60DEB9215FA96873176B70C64AB555ED84E8F2A2 AniM)
929,702,489 *60D655AB12B3E6BE6AF931821B684437F52DE64E ANIMAIS-DE-ESTIMA
929,702,490 *60D5C90DB6C17FD659D49512223DFFC5FBE32AF3 Animaloco
929,702,491 *60D5A721138622BB810B6CF1C643778265993DED Animalov8
929,702,492 *60D75373869D5388B37C328674CF6D2B4170E110 Animals
929,702,493 *60DC96DF1E73D34B96184849AF74DE0960809E6B Animals/Horseoncobbles(Imitation)
929,702,494 *60D37A31F60D55278DC51F18270798C35BA0DE49 Animalsindistresstorbay
929,702,495 *60D2174F902B6319CE3301706FBAA8A826E658FF animalswqsb
929,702,496 *60D88A01EE7DD88ADEA2717CF79B7D1F22406D98 Animatiefilms.
929,702,497 *60DE32479D9143A4521706C45838FF476F3E4B80 animaţiei
929,702,498 *60DFE412F9EAEAE633E1B84C27EDBDB89DAA3C86 ANIMENT7
929,702,499 *60DD2EFD4EE6AAE553341F98A287C54DDC0601A9 ANIMEREDE
929,702,500 *60D2E43A2E045714A7618308D2BA3465CE285486 animorphswes
929,702,501 *60D8B3A4725F570F490B03889E1846C4FE778C52 ANIMOSITEIT1
929,702,502 *60DAA4147C908F62F030747C6A3CEA00DEBB184C Anincompoop
929,702,503 *60DF9878338EDBADBC4914F770E484332B3FAA2B anindya kusumaningtyas
929,702,504 *60DB922E747D29B3374AA8A34FA51F21028245F0 AninF
929,702,505 *60DB54BBB7481F154CF1196EF429BA8713ECBEF6 AN+INUCLEON5
929,702,506 *60D16081E6BEB7627B8B9802612D1761E57D53FB Aniocele9
929,702,507 *60DD376CDDC91FBF54FE7E7E1B856C01CA3C21A9 ANIP23
929,702,508 *60D91782A6BA31CD9B70F96F1419C973BEF38FB7 Anipmiok1
929,702,509 *60D1AA23693970555E978E2AF22DACCF23B5E170 ANIPSIAS
929,702,510 *60D5B6C90A688E9139E9702ED9CD4C582AE97255 AnIR=
929,702,511 *60DC2061329424695DF5BD81907FF782DC0626E8 Ani"R
929,702,512 *60D633D880E99CC9228A5130B04B10DB88BB1C33 Aniramjfc
929,702,513 *60DB8F74E8833AC1D4235A3E307D11C0C51E677A ANiRK
929,702,514 *60DBE4A39EB7FFEC2C4C5251796A51DA3B85FB13 Anirtev5
929,702,515 *60D05F3988F6E7C3693EF9E70541B9D6284D8E93 Anirtruk
929,702,516 *60D14E7C667D4FFAA984DCF97CACF75A66EF9AA7 anisaanca123
929,702,517 *60D20C368934786F04AF26A9683E4B60A1173954 Aniseront4
929,702,518 *60D565068A0B16486363866F0FF22ECB0B4A39B4 Anishreding
929,702,519 *60D84F71628EB098AA280D9894BEDBFA815CCA4A anishsaigal
929,702,520 *60DF578A1B898B52790BE3BAB7814F8F419905AC Anisocarpoused
929,702,521 *60D0163F8025DFB3828E02E34B5747FAC9F97AB5 anisodonted
929,702,522 *60D4CF465234BD715470B2007851DF6CE7DA37F3 ANISONIA
929,702,523 *60DCB75D02E9033AE402CDC4C6C9BE1BF66DAD39 Anisuakk7
929,702,524 *60D14559AB336FAE53C66396AADAB49B5BDF99D8 Anisulem0
929,702,525 *60D2913DCC8CF0C83952AAE85E0FA001CE169584 ANITABABY
929,702,526 *60D121D3C418028591D623BB8CFB9BA10341B299 anitagardner
929,702,527 *60D2717BF9E97DF7691CF4A32AA9306AF6FA9B8C ANITAKC
929,702,528 *60D183793F621A9882F62C5FAFCC52253C1E641E anita morey
929,702,529 *60DEAC03D02966EF386EF990DC2F2AB09D65B027 Anita Steiman
929,702,530 *60DB76474E22B1F31A1F04BE57CC067B866FA5D9 ANITSIRHC5
929,702,531 *60D0F3AFB03E0F5B7CADB680631084098F97190F An.IV
929,702,532 *60D861113D7D73AAA93382F574272C19F4E1B39E Ani?W
929,702,533 *60DFC85708AB147A081C78EC006B61F447759A36 Aniya030
929,702,534 *60DC4AFFEA5525D9B1E8708C88220EDB902C6662 Aniya235
929,702,535 *60D750F0FD535773E69540EA71C2E938CDE109C4 aniya304
929,702,536 *60D14F5A58EBC37D7E8BEE7DB4D82D08F411154D aniya403
929,702,537 *60DDF7CEA2A4440AA674A398773B6D3D0693570A Aniya473
929,702,538 *60DBCB3A539F153AC1A45DE5107CBC639CBD870A aniyah161
929,702,539 *60DD959943BB4E08D8E1AD13680F76A90A3A87A7 Aniyah973
929,702,540 *60D682B3EF678677E673E415E9FC085D84866F5E âniye
929,702,541 *60DE8DFC847FA261E3D71C14E95346D4DE4B55B2 aniziusz
929,702,542 *60DD25EBB4A0C5309BBD3050E51544610F62D379 [email protected]
929,702,543 *60D961A29A094BDD41BB045485BA7A45D501D3F2 A#N-j
929,702,544 *60D44D90E45349C8CD99CFCE37EB0B1419B1B472 An$j0
929,702,545 *60D38E6917744B384104E6E5DCECBDA6F771D95A anjali lakra
929,702,546 *60D4B75588A60B6E24FBA1740DC4E33E0D207E76 Anjanika0
929,702,547 *60D6260C1F6C152A0CCE80E39271608B0314D34B anjanlyn0
929,702,548 *60DD909A946E2B6560C957FB3AA60C7363698386 Anj(B
929,702,549 *60DDDA7114D3CF7C6CFFCA10427CC5BCECB63D17 ANjdj
929,702,550 *60D3D7E304E16E5D7A273C61D793C5C42DAB3DAF anjihos
929,702,551 *60D6FBCFEB3982F8C89C3EDACDD0A2643669A671 anjiyotensin
929,702,552 *60DA07361B84D29E5EA821D53E0899B4EBC7F9E0 añjos
929,702,553 *60DE54E5E03A9A1813AB13F23BFFEBE5D0740F3F AN"k6
929,702,554 *60D8CD07080AF0954185370B04FD0F0E6F5F6E24 An!k9
929,702,555 *60D173602352731D8A63CE6897DCBFA8416FA2E0 ankaamt
929,702,556 *60D7A627CB9DAEA2D9C946C8C2B34C91238A894E Ankalaan2
929,702,557 *60DC815E047393C4C4404C64D6174C8881488199 ankaŭas
929,702,558 *60DA994C1C9BBDF159AAEC5238BE6BC0D7B03981 AnKdX
929,702,559 *60DEF7028C76E63B3792BA9094F607FE0570741F änkeprofessorskan
929,702,560 *60D42DF79CE978147CB429F029EDE3F93E59574C Ankersel6
929,702,561 *60DC984B6B351CD429B66F43393EB2576F06E8C5 ANKfg
929,702,562 *60D29EE63A6594D2FB9A958880EC84167EFBC549 Ankfullied
929,702,563 *60D269606D75F855CAFBA0E0D393AEA5F1A5C79E ANK?G
929,702,564 *60D80C914EB53758E756139B97D96A36452771A0 Ankhedens
929,702,565 *60D851FF22381C08B262430F6D67F455B69AC27D ANki,
929,702,566 *60D2CDA6649FF7F7C2EF807EE53FE03BADC8B2C5 ankin900
929,702,567 *60D2860DB6D81D0DB6EC9FDDFF44FBE220F58ADC Ankingn5
929,702,568 *60D8FEEE8E8AC9EBDE47C605B19FC75042422C4A ankita khanvilkar
929,702,569 *60D28F97B7D870A4A6025F60AD88654C23A2CC20 Ankkajevs
929,702,570 *60DF6459FDB325695B65DABE19FFEB6453EA5FBC ankkuripaikkana
929,702,571 *60D9CBA06D2CCA66151E7C997EF231AB0A8B822D ankomnes0
929,702,572 *60D2CB2565EC521549F19FB9B9F6342BBD27EE2B Ankomstdato
929,702,573 *60D726F7EAD15F28823459622B6E9DE72C31CF62 ANkpD
929,702,574 *60DD846E08B5A416B2B017C00E781041F8896F20 Ank$R
929,702,575 *60DDB89060E4395504DE9BD275AD88F0ECE9DF04 AnKS;
929,702,576 *60D348EB65E254C3BF9A401087D407BBE1B3A9F5 anksiau
929,702,577 *60D79E144CD73C5AE97B94F0659019C341BAD886 Ankunftsperrons
929,702,578 *60D63C904A2DBA8FA11B4808551240C7D7206D8E Ankylodontiaed
929,702,579 *60D9BA362CE74B5A54091487D333E660BC940C44 A=N_l
929,702,580 *60D5483B17B63A13AF5351DA6B5E24CC30C52A22 AN,L7
929,702,581 *60D02AA3F65A0F065A2DE814DFB8BC90B57502BE anlægningen
929,702,582 *60DAF1CA175464CB6F4D2307B07FB4DA94BC1AD5 anläggningskostnaden
929,702,583 *60D5A02C8925C04333A40C4638337BE4C764E6B6 anlamdas3
929,702,584 *60DE4F33379CC42979AF80F751A8EF60B63697A8 AnLCN
929,702,585 *60D216C01E79BEE5E3659E1B53F375CADC02A715 Anleihungsvergleich
929,702,586 *60D3E3A550FC852FABB5984161C607713B8E82C2 anlernen9
929,702,587 *60D0A75B68B7671556C44967FA18816CD37D1272 AnLhH
929,702,588 *60D92F1E71142E614F744555B6EC1229B1B41180 Anllerine1
929,702,589 *60D6A860B2174F31738F20B6880F8BCB64F84EF8 anloepens
929,702,590 *60D9B514C9DD944BA0C6007E015FEABB33FB7C06 [email protected]
929,702,591 *60D51B424E366BB909E6C26403F3C2CD9AE4A995 AnLov'
929,702,592 *60D58D9197DF5B35D18AC1A76FB4CB7182B65841 AnlrQ
929,702,593 *60DF689DCE3A2BCE1553CE1426EFCE2E19BF8601 An;M.
929,702,594 *60D0623D9FD21217A98D9A64271A07E084E24A51 AnM5o
929,702,595 *60D83907BC06BF68637509BA7302A2B003B83F86 [email protected]
929,702,596 *60D7640BFB89310AAF9F560E670D304D78F2274A AnMaq
929,702,597 *60D7230B2D7E9D3D01977854701C7F61FA13AC06 Anmár
929,702,598 *60D6ACFC043D7263E3E9B10EC42B0D19876D5D61 AnMcS
929,702,599 *60D71199A67BA2E33D7381BEAA47D302AD8BA117 anmelders!
929,702,600 *60DF22E6C6719F7C0CD114251970C9AE4BF7A7CE ANMELDT8
929,702,601 *60DE104B0D533F4B2177B11B3E3490163F1BEAE0 Anmerk
929,702,602 *60D6361C4EEF14DBF7481AC6FC7854108D667D9A ANmf0
929,702,603 *60DAF2A08B8EEE43D944483ADF0F26080222D1BA Anmiskes3
929,702,604 *60D312CA15FC685090FE79B703138B6B753D6375 Anmodased
929,702,605 *60D5809B9A16034A0D3F299ADEDEC0C3DF5F2888 [email protected]
929,702,606 *60DCC6EEBC7A5879361B44519669DD5FF1C4EEDD An/MQ
929,702,607 *60D0CDB505268F3D04AB95B9AB08C1EF91399FDE [email protected]
929,702,608 *60D7D9E2E3E25E67572E15BB2D5A89BDDBB581E6 ANm$R
929,702,609 *60D88D46C5717E028E708516DD9D450766AAAD5B Anmrker0
929,702,610 *60DEA29EC0A5CDB17E8570395B07D6091D731412 Anm#Z
929,702,611 *60DFA4C859EC1E1AC5AFCC5B59B9E3C036BB48E1 A#N#n
929,702,612 *60DD3C531D0B978D846A70CB7A2CFBFAC12ACF32 A-nN&
929,702,613 *60D7FA4AD57D3434ED46C1FCDD803F96909A908E An/N=
929,702,614 *60DE2FED8E790E157EE378EC2C4847F88FD0EAEA ANN2c
929,702,615 *60DF670D721B8B243B71CE421DB78A5F7E006F61 ANN3BALOT
929,702,616 *60D7A7C01006D2A05F4A5A60FFEA3F3213B09F6E ann3bb1ata
929,702,617 *60D9535A91C77D4520A1BEF9D820579A151ADDB4 Ann4w
929,702,618 *60DEBE9A3BF373C1DDC780C487A394784DF339D9 Ann520
929,702,619 *60D00304C1F385BCD57545F9A90FDCBF133BFA20 Ann890
929,702,620 *60D5D18CFBE465B6DD5F42F6A024AB08BC87521C ANNA87
929,702,621 *60DB8744875159361B8D2D76F75250A10D29C78B ANNAAMOUR
929,702,622 *60DC195C6D6D9B50A8C0BA3CD1031345B15B0E30 Annaandy4
929,702,623 *60DD533EC764F49EA69061A0B1769B1C594DF954 annabaion
929,702,624 *60DB7971BA7175C86AF102EFBFFE69893FB8291B annabasing
929,702,625 *60D6238E61FDE551A51C6513B2D97CB95D13C362 Annabel660
929,702,626 *60D86C0C8B413A0BAF23A3EEE5E1F4CB92C87BD1 annabelle134
929,702,627 *60DAC40EB9AF3AC3780F271F4BFF3465B8739D7A anna blanco
929,702,628 *60DC3DC893530F31ABB03012E8F90AF18D239631 anna carolina santos
929,702,629 *60D8FBB4DA1E3698D088A57ABC670A8021E0A8CE annaceleste
929,702,630 *60D98427C000C0C1F548CBA51254186B9C01C870 annacis3
929,702,631 *60DCB98E42E51377436ADD5F6BCB377E6821F79B Annadaisy3
929,702,632 *60D5CA5143B971CFD5ACCBA32E55C3FF09875989 Annadaytek
929,702,633 *60D73ED569F8617BD388D033B0F57EA8C19A2972 anna delay
929,702,634 *60DEC33F5255744ADE488EA815944B10A8C95AB9 anna-dogonadze
929,702,635 *60D3422BE36A042961E9726DD80B4B62959C2D18 A-N-N-A(feat.DonataWhartonGitarre,DavidePetrocaKontrabass)
929,702,636 *60D5A059179C8FBE1190DA4F38291FEA498B9871 anna fellows
929,702,637 *60DCB12B117D3B7779BD2C90C0C30D24E1BB048B annagear
929,702,638 *60D5F47D232FAFD0692911701EFFCD5C318C67FE anna hanke
929,702,639 *60D3E24513AD67D1B3CAA497569397DD8F14DC8D annajerome
929,702,640 *60D40EE110291C7A918BF3C2B6FEDD605B10C7C9 Annalenben
929,702,641 *60DB5A615AC60F9FF0953E7A832DA8CA354FA37E annalicia rodriguez
929,702,642 *60D9C355C21B0ACD48F85B9FAA78A03FB2B18036 annalundquist
929,702,643 *60DA90AE75505EDCCE6E53B24AC6534D0E41718D ANnaMARIa
929,702,644 *60D3AF38D89D5D2A1DE0258CF023389F991EDA4E anna morelock
929,702,645 *60D39792DCF8D1E5109FDEC47BD54352E84CA0B4 annan-burton
929,702,646 *60D9D716AF4D39462FFB25CDCA45CC50C651ACB6 annanikolakaki
929,702,647 *60DC78593BBE4AF4C25BE673B3B9CAE665330F87 anna o shea
929,702,648 *60DF80D9E29125AF978DD851BC19F15BA44DF640 annapopa
929,702,649 *60D0B440F3FB2F1D55548C8E07D63F490977EEB1 annaq_94102
929,702,650 *60DA718BB7B747DFEAB003911E7771FE0BB92038 anna rafael
929,702,651 *60DA49863F9E6BB2E45F1F4DF7FD3008D6BD6953 ANN-ARIA
929,702,652 *60DFA16FED45FA09FA3BF089A6A83148680231D0 Annaroy3
929,702,653 *60D04285FBAD4A47BC7398E5F5F297FFDCF8040C anna sophia raynaldo
929,702,654 *60DAF33F8F9F6D24CC9A36DA81C21082142064C0 annaspell
929,702,655 *60D58A0D975865DD9EE801A5B75F996CAF3144DA Annaspicavo
929,702,656 *60D33E5D34F6A8E04545BD7691BBE115F18212A5 annaswafford
929,702,657 *60DE55898B3B72FC908F0252793DC25DA41AD85A Annaszus9
929,702,658 *60D8C3AA73D12F6A8B7E3E13272D57FD951317BD Annavolvo1
929,702,659 *60D9DCFAEE09797A6941489E867398851F17E259 annawans8
929,702,660 *60D16F8019D8398D44E2375D2171F94CED8DFE31 anna zaks
929,702,661 *60DD36AB053B86BB95146722DA9E7D1416E25F69 annazette12
929,702,662 *60D897EB7A4A44E5E0E05E387877212BF3095062 ANNBAN117
929,702,663 *60D36A40F6618AD4C9FE808AE440744772B32001 annbob1c
929,702,664 *60DB4349278BD76FF3396ECAAFBEB425B543C4E8 annchanner
929,702,665 *60D74E3F417C5871697C6D8E65925D087C1C406D anndaugherty
929,702,666 *60DFCE33953405226BFE126A42F1F73BA5662F9F Anndg
929,702,667 *60D4614D7411359C655629939C33B6647416A185 ann dicarlo
929,702,668 *60DA20D3FBDAA38B2F85570B165C78E12B1EDB84 ANNDOMINO199114
929,702,669 *60D5339BB1F0BF12A61FCFB911D95705C6B9D3B4 $anne$
929,702,670 *60D6D60A1FBD1728C8EA5EB2C2ED2E6E7CFACCC5 Anne465
929,702,671 *60DE87ADC8BC1026EA6093FC96D377A03EB95CD0 anne charlton
929,702,672 *60DC1FFAF312B46DCF5BA21F7CA0DE30C63A5CED annecia gulley
929,702,673 *60DDEEF93CCEAE29F1E2A480297EF918E469B01E ANNECLARK1
929,702,674 *60DB4064DD822BD912D77AB4FF1A77A12C84576F anne conboy
929,702,675 *60DC4BB8949B0424A160EFEDFAA7EA5B81F7DD87 anneCorINNE
929,702,676 *60DCF75E774834BD9E85ECE2F65992F903B42832 An
929,702,677 *60D1E39D482B8F7684D888D37355BA32EEC093D1 annedoc6
929,702,678 *60D0ED13CA9E0B1F3D7ECA998854D6FCB0380178 anne dugdale
929,702,679 *60D313A129596D547994497254BD8BAC90456519 anneealy
929,702,680 *60DCB2A19E37FFAB55DB88EC7604D6D343F0E150 Annefden8
929,702,681 *60D8AA078EC21C558F0DA34826A4F20FED03E7C9 Annegas4
929,702,682 *60D4EF823E8F44EF1E14DEF83A96E9613BCF2B77 annehillis
929,702,683 *60D209B64A753DE3944AB629B7D5019DE0BD6060 annekate0
929,702,684 *60D442F943A34A1BFCC5B70077FE24C2B57B707F annekidd
929,702,685 *60DB1F0A09466CE4128ECA673F2CE0C738D3CA3E Annelid!
929,702,686 *60D74F211E469FA8DDC7D8D1FF2AB4825BFECEC6 ANNELOSER
929,702,687 *60D9008808FB389121FCAEBF43C7A87903E1E2BD annemariedillon
929,702,688 *60D5C6A1362D4A5F71B68388B0A83CBCC6BD9ACC annemarieverster
929,702,689 *60D6F5073637E57575E56E2BDA128EBC9C9E2625 [email protected]
929,702,690 *60D7712171324D2898FB0E23EC750E722084A03C Annenhaus6
929,702,691 *60DF72D563B6EA73302E88686F4A7C7C51987E20 ANNENTOM
929,702,692 *60D52B588CDB5C8177AC61D05F6E287391F04C10 [email protected]
929,702,693 *60D16C2BB25E63029B05777977429968E0A9ED87 anne racho
929,702,694 *60DEA378843AE506DA9848AF15F20217CCFE64D4 annerfid
929,702,695 *60DA68CDC7184F97FD68B00DC913FF19AA5F5EBC ANNERIVANO
929,702,696 *60DF8E6154C28C5E0F9B8A836DFE8026375712FC Anneshit5
929,702,697 *60DB4FEFD763B591F44A66FEB25AE3CA5422E45E Annesirhc
929,702,698 *60DED6C96C46B18EEE4EA0719DF73CE6801C1673 annessoise
929,702,699 *60D0A1A4D3EEE5301AAFAAFFAA6FBB86E9C4BDC8 annettebusch
929,702,700 *60DD79839CDC7FBC69CB3576EE18481E9399F80B annetteduarte
929,702,701 *60D27B9AD2128BF8BA339E1724F0146AB1F5E8EC annettewashington
929,702,702 *60D1E397E94B6EBAD85B45DACFD7C745FC544568 Annetun5
929,702,703 *60D6C9257D7AB6233ECAC2447625BF7E10EAE443 ANNEXIONISTEN2
929,702,704 *60DD35BBC552F921A9B1CFCFF1CD8CB9B2C3EC35 ann frago
929,702,705 *60D33C63475486772E4AB470761C1E6D7EF5B448 ANnG8
929,702,706 *60DBD904733E42E741E2BE2F0F473E25ED375836 ANnHd
929,702,707 *60DD7EAA341E240E45B66803AABC7256FB09672D annheid4
929,702,708 *60DC983DD790E1C7B4162E4D1C148E1C3EDDB8B5 :annie
929,702,709 *60D93017342EEC5C6ECD4F828137211FFF2B2223 [email protected]
929,702,710 *60DAE12BAE7144F68D708054DF9D8F88B26FF661 Annie1979
929,702,711 *60DF074469DB52CF1B92D66560ECD18687336318 annie222666
929,702,712 *60DE7AE73933056301B061BD3FB18F68B4626A0F annieang
929,702,713 *60DB76CEDFCB81A63A212538E5C09AA20D53D812 Annieath3
929,702,714 *60D45EA53F4B90F33DEF5FF0EC2C2AB25DDD01BE [email protected]
929,702,715 *60D33616FA41ABE336A0AA4D2EB6E75128F1A2DF anniecoombs
929,702,716 *60D7F0B70579B7BA545D76EFA26A31988E565911 annie dunlop
929,702,717 *60DAE7098E690DBA34FB9B8B133877760A65FFEC annie lay
929,702,718 *60D9B481594E0A5A15357B3FDBBE63E55511A412 anniel.bbs
929,702,719 *60D0169C6379FE25AB1C19477B191689518E7E7D AnnieLennoxInterviewonSing3
929,702,720 *60D5B3E41FDD321CB3D49540A4C4BEE789456F39 annielubben
929,702,721 *60DAA4DBD123916EE94353700683608AEE576DFE ANNIEMARIE833
929,702,722 *60D44C3DB81EBC5AA52A6BD4639C12DD6232B7F4 anniemather
929,702,723 *60D816A7913254EAA7DF1D0D700A9BB9BDE0E0CF annie nielson
929,702,724 *60D1A7E1DADE30B3BF86946CDAAD9FA81E45AE72 annies_affordables
929,702,725 *60DA4B8EB7B678256849BA40E40CC02A1DD3C928 ANNIESCARLET
929,702,726 *60D29A175BD644F39718ADC03E75B45FF74FE771 annievigen
929,702,727 *60D38F57BAE92A4479D42C32E1A74CE8CA34041C annieyen
929,702,728 *60DA32EA4D060EDD627B8DDE1C6ACAF520F62B92 ANNIF1
929,702,729 *60D6AC9EE3C4BD6CA6D11EA29878A0358E3B5233 annigue0
929,702,730 *60D538BDC45C83DF577C7F5213FAEC3199C0E1E8 ANNIHILERONT
929,702,731 *60DE227534E3947647238CE50ABBCF0690DCE6CF Annika054
929,702,732 *60D4E748C46056419CDC204411A85AF34828BB81 annileing
929,702,733 *60DA8B559AAE6B0BD5F7E6A593225CFC65570872 Annilulm
929,702,734 *60D8A35999E931A575D79BA73187525BF55A94FB AnniVersaries
929,702,735 *60D15239545408AFFB7A8915058CDCD00721F0E2 Anniversary Waltz (Part One)
929,702,736 *60D2ED0FC73E493492A79EDD483AFCF650A7CB8C annlisa5
929,702,737 *60DAAA892B931925B85AE2BFD955167171AAA1DE ann lumley
929,702,738 *60DC997BC8FB02A1061F5678E5AA7FF14861BC64 annmargret1
929,702,739 *60D3913BB6C0AA47DF34CE62D8E57AAEB2BF13D0 annodand8
929,702,740 *60D6275F2207EF27953F4BD7839CFF3704302C28 Annokked
929,702,741 *60D74680498051C655C85329ADB4BEF4128387DF Annoncenwesen
929,702,742 *60DA23AA5745167EAC0C6756972A7A8304013AF4 „Annotation
929,702,743 *60DA6565769B8215B996E0915CC3F75A95DEB5E2 annotativeness?
929,702,744 *60D3DC3C8E9E327A03757EEA00D1FB9EC2072F38 [email protected]
929,702,745 *60DD031BEFDF55E2A4209603C5B8056575BBCB53 annoyful1234
929,702,746 *60D8B09F7824537DB71A422E23D1B2C8AEABF579 Anns
929,702,747 *60DCEAE110364A3C6DB8F47ACA3D1CD3D5F68EDE annsgenomnntett
929,702,748 *60DD99981FB67B3BF4A2324659B049251A2965D7 ANnsH
929,702,749 *60DB671B9039412B53F30E8436C598BF2E033F7B [email protected]
929,702,750 *60DE37F222473BB1D63BCB800185033B3FA81828 ANnta
929,702,751 *60DEE01B421021CBC35A379A4E535998A006CA01 annu11ere1
929,702,752 *60D3BB8B7FD4C84F81F4DCCB37A8D98AF707B176 annua123
929,702,753 *60D91E43600CC3A205227F1BA0D588D28F794D63 annualstardust
929,702,754 *60DD7C0252797D792441827B993E306ED9E14E81 annulero9
929,702,755 *60DB35251A58628C368096C35CE8E8ADF7AD7368 annunciating7
929,702,756 *60DDE6832D85C9C7737556BD28753269F0902C7D Annusai6
929,702,757 *60D8AA371D0B146294CBEB79E2C512ECEB30AE43 annusera7
929,702,758 *60D7537EEC79CA3B56081E0E2DD154E4B75F62FD [email protected]
929,702,759 *60D97331AE481194CE42546CA1EE0D7EF6D39530 annyongbluth
929,702,760 *60D7736739D725D7314DFE5670F3410E9E8AF104 An__o
929,702,761 *60DFA572F2099215847CB0B05F369B34CD2898CD a no. 4 en mi menor, op. 98: ii. andante moderato
929,702,762 *60D3DDAB7390FE5A9D093710B2DF4C0707D4FDE9 AN-o9
929,702,763 *60DD683972DBF0641F3CFE09846541A8DFDF2BE5 ANOAG 6
929,702,764 *60DBFDF05BBE4D5ABAFB9D87DA33CFD6A5BD2401 an ocean
929,702,765 *60DD4171C49E92D7D07615DEA6572B59F2AF10D0 anocithesia0
929,702,766 *60D7E0246ABCB5EB5E2F2369C20D31EC9C35B092 anodajay
929,702,767 *60D13CC2DAB8133B39878235A849BCD267B69CF8 [email protected]
929,702,768 *60D4AEE3AC4FC2FBCD979E5BD444F90D316246F1 Anoigar1
929,702,769 *60D1926F39E819B2CA59240142E6E85711367BC0 Anoin+ed
929,702,770 *60D10CF95AE51590F046447B609F44E88797441C anojastes123
929,702,771 *60D0AAC6240C8262ECAD870931041662237D46C7 ANOjZ
929,702,772 *60D16D132CECBC205A4082A718748FDFC43ECA83 Anokalle6
929,702,773 *60D48E610BA2D62F6BF74EB5C1D04D42C3404421 anoldbassman
929,702,774 *60DB7DF4262C2269B77CFE3124D70B85847DCD8D ANon;
929,702,775 *60DCB2985C5B3718E0A54B00008D893D78BF110C Anoncorrupter
929,702,776 *60D660A1E5B9A20FE81C851529E40FF6FFA6DAD2 [email protected]
929,702,777 *60D43727DF9A7BBE2F250729FD7952571506C1C0 Anonfibrous
929,702,778 *60D170294CD923A8A2A5303A17A02C55FFCD4DD3 [email protected]
929,702,779 *60D3BB79D8222AF867E1D719DCE06AB678588FFF Anongoff3
929,702,780 *60DE859EE16B992297DA4611ADA6E9EF54D609D1 anonnerions.
929,702,781 *60DCFDCF5A7F60AF92CD0A52F1BB29C1E506A284 Anonsarded
929,702,782 *60DDD4B51FBEE10A16C4572481942BB080ADFD6B „anonyme
929,702,783 *60D4260418BA66525113E854C35B36E3E8C624F5 Anonymousette
929,702,784 *60D5E68CB58FE52E7DDB29EF99C5FBBADB8DD580 anonymousnon-logged-
929,702,785 *60D867108AE5A0B66A0ED6EA932E706D1A039E27 anonymousscotford
929,702,786 *60DC5BD1026459F34B3BC35E509E09FCFEA20139 ANOpN
929,702,787 *60DC497F3853ACE712E8FD583371FC3F672D9CB4 anoriginalmacintoshbackcaseunalteredmacintosh
929,702,788 *60DC880A7919A4A4B9423FB07FCA2C924C197AAC ANORIX12
929,702,789 *60D4295CD9031738E1D7FC77B24910A7F7FB75C0 anorxicas
929,702,790 *60D3628623447D6B565EFD3F62D6D56628DEA5E1 Another Abandoned Farmhouse
929,702,791 *60D9AF3CC33266F8778DC2D0DB6B9F1C727A647A Another Hustler
929,702,792 *60DC950CF75FA41F40E9390E3AA93F23B0846AAA ''...anothertalebegins''
929,702,793 *60D962C7FE9D7444555B4C00CAFDB7C19009412F Another Touch
929,702,794 *60DD110DD57F229DC8076DCD0EF3E41BDCBEABCF AnotherWorld(extendedremix)
929,702,795 *60D688E6A2BBB0E2B1C5138FC2FE5D73289568D3 anotonom9
929,702,796 *60DD2F43C02BBFF406A476B76E539C007516D6BA ANOUK301
929,702,797 *60DCF51E73EF6574244C05C43A6878692C2CF28A [email protected]
929,702,798 *60D752BB9D91E0A404B554A194438EF8BE7DBBCB ANp(+
929,702,799 *60DFF6F1E1EF9D51DD6754D478868673C0DDF7E9 Anp7P
929,702,800 *60D30C511B00C67BE055FD0F708D40B8D794FD09 [email protected]
929,702,801 *60D7E1F6D3890D3FA319678DF86CFA9F12C26526 Anparax [demo]
929,702,802 *60D116677E3B4FC860DC9C9F66E69A9D05C6B103 Anpasema
929,702,803 *60DDFE8B25400A797D306DE002CE8B38ACA5AC4A Anpdbsw5
929,702,804 *60DD90DCEDF121F9361886408A95690C9889FB19 ANpH?
929,702,805 *60DD612A361E347E5994D3F9F446DF39A11EF852 [email protected]
929,702,806 *60D4CAAE18FD6AA2F3042B07864E785E0D556F77 ANPMX
929,702,807 *60D14676D926DD915F59D4EE741B923436BAB3E4 anpnj
929,702,808 *60D1F2E3516AB6A4CAD19995AE3ED0E2FD7D4F0E AN"Pq
929,702,809 *60D3C6F7A913F1E292DA3A0055E0C5FF5E66505E Anprobieren
929,702,810 *60D150D0BF3F003E22637FC0548E36B0F8F18AFB ANPT6
929,702,811 *60D91B1DE9DF7ABD8F005F1FBE3955AE4F364F7E ANPw
929,702,812 *60DC3352DBDBA64CA7EBEF73AF032CB42F5CD84F ANpYs
929,702,813 *60DC7705E5D76F68C9072F0B713A716486F1E1C3 An:=Q
929,702,814 *60D34C95E164E1444BAA6D5897586A70E9367519 ANq6
929,702,815 *60D532E13902D2F1BA7E47AA2F7D36AABC45742F ANQ6Z
929,702,816 *60D7FFFBAC818B3E5C9A800A559F0EF1B62FB179 AnQAg
929,702,817 *60DB61976663DF8DD3DECDFCF29112151DDF0F84 ANqRc
929,702,818 *60DFF006F3A45C8860D19AAC9BE01EA010B66264 AnQ$s
929,702,819 *60D7B206A040408260D07D10A095FF890BFF792D Anq=T
929,702,820 *60DA07FC04AEEE51EA90A9FABC869DAC830BEB42 AnqV2
929,702,821 *60DAB509CA89E23A7E54A1BE064A297216D0424D A$nQY
929,702,822 *60D3B68B71C2602B9A6E541BB78C758E19BF96B6 ANr-:
929,702,823 *60D26234514CD163D1F513FAE60575FA35C35CD8 A$:nR
929,702,824 *60DA6A1DAC7324E35BBBD3A77C3EEA8262BA3917 An!-R
929,702,825 *60D965F8DAE8CB00EC37D8DEF97AA77E9CC05D85 ANR,5
929,702,826 *60D497A4E6B69CAFFAE0F5DE487E38D04F69AE4A AN%r5
929,702,827 *60DAA2E5BC12D90F492E83C32EC9BE4F6623F4C7 ANR7+
929,702,828 *60D3D9EA69E71F585EA02A2395A2491E265BE48A ANrA-
929,702,829 *60D28FF45E7C03BA05B3B5804A6A261C63C96AB8 A+nra
929,702,830 *60DD7C7D387E1EB24301B82FE850EB3634B7F519 A
929,702,831 *60D8282F1C29C7310CC60AC2ADCFB53D594A7992 AnrCE
929,702,832 *60D272285E0F3D499AE84D47C2ADE36260E873B2 An
929,702,833 *60D853D8684F470FFAC53F11CB70DBA1362861A9 ANREISEN
929,702,834 *60D9B1A79544F60E0C81F3660EFAC4601E65E536 Anrerael2
929,702,835 *60D0F8B05EEDA5142377C789E9CE44C21BAC34D1 ANREROTK
929,702,836 *60DE1763DC51C625738988D3D67A645A1BB149FA Anretegn2
929,702,837 *60D24E53F453CFAE1EC388A2B066744C7331E65E anretpotiL
929,702,838 *60DA6E62E22ADC8ACF32254B4D6DBA8F12EC0421 AnRi(
929,702,839 *60DA68FBD0957873700AA2EAEA396B471F3FD221 anri smit
929,702,840 *60D8D80C6DA970C4A23B2657891D193A3BD102DB Anristte5
929,702,841 *60D5D89F8744F5E9A79E4D1645724067236FD45D ANrjn
929,702,842 *60DE53E383C5E0EBC2F9FE4D6CCED95C92ED10E5 An,rL
929,702,843 *60DC9298483A47290E67FFB4F26B777A638CB1D0 AnRLw
929,702,844 *60D0F5944271FAB819734725D98CDBEEAFBBE22A ANr&p
929,702,845 *60DB15AA052795BB30A973030831EC5B3CA1239B anruoter0
929,702,846 *60D36ADBF0DC9A2C3A5BEA5B95AB95986FB57F0A ANrVH
929,702,847 *60DA6DAA847AD3D73EA67E362CAEB2090A36595A AN+RY
929,702,848 *60D3DACF2B3CC18AA6993BCFF5C0D6D0B2DB0A7E [email protected]
929,702,849 *60D8D00BC49E0567AD8B67E88DE54349FC3C253A anrymachi
929,702,850 *60D705B17A6B023D54F7127626044AF944070E82 AN,S#
929,702,851 *60D76F675A3F235FB8D4CB6B1BD88300ABDF6558 A;&Ns
929,702,852 *60D5BEFA0A3CF0BCF2F36CCBFBC7143E621CFEB6 ANs6U
929,702,853 *60DB9047D4F950178376752C7DA8C45460F0D99B Ansaruudun
929,702,854 *60D730901F3A134FACFA573F048BC43CAB6D9055 Ansaugte1
929,702,855 *60DC38815A88A0C7F3BFFF2CC844CCCC507D7447 Ansaugtrompeten
929,702,856 *60DC6D3508EAE931E2DCF8BE7BD1397845526403 AnsbA
929,702,857 *60DAEC09540339A519F47B7A9CE638C6BEED7B81 Anscetti2
929,702,858 *60D5E103DE111BF50444333F00A90245F4566774 anschauchlicher
929,702,859 *60D97E4A542846E647BB5700A99E613ECAE10072 Anseilten3
929,702,860 *60DCD5932A4E35A8BDFAEB1F420A29B9989CCAAF anselbrown
929,702,861 *60D8A4666D6121D316D5CC3620AF70DAE2FF5A58 Anselmina4
929,702,862 *60D56CAF5487665232E70383FCE5783B79EE4333 [email protected]
929,702,863 *60DD47EA38AD997947E715237B490B0B2D8947F5 anser naveed
929,702,864 *60D395A8C23834D0477D1B51DC50A4075BCAECAC ANSF%
929,702,865 *60DA68D8F972869B0E292048A35BDB3EA31D829A AnS;F
929,702,866 *60DEB5F22712838C2237223BFFC27826FEAE79D7 ansform9
929,702,867 *60D2E09B5B77A2A4358F742A508DED311D9F7972 [email protected]
929,702,868 *60DF23FC35806B25206C82482E439AED05F3C09F Ans
929,702,869 *60D1A6C70E807F40652B189F983BFF9FBBC82BC2 ANS
929,702,870 *60DC1CFF33C8F4321520BF0D1E7EF75C54E850F1 anshan1
929,702,871 *60D580652981BFA6B19AC9E238321CBFBFFF52FA anshinsoft.comanshin
929,702,872 *60DA21FFF1080DF35150B1580A5267B804790D51 anshita malhotra
929,702,873 *60DEBC85555E134EF31C433225101E9136281ED9 anshul gulati
929,702,874 *60D0663C6FCF8230DAEDAF1625B15F06F2605050 anshumisra
929,702,875 *60DE2422EF06F2C36D816A034B593984AEADA8C7 AnsI&
929,702,876 *60D39A768E22EC81804E01E55770CCF73EE3C63E anskaffelsesfunksjon
929,702,877 *60DD7418D775442A4F78D4BA2EA1EF1DE94965A2 AnSL3
929,702,878 *60D54B3858B8CF6E310548F9942E8CB327EC2CAD ANsN9
929,702,879 *60DFBB3F290B62CD8DDD20705286AEE738734253 ansrbsw7
929,702,880 *60DF7B158B21F7B0740DD8AA07F9352F45F2B991 anssi_koivuranta
929,702,881 *60DBB84891701F88D906B18010CC2BF76BB39F91 ANSTEIGEN4
929,702,882 *60D246CA92789B69A46D2D0354DDAF264B77D82A ANStj
929,702,883 *60D9D9D701525CE6D1C2190C3A10A6DE53C0A0D5 AnSV&
929,702,884 *60DDE37CA6B1F97A28185EB714760B50360C26E7 Ansvarens3
929,702,885 *60D1A7420E6F5C288573A3993B0A16BFEA0F32F7 ANSWER THE CALL OF DUTY
929,702,886 *60DBD1F652BE093B9BD14791E26CA7F22D1E0AB4 ANt/
929,702,887 *60D679AD36AD27D5B1A53E46B6ADF7AFAE95435C ant1tu8erculot1c
929,702,888 *60DF76F4E5D9F6C65E441BAB7D9B8848FDF448EA ANT!50C!A1
929,702,889 *60D75BA71FE45259D24E7466402F75B59392B625 ANtA3
929,702,890 *60D7A14C3A760AE0776ABFFE35724463A5D79761 Antacrid6
929,702,891 *60D935F72D28F888FA642154230622E3ACA25455 antagon9
929,702,892 *60DB67FBD55A6B4E613FE04D74432BE3C03433F4 Antagonisierungsspielchen
929,702,893 *60D3408E4A9FE4109C3DB761144739C538B5BCC2 antagonistih
929,702,894 *60D39A90DA5CB7214A52714CCC67BFD7E8D1A70C antakelis
929,702,895 *60D5C018DADE8D5D6EF9827EBB7B67474E3E4D3C Antaloped
929,702,896 *60D4DC4D53F0FF167C5B1763CF83EBD998E09433 antaneesi
929,702,897 *60D9389246A7874828196F57FC05EEB3CB00563B Antao123
929,702,898 *60D20B652C4AE2AF228A7E75D79B8D0BF85E0AAF [email protected]
929,702,899 *60D2F53EA4B246B3D68854C2C56CC69D76C4BFFC Antapolo0
929,702,900 *60D163D3049DD8BA5C14BF3043D1716F42BC2D81 antarcticakane
929,702,901 *60D1ADEBEE4D0E6CDCD600CF5907F20649688726 antarite
929,702,902 *60D7299311261BAB8E4A61A08CD7A262B8501561 antarktidą
929,702,903 *60D1ADBD1AEC4F7F49E3463892DE2A552D523C68 Antatte0
929,702,904 *60DB99E40E4404A2588FE792D99A48A278E30B84 antãžiegė
929,702,905 *60DC72E3DCA8BC27D1D7C0EEC159F3668079BC23 [email protected]
929,702,906 *60D1583481F1FF358D109322FA5BEB5B37A58428 Antcathy
929,702,907 *60D62F35FE783FBA5B6E66F63054177C996DFC4E anteal1234
929,702,908 *60DA1083FEA5FF6ED6A06CE07E77BB1B2A54E5A5 anteambulo
929,702,909 *60D23C71392824CD9972DD9AD8EA2C0E1AFEACBF Anteau
929,702,910 *60D1D2AD1CD88A93A1FE2CA2E0674F770AD59365 antederemlho123
929,702,911 *60D94CE08394BE21F6CA47D28EE61288F6488BEC [email protected]
929,702,912 *60DB63B6B6841AE731F6C4C2940B8C78EC990393 antelanif
929,702,913 *60D71870E2CA6060B7428DAF5B992DB31E58AF42 antelocati
929,702,914 *60D98DD67BD0DC75209177FE37D82E6985184F78 antemurloei123
929,702,915 *60D05D0869589F2919EC382B972E190217A5FB2C antepagando1234
929,702,916 *60D872A64387163A8E99A1C99DF2A1E2EE8A9609 antepass123
929,702,917 *60DDAF19A8E7919A7F5C206EBAA6139ECA2B3493 antepileptical
929,702,918 *60DD3EFBE753FF5796F3E58FB784418986989016 antep.net
929,702,919 *60D8F14640127D2CEA948CA3448F5AA646F06915 Anteport1
929,702,920 *60DF9FB7FCEDE4B0AEEB4DF745A48F33EEACE57A anterormente
929,702,921 *60D7D53F0A3F0A3E82A6E8B563C392FCBF4355FC [email protected]
929,702,922 *60D849CF9DDFDB19BC0921D4474E4B2CEA65230B AnTev
929,702,923 *60D3BCBD97A02A8C80476411410E950F406A5ABD AntgO
929,702,924 *60D40F247084E1A8479F99ED071BE75A34882DA2 Antgomery1
929,702,925 *60D619999BC00869BD34D19EC2A017EEA6967C45 ANTH0L091ZED
929,702,926 *60DA06D617EAE8AFF367A476E454291AE7C4BD6B anthaip
929,702,927 *60D58EF2371403430CBA644F6E6E999C97390E69 ANTHc
929,702,928 *60D87E1697F9864F472DF42BDB63D28FC3E67DC5 Anthcrce
929,702,929 *60DBEA1983007BCE4805C99FE4948E07E710241C Anthedoning
929,702,930 *60D72B9210FB0DCB2798C8B80C51EE4E3CABA9D5 anthelion.2
929,702,931 *60DDC4F439DA7B63C262BDB2E822211F7459879F ANTHEROZOOIDS
929,702,932 *60DE65D72BA92CB609CB8E5DC7BFEE425A7610B3 [email protected]
929,702,933 *60D89F6DD5D5C13121C7ED0CC7EB5D3DC44D7EB5 anthogenous1234
929,702,934 *60D572E963ABE43ACB04EAA7E5E17072AB7BFEF0 ANTHOLOGION0
929,702,935 *60D66782FDC768DBCDBF5F2BFE6F29BAAF69E3C0 Anthony404
929,702,936 *60DFD788409B6A60333B4B752D930BEDAD5B66D4 anthony arostegui
929,702,937 *60DFE9EDD8E546F8E07882842D7F5DE063978D7C anthony barcellona
929,702,938 *60D71BD8FAAFEBFBAB184D1F2EF1B030BB82A657 anthony.bester
929,702,939 *60DC3C1789F19E1A90C93BC8CD5564DCE4B7F209 anthony.boeding
929,702,940 *60DF4170C378F59519087CD5542D89E3561D154F anthony campodonico
929,702,941 *60DC327CA1318A4EA03C225F3BCF8D2B0FBAA206 anthony carmignani
929,702,942 *60D6232D4E6A2D02CAFC5169C12DA150265F1DE3 Anthony Cartier
929,702,943 *60DC7FD38A99634C0B839989BF77BC194F6586AB anthony.cintra
929,702,944 *60D794E372C2399DA7BFDB6D542E49CE4CAB8F65 anthony.clakley
929,702,945 *60D9BF2C1E14FBFCD64BD7C642A49802BD347566 anthony.coradi
929,702,946 *60DF9E28E1C3E336518D47AA27081AC725DFA281 anthony cotton
929,702,947 *60D8A528B8792B20CB8E2C73D4CD925BB21673E4 anthony.craft
929,702,948 *60D32C8C449F3B6293C51C1C4095EACE55D6A4CF anthony david matthews
929,702,949 *60D24AEDD2FEFEE0F14F22A63C440646C104EA1C anthony dodds
929,702,950 *60DC3E3EA0FA261F4C41B1B84F2DC9B39A3DE1C3 anthonyedwards
929,702,951 *60D0750732B9FC8C6BB7A86C0476C9B54D84CDAB anthony elicier
929,702,952 *60DED368AD0A14BA189FB8F8BFF761354BAAD6C9 anthony eul
929,702,953 *60DEE6433ADF9461756F4316329B56F07744A95E anthony forest
929,702,954 *60D3D76C85E85C19EE5ACFBB9DE984A3AD934EA2 anthonyghirardi
929,702,955 *60DA813412BC70D7CEB03127F5C3A1340271C00E ANTHONYGRIFFITHS1
929,702,956 *60D2FDEBBCC06723260DCBDFEBBA16EC3162E64F anthonyheslop
929,702,957 *60DFB2E9530CC1C696C0EAC25F7510BE72FEE120 ANTHONYHUDSON
929,702,958 *60D10BA27787F7459A0FE2351F34C962BDC7AAC2 anthony.loparco
929,702,959 *60D4F4CB422626E1D2A6F6C15E5D0498206C4B49 anthony.mage
929,702,960 *60DF0F4C4E8560C378765748F616A592A79298D7 Anthony Mark
929,702,961 *60D1C74826C985C3982D70B5A53ADE9977D30A0C anthonymontagna
929,702,962 *60D75F34AC9613AACBC7B17471A42E29F8903E1D anthony.ocallahan
929,702,963 *60D526C1BC4FB4E12E09FDAF014BD9CA1C44AE1E Anthonyorlando
929,702,964 *60D31767F7E100985779B3C0301531BD9118A8A4 anthony padro
929,702,965 *60DE8E8D43C1DB7F1639A0B9C75A91723F4D0DDE anthony.roebke
929,702,966 *60D6E21F08745A5715802CBABD990967FD032470 anthony.rumbolt
929,702,967 *60D149D7223E8884D7E950A998425A93819F6540 anthonyryle
929,702,968 *60DA5FD779BF83C605FCF237CAFCC84227768958 anthony.sealey
929,702,969 *60DA71D5CC4B5E50BDBF82D73DBCFA31CC52CCF0 anthony.shindo
929,702,970 *60DD05D1D37DA66DA823903F844B5CB5430B9430 [email protected]
929,702,971 *60DB849E153CC98DFDB0688A3115ED4F25872CA6 anthony.sival
929,702,972 *60D4BE7A5C534C09CCDD082102A4EC2359F74462 anthony.soleman
929,702,973 *60DBBC8F77768CB58BA895B10FCCCD3CD36147C7 anthony.stuczynski
929,702,974 *60D59DE1B3129697149AA01D0831E80015E1D1BB anthony swaim
929,702,975 *60D6A25C8190B38EA376102D20D44DACBFEF878D ANTHONYTEST
929,702,976 *60D3A2B798416D03512815F1B164F51B9C2C5902 anthonyvessel
929,702,977 *60D5B15B0E72C372F65EFD285EF2B6AC7730B8B2 AnthonyVincent
929,702,978 *60DE41672DB970C68A49077FBF98AA71340ED5DE anthracograpta
929,702,979 *60D129444705347B50584813C92918043B6F2E74 Anthracosis6
929,702,980 *60D3EA9545BF81076F474E26FD41146D9C907877 ANTHRAGALLOL?
929,702,981 *60D935C4F422A3EF5C6BFF8019FD39870E20C820 AnthraxVaccine
929,702,982 *60D9B2E25AA7609B1E69EE7FF91F3A6FACE19C22 ANTHROPHOLOGIC
929,702,983 *60D2EA71E616C5E0E2966042668B9AD49806E1DC anthropologues5
929,702,984 *60D3975BC900D2DD70BC3C72FEBD8BF6DCA2EC58 anthropomancyanthropomancy
929,702,985 *60D8697470048116D1D2E616872716EDE6A303A9 ANTHROPOMORPHISM5
929,702,986 *60D5AF0BB92A9CFB72B868997E471D7A8298B86C ANTHROPOSOCIOLOGY4
929,702,987 *60D197E2D8763DBC51251E2989AB82E65ED39ECD Anthropotheism2
929,702,988 *60D7E2FADB987B33022390F3F1C7A83C3FE21EDB Anthropozentrische
929,702,989 *60D103C8E94B96C0B750A5D904B785776C110A8C ANTHSETW
929,702,990 *60DEA2DAA89651EE32B0C8FF43E209F3D2DFFD10 anti8ary0n
929,702,991 *60DBCDE18D2E1D8679F55446C02F1D3397AB03A8 Antiagglutinative2
929,702,992 *60D716DCCB862037FFE5A11A618DDE048479F53A ANTIALCOHOLISM8
929,702,993 *60D9077ECD562965E684804CD0E540E27BFD5EFB antialko6
929,702,994 *60DB99C8332FC6805B9C2243C048C4047CB6CFAC anti-anifa-aktivit
929,702,995 *60D644464FD5C2C0F1240EA037A32AD7067E4CC2 [email protected]
929,702,996 *60D5D2DB140D20502D944453D12F15A08BD9BE00 Antibonle
929,702,997 *60DAFDB27081BD431E3C897BD1FE907ABE44F1D6 antichan7
929,702,998 *60DF951B5174CE0ED9D1C43F9C06BF3BDD30A94D [email protected]
929,702,999 *60D248222A9984C1CD4E568B3744E0DC97F07347 anticlin5
929,703,000 *60D8FB5359DCAC315F2C4BA8DE9BF8D07B4665D8 anti-com
929,703,001 *60DE28F29D8084D61E780A583133271C8A458EDB anticonia
929,703,002 *60DDCE62EC1619DCCB845AE4EDBEBCADF137003F Anticonventionalist0
929,703,003 *60DE8BBC6AAF28B3A92DF3AA7DBCF92DD7F739BB anticreational5
929,703,004 *60D76077B35721ACF2F77780546FB0B88BA26465 anticriptogàmics
929,703,005 *60D1120B40A26FD79EA8095DD19315BF775FA4CB ANTICU2
929,703,006 *60D8ED4AA485FD87691369FCB387B374D4CCF212 antidelcev
929,703,007 *60D7B19216CE912494AAEE9A0D1DE1BD80E42796 Antidict5
929,703,008 *60D9A5B4117E403D8350A39EE2ECCA4A6019A571 antidievišku
929,703,009 *60DDB3F535894148170239ACE63B40E3EB76D013 Antidivo0
929,703,010 *60D0499693E8686DBE9D34CD24C4B1DDC87FCAEB antiell5
929,703,011 *60D5425D0C50E2BA404DDC7F53BC15A4093DB095 Antifacesing
929,703,012 *60D6D50B35AD22AB6780FAD1AF03B7249F58927F anti-germanrex
929,703,013 *60DE33E86A54056A4D8AC77DC3FE546C8E7CFBA2 antiheli0
929,703,014 *60D1ED1419C67C0B9B18DA04E008C5BC3C2180BF antihyst9
929,703,015 *60DB962A65292C2693DD9AECEA2C8DFAE6DA72FD ANTI-IT
929,703,016 *60DD0433D03602F0E6525EDCBE10558DA9501A51 ANTI-JEFFERSONIAN
929,703,017 *60DB278ABFD94C63F13782D9C595897FBBA57C33 antijuri1
929,703,018 *60DDF58BCCEC5B58C3CF0083A595CB4EFB2A2CF6 [email protected]
929,703,019 *60DC83B66027D213EED4593098666E08AB8AEB0B ANTIKRIEGSMUSEUM
929,703,020 *60D0FEDF10730ADAAA88ACB1BE332AD79FCBBDA7 antikvitetsmuseum
929,703,021 *60DBFA2E3614FE01D0CFFD86987243EFC3796F78 Antilaud4
929,703,022 *60D1984C56DF467A5458D4216A05C1F08B07A965 antilegomena.15
929,703,023 *60D95A24342FF024F9E32A3E112E472FD13CEBC5 antilogismoy
929,703,024 *60D69DCBD543FD197D370AD7404651CA7C490861 Antilopeachtiger4
929,703,025 *60DF6245198BEDCE7972BEA519A04C22F948A245 Antimach1
929,703,026 *60D144E1BAC95EA2ACA76E5DEBA8D6B3DDFA08F2 ANTIMELLIN0
929,703,027 *60DC80ADF80EF3DEA46E0DA5E6A81DF97007EFAC ANTIMODEL6
929,703,028 *60D8BB889D006BD6B0878F96B76039DDAA98782E Antimonarchy6
929,703,029 *60D67DF486FD3AED3A9FA7558008394A3C97B765 antimony-caesium
929,703,030 *60D1495FD34216F390DE5A6F7E70AE0B9C475D25 Antimorality9
929,703,031 *60D6005E7D21755678B495BD8F8AB823189F6D4E antimyonen
929,703,032 *60D386DE3B89B60E7EFE9F85B6FB8C1E0375CFE6 Antinationally2
929,703,033 *60DF703B8B8EC1FABA9AEA563507A06E8C91AF53 [email protected]
929,703,034 *60D3C1CD5A08187635E1026A472F3EABB2301CFA ANTINOMIE4
929,703,035 *60DD6339ABA2C63CB3D26EA35AD0B7E97627088D anti-north-korean
929,703,036 *60D9DE29B27C15ACF59E454FFA37BE40FB193D10 Antinoss
929,703,037 *60DEA1A7FB5394CA83494353E1F33310100F2A0B antiochem
929,703,038 *60D1F38B612DC04C47F5022DA7A0F907F26B4521 antione.aguirre
929,703,039 *60D04E29792FBC601699375AFB34D616CAA95016 antione.beres
929,703,040 *60D7487F430D67AEBF53ED83331E5178E934D36F antione.burgin
929,703,041 *60D0189F5A1BF9069D0760CC5C786F7417B780C1 antione.casal
929,703,042 *60DD10DE62FA488C7024B8D0CA7D0159E7149427 antione.cereo
929,703,043 *60DF09903F848941DDB7AFF6DF8F4D36F02C02CB antione.detmer
929,703,044 *60D4039FE5AC4E6587B15438CF94F54C16C94B9D antione.hasek
929,703,045 *60DF099AD362E9C4204E04B927D39C087BE6494A antione.huttman
929,703,046 *60D35D1180F1EF1B286B8F50F701C9EEEF76AAB5 antione.kelchner
929,703,047 *60D7CE75C9934D39FBB3F3C1DF138CDF5AAAD651 antione.koshiol
929,703,048 *60D235C62AA0D013E30154D71FCFF7D0C0A37A2E antione.lindwall
929,703,049 *60D966821C86D17A615714DCCE4E053231DF4156 antione.masek
929,703,050 *60D58047C5044DA83BEA51F33F53315029DEE63F antione.masi
929,703,051 *60DFF55818DDCA7719BECF948EDD0970366AEA6B antione.minnifield
929,703,052 *60D8691BECABD494D57418E7B360C5697F0814E4 antione.obarr
929,703,053 *60D9D59BF09AC0344B04729CD82847DB830A9797 [email protected]
929,703,054 *60DEC8C06EBC159600EBB423DB9554E32D25D8B3 antioquia.svgimagead
929,703,055 *60DB694BD4F740FAC91565E29D31832CBAA13CC8 antipartizaninės
929,703,056 *60D2D2C2AD35EC403640102ADB6AE1CB8A94A7B6 antipeptone8
929,703,057 *60D2BA0AAD1E699918BC54ADBB2F75AEE89D90B3 Antiphona:HodiebeataBarbara-Magnificat
929,703,058 *60DE46C4772CFF6940C32A41C40CDB3CF4595BE6 ANTIPHONEAE
929,703,059 *60DF1590B1A9AE989765D30E3A86126EBB38C945 Antiphon: O splendidissima gemma
929,703,060 *60D07595D69132EE89866E7552AA9DFFB700951E antiplatonist
929,703,061 *60D6525801855047A0037B2E4AEF86E14A336111 antipodagricing
929,703,062 *60DB3253D6264D5DE50FBD4D18022898207B951B Anti-pre-
929,703,063 *60D415AF211FA84D5BBB6F865867B0C6622D92AE Antipromozionale
929,703,064 *60DF1B0DBFB635A10A724A5B4CA0CAB05954FB5A antipruritik
929,703,065 *60D562E6F0043F9F35E09D752C2C656F1009C063 antiquados1234
929,703,066 *60DFD7D7A4B1872A03358D1C8C3AB8448D52D45D AntiquariatBurgplatz
929,703,067 *60DD8E309E2881E471709362726C7102AC1834F8 [email protected]
929,703,068 *60D3664B67607D790B62ABE8C07146D1D02FF6CB Antiquity!
929,703,069 *60D4D8F39B7B69FA663CAC9D020DAD0245DB4B6A ANTIREFORMISTNA
929,703,070 *60D55737B66D3E388E42876595A268F8401B0490 antireligion5
929,703,071 *60D8BE33C40F0CF90958A471A4615C14F267BC72 antiscorbutical5
929,703,072 *60DBB885B23012E258A237D2E01C6AC79663DC04 Antiseptiki
929,703,073 *60DDE813DD56351134EFF76BCC4D48BF30F02DAB ANTISHIPPING7
929,703,074 *60DD85725465BA51C7D9DDBEB66805960DD3F89B antisistema solar
929,703,075 *60D9C88A461F995F821C94B55CB97E892B07347A ANTISPASMODIC!
929,703,076 *60D2D06C01FFA5BBE29A5DD268ABA3B0008A3366 Antitheologizing5
929,703,077 *60D80F058EED08C7FEA0E28042E2CC5B082A2328 „antithesis
929,703,078 *60D027DEF66CC17702A716AB1814D94D74FC7CC2 ANTI-TOXIC
929,703,079 *60DFF9F37A93E8A33191954A79E07DBC080F51A4 ANTI-TROTSKYISTS
929,703,080 *60DDA59BDFE3016A71CFD9343B89B246267DE746 Antivandalizm
929,703,081 *60D5FBEA659A3F3FE5962D3AD69E0212C43C869D antivirusprogamm
929,703,082 *60D11DE56CE7CD6750844B3CD7CCBD9610D9169E antivlastenecké
929,703,083 *60DF175640A82C1DB92DF4719BF993B170640B7D ANTIZEALOT3
929,703,084 *60D443B2C74232959AB7A6087F5093CCCD888E8C antler-tipped
929,703,085 *60D57701236FD9F1646B426D2BD416A94FA04A1C Antlikea2
929,703,086 *60D6C19B5ABD567AF078393C4BDD46CDCC4C91A9 Antlová
929,703,087 *60D04B40103E5B52D80BFEE0FC901A57CD4F3149 [email protected]
929,703,088 *60D6831EE44514376C646DAD8F5D208539833645 anto51
929,703,089 *60DBFAB0A633A7C97BA18407928A7F4525CCB4CA antoine.bard
929,703,090 *60D7D5CE40560CEEE6E890C91099DA76AF6E6A9D antoine.berendzen
929,703,091 *60D047C0B31CD1923F1894D6D7F4D74093A2AFAD antoine.bodey
929,703,092 *60DBA1081A26DC6FCC20507A59528E432B21CD1D antoine.carabine
929,703,093 *60D563D7D1774B99EE0AA0CD4DBA02C08119AD16 antoine.chiado
929,703,094 *60DEAA0E25A6F7E8979EC9C142AF2AA2070BADC3 antoine.dibattista
929,703,095 *60DA114A40CE559DB3A5FCA73A5FA17995548598 antoine.falzarano
929,703,096 *60D2944D677B5391A8F76A1FB67628372B6D8FC7 antoine.fornea
929,703,097 *60D719D4957B9EED1DFBDBC6905B48D0545FC76C antoine.honkanen
929,703,098 *60D7E8AD4A3D595B6599677BDA4D22B5E3DB9AF3 antoine.how
929,703,099 *60DC289F901D53D9816A5CAC8CAD7895661759BB antoine.kapsalis
929,703,100 *60D32C366F81BB04F358785713C2E41B50708984 antoine.lierman
929,703,101 *60D94F27A1E27A7F8214215D93CDBDC419EC05C3 antoine.mabel
929,703,102 *60DBE07F489132BD2C63B09A0AEE14BEC34F3326 antoine-masson
929,703,103 *60D3C5326F1ED768F78E768FCAA18AD1B13B36DE antoine.nappi
929,703,104 *60DE8BC2DE3A268809266D2995B0B3AF67DFF289 antoine.partee
929,703,105 *60D1AF0754689561AD84BC4B6530D7C31AF55C6E antoine.ruda
929,703,106 *60DC0F08400B07D44E2114A032CA849EF1443A22 antoine.rudzik
929,703,107 *60D4CE1CF86FF5540BEE02BA03DC9B533E10FF35 antoine.rzepecki
929,703,108 *60D4F3CF923FC108D6C9915D7B4470912544535F antoine.sikorski
929,703,109 *60DFA6C2A00E64CB56215741A14DF67759426A72 antoinesteaua1
929,703,110 *60D5EDB451A5C346FBD7B36954F118CF54E39F01 antoine.sterlin
929,703,111 *60D85B0DBEF811E52979CD481BF98FC01BF086EB antoine.suggs
929,703,112 *60D09DFFC6514F5EB7FE1A5248CA7C615D35102C antoine.tehrani
929,703,113 *60DF8803F3E4F2E7147E7EB00134231585BC4222 antoine.wehbe
929,703,114 *60D5A6B95BCC0C844FA29D356E22990D1474CEF0 antoine.zuvich
929,703,115 *60DA836805BFCA689B97C684133F95734985BD0A anton128
929,703,116 *60D2676954D7A57462F0EEAFB00CA05FE8712931 Anton660
929,703,117 *60D9C287FD925B204F2E1F61BAE352444D01001C Antonakes6
929,703,118 *60D701F079089CCBE1FBD816F9AA61E81D66FB97 anton.bodine
929,703,119 *60DFE31E0EE291CFC118C8796452119E95959576 anton.bui
929,703,120 *60D0249CAC88D1AFE103843C0CC5EE881D4D69A7 anton.colleen
929,703,121 *60D470837B9DD1F35869CA6DC193EDC8B4765582 anton.conkin
929,703,122 *60DDE3BFDC245A6BB3CBC4934EEA0B0DD30B3F39 anton.domann
929,703,123 *60D4BA58084DCBEEAC354E776D02A93B865C0A9B anton.earlywine
929,703,124 *60D5F25DB4A1305111431899714B4F37F426C27F antone.bergdorf
929,703,125 *60DBAE5D505FC9AE9F0184BA6CAD044C6D0F5B3C antone.canta
929,703,126 *60D9903DB1840F5ADF46DEF4C200279B2844EFD9 antone.chenoweth
929,703,127 *60D7BD728E83D2BFE8403BECB21E6D9501516943 antone.cutsforth
929,703,128 *60D1DEB544562222B924B6A2B648FE8E2A64CC3E antone.duclo
929,703,129 *60D97EE1D8B9C3670E9ACC12B07A49069B941DF0 antone.ehlke
929,703,130 *60D24218939B81E81D12DFB8B39902D2A623804C antone.fukui
929,703,131 *60DB1F12B5F1152AA42DCD7D3A671FE567097CBA antone.garriga
929,703,132 *60D316E0710B185FEFD7CE28F812BA711815C4C5 antone.gloster
929,703,133 *60D2B2F119A8CB6B7D88E6BDC286044394B4599C antone.golembiewski
929,703,134 *60DDF2D9DE1AC7431BCECFF1365CC11826CD4C49 antone.habif
929,703,135 *60D172FF84FA3BFAEE7FC612BDBF28D87AFF01A3 antone.helmbrecht
929,703,136 *60D78C12A9F3F6FFD59E62A18D7745C3C9E35AE8 antone.kalp
929,703,137 *60D11D32BD1A66E358A862884E0A925D2883565D antone.kenkel
929,703,138 *60D7764A2ED17868F6E6ED5DB757B53BC784B6B4 antone.lampert
929,703,139 *60D8FB3F43523DDAD7347D006BDAD78E28709295 antone.lawernce
929,703,140 *60D560600B57F5B3D2B6545D0E006E805E4C1F6D antone.leyvas
929,703,141 *60D4A7010A3E28CE19D9950A26BA58DBE4E9F670 ANTONelLa
929,703,142 *60DECA5DCC243ED4BCF1393574D55BCB0A061C66 antonellitoni
929,703,143 *60D3A5238BEFF0CA56AE524CB5D3885166E3645B antone.lownsbery
929,703,144 *60DCE38EDED6453C780CA33C725249FD97E766BE antone.malakan
929,703,145 *60DC3D57B00D550B68C6FE77083CD48CEF7797D0 antone.martelli
929,703,146 *60D2EDB7C6952D88BD4F5B4BF93C32D31E15D555 antone.mcclosky
929,703,147 *60D35ABD1C4C62A1DDB05203E1FA4810919AF0A6 antoneo9
929,703,148 *60DB40955B168EBE860734037E96D5AA0F603F5A antone.ogrady
929,703,149 *60D6ECFF08C0AABEBE78F70FC50B9D00ED3F7C09 antone.pangelina
929,703,150 *60D8762C9EA9F6945CCDD034681FCD7C24E6F80A antone.pauda
929,703,151 *60DD17C83160B29C33C95194BDFFAAB825AD906D antone.quaintance
929,703,152 *60DA171D79B3B9B169BF3D0C6015901C1B39BF3F antone.sernas
929,703,153 *60DF2D8F11DA91951D052D16CEDE021C6FA6A35D antone.stillie
929,703,154 *60DDC9A7C343CFE28D66098965F2CE42350069D1 antone.stridiron
929,703,155 *60DE414B373DFE775C19F92DF22F7E09C00D11AC antone.tollerud
929,703,156 *60D1D0120B2E906466A8D1A2EC4C994B773CC588 antone.torrella
929,703,157 *60DAA650A01D0EBADA876E87FC4A7012AACAFB20 antone.warton
929,703,158 *60DF6E4054DADC5E75146DCA548BF683C60A8A7B anton.felgenhauer
929,703,159 *60DEDC84947662B1A28A0E22536382EF4C5D3243 anton.filipi
929,703,160 *60D3C164537C05EB688D2B01BF95122777BFC49D anton.gongora
929,703,161 *60D6F9C0060CCC4C5FD2FE489E59B93D5BCCDE26 anton.gutrerrez
929,703,162 *60D82C38317E9A82D694648C0310F0B03EB8D91F antonia.baseman
929,703,163 *60DD128213F1E0EDA1D0BCCCBC29BA64A8F8DD10 antonia.bogie
929,703,164 *60D4C272213D9298EBB63AFB7C4B47729D7B6310 antonia.caulley
929,703,165 *60DA90962284FB7BF05121B62ACFA8BDB5D329F6 antonia.chinault
929,703,166 *60D9F7B2817560287D5D371C77BD07319ACAC4E8 antonia.etier
929,703,167 *60D314E34148979E36C97263EB5DF739172103F7 antonia.filburn
929,703,168 *60DA989BB993B582C1E81972766EAF1BFDC061DB antonia.freitas
929,703,169 *60DA8550338885768D41070BF06F223E57F25AEC antonia.goffer
929,703,170 *60D3B3DC1ACD4478EF5F4D6D6B4A25A08F04BD22 antonia.grabarczyk
929,703,171 *60DEF0753DFF472054C4202BBE8BE20A0BE99ACE antonia.grossack
929,703,172 *60DEB528C3694EE1FE7D7DA5A6BD04DB45B929DA antonia.guelff
929,703,173 *60D2C7F05A9426B8F454E9874DF402C3ADFF710B antonia.higgenbotham
929,703,174 *60DD298073876A5E2DF34AC6454FBB3C44DCE443 antonia.husted
929,703,175 *60DD3CF842A10D81F99972F36FE5ED7B0A277230 antonia.hutton
929,703,176 *60D8B1958E6FB2A1DDBC90889D66F3F2211B121A antonia.knewtson
929,703,177 *60D7D602C3F7F4F7A8A0E83DB753DE397A0BB0C7 antonia.koslowski
929,703,178 *60DCFD7DE7D0F96F7DA6FCAB7F2C9D2987039255 antonia.loner
929,703,179 *60DF906A492DF5770BBFF38BE7C2EFD5260BFA99 antonia.longhini
929,703,180 *60DCF20C1E33D654CA66BE3CFFED704C2F8A8CE6 antonia.mummey
929,703,181 *60D398AA4D332A0963F0EB8C0424CCAC3B3A9EFC antonia.nierman
929,703,182 *60D3BD11C3B4B9BBF53E7B8BB7CF0E99BD27E7D2 antonia.panke
929,703,183 *60D379613EF74D568E9A48943AED9F88829C9375 antoniaprice
929,703,184 *60DB2C7221A347CFAD9E66BB6B337BC3DB9B2DE9 antonia.renney
929,703,185 *60D3C9AA13BF9ECA14861FA1F45F2974B12AE3D4 antonia.stearns
929,703,186 *60D427034BCB6B07E92BE770C24DE47B2A0A22A5 antonia.trudnowski
929,703,187 *60D53BE227377864DBCB105A8C51A8AED91D54A5 antonia.tyrer
929,703,188 *60DDBB0EDA3561A90D312C8177BE29311091573C Antonina.
929,703,189 *60DE72603773DBD364D2AECBFBA9922E5DE24263 antonio'$
929,703,190 *60D5682216BF25C82290978EFA7D25B86B4D52DF antónio»
929,703,191 *60DE959337F66F35F1408ADEBD472BFAEE489B30 antonio.blacklock
929,703,192 *60DAB4E35B4F2EB1CB54984CEC980557A9BA3A70 antonio.carbaugh
929,703,193 *60DDD15E6FFD78D9DF6E5BC7CB247AE8FEF8BF22 antonio.colomba
929,703,194 *60DB1FED9EAF1494A8BEC537D505C076F3D08BCA antonio.danesi
929,703,195 *60D8F87DBD0D4A5BE42D8BB04067588E9E38FAE5 antonio.digiulio
929,703,196 *60DA5ED8860133AC9F8154BDB4587C429299780D antonio.domingo
929,703,197 *60D15FE16308FDA16F1073E23186480B25D4186A antónioespírito
929,703,198 *60D34014F1C7BF51263C887B27B8EBF872A9105B antonio.fitzsimons
929,703,199 *60DA22546F1218E4E7A3A286629B21F089F720ED antonio forte
929,703,200 *60D6774FBBA128F642B1B32C3D6C785FCA103346 antonio.gevara
929,703,201 *60D342EFE4300CBB855EF6AFAF3BBE0ABD7C4A57 antonio.gossack
929,703,202 *60D543071FC28196BE27E1C5E123039BDAF0C9E9 antonio.haulk
929,703,203 *60D408EF07AA17412883908228C20567B203228D antonio.hausteen
929,703,204 *60D83D525F653EB4215480D5218D7EE0324E645F antonio.herrand
929,703,205 *60D62DC2B4140CB3269A121D9164A07B28B2033E ANTONIO.JENKINS
929,703,206 *60D7BB73F78AC9B221DC914B3E11BCAD781E780E antonio.kacerski
929,703,207 *60D563BC1EF67A2561663889730D10074C27E369 antonio.klump
929,703,208 *60DE8ACE26660E187A8199FCEA3F2C4F598038A9 antonio.knowell
929,703,209 *60DA89B915EF96FFD390F384545522FCE982DA35 antonio.marchan
929,703,210 *60D1E8F8A79ECF83582CC0CE037253679981977B antonio.matamoros
929,703,211 *60D1969EE11435B338D3A56DF5C51F719A40C7CE antonio.mithell
929,703,212 *60D1C59BD42FEC2EA9E316854BB559BA0BD36E44 antonio.noye
929,703,213 *60DD06AF650E8C11A5AFB24C97024D363A3C1BE1 antonio.okel
929,703,214 *60D3DE5C7099475A3A10920D56A3F865B4C02F13 antonio.olesnevich
929,703,215 *60DC79B4C5467D31A3A7CC86FF8D9C783BF6A2A0 antonio.oney
929,703,216 *60D476D71F1E22D26D9BA9AF9C8727214184EA38 antoniopipitone
929,703,217 *60DCA23938FD9A53CCF6B97EB44EE0A2497C20AA antonio.poston
929,703,218 *60D83E40E622B74177FACA486A52B56BDFEF27C5 antonio.rochlin
929,703,219 *60D8ADDB84A938B0D2A11734433926C84A605FD5 antonio.shoulta
929,703,220 *60DEA51ACBB21BA75264DD44F89549F5B9949A9D antonio.sobey
929,703,221 *60D569DB6C23BB95E1DFB0F885B5D3E599128F7C antonio.thweatt
929,703,222 *60D632B49D6FA8948ADBB29DCEA181CBA966AD11 antonio.timlin
929,703,223 *60DA3F8039C969FD3DF817F899776D102779642A antonio.vanderwal
929,703,224 *60DECC7A5A54E707D3F308185C9584620859903E antonio.welde
929,703,225 *60D1C2DD8AF180DC9306F5928E6542ED79334995 antonio.wissing
929,703,226 *60D8BBFF6FB0487279CFDB1A81F58B53E9C72F17 antonius tong
929,703,227 *60D0D5F97BD918EFF028FD6C26A0156EDB4EC36D anton.kuhlo
929,703,228 *60D1EA2B6D94AEE58F7BBA3D44E2A18F29518691 anton.laford
929,703,229 *60D65ADCE22AB6F7620518017FB6BA750F738D1E anton.lenke
929,703,230 *60DCF4E4A4D49C3E9DE3A6CC8DB1E8B4136107AD Antonloses
929,703,231 *60D73F08E646925F31002406F364C5FA09C67687 anton.maitland
929,703,232 *60D84A925ED96475A23DA2F68BBBCC83BFC3C5F3 anton.nostrand
929,703,233 *60D195022C4A96811F53791067B21B58826C260B Antononinu
929,703,234 *60D6EB5990A2BD9C29382F0F0B612FDF4463615A anton.paponetti
929,703,235 *60DAA2F04B49777AE0E509DD6CB1AC5D1BC69E00 anton.pitcock
929,703,236 *60D8A2F7A1CB03B225D32BDF8365CA5291F593D5 anton.shiley
929,703,237 *60D6FADF1C5D209F4B99EAB374AB311928DA14D0 anton.sinibaldi
929,703,238 *60D34B6D7AD851A9B5685339ECB72A6E6528A253 anton.willame
929,703,239 *60D838CAF3DF6C3255EA718C87A2A837BB14C25F antony.ballman
929,703,240 *60DE7C5F070242DD952DF105EB6944BAFE4EA370 antony.bies
929,703,241 *60DA933AF48663C4979E6820F53CBB6EEC65DF46 antony.bravata
929,703,242 *60D274CB533D978FCBB824148E1BA8389C1D8466 antony.buvinghausen
929,703,243 *60D719B96679CF2062B68401FD829F2F1499FE09 antony.consorti
929,703,244 *60D6166EAD019135F66B98640FFD0C614B0215D8 antony.decasanova
929,703,245 *60D6D5EA90E8E1530228C3CD8E29414841D50F93 antony.demichiel
929,703,246 *60D2B12B1D7A2887978403D7BF8C28F42B72ECAE antony.digrazia
929,703,247 *60D316CEDAC8FCD634FE36EE69D6A75A9BD3E925 ANTONYFLINT
929,703,248 *60D5B79C68E2B688B195F36BDC92A2CBE14E7678 antony.guterrez
929,703,249 *60DFE9083EA6C0A6AE80A92CD2D6DA584B3894D7 antony.heizman
929,703,250 *60DA30064E45FE0BA279C29D3DB03C017585C89B antony.krynicki
929,703,251 *60D0F5076975B43FABD9D49303E4F2C7F92C0584 antony.mamudoski
929,703,252 *60D571CB25D33036D18F11E7332F72F94F2C2A53 Antonymet3
929,703,253 *60D9A0C343BE55660B10A3107D4F88DBE2C51DAB antony.morning
929,703,254 *60D22BBEF819333067EDA53E0D26FC55F74627A9 antony.pierron
929,703,255 *60D72A0A4CF6F640EEFD6CD8AF43F24FE7A8CB2F antony.reagan
929,703,256 *60DC72EA5EB93216550E0ED76C5BDAFDAC844531 antony.reeh
929,703,257 *60D7CF861042F00735E8D047F990545773BAAE87 antony.rodea
929,703,258 *60DB664C0C1151F78BB8CD5AEC6C88111286F927 antony.sabean
929,703,259 *60D72657B4DDEC798621E6685A2AFBE61C000E9C antony.schoenfeldt
929,703,260 *60D59435BE9C6036CF31B01D4B3EB7158523D14A antony.sorgi
929,703,261 *60D93238A621F9D4EEE72D4982DFC5D5426E6707 antony.trojanovich
929,703,262 *60D8920C08D02949A33AD32E73BD2DA553B4FB68 anton.zahniser
929,703,263 *60D08104C8E4E2D9452B7BE0C309D0B6FCB8C53E antou1234
929,703,264 *60DBC83D75C58AD38C4712D3249C090D0B846375 antoxhs1
929,703,265 *60D54B3027DF06549520A0701C615E58E6CE1B97 ANtPi
929,703,266 *60D10143B7C056AE1884460BA2774F280EA4CA92 Antproof!
929,703,267 *60DA00261A997583E7111876919A477807D5DC70 An!tR
929,703,268 *60D190516CD1CA8BE57861A2BB7AA642C17E1290 ANTRACITKULLET
929,703,269 *60DBA10F70C3FFB3D697A8981997757AB551CE39 Antragsb7
929,703,270 *60D2ECFC30CE2B0EE507B0284D35218C3138D6B8 antrere
929,703,271 *60DCCBF01A08A9F59F4BA13EC3740F3634F9084F ANTRIEBSREIFEN
929,703,272 *60D5A3A2D30B14C204C1020C83B151BA08CE35BB Antrimpas
929,703,273 *60D795F135FD29A0C95D814071E9B448488F63E8 Antrisco
929,703,274 *60DC7616AACC32B474C39F16EBB51690B1EEEC7C antropomorfizem
929,703,275 *60DC2E33293DEFE1673A4AA69DE42FF495C2C1DC antropsofas
929,703,276 *60D101B5807EACD551446EA982F019313A7B4C34 antsiferovs
929,703,277 *60D2FEB7F399AC6B6870FE0D7C24E089FEC518DB antti lehto
929,703,278 *60D7EE3AAF4AB962026B16F4D43F55AF40CEF3EC Antuleva7
929,703,279 *60D3F1CCA77C93A2E536297B879DF2F5CAA7A85A antwan.abramov
929,703,280 *60D4E094E84294C76E808149D6515CAABC2FB010 antwan.ailor
929,703,281 *60D45CD1942E4FDDDC20A7B0BB5C77B8A681C8DC antwan.balthazor
929,703,282 *60D213CFC238A1228B04585BD2A22E4CC4C5D4E6 antwan.buckler
929,703,283 *60DB3763119BBA63043D9EA8A3C291B32FE36BE1 antwan.chess
929,703,284 *60DDAA56F4A57BF8F8BBF88C77922E63832DFF89 antwan.eliassen
929,703,285 *60D1A949F97FE0614A83EE0F516524A4A06165E0 antwan.friels
929,703,286 *60D012D7F1861176836F18058FC1789A8DE6DB30 antwan.humphers
929,703,287 *60D9F94516B53B65B4A75CB0DF9275F0E169D2DB antwan.janovich
929,703,288 *60D1F860BA9EB2F15B69EF2068990F7C1235AF25 antwan.kaelin
929,703,289 *60DD0292BA28079999AA7EAE215B8DCF6CAB06AA antwan.mceachran
929,703,290 *60DAF45FA5040BE261E1BF0EA631528EBD4B2429 antwan.mcgugin
929,703,291 *60D64C24B47AC1DB35CA347C3B79683ABDF58059 antwan.menger
929,703,292 *60D134D922FECA9B0E15D234D6008D611DF1896D antwan.meserole
929,703,293 *60DAA925977CC06F8E6D31FA124478D74408D4B2 antwan.nuth
929,703,294 *60D59CC8AA7D448D36CC6AC33FCA30FF4F363712 antwan.paga
929,703,295 *60D6111737B58D1478B62B30ECE2C85F2746AB73 antwan.panias
929,703,296 *60D2E6D424F5E204A227E0BA08BFDAADC4981836 antwan.williby
929,703,297 *60D966D26F8A022607808A1F1A26DE9C098C39D1 antwan.wineinger
929,703,298 *60D95978E5624B08EE406E6AC0D5BC0EB7B28CEA antypmrkenedy666
929,703,299 *60DD41ADC57E7E7208E9D37AF1E17A592BE0AB6F antysomatyzm
929,703,300 *60D65A8A6038B9D579762893AE6255E1E8780252 ANTZ_
929,703,301 *60D746412704E3C7109D19E81C34EFEB06247195 A!N%u
929,703,302 *60D9D931DADDB83A651E273521216BA4C736E7F0 A%Nu$
929,703,303 *60D418FF178E002C6BED5778D2AB9A92844F98D1 A|nU
929,703,304 *60D8BF72A797E4F563EF402515C445EE47F75BB0 A&n!U
929,703,305 *60DC4DC1984B44B286E0A71C2E3CDF31115B27F3 AnU
929,703,306 *60D925B56D6A76C0E875AAE404D0E3E5FE0696CE An$u
929,703,307 *60D6DA05D13BBF4EC7C6C84C741D2A0338880834 ANu37
929,703,308 *60D184EF336E7191E3F5186AA6029408F2032C27 anu45
929,703,309 *60DDC4392662E573992C01AFB3B051DD0206CB8E anu7ram1nosa
929,703,310 *60D3765B427C5BAF7611197CB9C76891F5F644C4 anuarul4
929,703,311 *60D57BA8C3B73D62895F60E9D905C5ECE7608A2A anubrata7
929,703,312 *60D0966D3D8BB9B10C33F8F2C74794CD634320E9 ANUek
929,703,313 *60D3607FF958A556F29AA1F74349BC775AEF18C6 Anuglaring
929,703,314 *60D33F73B0D83B7EF2EA1ED677615CF6EA2D270F AN-uH
929,703,315 *60D4FCA7FBFC43F578219607302FE7B197EA0320 ANU.K
929,703,316 *60DAA45041834B5CB2882C7A89DDC762ECDC09FC A
929,703,317 *60D4799CB896753A523500191A2DB99DCA51DC9A AnuL)
929,703,318 *60D40EA2E94C8B4DF99370D72BB604667950C326 anularte7
929,703,319 *60DE466C6FB829ED05309874011493D75F8F83A6 anul·la
929,703,320 *60DA01D407D7B0B26C51D6A685B001353BB24A54 [email protected]
929,703,321 *60D17859996FFAF84078BA1E7BFDEC31BBA1EF8B anumA
929,703,322 *60DE47F8680B5A5C3D06BE37403160CC5FBCA239 «Anund
929,703,323 *60DA0A8F37F2BE5C77E36F8CC966905B5C4EDFB5 anunda.comwww
929,703,324 *60DF5B20C7E2FCFF973746ADF5BCF0183C1623C4 A?nuo
929,703,325 *60D690687DFFF86D9B704B0C4BB4468D9B476DFC ANup;
929,703,326 *60D27AC4911CA2011A25403A76C2AE1CB4BC3579 ANUPf
929,703,327 *60DC3586B99C687F43040EF25AB7AA8299101E3E anuragsuri
929,703,328 *60D01B617D831E0880FD6C59B78272D933ABAC18 anushakayastha
929,703,329 *60D1AAA1197721236AB2B8BC8D2D690086F31918 ANUT5
929,703,330 *60D6F47F5A92578658BAA7E397F933FEDC7226C7 anutza_pisicutza1
929,703,331 *60D1AA09B2271E4752F468B4557D45450A2C5F50 anuvicar
929,703,332 *60DECC8DE9BD67D073F96D976AE5C3406CA5A62B AnuYS
929,703,333 *60DFC3D5ADCAAB195A0EA6B99C886B784F0AE1E3 An=#V
929,703,334 *60DAF0A28733ABDA162BCEDE1EAF25E5AB35C25D AnV$(
929,703,335 *60DB6B3F9F8C57FD4DDD08D91035353C216BE898 A-
929,703,336 *60D968513AB686CC75376FDE0462E773F432B814 AnV5v
929,703,337 *60DF9ABF196588849D2BA089A6E6BE6F3C8F1A61 A;NV6
929,703,338 *60D2E7965DF2D16276F956224A9AF32C0F70C172 Anvaltaing
929,703,339 *60D30326E885D0213F270BA871BB5C530A2123EE anvangt
929,703,340 *60D66651454D8F76F58DC54683221A318C0FD52C anvapadyad
929,703,341 *60D75422C6206CF6F60803DADBA56396C746B435 anvar babu
929,703,342 *60D8E6A39E283F38BA56D5E59E1A0611773B5952 Anvasser7
929,703,343 *60DAE15C5B39E1099E9F1D989E2D585237342474 Anvesse
929,703,344 *60DDC6EED70F600F4D60F44E10E5F4F73D395708 Anv$H
929,703,345 *60D199BF8F86C67A88B3FBC0E1BAA46C1BA554A6 AnV?I
929,703,346 *60DEA9F31DF93C8160431C370766BC4E9B9BB4B0 anvilsr0
929,703,347 *60D2C0D4B5B1FF710A687A6CDF663546ACE183CA ANVPa
929,703,348 *60D1CF26D1524EE173C0C34A03186704CA3DFA61 ANVQW
929,703,349 *60DB08299D821D3B3552E59DAF8B702B223C6DBC A,nVR
929,703,350 *60DC199D93D3765795468FF03F486578A5C82454 anvṛdh
929,703,351 *60D33AA104A442EDFF49D2AA1EB325D6312690A7 ANvwV
929,703,352 *60D9854A44CE0669047AFD7491C536B9E90E46BE AnvZT
929,703,353 *60DEB0C5637D911885B30463F8C75A23BC4E2090 AN=?W
929,703,354 *60D6C36F787FF034FB1CD6DB87B51042AE7AB356 A.Nw+
929,703,355 *60DD707F0211DD124AFE1BE15A795713433AFA2E AN)$w
929,703,356 *60D6FD9A77D92B16341ED95117B5FA7219AF3092 anwartsrecht
929,703,357 *60DA6BE6A3CDE12EE9F0D53C1411370E96FA5B67 anwar yassin
929,703,358 *60D439110DC76073CD2793AF47B1A0CCB50EF7E4 An/wB
929,703,359 *60DCA76F03291701230E159F55BFD31D52396EDD An:Wc
929,703,360 *60D02776E3B078CD6B623009049C55B593709381 AnweiIer
929,703,361 *60D8B44C54CC8FAC34D89F005F55F147485A53EE Anwendungserfolg
929,703,362 *60D0F3B0FAE40C091A8D123CB3BA0196B14A387F an+wi5e
929,703,363 *60DDE93B361ED17B437A4F2489BC6B7E87E6AA87 A(nwo
929,703,364 *60D6F0B59CD5CAB55C54FE8F1778C1A342D3EE09 A/nX%
929,703,365 *60DED88630D2D76D24AA8DA05FBE656BB4E6E808 An,X.
929,703,366 *60D182BC7AE4D09F99052345C835CBEA39635B5F An/X0
929,703,367 *60DCAABF7903E6200592BBEE70077DAC942B7C3B anx12
929,703,368 *60DA6B24357E38119E00B3610918974F1DEE2BF2 An/X2
929,703,369 *60D68266B3D8FC4FC22E1360A81A122291D30FA4 AnX
929,703,370 *60D1D410074216A2A6795E1BFBAF26DBCB2F0307 anxiety....
929,703,371 *60DE73481CC6B21F593ED0ACEE39BB648B8B0712 AnX&l
929,703,372 *60D76158305D5E419A566784174F505E99BA100D anxscint
929,703,373 *60D18C9851A8BE2AC134D364F47ED630ECF34BA0 A/NXw
929,703,374 *60DC50D25A2783F9F3B3E46DF14E464962D94101 AnY%
929,703,375 *60DA076443F3FD0D5FB8CAA214D79B48E9325BFF anyadinamo1234
929,703,376 *60D2DB46F4CA302D339CDC43D5232079F9F9A42C ANYAKNOWER
929,703,377 *60D115093B7939DCD616FB35F46F431F00DF5BC8 anya_philips
929,703,378 *60D3FA14B80BDA536B1F881641E2DD4005A1A787 Anybodyd!
929,703,379 *60D725FED5C097CC4A39A8C69B4DCAB87133F7D8 !anybody'd
929,703,380 *60DCDA82E1DCFFF0DE753C2DD64625220E8F1CF9 Anydrophila
929,703,381 *60D6BFCFB6C6A5419F0239290C23553FBC9D2C41 anyjka1
929,703,382 *60D23AB8C2AC55641B90C9F28822307D04AA8F6B A
929,703,383 *60D647D8F81AEA30345CB3F2D251147B8ED3F05F anylabeL
929,703,384 *60DFEA734A5F62B770B60E2D2FB3B734B0EDB4C9 Anymakes
929,703,385 *60DA020715C6175B528D34F27DDB5CA9BC668BFB anymore.81.153.215.5
929,703,386 *60DF94929B170DD75CF73AECC594D18C35B0AC63 An
929,703,387 *60D009D28D93B4669A156DC9832CA50E526D4EC0 anyottersb
929,703,388 *60DF4C13041127A64FF20520DA7BE0BCC178EE48 Anysley
929,703,389 *60DE503A0CE4FE9FA9FD1BE83FEB08DBB3332BE6 anysongs
929,703,390 *60D9B3F8EEA6A8CC193E222D7DA42C8D3BA6B3DD anyssa groves
929,703,391 *60D1DAAE228B740FA5AAD583D4DE054E27D7519E anyssarodriguez
929,703,392 *60D343BB514939BFB56D9FD0E010C45B4341A50A anythingchunky
929,703,393 *60D0721460D788550324449A55D58555AC4EEFBB anythinguseramandawi
929,703,394 *60D02444097F973A3D71FF61EF9A6BFA235882DC AnYVH
929,703,395 *60DD09C90A0221892D5B606EFACF5D0D0A929D50 [email protected]
929,703,396 *60DADC62900A7A38C518341DC6201DE77C14574F Any World (early demo)
929,703,397 *60D10CD7708FAF141AB3E0A029DEE80C925B2012 ANYwr
929,703,398 *60DEA80A2C9CAA2FAC68C728DED3758590279479 An#Z
929,703,399 *60DE825E75A0A6B5EAE34803E427B3C38BDA6FDB anzahlh5
929,703,400 *60D1354D111F760CD467183E7F4708ED5DB28A0F anzana veer
929,703,401 *60D0B19F4871022C8ECB2DC1634166107EFAC027 An&Zb
929,703,402 *60DA00092D0462E2732E144A50F2B7FBB303F6A1 ANZEIGE1
929,703,403 *60D92770CE6C0C40854B6C854CEE8FE2507576B8 AnZH/
929,703,404 *60DFB04E94F92B8876ED9C927B11E9D661C46428 Anziehungskrafl
929,703,405 *60D455D2C66B876A87448FED86C1800459F62A75 AnZIY
929,703,406 *60D7EB555031A180A35E3F0990C15622AAD5C797 Anzolarases
929,703,407 *60DD88957449AE7BEB555AFA0FBDC0171D9840F3 Anzu"ge/n
929,703,408 *60D9E7E74B5888966E2B7800603E766A4693F76D A+NZX
929,703,409 *60D0F879BF11D7245BFD4F33576C3C2ED478B8FF A|`O
929,703,410 *60DDC63609370F5B05265A1D70A738FF4C83A6CB A-$O
929,703,411 *60DA2DC67F7D6660B4B7E1B9CC0CCE6ECAE4AF87 A;O
929,703,412 *60D7AF0A1CDF3B71CE630BC9F92ECD06A1990964 A?#O(
929,703,413 *60D32ED0206934B04D451CD24948AF8AE4EE4B71 A"#O#
929,703,414 *60D61A37DA0AAD4E9912DBFDA24CDAEDCF686DEF A*"O
929,703,415 *60D746B6CA52094D34FD709C9D55D8BBAA5C7F0E A\O.
929,703,416 *60D0D82CA7F1FEC79A61A4FA74B80249279FB01B A#_O)
929,703,417 *60D0B1DC756A242AD5336CDBDD64382B2A35698C A#O;,
929,703,418 *60DE4A60DF0D4B6EBCDA37D36654D70E464E6CA2 AO:".
929,703,419 *60D4D539918A07789E47B6FA1E48B79ADB6DAA05 AO#)?
929,703,420 *60D46B30C24DC3CA5369754AD209FF300298F920 A-o
929,703,421 *60D979DBBF9C46B82A6D71229FAD812B8DD668FD A;(%o
929,703,422 *60DE0636CC3AA3448AC20746E389F1520B69B54D A;$o)
929,703,423 *60DD23AAAD11DD709AD28B752E8CE56432D27DF6 A;#o(
929,703,424 *60D18BCB41444CEC24DE96219934A52098079F85 A:o_"
929,703,425 *60DC3CC7E2F25726A08B912417FF7DF1E4448730 A+!o$
929,703,426 *60D1CFEF47FD46096E0362A33A38979D3C514F62 Ao?#)
929,703,427 *60D7EC58251014AF4480E7A8765B9B1DE6A625EE A)o,0
929,703,428 *60D3F3B7F6CF75AAE0C5901064B288726097B34A Ao09:
929,703,429 *60DB1FE458E5DB1FF4ED88E85769AB5E04D9BCCF Ao0C,
929,703,430 *60D426844C5C7F912F2645E288D54D8E18824150 AO0+o
929,703,431 *60D477CC8F21017725734BD8E73DE611228950AA AO+1&
929,703,432 *60D85B1248B92A81A2255C70EB63AC060CDB3A7F A(O14
929,703,433 *60D0BDC39A8C924036BEEA4141E5D1012CC94B8C AO16p
929,703,434 *60D4BAE575EBBFCCB1B41DBFFBD441D1176751E6 Ao1A4
929,703,435 *60DFFDDC7D6FDEEC32660868E29658E94C5369DC AO1Ou
929,703,436 *60D122226AF5800082E422396A33EEB4C25FA7CD AO1T7
929,703,437 *60D57084DDA203C0CA5B633D33C942B9A819ED14 AO2OMU16
929,703,438 *60DB0C7B3A8FD3A721BDE825F856F1AACEF64F22 AO3+/
929,703,439 *60DB7B6F7B65CF231999FB7A4F993F1FDCAF5C30 AO39V
929,703,440 *60DA7A1DA4A4C9FCDD2DB2FCA7DA7C52EA336761 A+o3D
929,703,441 *60D6B54E9F346C52F7EBCD309F60A302F66168E7 Ao3dM
929,703,442 *60DB7EA460E9FDAEB218C01BC8668F0760B0DF86 A$o3l
929,703,443 *60D0494B99CF4EEC1E4409A2AC26759D30303AA1 Ao=3N
929,703,444 *60D3CF662F4AAA7496CF8F3DBDDD2BA692E2B980 AO;3P
929,703,445 *60D65AE890144FE85B0E874DC4A33B2FCE500EA6 AO3pM
929,703,446 *60D8CF92981596954570B7A875448F38E539679A AO3v:
929,703,447 *60D5369207B66FEE807B7CCE1EBD9AE1AC7EF208 AO4he
929,703,448 *60D0EABA381B615D1643B9B13F4665014FEC0E01 AO5-d
929,703,449 *60D24AC2D898C34E14BB9AEA3A251950BF15231C Ao6
929,703,450 *60D476A1FB3D6805234EDA4242BDDFB37E3F8F5A A/O6W
929,703,451 *60D8967B9824AEEF99BA25C5345980AE6E050746 A,O7?
929,703,452 *60D63C69B5B5205B0DA3BC286E95B006EF780175 AO7
929,703,453 *60DF3678C42FC17E5F0515C4564F0A46E02C13ED Ao7;1
929,703,454 *60D5A4B467D2024923FB19177E38B3D32604AA09 AO&73
929,703,455 *60D0DF1E92B8D835631CD1F20C6F9BCAC2D89A6A Ao#7a
929,703,456 *60DC201744F862E458FC9FAE9667602574E87502 Ao7r#
929,703,457 *60D9EE39217F5BE971B569C9CF24729EB23FD9F3 Ao;7t
929,703,458 *60DFB5ACEF5E7B6CBD2151C5C031CC841293CF57 A)o8,
929,703,459 *60D382E6B961A34C204A12EAECE9673A8894A870 Ao-.8
929,703,460 *60DE72629B2768A0DDE2B4128B2B45B6237F076A Ao8:8
929,703,461 *60DBA5EDC9C4BA14BB90EBD217B7EF7802712222 Ao89g
929,703,462 *60D20D9B91C26D6AD45A85C77A05BE8558EA0667 AO?8I
929,703,463 *60DBC60A906CCB51A9CBE443A272F684AC298474 AO8PM
929,703,464 *60D520A31A749581FFFE5CF85E36C388B5F2F809 Ao?8T
929,703,465 *60DC8D2BAB595A308914E69EE13A37F8704C2D43 AO9Fp
929,703,466 *60D6ACE5B640C2001E5477D98044E33168EAA92F A$O9Z
929,703,467 *60D8AC6AAB74A857E196DF1DD64BE86BE9537C0D AoA%%
929,703,468 *60D75E31FCBDD95F643ED07AE49DCE1C0C37F12D [email protected]
929,703,469 *60D4571D7514B8EB7D5B65045B7B14E757EBA889 A,OaD
929,703,470 *60D8BC72BE38626E5EE565D372C840D1247AAEE6 AoaEA
929,703,471 *60D8CAA96E1ADDCEAB6A5261055BDB975E9BB664 AOaF_
929,703,472 *60D1F8B12ADA6D2C8392E59F889A1925F4AA2BB6 aoaforums
929,703,473 *60D87C7ABC56361BB9062A962B5FA8FE6F9C7FF8 AOaNO
929,703,474 *60D1B20681215D3640D759BFB7D24B15CEE6D860 AoA,p
929,703,475 *60DCBA50A108FCD8D08388C9D33670B1CE75AA66 AoaRd
929,703,476 *60D103C05DE7E2935579319CA461559C521EF298 AOauf
929,703,477 *60DB7778AD32B50E65A93AEEC172A61C1FA6EE8D Ao-aX
929,703,478 *60D577FB93A380A080821C0AA53BC8F7B3909886 AOAZA
929,703,479 *60D50D4747784768F5D85827D7637D48DBB52041 AO?b(
929,703,480 *60DD2F97782E12FE842F064728311E47A13A2D2E Aob
929,703,481 *60DD9E3B1DD05BE986A4082CD456388DB297655B [email protected]
929,703,482 *60D1D9B34D06F2B5B79AEB9350958CFFC4E8546C Aobdaerb0
929,703,483 *60D738F99446DE73A3AED5B8674A64F06F83D8E8 A)ObG
929,703,484 *60D023EDFDDF241601DE9803340E29038B18F386 AobLU
929,703,485 *60D2D8432A42891BEC3347E98E94F022EE9A8933 A#obM
929,703,486 *60DBF5ECD3E59F58CCF4BDF8060FDA1E947808CE Ao:bT
929,703,487 *60DB462F9FD1995C2A9C1FC79988C6859105D363 AoB=U
929,703,488 *60D6BDE04DF4CCC46DAD97BC13BB62100637C260 AOBub
929,703,489 *60DC7631902C95C5F3584C2E094E530F9914BB40 Aob(v
929,703,490 *60DB71996A3D667DE337BF813E925E8FA96CBC18 Aobw6
929,703,491 *60D2E7C56EF6F8A6E158FBA28D2114910BE1FCE9 A(O=C
929,703,492 *60D07C9BF4AE50F2184E7E83CEB16D6F31912DF4 A?O
929,703,493 *60D3570630557B5268C40E94402A8D8D9F974CB5 A"O!c
929,703,494 *60DCDCDC496A9CCD08470DFE3726D2434CD5B54F aocブルゴーニュ
929,703,495 *60D0D6F054786EEDC9A686D82DF1292D88543DED A
929,703,496 *60DCB349CB2C5D414D9F4DC9545C7B38638DB386 Aoc4
929,703,497 *60D72BA274D0ABBA462EC0C60877EE8ACC71906B AoccX
929,703,498 *60DEB48F1059CD88A786AF96E0139696F5299D40 AOceanvillagemarina
929,703,499 *60D03CDB5C094211123E280F0ECC98512E421FF4 AoCI
929,703,500 *60DFFE95FA5A86357C7AB8EC8ED2C0598944DE07 Ao$Ci
929,703,501 *60D0F2D4C835131E0B1DEF5EDBFEB2A9C7ABAF22 A%OCM
929,703,502 *60D29C37F62E4596BBBE0EFF64D67BDD26E03C5B AOCp_
929,703,503 *60D36CA12DF6E8DE29F6168C12CB080597216F50 AocR+
929,703,504 *60D3952975B5972E9E5137C18D3C25549BA73465 A,oD
929,703,505 *60D145CAC42B50505601773F1BDF4A91531E4A90 A:
929,703,506 *60DCF7256F94B1FC7026A7ABEA580C7EAC1D3964 AOd2v
929,703,507 *60DFBAB17EC042E100064BDD812F565DFB3EADBC AoDET
929,703,508 *60D4A4D1F6BA16AB941BD4EE59CF9C472A8CDA35 AOdfT
929,703,509 *60D8DC1B16413A0EF27D11160A531F0179DF29AA [email protected]
929,703,510 *60D8BA82B82924795337E3383BC5812663D0EFEC aodinuf8
929,703,511 *60D562849DDE7B1E8D813613519C80AE77F5D460 Ao)DN
929,703,512 *60D781C8CEA487495113BF1844AAE5455CBCA1D0 AoDv9
929,703,513 *60D50ADD46B18D22CF7C8ADD698D9781878A5EE4 A+OE_
929,703,514 *60D8B8B79DA0E8B2CC91100BE94955B07F227484 A+Oe,
929,703,515 *60DEDFEFCF9F96F124ABFBA0C2CB5F564907427F A,%oE
929,703,516 *60D9E445FFED917CE4BB33FA472EB66693AFD4A6 AoE#5
929,703,517 *60DF435E38DB19344ECCA6ECC7CA0502836365F2 [email protected]
929,703,518 *60D22D33ECFE424A9EF640DFF6DB2719255EE023 AOeeI
929,703,519 *60D343C3E91D7BEF6F2D393FABE18A2A2DF9F59B Aoei3
929,703,520 *60DA6A416B07405DFB7531D7B8896CABA56DE6C0 Aoes3
929,703,521 *60DD2BA41A87D314464A71D17483576D304783EB AOEs6
929,703,522 *60D2A774F03AE66209C2A3E5112B090C81889EFE Ao/eV
929,703,523 *60D55FE414D3895521F09083E0B2D5DE7BF8D2B9 AOEVs
929,703,524 *60D3969F451024792C8C677E14F1C5736ABE8133 AoEVs
929,703,525 *60D32860F5E7A93DDD9F12BD80DDA6167A04AB79 A;!OF
929,703,526 *60DE5D262FA250D16683B7CA537513A2E5FA3136 A:OF%
929,703,527 *60D4240A34893A690A331DC4C155D8956A4CB256 A+oF
929,703,528 *60D8F4E37FC8A0C3219326A01F6A6E762980E5F8 A_&of
929,703,529 *60D532A77CC2BFC567A7A26F3AAB2F8AA1E7D092 A"o)f
929,703,530 *60D35D7BA1CF3B0A5F2DAE64A7E50D3E4CE1B1AC AOF7B
929,703,531 *60D494DBC0B1EEE401D8444D9B0F62CB926924BE AoFa:
929,703,532 *60D3E00AE9AA35D316A2E581ED3FC270624CD9F7 AoFDC
929,703,533 *60D09866AE20DBBBB8FB9A7C7E8F9F0EA10F9EA0 AOfg9
929,703,534 *60DDAC6D074523CE3DA3275AE14B11730DACA912 AOfi8
929,703,535 *60D52D9602B32AE2A34225F604385918E4DB64B5 AOfjB
929,703,536 *60DF31694B2D5FBBD87B79943271062192617E62 AOfN_
929,703,537 *60D1FAE4889377A4AAEBC04112CA15E2D06CC826 AofO=
929,703,538 *60DD8201F2493FF9FDF9E49368526842B2EC9E93 Aofpt
929,703,539 *60D2E6516E374395809FBE2EF10D0EC2BA8EFF7F AOFr9
929,703,540 *60D873149A1485F3635CAD3767DF2C6CB7ACAA1A aofriend1
929,703,541 *60D7EF73D9FF91B5A3B35DD7DA4090805CA56BAC AoFZf
929,703,542 *60DEE15E5C4CBEEE84537D557827633C13D1F553 A*OG
929,703,543 *60D872DE7DC9B112619349BA120287B8390EDA20 A_Og?
929,703,544 *60D5FA79869A49910319754E026AF546CD73F8A4 AO&g)
929,703,545 *60D605960BA2E40F8EFBF10496AEE36E0A7B0F6E AOg3T
929,703,546 *60D54B219B9E8BB6758057A833756D6C664C4DD8 Aog4Q
929,703,547 *60DEFADC16E379832B4649B4FF033FB9C307FC30 AO?gc
929,703,548 *60D943AE8EB311AAFC8713F3C45D44065134414C A#oGD
929,703,549 *60D9B3782ABA091DB9A70955A84A534A41B69913 AOG(f
929,703,550 *60DD3AD685157286541AB9C36A4E87F254A59BAD AOgFd
929,703,551 *60D5656202E2A60276B3920093FF8127AD2710E4 Aogig
929,703,552 *60DAA89543EC0A06016CFB89AFA6AE6C5612327B AOgNW
929,703,553 *60D5AD63D18DBB0568296D65935BC54A25F3C3EA A.oGO
929,703,554 *60DAC1364CC6914449AF76D96BC5B354028FACEB AogO4
929,703,555 *60D30A918A0F8A7294182492D7EED0133A234E8F AOgqa
929,703,556 *60DC21E3B0B7AF791494E5F1460DE93E4B8463AF [email protected]
929,703,557 *60D7651368427E51B22E7F5B5D8B8305FEBDFB96 Ao
929,703,558 *60D0080CB35CFD637B4C69162D81A9220DFFC066 AoGWZ
929,703,559 *60DC70E2195335E1CC3A7727ABBA2820BFC9AB80 AOH=!
929,703,560 *60DA02C2E6632A237C3A5CA2BF93A33DA3E20D02 AOHBu
929,703,561 *60DE220696D6E8D57CD964ADF7182C709E91550F A-Ohd
929,703,562 *60D9CFF7BA48FD36B2EAC880B8604ADD2CFEE029 AOHDIV
929,703,563 *60DA0D12AAEC5091479B1EE695F4F51A0AB329E3 A=OHN
929,703,564 *60DB7C6AE7F2729BE48417CD989F2D05337259DA AO-Ht
929,703,565 *60DED2F9DABBFFD39E669DF02A7122D3E87BA6DA [email protected]
929,703,566 *60D05AAD509304837100B4E2A5B4637A9047D20D A=oI;
929,703,567 *60DC2EC3645D13C4F4A6EE043C33B1CF2A326417 A:=oI
929,703,568 *60DBD1007B0C7BA0A793C619ADFB6FEC6A1DDEF5 A(o#I
929,703,569 *60DABA09FAC20158C1D1C4C56D9E3B701509DA94 Ao=i4
929,703,570 *60D8EFBB90C3FCA1793D8B012043B1C9BB6D8367 AO$i5
929,703,571 *60D83C0A3312DE037C1BBF293EB3B8FF20751E65 aoi9LI6M38x
929,703,572 *60D53B4C71C19E8263577B554A960A0F9D44D036 Ao!IB
929,703,573 *60DEB392154501B4E9352A040B2E512F7141E0C8 A+oIb
929,703,574 *60D4839A1619D6C60B895460F915D4A1094256FA Ao,IC
929,703,575 *60D4524FC4E60C0C08BE6E028B8CD04946C0D174 [email protected]
929,703,576 *60DAF0CAC2EFC79F20103B290EF6912C0E74DB3F aoifes741
929,703,577 *60DD091C9F58251738C4553549907CA2F51C76B0 [email protected]
929,703,578 *60D1BE81F9E9CDEC1B751644A26F4D41BFB15E13 AoIK3
929,703,579 *60DF7E355848DA14E35F7DD9E737A7CEDA787D27 AOIr8
929,703,580 *60D7A78204BFC3E742027B765DAC2B8AF04AE828 A/OIU
929,703,581 *60D40EAA47BBD1BC55184361BA7B18A06E9DF091 AoiuP
929,703,582 *60DEEBBF52B72A443E0EC1AF9146E32E5904F677 AoiVQ
929,703,583 *60D8599AFCE27964DEF80600F21681EA0C518406 AOiY4
929,703,584 *60DA58E748D4904274079FB60978B28D1F6A695F A_,Oj
929,703,585 *60D000676E38EF4D18C781917154FEA7217B15B4 AojC;
929,703,586 *60DD944E7C54D743488A3755C6955A8DFBA11408 AOj/E
929,703,587 *60DCDFABA11BF97BA86BCCFF096BA2143187EE82 AOj&L
929,703,588 *60D705D19D7A21A33C87D6CECFFE3032C6C27695 A&ojm
929,703,589 *60DB66D44879FB675CB5D9946E9C395037E9AA64 AOjp/
929,703,590 *60D971A32DDECF0109E4FA147D739A4A882E8B6C A(/oK
929,703,591 *60D0A6E2B4090D43075B9835601EC5C4381050C1 AO=kD
929,703,592 *60D6028990FC48CD5E83298B0D5E1FAD52F9208A Aok!E
929,703,593 *60D575DE32FE6823A2607FFF8A06C34E4429E9E8 AOk;m
929,703,594 *60D6CE473D7AE82ACD32EC888743CBAA1D23F749 Aokpi
929,703,595 *60D5C6F7BAC69A431D8F7FCBB19D19AB901A991E AoKr0
929,703,596 *60D5771596D315F5996B77E4F7EEF4E72490EC70 AOkSi
929,703,597 *60DB58412817598A95D80D03D59C75A7BEB7DD53 AokXC
929,703,598 *60DB6F3BC6DCB25C9E05EEEAF1781A307EDADC78 Aok"Z
929,703,599 *60D811E4C3047B0840454D18CF4ADD03974B9D50 A"Ol.
929,703,600 *60DC2C08C4067131501322CCB03CB9ED68514D64 AOL4F
929,703,601 *60D264D37B9E9D441A7E22683C14AA972035ADB6 AoL93
929,703,602 *60D7AFC9EEC154FD211896460B4A401EAE26AA6A AOLAVNOG
929,703,603 *60D27B658A20142BCC9F31092A357ED627E266A5 Aolinate9
929,703,604 *60DCA961D84D2238520E1B4EA8F6B143654A555D aolishit1234
929,703,605 *60DD5C9CE2DE470018C14D96CB4F3D2E4E255A52 AoLk7
929,703,606 *60DE002BE26664429CDA670BE9665CB778FB93C3 AOLKZ
929,703,607 *60DEE767F7A9950C8F9683B8C425A4BC92CE826F A=OLm
929,703,608 *60D898F14A5751DEDEE984608C01BB377BC9D0A1 AOL%U
929,703,609 *60DCBDFEF038490E8AF880AFB2080365FBF771F3 A!OLv
929,703,610 *60D4BB9AFE564C49C9801FA1D292AE003EA6563E AOlY:
929,703,611 *60D75F7BAFD1BC39800CFACE1DE15894DCFF682F AOm,=
929,703,612 *60D4DDDE5DDC20E903ADEA261FA5752C019AD74E A?o
929,703,613 *60DE6BE706937BB29C1D06B98BD3D96892186BE9 Aom.=
929,703,614 *60D24B300D82583CAED77D121826B83271B2139A Aom%b
929,703,615 *60D17DD679BD1D6EB57844571356139544F60CB5 AO.md
929,703,616 *60D5C75FF65A9AFCC664034BBE69019C486F9D4D Ao?mH
929,703,617 *60DB564A2BADAB7CE3E72CE8F5D4903A03E104D5 AoMNA
929,703,618 *60DE20D6AF4874DAE2678F1C0A5AA76925B21646 aomne
929,703,619 *60D61450A2EACD541704CACC0E0A6F6FDDA9A943 AOM,O
929,703,620 *60DBDAE88D384ADFADD726A34251A78D73383629 AOMR=
929,703,621 *60D03D8E1C0AC7A4AAC19D435082146F8373E29B [email protected]
929,703,622 *60DAF5804FC10F318F7EB0658A7E8E596517B26B A?;On
929,703,623 *60D479B636C858AEEC380CB003325D282A9669A5 A?on#
929,703,624 *60D5008A5AA57F39734352867F4641F313C0F98E Aon1(
929,703,625 *60D5BAB8F8529B471BAF9577DE2A52EAA3C20D7C A+ON1N9
929,703,626 *60DB155C6FF27FDDCE251A57637EBCD3F2967619 A#onD
929,703,627 *60DA480565C2BCA58220251378BC33FCF59DE585 aondray9
929,703,628 *60D3F4E4E573AF0CDF297C9C8165315187F8C52F AONESPAV50
929,703,629 *60D13BE00F008902C77601E918ACD89702C1847F AONjP
929,703,630 *60D6909A7BF4CCFE0EB5528C0EC00E233FE1B3F3 A:oNp
929,703,631 *60D77BB6135674F055B2A6B061975C6B5AA80C3F AONqL
929,703,632 *60D1ECA2D805C84EB480C280BE555B3B3F91546B AoNT7
929,703,633 *60DCE8D154B9C8A4761B72DB385211CE9CC40484 AOn%U
929,703,634 *60D70DF22676F3A9E537600BC5AA18310D52554C AoNWw
929,703,635 *60D9B1AE07C15E8A2BCD1DF11B52D3782E9B951E AoNXX
929,703,636 *60D22C105C1DE285D3C77A8FDE3B009A6F4198D4 aonyv
929,703,637 *60D42C929145E2524CAEEA73FEFEACD8B8FF2F18 AOO=#
929,703,638 *60D76275E6371BF23673D4B8A2E11F7AD4A779FC A_Oo;
929,703,639 *60D7B0FD9FD4FDE4A3B2EB6A429C5DD59FFD052E A/Oo/
929,703,640 *60D7EC4AE2B1D20F98AA535906B7AA5EBCC92B27 Ao-=O
929,703,641 *60D1D536AD55237EA1A47694990D9111BABEF76A AoOb7
929,703,642 *60DDF82E7F980338551951DEF979640F59AF9A89 AOOha
929,703,643 *60D4C63FF58D5CC3AF22536D4976BDD97283F84C AOOIB
929,703,644 *60D06D53C88C3531CC72F670710FFA5906776347 AO"oM
929,703,645 *60D9D7CE5C80B2D4DF7545A84B8A9916BFE85F69 Aoonf
929,703,646 *60D91134E95AD88F63CCD17329C3A8D656717DB3 AOO/s
929,703,647 *60D896C862757EC6C2E2F46E640B3CA914C67AD0 aooubudp123
929,703,648 *60DED731BA98C3E72B34EEFB6B2127B79E97A3FD AOOuW
929,703,649 *60DBC93F3528DA37FDB01984701338D57F28E6D8 AOoZY
929,703,650 *60D55697750B9C83FAAA0FEBA5D0FDAE790B02DA A?)OP
929,703,651 *60DDB3457AD556A6274EE647167064B3DC6C1E7F AO(+P
929,703,652 *60D35079A8B97A645E958CE629E846EAB5A50F20 AO"p/
929,703,653 *60D6C6B1AB15593439C005DEAF7F675777BBC63E A(o,p
929,703,654 *60D034CCE5CFF6728F66CD2363E220FF2093475B a?op
929,703,655 *60D98084622CE5D2A6291E3B7494E5C152C73FD7 AoPC9
929,703,656 *60DE3F9A121E7C9D05901AAF1389A34939AF0CBD AOPC.bbs
929,703,657 *60D355027C1DC99417AA3ABBB8EB6DAF175C9443 AoPe7
929,703,658 *60D31B512C4983ACA0997F3051039CB4AD82168D aopear
929,703,659 *60DB30B0C1396BBE79841003FB9C0C235B9AFB87 AoPEr
929,703,660 *60D313195F5153D4B629604178178A2C35B347B3 AoP.W
929,703,661 *60D92C5E78C4B026213B3A8D72D8D70A499D11AA A+opw
929,703,662 *60DAB24F5361742C5C709B822CC8BC1BC696AD62 Ao+Q-
929,703,663 *60DA8E0DA194E126FB3C3C1C43FAF4984FAA0715 a:oq
929,703,664 *60D0D2F2371AC79E5855BB0A6C7A0AA2649DB306 AOQB/
929,703,665 *60D50C4CB9CA6B4BD3F74E46EC884F9425B3B8AD AOQcm
929,703,666 *60D9EBECE3883D1E6C5F89C4BFF4556A5420878B Ao"qE
929,703,667 *60DD6A1628C491AA4139F7CA870797A4EBD7196D AoQE2
929,703,668 *60D3D93CFFB6AFC6AB1102D13C57367EEC78E72E AoQlt
929,703,669 *60DCBD540A66D46FA161A52DAFDA6B64BB0C9801 A"oQN
929,703,670 *60DEA4AA1CE53EDFC45A70F9BD2F53493567473B AOQOQ
929,703,671 *60DE3FE25EE751F46FDE80C6449287C7BBB9DB2C AOQOV
929,703,672 *60DCEDEBFAAF9B18245DBA6042C536C3BCCB277E A#OQZ
929,703,673 *60D7D9D1199D77DFD903F8E97CCBAF513F4966F2 A_OR!
929,703,674 *60D6902AE37792A9DAC4169409B7E6F393C27C63 AO"r
929,703,675 *60D92CAB34A9F1AE4248BB1AB3EAB23C8DBB5BFB Ao:%R
929,703,676 *60D22FCFC7F47A9C50C1E87BD51FA1409DE9AD2D A:Ora
929,703,677 *60D9253FC2F3AE77EFB6F95DC351DC96A152C0FA AoRcU
929,703,678 *60DB4DD6E82B7304037CB1197D93A19E8A5C455F AoRQh
929,703,679 *60D172AD2621E9DBF1B4E6A1DDE17D2BCA2F17B5 AOrs%
929,703,680 *60D88B827C2E16A7D2E458A874E7DAD197540858 AORTICOR
929,703,681 *60D74A330E2D3615F7662FCFF73405311FBC391F Aortnaved
929,703,682 *60D0A925329EDA56D2E42D3533CD286BCB1E1448 aortoclasis6
929,703,683 *60D608D5BE49B2F360F56C793B94B8E21DEBF3C2 A#os/
929,703,684 *60DCE90C75D427C515013AD70CA407D100F437EA Ao=;s
929,703,685 *60D2270AA70682ABF3C302A8B5E779E952AFA0E4 AOSc
929,703,686 *60D88FB4D9EA2436949192ED54E3CD99DAC5162C Ao,Sc
929,703,687 *60D5EEE5C07F3CBB75145491C8638F04F40D132B Ao?sh
929,703,688 *60D76C99E7B2B4A8771DD78D559249072C47FA45 AOsS2
929,703,689 *60DAD9B49BDA974FBA581259D0E1F71B7363BA9F Ao=SX
929,703,690 *60DFC889D2026FDBBBB5C48E77BCB65B25000DF0 Ao:sZ
929,703,691 *60D761C60AA45E27B195F9429701F6CBD8A95684 AOT$(
929,703,692 *60D0461B36CDC6AE3ECB4ADBB3830E6B240A5B0B A+o
929,703,693 *60DE3632BAEA909733AA3EA70B9F0C79E810C58E Ao
929,703,694 *60D9CDADA46FF1FD4C637C688A224999A82D888F aot71ac
929,703,695 *60DDCE718668A5B75AC76B133CEA0D8CA389FFA0 Aotabō
929,703,696 *60D9C6E99D463C7F8A7BBA250DE9808D8337F67E Aotiohsa1
929,703,697 *60D000615524CE4C74A33F1B5B9B3010ECAFD143 Aotiq
929,703,698 *60D99F9863804AB9884C80D52B8F8FB58E1C6BD9 AotOX
929,703,699 *60D82F756F16E66A5E08ACD9F2578911C10777C7 AOTQ-
929,703,700 *60D7125C2EE23230B8C505AFAA02FCCA940111B4 AOTTIOVO
929,703,701 *60DAFF75E99A015B59D31D869FD6C17531BAC6A8 [email protected]
929,703,702 *60D00D0F66DA3ED49E17F8ED74096E30A2C3DB37 AotvM
929,703,703 *60D509D2673FF320425599B572BFA0D0913817DC AoTvR
929,703,704 *60DF36D7A46EBC2AC0553DC8AACE0EC29ADD6F57 A,O?U
929,703,705 *60DC33EA897066497120AD6B6CFEA770DAC23151 A!=OU
929,703,706 *60D643D938F7A2DF447E3D750909BB1E8116DEC8 AOU-,
929,703,707 *60D0DEF963AF565F1AD95DEED15A8B54BA0A7D8B AoU0;
929,703,708 *60D7604E5E4FF1144B5399ECD281769FF0F44644 AOU2q
929,703,709 *60DDB21522B27C38E111806BB870395AB13FF618 AOU8!
929,703,710 *60DFF83AE6483B62A5FE4B9203C9E3BDA962FCF8 AoUav
929,703,711 *60D66CB05824BE6AE69B4F2BE72BA191DCEF295C AOucb
929,703,712 *60DEE569C30DB8A06E23D65D11073EFB648AADEA aoudouapache
929,703,713 *60D29B4B423D5CD8DAF83835BD2194589276A02B AO_UG
929,703,714 *60D8E2CDD0B394A86834E811A2F88B9EAB3856CB A/OUg
929,703,715 *60D431AFA880D4C993DBCAEB203D630913347D75 AoU_l
929,703,716 *60D256DE9308934E29190E30859535CF0961FA63 Ao=UM
929,703,717 *60D764E52C7C4C91B7A1E6855BB7F899036E8C91 AoUMY
929,703,718 *60D927FF7BAB64D538CDEDB52BFCED2445C4039A aounzerolando
929,703,719 *60DDCCF9C71575D04B6A66F5FD59FF4B1EA0BF82 Aoustienne
929,703,720 *60D1A33DB43B5247FA1F427E624FBC907971DD13 aoutj
929,703,721 *60D25581ACA44F1A725D3F94753DF0B877CD9582 A&Ov=
929,703,722 *60DF8ABB48375AF365C5DF7CD6902C69FC12C282 AOv?,
929,703,723 *60DD8079E794F627F2FBD53525E265F4487B9045 Ao=v$
929,703,724 *60DCBB2E9625CB1E4A69C335FB26FEA1104240BB A_ov1
929,703,725 *60DCCE1C6ADB19B82D43F1636C4CABA7618CCB52 AoV1j
929,703,726 *60D4847D815F32B1649FCC4602C6271861FFD3A2 AOV+5
929,703,727 *60D880B9AAB85B27F2702EB74A7181DB112EA3B1 Ao+V5
929,703,728 *60DA048A664046C59B4412F7E281E62000CD0365 AoV6g
929,703,729 *60DA5F9E5AA10F893E5FBF0134504E2CFEDA5ACF aovdberg
929,703,730 *60D0CED2D5D9A272BDE4932723B117C5BDDAEFE1 AOVId
929,703,731 *60DAE3367BB91646C999FF5F71E156C560B317FF A!OVm
929,703,732 *60D15D698D44EAE6D23A89C5F733676EA4E34292 AOVmC
929,703,733 *60D63CB902CE877E761E50BE7BDA4B55CF8400D7 Ao+vp
929,703,734 *60DB06EF0CBCA38CA7DBEC1654FFBE3677F78604 AOW
929,703,735 *60D24B718A1F18F434E2519A52EF79B5D1F1DA21 Ao=&W
929,703,736 *60D14E7DDA36B51959E2FFE1D103E8D60A38A4A1 Ao%/W
929,703,737 *60D1512FF354CEF1B80B5CBBFF3D2E6A54B89CE0 Ao#W0
929,703,738 *60D05BBD0E22EA609FCC0D519EB83218CF224B45 Ao_W7
929,703,739 *60DCEFFAE080C71D381872B195D913A08D715B15 AOwEH
929,703,740 *60D7618BE75CF4CFBC739AF114C51E6E283A09BE AOwens
929,703,741 *60DDC2E1E0DE1E781102B7E75AC4092957E6CDD2 AOwF2
929,703,742 *60D9808D0A4ABBED74D5BE23A86FD1E1F4A4E126 AowH4
929,703,743 *60DD1C7AA3087AAF42FB7F970CC0EFDD25934D32 A,owi
929,703,744 *60D5754A9735C2FD4302933393998DC276923A86 A-OWN
929,703,745 *60D28CCE9AAB4966163931ACAB3C1390DCCDA86D aowrp
929,703,746 *60DD494DF7B527C206F4EA6F1B769C61B9B8BEF3 AoWY7
929,703,747 *60D226D61B2EE9C670FEA8EDC09482363C9E570D A%o?X
929,703,748 *60D76F831288C7CFCB292B9EAD1F989B0081AED7 AOXo
929,703,749 *60D1CB13BE1F88A1E6DEC80127E29CA1C4868036 AO-Y
929,703,750 *60D6B43302BA34CD8A30EE1E750C52ADA1498FCE A:oY_
929,703,751 *60D75A7B6005405AD316796D96132E05899ABAA0 AO_Y7
929,703,752 *60D5225E6C36758525EE32F6EFCB65F7F2F59F72 AOYeR
929,703,753 *60D2F5216B97DD5C49CF0CC65C0BF20B15A7E867 AOYLj
929,703,754 *60D6D4A67FA8DA98BB1005E6EFED8F4DFF1AF44F AoYpX
929,703,755 *60DF9B434CEDCF2C22D5E74ACC1D86A97DFC6619 AOyr
929,703,756 *60D6DC7C4BAEE1680A776A6847AA360AB42804D7 AOYsL
929,703,757 *60DB17E6CCD17F9E6ED52998E357B4975F6B6CD0 AOZ#-
929,703,758 *60D88E6283DC77FFD9A0A0F1E52A10B871F77EB2 A$oZ-
929,703,759 *60D4807BC1FB2A8762A94816E1D0A92BFF669EB9 AoZ7U
929,703,760 *60D7E76A6C0D6540AD511B2BB352CAC999FB723A AOZSL
929,703,761 *60D2B638E393B3374E26526E289250C43FB32467 [email protected]
929,703,762 *60DB5361B20E8BEF6E84818A82E5E1A12B5148E3 A.
929,703,763 *60D6671C11A7E6ECDB22373D8C9845D97DF95570 A(P"
929,703,764 *60DD36BDA63EE6934899F35D4A318E6161C4CF35 A$$?P
929,703,765 *60DCF3EB04961854CF3272FE7085F8D1A84571FC A#_!P
929,703,766 *60D3F094E8BC9691D8C6142D01D85104CB6DADAB A#,;P
929,703,767 *60D625CA17767E5A88B07F51C53D9BA417A209BC A%"P_
929,703,768 *60DD504B70F89FEFC69A96F6F15988CC238E83AF A
929,703,769 *60DBF676D39A86BB651EAAA1D05FB48BB06EAD4B |{Ap+
929,703,770 *60DDA6B8D2E02BF6B16F27A75CB23F7566AA41AC A-p&
929,703,771 *60D3581297DD77B297170F4F90A20FA40D543194 A;p.&
929,703,772 *60D2092DA40A8F4BB7063497A976C53BD50EB016 A/;p?
929,703,773 *60D763747259C29893F630DC5027D07C7D32885C A.p$(
929,703,774 *60D621CE214E00D8FF88800BC9B37190BBDA6ABC A&:p?
929,703,775 *60D7D81ED79813B011250F5356156DDEC5FAC38F Ap./
929,703,776 *60D48EAAF51048F545270246CD03B896FBD1820C A
929,703,777 *60DE99FF764BDE158A6D402F769B9718F4DE3D47 AP05TAT!ZE
929,703,778 *60D0FFD930E5A64BEBC91908FB18741472EB45B7 AP?06
929,703,779 *60D0F795E304976D95AF07713579C14D5BF19171 Ap0d3mal
929,703,780 *60D94372E96C29AE73DA0FD7153B4D9B9E7BC174 Ap0-j
929,703,781 *60DAF58E41D17519C705896250846AEDF7EC2027 AP0rM
929,703,782 *60D2984BDBEDADA46823E6FBB50693322330688C AP1oG
929,703,783 *60D1C9F1C79C39E2D565C35DF1E61BDC61E25671 AP%1R
929,703,784 *60D8C8FE7C606B4E826CC66F40D01A3C5044AB70 AP"2)
929,703,785 *60DA70345577285062766A6885993B451A15A213 AP#2/
929,703,786 *60DAE6E6CBB0E88ABDEAD1B397CD137E37CA8625 ap2512
929,703,787 *60DF0A0332EC1E8FEE5F5D559D7792E69D9C178A A"P2V
929,703,788 *60D137E769B5B717274F6D7E91967F9DBC5A110C AP35b
929,703,789 *60DB670A88C583AF89FD582CB38D7781AB7AD433 AP3b
929,703,790 *60D9BB6D5D08D98D4F49F4AF9BE9C0D624889859 Ap3FV
929,703,791 *60D77331808494BE42E63FB1FCE0407596C1D47C Ap3=L
929,703,792 *60DF22AC7B9F1D600C269839202EAAE14FD823ED AP3QQ
929,703,793 *60D6A1FF46E84EF451BCDB8CA28F2E8A70547B57 ap3r+ur3
929,703,794 *60D74ABE706F752C619638AB289ABD11F040C94A Ap41U
929,703,795 *60D4910004B5424F186874530F2B464CB7964FC4 Ap4H+
929,703,796 *60DEA2A37A27A78CDDB5E3284AED7589A30600DF Ap4uH
929,703,797 *60D5497719EA658A21E6D7987CD831A314EEC8B9 Ap564
929,703,798 *60D0923580FBF8C3A2280C34B7E84E364DAEBFCF Ap5G;
929,703,799 *60DAE57B0BB67BFF7C7ACBEB3D2C068F781EC764 AP5t0
929,703,800 *60D30A5A1820056317372CF692773537CB7CE8D8 Ap5T9
929,703,801 *60D17EBEE00C112CD6768C2024D693506B166692 Ap:5u
929,703,802 *60D8EC59AFC5F4FFA335671F29CDA4E7DFE38E10 A?P6=
929,703,803 *60DD20A0942407975A67CB5B87C251BA36C8DDB4 A$P#6
929,703,804 *60D7DC0E493A597D1848C7E518AB07E600DE28EA ap6493675
929,703,805 *60D7838A92255EB817E1AD5E2EB50FA14617B34A AP6mN
929,703,806 *60D90177DADBB2640EFFDA342630CA2AE5136E76 A#p6N
929,703,807 *60D0902B41EB23C5BE4E77BC75A163719A7FB0E6 AP6Pc
929,703,808 *60D6BA921348A32DB185A2BDFCBC9A54747F922B A:P6R
929,703,809 *60DCB2F6C50D72311CB2011935BC243178EAA2EC AP)6s
929,703,810 *60D175B686599F89F24446E496B6C7A9F26CA6D4 AP6
929,703,811 *60D6FD5EA335EC0307D5F6C5233D2E1AF0C83483 Ap6vH
929,703,812 *60D0CEC312D73DD45985D18341FAE1A392149BC5 Ap7l/
929,703,813 *60D0C455150E12E59D692A982562292910F8C91A AP+7q
929,703,814 *60D4F02696F44E038F1EAF474BD0F0353174A268 Ap8)#
929,703,815 *60DF8BAF77D4FBB7C460C0CA43217E9D9C746200 Ap864
929,703,816 *60DF5A160A698761F4CF1D21B01EF414539E14C6 AP/8E
929,703,817 *60D26E42604CDA037E0E53852B196F0867C70228 A.p8m
929,703,818 *60DABD9491B25E8B254104E8BB5773497FA60B54 Ap8mT
929,703,819 *60D850ECAD7B1F0D9A4AD6A0B85ED31B72CABF7D A#P9,
929,703,820 *60DAA3CCBF55665FD915EE1D5FAFBC8C7DB4A549 AP94u
929,703,821 *60D052CA1B4D64864B3D489E65556E3C7B5BDAF2 AP9T;
929,703,822 *60D9CB50556933227DB5EB4E0EFD60C91C9B1BFB Ap9V1
929,703,823 *60DEAE4C62C170F8D035BB595D128F7B33B79701 AP-A?
929,703,824 *60D607A12081229DDDB60BD830EAAFAE5AFBCEDC AP.
929,703,825 *60D22F3F6C660507B63C17CB9C0096434280A991 ApA>
929,703,826 *60DF7B8536974F6075418EA51E34A633E57C26B2 APa0A
929,703,827 *60D349E17D872CCAFCA5F769EA65A31BA914C9D8 apa-119
929,703,828 *60D5D83B141E3284BFBB95E4C2B91A279A421C2D Ap-A7
929,703,829 *60D2F09CFDCF3F0393269EC5ADEC8CB092628259 aP.aa
929,703,830 *60DE7916B35ACF6F44357097DB475DEC022C13DE }Apaaa
929,703,831 *60DF705E436004C63ADA32318A879C6B86B503BF apache1911
929,703,832 *60DF29AC3FF4EDE8076B9CED9B9A132CE87A3A9D Apacheeddie
929,703,833 *60D0514C44DC228EFF348D398134A42AA48D0024 Apachethumper
929,703,834 *60DE71BE836B8C9D37E6E7581CE1ADA98C5A1BDC ApagaoFogo,Man
929,703,835 *60D9AE2A4B8F05C19158DDB2C61FC9FFC64AAD4C APAGOGICAL.
929,703,836 *60DF1F65611B21638FB12CE2C98A5C2BC7BB013C Apagonac6
929,703,837 *60DF36FD852FB4CC2640F7312C5D2204E241E51B APAH
929,703,838 *60D1C8B42D8DA159293952AD47DB822A47C264C7 apaikths
929,703,839 *60DAF8E260176AB00434783118D6098BCBC14B22 apaïsats
929,703,840 *60D04AFADBBC3BED0CDEED8460B22420FB445199 apalermado123
929,703,841 *60D65FBB6D19C10FC6278D7B6AA59BC00A525AA3 ApaM/
929,703,842 *60D48F22AD07B0C7F381493957141E53A3A6D546 apamanea
929,703,843 *60DC00BCC6BABA8177C8A7421FDB557D5DCE113D apamysava1234
929,703,844 *60D5F57105E8824ED450BCCFF35695971003B3B2 Apandor7
929,703,845 *60D2BCA3BF0C8D3E18FD6FB359618A117A8CD79A Apaniitau5
929,703,846 *60DD36727A5BEFD6407B2005D320A51B329BE50D aparafusas123
929,703,847 *60D4F714B1B838EA99BDE7D6FC5D256815BBB611 apardytoje
929,703,848 *60D1AACC2F1B57D7489DCEBB503661EF21E29868 Aparelham
929,703,849 *60D044E27C1E4A5FFA42A3D9668469D7CB7C11D5 aparentas1234
929,703,850 *60D0A4065068D6568AF695215C2A8889AAD45F68 Apartar7
929,703,851 *60D2C8FC54482CD9F0A90AF02E4EFFC489F4DA0C Apǎrutǎ
929,703,852 *60D03EBB937BA5DECB371A2F17C8927E464BD916 Aparvador6
929,703,853 *60DD0A02A4F6715FD7C2272FB7B1CE18A0CCA507 AparY
929,703,854 *60D5C815D68447C5C0E6856545DC2CA2532E96D5 APASARPATI
929,703,855 *60D4CBE11859594513DB4EB5FAD7D2D4EEA42A41 apasdinamo123
929,703,856 *60D673CDFBB8B8DC82E476AAF735E9DDF6A35139 apasotesing
929,703,857 *60DDF48DFE069FBADD1D39B51EE31DED282225F1 APaSV
929,703,858 *60D8A2461F94C3AFA0B9FF67BA848824A57508DB apàtico
929,703,859 *60DC12E92F564F691A152AC46AACDF4214B6FDF7 ApAV&
929,703,860 *60DB8C8CFD56C2126307D284FECD5094EF8AC78B Ap?av
929,703,861 *60D288D6D20752BCC7A462F20E315CA7A8B6AC81 apawamis7
929,703,862 *60D1A35BBC3435878BD66BE6CF84914FC2726AD0 APB
929,703,863 *60DDD443889FBAE991FEB672032A718EE4BDF727 Apb&g
929,703,864 *60D76EFA28671808E1B84EF518D25973C29CDF16 ApbGr
929,703,865 *60D05AD98CBC0D7C8C0E1B2ABCB6B52B4E59CA63 AP
929,703,866 *60DC98473C14F2F850948014AB6332FDF59FE250 Apb$t
929,703,867 *60D668566C11D34162EC74AF1107108E5FF530A4 APB$U
929,703,868 *60D2F195B9D4E7998D10A42A0B5C09665ECD7CEF ApBV$
929,703,869 *60D6819D5722F12B32C829884449F6AF4FEE64B5 Apc/(
929,703,870 *60DBCE29CE937AE86E700825D6B5E3FF1C2B6764 APC$2
929,703,871 *60D9D590B1CAC299CDBFCBA514FE4F4ECD9046C1 APc6E
929,703,872 *60D0C5BB05A992437DA08AE126CF863E6AF4F638 A:pC9
929,703,873 *60D347DACC7A9FA9A28EC2B2F67E06E9812B448F [email protected]
929,703,874 *60DF2F89A7A6FC4C8992D22CDB731C7E813D21E4 APcID
929,703,875 *60DF9CA1E599C2C3D0769E203B039AB8610CCA3C APcKp
929,703,876 *60DE6BEBEA20E5961D817B04031751BF6C06BBD3 Apcpo
929,703,877 *60D1F9122AE034D5FFBC9D74DF3CAA3504813E21 APcQh
929,703,878 *60D94F9D2B3AEA44A782C5048A0F1A738872278B Ap=cv
929,703,879 *60D2F6708438250750ED9BEE56E2DBE472AA78D3 [email protected]
929,703,880 *60DEF492012BFB6C7F41DDB213FAF338D7173BCB APcw3
929,703,881 *60DC2AD85C56B6C350DBAEC7D697C6530CF36A61 A.Pd;
929,703,882 *60D7C0BE3D3E51EF2445ACE4C6F740FA0E5E805B A-pD"
929,703,883 *60DF7A3DEEC05682C2AF188F2C74B183F89FF614 APd95
929,703,884 *60D97E42853DDB9EEB9763F8EAE7800C99662121 APD#d
929,703,885 *60DAC7C6AFDF1243D744F7998CB7B684BB81CBE3 APDdb
929,703,886 *60DE8C30B03523F06C8A50214EC51A6632128A0A ApDf5
929,703,887 *60DA94219F3C765619948224C94CF48AED401D4E APdLq
929,703,888 *60D5AE342AE18022DD78485226C3224605A99488 APd
929,703,889 *60D6920802D969EFEF59E235EE0D835D8EC46C26 ApdV?
929,703,890 *60DADD6732C092669FA067A7C9E05E9964FB03CE AP$dY
929,703,891 *60DF05D2084B35CE7D766B8074BC3C6C9648BA0D A/pE-
929,703,892 *60D46E94EA4A603D6A07A8ED9A6F4C3BBC527A0F APE2009
929,703,893 *60DE3719AA39DCCA53D7153E1270B8826B2696A3 ape7777
929,703,894 *60D86964162ED3C32CC1E057E8E52C7EA5E74796 ApeBG
929,703,895 *60DAB8B94CF2DC08B7EE48FB20A7FEA2EBCCC245 apedrarteias123
929,703,896 *60D6CE0728DC50F5F4C4601E953D9EF85F5C4075 APeFp
929,703,897 *60D1758E696A0FC0775DF0DCAA8E196C4D963DD8 Ape?G
929,703,898 *60D5E6E765C49C653326D388D93D48529416C969 Apegaresa0
929,703,899 *60D9078B5A89B1C70C504256AAC7125487F3EDE3 APEKOP2
929,703,900 *60D4ADC4F1A8A0504E469552A5A191D389D964B5 Apekoppes
929,703,901 *60D2B85C0A22D2644E0EB3558833A456A3B9D948 apekriqh
929,703,902 *60D67CADF811EB6D88AF32438D7C531C55AAF31A apelant6
929,703,903 *60D0625D5FB56BEF3FD84B1F6BEB306D4E16BF03 Apelaramos
929,703,904 *60D2290D3054FDCFE031333F2A3A05CECBDB8455 APEN?
929,703,905 *60D473784C5D08904F87A6AD1EC79137CA63EC2D apeneme7
929,703,906 *60DC925FDEF4D08B1B03C345BDF8D3FD745BE109 Apennine mountains
929,703,907 *60D848AE691514CC870E3100941EC2567AE0BBDE apercevra4
929,703,908 *60D8FC5C00EB23DDF9DB639F0EFB91189E522207 aperfilharnos1amos
929,703,909 *60D5B20A210CDFC9DD8C204415570A55EDCA5305 Aperitta4
929,703,910 *60D306C9B1EA38D3E05A40BEC820710F9B67A20F Aperots8
929,703,911 *60DCA63A7ED6F857A4682090FF7ECF25D8EF0069 apesar de voce
929,703,912 *60D35F56CD577330EA553E925D801C0AE8BE2B02 ApE+T
929,703,913 *60D74829BB21FD809D2FA76AC39E9A0E185303A1 apetlock123
929,703,914 *60DA233FC86EE2B1080182676B40FD36CEDDFC9A apetyxe0
929,703,915 *60D74DD7489535D355A6FA3BA445EE1B38D65006 Apeuttis9
929,703,916 *60D2FD02B6B3B264930ECDB4651FCC3110CBBB33 Ap_EX
929,703,917 *60DAA8BB59E35C51A2328B7B664C90390A63D210 [email protected]
929,703,918 *60D0CA00A9FE9E57E4BD9E7BC19F256317BB4E76 Apezuares
929,703,919 *60D8D3FAA51C1EDF8ECBFE97C896E1AD38742A40 +apezz1no
929,703,920 *60DD13380C5AAC5DC1B64BFE85281A88369DA794 Apezzino6
929,703,921 *60D09AA17BDFF3D3B86CDA718560E72BB4D5AEC9 A(pF_
929,703,922 *60D6488A2DB67F0AB5335F3C55E10C0A39F75AB8 Apf#&
929,703,923 *60D03CEC238041766207C13D7D5C898B29B29D48 APF2b
929,703,924 *60D0CD267980040BA62B9F161E65F19846CA48F1 ApF7X
929,703,925 *60DF1FD99BDDBE02DAB3F51BB346B41AB1D1A756 APf&8
929,703,926 *60D95C8AAE45F24F6703AE871740BCE3CFFD6A43 A!Pfh
929,703,927 *60D2FCD2D4633320C7DFA968D9F3DF7AA49A475E ApF!m
929,703,928 *60DE76A85A788DD1DBEE4FF1F96AFD2167546E26 A?Pg:
929,703,929 *60D00943E57F2D6A5ADA7644E69414FC7B65DA39 A$P&g
929,703,930 *60DA4BFD6A55B1E36FA8B4DC3FC5CBEACB02D5A5 A&Pg)
929,703,931 *60D13B18480948974EB1D21D12BFD7D9D82D2330 Ap_G!
929,703,932 *60DAFEEF57FFC502858688C8AFD41A0AB5EEDE56 A
929,703,933 *60D495FD08A8038FA9516AD9A432085DDAF06915 Apg6O
929,703,934 *60DE872D982411BDE58F6385B7367F4939D174E8 AP&gE
929,703,935 *60D06DAEEADDBC03BA7D0F468DE0CA0165FBDBD4 APGħ
929,703,936 *60DB91A324F067D3005596B455306DCEA171D1B8 APGHj
929,703,937 *60DB5D789D6003ECCA57C6551874376F4475821D Apg(k
929,703,938 *60D3B2447E2A053DC6908A6924060FEFCEB08292 ApGLq
929,703,939 *60DEF211745E227D5D5F9C928CDDFF911C0C1CD1 ApgLR
929,703,940 *60DEBDD1F85F9BB60E818323D9059B882EBD72C6 APGm/
929,703,941 *60DDBC2E11961313840739DC3B69BC7B07F66D90 A+pgP
929,703,942 *60D3725BF9146F0E3C828F4C6161CBB929ED6297 Ap)GT
929,703,943 *60DCCFB00853E9AAAD6470422F98D6D11209A453 ApgwA
929,703,944 *60D79A5246C8A48E0630C917FEF967CA144F9060 apg网站中的假红树科
929,703,945 *60D0BA2AD45092C75F7A21408040BD2499A0A376 Aph))
929,703,946 *60DC16AB55CE2CAC7F318123C846E306A5091733 APH4,
929,703,947 *60D75A120D5E57AFF21B961E63D83535D4CBBCF0 APh4e
929,703,948 *60D63B95587FE1A9FA7304CA21DFBF2166DAFA58 Aph8Q
929,703,949 *60D697E2F4C465EDF46B3FF72D3ED2907D5FBB68 Ap/HA
929,703,950 *60D54072E11B130F59CBDAFB5807C7C20FC7F0A8 aphantom5
929,703,951 *60D01D4DB773AAEB4254BD3481A9AFBDC06702C6 aphapl
929,703,952 *60DD7C848B127F58712D5C63B0491A5CDCDD1E1E APhCB
929,703,953 *60D83A62547A120254AB844314B483C1B5C82857 ApH/D
929,703,954 *60DFF191FE535CF48F6665B0E94A4E19DEF9C561 [email protected]
929,703,955 *60D5AA2205A6C37D0EC0C6CA198C51F4499B083B Aphesises1
929,703,956 *60DD8B9510406C94794DFFF5A5D4792148F7D6AF Aphorismen—
929,703,957 *60D472CB52B3992C2970BCB6676CAC59254C5E34 Aphrogeneia.
929,703,958 *60DA2BE8120CBCD42BE8FAEA0C0D238C97B572B6 a-phrygian in octaves
929,703,959 *60DCB7A63E5CCE4500D04D77FF177D878C37D469 ApiBb
929,703,960 *60D5CEE3602746F909F719A1184154371C62573C APIC’i
929,703,961 *60DB78F8E3D94940B025CD28EDEF3E8D47549DE1 APiCS
929,703,962 *60D3C46233A48E846569830DA104A9A557C601A5 apiedaram1234
929,703,963 *60DE3821193541A99239E6CEAE7210EE7510E713 Apierend0
929,703,964 *60D844A9170AF2894B493397810E77659BCB4B4E [email protected]
929,703,965 *60D6EA24D67CA39AB0A10218FB57AB69BCF9756D Apiflabellum
929,703,966 *60DBAF295BD3DD3961270D9BB352D86B39243127 [email protected]
929,703,967 *60D20A929A4948C0B038FAC2A0D0A490F0A86E25 apilary8
929,703,968 *60D3F0DA8D35E69D61BCDA2D3A46D97551F72092 apilhariam123
929,703,969 *60DDA423F46EC7FCA6B9F90DAB181AAB9CAB6975 ApIM#
929,703,970 *60D9DE8FFEFA72C73F8C5B248B294E3FBB798EB3 [email protected]
929,703,971 *60D12D96A9F97D8D170051F6F6945FD323B4F82D Apiojareses
929,703,972 *60DFC7D79B753FD916BC64EA196ED782EE0FFF4D ApIqI
929,703,973 *60D2C66A6638FDD2857275BC594C8BCE443478BE apirakuos
929,703,974 *60D9250A542108CA77951A27FA8EC64B0FD75D1C A(PIs
929,703,975 *60D9BA15883779C238F167D768E5292EC40D6D74 apitianpu
929,703,976 *60DEAFCE29168EB8A639D7643303899BEC70670D Apivori7
929,703,977 *60DD0B1B8446E431C19B881BEDF1D21ADBE849B1 A)p_j
929,703,978 *60DF88D0C0416D87B934DF4BAC6116CF66946452 A#p"j
929,703,979 *60DC64628F71A77A1A4758B2DEBD17992B32BBF7 Ap-j
929,703,980 *60DFBD48AD8F6A2D2C9716C627249684C162F0EF APj0
929,703,981 *60D747F9F05467B36D3D191CDBBCFEBE0D50AD18 AP$jd
929,703,982 *60D5447860B5124CDD89164C447410974590582D ApjI)
929,703,983 *60DCF4AE98F2A8AA5B72A67B110B69E5D38AAF6D Ap%jj
929,703,984 *60DD3EC8E652FFDC4100201A17B7921B39C5F563 A-pjK
929,703,985 *60DB45CCC7EB1141D8E159343605B4829834AE74 ApjMn
929,703,986 *60D64C7B7BF0A2B22835A8FCD0DBA07786F429CD A$pk/
929,703,987 *60DCFD5414BB26560C3A1AF7DE55D3B437A73433 APk6Y
929,703,988 *60DBFDBBEF984601B279ACFA2CD0CAB666E3D7B1 APkAR
929,703,989 *60D9E440ACBF7725C3875A2C84F0C608D6B1BAB0 APKC
929,703,990 *60DB2CCC2F98D9E870A10C1782EB979393CB555D APkcL
929,703,991 *60D368EE7018FE1A81FF26C4F98A164A9C2DDFF9 Apk+e
929,703,992 *60DDD7513929C50C0B71C7670AE44097A65CFDF7 [email protected]
929,703,993 *60DF2D1314BA59B85BF99867EEEEB10401ABA144 [email protected]
929,703,994 *60D98977A7EB8524426EE42F4720190AA02D7724 ApK!V
929,703,995 *60D9D8EB69C9675F3D5BB3EEBD918278AFAF5CEC APKZ6
929,703,996 *60DDE830B8F73D684A73F42DDDC2264C9DBFC4A1 A#P?L
929,703,997 *60D22D6EE7D08794BF880BBF77F93483C248FA7C A$%pL
929,703,998 *60D14159D464EFB457DC2A18316043EBF4F985A8 ApL0t
929,703,999 *60D69A3D930F158B2D7CD848D17CD0F97060A7FB ApL3p
929,704,000 *60DE664D87AC0E8D391E8531331B38441A948BF4 A plague... on both... your houses...
929,704,001 *60D577463C5DD1EFF49677F496FF7226EC480ECE aplanare3
929,704,002 *60DE34A510A7FBD17C368F81EF338A2D844C1AFC [email protected]
929,704,003 *60D0A9A57AEF7478E668C71F884EB1BE87822501 aplbark5
929,704,004 *60D7F2F8484FD4431526D0025ED5F2C7D236DAFE APlEi
929,704,005 *60DAAF2A0F610BA2B47F750A7DA1FC4F494F6349 APLI0
929,704,006 *60D222819852791DB70572654552280E0106D0E0 apliersi
929,704,007 *60D759ABCB3D9C7EAB4937C9B56C208CA4BBFF13 APLODONTA
929,704,008 *60D7101AEC35319AAE7643F620F03EDE72F7619F Aploika8
929,704,009 *60DEF161C0B10D9026656DBB7AE6E5A5A09D53DD aploikaed
929,704,010 *60D10C814B24F34B24209A59CD950028A31A0F2C aplombassiez
929,704,011 *60DB1C401385BBA6BFA8EF40C911133BC3AB4426 Aplonda
929,704,012 *60D42246E2230B3706C76F64BEA030EC1EA23B91 aplsh
929,704,013 *60DC29C8C97C4A238AF2D22089E5158A29DE1848 AP+LU
929,704,014 *60DFA53EE53C6E78B84649FA2EBF5F742D0F5681 [email protected]
929,704,015 *60D9DDA9047BBACA022915DBB08A60680ACD2E7E APLvn
929,704,016 *60D3415A10E1154A6EDDD5E2AAAB68E6A0F4C14E APLwA
929,704,017 *60DCE824877DC1EF51AF02AE09EB123677648C33 AplYH
929,704,018 *60DDD3EE9C1CFCF46AEE2DBC47688DD3715EA6ED APLZ%
929,704,019 *60D8A4497B96A4DCA32EBF28529CA56D30AAC262 A-P$M
929,704,020 *60D5C034742D7652E82098A0E84783FDEFC23E2D A)"PM
929,704,021 *60D85B1337AC37A3AE93D0485CB4A8E419092CAE APM_%
929,704,022 *60DDBE28A68A780093DB6292456A6EC6060A275E A$:Pm
929,704,023 *60DC8DB6DE1E65C2800D5A2FB11E4A188360B5D8 A&;pM
929,704,024 *60D05D4D431FE55440F63E2B522CD9D9356805A7 ApM".
929,704,025 *60D735D2BA9B278E966B5CA670D75F62AF48870D A
929,704,026 *60DDDB3019EB4DC0E572705590A2C3F1A06E74ED apm3792
929,704,027 *60DD70CAC34327EC326C5D38C4E7303480742E2A A_PMC
929,704,028 *60D2FD97B81BAC5C44C2BDBC86C4D403E728F577 APmc8
929,704,029 *60D69E72A3247412E4159446824D77DB345D8C30 AP$MD
929,704,030 *60D7EF2FFD0C9F8972CD1ABF73A45196821B8ADB ApmEe
929,704,031 *60D26D8A6C4067C7842E4E7335448ABA1EF41471 AP$mI
929,704,032 *60DBADCB82C494C429B5BBF4C20190F890DAC180 AP:mi
929,704,033 *60DD1DD92B5B216072F561663498035E744F4F97 ApmQ=
929,704,034 *60DF33FFB7C71772862770E3E90025474241E344 APN!)
929,704,035 *60D69281724F82A26CA21370560CD6E745421E3C AP/n$
929,704,036 *60D60F601FEF05CEECBEC05DF9C7A21F50484C0A A"p+n
929,704,037 *60D4F13BC58668F1D07C463BAD8FC97A93C2A093 APndc
929,704,038 *60D997A671EBE9649159757E39A1D5D719765E3B Apnesrob7
929,704,039 *60DBF0774D8C1FDE486F1A765FCB2ED5A61C7D39 Ap
929,704,040 *60D211E5A83FCBDC8E7FCD3F928E292604814A29 åpningsshow
929,704,041 *60D0F51E95CBA9734313A9980062CD5B1BB90E9F Apnisath1
929,704,042 *60D7743B3DA8785704DD95678A807EF566388601 apnln
929,704,043 *60DFA375E932788D83EC527CB7A8C81E5AC51120 ApNmE
929,704,044 *60D549DB3EF3BC8E39FE3A96AA18AD5EDFE3A618 ApnOW
929,704,045 *60D661DA3671F5AEF077DC35AEBC3094697EC38C A-pnq
929,704,046 *60D444AFB8512F587D4F42655A6704DA24C77916 APnRN
929,704,047 *60D2EB9BB4AD03C2F0DB5C548F1622C426C4A6A1 Ap
929,704,048 *60D3B5A7CFFC362DFD79CCFADFA0B90BA93B17FC ApNSS
929,704,049 *60DB5B100EF879C4CE2E1BD07F052F984E1FBD62 APN&T
929,704,050 *60D05BC7E71AF359F4A11CD1297FE2039D254948 ApNUg
929,704,051 *60DE43FE26E71F04894E5058C49C3208E9BB8BD1 A%po/
929,704,052 *60D34641E9852374267A6B5BBDE6C8FBA6AB7878 APO1OG!$T$
929,704,053 *60DF26B8678CEE08B6CF5FA2728D4FF13D12D032 Apo2d
929,704,054 *60DEE74C2BE1F03D8226AECA0D8DCBCA1B6F901B A_pO5
929,704,055 *60DABCC09340524872F98B001DBA1125713A3E17 A%pO5
929,704,056 *60DD94D361879B60E87261C8BE092CD16F4CF720 AP(ob
929,704,057 *60DCEEF82A0BC3441113645DA81218AB4B5C6100 apocalypse-fearing
929,704,058 *60DA2CA42CDEEC749A78445E07B72E84C4F2086B Apocara9
929,704,059 *60D2EE8554E9045D20BB1E9AF0C0A9F89F35AE73 Apodiformed
929,704,060 *60DD49C8ADBF155B182DA6335617A5E79241EA25 Apodo8entos
929,704,061 *60DC6BD63276818E03071D2C545E9BC29A31599A A"Poe
929,704,062 *60D675A8F444BA5D660C8CC89591A3EEDE4A6F4F a poem in slow motion
929,704,063 *60DDAFEBD257A9B3996CE51C4DCE6B069B32445B APoemofStars/
929,704,064 *60D1C9CDDB7F12580CC017471E5D614FB172DE92 apofrada0
929,704,065 *60DDDC4C1A83D3ECB0CE4A4EDA133E8438DE3261 apoiseapoise
929,704,066 *60D6FD1CF9192BBF694B5BE462CBAD35B6B63F41 Apokalypte
929,704,067 *60D6BC180D5324E595D7B10BDC440FBFF6BC54B4 APOKLEISTIKOS
929,704,068 *60DDF5D8997BC1EB51C3A60E9DDE7EA027C99667 apolarity2
929,704,069 *60DB531560D39AFA2F130366210BE432380D8DBA Apollo13gabriell
929,704,070 *60D4192B74422C33929272051C7D001C3B74693E APOLLO-CPUS
929,704,071 *60D96914BC9CB7B41CE32C7B91B4F19A6C15D79A Apollohanson
929,704,072 *60D39D23104019B71D3C3F2661E3A4D5A6C37EB9 Apollwn0
929,704,073 *60D7F01E4E8C09FDB7296364BC1AF428518CFDBB APOLLYONIST
929,704,074 *60D348CDE989F0E9047B9BC7F3B418FBFB56253C Apolonske
929,704,075 *60D24FDC2D78558057276B11FFD0785830CE71D7 Aponeurotome6
929,704,076 *60D083D0AC2F1DE09B7DADE52F79FF1860C8BA6D apontai1234
929,704,077 *60D7CAE4D5535D785F89E7BDD8A76B430C274712 Apo!O
929,704,078 *60D51ACAA8C19B7A4F27F143A1D4FD5ACA2AD00F ApOP.
929,704,079 *60D210EA5BCE5E92750C7B0EEF5EA24574C7750D Apop13cti
929,704,080 *60D08F451EF3D0F934C0850B5C659A0E38CBC93B apopapop4
929,704,081 *60D68251A7A43DCE11BD2B4FED0C5DF6A6A71C57 Apoplanei2
929,704,082 *60DC6BF278262EF3143EAA89F5D798EE50B8DB4D apopyle1234
929,704,083 *60D37E90968DCBB8C3E964C749939871C19543DB apoquentlo1amos
929,704,084 *60DCBB901D4A5465BE6803C64E135A984AFF057A aporodon
929,704,085 *60D1EF0F5673AAC1927FA0CB462E568F9EC81E96 A-PORTABLE-SOLAR-POWERED-FRIDGE-FOR-THE-DEVELOPING-WORLD
929,704,086 *60DFB6180479D3FDB6459A5AB9F66408D06B3657 aportugueso123
929,704,087 *60D3761D18DB8575BB70A3FBC3F0E86511D082C7 aposetud
929,704,088 *60D6D6A8A5EB70757D3478EF53614E452BD37A45 Aposfragish
929,704,089 *60DDBFB5C1266A8E26E7753BCF565768D4C93DFB APOSTATES7
929,704,090 *60D724F620AD7ED19673D6D82986CA9E863F31F5 «apóstoles
929,704,091 *60DBE66A3997433BEC7346542885C1442BDEFF72 APOTELWN
929,704,092 *60D4B1339C0FD16DE0B086A7DCD5A9A41B0A3F7F apothegmaticaL
929,704,093 *60DF3A2837B4C623620640168B6745B1C042D373 Apotheus9
929,704,094 *60D40AF17D7B9784720297C73EFD62DC0D1AE159 Apothtegme
929,704,095 *60DC84DE638E35C8F2C0A7A88C8F51AAE7E37CF2 APOuh
929,704,096 *60DD2B044FEE2B5D0557F1811A7602D7C877C3AF Apoysas0
929,704,097 *60D4CE9A6FE2A2C24F531E79D2F992937D4DDDD2 AP.$P
929,704,098 *60D27D9E2DCF8189CB9FD758F988CF5278810780 App0in73r$
929,704,099 *60D65DF4CFF3E84010460A28BF0881653AB32090 app13 but
929,704,100 *60D33E56BA8560DF950F7665B09422D03A3987AF App3ndica
929,704,101 *60D51F9818B2D93BA686DFB5BE8D37CDF247FC62 APPAGARE
929,704,102 *60DAC35D7E90EF312A85F63F49BB150BB43ED370 APPALLINGLY AH0 P AO1 L IH0 NG L IY0
929,704,103 *60D61C2EDBD08A382A8E7BBF9B7423961219C585 [email protected]
929,704,104 *60DB7C5858E0B8238CD1E5649A82060AB4BDE6D0 appannorno
929,704,105 *60DEF960167288876ADAB11F8FB0BAED07BEF45E apparaated
929,704,106 *60DC010F7CA340557798E1B3905FF5A9B53898A2 apparaisse9
929,704,107 *60D491B9E0FA602FD3B7C1C6A46E5D828637AA42 apparamyeon
929,704,108 *60D1DD3254750885094C6318745504C4F887A253 apparatusbrodick
929,704,109 *60DFDE8DCE2EDD6893CA4B445A616C337B3BC0DB apparciate
929,704,110 *60D586ADFED7D6EADFCDD36910E517F8F8652D05 APPARIA7
929,704,111 *60D1199FB7520772194C64E669C5FDF98AC9CF0D appariiez1234
929,704,112 *60D1BB1E3AF291D22EB49B9FE938D4697671864A APPARIRA0
929,704,113 *60D4C2A4EB3E483EFCC1CADD46D37BA34A1602A0 Appauls2
929,704,114 *60D8F390B92C8ACBED4789F196026B1143D9A226 Ap=pC
929,704,115 *60DABD836B57011C0CB50EF7C518D4DDA690F8D7 appe11a5te
929,704,116 *60D4573C24A55ABF6EDC674712E837AADE520FF0 appearance-in-december
929,704,117 *60D1D78EB787F553356E23339D9F176DD71BABF7 appearanceswins
929,704,118 *60DE34674A80E0D02AFFE1F5F21E2027A3EAC853 Appelbei
929,704,119 *60DCEF213CC1364765B1FC0933FA37E17F3D5F05 Appelions2
929,704,120 *60D96BAA033C789CC3616E5230C64CC366F9391C APPELRET2
929,704,121 *60DA5C741506FDD27D33480194B2A90F4D670464 Appendiceálnej
929,704,122 *60DD7033032FEACFA7BB0A7CFDED2519CABAD345 appendicectasised
929,704,123 *60DBAE8550FA872A36C5A6084FA05140EE2EEAD3 Appends9
929,704,124 *60DB9B11A146FB12E65E7526E34561687A205211 [email protected]
929,704,125 *60DFE173EBF7F3A2B49382C83143447A0C21C739 APPERCEIVE6
929,704,126 *60D35C7F65D778DE229C542936EF5C1C0C394B11 appetenci
929,704,127 *60D578374879439623C5EFAFED582F99FECE406A APPÉTITIVE
929,704,128 *60DAA7D8504B6A81D86E84F7E837A5EB593D1608 appetitz
929,704,129 *60DCF2E8C0592A7395DFC1BC32BA89D682E45F02 APPETIZER(2003年9月、アクアハウス)
929,704,130 *60D553BCAC2FB5995E4272CA8FCCB2AD7464BC82 appianino?
929,704,131 *60DE6C8291E8974B52AB8A5D872D97904CC1744C appirga8
929,704,132 *60D0F1E2F5CF15C1DC38171E50EAC82D7D489D35 Appl1ca70r5
929,704,133 *60D064EE7EEB3B4C11860716078B6970F1BD3F5C APPLAUDIRAI.
929,704,134 *60D85E83686F0B2D482E4E26291A2E74922986FE applaudis1234
929,704,135 *60D487360BF3244F846D3CAB6E6EE6B7EE95933A Apple1ghost
929,704,136 *60DF525014EDAB4652C40F08DC1A72F461240DB1 Apple1kitten12
929,704,137 *60D1EB1DC71F79CC9CFD9431458A9F3B78169DFC [email protected]
929,704,138 *60D7664BE7A20284CAA672A7D497790B9BFA880B applecrownpowercap
929,704,139 *60DEB76CD32C3D1DCE40AC395E587E4C8BF49240 APPLEDOE90
929,704,140 *60D8610EDF410ABB21807765C06EB219A28ED5E0 Appledooming
929,704,141 *60D95B5B4ED603C31DC6356E09598CDC54992B43 APPLEFAT
929,704,142 *60D2543EB84D92C747AF144D6CABE96B7D1FF1F5 Applehell
929,704,143 *60DF26314946360523720D84EB3B5593A046F50D APPLEHERBERT
929,704,144 *60D5A32F05408576CD92B86F1F418026A0DE66A6 applejacks9
929,704,145 *60DC60505A0F26FA36AA290017506867CA105CA5 [email protected]
929,704,146 *60D37C05DAF3DE6FD4D0019B30191D989F315CAD APPLEMITCHELL
929,704,147 *60D09A8EB0E1B3ED741071DED56B893F0AD47246 Applenutsing
929,704,148 *60DFB1C7216291DEEF55B6E3FD2127F427C11BE1 appler1
929,704,149 *60DD5583E62E66A336B4F750336BB9F3CA2073E5 applesk2
929,704,150 *60DA39D0393BDCF30264246E8BDBD7FA9DE16474 applesnitss
929,704,151 *60D6F342B437044D5199D7DF5902790E1BC5E1BE apple-something
929,704,152 *60DA0594F36C41EC7D9269A33956A455E51BB069 Applevan4
929,704,153 *60D900FEF73F468CD9B541DB4A8A61F7D375907C Applewilly
929,704,154 *60D00DF3E31E563C55CDB78EEA9758DBE614234F [email protected]
929,704,155 *60D3DBE4CBA3122329A1AD8399BC55DB260F00DC applianceinfobox
929,704,156 *60D26F9A1D2C0105A50427B2710EE299F588A996 APPLICABILI+IE$
929,704,157 *60D5152F70E320E2C90A001571993C706BCE5BC8 application/rex+xmlB
929,704,158 *60D6B0099FEF72225F61F2AAAD9EF7DA71D132FC applications.bcripst
929,704,159 *60D7B7CEA29B5472F3A9EA7B382F78844D66D529 Appliquo1
929,704,160 *60D2562DB644F6C12835661FBE8E90E47C24C130 apply...it
929,704,161 *60D3DDE8C8E6C395910A16981BA7DD9BE86F3607 appo11vely
929,704,162 *60D60F3ADEFA25C57B7BA2A77A5D65CF6ECA53E2 appointeras?
929,704,163 *60D631A0839665C9DED4EC0046F08FE98A0C74B9 APPoloNia
929,704,164 *60DCBFA8AF0E21691D68B226F60A7A1ED3009DB9 apposerions5
929,704,165 *60DEDEB31A35DB2F576C5FFAA39735A638EB865A APPR0PRIA73N3$$
929,704,166 *60D33B75F745833C113C0E0C4648024D2F4E5C6A Appr3c1a+1on$
929,704,167 *60D254F216FED7822CD219981B7CFC8B0336100C appreciated.jldolph
929,704,168 *60DC430C998CC1BEB0434AFC3368515DBCC26743 Apprecieriez9
929,704,169 *60DD2E4475EADD2E3408907F42F1DC73C4A025A2 appreciluv
929,704,170 *60DEC971485465A49CE529553D6FE4D13CB9D568 APPREHENDEE9
929,704,171 *60D605E3D97451CAD4686463495C30F4AD4709A7 “APPROACH
929,704,172 *60D62E113DC0E155780B530073792CAE55C9A97E approach1ess
929,704,173 *60D1183BFB77DF88967F88AAA8A20B7AE7468E73 approbaS
929,704,174 *60D75C0487EEC07D02439C8C9AF77A6FAAEEAA52 appropr1aene55
929,704,175 *60DAB68A7122E21E10C22384CB2F3546EF7362F0 [email protected]
929,704,176 *60DACCE234A9F81A93EDBB2C0407C06B46D478B4 AP;PS
929,704,177 *60DF7F437380F995643E87C78578F800DABCF723 APPs3
929,704,178 *60DEC0B7478C32B08F66F6ED163BBDCB0580026C appsofted
929,704,179 *60DC502B33D0BFDA666B2F90EC4706DDCA085BEC Apptrent
929,704,180 *60DCA85DC2E36EC4D94EC644452D9B7AA1B0CCBF APp)u
929,704,181 *60DEFE9B1C6663DF6940DE5A103F1B8BEC9109AF appulse5
929,704,182 *60D21DB2CB2DA65D3169CD52578D35C2205CB4D8 Appulsi2
929,704,183 *60D56C9933A42F995DE5049ABF2CCE52C3520A56 appuntiate2
929,704,184 *60D5DB7A13219F968FFEE567D34B75A6DCC29A66 appuravamo3
929,704,185 *60DF319A005683269B2AFC1DA2C78E89B6D55F40 Appurera8
929,704,186 *60DA89490F457F164006E58B834DFEFEB92F4A52 Appuuppa1
929,704,187 *60D2651F326279343D46034D9CB17E9AC65F7C37 APpw$
929,704,188 *60D7BF66A132B03F7F922E3C2CD28964F72B0190 App%w
929,704,189 *60D2BABF056842F572701B5B3E94D5A3C2D923BB APpZ
929,704,190 *60DAC594EE08874671FFBC3BFE9478564714EF08 AP%Q!
929,704,191 *60DE2A1DA301B7ED09B463E5703A18DD85B03EE6 A
929,704,192 *60DD57EF25F18D37D747CF9F499924EFE4A749C6 A&pq(
929,704,193 *60D37A31695CE2092A0738D656AC75096277FB05 A:pQ0
929,704,194 *60DBBBDDCF644B8F79805B39B03DCBD06AEE43CD APQ3D
929,704,195 *60DF724CCEBF74C9357DC830D98451A4CF7FFB9A Apqb3
929,704,196 *60D8DE64C3BB258E48A9A00CA451E6E9F4F36354 ApQCm
929,704,197 *60D6D532E5E898B1466C4E2C992687475F6E8C5D Ap/qe
929,704,198 *60DFE1DA9FDE7411B79FF2220954EB14B2858D49 Apqe9
929,704,199 *60D6804F2A903EB7345CFA6BF7CC62897BF7A27D ApQkG
929,704,200 *60DA92E491D79E320857901EE8208C39FA2F3B91 ApQU=
929,704,201 *60D3C6907D3B66D7CE16A835EB10E41AE0FFE6D8 AP%R/
929,704,202 *60D386B37162C65F2F95B90EF72DD6948D7A64BA “apr”
929,704,203 *60D4187752F19C1DA6B8A1B88F81395CB0A004A9 APR1069
929,704,204 *60DE9A873308FDF15203FBD9E7A0B443CCAC8B8A APR1600
929,704,205 *60D0E7FB26D6AF4BB5DFABD5186F953F2AB38BF7 APR1787
929,704,206 *60D289DFDF7FAD798D86784F9FA73C0A5A241B1D apr–23
929,704,207 *60DBD7ABAAE64E7A18D8F190F526DF956F927774 A"PR3
929,704,208 *60D0D1AFD91563402459D683DCD8E9053C8083AC ApR5X
929,704,209 *60D4FF298C6166B3157EEB685ACA02DDB23EFEEB AP!Ra
929,704,210 *60D5785769592AF1CB9212D081FF80C2A4283C89 Aprashaa9
929,704,211 *60DECB1F2EB5246C3FABE440929C54C04C70F691 ApRbb
929,704,212 *60D6BD2050EB1942576919BEB83CCC60AF72340A APRD00366
929,704,213 *60D0048F085830463816115D9BC728020C2261C3 apreciares1
929,704,214 *60D7DB6E828CD844AAFC81EAFE1EC09C73D44228 apresassem1234
929,704,215 *60DE33F2558944223988BD6D40E9DF1EF7F0CFF3 apresiando
929,704,216 *60D2679B3DE3D82F1C9951A7053BDB60F6F19D81 Apresser5
929,704,217 *60D963AE9E4E247ABBB0AB239C30DB70175B3EF3 APRHODIA
929,704,218 *60DF239D61EA2F5D02125030A1B8D8DBE8895B33 Aprição
929,704,219 *60DC2DB90AF5A75E175159F0F472F5D1C448FDF9 apriilcuore
929,704,220 *60D9B105F15963F3FEF9CB44D5C7F6227C40A173 April281
929,704,221 *60D04B9B34349E2BC2AE47B0B1757F1B374F85EE APRIL301995
929,704,222 *60DF08F755E75B9ABEAA76EAD1B3BBB0A87E34B8 [email protected]
929,704,223 *60D933D809CDAC6233BAB59C4DF97CAC5814E115 april772
929,704,224 *60DF75546DA3E20C26A05745BE912AE9897ED8DC april7901
929,704,225 *60D16AB68167D05FEB3BA8473007DCF76DA5E8A1 april burt
929,704,226 *60DE667362FB151334D186451048D368EC6D918D aprilcezar
929,704,227 *60D9B01F98A5A2C407E97AE5E45B3171FDC9054A Aprilcool4
929,704,228 *60DC70B5E655805D59B7AD55C041283B35DBA7EF aprilea1
929,704,229 *60D36A534F669AD923FB5661E77AF988EDF8BC15 april.g_o_o_d
929,704,230 *60D6606F486F8BC9D742B4B115FAAFEC806EEC81 APRILISLAND
929,704,231 *60DC89AD3C1FBD34D4D84A6EEA7B7215E850A1B2 Aprillip4
929,704,232 *60DF11F071E661BA77E4027CAA9EB2FA3DC9F379 april noe
929,704,233 *60D9A5CD1AC25C975B74F28645E8AB006B68F4FB aprilpiche
929,704,234 *60D2DD4495FB85DDB3C286283D57C1D7E8538696 aprimorarteias123
929,704,235 *60DD666C866CA47D05D5B3EE4FFE54D311BB5A08 Aprimorem4
929,704,236 *60DFA8D623C758501D29DAA68AC0462CBCD89BC4 Apriscares
929,704,237 *60D834DC9D49C6FFA0A871A3B08ABCF82B5B0180 aprivamo3
929,704,238 *60DCE0C773B2B9C0D5E34F97A683801CF92163CA Aprivilegged
929,704,239 *60DC12AD97465E76C9FA659396BEC3B079A406DB Aprofundarias
929,704,240 *60D984B19426082C3B6CC03258576BB700AFE57A Apropi
929,704,241 *60D8DD0C9401A0EAB2420C48D6B41FA6C4F568DC aproptart
929,704,242 *60DE464D8D163C28718F7BD2DE390B8544DA828B apróságaira
929,704,243 *60D3BF4637E1C95B2DFC7177BEFE2B0AA05F7ED2 Aprotest0
929,704,244 *60DC82D12E7B535F644F7E0A7608DDB13232BF79 APRsR
929,704,245 *60DF91B2F401BA92B21387D6BE63A5C3E44042AA APrtS
929,704,246 *60D7086BD5707530AD922E5BA46DFB434F0A6AD2 ApRtY
929,704,247 *60D7E8AD70D23263490F7769BC6E66954E9E852D Apruted4
929,704,248 *60DD582BDD83A396D23815086B95C5F40EEA1C9F APS,+
929,704,249 *60D209BCF0FAD83F6A0B720AA885C442F2753B33 A:Ps%
929,704,250 *60D43C409C89C514DCEB5253C7A3DC79474BABBE AP_s-
929,704,251 *60D2611F1B7B94D5083EB08008A601AFBC73ABAA A_p,s
929,704,252 *60DC65B62A53F0050BBAA2F8290815D835C19B74 Aps$0
929,704,253 *60DDF45ECA0591DB2AA4506D92659BDF21238A4E APs9b
929,704,254 *60D5ED15E477D33ABA2C742E8113120AD11D10B6 apscore5
929,704,255 *60DFEEA97B0BA42E631C5577200BC417E38CA417 apse_linehas
929,704,256 *60DFCF2FA1A616BBB166F391E6C45A90F39303DC Apshtein
929,704,257 *60D65993D956CB984622924D3178B3D197E8194D APSj+
929,704,258 *60DB6A600092CEE03BFB573721963A5320FA1AEE APsMm
929,704,259 *60D4E03E62793B039056D98AAD1109F7BC10E626 APSNH
929,704,260 *60D1EDB46F0A6C235D570734E7E73352821DF2A8 apsnypress070222
929,704,261 *60D3891DC344946612E0C72B7259B8421579D5D7 Ap(sp
929,704,262 *60D87A8F8AB239AABD843E7903733D4CC51D6229 APSq7
929,704,263 *60D56C57FE05EF672EA133E45B12912FA807B881 apstrahizam
929,704,264 *60D9CF2A51E58E83495EC8005EC16B51F39123C2 Ap#Sv
929,704,265 *60D157AB51F15560C0421AB43608C5A1E1FEE07D A)psY
929,704,266 *60DF7F0EFDC153CE7BAA3B67283CF10441848BB7 ApsZY
929,704,267 *60D9532C4C4596821598DC74CD6211F7A4921154 Ap"t,
929,704,268 *60DBE633181DCB9F88E7758B3C9953B9EEC727E5 AP?t1
929,704,269 *60D56ECB90D04C270E4B27432DA2121F872489A9 apt 2
929,704,270 *60DD25E641F59923E4A4C80648DD4402FE9CEE36 Aptamente6
929,704,271 *60DA2C5170CDCAED9618EF482109B62BC75A20A9 Aptateur9
929,704,272 *60D7A3559D39CAED53C32BF9202806E359824366 aptbio.comwww
929,704,273 *60DB8597817AA8C4EC1B9E78D5555F613AF23468 Aptekar6
929,704,274 *60D2A19F4F14C2D0F47E8D67CA85AC2E570AA162 Aptekort4
929,704,275 *60D3D6A08DB868D79CAC7CA58FFD3D63D1ADC167 Aptgb
929,704,276 *60DFE1E8B2418677E26A50BA4A7804F52A1715C7 AP(tI
929,704,277 *60D2A26A5B3DF2D17D5610C0EA99E8F5B0129A1F Ap'tizoisouthavgo
929,704,278 *60D7A4BE92FE8CF6356E5C1E63894F39C3A9F471 A#Ptj
929,704,279 *60DC709D9DB19FF3027CBFFC669C13ACE19BF430 APtl
929,704,280 *60D213FFB7DF490A43EECFDC47EA289D22CE58BD ApTLQ
929,704,281 *60DD9E70E7F21B5B76A09C81B77A978A25311823 A-Ptn
929,704,282 *60D0734CFC52C2EA27D2467A0E7F35E9AEEED354 APTOG
929,704,283 *60DCE02574BA2EA4A8C5960B45957F52EC00CA1A [email protected]
929,704,284 *60D29BE18283EF12BFAB9FFC33AB93837A0431AF Apt+v
929,704,285 *60DA86CA47BBA3BAB9D4A87B6EA6CE4B193E6716 ApubR
929,704,286 *60DA7E99E11D15A6FA8B9BEDEFA1C0757CFADC72 APubZ
929,704,287 *60D4182FA43CE38EE154F5D923F55BE6C644FAE6 ApuC
929,704,288 *60DCA5F12FD3A24D83C23F9A1A989FB184DFCA9D Apu+c
929,704,289 *60D0851990B5C3E844618283E79E0EE798BEFF47 ApuE_
929,704,290 *60DB7513E2031FF63A9169383AECD3D4F4697F04 apuhtin2
929,704,291 *60D034EC002A6790827C183CA63448B18284D222 APUK"
929,704,292 *60D7087E5A3E72E56D31EEFEF48A9710BCDD89BF Apu#l
929,704,293 *60D28F4C2B1A0FE2FAF6E621078756E7B4A562BC apuleius’
929,704,294 *60DB79B55BDDA2210D187D017CBFA46006C2A08C apulienses123
929,704,295 *60DE22A6D269EAE350A3DCD6697A2110DA4BE360 ApU+M
929,704,296 *60D28B3EC3DF708EF9D36C017B1C41A1E41A96F5 ApUm
929,704,297 *60DA9871CD07DF9822E743808CC1746B2F4C10BA apuointed
929,704,298 *60DF7F9867F6434D5B832FAC85D55A9BB4DB4FAC apuparnos
929,704,299 *60DFE1CF58298D42ADDA5F84CA395255F6E1CB18 ApUpw
929,704,300 *60D5B38011C9C3E64E3E6FA4EE988292D0401069 Ap&UR
929,704,301 *60DDA48EBB7F22C2790A5729AD03B32856A9E24A apurassE
929,704,302 *60D35C596ACDD161EA59B3C31EBA3C00C57F9BB7 Apuré“
929,704,303 *60DEDF9EF6B95D9586BFEB213BBCC5EF5DCFE738 APURIMAC6
929,704,304 *60DDE6D158A1528BAB343CB3C7637F835F988C4E APuW_
929,704,305 *60DAB12246112B1012ECBBCC8E535278FBE95D13 ApV1F
929,704,306 *60D9A647776045BB3AA83F80C5661DBC814EC242 APv;2
929,704,307 *60DBCEB8AA277A8A8C696471813541E221D60BDE APV7C
929,704,308 *60DD0045869BC4791C99F68706316EB2897A0AD4 APvjV
929,704,309 *60DBFBF008142511CDCC7E4A860406CB8CA114C9 ApvSi
929,704,310 *60DFE5E1CDF0474EE49C60AF3731861D2BD13DBE APvTR
929,704,311 *60D52A5175E63F760F7C944F280414D443C316BA APvw%
929,704,312 *60DEED1FE5C63B5A4637EB21CF6FE6D3CBF7937D A"P$W
929,704,313 *60D325A24962F4AE9F3629CF3B661EB7F4A0CCD2 APW!(
929,704,314 *60D71B32214875972A2671D381467A0A1163FACE A/$Pw
929,704,315 *60DCF67B93239F07204301F973FB32457F7DA11B APw3D
929,704,316 *60DB0349AB35BE5796CD58034CF72825EE93AF03 A,pwF
929,704,317 *60D095F9806EB7A69E93343091E683A022ECDF55 APWNS
929,704,318 *60D21EC164BC2508AE45CF0AF199BA273E139904 A.PWS
929,704,319 *60D446D62D6D483BD45261BDD0E3D573AB814E01 ApW_S
929,704,320 *60DBF7CEE1ED6BD378023A18A78A001794664DFA APwSb
929,704,321 *60D100E0ED278EBA32946241C37497617467BF35 apwteros1
929,704,322 *60DF9E580D72272F5BBB81A761269953A56D0450 Ap/wW
929,704,323 *60D327A36D66C8D4A0C1708E12370C473270CB9B APWws
929,704,324 *60DF1EA95953D5A40E321004DAC32DBE24D4F991 A,P-X
929,704,325 *60DEE71BC02EA20A8E6B9994D9EE6078FBE6FCFE APX$8
929,704,326 *60DE47A979F860AD656367DB8D364892041F1AD7 APX!a
929,704,327 *60D46D3989DA1776861F4D4FCB01ED7A22B3BF02 Apyavasan.h
929,704,328 *60D33CBD54E3F6E1AB7ECE64D54D32C4BA48B2DB ApYE6
929,704,329 *60DD9762473A03DD6B8AC2835B0D8CDBE365EA98 APYG3
929,704,330 *60D3DC97F35E2FFCC9732890028BC7E6DFB3D9D4 aPYgdtNkPK
929,704,331 *60D58B36C9A5E8F6BFB8459E8C020404BA8996DF ápyndrian
929,704,332 *60D692DCFF1348834923E0DEDC7E23B1227EB333 ApY+Y
929,704,333 *60D9C938F0AB6DE5EE86A624035DF01410FAED9D apyyb
929,704,334 *60D05B72691B52642AB9F075B4EAE3B0D4383AA1 Apyyntjn0
929,704,335 *60D733506471E9CC1CE616615FD6EF57EA92AE83 ApYZu
929,704,336 *60D07716C7E213D336FC82363B7985A69363D5A8 APZ/(
929,704,337 *60DC951E28275BDAB297AC59391F741B9F839C1B [email protected]
929,704,338 *60D6B500170467EB9225B53840BF7CCB1B37A3C3 メンソレータムapソフトローション(皮膚疾患治療薬)【指定第2類医薬品】
929,704,339 *60D39B7E1D2AF4516F1554FB4F549993B29F93F8 A,+(Q
929,704,340 *60DF1F60420A590324FAD6F18BA7EA1569DA71D1 A"(Q+
929,704,341 *60DA7088C93F406D3E7ECA540DE59C5997DDE2A1 A(")Q
929,704,342 *60D6B9E1A43BB73945DC188A1E062FECBA10B17B AQ}[
929,704,343 *60DE4C26053FE6D3AC6E01170783429841CEB185 AQ&
929,704,344 *60D8D16E4F83B065D9EA777423933E5F2AD6EAF6 A?q
929,704,345 *60D2D4B4603687929D1436A9807D058DAD340505 A)q&=
929,704,346 *60DE85238750612FC2A80F3B9489392F36B147F3 A+q;
929,704,347 *60DF4A833E79930213906EEEE372FAD035D49165 Aq0!7
929,704,348 *60D181686FB28A530E29321B4E6F64F236FA52E3 AQ0I8
929,704,349 *60DF7698567F233BA91A6DC39CAD97594C030A9B A&/q1
929,704,350 *60DD8664CC277DADB750BF7DFEE39645354C0BF2 A+q17
929,704,351 *60D8D819E1C33EF643B07C3C901BA0D53AD8D2B9 A!q1A
929,704,352 *60DDAF1DFB2B27E9AF57EABE58CC4EE3C2040135 AQ1jc
929,704,353 *60D0410B7E005B87120BC111732D4E7BB84902BD Aq$1m
929,704,354 *60D7BC04F37334694BCC293E6FA2E25CC3C5634D AQ1R-
929,704,355 *60D96F8C6D26A82F47F799A1B3BBB7113E8A3385 Aq27/
929,704,356 *60D49FF56668081B4D773211A19232876127DA63 A_Q2D
929,704,357 *60D0D7C67E1E7B243F71387FE200A32CC15C6AB9 AQ2E-
929,704,358 *60D0A5D7D3D27860FC9F983CA445964AFEFA98B1 AQ
929,704,359 *60D4ADF4CB05EB97C7C20FEF136F9E64DD2CB30F AQ2md
929,704,360 *60D9D471FEC8B7BB8C0521ADB9779F2D4A4C4125 AQ2MM
929,704,361 *60D7BB5A4A1F17D05A24556057D870F7FF54ED8D Aq2pt
929,704,362 *60DF13AB3B317A6E30E00FC4D7A7A79BCE4A4099 Aq2u9
929,704,363 *60D8195C81B54ADB633C566DF93C55878C3DF0CF Aq344
929,704,364 *60D3C02EB44A55CE490FB4813EC2E658C19C8E0E AQ3&5
929,704,365 *60D4527D746C58FA9FFCC0436BAA59B63573FF8A Aq3?L
929,704,366 *60DA35D33F3078891074FDC715D786E0B17CF4F4 A+q40
929,704,367 *60D77BBDF3499ED40ED20B2A01DD94A0987ADA84 AQ4Db
929,704,368 *60DA0456C5AA04623FF5D11D7843D4C7206EDBF2 Aq4F2
929,704,369 *60DB425DDBEF509F3C330F9D8FABF3A434275DBD AQ4m$
929,704,370 *60D1B9C29077A4FD4A1E9F254DC7B75509AA6029 Aq4oM
929,704,371 *60D7457C4FD0ACC3FDCA36FF8CC89B715A5378D1 A=q5=
929,704,372 *60D7BD05F665C08392008181DF692E5B3F485F15 Aq5(5
929,704,373 *60D1467F6DEBECC30A6A346C92E045FFC6BF46F9 Aq5b)
929,704,374 *60D0071721C1E1C7E699F3DF20BB0624CFDFA366 AQ5b4
929,704,375 *60DBE7408F914D71F98E3C4E8C20A6407F0CE0CB AQ5EP
929,704,376 *60D53D653C2F48B838CF30D108878496A9ECD697 Aq5"f
929,704,377 *60DD8DE39CE62A3E6F3578FCBCE870B0ADA404A9 AQ$5H
929,704,378 *60D4EFAD9FA9630366C70DC6D062FA0A2D430516 AQ5-V
929,704,379 *60DE3E113022C2E978FBCFB6616C7DB38845618B AQ5!v
929,704,380 *60D2BE867487417FFD196E7F3F8BE88BBB006457 Aq5V!
929,704,381 *60D126622F2EFECAA03254E8FA711C1A0579B427 AQ%62
929,704,382 *60D23BE287FFEF86DBAFD3B822A1CB9482FEFC67 Aq6kE
929,704,383 *60DCCCC7C53BC136BECBAE319897C983EA74F767 Aq6:O
929,704,384 *60D03E8851E5CF6B5C9689D6B953299DA755F1EA AQ
929,704,385 *60D3A662FD2FF245962560D0AD304C0490A13F47 AQ7I#
929,704,386 *60D5BB35A1F3A899E11D17CA82FD50079170BF8E AQ7K/
929,704,387 *60D6353A8691BC92162FE03E7F86AB9324C2069C AQ7M"
929,704,388 *60DF8D7D540142E2A302220780E7CB6A0E0F610F AQ#8_
929,704,389 *60D1CE6E46EDE54380D5AD0F5BA3E8A2086448BB Aq8
929,704,390 *60D32ABD80F4924126C913651957F400DE2B8D7C AQ81b
929,704,391 *60D2A08ED85E6ACC0523CA267946578CE846345D AQ"89
929,704,392 *60D36900BAD119860A0732621F33277A1F558C96 AQ8C5
929,704,393 *60DFD7961A544C900D3A5415F058E6C00E322973 AQ8eq
929,704,394 *60DF27F794120827FF2CDA28CA2AD199342BD8D9 Aq.8k
929,704,395 *60D5EB904C07B6D09A42D0390E1968E06E9D1AF0 AQ8OT
929,704,396 *60DAD05BDC8C123EC7C02C7C11FFD1C9B3EBDE37 Aq8ST
929,704,397 *60D34C777FBEC2797743FA5A51EC5DA0B7139008 Aq8)u
929,704,398 *60DDACDE6C391C5D5C2414D13276EC1B781A694E A-Q9#
929,704,399 *60D79E2E5E9444350C1582812436C39CB3855076 AQ9BC
929,704,400 *60D14D15E5628A08508974449BEDE9200A4BF7E7 Aq9hA
929,704,401 *60DE4FC430231B6337F28D43E6BDB22CFC3F9C0C Aq9i,
929,704,402 *60DBE90E6CCC6E8B99AE794BBFAA3FB99A1703D7 AQ9K!
929,704,403 *60DF743484988C7CC3C81F2148B7938F1B1FF388 Aq
929,704,404 *60D90D1DE2D091555FEC8B9BC47BB1BC79762C19 A=Q9Q
929,704,405 *60DC15C2DB6F1FA9836DDEF9184983A66F8CB642 Aq(A
929,704,406 *60D885FB555F39D63F6ACCCB6FCD5C79E1E90266 Aq
929,704,407 *60D8DABD1EAED167F071C9BD9F5B7F0A7EA7E21E AqA=+
929,704,408 *60D77B87854CCAA70B8000B3C5CBF4459ADC0C0E AQa?C
929,704,409 *60D31056DDB433579F026187DE1C8EBF1643DB31 AQaDb
929,704,410 *60D010F676AF1EAFED77BF8491C1CFD4CDBAB28E AQAHc
929,704,411 *60DA4E957760D48D08D6EAF351EECF6D57072BCC AQ?AI
929,704,412 *60D06500D30CA947CF49283225AF7BB57E77944F AQA/I
929,704,413 *60D78F49F2D2E491E289DFFA30D18AB8481C3F0B AQa)p
929,704,414 *60DE6A85B2DAAFD01AB4EE8F1EB8483696EB176A Aqarius/LettheSunShineIn
929,704,415 *60DDBAE998A43863C69FDEE5EA0F97D1ABFC3C09 A:QAU
929,704,416 *60DD0A9FDD590B1CAA2B59F8F8D12474C165D784 AQ
929,704,417 *60D48BC2AC2EDF3E2A34CA47931B1F85096C0489 AQB%"
929,704,418 *60D73B4E6AB22723F0EAA3527B6025A40A5EB59F Aq/b1
929,704,419 *60D8102EA81FA931E9A626A2A41A09F2E3411467 AqbaX
929,704,420 *60DE2F179E48A1C85E33D017E991E65AA68F5E9F AQ
929,704,421 *60DF2F4260696E6BB58F45CC4AEEB6C58528DACB Aq)Bm
929,704,422 *60DB61992D8DFB565457D045090B65AAD7CDA33E AQ?BO
929,704,423 *60D42EE51E585BA9499E88864A0B38385DBD1FF5 AQBri
929,704,424 *60D2E0CA55B18110A74ABDF4D913654F9A4E2824 [email protected]
929,704,425 *60DAF10201C5EB53F4A8613BE9BF22FD77694C77 AqbUS
929,704,426 *60DD923A8B43EA567DB8B2E3833F72042334D504 aqbvc
929,704,427 *60DE715B63140384131CD0351078BB30633FB88B aqbxa
929,704,428 *60DB0F8BB3FACF79FCB224F96C5E0A61465AED94 A%qbY
929,704,429 *60DE2044CA75D4D6F6D6084E52DFAA25713BE60E AQc$1
929,704,430 *60D16B4F2DA784852AD2CE29405BC30B1313C891 AQCC6
929,704,431 *60D470EA1EB1A1009F70A42402C5DB5E048DCB93 AQcEl
929,704,432 *60DCAC17CD2BE5535142C41106DB05F563805785 AQcIu
929,704,433 *60DAD33C6EC969D37BE807D7DF9D15802F2C955C Aqcp4
929,704,434 *60D9DB0601A5491621DABE19896F6BEBA51F5CD9 AQc)v
929,704,435 *60D849001EBE28EBCCA0A1E4F221AA84B13A7EF3 A!q/D
929,704,436 *60D9C9BCCD2CDD31EA344F679249B92F56B8DE46 A#qd+
929,704,437 *60DE35AE4C4E7073EBD09081C121CA4D30C500C8 AQD3D
929,704,438 *60D32C2BFD50C7CAA8D8F64543ED0D2BFAD5EE7F AqD,h
929,704,439 *60D0FB8C1E7A1C7F387DD2256F3C05F57EF2FD0D AQdj7
929,704,440 *60D929B68D60E0654668D68E088E9F809F8E3CAA AQD,K
929,704,441 *60D8441D6C25BC141D04A2FF2AB95B3186080024 AqD+N
929,704,442 *60D03F60347C9C970CDFF2B5670B200C64EDC950 AQdq+
929,704,443 *60DB16CBCEAE263702D739F83082CFB2D1AFA48F AQDW-
929,704,444 *60D3C373B3C269FBC184607FCEC8FA2E9FC9A075 AQ%E,
929,704,445 *60DD4E41D955ACF34F59BE42C67FD1282F3FD71A Aq&$e
929,704,446 *60DEABEA5C1A746AC3A62D7F4814DED7C415EAEA Aqe,,
929,704,447 *60DD95FE8C958D3C68372FD1A275367F2F7C3147 AQ
929,704,448 *60D5114AEC4B9F053D2F28B534A76C5865A20A62 AQee
929,704,449 *60D28097DD888A8B96A187AA72A23F8266D19506 AQeft
929,704,450 *60DAD91A8B4A7BD07B38D7A928D152A4472B8A99 A/Qel
929,704,451 *60D838DC4F7DFD920F43731D8E2AA68BA8F7FF89 AQ-ER
929,704,452 *60D0661A00BC87DA790A16CB94FEB9E7143A0EFC Aq.eS
929,704,453 *60DF92D4A85F5B09DDD2B5F2CAC2198B43200DAD A!&QF
929,704,454 *60D77EB9B1283AF523688A354F971B6016F5F8C6 A,)qf
929,704,455 *60D5D37D8BE1986F7659F9BC2FCAE475092069D4 AqF4k
929,704,456 *60D7FC5615C617D323C87940B6E5D3D629CFF6AA AQFd1
929,704,457 *60DE2EEA7670908AA908405AD2B0DBB6A6BEDC29 AQFqg
929,704,458 *60DC1CAA035200E623C6A9CEEDF3BFA6253D8D09 A&QfS
929,704,459 *60D42A5F56DF000FF5E46CC15C1C84FABC710081 Aqf.Y
929,704,460 *60D967DBBA1F20B9714FC6B7D49A9C96663076AD Aq.G"
929,704,461 *60DFE98F1D1ADB7A5E81BDA68671DBCF6843B8E6 AQG3g
929,704,462 *60D3A931B57EA8D60593B3E7B5E9255CD8D279D6 Aqg&C
929,704,463 *60D3E5A289B35DD928493DBF32BFC9728D7E1F3F A:Qgf
929,704,464 *60D17DE4F2EECC5F793EA825623E4130D8D529F0 A&qGh
929,704,465 *60DB137547C83133FA61ADE280B92C3F826F4C93 A#QGI
929,704,466 *60DA44FD9C7799493E1A6755213E2B9E27E1EC7F AQgk)
929,704,467 *60DE572547FD2F7ABDE7278ED511765F0B229DD7 A+QgL
929,704,468 *60D9ADC159A7883A60558898747A43C4DDE0BBA5 AQgwK
929,704,469 *60DA91724B68EFB5D08E6203B4A50215EBD576D1 Aq)H!
929,704,470 *60DD71FBC443DED0523D88D85A24C59BC1AE301E Aqh!3
929,704,471 *60D4848F8B1E3A870CBC3805A08688F4743B40A5 A:Qh8
929,704,472 *60D5C5E58A268178507F4E9E26AFDB37A0BDF5F4 AQh9k
929,704,473 *60DE6CE28E3BD4894A9827D103F5B428FDEC0F1F Aqh.F
929,704,474 *60D39C634430D5CF892158EC0896AC10E290A3A0 AQHgR
929,704,475 *60DA6EDE08099AF66004E309AA2621F5B54784DF A#QHi
929,704,476 *60DD08DF609F1C9B8C1C0F5FE4D7EA7FB812CE59 A=QHK
929,704,477 *60DDB0F09E162960FD947BAC52C422BF7ABB6720 Aqhnaion7
929,704,478 *60D566C435CB8B38F7D682A1E0892B091DD85B1B AQ/HU
929,704,479 *60DCE655E5E6CB0F19AC373536FEA7AE94BA56D5 AQ((I
929,704,480 *60DB9F27FD3376C2E52B433B63E045BFF49090E8 Aq;I+
929,704,481 *60D4D0D06C8E9FDB97FEC71553E06A51BBF64816 AQI7A
929,704,482 *60D597DC1ED193B9F4543B64C5B2B38359810D44 AQi82
929,704,483 *60DEFFBE7CCD1B89D337A3930916DDA63A061EE3 aqibbashir
929,704,484 *60D5BA40A5C402F5964DDBD224C72CF3523B2460 AQIdR
929,704,485 *60D01CE175DFE6F1398C20282229D4F30E62821F [email protected]
929,704,486 *60D96BAAAC25D0F2DDD0C2EC1D75CD8BD3C55CA2 AQ,iK
929,704,487 *60D709104464C184B5FF5F5E95069D3165155C75 aqılsenık
929,704,488 *60DCD1A293A0D7A4C35C32F9AA3D4D66AC7FB64A A=Qiq
929,704,489 *60DB64B179BDE0B4BC7C0E4C55BE1BB0747A2F22 AqIsU
929,704,490 *60D07B30FBEB44CCE54A1A1E63FAD6708EADCEDD AqITM
929,704,491 *60D32E76813D5F5CDD246EE6C801F80AE47E31FD AQ-j#
929,704,492 *60DC08724DB1B64DCFCEC6F9C053226707376C76 aqjlj
929,704,493 *60DD19E67D0475EA8BB23DA4D10382E7966B2543 AQjsF
929,704,494 *60D9E3BEB2DEA3A1DE13F0188BBE455D43AE736A Aq_jV
929,704,495 *60D92AF3098EF87A51578181E89EDB568C6368FA A,#Qk
929,704,496 *60D1B19D67175B52D8C5074F94D2DC80C15B5797 AQK2d
929,704,497 *60D5FB36748310FAD7ECCE53FF6116F9817019BB AqK6b
929,704,498 *60D2D5DCEFC2B83B03E9064A691F0ED763CD06D6 AQKH$
929,704,499 *60D5BAE360FA153803B08DC8832C5E1167CB418A AQkTZ
929,704,500 *60D1935ECDFFD623D5756935A2E9CA19AC7DFDDE Aqkvu
929,704,501 *60DA9C36A68AE0646228ED2F4208D06B330D885B aqkxgd1bs4ac
929,704,502 *60D77E1093A920DDEA8856B58ADC37D34B03D1D8 AqK"Y
929,704,503 *60DFA4831D2BB33C5F5465354A1AA7F4D78C7072 A&qkY
929,704,504 *60D83459E2E382DF074B24894B914570769234B9 A+Ql#
929,704,505 *60D35EEA6B611620541971F6913BFB0FC380671B Aql)_
929,704,506 *60DD3CA47D827A7A83B37FEE6F4DD2D2DA1D4828 AQL0A
929,704,507 *60D878A636C0760917B24C90188C56C5493202B9 AQ/L4
929,704,508 *60DBBCB70335C370F70B478B16EEAB0B3DBE1692 AQlB0
929,704,509 *60D5D7AE99FD20BA50BB47D778619EF37A82A377 A:qLE
929,704,510 *60DFF692580B413CB79600602DBD1C8C4446F43C Aqln_
929,704,511 *60DDBFAB74F20DB959D013974247A42BFA839D12 AQlYi
929,704,512 *60D396372A349C98188C9C1AA102FD5BFB1C338F A.QM:
929,704,513 *60D9AF8A91314EDBF162D9A8DAC09AD2C7BFFF2D Aqme
929,704,514 *60D877E482D1C7FFB2A4DB4911AA90F966304E02 AQMFI
929,704,515 *60DCF50E2311CEA66BACCA089CB6B9B88EC3BAA7 A?qmM
929,704,516 *60DE8D1D4FC00B5C392B473C4A54E033E714EF20 AqmP=
929,704,517 *60D1C84BB38575A7C5B42E59D59BE4A5E64A3662 AqMu&
929,704,518 *60DA645ACB76FC44B67F3A66235812E7FC61B178 Aq_mw
929,704,519 *60D7FBC85D67840C5E77AD3D59E514A53629BD59 A_Q,N
929,704,520 *60DF7EEAD0C060FB56C8D45E72569D0BF76F2669 AqN
929,704,521 *60D862E7175BEC5EECFF273AF6DB4D5DB89B276D AqNbG
929,704,522 *60DAE0307A3A9FC1CF61E9EBC0FAC8B8B655AB54 A&QNI
929,704,523 *60D755F2DA5D679817DD48B0BE5F6DA89D212D15 AqNKW
929,704,524 *60D15C1B19AA5FCE391BEB40A21E6CA8B7953AEF A:qNo
929,704,525 *60DC9512BC289DDA02C8E447816DB17CAB2FD65B AQ
929,704,526 *60DE78D4CBD3F83F48BDB1250E2A6C1504350DBE AqNr+
929,704,527 *60DFFD04F948807FA4723CF7E2ACA61E3F6B533F AqNud
929,704,528 *60DDADB4921BC83F8F0A10ED1EEFDF5EDE05254B AQ.+O
929,704,529 *60D7D91AC3719024D5054E9F49D5075E3CAF10CA AqO/_
929,704,530 *60D20C31A7D18D489F016B5DBFFA1C459563714B a=Qo
929,704,531 *60DB10275FA7CD42AB20297D07AA38FA8B83545F AQo.e
929,704,532 *60DF7F294671090342C944CA356E960FFDC10D60 AQoFd
929,704,533 *60D4859FAE13F7797B8D795AA2D7A9EFE4EB052D A?qOg
929,704,534 *60D4A0A81AABE1B91323173E5068C6EAD2B55964 AQo)k
929,704,535 *60D03FC991F4500C2B0FFEB02FB9C7EB4D47957A A=Qop
929,704,536 *60D1CFB281FA32680033A18D324A3E1C90ED26D1 AqOp5
929,704,537 *60D3B1CA9104A1A3DBA28F80BEF1F1724CB4AD25 AQosk
929,704,538 *60D9FDDA9351A7C5F6E4999F388CE0EA734FDCFE AqOZA
929,704,539 *60DF450EA582F73E67D513AEFEF849482D0C57D0 AQ[P
929,704,540 *60DD1D498877C9D5D7C0CE9BF19609CC5246A979 A+Q_p
929,704,541 *60DFF1E65094FAE8C003DA18EC3F551CDA625494 AQp/-
929,704,542 *60D3D51C7FD7E73CE2F808FBAF1AFFE3AADCB1FC Aqp_?
929,704,543 *60DC53BFD2E9167CDD1784758CACB7E4F2989D37 AqP3)
929,704,544 *60D7AE7F4798516926661AA6E86253F75745F678 AQ&PC
929,704,545 *60D05213A3BC2C5659B0CE07823907F026801912 A;qpf
929,704,546 *60DFF2F3539236B42A774934509DB75D8353F5CC AqpPD
929,704,547 *60D7B81C42B5FF4B238FB6F572A70E18A45E1B0D AqPs?
929,704,548 *60D621DB26520962A8C24A24D36901A7E845CB15 aqpv
929,704,549 *60D7392A242A0C18F50E7635E6F546BFA20C5291 AQPVn
929,704,550 *60DD3C284CDA8A95609069B78FC451624451CB53 AqPwL
929,704,551 *60D86712DEE66BFEA8736EBF7C5217728A70ACA3 AQ?Q$
929,704,552 *60DE06B5FC9EBE497A396DDF14AD6D8504E66299 Aq!+Q
929,704,553 *60D2E0FFC6D9EFDFD263B0C964EFDBBFB0495669 [email protected]
929,704,554 *60DE799972A395F97EBF6A793D6EE0B8FF37D3BA aqqwy
929,704,555 *60DE28F74B133F72DC1AEC76708EA8F9064ACE70 A.QR.
929,704,556 *60DDE0F9D0C1EF14F58254225560C092DCAABD8B A!(Qr
929,704,557 *60D81553F5DD95E1EAC156B4D128328D22F90B6E AQ&r-
929,704,558 *60DCD767554CE922EDB38865497B9833629080E5 A/#qR
929,704,559 *60DAAD368BA210A201719CC4E8950B834F60B471 AqR(c
929,704,560 *60D0B5899B3ED023AB6B0685C52FF43F2EBC18E7 Aq%rc
929,704,561 *60DFDC3E82A06AF19FC381FADF1B28890804BAF6 AqRLf
929,704,562 *60D22472CFF086A6417F53C3776FBADAD1D70C0B A%qRn
929,704,563 *60D19E67B9FA2C002842291AA28C4E441DB846E1 AqrPh
929,704,564 *60D046AA3E8E53A946D74467E8D84865B853A9BA Aq+rq
929,704,565 *60DD7FFA6CF3042AE250FD0F6A5142AE078CA1F3 AQruY
929,704,566 *60D1EDCBF4371461ABBF4BB15528E60B2B8DD536 A!Qs"
929,704,567 *60D0BF3E319886BF320ED158218EE1EB3E04D089 AQs&
929,704,568 *60D2C33827804971B6ED317DDF41EEA591B4E159 AqS2b
929,704,569 *60D0177B2E6F67136807A9638D02D73E92E83F9E AqS8
929,704,570 *60D35BDB66D9CAAC48B2050AEEBC425D15A5D904 AQsG7
929,704,571 *60D325E1BD1CA5011F7B4F1B2A6996E0DAA3E518 AQSIMPLICITY2
929,704,572 *60D896BCDA8D6AB0777714D57F958F08D0D731DA Aq)sn
929,704,573 *60DFDC2A1FEE19ECB645DD38E7A353BDEE687B65 AqsO8
929,704,574 *60DB5C5758C52D9FB02AAAFCB2F8924D3974CA50 Aq#SP
929,704,575 *60D2B7AE219FA76AEB15FF8F02AC6B145B57919B Aq/Sq
929,704,576 *60D439D2EB390407E60E469BAFB8C6BB31EE8F2D AqSTK
929,704,577 *60DA59D2BBE53167C5D971243A891EA6AB8E4F70 Aqsub
929,704,578 *60DAEFB4DFCEAE5C6E3119D002FC495363B8CB7D A_Qt#
929,704,579 *60D38B974A600266EB8EF35EC35B9EAD2A84D874 aq-t
929,704,580 *60D92CAA9A7EA9D583DD945391A790F4C36916CD AqT0P
929,704,581 *60DA9C65DB865E79DDD06CEBB674F89D8BB60708 AqT3n
929,704,582 *60D9F49C6471BBE7966AFA07D90A10ED0CEECAE3 Aqt8l
929,704,583 *60DD548740F50F95F44BA4E63F203C4B22437EE7 AQT"9
929,704,584 *60D64BEA78AC76F3228EDBB6C3D142C1AEF06261 AQ(ta
929,704,585 *60DE2B7680A4B134274CDF1B74C77E2803D44820 Aq=Td
929,704,586 *60D18304D96CFF15D48701658A11BFAD0B692A51 AQtiR
929,704,587 *60D127B099C0CFCEBEFC34CB2B1B5E21E206F66F A)Qtk
929,704,588 *60DD2BC69422834A5123E5CDE375B93FD620C117 AqTk4
929,704,589 *60D7DC0A445A36CEDF7B6A66FD9428287B45A235 AqtL
929,704,590 *60D65338734F4BFF5F31879B0271704AA8B37C00 AqTS8
929,704,591 *60D9303D19669D1391F766CAD8068448206D6A3D AQt-T
929,704,592 *60D2E7FAC8DF2612ACA3485E4D98EA60D4CE30E8 AQ+Tw
929,704,593 *60DAC5DCD2AD62217563E62C35177FCCBDAB1068 A/Qu(
929,704,594 *60DF047E656A9C570E87AF6247C942698FCB2BAE AQu+$
929,704,595 *60DA36EFCC9D2F28FC4FE59228AD02F05ECAE646 A"qU!
929,704,596 *60DD1025281FA2678378B53DB1CFD1FB0D4193EE Aq+u!
929,704,597 *60D8452CAF1F3EDC6036F83F67C24B61618831C1 Aqu"9
929,704,598 *60D11F00AA29442D2730DB924CF71754873ED80C AQUACPA
929,704,599 *60D7D771E088DD991A064E31F375F4BF0018A449 AQUADEGIO
929,704,600 *60D707919BD7EB930E3D9BD14451FB8353E7B5E2 AQUAEMANALIA?
929,704,601 *60D4FF0DC1621D5FE4A4815BFF01193BF51E63DA aquarij6
929,704,602 *60DC5935937D53DA509860B8B03733051FE9790D aquariusboy01160talk
929,704,603 *60DE8C738479A62AC2167DA803A7C80BCC61CEA4 Aquarius(Evolutionmix)
929,704,604 *60D75C780052C7F68D418001A8FA8D8BF96B1529 aquarius (the maxwell implosion remix)
929,704,605 *60D03B34CE7C0C80D7AD6ABC8A4309460438AE0B A Quarter of Dawn (Grinch)
929,704,606 *60D26ADFE51115FB8AAE9EB9ED117485646DBBAE aquatic (instrumental)
929,704,607 *60D644EF3752ED42138B7F13B7002D423CB59D30 aquaticoides
929,704,608 *60D29BAD9632E6621099154ACDA0382F6FF578D8 aquaturi
929,704,609 *60DD9395EC01F8FC585A38F17DBFF3EF131DA94D AquD2
929,704,610 *60DA1DEEC6E0C3E555076B316B3345EC641F75E4 AQU:E
929,704,611 *60D85058838DFCD0A4F5AEA3FA1102A9B293A980 AQ"uE
929,704,612 *60DA4C023058AC5A469126F844D0B8479A2ACC99 AQUfX
929,704,613 *60DDA02DFB379DAA3D2833221C480F9DD7868EFB AqUhH
929,704,614 *60DC6191994AF6EEED280C72527F072F1E082BB2 aquilarensis”
929,704,615 *60D46393C409D164235B3F43FC72551776D09ADD aquilathe
929,704,616 *60D0EB5DE949B09E02758DAB1313481E1BFF4014 aquistau
929,704,617 *60D5ECD1BBFF749C6CD4797809A14FA3A97B675E Aquitanos3
929,704,618 *60D6A75CE94155AED3A8DDC04F2165B796303AD2 AQ
929,704,619 *60DF34C0D26E07C2D6EBDB89767A253C974DEEA9 A/QUm
929,704,620 *60D6842DD5A7BAFC87BB807FDE6E14F5E4E41383 [email protected]
929,704,621 *60DF9B763E4C7716E7A1B00A2224DA94C20E468E aquoxide”
929,704,622 *60DE6258244B5C49B2969AEEBF54F6D071DE7C6F Aqupa
929,704,623 *60DEA653C146150599595C04B794D5476B7627E4 Aqupr
929,704,624 *60D8C7AF7690BE95EE1A5B8F8AC19A5CD6A76985 AQuX9
929,704,625 *60D9483F9C519D4744211C32F52803A4F354C534 A&,QV
929,704,626 *60D173BE4787C9D80E08D2530EA07F39024A3CDB AQ,v:
929,704,627 *60DADDCFB1D5FD7517240AAFC18D1F7B95FDC22F AQv=#
929,704,628 *60DB0A8E186BBA89D9CC3E48BCA2A5AAB1826710 Aq"V_
929,704,629 *60D45EAEDC4038EDCA1EEE672991C9DA5D9E48AE Aqv-.
929,704,630 *60D47397784E86B60A97DAF8D464B2D5FAF6A97B AqV)0
929,704,631 *60DB3A3739E4EE9B85A670A42CD70DE1D40E53B1 AQVp=
929,704,632 *60D673847CE21CCC05B410DF043891E548012A1C AQvQn
929,704,633 *60DCAA623D586051950A29BCBF4ECB49D355085C AQ
929,704,634 *60D073A26A5B035C43A46A397EF5DE965A33B83D AQvu
929,704,635 *60D4F002AC953E5C758D9D521D0DF9BC2D8B79E1 AqvZs
929,704,636 *60D9CCE231C15A705DE70979F690366E24DB0704 A&QW#
929,704,637 *60D491F4ECD430D22F0FE00AEA85F399AEC2D111 A-$qW
929,704,638 *60D7A92F565758E6D070F1119E3D673DB1D7FFA6 Aq$Wa
929,704,639 *60D9F0606E05E516F129FEE33E39727C17A01FD3 A+QwB
929,704,640 *60DEFD22076AA28AF2E12E067BE266D118562568 [email protected]
929,704,641 *60D7445216586E8C1D80F8734CCD7B28EFE8347D [email protected]
929,704,642 *60DC58D60FAB2BDBDB3D37FA8910ED312679C187 AQwP!
929,704,643 *60D669AE9AA514B61E42719F7A3A601501F58F44 [email protected]
929,704,644 *60D37C322DE4A2D4776B4D36D50B4CE079406188 AQWts
929,704,645 *60D47AE428E4E86011A3A70AD43422EDEB9AF0B8 AQ$?X
929,704,646 *60DEE974C3EA482F0EAF299582BDEE1EE83B81DA AQX;$
929,704,647 *60D654D1C35500CD9EB762C898F0EFE6840545EE AqX+"
929,704,648 *60D9BDDBD62C6E6672F9D868A2557F6DF2C595E3 AQX4=
929,704,649 *60DD0B10512568C2B2188BBD3F310913D19BE768 AQX9k
929,704,650 *60D38E50693525F0FB05B329ED8F7A6B2B024D7B Aq#XN
929,704,651 *60DAAF129F9F7B94141BA5F4347B7A658C887E9B AqX%T
929,704,652 *60D128C188F3EF8F2AC1A3239008789AEF3DCC02 Aq-Y4
929,704,653 *60DAEEF36C26EEBDE6C2C44465F4CACF8FB8C5A6 A,qY6
929,704,654 *60DCC98586C3DC16403041E46F1DDFF57945438D Aq,Ys
929,704,655 *60DB5824AB2240B6F6F57F6B57B340AD282F7B2C A?qZ4
929,704,656 *60DED24D6BA4631BD515163D6D7BEC674D2FC7A3 A+qZ7
929,704,657 *60D27AB9DCEEE1C8A08E3FE338AF62F30ED588EF A$qZc
929,704,658 *60DF5308C35BE35A8AC8A74C85EEBB2D4E31B8C7 [email protected]
929,704,659 *60D891A234D36BD9E52661452064E201EE778342 AqZj/
929,704,660 *60DA325CE8046C7FC5FE99C47183A893CBCBAEF7 aqzpn
929,704,661 *60D79D611EEBD318249AD1D424C3B7CE3A9D2FF3 AqZve
929,704,662 *60DD38F08C3918EB7AD0717A73A5060E37DAECDB A-?R)
929,704,663 *60D1A28464F84D508733399D094268B904FEEE8C A,=R%
929,704,664 *60D302F950FD867C1995194D9FBD5E654BBB7729 A,:R;
929,704,665 *60D44FF70F809FCFA8D8B91F68FED01F8BB958A7 A!?R)
929,704,666 *60D5556338D0A045E7C98C346E0B08C4E783A51C A""R:
929,704,667 *60D6B6B4404997622CA6DDB6FD98CDD71F404172 A]R`
929,704,668 *60DB7D5AF64AEE878E7ABE45FD20ED6CE2879072 A_r-?
929,704,669 *60DF8B2A974C432F501EE002558121B6BCD769D0 A,r")
929,704,670 *60D69C360819DF7458C55EDEA9C704175D43CF4B A:(,r
929,704,671 *60D127EE34C1652A020C9A81CBE48508EB80596C A!_&r
929,704,672 *60D7B144842ABBF8541C716BCD2DB56AC25432B0 A??r!
929,704,673 *60D4484520A3C8300591948CDFDDA96B5E7976B1 A.-r&
929,704,674 *60D7CF164520629A842D2D5BF4B9F6A5E133E395 A#&+r
929,704,675 *60DA67CAD80579C1132014CE558A67609B75C730 A+!=r
929,704,676 *60DBB58ABBFEBB05404F896501AF96546C473172 Ar..(
929,704,677 *60D073BD6852EB5A1CACEF7429FFE1A1CF174889 Ar00213
929,704,678 *60D6D691952C1BE8E0D5D3EFA005241EF0A12AF2 Ar/05
929,704,679 *60DCF77E150DF55854A99BAE383C6175BDD84174 AR06D
929,704,680 *60D97C4C4CE3FD696C80D0492054960CF2C52B5E Ar0cB
929,704,681 *60D551178E888A439A1201D0783B3013C6223B86 Ar0mK
929,704,682 *60D109C256507A86AE178706728E1CA0763F6459 Ar0Oh
929,704,683 *60DB9464B83B40656104CFD2AD67BBEB2BBB1BD4 AR0VSFY
929,704,684 *60DBEF3392BF221C4339102514A6A3AF5E703309 Ar0w
929,704,685 *60D55EDF7F9AE594827A320490A88F76E1F99C20 A/R0Z
929,704,686 *60D6FE0E1C5CBE4F1CFEB7827A8D94A536ACAFD8 A;=R1
929,704,687 *60D98A2EB546A62A1BEDEF7D3D1B12B62938D7E7 Ar!1&
929,704,688 *60D1E899CCFB894C48E1B2F9C9C13721BD822304 A+r17
929,704,689 *60DECA07D690501B13D51335F4EF62E862DA9F31 AR1HA
929,704,690 *60D8D844276CA32AD0DD1EFB1AC0F183F6519C7A AR1m
929,704,691 *60D0BE82CE024923C94DE70B3CD55C23426FAC50 Ar1Q8
929,704,692 *60D0710E04A7F980B9B573731AD5E5282A12DBC5 AR1r!
929,704,693 *60DEDF0CB0276FD5EA3993AB1ECDD627360BDADB AR1!Z
929,704,694 *60DF07BC8B670A29833A2A9C7D4FEA478C6AC251 AR_2:
929,704,695 *60D9BF56088D7B471662EB68C119FFF09537F09F Ar;2-
929,704,696 *60D546D6528F339076EC7B60042CD3429C29CEC7 AR2006082700747
929,704,697 *60D991256EEB42F3EDC0178D3A00F27DCA1BB82A AR2006091600674
929,704,698 *60D7D5E325ECE87921271AA20CC0A93EDAE33A36 ar2007070300588
929,704,699 *60D21773C82F7CCC52C3DA54D62C31373C1BF550 AR2007082501474
929,704,700 *60DA611097660027A6A4BADFF13B23598A47880F ar2010042804063
929,704,701 *60DE82348BAD2FF20E22FECAEB4F0B721C97F117 Ar2AM
929,704,702 *60DB428831064D717BA68A3DF854641E6DD30E33 Ar"2b
929,704,703 *60D6CFB103CB1486C76EFCCD6A2C2050D56C9CAE Ar(2S
929,704,704 *60D7F46730DAEC0F34CB95EA18CB6FBD24A21E1D A(R2V
929,704,705 *60D29F0989BB89AB282BCAB77055FE7BC9537D25 AR38j
929,704,706 *60D37B55A0BB363B7616D5F6D62740BA56DA6FE5 Ar3OC
929,704,707 *60DCB2701CDA94023D9A6468EB249CBA2299FF2A AR4.T
929,704,708 *60D7BC5A3B83E2B3C1F243C94491274EBD139C65 Ar4Th
929,704,709 *60D7C810D63A7C9F06581175481B89EF41BAC7AD AR4vN
929,704,710 *60DF76A06D1A13B3A53B60BEF663FD5EFF12A76A Ar4_Y
929,704,711 *60D4AA7D328BC8A6D57A561CAA6E58046B8A86CE Ar%_5
929,704,712 *60D6776B2E82929D1BD1EB372B05F85A571E8777 A!r5g
929,704,713 *60D25DAF3E88849BF1F2631EBB9EA9D7AC209C11 AR5Gw
929,704,714 *60DAE53112F1EB91568BEAD24F4827A5757F284D Ar5QH
929,704,715 *60D94A2054606C9E2F220B2028E560CF78746439 Ar5R(
929,704,716 *60DBA0DEE45E80F32DF577B44FCBC83B2EB1EE0C A!r6/
929,704,717 *60D5A76E2D308BD53EE4916D2210BCF5555BECF5 AR.6M
929,704,718 *60D973FC227E171744A473DF668E9DE81A2F7DEA AR6m"
929,704,719 *60DF95F725E7A8590E5B05CD228497EACBB2FEB7 A,r6O
929,704,720 *60DB8CE19CD468B6A7ABFDA1E8561A7C2778687F Ar(6S
929,704,721 *60DD72E3746603CBC5A3838038BF4574855DB8AF A)?r7
929,704,722 *60D0E03D9F5BA0FBC0F51DCBF8F31083D3BC66C9 A$r#7
929,704,723 *60D642838F498D28894C149BE3A7E3BF371E4272 AR7!N3SS
929,704,724 *60D6137DA3ACE7BB74AD54F31870EDED4F67C514 Ar817rar1n3ss
929,704,725 *60DC5A673E3A68B6CA3FE5792A9E6F6F5DACC9B2 Ar8B6
929,704,726 *60D528C00A3DB763520B0AFEFB80553CF8520FAC A/r8K
929,704,727 *60D246C8DCF6FB62287E4D68FCBEE6EE13A04590 AR;,9
929,704,728 *60DFA8055ADE0989CE24833E8D4A7C1F09140095 A%r9=
929,704,729 *60DC936155B96095A98F5728054D27D0BC07A467 Ar9EZ
929,704,730 *60D347C3689DE56BC2049D3FE9D248519AEA37BC AR9#H
929,704,731 *60DF5A5DE0DDF42B71DCC42DCB655578BDD4474F AR9!M
929,704,732 *60DC735890E78A6C316BD9006EB4D1BC8481ECE1 A_;RA
929,704,733 *60D8A8F41110F44764F355C395CDA3995E27970D Ar)A#
929,704,734 *60DA5DA98D785BC46E4A276E676262A028429785 ARa8/
929,704,735 *60D00A3191155E9762D67F34E044DB326F90FDE4 Arabella651
929,704,736 *60D5EE6C690798C3496F2C98666569AAD412A96E [email protected]
929,704,737 *60D9F394AA4ACABBA069EBA930C9D1659ECD59D9 arabeszkről
929,704,738 *60DB40C824E66C1EB918E9B725A7B95B8AAB58EE [email protected]
929,704,739 *60D44033AE315651368CB2D0DF9DABDBBB053A50 ARABIANJASMINE
929,704,740 *60D538EA8520DCC3F60E8AA9C36D5BFB4B55E76D arabictalkchi
929,704,741 *60D3CD14D67A00EDB61C49739078463A61017C91 ARABISME
929,704,742 *60D10832C53E2CE3BBBDBB1944BDA4920CC356BA araçalrın
929,704,743 *60DCECC59B5AC54395C829360AFE4857A00D346D aracelilomeli
929,704,744 *60DCD7847EDE2F60084879096003BFCD22DB317A Araceoe7
929,704,745 *60DF9C8B6C2149FC6D2CD57D481525913A6AFFE4 arachaeopsylla
929,704,746 *60D6B628A9CD4BA5936C17A96A3DE60C8B210493 arachneon
929,704,747 *60DC3636949B4B4D1B18D4DD9004965F31E4EF29 arachnephobia.
929,704,748 *60DDD75F8B04702A20BF28AE71EC0BCC06252040 Arachnopeziza
929,704,749 *60DA659EFB5F0C7872D35E80CD2885763E0613AD aracıda
929,704,750 *60DF6504D64F3293021A13CA0CAD4C5B06BCDCD7 Aradeurs6
929,704,751 *60D28D0AD4A1CB0027084C4A17C46E4BE3F58AF7 Ara_e
929,704,752 *60D7353C97F190838CB0D302A7CB551AFC9A0CAB arafat robin
929,704,753 *60D664419FA00A71C7FC9EE97BC1ECA1DC0A4266 arage854
929,704,754 *60D6D4BD7E1B680ED0DB9388DB2E122991690E61 aragoneshotmail
929,704,755 *60D7A373D19D390EA37BA06C66E608A4776DC614 Aragonite2
929,704,756 *60D0E5B8893D2039E6EEFAF8D17573A2173C9EE3 Aragoogara
929,704,757 *60DD7928170032FCF68C3DA0C7ADD953F55DCC33 aragorn(feat.rbx&quazedelic)
929,704,758 *60D11CAF00CF8C8207CC10B117B94C82BB53C428 araidhe2
929,704,759 *60D1BF82CFAF15612AF2048D85E930F4E80E2F8E Araihc 1
929,704,760 *60D0FEF21E32920CCF54086E3BDD66F20C00CBE3 arakatzeaz
929,704,761 *60D2B6E02EF8C8E161F1D1411679D86CBC84131B arakhachtryan
929,704,762 *60D6A061420622D15B33CC2C70B9310EE297E81C arakidoniko
929,704,763 *60DB660EE0F360CD4D486B2F0C5C5DB4E40F485C arakimu
929,704,764 *60D41A726C8C08097A0D1864C8958049D9F4F625 arakisumio
929,704,765 *60D9563F2E80F1E775CEB267BF480307F6D554F4 araknofobisi
929,704,766 *60DF5C8662DB514055DF599A609FF205B40C8899 araksmas3
929,704,767 *60DF7493EE1937B5056CD4E14734FDE49710D145 ärakutsumise
929,704,768 *60DF850AAC7B42922B2A213EC653124524599E62 aralaners
929,704,769 *60D1F384E37DBB68E4220BD9139ED605174A7AC7 [email protected]
929,704,770 *60DA0DFC0D6DF7ED6527BDE452C5D4B9A549BDB9 aralluned
929,704,771 *60DF29043484D56E623B47EFCFE1ABFD00FCBD9F aralocs0
929,704,772 *60D3C747E661C797F88C0BF9BD8E70F1E6387D03 Aralovas
929,704,773 *60DF1E675AFC0786C41BBC59399EE671337B344F ARalp
929,704,774 *60D653B091B679106A9F20D07F8DBFEB9FF947C6 Aralutit
929,704,775 *60DDE573FF00703B337ACDAAF5F0427C65D08D09 aramatic1
929,704,776 *60DA06ECA82D660CDA9BFBFEE60B107F4CDC2852 arameese?
929,704,777 *60D016BB194D3FAA5B4072E78C888FF5BA76B04C aramiswalker
929,704,778 *60DC0B2ABACDB3CFC836E1F7EB23527C9B6E834C Aramrala
929,704,779 *60DD4E66360F69A2DAEEFB3784FCD9C0F807B90B Aramsri0
929,704,780 *60D48E9832C612189752D369400E59B5756B9A25 arance”
929,704,781 *60DD67E146DEBAD1ECDA5A4FC871963808116B5A Arandassienne
929,704,782 *60D4A89831A3F1AA016E275E9AC93FD8C39B0221 [email protected]
929,704,783 *60DE960BC54EE61F6FA78A7E3931AD445C64AB4C Arangerais5
929,704,784 *60DA804680A806077879FEF1FBE6CA2D94EEBCE3 arāṇiṣus
929,704,785 *60DFA137D698DE243D4C83BDACA4CF383228C91B aranmor
929,704,786 *60DFEC65DF1B2B70F5C3AC186B74802E6F282581 Ara no
929,704,787 *60DD4844CB220E961913D035EBD677C355832655 ArAOD
929,704,788 *60DB42D66160ACB1D7E3CCECCD76E903519BC275 Arập
929,704,789 *60D18CD8B53C45D297DDEBF14FDA9E9F2529163A arapbülbülleri
929,704,790 *60DB35311AB7D59950D6FD854B975F193ECB8089 Araporta
929,704,791 *60DE3410E54C3DA0CFDC34A2BFFA80197F66BC61 ARARAKNA
929,704,792 *60D77BD1571152CFA55811E3ECDF05CCD4CF8D85 ARARIKOTAGIRA
929,704,793 *60DBE05893ECEB85D2C8FBBB7060E6E24D51EDFA arasemia
929,704,794 *60D677617F6089443492B71E55585E8C0D220263 arash alavi
929,704,795 *60D05B7142D94641848663FBA1D34B13E4411324 [email protected]
929,704,796 *60D51D13AB7E74A95D7C2F362F0F206A50E1B579 Arasocse
929,704,797 *60D7453C378FC379D19B2C9DDA5E96036873D66D ARASUTORU
929,704,798 *60D8F886DCB6A3CDE0702ABF7F5D9C7F57B9AF95 ArAT2
929,704,799 *60D7588F2C3D92025BA071CB3FF176FADB7B5195 arativoed
929,704,800 *60D02AF69D5F0DB7EEFF2ADEB02749DC745A6173 ARATj
929,704,801 *60D59613973B3D99FE36B780A3A065F2EE7DB222 ARAUCANIA.
929,704,802 *60DE62185E7DC22D2910AC20B27CCF7F8DF1A9E7 araukan3
929,704,803 *60DAB4DD9D6E4BFFF08C90138492965CD7E36A03 Aravenas7
929,704,804 *60D80F8128727965E1392E881ABBC12AA84E05F6 aravosito
929,704,805 *60DBF95A1D3EE094A02C4736C1AE222430DAA0DA Arayu
929,704,806 *60DD636502D7883FC77F0B89B28128152612876B Arazdordi2
929,704,807 *60D1827E9956FEDAC2E6117CD1864F8E3FF551AF ara卻打破慣例於綜藝節目《Radio
929,704,808 *60DD943189D7ED7C120305EA6FF08B4EAC2E186A AR;B/
929,704,809 *60D927314E465DCF36E0AF0A0A6DB294649735DB A#Rb;
929,704,810 *60DB19B6F417F78C511AE7A35F1E830D00048E1E ARb?%
929,704,811 *60D57868DB321D770B02CCE0F390D546C36DD582 Ar_B
929,704,812 *60D934556531BAC164B2E7AB6D8B3E1053A937C5 arbanesis
929,704,813 *60D722F1EED656ACED48ADED3B4E9C31A8285349 Arbegarde
929,704,814 *60D9021F348022891F8511201C917E67D893C6D4 arbeiderparti
929,704,815 *60D1E16E4184AABF8BA57E1A6478478DD21BE6CA ARBEIDS0
929,704,816 *60D6B6336C3E79A995DB30156472A3522D2170D0 arbeids
929,704,817 *60D26BD9CD8DF364C6C4A7DC5FBDBCB1FAF28870 arbeids
929,704,818 *60D2124A36C3D8044BF11DC03FA362637F0E88EB Arbeiterklassen
929,704,819 *60D21A023B865F700C7FCC558DADE33735C81A3C arbejderbevaegelse2
929,704,820 *60D9E7F450622B5E953A9DE422BE72A7531AC9EC Arbejdsdag2
929,704,821 *60D88E3CD3AA0B5040318E7D41EFD2712FA2AECD ARBEJDSGLDE
929,704,822 *60D0E0807595B5F81D80D636492AF5BD6B8282A9 Arbentissa
929,704,823 *60DD66AB938435554FAA9DA93F2BF5DCAD07AB4E Arbetsgivarefreningens
929,704,824 *60D61FD4DC18478D202AB0A5219937C4EDA1D65A Arbhcrud0
929,704,825 *60D8C9BFC4C32DF2CE38F51B93B50ABE1335FAB1 arbirarin3ss
929,704,826 *60DF8A105BDCBC97FC53B5D96536B9560318D4AB arbitrayong
929,704,827 *60D5B718CCA2FF2D757FCE2CB43EBDAE55B611BD ArbMG
929,704,828 *60DAFFA565ECEDF4291C92C0A1D37155AF96B723 Arbmocning
929,704,829 *60DB26E7A0DBAD5D6F66D27AA4BDF609C2DE8DC2 ARbO?
929,704,830 *60DB6C8C1337710D540C44D52F39DA01B282C037 Arbocybab
929,704,831 *60D0C29485E725209A605CE3B63CA745531C3122 arbogada
929,704,832 *60DAFB6EC5D31AC36F239A7E4D572861DCA27395 Arbomred
929,704,833 *60DD759B4767321004AF1CBCA65E8DBE487115D8 Arboneau5
929,704,834 *60DB098F6D73E5BC6CAA553F2D70B6C164C0A760 Arbonsoff
929,704,835 *60D4E9FD73B43C9AE9DCBFBA69D879F284DB297A ARBORATOR8
929,704,836 *60D0B0BCE3C63FBA7D0FD5E89C1DAC7D25866CC7 arborerais4
929,704,837 *60D43B46898A98A1A6E5EC5C0516964A7CBEA941 Arbories6
929,704,838 *60D84A4591DEC5D5852448A39F9B998CA2E8B4E1 arboriez2
929,704,839 *60DC6D68B936BF5A08C83DE9B699E0C2D728FBF8 arborizarei1234
929,704,840 *60DCB47A3B56237E6F997EF07BFEDC4BC85FADB8 arborjet
929,704,841 *60D4FD9EB2D4D347DDE4C73C30E102FCA8082938 Arborvit
929,704,842 *60DBE1ECC31169896C2E8BCE241DC966AF252580 arbor),父亲名为康那理惟士
929,704,843 *60D004AA9776503B3A3687CDB22DED958D45059B ARBOUET
929,704,844 *60D01341D68C74277042F6B67B7E30167B62AB5C ʿarbtä
929,704,845 *60DA3E63BCEC45C77126D48C0DFF1F25D921E576 arburdea9
929,704,846 *60DF561168E5C07E2F5FD530F169545C6D30519A Arbusjes6
929,704,847 *60D7A3C537571DBF0A23780339CFA727325CBEF9 ARBUTHNOF
929,704,848 *60D045D72971020D1F9C3952B922F8F292B5DCBD ARbX;
929,704,849 *60D4FC759A2071F57183DC34F4DA2ADE1F9B4FEF ARbXr
929,704,850 *60D7657C426AC6EB276B0303A245033D854C6727 A_R+C
929,704,851 *60DFFB6F72052283101CDC620E19B6299385BE21 [email protected]
929,704,852 *60D8C90905A51D7F41A50D24DAA393CFCE2300B7 Ar!C.
929,704,853 *60D1A8F75CB416E17302AECC7E88F1684A537389 arc360ane
929,704,854 *60D67A65A3F457CFC6607DE910D8E0E8E7A150EC ARc3b
929,704,855 *60D3BA773E6C44C7DDE2D66EA806FBC39A9BA072 arcadeboy
929,704,856 *60D2709249176D56FB05CE0FF0707CE22918A97B ARCADE-FIRE-TO-PLAY-PHOENIX-PARK
929,704,857 *60D57C7A2195F1690EC676FC7D6095F704FC07BC [email protected]
929,704,858 *60DE3F5F0C96FD746C5425FE33CE55555481AB5A ARCADIAHIGHFOREVER
929,704,859 *60DD1FA2B5FD60C7583B53CC186353D2308B1AB9 arcadrios
929,704,860 *60D3AC07F3A3037FA60510604DFD3539432CFCD2 arcaehology
929,704,861 *60DBE33C0AEBE869DC44377ABA230F078DF0FF88 arcaici2
929,704,862 *60D12DD789BD2C175675788BBDA1F28BFBCB1951 Arcallied
929,704,863 *60DA13A75CE2D29E8BE6A035189DC4A85F673304 arcaneradio
929,704,864 *60DB4795190551216A11C6E3355A4159EE7B2BAA Arcanist4
929,704,865 *60DA8713BE16327E0FA20AF76AFB6B77EB2F2E87 ARC-ATOM
929,704,866 *60DAFDFA6FA6D705CAE9F8C83A2ED2562D16FCCF arc.co.ukarc
929,704,867 *60D01AADC509164F60D352A8DBCE0915874D9C48 AR;cE
929,704,868 *60D8A627409478AF6277D316C5E7E9427D3F2718 arce.ei
929,704,869 *60DDA06EC1BE4F15C8712DAB041F16B2E5FAA828 Arcellen
929,704,870 *60DD173765566291BB9CBBD438E29516D4F8A97B Arcellen1
929,704,871 *60D8F4CEF445726C4D2BBD24969167881DE1EE6B arcenal3
929,704,872 *60DE27C38550E7EC14D2C8476D881D83E36195F0 arc〜en〜ciel『chronicle』
929,704,873 *60D7EA715033C7E5BE2C1E3AB635B8B984DC7A18 Arcenne2
929,704,874 *60DC0F4D21C53822BB7682F31E69C6E2390A0664 arch1t3cton1c
929,704,875 *60DEEA4D299A0DC4A71DF2FCCD207B1198410B3F archaeology1887
929,704,876 *60DD5ABFC5080033E575B78D49DC6E60543C2146 archaic-instinctive
929,704,877 *60D8D0A3F1E54000411A84BC3F0BAC2199FF0B80 [email protected]
929,704,878 *60D2135DA4F61741F88396277574E06E928EDDC1 archang3lical
929,704,879 *60D2AB167F1194947769CB55005DB8BE9980A50F [email protected]
929,704,880 *60D354300B95BE61C1D5EFB49027F80E32FC9E51 [email protected]
929,704,881 *60DC58426CF696D9D54404F1E8AE871D2961636E Archardes
929,704,882 *60D5AB1842CA37CB9C56959CAF8FD9C570ED3F60 arch-atheist.5758
929,704,883 *60D900F7D916F804395AECC9FBA968B443BA0E3A Archchring
929,704,884 *60D438319C6DD0AFD806CD730635B56FCAA2AF4F arch-darwinist
929,704,885 *60D78F973C2C08BBE0AB6B400DAFAD997F114300 archdeaconry?
929,704,886 *60D7C06516884C55C5D28C4ED8DEEE9E24D2D9FF Archduchies3
929,704,887 *60D3CA805DDA3879992AFBE9C32F358FB586A807 Archenlandia
929,704,888 *60D6B13E254E87E128123BFF1CE41B6F753D27B7 archet.
929,704,889 *60D6915625D89969E18AC485E3935FBC191C5620 Archetypálnym
929,704,890 *60DBAA28A2C3B28ACD8BF417ABC6340580358034 ArchHillRecordings
929,704,891 *60DC7E00F6E303F0F83CA2860F590255299E1E84 „archibold
929,704,892 *60D3A8C4AFE85C032B9F11D376E52D413664CA6C archie.brull
929,704,893 *60D9AD92C2BC166635852A503604E723E77DEB95 archie.fabrizius
929,704,894 *60DDC45319069E5E9FD134F28798D15724FC8AB4 archie.fieck
929,704,895 *60DD646BFFD7C23905FAF27C9D775F060EC17D24 archie.girt
929,704,896 *60D152E51B191E60224088B92E4D681DB2660AF2 archie.giusto
929,704,897 *60D70788C8BB8E6776D2BCAD18F6D421F6091FEE archie.gramble
929,704,898 *60D2AF4987A35DC9E1A01CA9CB58A62D4DCDAA99 archie.greil
929,704,899 *60D08F532CAFA61F5F4BC8CB9D9D00C7FEB19F9C archie.guiles
929,704,900 *60D2D075C16105037EEDD2097C22FF811BC454EF archie.heitbrink
929,704,901 *60D82AC8FA3352C99C87BE4A21DF9B3592BB34E1 archie.hidinger
929,704,902 *60DB28B4B8D68E001315176BFF51C84430B513D2 archie.kasprak
929,704,903 *60D968752D376DD252D97DDBBEC767A1845DBB03 archie.kiesewetter
929,704,904 *60D739C4856DEF82919E35FC5E2A6D0B237104FD archie.killeen
929,704,905 *60D2D36C030E3DA1E4A05B11FF3E0E2D871EB2B1 archie.kisch
929,704,906 *60D06A3E4309B1FAC3937F780AB1EA03F4AF6525 archie.landey
929,704,907 *60D21B1778C81AA417159762A43017181DB57D2D archie.maciel
929,704,908 *60D34D41C4CACC38AF7D47410767EF4A4D347658 archie.madrazo
929,704,909 *60DE6F9D3F5701D1B8F66E155D9B5EEE172AC0BB archie.mccombs
929,704,910 *60DE020EF48926C10F3E62569E1C7D800C623E41 archie.nothacker
929,704,911 *60D5CDB0262830F195E5A1444CC77ADF895FB0FD archie.ohlemacher
929,704,912 *60D5B6D1979BFA644240CDB7F467506728678117 Archiepats
929,704,913 *60D3CD9708BD0DB28B42C8DE5E47E869F798830D archiepatterson
929,704,914 *60DD04538AB569652DB962D2EB5D62BEC430C47E archie.peddy
929,704,915 *60D796681F56FB5C13B8028ADA761F757776EE32 archie.szafryk
929,704,916 *60D19A218AF5B3C118C322CB4778FC106F706D86 archie.teeple
929,704,917 *60D26805780AFB49E649F66E53B30BFE78582533 archie.tomme
929,704,918 *60DA09C4193005EE9961CB340F02B111432D6D76 archie.troha
929,704,919 *60D29484FF9F8BCC9327A9ACAC1FC1724DC293C1 archie.valente
929,704,920 *60D0EF8A4EA2AFFBC916854565AC4276A386EBC1 archie.vanalphen
929,704,921 *60D74551211D0995286BA9422E3D78BBE33F3050 archisel
929,704,922 *60D29847320FB7C46DA679B020CCC4662F95FB5C architectsforhealth
929,704,923 *60DF3CD3078DAC25451E5A58BBBCDD002F163945 architecture.1
929,704,924 *60D34769C42D42D07E98D18532116B551E13942A architectureclass
929,704,925 *60D8FE8C72F5EF97FD75F9406D297A9D7F6E4629 architeva
929,704,926 *60D7EAE82D5E9600E15CB686487F2DF885167FE1 Archive/extricate
929,704,927 *60DB8E89E5B04428610622B6FB5F445FDE062544 archiveraient!
929,704,928 *60DDBE2DFD84181B457E45116141B4DE2628ABDF archiverez8
929,704,929 *60D1019B6CD6DDB17B891F4819C87B288BF56FE8 Archívumból
929,704,930 *60DA19708C3ED896B06F3755FCADE4EA069CBCE3 ARCHPHYLARCH0
929,704,931 *60D8661F4EAAEFD7CB14957D2DA40D535CBC9477 Archseeses
929,704,932 *60D54F15B0FEFCE84289BE2D7D6DDE33A1F2C756 Arcicofraternita
929,704,933 *60D2B1AE3E975A0DE395EF5F49BAC3962375B102 [email protected]
929,704,934 *60DF1475223564A4A5D5EDE7584AF00BC66719A0 arcifer
929,704,935 *60DC08B99571833299C4A4636A16F6884F2D6FBD arcitecSee
929,704,936 *60D46BC1E8C12FE326AD6115CD09D1513C6B2145 arcocentrumed
929,704,937 *60DD7D0789546C8D7396D282C05C8C0730CCC6FF arconadan
929,704,938 *60D837AA8F1E361B95406CDBC9DDC3246E9B73EB ARCTANS
929,704,939 *60D075168B256DA40EBDE559EB3F5433C0042CCC Arcticone8
929,704,940 *60D605FAD22CA4094605553E03F5C87BED3595E4 ARCTICPOPCORN
929,704,941 *60D92947CF48CB7F8ACAD24902CD908D90DD7830 arctorius
929,704,942 *60D6BA7427ECEEBF1D35D525D8E08574177DE7F2 arcturellina
929,704,943 *60DD6C73AE80640A1A769E09AC7DD7B52CE8F5D2 ARCTURIS
929,704,944 *60D4409AC2B631D7A53902224BE0273D390D51D9 Arcturus Dominion 2012
929,704,945 *60D3ECC25349D41B6159358CCE0671C5410E37E4 arctylos
929,704,946 *60D82CB82999AF6FCF0A5F1DE835CA358AC63D94 Arcu4
929,704,947 *60D72727A9CA505AB751C3F54F3C67C88A26F06E Arcuques
929,704,948 *60D9BA135D43CFE771CCF3F8404303A736DC72C9 arcv335
929,704,949 *60DD481E9AE86F0C21AF73A3621444F230FE27FB ArCVd
929,704,950 *60D94B8EA2A8777A1DD761637481501663F7ABD8 Arcwr
929,704,951 *60DEE61676DA485F48B3BFDB10E826B0285FB90C Arcyhovskii
929,704,952 *60DCBBA027CDEDF1A5A9E1BFE83E42A16A7C328E A=R)D
929,704,953 *60DC95BF799D2941C24157BCA8524510259B8E0D Ar(d_
929,704,954 *60DD69C5BC55FDE087BA09F9F69C4C7EA35DD60A ARd%a
929,704,955 *60DA2D022DCEB8F5F5C1090195C5984F70D5E2CC ArD(a
929,704,956 *60DD22F28698B637CA67220C289D2786E6298A3E Ardanza1
929,704,957 *60D72696C33B8F8719A2594DEF5361CE1DE53639 Ardasev
929,704,958 *60D3E6528C2E12B2E2B0DDE44815C29451908ADC ArdbX
929,704,959 *60D559DC9ECFE17465BFA4C34DC12E752FA7F293 Ardehsn5
929,704,960 *60D8995CAE6674572A211CC48B91D1984AFBDEBA arden.buresh
929,704,961 *60D37E4FB8AEB4FB6446510CBDFBB1CB5E2FDA4E arden.ciaccio
929,704,962 *60D7C2E75F3727AE72EBE39D43A937A5FCFBBA5D arden.cinadr
929,704,963 *60D6FFF6DB59B4E795595A2E37BDE7EED1736AB5 arden.consigli
929,704,964 *60DBF08D4102B8355C3D062313BA398A90C8CAF0 arden.cun
929,704,965 *60D6F6606CB0AB110496CE5440227073B422432B arden.ellsmore
929,704,966 *60D9F5CFBE81C953179647439C38F93C9629D8E7 arden.erwin
929,704,967 *60D92F509DA9162678202EF05ACD6D19429BA811 arden.gizinski
929,704,968 *60D8E88ACF6133DE544F04D8833DB0EC89D1D546 arden.kuttler
929,704,969 *60DDC56111D2398746DAF248DE53DD0AC497B853 arden.machuca
929,704,970 *60D5DF0F0E9E9890F4BE46AD82F00AC40E305304 arden.mallick
929,704,971 *60D599EE479303597754F2454F8D5614FCEC984B arden.skane
929,704,972 *60D9A0B4DE16B78B4F3E28456B918DDAB92B63EA arden.soucek
929,704,973 *60DD8F4445A37D542AEDAED72E21C936DF943764 arden.sroka
929,704,974 *60DF916956815B2DC70674A9B6E4A891AAC43B00 arden.stimson
929,704,975 *60D5044EE25FBD4190631D578992ECB280415FEB arden.stittsworth
929,704,976 *60D274B0DFA7E5BDB29CE591AFC77281D9BC6F47 [email protected]
929,704,977 *60D06A09FC9ECAA2CFDEC1E8177103BF4D4CC444 arden.teitsort
929,704,978 *60D07C21EF9ECCE183E5B8C092FA19D4F2A1CC92 arden.terracciano
929,704,979 *60DCC0E8FAEFEC8D342D1C475AB51CC030B015BE arden.tullis
929,704,980 *60DD387A616AEA95EBD097E77BC735B36F1D023E arden.vanlier
929,704,981 *60D911C78AF142EBE9DE80B8D70A345683A736B0 Ardevaas4
929,704,982 *60D4C5921E78AFCC86DC49E76B54ADFEA2B60924 ardha-magadhi
929,704,983 *60D965A53F68C0A9CA0B89B69B04FC9CF0DB2848 ArDi;
929,704,984 *60D4C030750D9B2E3483AB73B9471D5C50F832E9 ardıclı
929,704,985 *60D8B9CFB4A7192EFDA955CC01914899DEC21786 Ardiendoenlanoche
929,704,986 *60D822F08B95246B4D0D31DD796F8F7B31B7417B ArDlY
929,704,987 *60DFA7DD143077A1EC4EF80C816C907F37152129 ARDMEEN
929,704,988 *60D7F139FB98F6D523CDD89680AD3FEAFD91672E Ardnete8
929,704,989 *60D984FA0F57C1C838B3453CCFDF92835313615F Ardneytas
929,704,990 *60DBF6CB971A9E43C6DCB65E669B48E0B4BE4172 [email protected]
929,704,991 *60D32131F32CA7056AB4694E462BEA358CA65168 ardniep2
929,704,992 *60D1974F20146CFB7AD9D71FBE37F88E22E5364E Ardnuhal6
929,704,993 *60DF1913927612B3A47117875EE0518B60FB3D71 ARd?Q
929,704,994 *60D9D6F0ED565DCCE8D4F1D65FBC39D126D433E7 ArDQ,
929,704,995 *60DB13FB7C0F680D842AA446E58A674DC83578FF ArdR-
929,704,996 *60D761D4AB6AA1EBDC4EA529147D57626C206098 ARDSLIGINISH
929,704,997 *60D35C1C770A0BB92CF5D4D9AC30C54883C8EBF8 ARdYV
929,704,998 *60DD652EBF4EFB61F6C5B31943019F31180DA922 A/RE1
929,704,999 *60D9E5A9F660AF0AE566F02E350F08DDAE724666 ARe8k
929,705,000 *60D500B7370753E78A725E7B955D20BF0B74640F aready...
929,705,001 *60DA76667B7E9A74B8E31B0E6DAC6F8FFE2C5619 arearesourcesintrodu
929,705,002 *60DF87C0D3DCBD80D2B01E58644BCFD09E802C07 area.right
929,705,003 *60DC5E3A0E8B07F52B91463F982B6AC53B4AD889 Are as defined here. */
929,705,004 *60D67D9CF715C05841D02DECC1427B924A43966E AREA-STAIR
929,705,005 *60D0C4031E4E9F26EDC5E9787E0589FC0A3D0EFA area),位於
929,705,006 *60DE979EF65E7DA1F7F8E9DDFB894D1FC10C078A Are;b
929,705,007 *60D29CC1BB577CB10F24FFF252775FCA1B20AA7D [email protected]
929,705,008 *60DF628997846FB382EFEFC8201AB3384244B0B3 Aredaloma
929,705,009 *60D48708DEBAD0494F47FF6F905AA645A2453B2C Areddalking
929,705,010 *60DEA25DDA46312A02E5F178B538951B4B9E3962 AR-Ee
929,705,011 *60D04336EE8D5567E18B9B29969CCA6746EF26AD [email protected]
929,705,012 *60D1389CEF9A1AE44234C945AD40402CC770A445 A
929,705,013 *60D099FFA7363A44F911C0723434CE9D25628612 AREGENTIERA
929,705,014 *60D95C35D330675C945C7666039370C1A27D7618 Arehcnarb
929,705,015 *60DB3DFCA249E8A5134C6223120630D9C82B104B arehcuab5
929,705,016 *60DD8B7A89E5375BB4647693F73503A7B17D9B24 Areifilauqsid
929,705,017 *60D881300D847F36C730486207881033060A411B areisd.
929,705,018 *60DADF08F18635790C061177541F2A67CD31D219 areleth9
929,705,019 *60D69DD137FEECF58D50CA6AF4F55CFA7441136D Areliuses
929,705,020 *60DCCC34EF4F645A6871E8989B887D8387EBEA62 Arelleum8
929,705,021 *60D372D45D11CEFBF44269DFBB68E94410A93545 ARELODNOD
929,705,022 *60D7073E29F8F4EEB3614A5F4BCDA1CDD81F7182 AREMAND
929,705,023 *60D2FBFB98A7B494C72826B88E90429EE8FA6935 A"Ren
929,705,024 *60D9F8390205B9BDFA41F3A4D46AAE33DA56273B arenafosshaugane
929,705,025 *60D2A3D83081C2CC77A7F3BB7409ECC7117ADE71 Arenalle6
929,705,026 *60D470C8A38046BD88008E9380DA14CA5DC78738 arenas0609
929,705,027 *60D9CC06C6952218C1DE6C37D209A1F8B1C24BBB arena』のゲームエンジンを用いて製作された『openarena』のスクリーンショット。
929,705,028 *60D8F154B2B02F72403544461DA60C62A71C51D2 ARENDALHERREGAARD
929,705,029 *60D41C5A5A1E24CCFCA07507385A3877B1564335 arendia4
929,705,030 *60DE5DB19EFAA2DC568629ED01BC7B54C157642A ARENICOLE2
929,705,031 *60D407852DBCD6E634F90AAE23E150EADB8748F1 Arenicolite4
929,705,032 *60D2FC375687460BFD147AA96BAACF5DEA979D61 Arenoth
929,705,033 *60D26B9993430AC7BD3E76D374C4252FEE6A1CD6 arensky9
929,705,034 *60D9D1DB05297F0C447D6388DD7C2D4701BE40B6 arent.hoponpop69
929,705,035 *60DB5B266C1B53792D610E9E58B38200FE24AB36 AREo_
929,705,036 *60DD9758650685E03F2302BFC22474563500DD39 Areometri9
929,705,037 *60D3D18A8A3B104E661BE02AF80FAC875ECB79A5 Areopagite4
929,705,038 *60D3C7648DB86A9A1DA118D2AA072592308D2412 [email protected]
929,705,039 *60D8A553EF0CD587B98251DF46832F7F01CFE50A areplapping
929,705,040 *60D02090EFA11C4BC437B26A576A57C59629F0DA Arequipáig
929,705,041 *60D54511F6C6A3AA3F1FE0DD1286300A5E1C4CB5 Arequipeños
929,705,042 *60DDABA15D71DA9A49268B6DF4000318054641E3 ARE
929,705,043 *60D30CFCAFCE1A40F94005711B34CF225B67AD06 arer1ole5
929,705,044 *60D49CDD161BC37DA57607B9326EBDBD5EAF645D Arerdneg
929,705,045 *60D1903AE9D33BB849B5F7A75C1B8495A2558229 Arerudne2
929,705,046 *60D26EE35EAF2F76E7A6CD0D4D42A7D7BFC709B1 Aresaine
929,705,047 *60D435DEA484536F484C34785CE05FCE25BC6F98 ARESEARCH
929,705,048 *60D1B818619B97E8EFEDB9590681EA4BA3DB387C aressiab4
929,705,049 *60D76CC2B11D622459760C1DF49D5DC9FE1F2BD0 aretha fields
929,705,050 *60DBB1C1D2716F6FF9261B6FAE130E929CE0178D aretheycomin'forme
929,705,051 *60D597930E1CA1F24F97A078CEEE764192DC5720 areties3
929,705,052 *60DE597D20DD22527777ACB2A6FF6F2C04854E35 Aretiraming
929,705,053 *60D9C34B8F33398E85D37D37834418CAE1149BD7 Aretluda9
929,705,054 *60D05B0E3B8905728424BF13D2245BD6BB5B1206 Aretpmexed
929,705,055 *60D7617B391DD889C3C1D222F08A212D0DBF0984 Aretsisr5
929,705,056 *60D1F23A7682BEF7BEDCB3D9F00482D56D22DB46 aretsuk4
929,705,057 *60D7AFB44E017E06A01B3D58F2750D3F9B4E954C Arettuog5
929,705,058 *60D115C9545CDB1F3059F49F58EA674225DEF6F9 [email protected]
929,705,059 *60DEDA1A4F6AF77DD3067615325038697979923C [email protected]
929,705,060 *60DC584F4085FAA39C2A44C8FD4F6A20618CBB5E Arevstewed
929,705,061 *60DA9F64A9FB7995FD0120BCEFFA08A414261119 AreYouThere...(Newmix)
929,705,062 *60D8EABDEBEDB0A690E4C071A3843A0C5501DF7E Arezzamming
929,705,063 *60DA14FC12AFA23F424C530C5C37D491D9AD5FD3 A%r?f
929,705,064 *60D824A2B52D103F29114DF477DB57665ACD915C A
929,705,065 *60D0E4B6E4D8A27E5F1B2FC4F0184228356071B1 ARf87
929,705,066 *60DA6EB291A049984803EBAFD762A1695FF4A2A2 Arfc$
929,705,067 *60DEE9BB8117D3F740071BB8962871DBA80E753A ARfEQ
929,705,068 *60D3DCE451070D3D120D38529417A6F119875F4D ArfeU
929,705,069 *60D77489336FEAF16006EBB96A982FC13C6DB34E ArFfi
929,705,070 *60D6D6C50408B321CFFDBA4D0D506701446F7FBF ARF#H
929,705,071 *60DDD7D0C0C11A7710C00FE565EA17F51230AD2E ARfIi
929,705,072 *60DE9932BDCC46F53EA29B49B54C1181B3CA9C69 arfillite.
929,705,073 *60DE0309ADB1F504FADC6693B86890FF89D57D09 Arfinnss3
929,705,074 *60DA713CE7FEB62669F059EED22DFB4D349BB78C ARFIVI
929,705,075 *60DC277AFC048546B5446A349DA9FF25027D27E4 ArFjV
929,705,076 *60DC2C0C382EA48CE9892F4CA944B9A19B4D9120 Arfnetu2
929,705,077 *60D55A39FDC21D79B111DBBB9A795E109DD33B63 ARfNY
929,705,078 *60DECB6167E9379C3E235EF2551F7387A58807E7 A/Rfs
929,705,079 *60DB9013C9BB6E645DE5FBD510F686FE70C07EC7 ARFURDOG
929,705,080 *60D5FCA7188F3AACF230E1709125805BB5E09BFC ARFUTURA
929,705,081 *60D5257D654ADBD61122276D7F1FFA1EEFAE70A4 ARfW%
929,705,082 *60D51AA355DB10868E433901C400E3AE97EB03C8 ARfZs
929,705,083 *60D9B9C97F5BC04E019FCF903DDE3AE2452CC65C A&R(g
929,705,084 *60D866E8576F61234FE28983E764E97F80F1E904 A=Rg1
929,705,085 *60DA15B392B9F71D1884034E9A2F0442D7C24437 Arg561—Val562
929,705,086 *60D5D4E9F78CC5D4C0F4DCBA5B6DC8F22C60C52F ARGAINOR
929,705,087 *60D79B6C7861B5452F39634776D4B70A60D4BC11 Argancon
929,705,088 *60D45A76AF33D62615177638FEE2435D2C0404B0 argath.com
929,705,089 *60D2788AC3E2A7662A30C3D239ED3C61BA58C234 [email protected]
929,705,090 *60D1AF0CF8A31E6FDA5BCCEB743578354E92A8D6 argeeay7
929,705,091 *60D8476B59E6E08FFAAFE432353F419EA9FD44D0 Argelegt5
929,705,092 *60DE782C7DBE236FA76E7EBF13389ADF0F5FFB0D ARGENTAN0
929,705,093 *60DE40C330D18915262B916AD73292D26740D630 Argentee3
929,705,094 *60D84038BB0A90FC638CD5DED206EF8E7AB824BB argenteosignata
929,705,095 *60D4DF55AADDB7C2722B72A9CA2486C7C568CEF2 ARGENTIINALAINEN
929,705,096 *60DAC1F7A42CF2950C83C26CB443AD5E3C554D77 argentinA
929,705,097 *60D67B04187B916A09CEDE0A38FA883B8542E0AE argentino'-'argentina
929,705,098 *60D50812E829A3FB5BE6B7C70CFAC76320101F3F argeos1234
929,705,099 *60D73AF42035B9647C3E69E7B819AE2B70BBA06C argerdi
929,705,100 *60D988F8721AF1DB6739AFBC0FEF7CBF3E592800 Argeses2
929,705,101 *60DEAC29B5688601564F824166C02FBFD69E95B9 ARGEUED
929,705,102 *60DEA4980D5B15D133F590FE3AA3F9834BAA6C8B ARGFest
929,705,103 *60DAE15088BF87995D433119D7B36A16390E6F6E argfile123
929,705,104 *60DA8FDAF788CAF5BB462866EAA2818685D5E9CC ARg:g
929,705,105 *60D0B76D917B33642E6CC6533507133B8FD02A0E A;rgh
929,705,106 *60D6383E030C16D23E728D29686E2C78AD93EFB7 ARghw
929,705,107 *60D3EEACFB43ACB7BA19808C5FA387155B3A1999 ARGIEMH214
929,705,108 *60DAAA45EDB86AFB6D7D4FB72F318253ADB96A77 argilioy6
929,705,109 *60DA19E705BEC1172BADB5315AE2CEA968A5EE85 Arginaste2
929,705,110 *60D2B5C73B5422BF82F9067A2CCECB56473CF43A Argitcer3
929,705,111 *60D1EBCA6DFB3213706D6E556794A2BAD0E3777B Arg.N
929,705,112 *60DB92CCC09FC8D280900C6C41074B6B1968FF41 Argolicus2
929,705,113 *60D0CCB182B44CFB03688A35031456DACC67B598 argononsed
929,705,114 *60D6EF86E1C01E2568A6FB36A57A7503B30A94B6 ARGOS1213
929,705,115 *60D3F0D3E1151884C081B7863C1242B0E5646FF7 argoted
929,705,116 *60D0748C2DA763902959F5DFBE4F8D27729572A7 ArG%r
929,705,117 *60DA588525D2DE563DE7D4A85E730BAFBEB994FF arguciardes1234
929,705,118 *60DE2C7753C0709EC23E64DCC5AAC5DF4CDC79FF Arguiate9
929,705,119 *60D3CB7BE83B6A4B1D72E41490B9462A086EA3C9 arguilh
929,705,120 *60D33B3ECC11A2D9CBC85862F8909A0D31FFFABB argumentowanej
929,705,121 *60DDA45717DD2E9E60F5AF0271D7065CD8CAED50 arguments.cberlet
929,705,122 *60DDA6FA40C82FDC06DE83305B03F3B80ED31D3B arguments.edwardlove
929,705,123 *60D3DD207CCD8A29BD1ACCD79626374D95CDEDE6 arguscom
929,705,124 *60D63C00D362B8BB5B7B1D2A82A08E597EA1D8FA arguso
929,705,125 *60D8F823EDEE2D51A8A77BAEE57F2AF547DB2D86 argutare4
929,705,126 *60DDEB58D206362A1CF90DE46D2CF93036C89222 A;
929,705,127 *60D775645DFB2224760DCCA9EBD5CC3C17A5C491 A;R!H
929,705,128 *60D095FD1B44C19F070A6950A69413DCA36FDB75 Ar%;H
929,705,129 *60D947C4C269D22438225DDE0BFBFCB8ADBDFFC9 arhanaam
929,705,130 *60DF966843F8E51DADE7C302D2C01AF398A5B5CC Arhatoh
929,705,131 *60DE916833004B8D6FB85A23ADD46841CE799F5F ARhb3
929,705,132 *60D4F612018D6644B4374C43EF17B9CBE7C47171 ARhC#
929,705,133 *60D90B50205B12B29BD4664E1BB3D4450306089A ArHhQ
929,705,134 *60D94E794C22E396D70CB1511A598F21686216E2 ARhhW
929,705,135 *60DA42D630318F0E855FB25C3174DCB4BA7DCF94 Arhinia6
929,705,136 *60D6B9A745563E284F86F4064FF650CDB5FFA0EF arhipanpoika
929,705,137 *60D8473C75310E5759BF8418D6A9F5DECCEFD754 A)rhK
929,705,138 *60DF895F4EFC664AC31C679D8D62FD083F0EF15D AR+hL
929,705,139 *60D1F61E98BC0ACB3A82C0CD29693884349C29AE Ar$Hl
929,705,140 *60DDFDCD00543451984F35EEA0657EA9516DDC84 ARHMZ
929,705,141 *60D5B986D31CDF95AE16AD57AEF0F63F8934A251 ARHSa
929,705,142 *60D32894D89F923A12D4C151CE441A86C8F3C526 ARhVi
929,705,143 *60DF3B0638C9FC0E03762FB1C66AF4FB0D954851 arhwpzk6
929,705,144 *60DD3D4EFA715381D8AEAB9148F14FF679176D47 A#r#i
929,705,145 *60DE312448AE308A8392C90B50638FC9316B8EA3 ari200708250
929,705,146 *60D5D47B5BC8C6938CEC29B25D0AFFB141B95790 ArI4o
929,705,147 *60D86B131EFCDC046B302F6EFB824B48A9CACBB3 ARI69955
929,705,148 *60DB1FF654FC549DFDAEBE45DFB358B2DE586E86 Ária
929,705,149 *60DA46B33E2355B5BCDE37469482BAC00EF38C30 ariadne1954
929,705,150 *60D56BE290A4D7D1283491CA2F5CAD3ED538EA3B ariadnez6
929,705,151 *60D932E18A7A9DE5F100B5B0ADBB849932A509DF AriaFromMadameButterfly
929,705,152 *60DEBDB8BE71D25E3F58B3F24800ACB4E5A08893 arianawylie
929,705,153 *60D63CD6C8B620932A1A06A9C7769F6ED001C566 [email protected]
929,705,154 *60DAA7E8B0A3AC716C7D002165C6746BA3DFF0FE Arianecasio
929,705,155 *60D22FBFFD972DC9F990AD8775D0117025433CD2 (arianespace
929,705,156 *60D32A6B32D4F04D253CAB7C025CF88BB1D101F5 arianné
929,705,157 *60D3E8A76CD55927698608D3C51DD14E90F98096 ARib6
929,705,158 *60D165866DAF7451BA8877510CBF604B30897064 aribtron's
929,705,159 *60D63F13C2FF7322434B23C5C1AAB4CF3DA4B1FB Aricins4
929,705,160 *60D2E08563AD522D40F0E2659D98337BCE1A9009 AriD_
929,705,161 *60DBF1DC4DBEA4E00D3256617FAC7CB548AAF8FF Aridaibs9
929,705,162 *60D8D2E5AE5BB449AC031BF2B727E7B40EB82FB7 ArIDB
929,705,163 *60D5B6377CE06AC7D77CB0BFFB6D865824ECCA86 aridnarg7
929,705,164 *60DDC0168EF6AD0F75C22D96853C869F3C5453ED ArIdv
929,705,165 *60DE99A1268F2A165FFF41835C145C52879BFCE4 Ariehcni3
929,705,166 *60DB2B5441118E6F5A9826E16642EA37D524861C ariel.blackner
929,705,167 *60D8C9E9B417127A015EAE03B118F828C30C4E42 ariel.boclair
929,705,168 *60D7013D1BF97ACC25FEA906FAA1B4B0BB84DF93 ARIELBONER
929,705,169 *60D170952E1A9DD17EE06854333401FFB8F35ABE ariel.carrea
929,705,170 *60DD563ACB152EC611654501E13BE216CE79D887 ariel chavis
929,705,171 *60D4A9FFE0CAD05F69917899F5BBA9640D3A9F9F Arielcoolman
929,705,172 *60D45D2D827E4AC22423AEC7C1861FF321676087 ariel.eagle
929,705,173 *60D7D762820AF6892E6F96F3C4134B2B05023B82 ariel.emanuele
929,705,174 *60D202DDF9A86EE1865E81F9F2350348AFC3B052 ariel.fosnough
929,705,175 *60D713097DFACE1C62516917B9B57A130E3958EA ariel garza
929,705,176 *60D4FF413FCC82EAC97D658855720DA2F7D25766 ariel.kardux
929,705,177 *60D926F641828BB32B33BA0B9CF3DD0FD1931EF1 ariel.kubick
929,705,178 *60D94E7792688212CD9FB70560BBD13D90554CF0 arielle gray
929,705,179 *60D993674EF2369A918E9C1A859AC5214DB2630B Ariellucy6
929,705,180 *60D05CC2ED4EE59F5E48AC1E7CF2353E881E691F ariel.ludvigsen
929,705,181 *60DF367029A7CC0B8A007927E5E8F4F0BC728E09 ariel.marvray
929,705,182 *60DDA22A93F2601227AFFC8F2A763F8D3BF5AC9C ariel.neumaier
929,705,183 *60DAB772F74F0B13663A9D8B9166D4B5026131B9 ariel.noell
929,705,184 *60D472A5AECE75F9242AB4D804665F6C93B8E48C arielpetroni
929,705,185 *60D68252D60B71FE4A4AD9A37C155F8DB3788AD3 ariel.piel
929,705,186 *60DB26BDEA8A344AA20F532390320F33E6559D9E ariel.pluvoise
929,705,187 *60D1B1354A997F6D6C670E42A0AD24CE55A8D462 ariel.pridemore
929,705,188 *60DCA60E8C166B10D5B673F93CE73C58D7FCD5AA ariel.reta
929,705,189 *60DBEC32EF74CA8DF4387164BFE5F849921600AC Arientos
929,705,190 *60D05EA08564162464232D447A3134F60D25EE52 ARIERRAB
929,705,191 *60DA5803821716898869F1153EA7944E5C87E5A4 [email protected]
929,705,192 *60D7C34C93C68FAAF8AA4E9D0E337E7A49174DAF ariesesmeralda
929,705,193 *60DFA42C5ABAD1B651BD2AC98EA73E8B00F55925 aries-jacobs
929,705,194 *60DA1A222AFEF781236813243D0FD2189DBF01BC Arietaux6
929,705,195 *60D23AA936380BFC586EAC2A4ECC80C5136360B4 ariewil
929,705,196 *60D89E1CA8B1C63CAEC4930F4F60FA95CBE2B44F +ariffism
929,705,197 *60DB425DD70C53260FE1ECFEAF3AA023644158FC arifulabedin
929,705,198 *60D37FCF07343D8534210EEB6C065F445583674A ariful kader
929,705,199 *60D009657C2F23404654B067C9DF7C788616088B Arihcos9
929,705,200 *60D596538BE0AD1B60062F590BDA19308A7C877D ARIILAN
929,705,201 *60D1E11CD164F2C7DEEF8995CED08FD3BA0C402F Ariimsha8
929,705,202 *60DA93B0FFE5A8DD872E641ACAF86A08830D7C9B Ariinkin5
929,705,203 *60DB216584CB2603418CF544E576EE4BA7C48143 arik2007
929,705,204 *60D4E631BF687F7E09ED4BFE7E07CC9E98F6A268 Arillomar2
929,705,205 *60DD7B7CDB464CEF43717B75A85254863685679D arilpmes0
929,705,206 *60D531FEE98F93989D0CFB9343727C443B0F350B [email protected]
929,705,207 *60DAC37CC08B0FBB6C534DFE5743C5B1D20F380E ARInK
929,705,208 *60D383DB6C11589AB0E49ED54710B42D95C07668 Arioncourt
929,705,209 *60DF0E5E6269276083330659BB035AC2EF87BDC8 arircsed
929,705,210 *60D235B61951C651D0E683D5B4A28788EC39BD9B A%RIs
929,705,211 *60DC0282B0AA3CC174C181E7A56F346DF02F2A36 Arist0gen
929,705,212 *60DEF8AF4A998750F5111A94681A20CD542CABC4 Aristaínetos
929,705,213 *60D3CCD2479770CF0032A8BADAE05AD5720531F5 ARISTARKUS
929,705,214 *60DDE11AEF6749909FED21C7C1C07F6C97FD6057 aristero0
929,705,215 *60DDFDEC5A14AE3695735FDAE91B78AF8824791B aristocracy.bbs
929,705,216 *60D852BD2CF3A9589252ADCB7A598FFA80677FB8 aristoy3
929,705,217 *60DE9BF78A36019D839D698CDE88202F10CF0807 arita!
929,705,218 *60D033CC4C1FD336453230BF1F2C1462BB790A64 ARITHMETICS.
929,705,219 *60D639A51B2415909D78B6E5F2D42020D3DC7455 Aritimes7
929,705,220 *60D200D652653CE0BF11343C899AB12CB77971DE Aritóteles
929,705,221 *60D59E93DC252D1B3A05F6759DECCC9875640E74 ariyde
929,705,222 *60DE0DC86A66CC962A71FD5F7D942F98BCB292AE ARIZAFA
929,705,223 *60D1D3064CF83883000084C164E370D2D9C5C473 arizajr
929,705,224 *60DDD7E6D9C63B895320CD01CEB9C87C93181322 Arizhel8
929,705,225 *60DA69D30BBE488ECBE3B528EA687F164C033EDC ArIZt
929,705,226 *60D0419ED537C1CEE75C22D829720A368736CD97 ARj%,
929,705,227 *60D3842A3C78868EDE492900461E69CA18E3D041 Ar.j$
929,705,228 *60D01AF61140877C57DD796E7E943D6CF5CA30BC A+rj3
929,705,229 *60D5B3CD0D034DAE95054F0BB71B42CBDFB37C21 ARjlI
929,705,230 *60DD7080387D48D6D22355696A0FEAFCAA556536 Arjq_
929,705,231 *60D125D15FC5B83452BEB2377BFF8332452216A8 arjun727
929,705,232 *60DC5FDAD0CD0172B988840D6A51E652DECCF48E Arjuzons
929,705,233 *60D75E9DA9D873D5DD50399CA2C363E1890082B2 ARjYZ
929,705,234 *60DE6D4AD488C447621197295BDCFDA9F5D33CC2 ARK??
929,705,235 *60DD8E903E72D07C2630B51F24BA4A53616E28B9 ARK+)
929,705,236 *60DE4252CF01DDA3298A9F00ED5C2FAF6CEEF941 ArK7"
929,705,237 *60D8BCF55E79DC14BEC75DEF69DBEA0963A0ECF9 Arkaavaa9
929,705,238 *60D533E8EC10241D2C3381F372CA4B17DEA7E11A arkada4u
929,705,239 *60DDE37DACE9B3DE2947CDE4DD85BBB047343FE7 Arkaduy0
929,705,240 *60D7CA57B9EB87B7DC40F2EA89BDC36C7C7424D4 arkanđel
929,705,241 *60D2467AF0C328B74B4FC48FB8980FC01CB4DCEF ARKANSASFANTASTICS
929,705,242 *60D980BAF4116B3ED84C20B3E1A40B06FEF75800 Arkansas: Kentucky Warbler & American Crow
929,705,243 *60D02D55C3AAF5DF2802F3F2103413C7EF35EE9B Arkasından
929,705,244 *60D06435BDC896CE09ED8BED868B69AEC5947DAD ARk!B
929,705,245 *60DF6897753903A3A051701D8288FBACE6652F7A ärkebiskop
929,705,246 *60D5BC1CF20E671164831BFA9E9159BFA5E99813 arkendaleBSW
929,705,247 *60DA9B8555BEE0CF0AAB54FF4164BE9D9C6BC79D [email protected]
929,705,248 *60D340D90DFAC2B8A7755D77E5585497984D3A8A Arkesthke1
929,705,249 *60DE8313FC4BC22A0D626F15E385C4FEF0126606 Arkhiasz
929,705,250 *60DC83CC98B0B620D77C3566697FC267D2FFB0F2 ARKINUS
929,705,251 *60DB91FB19778BDE4B62FE9F7491AD637F2EF9A4 arkistolaitoksen
929,705,252 *60D991CC358C13310BFDD1BD5D72541EF9D4DF1F arkizla7
929,705,253 *60DA907CFDC3A459D8675613E865EDC00E97E162 Arknevah9
929,705,254 *60DC75C782C0F85F3A73B6CE25E07D6DB640AF3B ARktH
929,705,255 *60D33D67B90340A83247CE2F194ECB46D281C253 Arktisfo9
929,705,256 *60D8305EFC72B2A2564CCB2395375D2F52EA82F5 arktos241234
929,705,257 *60DAE70AE6D7F4942BB99C13DE40C44CFF028C15 A_RKw
929,705,258 *60D30A5D5334A61551A33A038E3846C9754BBFE9 AR!L?
929,705,259 *60DCE907F10654A33C15A0F62E1CD955A30C5CBF AR%&L
929,705,260 *60D97B83F43AA397595758A87ED01B50F02F285D ARL($
929,705,261 *60DDEDC3E321C1C4B5F3E0723B9131788EA4611C A_R;l
929,705,262 *60D097ECE0D269B0CED7E06BC552D88CFA004F73 A.Rl)
929,705,263 *60D0204BD96F8A2631EB7753C0B26E972387CFE1 ARl&$
929,705,264 *60DC57B33B886158D5C32D71071B03C062E600A8 ArL2
929,705,265 *60D55D52C987E2168F1F893C4597F79C268DC8DA ARLA4
929,705,266 *60D154862CD914FC718CC32A08EFC2FACDE3D3DD arlaten5
929,705,267 *60DD0DB7D92A9D75FBC9D863750E258CCB8479F8 Ar:Le
929,705,268 *60DF6942F51FA28ABC32F6249F073E2C483D4E55 arleequin
929,705,269 *60D4F9BEE03AF9707B43EDA074B61A6EA3A0DCB7 arlen.billingsby
929,705,270 *60D2785C58AB72F95654B7ECB627AC3280181396 arlen.borah
929,705,271 *60DFF89D42DA16FF768A3C07D2DF6C8AEE17B858 arlen.caprio
929,705,272 *60DE8FA796502EE7C0F3093FA0E2EDA2A33372E7 arlen.chappan
929,705,273 *60D15CF2D74A86EABC88C72A33114EDC8DEDD030 arlen.dancause
929,705,274 *60D4BAD3FD8396EA3E4845B2B702A5AD5F8277FF arleneJ
929,705,275 *60D182EDEEF24F0111F2DCEA833B15ED4C86A8E5 arlen.engen
929,705,276 *60DC8240953A1B283873CBC7B42322C78BA35619 arlen.gambler
929,705,277 *60D3EE199A881CDE5E7C5AC6F3591DD32017AC47 arlen.hardegree
929,705,278 *60D1D1F11B02705C40BCD71192914DA31F75FA61 Arlenia
929,705,279 *60DF8405AA867BED91699A0B61DEF75EB32B3DDC arlen.miro
929,705,280 *60DA9CED826869CDCB8F27BE5A3547284BBE53D8 arlen.partis
929,705,281 *60D43FACA111C7FE4D26855C828741DACFAACB86 arlen.pendry
929,705,282 *60D8067E5BECF473B6E60EC4593CE734E3F4AD6B arlen.philliber
929,705,283 *60DAA42799C48D28FC00F4FBC403BDA0A56BD4DF arlen.prusha
929,705,284 *60DF41713C65D6E796D73242D375FBBF10FC6BE5 arlen.scarlett
929,705,285 *60D3718A5BF7B6CFDD2714DBE255A4768361A281 arlen.strick
929,705,286 *60DC6436602AE143B8B948583E8C0D5B094C295F arlen.stuchlik
929,705,287 *60D84D6F7528AAB1DF87BB25E6D7F5CBD221C1C3 arlen.tice
929,705,288 *60DFA80DDC5DA2329C5ACB886C0413DABC344EBC arlen.vanslander
929,705,289 *60D2A29DD1BFCBFDC5C67362C60337D330ACAA28 arlen.waddoups
929,705,290 *60D9A4C92A52429606EA31DAB0C28C9BEB21C7A1 arlen.waltjen
929,705,291 *60D3403350584A3E559ADB8F2DF38DA1F6BFFD8F Arlèse
929,705,292 *60D88D27096DA7B017DF6C5A0FD85EE0C6EF7FC3 arlie.angst
929,705,293 *60D67FF84FBAF257A7B1A6673794E4342D1C8794 arliearlie
929,705,294 *60D43291F0AEBB44E24A8B2AB81EE61BCA304785 arlie.bemrose
929,705,295 *60D67F12A4DF8B1AED41A4C47EA03D6BC176785E arlie.cerrello
929,705,296 *60DDF99C305C5E6FCA6E2B3C9DF45A0578340283 arlie.dallis
929,705,297 *60D0C192D81B50C4522DEDC8E00CB3B7BD71D08E arlie.dorf
929,705,298 *60DF993E4F1AAAD225DCD478B3B077C12CA0AA47 arlie.dulkis
929,705,299 *60D96188DCF8901A52A692F4712EBE87A39F84A1 arlie.felderman
929,705,300 *60D8C347BC727126A66607A4CD9AC75261A0E394 arlie.hussein
929,705,301 *60D441EBB31ECD4094CC02AE7DFA354D6F82AC6A arlie.magalski
929,705,302 *60D15CF3216DB42BFFEAD2FCE632036D985C15D1 arlie.marflak
929,705,303 *60D9D6D4E4FFFC9D11AD387A7E25FDC72429A46F arlie.matts
929,705,304 *60D9803B55075BC39AD87F41FD157E0642DA7973 arlie.mixon
929,705,305 *60D38BB92B2A10FE6A5EC4E9758F82A514EC9292 arlie.rebeiro
929,705,306 *60DDA8B6F8DAB39BF3E6A779E57034F5569E6A26 arlie.semmes
929,705,307 *60D7D55A05014B2255E31CE2E0C9BDF4AF08C5D6 arlie.siegrist
929,705,308 *60DEC7909F163B443833F1F8E45CD7BA1A07CE19 arlie.slunaker
929,705,309 *60DC62EF235114A44373BFEBE6037E292DBD5776 arlie.staple
929,705,310 *60D3DFC917DB8EB6081CC82F85A98C7B59D7879F arlie.talaga
929,705,311 *60D2E0E02F3A59D685EAECCF43275B790C278DD9 arlie.thill
929,705,312 *60D29A82E49F16BCFA02D122603E0CD5D356E793 arlie.trampe
929,705,313 *60D8C0E0ABE86CF41699AE08A77A9E7172602B50 arlie.youker
929,705,314 *60D6E5D6B6FC06117F9E9FBB55AF25181EAFE3F7 arlie.zalwsky
929,705,315 *60D9F8DFEEA87C43F80155FEC66B9691B4754939 arlie.zanghi
929,705,316 *60D2140A79C359085DA93E040D5522525E7D15D2 ARLINGTON NATIONAL CEMETERY
929,705,317 *60D0AEB72E0AC7BBAE5F89A40C4978617C6E1560 Arlis7
929,705,318 *60DBF2DF93C1488F9B9F79B5A33B89412A75DE45 A)rlK
929,705,319 *60D35F7D15517E2D6A39D1BF88C7099F3DEF2AD1 Arl.M
929,705,320 *60DD79E4AC220BBACCD530333BD74E32E48A9DC3 ArLR2
929,705,321 *60DDA7EFDE2792952E6CCDC7B3A93799E29AEE9E arlry1
929,705,322 *60DFF6F5CB03DDA728464C759E887EAF07C88B0B Arlstroms
929,705,323 *60D79A071CC446BBFDD38B7AFBA9D17685FF0EEB ArLw4
929,705,324 *60D41A37D2930DFED972BBDE375B712868B377BC A/RM!
929,705,325 *60D8A2F2C182BA8AEE420CDBE2C247B9546A53D2 A.R!M
929,705,326 *60D9BDEE3292813F7F3914EEFCB15429F6864704 A#RM)
929,705,327 *60DA5105BEB58619C9A90F3EE32D0334176E8854 ARM"_
929,705,328 *60D1C8477A42B045C64E91EA5EC2BC66976D8432 A-
929,705,329 *60D8337758CF94A087A877425027F9919B13FFC4 AR/m/
929,705,330 *60DF79B0B86B50C3A9534B5D29FCB973F9AB2F40 A&-rM
929,705,331 *60DE81E6E39307B6975074BDA162F3B7CB25CE18 Ar!,m
929,705,332 *60D5569B246DD20C15BE5B229B2EB1711ACDDB8C arm03
929,705,333 *60D8686A9BC9AD3EA924D79EE81F6AB664A6699D AR%mA
929,705,334 *60D1E38C8D928C348A2E7600E01513304CF873FC ARMAGGEDON
929,705,335 *60D43B8450488D0AC28CCA1C9CB95A38458AFA2B arma-goddamn-motherfuckin-geddon(theteddybearsremix(clean))
929,705,336 *60DF2AE2F27F4DDD43B30844540EBAF49F7CF20B «Armament
929,705,337 *60D5ACE683BF1F3DA63F97CAC306ACE66B7C8EA6 Armamentului
929,705,338 *60D234B1C66551CBC770F6AAC83402E3DBC269A4 Armamets
929,705,339 *60D245C1900DD12496A3084BDD6EF35473056467 [email protected]
929,705,340 *60D94F72E4CDFCA20740E5778FA2DE727C758978 armand.buswell
929,705,341 *60D8BC9D533C854586106A802BE3C261964645F6 armand.deveaux
929,705,342 *60DFE08A2BCC094B1A80FCA391E2A6C67E2B138E armand.duling
929,705,343 *60D3A8B95E24F47C8C2AF53F16BBD42527033D32 armand.dyett
929,705,344 *60D8FFA3DF68757A50D94BC38396360256F43158 armand.eckardt
929,705,345 *60D1ECCB99EE42A62C92A8408CB4D3C61DA0D8B3 armand.fagley
929,705,346 *60D71784D95476A27F8BB61916ABC10FADB60C51 armand ferland
929,705,347 *60DF47055E873B3F166578C62741486F9092A001 armand.fraize
929,705,348 *60D7C4C3FBB2B9DD33D4C89EC7A89B405EB366FF armand.futrelle
929,705,349 *60D723DBA8BD439F5F37587E1B3528D5482AC9EE armand.glazener
929,705,350 *60D2FB1D1F8266B79499A4E4640E7B3C098C4E8D armand.grzesik
929,705,351 *60D0720B6867357C64D34A10E2B2B40FDE3E1F93 armand.horen
929,705,352 *60DE5D905ABD5A7EFA3CDEC30CDB701057982AA8 armand.huffaker
929,705,353 *60DCA201AB156AE2C42BFEEE9C7B4C269491E6B6 armand.krupp
929,705,354 *60D0FD927B23BF02208636ADF25F7F3681721FF4 armand.landrith
929,705,355 *60D6CECB03818BB35203D82EDC11D9E497092C85 armand.mitra
929,705,356 *60DCE2881EFDB591C1A3EA00FE12CE2BC4AECB05 Armando139
929,705,357 *60DAD3680575B2B9B699F4AA6282A037D61D61F8 Armando784
929,705,358 *60DBB9D093F67EF396DB87C3B3D00B1E36CAF110 armando arcilla
929,705,359 *60D60909C20782172C617F8FF23B25193B06A548 armando.brossoit
929,705,360 *60D33471AE0CE930780F938CCF6A2D18CE02909D armando.bruss
929,705,361 *60DF4FACD6EC2098B54D805725A3F9FE056F1EB5 armando.chiarenza
929,705,362 *60D51E9E71BED8064A8164337E2E3AEF13A41941 armando.gangi
929,705,363 *60DAD22D064E668B6C2B00979EA5BAB28A00D740 armand.ogborn
929,705,364 *60D9D3C353605D676959373F2EA841FF8FE9BB6F armando.graeter
929,705,365 *60D353471103EF9D49926E71ACC169D6CD1E8239 armando.granzin
929,705,366 *60D50901EE6304C3B21F839259F44B1DFC6B34C4 armando.hokett
929,705,367 *60D64AFF9B00FA4B8C35C68B4DB0A5609C7668C0 armando.huppenbauer
929,705,368 *60D8A401F84BB8FFB26CFB8729BFACEE7D485D56 armando.krutz
929,705,369 *60D1B40A662686E84992E760EB85C3302FF0DF7C armand.oligschlaeger
929,705,370 *60D96EE9166569E8EB7FD884D59FA71DEB410A6B armando.marean
929,705,371 *60DEF4D3FAB8F4B14CFAB5ED730A116FAD60616D armando.moorhouse
929,705,372 *60DC1E449E27FAC8EA28DE938E25D3756404F2F5 armando.ollison
929,705,373 *60D30F6127693DCE82BDC712E8E367AF2169C9DE armando.permann
929,705,374 *60D3D04281E39F7D91950629E5AFC6333FFE8556 armando.rioz
929,705,375 *60DB02F4BF90D9DC188F8D20BF42A22090E2D563 armando.steik
929,705,376 *60DDFA6F90F552DD9C9426E1E59702C1EDCF6008 armando.sule
929,705,377 *60DE3030C526DC3904A11C4F1226F5D415975466 armand.poulet
929,705,378 *60D55AC547AD221084E0A95EE6E83421A79E7F72 armand.skains
929,705,379 *60D56578C967715C590D601A97436432D9E4E7BB armand.slipp
929,705,380 *60DE350D2C142908EF2115B9794C0CDDE5385517 armand.strock
929,705,381 *60D749F0701F2C66C66F9777D34A6ECD925AEC31 armand.sully
929,705,382 *60D11EACB89816EED203BB4088F6E4A6C1CA35A1 armand.washor
929,705,383 *60DC33FF7F18734F26EB9AE519B56466F25D6E34 armanfarajzadeh
929,705,384 *60DA35BCC8CC89A3431A45E8983F234870E64857 armanidonaldson
929,705,385 *60DD75954520D4E76DAFF3E4C00314B4D26C814C armantn
929,705,386 *60D214F3972DBE529F170FB11CB829BA192ECF44 Armatuur6
929,705,387 *60D0B57211C308ECF9188777A60C47582FC8AB55 Armazon4
929,705,388 *60D6D181C64CDB65158501ED272B0AEEA15C7D3A armbrechts
929,705,389 *60D117DD56E4B122CE36198AF0F69DEF2870C984 [email protected]
929,705,390 *60D546B6975D592AC7C26CE874FAEF8E0ACE82F3 A;RmD
929,705,391 *60DBC9FB3EA198363161E7D2E9F7CF20EC149D12 Armeerde1
929,705,392 *60D3BD69F12A101509643A01F208CFC69B07E64B ArmEk
929,705,393 *60DC11F80E0B9ADD1398AFD01C03898FE689BD56 Armelijkst7
929,705,394 *60DE7E39F42C12B8395A47A98B69DA63EA2CAEBE armend bajrami
929,705,395 *60DB04B10F2A0CBAB7BE33C75C2CDD6194685CB7 ARMENDOKTER?
929,705,396 *60D9C9F46A433115924EFC698C4D60710D1B32F3 Armendro8
929,705,397 *60DE9EAA3075C707FD2BAD95FA3C85CF6CE71C6E „arménia
929,705,398 *60D762527653B68AC6A7C6815828A1740A0B651E armenia6as
929,705,399 *60D1927E1A6E68D5FF9542A2D9F8DE290D9DA6B3 ARMENIANNAME
929,705,400 *60D4A363F80216ABBD5D1EB1736E8377EF5FDDB2 armeno-phobic
929,705,401 *60D207F23B21F0EC9FCFFB82495EC28A9815519C [email protected]
929,705,402 *60DF5E7D9F495357DA78345E9835BF36C7339E32 ARmes
929,705,403 *60D81BA373A41FB6C20F91B284941108C3B64FD7 A)rMg
929,705,404 *60DDE558E1784BFDAEE00F74E82E37738E5793EB ARmhZ
929,705,405 *60D7C59008D00B2ED837BCD945C256B1A6D11F63 Armiate9
929,705,406 *60D2C1DE7AD289F61929889DC20A29038D916995 armide: act i scene 4: i. soli et choeur "o ciel! o disgr
929,705,407 *60D3C818CBDFE96EC4A5C195E1A884E6024B5027 armijom9
929,705,408 *60D519FE8541E67F3CD565796F976FF5FAFCDEC9 [email protected]
929,705,409 *60DBB2C6C57742A928E100E210025A16E1B79D99 armingugel
929,705,410 *60D23D17B5393D26297B69D45D7F403E19196081 [email protected]
929,705,411 *60DE3D217548D6DE2B018CAC29B562150B1C4970 armisque2
929,705,412 *60DEB6066E859C43CA6BD88653DBE2C6E9DEF014 [email protected]
929,705,413 *60D1743FD64C5DEF98CA44E61E88FA9F86F67B07 ARmm6
929,705,414 *60DD892606E3C89646787249D92933645982F2E0 AR_mn
929,705,415 *60D7373127C3D93A7C74627E6F1F8DA64C80E1EB ARmO$
929,705,416 *60D93901EFCE8523A3115329B4A369276EAC2242 Armoedigst8
929,705,417 *60DC78ED94C313757F1439E3EEBED8F908934C6F Armorics6
929,705,418 *60D7D0D34024B0AC2891C7ACD2A5CA402A431020 armoured_vehicle-lau
929,705,419 *60D2D3F95F0E4FBE646168EFECFFB581FF68547E Armr:
929,705,420 *60D387FD00AC114294AD1EFF9CF1FB2576168C22 ArmS;
929,705,421 *60DF3E540FAA67E7D6C4C5EC29AA9F1010686962 ArmstrongAirportJune
929,705,422 *60DE77155EFD1CE907CFCB4870B03C78D159F78F armstrongbadstreetar
929,705,423 *60D9C6329570A0B3372355EB10C33C63F69B7F21 armstrongvillageonline
929,705,424 *60D249B610AAF83D2E391AC87696D690BBEE2A08 A"RMw
929,705,425 *60DB360EC5FBD22306536486EDAD789EAFABFF56 ARmw?
929,705,426 *60D5378C95653A5A1897196B84F102E5F60FB760 arm-welcomes-adobes-mobile-flash-move
929,705,427 *60D8BCE04C3A82CD1AA18577341CE6BF027171C4 A_RMX
929,705,428 *60D6217E401E37A7913F478A3AAD6870CCFF5B0D Armye
929,705,429 *60D902569B021E9EC8346FD31866EEC400326F07 army.mod.uk
929,705,430 *60DD10C3D1F27611AEE3A6DE1431CF66CDA78D7A ARMYTROOPS
929,705,431 *60D6F454507821BABF49448BF46F17D393A9D3DE A.RN_
929,705,432 *60D52A51E19A44C026731597846CD8B8DC78FBF0 AR--N
929,705,433 *60D9AE93733540EEE906DB21AE6E4200C2D1AB2E A%rNa
929,705,434 *60DC3E1F1D03332DD1A98BFCF4DA4E9696D4A8DD arnasca9
929,705,435 *60D8855D4075BEEC1CC90E1830EED394B978FF5C arnbachrules1234
929,705,436 *60DABEA432B58C0733B0A0F9CDD092F333894465 arndjl
929,705,437 *60D2B1CD820717469944AC584800E7BD6C98F470 arnedale2
929,705,438 *60D0C0D14C2EECF8CD21A7C4455D86331445BDA1 arneeder4
929,705,439 *60DE10D8A42C7F122DECAA27C5C5640E1D96A451 Arneidia
929,705,440 *60DF5EEC9D83F75E852061A108B3FF8B06AFA8AB Arnekuek5
929,705,441 *60D3D6BEDE402CC920B8F70EF63EBCD282319B0E arnel bermas
929,705,442 *60D68A01F197ED0EAAD0C18469D51A26C2455664 arnel gallano
929,705,443 *60DB0FFB3F0353EEA2D091E075708902EC3154A9 arnellcook
929,705,444 *60D0A8D8BFC4B495503E1081A5076947D06CA45D arne-mueseler.eu
929,705,445 *60DDBCF3E81C614E0FD1E677CFEAA30675A615E5 Arnfirðingur
929,705,446 *60D3E75F60B5908421288EA42F76401035727286 „Arnfried“
929,705,447 *60DACC5DC3324CD34DE56B5FA54AD3E086FE3375 Arniloffing
929,705,448 *60D3E3FEE7BB5A5AC39E7CE2E2169FB0EA43DA3D árnimagnússon
929,705,449 *60D8A5BACC82877BC716812EBEBF437F914C275F Arnivals
929,705,450 *60D29095CEBAA77A5F2C6608E51373815C210FC4 a.r.nj
929,705,451 *60D3C0FD9C67B4200866521481E594F6CA01660A arnold abella
929,705,452 *60D28549507AB2960CE339BA4C9939CC38C9CDE9 arnold.accetturo
929,705,453 *60DCA2A2E7B3E357B36226B28C606DE413FB94EF arnold.airhart
929,705,454 *60D81B51611302D811BC10C574869066E34A88A2 arnold.bending
929,705,455 *60D2426E078BF861DCA69CE7008BA69C09EC909B arnold.economos
929,705,456 *60DDFFEB648DC4D36FCB29617B37D28D89FB3E1E arnold.eppley
929,705,457 *60D306C75D7181085A606BE4514969D37CD2C247 arnold.fette
929,705,458 *60DBD71577F1AA406546C7AFCA5492EDB91E3B3E arnold.gorn
929,705,459 *60D58F44D14C1D824C304ACEE0049491D812BE99 arnold.greenfelder
929,705,460 *60D20D7E72F2C1E4A58D0CAD1DB540039DD970A4 arnold.greggs
929,705,461 *60DF32419F146769F0965A4437FC2C887057E4B6 arnold.grijalva
929,705,462 *60D1C73F65793991D2B9338904F946803BAB9CA1 arnold.harradine
929,705,463 *60DAA7E3A463925A1B807D35DDEC642D6430F420 arnold.hayden
929,705,464 *60DE19D289A3500E0BF051EED2D853549CBD52FE arnold.jons
929,705,465 *60DFBC0B0CFD1DD96183B5A2D81F97387687D3DE arnold.kantarian
929,705,466 *60DD76B24812FC05BA9638D666721AAAC19B170B arnold.keh
929,705,467 *60D2B5E2CA06F67A35936430A7222F5FEE5AED13 arnold.loudermill
929,705,468 *60D1CBFAA5F3E34456E2C3E7BF4FED0CB6E0A2FC arnold.marchena
929,705,469 *60D26765C8AF89FCBFABECC02D240D260D0D001A arnold medrano
929,705,470 *60D8A36EAEC7D6B0560335FB0489FC35054BD782 arnold.nacar
929,705,471 *60D361A36B461F77040E9208233D4050111578FF arnold.nolde
929,705,472 *60D3A24B67C58AD98EC0B53413E8484396782C9F arnoldo.asaro
929,705,473 *60D721272D88AF1B3D9A09DED16F7DDD12CF6F8E arnoldo.brescia
929,705,474 *60D50AD54942D2AF1B68616684B84C2568D701C0 arnoldo.coad
929,705,475 *60DD6AB43ED24B6E9584EF20E548ABCB7670CF9D arnoldo.cuva
929,705,476 *60D328DDA3A6ECD02D6EF641E7672961F29BE593 arnoldo.dadd
929,705,477 *60D9544523FE38C764BE1E67A50CCA665282923A arnoldo.deyette
929,705,478 *60D72E59D97EC4E576C8068C9CD08A3755D6374E arnoldo.drinen
929,705,479 *60D5E32CBD2DE8717CEE330A197207E27285BB25 arnoldo.gloden
929,705,480 *60DB12B4E9ADB5362BE0BBF601C2B0C7E8E203D9 arnoldo.golojuch
929,705,481 *60D06449238E00B869A363F2819120AF74D048C6 arnoldo.gonzalaz
929,705,482 *60DFF0FBEEE3561BFF6C492C450FFABA0330726C arnoldo.hallett
929,705,483 *60D99C623BBBD1D6460E3C2FB3DEE102029113A9 arnoldo.hegg
929,705,484 *60DE05DC186B231AFFE7A0D6EDF64842F831AA68 arnoldo.krain
929,705,485 *60D547B7CF4C87F5932ED6A257129BF000B16388 arnoldo.lerno
929,705,486 *60DFCFF5469F300B3DEDE5D9271C51D4E150F92D arnoldo.markway
929,705,487 *60DE4945A0CF721FBAABF25C5D1FCAC1F36553B6 arnoldo.mccalla
929,705,488 *60DF8E43B573040E5142D6492DC77F06895950E8 arnoldo.mohring
929,705,489 *60DEF1D938A40687A4963993591A29E8BDFCEB17 arnoldo.natividad
929,705,490 *60D1FC4B9F2FE2A4A2523581B8F3F75CF8DBA529 arnoldo.papke
929,705,491 *60DA3708BF9516770D988165F46BCD57795C540E arnoldo.planas
929,705,492 *60D34499CD5B8145C15F72F717E5A18C52387E6E arnoldo.shimer
929,705,493 *60DBAFB50321C4600495708FD566BE73C88C4299 arnoldo.stewardson
929,705,494 *60DF76BBC8F70EA270AFF423935A54B4D0B6227A arnoldo.takayama
929,705,495 *60D41C1AEDEFB1F1C64CB5930F706A5054DC10ED arnoldo.wheatcroft
929,705,496 *60DE1B86AB9B298277CCED7E414B18749766CE33 arnoldo.wilshire
929,705,497 *60DC339332C984D81530233DB7632066DAF36000 arnold.petersdorf
929,705,498 *60D8D3D758FF7211EC64E7C6481A7724AA961347 arnold.rajan
929,705,499 *60DB19128B7EA52D44040B10DBA820E83263CFC1 arnold.ramsy
929,705,500 *60D31854C94FFB0F5574E284291B3CE090ACD00D arnold.ranft
929,705,501 *60DAEC90F771F084E0FE63C407374508A2FF3512 arnold.rumpca
929,705,502 *60D845CF4733291146EF8E355F2023888A25AAE8 arnold.schattner
929,705,503 *60D423DEF48F34D20F735AE059E04862E39A886E arnold.shouts
929,705,504 *60D340BF1C36C784F68A9BE277720330B7366402 arnold.sondheimer
929,705,505 *60D85ABED771FDE95E479A0A96344014A481F9A0 arnold.spiroff
929,705,506 *60DF105776E6B7188FCA2B86A7049A560F086E95 arnold.spittler
929,705,507 *60D017AB8153BD452780908388DF13967CEEDBB2 arnold.stivanson
929,705,508 *60DB86272784F9E49BF6D93620623A2C48A26FD3 arnold.teagues
929,705,509 *60D65B6A77BCC5802DD312BDCDBB1340C851D51F arnold.teesdale
929,705,510 *60DEF1A22A2DD2ACF10FD9D5293CA7DD0275E3C9 arnold.tryba
929,705,511 *60D56EC81921CDE27842EEC6EA3238AA05166534 arnoud1234
929,705,512 *60D1847DBDBFBE766E7DCBF136D9B7A495070217 Arnpsnfj
929,705,513 *60DDE1785BEA42BE3CBDDD4B3D1965D2C19677A3 ARnQE
929,705,514 *60DC11741A4C7C89445DDBE0E386DB8CDB5A615D arnulfingischen
929,705,515 *60D20E0DBEA77E7C5DD48D1EF05D1CE2374C3ED0 arnulfo.baisten
929,705,516 *60D049F12B8A954FDE2D7A3B0AFC9C99E29F1A7B arnulfo.chapin
929,705,517 *60D702DD3BD1617E201F3D534068B22967EFF2CC arnulfo.espenlaub
929,705,518 *60D9D5FE7D6D724414D7948D5B2A798B77C4A842 arnulfo.falto
929,705,519 *60D18CF72E467D159B7CAD345487BF2777CD52D0 arnulfo.gerdeman
929,705,520 *60D74568CA7EDD0A33BFF0458846986061BCD4FB arnulfo.gonce
929,705,521 *60D13930C4093A80D8ADB261F54F3CC643236237 arnulfo.gondek
929,705,522 *60DE090902AED55A6435A287849BEEC73C7FBC25 arnulfo.grantham
929,705,523 *60D5AC452E575F517DEFC313F937AABF596E54E9 arnulfo.ishmon
929,705,524 *60DA09509597F4309E7B12BE7DA594A7E51C4817 arnulfo.kesby
929,705,525 *60D0E308D72CAE8BC2F6810B2E5976E2A89D3905 arnulfo.mccubrey
929,705,526 *60DBEB81CAC0CE2FB5533AB63A062E9BAE1AAA03 arnulfo.mcgarrigle
929,705,527 *60D2D51BF4A4F3BA8F55BC0BF9BEDA43F9670E63 arnulfo.menjivar
929,705,528 *60DBC556CEC3DE067B90880726508198FCD2B08E arnulfo.musselman
929,705,529 *60D063086DAC633EF2271192A4C631ACFA251A98 arnulfo.noble
929,705,530 *60D07AFD5F528701B60409E4627374AFC82ACC73 arnulfo.sawtelle
929,705,531 *60DE6191D2109BBBE8FF854E213ECE59D9A2D135 arnulfo.shaline
929,705,532 *60D4EF132E1535A59843EE924A1CA5A0756BFE22 arnulfo.shappen
929,705,533 *60D8071BF25D3492BC98D48A11C568C685101E71 arnulfo.sidorowicz
929,705,534 *60D7604195C477D2CC5E2ED16C9AD7894F2E8255 arnulfo.silverio
929,705,535 *60D1C31B4F22C826CB7F9D40E9E6E79A028FF8B8 arnulfo.suttie
929,705,536 *60D47CE574AA5B829910EB53ECA64C724A54E2B4 arnulfo.talluto
929,705,537 *60DE57E3023A9E2EA9A846407ED6553E30FBAF1A arnulfo.uchimura
929,705,538 *60D84398CACA8B727EA050758ED77F6249AE6A06 arnulfo.webley
929,705,539 *60D83335820D89713ED6BEE2C131F0480E3545D1 arnulfo.zakar
929,705,540 *60D05126106F9C3D62F89518E23BEEBE7467CA79 ARNVDKERCSHA
929,705,541 *60D794FCBCC66F011582136DBCE66E1EA115F495 A%RO
929,705,542 *60DFE7D5A7FBA2971E1223B075B27126EFBC4773 [email protected]
929,705,543 *60D05FC1D299B78B7147600A28703226642D87D4 AROA,
929,705,544 *60DFB31BCA3DDA19B960DE60576D73F8C905D156 A-ROAD-TAX-FOR-CYCLISTS
929,705,545 *60D096E9C32E86B0D7068DD9AA01A6E35287561A ARoB.
929,705,546 *60DDED05762FB1B0DADAFF2831C5ED399472BE7F arockia doss
929,705,547 *60DD68367AD5B9BCFA030835259CACC9D4CD412D arogantný
929,705,548 *60D27A03544DB6FA93FBE45F8A0C56861E20B9B0 A,rOH
929,705,549 *60D4E269FAFE1350EBD4AADD25DB25C8030080A0 ArOh;
929,705,550 *60DE16F3E762FB4BDFFE915394279F13714575E4 aroicluD
929,705,551 *60D367CD522C3A44E81EF0141143C01FA86648F9 Árokszállásra
929,705,552 *60D58FB113473C6B6CE5BB24FC2DCA7FF748C05F AroL)
929,705,553 *60DD4B6ADD780833495A1B1853E2ED8584DEA450 arolium0
929,705,554 *60DC669FBE09C4BB154B3EFD80663FB0E8C2C66C aroma-ist
929,705,555 *60D6C0FDA7F4A387669E4BC79920D42F308F7278 aromando123
929,705,556 *60D9A1EFF7747894BBABBD33ED4FEAAEDEE47090 aron010
929,705,557 *60DBF0D44AA5B03EFDF95F1322B4CF88D6F7EF75 aron.christians
929,705,558 *60D44D3FD76DB17F3ECACB259CA5FB13184142E1 aron.diruzzo
929,705,559 *60D3E3EADBFEC02F77CC78053093BDE290FC3E2F aron.frische
929,705,560 *60D03B2275326661A4A4704BFF4E2AE1110BD72E aron.hale
929,705,561 *60D9C5EE5A1A4372101CD1F55ECF7CE6F0B2995C aron.hearnsberger
929,705,562 *60DCF4498A5D07FAB9181261D9DD3070D8E456E6 aron.hewko
929,705,563 *60D1BA56BE9506AC7E32C658EE439361F951AA50 aron.kubasik
929,705,564 *60D2463163CA6280EBE447BDF8768A9BD1008190 aron.libberton
929,705,565 *60DE82AA4519404B9FADE78AD624308AA9FDDC27 AROnM
929,705,566 *60D9505CC56A24F64EB4E0B57655479144414AE3 aron.maida
929,705,567 *60D9A5F0D0C579FE458C99F29B375EA6F21EC8F7 aron.metevia
929,705,568 *60DDA883E880E4D98B93B2ED86BD6381448617C2 aron.mthimunye
929,705,569 *60D996AE02E98E81A6DBC351C189288F792FEDC8 aron.muschik
929,705,570 *60DF803D935F07788F7FA0655E78E05824376F03 aron.nifong
929,705,571 *60D4F1126AC365FE8974686813B2D9E399A9DFAD aron.palmino
929,705,572 *60D701C9155417331729EAAE21C4977CF937CC39 aron.pirkle
929,705,573 *60DB50E18CCCF0F59815AE5D2E86B8DA49EA8ABF aron.pirtle
929,705,574 *60DEC3CF1120EBB30FCD1C4248C8B4DDC80F741B aron.quintanar
929,705,575 *60D53F5D07347551F2B78B9CF1A3ED5A984F52A2 Aron’s
929,705,576 *60DEA3B4ABFDDFD1929EA245A4759338D714775D aron.tieken
929,705,577 *60D57F5CA87357A593DB3EE5FD658BB132516AB4 aron.vides
929,705,578 *60DD6781E59C6DB0D6BBA825453E1374A9B70076 aron.wist
929,705,579 *60D9D8CFAF01C98FCDED2B769AD0FF797AAC815E aron.woodal
929,705,580 *60D9E5FE5BE136C61A83E6AC2ABCBE07C629EE5C Arootz1
929,705,581 *60DCE3125102E77DCEF288E83B24A7EE4F6A8B8E aropelto0
929,705,582 *60D77FFEF007C4DB0A672CABA647520E5E461FF4 A
929,705,583 *60D084CE34AC7E2589CADB4538F973D8BE826868 Arorua
929,705,584 *60D38C0EBC151C64B7BCBE17BA987CB1E5B1817B [email protected]
929,705,585 *60DA513A82CAAB9C20617CA18E030C5F5A8D9A1F arosalls
929,705,586 *60D50A56DEB1DFC970EB6489360133342E6A49AC arotsaka
929,705,587 *60D6D5327765A50F2347B67175F8E299395D8B0B around.pypex
929,705,588 *60DFFF984E898E7EADB9D51FB5DEDF589BD6ED3D Arouvan7
929,705,589 *60D2A00D3006CD891E202B4B7C04396409919610 aroversso
929,705,590 *60D9B7C7C3C2F6F5A0F37E92F050866858D57249 Árovre
929,705,591 *60D7A57F17213FAD4112FF4F9C8C1942658C0702 arowarow9
929,705,592 *60D0D974BE47ED5A2ADBEAF9398730088A30E64D A?RoY
929,705,593 *60D951C2E6D29FB4BFA8EBB5ED8175ACBAF35EF0 aroymint
929,705,594 *60DCB10B6BCAF7F4361AD136FAC55418E2F9706B Arozqueta0
929,705,595 *60DDD1B461976CFA0A3C1EFC590E82041548614F A)R,p
929,705,596 *60D78D1C1CECA2F62F7E333AE14BBBB974A26D36 A#/Rp
929,705,597 *60D606714212760BA32074DC88C58307C2816680 A;r&P
929,705,598 *60D6A066BA94B6033EF5ED6E35EA2A9145EDDFCA Arp0+
929,705,599 *60D88D7004663FE85367070604FF670016139030 Arp4i
929,705,600 *60D1A637751C6012FB397472FC1893168DAE7292 Arp8i
929,705,601 *60D6F4D15B96FD0F9C2C5BCDB4EDDA1C0DBA1EB1 arpan dixit
929,705,602 *60D829E733F1D9F58C996D884BB325F6FAB77710 arparamos1234
929,705,603 *60D9CA4173309D2AC4279ACFACC0273BD9E1492E arpares5
929,705,604 *60D7E6B02859E7BD6681EFA18F2F06A323C4EE90 [email protected]
929,705,605 *60DBB0F27CFB54A152F3BBCB3B8C69A2E1E1FDFA ARpi%
929,705,606 *60D6B4EA9EAC589F4F7CE2C3AF5DE230C477F63C arpitaghosh
929,705,607 *60D54466ADD557B03DD4F266946AD9A4A0525BD9 ARpo2
929,705,608 *60DB6BDC1D0E34473C95C88C943C3632E1A7A7D5 arpraveen
929,705,609 *60D6F47E25EFF18D78405FC6462098B04507EFBD ARPU5
929,705,610 *60D4F8686572C54E41D4D6F9B4C53CADDB4ECA84 ArpVU
929,705,611 *60D728743B34A70CA6F791E9C62874FED3736979 Ar#PZ
929,705,612 *60D4BC00EE1FD9F569D7A906BDC0CEA8D3C1CF2D AR%Q.
929,705,613 *60D503E90F09A39F9C8823D71509A1C27316A637 Ar"q)
929,705,614 *60D2C1A78D3D065AE4E18A9FC9AC38DCB2FE6A7A ArQ+2
929,705,615 *60D962B62613E0BB08157A245C8BA2A7BCF81349 A!Rq9
929,705,616 *60D2B7327349E98BB9F4573B344856D972A1ADAA Arq.a
929,705,617 *60D18D72542FCFFB9A84A3EE188F076CCF455F0F arqbibl
929,705,618 *60D3B3CBAC4BA9609359AA4B49B329949B4ADF0B Arqcs
929,705,619 *60DFCC3054366DBCD252AE0EDD7DBF999F57D9DA ArQ$h
929,705,620 *60DD2B2E6A2D46B63273E7CEC9A4ABD0716F65A3 ArqK
929,705,621 *60D2873B956E593F9AC8B200B7F79D15744DAE42 A,RQm
929,705,622 *60D2790581F59F4C3207AC04D23AF80B10E31B79 AR.qn
929,705,623 *60D9F6659EFF6D98004D8F5EC071595BCE0C4A97 ARQQ%
929,705,624 *60D1926EC214547815EA6FB9D10B9361E2453997 ARQqe
929,705,625 *60D14CBF8DC0A2C59BE73165AD65E947F2E318A5 ArQ)r
929,705,626 *60D4BCE10FD03EDB932C2D458893D930A1529FA2 ARqU$
929,705,627 *60D9E6E874C9B248BAC1F552F512723EAD6B2670 Arquit6
929,705,628 *60DBFB59706BBCE0538A7F9EF4A2CD4FEAEFAD67 “arquitectura”
929,705,629 *60DE675275B791041128CA405BB3B4B0E76307F7 arquitn3
929,705,630 *60D9527B57EA7E6C8D551578B73292B5AA48BFE8 Arquivado3
929,705,631 *60D868CF0215DF21EA5842ECE011F0A63027448A ARQUIVES
929,705,632 *60D100EB3827B53101464045D6CA87C6275E8513 AR&Qw
929,705,633 *60DB9561CB55884DAD958161B85D1210839D52B5 Arr0)
929,705,634 *60D1B7CC4AEF5AE7D445DAB59F96F502D959B174 ARR_2
929,705,635 *60D9936226052E07B40F9C5841F23890DE915FF0 arrabujava
929,705,636 *60D6DF79DD232800F8FE120741C14F1BCCCEC230 arradonnaises
929,705,637 *60D8350CFCE977A7FFE40B014898C8057E92B72E Arragonernes
929,705,638 *60D5D96BABAEEC0D1631EE6F3F7CBA7FA8947676 arramaieda1234
929,705,639 *60DF1EE9C1494AFB5521F4A1C9C0F412DBE0981C arrantzarentzako
929,705,640 *60DFEFB6A16E328BBEC45BCD67106D1B21BEC456 [email protected]
929,705,641 *60D6D38A9892C2857CB3CFB73572BAF07F1AFD9F Arratibel0
929,705,642 *60D9DFF6F3B33C1E9D890F37B4C047B6C242486D arrayashinobu
929,705,643 *60D1DFBAEAED57FF240E74E03AD965A629812514 Arrayaz4
929,705,644 *60D265DFFC9D9848B92E05438CD54A1DB9AA843B [email protected]
929,705,645 *60DB26BC50A0ACB561FB04D2298B975913FCE314 arrayslice1
929,705,646 *60DBE2725BD4DD338811FA168C59D5124BC2385E Arr/E
929,705,647 *60DCF79E3141DDDF4E8DC52263212C8C00C08D87 arrebentreis1
929,705,648 *60D298E01F775E562E9697ED375A952E7FF31A68 Arrecifar8
929,705,649 *60D2A22AE65307EC0E0627E5E484D0FC98D1BB72 ARRECTEST
929,705,650 *60DB78C1C82B2839AC9C1BA8F5859DA346D32696 Arredando6
929,705,651 *60DE284B5EA15087533B60E3FDF886B17EE60EC6 Arredises
929,705,652 *60DCBE58D1D91E69DD79389DFABB8DA593CAD373 Arredrosing
929,705,653 *60DBC6582008212B2C86529E2E52C30A5F04D5EB arrefecer123
929,705,654 *60D1188B84F3A4A26F482969045FBB8B4A9772C5 arrendábel
929,705,655 *60D91CCE4D990AB1B0973054C1C6C9835ECB8389 arrepelai1
929,705,656 *60DD4357E1AEE5F7E3E7DDB1AD6D354DB069C690 ARRESTATION2
929,705,657 *60DD9601821E19C069068802FDA006B8E64AA3A5 arret final
929,705,658 *60DBDF66BB9C0A50336F398962824AA2BD28E5C3 ArR-G
929,705,659 *60DEBE83C2F1193DC25FD993C2944FD2FC8F72B2 Arrhesesed
929,705,660 *60D80D194616D8D775D623110D982864E5504212 Arrhinoceratopo
929,705,661 *60DBF8FDF53EC83E195145421207F71E97FEB7A1 Arrhiz0u$
929,705,662 *60D78E45D44AA41A38C9FF5247437658BE3D2D10 arrianos2
929,705,663 *60DF058DA48C8873E82C5153FA87EEFA9AC071B6 arriccioci.
929,705,664 *60D057B68B025E393793ECF0A659B09A3C82383C arrichendo
929,705,665 *60D090EDBFCC0841F22711F930B9D23DF368D628 Arrim
929,705,666 *60DF8E2B030A740C78F70BD109ECE566F2B219E0 arrivaltalklorne
929,705,667 *60DCA3861DE18240C759B873443C2237388D0D36 arrival-theintentioncraft
929,705,668 *60DC2F39647627A672227BC47DC1E2432D97875F arrivasti8
929,705,669 *60DF32A394441BC6EE04C7303B54AE2FD3F1C158 arriviste9
929,705,670 *60D382DA57EC5EE95BA602DCA6304F6A90CA2473 ArrjI
929,705,671 *60D9DE675DBD17F5ACEE38F42F135F7C3CB401F9 arrl2
929,705,672 *60D67058BFB79E8555179F3FDA8BC6D8C611B30F Ar%Rm
929,705,673 *60D61C43D0456597DD85DE6DE8735CDB062B8E72 Arrojadosing
929,705,674 *60DFF3BDD6E229515B1B0C14FBBF40DC9C8E4B4B arrombaremos123
929,705,675 *60D8CAB0888FEF7587B9A913805C0D9CDA680F30 arron.balog
929,705,676 *60D2363786A0AAEE97F9D4CCA75F009AEC35A57A arron.birks
929,705,677 *60DCB48795CD697951096688E35A125550D1959A arron.brunskill
929,705,678 *60DE88DD950EBAC47DEC706EDB618ED2E834181B arron.cables
929,705,679 *60DA1E9A7F96BF72DC2DF6B1954F3E4978102C80 arron.daubendiek
929,705,680 *60D9C8FC8055C7D680F6C7C0AD919B3A8EFF5A8A Arrondel4
929,705,681 *60D12D7552CD59F84124AEDDB414039EE8381550 arron.eldreth
929,705,682 *60D6431303DEA580D1FC89B6375D79B1D0B42F4B Arronilo
929,705,683 *60DA56D19E14FB2A7A3982C04A89AADB2DD98512 arron.krivanec
929,705,684 *60D1548A4C3D0214E32505B9B861878C8F3770F8 arron.lapere
929,705,685 *60DF79F0EE35298CED16830FED8764615F88FCC1 arron.lown
929,705,686 *60DAC1C0ABAC8F5B6CEB0FC1DAFB76C29C1877F7 arron.naish
929,705,687 *60DC83F7FCF90D281F933AA60282E3EF5CBA3456 arron.reyman
929,705,688 *60D97A0D4AE92B512EF0495CDE8ECA46BD74C6EA arron.sealy
929,705,689 *60DAFFDDBC740B4ED43BDF24D67E28ED4B5B98DE arron.seiberling
929,705,690 *60D1A25502102C445659AD153A6AC594753B68B7 arron.sur
929,705,691 *60DB94BC65FD660A764AE6733331DDED1E7BF865 arron.weissler
929,705,692 *60D53894D91993A9CB4D3386FCC81BDBEFC1B291 arron.woltemath
929,705,693 *60D2CBD4FA9BB09208A5F39ABCBED3A8C524FBC8 Arrostrarle
929,705,694 *60D832EFC7D0081E266DAF6B785F075D2B9BE503 Arrotada6
929,705,695 *60DC8D7F3C144D5855D5EF5C58A10BEFBBC8E781 arrouaisiano
929,705,696 *60DFA1B36962DD79EC8CCFD82586FAEA0D73A89C ARROW537
929,705,697 *60DCB28CBF5BBF44A8E79FFC21A35BD1D3ADF578 Arrowhead9
929,705,698 *60D2EBD1E07039A5459497874BCD586F2B3F3B08 arroyo45
929,705,699 *60D9371C1C35DAA127C80B051DE7C5009FA7D3F6 arrrrg123
929,705,700 *60DD9BF4843E23171B02B008A33C3A80FA05B3B5 Arrugadas5
929,705,701 *60D5B1DC759EF234C4CEE08CA12427ED0005C527 arrumaco0
929,705,702 *60D400CE4F4CF1DEE16C830C7B4D2A2F136CA018 Arruoliamo
929,705,703 *60D00269B69970CD60145FBF517CA3EAA32ACEEA arrwstwn1
929,705,704 *60DC23D6EAE6461C602EE4B835B5CE52DAEDC145 ARRYTHMICALLY
929,705,705 *60DF8924730A5581A61FB42C192EAC76C798B0FC A?Rs
929,705,706 *60D43FBBFA7A6977CB7CD9CF3900163D5D163783 A?RS1
929,705,707 *60D0CBFC2482EE2ACEEE9C1E958BD45865217EE1 AR
929,705,708 *60D6817E7E4CE2CBA0426CFE84DDA3DE4EC768DC Ar
929,705,709 *60DD7058ACF58C6C4C6234A204E7FCC839BCF85C arseenipitoista
929,705,710 *60D4BE131444B057DEE63B74E876EC579615A38B ARSeL
929,705,711 *60DF2C255FE817E852D4D4B1F1A11191B9174F9C aRSenAl
929,705,712 *60D7F92C2E271160014BFA357EBBB8804930D5AE [email protected]
929,705,713 *60DC022F645F1E6BAAB337BA656B629B39B5D795 ARSENOTUNGSTATES6
929,705,714 *60D073510A7E07C0A538DEB164D5A5958B861D2C Arsenty7
929,705,715 *60D4A8700844B3B60BBE7019DDBF92FE4079698B Arseram1
929,705,716 *60DB4DD35BD70CABA503D94E7E0D6A5B13C70195 Arseris1
929,705,717 *60DD566F4EEEE87262148D0B92147130F47377CB arshaqmuhammed
929,705,718 *60D8D18C4D56ACB706F9D29CB2778A09EDF893B2 arsillio2
929,705,719 *60D336C30CFCFF27F3FF8BBB500F791DE43AECE1 Arsinoitherium4
929,705,720 *60DAFF1E2C5141D43B1B610F10220BA68E72D964 ARsjc
929,705,721 *60D2F771B19B52453F3145C4107839A0AA9D3F57 ARS
929,705,722 *60D40F27C2A1DE3BF771B64AEDB3788EF94434A2 arslanyaylası
929,705,723 *60D57A62FAE1ECC6EEC6C10D98BBE146691D508F ArSnm
929,705,724 *60D5B8932ABD74AF96484BD532A7BAD60944B06C arson1234567
929,705,725 *60D16DCB6A37A63D69C966B077F60D34BF2EC687 ArS)P
929,705,726 *60DD5138B1800923A3717E70DA57720FC58B2BC9 Arstower6
929,705,727 *60D0CF3F3C29C19E3E9C6A5B58F19313E8FE28B9 ARSU#
929,705,728 *60DAE79592B03AFE98F73E9EDA895392369E0B8D [email protected]
929,705,729 *60D19804D4642B4A60F359D5289285B691B94D73 『サンライズart
929,705,730 *60DCDAC7FAEE4614B1CB04DCDA6B6642A1FF3CF4 art160102
929,705,731 *60D59468CD3FA52DDBF61D1F5B1D4912B85304CB ART1$T$
929,705,732 *60DEE851E0F6A78C0D0BF7EF23D9EBF07C98D121 ART!5TR!35
929,705,733 *60D2594319184DA36C47875C0C13B1B4B9E87092 art7815
929,705,734 *60D2E5029CE0FC58A4BB7E47296D957509ECD327 Art9e
929,705,735 *60D49075F4E45289DFBF2FFCCC9F09411D960F71 artapadura
929,705,736 *60D513FB79832E7C7EEA3EAF38D3BC29775AB278 Artashshumara
929,705,737 *60DAE216B1F8A8FD1C509AA8688DBB2A88EEC9C1 ArTB5
929,705,738 *60D632008435C8DE7C434C67D270EA2FB98E29FF art.bartling
929,705,739 *60DC1384599D88562684655D9EFE859AF39B09D5 ART-BIO-STUB
929,705,740 *60D8079746463B1C9D745E1B583F91B2317110BD art.boshard
929,705,741 *60DE98349BDA14CDE74F7DCCC73B1B91EDA572CA Artbroek9
929,705,742 *60D031AFD6EC2D3337A900564706020D41856789 art.camposano
929,705,743 *60DA0132DA6FECC2E11CB793B8A756CD9305B2B9 art chin
929,705,744 *60D71E187B8BC8134A0652A5E95E0EA391521A21 art.claxton
929,705,745 *60DCE9A4563A5AF5C99997A5F6AB389559B2B505 art.cronoble
929,705,746 *60DD5BF77F7D987BD248F8EA48A973AA712BD2F3 artdecluny
929,705,747 *60DE8250E06E5D19427542DC8153785B0B1B8BBE ARtDm
929,705,748 *60DA05F499ED2FACCF2DC7E6BDEB35771374A15F art.dugo
929,705,749 *60DB466E9C8EB19AFE6506D5808D205895EAC9BA Artemese2
929,705,750 *60D7824F6D602A1A083BF06D0B0821F54C23DC40 Artemias4
929,705,751 *60DADAEF940EADD78C05732BEEDA21E8F23F82C7 Artemloed
929,705,752 *60DD2B1B9A58078E5C5EC0599A03231AEC881B04 ARTEMPOS
929,705,753 *60D5682DA9E290AD5EEAAC70125FD881AD6548EC Artemusses
929,705,754 *60DF178FCB5185067A131A471FFBB4567DC320F1 artemyev2
929,705,755 *60D9928D6BB9EAE2E6392FED2AD7FD84A97A8C1C artepalineco
929,705,756 *60D17F4C0C93E406C61851BFA6EFBD0F95FB85DA arteriop4
929,705,757 *60D293B44865FF434221DD8571BCC6174AA5FCA7 ARTERIOSCLEROSE9
929,705,758 *60D0BBADD0789ADBF7EF2116954DEE1879E0FB20 arteryramaz
929,705,759 *60D299853DB03A71C718D6BFD247DB3243505F65 ARTESANTO
929,705,760 *60D32F81657BF0713234DFD2B7D62A2C957FAB23 Artesiano–Karditsa–Rousso
929,705,761 *60DA1C52DEAF42CFC2E8FF510130142308325C46 [email protected]
929,705,762 *60D69801461AA7FF272E33BB2BE348CDCC60AB4A [email protected]
929,705,763 *60DAC72D57B2644578A356E70AC83CCDAABB75F3 artfeat2008
929,705,764 *60D8BC33C7B2144B74A954C551A8E19B9EBA6892 artfldommr
929,705,765 *60D6EF5B7E480AA9FC7677690CE19B9CE32B60C8 [email protected]
929,705,766 *60DCA929179B7AC635F62048DD614F0D4C4545B0 art.funez
929,705,767 *60D75E4F9438521A4BF43119C50585048985A3B8 artgiesler
929,705,768 *60D5CCC3674B8C9A15165DBDAB961A50A5E00978 Artgur
929,705,769 *60DB73B33B968B9F144AF63608B916D7A3E987A4 ARt(H
929,705,770 *60D4E9B5F005C77D5E2EC9EBB820369A9528F4DC art.hardmon
929,705,771 *60D69E9266A2640B5916F44680BCCFDC425B63FC art.hintze
929,705,772 *60DE1690EE6FCDA5CB250A26C6C89EE03B2F065A Arthitening
929,705,773 *60D0B45A9DA41BDA0A18DFE363D1189D64EA0B65 Ar!thmet!c5
929,705,774 *60D3BE2FC09300740E897290D96003A2838F223F Arthragr
929,705,775 *60D21909CE441FFF4BB65CEE59ADC946EFF4F9B1 arthrocleisis9
929,705,776 *60DC22544B4F8DD5E3867A71D7B00507B87F7DCB Arthropleure7
929,705,777 *60DBD1B9E7DA5F388B68F9BB6A469F07F3E99569 arthrorh3umati5m
929,705,778 *60D3FF39DE00DD4303283A9B5C484116CBAD3381 [email protected]
929,705,779 *60DE7460BEFA7AA542DCBBB92E131334B4B67124 Arthur16thjune
929,705,780 *60DB2C3B1E0ED1B2FE6BB6B89B8E9DF7252463EF arthur634
929,705,781 *60DADF6D9BBE8F0017DD156CF2136733250925FB arthur.bastic
929,705,782 *60D69242D8D292938CE8190B7D45B2197200CEA6 arthur.beechler
929,705,783 *60D2D0B99C6197BAA4E9141D31D84A0285A2E71B arthur.bojanowski
929,705,784 *60D0C43478743CCBA977893C143D0EE34F092670 arthur.brands
929,705,785 *60DD969045AA1703197942B3F85215716C809AA3 arthur.casco
929,705,786 *60D89D1E76F382D9242F8B6D5CB594DCB85FCA69 arthurcelestial
929,705,787 *60D772944C44B137565EA5BFC660570A7AE17CBC ARTHURCHEN
929,705,788 *60D36D4FF3ACCC55633EFF0081D466A41BD4B6D0 arthurd407
929,705,789 *60D929F9957E3465C4ACD6EE5B4470CBFB2B14D8 arthur.dathe
929,705,790 *60DC5E8BDFF61F21FCEF92ECDD0F88D59AC7E6E2 arthur.dirienzo
929,705,791 *60DEC14EB910DCDAA765304B603A8678C542C06E arthur.epstein
929,705,792 *60DFE9871134E87083826ACC5844C300B8716B40 arthur gambino
929,705,793 *60DF97AFC94278211FFB935F6E89CDAE37CE936E arthur.gerke
929,705,794 *60D5F181D16A341573764972EEC8ED81E3CF172A arthur.hackborn
929,705,795 *60DB7187E69D097A3B65D5A6CFC15B74F9B01A57 arthur.kapusniak
929,705,796 *60DAE19C0C9A3F348DF354656110AD7C6B0D3BE9 arthur.leubner
929,705,797 *60D92B4F14DDA8CAF9C010DBE3EBAF09A6D15FE9 arthur.marking
929,705,798 *60D0D2819896F360AAFB88EC91AC6B5763BE594B arthur.mastine
929,705,799 *60DAC4A831FEC58FB8D2D1098C6C2F90427EC302 arthur.matos
929,705,800 *60DC29EC9880BF841465FB6D08635AF9C439BF85 arthur.milster
929,705,801 *60D0C241941660DCB77BB5445C2AC584C4D86916 arthur.pascoal
929,705,802 *60DA83B81B9E570126D6B47E9F0069FFA7C04273 arthur.pew
929,705,803 *60D290A9C15D3DDA906870E12F6F4ADDDD2B5B31 arthur.platner
929,705,804 *60DB98CB7614688CB1571CE61036D464DCD633CD arthur.prochnow
929,705,805 *60D73DC214EE60647D34116003F3C44F326C4F8F arthur.reddix
929,705,806 *60DF3F8C773963257331B3CA8EF515BF17E07290 arthur.reves
929,705,807 *60D3120C83D621D4D44B4A713B7218EA9A73F5F3 Arthursagorna
929,705,808 *60DCC1A75027B9A279920F1B9438599D5903EF8D [email protected]
929,705,809 *60D03122543594326B80E7F187AF7D36EBDCAC21 arthur.shipmen
929,705,810 *60D4527B2770CBDC593CBBB665550F3420E956D5 arthursviews.com.auwww
929,705,811 *60DF5497BCE082EE748C7D8FCFB44DEC2DF93D55 ARt"i
929,705,812 *60D73095D92E2728C4F4A4D0D0050A63811202EC articeuser
929,705,813 *60D970F9C76711737CECF64A7762B7BE3E2475B4 Artichoke360
929,705,814 *60D44686B0C55A24A67DF0E892D7ABC4E3AE2014 article016898
929,705,815 *60DAF735CDCF22960F80E66CE83DB8DF182CDE83 article1012828
929,705,816 *60D8B4BEA304C1C2BC764E40C56FBE9A44DD7F30 article110601
929,705,817 *60D5A35D00DFA64FB56E55F3ECCE2B60333F9A13 article1216282
929,705,818 *60D0DAB707038E900CF8DBD1FB8CDAA1690C3B61 article1245678
929,705,819 *60D4189F8B12579AE55DE7F1D9076AE8481BE257 article128738
929,705,820 *60DDDEE62F7F2391640C554A6244668A0300911C article1356888
929,705,821 *60D7310490CA26DD9F95D875BE090B25039FBB68 article135829
929,705,822 *60DFBEA12439E72F96D136C17BC2C3C3C94423C6 article1604
929,705,823 *60D913A6D3D79C7DD012C346BB18D06457C0006B article160join
929,705,824 *60D4EE5267D51F1EDBC11D4DAB4FBFF8BF12FC65 article1669
929,705,825 *60DF5D6A300541470FBB18A94A144B5F54DC2555 article1846180
929,705,826 *60D7BAEB9852E60E6AC06A72CFF3C1E375773217 article2208939
929,705,827 *60D3A186C9DEBDF749FEE74F2A09FE263745C3A4 article2585
929,705,828 *60DE6AE3E7F8B37BD27B7291BE03CA5F64FB4CEE article2989109
929,705,829 *60D0B41AB3A889AA50FDAB269C0A11A91564DFAB article3800892
929,705,830 *60D4966DAFC5BEA0AC26720149852FE7A9CEEFF7 article428674
929,705,831 *60D1F6DD7E62C3703762550A22C0BB6DB8F26F9D article454
929,705,832 *60D67B69A94174318F0B4D022ADE8848E4E8F807 article621782
929,705,833 *60D238D84BE1AC2D64FA5E6E4C7F1C22B5DAD7A2 article6815569
929,705,834 *60D1EA042D3142BD80BB5E30686AE9DDD37CCF11 article6874921
929,705,835 *60DB0F995C737C6BD642C1ACD2A2AFAF13734DF7 article6965331
929,705,836 *60D503B369AAF233297B319397B7648FE4C6D867 article7025743
929,705,837 *60D46529B1877338DEF73C53FED06BDB39A04D15 article7121305
929,705,838 *60DD75998674E9B9D095668E245947A39334789A article782486
929,705,839 *60DD654ED4656933E9CCB14DF725B5A2D3559342 article80346
929,705,840 *60DBFAD247EB151E131D58CDF67AEBFAA36CF7D6 article839791
929,705,841 *60D68A598E1A67BC83A0A330E3D208D386F7F775 article846256
929,705,842 *60D97900CFA76B068CBCF963CECF1D72458FA02F article898815
929,705,843 *60D8AF4AA0A228F15ACED60D09EFCB0240EC9595 articlecheck.py
929,705,844 *60DCD1774E23E9C45A742643AA3923D68C604D2E articlepstrait
929,705,845 *60D0127FB305419114F94CA90301700B51ACC2EC articles.claude
929,705,846 *60DB8A62658EDEE6D16CF13FC481F525308F9B46 articleshort_s.8_cal
929,705,847 *60DAFD23FF7DFDA2E73771BD9D205C5A4581952E article.somanypeople
929,705,848 *60D7E3F0BA4054E599CC42167F958E4C433318FD article.swiftblade21
929,705,849 *60D3A1C224DF43CCC46F063EE6C64109132BE553 ARTICLEVITHEMOVIE
929,705,850 *60DB707976D4998C7C469C6EBBCB0E876CE730CC articlevrak.tv
929,705,851 *60D7CBF1D23F47732A14A34CA1D9869AE3C604F1 Articulatene$$
929,705,852 *60D5B0AD6707B6EB6AA177A04AA332E38EC8009B *ARTIE*
929,705,853 *60D40FA3C2CCEB82D6854D6CD06EF63EF7D958E2 artificial barriers
929,705,854 *60DE241EACEF9EED5FAFD7F1D7AF5D596703E006 ARTIKEL8498
929,705,855 *60D7A12FEDEAD3338C478F884FDA8ADBB0C9C67D artikelempf
929,705,856 *60D9B3E6CCE30951FCDCEEA2C8A8980316F62C17 artikellgruppen
929,705,857 *60D932E7854B84392B427EC0F3EE17B960019125 artikelsnamenkorrektheitsprüfung
929,705,858 *60DC27EDCAF6F9A407502853973F975E059ACC09 Artikeols
929,705,859 *60D2A7F58248A3935A863FAF4B450C667973A2BD artillerieführers
929,705,860 *60DCCF529B8E34FFF0961832767C50D514E1F1C8 Artiseried
929,705,861 *60DB065E46E70DB0FB49BB3A006670E9E8370984 artistas9
929,705,862 *60D85EE113A8A39B977C55778ACF6BA0895EFDF7 artistave
929,705,863 *60DD41D464CAB49F8E5457F928CDDF92664CE833 ARTISTBUTCH
929,705,864 *60D279F91C712AD6AD983DA6889288A2BE7C053D Artistmole
929,705,865 *60D9E1B8E752A1AE8A95BEF44566120B1D6BE735 ARTIST-NAME-N-SYNC-ID
929,705,866 *60D6E2F4C4F1D28EC172F396E607F866349E16DB Artistom7
929,705,867 *60D5CDC77A0BB22325C34AE094940F5CB0A7AEDC Artistroyal
929,705,868 *60D403158303F933D73DEE07AAD8E56FC4459CFA artistsendit
929,705,869 *60D455446CF8475AEA0FF1BBADD82EF4A26DC5C0 Artistに就任。
929,705,870 *60D5D072849F30031100F9AD0914790705C035E6 art.krimple
929,705,871 *60D3C15889A909BA97C85A81D0866B7FA8674A3A art.lanoie
929,705,872 *60D2C6C1D96CE2F92BE6B40D782FBFFD027A41D7 artliceon
929,705,873 *60D10D337BE9BE6F689152502F99103E68F86CAB artlovervon1234
929,705,874 *60D3F67ED90B8C484D8B383C2C48C8B7DC44E5EC [email protected]
929,705,875 *60D931C8B299E34199CCEACE09856414A56DB699 art.malavet
929,705,876 *60D55850EF3A8ABF2204DE6C6D2089A1AB0A2D49 art.marki
929,705,877 *60D5165A3B9378C3A90979618C32DB736CB07325 art.marsingill
929,705,878 *60D79914B0BBD452E937CAE16B439715131BA78C Artobsw5
929,705,879 *60D06DEE0F25FEF7213858502D019073400B4142 artofdawn
929,705,880 *60D081BBD107224937BDD7EA929C1A03BF91868C art.oliff
929,705,881 *60D059DC0469C2F331265D64A4E0D9044B0FF56B ARtP;
929,705,882 *60DCEAFD4F15FAD25A563391344E268830B90946 ArTPn
929,705,883 *60D636556FEB4FE47B7626FFA42C54D06ADD30D1 art_porter
929,705,884 *60DE2B1095B2CC01BAF76DE3B8B92AECFF630944 ARTPROF
929,705,885 *60D60539F7C534AD227143D83DADF6A91F364BCB art.saavedra
929,705,886 *60D708A834854AC42565DF4171C764456D2C80EA artsadaed
929,705,887 *60DA673F2E1BC121F0F9A8C4002D6BF06F506647 artsamelie
929,705,888 *60DEF4DD7C4E50A1D0A85EE42EF7ACCB76A40C77 ARtSb
929,705,889 *60D5AA05F28D13187F553962F15FE046D9FE2B61 art.seabron
929,705,890 *60D3EA5D46F433BDF5E9AF1D4C67E4101711FD28 ARTSEMES
929,705,891 *60DC40D22DFB9F6CD31D345087077A09352E81E7 art.sina
929,705,892 *60D033C08B2FB9F6E519D08B7A33A5C80F5F7CB6 artsltsmallgtltsmall
929,705,893 *60DB6694B175E4EC66F6D2C91A8A01D969FAFE79 artsmag.orgwww
929,705,894 *60D17AF25A86EF585F10E008D54654D057FCAFBD Artsnet7
929,705,895 *60D12CB63774FF6E86AB3C2E141E2721393C9AD4 artsquickbio
929,705,896 *60D0B7CF78DE0887C1F29B91F2FC85399004C7F8 [email protected]
929,705,897 *60DF5E5BFDE5060C9124466227BDB544FFE023EB art.starry
929,705,898 *60D7D6A3050372CF412B92E4EC5B7B4ED7434382 art.stefka
929,705,899 *60D3A3E0FDA88FDA560F149B6B0C550195F49368 artsteining
929,705,900 *60D203B0FBC7B1C0DCC41AF7EFED4E54696FF104 arttextarchiv
929,705,901 *60D56085CB384754A14E072F84057DB5F67F249E artuku
929,705,902 *60D0C55A20CF7E109308DD5FC4C02145A61EE53B arturo.barends
929,705,903 *60DF4958A8F88BBEB503ED6D4AD4CCC75F65B7A9 arturo.benoy
929,705,904 *60D7EC9EDF7D9A6FA71AD1350A5BB9A094F8D3D7 arturo.bigony
929,705,905 *60D5BE7261DD12C0D90C8B94C3E1C24034F05CB8 arturo.bilger
929,705,906 *60D416E350A6270CA0D34F1F461FDFC9CF36B2AF arturo.bulkley
929,705,907 *60D5862CBF2DA6D53216123B70EDB64FAD6C5331 arturo.butt
929,705,908 *60D3D257E6F104491654A9BA4AEAB86E6E3EB4EE arturo.crossmon
929,705,909 *60D0023FD7D82CE805AD5F5F9F882C5043CAA362 arturo.dallaire
929,705,910 *60DFFB6320BD7D619272486F90D45EE883492A5B arturo.darugar
929,705,911 *60DAB0739F502D6494ADB04D22F4BF56FBD067C5 arturo.dority
929,705,912 *60D9C98E1B8825C73CCEEF45D2A7042DCFCD6305 arturo.fauscett
929,705,913 *60DB0D0015E2762845D020C0B37150675077EE21 arturogamino
929,705,914 *60DB162BDE7F7392A3FE55478192FC1D7AFAA919 arturo.golembiewski
929,705,915 *60DFD68AB843A129778A5C332E1FAEB55728CF95 arturo.golston
929,705,916 *60DAC62FA519BFA778BFE5DA3CA0495149E5A854 arturo.henslee
929,705,917 *60D44D415CDF5CA380A233B88376A3348B49A465 arturo.hermsen
929,705,918 *60DC2BDD6179756FC1D29E48E6201100BA858EF2 arturo.kaut
929,705,919 *60DABC3357F1312D4ECCB9B1F35215191E98A9DC arturo.lafranca
929,705,920 *60D60B087E5302549DA638DA433A3D6F9930E778 arturo.mcavoy
929,705,921 *60DF7931B5773646A60CD2CEA4D032328866EC1A arturo.meadowcroft
929,705,922 *60DC66011174D10AEA79ED746080F6A456FF600A arturo.peskind
929,705,923 *60D0F8EC91159AF5685060CB09A3A8F946866989 arturo.rook
929,705,924 *60DBF077177FC9E8466D9E1FEEE6851F552DC7E2 ARTURO_SOTO_106
929,705,925 *60D37A8FC702869A48FC139A92051A09FAC8D2A0 arturo.spielberg
929,705,926 *60DB3CAF405634C08D9D8B4275EBD9A7030FD7C8 arturrychlewski
929,705,927 *60DB4B9AE3293A5C390224F6583BA7499777487D artur yakubov
929,705,928 *60D733EAD0EC14DA9EAB14663FA4E5CD5F32923E [email protected]
929,705,929 *60D4E9856F428B70CD8E4D5F3246CC66F434841A art-without-artifice
929,705,930 *60DB1824602F7BD5916093384EEA30846DE417A3 Ar$TX
929,705,931 *60D7EBC3CB725CD74C44AC884A55B82797A73D24 artyom112233
929,705,932 *60DB63E6EF42FF8E0E6C43873766B01E82271DBA „artystki
929,705,933 *60DE1E0C49D897866CD800E08FD2C4A3591AC901 [email protected]
929,705,934 *60D4A1307E4DDF7323EDE4B7530A6115BC2E5EF6 artywill
929,705,935 *60DE0B03420D90C40586EFC7B15AE370569F9B1A ARTZIT'S
929,705,936 *60D1C43E6F14336AD9931F2FE5B54EBFB7018F22 ARU
929,705,937 *60D7DC8EA12D1D811289F4B70B69D20D1D196B8C A?
929,705,938 *60D05186D5E5744E3304EBC6D4F30506D4E55C06 A"Ru(
929,705,939 *60DC7CD4435CF0E5954FCA354EA7C195351D9412 Aru)"
929,705,940 *60DAB278437B1A8FC67C16D9815DDF4348060B59 ARu8V
929,705,941 *60D3FD87B9E103BFD1A3A57A2CCFEC4B15EF6BE1 Aruba, parel van de zee
929,705,942 *60DD90BE1C8766D96A9A6E69EBA02D209B4B6C33 árudákat
929,705,943 *60D050651AC39EF68C7E4D9184B95CD4E305FA41 arufwtly
929,705,944 *60D423D1467BD23C5E7FC0895B3B6D353FD90A3D ARu_g
929,705,945 *60D63A27EF1777D208BA8C0FDAB7099C5BFDA3E6 ArUGH
929,705,946 *60DA39E2176ADFCA8019D6C785A135B0EEA13EEA Aruiatub8
929,705,947 *60DD98CA6D8F8F27BD497AADE123D8A8AFCAE4C4 ArUii
929,705,948 *60DEF7C4A940125805468FBDC3B36E01202AB019 Arukitum4
929,705,949 *60DC5399D52F74D285FC1EE2B06B1FA55A95D500 arulcnoc6
929,705,950 *60D6DBD3322BCEED62E65EA8244940AF606D9690 Arulmolinangayar
929,705,951 *60D4C09DA83FC348C449BB73666FB951F5A4A52C Arumiad1
929,705,952 *60D28E7A96CE044BBB70BDF89BD84535822AEF1D arunapoojari
929,705,953 *60DCA91969A21AD1AEEB6364C64458434385CF30 arunlfo3
929,705,954 *60D5711756B8EAA993F6D8721A1B4090D9B40C38 Aruomis6
929,705,955 *60D0933DFAB961C75BDD869547D103729F2D3CB7 ARUPA-LOKA
929,705,956 *60DEEF21CA1A0D30DDADEC61EFF81F6579BA3B67 Arupbsw9
929,705,957 *60D1210C50A8323EFD745DB0AA2AEBB217DB9C53 arupirting
929,705,958 *60DB49455E38FE21B0DAC1D23F2690B24AC7F682 Aruppus0
929,705,959 *60D44986473B47F50A06FE2F86DBCA1D8A3871D6 arushteb
929,705,960 *60DF68AB00CA3529A7C0DF1BA45012868CB024AD A(rUw
929,705,961 *60D143DA2ABC17A692188BA9421ECB2084B6275E ARUYe
929,705,962 *60D5099FA91FEA74948B20E8FA81AC3528604DCB Ar/v-
929,705,963 *60D38230AC6D626DDFE8E2D1850552FC2D5103A7 Arvalen9
929,705,964 *60D589A5BCBD5DDB46CF6C29A9183ADD8CCEE01E Arvanatis9
929,705,965 *60D4C7120A94B98A920F8130A4EA03F33C65A4FF arvaniten
929,705,966 *60D53368255CA0811FBC5FD9031CF909580FFC35 ARVbY
929,705,967 *60D0D053CD25A23BB8E23ADA16994405224676BB Ar
929,705,968 *60DC3B88F10661A6D24704A24CD0E521E57F5D51 arvinabadilla
929,705,969 *60DB7CB553AA900D8483E490552BC51E65B3083A arvin clemente
929,705,970 *60D075716839F9B70AE35568EBC906504A90A86E arvin delacerna
929,705,971 *60DF42FA958B2352207230CBA0B529B35163F8B9 arvindtripathy
929,705,972 *60D49AA3E78D600B838A63FC631011ADFD75AA8F Arvioiden8
929,705,973 *60DF33D5C897C2DD97D443D951A79361B9A9B19C ARVn:
929,705,974 *60D013EB5040C0A4A64BC9654637DB92BFF40505 Arvokasta6
929,705,975 *60D4A9992742C2420340D036D939320CA188E100 Arvopaperioikeus
929,705,976 *60D61347FF970FE7F28C0782BF7728E87F206F99 Arvorum7
929,705,977 *60D891924E068A429220ED8CBBC5567AE792C1C0 arvothan0
929,705,978 *60DC9832172ED676E2CA81C84209CFBE00792A20 Arvottujen
929,705,979 *60DC290E93286851E18FBDD132A7C32648EE5C46 arvoy1234
929,705,980 *60D88F8D12D5FED4B27DB961B796905C270899D5 Ar/vp
929,705,981 *60DED3C2E3007CEF84312691A2D581E09D611820 arvsrätten
929,705,982 *60D59635F1847C4B16A18ADE4A810292ADDE3942 ArvU"
929,705,983 *60D4E08B23ADC56003230C1BFA77A1DF692B971F ArvUT
929,705,984 *60D647D031E388DD0FE2070179F9312678EBD8F1 A&RW?
929,705,985 *60DD6244466A039263DA3107B46A625FAB0DAA84 ArW+,
929,705,986 *60DEC8BADFDEAD8BCB4EBFEB96A22471487BED6F A"rw=
929,705,987 *60DFA70E31C76FBFCEAB153B5A8E522778B97768 ARwa!
929,705,988 *60DDD1BB9DCBCC3DEA08587285D47D55AB7C627D arwakki
929,705,989 *60D72A4B26B81A5E0FFE142E54338C80309FD37E ARWau
929,705,990 *60DF20736D8260809F200816151A72CD31D65510 ARwdl
929,705,991 *60D080FE445FBC0EB7CFCA278B79A5174AC5D8ED Arw_L
929,705,992 *60DCAB62B282096FEA38737880E22C6A79461B53 ArWLK
929,705,993 *60D8B1C0AA7564C850366BEB19E1B75F3364462F Arwm#
929,705,994 *60D4D4D7261DFAD562F6C837CB55D188CE1E9B67 AR%wO
929,705,995 *60D24CD8F24668BC92E835771FC1BD9E449C0576 ArWpL
929,705,996 *60DCADB8E682E2E4208CCEDF27C29221AE5061E7 ARwpU
929,705,997 *60DA77A70683928B3A6F3F0E71BC84B8E5843725 ArwSS
929,705,998 *60D7719CF3223598BB5A652E96D335142223D652 ArWtd
929,705,999 *60D8CE9D9BCECDEE277784A98338A65FCAD62E5D A),rX
929,706,000 *60D4DC329369E195EA3C3387F3B94F89C192ABB0 ARX:3
929,706,001 *60D5FE31BF815498744156714986846DFCA83843 Arxiereases
929,706,002 *60D343B4CA643DED739BAC4CEE2DEA8F6567596C ARXrO
929,706,003 *60DE738DE2EBF2E62114C4B876144C0CC60C3E54 A_R
929,706,004 *60D6F7C9DC0FD0C05D9A2B56886BECAC0BE16E22 Aryan407
929,706,005 *60DC162C41229BE2362AD018AFB535B367E55C0C aryan560
929,706,006 *60DC432A7B823E43576803747C10DCDD68B0C746 aryanna825
929,706,007 *60DE294C841F5835A365744B32809441FFC90201 Aryanssnayra
929,706,008 *60D0DFE51F73884840285A6249249B792C99481F aryayudhistira
929,706,009 *60DAA8D02BBACF7752DDD4EB1E1D452206C48131 aryeetey-attoh
929,706,010 *60DCEE18EFEA3215E1B79C276D8035B86A885F35 Aryngeus5
929,706,011 *60D135BC8950A818D69B76E6CEBA818D11781837 ARYo"
929,706,012 *60DBE3218E410CF1C107501E8B15F19C735B0403 arypnus
929,706,013 *60DF865B7F9FFC7FACA545EE734BF298843394B8 [email protected]
929,706,014 *60D070D639325386BC2BC8FC6C505F4AB6656692 aryspydy1234
929,706,015 *60DF319ACBECD9512D2AC28662D24A6B6161C9CE A!RZ,
929,706,016 *60D9A228ADD9B2F55446A7A2E7A1B86DB2E71ADA AR?)Z
929,706,017 *60DB765AA772DC9BC4540D9C6080ECDCE222AEE3 A,.rZ
929,706,018 *60D08279DFFACAAC658DE4C142B348D12011C150 A+r
929,706,019 *60D53EA0DC63D8C80F2A337D0C42F6E0ABCABE51 A+rZ#
929,706,020 *60D13A9EFC8C39810147DF9A67A427954D3C327D ArZ-2
929,706,021 *60DBABDE6E421E490AD8B8C9C5B391C3B82DD4C7 Arzaks
929,706,022 *60D006A537D3BE3C184244D15C1E182C996C1B58 Arzawi
929,706,023 *60DE20F1CC23D0EE727AB8B653A382E15DC3F9B9 Arzenlus
929,706,024 *60DA3437B4E1DE5DC12085F1D1286EE974454C90 Arzenopolybazit
929,706,025 *60D581BA6CDE1C5DC1400EA81C37333573FD5A7F arzerelo
929,706,026 *60DABDE44EA0C391CD032983C0A9B8E88ED072FF arzneiverkaufstellen
929,706,027 *60DBC8B5A0D8A126ACAE630CF7882BF13E8847C0 Ärztestand“
929,706,028 *60D8E5272D31B8BF9B5673C19A166EBAA0F289F2 ARZv?
929,706,029 *60DA12D695A4C171446B49B4DE361597D0A714BB A-:S%
929,706,030 *60DAD2001E14F3E545EE84320FD38E2AD664B3CA A#S+
929,706,031 *60D85935F0B58D46F34A1CE5513E51F6C2B7600B A+S/
929,706,032 *60D0D6E79A527368D71F216994CEC8ABB98C34E1 A=.s&
929,706,033 *60D7D8BD6E4B61C5C2E1A466E99DAD3656A3E88E A=s
929,706,034 *60D9C027F673200AE01C3C9E8CCBD9507156233C A,s=,
929,706,035 *60DEE5CF6DB7385404A58A0C17143C6AFCB83F61 A/-s)
929,706,036 *60D3C8E59CEBE8F2B4ABF53DB44327542465C75D A"
929,706,037 *60D9C443B9D4C2B03168AFB4402306619081FA4D A(%+s
929,706,038 *60D4834FB90E333C9DCAEA800D5085F5FBBF2F1D A+s
929,706,039 *60D5DDB51B415FC6D5C2AD967BD2FC6AFF563501 As;!+
929,706,040 *60D48ADC680A46DCCACD950E31535F7DD9C7326C A_(S0
929,706,041 *60D693B6BEC758C9EC9CFCC26E3923170E6AE55C As%0G
929,706,042 *60D28D62BE87340687B2F7A10894F2C66710BCE1 A
929,706,043 *60DC170A4BA654C3AFD28819F903421CB25D65D7 As0(m
929,706,044 *60D611FB1AC0F3AAD6D13B726330739E14E19D30 A$S0O
929,706,045 *60D4C39EA090572D3823FC989C4FE3F1D511CD47 As$0t
929,706,046 *60DF08E4AA22ADEE7D1A2BEA9EA0A6BF8C83759A As16E
929,706,047 *60D20A55E67D9A4BDE4495C55290A57C70CE1E62 A-S1A
929,706,048 *60D98BED524E02A03681DE2645CCD339D49B93D9 AS1fF
929,706,049 *60DB13E4CC10936B6E84473C29372BCA668F8268 As1T-
929,706,050 *60D32D97FD0CD420446E9986F007F4DC2CFD454A A!+S2
929,706,051 *60DC985568EC4389B6A918F430D340AF3B4C8431 A"(s2
929,706,052 *60D73920A5FB4EC65256692D922A364E310255ED as2885.5
929,706,053 *60DC27B42DE4CEF7877340CB5A52587B09394800 A.s2H
929,706,054 *60D6CA02824A924A5469DD6FB3559C4ABD1A4062 A/S!3
929,706,055 *60D81FB1339DA8335590021B5F1E48D3925B6FED A&$s3
929,706,056 *60D1416D7475EBDE1399F796F623452ECB905674 AS31i
929,706,057 *60D58AE6DCDA6CD146395CC060DE87ADD695A17B AS3
929,706,058 *60DA976884391DD6C0106456DBB8B729455F4C7A A
929,706,059 *60DD932B59FFA1EC9C8352E3E8731D975FDBB375 A"s4.
929,706,060 *60D87AC6BDFFDE7A0887570279ADD0A65743B1E7 AS4059D
929,706,061 *60DDA827D3AB76968162E153513FF7E1C5C39741 As48,
929,706,062 *60D040AD637DE54EAF7F543D6CFACF924D68D1AA AS487
929,706,063 *60DFF82F94AE51FA84100A4A149162481BB5BF2B As4ZU
929,706,064 *60D1E532874FD8FD8A736FDFF10635F6CBCCC26F A!?S5
929,706,065 *60D6E531AAA45EF1CC56A2ED2D7AF1FB220DC615 A=s54
929,706,066 *60DE9BA7BAA7426417BE65018B882E86BDC97F13 As55d
929,706,067 *60D8A8A523BA52BC15982597C2E5D07F7D0C5440 As5Sw
929,706,068 *60DD80BD4DDE119FF7A1D337710B23A8BD1BA5FD As5va
929,706,069 *60D7AAE02FF752C72042A73D1E2271323660C90B As&67
929,706,070 *60D4C8C85321995849C348DDC3AA03896C4FF5B4 AS69%
929,706,071 *60D8BDBF0B197F6441929D49D18CF732E53133FA A=!S7
929,706,072 *60DF3C0B335E37C6A96734EB11ACD7FAFFB1904A AS73267011
929,706,073 *60D57187115C5AF9B13B2E8D9C624491218695AE AS76H
929,706,074 *60D19B12E1198ACF1FB296751B51702329A8749F As7ji
929,706,075 *60D63607E10DAF897F481188C6699E5F919125AA AS7Ll
929,706,076 *60DB781B87C4244A762F768214A044D9AC295091 AS;7m
929,706,077 *60DA0387BD6492E3769A8DD24FBB2C7651F316E2 As$7N
929,706,078 *60D5A5CE868E7946FA15A34D131CB934F4B96FA4 A.s7s
929,706,079 *60DCAA9A8A3CBB4A9A5F2580B0E847A938728BF6 As7X0
929,706,080 *60D15081636B72A5C473849D278DBAA02978C92F AS"8$
929,706,081 *60DD2579878711FFBF66E15F0D0A9B31EFF36163 As8+5
929,706,082 *60D8252723748F1148D941F6051B0F31993BED7B AS8En
929,706,083 *60DC3C6A97FBB17B1D8CC3ED4827F1CA30AF6FAE As8jC
929,706,084 *60D5F4CB16AAD46ABE0132B2FD5AB5022FAB09EB As(8q
929,706,085 *60D479044069AB29C69421F0739C4EF391C7BBC2 As8)Z
929,706,086 *60DBE801B6DFC074F80C65AF7B701B94129200F1 AS?9%
929,706,087 *60DFD4F828FF75023BE05E279160E1D6AB49627F AS9((
929,706,088 *60DD4B54682DCBF02794507AD943174F7A7E8625 As_(9
929,706,089 *60D9106DD34E008664F422D58633E133B51C32E1 AS95N
929,706,090 *60DFEED3CE2F47332C00B2511DA90A4AA8EC87FB as978
929,706,091 *60D23F4FE47F60D659F46580BFA70C94573399E2 As9bi
929,706,092 *60D7EA764AE5FA8F27FC0CD7BF5F505A96CBAB63 A&s9g
929,706,093 *60D4820A5BD84CD8E5C87FC5608D6A9ED67F5C7E As;9h
929,706,094 *60D9AC00CEDEA8C4092DA403FE99AB8521CDC51B As9jl
929,706,095 *60D60F68FC8F3909309B485550ED07376104AE65 Asa326
929,706,096 *60D42D8DEDFF022239622A7E82E099D5615959D3 As,a6
929,706,097 *60DAC0FA0F0A11FCBC46DF62C31C58605B69A21D A%SA7
929,706,098 *60D2C45D61546177A782AD8F60198E4FBF9A875F ASa&b
929,706,099 *60DB305CE4AEBA91856E1529AF9477D3DE263EAA Asabilik9
929,706,100 *60DEDE2232EF27EE8510FE3C4C6E373BB08DEF50 ÁsaBjörg
929,706,101 *60D1235EBE62510EA94FE61F5BEFB0264A64824F [email protected]
929,706,102 *60DB43DC966916159F87FA64F725B1E3B497242A asa.bovain
929,706,103 *60D68673F910B8732DA3744FD2DE7285AA62ABC6 asa.bresett
929,706,104 *60DF55B9C0721ED1898E8E0F0B285941CADAE44B Asabrin0
929,706,105 *60D882F98E11A9628BAEA486EE5AF5921486680C asa.burnsworth
929,706,106 *60DFCD49165CB51A77A8BA7A738C661D26D118D5 asacaré
929,706,107 *60DBEDFEB1C8C29C8FECDC9D5B2D988D1F79AB81 Asaccor5
929,706,108 *60D15B4403C919F720D580ADB6446731682BB90C asad ali cheema
929,706,109 *60D634A85279FD2DD9D002AADD7686300AD94951 Asadesus8
929,706,110 *60DD8EF84E334FB39C6C53135812CFF69B01B6C7 Asadighed
929,706,111 *60D3846AB0F14E805BE6A1D7FA15227F706DBA8A asa.durst
929,706,112 *60D78C57FF350C0D6B042F06FCAE67C2518C56CF asaeasae
929,706,113 *60DD7E1D5E037124BF5272DC345B7918803E2D56 asa.edgeston
929,706,114 *60D703FE831338553E801E842658EEBA509C2DC6 asa.ficenec
929,706,115 *60D5464CC3CD556CF38ECC72C4F68D0D88ED3D03 asa.gabbett
929,706,116 *60DEEA915E0D0C444005D70AF648318F658D3BDC Asagift7
929,706,117 *60D80ECCD294391E9383BCDA0061A807D21BA795 asa.glassel
929,706,118 *60D8A9372523FCB0059EE45A53B7BD30B9767C99 asa.hedrix
929,706,119 *60D321360304CBD5D1F89CA3B12318B0991AD863 asahi20100323
929,706,120 *60DFA14204FE2FF1924B28EFD5FE0B950D33FF56 asahinay1
929,706,121 *60DC8CF88AE64D50332B48F2BDBC13F66CE0FC20 asa.hueser
929,706,122 *60D4FF8D34E5EDACB421519C5635CC38D3D20753 ASAIN_GURL
929,706,123 *60D3E05BE3D8992CF6AE8A25644C24901090C400 asa.kaina
929,706,124 *60D166E7C4E0A7B2DCF65B8B8E03B24D971C5156 asakamay6
929,706,125 *60D955BC0AC9BE462EE934B5DDF9915D71E86735 asa.konieczko
929,706,126 *60D05497A2625A02F7B439BDF18BC867CA587058 asakust0
929,706,127 *60D626C8FE4AA53AE47DC14D05B7C2847B56DB2B Asalabsw0
929,706,128 *60D085185DB34B68E012E2E286A8F48AC9CEAB96 asa.lacuesta
929,706,129 *60D1F7EF9D6F1E26B880F780CDC583A2C0502292 Asaltada4
929,706,130 *60DA7B59488F7F5912DC6E826F5526E4224B2CA7 Asamajin0
929,706,131 *60D1879CA7FA4D03AD5C0520C36DE7C531B3569B asa.minniear
929,706,132 *60DE313FC957BAD7537FF4E38E926E63E946E90D asa.moyler
929,706,133 *60DF90BE22AB52B5AA7EBC1411862CCA0F39833F asa.nicewarner
929,706,134 *60D6FBFA556C7512CCF728CFF85D12A40471F8A5 asa.nightengale
929,706,135 *60D36FE6F8807D302DFD1AE627F1959FE4421C40 aŝantoj
929,706,136 *60D4C93CDB451AC0EB85FFD3005768FCDB52DE3A ASAP#
929,706,137 *60D27BEB3FF884759399BCB3E94337E90789F2DB asa.parisio
929,706,138 *60D738C3A6B8F02C3409128BE3ADB5DCD10B6937 asa.prewer
929,706,139 *60DA72C3DA820E6D61638E73BFBD5074B82D3680 Asaradży
929,706,140 *60DA96AD1E613E4BA1E07F3F1E70E2BB23C26BF0 as a random number.
929,706,141 *60DB505F4531AEF998E6598BB62E179A804369F3 Asardanting
929,706,142 *60D406C6596628B838EC3C6B97E89E5C0049EF26 asarinae
929,706,143 *60D03D4347B872868FF0BB6B69197A0FA94E3615 asa.sapienza
929,706,144 *60D1AEFAA0CFCBD45664831CE0DB2D3E40855611 asa.sharif
929,706,145 *60D203149F605A5A701BC5676BAD61E750EFBBC2 asasin3
929,706,146 *60D2D5718087F24A76A0FE9F904B7CA318CE5D0D Asaskk
929,706,147 *60DAE2758A1BCB2939AB2ED5F1C40AFECE23560F ASaSu
929,706,148 *60D49E4294DDFF95BE6B9C0C61839AC6180038A1 ASA_u
929,706,149 *60D8E0787BD333BC232C68BBF3044D24515195B3 As/av
929,706,150 *60DCD396C83BAF9D9E40B3CB6247BE5F974453CD asaylly8
929,706,151 *60DDB183B4B086B4ABA63C0C8C1B992CC02DC844 asa恵庭恵み野内
929,706,152 *60D862346C7750904BB891733F701F6C9ED73D81 A&S(B
929,706,153 *60D0CF2C331027F890118B8F6D6F20479C5CEA8D A++sB
929,706,154 *60D2185F72DC861371292B1250BBDCDD337A2162 A$+sb
929,706,155 *60D69ABE8D38DF8F1529EDCD9309458C811A1359 Asb5,
929,706,156 *60D377680BA233D9BDC7B5B175B716E58976EA3A ASb9A
929,706,157 *60D3DC829818803A87E6BDB1E0C2AB6E8F84B96B [email protected]
929,706,158 *60DA0C909D556EE7C141F6EA3A08147D084A017C Asbestdragterne
929,706,159 *60D74CC5ED2B35862794564FF563EF20D39E7043 ASBESTIC6
929,706,160 *60D479D11612767571B11BB6B404772A87D6296A asbestos-warning
929,706,161 *60D5390082AB7544B2116461663E0A7D81CAA50E ASBESTOUSES
929,706,162 *60D6A0E7779F72D79623052E380D0F518A8A6647 A,SBg
929,706,163 *60D9840809C077E59B86EBF29B6BD656E4436AB6 ASb_g
929,706,164 *60DF81E9462681D121ED9E7828A6D9EA7E915E1A Asb.i
929,706,165 *60DEECFFB6828E96590B181C4DFDC8C3576533CF Asbjörnsensällskapets
929,706,166 *60D83C6DF2CF7848CFF7849A0EB683CCE4C615CD asblëwichadje
929,706,167 *60DE0F36E300D6FF842C2B5CCD7AAB88D0EC0535 AsbnG
929,706,168 *60DFF92A87BA0551C0679C469F5097913E93E9B9 ASBOLISTIS
929,706,169 *60D7A43F67E4F18EC1255AA69841FF5B031513B6 Asbordens
929,706,170 *60D1DD41E48FE280D5650CC688A239F343D0E4D2 ASBp=
929,706,171 *60DC15BB1592A2B5CBCAAE5852F352C4DEB34817 A/sbS
929,706,172 *60D6241E2D0B0DFB3860BFDADA14585C30DBCDB0 AsBvB
929,706,173 *60D1E5BB53A0F49FFA8E234A77666F4E63D79201 A;Sc?
929,706,174 *60DA1DE18286B9362133097A0E7D2D370461F8FC ASC:7
929,706,175 *60D5DDB2694B005D4FE582057D0AD6B54C4E58E6 ascanbe4
929,706,176 *60D091B9ECBB2F741001CCD85AC8D3E2B8E250DC Ascarrunz6
929,706,177 *60D27D6DDF2B2D6C808FACDEB08CFA07920E0435 AscEf
929,706,178 *60DC47F3A4239DC77C459D93AFBAF33438253925 ascende6
929,706,179 *60DF094CBDE8B03ABB958D1ED0FADF76C80A27D4 AScenicFall
929,706,180 *60D87103014BF226D7C56A7A0726A1CB2506A15A A Scenic Heritage (a)
929,706,181 *60DB7FB7701A71B2625668CB45F5B04C7BA61A59 ascery
929,706,182 *60DCBCBBB9EC1F067CCEE28984ECC4F8A4CB3FD5 A.sCf
929,706,183 *60DFB2F97E525B32B302B57FC3434696C0EDDDB9 ASCg+
929,706,184 *60D7499C7E2D64366945607DD1FB39D9ABFCBBB2 aschalewworku
929,706,185 *60DB0281525FC3B84CD6C8D930BD4494D3087F05 «Aschenazi»
929,706,186 *60D84DECD131ABC1BB590D4649C118182D0D876B ASchlosskapelle
929,706,187 *60D7C7C41A20E7ECE0F3312D0E360452B734403A [email protected]
929,706,188 *60DDBE097C8950D7053416757481378C62B74F4A Ascidiaes5
929,706,189 *60D147D389806627B5A582BBB20632D6A3F6A0BE ascitica4
929,706,190 *60DF8A5DD4F8E07AB207F509E434E95FEB87C561 asciugaI
929,706,191 *60D243181075ABDE1B605B64EC81A4668A645DD0 ASC!L
929,706,192 *60D4D5071EFC13BC59B94F08B72054BB799863D2 Ascletarion
929,706,193 *60D72DA54B70F576F56D236CB6BDC99542FD394F ascot-tophats
929,706,194 *60DEC96B79B2843A01F17526CCD01DF85EFA6DA4 [email protected]
929,706,195 *60D9198AA4CD980C1A096D1EEE1BDE77AED8A29D AsCu_
929,706,196 *60D5FD9C4C68932CCF5719D98A4B19BAE007353D ”ascunselea
929,706,197 *60DC933907B9E2FC3ED5D3ACC4BC03F8C9175C89 A;SD0
929,706,198 *60D7CC23D7570CF2846E39333BB6D1A781753BBC Asd0p
929,706,199 *60DEB4598495E091EC7F19841A2A24669E348E71 ASdc"
929,706,200 *60DD3F0B316FF951A0FBAE4FA1457608601AF8B4 AsDco
929,706,201 *60DFA70809F80E0BA7984DF8D453C4E98FDFB453 asdf5484
929,706,202 *60DFD210795611C6F88DECDF58E3D2F5B5025B25 asdf653
929,706,203 *60D40B6990491EE7D73F9ABE6623CEDA59E0BB50 ASDF6H
929,706,204 *60D888A2A02A7D178776E1783C3E9AA6C8F3D88C asdf90aewurq3
929,706,205 *60DAEC13A346330D90A373752BB77E05D7087157 Asdfcasper
929,706,206 *60DCE4EFF81349DABAF722DA816CD2F5BA1490BC Asdffg
929,706,207 *60DCD69EC4F5195D57117C22D184A3D3444A240B Asdfgchip6
929,706,208 *60D3DC5FB32F0019E04519C94CEE9263E66A65E4 Asdfgh\
929,706,209 *60D17A0847E73354D168042F5521DAECF3380CBA ASDFGH2001
929,706,210 *60DA47A8FB25DFFF6E888C5C82037F41D9F480D6 ASDFGHJKL691
929,706,211 *60DE6862753B17C7A059E2544821EF1469C04589 ASDFGHJKLazsxdcfv
929,706,212 *60D7EC67AA9EF93C04AAA87CEEFD56E57202A6D8 Asdfghjkt0
929,706,213 *60DCA4C4C278C675799FEA7F7DFE528F0CED4F00 ASDFGHTRUCK
929,706,214 *60D2AC42E0B677F9A2818D03D12C85CAC5E0A61E asdfg:lkjhg
929,706,215 *60D7780C1524C008D63F2EE3DD7EC99A226C0B1B ASDFJKL;PASS
929,706,216 *60D357AAC201821DC4103959B48777514BE40735 ASDFJKLVANESSA
929,706,217 *60DEC6CCCFF2F1A9572B7D2AE7D31EB18FFC4664 Asdfvictor
929,706,218 *60DF3E64D523D77968945B8CB50C545D739B977F AS)DM
929,706,219 *60DA9B2745A2A96AE2E9A2452A678E62773228C0 A&sDs
929,706,220 *60D703672D408294F0309D0EEF29B23C2B3076D9 ASDS7316
929,706,221 *60D6411D25A2700D5AB510C7CE12B50F04E5A061 asdtelephone
929,706,222 *60DA2EFEF6910542FA7C7A0EA5D17B7DEE1C8BD7 ASdV
929,706,223 *60D58B4B149CD48DF3001396425ED5EADFC18A62 ASdvu
929,706,224 *60D92610A166F4DC1D6DBCA5ACA77440A840A465 ASd-Y
929,706,225 *60DCD08FEDA9E89B586E88F48C10646A8FD3A676 A"_se
929,706,226 *60DEC5B0BDDA2EEEC11984D5844C75895F5E6BCE As&e%
929,706,227 *60D852069A552FEC8B7005A8713E118961CA48A8 A_sE3
929,706,228 *60D8F01754CBCAA2AC29339AA398981CAF2D3781 ASE=8
929,706,229 *60D52D4B05E2FB5BF017538B8B6386760C5F1775 Aseaw
929,706,230 *60DE9073ED6FE9D909C145CBFEE8CB5E0951C8F1 aşeb
929,706,231 *60D00107D6740D1EFABDEBA4CDC638A5E137FB4F AsEcV
929,706,232 *60D02159B87F6ACB7DC66CCC45EE210B682AE111 aseenpiippukohtaus
929,706,233 *60D1314767339322D034897BFADB7CBA2E78C0BE Aseettom
929,706,234 *60DAAFCEF9FE2131738512AB2B361C0AE6496551 AseGo
929,706,235 *60D2CE691563696A092944E2FEC2B4C6659FC911 ASEGUR
929,706,236 *60DC9425F69FEE7C2D46D43BA2A63D5CF8C6D170 ASEHS
929,706,237 *60D4DBE52D707CE9A9E86A2F6D4D83521FF820D6 aseidel3
929,706,238 *60DADF5125F894B9EE4BFA4EDF3667598F822CBF Aseirrek0
929,706,239 *60D5E58142D23E1C520387CEA7BE5489E4B93CFB ASE=j
929,706,240 *60D3953437776E09D51B40EB416152FD5AAB8DDD ASEJAN
929,706,241 *60D7BA0155BFE3978B3F0888B84D3B1953853316 aselectlibraryn08wacegoog
929,706,242 *60DBBAA6FAE5776164BB7BC090CFE1360C3868AA Aselqllhing
929,706,243 *60DD093EC8D33C92C498B0A4EEE11D8BBA42E349 asemalaituria
929,706,244 *60D2ED1B2A2D85C56B520331CEE9401972A906DD Asemenea9
929,706,245 *60DFD5725E04C6F9F31F48C74152A1883E39110A Asemiglaze
929,706,246 *60DC5FC937599660B076E1F52F280FA8B8526DA8 Asennekaed
929,706,247 *60D8B803126126B3CB2C5AEE1AC732A80765D2E1 Asentasen7
929,706,248 *60DA050F077E5C15A37B62EC324A6B64D9359CB7 A$SeP
929,706,249 *60D991C5E6C005113CB86768499D74E9E91C85D6 Aseptise2
929,706,250 *60DD15901D72F0BEBC929613EA5C82997E2A9CA7 ASeqc
929,706,251 *60D7E9E90A001E6A493E5A177004894416F8ECEF Asesnihs4
929,706,252 *60D4542A11396C47C3C60A294831E2F473B73419 Asesoriasing
929,706,253 *60D2C2DAF7AF5678B49B15756541B1D32C298F8B Asetseeg3
929,706,254 *60D5E8A929582F54D3F7B906A86803CBC2DD0114 Asettien9
929,706,255 *60D547C1E3A6CE082AB26F219E53B8DE4B937F70 AsEuo
929,706,256 *60DE21985186A036F22627980043A41F5681819A [email protected]
929,706,257 *60D81F3C4D8E50A58F8A3B9DF60CD454744700E2 AS.(F
929,706,258 *60D47ACB1FE8811EA4F904EFD064CF03F9F0CC3B As/(f
929,706,259 *60DF02F7F806B33157561FF4F140007C2BB4A109 As+!f
929,706,260 *60D63A9737A3C04A536BC5DB3BEAC73A0D2A3242 asfaltbaed
929,706,261 *60D18855AC2DB7F98D08D19F726BABF5AFB23C4C asfaltówka
929,706,262 *60D80FA1E24904B1C931DEA8DE78F9B5B3EA9905 ASFのプロジェクトは、Apache
929,706,263 *60D9C39AC4F47CAF9C65C9AF4F350D35805EA130 asfārihim
929,706,264 *60D850E207A782E986C094D983FBB65B4F04E478 asfhqulah
929,706,265 *60DCE762A63BE272D0BE214E85E1F706CC733D35 ASF
929,706,266 *60D82F499F7E9072C036B8AC82B404E8CCB1C1DA Asfmq
929,706,267 *60DA054E6BA44B57C0B45C8C1E3C38F7634C70AD ASftO
929,706,268 *60D6838ACD6E1C15D037893888AF5388E4A3801E AsFu5
929,706,269 *60D37374E659B4AC0EB8A7A4DBBA3145A5203E2E A)SfW
929,706,270 *60D8E25E960F61C98A3BD479A22029F63D402AFF [email protected]
929,706,271 *60D31CD81C3165426371F35424200AB6EDCA615D ASG2(
929,706,272 *60D0A32FE494B2CBD2EBD3817219B41DB395C9D2 AS"g3
929,706,273 *60D4C69688D35CEBCC701BA68C98EE23A0D9D807 Asg4E
929,706,274 *60DD0C34B29E43CB8FCBC39683DE211452E33368 ASGAYAGIGAGEI
929,706,275 *60D4E695C6AF599790B7250AE17AACBB9D6AF6D1 AsGB$
929,706,276 *60D34016BC91D91FFF23B209E8079EA4A8F20FB9 aSGbaa
929,706,277 *60D363DBD20F956BD0A8B2EBE91A55C2C9D4F5CE ASgBN
929,706,278 *60D9B72C5310D30DE067DF711143EC4ECA06DB4A ASgCW
929,706,279 *60DE9181F0BE433B6F39ABDFAA7BD02A9BA51447 asgfiel
929,706,280 *60DD0CE0A64FCD137A49C3188A42CC243CA1DB36 ASgG0
929,706,281 *60D7B15D1562891B071459DB0152008EF1CA77CA ASgi!
929,706,282 *60DB33FA56ED07431E4670EAEB6CCD57BC061B04 AS)gk
929,706,283 *60D9D98F322CDD225A8C0BE3390F0A212DD91E62 ASGPV
929,706,284 *60D61612B896433F099B01E8F6CD3DBBB5AEE677 AsgPZ
929,706,285 *60D960D6811CBD8CD32DD78DA582C2EBBDE32E6F AS:_h
929,706,286 *60DE1C9895F4A2F8B8340391A1DABFAE245E34DF ASh!;
929,706,287 *60DA3C52FD1272830F4AD0021926FAE336567115 A/_sh
929,706,288 *60DBAD5F1CA700FADEA8673D5BCE63E09FA94CC3 ASH00
929,706,289 *60DA87BB19B94C3E41B8039B04B7631A768FC13C AsH0M
929,706,290 *60DE0DE9FED4461404E90F29CF31A9563DCF9DB5 ASH1+
929,706,291 *60DF58AB8D0965DC6C90F6B42C581410440DAB5B ash3.2
929,706,292 *60D9E9F8EA03828E560B24C0221078EC6897DCF7 AsH:8
929,706,293 *60DDEB43B7DB82A5221B33BA296EE2F8FF388752 AsH8!
929,706,294 *60D5160B23BF25C5F8D8014C35AD6218BC00C078 a shadow of your own self
929,706,295 *60DCA49F4DCBB8A0E5536A0FCF3710BA09B4D990 ashalomed
929,706,296 *60DD90BBFE9C08500BC2771D497C287FA4F0AE19 AshamedofOurLove
929,706,297 *60D56F1A4565CE2055304F7D9BC7217134B3894F Ashanena4
929,706,298 *60D38851577D1AD87BB29DFFFC486FA31B1BC867 asha vimal
929,706,299 *60D7537B85DC105B4DCDF4F0506274CBE6B4AFEC AShC%
929,706,300 *60D4140A21F30812C29271D4A9A3C3331CD1B82F ashc610
929,706,301 *60D95356A36F9D67854B6521DCCA7C3775D35032 ASHdl
929,706,302 *60D01A575C27CC436C8F21D89F9036870B0C76EA AsHDv
929,706,303 *60D477A555CF1B75E15547A8732E9C43FA9DDEFF asheapproachesthem.
929,706,304 *60D5A4E5F771141ABE7500292A2FEE8BE8595C3B ashen shugar
929,706,305 *60DC49E37A97A2D2AA7946DE99B1A4E3B5DFA95A asher418
929,706,306 *60D9F47B2106AB5415FD11DED6DB0E7CE9CA92FB [email protected]
929,706,307 *60DD99E96EC4F4FA800C31A552B53726953C73A1 Ashessea6
929,706,308 *60D97420D47C1F2B9FD8346E7B657900B06B11C5 [email protected]
929,706,309 *60DA1BF65809EE69A5E922ED9F08317E0AE393D0 ASHFAQ7
929,706,310 *60DAC5A0A043D1B9DDF974BFA474E11D9F670583 ashfordbaron
929,706,311 *60D86080EA71A7F221776FB2D319FB3973A5857F ashfordposby
929,706,312 *60D4FC6706D271AD6740CA7DA0150A1AA169C513 ashhurley
929,706,313 *60D6C2168970098C091A4935157747652B86BC10 Ashiakwei
929,706,314 *60D9D8D5E87833FB41434031E50B0A14E962EFE2 ASHIEBABE
929,706,315 *60DBC5278B21F0D458596573FA380760AA0C39E3 ashikabi
929,706,316 *60DC9BB11601D0B13811E69A1B38A1080D496630 ashirbadmishra
929,706,317 *60D262C0ABCA72882D20550445535E6F630C3DFA ashish jaiswal
929,706,318 *60DED01453D6BFFA9D194E6BB820AAE3F3659C5D ashituki7
929,706,319 *60DE6222B4BA54D809F21D20B74FE08ACAFA26F9 ashiv09
929,706,320 *60DE8886730AE3EADE3EC1F3484C013E9335FA4F ashjabad
929,706,321 *60D9786D782FB53A1678B1DF5BB42E7C99433126 ashkaliegyptian
929,706,322 *60D8E50D8E05DB5E4A2E1AE9C24B531BD86A1359 ashkan sedighi
929,706,323 *60DC8438FA0F1C417E19CBFD37D2BA49EFC21C5C Ashlee284
929,706,324 *60D6156E7BAB24E94DB759A90451077C8B2A37A3 Ashlee408
929,706,325 *60D77012B2007A91BE9B0DB3AC7AA991AB00FFDC Ashlee470
929,706,326 *60D6DDE1703077D3AC87F7AFDE60011732541142 ashlee brust
929,706,327 *60D0B8C9FDBD45C0B71E7BE795930A6994A889E8 ashlee desiree
929,706,328 *60D2059A5B5BF031E32368962D1B2053CD06D505 ashleeyeager
929,706,329 *60D0A026EDD6DC9C6B5C8E07E75B7DD064CD5E4E ashleighbridges
929,706,330 *60D4503C174D99245BB5F0E9EB76DEFC495FB2E6 ashleighvoss
929,706,331 *60DF5525501B13E4572E7F78AA96557E826C991F ASHLEY4BRYAN
929,706,332 *60DDB438D3F3933E412A547121689800667FAFDD ASHLEY6606
929,706,333 *60D3EB5741F0B3DCE1AF38456A350F3186D6A7E4 ashley932
929,706,334 *60D23D0C62E1AAC3C865E29888A444EDA7743540 ashley.blazer
929,706,335 *60D13BC0DA79B640FB86B43C26745B455C3C34BC ashley.brandal
929,706,336 *60D5CB1FFE7101A53678880FEF5AA6F2C81F1214 ashley.bugay
929,706,337 *60D54C2D3A74DB3FB79022BF5CB16A83A47E5A9D ashleybustos
929,706,338 *60D2CD46E976F35682E90007CD63368778D59AFF ashleycapotosto
929,706,339 *60D5D580026192162DBEEC45B95ED918567554B5 ashley.cassase
929,706,340 *60D746CCB14488B5786207E7C2A9C042CEAC9F15 ashleycavell
929,706,341 *60DBD9613AAF5BC762D2F31F56F16CEF7D149E0C ashley.creager
929,706,342 *60D4BFAD7AEE99B2866A6A11E8783556069A3A13 ashley.elhard
929,706,343 *60D6FDDC6645126709A0BA1F5388BB7D71D44942 ashley english
929,706,344 *60DA57D0C9F25549BF440F1EC210251D70B9FA17 ashley.fitzgerrel
929,706,345 *60D7D3F0D9AB118D3947584DF26C1309F4C79161 ashley.forcello
929,706,346 *60DAFDC1A99E182F85EE760E80C77385A6ECE524 ashley gahm
929,706,347 *60DF051305B3F5252F7EB792F8C0A04BB9ADF816 ashleygillion
929,706,348 *60D829710387ACFD99F80ACF2B0B6F8D52DB9D14 ashleygreenhow
929,706,349 *60D60F19E0C279689206C002D39CCFFB9CEE4501 ashley.hawken
929,706,350 *60D083ED39CF16ED3EA4A4B35F5AC60C126AEE39 ashley.hossain
929,706,351 *60D9095E3684F44B6660A2146C46A6240515590C ashley jawor
929,706,352 *60D3A15F478CA8208966A1F47617F9D681A36002 ashley landon
929,706,353 *60DC3CA0AE1D06A63466CD719150F6032C1B329A ashley.lema
929,706,354 *60DE7C8EF52DC2A1DAF65B9D7C54BA887C839DB4 ashley.manely
929,706,355 *60DEBFD64470327307942CFDDFF884C20573CFA5 ashley mcclurkin
929,706,356 *60D80764FAF811E998FA7D2016063483F8E079AC ashley.micco
929,706,357 *60D7F26FD6DAABFC50F7A1F3A36D86C151FABA73 ashley.mitchler
929,706,358 *60D959B71BDE4E280E86F4886C3D4F6D9E67E3CE ashleyneis
929,706,359 *60DFF6F5EC5A1CCB65911199A1F37855CE372F4C [email protected]#
929,706,360 *60D39B25DDAA9942DD05F94603D5EDAFBC1FA8B0 ashley.nitti
929,706,361 *60D12B0CC483F24032D237C232CDDA57C45F2CE1 ashleyoliveri
929,706,362 *60D1EF817A12AD045213F76EF11CF221C05F6255 ashley.pillon
929,706,363 *60D30CD7F4D650AD21E7F198545DCBE464687114 ashley.pooyouma
929,706,364 *60DB037DF7BAF5776D7137A3FD927B639F68A9EA ashley renee karnes
929,706,365 *60D39E44D067F6B5AC206EDBE4540AB0210AAE9E ashley.rhodie
929,706,366 *60D9F982FDCC3EE747C57A6B1BE02D043F00D50A ashley.roskopf
929,706,367 *60DC059C87103E12A99C6A816CC837F1B6AD72FB ashleysaine
929,706,368 *60D39FF2ABFA39A414FEEC4A87C046BA16C6D190 ashley shough
929,706,369 *60D2F888AA744F3998CDD55608F882419603FDFC ashley.shubin
929,706,370 *60D68E81AA6F4AB70C7C40B9F6C0FC3B5E5A0F33 ashley.teska
929,706,371 *60DFAEBCF1A0D8301EE6B6296B8753ACBD785781 ashleytimdal
929,706,372 *60D9C3C006CCE953F7EB6C9400685C7CF04648D2 ashley.tsuji
929,706,373 *60DCD4F7D440E5754E622CC2A9D8A39664622AAC ashley woodrum
929,706,374 *60DE93EC37FAD48AA6B2369BDF54D8ACC75FD582 ashlie reilly
929,706,375 *60DA0B27D16C79C50D2AFF1EB58C12E03541C07B ashlins9
929,706,376 *60D7CE8294AAACC463888E17A497CFF16C7F930F ashlyisgreat
929,706,377 *60DEEA5A6E87EA822EEF9442F16F7D7385A704FF ASHMAINE3
929,706,378 *60D10E33DCFE22C1AF312BA89BF1CAE46C567138 [email protected]
929,706,379 *60D858BAE721476986A80B39112E604CB30FFED0 asho2
929,706,380 *60D17346421746AC8ABE85F79095896C38DB1A75 AShotintheArm(feat.GlennKotche)
929,706,381 *60DAD894F3DBD754A33610A909C2B9B125A48646 ashraf saba
929,706,382 *60D93408EC90BB82A2882E5661785309840644DC Ashreyase5
929,706,383 *60DA50C580252CE1D4BB759AE719C0A49F90E54B ash rulezz
929,706,384 *60DA1CD5D547D95BED80356118EB5A24C9C9CAF9 ashsad
929,706,385 *60D6A892E8E65E0AE1F50B2E43222FDF76B2644F Ashterat7
929,706,386 *60DE7ED12BE59F6003FFAAF44A5147610089660E ashteyngarts
929,706,387 *60DA338210EF6D1DD57DB77FE8C9F2DE71502941 ashton:cigar
929,706,388 *60D6641E551712A4B74A42074A03709624DBD79B ASHTONIDAHO
929,706,389 *60D4564F3C9155211B3A9117343C548D4C5C0D9A ashtyn210
929,706,390 *60D6A0B70D6991C75AD9FD50A7220E377CE58E2F ashtyn868
929,706,391 *60D2C944AC097A05A8E424B2D784A317931D64B4 ashultz4
929,706,392 *60D079BB323E2BEDE1CA253300347D9C33DFEF1A Ashurna1
929,706,393 *60D1991EBDD08D41FED3C113802F34A4268A2FE9 ashutosh tiwari
929,706,394 *60D27B6C667FB9FE0F01F36A9EE70C0BDEBF7D51 [email protected]
929,706,395 *60D3BF34D808B25C903564F9097D756A09DA7793 ashwin kishore
929,706,396 *60D57A07E4FED70F5CA1D87B58AB430799AB1DD3 AshwY
929,706,397 *60DB6097C020454F015669AE1C723F6E174BF801 Asi%#
929,706,398 *60D2C172352B2E939E5DF309AC6CCE5F9A40A734 As)I7
929,706,399 *60D62C4643B2F670A833A4721BABD47DF59C31E4 asiakaspalvelijoitaan
929,706,400 *60DDBEC5C10F0FBA0D059F1E8E643B55CFF55654 ASIAN-CELEBRITY-GOSSIP-PARIS-HILTONS-NEW-ASIAN-BFF
929,706,401 *60D497EA2B4159C74E2B920B1EB334B1DFB5B88B asianchat123
929,706,402 *60D2EF4373AF17D0A304FC32ABCB783EA1FF4354 ASIANFD
929,706,403 *60D5C3F8CFDE900C168D5D24B1436B5041D9DE6E [email protected]
929,706,404 *60D06C3BDE937B63DC6A8806FC43DB2C1153B4E2 [email protected]
929,706,405 *60DE43EAB838756B48F2AB257DA46B1A6820EE74 asidehand!
929,706,406 *60DFCBE887707CCED7D01479CA2FEDAD78A0C7D7 ASIe;
929,706,407 *60DAADDEA36AFED15CFA304392008A1396D87473 Asiemtt0
929,706,408 *60D038C480C87B522C0830781C61D57DC58A2E95 A+sIf
929,706,409 *60DD0E8C41761FEFA8DB0CD0364E826EBD61A79C asifnayeem
929,706,410 *60D43F6A22F03A18AFBA8EC67206CD63DBCC7418 [email protected]
929,706,411 *60D6AA05E87BCC63362EBEFFBD3620E5B11426FB Asilagat1
929,706,412 *60D7B660D6D889460BCC77CDD2BB44FFDBDAD4FE asIlive
929,706,413 *60D9834E5F419787AE7D4E1DFB28017D847C1F2B ASiLK
929,706,414 *60DF9CC42382CEA69A16FC05BF4001901DA50CE6 asilyp.18
929,706,415 *60DF6BDD681C43D93BF28F00C204760C3D253E02 ASIMAñANA
929,706,416 *60DA8BB4ED8AFE69C06A0E2790AF36972C34241F [email protected]
929,706,417 *60DB6E575FB3F394AF2C0EEE41909DE6FE9BBCEC asimdelalic
929,706,418 *60DB6D6C8755DE22BC02878F974CDCC8503CF71F Asin"
929,706,419 *60D07CA5872155D91F8873A216AB85FFE140D584 [email protected]
929,706,420 *60DE9EF70AC08943CA88AE95DD6F679A650976BC asio-files-full-of-hyde-and-seek
929,706,421 *60D7BCCA97F2B6F9E5ABCFA29E51FB8FE27E023C asioilta5
929,706,422 *60D282BFD3DAD7362F379C171EA05FF5D457173C A.siR
929,706,423 *60D602339A832D3EFE09036F6D8C096E55B37403 ASIRIANA
929,706,424 *60D4AFB57242D3A52B5AB1BE01E0000C3C8D5540 as I rode from Calais
929,706,425 *60D1F54E6E121982BEAF456E1B6C9E0CB19E61ED asit vellodi
929,706,426 *60D8DE068EA5D90C7B3C6D81D2D27D02AF715323 [email protected]
929,706,427 *60D5F72CFE4BCC569DAA2E35DB7A8F028BF3F226 Asivybur2
929,706,428 *60D42FDFFB1B498C8E73C1119DE711E118EDEEAE AsiW"
929,706,429 *60D8C3E52B5308BB57F2DBCA7A0109233ECFFE7D Asiyoro4
929,706,430 *60D0705C686B5A995CB794F2791C232E7D9011F0 AS
929,706,431 *60D973A58210E5FE284E92373698010C411E873B As#j"
929,706,432 *60DB832842378863710A787EE6239CA611E058D7 Asj8O
929,706,433 *60DD1185B4878B7F0CFBBF46B8740B459D366981 ASjG9
929,706,434 *60DC8B32B73D93083F93BD45880E3E330D5D9194 ASJi
929,706,435 *60DD4B4A2D3606F062CA80C0B14F9D561FED7FD2 Asjic
929,706,436 *60DA653A1DC60015D28D4709C57AC0EA808BB26C ASK&,
929,706,437 *60DD37DAE12ED863AF04B12289CF3A0651CDB963 A=Sk;
929,706,438 *60DDA542075DAE92113D3FD4FB3B0D2448E171F2 A(-sK
929,706,439 *60D371C832CD29FD22B25DAA07AAD4157DA63A1F ASk3G
929,706,440 *60D57211490C9899096E051D31B168981D485C1C AskeFuglsangRuhe
929,706,441 *60D5408A5E2FFD5C894C3FEB18F64BB84BB31A22 Askelmaled
929,706,442 *60D9EEA372FBDC5A77CBE0C91DC7C366049F5E44 askepoys7
929,706,443 *60D28CD8F59912BDA62AB395CB93E419323E31E9 askerout
929,706,444 *60DC39D804A2C1F03E92A76232FD766CDB49439F ASket
929,706,445 *60D05FEF054AD247146A7F5F871B92470DC85DC6 ASk
929,706,446 *60D99CA7FBE8A10D7E8BBF4C297405A210EBBFDC askhad
929,706,447 *60DB7A42810786461A5F36485284F25DB0160FB7 ASkHl
929,706,448 *60D83F0E4D07E4C76BE0CC5179D803E3ACC51580 AskimiItirafEdiyorum
929,706,449 *60D13A8E0A95ECE9F212EBAC3F24BD1B735004EE AsKKT
929,706,450 *60DA28AA66B0CDE7517E76017A8328B913DA8DF0 Asklepiosarstafinn
929,706,451 *60DDB46D73246E574FAD373389258988299679D9 askogenní
929,706,452 *60DBF535E24F23364AFF3B55C76BE4E086A9DEC5 Askramer7
929,706,453 *60D5C086BDF203BE2AB49CE63E4CF838CCD173B0 AsKsw
929,706,454 *60D878043A991F24DD99E97FC443FEB33F7275CC ASkUq
929,706,455 *60DA2231853BF89714A716A02B2EBAB14C736470 A/s:l
929,706,456 *60D6034CB9B29976AFA95A73DF8147369B353C6D ASlcr
929,706,457 *60D040B5C91D498B3D66D9CC4CADD20BFA43317C Aslekar2
929,706,458 *60D0E707AF030A1713AAC91A4BDD2E9179295A8B ASLH4
929,706,459 *60DEB03421EC4E4867ACC264F8BE79A95D6B49FC AslIq
929,706,460 *60D1594CA0CF15372833E6911458A4CC518F325F A!SLN
929,706,461 *60D02F61980AEE9806752D7B76F65576698DCF30 A:sln
929,706,462 *60D9F1FD0EE564B080285C17D1F7B168B0B47916 as long as the moon can shine
929,706,463 *60D37DD9D26F9733D00238574A00716EDC2FA4B2 ASLQ3
929,706,464 *60DD53645879424F20A5934C5F19F39A87BC81F5 ASlXB
929,706,465 *60DAD2DA98DFDDFB23B3808C9BF58BF0DFAEC932 A,SLY
929,706,466 *60D912B74CD4BD58647BD1EAE0B169B9CB7AAC13 ASL(Y
929,706,467 *60D18B1F7B216215E5BC0CA5CF17D04DFB260F4F aslza
929,706,468 *60DD242BB93F75CA7C06B76C3048D6EFFB3E6429 As+=m
929,706,469 *60D3A589688804027D7A319ADE50ED8D96AAF266 ASM1080
929,706,470 *60D250EFA69924A625F0CF80F6D6205493D7D616 AsM-4
929,706,471 *60DB14F3119689F9BBFD182A9024913AB02696BC ASM5
929,706,472 *60D8A1A80DF32880CFEF967C37A25BFF1676671C Asm7
929,706,473 *60DB36E37878BF949DAE94464AAE69612C8EC16E asmaa hassan mohamed
929,706,474 *60D8CA602FA1B2A63C8DDBD6462B3E1BBFBCE62B asmaasaied
929,706,475 *60D41AE160053F0C9C4CE6DFEC1F4F49466D67AD Asmalianing
929,706,476 *60DAAB7A3AB73A9E08D6FB5CCF229DA7DC788104 ASmAO
929,706,477 *60D37BE86FFD37E3B831220429D1F575CF1909C2 A-SMb
929,706,478 *60DFED9E2FF9CFC0620008AB7D12083B9A299E02 ASME를
929,706,479 *60D7FC22CCB0287BD6BFA9E32D6E3C48FE29697B ASmena
929,706,480 *60D1478B83450DAC6C8BE77FD042059467E098F4 as Menas says
929,706,481 *60DB329315A460E62DC7612429D71D45460E8A32 as-mermagen
929,706,482 *60DFD64F4A3772BE4D19725BDD9F96740E25D77E A#sMk
929,706,483 *60D6897498A13A0B9DD4F56E9AE760A9B607EDF9 A(smK
929,706,484 *60DE5A830D98D713195BE84E6C56434B08AD7E6E ASMMH
929,706,485 *60D7E741D4BBF6C7ED5CE55AF15E941DAA33C04A AsmmL
929,706,486 *60D5D88FA7F40D279031956F9D7574A5C565012A Asmodon
929,706,487 *60DB6C8F7347AB485BDD801CAA443430D27F13C1 AS-MQ
929,706,488 *60D44C863A9A4B0110CD5BA1B3BCD8C01D5973C0 ASmTp
929,706,489 *60D705F544715A413B250C95217C97A7A1F2ACEF AsmtQ
929,706,490 *60D6A8FE43AF0E3886639FEED36CF3CA1B86A699 A?s;n
929,706,491 *60D681D51B5F2BBB967CE47556ACB0A0CBB9D20D asn78591
929,706,492 *60D582B9B497F0AF6A68855718D99C35FD3D2D6C Asnakhaned
929,706,493 *60DBC01F2A0FABB32AC8AD4B5CC60A1F2274A16C asnaoui
929,706,494 *60D3C05C8721234C349CED53E3B0DBC252F06F8B asnba1234
929,706,495 *60DB5BB407EF5CA51D58EBD12F63B3386726FDD0 [email protected]
929,706,496 *60D52558DAABCD1D2D8FBE72633547E5C02211A9 Asneennas
929,706,497 *60D473D5BF89537035925950981DEC4ECF365C85 ASn,F
929,706,498 *60DE54F0F8D4BB07BE7EDD45B4065609BAB2F3E4 Asni)
929,706,499 *60D3525A492666EE534EE184C0AD289BFFE5CCF0 Asnidraking
929,706,500 *60D7ADBBBDB6829D30B34054AFD486DD3F18ECAD Asniemegs
929,706,501 *60D729B661F065AD9E056D0CC5F1E4D33906063A ASNIIREV
929,706,502 *60D8E92AEBF6CA83E8C258DBEFE8551FCDA198AD Asnirrop
929,706,503 *60D1EC5B622D084A68DE1E85481156C2CC75CAD5 [email protected]
929,706,504 *60D11DDD91D1AF25324E768E2C423D8030EBD6BA A$snL
929,706,505 *60DC73E3F4042A9F2063EA5466422EE3C946F62F AS,no
929,706,506 *60D215BD96E87F08EFBBF9B08FDDAB744E0FCE1E Asnookok1
929,706,507 *60D3C6C4053123728D9C1E5D0B5A242B5DBF16EC Asnottou5
929,706,508 *60D6BFB43C613AEFAE633A180CD5D68892EF3655 As$NP
929,706,509 *60DF6C8786CBC69825054B66E90967AA9CF81C4D AS;nQ
929,706,510 *60D995D93712332A9831406A990709EEC17A6436 AsNT+
929,706,511 *60D4A2E1BD0932FC27B28AE2F38F4DE6B4676474 A.S
929,706,512 *60D85366EEFAAC472DE0B3FADA33BB1E1224A717 AS-O"
929,706,513 *60D61724A90FB09DD3EC7009B617254033436DA8 A!So4
929,706,514 *60DAD8090A73F81AE5222F3F7B0C6DC56669C0C9 AsO8K
929,706,515 *60DDEEDD55F98B0D31DF3F98D3FFCF7A2EED5BB6 [email protected]
929,706,516 *60D1CBC16DF97AB091E720E76E7DE49904FC10F0 ASOD9
929,706,517 *60D88BACECD590410DA1C295A2C0BF17F2258AB5 asoflyer
929,706,518 *60DC361B47C38F740FDABF3B036EB94C6D221F27 asoght
929,706,519 *60D633F4E1F88074A42E628EDAD55D7C249A9EC0 A#Soh
929,706,520 *60DD086596A7E3AC396F72A1A60EA6A6A5FD9853 Asolpmi8
929,706,521 *60D52BF94F9833A8DE0C3C958992FC443DE3A1B4 A)som
929,706,522 *60DEE8ACF5DC76856C5736F4FC5C2307E3F095C8 Asomreh0
929,706,523 *60D464338938F4AC4512286C297A26DBA112C753 Aso
929,706,524 *60D2C460ABDB70C02B088D941B5F770AD7C71838 A Song for Myself
929,706,525 *60D57C36AD05D7ECF71E70363F0322193D454C55 ASopF
929,706,526 *60D6AACD68FB036E03B566642BB1CEC6014A6CB9 ASOu?
929,706,527 *60DD9628FED645ACC49F59C7B4D58046484292EC As(oW
929,706,528 *60DF9C61FA7B045934F3AB575E7ED2E020B6AC49 AsOYR
929,706,529 *60D323CF035B0E094F94F45E368758C5691B3314 AsoZk
929,706,530 *60D7F2C3FE24CB2C12748CC23B2A780DA9F97BE3 AsP1j
929,706,531 *60DBF69CBADBB075B49587E428240F06004BBF6F ASp6r
929,706,532 *60DCDEBAC80F3CF04B6C1E15AFFB0D58E8861676 ʾAspanyāʾ
929,706,533 *60DA3CCB193D1608B43362625BD6616EFA1B6723 asparagus67
929,706,534 *60D4B9F5B533619A3DE0AF2D6EEF4EB5C8CE147A AsPc=
929,706,535 *60DE9163FAED3F652A27C5C36A50C05B06A01D74 aspecinlvirw
929,706,536 *60D27F31DD275378FDA5FBB167E752D8B93EEF36 ASPEN\04
929,706,537 *60D3205E309F83454DD992D489ECEE65DF557B39 ASPEN4QF
929,706,538 *60D419276E63E218197B918B2219DDD5F32DDEBA aspen571
929,706,539 *60D938AA71A2681133076B8BFAACDFEA5DE85E6C Aspenfox9
929,706,540 *60D4E911F2272C09281925BC10846EF26E1C636B [email protected]
929,706,541 *60DB28878F7E721D9DD69508561DFBC152D19E3E Aspenruy4
929,706,542 *60D28DCD92381C730B4EC210ADFC7E309F80B891 ASpf#
929,706,543 *60D3F92546AB95C2AA74469562DFC4ECB94B4055 Asp?f
929,706,544 *60D083423DB166155E66A1FABA3654841619A679 aspia?
929,706,545 *60DF05857A369DE0C7B3F1EF4CD90E5984DBB80B Aspidiar7
929,706,546 *60D880842A20410F4631EE2EA6087953A3DF49C2 Aspinwal3
929,706,547 *60DA8431DADE7747290C50B1F5B5CE6EBD7B0586 aspiraciones…mis
929,706,548 *60D4A3FEDFBD928A56A0EEE884C56A01BA3825AD aspiranteco
929,706,549 *60DF6CD60FC2CEB62A37D037721F5F170D3E6688 aspiratörlerden
929,706,550 *60D295A8F2AFC754589D836144AE52B29A63D888 ASPIRINO.
929,706,551 *60DD17C999DC045B282719033A3FD76B28922867 [email protected]
929,706,552 *60D45AF2CCFFF4A559CD4C302C166A3FCD09CBCB A Spirit Filled Revolution
929,706,553 *60DB3BCFF9ED9A91AF82521821E0B20748E106E3 Aspishly2
929,706,554 *60D27FBF096170C4788399C2CB64C478D0BC92DD ASPLPG
929,706,555 *60D87B9A7C32A1E6EC83F8068C7FC1B25E01917B aspögonb…
929,706,556 *60DAC56F8FDEB5FE19BBFA5409E93B6FB2D21A0A As$pp
929,706,557 *60D1BD3D83F69025005AE681C644462AEA6187A8 AspPh
929,706,558 *60DC05299796A7841F781DC955D5A07C3DD20D8E asprinrox
929,706,559 *60D4D2BD986E00F0480EE1B586FCBE30F1B89A8C ASproxsox
929,706,560 *60D8A274E62AC4034EC3374E8D62B1363DA84E06 [email protected]
929,706,561 *60D101A6472DBCB87D5983186A0BDF1FB460D2EF ASpVg
929,706,562 *60DF926D51E2E21A202497702D458B879AC5F4ED aspxp
929,706,563 *60D1557E29C90EA2D83CA1AA59F77CD189FBAFCA AS,Q_
929,706,564 *60D03091F602B4DED845190BDEEF858C2A3E8686 A$Sq,
929,706,565 *60DD0570F21E992C4F9B88077E4744F815FE17CA Asq3i
929,706,566 *60DA282EABA5B2D95CFD0C0DE444946DFAECE166 ASQA%
929,706,567 *60D752A0F30E3E65E555C937D56F8D2F26213D87 AsqCi
929,706,568 *60DE52A330075DEE084EBD907349589B56F8C962 As+qD
929,706,569 *60D8D3E5D45A87458C182B01C0CBFC2913EADB64 ASQeg
929,706,570 *60D910DA2281DB0818D14FE2233977B0F3F70BA4 As?QF
929,706,571 *60D7174D8AEC4AC73AAE795A8EE3920E693011D4 ASQG"
929,706,572 *60D9045022EFCDF32331174A521DD2FA55731505 AsQg"
929,706,573 *60D4B8D88A330980CD97A3FAEE38BB16DECA2B7D AsQGB
929,706,574 *60D07BE27B1A3BBDD54FB04471CF03858AC22EEE ASqQw
929,706,575 *60D03CC8111E4406AC4D18E28BB3F86F22D937EB As$QT
929,706,576 *60D606B00A69A4468E768D2AA63FAAE4442050FE ASquX
929,706,577 *60DF6B12B3F9D300E2702B392319090DE8A93133 AS)Qw
929,706,578 *60D1A66763EEF73724DA00B4E2361343F79FC77B AsqZn
929,706,579 *60D5E27130936CDCE42E419E8ED6F14792DFB24E AS,r?
929,706,580 *60D2096AEB37CF1F646CD1A7CAB98F5E9E8CBE9E As/?R
929,706,581 *60DC7FCE67EC0DEB8DB24AC63A9F0A37EA0E13E7 AS+R0N0M!CA1
929,706,582 *60D2767DB321AC10935939527D84962E1EDEE886 Asr7d
929,706,583 *60DDE2492B2BCC0228C2DAFFDF41A70A4093CC4B [email protected]
929,706,584 *60D937D15D34E25860D42B8BE1C63324B7C35F61 ASrd$
929,706,585 *60DC93BED4C57E4AA90BF4A607605D02BA77CE9A ASR$e
929,706,586 *60DC0656DE3B1BA6D717A3E33B9E0E150A78C87F Asreehcs4
929,706,587 *60DE15CBE8CC71B1D74ED89537BA999206BA2E27 ASRFf
929,706,588 *60DF27B1F0145F057F36F64CD31CCD25E1F3EA6D A)Srh
929,706,589 *60D066F3536670979714EE30A09196655841A33F Asrh"
929,706,590 *60D1DB509743C3AE0D095CFF703E8D3F44147CF2 Asrhm
929,706,591 *60DD159AB9DBF8A3064321E22FF7B5A42FA82AD0 AsR,K
929,706,592 *60D7C19DC652583EFBB7AC3C7FF57DB507A0B06A AS+R!N9E
929,706,593 *60D2CD0EB5E754FED52D6AE8C9DECFA64113D21C Asrwd
929,706,594 *60D0010D7CD4649F9C695F04419B0714ED88D1C2 A)s
929,706,595 *60D9B418C3285C76D6B84BE1290BC337C7CDDA11 As&s,
929,706,596 *60DB900ADA2E1C7BFB0B0E41AE41BA20696884C6 ASs8c
929,706,597 *60D8F463EA950F861599A5AC76433ECEB90AF7A7 AS:sa
929,706,598 *60DE027F8E2476E81EAF0D51FC347F081A3E1F46 assadhana
929,706,599 *60DAAEA9CDD7A88D26B2D2C043B2989AE9A6A606 Assaill4
929,706,600 *60D3D31CC3D85F0998A7D5905C14C19E3E363200 ASSAINIE2
929,706,601 *60DE7E7671B4DC7D3CF2472B24590D204106DB78 ASSAINISSAIT8
929,706,602 *60DFE8B9EF1AA4FDAC9F5368AB61D5BA8857C7D8 assaisonnerait
929,706,603 *60DE80ACE14A077F85C69B2248C992540F005889 Assamoibbed
929,706,604 *60D06F21D5115678AEAB2D621E61C78823CAABB3 Assamore7
929,706,605 *60D0DCE6F2AE15CB62424D8BD39B302C9968B8F8 Assarad1
929,706,606 *60D0313F946E552D03A4EBE8C188E55493FA4145 ASSASSINI0
929,706,607 *60DD2AE568493D019B7661495AAF333732D0E385 Assau1+!ve
929,706,608 *60D4B487B8CAD6312D048061FC8560208B309311 [email protected]
929,706,609 *60D1A23AAF3D2E3177624C5271084E34C364697B ASSAULT!N9
929,706,610 *60DACCDA487B1B6EE8AFF1376FF168848998CAFB assaultofthesilverdragons
929,706,611 *60DF3941E3D79B74A472FA073B704BD3B0A76BBE Assayta
929,706,612 *60D1D04A4EFD77ED192391513672B7B3E2FFABE8 ASSB+
929,706,613 *60DBFDD5F9BFEBCC5CAA26362321C3A57E4D7B88 assbozo2
929,706,614 *60D805F9A6C375B06FC9724ADF4988658D45EED6 Asschuck5
929,706,615 *60D8D1090069B580B24A4A27DE813C30B0BA10B0 assclboy
929,706,616 *60D08C6E67EC3F70CBCA671E05A79C1452E3A0AB ASSCONCEPT
929,706,617 *60DA635E5C81CF9E28AB65A54D7D52D9A27F0645 AsSEB
929,706,618 *60D518DAB796606ECFCBA914A811D510DE190B47 assebuch
929,706,619 *60D06B156D46BCD041C998B894A0EFB1AAF594E3 assedares123
929,706,620 *60D380DD90011677646E8759EB141BBE19A541EC Assedlab1
929,706,621 *60DF71AF1E695D3CC6D1EFA73BC1A135C18EF352 Asseforp7
929,706,622 *60D2D82DDCADB661F1B3DFA4BE341912DE489479 assemblaienT
929,706,623 *60D75BA9C29B457CF336DCEC43F3FADFAA5A5DB1 Assembra1
929,706,624 *60DB28A8CDDE7AA99B71B376A3371AF22B65D531 Assenerons4
929,706,625 *60DBBA56A1F102B10A5DD7EFE1254031289A5491 ASSENTADORES
929,706,626 *60D9690C4A18759B77B9FF2F8BC36AEDA16C21C5 assentirem1
929,706,627 *60D095E75442A8BBB0739F2BD6DD8FD545D5795A ASSERCIONES
929,706,628 *60D318972154750631F3166CC9A5B554C9AE1320 ASSERTIVENESSES.
929,706,629 *60D6DE27A5A9F1D824990768DFDC260DC5032DEC «assessorament»
929,706,630 *60DC30663F3DF47DA74B0EAEF9BD71DA64D4BC06 ASSESSORSHIPN
929,706,631 *60D7C6B9E8B20FB66B5CBE3B44811EC1CA58D629 Assethal8
929,706,632 *60D382742BE20CA1E76E6315DB7BAD4143071F81 assetsu9
929,706,633 *60D3EFB3FB4F56573FA7966741F84686F401F74F ASSEUKTA
929,706,634 *60DC67BCAF0BAB90F9B0A59EE211F08DD2E33223 asseverarmeia1
929,706,635 *60D19511843EB872408F7F0398EA5EA6CC76D4D8 asseyions0
929,706,636 *60DC9602F86532689ECE8B9181CD786D8B3E2356 Assfugazing
929,706,637 *60D614CCC45ACB1EB6F547750F6E601A163C6E34 assheim
929,706,638 *60D06B230CF3E482AA6E03762391CC3CAC45553B AsShN
929,706,639 *60DF5B34A23BE7056AE95AC3A55472EEBA935A80 Asshoile9
929,706,640 *60D489AD961FE0EE224E09BD8DC14374FA14A39C Assicuros9
929,706,641 *60D9C6A8347A0495B74598B27D0C16B53FEA0321 assiderai5
929,706,642 *60DD40B89A6E1F03AEA54FF726F99D15BDDFA0D2 assidu!
929,706,643 *60D29A766667CC3D87F5F78586238F0D64654B0B Assievoh9
929,706,644 *60DBC48015217FCB7FE2F0E2D635675BA4D518FA assiggiatu
929,706,645 *60D01C32611F8247595462EAD035E93F7AC5C1C3 ASSIGNAAT7
929,706,646 *60D0C5E1BC8EF2C743E1C8E113DDEE2013F67294 ASSIGNERONS8
929,706,647 *60D2ACA7CE6968C18FEB1D86C8FB101B6A1B4103 assignmentexam
929,706,648 *60DE2A549726D26B18B5D0DAEF69543DAA0594E4 assilola
929,706,649 *60D345954BD3442B4B2F1D06C917E1308EABCA32 Assimilationin
929,706,650 *60DCBD86830103DEE8B9B84059687E70628F643F ASSIMILEES8
929,706,651 *60DDA1A6327B7B1B649DE54AA926A920D12D7BE9 assingnment
929,706,652 *60D40934AD65032A1F2838D3D8B53B87FA92E68E assinion5
929,706,653 *60DAAA3BE6A4BD9E617FD4A07E67F01B085DD106 Assinnuus
929,706,654 *60D48A48A040BA68887EA07878BECCD8B1845C41 assisaac8
929,706,655 *60D77545AB75369F2D748CC26FFBCA7AABA0C060 assisis0
929,706,656 *60D7136E1269C99D20679607D3EEE6611604DF47 Assiskuds
929,706,657 *60DE11786C915E32D88FC7D8FA45CDF90B77887A Assisto9
929,706,658 *60DF9E4668B9ECC012AB7EBF85EF695605EF7BD5 Assitv
929,706,659 *60D4AF671D2D738D5B737CA17624310C17D8A338 Assivite8
929,706,660 *60DB73B0FC83EA8B6E383ACF70C4E1BF8A652507 AssK,
929,706,661 *60D748916633DE82BCABCC0DC0C20D0B3413347C Assmantra5
929,706,662 *60D10DA3ED79AD7F5B09219C045891FB7C672ECF Assnn
929,706,663 *60D17BAC95AAB4B9BFC2265821530F9ADD20E1E2 assoberbassem123
929,706,664 *60D0FB87E5E811B91FD81F03EE9A5FEA0AA54098 Assoceremo3
929,706,665 *60DEADF0ADA114EAE4C75F8C30F61245F4DCEB51 Associano!
929,706,666 *60D940592B5E84070C840FD1274176211679C001 associationdiamond
929,706,667 *60DBA474197257AD36723E356D388E2729A4300F associationhealthy
929,706,668 *60D90E010A10DFCBEAFF7DD815A216CD1970D5CE associationrequested
929,706,669 *60DCD397BA8EE46333174D6A1AA5B4199D6DC94E associationwyoming
929,706,670 *60DC7FC82BBCA58A251C4FB7FD6E5945FC266D7B associationyvonne
929,706,671 *60D9EFE3794EB476D62056C1FD608A42B4451CF4 associative3
929,706,672 *60D19B210D43545433CE15B8F68F4CE68530825A assodiamo?
929,706,673 *60D60B0EF95D7A380D1CFD6F225C21B16800CD03 Assognihs
929,706,674 *60DD000C32695ACE1B22C28FC07F90C666A01D3D Assoldano4
929,706,675 *60D9D9514A75BAB7BEC1C5171DB164876C0FC312 Assoline7
929,706,676 *60D82369F7882DB60A6F961FC3AEB6584C5634BC assolse4
929,706,677 *60DA100C3C3B40737FF192CDB5DC95B9F9F61F37 Assombrreis
929,706,678 *60DCBF816A15B6450A331CB446C1AE90A0B616A4 Assonade8
929,706,679 *60D69249842E69622543BCC2CDA632BAA6DC6256 ASSORTATIVELY9
929,706,680 *60DADF8FA300A6AC8A8BB92E87A92675B8A37F74 Assosiziationskategorie
929,706,681 *60D766B8E8FDA0C9FFD63CB9B42D617041C9FF74 assotisputonme
929,706,682 *60DDDD5B62694717FC435756FAF56C1FCF1E25B7 A&ssP
929,706,683 *60D53B1AC6614AC8B60AA70F774F5805E61BF4E9 Asspbswed
929,706,684 *60D0CD80AD9616FB6381F1419265B3C1979CCC1F ASSrr
929,706,685 *60D2401EEE3DAA56FCEA342D64FE7C46B1675D9C ass-stabbing
929,706,686 *60D8D63F78CACF97BEDE51F17F0648AC9D811D33 asssumes1234
929,706,687 *60D49F06D62FE7BD16F098303CC861F962A20002 asstrop2
929,706,688 *60D6A22368F9ACD2AD7EC20148245AE7DC4DD132 [email protected]
929,706,689 *60D0BC1F1A8229C83FEDFA3BEB57304542D633EB assumes5
929,706,690 *60D348A6E87EA7D7DBBC9B775B2DCCD70D3C750B ASSUNING
929,706,691 *60DE90C96E5EA0DBEC2A1E7310F8B988B68B63AD Assunsi0
929,706,692 *60D91CE865CE9DDA58634B817FE81DF5DA25C340 ASSUREDS3
929,706,693 *60D7FDE7DAE70000FD2027D8D3FB0FF16C70C000 Assustais9
929,706,694 *60DD4AAA65CAE7ADF38C6ED86548AD7C87B3F034 assuste123
929,706,695 *60D6605BE50DEE05D37CC5FDF49164425E83DA4C assustloei1
929,706,696 *60DF7D5243BEA2CF41ABE8203C5394D855B8D573 assuyer5
929,706,697 *60D0B409BF2E4C4DF452CC8CA4CE27621C0FDB89 AsSW
929,706,698 *60DB05B69771E9D1F09245A19FB55A2E833C914D A?SSZ
929,706,699 *60DDB744DAD3C87A81E3063C93649F01895B513D asszonyuralom
929,706,700 *60DBB3773F1C560BCB897F9D38A0194D18B42BEB a St
929,706,701 *60D50AF1EF58E4DA6A49FDE0999E8EAB549A0087 A?St2
929,706,702 *60D8748EE4B45D9BEE2440723402B35DB5D5897B ASTAKONA88
929,706,703 *60DBE5F1C7F6C2FB97519C647A49B5B61DC74D1A astalabanti
929,706,704 *60DA356E267E53991FD659EFFE08C5C5C086F49F astapovi2
929,706,705 *60DD71DB7B2AC605B60BE0B6C602DC0AD86AFE48 [email protected]
929,706,706 *60D04F809DBF512C08E193CC29EAE22CEA56FF12 astarito1234
929,706,707 *60D812B57C5DD3A04D30C01EFD39382E624A00CB [email protected]
929,706,708 *60D81CA6B197E3143CC39754D6818FE6081E9407 AST#b
929,706,709 *60DECBFE064C5341DF429C8978382FD3BEF24C1F AsTdp
929,706,710 *60D7EF36C9FEE81BC226B9CC2997EC77CA398F4F AstDY
929,706,711 *60DCCAC051303812DF267A86D22D09DA329DA6D8 astebete
929,706,712 *60DD2CC5B109280D2114CE27CC4A0A4CFF22B32E asteena8
929,706,713 *60D21F8772E89D6398897F8766F022B43D26CA45 Astegwn0
929,706,714 *60DDC4FC708F575E8280ACD6CE4180A244CA8819 astelastel
929,706,715 *60D5D0EEE2CCEEFECAA5770E5133D73BB38F9070 Astenevi3
929,706,716 *60DBAEFD26A4C63F79E3C62DA0AF7873154AC66B Asteredoj
929,706,717 *60D92D6041AEE0B9DD4CEF35AB3326DF64DDCF90 Astériennes
929,706,718 *60D512A905EE31BC76A450F2E6CE1A63044DBB2F Asterixclaire
929,706,719 *60D10046E67B7C120DCAEAB2D02E2A67BBA393D8 Asterixfireman
929,706,720 *60DE07CBE09D1014095FBE2F4D7DA2DB3F6CF126 Asterocicline
929,706,721 *60D25BA8FC0648BE89EC3B8EEA8CF991E5642C44 asteroideoverflatane
929,706,722 *60D5515ACB1A595078E44318FC9887225CEEA1F3 [email protected]
929,706,723 *60D2A3307BE860CB7D392D0FAED4C9A0A491C3E6 As the Storm Chants
929,706,724 *60D133977A12CFEAD440E0F457B67B61AB490F57 Asthmatics7
929,706,725 *60D7B7291073F188797A998C33232E5F7E3FB127 Astiani5
929,706,726 *60DFF485DEF0445B8BD6610ADF6403DB60B303A3 Astigoda3
929,706,727 *60D698F8F98A1E1B4E334F53A625B4BBEE314D66 AS TIME GOES BY (PERFORMED BY HIM-egg)
929,706,728 *60D2B4A2494A84A5A818C35DC000E2929FA31876 Astimod
929,706,729 *60D3C944C1600D712909C48EBAAF20A854AA8C6F A
929,706,730 *60D1ABCF12505F63CE62C1EA92120D481077335B ASTKF
929,706,731 *60DE369BBC356DBAA6F332F7CE206CD315F2945B ASTONE.
929,706,732 *60D4B9680FF8BD39225D33FF64AA90E942392298 astor9
929,706,733 *60D5814F09EDF28611D4782A9A07A0D0939F2698 astorga7
929,706,734 *60DC8FFE3E61754BD0D81C80E07749A9AFA5492A aštoundešimtūjū
929,706,735 *60DDB873817D9EE7A4BCCFBC9F0580F0CE913083 astralizarse1234
929,706,736 *60DA8566ACD10F2090B53B09CE2A61613A3588A0 Astralmaterie
929,706,737 *60D0A25CE6B36F269D36FA741E0D5984278458EB 『astray』に登場。コーディネイターの民間人。プラント最高評議会から依頼を受け、コロニー・
929,706,738 *60D785D477539B714442ACA3D6585743B8D88581 Astreaes
929,706,739 *60D41BD92C87ACBF37D5C8F700DCCB38D981E423 Astrika7
929,706,740 *60DE900430EB37E2D693ADA9E6666FBAE3F9DF62 astrodroid
929,706,741 *60D1AD91A8BD97322EAF848A75F749A81609D077 astrofotograficzne
929,706,742 *60D1F4D9DF180EAF3E0529B08FA0033D8DE63681 astrofx
929,706,743 *60D5FEC47E6E8E513D2DED0B1D08BBF7F080E509 astrogirl(redmix)
929,706,744 *60D7B869E7ED9EEEF038E833234D13665E4CD968 ASTROGR
929,706,745 *60D9CC48BD88FD771CD5E8168C7C014927A4ED1B astrologo1234
929,706,746 *60D5D0BA8658CA3CD06BAAF590F147A05C601CED astromixxxsalvador
929,706,747 *60D891ECF0984D133A7670255F48654F2E0C14CD astronaura
929,706,748 *60D4317CEF193259DB66B5C6630C288FD389D6D9 astronaute:
929,706,749 *60DC03642E997074EFD588198347EE55DE220C39 ASTRONAUTICALS
929,706,750 *60D647D7301362743A941BFFDE8CD3193B36E044 A Strong Sense of Urgency
929,706,751 *60D9F664A83BA800285D5776700F99B94D6F8BD8 Astronomersroyal
929,706,752 *60D30AA5158E836DFD27D1FACF9E115B0DD9FD64 astronomysociety
929,706,753 *60D9BB1A1D14C90533BD622C361D97B37FE6726D astrophotgraphy
929,706,754 *60D219D2744BFC323CA70AEFC88A7B161DDB8CCD AstroPulse
929,706,755 *60DBA16028D49D8E0B984768FCFC0FD52FF0BD58 ASTROSPECTROSCOPIC!
929,706,756 *60D5A962270DF1DB8E70A3413EF0F43E2FC3A459 Astrovac3
929,706,757 *60D8299B8ECADC7B738468D7E0367699A89173F0 Astrttori
929,706,758 *60D4FBBEBBA090F9C3D9C250103EC125DC42126E Astrwto2
929,706,759 *60DE2FD5EA432203FA46FE303738F29ACD77564E ASTTNXUQTN7LJSMO
929,706,760 *60D05ADA34409D02BFF0E2453328CD779510D9E6 AStvT
929,706,761 *60DC5027F07754E316FE4DDDBD1AEA7626B2B9B9 ASTYDFUI
929,706,762 *60D19305FBD1EEFD17E82121FC37CBD1468E325E Asu4$
929,706,763 *60DBCD43ED9B3796E780977BA180AAA2C291350C A,sU7
929,706,764 *60D51FEDC98384927B966F79C4730B451638C294 asuC
929,706,765 *60D30A0D54324E92710D7F1FFE4343437E187A08 As;ug
929,706,766 *60D1D0588B047E20850B153155E44E40B03C0601 asuga.bbs
929,706,767 *60DDAA7A9984E0C58D738FF9A5B2082622A08D7C [email protected]
929,706,768 *60D8DD41F044B7F5E8D9E239B0B5111646BB1347 Asuinrak3
929,706,769 *60DDABF90008FB6CA5829A204EEA63BFA6140103 Asukibak
929,706,770 *60D9DE05565781C2C33027BDEDB57BCC28FA9D91 asukkaat4
929,706,771 *60D3BEA4DDC919683A725A2634BEE5EE8B716040 ASUNTOPALVELUKSET
929,706,772 *60DF36E84091F4496A5FAE659F5E14DDE8260400 asuntos
929,706,773 *60DE2788C37FEE44062BF54399D1C14D097CA786 ASu"O
929,706,774 *60D48B20192191E6092F608BA001CE5685E1616D ASUOKNEG
929,706,775 *60DE47C9B850A39014583D0C1B447A10C7C507BF As.ur
929,706,776 *60D7ADA79DABFD2E4B9707A20F2522B9886C3E9D Asuryaa8
929,706,777 *60DC28C2E596B3BF35771D0CC79B39BF86C5F7FF As(UT
929,706,778 *60D30DBBC62B9BF0DC30318230AA749C63070B4D ASUTHEONE
929,706,779 *60DF854C952FE03814FEECB67D4C441BF328727A ASuuv
929,706,780 *60DCEBBD0C74CB08B9DBA25C4BA2640B82CA2A49 ASUV
929,706,781 *60DE323A5F3FDC21E148295908D1DD6B18B985CD Asu-W
929,706,782 *60D4CB6323EBBADF0498B33170F4388FBE41AF12 ASuz
929,706,783 *60D8670B5EBCEFFFB85805FFD3F77F683EDEE838 A_SV+
929,706,784 *60DE616E650761D287235D01FBBE2AA60F2BE29B A-Sv&
929,706,785 *60D247D1BD1FB159FE615CC0018AD1E37ECB0C44 A%+sV
929,706,786 *60D335C9A9D7740207962510721296A664B099B6 As?
929,706,787 *60DBED483FCA0C24109A0116B65B003A1787B676 As:_v
929,706,788 *60D0C45AF9113F539EE77B46E88C17987E5C18EB Asv-_
929,706,789 *60D56B514C797484A7C27A268D3FE76EE3FC9FC0 a<SV
929,706,790 *60DAC8F264F180F5C80696786334ABF3E51149F7 aśvaghosa
929,706,791 *60DBC08739D9FA6CAB5BED617373C7374F279FC7 Asvaltın
929,706,792 *60D87A85D48CE68E5DC5ED0399FC02ABD2299893 Asvasthaa8
929,706,793 *60DDC197CF6F62B2868EB75578B87EF8E281DD00 [email protected]
929,706,794 *60DE8179EA5850D8634F1B5B4CDE82F501F75599 As?vN
929,706,795 *60DD61867463BACD1D1C8BAC00A105701F7F8C08 AsVnN
929,706,796 *60D73E12514092385AF90013FC214E6480101B52 AS+vO
929,706,797 *60D29F728BF3F8378E7C2060431BE2F77432FC0B ASvpe
929,706,798 *60D55FFD8F3F290CF23E7D735B11D79A6DC0CD79 AsVu$
929,706,799 *60D34321866ACF96CADA48458D19E1D0FF9C77FD ASvZt
929,706,800 *60DFB40DEDE6BB5BA1C8E4F134E5E808BF0C62BE AS,#W
929,706,801 *60D9AB61DC6E184FFE093B5FBD161E34FB2E7542 A;-sW
929,706,802 *60DEBE9855372CAA58B847D51BB25D90D2BAF7A4 A#s&W
929,706,803 *60D174D6E2CFD1C6AA15843265FA62DA482545D5 ASW.9
929,706,804 *60DA6B4462E482A7B0BD19613B87D01D027FF55A aswathyprakash
929,706,805 *60D0B4E5464E490B31AC12FE1F7CE8C793FFCADC AsWd9
929,706,806 *60D3AF4519D302B85FEF3CF4881A3EA3F2D82C3A As We Arrive
929,706,807 *60DA68AB8A5B6633B8D35009A6AFD34321828DB9 as we do the minstrels; draw
929,706,808 *60D50DE91ABFA32FD38DA91675C5F06CDB613DC6 aswellnwe
929,706,809 *60D7736AC12BA56CBCBF6DCA148AAB154D859CFF Aświnowie
929,706,810 *60DE125B7FA13B8324CB8E7538ECCCD3977C4CDD ASwpS
929,706,811 *60D83B9D45674C70696A1D7FDC9CED41449818AC A_SwR
929,706,812 *60DA1B1EE7AF56049CE1CAD30054948C222C230A Aswr%
929,706,813 *60DD183831AE370E73A0A0C6E226843F50A57F4E A!S,X
929,706,814 *60D194948C14DD86BEE71B03A5531244AF0877AC AS~x
929,706,815 *60DF7FCAAD2FB9FC17C2A51599ECC5C66D57FF33 As-"X
929,706,816 *60D1C39A9C699E14F4F4107A065D9049F79DB395 As;X#
929,706,817 *60D90AAFCE9BFAAB45B603914110E9D3AE0A14FE ASX3l
929,706,818 *60D8AFC4AE1D0D0D48A20DA5FA7DF6343CC392A5 AsX(A
929,706,819 *60D77C5800BAE6C44352C98C06C718D98EA77EB0 As(Xc
929,706,820 *60D3D417BB0526D9A21932B1DF14BB880D42CFC6 asxetoi1
929,706,821 *60D5178461117B21C7E791F247571C6B659F9A89 A"SXP
929,706,822 *60DC93616F2B6D2CFE84E00346EAE6C64CB979BD A_"SY
929,706,823 *60D7D59F6F76DEA9BD44952CE0437AAF86DDAC87 ASYBWJDA6
929,706,824 *60D414B3C23D80CF88C13588F234CBA6FF0C210B ASYD:
929,706,825 *60D5666F8CE38A93A80A086438EC91D016A2B3A7 AsYf2
929,706,826 *60DD8B02EAE906356569FD32F866D30D6B162542 Asymp+0+ica1
929,706,827 *60D86B543671DDE7ADE92D663BAEC2A4CE9DA3B3 asyndeth
929,706,828 *60D3011CFE04B1BBA0B298C96CDEE3C1806329CB as you can see
929,706,829 *60D155C8DEEBB9ADD71F3A76F0CACE1FADD1EAE9 asypops
929,706,830 *60D5450E5E2A0E8CD3F915AE0AE7ED8215258E10 AsyQxN
929,706,831 *60DAF8734BD8B33AC70DAF4BF2F3250863E92F9E [email protected]
929,706,832 *60D032E05F1991173DBF44778B6BE77B32CB07EA ASYZ0
929,706,833 *60DED554CFCB16A72090B05882333E4FF10344D1 AS:Z#
929,706,834 *60DD3CB349BB8C13E86B389ED0522E252A8B99BB As:Z#
929,706,835 *60D27E1DA56D24838CCF3B249C620B0FAE5E46E1 A/sZ8
929,706,836 *60D263C34D0A2EC2A599317067346B148BD9A2EB Aszkrába
929,706,837 *60DCF77DB8B070C876ACC48F92A931BA05CCC53E AsZL#
929,706,838 *60DD3D18E4BA0668167EBAD221532F51478792D6 A!SZO
929,706,839 *60DD65C15B57206F3F0CF0E2A95AE7158D1785C6 ASzondi
929,706,840 *60D7CE8206E52A895A215383B624D5070497030E AsZuU
929,706,841 *60DCB8BA3475BE3A54187B76E976306338F6B6E9 aszxc1967
929,706,842 *60DF88CFD67B9C4D09B8ADA57137A26D6A941FB7 A/#,T
929,706,843 *60DBB95DDC62231E109DD86FAF8D36FDEE9F22FA A&"!T
929,706,844 *60DB55ACEC2A23A90F50E8F87E2C99F00D385B88 A#T+)
929,706,845 *60D41744B7078ECB461EC48FB8E7B059975CE3AC A
929,706,846 *60D16B7C4315C17110F743545F3C839E71BE0780 A,=t#
929,706,847 *60D177B56B1490684FED3B7D8AA6B90BA2D25374 A?&t.
929,706,848 *60D57F5CE9D15F317684B7E98C20B919FA7B0C87 A"/t$
929,706,849 *60DB3BEEC336207DD0014A398C48C937E1057C06 A(t
929,706,850 *60D72ED2739FF7E9E4F87AA47F640330B0C8767E At06s
929,706,851 *60D760BB5257E7B7DFD7C76F621894576960EA2B AT%0a
929,706,852 *60D9858DB98CD5B656E15C3BA720A25F0FD21498 At0gB
929,706,853 *60DC7FCE4E5349216B9A6690A0B43069FF9DB723 At0&N
929,706,854 *60D0ADF5D8EDB7050470602D8A9261E632E6788E A=#T1
929,706,855 *60D8F30AF0569FE1F96E04F28AD7114FE518FE95 AT1#_
929,706,856 *60D72580B8B6E0E24BF0F23E7F8B5083500EF9CF A-?T2
929,706,857 *60DA33FDF8903C5CCC73EE43DE3A43746A581981 At)2.
929,706,858 *60DA7A29BC2301ED43A136EA1B59D5AA57E016DA AT23?
929,706,859 *60D88D2459096561D0816D762155A03208922D61 AT2a"
929,706,860 *60DD86002D63B63DA3D475D2FB44D572F4682315 At2C0
929,706,861 *60D7F71675CDC7AE0D1AB400D15A9951BA226F1A at2g13550.1
929,706,862 *60D5B8E378ED7B73EF688BAF75E37C264F9D8905 At2nB
929,706,863 *60D136994581E78E4929B8AF41B81FA94867F2EF At2Os
929,706,864 *60DBCFC07E457CE39CA2E81105FE1A514C0A7862 AT2s!
929,706,865 *60DBF32E92A8534D33FF0EF59EDD23E7D79AA143 At2udyip7h
929,706,866 *60D20F16A2BA3CB44F40B8BFFE4893E94A0AB844 A=t_3
929,706,867 *60D7ECC4A2713E057CD7D97AE62E82E4B2147851 At;3L
929,706,868 *60D7B6303B62E202C86384BE961A20D45A31F2BE At3pv
929,706,869 *60D77703B94D0E1C95BFBC44DB5F77C5E8040000 [email protected]
929,706,870 *60D6E6012E8F7EC88E08BFCB1E83D98B980CDF4A AT.4
929,706,871 *60D80D2FD9BC102402882B35DC27BD4625288FDA At?+4
929,706,872 *60D5FE7140BBC45BAD447C3817AC9CD57AD693A5 At46,
929,706,873 *60D5908E1726D2750480FDA9CE4A131DD5A3916B At4E!
929,706,874 *60D37840C0AC93C953605CF98556E331A4E6F2BE at4g39960_draft
929,706,875 *60D77F1BBA9545C8E7A0D982DBB93CA83EF9B420 A,T4I
929,706,876 *60DAF224DB19BFA05C4223E5D077E61A6AAA0087 AT4qn
929,706,877 *60DD9D5567E5FFFC15784ED80266A58614131724 At(5=
929,706,878 *60D9FC8DF0664847C53FD416ADAADA07F8C12F84 At5;"
929,706,879 *60DF5B958E95E13678C5A430DD3E2625B2E16D6A at5g36070.1
929,706,880 *60D7C6CBF573B257D628977168E8C8FE3DE1397C at5g40100.1
929,706,881 *60D713FD34D76E9F3529DEF2CD84475CEA04323A At5%N
929,706,882 *60DB9637E89FF6198EEFF670DB3977610DD9325E At&5t
929,706,883 *60D60A6E3A97542535C904B2A7DD78D95631497D AT693
929,706,884 *60DC4D95CAE74C1EE6BCF6067E9E69CE81618614 A:t6a
929,706,885 *60D4E8CBDE7C220219EE3F6B84DBBA1333225870 At&6V
929,706,886 *60D5064A864C86FB9092F29258AB281E792DB607 A;$T7
929,706,887 *60D1D0DB6103716FC807BCC26E8E6A6C7C0ABC11 At7;8
929,706,888 *60D7E7C1E32CBD4E95BD5A622BD619FA744A0957 A?T7e
929,706,889 *60D856B344B64367B8626227DD1F4DA80D35960D A!t7T
929,706,890 *60D3BB5FB4647EFBC450D162F42BD80D58A2D8C4 A.=T8
929,706,891 *60D8B4BCF4567E64EF328392DE82913FC9D98115 AT]8
929,706,892 *60D2971FBD6174696765956B8A31E4D226171BEE AT8j#
929,706,893 *60D8D12B7D80C2063FEFD57860A33570CC4064F2 At8R6
929,706,894 *60D077F6E3C3667442FED8913AE281D8F675E97F AT8sg
929,706,895 *60DE0887B01985EE1F8A01B50FFBD2D987908E08 AT8ug
929,706,896 *60DC52E5F3F961A1EDAD1AFCB33E7F27AEBD2EC8 A,T8V
929,706,897 *60DCBB0137CA939BDD57E601A2EDE4CEE3400D82 AT97;
929,706,898 *60DD24648663ADAFD0713BE59E9170391086BA52 AT9A0
929,706,899 *60DCA191F0C27379F5D4D3065CA64085F5A120AD At9c=
929,706,900 *60D49859F0986E5CC4E5F063388811879954005C A
929,706,901 *60D045324B4E004CC44445D4BAD8BB354E735C4C AT9L5
929,706,902 *60DFD559172D389C056708916933E6FF72E3FA3C At9rk
929,706,903 *60D26C9819C91EAB4F67B1F41A43DD5DD9DFC4E1 A:T9T
929,706,904 *60D87AAE6EAA6024FD77B8FB6BD33AF5450D15F6 A_Ta"
929,706,905 *60D3989BD106282900817AF9883C54D2D388E87C A?ta.
929,706,906 *60DB94BFDCEC0EFFEEDAA5086489F5D7CDD9A283 Ata2C
929,706,907 *60D8D2CCDA9E72F5A1E87EED5ECD442561B613E8 Atabh
929,706,908 *60D01FAB38CF7255ADE157DD890F6E1DCBF9C8F1 atacifireV
929,706,909 *60DEF17D0BD5DF74644B58756A4B58EB0A548428 Atacnam4
929,706,910 *60DB28AA9D731CBF967449257C545C02DB125A1B atactgtctccaactccagttctgccccagtggggccaattctctctctttgttgtaaca
929,706,911 *60D7A3FED6E81BC7D8561D7BC81870CD642F9047 Ataditna8
929,706,912 *60DECB07EF8A8F1333E9A9194C846D36273E6457 ataekatas
929,706,913 *60D75BB6F11ABA85E01DB5AE1D92CB3CC36E1380 Ataekiuh0
929,706,914 *60D6ED2146277D0B73B1D920277EA7B5B906F23C ATAFUKU
929,706,915 *60D099EEC964E83545736BDA95462B02E7D4D8E8 Atagenna0
929,706,916 *60D6D04DC8E2FAB47F59420D6AE7FC2DC82724A4 atagtgagacaaggagtggaatgagtctttactagtcccaaagtgagcagagcaggttgt
929,706,917 *60D94152E830407E9F9C53636B064479C9F4F3A9 ataicsaf9
929,706,918 *60D91A1F4B3FDEC501D55EBF2361A1C1892A1A61 ATAKAPAS!
929,706,919 *60D8C651F0D5608A62FA32CBF2D6C68AF964FF34 atakepsa
929,706,920 *60D35E6EDCDA7C7E4D439B9A877AAD77D3369DBC Ataksleming
929,706,921 *60D9D0035C41D09CD87A9C12F93531F266514643 atalaiarlho
929,706,922 *60DE13223FF1B099B1F6DB19D370A681B9A5DE7D ATALANTA22
929,706,923 *60D249086215CCCA8B62C6C8E760DE54DA4ED37A Atalapha3
929,706,924 *60D9470FDBA409906CEF4EF49C304EE6647CBEE1 a'tall
929,706,925 *60D5F1DDC3652D402A127CC8D71E31E502E91518 átállítható
929,706,926 *60D05AEBF59A8BBC0B583AD8E9D3B658663465E1 Atalrub
929,706,927 *60D50BD77D842CEBE5DB097FFA28B76FA0AFE326 Atamats7
929,706,928 *60D5C275087622E52853CABE9CEFAE3E203D6A36 atamieto
929,706,929 *60D1D5623784D621F143A867020B8756510A22F6 Atamisaib0
929,706,930 *60DFDA0905D68CFFABB1F5EDF0ECD684CA42AB41 atamrof6
929,706,931 *60DE2FC3504BDD2CE118B9339BB9F186DCE465AF ATA!n
929,706,932 *60DDDF072ED9F51A24ACF8FE4BBD613744B6594C atapyamāna
929,706,933 *60D899DB8FA8EFC5792D50DCF7A130F28C8DA77D atarandthefunkadrome
929,706,934 *60D3C9F9D4620EECAD113B466378AC02C27A114E ATARANTADO
929,706,935 *60D7AFDD260AFF16AEE5F3C4F3BC0E84D6A69912 atarantou
929,706,936 *60D8D2BC849A3098C5073546A3C24E7CAC2ACBD5 Atarapes1
929,706,937 *60D8211A480372CBE794193034C050CFAC59B93A atarte1234
929,706,938 *60D5F1CC2B8B17D0E44924692431C291F61F8BD5 atashley
929,706,939 *60D779A63A4E8F69B7A6EADEFC9D8C14D837F512 Atasnedd6
929,706,940 *60D10865C10678226CFF6E52B812B4DFED77880D ATaTE
929,706,941 *60D4025B43F920F9F2D2D918E0896EAB9AA13DD2 Ataugera7
929,706,942 *60D247B9C2B17015143D71C7A2DB0EC78B890B39 Atā’ullah
929,706,943 *60D447F390E13F4492B58E68662EC4F1CCDF6D25 atavacnis
929,706,944 *60D8BF068D41CC7505D25E5FE815023DF8DADC5C Ataviav8
929,706,945 *60D857D55368C0413E3ACF48C351893FE1DA356E atavlek7
929,706,946 *60D0E3A908F840FD1A8944B7FAF68DFC65800EFB ATawC
929,706,947 *60DD6FED3736D841470FADE9883639E5769A7C2E ATaXi
929,706,948 *60DE025CA9F857D3DEF1E1C1E059657812A437DF [email protected]
929,706,949 *60D2ABB70AEADA4CF56C774690CB44CE8EB577E0 A,Tb"
929,706,950 *60D749A122EBC3EE7EC8CF8174307177A4DCB5F7 atb1inc
929,706,951 *60D47992D2F1D308637B74ACA1ABEF650EEBAE0D Atb-D
929,706,952 *60DDB0C13C017CD5CC786F8D6176CCCE64E983FC ATBEk
929,706,953 *60D6902133B92C0F1A905F8BB63378131C3E0E8A ATBIPZSEGIK
929,706,954 *60D1051C2D8E464314720CC30A2CFDAB91D64F90 ATbM0
929,706,955 *60D32F353AE6A3E82B895A9CB28DE4ED6EC82744 AtBNC
929,706,956 *60D4FFC574C5B8CFE7E7DF7282A30DEE0590D399 AtBs.
929,706,957 *60D174ED3D7E88C1C604D27471B4FEB5E2D0322F AtB=V
929,706,958 *60D1586F00CB2862B4600108232AD6D5F6A2C09F A-tC_
929,706,959 *60D28A7C323279DD4B2C8675587E8BC05E982A0F At&C
929,706,960 *60D983DA4779B9D6DF45625AF68E8E0C201669FC A&tC2
929,706,961 *60DDE1D204AC737AA524D55AFE296DA353C83DF8 ATC250R
929,706,962 *60D00FDD09CCEDDDD9F5283935B9EC1CC704C92F AT,C8
929,706,963 *60D628CC785D67626E0E014FBB811D6CE030F77D atcacaccactgcactcccgcctgggtgacagagcaagactcagtctcaaaaaaaataga
929,706,964 *60D6CD99C0463F593AA67C593BD61BD69B273C47 At Carnegie Hall, New York
929,706,965 *60DF412BFE9B8F2764F670BE7F84FEBBFCA82D44 ATccB
929,706,966 *60DD6A5D746DE06DE3C1F83DDBACF9072CE12E83 atccgagcactttgggaggccgaggaaggtggatcacttgaggtcaggagttcaagacca
929,706,967 *60D9F8A82042A64AF8D132112BD32F14B56EFB0C Atchougue
929,706,968 *60D1018F2FD21AD4E229A8210F80051672B7F388 ATcn=
929,706,969 *60DF619E184E33C1E13A8D0BC130599A7235E2C1 Atcorpys
929,706,970 *60D3B6BC1F6E369F666E971605C7DCBA5B99F683 AtCsY
929,706,971 *60D6D0E128D058E9CD9A15A351D23B12E1F7343F A/TCT
929,706,972 *60D5B51AD4B6CDE8DC46536DE1DA968A7E2D9CEB A."TD
929,706,973 *60D17657B4FD7361347AC7355AB4F2D0923A67AF A"T#D
929,706,974 *60DC63F1A1AA347F1D1A41ABCDC4413B1FA15E3B AT;D4
929,706,975 *60D33446B4EAD30661C33B68DF7324DF6974ED27 Atd4U
929,706,976 *60D776995A2F885A9D251839A77243EFC235A6F6 At)D8
929,706,977 *60D979802B3B965D3A73570A750E8277ED593C30 ATdD6
929,706,978 *60D33153B6C2E1ED5D3C7DEFCBE6B16FFE7DA715 At;dE
929,706,979 *60D7023EFAE3E87E840EF0139472CCD792276C2C atdeskforblog2
929,706,980 *60DDC6A29CC8A4FE1052DC7C1171F134F13E7FFB AtdfQ
929,706,981 *60D55C1A527ABF90B1F27A963573559B9E9D69C6 atdjl
929,706,982 *60D64EAD664DB04DA7EBAABA74691120CF2B5F61 ATDo)
929,706,983 *60D87AAB851BDF001A8813F99F289113CBB014A6 Atds/
929,706,984 *60D81A630D0AA2818D20D19D14A755BF9994C296 AtdS8
929,706,985 *60D7E5B6F517E5C11FB9D0654EADCF625DF9E417 A.TDu
929,706,986 *60D15A5BC29E2134FF0EAB51A8F66B1D63F28546 ATDZ4
929,706,987 *60D2A57E4A133281EFB3805FB6D1A07A2EF6AFBF At$e&
929,706,988 *60DB54854CA33728EF913FAF5B11BFB982C2C696 AteA&
929,706,989 *60D963E175E9A578946113961C729028144CC291 AteBN
929,706,990 *60D3FDD1450DDB4D4DE5BB75A8BBEB6162CEE332 ATE)C
929,706,991 *60D356652DB550EA11365DF0BBCDAC14C3E62AE4 Atec!
929,706,992 *60D07B8632F52417257E83C57C1FFE13A0A7762A [email protected]
929,706,993 *60D529CE830354DAB9D40657BC7C9BC32B421C1D atéchisme
929,706,994 *60D68DBBE5BA39A41221EDB01EC49ABD7E8B1393 Atecomer2
929,706,995 *60D4C281061EFA8722C322741A35C4A579A4D77F atedimos1234
929,706,996 *60DA910AFD01BF949979638A209003C504DA0FED Atehort
929,706,997 *60D97247DE51D18BB197293BA003C3CF70613676 [email protected]
929,706,998 *60D6DC182F7C22C6918E3051AAB6F61DD2C598D3 [email protected]
929,706,999 *60D40F66CD05C91B7C9C77583B8810DB89AEF896 atenuar7
929,707,000 *60D5F7E7790308934077C52D137C0009AC73D334 atepper626
929,707,001 *60DC84A03F93304D488A7BBB74230FAF260D5F4F återfötts
929,707,002 *60D5A528E4F7CD30450BC6A92DEE2A8CDCDF50DD ATERLIJM
929,707,003 *60DD7143ABBB9F0A94A326631C165117FB42B492 ATERNELS
929,707,004 *60D805B1EF875C50DB31A44E39D7BA4602AB0324 Atesta
929,707,005 *60DA1B3B16D81EDF0C2DF979573EAB78F17DA010 Atetiokr8
929,707,006 *60DC81E3CB4D2BDB8448F849BF3B68C445FF95BC Ate=U
929,707,007 *60D882AF0C8E6F4DAE05BB671D7CDDDCFD0C9212 AtF7w
929,707,008 *60DC9C5C76D93684CE312F4AEED7A3C1892E243C AtfAj
929,707,009 *60DD5A60A4989A0E3C77B24D84F051757BF044FC AtFB%
929,707,010 *60D6F6D070413AA234F803A1560270F0B78E88B5 ATf+H
929,707,011 *60D810EE36EA05087AC926806682600433AED684 ATfj!
929,707,012 *60DF96AFCD1F8FD717A139F1A68E618E1489E38A AtfNZ
929,707,013 *60D1C54786648BABB82EBFAAA4D49AE240AB3150 atfoobar2
929,707,014 *60D8C2CF7DF163706726FE3D430C43EAA7A3BE6C ATfp+
929,707,015 *60D8DFE54ACA94615A523D09DCFB0E6491651DA9 ATFpd
929,707,016 *60DE1F50546A5DD360734A50C99229DBECEC8DD9 Atf:w
929,707,017 *60DABFEEE7706D6FC087755097277B05B98E1320 A%)tG
929,707,018 *60D66C77C29E4A4741C181D6937FC3DDEA16AF2E [email protected]
929,707,019 *60D7F088C08B200C558672A9F575199A637B6153 atgenhedlol
929,707,020 *60D80D108D463D421F01A15BBC4A755B877C4965 ATGL/
929,707,021 *60DEA9B8EEF8EF978637669B2DF7AEFF0DA1A759 ATGM5
929,707,022 *60DAEEFE0BCA760B902E9A9428E47755AA5B7656 AtGsY
929,707,023 *60DD0063B88597282F15E8B1A23031919B022F0D ATGU&
929,707,024 *60DD035F0911D4DF4C81F86B6B0562A9EFC2EFAE A=Tgv
929,707,025 *60D40C5AD828729AB88BAB5ED549D6D315E91B0B ATg-v
929,707,026 *60D7C9DC4A45C09DAE06CE2EE968A74B1DDB661C A$Tgw
929,707,027 *60D6F84B8F8035CFB84359590BC474D9FB5D6B70 atgxz
929,707,028 *60DAA88CD061E9879FC21ED0653BB901E5636746 átháramlik
929,707,029 *60DC7920EC880083575E726C02759718297105F6 atheerog
929,707,030 *60DC0762FE964584E54C355DBC4E2A4493D364E1 atheistiques
929,707,031 *60DCAD8E56F8C2010783D1DF9F4A01BE970E8DC8 atheist-rap-osveta-crnog-gonzalesa
929,707,032 *60D79A5088B1C609203365DDFB31EEE14A98C0F4 ATHELSTAN5
929,707,033 *60DF14CD6B233862FC648C65510B7288D242157D ATHENABASKETB
929,707,034 *60D11A9015235845405C528DF9A8B83CE85447FA athena eng
929,707,035 *60D875F1C4F35ECCB08B1EBC2BDC8C53F50D5758 Athenanathan
929,707,036 *60D2DA035618E9B2DE1DB43ADA842B67F3681D0F athénéum
929,707,037 *60DEA4A3819EC8AC35F793F13559BFC3A61BB0A7 atheneumtheater
929,707,038 *60DB526E441F8ED4D9660539632C35CD1EFD3F76 athenstalkancient
929,707,039 *60D7FFC54593FA4CC58422FC1EB4922DE70842AF atherosclerotic!
929,707,040 *60D351C9D0D468FAC71F39BA213E0B106ACA42A7 A!thH
929,707,041 *60DB5BF0A12335212BF48E4BA402DAF397FDC306 Athheres6
929,707,042 *60D3B12BC1FF10DF046720A39D262A1FA9266886 Athhurst8
929,707,043 *60D71792A73B9429ADA8E9792CA9C9F54291AAD9 ATHISCARS
929,707,044 *60D49A7AD2E9960A77885FAB2B68B01DEB3B5465 athlete.13
929,707,045 *60DB4BBA0902848D57CD0F16F7BEF9EB68B16ED0 athlete333
929,707,046 *60D88115625EAD00E0A952EDCCB90715B93849EC athletem21
929,707,047 *60DDC78EA79EFC0CCC276CD67610A029606021C7 Athllon
929,707,048 *60D158DCBB8BD61DC4AFC9DAFB050CF4D1BFE662 a$thmatoi
929,707,049 *60D1465EA90DDAA0E95C3FDE03B0D694BD69F260 Athnakill
929,707,050 *60D60B71B521974D58CBFC83818AA56D7CEBEB3B athneartaithe
929,707,051 *60DA0F344E04277ECD362031E0F4E1F1FBE53B32 Atho"
929,707,052 *60DEDC7A879D94916326936C40BFD24C6865534C Athorne0
929,707,053 *60D0A0EEFC1EC55444D197729511D1E102C53505 ATH_Q
929,707,054 *60DADA9C253E5745AB4C609D7D74B28C02DDB186 athricky9
929,707,055 *60D86B5599CD7881EA0B0E35C30E6A30E5AE662E Athspring5
929,707,056 *60DDACA110B867B78159C5B14F705C81A6F58244 AtH_V
929,707,057 *60D895846C6893D7CD1662C41552606BB82FA32C AtH%v
929,707,058 *60D23B0A3E5CFB90B9CD17F6978B561E78F69C38 Athwarren0
929,707,059 *60D3E68A210A42AA012285D8E9FCA9BA178BE10F At.HX
929,707,060 *60D891E993CF9ECFA431D1A28732CA3E10E45004 A#T,I
929,707,061 *60D18EFA59EDEEAFD5CE4BD70300E71DFAA98CAB At_-i
929,707,062 *60DFEE462405AF9C97211537F6F23AE169947684 At";i
929,707,063 *60D7974BC303EF3FA91F33A8F6B8381598E42F50 A/tI0
929,707,064 *60DB1E6076FD51309DC8856D38B01C10342A2A66 AtI80
929,707,065 *60DE613962737C535E2C5F3296B1EB4797BD8A0B Atiantisë
929,707,066 *60D04A8BD17FFB17EDCB0595C6EA628D8BE89175 Aticness3
929,707,067 *60D1863C8028FBDD8C6437E4434BA432B2BB7717 Atiderp8
929,707,068 *60D72D06956183288CB3FEFED83BC0E502856E47 Atidica6
929,707,069 *60D891C4D74564AE6C1DFA4A9408C08E3AF76ADF ATIEKKUS
929,707,070 *60DFF938AC89BBB8AFC3609E97083B0F4363CFE1 Atieksiu
929,707,071 *60D72A627370580BAE1C245D535D6A09002DDC01 Atielapping
929,707,072 *60DA16E87AC24D118E3262B02AFA16ED0606028E Atiennod6
929,707,073 *60D3799B2012F5CEB43F4A885712BCDD9C460243 Atiennod7
929,707,074 *60DDFAB129CABD6917880A8DBDE9B22F05D1FD8B Atieretts
929,707,075 *60D7EEFB8781FFF1D3EDDD1C95A7179AE8E64D7C Atiereva2
929,707,076 *60D738C0A8BA4C2C885ABC0822A9D1D00F4FE027 AT.ij
929,707,077 *60DB538FF1EC7262BE69361B3F12E52E9DF4098F atikhidayati
929,707,078 *60DCCC56DC670EA3C970CEC6BE47064F95FF50A6 AT?iL
929,707,079 *60D2337A057000CB68A7B5C8B17E14313AFE0729 atillas7
929,707,080 *60DF098C86AD2939F03C715EB648C13E4F5EF2E0 Ati#m
929,707,081 *60D71BA7E69307F8134BD137A4E25EB2C813080D ATi!n
929,707,082 *60D43C02F468E645B14268FC497783BB99C8C6B8 ATINARIVE
929,707,083 *60DDE364FB6B850B58243D27511289A1CB4DD03C atingisses1234
929,707,084 *60D771A8F38596EB81F79C78856F15AE396FEA5A Atiohalu5
929,707,085 *60D180AEA9B41530AE9258A3E33B447489161722 ationen3
929,707,086 *60DE146CE88DC0150C9C00BA360CF8B277701F64 Atisbona0
929,707,087 *60D75662EB49399671799061E0BCE9A71CE4B9B8 atistd
929,707,088 *60DCD21B959B491D555BBC7F978D557096909071 AtIw0
929,707,089 *60DC40CCBD84E72E415266AB60B97F226873C1FF AtIX&
929,707,090 *60DA717AF0A1E0A171B648C219614BDCBF714F1B a=tj
929,707,091 *60DEDEC0AD009612317B92E555DFCA07665F44FB A(Tja
929,707,092 *60D56C6FC34F96059D27EF60D5E518C42E3E401B AtjMu
929,707,093 *60D4CCADE24FD635BEC09DEAF6F27AA7C7BD71B1 átjöjjenek
929,707,094 *60D8142C7AC307DD2252BB9A480E650D2DC5B4F7 ATk/&
929,707,095 *60D9C9D5DBB0E5B05C32A6C3A52980898B6B8F48 A?Tk6
929,707,096 *60D4CBC279217A42BB028C40E54FF0C1C192F380 AtKaH
929,707,097 *60D91EE2B5FBEBEF965AF2AF9B127023461FB83F Atkh&
929,707,098 *60DD75122019BD6CFEC972F91B5DECCA81C736FA atkinsas
929,707,099 *60D0F5D898A92A10E789A9F1F6887FF348D42750 atkinslogo
929,707,100 *60D8359BE4B3B0D6DF61B438F07ADCB340380F6F ATkP8
929,707,101 *60D8CC5F4A4D1A9355CA91E77F2FF6C1AB05252B atkreipusiu
929,707,102 *60DC681579B1AD406CE2A143B0C60CE8C7320FF1 AtKSo
929,707,103 *60DBF9E1368747DB2D9FCC14D79E6414C55D847E ATku&
929,707,104 *60D9E91652B1B4D6C7CD412E439C132E5467A2A6 A?tku
929,707,105 *60D6D20122A27189416D1415C35D61FBFD5B3C85 ATKXS
929,707,106 *60DA6EE112ABE13A0B6C2A796292AEACB91AD0B9 A$TL-
929,707,107 *60DB9217426D7EC4EB01AC2B557681A36BF0A1D2 AT?&L
929,707,108 *60D7DA532B62E236C3E8D9F52B98FFF28956F86F A#tl$
929,707,109 *60D105F4074A97934BF2F15425619053DCE3B4E2 At/L0
929,707,110 *60DBF086C18FC3C1328A14F9883A1F043521F396 Atl6;
929,707,111 *60DE6902062368E7BBE25657213A73AC943B140F ATL+7
929,707,112 *60DDCFA1D8D04C329E17D0115EE20C0A50B06ED5 Atlaamn6
929,707,113 *60DDFB5B5A752B7B111149B8BD76CC5258F18881 atlaidais
929,707,114 *60D3C6D4FBE9CF2821B76C0512CF214F619B30FB Atlanhih3
929,707,115 *60D6EAE811E9466A2BCB167A5399BC491E1BC649 atlantic_central_foo
929,707,116 *60D93F0A4F0D6FBB400672D038BE39850B5F5909 atlanticinstitute.comatlanticinstitute
929,707,117 *60DCB08E21ECD04ACEE7BAF21013834A892EA8C4 ATLANTICROWINGRACE
929,707,118 *60D08058CE26EA5FF14C378E3EADFCFA1AB77027 atlantic-web1.ns.ec.
929,707,119 *60DE5B3A5AA5589A9F187708BAA18F23166883CB Atlantoöccipital
929,707,120 *60D217D13C9B2AB561136AB473A751BFED82696F atlantoodontoid123
929,707,121 *60DBCE735009CED160A0E88E1568AF535AB6E5AD Atlas Shrugged, Part 1 (disc 4)
929,707,122 *60D7342A970CA720A90A9015E942468221B30EBA atlattığı
929,707,123 *60D4C4C44D3C195EB106D84A028A7AC872780F1E ATLc%
929,707,124 *60D74817E5FAB5E208A94DE23CEEF39BB74735AA AtLe#
929,707,125 *60D717C6E1CBF2D91C73A1322932A417E0298548 atlenksime
929,707,126 *60DA0B099996D8D9D6AFC5865AD02DEBFD0DE42C atlenkti
929,707,127 *60DF0B4BCAD802DEA0FDB17081513D17C55B0ED2 ATLETI
929,707,128 *60D1FCE7FF825ACEA76696B8469C980CCB3756A0 A#tli
929,707,129 *60D0F2E6226C827132F4298D1901C335708CE2B8 Atlibraries
929,707,130 *60DC67B777A0B765E559282E58D6C46C34163E74 Atlieulaed
929,707,131 *60D46BE2EDE571FE0068551CDCCE2724E93053E3 atlinge3
929,707,132 *60D322CA883B5E40DCB1CAD4CDE940446BA4AF46 AT%Lk
929,707,133 *60D8A6A4B62DE9D5B8D206291A2484C2DCA5AAE4 ATlpT
929,707,134 *60DECEDE32969D3E7CF2F7C372FF84EE9450ECEB atltypes.h
929,707,135 *60DE0A4D7A2467B7961D2C70A156B3261C47BCF6 AtLuI
929,707,136 *60D0AC43D5872815C569B2116715BC7B72996254 Atlustio6
929,707,137 *60D1418444EB8A11B752BABE43308655BE6E660E Atluvus5
929,707,138 *60D8EE2A5BBBB550470EC363E33D3F87CAD33D33 AtmaF
929,707,139 *60DDEA929F30EF1A8C9DED38EB21E2F7FEEBE914 AtMf$
929,707,140 *60D5B90E65701DD202C7891A7B8A8E35ECE19726 AtM-G
929,707,141 *60DA83283C8A65E3ED826813289AEEBD9784F566 ATmGZ
929,707,142 *60DD59D0E1356CA453CC6D448C0BAB82E346F571 Atmo (live)
929,707,143 *60DBC91054670A18293834FB51EC23457A67D072 atmopher1ca1
929,707,144 *60D8B4F4D8EFCE087B4D8627A51D4BDA8F54132C ATMP8
929,707,145 *60DB9C6E5147D944F8B05731ECDBA410C39E5D71 [email protected]
929,707,146 *60D8D427A5FEEA85A1E297F6EB451AE7DF0BBE25 ATMSTR
929,707,147 *60D6A31267BFC2F86A3F6A15E906793458BA77F7 のatmが設置される。
929,707,148 *60DD57DA4C45FEC1E75722DBA29C9DC186496CBE At=/n
929,707,149 *60DA9E856DDDFA66DCCE8714631F0B25DC895A46 atnas 4
929,707,150 *60DEA1BA47C2FBBFE720C40AF4DEC5938CCB828A Atnatsab
929,707,151 *60DF2BB1732D65BD7FF8BB31D5843717ED5DE731 AT/nD
929,707,152 *60D20D093DAD069E9BADE470B8AF40234DECA8FE atnemroted
929,707,153 *60DA18A6673F7E014800631AA73E2788A3F3A278 atnetnoced
929,707,154 *60D949DCB47EBE18A4D8A709485268B59F161C0E ATNGj
929,707,155 *60DAE0D4ABDE6DADBF472F2D9CE9CC2AEC44659E ATnk+
929,707,156 *60DB59D2C4AED87446172E8B844880967670EAD7 Atnocmac9
929,707,157 *60DE3DABD99CC5A70A840740FEF0E74E4F4F4056 AT NOON
929,707,158 *60D621170D3E3809EBB5846DAF77942C865AAFB7 Atnovuen4
929,707,159 *60DFCD0D71872414F916D020EFDE1A6472E0ACDA ATnP+
929,707,160 *60D5C5FD83767D43FBC521811F69732BC95F9ECD AtNPR
929,707,161 *60D1C4D67667CFFDC42BA0BF596BF5F6B7EDB4DF ATnr7
929,707,162 *60D5E4C092458FA4E419942D95771683A5047AF6 Atnukule7
929,707,163 *60D08FB1D347335ABC94D1A78FA2CD0F06D10C94 AtNuM
929,707,164 *60D883AE085AB653EE8F7B47B5B35F223327547E Atn;X
929,707,165 *60D9D13855451D26710B8776DB12B626F1125A07 atnyematye
929,707,166 *60DEE54215AA7794F0508BBF85DB5DAA27E15858 atnyk
929,707,167 *60D8F7ADBDA80754243E9560C0EF26C18DEE2E4B A*To
929,707,168 *60DCC6DFEC6EB49135E603A8C9514FA7CA885274 At+o2
929,707,169 *60D794853FA6B4953948D4BE5FB244C3EC67A4E4 At?oa
929,707,170 *60D4A00CAA32B44ACB3B99FE26B7A4D078677DD3 Atoco
929,707,171 *60DD748EA820C6E3984463D84C3B9EFF6B540473 ATodE
929,707,172 *60DF389D4D38A974838ABBA4DBD1702C21DD4530 Atoe
929,707,173 *60D9E228C3CC2B1C4F5BA8C1DC378F35E81FEF31 AtOEW
929,707,174 *60DB6D44C7885C228F9EB6AAC761831F26D4D538 A-tOF
929,707,175 *60D16201355EE1ED688F7BDB1E7654EBD6F327F0 Atohcamed
929,707,176 *60DDCFF48938CB30566FE4EB2BCE8D13F188F6CA ATOLAVAM
929,707,177 *60D07D1A55DEC731BF8D23DA7C291677BD521CEA atoleimaria
929,707,178 *60D42D0C9CEA0203971818FFA1163542C52D7A9B atolljain
929,707,179 *60D92F8EF6BB37A84C71E741350973D744D6752F AtoLo
929,707,180 *60DFDECC5AF48E37A5C85719F62D91B92116E12D Atolphus0
929,707,181 *60DA9F8CA37A27A62671B115B1D6D8310500942F Atomekk
929,707,182 *60D69A3DB1B8691C18EAE9BDD6F992AB6743D1B0 Atomicweight
929,707,183 *60D0502B0215257EF3AE8FD860FB42571A8AC8F6 ATOMIZACIO`N
929,707,184 *60D24260C31038E0B41BD1305E105B85AD195A96 Atomizations
929,707,185 *60DE6D808BDCDCA63B7777E08E2CE93108D02A59 Atomstre
929,707,186 *60D31699984F1AE36F8B79FA9C5E9B78CB8F82B9 atom
929,707,187 *60D230BBF12589A520E475AABAC7F980037BCF47 atonal.jerome
929,707,188 *60D88867FECEA45CCE88D2BD5DBC8AFFF0292873 [email protected]
929,707,189 *60D119BAC5D94EE553A7155A43B60A71022285A4 Atopisch4
929,707,190 *60DDC31B7D90726627AF1A50CE58E3C8E7FA4430 [email protected]
929,707,191 *60D9AD67982C1548E5736C35BB382ABABF3168A3 A"tOq
929,707,192 *60D4A7245C3B92ECBBD2A42DBA3B9E45DF5D5A23 Atorform4
929,707,193 *60DE9C37A3EBC917DDC79AEABDDD7C3BAB24D351 AtOs
929,707,194 *60D7C403990BFD0ADFF07B474575459228D23143 atosaki5
929,707,195 *60D4F99B545B271ED9B4C09426D5A7374DF195DA At/OT
929,707,196 *60DE8E823A73FEF1E58EE7AB228327E8442D5A4E atouas
929,707,197 *60D4F509E5296612689E5F328E253DE423DEBEAA [email protected]
929,707,198 *60DD2D8F31B5C6600FCBC18691F0734CF1DDBCB1 ATPチャレンジャーシリーズ
929,707,199 *60D617C36EB1FFB51B974F5300BE33D72D2C4720 At,P$
929,707,200 *60D9F850597B2694BE1953994E78F25A4A7DFB08 [email protected],[email protected]
929,707,201 *60D54AE4F65587D037831693E844D248845B2EF5 AtP8v
929,707,202 *60D74C2CE73892004BFDCCAF6441C4D42F1FCAD9 AtPBp
929,707,203 *60D7B416E3CD56E9A3978AEA6E65F478C9EFF1F7 ATP-FACILITATED
929,707,204 *60DA0C896CBA200A4D8F89FD74DE80D5B34D68B9 AtpHt
929,707,205 *60D6AFC05C1587F81DECAAC39919A0B7DFB37B55 atpjan1234
929,707,206 *60D92B0634ECD2500D15FAD313D87B1D020BC407 AtPjd
929,707,207 *60D9EF041D19477D55366B45A417526412DE8EF4 AtP(N
929,707,208 *60D04349A28A4DF1093460C3EF7DB7708A719CA0 at present
929,707,209 *60D9133CAD406F7A0C8B7976A7E028F68E0A49CE [email protected]
929,707,210 *60DAEA3013DC1ACD5CB452011FCCB315D65F0594 AtpSZ
929,707,211 *60DB1452B3DB7629ADBA973F5B483BAB12A938EA A#T-Q
929,707,212 *60D84954EFA62F1FD667D203B5843FC2D61408B5 A&Tq-
929,707,213 *60D739AEFD9A609B2A23698CDBE605BB0BFFB745 A(&tQ
929,707,214 *60DF64C16AA270619AB3B1CF1473047537B6353A A$;tQ
929,707,215 *60D652637B1D6F5126F8E906D2E4B342DA64C6B4 AT
929,707,216 *60D5F922742B50368D39B89C0D781ADC8C00AD47 AtQ0
929,707,217 *60D48F58BCD07EAAD68F58B784EC7DB3C4AA5BC4 Atq2B
929,707,218 *60DEE59558B473E4F2128D1D97E4EC7203115523 ATQC4
929,707,219 *60D54D477219C6103C57922F4E971E682A486509 ATQd?
929,707,220 *60D02BCDB6CECF452DFDA5E992C11D06D635A255 A-tqe
929,707,221 *60D678CACE1F3ACFB730BD6C6DCFF816ECC306D9 A%tqf
929,707,222 *60D6D181B57A41F07442E4F6601BC7CA8FFF253B A$tQH
929,707,223 *60DA1259BB480F4BD0125DC3BC22E8EB056A34BD ATqKr
929,707,224 *60D07D5ADD6336275555EDEAFE89F7BC8EFA1E6A ATQKs
929,707,225 *60D5E8A460B2FDB2F47B02D7FB600B4AAFC623CE AtqMS
929,707,226 *60D4B74FAE90BD38D342CFB90FD84D45E9DC6742 AtqN2
929,707,227 *60D1516CC74A55D64FDCC049A96911947FB65645 ATQO=
929,707,228 *60D927424D4F16241436A23466B1E4B3A1CDCEA7 At)QT
929,707,229 *60D7C21C5D4A704913E86E6025F236246A2ABB37 atqtwadx
929,707,230 *60DBD8E0F3DAFB58EFA908A89FD0ACA2A65751E9 ATqWu
929,707,231 *60D0E6A12D8BA5B4A7ECD67656B25426B7C3BAA4 A:t;r
929,707,232 *60D21265F5B061A053EA2E5B72D8F4A83BA5ED04 atr-28
929,707,233 *60D9A36C647561846148BF28E950F5CCBFEBDFFA Atr3b
929,707,234 *60DC0C5301BFD9617C79BF8F2FCCA5245A52FA26 ATRABILIOUSNESS?
929,707,235 *60D20ED7D93923DDA1C50B4312C1668B089F7B9A ATRACTASPIS-BIBRONII
929,707,236 *60D464F51330EC44A7BB191CD73298B623F00EF1 Atrakarus3
929,707,237 *60D9CBA07CC3B24D839A5A6BC78422E4FC4BBE6E atranslalionbyI
929,707,238 *60DF942AC7017B602C25CF4075F2700ACF28553D A.TRb
929,707,239 *60DD09D7574EBEE04BD38B54AC4DA35AA45C867D ATr+D
929,707,240 *60D5547D6C31D0B0409DFF881369EB08A23031CF atriale3
929,707,241 *60D056CF3D63C0F25940D3F45BC0E074236CFA42 atributetoleatherface(disc1)
929,707,242 *60D6D0703FE0F65A773370C279390AA86D846C70 a tribute to m&m's
929,707,243 *60D821CB75FDCF4B296BAE811B22F07F4ACB6EFC atrichia1
929,707,244 *60DA84A76DB328A0154ED2E23C0CF5A63085FDB6 Atridaen
929,707,245 *60D5C428579CFB3E99AADB12D8780873C17A54DC Atriensising
929,707,246 *60D939B6E5DD2A509683E6331F7558F049D23DC7 at ritas
929,707,247 *60DC9A6DB201910EDC315F0701575564A366CA1A atritona
929,707,248 *60D5C958D1FAB5DE99A91C81D40D294EA8B1A2AC AtRj1
929,707,249 *60DDCCA74F32C396F12533D5BC1FF2B95121661A atrogat
929,707,250 *60DB07166A9E48A5512307EB0E449B3376DC482E Atroketh6
929,707,251 *60D7C56D8A3C9BAB9FE0D08AB139A15B3B929E68 a$trometeoro1ogy
929,707,252 *60D3F188E50286593AA1B7734EFAA9117F07446A [email protected]
929,707,253 *60DCD44A5FE6208A131FFAF856B4A7B4F0F29C8B Atruppen9
929,707,254 *60DD8567B54DBA5CB211513EE982B8B7F36811E8 ATRw6
929,707,255 *60D703BD7CCF3E057CDDE220F5D15E51A9C3C507 ATRY;
929,707,256 *60D3E60E6428AEEDA8D30E802153CD9CB91CB061 AT_S"
929,707,257 *60D50C14099EA8E10CE1D6CCA52D9CEB4E28AC70 At$S)
929,707,258 *60D5A07D9E9DFD41C6508837AF809E82D6D2ABCB A=ts#
929,707,259 *60D4F1607C23AD1DDEB81A598E4A806E5560ED25 Ats#$
929,707,260 *60D81B5B718E6B2E70F1C8109B7E74C7280525F8 A,tS8
929,707,261 *60DF9426521D6A0EE93A7659217412C1F1E74255 ATS$a
929,707,262 *60D47EA7FE8F2AB05CF6629654828A7ACA77076C ATs/a
929,707,263 *60D3A7A69E1DF8002C57CFECF3895AA374E99AFA AtSA+
929,707,264 *60D02C8574E020090575D95139FB018738D836FF Atsaamis8
929,707,265 *60DD3DCAB5E9AA5472096DEA714A11AC537EDF62 Atsakik4
929,707,266 *60D737D6EF4DB2BA180F932A47CB238B8D41FA88 Atsasonas
929,707,267 *60D5B7CBD24C821271883A69F7C7E05EBA6A7375 Atsasseses
929,707,268 *60DFB2D3F3322FB04A25CF422123A565E7113ADB Atsatimi0
929,707,269 *60D8AB2732E95C2BB060322868F6A244692403EA Atsblesed
929,707,270 *60DE5468016A4C6B10201593A288082D852D2568 Atschenkopf
929,707,271 *60D773ED012DE0FF741F40744622C96AD1425CB3 ATSCt
929,707,272 *60D76E7C798EF3660AD038732A085E24DB506AFB ATSdt
929,707,273 *60DB864BAB4BAF486A07D38112615CB9087F57C9 àtse
929,707,274 *60D8CCEC7BBC42BA1B0B815291184B89F02B56A3 ATseD
929,707,275 *60DFF6CB045ED809CCEC35921CD0420EDA1D382E Atsensib5
929,707,276 *60D7C09168B42AA699055AEA717903D8AE68E7F7 Atserouv7
929,707,277 *60DBF956A729EFDE663D5F53E34DAA992D71767D Atsesata0
929,707,278 *60D2E79152C883A80FB125ED54EF0CF0533E9BCA ATS+g
929,707,279 *60DDF6938DA5F528510DAF9A0AA4747137C11D5D Atsiekki2
929,707,280 *60DB29CA622E8461016953CF8A204E2BFE679B58 Atsieneking
929,707,281 *60DB5D65DC4CF73B45E48B3C472607644FA616BF Atsinimaed
929,707,282 *60DEA50A6B6E211AAA09C9F48D9796248950E672 Atsipotua5
929,707,283 *60D084DEE9FCEDC5974EAA76CA903C0C02EAF447 atsiprašydavusius
929,707,284 *60D2FDB8DA88DFB024C36543008B927396044973 Atsisllaed
929,707,285 *60D9F10007DC2B322D010E4A255D4CADA428DF2B Atsiulas
929,707,286 *60D2530AE4B492AB2D82A5F9059FE8713898E350 atsivedęs
929,707,287 *60D0115DD5B235FEBF20BA228B454A5CE0783CD8 Atsleben8
929,707,288 *60DB3DFD31D3BD9B19DCFFF045FD4178FDB551A4 Atsmbswed
929,707,289 *60D281CD9E3555BD14D6D3515AC475F9314031DB Atsoitpos
929,707,290 *60D343D33DE9EC2EB174E96C9377043C7089B370 Atsoluto7
929,707,291 *60D066074CDC00F4EE90A4854E454E087A9A5781 atsotsobe
929,707,292 *60DE056D749D1B41BBE214D14FAAC6E7991B7B9B Atsovuen7
929,707,293 *60D93F33220DCFAE71868D57D0D7DDD4553E2268 Atssnora1
929,707,294 *60D6DBA280C91044189900F2130AF8FDB8E517AB atstovaujamųjų
929,707,295 *60D8DAEBC4D049AED0E537C9A6E37C45E2083EED Atsuessies
929,707,296 *60DF3AD606CF6BDEB3A8EFCADA28936390213628 Atsukans
929,707,297 *60D27A45AEAA396912C72FD3211CB35E24539C01 A:tT
929,707,298 *60D6B1F2D531F4A65837AE7ABDD9FC42A30565E1 At:t"
929,707,299 *60DF1E0F6A72B040B135725699983718C84182EC AtT0d
929,707,300 *60D5B359B0D4F9AE57E0FFA8294C33C9F3BA2506 At%t9
929,707,301 *60DD0BA49BF926B585D684D1883020E63D3AA045 attachétätigkeit
929,707,302 *60D586A8C258EE9E8AC1637DEDC09E9A6366EB43 アタッチメント(attachment)
929,707,303 *60DBDD1B2E459CF089D1E8C50A887FB20E567722 attack105
929,707,304 *60D738949AE2408981F177C125014804F2841B1F attackéiert
929,707,305 *60D14148F0105968D1B75C7604F532A77CA68F44 attack'ICT
929,707,306 *60DEB884851C1E4AB84667C10B8047297CBD77FC attackinvestigation
929,707,307 *60DD676A8794502BB22AF0DFBE4EF60EB7126682 attacksround
929,707,308 *60D43A4C8AA9A62F0CA0F95E977B044450EBB3C9 attack」。右舷裝有主炮「重量子反應炮」。
929,707,309 *60DBA7CDC91C9949E05F534E18E71DE0339DE60D Attamino1
929,707,310 *60D7FCD5A46E009178629F4023E04E7B3146355E Attaniiks
929,707,311 *60DE476737CC80BB969C6A2998E7832A61C7A190 Attarder8
929,707,312 *60DA2B1A0B8756321B10035BEFB7AC382C4D8020 attarderont2
929,707,313 *60DD7D63D1C616E9C4063F3E4CC9F28B9486BCAA ATTARID
929,707,314 *60DCACA3ED920F29753A502A7EBD17F6171C6039 attaullahafridi
929,707,315 *60D0B81E9CEB4C3027959C037BE25FED07F00FB2 Attcp
929,707,316 *60DB3571793C457DD55B4DDC359971F3CCC62362 A"TTD
929,707,317 *60D4FE30664E46ADE7109F050EC0871E2323D95A attdeleon
929,707,318 *60D49666844691E2EAE346101BA5D9DA90A16554 AttE%
929,707,319 *60D2140D48AC78C4F8EAD66228A18511D2127A16 At#te
929,707,320 *60D8D185C29E3A9A23B1091508D0BCDE7A335C08 Atteelle7
929,707,321 *60D32D8282B0EFE0A7B0A2E4682BCF9C316C8A82 ATTENDANTS6
929,707,322 *60D3574FB88C49FEC8549A5505CD2BB7F046C406 Attendues0
929,707,323 *60D3680139E6C4113FF148CF905176461AA620F1 attentionw
929,707,324 *60DA575F7A5D8AE7CB79253AC3010154A52D4C7B 《attention!學警出更》
929,707,325 *60D12ED94A046D899430800F081E12DE1AD63948 attenuating3
929,707,326 *60D50E75698EC4D1DA4545288EF6FBFF4E2295FF Attenueras9
929,707,327 *60D9AC41EA19A4DA0824C02E0493BB0E45405739 atterctive
929,707,328 *60D70C0876085D3C26EBF5A25131752699BBDADF atterrons2
929,707,329 *60DE787FB8CA0E48541078858CD8B54FB9856CD0 attesterings
929,707,330 *60D95638BE007E52982A5748890DEE11134CBB14 Atthefootof
929,707,331 *60DFA7AEC8CBD21E8DC2BDE7FCCC9B66DFA8A399 Attica Blues
929,707,332 *60D410E2489EFC2E072E51290374ED9178545162 Attilapolaris
929,707,333 *60D28A7007C33FDFDA068D05EDDE6D0F4A897092 Attilaroux-Attilarufus
929,707,334 *60D9C0980A12CC2CDE116D01A7441BC005561527 ATTILASNOOPY
929,707,335 *60DBDE891A6649DB295DAE379C578F18698838F9 Attillat2
929,707,336 *60DBD8D273DEB823ADE6365AE87979BD28F2F129 Attimi (credi di...)
929,707,337 *60D117F8BCF2FBA66D52FA8FFD6BD88F213033D7 attino1234
929,707,338 *60D479A12C2F5B8ED47E31E0792DECC69BBC0A83 ATTITUDE ART
929,707,339 *60DBB168572DEC30CEA4702C47B731F4113F796A [email protected]
929,707,340 *60DAA28A1C80EFA98F5ACD0627B2453991F28A4B AtTm#
929,707,341 *60D23F526CC2F4890486B9D1C73FF2E35DB51C60 attogray
929,707,342 *60DA8B006D9BA630BE18898F24E51B6292B400C5 atto i - mister johnson, voi m'avete seccato!
929,707,343 *60D7178F658376F6A7390491C5AA611593670821 [email protected]
929,707,344 *60D55C3A36E7DA75DD72DD79F4EA98869B6574AA [email protected]
929,707,345 *60D7D0F947A8A03854864F7D19F8FE61BBBD689A Attotneys & The Real Estate Forms
929,707,346 *60DD144FFCD3B523A00F45D955F220D691400A84 A,TtP
929,707,347 *60DC851AE718BA15129ABD8722C1174018874096 ATTRACTIONSDETAILS
929,707,348 *60D7323EEDDE09EC4ED07321D530DB0309950379 Attrassi7
929,707,349 *60DBF16A6F20E25A25B41A96CA62228B8079262C ATTRIBUERASES
929,707,350 *60D9F3A0D91707C311343EDF50EC193A0CB2F2AB attributionmitchiner
929,707,351 *60DC5A48FB8857FB870CEF9AD556690D526088E8 attrita5
929,707,352 *60D8CBE50393A8D06D2DDBC38610A1166D5A4E1C ATTS48RW55
929,707,353 *60D7C212AE3F8ED5E317BC914E4E843D4AEA8E23 attuabileattuabile
929,707,354 *60D64F3797A07D1CBEF2F9A397F268E1BB2E2C34 Attuatos5
929,707,355 *60DDBBA5DE19B90DF2FFDD4655CA98F343AEC7C6 Attukheh1
929,707,356 *60D56B98E189EDA5A1A84036024736803225AA07 Attutivos
929,707,357 *60D5F7D61ABC81344EE91C57113241D1D875F402 ATTVa
929,707,358 *60DB26C905C3ABC168E89F2EEA0D6946C3B8298B attyhak7
929,707,359 *60DB13A08BC93F53B95228CB06968FB72976A350 AT
929,707,360 *60DD45EE3E76C20BDF691E1A4DB1EEAA6B728805 At+-U
929,707,361 *60DB04A5CED976FEA6F69EB3312D04102026CB13 A=.tu
929,707,362 *60D6A1EB8DEA74EE196A0DE456310AB69C7F8460 A+!tu
929,707,363 *60D2A965932FB1809F868D5DE68C5D08AA1FB26F A(Tu0
929,707,364 *60D530B444768B65E79391763EA49E77BAC040D0 A/tU1
929,707,365 *60DE9884033FB008A71F5B86491B59482FB25E4E AtU
929,707,366 *60D6055D459433F2091238B7017F89D784FC19ED atuất
929,707,367 *60D23F71B12A2A0F9318689984712D6C459C3627 atuation8
929,707,368 *60D7C867D08CD8F8C467879722D7643FE3E0E7BA Atugishi2
929,707,369 *60D7043F3E5939F35FC03E3720BA2B14A5AAFBD6 atuhiro6
929,707,370 *60D7819ADA9D41989B56073CB99D09E223B0D4E1 AtuHo
929,707,371 *60D1EEFD187319971FF3B8A4E7BB2E07E1DE7F60 ATULHAR
929,707,372 *60D095578326899563744E720CB8A773E9D4F031 atulpule8
929,707,373 *60DEE1DEB0EE5C0840DD2BB6D9559CE629676A90 atulsvas
929,707,374 *60D1DF4CB9463A24CC4D54C012587A49F50B2C54 atune.
929,707,375 *60DEEE9618D508D75B9C5BA619481AC68C09D0F8 a tuning notes
929,707,376 *60D80BA16FEAED5AFB40996183983393E4B3CC6B ATUPHIEP
929,707,377 *60DA4B4B926F31681F4825F9066F4B062E564A3E Aturullara
929,707,378 *60D1B18D11259149C51DD85F59997372DE2AE3D2 AtuXY
929,707,379 *60DD67EA7875EBB1418C83F407FE36F0C44CF2EC AtU=Z
929,707,380 *60DAB0BFA5FE56F0CB5887AF9AD66D127AF77C99 Atv2v
929,707,381 *60DA5D9108320BEE790BA23DD59531FF9732FC71 Atv7A
929,707,382 *60DB8E38E4D68CBA91D2D77D87F0C94FD4893C6A ATV9D
929,707,383 *60D6470F7560670B87B45377021889E2ACB2ECD7 Atvaisa
929,707,384 *60DE060B3D8C415DCDD6E60D20DD40B577D077A3 ATvDS
929,707,385 *60D3A1119F21D74FEEA08247F5F3B61FF730A2AD ATve3
929,707,386 *60D10EA000A1A98CBAC4568DA09E20A1DAFC58F9 atvic
929,707,387 *60D6EED2405B28137AD5344F3108EA7412B6EC6F ATVIHOK-U
929,707,388 *60DC0F59E2B1280F63C501F0FA34C9B2A89610B5 átvilágítottság
929,707,389 *60DA7FB985118B4B3A4DEDCDE48469144B736D96 atvincolour
929,707,390 *60D609AE02D0542C660FDB2497239C7861D0D405 At"Vm
929,707,391 *60D95DA330D8397979D4DEF9D7ABCA42A914766C At
929,707,392 *60D46C1B2D8168D9B7A3206443BC53C3A1C71031 At
929,707,393 *60D8DF81774942FA069328B5A17E82774273636D Atvr;
929,707,394 *60D48943CB848E76F9A4849156E5E6A3D6669AC5 AtVtP
929,707,395 *60DF84EFD02A804EB420234FD965B6E3894E51D5 AtvZ6
929,707,396 *60DE580ECC35308BFE574F7D49708BA2247A930C A!+TW
929,707,397 *60DDFEE0800DB9BDCD2F5723F5B17EE7413C522C ATW8h
929,707,398 *60DC82313EE4CD77DBCC1793A2DDE0C1C71EC1C0 ATwD4
929,707,399 *60D7DDF6EE28183D0DE77C60A5E4661CBF6DF0CC A_TWg
929,707,400 *60DD1A60DA7DB04FB8268F2F2CA22AA4DB817502 At?wI
929,707,401 *60D147BB696961C49E53464AAF5808983CD812A4 atwood160talk160
929,707,402 *60D7AB087785886EEC6DFC1D2D0F513F328DD322 At"wr
929,707,403 *60D0767D185121B4D8899ACE3EF855BAD6373FF5 atwrecks
929,707,404 *60D57EB9768AFA2C562CD433E4A07D8C79B498C0 A+tWW
929,707,405 *60D5257FA81F12361D0B0E21C8739313EC06CEC4 Atw"W
929,707,406 *60D479A6E7FD67C46F4D832B65FAA8A636023CA0 AtwX#
929,707,407 *60DEE3036B4E5226AC9F38605DE8699B835E1CF1 ATwYG
929,707,408 *60DFBD300CB17E85DC9D03B17A34E98DC0082199 A,T_X
929,707,409 *60D939C10AF7C64BB7E4D22A0B7FDE6CD98BE71B A,?tX
929,707,410 *60D128471F345A0CE3AB11CAFA98DD15A9F27CDF ATX12V電源
929,707,411 *60DE9FC8FE9EAC94C680BF1C304F9248C00B6171 AtX;I
929,707,412 *60DE839C793FEECE3582C03737F11DB300EC8577 ATXob
929,707,413 *60D0F4DD872EDD4CAFB7397F249897A5C61A97A5 A:#TY
929,707,414 *60D9A9E6BD41CE7CE6F884433F8726F56C146515 ATY9v
929,707,415 *60D5E018367215E3C836A99C012A5922D9036254 atyádfiait
929,707,416 *60D102208445E68A5BAC2CFC1EDB7591214AE9F7 Atyavár
929,707,417 *60DAD014CD35AFA6EE12B80F43B4863CF64B0A8A atychiades
929,707,418 *60D227C3ADEFACDE5E4011779CBC0EEA7C34084F ATY_h
929,707,419 *60DA1D80DE3EF9B4445C40B008854FB7066AE9E5 atzeritartasunaren
929,707,420 *60D957DA66E7318376E4AADBEC70F69B7C6A4A37 Atzj
929,707,421 *60D202C0DCC3595506545EEC3A08E7E9C6B413AB Atzpaketed
929,707,422 *60D7C424759A9626939F47E9B59286DF975B68FD atシリーズ(第二世代)
929,707,423 *60DC926DA613BD172F256B85D9863B34E2100C08 A_U?&
929,707,424 *60DA5CCFF461508B6025AE596D282869B8FE31ED A!=-U
929,707,425 *60D928785A3B15C104A379A8311FC2836B52EBB9 A/%)U
929,707,426 *60DE4658AD1FDC1FE2AC0FE60E840E61C3FCCF11 A"=U"
929,707,427 *60D09D99279BBF18005CC7A9833A4EB4B22F147A A(`U
929,707,428 *60DA093552655AA04B4C11A594D59F364000653F A&!(U
929,707,429 *60D1207357A0254DF0B74DE50582ADC5CD192556 A+U_$
929,707,430 *60DC878761A9535CB777C0E0A9DFA0E82698A80B A
929,707,431 *60D369BBA8C6B5F9E262E02295D5F260E16808FB AU,?_
929,707,432 *60D73EC41C69DABCA3404578197BF8FCBDD51D7E AU,)-
929,707,433 *60DA55A7144DBD9314E83C1E317D256AC92880DC A_:
929,707,434 *60DF5B7BC13746C16067CCF81F5B661928EBED5D A-u!%
929,707,435 *60D7FC5CF44F2C4EC066B518D0C945042469EBE0 A&(.u
929,707,436 *60D495B59BA9A956F0D860C57A03F6FD1B59DED9 Au=;,
929,707,437 *60D4FF559D7DF56E2458227B99E959E7E893CC32 Au?)(
929,707,438 *60D4B9E6DA19AEA7951CAA6680FE7A2A0E03F3CC Au(".
929,707,439 *60D89307C7A9DF57039983CEF32AF34531AD6E31 AU0AP
929,707,440 *60D06C1E15FF4CFB817B6B2BEC727471B6923D53 Au0gS
929,707,441 *60D9B97907B3BAADF89D00926A03414C95C16DF1 AU&0j
929,707,442 *60D1BAB87AEA94ECB93BB064C90F7876FEDEDF89 Au0!n
929,707,443 *60D431FC294DC9AC520C12D03B72D77BDF281082 AU1;;
929,707,444 *60D4582892F4E7FA481735ED04B29E96E18F187C Au1H4
929,707,445 *60D9BEB8F99B9853B456AFDEDE79579987C93857 Au"1L
929,707,446 *60DD52D0DF35ABCE0B8922A019BFFE70984092DC AU!1M
929,707,447 *60DD2A70B9E736BC45CF0549DAAD3BC39D4950AE Au1OY
929,707,448 *60DD5E3E24CBDB7CA02DEA61EF770DA29B109C4D Au1U:
929,707,449 *60D8885DF7DD9AB83D9A7621DEEC262DF45980B5 A$U"2
929,707,450 *60DD89FE547170FDE2AFE59BC133705107B08DA1 AU21q
929,707,451 *60D0B18090F720C6B0D13D5280CCA80E756C053A Au2fp
929,707,452 *60D428B241801945DE304AE1358105E2AF85236B AU39g
929,707,453 *60D67631AF8ADD9F32D5E2795D2E0E3E47AAF545 Au!3h
929,707,454 *60D5D7B218F6C0BEFC9A9A2D12B79C6F7500FB29 Au3iH
929,707,455 *60D1D5D599B2C00F2FC1CFAB5B0EAED1859CAE54 Au3jI
929,707,456 *60D976E4F7853D4C042CA2EA5DB17EA95916CB36 AU/3O
929,707,457 *60DFE30ABC1EDF4ABAFEBBCDDA4F003A5D4D6D98 AU3Re
929,707,458 *60D99126F012BFD4EB997C55D597AF30956F44F9 Au=3t
929,707,459 *60DA2927D2ECDF1A09AF36EF10D2EDF89349EC1B Au3(W
929,707,460 *60DA02BC27E7CAD443CE6692C7F5EA00AB0B3D0A AU)4!
929,707,461 *60D5755A5BD176BA2FADB39F5E7BED78727D33DC Au4-6
929,707,462 *60D4CDAF1F787A5D85A7A50786F3FFD111E8F21A Au4AF
929,707,463 *60DE128A5AD459337AC74837978CD4E46076B596 Au%4d
929,707,464 *60DE0801ECE051246953C64F858E2592F003A3E6 Au4e?
929,707,465 *60DE4B97BF7C9F9DD64401C5B1165B34C40D6FF1 A+U4f
929,707,466 *60D97EB65E2BD8F90FDE8C326DC2E2CAD6272ED7 Au4io
929,707,467 *60D03850D71C429B7A52F7140AB5338ADA3B8314 Au5+:
929,707,468 *60D5755259B9A37BEFF5E829E7F078166201E1EB Au5:9
929,707,469 *60DE4CC77E82CCB7B5871CDE8C2810276806FFB1 Au5pI
929,707,470 *60D7E05D4F80FAC00DEA83FBDA57E0F3D28AC54D AU6=
929,707,471 *60DE0E0AB55B32B26804177348F59A1B61A2BB64 Au6/"
929,707,472 *60D4A8BDC08796C0D08083555EF33B5039A9C312 Au6
929,707,473 *60D698C3C893EAB05D53F0C7B52C74E7DED3D51E A-u6M
929,707,474 *60D4644C09CC6316F579B444567E30DE065AD58A AU6qf
929,707,475 *60D25387C10AC4CE91E711120C81BB4CC76D8B22 Au715
929,707,476 *60D63DAA03843FBF9E0643CFFF94A0948C1790B9 A,u7m
929,707,477 *60D13BA46B39C4FDBFA059C17AE1D36CE9459A66 Au7Q"
929,707,478 *60DDD1263C7A8719D5AC63085D5A5B8025CD84EE Au$7W
929,707,479 *60D5DB91301B9B6BDE67E1DBBC8EA1BE2639CD7D AU8
929,707,480 *60D3E913D7F7F8ADFB6683F58DF4F7E0271022C8 AU+8g
929,707,481 *60DD8A951E63A51F70FCC97F00F9C060713060BA AU8hI
929,707,482 *60DA208E97F964EA853B18864BF0EDAE65AE7C53 Au8;o
929,707,483 *60D8655483214B83049F5BDE3BFDE0155DA9F35A Au;97
929,707,484 *60DE63E081DE7EA49A5FFB37D7062EE52EDF7B78 AU;9f
929,707,485 *60D41C543615E2EB67E93DCC4CCC854877FE9A65 A$u9F
929,707,486 *60D173509003046DE604F6E94BFC96B1C3671964 A!U9I
929,707,487 *60D7003CA03E09C4FC53D325C52400C5FC7C2B60 AU9TX
929,707,488 *60D41A4A44F836C2A0E250BA0D07EEFD0ABFE713 AU9
929,707,489 *60D3F39FC05DF52051BCEEC4574419206A4EC89B A(u#A
929,707,490 *60D0DE3C1B3979CF2D8B883F386E668175794661 Aua2T
929,707,491 *60D5C939B7662B615BEB2F9E73356D301901669F AUAAe
929,707,492 *60D7DE6339C0BAB60FEB0F838ADC5C1758A5FE3C A/UAE
929,707,493 *60DA4934C0BD0DC6E20040E1E16D0CDBFD99FAE9 Auahroz8
929,707,494 *60D3B5E005AE7FD8DE406AF9B5767C008CA73AB2 AUaHv
929,707,495 *60DDB698EB19276DAFF1DBC830414D6EE3073B40 AUak=
929,707,496 *60D314DD869B04F1052A3A6B713CAD7B05DD254A aualenn
929,707,497 *60D49CD58FA30E5B8AFA600119173823A8C408E2 Auamj
929,707,498 *60D39CD994B543B90FA5C806736BBCCCC730F7F1 AuA!Q
929,707,499 *60D5DB3A3DA557414B01153BA460DD3430D1226D AUaT.
929,707,500 *60DD398BAEF9AF6FD7DC113D93FCE9509720EA0D AU$AX
929,707,501 *60D196DAD85AA2FC8141F27F8349935D455D575C AU.B_
929,707,502 *60DD5F4B64E1DE2FCDA39B877E088E482821FCD4 Au/B=
929,707,503 *60D6EBBC054644FA066EFEB73B20A2291639BCF4 AUb"0
929,707,504 *60DD6B49D79CA7FDFE20299CD183980350039711 AuBi
929,707,505 *60DE5D81985D3291B81F4C580555E3A1503B410B aubignyfernando
929,707,506 *60D54415B414596A95024FE0014FC02D0529CF3B AuBjP
929,707,507 *60DDF2210B8DD3C033D1795EC2D5F5BC2D04B943 aubrey.allaway
929,707,508 *60DD023FF8500991ED71A23F9D40FF326EB532E8 aubrey.calvi
929,707,509 *60DD45A5B287E3545319FA22666AEFF601ADA6BA aubrey.disponette
929,707,510 *60DD9F1E1DF89954718D3C32FC7341EA97B4FC5A aubrey.ferlenda
929,707,511 *60D80F4068BFEDD1FB92663F4A843C48D4BD9A7D aubrey.guardiola
929,707,512 *60D4553BE26381F02B7C26EF595FC8045F475982 aubrey.gulinson
929,707,513 *60DF21A5CB7F53811F34A14A540F798C0DC0ED7E aubrey.kanoza
929,707,514 *60D86C268AE5AEB4AF27F7C21FC145283EC7FFB2 aubrey.korman
929,707,515 *60DB701EDE2BD7E9DFFF0AA736E6276BEFD630A5 aubrey.lascano
929,707,516 *60D6453F4439F7C7B65A27D2DE5BA3C408615394 aubrey.ledden
929,707,517 *60DC07D600A89BDD6DBA7D01BA83F972CE569949 aubrey.marfil
929,707,518 *60DCE58A3E428BFA4FBEEF9CB5D4E14D3880DE15 aubrey.morada
929,707,519 *60D1B3EAE8FFFD74DD268F6CACEEAA1FA80FBB6B aubrey.oyster
929,707,520 *60D9A2C2BCAD6CDAAB6258DAD7168789B9A3D729 aubrey.pealer
929,707,521 *60DB3554AD035259383D06C975BD567D9143D891 aubrey.pocius
929,707,522 *60D9507635DB686B7F7D49B085F85E997D228D3E aubrey.reihl
929,707,523 *60DA8276209D69BD952C202DF705432F5B76737A aubrey.shoger
929,707,524 *60DA9E429B44BC801F1A77C9CE2336D69833A73D aubrey.vandenberghe
929,707,525 *60D40140F54B2C1621819E2F255AB884D306C5D3 aubrey.vassell
929,707,526 *60DDAF6898E76136F74E1F52E5244AE2D856F892 aubrie718
929,707,527 *60D599F2DF34B7F84E2D068F6B6E8ED9A4A4DAF2 aubrky
929,707,528 *60D332EA6FB6679F56235B1F6349E3D6F6C632C4 AUBRY89
929,707,529 *60DF17156FD6046D8DA7669316AA3DA6AA98B693 AubtN
929,707,530 *60DDA685D503B93514ACEAF5E0F0EAD87454DDCF auburniowa
929,707,531 *60D2335CD75EFDA4FD237CF20DE134CAD87752C8 auburnto2
929,707,532 *60D671061C5487106FBAF789B325928EB1523C96 AUbwP
929,707,533 *60D463462454379433F95A3AA4CEF1DFFBFCF50F AuBwt
929,707,534 *60DC6C2DBB52CB42824B0FB4CAC45CA0D667DCF9 Auc0u
929,707,535 *60D57549C8073EE1806FF64A5265737E5D096F23 [email protected]
929,707,536 *60DA930AC8F2D2C41474E6C79E3F9EE95B4BA0D2 Aucassin2
929,707,537 *60DE08C5072034177C3ACB7A41FD5960BD6B990D Au.CE
929,707,538 *60D46784402497AE097927BF707A819757FB6649 AUCES
929,707,539 *60DE56ACFD688094A156A4D19E08F6E27E01222B AucfR
929,707,540 *60D112A24671FD006364E25E109C27C7DD5441C0 auclemente
929,707,541 *60D09BAD64E27E112F95195C32308D83A22494B4 AuCPP
929,707,542 *60D8F7D8001F74FF63D5F02CE77038790F4E9772 Auctionneers
929,707,543 *60D7CF024378999269A06D50DCF80F3FA556F9F4 Aucturae6
929,707,544 *60D5155AB6571FC619112B9E0542024CCD1E0011 AUCv(
929,707,545 *60D41F7E34FAB94CDEA0F485B822947F8DED659D A%?UD
929,707,546 *60D72C20A747C9835642F6BE64768A26D66A9788 AUD-&
929,707,547 *60D35B5E93192356608332981573A685DA65C052 A-uD?
929,707,548 *60D47F02D781D3AC350E112430AF50919DB49D72 A#uD_
929,707,549 *60DC588A1E0094D91FFF2315971CA209AADB3531 A+ud$
929,707,550 *60D4B7ECAAF0CA7ECA8469FB7A3A26E60B603AC2 AUD1010G157
929,707,551 *60D04889B73C38A070C81A20C8497A1557145C2E AuD1E
929,707,552 *60DF382C22C0A9896EBE4786635B9210E363523A Aud1olo91$t
929,707,553 *60DA0AC747FE295C34556138F5E998E77FCACCDF Audacias4
929,707,554 *60DA39EAB9BB84F7347B3A29E9F85AD03D684743 Audalak
929,707,555 *60D059D94BAF702DD70F025DC7BA8900D86E9F50 audargeD
929,707,556 *60D57CB2170B6BD0DFEA3C0DB2E2B7E36434FB56 AUdbM
929,707,557 *60D74C9475E4D4C10B253320825389A38FEB50C0 AuDd)
929,707,558 *60D74F443D2CBEC090003563B230FF0FCD6199F9 Audeline8
929,707,559 *60D1CE74E4F1190340A40EE9A04C68D5BBE42699 Audi18tq
929,707,560 *60DB0C59D87BE5E07B3BF9BC99356B50E52CE289 audícija
929,707,561 *60D8FEDC02499CD52FDF8F791BA53EB9B5803867 audiencedemographic
929,707,562 *60D7BF14BCE37C3F46DB95FB80EF23CD5234D470 AUDIENSEN1
929,707,563 *60DA8A5BBB389696AF46B1372E43CAF02E30EEE5 audiocdmix
929,707,564 *60D0702514F64269A84959BF80520E18B6AEF97B AUDIOGRAPH3
929,707,565 *60D657ECC7D1768145B6681953066A31258C15FC AUDIO-LEARNING
929,707,566 *60D0D7A759E557709F0BD5EE42378E7121CE0FE0 audiology1234
929,707,567 *60D4F7F8D7AFE0C0D0536893056A6D0A108C8F83 Auditionniez2
929,707,568 *60D319EF6F68DA9213870AC4525AAE30E70C0AD3 [email protected]
929,707,569 *60D58A1A2AB7ED91F039319E0E6DE196DE3D9972 audivision123
929,707,570 *60D775E7D26F0DDCFCE46C523DFC16B45C23C6CA A%uDn
929,707,571 *60D74CF17EC7CA0EABFD2D36970BC5A49065E540 AUdN3
929,707,572 *60DD885297E3C41CE391A770BC84913428DDA810 Audoliing
929,707,573 *60D96DCD40CCEFF4A3935429AACD88C846166482 [email protected]
929,707,574 *60D2BB5335F77A094A1210A868A4336FA77352F2 audrest8
929,707,575 *60D2978A66A9F7812CAE8BB3B243E88C15FA2C31 audreyniles
929,707,576 *60D64E6D4BC202F989948C8D84FB4B7A4598F5BC audreyrader
929,707,577 *60D77B86D36F95AC16043AEC594DABC7D9433B18 audrose1
929,707,578 *60D12C307C35CD193C4EFE1DD0887580CDB49D5D AudU
929,707,579 *60D84F93273D76BE2031669AB725135B0CA2B399 audun7
929,707,580 *60D190C79096960F1DEE496B93D7CB190CA1BC60 AU%
929,707,581 *60D968D682293A0A3FE988B0F2253B978AF3C11F A_$Ue
929,707,582 *60D55E00447A2F9110E6FD88963D0F5F2F13DBFA A#Ue%
929,707,583 *60D2627E0016FB09B11DDE950CDA6549957145EF AuE_!
929,707,584 *60D6CF484C2D8521D42645611F372967A2483446 $au+e
929,707,585 *60DAEC8DF25766A7848C635C328BA2D1995DC706 AuEL,
929,707,586 *60D4D3D71CD37CE40B1E3A2DA655C20237DF95DF auelbekov
929,707,587 *60D66EBD5D755AA5D3414A8B25A19592E4EF049F Auelening
929,707,588 *60D8831738C59C04CFFA3169CACE9153CD8FB255 auenetBSW
929,707,589 *60D082EE85E4F813015BC06AB1D2B8D2DFC691A2 AuE/q
929,707,590 *60DD3D986F6930D8BEF5AE2DFD29D4713039BB8C auerbachischen
929,707,591 *60D604E4B497D15F1189945122CC6F0F78185537 AuERm
929,707,592 *60DE87EA4A15AB0064CBCA540129EDC329239E64 Auerochse/D
929,707,593 *60D4B6E9DCE6B90495340502D2FE82EB15E26195 Auerzuge7
929,707,594 *60D1E1A3BED6B0A415E9557A74EBF3B92039574E auespæ
929,707,595 *60D4ED6E453C19CC205944E962C59E3042AC779B Aue;t
929,707,596 *60DA63A691EFBE63B2CCE32B1B6650D493EFCDFD Aueua
929,707,597 *60DA97845B614A390F0FD40F1DA292A6232C0DDB AUe/w
929,707,598 *60DA612A218FA1D4D956887A338D720C1A44B7D5 A$,UF
929,707,599 *60D7D413C431762F44C760901219F78736752F6C A$uF(
929,707,600 *60DF6788C1766788F7175D42ECBD678A555C6D61 Auf/
929,707,601 *60DD50DECE53E5316E98E7016747AB8624C63424 A
929,707,602 *60D98A8AD77DC91112B2D03D43AE1BCB82D8EBAE aufarbeitend
929,707,603 *60D617AF650A8F5A01EE160CD9FDED57F843D43D aufdemklabauterpfad2
929,707,604 *60D72835911B71B991CA3B8837765CAD7A3D3932 aufdemschrottplatz
929,707,605 *60DC5EC77E3F53F8960BD2A1A460E5EF20AA467B Auf$e
929,707,606 *60DBCF6715005CC1AF34B02332A8371694BC036A Auferidoed
929,707,607 *60DCD564F9CA69851984BB7017A94B884B00723C auferma9
929,707,608 *60DA80FE359F37D658BC839CD57FC6EDAB0FA0FC AUFet
929,707,609 *60DF23403C831E78EFB2C3A58844FFC803E9BC8C AUfEV
929,707,610 *60D2996674DE8A25E432EB616B77ADDBD884053E Auffälligeres
929,707,611 *60D84156D1D5DAC621E88A1F38F94FF194C9CA96 aufflieg9
929,707,612 *60DC19CC581C83EBB42586B749809C37C6F43708 Auffuell2
929,707,613 *60D662B2700486C5C1A32839FA657E9B2DC09A39 auffuellbaren
929,707,614 *60D6ECE9A80DDFB8B25D7713A4B96923849362FB Aufgelesenes
929,707,615 *60D8EFD39CB5C29E8A7179AFA546488CF246E566 AUFGEREGT?
929,707,616 *60D62E33829681A175A531D3EAEF5F1E5DE0AD93 Au$fl
929,707,617 *60DFB247776596B3BB6BB67FBD59609057F12423 Auflegungsstelle
929,707,618 *60D37CD061FAF7779642C2C14A358224E4B49784 Aufmachermeldung
929,707,619 *60D8912C5CD053DB38B9FD0E1D42E382C232ABD0 auf'mland
929,707,620 *60DA63BD32654088A7E96A0D1B84FF6DF3D13BFE Aufnahmebestätigung
929,707,621 *60D3DE7C7DF6AD39161980EE08F5BB382C1BFC97 aufntnerckfam
929,707,622 *60DA32E82C32F4ECB515D47660EBD31678FDD651 Aufosbsw9
929,707,623 *60D87C6772FDF42AED82B8A748EA9400250D9031 aufriateluder
929,707,624 *60D38B041452E58735B651DAD5F6C481192B1117 Aufschlußmethoden
929,707,625 *60D55C9A5255F16EE4C075F36AACAB21DDD420E0 aufschreibsysteme
929,707,626 *60D5B6AEE226E0E3775058D38265A5D628AD012E aufsichtsratsgremium
929,707,627 *60D7644DC1AC25D9DA258CD31671EA41E1699D5E Aufsitzstange
929,707,628 *60DD547883B069EA8738FD49E5FCFE440D9812A1 Aufstellbar
929,707,629 *60D5BE1C309529D9208545564A70D002D0F35BBA Aufwandes2
929,707,630 *60D0B05A1A838E3B24964F92C007E2421800F7A8 Aufziehts
929,707,631 *60D67BC0906EAC3075D4D031F8FEEC1C43BA2E51 Au%G?
929,707,632 *60D820B0C44266CE476EA66250E3508464AB22D3 AUG1661
929,707,633 *60DCB828678AEB435B0984E7F79F5AFACE042894 AUG508
929,707,634 *60DAD1820707110F2D44547A4A51D23FE9F0FF07 AugdH
929,707,635 *60DEDC2D4D7512A8E894EEC24E333EFFAFB0ED35 augen
929,707,636 *60D1585DC21A1BE7821AB5961399F2553584669B augends3
929,707,637 *60DD8A3775881BA0BD52974586358164DD71B7F9 Augerholing
929,707,638 *60D199F2D69B372200AF18C77FD79372FC08F263 Augers7
929,707,639 *60DF39AD8E0E7A77D7AEDB8EBD90FA76EAA1A1AC AUgH3
929,707,640 *60D2B59BDD6EFAC189B25A47544E0407ED64CBF9 Augitnoc3
929,707,641 *60D2B6800FC4D95D1C1EDEAB44EDA4D5739AC495 AUGMENTEE.
929,707,642 *60D742D0EAB335E76EE7594333352F6A42A3893B augmunch
929,707,643 *60D0F13A73701BE01AB1E98B1836C6B0EDE18AAB A!UGN
929,707,644 *60DDF937CD639833CC6FAC5C6E5971EBDF93AC5B A:ugN
929,707,645 *60D0F04B74E49F80A606816ED899AEEF15AAF46D AUG
929,707,646 *60DBEEB82215E46E1EE5B438296B0AA4B213A51F AUGRADER
929,707,647 *60D1F278A29687FF4F68F424B4CD6814F1A86A86 AuGT#
929,707,648 *60D255BBE34AE1F70FECB3FDDF2FBADA1ACBB3E8 augullaliì
929,707,649 *60D4BE0981ACB54B782F7925904FE65A52603D6C AUGUN
929,707,650 *60D2AB2690AC4D1E13F1153D471DEFC62645D39C [email protected]
929,707,651 *60DD4E92457892D07D32A070870894D6F702F4B7 Augurism8
929,707,652 *60D5A29BA3C62377F2DC53F12D2AF63E6959EB01 [email protected]
929,707,653 *60D121DA2041564BD8FD10C1AFD385174695A869 augusalis
929,707,654 *60D6BEC2E368DE6B02E087D8A6CBF5892A780506 [email protected]
929,707,655 *60D1A6BCD52D311EA6C4A0E1E8615CBB843F4224 !augusta
929,707,656 *60D92248845B5BD63F600CDDFEDF12BDFA4DF18B august.alstott
929,707,657 *60DD6818A45AF59F6CEC955A8080D8C98DBFBDD7 august.armwood
929,707,658 *60D80B83E6493EEEB32E9385CC7963E70FED0554 august.aronowitz
929,707,659 *60D380F26DAC523504F6585DB5D615326D88F48C Augustavą“
929,707,660 *60D4B740E15C604568FA87F482FDD9D7B128F06D august.burgener
929,707,661 *60DBF238CDA09CE9BBF45416E89E4FE88CA7F6B1 AUGUSTE1221
929,707,662 *60D5FD84B8ACDC3929C5A13D6DC1E613D84B8D22 Augustenbnr
929,707,663 *60DA5A0AA535549D050E09267771E914066A454D auguste-viktoria-platz
929,707,664 *60DD0E8A0F48C26245A45F21A395B3AAA4962494 august.feichter
929,707,665 *60DCADE00C0A5370F4D9DF1E969195035F70C9F1 august.flakes
929,707,666 *60DC72FB5DFDB005F8BFEA5EFE9B883736CD87B5 august.gruiger
929,707,667 *60DB80271A080C2A815B6F37424F1B7D6C154862 august.hemminger
929,707,668 *60D3DE691BA0A2A55092B8B93F0FFBA3393009A8 augUstiNe
929,707,669 *60D582CC215032DE41F2948ABC03621AB691ACD5 augustine.berish
929,707,670 *60D838B544E9C00B08D7B39AB1CE7ED0BDD954F3 augustine.calfee
929,707,671 *60D60AA86478762B3033CF2095973223C8B4C369 augustine.ebert
929,707,672 *60DE20B0D2B741382D3DE013BDDAB08FC492E913 augustine.ellner
929,707,673 *60DD9A14FBF2EBC3EAD04933781C6D3C485D3B87 augustine.etheridge
929,707,674 *60DF83FE51BE9ED9B7C80464D8207B838434B2E2 augustine.gaarsland
929,707,675 *60DF210B17E8EC9C1D1963C2E453F60EDFEFC15C augustine.galuski
929,707,676 *60DED170446BEAEFF5EEB5DFA452B7FDC48E4D94 augustine.greth
929,707,677 *60D536172F26F616ECE019A45961DC6B1B765497 augustine.hakanson
929,707,678 *60D77E7461998EF09278BA52960BCB799A1ED9EE augustine.hier
929,707,679 *60D8AF1577EF51C7402FE3DEB5F80B7112CCE390 augustine.lafontant
929,707,680 *60D0AB9FDDC4D36B236F1113C304D13B7EABB5E3 augustine.lannier
929,707,681 *60D080826C5FD4CDA89FEDA756B623F4F46C6378 augustine.mccornack
929,707,682 *60DC8B26ABEB6E98891C22282E96B42062A9A1DF augustine.oeltjen
929,707,683 *60DEFAAA885EF7B41BE033812CD679A0F5E42651 augustinepower123
929,707,684 *60D9B07A053366AF84295239FD5B3EACD43E4534 augustine.rosser
929,707,685 *60DBD4627E1841B3287BAF019930EE60E072A292 augustine.sakshaug
929,707,686 *60D7E5F3EB7B5CA3B0E49400F29ABF787F2E0A6F augustine.satterwhite
929,707,687 *60DD007FB9352878BE7CB816446A337E26F79E88 augustine.sier
929,707,688 *60DABA8FE69CCDD5C44D5E081139C67AA80DC641 augustine.sothen
929,707,689 *60DFCF2B4F9F822E4DD5D31FA7C76572580DFE3C augustine.stiebel
929,707,690 *60D3B4CA65CA1D995F7805FD2B003C21BA6F3450 augustine.sundstrom
929,707,691 *60D3F1949062E4B9AB6C5C3F16E3DF98A1089417 Augustische
929,707,692 *60D0EA09A00E288F5065CFF5C2C641372CABE327 august.kounce
929,707,693 *60D5947D877DC08C6D6AA38928EDEFCFEA584E94 august.mancherian
929,707,694 *60D966F7E49E150840192A4CBB820044EC598D7E august.mcgann
929,707,695 *60D5EDE5820D1268228B4A041F2D4B2BB4F605B3 august.moorehouse
929,707,696 *60D5816A5C39D0194F7B0E9B862B325B240AEEFB august.novacek
929,707,697 *60D94F02BAD5FE07E4DC1EAA2973334DD2DDFA23 august.oeler
929,707,698 *60D3191E61EAC4129CEEEE93771005B55C259E3F august.persson
929,707,699 *60DDFF704B283003FCF8A92C8509E7B656639CD8 august.prator
929,707,700 *60DD8DB6C7516CBAAA1CBFD88C2C5D4C1DEE7975 august.rodney
929,707,701 *60D996532F4112C75025BFBFA3201AD2F815DE72 august.sapinski
929,707,702 *60DDD3D3E74B68F7B4F5C14726EF9E0EC7D764EA august schaefer
929,707,703 *60DDE8C0B40ED60304D920664E88330C51EA4740 august.swendsen
929,707,704 *60DE4662A2456AFA5B0553769C26EF1062F42918 august.syzdek
929,707,705 *60D474A4017BE4F383D589B21454C9990172CB47 august.tasma
929,707,706 *60D85B985FBF022A8C7A03F6E6EAD40655C27346 augustus097
929,707,707 *60D5D1A3CA0DB009FF7BBCA58CF2A818AF0A87E8 augustus.ahr
929,707,708 *60D743F946F8817A1A324651561018B911716570 augustus.annarumo
929,707,709 *60D788E7E3A2BD68C21E255C6BAD2E6CFA5D654E augustus.beer
929,707,710 *60D6FC5A0033B1A7F58D30A37180C4514A01DBE3 augustus.dulaney
929,707,711 *60DA7538924C2D218B63312BCC4C4E515784046D augustus.edmisten
929,707,712 *60DFE7F0B6101C6817167CAD63FEE74609CE762A augustus.habersham
929,707,713 *60D63D36DDEF4FA9AB25531A99FD7B4C3FE535EC augustus.horst
929,707,714 *60D32C812CFB721EEF0BA0A01E108CC23DB540E9 augustus.kline
929,707,715 *60D8F24C09D9C8FC799DDE21D0ECE08DA6B9B596 augustus.kogel
929,707,716 *60DE829EFD3D62EF5F2BFA61F70594329DCDF491 augustus.kurtulus
929,707,717 *60D6726AD12874F68E9B37C85EBA3A87476C1B00 augustus.laduc
929,707,718 *60D76A5DB9D7B3F44A01FBB57B920A4075A7D17B augustus.lawn
929,707,719 *60DA579C686A3A3E4952097B2A1F5F60962F40F1 augustus.livley
929,707,720 *60D51E6B1E9ED6FEAF5EB04EF5CF826C4902CAE9 augustus.meisinger
929,707,721 *60D1F00E6BBAF8613354D1B210181D10DFD72315 augustus.newcomb
929,707,722 *60D186F1E81EBB6F39BBA3B833BDD28913A2569F augustus.plotz
929,707,723 *60DBD88B63732994D0313EBC806F7F12C83BA9F8 augustus.rantanen
929,707,724 *60D933BF57EE4D8C76A34A1FE04B94777563B8E1 augustus.samay
929,707,725 *60DF5C7C63E900BA4F602FC3321CF51F099548E5 augustus.scroggins
929,707,726 *60DAB85FCA40F2CF4515035C3327BBBEB559BE0A augustus.shearn
929,707,727 *60D909850228F4B6C3821C10589CE3D400BF07D3 augustus.sheltra
929,707,728 *60DB5405591EC744D0107D0B7CE33EE9A76DBD5C augustus.siddons
929,707,729 *60D68956145F4334A541CE8E46F23315492B64C9 augustus.tenenbaum
929,707,730 *60D76AF90B84787CAA04907FA7566E11FEA3DA19 augustus.troy
929,707,731 *60DE569521DAD8CC8CECE8118F4BB82158928C70 augustus.wackenheim
929,707,732 *60D7481A904FC9B8814767E01E44B58166E3C9FB augustus.wallentine
929,707,733 *60DEEEDF2FBC017C81055182E9956D440F84D0B1 augustus.weyrick
929,707,734 *60D906DBE7A79C60F6C1302E48BA7AEE448B760F august.watchorn
929,707,735 *60D426BA15220C3847207CF1E7DAFBACA6097F9C august.winterstein
929,707,736 *60D24A03EF313DFFD22610765E776F4C6F6824CE august.wissler
929,707,737 *60D4F4A430C3978F9A3C769EB5691BB04C0F3E06 august.zuchara
929,707,738 *60DD159722F62A5D7326D5EA7FE522EE9804D2F9 Auguswsplatz
929,707,739 *60D302D7E5D2A7B50E376D0D50019390E2DA3308 Augwabsw0
929,707,740 *60D2D21B7FF04D615A18B315A3A5ADFCE9715E96 AUGY-
929,707,741 *60D01BA558F4AAB20C3718857C59792E05217130 augyust
929,707,742 *60DE484CE0BAF49D4998E0CF701EFA2612522573 AUg_Z
929,707,743 *60D0DD63CE96A28CDB573C66915656DEBFA9B653 A"U-H
929,707,744 *60DEAAA0C6C71C63C9D03DE998D0AF2048C5EF16 A_;Uh
929,707,745 *60D6CB0F98200DACB48D69D89F314DA64F76EF87 AuH0G
929,707,746 *60DDF748D2166180CF1FC86AB9DA9D734873DEE3 Auh4=
929,707,747 *60D213835BF7ED3857963FD341F7B094F315255D AuH7Y
929,707,748 *60D294B44D52E296EF1F3860ECE774EFB348A9F1 AUh;D
929,707,749 *60D8DE3F036D32F1517E53E8F5442D97A1FD1EAE AUHMB
929,707,750 *60D964B7B8E48033413BCAE539E26C8CC838D88D Auhq%
929,707,751 *60D84F8BD304A39C6F65D4D27FB6F05E04580337 AUhursthall
929,707,752 *60DFE641014A9D574740EEDEC134E9BA8C94244F AU$HY
929,707,753 *60D4D3CD0DC198B25626851FCA81EFEC68696C3B A-UI&
929,707,754 *60DDE68FB04BC6A6382BDAB8026DB3B1617EE242 A.(uI
929,707,755 *60DDD1164804331128374C21AEFE5728EDD19F1A Aui[
929,707,756 *60D46AD9C5B3B54FF374F9139A1E70C259737A4E Aui+4
929,707,757 *60DF3B03B88F76CFD4A0399727429A2180506E9B A(Ui5
929,707,758 *60D56ECDEFE043A5137F2DDD3A03EB2F4C616025 A-Ui8
929,707,759 *60D0B2C866B1375C9417AE3A03076DF1EC9CF587 AU"ia
929,707,760 *60DB76E850713013E852F809D23D9FBF156EA035 auiatara5
929,707,761 *60D28D9AFA912397AA866AAEF25D80B0B917D496 AuiBs
929,707,762 *60DC79C4A1005F73E72D41CD9694782AA7444113 AUIH8
929,707,763 *60DF5EC6D29C29A690315C198CEB24A2C8146E30 AuIIE
929,707,764 *60DC932095D7E15DDF7094DB0B86FD96152E0614 AUIIu
929,707,765 *60DAA81829FE131B6CB64251440E2457BE704F35 A.UiS
929,707,766 *60DBDFDAC641B967B6525B5E2DE45249703E2038 A&uIt
929,707,767 *60D64D3F230CD8E4B12A8C674A1382632B2146F0 A%UiW
929,707,768 *60DF2242C7F22F4D5C670C422CDBF53FC7C1B962 AuIXn
929,707,769 *60D962E9E6EC49C0CFC555494E24DC69A4370B4F AUIXw
929,707,770 *60D7021A27F63C682355799D6DC8942B34910092 AUj_%
929,707,771 *60DDB2FBCEB35DB0BDF0864AE66C237ED5DDE228 AUj5$
929,707,772 *60D129B5EC62C51207915A65596A244498F4D9CD A"uj9
929,707,773 *60DFB71A198CAC8A0187261B35DC3E4A873DB10A [email protected]
929,707,774 *60DD0B7EF587CD344F81272FF31B6AE5F9BA8B54 AUjIj
929,707,775 *60D9C4E13ACA286194DAE3D42A7703701EA0E20A Aujm5
929,707,776 *60D3B08533947EEE6DA51A8A892480CB03ED1B86 AU?jX
929,707,777 *60D44C25F61A60D31C1226AC6FA368CC10376561 AU;K3
929,707,778 *60D4CDC6BDFC8C1C8F66894373FD6972420CED44 AU%k5
929,707,779 *60D8AEE4F166A4193DF6831CF2B54ED80E7ACBD3 Aukamihc4
929,707,780 *60D192667ED4642DFBB60E6395DA5ADF6FCD0EF1 AUKASIDUR
929,707,781 *60D0D279D4ACB6EA93D03BDB6788ED3AB5CA6B49 AukHO
929,707,782 *60DBA48846481379D58DB7A0CC0E820C8753B079 aukkaaaaiaaj
929,707,783 *60D90F4CA7E842C81DAC6C3B84E9DDDB18E5FA4E Aukohus
929,707,784 *60DD927D6C036CF40F529B6C89791BC12BAEFDE0 Auktion$
929,707,785 *60D3178CACF469E0DF7DBF81C0C06591ED166405 AUkXY
929,707,786 *60DD7056603CDF46DDEC0CB5DE3F149B8211613B AU)=l
929,707,787 *60D9F94ABF6817B694AE4892D4FCB06559C4EF9A A;.ul
929,707,788 *60D3B2A7F20B3C71A7C779E5656CDEC845A84445 AuL)7
929,707,789 *60DB256E9AC5EEC55B38767444B0DA42167A52CB A+ULA
929,707,790 *60D72EEA529DD36AA4786212DFBC38FAD559306E [email protected]
929,707,791 *60D7A69EE9DF62C82054EB650989EDB2FFEBE828 AulAb
929,707,792 *60D1CEB4C44BD64FF636C60CA5B9D795AD9D317D au-lang-stub
929,707,793 *60D1146C625A8EE1D8F89C03E8CB84F09EB13516 AULAo
929,707,794 *60DF1A78408BC658AB37F2A1AD155E5CF3BFBED9 [email protected]
929,707,795 *60DB772BA26E42A33CB4E55CDD58093B1E48FD48 AuLc/
929,707,796 *60D6258DBACB04C2F6AC9E6CA57A6933DF837FA8 [email protected]
929,707,797 *60DB9FDC221425A27F5BEB0C58FED6753BB09F3A AU!li
929,707,798 *60DCF19BC0FFEB82FEBD1DA080C76988056A435D [email protected]
929,707,799 *60D106A72A083739104A326D530FAA2CCE948A2A AuL.M
929,707,800 *60D7D630CD1D43C118908CCA9F71D8A338E1ADBB Aul#N
929,707,801 *60D2BB6E77C4074AA9E68145FF399EABDD66B2FB Aulogis2
929,707,802 *60D2D767528892C4070C54BD4213F387FEE3B604 AulUt
929,707,803 *60D130598C47F02648C0A0DA2B44093026D69ABA AuLwI
929,707,804 *60DAA41055CFB7AD73C960D7B8A9B04E0582974E Au&m-
929,707,805 *60DC8D3F300F9639AB9BCAFFEB78B244ACA20635 Aum4/
929,707,806 *60D65320FA0C6B62AFC64C7D8C757988C223A420 Aumentava!
929,707,807 *60D2B98B097FED4FB1D024500A96594179055676 aumentopeniano
929,707,808 *60DB16A751B373D94A5B6D52302F08D6BD3D2FC0 AUM
929,707,809 *60D0E4EF93A822EC52AF16145A50A16C6D464FD3 AUm$l
929,707,810 *60DDC1FFDC3D5B8F9B372F44A3B5CA0B23939AC8 Aum(l
929,707,811 *60D6C46C37E340AAB3F2FCCD76B2DD58E4207D12 AUmO(
929,707,812 *60D3F2F99E9C3A8123EC51D86F22DA62FA2A7E64 AUm/t
929,707,813 *60D1BC8340FE16B0BE32C5171FEEDD6FD07309A9 AumWp
929,707,814 *60DB6E39437AEB1A781F8E43A46B83DAA165E229 AUMYY
929,707,815 *60D8A58A6D3D94CC5B33CFD35AE28A15879DC75D A=Un!
929,707,816 *60D7BDF9DB0E25DD099FBC1725BABFFE0DB15E97 AU?n=
929,707,817 *60DB9BCF2460DE41C22EB1C9C3586E046AF3CCAB AUn=?
929,707,818 *60D5CAF5640713D6FCD774C59E1288B098CA4EDD A/u.n
929,707,819 *60DE13842A42D41FBA4122E18A48602C6E949CCB AUn6R
929,707,820 *60D8281F7C12A92BF95A92C42075EFFEA5DE4CBF AUNa:
929,707,821 *60DC781BCE4143097EAF64075991AA2B1D830681 AUnb!
929,707,822 *60D1447F1B10B5E936162EEE8E937545A46AF3C0 Aunexalu6
929,707,823 *60D00DB47EC1032F8E08A0E09EF3C15D6F58084B AU:ng
929,707,824 *60DFDF3EFB2EC1C1936718BB34E19F6A5B890C24 aung nay myo
929,707,825 *60D963982DDD635878B6C1002AB740AF2A0C6020 Aun+h00d$
929,707,826 *60D4236C22F9E51CF82623E47BF681623BB34B88 Aunknightliness
929,707,827 *60D13F2BBDBEB9ECC6FC808C007B56200C3B487B aunlyaunu
929,707,828 *60D9869041F93EF43DEB39208A55829EE06CFF9D Aunnectareous
929,707,829 *60DFD133A30A1D71148AC597AE1FB5D4D532732B Aunoz
929,707,830 *60D37DAF43ADA61895AA626E60C0CE4D2AFF40BF Aunreaving
929,707,831 *60D072698DBD3395AA2CF65726FAFF6F7A02D2D3 auntavel
929,707,832 *60DEBD053363B2901B400E6E8576323DE79ADF82 Auntrin0
929,707,833 *60D22CFA86A0B1DC1EC7A82D983B9E539069B62D Auntune
929,707,834 *60D19ABC80D46720DA4AFEA42B81FD75B1A3CAF3 aunty cath
929,707,835 *60DBC523DAC5DA10B7902B46880D597810E20946 Aunvwatu
929,707,836 *60D576671E67E1943D7E2B9F1B2F233DEB72F785 A/UNY
929,707,837 *60D25BA1AD2881AF0438D376C2C4E42B09FF4384 AUO66
929,707,838 *60D19380C1FFF2CCAB58E2E359B284717191C6A7 AU-OE
929,707,839 *60D817EB68E6C63B536F9E21AB0384F5C78F8509 AUok4
929,707,840 *60D7007FB861EBB995591E9B94CC1B49EB390800 Auolant5
929,707,841 *60DAB8FAC650ECD6B92DC194D8897364B5E28581 AUotG
929,707,842 *60DAF86133F28101AE43083901E922EC4DC894E3 auouche
929,707,843 *60DFAA8DDB5B7EE1CDE3D2A2261AF14BAAD23029 Auovqaqce
929,707,844 *60DD9A08E1E59894073B667CCF8ADFA8A3D15D36 AU"OZ
929,707,845 *60D241DDA040F25FDD0E8D6D7A77EE78AD3942F1 AU!P?
929,707,846 *60D2024E1C2C3E044DE40697D70680DF67B03A58 AU%P)
929,707,847 *60D82C10EFCCB43C1A7B2E49A8FBF8FE7D2C0A4B AUp)#
929,707,848 *60D370254938B0FCEA5F1182BD1870F8D56795B2 AuP&9
929,707,849 *60D262BB429FE8BF502F69AB412030387C2D5E94 AUp.d
929,707,850 *60D86D3A8A9E54016DD61230E327BFDD804960A3 AuPdj
929,707,851 *60D2918E87CFA0A28C33CCBB24065221466E05EE AU?PF
929,707,852 *60D96437EA2495C4504453EAD2D80BAA5C29E952 A$upI
929,707,853 *60D8FEE7AA5B9F515B58E272A3D886EBD2A745B9 A=Upw
929,707,854 *60D8D0F76DF450485EB23D4AD340820F8A9417D3 A
929,707,855 *60DAB82634CFEC7C7CF721D791EFCD621E0B4E79 AUQ;#
929,707,856 *60D8245AD7DC305AD2422465F8637854FCFD8F69 A=u_Q
929,707,857 *60DEE7A89281C1D5C9BAF48324782CB6E6EC4C00 A
929,707,858 *60D0FBAE7064710B9907A4EFF43DAAB44264C4F1 AUq0t
929,707,859 *60D79463EE6CA40757FEC61C9C6AF0EA59363134 Au(q1
929,707,860 *60D1A9950CB72441AA0A596DFE18023AB35DECDA AUq!9
929,707,861 *60D21188FD80CE9E50956CD0E7B50F45889BE9DF Auqew
929,707,862 *60D43677632775B4927773EA5740DC2B8738C276 A/Uqh
929,707,863 *60D9BF38F9D60FA4C0A96E0DDFC9A4B96D011E71 AUqHQ
929,707,864 *60DDD6436BEA929D7372C955973E39D3A428AA9A AuQPb
929,707,865 *60D7932DE7FCC1435CC3416328C112C94BBE0196 AuQqP
929,707,866 *60DDB6FD99B4C07229EC0EF55FFDAB19D9E2EAE8 [email protected]
929,707,867 *60D97FB71BF2B6176CD13F797030E14CDCF5205C AUQWn
929,707,868 *60D0046E06A26685CF4F4329DF2E2F586F19EAED A&UR?
929,707,869 *60D7B8D41BFEC85AF00DA7BA5873AD731B69060E AUr%
929,707,870 *60DDBF8ECEBDC1607D47E950430757C80F62C461 Au_R#
929,707,871 *60DA3CF231BE03DDB48AFBFEF98AE881B73761F0 A!uR9
929,707,872 *60D9DDE5995CA5D1C786E20448516D1F9C0C6FE8 [email protected]
929,707,873 *60D4E6E46922F819902C6F7FBC2FEC5944648E7D Aurantiaceae5
929,707,874 *60D3E014EE83E4D8E1289220705B06CA77C67408 Aurases
929,707,875 *60DB3FBFBA0D164C91743A52DF5847DBEAD6700C aurash_ingerash85
929,707,876 *60DE325CADF57A9D14A70815C0B662D7E4142DC2 AURATA5
929,707,877 *60D0868E574E4C38355B71513CAB12F8230DC338 Aurause5
929,707,878 *60D20D5D4C09AC5658270A851422DD9808369609 AUr)c
929,707,879 *60D8ACC106A357B252FEB3F0BC863BBC7376A5DF AUREADSC
929,707,880 *60DA8547A9133BEEC94266CD7745DEDC255AFA68 [email protected]#
929,707,881 *60D7D9C77D1347DE6244EB14CD0D4F3B7E14A17F aurelio.aloy
929,707,882 *60DC98BA9667C8076EF8C300C2FA47B624090771 aurelio.benik
929,707,883 *60D362DC386545E57C8E9806EDDD7B1ABAFE3EAC aurelio.brands
929,707,884 *60DC091D2F14721748604A241E122A3DC1DDB0DC aurelio.ciesluk
929,707,885 *60DFAA0F0B6B914C2D214784C2BEE1DFCDD98C88 aurelio.dirth
929,707,886 *60D0F8DF6CE9340D5F1EA4C7F60B56484F592558 aurelio.doubet
929,707,887 *60DB392FE08D5C65B9F8AE8917DEA2158F29A3C4 aurelio.gustine
929,707,888 *60D4F70A3EB3C9FA746F4ADCD61D231168CEF9D8 aurelio.hofmans
929,707,889 *60D408C9D4B7EBBFB3AAA74D327B32505F8AD1A7 aurelio.lenyard
929,707,890 *60D260F3E150ACBBAD905422EA182D8700FF05E4 aurelio.marie
929,707,891 *60DD01C87F336F6E72C2D708FEA8F5F4E0BF44B3 aurelio.michels
929,707,892 *60D3C35200DC9E7A977A06C63FB79B6B499A0012 aurelio.nakajima
929,707,893 *60D470AEA6E9BB2102E98ECE45306204997199E5 aurelio.pearson
929,707,894 *60DC8FC54F4759A8D04A1C8A0A7A91D3ED318C5F aurelio.pesta
929,707,895 *60DDF24F0878A95454EDC21A7C7599A222526423 aurelio.schlussel
929,707,896 *60DC69E787FB0E29B0F4CBFEB3185DE172D8CE1C aurelio.smothers
929,707,897 *60DE70018AC45FE93DFCD3B69DDA16D02502724C aurelio.thruston
929,707,898 *60DF0A1C2AF229560D0EB6EA1FC7FBF2E22AEC3A aurelio vargas
929,707,899 *60D22456E0A165417221653FB765E454EEC8D082 aurelio.vokes
929,707,900 *60D649B12015B42E2E504C73B4CAF511F2B1170F aurelio.wolvin
929,707,901 *60DE398D23E6DFD3BBE8434DA1C8F12D91E89465 [email protected]
929,707,902 *60D1E230DB3AEFD9CE3DA7474BFA0E3E61F1F573 aureomycin.
929,707,903 *60D9E7C1286FE0770D57614D76A79EE9B1A567CB Aurérien
929,707,904 *60D404F64180D2E10B28F45EDB632C161F9B78F7 aureuscarinatogeckoc
929,707,905 *60D5057B80F3C08AD259A2C789E35B089520DEBA aurichalcuming
929,707,906 *60D0D10D43C86FC34489FE36185D5D8D474DC501 AURIFAUBER
929,707,907 *60DFA14C3D9056FA6B0113C2FF50E2BF21AE2DA5 AURIFIED8
929,707,908 *60D1136C14E2B4ED6556A976D1E41D7947C102F5 aurifyt8
929,707,909 *60DC1A6CB51127B57942D9C715AEE50F8A56406A Auringon lapsonen (live)
929,707,910 *60DA503B997C3CB5DA77D2B68CBB2CF3BE6DF03B AURINKOJ
929,707,911 *60D83566B495E23E570CB7063B96D97D180F8CA3 AurjY
929,707,912 *60DBFE8EE226276F8118DF2A2C6838DF2D332BEE auron1305
929,707,913 *60D3A0B7FCAAA26518E5CABACBDE7E7C7D0D6622 Auroopa2
929,707,914 *60D3E15F1C5E132C23BB9ED50064029C2EE5829B aurora653
929,707,915 *60D4B8D96192F6B54BAAB84873DAAEE05BABA214 aurora763
929,707,916 *60DDC5B02DEC38A430B0338570E35A376223C0CA auroramd
929,707,917 *60DD1FAC12127D8085FCD0C757EEC61FB7FF5AC3 aurorean8
929,707,918 *60D51CB75CD210B6382928E99AA7C6F8CD7D74C5 AURRv
929,707,919 *60D2A462FFADBBAAC17EC88B3DEA78D286EAC4BF aursia
929,707,920 *60DE7ECFB76CBA40FCA2CDD45E183DB3D2AA78D2 A
929,707,921 *60D8C90D659230FE961D040EDB52EE7CC5D2BAA4 A&UrY
929,707,922 *60DBA80776BFCE1692AECD431E8C5CAC2A5E3E1C AURZ!
929,707,923 *60D71A7655BFFAE128D447CEA3BB5A97868A54DF AU$!S
929,707,924 *60D31DB70B9548DD2A4EF9A251D6D296674CCDB1 A%&uS
929,707,925 *60DB806A12FA1F9882AF9BE41DCBC5B6A5BB6798 Aus,1
929,707,926 *60DF1586CFEE4ADE5F66B407B96AFE7ADCB5D136 AuS1I
929,707,927 *60D7AB270954213EA1297A37FD86F8F3059E483E AUS2$
929,707,928 *60D595EEB19037A1FFFBAD5770A85A998E34059B AuS4W
929,707,929 *60D89A03304D1FE44917D78B43BFB0FB51AD528F AUsAu
929,707,930 *60D691C287914EEE2025CAE39E8B765CDC61F9B1 ausbildungsbataillon
929,707,931 *60D484C5BDAE180AA5178B9362207DCB8B2A86B6 Auschla"ge
929,707,932 *60D56AF3FFCA36920C7C5D4324BEC298916FAC12 Auschlussverhältnis
929,707,933 *60DA914A077C7C698357CD2A8AC4D60A7CE34830 AUSCP
929,707,934 *60DB9453964FD96CCAF3C5E8A7CB9A010044EB0C AUSCULTAVA
929,707,935 *60D66B023AC0250EBA791820CBEE32E8DD0C4D4C ausculteraient!
929,707,936 *60D7F6C26B60FC6764E3DB80F60D1E7F990675AA auscultereste
929,707,937 *60D91B2F63AA97E19A6F219BC1E85B35A18811BD AuSD:
929,707,938 *60D8D994CA7529E92435D8FEC74F0BC6896F8AB2 ausfahrtssignal
929,707,939 *60D7B7D07AC60BC6CFC067651F8FDAD4BE18305F ausgaben5
929,707,940 *60D6DE3ECD9E261311B118C96718AE6193247464 Ausgabetitel
929,707,941 *60DB3D3CBAD4A3A60B0A3A1DCCEDABF7E4D3B1CD Ausgangssituation/p
929,707,942 *60D65B3DB5693901A25C5D9443E434AC8773B8DB ausgekos0
929,707,943 *60D1E3246B20F10D03B69489AAAFB0575988893B AUSGESCHUTTETE
929,707,944 *60D4CC2B94BF14C4B739FC6C540831497121C835 ausgeweideten
929,707,945 *60D3B049408E9B0C83F5E04E52D81BB7E6811F9C Ausheben3
929,707,946 *60D4F014E07AE8AD2D326A8B96CBCDB71C50415D Ausheilt8
929,707,947 *60DD2DB687A952E306EAA0CAF1D7202036CCC303 AUSIPTYS
929,707,948 *60DE67A30804E6162702152A368D3586FF1A02E6 AUSJUHLA
929,707,949 *60D5010F6024C392467DEE09090CB2EA37A4196D Aus.L
929,707,950 *60DCF88968A9B3174FFED131EBEB61D7076561DB AUSLEEREND
929,707,951 *60DAB4600317B6AD22825C5206AB85871534A735 ausma"rsche
929,707,952 *60D1FDFAB406F41797DA96D7297E92663CE847E1 AusMq
929,707,953 *60DB8A6403A7F9E1C94033EF8187135420F58F90 AUSNUTZENENS
929,707,954 *60D78BB265D62922172B8EC40F9C678C249D6197 Auspuffes3
929,707,955 *60D9D813B8D96228DF720E45EBA95FCA014E0C95 Ausragting
929,707,956 *60D0FBD69D28FBE76338B5A6186FA10AD41B493F „ausreisserinnen
929,707,957 *60D53BD3A26328826117E0DB0723F37533B40247 “Ausschaffung”
929,707,958 *60D76EE8787BDD98E32E4BC34019DEC8A1E76AF6 AUSSCHALTUNGEN
929,707,959 *60DCD71D31727834C26E75D91D8BBBE0814BF8AD Ausschankpreis
929,707,960 *60DBC61FB48FEF8F65C14601A100097B6A08FE4E ausschichtsreicher
929,707,961 *60DC290F3279A56598099340E5FB38F2A72DF25C Aussende8
929,707,962 *60DA72B6FD92B7E867C1B9E6BE177C5EAAB1111A außenhandelsdiplom
929,707,963 *60D783EAE3382249E8E43E96062BD4E545CE5997 „Außeninsel“
929,707,964 *60D90072C15E67345BDF50A9A09A4DED3A89AA1A Ausserst0
929,707,965 *60D73B7AEB7B9C314A12C12CA91BA2ED502F4C5B „außerstand
929,707,966 *60D1EA27D1BDD8F1855578A62A2E8E910BBB18C2 Aussetzvorrichtung
929,707,967 *60DA024BF6CF1C84FC3E721DCD5F24D44A30B6BB Aussi6
929,707,968 *60DADCC97994D0CFF7B5DBC6D4F0FBD825B15423 Aussichtslose
929,707,969 *60DE5F2AB5DD917C4A5FD9353308A8BC6D7D683E aussiealgae
929,707,970 *60D39AA9D35045E1D18521F08959DB386F75B357 aussiepridemcd
929,707,971 *60DC958CFE54360508F00898783F11433E8B1D49 aussL
929,707,972 *60D73050D01A47DC72DCD55F0517319038618187 Ausstattungsoperette
929,707,973 *60D838BC90A885B00C5F9766518D0AAF6A598744 Ausstrahlung7
929,707,974 *60D20308223D374C669F82F4E16BA0BA83513AF7 aust7
929,707,975 *60D3F6AF44D6DC6AABA73C3D8CCC40455F91D8E4 austalshare
929,707,976 *60D6DE450AFC284E410BD8D871361ACBE271429E austamas
929,707,977 *60D7496615C91DDE0D78095FA95BB7836D696328 austausch8
929,707,978 *60D16CB0ED83346CC9E720BD916D13C4F86FE126 Austauschkühler
929,707,979 *60DEF5B1971235B71C6BA2536599F0DE930081E9 austauschtypen
929,707,980 *60D3F0E30DFEFCA3A5A7F354FB403084FF79181E austene0
929,707,981 *60D1AE2FE5893B82D3B7A459A000D655CC120FAD austin854
929,707,982 *60DA18E91E70868D6C56CC4D058B11A4932F41BB austin.angelotti
929,707,983 *60DEAA896A0179B471AA9EA5BF1848AE2A438B3C austin.burbine
929,707,984 *60D7AE3D25160C1EA2A3CE557BC23A7FED64C313 austin.calibuso
929,707,985 *60DE39E86111E4D6645BE210681BFFB80A66ECE2 austin.canatella
929,707,986 *60DC850028FF665322D78061319F348F35B8AD01 austin.conwell
929,707,987 *60D22496EB1C1118AAB6E4B7DEEFBBAD371C1E10 austin.deihl
929,707,988 *60D065E170BDAF64A8AF9BD8F468F7AB2AF47CDD austin.dietsche
929,707,989 *60D066F009C710A0A1F9A4566C1A3DEC4248E11E austin.inzunza
929,707,990 *60D80B05EA55F613F1530CCA152CFCF95045ACBA austin.kovalaske
929,707,991 *60D79FB2B8C5564C3D4B5FC165B2D4DD7F4444D9 austin lovett
929,707,992 *60DFE60D6C4A62D5D0E532263A6A269681A2A30C austin maddox
929,707,993 *60D067654020183214ABC7D1CB3E32678E8D1EF9 austin.mineah
929,707,994 *60D9AAD79E4100EBEE231EB1380946B3B7BF302B austin.netzel
929,707,995 *60D358AF8461681C19BF2AD00840C0F9F782B02E austinouthouse.comwww
929,707,996 *60DFBFFAF7618247C62271541BCB74C54D59AEBE [email protected]
929,707,997 *60D80024A489E5BFAD89F36BD31CF9F9C4DCC5B6 austinrdrunner
929,707,998 *60D8ED8FD921B2361519CFF710A76763E1C2FAC7 austin.recalde
929,707,999 *60D3C173CA6BA1241C6628E632308E5CFDC7E81C austin.reggio
929,708,000 *60D7D84EE4319987A988F03AF4CA2F6067A08ABC austin.serena
929,708,001 *60DFC05FA47181A74353E2736A7E6D26DE8E0A28 austin.shost
929,708,002 *60DB2C9F431F669A62E033A703004B13AEBC6DF3 austin.slominski
929,708,003 *60D50F42F08ECEFC9CEFB0F03E9029DF2E1905E9 austin.stoots
929,708,004 *60D43D8789F675F50960F061D89213DA92E1A574 austin.sveum
929,708,005 *60D9F0D776805D7917BEB886B139AEF08CFBEA04 austin.tresca
929,708,006 *60DF91A5F65355AC9FEB3EA03B722319CC7CF4B5 austin.verdell
929,708,007 *60D39D6F4181F0839C3C5C08867544DE453B31E9 Austinw9
929,708,008 *60D27799A9811DBE351029201353BF8C2EDA57C7 AUSTRALIACD5
929,708,009 *60D57522616564BF790D5BBA8F9186E46DCD7A75 australiakarrakatta
929,708,010 *60D506F5A62D26A79F77A6D5A48FBABC09F615A3 australian-immigration
929,708,011 *60D1936676924AED4410EE610E9CE71DA00BDDBA australianises!
929,708,012 *60D8825F1DFAF228F8D99DEEE176222D7668CE1C australiaquality
929,708,013 *60DB5F431D05FB9D0535776CCC5F2C76ADDB8224 australias-next-top-model
929,708,014 *60D32A92FBF748C8A215EFF47BD291FF8FCAD3B4 [email protected]
929,708,015 *60D9309C6239639EBC4845C3D352D9F80012FB8E austriacism
929,708,016 *60D060F5F3AEF7F959DC3720ED4528D87A47CBD4 AUSTRIAN-BAND-TEAMS-UP-WITH-DAYTON-RECORD-LABEL
929,708,017 *60D8A15AD9658F928B59CD549FE6DD1F2F6DD6FD austrone2
929,708,018 *60D1747694478284005F49ED38EEB1F238FDA395 AUS-U
929,708,019 *60DAA2915030F2C8DAB9AAA53FCF1DC1B99CA7B2 Auswandererstation
929,708,020 *60D079B8833530C4583E965D1CFB4985E105DBA5 AUSWEIS.
929,708,021 *60D1D38537348FA9F78F9B8CF5E8D0A7891E1E56 auswirkes
929,708,022 *60D8BE48114B8D2DB32A2FAD857C43AE081DE422 Auswurf9
929,708,023 *60D2E82518F026E138B94734285FAED904BDA512 A)uSX
929,708,024 *60D1FFC55ACE10738DAEAA1E0ED499E13AACC424 AU%SZ
929,708,025 *60D59814EFE2E95641588C0DE1E7CA14D24ED8BA Auszudeh7
929,708,026 *60DED0AAB75421F06A6117A46FC011CCAA4174DE auszudruckende2
929,708,027 *60D11B4421E6E834FDF8D021F7B8098EB0C3269B AUSZULOTENED
929,708,028 *60D4EF891D213ED7464118A2992CC6A6BED8553E auszuradieren
929,708,029 *60D84CE6A0E8E420578D6AD50C2B7E9EC40A816E AUSZUWER
929,708,030 *60DDEF7AE3E2522FF4DC7271255A4D3E34EFEF10 aut0typ3
929,708,031 *60D702B04D1A06DB2F9847A0BA00CA74B0A31423 autanthema
929,708,032 *60D351FC3800C9E9EB2F2315C3722D8E9BD419E0 autaprep
929,708,033 *60D7A9758BC0A47FA7493485C56EE1EC291E613B autbarlow
929,708,034 *60DE4A9D6CA6963BD06DA94F1F84D201E7268167 /AU/tcookshop 'k/U/k
929,708,035 *60DF2EB258652BDE6FB256E749EA607669C29C2E AUTENANI
929,708,036 *60D45D6899D2F0228AD412CC4A905DBCCC7B2E2E autentificars
929,708,037 *60D5BB454113738F20AA5A92B072FB9F08C7650F AUtF.
929,708,038 *60DEFA95852C38518DDC75F9BEAA597E85A07309 authentic4you
929,708,039 *60DDA286F5020090B306CA4DBC8EC0E38C3948DD authentifizierungsmechanismus
929,708,040 *60DE6A36F50723A83F9293CD1933ADD75861499A authie_calvadoshas
929,708,041 *60DD3532C359E3830E10383AAF7B82190A37604B authoracrane
929,708,042 *60D1955DF8999E4DBF87D43E1310C98A1AF3202E AUTHOR-INTERVIEW-UL-HARPER
929,708,043 *60D032D34A85F5141CF6FFBC9E3EC58C5ADAEF71 authoritypakistan
929,708,044 *60DB84662B11644ACFFF0FE50BCD86D03076AE66 authorjoram
929,708,045 *60D609AE0285A0C925351D5B30C27A7D98B8D00E authorkelisi
929,708,046 *60DE335C6464394B12ACF5C23D66419CB0DF0966 authorkustedjo
929,708,047 *60D4F27B57994D611F2F657E4B49F8F598AC211D authorraleigh
929,708,048 *60D38AEFBE32A1DDBEBA064C0E590766835494AF authorshimoda
929,708,049 *60D652F282D3C927012F1CFD69ACBAF242337688 authorship66
929,708,050 *60D95EE1EF400F93919788FEF4CD7C9E9E59BA23 [email protected]
929,708,051 *60DCDBCE1741CDAC8C181DAB9DB879D42A6DC284 author-text-reader
929,708,052 *60DF7B0C5AFDC4CF1DEE7ABA20359685B5E1ECE6 authoruserthernlund
929,708,053 *60D3C30C7AFF183DA79152413AFFD5715B256A27 authoryagasaki
929,708,054 *60DFD31BAF03681014AC46132E95B59F3A3ECAB1 AUTHORZXCVBNM
929,708,055 *60D3FB1015481AE98FC29A08F7D5D48BC01676DD autirización
929,708,056 *60D0C7E47AA48AFAB265E31A31335AE5A671A8C9 AUT.L
929,708,057 *60D7AC75FFFF7392B5DCC3F2935CC00FEC37C2D5 autldtps
929,708,058 *60D82D5CCC4CDD6C80D089C106B31B3E1B07BF2B Autlieva2
929,708,059 *60DB680FE9BDE55028E083D8802D5D59C3601270 auto3x3c
929,708,060 *60DB4D3BBB1C43D37FB99ECC1FD38F09934F6B7E auto4495
929,708,061 *60D52C9BC9BC13EA0E973D82077271265998EF27 AUTOASSIMILATION6
929,708,062 *60D08388DE7384A6EE7FD5A26FC50F75AADA90BF Autobiographischs
929,708,063 *60DB53FDA0500C54C5A876127E006DE182193C41 Autobusiness
929,708,064 *60DAD287AE30E62530F8134EC94DDA9FB1685AB9 Autocar197102
929,708,065 *60DB796E529D4E2CE384BC29B86250316D71B458 Autocephaly7
929,708,066 *60D3445F24932A8CABBF8552275214B93F27DDD3 autoclassifiions
929,708,067 *60DE41833EFDCB36F83395CF203218084C863793 AUTOCLAVE-SAFE
929,708,068 *60DBF382F32AE1890BFEA317EED33611CF6E6099 AUTOCOMPLEXES3
929,708,069 *60D22ECDEC854FC0D9A14E6F660E471BC584DC8B autocopilo123
929,708,070 *60D072A7C55EE090FBA1B6554061F49826552E1E Autocopr6
929,708,071 *60DFA9D82D7EB6C2D44FEE3ECEA1A59667292540 AUTOCORRELATING9
929,708,072 *60D22D7EA8035338D1950C400E6C9F63C70CF6FD AutocsUNIieplyon
929,708,073 *60DF46604C5DB09BD03925A06F7DC13176C44A79 autòctons
929,708,074 *60D02FAE7197B6905E4814910E05211FBB4D25F3 AUTODESKVAULT
929,708,075 *60DF2FEBD60E71CBDF4D9091B550F82635129E1C Autodex1
929,708,076 *60D5F13918D086975757A3F36D547EEEA3CE3311 [email protected]
929,708,077 *60D2FD714ADDE1CD7A301D4283055DE19CC2DCCF Autoedut6
929,708,078 *60D5FA79FEEE17FA7417A2118FD2903AA515F4B7 autoestereográfica
929,708,079 *60D94F1EA1F1ED4ACF4F8D4D4996BA41A298FB5A Autog3n3t!c
929,708,080 *60D586F7D268AFD5A18477FE8071075D92963649 [email protected]
929,708,081 *60D1B84583AE586EC911E25EA679087ABADAEACD Autohete5
929,708,082 *60DD4397945B467D2DD893CE5EE655108F3E9394 autoinfusion8
929,708,083 *60D33664CA9EB5CAC325DEC4BBC256CC4343CF4F AUTO-INSURANCE-BASICS
929,708,084 *60D77659D17F38B2B4C40C1CC3835928C07D7E2F „Autoliv“
929,708,085 *60D6D743382F0FE674A09504DCCC0A14E0ECDB24 [email protected]
929,708,086 *60DD19836C67C6F022F44806BD89B7BC48A60AF9 Automacy3
929,708,087 *60DBB486FCD6FC5608905E7C9FBDA1298EF45048 automaticly-generaged
929,708,088 *60DC1DBBB2807F926A98753DADAA7E50EDA310EA automaticrecords
929,708,089 *60DD214B81D7801D073F95A5F30B96BA736BFD9B AUTOMATIKFUNKTIONEN5
929,708,090 *60D04AB2E61761E7ACCE17B3D4738FBAC76671CD automationlinear
929,708,091 *60D36A5271C8398C330F229BE11F40AA940AE9E2 Automatograph2
929,708,092 *60D79D0A35C482591377BA3FA51451847D6598AE automeren
929,708,093 *60DBEE133211FA01ECA07B56F2DE3B9511ADA175 Autometr9
929,708,094 *60DDAA97085F3514D3E16C730213E9E7AC2BB2C3 Automobiliais
929,708,095 *60D070629E636F226236CB52FB0081A548F1A9DF automobilowych
929,708,096 *60D77AF9E04291D0212F5345A3B0901C99E4DD9D Automobilstudien
929,708,097 *60D7EB363DB4306241AF43A35E9B0812F0AAE8A5 AUTONOMA9
929,708,098 *60DAAF3A41353345C61713FD92BC76C0E3C79842 autonomašica
929,708,099 *60D6D4C45AC51F5C4B1AFB4A80357B39A98CFA40 autonomizarlho1
929,708,100 *60D7F0F72FC213E421D6083F38E524A761FEEBB9 Autoparks5
929,708,101 *60DA5C233472AC51D567504BBB33B43DF4204C0D autoqualifieras
929,708,102 *60D04D94AA093EBE6497B1DDB1ADB71C3AFF34AD auto, race, pro stocks road course: straight away
929,708,103 *60D8252C1871FAE209CFA5FAD2CD330F4F04ACF5 autoréformasse
929,708,104 *60DAB4C47A1E52524CC6F8006B2DE860229F3776 autorek1
929,708,105 *60DF3C58EDEA2933FA967F41D0F4E6092B3B9833 „autoren“
929,708,106 *60DFFB4B90B580614EE1D83D7D22E2DF24C96324 AUTORENGE
929,708,107 *60D9E6BD81AB25C1ACE8AC4C416B113576E5A555 AutorenSR
929,708,108 *60DEA410A0D073A5C5A08695687D238A750CB637 autoriser6
929,708,109 *60D1D44CE4CD090D0264B1EFA220D88263F87429 autorivic2
929,708,110 *60D157D32E257ECD1059EAEE1974B6FAF6B2D23D autoruwendo
929,708,111 *60D763428809CFB607497EF9352BCAF51769CE9B Autosomatognosis2
929,708,112 *60D8F5E11CE2B109464F07EA3659C00956998D32 autosoteric8
929,708,113 *60DDCDC66E3C673C4744B1C355C4F4CD297A6B25 autosputnik
929,708,114 *60D464FAE0B6C967197340A2532A33C1689E86F9 autosteaua1
929,708,115 *60D3D172A7558F7D2B29DF1B6ED1D550D9BE8D36 AUTOTOC
929,708,116 *60D3E8A4817036575B02819A0893537D2C255E08 autotomiasses
929,708,117 *60D73CA8FC8C1760A94F8418DEEC97D8E9D09535 autotr1plo1dy
929,708,118 *60D792620A57839D8B164DD9BA6753814E22145F autours8
929,708,119 *60DDDF5030013B815FEF29718472B675518B0F46 autoverhuurders?
929,708,120 *60D76134562F2039CE7518D200661814242A9B45 AUTOWORKERS-SSKU
929,708,121 *60D6416A1BAB95164EAA4207AB434601B71E3D6B AU+TP
929,708,122 *60D5A448E1A4F9A5BFC39702C18B0B87B8631DA6 autper
929,708,123 *60DA4EFD5560FC208F2DE67138FC645FDAE5950C —autrefois
929,708,124 *60D5DBCD1AB944D87F558C5E6E849E774B920CA1 Auttanev9
929,708,125 *60DDA3BF8F81DD4143E7B271D4BC43AE0AA8CE5C AUTtn
929,708,126 *60D26D8667D641B22A324E5908EAC2EB58FA22B6 autumn817
929,708,127 *60D3DDC55BF522AA9B36BEE5FE905240B859626B Autumn Glow
929,708,128 *60DBE8663EA1FFE912A01B7C7D706CF462E847BD autumnguzman
929,708,129 *60DEC60FE467E4A4458A345D897AB47F7E5D1EE2 autumn-hardware-innovations-for-ytrack
929,708,130 *60D75DA8980C4A6FCEFA54D302AA80490127E2D5 AutumnLeaves/SpeaktoMeofLove
929,708,131 *60DEF62F90DDF9EEC85EE1794040030E23F23D37 autumnplaying
929,708,132 *60D79A87424D743D69D0D58F90C1028472A478E0 Autumn Tale
929,708,133 *60DE775C59C3BCEC4D22006147A180DE9854A23F Autunianing
929,708,134 *60D1E52961F20995A617FE67048DFCD8A91C86F7 Autvk
929,708,135 *60D369A712204B9741AF68D142318CE507A8F023 AUtwf
929,708,136 *60DDCAA7F94345F9673AE1A0BBF40E6B3B4A66AA AutWh
929,708,137 *60DD2D5319E27DE78C935EBB00C8310501CCB13F A$U&u
929,708,138 *60DE0C71E421828B506148F6BC78768D1AB614AD AuU=6
929,708,139 *60D1CAC1FA19BC3B6027EF744B9D787C0F1C5C85 AuuaV
929,708,140 *60D9B0C28F2AE0D1C063369642E7902879354FCE AuUc&
929,708,141 *60D2D02E6C3E8C2F828701E077150123A6ABDDFA A.UUH
929,708,142 *60D6A9FC01F4B0BD34DAF11B39761F52E60F07A1 Au%uh
929,708,143 *60D672A0794815D02C0AEC18DAF33845B3A03AA0 AUuhI
929,708,144 *60DD3CF15F2011CEB05AF947326B1B1450E78362 Au
929,708,145 *60D5E5A938B1ADCABCF49C6DDEA966967CEAAA68 AuUov
929,708,146 *60D0FDCCEE0386A266C0BB34369D3A50150F8E6D AUU#P
929,708,147 *60DD81768BA73B6323C68E5FBFE6F85A2708BD24 AuUuU
929,708,148 *60D7295B4D76B17BFE1F79AA510DC2C9BFCBC26E A(u%v
929,708,149 *60D741C96345D9DCB8C04B8017FA3696F672567C AU-vO
929,708,150 *60D12702AB8903040E6D18006766FDED6DB794B4 Au)vp
929,708,151 *60D38B6D1EB328FD592529B1A4CAC75542967502 AUvQe
929,708,152 *60DA93D0D944CA8553237735329DE2C0ED1881D6 Auvresse5
929,708,153 *60D9B752495929C08CFF70D85915869DB0314246 AUv$V
929,708,154 *60DA7CB23E6771ACC78BC9A3EB73BAAB561B4FB1 AUVwv
929,708,155 *60DD672AB14932DE9BE0134574D74F8BFDCCE52A AUvXp
929,708,156 *60DE34DC5B17349F8C52584F8291F628DF508648 AuW/_
929,708,157 *60DE6C858C09C7D503E9CB45A41FF60E2B3D1E7A AU-w5
929,708,158 *60D057F8E906B6B5D2AF1C96FBD6654F0DE9A4EA AU%w9
929,708,159 *60D3D0C4E1E04EB86D06A2EFDD2767FDF769A7D5 Au#Wc
929,708,160 *60D1499CFE1EB5286C54852A7D97A3E9A91A7C6D Auwc3
929,708,161 *60D468AFE1405AE4FB32A2F72B9CDE852229B4F5 AUwD3
929,708,162 *60D9EC85D823461DA8198E49A8C45261123D8E56 AuWd4
929,708,163 *60D4798197DD8A99812323F2EB0A5600D620D028 AUWdN
929,708,164 *60D16B3A353D54CFE70DB1DDDEB1D35DC196B7E5 AUWIN
929,708,165 *60D968A0ADF2851898AEB114BB695BFF3B45353F Auwk#
929,708,166 *60DA043081D281B133937542277FFE77D4C352E9 A.Uwn
929,708,167 *60D1A19FC1C6C876B1A89B414A3D1CEE6D5A708E AUw;O
929,708,168 *60DA22F81EF50A0C435B33F43CA5D9EE57041A53 AuWoO
929,708,169 *60D5D371AFD8435A81ECAED24106ABA7C16ABE08 AUwSY
929,708,170 *60D0A0FF5F38E70FC6785483B944F2BD31D448C2 A,&uX
929,708,171 *60DD877404D09E1F300BA603747497D79A240610 auxdefault
929,708,172 *60DE6590BA7A9F3C6FACD52C568988F823C6E9DA AuX=e
929,708,173 *60D58F4D440B7E434CA8D583E5EB171738488E33 auxi lia
929,708,174 *60DEEF87A98632925BE52307F21EC370537BD0F2 AuXLL
929,708,175 *60DB9F87B98D923E5D0D9B7509341292312B0DAD AUXOBLAST1
929,708,176 *60D43070F216376DB51ADA777FAF7F2D7E1E97DB A,UY+
929,708,177 *60D9E6F9776AA7CA7A005A4D7E213114FA76333F AUY79
929,708,178 *60D4C66E34D0DBF09C05CB1BF28DF26CCA4F568A AU!Yq
929,708,179 *60D5EED0908E9DBFADEA748B58F953B4EFE61568 [email protected]
929,708,180 *60D91D31974663E8EDBF96F78D7763000C92FD7E [email protected]
929,708,181 *60D618ABB24F0C9A52E41CA4757AAB1F111ED77D AUYs2
929,708,182 *60D2AEC3C1E01B3DD7ECD25F15E4EA9DCD8592F9 A-UYt
929,708,183 *60D88C7C6EE2E36285A1D300A7CBE2C41D5D1EB2 Au"YU
929,708,184 *60D7322ED1B0965719E5A41B25DDD193830C7590 Au;Z%
929,708,185 *60D3A14338B56ED062AB077313A67FE71BFBD161 Au"Z-
929,708,186 *60D21C6CBB9BF5F5425C3E98E9BC53E6797B3B2C Au(Z;
929,708,187 *60D9D548F931D7D1D64DC0F0CF8AE1E106AF5FAA Auztlālpan
929,708,188 *60DA128E9AF4F90ADFC7950AD95D4CCBD6FCF3AA [email protected]
929,708,189 *60D56BE9F88D3C9D4AA9D66BBAAAEBC0F456244E 「auシカ」と同じく、「キノコ」が大好物。
929,708,190 *60D611FBACBF6C9C602ADB449CC2A786045413B4 A."V#
929,708,191 *60DEADB337168213C2A197F9D730FB4DE7FBF64F A(V%#
929,708,192 *60D6B6EC1A78016E11C9308651864F10E420E4BD A#
929,708,193 *60D2E8CC8902E0FD8FF12A4E1EDEB3F76ACD7556 A%/(V
929,708,194 *60DB8F7C882E872DE0D55535C90FDF32BB164E4C A+-V(
929,708,195 *60DAC95D95F812EECCFED3761728E327B82A38CB A+
929,708,196 *60DEDEA0E1950021D3B0C641294004247096122C AV
929,708,197 *60D1D21B43559FA4C15060DA8FD838C1ABAA6EE0 A"v#%
929,708,198 *60D80C44CFD5C341820857CB88CC64A8285A44B4 A)v+.
929,708,199 *60DC8F019E925A0A635598C8C5D1FEFEE12F9532 A$.
929,708,200 *60DB1591721D4FAA597DC9B2EA7AF81AF305ACDC A+;.v
929,708,201 *60D0F8CDF22483089DBC197628CB9E5F9DD88E3B A+&/v
929,708,202 *60DBFDA4DEC9C640C21A1BC538FEA6EE16F4FE2A</