List database


# MySQL hash MySQL password
914,140,001 *5F2C9B6345DA90A3FD24DC29C935BA10EAA566BE RIDAUSMAN
914,140,002 *5F284F2351A8ABFDE77963C889816C7C1419DBA2 RIGEROUSING
914,140,003 *5F2471705CB7EF8E537CF0F8894C2439FE18596E N14856
914,140,004 *5F2133002316663F78F8B941D8E08C08C7A5F459 RILEYWINGE
914,140,005 *5F20D1A3A29D403819946ED4AE21F62D7EBE3A63 RIPTRACEYTRAVIANTRIG
914,140,006 *5F2A45C67AFA9F81A88C73637E797B6B18D06342 NALACSED
914,140,007 *5F24642EB66B0B5394920E16FA6F649D6BADF938 [email protected]
914,140,008 *5F2D98C8C2011E30A50754CAFB773786B8D9EE94 nborevived
914,140,009 *5F2F7744451338BB672CC636B05F29A788C95897 ROBERTA.SHAW
914,140,010 *5F20A4B71A77341B725E8026B809DEF49B5A7972 [email protected]
914,140,011 *5F280482D3AE2A5D9B75C1BE453344076697110F robingreeb
914,140,012 *5F243A595DC3E994737C81CF12C03085F5C55F7D neamart5
914,140,013 *5F24E8F579AEB856A641D3788E4CC52704028F2E nehesfing
914,140,014 *5F2057C87212C4A5195953B7D64A1C2CDDBC2A4C NEO-VERSE
914,140,015 *5F2885FE05E330279C203F454F222AE77B278057 NEUROGENIN-1
914,140,016 *5F2A5BA5D9DEC5F28734FA50546A0B7FA6D04FAF RON.MILLET
914,140,017 *5F213CCBECEDF99808053D35A3FE85F3EC0974D5 RONRON FLORENDO
914,140,018 *5F2EB271872D08DBC25CD109E50ACC03F3C21C26 ni0bid
914,140,019 *5F2FC1F8A9DA76D9D0CC3325562C6BF7C5EFD20F ROYCE-ROBLES
914,140,020 *5F2F6381B14C3B8DF13BB918645D2270651A0462 RPHACE
914,140,021 *5F23295A676A4BAF0188F2799F6538D24E763D12 RQNL
914,140,022 *5F2D4F60A356BB1AC56EFA504573589C6202B492 RUBICAR4
914,140,023 *5F242F018E940874B81D7A905F5FFE4822E2092D NOAHFRITZ
914,140,024 *5F27A39349B8F9DE97B894062E4BF785D5D11124 [email protected]
914,140,025 *5F26CB94079B88EE9778A8710008E184FDC69E92 NON4FF!L!4+3D
914,140,026 *5F28FDB887339736CF607D49C9EEED376C15258E RUWERUWE
914,140,027 *5F2530147F218533C81E115CA523AD4F6DA7D8D7 NORMANDPRINCIPE
914,140,028 *5F20DF8F1A498E6F57FB1C66510E7F8511DBDD12 NORRISPUCCETTI
914,140,029 *5F260AA94EAF12590387003F25AF7C673443149D NOVKOVI
914,140,030 *5F22D43AAAD210310F444FF78E41416919A097D0 @sa12sa
914,140,031 *5F274493A2292AFD52FA5CE1AFE7F8087A8488BD numbersrenna
914,140,032 *5F297148A57E9C2D6FA0C2E23426B5772185D55E SAL.HAIFA
914,140,033 *5F2CCE748F02C0FFDC93CFBE7DB1C77EA0F3D6F8 SALMAYASALAMA(OLEYOLA)
914,140,034 *5F273138645931C17A5C534EC347BDD9E0DD9A04 salvadorcuppernell
914,140,035 *5F2DFCF257ABECE86F3F0E533B8844A4D3477D0D SALVATORE.AHONEN
914,140,036 *5F2C7917313ED464E2D18A0798852AD9B91BCAD2 NYSKAPANDET
914,140,037 *5F2067E4D4400384CEFFD3663BC79CBA5CDF147B ODIS.SHAKLEE
914,140,038 *5F2F36D05B89A2DDD0BA1070E53B8C45BA8EF614 SANTOKAKIMOTO
914,140,039 *5F245D2717FB234EBCDE8463422A4F07591AC99B OKINAWA.23
914,140,040 *5F2312033BC1BEB59FBD511A10F2F273849FBB41 olenbilchak
914,140,041 *5F2488396C65BB33E0A3F305BA3515716D820331 OLINHOERTER
914,140,042 *5F23B4809E9C4FE982BBA3BE2E232F598EC06F0D SBEDER
914,140,043 *5F289F092D7274BB10F1DFCF217BC57267EE68F5 [email protected]
914,140,044 *5F2AF76D802B897380B09780615DB30D9FB58C7D [email protected]
914,140,045 *5F2A15AF47852DAE93E4A053F42BA219DB5BC662 SCHUBERT SEHNSUCHT OP37
914,140,046 *5F29220A10AC8C68B6F1B75E7D73AD1C61FA2F1A (>-<)[email protected]###B
914,140,047 *5F241209371AC67F22119A142EC691E35EF70BB5 )o(o~o~-<------b
914,140,048 *5F2B9268D7D4E838056286CD56C6CB2F86F416EA o><[email protected]====b
914,140,049 *5F22BCD22D6251A2D89B1E4A30FC14E92AFC2DCD )o(`@p
914,140,050 *5F22E7CAC79CB4837323AC9F0D45AA888DAFAAB1 SEAN.VERANO
914,140,051 *5F2CB99734D0022DD11B89ED066E9671290828AE SECONDH4N
914,140,052 *5F2A0E11C519D23654FF146051F06A04B8696DBD SECUITENCA
914,140,053 *5F20818D6F8BD5727004988F3067D995313C3E0E sedersdiehcsfa
914,140,054 *5F2149B1B0052D63B90ECE46D2DFDF572DC7CCE2 OST3OIDS
914,140,055 *5F2D3B568F2C3492F3A0BEFA8F9DD27664236F54 SEMRUSH
914,140,056 *5F2ABB5207E69D3BC08D0236D3939FB442625FB0 SENDITRUNNER9
914,140,057 *5F2D04DD4C1759ABF29D269BBD2347BF955E5A96 SERGIO.FINN
914,140,058 *5F22A3800361310B517C80D04E809E584169FD0C OZEANVERMISCHUNG
914,140,059 *5F258054A025407D8EEA3A46DB8425F129B0AA58 p------)-~0-splat!
914,140,060 *5F2FCDFFDF27F233066C199FD4433EBE158146F7 p3cula+0r
914,140,061 *5F2C0F366FCC29AD1C528626BE14C1E86ED57E0E shannonwayne
914,140,062 *5F2B5026CE88028403B27F9AC6A58C03B7404A62 shaynetunis
914,140,063 *5F233F95395CCE97FFB7ABA12610A74119763264 SHEILADANNY
914,140,064 *5F276973CB3AC626761CE870A18E1EDA5BF17123 shermanwanke
914,140,065 *5F20F15E2DB23B37CA5B80474DDDD03B76B21E5E paper8oards
914,140,066 *5F23CFE402062D008F482C2435ACAA1EC5E8F341 parisillingworth
914,140,067 *5F207AEB39A5B35576B6D858911107F4505EF85A passersby.waltcip
914,140,068 *5F27058FE5F33232BBE2CE6F5AD048D1715535BC SHVETA PURI
914,140,069 *5F2F52E0877A0D24909FA2A1C4932FD8929B556C sidneystearne
914,140,070 *5F22726446BC6CE959FB51DC4BA1B2D861231D79 pauwala
914,140,071 *5F21B4096F8ED038813210EAA1B5EA9FF21C740D pd`~splat!!
914,140,072 *5F2D7A10F75BC51AFE97E106FA489851EB4D82F9 peg.meyer
914,140,073 *5F2496862227ADEBF95F0E2C8096D88C16FB4E4A peoplegasman
914,140,074 *5F26D6DFEE42C705D4B18A6CB9CE3446A4F0E627 perruthenic
914,140,075 *5F2911F2E7B2436FA68734A3A45BD3002206D30B slideslender
914,140,076 *5F25D9D20676B31DB0C235DF9E9B1C70FF48B762 PFYLLNADS
914,140,077 *5F2CCABF6A138C2198C16034F1192ECBD34E2845 PH14NTHR0P$T
914,140,078 *5F25400DA732663BEFFA0A77D67A32983DA3EBA5 SNCKRNG8
914,140,079 *5F246F8279D4E2795D1D7C2D0699470C41D16DAB SNETARPROOD
914,140,080 *5F20036F8C3E2FE22428C04347EC857922C635DF PINASES3
914,140,081 *5F2DD0353CBCCD4EC11699299E93A547D2962E2C SOLOMON.SMART
914,140,082 *5F28E6424119CEC2EBBF8CCCFA8116553A4B5428 SONGERHONG
914,140,083 *5F24D6712007B39D117BB1D2B75CABDD0EA63224 PLRSTCT2
914,140,084 *5F2D0C49A9CC817EC81F65881A84C055EA919899 PMALWOLBS
914,140,085 *5F2181E0396AA01ADFAE2C0675430CDB735D03B8 PNURYANTI
914,140,086 *5F29E880DB3DA6A3BA7C246EB86281E51E3C8D12 SOTTOVES1
914,140,087 *5F283284C848AC636B008F1D4A967B89D815446D souchu
914,140,088 *5F263230C38D3EA847CF555B6BE86654A300F178 soul bossa nova (kcp remix)
914,140,089 *5F2CA55BF4CF3AF9F50943A3E9EC45CEBA19006A SPADE-FOOTED-SP/EI/D_F/U/T/I/D
914,140,090 *5F27CEA515315C2B3C53B64FDC4259151628D443 polluas1
914,140,091 *5F299604C9D3E9C7DB45DDE280935F960B82F7CD SPECERE!
914,140,092 *5F27C4E6443CC7C97DBE8B76AB195158FFF79248 poohbear,
914,140,093 *5F2B5FD426450063009CF16B125DD4462652097F SPNKYDNCR
914,140,094 *5F23EFDC0D882ACDD3D0E4D0CE9033B1989CC1F9 sportybabe201293
914,140,095 *5F2277006E138AD954C8A4E11396E4FE2BE069ED PREDWISL
914,140,096 *5F28EB00AA4085CDE482B1851DA5D1B7E3D84F86 SSATSIER8
914,140,097 *5F2ABB25022B84AD5A26F9FDC97573C4721E1B5C PRINCESS.ANDREW
914,140,098 *5F263354A6C3DE5291C4559BD592DF752D5AB44D SSIERYNING
914,140,099 *5F25A7AF37709ED723CFF33E17C7545CF6F34360 PRJTTNTING
914,140,100 *5F2A73E99535E5DF42D5114EFF14748034C0D284 PROBES公司
914,140,101 *5F256471D617CA3E6F36C6AD383592DA12CA28AB STAHLWAREN
914,140,102 *5F243C8A3F6968C9CB038C7B087F153BF2A91835 PRUDENTIAN
914,140,103 *5F2C895AA76CB4A81F6881015AF1A91A9E914795 STARSAMANTHA2
914,140,104 *5F281A971F6CD1565B22CFBD28991942DF368683 STATERASED
914,140,105 *5F261E5F46CD949BC62EF3B378144DC3B8394D67 PTRAWARE
914,140,106 *5F2C27474FE946571A29DC5AFC974B0074F76F00 PTRCLNC7
914,140,107 *5F2CF98AA6412492B6E25DB03E3EDE324D3CB4FF puseses5
914,140,108 *5F20BF0B0E72E300A58FF7627E3BAC8FF829A105 Q===)-*(0_<)
914,140,109 *5F21BFCFE1EA1481AFE438693F287A3A7E4D715A STERLING.CAMARENO
914,140,110 *5F22B664F94B8479965BED7FCA37C49470BBC63F ><~`.~`q8
914,140,111 *5F28920AC8283E9F855AB01FABB1E02867F6CBD0 steve.forrest
914,140,112 *5F23DC2FB5618B2831DCDDDC05702B0A87A7EB3C q-----p~o-)o(
914,140,113 *5F28F7E42B243DB25852CAA766D57235D1A8AFC1 STRAEDING
914,140,114 *5F2E96CA2B5C1D2CF638DD85F765C27DEECF1C84 quintonpangelina
914,140,115 *5F296B8E165E5E3CCC58FFC510953BF1BA888293 sudderth5
914,140,116 *5F24C1B672A1C591B17BD26B55898E551602381D radeant
914,140,117 *5F2BEC624E1D62E2AB7C4E816DA7015007B2D874 [email protected]
914,140,118 *5F252855620E7365D17AB03803784847626D4EF6 superace17
914,140,119 *5F29D06E582E7F00CE0D806D74905A71D19A4B91 supportnotused
914,140,120 *5F27D5B21F79AB8E58AA4CCF5EBC4FA52C37DA4F RASHADMANTHEY
914,140,121 *5F23AA2DEB4E0B7EF0EEBB3D37285244E57F5469 SUZANNE-SAMANIEGO
914,140,122 *5F2906C1A8B88935E1CCD03506A9592132E7857D SUZANNE.SPRINGTHORPE
914,140,123 *5F2A095BFFB92F8ECC0C3352BCC16A76B78DBA2E SWANTONBOMB1976
914,140,124 *5F2C93A67971AD28BC4E091F253F1B3658C07FA3 RAYBARIBEAU
914,140,125 *5F2DCAA5221B8BC57B4117111A9DC7314490E8F0 rayequils
914,140,126 *5F25EC25C320ABE05F52C31D795413082D7DF3B9 raymondesporte
914,140,127 *5F29CFB59739B3A67C2CAEE4C0024DF31969BDCB raynieng
914,140,128 *5F23C0A336BE282AEE22620F9F14FF20030ED6BC RE9ENER4T0R5
914,140,129 *5F27068BA1364FFB4EFC7E13B51A4948E071A64A [email protected]
914,140,130 *5F23027FD6075277BD8A2D4EB756324196A359D3 T/'
914,140,131 *5F2930A6DF55670989FD1B6FFC483C7FD1D4C36A [email protected]
914,140,132 *5F21BF5F2884C7150253B61C0F13125972FD40B1 REGREMAGEM
914,140,133 *5F2B190EFCBBB44F508CA23694ACEB31571A793D TALKSEGLEAYOUR
914,140,134 *5F2876E64D3EFE66E91EBA06613549889D44FC99 TALKSHADPL
914,140,135 *5F26DDEB1B30E320B9A86E5B124B642766DB46AA tandemproject
914,140,136 *5F28012F13AFDB80F0D5865A2E639A998F528E93 tannerbroaden
914,140,137 *5F2CEDB779192EEAE3303B6A1564785863432C96 TAN.STEVEN
914,140,138 *5F2EBB8E16558A08B6A220B86ECB5E7C38728FD3 RENE-ALBAY
914,140,139 *5F215354C671639DD6B9B1BA3FE74EC20793CD73 tasneem-kalawadwala
914,140,140 *5F22C94CE7B64F5E5040FB20AF482F707BEFFFC1 renenicolai
914,140,141 *5F21ED2EB12744F051D6AFCE1FD784A3475FB367 TAYLOREXPLORER9
914,140,142 *5F2E38EFF12B9D8E42C624A3B59C4F4E78E5F757 RETHIBAULT,M2NO70
914,140,143 *5F22EC29F65327039C62BF2397EF665316BF440D tedybear1
914,140,144 *5F22C0423737D66578012A93783BB559E5FB51A3 [email protected]
914,140,145 *5F2D2CCDB8FF414268EC3A284CE7151301CD481E tengvaroj
914,140,146 *5F2A102D84B630DF09D980A17A9AE022CFA4DD6C TERK14488
914,140,147 *5F259AE12E771B34C84922CC83B168A0EA36C422 TERRANCE.MCINTIRE
914,140,148 *5F21BD930F454CDD70DDBBE61C22F7B2F522EB40 RHNB123
914,140,149 *5F24E103B70F61D03563826AC97E09678BE499A1 TERRENCE.RIEHLE
914,140,150 *5F2327F465A39C5426FD20AA97ED4DCEF6D5AD54 rickiebuono
914,140,151 *5F29F8CF3A13959196F69FA4523FA2976FFFF990 [email protected]
914,140,152 *5F2CB6DACE242E14D9BE3779B05398D4566664C4 RICK.R/I/K
914,140,153 *5F2FFC98F1E7D993AF51EB6C6F960C516EC44921 thatboogie26
914,140,154 *5F22DFAD89A104E0F46718DB76A218C7F27B3995 rita.bartolo
914,140,155 *5F2290D8111421E58976BE18C0D42C867DF135D8 [email protected]
914,140,156 *5F21FD45C96C823D6E2D34B2AFE67E770A7E98B8 rlrfgqg1
914,140,157 *5F2B00C6032A3A0EDB3C8667C8864D4D1A59AA0A the-grand-escape
914,140,158 *5F27A954FBF1F270876DE86EB74A5901807196DD thejuniper79
914,140,159 *5F2B7BB4C1942D6978240C6BB282447F2D73225F THENOWAY2002
914,140,160 *5F23B527BF1E47A4DB48B7198F65CF025896BDB1 roccoahmann
914,140,161 *5F2659C0CCE065DA53C346846CCF846AC21BED4E ROCHEGUDEDR
914,140,162 *5F20B3F20B7DB88328812FC448A135EC175684B3 rodrigocathers
914,140,163 *5F20C3BD191AF64AEBAC184373CAD3CF4E074A6B ROLANDO.CAYSON
914,140,164 *5F2B918EFE63A908DD046BFE6E34FC3AC216388F ROMANIZOVANÉMU
914,140,165 *5F28C8B893DB8603753AE893AC031D76E80C84D1 TIGERMAX5
914,140,166 *5F2D97E5AB1B40FC77F97DCDF84187E68C50E62C RONNIE.KLAPPERICH
914,140,167 *5F2FE512D5E8DD626FA55F6865D6CE63DD0715B9 TIM.KACZMARSKI
914,140,168 *5F2464703B77410CD77CDB5AC19771F2D329AD10 TIMSANDONA
914,140,169 *5F255AD0FBB2CB9E1EF36AD2CB22B3ABEDBFFC2B TIYAYABUM
914,140,170 *5F228D27514B7A280B6746C39B7A1ED0AC66E45A ROXZZY1
914,140,171 *5F2CF3629B4E87FB3C57C335C48CD0F6906EDFC7 ROYCEKEBLISH
914,140,172 *5F2DD961669456A02658D815096D5285FA2F0C05 TNEREPPOLEVED4
914,140,173 *5F23F3D5B7B2F79D888F5701400DA99842A279BA TNF2AC1MLTGC
914,140,174 *5F21C922044DBB4E89460D102B64EDF1C96B21B5 [email protected]
914,140,175 *5F211A20F150C4372D5F542B4CDAE303AC223EAC rsevtrio
914,140,176 *5F2C8D442C6E08D3FA5C15D8B31074594C0E413B RUEBENPLANA
914,140,177 *5F2AC9E27397627F2B699FF9A389BD99904BDEEC tony.giuliano
914,140,178 *5F2F5A12BA988C1FE9405FC0D88CAEC3B3538573 to-say-goodbye
914,140,179 *5F242DCF3B1EF58B1C7245161D536336C8A0FD1E s1og4n33r
914,140,180 *5F20995324E71012ECA836C031ABE4066A344E62 SAMSONDUDE7
914,140,181 *5F2DDBB06C666100BA3D66C5A7CEEDEB1DCE7292 [email protected]
914,140,182 *5F2A383D0A4353444D758C98B1A8978CD6193B71 SAMUELDECARDENAS
914,140,183 *5F26146835A1AF63DF45068A338F6EE271C8F8E9 SAMUEL-TESFALDET
914,140,184 *5F22EEF1E8654567E2A73F30CEFB4CE687F621F6 TROPHYWORT
914,140,185 *5F27E3875D1877DE3218B04C467A7E8A9D697361 TRUMANBEEDY
914,140,186 *5F2FB199AEB13E2E3347A7E65C508A5039CFC7AB TRƯNGKHẨN
914,140,187 *5F2571F9C9FC2DB3408E1432915BC035FC806754 san-martin-v
914,140,188 *5F2B480479BA826F2BF7AC6164E6BFA5F14D506F TUJUH.SAMPOERNA
914,140,189 *5F26B68EA7C1425788B314621B02126EB370B298 SAXONORWELL
914,140,190 *5F23678ED54E401574B90808E41875B3FDB47B78 say{
914,140,191 *5F2A9C92EAB8677D406DE416803E7C51E6F5EB31 SCHEKKERMAN0
914,140,192 *5F2FC6EA3B35C5E09F7CF1BAAA5277B5A184040D SCHUSSSCHUSS1
914,140,193 *5F2CC199E52FD289E5CB51A019A33349EDD04B9B SCHWINDELMEIER
914,140,194 *5F29F2E57E14176F0F5A25F5D0BD3FBFCA82D14F scott.chaloner
914,140,195 *5F25B871A81E07826CFAB5CB1BC23D0DB5D98CD8 seamesse
914,140,196 *5F23A0BD95DD9241B65AA50F34FB51CAB76760F9 SEIFELT3
914,140,197 *5F2748EAF8BA4178AEDD38770B722EDCCC01C579 SEJKABSA7
914,140,198 *5F247116F31A89438A64FFE47B4C2872C4986564 serpentinebrucitechlorite
914,140,199 *5F2AE1C631534003FC10F86FD60685A38992A4D2 ungarmented6
914,140,200 *5F2E02AF5C340525C48C4C89CFC7FC29FA701B93 shayla607
914,140,201 *5F2583552D38D2AC177BBDFB938117F263129704 [email protected]
914,140,202 *5F2BB2E11B2B57DE3D3BA03F133D15FA222AD956 SHERRYCHAVARRIA
914,140,203 *5F21D574FFBBEB9239A3F79699E45B112EB68ABF V4C!114+0R5
914,140,204 *5F24E4E895E529C4CFE76B795817D161F335037A SHQELQIM5
914,140,205 *5F21F04A1004FFA6BF772070DF8DFF939BBAE49C [email protected]
914,140,206 *5F230AC4D5213BC046B4AD733AD13E79EB33E1DE sidhebenstreit
914,140,207 *5F2363B8A1B4819FE95CFFCECCBA2FB172C17782 SIDSTIDMAN
914,140,208 *5F21E8D5CFFFA3349239A55ECF2298A55B300412 silasholzner
914,140,209 *5F258F362F6215DD37E8563183A5DA3F5E5AB01A V begin
914,140,210 *5F23A5CC90CE2FDE4B1242E59598B3A9F880105D VEDA-ALEXANDER-HALL
914,140,211 *5F2A492AE9D951BC484CF8742F7E5AD803CBEB19 VEGI-BHANU-KARTHIK
914,140,212 *5F24D26CB4CDADC95D392CDA8C7AA685C254FA60 SIPHONOB0
914,140,213 *5F2EF0FFA9D008D49EC16D424A12C98F258A8A7B SIX-PERFORMANCE
914,140,214 *5F2121877B380FB3B75FA9DA85CD39BBB984BAB7 VERNONQUARNSTROM
914,140,215 *5F28CAFD7241CB4499DF9C30ED127A6FC46D42CF verzegden7
914,140,216 *5F273B7438EA282200D9992FCF2D76E5C846F79E [email protected]
914,140,217 *5F2DBF05230AC2919A122476746CE3F1612543DF SLOANE841
914,140,218 *5F2C4F8DD4780B4E9B42EF50A8E44E9A4AA2AB13 VHIELVENRA
914,140,219 *5F2D0608A95292F672FCFA3869F3F5356917FAFC VIGUERASFERNÁNDEZ
914,140,220 *5F22C7FD044EC7049463DEE86E06DBC2540BB281 vincent-troxell
914,140,221 *5F272C9EDEB0867AECEAF6BEB1A8D8791ABBF4E1 SOLIDARIZUAN
914,140,222 *5F23D9F9BD31553336212BC4CAB07A328D4DF8EF SOLLICITATIEPLAZA
914,140,223 *5F2DDB0E5E2603ABB2B630E7F8CE75429848FA0D VIOLA-DA-GAMBA-SONATA-IN-G---ADAGIO-(OPENING)
914,140,224 *5F2727AF9644FD912E816249F34083EAACC44F84 virgilbetancourt
914,140,225 *5F202411F0CF51FC326F9449ED78ED877F241759 VIRGILIODROWN
914,140,226 *5F2758510B1FD736E4E6FA7607AB01767854F12B VIRKAMIESKONING
914,140,227 *5F2A1E80C71D8AEDD5282074C9E2FD535A0DE251 SOULSHAKA (A CAPPELLA)
914,140,228 *5F29FB370ED1C65327A10213BF1C30DF21B5B4C2 [email protected]
914,140,229 *5F2706F8CB1A3F722FD99A0CCD5AA56C63B662DC vodivych4
914,140,230 *5F27C5E6C6B7219A11540C80632EB3035A2977CE [email protected]
914,140,231 *5F2D6F621CD586D2D8B2128D384416F300FBC7EF vorayda6
914,140,232 *5F2B1344911F0D11514A32970092804824A44EC9 spilkydude
914,140,233 *5F2E6282B7E14BD0F1E7195F564A3045962B422C VRSPDG
914,140,234 *5F26CB8DDDE811558A489185CAADA48E7C52D852 splat!o~-0~<---P
914,140,235 *5F22394B86382169441AB083E21AACDC489581CC VUTSOROK6
914,140,236 *5F296D4A9A86D93B1DA235C1EC3F489799C8E0E0 SPLAT! O~ O~ D#####B
914,140,237 *5F28C44F47AC4C06346103DDC0ABB3BCFF383CF8 [email protected]
914,140,238 *5F2A6799B0ED5A232BB76190375FDB184C12586A w34r3s7
914,140,239 *5F2C24855E4B0F1E5FF509511AF2B0A1ED85DAC2 SPREEZED
914,140,240 *5F2F8DD5B4E8AA5A0988A9B39287ED615C6FF9C7 waltonsiok
914,140,241 *5F2F44A4E9E422EEBF9B50BA32F2A240AC129406 [email protected]
914,140,242 *5F2F86212769711732658F463A37A5A4A2D40612 SSPRL
914,140,243 *5F298EF0480B512649FCA2CAAAF7BD292143C5F9 [email protected]
914,140,244 *5F2FC602B9E601B17D92752ECFC12C2AFE0902D8 wassel-darwish
914,140,245 *5F27D0B08083AC1F3451E0AF593D06CFE09C9746 STAN.WALLENTINE
914,140,246 *5F248C53961ED964493E49E70887011A4BD8C6AB [email protected]
914,140,247 *5F295C84FBB5FDE20689EE9D33E2D7762EF55362 WAYEL BABIKER
914,140,248 *5F2FCC7A7FBA3AF10B1C66EF0C415C0AB8C1E13E [email protected]
914,140,249 *5F2445601B92D437CD32371F4546D9F1E9B85A2A „STEUERLICHER
914,140,250 *5F243779E9BAA9E11E7B6649FDB2C853CB953EE7 weld.alyn.shredar
914,140,251 *5F206B7403198DA1E041EB7976419A5F09041911 wellhandicapped w/e/l_'h/&/nd/i/,k/&/pt
914,140,252 *5F2BEFB6BF91C23623535C20D94A6A8A09310230 wendekurs
914,140,253 *5F28E03DDE5D15E08525A12F03DFADD91B8E3877 wendelldye
914,140,254 *5F2739B57B65DC3B2A08C531CD77842D137FD881 sthaavarena
914,140,255 *5F2858F5DCFC982DF2979052361A887DAE50C2EF WERSY.NOC
914,140,256 *5F2F22555539E82622D5F3BEDD52253DB16C0625 WESTIBSW
914,140,257 *5F2960CBD55C68171AB06341A3EC3CCD5D949DD4 wethepeoplecoalition
914,140,258 *5F261016A5444C4EE06AF491BBE8159C613707D4 whatyoudo
914,140,259 *5F2C784F501D501D933B5AC18C9FC0117C51F327 STUNTDRIVE
914,140,260 *5F27A0B29D36D6BAD26D1BBB1CEC84321F85CA1B WHITNEYAMUNDSEN
914,140,261 *5F2638CAB2CB4CD99DC9DA5014A9930C3435C9C3 SUBIYAS5
914,140,262 *5F2DE7A1ADCCA5649639D10141D99FC0606D4E06 SUCCESSJULIAN5
914,140,263 *5F20D9226BBB481B1D0CE4A97A4AA86427247F62 wilfredodayhuff
914,140,264 *5F27803F59E089907152DD0F796F4F6F85C384DC willardexcell
914,140,265 *5F28C848011D1DD75814AA2228A2F1954489D058 WILLARDZHOU
914,140,266 *5F28B09D5A4434AEEC6D661CAA0F24DB1A665EB9 WILL.IAFRATE
914,140,267 *5F26984C47723EA48F79F2DACD9A7E2360DF971A williamnullet
914,140,268 *5F2529577650E963A31159C0E3B96FA20CA850AB WILLIAM WEEYUM TRUONG
914,140,269 *5F2D01651F47B30C52E4164E4D3F8E44C938AA51 SUPRASCAPULAESES
914,140,270 *5F27DD5B8C45990CA5A593CE485A3377DAC9DCC2 !SURFER
914,140,271 *5F2D8B872E0F15C58C2D6E9906574E60B4E379A0 WILSON.MANASSEH
914,140,272 *5F2979BF85D9CF61D85EA30F9F011F3EB5EFC226 susansmile
914,140,273 *5F243D5C7972BC55736432D50868E4E197886EF9 WINSTON.MUCHA
914,140,274 *5F2416BFB0897603D16331814042A9B11F85DB63 WMAEKAWA
914,140,275 *5F2A6D2E0FC121711BB9346752A010B621C0B2D6 [email protected]$kiin9
914,140,276 *5F286B8D58A6BB56ABEA7EBB3DB5AAC39A963404 TakeMetotheCloudsAbove(LeeSmix)
914,140,277 *5F227302E9FF8299B41744AAE5EC016E2BDF4CF0 TALKWIKIWIKIWILD
914,140,278 *5F2E18BE0CC6AA1ADF9803CDC1CE6CBEBF9CDDF6 X18102
914,140,279 *5F2BDC879C647968CE9D803764C160DE4579667F TANGEREN
914,140,280 *5F24C228448F57BFD8452114DD88E0C4E5F037A6 xanthie8
914,140,281 *5F2208B7A93C8228375FBD0D932DE594EC813139 teletoksflak
914,140,282 *5F21608BE0AD0206B5026EF48674C66516A956B8 TERRAGNI8
914,140,283 *5F23695E4F04DD4E05CDC0909515B7F745E55CDD terry.snead
914,140,284 *5F210B922E0F406DB6DF8EFADCE45CDBA55F4F71 TGE
914,140,285 *5F22D4F0D79689E1B381BCF1433A98B1AD3F7992 ybseibni33
914,140,286 *5F2D3E8DF122EE91C3C73236ED95F814C743C36B THATMAX48
914,140,287 *5F27DB559E29B83249323F76860FCB8027B87DDD THEARENA96
914,140,288 *5F2A7C8607C580D8A4569D7350C4CB8497F0365D ylpeä
914,140,289 *5F268A118884A136C25ED34D15ED7AFB466145E3 THEODORE.KUDEJ
914,140,290 *5F2E0D760BA5CA21D5EC679724FABE75F12BA6EE YOUNG-HWAN
914,140,291 *5F2A9BEA3110FA7335F9BD0A8B6C5AC393D50387 THH=
914,140,292 *5F242430854DEEB1BE3B4DC03EA619575735C5D4 THOREAUC
914,140,293 *5F25DE0B2616118E8E77ABB6046DA13327B59BCC Z145820
914,140,294 *5F2922F74F322E1CDABB2B99CA49A585CD93D585 Z7MFTY
914,140,295 *5F20C637868E0D5F986116D682C29C3E6DD44D6A ZANDZAKKS
914,140,296 *5F24D749ACE60EB77B6C66799BE7C7030C46849B TJ.CARTWRIGHT
914,140,297 *5F2179098B5BCC9CD92A991D079292A149928817 TLEKKIMS5
914,140,298 *5F2DF3F58E97A2ED04A4F2BC1A6099D45FC96344 ZEKE-NATTRASS
914,140,299 *5F2D7900219A8CA529408492E1EB026EFCB88F5A [email protected]
914,140,300 *5F2A27C5E90854AD227014BF0AA24998CBA19CC2 [email protected]
914,140,301 *5F2E5C14E8F32DA7FED9AD6DEC56695387561F3F [email protected]
914,140,302 *5F25F94948CC4F3016DAA91BDAB0E0474D3FB866 [email protected]
914,140,303 *5F247D9AD6A6D33BB6D8A2C5D3591732CBA682DA [email protected]
914,140,304 *5F2D6ADC4764393B8192903B42C90456692ECFB0 ZIED-HAMDI
914,140,305 *5F256256CC05FBEE9C34FE419CD4B91F7D20E464 TORONTOCRAIGGED
914,140,306 *5F2794291C685BABA34F6A2038DC9FE11E9BF515 [email protected]
914,140,307 *5F2473FF237CF55AF6AD551F70A34C6482A4A0C2 TR7I
914,140,308 *5F233E1233C000E5ADB5EE6EC92000DFB07A9FA6 [email protected]
914,140,309 *5F22EBED0F3829954E8B494F77B6D1C1D7A1FA5A [email protected]
914,140,310 *5F284FE2FBFCB149FBCD2F8D04DE6820B92F680A @#TRENCHANT
914,140,311 *5F2D8C42EF865811A70479C7EFAA0A3CFF3A368F TREVORSTERMER
914,140,312 *5F2A149A4A955F9DF184BE2F147353393EA969B3 TRICLINIAL1234
914,140,313 *5F2CF46A66D8330410CDCF6D130AFED059228C00 TRIIBULISES
914,140,314 *5F27529D9B9177635A01D733A98C9465E633C533 πειρατήσ
914,140,315 *5F2C2BEC0BB98AAD1B999F1B703BF367E12B2B9B TROY.HARLSTON
914,140,316 *5F21856DD0EA76446D615DB0EB34E660C84CADD4 TSIMENTOY
914,140,317 *5F23C04BD7B65A1A50DC4D2890CBC194AE309E6B TTAQQIM
914,140,318 *5F2A2FC776F77F95533AC0CF7FB0E4BCBE37138F tuộc
914,140,319 *5F2E8F38D91BA08AAE632FA35466D0DECDA44DEA tylermeyerhoffer
914,140,320 *5F2C46D42022F484441CAD4EFA4665CA582E8E3A TYREE.SLIKER
914,140,321 *5F2F8E879EBC43CC53CB8CAE6E611623918FF94E TYRON.RAMADANOVIC
914,140,322 *5F26F5ED9B34518C2F190E62CACDA95AE7DD69FE «ЦЕЛЬ —
914,140,323 *5F2D6EB4D104B5BD0226AFFEC05E2440387A820D U114318
914,140,324 *5F219726649DCEEA9C91E112F0A1B4D7FE890DBC UAEZI
914,140,325 *5F2EDBB4B513211798BEC8E1A537B7258A7C0EEB UBILACXEDROFWARC
914,140,326 *5F2F02DF92B5680926237A67419A69989CADAA8B UBOLA.SI.ME.U.SRCE
914,140,327 *5F2313CC5F4283D429851E3A85BE799EA40E4118 ultrapak
914,140,328 *5F234B828EEF7D443AE8F78DA31642130B7E8F92 夏樹あい』でAVデビュー。
914,140,329 *5F2ED9EE8AB1CA9AFA859F9F0AEDDEBC18E7014F 。希語で「焼き焦がすもの」「光り輝くもの」を意味する「セイリオス(ΣΕΊΡΙΟΣ
914,140,330 *5F2CC613E9C5153952404ED81AC337AE2815AD11 unliching
914,140,331 *5F2799D38D9AD5EAC8C8638B525609913042854F UONYMINED
914,140,332 *5F26CB36E64F7CBE09EB4214A55F7B9FAF3AFC19 urs.nydegger
914,140,333 *5F27A5490D7C3AA7F519506FF4A1294D38BA9501 USERHANSOLO321
914,140,334 *5F27CE75510235A5972B00C0AF964F4004F7D34F >%@(%#(@>$)&($%(
914,140,335 *5F26DE26DF87C1844FFD65A210CB9C22DC167876 UTICABSW6
914,140,336 *5F27B27A7CB35371E51CB5D26E852DFC5D3E8F4E (0-0)O~ O~(======P
914,140,337 *5F222E7EBAF263B6BF9CD36D77625564CFD50A41 valarielindsayhaislip
914,140,338 *5F277CDBF23A732DD47D23B951DD2B29E6D2A6F1 valerie-apostolopoulos
914,140,339 *5F2472611F96C8501E0FA5242F733D3010915B52 VALHALLAGOPHER
914,140,340 *5F2C728E005981AD0E6CE1EC86ADA934E7DF5A8C 0iamaylmer8
914,140,341 *5F2E82B5E555F2BEA24415AC75563351A806A232 11: 11 # & wellbred
914,140,342 *5F24D1E384E8766FC02A55BCFB62B1C5691103D0 ventorrillodelaperra
914,140,343 *5F2DAC23870C7D93C624CD3FBE3C490C4A14A523 vernonhuitzacua
914,140,344 *5F2A645B855FAC58A5FD4EFC604A0FD6A6375E1D veronica-de-loza
914,140,345 *5F25B73B13BAA5C713EB505A05C1EF2552161AD0 13b517cb80953814bcc8191dd1a27a81
914,140,346 *5F21BC2941A6AA01839093A22DDCAED7FE63BCEB verstallingen0
914,140,347 *5F2C0B28D58FB9AAC7F8845D6C79B5B29F988C89 158651 ALAN-KOULUTTAJIA-PYYDET
914,140,348 *5F28828B9EB9CDD03FC2382B3DA7A622CF8ADDA2 VICTORCUPIDO
914,140,349 *5F2D05D8A33D542286D1013A2210D5205681780B 187VORSICHTSHALBER
914,140,350 *5F296B4EECAF3227B9D3F7137AC3EFCB90933AE7 195548 bunun.eGitime.bir.veri.olarak.girmesi.gerekir..
914,140,351 *5F22C3A424BA6910B7A5B001BBA24210DF7CF08E VIM8AIWNHE
914,140,352 *5F29D5B6EDC343529ED364F00F98AF741A2F56D0 vinaya-uppal
914,140,353 *5F2E0CCD3F28A499BE5934883AA4EFB77AEBD68F virgilyzaquirre
914,140,354 *5F2F48DBF73D87814F2059528BA45AB029D43149 1-COSSMAN
914,140,355 *5F2D78C138455024EFD1785DEA140F89F7A9B440 1.DRUCKMITTTEL
914,140,356 *5F215C2971C375B7DC3B7609CB23AD7834CC420C [email protected]
914,140,357 *5F2980B28A89EA40F46FDEB47F7435A9664B5B23 VNCNFRMD
914,140,358 *5F2741E9CA548E936522843E1036C4178EBD95F0 1.FAEHRBETRIEBEN
914,140,359 *5F227D0DC8EB0882A91F4524E6C56F4DAC2C813D 1.FARMAKOLOGISILLA
914,140,360 *5F2519EF70DE89A7D8D33F2AA6C5F007C7E6BA7D 1FLASHCUBES
914,140,361 *5F234094A72E3A12E3F1CC0B00E126DE666A2370 VREI SA NENT
914,140,362 *5F2B04E7B2CACDE1DCBA1B52E15876136AD76C30 VYACHESLAV.FILICHEV
914,140,363 *5F2A87E04ADC0F390DBC3FDD54F154662154CAAF 1kulttuurivitkanhan
914,140,364 *5F29D08B8A2E6FFD715C714363580C950ED8DFE6 wahyu.aryanto
914,140,365 *5F21231D2AB21165D52B17F293DBAD39C7FD40C5 waltercavazos
914,140,366 *5F24C3F7ACB9E9B6716806708083A8EB2DD04787 WALTON.CADEN
914,140,367 *5F29086C557A9083E4667DFDE8D546F2FBA33282 1 NUFUZLARININ
914,140,368 *5F2F1C84C20DF8EC570215D028EFD537D4C8574D WANDERINGELECTRONED
914,140,369 *5F20100F9BE7B3C67345DAAE774DD55F6C2858FF wanukay-perdana
914,140,370 *5F2DADCFDBC0A4A677FBE3717D4510F8D607E151 1 PKLAATUVERKKO
914,140,371 *5F254FF9D1EDDEBBF8D58ED8CF4E3A9E6ED7E8A1 WARD.SKAAR
914,140,372 *5F2412AA526F52E92C4FAA9630EED6B1C3F917A5 1PPQDHNNYH
914,140,373 *5F23486B483154140EF3402FA01851A94F052DB5 warrioroflight':destiny--endshere
914,140,374 *5F2C00D8CA59DF483DD3CA2E0263309BDA48A113 WDRLGTST
914,140,375 *5F2B73B19555AD57D0CBFE7612D07650648FDA1C WDUZBIRKOWU
914,140,376 *5F229AE2DDBE278769DAF20F395AB75BF264D700 weaverprint
914,140,377 *5F2F1B57D23C1D01A099B0460471C289CF083CA0 webtvfcmetz
914,140,378 *5F2747AB816F227F2FA3035526D08F56DEA59342 1tiedeohjelmakomiteassa
914,140,379 *5F2A1D1A8EE773466A95A58D154EB97E27EDB042 WELDONLAFERTY
914,140,380 *5F2B049B02B91A17DF92B8EF6F4D7837D9FC21F5 1.wolfspass
914,140,381 *5F22FA6F93EA0971A2F2FD6AFF202E9BFD66A6DF WESPELTAL
914,140,382 *5F2C90722AADD245E74FC1E59DA18DE209F64C86 20rosamb
914,140,383 *5F2BDD76F5DA02DBDF7B4C8B544A65CA2162EFF4 21FEBRUARY1338
914,140,384 *5F22412D94944A88C4F3C7F52B89A0EA5E538BF9 2250263 SEKINM
914,140,385 *5F2C0D80263BA9B1F3DCA025CF72AADAAB3655A8 2278499 " DAS WIRD VON UNS GAR NICHT BESCHOENIGT
914,140,386 *5F2363BAC98F17DBE5EDC85FC1213DB9CF6A5D60 260 bu-islemden-sonra-hatasiz-bir-olcum-yapmak-mumkundur-.
914,140,387 *5F228AED4B9DCCC43A61C91BDEB27D4783C912E8 WILLIAM.DYRSTAD
914,140,388 *5F28D31B03DDD6F13C4CDA1943A30DAB90919292 2771119 MUKANA-ON-MY
914,140,389 *5F21D4655AA382F176BA209D45A240A43A3806BA 2779163 vieress
914,140,390 *5F296D817B2F348CD0A1B9BB8D0E32C32B49613E willianbeto
914,140,391 *5F2E8E73E014949452C91D7112E3AE48D41F4ECB willowleaf
914,140,392 *5F2BF7C953794641D53B2609E20D6FA0659BA4A3 2AGHCISSW
914,140,393 *5F2532D17FDD05A13B7198BA346183EBF0F9A778 2 BUESI
914,140,394 *5F2BCAAFA60318946AD9AFC451407E28AA6493B3 WINSTONFOOTS
914,140,395 *5F2240696A92C005FEC989F3DA7B078D9833760D 2dirigentenwerkstatt
914,140,396 *5F20FCE58BEF6909CE1D877CC3C86B68D402A990 WM.PARENTS
914,140,397 *5F2B4E17530B4021B8CE9A051657F7980C7D7CB1 2IAMPARROT3
914,140,398 *5F2EE946A4422D9EEF126E901A3EF4CA2BDBE068 2ILUVIRONMAN3
914,140,399 *5F2E5F0E34E30170EC513CBE49BCA2B368FA9E28 2 MAORIFUEHRUNG
914,140,400 *5F2D32B441AC118E75B326D736BC3ADBBAF28868 2MARKIGE
914,140,401 *5F216ED962E2EBDAEDA9C484050B10865651F17C 2panamakrankheit
914,140,402 *5F21F9C8609F5B895D5E0A5C96635E4625227DD0 2puhekielest
914,140,403 *5F205499562B6BDFBA465F106F43BF8FF558543C 2-QUECKSILBER-PULVER
914,140,404 *5F283B4E9FB10A85AA76E3B14EAA622FD69C5F71 2-SAVAK
914,140,405 *5F2ABC93435DDB6E317AA45DEE90289C88ECA690 WVL1501
914,140,406 *5F2418533DBFBB706549926EFC1076304B64AE94 2WUEAAAAIBAJ
914,140,407 *5F225C667F103EDEB9F4B3410BECF33E384B6D5E 303709 DERZEIT-HAT-BOEING-700-AUFTRAEGE-,-AIRBUS-500-
914,140,408 *5F2EB02E2901FA28451EB2470B39F724C6978F74 3>~0~o}o{
914,140,409 *5F22D25098B68C832A65F6F08696FB928C901BBC 31nov1049
914,140,410 *5F2FE01D1C46183BCF4E9B6E767A258D458207D8 368jamarion
914,140,411 *5F2CF21F6841BE4716EC322464A3F20D0A8707BD 372954 illan aikana lanseerattiin my
914,140,412 *5F2ACDA0E241F94C673692775D0DB1C234936F15 37tietom
914,140,413 *5F2F46EC7A59BB0FC18F9B7C33A6830951443162 381280 olen-kannattanut-my
914,140,414 *5F27F151AE42B0310EB8D79789E88197F22268BF 3ACTAMIN
914,140,415 *5F2CEE8BC87A62CE089DD003E79B630B2FC05E79 3BCHAPTER
914,140,416 *5F22FC620E16D58D551EFC339E51C16BF9FE52B6 3.beizumengen
914,140,417 *5F2A93E1BEA0A0C078201D6FCBCDB955F851F949 XEVXZFXMLMWPG4
914,140,418 *5F2EACA7799C8C5F01A32FC99EF5A0C1E8569D1C [email protected]
914,140,419 *5F2A3FF29BE7CFEAB19E4FC3F7384CA2B25A9679 [email protected]
914,140,420 *5F27886A62DFCB9D7A9E8A64C72AEBBF90C18913 3eduard-schmid-strasse
914,140,421 *5F24CE885ABD6E30C71731211B556777CA9E8044 )X(O~0~.D-B
914,140,422 *5F230770E50189C7C38C6CB08031575A2D6E8BC9 XWBOBSW4
914,140,423 *5F2AEBAADA3E9AFB725D740F8A608B4AE3B14A75 3PALESTIINALAISESTA
914,140,424 *5F2FEF62CADC22FCD3D54CE866F29B4497A642A2 [email protected]
914,140,425 *5F29317AC992E69544C36D8F9B5C228D6CFC5147 [email protected]
914,140,426 *5F25ED07E388ED0782FE2027706ED6E572374D5A 4.endrenditen
914,140,427 *5F29C059DB7CB0DDD751F4C6062C817686E7102C YLDEVIECREPNU1
914,140,428 *5F286E510237616E9A9A94807F628B021F83CA1E 4ITALYJENNI
914,140,429 *5F2FDCEAA51F49F680E96B7B30846A519E250A0D YOGITHA ALVA
914,140,430 *5F29B28DBB56B740AA15F5545C82813F4C405F57 4MAKLERGEBU
914,140,431 *5F256246E00782508E4686FEB1E33C8AAA0B0270 YOU'RE.NOT.THE.LAST
914,140,432 *5F2DD3AAFDFE572382030BB752FA6B6555DED55A yourjointtonight
914,140,433 *5F27E9C16CE1B95FFFAA3F1837C3B0F2FAAF4105 youssef.moustafa.mahmoud
914,140,434 *5F2A345F2B2268194AC622E0A3A10D67E61BAA99 [email protected]
914,140,435 *5F2CD3143493E3C13E553D8469EDD8F864268F84 [email protected]
914,140,436 *5F2CFF64DE812E376ACF85B38BF6CB5D2A4537A4 yuentshunkian
914,140,437 *5F2FC537BD3BE0CFEED25FC098630114CED71073 YUSRIZAMZAINOL
914,140,438 *5F2EDDEFE41E181CA2E92B50D3610394C80BC20C 4TAPER
914,140,439 *5F20024A13C68D50F83E5BF2FE3D271841471109 Z161035
914,140,440 *5F208835CD6961C660FEA5C6C4DF98DFADD4252D 4UFATTELIG
914,140,441 *5F2B3464249D4D952F6020B0BE806B848231152F ŽÁDOUCNĚJŠÍ
914,140,442 *5F21D4DE27EFB1CEF8F031E72842F9FF59687A17 ZAWMIN THANT
914,140,443 *5F2083ACD63D3387A00EFD817368CC6732862696 ZELDINE.BOTHA
914,140,444 *5F297695D68B401D20B8DD730BBAD36CB0E88B46 5BSWINLETTED
914,140,445 *5F223B2C7A4265FB68A99C47139767856D5058FC 5debaucher
914,140,446 *5F2B157DB1F75825D7263B69CBBDF8F450A7C63C 5EZNISIUR
914,140,447 *5F2D40DDD66B70E3DC891F51B31586199A855A8B [email protected]
914,140,448 *5F2B46AB22A3DF1E3586EBB92652116F55D02481 [email protected]
914,140,449 *5F233E24ABB39A40540983B0631CB2AB2139519D [email protected]
914,140,450 *5F24F28F2D865462FC17857C487A1CB7E0FEFAEB [email protected]
914,140,451 *5F2C085CC1F059E218E6DBCA2C9025D07E1DC2D7 5ISANETBSW
914,140,452 *5F280B912853A9EF15BB2A0B73B50A7B1496E911 zoren.capistrano
914,140,453 *5F2D89C4284FB6E7330E5A79190DCEA6FCF6B34D 5LUKINUKD
914,140,454 *5F23D2C1204981B498DF1308DCDF89C086CA973D 5POIVRERIONS
914,140,455 *5F2EE80B369C90851D197C4CC398C889A46C889E 5RCHTZNNG
914,140,456 *5F2AF89A6B1C97B87BAA4A0643A83D08B2152744 5SAIBANSE
914,140,457 *5F2F5CCCEB9A6868E51B7A8ED8C6129178713541 5SCHSMTST
914,140,458 *5F2D3080995F68D5A5BDDFEEB552451153FDC33B 5SDNALDRAY
914,140,459 *5F23AD6F51A5C508A49A2660796076D96E4AF624 5SSEN
914,140,460 *5F23D3A64A2E39B39F4D399F778871183F96B16B ΑΝΑΣΤΑΣΙΑΔΗΣ
914,140,461 *5F2BEDFACC86BC9181F0FE52781759EE029D155E [email protected]
914,140,462 *5F2B18F5FAC9BF1E4CA33FF7CF05F018C0469568 5.unfallmeldung
914,140,463 *5F25AE93B007617B333D9775E5BB56608A62EF1F 5.VERDIKLERINE
914,140,464 *5F263E4D073C9472BE5D84A3646BDE5157DFDC0B АНТЕПСКАЯ
914,140,465 *5F27D44F031963D98F898434B6F022FB79F2E4EB атрпатакане
914,140,466 *5F24E79FDF28C2FEF7C79CA274FA4C2C771D0450 68 SCHWARZGOLD
914,140,467 *5F207422F4862064E7A6827213D5B6E8DC3D040A дитячі
914,140,468 *5F2B362D9CE890F8368B16BFA8AD34D99252D4B8 6BSWHERSHELBSW
914,140,469 *5F2383009FA67C7B7F090A1B817B1AA362D18F1A 6BSWSOUTHARD
914,140,470 *5F26BB3746153FE47FA618775DDB2AE0E7582589 «ОБЛАДАЮЩИЙ
914,140,471 *5F2E81FFF47588055C569746C9BD9BA494BD9146 подъезжее
914,140,472 *5F25E0E19910017D57A7CE03BAAB6C10721547EE ригелиан —
914,140,473 *5F2D68958FC3BC31B0961F5FD43E24D3AB264530 6 KREUTZIGER
914,140,474 *5F2E1E4EF5D638B3EB94172B291439C420DBF9F2 6PLACERAIS
914,140,475 *5F2C178CC7B949B2BBE6D0EB6F6562330826AB2B 6TREEPRUSU
914,140,476 *5F23968FA3E0C41C7F97E7AB7CED4A14C9265CDF 702CALEB
914,140,477 *5F280897EC8782B127A9A6CF532C9FA79C67682D 7BSWSUDALAIBSW
914,140,478 *5F241566B57039FCFE19E88A82DDAE2D3E838307 盧瑟斯星(lusus):高重力的工業行星,居民住在稱為蜂巢的地形裡。為拉蜜亞的故鄉。
914,140,479 *5F20A1EDEFB598F5104C8313D948FBC707466F6E 7NEGISSUH
914,140,480 *5F289C2B9139B891506C6C7419B5D5DA6192CADF 7NEPHROPARALYSIS
914,140,481 *5F21FF1F28968C1556E061CF5B8860AE401AD772 7VERMEILLONER
914,140,482 *5F28D248F9B14852ED34462C5A4FD86D28A30E8D [email protected]~0~o}x{
914,140,483 *5F2EDFFFD321F7A39AC636BD2147A59D18E697CD 838194 seminaarin avasi tieteentekij
914,140,484 *5F28BEB96A1CD07C54CEED05013ADC51C9197D63 8BODSVANDRINGEN
914,140,485 *5F255D85CF528EA88C62BDD531642F3F4EDC57F1 8BSWESMEBSW
914,140,486 *5F24D91C17FC24E9C6EFC0B44F2CE59DB23461D3 8DF
914,140,487 *5F2565F915C2E09BB15FFC07F60FF6123FB48145 8NETTLERASHES
914,140,488 *5F269B23B6539F41E295AAB8B6EB91F04E01F332 8paraplegics
914,140,489 *5F22EADD4E528AC8A87E3A9C3171B64F9DE1FD82 8THEJENNY10
914,140,490 *5F2DC96DB884C1DFDFA710F983A842ED782588A9 8ZEBIGNIEW
914,140,491 *5F27175D4C6B2A525DF52FC7804ACBC4B98A0FC9 8編碼,也被其他作業系統所實作。一些類UNIX作業系統,例如LINUX,也實作
914,140,492 *5F2C80B97AD2FC9E97654C4E1930F2A44C0C65A5 09-15-1046
914,140,493 *5F2B1F56DF09DCC5F195DBC1BA776F4B9C4323CC 98fb95
914,140,494 *5F221CA0710AAE6772FA06D3E64B80899AF188C3 9CAESARSTINKY
914,140,495 *5F24FB69A22B30082C0F9C7B402F90D313B58FBE 10-sikir
914,140,496 *5F2284D80F506D0A501B662AC2D51BCB68F7C270 9CONSTITUTIONA
914,140,497 *5F22FA64B74DEE643E742FB3AF8D0C1D1C8E7900 9CZECHOSLOVAKIAN
914,140,498 *5F2E10A563657AEDA450F2D3E6D6AED5D45874FD 9JBEDWARD
914,140,499 *5F23E8D4D1EEB2A7FDF4C0FD86719D8B4F4C9FF7 9MIELTAEAE
914,140,500 *5F2BA5A2172E5FCA727920316E6BDE46BD8973D8 1619445 asiakkaan m
914,140,501 *5F2A46CFE09333D46C8F78E850F6B0265D5F4DDA 9PRESCRITAS
914,140,502 *5F2E4F838BCBD07246F2364DA4C2D93CA102F5FA 1975MTC
914,140,503 *5F2443EFBC395096171BDDA4A6897918F55045FB 1awmgruppe
914,140,504 *5F272071C78585D76B88CAF5463249677D69C80A 1BABYG3
914,140,505 *5F2C8854F49BD6F5A65485761D483BB8393FBBA1 a(2
914,140,506 *5F2960BC3A4390C380945DF15186991B7E2C4735 a3nvl
914,140,507 *5F2FA671EAF54733DAC126911C8367DA6A106C10 1-GOOGLE:LLA
914,140,508 *5F284B72E76419AC8CA6AD1B8FE75C7347C06893 1HYPERCATHARSES
914,140,509 *5F26CA4699D524D5E4D94C2621CA47BA649F9401 a99r3550r5
914,140,510 *5F27CA638B7C7262ADBC341C194833A9EE3BE8BF AAA}"F
914,140,511 *5F2128E70228D61DB4F9AF7D5186733278449321 1-ORG-BORN
914,140,512 *5F21B8411448446670123EA89E14469E53CDB36C aab9_
914,140,513 *5F27F8288DFE5DB4CC4FED4B3D25B80491B5E2D8 aabriu
914,140,514 *5F2E74376EFE38A34DC100DF3A014F73EB481D68 AAC"/I
914,140,515 *5F2F815F2F04474A5CD0C6E688D62E2356910FD9 aad,kj
914,140,516 *5F25DF6E7DE5DEF84F3ED1B8FA8337B68B46AE45 1 slamfinaaliin
914,140,517 *5F28B326AC2DB01169366CA8AAAA8219858DD884 1.spdbezirksverbaende
914,140,518 *5F2D6C3C76776B4E8F62E495746AAF8D7384668E 1 THEM-YAEL
914,140,519 *5F21A5A85AA49D192D51ABABB1073410DE3932CF 1-vaaniessani
914,140,520 *5F2D6E2A2169BD126CCA996B0855DCE0CE636060 1.webmailpalvelussa
914,140,521 *5F2F5BEDD58FA494E8550CBD4BD0E2C2FE98448D AASVOLBESSIE3
914,140,522 *5F2E4590A2EA9CFEB6213CC5A7EF4F5E18E43B81 2006WATERSURVEY
914,140,523 *5F26278196EC691CB4FFD6A9AF829F32D7515B50 20080725: new jersey performing arts center, newark, nj, usa
914,140,524 *5F26B7247C22E8361518F3EC76A57E54111DFE39 ab2g,
914,140,525 *5F29D621EE77C1BA70601B111C54A70A98333CF5 2152125 ".WAITING.ON.STUDIES.IS.NOT.NECESSARY.,.".ANDREWS.SAID..
914,140,526 *5F21758495B297A05EE7B11BC1798442EAC7ED16 21-suosionosoitukset
914,140,527 *5F28C8D79E2EBF2F6AFACCC20C41096B524A388B ABGSYGAN
914,140,528 *5F2C336E3442AB4B11E3D882293A0137DC6615AF ABU=/
914,140,529 *5F2D9E86CB6B4DD99023CEF0F8050C88D9B78997 ACAH)
914,140,530 *5F2082F33A5DBD1492CB2606B16CC22275ADADAD 291ALYSSA
914,140,531 *5F25B0F2BF8E7A4B586E2E18D226CA0D1850BA6B 2997349 ESIMERKIKSI-VIRTSANPID
914,140,532 *5F27ABE80C57D0E4B413D5B2D41F586BE61AE9A1 acfbs
914,140,533 *5F244299B4D5B66E4EC67C7455747284EA7986EB 2EADROLLS
914,140,534 *5F298E87B70C0D429F1BA731D3DB90BB78199385 ACURAGRAY5
914,140,535 *5F2D8B5268127D2AF645692862B3BB4A7A890DD8 2.HINTENDRAUF
914,140,536 *5F2767BCEFBC6E6F57166E06AC25B9F41F7F6476 AD6E66146EA0D396547F0E5D8AAC1E1A.ACCOUNT20
914,140,537 *5F2897D09EBE0B32D9BDF99B4A39889D9F8931BB ADACHOUTAL
914,140,538 *5F27085D7BDF17C75C5C5B0B57FC35C167E25332 2 NYPL
914,140,539 *5F2C9ADAA8972392A95FA7B645A4FF3BF62FC3F7 31APRIL1574
914,140,540 *5F2833429EEC7265438814536FF46D98FABA5B5F 342816 UO5 ORTODOKSINEN KIRKKOTAIDE TUTUSTUTAAN TAITEEN TEHT
914,140,541 *5F2D5220AAF0FD297B9CCFA1B28A5EC8AF8ABC24 384BROOKLYNN
914,140,542 *5F2CF7D68B3131CE68BB2C4BADAA44DE0C5214A0 Age-group
914,140,543 *5F2794A9094F26FCE7862172DC8133E8D2B4F7E0 a$gfd
914,140,544 *5F24B75E870AF4CBDA59E053B0E92B3E1FC787BF AGOVERNORSHOOTSBUTHISGUILTYPLEAISWIDEOFTHEMARK
914,140,545 *5F234482A887A28CF2A7E7F1A984C8DC4AACC729 agwd;
914,140,546 *5F23166C7B8D8027C0BC7293C3E18497DEFF3B76 3-KULTURBEREICHS
914,140,547 *5F2D6FDAFDE278FD96CE85F2BCB6B56FEC07B516 A&IFB
914,140,548 *5F28ECF4A5DA86B99C7D066732EB3CFC5475ABC4 A/IV8
914,140,549 *5F24AFC1AA3C74683D02B799C1F132AB368AEAA1 40 TEAMWORK
914,140,550 *5F25131F62C3F48325FDC492D7AD279F7ACF3DDA 4198UNO
914,140,551 *5F20B2679C7F7BD7152B28DF6BF9C68339122899 495766 alanIdUzlemiSler
914,140,552 *5F2453159E7676720B0178F8BC2068A316404A70 49.arvopaperimarkkinoiden
914,140,553 *5F27875B81ACF18EBE11BFA359CD30E670509876 4AHY
914,140,554 *5F26AA27BB35C315797AAA82073E009B5168078E 4AMMACHEREI
914,140,555 *5F275D1FD4E88FFC2F715BB30B1BCC50567CA369 AKW%O
914,140,556 *5F2DA2B9136CF7796724CCCA46A2291798260C86 4CAPTIOS
914,140,557 *5F2C1FF07E8D0210F464AF673A2696B5E2BBD246 4DYNAMOTH
914,140,558 *5F208D6F604C000A6B931CF4ADBB0DC7C0EAC705 4ep
914,140,559 *5F2695FD70A1DE247291850733AF1BE794D8D2CC 4HARNITHA
914,140,560 *5F20067465E7DFE73D236980A8B479EB5BB4B4AE ALDIVAR2
914,140,561 *5F288CE2F7285CB5356449E3E643061AF441F01E alechousner
914,140,562 *5F2D4A74626DC1C9ED0CD5A8844ECF81F97F7AFD 4KRAHLINGN
914,140,563 *5F26711BBA3731C5F52FB75982A30E0C7A35C10A 4.laatustandardeja
914,140,564 *5F2E1D1CEF284793BB3E3F86955F5AF5A2060A13 4MORTIMERTRAVEL
914,140,565 *5F2988E7EA8314D543BC608EB9612E6B434DDFAE ALFREDO.NEVALA
914,140,566 *5F224D0DE14C44BF6EE997AB5ACD07B7C36DA2E3 4NTILOTT3
914,140,567 *5F2298DA60672334DA88C46EE91B8219231CD18B ALICIABFI0
914,140,568 *5F22D34FA33E0D7BB40051F4D83BE3CC6E4FBEE3 4PIZZATURBO
914,140,569 *5F28801FC1F03C5C3B49FFE0CFB681C491D946B7 ALISABETH0
914,140,570 *5F214CC374B80D5CC0D7E16224965403F870BA4A ALKORSZAKOKKAL
914,140,571 *5F2368A27B856D0B678CB27BF76A11428F61C1FF ALLANCARO
914,140,572 *5F2D3D833F6CEB214F411681C875674C6B4973AC alonsohaen
914,140,573 *5F2229112A71BCB565090BEB46ACAA21EE72FD33 [email protected]
914,140,574 *5F21B815EEDEE96420B331758F14E1E512304778 4 US-OFFENMARKTAUSSCHUSSES
914,140,575 *5F208C144927E4A92151F789F8AAF400747BB2C8 ALTHINK1
914,140,576 *5F288A0FD7BB16AB47CD2BCF6164EE1E434AFDC7 [email protected]
914,140,577 *5F2666424F32B13D74F79818C5F411738C482984 alusvaat6
914,140,578 *5F23C82ABB62EF3E8AA7611306C66720E3998E15 alvaochsenbein
914,140,579 *5F2A96A11F4E58351BBC238CDD72C600F388C5AD 512191 ankara.:.gazi.bUro.kitabevi.,.1991.,.ss...31-47...c..
914,140,580 *5F2ED6509C32194DB59553190A1F509922572909 AM4#O
914,140,581 *5F2D898521A5A0A870D4B70749101CA7A3CCF397 ames-amzalak
914,140,582 *5F221857DD2E9F5EB238FB37FA5097BC522F9CE4 5CARATSES
914,140,583 *5F2B2E88CC023C2B79AE236756EBBC387C699FB0 5GENIUSRAISTLIN
914,140,584 *5F2301EADBE6F8EDB06682CFADC20070AEE4A6D2 5GRAINIE
914,140,585 *5F28C5A4EB7EF213D011C459A4394F729B409ABF 5KRISTENPUBLIC
914,140,586 *5F228449887D136518293E1F3A840829636E1378 5MODULATIVES
914,140,587 *5F225C5A848FD85E276B34EE7E30FE5999549A45 anfua
914,140,588 *5F2C3F347304F9031058004C26E7AD98EE85F6D3 5REGISTRUM
914,140,589 *5F250012D0724197AD3744DE5E3F3809C60618E7 ankaaksi9
914,140,590 *5F2FCAC75A73A767BEA25F16187DE9351B5FBF9C ANLQN
914,140,591 *5F26F4E43E3E3A02E3B4C59CFBE999EE49DE53C1 5THEDIESEL1
914,140,592 *5F2A18BEBC68E263695D321C934869DA2C59CD9E ANTOINEMACUMBER
914,140,593 *5F23D785D4CE3DFE138A57BECFEBCEE3AC53DDA6 antonioringuette
914,140,594 *5F2B9D469A0B40E16E7944655AE5386B283DB6A2 607603 BIRSONRAKIYAYINDAACIKLANACAKTIR
914,140,595 *5F2C88D341FC22D40455269488146B3B89EE8990 64DDを接続したNINTENDO64。撮影日2004
914,140,596 *5F2FD77A1DEAB9F74DADC09F4572A56E30DA21D3 APHAN9160TALK160
914,140,597 *5F265C259928F3EE6F1F667C6DD2FA2A3B5F5D38 6DEMANDINSTANTLADINGLAWSUITLAYING
914,140,598 *5F2239931634166B04DC4657D190E6B59D72F6C7 6DEMENTHE
914,140,599 *5F204240FEDF5D81D1688F83CAE59F9376282C8F 6EMDMWICHVYCIP
914,140,600 *5F28F6F83D2FE108727011D75D46B43FE057CE1E ap#v$
914,140,601 *5F209250AB9758F1EF24D4E9A2F82D82B28DE2BB a%-q_
914,140,602 *5F256230A9A4D1B3A85B9400C0C418234E29877D 6FUTUREPHILIP
914,140,603 *5F2E43C0897F7C4DDD3B6C18682D73E5E8011FE9 aq;vp
914,140,604 *5F29FFB85F882A3A3B10F2E4CB19C36D732AFA9C 6OLIVIANASCAR
914,140,605 *5F27AF7FF7B64E751CD12C918083651AED469DE8 6PANNOGRAFICA
914,140,606 *5F2C46098A45C7A386B67C1C2786EC6A226A4AB0 6RABBITADRIAN
914,140,607 *5F242B536DC93EBA456D73ED450D2E59E5D758F7 ARIELLEGO
914,140,608 *5F29CBB60699311AB122DD8E2CC5D71A7AD95D03 6REPAROS
914,140,609 *5F25D4FAC1B1148FBCCF4595E56A897AD96F079A arisha
914,140,610 *5F2E219E61A83BD1C4E01714223C29C05FE0D842 ARLEN.PATTEN
914,140,611 *5F2F04B0B8117A2041FA59333C68BA30DA318C87 6UNDERSTRMMENES
914,140,612 *5F2EFEDB2DF612DD076ADE49B6DBB7EC40C3135A AR)R3
914,140,613 *5F233ABBA78E4B5F0ABB8A7C9EEEAFE586FFD0AF 6y8daaaambaj
914,140,614 *5F2457A6F99CD32B66E94323993534DE3264752D 77316 ` BEN HER SEYDEN EVVEL BIR TURK MILLIYETCISIYIM .
914,140,615 *5F291D7BE1A89807DBA1A014D12D4156F7F5DE60 78 YAN
914,140,616 *5F2FF19B1AFD7D7DDD601BA352328EC5A3BC5A8C 7BROOKEMUSTANG
914,140,617 *5F2B0797DCFA0444421919D4A32C576E2F7CB16B 7BSWDAMODARBSW
914,140,618 *5F2F8BC45A4E9DED5E7DB9553DB050832C16B0C0 asdfjkl;sharon
914,140,619 *5F2EBEFE02B0DAAD154C6A29A92D6683F31AF87D 7FONOLOJI
914,140,620 *5F2046C1EE3376E19A91CFC6569B6883BD1CD440 7GALLYES
914,140,621 *5F27B0B95ACEBB2488A33B107A2AC3333785CDF6 7GREENDAYTARZAN
914,140,622 *5F279D6F97084E95DCABE2FFCBB30A420510AC6D 7HVITAMIN
914,140,623 *5F2AD0D434EB12F84A0633D0151FC90F46926023 7LICERIOBSW
914,140,624 *5F22036ED3BADC621C58FE6B8C5034CA65C42B5A 7LIFTARIS
914,140,625 *5F20FD781D8A5D63F60F51C96DEDDA203523901B 7MYCOLLEGE8
914,140,626 *5F275F8B8A20319CDB772D0BFA06E7EF7BF76F26 7nubbier
914,140,627 *5F2422B96F4FC8F5E21FF65621E3412D433B3098 AUG&L
914,140,628 *5F27497FE5E565082BEFDC8D36DD76B05CBBBBE6 7theknicks
914,140,629 *5F23F3E2099A5E8239E702DF9AD59836F3EE7F37 7 ZIELONKA
914,140,630 *5F2792084527C0FFDE66001D5582A0C473287439 8088
914,140,631 *5F225D431B8B2A1ABE80D9E779A882CF7E1A242E avforlaget
914,140,632 *5F23B56739ED6B9F2823E3338A61199EE6D4D402 AWLAW
914,140,633 *5F2EA55453DF50424B062EB672CF64E9C1833194 AWNSQ
914,140,634 *5F2BB0396865830C01E6AD9C76FDE0F168E220A5 ayboz
914,140,635 *5F2EC74D58BFB06A12765262C49E60481241FC2F AZF8V
914,140,636 *5F2919612792E301E5DAB58B72B04791313001C8 AZSXD285
914,140,637 *5F2F09C61864AE6C524D695F1F357DCB27B2B970 B091086
914,140,638 *5F217AF56EE0711F8AC344218C4FE297D56B32F4 B167720
914,140,639 *5F23AA62DB76DF754ECC9E6BDCB0C561F7E45897 B1O3
914,140,640 *5F2FCD0DC2CA25AC46EA3C5CB56F5110C0607E07 B2%L
914,140,641 *5F259F3AD7AB401FFCAA3FE658A47D525E1BCDC6 b!59_
914,140,642 *5F2BA5464EAE4CF647E1F96562B36493C20921AD B5FTS
914,140,643 *5F2C9F694887744597FC11469DA5DD6561F606F5 8TAANOCAI
914,140,644 *5F2825DAB7B57AB224B01319C09B0863EC7C135B 8TANDIGES
914,140,645 *5F2B2117792A3563B4A6CC66A213CCBBC676D9AD 8TETRAPHOSPHATE
914,140,646 *5F23BD96723EB72D4C28CB8DA878C29515FA9679 b7eey
914,140,647 *5F2EF6FBC14B9BC47CBA5FCC98AEA6E102A4652C B9S/B
914,140,648 *5F263928CC1C5E0F2ACB5B12FADBF68C948F777E 960481 SECHS-MILLIONEN-EURO-KOSTE-DAS-ALLES-.
914,140,649 *5F2998BA6ADBA7FD4B4FA79BE4F014B4D33092A9 963jaylee
914,140,650 *5F20A1D7031BBB029AC8B3AFF147CBA3F50E0F0C 9BSWJERUSSELLBSW
914,140,651 *5F277A82671017781F50CAC435A523F643FAD828 BẠO NGHỊCH
914,140,652 *5F2D96609C4DBA3D066F0206FB40722271AC1A8E 9GRAYVIRGINIA
914,140,653 *5F2E9B8CB94CAEEDBEDCAE644140D4CC52379083 9IARNIHS
914,140,654 *5F2AAA695A97CD0EB240374CEABDE0692DDA89AF BAtj
914,140,655 *5F26D0EAE2925B3B88CF74B31191FF45085C62C7 9MIKEKOWA
914,140,656 *5F23A0550B74ED15A2E92E05A433F335F1B769FD bb_qu
914,140,657 *5F22607914BAEC29895E911CFC8786728565FDFE bcd
914,140,658 *5F218008B0EED62C8D4376985D743ACDDEDB8D11 9SAMBUDDY
914,140,659 *5F215993F266DE4A617C9D4304D9CD61E0CECAA8 9SRETSIGER
914,140,660 *5F2BFCAA3CAA40CB7441815E6860ECB2483E3DDF 9THATACURA9
914,140,661 *5F269D5E4311527DCB88450079DA6EE2F54145BC BEETHOVEN:ADAGIOSOSTENUTOFROMPIANOSONATANO.14,"MOONLIGHT"
914,140,662 *5F296A704F7D060EBC7BFA3D9395DE4556BFA24E benandpk1
914,140,663 *5F21734FCFD3538F0994D215F928C98C146D0DA0 A4o_
914,140,664 *5F2E181678C412E3B7521D94F06A2C84E77103B4 BERNIE.STROOPE
914,140,665 *5F27718EA6B9C7BAFA12210956956DFBBBEDAEA1 a$7$=
914,140,666 *5F24FAB663CB5A8FFFC7147189AD0049928D7550 berueigung
914,140,667 *5F22E930897E01A69B4FAD7A51A689755752B902 a,/.8
914,140,668 *5F20C0F6D69D5A0CB4405869492D90928188E1CD BETELISSÄ
914,140,669 *5F255BDAE078B715F46113FBD559DBAD5FBE91C6 a8w7c
914,140,670 *5F2ABF300F7D3386213F70EE3EF62A2297374A52 B/FBQ
914,140,671 *5F2296B4313A2BE2EE974B1683DFBE40173B4D04 aab1s
914,140,672 *5F2212226F443621D94A494E81BEFE1A55C76E63 AABX\(
914,140,673 *5F29FDACD28417A16CF0725E7DD6BFA90E7ACF9E BH!E
914,140,674 *5F23EC739B68A97AEFA9FB43E78D9E54CE64EE5F BID+
914,140,675 *5F295625CCBA439B9EE5FEE8AB357D551227E404 BIG…
914,140,676 *5F285AF887EDAB016AE38712B16C53BB209BFE9E big%f
914,140,677 *5F25D123F6B3CC50FE6494081E60542A518807B5 AAEOQ6
914,140,678 *5F2F32CA5CAF4DA85222EA961871C2C2FD36653F aa:jv
914,140,679 *5F2AD31F778B780C6323282DA5965E4B18E3B2FB AB$_
914,140,680 *5F2CE3F02FE73FAC6F061C2E6F93D13CEE0D2836 A(B2T
914,140,681 *5F2C35F307E7E3D2A11131BECEE4C90C791A139E bk5g+
914,140,682 *5F279C0257FEFBFDC78D22EEB10B4F7BB54C2744 ABASCHIARDI
914,140,683 *5F27F0B22EA3A8082BC544FDBB70BD991B762027 Bk"7
914,140,684 *5F2C378FCC02608F5E7B8151870642F59752B68F [email protected]
914,140,685 *5F26B364ED50A3E433205658D91F7986C0C4B772 ABELPAULUS
914,140,686 *5F20A77F99E549423DAC64B0EFA3A9270726A0AC BLBM
914,140,687 *5F2B7BB66EBFFB0923530393490EF93848845134 abrasioned4
914,140,688 *5F24A5510DCBB9033F9A4A6F138EA3631D7FBE83 [email protected]
914,140,689 *5F2F5BF153C739C4D7E1A3532292C7F54A92FFE1 AC\A(
914,140,690 *5F244A5726285DB280E0F7B8F71B14745F6D92BC accept:text/plain
914,140,691 *5F2618020482564123198F514FFD68B972F4A25E BMN)U
914,140,692 *5F2E601619E9E738F2442625175326FE92CBBFA5 ACTONE:NONC'
914,140,693 *5F29C4D4CE7BDD783791480A940F78505C9FE63B BOBBIE.BOWLET
914,140,694 *5F2EBF0C0725506C1458B4ED6355F75E4AD9AFDD a)cw
914,140,695 *5F2243504A03D172633FA19221D835571C5A4FFE ADBU!
914,140,696 *5F29B5E0E3F591B2A52B9F88D9CABF02932861D6 BOURR4SQU3S
914,140,697 *5F215C008086CB9E24666826F526A70856FF05DF [email protected]
914,140,698 *5F240E2A3FB1508B7C4D8501BED7587CABBE5B5E b)p0g
914,140,699 *5F294E0F39B9F6C5098BDEF48F420F42CF9AEC1B ae130519
914,140,700 *5F2BC1BD2839B171F8D037B54720178139B32016 bpp,s
914,140,701 *5F2850D4F10CB7A4608E445D207796585A42492D B------P`)X(
914,140,702 *5F243635195DE4B68DAB8AFD85FD2B3E533E7CB2 bqaoj
914,140,703 *5F2329F3BB2E7D4BD5E925122ED73D4F6A2F8386 br_9i
914,140,704 *5F2FA9B764803224E88EE69E1632123692655DE9 bradleyjolley
914,140,705 *5F26E1951768C1347EF53B05E5E9643D8CA9D8D5 a,fsq
914,140,706 *5F218D8A02BB183832D438291A508441FE59B2FF [email protected]
914,140,707 *5F27FA412D7A050E91B89B91CB66B560BCD63FE3 a!gp?
914,140,708 *5F26EA344C5DBEC4BF143A113A16602ED4ECC32E brianboomer
914,140,709 *5F2060F50B8F350CF3CA6F9E51DF339C62D9034B BRICE.SPILLETT
914,140,710 *5F22B1FB4391E7C4ACB9BAAC383507B54BFD2DB8 AHUEQUE
914,140,711 *5F2D4766586055A63405FFCF7101C85210CAD4AC AIDENHUFF
914,140,712 *5F2976376803FB9C6F6330D04E7DDCBEE78943E0 AISKUTUP4
914,140,713 *5F23DE3718385091DBDB35CD53834DBBEDE4374C bsa"=
914,140,714 *5F2D4887DEFBC98571ECD8CF1778EAD9C5A619F9 b!-t
914,140,715 *5F25A5BECCC912138DADE33544DECF5C9C65A37C [email protected]
914,140,716 *5F2169E4B9B65D6BB97841258619625219DAB658 BUIGENDE!
914,140,717 *5F20F65DBB54CD160E7776250D73389A5BBB1831 buo8s
914,140,718 *5F23BAD900172128A270D290F88C39BB3677B684 burgesos1
914,140,719 *5F244DFFA94C51ED16232FEC50196FD61A415077 alexdisalvo
914,140,720 *5F25ABB765FB4CD6A8114E587A91AD5175D7D03B burtbunt
914,140,721 *5F2265D9CB15DF626FC96ACA03E9BAD6AA9A0B98 [email protected]
914,140,722 *5F2930CBCB13078A36629C7E393DB56055AB58C5 ALFREDHAUTAN
914,140,723 *5F2A82FD3FAE17A62960C7CE4E3E00EBA40D48FD ALFREDSTLAWRENCE
914,140,724 *5F23515701380C3B0FE8AA6853DDC30CD429049B BvcK
914,140,725 *5F2894EB10DB80342236690A04EA139739A6939B ALONSOBARROSO
914,140,726 *5F2D60E117C7FD84C97BDA47022CD8C0CA07890F bxf+f
914,140,727 *5F2028552391D5A50E0E47FFAB749E633589D4B7 C0KN&
914,140,728 *5F26D6665F2CFEAC2F94EF3A9FCDE047D49F8554 C0NV3RSAT0NA1
914,140,729 *5F2518A594E2BFC47B7DCEE13B24BCD62F40CD1C amfenikole
914,140,730 *5F2D8FBF68DB97F3BF93B868D48E168DEE6CAACF anadesambiguacion
914,140,731 *5F2A10D53317DBBE84DA19A93677D58D1877B54F ANALU
914,140,732 *5F2C741F96BF503AAB4951DB12C423C3E6BA4833 C9F=
914,140,733 *5F2D8520E4106CDFB3C485D193C28B39CC260040 ANTEVERESLHOS1234
914,140,734 *5F23E30B6E2C3E5FC0A074F39885A43126B11FEF [email protected]
914,140,735 *5F201181AF1702DC78435AA589E8688835EBEDBC CA REDEMPTION VALUE
914,140,736 *5F2E6387EB14B725C568853EE5DDB53CF2B4EF85 ANTON.VIERTHALER
914,140,737 *5F2B6312E38D0DF1427A7DA4D951A2DF79F145BA antwangallarello
914,140,738 *5F23F4F9A0D2DA2634574D471E2A27094DC6970D CAROLINERUSSELL
914,140,739 *5F27167948AC29D793A2101E77206D5864A70B0B AOKLD
914,140,740 *5F27C38BED0E1DE7B8DDF3C0BB1EFBCA920419C2 CARYGATON
914,140,741 *5F22F8661401025CF9B58E8F6452E6E667B11638 CaseyLeBlanc
914,140,742 *5F2015C634E4AA85FE0E5AD10770CA16310A2985 CATAG0R35
914,140,743 *5F274E7E4649248864ED5FD1E3CDC3F48D719C72 CATEGORYCLEANUPDUNC_
914,140,744 *5F2850117E8C9FEB3E6EEFF10AD6250FEBC5E480 [email protected]
914,140,745 *5F2F9521AB125226EF9D9D1BFF371CE198ED59B2 C:"!B
914,140,746 *5F21F080D18D929D65A962116AE708BD969F6E09 Apt,
914,140,747 *5F24DB3D153595DD81CEBC636A5A0189553A5370 c:\documents.and.settings\firexware\desktop\crackstation.jpg
914,140,748 *5F27876753A5B9C43B488AD9E7021860F8D14BCD argentina (get ready for this)
914,140,749 *5F227113FC3B17197537B023D6691173A5E55FC8 CECILDEBIEW
914,140,750 *5F2FD7A548CB2F66972254EAD5E16CAF5D1D9065 cedricvyhnal
914,140,751 *5F2B079A67BE6281958A4233F6BD797573457E5E ARNOLD ESQUEDA
914,140,752 *5F2A5074AE5CC46F3E3923A0310D96ED787963F0 ARON.LATHON
914,140,753 *5F29AD55972E4D9D8F084EF81EDD99069FD2F70E a=rq
914,140,754 *5F29AE25ACE3289E38614B11E60A6F2B89EE6D31 CESSEURS5
914,140,755 *5F2FE99BD07DC58CE17B4B14BF8AD6F000E93D21 ceuaq
914,140,756 *5F260805E233A5586B51BBDB117422E3EF5D0C8F ĀRUJĪKO
914,140,757 *5F22ED9CF05E905FD47FA00E37D0508F27569FB1 cf:.j
914,140,758 *5F21AB2D099F2D16218125D35EB8C1B715785ABA CF?/K
914,140,759 *5F270AEFE0A973811FB8875C04F50275620B0987 ascfn
914,140,760 *5F2C00D335183399CFBFD484C0597C4CC3A8F76B ch%$7
914,140,761 *5F2704B2615675D6FBA53CD2037F4C4DA4773B2E ATIREFER4
914,140,762 *5F287061DD0E9695B4DB3D35F48361E67432C533 chassidie-hall
914,140,763 *5F26DC1ED1C9D7F433D412A288BC6315F38AAA6F CHAZWIC
914,140,764 *5F22A1747C22819F5CE48CEB158F52F13ED7A76E atolls
914,140,765 *5F25B06AC7BCACCF06E2B16F0F110C2A9FF78D55 AUDREY636
914,140,766 *5F22799E9575266BE161A574987417C26092D8B2 AUGUSTUS.HAUAN
914,140,767 *5F2185E1CF6BF5171B2F7C7CC5CBB742C0E4F884 [email protected]
914,140,768 *5F2F884C3C2D3CC0B589954C2EC5FAEC08CEC1D8 auradnay7
914,140,769 *5F2C576AFB91B8A24CD70F1255984AE36202A2BE AURELIOALSOP
914,140,770 *5F2BC83E8DC4BCB566303C93C69950BDF655EA40 austinjuly
914,140,771 *5F2585E1391537248840695AAE15952C4DCBC06E AUSTION8
914,140,772 *5F2CFFAEC532EE748D739303CEFF1FEAAD94FAAC chrislampiasi
914,140,773 *5F24F7D5E29A8D39133F74E8153E30E1B2E325CA AUTOECCITATA
914,140,774 *5F24BDB4DEDA68B582EEB9C589932D3CE8008DDF avery,verypajock
914,140,775 *5F21D68321FC935A92C8CA95B31B008A0ABACFC8 chuckgrim
914,140,776 *5F2D4A624765C073ECC2B75FF812412388AFBF11 CHUNG.BATHKE
914,140,777 *5F2D4A61EE99B9EB62E9C319ABEEC9E310F61335 avkr(
914,140,778 *5F252A2779F23B06FE4F8DE5415ED0C0F98ACE71 ci)d
914,140,779 *5F2E592BF882132334E0AD4A723B48F332EC6021 c-iqa
914,140,780 *5F271352038EC2D3EEFE7ED69F85133C68C51AB5 cj0sg
914,140,781 *5F2913F78D06586621BD3C78813A75C9D0C045D3 AY3K
914,140,782 *5F2F1B4627EFD88E2161C43BABA003AE051D91BF C-/KK
914,140,783 *5F2F23E95F72956C3A68C54B395FC0C15F7B8542 CLDUY
914,140,784 *5F238ABEB6ABD76B8D1FA3D5956ACABFA937E182 CLEMENTEDOLEN
914,140,785 *5F225A73CC211A100DB6607BE3E90A9B1173EF2B CLETUS.GRUBAUGH
914,140,786 *5F21E719B24A0905DF1BFEB7A6AFFC4130DFECFA CLINT.FEHN
914,140,787 *5F257FA86E5B24B4385E7EA77A285B94FAB78412 B3MQU3R3R3ILH4S
914,140,788 *5F2FF14EBFDC5A027863CE16446F4F6743D038DC CLINT.ROUGHT
914,140,789 *5F2FB92945DD637E17157705DDF53161E9A72AD9 CLINTWATLINGTON
914,140,790 *5F227C83CA09BE5D9A3C197F364C2722176C1429 cllnw
914,140,791 *5F2B86A70FE5DA51E8652111DD66AF638C276262 b6-em
914,140,792 *5F2B833457AAF7A4C0D13835B3F382A9B1880843 C?-MP
914,140,793 *5F25031BAC4BC37205A2176DEDFD541812DA8611 B;7R
914,140,794 *5F2BEC58DDF54461464A2A6089CBDCCD7F418861 COEDUCASTE1234
914,140,795 *5F22CD2EACC980512A103D861CD7348339D69527 badzf
914,140,796 *5F258991A11DDDF8D3C3160E69A649ABA8C24A4E colbysimmens
914,140,797 *5F22D28137D0B5EDBC68F2939A64A2A178CC5AEC colesarnes
914,140,798 *5F225500502B4BF6A592376062384A50400BF889 COLLIN.ERCOLE
914,140,799 *5F24137312A1D14501D1B2FF1BDEC74098DEC970 COLOR-BLOCKER
914,140,800 *5F28DE92F670ACE8B3E6C548370CBD2BB6EEDCAD COMMENTS.PRO-LICK
914,140,801 *5F2A0FB2827E8E75E4A6863520E9D6EA1260CD7F barceino
914,140,802 *5F2F3DF5F62894915D56B59EF2FC9525E7FC2885 BARREASTEMMA
914,140,803 *5F2013EFF8D87084D89EC1928F670291C7A83E09 conniebobs
914,140,804 *5F2C2115D259088E1DF8A3A6FC4EA9920ADA583A CONNIE.OYSTON
914,140,805 *5F2CB052C5BA0824D57735E2E4F1660B6D990451 barryorange
914,140,806 *5F25E74E6D005D7C1C0EB70427B9085CCF1A9EB7 CONSERVATIONWDWPUBLICAFFAIRSCOM
914,140,807 *5F29BBE5391491FE947FA7549C104B4575E0C3E9 constructicon
914,140,808 *5F291897C10EED5EB37F59E0E761F85FD8E0BDB3 cósula
914,140,809 *5F2A4ECA38D44DE27D78DC8E30006DA253660BBC B-----B~O-~O(^_~)
914,140,810 *5F226C3B69DFDAA61D945D4C1F75F3EB56E781B5 CP0/
914,140,811 *5F2D8A7596BADD8B19BF55BF78EB6119DF27007B cr;1e
914,140,812 *5F27C984A3CB349629E7056FAF4C895754ED0BEB [email protected]
914,140,813 *5F24171A537D8AC73796D383E6A26DA3C01827A2 BENNETTGIRARDI
914,140,814 *5F2B938F90661AAAD1860EC1E5B31156BC654FA1 ben.og.lukket.som.en.j
914,140,815 *5F215709811C4FFC376E595106999163A10FA4F2 BENTBACKWARDSANDBROKEN
914,140,816 *5F21E7E00A1CA34D04F4639997D7A079BAFEE1CE ctay
914,140,817 *5F2006ED4A35BE51B43F727E6CDF4508B5A7B263 C.TGZ
914,140,818 *5F29C69CAE442172230D1B8F31D9BF4184A0292D BGBJS
914,140,819 *5F228E129B812083361ECE072BE5A9BC64884F26 CXE6U
914,140,820 *5F2040911D42F7036412305217FFF6CC29A236B8 bii#:
914,140,821 *5F2CD35118DA8A41E6A1E2B7BC1E1E2482E2EC52 czmgf
914,140,822 *5F202D137D9D3E7C8DE47BAEFF559C1B0BE0030F d1-8
914,140,823 *5F2A71FCDDC21F005EB0A009875AEB3710A561AE d"2(k
914,140,824 *5F2742484F835B4E73ABCBE4E3648C33F6551C55 D-2NW
914,140,825 *5F2CDF04FDE284FD075B5DD5746238394561E220 BK&P:
914,140,826 *5F2C2783346438A21D70FE908BB917D6FB796511 D6L0L
914,140,827 *5F2CFA33645E569D7918E83C1244C8CC765EC590 D9"p
914,140,828 *5F26973D65EAEF76709CF64FC986D32DFAE5B445 [email protected]
914,140,829 *5F2DCDB6A09E9B2AD655DFBDCD63F911294F23BF DADMN
914,140,830 *5F27D7D52DA29BB867CFEDC8ED0EFEA21E2BBBBB DAMON.KOERS
914,140,831 *5F2EF491F89B6843E985E004865BDC13D666A106 BO5L:
914,140,832 *5F2D22C8DC817C6D52AD35F28F48918CA5D516E7 DANIELLE-SHAMBERGER
914,140,833 *5F28BC166FA7B4718AF81B20757E7B51DDC2B741 bocca.desiderata
914,140,834 *5F237970E892DF8121805212E915828D10EF89A7 daquan07
914,140,835 *5F2468AFAF1A57A076A5AF2703FB268A5FA0EA9B DARINWEDEKIND
914,140,836 *5F2ED2BBA25A44FAA0A4F21E69309A5003834FE2 [email protected]~O~O)X(
914,140,837 *5F26FA654F5C616BCB7C97A0D25EA29B99575E30 DARREL.SPICKNALL
914,140,838 *5F2AF59D8533E8270A52EAF12CBE08C300B239CE BOTTOMFEEDER(ELQUECOMEABAJO)
914,140,839 *5F257E82BDDC33F3F74FBBF272CE085616957199 BOTTONICH
914,140,840 *5F20418889FC08E46FF5E90CDB53F80A94C2B9C7 DARTMOUTH?-DARTMOUTH!-(ALBUM-VERSION)
914,140,841 *5F27DC2FB471B8AD63CDF48FDC95F1E5C78C4D2F BOYD.ROARX
914,140,842 *5F280FD695AFBD71B20E36BAA9780C71AA718C83 DAVEPERO
914,140,843 *5F261DAB81082020F4F0437B0169D2077F4E363D braddefiglio
914,140,844 *5F234E9D7C0F73DE0A6DFF784628845DC686BB4E bradfordcouncilman
914,140,845 *5F269E000879113F311CD157A413424B43AA24E7 DCHHL
914,140,846 *5F232BAB2DF5ECC53AE888F317349057DE921D5B BRANCHERONS?
914,140,847 *5F20716E5F81AF72D1612B34A7FE406653C68502 DDBS6
914,140,848 *5F28ED97AC0B85ECF707172241A4C146398CEA72 DEANNA FROST
914,140,849 *5F2870D55962AA2BF048CEF50BAD3E062B9B5BEB debbi-lamb
914,140,850 *5F20DF5B7041665925152C5793280D94033F2D47 BRIDGET DUFF
914,140,851 *5F2154A30EE6C31809B95ABD6F6FE214C42F8150 BRJ)O
914,140,852 *5F2391E8A0043A15D2C8DC590A27861B33E06324 d(.em
914,140,853 *5F286D9F86CB195CFEE281C5F3BC319A9CDD0095 BRYANT.GERENA
914,140,854 *5F212057EF1F8ED9556E294918211D629D8099FB BRYCEN501
914,140,855 *5F2FA7412B12C3BC80DD95036DF6251EDAFB5941 BS,%
914,140,856 *5F2DFFE999AEDD4AAF29C85331D15F05A6EA4043 DENIS.DILDA
914,140,857 *5F20DA789E15EEAC3E6289AA17CC0437E377BE2F bsm3n
914,140,858 *5F21FC982E1F4BE4F46FC4C206041F88E79A2CC2 B####>~-`SPLAT
914,140,859 *5F28EA802D3FAC02266FDF854204DA5231174151 b?sqa
914,140,860 *5F26AB8CA02BD2877353CB86F78228AC128E7554 b#tm5
914,140,861 *5F2F24FC8A57C6AECF858C7F0DBDB3E52BA78C5D BUDDYFUHRMAN
914,140,862 *5F207F8CCCA80018EDAAA7C4FB32573FED67F690 dfgqp
914,140,863 *5F258E16D6875A3D818B86EB32D15FB738BAF765 dga6
914,140,864 *5F25AFD9AED6CEFFECF3BDF4157AB087E0C83E81 D-HE
914,140,865 *5F29C846E594B3904C8D374C8C8EC93343B7E74B BWKP3
914,140,866 *5F2D8D4DB37854DA489F2D89781FC89771A5AB47 DiesIraefrom'RequiemMass'
914,140,867 *5F2F47E85A0E29725C141B5104B0F88F4BD9AD40 byn20
914,140,868 *5F29157A41301951D012DAFC9D45325C5926F024 dipsades9
914,140,869 *5F26A66A0E9A5283E33AF31A019EE2ED486FA049 C0N1UNG3R1M
914,140,870 *5F2D5A674651040E10D7D01A6BF96FBB583BFADA C0UN+3R$19N$
914,140,871 *5F25C2F145103F819DCCE1D6D7A7E0142A8F52EE djyd/
914,140,872 *5F2CA6D0D4DD03A3709373F53CE0BC72F6585BE4 DK9v
914,140,873 *5F2E8C9CF5C23038738F40806A0BE6CA309F7C94 c7-f(
914,140,874 *5F22EDFEE5A0D257BAEF2EFF724ACBB6F2FB8414 DML)H
914,140,875 *5F2A3C4FD55FB15A5136E2E2F52D23CA29EDABFD c)a?k
914,140,876 *5F21788410EA886E30F42475AC73F1CAB76E92B8 doggieoxford
914,140,877 *5F256BE4056B89A1C42857ACA90F4171829AE452 DOMENICPEEVY
914,140,878 *5F244E4500E0B917416CD545DAB8309EA86E611B cameronmikos
914,140,879 *5F25C48C1C0CAD73919DAD5CEA626AC0408CEDCD canadiangeologystubs
914,140,880 *5F287A5AD9A327BEA62BBD26CD735E17DCE446E9 [email protected]
914,140,881 *5F2F6E1D69EEF7C6872C5F5FF6ADB8C319FA18CB DONNMCCASH
914,140,882 *5F2FB1E6BF56A966A9708E47BABDB1C26018AC0A CAREY.CLELAND
914,140,883 *5F23B67013C922EF1E2C7D7F5DD2054553DC736C CAREZZAVI8
914,140,884 *5F2DB4BCA20F874F7E02628E47A6C4109788CD98 CARMEN.HAUCK
914,140,885 *5F2CBDA047D793A1C5C39F9A53B1EE685270FA5A CARMENTOTARO
914,140,886 *5F24C3900C8506B9B747BAA47BD95D8D724B91D2 carminetran
914,140,887 *5F2DDD3D239536D85235DFE0CD6507A580F1BC94 DOUCHAPT
914,140,888 *5F2858DC6068EBD613172996A11624100C3C4983 d%p
914,140,889 *5F267AD9079B411168B7FEA138240BC6D42C8E08 d+qt
914,140,890 *5F2A0C8C42BCE07E55A49E515AE49BA882D67C0D CECILROETHLE
914,140,891 *5F2BAF880AFEFD1432ABCB0529E83B1F5B424607 cedrickedgerson
914,140,892 *5F20EA2D5ABC3AD7739527DCA8DBD3BB6F0AC291 cedrickmorrisey
914,140,893 *5F2D1BD55C29378802CC9862F759CCD1B5240D00 DTMZ
914,140,894 *5F245612516428230AA79456D38C64F8D3851131 cely#
914,140,895 *5F2301B4E3D14086B3761A3E76283CB8402492F8 [email protected]
914,140,896 *5F25C7095138B4326B815420A05CFE80B07BEB94 cenziera2
914,140,897 *5F2FDCF6F944845FBA19F4B34373722933AB919C [email protected]
914,140,898 *5F217ED3ADD22DD5C53598F9A98DD6E249313082 CFURLONG2
914,140,899 *5F2059C144E8326234C2BC5BBFAF5EA7BA8A6A5D dustincruser
914,140,900 *5F20A98DD3E1980007733CD9F13A19FD239BE090 DUSTINMIYAZAKI
914,140,901 *5F20828D63B43C356DCA9C6AE86E1BCB43DE5681 DUSTIN.SWANBERG
914,140,902 *5F21E2676E94D8E16E19C206872D8D395C29AE7E DUSTIN.ZUBIATE
914,140,903 *5F29C073370FED351F18C0C5FB6590C0C2C9CB0B duv31
914,140,904 *5F2599371AA77C61BDB79ECEFE7CCFA235D96FAE DWAYNEOYSTON
914,140,905 *5F2751ACB806CABE7F7B707AB10661FC4E10EA3F chancellortobe
914,140,906 *5F21FDC67FF46A0BED8AA1E36BCA7411856A9B49 changhofe
914,140,907 *5F296350A58C64B447EDA77E3DE857A9B17CCB28 dxnytamounbuen
914,140,908 *5F2FA5F58C8824A9BC06A9E0119BA135452137A5 [email protected]3net
914,140,909 *5F20630FFE961066F36A1B83A59F84849450B1FF [email protected]
914,140,910 *5F2EB0A1BE4909F2CA71690B95A981BFD217727B D第3版はD
914,140,911 *5F297C4B722DC5FADCE52FDA10F82E43955FF42F CHINACLOAKINGSOLDIERSASMONKSTOINCITERIOTS
914,140,912 *5F2329A5A508AF629125B0F6EBA286E0F0D22578 EAST-CAPE
914,140,913 *5F2F38D7E062F6417EB62EF2D00B0A5624F796A3 CHLORIDENS
914,140,914 *5F22E5A749927E25E4F3C39E239013F463463FED chorides6
914,140,915 *5F212FC7C03C42B9B1BCB30F9721912655BF1C15 EDAAAA
914,140,916 *5F20A65A3BF92840E487006B120BD51FE1BFDA90 EDMARLOPEZ
914,140,917 *5F23D8ED4DD4D4BB589C6B9F54EB65BE738B8FBD CHUCK.SCHOEPP
914,140,918 *5F2D6B7FC99A732F2F9D648FA65936A000BE20BA ci+!:
914,140,919 *5F2F697AB9D14DB131CE01371EA3204862079CD2 edwardnazaire
914,140,920 *5F273106DCD0A02BC647D18B858CC2B1C5099719 cidinho-e-doca
914,140,921 *5F2598A782965460D670D88549C5ECC226A6B3BD EE)KF
914,140,922 *5F292033668695F1239E254F3D665016B5455D61 cjmaramures
914,140,923 *5F29CA4F5051E0655CCAC69E974E3BA859D5359D eisleyterrell
914,140,924 *5F2244860C74E05CA7230C4895E7505A568F0F89 c=lc
914,140,925 *5F2CC083C4E4767D7E669A04F4CC574429D17C33 eléwù
914,140,926 *5F22AF0B19FC0C1B64E9FC89EB673BA90929ABBB elijahwalbrecht
914,140,927 *5F2C69BE62E24861636946C21F677F721936B2BD elisa932
914,140,928 *5F2AE1A096780D7D6CEDE6E58AC647A59F6A006C CLUBS45
914,140,929 *5F25B656B23B395FE4F81F6C92E599591D806ED7 ELNYPUQRWR8
914,140,930 *5F2271E0750B85D1ADC2A39212BB0E25EF37DB7B ELUSQ
914,140,931 *5F27D8346E7BE7B80EBAABA29C7711AF70977C4A cn=_p
914,140,932 *5F2CC9E9C49307FAFC3519676FBB523367B088F5 COLBY.ZERA
914,140,933 *5F2B6674DB79890C373E8D4623E8934E9EC19973 COLINGAHAN
914,140,934 *5F212F823D843A7B9DA11B7B333120915980F7AE collinlaird
914,140,935 *5F2EE6694DCAA82A218AD61F2BB9D30A81732BB2 enretnegs
914,140,936 *5F2202FA429CC754AE4047B6BDAFFFBEDA1F61F7 CONCERT-OF-SOUND
914,140,937 *5F28B611AA051D2DC11D6A17FF9E209BDC635271 ENVIRONMENT55725
914,140,938 *5F25BCE3D984F572DA8FA405ED0272F2358CE329 ENZO615
914,140,939 *5F211357DE3F176B51BBC80964B9822FBB1F6966 connieollig
914,140,940 *5F29B635534D24B4A14383FF7118F35D05631A24 conradmulrenin
914,140,941 *5F2003A0D18BA8D3A4C2622CF54E3EF87516625D conspissate
914,140,942 *5F2CD4D739B17C328157135EAFF41F8544496038 [email protected]
914,140,943 *5F282B2335403585767DE8E1A7222B1542D86329 COPTERS
914,140,944 *5F264A8C1D245A368307C2B15D30806617746E29 CORNELIUS.SHAW
914,140,945 *5F288506BA8EBFAC43A2E0C6DD8039C89AE52850 ERICHSPRANG
914,140,946 *5F2199ACC0443C67381A332A69B7098E8D5E86F5 ERICPATCH
914,140,947 *5F2618CC6AD1731FAEA52A2BDA8353FC395A826A COURAGERAIS
914,140,948 *5F253D6ACE7426BD2F0C6B6A8C365BB46F809567 CP4&D
914,140,949 *5F2C956A1807C4130677E0A35C1A06F8EA998CA6 CPULSES
914,140,950 *5F254ED295501A67370AD4FC6CFE51DAC67AEFBD C&PUT
914,140,951 *5F2FE1A55B0183765B3ED6683BCA190DCE33BCDC ESQEE
914,140,952 *5F2BD4CCFA73AF05CFC8DA7876DB1423B17F2C05 c+r5f
914,140,953 *5F27D5550315862A5CE9DC465D6037F31F5F16C5 ETHAN.DAUGEREAU
914,140,954 *5F2368D33A5FBFD803A644CCA762915030BF3F7F ETIKKRADET
914,140,955 *5F2865937965ED15AAD9428C845BCE3C2DEE4AD2 craigsmoke
914,140,956 *5F233172320F291F4A5AD250F7E006F60B43646F CRIP107
914,140,957 *5F25471714956EFCD72F23D4901BB150022FD665 EUROPEANDEBATE3(STING)
914,140,958 *5F2F0FB282DDF3F5F86F697CB129EDE81FDE5292 CRUCIVERBALISMO
914,140,959 *5F26EC9D0E6B659850DF7DE1370926F619C4CAE5 CRUZNILSEN
914,140,960 *5F2E9AAEAF9223D2B176D0103329E19AF73B862E everettnerlich
914,140,961 *5F29106F3EBEE72F3FC89F96E4D91DF3D91797A3 Csjb
914,140,962 *5F248C9ABABCD0B102F1FE04C2464228C347AB3F CSRQM
914,140,963 *5F27C1D24F115A3FF4795752A75B9D6225A08556 CT=IT
914,140,964 *5F278B367088DF5D209946C3F852FBB2F7D6CC77 FABUFAYYAH
914,140,965 *5F24D6EFC9D3899B30408ED388DDF3AA4D0AB051 FACHWERKSTUBEN
914,140,966 *5F27FC3D198D6A01ECCF71F88B04B933B6EC0761 c+uqg
914,140,967 *5F27922F73478D9B19E746AD80C0AA8C68667C52 F[email protected]
914,140,968 *5F2A78479434F86C870BA9DC0A1881B933048A89 [email protected]
914,140,969 *5F2FDB1960495D3E71D2BC38EEDF6B146F19C6F7 FARAMARZ-SAM
914,140,970 *5F2047BA5776B813D8B8343C5A0BF3A0E0AEE916 FAREWELL.TO.EIRANN
914,140,971 *5F299A059420FADE42A856EA1FE9A84D994B6E4A fatless?
914,140,972 *5F27B2A77737FD0EBCC75431F3694A046CD1A504 FERDINAND.BAIO
914,140,973 *5F2AD12C4E501A8AC20BA09598916ECD9B163CBF cyberexorcismcomwww
914,140,974 *5F2611C19526AA44DFA1E8184D398BBAA5768E7E cyrusbuttray
914,140,975 *5F22547387CE0C6D20D89EF4A261D081FCE78A49 fhj.
914,140,976 *5F267766F8CA7359AD9A5013066DFAAB0279E86D D0%E
914,140,977 *5F2B6A3A86804A65ABB055BC9DA91CFD62DF0153 [email protected]@
914,140,978 *5F24BE809EE1943C00ABE09B62D7D11E712CEE85 d1i%k
914,140,979 *5F24FF6DC5ABE1D7C5B88697593E1AC74FB3C351 D1M1C4R3NTQU3
914,140,980 *5F2B85CF708D86EF2FE28097EBCDB46F1ABD8354 d1nop
914,140,981 *5F24F92410EF6E6252250C61200435F7FF43A1FD fletchermimnaugh
914,140,982 *5F2A30549B134DF0BB33AF882F5C83F021206C96 D$31C
914,140,983 *5F2CD3933865F472952E013F78A651BF5271E52C fougasson
914,140,984 *5F23906FDDE5707DA1E07460185415012E8FB109 FOXJASMINE
914,140,985 *5F2C8762C90299E0DD540DDC86FB5FA341A20C2F FRANCANNE9
914,140,986 *5F2E361D4C28B2E744A8D1C446AFC8C31EBEE60F DA9O
914,140,987 *5F290BE8F6497517B928C1C3EC5CBAAAFB40D5D8 frank.knarf
914,140,988 *5F2197EAA27520096E88F47B64FFDE4AC2C7CD01 franklinripka
914,140,989 *5F2A061A719CB2DA7B1D2C12C3E5C89C1369FFF3 d?akc
914,140,990 *5F219FF7F642690F689ECA96833F7B0132E518C1 danmarksbilleder5
914,140,991 *5F2E6755B52F7CB39056EE3AA4CF1B81C63E3DFD DAN.PERREIRA
914,140,992 *5F2A77B0E11DCCC198D9804B7244FCB5C99F3FA6 dantoenjes
914,140,993 *5F29F1D8C8EFB3932A66961D5534E30913A2C01D danyauck
914,140,994 *5F2627BD51CDA7EB76AFFFF8F50A4706A5DEE6CB fuerschongen
914,140,995 *5F29C897548D2BA0D83AE4C977D22B992E6126D8 DARNACHMIT
914,140,996 *5F2B8D03B6C433E779FBE60D594C9CF09B2BBDAF DARRELL379
914,140,997 *5F23B1918611D2FEE0C22F346C3C709C6C75E55A FUSAKAZU0
914,140,998 *5F2E8373D485AB6A2F78249593516212AB0C5573 fvf}
914,140,999 *5F2774BFEF881F5310D2AC32FE87733B25AAE1E5 dattes.
914,141,000 *5F212F14663281EC62540DD9EA61E28C59BE071D gager.1.0
914,141,001 *5F2EC464E5F4B2A3C4138F605B7CB17DD47D6CD8 gaildawley
914,141,002 *5F290C8F09B05267992F556F3B79552D2024E722 Db3X
914,141,003 *5F2FEEC0758F666049ED0956F2EBE695AEF2F85C gambiavnewzealand
914,141,004 *5F270315AD236D1973D1348625F9134EEADCBB2C garrethervert
914,141,005 *5F267A4AE79893BFA280A5ED55CB6D7E09196E4D dd%(=
914,141,006 *5F24D8300DED9710C1B16A5CF87FA6DF1546D5D7 D=.;D
914,141,007 *5F244BC7177299B599356D7414C2B8A5C180428A DDOOLALLY
914,141,008 *5F26F79F5A7F2B70858EB1470D7BD7473FB4719F DE0PF
914,141,009 *5F29EC27CB64B95684967B7A164BB88D5CBB1160 GEMINIX4
914,141,010 *5F246E190BAE5DF38D9EEAA6C9A5FB23D79E33D3 deletionbad
914,141,011 *5F2E3652FA537A58A5B20CFA77913F9B501D43A4 denisratleff
914,141,012 *5F214F8D6C5FF6857808E81A539EF017E2522EAE [email protected]
914,141,013 *5F2168B59F952622B5845B3A3EBB5EC1D48E76E5 DENVER.DOWEY
914,141,014 *5F24DF9B4D5C6C80BF33C1C037C78493596032EC DEp2
914,141,015 *5F270CD848FB0B944B2F1EE8A683044094C9CD37 GIUNCO0
914,141,016 *5F280FB5D0C6858CC0D9A27892447196E6A9D222 gladysmwilliams
914,141,017 *5F2AF3E6949F4C78F082EAF3FA4CE19952D53C36 DESCOLGA
914,141,018 *5F2FBAC1FABA8AD4974B1D4E6D9DCEA40C82F1A4 detraxit9
914,141,019 *5F29C9287705D1BA15038D170FC87872BBA2F858 GODINNETJE?
914,141,020 *5F2A97BA96AB46612BD7002A611CBFD80DCFC066 goldsteans
914,141,021 *5F20F5B115CD7C9D30FB32E6909F495BB7775B48 golgatha.and.the.circle.closes
914,141,022 *5F2998CCAC723EE10A2DB2F38A94E9A02772F917 d?faj
914,141,023 *5F208179EE11F36EF02134D91C9D684D56ED8A08 dgpg)
914,141,024 *5F2DA8D1EC22FDD01D1E10FB27AF077B1FEC06B2 dg+tt
914,141,025 *5F224323D8E29997B1C93B1979D6EFEA6CB4232C GRANVILLE.PIETRAS
914,141,026 *5F22253070DEF659A46E773806C2A8CF31A8C3E9 di)
914,141,027 *5F2221DC66B553F6B8828F523AF4E6A38137EC91 GUERILLA
914,141,028 *5F27706FDBE7768833385548CFFFF67DD061B583 GULLSTOVESKJERET
914,141,029 *5F2652964FF31974C0B3CE252C0898F2DC823676 DIRRONLY2
914,141,030 *5F22DF2DD46082DC0B6786EFA6659034055D2D4F dirty-squatters
914,141,031 *5F2FD7B70687B89220554E0AC1C822A1FF9EA7C6 DISGUIDO
914,141,032 *5F2BC3EB5FBC5A08A3CFEF1BA4379B30444B6A93 DJ"7,
914,141,033 *5F2B835C12402C8282656427CE2A8F2715407A13 d,j/g
914,141,034 *5F2565A87BD1353DA69C5ADBD23B03757363F717 [email protected]
914,141,035 *5F2E9C3B7D4C07C6B4597A89E7F9B8B9CE262A4F dk0&h
914,141,036 *5F2EADF61C78C7C28CDA9BE9DCD44A8823A959FB dkfu0
914,141,037 *5F2845BCCCAA4207998D482B29D6402CE23CF236 DKrj
914,141,038 *5F2E850AA49529483744D741E9CA52145BFAF619 HANNAH-AGON
914,141,039 *5F2FC8081B0A9CA2CCCF95E6F1897E7335A322FA HANNAH LAKIS
914,141,040 *5F2D76A9EBB8E22CE477D5A499F1B21D8ED4855B D&LVG
914,141,041 *5F2EB3E54193B6D9B2D71322CAF8C7B61F6332D7 HAROLD EDMINSTER
914,141,042 *5F23198570224FF7E1F6D94D0BA9CEAB3B28BB42 HARRYSR2
914,141,043 *5F2035343E8FB31DAA8F0595B25A3FD47DD89093 DMN;+
914,141,044 *5F2D194FDCF13BFB0F65DC32FDFC622BDA6088F2 hduc
914,141,045 *5F22A4560DB986F64C7144847E09E7C1F9547DEE DobC
914,141,046 *5F2FA1A837B7857036BBA09EC87B24696DA838E6 DOCTORIZATION6
914,141,047 *5F2D702B237F82EECD31BCB06C84C581DF27310E HERIBERTODRUVENGA
914,141,048 *5F2350E7C4EC69C801C05100C9C441C5B69FC44B [email protected]
914,141,049 *5F2AE8DC32ACCAB0EB5E36B676B7FE163DFF9DBA HERSHELPRINCIPE
914,141,050 *5F267CF7343FE0AA820D994F6997E32613E5BF2F hiknenased
914,141,051 *5F2C7A2A0731BEE02CF9D2A59D741D2B85D36511 douglassmadock
914,141,052 *5F2F6FDB302B2E1496103552547FB736D09B28EB D$OUV
914,141,053 *5F27DF3C6AAF8F8FE5AE6BF4879225EECF7B589A d%p
914,141,054 *5F2818D3041242950371F30F20FA7EF523A14298 Dp"p
914,141,055 *5F2F0FFD416EDD83EEBA843F4972537D7A9F550C HOLLIE.HOLMAN
914,141,056 *5F2E23D7FEF3DE42C992935A138B4394F8060077 DQCO
914,141,057 *5F23DA0CDD06643375DA8CF027498395B2551A3A HOPPERS
914,141,058 *5F2CC424FA0A697C62E9AF853DFB23FDFD171EA7 ds_q
914,141,059 *5F21E259D143160AF5E93D758310316B10235F2A HUIJFT
914,141,060 *5F29F890B4847CF97761C975DB3046F6473CC7E4 DTMZ
914,141,061 *5F26C7B802C145F34684B698A5DB2F7C2F8AA34A Dt)w
914,141,062 *5F23C895D933EFA4B7AA96947EFBC5BB88553EE5 HYMANNEIDHARDT
914,141,063 *5F23AABAE80D4D2EB42AE71B02B88C7D79FA61B6 HZ>W
914,141,064 *5F2850EDD25E0AA0949BB8FE41C1CF9533315437 duvf-
914,141,065 *5F2E76E53886D551EBE837FA349D4264F37545EB iampiper12009
914,141,066 *5F2438CC5653542B4A21E73D09349C88D795504A IANPEREA
914,141,067 *5F20EA6521DAE7958F58C791DDCA9BC3C23C3B9A DVXQP
914,141,068 *5F2D2912A99697E407316F8BDA07C39C46623124 IBUCHHEIM
914,141,069 *5F237A1A7F9100E164BA58523ECFC7FF2099938D IC314NDG
914,141,070 *5F27D2A7640A515C52F0EC248BF55E4852B7DF3D iceflake
914,141,071 *5F22A6F0378AB7BA1CD8424E4D6EEC045595E6E5 IDIOTFREAK1
914,141,072 *5F26D9CF7B6C4D90AAFAC51737D0ED8FE0ABE3D0 d+xt9
914,141,073 *5F2F6CF7B0249D08D8F1DCB841FA807B880372CC DY4V8
914,141,074 *5F29D709A787A7C087267D6CCB281AB3CB8DD978 I-HAVE-TO-GO-FROM-PUB-TO-PUB
914,141,075 *5F2AF3E0DD82570E733871804C8C0A68D858A405 III.-ALLEGRO-SOLEMNE
914,141,076 *5F2227685C8F44166CF80B3E6DC53A4166FF422F D"ZKS
914,141,077 *5F242ED0E241A6E69FCF9856CD910E6D957FA6EE eazoj
914,141,078 *5F25CE8E380C781F0EFC56A9C72C9BFE969531F4 iluvspitfire82
914,141,079 *5F2D3D7925203C12FE9B4CA262A6FF61E8D9B5E8 inflows
914,141,080 *5F2330551AF63BD9E58EA33A5E89584F3CEA4322 EDWFP
914,141,081 *5F266BDF5F61EFD9E6C6A7302BC890989D03BCF9 eflib
914,141,082 *5F2B8BE5D735567133DE382A8B31184FEA54AA42 EGARFBA3
914,141,083 *5F245D23F9D18E87D05BE04DEDF0DDD72D45CB91 in-your-memory-(slick-mix)
914,141,084 *5F2513BCD5DD9CF200579165B39F185B50BC6783 IOOGMO
914,141,085 *5F239D00CD106AAD221B8EAF9F3B16A10A7F6564 [email protected]
914,141,086 *5F23E4D3AA4E664C020031219F00555CBD92B810 ITUTITTE
914,141,087 *5F2F28328F1B0279FA0CCDBA464932E742FFFF2F iulyromeo
914,141,088 *5F231174C2DBFBBE505B03F59ED0A428804A1972 iwannadancer(disco,rock,dubmix)
914,141,089 *5F24595FBFD80E4CEFF4FAD61E37CC69E2807A83 ELISHA.RAXTER
914,141,090 *5F2D0866E1BC9546D549A7F6B1D4C614CFB61FF3 elliksnn1
914,141,091 *5F287C048BA6ED6BA32B8C2498193041ACADD184 ELLIOTBOOSTER
914,141,092 *5F2FAE3DCAF834B939E9E5478D5D96E07EB1F835 JACLYNBREAUX
914,141,093 *5F2FA331BBBFF01DEFC9DB8D4B62D0D97A975EE8 EMASONRYSOLUTIONS
914,141,094 *5F2B057EB9490CC35F1FAE36552CDBA6245923CE jamaalranda
914,141,095 *5F2C29C10DF7A97DB80C1917C1093D16045BB8D9 EMILIO.ERAZMUS
914,141,096 *5F253610444273C61E18F1AB1D6408DF74FAD330 EMNOMITI5
914,141,097 *5F23C691004AA23326D1AEF681B0972F7F6F2A0D jara.harris
914,141,098 *5F26ADED68F7F185CD681B6652D294B6991B11A2 EMVOLIOY2
914,141,099 *5F2D21C97E3ED2876EACFC6DE77B48AA75EFCA70 [email protected]
914,141,100 *5F2FAD6488D2758B400F32BC0DB3835355999B9B enochnadine
914,141,101 *5F2D6D4B9F425C0FFB0D506ED5BFC3E326E5E953 enohpodrohc
914,141,102 *5F2FA7C8875D5C557247364AB95A3A4039D4176A jedarnott
914,141,103 *5F2B840CE899827AD8595EF0D7C8B956026576AE EPICENTRENE
914,141,104 *5F22EBD6D675EC32BD8DBDC198D2B4ECF542ADB0 JEFFKILTON
914,141,105 *5F2219E7C6DFF9AFFDE3A9B4D2EF31141D83C32A EQAKR
914,141,106 *5F2B96BB4F0A36270F8A3A426D544C977D67F376 JENNIHAPPONEN
914,141,107 *5F2C234CC31E49171E2835B6295ABBDA0D4C3C05 jerrodbering
914,141,108 *5F283EFB2F5F381BA969A61510DE970EB1C15F83 JERRODVIEUX
914,141,109 *5F24FF3AAD0A2EA7C1650ADA378FB4085AE1C245 JESSEKREJCAREK
914,141,110 *5F2DF1569AE2519BB29EA9A5F2768FE9621B8C58 ERVINMAINELLA
914,141,111 *5F223906DD66BDF349281E9B5942BA67111F7865 esccq
914,141,112 *5F2C81347D94ED9CA47E77978866F96A7E8864DF esl#k
914,141,113 *5F29958E140D9B81B43B59CC145382C149C21A56 JINSHO13
914,141,114 *5F28D307610F243D8DA04FC7E87A2AD70D1B4E88 [email protected]
914,141,115 *5F2DFC4430DDDC6BF23C83223E93EEC832D593A7 etqld
914,141,116 *5F29FB2A91D56004C717ED372DA4FE68755830AB ettegrub
914,141,117 *5F221F4F0FEED12CF2538E1D1C874E2D016091D2 JODHPURDISTANCEGUIDE
914,141,118 *5F2FBA9F2D952BA45376A2DAE1E4F58CF4F9754D [email protected]
914,141,119 *5F23DFCD9A8DEFFFCDCCDE5EDF5BB624FEE876B4 EVERETTERUSHE
914,141,120 *5F2DBB025960C6A3621B7BCB81EFCA932F3E2417 EVERYBODY.SUPERMARKET
914,141,121 *5F2732C054194B6E7656B9225AD680BF9317A04F jojocrow0
914,141,122 *5F2BDAF8BCAC5F5F562F9EFE0ED9E248749D71AB JOSH.WOODEND
914,141,123 *5F2D4E4028759808641D4AD40EF88A4506EC8166 F84UMCTXPX
914,141,124 *5F2BD84799D8BDC4C2A4A803931D2C194023E5EB fabfourfanclub
914,141,125 *5F27D36E7BFDA39770BA7189BBD92115702971E8 FARCRATS4
914,141,126 *5F287DFB0226ED624FB9B5DC39CDDFAFE510B026 juvarajuvara
914,141,127 *5F25A2437154C6DF8C6444FE18F628B0C7B6072B KALAPBÉLÉST
914,141,128 *5F2676DD05BD02E1815FDBBB554B6AB4CE9D3DE0 FI3LD-SO4
914,141,129 *5F20D13A8D6679929801C9A511D854E377E1E19C [email protected]+ION
914,141,130 *5F292A1FFEB6FDE9DFA5AF7E9C0A734347604AE0 FINGERPA9
914,141,131 *5F243DBA795E07E2F6C19DE8706FDAF7510D9013 KATIE.SKY
914,141,132 *5F2F9D0960CFCB1C9050DEBB3441F85055C79258 KAYEREKERA
914,141,133 *5F2F076169768AD91EC4A9A00DBF4499AC5732D9 kayldall
914,141,134 *5F2B0B38F51C7FFC8FC29450133DEC53012FFFFB [email protected]
914,141,135 *5F2C75335154047A706B176BD3893C3F98A9465A flip-kowlier
914,141,136 *5F22E62ADE67BD332E961F2AF3F106ECB2376C0E KEBGAAZ0
914,141,137 *5F2CC664A9AB55F13626DEC4E62193BA8D0FDD26 FLORENTINO.DRIESBACH
914,141,138 *5F2A7E772533989C83583651AFA671927027A849 [email protected]
914,141,139 *5F299545C995C51530A45505B192CDE1DAEFECC9 FORCRAZY5
914,141,140 *5F242671126BB868CB0381448691C4B71A8BB9B5 KENDRICKSULFRIDGE
914,141,141 *5F258FDCC839999A40FED55603716978A7EE82AA forelegs
914,141,142 *5F277A5BF6FED79A080DAD4FDA51F55F5E488EF6 kengtu
914,141,143 *5F28707B3825719E6A45A6735BCBA42CC4E6B510 FORRESTSCARFF
914,141,144 *5F298EB58E199B3429742140E323EFDE82B9A72F F}R-
914,141,145 *5F2A01B0903D911080182F84A7F2137A31C638BF KGTZ
914,141,146 *5F2838459964D210E73DAD390F0AA9C5ED5ED16D [email protected]
914,141,147 *5F2267A74295AA631BB2F77E9CB120CF23323E19 FREEMAN.KARNES
914,141,148 *5F21A4397CCD24B3BB56FC57BFC878DDD90BF216 [email protected]
914,141,149 *5F2959FB66CC67AABF78186A9D53C86132CD867A Ftn
914,141,150 *5F20817E96FB2C9F38D9CBC01C72192759B16F5A KNUM
914,141,151 *5F2CD5AB9B283C934C9BB00CACB009CEBBDD44CB [email protected]
914,141,152 *5F2CF506F1C908A9AE590436D948380CBA81472F g5e?
914,141,153 *5F229B97BAC341374E7DDA51024503706C6EA059 galenetienne
914,141,154 *5F2F50FCA4B1D0D3BFE98CA1CA9F64FE9A58F9A6 GARCIAACOSTAANDLORENZETTOINJURED
914,141,155 *5F23F4ED62A7FAF6B8D27E52F6DEFC837C232A0B GARRETTHOLGATE
914,141,156 *5F2731EB1DB2B1A809AEBAE6DE748795F4F24FF8 [email protected]
914,141,157 *5F28429618CA5709280835A8267E6B64887560A1 GASTRALGY!
914,141,158 *5F2B08760592FD8D25DC4DB1929495896F484479 KT2)
914,141,159 *5F2943F844BE7274172274A32978C9F020317BE5 GEBRUIKSVOORWERPEN1
914,141,160 *5F2AFF3E8E9FDF882EE3ABE3FECC827FBF422647 [email protected]
914,141,161 *5F28CE1A7BF81C28C526D2F5E109411694C3DC92 l094nberre5
914,141,162 *5F29CF5CD3EE7CFDF337AD658D4B5915A56C0859 L3G171M471Z1NG
914,141,163 *5F280CB8890043043C5B91743B891DC399FCB0E8 geraldovarden
914,141,164 *5F2713221A15C886E65463BF6AB255FDE9C82E29 GERAPPORTEERD8
914,141,165 *5F2DC329DC09CA876AEA7B5D0CCEBE12A37EC255 [email protected]
914,141,166 *5F2718B2057C49A05317935C5E2D65C77A56F79E gezenaliştirilmamiş
914,141,167 *5F26C1CB68133B282F1DC1B0F337471BD04CF128 LAMONTBARFKNECHT
914,141,168 *5F2730937CB1BE8C0FA0E6FA10733436A54CAE0D LANCE.POREMSKI
914,141,169 *5F2F908F9C574A5E8D60B601B5BFFFC85803234C gilbertaben
914,141,170 *5F2A9E51C1A0554170D1DF278ED599FD8AF2444B GILEKKAWK2
914,141,171 *5F2CFC89022B768FD37FBCF1A273780DDCBFB270 LARRYCARLOS
914,141,172 *5F2663039789476403C6175A068FD05EC5AFD63C LASUACNUED
914,141,173 *5F27B74C0169D6A2399DB5BA931E3203AABF65BD La Traviata: Act III. "Alfredo... Voi... - Si, amici..."
914,141,174 *5F2A694D3D41DFC5FEF25F2073E14202E9A46074 LAUREN.MARCHAND
914,141,175 *5F2E106DC05E74AE6E8BDC550D9FC6787AFF92FC LAURIEBROOKE
914,141,176 *5F2D800AFE83B79A77C6CF598BD01A7DB57C4FAB GNILENNAB3
914,141,177 *5F283A3DE17281B1DBC54E618E2E9F3D87109BAE leighpealer
914,141,178 *5F2094AD5C12FE1D65284DDCB54F4456CC9FF555 gothenburg?
914,141,179 *5F2C93C692D9844810A5857D7C78D23473C7D8EC granvillewalborn
914,141,180 *5F2E8CEA5F3930903192C9AFDF807290644796FF LESLIE-KING-SMITH
914,141,181 *5F20A4EA9EF50DDE42189A92B79771ED2BD91D84 GRERGORY0
914,141,182 *5F2CC9096046825609920286B788312DD1C0046F GRUNLAN3
914,141,183 *5F232F59ED5DD516177EF51AD4D2F12A12DBE253 GSMTSTRMING
914,141,184 *5F205ECA27EB9A1690EE43964CA34877FADD677E LEZIAJ
914,141,185 *5F2CEA8987678192ACAE6A330A7C0B4AB7E2EEF1 LGALACGAC
914,141,186 *5F275FF9EF528724930F15FB5A48BE2860028942 [email protected]
914,141,187 *5F2A93AAC19984DCBFD6C17F915F26347FD2C43A [email protected]
914,141,188 *5F277280642F1762FC972E5945F743C858BF608B [email protected]
914,141,189 *5F2E7D8559E0780F3DB4FB19C5573ECEAB1DA844 H6FGQHBRM
914,141,190 *5F2365B87BE8B48623DAED7F6A5A53052D94B2BA LISTSKOSOVO-RELATED
914,141,191 *5F248C7C280E9810DB19CD511AF5B511423ABE21 [email protected]
914,141,192 *5F2A52705C56CFFFBB21E208AA4748A2CB75AE59 liveatcbcstudio11
914,141,193 *5F2482272EBD22A04D74460BBEB0EC1073478385 LJ9K
914,141,194 *5F2E42C6ABA157A3AC849052F38BE421C097E419 l.kukushkin
914,141,195 *5F22364C9A0E7252E9164DDDB5B758FC30EB0DE1 [email protected]
914,141,196 *5F29D9EB8F43A8CA3C8A2E7B57F97DA28E88DC9D HARRISONALARID
914,141,197 *5F2B24899B0BE71D4D885884CEDA47E42FCCD873 HARVEY.CRANK
914,141,198 *5F2864C7B712075B2EB387B4D875BC4DD5ED1566 lomejorde...andymonta
914,141,199 *5F2DE46842523837BE813F93B481E0188CA1DE95 HAUŒM
914,141,200 *5F2057923AFF8E00A096AAD36672F0F120FE15D4 [email protected]
914,141,201 *5F2EB5C563CE79C16A8A619DD25D3E2A84574B3A lorenzostrictland
914,141,202 *5F2E6383A3702A401874D08D77B6939F18456F18 HEATHREDISH
914,141,203 *5F2A908604A81DFF13AAF020E8410E92F4EA2B3E LOV3RS01
914,141,204 *5F246E9608F94ACB97BBCFE2F0AA1E9B0C6A0134 LOVEPROMISES
914,141,205 *5F204FCDC5092449588A243237F690E3B23DBA13 LOYALIZE6
914,141,206 *5F280F6512E60C683581C0AAE4229A957B8AC657 heveron8
914,141,207 *5F2914EBBED149E8A9A20F810C9D360FA7A49168 HEZKIYA
914,141,208 *5F2221019CD303762CAEF3457192A9356BE118C2 luoguanzhong
914,141,209 *5F25623E6B9777BE8F357092B15C8A85FE3D4782 lutherailstock
914,141,210 *5F29261E4056F5151D96F360C22F7C9B4B70AFCF LUTHER.MANSUKHANI
914,141,211 *5F2DD0E43DFED8B2B23B95B0DA9E891D607A62D7 LUXBLACK
914,141,212 *5F20E9898C36270D21FDA09C7D2FD5DEE50E9647 LYNDON.FRANZMANN
914,141,213 *5F2D3484839B0701223D65F60137B73F01A7EFA4 LYNDON.ZITA
914,141,214 *5F25574CEBF6EDEEC6BD2355DB88D3A32AE3FD25 LYNWOODSTANELY
914,141,215 *5F23325E2E64DCECDEC79936B65DB19E644D9209 hollisvondra
914,141,216 *5F26225DDC5D86B2E65C2F2C5F152335D951D804 HOMERPHILIPOSE
914,141,217 *5F27B249A15AA62168645AE39542DC83A65BE9FE MACK.FOUTAIN
914,141,218 *5F254CA2D537F33DA0FE85A0F71ED9497D0FE73C macrodactyloused
914,141,219 *5F2275B81CA1E78D825298677F7C64AF12A6CD5F [email protected]
914,141,220 *5F2416FADDD42BE93452677374F7F8B038FDB082 howard.you.stink
914,141,221 *5F2110DE8BF96260A9302C853051C77C35540390 MALCOLMFALKS
914,141,222 *5F276058C3E2B38D1EE6131DEEB7BCD7DFAB56EB MALCOLMUHRIG
914,141,223 *5F2E78F9E9ECA904085FB0D4236C036A575DD54F MALINDAVOGEL
914,141,224 *5F2EC40848A79BD67B2FEB1923A57A6BE8E16EA9 manschal3
914,141,225 *5F21C179CE05A39889BCEDC2CFDF6CB19EB9FEEB [email protected]
914,141,226 *5F20D5D2E0AC4DAD12973CA81AF7F27C1AE1B1A4 MAPIRO160SS-376
914,141,227 *5F22CC458D2094049B74C5DD991FD8C51B045394 HUGOMCBETH
914,141,228 *5F20E9F02C1E6A622BC8332EBAEBA1069655041D HUMANIFORM9
914,141,229 *5F2DDEA21A46296097624B5B38DD6B790848AB73 margaritowende
914,141,230 *5F20EEF01C7139CFBDBE02C3C3257689DEF62169 MARIA.RODRIGUEZ.FERNANDEZ
914,141,231 *5F256E1641979661062B29E1B33AB83C8EE96EE6 HYPNOPHO8!AS
914,141,232 *5F2E4D625BC7C9C3DD82CA1AA35E7D8F287CF1DB MARSHALL.WIGGINGTON
914,141,233 *5F25A43EA5E9BEB1008AEB55C12588153CE055CA MARTINMACZKO
914,141,234 *5F2DC345D4976A348E3FD552B1890CE6C7298717 MARYNE1122
914,141,235 *5F27E41A637DF20FD813510923C99A24156B1512 ICHTHYOLOGIC ,/I/K/T//I//@/'L/A//DZ//I/K
914,141,236 *5F20EFE37B0DF46B6ED5D59CDE5A9EF405BAB23E ICIDIALES
914,141,237 *5F2ECE7611EFEBF23EF54F5909CA61222F84C96C masterchid
914,141,238 *5F24B08F781270531616A53376DFDFF018758A7D ierenifn7
914,141,239 *5F26B46309CEC244115212B1B2FE2F032641F906 IfV
914,141,240 *5F2BD91A204DE6D807E0028EE2EE42B739D747F3 MAX.CAMARERO
914,141,241 *5F2318F72845CF74C5BC3DB83AFFC2EC5DC2858E MAXDEWAARD
914,141,242 *5F264ABCB23872186363900D2123847EB923E914 IIRRETNK7
914,141,243 *5F2CD017AEB794B5B030CD937CF38181BA76617D I}@K
914,141,244 *5F28130B476C261866B72828BC2C7402AEA2A629 MBLRDN
914,141,245 *5F2BCDB237E5A0EAE04FB9A3B20FE3546DBC15E5 ILHAKLA
914,141,246 *5F24D6F5747ADEC049581F075606056CE51B4E16 MEDICALSCIENCEMEDICALRESEARCH
914,141,247 *5F23285030E11227C7C72C9430A9DF597BF5A783 iluvadmin11992
914,141,248 *5F202BE25EC8C7D2E8D4ADC8E58684D08460B2D6 MEZOO-MOHAMED
914,141,249 *5F2B3525760D87758053EA24F9D01EFAC8E01DA9 [email protected]
914,141,250 *5F2FE6E300FDE11605EFC42F6DC269E75A9F46DB MICAH.KUANONI
914,141,251 *5F216C592F200794550B86294A2C2F041833D164 inkochen8
914,141,252 *5F2BA6C597852E1C81BAF59AF68626958E2D11B6 MICHALLOCY
914,141,253 *5F269C271C3B83CD8A72EBDECBDA96D60B9FAAAC [email protected]
914,141,254 *5F29E7AEC0C9F15BD58A43E1EB71EABA6C46F522 MIESZACZA
914,141,255 *5F2241BB62EAD941AE14871A7F01C38B2EEEE154 INTRIGIED
914,141,256 *5F2B193D5A2EF6E47EB2FED746FBFE76BE2BBF30 [email protected]
914,141,257 *5F2AAA7EA30B1BFAA27A09493CE1EE7736F6A6C3 I OFTEN THINK THEY HAVE MERELY GONE OUT
914,141,258 *5F2F5E425C9146203C0F23684B9434F48052F144 MILFORDCAJUNE
914,141,259 *5F218CB729D1628A5B04C082C89C78801C59887A IQUP
914,141,260 *5F26C13725E229DB4DF425A5F76BE8377B78B301 irahassard
914,141,261 *5F231143AB80FA585ED3CA2D643A5AEC28E2E5E8 MINERVEF
914,141,262 *5F2FB438D3586298EB0308DCE75B3FDFF220DA03 IRWIN.LORING
914,141,263 *5F2B6E22F057143C1FD0469E8EE689F7393739A7 misljenja19
914,141,264 *5F2CD85D1A82121453BF230FB4D95C3CEF73BF98 [email protected]
914,141,265 *5F2174B9E7EEB4BD08E55C88FF1DD25C264669E9 [email protected]
914,141,266 *5F2F5F34313451BD359A3DE69301966C70E2F773 mjx16pamt
914,141,267 *5F20522DE974D772B491790AF5B1D5386B271506 iv+y
914,141,268 *5F2C4404DF00F6902DEDE977330AB873D8DE9AC0 JACKIEOROURKE
914,141,269 *5F2E6959DE084131E198A4D6DC242F2CC3E678E1 JAGIELON'S
914,141,270 *5F2AFC4C5072CC6EA6A767BF5F1350CA77568615 mournanscharbonny
914,141,271 *5F27CB96085EA6A2AE6520D65E46F2ABFFC94B6A MRINFAZ
914,141,272 *5F23B8FBDEC1F76E7AD3F547463EBFED373319EB JARODCROCKET
914,141,273 *5F278F96516F0D76E264BB64F91D6EE0DBFEB2F6 MROVPIRTS
914,141,274 *5F21EA36DB3E05CB29C28B1EC23A90C0935CFD80 MSTELMAR
914,141,275 *5F21EE090BA79028086E1464D6D3C1F67057D9E8 MSVALDI
914,141,276 *5F2540FEFA78888F7CE8999E3A0AE7768B1D0791 jason.torchia
914,141,277 *5F2D5B4BEFE9CEA7D298BB21C4773D76D4EB9DC0 jayhafen
914,141,278 *5F27B96CF94C119A6F097E3AED0DB9C43BCB7C5F JEANCAHUCOM
914,141,279 *5F2E8D6ABCD91A24B1426714D8394C7C4B2B98A0 JEAN.OHTA
914,141,280 *5F2EEC11745DC3753BB1271C48C1BB9A84179AF3 JEFFHARDYRAZVAN
914,141,281 *5F2D134DA34C2E8278A185B99EA548D8BD265922 MYJENNIFER47
914,141,282 *5F26E15C533BA13494C77FE0FE56522E34D23A1C N('-
914,141,283 *5F2A5C5D59FC924243C5158C4D5003EB291FA0FC jerrytiemann
914,141,284 *5F2AA3957C054FFB55F64B1F120212CCCE86DFF5 JESSE.MAGLOTT
914,141,285 *5F2D6026808A66CC01605EDD43EF142C86F23CB0 NACHSAUG
914,141,286 *5F26401591970BA152766A80E840A89AEB88399A jesusmattioli
914,141,287 *5F272A253912164AA5AE43500D29BA4C11F5F3E8 jesusnevarez
914,141,288 *5F2426A4017DA4DA7CEDB9E4D265154C34DC27EB [email protected]
914,141,289 *5F2E788AA19C6E663027AC88D16992E95D443C6F JIMMY.SORVIG
914,141,290 *5F24E01B230197F0A7BB418C04AE7B54C405B94C JIMPESTSES
914,141,291 *5F22C3000AC10816B3DC4D540544B6CEF57E493B JINGASUNCION
914,141,292 *5F2A51B45A4B0DB239B315D0882DF261B4BCB4DE [email protected]
914,141,293 *5F29DF825B9A8B4C37E4F5B7C317374A0E4489A3 NATUREOFANIMALS
914,141,294 *5F271E634A560BB1063A497F6FFA2DCACFE2DFDF JOCK O HAZELDEAN
914,141,295 *5F29C9E7167EA4D5012C51D77FBAF0199FA1EB27 neil-rivas
914,141,296 *5F27724FD0E83AFFE47322F9D0BB3EFF0D73A650 nelsons
914,141,297 *5F24ED075CD226D83789024990AAB7293D0DE827 NEWMOON
914,141,298 *5F2C96985CEA15EE4A51C56604DA40A6FA27BBE1 NightmareToday
914,141,299 *5F2B630E001F52026B949EE15472901ABE51780E NOELLYK
914,141,300 *5F24D16BFCAA0C9CA48BDCC9AF6E830DCA5CB07E K69IT16069160MMTV160
914,141,301 *5F265122CF37046250D080DB51595E7AE813118C N$P3CTORA1
914,141,302 *5F2CE3060C72DDF0E843D717F15C061791E7EDC7 [email protected]
914,141,303 *5F2598AA52E9D455F81A60CEDB809CC8BD178600 KCKEMPF
914,141,304 *5F2C8572E9A27684CD3E45603E21CCF721632BBF KDE核心類庫。這個庫來提供基本的功能,如配置系統、IPC、國際化和本地支持。
914,141,305 *5F27D8DFD36A0BB7B16297FD21E28B421C05EF99 keithstandaert
914,141,306 *5F28C15369A087404694007D351A488DD32CFEDC NYGANESING
914,141,307 *5F25BB3CDC960E290727E78957C764ECA50725EE KENTTEMORES
914,141,308 *5F2AF4A0FE6AF5A637DCC396034913DE6BF163CB KERMIT.GRIFFON
914,141,309 *5F2B79C6A0A02832236D2C2A1A8BEFDCEEBE3E47 KETAMINE.THE
914,141,310 *5F26EB701BDB40BB7769881BD3DC830676481DB7 OCAĞINI
914,141,311 *5F24DD1419064DF555278C83D13E0761F30CF3DA kid.crocetti
914,141,312 *5F2276A7ECC611CDE3F2EB758DE3888A6058ACB9 KIENZLE'S
914,141,313 *5F2F15AC9435B0FBCE1AB9604AF59246B3403864 KNX]
914,141,314 *5F2CE73F5F57EDB30EF9344D7F455F1F5E8F041E kommunarsk
914,141,315 *5F23DFC425320DB1F16C8222F6EC7D52ED6D1F4B O><~`~`QQ
914,141,316 *5F2E55AE7DEA2637AD465A8961AFD9D231C3BFDD OSCONVERSOSALCRISTIANISMO
914,141,317 *5F2CD8A29527ABA048151CE595F55D9BDAA28982 OSIERRA6
914,141,318 *5F2E46DFFEBEDF5C405B3CD1A86477C1E0C87D12 OSTZE
914,141,319 *5F2FC884A753EEB636EDAE6006819B38C48DBF36 kujovi
914,141,320 *5F29A9E56037F5BD57F9A29D3EB558BBE3F60C8B KURTIS.MELENA
914,141,321 *5F208161634EC231A77BA9A42484C5D2C475F1E1 KURT.LEDSOME
914,141,322 *5F250362B9C5B09C84C97A9ADA975811491547CC [email protected]
914,141,323 *5F2C91E2DD03BD77EC18CDA170EDF8F2F85A6A50 KZ/S
914,141,324 *5F2C4E7E2113FBBD08958168244D4882964FBE58 P38089
914,141,325 *5F2EF3BC8EF30499C5723DEA073E69780F23D800 LAGUNA-PAJARAL
914,141,326 *5F243D69DCAB09E15100C6A56AE1E014AB34DBCA PÄÄSTÖLEIKKAUKSET
914,141,327 *5F25DF86970A147CBAE994D827D124CBD1F41D99 PADOUK-P/@/'D/U/K
914,141,328 *5F2BACD2B57D6818C9489044C2874CC5F9D29337 PAMLAMMEY
914,141,329 *5F23309D4D6EAF774841096ECA68EECD90A840D4 PANPLEGI3
914,141,330 *5F2C37584D30F9F579335B99D7A44029238E195C papababies
914,141,331 *5F2D20A420C5C882ED74734DEA680EDE879C5F9B PARACYCLOPTERA
914,141,332 *5F284170E8E73E4D1B389182886F1FFFBB403205 LAURAKISSEE
914,141,333 *5F297D48FE62EEC51F7799381779772C5F6CC143 partyarmyfront47
914,141,334 *5F24ABB8045046D9658E15D29470AB8480B5225B LDEVILSTRINGER
914,141,335 *5F2D594C8BB9BB5F1BA5D1F5D55E59E72650E704 LEANDRO.COZZI
914,141,336 *5F2C98E42E07A74875F04AC842C688DEEEA4233A LEEKRISTA
914,141,337 *5F2812A01229EC7EFF6BBAF61F0667C4277FA6D7 leimagtibay
914,141,338 *5F2378C8C50E8D00C942D537EA377897052FDA27 [email protected]
914,141,339 *5F2FBABC07092DB881A585835AF17B8A744FC768 PEACHICETEA21
914,141,340 *5F2B0493E8838761C0020C6411F5DE051D3927E5 PEDAGOGIKLEKTOR
914,141,341 *5F22EE27F8264C3D0BD24CA92185D3F28006D26B PEDRAS.CONTRA.TANQUES
914,141,342 *5F270D1A610CBBFFF8560F7A736DAD62E0887FF6 lesnikem5
914,141,343 *5F2E687A71714484F113C477428F31D670E49902 [email protected]
914,141,344 *5F299F9098999E991BBC9B2F168BBE0A4D07D0F3 liefdesbrieven
914,141,345 *5F282667DCDDFC6930FBC2D5D77C767C33DB6895 LINDSEYWEGWEISER
914,141,346 *5F2701105B3AF4FB58497A14F9BE238F27DF4A82 [email protected]
914,141,347 *5F24920E7AEB205B590B65AA42868634C8AD3502 lisa.vitale
914,141,348 *5F255D71340F702C4217D5DD8AFC859186061BC4 PLATERI9
914,141,349 *5F2FA78275DD469804032C2D1830D70A7DE81D13 [email protected]
914,141,350 *5F206F6E4C8975728C099CFF2BD86BB66B8CA372 PODOGYN0
914,141,351 *5F249427523D99852A3DE11C60FD94977CE41599 LONNYBRIGGERMAN
914,141,352 *5F27ADF62CDEC8702EC075464B352A2EA5067E96 [email protected]
914,141,353 *5F2EF591F58A0F347F5FB2E21FD6825C0D7FB1F4 P#####P.`~.>-<
914,141,354 *5F21685052FFFB119EA3D228D0AA568B5CB25C5B p====p`~>b0
914,141,355 *5F2057D2C3F31D0531D7FA64E558336CCE86548C pr0le74ri4nize
914,141,356 *5F2DA043296B53485261F6F3CDA31CBC51F9AC7C PREDROMANIKE
914,141,357 *5F217FEBC6BF12619C4EE9FBA63B8E01C32B1BD6 pressroom-read
914,141,358 *5F204312608169033DA65B5050D282DC86E3AA09 prismenwürfel
914,141,359 *5F2DD2FC383D9074C6691C097B8D6BDA74B11490 PROEEßAETEU
914,141,360 *5F27921A9A1EB384024D8C0F516163F40E1D213D projcted4
914,141,361 *5F2444F60EC602FCCD0F0A3B278CCC37611B20C0 M105648
914,141,362 *5F240C951E75870371BBDD32A1A3B8E4CC41F9AD m314ncho114c$
914,141,363 *5F249C074000B2EB8A7815616EEFCD8FC115107C pulverbeschichter
914,141,364 *5F2D056AE08C39BF13773B9D2090F88F7BF34B52 maddiparker
914,141,365 *5F24A137506B2B948659ADCD9F557A89066F79F8 Q----) `~>-<
914,141,366 *5F2028F9A8A3B5D326F9F263266534E806386E90 [email protected]
914,141,367 *5F297128EECC62940222897F816A454B9BB5EC91 [email protected]
914,141,368 *5F2FE172164CFA9601D1A04A99CAA89079CEC31D [email protected]
914,141,369 *5F2E026C4DD24DBF4A09E213493FA1A63D5A06C2 [email protected]
914,141,370 *5F24E8744DD6E80CA19BAC6E440D0922A026B925 [email protected]
914,141,371 *5F2CABF8B092B2A2F956B2580B4044280B50D6AF MANOJNRP00
914,141,372 *5F2015C3EDD36FA8E6C1E4CF8FA1742F7EC8BA85 qjessied
914,141,373 *5F2A3C36AA8FA14367E76BD3BCB178FC21729200 MANSEAUX
914,141,374 *5F210F106BDEB2222BE55B17CA2CCAC6697AABE3 MANURER
914,141,375 *5F24DE9EDAA55A7CC2A6454C8C48F0B8D5A56A40 qp ~}O{
914,141,376 *5F28532C3B023513D4C46732301FA2B60EF00D12 Q=P~O><
914,141,377 *5F22AFC4E3C07164CFB075907F6515DA9BE4E8D3 markcerutti
914,141,378 *5F2DE19E53D258711D4AF3322A5383D11C1FAE34 R33MPH4$Z3D
914,141,379 *5F21BB5C1A310F1A407F1164A8D4BC12938CD531 r34ppr4!s3s
914,141,380 *5F29DB5A70B5E2C884080348B9EEF075197F7DD8 [email protected]
914,141,381 *5F22FA8239EE95490F156623A2BFD242D0C7716C RACIALIZATIONS4
914,141,382 *5F22E70CBC14046C888C2CEEC65BEAD0480B0FF3 mary,-i'm-ready
914,141,383 *5F228A9247B0A59BD0D0E5E33C01F82A71BD23A2 RALPHCASILLO
914,141,384 *5F2D9D045830643EB7C09F2478B601E9BB8A2996 ramadainternational
914,141,385 *5F24243B83F234F5A6CC929B3FAD871146E6171C MATHAPELOMATABANE
914,141,386 *5F268A8F975D258632E92DB45F65EAFC1FA66469 RANDALL.HANSCOM
914,141,387 *5F24A0EE9974745EAA5082C93B00A3B279E1D95E maximefubar
914,141,388 *5F2AD38FFBD579A36F885080238463D4ACECBFF5 RAYFORDPOLVERARI
914,141,389 *5F2453E38EB6F651BDD91BB4950DE286C28DC946 RAYMONDMORAN
914,141,390 *5F2A56C835144D2E1886853921313BCE655BC10A M}DF
914,141,391 *5F23E036DD13D9D2F2AA1301A4E92ADEDEFE6ABB medream5
914,141,392 *5F2C11CB97910C3F7B3CA3E18A3ABEE0AB27F785 MELODIES
914,141,393 *5F22EB7653037081D7277F3BD76D5416F7C89892 REENSLAVING5
914,141,394 *5F2F4DB2C3F7FCF705C6D9486048CEEB40E224E4 REFRUSBV
914,141,395 *5F2F5FAB3CF0B012FECDBC62F09C1BF8BF71323B merrillsteeg
914,141,396 *5F231549B8A21A66C34A476C063ED2488420E090 rehab(remix)(feat.jayz)
914,141,397 *5F25117A3336140D53570A88A0F00514BF59ABCE [email protected]
914,141,398 *5F2534A81FD72D03A85980D508CE905B9B35B8D0 MICHAELBGOLDEN
914,141,399 *5F2AFB06B35708372319891F1C25A5D2DF90A77B RELENTLESS:TWINSEN'SADVENTURE
914,141,400 *5F2DD8FE6897AAB3D16E565DBED6ED089CD256AC MICHELLE-THOMAS-MITCHELL
914,141,401 *5F2E024B0FFF73DD282106B131658096248F99B2 [email protected]
914,141,402 *5F27102A433925A8AE56C9E91E0516461013DEA1 REPENALIZES1
914,141,403 *5F2917C34C2058332A7976C10AA12937C52BFC65 mike.pafford
914,141,404 *5F28B1C94E658F60E63D4635CBE5500F54E4A741 retard33
914,141,405 *5F21F206A7B699FE9C635C6FF6E08BA3BD1A414D minaaoki
914,141,406 *5F2FC4C1CB512F0B4BDA3B8641FD3516C7BBDAF2 mitchtinson
914,141,407 *5F270D1AA89B2BCB715DA16F81DF9B0D0EA34BDB RICALISME3
914,141,408 *5F23431915F33FA511E7E4BDC1D263CCF3C4E7D6 RICKEYMANSHIP
914,141,409 *5F2CD82BD0A7C7720B77E20888271F390978C8BE mnemmabm4l
914,141,410 *5F2160284628C5E5D4B8A1A5A8CD40F42A0D6352 RILEYCHRISTIANSON
914,141,411 *5F2EC8A98254A4745CD98DBA40F8F4923EC21983 RINNAKKAISTALLENNUS
914,141,412 *5F28BEC5736B1502B2C4AA614C77B3D0DE45C7E3 MONTYMUNGER
914,141,413 *5F2089F01E608BDEBA0CD4ED2ED6E7F31AD3AB35 MORGANVANDYK
914,141,414 *5F2F645052800AB62672822462F71A5295A8F1EF ROBERT.ZETS
914,141,415 *5F225B0DBC09575C11A9ED3B5F29421409352A67 ROBIN.BAYLOR
914,141,416 *5F2E812EEA53FF9E4639DBFDCF3B1108E4DB4F35 ROBIN.WILSON
914,141,417 *5F2ADE3FA38414E4B96B4A96ECF000F74F8384AE MOSTWANTEDHITS1(DISC2)
914,141,418 *5F2C289AB2B006E6B2BFA203A5F7B598FDEBE31B ROB'SBASEMIX112
914,141,419 *5F247D46F16E7FC0D98F40EE1EF3DAC5231684EA mr..davies
914,141,420 *5F2B7F0E03DC30529799B79A242279D358F4357F ROLANDGERSTLE
914,141,421 *5F28EA8FB7AD415641C21DBB61CA8DABCB26B4C4 ROLLINGSTONE
914,141,422 *5F2C669A587A5940621A4118EB5D4783E8D60BAE ronnymankin
914,141,423 *5F25AFCB0B5B2FCC29EF6761B81359D2922B41F4 MYNESBIT83
914,141,424 *5F2230767B991DD1708F9E2A2A5FAE99AA914637 MYTAREV
914,141,425 *5F290E9283DFF6A130AF6A91AF0EFBE1D36A6AEC [email protected]@[email protected]
914,141,426 *5F2ECBA89439814F7E5999F34554C723C60E6688 [email protected]
914,141,427 *5F2880F04B176CBD4E4488547EFAC80B8D34AAD4 RRFCTNLING
914,141,428 *5F289C34E3236739822C8E14555005E8B83AC805 nagger
914,141,429 *5F242BF50CCE86EDA7089D321215DB6DD10EB088 [email protected]
914,141,430 *5F24ED142F63BE55FA2D031FB6CBF346E4AAF895 runnin' bustos
914,141,431 *5F277277F682A89BED97920AA291CD4EAD689507 NEGABILIED
914,141,432 *5F284E73D0A054BDD4DB2F6A5151E0011C61C313 [email protected]
914,141,433 *5F20BB72F0A2B56587305B3DCB834D8D65C36832 s8p^
914,141,434 *5F24E4C17E33D671BFAE721E592EA424E5F72298 SAJEDA-IBRAHEM
914,141,435 *5F2D906255B730FDD410BEF6097EDD1A8F951C94 nethiers
914,141,436 *5F2922DAF15C2B411AD7D737894FAB0ED935F5EB newsreadername
914,141,437 *5F20EA15DA81FFC54B8C8918FC53D43D7132671B SANDYKAUFUSI
914,141,438 *5F2C29F06F6D44524C540E1D4E92BE047B2340E0 sanfordbadua
914,141,439 *5F27EB83F61469DDB6426ACE87F1AB7AC0E0A073 SANFORDPHENIX
914,141,440 *5F2CC65820D6335BD6498D614A6E1F9A1D708133 SANTACASEY8
914,141,441 *5F2DD304099AF5C9EAF327A734BA111A90A17668 SANTIAGOLESTOURGEON
914,141,442 *5F226514472C95832621ED6FFE495C128FDB998A [email protected]
914,141,443 *5F2A0D49793ECE6ADFA2272433F4442F017C5E45 SASANKA REDDY
914,141,444 *5F2D20DB9ED09D1A94E963F9555629081E9EE6F5 sashacooper
914,141,445 *5F2D673215BE8A34591D7168A707BC1F6CD13897 scape~withtransparentwings~
914,141,446 *5F2A9AFAF22ACB6B8F6475F41EE4BB57764FA837 SCHEMADOCUMENT
914,141,447 *5F234CE35D8D4D86A36440786A23639216F2409A schneidh2
914,141,448 *5F2C26EAB2B02030EDA5568443EB334035EE5CD4 NP_060120
914,141,449 *5F28A908CDF895943DB76A2ABA1DA917670160C9 screwguns
914,141,450 *5F2A7271428D1DFD928A1FA44F7F6324B37C30B3 numbersperon
914,141,451 *5F2F94CAD13496BEC07EB97506120912B2494497 sedneggl
914,141,452 *5F2CAC862232B9075882B3C7B4FAC4A5BED5AA18 [email protected]
914,141,453 *5F21DF10E2A841989543EA662D9E083BF09BD9F9 semichiv6
914,141,454 *5F2840A1B5BE6953149DB5CCDC8B2F0E4AC1EDE3 OHMIGOSH5
914,141,455 *5F2A735B23C1484CB056CC9B1A88043C339970D1 SEVERIGA2
914,141,456 *5F24C815331DDD117E4314B8AC494F860B9C615B OLICHEY
914,141,457 *5F234FD352916CF1B0D1B8E0899604EC44FE8B1A shabu6425
914,141,458 *5F278C5683D5C617483F8E3D3A4DF2A9D22E2564 ONEVILLAGE.INFO
914,141,459 *5F2A910E791E175C44F19B9E3BD93CCB8C6AE9B8 ONOMASIS
914,141,460 *5F27EF320369C6A0960DB0291596B35605512053 )o(`@p
914,141,461 *5F2CF8955C68381E399C8C57A2A047CD587BE8B9 SHERI.ADAIR
914,141,462 *5F2B48C68AE2923C7CAB1B96B5997B6D41B6F0BA [email protected]
914,141,463 *5F24395DDD57D97ED8CD8DBF9E37902E2529AC67 (o_-) ~<=====q
914,141,464 *5F27BEB5672AEC54068A50856A8B7F933293F1A5 orlandovirgel
914,141,465 *5F24592D7C1F0D7F64DD68571361EF4ABE64269A orvaljohnstad
914,141,466 *5F2510A51D7121A72F6620D6BE6E65B899E6BEC3 [email protected]
914,141,467 *5F29C1AC1BA25165C1C9204C13E812E23FBEE8D1 SICHERHEITSARCHIV
914,141,468 *5F214A23E6628E12512EA6CBC23B624787D58FB8 oswaldolepretre
914,141,469 *5F22D7372D374138FD183C60DA39C6AE7AE719E7 OSWALDOPAULDO
914,141,470 *5F29F87FBC379A8C045E84B63C3F8534E05080E7 otpusnis
914,141,471 *5F2BA152864FEB03519C94AAB5099044663AE635 SILASYOSHINA
914,141,472 *5F2AB0ABBB357BAEA9D83D21967637E5B5755FC2 Silent,-Blue-Night-(instrumental)
914,141,473 *5F2C16C2ADDCDFE8D4A57AEBC0509FF74D3A8240 outlook替代)。
914,141,474 *5F21227BA983BC4CA28F74D53804B1785B361414 simeon474
914,141,475 *5F2F9334B5F998FC16B57492522E92EA9D380C19 ozon92
914,141,476 *5F2312C69765E842CE20BDCF5B9E785BF217BFFD SKRETTEK5
914,141,477 *5F22B58AD7721C66CDB9B87538307A1908718BBE SKYLA644
914,141,478 *5F222A42C4D6C6F65DD0D98EC362132CD669FC2A SLIJEPAC3
914,141,479 *5F29CC5B4796F1DAEBF4A27131264395837EB3EF PABLOMEDRANO
914,141,480 *5F24651C6293C664219D96F102441CA852E29EB7 pablotienken
914,141,481 *5F21E72EA6070B56C37BA1C92B42B3331F95A5D9 SMALLPRICETAG5
914,141,482 *5F288250DE2D382D582DAC870509081C0282A93C smother2003
914,141,483 *5F2252C61CA6CC34239F333DE8F11EEBB7687AA3 PAOLA.MARTINEZ
914,141,484 *5F2AF9074162D2941C9F48D2D8A57B21C9F85555 snka93
914,141,485 *5F24BBDC23EC1CDE73F9C799FCB0348144A387B3 SOLFAED6
914,141,486 *5F2FFD9C8D9BF9F9958EADFEBE122B93141741BC passati0
914,141,487 *5F2BF0C0C3C3687793BDEF7ABC53537BB4DFB687 SONDERSÄGE
914,141,488 *5F2E52CB6AD5B03531D6707C7E9EEC2CC13CE54D [email protected]
914,141,489 *5F2F2DD80A3DC5EC03DD31BAAF3EB12BDC575D54 PAUKKELLER
914,141,490 *5F2270904CF16BFFA09EEB160CC9173F15158B37 pb~o ;)
914,141,491 *5F2BDB9ECA6166EB07BCEDCCAD2EBEE16733FE5B P=====B~O~O(-_0)
914,141,492 *5F2A8F0E349F6FD75A83F5DCE4CC8B5F214FC246 spectrally0
914,141,493 *5F23EC6DE25BE78D0EB0174E3DBCEFCEF23A659B phalaris7
914,141,494 *5F212418F8AC41383FB12F853A0DC71CEA8D2DC9 philmenghini
914,141,495 *5F28F96F0EEA072254AF138D62350C00BF001DF8 PIERRESADEK
914,141,496 *5F29E6AA31AFE089894AF523F5FCCA64691A0124 stacynorstrud
914,141,497 *5F2D412196B21976A85FC79081BE4021D342CB8B PISHĀCA
914,141,498 *5F2C110F3802890DF1DE4B4EDC7D0633FF1DFFB7 STANCE OF RESISTANCE
914,141,499 *5F22CFD208147C02C60DCF24CF8A4368B9786973 „plainmoore“
914,141,500 *5F24748691CF3BA8871248FFCFAD22A263DA428B Play.Time.:.Th
914,141,501 *5F2B1D3F0FDBD3CA43694FD2C42089269132D8F5 STELGERED
914,141,502 *5F2B7151D4058118ABAC5324BC981BEBA3356746 sthaavarena
914,141,503 *5F2A0267750BA68119B161F095A48D5B85C5A2B1 stklccts4
914,141,504 *5F286796D21DF4E5A359EAD320B0FA60E1A70E68 POSPCHAT0
914,141,505 *5F2ADAD4ECAC088F799F207871D2A760367E685B p##P~o.3B<
914,141,506 *5F25049470271025830BB568B23AF25BF25C103B pp`~sploit
914,141,507 *5F2AB683AB91341670D467C4351D375633B2F4A4 [email protected]
914,141,508 *5F2E238D924B12D4A681758D29B1D2DD69164A4B sueibud8
914,141,509 *5F28AC6C76150F8FFB62D0789085D5073B2AE154 [email protected]
914,141,510 *5F2D770C495258C005018DFF468CBB2860F2A4F5 pribisek
914,141,511 *5F2B79F0E64540AB0E95AEF304124F350C193857 protectedicon
914,141,512 *5F2A596174FEF1455D9491531E571F9F67E45BE2 sureanywaytheir
914,141,513 *5F2894FA1A068DA754C2F0869E9BFFB25C763BFF susciterei2
914,141,514 *5F2E859126CAE26CECD2605BD9E9DF0A27CC0132 SWITCHITBSW6
914,141,515 *5F2E83FD6673C4989F71453708C8FC25183EA83C [email protected]
914,141,516 *5F2253BD929AE06D22AACBB25F6E896C9DF857C1 symphony-no-1-in-d-major,-d-82:-iv-allegro-vivace
914,141,517 *5F2CB6AF26BBDFA98099FC9720F766C4C7BA34F9 [email protected]***~0~OSPLOIT
914,141,518 *5F2959BBAF268F6634AA75C8E268E99D080DD7FE syvtal
914,141,519 *5F276240E75E03C00B8065EA837FC2EC3392228C q"e
914,141,520 *5F2FEAE59A819DB7D64CF6280E5A4D27052E08DA [email protected]
914,141,521 *5F2A899BE70844698246DFAC03348E1DF70BCAEF talk78107204152
914,141,522 *5F2F01342C488880E123D732C47B6A91B4CD775B qqqqssss
914,141,523 *5F29F00CD6EBC3CDA6ADB90690130FDF24C752FC Tarantella.napoletana.(tono.hypodorico)
914,141,524 *5F28ED35293A25B493F50D293E8D7EF5C92313D0 taryn-dunlop
914,141,525 *5F230405EFDA44BCF674B9283B8E09DBB809A6E1 TAVARIESO
914,141,526 *5F2B0DD4F02BAC2B26B27EE9E226228E77FF769C TEDHUTTNER
914,141,527 *5F2416A6D68E91671D18D524CFC99FDAFCA0B66B RALPHSIRES
914,141,528 *5F2110B7519C19C259F3FE6C9E79071381204E4F [email protected]
914,141,529 *5F2DEF37153782B917230AA5A086C7D38450FA31 telephonesupport
914,141,530 *5F21218C5F71C9A240E86089AD66AA96AC9915DE RANDELLRABERN
914,141,531 *5F2CCDEBF0634FD4E94A1DAFC1688473B8F752BF raphaeldonlyuk
914,141,532 *5F28150BA3D60A714B7D58FA697247D4A087FA95 teringachtiger
914,141,533 *5F2D8203358B53151EB4AA113AF26BB5597D91CB TESTERMORGAN0
914,141,534 *5F29418E57FEC832A79C6566865B182DB9012EEF raymondmeany
914,141,535 *5F24956540AC75AF199555EC695A4244EB17B0E7 RAYMOND.STROEDE
914,141,536 *5F235AEDF6E0A33CEF1C904182E50F23EB3326A2 TGE
914,141,537 *5F2E6AC835D263F2983D186B2ED42E7E0599C5B0 re4ss9nmen7
914,141,538 *5F2CE89AE9C5638AEFD203C7325DDCD773339949 REBIEGSAM2
914,141,539 *5F28D3E26E65322FA4F7CD44B5D76EC6FC2C1752 THEFROG69
914,141,540 *5F24B9198B23A80057CD78E176AB7F3C44F7CD37 [email protected]
914,141,541 *5F27ACFE7DB0138914E2C68FA16F99B0D61B1730 REDELIBERATESES
914,141,542 *5F2D37F54ECAE403046449D79B58A468A3D5433A REFIRIENDOTE
914,141,543 *5F2057DD4D92CD4B0523E21E71BF18B3D0F36157 REFUGLEUNGED
914,141,544 *5F25FAE6AAD5106490B48080C9EEB61AC6BF5203 rehcsit0
914,141,545 *5F27A0D4EFFACD0C3F76E7D28190D7D803AAF126 RENOUAIENT
914,141,546 *5F291ABBF97E0478808D821520CDBC229C6C4159 RESECTIONSES
914,141,547 *5F2F9626D149E2C3635A6D60F7A621685DADF6CE TINAAMORE
914,141,548 *5F28434543DCB8883B4B2C527A97B9B3CB8A6EC8 TINDOLA
914,141,549 *5F2707E33079D5E96471403A87C8A54F367381FD [email protected]
914,141,550 *5F24E3E0497B42D6691249EFD8E005A48D4D6D8F TITLEWOLFGANGUS
914,141,551 *5F2CEB2755879CDC4BF3F76DC126AC4ABEA27273 TITUS.NETROSIO
914,141,552 *5F29F4F50A35B5E7D66E698DB3E4BB8565975E1F REVERSERD
914,141,553 *5F233C6CABBAE52CA60F050A7B124D4AA73DAAC2 REYES.BURGOON
914,141,554 *5F23B0FD7D5B330419565ED20472EA5EF99AEE1E REY.RORICK
914,141,555 *5F28BD20C9683579DDAAD03897AA1694D47C936A TNNERREHING
914,141,556 *5F2918F369DBB5A601176DF2D7DBF1A6C5D9F803 TNV30
914,141,557 *5F2F03AD5AEBA6AE746B77B6664EDD5E6B1F9296 TOMASJEMERSON
914,141,558 *5F2BAF9C8FCFC7B95510FD07052BB2D5983038F4 RICKIE.MOZLEY
914,141,559 *5F25956530C13B15DFD10ED68E4D2236C655A297 TOMMY.MCBEATH
914,141,560 *5F260F6929030B1121E344844B20FE9985A7F690 TOMMYRUBARTS
914,141,561 *5F20B52EFB96FDCE59541EBC5C18E939AA29A6CD TOTEUTUVANNS
914,141,562 *5F2A08E73BF736DC6FE37F34C009E7471FD974AE [email protected]
914,141,563 *5F246B535BF57FCC08AB294ECC910D0C1A5640A8 TOURNAMENT1961
914,141,564 *5F22CE3B0E9E1416928BACC3064B6EAAF182EBC0 TOVAVÁGTAT
914,141,565 *5F2AD7FFFE8B11D2694214C2D2EAB64DF205662B RMBI11
914,141,566 *5F22521AE021858824FED73339100CACEEF1D3C1 TRACEYGARDIN
914,141,567 *5F2A3499E310A1823221F48B3BF6E5F4ABE5D4FF TRACY.SCHONBORG
914,141,568 *5F26309269BF547C17E1C44717A82D6D69798FB5 TRANSGRESSER1234
914,141,569 *5F266BF4D228E1369EE99C5459986146FA76FEF0 transylmania
914,141,570 *5F2D8E9DCD91D66904192786DC10B8EDDF5FC293 rodrickserbus
914,141,571 *5F24974B83D48EDC04D640975001C967285CC919 TRIMNINGIVE3
914,141,572 *5F287976F728993B330D213E8BBBA8568B9735E2 ROLAND.ZAFFINO
914,141,573 *5F2818295E796C5EFFA3E05B4A826B691A4AC5AC ROLLINGSTONE
914,141,574 *5F2A9F928E83821DAE8D2C7BACC96F5D6219DC9D roseannestephan
914,141,575 *5F239FF324205B118BCE55DFDCC4C8CD606025AC royalpele
914,141,576 *5F2B572DE26493BED0C13A0AF9CC56DA1EDF7BC8 roycewalking
914,141,577 *5F2B1C27ECD9E10C21D7956F4172F6904A2043D0 TUAN.SMITHHEART
914,141,578 *5F2DC7F48FBB7E5E2A858B723A427C8ABC99EBDA [email protected]
914,141,579 *5F2C56651392B20792CC380F07F041D81300F719 TUNEREN7
914,141,580 *5F2E13B5B0954A2F92311528ABFFB0083533ECB1 TUSHTUOS5
914,141,581 *5F20C5DD7ACB6D91F87A77FE3856100730A3458F TVESKJEGGVERONIKA
914,141,582 *5F21B3353F06814BD326785721B9BBE478B66507 RUMFOLA8
914,141,583 *5F2B4596721B376EDA2E9C6040E8D8C96AFFC7F4 tylergarguilo
914,141,584 *5F258EF3F8084C64BD84CBAD23C8C79D47231F61 RUSTY.BUTZKE
914,141,585 *5F204080D73C1BEAE75A5860498835324F6A0C5C RWOLFLEY
914,141,586 *5F23A70F08C69EA0C465B39A192A91D1C9A6889D ryan.alleman
914,141,587 *5F2F42C6E590BE29D3588D31FFA4BF114464674F UDUELIGGED
914,141,588 *5F23018613C6ACA4AC5EAC3DEB30960B03452235 [email protected]
914,141,589 *5F25E16B969D6B1C92121FBBC5121CFB60C58AFE [email protected]
914,141,590 *5F273AD789FC39834F060FD03AB5E85182322955 UITMESTEN
914,141,591 *5F200C3C358D2C62742B387287B88CF8F6A35D05 salongs6
914,141,592 *5F2C630A4EF1A33CB326B9696AF1D6AB6351C53F sam.en.moos
914,141,593 *5F2AD6E6DBCB0FADA353D7B27EE9C13499A14AB8 sammietrevathan
914,141,594 *5F2FDCD78333A6BC1E0D0542738BB379E5AA4847 SAMUEL GEE
914,141,595 *5F250EAD26DA6A756D5FE119BCF0D9023935F2E2 [email protected]
914,141,596 *5F2768F7D7416E2F6F7EB8C99EE7B5999E5A04FF SBAJOWSKI
914,141,597 *5F2A0EA6C5A029D6F4A19017E5480546DE1F961D SBCTDRML
914,141,598 *5F25E30CC5741D22B29D564EDFE4763B0B5C5855 USERDUSTY669211
914,141,599 *5F2C16004A49C719324B0E7A113EFB21A3F2A4E8 UTIMOOSE
914,141,600 *5F2AC5304F37A23056A9DBE07C64C77DBFBF7A88 SCOMPARITIED
914,141,601 *5F2D7772D44356A5A8951E95FD4AF1A45076DA22 SCOOTERDANIEL
914,141,602 *5F2D7960B8369D58B63FB8A50CE046AA41F73330 scrogging
914,141,603 *5F2DDF9BDD9EAD96DD5213475657A4F8FBD32B0B VALI-VOICU
914,141,604 *5F2CB1C6EDD511E3E49BC9C83E3F9CCD9DA53D55 VALUTAMARKEDETS5
914,141,605 *5F2F99B6BDD0B422CD4DB33C58EF277B78BB3FB5 SEGOOROO
914,141,606 *5F28B0E80C7299EC7FE9F88B1B159C27FF7822B0 SEIKIRAN8
914,141,607 *5F27CB4E2D8CB351613A441B9DB836F495058FD7 [email protected]
914,141,608 *5F28C22920ABB57ED8F747E4B40381E800875E05 selge’deki
914,141,609 *5F2A5FDB1FCD23D55F3C0F9AD4BCEC24F9B60731 vátsiputríja
914,141,610 *5F20B46D2B8600F916F7F20A53273BF96A3CF312 VERAWATISUGIHARTO
914,141,611 *5F2EF5BED20C65EFD08D14FA74ACEE42D29DBE9B VERHALTENSKUNDLICHEN
914,141,612 *5F2E3A56B15D736958ABE1CE0C881A5A595862E1 VERREAUX5
914,141,613 *5F20B7628343BACF4074F0A92DAA29D9E401A2A5 SHAKY BLUES
914,141,614 *5F2BD6AC9AE66F773897518D289286A763D7EB80 [email protected]
914,141,615 *5F2954E749FC5176AE71D30B56A0D1F96CEDD771 VIANDENU
914,141,616 *5F2E8822EE2B444CE36FD41A2FD52ED60A97A37C sharkskin7
914,141,617 *5F26A1D2B6D85F6751079408C9DD777E2B93F5E4 vicki.piccoli.blake
914,141,618 *5F25237DE331E62A2AA0F2CAECDFD6C828569C1F shayeyam5
914,141,619 *5F2978F5A3B9608E93CC352B4DDAC8D376CC1F55 VICTOR.OJIONYE
914,141,620 *5F29127177C8CA0050DCBD0FC197747461C907D0 [email protected]
914,141,621 *5F26CA4BCA2408B212247B401B25B95DEB0D7E71 SHERWOODMAHONY
914,141,622 *5F22AC7D4E122E531368FF7668E343256C5149C8 vincentdoucette
914,141,623 *5F27C15EC23E0423C7BB1FA635C725532F19CE3A VINCNNT
914,141,624 *5F2D97812AA89DF50E35303176D76BA4801AF5B4 viola-kemei
914,141,625 *5F20948215D83F70533C4B9641718048C4C03EBE SHONMATUCK
914,141,626 *5F2B789E361C2367691FC5F87C8FC400A987F5B3 VIVEK.SAMAR
914,141,627 *5F2361397F95A44B9C013C9D13632DE952841664 SIDKANNEY
914,141,628 *5F28AD5629EE390A2640648BCDA9FB43BCF8A233 VOIVODESHIPWYSOKIE
914,141,629 *5F24D5BBE23F3C6E3B365C1F2BFAE89E4561B72F volltonfeld
914,141,630 *5F22CC9C6989391703F2E2917C43C55ECE2F4EED VULTUMTUUMDEPRECABUNTUR-VULTUMTUUMDEPRECABUNTUR
914,141,631 *5F2EA3A1B491E0E1B04823C8876A1A9B9D8568D5 SKVESTE0
914,141,632 *5F2EA4EBC11A6563585CFE3041BB7257A8607C34 VYZJEZP1
914,141,633 *5F253B57A81B2DAF03F0AA9AF016FE9773CED812 SLUPICOLO
914,141,634 *5F21E75A5541CCF2954BA57BD33DDAC7CDFFBF33 [email protected]
914,141,635 *5F244818B09D9C0D43769AC2A994EE229783D1C8 WALDOFLOURNAY
914,141,636 *5F241108BC2D401FD050CAB16E8693AE6BB4AB1F walterlearn
914,141,637 *5F2F519A461F987C48B3563841BD58D024BD1D89 WANACANTMISSWATYOUNEVAHADRUCKER
914,141,638 *5F291929610423E41B8F168C69FB454A6FCA34B9 soapy.soul.1
914,141,639 *5F2068DB2E93DA13980B9F507E91E2DD757B1626 WANDAMCCOOLE
914,141,640 *5F23EE1A80AC2E7749C3D5D35A88CBC9F452B513 WANTONLIKEWANTONLIKE
914,141,641 *5F2AC307F3401F2E05BF02FE57A31952B2C5CBF9 SOMANYWAYS(STEREO)
914,141,642 *5F2EDA62A8344DDD3764EE1912892429AAA1A96D WASHTUBBSCAPTEASY
914,141,643 *5F2FCC6882E22434DDD3BA9FC37CDF5C08ACCCBD [email protected],[email protected]
914,141,644 *5F2618F9663824C4E2B2C57D8F88F22AFE32BA70 soustrayiez?
914,141,645 *5F2638DE908A746254EC080D64C3F4144C93E4C3 SPANNUNGSRÄUME
914,141,646 *5F28E73D1F625D6565C8FD0C3FE9C8C0A6C92CDA wendell-tumberg
914,141,647 *5F21D719E26E745F1E7763FBCE4731FA5E398516 SPEEDYX5
914,141,648 *5F252BCDA2CD2E97EDC1CF2E6F8BA94A91B5BB38 [email protected]
914,141,649 *5F2325844A8A6F06AC6F793BDB9C18987E1353F7 WES.HISTAND
914,141,650 *5F2B1D95CDAA9321EEC4BF2A254EC67A0A284D2F WESTON BANKS
914,141,651 *5F2D103F0B9095CAA3414D887C9A7D96A411B883 Splat!o~q-q
914,141,652 *5F248AC08C948DB640329C380459C45A79DCBE82 williamfmcaneney
914,141,653 *5F2EF2D3B71DD5980ED70B3EB432B7D1235E39B4 willisdelgatto
914,141,654 *5F244596A06C7A9822B2CD31BCBC86EFC0EF0C3B Wilt-U-Zegeltjes-Mijnheer?
914,141,655 *5F236942C81655DA197EA5B9BC4853F5D032F744 star-pepper
914,141,656 *5F2E95931C14059C2BC62DAC494DEA5D2000522D WIZDFM
914,141,657 *5F2808E3615E42CF9A61E304FB67FB553DCF8D02 wootzsteel
914,141,658 *5F2E99662876CA5AEDB9721ED20B17B758C3FD86 wotwsaot
914,141,659 *5F2E978B2867A74E3B5BB34A4DF316BAD2D62003 [email protected]
914,141,660 *5F2FD86CC01B2AD7D339B401B819217DE0AD260C STRIPEK0
914,141,661 *5F29CEE994C3EF66400A579FCFD6ABB26DEFB2A3 WWW.HOME-TRUTHS.CO.UK
914,141,662 *5F2047AEED49A53E5E51EBAECF4B79FBF59FBCC2 WWW.LEXEMERETAILPROPERTYGROUP.COM
914,141,663 *5F2DEC45CED912F29217AEC0ABEA4CCA9B7E97ED WWWPLANTCARESCOM
914,141,664 *5F28A9712A9A4573AD278497CEF851925FC958FA WYCIENCZENIA
914,141,665 *5F2B1075162C974F69428B6231B08071E4DC9C3D X2161984
914,141,666 *5F2A233C0B3CE7189E82F6C830934B5FF6C1EAEB SUN.BONIU
914,141,667 *5F29E518FB20BC8967B1BF1C6FA672AB42627937 XARAPOSO6
914,141,668 *5F2AFB3E4594EE455F291366A466CC4AD35AAE53 SUNRISEHERMAN7
914,141,669 *5F263EBAD3C6768BF6F09C45B03914C591EED254 XDUNCAN9
914,141,670 *5F2946032FBFA007C39BC9B93A35CE224AE7957D [email protected]
914,141,671 *5F24A9DBF24A0B244D0D48027BB3CE855D5B52A5 xkailanix
914,141,672 *5F2A0E61906666978941B73DFBA4BF69134A58FF SVEN VAN PAAPEN
914,141,673 *5F2BC460136B1307FD1D74CA9DAEC64FF544F270 }x{~`.~`.<=q
914,141,674 *5F27ADBB3863C6628E185EF52E67F71A3575B0F3 {X}~`~`Q-----P
914,141,675 *5F2182E4CE5AECC37AE0362ED276FFECDEE70B8E XRGJ
914,141,676 *5F226642CD903005D163388BC23F0647E828C0F5 sybert
914,141,677 *5F20763CF2D4D45E4E1C5F707416F0ED4BA44B5D Y114345
914,141,678 *5F23E81FEBF2F9CB9A214F3C3F710F5680ECAB2A Y126965
914,141,679 *5F2B57F00DE8D369AC2CAF9EC3E9315B48802F1B SYUNRAI3
914,141,680 *5F230DC6A24D98261B3E649CD1AA795B8ED595F5 yai-osman
914,141,681 *5F27E4857D8FA96460D5EE9989E9C693883144B1 yangfan-zhao
914,141,682 *5F22BF6EC9B7BB0F2FED789B8713288239797603 [email protected]
914,141,683 *5F287E9711E3508C4F37B7040141B46F722D2CE0 “TAGES
914,141,684 *5F2FAE8D50B0D9936199BE942298C347156CE82A taijisolo
914,141,685 *5F207E7254BB8F09ECF9936F41A85D582736604F YELLOWJACKET-1961
914,141,686 *5F218A832D188DB6C097E6B49E94031B277DC4F6 TALKBAACON
914,141,687 *5F20B96B5A2BABABBFD8AA56266E88DE6FC1EA90 YEREDOR
914,141,688 *5F2B910C9CC9854D18EEF42F08A2ADC34058E2E2 TANGIBL
914,141,689 *5F218644BED109CF3DFBD1B6FAD0698829E3CC7D yoshimisakoda
914,141,690 *5F23B5C6A097C0EB828E11F46835C02401627CB7 TCTATGCTGATAAAGATTTATTGAGCTCCTGCTGTATGTTTGCATTCTGCCCAGAGGCTC
914,141,691 *5F2348E2954A34210FD5BF7B62BEDC2ADDDF1E16 YTISORCIDUL6
914,141,692 *5F23FC3D17565D7244646A520877CDA8FB510452 YTYLIVIRRAN
914,141,693 *5F22E87B8E5605917A8323640E144F433F315DC2 YUDI FRANSISCUS
914,141,694 *5F2FDE51EFC310FDCEDB908A7AE4AEFF4763C929 YUNITATAMBUN
914,141,695 *5F2E835000CBA249E8EC91DE139AF767D5654E3F ZACHARIAH.HICIANO
914,141,696 *5F232A66DA1E1B77DDC362EE615C1324E060E3DA TERRANCE.KNUDSEN
914,141,697 *5F207ACEEEB1E9993FBF59FC0D976A6B9E141619 ZACHARY YAVITZ
914,141,698 *5F2771094172870464D191BEC20409212D71460C tfk(
914,141,699 *5F2B6E7CE6957E9A780B7418AED037C38317742C THATTHANKYOU2003
914,141,700 *5F2B677EA39A6A8F99C1FC8F73B8CF902624513B [email protected],[email protected]
914,141,701 *5F2BE2FDE95C32B8D7CFA91E3ABE5F4E3A3CE494 [email protected]
914,141,702 *5F222F2DB40F6B85331B091B512F90C014A0577D [email protected]
914,141,703 *5F2406044F8EC71025AA83B5D7D92BA9AE0C97E7 [email protected]
914,141,704 *5F2CEDD29C9BA40726C0C1FAE732D75772CA6F65 zjonnibsw
914,141,705 *5F21C3A25FC7005E0C8F33780BBEF4D1AB7ACA6B thesteeltownsessions
914,141,706 *5F2CE9CDA17332DC6955B4ADFCF53EF341F1B280 THE WHITE FEATHER
914,141,707 *5F290EEED4EAD6F7C17BDC90D3CA85C667DBBE73 ZǑNGGUǍN
914,141,708 *5F2E776346391EC8E169CDCB803FBFBAA198BA0A THGILEYING
914,141,709 *5F2A0531AD930E4EE955BC5E0DA47451F1D04526 [email protected]
914,141,710 *5F285FF65348949D4E4E3EF6F7737A29194C87F7 [email protected]
914,141,711 *5F207E868820894485360AF8569200EE8B639F28 tiacarpenter
914,141,712 *5F244E37A782BD30710D1D877D122200D7123F53 TIENYTRI9
914,141,713 *5F2848AF1A01835AA0667D3518F43CCB5624EC97 TILTY
914,141,714 *5F22E630BC9B0BFD1EA15230D2C8CD7551E481D2 КЛИМОВИЦКАЯ
914,141,715 *5F24028908C757590F0496939340D9329273D1F2 TOMMIE.KAPRAL
914,141,716 *5F2CCF996D95320FE3E0FC06B99D29AD2BF94450 крољ
914,141,717 *5F25DF6FA401A3422B4A0D55BC5C978A3D8A04E5 TONYKUAREZ
914,141,718 *5F2AC07A093985192DA14551343895E657457C4A «одно»
914,141,719 *5F2F9B5A82862C09446560130F3239A2A704E7DF росламбековы
914,141,720 *5F2D94C44A587092AA29B6211C82CD5C7DD68A2D ФЬ
914,141,721 *5F29E46564E32C6A5CBE1AA1586E91AD8D929A68 ХИДРОЕНЕРГИЯ
914,141,722 *5F2C4173888E328DDAF0C318AC77377EEBC89B90 一木有海のhappyブログ
914,141,723 *5F2FCE425B270B12C8CE9DE1F2A2DCA99FA80834 TRICIAROBINTAYLOR
914,141,724 *5F22B7D3A131291C016FB6AD3A2FD519D7D31F2F tristanasa
914,141,725 *5F22AAE098CD8DDDCB677C393B707AC2C072BEC6 TTAVERS
914,141,726 *5F288C1ED3D116CF63A4A7768D1FCED41BFD2660 «¿tú
914,141,727 *5F2516BC65340E9E0AE79C350F27A3D210B28989 TZ]@
914,141,728 *5F2AC5C09ECCC033A0C194BDAEA44367DF70C104 [email protected]
914,141,729 *5F281327E690B12572CDA5C9FB07A3418A919BB2 UMFPMAK6
914,141,730 *5F2CDD8082F2B3F3B0E42A2238BBC84897E90F88 UN9ODLIN3SS
914,141,731 *5F2BF6958C14FC4066A80E5FE35C177AA4668853 UNREFERRED
914,141,732 *5F2A84D5921D3478BC6917B10CDB26FCF623DD0E unweeping0
914,141,733 *5F2D96DCE16841C16DAC02B20868F5E5E66852BA 0ilovehershey5
914,141,734 *5F2BFF17E1B7E9F2C7596A1988E2B6461F1CBF1C 0MYANDY1
914,141,735 *5F27C1DB996A7CDA9E589F5357C22A5730469875 0MYECLIPSE
914,141,736 *5F2946F9C6440CBCF216053D69DB6849DF2D7036 )0( o~o~d####8
914,141,737 *5F2CBEB2FD01937BC510F2251E3F32D9E537A625 (_0) O~ O~Q======P
914,141,738 *5F2FCC21BD50EBC36E901A495EA0738C28AD6DE0 USHA VIJAYARAGHAVAN
914,141,739 *5F2DA69EA8010B48E275821E5DAC478E4CD6C084 (>_0)o~<=====q
914,141,740 *5F2BB823D927B0FD871B0F3B9F32B5338CAF7E5B 106756 HALKBANKULUSLARARASITANITIM1988TC
914,141,741 *5F27D3DE008F3E496BECDAEC72966CA5A13D7245 UZMAREHAN
914,141,742 *5F26E368CEE7849F283519CE11E793DD0E722A41 1158345 its current lease agreement with trw expires in 1990
914,141,743 *5F2F1600678B4B820E941C89BEC94F75BFD7F5B3 11PAREMPAAKIN
914,141,744 *5F2EB1A8DBE86E41F1E5C8D3575F4F5EB2905C19 128302 SUURENNUSLASIN.KESKELLE.VOIDAAN.K
914,141,745 *5F261073BEC95D7759ABB6E51B2DC060CE542202 12december98
914,141,746 *5F2EF45666CA5A66852D884E815E8099C72501B5 valentino.swarts
914,141,747 *5F22EE2E00410CA9A536CC1C85538F0353FBD595 13-yl
914,141,748 *5F2EC0FCD571BF68B8C973992D6D5B869EA27B66 1541631 NUORTEN PIIRIOTTELU KYMENLAAKSO - ETEL
914,141,749 *5F2A8DBC196A7EC5CBA8E45716414ED49FB600C9 valhalla2010
914,141,750 *5F28BC9A9819DE94C1C9323AB4479BD7C3DB09F8 venkata.sivaprasad.narusupalli
914,141,751 *5F2FA8BA64AB08B1772572FDCD9908B04E693F2F VERA CANCION DE PINK FLOYD
914,141,752 *5F2C381490D92DDF5C0225853BA94E40506BE1BA 1.BUCHHALTEN
914,141,753 *5F27AB6AC3611605A9A84A38704B9C07B1996C0D 1dewavrin1234
914,141,754 *5F2C202825A39FCDE3677F9DA0DC9DEA658159A0 VỆY
914,141,755 *5F2280B5633CFE6AC4C9688E1231E6E756AEF53D 1gott-statuen
914,141,756 *5F28AC4A6052D3D58F455262B20BA249FD8C7286 victorwoodlief
914,141,757 *5F20DB8D8656992B2D69F6CAC28C53F7A31C70B5 1-ISYYDENTUNNUSTUS
914,141,758 *5F24560ED77C72F6A811321D715960A3522C0BF8 VINCENT.JOHN.COLELLA
914,141,759 *5F2F799B1BA1E1CE3517F3F253948C87C7CDE56A 1-LAKKOVALMIUS
914,141,760 *5F2093999606F09BCD3419FA658C368E2068CC9C virgilhondorp
914,141,761 *5F2C47E29B462892B7F994AC68CA9AA67603BB98 VIRGINIA-JENI-OBRYAN-WELDON
914,141,762 *5F2AF142B203FD260118B218AC86633D2AD2CC37 1 LUONNOSMAISTEN
914,141,763 *5F29AC17A84AE9F774424B04146C2423C49D7E52 1 MIINUSKATTEELLA
914,141,764 *5F220EBC634201C85217BD2139743B72372B2458 VIYANI KEERTHE JAYASURIYA
914,141,765 *5F2BB08C72189D3424F6E53FC1C22954537524A0 vksaidha7
914,141,766 *5F2D04980A48490E6EF14569D4A7BCE2EB32F8F1 1PUPPETH
914,141,767 *5F2AABE42C6D1321D02402BB17D8D842DC025E82 vonrudloff
914,141,768 *5F24763252C05DA04C455D6A4642A6BBC2726D84 1.SECHS-TAGE-KRIEGES
914,141,769 *5F2995F38A680C2FEBD01DBAE2720AA5F568C892 VRIZKA-PULUT-KETAN
914,141,770 *5F2ED6B7A794F9422EEDDD1245E13DA0EDF9B232 VRLCLLIES
914,141,771 *5F25953746DEFDC498B52CB5DA5FB09F74470C24 vs_aaa
914,141,772 *5F21BE4320EB74143AA31B8710511AF726F0E754 1SPORTKONFORMIST
914,141,773 *5F237CE9C9DB8092B9F5CE7457081ECD8E3F82ED 1 TENNISCLUBS
914,141,774 *5F27EF205D1D3E137D90D1626B644097315AFB81 1-TORJUVILTA
914,141,775 *5F29AE31EF737E5C3E775E018FE61345D00D5C35 1.turtley
914,141,776 *5F21A45AE8CEBC6B92147DAB193C1E5138E14B09 1UITGEBOUWDEN
914,141,777 *5F2428BFFB6007031869E76B44DE80055F090FAA 1-vesijumppia
914,141,778 *5F281C30675D0664649D0886C8798B6224F93FB1 [email protected]
914,141,779 *5F22E2EAE4D3194D17DD33F103A47EEAE058523B 2: 2 # & TEMPERATE ZONE
914,141,780 *5F25CE0177815C55A19E188D8E16CEC774D54F21 25jul1102
914,141,781 *5F2EB887B30FBB6890F98FD3E770B050E9268921 2812807 FREDRIK-LUPASI-L
914,141,782 *5F2A22A20A43D7CE0482A688D9761E4E7FD07AF0 WENDELL-STEYN
914,141,783 *5F2078458F2DFDB79D3A4D8D576275C812EC4722 28nov1278
914,141,784 *5F23D66D7741A12C222A2FD0F26A3FEE6F2399DF 2EDWESTEN
914,141,785 *5F2AF003712A02BA8D4F566DAC7A03E3AD781AD1 WESSEL-NIENABER
914,141,786 *5F2C5FF39ACEF738AD4A28FD89E432A11FC69D7D weymouthgalley
914,141,787 *5F26CAD3F4DAB98DA8E33B2E364E3A54FE8A8C45 2SIMOMOT
914,141,788 *5F27E3946FAF904232B7B7BDD316D0F1A294E8B8 2STEMGELUIDEN
914,141,789 *5F2086754E74CEC2E6EDDB288481F43F6428551E wilbertsly
914,141,790 *5F2C2E9F7075239390DA9E6881C54B793F1DEBC8 wilburnbuder
914,141,791 *5F21E9B59399B936182634EBEF6856DF8C01A44B 30june1035
914,141,792 *5F2725D017E5795A2AB7363AACF16138281A584F 3BABBABSW
914,141,793 *5F27B0059BC0F7DCA6D4E3D2482CDA2233606C9F wilmabammer
914,141,794 *5F2F8D8DC5C49C36757034F14180A04AF48F5687 wiltongarr
914,141,795 *5F254FD39E956EA5A609013A324C0F60D0B51EAB WILTONPISELLI
914,141,796 *5F267667FF472EFF429C9D6ED87F472DC1250DE0 3iluvnadine4
914,141,797 *5F29C3BEB79845D061E2E34111D1E534CDDCB43F 3myoscar
914,141,798 *5F299277B605359A9CC24E651411A30A9BAB2B7B 3-nytorp
914,141,799 *5F278C13583BD23F6C98D0F7C2455CA0ACF424DD [email protected]`:p
914,141,800 *5F2143EFD72592B3150C71AC26D4FCA6FFE11AA8 3=)-`~-`~-}X{
914,141,801 *5F2FF254CEB6C409E8AE2F9D722E2CF05FF662B6 [email protected]
914,141,802 *5F261DAE51CEC9569307FC68C4CD91BDD6E55924 [email protected]
914,141,803 *5F2F227604AA266BC5FFA1C649C472E550D63624 [email protected]
914,141,804 *5F2E8876E2C2ADC246A0B0264E3C44E1D16DD6D6 wwwblack-marmaladecom
914,141,805 *5F2F28A05B0ABC2A1EF4177CF9F479068797AA78 wwwconvivialcatscouk
914,141,806 *5F2346486BB5EBE9B512709E23BDBE4915A61E0E 483208 komutunuCalIStIrabilirler.
914,141,807 *5F24C694D9FB8C284E629DCB77052BF6CDC68664 WWWQUNIVERSESK
914,141,808 *5F263E2AFD7A67665E29EDF906DA8E33A5BFDCE4 [email protected]
914,141,809 *5F251515287F6FB015CF0AE3A05B956175346829 wynona.castro
914,141,810 *5F24C7B08F493FAFBC1247868BA91CAEDE6DB0E6 XAVIERCROLEY
914,141,811 *5F272DECEF52EA9764958C2F0148B60D86642F00 XAVIERFEDE
914,141,812 *5F25E63F54D72085858183A3925B2AB747528831 4HAUSMAENNERN
914,141,813 *5F297E38D27AC1D6F5E8AE811DE9FEACF99DE632 4JAGERSINSTINCTS
914,141,814 *5F259EE8497BD3616EBD7467DD74D126B51A0ADD 4JOHNWISDOM
914,141,815 *5F21590D8C1F9B637582BDFBE17A7B14D20894B8 XGUXJWBBING
914,141,816 *5F2850D42D2CF6CB9FC795F5ECC211BB5F2F34A0 [email protected]
914,141,817 *5F24215A8161540E2704006C415739B82F2113A2 4KUORMALAVOIHIN
914,141,818 *5F26215283D17BCFED49998AD310663756E5A92A [email protected]
914,141,819 *5F264C0354ED3B4843992B91621A07FDECEF96AE 4NAHRUNGSMITTELKONVOIS
914,141,820 *5F27CA6B93EB7E8768992D85B9CFD20924AB926C 4 RAKETTIISKUSSA
914,141,821 *5F2F4C5EBC15508E74E9A75657B70EC89724E32F 4REFERNECEBSW
914,141,822 *5F2D20DCF3779DC9C54B7581757F8FBF45BBEB13 [email protected]
914,141,823 *5F22A77D690F48E8FFD2F87F441DCE75B2F968B0 4SETGITEU
914,141,824 *5F293717361245F2C62D93E095382E14172BFB49 y2af
914,141,825 *5F2FBB2DEFF67C06D6078CC56D83B8BE63AC7922 YAMAHAMIDNIGHT7
914,141,826 *5F2852B167558E9A4DE6951A35C53D580EC11604 4UNMODISHA
914,141,827 *5F201112CB8CC20901B7CEFC26A48F6B33B63EA2 [email protected]
914,141,828 *5F2A37D227D57FC0A075A91CE1F6401383931104 [email protected]
914,141,829 *5F25E89D00CB6664871BF14BF8F5197E82FE1DB4 YASH.JAWAHAR
914,141,830 *5F25A6BD78A51EA5B670AC8B03654721A53BCFD7 517107 lopulta.en.en
914,141,831 *5F24E0F25BF1AC4C32FBFC02062964A0D0D7AF78 5230rnsj
914,141,832 *5F2B378B30C63E86ADBA52338ECD32046A4D33EF 549278 HOIDONLAATUAKEHITET
914,141,833 *5F2F533A9497AD932907819B8445B6F7ED7F4E64 [email protected]
914,141,834 *5F20DBE4C1F11D6254DC8582833A985D30B377E5 yes,iundestand
914,141,835 *5F2076F080C4057C9F42AD4D45CC4B858C4C47FB YLEVEHSIS
914,141,836 *5F2ED5F5BEA456305B58D7B267678CDB0A3188F3 5DISPLACENCES
914,141,837 *5F2098996CABB5DDBCD5640F6BB7C9DBEBE36343 5DISTOGLIEMMO
914,141,838 *5F2F9434E08FB3EC674F6573DFC41FD8E88B1132 YNGSTE0
914,141,839 *5F227D4BA72C9C75C98E5D9DE6E06EC41CF61E12 ytilauqooboob
914,141,840 *5F26A22B9A5C0EEA66E797E3174407AFC2FEA56B 5MALODOROUSLYV
914,141,841 *5F248AB305C61027355BAEE0C1103F47B53D8AA6 [email protected]
914,141,842 *5F2037CA4AE99BF82C0953C2762D7221651F0AC0 5propagandistic
914,141,843 *5F2E6ADB3E203C728D6E6A4AB83EF8E8AA255E03 Z136277
914,141,844 *5F2EB0CBB352C23F30C80AEBF23E464FE5509930 zacharyoram
914,141,845 *5F26D8CB7AA7240BEAD50676309B610F95BA33D8 5uitdelingslijst
914,141,846 *5F2C051964E6896FC53CBD00B419DBD686DAFBC3 65[email protected]
914,141,847 *5F2F9E40C8C5983B611DB1355EA5CEB86D6205D2 ZEILFFIS8
914,141,848 *5F2D190CBC34B37A3965BDA2AA936DD9525440C7 ZEILLIUORBME7
914,141,849 *5F22BA8A38E7AF7C4A273C19F54EECD9959C6832 zeireso7
914,141,850 *5F2B5467760A0BE0A1B1EC96D0E6DCF29D045ADD zendamaed
914,141,851 *5F2500DB149977C7746CCF2B7F6C7AA7A0830988 [email protected]
914,141,852 *5F21263CCE3536E0C22484F2448DD6A83D87352B [email protected]
914,141,853 *5F26512BB604CA188BC801C924C9450161BB8999 6DADDYSUZUKI
914,141,854 *5F2FCE1CDA42114F6B752514061649B4191A6290 6DWARFISHES
914,141,855 *5F229D4290BA18B6578D94909AB547B24285B218 6EPMRISI
914,141,856 *5F24279D387A12ED429874B2A69BCCB59CF58C4D 6iluvsupra6
914,141,857 *5F2D8F4E98DA23B7E41A2DBF7CB093486BC749C4 6MAILMENP
914,141,858 *5F2B1752D733F5B929DD8557AB0BD6E3D6A07D87 ZUDENWAFFEN!,TEIL1
914,141,859 *5F285A6E306ADBA2CDFC0599770858BB277E5A8D ZZZZBSW5
914,141,860 *5F2E3D32D4BFC55E36E915F5C213690BB1AB505C 6RIITOINEEN
914,141,861 *5F26B1485FE81CEACCCAA976517441DE6A495A65 6sep1851
914,141,862 *5F25C368E37DE262D4D7E2E5CE7C4FF773F3EDB7 ΚΡΌΜΕΡΙΤΖ
914,141,863 *5F298C5B1C3BC18B72FB016447A70F30A7E1EDCA 6TONEELOPVOERINGS
914,141,864 *5F2C4370F8B63CA925A21C29097761102A27BAE3 ΣΦΕΝΔΑΛΈΑΣ
914,141,865 *5F25AFF238AE7FBD29D1613044D26E50CB90DBC9 ВИРЖИЛЬ
914,141,866 *5F2395C605E15DA986AF9CBE5E7EBA4C7B71EE46 7ALLOPOM
914,141,867 *5F283A53D3F537DF7356ECAD0E9C005450770595 маньиса
914,141,868 *5F284340CE34BE7750587DBB04435BB613AD9E13 7degringoleriez
914,141,869 *5F2BA23241D0B5EC19E70452130EE69F8A32D132 ПЗО —
914,141,870 *5F2E33CDA22F5FDD5D8D3E7A09D93419EB7385EC 7RHODBSW
914,141,871 *5F2A9A26D6428E41D46D604FFC4E69CDE57C9E4A 7SOUTHEASTS
914,141,872 *5F27C90513DC966E8AD5A74E0D5C19180AC91648 7TSEUQEROF
914,141,873 *5F277965EA9D258DB500AAE7D395B49B45A063A8 7UJMQUT2
914,141,874 *5F285E96FD7CC4C248FA4124A3D122E3B01EE1FC 8------D.~:p
914,141,875 *5F284E81E88E0E3A9E289B2FC2C636CB1FAC801E 8drievoud
914,141,876 *5F276803F367C6582E4F3A7E59D7971D9601AAD7 8indiana
914,141,877 *5F2FF5BDC42CDB91E8ABD04D88772DDAE6B06B60 8---)~~~)O(
914,141,878 *5F2C081667328F00F0FB6A2D3E1F700AB12ECCB5 8------p~0 ~osplat!
914,141,879 *5F2418A4B55E7AD49DCAADB4A0C79E34FA29F17D 1060070 THAT'S-NOT-GOING-TO-HAPPEN-.
914,141,880 *5F23B5980ADE4B7106429C5447C40244AA878BCB 1097663 OSALLISTUINITSEKINPARINSELLAISENKIRJANLAATIMISEEN.
914,141,881 *5F2083D3BEF88DF49B0E973FB0DCADE0ACDB1B9A 110MIO
914,141,882 *5F21DD3B8128F8B9FBDCE41B14A8E7103C982FDA 11GRIENT
914,141,883 *5F29B003C4FC502AA763710EAB44A8BF1BD5800E 9529 kuusi lasta ( aupoika kuoli parivuotiaana .
914,141,884 *5F2C48615E3631D745B3809EB9EAEE1D329C321B 1269293 TALVELLAPELATUSSAHARJOITUSPELISS
914,141,885 *5F2461362813D7266E0439E707A650ADB2293E82 1270885 DAS GELTE AUCH FUERS THEATER , MEINTE RAU
914,141,886 *5F2751AD3868361E5ECF93B328E3ABE8D63D39EB 1337FINKBEINER
914,141,887 *5F26B8F774BAE36F747D26ECF454C7E9746B7FD4 1339312 T
914,141,888 *5F2C37DF1CD94F3837B633D816C1D7F68E1F6C26 151-ENVISAGED
914,141,889 *5F277DFC05AD9FC8B2B3B62B61AAE58A8B15CD86 1524113 LIEKSAN.MATKAILU.OY.V
914,141,890 *5F258C045643F45A190DB457C9986CD008D601FE 1615016 KESKUSTELU.LOPPUI.LYHYEEN.JA.PETTYNEEN
914,141,891 *5F2904451FC7E9312D5CB23977648D584EB1C8E5 1789089 DASCAF
914,141,892 *5F260A78C89D76DAF1903EAC3E3CA41FE0C51A56 17imalatini
914,141,893 *5F251BC98188AF017BBCA3CA7B93C0394C6C6857 17 wellthumbed
914,141,894 *5F2BD22B44CD9DE5A68A11719B2B1185E26FB2FD 180914 badawi-tuo-esiin-my
914,141,895 *5F2D5777364932ACBE83069C1A12A9F12297BA1F 9HOSTAGINGV
914,141,896 *5F2F3E6605707E3CA45EB1355AA4EB5DFFD5D310 1995773 "UNDMIRLIEGTVIELAMERSCHEINUNGSBILDDIESERSTADT.
914,141,897 *5F20FB9C9F775A871381114677158457FAF23761 1997jmemetics
914,141,898 *5F28C79B10779FBBCFF9658AF8C5DF0A98BB2036 9.LOHDUTTAKAA
914,141,899 *5F270F0A1878BB42D9F5CAECB8A5D805A0227C5B 1.arbeiter-und-bauern-mall
914,141,900 *5F2BBE21D6A0958C58C71A9F41FBA8BE0016C688 1 AUSLAUFER
914,141,901 *5F255346E53D9C5BC99D972DA3DE627652865E74 1-bilgilendirme
914,141,902 *5F2E49A678ACC2C4B40EA569A13088C85DD84068 1-DADALOGLU'NA
914,141,903 *5F2E2DC40B67D706CA3E785FEFBD35B88774F3E3 1demens
914,141,904 *5F239AA326FB81A0AEA6ABFA2F5362BA2DC36316 1.gebaeudeversicherungsanstalten
914,141,905 *5F28354EB31D598B98C909F641C271DBFDAD288E [email protected]
914,141,906 *5F201A4B05A1C4C38D1756FE8DBF3878683868A7 a0%r3
914,141,907 *5F2BEC60B15A8EA27684995C56604E9AC1716F00 A121067
914,141,908 *5F20B5714E02A3BFFCA8572F0FD1D441831ACEB3 1-KILPAHAKIJOIDENSA
914,141,909 *5F20BBBB12817443C7C552C951C8499D28822E2C 1-kirjailijahakemistoja
914,141,910 *5F2E0A2A71D5559553FAA4CB4B24892B5768D2DE 1.KOTIILTOJA
914,141,911 *5F288F147B68DBAA99D41F366A2C17A122F79D1C A3AP
914,141,912 *5F2B72014F815056ED6735250D656A1B1901F20E 1MARKUSSEN12
914,141,913 *5F232F579B67ACBCDCC7F25F3F806FE91EF4CD12 A5EOU
914,141,914 *5F2524732551C07B4E94358A4DCA0053D6CFB41F a6etl
914,141,915 *5F29B86FF4FAC038B0D1D5F11BDB6D7A4AA1CAE0 1NONCOMICALITY
914,141,916 *5F217EE123614CAEEDB68608435AAF5C3FE9E181 a+a
914,141,917 *5F2579AE75145B9AEFEFA1263C58E23DBF78E725 1.SANGESKRAEFTIGE
914,141,918 *5F2394E5AB0B160150DC19F62B39D19DE4DBB806 AAAJ`M
914,141,919 *5F28A95B53C64D1B66040B3C588748980230A7AA AAA%~N
914,141,920 *5F2AF77FF533A96A775BB48C262530AA07E91066 1swannack12
914,141,921 *5F2F2E65681C30C1F034D5D02527C26FCE3A4401 aacj
914,141,922 *5F2DD90246737C5ED96DE0CC34084E5C5CAAC1E4 [email protected]
914,141,923 *5F2F833FFA5B156B2CC1AC2E61E0B512D3CFC1E5 AAEN9A
914,141,924 *5F279289388A429541588CF7AC22C3BB27B142EE aaoed
914,141,925 *5F24848EB34A0DA5FD098B0AE77795E736E5F71A 226509 LOPUKSI HEITETTIIN YHTEISLENKKI JA SAUNOTTIIN .
914,141,926 *5F2126D6826D46CE58B35BBC14A11656022D078F aa:u(
914,141,927 *5F23C4B78E195EA90E225CEA323279C7EE2282CB ABCDGALAXY5
914,141,928 *5F258A61780F7F9893C522B6EBB478F61A2ADF47 AB.CR
914,141,929 *5F23C2133FDF4C6A78E2633C2267AD79E36A8263 ABRUMARME7
914,141,930 *5F2FE3A1E469504F67C025DCD08CA7E9D613A4D7 2-aldanmamak
914,141,931 *5F2493B9DF2B7DAC3B2E83FE7310562A7022831C AC3HJ
914,141,932 *5F21897BB2CDCC74581CA7E930896CC742F3A8F5 2iamtokyo1
914,141,933 *5F2616F79732AC1B9959A6E5AA49A599F3163C94 ADINACODREA123
914,141,934 *5F228A746938F14F7484063C049E6632C643FC73 adolfoseppa
914,141,935 *5F28E8E0895C39B61976D0D29D32F1D70ED5C41C 2VARKBOER
914,141,936 *5F2BC69B4331E79E7986BAC60B1E8F649A984CEF [email protected]
914,141,937 *5F22765BA2BAA69F8A186A0B01255D9CA5F3B5A0 2zeitzeugeninterviews
914,141,938 *5F2DE3B5BC8D9A45E390D9652B89D9C081EEFA1E aegp
914,141,939 *5F2F3B33C67D2CF3944978FE2813C3AF7C46D22B 340105 SAATLADATTUAOHJELMANILMAISEKSIT
914,141,940 *5F2D804CA3605767D879EE53359CA4E6AE5AABCB AFFEARERING
914,141,941 *5F2C1FDDDAC49C8144AE2814F939CD9287FCEDC8 [email protected]@1N355
914,141,942 *5F2FF7267DD33F8D4559629E0849165A7F063B98 africna9
914,141,943 *5F2ECD6F866A694BC0E10928E9400129BE91EA55 afstg
914,141,944 *5F28A3F937235BB3F9DFD2C6DE66BE8493F142BA ag6b4
914,141,945 *5F2E49D7158986C6D832831EDAF4DEE001674AAC ahkof
914,141,946 *5F2B4D764D387D5FB158237BDFA89D4156F479AD 3==>~ ~(X)
914,141,947 *5F298063BE704F74EFD0EA82DA3D2B9A861CA484 3YINZHOU
914,141,948 *5F2F9262BB574BC4B1BB590C749A7A2A84DA7A92 airliaeh1rliy0ah0
914,141,949 *5F2A4C5CDAE06F612229C50F0BCE9C9452A7E19F AKG#I
914,141,950 *5F236375F8270E209EFD60FD0FF029293D3E50A5 4iluvsponge
914,141,951 *5F29AD1352EC6470F522FBB5162B8D80352D52BD Alf
914,141,952 *5F26482D3A40BB006EC3920F5F3C44F62A8500C2 4ROLOCNAW
914,141,953 *5F246FF28C9C899C902DABB35589CF3A8ABC3C3A 4SKRIVBLOCKETS
914,141,954 *5F295E9F1BF95DE046E872D05E12E03FE504930B 4STILLINESS
914,141,955 *5F2492BE183D42C7899024AFF5973A7C570A38CC ALMCGLEW
914,141,956 *5F2FF7750518C7158D1839BFA3ACD6D77FF4415F ALPHONSO.DINICOLA
914,141,957 *5F23ECA706E1FE08CAE208E8143CA3C3BFBC21A0 50P0RF
914,141,958 *5F2E965F9189A94DAAA586F025406AED9A591CBC 54OCTAVIO
914,141,959 *5F24BD621FFB36A92BEE56F7E513FF33314D67DE ALVIN.KRISKOVICH
914,141,960 *5F2474EDAE26C1337F901DB5823932799371E7A3 577JAXSON
914,141,961 *5F28DD86C97058A417F242AC18C1D4535184C298 AMADO.PADULA
914,141,962 *5F25FFF3820024F66374C3987D3A139DD65BB898 AMATEURLIGADRITTER
914,141,963 *5F2F61266EE08522A0865EF2FD8458A9AA445CC3 america71904
914,141,964 *5F2D7F0D7B529841471913E3828ECBBBF1D2FE73 5CHAVKIN06
914,141,965 *5F2B1388C8F72ECA920FBBB77102693AC5B73439 [email protected]
914,141,966 *5F2F74C53AEB719FD6F4F8C271498ED046D9BEE0 5CNOCAIN
914,141,967 *5F2F6DC16D47A129D651EA0791439233A3D3F735 5ENONIMUBLA
914,141,968 *5F2F0ECD52874E9A9715C46807FE7ABBAB23956A amyrachel8
914,141,969 *5F2EB5810CBDE10088B6E96ACCAD2083CAC7FD73 5hwfs5gwlmvb4gbnokzyaq
914,141,970 *5F2A151DA62C74382AEAFE18472DD61028F5D8EC ANDRECICERO
914,141,971 *5F20FF6B47506A84D3E0F21607D0DEC488E2E7D6 5LAGODNIH
914,141,972 *5F26B41E4D14416CDC1F1C034F6514707D8BD495 and the horse
914,141,973 *5F26022DD864EFEC173A783AE32B44637C1F60E3 ANGELFLATH
914,141,974 *5F28FBDCE05A6D73A4898B0553A1732D5E016D9A ANGELI HUMIWAT
914,141,975 *5F2BEB8E8362560458D6192F70444BF555EFC331 5ODJEZDILI
914,141,976 *5F2D01B6F6B010A6CC3C92F78F5C1F422C09C65C 5RUFUSSHADOW
914,141,977 *5F28E98FA0808B79526A4D8C67BD571090C7B7AB ANTONIOUMPHENOUR
914,141,978 *5F284B48C7AFAE9EDB1F5AA3505B2801D7C3BC10 [email protected]
914,141,979 *5F2AB62E60A461D6B28F6F82E868369A2959B959 AO4+N
914,141,980 *5F26050E6CF3B07542BEBDF26702C1EA144AEB55 apositivo7
914,141,981 *5F2D3624A0EDBC8330419E54054E60C72123E2DD 6CONRADELSIE
914,141,982 *5F20F0D6450C1BFF02D633CA9D1716053281A464 6consultaient
914,141,983 *5F2C0606F200AAA9D711B5ED1563D8C6D2A0E6AC arbais
914,141,984 *5F23878C2D7DA8A2D705BB480F76880CD7041F72 6LISIMPI
914,141,985 *5F279DD9CF0AFF9F7F30E921E88571063690B4F1 ARLIEPATELLA
914,141,986 *5F2A7F692275A8B02824F9F77B61450652A4CDCF 6NIMREVNI
914,141,987 *5F28EC20940D3832EDB86CC6190DDCA6D59F7CB5 arnd
914,141,988 *5F2594BD094B3A5103F6CE740AD8CDF081E2E355 ARNOLDJUART
914,141,989 *5F25370643DD6FB1F4EA8687C7187C10E7698D3A 6PAULACAPTAIN
914,141,990 *5F28909543A9B0B8697FDD26DABAFDEB30B63050 AROMATICS
914,141,991 *5F2BD519B64C7CA9DC996E5CC9097B7C972B60FA 6REBRYDE
914,141,992 *5F25F43385586F7A6D5FFEFC992303BC5FC46795 ARRISHED
914,141,993 *5F2EB3286A08930E587AA43654DD523F77540DBC [email protected]
914,141,994 *5F2B62AD3CFE9977CF77865DCAFBE946C9683208 ARTNEVOC1
914,141,995 *5F27DC928C742727A5BBD51A37C30CB820EE9A3E ASAGREEK
914,141,996 *5F2F263ED487DBA66D1635BF9B3B0385930626A0 6warriors2
914,141,997 *5F27F9F3508E1E11D955DD538374215D96DD31C4 ASSHEKNOWS
914,141,998 *5F2FE783B42FB6B0DA514CBD5F6BFEE6B4190CB6 7EGAHPOMO
914,141,999 *5F2D39DF0E54D98CECA9D20262B879E2B3B4A9EF 7ESABATADREGURB
914,142,000 *5F240A829822688B284F55F6FB3BE6881AFAAE6F au8g-
914,142,001 *5F286EB4B475573D6F737E78FEA4B3B412DCD7EF 7GRISLYYLSIRG
914,142,002 *5F2F38077D372E7F8655B4C8454A1BF66BBE2ECA AUGUSTEHRMAN
914,142,003 *5F2B535914628B3C01E155B3BCE2ADF91E9B0B1B AUJGD
914,142,004 *5F2BB8E243601914A2512BB187D63EE8E07E5060 AUSTIN.KACZMARSKI
914,142,005 *5F2B87EBA30C9468AB814FEB96BF57E6F02F2161 au voleur! 4
914,142,006 *5F2A625ED070778D9D953911294A0BFA30E246EA 7PERTROUBLANCE
914,142,007 *5F2380E7FCE4E65C41B6799D915D50D2956C2A6D 7REKLAMOWO
914,142,008 *5F2FFFAF2B7082F0CF5ADFAB7FF7F7CC4366F77B AWIA5
914,142,009 *5F22DEB19E1D3406961FE7705747CD601A2ED349 7TRUCKSRUX
914,142,010 *5F20C46E02819D8AB33A3671F40DDDCEC5FF710D axmyu
914,142,011 *5F2A4648D7D67AAD728AC916564774381E1ABDA6 AYLMERNEW
914,142,012 *5F2A13C33F0BE527E88D9B5CB787BD764B11C8CA aziaimuk6
914,142,013 *5F2D2E6010C16AD1378AD73B001C9B79D823BA8C A以及「
914,142,014 *5F296D1AED19A0696E00AD5EBF8043BD2640E4B1 8BSWAHGORABSW
914,142,015 *5F290F2ED8F183D316C17B819374895952BC1CB6 8BSWMBOEKHOLDBSW
914,142,016 *5F26B147BFEDB9A634D30ECE7FA013B8EB098773 B1_VE
914,142,017 *5F24564AC7BA9D06BB1AFE7BCD37BF52769660E3 8DECEMBER1113
914,142,018 *5F26F6B31A7D739DCC048CD95D060B25D21CB3B9 b>7<
914,142,019 *5F2FC058CE0608D368B8145CB71B41F70332DE48 8iamredfish6
914,142,020 *5F211F659A9D2C4009A626893E4E51BF1598A757 b7_j
914,142,021 *5F224CE29DD3CC39A6EEA6EBD1F145722ED65C63 8O(AAA
914,142,022 *5F2A421493EDD4ADD39536F02299BF7BB1860C5F 8p**(>_<)
914,142,023 *5F20CEE92E326770157DF8A0C9D33DEF58B53CD1 BANANOS52
914,142,024 *5F25FE968D1BABAAFAD5D08D5CB6084B5EA1DA76 8SNOLCYCE
914,142,025 *5F2D6894D734554284AB627BCF30669EC96B3007 BARDROFF2
914,142,026 *5F242130E2DEA66494718350395E890FC9267809 8UPBEAT
914,142,027 *5F29EFEBE590B27DA133AF61D160CAD6EB2B6BDA 8VERVLOEKTER
914,142,028 *5F226EA881FDBD292E82D90B101DCBDA8034564B 8ZONDAGSVIERING
914,142,029 *5F29926C2105FC0A08617EA07079AD118CDD97FF b-b-~o{x}
914,142,030 *5F2D89FF95AE8661F358809E320E53B01282BB91 b------b~ ~)x(
914,142,031 *5F2651CEC8DC255C49CD2745FC130F17B4C6055B (bc
914,142,032 *5F2CE5BED79EF573F58C4BFD276039000AEAAEDE bci,
914,142,033 *5F24FA4358B740E8CC82E08FB4A1773D61ACC68F becka15
914,142,034 *5F27EB41932026E8DBDD122142F362E4B7A38E6A beranová
914,142,035 *5F279C862F0E0866760FC2D1746467A4F33F2FB6 BERNIE.GLASCOE
914,142,036 *5F29CA760883F3B7339E79F04396A8840C4D9E12 9TRAHITS
914,142,037 *5F21C1B3C2903650BB5AC137500FD2668F73818F BEVERLY.ALLPHIN
914,142,038 *5F29F715CBA1293636D2CC27A44B6128BA6C2231 beyd
914,142,039 *5F2B7C0C66902760929F586A232AB9983724BADD BF5RP
914,142,040 *5F299250E65FD5D3818F8074BE27D237746AD5A2 a(2
914,142,041 *5F2D8ADE83BCEAF8D00B73EAEACF0D17B6944A83 [email protected]$
914,142,042 *5F20D79891FC5FBD38BF5BD6E2396D391E6EB077 BILL.TRONNES
914,142,043 *5F2A16F14487DC3A257CD1F0491F99E4EA08598F a8!rr
914,142,044 *5F2620129E573131D2B496BD6BC70298DA8DAA73 BIMO1212
914,142,045 *5F2A63228445B120C3759C3F02541DCF60A8AE30 BIN)N
914,142,046 *5F208AB043081E6A0732400B20CDAD6D6DB5F8DF A9K6V
914,142,047 *5F2FAD77229685329CCE6BED3DC72DA21AA0B927 AAAGCCTAAAATGTACATAATAAATAATTCTAAAATATTAGAAACTTTCCCTTTGAGAAT
914,142,048 *5F2A30AF5BE1429812B5B9E0D846148A44DE922C AAATV=
914,142,049 *5F212BA3F587CB18217AEA7322B65F1F3078C8EB aaepf0
914,142,050 *5F2B8A83D6763FB7F2BBB86654DD9FC3F17D3A9A BMAJ9
914,142,051 *5F2644A2E0B9FFE01F9560CFBEE2BF99DA0CFDB3 BNFTN
914,142,052 *5F2E671667B8C3361DA48984215C39BECAE92F47 ABEPITKA
914,142,053 *5F2707D29D33549F8A3AA562C611B40E1BBC7D89 [email protected]
914,142,054 *5F29490A88FD41E2EA5EBCE101655051D5D6A1B9 bop#u
914,142,055 *5F2FD50F38F0795924B9CB11EA2AC614071217B3 ABV
914,142,056 *5F22F2FAEAE69C250A4D6F9DFC4EAA8ADE5D354E ACHMAD SAIFUDIN
914,142,057 *5F2220E95CE181C22AB85FCC4131E0B41A5F96C9 BPHUH
914,142,058 *5F2A4156B2AD8D27EF9727065B879CC9C1AC6956 acp,=
914,142,059 *5F2F0CB4F2F1A89891F5DF39A031CA852B69E0E5 ádenes
914,142,060 *5F2BB367B0706BACBDA4EBCBB5E45DA1D040F80A BRENDON.CLEARWATER
914,142,061 *5F25EE5D56EA5CE7522598FAB9912460D987C4FF BRETTR4763
914,142,062 *5F2C083BF8A4D72002DDD940F38FE498D3FA1BCD BRICECARNEVALE
914,142,063 *5F25602FB7AF6EB297212A2EC0EECF0378EC9974 [email protected]
914,142,064 *5F2C7C96F5402ACBA10A523EFAD303BEEF112690 AERISQUE1
914,142,065 *5F2AF2C49DA0B035C2E846A6932B22AD3CE52F01 affioried
914,142,066 *5F2CD1CDA70DC1EC8249060CF40E4F68E20874D9 af,m=
914,142,067 *5F29ADC7F4E3F593EBF48004E0376FD8DB224ECE BS,%
914,142,068 *5F2C241DEC23B3B3F3A1E34E09518C79284FA542 AGAIN WILL THE FIRE BURN
914,142,069 *5F2CD85D33E06D4B12689DA9DBA49041B7FB841D bsve9
914,142,070 *5F269BCD37BEB8DE74F1B2110C3714B5D80984CE AHMEDMACDOUGAL
914,142,071 *5F2B38FACF6D48E3216EE53CA67E4E4B39EF1C43 AHu,
914,142,072 *5F2964C37DABC4B862018A4D152CA196616C36CB AIDSOFSPACE
914,142,073 *5F28E188A973E18C735BC401BBDB3D61FF035820 burtnauman
914,142,074 *5F2080521AA7E1ECC2A69F964169D52CBA8F2FFB BURTON.TUIA
914,142,075 *5F2059A69A6B9C5C60FF3E260A9E23E94615C038 a;:jd
914,142,076 *5F2E81511CC6A4EDE1BE4B8541558755A7B3B754 b&xe
914,142,077 *5F268479FB7274E6C8B45A254981D362790D904E BYDOU
914,142,078 *5F2DA4EDDAF62D6DBD2BF8BFF87F029E3EE9D788 ALETELBO
914,142,079 *5F2941CB0D90068491B36CE3CCB0C338DAEEFDDC Alf
914,142,080 *5F2CA57DF7AC60EA441CC4CB4FD3C349E2AA369C c0mm3nd4813
914,142,081 *5F215BB82961F4743361D3E556D6ACB2CCB12BCF ALONSOWHITBECK
914,142,082 *5F2CDBCB101A54A0634508595DBAAAB8C255D2E5 A L'ORIGINE
914,142,083 *5F276E6838859D0548681728678DF93DFAC9560C C4"%P
914,142,084 *5F2B7CD878EA0374E73E70E1556FB1684435E02D al&t)
914,142,085 *5F2EE4ADC8A9F40ACCD8A270AF0E6875B9E3B50A AMADO.URFER
914,142,086 *5F2EA85E0CB5F27BEFF400505493438AC6EFD3EA AMBERLAST
914,142,087 *5F29FE5F222614FD353B0F7DDF16908A15BF21A8 a-musical-joke,-k.-522
914,142,088 *5F2D744F309DBF33D2D948B51A6846ED55AECD25 CAGE-BASED
914,142,089 *5F2F0F2262E180F501202514BB022153F786F0D1 an=9q
914,142,090 *5F2D8BC51F6F1B1366F86486611868BF68B04960 ANDREHEGYI
914,142,091 *5F2F49CE96135071B3430A828C9FDA02D09F2735 ANDREW.SEIF
914,142,092 *5F29A8038A8FF8C6E28803D5DE59890B12FEA2B3 CANELGUED
914,142,093 *5F22B20AD5AF092F63CA10CF40DDDF981226E7E9 CANNLENE0
914,142,094 *5F27AA3BC5E514A15AEB4BBF87A5AD24C81BE3DB [email protected]
914,142,095 *5F2B9D95F02E1328D761D6638CDFFD31AD90AC87 cântpreţi
914,142,096 *5F27E3C1F42CEED68BAFDF54ACE96254B4095987 CAR3855
914,142,097 *5F2075FEA4487D19A461976A7D1B6326067E6E26 CARLOGROTE
914,142,098 *5F21229692F2C7C3DD5D861266C21A29B20BFE97 [email protected]
914,142,099 *5F28D81AA49B3DB37962E83B9389AADF55745BAE carrollmarriot
914,142,100 *5F2B1E6D145C5C25463CC1F5C9D941868A1B971C carssdd
914,142,101 *5F26E77B2F93C43466E77EC5F3A410592182787F CATHRYN.CURTIS
914,142,102 *5F2B4E11227682BF920809786CD7CDED4DF2DBCB AO=9M
914,142,103 *5F27F3F8136F46D37645CE8636BD886347998F95 [email protected]
914,142,104 *5F21C61AC343268519AAAE2A8526783A22543081 ccsg
914,142,105 *5F26663515906A1AA511631C0D12097D1A74A189 ARAPSKOJ7
914,142,106 *5F2C46A2D4F5FAD12D9F8148D25CEEB7C61D4BA9 centile9
914,142,107 *5F24F14E5C4C250BCC90FC3D855174D3D8F36C72 arondels4
914,142,108 *5F2B25376F33BB21E29E93565195A83A327AA72C ARRIVAL-OF-THE-ANTICHRIST
914,142,109 *5F215561A7BEC719881B3E77801F4DFC8AA2AB20 A;S#D
914,142,110 *5F2D2F51E65E85DB3AAB193BA18599F46BEB5B25 changviall
914,142,111 *5F2594385C86E9843D61614700D78F9139678293 A?S?K
914,142,112 *5F2E28761CAAA6A8B1D3E427C0FE30BAC10FD63B a%/t
914,142,113 *5F2C1DA2D6670418086CADA3FA210CDA5340BCA1 [email protected]
914,142,114 *5F2C23A0CE804D886E93F8EE9255380D4D9FE4E7 [email protected]
914,142,115 *5F2097406EF7DCAC709A942FEC6E39F37F0B3072 „chenti
914,142,116 *5F292A4DA2CA2E67ECFF357166F25007B3AFB20E CHINESE CHILDREN SCHERZO
914,142,117 *5F24FDAC8EB333D664E93A66D2DCCBBD056E6055 [email protected]
914,142,118 *5F2F4E47E337BF3B3C513CF2792487E842561BF8 choujiakamichi
914,142,119 *5F2735E61DD0EDAFF4F76520FD8707CC0F797843 CHRISTOPER.HOMOLA
914,142,120 *5F226374D46633663377AE5C8F571FD8239EDF3B christopherwar
914,142,121 *5F2025E9C09A6470EEB5CD6CEB3CB7798CDC031B chuckbabicke
914,142,122 *5F225EDAF57581AC096016508F0D1271AEDB6C26 chulbeoms
914,142,123 *5F2163164840081F7DBCA6E4A88C8EBC25242BC0 ci,32
914,142,124 *5F20A88312C04A49EDED86FBD45821779DDF5572 AUX:R
914,142,125 *5F2578EC308413BF0177C6C1D0293A39A6945244 cj3-h
914,142,126 *5F2E045F4AE366BECFD82F32F1A4D14138678C32 A:X2G
914,142,127 *5F23CD69FE03857F67CF51A2732D08D7CE7820A1 a?y_u
914,142,128 *5F2512C52B9AA1E5DCCB965489C824BD5863DCD3 c=lc
914,142,129 *5F22BB540CDE8EA8810720F433D61F1A6A8012ED CLIFFORDMCCANNA
914,142,130 *5F201CA758E83898EE975308E869C95FC346456D CLIFFWIDNEY
914,142,131 *5F2D949087E115FE59706A9AAD5AF8AB86607DE4 b0s?g
914,142,132 *5F292DC5B50947CF7BAD8648CD5001E69F2D4CCD cllrwmn1
914,142,133 *5F285516BF92DA0968E7C527BBD8F2D129E58E31 cnck_
914,142,134 *5F29B176B40B9786C65EC1164BE0DA462A453F8F [email protected]
914,142,135 *5F23504C94738D674AAC77A2693607833CB15E99 b5yme
914,142,136 *5F28B260855FFFA6A3F8925FCE273F9E395CD72D b!9am!$7
914,142,137 *5F2CA30169111C44F066EEAFAB217F7D5769495E CONCERTO FOR 3 VIOLINS IN D MAJOR, BWV 1064: III. ALLEGRO (2)
914,142,138 *5F203B156D3C09DF596150989A4F187CD98BB54A CONCERTO-IN-B-DUR,-OP-9,-NO-11:-II-ADAGIO-(NON-TROPPO)
914,142,139 *5F25BDFF60388D5F7E8C77AC13D3239FD5BE851C concertono.5indminor:ii.affettuoso
914,142,140 *5F2EE0F1F2F6ECB3DC84FF9FAB17FAA88BF9F1A4 conniebuchannan
914,142,141 *5F23B862F337B707329C7EB056DD64C39AA4C56F BARTON.GIRVAN
914,142,142 *5F2330CE5EA27B199535EDDC3F73C27E4B1241FB CORALLAIA4
914,142,143 *5F2F960D620B1E962D185F1E5CB29DE815A40421 BAYANO9
914,142,144 *5F2ED06D31317C1CCB3AE62E6C63D8280A2DDFDB COURAGERAIS
914,142,145 *5F227C2289E995C2C168590F137BDBD34E3F9F21 CRISTOBALSHOAFF
914,142,146 *5F2AD3EF94405B802F1BA369D80992F8182BF680 bem=i
914,142,147 *5F265675A638FE5A6339CBB59086158BC77749BE cror$
914,142,148 *5F2DAEADC7329D68B9A1F3294C212F797F93191B csfgj
914,142,149 *5F2AB8431C426CE74342DF6A09F12B9F05A21714 BeyonDLusion
914,142,150 *5F2B060ABA67E1DF8D97EFC1A181A4A2E50B17A3 ctv+2
914,142,151 *5F23C9F78EC2BDA7CF5B14849BE73AA51F1F7123 cvaox
914,142,152 *5F2264743D4AEB0969C30512CE524D4200823F44 cvf,2
914,142,153 *5F22416ACF2E631848C756B32C05F189788A8892 cvl1s
914,142,154 *5F2C04EA1201014A812D0BCE1E7BD9A6EA00F565 cwqz5
914,142,155 *5F2061D62B696EA3960F8ECB5361019307453887 BILLY HOEY
914,142,156 *5F2E31F6CF93F177CC1CF9DD18F3B55B76F1FC3F BITNV
914,142,157 *5F24B5A418F8A85BEC079FDB1F044E5BAE8891D2 [email protected]
914,142,158 *5F215F4F8D716E2F4359BCB2F62B226FB783D603 CZJSO
914,142,159 *5F2EE45F74331CE95D13D8A753282CECF8E07077 D0ANJ
914,142,160 *5F2F17360FF1C149CA765C18FE6424AC36ACB44F b%$ky
914,142,161 *5F2D21A295D656A78D6770BC795B1A9C0220D96E BLADE
914,142,162 *5F2D26792143E1569874DD83F64676FB57D3504A blejale5
914,142,163 *5F27711BDEC9049A819C179E5ABFC37D3DD151A8 BMN0T
914,142,164 *5F229C0F22821273BF79669F6662A5B3B4D6849D DABEISTEHENDE
914,142,165 *5F2B84CBA61CC175167CEFF7F4B24490BEB2DCAC BOO$
914,142,166 *5F21AFD042A38146EE056CC7C32F4C122E59B1F0 DALEQUINONES
914,142,167 *5F2DFD5C03839CBE25BB881C17AD0C71A0F4DE5A DALESOCHOCKI
914,142,168 *5F22C2C88BB7740A9E8AFC5DBE6041A65BF03821 BOSCAY
914,142,169 *5F2376B99D0CA75A972EB9560E80051BB5C41E58 DAMONKOLDING
914,142,170 *5F240B6ED25C157B1C248FB443495E9C25DD32B9 DANNIE.CRONAUER
914,142,171 *5F2A62B384B9C8E13E7BFF98852A8C0753AD41B4 DANNIE.LAUSCHUS
914,142,172 *5F20E83D6AD697244C02D1DB2809BA88AB40818A dannydigiacomo
914,142,173 *5F207FEEDFAD0B759CD13C2AF83BE0A38D890197 DARENMICHAELSON
914,142,174 *5F21AD85D36481C74882268923D98F5CB0358A42 bqf
914,142,175 *5F278AF7A9BF95FE5D83923DF2381FD4045A36EF br"q
914,142,176 *5F2A5E354E999F5731ADCB929DAE6A18D3608E01 DEANJADLOWIEC
914,142,177 *5F2D5E182C8646875983FC9ED982EEC511D27635 bs#h_
914,142,178 *5F20BB091B5DFAB081547906D40AA054FDBFC2B6 Defendre
914,142,179 *5F28C179ACF08E35DDFC9AF846D9F844A39929E0 B#t
914,142,180 *5F2F4AAC3E17EFC0D2F04EA62C4CEF710B08FCE2 BUKE0
914,142,181 *5F25FB26083F3DE6D7446EF1CF0A3F506354A8C4 DEVONCARABELLO
914,142,182 *5F225E58161A597E2C58FA3130517E20D25CF8C5 bv:6
914,142,183 *5F25820FF03F6C5A55B298363A3891E67219094C B-WCZ
914,142,184 *5F28FE06B0886980A79F5D5441631A0198A34AEC dg9ur
914,142,185 *5F2A516282D8372E9A14D1074F4CF39398AD5D82 bwxba
914,142,186 *5F25FC17FED614278DDFC6342A15C276EA67A22F BYNK.
914,142,187 *5F2BEBD43E52C1C78BFEA77E77F2E8A01895A283 [email protected]
914,142,188 *5F242654D1A83469FE5BAA9FDCB820556D6BA472 c17;1
914,142,189 *5F22485E292539CAF01CD3C7611170BFBE3B1B31 c1.kc
914,142,190 *5F2E2F2817465EC59684CFBEA9FF3DF419A49CC3 c2a0
914,142,191 *5F2182DA49894754D4F78E178CC29D4F415FD473 c2iqr
914,142,192 *5F255BE83FD959E2F5FD877CBE9CA0FA82E6F9FD C4IB4IS
914,142,193 *5F23579A065EFE4FD0F63D9A71FFC4F177533B84 D&I)T
914,142,194 *5F29B476B5A99D07A0FB4B30047CDC7554D6DB34 dlh-q
914,142,195 *5F2ECCEFAB06C0A446A9C12AA397E1A8B9965AE3 D:OE
914,142,196 *5F2F8A604A38337809468B21F3FBBDD51C827E58 domenica.sera
914,142,197 *5F256314E5AAE69B524CE449DCBCA4986FC5AFBA DOMICASTA
914,142,198 *5F21A8095F160A3F0A6D51B37D93AE2966D5720E domingostankovich
914,142,199 *5F2527453845B2D8D3C760D5B5EFF36C7FC42C1E domingozupancic
914,142,200 *5F2014C53D9CEC955859637A59F30F3524E0873A CATHERINE BARRANCE
914,142,201 *5F2E8E9420FDB3C67BB909D3D5EE9B8FD497B6D1 donna-amante-m
914,142,202 *5F277A31091F9AC6BE1ED261B77DA07365AFCE4C c;$ba
914,142,203 *5F20E3A9B8A6F1A3D04C0F65767B6D0FEA697C84 donnypoissant
914,142,204 *5F2A050235D05B5EAC5B336361D5D8D44CF7C138 DONNY.SCHMITZER
914,142,205 *5F2F0DDAC4B3F6E66356885E45A78494E9A192DD DONTEMOSTELLER
914,142,206 *5F2182648B978BED83EEB9E56BDA962E71F8E61D CCGGCCGCCA
914,142,207 *5F2FA746587866B6BE1A557920A4A9C91202DF9F dougbisom
914,142,208 *5F2EF1DD0EA77A8398938BD79745A6BC839E79B8 ccsg
914,142,209 *5F2C53502EB2DC78290D39713A9E5E048A0DC75F [email protected]
914,142,210 *5F26CC23345A80709D2F28F821BC5A47F7B07095 CE8W
914,142,211 *5F2CC036F822339AA70B20615AB6B385152CBE70 DQNV-
914,142,212 *5F24BE5A6E374E7733DEADDB0E3B5D1563365B9F C)F/1
914,142,213 *5F23D9673A2BF9784CA4C7DE5884C1BD12F4A445 [email protected]$ter$
914,142,214 *5F29BFAAD2CE7C32149CFB6CC25132D3660C824E DSDPA
914,142,215 *5F2774D5B00AEFD7B7275A9604FE1D87AEA3F25E DSOML
914,142,216 *5F27A9ED878062878599F861E156BC12558EE31F CHADMCPHATTER
914,142,217 *5F2012F75A8A16EEC698FC2AA42E831A7CE66CFB CHANCE.GATSON
914,142,218 *5F2ED7B73DAE32E7C236052134D078D7BCE5133F chaostony9
914,142,219 *5F2740E8BB9B5604F45BE81728CF69055E6A07EF DTMZ
914,142,220 *5F27143287A0DC618C83A8A68F82BDC151E6522A DUCHENNAD
914,142,221 *5F2BD5914CD21B79C0DAD8BAAD371A8BC14EE1BF DUDLEY.COMLY
914,142,222 *5F24C5CFE1F29294E90AA9A611C95EA29541D3D0 cheese-'pizza'
914,142,223 *5F2D71599E1343E2FB4ED93B3C17F0A2468D5E99 dukommstzusp
914,142,224 *5F2C6A9EE65B4590B5E85EAAE3A448E6402C789F DUMNONIASES
914,142,225 *5F2ADE45690582D2A448EE2E3DA1F2EFB441EB44 D!UOB
914,142,226 *5F26F271D6C247716CBD61963448E7CEFB491522 D?WK4
914,142,227 *5F22F15D7618FAAC30A5E337CAED1C3E020A8B22 dy2;o
914,142,228 *5F2293178617524ECFD619A6D0BC22CC1224C69B CIGJ2
914,142,229 *5F2007F1A65570846CFEE99B908B762BAF74C57C DŻAMIATE
914,142,230 *5F2125B3B309BB99E6FA40ABA3FEFAB95E431640 dzm7k
914,142,231 *5F27E849B42BCB1708C43A4D50233F792BE2EECC E{
914,142,232 *5F2FBC4078E6398C7DC754F57AAA56896B2F1FC8 c((l!
914,142,233 *5F26B5B864586FC1D9464610EE0128EEB2913DFF EB?TA
914,142,234 *5F277E2ECB2DA78A6DE78660E9F73098BBA5F276 ed!f!c4t!0n
914,142,235 *5F2662A00AF6FD5ED0357F14A2F9AB2DDC77223E edi niederlander
914,142,236 *5F2B64011468967D889D007B97866FE4ED95C543 edmasenten
914,142,237 *5F205595581655A480C578FEDBA31EEEB559C016 EDMUNDOMECCA
914,142,238 *5F2A57A67989DDEC7F9F262C0FE490EC43AE5FA1 ClOV
914,142,239 *5F2275D8BE515E5A53C9FA87D92BA3828231FAF0 clxlt
914,142,240 *5F2FE058B22237AD11FD6687AC34631CC6DDA20C CNMJ
914,142,241 *5F25CD934E73A769530E3FDA694BE6A2ABC2AA27 ehfvl
914,142,242 *5F20E38AE06D5CA04A8667899752EABFFB23965E coaza
914,142,243 *5F20487D8CAFBC728A98FCB481646BCC659B0106 compression4
914,142,244 *5F2C3766D9592FD204A7846EBB628E249A73020F ELISHAGAGG
914,142,245 *5F22DDD0474007B6323406EE1B6292857FC10459 continuumobscenity
914,142,246 *5F2DE777542571D4BFBA645583CFE6E917772D12 COVARIANCE6
914,142,247 *5F201F335F2A3E732681E8B965E3F8578BC9B447 EMILDELGIUDICE
914,142,248 *5F206D788F412F9509626D09DAD4BD6F6B62CFD8 EMMA.JEANES
914,142,249 *5F265CD92553BCBF549263EBBEEA7BCCFA8FFE40 EMMANUELREINMILLER
914,142,250 *5F2060215FC1501A49BE7DABF79A80399EB12C1B CP$WA
914,142,251 *5F2D6D63A7F62F40198CAA6C2DAC99AF06622D24 encorajaramos
914,142,252 *5F2C5DEAD762E2782456953EAF7BD8DF4978BB44 [email protected]
914,142,253 *5F2D9A56CCA66840141A4094C4B9BB193C0363A2 ENEVIEVE
914,142,254 *5F256875E0E68CAD6D89ADD3ECC51F3CD94DF5DD c&rcz
914,142,255 *5F29CB0818F6768DB9F4EF65E2B96DEDAB1D47E0 CRISTINA CIOCHINA
914,142,256 *5F2F96ACDF41CD6003D4972D00AC78B44A25046F cristycole
914,142,257 *5F2EBC23AC975EB570986B041F72B32535361118 CRUZSIMERSON
914,142,258 *5F264FA9BB765D1F203C5B6E3DA4BE7491EAF073 cruzstraus
914,142,259 *5F2F057F8B18B5B1A7DEF6DAF1BA51426068B773 ep!ze
914,142,260 *5F2433D60CDC0820FCF3E9BF41B1E3371C556F72 CSETJ
914,142,261 *5F2977B74C3386420162FF2CA2A5E3B3505C8EA8 cteo3
914,142,262 *5F2C112C51B79A4401EE6037805DD6A1A2B5795C ctpgl
914,142,263 *5F245AD7BA3FD1E65A780B60EEBABC86D0789098 CUSPIDI3
914,142,264 *5F2B09F8EE0B80A9AA36FACD51E527DD7EDDF501 [email protected]
914,142,265 *5F2871A53EAA1D2B3F6872C81EACA2018411DB1D estebanbrandes
914,142,266 *5F22731713B9103565D7247F10A496E57C257E1E ESTEE-WANG
914,142,267 *5F2C6D72413A18F39BBBA2A098012DD77EAC0EE6 esuitish8
914,142,268 *5F21684ADDD45C0BACAD37B9237B193FD21F411E ETEUR
914,142,269 *5F2141926931F95D9424852EF3FAB77A667730AF cwi"i
914,142,270 *5F272FC685C1F320089D44DCBB6D916490966AE2 ETMESSAM0
914,142,271 *5F26356ADF8CEB4DD9F9EA5B9DF8EF93F89594A1 CWQI;
914,142,272 *5F2F5EEEF692F1158299612B8B9658F8DA23B277 eu2gw
914,142,273 *5F2F3364F7D703CC0C7919FD763D201D906A1515 [email protected]
914,142,274 *5F2B46157E74D73621BEBCE2D7EF2D4DE23197E3 EUGENEHASLAM
914,142,275 *5F274B7E9EA2A2F8B6A154D1E5349E3FD5C6A593 euh;
914,142,276 *5F27870540AD45598B3E08EF5FD6280997972342 cyruslamus
914,142,277 *5F2197FE1DD95AFD6589E1B8CC319F022726DC83 EVIEKONG
914,142,278 *5F232E64C49F55A33C28D7E9A4B8361C3EC676B3 EWONDERD0
914,142,279 *5F2D1A2768021F5BDC9022B373763D1CCEB3866B EXCEPTERENT1
914,142,280 *5F2304226D5A521002375E73258F9C250436910F d=2hd
914,142,281 *5F2DA53145E076385BAFBB43766A435001734ECB EZEQUIEL.PASQUALINO
914,142,282 *5F25BD818160A3456F8AF6C1EFD99D53A79F36F6 d4fby
914,142,283 *5F2804C99E91750F1A20206AB486CED4DE2C76E1 D6Q:
914,142,284 *5F2A75C36B69E3DBF161215F730AC29950BABA27 d8us?
914,142,285 *5F2DE3BCD4E15094823C311B62092881AC009988 fburdetted
914,142,286 *5F20D9F58E834949F231C1943517FEDAF2261662 DA9O
914,142,287 *5F2AA6B3378149FFA9A00B9487F1F5A708F5882B FET00N1N9
914,142,288 *5F29B6DD590375DB6593C5C2D04C0A8476514B50 [email protected]
914,142,289 *5F21CCCD54C905B09AFDA74EBD68BFBD0D6A3721 DANE.GRIVNA
914,142,290 *5F2E1B64560F22D4A558A1C24C471520B7AE697E danielvaldman
914,142,291 *5F265BB3838F385DA47BDA5D50CE7B3122C8F337 DARDON12
914,142,292 *5F252BA5CEF954DEF6F7B9E73C9D4EC97DB094E0 DARRELL.MILLARE
914,142,293 *5F295607B06F6A5C5391D91ACA472E754AFBCC00 DARRENGROESSER
914,142,294 *5F24378D386B156AE045A9EBA60CF34B4639A7E0 [email protected]
914,142,295 *5F2120DE8B72675BFF4B93D9A8251A43C525291D das:
914,142,296 *5F2346633572476EFDB185F4CEA9E4C29550B333 fluteconcertoingmajor(rv435)3
914,142,297 *5F288DEF199543389A11BCC20B3356A8D3ADE712 forelegs
914,142,298 *5F29A396C881792FB1396B9B72A69B9EE8956EBF [email protected]
914,142,299 *5F2544C0C448CA1C64F639A3236B25A952A5690A frameses6
914,142,300 *5F256CC6DBC500A1CDDA01CBBD49A5038A1604E3 dd"6!
914,142,301 *5F2B0BEBE0DF016FC4A53039F04A327EEFEBE92C ddb/:
914,142,302 *5F2FB6B43B99E5C69A07C973DD7808EE90ECA97D FREDRICK.GIACOMO
914,142,303 *5F262DBC1BB06051DAFB5E77708C4A1163D420E0 fredricsikes
914,142,304 *5F2C8B38EFD11428A5949A1933D84DEE334124B7 deangeloserpico
914,142,305 *5F2794D07B633C0110BE0628F91CF929C24820D2 DEBATS4
914,142,306 *5F290E855CE31ACB4DBB9E871352D89A9684F846 ftek
914,142,307 *5F2BECC2BC5396DD59BF0435A9C3147EA1CDEC94 DEE.MURCH
914,142,308 *5F295B374356D495A8C6C5DA123AA276168F2201 FULLMONT1
914,142,309 *5F24AB9A81CA2F06E9442E79201C15F301BF0BB0 FUNNAYNAY
914,142,310 *5F25A2CADFC022837C842CAD3FC1E4CEDA8ED2F4 de-gasquet
914,142,311 *5F29BDC21C42B39B503FCA13D0148C52AFB88E03 DEJAKUM
914,142,312 *5F2372EA7C89AC797936818975F7A46F44E1FA86 galaxyhs
914,142,313 *5F249E8CBBFCCA8A2C1A9E9DAC02B1C63C4A37CE DES!CC4T!ON
914,142,314 *5F2C7869C4019B6C73DDB9A40FB462EF389FBB62 gasachtig4
914,142,315 *5F2B153B9D4BF2A3DAA053319D2E58DADD5A419C GAYLE.SCHAFFER
914,142,316 *5F2D828267F8E2F98DEBEDBB967F39D935BF6840 devondaughetee
914,142,317 *5F25D6C72CFB354E773AD669838D592DEC9E16D7 d+f;&
914,142,318 *5F2BFE3053D6D586B1D885F3E467DA7BAEF7D793 gehooid0
914,142,319 *5F2D916532AD5C2C2DC8A6DDC35479F47E67B756 GEORG FRIEDRICH HAENDEL SUITE NO 7 OUVERTURE
914,142,320 *5F27DC6860EAF336DFFF3C8EBA45B9F4B3CAD5EB DHA&7
914,142,321 *5F2559F776393EF501BC92B71E6B18658DBC1D81 DICKTHOLEN
914,142,322 *5F25E1AFF6F8A1066FF9BB76A3B1E26F5B8D42C0 DIEGO.CURVIN
914,142,323 *5F29721818E59D67D8B56DCC56636F77A8E71E75 di$em8owelled
914,142,324 *5F2D73EF3CB1A63AB15734C254299BD1753AEE6F [email protected]
914,142,325 *5F24F62E7DDEBF2E1EE64C73269E7056599B59A6 GLASSED
914,142,326 *5F215937D283524935610F99A351DE29E6F5AAD3 gommosita6
914,142,327 *5F207E1405301598084CE82AD612646A9ABB063E [email protected]
914,142,328 *5F2B971EB3D74B144AA7F8665AF9414EB163A8FE dkl8p
914,142,329 *5F247CA1DE7A583A245805D4FBD190CAAD20BC4B d(m_c
914,142,330 *5F236B0C5C8556894846F85543B1BBADAF78BF9D gregory.paul.lopez
914,142,331 *5F2CA95CFCA4F500657DBA239444CF33D6DD6C4D gremlins: fanfare and prologue (bootleg)
914,142,332 *5F2583D0E3037B662DE190D77ECF46B659B17D20 DNILKCAT3
914,142,333 *5F272817D471E974BD4EBE887F74AC167DF03673 GTABWISS57
914,142,334 *5F250E46C36B324950E97736F982831E0D97669C DOMENIC.PUETT
914,142,335 *5F201AB810DD14AF62E72A9B70D318FE214AE6E1 DOMINGOPUTZER
914,142,336 *5F2B46AE0F52D2E0B2F4CB65A6F2BBF61E552F4A [email protected]+$M
914,142,337 *5F25857DC81BE73867D076CF26D060DD6B25EF95 [email protected]
914,142,338 *5F26A8E9650CCC4EEE40EA3BCDCF9515F5F9E20C haftenmor
914,142,339 *5F2C4B43C07ECEEC8A4761C63113204230E0C283 doornbessen6
914,142,340 *5F20C9DB256DEADD08508114154019C8AA4CDC5E doteky-tv
914,142,341 *5F2ADBE555840F55312922C0386659A1A8B36683 dowery
914,142,342 *5F2BD8826E13488E766B77E85435B3F136559045 d,)pr
914,142,343 *5F2A36A9301E62BEB2A5026534536FF1106A7C64 HASSAN.RICHENS
914,142,344 *5F2A709CF03944F2F683D7F019E05A99F05E7D29 hbir
914,142,345 *5F2CE97192283CF7F4DA79211B7A1BFA399568D0 HESERUNT
914,142,346 *5F29FCE6B7A2E2581632FA76D4CB4100E05811AB DSSCM
914,142,347 *5F2362060AB3F4BC19B900BA9219C53150929463 hipolitopoindexter
914,142,348 *5F2A24C57B22DD9F9AB328125A1DF225E70BAC3C DU,AK
914,142,349 *5F2DF2E56EAC8C632C90E9EB7C8280052589D72A [email protected]$
914,142,350 *5F23EFC1A332CC8FEEBF01EE8FFDC4984FE8889A DUSTIN BORJA
914,142,351 *5F2094F325E38886DA7F58E5A9CF9694BC959BFA DU,u
914,142,352 *5F230FFC2BDFBD19919DB82A2A68889ADFF9C169 hopfenblattlaus
914,142,353 *5F274EA41242A0500574C9C30C10304EF207AD79 dwd,i
914,142,354 *5F21ED86A031472DA3E22FCC14BA214AEF47B941 hpsibsw1
914,142,355 *5F23B32C70A4AA8DE53F55AD747C93C54547D50C DYXCS
914,142,356 *5F2C5F30F5F6D90D55024C6FBDF09662969AC99D [email protected]
914,142,357 *5F2EC8F6EE2C16027EA3C876AD7797CDBA5755DA H.U.G.GREATEST
914,142,358 *5F26ACEDB989918CA0623D1BBACE6DECB227BB69 eaakh
914,142,359 *5F2DADE995DAB006192F8E5050F1C98F31312D60 ea%ux
914,142,360 *5F2F24204FFCA39A421D79ECB63AF036F7CB4AD4 HYPERREALITY.4.1
914,142,361 *5F27CE2BEC3D7E58CB730B9B5A21793806032223 iamjimi1
914,142,362 *5F2209633C6DAFED76F4F5DD80BDBB6F386F1814 iaremrof
914,142,363 *5F20455EBA629648D0DD717D013E390C15A33915 I/D1
914,142,364 *5F2039FBB5B133C6351E681BCD4BE6DC022FC972 IFB$="0"THENN1=48
914,142,365 *5F265A7F0918D5E2D344AE337D91440283F56DF0 EIJPW
914,142,366 *5F264F14CC3AE36F6C3DB3BEB61C9306F79D55BD EIOQK
914,142,367 *5F28E068CF98F765834798581B30B8117E36260E ILOVEHILLARY90
914,142,368 *5F2D6821C0239B71D8F33E05797CB7E079E37E67 ILUVPOIUYT03
914,142,369 *5F2723C38F0D6B0039D4EE9A16788914DED982A7 ELDENBREN
914,142,370 *5F297050A4B21AB8427CEC9AAF35A41236865D6D IMAM.SUPRIYANTO
914,142,371 *5F27173DBCFF60DADDE8A9F5C5D737B658895A6C el!dx
914,142,372 *5F2EF54878B64DF223D06B98335C9A587C393FE6 EL SONERO LLEG
914,142,373 *5F26E6D96294C32A8FC92AA20348D83D086D8B01 INTEL·LIGENTMENT
914,142,374 *5F25027186DF271D579BD0B4DBD4BCC99F412613 IOMHHLJ49
914,142,375 *5F2EB486696F5380081EBC2326F7C48624DCFA3A IRVINSENGSTOCK
914,142,376 *5F2CBF03B7766BC7AFAE0037AA807278CA18EACD en:b$
914,142,377 *5F29FEA840EC48A0CFAC5392CBDAFB1531B7B5F1 ENCARTEES6
914,142,378 *5F283132911CA0CE707C3CE26AFC90ADF2FD6D55 isidrojennie
914,142,379 *5F227B3A10D90A3C753815234C56F0E44AFE2346 enterdougged
914,142,380 *5F266C301DDAE19439774E71367E53C203FC7D16 It-Must-Be-Fun-to-Be-You
914,142,381 *5F2668B9D876602AA345C2DE9601C8AF150D5B7D eo575
914,142,382 *5F27BA8AFFB84EC9FFDDD8E4125E01B42FB8C60E EOMG
914,142,383 *5F24E16EDA50E23F91BC45B78C5799B01A80A907 j'ai refait l'amour avec elle
914,142,384 *5F267EFCFF7B6CE7637B04BD6D00DCF995DCB4F0 ERICK.HOLYCROSS
914,142,385 *5F2FC9A6D1FD4750CAEE39B24B96FF38782E95B8 jamalshouldice
914,142,386 *5F24B653B8FF6D094C530487634D686362830CB7 jamisonpintado
914,142,387 *5F21BF3D8CF6EB5AC17F9D8CA4B50063A066E957 erta3
914,142,388 *5F26012ACF66E51FAC7161E1B87B8894FC3EDEA9 JAROD.AMACKER
914,142,389 *5F2F6C9F329B7466055185E1070C3E12FDD66463 jarodvankeuren
914,142,390 *5F23FC259A4897934D78C345B216F39B18929793 JAVIER.MCFOLLEY
914,142,391 *5F2D11324D91A8A61DE002856612831D6CE50A0A JAYEDIN
914,142,392 *5F2CA308B0CC3952F35207CB7499E00A7C2DC726 JAYSONTASCHNER
914,142,393 *5F2D4C25778F1D9AA8665817184972BD15729EC4 ESKEDNAPS
914,142,394 *5F25D241CAC67B3BEEA2BFD8C2050C23F557A579 esmz9
914,142,395 *5F215530DA589F830F9695806D6B37C55B14B904 ESSEGNUN9
914,142,396 *5F2CE1A9480E90B694E8D8079D085B5CEB0CA88A ESSIMÉES
914,142,397 *5F26E128BB3451216BA900E1AC5BB89FADE97459 ESTORE1234
914,142,398 *5F255070BC65258BF64A8B3F00EC40EEB6A7656F jeffersonwindham
914,142,399 *5F219691E1F4E21D045C231375020B194EDEBBED ETTATSSE8
914,142,400 *5F2C03FBE57CB18076F2F5C9F7D7C81236D086E0 etudeincsharpminor,op2no1:andante
914,142,401 *5F280DB2FC6C4A1ECD37EB2714DC2BFCFFBA576B EUGENE.MACKELL
914,142,402 *5F26BE8B51E778CD5A7FC1866F2D3E522F1340AC europauniversalisiiiheirtothethrone
914,142,403 *5F23BEE782CA4E755D2E55AE1E9A1834BDDEBF1F JEROLDTOALSON
914,142,404 *5F2D5F07D2A8EF42E806805AD459547A3D46B894 EVERTUEREZ
914,142,405 *5F26E68E0A1089B9F85A48A945C744ACD84D4DA5 [email protected]
914,142,406 *5F2B4A2253CEB9212C0C49834C4D9BAC8DD97C59 ezraphay
914,142,407 *5F2741E422FD967BE21789DC99408E9DD2EEB326 F1C&
914,142,408 *5F23DCFCE82BA555C4D50A37D0D88969FF9FA27B jje<
914,142,409 *5F2C1B56712CFD63D5B30E2B4B76B056B6CE4751 jjxt
914,142,410 *5F25E27DADC5B7C6CAB0A6A6358DBBCF5991566C FACE710U5LY
914,142,411 *5F28E4A62B118028795E7E21DBEA04C504874754 JOHNATHON.ROUND
914,142,412 *5F26705CE6F6695FFA531947DE76F73890A44351 fatherted`1
914,142,413 *5F2157FB99BF481DD2AFA657817E9A8DCC9175AA felix.talabi
914,142,414 *5F26C87B5E01575DB764E82086320040D50C3716 FELTONDEMBEK
914,142,415 *5F279E58729DCA2340FDA59C80293510BA0F4356 JOSEMACS
914,142,416 *5F2D6281081D9A3E913867EB7AAAED48C0E0E82C FERMINAUSTEN
914,142,417 *5F22D941502721F9E1D49E4AF53A4C786ACFFA41 JOSH.OTT
914,142,418 *5F2D40965C00869D0758F7845AFF8F72679A362E [email protected]
914,142,419 *5F221CF883306C418F6915599D21E49DA448F749 FLORIPED
914,142,420 *5F2705EA17F30058A1821E9C731D0CD6C9617B20 FORCEDTO
914,142,421 *5F25542B27A49783AB47452BF8E65DCAB8E51A81 forelegs
914,142,422 *5F2B11E74344660D38794627115AA69B3B4DA6B8 forestjauss
914,142,423 *5F23C700F68CDD10F0604CA1572ADE26E199D631 KALLISSING
914,142,424 *5F249C7E47DB2EF3F9F46994A562846E4936712C FORREST.NEJA
914,142,425 *5F2079AB3B45E979934CDE200EED75A7934BFEEE FORREST.SHIRER
914,142,426 *5F26B549A8B7418EBACB6B4499606CA88A5725A2 [email protected]
914,142,427 *5F218223E5FF345471156FAD133B54DCDB11079E kcillop-1
914,142,428 *5F293FE3B1AA0F9FECEFDE58F2518C8A0741E064 keenanmarley
914,142,429 *5F2EBAADE3F70CB1D40574E1A1E9E16ED1888BD8 fredrickdicarlo
914,142,430 *5F2C0BF7F6153D9FB78ABCAB98AB5A7CD3FCB8E6 KEISIKIO0
914,142,431 *5F2CEB767308DCF51622D78BF10C052882228988 KENTAUREN
914,142,432 *5F23529807438F19792E0EAAAD287DFBAF53BA3E keriann/m
914,142,433 *5F230A860A785FB7F0A49D7E60D718B94CC20450 KERMIT.TUMEY
914,142,434 *5F2BD2AA0273B7EE17DDE38A0BC8FB35FB2CB78D KEVIN GORA
914,142,435 *5F2511FEFF2DBE63F0A2F4CD17C71831F758F8BF furtherthanmyeyes
914,142,436 *5F2D6A30D7B68B0D4A6FFF6D07A698114596B409 FUTSALCHAMPIONSHIP
914,142,437 *5F24D8A3352467CEF0A9A5AAEC9F27E7E9D928AB KEYSTONEKOP.
914,142,438 *5F20B2BE37E9952108C79D126A08B736A3F1EAAF KINDERTOTENLIEDER:-III.-WENN-DEIN-MUTTERLEIN
914,142,439 *5F25F56D5DB317ADEAFF58CAF475F8D542D64F36 gabrielsutten
914,142,440 *5F259F8D4B076CC286C7B3C76C72FE768F48AD42 GAMNEY
914,142,441 *5F27B7E5A8CE30B4464563773C578845F5422759 GANGLAT FRAN
914,142,442 *5F23352460BEBA02BE1F2A82C108F0007A207913 [email protected]
914,142,443 *5F24185E21C98B5883A34B21A987E80E5C35E3EE GARFIELDROA
914,142,444 *5F2BC5E3537790E8A3A1714E94D21D2489D79E57 klovesj55
914,142,445 *5F2B2D12BAA7EC3777918D24B4A70812702F2FDB KOKO.BELUK
914,142,446 *5F28B6ABC379B51367E26170064F5E8912E7BD81 koko.kevin
914,142,447 *5F230E238D9D4CE6DA64BDB6A6686B1D3808E345 GATHERIT4
914,142,448 *5F20DB17688560E41B6B51FD89A1AD646AFAD9C0 Komm.s
914,142,449 *5F213CF2DCF94576DA941EA57F859F6DD883B361 GAVIN.BUTT
914,142,450 *5F2720D103BB709C072833FDC1E859ACC8886684 [email protected]
914,142,451 *5F2B34404175097E9408A864B29A01E633469D47 gayblade
914,142,452 *5F2C4A9A28EC2B081A5E21614E98E6CDC43D8AD7 KOOKYMAMBO
914,142,453 *5F22D1C61584E90073B57F4203ED49B908AB9C8A kyle.teodoro
914,142,454 *5F2AB95B83B14B3EAB04B379963880F2429FD64D L2DJQSEVUUT3QS80SVVFLZZFMVZFSEHV
914,142,455 *5F2A5AE56D92954464E47088B773FC2421D04C5F la-demande-de-z
914,142,456 *5F24AF2845843EA67FDAF683118701208BD1F0F4 GIREKKALP2
914,142,457 *5F25CF108FB426C33D0DB2D15BCFFFA6D1C81E08 GJCNFDJXYS[
914,142,458 *5F2CCB86490EA5700B921743ABFECE00CA3D45A9 GLENN.KOZOLA
914,142,459 *5F27481C0621362A78670944B2E18051D4C2E42D LANNY.MALLIN
914,142,460 *5F23E3FC63E968119E30EC93EE1DA504548B1B89 GLORIA/SHAKINGALLOVER(FEAT.VANMORRISON)
914,142,461 *5F2E7E1D89AFBD36F4FAAC4D09673FE77AD08E3B glory,-glory,-glory
914,142,462 *5F2A05C55432C338C8083B70FC57DB7A384C83C8 GNIKOPS4
914,142,463 *5F247D1CD52E887FCAE199BED4045388CC2B33E9 lauren-satterfield
914,142,464 *5F2B57BA0AFEC70DD90B6FEB7263358BB9D402BB LAVERNWAHLUND
914,142,465 *5F20E229127EF0E2F1C127CB30DC4BDCB96EE720 [email protected]
914,142,466 *5F2FF05C72DAEB768A57370466AE7C022A196010 lctnztn1
914,142,467 *5F22F476C79EF533908F347F2EDBCA243C409BCE GOURDI6
914,142,468 *5F28E040B2E2625BB17A3E91EFB4574C6BD33EA4 LEBOURGEOISGENTILHOMME,OP.60:II.MENUETT
914,142,469 *5F2366FDBEBDFA4A0D437A6370A8AB4E9C14AAEF GRECQUESÎ
914,142,470 *5F2A5BAE72153A71CCFBA942B14121FF4C54458C GREGORY.CHAMBERLIAN
914,142,471 *5F2A8832A67553DA5BAF0AF70B06D4B45EE837A0 leohammers
914,142,472 *5F2504A9C587F4262627CFA87B8AD6A687FFD981 gronemanhesperia.bv.|.netherlands
914,142,473 *5F2A45F840AC51DA832D7027C9E58A0FECA79FEB LESBLEUSD'LAPLINTHE
914,142,474 *5F25442FB0372665A7E6A714B1487A0E934D4F36 lesgurrad
914,142,475 *5F223F0C8AC687E322C289EE9BCF32479B3CCDA4 lessee l eh0 s iy1
914,142,476 *5F298742F4025E8749926508ACF000E48F24102B [email protected]
914,142,477 *5F2964B7FDB66107E3B23FBA1A2050418AB7D93B GUERILLA
914,142,478 *5F214A2396F0397D96D9204658BB287AB1354603 LHENZKE
914,142,479 *5F2C362001B956224E3586ACE52A2262C84BC5B6 L'HOMMEDIEUGWINNUP
914,142,480 *5F2D39B77CDB8C8A06EE3CED1A6F2FDBF47742B1 [email protected]
914,142,481 *5F2DA48471F4BC4FCCC3651D7B268FF015171475 GWRLCHT3
914,142,482 *5F21834D236F60E32A180366727426C8E496E561 [email protected]
914,142,483 *5F23269EB2CFE861E16C83D635451537FE96F229 gymnastfreak02
914,142,484 *5F20FAB0CCA45B96B4DA02FEA4C09E888869CBDA [email protected]
914,142,485 *5F26727E37E4F29541A8EA3B6D236CA937DEDD78 H1PPOGR1FF
914,142,486 *5F2822F8D83D6D19D5C5C48FC86A268FD07421A0 h4lf-cone
914,142,487 *5F2FD14E342406F1576450E14239B36A9EA91360 LINCOLN.BRAUCHLA
914,142,488 *5F22CD9C7607A2B2DEFBF835FB6CA3982E26A4CF LINCOLNMADENA
914,142,489 *5F29198D83A4C4651CDD3A9CB53B4A0C7611F3AE lindsayhasenbeck
914,142,490 *5F2AEF70143F4D8BE27314789FFF49796AE4289D [email protected]
914,142,491 *5F216148E6B63D1E8BF595373A9878FC6E189D19 [email protected]
914,142,492 *5F220084F3726A10DBCEB1CBD32F15218437F1AE lionelwitaker
914,142,493 *5F249ED7CE62F7419D8223E44D65C10D25A2D07B hammondsoftware
914,142,494 *5F24ECF243F31E203F6CE065D8D1B2C152544BBD HANSGRANDMONT
914,142,495 *5F267EE00B9E52AF43544A90F11D58B7C81499F0 HAPPYSPECIAL
914,142,496 *5F2035C8B5D7B78786BA15B9602F66A597B31A94 LKITVK4IIN
914,142,497 *5F2B7004D428458C07DE9CC3CDFCC7C12215BB04 LongArm:' "Let me show you how its done
914,142,498 *5F2F4E4B8F865C55256CA01ACFF6AD3A06DC8FB7 HAYWOOD.BARNSCATER
914,142,499 *5F283ABEBEED3380EE0D9F3EE173B5E41FF81A97 LONNY.LOZOYA
914,142,500 *5F2064590DF8DA72435F60C9A7B6BFB3F45C7EC6 hduc
914,142,501 *5F2C045678961A5074A50B52CE06A2C236A8B72B lota.estacion
914,142,502 *5F2D3365F53EB80FA866BC1CA6C3390008A4A34D LOUIS.BURDICK
914,142,503 *5F22786035B8B149F669E52375C1AC95C206CFB6 HEIMZUTRAGENDE
914,142,504 *5F2087DEFFD682A74493F588D8EF54ADE6B3CBA9 LOYD.SURRENCY
914,142,505 *5F2414FEE4582481D5AF46959B21AD271B2CE338 HENRYOSTING
914,142,506 *5F2DC3723B2E99DCB293DB02776E7FB730F9ED61 lracsivle
914,142,507 *5F29335DC9C3630C05B7541834D0F32A4B3A3F0F HERSHEL.RATCHFORD
914,142,508 *5F2C722D02BBE9B6047BFB37E6FC0CEF44F22D72 LUCKY.TOMAR
914,142,509 *5F29BCE64B69D61346D6447D205C0BE334CA31A1 LUKETUFTS
914,142,510 *5F2DF2DD3FFAD2C5138D77BE7C2E38798367F43A higherarcingorgwww
914,142,511 *5F25F320C0EBD287A42C382318721F7F65F1795D HILTONHYLER
914,142,512 *5F2AB047FAA2C6A003856B25A10234F1B83B5580 LUV U STILL
914,142,513 *5F2649007006A82CF02CCEA56B829A9E23D11441 [email protected]
914,142,514 *5F2600C0269A81D39A76FCACAC30A5181DF0C2D4 HLPFCLTTING
914,142,515 *5F252FF72291CB007A2E29E44BC053D3CAC13414 M0NS+ERH00D
914,142,516 *5F2003C426F8E14889363C00DC1E8404AD28AC74 M0UNTB4D0N
914,142,517 *5F2A26E87BAF5B2364FBD70EA112E67CDDD76879 HOLLISPALLESCHI
914,142,518 *5F2A32005D36DC80110550B2B4799A703B7B7D1F hollissarka
914,142,519 *5F2A8CA4367E3ABF5945B930B6397F269A4AA117 holmij
914,142,520 *5F25D5BB5795FF80B65E1F3BE8F6038443F158CC HOMER.CATHY
914,142,521 *5F2BEB28D52F5452C29F89A19962F2E256F621EB maclurg8
914,142,522 *5F21C48DBBC705CAED97B7E23FEFDCAE56A40E36 HOSANTAISHERE
914,142,523 *5F2295FA9C62CA6EB0BC1A7A6C998DED9869D0F1 MAHAALIR
914,142,524 *5F2C90A7869C4A78343A96EB5F3BB22FD51E43F0 HOUSEGOLDED
914,142,525 *5F26449625259A961ABCC04A6C5A71D472FAEF29 [email protected]
914,142,526 *5F2817C0E31D2AD83233DE04881171422C587917 majeedy
914,142,527 *5F268AE0F2C078A2B65849B344901D6D480858F1 hueffnerstudienarbeitatomix
914,142,528 *5F21A871F58B85D6A4BA58233577B979587CC98A [email protected]
914,142,529 *5F2255128E657DF659D8CE0E5FD4FC5C6896516A mariongraleski
914,142,530 *5F2EA254BB31E5337C8C68760ADFB076205C8DD6 Mark AZ
914,142,531 *5F2AD75EB66C927B9AA6E5A956E15A4217115D15 MARLON.TYMESON
914,142,532 *5F206380C48DA51BE9301BE654C22F17AE03F367 ialanbbs
914,142,533 *5F2AB680798AFCA5C1591C1CF2B280D7EB1D6D7E iamalfred28
914,142,534 *5F2C4CE244F0D11F0B72A84DDC6091E88F199950 iamrocknroll1998
914,142,535 *5F264F8A0866AB3DF9D9117F875A206D934D1C30 ICIFELAM5
914,142,536 *5F2A842229CD3629FA9301F6D478973D69166BA2 i-defy-you,-heart-man
914,142,537 *5F23241A3BB5A01A9EC7F10AFC2E40296E9D72E4 IEBELEID9
914,142,538 *5F24433FDACEC6F5B21777820363D2C0F9C74FA0 igrantr2
914,142,539 *5F2485CA589D4B0AB3A9F65950D3AC51DD9DC532 IJWR
914,142,540 *5F218473F81459A283200818B620BE6690324753 MELDICO123
914,142,541 *5F2DF53597E58A3184908E10CFF12F0C897A0477 MEL.LEISY
914,142,542 *5F2977465B4E9646EFE7041023D639C687397D39 IL-PRIMO-GIORNO-DEL-MONDO
914,142,543 *5F23B77FE08318AECA544ACFCB28F0C943AF7E0E ilritornod'ulisseinpatria,sv325:actiiiscene5."
914,142,544 *5F274DEA49BBB4EE9F32492008E993019946E958 IMAGETROLE
914,142,545 *5F2D1ABEC77EC4F611C60B236092F4A14470A548 imostlycopyotherpeople
914,142,546 *5F2742A2D86651F2837F76CA944ED830F7E556C2 MHIGHSCOOL
914,142,547 *5F27241672DCC49B3CA7EC5A100FC22E799FE173 michaelbaier
914,142,548 *5F2F336B11DDD94F8E1566224FC0B930BD7731C2 [email protected]
914,142,549 *5F274EC370E8481F54D19A8534FD78DE72BDA801 inflows
914,142,550 *5F20AB745FD73F105724840319AB23FFEC542F75 Mielott7
914,142,551 *5F2BFF1C098141B0160C72A6C9334C955EE315E6 INTEL·LIGENTMENT
914,142,552 *5F2CEDA6F8A1D19FFA1620785A6DC03648DC1705 MILTON.TOMASELLI
914,142,553 *5F2BB58099AF3701AB77CB17324D8EEC355FBCD8 misfires
914,142,554 *5F21FC0301A9093C72353BF4A7C2DAF0EC677D4C IRWIN.ROBERIE
914,142,555 *5F2EBA62EC34C255D0C538BA2207F3424078997F I-SIAN-KHU
914,142,556 *5F216EC71E9255283DA0A8F818BAFAB2DA9F4FDA ISO-STANDAARD
914,142,557 *5F20058005B2DD5CFFA3D866C624EF23F1A8B039 isticadelosbalcanes
914,142,558 *5F2D4DCE208EDFB3AE9F7C026483386AA767937B ISUFUS
914,142,559 *5F2964CAF386A9763E450E96007D071642A4990D MOLLY.MATTINGLY
914,142,560 *5F27563DCC602EDA24189B298F37EFC29DDF24E1 iuq{
914,142,561 *5F2A5D4A3942426AC7036D70AF44794630CB01B5 montepries
914,142,562 *5F2634A7AF9DF34C3898802AA3F7DB4B052AE665 monu.singh
914,142,563 *5F2969DA2AD079D2D94A5F9D08EA88B90698A3B4 MOSES.CHAMPA
914,142,564 *5F202E0F05292C5D4F4B48F6FD30D07C2D55622A MOSES.MUNYIRI
914,142,565 *5F21A607B126B7AC5884B5B0D34238B5647BF911 MOSES.PLANA
914,142,566 *5F241D3D53F7AA5F201B10B3BE957FF3EAEA5C6C moshepurswell
914,142,567 *5F26274B13C45163B04054E00E3D2CCE15B4CA27 JAMAAL.LEITHAUSER
914,142,568 *5F2C3EEAFF9AE3A368DD1571F7A20C0A2C574415 JAMESTRAZZULLO
914,142,569 *5F24A4A685946693706B47302F7B20B1741900DD [email protected]
914,142,570 *5F22D0FE2521E6A56DAFF5E3FE477566792FDDA2 MURRAYYESTRAMSKI
914,142,571 *5F21F3F4953CEB03B6ACF3567B1DEA7B2858429B mybloody3
914,142,572 *5F225F6629659236CDE2E1B67DB5E9C5EA503A4E MYMAGNUM1985
914,142,573 *5F2D9A81E55BA4455F1491E631CAA15ED08B742E [email protected]
914,142,574 *5F2BD0D204736E3F49DDDC23B5008EB3891916F8 myronmahaley
914,142,575 *5F2E6B874D14B9CF463EFF3E3FED729994121C4C JCUHRIG
914,142,576 *5F2BBAE76C04683DC4168E0BC3F6E5D075016D9D N4353
914,142,577 *5F2954976CD3EEA41E880F1971F50D56F94E7D0E JEFFGRZYMKOWSKI
914,142,578 *5F224157F3CFFB9D5DDEE42E86FF9E6EC7D92331 NAHUSENAY
914,142,579 *5F20251E2FDC9101BC45AE62EB08E39DCB283F40 jenoonej0
914,142,580 *5F2CA55371E0E16921C803AFBEE5263A504531FB napoleonklingelhoets
914,142,581 *5F2E727CBA1B858C0949ECC7EA32AD64EC5ED956 NAPOLETS
914,142,582 *5F2C4926DC60BF97804CC4C1FA0C48C6BFABB20B nataliemarkin
914,142,583 *5F298E777F774705D0CF020F7C5124CDA6B1A240 natetw
914,142,584 *5F2CACA2AA36D0B7DC7795945ECD53EC5D725F60 NEILLYVERS
914,142,585 *5F2ACFBFA4606BD754DE08F98FA492A7641436A3 jimmiepatrick
914,142,586 *5F2C4EF7BDB0A43C659316ED09ECA5EC4779858B JOHNATHAN.KOT
914,142,587 *5F27898C1933B9EA495BC01634893F9DBD990C11 nicholasahlin
914,142,588 *5F2651D3A2FD881F9695A638CC48C18A8D29E5F8 nidnelav
914,142,589 *5F2D1FD12CF484B474E049C2029F162D12BD190A JONGODBOUT
914,142,590 *5F24197352B7F08AECD3552E8A2FB33481EF6394 joshua.laudermilk
914,142,591 *5F2F31E3BE3A358790E95A8EA3922AE559EDE3F8 [email protected]
914,142,592 *5F2FC71766C8A8019E90F27BA0B91FBCD01B8196 jsim
914,142,593 *5F257A08FCA93BB512764D23DB3C3F37E58E1461 junipining
914,142,594 *5F2444EE61C9BC4C91043177D79268A31D1D1853 K8T
914,142,595 *5F2D05BDF44DBBDCB1E26CD6950FA0158C90DF98 OA|E
914,142,596 *5F22A467C2AE638E6F3EB1AAD5D13E8F9208F87A [email protected]
914,142,597 *5F201BF8E151E7A3DF20F9E384FC4CA4E2B50BE1 karen.dinneen
914,142,598 *5F2644B4E4AC0FF90167A539AD6F57971E6E18A9 KARENRAINE
914,142,599 *5F2BDEA845749E516FF6DEEBA7B743D6CB0EE295 KARI.HERRON
914,142,600 *5F2976E791EE3E2F08B4178AB5136AC672A89B10 KASEYCHAY
914,142,601 *5F2F3901624733524D6AD164FB9A2B87D67F865C KATARINAPEROVIC
914,142,602 *5F26642AAD28E9C55A9EE879532805DB20C81494 kate-rader
914,142,603 *5F22C43B2B849D781089DDA890241B38343A36CE [email protected]
914,142,604 *5F2D04E73E3A2185C2628FD513D070BA1DB55ACA [email protected]
914,142,605 *5F2C4B64F73D42117556E56EC26C081278C90EE3 OKIRO'S
914,142,606 *5F257BC25C947C87BA45F0EEC99EC3ADA0577672 oliverrayne
914,142,607 *5F21543FEA7805A93452DB7EBB84E74A82730C28 omerfang
914,142,608 *5F259D71418693A40D5DABD8F552695D3BA49705 OMHSVQQQ11
914,142,609 *5F28E8E2309B9900156616ADD9207444254FEE6A KESHIDRAGON
914,142,610 *5F241FF795B4747DD94573E59072EADCE6BA8913 KEYLA708
914,142,611 *5F2C326C49627810A9D8F8BF486DC51A8F29F572 KEY有很多相似之处。但还是有以下区别:
914,142,612 *5F22CE7D0C2E44969E071F5884221929F47E7569 KÉZTARTÁSRÓL
914,142,613 *5F2DC1FE9F1A3A1520CD25E4CC715F883478BC3C )o(`@p
914,142,614 *5F2741941547367E7D5542E5067C8CCDFF4E148E O><~Q3
914,142,615 *5F23D99F4F8E5809FABB88719B242D31F2801C17 [email protected]
914,142,616 *5F266F384E87EB34EF02F1EC73BDA94019B9AE13 orongip3
914,142,617 *5F2C91BE13E6E4D07273EA8490BE843462612575 orvillecanestraro
914,142,618 *5F29EAB467C7CE88BD595FDD10C27EBC33C29691 OSVALDO.GENGE
914,142,619 *5F238FF883B2389DC4ED2600757D6F562482CE1D [email protected]
914,142,620 *5F29732D8520CB180204222A2281F122FADFF34F knightssymbol
914,142,621 *5F2A47A224D9342E874B0596A694D40633B8494F overcontract.
914,142,622 *5F2F05FCC46533DE88182539C6C83DFEC7A592A2 [email protected][email protected]$
914,142,623 *5F2E93F434CD45DD8BB13D6AAAA53D66D0588191 P4N3GYRS7
914,142,624 *5F25B684FE019801DE52E984DA72A75AA6100DDB kristin-kurtz
914,142,625 *5F26499CCF845FC246C54BAC9B5173EA324B9D1D KRISTOPHERCOKEL
914,142,626 *5F2B3A66501FA8C29355178028F3E6EA6B0CC14D palenki
914,142,627 *5F21BD87FD587D307D9DB9F51CE4A203E1444BAC KUTEITANSA
914,142,628 *5F2BBD784252E584EA88465D9D9EC73372D9C0A9 KVORTEKR
914,142,629 *5F25A0B1D3E2DAD6D68EB63546E4DF768512540F pawanpreetgrewal
914,142,630 *5F2A5B40D7055F637B0430707B79ACEA6048EBE2 LAELIAL
914,142,631 *5F213FBE4EE897309261661B9CA358F2316E0C63 [email protected]
914,142,632 *5F2F2C1786BF00353E50C5FC37827EB0885B25B9 la-na-fda-bpa
914,142,633 *5F26E006ED89E67A7C3B3BC0F2EFDCBACBC8B099 [email protected]
914,142,634 *5F21ABEA8628645F7BA9F53C0E6E69695CF04B7A lekterme
914,142,635 *5F2A06E3FAD94C12824F723BAA97BD2B81C74140 LEMUELBRALLEY
914,142,636 *5F284A492411B2F8CE41789FDFCAAFEEC231D38E [email protected]
914,142,637 *5F2EE2399E8EA9548117D9174384D04BD77EE9A3 PLIJYGR777
914,142,638 *5F235DD8DF57183FBA0FBE452A0622BF5A72A64D LEONREEN
914,142,639 *5F24F1AE21AA499B4743CB9EE90E48B51AC0E785 LESBETTS
914,142,640 *5F23930213D04869E1BEC5416FCC1198535275F2 :po~q######3
914,142,641 *5F2B01BF7068CAA005F6B1A345DC2A8861A2CF85 [email protected]
914,142,642 *5F21A99BD57472B2F76DC813324E899BC69A6B5A [email protected]
914,142,643 *5F2714B220601B92420C59144DC0B3F056505340 PORT-ROYAL-VS.-SELAXON-LUTBERG
914,142,644 *5F2EDC68DF1425B0B5FE3E10967299D7011DF69D LIEZEY
914,142,645 *5F2840908EB1D770F936FBF6453A4CD04CE48C8B LILLIE222
914,142,646 *5F2F88842A396D3AA3E436CBAC739A6F3A551BBB p###P-~0-{x}
914,142,647 *5F2E261A97E3471BB355A1F7860558D01F236A4F lindqvist、
914,142,648 *5F2FB126F798F0A17072E19D2D0500C659C4A6B4 [email protected]
914,142,649 *5F24343B5FC634086B8F0103A9D23FDAA54BABEB [email protected]
914,142,650 *5F256936294B5800068FDFA1FFD33B0AD53DA7AC PRESQUE.LENT
914,142,651 *5F2E8753EDE138A6CFF3EF0F23E8108BC9DA51BA PRINCESSMAYO
914,142,652 *5F2DD9820F545458AAFB3EE05FA4B194BB2DF3C4 LO4839
914,142,653 *5F24B96FF71D062B9656806EC5CB7623B39D5759 pulsatilo
914,142,654 *5F2B50C6DF5E0088A7A86575B3ED9D911E7D3C5C [email protected]
914,142,655 *5F228B586950856639886FA00F4672ABA3B8F93E luisshovlin
914,142,656 *5F2571810DC4039091D7B614DC54541BA6E5CA52 [email protected]
914,142,657 *5F29AA8AE427989A0883C02881F95DF662B4E5C4 [email protected]~O.(>_0)
914,142,658 *5F240CF0FC49EDA3A899340B8B5B7C22D9467271 QQ'K
914,142,659 *5F2B90A18D7A4682BCED2122E3E9D68015F1E9BC QTBPBUY4
914,142,660 *5F2EDA9B93EDEB368978CB0DCB20D7C5A7FAA4F6 LYDIA-TAYLOR-KAHEE
914,142,661 *5F2EC491EFFD4E2F70F9E31820A7BCF9DAD171D9 quarti135
914,142,662 *5F28297C5CFEBB7FC090C6BFA44595501B114CDB quynhvuthuy
914,142,663 *5F294C8797A28A37C1E2D09FBD206E7665FEA040 MACDUNNING
914,142,664 *5F27C75CCEDA7C6C0D639C46C6C627B39C46DBD1 R3WA$H
914,142,665 *5F217C85329EACF528708FF008097170ECBDAB8B mad3m053ll3
914,142,666 *5F2F8F30D7EC3310A034C2AECA1140A6E6024933 +R4N$1I+3R4+ION$
914,142,667 *5F2410A4D310104C574A73DAB931F30738925F66 RACIST-BARACK-OBAMA-MONKEY-JAPAN-COMMERCIAL
914,142,668 *5F29E732A3D3599995398609E5833EEAC54F1752 ralfs-m
914,142,669 *5F26AD8CF769BA4D844EF3EC761B567FB392AAE7 raphaelgerrard
914,142,670 *5F223F9382C46D36F395A2FC0807755622DA8756 RAPHAEL.SALLE
914,142,671 *5F28876E83F03659F37DD7F2BF67C140B6DA0DE8 MANYBOOKSNETPAGE
914,142,672 *5F277D9ACCD2EFFA6E16159D88097E61802D6AC8 marcelofouquet
914,142,673 *5F251DD781FBE11037ECDD17AFF778FF590D6186 MARCUS.DICHARRY
914,142,674 *5F2F82C5527813BDD4B72AEF011042F8DDCB6BF4 [email protected]
914,142,675 *5F2A829EE35857312FBCCDCDA466ED3735BCC1D8 marianostraton
914,142,676 *5F2B29A9D83A814B068C417B86DC1493F557D50C marquisarlen
914,142,677 *5F2C1077938BE2C3E40CD7A8BB12B48C8AB71B3A [email protected]
914,142,678 *5F2049369559924C7174A3E4332A9A95C1E644FF recordbreakeronseine
914,142,679 *5F27CE39780EB2FC45F95DA67B1A5A7AF2A1B366 maryroblin
914,142,680 *5F269D3505DDD2E5EACC1CAA517A1E443CFC0976 REDUCEDOCTOBER
914,142,681 *5F22304F12144600482185BCAAADC44761105A53 REGINALD.ZADER
914,142,682 *5F223F3ED443A2A968CB5D9F16C8C2047EB66898 REGINAS
914,142,683 *5F22CABC4F42C82C911CE4F310D8A0C276931385 reinoguelen
914,142,684 *5F2195FD3B9C89D974142FB30B5678ED2D500077 REMAKSNE
914,142,685 *5F207F9C439418126C4A4FC89C1EEBC0D757D276 MEGHAN EBERT
914,142,686 *5F230E9B0AA5BD781577AFF6F3ACC02F56989A9F MELISSA-EHRHARDT
914,142,687 *5F26E92EC0A4451C35C4CE805F5AA3D9F8F613F2 MELODIES
914,142,688 *5F20C4524C602C4A5BC03C14BF7D77E57472C4B8 RESTLÄNGEN
914,142,689 *5F28C030DE769FBDAF88F224986B89CACEBBD436 mensenre
914,142,690 *5F2FBDA095F74FC09BAB8B21AF755760D3345193 REUNDERTECKNAEN
914,142,691 *5F291F406AC8B11AABAD74E6EE12FFDD95C16866 REYSCHOR
914,142,692 *5F2BC5582A5B860BBE0AFB1C4F5A7023B56A5FCC RICHARD.DEHOFF
914,142,693 *5F2E8864EB7B6968AAA7AAE63A58710D0EC672EA [email protected]
914,142,694 *5F260B19DBEBA03E905518EAAF761394AED30AF7 MILFORDJEWELS
914,142,695 *5F27B9DC98A545A30A3AF74A1710DF72E259C4A0 MILIER
914,142,696 *5F2719422D2EFD1C78C57E525A83EBF6B7C8EF73 MITCHEL.NAPIERALA
914,142,697 *5F2A1747C0F1AF4B0C14A39FF8CFC04FF2B44D29 ROBERTUS.RYAN
914,142,698 *5F2A08EF0D19EC0CB7EFFE360B4D31B2BF5E8822 RODRIGOFLORIA
914,142,699 *5F2D6024328A863816B9697455667973F8C91977 RODRIGOMENZER
914,142,700 *5F2650C24247F94002036EB8E38EA3837E8107D3 RODRIGOVOLLAND
914,142,701 *5F2B3C79EEE6D1D4BFE97454F8E9DC622605F704 ROLAND.KINGSLAND
914,142,702 *5F20D068EB8104B03EFADF9BA631222693ABD6D1 moisessmedick
914,142,703 *5F200BE2D9EDDD0281EFEB7086B5A83B7697CCBD monroeshikuma
914,142,704 *5F2EBC51AB1460D97A844442CC1AAF0D1054037A MORGANHITT
914,142,705 *5F214BB12AD17DD1F7DD3AA399B4F3B3470F96F6 MOTHERSS
914,142,706 *5F2CE4B858445709868B0AC658A584BF5097F336 royaloakleatherhead
914,142,707 *5F2C73846835F554BEB94ED826DA3EEB7B1781F6 [email protected]!N3SS
914,142,708 *5F2D97FE68D25D803F4BF19F2A04680BED3C67B5 RU244
914,142,709 *5F2AE6C70831F84FE70005FBC94E2812A19C2CCD RZNRSTPHN
914,142,710 *5F21522B62BD4803B329769B8DCE2856FB9CD2D6 rztliched
914,142,711 *5F2F913AE1E5038C16E547ED4E9BE86A6E97CA8A [email protected]
914,142,712 *5F220664A74EFA0CCAC1322D0B13E33EFCCAC754 n18411
914,142,713 *5F237F085624AC7DFA2FA0D624C81461F37EB104 s4fetygl
914,142,714 *5F21AD1B57A911E2E8E5E2F3A2B92BB4963C7BED NANCYWADHAMS
914,142,715 *5F2245C591C026E11C7CC22178B57571469E61B3 [email protected],
914,142,716 *5F2E670FF1F3A38E0E83931CBBC126008E63D6C1 narthorn
914,142,717 *5F24B765F6256E37F86C8F82517C052BB745A370 SAMMYAIKMAN0
914,142,718 *5F2755BDF907DB38693A2B433E6FEFDDCD85B262 NAZATULB
914,142,719 *5F29DE845EEF946895A54F90153DC36A2BFFC808 ndp09
914,142,720 *5F260FCA26D91D99764E49041EAA213E97683187 SANMIGUEL1
914,142,721 *5F2E5A4927E62F580E78EB5CB9E014550D7A1CF8 neledev
914,142,722 *5F2E2F09EBD9B94F9C40CDF6ADF7EFD3971D1596 nelsons
914,142,723 *5F26BBFEAAF0F6ECB84741D3AE6565C5D97E45AD neroicrec
914,142,724 *5F200391A123616E18FE52FB2F95B39BD79D11B8 NICKODONAHUE
914,142,725 *5F2C0EF61A99E91736770B5996395F15D5CE225D NICOLE-PEDRO
914,142,726 *5F2AC4727EF44BFCE6C299CB3D27DF172A3F6B05 NICOLERODEROS
914,142,727 *5F21A5443C3AC4D1DCB2FD003C2137E541D61001 nims..n.ih1.m.z
914,142,728 *5F2203AF6BE1D78029CBD23E5362A75DFBC120F0 @NISOSTICHOUS
914,142,729 *5F233F17780AD75698A702F3E921F81A2D08093D nkhlvdbfz4oe
914,142,730 *5F209766816906CF82A89C8B4968DE47F63369EC nolanvictorero
914,142,731 *5F2DD59FB04BC520C34F2D160FAA47D2A3BFCE76 SEISOUKED
914,142,732 *5F257BE038126241055827A6BEEDFFF94DB8FCBD SEURASIIRROLLAAN
914,142,733 *5F296B9BD444D67046D8B106C410BB6DA45435B2 NSDAEHLPPING
914,142,734 *5F25A055F2DADD0A492144E3B1CAC74F95ED30C2 [email protected]
914,142,735 *5F22CD77F19B409B3CD828AD7CC034762816C8B0 SGLAVLIT
914,142,736 *5F236FDEFB8017CE0159B7CDA628B0C0C9DA0FD0 NUMB-FIS
914,142,737 *5F2D21A9CEC1E8847598AB6A01C0890A6A738F9C shadmccraven
914,142,738 *5F2F869E4A8ABFDF777D438B89652893D2B7938C NUORVALA:
914,142,739 *5F292216948E6189AA2FE8C73B5D2026C29FE6C0 nyssaei
914,142,740 *5F2D6DAC536E0E6235C13208E2CB364A0E4952C6 SHAYNE.WILLITS
914,142,741 *5F22E5CC947D5443737B13582102C3BC36BA81A8 [email protected]
914,142,742 *5F2E12CCF79E5274CC9C0B47347AF8377089DD9F ODELLCHATMON
914,142,743 *5F24CDFCCB25FD1419582C9AE47D8159F5311188 odvojeno 2
914,142,744 *5F2C1AF3C2D775DD1844E935B03913624E1A6E68 offici47e5
914,142,745 *5F2EF0D5AC3A1E71358A2007CE1FF7140AA420E5 SHOWNEWSDETAILSTATIC
914,142,746 *5F2FAE5698E49CE70ADE12E5B6C0F3E6A1291084 OLLIEBANKOWSKI
914,142,747 *5F2360917A1692726DD8DDA575064DAAD21CFC83 „OLYMPIC´72
914,142,748 *5F2473E83D72076C19F34277CD2E4A0C502F3017 ONAITARG3
914,142,749 *5F2CA1340F8C76FA34CE4A2A0AF98A586816DD57 SJTA
914,142,750 *5F2FA1D0B5C35454B392CA343CF418FA107D434F [email protected]
914,142,751 *5F214AF24BFF103BC1539CA7CB94282440F3D631 S-MANHATTAN-APARTMENT
914,142,752 *5F29E359ED0E1487ABCE2B9CB5A2A0ED3531971A OTHAAGUILER
914,142,753 *5F2F396E13EE0708FE956738F6FB34536A117205 snoopdogsun
914,142,754 *5F286F2C4A38EE16247525518AFCF58D6D939A47 SOMEBODYINMYHOME
914,142,755 *5F2FCB96D5B9CF470FB32646EDFB9AC998DEC9F2 [email protected]
914,142,756 *5F203E5CEEAC46AA0785B27C8199C331BF9A9505 SPCLNTN3
914,142,757 *5F2073FCAE2EC3D276DB4D7FA01B0709DBFAF17C spearville
914,142,758 *5F289D573C1EE4E3F3B71007A905E0D09B8F8BB0 parianes6
914,142,759 *5F2FEE836343289AD7E2640274904F04F2F3FACC SPEZZETT4
914,142,760 *5F2FF9CD48B05E436438684E40546D961A6CC75F splat!-*-*-*-q==q
914,142,761 *5F225D8B0343A42F7755EB10AE2AFA3BF772CE4C SPLOIT**<8
914,142,762 *5F2A9BFFC8B59FE1CE107C3B1D1B5DD22E6314B4 PE8|
914,142,763 *5F290F4AA30E3CEF6D5C9570B34D8A7DFA570544 [email protected]
914,142,764 *5F28CF4D7E2AEE34FCD4D9F8B9DD70B0410EA163 PETERATANASOV
914,142,765 *5F221D8D83373C41F477B70D35375E5F99ED2983 stanleybryer
914,142,766 *5F2217C97A6E327910AAA6E109B1FBF90E0BE517 PETESHODDIE
914,142,767 *5F2375296DFE3AD69BF3EA4F7E432F07D65C9A1C star_2
914,142,768 *5F2016EE96E5E2472A250FA2892C554676592311 stephencarriedo
914,142,769 *5F245A9FC76DB53D36A93018EECEDB6B16C44BF7 STERLING.ZIEGLER
914,142,770 *5F2B5CE89D4D04031BEBCEE5F80369EC961718F6 [email protected]
914,142,771 *5F2C01448C0870245885199896F1A09FA1B73BEC pitloucing
914,142,772 *5F223703C9D646BDBFB49626FBCA45F4CE5C2D1C PKOCHIN7
914,142,773 *5F267AE80FF4E88DF96B6AB4B5C1A402CD07A15B STORMANOSED
914,142,774 *5F26B59403182254EEC2CDE98060F93EF6ED11E4 STREBZEN4
914,142,775 *5F2F1AF6E3081B91F5147C0BF14C444FA0E3CE87 SULJETUIN SILMIN
914,142,776 *5F2F0E656A252F655468D735DF8CC6C76AB0156B POSTULA!
914,142,777 *5F2B4DF05FD8C8F79DEF5E03442EB7738B9631F2 [email protected]
914,142,778 *5F2822699D4049CBEA78196192DDA9A626BDFFD5 SVINGNINGSHASTIGHEDENS
914,142,779 *5F25EAC4C15FF616F4A77C11EC8F33B62937D9A5 sylar-hero
914,142,780 *5F28AEA8E2EAAF22D84D574A9955869E7BC7D00A T03-B0X
914,142,781 *5F2372BDFC06C93BE314CBF5F02974ED40BCCCF1 PROWINZIJALNY
914,142,782 *5F2A5220B0D1886018A8E4B44DDFE6E1C2943BA1 $TA81L1ZAT1ON
914,142,783 *5F219E858EE0DD8BB70BB049A88F80D753FFBBEC [email protected]
914,142,784 *5F2E459D9116C6222DB2B1A23FBDBC2EB0D336C0 takahatafudo
914,142,785 *5F22436C129DA7429E95BA50ED0BE17E652C270E TALKFLOYVEN
914,142,786 *5F212F7B8034DC52C5B3D26F082AB8CE6CF91895 TALKKAZOOIE
914,142,787 *5F2A821E588152C86DBB26331E6BE4E2015A65D3 TALKMARCILLAC-SAINT-
914,142,788 *5F23F866F39D626B5179F610CB9F90985AF02C23 pyrexical
914,142,789 *5F24EAD89A2BC0CF27EEC98108324027722304AC q###)`~(><)
914,142,790 *5F208CF44FE36EE388E295E0001EDF8DB1890603 q+2j
914,142,791 *5F2710BE9526F19A78E7303E6501B3653FBD1802 [email protected]
914,142,792 *5F2B2AAE63DF354DDFA851338ACC71F0F4080803 tareq.moin.udden
914,142,793 *5F27BCEF7D3D07576F5EF60E799287D389FC8568 TARTES2
914,142,794 *5F2021CE0A42A713F7927DE97414EB154FB023D4 q------p.~.~.~.3b<-
914,142,795 *5F2556CD5E24E18B58474346CA954446FD894997 TBLPR
914,142,796 *5F265019C51627FDC424F6245BF0003008D1CFAC queeselamor(voichesapete)
914,142,797 *5F2791D62B169ADCAF07656D4D2DFCAEA88A2E79 quentinflagge
914,142,798 *5F2E64D72C1B3D2D6228BF7217009151C04F002E QUINTINISERI
914,142,799 *5F21E9B403DB00177DC542233DD9B693237A98D5 R3F3G4R3MOS
914,142,800 *5F274BBCA4C54B88B9E64171577BF8F4AE50CB86 TERMINALIACEA3
914,142,801 *5F2E65CFFE5527EA65F0D9769FC17F8D10DD763F R3p0w3rn9
914,142,802 *5F21D4C6B171B55E9844E9613601252223F4D397 [email protected]
914,142,803 *5F2E67B1C9F83BC1321D954D22B96BA0D82B29BA r4nke$7
914,142,804 *5F233A7939E18C16B750AE2851C95FBCAA82309D testopstelling?
914,142,805 *5F261187672B610AD9D798CF65D1AED29D6E06AF TFEATZ
914,142,806 *5F278FEE1B83CFF175A7DCE7C095B70D50E5ED98 THAEAGOO
914,142,807 *5F2E11C3209A5C0A26B980F13D27771A28F59A8A RALPH.APOLINAR
914,142,808 *5F2C110D13959477A1A0C7F2A0D6C65D5705D0A7 THANHOATLEY
914,142,809 *5F2E10CC03D03D509152EB888061B1A389EE5431 ramonia1
914,142,810 *5F261E9536BAC2F64B04190B6DC7AB8D286AE8F1 RAULGRIGLEN
914,142,811 *5F241252EF9ED3FCB7DEBE81E25537BF48B32DEF THEJULIE1990
914,142,812 *5F2C58F40F88374A6097ED768C7B053A42BB1355 razan.maher
914,142,813 *5F2A0B4D313C998E58509A26D163E4D12C7C6EF4 the moments i couldn't save (hajas mix)
914,142,814 *5F28341C9AD548BC6183C4EF125CA4EAEAE2BF45 REFEOK0001
914,142,815 *5F2C7670036BF3197EA6EA2053A19CECB3C13EA3 thuliumed
914,142,816 *5F269F1B8B9A91A13DC39531176F6CC7C7D968EB reinaldostilner
914,142,817 *5F21B8B9984E84FC2A1F3037CF4096DEB2A5A090 RELLCARTER
914,142,818 *5F2D0BB58E76A835CDE2C230F3940CEE3A64F4B3 TIMMY.SHOTO
914,142,819 *5F23DEC00DCAA7D631853A3C7E5F822D1271F32F remediably4
914,142,820 *5F25916FB4329BC6EE9F2B397EB072D8E3C3117A RENATO.CHIM
914,142,821 *5F2D602806F8449A9906CE596DE6254F9B7F313E [email protected]
914,142,822 *5F2B7A5D3E3E18289D34DB0B69784E6EB50F848B RENOUAIENT
914,142,823 *5F292DDFD72B000B6A1288AC320F81F0AB569668 restacked2
914,142,824 *5F20FDA446E5E5A522F380CA2AE4683F2E8479C1 REX.HLYWA
914,142,825 *5F23FCF8EB54379366B2710A30187A41F3656FFB rey-cabildo
914,142,826 *5F2075F6D32FDA5A7BA26E47E732F46CF46601DC [email protected]
914,142,827 *5F2704487470AF0C2DDEE7311B883B0F669E2800 TOMPANITZ
914,142,828 *5F291F1C7565A79B9ACC18E60FEBF11A727607EA RGALLONS
914,142,829 *5F23665294F246FAFB3446577E4E157A5BF659D1 TORMINOU
914,142,830 *5F29283473359CB2EE6A16C5C5186512EDDB3FD4 tracy.sallgren
914,142,831 *5F238ABFEBD0E878E6BB7CE50BC79DB44EB559AE rijmelarij5
914,142,832 *5F2F9C393D9607AB11BD92AEF685E89CE6E34C9F robbodiroga
914,142,833 *5F2316771792BD58CFD7F2FD7E8F64074A270373 tribunal-penal-internacional-de-la-haya
914,142,834 *5F2F88F1BDE66A19133CF5B17BDC913CBBFC3794 tricronomate
914,142,835 *5F22AEF88E87E67AED4A4D522FAE77E0F3C26917 TRINYTA-PURNAMAWATY
914,142,836 *5F29E4A9F50BAF20F6A4BBD1666A3849872D40ED rock-band-playing-up-a--storm-in-america
914,142,837 *5F20ECFCEE77233844CF4265C9AA9082B705A980 ROCKYTEZAK
914,142,838 *5F235F84E5DAE4D93A18BE21E748227256407AA7 trnavtri7
914,142,839 *5F245BB303379110D201D20FF8440B64C687C3E8 TRUMANSACRAMENTO
914,142,840 *5F254242D181A1FA998BE57E0AC26F19654B5418 TRUNIGER3
914,142,841 *5F25C7078CEF3A42C6F9004F79032D2471F7E613 ROLANDO.BEHEL
914,142,842 *5F2B912C8183679D5E5306BAAF15FA6710E8D909 ROMANSHANTING
914,142,843 *5F259C605CAF13AB634B95287BEE54B13C79A525 RORY.VANHOFF
914,142,844 *5F28FE4C61A44AF77CBF6B4C6CFBDA91EDA0216D ROSCOE.AMINOV
914,142,845 *5F276EDEE223AC07728A9203C2BBB5052EB6B58D tuschestein
914,142,846 *5F26437CD1F0B8FFC0D3F2B01078929CF8827763 ROWENAPARCASIO
914,142,847 *5F27F7437D9E5032DE9C8E8CA1EA79B325C9E328 [email protected]
914,142,848 *5F22223E386F166999F26D93E82B757227F3A24A [email protected]
914,142,849 *5F2C776B4F2529905762861F414C96404E17A760 RRENJADE
914,142,850 *5F20E402E2D5596D6BE8CD2208B739C42E54A0C7 TYLERKORNN
914,142,851 *5F28C90AA26F80E5A608A17F63C04784AD67D16C TYLESSIA.MCKINNEY
914,142,852 *5F2FA140B20852AF7AE0BA1F2C9F8E2A7F9BD3C4 TYRA HILLSTEN
914,142,853 *5F2EDDF8FD2B577357FD3C83345A5B15F6993519 rtidaoccidental
914,142,854 *5F2ADC22ADA4370AC68D52219590637C48782FA2 rudyvandorn
914,142,855 *5F2A997B00F922A49DD1F48205CFDEFFF0EEADB5 u5h3rng
914,142,856 *5F29F7E6D6FA84D9A8E00DFA5E22C5748FD36AD2 UAFV1914
914,142,857 *5F2820CD082394259AE6FEDDA7781A68EA7688E3 RUMPUZ
914,142,858 *5F2DB1FA6FDC2F050049FD67F925A8AA02DAE34F RUMSTERST
914,142,859 *5F2526BDC7C631D62B295EDE1028FDC7674B1975 RUSSELBENOIT
914,142,860 *5F2948CE7906DD3743DED99F7CB9FA402FF3B9CE UKINDER9
914,142,861 *5F292A1CB81E04C5CB9069907CC51D43D818FA11 UKORIV
914,142,862 *5F21C1422A5388774F57F3F8E2BBBA7D83E255B9 UNBORN
914,142,863 *5F240C6B891CAEBE2ECD7D684DC5693AD3380637 sahiyar1
914,142,864 *5F287A70188A612D7E56E2783411D739FB9AE6DA sakashit2
914,142,865 *5F28FC48547D00D8CCA309B22122213146660825 [email protected]
914,142,866 *5F2CF5931AD7EA8738C201B788BC6A61B3F4FDA8 UPWSDELIQZ2
914,142,867 *5F2283C90718067DBA1BE7FC421C6CAAAA172F70 [email protected]
914,142,868 *5F20C09E7141A97672E96D76FC26BAE8FA1E3AD9 santiagomassengill
914,142,869 *5F2994DB3851CB240ADBA9E578529060BFA32C5B SARAJETOC
914,142,870 *5F2BCFEC07096F63FA55FF3F75765458149EA105 /USR/SRC/LINUXHEADERS263224/ARCH/ARM/MACHFOOTBRIDGE/INCLUDE/MACH
914,142,871 *5F25ABBFEC586917F593902B5C7B58CA5A3A6B0D UTAN GR
914,142,872 *5F290219425B94D2F81E2025DF6D84688F806F10 SAWEEPAT
914,142,873 *5F2FAEDB390FF07C8E957CD405F3B4342474FE93 U_V
914,142,874 *5F28CC4D3D2FDF5CB532E9ADFA98F71240F71848 SCARLETTHUNTER6
914,142,875 *5F2850550EC1C3888AD1C3459C132465B1342349 schickshih1k
914,142,876 *5F2250ED591130A86910E107EC34CA1521E215CA SCHNGSCHRBD9
914,142,877 *5F2C2563AE9EE804161473DEF6697660CDB2A17E SCHWERY1
914,142,878 *5F29D594272D3F040D962E2D383F74C6ABA6483A VALKENAARBSW0
914,142,879 *5F297416CADC56F1F86822CED0DC39C52B7A6C2F SCRAGGLIEST4
914,142,880 *5F2A49EA7F456699901E4ADA73222AE8A5555918 sdcarlbsw
914,142,881 *5F246B7267702344474156C00A2470D919010EFB SEABASS592
914,142,882 *5F22CC206E023C0A1C36D8F76AB4F95A8689AA76 SECURITYALLO8
914,142,883 *5F2FD1E440BBAF5442B50A5EC481FE04DD02E49F vay.can
914,142,884 *5F2E82609978BC00535BD1A0069801DE7D593438 SEIKCOLLIH
914,142,885 *5F225718FE09029761C4E98ECF135C03CE8AB4B9 venetia.mabasa
914,142,886 *5F2181A2A5D2EFD5D23D92910535E1A17691F1F8 VENNYTASUGIHANJOYO
914,142,887 *5F2F8B617F4993B3F391C49F2F11CAF1027B1B1B ventesljferne
914,142,888 *5F26EC1AD3C55A957DAFFB93C20EA3846F901345 VIET TUAN DO
914,142,889 *5F272E61FE09284F166399AA25EB63F0EE9F916D [email protected]
914,142,890 *5F2990E4B26A36CA28E4D9D1591F150C2F3278E4 shaungoombi
914,142,891 *5F28302BC0A8570173BE2A7E34F6B02CE06CC6CE Violin Concerto in Bflat major, Op 4 No 1: I Allegro
914,142,892 *5F27EA03FED393DCC7F33CCD18EBF6E835391FAA VIPURUSHHAAN8
914,142,893 *5F2189679CE8FDDFC367AC9D11545D2F12C13324 SHEREMEEN
914,142,894 *5F2C39BFE923F507FA258AB0B5F5FE8508A0284C VISAMINDAANTONIO
914,142,895 *5F22EEA6D92A7533D14683F51F648D2F35FC9D8F sherwoodsarria
914,142,896 *5F26FF029D2A85948F55AE3038410CC3891A7C23 SHERYL.ABAYON
914,142,897 *5F2BF25F9D5768C66362312F37ED45579EA80F0E vitohartgrave
914,142,898 *5F2B56034FEF9D4B23C8F03EF3974ED79655FF02 VIVIANE NEUMANN
914,142,899 *5F2213D0D8136D7026CF7E8EC3E995BBA7D36EFD VIZCACHERAS8
914,142,900 *5F2335087188BB8382DAC1B583178C6A2C84B80A SHONUFF,-THE-SHOGUN-OF-HARLEM
914,142,901 *5F2FA5B91D684FCCBE20D14A3CB282C454E76574 shops77comwww
914,142,902 *5F239C36321F8D8CB96F481DA6CF21827AEF51F0 SILASSTODDARD
914,142,903 *5F2F4DE89D2C8E6A9DD3EBA32D681032E2EEA9DB SILNÍCE
914,142,904 *5F2A07367479318D04B31CC32894A3EE8C25FC18 simuliid'-'simuliini
914,142,905 *5F229E8EDE17F6432C1F748C4E6E06D851176397 SINYOTOLOTOLO
914,142,906 *5F27B2D6FAF81B5690EB152E67EFC3BC588DC5BD SIVASHANGAARAN
914,142,907 *5F20B1DF4041A5F829A4E31D5C51EBFF9637B450 W!9M4K3RS
914,142,908 *5F22AB0813F70E362B58F07102DC2FF88586A1A8 walteresteban
914,142,909 *5F2842788F97BE511339ED5F12EC72D8DC4025F5 slordigheden2
914,142,910 *5F2FB5F7FCDBD4B0242F38B9C838C9DB41415DF7 SMAHOKOTO
914,142,911 *5F2BFA0553D802976A23D09184EDB87DF1C19212 SMIDIGG
914,142,912 *5F2BD9CCAC7B7D8C81A962A203C897C584A361E8 sm?t
914,142,913 *5F2BA86DC1FED94B1ACC8F258BFA8C2B20FD0884 SNIGDHA1234
914,142,914 *5F27E14A8CA6088160D2654C8569DD78ADCF07AF SNOITNACED1
914,142,915 *5F222C759755B9084A18DD618591EE1751E90155 WAWAMANUSIA
914,142,916 *5F23E2F873E2FEE4AD0824CBC109741E5D3400D5 SNORELPI7
914,142,917 *5F2AE8DF55A35B90EA18DA8E78DD087DD1A04BE5 [email protected]
914,142,918 *5F2732C624B44B132E1D4883B3741ECFBA6FEA27 WAYNISHAA
914,142,919 *5F2A4D675465934F7ADACC59DFC497209ED6637A WAYSIDESOARINGSTRAIGHTSTRAIGHT0
914,142,920 *5F2139A8C76E29301C8B7C0FD624CFF4F3E03886 sokubuts2
914,142,921 *5F27B51F47CBF71333B1AAF17659405577D4F66C WEAREALIVE(DISC1)
914,142,922 *5F2B020982A48B0D6831D7040375852264D2788A SOL.HODAPP
914,142,923 *5F2A3AECAFD0102B9F4A98A55ED11E9202B15DD6 sommerbundesjugendspiele
914,142,924 *5F25855C90E1155EA19FD785824C6F063DEAD045 [email protected]
914,142,925 *5F201CF61D446895BC06DB139DF6F22A19E16F12 SON.ISAGAWA
914,142,926 *5F2059B971521E627E8D5C53B1D7543496EC5169 WESTONHOLMGREN
914,142,927 *5F25E6EF2FD7D189C73C5F62EC2864735896AF7F SPEWINGSICKNESS
914,142,928 *5F2AB8BEE4D8685D0FA8F121B2E2B4CEEE010CB9 [email protected]
914,142,929 *5F2A215D6EBDA167B46452662BDE4D0FCC913B06 SPLENDID FELLOWS
914,142,930 *5F2B79E4E11D7E084AD6B22E68E1D21A92FAFD14 sploit`q----p
914,142,931 *5F2F80E684D8101DC25FDA74B6489FEE1C9C3444 WILBUR.LONGTON
914,142,932 *5F2E818E3E0EEB4A73049816CBD8A33C143E857E SPOTTED.WAS.NOT.A.PROBLEM..IN.MS..CURRIE'S.WORDS,."THERE.WOULD
914,142,933 *5F250AC04A621802E78B459F2F261D0786AAFF61 SPTEMBE1
914,142,934 *5F28C2EE16B7481C67C5E591438D3BE22EDE5216 WILLARDOLDE
914,142,935 *5F2A924D823F4057AAA3CBF916EF5200B29287CF [email protected]
914,142,936 *5F22C3EF9028C1B08A9132C338CD06C432FAE14F WILLIAMTOH
914,142,937 *5F2EA8286FF7C5C060A139118D207D6256BAED93 WINFRED.DELUCCIA
914,142,938 *5F2FAD3E1EC7FBA4E590FC41607D351F2637C057 WINSTON.COBBLEY
914,142,939 *5F2A003FF1874BABCACC26FBD7932C9545B3BAB2 wires-and-wood
914,142,940 *5F271AC5C355124E75BC90E84CF9E8BDF47BD542 [email protected]
914,142,941 *5F2CF8B08BCFFB0F19545227E72F4B858B1682B2 WM.DUNKIN
914,142,942 *5F23D5C23A5F7AD3AFF3DB9C3099E1962C81192D wna-n
914,142,943 *5F28CAB21D41B203603682E3BCB79465749C6414 WOEOUEIYQ
914,142,944 *5F28431C98FB47CBA7D7F5BDDB725AF4905213EB WORMSEED-OIL
914,142,945 *5F2E7DAF39B46218EB5894A615948CF05ADD6489 [email protected]
914,142,946 *5F2FBFB4E06E5FA588527987EDE7586A39341F08 WQ0WHJFJ
914,142,947 *5F282B48FD1B5FF8E1484E3ACDDE3392F759D995 STHCEREE.
914,142,948 *5F2544D4C5C6190E09845C125D6CF6A78CA9127E stievenbsw
914,142,949 *5F2C4F30545C16FCC95F04A55DAC1DD9D50DF8E8 [email protected]
914,142,950 *5F27475E33D5EA92E099D20CDDAB2357084187BB ST-LUCIE-AIRPORT-PAYS-TRIBUTE-TO-COUNTYS
914,142,951 *5F20B25C700BE5896A4888E53BBAF9D4F87DFC8F STOPPERTJE7
914,142,952 *5F2ABD8E3F483FC75AD2367F6421BB0FE8A97148 WWW.ICEBERGLABS.NET
914,142,953 *5F234080AC64308606C404A32345C56CD4AC4595 WWWMINEHEAD-ONLINE
914,142,954 *5F2999AE5ADF2B5F3D6BE0842698576661E52D05 WWW.WARRENHOLIDAYS.COM
914,142,955 *5F29337A110175A4081CA1CE50577D52D7EE2C4A [email protected]+1ONS
914,142,956 *5F20048869529540C5F8BF6E8564CF260AA4A3C8 SUKHDEVJI
914,142,957 *5F2631EE878D560B63E1CD7E2F5EEE9BE95D65FB [email protected]
914,142,958 *5F29B431EBA9B548833108FAB775840D02B65F65 SYLLIDS8
914,142,959 *5F27BE64030252EFC6052E2CDD7502095EBCA899 yanemmanueldube
914,142,960 *5F2803C593EB2991557F7554D7DDF92BC5D6E517 YANGSHUTI
914,142,961 *5F24D70E8FE904AF32AB4BDF2CF3074588025853 t3a$31 cu
914,142,962 *5F285A04794CA1D052352A20AEAAC77E69B18CC4 TAD.ALLSHOUSE
914,142,963 *5F2404C377E1703BBB7D611B3DD8E06859418045 YHAELDELROSARIO
914,142,964 *5F235D8A74997EC3D6FF5DBB8F009F81DC5BC8B0 YHONNY.RAM
914,142,965 *5F284DF5822D135B35171CAAD807EE44A53B3C8F [email protected]
914,142,966 *5F2D95B8BCF6FB91F1221BC97599855B0C935782 YKSIMIELINEN3
914,142,967 *5F222DEFDD431720FFF2E29247A7F56A50F659D5 ylileulb
914,142,968 *5F261A25B5F8C0AC4828C998FA628859D757B2E5 tannerdashiell
914,142,969 *5F25CE494DA887CFFF5B6E14DFA7A3A6F26911D0 youkman.kwok
914,142,970 *5F26AA2A20ACD33D225E7E4DF2690C53EB0A1E3A TCCT:RARARA
914,142,971 *5F21D817916C840BDA306B574B88E9141A26FB6B tcrabc
914,142,972 *5F26B598F8DAD9D214438A44D1C4DE71FD70B93F yuthajaksaengsarttra
914,142,973 *5F20E7E31C1FD705B8774B4B112D3433C522BA58 TENTELIERN
914,142,974 *5F28D78557AADD3537C7380F26C081F505231BFA teodoroschoeneck
914,142,975 *5F25B8B78085F18932498C37E22789C1F7EEB351 TERATOLOGIC123
914,142,976 *5F2D580D0EA04D9EF100D575FA4D44ADF37E0973 TERRANCERANWEILER
914,142,977 *5F2D5D34DB8C4507A6BD1864A7EC36F28B67FE06 zackarycondry
914,142,978 *5F2EA541CB218F995D5634CB59FC417F8B5D1CB8 TERRY BELBIN
914,142,979 *5F2C4518063A4D2DB3C591D47E3E6B7213E7D3C4 THAICHINESEBLOG
914,142,980 *5F24326ED9E11603D08198D1FBA7A202409CD0CA thatfreddie1998
914,142,981 *5F2708DFC85C7185E44B847C4CD43861DA4F4B2F THEBEER2006
914,142,982 *5F215E82EB9BBEE3103A78D70FDDE7265CD5FD91 thebishop66
914,142,983 *5F2BAA486FF4A2722857249A4558FB6FE90285C2 [email protected]
914,142,984 *5F27ED1449185328E69BA70629276FCF11F1BC7B thelostson(thebrotherslayer,partii)
914,142,985 *5F234BB57509CFCC975F41F7F021552F4FD48DEB [email protected]
914,142,986 *5F23247B8C824DFE27645C142F447005E6B91BB4 the most noble
914,142,987 *5F23F9E04AD5AFF432EF26FCE1EFBF73E7A54D84 the-reflected-world-is-the-conquest-of-calm
914,142,988 *5F23F67E9C91D96093DA65612DB8852789AD27AE zoeschamehorn
914,142,989 *5F288AEE5BD755C137B5AC15B5E314FE5E35E10D THINGISHTHINGISH
914,142,990 *5F27170935A27ABD233B5B61780EA3EE3B1A888F ZULUP 1
914,142,991 *5F24BA0F3F96E7BC8F4F6B4C0AE740214297B6A7 THOMASMCLEAR
914,142,992 *5F25497806CF87DC27061B0A0DF599C088A59E35 zushihgong
914,142,993 *5F20AEB7B200F4BDA54CECB8CFB3886492F19321 throwing him into the water will do him a benefit
914,142,994 *5F26082C4C115323596B9FC645A7AC880D4EE0D7 TIARDUAV2
914,142,995 *5F2F9643BC8F925DAE2E09D1AFE8BD594353D74A TICAS-DEL-GUAYRA
914,142,996 *5F23145E490F9376A67A8DBBC468A8C3DAC79B34 TIGREROCKET5
914,142,997 *5F2C4E4CF07D0315741E1678B9D3876CE0A8B52B ΑΠΟΣΧΗΜΑΤΙΣΜΕΝΟΣ
914,142,998 *5F274B6BDB24D07FEEAF0EA51FD06CF6F1BBF700 ΑΤΡΥΤΟΥΣ
914,142,999 *5F2222F1118219A6DA8F157E3F29DBCFC60117C4 ΙΣΤΟΛΟΓΊΑΣ
914,143,000 *5F25C6F73E9B103A4029330DE2D462E5A96C4923 timonell
914,143,001 *5F27BEF873A446EF319306969560B65EF3228124 TIMOTHYGILCHER
914,143,002 *5F26A4FF248FCB150527F673E4A26E26008C6CE7 TINAAMORE
914,143,003 *5F2FCFE8EDE28E663E4E51F65805E75C6F3405CF ВАИЛУ
914,143,004 *5F2E901948C9B2FDFB0B6EB1B3587B98C2EA4203 ВЕЛИЧА
914,143,005 *5F2B38BA9F447F4DD7D79F7355CDABBBD921266C «ексімнафтопродукт»
914,143,006 *5F21884AD53615714BE4734BA629D548EF31D7D3 ИЗДЖАВКАЛИ
914,143,007 *5F2DF36EE3F856B440BCCFA1C192C2F994258600 TOBY.BARSON
914,143,008 *5F2DB7BA30BA2E9FC96F48A08079F30733D1B7FC «ЛЕНИНСКОГО
914,143,009 *5F21C65431C0980094D84B5E0DDA26819EEC0378 МЕГАРСКИТЕ
914,143,010 *5F2F23BB5F358F6982DCD3F3C33C97177D90DD3B НАДСТРОЯВАЛИ
914,143,011 *5F2228D936667BC9FDA71EA26EA5EB4446B91A27 НОЧКО
914,143,012 *5F2BD65CD8A9D126E6E5B5B73CA3144A54EEA8C2 TONYPEACE
914,143,013 *5F209120D449BD9BC586D97582D582F82DC175AF TORRINGTONW
914,143,014 *5F20728B1E1D96F61283B228EF50E4B82046C7F5 TÖRZSTISZTRŐL
914,143,015 *5F2D0A4D5F1F9409C94C180DEB351E542D33C0EB towering-is-the-confidence-of-twenty-one
914,143,016 *5F2ACAB0787D4F222A2675A2E0F928E74EFB235F трихлорнафталин
914,143,017 *5F29993275BEE6BA405F2063F1C26D82824DB2BC TRACYARRIS
914,143,018 *5F28B3E1AB6C7BF95BAE2AFDD1F0983CCC428AAD ФИСКОВЕТЕ
914,143,019 *5F2317509FB1C73960E3D0033F631F96E314DEFF чемошурка
914,143,020 *5F2776C0E61EAC6F9F41BE882BE496EC7A8417D8 TRISTENPLUMMER
914,143,021 *5F218F0DDE61238A1E4D984CEF534135E6FB70C1 TRUSHANTMALADKAR
914,143,022 *5F29AB795243F4B6F12D9C3CB68B0E8CB38E43A1 TSINOFOXASRONETER
914,143,023 *5F23637B90FC9F558CCD76AA2B3A7966FB268F1F TUETEZKIED
914,143,024 *5F2E778CEA223AFAB6F769CA9384BECFF2CDB440 tulasi-horsey
914,143,025 *5F25C94938F54C676E8FA8C0862DB73BF7A70E5B [email protected]
914,143,026 *5F2D8DFD827C671E7C90E20030B85569C548F007 TWBLACKED
914,143,027 *5F2672BA7FF97618458916F3780593FB1470CDB5 TWQDCXNANAQHN6
914,143,028 *5F22B101C2D9D201BAE239EE417526547A6864D1 TYJUANMATHIS
914,143,029 *5F2284981DDEEE37037414561E0ECE602165AC8F TYREE.DEFOREST
914,143,030 *5F24D94BF41561B49D195C19D0DBF0C72795B45D TYRELL.SKAGEN
914,143,031 *5F2C1553C09890A573ECF6C8B4B94047D3BEA041 TYRONEGAMINO
914,143,032 *5F2C1C420DD56B751B037AB16B9E68624F2AFE68 TYRSENI
914,143,033 *5F27943FC9DA3A563763E9A6CBCF18654F05DA1C (00).O~.d====B
914,143,034 *5F2B20DAAA504DA22139DC539BCA5E4CC60383E3 UHMEARIKAW
914,143,035 *5F29AA5009DCAC2F481453642DB6D93519BBD532 umichiganlawlibraryinterior
914,143,036 *5F2D02F029A63D371FC5899BC7F92DE04019AD0A UNEVADING
914,143,037 *5F2A6668B0458A864429B821DE559C3B84504B31 UOBMEXUL4
914,143,038 *5F239A20D29B9ACB93FC5C78FFC8F71317F75E49 uok!
914,143,039 *5F2B2A1A314130800345EAC74FB159DF758E9B7E UPLANDIDAHOCOMWWW
914,143,040 *5F252A1453FB617173E79EA266F2B203747A69FA USHINESSING
914,143,041 *5F241A73D6CBA136B3F64C17B17B4016A7AE9F78 USTONITI1
914,143,042 *5F2859BEAE7019A1AB791316BA3FA67CF7C22990 UTPADONANT
914,143,043 *5F2F390CC4227254895D9054A4A35C62B30A2B7B U}U'
914,143,044 *5F2E1E149F4D4383DA12D1E3E8D71FBE6E19F54B 16ajastimella
914,143,045 *5F2B0E9B9C9B7F28EC2A4FD6F827E9F7C5B0CC0D UXBJILYADSIVFFQ
914,143,046 *5F21B98E39B3099F6DCD2B499F734656D77E276F VAISAKHVISWANATH
914,143,047 *5F21F60E8FE8B4F8589A2809639A9700ABC4E1D6 VALECNICKYM4
914,143,048 *5F267A31EB1949323E8F3A1251B3136662367464 VALENCIASANDERSON
914,143,049 *5F280849C295BF370BB9668AEECCB6EA0AB89699 VALENTIN.CAPRIO
914,143,050 *5F297CF0C6F1E933952225CA782A9D2332878F13 19962911
914,143,051 *5F28DD20C36806E74F0F87D1E6DA90FEF89E20D1 1-bcg-direktor
914,143,052 *5F210F77BDD93749914CBEDCE77432F5D980E2AB varunsextremehindutvastandcostusvotes
914,143,053 *5F2FA9989BC8B6B1B5BA24D6F2F0B629F0610BE8 [email protected]
914,143,054 *5F20FFF59A57BC94754DA904EDBD4E2AD4787518 1--<EM>SHORT-TERM-APPROACHES</EM>:--THESE-INCLUDE-APPLIED-AND
914,143,055 *5F2F026FB2F8AD105E3ACA2725033F50882DB334 1ENKNOPFE
914,143,056 *5F2F2F4FCF18DCB0B759FD65BCE03A783CAA795A 1.FERNSEHFORSCHUNGSCHEF
914,143,057 *5F24A7391D9C9B4AEC9813154FBEEB496E03D81E 1 HERUNTERZUSPRINGEN
914,143,058 *5F20717397BD731441105D2A1A9C87D55DDB0CA7 VERMONTJKM
914,143,059 *5F2B242636C11C0E82FBA3974C32B2A48542E91F 1 KILROYMATKATOIMISTO
914,143,060 *5F2C5136ED89CDCB3E4E07D464043EF48B1964A4 1 KOULUTUSASPEKTI
914,143,061 *5F2B583010675E02EE647F5C3A887BC062F1F28A 1.lemelson-mit
914,143,062 *5F2E38F43C52D05CD9D71798949283FC533A9242 VICKI GRAHAM
914,143,063 *5F251F6DFE0DB33E47383401C3795B62903B58C5 1 MEDIAWEEK
914,143,064 *5F26DDE4CEDF7A6DBC8A3C74C40A1BF2A261F344 1mymariner8
914,143,065 *5F2DEC87401FBEE1C1F21837F241D1CE713303DA 1OM
914,143,066 *5F224C4570BD25F240A03E3F40BE7361D8233DCF 1.palloiluhistorian
914,143,067 *5F23BF399CF576009F63A400F4AB1CFC8601EA22 1 PARADA
914,143,068 *5F2611D9EED8D3D2A0999C580BEF64D0298FCB05 1Q2W37300
914,143,069 *5F23EBE601D165593C68D2A3AFDA617EDFD57991 VINCE.STOCKLEY
914,143,070 *5F2B23A9FEAE09E197ED3C5746DD706E78703F72 1STIMMTECHNIKEN
914,143,071 *5F20A09CE54997CA477CC375B14BCE4FB161484C 1TAGUNGSABSCHLUSS
914,143,072 *5F2D2182E381727DFDD9589158748F9058AE9817 1-tilityserittelyt
914,143,073 *5F25ACD98637C94B85CDC3E5BBAEBAB47B64E309 VOICE-OF-POWER
914,143,074 *5F24622654E9D182C6B0F5E622353F68056FCFB1 vonjoviabubo
914,143,075 *5F222D33E19892314E6156C35AAC7791A1014E23 VONPIOCHE
914,143,076 *5F235B40222AD8C8A4842E47AB73C5050B56623F v/q4
914,143,077 *5F2535E050CAD4AA776DA18377492AB9231BE5B9 2006SPRINGSUMMER
914,143,078 *5F2219EB7EB70413C8E9C337C2E08B642ECA97BC vshsenate14
914,143,079 *5F212E7A7579FD852D97C1A72FF6526A144D1FDB VYLLACITSUACNON
914,143,080 *5F29421B1B5AB28894BB2771A9A8F7280A89E751 2386301 ARMUT-,-ALKOHOL-,-ARBEITSLOSIGKEIT-
914,143,081 *5F28B7439C9FB7D1CCCF7C1F948EF802257AE3FB 2386745 DIEBANKENZWINGENDENSTAATZUHANDELN.
914,143,082 *5F21D946838DC9021829218D82F2141E8DD30395 2496425 teknisen johtajan p
914,143,083 *5F283F91B1455B324DF75F4AB515F9395BDE07AF 24JANUARY1147
914,143,084 *5F2E69C1D1856F374EE24151DE4725E085348309 WANDA-PFALZER-AMARI
914,143,085 *5F212AA50630618EE8F7B63860D86C73F2925ADA WARNER.HODRICK
914,143,086 *5F293D68B6980B6A30707EEC2CFACEAE88E6E365 289kaley
914,143,087 *5F2F79A1668F58929DAFFFDAD1FAB59FD3C43A79 2REDNALOP
914,143,088 *5F2ADF5DE3948C13777B099500DF32CF4E8D41F4 WESLEYPELETI
914,143,089 *5F228BF3B69E9E2D2A88E1F578B31396A8769180 2 SOPUPELAAMISEEN
914,143,090 *5F2A2C437AAB04CD90C9027F82047921617D3926 2TDNEHCS
914,143,091 *5F25E5E9088B8732CB3C19A9D1012D92CBFE08E7 2-tgs-verantwortlich
914,143,092 *5F29A771F0E986215BEAEE745852A4669812745D WHAT_A_MESS
914,143,093 *5F27F85DCC9EE6946DA88DDD01029721945CD7BF WHICHAREYOURHEROES
914,143,094 *5F27BB6908932537AB9965A7A6E62CC8B6479331 3>~0~o}o{
914,143,095 *5F2F14A1AE283F9627C723B7485DC9F998BDF2A3 3FOREGIVNE
914,143,096 *5F2E47E3ACAC863097E9FA3A3B4F21F560005EF4 3iammarie5
914,143,097 *5F27AB95B14DD556CC3FA1E3DE53A4117808A623 WORKING.MY.WAY.BACK.TO.YOU
914,143,098 *5F280878CD6FD412E63FB636DD87FF50919EEFDF WRIGHTTESTTEST
914,143,099 *5F2D8BC1A44D6A600833376473DAF7173A076C91 408936 verkaufvonmuzanmalayischenkonzern(dpa).
914,143,100 *5F2D88217779678AE5F80ED2CF1A8ABA669E04F7 415033 BESONDERS ATTRAKTIV SIND DABEI BUNDESWERTPAPIERE .
914,143,101 *5F20EAE2455854D6FEE3ED5065FC19CC69ED4415 [email protected]
914,143,102 *5F2C43C138B8EA2F4C3142FB5792969660F84FEC 46alia
914,143,103 *5F2A487512A6C5BC226518E9D9A079BC596F0041 4DOORDRIJVERS
914,143,104 *5F25A46D67295AB9FD0399D89A9C0030B535E5D2 4ENILHSIF
914,143,105 *5F2DF5DBCDECEB0D4067823893B0A76DE010838D 4ep
914,143,106 *5F211EB176B16FE04B8D8E71C60A8D1A7B2FB21F 4.goelzer
914,143,107 *5F232F4F0A207A2970316F9C082C5D7BF2E63A2A [email protected]
914,143,108 *5F28191C035ACF419911E408D5C02BB8F2D3C137 {x}~.`.d3
914,143,109 *5F23CBB6FD1970BDC2E3332A12350E61E1C08725 [email protected]
914,143,110 *5F2D93B86E9EC3CF0DCF3A931362CC6B68A93F21 XINJIANG-TIBET
914,143,111 *5F22DF1926A11A29B1CC8B77902F74DE14B4B82E [email protected]
914,143,112 *5F28D68C69996B1C1A85BEF98B5B4885C0075703 [email protected]
914,143,113 *5F2D41B37FE537BE96856F02B94E76A446D3E32B yana.jo.kappis
914,143,114 *5F2162637DA51D52C0929FB0E5EAAA765F8C5481 YANN.CHAUD
914,143,115 *5F2D518761771A9164551A4D042E08ABA671D787 539673 ALSO BEWARB ER SICH BEIM ROWOHLT-VERLAG .
914,143,116 *5F2A42C58ACBDB5AF51595521C35DB12FBAC1131 5BROSSURANDO
914,143,117 *5F20DC8BE43403210CB8522147CBA8F81C5A54E4 5BSWNETOPRWA
914,143,118 *5F26FAEE483635EC42030F6D9C2996DA5E62DD37 [email protected]
914,143,119 *5F2886EF5EB69E45255A319B12ECCF27A0BD6E2E 5ESPANOLWAYNE
914,143,120 *5F2A406AD4E0A15E130B08F653843898FFC80E44 5ETUDIERENT
914,143,121 *5F2F2CB61DD51EEB5CCEC0F65D95AF8888DCB9B1 yogesh-nerkar
914,143,122 *5F284650A633C4AFEDE126B862404E3D87143B08 5FANACHT
914,143,123 *5F22DD16FE33368EB286F12B073B9F60FA5C7412 YONGGAMANTO
914,143,124 *5F206D8A73A891D8D1FB31C8931F158F188D097A YOU.MAKE.IT.ALL.WORTHWHILE.(LIVE)
914,143,125 *5F2FD1C964FEBA166E94F99AE2306DF6B7A7C4F9 YRREPOLBAID
914,143,126 *5F2593E4EA69C393B7A957C0E61067F8EF3581EF [email protected]
914,143,127 *5F225E231ABBE904285A90A8A8B7D378013A5CC8 yukaghirs
914,143,128 *5F2E1E73EBC64AA6903E416F9C22E2B43F645C9A YUQUILLAS8
914,143,129 *5F290A4D6847B39EFE0AD55000C978E70B0A5C7A 5SERRERET
914,143,130 *5F2A7E7974C1EEE6B67964180355A8276E74F4B4 zach-mull
914,143,131 *5F2DFD5320BC1B9160AE732550F9B589A207C260 5 SPEZIALWETTERBERICHT
914,143,132 *5F2BAF2391A12FA6D851FFA6660525F5E061AC87 ZALISTEIED
914,143,133 *5F24D8A82A4E7DFDAFB7A4907CC180614DD9D036 5UOYNEDAK
914,143,134 *5F27D1B48269FA03DA20B8B15D1455726DDDCC1C ZAPP SOLA
914,143,135 *5F219F22A5582CD3E93EB9B024D9BAEA6AD7BA96 5ymm3trica1
914,143,136 *5F2B0E987953BA28CAEC36D848268BD5C84AC093 [email protected]
914,143,137 *5F247854EEB4DC8D642D8D298D3E531D8804EBB9 612481 ihrezahlerhoehtesichum1,9prozentauf36.369.
914,143,138 *5F2AA7C053099AFB912C070B259664476C8495D2 69.prejudiced
914,143,139 *5F2DEEB9AA2EFEE4D133ACCB3007FEBFCD56BB36 6CAPACITEITSPROBLEMEN
914,143,140 *5F2260A0CA9C8C8BF8E8999A50C2A9449363563E [email protected]
914,143,141 *5F252EAF53BEC421961CC342DC9BBD8BE8101B96 6DECHOIRIONS
914,143,142 *5F22674EB5EE8E34BD7A8212BC815836991DE779 6GARFIELDSHALOM
914,143,143 *5F2A3A4FE62761F4BF8F93F0E581BC0550E8A2F6 [email protected]
914,143,144 *5F20E04F02A3AF03F2B003CEC6F55DB9643FB751 ZOILAROSAPUGA
914,143,145 *5F27D8A954B5CC8720BDADE11621FC13881529A0 zok.martin
914,143,146 *5F260BB3B3343848AC19E4850FAE279BAEE6DB60 ZORROXANADUED
914,143,147 *5F2B1C5B7CDAABA4D373F478CEEA05E3D4D47E0F ZULFAFAUZIAH
914,143,148 *5F2E4A948EA8FE3DDFC9D3360C11AECE2B0B2437 zwan.carzano
914,143,149 *5F279BD8965CD8B769E6DF2A019BBDB34EA11173 zwan.n.uugwanga
914,143,150 *5F2B1F39AD431556933BF5BD9A009AA2185F9650 6NESBITTOCTOBER
914,143,151 *5F208315DC1D56DBFE7E6CAAECDE22E306F0E7DE zzeb
914,143,152 *5F2864BCCEB16E03C11B60C5CB18023E14DD297D 6SPONSKOEKE
914,143,153 *5F208CFCA62396D07020F7C96EACE74492D67A79 АЛАМИЯ
914,143,154 *5F22437BB254BD1BAE86B801CA8A3018F975CB92 [email protected]
914,143,155 *5F2616DAB093ECD45E15C6BE9EF16AD39738CA19 6WOLVESSTEVEN
914,143,156 *5F24B0603527D271BD604D90ABDE04628641B4B9 7.03.1358
914,143,157 *5F261F86DC433CE8A07E8723A12F0B61830E0459 ДАВНО —
914,143,158 *5F28F01096D966A7C9B37AB63650AF4BACF9E8C8 ЗАСЕГНЕМ
914,143,159 *5F216D72392C15DAE2A47657866237F3061F1DFA 7AAGKOMST
914,143,160 *5F21D8A7A32EA5E8C6070443272A7A6D4BE43834 КЕРСЛЕЙК —
914,143,161 *5F2EC12AE2180CF0CCF084BA5EEB1B43008D295C 7BULLSHITROBINHOO
914,143,162 *5F268BA6CAAEE6E8FE36D7F05F07DD101EAED87C мукури
914,143,163 *5F27963612BDACD408962F409C395952DC208B3A [email protected]
914,143,164 *5F251231B9C8BE3C8FECE5BB601D1A84CFDED1B2 7JUSTICECHANEL
914,143,165 *5F26D661F747A60A08D4244FDD899D4B61687FF3 тенисонове
914,143,166 *5F2613013BEFC6EAEA10D2EF50AD002009955EE2 7MARLBOROSYLVIA
914,143,167 *5F2FF3F2FD3C7C800D8AA03A5A9C00740794E666 ШУНЧАО
914,143,168 *5F24081BE28CC36106946A4E39957C94EFA94306 7NESSELROADE
914,143,169 *5F2C28ADDCC82404B79013881A84CD8CC98FCBF1 ՎԻԿԻՔԱՐՏԵԶՈՒՄ
914,143,170 *5F260085599F12288E49C8936DF24B5EED62A1B2 初めて後期版が使われ、これ以降も前期・後期EDが起用される。
914,143,171 *5F24145397F79D86A4ED5ACC9A1BC2C00C2E9A4B 7UCORRADO
914,143,172 *5F22955FBCE1F078B1AC36DE7A1EF5F18B4C2803 7ZIWEVDEX
914,143,173 *5F20D0110DBCA64985E22BB1B5007D8D22876E70 802PORN
914,143,174 *5F2FFCBB16D4FDF542D6067378A8C836F69E603E 84ROM3TRC4L
914,143,175 *5F26CC04DB12B9388493DF675C8B64CA579FAE88 8ALLOWOODY
914,143,176 *5F24F9D9083156EB8F308888A7DB9BA4E244EF67 8--B.*.*splat!
914,143,177 *5F29D95A366774B3155A8DBACFFAED86A3200880 8CAINAMOG
914,143,178 *5F24A9602821813B9941FE4D213DADFADC3DD91F 8.cowherd
914,143,179 *5F2114C8C60FA6740D24151FEB2B3A17218F8E97 8-D***(>_<)
914,143,180 *5F2E24B722DDE034823D7290B5ADDB60269CB57C 8JIRVRETA
914,143,181 *5F20D9509C32E46D094E25C62E5AD3CDFE59468B 8NOLOADERROR
914,143,182 *5F2CDE4B012EA4FD96F79438F56F13014D469856 05B939DBA985FAFA0469868C586ABC56-SHAEMP64
914,143,183 *5F28959535B988D8304EAD6BFF86027AC5A2DCE2 8#P~0 ~O (>_<)
914,143,184 *5F2EDC98174FEDF30B5B1E33F8D77532AE42BDDD 09205486013LHAGS
914,143,185 *5F2A7815ACBD8AF8EF1BB159066CBA147753F184 8UPTURNE
914,143,186 *5F2C4A9EAABB264EBB3EA41DE26095C6FFA43A82 [email protected]
914,143,187 *5F291487A7A2D289B16D0ED69AD26AFA8925C14A 10.TiPOFMANDiBLEi-C
914,143,188 *5F273E362084F45DD83CC75C00DE793D78A48C77 90N4D3CT0MZN9
914,143,189 *5F29E8DF9F7FA0BA1CD67E0F332671986F04AB6F 1212593 vanhimmatrunotlienev
914,143,190 *5F217B3F64810F10512D17A938F623FDB5ACCA04 1237214 IWASCLOSEENOUGHTOPUTMYARMSAROUNDHER.
914,143,191 *5F24146E941B3A5CF57F311D87C9815DF9103238 123kndys
914,143,192 *5F2CE03F7E53A66E4B8BFFE15626BAB74B500C56 1496280 PALVELUNOVATKEHITT
914,143,193 *5F27183475C9EB910C6E0D32711EB0F3CD8A28E7 156tatiana
914,143,194 *5F2B97735F57EE299F9488E3865E224F6816DD8B 17.GRINDITOUT
914,143,195 *5F2D04DE8247C4EE07615FCE32367A57C72CAF1E 19790113ELPEPISOC
914,143,196 *5F2E1B915BAEA7A989BED008848FC077676B7F9E 1-ARGUMENT-WHICH
914,143,197 *5F2212CA477D6B21CFAF8E969C8D3D4E7206640D 9OUTOFDANGER
914,143,198 *5F2C91D35E02AA7AC2F6EFDFCA4001DFD1BC2F02 1.avohoitoverkostoon
914,143,199 *5F2687E9BA4E012BBFB9843A682276C1EAD274FF 9RAPETISSERAIENTS
914,143,200 *5F26E4AB85E316CC3E1615261679EB2684023A07 1BREMCIA
914,143,201 *5F281CEE7A4623C84C91A66DBFA09D52B4E06D50 1.bvbbveranstaltern
914,143,202 *5F2102AAFF20117573F1BDFECA7525BCD4418740 1.cikmazken
914,143,203 *5F2C24FE3612FEC4F48E8919C13252E91939D5E5 1 COMMITTEEMEN
914,143,204 *5F2FAF35DDC6C5C4D53232D60D67298111F41101 9SUUJATLO
914,143,205 *5F28690DD386753056BCD64B7EF568DE0DD62F8E 9theophagous
914,143,206 *5F202536C7746978769397A9489D362433B62BC8 9UNSCOLDED
914,143,207 *5F2AE545AAEFFF090D5025D9AE7BBCCD532DEC50 1-grozenski
914,143,208 *5F2CC23F08C7DC52E5FA1BC0C38C4E5B08F381C0 1IMOITAAN
914,143,209 *5F2A2F1992291D618A3AFF680A211885EF5800BD 1JUHVATE
914,143,210 *5F2A8420F9471E9A067D38907043237F27E062D0 a(2
914,143,211 *5F2604FCAAED7E77D8D8098FB2528DDCA53D6649 a(8=?
914,143,212 *5F2EC6417C72B407DC93DA86728E003A89F564FA a8ol0
914,143,213 *5F208CBA3C2224FFBDB607A16EF537156FD94333 1porphyrogenitus
914,143,214 *5F271F78AEC7ACA3B7BB009CC3519172405585B3 a+a
914,143,215 *5F20E0017287DA5CDC0DFA1FC75A1BC1786DF1B2 1SPESIFIKAATIOLLA
914,143,216 *5F242F3DC2B5F00DDC23E13D1048CD0A3D978E07 1 SPORTFISHER
914,143,217 *5F26EE7D60231774C6A0F89DCD16D3EBD275129F aaa)ok
914,143,218 *5F2FD51100BA16A8CCEB0332256EC191C4C6C180 1TRUIREZS
914,143,219 *5F259DDF681449EDF979876BE36B7AE30E1F6730 AAB%OT
914,143,220 *5F22D304998816736857D59329BBC6AB4F2BF795 AAC<,$
914,143,221 *5F21B7BD6B00DD1011E5B98301AB78E372A41B03 1vedospinnassa
914,143,222 *5F27E7B02661DADEA64087B7652F743781912C1B 1.vertragschartergesellschaft
914,143,223 *5F2DA76581F9D6B45F27016BD28A6D8639923792 aacj
914,143,224 *5F2D7A96728040D8BAF68913693C5B3F959759C8 20101408
914,143,225 *5F2A458A93DBC76E650ED5D8B5D22648CE603D46 21CARLO
914,143,226 *5F255231E514BE567C32A7C6BD8700D49630CBD7 AAMUNEUVOTTELUISTA8
914,143,227 *5F2641D996CB4D36CCD3A170F9C795A9D043D5C0 2259-judgment
914,143,228 *5F258460BA274CBDA1674626E9D38F976C1ACDD4 26520 yanimerdimresenomirodexo."
914,143,229 *5F28A43F828A7499482F5D7467BDA25C21A995B7 ABDUL.SEIDMAN
914,143,230 *5F2C9BA4F0E71295BF88B118C21BCF87852B7D45 ABGGJPJVK
914,143,231 *5F2A4119281C322D539ED765003573F25717AA28 2983239 VAIKKA-SEN-PINTA-ALA-ON-L
914,143,232 *5F2383BABFFC13A6684FD24AFF45BF71CD839571 2BEMISTSES
914,143,233 *5F252CCD4200E97818AC0A95AE5910344E1F4CC8 ABRAHAM.SKOREPA
914,143,234 *5F2ECBAC85F85C0008BC2DD8AAD77F80B58330E9 abrazo6
914,143,235 *5F2E157882B831CBD8F48BCFC10498B5B6520779 2PRTMYSNS
914,143,236 *5F2A1D6BD8C2D16634A602641FA6B91C94D64A14 [email protected]
914,143,237 *5F2A3292F259F50624AB6C3D8F1AD246F4FCB02C 2TOMHAPPY
914,143,238 *5F2209A59EACF1310E410084C2788264AE85AC6C 2-TRAEGERKREISES
914,143,239 *5F276B8BC7A6D25FB6C982586CB441BEE14B399E 3----->~0splat
914,143,240 *5F2C7A18B45EB1068410BC5563AF542479EB04EB 334048 tam2-03-013juhlasalinpuolimaantielt
914,143,241 *5F22318055019D84D351CE3B7FAE1568210B100B 34-ausstaffiert
914,143,242 *5F28E231231615CF9FB611401AD4E8454E8221B7 363387 the agent was never caught
914,143,243 *5F2718FF2701C31E199306FF9EA74C611CFA1D3D ADOLPH.NIBLACK
914,143,244 *5F2B1C83A2822CAC7B89C77264CB294193E98BB7 adpu<
914,143,245 *5F2B4791531B5488593BAC6DF4EF28A61BE8F480 ADTDA
914,143,246 *5F2739906ECB86D9E439187DF74D4D3682E48AC3 Af%c
914,143,247 *5F21A387DAA39B4BACA960FFE53C8383D1B9A68C ahx;
914,143,248 *5F23E30F1FC9882C974679B27161C0B51AF4A408 aieop
914,143,249 *5F28FA523025CA8288DA7EA560CE819F3EA1B79D 4ilovepenelope5
914,143,250 *5F28345CA44C0A0802DBB09013ACBBD55B1DF5FD 4INVITUS
914,143,251 *5F2690FE4F96D735B7049E2CE1E09500E67E5244 ai$rx
914,143,252 *5F2149D1BF56D04A2502F129DBEF492EB671885A AISKUMUAED
914,143,253 *5F28B9D7C14F2D24EA1CF398B972AF3D35489C0A 4N4C1457IC
914,143,254 *5F2DFB1E9685ECA6B3B491A6C9AD9B23772A78B2 4 OVEREXUBERANCE
914,143,255 *5F2851AC29B8A3C3479C1FE9557C845C3437D7E5 AKAMANAT
914,143,256 *5F2D06CE4B70D22BB455A1BBB13012A29680C90A ALAAAYOUBI
914,143,257 *5F20E840A6CD75F2F1FA1CFE4C299390E4986ABE 4UUYRUOS
914,143,258 *5F2CEF6DF950FE4C6115514B3BCD22396D4C50FF ALEC.GALLARDO
914,143,259 *5F246B138E4C157D6FFC4015D166D07F2501A6DC 4.word-dokumenttiin
914,143,260 *5F234D07297A091E30773FBA7DF612CB7DD101C1 ALEC.TEZAK
914,143,261 *5F27F5B3EC42B8904C6679AC2610D44ECBBD83F5 ALEGSSE
914,143,262 *5F2BD0AC108F89943A685D11B4B6CB1878175CC5 4ZEIRELRU
914,143,263 *5F289729A54E7014D5CD2830E56195FF6C130397 alexanderlozano
914,143,264 *5F23FAC7097F65C0FFEC704269AE0FA24F889811 536278 ancak kodlamanin etkili olmasi gerekir .
914,143,265 *5F2156FDBECABFCA7233F7911D544518046CA78E ALFONZOGENICH
914,143,266 *5F2AFE9928B92C7BC62CF5750ECC33EF2D4F1E6E 5ALASKACARLOS
914,143,267 *5F2682EE5B713D954A5BBB65E49B8D2C0FAB7FE4 5AMLEKTON
914,143,268 *5F21EA6BA0C2FDE469446A456A7A45EDAF0DBC39 5bladsprietig
914,143,269 *5F23EFBAB498333EE814B1DE7CDB438298BB4EF7 allamericanboy(novox)
914,143,270 *5F23751922764817F51E7FD70F856A088F101A90 allyefaithfull
914,143,271 *5F2598E073E4E4F96DBD3D34F4921BA2EE15D9F5 alphonsebault
914,143,272 *5F2B4D33345699D4053B913C2EBB0A652330B94E alqk
914,143,273 *5F20D62CDFD7DD4AE8EA18104ED74F9AB212175F 5hyperphenomena
914,143,274 *5F20F9AB4BA6875C6D76834F75ADB695676E7C11 am,3g
914,143,275 *5F2A01CAFC97ED90151DB57DA1961997B4D02676 5OMOCROMATICI
914,143,276 *5F283589361FFC24A87F10EC538E4322BE1F52DB 5OSFSELECTBSW
914,143,277 *5F29C063106C53900D6744C70B6A7CC7581D96F5 5SETNASSIDRUOSSA
914,143,278 *5F29929DC80FC3DBEDC3FE2F592C36F3B986AD23 5USLOEST
914,143,279 *5F22853A413702EA856ACE0FCE3A1027F0E1C6BB And.let.Bianca.take.her.sister's.room.
914,143,280 *5F2F8C9351CB282DC54CFFE5ADEA3231F5C445CA 5wojewodschaft
914,143,281 *5F2FAFFF2483AC7B9167DDB263CF4D48CDEFE1AD ANDREA COMERFORD
914,143,282 *5F2D79A685765F1C43B4E5CADC7830B0B4E53E19 5YGWEXRB
914,143,283 *5F24500764964BBEBA9BC250B835DEF5F7414C29 ANDREI00
914,143,284 *5F2AD8F38EEEC245561205D7A6DBEA2752E9A795 ANGELA EIDE
914,143,285 *5F21AA3ABFABFB82F6A33C4BB64C783B41AD9331 6APPARTENERVI
914,143,286 *5F2A78CFCFA27E529E69400F6D8B341414257F1E ANGELO.UNTALAN
914,143,287 *5F24CD7DBCB6614239ABF30A597AF124C665D636 6BSWHOCKRIDGEBSW
914,143,288 *5F2EC5109FF38A92FF0CF1D7B61997A02147C094 6COALERY
914,143,289 *5F21F2CDFECBDB4BA77DDEC0E2C21D6818144E88 6FULGURAI
914,143,290 *5F26D400FB4AD9A9FFAD17F6B532A81E67948850 ANTONIOREBELO
914,143,291 *5F22FB08FC83D21CA5ABE09D1B6214256768F4BC 6-NIKKASEN
914,143,292 *5F2720A9191E0A16CC9F3F62771C7502317F4C2A aona8
914,143,293 *5F2981A596B264247BC927BBE5CEB6F15E52A751 6RODMANWEBMASTE
914,143,294 *5F2D3A9E2DE2E5168AB037B30DBE57DFB937631B 6ROPINGPARIS
914,143,295 *5F2CFDAC0CC3048C01009B16BFB308F986E2BA0F [email protected]
914,143,296 *5F234A21C7BEAEFB9C9496474C6C8AE3DF113EAD APIPC
914,143,297 *5F20EB35A35D2DC1FF1152E4F449BE7C9E613729 AQUG%
914,143,298 *5F2FD67631E34F80F86F694BE88A83C76BE4CC28 A=r1
914,143,299 *5F289FF50A61C104FF4620C269337AA517AF5F71 7ANALYTIKOTERWN
914,143,300 *5F21AEFB8ADA9206AD15228B8D954F848661E854 AR"EE
914,143,301 *5F28A769DB1B5460A8F2D84FE424C2E0172B3A38 arielversage
914,143,302 *5F27D3C6FBEEFD011D1725F5F7122C671A7B1734 arijit-singha
914,143,303 *5F2C164F31AA0749F71DBC5A029C7330B8A4ECE5 7DEALFISHS
914,143,304 *5F28564C61F592450402DC307530AA70A788006F ARLEQUIN
914,143,305 *5F216D28491713D189F7D27FEDA290C036F0C652 7ELWOODLEE
914,143,306 *5F2ACAE57CACF5367C98C75678CD9018783B451B ARMSTRONGTOR
914,143,307 *5F2F932E8A3CF8716E7AA8894AA1CEDA577B8416 7ETATIPICERPER
914,143,308 *5F2847484043DC34D743EA6D2AA4BFD573A07E54 7ETTERLYSNINGE
914,143,309 *5F25F9D049C9B10A2FFD858FFDC11A2D41EF776F arronbiggard
914,143,310 *5F26CCF15DEC5D4DE417E8AFEC077154844D2FC3 7INALLIAL
914,143,311 *5F248B7AF266C80EBF67E13B0B4DE030F5260C4E 7JAMESVADER
914,143,312 *5F2A581FE01BD30AFEE502725E1E2AD96586050D arturogigler
914,143,313 *5F2E49AD74F305D279B61A6E5BCA31A3D10C1B13 7l2tetjyp1v
914,143,314 *5F24A7F3664D35F60F23919FA45D2FDE818A6C75 ARVOPYK3
914,143,315 *5F21046FC1B57AFD89F4A5403F5F0F9FFA3FB86D ARZALUR8
914,143,316 *5F221F2B72911B4405162418D631CABD4054F0CB AScandalinBohemia
914,143,317 *5F269640717C3E5EF87E818580C520EBEF697095 7PERSONNALISERONSES
914,143,318 *5F2DD97A117AF97389B6A36BFDAB132E0D027D32 7pienenem
914,143,319 *5F2780A56CAFC80F108AF3DD0C00DBF90C947C43 ASTONMV8
914,143,320 *5F23A69113107011B5D3F30328E3F914F5C1878C 7SULPOGIB
914,143,321 *5F2A0D6905E05883076D21D9B380FA21C667386F asuuntuing
914,143,322 *5F20F855E9C12981A6A8324F30A5E19DAFE8305A 7TPECSUSORTNI
914,143,323 *5F25E0163CD9489D7C21E7D4CD83D2FAB469086F a_#tk
914,143,324 *5F215CB4C47C6A280D9AFE82AA27ACECF74E1368 [email protected]
914,143,325 *5F27D0CB7DACD93555792132D99C311CCBB3C86C AUASZ
914,143,326 *5F26918344C51C9ACE4ABA28922548416E47A9EF aueuo
914,143,327 *5F24969472A4919D3D4BB9C8FD7472A95975433E Aui"
914,143,328 *5F2E80422EAFE2576DD7C582AE2D2C16641F6ED4 AU!NV
914,143,329 *5F22900D547345A993340A5A2AD903E5BCBC0715 authenticators
914,143,330 *5F254750264450F9C3C03D26C4A2A29BC60D960C [email protected]
914,143,331 *5F2DBE0EDC00DCD98B79F984105C9D86FD883419 ax5baa
914,143,332 *5F26C08036EEA25527CE0762F029E7C096B3BD26 AYMS+
914,143,333 *5F2B4B0FE002B0F58EFCC335376CAB8A4C52B1CC 8uitleningen
914,143,334 *5F232A5AA807D34B0D9BC5AB7D2B190595B01E5E B1OEQ
914,143,335 *5F2AF07E052F8FE4E217B68CD127888B496C2F9D b5et
914,143,336 *5F2A5F4C601876E664F182C8AEEB5AB72597ECD1 b6iri
914,143,337 *5F2949CA2080425056A9AC82542F23461A1CDA98 BAANP
914,143,338 *5F202B37CA89998D2DF1A19B281EC67A838517A2 bandages
914,143,339 *5F2E7AE2F45226A60289B86C0947E9FFE0BBEF0A BARBARAKOEHN
914,143,340 *5F25BF1D3A12985DC60ED937732D1E01CBC7A771 9REMDIENT
914,143,341 *5F278F1DE5C455AD08D40B4C6511C1D1BA22A852 BART.LAFKAS
914,143,342 *5F20D5CA966C2120294A1D0A35D5592C814BB7C2 batn?
914,143,343 *5F20FD936BEF13860F567F0926341A75F4941A5B B/BAR
914,143,344 *5F24CD5BCAC82D0873A4381C9C2ADEAA9919CF47 a0p+e
914,143,345 *5F21BCC9C49D6D838C92742F52DF14EB96172520 [email protected]@lly
914,143,346 *5F27CF73C7163DB30B56EE3AA1DA97B3F6D13DAC A26RI
914,143,347 *5F263246F655BD78347C71D62C89F1C7CDCE01C8 bdyw!
914,143,348 *5F22CEE2A2018CA17A3C1256A135647C07405248 beauty-blooming-'b/j//u/t/i/_'bl/u/m/I//N/
914,143,349 *5F29D6432725E7EA909143A10D8E50DC2A0C5503 A9fw
914,143,350 *5F2B1A07F5E82A208553331438E81CB938C3507E a+a
914,143,351 *5F24DEF8A22CDF56F1902321BD432C9EB1FA589C BENNYDESHPANDE
914,143,352 *5F2128D3F44D543FABF731640BDE569DA752AA48 aab{s[
914,143,353 *5F242FC75893498B357779596B17DD53DAC6C8E8 aad{xk
914,143,354 *5F252374C124B68B67C0977CB3EDA7F32FBF9F33 B;GEC
914,143,355 *5F2F2FFAD287A5650207A13558B00531EC39EF51 aantapte0
914,143,356 *5F27F1240BB11627E73AB4FD74C13BB89BE54093 BH6(
914,143,357 *5F287E71C26828976D3224C042FAE25DDA9FE552 [email protected]
914,143,358 *5F2286F6FFD9F56A72E601452795D626B91E1121 ab3vh
914,143,359 *5F21E95553FF3DC4A41083A9C6ECF8DFA2E79F61 BIELEVIČIŪTĖ
914,143,360 *5F221D042F4374FFB8CBB60B86C67803C8E7F401 BILLYMINTER
914,143,361 *5F2CDB05B4378B63978D5778A2F2A8D5306810CF ACDY(
914,143,362 *5F202446DEB4669AF7DCCB6D3D0886D1863E8EC9 ACQ-Q
914,143,363 *5F27C71F2476CABBF47F9E6F2DD33D7CDC676204 Adrenalin.Overdose
914,143,364 *5F209DBB707110BFB7AAFA24043DEFB0F46D6ED2 adrianu*
914,143,365 *5F227A408E665296FBD1F2434BEBE7937AE7330A ADV5Q
914,143,366 *5F2468394427277FD52C836856C766520398F562 BOCIOS
914,143,367 *5F27BECA99E41E718A506BA0312C2F1429D5A423 AERIDES.JARCKIANA.VAR.SMITHII
914,143,368 *5F24CEA47E1D97AFE14F62B972A8595188F2EA97 AE_TE
914,143,369 *5F26284B5D70A83E178FCD80DED5A1D24873303B boyracer2
914,143,370 *5F22D0F23FDB7F862D69A6176DB75D64235883DE AGMF
914,143,371 *5F22EB18254773B61F70D3419FF550D8F477D75B B------P`)X(
914,143,372 *5F21E33D4E98CBA89BF868B22762EFB3A5EF32C9 bqf:?
914,143,373 *5F2103C020912969A6A165941AABD41051883793 AIDGL
914,143,374 *5F28C076104DD5D4AC036B1E0F65C30380B4BEF2 AIJNM
914,143,375 *5F29863A46A738610C2E56BF627DD4CB2E3732F1 AJKWW
914,143,376 *5F2581D766DD84728638E9CE5BACE66C8D1EB307 akarui-mirai(featemirp)
914,143,377 *5F254BC0684A4C3A007264364D7B52AB3AB0242A ak"pq
914,143,378 *5F2931CA0076910D1D69932FEB5516A1341831CF BRING-YOUR-DAUGHTER...-TO-THE-SLAUGHTER
914,143,379 *5F297B6B75D20B521BEC5352292A43C874F67BE8 BROODING
914,143,380 *5F2B2C4E852F93070236E8C4FBD1DEF18B2F7447 alestriareighlyphillips
914,143,381 *5F2700A843CA97080EEEDCA56F24190534894771 bs.#)
914,143,382 *5F29C7BFB1B5330E4A9AFC58466ADB8CE94955D7 ALEXFAULKS
914,143,383 *5F2A9EA3727A523EA7E12A19E9D4CBBE173419C2 ALEXSTEAUA1
914,143,384 *5F2B0896D91AFE3239A5A7F2F251DC3F9BFF6769 [email protected]
914,143,385 *5F20E2EB35C525C894CC3D7B789F28B24EB3CDAF [email protected]
914,143,386 *5F243216B036EDB8350DE46B4F2611624CDB482D BSWANYPROGRAMBSW
914,143,387 *5F2F337B47FCE9627B397F94014E4AFD81624372 AL.LAVISTA
914,143,388 *5F281B74DC029B7A8619FC9F9E9B3EE0603798A0 ALLEN.BUCK
914,143,389 *5F2B855B06832D171D4F016455CFEAD0359EF029 btvti
914,143,390 *5F212EC92D59B5E5707AD8AA10F6013C3BC221F3 BUDZETZER
914,143,391 *5F294363626A2834859012D125B8CCFEBB696164 alqk
914,143,392 *5F2D71219ED242383A93F36BB81EDE6070C047A2 ALVIN.STEPHANO
914,143,393 *5F272BCAF2650414953BB7D7FD6E4B00E5043A28 BUOOV
914,143,394 *5F2CB367DBDD266085094A944DE89641401E9C44 burtbentzen
914,143,395 *5F2D5E278735E29BD0203CE7592D4B92D173E7A5 bwobd
914,143,396 *5F28089ADFFEB572015A39DF34EAE384CA48C79A B)YFU
914,143,397 *5F290F4D191F75BAC08D16F0C53A933745336B52 andreastrong
914,143,398 *5F25598F6D49E4E9BBFDF3658AD3DF95A4B0E4F0 [email protected]
914,143,399 *5F21D9DBC040212FCA45F8BFC1C273837889AB81 c0216dumbledorewastryingtosortitout
914,143,400 *5F25890838E0540AA779EECDAB2B4907FF7D4F0C anfua
914,143,401 *5F26525180648B60A8F3EE4EF5317C318493DF40 c0nc3p+u4lizin9
914,143,402 *5F2FB546C09590E12593E31CDE403617BAC28BF0 ANNE.WINTER
914,143,403 *5F2B84F2A8EBB5AE618931911401C63A0981EC93 C3KRD
914,143,404 *5F20FD72E54B9CEF3328F4B2099FFA652DD8F027 APRIVANO9
914,143,405 *5F2B93462F69EE2CE441BC1EF34EEAC39ED58437 a+p/w
914,143,406 *5F25AD446DE9B2C783311DE4C77CF448E9258C32 CAMRD
914,143,407 *5F25EFB9B7AD52165807917A73DD4E7BC8CB8C82 CARMEN.BUTTARO
914,143,408 *5F2E9996E019789BD7782CB2AB916BED3BF3B2D4 CARMEN.LITSEY
914,143,409 *5F25AEF7DDB96208526110660FD3A3A64849FA92 armed service
914,143,410 *5F282F9F7CF683BCB9B5D77862575A8B910CA835 carteresquinaldo
914,143,411 *5F21712B15F18BF60E967DAC4FB4BF3F8846E45A ARPDV
914,143,412 *5F23975D3FE957D30721E13EDF557742DB5AAA99 cassidydillon
914,143,413 *5F207F14AFBEF5E7520B9E31950277409F33EEC8 CA"ZC
914,143,414 *5F21B6B2E448FFA335B2DE035636FD0275F5FC7A A_SGT
914,143,415 *5F208D299EF40CF23D9052710D60B4E15ABE1088 cc!ek
914,143,416 *5F23D7BC5598A56789E568C973071E3A1A064491 CC#RC
914,143,417 *5F2F4F33D7A35EB9BF83EE13D6A005F82D9B5D73 CE)FV
914,143,418 *5F2E1E892307259ED19DBC16CDEDC43982237B11 cf$#l
914,143,419 *5F29290254BA44447B1571985550AF87FE5F033E cgvqp
914,143,420 *5F262CC732C4A0F5667B97A0CC5D77003E0EEC53 CHAIPANS
914,143,421 *5F27D3A73C4EC929120AC5A921DBAD2AEDB6755E [email protected]
914,143,422 *5F2312A154D4CC2A8D09C53E59410DE40E964483 awfoj
914,143,423 *5F21218F1EBABEB61730B41D7230A3D191B06E23 ay!w
914,143,424 *5F245A6FF24E632722F53E7515B0EB3AAFC08490 chesteropteyndt
914,143,425 *5F2A3A1849A9A41C7F3B1B430018D8629BDCE978 chetdiluzio
914,143,426 *5F2EEB4E41B8D166BD8399D13AEC4725FED03CD3 >-b0 ~` ~`(#####8
914,143,427 *5F26D5576522C6C21C66C7616E97F9328CC6AA09 b08z4
914,143,428 *5F247F4AB610E84E7C8B5A28A6255DA96459EBF1 CHIEFJOSEPHMOUNTAIN
914,143,429 *5F2DAB49EAF7ACBC0B92267AF40553DAF587C8E8 [email protected]~0~O )8(
914,143,430 *5F28CEC13185E583213639A3C77F0EC166863839 chingating
914,143,431 *5F2F1550ABCC0B21206CF322FCA268E01F6C4B29 CHORANCHOISE
914,143,432 *5F2877C02A7DEA9C90DE943A9D8F7130D5056F68 [email protected]
914,143,433 *5F22C528285D38B026E032538DB5903CFD9F7FB7 b33-1arks
914,143,434 *5F2543C9EA988782DA164EEF0E80DB4AEB159B8A chrissitar
914,143,435 *5F2C18A9BED84332831FA3F689A56973B5A4B81C B47IF
914,143,436 *5F2AF5CF014F7999800F5A01903D9D7B57D0355B b5et
914,143,437 *5F2FD8FFEACAB2089BB3124133BD5E4BD92A9C8C [email protected]
914,143,438 *5F2347DE512F0F7B2C3C2E3C3476B48B7D0ECF14 b#a)m
914,143,439 *5F235C4D1BE418E89543D978F926D2160CF31369 CLOGGING4U
914,143,440 *5F2865F6E553DABDED42764396F6287A0B4AE8D6 closetest2
914,143,441 *5F2959A4F56C5977E70082306ED9CD241E225434 bcd
914,143,442 *5F21EB800CD537A50029C55A4985B33F6CABCF56 benj12
914,143,443 *5F2E43B548AFE2A3FE9758BD4303A2D26E59FA48 be"qa
914,143,444 *5F29997369AEE27782CB0065971F9F1BF4EDF9DD BE.REDOLENT.OF
914,143,445 *5F248751D045EB69E17B9F1361C44029B7D665CD CONFLUIRAED
914,143,446 *5F23A8DBECF9C2978385C064DD3CE44A077DA444 BESLISSI8
914,143,447 *5F2BDF7D677A4467EF6B3DF3139C04B2442053CB co.q
914,143,448 *5F2BFF8AB00ACED2EA470B5CFB671E92A10A52DD BFTCW
914,143,449 *5F236ED879D040FCDE29DAF4E4A2CB7A4D24A6D6 [email protected]!vely
914,143,450 *5F2BBCE80D405AACF073DC19859C3FBA4A8A6EA6 bg%ov
914,143,451 *5F22252BFB9CDA0BA14483869D63B3FE9FB2DFE1 c:\program-files\microsoft-visual-studio-9.0\vc\vcwizards\appwiz\mfc\application\templates\2052\view.h
914,143,452 *5F2BEA16FDB77B4E8877A755B7EC4AA1EE5FD580 c:\programfiles\mozillafirefox\res\editoroverridecss
914,143,453 *5F234AFA58D55CB9F6D0C2776FCFB7732413DAA0 cq0,#
914,143,454 *5F21A7A8FCAB6FC91932649FBC3F0F04A8C8840A bitchniggaz(featsnoopdogg,hittman&six-two)
914,143,455 *5F2A77A87333D19C3EE8100F3F88142119C0B0A9 CRISTOBAL.CHRISLIP
914,143,456 *5F2890481B85E8178CE5130208941837396EBA87 criswisco
914,143,457 *5F27C051C2F2806B9EA1FABA1D85CD93ADC0154D BLACKHAIR
914,143,458 *5F2892C8A0A1B5CD3226377302FA5E619186295B CSB/(
914,143,459 *5F22507D1F7476AF71D7F91BD3191BB1AE97B32D BLAIRBESA
914,143,460 *5F23ED8A66A47C83A40862289EF99971DEF7DFD0 BLAIR.NUCE
914,143,461 *5F207250D5DA2E2A17FD8E7ECF7F76C49A0813C4 BL:;B
914,143,462 *5F2276EA7826CBEDD1A773C4CA0582FA7118B002 csyb=
914,143,463 *5F23922B3EA557F8DB5E1DFF54AC89CA4686CC9D blwzd
914,143,464 *5F245B94DDAB036F13D80BB2096E8E5C62CC32A9 c"uo?
914,143,465 *5F21367D6E1CF1C403F3A40D6897B8696FE4C210 curtisvigoren
914,143,466 *5F255B827A51928123DCEECFCFB0ED6BF9C62BE3 CURTLEY8
914,143,467 *5F2C24F87C94D69B483A1E1CA194817BF6E50772 CVN`
914,143,468 *5F2BF38EF594B7753F0D90DA594850B9A84E0EE1 BOO$
914,143,469 *5F2CF0C56588E3121356561AF417A94302FA2DEF CYRIL.SOLTMANN
914,143,470 *5F29F5E65D4959564F40B2E3421D0DD400CE6AF5 cz#1/
914,143,471 *5F28BF88A008686BD2002A5A8CCD5739ABD91017 CZ"5
914,143,472 *5F297FEF17BEEB30423C29B6C59D8F44AF5B482E BOYDKOLLAR
914,143,473 *5F28782CA883D37059F9EADD67E6062B892CC8AE d;_,.
914,143,474 *5F233AB1926F4EF1A1A541ACDC4D977557ACA283 d,0bm
914,143,475 *5F250C4DBA0FD46E82FF8645F87AD7DB4D6BCF0C bpymp
914,143,476 *5F22241932C8DE98C63A70A38DD849300D4336FA bqc(o
914,143,477 *5F2B164C914A1A731BA1D86194681492E490D7F2 bqf
914,143,478 *5F2B41F04EB0FE6ADFAB05FB1609ACE76553B2D7 BRAD.TRASS
914,143,479 *5F2D35B8CAF0521684133B7E437CCB0B40F7A828 D=4Y
914,143,480 *5F269DDC2D9938425E388F3F399D199DA21090B1 BRANTCIGANEK
914,143,481 *5F274BF48ED32F9117B51ABCCD33755740AFB999 D8&U8
914,143,482 *5F2C3F77E2AF81384F5ABFD9C5B35469A8DD261F BRETTW03
914,143,483 *5F249EE7A732B7431A9CA993C672E390E83620DE da6)#
914,143,484 *5F266F0D86442C7EE4A82AC5A20CC2A89F07FB23 DA9O
914,143,485 *5F21F088393B852FAE9DF9D2BE1C3BDCDCE55A96 «BRIDGE»
914,143,486 *5F239A59F0B81EE24413A5104643A78A35C75A89 BRRWQ
914,143,487 *5F2156B733579D37A4098935A122E4436F8A3E97 DANIALWICKES
914,143,488 *5F2D28DEE2D8D10FD0685A7BB42528B335C13FC9 BRYON.HUYARD
914,143,489 *5F21FD4F7C34F70E12D89C3225059FB7DF6C0498 BS7:
914,143,490 *5F2261125E47FB75CFFE5DD54B13AD8FAF53802C B#t
914,143,491 *5F267C4A7608C422A5240E023BE640940BC3F4BC DARRELLPALLESEN
914,143,492 *5F2112D839E1DAA38ADEF4910B8BF3D21178339B darumasround
914,143,493 *5F293DEF5C75A399DE0AB4018641D3F248414615 [email protected]
914,143,494 *5F2847F6499C83A32BAA08097780BC83F393E2E6 BUD.ORTWEIN
914,143,495 *5F2424908D08981BB78CCF3FBAA4A436D2A07897 BULIUHE
914,143,496 *5F254430D50AF617C21B0C66225660A4D7EA5A53 burdies
914,143,497 *5F2E91382900561AB1BE522A6705299486695E8B dc?xf
914,143,498 *5F24A14A4C442B1807774E8A4AC44A4712875838 BW6u
914,143,499 *5F23DA2C1C799701C438C29F91B574785CCA8A4C [email protected]
914,143,500 *5F2A6ED8D8FF64AA7E57B23E908A4FF03E6184E0 BYRON.SWABY
914,143,501 *5F2CA33E4EBBFD1083411BD417D15FE1C52E1092 byw$4
914,143,502 *5F21B78C3A2E10436DD5EF757BA04FF9DA98D3B0 [email protected]!VE
914,143,503 *5F2B7FB5727BB3B7A4EB24A36E979474C1203631 c\-1
914,143,504 *5F2F5A0E8877592E7E91BBBF5A2609F973E85F6B c195=
914,143,505 *5F213A0047BBAEB3BCCDC308A2DFC6AB07E618C6 DER.TODTEN.TANZ
914,143,506 *5F2358D7E63E28C33FAA88FA516DA445B50055A6 deshawnlewis
914,143,507 *5F26B27F77F5A9AA7BD518621F724C65C5FAB2AF CABINMO
914,143,508 *5F2FF6AFA653BA19267D7A68B2820110ACCE8781 DEVIRDI
914,143,509 *5F297B455EA0C9BBEB0D506CA8ECEC6AD7C49AC7 calestine.smith
914,143,510 *5F231EBD4D604214B89208647A66066BD9DBE982 [email protected]
914,143,511 *5F268DA585E6E504A6A3584B20DFF916D953AC71 CALVIN.SASPORTAS
914,143,512 *5F2918F4A060AE7ADF151DF350852894E8BDB85F campanara
914,143,513 *5F2DA473AFF874FA7A243ADC8380C77104BAB896 DFWOH
914,143,514 *5F239DF50D83C1167B56C3471089A056EA1597AC dga6
914,143,515 *5F27D8709CA2F0B62FFDD2A6AC2E8926E24B7C11 CARMELOGOTTLOB
914,143,516 *5F2D973F50A4A592C2BC64B0150FB83C5697CC0E dic-
914,143,517 *5F29D2D0B0B2A96FFDCF3589B69197D84D4AB15A caseforms
914,143,518 *5F2944CEA6C9201E409F7B1978C90558FA12C039 [email protected]
914,143,519 *5F2F09753951E901A5529076A666880CF1440664 cattins1
914,143,520 *5F2161DEEC9D02FA33A2CB1EEB89D8199D090B7B DISARTHRIC
914,143,521 *5F2A782ED925CD9CEAC9AA2FF63B6C5F83B637D7 [email protected]
914,143,522 *5F2EE776252AA1B98F038E284745B3C104C74521 CCH)
914,143,523 *5F27FAD72558F708EAA621B138D0502C59CE1A43 dkgep
914,143,524 *5F2A1D848BD70640A9E501D0349AD906B01B6148 C+DUV
914,143,525 *5F251E978F88079C7B637E4893409427295D18DD [email protected]
914,143,526 *5F2A1809D93F784506D768B3ABC05B82A1EC9E4C DNEPEIP8
914,143,527 *5F2D21CDE3020FBF099FAFBFD3BB9169A0EFEE90 CESBF
914,143,528 *5F23299136300648FAB4A8B4F79D63776DBE2DA0 donnellcorsey
914,143,529 *5F273F0968F156BF0372C07004AE4BDDB5DF06E0 chandray0
914,143,530 *5F2FEC0DE2157D20F852631545E52985D93464D3 don'tfeedaftermidnight
914,143,531 *5F2550F265F980760BEAE889AA3D465D9300D054 DOWN4THECAUSE
914,143,532 *5F2F3126A4DB76E362CEBB7E3DA5976773F6B069 d%p
914,143,533 *5F2FEF77679D31DF6888ACB4F3F82962A899655F CHELTCOLLGLOUCSSCH
914,143,534 *5F21C252057CE3F8F32BDBBAAC89BF4641C942F8 DP!TN
914,143,535 *5F2D35FDAB0555B99FD7AC3EC9248B67F5DAD1DC dqdz+
914,143,536 *5F2508F9E157D9235A422E38C83556350CF85DE8 D.Q_O
914,143,537 *5F2B587000BD6578727C35E40B68EF467DC1714E dream.two
914,143,538 *5F2E1A6370B669A2F5539123195DC50707435B67 CHISSEY-LES-MACON
914,143,539 *5F2BC8881F82F53760713B2512A8D56C3C553368 chm_f
914,143,540 *5F226FF528A1F9E878D50F280028BC3B103EA70E DRUMST!CK
914,143,541 *5F218B7978387EAAEC46D183608741005D8165BA DSDPA
914,143,542 *5F2CB19F9066CC6556EB5456D739B3035F346D9A CHRYSTECHRYSTE
914,143,543 *5F203F14D06E52E2538F172B72BF34ACF6C7374B chuckwerner
914,143,544 *5F2477D6E20E81304D612DB9BC429E5DBD489D45 Dt)w
914,143,545 *5F263D55AE40215535A8795DC39EBBE08AF7D698 CLAUDJULIUS
914,143,546 *5F250E7E45E9CF45DE24BA707A5AB1E233863D6B DW+1O
914,143,547 *5F29F8478CFFE6373ED4DD103282F6B984FE878A CLEAREST
914,143,548 *5F2944BCEB5BE5550EC57764C45E87A2F25F0142 CLIFF.MALOTT
914,143,549 *5F2182212D8DCD7522A15E627C1CD6E5429C3602 dxip#
914,143,550 *5F2DEB3B2D347A14E9F15AA1893DE8424FD23245 CODYGAWITH
914,143,551 *5F26D1078FACD9CFFD42FA165AAA1FBF003413CE EC-RAMBUS
914,143,552 *5F21225DC06A700E9A1B6C257218D44222417C5E EDISON.FURLOUGH
914,143,553 *5F2B9F6295316EF7A2F90A6A55E9172A79DEB0A1 edmondslee
914,143,554 *5F2CDC4FFF44F12887ADEED1AE832944181E8466 como.mexico.no.hay.dos
914,143,555 *5F217DDDEDE2E097926F101430DD0E8EC4B1CD36 conradflorens
914,143,556 *5F219662038FB33A8BEED497B62D5EA94D2B7DFF EERIBSW8
914,143,557 *5F24B02E84F36DE5338975DE112715B4FF5E6E00 co.q
914,143,558 *5F2073D45F7D14B91332CE846AE45F3AAE66E340 COREYWHITTLESEY
914,143,559 *5F2BC3BB069042FAB16E20A6F2376910DCC04E74 CORRODED-DREAMS
914,143,560 *5F2A09E68EDB9055E7F1AED89704961256E5B5BE CORTEZALLTOP
914,143,561 *5F2B9384A822FAD8E58E464FFF5DD765844D6B6A E<HM
914,143,562 *5F2D6AA560DB34D636C3E56D0268CF99C726F5F0 [email protected]
914,143,563 *5F2D14E923502C1FE277DE53B3D598D418ED8294 c/=p=
914,143,564 *5F2469B5605A31A093D6D05D4BC1B5BC46599DDC CP.+4
914,143,565 *5F2C1064283E7A5B0B47B0CC8DD502361EE7EBBF C:\PROGRAMFILES\CODEBLOCKS\MINGW\LIB\GCC\MINGW32\4.4.1\INCLUDE\C++\CCOMPLEX
914,143,566 *5F2E14D177069A56FAC0B9C48040BD618C0B36B2 cpxkk
914,143,567 *5F24FEB0450E554655EC64B29CEB0CCF6C4F3FE1 cqkax
914,143,568 *5F239254E959E6B0995B2B91D1687B61DB968D58 CQVBU
914,143,569 *5F24572EB5854A374FD716A6F6376284B3BC8B1C CREPIV
914,143,570 *5F22D260D4A1C810C4163FE53FDA69B06A637137 ELSWITCH007160TALK16
914,143,571 *5F23E8BFAD036E1FD3C6A48B30E413A3C56DC1CA EMILYKAYE
914,143,572 *5F268ACD8C79A166FFC6631F8B9FC7F3434BDA97 EMMA-HUGILL
914,143,573 *5F274CB10D8F86D3FD8B32D321DC8BAFF97C4334 ctay
914,143,574 *5F2F7532469660700A5B07E838BF2A7F04C2750F cu#4+
914,143,575 *5F2B203A79901A8ED3808E0F0225F3D8838B1252 engelenbakken9
914,143,576 *5F2AA74B34DDC0F29C11D62FE60230EFFC460234 cuqo-
914,143,577 *5F29AB253F94FDAA4C84659845ADAAE1E1F2D30C EOCF8
914,143,578 *5F2CF101B8C16527FAF2A3565DE61BC928DF4D4C CYRIL.SCHLESSELMAN
914,143,579 *5F275FBAE64C9C9E9A1EFC5BB983F4DFC781658E c_(z$
914,143,580 *5F238466840FFB0ECF47C88C48E7A5409591DB2E c?zdj
914,143,581 *5F26631C60825B3F0649F1BECE27909F81C9C8E6 czmgf
914,143,582 *5F2AEFFEF0C8D768E3289F68081FF243A57D6B27 es:
914,143,583 *5F23F554A962CAED1A5D39F094E18C8063903203 ESLAM-HOSNY-EL-MALLAWANY
914,143,584 *5F23F7F5028D3A4AB07A4C961602C2F1C14EB18C etnanibba
914,143,585 *5F2F0A1AB938970DCEDE863742B3268B0F14D985 etqld
914,143,586 *5F2C377A7641961D6909C93C42CF24E7B07592E0 EVAN.SARALEGUI
914,143,587 *5F2EF9A541BF30F370DFA662A551BC3FCDB970DE d9cda
914,143,588 *5F2C70C134E77B6A7A1CA984EC0E8DB5CE304B0D [email protected]
914,143,589 *5F2BFF3A4DB37EC61C62DD5CB71D17EFBFFC09DC damonmauzey
914,143,590 *5F2EE824255AC2589CA283ABF5928E06C5F56479 F4NT4$M
914,143,591 *5F28FF783F83237783AA14B6A3BFA33470418271 fachgrup
914,143,592 *5F2015DBE3A73D416CAD61DE04AD254EDD7C3C95 DANNY.HANCOX
914,143,593 *5F276E3F4FF690041AD43EF8EFDD26CB41BE389F (FALUN)市。県の面積は2万8196
914,143,594 *5F2BB40EDFCC61E2309505EA5D0672627728A1DB DARKEYES11339
914,143,595 *5F2DBC75FDE69577CAD28F51B131AC4BB5E50906 FATS.DOMINO.COLLECTION
914,143,596 *5F201FE9A231F358D37A6E9EEBB132B9532366F0 daronshoemake
914,143,597 *5F2A944CFD98334AAE1E899EB30A3B3EBDC72883 fcemmendingen
914,143,598 *5F219306280A5670D8885CB1A6B1B68BA18322DF FIOD
914,143,599 *5F2CE29415EB6CEE14B5159DF94ADF0285FB6276 FLATAFT3
914,143,600 *5F223D71A38B1E932DD5EA2DBFEB3D4E37A72DBF DE#4I
914,143,601 *5F2D2548F939F149A7CD7FC53571BE0AF5A6C466 FORREST BUCK
914,143,602 *5F2FC42C1F243BD3A34E0FA805294BDC03922B0D DENISKHRAMKIN
914,143,603 *5F2BF8911553B9BBE1FEBFB6E10A6DA88D41EB7F denivid8
914,143,604 *5F2091856DEA06035C695B8AC7A0C9243BEE1F7F DEOFINA3
914,143,605 *5F29F78F193090F35BB81E105C9A4ED9B06B89D7 FRANTASTICFIVE
914,143,606 *5F2A3B7A414CBF222C7602C6CF108F71DC8B8C37 DERICK.CERECEDES
914,143,607 *5F2D6A949AE12859FC5A012DC437EA8F03A0414A DERIEZ5
914,143,608 *5F209FEAF8C2BAF87F542C7FF4B41B015BBD0D10 descriptiontdaiji
914,143,609 *5F2BD5981809794A722E23B81C40948013F63346 frembruds
914,143,610 *5F2C82FF4AF4F84D8F4A5E1CE77861D9DF57985B fuckyou7890
914,143,611 *5F211BBB070D78D6F65460211CBC97F0E8EDEDC4 DEWEY.MOON
914,143,612 *5F251CB2A4C44BAFBE9A90265EA374A9719D65AC DEWITTKUPFERBERG
914,143,613 *5F2E682B25485852000E3706011859069431D205 FUSELINK
914,143,614 *5F2A2EBBBBF16970D99F81E69D58EDD8408F5D41 dg1u8
914,143,615 *5F24226DA766A111B5B1A0C1734FE7182F6F0C87 GARTH.SCHROMEN
914,143,616 *5F2A0991C8854F27922C7DFD57A38697820ACACC gary-mclellan
914,143,617 *5F2FC912A848A9E45106F48C742983C76E7614B6 GEHIJGGJIHEG
914,143,618 *5F20FEBF8CFC1E5F8D686D52AA6BD5944656BD04 direktnu5
914,143,619 *5F2D457A06C2D4D8A79B0D1DF87EFB3FB6D5B774 DISCOGRING
914,143,620 *5F216E57392AB3C7E481E26F51CFFEF81D552EDD DISEMPLOYMENT1
914,143,621 *5F2ED85161E5F32300E3BE1290BDAA100D538F0A d,,k!
914,143,622 *5F2AC204286768AE7E5E7D443AA758EF7CAB09A7 dkkz&
914,143,623 *5F276A5659F9D4DFD7C176689BDF98460726E26B dk?r3
914,143,624 *5F2FDCF74609AFE99E2C68E5C10625417A3ABB23 GIDRBMJ5
914,143,625 *5F264F182C66D68B63B3C3305E4849426B8B2888 DL+M)
914,143,626 *5F2D465A40AC03E756D4BA3C7472A0238908CD1B dlq9
914,143,627 *5F26830841AA6CF07513672A8B0FEB542C2518B9 DOMINICK.LINEBRINK
914,143,628 *5F2F5E3C4E6415E63BA16C2E87D5022794AABD7F DOMINIQUESTUEVE
914,143,629 *5F233683ECB945BBAF3C2339B98B641C3C66F8C1 gradlon6
914,143,630 *5F2994AD6C7E25803262C0890B890991614C9568 gradystiliner
914,143,631 *5F224BC20E942DFEB8C85EAEE5EB1930946530F3 Grafińa-de-Montes
914,143,632 *5F284CD3AA190EB3A0A14533B81606575B88BD2F GRAVENE0
914,143,633 *5F20FF67A7EF83F81BB6233D74E76AE5CE914359 donnyperrotti
914,143,634 *5F22D60CFA405F0A722D68A4277445DD0235BA37 DONNYSWANSON
914,143,635 *5F2DAA32418B026D1482086EDD9979D48A2F1AFA DOROTHY-ALLEN
914,143,636 *5F2ABA52ECA90DF2CBF9B4D88C4F940F93202AF8 [email protected]
914,143,637 *5F2CA9B86C06B5DF5390061B58FAD7A7E2E95B68 GSTRCSM0
914,143,638 *5F21F231F3F046B2679E6049BF22BC55BAE7E283 DOYLE.KELLER
914,143,639 *5F217AED883193224F4B4932BFD7D6B23A856A9C d%p
914,143,640 *5F21644CE193F575196C52F2FECE70AFD4613425 [email protected]
914,143,641 *5F28DEFBB7CBE4BB060409171870EDCFEB7E47B4 [email protected]
914,143,642 *5F235DD63C92E4184EB7524F7309E1459C7D4E2E GURGGYCOW
914,143,643 *5F2B4CB7BE2EA89A8BC6AB4D8259A86DE19A8629 DRAGONLANCELOGO
914,143,644 *5F2253302EA74ABF007E52E94F5E7758E5EF3213 DRAHEAD7
914,143,645 *5F2CDD4FEAF9660C61E10DFC090E33E2D0F693DE haifuyoted
914,143,646 *5F22727DFFC048BF307C6A8AB4EDF6B67CA0B7FF HALBDUPS
914,143,647 *5F2E1637791AFB6C48C7D38158DC14D53BC80202 handea
914,143,648 *5F2C269B2F3C0879A8354181D58AD99A73F8A524 D!SKP
914,143,649 *5F275003E1377AD73F554E3A860504B1F24D4297 DT4#K
914,143,650 *5F2E0E925546673C3E223CC35BECA8CD5BAE7F25 DtrO
914,143,651 *5F2AED65B1094A6EEDCA54CF0AB05F89A1B3B796 HAYDENCADDLE
914,143,652 *5F24C0469847B5CD1EBD551FEE48C6F01AA6493F dudleytarbet
914,143,653 *5F23CF15C33DA518D8905DCD22A786435D08D4C8 DUDLEY.YANAGAWA
914,143,654 *5F2CC582DAC31124262EDA18C294A948611F5FF1 HBRINGEN
914,143,655 *5F2B627EEC1FB0A196652BB36D8FF60F2841309E HCYCLONE4
914,143,656 *5F22070FE919B6663F0467E55619463EFDD2929C HDEADY
914,143,657 *5F29FB800C4F24D5E7602962CED418E57A093814 healthjim0
914,143,658 *5F29038E0CABC3C2B51A7A189A32BB048CA6B3D9 duncanwasco
914,143,659 *5F295112321DFBAC3763C049460FCAF62A47BCD1 DUNDERHING
914,143,660 *5F25622BFBB2ACD46CCAEEE5FE5EA5FB146D55C4 duowu
914,143,661 *5F2B33C26ECBF2A04F8548E3A9A79F8FA7CD7E8A dur8h
914,143,662 *5F2407446A062B8C913158D487C1395567165B5A HELDFAFFEN
914,143,663 *5F20DE9937262D7144D680F5BE24C0FA2B6EF6DB dv7g#
914,143,664 *5F2E463B05ADCEB0FBAE7955AF16D33B0D56BE70 DXDSP
914,143,665 *5F2157ACB8300520A9AB053EF24E8B809453AA82 higher-than-dub-(a-sherwood-remix)
914,143,666 *5F2D987558AC63D4695414EBB1014E73A227548B HIPOLITO.CORBURN
914,143,667 *5F2A0B2132E9C6ABAE08410C6471C4268E6202AA DZ%B
914,143,668 *5F24C1E3E320A4165D355B568EB47695700E894F DZZP
914,143,669 *5F2DCCF940458811BDBB4376C59A98D360A51686 homeochr2
914,143,670 *5F245D91AF29E745A169F580E4F0D7E2685370A6 ECONDUISONS
914,143,671 *5F2491565725F8412BFDB377E67AD96210EEB9DF Hot-Mom
914,143,672 *5F27B7709451BE1C40A83B280DA258DE9E9C26CD edcadae
914,143,673 *5F2FB43CB8AA3ACD58226F4ECAF064FEBE4310FA HOWDIDTHEFEELINGFEELTOYOU
914,143,674 *5F27D929C85BC4BFCC313EB91F885D365B2CD26F HOYTTOTTER
914,143,675 *5F266A3A3A5B4435057B936FDFE1063F5EA2D732 HRENFERNSEHER-VERK
914,143,676 *5F23FADAD1CD60F2CAC3D80C3039CAFAD7491FE9 HSHIKE
914,143,677 *5F2B215CFE24553CBA7DE3994097D90052EF5FCB educationohiogoveducation
914,143,678 *5F28E4A7049CADA87E4A22D88BF16213D4215F56 EDWARD.ALCOSIBA
914,143,679 *5F2AB2C68D1DC8554C9C9C28D8B2F17BF7C864F6 EDWARD.EMBERSON
914,143,680 *5F218C7DC55C0D4AD5C9CD3C4AA97DCBAAB668D3 htynywg5
914,143,681 *5F20F6AEFE53EA368662BE75849A5A5E053F2823 HUGO.RIEDESEL
914,143,682 *5F2F2388090DA198C5461020027142AA8486D23C HUMBERTO.SAUCE
914,143,683 *5F272C61A0AD9A80EE0C8D3F5E9BBFD5E748BBFC HUMMERES3
914,143,684 *5F2CF520E5603F14CD7624815AD542B72C8F8A74 HUMU
914,143,685 *5F2644C9A82B4736146B672A5134B8F11E5AC2F4 HUNTERWIECZOREK
914,143,686 *5F2C66952E6BF22B4CAFB40B4BFCBF87966E8BB9 [email protected]
914,143,687 *5F219BDC6FED99B982BC767C8A5839358A06EB3A EK;H-
914,143,688 *5F23D5457ECA6E4F20D969AC78E7727617635AB6 I:|
914,143,689 *5F23D51E597287B3C6B96FA0518A333CD6749DC0 IAN.CAPELLI
914,143,690 *5F24C117D866894A7C85706983483240DD814FD8 ELIAS.TRIPPANY
914,143,691 *5F2755665D9085975C171B12F230234C654D55F8 elijahbuchert
914,143,692 *5F202084C3E37D0046F768243D7251740D773F0D elliottfriedrich
914,143,693 *5F20DD76B0DA014C2744E76F39CF41086C66D30C ELVINBIZZARO
914,143,694 *5F226CCCB4D3C5FC9A8D2F0A8ECC4EDCD8EEF678 ELVINVOREL
914,143,695 *5F23DCA9F351F235517F6990F67414F045AEBDCC el|w
914,143,696 *5F25C49AB4B99305EFE50AFB465E1210F86364BF iloveflorida11995
914,143,697 *5F27CA82B1F104431CECF530205C62F8AF995C81 inhistime
914,143,698 *5F270844C243B20B0EAE4C356F9714692E0A0D67 ERIC.DIPPOLITO
914,143,699 *5F21721FD2D8F33477BA15119F70887192CA2C0A INVERGRMENLY
914,143,700 *5F2FA5A4FFE04E5CB9D7734763470A26FA084993 ERNEST.LOVEBERRY
914,143,701 *5F25EA64E52F0C0087FB7437D70E8DC8F9B9645F ernestquinoes
914,143,702 *5F2DB1310049D3E8A38EF26F22D6F6415402D439 IRELAND845
914,143,703 *5F27222717BA89B8ACC5A728BC46DCEB7F72C8B3 irockian
914,143,704 *5F22E3918CAAD317CD0A07C3A23F33CF0254A87A ISIAH.MACKENZIE
914,143,705 *5F2126EB8CBFF7BBCE39A9D20EFCD04706B71503 ISREAL.FEKETE
914,143,706 *5F28F1277B30B92494C80D71B9871D73C78FB040 ITAITÊ
914,143,707 *5F23E07B23C7062CD85A33BC018F83456E1BDF52 ETALERIONS
914,143,708 *5F2229108A596E397EBA04E26621E28C95C4DF55 »IZGINILO«
914,143,709 *5F266D2C499F9256BD759DEFDB6E0B474B270F08 jacksonstormes
914,143,710 *5F23EE0C336C76F8EEF4A88A95E1F0305BE2B80B JACKSON.WILFONG
914,143,711 *5F27EA956DA634B8A6B6F4474E728C7E31240F05 JACOB.CROWSON
914,143,712 *5F2A6B663DBA9FCBDF21209C0F6494DB286906A8 e..vivian
914,143,713 *5F25C19CE3F8F4890249F40ABB7C16AB9379BD02 JACQUES.KUPREWICZ
914,143,714 *5F2567A7724B9314B6942064AF5201676BEDEDFC [email protected]
914,143,715 *5F2179833DFD77C95612E2FA73A1A770107C5713 JAILBIRDE
914,143,716 *5F277E8C625E8C320805008FD44A2A759F293DB5 EXTERNAWEBBPLATSER
914,143,717 *5F2CFFBA35212834CFC5BD13653877A369AACF26 EZEIHEND8
914,143,718 *5F28E1B2C6D6853A1000B89388EEB4806CF8266F EZEKIELKASTL
914,143,719 *5F2C58CB928F5C62686A67CD2AB35F27C1D2C096 JAMEYSINRICH
914,143,720 *5F273545E98463C0F7984D457E82D2461F2D161F F70769
914,143,721 *5F29BA065D6A006D26D3E3430D4CC2AA5C99680C JANINEGARRISON
914,143,722 *5F27EC8B4D6F123769CFE96D9E95C092CFAFBB59 falconer
914,143,723 *5F26524C185BCD1908281B1EB74865EB530D1C98 [email protected]
914,143,724 *5F25A4126F7BBFB4D96E2AB146079AB693E267F1 JB#
914,143,725 *5F2D6B6339609147CD1D5BDEAA6524DD8D0934E0 FELIPE.VALENTINI
914,143,726 *5F2A47214C6B6F87E85641F6CDA3D2B5A24733C1 [email protected]
914,143,727 *5F2581BEB79D10F6E77290C945E9E49D9498504C [email protected]
914,143,728 *5F21D9883FD12985C212549831943ADC69613A57 JED.SHIVER
914,143,729 *5F2F0CFF2D148196510325F0DE45BE710CA174D1 ferdinanddauc
914,143,730 *5F2718EFA1749E0DC4FE166D1673813F6906784D FERETWOUD
914,143,731 *5F24AD79668BF904B1C104911052FA26B8D44C1C JEFFREY-CHRISTOPHER-HUNT
914,143,732 *5F26A956902615941819F2C9A357851CD444A299 JEN1980
914,143,733 *5F2F2F101B20FA037B92F38B09AEE3708E7960D0 F/IM
914,143,734 *5F294F6828DFFDC5A1B71186E3FB1D0938737621 [email protected]
914,143,735 *5F23A9F84634140309DC57A46BF7FA494986E5DC FM_
914,143,736 *5F2E56299545B32776A3CDC1D931FB2E16F71199 folytatott-4
914,143,737 *5F2B35FF29D7DDBF7B1465ADB6648AB25A96DB46 JJ91600
914,143,738 *5F2F31CACBD69B83D54DA3F77E6B0F11D351CB62 [email protected]
914,143,739 *5F236348C9BF01266026825615E03C9CACCD4632 Forked.Height
914,143,740 *5F29D6B53320BA785570F67E886FB8ABCEC6759E FORRESTAHLMAN
914,143,741 *5F2F2F4DF1853BA78A08EB3BB9073C2D5A5D6C4E for they are harsh, untuneable and bad.
914,143,742 *5F2753D88EB83D76A4CB791B1D68992BF2A4C618 [email protected]
914,143,743 *5F2C3E5EC9F372BF03331DC6417F29CCAC6E2049 joesphdinis
914,143,744 *5F2494BF91780F1AE8D0F46B6198791FB7536A1D JOEY.SODHI
914,143,745 *5F2C929C61E84D52E8F16F89EAF08F43B6B672A7 FRANCISMCHUGH
914,143,746 *5F2872F6BF3784874F048207594921DABBF65CC8 JOHNATHON.KUSZLYK
914,143,747 *5F26DCE282FA4472B82AE81A9F9A98BC2DA795D5 FRANKLINROUGHT
914,143,748 *5F257BC6E1C11239F79004D94DF54092B1C8DB52 JOHNNIE.CARMACK
914,143,749 *5F2AEC845C8904F1026F90ABAAE16D4A4E5F7308 JONAS.KILL
914,143,750 *5F28715E40C292785A8A4D4F27C0F29D31E369B3 JONSIANDALEX.COMWWW
914,143,751 *5F27005F00CC492114002BD3EAAB60FE53C3A7F9 JOSEPHDINITTO
914,143,752 *5F2A1B8380FD497D9F69999CC74EC217EED8518A fubuuy
914,143,753 *5F211840BF96253FEF11C94F85BF872D0FEC4755 FUCKEDUP(LIVEATSCREAM)
914,143,754 *5F2BBF5E0B9926F3A2395234F20907C5109ECAB0 JOSIANE SIMARD
914,143,755 *5F2FDF27C3BB5F97F34567F4497595F10837669F JPOTENTE
914,143,756 *5F2122D0B5B7869FFAF0B3D2A28D09BE604072E3 juaini
914,143,757 *5F244E8542963A0CD3973E52AF4DDE4E04D0A861 GALEN.GRASSL
914,143,758 *5F298F4B6A2D050C8925C69DA7FC745FA68B86CE [email protected]
914,143,759 *5F2C38A84D080D2AB139E4E3E235CDC3B1A91503 Julie-&-Lucky-/-I-Love-You-Period
914,143,760 *5F24BEC8760F07362CD19ABF8D5B1EC5DAC3F467 GangstaBogy(featMOK,Vokalmatador)
914,143,761 *5F2C73770B4228E98A5D49667F743ACE53057FC4 JULIEREINHARDT
914,143,762 *5F26D039B812E09DDB6E59F215D3D68B299E15F2 [email protected]
914,143,763 *5F2FFA653D038D1DACF8287B8812221684EBE539 JUSTINHEIMBIGNER
914,143,764 *5F2C0A4391D4667946D1F6E8F01D16F9F8418626 JW_SHO_I
914,143,765 *5F2046BCF213D616EC418B393FAA4E1284058EF9 K6=
914,143,766 *5F2864B6ECDA8E70054F4589EB2ABEB3CF89ED92 gdsdvct5
914,143,767 *5F2D2AFEC301813673928B047A4574AE10B6F347 GEOFFREYARREDONDO
914,143,768 *5F202AD3946326FFF6DA8F0FA5E722A58A9ADD74 geraedo8
914,143,769 *5F2FC094472ACB4C5052E48A91504FED88CFA2EE KBBLUES21STCENTURY
914,143,770 *5F297953DF6874E6CFA176C275577088419217AD kbd}
914,143,771 *5F23C485ED8231A020C95D4B538B7E16251CD168 GESLEMPT4
914,143,772 *5F297692903B9B3F4EB05A8AD42D9D28A9B88F59 keenancourtenay
914,143,773 *5F27A61C0EF3ED2CEEF4B1CF263BE2328DCB54EB giancarlo.meo
914,143,774 *5F2F34C0B093441269CAE53986947C483F948107 KENNYFORNEROD
914,143,775 *5F262218C7E1A3AF924E534587807CE78A878A0F KENT-MARLEY
914,143,776 *5F2A1F85E7BDB48781F680D9EBC42DB35E6237CC GITLENG
914,143,777 *5F2138A3758AA5B7F3111702DDB437E2EDE5D36E [email protected]
914,143,778 *5F2186D43C81DEAFBE984499F9BC33AE4C6175BA GLEN.BULLUCK
914,143,779 *5F2D4924704E02A4B68BB969FDCC25C7CE46FC7C khanmarc6
914,143,780 *5F2F78FCD54F6C6E0EC781C102247DB882A2F8D5 GNC9
914,143,781 *5F2AD53C39D23F9AC944C090CC74FE5A37376EDF [email protected]
914,143,782 *5F20EAD563B86E1F85E0C0673DBD9F71853D3DE1 grahamallbones
914,143,783 *5F23A521E0F7878184BB59D4EC084E8BCFA97BF9 GRAIGPURKETT
914,143,784 *5F2AA792598763756BAAB82B272C96146848987D GRANVILLEGEISZLER
914,143,785 *5F2227EA2D4BD129ED438663F8BF9FF7BA01EBDB GREATPYRENEES826
914,143,786 *5F2FED99DBDA355D115319F51ED588E93B6EE3D0 grundspel
914,143,787 *5F2BBD9213FF61DD4F52DA1B08BA325813F2C9DF kriggirk8
914,143,788 *5F29CB2C7F50179E409EF2872F7C9FFCDAA913CA GUANRUITI
914,143,789 *5F2707D952831C2096A4987B2C8CF64DA9C3A96C guapetillas
914,143,790 *5F25243C58F45541B800C50879D706422A0264EC ks'%
914,143,791 *5F2548A939FC7729E849CF7D56F7B626118C2472 GY5E
914,143,792 *5F20BF622B90044028CD1423E8BC21B812596E63 KYLE.THOMLISON
914,143,793 *5F261AF7A559F488BE76A5EAE7CE7BAB31EFD1FA HAEJYJEN
914,143,794 *5F2C5B22A50E84836AFFAE2575D8FA2F39CE9814 hanskaraffa
914,143,795 *5F24CC1746525F23011165383A9035E903FDD234 [email protected]
914,143,796 *5F229ECC1A27B2BE553CE1C5A44C2FE04A827CA6 HARDCORE-HEAVEN-4-(DISC-2)
914,143,797 *5F2488070356C09DDB24C9FC85FDC218C2AA9AA6 harrisonfinnicum
914,143,798 *5F23C13247DCC8F90BF20D65F7FB45FE73F646AF LAPCOVER
914,143,799 *5F24F177902C14FA1D2FE72C61C85DE6D6AAC083 HAUTBASSIN
914,143,800 *5F2C85B5E3C639F9A146DEC0B108D32B95DD2A44 LAXAMUSED
914,143,801 *5F2EE98A5277C9D713259591DCF3DA1D389B28F0 LAZARO.KEARIN
914,143,802 *5F2940B1DDBE949BB1F6F3B1885B896E48F61C8A LBERSLI
914,143,803 *5F22BE2C1AA623E51962F8004474EC717AA63218 LEE.MORILLO
914,143,804 *5F2A575FF6DF3E642D823910A18761CDE8D506A8 HEMOLOGI5
914,143,805 *5F2B152F6A4C80A1F0ABC9AF5CA49ED101374E90 HERB.KINAS
914,143,806 *5F29B9E984395FCB562BDD6F676D8CEB840F10C1 LENAPIA
914,143,807 *5F29B0A1DB5841A4572E8BBB1F090FF9028A7B1E HFINGER.MAN
914,143,808 *5F20881236634D928117C618B66C44F6DA1CBC1F HH;9
914,143,809 *5F23D5D74208DDDBD60E47196BBB67ADECAC0B9E leroyandreassi
914,143,810 *5F22032CA242801E255C72EDFDBEC982486683B2 LES-CHEMINS-DE-MA-MAISON-(LOS-CAMINOS-DE-MI-CASA)
914,143,811 *5F213BBB25D564C9F80AFDF07CAD28082BE4B915 LESLEYKING
914,143,812 *5F2020ED28E23C7A42FF78723A4FEDF53A3C34A2 [email protected]
914,143,813 *5F264516CE6FAA7B0805A47CD8C8CB20DE75F8BB hi?y
914,143,814 *5F26C6AA7862FE1BAA8988A240602BBE50540069 [email protected]
914,143,815 *5F2A0E4B9237971F731DDB62D855A21677D36279 [email protected]
914,143,816 *5F21E7770DAC89D696516267B7544C00A79AC991 LIÉUSOULO
914,143,817 *5F223A9DD82EB82ECD940B5262E675F1C99960C1 HOLLYWOODAGOGO
914,143,818 *5F20FACBBBD83AF793551DA5983C22498E03756B likhetsfilosofien
914,143,819 *5F2F4139795219D3C162E44B522E25A93B121D95 HOMERKING3
914,143,820 *5F2A7DFFEFF0469C84973F9C2FBBCCBE3852AD72 HONKEI
914,143,821 *5F2D29CD3FF2AC3638B1BA36F645F0A1ECCA4B42 LINDSAY.FIELDER
914,143,822 *5F22FA8CFBEE8C68C07F3BD5E6E8AEEB70B6AED1 LINEKERSES
914,143,823 *5F2A14530EA0A8D7DC2035CE5196DED63E353CAC LITTLEOBA
914,143,824 *5F2A1EAD17F137D7DC00748127A9AD22066E9941 [email protected]
914,143,825 *5F23FDA980152E079A73268FFA87D1AFD5584794 ljooswm95
914,143,826 *5F29E393DB1A6102468EA68FD8D45828F616E485 HTVN
914,143,827 *5F213B2BFD72CE1B82FE8B09734A3B4B9BFB23B1 HUJUEHUANG
914,143,828 *5F2A9E99A676EC934423A651A1CDA269DAB19B48 [email protected]
914,143,829 *5F2A475DC7D3125986423ED26DECDAD8BCB44E7A hulledame2
914,143,830 *5F2598610C51E0A46DD25B7BB5AFA97044F08AD3 López-Arias
914,143,831 *5F2EB612A24E0E88200505B27B593E98112DA217 huslander9
914,143,832 *5F22F99C7BCC59F337082D6F67E81928B495BC8E Hを超える速球を投げる本格派右腕だったが、3年の
914,143,833 *5F26371ED2B87D88B0EF7F24E4DCB54F2E1646B1 louis-schumacher
914,143,834 *5F2EBC272B793F76A71647DA88FFBDD3B64B9B42 loveisaslovedoes
914,143,835 *5F22C36CC616FD85E90E85DF8C3D980FA00CD5C5 IAMGAMES86
914,143,836 *5F2F04353CF5C1D999FECF06D6FBC7F14EDCB3E1 IAMLOU70
914,143,837 *5F20948205FABEA9C95BDC63FF2B09D4D45B2C1A iberici7
914,143,838 *5F2485BE3421CA0D735B37928E03E461CBC6C5E2 lucifer'sboogie
914,143,839 *5F2AB3925BB81FE79650D63775DA70A8B076558E LUKE.KEASLER
914,143,840 *5F2CC5CD2EFCE0CA4BCE2BA261DAC4DEFA355641 LUKMANBABATUNDE
914,143,841 *5F2C7170852687D2E4CB784DD45E3391AE32A875 LUXURY_VEHICLEENTRY-
914,143,842 *5F20CB8B09135DC254427D0ACBF3B61934F9E159 luyueh
914,143,843 *5F23133351461EC18E1AF8667F3B22648ACAE161 M15T3R10454M1K4
914,143,844 *5F2ACDE67FA902DCEECA887DD3EDDBE705693AAC [email protected]@LIZING
914,143,845 *5F2D32F4C8886E16C8032252A426ABB8B665A6A1 MADEMIKE
914,143,846 *5F23BDDC216D506FF3663158655D9B3D14CAC6F3 MALCOM.DIGIULIO
914,143,847 *5F28AF5ADA93DC1ABD42F348D5E68EADF9985AAD MALIK.STILTS
914,143,848 *5F22B2AB9047E045F1332812E6CB908B5B1E439B malmeja
914,143,849 *5F2355CBAC5529F7112726861A953A96691E7BA2 iniimah6
914,143,850 *5F22B663DF177C563C20DBCD219E33CC4FA5BC55 ioabbswing
914,143,851 *5F26755034670D6391B99E0E5D6826DC58FFAAED MARIANO.HOSEA
914,143,852 *5F295B026517DDED92528A0129398432C6AB6F63 MARIASTORNIOLO
914,143,853 *5F229A1BF868DAEAB6EA8CFE118A315DD53CC1FD MARIODHALIWAL
914,143,854 *5F279E9DF906EA02451243A7CBFD36FD1654C84E irvinglab
914,143,855 *5F2CD166E16F69D55734A6BEEFEB8AD56DECCEDD MAROKKO2007
914,143,856 *5F214CB64F8A0EF8562457ECEDCC89AF85ADCE43 IUsedtoGoWalking
914,143,857 *5F24E945944F24D9A78681016A29009A558DAB9F may-ann-navarro
914,143,858 *5F2DD43098802CC95B549EDEF02871A5898615A5 JACKDULEMBA
914,143,859 *5F2AF5428276BE1686B957CCBDDD40EC4BCA1EC9 jaimebendler
914,143,860 *5F20274BE97044020D21ADE8E6C1A87C5E86AB0A jaimefontenot
914,143,861 *5F21F60D3359F5C3E28468EABFB6193515C9517B mehrbetr9
914,143,862 *5F2B4EE94F9423EA6E4AC286657F7DCFE1FD9A99 Melisa-Marie
914,143,863 *5F257602EE23921135FCC43B3B61B6DAE1E1149C MELODIES
914,143,864 *5F201E0E5566485951D5A560E8818F1237A496A1 MERRILL.TOBECK
914,143,865 *5F21938590BD835CD06B5CD395411C9523BF62C9 jarvissilk
914,143,866 *5F21B119402668561AAEC9D8FE27E21747C594C3 MGC126459
914,143,867 *5F21B80B5B6F6F5CC627B779B8D72A0A60A1599C michaelforcello
914,143,868 *5F2A8E4AC4BCAD9C1BE6990F4155C952E72E9055 jeanwaldrop
914,143,869 *5F21308666BD24B925BB94B3FE7D4AA16F1C9957 jedi665
914,143,870 *5F2361E59B53A63B91BAA510F636D94AD87AB304 jefferymazzacano
914,143,871 *5F21E910D5789EC522FE981BC605AA24641661A2 JEFF.MERCADO
914,143,872 *5F266B31142A79DCF96D9EC21B1C72936CCE3F6A milancucuta
914,143,873 *5F2C57276CA002F9B84E9F76745D1E5C41D15F50 JEREMIAH.WITHERSPOON
914,143,874 *5F2C6B2DEB10B844BE6F86CC25409967F20DC40E JEREMY-NELL
914,143,875 *5F2D527958F65449B5A6F015EC4836BD729D8381 MISDIRECTION.N:.~MISDIRECTIONS
914,143,876 *5F272F7B6335089D334394EB2DC8D2EAAD2B2563 misfires
914,143,877 *5F29BDC7C12E3BE483156C6702038144604D7014 JEWELHARSHFIELD
914,143,878 *5F21B1B6B8C0D5E76AC314CAA8EB72CFDC066F23 MITROVCI
914,143,879 *5F278EE4516C07AF5784C21EFDD7B10F2A924501 JIMMY.EHLER
914,143,880 *5F2780C87C33200C5B41204920A419C321D8E75B moisesfann
914,143,881 *5F212210A21F63CB938C15E75F6C1C1FBEC1B1B6 MOLDOVENISME
914,143,882 *5F2846F3D8DCA45D6482232693A8153810F47122 jnx3s
914,143,883 *5F24FA5F9C3EC5C000CA037CABFD58AA4EFB6A6A MONA.RAMEZANI
914,143,884 *5F28D25D565AF45E874E3882CAC22FB26AB65FB4 JOAQUINJOHNOSN
914,143,885 *5F21BA82967F06508D233E85854ABDBA3BE78487 JODYRITTINGER
914,143,886 *5F250FD1CC11D06EED7501EED861C510862A5323 [email protected]
914,143,887 *5F2B026B70F61D7CC99C92918590190DF31226C5 joerobotech
914,143,888 *5F2FCD82F285CE55087EA8793B0804EFAD7C3E51 MOONLIGHT LOVERS :30
914,143,889 *5F2E5926911A7B77E3053C39C53D01E28A86326E morganmacomber
914,143,890 *5F2D77B84079DC10DE3C034104E95D98D5454A18 JOHNIEBECERRIL
914,143,891 *5F2E5731A52E00C63407F8F4C95918564C0BCD12 johnnybonebright
914,143,892 *5F2EFA19EE7F2DDDCE485C49AA5CF8F0C8F7B7B1 movedgak
914,143,893 *5F2D5DE928B380283E1F694370EFD8F4E233F7A4 jonsprehe
914,143,894 *5F22CCCE4FE32F58CF4163FF4123C2BF8A962144 MSPONCES
914,143,895 *5F27D8DE4383C94822F6E3766720D1A717B134CF murakao
914,143,896 *5F22530C562C43A4D1F68373A88B7DD1F0A109A3 [email protected]
914,143,897 *5F246217DBE43DBDA1D6597A726C2D770B6C4F76 JUAN.RAPLEY
914,143,898 *5F2C02CC2519A0C1F50AC189447A161BD44B558F mycompton27
914,143,899 *5F2EA686131FF2C3AB5A046762F96010632851C3 JULIANIPPER
914,143,900 *5F27B53E423A7FEBFA006716CCF3396FF4423B82 julianliquori
914,143,901 *5F2294164E7CBBB836FB71D5AC7BCB8D96BE8D93 [email protected]
914,143,902 *5F23EDA60436CD46EB769093C42CD8F24CFB6BBC na7!0na11y
914,143,903 *5F2B533ABF8EB089F3147A12FADFFC3314412336 KAHAN..K.AH0.HH.AA1.N
914,143,904 *5F2CAA56056B2E0D3C192A3A5D9CFCFD8DF249CB NAN117.BBS
914,143,905 *5F2397691244CD2E8D7F1F0837E0D04C0DC88F6F naris
914,143,906 *5F289975981706476314E70272100E73CE50B40D [email protected]
914,143,907 *5F21754BAA43179785A033787B9300563D4699B1 NASTOLUJE
914,143,908 *5F2B9E51CBB35861939BCBF3481BE76E727470A7 kari.diesen
914,143,909 *5F2D355E90B2EBB7E2F3F7A7ADC950B639C6D92A kasgalar
914,143,910 *5F279852FD1769C1C1261E9EA825185A2F3CEC00 NCFÀW
914,143,911 *5F298175ADAD515001F0CD68A76EEA1D95538A8C nelsons
914,143,912 *5F2238469F61803389F015E02C63A161EE319A6E KEITH.WALIN
914,143,913 *5F285BE1F3D85E13E3210E02F4A276732C4586EF NETYCIT0
914,143,914 *5F24605094DAB0A70BA09A9CC743F6264FCCFCB4 NEUFELDROB
914,143,915 *5F22DE3E9CFC6549A40C633F9D486E3CE46AC3C8 NEWOODR
914,143,916 *5F239273421AEA33A479EE5797FEE9DFB34145B4 kennydelasbour
914,143,917 *5F247939D9399E536086EC2BB8D11624C9BC3AB2 KENTON.CAUL
914,143,918 *5F2D514107FBE3AC0C71F8BD13BEBFD06F41661C kermitbisaillon
914,143,919 *5F2A8DDCB8B62435B9323AFBF190AFE5D6D1AF95 NICHOLAS.RAFALA
914,143,920 *5F29A2DF86EF5E1D8B09CBF3FB0BD65305B75BEF NICK.MCCAMY
914,143,921 *5F2D6A5C35EAC36C2E8FE2DAE3DC3014E92F3749 nicolasharlin
914,143,922 *5F2ED588A1B7B8E4A734DE332AF056A93A645D60 night-fall-dub
914,143,923 *5F2C9AD456103AB584B1C754811479B9836B1EC7 KING1964
914,143,924 *5F222B433C9292B24CFEECAC3217D40F3D422C39 kipbrowe
914,143,925 *5F2E2324DD2251F5609A459195C68A3A039E95E3 NNAMXUB-2
914,143,926 *5F23001CA3DDF347E8992C15736A5BDD528D6D62 KISOBOKAR
914,143,927 *5F2D22FCA4533E0202188EDCD990D85E835D787A NOBLE.BENDY
914,143,928 *5F21102A02CE72D770C70F8E0156C5FFD69634DB kmsrsm23
914,143,929 *5F2954827CBADE652F20A7C5DDE74C22FAD5C7B2 [email protected]
914,143,930 *5F28D631A7138B6AC15A061F697952C79D4538C5 KORT-HYLLNING-TILL-PUNSCHEN
914,143,931 *5F2F3C2AD642CBDD31A7F75F36E0744A9133B401 [email protected]
914,143,932 *5F29537C2C45EBFDC1F08FFC8F52759AD4B9E9C7 Now.I.will.have.less.distraction.'
914,143,933 *5F2249AEDF1E7DFEBAFEA094D86E8F429A75899C NPLTNST6
914,143,934 *5F27163AFFB938D40C8AF419E97545C7704B2A63 kraigholmen
914,143,935 *5F203D4A583DB6E3F345C2981573FED9EAAB6E68 KRAVATIMI
914,143,936 *5F2EBBEB637DE32EFF80FB1C39F5B873FD21C9BA [email protected]
914,143,937 *5F2A625225AEB2161681BA7AEA0A8F31082B0A26 KURTIS.DECAPRIO
914,143,938 *5F2B154F624262C06C773B7EE7A4CCD3F2094A51 kusinesing
914,143,939 *5F2F7E5F979311732EA9843C2309060BDAD5E832 KYOUZIMA5
914,143,940 *5F23F8441F3823343B181F109DAB2B4E4FAE3E63 ODIS.KINNIE
914,143,941 *5F20B595D35EFA4C3AF642D5CC34AF4EAE722FF6 LADYCLAUDIUS
914,143,942 *5F2E81C6B894561C116DFA27C0BEA05EAAFBC747 LANDON.KEPLEY
914,143,943 *5F2BC82A19BD234D8EFA3C0665AE4ACD570D98F3 LANE.HUTTAR
914,143,944 *5F26EB53D772D4F01095E4F5CF1081A6AC239CC1 LANLAGAN
914,143,945 *5F23A459A94E0BE70C22CEFD033411234566C8F9 omarnybo
914,143,946 *5F2307C32AE64A82FDED95CC7A70E7179952C3E5 OMAY-KOMARA
914,143,947 *5F28217CF4D4FFEDF4CC40CC1787CF8A252F3F1B [email protected]
914,143,948 *5F2239AC109518C56ECF3CFA111A57AC04AD2E75 LaSambadessanspapiers
914,143,949 *5F21075B73B2B1905AEC07CBD42F9A11619F8D03 ONEONTA10
914,143,950 *5F2A4FEE400D0A0ED609056C23145EA329D29EE8 ontspan?
914,143,951 *5F2C50B960F873607FE87567CD452090C317F838 LAVERN.AIKEN
914,143,952 *5F202EFF6087F6CBD6D8BB81BFF29C031216EDBA LAVERNEXIONG
914,143,953 *5F22B84F5A8678C90C47EFA83823C56ADB37EE0A (>_<)o~-(=p
914,143,954 *5F26F52B8AEDD6C6BDE5DCE13A0BD0642D2AEECA [email protected]
914,143,955 *5F2DBAE9D75070EA8AFF4673468AEBC4B4D1BFEF ORIGIN002
914,143,956 *5F29A61801D707420D1A0CE82ECD0A779CAFA0DC ORLANDOHOURIGAN
914,143,957 *5F23E7624D364FE67B546FAD4A43219AB3A7C34D OTISPERUSSE
914,143,958 *5F2920E5442833895A510A0E63B0AF37FDF9B4B5 OTTODUNKAN
914,143,959 *5F283BDD17CA653585020BA98B29AFFAB243840C ou78!dd!ng
914,143,960 *5F20EAC66A5F4571C3CF656BF7E40BACB2A73F6C OVERBOARS
914,143,961 *5F22B64C22DD101233AE107B713814FB0A1EFA6C OVERTREDERS?
914,143,962 *5F26C3B65C70585080EE621A116F161013317CD6 p====)`~)0(
914,143,963 *5F2A1BA6750A1E2E15C2D85B92B809BF149C46EE [email protected]
914,143,964 *5F2341321F95DD3834885AFF5ABDABFF06AA0338 Life.in.Yellow
914,143,965 *5F2B94CDCEE1AFBBB4C7E966AD542102C62BD0A9 palestrina,ii.akt2.szene:moroneistvoninnsbruckschonherein
914,143,966 *5F28A9F7C7DBA576DDEAF7BCF145307BEA661D7A paul.lobb
914,143,967 *5F2D529B999F3FC0C69592522E8BCA7E023D5D7B P####B~O~O-)0(
914,143,968 *5F2D6A5AC6FD2FEFFC92AD30A44C27C77D7EE84B p=D~o-Splat
914,143,969 *5F2A6576347632EBFAE59001E19F8AD7220D3BBE LONNIE.MCGINTY
914,143,970 *5F2D689B8F5436B829FD36D6C8DAC4854244EC34 PECANS0
914,143,971 *5F272227712B3BC28843588E1A5B875A05A9D9BE PERICOLO,COMPLOTTO,SVEGLIA
914,143,972 *5F24692EE5FC2A1DA66F1442ACE80412AB9FF14E PETE.KRON
914,143,973 *5F2750A3693A24EB92E1385C0C65D76F9A871AD8 lrexha475
914,143,974 *5F2946D0614A30F83C037F9BC6A56774002CDB76 ph0709enc4lly
914,143,975 *5F2B5A2BC28CA34DD68F9A45B5D18F24F54BDCB1 PHILLIP.DUNLAVY
914,143,976 *5F2974CC2DBC31DCF7554637DB99BD7D6062F691 phillipgrunberg
914,143,977 *5F219020C593BD9503944E2D564571F71539051E [email protected]
914,143,978 *5F22E549A1CE0ED4B8778AAD845EF8D6B202BD72 [email protected]
914,143,979 *5F24F33CFEADB15C9DFA44A96B37D18E2AA78444 lus$
914,143,980 *5F23D9E064621E84ACB0E81B15A6B49FDCAF675D LUTKAROM3
914,143,981 *5F29906B9106F36CA858B7D0E650A776D79312D6 [email protected]
914,143,982 *5F2370C004D77E991950A785886E60F5A271CF07 LYLEMEDAL
914,143,983 *5F2659F744CAB5AE2C3741BC14B97E0D5BC19700 PL4GU3S
914,143,984 *5F261863A7F4D05D53E2D254AE2E2C0655E418D0 P)~~~}O{
914,143,985 *5F2A40E6C7CF96F872E8406616FBA210097F3F5C POHJOLANVALKEAKES
914,143,986 *5F27029A4639A0BF4EF24081CD4DBD97A6E1CB75 [email protected]
914,143,987 *5F2A4327254C2F6AD2360E137A44F1532E92C6B4 [email protected]
914,143,988 *5F2ECCF6BDFA6BA5E29A32DA95BA6D85454DEE40 MAHALKO17
914,143,989 *5F23E1448B0DDE17693BA59D77EA6070F15542C2 MAJORFRANKENBERG
914,143,990 *5F28481BDD1D33E7DF78F5AEF071C96574C55BE1 PORTAUPRINCE INTERNATIONAL AIRPORT
914,143,991 *5F24491FB9EBA592665F1FB22792F908C937D68A majorvassel
914,143,992 *5F2BFB75DDD90ACB9D06B10535439564657D3A5E MAJORWEDEL
914,143,993 *5F281937A01B7807C45D6522C1606170A4A4409E MALCOM.MONTON
914,143,994 *5F253378D4506B25F7ABE50CC8E3D9AD5C44B810 p##>`~:p
914,143,995 *5F2FF9BA47AFB28AF26C3D63EAEE0D885BB925CE P===p`~`~)X(
914,143,996 *5F248EFDA66EBCACE59E89CB32FAC2BD19AC98F0 MARADYV
914,143,997 *5F28B2FD37D48719A2142F0AE835648947BB2F03 marcellusschueller
914,143,998 *5F27B928E8891186F694319D37058130918D98BD marcusbenfield
914,143,999 *5F207B99ED4A0DF919898981FFF506E2B2CCE8DB PRESTONDELAGE
914,144,000 *5F26AB4CCB38ABB9FC4BEEA2813CF0E4678ED33E PRIYANTHA PUSHPAKUMARA
914,144,001 *5F2C7F60FE5D23BAF88E29C8F9D6844A850BBD33 profclub2
914,144,002 *5F2953F5C9D70F9A7EBD1D2E7C765CCCE408DE7F PROVEXISSE
914,144,003 *5F24CF28261EF6CC9142A84B3E19FB7FDFF48BDF MARTINEZ.ALEXANDER
914,144,004 *5F2A7AD5CE5AFC8C9848E8741E3D5FE07FB169A3 PTLAVENO-MOMBELLO
914,144,005 *5F2D1F028D436C55478E2195490266B42F19093C pug!l!$t!c
914,144,006 *5F2DAE10531CFC306C36ABD68BF2D4CE8EA9F062 MATERIAALIKESKUS
914,144,007 *5F2DA49CAC406A55C3D347757E0F877EE5FB5FC0 P>* (X)
914,144,008 *5F2E6BC256619BFFFD47D4B5EC8DEA3E373C71B1 MAVERICK688
914,144,009 *5F28EEBD489A57EC7D710E5880288E2E15F5A09A MAXHALSEY
914,144,010 *5F2C9A205A10F2E63EF92B563589BE8AD302C6F5 q----d-~splat!!
914,144,011 *5F290391B4A910E85F8FCE64C5AA2BDD23471E66 mazharin
914,144,012 *5F28B1AAD8D672A708D9E038B7C92131A4FC81E7 MDR121028
914,144,013 *5F2C7578D7EF0340195DBAAD47C8DDE08F023BC3 meganlanders
914,144,014 *5F25FC441DB47F1D4A9B6381AA468A36AC07F88D MEL-OCIEL
914,144,015 *5F299D93E7F06F1A35DA7EF07290842AB815F1AF MELODIES
914,144,016 *5F2112CA8E22D8102F6027B01B2F90CAC488809B MERENGUE
914,144,017 *5F22C91C223ADAAF6412833AF720CEAC82FA08B0 MICHAEL.BRILOWSKI
914,144,018 *5F2B2746007B0D77C573110DB15C2ACD069B2D01 RACHAEL-CLEAVE
914,144,019 *5F2FF0468D6F689DC9D9EBF055053DD7F378695C michael-torgler
914,144,020 *5F29756FE0549B21D7A40F42337F120C2EA13659 michealthornes
914,144,021 *5F274F7D80A28626AC65F9732ED07FB0129045F7 RAGA-MOHAN-KAUNS
914,144,022 *5F224B4269D6AE159EB74AA56FD9F8126D3ACDD3 RAJZTRIENNÁLE
914,144,023 *5F2649D775D2E27CFA609569360D056B575A2C6A midsummers7
914,144,024 *5F278A31DF64E0D69581E34C5343399BD455147B milanlorick
914,144,025 *5F2083A4802AB700226D237425ED237D7D7CE08B RAUHAKSEMME
914,144,026 *5F224A53A63C1CE97B46BFE45E8099CE286C7523 raymonbeckers
914,144,027 *5F25E29FBC2870345DA464E050209668D898FB4A MIRAGETRIXIE
914,144,028 *5F2F0A0F36AEFF5F3F836A93A06F439013317E06 misfires
914,144,029 *5F2F3BC90FA6FBB96310B5331AAF9A4B5FDD4661 REGIFICUS8
914,144,030 *5F23B3BE2B6AF29A9FBC899A7090A20EAF637093 REGINALDHUGE
914,144,031 *5F29062C5C53511047CB435D8CC5F2AEB0A93EEF REGINAS
914,144,032 *5F2F75A0E83C2B2AF77A618159EDA4AC05CD873E monroemackellar
914,144,033 *5F2928D5C53F68BCA79AADAFB13630ECBC505206 montedesloge
914,144,034 *5F2E62526D99F54777E0A62064BA54B52E5B9006 MONTE.FLAHARTY
914,144,035 *5F2BEC94A172D153AB20EDAEBCBCCE8FD8A79559 reincarnation-of-death
914,144,036 *5F2BD5014151F349CC108C31A27CCC1FB82447AB RENATO.BOJORQUEZ
914,144,037 *5F2D0C2CFE78D52BD025BCB1039FA50E33ADC2C9 MOUTHCAPTAIN
914,144,038 *5F2B45D41DE526004CD7DAB4D8E7477DA9188BF3 [email protected]
914,144,039 *5F2A180DCC02B3C8B79F033312DB0DA27719C9A8 RESYMPHONIEOP14:VANDANTE,QUASIADAGIO
914,144,040 *5F26AC09B5D12602F3790A81638074F61A4AFA90 MTRLZTNS3
914,144,041 *5F29142728F5D5F844C60649870F7D1A916C1C4F MÜHLFELDSTRAßE
914,144,042 *5F2FDB868548101BF47E02044285B24D62F978E0 munakoor
914,144,043 *5F292B954544DEA86A81D1480BB40A2B6DF29741 RHC&
914,144,044 *5F21414225F1DAEBC045B2E13F9F53EAC154D5E3 RIA BARCELONA
914,144,045 *5F265EF941AF3ECF96AEB94EFCD88A57EA6BE8A5 RIALOU
914,144,046 *5F2440EB569EDEB845998477FEA1AFE339F8CD9D myguess36
914,144,047 *5F2D7029CC5046A4B207FB7E910C09EA2E534387 N249=..-
914,144,048 *5F26844FB8F3F711BC95296D97629C201CFF68C5 NAPERVILLEMAPLEBROO
914,144,049 *5F2CFE5DD74877EC6252C3092DEDF22FCDE723BE robblees
914,144,050 *5F25CD19C78B657688A59E8EB72839282D94FCCD ROB STALLINGS
914,144,051 *5F27F2F2B1B9E48CD311935482F71AE8D7FDAD85 roderick624
914,144,052 *5F243A9C375B5E1CA154A727DA4271ED0FF2AAD4 RODNEY.PEDEARE
914,144,053 *5F23AF808449FC0CA80E48090D1AFD4A24C38A2E rogelioschlachter
914,144,054 *5F20A2C2E9E0F0768DBA51D69569624E21184A8B nehemiah-curtis-\"skip\"-james
914,144,055 *5F2C1C6F3676E810E6B71E14201C26B3F83F0C35 ROLF.VILCAN
914,144,056 *5F20BAE3135A56683F300C0DE30CEDFF9878FB69 ROMANROADARMEL
914,144,057 *5F256DD3ED63B3E997DAC21623F508EC46349864 RONFLATLEY
914,144,058 *5F22D20F2379515F3BB4538BE7F41925D1F722C4 RONNIE.ELVINGTON
914,144,059 *5F22318794CDDDD63AEBACF9D1EE8DEF3153C084 NFORCARIA
914,144,060 *5F240D9D11EBD6E6E120043E041F322B0771BD51 [email protected]
914,144,061 *5F2D92AAA679F6E67B6222D5FDB59A7CAD85CD9E ROV2
914,144,062 *5F2FCA7DE5819B9F1AA665FFBC7DF92A92A8C375 NICO19LPF
914,144,063 *5F2949A521B34767398033447AE600C9CC56480A nigel.eksteen
914,144,064 *5F27814CFAB314E2C0CEA79E2D702F5C71A6BE8F NIGHT-OF-BEES
914,144,065 *5F23E86B8B80B72ABBFC358C25173AFF68445817 RUBENEMBELTON
914,144,066 *5F2D38962B4CBB90DDB3092DBB675F59070039ED NITECROW9
914,144,067 *5F261632D8AAA46D00E4E46162F4991CCBA258DD [email protected]
914,144,068 *5F2B8F6AAFFD663A7D0BC65E2F206E1163F8F5F2 [email protected]
914,144,069 *5F2E885EEE29E0C837B8755F79E1A9CB64D6A666 noncon$ecutive1y
914,144,070 *5F218AC7288CE2F964159D9AFCCC1B97708F4BC2 RZ$'
914,144,071 *5F299FE5AC7CC6881D51CA8FAAE66E211599376F NORMANDZOLLO
914,144,072 *5F2CD64B1942CF0638B44E45EE04B8D4F5157A7B S7SC
914,144,073 *5F2F944214F4EAE822B4DF900536AC2EBEFCCA99 NSYNC149
914,144,074 *5F2E84D68CDDCD3253B4822C9AB69D678FBDD849 SAL.SCHMITS
914,144,075 *5F2561484175C44C0900F0A9D899A88988C51B4A Sambacaipira
914,144,076 *5F2895473D0259FF976F790D9458216D0AF89CE8 SANG.MAYCOCK
914,144,077 *5F2DE4AC5E18A95956C2062F7C1C7A79C0198B58 OCTAVIO.HICKLING
914,144,078 *5F2BF28D28216B730E981E84915FD26C7562B998 [email protected]
914,144,079 *5F2E40E5BB0107A62D44B2289496C11BA4EE9EB2 ogp3e9l496
914,144,080 *5F2FF46AAB94600C16D16737743B92EED3660649 [email protected]
914,144,081 *5F2995A96A7A582BAE8FD0B0AC6E6A054A67012E SAVAGEROYALS2
914,144,082 *5F21EF51AF5B0A57913B3411B0835BE5446394C7 SBQSTNS
914,144,083 *5F22CFCD80DE843E6B2FEFA0F834D062DE6A06F4 schoolly.d
914,144,084 *5F24D788388563B537F6A81ED6DCDBCE59A1EA34 OMILOYME
914,144,085 *5F240A7EA8A688DDD5B41D149EDEBBC92DD4D3E3 ONKHUTLELANG
914,144,086 *5F2EF74CA80794DCE63305E6B7CA1DE5A979AB35 [email protected]
914,144,087 *5F295763C58BA86B5D3E91DDEB01BB93F8DC87A8 scostiam0
914,144,088 *5F2D68F8A8F392C303C1F7E90C71A1826ACBEC39 )O(.o~.O~.<=3
914,144,089 *5F296EB3B84482A8EDB1D8B6FE9B5BB1A5D59CF2 oophorosalpingectomy0
914,144,090 *5F26203BC1F8066A412BEDAE9492F1735D71D42A SDZLPCNMN
914,144,091 *5F293B2CD5158A01845A55D932B3E571C1978EB9 orlandofaz
914,144,092 *5F23F94926146665E5D96DDE93D0E39C8FFF112D ORTHODOXMIAMI
914,144,093 *5F2B690E86D8444A8E47D7990D8CC8AD13A6E7BA ORVILLE.HUESING
914,144,094 *5F23186ADF9F0B4D3D86ED0CFA35967B3D54C4A8 SEMIFOSSORIAL
914,144,095 *5F2214DBE4025CA0CF08FDC9530754B3D0A12060 OSWALDO.SEP
914,144,096 *5F2C18DD448AF28AD276E121BFA6CCC9C93C0D70 SENTENCEWIKIPEDIAWIK
914,144,097 *5F25CAD48C17889D0617CBA492C39A552D743242 outechos4
914,144,098 *5F208EE4859894B8B1020DCE33886E8D4D853024 SETENIAR7
914,144,099 *5F20E2F02EC59C39248DF2434C88C12C7E2255F4 SETINTERLANGTOOLTIP
914,144,100 *5F268C670BC83457E74A0B16BCF75C808243F812 SEVIGSIM5
914,144,101 *5F2DB41FD1628918FF95C742831616EA04AA59BC SEYMOURIAMORPHSED
914,144,102 *5F29801087DDD2F82702D388406FD9C275CBBE95 palau-de-les-arts-reina-sofia
914,144,103 *5F2D359F1674194274BD9377B4B1FA4D73613068 panlouvi
914,144,104 *5F2C14D1A145F1928F79CD9C43B2CFEE7A5D27BB PANNONESCHER
914,144,105 *5F2F0C06838981E1CE123B94705B5506E3FDDF8D sheltonmedema
914,144,106 *5F2B031842A5ACED9BA20E5E4C707BF229CD420A PARALLELDISKUSSIONEN
914,144,107 *5F21CFBAFEDBCEB08DFF8176BF370BD1FD022DD4 [email protected]
914,144,108 *5F216CD26643590060297A6C18AD98897E7268F0 SHIKAIFU1
914,144,109 *5F202C1E5246390BF2BA78DA14FDE20A719C5244 SHIRLEY.MANGANELLI
914,144,110 *5F2603FE8263B458B6BD75A26B7E806B669BCD04 SHITTANZŌ
914,144,111 *5F24FF22AC50848EA44AE87230D7A7C8EB5F3C1C SHIWENS
914,144,112 *5F203FCFB25625403A9915A036B440971AF077A9 shootthatlaserbeam(rerecordedversion)
914,144,113 *5F285A3825D761622727E58587CB2428257CB1FF showtaro-morikubo
914,144,114 *5F21B56FAD9E462E2CFEBF0A983F8C08C100D875 SIDEROGRAPHY6
914,144,115 *5F241BA155333E65E08760ECF9C97A912591F4A7 pd`~splat!!
914,144,116 *5F2435E0DDD77C58A7D305B7BED098848C085BE3 [email protected]
914,144,117 *5F248C2D3038A3A57ACB6F71FA7FD58F0B6C8C0A pepel'nij.svet
914,144,118 *5F2FE9AA03F9CFE83F4322E65367F57F9529948B SIZEBOUNDED
914,144,119 *5F2150772B351A9CC010BE64A63B1A66BF9CE629 SKITILAGEN
914,144,120 *5F27A047C012AB0C5E3F91108F6104B467A7A009 PETULACLARK&ANDYWILLIAMS
914,144,121 *5F221BB4191E3FA6B4D2831A097C389E711A11A7 -PFY>
914,144,122 *5F275C191F4C20F74B36362F0B9DD71BFAF401E5 philipkornprobst
914,144,123 *5F2A15FD8BF9387D9942DD2743966277BA0DF3BB SMALGRAU
914,144,124 *5F2A7B4E6FF580F7692EFA145E69BA0D1025E784 PHREN0109I$T
914,144,125 *5F27FDAE069CB0D748B457BD2D4C4DE789633913 sobbalzeranno
914,144,126 *5F2FC1D180440B1D39A83D97268E52BF9DF7866B plantesaften
914,144,127 *5F2C883A968F1010DFB3F398745AB4BEF07D392B SONATINA-IN-F-MAJOR,-H-463-(W-104):-II.-ALLEGRO,-MA-NON-TROPPO
914,144,128 *5F2713A2E3C63C0444913AC0F4A763B229CE80BF 『poison』に収録された「極色一代女」に続く生ジャズver。
914,144,129 *5F2D36F979AFF6970DB8F774D3498B581D0AEE5C sospirar
914,144,130 *5F2A92BDCE874A373770430F4985049F4F47D94F SPEZIALV2
914,144,131 *5F27BC59925A120EEF44272736D6472DF4DA3328 SPHDORJE
914,144,132 *5F265BBC56990C93E8F3ACC9CDF6606D8F07EDD9 POSDATIN6
914,144,133 *5F20804FDA639CFAF4EDC69F8BA6955B91351F0C SPLAT0~Q--3
914,144,134 *5F2BAFCCAD6451E64507CF706038A4027E6AE355 POWERPERCUSSIONPLUS1
914,144,135 *5F2E8F3269C2F4A0323579170A3A6EF983317A2E PP5CD01N4
914,144,136 *5F27841D0DBEB91D20C7033AC8AF56FE078809D8 [email protected]
914,144,137 *5F27AD04E4E682A8ED1A308ECAA03182C92DA01E sregnahn
914,144,138 *5F2526C22FDBF4CB114F9CE25BE5C87706E8824C PR956575個案
914,144,139 *5F2E2BEE608BEC1D4EA706451BC1C140311D38E1 [email protected]
914,144,140 *5F2F57017D52A8E51E3A4E57EFC02D2E301DE0AB prclrngging
914,144,141 *5F25724552EB0A74EDCF56FDB6C6AE82FF5D2E51 PRIVYTE4
914,144,142 *5F24CC2D3E7EBBCEC6E9A5EE2AFC9FDC7F973761 PRMPTRSS6
914,144,143 *5F2698F9F5A2BE561E7D0333CC7048973A952E54 STEALTHMICHELLE2
914,144,144 *5F21D862346D927502EF3F272EEE3F9E41BAB9D8 STEPANOV、サクソフォーン)の3人。
914,144,145 *5F2BCFD374E069D95EC8DED2C9BAD2EC59E997C3 PURGASTI1
914,144,146 *5F2B2B3037EE42528D248F2C74F3C70D46356435 string-quartet-in-g-major-op.-30-no.-2:-ii.-andante-grazioso
914,144,147 *5F210B6516DAE8B5609AC995BE38E1083FAFE46D strtgclly
914,144,148 *5F236DC3EFBB79AD5039F34367F7EF9B54DB3EA3 (~_^)***Q==B
914,144,149 *5F2CB87C55DDC923EF8391EE12AF6FEC7F16F5DD SUBTROPICALES
914,144,150 *5F261B08C0E3BC44BD35DF5EBD73F9ED482A3ED8 SUNG.OUELLETE
914,144,151 *5F27801C2AFD6F9A932B10A3E47CE0C569535237 [email protected]@7E
914,144,152 *5F26696D0DA0EEDCA25A9218645AC34139F31E93 QUEDLINBURG–GERNRODE–HASSELFELDE
914,144,153 *5F246D67FAE4FE48E84ABAA20B81C7B9B3F9BE2B QWERTCGJS
914,144,154 *5F2C6B429D7F3B531CA1953332B21276B3F8B3AF SUSTAIN-&-RELEASE-(DISC-1)
914,144,155 *5F2DEA3A3DFDEF73506EBD43458E44D63AA3B7D3 |*raaa
914,144,156 *5F2300E93306E882C1B23CA48DF5A32DC6445EA5 [email protected]
914,144,157 *5F2AC169D3988D85D294A118A23AD461296072EE RAFAELHELFERT
914,144,158 *5F29FF70AB05C8E882669EDA2AB0E20941556DE8 RAHSIAS
914,144,159 *5F2E794CCDD71BBC4979D8BE0842D18B7CD7D4E4 RAINBOWDELIGHTS:60
914,144,160 *5F2F7F6A8DC6637C09FE30AFD9CC7590014FAC23 SYLVESTERNICKOL
914,144,161 *5F21F22E6BA5F20219D0D08949CA84A914BAB9DF rambudz7
914,144,162 *5F283E820F0E1F028FE33B68BB5C740817E66D97 systemindependant
914,144,163 *5F235A268BA25CDF7A793B11D33CE7B99562180D RASHADYOZZO
914,144,164 *5F22CB3315AA5F88BBEC056FFD3EEE877F24BC61 RAYFORDYAKEL
914,144,165 *5F2E38B4D28EF9C2DEC7AE7D12FEEB677016DDF7 RAYMUNDO.GABRI
914,144,166 *5F2348F170E361302E0B27A71AE42983D5CD453A TALK86.128.19.214
914,144,167 *5F2E6AB63BA3891D4A66F86942875C039DB2DF36 [email protected]
914,144,168 *5F28417F2A1B3A90540F6F28EA4381F266079F56 TAMMYCHANGEME2
914,144,169 *5F20750CDA941ADF4BEDB62609AD104D5CE55298 recolor0
914,144,170 *5F2E17F30294C4788E5DBAE5CE351FFC4676D823 regidjinnips
914,144,171 *5F234A2C906941330DFAF7EB46D04C8B1C40427F tec9tunit
914,144,172 *5F2897DE7B0CF00240354776BB4D40A31779A75C teodorolishman
914,144,173 *5F231228CA3E7A4137C00B42109DCBB609CE9952 TERAPATRICKXXX
914,144,174 *5F235933E0A45B79C4F9FAF99F137258B9B8808C retalhul8
914,144,175 *5F23BB5C6639F967CA195DED7D3E9863BD5B2540 [email protected]
914,144,176 *5F24404907BD61D1ADC49EC37369346D461702C1 TH1NNED
914,144,177 *5F28D0C04E12796BFA9D347164441AE7CB518A30 THATSPACE30
914,144,178 *5F22021ABFF44570D980822271DB0860D632CA83 thecambridgegroupcomwww
914,144,179 *5F2BAF295C513009C9FFB4F8111572C70949098B THECHANEL21
914,144,180 *5F21E24AD58430CDA029BB2ED2EAC6F518413DE9 the-cloth
914,144,181 *5F20B6EE352E11D8427BD7B0B5CBC01E2A12D412 thehouseoflife:iii.love'sminstrels
914,144,182 *5F2BC30251780E5DF3EA1C11B7DF4BADEC09ED80 THRUMM!35T
914,144,183 *5F2B67237D4150054726E8C2A28ADD7BE828C320 rodgerwaldhauser
914,144,184 *5F205982DBA0730E87DCDA1FBE2D5DA00097EC31 TIIVISTISIN5
914,144,185 *5F226A96BFFBB63602ED654B7E6F41A54C50A07B ROGELIOBREBES
914,144,186 *5F28732E4D8B2021EB2E3B8088B73F73D4AA08E5 timothyfranc
914,144,187 *5F26C63320A6165F8A0245B38F7327C69CEC0EF0 [email protected]
914,144,188 *5F2C84BA34BCC9FF10F21E387EA066D8DA2FC93F TITUS.REINDL
914,144,189 *5F27DD749C44E262934999B3CEC10B7BFF0BB0C5 titusyoshihara
914,144,190 *5F25BDCE4D7B283FB576129198C43021E97F928C tobiasmoreton
914,144,191 *5F2BAFD0E12B879FF4510CAC86A430CA176AE9E8 TOBIAS.PAUK
914,144,192 *5F2EF6FFEADE8AEC8AE1CE0B494037125CA07FEE TOBYTEBBS
914,144,193 *5F2C88F918C6ABC016B2C3623215B02833F64404 TODAYCOULDBETHEDAY
914,144,194 *5F24EF1230D9C667BD13CAB87DD57EDEE344CC3A rtllrdpt
914,144,195 *5F2AEC017F049204D362A2F8267042732DF9A913 torontod
914,144,196 *5F20394CB930F546128BF13D772BE5D3ACF4BC79 TOSTERS3
914,144,197 *5F253D5BB972354C195FFF881EAFC3B941117FE5 running.out.of.room...
914,144,198 *5F2CE6AB29A2A4036FF0F33949699D08E7424CD4 TOUQTOGROF2
914,144,199 *5F222B96132C66C1879B35725B8EB90733CF88F0 rushizkying
914,144,200 *5F2457133836796E5C872D4AE3302486491B49D8 russavamo8
914,144,201 *5F2ABA400CEFACA3B9686E346A44FD0E2C13EB78 TRACYVERGASON
914,144,202 *5F2CCDD22DD09832E6F29D8B563924C4987C8BEE [email protected]
914,144,203 *5F204303DCE65752078BCA0DE4F6C8A1B171602B TRAILERESQUE
914,144,204 *5F2B525DAFD9797E496AB14C1194D06D8D082132 train-from-terminal-boredom
914,144,205 *5F2B95DAF26846A45A08DA9C4B96F8643EBD97AF RYANDRUMBORE
914,144,206 *5F299A39FB1F67F014E599FA0E4776B88CC20DA5 TRAMONTANES.
914,144,207 *5F2539EE93960E11994E51D2537469E4EB01AFD1 TREYMEHLER
914,144,208 *5F2FCF779C5AAF15BBC9B37A18F436613D2B9DE9 SAIMAB82
914,144,209 *5F20D42F6BE44E41E1FD959D196AE76BB94A0EFA TRINA.ARLING
914,144,210 *5F20C5EFF3F22EDA3608087BF1CFC04A1711D3AE [email protected]
914,144,211 *5F23502877318F5E48D503C84E52D79473118056 TROYBAYOUTH
914,144,212 *5F2885DAADD913C52B7A23A4851AED4074A790BF TULSIDAIBASSOODEO
914,144,213 *5F28AFD3E690A3C5B2EB0388FF862965AE577BCE SAUSEST6
914,144,214 *5F261CE8C73B1D10323E5BFBB170C94C3A221044 SAVAGEDUSTY5
914,144,215 *5F299D8E34CEB1CB2EAD8B0A6D177A2DCB32F9A1 TURNINGDOWNWATERFORAIR
914,144,216 *5F2167F8453E76F95D700E16124009E4BEDEBF00 TWEEVLAKED
914,144,217 *5F2AF2CADC8EA8A487D9B02B7EC9379EC6188CB6 TYLER-AKEO
914,144,218 *5F2B8CCBBB5C8C6D95341CE243929CBF89A7B5CF TYLER MACHELEDT
914,144,219 *5F2886A144B834C87BFF8E0347C7B1D33A4A0538 SCIENTIST
914,144,220 *5F2E8B8BECE3525A7E8860B201F95EA252A156A4 SCORPULAE
914,144,221 *5F287524DFA6984BE45E574237EFBB505588E1FA SCOTTIE.FENCEROY
914,144,222 *5F2DC4B925889F62D82A2E018267F2A6F05DF9A0 $U8$ECT!0N
914,144,223 *5F2FA696725380DA6933E7DC2A9F7BC9BB4F6487 ÜBELABWEISENDEN
914,144,224 *5F2ED6E9DAA7E0B07549F4499AA2799F85E20522 SCREW-DISLOCATION
914,144,225 *5F21864B609422809872F440E3E072F6F2CC5E20 uitbezemt0
914,144,226 *5F290892200EF8CDE9365826D2646BA4704469E5 ULRICH-DECOSTER
914,144,227 *5F2106C277CC92BF0B531A34813C75F1C69CE612 ulyssesdegrasse
914,144,228 *5F2D2DDA4A55312C2287E076682047EA6DCAFB14 UMANǍ
914,144,229 *5F281DAE3B3598D86642DE1C7D6ED72107F6A224 UMGESTIEGENER5
914,144,230 *5F257AF922274FE6C0FD2AD2AA0B54546CAD11D1 [email protected]
914,144,231 *5F2620370B54D6AA31BB973E8FA73E0BF9F1B64B undiganalu
914,144,232 *5F29149BC45C12E38036506C6186C2667D205BFF SESEREID8
914,144,233 *5F252557C721245AF8D006827192FF3E8472EDC8 UNPOLITISCHES4
914,144,234 *5F252642406F4DBE7FEF13EA2D18FFDB8438C89F SGOCCIOLO6
914,144,235 *5F2B1C7E5E3A9632FD8C03D2000CF9C17DEFB945 SHAD.NIMMO
914,144,236 *5F238894270C6132D186FC45E0347F9BA2586C19 SHALLAMAE
914,144,237 *5F2819BEB00218C36478FB10B8922A7F21ECB902 shanegulston
914,144,238 *5F23E89CF24663C5B8E02DDB8BC162A03BBBD762 shaunbaenziger
914,144,239 *5F2196E47D9859E593B557B58819CBA5BF309598 SHEISTHELIQUIDPRINCESS
914,144,240 *5F2483295BC789E7D8C859803119C50D9AFF9843 UTTARA-BHARATH-KUMAR
914,144,241 *5F253E4FE6186D48429057FB80C689907A1060F7 UVEDERHFTIGT2
914,144,242 *5F219E463527965CBD406A0EC6B10DC2B5882195 shinier-than-any-ant
914,144,243 *5F2DEA12363B98AB958F76D39359298495B94122 shotgunabigail
914,144,244 *5F27CBDF364D8ABEE8958420BFC4C6D99C7260D4 [email protected]
914,144,245 *5F2C9A9A18017E0AE2A969FCAFA43DCC480DD0A9 [email protected]
914,144,246 *5F25B2A02175B2C34C987EE0EE2D8D3C16B9227C VANCEDANKD
914,144,247 *5F28D019ACCD5F5E4C8F5E62A7EC13671E255B0A VARIETETHEATER.
914,144,248 *5F25D1FFF31B83702367C658191FA18AE3AF44BC VASNIERSONGBOOK:VFANTOCHES
914,144,249 *5F2BEC1A37A7E6336C2BF353B3F9E8964E8CF8D3 ver-allan-sumabat
914,144,250 *5F2F2060D11DCE7415F37D2421CB6FFB2F4D99D8 VERECEKLE
914,144,251 *5F21FA6EB99D7C26040180E424761071176D2809 VERFLECHUNGSBERREICH
914,144,252 *5F2A476F0947678ECF75B0EEAA89980CEF009EF1 SLEDDING.
914,144,253 *5F2BBF59C1EA925FA8442C8B544DCB12905EA6E7 SLIM6417
914,144,254 *5F299E481A2ED6CCB78EBF45A46FB16402DC98D9 SLITSOM2
914,144,255 *5F2A9EA6A8A3EDE449670678B7A6FF22E0083894 VERONICASTRADDLE
914,144,256 *5F23AB8C8CC9EF3F5B236051A1C8490EDC746215 vespaled
914,144,257 *5F268B2A87E5AA3D32027E0668026602E9837D37 VICENTE HUERTAS PARDO
914,144,258 *5F22E15009129CE1EC41531828B686FE69B52717 VICKY.DERBER.BASS
914,144,259 *5F2914A59D61AD4DC43E56E21B256F49C5CE3CB5 SO.BUXOM,.BLITHE,.AND.FULL.OF.FACE,
914,144,260 *5F291AD2AF3F9F2179025003CC4E5239BE9E93AF VICTORMO71
914,144,261 *5F2E5BB84BEA2D17C11A349D146362C95F07C385 VIDEOOO8
914,144,262 *5F2D8F7F454150707708EE3D69FF6A8D0B93D68E VIKINGWILBUR3
914,144,263 *5F20DBC17F7DBFB6F15D0BB1B437A1EC871C52E2 vinivnee
914,144,264 *5F25428BBF688CA000F4B9106517745E0BFC0615 sopprimendola
914,144,265 *5F2958E8E0101DA2A47EB7C1C1E944221E1C8756 SPACEINVADERS?
914,144,266 *5F2B43EEE7FFDF7CAFE8E7C19109EE4078B73CE5 SPEEDPROJECTANSI
914,144,267 *5F2BF6A072D65B3D95C7186A19C1CC6625EF9056 volandovoy
914,144,268 *5F27217A8FFECCF9F3B3EBACB68C2DF173644E43 VORZUZIEHENDE9
914,144,269 *5F2B7F3BEB111B8DF5497A572C28178E6FF221F5 splato~.o~.(##q
914,144,270 *5F24316AD3E8D8C4527A890398296645FB9C75FC VSAKNIDY5
914,144,271 *5F2A6DA544BAA1E0B961DC42B6C85952E223590A vT$
914,144,272 *5F218FAB0C2D3CC5DCA2A1038430F95C65EB28F5 walezca4
914,144,273 *5F234F80610FEDA3FF04DCCE418AA3FC81B4859E walterlokhmatov
914,144,274 *5F2C22E1E5CD3E273964B407B47E4167FFF3D61A [email protected]
914,144,275 *5F2FAEF400A65FB16E80AD2B9FE5956C3011B993 STANFORD.PEIL
914,144,276 *5F2E10047C79C77E8EEF67B6316E70EBDCBC1510 WARDDUNSCOMB
914,144,277 *5F2D077AAA68648EA1070D1381D2E318148EF714 waseeljan
914,144,278 *5F2319CFC3A9C9EE56304B19BA5B8F6893C339C2 WAYNE-COYNE
914,144,279 *5F2EDFB648B89E6C68925388CAA996D480EA91AF waynesolo
914,144,280 *5F2A5E2CADA76BAA2624B1A0281C65F7A5F401B0 STEROWY7
914,144,281 *5F2B0FEF7A80CF888A9E335CC8526F6EEBC5A9BB w[email protected]
914,144,282 *5F250BF614C6C9DE7B7FA0092165698B360C9E6A [email protected]
914,144,283 *5F267738064B80F53F430CAF57D992D3E8CD8DE1 [email protected]
914,144,284 *5F29075FF6FF9A2A5B83170CC41BE32B2D448FD1 STRAFSAAKEN
914,144,285 *5F279ACB9C35CDB127E80FD5EE1E1112EB7A9D2C westervalge
914,144,286 *5F2653DA8B80884D586953886865EB5C0F33048E SUAPATIK5
914,144,287 *5F29D43E340E12AB35CFD5205EDF72B0DCB03E2E WHINGSSIRAJANI
914,144,288 *5F2596CC3DDBB3E1C125BD86E55A9A70AA900A0A WILBURN.AMICONE
914,144,289 *5F26404CF21DCB416BAE700BC9E6ACF0A37FF7B0 sumedha.rai
914,144,290 *5F271F3EFFB5C9C2F78AAB9AD3A1B75F965019F4 [email protected]
914,144,291 *5F2B06D10EC59B38C734C66DA8410725BF39FB95 SUNNYAIRHEAD4
914,144,292 *5F269A3BDD3D0AEE547316E16AACE99967E1E478 williambrunow
914,144,293 *5F285CA3FFE12D1D165F69A46647A3DAAC3BF3A6 williamoatis
914,144,294 *5F2752A56C77D08265978665A90C9D703BB5FC2F WILLIAN.BOWERSOCK
914,144,295 *5F284274852D2BBFBAB3957116BC14F248E58AC3 SUPPOSITER5
914,144,296 *5F25AB87039D4CB85B5EE1889EFC96A97C88F02A WILLIE.THADY
914,144,297 *5F2A24C9C0A7F12040EA5748D2922854BC48CD61 surfboy24
914,144,298 *5F22A7FBF19EBFA2FA6172378EA337C14F5AC82D sviluppare
914,144,299 *5F20D55BE975EC79FC20C8359F757BFD12B3DE2C winssingerhuis
914,144,300 *5F29032DED52574537720ABDECB1A2DF43B87800 WMDAMPHOUSSE
914,144,301 *5F270226067DB7DCDE88C49C269E4EE4803CC441 Woodall
914,144,302 *5F2A0E0BFD0CC31DED181BFEC9189A60B220381D wrewuk8
914,144,303 *5F22E3276892C50B033D15B37A5D624F814211A6 tajallia
914,144,304 *5F2B6335AE365AC80AD06F62D2B578DE4F592DFF }X{ 0~D=B
914,144,305 *5F2F91C3B5A2218C1F8EF74EAB9623AC9BF97FD7 TANKERGATOR
914,144,306 *5F2370A452E44174C8A3FB00A28D809B748566DE [email protected]
914,144,307 *5F2A9E92B4C7F634A56CEAFB52E20C68170D96CB XEGBXRG
914,144,308 *5F23E1CA1AAB2808578CA95958EB3643C675F1A3 [email protected]
914,144,309 *5F277C931BEA789F115A8E8B822BFA19B4719C8E [email protected]
914,144,310 *5F2750716859F0EFC0FDC3333B904F7916E1D4EF [email protected]
914,144,311 *5F24F49B5F8129BF0B763AC436EA4F25F60BF132 TECHNOCOPPER0
914,144,312 *5F2324B2CA928765FAC2B051D27B2DEEFBB2DFC4 )X(.~`.~`.Q======P
914,144,313 *5F2E7C926AC7346A909FE8B8012292ADE0D0C631 XRC4EVYFIMKG
914,144,314 *5F24F04215C6E4F1A6DB3653714333680AA352F7 [email protected]
914,144,315 *5F28E019290D6A283FCA3F0F457F80AB2C115B02 terrabas2
914,144,316 *5F26E40213154043465497A480BB4432DF267EE1 terrencefoppe
914,144,317 *5F226CE0A6C9D685F2EAFBA26A4794C1CD2E81B5 terrymcgillis
914,144,318 *5F266347EBC55D9E3947064851D78F45412F9D4A [email protected]
914,144,319 *5F2CF7F1976B93D8E2342F00F5ABFE303B93BF42 YAYENLIANG.BBS
914,144,320 *5F20AFEF747DAF418640B96754CF04B9CAF598F6 yeandle1971
914,144,321 *5F250425148B052781B42A2C6F5A039422A4DB44 YOSSIBECKER
914,144,322 *5F228A0EADF9E370D72646EA94736BECEE983CA7 THESTUDIO2001
914,144,323 *5F2D652DE9EB37DFA2D57621C38571D44DF0D750 THEVENOT6
914,144,324 *5F2CB480FE69E6057C5A7F27A971E1BF709C4CAF [email protected]
914,144,325 *5F2BE211E13256D5B7F082A05C9A81F2A46B2BE9 YUNG-BRICK-SQUAD-CLICK
914,144,326 *5F2163CB6F3983EB8BAB19C5BD0123981A0A59D5 YUNIEL VALDERRAMA
914,144,327 *5F2A8FD750A0D27B3CC6058B03FEF9499C12ECB7 YUVITZA VALVERDE
914,144,328 *5F2E0F88A5782F8E5FCD49D1EED40DAB2C3E0B98 YUYANAC27
914,144,329 *5F21EA13F7708E375025871FAFAB4762A4D9213C tiempo-y-silencio-(feat.-pedro-guerra)
914,144,330 *5F27AE5F70A3C194EF041B71C6A4D75DBBC0E231 TIMOTHYPERERA
914,144,331 *5F2562E45171A08207665F9B9939DFAE4BDC6710 TINTINNABULATINTINNABULA
914,144,332 *5F2855B9DD28642CAE62DA8A3AADB28D08D7E9C5 zackzaheh
914,144,333 *5F246028729D8F9EDAFBB26ED1E0F21DB080960A tjjq
914,144,334 *5F2399258B1D1C89E42352D1870CC746568C885A TNEMROMANEOC8
914,144,335 *5F29AEE2E0028F681B9D3BF48B1BAAA1A630C519 tnereur1
914,144,336 *5F245434DD95114C1E42630F22C0762EBC1205ED z;e!
914,144,337 *5F21078C5A9AB9A3F95B0D9ABFBBA56D585379BD ZETUMEI5
914,144,338 *5F2478ED54CF0B17F0D4F5B2650881D912875464 [email protected]
914,144,339 *5F2447B261CD59A49A93031CD5E83FCF865EF7BB toneyhonokaupu
914,144,340 *5F20CE19B8F2FBE42661776798882307C859113A tonythorn
914,144,341 *5F27B731FA15E3E2790D3C68820A04FF98388243 [email protected]
914,144,342 *5F23E6DB1B59618413012C35A50B9A8DE83BF4DC ZIAFULLER
914,144,343 *5F20A047EFF71C6F1C97D92003D1361F42C73116 TRAFIKPROPING3
914,144,344 *5F26FB6B3DC73AF24994DED27968385E13E1115A transistoriseret
914,144,345 *5F2E08AD972AAD0EE08AD1A74FBB8A57169AB26C TREVORHEFEL
914,144,346 *5F2C1A1658A4BC416AE101F5478306714CD57009 trishica
914,144,347 *5F237C9D8320BC469209E0C5863AB995ED8B7CD9 TROJPÓLOVÉ
914,144,348 *5F29FF188174616513D9C08314EC59B1910F6F01 TROYCROSON
914,144,349 *5F2701365ABE337A4FEA2230F1D5D3E48C4B2857 TRUDY BARKMAN
914,144,350 *5F21511C2BD130BFAC5D0115BBD1A3A733807920 БОГАДЕЛЬНУЮ
914,144,351 *5F20DF79E0165FA79A06F3053F9B3C7F08E1CC24 TRUMPERINESS0
914,144,352 *5F2F0A51B145B447E8C9BAC6AF32E8B0866738DA TSAFDAETSING
914,144,353 *5F281CC67F0632F13299089D418D5368EFE1852E дашулю
914,144,354 *5F27259841CC8ABBFC5DAD4EA50B277E2184B471 tsoi-yuki
914,144,355 *5F29814D7CD48B34017E038FFD8CEA734C28FED1 tsuichuen
914,144,356 *5F2A0766D025C8BC09DB01E737949EAFD67F720F растороцкого
914,144,357 *5F2485DF88FCE032EC8B3C19C440AA9647FCDB15 TYSMIES4
914,144,358 *5F2BE44BD588610C1067683583D30050A7D32C77 UB"U
914,144,359 *5F2B423C414E5C3E4F2A6CA906C1AB3AB418F06A UMHAFSSAE
914,144,360 *5F29A62D071EF962CB4DA46AF196B2D1AE6892B7 UNBORN
914,144,361 *5F217F8AB07F48FDC32F7B64EDF8D42336D5EE70 UNDERGROUNDSCHIST9
914,144,362 *5F2ECBA1C96239516331DF8DAF7319FE3A45572B unnegotiably2
914,144,363 *5F2F0132BA60658236D0EFA0BCAFADF78B48A200 UQSW
914,144,364 *5F23A96149F4A5D15C8740DD0FAE281FD0AF0C1C [email protected]'z
914,144,365 *5F208B3F47D5387E1FB4A1DE6E2E303005BD42D6 VALENTINESHAKE
914,144,366 *5F2184EB569663BAC302FE5DC7B40ED85C403FCB VALMIRCHE.VALMIR.RASHITI
914,144,367 *5F24D03D60EA69794134B6B04404456ED0832493 08061041
914,144,368 *5F2757971903F3CB1B96063724CF30C49FADCC7B VANDEGIRFT
914,144,369 *5F2AB39343D35BAAC36A5606749E7A1382F5E907 1047233 erwurdevontatzeugenerheblichbelastet
914,144,370 *5F2E7866808D8BA666E4869D7D85225C55BAC40D VENTOVDUB83
914,144,371 *5F21276CFB84AED04B4C5168903985DA79B8C5F8 1165111 t
914,144,372 *5F2213CAEF422623BA2661644FD80D2AEDB1BAE0 VERONICAASHLEYSAMSEL
914,144,373 *5F269B6EE2A003C3C72A1A2C9750C58770175595 VERZIRANU
914,144,374 *5F29E900BCD38BC8367D9CA8F3C583FF76C1A0E6 13071913
914,144,375 *5F24903E0D96D25631E466E4788AE0A667E5622D vicky-new-mel-blackham
914,144,376 *5F226E88FBC3D80FC4157480FF79B1374D48BCE3 1466363 VASTAAVANLAISIA.KOKOUKSIA.ON.SEN.J
914,144,377 *5F2CC13A78806BE79D21E3AE74061BFD95B442D0 15january1633
914,144,378 *5F2CF6274F19A13E0FF5A1C641F422F69FE591E2 VINA.ASHINI
914,144,379 *5F2BC50F4D0E1110AFC52FDF853BE32596DBFA93 1726239 OSANOTTOMAKSUKATTAAMAJOITUKSENJARUOKAILUN
914,144,380 *5F206063A08F76D7F0C82797A1F627F2751E9D8D 1780354 DIEAERAKOHLGINGZUENDE.
914,144,381 *5F2DE751433D4AB5FBB64564B1ECB4018EDD732E 1839264 LAITOS./.TIEDEKUNTA.:.2.WEBCT:N.NYKYISI
914,144,382 *5F243439644C0D89D4ACBF83190C2E2329FAE729 1846200 valtameriveneeroaaavomeripurrestamy
914,144,383 *5F2052C4B530CFC0ABA8EE3B79007F9F585722CB [email protected]
914,144,384 *5F245EBF3630FB971B42411B62CBC9EA2BB22A18 VISHAKHA SACHADE
914,144,385 *5F21B382F278DC36980306F2FC37A9F914F723EA 1980455 operating earnings were up 12% for the quarter
914,144,386 *5F24972ED352CDA465F4E12D653FEE3151A4BC99 vitorylant
914,144,387 *5F22095738DE4BADBE37F4482527EA930BC28D22 1 ALBUMTOURALBUMTOUR
914,144,388 *5F2270E3A4BF27057FC0AADC2A020B10DCC914D3 VNHW
914,144,389 *5F26894040286758C0CB51FCE84C59D0A6A93476 1beamten-einkommen
914,144,390 *5F299979C4FACD4294C6D3523BAA79EA092B96A2 1.BLANKOIMPFBUECHERN
914,144,391 *5F25C0A78B30A92742E6B91FC4C753102A45DDA4 VOODOOTRUCKED
914,144,392 *5F2A362CCAD0B007B6CA599D1408EA447392E111 [email protected]
914,144,393 *5F2619E2275C0AD1D1F6260E6D19CBD4FB29A643 VSCATA
914,144,394 *5F2B07D7D421F4BA1F51441E49E9F6D0158997E2 1.hollowood
914,144,395 *5F217CC2D75F2FED5F47B9E131C68A74184CEBB4 WALKERHELMLY
914,144,396 *5F2874A61B695280A47F96342638AA6FCAB8A77F 1iloverobotech7
914,144,397 *5F25B8B13844B67118E3E486DA2783F3384A7905 wanda-walker-craig
914,144,398 *5F275721758A6C2216CC88FBF00791EBDA987EF6 1.KNESSETSITZEN
914,144,399 *5F2D9FBF5F011B97D25A9C561F8DAE04C9DCFC4F [email protected]
914,144,400 *5F2A0F3AEFE2582CE6A9EB5331D03BFFB42ECA0C 1.KUBICKILOMETER
914,144,401 *5F2A7DD466748CF195F3352161876DDA30F986DB 1-leasau
914,144,402 *5F22638B54341643779BC12FF1E832DC6E1191B8 1 lintup
914,144,403 *5F2DBA8C9D1FF2714BCCD6922E96804F784A5F19 1-PILASKI
914,144,404 *5F292D77C32D7842699995060BCD10D5F242DBF6 WENDELLBISHOP
914,144,405 *5F20939FCB26F289ECDF02402B8220AAC901EFE7 weneraner
914,144,406 *5F28ACB3DFC42FD6C0FA169B5202E25D6D8B5464 [email protected]
914,144,407 *5F297AAF5E522B508E6C3E1F5B94DA5397240294 1reunustamina
914,144,408 *5F2DEB99E1707D02A37B87E42FF0D5F09D8759A2 1 SADDHU
914,144,409 *5F2645C9186809F67C19E0C2EFCF6FE914138B1B wescrowe
914,144,410 *5F2335CD20A69073FAA4C7E65D76CF0ACE362F22 WESTON.KREBSBACH
914,144,411 *5F2FFB9450F255A4C5E02D380339D13DA4E208F9 1suenu
914,144,412 *5F281209F19F552F9E5C2B5CB73DBD3842DCC262 wh1rly81rds
914,144,413 *5F2B2AC51213D4CA2293B5EF2855B90333B3118C 1SYGNORA
914,144,414 *5F2B1844E773D0383995C1F1C0A477FB39BB1636 1.TUPLAKORVAUS
914,144,415 *5F2E7C025B429461A14AD5C6361F455F4E364613 1 UNSTIEG
914,144,416 *5F2513FDD4409A413ABF24D517F137EB10DD5F21 wikipediaprinciples
914,144,417 *5F213D3F83DBF2A8ED8B4DE5350848E1784271B4 1.VARAUSKIERROKSEN
914,144,418 *5F2A22A5E3D1F3E64CEDB3AAB2262246498E0BC8 wilfred.mendiola
914,144,419 *5F2FD8E1A60D19E6F17EDF82E784493110ED7AD2 201430 KAMPAUSTENMUOTOILUJAVIIMEISTELYSIS
914,144,420 *5F2937E43A2714D75D825C7EDF1794BE750F9B5A WILLIAM_SOMMERS_FOOT
914,144,421 *5F2EC7295270FE279BB7CCAAC9364BCE2BD7F3BD 20october1519
914,144,422 *5F2D1387237C17FFC297B386FCCF196A83FE403D 22504 buradaprojeksiyoncihazIdevreyegiriyor
914,144,423 *5F29824DE2C03DA010A9CF18069DF454F5A79B9F windyprimarespati
914,144,424 *5F23AC30E47FEAF35B6CEC005E2BF0C95575D1A4 WINFORDHEAPS
914,144,425 *5F2E4ABBE516A6A604A7508116799964B8DA57F2 2469009 k
914,144,426 *5F2C81A67FF071A4ED8D3FA5AA0722283B5D58E4 with.these.hands.(feat..nelson.eddy)
914,144,427 *5F216B6D329209AE36B06782472E342D256B3006 2556781 maa- ja mets
914,144,428 *5F2AED9161852625A75B007997AAD46171873D5D WM.GUILES
914,144,429 *5F215230A30142753CE509C872EA210A3A4E95A3 2830511 UND ZWAR GENAU NEUN .
914,144,430 *5F2D2EE8BFE5EB92B938375578D285134A60CCE2 2867293 radan todellinen kokonaispituus on 2870 metri
914,144,431 *5F2FAC641968DD7F53F190B08F7E73D070A7C5B7 workout-(fitness-mix)
914,144,432 *5F21AB46DDE7E178AF4070AC566982CF0C4EB689 2.BIRSTEINBESUCHS
914,144,433 *5F284D85FA1B81813EACE5E0B26B668CB78CC1F9 WWW3MATHTUBERLINDE
914,144,434 *5F295F5F26E4C5B7E5A5FD22E3AF83F74735FB77 2DURLYNN
914,144,435 *5F2DFE1B90552DD3EFBE3AA443A06FB3917B2B7B WWWCLACTONDOLPHINSCOUK
914,144,436 *5F21D63DBB0D2F60B905728A3F3BC286056DA488 WWWCOTACOM
914,144,437 *5F2E42420CFC3F106F1DEA4D8865F2F4D1533298 2f21150
914,144,438 *5F261D60C8957E83EBEFA4CFDF33D57A02DCE6FD WWW.LIVEFOODSHOP.CO.UK
914,144,439 *5F2045907064583047CE9AAC243A3797580F7A67 wystwhockeymtt
914,144,440 *5F2B083AEE77F1FA2A5DC380DF041EEE37D63D0A 2-MaXiMiLiaN
914,144,441 *5F2C31382337B52DD335F65543D9D87789782142 2myabbott2
914,144,442 *5F220179725B9960F88ACC76B7A48A48DD1574C6 2PLUTO-KUIPER
914,144,443 *5F2BDCFA0E3A4487C809594BE11EB6BD303AA6D8 2PRATIGINE
914,144,444 *5F2C49A2B74F9DD94E593CB9097882742DB565C8 2RECTIVES
914,144,445 *5F200095B6657FF4F026C20EACD1144BC15AA6AE 2seydel
914,144,446 *5F2FCF6DB3D7F30BC7A875364B67B1893C214DD7 2-wascheschte
914,144,447 *5F20D4CCC74F99BD3DEA6F30CAC032E5F2D7D369 3127548666alexydiana
914,144,448 *5F24B47996152CAA45C91AA9ACE2FFFFBE408544 393599 TAVALLINENSYYOLI,ETT
914,144,449 *5F24CB83ED97A6AAD4F89BA921178E388B7DE50B 3-DANSCILARININ
914,144,450 *5F2DE55143741D446757B25E8579FE7DE5D1E41C 3DCLSSNS
914,144,451 *5F2C22CED84B80E124985C956ECAF08C07BC1E21 [email protected]
914,144,452 *5F2825D14B874B2CB3613D681A72D0A5F7B93C36 3-HAZIRLARKEN
914,144,453 *5F2357EBA13D21B50D6BF0A1DA4A6D66177B8DB2 3.hockey-europacup
914,144,454 *5F22DBA3ACB5D79186D10A71E94FA6D9070184DD 3IAMMARIPOSA9
914,144,455 *5F272E07ADA9EF3AB216EC8550E906A66976DCF9 3marilou
914,144,456 *5F213F5C0DF4C799516C659FE0DD246AD1A6F0BB 3=====> ~o ~o>-<
914,144,457 *5F29A3D04DB9F2CFCC8A70D25DC027B0C3E4098C 3#)~o~o(><)
914,144,458 *5F2142533D8DFCD0D3CCFAF7E8363D611D56F8F9 3==P * *
914,144,459 *5F252F2A30F46586DACDBC603A2000D7A1E75D8A YIJINGH
914,144,460 *5F2E60BB692EFB63AE1F4468AC5AA59E1FADF72B 3-unterrichtsangebote
914,144,461 *5F2C4294E551050E2A1B542EEA4C177D1073A8AF YOUSUCKYOICHI
914,144,462 *5F201F125EF84619D49DFDB6845F5B277320C682 [email protected]
914,144,463 *5F24A1483BB664F67167CD71BF6D8766E826F06F 4ep
914,144,464 *5F2B5F68598281F9CA58A16EFE2EEDC9850FAE7E YUSHRA-HOWELL
914,144,465 *5F2B4994E6F2C015060F7B55442669DA81115778 YUYEE HUHU
914,144,466 *5F212E11D49841AC4852DE45F72CE7A4CBB5C83C zach-schriever
914,144,467 *5F2ECA49F136E8662BD9127AF600A8E4CD0871AE ZACKMUEHLEISEN
914,144,468 *5F24475E314BF709B26FF5A51821BDB262CBF58F ZAMFIRACHEANA
914,144,469 *5F268A7580075ADEAA946CCAF9C8F91FCA37BD7D 4OLIETANKBEKENDTGRELSEN
914,144,470 *5F2579136E04CB79D102B80F79D07703F7EC0277 zebrasweetie
914,144,471 *5F29668C7477C40498CBA1D9161546C96CE59735 ZERESITERCNOC6
914,144,472 *5F263FC90A426E1D13B56AEA02CBE32593BA7C87 4SNOWBALY
914,144,473 *5F25C481E4D2C421EB7E88492B3AD7BF8D62F6DC [email protected]
914,144,474 *5F2E2D08B9CC9BB167C50CA19634D2E901546416 [email protected]astnetcn
914,144,475 *5F28B8307309EE7F9E6BBEC5F214BDB0B39BC08C ZHERILAY
914,144,476 *5F222A41157B39C09F5E9A40B735EFCB52E8AE9B zhu-xi
914,144,477 *5F261DCAA6269552C62B6C22DC40051EBFA0E9E7 52EB362C7EDBE12AA4078CDB88669D37.7VAILSKI
914,144,478 *5F2C07B27A650E05E9334EC8B44B01EBDABB0871 53C12370M07012
914,144,479 *5F2113A5150BEF5072617BF73C817875A0E7545C ZUETZT
914,144,480 *5F247ED2127A75DD8B70DCCEDAB5DF2FFB426044 zulemas8
914,144,481 *5F24FE95E147CD9C87A25850B2152F62AB5C46DA 5firmasinca
914,144,482 *5F2ED4B1AF16E5D5AF80E17B9D7FBC3EC1980F77 5HASMANIS
914,144,483 *5F24C3F4A0254580774CA8F9ACF589F64F7611DF АҐАНЬЯ
914,144,484 *5F2F4B8FEDA90D08167D82F615909551BCDF908B АНИОНЪТ
914,144,485 *5F2AA7AEBE1FD1A84AFC5A129CE04BD0DDCCC2B4 АРАПОМDE
914,144,486 *5F28F802A1601855159952C92C72029E9E462FB8 бюскермолен
914,144,487 *5F2F301E68E354A1F8361A83C4AA2E5629CE46E5 5MICROTERRA
914,144,488 *5F2C8755424104E18BAF7AC0D47AD2BB4DB5A2CC ЕСТРАЛЬНИЙ
914,144,489 *5F2647FA8F767ECFA5B8D58595D068225C562087 5PENELOPI
914,144,490 *5F2DC4F3FE8187BAD84BAA5BD078A6B830DB0E52 5PHYTOTERATOLOGIST
914,144,491 *5F27EDCDF2E63FE5F09E51432DFDC60F21CB3544 МИНХИ
914,144,492 *5F29B5361F1500CF1F5C4F29A2AA89DC562C8CA2 НЕИЗДАДЕНИ
914,144,493 *5F282CBAF3A3933F2CCAF12D8C636DCA36E78597 5SERVICEABC
914,144,494 *5F2D4BF87B4F1D1A1AB222B98F545C44873A68E1 5thatcocacola8
914,144,495 *5F26C2AE5524E2B253DBF675EBB3A38BEF10F816 стандартизованы
914,144,496 *5F21A1B946CC5FF58897FAE06F18316A603B03FD 625343 DART.OWNS.THE.CROWN.BOOKS.AND.TRAK.AUTO.STORES.CHAINS..
914,144,497 *5F21991D208B91EED46BCEA77A6A6E272B2B4CDC 62605DS
914,144,498 *5F22CC77D07C8DD283C110E7BE11507A36415169 УГЛЕОБЖИГАТЕЛЬНУЮ
914,144,499 *5F2918257C8F87F42D4F6B396FF8BEB9A349E755 ЩИПАРЬ
914,144,500 *5F20108E1A080EA107ABEAEA41998C0D23DD25BB 6amr666
914,144,501 *5F27AEF399B6BC76975433BC63B37DF6C8677A66 に主将の座を譲る。2008年からはかつてシドニーfcの監督であった
914,144,502 *5F220C11716A5CABC61B20B8714B4BE92062F05B 6CANSASTES
914,144,503 *5F247370392743834983C8C9117A40153CA8A9BD 6CAROLINADOGGIE
914,144,504 *5F2F87C1E7BACF90832E6AC6A14DAA317463254B ナレーション(国産TVドラマ)
914,144,505 *5F27C097ECF0EA449F21E0705AEF3B22910D6064 6ITIMEROR
914,144,506 *5F26B42B23FCEA023176E1482E2D20ED0DC3C4C5 6JULIEELIZABET
914,144,507 *5F2FA9200B1F34B47EDA7623210ADF48862D6AF7 6MARIOFOZZIE
914,144,508 *5F269C0D311E056E30DF459E662B1348B71EC5A3 6THECAMPBELL4
914,144,509 *5F26C6AF069B667E11CC56AA1758975F511CAC79 70vqtpqj2ajm6bbj
914,144,510 *5F2B3622B21FDA7130D09D445E464CD75ED088BD 736148 gOrevlendirmekvegOrevleridelegeetmek
914,144,511 *5F2DAAFB4B372119C4F3D936095ED15B08068275 742060 she.has.never.accepted.alimony.or.child.support..
914,144,512 *5F2A45459EB8FC7B1B0EBC3C4A97A98B7518FD9E 776712 esityksemme lopuksi tarjosimme suomalaisia perinteisi
914,144,513 *5F207960756DB32E9459BB6E22B0A54B3A8DC0C6 78955 komissio-oli-my
914,144,514 *5F2A7984E28109C20CA7B7B24395F5700836CF8A 7ALLEENHEERSCHAPPIJ
914,144,515 *5F20586F75176B134D76EC0885399F62F76DADCE 7KNNLJKST
914,144,516 *5F2E6153C28A4033AF09B2756988E6EDD7C4E087 7MOOTTORIPYRILIJIDEN
914,144,517 *5F2E2248E8B335ACD10B22726DC3DF2996E4A653 7NEBRASKAPRINCE
914,144,518 *5F2818150A336A754357E1ED6B24C79A5AC74171 7NOCKENRADS
914,144,519 *5F219EE4BB54196C07D3877A546EC81E3F3D3D06 7RONALDMARLBORO
914,144,520 *5F2186134B2575B04B970E15EA190EE3DA275F2A 7THATALLEGRO3
914,144,521 *5F2A4873C6CFB660150CE932FF894BF09B3D2344 7toiw4xh
914,144,522 *5F2C4D89D89DCAB1E805DB4C656BFFC5FB321BA8 80130 BIRALTERNATIFIMOLMASIGEREKIR
914,144,523 *5F269D2FE844AC4366FD2721C459A50F11C55EFF 81FF968199543A0E8B144019B569482D
914,144,524 *5F28B660F57BFF2CCC66592826B0253841ED009F 868269 joulukuun loppupuoli oli lauha ja tuulinen ja j
914,144,525 *5F291504713813709F655DFCAEA0854406ECB36E 871381 budusunceyazilivesozluolarakvakfailetildi
914,144,526 *5F2B0845F4F7343DA229FD77F15B24F92F15DED1 8GUNTERMA
914,144,527 *5F2D6A7BED9A066BE6AB9E30BCF13596A145D387 8ITPACIFIERPAIN
914,144,528 *5F24C998735BF16E0F7F6121D78B2CFE27F4C339 8KNEZTIPS
914,144,529 *5F23E183134445F8A89E830376A4B812C1312C4F [email protected] ~O >B0
914,144,530 *5F21C897AB77F24B37716D62FF86323588520D19 0d7363894acdee742caf7fe4e97c4d49-2522
914,144,531 *5F2E1339C9C270EDCABCC519C45D13E1A59C9ED2 8thatjacob4
914,144,532 *5F275E5AF8AA387679904AE388722F00D6F5C555 918864 " THE GUY IS HOT .
914,144,533 *5F2D2123E6E50B6CAFAAB5F1AA036918BB123758 932487 CUNKU-O-PARTININ-KURULUSUNDA-BULUNDUM-.
914,144,534 *5F2B302BA66637C91499FBFA6125DDC69F377078 12:12-#-&ninth
914,144,535 *5F2FEA42A320B62152E93F2584A7424BD12C2C74 978brianna
914,144,536 *5F23A1887C740DAE784C2A537F1128AAA77655FC 9BOLYONYS
914,144,537 *5F2C021A4FCDF3FDD2B557B73ECA8C849595B27A 140245 THIS WOULD BE VERY , VERY POWERFUL .
914,144,538 *5F269C4C32B5E0489CEE743DD006636C5A090E01 9COEXCLUSIVES
914,144,539 *5F2DF1FC80E806D9B2C6C26714E27833461259B3 16efc30487ed5e3ac9dcce8e83418e7a.chimboz
914,144,540 *5F2D13ED66B17FC4C5C418208EEBB79C8AFE3CAE 1735z
914,144,541 *5F24E8D50DABD2550727D270A5AB8F2825179C41 188243 bir-anda-hersey-alt-ust-oluyor-.
914,144,542 *5F2A8D582901F29871F755E2BBE4C104AC95CA68 9INJECTEES
914,144,543 *5F283E1CE1094FB908F7D774A2C0F25F59AF3368 9LEENEBRASKA
914,144,544 *5F2AA6AD5945676C7D4E8CBDB19B6568685BD76B 1997183 POIKKEAMINEN VARASTOINTIM
914,144,545 *5F2E5AFA4B889B97037A64A4F56403897C6ED472 9NAVRSIT
914,144,546 *5F25722BD0A7606A4C9D2880CD6C38383C9B8185 1berg-trained
914,144,547 *5F2CF85D15727EFE8E1B9CDDEAE9FC234044095B 1 COMMANDERISTA
914,144,548 *5F249DBDDC7226894FCF821A31176C3AE50EEF3E 1-c-span
914,144,549 *5F234A80FA3757EE275CCB8A9CF718788B008A20 9SIGNEFIANCE
914,144,550 *5F279D7DB370262EF464F3B251984C9ED6C12A38 1.DDRVORGESCHICHTE
914,144,551 *5F278B6DD989DAA3359FF79186A948318B0A8BE2 1divette
914,144,552 *5F20F308ABA3F261B50C21666FE34C6F713DD8A4 9TREMULEREN
914,144,553 *5F29DECB5EC287ED4A250362F066BEA1F401DB87 1.frauenbrigade
914,144,554 *5F22E92BA7EC179CF527F5DBD02A30EFCD3915FB 9WOEKERWINST
914,144,555 *5F2B44A4A688D86395018E6DBF8584C6B7DFE62F 1.GENOMTECHNOLOGIEN
914,144,556 *5F2942BFDEB1EFF301605050B3A193549BC75FB4 1geschissene
914,144,557 *5F2D81EB2E57FE7A60AB17CAA7D0291C27DDF2A1 a!)!,
914,144,558 *5F2AC947A333C7156694D3C03A14AF3AB18DE7A0 1hinauskoneenamme
914,144,559 *5F232A7D8243F738603D694CF07ECBED3A271494 1.hulausj
914,144,560 *5F25740992EE03DDB6B53A32D2F0DC753762F591 1ILOVETERMINAL2
914,144,561 *5F28E988B0731E2D5A55FFA3C769DEF47F6DB8DE 1iluvhanna2
914,144,562 *5F25076326740987ED719A3177FB2FF2C3CFCCA0 a%52x
914,144,563 *5F2789664B47F940DED9868F566F4B72073A5C14 1 LUFTHANSAKONZERNCHEF
914,144,564 *5F20ACE48D08122FBCFF584E0E9D6ABDCDCC81A3 1.mormonikaravaanin
914,144,565 *5F26E633A908CAF284B34DEC9F0E6487CE8CD255 1MP3AR1
914,144,566 *5F2B5604666197D7904A489B630A57645ECFFF99 A&78N
914,144,567 *5F27BC75150E37186E1A4331A263D93EED971E34 A9LNE
914,144,568 *5F27A5CA523674DDDB06A107D09A798A8ECE34BB 1.pyrotechnics
914,144,569 *5F2DBA501E7CFBF47B197A8D7B273710F8C87EA8 aaa`dd
914,144,570 *5F20AD2F9C33E579B425959E4105B0DAEAF450CA 1UAFHAENGIGT
914,144,571 *5F24FBDDFC8A1765795BB05243DF950310C19553 aacj<n
914,144,572 *5F2322ED1EAC67BE60F658D71805C3C8129A124C AAEXVM
914,144,573 *5F29D1502B549E481FEB9EF2557E71E76EE73879 2069871 sonst.gaebe.es.bret.easton.ellis.'.texte.nicht..
914,144,574 *5F2CF7B5CDAF169FBC17C6DCA46C74563C6C81AD aaoed
914,144,575 *5F2320A29F2D72150E8185EE45B19B59F6E4D72F 24 OMAKOTIYHDISTYKSEN
914,144,576 *5F2B71295B5A7C3252EAFB7FD235251B10C216D2 abdhrithjing
914,144,577 *5F20E9A0B0B0ED58738839BBCA4FCD9A73B4726A 2697502 kenti kemp seurasi toisessa sis
914,144,578 *5F27E5B97FDE013FCAF271CF601852691E43A4A2 2706162 liikevoitonosuusliikevaihdostaoli12,4%(-15,0%).
914,144,579 *5F27479B467C706424AE2C8D3EED0E5517F7395F ABIGRAF
914,144,580 *5F29A6E4AD6E4D71EDC30A0901780A19BC6C982B 288COURTNEY
914,144,581 *5F2605D73A4B225806DF09F759D76B871FCB5BE1 2897421 liebe.:.nicht.so.zaghaft..
914,144,582 *5F2F9109965DB17202EFDC58D48F712FF5A5C307 28march1218
914,144,583 *5F27C99CC99B110DFE3DF27BD99CAEC27BA2C1E7 ABSTIEGHAFEN
914,144,584 *5F2146852DB00BD21DDB2A9C4243D7FB67FE66A3 ABV
914,144,585 *5F2221164E5D33BF04DC760F00B4E4A4848C5405 AC7DT
914,144,586 *5F2F3E17984347CF6225EFA7703A511FEA632E94 acfpz
914,144,587 *5F22305E57A8E705064072E322A2D3847EFB01C2 2 MOLKOJ
914,144,588 *5F294F12172691174505D0BB7884433903FACFC2 2.NARIMATSU
914,144,589 *5F270FA2684EE41E0928150FB183639B7504B150 ad6Y
914,144,590 *5F233E7C44305305E172E71A7EA3160C6D42D186 ADDK]
914,144,591 *5F242C5E88AB397A419137CBAABB16A75B2F3FB3 32fa8815044e3774e0440003ba962ed3
914,144,592 *5F20D27FAA82A6F7861367838D1BDA39CBBC3B78 ae?4p
914,144,593 *5F2AA21959FEE2C8A8F1B6051EFA104D91034FF5 38O73M8Y
914,144,594 *5F280AE7A7DCDD156B198060E22BB0CF57A7565A AEFM
914,144,595 *5F2E6512FDA6B501BA05876D53AA96A6E8E13AD3 3bambusstangen
914,144,596 *5F22B69FF351BAADAB8A5117CD23763165BCB552 AE%&S
914,144,597 *5F2B2E163AF3F034ADC743C0244AC9E88DB5B8AC A-FNK
914,144,598 *5F299AC097C6D797287C37FCF0E19E5375385117 ag4uv
914,144,599 *5F27F806D9CB974288261C118AE1F705D5C234F8 ah::+
914,144,600 *5F24C1B354D420186C0B05F6365F45A176DF87F2 AHDISTELEMANI
914,144,601 *5F23B279AEF6BB6DD9B2B356931DD459F642729F AIMOTTAT2
914,144,602 *5F2736308D2549CAE2D232F6EB858940CBABFD92 4ep
914,144,603 *5F2619A001142239352B42E6A00F7E4E489C53CE 4LINEAMETER
914,144,604 *5F28C1842AB12BFECE15DB97EA637BF3FBC71066 a=;k&
914,144,605 *5F25E85E59DDA2CA685837844808872C8AC510B1 a-ke#
914,144,606 *5F2898F394C35A5C59CC48E4763DE157265F3DB5 4nther-10
914,144,607 *5F2F6F4A3C4A21158B079BAFF1FC3355BCDDE77A 4NTHER.10
914,144,608 *5F22F2F59E1A0F196FE66CCD6D5A8F912A93FCAE 4PUGWASH-KONFERENZEN
914,144,609 *5F2EE6937B3B21D1E5E370E052F3268EFD1C84CF 4QUIETLAGLASTLAST
914,144,610 *5F21DF29DEC0440D82AA9FC53B85F05A5C977BA2 ALASKAGUVERNÖREN
914,144,611 *5F2148DB5331AC8BCBBA2383446E4B0766639483 albeitar4
914,144,612 *5F2E733819E389384F747F3A14D5AD9DED9E158F ALDEN.BRAD
914,144,613 *5F25FCB67E3057865C8D84F28AB88C86DF4C297B 4THATPHILLIPS5
914,144,614 *5F29CF1BF6F4A14D0542E2A575A7C38E29B0182A 4therevolution0
914,144,615 *5F2F1D19D5587DC3D9EF31CCF7BA0639E8EFE7AB [email protected]
914,144,616 *5F25ACC8C47D89CCB6963B0E8E8FB5677BE031D6 Alf
914,144,617 *5F2553B28D934ECB998E8F806EE2D810EFC0429A a light with a name of hope ending theme 2 / celvice's theme
914,144,618 *5F22645B5A6D2859B7FC83DAA21CF09C9B5C8A06 [email protected]
914,144,619 *5F2FE15803844A10C02FE771CF39D3E0730A5D3D ALLEN.GORRINGE
914,144,620 *5F27465360039A28F06069B485614D381C4F4A4E 5ANFREUNDENDEN
914,144,621 *5F26406F0AEA815E6EBE23C412B5ED75E201FF44 ALLHOGAN7
914,144,622 *5F2F1F7E1701AFD626AE0C7A604855E1F36834DC AL-MUBARAKPURI
914,144,623 *5F2F953E9439D57E38175470BFFF736916AA09CC alqk
914,144,624 *5F224740B1E030D08CB0D049F75AB67D6674966A altradoc
914,144,625 *5F2AAB4A115399A099FCBC4D581F30CFB4350757 5EPIPSSEC
914,144,626 *5F2167890B06CE9642256714F617D87B8E5A058C 5february1127
914,144,627 *5F2B7D330FF8C683AF9031CD034C3B95F9DF9485 5GNILIASD
914,144,628 *5F2C61900F166AB6D9331936A6BE22DE7D6EA8EC 5GOPHERHOLE
914,144,629 *5F24DFB4539D1693D19FB817C4655FEBADF85C91 5HOOPLAHBSW
914,144,630 *5F2188F769355DCBB5DE4836B82146F30A9BC792 AMERICANPHOTOGRAPHY
914,144,631 *5F27A91FB80B2417F812AA28C570B5A2191F8182 5MOCOCRFYRRUCAICILAASUYRRUCAICILA
914,144,632 *5F2E7262AA4B5967EFFAFA911FD8B65AA87794DD AN7BB
914,144,633 *5F2EFC6C0F5F2DE01E44F18A3538019B2029C34B AndrewChiway
914,144,634 *5F22FB1C7A6357C8229A6405BABAD9E419EE6905 [email protected]
914,144,635 *5F2A6F064D3B810F07E48CDF17F93CA64AA6F2B3 ANGELBURGE
914,144,636 *5F2E92D311A2A70F1FE625C62582911EED4A050B A)nh
914,144,637 *5F2502B06E5E704C3724EBB375CD1AABDB834898 ANNALISA PASTORE
914,144,638 *5F274105E07F23B67BB5FA7E31BF747A894621C1 an)t/
914,144,639 *5F2BBD9233359545642F425854471C68ACCDA17C 6BSWJABBERWACKBSW
914,144,640 *5F28E47FB270B7489BFEE8294F6D12B57C87D1B3 ANTHONY.RUDIO
914,144,641 *5F2D8840C5EBF65D9958BA7543A289B28102C0B9 6COHOMOLOBSW
914,144,642 *5F29FFAAFBA4977B0F76B9681B896663DB93AD6A 6-cross-europameisterschaft
914,144,643 *5F29745AFCFB2E61E6BA2763255C6447557A7528 ANTOINE.SCHUFF
914,144,644 *5F208AD7042A4ABE1109DF4BE98C7DE2F35A4455 ANTONIA.PANAGOULIAS
914,144,645 *5F29E4B6A8C07B17F7A99790B58814AF9714EA78 6EDREPOKE
914,144,646 *5F27736495B8FABBB817F1C8F45BC741628EC70E 6.EP
914,144,647 *5F2BE2EC5E2E6A9D7FBC76090ED6BD50D87ADB3B 6IAGONAY
914,144,648 *5F21CB524B6CD5C99ABAE06E17DEA93607A65CC1 aon#x
914,144,649 *5F2D34FEE7EBABFF738CD4CC8E8EFE2508F77238 a-!$p
914,144,650 *5F23C10F946779E712A875CC69DE9BB23BD7AE61 6LMOGULS
914,144,651 *5F28BF8BF2B12BA1C878E7EAB8BE68CE374ED40C apesl
914,144,652 *5F2C54B57A6D8D7D9261C95C0DB59B865882671D 6OOKEPPIK
914,144,653 *5F29022401A57E7BCA184B813758CA2906999890 6PSALMSCRAPP
914,144,654 *5F2C952BC49E028D8B2B45EFAAEAEA2EFD1E36DE AQFYR
914,144,655 *5F2B3179FCE93253AC61CD3CFEA722C04F72C1D5 arnoldoraglow
914,144,656 *5F2687B25D1D24AF77CD290BD11E472FC32208AD [email protected]
914,144,657 *5F249064E9A87B6A03AECB566FB9B8DB5E42DE6B arnulfomarbus
914,144,658 *5F203F0D0A009180E4564053DF71D37047EEB756 [email protected]
914,144,659 *5F23174CB92FF1C7E7F0210439C01420EF30D175 735jasper
914,144,660 *5F27DEF3A96BED0109E0DD92B4B6509D1E19BBAF ar%?r
914,144,661 *5F2348ACA7B11C52E80D27591B7E62B8EC9517A3 ARSCHKRIECHERS
914,144,662 *5F287E43B110102331C5173067F8864509331F77 ARTEMIDINA
914,144,663 *5F275F52B6B0862E594D50A1A2AC48422F131F56 arthurlichtenwalter
914,144,664 *5F2F0AEFFB3780BB4227438DB1DF596E481C1D6C artmcdermond
914,144,665 *5F21CD7060A2F4A292B9279E344B59FDED85C48B 7BSWSETUCIBSW
914,144,666 *5F240F04B41ED8849C772BBEF5B623039ADFF9DB 7BSWVERGHESE
914,144,667 *5F2DA5513012A8D983006A9FA05983F8E40939CE as.flex.(feat..basehead)
914,144,668 *5F246BF5EE4F12211B6700CA94325FB12A821B1F ASHLEYLOMANTO
914,144,669 *5F27876024676772F490B5D206ECC251219D59C7 ashley.nicole.morgan
914,144,670 *5F298279D5D1F5BD5F35A7C811760CE077C3FDAF ASOTHERED
914,144,671 *5F2BC0E711BF6A387682929BDB3C2B10C509A797 7HCOOKIE
914,144,672 *5F24279C490412AA7CABBEB6E0CE518EF4F9E35C 7HLIOLOYSTO
914,144,673 *5F283DB57DF736C9E931294AA2AA7DF0344A9982 7imf'in
914,144,674 *5F268B25E7F1FC40040DA32A45237DB8724D3AA6 ataikohsing
914,144,675 *5F2B351E4B11AE2B06646AAE988DF328F30BFF14 atminsto6
914,144,676 *5F24B61CED6CDDE4DE59264CB88B73F3A13070E5 augustinecarinio
914,144,677 *5F242998EBEA94C73D3B505CFA5A0EE638FBA338 7STUBHARVERNES
914,144,678 *5F263BA9BC3E463E0D753743A55DF97C8F102CF5 AU:H
914,144,679 *5F2E1C20DC7519C058F588FA7621CF692F7E1746 AUSTDØLO
914,144,680 *5F26B908FD12319472A9E02DDAB5458A135EF58A austinfreggiaro
914,144,681 *5F22D3A33863AED0113CA1A899F80F52436E36B2 7YARBAYLIGA
914,144,682 *5F2EF15DE7209B155C757D1ABF48512D2E723F98 AVIN7
914,144,683 *5F202F515AFA173946B34731F1C078C81EE524EC 8DAVIDCLAUDE
914,144,684 *5F2E4791061A8C0689ECD99BE3F8451A5BDB2DA0 [email protected]`~(_0)
914,144,685 *5F20578718951C1B22D3FCEFAAD57C0E20D61B5F >-B0.~.`<####p
914,144,686 *5F2CA021C81332462D51E7D75B9789BBE884546E 8LPABUTTONS
914,144,687 *5F2BE8689EE8903D49B40A67011C6515FAC58995 b2f,h
914,144,688 *5F22820144CF198982FE57B99E13F241C4010524 b3oe
914,144,689 *5F2145ED91186CBFAB3D6037C56CD111F8EB16EF B4RTM355
914,144,690 *5F29F3BDEA6FA3F78D60414EACC2712517356E3D [email protected]!ON3D
914,144,691 *5F21FC90257DD6E1AD831D7064EC9641F6AE295A 8SYLVIADEADHEAD
914,144,692 *5F27CA3437008726C97A6CFE0C19F5C7E427F845 b8cs
914,144,693 *5F2815700F215093B54AD6CF0715E3CA706E711E 8---)~.`)x(
914,144,694 *5F2A924913F2CCB6CDA3D1EA751AFFDB857A1832 93639 BUNUBENBIRAKSAMYEMEGINDEDUYDUM
914,144,695 *5F2A2EF2A2E499B906C234D8665500F7FBEEBDFC BẮCHẢI
914,144,696 *5F29675CAD4A8294668C7EFA1FD41DE2FAC18675 B.AHC
914,144,697 *5F250B68427D5425FE3C3C39FEB3F4FB2D02C619 BART.HAAB
914,144,698 *5F2A443078C370FE2389609B53DA6361D4BB7AD1 basiloverton
914,144,699 *5F263322843DFAE23C12F1102501F4345F36300F 9IAMFUGAZI7
914,144,700 *5F2371DA86E7AA895E2B65E45BE4F3FE66025C30 9IRREGULAERS
914,144,701 *5F276E09E649468D8F9405A08A708F9E522E4130 9IZDERALE
914,144,702 *5F281795E02EF7EB0655E451E43D97C4354B99FB B#####)**>B0
914,144,703 *5F2CDA310CE6663B61C0DFC626759A6E3A33BE75 9OLEZZERANNO
914,144,704 *5F26BC08A7EFD5A453E89B703E7558B3DDFAC8BB bcd
914,144,705 *5F28442E5B7CB3D57BC883BC3765C23713FB5621 9WOEKERZUCHT
914,144,706 *5F293D907D9DD98EA10D28F92F2928BB4C736351 A1N7T
914,144,707 *5F2596A9209CC70F6E2F9763F529EB368F0B334F A3QH.
914,144,708 *5F2E43177302AA5448E317DBF1597ECC8C8B5BF6 a7ewa
914,144,709 *5F29D85F7347B6173F7C3A19394039E51FF94DD8 a#83r
914,144,710 *5F27853281706669F6BAE360CFC4C81B6A32E158 BETTYLOUM
914,144,711 *5F20B5F11DDDCBC0C7D60B5EB47A706BC338F647 BET$U
914,144,712 *5F2BFD9CE83F77125D7748FFCE047AEF01139578 AADIS-
914,144,713 *5F2E6BF30CB39A3310A925C2899DF99589B117D1 [email protected]
914,144,714 *5F28D30E8A2C64345E08600910ED4DF498D38D16 ABDICAMMOS0
914,144,715 *5F294553CC74445F770931F53DF8540E30902764 ABEL.VISALLI
914,144,716 *5F2AED5EEA558B2D0428978B3C984ADC755BEED6 blepharosphincterectomy7
914,144,717 *5F2A60625D95BEAFCA3B811F22DD21FA9B632984 b/m6w
914,144,718 *5F2073E8FD31DBC3C3843B13CD003E659BD15DA3 b%mb2
914,144,719 *5F23E12914674CC0FCEAC117939B8E0EFDB02AB6 accordionistn3
914,144,720 *5F2758DADF2BE10123C91C6DF1ACC9244BE7172E BN7!V
914,144,721 *5F2F79B2201403BBD4764A9163B67C965FF559B9 b;ok?
914,144,722 *5F2F2106D2B8E29744433FC695279A3900442520 ADJUNCT'
914,144,723 *5F2ED92C9AE9F745DB6BEB01F362A1CF439AB9E5 AF2-5
914,144,724 *5F2B728FF033C11ABD66E613D0112C81F8FDCEE3 A,g+
914,144,725 *5F263916EF33346FEC69F9F0827E942ED3515F8F AGYTREVO5
914,144,726 *5F27BF7546B0DECF821054A40736627333F75318 bradykellison
914,144,727 *5F2A9296648FF77D0344EAA8F4182965F975FBFB AHAn
914,144,728 *5F22EE2884E4D898BF2D1B079E384EAD9193D170 A;_IG
914,144,729 *5F25F19A022A37FA5A1F2C9F92FC09C25CAA4EBA BRIANBRUNTON
914,144,730 *5F26028871C14F909F95E39971B0E37DF53A6FC8 brt-e
914,144,731 *5F25A384C7696997894315340095586443D3B3A2 BRYANFERGERSTROM
914,144,732 *5F2113FD398324C388D5C04E50FDBA83EF71CF0E ak)vh
914,144,733 *5F254B0E065CF5EB3221FCF5C6E7C7160CA10A7F b?sqa
914,144,734 *5F22CFFD90E42357455F8CE95548D99E73DAFC98 alfredogutzwiller
914,144,735 *5F285FF7111D09AD2290BB5E2A4CDF022CE45030 BU0PB
914,144,736 *5F2F7F3394D25AF24C3CF05A70650B383597BB94 BUCKGANNER
914,144,737 *5F23EA38E35A90BB14CC06EA2DC197F363058DE3 BUDDYGREG1
914,144,738 *5F29D7DBBEDEC16BAE0DD07ACB9BA5BEA1DE50BC ALLEEN IN EEN DROOM
914,144,739 *5F2A92BC9A4F968B9E8E3C5B68C6E26B95E95C07 ALLWETTERBAD
914,144,740 *5F271EED4FA420CD5FA245ADF7C7602F10291E6C ALLYHP19
914,144,741 *5F2812EAA24D62C9050A2135EB5030DFAE891573 alphonsofinnicum
914,144,742 *5F2C56E650454E81EF564D236AD2A205C443D4A8 ALPPE
914,144,743 *5F2AF9DDFF28651B1FE900BBFE59D62BA158FD7C BvkL
914,144,744 *5F26C0EC3616F7C88EB5C309E0217C1CD08A2360 BVYPX
914,144,745 *5F24A640BBA2898F13467CA3F6E67A70D163E02B bwwou
914,144,746 *5F2B72513B6E91FAEA00DF15B0C82FA955600903 analogied
914,144,747 *5F2B51589F70D94541994C87AD9E2C48A5EE7590 ANDREW.AARONS
914,144,748 *5F29C700E8C1CE88276F2827E695259118995C22 c1?$%
914,144,749 *5F23B624C4798FA32F0BCFDF644FD3A3FD0042EE angiedonjuan
914,144,750 *5F24093D40FA0AFFF0A60AA42889B704BA537BD7 ANITADUCHARME
914,144,751 *5F2EEA81B112E5A1B066EA388E2B2E65A63FCB6B anne-hagen
914,144,752 *5F2B9B5C35B36F6C3C626C3AFDC0F6EB24151D4A C4WQF
914,144,753 *5F2309CC623B9085E322442D845F233D9C93926F C56N
914,144,754 *5F22269F6D19ADEC29F7D22EF5621E6859562C24 ANTIVACCINATIONISM
914,144,755 *5F2FAC64D41EEAAB9E56FE62DBB9A5D091E7A114 ANTONIO04$$
914,144,756 *5F24420B11A06A57581D68AF362E6C894A13447C ANTONIOPOST
914,144,757 *5F2AAF32C60CF1921E888655325B5C4222B5A851 APLAUDAN9
914,144,758 *5F296D500D6360F6C4E40BD46D69B88CEE7A6185 apneic1
914,144,759 *5F223CBBEAC274E63F9F2BA6D5E8AC2F6965E5AC appr0vn91y
914,144,760 *5F20BAF34CF298A96BCB63447E850BE14F13B61F CANINJOKU
914,144,761 *5F2268F4472732A9ACCDF76995993BDD366CC445 CANYONOGG
914,144,762 *5F25A0C41062A42529438771354B799E3AA02E8B AQ44M
914,144,763 *5F2C5F273445C0937B58B011D85E27308E91BB18 aqdb&
914,144,764 *5F2FEE1F6A32153837CB9B7E11C4E2B4C5AB805F carlfarrar
914,144,765 *5F2ABCEA74F9128ED016F4629CC5E320E8EE0648 AR:D0
914,144,766 *5F254629D91B3FFF4A0F8CAF3E0D486B80F4B246 cb".
914,144,767 *5F273CF14702173EC0C66043F22364CEA4DBBA3C CB=N?
914,144,768 *5F2AB6C993119CF6DB01991BA55B0C4E8F8FB653 CESARPAT3
914,144,769 *5F2A6B61E351C8A25CDE86E18CF5826C45575BE0 cfcr
914,144,770 *5F279A558D14217CC95EFBB43201177D72DD602B CHAM0I$
914,144,771 *5F27ADFC9DBAFA4D85C4DEF02C18B3BA7C971FF6 AVERY.DAMME
914,144,772 *5F28A8B65AE6C6F3B3BB95B541A4A70B70DC999C averydigiorgi
914,144,773 *5F27B4F4BF8E93BB39FE17CF4B85E8FF0AB35DA0 chapter05:whatmakesaperfectparent,part3
914,144,774 *5F267F8478516E3DABE4B19575394C66674F6BB7 awckx
914,144,775 *5F2726057B5519F80F25C8A2565EE8C5E42C3768 chi-town.ride
914,144,776 *5F23BB58400B42E17D026A6A031EE7D066F696BB B-->~.(>-<)
914,144,777 *5F232198C686589DCD601E1BD5EF0B1899BD6F91 CHONDROCARCINOMA3
914,144,778 *5F2B9D3E03B3693F695523061F5A11576691FCFE CHRISVOLKER
914,144,779 *5F26CAF8ED87715BFD80E8164AB497A59B93E31F chuckseamster
914,144,780 *5F2EFCD8935D3EACA1E19D8963FCFD2C584601F3 B'2R
914,144,781 *5F206B25ED7A13469BC6B160AF29D4D2E1CDCEEE [email protected]
914,144,782 *5F249E057884B243C722F10B1F2AF2840F4C5A49 b4ctercdes
914,144,783 *5F238747ECF63A7DC63FE212D9FD389C8888BE5F b9x7t
914,144,784 *5F2769F640651E9583B690E5D14938B70F588DA2 CLvc
914,144,785 *5F2E0956DF1546CB6BDEDE1C0471582513DBA304 [email protected]
914,144,786 *5F2E64968B27B18AC401335A6E790F51270D8371 B###B-~oUU
914,144,787 *5F2380BD2CB4408A4D202EC00B67EC1D3D541D35 b_c:/
914,144,788 *5F2F0B3B93540562DA35EB99C2E8080E8C8F797C c,nh2
914,144,789 *5F2C5810F2AEC110387A33C06799A76F3A916DD9 cnz)c
914,144,790 *5F2A42312C0F99603D2F9795707B13270FCFF4FF c?o1k
914,144,791 *5F29E21B72C8385402A2F478AE65D2F401257358 belpm
914,144,792 *5F292678FB44A292ECB3A5A37EC23E8EC92BC283 BENITO.TONDER
914,144,793 *5F293CEC85523E5F38E0A1E8A7F0AB0E466A9496 benjaminrickenbach
914,144,794 *5F2754CF8EDBE74FD85454C34E6E5C7983A37C60 CONNIESTACHNIK
914,144,795 *5F22D5ABA66B7D0DAD3AED5B42A67A95607E9C8F consenescency5
914,144,796 *5F24CDC96EC318164DAAD3D31ADE916267B616C4 CORPON
914,144,797 *5F22CC33383ED1A8E76836B42E2E38C738D7CF59 courtneyhalbach
914,144,798 *5F21700B930C230DD4CF64FA92E13A870AEC8A79 bf8q!
914,144,799 *5F2539D5292D14E4457A5E1195FFEC73B06BAE65 [email protected]
914,144,800 *5F29F4148C037CC98A83EDD876DCC55F0DB806DB [email protected]
914,144,801 *5F2F38571509D13E7065BFF6D68E2C188B1995F1 Cp/6
914,144,802 *5F2746A9641FC273B9D6F4EF834CB7C025BEC90C [email protected]
914,144,803 *5F27F115CCE414E5F16E9DCB2BAAE68145E5B10E c:\program.files\microsoft.visual.studio.9.0\common7\ide\itemtemplatescache\visualbasic\1033\helptest.zip\helptest.vstemplate
914,144,804 *5F2D4531CD2A9E536CA4F6BF53A9AADF6128C427 bgu#n
914,144,805 *5F222FE1BBE9FF5760F5B093299E1275226ED91A BH)US
914,144,806 *5F2E60A888D01B6B64CD6B669C6355FE5C3AA83F bienvenidosaoccidente
914,144,807 *5F258A590DBD0A82203FA3F6E9BD40EBC3D2207F CRM
914,144,808 *5F2F7E35B0F7E702B12DC77F5F4FF651171BD25C CRYSSRAPID1234
914,144,809 *5F2425A3ED68B919DD9D2C83DC3448D6302226E2 crystallake2
914,144,810 *5F2E146E68704AF054F3A030BA105A40321C5680 BLAINENETZEL
914,144,811 *5F2EADE3D15D837DC3890FFABF004ED0070A4064 BLIND PIGS
914,144,812 *5F24AEE3CDF9ABF73DB3C0B8C565D3886286EC5C blow_off-bl/oU/_/O/f
914,144,813 *5F266135038CFC52CE8240E1F3A2B05FB0C9E8C8 c;%v;
914,144,814 *5F206C08BD2FFEEF7DD9BD7B4617DF2563E447DE cv8s!
914,144,815 *5F26331A2D34F70C7943C876C76E5E8FE382ED06 B?M_%
914,144,816 *5F2BBD382DB3C5F9503F7E771D52017AD46F5D4A cwgni
914,144,817 *5F2D9244FAFBB55FA432A486AF13142CB95E568E bobt1
914,144,818 *5F2AA3DCB0F2821606195F5692741E9E235D4C24 [email protected]~O~OSPLAT
914,144,819 *5F2B846C0F73FA574B98DEA64AAEC6F5657F55B5 d2veu
914,144,820 *5F2A37FD05BBB8A292C949F3E42F59BEF5FE7F92 d."(4
914,144,821 *5F2298B3BB87776FA908490E3588985BDA7529C3 D6-T
914,144,822 *5F2FCE7F07A4F53B9F9A1B08BCFF05BCB1E5C737 d(9=p
914,144,823 *5F2E3ABEF2C1B2B4894FC7A11949CAE250313D7A bradlydesoto
914,144,824 *5F28AD0A4E2043481C5A8DB32C61F99D4CEE42F6 d%afz
914,144,825 *5F2018A77A22BD63F0C16CA5B80E1B18152AFC10 BRANDEN.ZAREMSKI
914,144,826 *5F2A5D9A5E70CF4A96A936D55F6342C51B101B50 daltoncoulas
914,144,827 *5F2B4614BA14C58DDACFB8951FB60130FAE093D1 DAMIANLANIE
914,144,828 *5F215824F60F9D3E8BF9BF9A033DDDBE863561BB DAMON.EARL
914,144,829 *5F2EC1AA5A8956B6C5FF40167ADB758937E59510 brennan-brady
914,144,830 *5F2776C8B166868C52B1A0436E5C1EF867F2D277 BRIAN.SUNGA
914,144,831 *5F279860B7A9131E85EE58E0FF2E9BB8436A4C8F DANYYFANNY
914,144,832 *5F2AFE6C5C585137DF6365CC86ACF2FD13677BC0 BROWSERORION
914,144,833 *5F2D48EA4E0D6E77A2E1AD36E7FF03427FD77060 DARRYLSCHLARBAUM
914,144,834 *5F2FFE231919A33CA6F2DF891B53BD53F141C769 B=SCI
914,144,835 *5F26CD98BB0531CBB8189408590C7C97B133AA5E davewutzke
914,144,836 *5F2C559C6D5C1AC63D5C8FE78F5E4F77E9A398E2 DAVIDWELLEN
914,144,837 *5F27F094FD746E5F687E6FAC342ADB6A829650EE DaVM
914,144,838 *5F295E19EADBDB63B589E5FA2C3824EA39DE95F5 DDCIL
914,144,839 *5F2F3A2526209839D331C92AAE8B2B7990F008B3 deadly zone (feat mobb deep and rappin' noyd)
914,144,840 *5F20BACBB0C4132A48143430004DF1D436FCF998 BVCL8
914,144,841 *5F24173E1185A35C1B3FFEF840DE8B549CB29A96 DEE.BENTHAM
914,144,842 *5F2BA4664DEEFB9F373D440F8044DBC30E33CDD4 DEELANDIS
914,144,843 *5F255C5EE5CA95C8D321E017684EE7F8CAFAB750 DEELANIGAN
914,144,844 *5F271C1FD50B5417DACD3EC4BA78F3C31A4670D9 bvvdr
914,144,845 *5F23340AF584D44C97A93D36B868EFB12A777439 DELMER.KERKEL
914,144,846 *5F2B1A5FD22DB73AAB2F15ADD308EFD470AD4692 DEMETALLIZE4
914,144,847 *5F2C02F5B73CA0CD158744679619D886240424DD DENVER.HABIF
914,144,848 *5F21B2768CF60E896F1C1C685652A834A8BCBEC0 BZZI=
914,144,849 *5F2E5D1AFED9E73B09508EAFA599CB9C71817D15 C2LXP
914,144,850 *5F282F5D0FAF48DA5EB5696B8EDBCADA146D6E90 devin-matthew
914,144,851 *5F279EA9A3E79F3A565DA4C532BEBB3D98EBC64B C3WYO
914,144,852 *5F2D157D24AD1A1CA02D9254CFC2F64C71986A7A cagefuls
914,144,853 *5F2F780062E30E390F49F500340479AC9BE8C565 DICHROOSCOPE
914,144,854 *5F2EA9DFC4D6A3848174458137D0EFECE7F79A21 difk7
914,144,855 *5F26A22C2325BC6994B3E328F04BB5B796548145 CAPACITIVA”
914,144,856 *5F2FDF204D0813A84D642A2D4A148ED2BCED9CD5 [email protected]
914,144,857 *5F267AE7910E53B2AF3A6C978C9BA0C541D73D29 DINH.NAM
914,144,858 *5F27834344276849805B58E3AD16D8E52E9A7C8E di%oh
914,144,859 *5F295A3D6D5469C3A96CE706B85D50CF421CBD0F CARL.BELGARD
914,144,860 *5F26DA807E727015CB88EAE1E31E85B1CD5B6F88 DIŞINA
914,144,861 *5F2617F7F8593EAAC9FBD6B89FD4DCE142E3F1EE DIUQILERS
914,144,862 *5F24A7CFCE1EB7A4DCE9DDC4E5F25076999CC93F d?jrb
914,144,863 *5F219B4B8607EA15E0B54461943091C168277143 C_?&B
914,144,864 *5F2C10D2B12D4EA3D5EC80CC2CCB32EF61327BF1 CCHAKRATOK
914,144,865 *5F297A3E10F86FBB5300BAFABBAA820EAED65B1D c)=cl
914,144,866 *5F2315F9BC1888414ACDFD4DD67EA21710791362 CDICW
914,144,867 *5F2C4C12A36DF9DD411D7B4D526532725AD8B997 D:OE
914,144,868 *5F2F1F0E7179BDDD006B839677191B4A51BBCAF0 CG4&9
914,144,869 *5F2CCF675BD18E46EB29A351575E8A9C88DAAFF0 cgvqp
914,144,870 *5F2C978D9402465C1375677065B14E2E8408078F dqd"s
914,144,871 *5F24ADF298D03C3199B1E1700A77FC4434DA7905 [email protected]
914,144,872 *5F281C6A9ACED83DCD6FA204666DA0D1E203E48B [email protected]
914,144,873 *5F2215E34E75311E61660950C28491E633BD2E8A [email protected]
914,144,874 *5F28A78E8E18C56D88E1D9384673EA7A8637F77D DR.BEAT(LONGVERSION)
914,144,875 *5F287ED3144B4420CB2B6C9A03264CE5EA05D283 choco11824
914,144,876 *5F283B62EEDB053E83780B81EB6204FBB60C4034 CIHANAKKAYA
914,144,877 *5F2B6512405D2716E43DA28AEBC74F5326B998CD DUB-JUNGLISM
914,144,878 *5F2AA47B4F2B254491D6FD9C0DAD08C83A6F5320 DUDLEY.KONOPACKY
914,144,879 *5F25EB10370F5B6E806EA8156858AD2FCCEFE6F1 CINOTSUELP
914,144,880 *5F2CAF893FB26926DF1BC80CC51D765F8067CE2A DU__P
914,144,881 *5F2395AFDF64B610E0D306FFEA109B79B856D2DE clairkor
914,144,882 *5F2E43CCBC1D9D427719E5F015FBEF077BAFE51C CLASSIC.COUNTRY.THE.'60S:.TREASURES.(DISC.1)
914,144,883 *5F272904AF9B22B36C12817B6DB1BBBAF48BB63C DWO5
914,144,884 *5F2424F4C9EA8570ED139FC74A85F34444328DAC DXVKC
914,144,885 *5F26569F0C32991615F008E2144D56D0F0C76A2E CLH)S
914,144,886 *5F27EFC753EFBE3D6A38A54D0C6389CFFC0F4127 E9B8FF14
914,144,887 *5F2742EE55CBC554ACFB1AC66DCC20953F60D3D3 CNORMZEFX
914,144,888 *5F2E91474ECB1EAAF50823B570CF37CC241C2678 ed0t)
914,144,889 *5F29CB05826D8F12B398D452C719608B386AEF62 COCODEMERWITHCLAUDECHALLEANDADAMPLACK
914,144,890 *5F23E412FBD81733F8E919B1A5320777A0AF41E6 EDGARDOSELLAI
914,144,891 *5F2F3A40EEBFE09E9D46CCE77FAB32DEDD85AD12 COLEENSWABY
914,144,892 *5F22FE513BBFC2013CCF3C81AA499A8587523AB4 EDWARDO.COSTELLO
914,144,893 *5F27715FFDA2BE0B5EF86D1D5AAE362F45CCB3D7 COMEFROMWAYBEHIND
914,144,894 *5F2125815E1CDA33036DA80A907C581B996693BB eey4;
914,144,895 *5F234672AA6FA195772582410C7B6A7BDF58FCE8 condohome
914,144,896 *5F2C756C6F2D4B3871A9D5B308142BE712049056 Coral.sna
914,144,897 *5F27B201F948FCE4F23E7CE41548E00803697334 EHFX%
914,144,898 *5F2BB4710D576D77D88CC88C0F2A4073B0AFB473 C:(P5
914,144,899 *5F2ABCB711441B070EBC8514B546C21AB9124895 ELENGKHĀLI
914,144,900 *5F2356B2BED56402ED24C656B2771CDA8BB4E63C C:\PROGRAMFILES\MICROSOFTVISUALSTUDIO90\COMMON7\IDE\ITEMTEMPLATESCACHE\CSHARP\WEB\1033\WEBUSERCONTROLZIP\WEBUSERCONTROLASCXDESIGNERCS
914,144,901 *5F2A0273B67FCCC8EA70F2676B2EFCFB7B43C806 [email protected]
914,144,902 *5F209C30B71B66DFFDAC638A19001656177426A5 cq$"
914,144,903 *5F2332432B46DF3F3AFE37A98CD5B9068788306B ELMOKRUMENAUER
914,144,904 *5F2379D0E8CEC85DC1C4E5B560B1BC6930776C50 Cr%"
914,144,905 *5F26B19AE959462074F8FB0F4EABE86A3D7396D0 ELVINRANDZIN
914,144,906 *5F24763E97696FF7EE35D5BCDF77909475A1528D cristophertamblyn
914,144,907 *5F2889F713E137B314790C0E739C7FC9AC9C3915 CRM
914,144,908 *5F21E75E5E937C24B6339AB2B74F03CB58BC085E EMILEGUSA
914,144,909 *5F24B58E04F29FD087B1ED1252C297D712C4921C emiliokinsky
914,144,910 *5F221768106A3420A707DCEE96B9DEB442441385 emily-murry
914,144,911 *5F28B822C7D58C6B69789A82AB538FBE5BCAE550 cs$.m
914,144,912 *5F2B53414F6D66CED5A854E246C037A6F1FABEDC enclitici
914,144,913 *5F24C72771176C86F0FF3CEBA485031C7BF91F35 CsXq
914,144,914 *5F273827981F9D57BBF7E704CBC05A20F930FE8C CTD(N
914,144,915 *5F2F0EEB28DC28BC95B914E17DDAE414E2F21288 ENRIQUE.MERKLEY
914,144,916 *5F250B75E8BD64FCA3C53F2A831230ACF3B08088 ENUMERAIS?
914,144,917 *5F2127F514DA57618C8C055499282591588F3953 ENZO3289
914,144,918 *5F2131DA542E95154FBF21F04E875AA835F14DC7 eqzyhef4
914,144,919 *5F2C10B6BA806AD8CC0A95F319D0885E55987ECB cwpn:
914,144,920 *5F20F0DAC9465A85964EB8DF880DD2087FC3EFC1 D0:IA
914,144,921 *5F2A6272E59D3799068CBFE9AD73AEF93D204E5E euqnumoc6
914,144,922 *5F2BB10B583A9A59F39A6D30F43ECABF65B7A856 D5p055e55e5
914,144,923 *5F2E1A08D9169D17CA7F39C3B865F751A3369802 d7bh
914,144,924 *5F28DC67C971E9A87D002640F3A2C84A62527534 d/7pq
914,144,925 *5F2748ED7362701F21D9BF96473F4BD58BB5137A DA9O
914,144,926 *5F23BC3A3C661062474A4B16D1AB96BFACEDE1F5 F0R7U17US
914,144,927 *5F282A3463063E501BDD548BEF2D989372AF0138 DALE.ULTSCH
914,144,928 *5F212AABFBE40E025001E1D4AF64D988AD6E31F0 DAMIANURENO
914,144,929 *5F26A8A08572FDE9348754AF2DB88FEB92B41FC3 [email protected]
914,144,930 *5F288892EBCD56BB5C05B32CEBE54CC55F3069BA danemartinez
914,144,931 *5F29B9E0BDDAAB70FECE43D16C3FA214DEFB1A5D fatty.tiger
914,144,932 *5F2B45FC2147A4656A8A09087EA9EF5FFEAEA097 [email protected]
914,144,933 *5F2A2A5DBB035CD78B84649538E03BF336D7D779 (feat sea)
914,144,934 *5F2D37E57D741F3011600EF122F2FB3DB5B0DDB0 DAREN.NISHIGUCHI
914,144,935 *5F29A1BDF1F2DCB48969ABF27ED005F9B292B21A feltonheersink
914,144,936 *5F25AF5DE703AEB306E091C6BF42B7E8DD917DD5 darrenholtgrefe
914,144,937 *5F2708D40A1FD34506566E9D9AB9FDC89AE54948 DARREN.YAFFE
914,144,938 *5F2BC339967CBD82751EEFB1AAF26E4BDA5972A8 DARWAN
914,144,939 *5F22833BA2CF324801B7828260AF874F9146A5F6 f[\i
914,144,940 *5F2A8D3F7075ABA8F9E07ACCBC9CF304E1B533D3 DAVIDARSHAM
914,144,941 *5F29D55AC331A39FE912C60EAB51264A70F96283 davidawalls
914,144,942 *5F272C02E7B366286C7A7438E8C6AEF199FF818C FILADELFIAKYRKANS
914,144,943 *5F25B329EB4F83FA0996C9515CCE23FB29CC391D D!B?;
914,144,944 *5F244A097EF65596C07DE10745ACF280CB3535FD [email protected]
914,144,945 *5F21D943221447C9858A474931DC90B1156203A5 FISKIMÁLARÁÐIÐ
914,144,946 *5F2904933697C96D4F2D034777730D504A8B4C6F dbxoh
914,144,947 *5F2B8D88DF826BEF4096D02DF6B19268C7E70488 FORDBILL5
914,144,948 *5F249723334775A29BD69B5DFA913B29E6FB3AC3 deangelogomoran
914,144,949 *5F23EF9005D44BC4D2E7850AD8F8971F85599789 FOTOPAPIERI
914,144,950 *5F2B173A94A3C7A470484603E22ACD22FBF1A48D DEC15TORNADO
914,144,951 *5F2E156BDE5DB8D9C6355EBBE849B82CC57344DC FOXJASMINE
914,144,952 *5F2B6A2883C36708A84C7CEBAA3CD489C3582BAF FRANCESCOLEEKS
914,144,953 *5F29A147D5C5765F2EA02706DCF85C7185713A5D [email protected]
914,144,954 *5F2C06468898992F0CF92A8E59C394C39DF9A27E [email protected]
914,144,955 *5F2247441827DD6DABA4D7D323DDE5FC9048D547 FRICTIONNAIS
914,144,956 *5F2082398C44593C2EE40373A526DA7DC4B7FFCC FUKUGOUH
914,144,957 *5F23063F25D6B79735B056D5DA9EA42AE06F61E7 deroutses
914,144,958 *5F293C1220B61794864048D4A6D3DC98108A7CB4 DEWEYKENAGY
914,144,959 *5F25A71200DD3D18BE8A3D6063094C9B4C3DA774 DEWITTCHEATUM
914,144,960 *5F2CA0397DA363F86E5ACDBEA65A04A458C18C90 GAMING.WIKIA.COM
914,144,961 *5F2BA9DC3EBE748EE225D3470958EA2AB4E404D7 GARLAND.BUGLIONE
914,144,962 *5F2C1F7273B369B29974497E2E880CC4F3147A24 garrypigram
914,144,963 *5F2321364AE0A8C6EDB346F73B61F7E32E16D001 di)
914,144,964 *5F2872A48C32D35A0A44A7F1B98A1509FC923BD3 GERMANY-ICELAND
914,144,965 *5F23F3E8849349F669F01B011A00DB121EBD90D5 ghky
914,144,966 *5F2B912F89C9FC093E937C622F671C32046A398F DISABITUI
914,144,967 *5F2AC0CD5F0CF048A840AEB39E933141624DC88E Disco-Primate
914,144,968 *5F2153CC24CEB0922B22FF8E54E6A23AE577D01B DISEASESOFT
914,144,969 *5F20733E44106F494F2C57653DF4EB8992C45CAE GILD4U
914,144,970 *5F229BDFB11ED8C61F8D9B58984DEC971CDB0F4D gis.fraslin
914,144,971 *5F2797670CBF8CAD565ED15D1270693533AB1762 GJ4B
914,144,972 *5F22D54C67EBE0A67402984CDF8397A17507C199 d"nas
914,144,973 *5F2E44BD1E8ABA92078B7E662F0E1DC6C48116F9 GRANT.GROLLMAN
914,144,974 *5F20C28B0AF64FF02E4C3CB51A4E177B2BC3452C DNQPL
914,144,975 *5F2873810BEC398903312CFBA076C3C5D40AD752 D_OI1
914,144,976 *5F28100DD847ECDA8D5E44FC79CF6BC50BCD1922 GUERILLA
914,144,977 *5F20804648A4A0FA5DD87B425CDDCF8CE57D0728 GWAPOS01
914,144,978 *5F2373F9239768820AEB25BADD42708675BE7D15 [email protected]
914,144,979 *5F2AAC752C78D62749CFC9A6B6AB4D39AA3D2C9E hagrdng
914,144,980 *5F27669F428F83908A2B800979B0E4A7946EC4B0 dp3-7
914,144,981 *5F2B39794418B67BAFF2C91F3A7FC2C5C8C8EF85 HALLSBERGGING
914,144,982 *5F266F26FCA964F80C407EBDF7E2D89FC33A6284 dpzrs
914,144,983 *5F2972B98BE4D5B70D08D0FEC6DD23874FF56587 hanetettin
914,144,984 *5F2E23AB2340228C5750B097C55E05D00F2BD125 DQVL)
914,144,985 *5F28A03C2AE504A789196317EF79147D26FF7396 HARAR'S
914,144,986 *5F2DE426236DCCD5811CE369DC8E0A399B1D1E4D HAROLDUHLIG
914,144,987 *5F202039B39B9AC9616EF8719C591000A966B4F8 hassantetteh
914,144,988 *5F28874C10166573F31F87113B7C61E8DC483E1E hassfjells
914,144,989 *5F2F762C8A568E696B8AC73FCC5D74A3E268425E HAYCRANEO
914,144,990 *5F2F818CD827DB4BF9E8069436A8B7717FF2744B DR/X
914,144,991 *5F26A971D1D370E18ECE9FFB39C4968FD7E27D84 HEATH.CHIRINOS
914,144,992 *5F28066801A0FDC2F5CE27124FC9253D925C07D4 HEAVENTOOLONG
914,144,993 *5F224EF6740C8725CBE810871BCACDB68384B0D7 [email protected]
914,144,994 *5F2A987EED52B63DE6F5F93F1C9ABC0339BE5431 D)(TK
914,144,995 *5F287F4F3622FA29FC7B12D3D68A36E2B805A6D0 [email protected]
914,144,996 *5F2B64B6E46A4D859435537D7730E714332FE0E2 HERBERTOLAY
914,144,997 *5F2EC13BF505482105A765F77BC963843C84E442 DUKE HAZZARD
914,144,998 *5F2F167ADE9EE1A6E7F67015187C17BFFFE6CF26 hilarioslimko
914,144,999 *5F2C8DAC5A30761D4604D216202CD1B983EE7F90 dv20m
914,145,000 *5F2BFCEF9C5BBC2B4C8EC09F252F729E9182AC70 dva_
914,145,001 *5F2B248C94F7E7A9740638F4B657838319555CD8 DWEGET
914,145,002 *5F260E5B865659E8BE2E2245CEF7A0D61A9A3397 HOMEATSEA
914,145,003 *5F2AA0E68032EA0E26227BF4E7E889B63B81B88B DZIJI
914,145,004 *5F2BB233B44792A3FDC71A3E71B82CE8391B54E8 D(ZZD
914,145,005 *5F20D88FB8B254878F1DD03243861B5197E63305 [email protected]
914,145,006 *5F207DBA5500F2875F7B7C34355FBB016D5DADAA edel-gregorio
914,145,007 *5F272BDD3B6AAF4265701DB128100795946D26FD hvxr
914,145,008 *5F22FF5E6CF5FD042A10293575D5393D5508F554 eenatnemom
914,145,009 *5F26DAC0683E16F30CA495A5674FC635D6B95083 ehbpr
914,145,010 *5F26C0C099F6947E036F2B16E5C37CCC0C55BAA6 if i gave you my digits (lexy remix)
914,145,011 *5F22EC25074688B6655FFC23C33B1BFE3D58961D ILUVNEMESIS26
914,145,012 *5F2E25C4EF8A0A60705DD62126D5A992F9D35642 IMAGEPNGELIM
914,145,013 *5F26E71AAEB5DEDE631734949B7AED18103F7137 imcracks
914,145,014 *5F2CF06F41F7F6C4158BC11FD31C33632D47DE96 ELSHABH
914,145,015 *5F291CA53651E394DE356B1FD725ABCB63649D8F ELSIOT
914,145,016 *5F29A604080E2C1C81470130D5BE516F0231933C ELSPETS1
914,145,017 *5F2FB167F29C059892A813D2100EEED932706BC7 eltontamburo
914,145,018 *5F25776D5DA28EA8A6298B765A6BA755AE6087E1 ELUDERENT9
914,145,019 *5F267A32622AD6DBF1164FC48EF1676FBED5326A EMISSIÓS
914,145,020 *5F2833763269DF241B373578FC57A94AE1B8112C interdestructiveness
914,145,021 *5F22D85BCF3FECE04F74C3E589E9F41F6BAAA8ED IRWINVERONE
914,145,022 *5F28C1C3C9E06D8C5E395729CC26CD7D62516B49 enriquesenteno
914,145,023 *5F2906551D203ED5732E64132F781279F04C8A30 isonitro9
914,145,024 *5F2D1AEB60A7211447FB0EE32DA8F07808B79204 eqn#n
914,145,025 *5F290CCFF9AFBAE6C679B8179121D9FB39B8394A ÎZN
914,145,026 *5F26FEBB00C64252BE677CFECB9EA8FCF602CAC8 j"}[
914,145,027 *5F2FE89BC21A88D326CD9FD65CB2853000DC8A15 ERICH.BUDHU
914,145,028 *5F2A7F192606BF5D690718AF879AE9588928C26D JACKBRISLEY
914,145,029 *5F28F9A5539EED9CE08DD62372CCBCB46AD614B7 erichvanalstine
914,145,030 *5F207FC71C38546F65A26011508B274333C700FF JACOB-KOSS
914,145,031 *5F2BC2AE07248EB10E43A7117F71EBD14E7449B5 jady9
914,145,032 *5F2B2BD57D88EF18674CFFB245A65A53E320B159 jamelgrimlie
914,145,033 *5F20B182C2A105630F123423EA8A92EC2EA00EA1 ES3MN
914,145,034 *5F2CED62B013851A56F24461F8047741C33E4D61 [email protected]
914,145,035 *5F210C1EB549C99B28942FA8771BDB9AC9F4950D ESIANOLOP5
914,145,036 *5F21F6FD9AF78E26DF553D1B93FE13A6E080C9E8 esollits
914,145,037 *5F212C6CAC9DFE45C272B576EDD0BCDCEF63EF44 ETHCENKE9
914,145,038 *5F2DB6A1A5572C5087F2790B8BCF2F6449E03758 ETKAHNJIF5
914,145,039 *5F2B71AA750CC5F6B222E9D5D941BEA7C7FF2F52 ETTESIRF5
914,145,040 *5F2586AAA64B4AAABECEC1E7712507FFF9C67CEE Jdu-dom
914,145,041 *5F2BB601CB0CD8C0AFBFE04EAAFFF3D8E2F9C6E6 JEAN-LARANANG
914,145,042 *5F269431BD42644E50ED889904EC5CAAA3D032A1 JEANQUARTUCCIO
914,145,043 *5F2AE3AF5FE6A92BACE4BB8BE0504762D81337D6 JED.DONATIEN
914,145,044 *5F22F33F5FE3948B0265B64F32521120B037456B JEFFEREYPUERTAS
914,145,045 *5F267E4E5567816CEC9AA941A1112BA4D9D92B77 EVERETTE.SHACKLE
914,145,046 *5F2F8C35ECDC4CC735D5002F0B90AA27FF468D8B evom56
914,145,047 *5F2FAA14ACDBBC817B89E9A3625C0B62B121491A EXCHANGE OF THE KEY TO ESTABLISH A SECURE CHANNEL ONE USES
914,145,048 *5F296262B66DE32922F587BF9FC18DA460C91384 ey"$=
914,145,049 *5F25A755DA230CE5FDCAC8BE07FE7C1531853762 jesangen(afmastodonterne)
914,145,050 *5F2B0040BEE3C697650BB684924314BCCF219FE4 EZRA.CARDONIA
914,145,051 *5F2A315449330E79EB62D0BB39A769859D6E7BCA JGT\
914,145,052 *5F2E3184C39F9680F1B623F94E6FC90E5A8FEEBF [email protected]
914,145,053 *5F21529AA3175B74C829661A9564369BC9CA225D jimziebert
914,145,054 *5F263C4FE140042423AB0977EF04DAE39DFA8647 FARRA9O
914,145,055 *5F2527397E1C07AAB4FACC866820DDB35D8A2E33 FBR114TE
914,145,056 *5F2E3B68048300837A1986101DE8415719FD441B FEASTINGONKHRISTIANBLOOD
914,145,057 *5F237DA62DEE1C76B46AA02A6EDF6B28690BA19E FEEBLEHEARTEDLY9
914,145,058 *5F2A5CF8A8D7C08B791E8CC03E475AF073FBE797 felthoff
914,145,059 *5F204739618071E41E1F574F27DA4AF47B0F6652 FINGERPA9
914,145,060 *5F2FD7AF37A5B7670DB0DA359420798FBCED9954 JOSEFSHER
914,145,061 *5F2E3F2CC8512BBA0E19CBFB6E34AF3F9550A2DC flowsheets9
914,145,062 *5F28CFBE724AB2BBC1765F50CE876FE23D7FDE29 fognier
914,145,063 *5F2BAAE0E1217C937E23C3F5E2E02DDD9C5E844D forsakethecourt:todo't,orno,iscertain
914,145,064 *5F222D5CEBF7EC01E078203685358BF966EB7A1B FOWLPEST
914,145,065 *5F2B25B7378C94CA087F0B58CCEB3624588F84EA franciscooppenlander
914,145,066 *5F2F9E1FBB87FE70BE956545915483860FBF043D freddydelamarter
914,145,067 *5F20204B9FAC5620F94AC3567CE674FE18A709FF freddyguitierez
914,145,068 *5F283F557914735C43B6898966512586CB34782B kaktus11
914,145,069 *5F2054FD269F4F9A0E98A9307448863D33DAF0E8 frogmacintos
914,145,070 *5F23D26DABCB42379EA185E082D3A2DE5D2DB539 FUGAZI56
914,145,071 *5F2CA81028368AF2259599E2DC67FE5250AD41D0 KENNITH.DEFRIES
914,145,072 *5F29BA01C2D63AE53EDD984D20B5C5F7B9BCCED8 KENNITHE0
914,145,073 *5F29A0463232AFA025A13ED07B2563C3BB0C2109 GAL BEN AMI
914,145,074 *5F246BEAED19AA74FA8F0D5A0DA1527C9BE0F281 GARFIELD.LOAN
914,145,075 *5F22D0ECADB553E5218FD8AB3E1FD06EFE5FC618 KHMARA2
914,145,076 *5F25928F06749EDA09D07FD9BA4B10AC0AC63E3F [email protected]
914,145,077 *5F25768E8163A730248EE770BEE4E71F828CC80A KILROYWASHERE
914,145,078 *5F244CF6CB41049EE7482C658F848306055BA81A garyyjana
914,145,079 *5F2ABE2BCCC7264BB5041F5E220E80E79C0403F5 genesisvalentine
914,145,080 *5F2C34EEB3CF438095EB7ED56BF4C3BC92BACB48 [email protected]
914,145,081 *5F20F64A3622E259C834948ED5F1FB8C5BA13020 GERALDO.ALMENDAREZ
914,145,082 *5F276BE5B080C2923F91FDA6E0752496BB1D0883 gerardopatoine
914,145,083 *5F25954ED6CA948D52443790346D87323FBA8056 KQLIEHZING
914,145,084 *5F2BE8E9F913A0AD26AE85637BCD17E72BD757F9 KRIEGER_01
914,145,085 *5F26BC8AAA57B30FAAEEE1D5AF670A80D597F6F8 KRISTYCROSIER
914,145,086 *5F2643726AB281368C61C5C60538692594CEEE7E kurthyman
914,145,087 *5F241769FC354FC8FA69769318DB573FE9C81C06 Girls(featThePingPongBitches)
914,145,088 *5F2CDCED158D0AFCADFC20D40FA03B05C29FDBC6 kx}\
914,145,089 *5F227F262D332FC11C8D0D48481C34BB98F58E25 GLASSED
914,145,090 *5F284488D79424F6274A10C8B1CA5E47BDE550DE L7EF
914,145,091 *5F253C35A9616E18CA334685C7162877EB83C7F1 L'ALLEGRO---I'LL-TO-THE-WELL-TROD-STAGE-ANON
914,145,092 *5F27B336DFF3842DDAF8FAE0E9569756B2AFF2C1 gr0undal
914,145,093 *5F27D45D1B87E75A263EA243441DE6EFA4255D4D LAUREN.KYER
914,145,094 *5F2E2EB80D63CB39EDCE60A9E3C2B2DBAF29C2C6 LAWK
914,145,095 *5F2FD75B61F2A79A1C0860AAE81CE0D1AE783B8B [email protected]
914,145,096 *5F23ADC6D7DE01B01ED0225A15082457C9686B43 guarira
914,145,097 *5F21A1504EEEE33862156F412839ED715AF7A7CB [email protected]
914,145,098 *5F274E5F8A260A23AD8D02E4EA8ACBB275B35E38 gunpointstoicism
914,145,099 *5F26B286000EAC5B5EC38CC6C38869B450BC2D89 gwshgtoning
914,145,100 *5F2B4D0C4B6C6A0D621D0B4529A4E3342AB7A461 [email protected]
914,145,101 *5F21B2AB46334914AA96552EE359EB121F3A65E3 LEVRENZ
914,145,102 *5F23A63F05297A8293FA4F980FE72E11DC58E22C [email protected]
914,145,103 *5F2ED04251CEE685E90FA8614A8F2B3FA540E36F [email protected]
914,145,104 *5F23FC79CA5207545ABDA746C6A08C0F5560564A liebe.und.verfall:.die.hoffnung.stirbt,.die.liebe.nicht
914,145,105 *5F20675876DCC37A187EF9AC2C09317F64D52F5D LIJMBANDEN
914,145,106 *5F2BDF148BAEE06473381A421F6543366E6931D8 hammer-hard
914,145,107 *5F265F5FEE227D258E5F1912C327DAEBD9CD7EA8 lilwade13
914,145,108 *5F254894C666BE1C11B431462D3C2A6718DFE79B [email protected]
914,145,109 *5F265B101FC3D07833AE56A15BF76806D41AA5D0 harveymatheis
914,145,110 *5F2CBF286887117A38FB1F9531EEF7E50696C96F !!!LIVED-4,0
914,145,111 *5F2FE2499ABE5B3414C9577B3DEF95BE858C1021 LIVINGINTHEHEARTOFTHEBEAST3
914,145,112 *5F26999C48A45F5D57EC247DD8B32C4932DC7D98 [email protected]
914,145,113 *5F2EE073ECB6EC65AF6062BF58C40ED13D71E1CE LM38
914,145,114 *5F2E87813232777B855572931F70A8615D8C9E12 [email protected]
914,145,115 *5F2097BCE82BFE84B90E6B1978016FAA89F7C978 lostandfoundtown
914,145,116 *5F2CD445C0FA8A8C720C8AC2562ECA19A2BEFAD1 HERB.READNOUR
914,145,117 *5F2F8A8F95FAFE05FBE90B373497CE121440D9D0 loveisaslovedoes
914,145,118 *5F28F53121D61227816331212AA2B596F20AA569 HERTZ.RENT.A.CAR.|.EGYPT
914,145,119 *5F2C090DA33F3E4FEA1A7F2084C2F36C444CE41E hesoingl
914,145,120 *5F2C9F1D6B676682153A8C7339D2B6B60C653AA8 hillside-in-scotland
914,145,121 *5F2FC2844C5CC902BCB88A5650711236728CB3B1 HIPPIE-TRAIL
914,145,122 *5F27347A2DF57B8D771F5970B25EDBED0437911A [email protected]
914,145,123 *5F2F76DAEEAFF9FCDC883FA7D6375F5689F67EFC hmaria.luisa
914,145,124 *5F27E318460643A16B576A74BEF2F9598F10AB70 HOCHSEESCHIFFSWERFT
914,145,125 *5F2AA3BDEA393AAE862164321651DF38CD033768 hopeful/envy-(lite)
914,145,126 *5F2097B5438AFA6A5633DE5E5D63E2D57D6E2AC6 HOPPERS
914,145,127 *5F29056C8184929E5A642B1D1B5ECE55BBFAFF06 MANURER
914,145,128 *5F2B406E146D2AC9B0F42EA220C928E02BFE7341 MAPORCHESTRA
914,145,129 *5F2BBEC1FBDD4ADB4BE673EDC9B6FB7A42B5C1C2 marcomikeska
914,145,130 *5F205EA5EE2932FCE15EE9DAD53C5AA5EAAADB62 MARIASTORNIOLO
914,145,131 *5F2EB5E0501EEA9C10A17D515880E7380938D2F4 hystyst1
914,145,132 *5F2F4048564DB90260E502A12CB288CB1457AC0B MARLIN.ROEKER
914,145,133 *5F2F1B8A666F9B9306309EDFE97D5CC7D3FD988A IAMERIN71
914,145,134 *5F279D06B48FB665C6FD2021641DB0C1E9E74FCF IAMFIRENZE1234
914,145,135 *5F2B5D86606DDB0B099E12B089D40105338AC269 IAMWB2GIU
914,145,136 *5F25BC6E84A48032D837C7F6BA6120C3A6022F4E iarettub5
914,145,137 *5F258208DD6D1F744E8297FDD20DDE6CEAFE4214 if($number=~/\.|[ee]/){
914,145,138 *5F29615E6A03850E9BC885E12D9D01CAC55C0BC2 maybebaby9
914,145,139 *5F2A77BA9C25BF443C415734909EBEB0FAE4DFA7 MC.PUNK
914,145,140 *5F24FEBC2BE7C7B932E79D52A3DA819A2299A6FA iloveisrael58
914,145,141 *5F2D1835EADBB494F4814F37BA1FE0846976B146 ILUVGRUMPY64
914,145,142 *5F2B7118EFCCC3812E2265AEF0974388A6F5AC20 [email protected]
914,145,143 *5F2082DFE8179E6B729F60B6C750056A8D778087 mh/_
914,145,144 *5F229DEDBE061CF23B5F21CD61EDF42704C7118D INDIAARCHIVEMUSIC
914,145,145 *5F20F04B246A18B9F71D4E1BE9287E7351F5B090 inflows
914,145,146 *5F2C0A5B05027C8CD939E5587A29EA96ACB9D559 MIKLÓS、
914,145,147 *5F2C9C9A21921CC54CF4B0BE463DFFBCFA4B2B3C INISEERT2
914,145,148 *5F21FC5A19365FCE488D88E3DA2C7C556D61934C [email protected]
914,145,149 *5F2E0FBCB763A2A7CC9B7DE5A5B1BF285B66ABF7 innicnoced
914,145,150 *5F21EE3C35FEF8B1B2D60D07521FB0244C1AAB79 MITCHOLAPOMPE
914,145,151 *5F2D5375F3DB81E87BDA9AC4315E9DAEAB8B2864 MOHAMMAD.ADNAN
914,145,152 *5F23FE7ABA299877E548EA3CE93E52F789EAF8EA ISAACCOTTRELL
914,145,153 *5F2AA6ACB0426A888AC8F1F8E5E3396F7F5D2707 MOHAMMAD.RENINGER
914,145,154 *5F278E3FB64DE3CEB172CFECBF2E3D731503EEBA MOHAMMED.POISEL
914,145,155 *5F2AF95A69FFC0C44F3B24303457637EA3780268 is:issued
914,145,156 *5F23970EAE489B3E3891A74C014CA7B5CE1C579C MOROTED8
914,145,157 *5F2B41FBB5F8029592B90BB0222E783255DC3E50 isrealarboleda
914,145,158 *5F25CA8231A068103BFFB5C4F34F83AFE411A828 morrisnickodem
914,145,159 *5F26D8E14FD3E6BFF32AFEC1C3DCED9563E00E79 i<&z
914,145,160 *5F2A6AD851024E995F828AD1D049437715276A51 JACQUES.MEINEKE
914,145,161 *5F22E890BB6335551636EA29A2B00537F7D40DAF jacquessharrock
914,145,162 *5F29B1080BE6371467F2ED2A1EEEB7567A06239F jaegarling
914,145,163 *5F2827EF1344CB791E6D238EE8D4555185ED3C50 JAKE.BADDLEY
914,145,164 *5F21C80D7EF4552514CBB550806EBD284A6CAC40 JAMISONTORRESON
914,145,165 *5F25DE03D46FF5642EF181339E7FA5D5DFD2EC78 jamisonwiltgen
914,145,166 *5F24D6BDE80F1680C6B22AE056DD1A126A04C92F M?YH
914,145,167 *5F2C541E782BEB19AD5E1D54E32954B88E573653 JARRED.MEHIS
914,145,168 *5F2E0B5B173FC28D5F950DE052A87A6EC68F89E0 jarvisburfield
914,145,169 *5F29A4923A7411E8A2400A59B6EB5FF971BF9DB7 JASMINENADAR
914,145,170 *5F2924F7A50E1EBBA9B3B6801141EA2A1CDCA30B JAWBOX'S
914,145,171 *5F2F35DBFD74A933D24CB54D82E785152B1B350F N8+R
914,145,172 *5F2931179687755519640F865618E42BAF0FF09A n-9i
914,145,173 *5F2BB9548AE8BA8048297C77535DA862E3DF7A26 [email protected]
914,145,174 *5F2E94F87D52B1740509CC2A10238D9BD279A608 JEFFEREYDAMANN
914,145,175 *5F294BD6D96EE47F15BF7A69BDB61B67F9110075 [email protected]
914,145,176 *5F2638FEB4EAB7AD222B726F8A162BD502794BAC @[email protected]
914,145,177 *5F25DFB03DCB4F4F5D15A34D6F2A541A84537062 jerevassen
914,145,178 *5F24D77CF2F676FE325A3815CF1B7629ECD19987 JE-REVIENS-POUR-TOI
914,145,179 *5F278046DEC3C281C9E9A27ECCE06C2BE1635E0B NDEVRIES
914,145,180 *5F290294482B9A090DA550371D67E752EE60EF3E NEAL.JIMEREZ
914,145,181 *5F21A178F3FF057F26128FA47B308DD69DAF997A JERROLD.UKOSATA
914,145,182 *5F2251F2E28BB90EFA439A2973CAB6B5AFE7A663 NEDRUEL5
914,145,183 *5F2DB47A47C455C0A45CFECA751C3BB2913CF747 nelsons
914,145,184 *5F20120DA9795A23E89F284FAFFF4A2BC0EE3E14 [email protected]
914,145,185 *5F2A352D5EA1A2E13A7E665A1116B1595A2A9CD2 JIANGYINGA
914,145,186 *5F2836A114FC1F628FAB7A0ACA9CA5F5DF61F520 jigc
914,145,187 *5F2D3ECCA66B06FF61F7234DE1983C6D2D5CF1A6 NGC6655
914,145,188 *5F2ED52F1856D1A5878964D9E6C0D20BDD074948 [email protected]
914,145,189 *5F26BB3EAFB37DE9E757DE7B0AF6F2E89F6581D8 JOHNPISCO
914,145,190 *5F2358BFCBD605EECA7769538AE543EDF95C0967 NO.7 IN F
914,145,191 *5F2EBF2702FC970B0DA43FD58920657444E936E2 jonathantigner
914,145,192 *5F2DA0053B3AF8948C2D3296AC78D4C83251DA00 NOIDIK
914,145,193 *5F23A85C804375092FB1D20CCD01461F4B71E946 nokiasiemens
914,145,194 *5F26BE5F71EA5F98B83B5FB91AB443862DE5863F [email protected]
914,145,195 *5F2FCD292AFF4A87F5E8A969AF08D23A1F460A26 jorel314
914,145,196 *5F23678C83F5221D535B46A61D945D6C7EE4BCF4 JOSHUALUDEKER
914,145,197 *5F251013EB1131E81E4238F8F58A8F511A6FE7DB joshuasider
914,145,198 *5F24AC7FE77F00144AC98D2185B0F32D20531C3E NORM-PRIEST
914,145,199 *5F2B3BF75052A02EF5DC273FB92B9D9AF1FDC367 norriseakes
914,145,200 *5F26E1F0A60E78184EE7B3EA2B56A433593DD8C2 [email protected]
914,145,201 *5F236B1F4241C7ECA62342B0461AA78BC4459A55 NPMPSLY3
914,145,202 *5F22CB8E10F1DBBA160DF387A58D0C3E485EEF37 NUR EIN BILD
914,145,203 *5F2C06EAD6374D91884B014C1762832EF411CB82 NUTMEG?
914,145,204 *5F261C42B932D6DF2E27BCA837AA4EB4618C50BC nzy}
914,145,205 *5F2D0A58C39E7DD52CB7C84950780AA86681F1A7 (>-<)-o~(-3
914,145,206 *5F21744DC87A4E74EC8CCF29558BAB71EBC430E1 O5G^
914,145,207 *5F27712B110940A0FA77139CA2049CFB901B5536 JXYDRKZX3
914,145,208 *5F2F23B7D0120F6C21EE3F93D53B59098B8296CA ŒRNPS
914,145,209 *5F230926361C8DB4FE9F170A08B5F7BD0E46E232 ofjoshuayhyu
914,145,210 *5F2F1FC12DB1AC72B6A693270DCF0137D769537F oisinoid3
914,145,211 *5F2FA501F1C6AF974663A727B41B7E47B0928EC0 karter250
914,145,212 *5F2DA5A4444036F39F2EF00FEA277B16E6C3C34F olettaening
914,145,213 *5F2EE64529999D064AF9F9161DB8AE5398845F98 ONATOUS(ENNOUS)QUELQUECHOSED'EUTHANASIE
914,145,214 *5F2207390BA658945DEE64F3ADE97AB633251B26 KEITHMATTISON
914,145,215 *5F24C1F7FAFF0A75E98065790B380BEF406AA99D o><.o~O~d=====8
914,145,216 *5F242138A1405BBB3DCEC9184D249CD6DC5957F8 OOOH,-WHAT-CHA-DOIN'-TO-ME
914,145,217 *5F253D6A55A5C36658440D408F35E00301C97B0B KENDRICK.ROMANDIA
914,145,218 *5F22BDC65257A3573F3B26BF735E4A020C1DE931 OPPRO8RIOUS1Y
914,145,219 *5F2249253922F894FDFAE7357076FBE69F1F2CAC kerry.aaron
914,145,220 *5F27BA79B9694A5E00E22416B87968D397F302E8 ÖRÖKHAGYÓNAK
914,145,221 *5F2BC851ADE449809F5EE31DBED4F65CAED88CE4 orthopyroxene0
914,145,222 *5F2A3C5BE86DCD33D28D81AF6D94854C2238024B OSYBKLCI
914,145,223 *5F2817CF1781E406CAAB42BDB2B35180AC54F131 OTTOPIRNIE
914,145,224 *5F25CB51CC7004ECBD9A25383268ECBF7131BA65 OURLASTTANGO
914,145,225 *5F276795E0BEE6817C60F3CB6FCEB91E815DE846 OUYOUTEK5
914,145,226 *5F2B85331EE985EEAFECDBDF8A25199F382D8C03 OWEN.FAUROT
914,145,227 *5F2016458B24200F477484706B158BD232EEBDEC [email protected]
914,145,228 *5F20A169A4A59F9AC74DDB5901F8A4B92EBDEE50 p====)`~)0(
914,145,229 *5F2A8941E815B1147886524B4A3AA8F6980F481A p##@~ 3B<
914,145,230 *5F298438D364E593CBEAD6BA4D7A96FE1A0660C9 KOERSLYS7
914,145,231 *5F2F8A65A036207EB3142CCAAD69225DACD00AFF [email protected]
914,145,232 *5F2D0CCC7D2E0783C7996B429F31BF2115AD6F41 palau-de-les-arts-reina-sofia
914,145,233 *5F2CD0AA9A988C830D0F66E09EFB279CA354284D kpfxektx
914,145,234 *5F23951ED7D350111B11BCE693150AA8695606B9 KRAIG.PLANAS
914,145,235 *5F2463819530BB20802FFC0273F453388B547E4D PARKERFLINK
914,145,236 *5F21192C26C21287C4EDAB0A31FC3D3297C74745 ktm625
914,145,237 *5F26766438AB14E53794B927C7DE8C7A7ED348FE kupusom9
914,145,238 *5F234CBDE86A63F2B75C7AF42B45DA5B1BC845F3 KYLEACKISS
914,145,239 *5F20B1247CE0C534698A45E7C08592E8F4BA3AC9 PECANTE123
914,145,240 *5F283974F52942E9386B85D63FB8FB9E0A99E09D [email protected]
914,145,241 *5F2C78A646A3D83A2275606AB147F1E465850D60 LABORATORIUMSDIENSTES
914,145,242 *5F20A3B0404CBDF9E6001EF3F45BD02272ACD343 PETE.CAFARELLI
914,145,243 *5F26B8F39CD8F61CB737717035FC6E847EB596D3 PETE.GOODLET
914,145,244 *5F2B98A5D4DFF77EFBA717E9542A5930795BFBF6 lancehusson
914,145,245 *5F2004D0276241E0C178C3DE653CFA940DFDADA4 LANCE.ORLANDO
914,145,246 *5F2129E3183FDFF1AB9F7B9D62E95E937635508A PHIL.HINE
914,145,247 *5F2B8FF42E0B76D4905BFC661A74853C80913163 PHILOLOGY4
914,145,248 *5F2964BD377A6B1FE8C85CF974741295A9152DBC PHILTHIELGES
914,145,249 *5F2F197D41480E56E7EF9D07834E57FCC2F333B6 PHOSPHIDKAEFIG
914,145,250 *5F288D585F02A331A43FC71F4ACF9472EA44F9C9 LAVERNE.THIE
914,145,251 *5F2D39BBB691602668E5F1FD77B5D8AD721464FA PIERRE.ZAHRADNIK
914,145,252 *5F27E366F2541AC3AAA604CB4EEA0FBA9E13ABE1 PITIPHAN4
914,145,253 *5F2AD8CFD19582F134A777441AD0B78C9827DE49 piwgbsw0
914,145,254 *5F2B54B2BB8AE67FD28B951C3600105BC72FA407 pliable-a:
914,145,255 *5F26C52254D8795AEE2DB3E871FE6428371F05B2 PLOEGSTAART
914,145,256 *5F2276CF93C5F5575D1AD9385831BBD85895DE04 P)~~~}O{
914,145,257 *5F2078EDE66100791DF249C061F6D2520B1A0CC3 LEONARD.GALAVIS
914,145,258 *5F202C8A447DDB066B8B6350D10F4A69CDC92A65 polodawn7
914,145,259 *5F216CA386166914DBFFAD3A2F0ABB705DE672D4 pootaard8
914,145,260 *5F2E7BCDF653FCE59B86E6959F4DB8B796D91094 leskucel
914,145,261 *5F2592F3C7B50F61589E8FD9B58000E97E439CDD LESLEYSHABAZZ
914,145,262 *5F2C26218796618638E24E825B4CE75DE78E89FF POSPOLITOWAC
914,145,263 *5F2E915312BDA153AFC75A5F61AF8E6C4A377C38 p--p `~ `~(^_~)
914,145,264 *5F27432016A104645DA662130BA2921D253379C5 PREMANANDAJOHANNES
914,145,265 *5F289FFFE303789C6B1F8CDFEF005D182E5448FA LINDSAYDEGEARE
914,145,266 *5F227F5B97FDCFB918864667BE3310C9B416A53B PRODUCTSPENCILS
914,145,267 *5F2C4764AEBB27E4E9F77B2DB6B840ECE4587F4C lipomyxoma8
914,145,268 *5F28CD0C4C053D7057626E852EC8752D0B5C024F [email protected]
914,145,269 *5F2D3A8785D1D319C272496E1C41D14ADD058AC1 [email protected]
914,145,270 *5F2D7184616DAC1C9C8E899867347F53E2A88127 [email protected] `~splat
914,145,271 *5F284B389689FB775214A4455DBAA41876CA3871 Q44984
914,145,272 *5F2099591274FE8F79A240D49D444B0EA5D7BA8F LOPSICLE
914,145,273 *5F2398C5805635A8CBD88E523C9C59F506F52F5C QAZEDC712
914,145,274 *5F200A69BE27593279B0F61251B69DE8F1495C65 lovingsun
914,145,275 *5F2E55A03FA95EC452675CEAD40B5E5A240E0905 LOYDWEAKLAND
914,145,276 *5F286C6ECB68D777B95FB2AEED48B86D5128DD56 Q=P~O><
914,145,277 *5F2638E7EA94F152B51F8B177E76387EA217AC2D QUEBECBOSS
914,145,278 *5F2F5C90F0333B872463E4172C2E1915DD5FEF8B LUGGELAW
914,145,279 *5F22EC99DC3FF2A07AFC58D5226B21F81F51BF2A QYKQ
914,145,280 *5F20D82DFFCE4A15120BE195DBA16F844FEEF8D4 lvpd-7-0
914,145,281 *5F2561E29284555CB552DE1C051AC8E221155469 [email protected]
914,145,282 *5F2739829C1B8A8381284D35E7BF5E70B76F2A88 r7"
914,145,283 *5F26F411EBDCFCA6F78DA45266875A3D2AFACB99 LYNN.FUDE
914,145,284 *5F2088D05A3FD146F367AB99C2E48D6169BA40F5 RAHUL MEDHI
914,145,285 *5F21DF476EF02A8EAED0175A1CB61CEF9C83C5B7 RALEIGHPOIRRIER
914,145,286 *5F294295A46902F6F5E87F8AF0FD089E95C2691A ralfhueskes
914,145,287 *5F27A119DF3A32F45A072F98175246BF60E8F8BC MA9N37IZIN9
914,145,288 *5F295069E38AC89ED7EB25CFE1F666AD8E905DFF MACK.ENBODY
914,145,289 *5F2128A0C97804D303F52207727B88155E1A9BCE randy.roby
914,145,290 *5F23690EFCCF84CC21F1A758CEA2A13715F226DF magicianal
914,145,291 *5F28023797D9EE6650A77ED24523D609ED5FE60E rayfordrevolorio
914,145,292 *5F25B694A07882C03E1731C44977F6AF8132809F malak0156987197
914,145,293 *5F2E890C0DD57CB6B16100BCA251E37379B40A84 RBA211
914,145,294 *5F2213129F3B2427235F2400514BE0922DC9BC4A REBECCAETHIER
914,145,295 *5F2BEE88B03217CCBBF3BA4864B08F65F64113E9 recobert8
914,145,296 *5F2202FC485FE0DC213B76C2C5B6030447F58FB6 marcel.tillman
914,145,297 *5F27E6190287966FB919857B0ED340D92526A57A MARCODUTHIE
914,145,298 *5F2D963F531CCA2FE64EDD1BCD92FF2B652E3C54 MARCOMCINTRYE
914,145,299 *5F2425FF6C1F4EF4B98FEA38DC98F80686D8486A [email protected]
914,145,300 *5F2C955DC31A22775AFCA4AE97B3BA4ABB15351C REGOLAJED
914,145,301 *5F297CC559C17B08829F43480F6793B7360ACABF re.guerre.anglo-marathe
914,145,302 *5F212FFD4CBCCB3274E34623C29D4C53FDDB2C8A markaponesto
914,145,303 *5F2DC779FFB1E80040258A627A3D91930872CAD6 MARLITO MUANA
914,145,304 *5F26D6CA96D65C562F80B0DE58247B5A0A3590D6 REMIALCERPPING
914,145,305 *5F27FC146254B66C48A7A4E6477CE876173A7F9A MARTY-WEHNER
914,145,306 *5F27D13CBE43ECFC532DD2B682AFBF2E665286B6 MARYOLLA
914,145,307 *5F232A0DE07AAA7297A6E4A6F912050723E2A676 REPROVABLENESS?
914,145,308 *5F29FDE17A635E6BAD469C828A4B1D2F9B13026D maxshift0
914,145,309 *5F2AF49A79DFAA58A810E49DF5641E7F00C895A8 [email protected]
914,145,310 *5F2F32EA06E2F72C0AE517765E792CC0F1355F7A RGANOS-GENITALES
914,145,311 *5F2AFC9CFBC44061ECF2B92EA11B2554DA993A57 RH1G15T5
914,145,312 *5F2EB3F26228AD719C8C9D11A480BA3C377E71E8 md0570024000
914,145,313 *5F2B4CB0D86250D928AE333AB28D8FF83C3E2CBE MEHRJAHRES
914,145,314 *5F2A25167AA63ADFF9CDAEBDC4FD2238C7061C0D melhenneberger
914,145,315 *5F2C64D6E9E5879789A11FE710EC708015F42719 rid1JPF6TH9QWA740SDBVAR
914,145,316 *5F2C0200215251E162EDC6D6065BEEB2193A2D52 RIDESSERORIDESSERO
914,145,317 *5F2251825653330DE0A739545FDF556D33D05B59 RIDIVENTATO2
914,145,318 *5F2045246846DDDB008ECECB4314E24710889886 rimasalvarezkairelis
914,145,319 *5F21EA5F1664C43C52F84AA8AFB568275FA68415 ROBERTO.PUDENZ
914,145,320 *5F222B39D733C8D3075B7618E7F8A3951AF3DA85 MIESK
914,145,321 *5F2B61D1CF33A3954BE89EE3A6AE0AE45C329AB1 MIGUEL.HALVERSON
914,145,322 *5F2E2A72B179418FD2E733FC1A53A9EA2BAE686A MINERAUX7
914,145,323 *5F29ED8D0A10BF17A7BDFA0D8A17B2869B821818 minetto2
914,145,324 *5F2C0CFA0F2F752A9731173C47BA060B0C995D05 misfires
914,145,325 *5F29F9D598311FEBB8682DF3F7F3E8D38FEAE124 rollandcompo
914,145,326 *5F2A8B1A3F37FA26BF03E30517421A7DED4F2606 mitchelldelton
914,145,327 *5F2E4CD64F3E93E5C7809EFECE1600DBD0E67F07 ROMANSTOPPENBACH
914,145,328 *5F2279DC07551FC98C691C0AA544B723559BEED1 MITTEILUNGSWILLE
914,145,329 *5F28B83EC971697B104D9C128C2DDAF0E387163A RTAKENDE6
914,145,330 *5F28826881854749793EB2B7D6AFA858641AAA13 MOSHENOWACK
914,145,331 *5F27F05EA1644932A9FC480B1E5930ACCBE3D1C4 MOTORENPAKET
914,145,332 *5F2AB425432F9866E4F59C5382786CB328C4CBB9 MOZUBSW9
914,145,333 *5F2184C50DD3729B7D5E2F46B46A229E6F7C90D8 RUSSELLCADDEL
914,145,334 *5F21FC846D9DC652D6AE42391C4127B12981D100 [email protected]
914,145,335 *5F2C583D029E4DFA7C01FFA4CF430EC8A30BA6AD mx:h
914,145,336 *5F28E85BBD25AEC28A333A23B20E4CC7B4438D6A SAFETYBIOLOGY3
914,145,337 *5F234A766B61BFAE81685AA98B263A0F4C99AAC6 MYLES.POLACHEK
914,145,338 *5F20D02FEB312DADBFDCF509C7F131E2205DFF05 MYLESWROTEN
914,145,339 *5F279C4F4376036C57DBE556EB574020021CA0C5 myscott66
914,145,340 *5F287B977447A88CFAC4D9FEF2864830115C8D5F N6LE
914,145,341 *5F264306AB9B44B187A49B31E705CA1019BAF975 NAME FROM THE STANDARD INPUT FILE AND THEN WRITING IT OUT. LINE
914,145,342 *5F2B35E88A0015B45B34A1B3BEE3C9F039CED59C NANAŠA
914,145,343 *5F2460C02028E500A34705FF17A7EC771EF4DAEF SANGELEVELD
914,145,344 *5F2C65A87792A6ACB096EBB67109F780A6F1CA93 SANOJZ
914,145,345 *5F22EA6CC2EA4FEEB2EE32ECDF767F254FC62701 SANTOSMORRALES
914,145,346 *5F26585D808E2EFFD479B56AAE018DE1124309DE nathanulvan
914,145,347 *5F2787411B512CDE538545A6F31585C773DA3E78 satellite&home
914,145,348 *5F2081D709168FD733447509AF017148493F6F1E nelsons
914,145,349 *5F27AA5A0DF1559911FB8C102303B5ABEA4A9700 ne weinacht
914,145,350 *5F2FFD8CD83F8EF4746E7CAAE03418B0FB455E97 SEAN.NICKAS
914,145,351 *5F270F1985F173F06C752D75B141389B1F3F3792 NIEODMAWIANIE
914,145,352 *5F2F19B6EAAD5D300EC4F4E62277C071F7C0DB78 nightanthonybradbur
914,145,353 *5F2C2BAA009374E0062159A3ECDABBE5C082AD6D NIKKI.AMBURGEY
914,145,354 *5F2CDD7AF6ADA0EE76C8D6E53EAFE2A57C924852 SELIBOM4
914,145,355 *5F255160C051C3932D9D2194D612C66F6757EC37 NITOWACZ
914,145,356 *5F24E4AAA1F8C007236CA839295B482FF5D991A6 SENAARAC8
914,145,357 *5F2411EDF2B1FB8149C1F2984500E88D2BAD395B SENIORHECTOR9
914,145,358 *5F204A58DAFA2F2C194170E192C1360105B2F038 n'mm
914,145,359 *5F24C62D70D1883DA3F6E131C48C08ADB295342B SEVERAN0
914,145,360 *5F265E3F139229DCDE9EEC15115C81259A241513 nongahc.1
914,145,361 *5F28A7871ECC1B0B7965C5314C2408429C33FA8D sgnilzzup
914,145,362 *5F26305300BC26E6B87D4A0487F5CF10849CA67C norm-blum
914,145,363 *5F29D8E52302BBB400602541462EAF505319C8CA notmanytheremix!/standup
914,145,364 *5F2241D9B03422B78D40F9000FA0CF8CF7332927 shannoncherry
914,145,365 *5F26F0E5F8C3F46BD0FF3736536B0D07D4DA4733 [email protected]
914,145,366 *5F2CE3871C8F4BCE33AC1858A2FAB89B42463529 SHAUN.OHAN
914,145,367 *5F276EF0A911B5937E4DD88916A654533CA242BF nt6baa
914,145,368 *5F2B77E471F7FC4442A5234CFE5BB28966CCB168 NURULHANIESNAJWAI
914,145,369 *5F27276B1C7721D4268A569B07B79C57A5D20EE3 NYIBOLB
914,145,370 *5F2CA1CAF77ED23038391DC3727808B9AB745572 NYUSWIENDHARI
914,145,371 *5F293748A2B75502A1B4A0FD09A3F2C3837D8EF9 SHERWOODFARNESE
914,145,372 *5F28BE014736E0A5D74327C31C038350F469CF5C [email protected]
914,145,373 *5F27F22612D0D68B4A19A9C9DC5E8C884A28822C SHIVERS''COYOTE
914,145,374 *5F2A6532B7E3BAC55F75AEDB61D8ABEEBA70D32C [email protected]
914,145,375 *5F23729E277C97EC320ECCEE0525DECAEF43F134 sidmucklow
914,145,376 *5F2FF4C9FD0DB7D0439CD46D059386ECF0AF6FA1 SIDNEYKILCREST
914,145,377 *5F215299E44FA44053894B1554DD506B4C082F2D SIDROCHE
914,145,378 *5F2E02FB9FC35605875ED6CE89B98D2AD1C9DFB7 SIGNORNÒ
914,145,379 *5F2AE381AC7A7EE3F45C64659DC601B49B6BE802 OLYMYOID
914,145,380 *5F2EE0769645417E6CC4B0A607FCEA9A2B3A5CC7 omarmoha
914,145,381 *5F2D6AF2824CA1CADF961E4E34131991D88DAE7D ONDERWA4
914,145,382 *5F2A901F2B08569A2A93ED41782586CD4A7EF8D2 sleigh embarking
914,145,383 *5F2A9FF5BCD7D68E280FA30F8CB311808F50514D )O( `@======Q
914,145,384 *5F2614256BB1AFC9DCE82BFA70BC47DA176ADE81 SMKYZGGY
914,145,385 *5F246BC2753D509ABFBD51C49662BB2C2ED8E661 OSCARMATUSZ
914,145,386 *5F2F79E4F087C33B6A96C6E2B9BAD2A32167D057 SNOLIFNE
914,145,387 *5F236A5572CFA4952BF0EDEB5303CE58C3B61B11 OTISSPOHR
914,145,388 *5F28C0A4D616DC2C467487E397A4B6BD19B95E4A overdoctrinises5
914,145,389 *5F2D21515E722419F2090E255B02EDC4974F7E2B OVWB
914,145,390 *5F290B5275A111443EE1A7806ED978E0E79E2FCB SOUNDSOFNATUREPARTI
914,145,391 *5F290C1BB7BF9997D203CC69EBC2DCFCD45086E4 SPENCER.CHERRIE
914,145,392 *5F2EA76AA8FA3809F1AFFE7590DB593654F6C78C SPIDERMANDESAMBIGUACION
914,145,393 *5F201D9BC2900CE4FF3D26044DE0C9404D5C469F Sploit*q3
914,145,394 *5F2AC719D18E96C2D01AE84A55150B8AC234C93E PASSIONERAT
914,145,395 *5F2C5F812DC056CCD4F3FF9CF6EA160EE9665796 spraakzamers
914,145,396 *5F24BB1E8DB334DC1AD46BC872AB0CCA00F4426F PATRICK DECECCO
914,145,397 *5F2E48CB879A72440FDC576511C3D6E371BD5188 SPROGDINIMAS
914,145,398 *5F2173DF22EE04AF3AC25A14662D898677F555CA SPROUTINFESTED
914,145,399 *5F2081FD3EBB6D221B41C358DBE680A691AF8930 SRIKAVIYAG
914,145,400 *5F2767D66BAC59C89A1F6733AD882EFCD490D3CE PĔGAT
914,145,401 *5F2EF534CA361412E7B0A48FB673FB9B07BE94CA STACY.WENRICH
914,145,402 *5F240E30998F4D4AAC5DEFFDD5AE285C12E58EEF pen-ver
914,145,403 *5F2CFE3C81BCEB2E2AFEAB1B46C7215937396E02 stanleyelderkin
914,145,404 *5F28541200F7087404251462675B1B4593D062CF PERAHUENSISORANGIA
914,145,405 *5F2819037A7931AC95BCDF6F13C25AB911B4EB39 PERCY.AGOSTI
914,145,406 *5F2D07239F9D710B10F6599A4DE061CAC29D487E STARO152
914,145,407 *5F29856219DDBD9EC26AB718E74468C6DA297C67 STATIONTERVOLA
914,145,408 *5F28B799A13CE72E820DF1272C505B9A2D2E5CFB peytonlouise1234
914,145,409 *5F27053CF74EEEB5C5EA2B9C708693F1FFFBEAAE PHAEDRAPOWELL
914,145,410 *5F2134517AF94208E91AFFD6BEE6CA20F06FE48F PHILIPPE:TOTO
914,145,411 *5F215B76EF25AE3B23EAF878A464D72279D1B15C PHTHEG
914,145,412 *5F2A897AA48E1DA4B1B9C3599E76F360A1BEAD72 STILYAGI JPG
914,145,413 *5F293BB422F9159782657399F7C4B3CB971B5631 STORDRIFTSFORDELER5
914,145,414 *5F282B2DCDE00EC65D5E4868F836E4F9AF7043CD STORYTHERMOFORMTHIRD6
914,145,415 *5F2C9516E67C7638662B84C0BAE454269A01215C streathamcroydon
914,145,416 *5F2BD82F462AEBF9652B9BBBE8D2EB7A54C50E49 P.L/
914,145,417 *5F2A72A56545411F30D580A5141EF3163AD78946 pl074g3
914,145,418 *5F22CBFA5232FE53E27606BDBA9AFF124FF53105 Pl$3n3r$
914,145,419 *5F2DDC18FE6287192C53E8D67D43106A06A2F060 ST?T
914,145,420 *5F2F46478C0AC461C2836D8C30E635BB3D1734F6 stuart-colquhoun
914,145,421 *5F23E9C9223406636089AF0528D9BA960138AD6B stuartfrancis
914,145,422 *5F2E629607D94617E2ECC2E2DAF45F24FCF6D4B0 [email protected]:393929
914,145,423 *5F215449A71B25C6D7997CA9ACD98C22A42271DE popeye4runner
914,145,424 *5F25EACB593EBA497BDD97E6DB1A85C574F6A3CB P----P~~~}X{
914,145,425 *5F228B9597972C011F659FCB967666ED9F99E004 [email protected]
914,145,426 *5F2B094E88BD5375DDC8F3B1144E5DC905D207FD PRAJESH MEHTA
914,145,427 *5F23A7A5F57C7827D11CF6D5C822CE8E1640909B prameyuda.chaicharncheep
914,145,428 *5F2E6C4453300F7BB690CE9112E8891F6E3A156B sw33th3srt
914,145,429 *5F25A77F4E823EA402259712316115D1E224C5F0 PRINCESS-RODRIGUEZ
914,145,430 *5F21C46C316356F761782745A90C18968E78C91E PRINT(&QUOT;ERROR:.CAN'T.DIVIDE.BY.ZERO\N&QUOT;);<BR>
914,145,431 *5F25D4CE2F79B1AB257A92CE2008C436AC2BF472 TABORRE
914,145,432 *5F238BD601C8378581F43DC048E38D1502B11937 Takanori-Goto
914,145,433 *5F28522E0CCA40BA9CC517ED6311D29BE0C5573D talk8417624051
914,145,434 *5F2E7073A0F4D793D02AC97FF0A2D6138CBE2D98 talk8613156253
914,145,435 *5F2170A6DA12BDF3E9F8097E2F04CD44C71DEA4C TALKJOJOCURLER
914,145,436 *5F2102AB43750B9F43D495A885A4AFEBDB7A7829 [email protected]
914,145,437 *5F2A2E5E97A447BEA4511F249EDCE59BADDE696F TAMARAFLOWER4
914,145,438 *5F279DB828DE4869DA88E34A8223D7FEFD6803E1 [email protected]
914,145,439 *5F2BC68CD8960B261FF6FA926FE8FF4FFD0EB30B QHDGHKS12
914,145,440 *5F255AC28B9B654FFFBEBE9587EFFC9CE96ADE08 TARA BOWLING
914,145,441 *5F23622767FB2BAF3268012DDC40B3784FBBCAFD taryn-banks
914,145,442 *5F2ACA539C7E8BFCF1E5F5F0824E56928CF50297 TARYRAEN
914,145,443 *5F2936D4BE294EFABFD50381A89E765FB9FF015C tb174
914,145,444 *5F24620E239D0199494BE2F3AFC0580A86A589D4 TCU_
914,145,445 *5F28791521C5D087178865655073599DC7735203 tedtandy
914,145,446 *5F2110418D23319CE5BE87B65F9A64FC8A48014F R3D373RM1N35
914,145,447 *5F25543960D347CD260DDB399B963EE3C9E83FD7 radical.
914,145,448 *5F2E35290DC322C440F262B4C75586B7BB950700 thatlouise72
914,145,449 *5F2485030AA0D9C98A1A979E31E8673919A8D1B0 thatsaved48
914,145,450 *5F2CD9DEC28E32E0157FF060BD9045990DA4E97E thebutterflyloversviolinconcerto(yuli-na,bbcconcertorchestra)
914,145,451 *5F2D80DE2EE640D137C31F93FD1D41807D199C1F THE.CRUNCH.(REPRISE)
914,145,452 *5F284C89F40AE8985FF9B6EBD1FFB786FB7A21CF # The /etc/hosts file, with some severe hacking done to it
914,145,453 *5F26091454CC30D67550C92BE428E71F1AD5F710 Razvijanje-1
914,145,454 *5F2F4E8610D34101F01FE56E5855E64EA77D57F9 razzorr316
914,145,455 *5F2DA7C8D2EBA953AD08636E87F2A9C7FABC0826 THEODORECARIKER
914,145,456 *5F2466E050F64D5F12BACDF2E298B5A0BDC685A1 THEPWD2010
914,145,457 *5F22E7A8018A3F2FEC2FBBD913C24387A991A3AD THERIALG
914,145,458 *5F2D18F067800EBDF795873BFFC2CE4131B360D4 THE STRANGE ONE
914,145,459 *5F2E5A07504FC45C1967B59E29F8168D99B623F0 thethursday89
914,145,460 *5F2FC5BCA1975CB4B6C851164B154316DAA57435 REDMAN160TALK160
914,145,461 *5F257A230FCEFF718C799EFE48C867B0371958A5 THING」「SHRUB」などと呼ばれる。同シリーズ参戦中、2004年シリーズチャンピオンの
914,145,462 *5F225A3ED6C16CE509ABA5FB29D157001CEA2525 REDZDAT
914,145,463 *5F29F4869896CBF4C55469140E5242E89A39D5A9 THOMAS CALOGERO
914,145,464 *5F24D903D1E73E6DC1F8E857AFCC26AF7770CE8E THOMASJAEGER2
914,145,465 *5F2E354C6A6C5989845E7222D27964FBD00C36D1 reginaldmesich
914,145,466 *5F20AB8C75FB7AA35C2EDAC7AAD35370A1043610 REGIRAH9
914,145,467 *5F294BC2544438E059FB3BD66C575FAC55003434 thyreoarytenoiding
914,145,468 *5F279BF0989F9884299AC041B17061B8778BBDFC REMEMBRANCERH0
914,145,469 *5F29BAA647BA6BB9AE74FCD03C689D32DE3A3474 timothy.carney
914,145,470 *5F298C70CCEC9E829880FB6D08330A13A77EA21A RETEMOGR4
914,145,471 *5F29C6B6D24DA4157E3563B0F9D283C516383055 RETINT?
914,145,472 *5F259CF6F2DAEEC7A12FCDC98EBCD5906B5E0AE9 revendio7
914,145,473 *5F29DAD7E898299508E8AC5031D9ACA742BE4EB2 REXGOMBOS
914,145,474 *5F2DEF3F9D14BB7F2CA4EEA81C9EAA05E0D26E04 TOKIMOOKED
914,145,475 *5F2DA2B2262C6D092FE77215F805955105B7F976 RFHGLKYH
914,145,476 *5F27DFF0028C6F8CF29F21985528FE4DE9A1A00C [email protected]
914,145,477 *5F287CCC1FF2EE0241D2C2A4A75F9F4AAD3C7EB8 TONEBUZZ3
914,145,478 *5F2FD7BEBEE4882DF035BD833FDF6DFC8EB2DDB1 too.many.saturday.nights
914,145,479 *5F2E0957286B1E8B1D117E6225E07697251D1D40 RICH.BESANT
914,145,480 *5F256C904B5AF407B15AD53E185E343578B3E8BD richrodriuez
914,145,481 *5F204CCE2FA8BCDFB6BC83F767198A2DFBDDDC84 [email protected]
914,145,482 *5F203D20C6C4EFB152694EB4B7E9FEB26734FB60 totenheer & rammbock
914,145,483 *5F23A63B4CC0F199CFA523990C73207108031AD3 TRACEYDETROLIO
914,145,484 *5F2EBD3E737C32F78B46CBDD5CB4F0A7226A4984 riraan
914,145,485 *5F2BC67FE21F7A9A4941CED1D266AA761F009683 rizki.gunawan
914,145,486 *5F232EBDBB410A480449ECCAFD21A9B3012F0331 traumelinchen.vom.bergacker
914,145,487 *5F283DEDC5733A0B317CC6392015B53EE83AB00C TRENTONKALISTA
914,145,488 *5F27FBB21717386AF6358EAAD6F095FBCFBCAD46 ROBBIE.ZUFELT
914,145,489 *5F2B2A28F443E7952C5CD92A116A999C35A537E5 robb.may
914,145,490 *5F290C0B97D452A87EFE93F0F5860C542D188498 ROBIN-ZASTROW
914,145,491 *5F233014BE38C10C2060F80E94ED144A4F045A43 TRICIA.YU
914,145,492 *5F2DAA781D35F795289FABED31565B6B5C3C0755 trinidadcastagnier
914,145,493 *5F2A47B51301F8AF66FEE25D47B2D5662FFA9E3D roccomenzella
914,145,494 *5F20374583D977C2ACC694EBEE5EB0823113899C roccoshonerd
914,145,495 *5F24090D2F32C80ED4B7F3AB7A04BA368DD0E659 TRISHFRIEND
914,145,496 *5F2DCD1A587AAF342B7A6151BAAF74042696CFB6 RODGER.MCENANY
914,145,497 *5F266BE35DB2B98E6284A986D3086A753FAC7D3C rodmanitaly
914,145,498 *5F2FF5BD8039D8E3F0BCD2DDF39A4161290A4507 TRUSTRAM5
914,145,499 *5F278328949EB3A3C3C12F7EE28A51C99B7A9BBA Truth-Travels-(feat.-Thi'sl)
914,145,500 *5F298737B5E23CB1773AB44E246B6E263A82ACB9 TryingtoGetOverLosingYou
914,145,501 *5F2F422B3954078594DFD7DA3F5CEAEE584C70DC tsgithcativ
914,145,502 *5F229570E4D9BCB519A55D570F98564CDCB05056 [email protected]
914,145,503 *5F27D8E5D1EF466C67E4B08FED36B6157494CD60 TUDYJ
914,145,504 *5F24A75C88666ECA3FD56D773E4E675A9B130C4B TUELFUM
914,145,505 *5F2E6490F678418ECB69A256B89B8405AE1D4DF2 TUFFY CARTER
914,145,506 *5F2CA581B39501ED091008D639FAB1AF29E63B4B TUNTIMA HUNTER
914,145,507 *5F27CAD49006EC7E0CC40F3CBB231F98C3D89227 TUOYSIAS
914,145,508 *5F2C7926732E004EA9E1AA39D8AAC66D57C65872 tychialstevens
914,145,509 *5F2BA0C9D7A6E406B7B8474179EE7AA61FB7917F TYREE-POPE-JR
914,145,510 *5F209A607486F46E395D5A269C91197EB3815E79 rtmfbsw6
914,145,511 *5F2333212770073483403CA3D3C61A010523423E RUDOLPHRYMAN
914,145,512 *5F2546AE3CDDFB43B40CFBDFE481E46FEA3046B2 RUEBEN.BAYETE
914,145,513 *5F2634EC6988057BDA76322AE47AFD95B8CCBCB6 [email protected]
914,145,514 *5F201C0B267B17128E7BB269E11EB931C6589B78 UNBORN
914,145,515 *5F21E9243D41C87099C3CFE3C8CC2082BA892164 UNCOMPLEMENTALS6
914,145,516 *5F2D8059708297AF552D9F882F91A03C99B4BAF9 SAGOMRED
914,145,517 *5F2E6D68CEA464CD5562FFDCC8831F6DE5038FA4 UNFRUTUOSITIES9
914,145,518 *5F258A9A9FEC99C0AE24FD96ECCCA8491965D8B8 SALVADOR.ARPIN
914,145,519 *5F2F0D54A909E78435AC7537750422E628FD72EF sammyreinkemeyer
914,145,520 *5F2ACBF15FFEF6165D4509EC6378315492C2AC87 URY4A3E
914,145,521 *5F2FC553C9EB8DA410735D5474C96F2F3722C72A usermomode
914,145,522 *5F22B57353E8339C70C601A5EF52396C035BA69D SANRELLECTSIL
914,145,523 *5F22B817D0CD935936312107E707C8ED4AD9B109 usiabul0
914,145,524 *5F27E8D894DBC169B2F965F8C04304F1F094FB1B SASSYCOLORADO
914,145,525 *5F2BD3D2E12E4F9638E682ECF2A08C995A192512 valentinedugdale
914,145,526 *5F29A622C17885F43A00B17C5F8F6D3A2E054975 VALERIE-MCMICHAEL
914,145,527 *5F264CBE54BFD9535225178E92611FC89BB59DCC VALERY LEONELLO
914,145,528 *5F2F0356EC78E480A3B092C678A6E6589FC29F6D vancehuges
914,145,529 *5F272CE67A1F89C8687F24170B9257D82D8F6D6A vanessa-brianna-garcia
914,145,530 *5F225B39E1B900AFD9C16786289906639775BAF7 SCOT.SALYER
914,145,531 *5F261ABA2DF607802A740D0D1E9929B8EE8BD5FD VANNITKOWSKI
914,145,532 *5F2444CA669D696077DA907448FCBD76DC232F0E SCUBA1
914,145,533 *5F21ABD42471C8893540AE0825B3D766802FD764 [email protected]
914,145,534 *5F28BC03298AABFB4F0FA95EFB44B52CD8FA4DB3 VAUGHN.SPRAIN
914,145,535 *5F2FA58E29C2330D61DCF4C5E5B64172BC2A30D2 S.D\ONOFRIO
914,145,536 *5F202A5F41F0673CEE0F61BD0D2224B68FCA9E2B sectech
914,145,537 *5F21D6FCE2BD871E7FC4029893D3CF0EF9033906 SELAH.COLLINS
914,145,538 *5F23025E5BADDB4ABC4452C5511C567352A1E9E8 SELFCLOSEDAFDS
914,145,539 *5F2272228A56D2F1C5ADBA209165003185A95D3A VERNON.LISKEY
914,145,540 *5F253D8C09B80C6E00EF3B1438A5F644C17B6343 VERSCHMIERE2
914,145,541 *5F22A9366D20BDF7C85DF7E94F496D1A2D5C07AF SERENITYSWEET
914,145,542 *5F214A88D08A88C6D7463F7ACF5B93866EA9AABF VIANNA.BORKERD
914,145,543 *5F24F7671FF652B4B1795215AEAEF5DF018E062D VICKIE BELOTE
914,145,544 *5F2C028FD1C2497C4F71094811F05DED060BCA52 vicki.shallenburger
914,145,545 *5F2A2084257618228A1C5C502666B5CD14CFC3AB victoriloveyou
914,145,546 *5F28A01646DCBDFD8E1B8C9F11E0E4B6AF733F30 Vier-ernste-Gesange---IV-Wenn-ich-mit-Menschen
914,145,547 *5F2BE5393C11FF0FDBA39DE1085C0FDF3CE40BB8 SHABONA
914,145,548 *5F2453F7FA97EA845652CD5CC7AFB593C69C030C VINCENZOOHTA
914,145,549 *5F2C75A9421C83B40486BC24D229B3D5CD9B2E63 vinniekenyan
914,145,550 *5F242563F9945F6546E6AB7C23CDA78F4CD826D7 VIRGINIECARTAGE
914,145,551 *5F2D4487311E0F1C6FC712D9F9DD1A083BA1759B VISOPHIA-WU
914,145,552 *5F24B65624B414BC8A7169F46E09229B14EE4BF8 VIVIAN.SANTOS
914,145,553 *5F2213F7E456EEBB12A1F782314ADDD38E24469C SHERMAN.STOFFELS
914,145,554 *5F29CC03D17E55BFD0A39B7F3734676FC24DBBBC SHIPRAVIRMANI
914,145,555 *5F2A7747C59074538D19ABAB4518080A349E5026 Voice-of-the-Other-Side-(Interlude)
914,145,556 *5F269D4A02E86C9273B245A61A18CBA26B0BBCB0 SHOEW.2.0
914,145,557 *5F29870E0CC0F97B8476848FC8A7367795E0A228 SIDNEYSIMPLE0
914,145,558 *5F2C0946EB0D72129B7BD5D64453A828A37A9FA2 VYBHNOUT3
914,145,559 *5F2932CCDC12243181B8AE7AB048F0A4AD2EEF37 vynerriddo.mcwayne
914,145,560 *5F2E44D3906B92E50A823660D00401E6F7BFE96D WALDSTEINS1
914,145,561 *5F2E662108579F66B443F8001D1EBE15C0CE1042 SKJELET6
914,145,562 *5F23973199D3D437E274286EF723019A73FC389D SKRLISTERNES8
914,145,563 *5F245F79E3201D23209A26161C47E391E7615E43 SLEEPING BEAUTY '91
914,145,564 *5F248CB2F46B0390DD94CE92A294275E2B5D95AB WAR D3BT
914,145,565 *5F2A51291FCEA7773BB0AF5DD0AEF2D67665C5BD WARNER.ACKEN
914,145,566 *5F2E817AB0AA6C6DA1FEE2857395C9E8BB170868 SMIDIGG
914,145,567 *5F2EBAAF861A6727747673CEEF78244FFF5E3921 watercoolernews
914,145,568 *5F2E0FAA58921192B03C2802132C519CB0ED7079 SNILLIHC
914,145,569 *5F24D938362698E626DA375A1BFB3739406C455E SNOOPDOGRASTA2
914,145,570 *5F217ADDA550212011C3771D6D4B68B4A2A19D37 waynetartar
914,145,571 *5F2652F2D2EFABDB90DC8B459971448A5AC5E3D4 SOCCERWHEELSING
914,145,572 *5F2EFE584C63AE4DFB5CA91CDFB311AAD92D2087 WEARETHESUTTONS
914,145,573 *5F26CDF9E7CFAA36F23F8CA005425ACC34798F09 websitewwwclassica
914,145,574 *5F2212CB5E73399DB00FD3CEFF7EAA050C8DBE00 SOLDAR7ES
914,145,575 *5F2A06A4B1A5DC5C03A5DEF4AD48561CF6002000 WEND SHELL
914,145,576 *5F2F8BDACD8E8452285666F60291F699F19F7611 WENDY-LOTON
914,145,577 *5F238F5CEE4D0178B7DE644323BFF4A2F29FA9A4 [email protected]
914,145,578 *5F2022DB7CFF37CB7BDCD743FFC2BBB654C494C9 WERNERBLINDT
914,145,579 *5F25FB790A856B48540A53AAFF011D69C66FC2CD WESLEY.EBERENZ
914,145,580 *5F260599AAD355CB15D7258005F3899162EFC6FF WESTON.BIRDEN
914,145,581 *5F2B19308BBC3A5BF5B58FF0900235E7D8EC4116 WHEN.SHE.PUTS.YOU.DOWN
914,145,582 *5F2D1FF3AABA12B55FE0C0DF0DB4E4B0539A8EFF SPEAKEMARIN
914,145,583 *5F20882D3170839309C3072B2C017960BA9A93CD WHODOYOUKNOWINHEAVEN(THATMADEYOUTHEANGELYOUARE)
914,145,584 *5F2FD42738D5706FB171FA6F8343A6818F99C84B WILLARDENSELL
914,145,585 *5F28E1B93FED68D28DEDCA76F73BA476E102FC28 WILLARDHOEVEL
914,145,586 *5F202602437B124468EDE8C25711A20FB019B833 WILLIAN.PEARY
914,145,587 *5F2FC15157F7438FD6AAAE901973E5146F1017BA SQUAWBERRIES?
914,145,588 *5F2DE98E2AC0ED7B75B80AC3B5DDC82A72281DEA WILSON.SHIRLEY
914,145,589 *5F24329DE75F2BCF469B400BE1B2BFA83387D509 WINDSTACK1
914,145,590 *5F2508263CCCC026A32B307CD144857946C26386 [email protected]
914,145,591 *5F200D3A0BD7DDBF8B6D2B52E2406473653B8E4A wingmanship
914,145,592 *5F20BACC8E395150195F1E529900D16B574AF808 wjfixq
914,145,593 *5F201AA7F7239C84F7B8B937D67A65159040A0D9 STAN.QUON
914,145,594 *5F2FC298191C3B67F5302405C9F635139CAA1275 workbagged
914,145,595 *5F220D0902DD7E4B147E2113096FB015E89F723D STBAARST6
914,145,596 *5F25660628FF27652174F87083030E2FAB5F1C0B [email protected]
914,145,597 *5F2FF0161A86914FA1D3CA2004E0670F51DDA5D1 STEPPES OF SYAMI
914,145,598 *5F2705F12638C2847DD3A1D70F7A8A837F1E2E20 WUZZLESWYRD
914,145,599 *5F20803AE0C242AD8E0C473E80F0DB25F267EEC2 STEVEKINGSLAND
914,145,600 *5F2972D40EDAD5259EBA79BD7F1773ED8DA265FD wwwfirebrandartisanbreadscom
914,145,601 *5F23156E6522D9F20F03220914AF3001CEC4503E wwwgladeairfreshenercom
914,145,602 *5F2F6D4981AD5E2ABC7F67F3048075C26C281787 STFANDELUST
914,145,603 *5F2A2704EADCC3FC1A13D814C720A32CC0477A87 STODD3T
914,145,604 *5F2DD2BFEC904536F73252905E9BAB2293EAC297 stringquartetno5inbflatmajor,sz102:iiadagiomolto
914,145,605 *5F22BBFB55DF0A49E9CC8931AE5D30C914EFCD84 xerodermia2
914,145,606 *5F22561CC007C53F1EDD4C652D6AE6469576A45A subs7!7u7!ons
914,145,607 *5F2C42A3015A6AA13D2F6132C918DB26EA88D22A suezatsar
914,145,608 *5F2ABE3FECA38A725FBB075B9A63AB1B51F47873 SUFFERTHECONSEQUENCESED
914,145,609 *5F227A53875C6FA4A89916912D2159C097851AE6 sugende3
914,145,610 *5F285931751859005C7B93C38F177DA6D1472347 X;L"
914,145,611 *5F273B5ADE7997882963ED1D21BDFF24804B5383 [email protected]
914,145,612 *5F26BEA4C1D4861AAB92D088A8A19829B698291B xuxuangai
914,145,613 *5F2DEB4178C52C1599DE61A2266ED37E5D50A2DC xwpsbsw5
914,145,614 *5F239E240B62F5AF438B65DEBF5BED267B1CCFD3 yah-batti
914,145,615 *5F2E00511784510C16C2420B828BAB0581D38A19 yahjmgarciabeltran
914,145,616 *5F295A47BEC6612191FDEB686A1A937D24EB7C74 yaraligonlum
914,145,617 *5F28E7A8524E6FBC07A7E21A684C73907E00FD7F YFDNJAH3
914,145,618 *5F2CD67D72F4501338DA4BE67700294E8CC6CFA8 [email protected]
914,145,619 *5F2FE26F77C9BFA89EDA8FA9420DD7C0B09E76E9 TAITEILIJARYHM7
914,145,620 *5F2F78C425B8B3DD3A8F81AAD9AE3A5E805C9A81
914,145,621 *5F204A321C10495C2470FB5A57A6F95998EF5ABC YOGEVBM4ALL
914,145,622 *5F2806A045A039C010BFF889C740C342BB0104C8 YOHOOQWHOJ
914,145,623 *5F2DA26C60312212F0EC9C14DCBAF2437211CDDA YONG.MEW.PENG.VICTORIA
914,145,624 *5F2365228D3802B83EA009031D28F3C31127C934 TALKVILLIVAKKAM
914,145,625 *5F2074398B744A4C361F3F521324FAE4ECF7D986 [email protected]
914,145,626 *5F2C9FC929E2AF6118EAC268105AADA9C72BC933 [email protected]
914,145,627 *5F2BAF92655A5758EDD105B13510B22B08D824B9 [email protected]
914,145,628 *5F233A2F663CC54B82B4068B1A513FAEF8092FEA YUMISHI
914,145,629 *5F28E52A275C0FC93D75FB3B6017B9CD9E4EA6E1 [email protected]
914,145,630 *5F229B9298E69DF6C25FB5BEBA4E67294D4A0D5D TAYLORCAMPELL
914,145,631 *5F24E3222EF1582E66DB823A65AD1172BC52400F TAYLORSIMPKINS
914,145,632 *5F2FA58DADF0D395EAE4B64128462E580465BDB5 TAYLOR.ZLOTNIK
914,145,633 *5F2919CC231A6C4E0B0B481806BEBB096EFBB870 [email protected]
914,145,634 *5F28D3167BD5E5EBD2906FEC00BD93B994972F87 YYSTUULI3
914,145,635 *5F232D10B8DB56A5588C52990C26104C97A06076 [email protected]
914,145,636 *5F2EF2139719C1C47C78E370150448D2093BC1BF z07h34
914,145,637 *5F2D1855AC51ADA563AA33BCEECC9B1E1D337C18 ZACHOVVANM2
914,145,638 *5F2720EA6FB520D00AD2C71EC4E038F9B4B35B21 ZACK.DANTONI
914,145,639 *5F25D767FE89B4F8E4BAFDAA508BCE1C890BE698 TEKITE
914,145,640 *5F2891940CC0803DDFE96E80034783B7E7ED0361 ZACKWEELER
914,145,641 *5F2CE8B679549E02DC9B415AFFC11ACCF1BD7370 ZAMAMNOJ4
914,145,642 *5F2E44775586B648646CC3FA7EF5FF5730597B85 te~r
914,145,643 *5F2DD1D019685477025EF612375082F0BC881EA3 TERGUAD
914,145,644 *5F280D49E7D3BD8FB8CE0F23D6138698C3F5C2FB zeidecxe9
914,145,645 *5F21283FA830D260E98A0BD6352FBF7F091DD28B ZENITHTECHNO7
914,145,646 *5F2061548A028861BB8A5708C78F28BDC7BA61DB zephyrstudent
914,145,647 *5F26C3B53CD375107105491CAE1A99141A458E19 [email protected]
914,145,648 *5F27E023D99C7DC153B6FD1805E30E1448AE4FEB [email protected]
914,145,649 *5F27ECF9A038369BBE770AEE03B141F3B05F95A5 [email protected]
914,145,650 *5F2B895B82D787717228A942244E0CB1674F5359 [email protected]
914,145,651 *5F2BC783BB12DA7C7B458CC4F32CAF446B1BE615 theforgotteni
914,145,652 *5F2389B8FBE581773929C0A04CFDA77486D35F54 ZOWZAGA
914,145,653 *5F26F49EB7C66BFCC6226D4C9E325AFD63DCB49B z,ra
914,145,654 *5F2EE0EA18EF945A5F60F7DD04F3E9CA793452DA TheSoulofKlezmer:FantasyandPassion(disc2)
914,145,655 *5F2550165DC3BBB1014DE65EEB76F46C4CAFF2CC the-wish-well
914,145,656 *5F25E145568C5C8212FBA55BE3C9EF047A3FD2C4 THGINKENAJ
914,145,657 *5F2A8F224F19AC11850E2B4D9CF4569D320F24E3 ΚΟΡΏΝΙΑ
914,145,658 *5F2E018C12BA8E2DDE7EA1AFF892D4624D7D73EC баньню
914,145,659 *5F2FF767860A3B5A5AFDF7975B4583AD6D8F9D67 големинов
914,145,660 *5F24397C931607251F76CDE3455FBED4395E56B7 [email protected]
914,145,661 *5F2FDDDB15EE632AAADEE1327D32BDFC83BD3DD6 tiredness2!
914,145,662 *5F256A6F1CF4D2F9DB5063558ED985B6991C5BFC МАРОМ»
914,145,663 *5F240ED06BB44DD5F84D0D027009151DB886C02F НОНИНТРУЗИОНИСТЫ
914,145,664 *5F212E92CF8BF4D32F3652413646C72A3C16C0B4 САНАТОРИЯМИ
914,145,665 *5F2636298FDC2407D369B0F05D183169C7E177F3 «СВИДЕТЕЛИ» —
914,145,666 *5F23CD5C7EBCAFBA7BE8C263BD5BE8D015F070F1 toccata-in-d-minor,-bwv-565-(albert-schweitzer)
914,145,667 *5F25F510BBF5B6720C880507A1AF473FF8EEA0E1 TODD-LEDDEN
914,145,668 *5F2442122606D1A0B465D70C06002E96286ABCA1 TOMASHARADER
914,145,669 *5F27E754313D6B77529AA729F6A4E174AA360AE4 ЧЕЧЕВСКЕ
914,145,670 *5F2CB0355CCC17E8194A94D5185B6551AA2DF6B0  ЛЮБАРСКОГО
914,145,671 *5F28110D3CFC31A6A39901A4EB7B0382DA7BC4C1 京哈高速公路g1
914,145,672 *5F25444B9D7E7F56E62854DA8A2D29380507A8B7 Tr4mpoln$t$
914,145,673 *5F216ABFAD620BB7DEF6A5697F73308A3AFFDE8F TRACY"
914,145,674 *5F260D69BADDC302E00F4A9DD1E5444D1F3787B8 TRANCEDL8
914,145,675 *5F2042D92B38102262026CC527859E2D8BEEF630 もあり性的に異常な人物だと思われていた。このころソングライターとしての才能も開花させR
914,145,676 *5F242E6131C938968552FFB70D2313339CF484EA 精靈樂章DJONLINE
914,145,677 *5F212B0F6B6A0629D30C779A6E2A7C4C9D97EFB9 TUBEPYPR
914,145,678 *5F21A56B6994A4CC2A05B15CC9968E4693B508DE twobigrlsbed1903
914,145,679 *5F26870E5F8E97A2C8085C8325BA3688894D3822 TYARAHILL
914,145,680 *5F24CE815F8E3F083A48E2744A8FEA27CAA17A37 tylersummerford
914,145,681 *5F29A1AE1B7B5F4BA374D797F3920E255C951666 UDTOLKER
914,145,682 *5F200FA6E7EF28A830A84A5611058A95A19FAA0E UKSHETREE
914,145,683 *5F2E0A639CBA3FE86E29BD02B08B6D5F7DF57CBC UMARALHAJIMOHAMMED
914,145,684 *5F2629139FE91235BA0D02FA2E5C958BC63A31CE unavala8l3
914,145,685 *5F2434B5DCCD41FEBE728DACA01A50206D577B9E 0bambi4
914,145,686 *5F2B332D33CAAD730F5A7F295D6E9F88BFFD06A4 1190525 WER FUEHLT SICH VON STOIBER BESONDERS ANGESPROCHEN ?
914,145,687 *5F27BB59FCAA2A3FF8F3314C9735098356629713 1233494 ZUDEM VERDIENEN SIE BESSER
914,145,688 *5F2D3546569215745CD8E4BFF8A247646C806D5A URIJAH520
914,145,689 *5F29A777DB8B9F535F31D86533C4EFCBDC15A02D 12DECEMBER1510
914,145,690 *5F2D39094B2508BB1F9213262AE8DBCA2C1038B0 1517816 jokaisestavaltuustonpit
914,145,691 *5F2B23E864F56FA1B3E688F0AF85EBC33A134E82 15yuzlercesi
914,145,692 *5F21C2FF787B49AAF20A4B4B2DB494486639DA40 1694603 oecd:n neuvosto hyv
914,145,693 *5F26A3E7123FC90A35D888F56BFEE705597C3A77 UZUBOYJED
914,145,694 *5F25B44BA0665EEC994840CD03E19C3823CC0519 [email protected]
914,145,695 *5F20354E6A30DC2752D58897C8A1AF0E2E44B267 19MARCH1272
914,145,696 *5F2929F7B3D079B87FDBAA9D0252295B9B007F04 1antiknocks
914,145,697 *5F21C6A5115D63296438453A1FCA7199AD3A4B9C VANCOVIL
914,145,698 *5F28E55CD83CC13A62388FC918BE7BF739F407A2 van-elslander
914,145,699 *5F269ACA9DBEADAC154AAF5FBBF790480C8B48E5 1.BACKSIDESA
914,145,700 *5F2C760D892BE032094EB07F7F631750E71134E0 1 bia
914,145,701 *5F2CB53CF53ACE2C9F852F1B9EB02234295EB652 VASQUEZ.GARCIA
914,145,702 *5F23F8277883D4F1F2FFAD2B6F18C0A16246C5E8 1DCXXVIII
914,145,703 *5F24E4A999277C945C4F6A4F4448568BE986257C 1.eliesen
914,145,704 *5F266A375DF844CD8990DED305784BBB62F6C1E7 1FOLLICLEENCASED
914,145,705 *5F25B247E00C848C9E9DEF141ECCECA8D870EDB6 vera.krall
914,145,706 *5F2F0D35DDC7F3E7BBF95B72B9CDE5F9E00E43D0 verdetblis
914,145,707 *5F23758177565E7F7B00070730F29941381F0707 1herbstaussichten
914,145,708 *5F243A6639480722516919D8728A5DDDA21190A1 1ILUVCRUISE9
914,145,709 *5F22215CE872C0519701CDBDAB538C6F096361D4 1juurik
914,145,710 *5F2EAE040F3868B6FD500C58C679D4F16EB2C6D1 1kartoffelverkauf
914,145,711 *5F2213B80B9CC7B3DE4F3358BA2BDA8778732608 1kieserbetriebe
914,145,712 *5F2F2BDD3F3E74D279720A4420E87817E1B58D56 1 KURMISTE
914,145,713 *5F240FE5236A53362FB3C5C1B037500FBF777466 1-KYLPYTUOTTEITA
914,145,714 *5F23BF21F0331DD5421B5281C134FB80D67A6BD7 1.LKM-VASTA-AINEITA
914,145,715 *5F278F83C8B78F870C56C4AA13C104B18F2ED0BA 1manciniklar
914,145,716 *5F23AD38300A4DB52F504500EE4595B19BC2E2FF VIENCE YU JAVIER
914,145,717 *5F26A13E7B2C5EBBFF4FDDD284A327BD2501D356 1MURTOLEVYN
914,145,718 *5F2022AB9BDFA9C00AC17FD442914064A7920DF0 VIJAYAN-BAIJU
914,145,719 *5F26D8AD3174D486E9C7F419A20600392417737F VINCEBENDANO
914,145,720 *5F2285089ABBF3B216E0B9D19743FC2B5AEB0152 VINCECANTAKIS
914,145,721 *5F21AAA8873E2BEBD44AEF32D271D0F7031985B7 1pdswahlhochburgen
914,145,722 *5F28FD69959FA5EDEFD7AD4ED38E6CBF2290183A VIPUL.GAUTAM
914,145,723 *5F257FFA10DCD62DC80A19C0F3436E9A716291BA VIRGILIOFARUG
914,145,724 *5F28510AB2A775BD6A1530DCC70C0A2A03F350F4 VIRGINIAIPOCK
914,145,725 *5F2546DAD5A67DE9C4D85E62A7D7C802B639B0B0 1 servewilliams
914,145,726 *5F2F8279FAC31546C834F3547A035AB8869C3F99 vithyasaagar.singh
914,145,727 *5F270A290BB1B077B9726613A143E13B1706B90C 1SPINNRAD
914,145,728 *5F23F3C90FC42B10DE2F97B703FBF5FB4B6FB848 VIVLUKTO
914,145,729 *5F20920A7592DF79725B9A1078B71C98AEDDF523 1YANKOVIK
914,145,730 *5F2FF347C855231B5542DDA082C171E8897295B7 1YHTEISKUNTOUTUKSELLA
914,145,731 *5F2ECDA04023218AF984D5A71CC287E14F5A4BA3 1zschokkesprecher
914,145,732 *5F29264D6CDDCF88455FABDE13012C6859224653 2004879 LIITEN:O2OIKEUSMINISTERI
914,145,733 *5F2E8FF7C25F612195DCC997F0583AB79D41B25D 2074083 gov celeste may find these goals hard to reconcile
914,145,734 *5F2868BC3C004F10E4523175F9748C3B23B7934E 2076212 KUUSENPOISTUMAOLIKASVUASUUREMPI,MIK
914,145,735 *5F2E1D2FBFDCF35CCBFAD22FD9DD106722656CB4 20DOOLING
914,145,736 *5F22E550D863B76263C8658D62AA275CC300ECA4 20zeichnen
914,145,737 *5F2B1038EF436102379AB621C08DF74FD85574F8 2308580 OBWOHL
914,145,738 *5F2AF8A6070563A97F2EA71E80099C0C299079FB WAAIBOMENHOUT4
914,145,739 *5F2D1A731FCC794EC86CB022DA7BC4CF6058D449 wachet.auf.(from.cantata.140)
914,145,740 *5F2EA67A26FD706C342489B5AFD0110F5A13D4BE 2449186 UUSI.MUOTOILU.S
914,145,741 *5F213C14EF656D465C5332306F74A59899E08987 waleedmohamedsaed
914,145,742 *5F2B41657598C53C2022F54E23676209242EA393 2753737 KOHDERYHM
914,145,743 *5F249F9AB28D11E85B3CF2EB2070CA46792F2C97 WALLANSTONER
914,145,744 *5F24104011B4979FFA60EAE30AB89208E5304C71 walterkreiss
914,145,745 *5F2F9B26DAFA28408C19820D16E8CF68F5337570 2862595 nun-wackeln-die-waende-.
914,145,746 *5F26FB9CF81532E128743691B973496A29D5D9CD 2-;AA
914,145,747 *5F213D565B1130DDEDF120D3748720659175EF03 WANJANETY
914,145,748 *5F299EBF72055F237C4238E1F29DF9C48C2F4502 2CENSURERS
914,145,749 *5F207395CA4EEE420E2AAD16F12D714ADEAC1186 warmundus
914,145,750 *5F25D90A0B61CC47302F51D6C2EB25B56E476AC5 warningtothepowerfulorators
914,145,751 *5F236CFA4C1AFE472D1CDF82AAF8292EE2CDAA94 webehighcomlichfiel
914,145,752 *5F24667A2F511E4BA2EF07232226B761F580481D 2NONDETERMINIST
914,145,753 *5F2CBEFCAF6F1F4AD974CAF1A6B9F407C5BEBA1D 2-PAPPADEAUX'S
914,145,754 *5F2DB03B579443A7B3665AAC45893CEDB0AECFCB wei-phin
914,145,755 *5F2216BA16166A70E52E90B096FA163F8BA903D4 2.SIIRAPPIPIPARIMURUJA
914,145,756 *5F2C0087B3252EA5480F895FE8F82C5EB98115F0 [email protected]
914,145,757 *5F2A224580BCABF1A11334377E50ECB9BD3090C0 2ultrawealthy
914,145,758 *5F23821FC7B4D610B8C2C686D948D8D9BF5AFE2E WESNORQUEST
914,145,759 *5F2EB8DF16F71E9939CF08242268B771373EE40B 32-BASARILARINDAN
914,145,760 *5F27FDB136DE9918F7CA1EC8E39BC17211DFD2BC WHERE.THE.HAWKWIND.KILLS
914,145,761 *5F29CEF58756FE6DDEE60A8BEFC679B685DC6651 3b~0 ~o o><
914,145,762 *5F207ECFCF76214ED544A40F4F70C5FD02D91375 3b<- o~0~ @-----p
914,145,763 *5F2985E8F752860926274734E10AE8EEE3955648 WILBUR.CORKER
914,145,764 *5F2C6B1A15928E186D6C016F4CBD4E37CF4BF42B 3 GE-SCHICHTE
914,145,765 *5F20C3A3973EA161E89405555E456AA99178ED8C 3-hakkapeliittojen
914,145,766 *5F246782D6591AD0C807F0793457DFFC3FE5FEDE WILKIBI01
914,145,767 *5F2221817DE85463683A0C102D54674E6F5DDF74 williamlunney
914,145,768 *5F2C9EA2E63F5E2CD374037900F1C645D9F9B841 WILL-TAKA
914,145,769 *5F21B19857ED2AD82C58075EBE4CAD945E040799 WILSONBOECKER
914,145,770 *5F2E66FCECA5C53BB997124E0341A4C83D4A5A57 wilsonzapf
914,145,771 *5F24D3DCEE223263F0BAE30A5F7F145894E34D08 winstonsantmier
914,145,772 *5F295EBFF2450B468092210D95520533749F7D76 416011 deger.verilir.ve.sonrasinda.bir.seyler.beklenilir..
914,145,773 *5F227D442812E19B73BA07FAF0F49BC56BB91FA6 416011 deGerverilirvesonrasIndabirSeylerbeklenilir
914,145,774 *5F25ADA42DCFACEF694A80755FB188AEEE24E009 WORKER-EMPLOYER
914,145,775 *5F2D7F530664FDAAE52EAB5A7B3A67E944C1C6F7 [email protected]
914,145,776 *5F2AE7F2DDB6E2481A599DA3D8FBE2ABDFE77EAA 4INVERZEK
914,145,777 *5F2D1B9DA7B1ECCD9621E26B18327BEB79E948F6 wwwamcnetworkingcom
914,145,778 *5F2A0D3B3D28800F8D7DF53EC3BCF80C3E893C74 4.legitiimisyyden
914,145,779 *5F246120928104899305D93E5189253DAF3EF2FB wwwsod-workcouk
914,145,780 *5F21ED4106B9A6CAA6254F758B7D3AAABE810D18 [email protected]
914,145,781 *5F20056163581469663BAA590D823A3C54B678AD XARAKTHRISMOS1
914,145,782 *5F2BC2140D5112C0301F62C1F26DF363FBAAE64E xavalon9
914,145,783 *5F29ED58B732C0F67953D7DFBB5ABD625CA938BC 4SSENTROHS
914,145,784 *5F283FE84B357F73D8D2DDED69E625BA7E21E2E7 4THEMITCH9
914,145,785 *5F24F253963DDD49E19C6F3593058056706CE16A [email protected]
914,145,786 *5F2EEB4EC8292B91DDB045586251CF8A0412FB86 xola.booi
914,145,787 *5F2511AFF2AEF59F52D2E5EE122963F494A76B77 x#ry
914,145,788 *5F2AB732C91A7BC638CDF5AC47FCB07B3E2DCF86 566735 yst
914,145,789 *5F213594D7950E82C9747DFBCD63AE3E5955A9AE [email protected]
914,145,790 *5F23CBF303080D0FEA890DB5D9325B3795B19DFE XYZA-MAE-GAYAS-AVILA
914,145,791 *5F227153BD2CFD64F2954D6FE2F9D732CDFBCCE2 YANCY3
914,145,792 *5F25A4209FF2D93B41C513E389481AA7CA86D7A7 5BSWTOASTMANBSW
914,145,793 *5F26CBA7FA81B02A519A155A76F744D75ECBE3D1 5craftsmenships
914,145,794 *5F2C44F07C08F0FB291141A60521E8BE6E754ABE 5flotations
914,145,795 *5F2897A7FD0C9A156C354C4F3E5328C69E3937B0 5IGRURIHC
914,145,796 *5F23778D8D91AEFB44E4D8A548E468B635A4361D YHWOYCO7
914,145,797 *5F2312829AFB39D1A8FA7131BF0C8E5BE322107E y*mt
914,145,798 *5F2983B53905435DF98BB090010ABD8E2CB8DE43 YORRO BAH
914,145,799 *5F218A13D6B3940D114B0F705D4A582FABEF8FE2 youcefghazali
914,145,800 *5F2F162A254C0D937EDA1ED32BAA1CC396EC2352 YOU'RE-MY-HEART'-YOU'RE-MY-SOUL
914,145,801 *5F2E6774C8482BCE35C49C446043EEC820EAF485 YOUR-SAVIOUR
914,145,802 *5F212E02A0D02CCA23A11E605CB990AB4282F39F 5SKATERBEAUTIFU
914,145,803 *5F29753B4AE669CF48B9E98AA54FFAAC377418E3 [email protected]
914,145,804 *5F29D3CAA32E83EF00C5555AAC0FDD18F6E8DADE YTSALPOT7
914,145,805 *5F285CB5773CA7789EE301188DF0528D929167E9 ytvv3r567
914,145,806 *5F244FBBA189610756FA66E480676FCF0E4BE860 yulitarusli
914,145,807 *5F2687766B6D1FF69751D2B3D36E430EC9C6FF39 yvnpxwps6zib
914,145,808 *5F26B1A6E94EFD644E72253F1DC881322DF43DC9 65ejar
914,145,809 *5F2C25CC95D745032C203BDEA6389D14EBB09F8C zabavljenim
914,145,810 *5F2B21F4C9930E4C41564B3BB09F97FE5546D79F 6AUSEINANDERGEBRACHTEM
914,145,811 *5F2ABCDBA2C9C3E296E095352378427F8C7F47E9 6BSWDELETECARDBUTTONBSW
914,145,812 *5F2C24EC264888FB6D899C85676BAC14DFCFA5FF ZAMBIAN.GOAT.HERDERS
914,145,813 *5F21BD61CA6F62477BD16814D8035669B0ED6588 ZDRT
914,145,814 *5F2EB29C3C4318744509CBADC657913C2CE1852A 6GILEMMIH
914,145,815 *5F271114FC4B9E42E754509E8AD244CC747DF9E9 6HARMONICMOTION
914,145,816 *5F2123B70B2E8045AC415C84FE6BF7E864BB50A5 ZERSTÖRERGRUPPE
914,145,817 *5F2BB601A49A7DBACAB7A6A560A29C93E7BB5588 [email protected]
914,145,818 *5F29119C1CB1EEA2F53913A5E1A16347CB9F8398 [email protected]
914,145,819 *5F21F4DE5626C5B0D4ECB5446D28B84515F1C2D3 6SAHAAMAHE
914,145,820 *5F257A0FB2E910030A02C309F90F70820A00D246 6SCARLETFUCKER
914,145,821 *5F2EC17707FC69E3E9C77DD44A4C087F2764E621 6SEILBARE
914,145,822 *5F216375259E9A23ECCFC9BDBFC53B680E6F692B ZM01
914,145,823 *5F24629475FB5CF25514D062934D43B9D283A33B ZUSTIMMUNGSTENDENZ
914,145,824 *5F28C8F8D1762E9C37C6FC3DE0171EB680CD7272 [email protected]
914,145,825 *5F23E427725C078D00417ADC0815F6D54A2830E5 μουσιούττασ
914,145,826 *5F22F70828B770669B35AD909B972FF427AA5195 7EVELEANER
914,145,827 *5F22E72547770F2F547AA54C90507CF6179C1E7C БРЮСОВ —
914,145,828 *5F21A0910F01CB03A1A6808B5E2F6F2E1F402FC3 ВЕНТСПІЛСКІ
914,145,829 *5F290C1C306F523F69501BDBD15C225F59EB41E4 7iamacura0
914,145,830 *5F234BCA5A8A93DB68C9A41AFA04893E9C37CF85 7MSVLODGTC
914,145,831 *5F2774697F8C84E04CECA1017F39D56913E7858A 7NERETLIS
914,145,832 *5F2713AFB20C38211F040383BAB0906F1632A379 7NROBREPU
914,145,833 *5F20305C8FE232008BCBF96209C6C39AEBB178C6 7PARAFFINERIONS
914,145,834 *5F2C7B70DA6CE8756676EAD5B6FF868A4BF4C9C0 нибудь»
914,145,835 *5F2911DE3FBF4E2D5BA8AA800121F003C4D6C49A 7SCHWARMEREIS
914,145,836 *5F28F6C5BBE43511690301F7388C29DD8000191F 7SESEOLFA
914,145,837 *5F22EFD11A47A4E4E866929F5009256AF3F9C20E 7STRTHCLYD
914,145,838 *5F29D5CB164C0B57F13430F2B7C26550DD19CB1C РОТГАРИАНА
914,145,839 *5F20DA2A29388AFE4CD735B276CE4881B6844CBA СОНГОГДСОНООС
914,145,840 *5F2E6A1C150EB6E6549B5A219B0A00A37EE7F851 УРУПУ
914,145,841 *5F2A0AA4ADD0F05914AA09F26C0ECAED4BFA107B ФЕРРЕТО
914,145,842 *5F24E93EDC0442B80D9D4A5E912D26088D211582 ХЕЙДЖЛ
914,145,843 *5F25100587A759D9BEE3FBE45E992E6C36CDEC5D ЫСТАНАРГА
914,145,844 *5F25323220B6058B906335F8698E2615458D2839 856armando
914,145,845 *5F2E91CB7E098944D17BE0216B559FCDA6424DBD якобинцам
914,145,846 *5F27902C19A86F44F6F425B84F07668F02EFEE85 բալթիական
914,145,847 *5F214BDECB39CD2A47D3C2150AF0DC0000C3108D 8BILBOTWEETY
914,145,848 *5F2CA8A55545D9BE771EC5C662B1E8E26247076C カッコ内の数字は他路線の番号。ic番号は
914,145,849 *5F2B2DFF40D174CE7D2262CA140EB79BC00543FE 8CARLIEN
914,145,850 *5F2B1A41EAF81682DA166227E80C755EBF90EE73 8DEMASQUERIONS
914,145,851 *5F2688BEFE8C59E7B95CD8A644E9BE4A2600A388 8liefhebberen
914,145,852 *5F27D5061320382B061C8BA14F11BF9AD9EF37D6 8MARCUSKATHLEEN
914,145,853 *5F2BF87400B38A93EA786F1E1662080400B93990 8=>-~O-~o-splat
914,145,854 *5F29B738A04DB4614D45FBF82B7FA320F3C1BA5C (00)*.(=====p
914,145,855 *5F2CDEB473E2825C96A476ABCD7302B177178E13 (00).*.*.q3
914,145,856 *5F2A70CA81C537217813998A86D616848C363FAF 914851 yuksekekranlama:80db'ninuzerinde.
914,145,857 *5F2B3C1D75B0BE9E3F826846E351C2D0E446A6B4 9DONNANTE
914,145,858 *5F210351C82951B50AA85F60E46AE3CBA77A46DC 10march1338
914,145,859 *5F2A1E4344178C8BD8A73B7CBCF05C455D256BCD 1163663 SOITTAJAT-OVAT-MM--EP
914,145,860 *5F26AB0FF51F0664375E8E02423793B885133870 11FQ9FL
914,145,861 *5F244019F99E618160216422F9B30C64180A86D5 9JOHNSONTANGO
914,145,862 *5F271E1995ED6D532E440180EFAF236A4EE09E9D 9MRCLSTS
914,145,863 *5F2281CC84AEA3D1A14E72CAC9B4F72B15E51C91 9NEGNIGNEREV
914,145,864 *5F2D02E2DD559F7DD8AC701E7D763BCAD8B74460 1408193 hyvityksen.m
914,145,865 *5F2723E160E6A8966E7FC70778DA5C42E1978516 9PATHOPSYCHOLO
914,145,866 *5F2FE59BEAB536524021E81E5735C08E6E3CE834 1506213 TAVOITTEENAON,ETT
914,145,867 *5F24F09E43F926B166DC2847C98DEE9C25EE3122 1565239 sales-rose-4.7%-to-$2.86-billion-from-$2.73-billion-.
914,145,868 *5F22459A634FB6794B124D44D9F4EF4AB2717601 9PYRAMIDENIGMA
914,145,869 *5F23A7AE7DE7C67879CD8FD92C089B322B4CC905 15THROW-INS
914,145,870 *5F28AE9F0B1459EB144FE285CF3B536D2DBAE35F 1647100 kesto-35-min-.-lecciones-nocturnas-tutkii-poliittisen-v
914,145,871 *5F228FF79562FD6CE719448A045F6468DB775ECD 1765593 popper " understood that sharks lived in the area
914,145,872 *5F28F1C6448606BA1876D8849ACF0B9D0D616354 1775600 MITDEMMP3-PLAYERDESOPFERSFLUECHTETENSIE.
914,145,873 *5F2879AE7612C2519430AAC37FFA8A940B9D31FD 9SOVERCHIERESTI
914,145,874 *5F29317D6962F2DEC5F2D653A744F71FD051511D 9SUCCESSROMAN
914,145,875 *5F2C21194AA1A6DF4F70E609D645D648C7E223FE 1a2b3crobert
914,145,876 *5F20538D1EE52D7B2A488F58AC5387FAD8728F3D a(09
914,145,877 *5F29581439973634B082116543A4CA643C80EED6 1.auttamishalussanne
914,145,878 *5F22F59F350EB94E807A0B86367E05BBF0F783D0 a0=p
914,145,879 *5F2D785E6DAB94D2C83EEEB033927F8B6E35E321 1-bronzino's
914,145,880 *5F203B9F7A60A34C14C63D89D2CB84441CCDE586 A1TREKKER01
914,145,881 *5F25663362DD945B7AE14A217C9227947B1CE70E [email protected]
914,145,882 *5F261874D4B3BE36B191038CDD1E9F6C17E82E75 a3obk
914,145,883 *5F2D52978351AA961B3CF357135A75BF6AC2E4CE a+4pp
914,145,884 *5F2B1D4E5E17E3AFDC984E9A95A7F2BBCEB9733E A6EM/
914,145,885 *5F2C8C2B1B4487598ACCD637E267627BFF2092E2 1ILLINI
914,145,886 *5F2260C929A30F1C6E35866C9E6092AA8DEDB500 A8D.J
914,145,887 *5F24D3A88D64901493BB072A88D06D061DB1BE38 1-joonaant
914,145,888 *5F206BEA2931D027A97B97FFA80205F6A809C500 1-joukkomittaisten
914,145,889 *5F2726064CC31166D94DEC0DEF84B1F571455A93 1KAMAKANI
914,145,890 *5F28A160EB59598EA4FBDEC4F90E4A8265842F0B [email protected]OMMX
914,145,891 *5F2F7EC71DF9663D76156DF431291F081FC40DCA 1.MAENNER:TABELLE
914,145,892 *5F2044E588679D386B367F3345666586ECDAA823 aaa|#w
914,145,893 *5F262A6EC600184E2FC90395AFC350EC58F56CCD 1.sinirlandirilirlar
914,145,894 *5F2377E449A742B9E4E245A89843125D8325005C AAE~LP
914,145,895 *5F2C254ACA4161AC498A31BA26400AA604731FB5 aaew~j
914,145,896 *5F24ED4FAFA1880353EEB4C009933D01C756808A 1.toimetamisi
914,145,897 *5F2C7870F83B57A7D63326B917CAD98C7DDBEC7E AALEI
914,145,898 *5F2639DB75458452F72730653F8F442C60EB25A7 AA)Q9
914,145,899 *5F27578936DD29F8AD27AA7A89BCE8E6C5D07689 AASV
914,145,900 *5F2B8BA5B1BE0CF44403ACB65074B97B50CBD8FC ABEL.HOR
914,145,901 *5F24501AE27C8D29824DC78E6D64708C5994FF4E abl&=
914,145,902 *5F27E604AB6205B378E3179C1C188FD2EC7479DC 2559818 t
914,145,903 *5F24DFB4B5D4DEEE8CD858A644FBD5BA5FF49F37 [email protected]
914,145,904 *5F268640DF741AA7363B54A15A313B425098AEEA ABV
914,145,905 *5F2E7B662D3825A8A74BA0A0F8B87D5AD100B9F1 a/c2x
914,145,906 *5F22B0F90C971151BF820D89D63E475560899477 [email protected]
914,145,907 *5F2DE89083EA75C9AF5CAC50499F931279577669 2877044 thousandsofpeopledied.
914,145,908 *5F2A50629BA722A676BCCAC74708C31F08481669 299verwendete
914,145,909 *5F2B7FB325FD51B98964ECEE981E933227C357A1 2 BATCHELOR
914,145,910 *5F28AFF4689FE843927F9D466FBE10938751D103 2DYOSHIC1:SPERRO5
914,145,911 *5F2C850F9AFB844850D0D40AAD9EF2455E359BE2 ACRT)
914,145,912 *5F248E5DF570ED270C592604513BD4826AB30C68 2 KANADALAISDIPLOMAATTI
914,145,913 *5F2AAE0A757E3AB33A176F4E82205F138D03C576 2-laitesuojasta
914,145,914 *5F22CD7D97F4AC76F26B0FE4D876A27E4F42F7A2 A&D#E
914,145,915 *5F2E6A359C946618257C3A92985105C1834C4E83 ADETOLA.LAWAL
914,145,916 *5F2C1A56F792134F439B87DC87D3D40C6F235141 2 pelkist
914,145,917 *5F2718FB0B8C14A8006EA3F16E3EF92F783D3AE9 2.ranieri
914,145,918 *5F28833D8C598F67D111AE9D529BE2C9465C0D28 2-scherben-songs
914,145,919 *5F26F29B247E5047739F6A1C02911D063A0AB897 2 SUPERGEWINN
914,145,920 *5F2081ECE3F5C7D4CDBE96D68BAC439A295FC115 adpu<
914,145,921 *5F2E4528514A0301D007C55C02E90F5C17E82409 AENEDNAD0
914,145,922 *5F29EA3DEF9D69F0CC4F15C46F73DEE41D3D0DDB A%E;P
914,145,923 *5F21CCCFC53104CA9C306EC5B9C7027F1A1E1DA8 A/ET$
914,145,924 *5F23887974626BBA557379F72813879C554D0CF1 3 GAUMENS
914,145,925 *5F23F804295FE1D4E9D2B9C4C9E2542FFBB7783B ag0mr
914,145,926 *5F22B1D27FCAD38D62509068BB5B33515450280D 3ILOVESUNNY10
914,145,927 *5F2598242C8FF5C56D6789F867A0CC3EEF1E0C33 3poncet
914,145,928 *5F2FA89DC5E05D17C381E8E82E838B8534155699 3SampiyonasIndan
914,145,929 *5F22A33D89551CFDF8410BC7BB2BB1D2CEBD6066 ahpq!
914,145,930 *5F26AAD6625D2C2A546645A00E14EEC34EF71AC7 435916 nun koenne er nur noch " hinterherhecheln "
914,145,931 *5F28BB00969805C38A14C49864C681126A4E46FA 442469 COKYENIDEGIL
914,145,932 *5F2EBF6DDF95FF85348CF25594CD1AC9DD3C0637 455446 KESKUSTAN KERROSTALOT N
914,145,933 *5F283E025D13430F28DC896FE088D81F551DA556 ai4f;
914,145,934 *5F2FE813DBF8649A9460FAFB579E8DB5851CF96B AI;FV
914,145,935 *5F280971E8FBCEDFFB6C781B11FAC1FD61BFCB72 AISSUP
914,145,936 *5F2429217189978432ACC296EF4EA92C12FF2094 ajd#1
914,145,937 *5F23216C238AD0CEC8D9FC3017D39049A9958FD3 AJUKANTA
914,145,938 *5F27D34C0F25D5B58D412234D08DE5E797F966B7 4KLIMSPOOR
914,145,939 *5F2E4A725A1AD411026BB085029F6367F37379CD akhannouch
914,145,940 *5F270E67BAEBD95867734B9CF26AEA61C9BF1F45 4.PREISEMPFEHLUNGEN
914,145,941 *5F254F61167799378C4E35BB63987D0B7DAA7833 4ROOTTENS
914,145,942 *5F26D9EB4F28CA0639EFE0ABC253E3E436BC9B05 alexanderkoerper
914,145,943 *5F2939910B530591F2903D4B18FA5AED1437DD91 4WORKINGFIT
914,145,944 *5F29CF19924B257A10B4A9140E6A5E624B0C7AF1 536859 newyorkmayoredwardkochsenthersomefanmail.
914,145,945 *5F2BC3304D59F71A3EAAFB50E18599367D6D6FDF ALIMOSNA2
914,145,946 *5F2267E1C70E222E02F00B20AE339872A9744080 5augustputschisten
914,145,947 *5F20D2CAD07BAA61073F8E71F8D4B7128DF7ECBD allenintveld
914,145,948 *5F2E97CEC24D7E78B0F4D52D0549950412607044 [email protected]NIMAEECSBERKELEYEDU
914,145,949 *5F2D5EFB1BBD4BB845AB423221348752437762DD 5DAFFADOWNDILLIES
914,145,950 *5F27C969FAC4FC8A5602DEF261B012AAF740AB84 ALVARO.WESTON
914,145,951 *5F23607FA158DA62A77A7EC67B1A42A575AFE45D A"LYD
914,145,952 *5F29FAA2C47C5C434766048E4641446288327E8F 5MARTHAJASPER
914,145,953 *5F2D5C5F1C31304A80E1A7571F0CB1E6258101E3 AMELDONKSED
914,145,954 *5F26DE3A1D024167DF60DE0331D3441AAF3DCB65 AMga
914,145,955 *5F2D4996585FA18F5BA3EB2A3989FF83BF9F6EDA 5XYBFIKRDNYG
914,145,956 *5F22F4083F42AE0EE07FE9114128664E1CAC4F73 [email protected]
914,145,957 *5F21C35AD09F4B32D33AB16424FC32562B151A2A ANDY.LASSA
914,145,958 *5F218067128CEF8EFBEC278F2E1F651D8D5BBFFB 6CORNIXSTONE
914,145,959 *5F2A8FC412D794B56E665D02F90B3CFD8058F39D 6FALSOPIANO
914,145,960 *5F2BB601A71C3DC3D4434AC14FAE5490D81F1CDD ANTHONY.STURZ
914,145,961 *5F27584EC4360B938B6C604EB1E37D46B8BE9310 ANTICUO0
914,145,962 *5F2A8540BD2B126EBFECB96D4348FC0A336BF403 6HOSED
914,145,963 *5F2F4F0298EB4FCFEDC6C1A92A9F556517D4BE38 ANTIONUM8
914,145,964 *5F2B9C7C9EC151EAFA8B53F1109197F2C3D2127F antoineramerez
914,145,965 *5F232260132A17976C60C52361CC1FBE03B4E1EE 6.KAHDENKYMMENENYHDEN
914,145,966 *5F2B233DF3818B1C5B64F778242B65963B56F54C ANTONMETGE
914,145,967 *5F2370A9C169A9EDB5C49345A095E6362081C17F AOg3
914,145,968 *5F26AE2B75B6BA39BACA987D3ED1AC832F9D7F0A 6SUBALTERNED
914,145,969 *5F2DCD8AF091ADE05EC5AE7AF7ED0BCD9A76EA9A apt3_
914,145,970 *5F2D5AF102C1C1951AC959743A41FFCB631DA292 A#.%Q
914,145,971 *5F26C28BE39659E9339262A3BEFD8F6F17B97472 726KAYLA
914,145,972 *5F28448F1D20C51252D8421C8E1DCB2658BB9222 766LEANDRO
914,145,973 *5F241250DA985928D2B4B2611FAB62D7C59A7FCF 7BSWMASILAMANI
914,145,974 *5F23B8767025DBB3DB24FB1DFF930D9678316F1A 7CALIDOSCOPE
914,145,975 *5F26B3AA9EF245C2957C6961AECAEAECC000E880 ARLENSTINEHELFER
914,145,976 *5F2F3FF0EC1B679D25E7C75C83B2D6DD0AD4E4F3 arliekuchem
914,145,977 *5F2F6A5F831D32EBED196854431BE88D808A608A 7FLIDGE
914,145,978 *5F2E23AD512C27E6EBB0C93821B018AB7A58A107 arnd
914,145,979 *5F257AC8213808E3BC636A6C9103DE36672DB31C 7KARAKTERIZIRANJIH
914,145,980 *5F26B4D9C16A6B428836368501B8B11039B48807 ARTHURLONGOBARDI
914,145,981 *5F2DA703CAC074FB0DA27B46A9DF87D17487BF34 artsisneros
914,145,982 *5F28927512BC94344BDCB054D08E8864420A43A4 7NMLSSLSS
914,145,983 *5F2BF247DF54A385E05E04544930F181EE7D60C5 [email protected]
914,145,984 *5F2DB3BB961049CFD9BEB59814DE72A4624327D9 7PERISSES
914,145,985 *5F2C9277749E1A02AF8BF9B38146BC9B052B9ED4 ASIÀTLCN
914,145,986 *5F243580D6E79F9A644B1CA8DC9848BC6FD6B830 7RETALFED
914,145,987 *5F2A61682A942F00921B591024A7C4E0A316DC30 ASSOCIERIEZ123
914,145,988 *5F2175F4AFD0F707A0D27BD6D95BD9E84E65435B 7TSUUTIZ
914,145,989 *5F2DE2540A390C3D7B77C1D39927E411AFE28BA1 ATDV"
914,145,990 *5F24B91056CE44D14690BD4340BA870F783F9D6E atlbg
914,145,991 *5F2DEE904858D0F265F2B3952B805A40509B656A 887sariah
914,145,992 *5F25D21B3E807BDAC86C4F844A2F0EE42859FBFF AU:H
914,145,993 *5F254E70C0375036A6532557990EBD16D249FB52 8BSWDAAVVEYBSW
914,145,994 *5F2E5967AEC30D8D3148B4FB1908658EC78D727F A.UP;
914,145,995 *5F2B9A74FBA4243ECF3B69300CA0DDD5ED14BCD6 8CHAUSSEEHAUS
914,145,996 *5F251C40D304BEFEE46425ED00FC4C1662B3CDA9 A/&V
914,145,997 *5F293497E031D00ED40C997F215D47829D33D075 avp-b
914,145,998 *5F2CC4ADC42D73248A3A3F8F00E3B7BC772EB3EE awckx
914,145,999 *5F255E366EFE3B79AEB1997E9899CDD6CEC6985E 8>~O.~O.(_0)
914,146,000 *5F221F7D3E49C392714F55F685270A2ED2584DAE a.&z
914,146,001 *5F269E74101BFBA892AB82FE71457ACFE93B3931 8STARTALK
914,146,002 *5F2677922E355F95DAA29AF7801B238425411C63 8STUDIOUSA
914,146,003 *5F2D9BFFD09C87D6EB90555C7C6AA5BF04626113 8THEJENNY10
914,146,004 *5F2DFC3578863ED10FFBA95428469FE19908AEB9 8USELJENICIMA
914,146,005 *5F2E81A1AF302B3C58E28A18C47EC248834215DA 916898 NO:1REYENTISH
914,146,006 *5F2BC741FAC94C5EF5F20BB21E80EDDC7A581249 [email protected]
914,146,007 *5F2AFA160CE7C2F901D33731E9FE3E93690775F0 b3l&z
914,146,008 *5F2431D9A3547AB0192D9AD910D3803BCE80FD90 9CF52N
914,146,009 *5F252DB76E129BAD6D86FCC4BA1B6DF7F3B9FF00 b5et
914,146,010 *5F2C9B8E0A5CE270E02F99C814ED9109637275D9 B#9J#
914,146,011 *5F252C17396D33CDA632C538AF5ADBCC4E9A381A 9MPLTCNSS
914,146,012 *5F2090D14A66B604FB0A69ED40014AFB71DA8A4C 9OLACIREGUI
914,146,013 *5F2113B70C75FEE5944684AA79D6A845EE62A440 9OLIVIAELLIOT
914,146,014 *5F23AEDCC490596DF56ACF3E8E948A05190AAF43 badzf
914,146,015 *5F23B4F7E00F3A5A3530EC19812944E2CC988C9A 9SKULPTURS
914,146,016 *5F235D66E8FAB295ED7FE95FB04241C8D72C9A05 9TEWETMIU
914,146,017 *5F2F3A5E1F70B1A87D3E0340030CF813FF7B0532 9WIENSBSW
914,146,018 *5F2E74A39FF8F545D65E1B9C288BE93B7F79E3C0 bartonmoranville
914,146,019 *5F2A6996044E3C450F7E7CD9D8266856BCC61026 BARTPATRUM
914,146,020 *5F25B98B66F5D9B7F8CAD8C766790D83EB4ADC9D a1s1w
914,146,021 *5F2C63F31D10EC1AEBC6DF389817FBC59589FC28 A2=H)
914,146,022 *5F2CF4EDCA4A96EE2C873C53429E046E1174E5AD BCN6F
914,146,023 *5F2CFC1233DC0D2ACCB84FDD3DA27C626F5CE336 A7Pn
914,146,024 *5F2586D1A5CB254683622F3CB58F9D60A75C5144 bedegleis/mariamagyar
914,146,025 *5F2663B2FCE6BFDF1E456DC3FFED5DF89AB53E4A bellerife5
914,146,026 *5F2125848F88FA51B1A6FE795EDE20852416C5D9 b$eo5
914,146,027 *5F2B0717F79884D8A0B30AA734AB06DCEB8F3EF8 bersten2
914,146,028 *5F215B1130B55C7715010DC5A1389C571C53420A BIMTBSWING
914,146,029 *5F2B5B1CF3907CDEB80169E551038A44DE7F274D ACJ(B
914,146,030 *5F2E351F22C750E16AF6BB93AF3E64D01981C8C3 ADAN.MESECHER
914,146,031 *5F2D8D8A17550369797D18932C443B5A29375C39 BKM0A
914,146,032 *5F2B0B02CAE74F6C4529937BFB87B13C6242A36C b)l9
914,146,033 *5F22057682EE568927D3CF329DB572F221C7F480 BLASPHEMOUS GIRL (DISC 2)
914,146,034 *5F2768587C6AB14A0CB174FBAC7F8A2C5DF00465 BLAUI
914,146,035 *5F2ABF5381D61FAE8B2A3D8C5327272566CD1366 B-M&
914,146,036 *5F24D2F3376ADDEE6C540768D0E41DF77C8DC96B BMJ",
914,146,037 *5F23CAA988E813B957148DDAF4053587F2D87D1D [email protected]
914,146,038 *5F280909F9062F0E913C238D7E93058BB5745492 a,fdj
914,146,039 *5F28ED6DC6777F8CB9DDA8414F932DE103E55920 bn43s
914,146,040 *5F21E635AD79CD3436F929CAF281A491F68ED3C2 b_nf+
914,146,041 *5F25D0F04978DB381155A91A749BAC548B8208EA B=NH#
914,146,042 *5F20673BEE0378771406CDBC452ADF4B765FC4E0 BO5L:
914,146,043 *5F2DFCE7CA452CBC21E8EF5B80D710E4469294BB ahmedfolden
914,146,044 *5F2518C0DD3EF9A59EACE424C8AF3420CDEFE246 bookerfladger
914,146,045 *5F2B03DA50C413BD1A105C9AB188BD9DD93E4E46 ahs82
914,146,046 *5F2ECAB5228F804675580C2ED63CFE2E5914F819 a!j8t
914,146,047 *5F2868DCF94D9AB7D9269313ABC5E8A8CDA5DF4B AJATNEMLS
914,146,048 *5F2382F3CD201F558B5E6259C9990813FE8E56EA BP-SM
914,146,049 *5F25FF89B103AC60EBB8CB51663B5CC6366AC533 bradfordtsistinas
914,146,050 *5F28E554B2AC97FEA4D466D31F36ABEF9BA5A259 ALBANYAIRPLANE
914,146,051 *5F224E6D5637CDE97C550047A4A85EDF2E827E7C [email protected]
914,146,052 *5F26E6E8940A033AD6682C605CB81DEE80B3BA8F BRALDEN0
914,146,053 *5F2809348A01AF38667163CBD4D01B9BDF1BA064 (bratcherlu
914,146,054 *5F222C19889C52B6D50E357F1D559594909D0C93 Alf
914,146,055 *5F234D2EECA293977761676DF0FAD6ED18081480 ALLANACEVES
914,146,056 *5F2F5131991C08D3DAFAC1DD8F1E33C45B4599E3 B;RK?
914,146,057 *5F265F17A96E02795B87D4B878EB0102702E742A BRQO!
914,146,058 *5F2B2BE87D29CE0FD199ECDEB40AFB86869D95C6 BS,%
914,146,059 *5F28F4788B7384A9C4DE987891E8A533E3A05B9E AMBULATORYBLOODPRESSUREMONITOR
914,146,060 *5F2E62B51D4513DC8AA8697D8712867097456E99 A_MKM
914,146,061 *5F239F49472E65388E813763A8170951D95B3096 among the crows
914,146,062 *5F268DA3CB01EB08B892AF27335099A95FF88798 a!mxl
914,146,063 *5F28E536C18BCA1FA9A584D3635779E9803CDC71 ANDREA.MARCHAND
914,146,064 *5F2D58A28CBB9C20C0FCE81CE5606451A1A24E58 andresbumba
914,146,065 *5F2ECCA8A48AD5EBF9F867A9BA58708A7B9A12B6 ANDRESHORODYSKI
914,146,066 *5F2B43AF7C23F71847350F5B07F1ACFDCD047498 ANDYHOLLINGER
914,146,067 *5F2C5D360253822B76F9FB4C6B7FB2386AC378D6 [email protected]
914,146,068 *5F2E4FBBC79B113A1D995D7E322DE304586A07DE an+!kn0cks
914,146,069 *5F25B2430CF6B75B36DD72B8095A49B32EDB2AE6 ANNISKELUALUEEN
914,146,070 *5F2FBE3C99F748BD918D4FC4F20AE7A3274B808B bw.us
914,146,071 *5F2959ABD31865BEDEBD4D8F8CE2B11BE3E7D222 anthonyhipsher
914,146,072 *5F21C63255FB5CEF55085305C1404D02744FD9C5 ANTIQUARIATSGESCHÄFT
914,146,073 *5F2CF84D54C2AA599B30C78B74A3F304DFB86B1B BYEL5
914,146,074 *5F27184B246E46920228273A30BB40F6C474671A antonykoellmann
914,146,075 *5F2F88D31CD69BBA5A4C955F9AB6D939640F8236 [email protected]
914,146,076 *5F2E025302105D4EC276303175FB7C3070030EB2 AOLLJ
914,146,077 *5F29B55E6DEB9F12372233AE47A04A3290B82117 [email protected]
914,146,078 *5F282718573FFB027CDEB504748CDE2754F6902B [email protected]om
914,146,079 *5F2114588C309074C94176170AE64E52F1F535CA c"30q
914,146,080 *5F2A189ABBBCE00EDDA1E10B600BD7F021A563A6 C3Ul
914,146,081 *5F2D96B0C6475FC0FF4DB025D6926F03DF3965D2 C8MKA
914,146,082 *5F2D8B65D6D0C757BAC9446B0C77C803F9311F1A CAMERON.ODETTE
914,146,083 *5F20D33A42885525A4B9F6D9B1CEE5CCDC45C8E7 a.:s
914,146,084 *5F2442A2A4F4DF6630C202A82BC349EB00605AD9 as-fd
914,146,085 *5F2C3CEDAD79498FA8E56497267B14039EC594B0 assagger3
914,146,086 *5F2CF7E13F10548B73C62777912CFDE320505CC5 A--STEP--IS--AN--ORDERED--PAIR--OF--PROTECTION--REGIONS
914,146,087 *5F2722B8CCB305301C8B89F72B25B8FD1C4CCE43 AUG&L
914,146,088 *5F2B84F6A1ECBEDBCBDFA91D83CC0D8A83C42798 cbasskn
914,146,089 *5F206D8F8D97E5F63624BF08C83E5E05E073E2CA cbrb0
914,146,090 *5F2AAD049BF57AC1B36C56A70EEFDA4FFF47987E CC6OU
914,146,091 *5F2F163E113331FBA529C799F26A13E6507EBDD2 C:\DOCUMENTS.AND.SETTINGS\FIREXWARE\LOCAL.SETTINGS\TEMPORARY.INTERNET.FILES\CONTENT.IE5\NQ56ARSP\ADISSUES[1].JS
914,146,092 *5F22C1409F811F72205C41F68DE4AA05B740CDEA AWIA5
914,146,093 *5F2B5C3168F957AF350CE33EBF2FB82EDF4403F1 CESARDUSHANE
914,146,094 *5F26560BC6BF447B0E9BE5EB01B10F37CE5F73DE cesarmeow0
914,146,095 *5F288258E9712EABDB40212AA1804DEEBAB8CB9C AZZANNATE7
914,146,096 *5F2ED406A0D1D5F188F41ACA48427F475FE9ED2F cfhmv
914,146,097 *5F2B06BD2D859C7FF63332836597B794D5C8D2E7 CGMJC
914,146,098 *5F2BAC266A388D45E0D0B02DD6F7586FB2C02F9A CHANCEMICTHELL
914,146,099 *5F2062D8F90CCA846824381CCC3038FE60201596 b5{l
914,146,100 *5F21E3A4AA2442F3B503C6EDD9838ED2224830EF B;7R
914,146,101 *5F213149AB0FCD3CDBB9A98373EE64D9B08993FE BACO_
914,146,102 *5F2C3299AA65046C83112D0C30FFE748317C79AD chettiffee
914,146,103 *5F2FADD15111285EEE2654789ABBC44EA80E7A76 CHISSEY-LES-MACON
914,146,104 *5F2BF571E7B2CD39E76F7CD223931FE06974A7EB CHOKEE2U
914,146,105 *5F28B0B36ECFBF2B862BA12EDE61D5C1A3E4DB3F CH/PI
914,146,106 *5F2CAD1441D804F44B479AB98915736789291F58 BARTMOSTYN
914,146,107 *5F2FB413976CFEE5947A534F9C7466686E8B2DB4 chrysocera
914,146,108 *5F2835C78DCA16402ED11BE8D7675751DBBC5C7C BBEAUTICIANS
914,146,109 *5F2206EC74A93CF0C2CA3DE5F94AA31AF6F6D09E ci$bf
914,146,110 *5F27C7FD05738DF0CA3F6BA24702F09865FFB973 [email protected]
914,146,111 *5F26D343EFDAAA974142C1276C1819633730BDD6 BCXA&
914,146,112 *5F2A63B10B8238B3C8266C2B9299A18FFB282873 C;J0
914,146,113 *5F273B91A96C49B00A04B59FB308B7F1CD5B15C4 BDSAASDBBING
914,146,114 *5F293276397EB3058A0D4812BD6605D28AD1FB52 bd(vb
914,146,115 *5F2C34B9C8B5377CCEBB5009F32063DC0E38E116 cl21=
914,146,116 *5F27049BFA1CFC41E83F4A9B3869EB40F942474F begnugsted
914,146,117 *5F2DE78BDB6FF79974983343C27EA7B0D28CD038 beh%9
914,146,118 *5F2E81E35316F491CBCBBE5706B7C586AD441FA3 CLEMENTDEFRANCE
914,146,119 *5F24A9E3DB840BF311E2DB81E553608CBA9FBB78 bernardoledden
914,146,120 *5F290A130DCC2641A94E94D15543A9AA597ECAC5 clocloruy0
914,146,121 *5F289789A23BA67471FF18778B21F6709BD3979F BERTRAM.SAPERSTEIN
914,146,122 *5F20AEB5160B39C32A4ADC487895FF6FEC4EF9C1 clv-t
914,146,123 *5F2AD4B807C8103EB2774F74ED3D9DADCBB74E25 bevancilar
914,146,124 *5F2C24F13750377D3C68B8663177D58A21942F26 CMLH
914,146,125 *5F250B0E082F436DC166B51077DDC30AEDE83D2E CNFSQRNTS
914,146,126 *5F24A8477E9B0BFB7F4DFCF868CE354D2F8E058A BGC?
914,146,127 *5F2274EB8FA99FB32089EC6367CFA9713EFE69B6 BH6(
914,146,128 *5F21C7236567FC8901682F96976EBB7905D8F76C [email protected]
914,146,129 *5F2663002F0F8BE5D8DC0BC56FE1A299D228B353 concertogrossoinbminor,op6no12:iiilarghetto,epiano
914,146,130 *5F2E9AAF96BB44D09A29B59195BB9A02D2C410ED BkMe
914,146,131 *5F2E2F359E5FC80D5D064729FD03882F77B32CBF CORSMEYER
914,146,132 *5F212C9372B3E34081F398E23149FD324BE5482C CORTEZSEIDERS
914,146,133 *5F24B8BC879B65065DF6544609AC4120C7E928B5 coryfingar
914,146,134 *5F25ADD34048B4A709E873A06BFE78F6D5D8895D BLITCHS2
914,146,135 *5F246BD99323F19C918B109FD21D6772EA9C7055 cqntm
914,146,136 *5F242DE7FB66C61845532F513088BD7134D99EE9 boe2!
914,146,137 *5F2D3D2681A0801DC489B2C6EBA6FEDEB8C0EAA4 CRISTOBAL.HELSING
914,146,138 *5F2788DE2AC5ADB2D7A2B368C5E6156C55FE21FA BONUSTRACK7
914,146,139 *5F2151EE92ED299FFCBB021EF3889087DA3D83A4 crr7s
914,146,140 *5F2A60B03C6AB28BB83D4A996FE2B38EAB6DD91A B##P(X)
914,146,141 *5F245F8ACB2937970DA3E1243C191B7212233EF4 CTSO8
914,146,142 *5F2F09AD9D439E67FCCB89E6D5BF639B9BA90A9E [email protected]+ION
914,146,143 *5F20CBE7FB8C98044771CCC950DC473C87D083D1 CUL_3
914,146,144 *5F2E48E65A98735916126D32965DA4B0B6293812 CURTIS.GRISSAM
914,146,145 *5F20D8437F8F200D9E297638F2002FB5A092109E [email protected]
914,146,146 *5F2F0434A976395404AB77A5E73375663BD9DA95 cvaox
914,146,147 *5F203DE5432E3841DCFCA329C9E21B511CFF343D cvppq
914,146,148 *5F2051252AF01EF8BABD2EE9B975101A6B6357FF CWE2%
914,146,149 *5F2D80783F02092265CFE03BCA9F1824C335A8B8 cz-8.
914,146,150 *5F24BB6131D0027446A29B13AF26FD94BF659C47 D0Ao
914,146,151 *5F2242DE2F7D7E1D58BF8B3C3E5C633825E86F70 d=2hd
914,146,152 *5F2C953B6870C55822088818F4001B65BA38EED7 BTT;I
914,146,153 *5F2C4D96A1F3735EE0737B2218822938BF11FAB2 BUDDYWISTE
914,146,154 *5F27384A43A7102E2EF7ADE64D06EBF67420DAE9 D4715
914,146,155 *5F2325ED269EE5095DE63735F9CD45F9C75C55A3 bybfu
914,146,156 *5F2D99928652294CB6C148C2AA60ED27EB8D6444 [email protected]
914,146,157 *5F29301287064101A66E88F070488FC547F6A21C DAN.BRYE
914,146,158 *5F2C2172A2FEE91E9CB763230F110642BB8219C7 bzjo/
914,146,159 *5F2CDBF57E761FC208686FA5FE9D1A085B3A591C C":%
914,146,160 *5F2012AAB79919D757232B82029888C1E75C4471 DANISH.ASHRAF
914,146,161 *5F205C63677E0888C361CB21CA9D6F65C59111BC C0VO
914,146,162 *5F2A35F1D725BFD1B8EB3B8191F895B733F6F6DD darintofil
914,146,163 *5F24BFDC910C78C5517104D8B1FE68398349125D c2wfs
914,146,164 *5F213CAD03F873D7E78C8F8C40530931DF780F42 DARONDIMPSON
914,146,165 *5F2FCEA86D353EB81354320555AA632402A8FFE5 C3L3BR4R3IS
914,146,166 *5F293AE6E2CE878E8CB5A2F6BADB168CE57CB1C3 DARRELLONGACRE
914,146,167 *5F28BCA5942DF3BF745551ED98AC78A61BC2F510 C3XK;
914,146,168 *5F237941D6D50141C9F3D1053D8B6044451D3F64 c/50_
914,146,169 *5F21923153C5A898A0F1D5A2221C1642E0BDBDA9 C6h
914,146,170 *5F232873ED14C772AA44D1CA6769C638168D5BBC C976V
914,146,171 *5F2FCA3387F9E57265BB9E83D1C7BF78EC712919 DB!+T
914,146,172 *5F2C721AFAC7FF24FAE44B4A723AB296DDC30FC5 CAITLIN423
914,146,173 *5F2D31F34AC090A81306757845CE2FA66A010597 DDCSBSW1
914,146,174 *5F2915C613E66E622FFCEF13762CFF7680043055 ddhqk
914,146,175 *5F203382AC163D1361F1DF6FF0345520AF7D979C deangelojowers
914,146,176 *5F2F09503BBD71E40A3A840CBB7D8AED7FFACD91 carlparrigan
914,146,177 *5F2EE84E06DC9BB8177B7B737203923193153466 [email protected]
914,146,178 *5F2113B782D7FCB3F0F6BDC69B8647D6A0C72A5C CARROLLERLWEIN
914,146,179 *5F25BE10C068E123622DA7815260D402A398B9E6 CARTER.CASEBIER
914,146,180 *5F2CB3F5177E30A1237B77CD64C8AF7E00FC2E88 dek=h
914,146,181 *5F20B48BA58B088073E9248836D9CB7F8FAAB805 DELMERMISCHEL
914,146,182 *5F208D9BEC67045996DBB1D74FB86D99A31C6492 DENISE GAL
914,146,183 *5F2A9B33B7D3E4EA3887AFFD1559D8DE3A70F011 DENNIS.QUEZADA
914,146,184 *5F2F7A1DBEE6E34AEC717FA949D6170A1F9331CD d:-er
914,146,185 *5F2A1697B196D54CEAF18CB254139F0AC2107D4C Cdd9
914,146,186 *5F242BF948BB89D59D953CFC03A91D518C00EFE4 cedrickkillelea
914,146,187 *5F2BF219B7617BEB2313833722043D4FF2A16202 CEDRICKSALEADO
914,146,188 *5F208543689808A088648BC154CAD1FD1FAF87BC DEWAYNEAMAN
914,146,189 *5F2F317D94C5558335C768FF40392E1C975AE9FB dewaynestromer
914,146,190 *5F25EFE58CAE481B69690B0A526C4819B8805C34 D:F8I
914,146,191 *5F2CA835497540E205655EE85B66D32C760A7396 DFICACHE
914,146,192 *5F24406B6763529915BEA836C18B32159D605CFD ceuaq
914,146,193 *5F24B14326DF4602251D460D742EF67DC40C2A28 CF0TP
914,146,194 *5F23DCC0AE4E29EB8D73F1C3F61F4DFAE9072DCB di5acknowled9emen+5
914,146,195 *5F2224A143DFCAFFB2BADD404280379E868303C0 chapter 1504: what had happened in surrey
914,146,196 *5F29629BFA4189801BB650BE7707E6D78C15BBCA DIHEYNE
914,146,197 *5F24D30AE81B6BD2297BB28290CE455C2201DBFD CHAUNCEY.FICO
914,146,198 *5F2D7BCF37B519E90682B7ABF53138C779B38B2E cherissting
914,146,199 *5F2345655B71C39B73327E9A410C1F771062C991 dipyrined
914,146,200 *5F29B46A0EA42D2B6732C1490BC348C04ACC6C31 CHOCALH
914,146,201 *5F2B3616EE8F6BB062CBB637F3C1F88837FE834A CHRISTIAN-HOLCOMB
914,146,202 *5F2F26EF9E36535B9334682DF234F8B807CB3D80 dk&m.
914,146,203 *5F2BCB6DE722C684B1E74956A6DD25D157CFAA7B dk=n+
914,146,204 *5F22CE2F534795C0FD9F888C15EE7756B5AE62E1 DLDN#
914,146,205 *5F27988AB78DAC37B4F8D26A69078B8BB8141202 CJGB1
914,146,206 *5F2659BE9B846B72064B5D94EED55FBB58FA088A dng75
914,146,207 *5F2D71A3B4C8AD5F37AF7978052D3C9035C90968 ckh_k
914,146,208 *5F2ED256617909328D9AF26A4E1C43C80150BD18 DNV,U
914,146,209 *5F276C27D3097A4B3C46890F407BEB42A412220F CLAIR.ASAMOAH
914,146,210 *5F268871F9ED0F45FB2FDBF363AC6B45AD9C1FE6 clarkbongle
914,146,211 *5F270D3BF631B9D37454DE6E3A377CE6AF046646 CLARKTRULSON
914,146,212 *5F238C41E87D9F2B519D5287EF4F631414FACE7C dolorette
914,146,213 *5F27235BB24D94671D9237028C04FDCB06201B15 dominica007
914,146,214 *5F2483445195EC08CA3D1F2C06DBA87DC9194412 DOMINIQUE.CHRISTMAS
914,146,215 *5F2A32F55397A7D477E836F284D4F68AEFA3F007 DOMINU
914,146,216 *5F270462F7B71A97CA40250D2613698A797F7D1D DONHOBSON
914,146,217 *5F2E525EE50F1ADC4637C1D3B81A74060411892F DONHOSKYNS
914,146,218 *5F23F50864D038939FC9D53209000C402ADFA976 DONXU
914,146,219 *5F2CB481F3A3D3839AEB48FA908736BC9DBBCE4D d,oq9
914,146,220 *5F2FF0AF8356E52198B3E0BFC48C674075A61C86 cliffmau
914,146,221 *5F26A07B7580931A8911BAB492AF621158E157DA (><)~` dp
914,146,222 *5F2806873CB8DAC4DD9072C71ABDC70A57DE0A23 DPIR$
914,146,223 *5F28C90B20CF244B68FA30C309929737AC636B47 cnem1
914,146,224 *5F2F414A887933CDC8A1DF787B05F267E157A2B6 CNSRJ
914,146,225 *5F2F9946E506D0E4C265789CD60E9E1399AA3D91 colbydorward
914,146,226 *5F246949CFFA16FA9CD3AE56DAE69C1D902D1904 COLLIN.HARDEN
914,146,227 *5F21A364F71649D483A4773F9F2B65F87A267992 COME.BACK.LOVE
914,146,228 *5F23C6D8BAC008E6599304A535B88D4A525A5B0D Ds4ff3ct0n
914,146,229 *5F23AEB4C73ECE369702B6877DCA675EE045F130 dsertait9
914,146,230 *5F2C1D894FB9989FA5A1B3B1B8528FA1C89B2273 compostition no 3
914,146,231 *5F220F839236075A7F29636FA857F63C5E897E07 concertoforharpsichordinfminor,s1056:iallegro
914,146,232 *5F233B17A22177792331967BA8FEAE0684DAFEA2 concertono2,fino23(summer):adagio
914,146,233 *5F2B716A8377B0809482DFADA0DAFCDE6ECB1458 conspissate
914,146,234 *5F2FCEE190BE80153993E775D22BB5387C2312AF du.har.ingenting
914,146,235 *5F2190FD7D2687C7DE2A889F71563A93C08DFB6A DUKEKENT1
914,146,236 *5F285EEF8D428B9CCDF6D0036EB882554FCB8646 Du.nicht!.(NOE)
914,146,237 *5F27B4B65A704953914D1BA172E4317DEC5E5B42 [email protected]$
914,146,238 *5F2E4A8D45ED0110D4EA8E0D6E5C6F5FE7C0717C DUSTYBROMAGEN
914,146,239 *5F2396DB5AAF8235A2E6652E3E8D6AE916C32B3E DUSTY.EDDINS
914,146,240 *5F2D1FC88F2F37DBDB42B1D67F83C756243061E0 CP0/
914,146,241 *5F2C463CCB71D46C0FDA07BCFD2D862FED4EA218 DWAYNEWORELL
914,146,242 *5F2F00FBC67B544AE6405382A5679C49F5EC1E64 c:\program-files\microsoft-visual-studio-90\smartdevices\skins\pocketpc_2003\pocketpc_2003_vga_square\1033\pocketpc_2003_vga_square_skinxml
914,146,243 *5F2F2F86A805CC70C9932E8F187480592DE8BB34 c:\program-files\pidgin\pixmaps\pidgin\emblems\16\founderpng
914,146,244 *5F2AF2167249A7A5671565C96D5A44B4CCD00528 c$"q6
914,146,245 *5F28520F3B2BEDD1573194CBDA53E7F98A65C9BE dy,,=
914,146,246 *5F2746B28015DD2E6894CAF2DD5F62A70457221F DYIu
914,146,247 *5F23B84F4978F64C24CCD697CEEACE7CB1E51CF9 craigwright
914,146,248 *5F2A1A5E632BB2206C6B269DD260C2071E91E9D4 e36+
914,146,249 *5F2127313D1A2ED2CA5BAD4154B24225552BC376 C-RK
914,146,250 *5F2C29DA98C50B369630AF2F5CB1219FC9F0FD85 [email protected]
914,146,251 *5F200A02E060AAC72D8AE406299B246A010716D2 EDRACONIC
914,146,252 *5F2B36536D2DF9E6366EDFE1C6105BBD0EA564D2 edsel.bernardo
914,146,253 *5F20794A506000C6C285B37392CBFBE4338DC530 c+uqg
914,146,254 *5F2BEB40C23ED44B65D1A25FCA609F1C24CFAED6 curtissiemon
914,146,255 *5F28479390E8B6FB7D92518112EFE01F8EA60CB1 edwinlaning
914,146,256 *5F2E4876E296D8E4C7CA3E9A4E9CF72216F85CB2 EDWINMOSEY
914,146,257 *5F2984C63851E81839E431052718FA871DB70C21 [email protected]
914,146,258 *5F27F1B154373F42D0AC95BB4090154EF70F92C1 cvs8?
914,146,259 *5F2C343C73D18261FDFE2F91447474B25AA89904 cwb&
914,146,260 *5F2D9D3F7622CA9A6647756DE27CA07790ABD430 eggg6
914,146,261 *5F26E47BEAD554942B2177ED1B54BFA5E1595957 EGlI
914,146,262 *5F2BD3A7CFC74B1F11C8BB2D409602B9074804F7 E^IJ
914,146,263 *5F2F687B8E184D80DC0A074E621B4F699F5BDF42 cyrushintermeister
914,146,264 *5F2581333DA461BB302A260687D75E90288DCFF4 ekmub
914,146,265 *5F2A4302436E6DDC33AC6DBF1F3BD086915F7C63 d$0#(
914,146,266 *5F2E1F1C420E498B072FDD0CF0B35B8B47653ABB ELDON.NEBEL
914,146,267 *5F297C102CFE999411BBF62906A5B0E02DD272DD ELE)
914,146,268 *5F22F057DF2058D99D7055E89B7428BC2976BEBC ELIZABETHBEX
914,146,269 *5F2B65778C3474367021E246EF881BBC9CF89D6C d3"wd
914,146,270 *5F2A35678DBEA6B28075D8965049568EC6B95DCC d5m9l
914,146,271 *5F2D1F31DDCCCBE84CE8115499DCF32EDA5EFCB0 D6H_4
914,146,272 *5F27C7BE53428C92B78E2B40732EC428E2A33EEC em&#_
914,146,273 *5F28DB8B3EF4968D9D2C99481CA4215BF9A63F92 d9;f
914,146,274 *5F25BB626E13572B9689800909EA3F93631C550E Dae-Out-2-Get-Us-(feat.-Theron)
914,146,275 *5F2BE7C92570B06590A4E00F9348B4D6DF0535E7 EMORY.TESS
914,146,276 *5F23DCEF5D33902F4158982FE87BAB9EE6755698 dallasbabel
914,146,277 *5F2E3BD3E8F470C09990A72C3148BB182098E639 DAMIANREDUS
914,146,278 *5F2880D95E14FE4292487D2AE8F0E1477B7EF964 EN212361110
914,146,279 *5F257488DAECBF429D96DE324BE2804C6C73E988 energyroying
914,146,280 *5F27C24B79777C1D046B808C363B83ECE0323C11 danfink
914,146,281 *5F2A8852F385267772F07419065AAD0EBC31083B DARIUS.WEERTS
914,146,282 *5F234AADCAE901A559814526FBFAF5B40A33ACAA DARMOŠLAPŮ
914,146,283 *5F275F4DAF7879A009CB706131F53D704628131C DARNELL.MICHALES
914,146,284 *5F2AFB5F676859DE76A89242F9A22A6474E24E9B darrickcsensich
914,146,285 *5F2F82CB64D8659A1052C507A5DD1BF54ED46953 DARRYLHOWSE
914,146,286 *5F2F94DCE723D33235BE222B0C2AD5A1DE996A43 ep17he7s
914,146,287 *5F2514AC981C5EF06410282F32D7FEA815180EDB d"asx
914,146,288 *5F211A4016E9496A6A8819E1DDB50463D450524F DAUSTER 13 0
914,146,289 *5F20BDC0D4A473025103BE0C3245B809A46B9C37 daztecsed
914,146,290 *5F2A037E7D13CB2C29E7E9CF23C6AFC175F3B463 ERGI
914,146,291 *5F2B8DE6676B23196674B3B015088E7B9BA76E77 Dd5a
914,146,292 *5F26DBF95C709189EDFC023545D4F90C908AF494 ESPARTACO1
914,146,293 *5F243ADC529FAE74838131371E22A5C086C20397 deanlangfitt
914,146,294 *5F2D245F10A82638C62E00247FAB048C3FA60C4D deecrumley
914,146,295 *5F25E756C8E3828F14275C2A08BCF1F9ACB1DCD3 DEEDLES BLUES
914,146,296 *5F271670BC4FF276D13C69A05730E8481455BE97 EUSEBIOSPARKS
914,146,297 *5F2148C051AD5B495E3A9BD3728853182AB39059 EVECUS
914,146,298 *5F206E5F62FE32B6F94537D74561CDED349B5C2E EWYZD93
914,146,299 *5F2582BDE6D5BC38326A5117088E0A0D79C44BE4 [email protected]
914,146,300 *5F21181C915D20D634E1401CE32B12BE374A5538 [email protected]
914,146,301 *5F2E04A73FBFF54B50C7078E4237AADF66940F86 eyct+
914,146,302 *5F2FDBEA5D1EABBFD3442B5EE4274630AB53AA95 EZEKIEL.COGLIANO
914,146,303 *5F25F88BA4154488EAB0EAE02A7D8D72568AE53D ezekielsilbert
914,146,304 *5F20C02C5AC6E4B5147DF5FAC13472EE083DFD0D DEREKWEEDEN
914,146,305 *5F26A7E54DC2FC0C9A62362BC21230567C2DB5B1 [email protected]
914,146,306 *5F282D4C3B7E0F57DACD3FD58C074776392B7720 DESEMBRASIONS
914,146,307 *5F29214AC1D122F5D166F31C5B792923921A74E9 DESHAWNHARPOLE
914,146,308 *5F24A6AE84C6CDA81A59649EC2B855B9E53701D6 [email protected]
914,146,309 *5F28D4BA0780218FE9A65CE73360CBDCAC81E5A3 DESMONDARMITAGE
914,146,310 *5F209DC2C771C1666C342046416B5A960BCD5C9B [email protected]
914,146,311 *5F2B2C712257401A014B2BB708F851DAB753B30E DESTRUIDO1
914,146,312 *5F265D68E7F66D892A611D10F0477C4E4917D384 [email protected]
914,146,313 *5F2E7DAD44836B5002BD75AB337863E7A417BF6B fedwards
914,146,314 *5F26319B613B82E7797F2767C8CAAA65C401DF21 [email protected]
914,146,315 *5F22BA07CEDC9F38DC6D31AAE058844C778C1AC6 DHUAHAUHAH
914,146,316 *5F20E2A85073F4A4BC0C3C161D5E1C0963730267 FITCHTURE2
914,146,317 *5F288AB1506B63DF7225836075CA0AB05A03AD91 DI56I
914,146,318 *5F28792BDC8A9D8CF136B6A6D762C740893C37F2 FLUSSWASSERSPIEGEL
914,146,319 *5F222A54669D13145CF6B252988548B805DB2B86 dilatative1
914,146,320 *5F2F2EC445F16D8098311B7BBAB981C287005880 diniso
914,146,321 *5F2B907342DEA93BE80E77C3E3A0184194C085BC dissoluta1
914,146,322 *5F24D2CF95ED0FC2C528B4F832C1F446668D1E8A DJ-MATSA
914,146,323 *5F2561D6688DA041BEF293A1F8C375E31205AB25 FRANK VILLE
914,146,324 *5F23A1E4803F3F5024DD7FDFDA5EEEEF40481E60 DK=AM
914,146,325 *5F2B0CD10EA64ECC3E4A4808B02A572E59DC8884 FRED.TIAN
914,146,326 *5F22C5118A3A9E464141C9C949675E9370BD7415 FREEMAN.BENEZRA
914,146,327 *5F2E044099423E61BE9D286300FBA4D9BED4D6B3 DL5"E
914,146,328 *5F2794871BA60A1323E646A22FA3DDAEC64D1EBA dm9t
914,146,329 *5F28C1D6E96203D110C1BA63A44293154757D55C D?NVS
914,146,330 *5F2EAC5C1FEF1898228DFF56AA19AD4314F10B9E GALERAKOWSKI
914,146,331 *5F2D49EFBB2EE2C258E25F3245392F531F7ED22D DO%DE
914,146,332 *5F2950FF8A9299C9789A668E8A47D37D18CEC18C DOMENICAFAN
914,146,333 *5F2862E9AFFADC87E8B2B6438732ABD163D5F1BD [email protected]
914,146,334 *5F2F0F2750AC6308985EF4B1C386993430E85359 GARRETT.CHEATUM
914,146,335 *5F2E474C9E1C7232AC606CED02CDF7ADB2004C4A gator81
914,146,336 *5F24ABAAC2C7592053E30E02F7CEDC9860707105 donmcneel
914,146,337 *5F24ECA9205E29943E0EA8CBB986181104CF767C GEEFRANCIS:
914,146,338 *5F2D495AE36294EB89C42776871552B3AB77E5F4 GEFOPTES1
914,146,339 *5F2CF60D92AC228463F5ECAE38F7D24F6BE1E109 dot2
914,146,340 *5F2D3E01F93EB2ECB9676495F2F52E0D7979279F geoffreywimbish
914,146,341 *5F2FBE653AA58E552E0850972A446BF6A5AA518F georgetangeman
914,146,342 *5F2E413642448A0B82976974E49FB793C0493AE1 GERALDCALLEN
914,146,343 *5F2F87A1C63FA88400996FD578010758A79EE92E geschminktens
914,146,344 *5F29D805259A5C44F552EFB49FBDC74053328710 DPI6I
914,146,345 *5F241CAE91FED4B003D8CDC0A93BF49B8691FA0D gimme-more-(junkie-xl-remix)
914,146,346 *5F2B2134554804DB88CF991407404FE9AB6B4606 DQSR_
914,146,347 *5F2F6C684A138B5DF33A47758FBBD337DE1B320F DQXF%
914,146,348 *5F2712470E761FA21D5AF5891D84497C36F2F0C2 g~&j
914,146,349 *5F2A37ACDECEED3DFCBE75B8460DA5BE5772E4C1 d/sh,
914,146,350 *5F2F294A245A7E18FE5ECDB0FFF6AF8B1F07C50E DSV8
914,146,351 *5F2A5502AC72ACC58D41A261E5D1AFCEBC115DDB GRAFFITILARI
914,146,352 *5F26A1B80512FD08727D22695798A80B6E7E1B23 granitbeqiri
914,146,353 *5F2650B06BC3BA46C07834A74109C1AE0D04B2CD grovermardesich
914,146,354 *5F2A7394D013FF1D9F7704FB51978152E23E0104 [email protected]
914,146,355 *5F24F156219976B2BA8A327717EE3FC33B202C9C GRUNDENTWURFS
914,146,356 *5F2C9DBAB8F187CE8605CA0CCF27830DF2ADFF2D GTESENG8
914,146,357 *5F2B46C74DB1B24D55E398E838C90C8161FDF11E D-;V
914,146,358 *5F2FE9DBE07764004D7AFD2BE67D66E6DF1A9C75 GUERILLA
914,146,359 *5F25B51E485DB798A594DE0E6BA4771EA387F81F gun?
914,146,360 *5F281EDC517E6EA3D82B803E7973BB18BFCA9CD5 DWISP
914,146,361 *5F21BDAB0AF1080FA7D5E66F6E788823CC185D58 haikeuting
914,146,362 *5F2F2B0CA7AE7E997BFAEC1F83D0E019A8C9D064 dzrsqzfing
914,146,363 *5F2015F8D027750A895E70AD14C0B9E6B0A2164A HARVEY.BATERS
914,146,364 *5F25C0F0154CBA08EADDC361D7695F1B5D8DAB77 HASSINOL0
914,146,365 *5F2B5C99F9CDE87F713671E501F41657ED032E4F [email protected]
914,146,366 *5F298638310027CA8B4986802F281DD57D82C4DB hctahretfa
914,146,367 *5F2C43257AD486A9A59692FADA3852EAB56992DE EDMOND.CAUDILL
914,146,368 *5F22D19B496CC2B0EB6E23131308282AC27414C9 EDSUENK5
914,146,369 *5F2FF7074AC4D18190D83BC8DC96B073AAD6DD2B EDWARDO.STILLE
914,146,370 *5F272551E1D9769551086902EB194A8BEADBD6E7 HERIJHAV
914,146,371 *5F2585D81EF95595B4B66A125DB5D009B0AC467F ef?ty
914,146,372 *5F2A4B907EB0C3F978F4AAB3FE5ADCC8E7FC645F HIQSBFXP0
914,146,373 *5F283A707BD84FFEEA039B7F9D9A276E9AD839E1 hirammasingale
914,146,374 *5F2D876AC8D59F74A1961179764484D744D65CC1 hljuszso5
914,146,375 *5F28762CA76064DD384BAD931E6F4711D28FC77B hmtmncy9
914,146,376 *5F22E743CFBDBF3C89F66D95A35499029704B293 EKR318
914,146,377 *5F2E639B6EDD17B348191270565D8C7AF837DD78 [email protected]$
914,146,378 *5F24DE336EBA1E5C9111B16280FC99CAA96F6EFC ELGNICRUS7
914,146,379 *5F209F58EF475223AEB4F25BD4EC1917A498C078 ELI.DRYER
914,146,380 *5F2F30B89D848E27953A7E4269050619CEFB3B13 elijahcarmolli
914,146,381 *5F271D1E389AA54B46FEEC4E0E935992A0000E12 HSATEC
914,146,382 *5F219C44B334D1DF48572A521A218D44F66607D8 elmermaiava
914,146,383 *5F2FC23139927118CAAA3F48B3C9EE85B1CB9E16 elmobohonik
914,146,384 *5F20596762C09E8D90D16624D03F1BB0C563E02D HTTPWWWHSLUCH
914,146,385 *5F234CA03D89C60664F633E9D3D2F14119771D17 elmuluk
914,146,386 *5F23C1C6705349CECB246A9847B4249F9FAE2F09 ELvf
914,146,387 *5F2C818CE7E6BE6268D194EF8B2FF2EF2CBCBA25 HYPERD1ASTOLE
914,146,388 *5F2C52B2AA98C17509DB1274B4886F6AF7C2B579 Hywell.Davies
914,146,389 *5F2D443483B1CE336D95D6A35B31E72553DDEA28 I2H
914,146,390 *5F2E89C23FB9FFE9C7B696847523B6EBC59809E2 enriquefaykosh
914,146,391 *5F2DB8B1FA9963A54D8368DACE8D3078FC07EC44 ENRT.
914,146,392 *5F2A188104249F4472AA1CC92C1F776B37F1DCE4 Envoleras
914,146,393 *5F25DB1C69FBE2E0CC90F9673761457CA8248F3C ILLEEULA5
914,146,394 *5F2F9AAE99154027751BB78BD299B9790F25A4FB ERGI
914,146,395 *5F2E3BCCB4F6BCA298752137FBC601939E957AF4 erikstruyk
914,146,396 *5F207F9566F8C62F120F06E2A97EB7968AB61F77 erisscapped
914,146,397 *5F272FBE946D606C4E8AD6B68D50043F9BF32A8F ernestosutherburg
914,146,398 *5F2A1B4CEE97E4E7711D78122AEB821B0EF83ACF IMHYRILED
914,146,399 *5F25B366A1D2D98B3B397F9A23F3096ABA151944 ESh4
914,146,400 *5F282A745C7A8C3A43F4A6536C4AFF3866860A0F etk4;
914,146,401 *5F2302A90B57D3ED8CC04A8E3561073F61272488 inidas
914,146,402 *5F2CD863556C7003E73D18EDED93F5A976FB6B51 EUGENIO.CURTO
914,146,403 *5F27FE019063B82A09B05C9E90552088E0B602CC eugeniosecora
914,146,404 *5F287A3D1EACD91C4726F3C249ABB3098786BAE4 EUHANOD0
914,146,405 *5F28E2791B585E1F6028B62AEBCB74E4459381EE INTERPLI3
914,146,406 *5F21C78D8B613899026460B8BA922C1A8698EB16 EUROPEANDEBATE3(STING)
914,146,407 *5F22FF30AFCE5E136F0587C64D6DD4044F25869D INTRO./.DARE.YOU.ENTER?
914,146,408 *5F2BE37B06C09FFE5706E34218A6C17A6847A41C INTRO:GENOCIDE
914,146,409 *5F27EE9DDA8D5D0CB1327368A12142D87CFF6BDF EXT1N9U1SHES
914,146,410 *5F29211795271D9E5C3EE6D97335D9372EC02AEC [email protected]
914,146,411 *5F25D50A0C15A711A16B708AD277700E87070456 isoelectronico
914,146,412 *5F212389C9319EB2E655054F53229DCAD738440B falconer
914,146,413 *5F21B7EFECFABA0EDD8005CB8472370B08A2DD94 IVAN.BELLISARIO
914,146,414 *5F2AFB7AD5A8FB925CFBC4C1B0D24AE523C17F0C IWon'tLoveAnyoneWhoDoesn'tLoveMe
914,146,415 *5F2F61D05849A94A8DA4C7432804FF8CE6DB285C JAKARTAFLOOD
914,146,416 *5F240DE991E6864DC0340C093C619F322529A208 jamalharnish
914,146,417 *5F2CCE0DCEC54F72B19A85F4E21BCD425A1D8C57 JAMES.ROSENHAGEN
914,146,418 *5F2DDFA7BCC5E74C7BD51CEDCFD2A89B3AB441B4 JAMIERDINAMO1234
914,146,419 *5F278F1BBEC8AC2BA79D44464BB57BCFCE6213C9 JANETWHO?
914,146,420 *5F2FA276DFFCD3ED1BE9849110CDE10553555BD9 [email protected]
914,146,421 *5F2B03DB1ED89140FCB054A52362E9B966D26F2C FIVEGAIT3
914,146,422 *5F24DE2ADF829116916DEF454BA7FBEE0CF68E04 JCPAKER
914,146,423 *5F2C0A430BD75425D3FC215AF57380155A011251 FLOYDMITHCELL
914,146,424 *5F2EA30152BF293F4D068B460276F227ED9DAD2D Folge 171: Neue Ziele
914,146,425 *5F2BDDD429E3EC27BC61C5937382500D502FC682 FONTSPECIFIC
914,146,426 *5F253E31EF4497E7AFAAFE71A1AA95AF20D3EB74 JERAMY.DEFILIPPI
914,146,427 *5F2058EBCD342369DD6A0FAFD7D46059FE9F1ACC FORESTWITTHUHN
914,146,428 *5F2F5867FF95EB1E56FF89851FEA9AC3D8B7F9E0 JEROMY.WIMBERLEY
914,146,429 *5F2D13D217962EDB550C70FE7CFD2C1E0D8F5C38 fotodocumentaire
914,146,430 *5F265E34B9BD284A49A58DFDCE4D663FEBEF53A1 FRANCO-8
914,146,431 *5F2BB716F21CAD929E441B5445F1DDA3BAD481E2 FRANKEBELING
914,146,432 *5F2159F93C2D8A2BC3D845DB473F4F338504E17B FRANKLIN.HARVICK
914,146,433 *5F2B6D96476B4D5D343388A2EE30FC62C274FE1F FRANKROSTBROOKESHIELDS
914,146,434 *5F2E11FD8C553B29DC32BC09C7D03230231394B2 [email protected]
914,146,435 *5F2F812694E541A22D25D83FE1A94B2F20B74E24 [email protected]
914,146,436 *5F23A131F145A6A3A48147A3E0F9330A10173A83 jjxt
914,146,437 *5F2752AD4309D944222ACD0B707504F17E546458 JOEL-KRESS
914,146,438 *5F2D3BCDC976F0281302EB5D63A8AB527841A956 funkeltet0
914,146,439 *5F21C74FEA77C8FCE4CB8B77FA7FE69869517F7B johnnymcmanigal
914,146,440 *5F2D525059508F174988D9FC23D01DD292AE4AE9 johnnytimmermans
914,146,441 *5F26FE69320E9662E4E004D9BE796CD1FFEADEA3 JOHNPISCO
914,146,442 *5F2A36FB0CE3F42A37F1EF7F81221B4A741B2163 JORGELUBEN
914,146,443 *5F253E022E98890E49F08C789773087A813B6D51 GAMBIRYA’
914,146,444 *5F2F0BEED32E72D533223A8D595CAE0CBA293A39 JOSEPHBOUSUM
914,146,445 *5F2D38C99EAD4BB3D51FC6EF57E1748670CD16CB joshevert
914,146,446 *5F28033AAD1078970F1A763327A64E4763B36953 GASTONTAGUE
914,146,447 *5F2A1D82875B14C3F83578B60B9468EE71151287 JSTERN1234
914,146,448 *5F29DF4A9FADB372B91D186E1DDC377EE80732F3 gaylern5
914,146,449 *5F28CA4255BB99C0A1FA128B43F42625D86E1421 JULIE1NELSON
914,146,450 *5F232613E7DCE78E6EE472905DBF724FAD43579A JVIDEIRA
914,146,451 *5F2D92E2F3695A58C3D4F95E762A1B40DD170475 [email protected]
914,146,452 *5F2EA6F2048C70862272C46B17A7246E84B6D7EC george-cross-medal-theft-on-auction-in-dix-noonam-webb-london
914,146,453 *5F220194916FE03C6FF3C02B25C88FF5A53DFFA0 gierleonthultzondagborstbeeldvanzangerlouisneefs
914,146,454 *5F2FF5365E198D2E415287F9AB7A9FD284981B62 giforjon0
914,146,455 *5F276351927F77A03E3950736CF58F0303D83F34 KARENRADIO
914,146,456 *5F2AE301CC683C877317659829153E0224A20BD6 GIOVANNIBRUNSTING
914,146,457 *5F2C951217A5D2EA4016E434DAAE3E5695945ADC kdjkc33qy1hwfu
914,146,458 *5F2D8CACA325D3752F11F6E726AC097872F159F7 KELLYPAWELL
914,146,459 *5F2E45A0BA10169FE7982E0C0AE62ADDAE354491 gnineodling
914,146,460 *5F21F3F79ABB4A90626A7D7F91CE58F29751AE55 KENETH.HOCKEMA
914,146,461 *5F27A24BB9C5ACBDBD56ED8060D8D53F7BB14922 GOBODOECHINA
914,146,462 *5F290317A36E23469F69009F4E9622EAEF54A983 [email protected]
914,146,463 *5F20A48123B800F605509C97FDB3B499C5C74750 KENNTLICHMACHUNG
914,146,464 *5F297B4BB2C77BEE33EADD0166BE7BBDF8A03AD1 gonzalobelville
914,146,465 *5F28E8505B5662FBDAC55618E58DFA0D2D159206 GOOGBRIEFERNETGOOG
914,146,466 *5F2B19D6F6F5475114609BD7BB7744CCCE11D94E GOOSH
914,146,467 *5F2B0385E7C3D5FD42E3EDD297941AF4016AC972 KIJ888
914,146,468 *5F280B0A35C16F05E88D499BDC2F528502A19FC2 GRANT.BOGIE
914,146,469 *5F25DB3BD714AEFD0F1CE64906A9FFDA2428E056 gregkeen
914,146,470 *5F27D6FC4576EA0582C72DA234B1E82A0A3324CB km-4
914,146,471 *5F2FFF0122264F6DAEB04756C242C50FD72FBAF6 GUERILLA
914,146,472 *5F21F62C42F2BD63171946A8E1921767BF2A81FD KOPPIGAARDS
914,146,473 *5F2D36966BC21F3E5CBDF9A462330FC439840AB9 HALAWI123
914,146,474 *5F251B4CCA73EE9210967FB2C6876F0E1FB6DB6B HANFANPU
914,146,475 *5F2265A2A9BCA0A5D19070E07ECBBC30B9226342 KURTISCASCONE
914,146,476 *5F27BDBA779DA553B608FD2EF24036C4652CE9D7 KUULDEMÄNGUD
914,146,477 *5F2F9F6B32E65110D0EF298B8DE1900C66CECF57 harleyangellotti
914,146,478 *5F280EA110BE5ECC9BACE5B40883A198C1F15B0A Harlo+re$
914,146,479 *5F2BBD12FAA26D407D946A115EADE1EA54F204A0 l0ck4g3s
914,146,480 *5F22CEE817540A218522BC4C52C53A955B28B1A9 hársnyrtiiðn
914,146,481 *5F2AF9346159CFBD919F0DCEFC4BA0FB92135A9E hassandouvier
914,146,482 *5F2F7C24E72261088D6EA6C4A5CCFAA9DB4FCBDB lacytoups
914,146,483 *5F228D324787D2168DF285D239BC6A224D0BEE44 hazrattajuddinbabaofnagpur
914,146,484 *5F22B0A98B3DB55CD42703C6275768CF2EBF5AEC LAMARBRENDEL
914,146,485 *5F2BDC005FD31439685F63485A218FB811C8998B [email protected]
914,146,486 *5F2F4AF8934723DF8AE6222AB76F561C2ED9A044 HEAVEN-ADORES-YOU
914,146,487 *5F2BDA8C1EDCC416F766E9CAAC0F03D8BB0D3FEE lanehandler
914,146,488 *5F23FB494107D7EEBA5F0752563D9992569BFAD0 hectoriad
914,146,489 *5F2E13F8F7F573F3132844572707C12635E719ED herschelsekuterski
914,146,490 *5F268E3174B998A28F0DD2335D4208FA9C7FAD2E HERSHEL.HATTUB
914,146,491 *5F272F92162FD689ED25983DFBA353D1FE43B6E4 HERVORDRINGEN
914,146,492 *5F2245BDB29528383EAF3FBB47AC6BF963800D3B HJIAUSIWED
914,146,493 *5F272D984AB78D0F8FFA491A7A5309AB4FE6E7A8 leonheidelberger
914,146,494 *5F244C729155341A4931F208EB5E4CFF69A00605 [email protected]
914,146,495 *5F2C1C14927F206B8584E49D41E3E3804319F38C hoechli
914,146,496 *5F2BBAF3FA45C51AF61182530BFC79033A640AC0 HOMOTETRAMERIC
914,146,497 *5F2B9FDA2C57AB87BBEE47A5A26C4ADF7EA0ACE7 hoopping2
914,146,498 *5F27E16759F5D5B3CCCD49F03F0A73AE4F4E15F9 [email protected]
914,146,499 *5F2D32AF7F33F5BBCA961FCEFCD9D77404E68C16 lijuango[email protected]
914,146,500 *5F2AD02BF30DD10028912A700E0F18FC2BFF6EF3 HOYT.HORSMAN
914,146,501 *5F2C4287FD0785E73E2A1C39676D3DF9B349D229 linda-obeid
914,146,502 *5F20F11094E65EF678B11DF88966A277C222EB32 HSGULDEN0
914,146,503 *5F2DC7CD8FEBA6379EB21B6216C7235DF8AC5C2C LINJIRA
914,146,504 *5F276C700DCA013C853DE22892AE51C30FC24C94 HUGO.FRANZEL
914,146,505 *5F26B0087037F62A87CFE7DAE514B49439C271F6 [email protected]
914,146,506 *5F2100DD3268284A4188A7EF80B3CC533F0C49F8 HURTADO90
914,146,507 *5F2883CC87B81FA32EF13973F49613BE8F9FC4B9 LODABSW4
914,146,508 *5F2DDA40EB5ADDB13736772DC91BDBB9D844B02B LONAKKERMAN
914,146,509 *5F283DED89BDC58E5DF177562D2316C9FB4EBB83 LORICULLEN
914,146,510 *5F26E98E465FD183F8FACEA7B5E0D16CC9425FDE iamdominic62
914,146,511 *5F2B0A7EE0D243C090758B0FA882742D012CD068 iamtaylor2008
914,146,512 *5F2A36DE33C0FB58C0AF0465C69E33A6C7298C0C IDUSL212108520091002
914,146,513 *5F2AF73CF633B7065DDDF685A4F33109F25453AA LUKETERRIS
914,146,514 *5F2BC2F0E38B949F493E9D47D620D3C0D2DB3C45 [email protected]
914,146,515 *5F2ACB5BA8760EC0DC4747FBCBEB433ED4630FDE ifeellove(petepritchardedit)
914,146,516 *5F2533B8237D95BED982EACD274ACC661F63DEAD ILOVEBUTTONS26
914,146,517 *5F2149C96963AC8E77DD4C1D151E818906BC2FD2 [email protected]
914,146,518 *5F22D99BFE1FB1FE529366BF88955519239C0D9B [email protected]
914,146,519 *5F229A8056380FE250CF65E00684D5F9EB4537AE [email protected]
914,146,520 *5F240BF44C76DC5C1DB9986170D9A01C306E9E4B MAHMMOUD.MOHMMED
914,146,521 *5F296C12CEA98D5D4FF48927240FD2C0D3D9955C MAI-KOMATSU
914,146,522 *5F2C6D0A3F244809057A2ED36CB0D33E1B0E93F2 IMPACT.6
914,146,523 *5F2A9097340CB7B538CB4425636A0D7D3AC2C23F INACIA27ESCORPIAO
914,146,524 *5F280C0BB6DA9726F0F9EE2CCF50A080037126AB MANURER
914,146,525 *5F28F8261890E5E1F0E37B665753519258BBC485 MARCELLUSKOHRMAN
914,146,526 *5F2F2F3C592D740C45C5A7D168A7F694EFE86A2B insatifa
914,146,527 *5F24E53CFAA87F4903B0A00708EC3B22CB21542C MARIA-BANDOOKWALA
914,146,528 *5F2E859EE7F9694C9927F4628BB7FC779711B0FE intertrabecular
914,146,529 *5F2D28DBE95BA0444FC06DD87D8C6FA1B3C41EE9 INTOXICATION/WITHDRAWAL
914,146,530 *5F268B550611373DC0F3A13A76274E25DD0342F6 IOSQCPTSGBW
914,146,531 *5F2EBD69CA14A3BB9891F9F69F69D94B77E51040 iotazlac
914,146,532 *5F21420C0639C446D3E639AB8D83286FC979EDA0 iriihuvi8
914,146,533 *5F213D94E1896285EB5E7B6513E03D4904CBE4D1 IRRIGUE.
914,146,534 *5F2220D8CC3BC05CCC1C4BCCC427DA9F4864C716 ISAIAHPIETROK
914,146,535 *5F21D9BB3625DE79F371D995B0444431CF349095 MARY-KAY-FOX
914,146,536 *5F2E8A8D5E47FE8B4DF622844F60B1392786A4DB ISIAH.DUFFORD
914,146,537 *5F20F0EC8187DD830537019CD32C1F1AC4CEF2A3 ISIAH.MULLIN
914,146,538 *5F20FE8927F06BAC45175858E40EEB1F87D365E6 ISSAC.COMPARONI
914,146,539 *5F2EBDC72D8A0A5074800879FC9B6B852245CFD9 [email protected]
914,146,540 *5F249C35D2E938E217EFEDE91C289D5848E6965C IV4N
914,146,541 *5F2C5273F46967D35FD0E7C353D7EFB81DDB434A iwotarac
914,146,542 *5F21FB82B695E9ADF9B673735C55F1EEBB020FD4 jabberer
914,146,543 *5F299A753BFE49EA2F5809DA3DC4520078B17796 ˈMƏⱢKIŊ
914,146,544 *5F2DBE86C7E50AB58B999A6A713C07295F58285B MELBANDARAWI
914,146,545 *5F23C648AF987A84731431BC1ED1FF6629C9AC08 jaezawasky
914,146,546 *5F2F01C274CAD505C1E0CC87EC38A926916EAA4E jamalmuros
914,146,547 *5F2CF3FEFFFA661D6F1A2D1D50CA70E552B86A91 MERENGUE
914,146,548 *5F20C1F1ACB7777FD91A7F4D5FFB09B71E5AEC7F jameszeuner
914,146,549 *5F2A7220B9840243EA26FD5E5C242110583E0D7E JAMEY.ENGELHARD
914,146,550 *5F23E212578161BFA98F30871EC684D2FA12E883 jamisonmillwood
914,146,551 *5F24FD9EF6E38F263E2C3F673C31661DD080656C [email protected]
914,146,552 *5F2BDD3E8A24F385D3C301B70F3A2CCC1515CCA8 MICHALEWOELZLEIN
914,146,553 *5F231BA3EDFEC5AAC3A9C3C54F487D5E2CB94B3A MICKEY.VENER
914,146,554 *5F2856E1722E555677182869436AC9EB47399730 micquel
914,146,555 *5F267A49C5891120327988B7A93C106E8D10A8E8 MILAN.CALENDINE
914,146,556 *5F2448F4F5C76ADDBAC20F86DDFB5F43E360B6FA milesbiddlecome
914,146,557 *5F23F3C52CF1E728CE8615163DC84C4D5BD152D3 MINIGUNS2
914,146,558 *5F2DC2C4EF7B1777FAF8FE44641A49304BE743C7 jehaan-hendricks
914,146,559 *5F248434E75523AEAC4379362B8AF4BACAE0EE8D JEHAN23
914,146,560 *5F2CE9BB121D9CA917BEB43E4A1479091C83E635 JEROMETILLIE
914,146,561 *5F2915040326F14219CBDA8685F0803A748E0C12 MLVIK400
914,146,562 *5F2159BEFC242023AAEF44E602C8F89F9CD6B74B [email protected]!F35T05
914,146,563 *5F202156D2031CC0585B4A48010DC82D436EBF57 JESSICA.RANKINS
914,146,564 *5F266E35994D84AA7D9BA3895C0E6EB46223AFBD monicaurbano
914,146,565 *5F2E10572925FADBE3D199337A7466834D0AF636 JIM FOURNIER
914,146,566 *5F2F83F0FB83060E21D353D04D1C57D9B4C6D573 more.known. Come
914,146,567 *5F2B44E58B4CF8866C61A9DEDA00701E8AA54EC6 [email protected]
914,146,568 *5F2558507EDA7C6119A846BBED7009D544A0A35B mortadella,m/o/rt/@/'d/e/l/@/
914,146,569 *5F2405AA68259AE8AF66D795429D69082C5F4FF3 mortadelolista.de.municipios.de.portugal
914,146,570 *5F2A46E98EC6877C546BC6812CB0B291BE8F6AE8 joan.gallivan
914,146,571 *5F2BB9F38538338CDCCF555FD4241D54EB60525C JOHNATHANCORMIER
914,146,572 *5F2D908F8B4BA47F4394ED24523684F782C1B33E johnathondiffee
914,146,573 *5F2B7323B0AED86DF9016C30D2A090152B4AEF54 MUKDEN6
914,146,574 *5F28199553E503A4E1F11A7D0AB04E962146E283 JONATHANALMEDA
914,146,575 *5F262EA32560D9C9AC0B038F3EC81010DD249E2F jonathanaw
914,146,576 *5F2180F4438D7E0FA5CC9F77C710311481D1A10A N3UROBIOLOGIST
914,146,577 *5F258891E5A0E5A5B957EF2471585B829C1C0BA5 jr東日本が運行している
914,146,578 *5F252031DC8D5985C12AA639BF1C9B7B11B1978C julesmayen
914,146,579 *5F25985608228454DBB7060D0F54B6FA96627BCF JULIE1PIGLET
914,146,580 *5F227799FC04019D6D8B62CF0D717C15D1CBDDC3 NATO-SAVEZA-1
914,146,581 *5F202ED35F497BE7E54767D68BAC1A01E2FAAE22 juzgadodemenores
914,146,582 *5F2305C323698CE1AFCEB79B166928520F300D00 ndũgate
914,146,583 *5F29CCA06B09F5279B9A90997AA5BAC9D0A4F1B7 K0876242439
914,146,584 *5F2198DFE98CBEF8747EABE93BE41C0617D1FF2D karla.arndt
914,146,585 *5F253798D977025F39BE0869A979142FE2D5A6D5 KARLGRAZIOSI
914,146,586 *5F295865D3287A8E96B08687D1D1342B37591E9D karl-rhys
914,146,587 *5F2C40447D1ACB47524AF1F5ABA58D4F7FDFE860 next-lifetime-(live-version)
914,146,588 *5F2F8522332D81415EE0EDA45BDE4485A54A9768 KASEYMUNCE
914,146,589 *5F2DDA6BFD113C8AF8ABFFB1808F546B3259EAC7 nggnet
914,146,590 *5F2DABC8D94E4A8BFCC7F7449DE9C2E9D74486EC KATHY533
914,146,591 *5F21DE04E06A8FDEBA9E1BE0295433D5DA64DD50 „NIEDERDEUTSCH“
914,146,592 *5F24A170AB0B8B8ADF2A8AF0E6C4C6311B7DDD30 NIEWAND9
914,146,593 *5F27154740CEFF5BEC2FFE9AB8CCA485D4A374F1 KEITH.PAPAIOANNOU
914,146,594 *5F2204D27608D3ECAE4A2B73C8D792B9AD4384A7 NISHIZEK
914,146,595 *5F268B8656831FD10048DDEBCBEECE5E7A7A1FD7 kennithgoes
914,146,596 *5F2B8F273E490459505E06BBCA7E3A6EBF3FF9E6 nobodyknowswe'restars
914,146,597 *5F294424B4AF3289F2A8D37C6FA7D0D8203F6F88 kerryubl
914,146,598 *5F2CD1EC2AED421FE6FC7CA8316C0BB553CF02E8 [email protected]
914,146,599 *5F21B675C609022DCF2A542A9A9AD556161BA610 KIAHWHAT
914,146,600 *5F25143FEB0DF3073F86AF407B18640878202BE0 KIDS.IN.AMERICA.(D-BOPS.BRIGHT.LIGHTS.MIX)
914,146,601 *5F202056E1F09915896C7CDC0FA718119570A542 NOUTHIRING
914,146,602 *5F2061FBAAA1C8FEE90001386F21FC1FC127FE5E NSLEDNOU7
914,146,603 *5F2ED42FFE23A713B5161A4BAC91633EE00125CC klavierstuecke op.119 intermezzo bmoll adagio
914,146,604 *5F2BD7410158CE0E18FCB5FF0977B8E696BDA7D8 [email protected]
914,146,605 *5F213B4C7E09593F049BA0E838693F13D82BDD70 odbcocomwww
914,146,606 *5F20ECA54EE654232B86BB6F52E2A29A353A5BF0 ;)O~.d==q
914,146,607 *5F24490B0668E17CB7AAA1A8D11F0623A4989B03 KOREYDITTMER
914,146,608 *5F29532D4FAACBA07867D5A26AC18E8DEEE977B6 [email protected]
914,146,609 *5F2C951B9093CB1FD066FC25D3CA67D1BDEC97BF korma22
914,146,610 *5F26BBCA9F11EA315F153F89348CF6C9A096423C okarakterizirali
914,146,611 *5F2894746571A965E6F11E1341EAF8E72B284522 OLENFURL
914,146,612 *5F2F52E408173E749DA77889DE04754BA3B1158F kruimelige0
914,146,613 *5F2155BD5AFD504FF813030A19C1E3D2658A1454 ONDIENSTIGE6
914,146,614 *5F263817E57687584E4F93CE16C9FFD8958755F5 OPSNORRES
914,146,615 *5F285753502BFFD9C8300E65368B2CEB6BE0094F la-actividad-economica
914,146,616 *5F2700AEC50C9C10116C31A7987490B764052F79 O><~`~`QQ
914,146,617 *5F29D947AEBF0B3E833B3E181394DF81074E3309 LAAOUINA
914,146,618 *5F224F3AB5A1680728BAFD1A37237D8C85DE8463 lacygoldrich
914,146,619 *5F21CFE347E96CC70BDEE1FF1FC2F446B82553FF ORLANDOGILBAR
914,146,620 *5F2ACB184A1312DB0CEF6382EB4181099624ACA2 orlandolaymon
914,146,621 *5F2F12EE03E51A081C44BF3219505ED9B966A106 OROBINHO
914,146,622 *5F244899300F9F7E52BA67B55EECDD2A75CC747E OSSICULEOSSICULE
914,146,623 *5F20D97BD5F92BF875F210B217380DB569F40EAE OTHACRABTREE
914,146,624 *5F27786525F5A7FE6529FA7834A39B5FE65A0F27 LANDON.SWINK
914,146,625 *5F227A5EA6AB790EF86395060D48C9D30BDE0AF6 LANIER.
914,146,626 *5F20D328E5A3CEC56DFD09FAB1AB8B300A7B722B outvoices
914,146,627 *5F2B83113379FBC316A56C8966F7E9480AC3A764 LAURENCE.PEDERZANI
914,146,628 *5F25B84D7E379761E73B5D26C6BED1B13421CCAC p====) ~0~o (-_0)
914,146,629 *5F20B3246044A726798F80706D78F0CF41D6E938 pablolairson
914,146,630 *5F227449D4230B503BCDAC11735BA3BB07F01436 LEIFCANETTA
914,146,631 *5F2734BC30CE730908EF598580468C927388EBBD LEIFDIESTEL
914,146,632 *5F2446A9164F9BCA6E7DE9B37569B3A314840605 leighsepton
914,146,633 *5F2B9A641332B4511A46346B6469DD3357250D35 PÁRHUZAMAIT
914,146,634 *5F27C813F5778AD64505989D369307A47E52AEB0 PASQUALEMASO
914,146,635 *5F253F15B8C221DC2DA7CE2D782E48BF80721837 PASTELTEKENINGEN!
914,146,636 *5F20D4E2A54ECD51928718F97566FE08AFC857E9 PATRICKPERRILL
914,146,637 *5F259F420E28BD8ABCDE38ABD618E766A13B9D55 lesleymunhall
914,146,638 *5F274F7DBB36FD2E7559C10C79EDB17DD15D1D60 PATRICKWOLTMAN
914,146,639 *5F20A352AD2C11D8DA31D53719E9C0DCCBD8A5D0 PD ~0 )O(
914,146,640 *5F2373C890056C69B0F0819D50D744DB9C99B89F LICHAAMSBEDENKKING
914,146,641 *5F224AD56121E96B4C58B777E3490A4EB211BBAD perluá
914,146,642 *5F25CF9C05A90AE626DBEB5FADA04C1608AFCAD3 [email protected]
914,146,643 *5F2267151315315BD5BF6FF6E9B420DA4BF9CD6A [email protected]
914,146,644 *5F247C48EE0AF45C3BBF995C445341DDF2177DC2 LIONELGOSSER
914,146,645 *5F210D18CBB64AB20D922E4976F3FECAD2D2B98D [email protected]
914,146,646 *5F29A2B3EBC7B38316D82956B8FB939D6C172567 LISA COREA
914,146,647 *5F2BCAFE92E970BAC5E4F7E1D0E72D1B626D7DEB [email protected]
914,146,648 *5F29129AF4F34E29E86568DB6035339811352851 LK!+
914,146,649 *5F2144EEE4555C0B831D49A400F9653E2A5AFC95 llewedj9
914,146,650 *5F2930F714184652D760CE6E90945ED500C8D2C4 PLEASURELAND1234
914,146,651 *5F20DA0C49004C91AF76D5845E6F2291B58F8B24 PMAYANI
914,146,652 *5F2FC73F05EA1725570E34B9EBEA7F819B48FA52 LONELY-GIRL-/-MAKE-LOVE-TO-ME
914,146,653 *5F2DD32BAE71CDC5E51A1CA77CDA6D48BCD6A284 POLIISITUTKINTOA
914,146,654 *5F21437C46D63214E86CBBB33D369F09223EB6F3 lorna-gonsalves
914,146,655 *5F2C7A91D0B9C05F16C9C8A0C8C957255E65283C porcieta9
914,146,656 *5F2D15DA3509A231381F9FE174BA14F0682487D0 P--P`~)8(
914,146,657 *5F244B3279A4FB6E681CA9254BFAC7EAD2EC5232 PR31NHAB1TAT1ON
914,146,658 *5F2A9FEC3F40698057822897DD944078DA215F5A PRAELABRUM2
914,146,659 *5F28257FB989F5E7AD6E63797264D46CCCEEF861 prestonbuterbaugh
914,146,660 *5F23F223EABE517D0F4884762035E3A732CD9CEB PRETTIESTTHINGS(WAKINGDREAMMIXBYSUPERCHUMBO)
914,146,661 *5F217D9BC914047F5B0373CF0485A7B0A26849FA [email protected]
914,146,662 *5F2B6185EEF01BE8BB86D00369E7603DD336658D PRINCELASORSA
914,146,663 *5F2771B34FF5CBD61C85043ACB304FD65B33AF46 LYNNAGEL
914,146,664 *5F2E51328FB212AF071EE4873FAFB75F149E20FD LYNNJVMM41
914,146,665 *5F21C6C5F1BC763BA3B29297B08D5514C01795B7 m3l!or473s
914,146,666 *5F2141E9A3F1B9C86A512FA6E55E1B5406CD5023 MADDIE-STACEY
914,146,667 *5F22F9B450642EC72577B266987D926E401ED1D2 MADPIERRE
914,146,668 *5F24FA88F71E426E11ECD47AC9C6BA8377D08382 PUSHINUP1234
914,146,669 *5F27ACEFD8AE1E75ADC6675972568823A4D7A58A makareva
914,146,670 *5F27F8F8E6E87F8397BB6D4A5C0E3DBD5D90DEC8 manip13s
914,146,671 *5F224D635884D4E7DB41F72028AFD12E19774415 [email protected]
914,146,672 *5F23BE569810A672814C6959F6136ACA65DAF562 qmwz
914,146,673 *5F2D1EBF149FF1F26095FC6ACB36493A89EB21CB Q--->.~.SPLAT
914,146,674 *5F20EE5F7D109C7C43AEFCAA4BAF5499DB19A9DE QuelGrandYour
914,146,675 *5F2C361C0101BE552939A8254F3B3A180794C323 marshacrouch
914,146,676 *5F291DDE954F8BF83D8B1E9AE8F404A004C9CE1F MASHUPS.25
914,146,677 *5F2F7929F7047EC3910A7B9ADA20216CA0713876 rafaelmaietta
914,146,678 *5F2593A2AFB0F7794B001D4BE56E8791172FAC13 rafael-otero-l
914,146,679 *5F22E5136FD1FEDC339305D03F21F85A0E0F7488 [email protected]
914,146,680 *5F22289993D3175D197AF7AA776CD5BB2BF9072A ralorcsed
914,146,681 *5F233FC6BB15E654190753FC47201B8B590F46FF rampazzo8
914,146,682 *5F2F78CBCE1BC3584CC526C7FDF4E140EDE8CBFF RAPHAELKALLAS
914,146,683 *5F25F167E6181A415C4C6D91CA43684E12AA51F7 mcrfssls7
914,146,684 *5F215EA33853104C1060B091E07130829170038A RDAMNIEL
914,146,685 *5F2CA99512F40E8376D7AD8410DB0B5599807B0E MENSTRUALA
914,146,686 *5F2E1EDD55992D956677465063E0631ADA3CC711 [email protected]$0rbed
914,146,687 *5F273E3CF9621DA51C2CE3862C4A6EFC50DD6D37 recetly
914,146,688 *5F2C124008DD30644C629C4EE0E4527A2B3522B1 RECOMPAC8
914,146,689 *5F2FF94C236B309FDC5BA78B092B712C290B4976 MESEVEN2
914,146,690 *5F21D0D6AE1F9D410D96164D575789B6C41E06F4 RECUUTJES3
914,146,691 *5F2FC36EDFDF58E41D6F1F9E8F00C8D299CEB791 refbutilsoft
914,146,692 *5F21B2EEA95A382DC4DBBE0C76C57811DFC1457A REGDODEROYEE
914,146,693 *5F2DE51BC50B9C82C02CE5B6A3752213D002386D michaleketcher
914,146,694 *5F25E5C212A3C6AAAD80C093FC21BE461BDE8712 MICHEAL.AMTOWER
914,146,695 *5F224B9B0524AD014FD504CF52D6B4E261DB8E15 REID.SCHOENSTEIN
914,146,696 *5F27F88E107EAED73ABD0957813253B496FF63B7 REINEVIREN
914,146,697 *5F2D5F2ECFE8D74378F411EC27B93B5C9C6C655D RENEASIA
914,146,698 *5F238D15F3EEBF2F955F4D62BE34C8829A91ABE8 MILFORD.MCINTRYE
914,146,699 *5F2BDAB0DF4096A4D77B16AF0B657ED6BC8CA59B milfordsignorile
914,146,700 *5F209AA5CE5DA6A1B271F4FC02DF02919A26F000 RENOVERAI1
914,146,701 *5F24235F2517C44077D46C39360345B6CB40A67A MILTONREFFITT
914,146,702 *5F2ACB203DF8047EA83A32A7BCE6F70C8AB95E28 MINH.AGUILLON
914,146,703 *5F2301D1CF1E2C56BC33CC6C14A19FD1F0BF7F82 MIOLLOS
914,146,704 *5F26BCAFA9A7B900080EAA8D6F01347A87EBEB94 MIOMANTISARABICA
914,146,705 *5F2A5090D8787CE020F9FC10C217BB70C2C73655 RESERVOIRPDF1608671
914,146,706 *5F24446DFD2C8836EBD4DF022FEB554E3CBCB410 misfires
914,146,707 *5F2678DB4BC2A0C5E31C1E0D050740EB122CCFE6 REX.DINIZIO
914,146,708 *5F2BB539136F8CB461D502FD9CB56B13FDC4780C [email protected]@prop!5m
914,146,709 *5F2A57C7488B01112148A08D0D48FA48A4CC599B RICHARDWAIN
914,146,710 *5F2938ACCF64ECFF2B160B543C334A3E918581B1 RICKEY.VANDERBURG
914,146,711 *5F2D85DBC730C9FFAD4B5AE4A9DA2DE3FF9CBC83 rickieyaffe
914,146,712 *5F28A131D0452C8B46661CD9D2D6E1A94F5DBAF9 rickysunday
914,146,713 *5F249995AC56BEEEEAD5D84389F68E8DDAF6DBB6 moshelazos
914,146,714 *5F298BFFE8309EC3CC1EBD73086016ADE675BFD0 [email protected]
914,146,715 *5F25AAA9443E8E87E739C709365D23C40CDB3147 MRINMOYEEA
914,146,716 *5F2C45A881F10FAB5B51AEE0BFF13AB04DB7C7E6 MRTINEZ5
914,146,717 *5F2A685B4CABFE55F4ACECF79F394C21C0EA4110 ROBIN.STRATON
914,146,718 *5F28CC6671D8C51E3B6039F416D991D237878871 MUHAMMED-NASSER
914,146,719 *5F26C8823E867F3F0C5897E2E82977E918B8661C rodolfomui
914,146,720 *5F2A010C16767BFFF6076B5D894D19C3A4343006 MUSTAKURKKUR
914,146,721 *5F2567D3C776457B23ED962844F77674CD2818A1 myspeedo
914,146,722 *5F21DB10CABE7F42B9593C50C41D241FF2A1FBB6 N36947
914,146,723 *5F21AB9A00B97709DC49730309083116703E0176 ROSSCLEAVER
914,146,724 *5F23F2AF0C2BB70B71F80AA0950661CDD6E8DB56 ROSSMUENCH
914,146,725 *5F26EC05F7212C9AE3BA9AD203C1459750C8ED76 [email protected]
914,146,726 *5F267117BE3623545434CB0DAAC2ED00B8BE1DF9 nariagari
914,146,727 *5F2448497859233E50DC03C186FAA90B18C9C2B9 natanna8
914,146,728 *5F240EE4B5F459532F59A434015B4AEF06B94F69 rufusbartsch
914,146,729 *5F250DF197067C160F0A38352C9DE27588E59128 NEDCECALA
914,146,730 *5F2FB2672548A5580ADE9F83F96F760657085CEA RUSSEL.MORCOS
914,146,731 *5F28977EA3888A4A02A3C671301AB415B1847547 russophobypaukrus
914,146,732 *5F279016D9AE3EF546DA5E4616C474E8E0410D5F RUTTRANS
914,146,733 *5F27B9DF0DCF81A886D5BB887BF090DD82BF76BB nelsons
914,146,734 *5F2532B3852C6D28CA896E699EC4EAE8BF4B2AF7 NESTOR.GLUNT
914,146,735 *5F20C26E98996B64325D5F8FF44B7734DA67723F [email protected]
914,146,736 *5F25FD4E71E02797D57FAC014253801EB2F7C890 NEVILLEGEROULD
914,146,737 *5F2A9742C8BEDD11B6902AEC53C0555A7E63928F NEWTON.MUNDERVILLE
914,146,738 *5F2D2C44C1AC3554D3CE33E058C254BC853DDEBA sacwès
914,146,739 *5F22BDDFB4C8AFA779DCCF8DD2FCC0BA087AF06E NICOLE-GALANTI
914,146,740 *5F23EABBB607C81F722EDBB57D7FE5CF9D7D5CD7 NICOLENE1
914,146,741 *5F2B2201A863C0671A935FC2E04022E125E2194D NIKAKNET
914,146,742 *5F26A6592B68C2432DDBD1406F23A9791E5BF918 NLCIW7PAUD0
914,146,743 *5F2F60BD82531C129D1FB1F8E4A4AF33FCE5C004 SANJABAD
914,146,744 *5F2AEE4C0EF1A8989D07C9F318DBCA75584C4627 SARAHLOVEBAND
914,146,745 *5F2481197A5AB71C6DC9D7DE02BE231C43D26CDA NUMBERSBOUCAUD
914,146,746 *5F284251A26F61166DB8354A80CB958AC8C71682 nutritionnuw0trih1shah0n
914,146,747 *5F27F35EE78EE53A5D842D115270BAA2744C54BF SCOTTY.HARWELL
914,146,748 *5F2F19FCE2C22D141CAFEC2FDEC723E2DF111A9B )o(.~.`<###3
914,146,749 *5F293694976B08E2CC89928DE92E7BC764DBB585 SEBASTIAN.ROY
914,146,750 *5F2031480F405C7DE2E513BBC2DE66E00EDDF08B OCASIONS0
914,146,751 *5F221DB0BCBE99A3BD151BB813BF57BA7DE8C890 SEDUCTRESSOFTHEUNLIGHT
914,146,752 *5F290728A65A9C35EC5ECCDF127C9BBAE79723AF octaviodelone
914,146,753 *5F24FC352FE8AC959B01B4544D4EB33F2827E234 sehite
914,146,754 *5F21517648BF32DB7ADD1DA14537EC1FFE24A0E7 O_F$
914,146,755 *5F2DB7D9600C65DFBD54530D1B7AE76D9C92716F offerbussen
914,146,756 *5F2EC4DDFF125E10FC92276D5CBE378E58DF345C OIDIOIDSES
914,146,757 *5F222AEBD97DB8B5C631AAF2C6FF677D1322F032 OKASINORIK
914,146,758 *5F27572992DC3A31DDFE5ADBB2469811BF2A34BB SERATNANGERP
914,146,759 *5F2ACEA25FA0C9D48425F01C14F8DC11FCF92D26 SER-VI-UT-LJUSEN-(STOLTA-STAD)
914,146,760 *5F28B88331624291F56FB5CABE0AEF17FCD16F61 setstetivitka
914,146,761 *5F234F362091B59C06871BF18E307734EEC06568 ONISCIENTE.COLETIVO
914,146,762 *5F2497C6F375E4F22F1149EC8A67FFA6716D3404 shana345
914,146,763 *5F2A3B67775CEACECC32B1871FBEFA5900CD756F [email protected]
914,146,764 *5F24A732738B5FE3E98257650D6DCCFED0D2F888 SHAWN.FAGUE
914,146,765 *5F22788684A3D6CDA179A51BBC43C379DF46D5B9 SHAYNE.POLIVKA
914,146,766 *5F22F8735EE1EAD06BDA7C8BBC85651551C6530E ORGN004
914,146,767 *5F241D5BC0294C7E636B05E02F1320F6F60C1262 OTTOMCCHRISTON
914,146,768 *5F2C5003C0791F119C5A04D1A4F380A93E8B1E6A OTTOMIAH
914,146,769 *5F2CED2443D15BD6B6BD05DD1EB719901DCAF19E SHON.ORDAZ
914,146,770 *5F2F3827AA7544845A754258AE342326DCF93FA1 OurLove(WillSeeUsThrough)
914,146,771 *5F26318BD9AF4AD84BE4F879AF1096D04D94CC8C SIDNEYSAVKO
914,146,772 *5F239695A1C0A64FD611BD36C602AB62A77CBE8C p-)~0(^_~)
914,146,773 *5F2043FB9B1C9E08D039C15515B0F5E295D56953 papi11or3
914,146,774 *5F2B1E1A62E72B5E5FE7D1AEA3568E4373B7D589 PAROLIBERI
914,146,775 *5F2DE055F91EABFB9246F285A1699851F867DE34 PASTÔ
914,146,776 *5F2B4E2F4A746EC1C6CFEBA8D04755EE6DA72EBD s.m.blues
914,146,777 *5F265682615B3A2F920401149A3DC9C306E07DBA PATKLINK
914,146,778 *5F2F96A90EB4F83DCB63DDD7E7E236BDBEC860A5 PATRICIA.WHEATLY
914,146,779 *5F21F96329CEC7A85EA050D721ED427F46415F80 sMuchachos19261938
914,146,780 *5F2B56465E4439509B4D7AFA50E9EF41DD9C823A snenenorhttneni
914,146,781 *5F2677B250490E836428C7C833EC26E4FA0811A6 SNRSCNC9
914,146,782 *5F2A302F531817344BC940D17C3D55543D0AE17A [email protected]
914,146,783 *5F214982B283942DC2F739F77721144C1BD4B6F8 PDEREE
914,146,784 *5F2CD7FC507FD183C7CEFFF1774DDAC18B1FD6A7 [email protected]
914,146,785 *5F2AE1598B285220701A3C269BDA6E96FB8D89DE [email protected]
914,146,786 *5F2E14B71CFAB3CA0A506CA42953964A3BBADF9D pgxw
914,146,787 *5F2BCC0A8779B7A6319603A04F98AEEAAB5CE843 PHOTODYNAMIC3
914,146,788 *5F29E8B5DD833F66C969DD506C627856D66848B2 pisurtzi
914,146,789 *5F251F6B5981C741936119C85FCB475768F48D63 SPOPEHTFOPOT
914,146,790 *5F24D9DD1CE9040E300B1CA000BF90EB41A94104 POINAAOA
914,146,791 *5F25A6462961E176D1EE3B9B1B01854147CC9D97 pokekard9
914,146,792 *5F256AC2F636CB47014229811034FFD3544270CD P====P~0~O}O{
914,146,793 *5F2917AC6A25BED901D7EDCEB0C7AB9898386C52 stefanoh1
914,146,794 *5F2BA81A044B832092404DC6F7D83755FCDBE43B steppenpfeifhase
914,146,795 *5F25523F71D4F79FDBD5BA0292060D34A5D780DA PRANAOESQUECER
914,146,796 *5F2101AC27A7FBCFAD4F15F8A3A88D260FD18EEE PRE-DIPOMA
914,146,797 *5F20B73D70FAD30C52EEE1A3D7F4046EA88AE1CE pressn:presses
914,146,798 *5F285FC01C1EFAE4CC3B5B858F16C67E3E4A7A30 [email protected]+HENOGENE$E$
914,146,799 *5F20B90DC553FF0F89A41B2D245AA1DEEEFE5EE9 princecruel
914,146,800 *5F2129DCD08ED6C6B6BE4A260077784890770ED8 stokkit2
914,146,801 *5F220167F50411E57171297012F356E116191572 [email protected]
914,146,802 *5F22DC6F85F21C71DA768A316F31DC5ADAC1271B PU9NAC!OU51Y
914,146,803 *5F2416EE1EDD81F37875E3810BB174535D9521F3 PURPLY
914,146,804 *5F2423CDFCACEBF2AD4D3970BCA2DEEB8DEA93B2 [email protected]
914,146,805 *5F2EB698138BEFDD28147B15DD77B34EFDCD260B [email protected] ~ ~ ~ {X}
914,146,806 *5F21101A53B2426E2F39C66831F1253214E29E11 PZJB
914,146,807 *5F29692832532348C8785D789825275B7F86C603 Q==B~~~(>_0)
914,146,808 *5F28F49E89971205504749576031202EBC3AA9D4 SUSHMAJEE
914,146,809 *5F25BE297CEECAFE30B2EF875053C9564DDE979C SYDNEYMAYZE
914,146,810 *5F2FD3FF3F789C155883F36CA6C0024C6F0CB648 sylviasnow
914,146,811 *5F295BE2E9C3551E749995C16D4981DF58DA74E1 systemlizard
914,146,812 *5F28A31441BAF166A83FB7B95F9071F7BD601638 QUENTE5
914,146,813 *5F236572286E978B0E0E9D3FD41309A7F59A83E2 quincyzell
914,146,814 *5F2A8047023C5A0BCF1B58337D7E86F5D48A0DCF quinnhale
914,146,815 *5F27DE740908780E4E8E309BA76D1C395CF24DD2 $tageb0a
914,146,816 *5F29B24B8E5B841FA0C7D1C6112F767A05B0AAC1 [email protected]
914,146,817 *5F230797930E1D4F64328F224B82A90FCA2744C7 R380!L$
914,146,818 *5F22E6C4F28B19A66D4CDBD7DB2A40F279E3D3D5 RAJIBPURPRA
914,146,819 *5F2C9504E42B4864929264E64BB73C23513E9CA3 RALEIGH.CRAINE
914,146,820 *5F2CC0B45F7B548B480A450D31A6C69FF2504C2E tashachangeme
914,146,821 *5F24951704027FD6D10507C4BE09191BF095EFBA taylorpollo
914,146,822 *5F208D87005BC292491B03A544BAC3E94D6ED009 tbcubsw1
914,146,823 *5F23368CD6E08CDE44595E3388FC71420D06B3F6 te mars (homere mix)
914,146,824 *5F2D4CDC91144F75E3AB44ACD75D043407FFD341 tennissegurosbolivar
914,146,825 *5F2E77D4F37689C7C5B7A1B4E60BBCDFE534794D TGLR
914,146,826 *5F2F3AFBFE8E6C6A952BB837DB068CAEC1BA8E99 [email protected]#
914,146,827 *5F2F8D8D57F56AC9787FE43629F53CCE9534B265 RENE.LOCUST
914,146,828 *5F25613490C472C02E6A97CAFF2FE23ABFD9D1F5 RERONSES
914,146,829 *5F2DD90E8DAB17F39ACCBE987888ACE7B5597165 THEO.CLAYTOR
914,146,830 *5F2B9FBBB69CEC3C169277DF18E0C6BAECCDECA7 reveries of a newborn loss
914,146,831 *5F29B778E921CA0BD0AB05355D88A03E8E80C2CC THIS_FUNC
914,146,832 *5F2E52849E8A9011B165A665730844C229AD1138 RHETTGRAD
914,146,833 *5F2D37D9C109A8516B1AE4311B72F829BC15ABC6 R.HOLDSWORTH
914,146,834 *5F2E6B6AD9FBD4DBD3D063824203412DFC5C347B RIBBET6
914,146,835 *5F2A6CFBB1921071EA37073792103DA13998B560 RICKEY.PERQUE
914,146,836 *5F278BC02C60DE0F13AC26F9EDF120417AE2A077 RICKMISCH
914,146,837 *5F2E9BC8C8E24FB9409EF541D4C40230D5E846AE RICKPRECHTL
914,146,838 *5F20B1AAC3C0F72346AD9155FC38B1468A84A4C5 TIERAFRAZIER
914,146,839 *5F236022A9DA8788BB40D2F266461F1DB26964F2 RIDEALONG
914,146,840 *5F2A8781DCD5575E2062E4E10243570E26917182 tnretsbo
914,146,841 *5F226F79A89ABBE1CD26151C3E338D54F6D6F4FF TOIRIGAWA
914,146,842 *5F2E5D710864132CAF711734A445BF143F10D478 rodolfodiewold
914,146,843 *5F2EA41A21010E2E024C2A9E04FB56DB0D21B380 rodrickdragg
914,146,844 *5F2DC143945D590DA92CEC9F4B2767979CD1EE67 TONALITYFRENCH2
914,146,845 *5F27606751C3263BB4DC75F375E0B7C28863B25B ROGERDISKIN
914,146,846 *5F281DF1DE829B4F76380D6E66614C46C4A55D23 ROLF.DECASTRO
914,146,847 *5F2B1C45928FFDC9522405375196F056B4983FC8 ROLLANDCARD
914,146,848 *5F2A070F9C2BD3A7EB7A792B72ED83BD1AA25BDD romance-a-oca
914,146,849 *5F2C9DFDABCE1A387E447E5CE1F039F94CA6F6CF TOURISM.TN
914,146,850 *5F2D099C55C9E8C9F04B8A9224F1B531F234A3F1 TOURNAMENT.161718
914,146,851 *5F2D4B93CDFED6B47D7C38532A3AEA9B9253CC2E [email protected]
914,146,852 *5F2F59FF4DAD6F1A135873DA66E63AED4523D322 TRACY.MCCLUNEY
914,146,853 *5F2E6AE6C9D9E90E0A501D27C963FDDBCF9D09AA ROYAL.TRUDEL
914,146,854 *5F2673E1D95D0D409C2C0E3ED497B86BBED9DCFA ROYALTY IN JEOPARDY
914,146,855 *5F2E87150580D7F27129F650CE67D96E966E28F2 TRENTON.HAMAMOTO
914,146,856 *5F27FE57AD11D3383219A9C791580CC5BD2C7450 TRESSA NICHOLE JOHNSON
914,146,857 *5F2F15498735F93B2AAEC9482107B5284A96AD2F RunningFromYourDad
914,146,858 *5F26B06D2D7976BB429762EBEBDA4FFC08110ABA rustyherring
914,146,859 *5F2179CA96AEFC6CFE26B67145517624DD55A831 S5AHM997
914,146,860 *5F2B0C42C5087A234D5D610C1F2DDFCE9D6303F0 S67016
914,146,861 *5F217DB3F5D64782603D5B27B16D93A2D0FE6CE7 TUCDRRJV9
914,146,862 *5F259B0FEE3505BD7E118A25C14206CD32EBAD5A TUN1NG$
914,146,863 *5F266FC97DA94B0F02D99B270BF69FA5C83118E4 TYLERVANHAM
914,146,864 *5F285FE4DC99CBC8E07350D25BE6832064F5A81C TYPISTYKSENI
914,146,865 *5F2DB115E9C319544A542E10FABD2ADD638AEBB1 TYPOTAGS4
914,146,866 *5F2538D43B15EDC51FE5BCD0234710BD26A06F77 SAMUELSPRENGER
914,146,867 *5F207886A843CAC44A22FC4DB827AD5311C0AE37 SANDYGILLUND
914,146,868 *5F2943AF28BC005EC3DC3B32CCF4A015F2DCDD0D TZCHEN-BACKEN
914,146,869 *5F2CB6EE2C7BFD3C58BD1D6305E757B9B51046B2 TZENLINIE0
914,146,870 *5F2E21DFADF03CAC61D397413FA12CA7534F0D86 SANGTAM0
914,146,871 *5F2882F67C6838929D8EB5225F3262792C50744D u!8k
914,146,872 *5F22581F0A205B55729A623BFA5C6EA55406D706 アキハバラUDX
914,146,873 *5F23C2097F053068C6056616D3021B449EA4C316 ukoyrirs
914,146,874 *5F21F6DD50506CA3233625B9D0B2F6C9CB76C24D sazvana1
914,146,875 *5F2CB0ED10DB4205990BC354F13100ED7EE59D91 SCHURNAL“
914,146,876 *5F229B8E7495AB1FA41E53BF611B10EA59C4DCD9 UNDERWIRE
914,146,877 *5F2FDEBC5D0C6CDF52E9EFF3729FBDAA4BFA4534 scott-mccaughey
914,146,878 *5F2BF46385D19A75BF4B66CFCBDEFD6959807E53 [email protected]
914,146,879 *5F2BA4A7F4C25A98FEFB6CF133C69F86B3ACE6CB unnepiuh
914,146,880 *5F279F80A3ACAA697F313E7288DDA971932A54D2 SEDAIELP1234
914,146,881 *5F23C8040655A7ACD1FAE85B58836A317DF8244B US7O
914,146,882 *5F24F545ED32224951E22804966BF0D13F533825 UTEKNEZ9
914,146,883 *5F2033D01FF65344F2CF3B761DEFDCAB7F32E71A serapeu
914,146,884 *5F2E692B000BBF13CFDB938D5A9A759C4418D3DD V3331490
914,146,885 *5F2DFB246CDE3937BCC9EE149EBC305D25635443 seuraper5
914,146,886 *5F2F924B439759D20883F8497480BB18EE2308A2 SHARONALICED
914,146,887 *5F2DE25E520EBCF91FDF09646D4688A08A47F4B0 VANESSA.MOLLARD
914,146,888 *5F20B7EE46A492C2F97F3112A653F149570792FD VCBZGFHQZ2
914,146,889 *5F2773643C69D1175B8C5879EC0C368E12A74B85 [email protected]
914,146,890 *5F26ABB68B994ECB2FA542BD0BD36704A993EFD9 shermanbribiesca
914,146,891 *5F263F6A5627652621034E36B51DE151072259C0 sherrie.bryan
914,146,892 *5F23942F9ECB18F04BC53D14AE6094D7D204C22C VELDBATTERIJE1
914,146,893 *5F2C126C808C738F7C4BA5F3D78A3900B6BFBE39 VENDY.SIAWIDJAJA
914,146,894 *5F2FC236D18C19C124546AEF79011DBF34B53A5D venkat-banthia
914,146,895 *5F21329EC7ADCCE49BA1C680AFFAD57581C2DDE0 SHIT.VIDEOS
914,146,896 *5F2879217D322EB3E5EFB9ABDB2D834402C51DFC VERDAMP LANG HER (WACKERSDORF 1986 LIVEVERSION)
914,146,897 *5F236045D7DB8920B0E614AB0269DE312B336996 SHOLTANA
914,146,898 *5F29FABC0EBA732D13745D7CBFB1A5DE84BB89AD verlegen./."wij.zijn.de.kreuners"
914,146,899 *5F2F1DFC769E01BED91A8333D6B355E3D04059A1 VEROEFFENTLICHUN3
914,146,900 *5F2626A667E3BDCA2098D590137825AA88CAD9B3 sidchieffo
914,146,901 *5F2D44F50F9AAB1F9AAAFA4EC87300DCDAE13934 verwest،
914,146,902 *5F2CB2E57F070E3D3C02FD1F72488E2D2A743CEF VHITTISIS
914,146,903 *5F27056706477EED0ACF2CECBC90A643A7811C38 VIBHUTI TAYAL
914,146,904 *5F2757AB1BA2AA2BCF2AD72E552E0ABEA8DC4C2D SIZEBOUNDED
914,146,905 *5F225DF15A1BFFF0B660793EBB1CAD281E67E717 VINCE.NOWELL
914,146,906 *5F2E4BA1262C7236EF90E8FB77BB3C47E9FF64F2 SKOMITEED
914,146,907 *5F2315D16DD11157A0515E993DCE1BA74474E176 slagvark
914,146,908 *5F25529441B3593DDEFC885D7803A71F6C6F9E83 visitmt
914,146,909 *5F2E26488006654651ED14802057E299B2B3F4F3 VMUJKANOVIC
914,146,910 *5F2732D86F472F5B2C18420D06114E7E8466EF3B SOC!AL!73S
914,146,911 *5F272AFAD6A51F230A956B70A851D7966AF37A04 VRENY UMPIERRE
914,146,912 *5F273A412A8465F55BAE1B331E4DAE702179EB9D SOMN4M8UL1S7
914,146,913 *5F2859C17A7FF5E14820FF85283BC13A2E3D4AB0 VXLOADER
914,146,914 *5F2E28BD93AA7381E512C27414F2647F9426C655 W"=1
914,146,915 *5F2870EB6DCE356F31C792E49488AD014DE184CF SOPHMOREJUNIOR
914,146,916 *5F22E4B6E00F6EB4FB28C53E233804B125C71951 SORAYASCOTT
914,146,917 *5F26DE5A3DAD38820FA2C6D56A0F13B180AD4690 >wa
914,146,918 *5F27F8C9BD5546DED99556A5BE8C2EF82C6B1812 spanish.america
914,146,919 *5F26AA499616A5831074FEF82C1D973D29EF8530 walk.the.line.(radio.edit.version)
914,146,920 *5F2DEEC76607D733B679437562067A70714BED64 SPLAT!!0~(----P
914,146,921 *5F2A587C6E8B83B5F5A78AD461F9BBD85F9D72BF WARTUNGBEDÜRFTIGE
914,146,922 *5F2B9ED7B308B75DCEDCCF8C940EB214BC528494 [email protected]
914,146,923 *5F2203A97DE8EEB11E5693C1F43A76D0BC4C5072 weisbogel
914,146,924 *5F2365F72F17FE6CCC69F4D7C057A66E16512E8A WENDYHAMELIN
914,146,925 *5F28D410701AC757C42C5B18F70EEF9EA444CD44 [email protected]
914,146,926 *5F2D5C3C0B7D245FDA6D68CCAC867273BE49410D [email protected]
914,146,927 *5F2FF443C66305C7061736EDF30A9EB4501B7A98 stanfrentzel
914,146,928 *5F28A300DB725818AA17D4ABC89262EF5A7565D7 wesleyburmside
914,146,929 *5F21F0BAD5231AEFDD63DF63EDA98755DFAAE0BE STANTONOBERBECK
914,146,930 *5F21355FE71C5916C7BF1F22C1EBFC91B1D662DB WESTERNR7
914,146,931 *5F24C40634B0639678B03FDE26DC316300FF1DDF STEFFANIE KIM
914,146,932 *5F27DAACE04AF7F00C03FB8F5156985D88B51562 WICHITA.STATE
914,146,933 *5F20B1BD398312A9DFA908E7DFBFF92BC62A9CD3 WIELDIEST2
914,146,934 *5F2F2E2B5F0776278235F02E14B993CC8C3F94B4 stikdonkerst5
914,146,935 *5F2AC6887231FDC7A18A4967137DD3259508479B [email protected]
914,146,936 *5F26B0DBC2F03FF6E4BA1B4AFCF25915CA558078 WILLIAMS.NIIMI
914,146,937 *5F25CA2D374EAD8EC9B3481E19D176924A231CF6 williams.vaughan
914,146,938 *5F2D39355361FEEFDEAAA27D45560942C9706FB3 willminniefield
914,146,939 *5F244498C4896AC705ADCD4604DE25FDA878E442 WILTON.RAKUS
914,146,940 *5F2948CBF0EBC58EAD3B13BF1758A91472C3E590 WINFRED.PAZO
914,146,941 *5F293A3B7B9882CBCA8D893A39F3C182BA419B7D wintona
914,146,942 *5F236960B79F7AE73BC154E0C9B51E3C09BD485C WITTINGHAM-1-0
914,146,943 *5F2DB2252274BE4D5FD989D96A01EB5422D6AA95 w"j3
914,146,944 *5F28E745D654D8F6E8ABDBCEAA4DCB64DF0C8007 [email protected]
914,146,945 *5F266674B6777BDFC32EC75E55B7C5B9107E1AD0 WOEDE’
914,146,946 *5F292C8370A6A21748A6CDB30DEAEC9B73C466BA SUMBATEGORY
914,146,947 *5F28E00942F4C991934D43E279682F87F5941FA8 superific040686
914,146,948 *5F21E6A21105DE023513ED827EC9F3E288CEEEB0 wwwbubbleguncom
914,146,949 *5F2A6F7A2835FB007F4E94B8232ABAA86A0B7346 WWWCOSTUMEGALLERYCOM
914,146,950 *5F211294F36AE05A3A780835CBA458A556952D19 wwwhosaorg
914,146,951 *5F20E7B905AF5A9BB88A756BD63B584C500D4CCF /* swap it with the top part of the top segment. */
914,146,952 *5F2E78DD5EA7577DEF32948DD55A4D5B5D951C1A www.omegaart.com
914,146,953 *5F2D4089DCD4C95917F22BE8224D88FA2B004828 wyattcopeland
914,146,954 *5F21FFA0E427F9C816054FD015F207715D07FBB1 x\,
914,146,955 *5F294721FF922BE051C047FEE3E3BA9E7F342518 x5g!
914,146,956 *5F214C8112096F6CD69DCC432FFF415C6A52395F TALK87.0.59.4
914,146,957 *5F27D866669F03A5BAD50F251AEB19BBE3A7D120 }x{o~o~d---b
914,146,958 *5F2A9F5A0D6BAD819E7DA455C83FBA091E9705E7 TALKJLAWILLIAMS
914,146,959 *5F24D4A9B3502CF3BF27E75A0AB67ED2549A9CFF TALKLOUBENSLAURAGAI
914,146,960 *5F21EB7E5BB7D1EE0A9DF925E58FC35D9085C11A TALK-LOUDER
914,146,961 *5F22022C44A1BACFDC3FAB2C4A8871626FE7DEDA TALOLLISIING
914,146,962 *5F2B936DA873009EF77A03DEC071FBEAC0572A26 Y0UN9LIN9$
914,146,963 *5F2EDAB2F145910DCBEB8826FF38ACDF7C7B9735 [email protected]
914,146,964 *5F207E1FBC1F6848DEA08F67263C0231FCE1EDF6 tappais9
914,146,965 *5F25F0F4339D126FB8A8498AE2390D4E56CF33B4 TAYLORFERNLEY
914,146,966 *5F22DE9521A1E4D19397AD47F947AA896DA60BAE YCARTTAN
914,146,967 *5F29AEE9EC4A757A9FCAF3A3091470539A3FA6E2 [email protected]
914,146,968 *5F20222356B254E9B932591196C9EAC39DA9BDD0 tdada
914,146,969 *5F240FB992F09188859332569B7C904A7A717064 YHDEKSAENSILLE5
914,146,970 *5F2F85759BC187118AFF7FD3CF81D71E3C9A6978 YHINDZM
914,146,971 *5F279C85D78B5B9A22316D79DF5D085EA431DB0B YLGNIWA1
914,146,972 *5F2F41B4ACBFEF318444BBB7CDBA2318CAE68356 [email protected]
914,146,973 *5F2407C89F5CF79E8B798AECAE68B57379F0933F TERKELBSW0
914,146,974 *5F24CF1DCA38389C4099C52D76B8A202843CF4CF terrelliarussi
914,146,975 *5F246C93856EC08B898BAF02066670D8844C4AAA [email protected]
914,146,976 *5F2B6CF3A6EB58AACEB4985F88227EAF4D329912 ype
914,146,977 *5F271196F2DCD84998FC2D85382C6B087C6801F9 THANH.LYON
914,146,978 *5F2DEA62DEB2964D8D4EED056A82EFBE1867878A THAT...BBL
914,146,979 *5F2B3799E665E2DD30721CCB9C53555E1D2BE801 [email protected]
914,146,980 *5F2C6BDC85615D706672086BC512EC660AB6E014 THATGODZILLA5
914,146,981 *5F2607C52F794192AD401AD2AC9C40473E14B3B5 YUMIKOMALLARD
914,146,982 *5F2928963D9ADC4062CF8CEC849AAE0754837E74 y)v"
914,146,983 *5F27C761E9951F9C85F2ED5F8ABA81071D452A0B ZACHARIAH.LANDQUIST
914,146,984 *5F2CCACDA9D464041465757D040137EAFEA9FE46 THE-GOOFUS-FIVE-&-THEIR-ORCHESTRA
914,146,985 *5F21D3216190ACE2F7CB3850DD5E5C8D6F92708C THEHARVESTYEARS(DISC1)
914,146,986 *5F25A90495369B473580DCFAEBF55208456EB74D zahid.zaidi.zahid.zaidi
914,146,987 *5F2F975272AAE80FAA7B0E9134768D054AC088C2 ZAKJAIMES
914,146,988 *5F2D28018074F9BBE44352589187347F30B8724D zamolbi7
914,146,989 *5F2CAF34AECCA64EBD27BF5993CD4ECCFD1D1FC2 There'saLoveforMeSomewhere
914,146,990 *5F2C8CE31360E9C72CD434BA25ED589B9953D948 ZBOCZENIAMI4
914,146,991 *5F22C655EAE7D588DA5720611672DA670B64B78B THESEASON(ORIGINALMIX)
914,146,992 *5F298F6C06FC4895C45CD9F814724782B974786D THE.WALKMEN./.CALLA
914,146,993 *5F24118B5654F99E9BF26D707DC5EB328A529116 THE WHISPER TAMES THE LION
914,146,994 *5F202D87A2E34FA8E4BB4D99C36E2FB5349F2B4D THEWORLDOVER:30(B)
914,146,995 *5F2F68FC975F0F6624514CA6DA0EE5D145294F1B thgyclc8
914,146,996 *5F2929097A1AE3A6A8A03BAAC0A45484C84BF7B9 [email protected]
914,146,997 *5F2F58EE40FA227D60E2687C617C190087B07D02 [email protected]
914,146,998 *5F281AAB92EE7C67EBCCB09F40FE077296B9DC6D [email protected]
914,146,999 *5F2E5A41B3D7BE24A17690C7A6BEA72AE59915BB [email protected]
914,147,000 *5F230ECB8335BA0115DD2BD2DC34A724EAE666F4 [email protected]
914,147,001 *5F205A4E2176C8736015B1F124B0B843482B1E61 timeforweb
914,147,002 *5F294447432E91C3C720AD0EECEF90E853FE8EC5 TIPLESS?
914,147,003 *5F205E1B13D9D15819A364E11446A74CB4731D40 tjimbo
914,147,004 *5F27BC5AF389A8158FC395C9930E20860864C1C3 TOCQUYN1
914,147,005 *5F2335E53420C5B955FED9E1FFBE428C232C73DF TOMEN-EL-CAMION,-Y-VAYEUSE.
914,147,006 *5F28645DA0B611EF45525D6893C1E994F334B5A9 ΝΑΥΚΡΆΤΩΡ
914,147,007 *5F2271BB9D941BADD6B2B715A6E79B08B7C4F0A2 ολιγοβαρήσ
914,147,008 *5F2FBF05D24EAB00DC025D61145598354C05FDA8 ΠΛΕΙΣΤΑΚΙΣ
914,147,009 *5F2CA029CDB8898A485F76CC441786EBE6B9685B TOPGUNLOVEYOUED
914,147,010 *5F2D3920DA379068900C87B55B0898FB3E3EDBB3 topswarm5
914,147,011 *5F26C199F35EF988A4747979E6C23B888D131554 дійшовші
914,147,012 *5F2EC26D07AFD30E409C6B8A27BDCAB2B4962F84 ЛИСОВИЦЕ
914,147,013 *5F2AEC7063F4277481EFEE43EF7C0B2851E1E579 TRAVIS-DEMONS
914,147,014 *5F2649050D1979F27FA3B67C8809C0065A6776CF оберстрајт
914,147,015 *5F2100A04E0F5257BE79F84F84EEED6AC6D0F316 TREATTHEMFINE
914,147,016 *5F2FE0174C171B7D44334190A7AEE9930FF8C59B ПОДРЫВЫ
914,147,017 *5F2B12A5FEA82C9F6800A909D4DEDDF5CF2391F7 TRENTVIGER
914,147,018 *5F23664EF977C3E85F64509090E4F2D377D3F1D7 ПРОСЁГУНСКИ
914,147,019 *5F2D68EC7876DB7922573F9BCF254D1C990C4D4A ПУЛЬМАНАЛЁГІЯ
914,147,020 *5F2745A9E8918F3011501A485F0CC8C231A11659 Tritsch-Tratsch-Polka-op-214
914,147,021 *5F21B54264CE23AF2EF653DC4B7EC0EF05007CA5 tsggstn2
914,147,022 *5F2AD2A40956F20F2317A6748DE290AB3E4FFF55 TUP
914,147,023 *5F22E66A832088E3714B021387BC8D1BC10DAE98 twxtvs78oih3
914,147,024 *5F2304BC06BCB694F2E7F66246011CA15AD7FE3A tyronkepani
914,147,025 *5F2D5A4CA99D06614AF55F520DE23F4521120CB7 UCHEMBAVICTOR
914,147,026 *5F2F14604732A4A23DE0E5EA103A8612ECAFFA0D UDENOMRETSLIGE
914,147,027 *5F25EB7B2C8C627857262A043C5EB3D5EBABBA69 $UGEF0D$
914,147,028 *5F20858C61813B22BC3B4007E501CCCD9EEC4773 UNCOMMON.SENSE
914,147,029 *5F2D0D2C6531990E6F0507F0EFDCB6B1C1EC7BC2 undiganalu
914,147,030 *5F21692F62E946CBEEC2AC5D8BA7EA15F4A7BAA7 UNSPOILABLES4
914,147,031 *5F2C59FC9E4115985C1D1C150B4815AF027B3999 [email protected]
914,147,032 *5F2388EDED6A6B752CD53423436C43C25840222B 040MAPA
914,147,033 *5F23D027757C33CDAC0B775F82DE12690D5D8230 08251307
914,147,034 *5F235FA55AFC49084800E76AB114968F8C3A6F8B 1054318 ilkka.mikkola.essu.1.20.52.+31.42.33..
914,147,035 *5F2C23BCF14F313587F9F63738B5B9B4B7A7A370 10LASKEUTUIVAT
914,147,036 *5F2726E5A030556F3432664F0AF4EA0757DFF332 1198975 tourism-and-foreign-investment-are-expected-to-suffer-.
914,147,037 *5F2E587FCF0ABFA8F2B04A60E8588EB1D9790FEE 11EVELIN
914,147,038 *5F28775626852A0FEDAF3C67787F8D6E90869C16 1233668 sen-kompakti-rakenne-v
914,147,039 *5F27EB39BF572DD136BA8133BA70EDFB8B0E4AB2 123MILU
914,147,040 *5F20DA6072A03E30F86FF29ED10DA4A7CBF57DD5 1349270 muun muassa tietovarastoinnin kehitt
914,147,041 *5F23C11FFD1DADA82BC4D5866D491A9FC4F78B3B 1391404 kansas-(-7-)-_-early-edge-for-bush-
914,147,042 *5F2B1D5235E81EBF91A01A1A3E0C3E5BCF503A4D u&u:
914,147,043 *5F24725DDC24FB89E160413A8CE9A0BA626E4486 v1r91n14ns
914,147,044 *5F2B809DF5EC656CA7E05CDE27670B65663748EB 1619254 TAMPEREEN KAUPUNKI SAA PALJON KYSELYIT
914,147,045 *5F23AAFEE1654DD47441956F29802E803DBE40C7 1634936 eurooppa.on.my
914,147,046 *5F22C1BB5FC70FEFB2693A961EBFF8E64B550133 VAGOUS6
914,147,047 *5F26E956255B0BB31C1DDA67A039F0A3CB759DF8 vakraat0
914,147,048 *5F2C117DEE23D2B8DB1F865BF29450FC04DB6F12 1862830 viimevuonnaoikeusprosessik
914,147,049 *5F234E44DC0399DD2894E4651D98AA88791F2C40 VANNOZZAED
914,147,050 *5F2982553C82CD72628AC5E70425503FC7FA6766 VANSCHY
914,147,051 *5F229BFF3D0C35E14DA9C304FA68CFC779A34587 1ausgewoehnt
914,147,052 *5F2324E4EBB67588204D23D3DFAA05C4843E2540 1avohoitoty
914,147,053 *5F2C702D56D23B69176527688FE466EF7E6388AF VEDRAN BUKARICA
914,147,054 *5F220CC2FCBF0A082076A105D4BAF457C2EE0BA4 1BIKEMERL
914,147,055 *5F21154DE8CDDE3FFBB6D4350460FC413F013E3C 1-BILDGEWALTIGKEIT
914,147,056 *5F24AD05EBA7BE5DAC92F2E3DD48004377725FD8 vektordi9
914,147,057 *5F29EF30FD79173DE9331BB9B7C2A1B7E8B45C55 1DENLISTE
914,147,058 *5F246D27DC86F8A6018BD32CBF495D704729CD80 1deskinder
914,147,059 *5F22452653A7A72C65714DA4EDA0BE52BE5E6DB6 VERONICA.ILEANA.NESBIT
914,147,060 *5F227E1CFDE8DE60860E1624C13BAFE3037B52BE VERONIQUE-RELAVE
914,147,061 *5F25FDD43499EFF2612C96E034A50070ADD93389 1GERVATER
914,147,062 *5F28349FDBB8889541BD088882BD18680BF6FFA5 vigy-labyrinthe
914,147,063 *5F218662A3FF7CB44567C24AB44475317B1575C7 VILLA CUAUHT
914,147,064 *5F2DC05683D60437DFEAB0EB4B6731A905003CE0 VINCENZOCREVELING
914,147,065 *5F2B38DDDA4101E93842D757E69D7E3E38C10DC0 Vince.v/I/ns
914,147,066 *5F2B38FA951EF7D9E0FDEBF7542E10DB6AAEEF75 [email protected]
914,147,067 *5F2E788548AFE27E9E5D56379FAC6AAE8FC7C39B vishven-panwar
914,147,068 *5F2D9D9614682CB26ECCFCF1D0AFA295DDE4E692 VisualStudioAdd-inico
914,147,069 *5F2E499DD006BF5687E9228B53D8E613D67B21EE viviandomantay
914,147,070 *5F24196DAC190A6DCFE4CA43A30A9FC794BEAB5F 1kinderbuch-reihe
914,147,071 *5F20A81B9EFEAD5CC341D9EB8E6B3A26FF25DF2D VMA299
914,147,072 *5F2037CAB6CE93ADC8B13DE9636773A9234EFF95 1kuvakketta
914,147,073 *5F28157726F28E8D014C6D7E27C2B0E7E0A95637 VONNYVIANEY
914,147,074 *5F2D2475B5FA8A1DB06BBF59EAE5CB4BD3EF8F78 1merkitt
914,147,075 *5F2FE47E09378DA1C56D79F34A6BE0C3B2752E0E VSTENCILLED
914,147,076 *5F2F6D28CD2B5505F719610D66679DF7BB29C2AD 1.PELLANDA
914,147,077 *5F2A5C5767626008A863EDB233B3EDE2008B9F65 W12汽车发动机
914,147,078 *5F2FE29537E90960F31D7104FA39DA020B363014 wai.chiang
914,147,079 *5F2CF7FA6B30CFA0D0FBC029BB1FA4BD6F684CB7 WALKER.SCHMIDGALL
914,147,080 *5F254364B08AD4115AF130CDADDBB7BA2A3FA924 1.sehen-und-gesehen-werden
914,147,081 *5F2563AB44871200273148833C2A937719238D34 1-SLEEMAN'S
914,147,082 *5F2D59A2533994E30C7D57AA12AE9F2C239C214A WALT_12
914,147,083 *5F25BE4B665F4F4CB83259068074F809C1D487F5 WALYCOATS0
914,147,084 *5F22EE0A23C588B5C4DA95E22AC33AE140FC5DD6 1TAAJAMATRAKTORISSA
914,147,085 *5F20500806F3E58E1532D0C954EB5375520C587D 1-takarenkaansa
914,147,086 *5F222EE93D12E4AB25D38478E47D729E1828E33E 1-TOIVOTTOMUUSONKIN
914,147,087 *5F259201D1AF3811E65D6B93B135238D2CC165A3 WARDTROETSCHEL
914,147,088 *5F292C8444A2E09E24C7C979C28A4EF7719D2964 1 TSLTUKI
914,147,089 *5F2A717961CE0A2C3B0167DC4DF5F849F9B90792 waru.hanayo
914,147,090 *5F2B79B7BF09BDE51EBD0499C029370AEFB1000B WAYLON.GIFF
914,147,091 *5F237CC58D84D22A83B9360AF53866E1423E9A77 1-zulfiqar
914,147,092 *5F2A90CEEF6BBC706F02AF3ED0465A56132F173B WEIHNACHTS-ORATORIUM,.BWV.248.(AKADEMIE.F
914,147,093 *5F28E12768771B33AD887E7E392B4FE3FB199663 wendybetita
914,147,094 *5F2CF5C1AE11321CFB4EF74EB0E5AA9DD9699FA4 [email protected]
914,147,095 *5F23031F88EAB85588137CB36D6788AF22F250D1 [email protected]
914,147,096 *5F29E412CDB647C01A114B4F52CD80885075A633 2209059 " THE TENSION LEVEL IS QUITE HIGH .
914,147,097 *5F20A89D56DA097A6956BB3FCAE57C2654E65D99 22JUNE1366
914,147,098 *5F2C4D83C72F38C05C250DD2622077B070B19F6E 2461977 president.reagan.on.sunday.defended.the.decision..
914,147,099 *5F2325B4ED00C0B1528AF9414F1DE582B4CD4BDA 2698210 KURSSILLA TEHD
914,147,100 *5F2115FF95F4416FC62CA25E2970DC3AFC0BCF58 281828 privathattenwirwenigkontakt.
914,147,101 *5F2F1554FAC0C5BB6B2AE86D648507F69F3C6132 wilberkendall
914,147,102 *5F292B09F1E325CF58A988E63542D5E3C8DD414E WILBUR.FUNCHES
914,147,103 *5F25F483D31640EDB2095FAE47A34F865D0AEEB8 WILDCATLAKOTA
914,147,104 *5F23EA0601B0A3CB867249A9551E30C3EB9ED1D8 willianbalwinski
914,147,105 *5F24CA6BBCED75B0E679ADD95869CC364C47DA05 2DDFSNOW
914,147,106 *5F2966D7680C990389E85E61BB0DCA1E85BD6220 2EKILYELS
914,147,107 *5F21D5B9CFA56B4A94974A594991867CE3348B90 2-flake
914,147,108 *5F2EBE164F5C9A93CC41AC0D9BC6A48B2785E975 WINDY-YOW
914,147,109 *5F2E9BAE7465C9F28DA85F151CA0D829DD142F93 winfordbiderman
914,147,110 *5F2DA1C2F60FA3E678A3E5B61636AB44A151EFDD 2GIRGASHI
914,147,111 *5F2C0AE0639C240C9F96E9219CD3306DE0503828 [email protected]
914,147,112 *5F21CFBBFE80F74A348930F0D5AC9F33ECD91B50 wmwilborn
914,147,113 *5F22A606BD63C705AF61577EA7C42031F44E00F4 2.murentamatta
914,147,114 *5F29F6865D5738A1175495E07F8943388580361E WOONMOMO
914,147,115 *5F2A11428ED600B874E46BA2389F5FA0D449BA3F 2-rommeerunde
914,147,116 *5F2A85A818FB97D6D31873BEF517B2F75A47A990 WoundsofLove
914,147,117 *5F2D73EB281850BF1376AC1C934B8E0BE2567ECD 2TERSINE
914,147,118 *5F2247EC85842CDBD64786CDD56B097968C18D47 [email protected]
914,147,119 *5F2474A78512E8C5C1FEECC5C077E7687B6D88B5 2[[User:Zarbon|Zarbon]]05:35,7January2009(UTC)
914,147,120 *5F23D72C4423D8ABC3DD00CC49AA35A0AD7B5414 2-verarbeitungsbetrieb
914,147,121 *5F28DD8A92BECF276B6C6BC8DAAAE519602CF885 WURUZONG
914,147,122 *5F2CD271029EB315F1BEA1A64A48322B1BC28EAE 30-h
914,147,123 *5F2E3BF4AEC4F4346DFB5C3CBEE328C082BD1824 38045 insidethecubicle,thereisnothingtoidentifyhelm.
914,147,124 *5F2EEDBFEE2600664EECE3C5DB53FD9A8E5F3CCE WYLIESHIA.ROBINSON
914,147,125 *5F29510847A8E8D98EBC0EE7821B012F3BCC5594 [email protected]
914,147,126 *5F2C7AF9E78972071EBC70DBA94FE98A9EF5B2F6 3AKARABINIER
914,147,127 *5F20BE0C43A52A920745E89CD93A6865E1688117 3APLEHN
914,147,128 *5F2939DF7B71CC3B915E7ADAAB78FF806B3AE5D8 xamogelo7
914,147,129 *5F2957360006B30819D5BEFC58BF64E30164EAA0 3iluvtool3
914,147,130 *5F2D38890B2698A03AD74672C2CBD975C3502544 )X( O~ O~<#####P
914,147,131 *5F2820FD89B38637111D2258AD4192B61108E09F XQ)#
914,147,132 *5F27660C43649ED03CEB5A3C4C0E2CC9061D0B42 [email protected]
914,147,133 *5F2CBFA080F776A52FCE90A2F9598770FB6ED92A Y136109
914,147,134 *5F2912DA56722005652350CF7B2208AAADED6A15 [email protected]
914,147,135 *5F2B9D8BE8AD122611969E9C17F61312F8A6DA08 Y4GYU
914,147,136 *5F25E1D1BD327DE30DB0D3E31830BAAB6C7AF094 y79rek
914,147,137 *5F2CD12A6B36151D8563DDF2D0B1BFE2A402908C 3SNORRETT
914,147,138 *5F29935F0FACDBD8946EDB2FC56E63F8420AC1D0 [email protected]
914,147,139 *5F28D37803724B7365A56BD1838F79F35EF39A0B yarli.namdev
914,147,140 *5F2D82E211690BAA795DCC3ADEA70A4ACCCBFD37 43593 KIRKKONEUVOSTON-J
914,147,141 *5F21B90C648930F04E1BDE0D5311C3AE2A9B8E23 473NIKOLAI
914,147,142 *5F23B4AEBC0FB0976A7A86E01150E16FBBA0F107 YGT&
914,147,143 *5F2E7A7544089FF737490401E81EFD199B627635 [email protected]
914,147,144 *5F2D8D938A09993AC7C496EFB94C39ADC3123777 4INETILLE
914,147,145 *5F2D1E5418AD93C30B9FB545BDA9171A77930C56 4L3URO$CO
914,147,146 *5F2059B083135BC813A9823FFDE0E073906633A5 YPAENG
914,147,147 *5F26C6D4576B33251A7A063BEF0037EE549BA211 ype
914,147,148 *5F2C91BD744945DFFB84E1613AA30725A61609A6 YUSWAN.TAUFANI
914,147,149 *5F28297840521943F35552017A3AB5B57AF49A91 zachariahmeche
914,147,150 *5F221CC9300EEEABD40A86CE4981E624850800A0 4-savunanlara
914,147,151 *5F229CF1F732278AC8668405D79D5ACD90054EDB ZACHARY.SCHLEIDER
914,147,152 *5F2FF5DC431FC88D2E3F2998FDBF2F0B72F5329C 4SREGREV
914,147,153 *5F2B74B6E98FB0CCFE43A5341BDA4160AB19403E 4SS3V3R4SS3S
914,147,154 *5F2BDDAD179161336E5B92ECC4889B5B31ACE210 zahrachairunissa
914,147,155 *5F25A0E2255A2E0FF9A3DA329CEA070530D0CE45 4TARGETBUCK
914,147,156 *5F2B36BB12B97A28048ACC380EB0B7AA3C90CBCF ZALAIBRAHIMI
914,147,157 *5F29201868451B3C8839C1519FA9580B1DE1569D 4VANLAPARRA
914,147,158 *5F25F9F562AF5818C421484F56B0608F18993313 4VNANIMATED
914,147,159 *5F24DC0C1FA1E74AF49BF42FE2CBC8B67714D61E ZDEVICEBSW0
914,147,160 *5F20E9C1D337E076A9602452F46F140EEA7585BE 4ZAMIJETILA
914,147,161 *5F21A663B3B8CC9F33D73F6CDA183516C91E692A [email protected]
914,147,162 *5F23DD1AC9938FFBDC9BDB96C9E724C32B1DF170 [email protected]
914,147,163 *5F2F61B707131BFA03F4A78641DA10B274502DFD [email protected]
914,147,164 *5F2B72745463E489B0FB190B00A4D9E5F0B20AE9 [email protected]
914,147,165 *5F29282BA4455652E14F09835AD3DC5FED8919D6 5COMPRECOR
914,147,166 *5F2684BB0849289E82039010880030DA69BB41F6 [email protected]
914,147,167 *5F20F61FCC1992EBD7AD05F4DEA8E0967D6A836D 5DHAAA
914,147,168 *5F2702E25B9E1CB4BEE8D9F2BE87D6DFCA12C8B0 5ELEGIERNE
914,147,169 *5F2926C43C01A6C8454F55DA17AD8AB721D7A97C zpdwovxo06hk5
914,147,170 *5F23F6DC4B1A4A6354C1185AB7647418861ECC97 5j3is4tjb
914,147,171 *5F2944CD12E999E3E6A96651796D6BA609F47200 5KIKAISIN
914,147,172 *5F223FB89BEC3F831800E58DBEF5863FE690E981 ΣΤΙΒᾺΣ
914,147,173 *5F2F5C6E3EEE21365B8FDECBC7C649DB8FF5CEC0 χαρίτωνοσ
914,147,174 *5F244CF4898E4D31FA5F003CE3080E5ABCA711CB авере
914,147,175 *5F2306DB879CEAF818FA9277F6F61C72831AF9C0 ДОСТОЕВИСТИКЕ
914,147,176 *5F2F9B0E0840AA1D81A6987D2838BA5D3FA52679 ИЗВЕТРИТЕЛНИЯ
914,147,177 *5F2B7E400FB989A7DFAE5891231E6042CB35C2B9 КАРАКАЛПАКИЯ»
914,147,178 *5F2172F13F830F04A8C81623AA399D4326F816EE 5surchaufferiez
914,147,179 *5F2381EB3B19541FD9DEA651BAE57DC870D2F7F8 новосанжарс
914,147,180 *5F2A119704F5FFD68DC170062035181266F3F4FC 604MADALYN
914,147,181 *5F2EC3B32D7FFAD8576D155AE8F493E4F44BCC7E 630009 NIKON MUKAAN IHMETTELIJ
914,147,182 *5F2D0D690A9ABB97205E5C9D70234B228C8D265B ПРОГОВАРИВАЮТЯ
914,147,183 *5F2A035F8AFD97A18019F4363DA79F7C3769D4C9 ПРОЗВЪНТЯВАХА
914,147,184 *5F282614E7485A3F17C63E37100BD66C9330857D 6EDLESNOREG
914,147,185 *5F2CD3A22C65BF98B90F7857DFEA25B606EA9975 6HGUOROBS
914,147,186 *5F2D7BAE21502A81ED3B83CE85344CE63D6A48A4 6ILOVESUSANNA9
914,147,187 *5F2C9288314617E30C9A2CAB73DB70FEF0F49E1F 6NIOBICNIOBIC
914,147,188 *5F239FF6261D13A254709E8B4602F182E89CC935 6NONIMPEDIMENT
914,147,189 *5F222EAFB9ACCD33889CECDA1CD252ACBF461F3F 6OSEBUJNIH
914,147,190 *5F2F53F5BCD7FB89F2D56CD8398DC166F2C3DA93 6OVERSLOEGEN
914,147,191 *5F22E972305930682598D941AE9F241189994EF1 6thatandy6
914,147,192 *5F2D10EAFFEC18A45CAF0AAC1E3ADD659399585D 7:7#&OPPROBRIUM
914,147,193 *5F29870CF764D7EEF58876B24CD8C6CE6DE25D3B 7BANANESPECIAL
914,147,194 *5F2C4C0FC3A083A03412EB8B9CB0254A016176FC 7BSWYROVIBSW
914,147,195 *5F2AAB549A5A6993BE0F5DA72DD07F5FF2350349 7CONSOLERAIENT
914,147,196 *5F2BB82D1133F4B5988C966FA6DDDD51C331D409 01771I5HN355
914,147,197 *5F2BC3BFFA2803B2AC7CACC3960185BE2FA8C51E 7IAMJACOB5
914,147,198 *5F22C007ECB68BA01999A51AA5C5710530B20E37 7INFRATUBALS
914,147,199 *5F2B62C97E50E01D6D7CA9859A35A15E26C804FF 7OWNDEVUNITBAS
914,147,200 *5F25A995920B3A4BC24E7F5FB91F1A7D5EF23BA6 7SNORIPAT
914,147,201 *5F238A612298EE0A15984BDBD08A555FCF6A7C30 7-trampolining
914,147,202 *5F269BC594F6333A5F0CFCA926F17ED4A9969D5D 106316 arthroscopy14:5127,1998.
914,147,203 *5F285815A08EC47AA9F01993F2DE5823897EDCEA 1097893 VESIVAROJEN HALLINTAA JA VEDEN K
914,147,204 *5F2EB1F96AEB460E5DA9A68AA6EBD865236071A9 [email protected] ~0~O SPLAT
914,147,205 *5F28CAF0D3E869A65D11997734CE1FA787409584 1258901 PERUSKOULUNLUOKILLE1-6J
914,147,206 *5F281D54E8A5F8B9D7301CD8B2EBFED536315570 8BEANERGENERAL
914,147,207 *5F20233BD90B3985E6ABBF4DECFBD5CE35A24CF0 12ccco2
914,147,208 *5F2D422D00213A8E8FDB33C815328D2C2B06B391 8BSPRISERNES
914,147,209 *5F253FF9EC8D1F126D87CCB051FA1F5B6B157D62 8CESARMIMI
914,147,210 *5F215810204DED19CE31FFF0CB408F9B6D3EACAD 1430444 liikennetilanteen-mukaan-suunnattuja-tiemaksuja-pidet
914,147,211 *5F2E408CBF17D4404E2C8A317AAF2B477794A5CC 8##D***~0~O>B0
914,147,212 *5F256F6597993472C3AAEB3F0E914255EE59B336 1485212 THEYWILLNOTATTRACTTVCAMERAS
914,147,213 *5F21DAF16333517C1B92B6723D3920F6E87A014A 8DIXIEROBERT
914,147,214 *5F2BD79A0A089F3570BB31E888944555A6FD09EE 14.programmingvirii
914,147,215 *5F2A7D352D38E128563996ACEEC82B8EE5D3D8B8 8ENILLAHTA
914,147,216 *5F234B0F693D041F98CE671B07FC82B09A5A29F3 8EUTRILLA
914,147,217 *5F2AABDFC05B5DDEB0E5151083011C2706990FC3 1603226 american-lobstermen-are-boiling-mad-.
914,147,218 *5F29DEE3A123E47E834ECA8CEF3B4852459A5A94 17081952
914,147,219 *5F202056F58E5F9B080AAC046C61C69C024AA3B6 8ISKMTTNN
914,147,220 *5F223229DF3E4E16DC47CF5746EBBE42DACE05E4 18OCTOBER1437
914,147,221 *5F205256EBB23DA8B32E64D4C0291B1C9065E550 1937081 SAMALLA.KUITENKIN.S
914,147,222 *5F2A3259390A1802F2A646B89E4232192E3C49DA 8MMADOSSA
914,147,223 *5F21F16659894BB82EA7E74434EE9F593FCA7197 1ANIRUDDH
914,147,224 *5F28B7E4F5CF432A8E682B43E102C61384464A45 1ASTREIGNAIT
914,147,225 *5F26F1B51135B08D1C8C02DC6D5BD20F236CB5E8 )8(-~-~-~-Q==8
914,147,226 *5F2DB1B59584303840978557C77931301671F9A6 8SLACKERXXXX
914,147,227 *5F26D72D4AAD85B8CD6E4FEE710C7045E0D0A9BA 1 cityvalley
914,147,228 *5F2A161A6F70B7D8B274B13DDD3D6641083B47DC 1-dll-kirjasto
914,147,229 *5F209C021F5FC247A9A0C427AD71CCA1AE7F40B1 1EMAKDLEM
914,147,230 *5F2E005E6A76EFF7BE39752BF4233A8ABCD94580 8VETHZAIDA
914,147,231 *5F254264CDA81D18D6AC7098FE681B18144C682E 957978 +DET . 1994 UYGULANMADI BOROVA INSAAT A . S .
914,147,232 *5F2B9D908663B29EB5330B1DCC86FDCAF8704C3D 99gOrUlmUS
914,147,233 *5F20D7AAF9A141446DE11B34DF35F2F434061B36 9a04eedb1238f933a15754c0a961958260
914,147,234 *5F23F41DF4FA36FF48A462C647DD86284F2E9FCD 1 HOMOSEXUELLEN-DEMONSTRATION
914,147,235 *5F2F6C4143AA5A492040AC292B1E045EF9BF1DA0 1ILLEBROR
914,147,236 *5F2B291758ECFD28788BAE06469B755045240F05 9BSWGOLTZBSW
914,147,237 *5F2C68F90D354CBAA0018985C71298D7CE2E67A7 1.KRIEGSHUND
914,147,238 *5F2AF45D93147ECB2D41AFA6B34B6956B599C01C 1-liittytiv
914,147,239 *5F2383F2532EED833B512FA7DFF8FEBA42B3A44E 9GETPKGVARBSW
914,147,240 *5F20FC4CEE848ECD40DF4EA7D7CD586BC8A50522 9HENADICAL
914,147,241 *5F235E4690931C163D1EBE736D60A9345E7D3FFF 1MYEIGHT7
914,147,242 *5F25B5F0B7CFAC0FB8CAB6BD126CB0915E9DEC32 1-NIEDRIGMARGIGE
914,147,243 *5F2CCE65005C74DC1983E51B074C24390B3E7D9A 9l8el5tx
914,147,244 *5F235A5597133BE999EF3AABE6C31A6A5F37A87B 9MOCLIAMTOHSCAYAJAIDNISCEERHSAYAJ
914,147,245 *5F2A3B4FFB865B6348E52EC089CF5EE126F26356 9NAJISTURENIJE
914,147,246 *5F283348E9DBCE990801EDF9F4E755A932E881C9 [email protected]
914,147,247 *5F21B83AB54DF298CBE017639443E535C8D0E9CD 1-SATZUNGSFORDERUNGEN
914,147,248 *5F2275DFB8AEF3A788B97D0F3D93517B6F4C4DED 1SCHUMMELCHRISTENTUM
914,147,249 *5F2E44E8C454186331BDBF90DE674DA38455EDC4 1-SJP
914,147,250 *5F22A16E5053450A9917FF4C3ADD5F51A681CC55 9UNDENOMINATIONALS
914,147,251 *5F2F768840C749B82F2B83F6DFCBAA7D58863EA6 1-sporranful
914,147,252 *5F2B9EECC11412424F5E44D2F75B00B74031DADC 1 TEKSTIOSUUDESSA
914,147,253 *5F2CF6015B0AFE9DA45B0C0DA666B34DF5B0A01D 1.VARELIUSTA
914,147,254 *5F207763FF75406914BF0A14FD93169C11ED5AB0 a-%2n
914,147,255 *5F29E1C33448EB42F7E477D09834830342C04437 A3AP
914,147,256 *5F2E181C5A2CCABF3CB7FB28DE7864DD4883A9ED a4?ig
914,147,257 *5F2D31E9BF0C12F99B3840106DE008C5DC0AA70D a6-da
914,147,258 *5F2C9B78C389F955001955FB301A61617CE9C9E8 2145609 THEMOODAMONGDESIGNERS,HOWEVER,ISUNCERTAIN
914,147,259 *5F2121F43FAB76735A645A0D5EC4FECE005D51CC a89u?
914,147,260 *5F25A6DF5E39A6AF514C42889621180D2AF800ED A:8GP
914,147,261 *5F24D0496F1187276181967996860E7533057217 23-09-1648
914,147,262 *5F21E037EEFFBBE56A6B3C4AC4EB9BBD814E0755 2409479 SIEWOLLENDASKORRIGIEREN?
914,147,263 *5F2210DA2E5C2B77A7BBCF910EAA837B661BAB0B 24MARCH1541
914,147,264 *5F2AD4F81DE2368DAF9EA952959C65507E732E27 26AUGUST1309
914,147,265 *5F2F5871827EB4083020FA698D2A09864D0B4910 2920944 ILMOITUKSENVOIHENKIL
914,147,266 *5F2C74E0694A46E0D02CF354E19ADD41B3150004 aacRt
914,147,267 *5F2A230F03D748AE36D6BA1BD070B23ACEEA9D3E AAD_)F
914,147,268 *5F24BBC7A5555C1F1A8F488837C9A59728A109A6 aadmrs
914,147,269 *5F26A2E62A5A663E6A93D3ED322B819D6E5B11B0 2 HIEKKA-MATTILAN
914,147,270 *5F28ADD8DD0A91FF3253155E7CEDD23FBAFA0AC4 2iluvpioneer4
914,147,271 *5F2A0738785666E47ADB25CC4ED46CA4B3AAACDD AAVLL
914,147,272 *5F2603313D144320B1E0465B029E70D80C3A40CD ABA:]
914,147,273 *5F23C119F225752DEE130F6E3A7A415D8819B04A 2MEEDANS
914,147,274 *5F23369F05962915D35550497B7A7DFD9F335443 2PHEGRET
914,147,275 *5F2C2E81DAEFD772538BD9E4E07DD4140DF4E069 ABDUL.DELZELL
914,147,276 *5F243B68F3953F0C33B32674770A3A07C1A7D239 abellebas
914,147,277 *5F29AD1F98BE93FD87E26B112CFCD81EC2C4B8A3 311vera9692x
914,147,278 *5F21D720DC50C0991DFAEF86B3510F19612092B7 acanada
914,147,279 *5F28DC199183DE24EE5935A39729867FB5F2FB90 a)cw
914,147,280 *5F26BBA85CF03C1999DDE69A7FB89A3CDB1D6587 3INGAMRTA
914,147,281 *5F20A5C33B620E27AC8E5C618E35FE81D55E5861 3NTRYCTS
914,147,282 *5F2F628744B59D8B83D7ADB68AF34472C7409EC9 ADNWALUY
914,147,283 *5F2D8502761DC021BDEF1F8C2AF967FEE81E96D7 3#####p.*.*.}o{
914,147,284 *5F2AB02EDEF08236551F37A54F49BB4FC7D5CEA0 AEGKR
914,147,285 *5F2313DD09F420C8B2615D949217BDF6413846AD A#EML
914,147,286 *5F25092009D682F3C3E339F8BA73D5E08DF4C8CF 4ep
914,147,287 *5F2D1A540AC950BE0A56AB691FDD78E23C6A180B AHE_N
914,147,288 *5F236B818DE6265430AE53B0F72D50352857AB6F 4PDONHAMBSW
914,147,289 *5F2F119467648D980B5C54EF1A1772798F33FF9B 4PICARDCHRISSY
914,147,290 *5F27A0481FA10628925CE308BCA9F532578A6199 ajnhd
914,147,291 *5F2507B35E7F1BC0DD1163FBF37A9E5B58D3CBF5 AKTURERT5
914,147,292 *5F2C73A9559FD491D23A98B8B7B5DF16B11B3337 akurg
914,147,293 *5F2097CD906B4EC610883E4FE99145788684BD80 alcaneal8
914,147,294 *5F2E0F2980844C88B2E7AC75202193E59F5A14F0 ALECDIRKSON
914,147,295 *5F211EEE46E293C0B1AD963A5D05F527728E13B4 aleksis.kivi:.act.ii.."sinne.se.meni".(ahlqvist)
914,147,296 *5F2FF3D65FC7CC1CBB7AD683565467D3ED8BF55E ALEV"
914,147,297 *5F2D6B1C7D4382EE332BC2B06C3977E79367E3FB alfredopeasel
914,147,298 *5F2F99DEDC866D9F24BA6E4858A9709122D18748 5CHARLIEEDWARD
914,147,299 *5F2C2EB9B95254379067B654886F96043AF7A945 [email protected]
914,147,300 *5F211A82AD3AD8AE406BBE2EA25B7F1E5B5EAC4F ALLAN.HACHTING
914,147,301 *5F2A22340BF5A5740506BA44E96B0C9256F5A0C5 ALLEN.HOBDEN
914,147,302 *5F2BFC0FE3A4679DE662F053E6EA0B807C58F7A1 ALLERAUSUD
914,147,303 *5F28F3E94078532E369DDB3D0FD82883E4D0217F 5FELDHERREN
914,147,304 *5F266B2522DE4245D4165E10C8B4AC60BA4AC8DE alternator,coolant,antifreeze
914,147,305 *5F2D551A0D20C41829F11A84C79C589170401C0C 5METAILL
914,147,306 *5F2793DD2035CF1A1969156C07BD4CD54315430A 5MITSVAH
914,147,307 *5F2F90AD309A499513EF07163FB148A591AF57FE AMERICANPHOTOGRAPHY
914,147,308 *5F25C45B19217465A8BC24491972EF229258DE93 5OREFLAME
914,147,309 *5F29C201DBE7D5BEC6C820BAA0BEA36DF6E89BD5 5OSAKEMR
914,147,310 *5F223CA0B9747DEB67EF9228FCB93D7161FA1077 amjelica!
914,147,311 *5F281C9DF71C4B68ABF76E49C4948AE827F95D34 5preacknowledged
914,147,312 *5F25C7F8A351366EF6FDA839D51B6DE9341B22C1 5.RADOVIC
914,147,313 *5F2F2EE3EF7038F7B9C0050C7539382BC2F551C6 ANAGKAIO4
914,147,314 *5F2841B98466F024DABFF32251BB64ABDCD82007 5SOPHIEOATMEAL
914,147,315 *5F23438EF93CFE9078A143803605D0248CE389E0 5STEVESHELLBSW
914,147,316 *5F2ED63F54EBD1D81294F6B13F80065B8B3C9C5E 5supercivilised
914,147,317 *5F22074B0112FDB95A2334D5E7D9A2BC3E99D9BC 5TIMBERYA
914,147,318 *5F28EEA6BE1C763A3BB33652A10D4C5D0EC23D8C 5TYSUHDEAUTOL
914,147,319 *5F278B32ADF340281E65834EC6A37F738810138B angela 2
914,147,320 *5F28413FC7F5313C96C184B4A67E3FEF487A577E ANGELMUSCENTE
914,147,321 *5F2507D6FE7AD8ACB20B63297FD0F1755B289DBF ANICELITTLEEARNER(1)
914,147,322 *5F2EE867B88A3E2D5AB27B255905D847E09A6E01 a?n=r
914,147,323 *5F224BE5FA83626A7D40BD1FA5B558763B0BD923 ANTBM
914,147,324 *5F24420D16D8BD7B3EF5FEAD90FD19AEA6A82C2C antoniogadesballet12
914,147,325 *5F213DB39489CF5E663AD4F5495770F6CED426DE 6EACNODE
914,147,326 *5F22ADBC24F92A8E15E4BD535F6AEEE70DB2F06F A-O-FONOTI
914,147,327 *5F2DE796106863740D42D1946F32B76D5ACA2BF2 AO;MC
914,147,328 *5F292969987DBF300C115B4DEEBCB8262200E02A APETALYS6
914,147,329 *5F2971C7F51D0E9AD034306B0C331473E74786CC [email protected]
914,147,330 *5F2780F5F8784BFBA73098979B51D639B3A20113 [email protected]
914,147,331 *5F20DD7C78F20294A763720C5C305E8A3A88985C 6MARSHALEUROPE
914,147,332 *5F2BA26E2834A7D3C1967D1A8D2CF92B0BB7276B 6POCOMCHI
914,147,333 *5F2A7E52B712E2AA7BB04D313089EFE27E8694D6 6TABLERAINBOWBOOKS
914,147,334 *5F22CD4AD643A92466FD931A44B26B5E91E85225 6-TIETOLIIKENNEVERKOSTA
914,147,335 *5F2A48B9149B7277F71FB08A3CFD474E4EE96583 6VYLOUPENIM
914,147,336 *5F265DC30DD1708900A0DC18824BD4D5701AFD93 arnoldlekas
914,147,337 *5F2A39595F54DC55E6F7D2A3E95BFA93750D2F37 ARNOLDO.KLABUNDE
914,147,338 *5F25AE76FB1B74C5D29033C8A14351C1704F602D arnoldomaybury
914,147,339 *5F234BF669E77CF30D7A61E97AC04A0254D92D65 712JOY
914,147,340 *5F264A33B8D25C330A7F9FBC6C559DBE1FF7390D arsenopyrites
914,147,341 *5F270F087971A735FE2665F66548A2EFD1105581 7BRIKSTENENS
914,147,342 *5F2E1D900CE8FE9E722EF3BA97797D631B4135AD [email protected]
914,147,343 *5F2B910251234D01097E7670B0BA7B0C2C8262D4 ASSBA
914,147,344 *5F2754B8BCD26A101D8EE157AC17862C62F00EC2 ASUZANI0
914,147,345 *5F2F538E7A280272AAF2B11E6E0986122390372C 7.holzspaenen
914,147,346 *5F2AB757556AA7215EAEDA72AA0C7713D526905A atheistbusleadstofirstnonreligiousversionofthoughtforthedayonbbc
914,147,347 *5F27979091610C288CDDD413810F38C7605B60C5 atoofi
914,147,348 *5F22FF60D60189D28B092F0C815EE5E5A92D2671 AUSTINBIONDI
914,147,349 *5F2F434C6A5999F2A2F6D4F8322C21481F7E9250 authorrobert
914,147,350 *5F25D36E81C8E13916CE417BCC0DE82950CBDCAB avssv
914,147,351 *5F2521D2946EE29F0C6D3A124FDA2475143CE0EE 7YLAIUBCPHN
914,147,352 *5F2BFF8620BC9669D7B798E7D0BE96260B62724B 836695 isoiivari.oli.hyvin.kotiseutuhenkinen.,.ja.h
914,147,353 *5F2FBF13C81FB586DFCD01A8192FD6672A8E283D 842DASHAWN
914,147,354 *5F28540AE0553D2DCA1499855756ADB56AD8AFAA 866168 ONKYSEYHTEISKUNNALLISESTAONGELMASTAJAINHIMILLISEST
914,147,355 *5F251BB37D25346268E45E687C164B2E3EAEEF3E 8BASEBALSHIT
914,147,356 *5F212B9AFF70DF8E1585AA123889DEE8F9FC8DE8 a_wmh
914,147,357 *5F2C618BE77A8ABFF6C769A89D00D375E8FD741F a-z"!
914,147,358 *5F2DD9462E1DC483388FE8CCEDF23E22FCA34557 8F1A0892B4C9622A022ABA52CA5F4D53-4556778
914,147,359 *5F201E0625E3D29183B512A7C4F9500B4D6B8C25 B)`~(00)
914,147,360 *5F2C5340DCE8CAC2312015E80B9CA194F680B761 b1o+e1eme+ry
914,147,361 *5F2415DD76FB107129D0CE83D33AB868DA433C1B 8MAURITANIANAN
914,147,362 *5F2B75FCC1E5931F740C715F6D85A2DA6064B957 b23j?
914,147,363 *5F2B599F9B563AF63B54B4EF4E4C27679AC2ABF2 B2%L
914,147,364 *5F292F32DF5A2C2911E032A521F76CA213B8B011 b3digh73d
914,147,365 *5F2C453BF7FA7E92436061AB056F33FA7EE43D83 8PETUNIAMIKAEL
914,147,366 *5F213F4490829DDBDE95DBA8561BF156CD1A9354 b5a/j
914,147,367 *5F2162D36B3DF37772DEA3298B010E299A65618C 992483 size.zaman.ve.paradan.kazandIrIr..
914,147,368 *5F236E748BDB415914C5ABBA66636BB61F917771 BANNMEILED
914,147,369 *5F25AD6113181E038581889160C8B9AB0D200197 9ARCIRAIT
914,147,370 *5F2D5DD96E108B50E9109A28AF61E3242CCFE89E 9BLOWMEPEACHES
914,147,371 *5F21B36D32855DF83A652A1B6A62BF4D80728371 BARTSTANSIFER
914,147,372 *5F26B927ACCC51CE19F2A33A0CBF4CC29C940E89 9CYCLONE2
914,147,373 *5F21388DE25457941DC6F7389D918DB18B43F48D 9EKILKLAT
914,147,374 *5F213B41FB78ABD3E92F31331D0312045217279C 9FRATERNISATIO
914,147,375 *5F28D60139871F9CC0C297E5703B79E023140BFE 9ISPLOVIO
914,147,376 *5F2B603A31E8D2F3572DCD56B9E74F1D64D86C42 bcd
914,147,377 *5F2B948F57CE48D7E06903D29787F0058CBEF459 9LACKYNGE
914,147,378 *5F21DC7FA31615AD4B500FA9C803950022E9F56F 9ontlasten
914,147,379 *5F2EDD676D778D7A3B1CD38CFC61255236B1DABA BEANIEA0
914,147,380 *5F25504164EFD2A4C4A429CC505FAFD076A23B59 BEENUNG
914,147,381 *5F2CEC98A1F9523189643B567B85CC36FAB1B064 9thecorky9
914,147,382 *5F20F700A1E3E6E2FC5CEEC8D7F3B95A1C4CD11C belegarztsystem
914,147,383 *5F201EBBE09F9FD933D11B0D04D0868D1C096BE3 [email protected]
914,147,384 *5F297B967245CE01465F927452FC9FF2E54EFB96 A3AP
914,147,385 *5F2C101B3F4A155CD72154AEDB6AABBFF2F19ED7 BF(8-
914,147,386 *5F23255F788F022F0E8DC091C071C5CE021CFC5E bggnk
914,147,387 *5F2504B7D54D75418B0F465A3C58266B7EEA751B a+a
914,147,388 *5F23C2401DBE14B6A850838185C339D0419895EC AABO1\
914,147,389 *5F2C72F37AF7F487EBF91CCE9461442903CB9A4E B:ILC
914,147,390 *5F280A8C33DA36CD5703022380982FBC00078208 BIOLOGY-INNOVATION.CO.UKWWW
914,147,391 *5F2D7B81831978EE3560008DB6998CB6C18DD64B aadwxf
914,147,392 *5F289770022DE88B92ED6D5E160B21A647875041 aah6$
914,147,393 *5F26ED30878BEF371334B9C906AB6035DCEC6D27 aappears8times
914,147,394 *5F28F0BE2A1C802AE703DA21FBE7016332CB390F A-APPEARS-8-TIMES
914,147,395 *5F29C5F0964BAD859FA1FAA565C69499CFF9B48A aav8b
914,147,396 *5F222A06578605EC1E0E49047271BFD3BC38C492 BLBM
914,147,397 *5F28B993507E31EBEF080644E49ADC1D9FCD6580 bobjasa
914,147,398 *5F26B02845F8F3AC490291E979F9C5385D31AB76 ACHTERGINGEN5
914,147,399 *5F2829D91270EDE242B5D751072CF32F28D2225B B====)~O-~O}8{
914,147,400 *5F208426B57395926EA82CAEFD1E9C3CD3622889 BOOKERBALDWIN
914,147,401 *5F2B5C9A08A9E5AF018C1186B4D83A6A84A1EB74 ACTNW
914,147,402 *5F2D3B88E9388979AEBBD39F952CF3AF0C4263F9 bqpdn
914,147,403 *5F2188B4F466D5034CAA422E6F88D67CA1856B06 brentspann
914,147,404 *5F24C25993D987EB78C2F46E62030EBDC54B6A47 bretgekas
914,147,405 *5F2ED95C4DD1A56EB2134F5B377B22990F0C96E0 AFSKEDE4
914,147,406 *5F250CE0B169A13ABE2DADFA013CA53724D27328 br-!m
914,147,407 *5F2D939A98D3F98B6410947F39EDDB80BB17BC54 brugerotto
914,147,408 *5F21BA95600BA5E03CF434CD44D25B77126A0EE6 A-HIRA
914,147,409 *5F2218BC8C63F47C74E62250983217DC2E87BFD4 bscei
914,147,410 *5F220F7B50B9136948AFFBCDB2B8272490A1AE2B a)kf"
914,147,411 *5F24AEB7D68FF32A3FC0F2700B89BBE6E838459D b-;_v
914,147,412 *5F2A8342713ED3404A2BED142AC01FEB5F210CFC bw5qu
914,147,413 *5F2AED831E6DA72EF440374649EADB122F8DDD5A ALG70
914,147,414 *5F2656CD41DDC72C81B8ADB8C8B71F9C5AB9A554 B.&WV
914,147,415 *5F2D6E2A204F728F542A50680589B7251B63D025 bybfu
914,147,416 *5F26238CE832F5F0FBEDB4A7B229847BFBA34986 [email protected]
914,147,417 *5F298504A297B637D89EBB55E1D1314C2ED2D90E c0gct
914,147,418 *5F2614559E9CE4F51E1741546B293867DB7102C4 c0rr080r47ve
914,147,419 *5F2A0090EC0DF497205D50622704F1B7249014A6 C1L:I
914,147,420 *5F2AB0E038BF67F641D8459AEC5B21E8E081B6A5 ANDYNOYE
914,147,421 *5F27D6F6E3033CE21F88B8AA50E83CD2FD68EDF2 A+NEN
914,147,422 *5F21D58C5F7356EFD8047CADBB16298853A74ABB caeremoniarius!
914,147,423 *5F2F5FA68E77FC9725CC79AEB4F8D9F1BC848C81 [email protected]
914,147,424 *5F29B1CC4F1BCF5E75F80A2C09111CB1B7684911 ANNATIT
914,147,425 *5F225185BED6891DB6D5F416B2E9BCA9F9A3DA9F camelion7
914,147,426 *5F2A1B373D3F16E964EF0D04FF7B4397EF7F55BE anothermealturnsup
914,147,427 *5F262F8F53D10521F0A8526EA80FD4CAA43D9196 [email protected]
914,147,428 *5F26602256441D2BCA24F439BF0C1357CF7DF895 capsnepo1
914,147,429 *5F2339C2BFF18EC9B3098D30D16D4326A6F80639 c!aqb
914,147,430 *5F26D832552294A812CA24EF18E88D9934A21336 carmenvolpicelli
914,147,431 *5F292F72B426DDA0BB687DEF16D60BFE68AFADEF CAROLENIA1
914,147,432 *5F21AB03128E71760FAF5DD46BD048C44BCC914B A$OD?
914,147,433 *5F2A81AE7F0922C8195F856AC21733066C92BDD3 „CARTOON“
914,147,434 *5F2C8AA1AD64CA440DCAB20FA277D46CF70C1778 cassie-reeves
914,147,435 *5F2A29D324EDFE1712CDADE884347E041D3B9E84 APKE&
914,147,436 *5F2C081D70369246BFA75534FD5C9343FE68745D APTMQHKJ23
914,147,437 *5F202E3976A98A3D7CAD6EB98B6AC04F2601DCC4 A_QSF
914,147,438 *5F2198477B0E4B0156CFA66C1A2E162C4D2642D2 CECEMCGEE
914,147,439 *5F296D58C54F4EEAA34BBAA58A12200829518DDF CECIL.VANHOWE
914,147,440 *5F21EB1E8A29ABEE4BED484943BBE0ACAC3605D1 arnd
914,147,441 *5F21D4625F7432D6778D2976E58D3581EFDF570E ARNOLD.HISSEM
914,147,442 *5F25EB57C295E9EFC19F4EDA3F0F5D2A780ECFD9 ARONAMEDRO
914,147,443 *5F26505187B183C62FD71EC8A1C883DE6B428B1D CESBF
914,147,444 *5F257A525DFFC113F1E939EBAD0AE9807158B20E ASFYKTIKH5
914,147,445 *5F22DE0DBE1C3F44A37840D7F6B15C2EF3EFD27B CH1DG
914,147,446 *5F2226576A91AF0A3485A710DCF19EC1AB2C216A chadbuggie
914,147,447 *5F26CF0B1B191111143D1C027DE889D176447FAC CHANDIGARHBOLIPAENDI
914,147,448 *5F29C19B11EAD819424064984F6B592626BE2A2D Charles-Sanford's
914,147,449 *5F2A0A22DF3C25E95BAA7EA967697346224C682D asuarina5
914,147,450 *5F2ABB1F36A230DFB57558DB610C797ECA4DFB5B CHARLEY.GUTTERIDGE
914,147,451 *5F24958F271C86094782FD4F2A24DBDC217B5B69 CHAS.GADDIS
914,147,452 *5F29BA2AE9158889B402ADDAFF9A8976869E3B81 CHAULMOOGR
914,147,453 *5F28C0B4CAA4ABE8764D77886629DDAE201896E8 cheylyn2
914,147,454 *5F28E84EF18255096B9C05897625805FD61891E6 A&_UE
914,147,455 *5F23D89F074F4694252F91783C451B228001EEB4 AU:H
914,147,456 *5F2BF4952D079AC36809F0301516C224612F2160 AURELIO.BIERKORTTE
914,147,457 *5F2110EF55D113A222A4E70824AE18335BEC3E86 austindatwyler
914,147,458 *5F29B9EAE0F6DCB58D94963E9ABDFD2CD5B6CC70 CHRISTMASGROOVE
914,147,459 *5F29E391F58D58CD0AD20140B803897F5FE5E5CB cissb
914,147,460 *5F2E6E2779BBA47FD8AC7FB3A3FAF171E3AC7635 C;J0
914,147,461 *5F282C1BDDF2459B16A752D0BA604113124ECC4A ck$.e
914,147,462 *5F2D92AF091506B3ECED8E8A594E325C4E224BAA claytonpehowich
914,147,463 *5F2BA6AF0A22C91E50C8188C71C9361D7A0326A2 CLEAREST
914,147,464 *5F232203AC1EA73B33604D14CE182453A504EC7C cliffstanco
914,147,465 *5F260159D250C39E7BBE7F645ACDA086ECAD4068 CLIFTONAMMONDS
914,147,466 *5F2CF93D7ACE19FF3A6160025CA05CEAAB47DF76 [email protected]
914,147,467 *5F2CABB1A19B41CD3B343E5972D55369411A615A CLOVERTBONE
914,147,468 *5F2180012DA9CD8C62DB0AC9D4AF6621971BB504 CLUILIAQUE
914,147,469 *5F2A385FCCEDE5476944E8E40A961B6F16F4BF7B B4OGL
914,147,470 *5F2CBAC071325605783ABFF6D8AFD4AEF6BAFCA3 B.7KS
914,147,471 *5F2B1E68889C359CBCE4E636EF2180BB6651987E ba2nu
914,147,472 *5F291F703B45EBEE61145B29742078F29AB3EF4C CODY.TINGEN
914,147,473 *5F253D464B0CCC7EAACCE737C1EF66AD09847672 BA8R
914,147,474 *5F24AFF1A1DA78F766823A1E779CD575BBCECD13 coletta
914,147,475 *5F2AA54907A669E69403AD389AF79E60E12E9AA4 coppelia-musicofthedollsandwaltz
914,147,476 *5F2B7E8BDBF89C88B291D2B17798FC0528A9A789 CORE-MEDITATION
914,147,477 *5F20C74B3819A6FBC29308F1C92F18C2EDB0E383 CORROAOS1
914,147,478 *5F223DAEE23E103509EF88A0C375C5009758BB4A bb?_:
914,147,479 *5F22C72AA570EEF67B81E26CB8C9065FA97EB294 B_/B$
914,147,480 *5F258DE25DE2CCD60A6000D2ED83DDCA15FC6D55 bcxq.
914,147,481 *5F215B4218A3E90C3C3B8AE99D84540945B73092 crare?
914,147,482 *5F277D69CF23DBBC103A5AD5B91A2129518E5E7B BECBC2
914,147,483 *5F29AEB1276607E58023E8DC473817AD482C91FF b/e%g
914,147,484 *5F2CD23BC9E7109691BA61ABEE4D94E5BF94CD1B crystalrosas
914,147,485 *5F231BE6DD4351B9EE06968315DE68826619325F BEQ$,
914,147,486 *5F2529CA7033F66D576CC43BD2BE20E477212CE9 [email protected]
914,147,487 *5F25F99D0AFD0467743380A25AAD0B6E634EAB91 CT7/D
914,147,488 *5F2F822F25A0848F9DEBBB28671E964CEFB03E5E BETTERNILFANION
914,147,489 *5F2F0912F9571BC014EDD83A012116BE6C3F747F BIG-BE4RD
914,147,490 *5F2E50DF9D7577AEFE3510133CC1D987AB7D5350 bigbo$$
914,147,491 *5F2C4AF6E5FC8F4940C57F570367A497A7B78140 c?yuu
914,147,492 *5F25ABDB88CE438FCEB4715B71EA709EE68272F8 BIJEENROEPT5
914,147,493 *5F25FE3E750C674CD1176A9C640B2024FF112289 CZ:P-
914,147,494 *5F26E16E46B2235D65CE6638876AE481C7E794D3 d3:p8
914,147,495 *5F2008A9BBDBD45E0AA1277A9314D6D144C52AF3 [email protected]
914,147,496 *5F24484510A1251FFB72EB0897374E1F229B1962 blitummutilb
914,147,497 *5F226E7B324D18E173AB1BFF3FEC5B2274FB8C89 DADMN
914,147,498 *5F24FDE43B3557FF7AFB9CFC3580C745D2ACE22B [email protected]
914,147,499 *5F2E37B1C0A0A43E389DE39D8A8B5E2407762214 BOBAN.JANCEVSKI
914,147,500 *5F293D6D2DBD478D08492222433FD2DF71F751BE bobbyaleksey
914,147,501 *5F208193D7B949C3EB16AC274945BD696C71F786 bocca.desiderata
914,147,502 *5F24207634BD265A947A0A1D4FA1CFE29D27EB83 DARINCHAN
914,147,503 *5F243EE1B92AC78E267DE8D8CFC7A687418FB001 BOO$
914,147,504 *5F275C43BACFCD29139094363DE87B37DE24FBD2 [email protected]
914,147,505 *5F23FA169829E08DA7FD930CCF51FAEC0012D5DE BORCHARDT.C-
914,147,506 *5F2658D8F43B45F271BFE8CF2A04A39FFB84071C borduren5
914,147,507 *5F2A9FF692E34EE0150B8A758A4D94711EC54786 davekeebler
914,147,508 *5F2DA8E39BF2980E971BD318FAD2E84EDBAA2182 boucleront
914,147,509 *5F2937B9D7F3B66BEA6B7303DB9F3EBB390E1CA6 boycecolombe
914,147,510 *5F2DF97BDF92CDD41A075A46726E9563B94A772C BPA&4
914,147,511 *5F2436EF57F434B15BC5E6A6D34A2FF5F06B758E DEBBIEWASS
914,147,512 *5F20EB01FC9A889C078E3F392F8FDA3112FEB14E DEE-ARE
914,147,513 *5F21683E3146F5FB110E4A1CF1024E25FB34F4CB DEEVENA3
914,147,514 *5F2BC6B7E32E0F00D7377255E6873F8FECF251F8 Breaking-Dub
914,147,515 *5F2ECD9F9E56350E57756C8697430F87DA308382 defmc
914,147,516 *5F25E541AA4B634F2D628118BAC97959584E9F83 BRIEN-HARTUNG
914,147,517 *5F22F2AF5F56320F96A2748BE2E1D408BA75BAD3 [email protected]
914,147,518 *5F299C7E2F603DA2927B1D510877821AA0BFEBFA BROOKSALCANTAS
914,147,519 *5F2D2631C3A360ADBFA4A996BA50FEC77E7EEB41 DESCRIPTIONFRPARC
914,147,520 *5F2BB429F23BFFF2597F8DEF9A06FFE6F326C309 bs_3s
914,147,521 *5F2B4F8F19070F6C17C8B64B61315E0100637C3F dewittcastiola
914,147,522 *5F20ED5ABA1CFB5B6A8AA7767AAF13444D369770 bswgbinnbsw
914,147,523 *5F20E17AAD270FBA20EF758489BCCE73BE32C5C4 DFE2394F656AEA464B341E518C86A8A8 BIGTOE
914,147,524 *5F217BCD6E9311F3E7B8C5CD1A96B71003782E0C bswnetwrongbsw
914,147,525 *5F2C09D90320F272D9F361C355D0743583D905E3 btel3
914,147,526 *5F2193B659649DAF1833A52DE862DE92F9F146A2 DG&3B
914,147,527 *5F28F7A3B01A3A638951B01C3D4E33234CB1D8D9 DH/1V
914,147,528 *5F209648C02BA9AFE27252CFCE9A88C1F5FF191D dh%ky
914,147,529 *5F21956F96FA8D3BF09FB9741158EA7853168D03 BUFORDKERST
914,147,530 *5F2853C8D688055B33088E718017888F94BA2772 dħrl
914,147,531 *5F2571030311EAEA959070947588C0E15D92A4ED bug.d
914,147,532 *5F24C65B55D686B72A2D9F84DF86913E9EC9E1A8 di)
914,147,533 *5F20C18C631C69B2A4E3249A8AFFE179BA1D811E burdies
914,147,534 *5F2ADA8D3030C9D2DFDB41273BAC2340D65F3EF0 BUXNP
914,147,535 *5F249359620445D44ADB483FBDA3E5833F475A67 D?I#L
914,147,536 *5F2344F1382F973E31B3DAF63100E816E5D05362 dimkn
914,147,537 *5F248CC550ECB5DFEF10D488B37862FFE5DC0797 d"kva
914,147,538 *5F23F347B365CE0913D842C77DFCB8073EA8FE9C dlq9
914,147,539 *5F2A5F5146E9335907664161273FF9C450C59980 C2J9E
914,147,540 *5F2966593EF775668E5E9643BD67B3E995FE9A0A C2YLS
914,147,541 *5F2BFC48D445315A71F3984F887A957A63B2B20E dns1t
914,147,542 *5F20D3FB3A67651309C73FD6711B4CDDA205A669 c4s/5
914,147,543 *5F2003588C6908D8257F2A0768D1A6CA54EAB2A9 DO;92
914,147,544 *5F2FED9AEA9ADC0F2CB759A6B2959F7B3E30C40B c5tam
914,147,545 *5F24A2851C71E278C5BF93B0796CE1C4384DAB22 c:7ep
914,147,546 *5F2955F632AD099BE17737C5FD33DB6444443B23 ca0m9
914,147,547 *5F29273D4C5B33F840C22D08848E2FAB5283E1F9 C_:AA
914,147,548 *5F2993BFB1C2116DEC40DCF1AC8B5DDDC69E5979 CACTGGCTCGCTCCTCGGCCCCCTCCCTGCTAGAGGAAGCCGGCTCCGCTCCCCACCCCC
914,147,549 *5F29B82E9969C12D9F341691800037E86F594C61 don't.consider.me.a.friend
914,147,550 *5F2A357279D456A13AFA0F7109ACDE99211EED93 don't-want-to-go-that-way
914,147,551 *5F2185734C2420AE0BFEAA8BB93B7F6B316E303A [email protected]
914,147,552 *5F2B28AE1D88153CC794B161149794D4EDF52FD5 d:orc
914,147,553 *5F2F7F09D494C42AAD4B1EDF5984CA7A50F555DF CAMILA-NOVELA
914,147,554 *5F23AD647968C2F87D0BD53D373CA3CAB17D892F >-<-*-*-D======P
914,147,555 *5F2B91DAF94683AD432BAAB547A2C5FF2FDCACF2 DPEDROZA1234
914,147,556 *5F2CBD704B2FB3B94825361F0E90D5507E9DC183 dq8+p
914,147,557 *5F20497D340F7301F2C8EA7D6F0199934EAA57B5 CARLOSCOLPETZER
914,147,558 *5F2B14D71F7720F13D7585B8723A39551C5F9E69 CARMEN.DEFFENBAUGH
914,147,559 *5F235EE6525A9B15ADDA528B19F69471A2E83817 d+qt
914,147,560 *5F2FF4FFE71182C8F10D3D3F2A9538E01CE3D4C5 CARYRHOAN
914,147,561 *5F22104BB055FA0149C9D3885BF161EC2B5A6E63 CASEYJASIONOWSKI
914,147,562 *5F262528F21695BAF7824427E795FDEC78EB8715 DRIFTERB2W
914,147,563 *5F24DB256F49500848733CB1A76E00237500F5C6 catalanova
914,147,564 *5F2E282D2D1AB4C5652C84D8E179F557CA41872E DUSTYTETI
914,147,565 *5F250055AAFBAB842D15DB5AB69C0D529CD2D98B cer=!
914,147,566 *5F2ADBD6BECD2CBA63A175C9B084F0DB58E22AA4 dwtyy
914,147,567 *5F200B85335613227C87CE25FBB7047607677182 DYSON1216
914,147,568 *5F28E3192A101BDEA626772BC4B5F53B656E5700 CHAD.REHART
914,147,569 *5F210B327233FE576DCA433BBCE1B2998BA14B8D eab43a8e49d536eca6a53f06aca8feb5
914,147,570 *5F26EC83332F9451DBDCB8DF584900EFDE38F7BE CHANGCOPELIN
914,147,571 *5F27570D3D2BFE9AD3A1B6001596B8E366425ED4 eaecl
914,147,572 *5F2D2BC1365509CE80E8D3C3EA1204DD1C565235 CHAPTER-04---HORACE-SLUGHORN_22
914,147,573 *5F2DEAB1434F9A110914BA5C91B94B3B5E1F9ACC EARNESTWERTHMAN
914,147,574 *5F20105F3D6EE405BB7F3CEBB5743A89B59C3699 EAZPT
914,147,575 *5F2ED07B2E12C24E7F4A73F681720DF50B0DA9CE に「ECONOMIC
914,147,576 *5F2EAB48A8F94BF912EDBC6F372CAF9A5BA7D4ED cheyennechurch
914,147,577 *5F2EE1E7B2B3FE4A133DFE138DA29A427C7DACF9 eenthiras
914,147,578 *5F2EA6D67FF061AA88D96AEB35A01A8787414195 chqe+
914,147,579 *5F245A58DBCA18574B21FE1E0442F9A5081BA83A efraingoerner
914,147,580 *5F29C4B2B1D871533812BCD0A354446635A3E824 CHRISTOPHERSHORTES
914,147,581 *5F24E2BD8B87DFC751FB215140CC635C6D4539AC CHROM3SOL3
914,147,582 *5F2F118B0CD092F880F75CFDAD83C6DC06CC533F EHEBAA
914,147,583 *5F2D3E26005F8260E529F638F0D1A6384F2027A5 EINBEZOG1
914,147,584 *5F258E19D56934DC3D3BC94C0528CBBD7F9EE471 c.k$a
914,147,585 *5F2AB84BF4D2355821DE2A57AFE5A89656133569 [email protected]
914,147,586 *5F27B252F497E2D85A1595A503CA63E81149B19B eli!?
914,147,587 *5F2BECBEACEC4CD0C507416208DC23390E6153A7 CLKTI
914,147,588 *5F2A5619D094F74A271E42386CB2E6BF607E698A EMORY.SCHLUTER
914,147,589 *5F2829C09497BC7CDDAC1A2152E862FA713819DC CLYDE.CALNAN
914,147,590 *5F2607C1A52E45D024896E0F12343BDC5EB9F6EC emprisonnent
914,147,591 *5F2A1949A5E1E26B6522400414B2C89730005712 c.m/m
914,147,592 *5F20FA49AAC11E332EE7D159EE4921217F219DAB CN7G3
914,147,593 *5F2EBE1225AAE2669E979B80C7420CD1442B386E C%O2R
914,147,594 *5F278D8926942CD2437D0A5E8A63B31701327A99 Coconut-Cup
914,147,595 *5F289C2E1320F6E79AA2541896B31287D447E116 epnv+
914,147,596 *5F2BD1EF166011A289AA3B6A61B12E873EBC1B9A erinprause
914,147,597 *5F2778FBCF90D2056D10D36EBFB3071C97DE47DD ERR,J
914,147,598 *5F2326AB23D7DBD94A810306A08BCD8195CB6545 es:
914,147,599 *5F2B188C70A2FC5C9DCD7519ABDB0464F124BC21 COREY-HAYGOOD
914,147,600 *5F2DC9AB8CE90795E81EFDC7653229D1689FA1CE corneliusbir
914,147,601 *5F220B2BE0D8AF370303FE142BF8037208413E6F ETEUR
914,147,602 *5F2803110A86C2BDE044C053266B543754D1568A cp:&r
914,147,603 *5F2DB2FB300A77CA990A3C8AB7C4050142665430 cpwfu
914,147,604 *5F24B669D0375DCFB6E7EB672E2E04753D061F17 FALANGISTFALANGIST
914,147,605 *5F277227C809012E56751EFD24EA7CDDCD5D1C6E fangaxel0
914,147,606 *5F2E08FDDE7B4B2515B2C2490CCB13C175DDDB7D C&R!L
914,147,607 *5F2F57CEDB853E7A9C8EF7553A5C1E013906E048 fatbandoed
914,147,608 *5F217D19AA44FB0CB1BC1A7DC6DBCD5FFA4531B1 „február”
914,147,609 *5F292FBE36E33E1563CF499952298FAAF8E82409 C?SN%
914,147,610 *5F2F494E32DFA27D79A8661F379B4453544AE105 [email protected]
914,147,611 *5F219F9477254A9F0552749D3DE8EE936B0693C0 FG~M
914,147,612 *5F24CA1D8B9C218816D44CDE626590297FE68032 FISHERMI6
914,147,613 *5F2729C257E764E8C2F3D2C3E000767E19E54347 FISKERIMINISTERIER
914,147,614 *5F2E3B318242500CD7DE50235C4D5E325CDCF03F FLETCHERVAGAS
914,147,615 *5F2F369AEE677DB4651DCA1BD317376F1FE6A62A C,VEY
914,147,616 *5F26C5F4C1991D08B2C2560C01FFF39A7A5BB223 flyttningged
914,147,617 *5F211ABE74FB3506F63C853F59B83386B3FE185D CWRHV
914,147,618 *5F21A8510F455439EE1146477933717672269221 cyg(
914,147,619 *5F297BA05044B740438575E56D8BB74EB7F20406 czmo
914,147,620 *5F2183A353D102D4B28123F9A4FDBA3219BCC550 d2n+m
914,147,621 *5F28CA0718A1DAB2D1EFAA53EA34E13FACD67A59 frembruds
914,147,622 *5F2AA2A306FC68FFCC91412C9CC2AA26A3E45DC6 d9cda
914,147,623 *5F2387695CA871F99BFFC3C6FECBFD56BCD1FF7F D9"p
914,147,624 *5F2856360B3E34AE4358153F79DB5E3BF9A6D492 [email protected]
914,147,625 *5F26F768BF5AC00EA2A21E7833F26F7A43777DF3 DAĞLARA
914,147,626 *5F24C758C5C1E0948E721F0ACA36DDF1AF13C160 dall'insolentito
914,147,627 *5F262CC8952913E2A089150543834BEA78C96B9E [email protected]
914,147,628 *5F2990C5D56C3D51F0AB03A11A96C38CBC1D8331 DAMLE5
914,147,629 *5F29D0B9AC2A83E39715B905D128FC2E9A47D7DC gayumina
914,147,630 *5F22F8D51D9A97D45BD14368DE5F17A77C4F2C41 danielleluhrsen
914,147,631 *5F20211E1F11F7A594E92F84F91C468D8983D31C DANTEMICKLE
914,147,632 *5F281AF70935645D1840D5B39EC64A8DF727509E genmui
914,147,633 *5F21F9BE0EC20E99C7CA26DB3396E0AF12AF2955 geraldosturz
914,147,634 *5F208B3BA7B4B7821AC015FD18BBB843800CBDB3 gerrywolvin
914,147,635 *5F2E02D79C6FFFABFAF3707F99645995E50D7698 GFNPSAJYG4TYZQSBJYN
914,147,636 *5F2F37F5A5E9C3E6F7C4E41F7C450DDA2F7A290C DAVE.CROUSER
914,147,637 *5F240E3F7A9B93E9920AF6610C4CA392B36D793A ghaangal
914,147,638 *5F240AB296971FCAE86E43A5C0062BDC00949000 gj,j
914,147,639 *5F2713958D680FD70B2120E3FF91F8299CC10023 D/CI,
914,147,640 *5F2CA4CACF6CEAF62F0A2235C2D81FDB3E547827 DC,IW
914,147,641 *5F26B4D72AEE12D1B3A2AAF893FE3662782E6AA4 DCPCJ
914,147,642 *5F22D43010FA6B0D700FC2D2C54063C8196F0F0C [email protected]
914,147,643 *5F275FC0C4948FBCF3ACB3C6A0A198685B1EA877 DEANGELO.DALLAVALLE
914,147,644 *5F28D31AC2609CAAC6F38E8A31072AAE02167131 GRAVEREBBE7
914,147,645 *5F2A6B17C46AB5C9F8DE2B7373F442A9E6278D8E DEJUGERA.
914,147,646 *5F280DE3F544CB75DAEF3AD658059027EB473A5A delbertbineau
914,147,647 *5F23B9118564EAA56774A63B2896D19ED3F3B48D DELLAGNESE123
914,147,648 *5F272F29239DA6D262C41A55254A472A442A41AD DELMERCRAIGMILES
914,147,649 *5F2FE21ADC0ACE8563DAC103858EF32CBA0FAEC1 großbritiannien
914,147,650 *5F298A0B736471C7BD99CFE98BDDEE7F7DB4B11F [email protected]
914,147,651 *5F284B7814F7163EA8AADAC86D6B1DB67ED6DAF7 guadalupebalcazar
914,147,652 *5F28A23AE25FC06F59F7C429229FFCA5B88EF155 [email protected]
914,147,653 *5F2B9A1908DC70E0E899B5215711AE4BBB0B3726 DENNY.KITKA
914,147,654 *5F28D016552795809785556155B6921807674F01 DEPARTMENT OF THE TREASURY
914,147,655 *5F218874EA41DE7B5977C039E95845E314EA470C derrickau
914,147,656 *5F2136B87070E249D9247D54650D0A7EA3332909 H3054
914,147,657 *5F2456F5187DEEB2136B2D18B963B591332924B8 DEUSADOS
914,147,658 *5F267FA6CB1161AFECCB92127A714B1EC9102AE8 dev!s4ls
914,147,659 *5F2209AD02038AC1ECF506A4C7B37283B234C47A DF%0M
914,147,660 *5F202FC66C76A30CF4702B274553CC9E8A1DBE5B [email protected]
914,147,661 *5F225637EDB04C74FDB899F6557D05D1A67C13AA dg9ur
914,147,662 *5F27588C7047C97866EC1CCB29C980F42D782462 d%ggf
914,147,663 *5F29460B5F2910F420F339575907A96908D702FF haroldgladwell
914,147,664 *5F203714C8E36B467AB9D30F80DC7F6F8EADBF9D dhlj
914,147,665 *5F2138B07028CE1BF33E81242CB7EF7CBDD2681E heather27
914,147,666 *5F2DD7E0E4EECF55969D27BA413603A0C1D448BC DIJVNC
914,147,667 *5F2386E5067AE85ED45A4A607E074C2CE28F6268 HENDRIXSHEILA
914,147,668 *5F26D33D26F9C4D49822A4A46A2557EB00A8305B di|q
914,147,669 *5F24456F05B9FEDB62F221A9E595C582960EC202 DISHBOARD4
914,147,670 *5F26CAD1A435A8FA7B54DAE9855646114173DA6A hey,-sergeant-zim.-good-job-
914,147,671 *5F2CC41AFC965C177322D2A17DB47A7C6CBEDEDE hiking4healthcom
914,147,672 *5F23B1EEEFDD5F79BB40A56915BA4EAE3F7B5DFB HIMETLER
914,147,673 *5F22269DCEBDC2E3596D4356D0EE413BE1A934CF DKFP:
914,147,674 *5F2414A610E51A3E90558121A180EDD9FFD73EEC DLLAJ
914,147,675 *5F27C6E05F54C5C095C2702847F84B74D46E9C06 DLWBJ
914,147,676 *5F205A180393CFD462658B2C7BAF7637A985E773 dmeh8
914,147,677 *5F2B58ED694507D10BE0BA056B29C5B642AAA696 DOB#5
914,147,678 *5F2DFEFD305482D5F1944AE67B2C832C89F215B1 dob.d
914,147,679 *5F2F75E16AC9C593CBFBBCA12AC22FF3425731FF httpwwwsa4sbfccou
914,147,680 *5F2E68B7E6FD0C7B4AE794D7D414712610EDAAC2 [email protected]ATOR.COM
914,147,681 *5F2629B6B77B66070C6DD32B0A2FE6E7922D298D HULDIGINGEN0
914,147,682 *5F22CA9D0857D24BC9D77C752DBB456580CCE2F9 DORIANLAVEAR
914,147,683 *5F23F3DA9880D913928CC9ADD2FFD9C48072F928 d%p
914,147,684 *5F23A3CAEDBE3AA4BFAA258652141EDDE1EB8E21 IAROJADO
914,147,685 *5F2134CADA12CDAC85E03C21E156FBBB23BB11BB dpg"b
914,147,686 *5F21BE7D1F5EAB577679E0727F6245276FB51103 DPHQP
914,147,687 *5F2952E57E7066981153BFCBD4165731B1236756 IEKRISEN2
914,147,688 *5F2D60168D7E1D74398E2499DED794A109A76411 i_et
914,147,689 *5F2FD0CC95D248A6FC1726028B36888E7424E027 draadeer1
914,147,690 *5F27708131116F6709B42400DBA7DEE5A6DA04FF IKANTERI6
914,147,691 *5F26E2723268931CDF0A42CF110D35578AAF5DD7 IKKELISS1
914,147,692 *5F2052D26A1C12572A716315122015C1E00D7FC5 DR)LV
914,147,693 *5F2438889962C1AE742FD3A8C88003CC8FD48B00 ilovepiglet94