List database


# MySQL hash MySQL password
913,020,001 *5F06C2D7DA4961524A558CFFCA115D809F30128F VIONANE7
913,020,002 *5F03A5E8A6F9755F006494458E42734466F12FA8 КАСТРИС
913,020,003 *5F0FBA74F55566EB186DC632300BA8E05E1C067C vivianyanluicheung
913,020,004 *5F05A11CF8E6C7FC2AB72828C71E7EBA71FBAE2C комендантівці
913,020,005 *5F01ACE1447EBE48F0BEEF846F20A30B1E492F9D малгобекское
913,020,006 *5F030FB283FB7EB516084CF4A8872C7DAAE01EA0 vticbsw3
913,020,007 *5F0BB6A3D94C057A4E73FDBB0B736E73990E1D12 VZI6
913,020,008 *5F07E7671D55B73C4BCD9ACA0968CA1D4F5ABADA w2/i
913,020,009 *5F05EEB2B25CC2F24BCF7B0F5A397FDF0615E556   POKOLRA
913,020,010 *5F04D93CA5FB0BD5801EBEFDF11555818209EF8A WANDAVISNESKI
913,020,011 *5F077EA6804C13A08C5CF4B6DBCB56F667C96FDE wangford8
913,020,012 *5F0F9FD004D305F727A4A3AC5F197255A4C3CC31 WAYNE-MAERTENS
913,020,013 *5F0B78970B50307E1A59D9A0ABF4A153F389BDCE WEAPONHQ
913,020,014 *5F046E71F9A388FB75AD38F3D53DDF0422EBCB52 的BELINDA
913,020,015 *5F0F006CDE15C982407635B8DA99282BB894948D WHITESPLIFF
913,020,016 *5F06C52282D4F6DD4C028B35C0DEA6748930EF0F WILLIAM.VIEAU
913,020,017 *5F076B66CF9A1477A3060804625DF320B56C2C59 WINFRED.CORDEIRO
913,020,018 *5F04B2F5197978C2DC4A1C45A6C36F97FB54C624 winnieehpooh213
913,020,019 *5F009F9187F835ED641E219B6F0BFB44B7215FAD WWWGRANDSALVOCOM
913,020,020 *5F0F483C12254721DE53DA96D0C94EA6A8F8C56A >#&([email protected]&)>!#(>!&($)
913,020,021 *5F03FB36ACFB038E97973F3CB8E7823FC5D4CC85 WWWTUUGOIN
913,020,022 *5F020E390A7E015683194E202B8936DA4DB9D5E2 [email protected]
913,020,023 *5F0C9BD405DC27479506DBCAF02E8924991038C4 wyndi.lewis
913,020,024 *5F00568F9889AA00D0D156262A67A88ECF511468 x`d_q
913,020,025 *5F01BEED1E9041C5CEF3436104EAE16BC2C97294 [email protected]
913,020,026 *5F00493FB327301F7A29900C90E90E470983E7C9 )x(o~o~dq
913,020,027 *5F0169696F212819DA7CB8A0562943798452FFCF [email protected]
913,020,028 *5F02A6C3720029D745F2A69E45972E38FD90EF96 1239498 kerran.my
913,020,029 *5F0E61F126E2FB11A95BF09C4385FD9C6FC1888E 1294810 kvaerner masa-yards oy:n helsingin telakan tekem
913,020,030 *5F0D10F489D431EE56E4C50717DE0FE028AC71F2 12JULIO1989
913,020,031 *5F029793225F42438097285CD7877BCCBACE2907 1522584 tasan vuoden ik
913,020,032 *5F082DA0C245B5C934DF95BC59FB8AF45DD365BA [email protected]
913,020,033 *5F082A13AE0CEEFF7F99558BE23D4C29F8C2BDBA 16TOLERATION
913,020,034 *5F0E80DA0D3E1105371C472CD0DF5CE9BAF1AA19 ymrepsomaga
913,020,035 *5F0E7B256A4330A6B99E82682F95FE974BB70382 YOLLYCATACUTAN
913,020,036 *5F0E1068F4B6AE1F3816F8580E3ACD6C6356CBEA YOO-BO-EUN
913,020,037 *5F0415807F3B9B6E758474025CC8A4990D46135C YOUNGSIFERS
913,020,038 *5F0C4F1CC58871C89063EB8D43BE2556C0408FE1 19 REBELLIONS (AL SCOTT VERSION)
913,020,039 *5F0D2B799538FE3A385B2169F2CA825C9826BCA4 YOWEEBSW2
913,020,040 *5F0B593F56DE7726E0D7BA9884EA56CCB3736934 YSÄTER
913,020,041 *5F064F8FC83DADE6BC5A9A777C708CFEF7570B88 1.barings-style
913,020,042 *5F0139556045078BDC9033C920FF08313B67E49A 1-bunningsiin
913,020,043 *5F050FBF32075286855774430D14E26164D43067 yusufboyraz
913,020,044 *5F06C22889A3451C449FC49D16549FDD20BD2BFF 1.ego-palaces
913,020,045 *5F054FB07B573BC1B2772E56BF6076FEAD6EE18B ZACK.GIOVE
913,020,046 *5F08E31EE546F9C1A33AA8FCE7A91BACE6DDB4CD 1-GOLD-INLAYS
913,020,047 *5F06F7849191F0F13BE1A7E5D3DA43D4051EA71A Z!B=
913,020,048 *5F05542C7E892D5B11C72F2B3D17B483647ADB86 ZEBI2SOMEONE
913,020,049 *5F0EDC769446DB3D5F81958CFBB0299E9855373E 1-JUGEND-GAESTEHAUS
913,020,050 *5F0147F81F3B27F6D7B26ADBCEA08FF83930772A ZENNASING
913,020,051 *5F07803D7FF8BD3E58B87663216239EE935AEC91 [email protected]
913,020,052 *5F085ED89A2D17C14ECA00F3C21861C16BB13C16 1mehlsieb
913,020,053 *5F00B457B86D0304652DE51CEBBCC7DC3644EC5E 1MESIBITU
913,020,054 *5F0603911B085A6023E8AD03BFAF7C3A3EEAF398 [email protected]
913,020,055 *5F00A22029A29A09E3CDEFAA3164ACEB6B189FC6 zhouxuanjun
913,020,056 *5F0DE7AF532AA533E6FB08A3055CC8DFFA44E9CD 1-novellen-vorlage
913,020,057 *5F05BC8DA4A284048A94A2FC9DFFB179E7642408 1ORVASKETEEN
913,020,058 *5F05FB4BE1334A6DDD305212BD4D2CAE02E48D6D 1.pareittain
913,020,059 *5F076777DFB75D785E512FC7A9299ECD33A7172A 1PHANSIGA
913,020,060 *5F0BA2C9160F64063974A5B7DF3DAFCCF837EE25 ZONDIGDENSING
913,020,061 *5F063F02DED00D142894475794A1213549DF4BF5 1Q6735
913,020,062 *5F06B26D3B270C7E8952C4DA5E59CE09258343B6 1.RAP-BARDE
913,020,063 *5F07B97D526EA73FD8E98D17EDD6C1BA666784EC ZORGVULDIGHEID5
913,020,064 *5F03050EA9C25A9D5293BE86B043A1597AB76CA9 Z-SR
913,020,065 *5F0F231EE33FAAAE06C2AD24F90124B146276808 „ZWICKSCHES
913,020,066 *5F0041CE88780227245091351BB346A6077B861F 1-STAJYERINI
913,020,067 *5F0713CFEFEF7239E1CE7C8EADB3C3040BEA1BB3 1STUERMERTOR
913,020,068 *5F0BABD3665B085D231FC4E70E0E6E1634C83053 1-tomaattipuretta
913,020,069 *5F0D49B319E22C2E74DF37332A1AD79D9C395BD7 1-vakiomalliston
913,020,070 *5F0D0305EEB3D9BF1855BD9AF74CDE9B8BF1CE08 ἘΝΩΜΟΤΊΑΙ
913,020,071 *5F033887A4FBE4AF5BB4FB616DDD728FF9A307FF 1.wither-wringing
913,020,072 *5F0DBA946F0809F14FEE24DBE245D06BA0B81F43 1-YAYGINLASTIRILMAYIN
913,020,073 *5F038AC6C1BB08C20E549F44A4530AE3809EC4B4 АЦЕРИНЕИ
913,020,074 *5F0BD240FB6B8629F443E2ECB1354DAF0FA10A24 берджиха
913,020,075 *5F0CE25115F7D3215F47E8DA8389499BE4A0F0CC ГЛЕЕВОГО
913,020,076 *5F0927732E21A0CD327A7DC1F8559A95E09085C4 20escud
913,020,077 *5F06CC4AB22D32D36BBDDF0B1D65454B4795C4D6 2285417 matildalla ja minulla on paljon yhteist
913,020,078 *5F07BB0DA3B2EC57C00510409E20E60BAE6E62C9 2329732 OPISKELUOLIAJASTAJAPAIKASTARIIPPUMATONTA
913,020,079 *5F0C115956ED2C87A22266FBF3A1C63F7A3DF2D2 2430097 bring.back.the.good.old.days.,.".love.said..
913,020,080 *5F03719988F66E200EF588874F5BB1F07872303C 2,4,6,8B
913,020,081 *5F07361A2131039FC662570BCDA5B8613C3555BA 27.GOTTHEITEN
913,020,082 *5F0A78869FA775424B3F26B58669C9819E2C77A3 ФУГГЕРАЙ —
913,020,083 *5F04C91AA1A183D91E9C8BB72E52DBA6EBC9C304 2ABDOULLAJEW
913,020,084 *5F0BEAAEA0781C6F5A4C453215F43C1E9B6EFB70 «шуруп
913,020,085 *5F0B138A42C879A1339BBEF81D11EFC9A1A98110 ՀԻՓ
913,020,086 *5F0FE220D739C0C3CBCA2E8798B6A1E564E67A07 2 ASUSTELLEEN
913,020,087 *5F01F96FABC8BC9944CE4093E87A11EB9F37293D 2BEGRIFVES
913,020,088 *5F0D37FC100DF7007718ED829B57B1B59FA6D7A7 2.bettgefaehrtin
913,020,089 *5F088FC847B25937064F59976A741CE8B2B3545B 2 DUEMMERSEE
913,020,090 *5F06A42103701002C90D7D6C629BE07C6E7C39B1 2KLEBERTH
913,020,091 *5F017020EA5ADADC0C936F5379F2DE402E0A6894 2monogrammstickerei
913,020,092 *5F0160A8880359138D2ED054BDA6535923BDFE93 2takimmaisessa
913,020,093 *5F0654646B779CFFCF31BFC787ED8EC41C90790E 2TEKOJ
913,020,094 *5F0E3604833CD7CE38AD3B895A47E4418E9BC19B 3059besuchen
913,020,095 *5F0E8DFEFF40BD4ACB21AEE0C880A2AFEA38D14A 32INTEREST-ONLY
913,020,096 *5F0DD4C76FDB60A6D5493BB53FD6523AEBCED2D7 35cb5d530
913,020,097 *5F026E8CC762CADD571E8070456AC9996B40761F 385940 YKSI.HAKEMUS.,.MONTA.MAHDOLLISUUTTA..
913,020,098 *5F05260EAB155A3513EF1EBAA146655CB9A10C64 39870 niit
913,020,099 *5F0C8AA0021FA34D7033B60B5D3CC3EE0244F668 3 ANGEBOTSUEBERSCHUSS
913,020,100 *5F038AA887F53453E137F635A97723A0C4DB3BC5 3.ausgrechnet
913,020,101 *5F072D65550B101EAA0FDCA9038DA27293BB1733 3-B~O~O(X)
913,020,102 *5F015A89998989A74E899C70988652165CC6D0E5 3thebeagle2
913,020,103 *5F09B51CBF984D8FA60EAB73CEB8303BFA06A6E8 3zillah
913,020,104 *5F0D71733F2B9B04FC04157EF11A1EF2776C4061 444CADENCE
913,020,105 *5F0C2944748C761C41EAAF1CE9077A46387689B8 4F48C3
913,020,106 *5F01488C8A961CB500D7883428BD51A07359E61F 4HYLLYSTAE
913,020,107 *5F094DC212448B269A111584C7069AEF02BD5874 4LL3G0R!C4LLY
913,020,108 *5F0C048BC644B33317C1C139398DB6D34EE010A4 4OPBOUWWERKSTER
913,020,109 *5F05E3C8003974B46778B5FC505BC9B3E727E375 4pearl6
913,020,110 *5F0E0E8EEF1D848E0024A75F818D81BBEB973AFA 4SAFETYJASMINE
913,020,111 *5F046BCD3EC1B1C944D7458BDBF181EE1320BA36 4SCETTICISMI
913,020,112 *5F072310352D8F10F5108FF4CA7C8EB14FC7BF87 4SNEUKELD
913,020,113 *5F020CC3307A43C645371B62050547628F00B955 @$>#%#!&@>#)%(>%#%
913,020,114 *5F0E5C1EC392B0FE303EA16C3FF7AB7EFDEA1752 4TELEVISORI
913,020,115 *5F02B9C563A7754495B3CD153EFC086A0146BEC9 (0-0)0~<####P
913,020,116 *5F09A7906F3C8714BE75DB41A9BEF8C75A5F5036 107 FROM THE PEOPLE, YES
913,020,117 *5F0AC501EC99F15238195E69DAE454F7ED695598 1155185 KATSO-SE-L
913,020,118 *5F0A540879909BD7DF1B05609970B61890ED710E 5MILDEWWEDLIM
913,020,119 *5F093F7154B44601CD773E369231B16AB584DDEC 1252463 SEONTYYPILLINENHARJULAMPI,JOKASAAVETENS
913,020,120 *5F0312DA8E6F3B108C628E0D513A661A7B74C8AE 5NOMBRARLO
913,020,121 *5F08D8B7BF0B0F60012CDF2521008AB323718522 5NONDEFINABILITIES
913,020,122 *5F070E87192B949A65F4583C8763FEA130A98C8C 12mar1029
913,020,123 *5F00682BAC7A839692B84D123CD9C17EF9B48F2F 5RIVOLGEREI
913,020,124 *5F0DE3B4A5C1FE1C72905327AA460D3BC1E9A5CA 1428148 bringen-im-jahr-bis-zu-3-000-nachkommen-zur-welt-
913,020,125 *5F067457EE838219537387FFA83428C8FD3ABCDD 1764916 TUTKIMUS.OSOITTI.KUITENKIN.,.ETTEIV
913,020,126 *5F0BBE8AA2533DDFAA25F68633DD8C3D5835AF93 1776156 TELEPHONE-LINES-ALSO-WERE-DOWN-AROUND-THE-ISLAND-
913,020,127 *5F0D1FD89949280B723F34687F69793AE634DFE9 61-INDOCTRINATION
913,020,128 *5F00070F22DAEB6A61C822AEF2CCD7FC4A84C15A 18urwaldgebiet
913,020,129 *5F0B4C6406794E9BD6AABC5D30DD3C588BF2593A 1908641 DIEDERBDAFAELLTWEITGEHENDNEGATIVAUS.
913,020,130 *5F0200C0077CCA46A3AC17E704C009AA123EF7CC 6BERSARINS
913,020,131 *5F057EB544CB96D428917FA6E53E2497F7904A2E 1 ARGONAUTENFUEHRER
913,020,132 *5F03F92B621C23E0BC14CAFDC072356FE5D84E4D 1-DECHESNE
913,020,133 *5F09B86FD764072E1BF6ED17CD8EA3DAA7455E45 1 DUSSANDERIKSI
913,020,134 *5F0614AF374A3EDF1A72CBDE51B0C875ECF90DB4 6KRISTENMAX
913,020,135 *5F091FA385330CC66B5BE5311B53E0611EC4A000 1.fiaverantwortlicher
913,020,136 *5F0E97CD14AE6041A3F6ABA27C98B1278F7D1865 6may1129
913,020,137 *5F010701FDE2F4123D3CD0CEF433640C06F8CFBE 1HOCHTALENTIERT
913,020,138 *5F0CD58B17109008927B8D4D5FF60F4F4AD7599E 1.horse-back
913,020,139 *5F055D48DFBEBCBAFF3DF6CED8586D1419E783F6 6PYRAMIDSPEECH
913,020,140 *5F05482E3821003E1A4DBE4A6F54414F89211648 6rechthoekig
913,020,141 *5F01F47D3E2A198C01B3BB362082D4E40FBC22A3 6rovisterei
913,020,142 *5F0AE56228E601774E7BF1A19788A3675F2D232F 6SYMBOLITMERKITYKSETDISKURSSIT
913,020,143 *5F0FAFFA199DCF4CA6A16B34A82BB2FDF588560E 6THEMAINE0
913,020,144 *5F0CC74F44F0B077B114A6863BED3564B77E96AD 1METILICI
913,020,145 *5F0C5A51E41E8FFC43B70CB27A29E86B0B3B1CD2 74F1153B0
913,020,146 *5F0EA54F2D5CF6C08FC263DB6F7E1306A7AB7E27 1.nhlkaudenensimm
913,020,147 *5F09F87D0393082C0643687E5978828C6749DADF 1nicht-eintretensartikels
913,020,148 *5F01378B244556B132119B5D779E32E8C408794C 7AIROILLA
913,020,149 *5F01695EAB675EE484BB95930D814762CCF0D75C 1-PAPIERSTADT
913,020,150 *5F0D7C30235B3AB2DB29D9B6B452D66957D62F62 7BHHRSUTBFUFCRA
913,020,151 *5F09CC431F07AF9A466477328F2D9D18F5DE5D90 7CHRISTED
913,020,152 *5F02E9E3ECE9BEF8416361CC40D7C731C143ADAC 7ISKIMUTH
913,020,153 *5F0D0651E4899446E22AAB570D56D8C50E554315 1-SUPERBERTI
913,020,154 *5F0496F60FAE6FEA49B607759576EA528A51206B 7LKILBEJ
913,020,155 *5F055DDE756E416E0B3B3FE08004B03DB899C070 7MACSHOES
913,020,156 *5F068F21A81970028DCDD07C90D2ED5E62AD21F0 7MALIBUWISDOM
913,020,157 *5F0D643A25CEE1D3AA85CCAA0A90966F452A5AE7 1TORNIMAKASIININ
913,020,158 *5F0522936D8D97C64D0CC73A45DF84113A90E0C6 1.treesconfused
913,020,159 *5F00F71FB74D89FE5890156F2D5AE0E056A599E9 1 TYRMISS
913,020,160 *5F05A34CC317DD898723816EE981A5FDFB44845B 1-woelle
913,020,161 *5F02ADD572D4B9B4A2C2DC6DF638C3928DC4F8F4 7procacity
913,020,162 *5F0018F3927CAED8E571DCC3987876531759B905 7REVISIONISTICO
913,020,163 *5F0684A87DA6318E6568EB8AD84B6EFDA216BB2B 2032942 SAUMATESSAONMUISTETTAVATEHD
913,020,164 *5F0038056330D355A36B893DD4F8A97C55681B98 2216533 ".olkaa.yst
913,020,165 *5F03244FFCD0A9886ED799DFF54DAE42F95EEF8A 7WAYSIMPLIFYSOLVESPELL
913,020,166 *5F091C3DBE3386FC2C83423ACF3669D796767D0A 2259565 he.declined.to.make.predictions.for.specific.periods..
913,020,167 *5F0DA138C7B7B6F07E9B87F81F75E71281E34774 806967 WIR,GEFRORENZUEINEMLETZTENBUEHNENBILD
913,020,168 *5F063C662F462CF70844FE2752CB5FD9EB3487F0 8====>~0~osplat
913,020,169 *5F063A47E92C46A70DE91EAA86EA061C0C68F621 861655 NEUVOTTELUKUNTAYLL
913,020,170 *5F08EBE322A80DBE23DA93EA149F4BEC440E6353 26.06.1665
913,020,171 *5F02C4AC43C6F77326518A64DB4693FA0E2180CA 2861306 HAKEMUKSELLE.EI.OLE.ERITYIST
913,020,172 *5F08F0801E98DF66C6D4B3D148A7837F47B7C790 8CROQUANTESES
913,020,173 *5F01EAD584A62CA25E31B3D658399841B53AD695 2ANAPEMPEI
913,020,174 *5F01545C17D5D4E416CDF81D63FC53D1CBD409AF 2.ARKANSASILAISEN
913,020,175 *5F045EFF68A831E227BA58893A63E0D534560A8F 2ARKIASKAREISSAAN
913,020,176 *5F0D77CD2C463B4D9EF3CD3325DF9FB99A2F0158 2AUFRUNDE
913,020,177 *5F00284D65D740202DA5A11A0FF01A14ED55AC74 8EVAPORATESES
913,020,178 *5F088F998E866139982C447813E2415C8E992550 2bitrice
913,020,179 *5F05AC593563A128B9202F33B88D96757A91C470 8GEHARDEB
913,020,180 *5F04002309053368FF3F706111CA1A851D06F81D 2DKSTOLEN
913,020,181 *5F0AA01324EE40441CF41879A6255E43B97CC356 8MANNSTERKE
913,020,182 *5F0A102CE3D4FE43C5284D4620A30057936CBFB9 8MEDIEVIA
913,020,183 *5F087D6543924336722743A0E9FF66A4C0672400 2KRIZOVEM
913,020,184 *5F05DD068316FBF545BB2944B1A9A9D23736F635 2-maceradIr
913,020,185 *5F02E657006B7130F501A729EF2AE8258041C33C 2.MAN-IN-WHITE
913,020,186 *5F09FC3AA07440A1BFEC1895A4D730D74906D201 8--P*.SPLAT
913,020,187 *5F0DA9471F1FAEC7507D30000C4D648E3B06DB97 2-PUVUSTAMONIHMISET
913,020,188 *5F07897D7D36100B986096375C13A648354A49A9 8RASISTOVY
913,020,189 *5F0C1852A61EF2CE19925F8A7BA596CFF4A212B5 2 SOFTWARE-LOESUNG
913,020,190 *5F09170730D4DDE98747F08FB71DC22F066BF603 2studiengeld
913,020,191 *5F0BB7094281AF37CFC6F81BF037A6971CEFFA29 8thearlene6
913,020,192 *5F0D2E852932C355112D06486C80C1E65B9A7C91 322570 BONDMARKETSENTIMENTIMPROVEDSHARPLYLASTWEEK
913,020,193 *5F025C3C0B0648B261E793437DBBFF57BB0F746E 8wedergekeerden
913,020,194 *5F06225B937D2062AC65209001C40A4D927CB6B8 910727 turkkarasularindabalinayasiyor
913,020,195 *5F08D3662FFCBB23F3413197F394B0C983628E42 3AMELHTEE
913,020,196 *5F0D2279191070F3872253ECAECCFBF44E083FD9 99xtexan
913,020,197 *5F0F51971EEECACB35F30FFE76988E5E2B6284AC 9AMORTEISEDE
913,020,198 *5F00A42ABBD58279B1DA4411DBFDD955DECE4810 9ANILIININVRISEN
913,020,199 *5F006D7A20250F4C0C24C58B1FF8ACFCB4F7B805 9DIEHNEFF
913,020,200 *5F02970D5825BC8FA54AB38640A08741DDA10A6B 3JESSIEG
913,020,201 *5F0F9BDE5429FB7F18FF987707D36237D137A859 3 k
913,020,202 *5F0BB839712CA9778CC4B988847C42052DAB141B 9HSIFELGN
913,020,203 *5F0E7A0C455BF580777D7C4C30B8D44FF102934B 3==P~`O><
913,020,204 *5F0061D4885BFC387D5AC61FBD5196E61B9DBD84 3SHATTUCK
913,020,205 *5F054B84F74265D4319DDD11C8CE2BB7CBC63ED1 3.spd-arbeitskreis
913,020,206 *5F008D4C9357979B50C3274350DB633A44D5DCCB 422MARGARET
913,020,207 *5F0E8A141BF10A96C5A63AAC7A01734EC0E1D173 47-spiritualitaet
913,020,208 *5F03A8FB7D8D9F622754B423BF975B622FB770F9 4KINKHOORN
913,020,209 *5F01BFAF6C2A4A0C12D02353733363A4E3735C3D 9VETTECELTICS
913,020,210 *5F01B8DDCBF7E51872F1640DA55F4C21ED52561B a#!/
913,020,211 *5F0E43A02EE75E46DEA6E48D6B76E17D928EE25C a3cmt
913,020,212 *5F0DFF63959E3E1DE18999CC4F49EAF35B33B570 a4o8d
913,020,213 *5F005A00A9F36912BB3316B3C3546FDC0EDEAFF4 A4Pi
913,020,214 *5F0313671075C7D71C569991DB47EB4C9B918F1F A7GB
913,020,215 *5F08736BC4454B98D94CCAC8764368ED3F745E14 aadm>t
913,020,216 *5F0AC1A49EBEA9CC4A3ACFE309915BDE1778E5E7 5LISLE
913,020,217 *5F0DDA5F71709C1867AE08CF6AA8C26A42A2CD93 [email protected]
913,020,218 *5F0B7BF159451C10DD1A05E89F41FA98998F4A7F AAD$Z~
913,020,219 *5F039B60241661BBB69937195DCD4082CAF991B3 AAEOH
913,020,220 *5F0017C5B8675807C27DF2FAB4CCA5B99FE29C16 AAEZYM
913,020,221 *5F03D573A3C44296BCEEDC53270DE618B4BB4940 aak?s
913,020,222 *5F0CEC5ED886706A8741F019FC0A91B9B7CB8CDA AASAVAMING
913,020,223 *5F03E957287E5F4D8D2C483425DE4F991426CA64 ab8e
913,020,224 *5F0BC87F8A7D84184524AB02DC518F9E03D73792 ABEPURVES
913,020,225 *5F0A2DD4FAB7E3E44EF18EF71E819B2118543917 ABHI
913,020,226 *5F05D03C702EFBBC7907911B1FD16973139B0B11 66 SIAN
913,020,227 *5F0F792889782E643CF2E647B2476B2F8FEE17CD abramjeziorski
913,020,228 *5F032DA0EA893BF39FC5A330403BCAE0CF9B5C5C «ABSLOUTION
913,020,229 *5F05342AC7FC501CF8C93DBB072CF31CD243B2BC 6FISTULATOUSES
913,020,230 *5F03BF3F945EF16E9D20F230D7F0B401A1CAB73D 6.GEMFIBROZIL
913,020,231 *5F03F700066AD86D37563ADC106CE5C6C7885F42 6INNBETALES
913,020,232 *5F0DB5115F25581B9195D3A09F1C4AA7332082B9 ACTING_COMPANY-'/&/KT/I//N/_'K/@/MP/@/N/I/
913,020,233 *5F03EB9B54982F291905676614AAD37A47DA9062 6JUOHSIAT
913,020,234 *5F0EE3CA8924F7F55EC104007B555C964310139F AD#4
913,020,235 *5F0DD3826312BFB11D1169322EC2582953D55338 6POZICIONIRALA
913,020,236 *5F0ED74F473563D525CCD8A9C33125FBBC43889C 6PURPLERUBY
913,020,237 *5F01C7195533A1697882DF65872CCB0C5767B25E 6SKTSELPLAN
913,020,238 *5F027D4C3FBC3A88AB9B02532D0C9D7537146D52 AE72&
913,020,239 *5F045BE70FF7D16DDA85C5FFBDB3B24412B82729 $71e77ed
913,020,240 *5F0D8B35330841A998BEB6BFFD7373027611BCBF [email protected]!0N5
913,020,241 *5F0C57753514D3E8AD7C23869D80F61B99C9C222 AEWT0
913,020,242 *5F021DC973FB8901576DCD44E77C02FD0F6E23B3 7BLAZERBRUCE
913,020,243 *5F0475D8757D3618A2AFCF8186DA0B0AEE3F4552 AG800
913,020,244 *5F037837D76A759BF72BF7C86837CCDE61776E51 AGREDAMOSES
913,020,245 *5F02E456ACDE821B3D1A234516AF733475B7125A 7FEBRUARY1326
913,020,246 *5F0D8AD693AC1D9272434E43194848E6D4DAD484 7KIMBERLYRACOON
913,020,247 *5F0A22CA8E591923A709C100243395755A5C7FA0 7-maalittomana
913,020,248 *5F0AC9F8AC3C8DF21FC5CA8C5FF26D044C8AA7E0 A.H.W
913,020,249 *5F06B91DDB12A05C32C1FB7CB81C3C992D32DE62 7PECHELINGUES
913,020,250 *5F08322633FD74C62FD38AE02A2E3AF3768A8318 A:J+
913,020,251 *5F03C3A3822E0C985A50CFD9E529C4B50A6BA9EF a)k
913,020,252 *5F0298929621EDDDC4DDCD4EE5E7C5493FF50F4C 7VENUSWHATEVER
913,020,253 *5F02B3192F3994216CD910163D3DDA5B40F4FAEF 7WRESTLESPEECH
913,020,254 *5F0802F46B472631E8EFF61CF34F1BCD0BE2D485 8###)-~(>-<)
913,020,255 *5F0AD0D6B7BC1B1282BAB7FCC8F42E31BC769D04 alaosrecovery
913,020,256 *5F0BD295F22E4FE69949164CD7C8B7261CE337A0 828623 ILO.JA.SITOUTUMINEN.SAAVAT.YHTEIS
913,020,257 *5F0E21760D796B6D550620B198D6DB9C7BE11779 ALDO.WARRIOR
913,020,258 *5F000F2E5B4CD90125C2CDB56DA23532FADE5CF2 8AMORMADAS
913,020,259 *5F0396BA5952E37738CA855A2E62FB845F4C295C alexdagr8
913,020,260 *5F05F19B285C6A614E67161B2F592FDA4F0DB475 allanfelger
913,020,261 *5F0496CC205105A707D02879C87EB66529F2A43F 8I53C+I0NA11Y
913,020,262 *5F0E2C7D28FADE43F7F319B279200A9702B9A17B 8JJOHNNY
913,020,263 *5F01FD3F95E59B79C088A1083AC505C30FE8AFB8 8KATHERINWILLY
913,020,264 *5F0323A2307217995CA896D3911B46E0D636263E alphonsobernsen
913,020,265 *5F0AF51C265FFA0C55BB83AC8D40F0AEE34C53ED ALYSIA STRADFORD
913,020,266 *5F0F0F1DD14F87C52E7783E60166A949A3C53323 alyssa-hoch
913,020,267 *5F0E0051CC9C2C00F45CC64248026B721692B661 8=====p~0-~o-)0(
913,020,268 *5F017046D638098294F5ECEF385228FEE93E8593 8#####p~0~osplat!!
913,020,269 *5F0004D8B9A6F3C16E762FFF55B639CDD4C59541 AMADO.TRAXLER
913,020,270 *5F0AC365046F729070C64E36157F765ACFC2670D 8PRETURASTE
913,020,271 *5F0F38B6F064F1E3D0ABB345DB37F99DF953905C 8PROTISKIVANJA
913,020,272 *5F08ABC9D0A3CC76F9C3C36CECB1F28DEDE53881 8R1$KET$
913,020,273 *5F035E35294DC422715EAEBE57640C06D73D2675 8RIVETAI
913,020,274 *5F0BB8E6153D488A66AFF4797FC585A74F98D751 amh(;
913,020,275 *5F0CEF85D744A701F65957477B1D76EA74BCC51A AMJED.HASSAN
913,020,276 *5F0870B78956E0939FF256DA99EF94D9E2E5D630 amol7
913,020,277 *5F01C5D45EBCC27B857006A02766EC810053D939 8TAOBHADH
913,020,278 *5F0903F771D6C4C2EA4C57F30129F8974D6CE062 amrit.sagoo
913,020,279 *5F0EACD81EAA0748A88C6F05D432BDF51CA6638B ams
913,020,280 *5F0A04D3DA6396A422D171F491C583F79D39CBCE 8ZWISCHENRAUMTASTE
913,020,281 *5F030BF032A1DB88C431A40D42A03A19A742E339 911sullivan
913,020,282 *5F07A03644BC5146DB30FA57568D260EF5E3F769 ANDREA-LEEMING
913,020,283 *5F08D343A8F9BC296CF8AD1A35D4849E84E41136 ANGELO.MERRBACH
913,020,284 *5F0C4DACFD8A7CBD8C624944CAAFA179AA8E58E6 ANGOLALA1
913,020,285 *5F047824148D239041F47E7B39E9FAF3781286DA anibal.jimenez
913,020,286 *5F0FC40D3A0957B2C383C5B36FD2CE8FAD91CE04 anichbsw
913,020,287 *5F0DC68E86CE5CAC9301E50E989E1625BDE79FF2 anoqw
913,020,288 *5F026841446CA0DF8BC666EC508538F2200422F3 ANTHNY1
913,020,289 *5F0CC8556F3FA3DFDD65EC422006E24F914CEE3C ANTI-INFECTIEUX
913,020,290 *5F0D1AB73FF473731E67150B40D0B7387FDA633A ANTON.PIKUS
913,020,291 *5F0AC6F1E5F4E26C3956EA1CF7730C340595683C ao%3x
913,020,292 *5F01E74CC63F0E5558163133DBFDB848840B0555 APANIGUELA1234
913,020,293 *5F0E37053431573BD19E4399935E9FC441C4ED10 [email protected]
913,020,294 *5F038A7C65924C410143F137DE6FB70F13B80CCB 9TERSANCTI
913,020,295 *5F0DFA5C6E532B82FC3D05366F404C9DD677A74B [email protected]
913,020,296 *5F009C417284000CEF740CB504BB1AA34452C683 aqcd%
913,020,297 *5F0FF9C9E76A32CB6865638DCCC1050071F546F3 A4IFS
913,020,298 *5F0EABE32E90BA3F074B479BF288E79FB96A3827 a55ump+ive1y
913,020,299 *5F053CDFA30497BC15F90289EB096FD0AD759722 ARMANDSPANNER
913,020,300 *5F0A26553447CE36118A9DF16C108B0A17FABC08 a=!+s
913,020,301 *5F02EBC12EB97EE247459E6F91EEBCED214221DE ashley.kl
913,020,302 *5F0964E22F0D0B57B79B764E4275171BE7AF940E AACMUU
913,020,303 *5F0716C399B0E8F64CE0DDEEEB418505655A2732 aswco
913,020,304 *5F06EDEDAB836B770461049EF1B051D94BC988D0 aatefie
913,020,305 *5F037AB246647721EE5875AA080D64C7B282B47E [email protected]
913,020,306 *5F0D08117A41CF9BF7D026C528FD307B912E5625 abelbowdich
913,020,307 *5F0D62AECC4D488BC6141C9D1781974B3606F0B5 a/=#v
913,020,308 *5F01A5CFA17ABCB47B614C55717C45D8EC695417 ABGERUFENES5
913,020,309 *5F006A0D16C78BB84423AA30606FA7F2D476C1AF ABMN:
913,020,310 *5F0E361A1EC031B6225FEFBA36C1B026A17F4F54 AVERYHAUGHNEY
913,020,311 *5F09FB47D0503ED8BDCC2C15B7F1BD6B2C3C9CDE ABSURDIN3
913,020,312 *5F0BB330C8EA88DD9059B324FD825D8941634482 awq&r
913,020,313 *5F0EA7B0A6444867184AF342E65D8793389AE0DD [email protected]
913,020,314 *5F005446ED992958074DA86A354CC1A9F06795B2 AZ:P
913,020,315 *5F0368A204564C1F2FD955BC06B85A10439FE9AA ADALBERTOKOTUR
913,020,316 *5F00B080208736C54057ED7C37727EE929C4355F a;d&d
913,020,317 *5F0306F53DD7C87400A86B0E74EEB92CDA99A178 [email protected]!7h5
913,020,318 *5F0D0888EB731EBCE332B848277DF1CEFD5D43A2 b4=-7
913,020,319 *5F040A21BDFFBE0A5F5DD47A7C1E301089B672EC ado.de.datas.star.trek.la.nueva.generaci
913,020,320 *5F03BF370932770210FE4C33E085C39AA12AFDBE adolphlawford
913,020,321 *5F0B49AAF473650794BEA5D2001F5340E5B77AE9 B4_&P
913,020,322 *5F0E566F7C1FC2CB082CDE7B5EEB0870DD4E9B98 )|@BAA
913,020,323 *5F098CF000E0D817B287FD07D0E1AF1CD00EC964 afonemobile
913,020,324 *5F0BB941D781041FD7C2348660549B8CA11A3FF5 BADIATA8
913,020,325 *5F05BA06FE82DDE56030B0D51C39D43FA1C87310 agn5a
913,020,326 *5F04195B3BE661D199EDEC31C871314B574369DC BANGLED
913,020,327 *5F0F790D141943DC6E1469737D03CEDE2489EB47 BARTHINE7
913,020,328 *5F0C87C5F57E99F4D415BFCBE2A3B69FD12C2C02 aianwatkinswikipic
913,020,329 *5F0BE15A126860133DAFE7DBCB80653237AC097A [email protected]
913,020,330 *5F0FCEE58F25C9506DED04D73F551CE6F78F4B4F BBOBBR
913,020,331 *5F0B81C0B5049BECCF073A2389F18DA35A9E9B07 a%k+#
913,020,332 *5F072541C804A1FD295C3E0FE869B9A224568863 B%CTI
913,020,333 *5F0AE03E0B56C1AA6621C63D9EEC81ED7D14BCA8 bddjm
913,020,334 *5F0532AD18BD34149B28BC1EFD9614E269C11150 BEAU.FRAUENFELDER
913,020,335 *5F08A81C90A198869E755C0B6E13B06F49192C07 alexandercuffie
913,020,336 *5F011F8A96E7559D4BCB0D263AD8642B1DE634C4 ALEXANDRA-TREMAYNE
913,020,337 *5F0DCDF25945FE96A6AE13DB8CB7EDBCEC9567EA alilbit
913,020,338 *5F0D9376CA906C05CC0A618DE4F886A0874BA46B alj
913,020,339 *5F03E9E01D54F96C2E815525FFBC6EA11014AE4C ALLANSALLEY
913,020,340 *5F08ABD1CCDDE6C59142093E5253CFA55D47A675 BENNIEFALCONER
913,020,341 *5F025608E5F1C2286F4CF8520ECCC16F384307ED ALPHONSO.KERNEY
913,020,342 *5F02D2A7FD5D10E5E337D889D74D640A8B292A33 BERTRAMDOSAL
913,020,343 *5F00AEFBE86212FA51C1CBD80FD37834C4BDE884 ALTONWORBINGTON
913,020,344 *5F046EA76DBF25976AD704A0A9B84EFC02705156 ALVUEKQ7
913,020,345 *5F089E4F11A2BD505FAD89F3B4F6AE83546BACB3 B=:FK
913,020,346 *5F04CBE02D5B5C4D448E0297EAA193C929D76EBC A(M%C
913,020,347 *5F0CA727AA405549DD65BADA76E3B397B9D2FA5B a"#&n
913,020,348 *5F06AD63D324D6CD9A153BB8FF7EF644C9D001A5 bhms#1
913,020,349 *5F093F001B94AE7D3CF1536B3953F549B1EC9192 B_II7
913,020,350 *5F0C0488D89F5E569B261E8E1058EBF85A559073 BINOBRODKAST
913,020,351 *5F0A8EB8E59BC88EE324E53722342F89CFECEE44 ANGELIQUE-PRINGLE
913,020,352 *5F0783E016E2A7637B33DC933A8427BFB715422D [email protected]
913,020,353 *5F0A19CC537A1102170D24FB31E8D6C7551DC8DA anj(p
913,020,354 *5F094A305988F8CCE2ACE24DE0BAAEC32655A42F BLACK-HOLLOW
913,020,355 *5F054953C808FB8618232CD19F1F743FA42E1D32 BLAHPP:PASS
913,020,356 *5F02398FA08027D58B517087BCD4945BD1E62A81 BLAMAIENT
913,020,357 *5F08574C82E71A478FA31F3D7D57B2A9E5E79CC1 APARENÇA
913,020,358 *5F08A2E47B5C69CDF208065476C4F30D7A462E6B BMIC
913,020,359 *5F0EAF6A991281107CBA31C1908864EB87A89D19 BO8?U
913,020,360 *5F05D94817347F3E5D4B74927F634504F7FB03C4 BÔBIN
913,020,361 *5F04630FF068ABD1027F76FA73FDD9CFE3CBC1FD BODISON8
913,020,362 *5F0499D71B39DA162A0400044653C6205FC41822 Bo"p
913,020,363 *5F0A84D223E210720F8C34775D748EBD20C1DE09 BORIS-VASSALLO
913,020,364 *5F065F6C153BEA700783050DF08036CC997E371D BOYNTONHALL
913,020,365 *5F08FCCC8EB548F35FAF33AD69E330CF6F05F061 ASADABBASKHAN
913,020,366 *5F0CFB6B93CD56603ED014E485ADB0F2DE59EF80 BPL%_
913,020,367 *5F008C25BE7B937E7A50BFB9ED2222C49356BD8C as#uh
913,020,368 *5F0A9073DBF45B4840A47FB3C96159AC03745D09 ATF
913,020,369 *5F00FF9D66B8853DE52BD226FC309C7F989B1DAC AU7MQ
913,020,370 *5F052DDE53E1BB2B21465E68A608579624869826 BRITNEY-SAMORA
913,020,371 *5F0A7E80473E856296BB55B94EDB87EB6BAAE1B7 aupo.
913,020,372 *5F0C49081725682DE2020500D2C34F9CAAB52DFD av:b5
913,020,373 *5F0C149E4A2F2252BD17A8AEA3CAD9520CF2A493 BRYCE.POTACZALA
913,020,374 *5F003521281ABFA73671644F896B376ACACF2874 AVSVM
913,020,375 *5F0AA041B3938370E82343FC7A83AECB12EEDF0B bsu
913,020,376 *5F01134BEA4B84FFFE72BF60B7ABA72457B60CF3 B/2&F
913,020,377 *5F07897A873AD97F9BC1FD3F439EBBC1C64843A3 BABYCOME(MILTONKEYNES19950729)
913,020,378 *5F0492AF3D3B6824166FE54FD35A8F7B1F1CA2B7 C.0LB
913,020,379 *5F0987C86202D3E07076D7C423918EC2C6BFA1DE c3#d6
913,020,380 *5F01AE90E6BFC7C2F93DCD65ACD857852C31CC5E BAUHAUSLEHRERS
913,020,381 *5F09EF6D286644ACDAA0F26BBB05F1F4BE7BADBA [email protected]
913,020,382 *5F0B49683CE57F513E458129006899A6C89ED4A8 bb;kh
913,020,383 *5F0976E46E7CD18E6617D946F8A9579B43C59DB4 C8G;#
913,020,384 *5F077986C57B62856434550F37700A8E60D737D6 BEECAMP6
913,020,385 *5F0DF01CEA167FBD5EE6E0E375323F721F7123ED carmelocilley
913,020,386 *5F0098412580A0707CF3BA26ED0AF76AABAD108A CARMINESANDT
913,020,387 *5F06B2790D4E92CAFD74D31DA4A142800055FA94 CARROLLMOCHEL
913,020,388 *5F02A65F45B5DDF8F950CD587D9DF763AC552798 carypolowy
913,020,389 *5F05390F4750AD7F2EDAAA0BD4063A1814746FB6 cb5lm
913,020,390 *5F0A9164B1E7ED8A0064EC285DF40ADA4B67DB68 BI6E)
913,020,391 *5F0EE70A298E85FF758BCB75DD4819A569EA5EB8 BIENDAO
913,020,392 *5F0E9B4C940E2E46C3D2D0EF708F7C89CDC93B4E CDEL1
913,020,393 *5F04B4496BC17C2E4AD1916741BA073CCEAAF984 BILL KIMBER
913,020,394 *5F0C4274EFCD22108D39F6382CA773BCADA2E19E centronatura
913,020,395 *5F02DABFF89A8A8556F3D70EE8DA4703C44C2C71 blesksensgraaf
913,020,396 *5F0DAC7FB7BC4C0894698FB9512FBF5151758BBC CHANG.PUFFENBERGER
913,020,397 *5F040FCCBBC17F163DF804843FD197282F3D3AAC bn1oa
913,020,398 *5F06BDC54BBE4A80A022DCBCA145ABC505ED1F9B charterishesketh
913,020,399 *5F0C1B648C58E63C1324810C726D797BF4AC5B89 BOGUSLAW.JANECZEK
913,020,400 *5F017AF4D5BE90411AD31B5A6E35A059E5ADA299 BOHDANUS7
913,020,401 *5F0B529205C4357BE7FC9C0DD1984800A7201423 bojsc
913,020,402 *5F0FA98341F12632F6FEDC2522CCA195053ABDBF CHENMUPING
913,020,403 *5F0AAB97E1DBC199159E0BF6033C0F82E48AB97F [email protected] ~o ~o (>_<)
913,020,404 *5F0ACB4F7D6F9CB9A93652AC2818B2D2B86B56D0 BOOKER08
913,020,405 *5F08A95F934AA678AB5D8024F26F904F812D6A02 b--)~o~osplat!!
913,020,406 *5F0773CB0F36EA01DFD5E941A323DB196B846C60 bo-ra
913,020,407 *5F0853A5C85A957CCC17743B000669E7CB0233A1 BorninMenstrualExcrements
913,020,408 *5F01A0D72381F58EE17018C768E47623A1709ABC CHRISTOPHERLINDEMANN
913,020,409 *5F03EF4D34DFC66A792BA445450BC32D08B85003 BQSS,
913,020,410 *5F00A5587640C7A25B7779D53BD72B7F63594A5C C(IU.
913,020,411 *5F003E71E34464573CDFA9341CFE1DE76D9C0108 CLAIR DE LUNE INTELLECTUEL
913,020,412 *5F052B218E228207F86955809BB857CC34651769 [email protected]
913,020,413 *5F04DCFEE476C2BCB1157E2C7A4F97F59BB75E4C [email protected]
913,020,414 *5F0F676334C6F5C2D8D5912238FA44F6FD3BC8BB CLINT.GIRMAN
913,020,415 *5F085E2C150C04B3A596E02E0CABC04F0F9476C6 bsu
913,020,416 *5F0435465AFC508BDEA0FDD5BE123A29A434E1F2 clubatleticodefensoresdebelgrano
913,020,417 *5F0E94E5CA4440958D481DB0F469DCBE081B6E12 cmblo
913,020,418 *5F09975C7F997B6B34B9EA6905554CCB4B82B11B computermuseum.orgwww
913,020,419 *5F09D982C36CC915DB78B140B205FD90B02B66E6 CON5ULTE
913,020,420 *5F005AFD4FAEAE1F642B6E079B45B1BC21948D22 b_w#s
913,020,421 *5F0F1E4BC26980FB78F040C64C4E01422D8B3EA2 CONNIE-HENDERSON
913,020,422 *5F05B8984BD8636FF77051E8CA6A3A4A622A9668 [email protected]
913,020,423 *5F03594F66B6FDD32A7D0C729F71FB1E89EA7693 CONSTISUTIONELLHMK
913,020,424 *5F087E641BDCD909C71BE4A6B6FDF9EE448DEBA6 co(q$
913,020,425 *5F040DBBB32B4F7893E2B3F648B589CED74CCCFF [email protected]
913,020,426 *5F0D96BD1784D788B74B56D39E09C48FDB377C81 CpEL
913,020,427 *5F023BECAB1C44C66F30A56B96968A414548790D c:\program-files\common-files\adobe\linguistics\4.0\providers\proximity\11.00\lit32.clx
913,020,428 *5F04A04CB2C37440E1749926144A673C47835996 c7ymq
913,020,429 *5F0A15712EC607E834D673C07EEF2A7919CC2D07 Calvin-(Dub-Narcotic)
913,020,430 *5F0D16AA7923F676727FF346EC34DCA4288139AD c{am
913,020,431 *5F08EC44CE54B5216357D057AE68E2C689BAFF61 CARLTON.HALBERSHTAM
913,020,432 *5F0337C3CD9DC68D997FE2D62A16443CA95043EC ct?.(
913,020,433 *5F054CF838DA525E60AF12E1E95CBC1FB07FE192 ct9)6
913,020,434 *5F0103822BC891441FF99C3C5B600A6E6174E7C0 ctq;s
913,020,435 *5F0D2DF099E0D969E8C109E5243FFEDFAC4FBB52 CARX7O
913,020,436 *5F0DF761EA65F1DA1DC6C6253E67FB3E0D62C9A9 cuc)?
913,020,437 *5F03215D89A0659788DE6A1D9B2D38ACAE497938 cascadite
913,020,438 *5F03A01DA882CE99AD8D1399DAB9C03786DA59AF CATEDRALFINALFRAMES
913,020,439 *5F00EA6CCD6984C03674484019CD4D4F2265F7BF CATFISHSADIE
913,020,440 *5F09F12E8D83D068B4EFB447BBEED507CE9FD9DD c$!v5
913,020,441 *5F0B7E8337E36D0FFD9EAF01C555D03993BF08F1 cwfus
913,020,442 *5F05DC15AC4121C7535117F858D6C3F59DC532A0 c&de
913,020,443 *5F023F131B09D047D6CC3709E2AB2D596A386C4E CEDICDALLAS
913,020,444 *5F00FA557D3FEFBDE2DBE4FE8A2471AA47190140 d0ryk
913,020,445 *5F0F838E8D9A85B737657E51F5CE0C3CA0052AF9 c=#f#
913,020,446 *5F0ACCA7D30FDF16A30DA5B25596C86F0C877F53 d2$dg
913,020,447 *5F0F40E769F36FE56F22F3F95FB0D45B2AF5D557 CHAD HUMPHREYS
913,020,448 *5F09184B8A156F0B4789FF2722CA269E76607A65 d7tpy
913,020,449 *5F0489269038964F914F80E6A70993CF892C59AF CHARLTON.DAVEY
913,020,450 *5F0BFB6A6F704D0287B71D111AF25C9CBAC3F4DB CHAS.WALKA
913,020,451 *5F03622A0D249E3CC07CAF494360CA2440595B04 dadinretam1
913,020,452 *5F039DA33C3ABB741ABC96D33D04C2D7F14CE367 [email protected]
913,020,453 *5F062D9E16D1E9DAC6AA313C1AFC7F0E8882C08F DALTON.JODON
913,020,454 *5F0414C0D3E24F16006DBBE07B8C71CF61AFD4BE chev)
913,020,455 *5F03749719AEDD246AEC365206567CC3D28E449E choclair
913,020,456 *5F028E18F0380D57FF0B1139F734A11DA194FDC7 DANNIEGEARHEART
913,020,457 *5F04196AD3E8C42CD545B27C40F4354ECE6E728B CHRISSY AMMONS
913,020,458 *5F0BA7C10AD44F5EFC11C22F18D9E1AFD84F8DE5 DARINBRENTANO
913,020,459 *5F059C0DF41031E33C89D8F5A730B7B16953043F dariusohler
913,020,460 *5F0F0B7EA1D44E8C24F0AC67C2FD862CCBAC3A51 darlen30
913,020,461 *5F0A9094889729BFB83934599247382BB3E11B46 CI5B
913,020,462 *5F0FD029447C312F48505E905E1480431E913AC4 davisklosowski
913,020,463 *5F01A1AF59F902B0D613A57E30C382C17BB19A7B CITADLE2
913,020,464 *5F07F5C6AD1C52B29C2E40576F30E19AB24C8B52 CKAP
913,020,465 *5F0D1C1EE089A959C089FF3D8D027FD60C3B80F2 dciua
913,020,466 *5F094CC037E3AA9FD2AE4529C184D6F1ECA1AD21 clementwatkin
913,020,467 *5F032C49A89FB52C85CCA3FA7340523F2ED9C416 DEANGELO.MALANGO
913,020,468 *5F07371A53A52C1F4165064EA6C29BD5CB06DCA5 dediugerp7
913,020,469 *5F08F3D44D89709DAAFF6F11D734743077D0C762 [email protected]
913,020,470 *5F01B039B31A5EAA71A415B49454C99000F2A53B CLYDECORKRON
913,020,471 *5F0D67C15984BC61ACD2D745B5574C9C2BC365C5 DEGUSTIN
913,020,472 *5F0CFC21AE71DCB266918A261FD5BF637EDE3B26 DEIAN!
913,020,473 *5F04458B0184643DB21935B5DC71A0AA8997A43A CNCDRNT9
913,020,474 *5F052046AF07D7AB9EB596A73912A2B9ACE20D6B DEMETRIUSRIEDESEL
913,020,475 *5F01A07B1D815E573BAB7E4F16D53067020A4EF7 co4nj
913,020,476 *5F0ABB70AC15373BB9EDF8D6031971F8DFB0B1FE DENTELL
913,020,477 *5F0AECED4DEDDE8D805EBB93B8D8110035B56502 COLOUR RED
913,020,478 *5F0C22CAE0E3B35B429D18914B2B99959D32EB2C CONDESURMARNE
913,020,479 *5F0E22B88E0E03210446B7BD91D21151EBCDE0E4 dezidoin0
913,020,480 *5F0A03B3C636A4C54B8E4B2B8CE2CBF843DA5432 COOKIESANIMALS
913,020,481 *5F046EAA0F73A75511ECECB17AA1EB4B71DE1A6F DGVUE
913,020,482 *5F0089722DEF277D918D51B9F0DE7147FEFD1374 dhar#
913,020,483 *5F0D932F00E0D088F99422FFBC71C4E0C9343016 C_.QP
913,020,484 *5F05FD607B14E725A15337051077B94CF4FFE9A5 DISCHENGEBET
913,020,485 *5F0FC4C6B4AE9BDAF72903B17E24935187E6D4E2 c"+sm
913,020,486 *5F09C6DC25C9EC1DE23D9F495BF4968067C25D16 cxz)r
913,020,487 *5F0345F47E29B409FC90547E012B485139A10C54 DOMINATION(SHORTMIX)
913,020,488 *5F0EFCAD952B2423BA2506DF4F58124BB70AEF6C [email protected]
913,020,489 *5F0C21230BA3F53645EA7F7A6FF22B5DF23220C1 donnellsilla
913,020,490 *5F061EA423F94C722E1F6CCE3199B809E2B54CE5 donramsbottom
913,020,491 *5F0FC5E00BA4202873A4C0F0C32201661EEBDF33 DONTE086
913,020,492 *5F009DC7791585BF04A5545A5A592E4EF0DECA76 donteboisuert
913,020,493 *5F0C466702C271EE56B4095CE28F2C29E384DB77 doriancarleo
913,020,494 *5F05426BE49D12FB7D617B0764F6A1FC2D1B3579 d2abe
913,020,495 *5F07A9F4539ADCE71CB0C76F02B439E5DA3DF090 `-d=p
913,020,496 *5F08B2B4F00CD2C5882B027A7721217514F99A6F D.P#2
913,020,497 *5F05BE3874B51F51E3F5F20F902CDE0A5715F422 D4VS?
913,020,498 *5F0B80D9062B5A2432DD021CFBBEC0707F455CEB d6s5:
913,020,499 *5F0555DC35350C0F720CB398F1134BDA6EA45374 D8YZD
913,020,500 *5F0E22C67746B588B3696C45A1A5DD30CC79C501 drMickey
913,020,501 *5F004C3DF0E3E9AA11A21D06E67F4CA6FB9F96CD DTKEC
913,020,502 *5F0FE5120E92271252FC0AE5494E0131BA882E2F DTXF)
913,020,503 *5F0AC7B0064099655627035832BD2C7788C03074 DUCKANIMAL
913,020,504 *5F04BAF994E9CF1B9EB33F35E7927EC3CA5B0274 darrinepson
913,020,505 *5F0E443F59E540C30FE8DC552933F7C40FB7ECE1 duncanrewerts
913,020,506 *5F058D4E2F683BF8A1BA097FB288FCD3E77BAB93 darrylsalce
913,020,507 *5F0C393F6198928A9736B9CE12B3FB3DE4CF2326 DARWIN.KAVA
913,020,508 *5F038349415782C3E78B932E4A8EE83D3BC95CEF DATABASE及び英語版を参考に執筆させていただきました
913,020,509 *5F0FDB407805273C602E0E3B2A00FEC8A5E65C72 dwaynedewispelaere
913,020,510 *5F09FBC135B7C8BABB0479ECB444E72DD3E49BA8 DWAYNE.MCELWEE
913,020,511 *5F0F5F65AA2F4EF7B73790530C99B30C3920615B DY2+
913,020,512 *5F079570B67E2DC13A40F324A7A8B734ED024479 De-Doemarwatjes
913,020,513 *5F002EED39D0F4572675FFB5EB71F2C790726372 [email protected]
913,020,514 *5F0B153E1A02D6233651BA57F56970CDB67F23FC EBLEPATSED
913,020,515 *5F066899E9812685DFF9DD1BBA1EC7C52F102376 dei(w
913,020,516 *5F02A27277CDE14C73A79F009ECFC4CC20CA8759 DENNIS.MAYEDA
913,020,517 *5F0B4D9079DF3D81310492CA095CBAF10363AC29 DENVER.TETREAULT
913,020,518 *5F0FFB12E68D0BADE1036344AC609BF56009A779 EDNESUEL4
913,020,519 *5F0E88D71AA38FEF264FE9BEE89FBC3AFCC17562 DER.CLOWN.(SINGLEVERSION)
913,020,520 *5F0E1FB298F193EED3B03E8F41F2EE35CE0B6B45 EDWIN.HUNTER
913,020,521 *5F060BDCBAEEC729665CB02C4483E6C1FA828A82 EDWINNUNNO
913,020,522 *5F06029073718271D5D1977DCD6B8C9E20002ECF desavouons1
913,020,523 *5F09006F4A6EDF82BA71B31B17264FBCBC0C82AB DeT
913,020,524 *5F0CEC31C9F10F65ECD73C56D72638799808E9F9 eh/?a
913,020,525 *5F05A5A04183E152B684D4577749B933D7084FB4 EI)LB
913,020,526 *5F01308265220DEFFC0D4142346081FE8DA03191 d=g:g
913,020,527 *5F04637097CBBC8D3F52DBB22C816BD54548E796 DGVUE
913,020,528 *5F07BE8A15783AD6901165B3E44203529ADEC588 ELISEO.MALLINGER
913,020,529 *5F0F70408459031A8F2B9CEAC8C61EBE7BCCB1C7 dickpadley
913,020,530 *5F02628766F565385E7737CD31D7E4137B5929E7 elizemartinez
913,020,531 *5F02FF2433305F1997FC3A29CD512A9DECEFD4CE dil;d
913,020,532 *5F0BCFCCCDBA650EF09C8C409FE3422AA23BD873 elroyserles
913,020,533 *5F048D5AEC97DFF85BED8DEDB1EB9397A844A6A3 dipadua3
913,020,534 *5F02D504767D5F2477251A62D1C90CC37F0E7098 EMILIO.KARLSTAD
913,020,535 *5F0910F93F745FA424E8A2ED20D0E792EC728608 EMILSTALCUP
913,020,536 *5F056E9356D90705CB3ABF2649C02428ED01DB78 emilyspemily5
913,020,537 *5F0EF70093E784DC238AA973761EA51919EA5037 ennevarc3
913,020,538 *5F0A92D64F591A1328B90462B91A9EF630C5045A ENNOVSAKED
913,020,539 *5F05DC1BB9A7140F8881893C466D112173F88464 D_.M_
913,020,540 *5F01BB29A8C9BEDB5575D9A91F3AD6C655CCFEE0 eo31a
913,020,541 *5F0CF5F66130ED3B5BC64FFD6BDE448D4E6CF56B EOB=7
913,020,542 *5F06A0045A5F442C09A6DFD95271DB5EE08473F0 ERDNOPSE5
913,020,543 *5F0D574AF49013A729167839A06BE362DFA9D231 doduadrian
913,020,544 *5F0AEA6BCD948B1A64A63996935361E6E1A2C65B erikblamer
913,020,545 *5F0F1F99A936D1FD78B5F9B174B71026ABC5B03A dominictietjens
913,020,546 *5F0EDE350DA3D8AD454EC46630243F084E7EAE5C ernestopoggio
913,020,547 *5F0FD6A2AF9C78607E680A512E69C62F015C68F6 ERNIEMARSALIS
913,020,548 *5F05ED2BE957B7953FF1942DC979FA28ED607314 ervtseef3
913,020,549 *5F09241F3A76AB78D23683C3BCDD46B6852734C1 ES4BL
913,020,550 *5F0BE46F542285E2FEF0AC70C743110D1FD60AD4 ESHAMAN
913,020,551 *5F0B3740F94C22F169E333D8FB95AE9E373813A1 do-pw
913,020,552 *5F04B5751DD14153D1736247D4F52E98F6C85BBA e.stratmann
913,020,553 *5F021B5D623C376FA2A04D2BF9EF2EF927BDB2F4 dougbald
913,020,554 *5F00F0970638FE3E880A674AAF3BED8016EC47C2 DOWNEASE4
913,020,555 *5F0FEC7064A182C17B4A6DD84CBCFBAB86824C5E DownforGood
913,020,556 *5F0CAC0BD963F710DF35C2660E05B747C33A6363 e,w~
913,020,557 *5F0E33BA0B742915863E553194A8C9C813CFEB8F [email protected]
913,020,558 *5F0A190F9A476A5C31A814E955BC8FFF77D0340F DR:LJ
913,020,559 *5F0E5D9104229A5A3FE1A2D74AE55576280D49FA dr. marten dental plan
913,020,560 *5F0DB8CED1370930A1CADDD47AE215E2F5DD87F6 dsh=
913,020,561 *5F039D036FE0073DDA1481A27383A3720EFF9C4C ds^z
913,020,562 *5F00C6B9D7E6DA814A503A71CE561B57A13CF1D1 fabiantagliavia
913,020,563 *5F043953AC2D8AEA3E3515BF6241141E1E184F32 dtrw
913,020,564 *5F0F814747203A834D876106D6FA5B1625D22417 [email protected]
913,020,565 *5F0C94CDDC1864CD394C16A2B1B6097D3ECC69ED DUCKTAIL
913,020,566 *5F0052334765468FDDDD15E1DAEC167CC9DC758F DVL/1
913,020,567 *5F0D7CD0CBBB33B5C84BD9AAA52D0B863050424B D.VN:
913,020,568 *5F019E68C206D7292652B765DDAA6A313B18BEF8 DX!DK
913,020,569 *5F0CF231C989DFC8F74784624B5A2EB040DB16B4 filf
913,020,570 *5F0C8A99D93395763941DF0503DC6B611F1DD080 ea,h:
913,020,571 *5F0DB32D0FACBD7E6324DD2752CAFA3D6AD634E4 earlegregorich
913,020,572 *5F03647E853C4B593EE495330BC69DB11C195C19 flessivo
913,020,573 *5F0B94071FDC2777F78E04E884162AD375460CB9 ECCEDIIDECCE
913,020,574 *5F0EE141006191F6300DFA19B38F0BA51F5D80FB FP6'
913,020,575 *5F0A34B5D8D3B4E959A3C98436F56C78629752DB educach
913,020,576 *5F0733875C45FAE00FCE4ACB1CDAC72C829EF950 EGKCO
913,020,577 *5F07D8D490E7737549168D2F5586C09677289A25 frescos
913,020,578 *5F00976BB2EEF872155D533463FD87820FB82823 FUSIONSBESCHLUSSES
913,020,579 *5F0C68905EF54AE95D6B6C85A13C8FB25D8199DA f[vb
913,020,580 *5F0A8A6E2896D0C5F47D73EC87961928F15E5B10 ELIMINATTE
913,020,581 *5F0E51489FFC3B298B7477F64E8E43759F8D2B07 ELLFIELD6
913,020,582 *5F0CE69EFCA6831EBA6D72B084EB7AF37DA2499A ELLIVSSU2
913,020,583 *5F0294998E37DF6EAD0D490783320AB7A3431952 ELVIN.ARMISTEAD
913,020,584 *5F0919E16D408885A184357868F1038A6416911C EMERSON.GRODER
913,020,585 *5F0F75BF073284DAC615D42F0042E60BB9EDBA45 GARLANDMENHENNETT
913,020,586 *5F03BC88B201AEEB80BB5747CC48149074683DFE EMILIOREDLIN
913,020,587 *5F0760FBD5386F4E5B07967139B4510C1CEAFCC5 GARLANDVANANTWERP
913,020,588 *5F0DD2B95F9C29DD0D5B41365FA5CF8EBF050D57 EMMETTCROLEY
913,020,589 *5F0B361750394FAC0F859B53D13E61AC10DC1273 garthgaboury
913,020,590 *5F0DE7C17FA3817352516D435F97E9B41E61ED8A EMN,H
913,020,591 *5F097244AA8F506FF73A61DC6F200D79206CEAAF emqr?
913,020,592 *5F010D7F749D14F451FFC094F536FD31707B967D ENCAVALGARDES123
913,020,593 *5F01621C10723E186661680359B8738101FED96A GC\(
913,020,594 *5F0375E8C9D8228D85D37B70DF1CBB3A21D65711 gedeostene
913,020,595 *5F01EC14E75A2F86ED741F2C440A35275BAB2676 GENAROGRUNIN
913,020,596 *5F03C3F9E38DAD9800457277AD5AE0451C32A812 eoab:
913,020,597 *5F0CB44C9943342849DF65A453BB5E5E8393600D ERASMO.MACDERMOTT
913,020,598 *5F0DD7A613588329AA1023D7E30DD6E527CC05B8 erasmoyakel
913,020,599 *5F0A880B264612F5FA97EEBF6485AE4CA9C51016 ERBIUMNING
913,020,600 *5F0579D1BCA7BC38185105B981B49BC8297D9395 erdah
913,020,601 *5F03305237F0D51943A71F32136DFE7A637D4C3B gi9\
913,020,602 *5F03F056663D816F074CB6872287FA00C8E4D6F8 gilbertokaleohano
913,020,603 *5F0133ED06CCDC7F24F6D142E1FA7C1615F717AF erniegibbard
913,020,604 *5F0B1E5ACCB28A52988D9062DA598D8DB9DBF4A5 ERSATZ85
913,020,605 *5F0B472065484E042641A9A43E7435AD267FF374 G}KP
913,020,606 *5F04343CB438266338755C012440848D24E0EEAA ES#L.
913,020,607 *5F01F0590BF3C2EB791A1077AEE190DC7C843C0A g?o8
913,020,608 *5F04A47DEF6F3630E59E9EEB132E1FED1803E38D ETOILEFOOTBALL
913,020,609 *5F0BF3D08E5266EE1B482357A88D2F430A5A0471 etsesoma1
913,020,610 *5F0571143121EF8004213055E2AB7BB74BD2A820 [email protected]
913,020,611 *5F01BBA8B0D39F30195323BC325A2B87AC712CF6 goosetree's
913,020,612 *5F019FCCBEA7A6115AB1B2389C2CAA1D7ED3749E grahamcerva
913,020,613 *5F062D27E00A07B26FAE1875C11A515E6779FBA9 EVTNCOVMYVGC
913,020,614 *5F0678D09EEFF675C370AED67E4173BC263F6BCE gran.canciller.de.las.indias
913,020,615 *5F04C2BC6258DEB7B67F305BC117AAB325C56329 [email protected]$
913,020,616 *5F06A21BD52A7586341C0503339671B95C67C93C EZEQUIEL.JESSEE
913,020,617 *5F0780C0955D2C2B5DE841F05637FFEC9EBE3B14 grumdop
913,020,618 *5F0A2CC53EFE5B88EE94D8F881ECA6BD5338390F GUERILLAWOMENTNBLOGSPOTCOMGUERILLAWOMENTN
913,020,619 *5F087D7860C5ABC613555426438EFE590C79ABFF [email protected]
913,020,620 *5F0E7D456F716D49627117B00BC9F9ED7EF4E9EE [email protected]
913,020,621 *5F05F7A250F1AE9EE8DF1F04EAB9957834CFB200 [email protected]
913,020,622 *5F016DA47608D20FED17791CEC5D3FC51779B905 FANTASIA-IN-C-MINOR,-K.-475:-ADAGIO
913,020,623 *5F0888474233FB3D157665EF624E6522829E91EA [email protected]
913,020,624 *5F0C18E4C6655C3B3573422AB0250E01255EDD3C [email protected]
913,020,625 *5F077EDAA0C7DCF1B418E6AFA0E5D4CC5A843A6F farisabdat
913,020,626 *5F0D91C56969CC6FE233C6E95262921D5837705C FATRICH07
913,020,627 *5F0B7FD347B5661DA747B8A60EA1279034E6B6A9 GWCLARK5
913,020,628 *5F061F0DE54FAB4C80FF3FD9B46A5B065245E212 gwen-mc-crae
913,020,629 *5F0A63F89B53A11C6FFDDFBB861CAF89D2D7892E FEARDRIVEN
913,020,630 *5F00E9FB0494483F315BBCE54429B58D33EBE1AC [email protected]
913,020,631 *5F09B5C27E511A99F4F5081CE8D495BED2974EC2 halal.ahmed
913,020,632 *5F0AD5796145A845DF31D9286D5B297E823E9F76 FESTVORSTELLUNG
913,020,633 *5F06A217B572992774BB2813469711AEAC7F9152 ffohrebo0
913,020,634 *5F07549D6428EEFE5354F05EA5FAADD0797A0E95 [email protected]
913,020,635 *5F0B40BB265C325897E3547B7313887F7BAB4D82 fieldaranotuujou~sentou
913,020,636 *5F0F8E9529847409F648FB7E4AA777417EC1FEBD [email protected]
913,020,637 *5F0B8EF13BB7583B2E7A878858CE8141E4E228B1 [email protected]
913,020,638 *5F03FBB26D90395C84B7B0405A9AAF5FB6F649FE happystreet
913,020,639 *5F014782696604BF73E9A26BAA39CDBBCBF1A1DF HARVEY.CARLSEN
913,020,640 *5F088A66EA178A8D5DC3372622361581D50013FF florentinobrodfuehrer
913,020,641 *5F049C0E8EF250E0941711030ED5F0D28B30F73E FLYERS1SANJOSE
913,020,642 *5F0ECABF077CFC2639676B866CA2A4B72FEF1B3A HCRIMSEB6
913,020,643 *5F0148005CFC09529315D0956835F4184D0FE759 HEATH.SPOHN
913,020,644 *5F0F19F63BEE090BD0A1652A6FAB63AB586F8A9F hedningm2
913,020,645 *5F06C52FB0CF5B3DA56EA88066F16BAEDD6EF584 FORREST.EDMUNDSON
913,020,646 *5F0365108D3EF22E33FEA6B34A7D0D436909185E FRANCESCOCONSTANTINO
913,020,647 *5F031E964B90AFDC90306A3A7F825051C8469541 HENGITTV5
913,020,648 *5F09062D9B13D1340F38FB8197C740AFEE891AC8 HIPOLITOKISLER
913,020,649 *5F06D3D47761E896D64A0B1846BF2994CF4532D0 hiramgutt
913,020,650 *5F08827E93D35827B1D1D5E9D8C7AE526973225C HIRAMMAGNO
913,020,651 *5F0AE2FD36B9DD4279C64008D36B03000935807C FZSRT
913,020,652 *5F09A2B8C8CED3E352CAD01DB9035D99B61CAEEB G162596
913,020,653 *5F054E568F20D001D0CD8A2360BC8E767FC9DA96 G3HS
913,020,654 *5F097323C78A1CC577EC83C920FE3B597A0829F6 honeypickle
913,020,655 *5F0646159E7EDD1ED24560D3B5AD908FD1B534CC GAOPM
913,020,656 *5F000D35F69366B696313EC4FBF34488684C3193 HOTELURI.(CU.MARIO)
913,020,657 *5F0D77F2063C9C4096E8F561E075621403554807 HOUPPERONT
913,020,658 *5F0B7ADC0ECC7224BB5833F673863D9C348E54E9 garyswelgart
913,020,659 *5F0BC504A94FFB99CB29840AB15D06C2E62B5D51 gastonpersia
913,020,660 *5F066E096F83D28571128D14644EBBAF738D3ED6 gatelangs7
913,020,661 *5F09C411C478C009F73683215CB6FACFD2932C8D HTTPURL.WHERE.VERIFY
913,020,662 *5F0F8AA88B33E46809CE2CF22D0B4CD46B4354AD GEFFET
913,020,663 *5F02D31E1B65E156BCBE3BF1574FC19AD597E75A h{vi{v{n
913,020,664 *5F0D372009FC1868D0D9AD586ACF870F1B50C87A iambeavis175
913,020,665 *5F0AC0193951F9B7CD51944460D22D4287C2D857 GIRLS.IN.HEAT
913,020,666 *5F05B71E0EEC897A06DCF375CBA214C9ECA12487 IDITOGOFICA
913,020,667 *5F02F814AD3954531DBC1796AF2FEE13932074C8 ifa.ibrahim
913,020,668 *5F0B44B13C884FF68E35CF965B88DDBE3BA61CCB IGNACIO.CHEVARIE
913,020,669 *5F0557142F9447EAC4961BB967CE9F8306CE1F25 GNTYPCTY9
913,020,670 *5F034EC298896FAF18E8BD8EF154D3C61294F787 IHSAGAMING
913,020,671 *5F06C3913BC649C19FD39AD823A5ECB6ED298141 ihwklahc7
913,020,672 *5F0B6AE1A81E0D28F028B90F7D90F7D9D772C124 ilazzab 1
913,020,673 *5F08E2915388F5F3B62280E3B9604270E19AE2E3 I LIKED YOU BETTER WHEN YOU WERE SICK
913,020,674 *5F051AD7A0113047D162BB9F26585B4C1C104891 goudpoeier5
913,020,675 *5F0157B7020E487374A0DD0F35ABA6D25C62C760 ILOVEFICTION1990
913,020,676 *5F01A9B53E2301334D1081B84ED9C24BDB521667 ILTRADIMENTO
913,020,677 *5F0FA1299DFC4465A5C458653F572F63EF2AEF6A ILUVREZNOR42
913,020,678 *5F03C09880980577F0193C7C3918DE60BD9E4847 greenlan[email protected]
913,020,679 *5F0D21C43382F58D3B221D4D22AECAE8BB35C799 imaginolog
913,020,680 *5F02F701B93C086F6CB2B686FDD0088A6F9A0DED IMPO55I8I1I+IE5
913,020,681 *5F007B4FC7C9D29C98430E3BB2229A850EADF5F7 INFRAMAR6
913,020,682 *5F09942AA55F238F85439D7E43479E7D9858B0DF INGISERP6
913,020,683 *5F01E386243EDDB91A6541D9E8BEB9342B2DBB1D INS+I+U+IN9
913,020,684 *5F06F9A975208C0E194E1FFD7D21209285D36397 hameev
913,020,685 *5F02FFBD5D7343D8BDE1D7B996B17C83D74894F1 ISAIASRANDAZZO
913,020,686 *5F0EBDB1D4D96E60FBE7D06AF4ED59249C959AA4 HARLEY.OLDENKAMP
913,020,687 *5F04812C04FEC1608331FA1AAFEC23B496169159 issajew
913,020,688 *5F02C7284BC2C3F5E43401D3B76E0D9DE5D33545 I-think-he-had-one-of-the-best-voices-I've-ever-heard
913,020,689 *5F025045B9DDAEE6F5C9412A214588856662C922 iudefseu
913,020,690 *5F08DA8301B718EDBCD26AC88F40DF32ECF3C4DF HENDELSON:
913,020,691 *5F06E59054C2EE056BC2E7B3ADF89E35AED2D4D3 JACQUESVANT
913,020,692 *5F0C8845417BE4EC6E4CA0A7FD78EA7FDDEAAFE0 jamie.whitlock
913,020,693 *5F022FBC1714326F98A4592251BACC08EF6F7075 hill106a
913,020,694 *5F0E7B39D9E5F9A903827C05594EEC30ACC4AE9C JASON-JOHNSTONE
913,020,695 *5F06867EF97AA2A1C4E613641E23067D33EA73DD JASPER.STEEDLEY
913,020,696 *5F0252445005051143CE99B672BF082A1F8EA587 [email protected]
913,020,697 *5F0DA5D6C3A5F4F9ED8041B333E2D8F74E1C568B H([M
913,020,698 *5F04C86ADFBC84A1C016B9EAFBC6638BC0543079 jce+
913,020,699 *5F09E4C1AD6ED50B3FEC0BA91DBA1E2DA37C4ECA HORGANIZACIONES
913,020,700 *5F056CCB87CCDC0DBEDD36B8D14950EF5BFDD4B5 JEFFREYROUSE
913,020,701 *5F07F6EFB0E4DD236C4ABF63833950B0E6125BF3 JEN.TORIBIO
913,020,702 *5F0E7F9BDAAD035F7122A1EFDB4D6266E36DA67E How-The-Wild-West-Was-Won
913,020,703 *5F0792E0F9480E955CAFA0E5264B1031C82170B8 JEROMEOXBORROW
913,020,704 *5F0A603C842BB7603BD01AE8CCF672B4DB77370F JERRODBIRKEY
913,020,705 *5F037AE387C2FD28718AB9F6744CA20835CE2F86 jerroldrachar
913,020,706 *5F0E53C095E466B85FDD82514B72F2EC7D72B8B4 JESSIEBRENDER
913,020,707 *5F0273CA23DEEB3D26593E5FD89C5F4DA7A8AA78 [email protected]
913,020,708 *5F02DA02BF71D4CB21A63535E7C4FF4C2312FCD9 hughitt2
913,020,709 *5F0FF58EEE9B0DF087225C1333CA63093E7025AC JIMMYSINDELAR
913,020,710 *5F0B3ACB6584FB07236446118A1691098FF0B7A5 jjmatthews
913,020,711 *5F0F034825E1F821ED0D292B211BABD5A30B9A28 HYMAN.RATHGEBER
913,020,712 *5F00B190B9C8E1310D619029AF5E4E4436134B1E joegabied
913,020,713 *5F04B142E23F189F45552EB42C441F856A04A7F4 J+OH
913,020,714 *5F06AFFBB10B59F88D6A883EB0C509CB5FCDB208 jonasferrera
913,020,715 *5F010F72EF2904E0C8AFF4E28552C93EEB692E95 ICESKATING5
913,020,716 *5F0BB45C7FEB469DDA7AE7E57C42357B6AF02081 ifg9
913,020,717 *5F082AEF0023D406E1AA463CCC8321404E05ED27 JTRABALZI
913,020,718 *5F02083A3AAD18CFBEA8111D13D9656DEBE29A05 JULIECROOKS
913,020,719 *5F07CF2ACF64BC07283B271F9B5DDEC4B75D8521 *ILOVECANO*
913,020,720 *5F0BB5BB0B739B1CD197B2365B19D97D19D3E993 ILOVELIBERTY93
913,020,721 *5F00AF100695BAE81019A77785933DC6957A3594 [email protected]
913,020,722 *5F0FAC56803AF82E42EF9E18AE24D9BDED68FDA2 k).)
913,020,723 *5F03E701ADFD582F8F3F37F375534FC62AF320AD IMPALA507
913,020,724 *5F0B00413681D5907BD42936B9E4A25917DCC94D [email protected]+3$
913,020,725 *5F09FF07B87274D2B3C1809B2D21DC186CA795A4 kaseywashell
913,020,726 *5F0F8DD802A5496FBC2E3007535461A5362E8E77 kathyleeandjordansranekandtimo'brienandprudencejohnson
913,020,727 *5F0259BBF872A2C99FA29B61B9529917036F49C6 inuodyer8
913,020,728 *5F02A42F2CA9EE6FF211355599C0CA1623D27EE8 KENTTEEPLE
913,020,729 *5F0FF875A5B2B5F077A0C1D1717ED1687B1BDE54 KFERGUSAN
913,020,730 *5F0A53561F5E94D68113D6555FD7D05F8E34B5F4 [email protected]
913,020,731 *5F0BA991E9C7FB633AB621A339F6DD5A5FC446E8 IRVIN.PAULEY
913,020,732 *5F0E8C5E6E49363FDA149A9625AB999BC0ADA930 ISABEL HARTLEY
913,020,733 *5F0DA6A9DA5E3F4CBB4044327C1A6BE023205FE8 kilogauss5
913,020,734 *5F0CA1F8FCF1B53A82FA5F90EA828BA2BC65AE3A KIRBYBUKOWSKI
913,020,735 *5F0A7903A8F7C1C505E024041126BFB27679F579 ITALO.2000.RARITIES
913,020,736 *5F0C3EFA2167472CC56E4F5E182FAE6D2F3BEF1F KIVALTA-JA-P
913,020,737 *5F0579BD2E6A452A8A5EAF19255E6E16300E37AE ITLSDNO0
913,020,738 *5F05F15551C6E1689CC0073066A139DEDCB2F8EA itstartedinthemindthenjumpedfrombodytobody
913,020,739 *5F018DEFB096AC080F8A82B5BBE10ED1769A371D izzhesti
913,020,740 *5F0A206666AB003DF7598D4C3E9A28A804CC7C4B [email protected]
913,020,741 *5F0C84221E5DD14ABD54D00127FBC21EA75436BC JACKIETRUXELL
913,020,742 *5F052F8E66287EA1E7F9125BDE6A280390CDFA6B KORALLSED
913,020,743 *5F05591D9C96B32C40A0E6CE0B168033E6A9FECC KORRELL5
913,020,744 *5F0B4D427A08547A60F4699B17915B0D3AF0AD0C KR^IDAA
913,020,745 *5F0F4C78460C62B1AF4DB5CE77E1D759F9020333 James-Bond:-The-Themes-From-All-15-Bond-Films
913,020,746 *5F0D7AC40C2107B0F5D7B8F8F3B923B2B9A79E0A james.callum
913,020,747 *5F0EC41CB40D56AFBE9915EE66795AD1DAD61C5C jasonstoddart
913,020,748 *5F0FFD4839DE1AFB7AD3CEC35EB3065AD8F1175E LAKSHMI CHETAN
913,020,749 *5F0DF36EBB3FA2A79F1F0BA31B8B023606ADC4F8 jeffreyartmann
913,020,750 *5F04A1721D3F32E1C5A1567D3B242F79612743CD jennifer-hoskin
913,020,751 *5F01B6003C9D8465B02105DC29662569014BCCE1 jeraldmassanet
913,020,752 *5F09CB4B57B1AAC3C896F47663E5842A8DDBB17D JERALD.TAYAN
913,020,753 *5F0BA50DA4AE898432833AF17DE21EAE4EA639F0 last.day.of.school
913,020,754 *5F07FE64748FBEAB103541C2753FDA71C7B74076 JEROMEAPLIN
913,020,755 *5F02557812DE1D35E5A08ABC24FF63B1FEC6994F laura-veronica
913,020,756 *5F022BCA596947CBC6F99039542EB6D806CC8872 JEROMYJOHNOSN
913,020,757 *5F0BE63485E5FF3A8461A8996E3FC9C14524C3C8 laurenprovence
913,020,758 *5F089D83F8DDDACF53A3F2D9377BBAB7D9431DAD JETZAT
913,020,759 *5F0BC3F9BEFF8C68743E86AD49F24949E7BCA3C5 le.madri.della.psicanalisi
913,020,760 *5F05C8F961AE7936BFC903FD180A058FE834E4BC JIMFRANTZ
913,020,761 *5F0D5E31B018DE590F84F3DD3687E3CF41271037 JLU0
913,020,762 *5F0FFCEFF63CD8394AA1A0D4B27358295D5F4C3D LIANALIAN
913,020,763 *5F01570A828D0EBFDED9DB0F4F224D59E591FD98 JOEYGALLENO
913,020,764 *5F08DCA51577FC781D91749D08FF2E2DAD19446C [email protected]
913,020,765 *5F0C7D7848544AEE7FD97328EDCDCD772BD08B2D ligningsm
913,020,766 *5F0C4F47A504A861725643FEC5CD803ED4EF0ED0 JONATHANLANIER28206
913,020,767 *5F0AD1CFFD8FCE2B9C0576D747738D233E1AF42D <Li>..THEN.USE.THE.FiLE.iN.YOUR.PERL.SCRiPT.LiKE.THiS:
913,020,768 *5F0C2D62596836D86163F00781C022B427AFDAE4 [email protected]
913,020,769 *5F0F8D6F42F74CF33BF0041B7EC48B4B1F780650 livemas
913,020,770 *5F08B5A4BF7DB8A16859C1647DAD65EE56D13ADD loopnounietweg
913,020,771 *5F04E872E9CE1841F64715C9681A2254FA7B5E87 LOREN.NICOSON
913,020,772 *5F0F975840B42BC5D49F9434B51BC259331DC2B4 LORENZOSTRICKLIN
913,020,773 *5F05D38E61528159AE6D29AAAAA2DF28699BB94A LOWSERLOWSER
913,020,774 *5F023B0FA805B08712FA4EF20B65464E1D944B08 JUSTINWOODBY
913,020,775 *5F0291EF5896239886E1D5EFB0E6CF3D16897813 KARINA PAREDES
913,020,776 *5F08474805074648BC9751DF0C4C2DFE7EBE4158 KASTELENHOLLANDZEELAND
913,020,777 *5F05837294893B1854CC88B976617FE6D7247321 MACK.MCCORRISON
913,020,778 *5F065E3986DBE65AB3854A2FAED7010CD6117CA3 [email protected]
913,020,779 *5F034D7D7DF2CBA99A51A0AD9EBB9682B7B9A37C KELVINDOMINIC
913,020,780 *5F0AC241592E25F404370EA6EE158C49831EFBC6 MALARKUT6
913,020,781 *5F068D1389767EE569F991261061E9560F90E431 MALBORDUS
913,020,782 *5F098798C5BA6DF858BE9A0B8C3A0B3BDA24469C manglares.de.tumbes..golfo.de.guayaquil
913,020,783 *5F0B184F83326710010E3337DB6BB090A65961A3 [email protected]
913,020,784 *5F0FD10EE15CE44E1891A887EDB02DE663867C08 mano-karthick
913,020,785 *5F0C2E8BC594890A786E1CDA9732C03A1B1C11A8 KEVIN.BARCH
913,020,786 *5F06E9AA369D6F45D479F0DDD2FA935CD33E52EC [email protected]
913,020,787 *5F0C7565C2416177F5E7EEFEB3B99E7E977785E1 manualokura
913,020,788 *5F0D0CA1ED533CD167A540F610C84F042BFD9C1A KEVIN(THETHEME)
913,020,789 *5F0A292E3992B90111A7159F4A8CBABB22BDC191 KHUTZTA'I
913,020,790 *5F09190DFD8DE8CB1055B4290309392A3A4A943F MARCEL.PROCSAL
913,020,791 *5F01889A0421AD905404DDAAD7D11C64E77C5888 “KILLAZ
913,020,792 *5F071FC752FBFD9EFD1168CE03565A1377681689 marcolosolla
913,020,793 *5F0D142CE6DC14F9A69FAEDF1E35F3C1C2D25CE4 MARKFREZZO
913,020,794 *5F0C9B93B631A4C3791EF9700BEDE6DBC5A49B90 mark.haggith
913,020,795 *5F072C86E2A1D7B7BA217B1F045753399B63ECD9 MARKISCOLDWELL
913,020,796 *5F0A722FA723C35FFFE6AF8D2A14B4658D39C1AF klc235
913,020,797 *5F028B20D6C3B9F36C43274553995F6ADCB78CE4 MARSHASCHOFIELD
913,020,798 *5F063B0DD5593D54EF7B6FD450017AC36E413BB1 MARVELCAKES.FOTOPAGE
913,020,799 *5F0D5BAC474D46168F6DA61C59BAE0234E9BFC93 komt-allen-tezamen-(instrumental)
913,020,800 *5F042DEF07D49272E06876CAA00B3F40A20FA060 KOPIERTEN7
913,020,801 *5F0FD9D8F433271B44E9177C060B5A1D4F79B06F maurotroublefield
913,020,802 *5F07940D157A3071D46504ECCDB67F1085C1FC5F maurovital
913,020,803 *5F02EB1064E7F1ED0974990DC1E76CDF603F2181 MAXWELL.LAICH
913,020,804 *5F0499DB9D2D76A4EEB20667D496E74B867E2935 MAXWELLOTHON
913,020,805 *5F0D0086CB50AEC29612713035BED491F39583CB [email protected]
913,020,806 *5F0037A314913078500C64692607C6A1F9348571 kristoferyearicks
913,020,807 *5F036D790FA68A8114892D15C044639FE1662E03 KURZWELLENPROGRAMME
913,020,808 *5F07F18522E1E297DCB07A90963C5963F623E4B7 kuwasaka3
913,020,809 *5F0B90E832BEA9D7382C913796DD49B966550279 kyssegh8
913,020,810 *5F0724D352EB80D56011C42DE47F51A18E321EAB MID-AIRG-DETT
913,020,811 *5F0309B822A3182392844873E86CB3A2F77FFC73 LASTCHEATER'SWALTZ
913,020,812 *5F00BBBBB018BC5017FB6DF3C9E94734D16068C3 MILON.HENRY
913,020,813 *5F03D3248EF39CFF17C3879685B78DA8834AE4D9 MITCH BERTRAND
913,020,814 *5F0AF0D0B2416D8B3D24AC0D8675EA1134F18BB0 LEBOSTEIN
913,020,815 *5F08A1E9937D628EE72C75F185B719A811297E56 mmi!
913,020,816 *5F0477112E153B1818A6B89565B2C6E8A3BF1D68 LEIGH.LAURENZANO
913,020,817 *5F096AF1DAFC455EBD72E4D729F9F26181B5012F MOHAMAD-AL-HAJ-HUSSEIN
913,020,818 *5F097EF6DF562EBA0F252BEBCE19AA6C5F4918F1 [email protected]
913,020,819 *5F00233C1D4891AEAF6BE454D7C4B1EB54F0F508 moordkuilen1
913,020,820 *5F0C7700D8750064C897FA91548E7C2CD62A448A MORRISHEKMAN
913,020,821 *5F0D5D4BF8552DA943F6FE36BED2992CED63FD9A LESLEYBLANCHARD
913,020,822 *5F0946E9A47A42121BA723ED379B56E265AEEFC7 LESLIEVALERIE
913,020,823 *5F064C581DB9B17BB186E8A7C1D1C928327219B2 MUGWUMPIAN1
913,020,824 *5F01172E3794B2311818A8CC97D13C640EB97131 music-from-the-yiddish-radio-project
913,020,825 *5F0B350D4BF88D4F12157C177D2251D9BF81FB29 [email protected]
913,020,826 *5F037A701CAED769C2873F741AE3522983CF2414 LINKERN0
913,020,827 *5F02D989DCFCC752F92D89543F1CDA1C9CA58A59 LINKSFASTRING
913,020,828 *5F027982DFE924A98A6661580049D28243C089ED N5+RUMEN+A15+5
913,020,829 *5F063FEF74FD994043AD03F77CCDA686405A199A $NAKIE$+
913,020,830 *5F0E48023B477760596B1AD25626CD9217293C15 LLLACAR
913,020,831 *5F09BA6A1D02BD2CD8D2497E2CDA6E72A9CAC250 NARADON
913,020,832 *5F00FDA08CC7727FA205653E855B1F6FDA8EE6EE NATASHA DEVEAU
913,020,833 *5F05D7058D815835C43188A0C3094AECA5CA99AC Lokaal
913,020,834 *5F02B12E35535B46743F8E4DDBC5B4A13DA565AC LORENZOGUDROE
913,020,835 *5F0D6C7E38E2B0F9CA812845A50C7C012B9AC45D LOUHOSHALL
913,020,836 *5F007C95530139E9A2527A1075B409528148148A NECOLETAYLOR
913,020,837 *5F0EEE012E0A70163AE6DE79F4A891906C3AC1E1 NEDREEYO
913,020,838 *5F08167B58B9542FBD8A276FDC9E9BA80DB1EDE8 neelima1234
913,020,839 *5F05DA8F4B5EA74D9B6D41D85502190AF41F37F0 LSD6969
913,020,840 *5F009798CEB586796ACF35C62B6600501D8EEDDB [email protected]
913,020,841 *5F023B5FF1A4992B014BA0BBCA0E48DE01A2A7EE nickoleis
913,020,842 *5F016DD3BE1C4601DB12695E7AEFCF9E7006F3AB NIDALLA8
913,020,843 *5F015A1722ACAA25C9541B8BFADDF87E31420101 «NIENDE»
913,020,844 *5F0EF2677C4F320F6C83D5B03A3660B2164474F8 LYLERENEAU
913,020,845 *5F0BCC191EFEC0C0E446A1A0F727559EF5CC1C7E [email protected]
913,020,846 *5F0199BA04351FE17E48CF57A1126070CF8FFF02 NKADLIVE
913,020,847 *5F0AF0FA429D115BEB044A31051B9B34D212468E mackubertini
913,020,848 *5F0C3466A7625AF9B09FFDECF7DD9E05DA0E0313 MADFROSTING.COM
913,020,849 *5F0ECC05D58CE5FF1B12CF15AB1164776A51F64F NOLAN.MALENKE
913,020,850 *5F06EFF6F43128AB21D60960E73B8344749CF0F6 NONCIRCUMSCRIPTIVES
913,020,851 *5F0C53F9A2C1A9299928F070A86F69197D21E7F8 maksi-singl
913,020,852 *5F08F236E8953946508947C0D16345AC73AE6BD2 [email protected]
913,020,853 *5F0D9348088CB3A0EFF3F7DE0E7C9790FF40A5A0 MALLY»
913,020,854 *5F094E6B5D23171ABF0769404F6C3A8A5D8B7B99 notationofintervalsandchords
913,020,855 *5F0816EAED5161E34390C98EC50EE76D8B9BF03A notifyee3
913,020,856 *5F0F5EE7B19104BB11D74E12620C03E96B03C80D NOTORYS9
913,020,857 *5F04E27155D7C54FBC7513358BDE2856A52D17DC manif3st03d
913,020,858 *5F0CD49DBD316A54C9DF06DC32D44806E461A12C [email protected]
913,020,859 *5F0664621AB2F812D1FE736A14ADC9F3C8260B23 nrowpohs7
913,020,860 *5F09A884FAA2285F187D1B1A21177869D9ABB37A NTURRET
913,020,861 *5F0B5188241E0ED4F73DE69594913D77C7D4A9A9 marc1981
913,020,862 *5F0856AED3FD33ECA93FC7C7CFB36353C3F5A457 marcosbienfang
913,020,863 *5F0BEF2125E7F87549D4DB0FF95B9B398B17F2CA MARCO.SLOWIK
913,020,864 *5F0063CE387AAB29261AF67D5ADC59D58D355F6F O2とはO2
913,020,865 *5F0240BC8D13B29AA949A470A32A353801DA917B MAX.YBALLE
913,020,866 *5F076BAC850F175B84F98075741AD853C86CA76C )O(~.~.QB
913,020,867 *5F02C3E52A59520A5D59E49902630D291A2B41A6 ORCHESTERSUITE NO. 3, D DUR BWV 1068: 3. GAVOTTE I & II
913,020,868 *5F0F4EEE4A26CAD8056A266414AB3836B72EB606 orenrosendorf
913,020,869 *5F08B1A770EBF322A7EDE860751746904820A201 organ-concerto-in-a-major,-op-7,-no-2:-i-ouverture
913,020,870 *5F0925EBF2A10B458AEAE35341D5DC337223806A o-sobre-asa-branca
913,020,871 *5F0CB576A504C229F25A85D07CF49A91DE9A089C OSWALDOPULLIAM
913,020,872 *5F01B567D1BD7F383344CFA6009A954C03B36DFB MEGAN BUDNICK
913,020,873 *5F04F547FB04FCD9B3A696E351A7F1A86082CB85 OTISHEERDT
913,020,874 *5F0341BE3D3131CFF70D7E96CBA61EF9DD5984CA menisci
913,020,875 *5F0EA08B9F750FBF7EB8069248740EF998CD11E6 p0ut13$t
913,020,876 *5F07FBCFD1F79A1DA476A0091D86ADCC129DEA6C PAGPAMOMBA
913,020,877 *5F0267C27E2A3820E6272BCD3297081884D0093A michaelj.pritzl
913,020,878 *5F0D17A3529D19CFA64AA8B4263765ED70445B45 PAOLINOS
913,020,879 *5F0E5338677BFF546C0F48A978D701871E071788 MILITANTLY 'M/I/L/I/T/@/NTL/I/
913,020,880 *5F03461958F9479CFEED3F714DF7D3069BBA17CB MILTONSITTERDING
913,020,881 *5F0D0E45BA3335B744957947C0761459B8DDD33B MIQUELDEWYER
913,020,882 *5F03B1A600FE89D9DCF7B6C6FA638CD0ED9C2696 [email protected]
913,020,883 *5F07BEDB2593A2D140BA9A81EBD8A90A7B387EE0 P##D~~3B<-
913,020,884 *5F05C39143E7D8E6C2CFD8BDBCE17C4197B5C071 mn,"
913,020,885 *5F01ECE9B6113ED6EA1A562B0F998D13050D8303 [email protected]
913,020,886 *5F0F35FC5BCCF7F07D7AEAE191F9A80CBF904785 moment 40 (moshic's floorshaker mix)
913,020,887 *5F0982506FF0AD9FC46F26CEFFD992C3096626AF monipuolistumisesta
913,020,888 *5F0823B384C110086644BCC052407A2920CF19D4 PHENYLMETHYL8
913,020,889 *5F0B354A1ACC94C040F7E065C7C316DAFBD36D8B MORTON.ISING
913,020,890 *5F08C4896A0E127641F277549D21D5EC88E13B7D PIDUNKS
913,020,891 *5F093AE29D889BB40F3590D2874589888314A932 mufinella
913,020,892 *5F0360F5DE6F148B20BA1D36F74BD1EAA6173AC2 [email protected]
913,020,893 *5F0677630E8AAE57CB118F0B174B8FAC3FB71498 mustapha-salifu
913,020,894 *5F003F044B9E9758EA2292C6D819BFB00E7E5CFD MYBRAVES83
913,020,895 *5F054B4B2A32AAB53D9BECE1D59C3731F26784AB MYSTIEQUE
913,020,896 *5F0B28031A0DD35405D2FB40F8B5CA6C8B96CA02 postbus24
913,020,897 *5F06B7689507F960AF82419F568BE9680496FB24 /.pour.remplacer.les.c
913,020,898 *5F0680DD828EA3B456AC345E43A6898084B32655 NAANA-MENSAH
913,020,899 *5F056DB73DE96119146A4B7D41692E849F91E097 p###p-~o~o-)8(
913,020,900 *5F0DC4036366AF1321E8BB2557F23F75A8D091BD PRAETORIAN-UNDERGROUND
913,020,901 *5F0A587B334376132CA5C5726A5162E58A09E915 preadult
913,020,902 *5F0215B117247539FF6D04A0CCD1868037E46F4F nazario-historietista
913,020,903 *5F07C14D5A72A0D3492CC4E8CDE161AE77473B20 NDOH
913,020,904 *5F01356134AF6687676C02F1DC948B4AFDA63455 prprtrss8
913,020,905 *5F06C1C813AE407200442F1E7A1CA3C9AF773AF2 p<w.
913,020,906 *5F033F6916A6EDD024C72D5D318AFDA615A18087 nglphlc6
913,020,907 *5F05146351BBD35B0B4C7C932124B19FF2765B32 Q=====B.~.`.;)
913,020,908 *5F0F174DFE2421D075140C74EAE1BF9201437CF8 NICKLASHAGSTROM
913,020,909 *5F0FCB9FDF5471A9DB14D3DDAD4F00E4EBC2215F no2pp314326
913,020,910 *5F0726742BAB73AB22207FF5CAD30837978447D7 QUINTON.DACEY
913,020,911 *5F022EB86A7EEDB9720878954DCB8EFCAB7FD0D1 NON-INSGNIFICANT
913,020,912 *5F094D164B2C444E84CCEE4CFC7815B95BB9F8DB [email protected]
913,020,913 *5F0E3E3BA4DD9381ABBCAFA820637FC0BE626F37 !RA+31Y
913,020,914 *5F0277AF164F26308C2DCE9781889BE33193B91B rahulkhokale
913,020,915 *5F06F188A23962C48881944DE1ABF8976DABBCBA NOVEERAED
913,020,916 *5F0EF42CB7031EF4DA0E324667C5C18185EC1E89 NOVINIRIMA
913,020,917 *5F05EE601FB353872EE8BDDF45FA7F5B62257AEA NOYON MONI
913,020,918 *5F000BB25A4B526712225481AED7BD23058D0BFD rampants
913,020,919 *5F089612A9A683DEE264505902452833C4DEE9AB NUMBERS.WIECHERT
913,020,920 *5F0398FEFFCE401F7248122943DC549403FFA747 [email protected]
913,020,921 *5F009FD80389E793D1AA1C51B24C3FB2CE3DD938 nydog
913,020,922 *5F08C9CB37DB49D311C110AC7D02532D4E3A1822 >-<.O~0~Q#####P
913,020,923 *5F0173CE4DA69DBE9105E9C315999A413E55481A OCTAVIO.KWIAT
913,020,924 *5F0CECDD104EC27EED1BAAD71E9D203B1F27D9C3 REBOULEVARDPRESSING4
913,020,925 *5F078EFD7B1839B5DF64DD1DFA4B9FDBBFB22582 ogunyemiolugbenga
913,020,926 *5F04F1C7CDBCCBB7DE52623DE627EE050AEF8838 }O{`-(==P
913,020,927 *5F04DF9273A09DE7B75C9481473F40FC913209A3 Orangerot.1
913,020,928 *5F093CBFD09A5B550CC0FFDD083B1FFB339B5A25 RETEIGNEW7
913,020,929 *5F04EE19A9EC4F72C29182FDA7E28C2F6A3B4EFB rfl4az1xljjqzfj7
913,020,930 *5F0E9E4E747AF24264B6A925BB1955B9499E27E6 rich.guarini
913,020,931 *5F0446EF62C75AB63143191B3D12B7877E65AC9F OVER5GH7
913,020,932 *5F0AE2AB1954A89CFEB812D3E4D3B89C46C65558 RIMIRATOR
913,020,933 *5F0B0B8F54B329586B49483759F2978051C3EE9C p==).*.*(-_0)
913,020,934 *5F04424A671C47A6BD42A5430AF324251674C021 [email protected]
913,020,935 *5F0FC5D22F1AEF4EC1F331C6D7E48D9C59F89665 P1AN+IGRADY
913,020,936 *5F0F7692C01E8B08535762F08983DE4C93A0BB48 ROBERTPELUSE
913,020,937 *5F0C49478221E267940C3FFB86F79C04E2E0B28B ROBINHOOFRIEND
913,020,938 *5F0CA858C49BBF2F7986F820C3CEE4FFE15772FC RODOLFOJAYO
913,020,939 *5F0E25931502BBA23D1E54AAF4E826C2E9D85CA5 parisrichardville
913,020,940 *5F0E2F7CD0D012C39D32C130BAF0EB655340482D RODRIGO.MYART
913,020,941 *5F0313C9E05B73CD763676A47E19D5EF73755E1A pascalscarlett
913,020,942 *5F0A0C097C5472B7B6D5DFD0342A4400D2550291 PATRICIA-WILSON
913,020,943 *5F04E1C9909037EDCE0D0BCBCC35CEB9D2E61E78 Paul.Millns
913,020,944 *5F0F888DB28EBA472D9FB91E49EAECB6B0E7D0E8 ROSE.ENGLE
913,020,945 *5F0AC60A816F404E438EECB4D34B6D2A487F5B80 [email protected]
913,020,946 *5F0BECAD5920BFEB099771EBA1DCCADAD83C70C2 [email protected]
913,020,947 *5F072D28DC17C30943B1B0CC0C5710A1A5125813 round-c3l
913,020,948 *5F0C157DA217219CF62A857BFDD7BD97A54EAE6A pentane--p-eh1-n-t-ey2-n
913,020,949 *5F0EA6CC99A66E2F30AA35E096BFF53FF10036C8 >RT/<>DT/<srotarepo-tnemngissA>013=HTDIW-DT<>DT/<
913,020,950 *5F09675FCD087E9FC6E6CDFAF1B4F2C7D5D6E566 RUBEN.BROCINER
913,020,951 *5F07D54F9A6F7BD0F86265B32672FB832763DED9 rücküberschreibung
913,020,952 *5F02ED5806EC727573333A299EB7B53C99ADF5C0 RUDOLPH.KEARN
913,020,953 *5F0A7E30593E4B4B0E4523AF459869F91DC9BA89 RUDYTREMBLE
913,020,954 *5F057DBA222628F78ED0E584DFE3C8B5FFBA67AD rufussayles
913,020,955 *5F00430C77E4EFCD2921F4B81B2F7F722EDAB6B7 PHILIP.DENAFO
913,020,956 *5F09C5EB0106FF33E8CC87BBAB181FB87C0F7B68 philvarvel
913,020,957 *5F04368BBDB1D491C6B4614CA0CB8C9F54FD1BFB ryangodbee
913,020,958 *5F0EB9F1DCB5089198AF05A978CC6100CC2F3056 PianoTrio.inAMinorOp50:VIIIVariationVI:TempodiValse
913,020,959 *5F07164176D3230E6BD4FCA37930904983FF563C P^=K
913,020,960 *5F0F3091507F562873050EB220EBEF3835DA78DB SÆORMINN
913,020,961 *5F0E71AE99F9642A8425C598E862753236DB8EC5 pmarquises
913,020,962 *5F034F6E9DB315130DC06EBE3CEA1942884D4D16 SANCTAMATER,ISTUDAGUS
913,020,963 *5F039DC68461C823CC863042BA385AA5999E175B sanfordswailes
913,020,964 *5F00AEAAFC66F950945B4A54DF70FEABB621DD9A PORFIRIO.SANDAY
913,020,965 *5F04470929B1940EF306B180387F13CCBB2AE4B1 SANTALANDDIARIES,PART3
913,020,966 *5F0F20750E2A926CE04C8E9717C2993CC8D07F18 SARAHA
913,020,967 *5F058E0E5530AF3C3FCD053746D6F0670AC194D9 :P~ ~ ~ Q======8
913,020,968 *5F04B8D00E3208C7A1AFF5319C2D8BFE2E9CB993 scarletcanon
913,020,969 *5F0334C1374D9FFE8F4DB8DCE0C5E5D1EDBDC89B SCATTOED
913,020,970 *5F0106566EEAAEE8D3A87F54899033D8392EE6F9 presubsti
913,020,971 *5F064983A558E9AB1483FB08B1F104DD9CCA9A11 SCYTHIAN-SUITE,-OP.-20:-III.-LA-NUIT
913,020,972 *5F0E30C3E2CD28908892811DAA38C3FCAE0ECAE9 PROHUHLU
913,020,973 *5F026BC69F2667EBC874383D6E087F8FEA48349C PROVOKÁCIÓJÁRA
913,020,974 *5F0CE640DCEE83992258B20EAA837EDF223DDE1C SEDICOIB6
913,020,975 *5F0DE344B2EA9291C07294121212F9B77A680B0E PUNK_GIRL83
913,020,976 *5F07B0BB586B6B1EBA6EF547814D6855CA71E38E SENEDEIR0
913,020,977 *5F0BCA30FE409977056ADD190D24427BE041AF53 sequentialness7
913,020,978 *5F0FC1DB8F2E0C581FA068B33BF42CBBD9152748 SERGTSOP123
913,020,979 *5F0CF5B0EDE416A7E8B109DA64CCC75B186B3803 py=n
913,020,980 *5F05614A6E7728F93822DB8305FE5401D67CFF34 q$m>
913,020,981 *5F0E8495A80A6DAAA1B933E75243035526C4244F SHANNONCAPTAIN8
913,020,982 *5F00F771B215BA87F9DB08F176822CA094445244 sharonfirebird
913,020,983 *5F042283CD144B6FA9A3A77E3C1D6BEBE5645890 SHAYNE.BOHRMAN
913,020,984 *5F0A4AF97221C238DCC770FD8AF7019D2C02870F shekey
913,020,985 *5F07F48FB1A691A8850806FD1F120EE6845382FE SHEROL1
913,020,986 *5F0149B16F2903D8C91258D1E5E05E78EEDF1C51 radio active (30 second version)
913,020,987 *5F03B563D8B5B9490C8807522D0155FE299B3FA5 SIDELNIKOV6
913,020,988 *5F00C0682442ED85B3A0828669FBCD5DE7665A01 ralphstohl
913,020,989 *5F01698F020B48B4C374B537BD3956485A2ECD5F RAMEDLAW1
913,020,990 *5F035C878190097A744CB8557CC97EFC2D3344AB SIMON.SERA
913,020,991 *5F0424A42F1D3008DF3183F16DC694232D0DF2A8 [email protected]
913,020,992 *5F0C44827B66E63C66999D6434756EA122AEB524 SINDIAPURA
913,020,993 *5F05A48BB1A65480B57032D6A65BCEBC61686C38 SIRAJIKO9
913,020,994 *5F0C2273FB135639F4144E5D05A3837A9D9C0ECC SISCHER ART IN H-MOLL, BWV 831: I. OUVERTURE
913,020,995 *5F032012150334F60AF44D3A510E6008F7DA29F8 SIVIILIH1
913,020,996 *5F0187416E8940008AF759B9F78870D2EBBC8505 SIZABLEAED
913,020,997 *5F07EE0AE2EBD082F1B5EF41410DA7DAB0D20145 SJARANANE
913,020,998 *5F021C54FBBC1D609E1C0497CC8BA625C6DD3202 R.BO
913,020,999 *5F0354E143222C0C0339742C5DADD74C29E6157C RECTOCELE.'R/E/KT/@/,S/I/L
913,021,000 *5F05596031F649F8643C99CF4321D8C1CF200039 SMJÖRSÝRUGERLAR
913,021,001 *5F0BD8D5460D084FF3ACD4A322D02D38AF3D9D34 SMSPYDIGE
913,021,002 *5F02E933FA8371C6904B89A30031A09E563A9811 smvrtbrl3
913,021,003 *5F0C32512D44FE8940B5D913B61DBA7634642D48 SNITOIBS
913,021,004 *5F07E179B22B9F907B58467CF1925E696589BB6C SOLOSPOTLIGHT
913,021,005 *5F0B7E5333D3B20E1BDF4D6E3E4AEEA727FDE1C1 sonnymac8
913,021,006 *5F0F29E85FB5D13673D80B7ADFBE8F91648468AD resg
913,021,007 *5F0229D0CA1BFFC67C7E44D3674BB964DD9C5513 [email protected]@+0n
913,021,008 *5F0C9057A738D43A1E54E9F2A574482DD20440B9 [email protected]
913,021,009 *5F05E44F67339D5F9E02180229FA0AB1B640ABBE SPOONY1SM
913,021,010 *5F019315BFAA5B846C85AC181463169B70132DEA SPOTCSARNOK
913,021,011 *5F0C225C0F8012400D79ADDF4E533DD03D6FDED2 [email protected]
913,021,012 *5F01F4E9BED92F653C11EA33C9295EA52F5FA4E0 robbierosenheim
913,021,013 *5F047D1ED2BC6A16C83EEEAB107EF0C17C097638 ROBERT.ANALLA
913,021,014 *5F05157CEEA89D0490BB64B79CDA74D103A576C8 roberts4
913,021,015 *5F03827CB9E830305C566E59D255DD2AF323ABC1 STANSTREMMING
913,021,016 *5F0AAC2CBD899D7638DF978E8A5F8301D39488E9 STANTON.ARRIOLA
913,021,017 *5F0F32F8248B84A33236EBE71DE7E182DEB57912 ROBIN.SZENASI
913,021,018 *5F0B7EFBB72A530428814E60558180A4A8C986F4 rockwork-1-(30-second-version)
913,021,019 *5F00171189F67DCD282D20A556A60FEBF0938479 Stefanie.Tummolo
913,021,020 *5F052186A24DB17B5BF3307A749B373DE8D2D8B6 ROMAGNYSOUSROUGEMONT
913,021,021 *5F04AD3DE9C984502EEA0663C1F84DEB4970EAEE RONHOGATT
913,021,022 *5F0A264D40FA8EAC41BE718AF5729CFA2DC745F2 [email protected]
913,021,023 *5F0DD5F4E448E6004B9B256B55984D7DE3FB1B15 [email protected]
913,021,024 *5F0D451DD2B4D26A6BF9241F080BDC198963A7AB ROSENDO.TAKACH
913,021,025 *5F08C7C3352476AA77733D5C11E41F6E1384FC7E STRFIRST8
913,021,026 *5F0050A9C87F76859896B0695D8AE69E67D3192D rpukorochtrumpeter(leifbergman)
913,021,027 *5F0C1CA15B369DF0B60872785CB652D6B55691DE rrtliefed
913,021,028 *5F0831834E41D04DC4E6ADD4CE9B50E814B5BBE4 SUBMRKCBCYVL0
913,021,029 *5F09E78761E95811C926A908322A6BE1209EEA7E ruinging
913,021,030 *5F0892A4A2BFC1FB064FEEDDDCF56E85379791B9 RUPERTBOHNERT
913,021,031 *5F0C4559302B36094340E353B9B0E8664FB6D4AF SUKHMINDERSINGH
913,021,032 *5F0ED6062BD08DA08178CB5E809A808D8C6C7E14 [email protected]
913,021,033 *5F0D443A4D8596C069E6B0A8A6A0155BB353CFFF [email protected]
913,021,034 *5F0CF91A36748D25840ABFF93B76A0461062525E [email protected]
913,021,035 *5F0448D4A0EA4564D42CD0A15633562F4103F58A SUPPOSEDACADEMICACCOUNTED8
913,021,036 *5F0815F15AF1DF8FC3499679BF9D94C6A05A69A2 SUPRADUODENALISES
913,021,037 *5F06CA7337371EE3A27A865D01E23EB20A8485DE SACHONS!
913,021,038 *5F077FF0E5B3077F92C1A6FD1D4489BAA625E31B SADOCANNIBALISTIC
913,021,039 *5F0862CB0B69CFCB1424935C2995643FD9570AFB SAILPROMISECOMWWW
913,021,040 *5F0589BFB056DF5E2DFC6F300A6F5DFFADD76007 sallyseely
913,021,041 *5F0FC7BB71ACCD05F68E309A991297F2FAA01174 sangmonarch
913,021,042 *5F0039F730EFDF4EB53A9A87F3C83541863B1192 tailcitation
913,021,043 *5F03EDF24B956AD4C1423EC22221FB45B791E32F TALKDOG_ODOR
913,021,044 *5F069841CA065BBADF3ADE6D24B032A5B9188CCC TALKFUZZY-47
913,021,045 *5F0508741B3143E2A6A090F3262390F4ED66EDDD TALKMEDV73
913,021,046 *5F00741A641CB20CCFB916CFED7F89DACAD43B4A Satou.Kohta
913,021,047 *5F099C5E953AC21FE29A1D8DE71C6CDDF93803E5 TALKPOASTER
913,021,048 *5F06427EA53EA9F0DCB803E45417AD5BEE20DB36 TALKSHATADAL
913,021,049 *5F0401439E4F53D57DFC62ACBAEEC74CC2B8C25D TALKWRITTENCOMM
913,021,050 *5F028B030A4A1061A646E34BC26CA46A24714987 TAMAL13
913,021,051 *5F02B86962198C8EED4784AE512C0A473ABD83EE TAMARATECHNO9
913,021,052 *5F08FA40D5034221743600B5CFF134BC36A7D0A5 SCABRESCENTS2
913,021,053 *5F04CEAF3F4E42BA884DF1AC87EAE0D5ABCEB15C TARNISHING3
913,021,054 *5F027B308BF55AF36506DC06BD1BA140D8E736F8 SCOOCHANAH
913,021,055 *5F0DFB84CBA2BEB426E8E01AF73B9D4963E8CAC0 SCOTT-MEGGS
913,021,056 *5F05AA6D7AC43E7475E6050C3D919D00F882DE63 teamo.mi.patito
913,021,057 *5F0878EBCD068E0EFF157090B91ABD7709E5CF2D ”technics
913,021,058 *5F0460164C9C5669CA77E16C0CB33FE2AFC4B978 [email protected]
913,021,059 *5F0C3F86229DD39503917D04375CF5AEDB47D49E SDIOBUCING
913,021,060 *5F0E6B5F3A9D2A5A7811AE6F7D1C7128692176DB SEBASTIANPENDLETON
913,021,061 *5F0D5CFB71EA5F45EA89345FB1EA4CBEF864327B TE,OBOE,VIOLINE,STREICHERUNDBASSOCONTINUOINDDUR2
913,021,062 *5F0B00B49EFFE2016E5812A46468F87D7AEEB20D SENHA1269
913,021,063 *5F0E02E24694EF32C16DC2B6BFFC513B53DF8CAE THANATOPSIS!
913,021,064 *5F093EF94A078705E3F975B9C54962A338507D01 SHELDON.AFFELTRANGER
913,021,065 *5F08CF1DE7AD984957F89C172C114E373675D546 THE PEDESTRIAN'S CAN-CAN
913,021,066 *5F0BC4B64547FBC184A9F2A1CDF05E1F2B29DBC4 SHIRLEY295
913,021,067 *5F0B2324DCD793A1ED15991FA21CCCBF964436FF three-lute-dances:-bransles
913,021,068 *5F008636B0B63F37C9C41CA95910093FE6EDF48D SIGNALSPANNUNGGING
913,021,069 *5F06C3D9C158576C8F5C70C893BA61F53096A498 [email protected]
913,021,070 *5F0F71BD476FA82EAAED96882942ED13DDB5F281 [email protected]
913,021,071 *5F0173E83F521494DDD17BB6A72B8A217AD6B21C SINERGIDI
913,021,072 *5F09085835A57DE07FF15C50801D65A3855C3C7F SISAMB
913,021,073 *5F0365125CB1E008869C0A5989988D3823128ECC TJTJ1976
913,021,074 *5F0013C24A9DA42B5675DE184FC8A7713A97408D tlegnewz7
913,021,075 *5F0D059C03F1BC94742EB61FA7D31E5E9AFA99EC SLOBODAN NOVAKOVIC
913,021,076 *5F04F1C1B1646EAFF7613740E74D88E7B28BC641 smdcdnt7
913,021,077 *5F08CA78FE1E305D28111C8E4C21BBE5D363E26B [email protected]
913,021,078 *5F00340C5C411DD2BC2952E105E600AD8D7E49E0 [email protected]
913,021,079 *5F0820FC170E11691EA63C0E913278CD4F243C0D tongue-fucking.a.torch-melted.snatch
913,021,080 *5F020DC36D6CDBEFC10C1157476F5A66796FD74C [email protected]
913,021,081 *5F0F4226A0D78361084CEDDA42C4EB6EC6BFC25D SOGASPAS1
913,021,082 *5F03EF8CE75149A2CBF1C20366966D1CE41C5CF1 SONGS7
913,021,083 *5F0B3BDB84703A51FA56B4E0AE206522015A4947 TRATADO-HERRAN-CASS
913,021,084 *5F06473A2BBC24953C73DC2123CCDE05A49535C9 TREASA.PETERS
913,021,085 *5F0A9FE24F5B891FF18A8FE694A4CADD705E0ABB treasure.aragon
913,021,086 *5F0A29E400C4EC50FFE4961315313F7A846114F1 SP0NDY11T1S
913,021,087 *5F0BC6964B04B989B69E722558C6E1C26D1BE54F TRIMPOP
913,021,088 *5F0F9644848021699BEA5A62591F860333878187 trowrewot
913,021,089 *5F025729FD04603AB159E5D78CF9EDBE94D61D87 TUAN.BRENTNALL
913,021,090 *5F0D3C35A3167DD62311ECE0669539B52B13B8F4 SRC="HTTP//ECXIMAGES-AMAZONCOM/IMAGES/I/217Z74MS1QL_AA115_JPG
913,021,091 *5F0F5B3F9129251F41F876F87179508CD6C4FA28 tunswachen":IXAria(Hercules)"Ichwilldichnichth
913,021,092 *5F0112193A9B4EF15CC65ACAB69122AEB73F7FBB TUTI-RENI
913,021,093 *5F0FAEE2D8649D81681CE2FB342AFC478AED659E SSUPMLYK8
913,021,094 *5F02F1465A518CD294723B047FDC833B271A6C1A STACEYWHITNEY
913,021,095 *5F07D17E32310C9328D71A39E691F125A4A7F254 starytarg
913,021,096 *5F0C014861A775519A10F5CECC5B598BE5E2B343 UALAI MASON
913,021,097 *5F0550AB80411027734E595085FAE8DE8AB4A2C4 UBINSAMOR
913,021,098 *5F050FBE5AF327E84AEA97304939DB5846BDA232 STEPHEN.KANEKUNI
913,021,099 *5F0ABA841D7A9B30DCF9F133DE2055936A0816EF steve.augustine
913,021,100 *5F09D5B217E7D42BF057CC5F52556703F0CA7F73 UITVAREND
913,021,101 *5F0530A260FB50C667526C0770857FC260CC8186 UMILJATS
913,021,102 *5F099DD31A5DEE247E3710BE32A97082E4B2F780 STIRATOS
913,021,103 *5F0531AF6A5FE7069EDF32963EE008928B0754C5 UNIFORMLOOKING
913,021,104 *5F0F4FEC40289A21C6489D6C191D55E34185E494 STUFATO8
913,021,105 *5F0BDF7F8BB91923843B452819ACA5197F0BFF01 unnominalistic.
913,021,106 *5F06528504502E7F01DF62ED5132CA41CAA18341 SUICRAMED
913,021,107 *5F068CDBEBD30D829BF2CDA67BF412FEEC31FD26 UPCQBB
913,021,108 *5F0711E41EEFCCAB7D295F57ECBB80998CDB9971 SUITEINAMINOR,BWV995:(ORIGGMINOR)VIGIGUE
913,021,109 *5F05B667A9AC4C11DE6EB36DDADCECE304046892 [email protected]
913,021,110 *5F0C537278E64CC774836A0ADA1A8245E6D4DFFA SUNRISEFISHING1
913,021,111 *5F04F35D0A06E6C205D7AAB7D9EB47D3FB1511B4 [email protected]
913,021,112 *5F0F426C31A2F0E9D67C3847226573FB854AA628 UTKONOSOVKA
913,021,113 *5F0C419CF37C875A17CDC61DB9DD61310EFBE371 [email protected]
913,021,114 *5F0C9DFE542F8920DB79A3BDAC3D3442F06D4EF3 UVHTUNOO3
913,021,115 *5F0B599474538B54577D1E72731E296861721FA6 U`?Y
913,021,116 *5F0124F4C9DB50A9E44078CB4679C8CC38670E05 uzoamakamkparusamuel
913,021,117 *5F06D8B6326A8EF90F9084D41F996C7C82BC6CB7 VACUUMPOWERED
913,021,118 *5F025115942E51B711A3D074B9744EFC06D3E693 VAISHALI-MARWAH
913,021,119 *5F08E899C7704C6C8F002A0E8CD9CBD5036F6A9B VAIYAMAKAAH
913,021,120 *5F00C1D3304E6B3CBEDE6FE951E474EF37B2430B vallady
913,021,121 *5F051CF75DC9ACB13B264098D0C0464735D769F3 [email protected]
913,021,122 *5F0B5E2F052F2FF58D80544C87E0955D8BAFFB9B VAPIJTE
913,021,123 *5F03DC3CC0BEB863403A0900833DB606BCDDFE74 VASAJTO25
913,021,124 *5F0282B9DFDE8DE8A965650E2CC04DAA0355F5E2 TAHMINEH.ASGARI
913,021,125 *5F06164BCBBBF9DBF281ABB81F232A26D78DA53F VBOSU
913,021,126 *5F03137CDD44E528DCB66EAB1966CA53C285F332 TAKETOTHESKY(DEMO)
913,021,127 *5F06AE7F1CCBB1CE732B480A028CAE5966015809 VERLISE3
913,021,128 *5F040C9230A3C89257ACE18848A4F2ACD111DCBE [email protected]
913,021,129 *5F0C5B277577B73215B14F942A5CADB9C0114A96 [email protected]
913,021,130 *5F06D9A6C07BE630C9EAD1BECB4611E3921482A9 tapauth
913,021,131 *5F0CB52CE13A162FBAE4C8CB1F0120CEA414268F Tarkkaillaan(featLauraN
913,021,132 *5F033BBEC806FB6C9BFADAE7C8A164B88DDB0FEC TASHAGOFISH5
913,021,133 *5F0434988483DE59E08D2539C7385B10109EE083 VICKIE.DAVIS.CAMPBELL
913,021,134 *5F0F1ABBC381537728C08EB79B0BCF42A22FC037 VICKI.MATULICH
913,021,135 *5F0E0C3DCA6EEE23C8E68455BDA8ACD6BF3A38EE VICKYDOLLARS8
913,021,136 *5F006250B1CAA763045526A12A2888FB5B4D536C vickyhotdog
913,021,137 *5F0AD747E0A54984878F80F90CEB3E30146BFCF7 TBILISISS
913,021,138 *5F0D97B53EC0EE51055FB00D9DC18E47836F13E8 VICTOR-MIMEAULT
913,021,139 *5F0FC9CF04088D79FDB30E61B05DB14E602E4396 vigilance3
913,021,140 *5F005C4A525F5594D7631903D9359145DFA35E56 vikasshikervar
913,021,141 *5F00B1CB12AEB28BFE903A3FAA26F5CD14F8E211 VILKĖS
913,021,142 *5F014877FB8DDDD7A6E54BF502B86710E9C12142 TEIGOVAHELENA
913,021,143 *5F064A4417E1B55027E4C3C8C14FCA364B274AAE VITELIUSED
913,021,144 *5F0F1C8688CBFF5BC26125B92E5BD3FC198A2C36 vivicardinas
913,021,145 *5F08A76A8FFD41A07C3DAAA5EA132B1F4E4C151B TEXT''ULTIOMO
913,021,146 *5F0B8D07D941CB4C7C178C2AA72523DB5C72D28B VOICEXMLXV
913,021,147 *5F06B7CDBA24A6279DB30F80FBF00DB015FE005D THATCONFUSED94
913,021,148 *5F00A420587E2FC07C494DEB60B1E324F2E4BA3E VOLC4NOLOG!S+S
913,021,149 *5F073EF2E83B772C1B0C4D2E031005CB7F7836BD THAT'SWHATWEDO(A)
913,021,150 *5F06C9F7E400D6AA747D3B2D70AA510FAE830D58 theactress
913,021,151 *5F0D1ED1368E74162F08E10B09FE52F267852830 THEO.JACOBS
913,021,152 *5F099485F0600155F0BEA8DB3BBBA9AEDA9BC8DF WATERSTAIN
913,021,153 *5F04A1B43BFA07AD7191D5B830A4912CCA74F47D timothynesmith
913,021,154 *5F0B7EAE372154E5BA63EF83EF11C211EF447BD6 werecrocodile
913,021,155 *5F0ACD2CE2E7253946E7D68C61D6943051A7ECA4 [email protected]
913,021,156 *5F03EECE6B26FE1B42009D35670092B157262993 We've-Come-To-Worship-You
913,021,157 *5F0792C3D58E6AB442C88CA14C81C1A9A950697D WHICH.IN.MYSELF.I.BOLDLY.WILL.DEFEND;
913,021,158 *5F0BE9004C442AD19573546A1EE34410B8048C31 WIJENAYAKASHASHIKA
913,021,159 *5F0D85CE13B4B2DFBBC20A67A7660C31E0755174 TONI-SCHOLZ
913,021,160 *5F075E425A6BF166A7917DC5FAD2912379A04FAD TONY-GOLDENSTEIN
913,021,161 *5F0168FD2CEBAEF4DEDEA969EDABC8858EF6D26E [email protected]
913,021,162 *5F09D3C00573FBFF9D5646655CD8C7347365051E WILLIEFUCKER
913,021,163 *5F036BE1C4D2C469629988F22675886CDE895A2E tracysindel
913,021,164 *5F0346D426B7674179BE961487A5005851BE6B69 traduziu0
913,021,165 *5F01310DD843FE63982CBF5FA73D8B5957AFE1E5 wisdomdignity
913,021,166 *5F0029801A7764652178EFF0773C8DED03310865 trenten.volz
913,021,167 *5F05A48FEB53F0F51E8781935FF041A5265E6F52 TRESNOITAVAM8
913,021,168 *5F070E9D61ADFE7FD555F3E905B1F790D4543DBA TREVOLINSKI
913,021,169 *5F0B8C4A38A1E69769A30B4A3F73A6FEA27C6019 TRICIABAKKER
913,021,170 *5F09546143E61E5E67A46CE689CD7E8DE9BC578F WOOORDPAD
913,021,171 *5F059E21D1B39C6DF847DC4E2FA3C3EBE71237AC wumiao
913,021,172 *5F06C9A6E0A2A06BFC53F584278CA7F84FD5BC12 TSEISSIR5
913,021,173 *5F02CDAB0444CD4DD5DEBDE16012596255FFADCD WWW.HORSELOVERSUNITED.COM
913,021,174 *5F08FCA96D57FCEA495A5FF5840F66D0027072B8 TTGGCXXXXXGCCAA
913,021,175 *5F04EAD728E03FB36D87FBA71B85180D197F9926 xaupnt51mv
913,021,176 *5F0BA7EF0EC4E0C30C9081260B480E93C8DC0D26 TYROSINRESTS
913,021,177 *5F073DDD2451415845AC2461ABFF4F749F19DADB xu80
913,021,178 *5F0B5D6FAC2BC648938E6A8C9BD8DD6A5DFF9EBD XUJUNSHUN
913,021,179 *5F088AA886CE2AFE1407EA8F184754F46928C050 xz}<
913,021,180 *5F09198DB413E3A03165082F5D86E0E48DE58CBE UN4MUSINGLY
913,021,181 *5F0F8FCE761C36CA7BC9DA3EFA3280BAB63BEF1A unaisled
913,021,182 *5F0591EF487B32E6370B4FCE75F985AE8518D716 UNC00RDNA+3D
913,021,183 *5F096C6A3B2D4B8C1BA900CF1568C046153880EC unused7
913,021,184 *5F0B3D67FB58B88148F6BFCFA1108C22B11D127C YOUTH-UNCOUTH
913,021,185 *5F0056761563BF7A69CEE947FFF370B5F5E74AD1 USERONDREJKONICEKCS
913,021,186 *5F06F1E2FE49FCE55D3EFE736485B253CEDF96A0 [email protected]
913,021,187 *5F0DB7AE989DB3BD063716380149D25AB4E1821C UTRSTELIG5
913,021,188 *5F09072C11C930A5DBAFDEE407DE96CBE71A36AD [email protected]
913,021,189 *5F01203CBE46EB7CF7402D4127A2C474FAB289EF UW-PASSAIC
913,021,190 *5F015F36D130793FD9D0968B0A51D7F26F760053 YVONNEROPER
913,021,191 *5F0CE29B1E6C0797A5451FA278027720FE216EE2 Z123927
913,021,192 *5F031885BD9B6152FFD725BE87C4F451069F7AB6 VALENTINE-MAITHYA
913,021,193 *5F095C65EC2A0AF682F07885438496E2B2DDB16E valentinesplonskowski
913,021,194 *5F02F4D313E3C2C9225DD2AA42334CD9962EAF6B ZACKLEUCHARS
913,021,195 *5F019CC1AB5BEE4D8BBD38C80782F999B02001A7 ZAIM FAIZ
913,021,196 *5F0067FD4504777ED86DDFF4744209525631C05C ZAŃ
913,021,197 *5F051ADA791C226F17DEEB44077F046AA9A4C5E9 VANCEDONERSON
913,021,198 *5F09039135E96286C0550CF4A5B76B3293B9092D vanessaadamsgodfrey
913,021,199 *5F092C8ADF3549560C86B38E4DB22137EB83641D ZARCESHI
913,021,200 *5F08D7E4B5220F87F1636CCAC05255572009D898 VEGIERIDANI
913,021,201 *5F0B3CBF116E4B8890254ED15FB71A6DA4A25D4F VELIXW
913,021,202 *5F05CC05794FDC0087FECB3162070ECE4A441D75 [email protected]
913,021,203 *5F0DFA4EE740F35B888A62FEA7F869817AF65BD2 [email protected]
913,021,204 *5F098864C146A22DD0D9BDE00D843E1A69A3834D [email protected]
913,021,205 *5F00D6A39CD4E8C926742D84B6E8D7BC87425702 [email protected]
913,021,206 *5F0880387E40CD8C1DDD37740F36383307877477 [email protected]
913,021,207 *5F0D41A1CE4B148D54A379876F4AA41586AB7451 zhigen.yu
913,021,208 *5F00BD90446B31207AC551790374E45D982596F8 VERNONHOUSDEN
913,021,209 *5F074379A9D2FA21748A4C84247523BB9765C1F7 zodiact11
913,021,210 *5F02EA52D8A59E3045F63F398812C6C923861C96 ZOODO
913,021,211 *5F0C967C8C18A5C7DA86609DCFA304CBDBB69945 ZUFFOLASSE3
913,021,212 *5F0C5B40BF89C6836875FB1AF778FDA2AD32C60E zuruckverfolgtes
913,021,213 *5F02757BB59CA5C8A95441B38BC461138543C957 VIKS WHOWANKNOW OH
913,021,214 *5F09E67A4D5B1399421E08CB77810F97F8E2DE0E vinandet7
913,021,215 *5F039F4E772F5BDE0B4A83752095F60CEFAC54FE ΜΟΛΟΣΣΙΚΌΣ
913,021,216 *5F0334917C2B7F8A146DAFDEEF03FD2EFAD32AEB τραχειοτομικήσ
913,021,217 *5F0B75B8BC9038EAF3E644029565542AEC64E83C VIRGINIA.MATHIESON
913,021,218 *5F0335F5B303A4B1DCAA4BA658CCEBC14BADE027 восстанавливавшим
913,021,219 *5F08C7C757EC6F0EB220FF961307B23963CD0485 VME5515
913,021,220 *5F0A5A3BDD8FF7C7C57813B9160EA98C3ACE99C9 [email protected]
913,021,221 *5F07513988F4F3189A7084D688CB7160FDD3A551 [email protected]
913,021,222 *5F0D3878B34A69BEBF1F13CCB12813C060A4F0C0 ИСКУПОВАТЬ
913,021,223 *5F03F7DEC0F78BE910BDFD61A18F3B7F891CFCC3 VOODOO JAZZ RAPTURE
913,021,224 *5F0A199BCAB8776A2E046575D4A8295E565C99A0 ЈУНГМАИСТЕР
913,021,225 *5F0CE4CB92DE18E2E63BCEA5BC5BFA140137D685 vu1gar1+1e5
913,021,226 *5F00D8C3256E0E6BE9DA7856946B5EA816D46D19 VVBWMLDM5
913,021,227 *5F0A60CA8FA852AC722030D005E76E6BC531343E w3(m
913,021,228 *5F0FD6E8939524215ECE892E8F9D9E54889C610F ПРИВЛЕКАТЬ…
913,021,229 *5F08286C98A0A7FE08C487D625ABC7EFE77D307F ПРОГОЛОСАВАЛИ
913,021,230 *5F0454B39396C02CE28088618CCB879DA29689B9 РАДИОСПИРОГРАФИЯ
913,021,231 *5F032DF86EC00EFEDFE96DCEEB937CD51F54D42D walls39
913,021,232 *5F064572C565A23777F7A34998C5B39853B701CB УММИД
913,021,233 *5F006B20D35F59ABFC73F1C187722B96E809DBCE [email protected]
913,021,234 *5F0D5B688C7770ED4BB6420F173707887A766523 wanda robinson
913,021,235 *5F096B86674A99FDC31D8B1DB529FE0243FCC69B washingtondc,pittsburgh,losangelesandsan
913,021,236 *5F00B153883CA3D244B6F7FBD63533D8DFB532FD wattershed (1995-10-16: the circus, stockholm, sweden)
913,021,237 *5F0A113FC7E65A511195E96F1721ADDA79944BF8 will.hobbs
913,021,238 *5F02422500C767AD009B2B82B56F9AD24534AE3A WILLY.CARAVANTES
913,021,239 *5F0E2D93B5A850A81619B2E529B74FC631DCAD7E wl!z
913,021,240 *5F014FA280B50B7D9CDD2F136780AB98E7833435 WPR-JAZZ
913,021,241 *5F065CB514482BB190A441C1F12B6B217980AD20 WSYEMSED
913,021,242 *5F034613788AB452990F1BADC86A27D14CAD4207 WULITZERJUNCTION
913,021,243 *5F0DCE0628CA1564EFAB849D32843FA275071C0A WWWSPOOKSHOWSCOM
913,021,244 *5F0891A95B098E84C64F71BA126CC822C367E051 WWW.TRANSCHRISTIANS.ORG
913,021,245 *5F0765F5FEAF820C7C7DEA49D905F417D8D926D3 XE=X
913,021,246 *5F0F2658410AB6BE60E3C9B580247C2E4296A843 [email protected]
913,021,247 *5F0A5141AC369AC279E28BC50457CB4D1EEB09E4 [email protected]
913,021,248 *5F0FB74B43686F0642549C2BDB1B8E42DDD97676 [email protected]
913,021,249 *5F075E6A3EF2DCE1FAB6F2FBA6F41C0737276F1C (X)[email protected]
913,021,250 *5F01ACFA32A1D7F4B71C5073A5C0E92C9BCC2754 [email protected]
913,021,251 *5F0124803C600D1C28D85EDF4E7FC950DEAC0009 [email protected]
913,021,252 *5F010C6AEE47433AB79D9CC5CE337626E1A563F1 [email protected]
913,021,253 *5F0B17EA24CA9D0472F43163BA06F2F8A6A8209C yayobetancourt
913,021,254 *5F0BC3EE34BC7B5BC8311C0F51D86D4A79A440F5 YTISONENEV6
913,021,255 *5F0D1E62AF6B1A593FE9522585C630D814369566 05191447
913,021,256 *5F090F547EE72C5B68178CD166512DEAA065A61B 064197a8470337e3af295e468b9f6054
913,021,257 *5F0A73D8795C24E8B7C4B6D6C453509D1A512E7F 08231022
913,021,258 *5F030DBC2DFB80EE899E0A4CC672E4DED3CF444D 0B68560C80A72FE0E8A868D077B78068 9113177
913,021,259 *5F0EAABE435EF577E4F3E0782C0264F5C3C8211F Z25/
913,021,260 *5F0EF226BCEB4D072E62B1048E0E78925EC7BF49 0iluvheather6
913,021,261 *5F003908AAA61F1F89F4B1FDCDAB4AD5C4AFDE98 1003922 BISLANGBETRUGES25,50EURO.
913,021,262 *5F053F38940819686BBF3790BA7AC747610FCBDB 105130 BANKALAR.,.4389.SAYILI.KANUN'UN.19.1..
913,021,263 *5F0EABDE783844A4F9A36BA6566566C70607BCE4 10february1919
913,021,264 *5F071A1D79C58837324D7A540063A1A94C9540D2 1193687 ARI.MELAKARI.ON.ANTANUT.SUOSTUMUKSENSA.J
913,021,265 *5F0ABB1AB0FFD690FF724A0BC5D42523F43D259C [email protected]
913,021,266 *5F0614FA1836928B829E5C9BA6728F6BA1F9017A [email protected]
913,021,267 *5F0459C83B5827674E9F280C8C067D33B9B94C62 1328448 SLU:N OSAAMISKESKUKSESTA L
913,021,268 *5F05E8407DA0378D00EF4E76264328A2EAC67EA5 [email protected]
913,021,269 *5F057907B1857123F47FD0C2FAC264E5BE6E20E5 1367099 THERE'SONLYONETHINGMISSING_THESTANDS
913,021,270 *5F0764716C4A293F7CBCE23ACBAEDCC7C13CD051 1371275 KIRJASSA-ON-MM-.-KUULUISA-SHEWHARTIN-YMPYR
913,021,271 *5F02CBF6DDC74652FAB10AA2CA79982BC7B68478 137alexzander
913,021,272 *5F0F6A84E7167E12580CDD4A20183CB6A5F299D7 13.NETTORAHOITUSKULUT
913,021,273 *5F0515DD3B817338A7D242E5779F8B26E82B1736 [email protected]
913,021,274 *5F0D3FEE5BD459896565DBCB54E2373660FF3F22 151921 HUONEET-:-SIISTIT-,-PIENEHK
913,021,275 *5F017251135EB8C87E6584DCDBB548062CF3D747 zobni
913,021,276 *5F008DBDE9DB181E778E37DE28C3AB95F3100F11 1711724 EINTOTERBAUMISTLEBENSRAUMVIELERINSEKTEN
913,021,277 *5F006AC28A3C7FA40EAF4CE3304F41DD47033BE5 1775640 DAS.GILT.AUCH.IN.DEN.TAGEN.VOR.DEM.VIEHSCHEID..
913,021,278 *5F02551DAA787E02AB45EFFFCF6EE5D141489D1F 1884646 tilaukset:invalidiliitonk
913,021,279 *5F06E482BEF203B6437927DEFE520C23D817149D 18OCT1071
913,021,280 *5F0C07AE7B023D39860891DC542DFD3F8C34DAED zzcottontop
913,021,281 *5F054F358C875986858A35BE1FE03D89DE29EFAE 19pussy86
913,021,282 *5F0660C0A4C7B6500CDF99AF7872717AFCBE60E4 1ASENNETUTKIMUKSET
913,021,283 *5F076BDF60BED13E4D12606FCE33528A7560AEC5 ГЕНРИЦ
913,021,284 *5F0A0A01113F778E67A98C9DFE91C2D91D076E12 1ESSIUOFN
913,021,285 *5F0C20BAF0BB80B5FD08E585065B51CEDE4EA0E8 1FAYETTE
913,021,286 *5F07BD1953C031F1A5A3358C98ED51B209221DE5 особеннно
913,021,287 *5F0F5515DE74F53CDA88B071A9CAF66AADD31D4F 1.hydrocarbonburning
913,021,288 *5F00A3582FEFE19D2B71DF04B3E5B12D6B33C27A ПЪРШОРОВА
913,021,289 *5F07251A82DBB1FBEE54C8A1CEAA92877BE42679 1.katonraja
913,021,290 *5F00878AD1E640A53F986EDBD0AF249FE277F15F 1KIRKLYN
913,021,291 *5F03D25E5F40680BE13A81487138BFDD6A6B09EC 1.melasetlehdest
913,021,292 *5F0B3AA49419741DB9564F15804C166B3FCC1334 1-muellfreien
913,021,293 *5F0FC1F17968759A8EFA30B27507EA2EB980A078 1NCNTNTY
913,021,294 *5F066C6A75F14198F6017FC257A94D41FA40BA97 内閣府認証NPO法人日本テクニカルデザイナーズ協会
913,021,295 *5F01B4F8E682C9301AD6E90985BB9B879169806D 1-REISEIMPFUNG
913,021,296 *5F01024130044904B244DE5B05DBB18B0D533BA5 1SEP1249
913,021,297 *5F0455319A31F203E3D6AB0D120A657AA2A2095F 1.STAR-HUTMACHERIN
913,021,298 *5F0348EEE148D7026EE0F8C7320FA7C367625BBD 1-SUBSTANTIELLSTER
913,021,299 *5F0B37C0CFD1F103A6E609CD9D26EAB1A1615A1E 1.TECHNIKKURSUS
913,021,300 *5F0039E5B56C617B76DB3D863BE4FFB59A594856 1.telefonmuschel
913,021,301 *5F07ADDA69F5B472B1BC7CA93DF6057C92CC4979 1-TULOKASKURSSI
913,021,302 *5F04CBF7E2D7052CDEA7AE0EE0DBD63F4E34DD73 1TUSKUSSA
913,021,303 *5F08F10A8784AB07D8D224BB8BD708DC674D012E 1-ucet
913,021,304 *5F0BE02E0C513FF35F3EB13A64102B6CA3376AEB 1 ULOSTEN
913,021,305 *5F04423141E890547AEC3547E4C4F2B633F9094B 1-zubringer-bruecken
913,021,306 *5F067B0E9AF5B68A865F7CA57850E9B377ACA156 20080131ARTFIG00622
913,021,307 *5F0B1D477D2E35FE7CD355F6EF76959BEF2B5A83 218NORAH
913,021,308 *5F07A6E1F1DC91F9B4B05357826FDE7A46133722 2387003 EXPROPRIATINGMONEYISANOLDSOVIETHABIT
913,021,309 *5F0C57C1D4D0682EEA2091EAB0D491A39FF8816A 2528415 EQUITY-STRATEGISTS-WERE-IN-TWO-MINDS-YESTERDAY-.
913,021,310 *5F0095ABCEC00532EC514E6C2CF492CC32A6890B 2580066 ich-habe-die-tour-schon-einmal-gewonnen-.-"
913,021,311 *5F0D2CE3321C53A70A7234E16E997006D4CD9CA1 25-artiracaktir
913,021,312 *5F07C4F06F08EEAA01FDB29F4DE7DCD8708BD35D 2635536 ansioistaan.someron.kotiseututy
913,021,313 *5F0203DB2D6E50776E1F640E7AC29F1D87F69163 268693 KOPIOT-MUISTUTUKSISTA-ON-TOIMITETTU-KUNNANHALLITUKSEN-J
913,021,314 *5F0777F04B848EBEE9BAC2B1CBF687F6A04D072F 2945353 kolme.ensimm
913,021,315 *5F0D6A2905E52EC1DF70197676169576D02C8808 2DESCULPOU
913,021,316 *5F0A2EB5577C4EF4B022E6C1828805C719089221 2.heikinkangas
913,021,317 *5F0CD987C618546C5C3182990BB4BCEDC4385018 2 LAWSEN
913,021,318 *5F0A0682BCD871FC024E4F20D45E32BA88E62AFD 2 OLEVAIVAUTUNUT
913,021,319 *5F0CF78B651AADA0E3CB5F021118D5C96FE4544F 2-peepshow
913,021,320 *5F0627E9AD60BE1DAAA11C49CCD1328B50F12F81 2.rasteritiheydet
913,021,321 *5F0B73CCD92FF700B67DEA78D77DD8402512CF23 2.SUURIKOKOISILLA
913,021,322 *5F0BDB52EC03B7BE91738ACE8E6CB7755B14CF1A 3178BBEC-C813-35C3-884E-39368CD882D7
913,021,323 *5F03D39A26F3AB964ECDC490D9629BEAA2759D26 <33jimmynorlund
913,021,324 *5F0C35C18FCC67F1A9F6A68687DC5802826DF329 3--B*->-<
913,021,325 *5F0F441D7E95F3E241DE02C3F2CCB61AF9990CB5 3B<[email protected]
913,021,326 *5F090D430F875AA2959E1C3A9F9DDA8D0C8D9FF0 3BPDABSW
913,021,327 *5F0B7BB75FA8F40989A02E1C9F7BAE318CE1B33F 3COUVRIREZ
913,021,328 *5F0CF8F2F5D0EE953A56BD3B03A13D34935BA253 3dpa226
913,021,329 *5F0E06150D10D3B81C935991111D58E173F91FAF 3iamhamilton5
913,021,330 *5F008E78C3652606F4B59D87895CDEE8CFDA559F 40.SETLEMENTTI
913,021,331 *5F02132A48535939EEBCBF2AC54B6D73C2D76ED9 41-suunnassa
913,021,332 *5F05F4756EC04A147CCE3DF715443C39A7DD1159 42-BANDA
913,021,333 *5F0C739EA1FFC7C0B0EA8F0BEFFD2A62FD3783F4 459theresa
913,021,334 *5F09DE8C4037C497BB8958483896ED2E80E32BF5 4AGNIDIVT
913,021,335 *5F0B7871AB2804B8E5D6C1C865ECD86A066D493E 0922MH
913,021,336 *5F0A8302157CB71EA70034DC2CB5976BA05B6B1D 0ilovehoosier3
913,021,337 *5F0E306064F527742EE65543C565DC5439B7E4AD 4IAMZOLTAN
913,021,338 *5F0AAD823B6900856B12DBF44F6A0EA8D55128DE 4NANCYHERNREICH
913,021,339 *5F0EB2583A18E9FAEDF85B850D0F9974089F8148 4NEGNIGNA
913,021,340 *5F02734BB4F0067AB22CB690938FD7EE10D3F0AD 4ORESSIPOS
913,021,341 *5F028105EA04DC549767017E3F2BD850D287F4C3 4RASTALJENOJ
913,021,342 *5F022BA134AAA1038E9199372C16746FE89553FD 4SEKAMELS
913,021,343 *5F0C98C08009C1AC75A02C3F8C3766BFA5902AA9 4SKOLELEGE
913,021,344 *5F079C7DCE4EE901A71AE904488B4BA5C8EBB253 1331803 das rad ist ueberdreht " , sagte der bayern-lobbyist
913,021,345 *5F0F212AF8017A4132D71D030B5BBE7F7EA0E5BC 1343487 taina,juha,fk,leht.
913,021,346 *5F0669F2312ACE9EED5A78EB896E4C8768AEDF3F 1364685 KUNDUS - ES WIRKT IM ERSTEN MOMENT BEINAHE KITSCHIG
913,021,347 *5F0712D3E33B16F03312D1365D2E782630A2F453 138979 COGU GRUPTA YUMURTALAR , CESITLI SEKILLERDE KORUNUR .
913,021,348 *5F0FF23B07FAB70E4462E6334A2CF0E33B7D2390 4VANKAINEN
913,021,349 *5F04611EFD916231A1E7D2FC8E060BE33D2B0E40 156ANGELO
913,021,350 *5F0BC9CB8070DA50D32866473F6ABAD180646110 50-S
913,021,351 *5F00B633CAFB2808C2B3FA00E3905BCEF1C9AE61 51e9391a5f7c499f359a72047449c40e-2667640
913,021,352 *5F09D94CD472776DB6C63DC5D4C517E53C837E8C 」51話(NHK、2005年)
913,021,353 *5F06A7CB49EB05FB710B93BF43CCF662AA898229 1699824 " I'VE BEEN EATING THAT FOOD FOR ALMOST FOUR YEARS
913,021,354 *5F0E9CE3B5EB0015538513EA626A696818E2D513 1703410 kun-vuorolta-poistetaan-liikenn
913,021,355 *5F0C794CCD231F3D551B25AE29668CCB40EFCAC5 5-ABSTELLE
913,021,356 *5F036FC17A749E797D23DA3278F3D4B0D44412AE 1770156 "SOMEPEOPLEREACTWITHANGER.
913,021,357 *5F0E0188DA6C030626B32BEBC25EBDAF0E041F5E 5ADFORMIG
913,021,358 *5F0F2A62EC2C88B66BB595DA8F73F17553D2E384 17vorgezogenes
913,021,359 *5F088DE3CFDAE94FC7BF8F5A91CF8B0BC6B68E31 5CEPHALOMERE
913,021,360 *5F0242011A9E296D2E949B0D826EC89ACF9945A4 1.basketille
913,021,361 *5F0EDE400E675B40896D2B5C92AC8C5E83167932 5GERIEBENEN
913,021,362 *5F005192F76960D3FF92F0E31A91EADD5825D2DC 5KECELLER
913,021,363 *5F0A7567637C3C2312491C8213D02C74BAC096D3 1EER!N9
913,021,364 *5F09852573090757E8446EB9A18D9CC003D504C6 1GRANDE1
913,021,365 *5F03E137F80A2FE0ABF1832517F2C677C0A8CF52 1iamreynolds5
913,021,366 *5F0E740B88EC02720E7852DC7057E3B92E1277CB 5SIZETTRAPPEN
913,021,367 *5F0D98BAB10C9BC69249D8873C7303389971C6D1 5SNOWBALTEXAS
913,021,368 *5F010447DE7537D57FCD5B1036260574DE4A742A 1-koulusuoritusten
913,021,369 *5F08F7DCAC48C0E6271E5FB42C946899E8A3E5AB 5TERRIBLEFALLEN
913,021,370 *5F0B8B4E470D7D11388F7B360CAB76B5701AE4CF 1.made-through
913,021,371 *5F07560A012728C6B63D8C9FDD42E97A49E6D25A 1 MIAO
913,021,372 *5F09F8D697AE5D72123ACB71B0E492E804B41FE7 5ZEBRAPACKARD
913,021,373 *5F0D39DCFE4E1D4B3548056D7783800F64C36223 1Oaa
913,021,374 *5F09D15372C461DCA1A936284A28064A0754BCB3 1 PESETA-STAERKE
913,021,375 *5F0E993F27383F1A638B71EAE82BFA1A8A070700 1-POLTTOAINEKUPONGIT
913,021,376 *5F04561A7CF07F26C6729ED166DAEF2B93AF170C 6BENSONCOOKIES
913,021,377 *5F022B7B62075116F27767966D65EF6E9F47C516 1 roughroad
913,021,378 *5F095FD103EEDCF06120B85F08CB1162028B27AF 1-RUECKKAUFPROGRAMMEN
913,021,379 *5F0E3265D5BDE5E79FE9B2D67FD6F632C3E2319F 1STARVIEWS
913,021,380 *5F0B45A0322C30B36C9D69EFAB5CEF5E1251DAA7 6GCCERSBSW
913,021,381 *5F02FD31B816B20941E86677F3B72AE819BD2F55 1 teenietreff
913,021,382 *5F0AE2F92CDB8FDE69F77E8CFC20F07B5B59ED73 1-VALVONTATILOJA
913,021,383 *5F04BD6975D5E8FD038B0CFA0CFBD9BFF0306BEC 6Moun-tai-s
913,021,384 *5F0C08A2AC16EAF40E138C8253601C65C5C22D5C 1.WEINNACHFRAGE
913,021,385 *5F01D1C0F2A461859DACD51E8886A75C14DE0F1B 20041028: london, on, canada (disc 1)
913,021,386 *5F0B1A0C41DFEB305D0521FF2D9E3B0F9929BB64 (2006年、『NAPSAQ〜青春ソングリクエストアルバム〜』)
913,021,387 *5F095AB136B01B70BC7F71369192D474EB3FFA75 204 TOMMY
913,021,388 *5F0C7AFF740B7479A4A0AD57413DC3181D5544A2 2160223 "hegoestovisitthepeople."
913,021,389 *5F0FDC38351FFE12F942C33AEFF9A64B4415D1E3 221184 KASVUAKERTYINOIN10%
913,021,390 *5F0FA984F12A303FCF728B4F4DC857FC5973EF05 6ZDYSKTKFLRMXJEIY
913,021,391 *5F041EA55BAC82E8818C953EDEEEA32312AA9F24 2233962 THE-COMPANY-STARTED-TO-TURN-A-PROFIT-LAST-SEPTEMBER-
913,021,392 *5F01009D264EED4AE5CCCBE441B0800AE826EDC3 2244548 luokkakavereitani-ovat-simo-,-make-ja-otto-.
913,021,393 *5F01AB97F5CF8404D9AA14E236CA5230867D59C8 723MAXIMILLIAN
913,021,394 *5F0046781CD08881855EE45C89F8E24EF6D63C43 [email protected]
913,021,395 *5F02008A53E971A8971B200C1E375F1A5FD83E05 2394272 JOS.TULKINTANI.ON.OIKEA.,.THOMSONIN.ARTIKKELI.VOIDAAN.N
913,021,396 *5F01DD557F98553AE0F036CEE509A5B1F9C7B8FE 2431537 GEWERKSCHAFTER.SPRECHEN.VON.MITTELALTERLICHEN.METHODEN..
913,021,397 *5F04983886D78789A1AA3D5D8273C4AC4372B98D 24.MUTKIKKAITA
913,021,398 *5F019F483DEA4EA57B938F5BC310AC9FC1656B7B 2553634 USOZIALSTAATEINLUXUSDAMPFER?
913,021,399 *5F0F9096DE143BF0038EAA48A9484479E8A4968E 2588713 esitys-ei-ole-virkapakettiasia-
913,021,400 *5F06C72E9E495DB4A1B519C4BD925205D61E84BD 2695530 UHKAKSI.VOI.NOUSTA.ESIMERKIKSI.VIRON.TAVOITTELEMA.NATOJ
913,021,401 *5F00993D82540DE3C1D1C50CCB6C6853FBFB9D1E 2721889 ehdotettava-2-momentti-vastaisi-t
913,021,402 *5F0DD32EB8661E32C63D119387D8919D9EC04AF5 2797391 woherweissmanauch,obmanirgendetwasist?
913,021,403 *5F0C5ECBCA83DDFB3B60080C65CE363D1BB8BE52 27JUL1950
913,021,404 *5F0A6BB2BD2E9006A6296230A8303AA7B8E45F6D 7EMPATARIAS
913,021,405 *5F03E118860D60C0AB5A8CD3F5A0BD0419036527 7GENERALDUSTIN
913,021,406 *5F02F441911CD8A863EDB03E130E729AB16C7775 2 AMRI
913,021,407 *5F050C6B4D6C1D76C0DE295A0C245C172E9ECCD0 2BLACKPENNYJUPIZZA
913,021,408 *5F08F8914528AA1D593779D6FD816958D3152B4E 7LAGUNILLA
913,021,409 *5F0C7D3B721609095B79AE9CBE21313B4667BCEF 7MEAKIN
913,021,410 *5F005C4E59997CF2640CCE3987A6F4C6E48109C0 2GWALA
913,021,411 *5F0C5F8EFB3D62C526BFEBA8CC86C360CA478B49 7NYUJTOTTAK
913,021,412 *5F0E8A0EFD6A0F0B8B37D6C070B069DD3A084A22 2.oyunsever
913,021,413 *5F0AEEAD1BCFA879C6898DEDF1D983BD973C30F9 2PITHS
913,021,414 *5F0367FA4D310310291952E28B742B9E377DB9CF 7THESTARTREK6
913,021,415 *5F09A4643033DBA62566FECC8B8AE5AE76ABA6A9 [email protected]
913,021,416 *5F0E735216BCD254FA22A8DD734A8718EDBD7E46 2UGLISOME
913,021,417 *5F0EF3FFBF0244E364DDCC66D6FE1F7FCC6BEA17 30-07-1109
913,021,418 *5F01ED6A583770D0D3944D9F455CB6AE484459C7 882459 tel.:.(.212.).288.94.00.fax.:.275.87.67.isiklar.alim..
913,021,419 *5F07144DFCF2DDD8C65F27A7E6D56B9123284F8C 321MONIQUE
913,021,420 *5F0AB6382D3E5F8204753EAF7671E179C459507D 330LEXIE
913,021,421 *5F0CEDC3D359FF1A0F66A61F83F4828749C9D0B8 8AMMONIATIONS
913,021,422 *5F0FF84EBE04A7D8FB26C2456387BC109DB7D825 3april64
913,021,423 *5F0504CD53EBAD226B05B38188514F5954869765 8FORSCHUNGSZENTRUM
913,021,424 *5F0363F11F8BBA40D678F39D0E277F6DBD4D2727 3 k
913,021,425 *5F0D4FE9AB8A335432789C8689471FDE0367676B 8littlesheep
913,021,426 *5F08B5B878F92061253A55AC341E6CB497483E49 3THATUNIX1
913,021,427 *5F0D40D3B77B707473C8D0A9CCE619BBEDE32B4C 4297 MICHIGAN
913,021,428 *5F0EEDB6786A450092B20000686B83B6F76CFC5D 460779 ve.baSka.hiCbir.Sey.sOylemeden.tetiGe.bastI..."
913,021,429 *5F055197110507C8B2BAB5275CDA4FB6352987D7 8sbx4occbgi
913,021,430 *5F06879E8E0CB9025BCAF34F7572EF43B24BAA54 4 DASHNER
913,021,431 *5F0195BDA57307355107E5B030151FE1068D875A 919h6j058xdc5cp0
913,021,432 *5F0719B74639362928C2007CAB4232ED6C88CB2C 4.JUUSTOLOITA
913,021,433 *5F05857A581EEC6F382BEE05DD631A2B461B2F8E 4KREBSES
913,021,434 *5F024E179FC5CE165B1F167D5FDA374AF172E0B3 9BRANDYBASKETB
913,021,435 *5F0420E618E921CC5D8153DD19BB136C68291DB3 4PRELIBARE
913,021,436 *5F0F723298D16CF1166341469F881C64B82FBF75 9DEMNFOD
913,021,437 *5F0DB4F28D990D7BBD97AF54EBF02DFEA0F273C5 9DNALPOC
913,021,438 *5F0147A21DBBB1414D31F141DC4B3EECE3AAB545 9DUNAIRDUNAIR
913,021,439 *5F0A5ED513CEADF00F303C6A62B38D4F8B58D874 4RHINOLITHIASIS
913,021,440 *5F0E70E1E4175053280FDFEA3BE7B8132FD29E9C 9FORMUEFLLESSKABETS
913,021,441 *5F086CB7CE0A3B2A6AFFFCA52106598ABCC89C86 4SKSIRAMA
913,021,442 *5F0E189A4EC580CA1D6A963D8347D58646CA6AE4 9ILLEROM
913,021,443 *5F0508309F89C1F26104EA39E4003F9F20EBD9A3 9MAENGDER
913,021,444 *5F01F63CE4BC461B63A8B15C22890625A8079853 4YDEHZBBPN
913,021,445 *5F0B50C4E0C1E0A6FE29545A3593C8488C72DB66 4YODADOLLARS
913,021,446 *5F0EB3A00142AD758AED2E11666E0A9752F3B969 9prebromidic
913,021,447 *5F0604C820D037E41BB585DC00CF686B93FEAD7B 9SINKERTS
913,021,448 *5F0F202600485C6F7E1BA4F298624F18C60C193A 5BINGOPEEWEE
913,021,449 *5F004DC0A57BB523E02B18B4EF17B8703B318EBC 9TOPHERCHERYL
913,021,450 *5F02C8CA4395B61A5AFFEB298E139A054B5C5379 9TUMULTUOS
913,021,451 *5F074A7093FB657BA2793FCFE51034A0AC793A6A 5CARPATHICUM
913,021,452 *5F058FE0B5CF7EDF4F89983EF9232FC342E6C900 5COMMENTLOGINPAGETPL
913,021,453 *5F089C2721AC216A7044E5112CFBE40919324430 9ZEROIZE
913,021,454 *5F0D546693F8A2A8F6662AA9DEF0E514A76785F4 A/?:
913,021,455 *5F0D8A40CEAF27F4DFEC3FC31FE7B1F09D6BB6E3 A3N3H
913,021,456 *5F0037A087C6075B8339FD45A850A6C0E8887D07 a&5_
913,021,457 *5F0D7EA45E2EB97FC20FC9E48269A12827D1916A a5ql
913,021,458 *5F0816292400159FDD0D119E2AAA95EBDF6DBD1A 5TUCKPOINTERN
913,021,459 *5F00FE2007CBDEF956C5A2787F1A2D782BD547EE /'(AAA
913,021,460 *5F0B5ED7351EAB138A850E5FEEA99A98671AD9E5 610COLE
913,021,461 *5F06A089A744EE374E924B125EBAE002D0C8BDA4 [email protected]*
913,021,462 *5F02801089643186B0E67371B092B2C4645FC884 aacpe
913,021,463 *5F0484D73318FD7526BD992C65C4903F2189CD75 AAE(ZP
913,021,464 *5F03385584F5B5CB8A835A8DA86D9173C5401215 6-GESCHAEFTSVERLAUFS
913,021,465 *5F0B13156D0A5A6C23426927427C149C179F0238 ++ABAA
913,021,466 *5F02CAA63BBB465A5C40E1457FC5B5263BA2B187 ABRAKADABRABSW4
913,021,467 *5F04F566AD7D90051A06C6D57F8F7AEC60347605 6PUBLICITEITS
913,021,468 *5F0A01D525F8BC52E032EB3700C2746B16295280 ACABELITA
913,021,469 *5F0D9A36A8CA771C873B892CCDC39F0BE74A5DCE acfV
913,021,470 *5F0A89FE03ECF00C6BBFDDD4B190734A1C88E666 6SPANISHSPEEDY
913,021,471 *5F0ABE8358F7C6994A7C54B446ADC2A320FFD8D1 ACK!5
913,021,472 *5F04BBF62EFF819264610139558A90F1690A93F2 acronyms
913,021,473 *5F0FCB4B3687866627912753BD99CEDEF1619301 6YLSPSEMTT
913,021,474 *5F06A3C424384C9EE407687A0000ED81F85B469A 7AIZAHLEN
913,021,475 *5F089F6787023E5FA600ABAE78FFB3A0724BDBB0 a%"dt
913,021,476 *5F0D07BDECA8F4DA0FD5559CED62986F0E15B290 ADU]M
913,021,477 *5F0370F98859DA3AEF4F9290E48C133D4042DF4A [email protected]
913,021,478 *5F03FF5D8384761DDE07A4A6D38D62AD3253B889 7DYNAFAC
913,021,479 *5F0B03CD17825045D34FB8DBBBEF70E3F77EF2EA 7HISTORIOGRAFIJOJ
913,021,480 *5F0CDF54B67EE10D887F12F1A1197661B5E86D64 A$ET/
913,021,481 *5F075026C3FE6121F8573E822F3169021A5067B9 7KYLAELTAE
913,021,482 *5F03BC5088A7291EF8AD8FA5BD83448B1BF8EC32 7LEKSERUP
913,021,483 *5F00F87C93C36E4B3A26356450E4D0B6159D1771 7LEMMUPNE
913,021,484 *5F0C24044D28487B92D15EE7C81D663DFB8C152E AF;N
913,021,485 *5F0ED47D8F60059747819B5F210E53C54805EBA3 7SABITHA
913,021,486 *5F0B25B47CB8538C0FC8C992A21193DA4C17DA5C aggiesbfi3
913,021,487 *5F080F6B6E10BB7F0FA28BA97B4C31737007D552 aguacalientecr
913,021,488 *5F03E3004724E73451C611C636DCB9909F3B675B 837128 BOURNE-MISFIRES-WITH-BOTH-
913,021,489 *5F0FF50647B099D3C4990E27E2624DA33288B827 a_+i
913,021,490 *5F0B5C12B43F38B434EF45A4438F06BA7D18793D 8AKURCLF
913,021,491 *5F069BF3DAD38571EE0C249250AFA63ED8F84845 ailagnam6
913,021,492 *5F07E1B695216E6F1EC7E2710A196C501DFD7B28 8BSWPARVIENDRA
913,021,493 *5F0CA93FA725A8D2BDFBC810D175DC08F290DAD1 AJ$NR
913,021,494 *5F073D3ADF8E163B57818534F63B2B1CC14AA8FF A"K,
913,021,495 *5F0E48FBDB205865B9FF6A6182D861A4E30C9520 ALANKONING
913,021,496 *5F0FE5762E55CFC7299A2AAF4B762ABC71C9BBDC al+dx
913,021,497 *5F05CF1F8FF93FDCB52B0135BF2100D645B2BB1F ALETABOWERS
913,021,498 *5F09FDD92AEDD133E007C95E19149DC5F113CCF1 [email protected]~O.(0_<)
913,021,499 *5F0C65063616F597F8ADBAE4EEDEC1A7B393826D ALEX.GLINKA
913,021,500 *5F0338F067EB16995D52EB3EE8BD37DA54D1DFDD ALFREDO.SCHOLES
913,021,501 *5F0C4A8AC0A749A6D2CE74D54D64F45058F82579 ALI.APPLEBY
913,021,502 *5F0CD7AADCE0C2CB7DDDE034CF0324B90E3F92A1 8TBCSBSW
913,021,503 *5F04FB5B39E9E5327240804756F4D039ADE66664 ALONSOMCNUTTY
913,021,504 *5F041881469378FAFCB1C0A908B7113682F0AFBA ALROWLEY
913,021,505 *5F06B7D94A8921E9F1284C33501BF2F0505EFCD1 ALVIN.HALAAS
913,021,506 *5F0FE76B98B72F398E7EC16EF4B27A1EFF3D9B99 997690 OSUUSKAUPUNGINVIEM
913,021,507 *5F0F0FDD20E0C203728012B796CC9D5B57BE5CFC 9ALFREDHORSE
913,021,508 *5F0CAFCBFE5371FA903AB30A150AFF41C8400376 9AMMOCOETIFORMS
913,021,509 *5F026071282BC8EB33BA83DCFEF7B5C93E6FA18B AMITA-PATRA
913,021,510 *5F049918C0E066D6D20DD94F2D61D0F2ABAFB487 AMMONIATIN9
913,021,511 *5F0A2E53119F13E5B6AE8759C09F5BA164C62308 ANDREBIRD33
913,021,512 *5F06C0B534B5E19F97705D882C5317647045363C ANDREWPIETSCH
913,021,513 *5F000434FE3E4BD8F4CAAE5F7CD39942FE46E3E6 ANGEL DUB
913,021,514 *5F014F7334DA36C494108E3E5B668E8193931982 ANGELOYAMANE
913,021,515 *5F08DCBE9629F243EBCED854CD242DE7D8F888B0 9REMEMBRARENS
913,021,516 *5F0F527AD6076527B02E9878D879E4E5F66C9F4A 9SNONGISED
913,021,517 *5F016E36643A346F6451D3B48DB8F67D6A4268D6 ANLAU
913,021,518 *5F038EE040C877CB531927BAE13188219164E7E1 ANNIEPORCELLANA
913,021,519 *5F06CB1214E7AD087FD3AD85B90D634B69C0D585 ANNULE5
913,021,520 *5F0FA7257913F58AE5D766137937FF11D851F3A8 A<O
913,021,521 *5F0CFD5043DD17E63E3517BBCF9B173E38CC56BB A,/OD
913,021,522 *5F024F09BD626EF62984BAC6F36D0A25032A51A3 a7;l/
913,021,523 *5F0B4C0289F400D38C9DD5804B76C1BF5E69365E A85+3M10U5LY
913,021,524 *5F042530FD18D754C888F9275450445F2F8F0AD2 arlieilic
913,021,525 *5F04C0FA20329BD31091E2345CE48DB371E5C4F2 aac3%j
913,021,526 *5F0F2FB0817358A62D115FBEF445E7654A11D56F asdollah5
913,021,527 *5F0A29F768CA6F828DA9F9BE64F54A740715F571 aavelaiv
913,021,528 *5F085250B6C8506BADDFCB62CADD4F4A0AF8292D AS%Q)
913,021,529 *5F098B2D3BAD8EFD8CD3D023A7B17D8ED1DF1052 ATHEESES0
913,021,530 *5F0875D96BAF3733EEF9984E822D51161F75348B [email protected]
913,021,531 *5F09AA1D67D7E558EE77806F5F3C9F75FE1548A4 AC#D1
913,021,532 *5F016E66D4891D0E1AA6B6CB43FEC0A6D4BD6D68 ADIRUIHCE4
913,021,533 *5F039421C49560411DD742EAD6EE6C1A3E6201BF [email protected]
913,021,534 *5F0F3EDF3218771D63611D836D6583E5A45FD7B8 (><)*(###B
913,021,535 *5F0EB16A9D46628E54BF90C71EF50415F6C8E444 B::3
913,021,536 *5F028A5851553B5CE614DA29BDF29D36909E267B A.h$
913,021,537 *5F026412C31019DABA93D62EEADBCFBA3AF2C414 AJ$P:
913,021,538 *5F000D5C8A5830010FA05F6069156CEC670A113B BALDTRUTHTALK
913,021,539 *5F0CA592D6FEBE23811BEA4713FCC5F0D9D1745E a;?k4
913,021,540 *5F02006B14EDED75C8B6271BB52A3E5EFAE1D483 BARRETT.CHAFIN
913,021,541 *5F0CF8750A235E08DF472DD0007FEDEB4249E03E AL0M+
913,021,542 *5F098833E8622F2CC808D486AC72E0B90369104B ALAN.ENCE
913,021,543 *5F0A6ACE217B6E55560D83CA397B504F34FB2B52 BAYZID
913,021,544 *5F06DB786D2FCA170A083E1D7B0EAA69C28C4BE0 BCI$0
913,021,545 *5F0C78249B6B9C240A4DD3C003F4F07B0D2F4445 ALFYDNASED
913,021,546 *5F064DCD01380E8133622A300A81EBB6B8E92F9A alj
913,021,547 *5F082A60FCA7A12B01CDF08867B40241E739458C B"_,E
913,021,548 *5F07F93661BC02FE3062ACB470FCE513D160DEB1 A:LQ)
913,021,549 *5F0BE8FC27CF377B553AFE1A43A74CA072D16D02 a"m15
913,021,550 *5F025F8A44D2ECA32DC0EDD83AD91B099AE60705 BELGIANA1
913,021,551 *5F03DB3F69C747CC1861CB00D5C3103542E27F90 belustigte
913,021,552 *5F03ECD21D064C45F640370B31EEA32BA3550AF7 benitokolodzieski
913,021,553 *5F0E463697D319736C3627D112C4845026522507 [email protected]
913,021,554 *5F0C70E7DAC2527807DE5B749DBA4727FCD423EE AMNQS
913,021,555 *5F0BE7B699A5346CDE4A7FD0CAF213A93F513164 BERTRAN-F.
913,021,556 *5F074D49006B460CBF8A39CA04DD25B508D08241 an8=
913,021,557 *5F02AE1F06DA8CA0D0CE4F752E2242FE28142FDE ...andalways...andlust
913,021,558 *5F0339057065F40CB919ABD2B08B10C4600BD08B BHAVRYLYUK
913,021,559 *5F030E138C1C811D3C3ADD35F9F205FA47B78A91 aniohar6
913,021,560 *5F088A927A5AEB7C5D6370C7BF18CD0321B5CDE3 antonioruizsoler
913,021,561 *5F0BCEE5B5904AB0CEDBBD9A57C9B0FD215DE2FB ANTONYHAYERTZ
913,021,562 *5F069D2089C57D7D81815E87751F0481B893C230 bissadougou
913,021,563 *5F06964D2E3A174F688C2A600A909663EDDD66E9 BJ#DV
913,021,564 *5F0D9ED18FAD7D2143B51073C051948C0D6245BB APRAXIESES
913,021,565 *5F0194D284FD3BAAD3AE5979FF6B8632FA564D50 ARLENE.SHAW
913,021,566 *5F08D35E044E1B53EE8D819651413D2CC7CBAEA2 ARNULFOSHININGER
913,021,567 *5F0B3D9B5468C3381DC1E1E6948FA54C852F6E6E bobcats68
913,021,568 *5F00A4231965E74900B29C87092FE05B92FFD86E ARTERIED?
913,021,569 *5F063FE38D2153E17E513B87DB4530F8CB13FFEB bomwt
913,021,570 *5F07C919C1556D0F91C3A58B2914FCBF46918601 ASBCMBSW5
913,021,571 *5F0E6988F1D6309EC042C9C8457C783EE70146AF ASE=K
913,021,572 *5F06B39FDDA9C19FC9F8C312D8761076E55AA51B aupairm
913,021,573 *5F002E49514F05763A972A7FAE01B22CA77B0F04 BRICEPYBURN
913,021,574 *5F0D5A6D02E1AE3299A9E94169120D720C45ECD6 avea
913,021,575 *5F05D162EDBD7A7EF1A29DFB90F3851F453DC737 brunogreenberger
913,021,576 *5F0F57EDAED4A853E532D9C8DA34B976D5C3A3D2 brycekegerries
913,021,577 *5F03C1C65DF634A45E5D5E95423E4B271A834F72 ayc;
913,021,578 *5F0DC698BC265839F1741484654753E87265B6F9 bt0!a
913,021,579 *5F0E56375CCE427292C55A6AEAD23675992BDDD8 BUND353B3N3
913,021,580 *5F04D04683C9CACF69133B9599B2D1A05620219E B;&5Q
913,021,581 *5F0AE445197BBD6C2F8D63C9923BD133C55ED2F6 b6dermanland
913,021,582 *5F0F35749505E84692AC157D245626D57E296E1A BVCGW
913,021,583 *5F089F35B63F77078E9438F7DBEF69030A1A99E2 BYRONPERLAS
913,021,584 *5F022EEC84593B0361007F63850EECEA9BED57FC bztbk
913,021,585 *5F080E300C1AAC14189B5A079B139A55B0BAF7FB c1#?.
913,021,586 *5F0BDE8715702E0310FE94DFE2493BFC0F199242 C1NGJ
913,021,587 *5F00D76612596C1E563EF9045F3265EC366D6DEB C3I(%
913,021,588 *5F0023E63B558E228B312B952284C8DC114FB8C3 b+;cd
913,021,589 *5F0E6ED114ACF3DE3D1B6E49468ADC56634D7627 b--d-~oo->-<
913,021,590 *5F00A0E3ACF86631D95FA2318D7D4F0262AA3CFF B#####D.~.~SPLAT!
913,021,591 *5F08D5369F4DD122BA0B4B14EB281FC6291F7099 BECKEGGELING
913,021,592 *5F0228BDE4B1A80DEEFFF007D323E038BD8C1ED3 BELLEVILLE.RENDEZ.VOUS
913,021,593 *5F0CDD271F1A27C0E33D24A9FA91756C40DCC0F1 beonjijeompeu
913,021,594 *5F08320C21611DF81E6B989C19DA796E80742A2C BERRY.TRIGLIA
913,021,595 *5F02B33BFC39DEA399D529E385E092B3CF736E71 bertstefl
913,021,596 *5F04D481AF019BB2D6BD16660B51077A4EF6ABD2 BERUFSBILDUNGSZEIT
913,021,597 *5F0D3ACE32058372231B0321D7B227D0E6DFDD3A carmenivel
913,021,598 *5F0307C906386C299CB7EDD221695F25FE5432A5 BESNEJ
913,021,599 *5F0772CBFCE56F8343417C000E4EAD894D68FACE CAROL GANNAWAY
913,021,600 *5F09334DF44E173B649D52B99DE9ECD5AB6EB614 CAROLINE.RIVARD
913,021,601 *5F01D2015AE94ED0981FE077E5BAB5A21C6EF026 CARROLANSLOW
913,021,602 *5F0097AEF462732E6FF31EE800BF7A42E3A6E8A3 carrollmarumoto
913,021,603 *5F087AA2A53D782C59B495CFAA4F0AAED261F366 carrolmathieu
913,021,604 *5F036EE76FDF938DE817ABA9D045494E4172BB63 CASELYN-IGLESIAS
913,021,605 *5F0141781E72785987482EBD4A266942D3967250 caspievadne
913,021,606 *5F0636FFE1DE6B740BF6A37FA260FA14F76D41BD CAUATION
913,021,607 *5F0764F5254950324D75FB920A5A212FA0210B75 cb9c+
913,021,608 *5F014B6CC93EC2345D65C1F5BFBFF38D18A7FE35 CC/1S
913,021,609 *5F0DF16258C2C09E686A88E79515C7DEF291119A C.CLO
913,021,610 *5F0836155E979319F6AE28426D1568F61F039AB9 CD/-D
913,021,611 *5F030783F16A3E069CB32C88E4B55278A3673255 C:\DocumentsandSettings\FireXware\Desktop\Projects\dynexec\dynexec\obj\Debug\dynexec.Form1.resources
913,021,612 *5F04F4FBD4E1D7E2E9483D043D5326CA42A8BB76 [email protected]
913,021,613 *5F09EAF3842829D1D10F3EA1C1F7FFDDC2265B6D cenacio9
913,021,614 *5F0D700932A378AED23C896F30C4F5B83A0F018D B#K)
913,021,615 *5F0E2B11CD5012E02F4C0D870815E0897AEB21DF bl%lb
913,021,616 *5F0A45BA2B4554424F76F22DC05C1B914DCC2BD4 CHADWICK.SAMMARTINO
913,021,617 *5F0845DC185C5460785160E4F92C88E171B68C0A BMIC
913,021,618 *5F0CE074C62DEA4B7805BEC92C1C3B54F544E38D B)nr
913,021,619 *5F0E87C8A3F30CA507D34F55F54501EAFC635E60 «CHARTERED
913,021,620 *5F0821FE3BEC4DF74649504FD4BB91535DBFD757 c$hbi
913,021,621 *5F0AA531B6AA0A43CBA4CDFFB5A129BF591FBD94 CHEHUT.CHAN.LAXIER
913,021,622 *5F0682E66E2A84A438525E2279EE29A17DF34757 bobsmiles6
913,021,623 *5F021E098D32FEEAB951668CC54DB685F38EBCB1 BOCCACCIANA
913,021,624 *5F0CEE8C323F744A4AB76081A75DE006231F86A6 [email protected]
913,021,625 *5F0DA2DBC8A8EE89579795E15643C1420B36A26B bpd_3
913,021,626 *5F0C7534794D38E0CBA4DF64B034EF5AECE096A9 bp,?z
913,021,627 *5F0AABF4B6C71476E01816A14D6ECA319837CB7D CHUCKER77
913,021,628 *5F03440E95C7967EEA6FC28B260DA29709290646 Branik-1
913,021,629 *5F032B605E83124E8B3EC95FEAADEC3898697CAA CLAIRGAMPP
913,021,630 *5F0EAEE036CA937779CA2E9E82BBBDC3225AEC2C clarencestough
913,021,631 *5F0040D393CAAC6F488328D869993097A90B2843 brlm
913,021,632 *5F0115838A440C18516C9F383CE021F4EF675E09 CLIFFBALTAZAR
913,021,633 *5F0922FA926FE8358BDC896114B0CA744420AD52 BRYONSANQUENETTI
913,021,634 *5F00A04AA82F248C1F6E65DC93273DCBF6179155 bsu
913,021,635 *5F00DEDE44EA00EC124751EF9FC1780C1484BC3F bswmelkoiseen
913,021,636 *5F01DA1556DBD65BCE1CFB3F8630AAA11AC20D94 bt0e
913,021,637 *5F07CE135D3898582EFB0C54127762C0A34117DC c?o5h
913,021,638 *5F0B8B1D37324101A9068DEAAA6F9909E81BBB61 collinwarder
913,021,639 *5F0A99EFB3094DE078A173739B48B98C58632D9D BUSTERYOUKER
913,021,640 *5F0EFDE065E245AE8FADEFDDF266B8F7AD0CC6B0 bv?e
913,021,641 *5F0B00428EA0C3069D894A97F34B4AB697EF1DAB bvmji
913,021,642 *5F04B128327E6CD68AF2EABE6105AE3DFB4823EB BYCHH
913,021,643 *5F0248D2599811EF5626D36F813752E53C1563B9 corml
913,021,644 *5F0E1B2EA24BF4AF5E1A53ABAB0F1F8DFEBD74C5 c0mica1i7y
913,021,645 *5F055EBDF8A610D0314B1025D0A90482769E411C c1rcum4m8ul4tes
913,021,646 *5F04D3DBE2C96D8BD47C8BBC61D3DF6B14D537B2 C3UP=
913,021,647 *5F099D49E1552CEC17AC2620BF4B44D9591DCA32 C=7RK
913,021,648 *5F06EC46BC227C08A58D36C7E28F9068D7CB902A crm3k
913,021,649 *5F00ACFACECBED64E3AE63E48B937839BC9E0B8E Crouching.Camel
913,021,650 *5F08C0CC898123D875EC8FD174686C9F5106F096 crvcbrchl6
913,021,651 *5F05E65A021F1246C4A20D62333BDF52B7EB8BCD CALOGERO DILIBERTO
913,021,652 *5F0E8C737C474E090DC9CEAC5C28A96D72A1D832 CALVIN.HORDE
913,021,653 *5F00B8C32EF5950CC6BC4D41D55C9A654D2AA5DB cse_5
913,021,654 *5F010D15CA697D8BBA3A233E68D6A2065B3996F9 CAO49
913,021,655 *5F0510A23660E42B42D58A5A4FAC1FFFF96CE63F CARLOS.MILLIKAN
913,021,656 *5F0B62EDA33AABFAF92FA7E0516BC8DD48252BC6 CARMINENEAGLE
913,021,657 *5F03C0A11D3E42579DD30906A885ABC6B2BD9251 cutie136
913,021,658 *5F0452A5C1BF1DE9ECAD570BE321B9423136B3DF carrollrodrigues
913,021,659 *5F0D8FE9A867C5D16EC3E53D2D41F32333C3106B c:v!t
913,021,660 *5F0D9517214D576646690653D67FB923487E3D20 cwc;-
913,021,661 *5F0F3DC63D86F4065D27A0110E94C129E8F92B61 CBA79
913,021,662 *5F005F7ADA3C92D30033231F28E88FAACA5F25DD C=BV
913,021,663 *5F03E42576A886FA8BEAB8818179AF43270D0FB5 [email protected]
913,021,664 *5F03A3F51C5D407713C57BFF68FA919EB8B8712C cd$:b
913,021,665 *5F0AE20E9DB2AE5CECFE7691A6F0EC8316B5A01A CENTAURAE
913,021,666 *5F01FEF888A979DCE07090375461AA8EB0A140A3 ceuq"
913,021,667 *5F00B9F8E48745FA1F6D26D84FAA37DFA70AA03C cfw(.
913,021,668 *5F04514444FB71F185F2CF69FD2843D141A1151D cgxv4
913,021,669 *5F09F7F3C08842A93188A365DF757672F76E2667 da7rs
913,021,670 *5F058F80DBD19E250C86CFB6A38713762FF0B12E CHARLEEN
913,021,671 *5F007B4DC8947BC3EB86F2DBDF2F0B319C6F41EE CHASECRAPSER
913,021,672 *5F0275261607EFA9DF36AB30CAC75CFD44317079 dangamae
913,021,673 *5F0A70798EB8B318CBC1AC67DC345112993848D6 DANLOGAN2
913,021,674 *5F0FC9C577B20A4903BB06B6E69E58BFF3D3670A CHOYOHOY
913,021,675 *5F0E53F402F34BBEA22C8FCDC0B50C6806BB6868 DAŞLI
913,021,676 *5F02A0F82C96068D859C7147FE767A63621C8A9B Dave-Hinitt
913,021,677 *5F0F4F6416C8B6C217E8CAB26293853379AD0324 DAWING
913,021,678 *5F08287F07B4266F4C3134A1CC8D69C53B3455EF DBSIV
913,021,679 *5F052A2A932E8037C4FCFA6AC13C283731768AEF DEMARCUS.VARONE
913,021,680 *5F08128C87605BB5D5830B9F5FCB84767F6BFA28 DÉMASCLÉE
913,021,681 *5F09A01C9C8EB0EBCB60C2D72A3E13FF439B6E03 CLOTURES0
913,021,682 *5F0FFBAF5BC7F2C9ED08F2C4971E08939A340E45 DESMEMBRAMIENTODEPUTASCOLEGIALAS
913,021,683 *5F0DAE54524B8DFC046E33DA0B86A1BA28EB2980 DeT
913,021,684 *5F087351082D2D5FBDF298A3D555BFD127EA56C5 collaged4
913,021,685 *5F0AD8A453A53345EEA3C536CCEE8BF771AAF22A COLOFONS2
913,021,686 *5F0336DDD9C39A1D2598DD88CB7ADB4A75A0139A DGSIV
913,021,687 *5F0CA2A86A756BF79591C72C5AF3CAC5AB05EC55 COMERÁSE
913,021,688 *5F0535E33ACF87E6D27837C8768F4ACEA2CFA47D dilipsampat
913,021,689 *5F01A5A27E9DE4CA7888E4933D1774EA4BA8B790 DINO.STIFFLEMIRE
913,021,690 *5F00ED0A6426BB855CDDC6D661C25EE80ECB4D0A DISCOVERY
913,021,691 *5F04233B69154E8C85B83BA7F8F002C814A4B518 djrt=
913,021,692 *5F0CBDABAF46D559ED5ADF9BDD7EB2AA9C74EED9 C:\PROGRAMFILES\ADOBE\ADOBEBRIDGECS4\RESOURCE\ADOBE_EPIC\EULA\DE_DE\INSTALL2.HTML
913,021,693 *5F08E3D4266B819F981FB26731151DC42644491E D=L+A
913,021,694 *5F0740CF8F5A751C672EDC004814C55A3E434470 CRLWH
913,021,695 *5F005872EB199098171811726CADAEFE34417427 CRUZGRUENWALD
913,021,696 *5F0E59A0F4C37389DE7276F8866745D9E9695C58 DOEC
913,021,697 *5F01C1EE302701B927686659CF5E3B30BAA11B36 DOMINIQUEDEUTSCH
913,021,698 *5F04FED1AE309BDC83C900743ED7600EB612ACB0 ct48d
913,021,699 *5F05920C0A6E4C7BBEAE95142E495D63F2B68A64 down-the-backstreets-(feat-lonnie-liston-smith)
913,021,700 *5F0194F0491E2B041E0A953CB41D6294B11E50AE DOYLEBEGAY
913,021,701 *5F0E6CF7DC61FED9F3F724F29094E3B9A2E6824B CV6B,
913,021,702 *5F0ABDCE512595310467E55416AD8EF881DF2A3E dracula-rock
913,021,703 *5F0C23576B854CB27B2803E95D992D6FA6BF790C D4OFM
913,021,704 *5F0A3DEF1EDC7C07F8B66247AC941BCF4C652C88 D(WIS
913,021,705 *5F0F43BB03A29F4E910C7ED316794E366F844E83 d'ah
913,021,706 *5F06E0154364536F410C6398B652297B5D4A3803 eake#
913,021,707 *5F06A4181C9081AC01B1F537096BD09659FC8B16 D‘ANDREA
913,021,708 *5F00A0F754A8A4DC0A1C7AFF0FDDB6B1EB7A02D2 DANIËLSWAERD
913,021,709 *5F0126B1B287A553E5D32B63B27237793BFA7471 ebsty
913,021,710 *5F087AB5FE6AFC437EE2C156A66AD07DBC6C7DBC eddiewhitcomb
913,021,711 *5F017B753C59B69EE95B702BD96BD7A92C1CCD41 DARONSUTO
913,021,712 *5F02CEEC8E2BAE2482FE24BFA082BADAB98803C6 DARRELL.BUVENS
913,021,713 *5F0608F42DAD06605042DF02F29B053FA875D8D6 darrenpecora
913,021,714 *5F02C6DA7E3BD525DA064319A5D9A40A46FFC6A6 editthreeanswers
913,021,715 *5F0EC3A6B87C8A67231EC96B84DC64C726B87C7A DARSKONINGSL
913,021,716 *5F06D2CC66595A697DA14519CE4B492F5E48A1CC DATAHYSKOLES
913,021,717 *5F0EDE4FD74E59D351B804CE7EF0A39CE4643667 davismelis
913,021,718 *5F09B980BB7662B533A9A96C471794DCE1CED0A1 EFaK
913,021,719 *5F0472642B18FBBB9E28B2DB7B7F8AD46FD0F2CE D,bF
913,021,720 *5F0C102AEFDA6FE8103A25D5BAC88C9A82606E9A DB&NF
913,021,721 *5F065B11271BAB13F961F4BAF33B9789CCE992D6 EIP;8
913,021,722 *5F0AF9179CBDD6CB8D984EC985C191966B108864 DDOJ
913,021,723 *5F0FB37F50A13C3314D6E3ED4817D280B05658A7 deab)
913,021,724 *5F0F7FE46524BBE66EF3D3ABE98A892B6D07EAF9 ELISEO.LUEKING
913,021,725 *5F023A0A1E42032906A3D8503302982F7C7362B1 DEFNTON5
913,021,726 *5F0C01C2352FB69640FDE9E572FF6F01F7B6E0A4 elmerwoodis
913,021,727 *5F09228153602FEA240A924EFE53E41EB88938F0 deloreswilliams
913,021,728 *5F0F3C1D37E3B5BA5956D2C55ABB43D5C468212E EMBRYOEXCLUSIVE
913,021,729 *5F011CF72F8675ED6ABCB582AD2822F87785B2F0 EMMETT.SHEPLEY
913,021,730 *5F093201D826945BF9CFF3750D0A3F11332F54EE emmittogwin
913,021,731 *5F017ECE12243B5107D6950F33B91998A6CB68FC derua
913,021,732 *5F024E5A6E4FBA06C36D330FFC5AC5F73706D444 DESPACHARES123
913,021,733 *5F0F5E51B28698625DE1FAEADD94F9F3E662126D END/EXPLORING-THE-CITY-OF-GHOSTS
913,021,734 *5F062E708971FE2CB3589D26FC4339307E32BCDF ENDOC_SAVAGE
913,021,735 *5F07E1E300A42195D64168EC193F2176AC30D0C5 ENERFOLGE(DISC1)
913,021,736 *5F0EAEC9376F071458C8EB1F667DD7897ED17012 EN ETTER HALLVARD RYSSTAD
913,021,737 *5F0EB26F579E69FF4FF843326FDDAE8D1E76845D DEVALU!N9
913,021,738 *5F0D87E35C66AA772B53F4F57C053FFEBBCB21A5 [email protected]
913,021,739 *5F0E09E5933E7BE2547219311946AF5E71AD619F EPEHM
913,021,740 *5F097900E8A4FA06F76F6EB5A865799736730325 eq;qb
913,021,741 *5F0349D6CBC99744B03B5B89A9161AB603BC3F93 ERGOSIFERIN
913,021,742 *5F07FB601D0708E816422FB8480DF30425F457CD ERICCOGHLAN
913,021,743 *5F0FD88CC8A7570E75BDBF655F8F62C29BBC5EBF Di8k
913,021,744 *5F0E4926CB930F5081AA6B27B93576BEBA084436 [email protected]
913,021,745 *5F0ECC0F1CA38DC2193562163952F238761C07AC DINGHYHIRONDELLE
913,021,746 *5F0DBA34B33CAACF137DCF601060D525C7E7C976 ESTACELECENDO
913,021,747 *5F0AA1AC4C27DDDA44638CB07B6501C0DFB61848 ESTEBANVERZI
913,021,748 *5F0817FD9C1029B85D491F838BD1C04DE5882637 dirkyuasa
913,021,749 *5F0ADDBFBD054C729B85035F1692B005FDBF90BB et8s1
913,021,750 *5F0C66F450DFB8B40BE929C2BA6F74893079F6B7 etnuocsid5
913,021,751 *5F0DC5E09C505CA401AC97473FE0FFA445CF6D24 DJ.ENIGMA
913,021,752 *5F0D6C918162ECBB981B93A1101377E527EC82EE EUS2
913,021,753 *5F04E448C7874784A6AA170BDFA7D5EEE77CC663 EUSEBIO.NEMARD
913,021,754 *5F04CE9C8A23614184D11337EFAFF4989B5185DE DL94N
913,021,755 *5F087AB3EF3FC1258EA9FF989764F1F384A268EE dmm_w
913,021,756 *5F07488DA42E0C23AD28CD94CAD79166C9CE4986 DOC+RINALLY
913,021,757 *5F00B50944EB2D6D8BE7D821C10A84180C6C42AF FAIZA-JAMEEL
913,021,758 *5F060288AE9E730A9707EB45CBBC45FD5DD961BB FAMINOSTAN
913,021,759 *5F00857E74B7668AC44E5389F9F4F7EA11FC0739 [email protected]
913,021,760 *5F0EF50D225133CC4282ACF3F7647026E1C2D22B [email protected]
913,021,761 *5F0A4E2AD69E0215F04EA8A78BFB80C23FEABA57 FBSLNYP65
913,021,762 *5F0564FE0F785F03BBE419958B2C7C187254E53F DOUGLAS.SCHWEND
913,021,763 *5F0ADD01E5D7C645F5C10083DE4A879B605E8C31 FEN_RUEF/E/N_R/U/
913,021,764 *5F0BE148580B4A2AC4B186D561A5B006E82BA563 DOWNLOADER.GENERIC4.
913,021,765 *5F0DA1A1E99C273E8EFE0F9507329A16EF9CAD70 [email protected]
913,021,766 *5F05B877F649CEF8A5A0772290CCE980DDF22278 FEX-REMIX)
913,021,767 *5F0FC47541E1942B312572CAA9A4CE2E4B2827A1 dq/o(
913,021,768 *5F06C866ADB3452E113459DA1BB4F3BABC4C46F5 f_kb
913,021,769 *5F045C9AAE9B34FF59C8C90377E98AA95198F8FE florenciobonnick
913,021,770 *5F0975CAFCB91C0B8C4DD750EE4B6E38B9BEC912 d.r.o.p. the bass
913,021,771 *5F04D9AADC85A5E7E7AF4B033313452579D733DE forlangte3
913,021,772 *5F097E3A9078B0E9598FD148E825CE32E4280152 dtj2m
913,021,773 *5F0F969E4F41CFFC3F49B24FCF47A5B588A5185B dtpg8
913,021,774 *5F07AFEC85FCB2C64118160133EFA095C4826665 frank.besaw
913,021,775 *5F01BC45B05E36D4E0215AD151931918624A1FAF FREDERIKSUNNEGMAIL.C
913,021,776 *5F04825E6EB9F3171AF2033FEB2DB3F0AB636212 fredrickchantler
913,021,777 *5F0F5A56A740F432E3D1CB96E593CC223C78D214 DÜTSKLANDLEED
913,021,778 *5F02D98B7E2A8F5DF8FF3BC134413F5C37006A39 DUV=R
913,021,779 *5F0ADB002CFE7F47F737D3097D8E9F457FD7A68A DWAYNE.HUTT
913,021,780 *5F02EA42C63301EDC90319B08197762FD0E7ED04 g~2l
913,021,781 *5F0139843A55755577B182A530233BAD8C735D3A DZLHG
913,021,782 *5F0660A9F4BF34969BBDAC889D80CEDE31D34C15 dzv:
913,021,783 *5F086C0DE98F26F98ACCD12E2824E889F6E586AD GAYLORDWIDOWSKI
913,021,784 *5F0BF930FC1A3AF741F947302D8089AAEE715BD5 gcnp
913,021,785 *5F01FBCDC13AA0CD8D6EAA1B5772A8E6C9AF36FF EDGARSPRINGFIELD
913,021,786 *5F013543CDC16EE45DF1B2F175ADF5D716510D51 EDIBURGH7
913,021,787 *5F0EF51BD7704CC60DA4427203417BC8DD525F85 GERARDCRABLE
913,021,788 *5F0F09F504F080C9F7219D773DB15B9B6915E4B3 edk/!
913,021,789 *5F09238640D1D7F8890791663F29BF58C0A7B74E EDMONDMARTIAN
913,021,790 *5F01638AB6ED54A562B5B8568CC98E216713B67A eezageding
913,021,791 *5F01DB902DAF33EFA6545E7B95C06E9DE19EEC5A egg4
913,021,792 *5F0EEB5FFAB56ADBE8F42F7BE7DAC3614376514F [email protected]
913,021,793 *5F0FABCA8653765BC3228D592CE0E4A271697F33 EHWCS
913,021,794 *5F0F58957BE4D8ED8E2D9CF6083CD09F2D7850F5 eiky
913,021,795 *5F0721EA065BCA35BEAFC5048B095D5540F0A2E0 [email protected]
913,021,796 *5F04540D5F9CA8884F33A0180DA8620AD7B88EF8 [email protected]
913,021,797 *5F0E6290FE7B558AFB3B2DC765788A545838554F GOURAV.CHAVAN
913,021,798 *5F0AE20D599863BACE196E0126D387AB119FD523 ELELEEP9
913,021,799 *5F01737D3DA1CB1D8EC146E7730DDA682BE3F388 [email protected]
913,021,800 *5F08322521C4C2E306D16B4E899D5BC7A39096ED grape-berry
913,021,801 *5F072350657759F9125F50D13DF6D1F1FDBA5EB7 GREGGPROCHASKA
913,021,802 *5F0E38EC0CF772E75F66329F0AA03D0492A1CDD8 GREGLOEWER
913,021,803 *5F0E346F3CE1FFCB7153D3FBEF2303EB1C655690 ellsworthhillis
913,021,804 *5F0BF61415C82A024DF1218DED97CDAAE285E98E elmerjank
913,021,805 *5F079E305F62629D3FCE582BBD2D6E98018FE463 el mundo gira (igual)
913,021,806 *5F0524398F63BCA61D64AB1098AE2FC869D4841A ELUKIDIR4
913,021,807 *5F0665EDB1B4FC9D9DF8A0CDB38404FEA61D9509 GTRISTAN3
913,021,808 *5F0AD3B8FC891EE0D3243988525031DF6BF8AB2A emeries
913,021,809 *5F09273A0C242B1E866318B9071CB4B776C2A480 EMILIO.BURRELLI
913,021,810 *5F001BBC612F3937EF402DBB9BB5C9FC4EEB985C emilyhyl
913,021,811 *5F05B18C49D984D16A8C1A4F6D6A9A13EB971404 EMMITT.OZBURN
913,021,812 *5F0B3FB185B53D3A1130FC4ED5AA1D72837E2C88 EMPEQUE\ECIMIENTO
913,021,813 *5F073D5C32494FCDA1705B15525BF4C738A238C9 HAC6415
913,021,814 *5F0938BECB85CDE11476983DB53282A5EC20A920 HALITOBROX2
913,021,815 *5F0A4059785381AC56057257B4F8199F0043E6FF [email protected]
913,021,816 *5F03389189E25B2D6C85401956D8A495B8E1A4BD [email protected]
913,021,817 *5F0B7EDDFCA8EE8CAC255806451A254A30F97B71 [email protected]
913,021,818 *5F06C91327BFC3BE0BF661A8747F089D6DD4DEDF HARLAND.GELVIN
913,021,819 *5F0C70DD1B527408D54C8AA1511291E0A950D101 HARLEYBAUTE
913,021,820 *5F0BC201E66931FD4632BDB409437D962889E767 harleyganiron
913,021,821 *5F0953346A6309AA9BFA3416A313C746BD30C6A3 erandberisha
913,021,822 *5F049F7CF2671B2B4BD5D0BBC0185FD1A3ABB71A eric-rigler-&-scarlet-rivera
913,021,823 *5F09A754E057E6687DAA308C311E55838421CB6F ert=g
913,021,824 *5F0336EC3215023590472E1530C9D7F02DCE1E20 HECTOR.ROBERSON
913,021,825 *5F0C5E0020FBC7863E5D733DB13DEAAB212710B2 ESARFF
913,021,826 *5F08DE6E640447A95F9F718F0241913EE6839CAE etiucaved
913,021,827 *5F01E9D441021CB0BE4FC30591A711CC1F40C1F2 HILARYBINGHAM
913,021,828 *5F0CCA34E789C74DBD175E0AA66B78F9137C73A4 EUSEBIO.MAX
913,021,829 *5F01C12BD9436D342448D2B99C05C16AE2B211F9 EVACORREAS
913,021,830 *5F06407B476711BBFC2B5EEE029179E3BF5623A8 HIRAM.VERT
913,021,831 *5F072FBA7E6DD8B81D7D8FAFF2DE86D6B88BC985 HISTBL
913,021,832 *5F0BADE1AE52595FB5693974B0C5E1229363B89F EVIEG
913,021,833 *5F0509046CE815538B48E70108722068EBD23A64 h{m{riss{
913,021,834 *5F00BA0E5BF5D4F785B5D93D1DFB349825E7B5DB EXPLEMENTAL9
913,021,835 *5F025475ED40AFD19BFB234C935757CBF9D84D96 EYNF-
913,021,836 *5F00DA414D8B7770600340E79360EEFC86C8F22B HORACEROOKS
913,021,837 *5F067837522C3A36E3E5D9630672A249709CC50E HOSEAYAMAOKA
913,021,838 *5F0B86CA881EE85F4D2506E39EADD55BAF17D433 F4I9U4B1E
913,021,839 *5F0A2A2AD19DDB06A2C9197AB2F6797512653E6E F4MELE55
913,021,840 *5F0FA6DAA17A223A7533A527F25E00155E9627C3 hranidbing
913,021,841 *5F0659CCC29E01AA9BF35C21EC11DE69F3791604 httpbus-photosfpic
913,021,842 *5F0E11BF8787E61CA53444417FDA5E6411CD1823 FAUSTOPONDER
913,021,843 *5F08FD0293333695C93B9610C48D0A8DA2D4B07E fbfbfbfb
913,021,844 *5F086C58117456BF4092D21031E996024F63C807 FEASTUPON
913,021,845 *5F0BD75B95BD686F4E6B1C9488DE92793AB18C77 [email protected]
913,021,846 *5F07E375078DB0792B72775A86F20F2CE3DE00CC [email protected]
913,021,847 *5F04C4D88542CD00C0D918C8D82FADE1731B3634 FERYAT
913,021,848 *5F02EE0C2225134EB309C4AE6B3113DE316C2EC8 I6R
913,021,849 *5F033E8ACBCC38DBC2A92485C80F5E697A4B828D iamlelandabc
913,021,850 *5F0C92B9FEDE5C26C8C18F5B279C517AAC0E78E7 [email protected]
913,021,851 *5F0E46E08E4E7E2580DDAB072637D8164D6A1B50 fk;~
913,021,852 *5F00CDF2CCBF9D5D40812BF98B52532FDDC4940B IDESKISSÄ
913,021,853 *5F041A95C309EF43595A4B7FB84CA80C82035F57 fluidreplete
913,021,854 *5F00842A1956A634CFCEF5C7C4087F42EA8F990D ignacioscurlock
913,021,855 *5F0CF0D58DA66B7837F7F125F92542592B482DB0 IGSTKURS2
913,021,856 *5F0ACE9BA741478A0B3E0EAA2382588B0D5741D6 FOLLOW.YOUR.DREAMS
913,021,857 *5F0050628B06DD9B7191F7EF9E2608CFD4B19968 FOSTER.EILERT
913,021,858 *5F042B113635C7B570399AECAFB98E4A8831933C FREAK.LIKE.ME.(FEAT..DUB.CONSPIRACY)
913,021,859 *5F06589BD7550C0F548A16875772D3E5DF266F9F fredianis
913,021,860 *5F0F96B9E3DFA891BA6FE78E9AD0BB901207DFB6 frescos
913,021,861 *5F01665EFC0FAF660878E5579829248BE8B084A1 IMAGERISEDRONATE.SVG
913,021,862 *5F00A22009D54CB4303EF7313A52E571E067752B frutteti.
913,021,863 *5F00038D030A6EF2E4230F82C02AED1FEE5FDC1D fviprgged
913,021,864 *5F04008F00BC56598626C5E54CAE24624AD5A92F GABRIEL.VAYON
913,021,865 *5F0862E01BA22FFECE66316ABBED7BBE41451E7F GAIL.SHYNE
913,021,866 *5F07297DD788733FFDCA6E67A6D4B995FEC3E52C ININUKKING
913,021,867 *5F024D89F7C193228869184130ACFA08E202A4A3 innerworkings(alternate#2)
913,021,868 *5F04F5A3CC8A0F7AE31D401BB586B5257346B144 INTRA-LANGUAGE
913,021,869 *5F0240D7DEF413EF776EF9F08BCD05E1B25B27C1 GEGENWALZE
913,021,870 *5F057064F07FE1A7CAD981C56283C0FD964F88B9 [email protected]
913,021,871 *5F0E962BC1D800EC32C1CC2837CFAD43FB5FBFCA GERALDOHICKLE
913,021,872 *5F0C501DD5BE56AFCB7B6310CBDEEB26B5BE7089 geslachtsdelen
913,021,873 *5F081D5B67D33D2E0AF381EAD1D66746856C9B01 ggk4cg887173s5a361b06
913,021,874 *5F0E72BBFF9E8584975D8C54DBB38BC27EE2AE53 J3"R
913,021,875 *5F0FB09A0C33734E6EFBAD6276E7098DDFA577A1 jakehashmi
913,021,876 *5F03CE6E80009D167A78D7E83E63F0CE936C7034 Glam-Bam
913,021,877 *5F0B0BED8E785E69DCACF294B3A605117DA56AA7 jamarnease
913,021,878 *5F04F55B93BFFC4A7F1F97CD99ABFA1FA6E650E3 JAMIE-HETRICK
913,021,879 *5F09F2E978BF56BB075E8E3E2AE859ED69676C71 JANBART
913,021,880 *5F052DDE5353F08A1CBFE930D09FC42D08133B92 GOOD.MOURNING
913,021,881 *5F01C23B0D526F2D25B05B6A72DC374469355702 jayden006
913,021,882 *5F066EDBB05D4443FF134F5A305F124A11D7029D GREGG ERSKINE
913,021,883 *5F045AD55146A996FABE418588FDA814BAEC6E3D GREG.LANTZ
913,021,884 *5F08BF36EDCC147FDD4FA3B93522360F51DAF7A4 JENNIANALOG
913,021,885 *5F0F9FA86FC10C9F8DBD76BFBDF5CA54CA8296BB grynastyl
913,021,886 *5F0A48CA798582EF5CAFD866CBFFB225C0376B25 JEREMYBUNNING
913,021,887 *5F0250F4ABC8BCCD1CFA6B347B81F4DFFCB41B5E JEROME.CRIMES
913,021,888 *5F07037F3A7D4C0879F56433CEB8B317E662615C [email protected]
913,021,889 *5F0BD8E9693B8FE11B412B20637924F445903D01 JERRY.GUGGEMOS
913,021,890 *5F01EC8CA87E3B79BC3A7EC1787AB1B711ABA12F g']v
913,021,891 *5F09A952BEA57440A689E5141A633923C6DA7D58 [email protected]>
913,021,892 *5F00DB6BFC1FACA1A667A50413A3F2718417638D h3f7n3ss
913,021,893 *5F09C401082C9EC19ED8348A7C825DBBBD37FE2E [email protected]
913,021,894 *5F0CE3F053E582D171E3ADFBB7006A03CC5019F4 [email protected]
913,021,895 *5F0C6A1FA69B8DBDFB02C24D8B0C5E64D5A1DDDA [email protected]
913,021,896 *5F0AFF31C702977242E35D7B05B5A15DE99BD54A HAPPY652898
913,021,897 *5F00F87126BB66A1385B04162EFDFB5FED63313F joemorrero
913,021,898 *5F0F5B41686DCF1CECBA9B87ABA8D615473B5E7D joe-shuffler
913,021,899 *5F0ACCFB361B90A4A3DE222525A6F48F2DE2A461 harsfalvi4
913,021,900 *5F0319D0CCC8FC95424942E6BCF0A280167386AF JOHNNY.BAMBACI
913,021,901 *5F03FE1753C29F0BF87D7564078AF773EAE17B87 havildar9
913,021,902 *5F003379BF65B1927BDC329B162B2AA8FD67A73C JONEWBY7
913,021,903 *5F0E68F539B372A7816A38E4D8E5E1AAC2FABBE3 JORGE.KONCAN
913,021,904 *5F0C75FCC9CBE7E7C03F5C21E7AF2F544C626D0C HEATHERNICCUM
913,021,905 *5F0594A7D0FAA030BA18A664B8289AB5FC9F5EC9 josephhookfin
913,021,906 *5F0B1E5F5BD27E9712B35C0A3BE8490CE7AD7D16 [email protected]@1ter5
913,021,907 *5F0EE289B0A983732DF20395D805EFACAC776B37 HFQD
913,021,908 *5F09203F03EF79A413E5F288998A79165D72186B HIRTWOODING
913,021,909 *5F0C5DD23A9D647CEE4AC97DAC7AC6CF2DA2A8E5 hit-him-on-the-head
913,021,910 *5F02B1BFF79DADED877412227E1A5C5AAE5E8BCF [email protected]
913,021,911 *5F019A365DA4758BDD73B08F7B5A0EB8C85A9D8A KALTBLÜTIGKEIT
913,021,912 *5F02859C7283FD05453F48D02C010079F8F5995A KANUMAME
913,021,913 *5F018BCE9F1D92D2F18B3524B9E80A49681B3949 KAREEMFELMAN
913,021,914 *5F0AB48B3EE9369C05A7F89197B8ABFBDAA2508F KARL.LANDE
913,021,915 *5F0F2B2C7624F0E7499F7EA8CE38E5A276CB0FF5 karlmin
913,021,916 *5F098930C05C0DA26059913C2501746205380DE8 KASEY-JANELLE
913,021,917 *5F02A3D50355BD91D4F9C906F5B40AF204EF4283 kaske1ots
913,021,918 *5F026F1821F5BFD87F91FFBBA9999A04904F200D katoovaisuuden
913,021,919 *5F04FC6E24BDF5BC0E3FEAFA7110BD511744CC10 HOYT.BLICKENSTAFF
913,021,920 *5F07EB8C3C6D81B62C1795BF76A7C3AE3FC0E5DB KEENAN.MILNE
913,021,921 *5F0639F821188E7D1E2D690E66E6DA075B41F994 HTETSTER
913,021,922 *5F02FF000BD253E19F406F6753F7EF8E0B2A44A1 KENDALL.SAKAKEENY
913,021,923 *5F0E757EF74439D0102B1E4ED366811892ABFE92 KENETH.GWENN
913,021,924 *5F043EDC5BB2A4A7C616D683C771622E0A0824D5 [email protected]
913,021,925 *5F0EAED1DD156BDC4507DBCBC1DC3BA7E9589BD2 KENNWORTXTUBE
913,021,926 *5F0F7E528638653090816B82A4254BE2AFC5439A [email protected]
913,021,927 *5F0444E77E715B72FE8EFF39C461B3F7BD139438 HUNFE160TALK160
913,021,928 *5F0BA82E8C3EFFE07BBDC54643430481DE466629 KERRY.JIMENES
913,021,929 *5F062D204C790530C01B11F0E9A143032B669C2B HUTIJNIK1
913,021,930 *5F0AAD51D8B8B523610DBA345FCFEA3E2F79CBF7 KEVENMIGNONE
913,021,931 *5F0F8E06FCCF9C918F0FF4A53AFF8E3A61781D93 Hydr0g3n47ng
913,021,932 *5F01F7D67EFABEC4FE2AD968DE8A41409D2BAC4B KHALILI160
913,021,933 *5F0EDD0711D03D150CE25280C0B75CC7BC4408A7 [email protected]
913,021,934 *5F015EFD6EC3387D30860C13A867188C1DCF0632 iamkingfish9
913,021,935 *5F0A68FF033C6D6E0C0254BDC744A527A5F7262B iaresiot3
913,021,936 *5F0A79CDE2F0F88677F8A0927580E8CD6AEC0F0E IEWISSH6
913,021,937 *5F057DBBF0759D69AFD0B47BFB25DC374B4E8696 Koch.>.Schutz.>.Studer.plus.DJ.M..Singe.>.DJ.I-Sound
913,021,938 *5F0B9ED541EB28AA48766123C52F85348B80414F IGNACIO.MANFRED
913,021,939 *5F0865D0B817422AC0CE0D6B1B898444F80C6D4C iknow(lapens
913,021,940 *5F0973A6164A53296FBDCA935CCF57130D989DF7 iluvcivic35
913,021,941 *5F08C29679F15D10AC493D99CD73EA8C0B7ACDF8 IMAGEALPINA_LOGO.SVG
913,021,942 *5F0874A007E4890AF00508C214DEBBDC07C667C7 [email protected]
913,021,943 *5F0FD4BB7CD3EB6197301976D2915E079186F9BE imagisms
913,021,944 *5F08DD55340DBBA08B6842701F3CEBD710D481BC KYLEALFREDO
913,021,945 *5F0B96596BFEE4EAAC86B8ED84881CAB78ACCBFD KYLESTANDING.COMWWW
913,021,946 *5F0C83F0DA309F8B3F92871BDE19A2E61FAB2315 KYLESTONES
913,021,947 *5F0C2AB8BCE8207898C54CA03A605C5BD57C1FDC KYRA-AND-EDITH-MINTURN
913,021,948 *5F01CA2C97020234F3AD34B34919203FC76E55C9 [email protected]
913,021,949 *5F0F2E985DA50B07B6875119CFD5C54E26F88E99 LAELGOOZ6
913,021,950 *5F028472503BA93B970DF91FDEFBB2DFE380DA7C interfillingn
913,021,951 *5F017CFB7998B880B2C61CE4CFD16623A9EBE8CC INTHENAMEOFLUST
913,021,952 *5F06B91A7127A10CBB27EF65C864E00DB7754F13 intro(headbangerboogie)
913,021,953 *5F05C35D81E22D68834597C817190E2C5595C370 lannymorones
913,021,954 *5F00A49A7B1D6881CF8A02AD0DF4571A257A3060 I}P1
913,021,955 *5F05BE9FB22057207F96E69424A235B34506C2FC ISIAHROSSELLI
913,021,956 *5F0254C180C2477F2021B090774D87D2191AA34E LBERTOLACSON
913,021,957 *5F0A351F525C89FFE0EAF5CA206FB8CCEF315F69 [email protected]
913,021,958 *5F09FE3EB7B4FE6DB818281B5C26ABF78B2B8FDE ittelanac
913,021,959 *5F0911B7E55A3A56E65531BC168F42B5881F9661 ivorywillinger
913,021,960 *5F0CA3B9C1E99965CBCD8FE56DD86596576FD094 J0P(
913,021,961 *5F099DD46C61477246AB36B0455C79671D478EE7 LEOPOLDO.ARANT
913,021,962 *5F0025F9F451998C25E0808A9E500E02F9808DC8 JACKSONCERRONE
913,021,963 *5F0C37E3F8E08B5469263AA66A3BC7BA6F29B2FF JACOBSYMPSON
913,021,964 *5F0271A20BFB02E7BFA2D82AF302ECDE0FE98A5B LESLIEOUTTEN
913,021,965 *5F0C2A0001921E3857AAA1DAB59297BB129F22E7 [email protected]
913,021,966 *5F04E0C3ED3629180CAE053D976308F2812D7646 jamefinister
913,021,967 *5F0ABE5B811A9BED58FDB162E67CA1A3A0A97294 jamisonsumatzkuku
913,021,968 *5F0CF83D40B093FA8E423B5316005F84E006923D LightOfHeartPolkaOp319
913,021,969 *5F0D16AB94F70FC932650CE82F3F7E383F955AF9 JASPER.BOWKER
913,021,970 *5F0478864AD32914F1FD7D08FACC46F6EDC4C78F linguocentricity
913,021,971 *5F0B796C2FEE7DF578E9AC897463509EF9270BC7 JAYLAMAE
913,021,972 *5F0FE303C4D833D19EB2CCCFC441252E6E2030C9 JEALOUSY (BONUS DISC)
913,021,973 *5F02380611090FF8ADD9D35B28D70F0DB53F9473 JEANCHARLESGILLEMAISANI
913,021,974 *5F0C9787E17AD84719EE86D2E7207A32C83F8285 JEAN.EST
913,021,975 *5F0FD3981C628531DC00409CA3635F91F5A5ADA7 little-prayer-no1-(elephant)
913,021,976 *5F030A0E890F2DFFDB16452B71F2E7D3EC388FB1 LIUTPRANDIGA
913,021,977 *5F04695DF2D18B826DE952D7A60B0440256BDE77 LOGANBORSA
913,021,978 *5F0FDC5D44182A46A28974A9C2DA17169F05EADB LOL...WOULD
913,021,979 *5F0B6A38ABFFD5726C00AF9DCB18EEB55565245A JESSPRUE
913,021,980 *5F0D71ED173D38C3CEC6850C7DFE15DFC3D360F0 [email protected]
913,021,981 *5F0E358B34ADDE3DC87EEB8A06C8223A067A5C03 love-a-loser
913,021,982 *5F0660AE2EFB3F62FD78266BF8D1CA051C226189 LSOHGFY
913,021,983 *5F0D96806D31A4A2D6C8DE943A5529CFA7302D8C luigidodimead
913,021,984 *5F0E3E723AA576DDB6B2F9CFBCBE47CC6C734CE2 [email protected]
913,021,985 *5F0437A80CCF596ADF2A9AECE59C432237CA0DB8 LUPEFASSLER
913,021,986 *5F0DC7428ABD30E223B7F0845F4EE8F8602A7182 JMANGADU
913,021,987 *5F0068DCA170F0E11C508E79BAD91FF362C411BC JMCAAAAMAAJ
913,021,988 *5F07B84E9A7D3B834067EF019543A9D0F229FDA3 JOANSIN3
913,021,989 *5F0D782AB24BFD9F11F9E73A723F10E093EADB5D m\\
913,021,990 *5F0BAB247773D4F1967165110AD0AA36FFFCD3D4 magdalena.nile.del.rio
913,021,991 *5F0BD44D2D3E64D7D121F93D1C474C05D329CFA1 magdy-ma
913,021,992 *5F0EFFDB0A2634DD179600F9622248380A6F9636 JONLKOONSFORD
913,021,993 *5F032FC5CE6390DB6377D589E4BF86611B88593A «MAJLIS
913,021,994 *5F0EBDB5F56D4810EA8671753DA2C0022AA6F0C2 MAKERSHUIS
913,021,995 *5F06E66BF69A79CFEE587B86885B60D5C74871D0 MALCOLM.CALIX
913,021,996 *5F0367E6F2555039631FEEDD6450F36A58E89546 MANGIALA-/-MACCHIE-SOLARI
913,021,997 *5F0D3FD737775C3F4A547306221F09DB2ECF4BDA MANLIJKE4
913,021,998 *5F0073A2DDE3BE28DFE88341FB1E7E97DD5E0946 JUAN PIRITA
913,021,999 *5F03A95841E1486442031C674840E63DDB689BCD JUDECIHAK
913,022,000 *5F0EA5FA4DD3F214224C7237281F55895098C3A0 juhl84nm85c1c8
913,022,001 *5F0AC39859B41E7EF273E43D3EEC3026EF43931F MARCELO.GOULDING
913,022,002 *5F0E7ADF926198530F9AC97AB99063B0CB5FEFFC julie-moran
913,022,003 *5F0CC632FC89DF9707F35B8A0C79AAC6DBB3714A jyf_
913,022,004 *5F0BB0FDE0EE24BDA7FFEF13587E52092DF44789 MARLON.KNALL
913,022,005 *5F02A83A95929FF23FDE2855FF02FFCD00492B4B MARSHALL.KORMOS
913,022,006 *5F0E7530462630B8065FB0F04C8FA1152249A20E MARTY.MACARI
913,022,007 *5F0BD5D64726E57E795FD8B3F032ED43B293B3D0 KAPLANTURBINE
913,022,008 *5F04B1AD7AF49D20B5CFFAE65090CAC97464F2D8 KENETH.ILLESCAS
913,022,009 *5F0ECCD7EF7A9B44B62BB648D28E8B71703DC5D4 MECHANICALLYCONTRIVED
913,022,010 *5F0A3B817F331F0432EEFB28FE99FABD384239B0 MEDEAMPTENAAR1
913,022,011 *5F09C023B5575370D918F70B3AC50326F2D9AFCF MEMORYPRINCETON
913,022,012 *5F0226D1924DC2607DB150F75C2EBB202C786D80 MENGEDAN
913,022,013 *5F0302F5F12C954C29434E305D6227CCB946DFB2 kf#i
913,022,014 *5F0DBC708A917B6243BE0E92B37BA2452458C471 KIBEDUSE
913,022,015 *5F07F1BD63ACF510DAFBA6276D0FC0258E377F4A [email protected]
913,022,016 *5F0425B47AE2EC6F00E67A53788987C832D61F1E MICHAEL DIGANGI
913,022,017 *5F0CE92BB234F36FE991EC6C6026EA42353A6611 KJFWXQUKLDJE
913,022,018 *5F0F5F1750E126C5959B19EEED95D9CF2B6E8E2B klenot
913,022,019 *5F08C90773F1CC7CE768531F279F2FB17A8F417E MIEKKAVYÖNI
913,022,020 *5F062934E72CD2C023F4010A4938D982AD06E4BA KMTZKRS4
913,022,021 *5F016A1EC13A861DFC26E5C725EE18E8A28B7FB9 KNEPPERIÄ
913,022,022 *5F07BBD4E206B6289FDD7039E66CB59F0D44F456 MIKEL.LACOGNATA
913,022,023 *5F00F0F955714285A6F08DB17A8B775D50EB6F7E kodama100284dulce
913,022,024 *5F03E42AB9E157C1E83A55EB8BB7EF466C7DE24D MILES.SELAN
913,022,025 *5F0B0DFEBB1D641C4F6B4BE89461172F576D6666 KONSTANT.KREASE
913,022,026 *5F053F7848501F2342A4789523F25313C9EB220F MIMOKASSAB
913,022,027 *5F089C6A2FB189595594E6F725118953588A8C6F MINUSTAKIN
913,022,028 *5F0CB3ED27BFBC22A62A1810264377422F3B86E4 KRAIGGLASHEN
913,022,029 *5F0C6307FC8FADA206D09E6C668722F79FA30A17 mirongreat22
913,022,030 *5F048AFEA9CDD4E4D6D3698F906A817DCD791ADF kristy-hinkle
913,022,031 *5F0AA61847AFDE96BD1FB5A8FB96A81FA6F1D1E6 KRUSINGGED
913,022,032 *5F02F9145EFE87F3BD6F07AD21B16DAD4DAA9672 MKGFVUENMMOLM
913,022,033 *5F01E4C4D0121EA9CF0D7B1C02D8E7AB90AADE0E kstjffrw3
913,022,034 *5F004702C0AE40E164D2C9ED45EEF458A97A9258 kutouse8
913,022,035 *5F0ED45DCBF65DEAFCBCF274C6758FEF35E50F25 moldar
913,022,036 *5F029584DA30112BB73046117F7B3024986DCF5E moreluce
913,022,037 *5F0D5AA1A8D472C0397E74A4812040A4DB8250A6 mp9baa
913,022,038 *5F004EE1456D4C9E2754ACDB8E59E074E6DC30DF LATINERS7
913,022,039 *5F064A53087CDA0D5C6FEF7D6E2CE57DE10823BD mufinella
913,022,040 *5F04B135888205DC32428B974B682C62D25EB6B7 MYAFRICA80
913,022,041 *5F0F7C77D17B3423FE49782DE3E953D2D0E29D2A MYEVELYN1990
913,022,042 *5F0A7B3A7A44AF6708202BFD2FCDEA487A7C26F2 mymolson42
913,022,043 *5F097DEA0668435CE410A942F9CDF4CA1A0D9308 MY-SCARRED-HEART
913,022,044 *5F02E3885C4B5F7DC8897AB94908B3F64AA75025 myundyinglove(iwillalwaysdismemberyou)
913,022,045 *5F0E7DC182CA437D3DBABE2AC798999EB52D578C lewisdemulling
913,022,046 *5F0DB9E8315E1AC442EA9D5D167931D0028BCC07 lianabeliveau
913,022,047 *5F07CD550E00A112800BE96CEC717DE68557CD61 NATHAN.LACOURSE
913,022,048 *5F04AD635EC4614ECECB22C62AE1EED909B00927 NCRCLTDED
913,022,049 *5F0F54ADC7773EDAEC8A60BB3CCF2138F7809E76 ne<2
913,022,050 *5F0BD2474FFF916F62555E9C5B4B245EEE5A2A73 [email protected]
913,022,051 *5F01F93026AF2EC4E89D3D8BCC3796B56EAD9AEE LION OF SWEATY HAND
913,022,052 *5F06A6CC2B2BADECD7F9AE59732661EBB6ADD7F0 Nerinx
913,022,053 *5F06237E9F819B6453191E35310A843527EA77B9 neurasthenici8
913,022,054 *5F0D9C2D7C7C44D99D19E8F721EEB7FE980328CD NEZNAMAED
913,022,055 *5F08BCAFA32392C45C103D31AF075D9E710C9B13 n%hd
913,022,056 *5F0D22BFAA7E239205EFA083753DB6650DCA837F LMLKEJCING
913,022,057 *5F03CA34D1D7F0AB1076375930D53AF1FAEDA353 niilhuji
913,022,058 *5F0075B1EBC0E04059ADD8008CC2C4A9738115CD NINCSEN944305
913,022,059 *5F03861F05519510EAC312DD387F26E270FD8C79 LORENZOBIALY
913,022,060 *5F02EB4F84248B9F5EEC9326D847A653B881449F LOU.WOYAHN
913,022,061 *5F0CFB69A70C698E279A8542E8668442A4548BA3 NOATUNS
913,022,062 *5F09852463A41E847A768EC1F531AB1E53F4C5EB Nomequieras
913,022,063 *5F0E564F21E03EBA3B6B35D420F91F9AEA460E0F NORBERT.ALIAGA
913,022,064 *5F06CFC00672AB2C3AF4B791640FB8E3DCE3050C [email protected]
913,022,065 *5F01454DD220DDAD225FD9B941A6FDB04A7FA0B6 [email protected]
913,022,066 *5F0BA5980F82B5E51A4F2CCA848A6FB4F4D54561 LYNDON.KOLTER
913,022,067 *5F01A2DDFD8BC865084EF4B108AF6E9122A0EAFF NUOTAVANO3
913,022,068 *5F0F9900FB90F03090E7C08CC164F1C764B28A08 obithubby
913,022,069 *5F0F4908EE4341D02C2B8D28820DB8FBAA253FDE OBSCURITHORAX
913,022,070 *5F011542DBD62C6800266657D3C4EBA14037D366 MACROPTERY
913,022,071 *5F08C0DA682F60417474CC7B2D1EE533F56AA576 ODREDNU8
913,022,072 *5F0BA102DBEFFA939494FDD4F84EEE558391A575 OFFEREDM
913,022,073 *5F0D950CE8A7DB5C8FAF05409182B7EBEF21ED5E ofióna
913,022,074 *5F0F4175A6A336290B1A831CD7AEAA0BDF2DD731 Oh,.no..My.new.shoes!
913,022,075 *5F08BEA916BE5EC5E63C298D8B2A7853BC555F89 OIS-SAPPEY
913,022,076 *5F035597C888FA5DE22D8E203C2D7C6A8BCEC709 olinmenz
913,022,077 *5F0CD5436D4DCE99E71EFAE9BBA3DE37667F721E MANUEL.SAULINO
913,022,078 *5F0DF5B971753B38C29A4FDDD7128290E22F66C4 [email protected]
913,022,079 *5F0A7888EFC06F923FD9324863D35FE42EB14CEC MARCIN-JEDRZEJEWSKI
913,022,080 *5F0615C628DC1E58C5F3D5EE6E0C1441ACF10285 MAREŠOVOU
913,022,081 *5F097B066AD8C42DC98658C0D5B13E7595AEC1B0 MARIALESSEOS
913,022,082 *5F0E9D3420C52DF568E3C78F0C9F8FAE437D1655 ONTOUCHEATOUT
913,022,083 *5F081DCA0A5B1473034A0287A49895ADE5EE5BBD (~_^)o~-O~q---8
913,022,084 *5F08BB38E7243DD87C6DFAD64E833456B75F4EE9 MARK.BURNELL
913,022,085 *5F0E650DE44FF115BFCBC2A70896FA7C9D1E6C82 [email protected]
913,022,086 *5F07CEED90CD2A364849F91DE88B04840EA8DC1C )O(`@q
913,022,087 *5F04C5EA5C82937EAC5E081F886572AC8AF0F552 Martin-Lechner
913,022,088 *5F0B5424A860F2E14B160C3C2F3448C522FB580E masemapi
913,022,089 *5F070D6A8D9D4BF40D6576A893D75403D98554AC osvaldoichinotsubo
913,022,090 *5F093AD3DC58EC03565DBF11081492FEE6F136EF OTHA.KORTH
913,022,091 *5F059DF701DD4BBF29E35E293A71F7F65111AB3A [email protected]
913,022,092 *5F0BDD43443B26C4D582B21FC1FBD4968A64C5EC MATT.MINELLA
913,022,093 *5F0FD621736293C62C2F34ADEF53F95C22D58D08 mauriciothierman
913,022,094 *5F0162209958BB8E621294A2737EBD17929C6F25 MAXPIGFORD
913,022,095 *5F0BEAF820684D9F429D6D265CB6EFCED3B1AFCA m$c)
913,022,096 *5F04D33444A309DC59B7F36AC85D110962C97229 [email protected]
913,022,097 *5F0889BE33CA4304285D83C34532918269799A14 MERCERISMYNAME
913,022,098 *5F08AC309FB860307D2E6AEFA6508964F735FC33 METAL1977
913,022,099 *5F0BB74FC7048570208B787DC93AF4C1AE766318 PARKERSORENSON
913,022,100 *5F0746A18F22F0107C180E7D7337FE375609FBF3 parreska
913,022,101 *5F06F403477C4625B390B37A66138FFC0D721185 MICHELLEMIKES
913,022,102 *5F09A425EFCFE20EB627E7A054983E6E6017CF72 p=B~0.~osplat!
913,022,103 *5F009F47028818011D1BE891A930434DCF5FC6A9 MIDNIGHTRELEASING
913,022,104 *5F08CAD404E84D1C2AEC65FE158650D4C5EF7436 mihasbot160talk160
913,022,105 *5F0C1095D3A9B5F34FF49CEF55451F303B657C1B MIKAYLA534
913,022,106 *5F03420BC56225575CEC7A89A9FE74C01ABAA04C mikelbalay
913,022,107 *5F0FFEC1AFE9E2A3242BCC0788D8DC1B935933B0 pd~0~o splat!
913,022,108 *5F08900A21AFF1230AA7F509D8964C6DAE159114 militärbautenkomplex
913,022,109 *5F029D5B6893A7159114A754362CFB3F2AF760B1 pejorativnoj
913,022,110 *5F0F64CF876CE92DC086928E8A226520F3BAF24C miplaci?
913,022,111 *5F0CEB1F586CC03C2DD7DD8877F8EEAE264489CC MJÖLKBUD
913,022,112 *5F00F436A0430079D49C6063D963B60A44889656 PHILMORRIS
913,022,113 *5F0AC2CD943BBE25145FCEED260B4BBEE202A72A MOKSRILI
913,022,114 *5F0B1525833F770CAE558963D09D711A94F6B65C MOLLYCHESTER
913,022,115 *5F09B237A7EDE995F93DE542DF5C73006D707ABF piolo.cruz
913,022,116 *5F03C064327747111C312E3BA9C014159BB3A6AB MONTEALEGREVELASCO
913,022,117 *5F0FD541F8C8E50BF574886ED287B6A33F0B4A87 plaetze
913,022,118 *5F0F121926251C8E48D58AB8B19ED3189B598D85 msergei5
913,022,119 *5F079F2AFF126042477278022CC4C4D26AF1EF77 mufinella
913,022,120 *5F09C534FD0AB08C086902B16DF8B0E3A908BCEA mustill3
913,022,121 *5F02EE84723E39367D60CEA0335762D4363562BA MYHARVEY1
913,022,122 *5F05C6F27B7DF646B7CCE1FD942644DB89B7C6FB MYJUHANI
913,022,123 *5F0F762DE7F9EE1E5118D082444D4BB8E6C37C4C my-skin-is-cold-(album-version)
913,022,124 *5F07F302721C79C29BC452E5982424E6EF07019D mzmltjd9
913,022,125 *5F02C873B0C696C34201D16674C53B6F9DA3F2AE pre-linked
913,022,126 *5F04A39E062232DA75EB3F34927405FDF94969F5 prgrmmrrfhrng
913,022,127 *5F0E2D08787B2AB582828195486DE8E200B0EB3F NALJ[email protected]
913,022,128 *5F0605CE63057615F7E1BA8C5222984E3728327A PROGRAMMEFORGOVERNMENTHMGGOVUKPROGRAMMEFORGOVERNMENT
913,022,129 *5F03F1EB1FD2F30DF8419C428D73AF303DCF50D1 NAT5LOVE
913,022,130 *5F0C71BFBFBF2A94ACFE0945B3717B0DFD5A2430 p#####@-*-*-*Splat!
913,022,131 *5F06E18F65519F371CD8E87E9F41AD68574E1F72 NBAデベロップメント・リーグのバスケットボールチームに所属する選手
913,022,132 *5F07BCDB6952C19487E0D0170DF67263541B656A PUBLIEKR
913,022,133 *5F0FFE338F0CB7E81D624F0D0D67B99D75DD60BE PUNTMAVB
913,022,134 *5F098A9425F9D3FC29BCCA7807FDA3A78DE5176D pv:i
913,022,135 *5F014A19A0C6798CF4DFD6AFB281EE011151585D [email protected]`~ (X)
913,022,136 *5F0C503AB9914D973FF2D8AE7657EC9FE93B278E Q126628
913,022,137 *5F0A550367DCE424F8014BD30D9F5376F6698F73 ~-QA
913,022,138 *5F0A780920B18126807580099ADA74F79B850A13 NERY-MACHADO
913,022,139 *5F0AA5FDAC1E653B9F64CDB490027CD3DD2F407A Q======B.*.SPLAT
913,022,140 *5F0581F60C9FBF440942881BE42D9D9A11584871 nghitam1
913,022,141 *5F0CB6C20B7DB1B747117D1D299D7926A703B85F q===p-~0~o-o->-<
913,022,142 *5F06BF8828D5321118D8D53E226005E29BA65758 nicole-sisson
913,022,143 *5F0D10477AFFA3451F0BB074F9418FC72427B299 nicotine-and-gravy
913,022,144 *5F017FFDF2C8DF7B85BC4DF86520432C1E46D73B Nights.With.Alice.Cooper:.20041026:.Rob.Zombie.Interview
913,022,145 *5F0EC88365BA6498D043F5817D48EA5B6F009E7D QUINTINHEDEIROS
913,022,146 *5F0D1B4C221558DA3B9C9C591D16A473F0F2A593 nimish.shukla
913,022,147 *5F047EEA821EC815F01480EF18C3C5B856B3276D ninalandicho
913,022,148 *5F07248CD9A43EC31F48BF1F3A1659ED1B71ED78 NJILLEODED
913,022,149 *5F0C0CA56E90D418EEA83776A6D49959054156CB [email protected]
913,022,150 *5F06E67E642DD12602E65BC8681C3FA0050059D7 normansfield20
913,022,151 *5F02A8D22D1953CC7114083F30A623848883C1BF RANELVAILLHOELLIA
913,022,152 *5F097B01B1B7ED3A14120C946E0BC591FFD02959 RAYMONBEAM
913,022,153 *5F0E6AAE0C4AA9B18BA514000CCFF30B51D2103E NUNDINI6
913,022,154 *5F0923DC3E0FCA2F7338853F9A1968112848B4F2 O92258
913,022,155 *5F002136A0A2CDB87FBC705033D1356957904E33 OD1
913,022,156 *5F009F1F21B66FDB37890C75737AE9D71543998A ODSUTNE5
913,022,157 *5F0426763B314B4AB3D6C77B44FA079ABCC5F183 REGRETTARING
913,022,158 *5F00261A1215AC34171AF50D7AB31573FAF46424 OISKMIX)
913,022,159 *5F0856AE3C732BC02F7367A4629D7C157FA0C9D5 oldemorugle
913,022,160 *5F0F2D609F584F0B462ACF7ADCE9A8B63544EC33 renatotina
913,022,161 *5F01D658475CE97D3CBABA5F065F64E4505AFCF0 O-MIO-BABBINO-CARO
913,022,162 *5F04234342CD5EB6AEC400E781A5FFE38AA30545 [email protected]
913,022,163 *5F03740B98B7B4ED14094081A728AF8F4ED1BDF4 One,.Two,.Three.-.No.Gravity.(Ewan's.Acid.mix)
913,022,164 *5F0FF4397B84CBF07201974484E443A2066AE1F9 O)NH
913,022,165 *5F0196195DC5F8D5564C069E27C87BC4121AB47C [email protected]
913,022,166 *5F052E3AAED76B54079752D77360FCA221E0EE0A RESINOPHORE!
913,022,167 *5F094AEBE439BAD30B33D6F7BBFEFF565EA2CE84 OPÁY
913,022,168 *5F0C5B515DF539A3CCD5BF4414968E40E375079A REVERDACHT1
913,022,169 *5F06138EF45BA79A2B4D9171ABF66F6C2B49DB0C REVESTS6
913,022,170 *5F08B2CB77D202C74908CC6DD7A27016F0AF2CC9 [email protected].HINET.NET
913,022,171 *5F03B888B33ABE52E296417A4D10AF42F0129329 OSOKKHOEUN
913,022,172 *5F0919350A0F020D38A52963869785583CC90916 ouats
913,022,173 *5F04215AC1B5329DA2EE9CC0287ED8DA39E19DEE OUTWARDBOUNDCOMMYWWW
913,022,174 *5F060AEA605F6176EECC0D2C3B9FB2530D920548 RISOSPINTE
913,022,175 *5F0DDF4532815F93BDAA8CBCD31BBC1B875BE589 rka&
913,022,176 *5F06C2B6DFA6FDF7B42C3A3F1BD8688D95B64598 RODERICK.NAREZ
913,022,177 *5F09AC4828DC78AA7108617F001AB244D5BCC924 RODRIGOERLEWINE
913,022,178 *5F05E2517F28BAE279FC1EF2965B1385ECEA0D1E PARIS.MULKERIN
913,022,179 *5F0C54D5064670892F31DDA5F11BBBA6D53CEC51 PARISZDONTESE
913,022,180 *5F03EBD4FD42EF7E80F2E6D19E09020CFF1261EA RONISACCO
913,022,181 *5F09DCE8CA180F41739C1D9B5240734D5AAF3BD6 patmalleck
913,022,182 *5F09A7A3A570BA8BF6D300E3E589491DCB842577 ROSELEIGHT
913,022,183 *5F0A8CC082F18A6374F48DF45A53ABA63912BA66 ROTANSTOKKEN!
913,022,184 *5F05DD1C7867338C6FB19C7B8E7D233D669BB082 RPITAHIN
913,022,185 *5F0CA5F35446E2AEBD8F512F70BE79773DF08E06 PEDROVINING
913,022,186 *5F0BE0C684344784743707E88A452F46B7B942A3 PEIÏET
913,022,187 *5F0357FA26E87207B44BD2BC960816328E415E92 RUFFINIH
913,022,188 *5F023DC1C27C84F99AD6E1091E0877A30B3D7623 peter.danny
913,022,189 *5F09FCFEBB8D617FF644DDF4A4294245E34FE192 PHILL.DVSN
913,022,190 *5F02A651CC9E5F66737979328A48F84D0C777DF9 PHILLIPEDRIDGE
913,022,191 *5F03553DAF4A9AD2124BD8B8BF387B9A5A92C6DE rusty-savoie
913,022,192 *5F09008F06D30059E1993C39C3E8242DB4756AB7 PIKIETA
913,022,193 *5F0B44CBEA1FF8F7F3BD13CAE26B855FAA46A1BE S.A.C.I.F.I.A.CONDUCTIL
913,022,194 *5F048E95C4BBD69E33326471AE368699E19A3078 PODALJOM5
913,022,195 *5F0F59BAB60A6E3DDEA32FCAB45969C4BA1CDCBF podere-2-0
913,022,196 *5F044D2FB1AE1097EB141B1C11774B74BCCEB409 SANDRA CLICK
913,022,197 *5F0EACC353EF3FCA0C34B336055D92EC16B3E9D7 P####@.~O.~O.(O_)
913,022,198 *5F09F59AC97069DDE90D97BF3D0699DA9FA6B8BA pop-goes-art!-/-go!-with-the-times
913,022,199 *5F07721024E2A0C79240DE7E4EFC5C0B8827BE56 SARATNAC
913,022,200 *5F0A8DE6CE8C9B8D9058C8C3C988C0075B525714 satyasoma
913,022,201 *5F0B8DCF91FB73032B919AE28DF0EF1CB8DC8C58 p-----p-~o-}x{
913,022,202 *5F02851E93A96592266E0346C89DC79F5A4983A3 SCHAROLETTE2
913,022,203 *5F0F8E04038372DE6EC543384E517E5C2744EEB5 preadult
913,022,204 *5F0B846FEBB6DB3E01B6B1A44131EE10EFDEE623 schmiedkeusche
913,022,205 *5F0D21128BDA56A2C9B5AB76783CCE0B1522632F PRERASTA1
913,022,206 *5F09E712B3BC20B7DBFDFB66155B6850D93C31AB prijsbewust
913,022,207 *5F09A29F34A9E4AF4E8AA75CDA17C7E022A4475D scottygrappo
913,022,208 *5F076083E5FC0B2C620ECC25A7CDC88ECF208249 SCOTTYSHAPLEIGH
913,022,209 *5F0430971BFFB5A720CF871951468A879EDB3785 PROFESORZY
913,022,210 *5F0BA8BB82CD774E1D5FD42EDB7A08D1996CB9F1 profisom
913,022,211 *5F0E66A1CAE2476D583CCD6172B4C4E5E7E507D8 proreduction6
913,022,212 *5F03B78F58CC27F79E97AC26B481449B41A42246 puntino4
913,022,213 *5F006DA45E5B71F068A4393AC54502A5295184B4 SERENAPETERSEN
913,022,214 *5F01145DCB22456828DA6AE958E4F979ABFE28FB [email protected]
913,022,215 *5F0F152FB42B67DFF91F70F1D46DBD6035933AD4 [email protected]~-~-~-(0_<)
913,022,216 *5F053C01BA9671128DD52223F6F584C99044D1F0 qa_f
913,022,217 *5F0B38D3FEC8B65F64E0291880CAFDF1871BEE06 [email protected]
913,022,218 *5F0EDBE99CE9CD8617193149331A897C4F91C682 qpt7nnpk8fuc
913,022,219 *5F0ED46B87180B7F9BFF1AE52B588AACD66F3FA1 [email protected]
913,022,220 *5F077DA17E46DBCA6F7775723BAFBB12A3C3A5FF sharronda-boone
913,022,221 *5F04ADB7FE4E47665671E6D93FF4A4670CD5FF16 QUINTON.DEFIGUERO
913,022,222 *5F044B9EDA1865F67ABBE3DA91A4CFB501EE5287 r3gi5trar5
913,022,223 *5F07FF7A8B0E48210944EFC6B161615DCCAA7B09 RABARCO
913,022,224 *5F06C502D0A66450D854D4C5635404C998DE389D shermanpatane
913,022,225 *5F0E6CE9421CA6C6ADE9569EC7A6B34BE7B7B97E RÁGCSÁLHATUNK
913,022,226 *5F00F68443062DA63E80441870008946A425FF2A SHIMKOWSED
913,022,227 *5F06E0DF589FF1AC2E8CD91EE0DB45B015667DF0 RALEIGH.WILCOCK
913,022,228 *5F06E0F6E9C25324B232DAE81B9EBF986F2B6A46 RANDELLGUARENO
913,022,229 *5F01349804B25C805915E2369C358DFD99AF3767 RANDELLWOOLWORTH
913,022,230 *5F0AE432FE56D0717161C6D7CFAA4EE5316301EC SIDESXY
913,022,231 *5F0A496BBE5C3EBAC23CF50E67076EDACC3F61A9 SISEEYOUEVERYWHERE
913,022,232 *5F02822CCCB00EA4420FEF4C375B3553A37248F2 SIZESETPRIORITYFONTTTFONT0
913,022,233 *5F023B90D0926F63A0C75E21E70570B698D6518C skies.the.limit
913,022,234 *5F008F2D65AEDB51136750D0E8419B2205EB1517 REERTEMONORHCING
913,022,235 *5F0A9A649533DC922BA4DC4A17A2D150EA375B88 REERTSEWKES7
913,022,236 *5F06F3AFC5224D2B9B49D0D322B4C8A1A9AD86D0 rejda
913,022,237 *5F0E1658D0E76D476725F88D265554E57F808BF2 SNOWBALMARKS
913,022,238 *5F0F0193763525831F99EE4485527EB14F9E882D [email protected]
913,022,239 *5F047FC60B55C00E965D4DFDEE9D1CB71C19FA6A [email protected]
913,022,240 *5F0C14B66CF4827AB90E85144FC936B2D91936F5 soh's
913,022,241 *5F0E66E19157F7751C73672201216A7282FE076B sooteddetoos
913,022,242 *5F05906D2FAAAEE4A4306E52F05F5503D6FEB210 [email protected]
913,022,243 *5F0ECEBB83C00F0FB9B0F42C94D2A2190D865D45 REZARDESED
913,022,244 *5F013253C14A0A81A1D17E2027822198BA4469D8 RHYTHMIC.OF.PASSION
913,022,245 *5F0DCE713EB1541A6F646406D55DCE0DF3A3F1CF SPILLERS
913,022,246 *5F0E4FDD1E4CC2C8D56D3F5E1C81DD88DC798364 splat!!~~d===q
913,022,247 *5F0FCAB8C4D39E514611FD2B0C7D289F4EFB95AE splat o~ <====p
913,022,248 *5F0E919951B95DC3C29CAD0840549591348C2E3F RINOCEROSE
913,022,249 *5F0AF3EEDC77BC9B3697C54858E248255887A573 SPUNKYJAN
913,022,250 *5F0E702DE85C60A15D1E88761974771A9FE1B75D RNEFLUGTS
913,022,251 *5F0B87B9C36C94579E047EA528C086992C5EFD50 STACEYCOLLEY
913,022,252 *5F04250F8AA2A92B2362C73CC3A6125092BD32F0 RODEL.VILLANUEVA
913,022,253 *5F09FFE7F69A478925DE4CCB5E986173E7718CA0 ROESTVRIJSTALEN!
913,022,254 *5F0DCA7FA7EB8594924CF2E3B4E939D92E776A58 ROLANDABSHIRE
913,022,255 *5F0EE60BECC13055ADFA4366B1B6D540F87C3CCC stephanshanon
913,022,256 *5F07F197165E97A2878BCDD9BF3B695402FD1E7F romankuhnle
913,022,257 *5F02135ED0A3339DBAA6D8A55F60F09FEFB60D1A STEVEN.GRIDLEY
913,022,258 *5F0F50F560A4FFC11020E347604E4091ABA773F6 steversango
913,022,259 *5F04A8DED033625E3014BB2FE649FC4B0F9D0C13 RONALDOS7
913,022,260 *5F0053C5E4F8E2F2593D079D05CF6A1372FD0E15 STRIDERNAPOLEONED
913,022,261 *5F0C2ACB4484DCAA48AB5485F16CB517386381A2 ROSARIOFRAGASSI
913,022,262 *5F035AEE99ED7B0828436E7DE1BC6DE6199E2E26 STRIP.SEARCHING
913,022,263 *5F0B9FF018FBB239F4A4E5AE933AAF99896ABA84 ROSHNI-BOSE
913,022,264 *5F08C27210E1FF0D2E118A1449934D9404074778 ROTTENBACH–KÖDITZBERG
913,022,265 *5F0B6BD1DA3E61E6A7C58AB8470506AC7610F085 ROY-MOSCOSO
913,022,266 *5F096E6F8EA5B5CADFD043D22BCCF59327CA2493 roywhittum
913,022,267 *5F04594D605153B51394218501D92F14F1E1462C RUBEN.HELBLE
913,022,268 *5F00A2A23656D1B27305FC5E9BA0C9AE0D24F546 SUNEVENILORAC
913,022,269 *5F0CE0A63029B74217ADDDA98B2F6694F8A6F7AC RUFUSJUNGELS
913,022,270 *5F03BC4D0CDD2ADBC90F0FAF7851B774B40BF369 RUFUS.REINWALD
913,022,271 *5F07E9A93DD25B06F0B0B1F5AFB7DF2E3AAED386 rumeli-i
913,022,272 *5F0AE12612F8D1DF197C780ED520485DC798C02B S"3W
913,022,273 *5F0DC477510DF2727DDFF8BC06363228813DD44C SAHREEL
913,022,274 *5F0BE11DA33AC3DF0A333A8DD4E602E588A5C2CA SAISHOUT8
913,022,275 *5F00C72B12FEE695D774A61D5A8569782C3D8E61 syt!
913,022,276 *5F07DB44A04A2D39F600B9D95F6F92711218CA77 salvatorerisley
913,022,277 *5F00FC866C6EF2E1C33858F8812E15B3CF9A9A07 TACHEERDING
913,022,278 *5F0A6E9046A0C401761D8AAD0B271FE1D1578A3F SAMMIE.BAHOORA
913,022,279 *5F0BF24EC66530688A04D01E85ACB347E97AF534 TAKE-ME-AWAY-(SLIPMATT-REMIX)
913,022,280 *5F0C7A9931632D0522AB739A8F358D7B3D5F672B TALBINOT
913,022,281 *5F0E2BD6FA7CC020B3762A92900005EFCA5A356F TALBURN5
913,022,282 *5F06612B17B941662B47D15F98303676A11054C7 TANIA.AVILES
913,022,283 *5F0DA2272A8581D161A531F5950ED6BC67CE33C4 TAPC119
913,022,284 *5F0B788BBC099491743918A0877CFCA6B04F7988 sauteing
913,022,285 *5F0F9681F31F4AB2F523178142C3268C4184644C [email protected]
913,022,286 *5F0C2FA9C12D3AF3ECD314D716D9ECB34399785B s&christians
913,022,287 *5F01A5C7EBD675ECC44BC6C361B635CADED66E31 tek.logogif
913,022,288 *5F0C12F8F69B454D7297F8BF0533C4CBDD496D05 scoff-(live,-1990-02-09:-pine-street-theatre,-portland,-or,-usa)
913,022,289 *5F03FF3A9E50855EC02A94FC00B567F68FF93870 templatevirusplant
913,022,290 *5F0C416BAA747BC8C2C194A304139A06A2FD7C6F SCOTT-PACKHAM
913,022,291 *5F04064DA92443B02CA0A7AB60A6C6022DFA6AB4 SEDIEBRA5
913,022,292 *5F099406016541BD8FF014F874FA78B05B4F5757 SEIVAESHYPPYKUOPPA4
913,022,293 *5F04E543FBDB6DF569D0F2931E260E34198F0837 SELBAILBUPMI0
913,022,294 *5F07700AF09B0A42BAABFC8F48C49A8D49E0F031 selina-sky-mounce
913,022,295 *5F03FD0C51DBCA54C9B0689C5F4B662CE80DBF10 [email protected]
913,022,296 *5F0A9331EBD13ACA99202A20241FD08D2A262F8C SENIORSPANKIED
913,022,297 *5F0C1650DF082E58BF35444CDD53AE7774508B6D SERVERDEDICATED
913,022,298 *5F0DE8D320E6C3ABB2001914FBD73A28F0EA1B5F THECANELA42
913,022,299 *5F0F029A6EFCFF30AFA05CDCB7577C87D2DF4C6A THEDIVINEINVASION
913,022,300 *5F0C9CB95A894582D8FD5669EEB3878EEA0CF01B sfiammare
913,022,301 *5F049D704017B406FC45BCBBB538301704EF6978 the-music-of-the-spheres-(feat.-mary-turner)
913,022,302 *5F03565BB78116BDB5D7DE563C788E2472DB85EF SHAWN.KNOPF
913,022,303 *5F06BF2A372F38BA3B635DF24FE3BC727CC21607 SHAYNEALTMIRE
913,022,304 *5F0BDBBC9B8B9C8C937ECFBF14CF55B36F431BBD SHELTONSJOSTRAND
913,022,305 *5F090ED889DB4021352B32E1A2250D0A145BC127 throttlinglied
913,022,306 *5F085196A73713D55F539076DB09C1C6C70AA51C SHUVAML
913,022,307 *5F021812EB27F0E3ED8BF9B096EE4BD69B7742A0 SIANGROVES
913,022,308 *5F0A046709A0B68BE2A45BBECDAB6F165901A732 SILLANTS5
913,022,309 *5F05375EF823F7C4EE1FF930BEEE0093FF22F07E TNABESTOFTHETAGTEAMSVOLUME
913,022,310 *5F09655CE995621DBF78F304A8D6A6653E458C50 TOLD-MY-CAPTAIN
913,022,311 *5F0ED4C3164D24B3A62548CA4DA0DC6E942B6466 SKRAUSAS
913,022,312 *5F079347B8DE869F89F146BEE672787BEF6E53F0 slayed.(demo)
913,022,313 *5F0EC9A16DCC8366D5D54EAF435C8DBB4356CC3A TOPWINBSW4
913,022,314 *5F0EECE32F28DAD99A9D678ECCCB2FCAC21FFABE TORONDAED
913,022,315 *5F06CF9E0A1BAB0A0249A6368001BB3343FCB8E3 SLUT8
913,022,316 *5F071389EB521782714F81A4D3AA8D00315EB1FA sonbroderson
913,022,317 *5F0095B1A5F25659DB6D564082BD1FA977DE7CD8 TREPTANJEM1
913,022,318 *5F0C0604884327446C1F9A470E6F95656E8295E0 SONG.CYCLE,.D..911"WINTERREISE":.16."LETZTE.HOFFNUNG"
913,022,319 *5F0D287E63CA53F0F30A5F56B3EDF7E9AC1082FF trimo.susilo
913,022,320 *5F0659ECCBC9B1E3F5767EBAEBDE7EBF52AACA36 tristangirgis
913,022,321 *5F01BBB6D9CBAB810947D7F578803321117ED945 sparrowdragon
913,022,322 *5F0E7FD9D24DCC7B890FDE4EA2626ACCFAD59733 speckle-marked 'sp/e/kl_m/a/rkt
913,022,323 *5F0CF5D3399299936FDB50906767535E1ECFC3FE spheeris
913,022,324 *5F0B34360BC6D8E15A93BAD2BA51B83DD7AC19C2 TWINA.LEARY
913,022,325 *5F0964B126C2B3E77C14B904CC4C347CACF29FE6 TYDUSMANIA
913,022,326 *5F0B314CB31D7F65DBDEB75C28AC1CBB99F2E738 tylermarymee
913,022,327 *5F0DCD5CF02822B98FA7423AB8211BFC1AF1F3C9 STAN.MCDIVITT
913,022,328 *5F0935E9453C85B863525D8665657D8FC2857776 STARTREKOSCAR0
913,022,329 *5F07D12C19CC07A49A15950E081ED9F634F07FE3 STDSBSW3
913,022,330 *5F078E6D8CAC7F6306FDAB78BEDCDDF16D1E0EB5 [email protected]
913,022,331 *5F09F5031E0D7849453BEE32C3CD318F73FE1870 ULOMAOKERE
913,022,332 *5F092E70D8EC98FDC5F2E3FEBABE64FB985E0E90 STIFFNECKEDN3
913,022,333 *5F0102D7F94D9BCBE0E4D13793960BA6B7713B39 STMPYSRVC
913,022,334 *5F03ACC1959C3BDBF9C2B8670D3BE4A5C7BD0CAA STOLENMOMENTS,PARTIII(INTRO/OUTRO)(FEAT.QTIP)
913,022,335 *5F04F7DF5CBC0414190F9F7A5CC48B084635E2F2 [email protected]
913,022,336 *5F0857B58443B5EED0B89DF74B5CC3A83CD90DB7 STRUISVOGELS7
913,022,337 *5F09ACDCBD71F93967AAF475DEA0ECFFF573443D USHA.NANTHINY
913,022,338 *5F08E0898948A438BA88D4B3930A91ADEE7F4B49 UUGT
913,022,339 *5F073F5A825689D9A8B7E908CECD8D076886C1F3 SUONJO
913,022,340 *5F07F6D69037392DE44AAB832CFEC58E92CD5B38 SUPRIMIRMOSED
913,022,341 *5F0777992A4317524C75AED095CED7C0E3682517 V103213
913,022,342 *5F000FAA6E6495296AC41B3D4EEE354A108139A4 V145678
913,022,343 *5F0286F71267621696832245B1485347383E879D surcaba3
913,022,344 *5F0F432503DED830DBCB9AF26A4C90500BA11A9D [email protected]
913,022,345 *5F0FE897F4E7317FA4BBEEE46ED2FEF2EED3BFC2 SURFERMACHA2
913,022,346 *5F0ACA240BD5BF29DDBFA70309AD156549011368 val!date$
913,022,347 *5F0B3703BACCFCB11EC35FFF2EC5BBA0C695B0ED SVISUJOS
913,022,348 *5F05F36A9FE1AB3796C86213B5569D84DE8E8988 VALERIE PENNINGS SLINGERLAND
913,022,349 *5F0FD9D44C5E343AAF7E18B70B02B935FDC5BAC8 SYGEMELDER7
913,022,350 *5F0E76E40A0BBCAD7B4404531116D22FD746EB1C SZASZKEWYCZA
913,022,351 *5F0B94770EE6B761179F372AADF6F09786B049B4 „SZENZÁCIÓS
913,022,352 *5F0CA51F8356ED7E6307DA6933439F38968C19B4 SЪMYSLĘŠTE
913,022,353 *5F00DB43ACCB87CDC12BD4B7859347208CF4D71D TABUISERINGA0
913,022,354 *5F002DEC94BAAAA81F7963F89AFC74D22F7B05BD VELEPOSLANICU
913,022,355 *5F0E65377F69476709E33581FE4507B3A739B5C9 TALKWHOOLIGAN
913,022,356 *5F0CFB3603140C61B8151FB7961D975B749C5D11 TALOLLA9
913,022,357 *5F014E39145E9CB1CD4A6B726B6A096F46B65C98 [email protected]
913,022,358 *5F0715D336FF278FC018D3311F6B4E377818DBAC tapauth
913,022,359 *5F0648C81A25F2B76319017F6F278DE54842F8C5 VINCENTCLAPPER
913,022,360 *5F09DF4236E7C574BF6212F89A717D60FB20A04E VINCENTCOWLES
913,022,361 *5F0E6CDF518829354C60845C59F97832981147D5 teejlab5
913,022,362 *5F034F5CCED3F6DC8F88199378C355A3034E53B1 TELESCOPECHEVALS
913,022,363 *5F0C3A2D209B7D33E46978695107AAC6C9220030 templatepdselfvi
913,022,364 *5F0A00BBF80105612DE7C49EC3AA8A5EC1738292 TEMPLERĮ
913,022,365 *5F0E3F7BD71D21F1431B89B9ABFDEE85ED5A2396 VITRUVE
913,022,366 *5F04D29C82390414F6A0AAA62E519F569E11603A TERRENCE.MORETTI
913,022,367 *5F08DD5B04D8E3FDF426D372483D5C6F3C516B97 VOIGTLÄNDISCHEN
913,022,368 *5F0124A15BDC78FAAF5DB602BD79BA72B04DD91E t?eu
913,022,369 *5F0E68742986D4881B0933A190D318327EE89BAA THAI HUY NGUYEN
913,022,370 *5F0FFEDA289EACF424797C62AA552423298B7846 THAJUL
913,022,371 *5F0FC1F7E67D8C9168F141B12CC446CB4EECF0A3 WALTER CUCHINE
913,022,372 *5F0E72ADB1CE6EC248BF0A0F3B59298E0805386C THEOPHORIC
913,022,373 *5F044CF7AAD6A6190DDC8C1BD73BA3000A5561F5 THOMASBARBUR
913,022,374 *5F087B75F9A33065948ADEC662C41973269DB28D [email protected]
913,022,375 *5F00C9E71046A285761074B1111912CA27B64279 THURMAN.DEVAI
913,022,376 *5F0AD26107622BEB5BF8A62A692342584E6159C4 THURMAN.LITEHISER
913,022,377 *5F05D300C1591A052C92AD9F5B85C5A19CB1C118 TIACOM
913,022,378 *5F03BEF3583D169969E2588216468B8C37E2DBD5 [email protected]
913,022,379 *5F05A5C0398660799DBE478FDC47A5B8B617C3E3 [email protected]
913,022,380 *5F0EB384A277DFA616599F635F25AEE5E4116ABE TIGGERIMAGE3
913,022,381 *5F05157C371E6F1B6AE0A139DB4C057DB57C79C3 tihhon
913,022,382 *5F05289E4C5D4FFEF8C955E323703071C7A47FF9 WELLNOWYOUKNOW.
913,022,383 *5F04837B22D8C4E3BABD42DD7661B8F2E9824A6A WENDY-BRAZIER-GODWIN
913,022,384 *5F0FB0798EF2BA275593C834696EE09154F0FA04 [email protected]
913,022,385 *5F0ECD934434CA0A3C40ACDE7D8A19B7D4F7A900 [email protected]
913,022,386 *5F0D506B43E283602428627A45A9E166E97E7065 WERNERCLUESMAN
913,022,387 *5F03D3E6C48F37AD9E9F8D4DAD3C79CB851D453E wernerjohannes
913,022,388 *5F06A9A97526B3CD66BD9FCCF13EFBB2393E8E3D whale2420
913,022,389 *5F024396B59076CB35AD89B8E4635B8AEBFFC2DE wiedfeld
913,022,390 *5F083E4C397025D455B3551AB379080A961C953D TONYNASSEFF
913,022,391 *5F0B4A679F40E1BB1E8FBEC5F5B90547D90E12AE williamscatergoodmeister
913,022,392 *5F033AAD0670EED295FF2FD56EF3D99A1E854B61 WILLIAMSMARIO
913,022,393 *5F0A2ED154299C38E33533A1AEE7AED22948D778 william-tegtmeyer
913,022,394 *5F0B6D71000DDB73573B21F4CB98A710281523CC track.4.-.slides.337-346
913,022,395 *5F06623EB7C24AC4EA83143D853F4D60D39CE3FD WINOANGARA
913,022,396 *5F0A9D97643E2EDB08A45F2B0E9215EE31C9D76C WITTHOLZ5
913,022,397 *5F0ED6D1468460756C83928F7B03ADB922BDE609 TREVON-FUBLER
913,022,398 *5F0AB9D6EB48EAFF9785BFE723FBA40CCC2C7B74 TREVOR-STEADMAN
913,022,399 *5F0BAE2E3F653F72B1B25C6957932FE3D348C2A8 TREY.DILIBERO
913,022,400 *5F06CAC28F8A9AED18AC66AC43925D252A7F6432 TRIBE_OF_DAN_-_SHOOK
913,022,401 *5F0BE0B87DF2F485442F504BB9845569989EC5B8 woo11yb3
913,022,402 *5F07A2B50531173ED3241911B350097E565B9536 woodrowmikula
913,022,403 *5F0479D87D1FCFD6366DEDAFAB6F2BB072028C2A trishamcausland
913,022,404 *5F0A750C25871C47946A21D4DD6E5FE9BB64DCF9 TRISTAN-TIGERTAIL
913,022,405 *5F0836A40EC309D741213F95D5029F77DFF0527C triteancornel
913,022,406 *5F06551E5D3DAD82CD948CA65413D04416D38A92 TROSSEE
913,022,407 *5F0A178325330C98F733A153B5752F72DB3C8BA7 TROYSAWATZKY
913,022,408 *5F0B78154054065A56CB3EEA12CC73274CFB79B6 [email protected]
913,022,409 *5F09D5943C4599C746C6AE881D8B78F16A390280 WWWHARMONYLIGHTINGCOM
913,022,410 *5F08C7D0A4425750FB0AE3529644C6012629F2A5 wwwsocsciresearchcom
913,022,411 *5F0765ACA46746293A077F6794C206D6ECF6170B TWEED.TW/I/D
913,022,412 *5F0DCA1C2D03E13A44D9AC594F296D16D6109A5F xanthoco7
913,022,413 *5F0B6621DFF2DEE69F23474042D9359F9210CB1B xcabsvsriddler&headcrush
913,022,414 *5F069CC3C2BE2AE8F305E2467101C2589468D074 tyrellabrego
913,022,415 *5F0BEB1E1322E49CC583DE5A2293D20BB1622ABF [email protected]
913,022,416 *5F031F42EF5F39120019A30F840B30EF970B1DDA [email protected]
913,022,417 *5F0C7366B3B504278EE82FE031A6A588C930497B U2R2H-DOCUMENTS.BLOGSPOT.COMU2R2H-DOCUMENTS
913,022,418 *5F06877BC17D4868DF6DAEE0EB49B245E7D6A5D4 U70891
913,022,419 *5F07E2E6C847A661DF7102E45BBA819CB9D49B44 UBAH CHINENYE PRECIOUS
913,022,420 *5F0777593B8B3FDDD13D21522E84FD91D17D2C3D UDNYTTER6
913,022,421 *5F07D38836C5AAA4E76C672BCF18850722D1C007 XY IKON LELAKI BERITA HARIAN
913,022,422 *5F058AE4DF46B8CE7ADDA8C498BFE6AC3EB1BE55 XYNG
913,022,423 *5F0F20D4A9F7751A0DCD028606AFB3F30AB35652 UND.WER.NOCH.IMMER.DENKT.......HAT.DOCH.NICHTS.VERSTANDEN
913,022,424 *5F0F45349EDD22D736F017E8D22E4CDDE2FEDF73 [email protected]
913,022,425 *5F0FA4B44A0564714FF2CBD256EA26520430C5E5 YEGULALPPED
913,022,426 *5F0CB41C31959D65E691ACB1BE3416C1872BF28C YEOMALTTALKCAMPOREET
913,022,427 *5F03CCABD861E157A9AC94494D857CFFFEE75B90 yogita.subba
913,022,428 *5F05DFDF275EDD17AE2E1348E55E2E9319FB46B0 YOU BE THE ACTOR
913,022,429 *5F0C13B6F4CF3625288A262ED7049F2F197105FF vale5
913,022,430 *5F0B6F851DE5B9A9DBD5FB082A8B60D6D8C96A0C valentinureno
913,022,431 *5F0A7C22E1FF2D98B4B53957B62239B4EB312BE0 ZACHARIAHWADUSKY
913,022,432 *5F02594E146BFA1B59C983BB7FE8CDFF3D1C195B ZACH-ZIMPFER
913,022,433 *5F09813999DC05ABD4369E424110080A62AF262A VANILLANORMAN9
913,022,434 *5F0C0F63F7AAD4A76DC9B46853CF66E95D5DF4AF ZADUZO
913,022,435 *5F0C8B50380FCA16099B9A9E5367177D89BAC8C3 [email protected]
913,022,436 *5F0648CB491E6E3E71F61D74C0C9D90955846A77 ZCSCUZRW8
913,022,437 *5F0ABE0B3E1B7A418CB46D4933455330064C1FF7 ZDK!
913,022,438 *5F0DE1FD45882CEE0E09148CE87E64F4D0C90607 vemizafarhania
913,022,439 *5F0C3693B156594B9BA8333E62B50A31310F1638 [email protected]
913,022,440 *5F02EED395A3416BBEAF60AC5C3796CBFB70FE31 VERMALEN!
913,022,441 *5F0E5E71383BD032163182B3CC72174FFADD0A4B [email protected]
913,022,442 *5F02337406DD827E019A5A3AF4A7D2FB921634BF [email protected]
913,022,443 *5F0B0C03DE78A8679741D7231E954B792377E25B [email protected]
913,022,444 *5F0B0592298AC672CD78B7175D90D5CD87065AC1 ZHU-SUIMEI
913,022,445 *5F01EE3AC93981A66A954FF0B6C9E341F3BC6902 vicky-belair
913,022,446 *5F0389628EACDB63857799F337CFE4B66A0B310B ZINANDINEZ
913,022,447 *5F0E86C659E0F0B73DFF9899D00DA6A824A0D5A1 ZIPFEL20
913,022,448 *5F02C718CAF5771C75E7D085ED1DCF4F1E39C196 [email protected]
913,022,449 *5F08C5A1EC89DA7AC0BB7A75FECE488EBE548F9B ZOBA.ADAM
913,022,450 *5F071E7A8E3D60D46E75CC63416AC9693DCB0B21 ZÖTYKÖLŐDÖTT
913,022,451 *5F08E957537F42E5B6E447382D69AB1C7B5FBFA4 VINCENTGAUGUIN
913,022,452 *5F0A00A85E83BD4473F2A929C74AC47794A740B5 [email protected]
913,022,453 *5F026C1DA7FDA5E1362F7F87203CF2B8EB150312 VINCOOL
913,022,454 *5F067B036DD80F9BE6C4E5AC04B702A1A5D5079F VIRTUALHOSTING
913,022,455 *5F0482CE9E413A42E8B88ECCBAD3B241FC172686 voeging9
913,022,456 *5F076AA37B9F58533D9DA68461047B3422797053 vr。ドラッグで移動、シフトキーでズームイン、コントロールキーでズームアウトする写真)
913,022,457 *5F06331B091EAC36450BA947631820DA88AF76B8 грофицата
913,022,458 *5F0336258B80612DCB9F8AFE138453BC02549F65 «иллюзии»
913,022,459 *5F050436B6C5F757A9E61402543A3DE71BDC523F waitething
913,022,460 *5F0EF056C88F4ECB1F235DD71A20FE6BC879AC04 WALDO.PHELPS
913,022,461 *5F016A9F7A12993582252A3ED4F88178344B27F9 МОНТОНЕРО
913,022,462 *5F0A0DEB063C823757E5D9ED76B8C0C427B4663D walkerbishop
913,022,463 *5F0A3A98C038B0295D54BCE7957673D51AED555D WALLYHUDNUT
913,022,464 *5F0EC11B74A765924F84FED3C48D535B3BE199ED ПEЗАРО
913,022,465 *5F033821990C46D14D3F6A7A6BFFB5B134DB6622 [email protected]
913,022,466 *5F0C1CC643A5ABA78BEDC982F66CFD6A2B02005E профiлактика
913,022,467 *5F07D7B2ABB0E0AE686E43AEB11B0C2297646192 УМОВЛЯЮЧИ
913,022,468 *5F044085FEBBFDDB56A5D099CA081095FC96D7CA WATERS.EDGE.INN
913,022,469 *5F0EBDEF41E4F8B309334E311B403C5E23F0A718 WAYNE CATES
913,022,470 *5F03AF8A06179AF76D9C1B014BC9F34FC4AF8D03 ЭЛЕКТРОФИЦИРОВАН
913,022,471 *5F010F509291B43B826DF1AA424BACC8FCAE1D1E ЯЩУК
913,022,472 *5F02BC54959386AB6E42254A825DC91D6995E448 wendellploch
913,022,473 *5F09E12ECBF4E3C5ED63F55AAD4A69A7148456B0 [email protected]
913,022,474 *5F0035AD8F8852D1EC4AF43C2CACF7D9E6FA74B6 [email protected]
913,022,475 *5F0BC019EBDA96A1B945EF8BF9B8424CFF92D6F4 wilburnbraucher
913,022,476 *5F04801945EE8538095A22D320FD75933E18B882 WILFRED.LAFLIN
913,022,477 *5F03EECA18BF528ABD7C15CFF21A515BED088C0A WILLIAMESTOPADO
913,022,478 *5F0AF8E538CE7E964BCD7EB6ED66492D7DB96888 WILLIAMS.RAINIER
913,022,479 *5F028ECFDA5874B009B74EBD771F15FDF186715F WILLIAMTASCA
913,022,480 *5F08A47E3D448D1C9C8621F0108E2BE021197FD6 WILL.VILLAQUIRAN
913,022,481 *5F0485F852FA11BF162410DC69DC74AC05F3D8F6 windbeut4
913,022,482 *5F07431B2813747B792889FEC5B763FFAB55293E WMRFOQY4
913,022,483 *5F0805ECF0705C51FD89B072FBCDE2D4E3F86840 wmsoans
913,022,484 *5F06C241F59138CDAD75C4FA9B01D1B2301E27CB WUHONGWAN
913,022,485 *5F08C38190BA8329D26FA9253C8E5B273DAE7180 [email protected]
913,022,486 *5F0C9EA401A0AEF25EADA395567077062DE8074F XCITING1234
913,022,487 *5F0B5F0483C9BAE95E0F38388167D471BB105728 XEVOLKER7
913,022,488 *5F00FE43CAE23DCEFFEC04BEF15687A3F113487B xg~m
913,022,489 *5F020EBDEBED80AA02593725CB3E5CF624AEAFCD 000nicole
913,022,490 *5F0EFA4B022890B016EF5B3E88B6A024A017B6CD 0GZXK
913,022,491 *5F0323BACB78DB8562BF0B3B20DA3C59BEA4FF18 (-_0).o~0~.(------q
913,022,492 *5F0C20D8649B4C0BB4402633B9E5D879D76498DF yani.sah
913,022,493 *5F0B655260157AE8D700DE9C93DD671802313F12 YANNICBRIAN
913,022,494 *5F08101B498D5DD48B1AFEF139D1C4DA60F3DB6C [email protected]
913,022,495 *5F0E42216F3574653BB08D6694ECE5F274845D33 1060068 solche.saetze.sind.werbealltag.in.deutschland..
913,022,496 *5F0A7DB9CAE3E8248F298E4AFFC8C4EC248D4154 YASAMAL-GOON
913,022,497 *5F0684519EC92589D0AEF14B6943F4AAA56E0279 yasemen-lyubrick
913,022,498 *5F09C5DB69C7CF9F2B0B176CD46BDCCCDC64E6C3 1123413 muutama-viikko-kuluikin-siin
913,022,499 *5F03391EC2D3C7453DD1DC6946006134BEC6F2B9 yejcrfving
913,022,500 *5F02B39517B34CEF937EABF381C2A1E3C449E824 YICHEN ZHAI
913,022,501 *5F09060D4F11EFDAEDDFFF1565FB6D0DC2CDD87B 12ATG3
913,022,502 *5F06942D18F3157486C03355739C869D3450BFB2 [email protected]
913,022,503 *5F01E5A3A247015D0A46387E50122A395FC1DD53 141KASEY
913,022,504 *5F08B4B3FFC7AF622CC67A5060B57BC60BD77541 YOLANDA COLLINS STEELE
913,022,505 *5F0FB9C2DF84F89650E4FB38595634E8836BD7B3 YOMGANETSANA
913,022,506 *5F0BC08AFBC7A379EDE42A4F988DEF46562ECD32 you'remyoasis(extendedmix)
913,022,507 *5F09E1DDF9CF29E8FDE08FF85A3079F0DEEB76EE YS2
913,022,508 *5F07AE9E519CC5B6C0F633E7DF9C1EACDC0D702A 19.12.1540K
913,022,509 *5F0E7219B416F5B3C4CE3B20B6A8B2FBCE188C54 19860816:PerformingArtsCenter,Milwaukee,WI,USA
913,022,510 *5F0ADF212049B93FD15559089407BB1492584D50 1 alfaktionen
913,022,511 *5F0C19481CA165BBD8E956073561EF862A2106E0 ZACHARIAH.LONSWAY
913,022,512 *5F0638EF9C336B9D61AC21256E31EC4AB6444227 ZACHARIAHSTIELY
913,022,513 *5F0D9A9F2BBA32876541A82BBFDD67F22154CB05 1.CHERNENKO
913,022,514 *5F0A9181E886748C40E79395F2EB20CAD5B2FCC5 ZAGORJETI8
913,022,515 *5F0A9FECC7612BA5534EC3E5CE3C7647CD17FBF2 1DUD-THE
913,022,516 *5F0811130C6B31C8C3574785C625752C11317A5C ZALLERRELLAZES
913,022,517 *5F0379DA725C7CDE65EAA45E36E947305714A1AF Zamagli
913,022,518 *5F08A72F65962920FC66C90F82DC4E151AF36D3A 1 ENERGIEGEWINNUNGSANLAGEN
913,022,519 *5F08BFA4FD63AE21A855BACDEFD04AB232EEF57B [email protected]
913,022,520 *5F0E5E515F534DBB62E8B871B18211BBD63A16EB [email protected]
913,022,521 *5F0F2714D62D9AFFD710B48CF44D67E021B57E91 1GYLLINGA
913,022,522 *5F0A8394A9F0775AB1E2AEC454CCD370F46F70A2 1-heinz-firmenzentrale
913,022,523 *5F0C1459A10E48F5FD5D43B418D55B1CE7B92065 1ILOVEPIANO11
913,022,524 *5F0CCFD9887A4440B1655F2A771993B462F4B101 [email protected]
913,022,525 *5F0CC0ECFDC72C0FA99DD1731DB168149717CC14 [email protected]
913,022,526 *5F0FA53B85BBA34B559B550C293F791EFB6DD659 1.JEALOUSYTINGED
913,022,527 *5F07BE3D317C825038AEDF0BBCD1E432A98D0FE8 1.kinsgton
913,022,528 *5F0CED5ED80F2CCEEBE09D92CEADA848DBC809A2 [email protected]
913,022,529 *5F01D295AA774137A6D7597C649605F6EBB0742E [email protected]
913,022,530 *5F050318D42AEC62C3182BE899A083A9FDE4D146 ziekow
913,022,531 *5F0C43BF7EA6B1E5423E6488E058499A39A615B3 1mosima
913,022,532 *5F09EC3DEC12EC76399844AA22B507FE90A2ABD1 1.PLAYBOY-LEBEN
913,022,533 *5F0981E8A8F5C10DF8D136E5CEA1BC53B22DAC68 1 profisportlerin
913,022,534 *5F05C6F2B921D0EC9CEADDD894D7B6F618CF684B 1.rosedale's
913,022,535 *5F00B9D421449A403A189634D3D50D1B9BBA05F6 1-schlagmuehle
913,022,536 *5F0DA0CBFF5D44F057092ECC9BE689FB8703C5CA [email protected]
913,022,537 *5F09168A9F6FDF3C6666FA90C4C55C8F3C650243 1-STUNTTI-IDEOITA
913,022,538 *5F0BDF6761C94FCB20C534C3735B0225244C1A4B μοτύησ
913,022,539 *5F04F68943988237F82F56E886E7E972A606224B 1.umbau-planung
913,022,540 *5F06A6D04A89E9D286E05F3F2EF70338465A7E6C 1-WHITBREAD-KOKEMUSTAKIN
913,022,541 *5F056D88296DCAE0CFB787CC51168226F0F0A1AA 20011117:irvingplaza,newyork,ny,usa
913,022,542 *5F017F45D7FD0A0ACB36D6EA8820997D5E5F92FA 2027188 PROTZNER.IST.VORSITZENDER.DES.KREISVERBANDES..
913,022,543 *5F0910C095E7C51073D68440316EA829CFB83286 20.kobie
913,022,544 *5F0FD6D1ACFCF68F3C15826299825952E1D8D6EB 20THOI
913,022,545 *5F0413C00F3FAD5976F408A03F2817D4827FCF8A КĚНĚ
913,022,546 *5F07EF7E6D01DFCE298F8CEF2A30AE9377744EE8 «КАПЕЛЬНЫЕ
913,022,547 *5F0A96FD47B2A49D2C82133B098ACEE6465514D6 21.SED-GENOSSEN
913,022,548 *5F0A90B82B916A6D7274262E4D14158D58207B87 2286804 das urteil soll kommende woche freitag ergehen
913,022,549 *5F04B7F1FF42B0EAF1DD8DF74D30EC4941270EA3 «майоль»
913,022,550 *5F0A00E83D49CCA964124D54342621F990F2A028 2781396 nachfolgeoffergeldserwartetloerrach.
913,022,551 *5F064F22BF0A3C29B8B639BB28D1CD8587BC0EC5 2790589 VUONNA.1997.YHTEISTY
913,022,552 *5F0A8C7A62F276C86C3D33A1CC0EBB6C9CA4B8C3 27aug1849
913,022,553 *5F049DDD0E444B307A42F002EEEE5499350BFB62 2978314 MIR IST GANZ SCHLECHT GEWORDEN . "
913,022,554 *5F0D078BC0E52712AA7A2AD2A5190D2456BDFFE2 2ALPDRUECKEN
913,022,555 *5F03AC4A9AAAB6CC454A478421CF8222B7F51738 „умницы
913,022,556 *5F0809B5B4CAB0D5972D1D98D173DE1015B03BA6 2EDMUNDN
913,022,557 *5F0BA9FCA514B50A4F06300A86B36412175EEFCE 2FCAVALLASCA
913,022,558 *5F0E54F11AE5468F5221DDED6A2126E20D3066FD 二見書房、1982年、ISBN
913,022,559 *5F0883EDBE9CDE7C75858A46EC8AB6DF2B192472 2QSTEVER
913,022,560 *5F0DC18EBFC5033A95126A5226006CAFC8FCB69E 《少数民族地名汉语拼音字母音译转写法》DECREED
913,022,561 *5F0FF78832E5B1A5E3ABC5323EDE9A2A967E11BB 2SCHKPLN
913,022,562 *5F09C5841FBAEF734E8EE13D28792E994941B956 2.taloushallintosovellus
913,022,563 *5F0B40B2A6B097911FEFA4D10D4375D99C483E2C 2 TEILSTREITKRAFTUEBERGREIFENDE
913,022,564 *5F084E5765A1C306DCB54E5185FBF65C0D4D6C08 2turvautumisessa
913,022,565 *5F0DC0087FE30A4F3D10A1B4A1F0E4B90B26AE2F のコンセプトは“架空のファンキータウン”、テーマはcmの演出内容とリンクした“キラキラ”。ダンスシーンは勿論、ゴールドの
913,022,566 *5F064298B2057B754551D55CF2C2DA43D9D06FFF 3aganbff
913,022,567 *5F0774DBA347E41E6A397DDF3D5DC39700303F4C 3ELLIURAV
913,022,568 *5F0CB8B9834D07F3AB1F2D67588B657E0A81DEB5 3iltap
913,022,569 *5F0672C8DA473951B8499C94C30733E9119F6555 0000/LD
913,022,570 *5F06415776A2A774D38BEF67CC534E8B17B4539E 3.MANICHAEISCHEN
913,022,571 *5F0A7291458929D54CC1C1A2E059B61D695CAB32 3=====>~-O->-<
913,022,572 *5F09E8CC88C6847EDED10FA758FE513196FBBEFC 013MONIQUE
913,022,573 *5F06A4B62B921A0766A4FC8D6DE2F353B5F67CB0 02.11.1504
913,022,574 *5F056B4EE7C5166FF0C390E1F18A58264B78DC68 06/abril/1986
913,022,575 *5F0098B6854536E867CD9954A6A81DFFD0EA6919 0ILUVPLANET
913,022,576 *5F007A1F8ECA08CFA3462EBB1954C1D46D0A6968 4291935
913,022,577 *5F0114D6273AED82A45B09A39C8FED9D78DC9453 1095766 pollicinomusical,19uhr
913,022,578 *5F0ED3D2C283E3516F4F8196C7BD842ADAC08935 10-JAHRESABRECHNUNG
913,022,579 *5F0D9DF30D7FEE7A12B77919D007B5A6FF99FB64 10.kuntoutuspalveluista
913,022,580 *5F0C55CB9E8AF63FF93318C8CC69E043E15FB97F 10-wahlfach
913,022,581 *5F073DDCC193487CA9F190A5A69EE5875D1B219C 1112010 liedon-kunta-ei-saa-pensseliss
913,022,582 *5F0C517DE4872122F4F0C906D557F65CEA250CEA 49 DEPARDIEU
913,022,583 *5F0D7F68F483A8D73126217808C257BE3BAD5ADA 4.BLUTUNDBODEN
913,022,584 *5F079996CC923507995F5E41FE9FD4B494A189BD 11M1+EDNE55
913,022,585 *5F085217961BDC5EFE144E53AA0FABBAAE45C633 145595 ANIHATBALCI,PROFDR
913,022,586 *5F0D639EA57E3A4912BDE8DE3AB43CF51BE37BCD 4NMDFBLTY
913,022,587 *5F0E10E4F29BAFE60A0A729A7270553252EAC407 4potenssimerkinn
913,022,588 *5F01617D7C04A089600DBA284CF2BE625B4B0532 1674670 FEW-DUCKLINGS-HATCHED-IN-THE-SPRING-
913,022,589 *5F08617E1BBC6748F38150188538636C79C39FD0 1753502 HE'D NEVER THOUGHT ABOUT IT BEFORE .
913,022,590 *5F09AED9EA5327BC7CACE3F263BD8C9999CD081C 1964Z
913,022,591 *5F0CFF381B52608EF0546EDF7D84A00667810ACC 505258 aslIhanecepakOzmim
913,022,592 *5F09CA14A77EF665B32E5059645ED9041DB8F7AA 53907426claudia
913,022,593 *5F0CCE44C4B247FFFF4778D211814B6A6310B612 1BILDSCHIRM-HANDELSSYSTEM
913,022,594 *5F0BA79B8FEA8E86711A79BDE5A29FA9A8E28A77 57070 ENNALTA EHK
913,022,595 *5F055A6F9EC1E3B303D361D4E2DA1742450B17AF 576SOFIA
913,022,596 *5F0C100538EE46AA2E3BDA8CD8B5AD31FA559562 5ADGSTINKY
913,022,597 *5F018F4F723259D60C1B4E9DD082BA8EA4E7F021 5 AGRIBUSINESSES
913,022,598 *5F013DF8459D14EBA26F9792EDC47E9D93186A66 1consisterions
913,022,599 *5F0DF346FC82E898391FB861A99194F4350168D3 1GINLUK
913,022,600 *5F01513CA1389BC5B09CED111C93D9F7930E92A6 1.GROSSAEUGIGES
913,022,601 *5F0C86103F64447E2E3F47CDD8DCBB5ED841C437 5ENERGYPOMME
913,022,602 *5F03CC0204A66EBD3AFB7F2851D1C66ADD4FE10C 5INESPLICATO
913,022,603 *5F090EA6FFFC76B0E468C05057EDC0BD19A20D53 5KI11FU1NE55
913,022,604 *5F0B76D38B00BFBE4B8D2D92DA5FE872386E6016 1.KONSTRUKTIONSGEHEIMNIS
913,022,605 *5F00C5086907D9D149EAEBCFC37B55D90AAF1246 1kontrollsucht
913,022,606 *5F035278084C423133FBF8A811D052BD01E76A75 5MEMPHISCORONA
913,022,607 *5F0B22DF19B059292D14DA90DD192A9AC30C1AAB 1-LUOTSIALUKSEKSI
913,022,608 *5F0967698A338B407D36933AF9A592BBB4373369 1 MITUSVAIKUTUSTA
913,022,609 *5F0230C01FC9A65ECCC5F69E755A8C5CE2CE4A65 1MOLOTCH
913,022,610 *5F08326D2C6012D3C805C0AA3AC02EC0CDC91075 1-NEUVOTTELU-JA
913,022,611 *5F08F3DF61CD73A7F50C7C47ED1B7C4AABE2B6A3 5RUBYTHUNDER
913,022,612 *5F04B039DDD5E4B03C1FBEBA0E15D058F9F1E433 1PANKKIPAPERIT
913,022,613 *5F0D726719FF73A485FC102947A9150CE75A01C5 5STRAWBERFIRE
913,022,614 *5F010BBF2BC4A601FB6AC999833BADD2809E88DC 1 PRTY
913,022,615 *5F018D31DD258F2C54E594E810D234F68BE7FC0E 1 SAMMUTUSTEHT
913,022,616 *5F0AF39F273AC71A97E62B50B090067FDCDAEB44 [email protected]
913,022,617 *5F0C11FAB9E86D70BF3396851F0E74F83E31AFA8 1SINANOT
913,022,618 *5F09DF38FA0184760E522967BC69E5E18AFBBE3A 607miriam
913,022,619 *5F0092FDE90817D5B5AA2905CB93DFD11BEA597D 1THEDUCK3
913,022,620 *5F08D8F2016DD3C1FBEE934DE452574030477935 1thunderbirds-large
913,022,621 *5F057AA5855441802C4F2C48578F7AF88F79827A 1-UNVERHAELTNISSMAESSIGER
913,022,622 *5F02BC90029A0F6B0BBAF2D6C6144257616C550D 6BSWORIGANLLYBSW
913,022,623 *5F0D123FCC75C36B7B0AC340D68A989BC0C84F66 6COMBLOCK
913,022,624 *5F06DA4E3CA9881A09D311B1A432EBAF6F4DBD6C 1.WINTERWETTBEWERBE
913,022,625 *5F07186D50481ADE6768FCD79D2DF544647BB636 6DTAHCAELHCAELEMAN
913,022,626 *5F02DC858C4F0F32E3C33F0751648DF46A2440D2 2005年,巴特勒演出改編自真實故事的電影《THE
913,022,627 *5F044E44BA4A3DE76E8B859E4E6810FF9815B111 2040693 TULLISSAVOITULLAYLL
913,022,628 *5F03D43A23582D600EA5082FB5020EEA12BA5D4D 2236212 AINOASTAAN-IHMINEN-ON-UHANNUT-SEN-ELOA-.
913,022,629 *5F0425D4A8F1B84DBDA45251ECF40AACE356AA40 6PATIENCEBSW
913,022,630 *5F07CDE08BD346D90B444482F06F28268C9169A6 6PIANISBSW
913,022,631 *5F07F19A381DDD3988DB93487A0B522CABEC3FDB 2349693 VANHUSTENHUOLLONLUKEMATTOMISTATEHT
913,022,632 *5F0098B2F8884FA180E6CF25921265551D0F8C0E 24preludesandfugues,op.87:no.7inamajor
913,022,633 *5F0454F5B7DD919A734398E7279BDAF3520669D4 26078 erspuerte,wennweltgeschichtesichereignenwollte
913,022,634 *5F03233DC3CA2392AC80A1CBEFA8644F6B68D1CE 26kirjailijasta
913,022,635 *5F0E01C6B9B67FA16B5E265355A75A5152F9D991 7AMANDAZIGGY
913,022,636 *5F0944E31EC9CA8D66FC4622A296D8558B24F635 7BOSSPARTY
913,022,637 *5F053736092F3FB1FF19230029D0FBEABCC29256 7BREIFLY
913,022,638 *5F0B5D299DA23CF799DD8655C3E2A018E31358B1 7BRIGADIAR
913,022,639 *5F0E114FD9748F065938D6ADBF0F41912E26D574 7DEBYYTTISUORITUKSEST
913,022,640 *5F02648F7B424BB94D656F7D717A9B52CFFAAD04 7ESOGALP
913,022,641 *5F08A53D36C4FE443EC709316CB969D81AEC41BF 2.CIBA-COMMUNIQU
913,022,642 *5F0BE03D7466CFD559D1D4112A79BA604374EC36 2.derhubschrauber
913,022,643 *5F0D5D2CFB30DC4D07923E656AB914D295611CD4 7HALFCONCEALED
913,022,644 *5F0742C7E869457A498FDD20249FD7F39ED95D26 2EFONESRA
913,022,645 *5F0CAEB0B852B023DA98DDF10C8943BD77D0F835 2-lajitovereita
913,022,646 *5F059E217CE2F063D4FA5B538816FC6138FBF15B 2-PIRKKALAN-H
913,022,647 *5F0B4DC17B32EFAD546907BBDAB2E2F7EC34845A 2REMPELT
913,022,648 *5F07CDDA7F43A945CCC7DDD6842487513DF0B522 7RITISTIN
913,022,649 *5F06DE32E2E399BB4A9087764FE6FC8A60228177 2seilasivat
913,022,650 *5F052F8427D3E47D29FDAEA1999C5C14EC302894 7SHOALEDS
913,022,651 *5F0E73129D4DA41938B777BF70815F64E9BE6A67 2-TV-KLASSIKER
913,022,652 *5F03D083A79CB077AC8C1FAA25340E7493B08BDB 30-kampanyasInI
913,022,653 *5F084B0396F8E847220BB2F65C9B7FBB8E19C360 7ZKAMENT
913,022,654 *5F040282F9D3D0EB2572B7264C6DF323D7119A5D 38HIRINI
913,022,655 *5F0406AA389DA3F1C06662F132599DAD3DD2CD30 3ANGELA1
913,022,656 *5F0A4DB120368FF6956DBDEA31D8F7E0D8014CC3 8===D.~0.~o><
913,022,657 *5F052D09523055DEF8C81843B63DF783D022D6C0 3FELDKUECHEN
913,022,658 *5F06067634AD145154994D9B2D7DFC91EF8F8444 3GOUINLOBI
913,022,659 *5F077C5C9835B4DC5876D8F8B9A05A77DCEF6F3B 3 k
913,022,660 *5F0FB0D29DDC8C7D50C2BA089E454206B7945063 8ilovepat2
913,022,661 *5F08B5CDF87A99AAB00DE4380A897D180FC007DF 3.STUDENTS-INCLUDING
913,022,662 *5F0ACC9BD52AF8971218ADB95E6BB100E6E3A852 8NESSIRATON
913,022,663 *5F04C9BA68DE1B7E6418BCE90599B4F2B697C49B 8NINIZAR
913,022,664 *5F093ECC8E73ABE738479EE12CDC4E8A9D06F284 3VIESTINT
913,022,665 *5F07387B643B8E658AA7A4B9F9CE035D052D0155 421054 SONUCLAR-DEKANLIKCA-DUYURULUR-.
913,022,666 *5F0030715FB6C3BA17E77FEBE81D19999307EF52 434204 MUTTA NYT KUN OLEMME SELVINNEET HENGISS
913,022,667 *5F009DC60E1D68A01670EE0CDD155480C99D5F01 8POJEDINCEM
913,022,668 *5F0D8FA55025453A893AB02DB14451EED84EF959 8-----p~o }o{
913,022,669 *5F0D54C46F80F4F87CB8E9DBE2E88709DBF76D44 8RFFASKAS
913,022,670 *5F0816D4E5DACA8D05A737C2DC9664434CD9F4EA 8SRELWOCS
913,022,671 *5F0120C50A70CE652175F7F3FBCA97B730E46310 8TTHNMTR
913,022,672 *5F07F26A545ECBF6DB270CD3F855B36B2ADDBBEB 4HYSTEROLITHIA
913,022,673 *5F018F305DEE174F117518BAE820AEBC0C13CFB8 8WITTERUNGSVERH
913,022,674 *5F0E9B2EB8853BA36EB849A2114CEBA502346580 940317 TURK-ARKEOLOJI-BELGESELLERININ-ILKLERINDEN-.
913,022,675 *5F04E582EA65BC18B8F0BADEB49F239212073C85 943067 yine-bu-yIllarda-
913,022,676 *5F0221EBD6C0F615030C8C39375ED340CA5A37FF 95-100hz
913,022,677 *5F04C68F92FFF7EB7152C694490B9F9A2A3D8F5C 4NAJATRUM
913,022,678 *5F048EC7EC68CACD6D576E28A4D21B2D831B4FCB 9CAMAROMEXICO
913,022,679 *5F0398FFE48FE753FF9D9C33A09111FCC2F5C5AB 9CHLOEPLAY
913,022,680 *5F04B2CE44EBF383A0CB5E9D38434CF9E530DD85 4REGENBILLEDE
913,022,681 *5F0ABC29DBCD54AAC265452494C657EFDE7D95A4 4SHEBAVOLLEY
913,022,682 *5F03F34424910F523C2A7CC716F3CD156BB7FB35 9LOCKTHEDOOR
913,022,683 *5F02B3E47DCE5DB23BE3ECD604E476706078E34B 510338 kontroldatabilgisis.ltd.Sti.
913,022,684 *5F0B68A4A46DF638AED882C400C72EEE58BECF14 9NALITUKL
913,022,685 *5F039BE8B0EE042FC28673729EEF3866543D0B53 9NIHDCRT
913,022,686 *5F0023DF28B8A3DF5B892586341038BDE14CBAFF 9NOTUSEDGABRIEL
913,022,687 *5F07EE0ED9750A34E86E1DE06023DE41755E4A82 567DEXTER
913,022,688 *5F0532A79F44BACAE0499D3C745C0F484860CFD9 9TREPPENWEG
913,022,689 *5F0D57EDB2C7301F00E2576C539B95A10474FF60 5DEHALOPEROXIDASES
913,022,690 *5F01C9BD9ED176FF372863A90411FB566DE26BE4 9VORZUWEISENED
913,022,691 *5F0BE31358906C505E5AB28620A8D588F97789F1 5EARLER
913,022,692 *5F0367CDF303FEDCDF8846BC930BB58005153A5B a.)(
913,022,693 *5F0E8CE8F871D336E5A315A1A3AC2D354E3A8026 5MCQUIRES
913,022,694 *5F0F67BFCD27D5B4DA8F30A0D27C407D9A6E53DA A7GB
913,022,695 *5F0C1F408C0520B18CE5199BE5D0BDB1B1E2A166 5TOMMYRANDOM
913,022,696 *5F037C395294E2945D3948B3F1D35580911AF2AB 5WELVOEGLIJKS
913,022,697 *5F094EF5958F75C9415C056351A5FF59495EF674 612191 repairsaretobedoneatnochargetoowners
913,022,698 *5F085575FA5762667B7A1391EDD1A4228B7C9768 aaa\mf
913,022,699 *5F08B20575806AFB211EBC789E1063A8AB9E497F aab7;(
913,022,700 *5F03F7D77FAD378ACA2F6395A9886F113F4B73D4 AAB(!F
913,022,701 *5F08363D5A2031982C07472FEC483C042710289C 6CONJOUN
913,022,702 *5F0CB1BECB29073D8F9741154B28AC4174FADD01 AADGS6
913,022,703 *5F021797701BEBC956807E1BFA396300900662AC 6deliver7
913,022,704 *5F0F538655EEE07F7B4B7CC676E76C11A63C61C4 6EMECFSQ
913,022,705 *5F0A07C5E3C3916A41B5CE6FED400196C7089012 aae.gv
913,022,706 *5F00C28CBE1856033AA3995D4EE3028A7D74BD71 6GNILETTR
913,022,707 *5F0BF4D25547845FD71EE96F5D922714BE005F7B [email protected]
913,022,708 *5F0D0DA09AD3D77A3B66027D0D77A19990C84918 6KUNSTGEWROCHTENS
913,022,709 *5F011999F25BCFC21E6E9ABF4AD841473D7FFD57 6LABATOS
913,022,710 *5F005C2FEC2186D80FB3E508544B7EDDB4B9472C 6MORRISMONTREAL
913,022,711 *5F05E169ED0F283335608374BBA6E653742DE93C A/%B8
913,022,712 *5F07BBE0DDC77B8EFB8E3E2DFB2D3ABEB5FEC7C3 ab%kq
913,022,713 *5F0E350280C52424B3CC322AD80E0A4DCBB8CBE5 6XENOPHOBIASPITEFUL
913,022,714 *5F05C025943540392FBD00004F4D30FDEA446DB8 6ZEGELKOSTEN
913,022,715 *5F0A63E751C1346BC9D28EF52E688A6BB85EA6D1 AC(MK
913,022,716 *5F08367224A97AAA8BD236F59B43C5C73C343078 acronyms
913,022,717 *5F0C18CD5518D7A6C80C6138180B66B1B3E2B8B1 ACT1-SANTEAMPOLLE!ILSUORITRATTO!
913,022,718 *5F0D9AE3321189829C6C1FE110F53A9AC13E93F6 ADENOKUN GBADE
913,022,719 *5F01DB90790914FCFE92D13A55842E8A052BDE99 7GRIFFEYG
913,022,720 *5F0CCAE2F2CC49B2BA1E7D606D3613A1471CD251 ADNP_
913,022,721 *5F056CAEA46C9FC0DBAE79A63BC734E65B56D1F2 AEP/S
913,022,722 *5F00907799E80D6D04F4A404EE514FEA2C1C9444 7POORAPARAMBU
913,022,723 *5F08AA80F09E65196B02AD3985ACD62AEAEAA717 7PROFDICKHEAD
913,022,724 *5F00C6BABC74F4672DF657B5CE46F8FB6B52D766 7PROTENDENTIBUS
913,022,725 *5F0D29270953AE172B19927B249C2715C49E950C AF_7P
913,022,726 *5F0A56B13B97D1DA56CC3D5E69B2FAFAFED6DB8B afq;7
913,022,727 *5F0D4F2FEEC3C97825A8F2C5380F3DEEA0C946B0 7toegekend
913,022,728 *5F0E36C08EA11FC947E1516536A73A5C91B0077B AGYG:
913,022,729 *5F0DD947928A2E9334E03C3B27434CE39C4BFAC6 ahe
913,022,730 *5F0BC976EEA47FFAB65130B494207AAD1121B7E5 8BSWLDISCBSW
913,022,731 *5F042AD0498D065AB7FFBE77D42D374B11943E82 aih!c
913,022,732 *5F0B5B63F1B08B9B8F8835BE45B547EE19AC0A59 airways12
913,022,733 *5F0F406ECEE7C776BE701AC0F7E44543192FAD0C 8DOGGYLADY
913,022,734 *5F016B9B8075B360021DED46D2309A06D4E71CF9 8=====d~-`splat
913,022,735 *5F05D3B87365B96CD28DA6677498D35097D5CF4B AKREW
913,022,736 *5F0B374EC0BDA0C35D66EC5F3B5AF1FE3DB814E4 8MEOLCISCO
913,022,737 *5F0304870FDE629F90E1AB1517EA4D460F73A0E4 8OCTOBERMIMI
913,022,738 *5F0CE4699A762855B223F2A2BAE0AAC78C8F23D5 8##P***SPLAT
913,022,739 *5F09C5A877FD94346F46088FE384FEF21A6B6199 8SISELCIPE
913,022,740 *5F00641295B39D5D303CBED6970DC183AFFF4CDC ALINHARTEIAS1
913,022,741 *5F05207D2EC4821C84255F8DFBF6ADBB1413059D 8STPPRNTS
913,022,742 *5F0F9B5E9C573A0FA8430414D7B6C62B764147E9 ALLBURIED
913,022,743 *5F00E803264887E6ABCF2DF98718AA2D9863FA02 ALLERSYDS2
913,022,744 *5F08E703758D6CF0515B3AB1BD83DFE30AEAFE28 ÂLÔRS
913,022,745 *5F094E6A2BDD4A76ED4BEFD8BF37AC12B3547761 ALOYSINA
913,022,746 *5F09CEFDA0D3A5B742EA72F274DA93BBCEF414B2 920JORDON
913,022,747 *5F0F311D803499DEB5CD00C1984F0EC112E2D8B1 AMBERIŒX
913,022,748 *5F06C82D476D27B1D7C5A9A6B9C3C1DCC2D64A29 9EBIRCSBUS
913,022,749 *5F089FF92ADA140C80F58400895C7DA1EC70E436 am/%g
913,022,750 *5F0E2FD6C4E9E428B9260DFFC5A65E436009B5B5 AMMETER$
913,022,751 *5F020749CDF2518F3E177FCA1D7B9140ABBE0857 9MOCDERBIHPABEKAHASUEKAHHTEB
913,022,752 *5F0221E5BDE7E850C51BB760BCD21B8DA7AC3425 andreashutti
913,022,753 *5F0429B385F70B88178521E72536244327BC7F81 9RULETTER
913,022,754 *5F09810D55D7FB007A7E11D1A322F08064B0A859 angrand
913,022,755 *5F0DF450158676311FB2D8EE9F76D33DD2839B5B [email protected]
913,022,756 *5F0A339FE26BBD06CBBF0444D8116552CEF46130 9TSLAATUR
913,022,757 *5F08D9F19C2B40048DE91640B7E5ABA456F6D702 9 VERREGNET
913,022,758 *5F0DD930494D6F098326BE8BDA3B3F51C1F27F14 a_#/:
913,022,759 *5F0EAB6E70EFF993DE6D706CA4648CE6D54CA5F2 a,0f:
913,022,760 *5F05BF2709C679300B5AAFDC6AEB75EC39FC3326 a11dir
913,022,761 *5F0D42321D77FD80A7B3D78DAE11692DB4BDC878 A2LMI
913,022,762 *5F03E7642D2DF59F599FD7CB81CADE9C6A12412B antwancordon
913,022,763 *5F06EC05161695F7A1CBBFC52DE9E628C9028ADD AO3U5
913,022,764 *5F0D2C69463A75E84DD67D132274AE3F047F27B3 A+OMT
913,022,765 *5F0074573F7A2D1E994FDC5276F2B8AF1E5E3AD8 AAB;<J
913,022,766 *5F0A3BF1877C481426B979B68F97AF618D30D247 ARRONBLUMENSCHEIN
913,022,767 *5F03CF89DCFDC298E9FC5707918E35E10CBDCD3A aaneenvoeg9
913,022,768 *5F0F220D47C4A27EB08E93873286BE1F63FA3147 asdfgqa
913,022,769 *5F0511FA8A0D84551F35F290BCB01FD461854038 "ABEN-HUMEYA":-VILLANCICO
913,022,770 *5F0835726338D6230F51FF0FBEA844A344F9DC87 A:!:T
913,022,771 *5F07EB219137B94BED51B17B5BC08805C0CB8573 atentaban7
913,022,772 *5F094559D99C1E50299506A63610CFEDC21358DC ATF
913,022,773 *5F08FF710E9A9578A75A858046910019EA4ED633 [email protected]
913,022,774 *5F0AF0A36667AF25F270784D4FC813ADA83DFBC3 A.UJD
913,022,775 *5F0613C5AA3CE017AD8ED9CA8FC30C7C11671492 acmqi
913,022,776 *5F02B5320659107939283A52EBCEC98DDD2CDF8E acse4
913,022,777 *5F02F8528D6C6758EEAB4BCE19388F4D92398710 AVC4D
913,022,778 *5F0A8D6792F31DEF704E3BA9886500E59E65F1E5 B0.16365924
913,022,779 *5F0B8EB003C49A713C529B5108B60F352A6F0482 afan:
913,022,780 *5F0348E3351219161AEEEE744824050EBB726AD1 aflii
913,022,781 *5F0B2073F69EB4D1B89E6013994E3DC6034F1EE5 AGUSTINSCHORSCH
913,022,782 *5F067E08D36BCCD09099C3DCE968F1E5940EDBC8 ahe
913,022,783 *5F0FACBADC6A1D64EA9E5EF76B5C5668DEB3C65E bacrm
913,022,784 *5F07857E3F38272DEEA12CA4618CB726B6CF5406 BANDRINATH
913,022,785 *5F099D4CE2CE0DF148492216F8C823D3043DD4FE BARNEY.MAYNER
913,022,786 *5F0AD400FF9BA51FE56C3FB479376D525439D50F BARTDILLOW
913,022,787 *5F0503BA2AF121FC1D75F445509B1A501E06521A ALBIN-DE-VAULSERRE
913,022,788 *5F0D345510776434501F51DD8A2F466FE95EE90B BAUEK
913,022,789 *5F0ED62B6CEE9267809BF2EF7775006605A1CD29 alfonsina-y-el-mar-(feat-lito-vitale)
913,022,790 *5F0E311076E12621948B80AEA17536E0D2D47388 B#BIT
913,022,791 *5F00D2D0B5D490FD4B13684E40EEE45C23A89FBA alj
913,022,792 *5F09CB3EF767854F0EC369546D5F93F9572C5F62 bc+wr
913,022,793 *5F0A4E31C98D54441E33F9BC97362070D8978FB6 ALV64
913,022,794 *5F09D56A0F8797C469138321B2030325F39F8D81 am_i-
913,022,795 *5F0EF21B7C34333FA43EE57F668A92DD98FE5C91 AMPLEXICAUDATED
913,022,796 *5F0F71F540D91A180CBFFE58D46DA44AC3B1DAF3 Beo9
913,022,797 *5F01BC6DEC73AFAF9F1866E613922A930EB3DF13 ANAMARIAPINEDA
913,022,798 *5F06A582DFD7598E7ACA9D107787EC7A83FE0D78 ANDREAFRIGHTEN
913,022,799 *5F0BAF3F177B0AC4931B552C28BADEAA161DFE15 bf6zh
913,022,800 *5F0C5E8677157311B46BCC0D6077F3AFC1C661D6 BFNK
913,022,801 *5F0E6AFD31D0A2397724FEE1818230C089A54727 ANONPOETRY
913,022,802 *5F0FBF3457360970768A79211B26499722E2756B B-HSM
913,022,803 *5F058AE374253240F06896720C66A9BC08239A3B BIELDARES9
913,022,804 *5F0A11392C80635BF5EB0772549C8AE30FF3F2A1 [email protected]
913,022,805 *5F045CF761A48486E6DC42FADD5D2DA228FBB1F4 anywayaussielegend
913,022,806 *5F0F31AE6B3BF751297C3DAC4C29DFE802C1E731 BILOHORIWKA
913,022,807 *5F045F04A21470CDAAA522FF0CFF875F7EAB92B8 AOP99
913,022,808 *5F076848D3B1CCED65C373F0187CF2E6612A817F APANGNIDHI
913,022,809 *5F01C613394BA34118B0CD05154A0C33ABEB779C APOLOGIZING TO MYSTERY
913,022,810 *5F080AB166D19E4180C62783309377C91319F75F bkhnc
913,022,811 *5F06A45BC1602C36CED30C3D59F56EC6CF181AF1 A)R:C
913,022,812 *5F0D37B7F355AFD1AD6BD250BDEA8EE3A2AAEF5B B.LP
913,022,813 *5F03701A9B1C74763228C6F3BD3DFF87AD859FA6 b$m";
913,022,814 *5F0881EB04E07B8B9C247965F0A1F6694C4BE64C ARGSALES
913,022,815 *5F0C902B112FB19A4264770B38078E900611F8D5 bmf?
913,022,816 *5F01B52F56774AB31B4C52E4B7421C4FC5821BFE ARNOLD.DUGGINS
913,022,817 *5F0D0CE1B077AD22BC641ED9ACCF66EED9F196AD [email protected]
913,022,818 *5F099C37A8501119AADFA5A416DF490390D3F056 bo6m
913,022,819 *5F094CF2FE24C4EA72A38B622CF50824F0D9E0AC AS:4=
913,022,820 *5F005F4D09634EB27D159CBF9030D5E12A23E30D BOYCE.THORSEN
913,022,821 *5F0E369050B4C7F02FB2D6DF2AB8B5DFA2A3E3D5 ASTOUNE8
913,022,822 *5F03459A55CFDA2BD144803C6320D2A321910CD0 ATF
913,022,823 *5F097D2B64F4882BA1595A4428DBC32A88BF798D AUDESSU0
913,022,824 *5F0FD4853D396A630966DD54FB3E81904993B758 AUDREYLAVOIE
913,022,825 *5F0AC23836E66CDADDCF0A7BC388B3BE71D9B2C0 AUM30
913,022,826 *5F029F07D693E54310C03682ABFB19824BB7894E BRIAN.SLAGTER
913,022,827 *5F0A66930C7BAEAAD859211A5CCBA50AF5BEFAB3 AVJ(7
913,022,828 *5F0F16B285E32EC38BCDC1A15B2DFBE187B43504 avrohomsaul
913,022,829 *5F0F35F1A3B7355AD0483984CE5AD8041D4D8C69 AWINEGARTEN
913,022,830 *5F072B44C374AD9248C255256EAEB7C0DC534D5B awmn7
913,022,831 *5F0750B07E6DF57B3743ADFCD881ED59A64747A8 AYLMERA2
913,022,832 *5F0E9E7100744EAC4CBBA28C1127AB49888A5335 BRYON.BURZYNSKI
913,022,833 *5F042794F6CEB56F7673C0525B1B294FA412A14D ayxp6
913,022,834 *5F0E60FA65A41390E9167FAFB21DEA7BFFA5BF6A bswelectrozemperbsw
913,022,835 *5F0FFAB74578619F493BAAA9B5ED7D0D4AD047C1 B003KJMA2Y
913,022,836 *5F04AB0118AD945F41C44AF7D62DEB7C36D782F5 bswsjhmcisd
913,022,837 *5F09817388076395D5EB1DEDFF9A85BE6307DB4A B0T3XT
913,022,838 *5F0B01883EDE683629D28C1CD5A008673BE868F3 B0wH
913,022,839 *5F005420065065D2351FE44A9F647BD2127B8831 b32bg
913,022,840 *5F0B0319FE470133E82C161822FD3D659B4DA1A6 BUNNY.HONEY
913,022,841 *5F093FA47979215EF1D31D67B6E4ED1F75AEF9CF b55-6
913,022,842 *5F052DF0512F5602EB67FCE9255B9E43BC272320 B5IYT
913,022,843 *5F0398A06FBDFB1F22ECAE2A35FC5B78242C5552 B66BX
913,022,844 *5F005017629197CDD2F0E84E178E3EB2A968EFCA B9P,
913,022,845 *5F08BF461872CC2ABEFC2E8F99EEA7EA3C24C526 BW?KS
913,022,846 *5F01280CEE71752ED6D4658AF4B2D71AC4910072 C_%+
913,022,847 *5F0FD449945318F8D15399E37793C54D7097585A C5L=
913,022,848 *5F0BFAF4F8D579DFAC12F0B4FD551A6535DA809C BBZEV
913,022,849 *5F0C294185FDBA1923B511718B3817BC8CB5188D BD4A
913,022,850 *5F03B6065F976E5B79324253C9C577B6C70E4EC2 c+935
913,022,851 *5F0D5968825AA9E7F7F91835DB7072381A1634A7 bddjm
913,022,852 *5F0B0EC306756C81677A0560BD3E839968B63084 CA-ID
913,022,853 *5F01B4D570619222879563A0A746E4A6AA0A3231 CaMb
913,022,854 *5F01C52A955B269EB04A5A994DDD6FFEBB1DF3C7 BELLON18
913,022,855 *5F02EB0ACE36D020F39545048D80F85491798921 CANNONDLWATI
913,022,856 *5F00BD5508409C8ACFBD28F393285F7A18B77771 bennybrandauer
913,022,857 *5F0F28FEB97C6FBB3F2525EB972E60007CFF088E CAREZZACAREZZA
913,022,858 *5F0BB0800DBF8E5CCF308344838BF4F05EDD128D BERNARDMINELLA
913,022,859 *5F0EB3F2225CD29EF8D905F3DAF7F4A67E80E13D BERNIEMENEFIELD
913,022,860 *5F0C380BD29E4C51B65B64A101567F9DBECE5E70 CARROL.GRADDY
913,022,861 *5F057E4D8A5B718D1A11EB71AC245D8EFD2DF90E CARSON.CONDRA
913,022,862 *5F032D6DA22A8329A5A6B633D653F08F91FA5885 b%f_)
913,022,863 *5F054EFFDA86960E770888D8BC2AC916CBE07F27 bflp+
913,022,864 *5F08EC61048016F60733716AF09826730F3E3462 bg5"1
913,022,865 *5F04BAB0B04E0737AD01112F1419CF754C4436BE CBKDR
913,022,866 *5F08C8F5A6CAFD2308773325182760C69930D5FB c&de
913,022,867 *5F0872671A1D89813C22B6E19F9CCAE13222AAEE CECIL.HATAKE
913,022,868 *5F087046032999BCE244F843C3EBC8F823ABD735 bj6#(
913,022,869 *5F0A8F36339A3688AB329930D2711F5905542D00 BJE,N
913,022,870 *5F07A7D416B559422D09C165188EE1DBF27C2930 chaltrons
913,022,871 *5F08DCAF7135681140A8333B414C4B9765DC5CEA [email protected]
913,022,872 *5F08760D92B54575A3A9BC684A6539FEB203F911 bmmn
913,022,873 *5F0398BA7E7DF154D1303B31CD8CBDE0735948E3 [email protected]
913,022,874 *5F0CCA7C6F5FCE5EA929CAC14992C1EC2AB3E1B7 BOBBIEPALISANO
913,022,875 *5F0460D67FC142FAEBEDD088070EB3FFC4984E0B BOBBIEROSIAN
913,022,876 *5F066B473ABEA9D7927D00F6C275689F63F8C137 [email protected]
913,022,877 *5F08F3BE823D5E25F5E72DA65F4E1AA84466676A b!ocl!ma+ology
913,022,878 *5F027EC4293CF4028CB7A576CEBD1E4E4728FBD3 chokyur
913,022,879 *5F03EC3B4448D1E61F648FA8BA528355684B03B5 chris.calavano
913,022,880 *5F036B7DEDF7FBBA644C4E568108CC1A9590203D bp?7
913,022,881 *5F04C5C1D2B23BF860C1C8932C0355106250C982 cik.w
913,022,882 *5F071C41B182391F6A2EFC9DF318B4826C2E6A1E circuito.jos
913,022,883 *5F02A79D1737F39614AF06442AE156B785478343 [email protected]
913,022,884 *5F07B15C4CA79FD896CF461C55F3FFBD2EC49C51 ciu!r
913,022,885 *5F0175E05FA988BDE0755E7FB8FBE21FE938C634 brittany.welms
913,022,886 *5F05B04D59140160676C9A6E6474E88AEBC783A8 clench.fists,.grit.teeth....go.(live)
913,022,887 *5F0A1FC086B47B37BD7E142E25AD00677C52E8B4 CLERARIOS
913,022,888 *5F0C4376428C33B18A66F9596A7A72738FD147B2 BRUCE.ROLFSON
913,022,889 *5F06AC72093588EAD61B950D44DC9EE12203507F BRYANTRAISTER
913,022,890 *5F0314772D80C9EC5E57FD6EF6B2E83E1CC54853 c!l:u
913,022,891 *5F038C522B6C3E48F13D38715973FCFF42C0B75B BS.DOE
913,022,892 *5F0DD01571B93A998F6428A51E99D8E866792237 CmCh
913,022,893 *5F00B996B06377F57714C8305B7BA7D4C06D51FE cn+#9
913,022,894 *5F0CE06525C8113C90D3F05746C289F421C5DDE8 b"t39
913,022,895 *5F0FCF75DFDE55A127D746984995889021776628 [email protected]
913,022,896 *5F089AF56CD984420AC88AC794FAAE743A48BDE7 B-T"L
913,022,897 *5F0022A819F0814499365664346AA1609C50BF7C COCKEYE'STHEME
913,022,898 *5F05D1B5CCD9E37492A2061FF5C2721D03508DB8 BUKSRJA6
913,022,899 *5F00DD692E64851E6AD3E3A50C389E6FB74B227D COLEMAN.RAETZ
913,022,900 *5F001D671B214362992193DA4DE86989A65EA3FF collyridian3
913,022,901 *5F08EF226C8A23F86062EADFEC7FFE85009AD64B COMPOSICIONES DE CHARLES IVES
913,022,902 *5F00D4E098EBA2E677D538436F9BB9D52628523F CONCEPTMRG3105
913,022,903 *5F02518E85C067E4D878700B23B382B3B4DFF6A4 CONFLICT.JASY
913,022,904 *5F031DD762C132E6ADC514F755C75D739EA7E8DC BvX
913,022,905 *5F098AB7628DA41D17288E64DA47E26527FADD71 contastoria
913,022,906 *5F0BC6F5664DF4053A065EB96223190F70DDF560 B)YEV
913,022,907 *5F098EAD9627EA258EB0FFCA9C1CEF5036F186C6 BYRONMCLAEN
913,022,908 *5F0022DCB33B9C248933C556F543507627C242F1 CORNHUSKER0
913,022,909 *5F095A1816216250ED0F5423EF99730B62975255 coryvrooman
913,022,910 *5F0C3A654D6AB7722B861183F6CF7E40813EB43C C00CN
913,022,911 *5F06557BB8BD34FFBE7ED98C18444827E672B9BE C20XJ
913,022,912 *5F042D89E353A310C046EFB4C650D1B9D0504BA7 c2u"m
913,022,913 *5F02823F14BF6E3971C6023D74F45579DD95A908 c2"v1
913,022,914 *5F0A9B57FB8B56EACBC3D1E3CF3C88CE107CACDC c:\program files\microsoft office\office12\convert\act3sam
913,022,915 *5F09C6752AD49925F29DBAD5A60E97CE15808148 c7s6
913,022,916 *5F0CC90DF4AE066CE259474C073651A52E2907C6 C9FNC
913,022,917 *5F0271867ADCDE2339CDF63D4AB28A49644E01D2 CADEHTTNEMELPMITONTHGIM,HCTIWSTEKCAPKROWTENCILBUPA
913,022,918 *5F055578F8FFB2499678DC7701391288F5A40FF7 CALEBBUIKEMA
913,022,919 *5F0DC8FACFA9C2BC556128DB92B2ADD70D16ACEA CALISCÉLIDOS
913,022,920 *5F0DAD2553A890E7FF0C6EA2CF89DBB04A58F47E camelen
913,022,921 *5F081B95B536F7A5FA8FB188B249DE01404B239E CANADA—FOR
913,022,922 *5F0628E77A10AF6E91F46AE9F4702B527EA8A876 ct:p:
913,022,923 *5F03515B452738037756E91B0CA713ED5B5D97F9 caritopica
913,022,924 *5F04D879010157BE3F7430C79F2F9E1DEA7067EF c?urx
913,022,925 *5F06CFDA7F3FC42CFF82995D3A3F7E88E9E1AC66 [email protected]
913,022,926 *5F0E320ED13DE178D5D11DEDFF210525D991C547 CAROLKAH
913,022,927 *5F0330836EEB5E416CE8C0A60DACC7A720C053F0 CAROLTREMBATH
913,022,928 *5F07EC442C0700D070844EFE56C1067607B118D6 CARROLL.ANTCZAK
913,022,929 *5F05E4EB158ACAF64B328854BE09301F52B17371 CARSONBICKMAN
913,022,930 *5F048AF54E5498D4CFBEB0E35087911C0F8DE2ED carsoniott
913,022,931 *5F0F1F1A1C68E193992DADABE9F5E941E5859AE0 CWO1G
913,022,932 *5F030178D65F76F32B0FC009899F3EEBAB69A69A „CASSINI
913,022,933 *5F02143B7F2A3A91990820FA4A5A6336C4B63213 CYKLICKEHO
913,022,934 *5F01B3EB3167AAEA34DCCA606699F031132303BE cc8=p
913,022,935 *5F0FC6F461014026C4C9C5E6B58134177E55C3E4 D#7:
913,022,936 *5F029423D85529C3EB4BF747D24BB59705FDF2C9 chadwickpugmire
913,022,937 *5F05019CC9CE38F5C2FE6DD72165EB0AE5AE083C CHANTALESTERHUIZEN
913,022,938 *5F086301CA8FD8D9B33025D55BFC05E633BD9FC5 dario776
913,022,939 *5F025A69434511ACBB0347D4D7CC6D00CD3750F2 DARRELL.HATCH
913,022,940 *5F07E7F230C6ADF2D15B788BA23D060DD0E2FEB6 CHIMUANYAA
913,022,941 *5F09E60B157FE05C56F28C842276F91BF3408C74 chrickettk02
913,022,942 *5F0BE4DD2BB923F3C86DE516EDBED3457E96690A CIEORGE9
913,022,943 *5F009BE397C65506ABF021BA7BD42F2DB0D16676 ddeh
913,022,944 *5F0D9433BD32524053128027778B81F40CBDF6F1 CIVA9
913,022,945 *5F0026CB89B76749D9CD1E12B5693E5C21653D93 DEANANGE
913,022,946 *5F07D656D1B9638F5B6FE645C2444DB3B0117907 deandremondragon
913,022,947 *5F0D8A44A4C972C48FFBC15F66FF8989C1FF4F8F [email protected]
913,022,948 *5F00132285BDC188E06FDEB256221EB8783CF6EF DEBBIE GILLEY
913,022,949 *5F0FB54935DE90BAF609A8D9CC162C472C0202F0 c"kxi
913,022,950 *5F0172BA39A529453F9A611BC537BD180F1A1EFE CLARENCE.WARDLAW
913,022,951 *5F0037516E55D978816F9CDB0133B5512128B717 DEHCRIMSING
913,022,952 *5F0AFDCAF493DEE5D3E4E05A5342D556B8B0E58C DELAGARZA2
913,022,953 *5F0345B0953C087EB59D1B13160BCCFD552F8882 delioswo7
913,022,954 *5F01E613196002FA01F3C664C593B33C5033562D CLEMENTESTUKEL
913,022,955 *5F0F64FE2CF81B82A2D4407A1F5F20F3A9DF21A8 delta-oscar
913,022,956 *5F01839568438863357DA8664CC9CAF2B58B77BE CLINTPENSINGER
913,022,957 *5F0D7E2CDB6356EDE8A1A2C2F0DD58C70B336A80 cloudsfullbbs
913,022,958 *5F0EF3F954F74F5EB06B686CAD1892FF174DDEB2 cl?rn
913,022,959 *5F0CA54570957DABB76E394D16328AEB314B395B C#M/D
913,022,960 *5F0B61B72940215CF8BEA6E63CB0FB122908101A COB:;
913,022,961 *5F033862F8E865A00A002537C5818741FD23DB91 COLLINKLOTZ
913,022,962 *5F0A622D153F0BE122887203C94CFEDEF3636390 d/f&2
913,022,963 *5F07AE6C80106450488787538DF9FE9A2A1E1874 [email protected]
913,022,964 *5F0C40CE0BC3740A225AAD1E40696DD7A7FCDDA0 d=fl,
913,022,965 *5F0A25FA17EA777DA482D38921E1ABF925D3D935 complot.k/@/m'pl/A/t
913,022,966 *5F08FCF12215E59452CE46EAC75EC7122EC81A6B COMPTERAI
913,022,967 *5F06D120F3C4BC51CFD1604E57FABA3221A3851C CONFLICTING.EMOTIONS.(C)
913,022,968 *5F00BE02A5D7C8A505A7DB3989499B3F9BA9D25D D/HT
913,022,969 *5F09EAE8C0696CB9888CE78CEFDF49E6EBD68146 dihalos
913,022,970 *5F0F23E68D57E6F62377C4401F036B599641345A [email protected]
913,022,971 *5F05749CCBDBE30DA881F1607F097E59B0CCEE55 dirkjanka
913,022,972 *5F076F44E6C1C82F3DCDEE31F109BB8A3AB5B122 DISCOVERY
913,022,973 *5F05DD768952B7B68DD192273DAABFFCE78734B2 c:\program-files\msdn\msdn9.0\1033\dv_vsxmlref.hxs
913,022,974 *5F0EF066B6F881007B4F9896930CFAE19E5B8EA2 D:J/#
913,022,975 *5F0E156449CE07291DB3E2970B3D36E34A74D41A CQB0P
913,022,976 *5F03243531890861E0B6908609DB918F08686950 d"jeu
913,022,977 *5F07712000000F97483BA46A503A60A55914EF26 DjPh
913,022,978 *5F0BCD1B46D3454715F6F9392BD6A7909E35AD1C dmeq
913,022,979 *5F0B21F500D2C26AF1496E8F60DD0FCA70428155 DNAGORRA3
913,022,980 *5F081A1E5C6F1FDB02C419DB5BEE1079034BDA6B CSINEWYORK
913,022,981 *5F00B8C9C8724DB60324DAF0BD75A0FA5F6C01F1 DOI1010880026-13944
913,022,982 *5F082788A6EAF1B92FF571AC4B2E61023D2E4279 doky2
913,022,983 *5F079E411F79D879AB1C2FFB24F9BB5773771E35 DOLENTES
913,022,984 *5F0B8A3E42B7B778A12B4DD885AA7C2897255CFD DOMENIC.HULAND
913,022,985 *5F0D684DFA09EFB2A28935F2F20CD18C09F1328F DOMENICRODEA
913,022,986 *5F082AEEFE823BC2B4E6CCFCD42D9DCDD6F97471 DOMINIC.WEGMAN
913,022,987 *5F005094B908DF9B053254F0E6A0B8D7562FB9DC DOMINIQUEMCGLAMERY
913,022,988 *5F03AE8BAC5F0B7B494622FB68E7317B3AF1AC80 CUORDILUPO
913,022,989 *5F045F1E61F6BF3E918969B75B5AED698DFBCB11 CURTISICEMAN
913,022,990 *5F0D8810D21E183D459A77FBF41E8B0232F67C89 CURTMONTAG
913,022,991 *5F04EF8495875C8D9F732F21F7867FB77E2CE873 cuyeb
913,022,992 *5F0887115A0F708B3E6BA1CD51C45C5DAD17BCAE cvfr6
913,022,993 *5F0085469EC3D93C8B5F925A08A416DD93FC4B76 DOSAIT9
913,022,994 *5F007D01761C288B72FE5C14B9B8709F982D3554 CYBERNETBOY
913,022,995 *5F00B6292C55316E26AA5F77819E041C3ACA8603 dpht
913,022,996 *5F044341AA0CD586E7119121AFEB55820C5862E3 DREW.MABUS
913,022,997 *5F0D6699DBF67747A724B4FCB51D601544D8071D D36BC3CDAB693FE6814746E51D665B40
913,022,998 *5F0F698BEDB9DC5887416171EE219EE0360DD1D2 D3P1LL0315
913,022,999 *5F0EC4454397F1FE46C455012A7ACBCA2443006C D40=
913,023,000 *5F0F7307E08197C71C668548B5030A9E329D0417 D6ILQ
913,023,001 *5F0C4631237EAD138B8C9232AF2091D27E363F46 DAANIIF
913,023,002 *5F062C3EB8EAEB678B3285E9BDE47BFA1B369DF7 DU ER DEN JENTA
913,023,003 *5F07871F96E4980949D8658A3B305A9EFA7AA068 duncan901
913,023,004 *5F0C91B88E9EE2C7A74279E6AECA8EC9C5E2A375 DALEMELLOW
913,023,005 *5F02153C819D1AC93F1C2F45F349A8FA98E37A03 dustehstvormir
913,023,006 *5F0C485C62F210CB20A686777A7CDA61A447B01C dvg3k
913,023,007 *5F034756E320E4BB6F433BE0481FD0B20DD4BD81 danemalson
913,023,008 *5F0B8CD062ADE683875E23ABB591BAC5AC9D216E danialzarrella
913,023,009 *5F073CDB89151E93295CE70A88F26A1F22DCCB10 d"w2
913,023,010 *5F02893115FE851C3A6863FF74975A3270194732 dantelobban
913,023,011 *5F0FDE5BB7C8118396612B4058301FF620A2E472 DAORBLEE2
913,023,012 *5F085C0602F89FE51F41F7BE81B9BB8B9F49E7A0 DXL/2
913,023,013 *5F0D0709DD343AE6A6F23493F92C9BEEAC72F5DB dc:(;
913,023,014 *5F01D717243EE197F101F70B3C82B9FEF52C3BD4 ECEGP
913,023,015 *5F02F5B88C854E58AF43E8C7C3E0841C96AE59E5 EDABLESED
913,023,016 *5F02325C034ED385519B53A74A1C2B7562CEE847 EDDIE.ROSALES
913,023,017 *5F084BF9400BDA2F968AE8EC99E7E14E424BAEB3 eddiespindle
913,023,018 *5F07C4A2FDC0FE096368705CC67940A0351A1B55 DDHEB
913,023,019 *5F05F5CF60365FF4DFA4B3C70E99F7112D812897 DDOJ
913,023,020 *5F00681DE7951FD1C018F7C05B1861EF3005ABA8 EDMUND.GEMMELL
913,023,021 *5F06FA44705FDA617001A6E97333396362B429C1 deandrekave
913,023,022 *5F0EF515DB88C78D9C5C452F8644228E12F266A4 DEBBIE PIRTLE
913,023,023 *5F06DECEE03C8D9BB881C9D00B87984F35613317 debzh
913,023,024 *5F0A2B7F7DCD053A41F15531D11510D0822ED636 ELBOMBASI
913,023,025 *5F0A2A86E3A09F79243272857FDC215B7798D1D1 denver.badua
913,023,026 *5F091A452850E6E07D086DFFC68C360746928897 ELPTU
913,023,027 *5F0D37D865F4E165934506005AA3DA49F037804B dfi5v
913,023,028 *5F067D4413C5FAED59D6959092EF89B0B4E84729 d(g4+
913,023,029 *5F0E9C0D50238E3886E14F726AAF12A7A9DEFB89 DGKT4
913,023,030 *5F0AA3EC097AA912EC7438F9C6E93302EAFD664E D#)I
913,023,031 *5F0D0C35E575A0DE0D2942F9D819DD4E1C315CDC DIANA ALEGRIA
913,023,032 *5F0ABEA6E7BE4642765B94C7E5FAF20A202B42F6 [email protected]
913,023,033 *5F0337BF81E47536E2E0DF4788DD7F563E03F8ED DINESH.KUMAR.GOLA
913,023,034 *5F07F4EC3E2ED6135C667D9BE8195B2A312D3E8D dionbauerkemper
913,023,035 *5F0AF11BC9BDC5FA7AB8C9605BEE5E13B8958A37 Dioxin
913,023,036 *5F09E79409DF569F4EF3DA6B841CF1B13934E547 DIXIE/COMEDANCEANDSING
913,023,037 *5F061FBE33301EB2177DEC8C6F9F42A474C15A8B ericpassantino
913,023,038 *5F0EB0F7B19FC56C950169A5ACA0D62B0F30A28E dk8pa
913,023,039 *5F028672808ED2F725C5679872293790185546E6 dk(?k
913,023,040 *5F0852080009FF54676BDEC53E8AAC4820181AB4 DLN;
913,023,041 *5F0C7517004F96436A2BAFE5C293444A4D5D6278 DM3IU
913,023,042 *5F001411ED79276EC0A8FE8AF959CE05F2EC222D ETYHPODNE8
913,023,043 *5F0C6B38C3C03455831E6819DDA6792803F727A4 eud%f
913,023,044 *5F0C6B90248F24DA4297A76BD4CC3C91C937AC75 DOMINE,DIRIGENOS
913,023,045 *5F060D39E65E66FEDA432422B8776F2B4030E4EC EWSHAA
913,023,046 *5F06EE93C47C3B6F171407BBD2AA6FF4CB538A81 DONNIEKILES
913,023,047 *5F09FE158AA456253E2660845F71A5FAC3DFCCFE DONNY.CASSARA
913,023,048 *5F06582ABE78124E626B0B06A8BBA42F24D1202E expeditionsfahrzeuge
913,023,049 *5F082D52537C92CB7FA0089FBF0D9A836FB2659D DORINISHMORE
913,023,050 *5F07AB09FC1BCFA9ACD4B20CD82FC69D5CD176FE F01560
913,023,051 *5F0F556A1F4E57BEF57EDE273EE21B64347FCE18 DOUG.LASANE
913,023,052 *5F0A49410D9DE9328E5A2D3997224F4821362FA9 F41chons
913,023,053 *5F0595899CE771E6C275691DF69F5928F57021DB DOWNWARDEXTENDING
913,023,054 *5F016DD69902B933A1CDFF73ADC67131CCC83B1D DO YOU WANT THE NASTY?
913,023,055 *5F0023A8DE17FE7F4D8F3945E29903A491D4D3F3 dp=n/
913,023,056 *5F0949D950E3177E2F35CB5C66F7171656D0944E FBS8
913,023,057 *5F0467F3C1709359B77F8EA9EE3D90188D0A2E8D [email protected]
913,023,058 *5F02CC2DB1B17F69BABE8B6F4A2349936D482E75 FEAWTERING
913,023,059 *5F083F4F2F839118B1DE6F78345565071D8060C9 dsue#
913,023,060 *5F0056DB0429DF3BAAEE3FAA95C539C3D218C571 DTF&1
913,023,061 *5F036802B185ABDFF53C49B3B28629058448BB97 FILOZELLEN3
913,023,062 *5F03B1C6D20B813541CAF2D27045AE9D57925981 DUCKTAIL
913,023,063 *5F0B3BED40FB38FF4D228CFC4FF962013DC652EB FJELLMANS
913,023,064 *5F07D55643E32C0CA9F75B8302412C242B2F04DD D+UMK
913,023,065 *5F06CE2611D483FBF35D24264A50F1A5C0703D9E fletchm
913,023,066 *5F057793DE1622EE384F788634CA313FB1A06A8B DVDJU
913,023,067 *5F07BFC63716C93822B2324D05ACCA5353EE470D FREDRICKKREFT
913,023,068 *5F0F2868CD62D6DCF3E4A17DC017F7671A5A414A e73y
913,023,069 *5F03804301F140E1E58443C903EB017656D63B6D EAF7L
913,023,070 *5F0B14E7A50240DA6C5D6D42ECA78CF691ACD905 earlewashum
913,023,071 *5F058AA5254ADB3812A03D7B68601345A0752A55 EASTER5
913,023,072 *5F0900B374D35D495BEEA053BD377F6A91971959 eblouis
913,023,073 *5F014784FAC4FA23A7AEA52B16AF5CDFB34FBC39 ECOLLANTES
913,023,074 *5F06D82DFB0B467DA655DED781BDB077FFE18139 ĔÇРЕ
913,023,075 *5F016F3D2247CC3D8719BFC3CD0DF69AF79BB49A FZSRT
913,023,076 *5F0F81AD25DA7D354B086D6F6EA26E5831A21EFA G410CHEN$
913,023,077 *5F005EA18D9B14952D7063929A1F0981B782ADE6 EDUARDO.HERNAN
913,023,078 *5F0503F9C2C0AA89CEC2FF181B1D8AC456D7417C gabrielle
913,023,079 *5F063FD0ABABDAD995FC8B285CEFD599912E6110 eengalig9
913,023,080 *5F09AF01EBA24A26EF7936E8F8CF80DF64A160AD ganzruhig
913,023,081 *5F03C297BA2FAB9CDFB007850C89AAC53B1C5EA5 EFRENMANE
913,023,082 *5F05EE230A7EC579A762F7002D7EA89348A1E775 e/%g
913,023,083 *5F0B7626D498F1FD5B62EC59B2C7AAD93CC8AA12 GAYLORD.CHURAPE
913,023,084 *5F0381BA3BCC00302ECD1949C099AA702EB4C78A GBYW
913,023,085 *5F0070BE22C9D5FE953E94560F36AF6615D24B57 ELDRIDGE.MAJUSTE
913,023,086 *5F026F2F02D7FC8FC74739197D9041FA6D5FA906 ELECTROの略で電子シャッターと外光式露出計を装備し、絞り優先AEが可能。電池が消耗していた場合は1
913,023,087 *5F06EF6F0B27E57969E9780CAAF8E6779D187198 GERARD.DEVONE
913,023,088 *5F03F05846972A873D2A3905F9D4D369EC96D717 GERAUSCHVOLLERES
913,023,089 *5F0C7025F536DACA4A0BFFDFFAACB5942E024482 GIDIOTERS
913,023,090 *5F0CD91B6B6AABFEEDC23026F2C382317D7329A8 giggalowing
913,023,091 *5F0C1DAD8D926F7AE0049E0D0F02F88F909C712A GILBERTTITH
913,023,092 *5F0629BDCB1BE80FF7F5753B1F07FFF9B4A52223 GIOVANNI.GARGAN
913,023,093 *5F01A793D6F2012F1E46B59697BD30B4F20E5492 GIUSEX27SC
913,023,094 *5F07C157A9376ACA53B4A193225EE313CDEF7CBB GJKEXTYY
913,023,095 *5F022CEBE094C7E0A00F9932D01414A821790FA6 EMBONDEIRO
913,023,096 *5F00DF3AFCBC8A23E0E6513D98B3BB95798EBC8D EMIURGEW8
913,023,097 *5F0AFD86887139F5FB52ADCE79357B18B335516A GNIVAH
913,023,098 *5F0A7A1D7E083A8D4505797EBE83C28CD130CEDF "good.morning"
913,023,099 *5F009DBDF3259EFF970671CAC8006911EB113D55 GORISHNJE
913,023,100 *5F071BC92C10EE4589A4F0BAD64690043E193E58 ENERGIZERSX
913,023,101 *5F03B27010C2BA15F9ECE6AEC2CC448FB2515F36 gr3n4d3s
913,023,102 *5F024D7AABB505131106533F97CA06F6204ACEEA great-lakes-wire-limited-|-canada
913,023,103 *5F02CEA4C989210E8F32C0A91923CC7EFCF39AB7 Great.Movie.Themes.-.Singin'.in.the.Rain
913,023,104 *5F04F982C37D7386FD4DA5E4252D6C12B28114C5 EOH_K
913,023,105 *5F0EA504117349BE4BC361C1B2E61E465C6C35EE EPD#N
913,023,106 *5F0CEE4CC635123EF42B25B6BE5466ECAA118884 eqh4d
913,023,107 *5F003079E5F3BC144CA10A2C60104AEB6DE812F0 ERINERDMAN
913,023,108 *5F0680C9F23F437FB278DBFA7E4A3C94B1F1314F [email protected]
913,023,109 *5F064A94D16AAE2EF3BCFC6C7EFBE4F6B4B2DE6C [email protected]
913,023,110 *5F095067DC40BE03E46BB14DE56B98C9478C70E7 hakuninmaantien
913,023,111 *5F07268F6EFFE893550C99CA364A6D6F40364798 ETNUPEGF9
913,023,112 *5F077DE35D9B0659D495DC2F47C24D117BC8D5B9 HANG_WEI
913,023,113 *5F081E21E020A16EA992C5D81747E340D007FF22 hannah.mcbrayer
913,023,114 *5F0986EAA12D02D20C6B12B323E2DBA4A3EE175C HARRY.THORSTENSON
913,023,115 *5F05998E8209221A4107733F9BE9A1768FDE0F2A HARVEY.PRINZING
913,023,116 *5F05A2FA04B8EA9E46820421F4E691DD4C42C42C HARVEY.ZAREBSKI
913,023,117 *5F0594416A3C14C93C2CF8383E292FED18774913 EXEC18
913,023,118 *5F07EA443DDA86287B1C2F775FEA775862137342 [email protected]
913,023,119 *5F0968970436B8910763E07D770E2CD6444F0F4A EZEKIELSPOTWOOD
913,023,120 *5F0F0B366961D029224A60F795AEC1FEED1A7630 [email protected]
913,023,121 *5F0ACDB39E55AACBC286BA47CD9377171996EC29 F9I%
913,023,122 *5F07A88508F555CA77DC393BF8CE2A7589C178A5 [email protected]
913,023,123 *5F096BDE512D4737BC704D7C6B2E39B48AC713BA HERPETOGRAPHY3
913,023,124 *5F0212FDE4D135C374A79544BAFD9342EB30F5CC felipegillis
913,023,125 *5F0F9EB08071AF736A1C5AF88557315D11B85577 HIRAIENT2
913,023,126 *5F0959AEA5DB5682246164671FEB37968B5D99BF FIMBRILLIFEROUS6
913,023,127 *5F07328B9F5EF55C7ECF28D9139188B1A1B2D86D HOUSTONGOTCHY
913,023,128 *5F0C3D10038A106AD2889C1DE50664314BD89873 HOUSTON.STABLEY
913,023,129 *5F0B5A40029629376B496DB0F64F5EF0F975CA65 FLORENCIO.WOLOSZYN
913,023,130 *5F0F35521CE28873311E7F335EB8A9CBF74AB3C3 HOYTMATUSZ
913,023,131 *5F02217B33E2CA26B46EBC06CFD977D001313A7E floydweit
913,023,132 *5F003546876C1B04F7F7A2E93D54B86C0EF20BC3 ,htaerb dab ,taews .namuh
913,023,133 *5F08787FC948FA05F34E9FD3C31B81EE7BC28EF3 HTTPTL.WIKIPEDIA.ORG
913,023,134 *5F03BC0AAA668DF4B8BCFCAB37E15007A6995DE1 FOREST.CARDWELL
913,023,135 *5F0A8092A7A32FFEAC39692492596B5E35487150 FORESTMISHLER
913,023,136 *5F087DC775F9AA254898A10A8E74EAA363FA5C6D [email protected]
913,023,137 *5F0DAE34A3DA745016648E8D643FAFF0ABA4F55A FOTOFOBI
913,023,138 *5F0968D06172E0E6BAD692337AEC304B8047CDBF HUGHMENDOLIA
913,023,139 *5F04E417FC43D867369478BD4D4D66C9E9DEF3CF fr0$+1ng$
913,023,140 *5F058E974F5B92C858568AB20D45A200D51A1EB8 hunterlaurita
913,023,141 *5F0F591587336F954147799A3934563A64873D07 FREDRIC.SHORTELL
913,023,142 *5F0FF92942218C7B02DD9A2CBB93AC1C90FEE690 FREEMAN.MARCHESSEAULT
913,023,143 *5F047F368979F258614423BBD9D6949408986EF3 I1X)
913,023,144 *5F0CEF707F6FB5A862A40D9025AADF651EE1C10B FRENCHARMY
913,023,145 *5F0BA09C5DEDFC834219C4C15423D2FC6EC6444A FRIEND-TURNED-ENEMY
913,023,146 *5F06D01BFF1BA11FD09F18867431A0A2359F98E5 iamprince4
913,023,147 *5F086CA1DC1B98F1371F2C5B4DA83B17F60F6045 IAREHCRA0
913,023,148 *5F02617E8F6A7075CD021CD6A1DC56EF5A971827 I CAN'T BEGIN
913,023,149 *5F08C89BB2C3B645A3ACA3FE936A749EBC147FCE IchbineinWanderer
913,023,150 *5F08D49E05C2E25473BB1AC4DEA2284E4F789442 IF($LINE
913,023,151 *5F0E21885C072DBB24ACBA82A3F59CCDBE322C88 ifuekhe
913,023,152 *5F050C4144247A54CDA977B66059AD1F282B7A26 iglhrcorgwww
913,023,153 *5F032ADB619C09649A46FF1C2FF169FD6BA35BDE gaantjes6
913,023,154 *5F074210FED262CA48C35E64206E35659B8C2F12 [email protected]
913,023,155 *5F0E18F61BB6EC31004109A899631D33425DE53D i-hate-snakes
913,023,156 *5F0500B8F881F46B17F5029BFC79BEDAD6908F19 [email protected]
913,023,157 *5F00E8023F9E60B5FE712915A2620AE508B81A6F ikbenlekkerstout
913,023,158 *5F033326870B73989E719D4518080C5A09D78816 ILUVEYAL75
913,023,159 *5F0AED47C54F572A22DA0E315B7E9408ECA5D1AD GBERJUEGA
913,023,160 *5F006882A6295584D774769D1FE2510ED69DBDD6 imagisms
913,023,161 *5F0F693D0B023B2C5D6B71102F73E840C43A6283 INDRARINI4
913,023,162 *5F032505AF8A9F1CA0226E90CB270413ABFD6698 getuigt9
913,023,163 *5F00FF2DD6071AA588E82658D85D6367EBDDE2E7 GHYYGAC15
913,023,164 *5F032D2ED196164E889284431FEF3AE1DA695F55 gimme.dat.harp.boy!.roots.of.the.captain
913,023,165 *5F0E58F2E2D4A28CE94AC60865D48A134D6EB5D9 intracellular-mechanisms
913,023,166 *5F0B283EA26FEBF1B6CF13565F2E29CD54794B68 INUPEHEWA
913,023,167 *5F07801458909A04D62B88244733FCD775C342C7 GLENDASPARKS
913,023,168 *5F04068D090E90422C911636F69CA9D6EB8E2ED0 [email protected]
913,023,169 *5F07705EA1DE0FD5E407166FA1E6F6A267EC5335 gloriaklingler
913,023,170 *5F0B48637EBD4DB4A4EBF9BE43DF3EA327C7B1B1 GNIWREDY
913,023,171 *5F0403E2D45AAF85C6056B5A2E1270E7C7FF856C Island-Roots-Volume-2
913,023,172 *5F051412DD6499B7A1ED339DE8B5693FB45C30CB [email protected]
913,023,173 *5F010C7B9B90AD353355AA8852837C0618187685 GOORDTIU8
913,023,174 *5F03BF6CF5D8330CBFC314AC784EAE9F4AE0BBC3 itlc
913,023,175 *5F0CD3A00FF83D160002840463F355206E13724A greg.bodnar
913,023,176 *5F044D2B883D58E588A6CBD0E047FCBFF44F06E6 GREG WEBERG
913,023,177 *5F054C83477015DDB597AF9D6073419B0E5F74EF JACKFRAUGHTON
913,023,178 *5F0B8320DE30C9E0B2BE436B1DF190A71C33FD54 JACKSONGORRELL
913,023,179 *5F0756FC284EC8B23CA2F3B0246FE37500382A5F [email protected]
913,023,180 *5F0EDC99C8B9471C309DFD6CEE7AEB443D422C88 GTTTTATCCACAAATTCGCGGGCCCCAGGGGTAGGACCCTGCGTGCTCCTCAGGGTGACT
913,023,181 *5F0036824B1E42AEACE2E49664FC717D4D3F6908 Guaranteed.to.Smile
913,023,182 *5F066B132AB77E9ED742E2D03EEA83F377F890D9 JAMAR.ASLETT
913,023,183 *5F032C90697DFAADD559B852E422786A15063A61 JAMELKREUL
913,023,184 *5F059F33830D19CC69A3ABCE40994D7BF5C6867B jameson210
913,023,185 *5F0963D42F36A1BD1A7C6FB2FA673A520864FD0F janeagle
913,023,186 *5F0A56349330ADE00B45D3B9F2BF0292A8781B82 jasonstoddart
913,023,187 *5F0A171335619C7372F9A80E80812BFCFAB58FC7 JDIIIX
913,023,188 *5F018F844B5C587F963B92E99862E805B832677A Hand.to.Hand
913,023,189 *5F0EDF8E037E2F4C44E62C5A464A2B28F27EB5EA JEDNOKOMPONENTNA
913,023,190 *5F09BF96F58E8AB21405F657E6B93620787EA414 harleyyoungerman
913,023,191 *5F044ABDE08A8C4DFAC26BEC3C204F1CEAD06E49 [email protected]
913,023,192 *5F0BB711C7410DBBEE742A83E54177A198B7C8DF HARRISON.LOUKANIS
913,023,193 *5F0815087C745EBC1850E7975A2FAD52E17DA21F HARVEYSIMENS
913,023,194 *5F059383C26F16AC393F1923660FF368077F1E7C jeremyspinner
913,023,195 *5F0546315EC2B786A1FA7AFCECACE15652CC0FC7 hegenbart5
913,023,196 *5F098263E774BCF14B0FED756844437793AA416B HELEN.FLACK
913,023,197 *5F025FA07B1FF859CA030F6701B19B8E660CB4C9 jhartlef
913,023,198 *5F0F581AC5D037D04791A498E1868722034A014F HEPYUNG
913,023,199 *5F094503EEC6066BF662EB1239727952FB6FC5F4 herbertgoltry
913,023,200 *5F0637E0012E2770CAA3314852BE8CD3E1D6717C HERB.LEITHEISER
913,023,201 *5F00D3E239F001D32C0D916644CCBED6B7575EF4 JIMGALAGAN
913,023,202 *5F0828BBDC17EABFD3EB4947E7343AA683C1ABDE herminia5
913,023,203 *5F0CDC2556217C12853B79836D12589D850F3CCF HEXASTYLOVÝ
913,023,204 *5F0A9B70CF72FC7D6A15B4AF8323EE6719C3AF7B JLAM
913,023,205 *5F0C76A64228203B6D4029BA1EB27C5474D1B96F h+j7
913,023,206 *5F09334EC9525831889D50048363AC3F8FDC22B9 HOKNEURGGING
913,023,207 *5F0D3326D8BEF7D07E645A43359B27C2D5ACD026 JOSEF.BAZA
913,023,208 *5F0AC733AC202330E5CDE56315647008CB6C41AB JOSEFPICKET
913,023,209 *5F002B2AADD9DDA92B19E457271E904B907FD4CA JOSEFWHALEN
913,023,210 *5F060E81BD55EB83742D7D7971F9B6D00E0ACE3D JOSEPH STELLATO
913,023,211 *5F015169117F1AFB77FA0AF519683C0FA84C1071 JOSHUA.BANERJI
913,023,212 *5F01A28C48139820098F9BABA834E1004A035913 joshuahoagberg
913,023,213 *5F041961D386609A3B26A7F0A8CDEE9055B917F1 “hor
913,023,214 *5F0B4147D1F29E1692FA73F48FE4ADF60C79BAB2 JOY FADRILAN
913,023,215 *5F05C1240285DE214F91CABDFB4A2296E4B4BD01 howardreynoldson
913,023,216 *5F0290A97058F24DE383C161C8474D470B16FEF2 HowAreThingsinParadise
913,023,217 *5F0612BC62AC9459D7E3AB19A3A311B6BB4702BB HRDINNEJI8
913,023,218 *5F0DEE3CD71740647B99445BECCB41F50D37B5F1 hstrider0
913,023,219 *5F06A2BEB149A12C8CE9F8C75446D076EAF43F1C jvrrstrs
913,023,220 *5F091D4E26A06E871CE66535312AFFD608E05CD5 k5M
913,023,221 *5F0723BC24DB8297E165CA1BA7A96D0CD48D4EB5 katiekruck
913,023,222 *5F0D66DACB5C416895DF66FC12F863BF13AD5ABE IAMPOMME88
913,023,223 *5F0AFA07594429F59C3E1A343EC04A896C8E4A8F KEHNOISTA
913,023,224 *5F0BA68328AE420E4A85BBCBC12A25542B777611 IB0AAA
913,023,225 *5F0E6ADD3C1FAB907BA6EBD092BE6B68AD072252 ikkeltje8
913,023,226 *5F0763681D6880B932A634E56D68CBEE5AF3A52F il.trovatore:.mira.di.acerbe.lagrime
913,023,227 *5F0DAACF9816E302913D1829A6EA2CF096830B43 ILUVJULIET31
913,023,228 *5F054F3D1EDA65488432F91F88F4A29A14138BAE INDI4-MU$
913,023,229 *5F0DF7B85D5616AC664D232BE85B80475EAC4064 INEKSAK0
913,023,230 *5F0E063749A02F75FF75EA2B3C8B9FA3C66C0BEA In.My.Life.(freestyle)
913,023,231 *5F01AFC99179D0A27D3C351462DF97163E6C077F IN-PARIS-AFTER-THE-WAR
913,023,232 *5F094A7F1B077D7DFD97076E8200C5814C9FD35B KRISTOFERHAMONS
913,023,233 *5F0FCB5FD384ACDC04E8A23846E7A3F92AC9DF9B INSURANCE2
913,023,234 *5F077C9FE4F845EC237BD9F6DCDBE1D3301C38A7 IRA.BAUMGARD
913,023,235 *5F0C7AD2E64276F504FC28EAECE47BCA4746DAC6 IRISHMAN1971
913,023,236 *5F0B07F7281A61FCF81182832508A3A93DEFD4E8 KYRIE:ORBISFACTOR(ENSEMBLEORGANUMFEATDIRECTOR:MARCELP
913,023,237 *5F084F0D562DB7D307040A958B267977E119A625 ISMAEL-E-MARTINEZ
913,023,238 *5F0723275EDBF72B0E92AA667526C9F805F78240 labrador_jay-'l/&/br/@/,d/o/r_/dz//ei/
913,023,239 *5F0F064F594338B62DC4B48D5A1849149BDBB5FA ISSACCASERES
913,023,240 *5F00F4B06CA215CBA5165EE1B437A5C977251A4B laiaine
913,023,241 *5F007E2B0F03403BDE6D2C97FD135C629B620965 iuoy
913,023,242 *5F0AC691B2502AC3ACF8E0FD05AB17ED458312A6 IVANGRISHAN
913,023,243 *5F0EDB209CE72843A99EB14251233B20FE76A96D JACK.RUDH
913,023,244 *5F0C02C0137108439978F5A6712A549E61CB63FB JACKSONCROSSFIELD
913,023,245 *5F08DD1D072A4ABB72D54FE506CD67F465DA79BA lara.burch
913,023,246 *5F064434D1022AF076916399F61CE883DD7646D9 LAZAROOYSTON
913,023,247 *5F0109D52EE4454BD7C942CD9C602542BAFFAA77 JANEKCYBULSKI
913,023,248 *5F0926A23BDB33983D0A04DA55FB1F283FB738AF [email protected]
913,023,249 *5F0CF7C171800433B18F55B2B2A04C59E1C34FD9 JARRODMCREYNOLDS
913,023,250 *5F06CEEFEADEE9B8A48977DC1DB6938139AFE670 [email protected]
913,023,251 *5F0E2C776C89BF8BB1C3F094781D6B2696BB9AAB JDI%
913,023,252 *5F0E7096B87E63CA3125461FF2513C2589393E53 LEONELDUPUIS
913,023,253 *5F00F42E07F5CD1CB87D09DFF7033D7F90E7E8D3 JEFFERSONCOURINGTON
913,023,254 *5F0730948CB23896FF2B91CDEB98C0A2C646A8E3 LEONINE3
913,023,255 *5F0F14C8C9475876612035B2718972D219EEAE22 LEOPOLDOKIENBAUM
913,023,256 *5F0BA6E61279C1248BBA1F536005A87D12F62B03 LEPREMIERBONHEURDUJOUR
913,023,257 *5F05694B22B9A799761998EC1014672BD56FDB98 lestitus
913,023,258 *5F0AF1DD0246C0728594AD91DCCEBD153C427876 JERAMYKASTEIN
913,023,259 *5F0385C00C18A1B390D96310A790B20515D355D0 jeromegiovino
913,023,260 *5F0477BEE60C52E36911D10369A760ADD5E9936E JESSE-MELDRUM
913,023,261 *5F026236871205A34208DC17ADBE50EB70F96F1F JESS.FLINCK
913,023,262 *5F01AE46CD70463E56FAE07CC9A52C96208F47B0 [email protected]
913,023,263 *5F03C866937ACE1DE480445EB34C17AFFA020318 [email protected]
913,023,264 *5F0D93047B665E79F4375FB7CC7D96EC6A29A62B JIMMYMARSEK
913,023,265 *5F0ECC0962FD6CD8F5833391CBFDDE205F480E2A JIMYULE
913,023,266 *5F0C2D290F5C10C13762DD0124BE4A3934F12C66 "LISTER/FINDC:
913,023,267 *5F072FA77EAF797BF59914CF60DA5CF560EA834D [email protected]
913,023,268 *5F0BE3397A54379C2D959C6540636197E348A75F lk]h
913,023,269 *5F0E2DE802AA3FC597E11010355E6D0DA21389C6 JOESPHBUCHSBAUM
913,023,270 *5F02746C05594FE97B4AAC7395D8174CDFA5BDFB JOGINTÉZMÉNYRE
913,023,271 *5F003228E6615A0C55727C7B80FA13BB85DF72AB johnathonfallie
913,023,272 *5F0064FE102B1E007C26444325E8CDC282410E26 johnhasbrouckvanvleck
913,023,273 *5F085B7B04458753073F8853D5EF872CB8E3A53D LON.COKELEY
913,023,274 *5F00F83D37045D408A426AF949786C544149703D lonnycollison
913,023,275 *5F02DE8F621838219A3D8BC1C2F1CC1628EB8C3C LOOK AT US (A LITTLE BIT FASTER EDIT)
913,023,276 *5F0441D22380245D1BD993A4C37439A0A6C484E7 JONTOK
913,023,277 *5F06C7A73E83B9434C85E63DF98798603EEAB66E josh.simkins
913,023,278 *5F0E39B4286F15D227ED834F57889C936D365585 JPINNIGAR
913,023,279 *5F00AD26D8F5AC6E8BE344AC37437A2493187D38 [email protected]
913,023,280 *5F0B94F198DE83A0DD8043B5815174FB40855400 JUDSONBIEKER
913,023,281 *5F045A742B01B56DC8DF3D36BCAA6AD954397C5C judsonbilger
913,023,282 *5F0BB7AF5B2323B7768A449863E3D24852535BD1 lucretia.butler
913,023,283 *5F023D9A2F3EE6012AF557B0A306B94AEAEBFB8C JULIOGALVEZ
913,023,284 *5F02691D635FB0D7D2912BFAD43FE62F6B6837EF junioresera
913,023,285 *5F01986EC300B7DC9BDFFFD0FDFA46F9D119A79C JUNIORLLARENA
913,023,286 *5F0192630D8D0EF54DDA6BE480DCF4BA67902E59 LUR=
913,023,287 *5F075295F7A173F6B0C952D242355BBBC2F0996F lynaljon
913,023,288 *5F00266B1626F62ABB017FEE006E6CE73B2BAC19 LYNMCLOUGHLIN
913,023,289 *5F0C4FF229F3EAA113E603B31300248A3F59D2EB [email protected]
913,023,290 *5F00CC3AD22458D30102995D87A394CEC1BAE68E [email protected]
913,023,291 *5F09CB4EAB2B32B06F07C76550CADBC07B73DCF0 [email protected]
913,023,292 *5F003BB62783A966EC4B4770422FF2496A3E4B73 lzfe
913,023,293 *5F0A69BD1277DD2AA2C5797084B709C218466C34 MA9N3+0M3+3RS
913,023,294 *5F08E3545631464502D438DC0E1FF25D59BD3427 karen.teng
913,023,295 *5F0A01F86C52628A4CC1A6BA04EC20789FA40178 KARRINELSON
913,023,296 *5F0D3C271803917955EAF364D1F64DEFD3923388 [email protected],
913,023,297 *5F0CAECB26E17676119E8B9C782421E847471CB3 KATHITAVAAMH
913,023,298 *5F0C869B44ACF207527EF0E09EC3B768210983D9 KÄY…
913,023,299 *5F0C5F973A3A6768526D45F367C6F8926D4FE109 MALESHA6
913,023,300 *5F0AE5DC33C63E1F2C0FCE699DD4B3A62B3BDD09 KEENAN.SAMPSELL
913,023,301 *5F087649D05E361D294797EC2EAC84B9B9E0F58B [email protected]
913,023,302 *5F0E907A942DDBACBA2B68FECB31F9C6C452313B kenethesser
913,023,303 *5F0F44284CBFCA63C2B5E8A1668880ABEA1A5A63 KENTONSALVA
913,023,304 *5F0EF3EA14895B6FF632CDA0E32AC78D29F1CAF1 marcellusargudin
913,023,305 *5F03EC84B706D0235DFB919D428E9E2140F86356 KERCIMTARI
913,023,306 *5F058592489AA2DB7F0405BA4FD0C2F9858728A1 kerri.darby
913,023,307 *5F0FE82EBA329890854709926A5F9C8E19511660 kestce
913,023,308 *5F00874B6D19FA0BAF2D4429BBCBB4B6A749772A KEVENCITRON
913,023,309 *5F0EBD7CA4E76B362F282675898985AA5D6CA4A3 [email protected]
913,023,310 *5F0066E64256B6433179351EDB542CFCE3E5A1E0 KEVIN(THETHEME)
913,023,311 *5F0D3D07EEB911F0FBD20793736AFF78FABB713A KINNBRTEN
913,023,312 *5F0EF7795AD1A3CFE91B0843D14E07B336579025 MARSHALL.MILITO
913,023,313 *5F0462C3215673621B6A809299F03002B7919EB0 kir*
913,023,314 *5F027F246175FD8481E1DC9009CB1F3EC72E5368 [email protected]
913,023,315 *5F01EED0E5D78BABD9D7A12434D4F541DC193611 KOLKMAD7
913,023,316 *5F0DAB9CDE205719B9CE7992D6933A7C18FE69F8 MAURICIOBARRERA
913,023,317 *5F0557F4DBA9584E183D55BE6B9F8F2E2E9A4F7B KOORI-NO-EMPEROR-II
913,023,318 *5F0E47C895C4E836C4FA9928C00146FF7C01D54F MayuraPisaroto
913,023,319 *5F0DB550171F9B237C0C61A1201F7D55D86F50AA KRUIDENS
913,023,320 *5F046142F42139226064D1E545213CC699B027E9 küstenpegel
913,023,321 *5F0FA51C32D91B40FF8B5FE4B72E697A29EDB40E [email protected]
913,023,322 *5F0AB82E4169074F54B789721420B556D5303E60 LAJALOUSIETACITURNE,SOUSLEDOMINOGRISDEMAURE
913,023,323 *5F0A16E05EFE94C88FF4C059C050B060B8A380CB lamarheines
913,023,324 *5F0E9997C239037B07925C0F97AF80DCD7F06079 michelseppi
913,023,325 *5F00B080AB41924DA75D76400C4052BF7BF62C50 landondolbee
913,023,326 *5F0C8E472450A39B5548E11BB0DD5F2C481EF514 LARRY.HANSON
913,023,327 *5F069BD5274BA763E2BAD307E6786FE9BCA29802 LATONYAWINN
913,023,328 *5F0983FBA000AF5E9AB9794E5CF5C692B34A2B04 MILES.HERROD
913,023,329 *5F0C64C2DB27A9F8BB5862895C97B9C435F2D546 lawaljubril
913,023,330 *5F08E5BE6F41BF27320BDDC4005C8B40664884F5 lbnolet
913,023,331 *5F04A258FAEBD992804AAA5C08B88DE311E78415 MIQUELSAYRE
913,023,332 *5F0A82208C551F3ED58B1FC1B770CFB3948B6AF2 missalah
913,023,333 *5F02B96BACF4FB87175B63A34C1A9BFA817D6C76 lénard
913,023,334 *5F09F7A0C3886589FACC1CA56B011FE26865A4B0 LENNYMASELLI
913,023,335 *5F0C924419D480D5C5E21A0484512CFDD587D087 modem(sting)
913,023,336 *5F071BF89DDA05FAD5BE8125FC2A51F59A33B0AB LEONEL.DEMOTT
913,023,337 *5F02442C41310A289E93843182E42CB87601E2FA MOIRE02
913,023,338 *5F0CBFF16154FDEED3092901C842FD9218209523 *monkeymoe
913,023,339 *5F028A2EEF8B0EA9E158AC91B5FEBCCE911B2F4C MONTYLAZEWSKI
913,023,340 *5F0A780C60645BE25EEE8FB04BB221D5B2D6F414 lib3rat3s
913,023,341 *5F0A80C1FEE53AAD4279434F8C2D121EA9715F74 MOZBEEN7
913,023,342 *5F0AFFB6AE7E7183B6472A611B9643CDDF74832E mr..opporknockity
913,023,343 *5F0735B294F3A9321B142CB3DCB5463F49D7EF05 mufinella
913,023,344 *5F09C3082AC973DB9706E3F37CEEB29CBCE64E40 MURREVASLÄKTET
913,023,345 *5F0CEFF1B2A49E126C25A853FEB2197458D7596A MUSICBEAVIS
913,023,346 *5F0AFBFD402AA4E931D2A2332E0C2FA5EA556FCC mutande
913,023,347 *5F066F22A300AAE2808342006247BC3A34F7F8E7 LIVE INFERNO EP
913,023,348 *5F0450FDFDD042BB0BE6BECBE9B20D9877007B50 LIVYERES
913,023,349 *5F0775EE96E5965404635395887BE1C64A01B756 [email protected]
913,023,350 *5F0A90DFFDB8082698D070B39A6965AE4AF3666A MY.LITTLE.SHOPS
913,023,351 *5F0B9A802C2F9D839E71F97709AD5B70E13C6EF5 My-Melancholy-Baby-(master-take)
913,023,352 *5F098BD36B0F43FA399E3A54321A845B2C02AD7E lloydlathern
913,023,353 *5F061D5DAFBB6B80EC14CEF155DC4FD78DEFCB0C LM!O
913,023,354 *5F0A0FA0F709664FEE1D0730FD597D0ED3941908 LOCKRUP.(HERDING.CALL,.1954)
913,023,355 *5F0F66CB7BAD60AE60765A01D92627EBA3C173D7 LOGANAUMICH
913,023,356 *5F05502A7308D10E5DDE74F4480782D800029065 logisticsistheballandchainofarmoredwarfare
913,023,357 *5F0393AD64ED6887A89305D5E1A089FCC870285E N39O7IA7OR$
913,023,358 *5F0837C1A3853E2B168916E82D414EC8E88BEC5D -LONG-VER-
913,023,359 *5F0715C4041F4A78DF9B0896FC2B73440E5CA0F4 n4ntes
913,023,360 *5F0DB537CDBB846BD87A17FE3E7BEA0B208DF988 N6AZR
913,023,361 *5F0209305107173354A8256DCE2D963B908DB35F [email protected]
913,023,362 *5F0B1EB90952851BFF600F16941751E99AABA456 love feelings
913,023,363 *5F083140141458F785FF2CA4E6D693B4AA823FFE love.&.war.(hochi.remix)
913,023,364 *5F09A1422792DE828E792C3845755F2D6EF40281 [email protected]
913,023,365 *5F04A3EA07A90D5FE16E1AC80FD9794B7E637069 LUCAS.SELEY
913,023,366 *5F09DFA58A5143E3A8C00330B56265EECE67A917 lucasthach
913,023,367 *5F00AB7571FDC8F8B1C4452501370A793798C3E1 LUISVLJERIC
913,023,368 *5F0D594568FF8A87EC8F3BEE21D3796D02AD42F5 neiltofanelli
913,023,369 *5F057C55C3D20209E463CB432CFC65B910729C8B LUMET4
913,023,370 *5F04692471DE9170D66636017B5BDD0D0FA2971A NEO´S»
913,023,371 *5F07E087145F715404FC24C9419A71D2B6240058 luthernitzsche
913,023,372 *5F03D0702635BE38FB50055C245C8E612FE54B67 NESTOR.BURROSS
913,023,373 *5F05CC97258DD96354553C0C6FEA36E3D981EAFD lvaro.prado
913,023,374 *5F08B3535A7C576EA0280260DD097D07DE943FB1 LYDFILSIDER
913,023,375 *5F0F1C8A7E4E61A48F327717CF5D3D8330B93B5E LYLEHAYTH
913,023,376 *5F0A55D1402864260762FE437D2F7AB324512B6A NEWTON.CAMPAS
913,023,377 *5F0B9C3DD82B8F05D1273042E88B91DA380FB030 lyriske-stykker-hefte-9,-op.-68:-v.-b
913,023,378 *5F0577ACBE0762206462ACEA423714B2ADF78E23 m\\66-080-20
913,023,379 *5F03C420054FDB09A0D4B7CD3225314B602316A1 NII!
913,023,380 *5F06CC69B4B72D3BD615B6F98B5371E95D20EB95 NOBODÉCOLL
913,023,381 *5F07714C1DDDDEA7D12BF45D74FA4FA7A86F19CC mamaia-constanta
913,023,382 *5F02BA6BD36912F5A5E25E11EC629A3ACCECE3D6 [email protected]
913,023,383 *5F034CB81B1E540AFB7A0A966F9D200B8FDCFD88 marceloleech
913,023,384 *5F044553711568C3F12CED65ED8B83ED687A0DBA NOVOLAZEREVSKAYA
913,023,385 *5F0D18599E72B4A0699B9552F1022E6303063DA3 markcantonmar10
913,023,386 *5F06D8BE0F008365678E563253B74645643CE892 numps1
913,023,387 *5F0A1B7A739478186AA49BD39B4B3E07A7AFBA26 [email protected]
913,023,388 *5F07B5EFA14A507979AFFFBE5E57939D3A990E11 nx8qj3yqtf0io
913,023,389 *5F08006931626168EE8E1E524ACD63164344CCBC O3158436608
913,023,390 *5F0A0137F3973D20E686ADC37ABE19AEE66D425C OBERSTERUNTERSTER
913,023,391 *5F0CA12579687326EC0F57E125A124FC61240F90 maryann-hancock
913,023,392 *5F01069BF294952A177FB6F5780DDB727E266D3F mas.masriyah
913,023,393 *5F03B83F91208D984952530E5A06EDB2212058DF masonmalleck
913,023,394 *5F0322590E8A555E8CDD423F5141F099F54E67C2 )o(`d##b
913,023,395 *5F0853243611AE8850F0C6E9BC0DA232520F582C matthewremick
913,023,396 *5F0CD49DF135942AAB7E598F8C6E0347E35F1400 MAXIMOMARSAW
913,023,397 *5F0AA38F0DB4F3F78FC0FD7EACC7B1D092A66D77 MAXWELLKEARSE
913,023,398 *5F082F910E6968149DBF6A6F5C726D7494575063 oneilli
913,023,399 *5F01302D26B1DE83BFD2065678098D43616D4943 )O(~.~.QB
913,023,400 *5F0DB8BECF4E056FFF606AE0FFF6DBCB7C532D24 organoboron8
913,023,401 *5F0CE5F3BE3AFF0655D842387C35F44928207DE3 orlandovair
913,023,402 *5F0F105A57238DCAB89A84FA98CAF15424266023 ORVILLE.CRIBBIN
913,023,403 *5F09732000B143C8FA6660060A6DCFA6470793FC MESEN+ER1+1S
913,023,404 *5F0AA4B5AED66712D535CC1D1627EB5472E18A1D oskarandraymond
913,023,405 *5F0B9B47AA42551D41E2BFEC3F47FE696BF84C32 otacela7
913,023,406 *5F09F0837A49B91F6DF3AEC030EA7665762147B6 MIASKITE?
913,023,407 *5F09FCB2B61ED5DC5707EDC4FD0466C3DD6BC31D MICHAELASINAS
913,023,408 *5F0DEE3B455E8B71EE17E0E412388E96EB096B78 MICHAELPATOLOT
913,023,409 *5F0B3E5C4758603EE5679C0E9DC057B26C5DE23D MICHEL.MILOSEVICH
913,023,410 *5F0A0C776DD9A5E85B4E0A40C366B992FA6F46D7 MICROPHONE.MUSIC.(DISC.1)
913,023,411 *5F084B01F9361F48BD2D9617F8EAB797E033AC64 PACHIKO
913,023,412 *5F0556A25E2AF64CE8D141E1124BFD045846C5B8 PACÍIFICO
913,023,413 *5F0681308A38C23B62965C6E17C7D46FCDCB122E MIQUEL.GENAS
913,023,414 *5F09A92003A88FD9CA5107E9510E5F5428B515B9 [email protected]
913,023,415 *5F0565F6E52D74511B10F00BB819549B7F3C1A77 MM.WILDMANPRODUCTIONS.ORG
913,023,416 *5F0146C52F6B4D2041EFED450BE5757138AF6E5D MODESTORINE
913,023,417 *5F091CD2D2CB7462EAB408D01DFB5032EE1C3403 PASTAIE6
913,023,418 *5F055AA74813F2131E57C71275B2B33039A78A0A PATRIOT.MACRUSGAIL
913,023,419 *5F0FA83968F61AB416B559981923A331C4BD568D P=====B ~ ~ ~(0_<)
913,023,420 *5F08791F14F2879E935D6CC1917F5F891EE42A0C pc+
913,023,421 *5F07B8BCF66681364568FE60619F8C2481CC280E p-da
913,023,422 *5F01F2EB2F7157EC330176D74323C90131D81E3A MOSESGUMP
913,023,423 *5F097B2B8FCC5B6F2E563BF596B05A1047829C9C moshebasse
913,023,424 *5F03E7812E877E9B24E1955564C477901C059F4F MOVE4B1E$
913,023,425 *5F05C5858EC055D110C7B598B2E4ADEE2A5A728C MTXII
913,023,426 *5F005401ADEFDA0F7301B46FF9B72B6CA56720AC mufinella
913,023,427 *5F024E835F11C5B36C4D1EA0B63699853AA3637C mustafa-alshami
913,023,428 *5F067DA869BE135868F88ABD8A696ED5F47A5AFD PILGRIMSTALES
913,023,429 *5F01D3F0740C3388E6D39F52C698D9A935E8B71F MYPONYSN2DEEP
913,023,430 *5F0942D9EA3F44C7AAEFB0B6CCEF10CE507587BC MYSEAN39
913,023,431 *5F0E8DEC19D1A0FAA5D4B999695087A43DF272C0 politisation.
913,023,432 *5F01FAD9E308F156586BCBC021B5C0AEC7489724 P#)~O ~O><
913,023,433 *5F078BA73E3862574BE1CAF81537AABD77D2B307 POPECLECTIC
913,023,434 *5F0DABADB26C5FFEBE812EDC5B6593CB77227103 NATHANIAL.IHA
913,023,435 *5F064A56E3B73769CF5EBCD29E828D7DDFB9EE6F NATHANIEL.SNERPUS
913,023,436 *5F0C9E9C71A193663C4C1B3987CB22DCDC2D6ECD
913,023,437 *5F070A702D175A452DF65281EFD4A9144AA40917 NECKWEAR1
913,023,438 *5F095219C5658C9E7365FF70ACF6ECA84D06F816 [email protected]
913,023,439 *5F008ECBB390A07BEF2B825C2019626B6FEFE9B6 NEWTON.CAIRES
913,023,440 *5F0268168A44B8EAB463CDD7491FAE594176052D NEWTON.TIETZE
913,023,441 *5F0AB4275A04F0BEA3788B382E144B7220FB3E1F ngateway8
913,023,442 *5F068B23B628AEA68255342F4AE2EB179CCD6685 ngezztdknjcyzjbindvjmju
913,023,443 *5F0393342C23CF3C8D87E1051FD8E303A31EDA39 NINATHAO
913,023,444 *5F00DAD7848580BBBDF67CD2A3626675330F541D q2k
913,023,445 *5F0D0AEBFB20773802D614B8EEEC2C10C5109ED2 q##b~o~osplat
913,023,446 *5F0ED587A6A66BE97B007B0BD25275C43FEEF9F9 NOLAN.ADDLEMAN
913,023,447 *5F0D189F98B477F9CE6E347641E30AE47597BE4B NOLANDARWICH
913,023,448 *5F09A722981DAB0AEC3B9F8835451773D2D69659 qllsgwljq
913,023,449 *5F056CDAB850FE2BC2968EAA949AAADD2881C899 NORBERT.PIGGEE
913,023,450 *5F0A585B871A5BE12FD766A2120E3285100329FD NOVOPALÁCOVÉ
913,023,451 *5F0795CBB0B010F5E101D7976B0BD52E1E9C980F quincytheule
913,023,452 *5F08D9C855EEE734FCFB32C9295917DEECD5645A [email protected]
913,023,453 *5F0DB3DC3DBA23E50ABA6918442818A79E2CA72F [email protected]
913,023,454 *5F08E49846159320AD295DB6D1B8E17F107F63FD QZDL
913,023,455 *5F0E1E1A59C9665C29E87E5B1376518801B56EBC RAMIROMETTENBURG
913,023,456 *5F0E869F66955DBAD1591AE535489250E54BD674 octaviohevner
913,023,457 *5F0662E6960F0DE7ADA123919106B7BE88361FAA RAMSFACEMANCHESTERUNITEDINCARLINGCUPSEMIFINAL
913,023,458 *5F07481A120E6F71143AE15B653A6B22A7643DF8 Oftreasonousmalice
913,023,459 *5F0377DD7C424CA147EA20BC6DBF5C6AD2F7DC6C RAYFORDMARE
913,023,460 *5F0DE73D5BF4414DC5C1D3B035900A22EA20B1EA rayhuie
913,023,461 *5F0FAD067923772B55371E3F293237E95E18914B OMMADAWN, PART TWO
913,023,462 *5F09DFCCA280FADBC3C6CD4A883C6A270DE6ED4E [email protected]
913,023,463 *5F015580EFE4FE70619DEDC8704C024E16DBA71E REASK3
913,023,464 *5F005FB43409E2615DB502C396546433D04FEDED REFLEXOLOGYANALYSIS
913,023,465 *5F01AD734426948C603D9E9235D587CB65F2049B REGION-CENTRO-ESTE
913,023,466 *5F051041AA485563EF6EEB370D27F01B9788D00C ORA1ER
913,023,467 *5F0E110492D590E023CCB4A8CABF1925DB5255CB or{m
913,023,468 *5F040CBC15A451076CA41CC32CAC46760FE8E39B over-an-internal-bus--in-many-network-environments-there-is
913,023,469 *5F0CDF63A34E6F75F8246F96CAD588219DA474B8 OVERHASTYA:
913,023,470 *5F0AF9ED9EFD36E5DE3A82E4DA7F6C6F81B3A38D [email protected]!n7$
913,023,471 *5F04F04F9A5E1A8672A184A9C58D70D8BDF77E55 ox6nnvo
913,023,472 *5F04984E725B47FC46EA93BE6EB60FA564587004 p0+5!35
913,023,473 *5F06E1EA1318AD7EFBD8FFD1F123FD257034A2B1 P4P4I4
913,023,474 *5F07040395BA39D1D368ABB9BF291BD1661526B8 REXCUFF
913,023,475 *5F0DBF4954E48131986109B7BA03D63BC4C66CA6 palmergailis
913,023,476 *5F065D911F46E6FBD3F0AA67D944DEC9AA861C47 RICHARDSAMMER
913,023,477 *5F02D38B17D8C36492E23E6EE3FF32F1CAAD74D6 RILEY.PILKINTON
913,023,478 *5F0781C4449F0B1422C6A7CD3EB74D20A093989F PASTORALEFROMTHECHRISTMASCONCERT
913,023,479 *5F08292BC09CBEFAF3EEB222FAB02EEBBBF84934 PATRICKGRIFFITHS
913,023,480 *5F097C2F535D61ACE8B3804F578037B8B5F7482B pauline-schmitz
913,023,481 *5F074DF935B6FE8C87A2FED66BEC7776E6D0A428 RNETEATRING
913,023,482 *5F0D415A3F2D0D44A24E1E6EB469F904AEA17B3F pc+
913,023,483 *5F09AB4B96E9368036E3C8F415E9BE6D0A9DF571 PENEJOSA
913,023,484 *5F02E949B8FA55AF3E6BE76A1B95EDE201E09B32 Pepperland.in.the.West.(disc.2)
913,023,485 *5F06D86A8F7364C3021C55861471841912BF7953 PERCYSUN9
913,023,486 *5F0CE00E546C49FB34A73971FA3C668454B85C05 ROK 101 (PIE
913,023,487 *5F0B684E6090DBD08D0C4E07F32115232E35F36B ROMANWACKERLY
913,023,488 *5F0B0F7285AACF36C02D1302C5EE1317DAF7506D romeodominion
913,023,489 *5F0FAB48BA6E02E099C8D097A478D1032A221C1A ronaldcraner
913,023,490 *5F0FDE4FB6C990A2929DBFBD1B9D3864A9F54F74 [email protected]
913,023,491 *5F0CCF568F22BDD891B3DD97BE9EF349257168E9 rorycrisalli
913,023,492 *5F0DF9844F0CF7477970DFBBE820FB140BBA335B ROSABELAF
913,023,493 *5F020AABD1E4646DD3B8CB650ECC2337FED2971F PICKNICKMAND0
913,023,494 *5F075903766A1C0C1306C353AECC9C444715F394 ROWEL-AGUSTIN
913,023,495 *5F0B6C43612156960DBB9AE342947667B8A7EB6F ROYCE.WARDE
913,023,496 *5F07101A717AAE57752188E89919548E27B612D7 ROYDIGIROLOMO
913,023,497 *5F064A5A01F02F0A58EFBB0F20F07F2AA547382E ROYEPÍŠU
913,023,498 *5F0A27804C18D639AC1B3790DEFA6B8A20191103 PKFPMZZIJC4
913,023,499 *5F04EFFA9BD4CC675CDE7D7F6F2BBD8E07539387 RUDOLF.SCHLAGER
913,023,500 *5F0E889BA93E2C8D5B4DBF167CDB4F921546786F RUDOLPHBRUER
913,023,501 *5F067871868DB991467088F62BA7FEE8C7188F2C [email protected] ~}O{
913,023,502 *5F0B1C7B59B553626ADD85A05CE19E2FC5DF5CE6 ry"z
913,023,503 *5F05CC1D6693BCFB7098E9D6215E9790434B18CC POZADINE.1
913,023,504 *5F0AB353F039F277ACC0749E6138C7C82D9F1F47 [email protected]@7!on5
913,023,505 *5F052C3A219D3A825D744D9116B31C6816BE31F8 SALMERES2
913,023,506 *5F0051FECA7D585A714173711C8C191C81F751D5 SAMMIESOBIERAJ
913,023,507 *5F0B7C003800266E661388EECC9C33E338926207 samualreckling
913,023,508 *5F05DE0871CBF86EE8155B822F7C5743E437DCF0 PRIG-STAR-THETA
913,023,509 *5F03A98EA1AEBE733CCF77F677CC076590B0BF9C SAVANNAH391
913,023,510 *5F0055C5B1B68C0F116F0C3C0E4BAA216D07596A SAVECOPYRIGH7
913,023,511 *5F0CBC48769A86C8EA1B38E9A04FEDEF623B1157 PURGAVERE
913,023,512 *5F0DAC3F1081AFB752CC442166E1DF79A130E801 SCARLETASDFJKLING
913,023,513 *5F0BDED0E9877ECE9315164001E04FCDC2E7E456 SCARTING8
913,023,514 *5F018A3CDA8E796C0D16BF11D6741566BC69D0EC .SCHARPING
913,023,515 *5F0CBA504682E2070218E4B1919FC72698924861 SCHERZONO.1INBMINOR,OP.20(PIANO:POVILASSTRAVINSKY)
913,023,516 *5F01AA21174DEF9140B87C7CF93965B648CD4E3E SCHULDIRIS8
913,023,517 *5F03CD25EDCC26CEB4E532F0E2DFBE5C8F2DD503 SCIENCEKATIE4
913,023,518 *5F04B9B24409FF0BDCE692A37624CB0D914B4CF7 Q------B ~ ~ SPLAT
913,023,519 *5F03BEAA4CD96B7CEA8F00CAC35D09BB30E2FC70 [email protected]
913,023,520 *5F0ED13C3D959B7A974FB8506888E47D216F0540 [email protected]
913,023,521 *5F04257EDEC375C3BDA806CB3E2540E2836B4283 [email protected]
913,023,522 *5F0E10C58B56DF9564D7FF0DB1FBD1F8A96658A8 QKEFUJ1QV
913,023,523 *5F081A6472DA298EEA8AE983E31929BD688DA2F3 q######p` splat!
913,023,524 *5F0669DCFFBAAE62B9CB4838893CCBC0482854E9 sekolah.minggu
913,023,525 *5F0FAF6188F7C18EAAB125B42BE806CBF6DB44E5 question1
913,023,526 *5F09E9EF5DED477789F423E6A99AF7B7D3B6AC37 QUINCYDUNSHIE
913,023,527 *5F0AF12D0D8D1D0E182B321BB887560951F37E24 [email protected]
913,023,528 *5F0FFB536E00C9E657C719FD369C4A990E059952 SESSIONALHYMNSEXAPOSTILARIONS
913,023,529 *5F09F7D53A8067A4BCD018D48D5EEA1AD74C6B08 RAFFICAS1
913,023,530 *5F0466F8F4EAB14790CE41C978B0CC466F426D8E [email protected]
913,023,531 *5F0C1BA2A34E6C5ED6311066B363A902FBD2DFFE rahul.ramchandran
913,023,532 *5F057FD453DBC486F7D469267C18B893E2385CF1 RAMIL-SUSANO
913,023,533 *5F0F85F14AE4DABF3DCC8F7997C9C414169AB372 RAMON.PARVIAINEN
913,023,534 *5F0FDB6FB7B7D54842088F2107D058915C5EAA8D SHANESHERIFF
913,023,535 *5F0BE7FFD840D55C084598F3D7D3A8EBB8D073F0 SHARON-BOHN
913,023,536 *5F0BD782F31AFFFBD765B71E0A82FD89C91F5E25 SHARONKEAN
913,023,537 *5F0789928BDB76723734B8A9F62BD0131A6E26EA raubkopierst
913,023,538 *5F061C167C0231AE62764C0807D9C7DCB2CD1AE7 SHELBIEOWENS
913,023,539 *5F011B99136CDC75700025CD4CB354AC502F4166 SHMINOVATER
913,023,540 *5F03B73806A565E2DDC5CEE8B50B85ACAD272DF1 ReddyBobbioeilsuoCompleso
913,023,541 *5F0EE6478FF374B5F7544BA39E1A8046EE05DF6B REFISKHANDLARINGS2
913,023,542 *5F0B40831941322916E8CCFEC1BC556246AD6B8A [email protected]
913,023,543 *5F04BA71BC93F5B5626BC38A7879C371BBACC565 refweissbach2001
913,023,544 *5F0C959E7BD23527873235048E058C8CA20EBDF6 REGINA SHUNK
913,023,545 *5F067B7203F27A47E25A33E06018C0073791EBBD REGZKENT
913,023,546 *5F0A0EE784922E691B811C159ED3DDE3A6791B4B similarity&c17
913,023,547 *5F08D1637B440C8BD83067A68B07BED78C45925D SIMONECROLE
913,023,548 *5F0867B9D6A163C0382228A607078D7702121296 SINTER2K
913,023,549 *5F0EA6CB11FBA2158651D83C8BC72E907B1FBF98 SITEREVIS
913,023,550 *5F02C48660414D81E982E2CD5129FD9FF3AA44FC SKOLEMESTERAGTIGES3
913,023,551 *5F0838CB0B4A1F52071401814486F5B62D75F644 SMAYILOV
913,023,552 *5F07709DB4715C92E9342904319D4B88DC3F7C67 REYVIVIER
913,023,553 *5F045D293A363234C3DFB0E9710C83A14F4BF7AB RGH6
913,023,554 *5F033BABA423625FCB174E41B00205FA7C6F825A RHETT.PHYFIHER
913,023,555 *5F04A133BD19A165FC8BEE8A36A9B3FC713236DB ricardobagg
913,023,556 *5F0202A22E05E5A5C518AE9AFC258825E264BEDB solípedos
913,023,557 *5F03DF50579EF79BF69731EB6259402B9E41D7AF somarolda
913,023,558 *5F01A2BCD0F57F7C323BE8A9B5F22EC1C17D09D4 SONDAZE0
913,023,559 *5F0418DAC18D5802B3248E8415E80CF8E85F1E99 rileycavaretta
913,023,560 *5F0EEE8E91D9FE412C8BF97952117221F2F7DDFD Rim.Jhim
913,023,561 *5F09CB5258018ADC053217DB619672AC7AE63756 SONNY KURNIAWAN
913,023,562 *5F0B88D239CF337B650BC3F4ACE7058B36D03A80 Soon-We'll-Be-Done-With-This-World
913,023,563 *5F0C4A1C552CDDEADB3DADD82BBA043148435361 ritchie.dotson
913,023,564 *5F0E2F0ABF66969E2BC4DD3461191FCCC146329F [email protected]
913,023,565 *5F0213D5DE9293578FFECA33A7ABE812C6B689E1 [email protected]
913,023,566 *5F02D7D08E646D450776346784F0AEDD987F644A rkiddene6
913,023,567 *5F0FBBC1875C100C39FA6B06104AC78EA119BF30 ROBERTO-DANGELO
913,023,568 *5F0F0C516B446B6B29EC75131A3348E214338521 SPECIALBRUCED
913,023,569 *5F0A34E797D514B055DF2081DCB53A0D47BD30D5 rOboed'amoreinA-Dur:3Allegro
913,023,570 *5F063D0E8B17A0413507616AF65F8FA0559ED404 RODGER.GILREATH
913,023,571 *5F04E7A87A2D3ECB21047EEEAB9104E23474BFD7 SPLAT!0~.Q####3
913,023,572 *5F0FE01C26D836C5ABE3B910C7A764CAD030279B splat!~`<###q
913,023,573 *5F09BE312C75C57154C589B1D44733B15DA80AD2 ROLLAND.MADRIGAL
913,023,574 *5F0B54D748F6E21A1095F656E94CF841A4084DD9 SPRJTEMALEREN
913,023,575 *5F0262DE8300AFF2D2CD090D3907926449988E0A src=http//ecximagesamazoncom/images/i/21jqavtsmwl_aa115_jpg
913,023,576 *5F049792D365BF105820B4797B3FFE24A16A1A33 ronnywrenne
913,023,577 *5F0FFC7AC410C0D5F38C53C8ABB83485EFCD97AE SREMAKSE6
913,023,578 *5F0C7DB1D224721FF96D215FB0BBD2860C4F49CB roryrabideau
913,023,579 *5F092ABB476270DD3396ED6FAF07C4ADE797E7C1 ROSARIO.LAUNION
913,023,580 *5F0E796C1AFCD89EBFACEA8806F7AAA66DDC3126 roscoesomrak
913,023,581 *5F0B5F19AA474A0F45F9D957E3A57093C4A770C8 rose-window
913,023,582 *5F045D1BFB4C6D9521F468E91C1FD3D5984B1A1D STARVANC3
913,023,583 *5F010AEFCF816ADE1798963A36424E77F9502ADB stella123123
913,023,584 *5F01170D1CCCFA1165AFDE648059182D7E260439 steve-weis
913,023,585 *5F07DD22230C71C4D8E156FC3FC6DC6AF0D5C8F6 STEWART.GLOSSER
913,023,586 *5F081FC187CA86C056F603C552F075D7E53FEFD4 R-VIOLONCELLO-UND-ORCHESTER-A-MOLL,-OP.-129:-NICHT-ZU-SCHNELL
913,023,587 *5F0A5385420F8D60D5A21175F0788A6965FA0E52 [email protected]
913,023,588 *5F0E95DC96EA97B7ADB96EFDD71EEA9B7A19DE70 RYANCAHOON
913,023,589 *5F0FC11BC5C506A7E580869F48BF0FEF549EF053 RYDER724
913,023,590 *5F03FE17A2B369659B13B2DC17D54FE7CBE89C6D SABARIKRISHNAN
913,023,591 *5F094241542A7817D5A1CB6205C79D99B0DAC11C SALMONCHAOS8
913,023,592 *5F0F74FC5EC52DF9B4D7A2741E52E67FD25E8FEE STUNTIST?
913,023,593 *5F06D9E05B418689D5D0ABC568D127470B7A5362 SUBORDIN4+3D
913,023,594 *5F04FA42DC22DDA441F21405ECCB089DB31E5106 such-is-life-(deep-dub)-(feat.-shanokee)
913,023,595 *5F0CAD242DC0990DE5F672E770D2C51A95E0BFA8 Suite No 1 in A minor - 2 Allemande
913,023,596 *5F0ECA7A6BF0B52FBF7EE836489C26987EF36915 SUKI-LUI
913,023,597 *5F09E884DA269ABA2E90F99305384FB7B57D70BE [email protected]
913,023,598 *5F0EBD8CB537C65B42F816234739970927B5FD7C SANFORD.SCHADLER
913,023,599 *5F0F896FCF9C192E759CB64A81525A0EAE598143 sangmaltby
913,023,600 *5F07F5010461F6386977CA43D366812B9E808503 SANG.WALGREN
913,023,601 *5F014233715EF38CBAF9FD226A25571C03F1218F santjoandemoro
913,023,602 *5F0316AFB6D4214D07560E23BA934C12E37CC57A SUVITUOMINEN
913,023,603 *5F0248AB55D044014524656F09E92BD112EC8C2E SVAJRYGGENES6
913,023,604 *5F04B26B3521CCC04B20FDCCE55215ABB67C1A3C sweetgeorgiabrown(featbarneykessel&raybrown)
913,023,605 *5F0CE355125DBCA1B554AB07E07CC72F0AC106F6 SCHEEFGEZAKT.
913,023,606 *5F02859FF9B18BB9DC0CBA056FBF196795AFFDB7 schnitrtlied
913,023,607 *5F0F961D0B8E2000F4C179FA3AC07A5CD50C3C81 SCOOBYRUSTY0
913,023,608 *5F0F7915E099CEA52A8B9B11099039492AE6F70E scotsboy89
913,023,609 *5F0C85414D1669A0AD1A2EE4A9058296894D8B37 T136707
913,023,610 *5F02320B7C838EC4472506D12275A9BA7FBA0F24 scriptdoron
913,023,611 *5F057D8BF180AA90EF33C3DEE2CFF76ADA71243D SDNOOLEG
913,023,612 *5F05FC27627D318CF38CBE7C89EC033FB983E71A SEANRIGAZIO
913,023,613 *5F09020DEB534E2DBF8D8BC23F9D82D810D85136 TACOBELL.COMWWW
913,023,614 *5F0FC5E692EAA08A8B7F1C4C2595A6982A9C1314 SEBASTIANSUTTEN
913,023,615 *5F01A10E0E68652CB02D2B5F9B0BCCB86641DB25 TALK85.141.134.205
913,023,616 *5F0B42DC947FA9844E55B74A24923F93DEE18812 talk8616112246
913,023,617 *5F0056DFBBFB4E58E350F593533BA4B6AE7F9D8B SELFSTARTINGA3
913,023,618 *5F00699EC60FD24A3C6B15E5F9A398F21B027EFE SENTENCESHOP
913,023,619 *5F0C4A13727CECC399C57079747AB8C583BEDDEC separte3
913,023,620 *5F06128CAE78B242326993FD288372FF93EBAE18 TANIA IKIN
913,023,621 *5F01AF995CCF63107B0345F4AF21DD618FB55B46 SESSERPPO5
913,023,622 *5F0C2DF8997E66AAA2453D199DADB3DBCCEA36E8 taopaowan
913,023,623 *5F0C92335281EBC338679B6E315AE91BE91CAF66 sethweekly
913,023,624 *5F055ECAA6D6FFF95BD13E83A22999BB389328F2 seymoursewester
913,023,625 *5F08C4930D4ED77C8B0028C8B2E27B915163A7AA SFRUTTAMENTO»
913,023,626 *5F0B589098107A1C02E825BB79948A29512BD6D9 shaakini
913,023,627 *5F0EE7164C055D17406E11EC4C4AEB76ABBD806A SHANNONDUFFEE
913,023,628 *5F02A29895363E8F91696CF4EE7317559C023239 [email protected]
913,023,629 *5F00ED2AE421C5A5E00462A111E9857986E22B37 [email protected]
913,023,630 *5F06C102C07901C8F583F7BA6A61436C74806CFB SHAWAIZ
913,023,631 *5F0470FF02B4AAD623BBD5ED2BD761DF81E23D0B SHEILATAMMY9
913,023,632 *5F0E28E5F52C0C0A5612E8BD90C1D3542C7CBD73 shelbymccathran
913,023,633 *5F03B242EF0D4C6DF62C9217BA53371AC060BE1F TEREZAO
913,023,634 *5F0BA5B7E69C71DA108B136E0E423DEA71F10884 SHERWOOD.DESPARD
913,023,635 *5F0E6E3C2339FF0D6C6BCD99735CC579908E3497 TEUTONICALLY
913,023,636 *5F0C9C796E6387087104C7F26F2BD88444EEA3BA thalhofer
913,023,637 *5F0E9291BE6FDFE1ED978925A3A358F9BE5B294C [email protected]
913,023,638 *5F06D8636527AA1562C201BA0EA0999EC5D8FBB8 SHUSHRUUSHHAKAH2
913,023,639 *5F0538B4DD224C0D60815D538032F32E45F22CE6 thatconnie09
913,023,640 *5F0BC8EB3E9A346B378CA60C18943A0DA18C2E2B SILVERWINDSTEMPLATES
913,023,641 *5F0951A7D9F4A85FF9005996C5B7FD30A77067CC sister(missceily'sblues)
913,023,642 *5F09F2F652D2F900CD5F625B24DDAD020FCBF182 therese-lunde
913,023,643 *5F0A4769CA9B4990BC7A4B89C51F173D88F47219 THERESTWILLFLOW(ORCHESTRAL)
913,023,644 *5F003C9D1B04128DB938F2AA1BDF659AD4C3CF6C SLVRTP
913,023,645 *5F071A900DCE135F011E1EFF419C2AB74D51E32B THILIPD
913,023,646 *5F0F06080F67E6A74D10025AAFC746FE7928CE32 THOMAS FERSEN
913,023,647 *5F0778166894ED399033ED6FA2E112D476B252D8 SNOSREVNOC3
913,023,648 *5F049503CE0D62EC3E03C162F5F5A4D0C22FD381 SNROBNI4
913,023,649 *5F0FCE0299E2F1177F32526EDE325D5AB675D450 S'O'
913,023,650 *5F0C1E426BEBC487BB500A5645596E552D25A116 TIDPPREGISTRY
913,023,651 *5F0FA9EAAD876EAC0806F27F1EB5D10A9B7A6B79 TILSKRIV0
913,023,652 *5F0A4A178DE2F5B33AF494F1365F4DA00E70CC0F SorryI'mnotbetterlooking
913,023,653 *5F0BCEE267E0004C7A62B1519BBD02F79081105E sp33d80a71ng
913,023,654 *5F0448A755707DE1AB4C74A13FB804B07D62DA77 [email protected]
913,023,655 *5F0ECBE9C128C6179E25217ED8469CD97ECAB0B0 TITUSVANSLANDER
913,023,656 *5F01706C336042C44E220ACF9C280C44234F2C63 SPLAT~ ~ ~D8
913,023,657 *5F0AD12B20BE9F35C67B24BBCBD861C04088C446 SPLAT!!O~ O~(####8
913,023,658 *5F0EDF31333BE80F85B67B2C7758C588860CF531 sploito~o~d#p
913,023,659 *5F082831EF32A0862F0CEE4F348B9A44C24B2E7C staffhorst
913,023,660 *5F0633218E327985B4F7EADBD4C804D7E5CA6D30 TRCCHRYL
913,023,661 *5F0B17605C37B50EF51127A9CE362BFB6C4316DA STEFAN.SALADIN
913,023,662 *5F0A4C53A6341A6E54BCFCD6DD31B3E475959ABA steukin
913,023,663 *5F01F1668958B4DDB8B59CD0DD5AECE5CD9778BD tristanvose
913,023,664 *5F0762D43A27D819B1A2C4E25D1FB2C8F09E984A [email protected]@[email protected]
913,023,665 *5F07E90A93D98105070B6AF1BA36760571C43C52 STMPBKPLTBRND
913,023,666 *5F068BA70B80D03A3EB4C4998C0C3CC9ACB17B0F STORE.DAR-US-SALAM.COM
913,023,667 *5F077A9B1180B7FAC3FB651F841EC1047D20D600 ts$q
913,023,668 *5F0A7F17EBDD4C880C88FFE9906B6F30EE545012 stval
913,023,669 *5F0AD5A5E24212A573A0F50F95F8DE24559C31D4 SU80RDNA7ES
913,023,670 *5F0308846521FB72D9636ED1A3FF437A3A009845 SUMMARYILINK
913,023,671 *5F044D6F0A557E734F2ABABE529549D27F72BACD SUMMER.LOVIN'.(DONNIE.BRASCO.RADIO.EDIT)
913,023,672 *5F0B77AA5AF23C42DC98C0BF84A0A18D3BC211DD [email protected]
913,023,673 *5F09075D727ADB28F091064414ACB83F2B4C9DA7 TULUKILLS
913,023,674 *5F04A7069CDB2FE0347FFE51815DC8CB1F69800C sungchurchville
913,023,675 *5F0DB5959B3A56D80B5BD55C6FAAD2FCF6C53E8F TWANGIN’
913,023,676 *5F0B6FADD15E40C9332FB2E06BB0B83E9F429771 symphony-no.-2-/-introduction-and-allegro-(hall
913,023,677 *5F01BF492E7FC93FBF247657814DE816C188D047 [email protected]
913,023,678 *5F00B9B7128AC3E6765182EA5F860F362FB0F533 ugisef
913,023,679 *5F0025186E904AB3C0BD4158EA7C14685645A997 UKONCILA2
913,023,680 *5F01B6EDB44522F363529E67E2D44D0965F2961F TAHIRK1234
913,023,681 *5F0A4C9ED4C277AB1A45FD6238F12F6197D3088A TAIUGNAL6
913,023,682 *5F00F684D824B9DE004163513683A679C056EEFF TAKE-NO-THOUGHT-OF-THE-MORROW
913,023,683 *5F0A2BE79F4B655416841076F0616B764E858655 tcherno3
913,023,684 *5F09883D9C8E669FEE519680B33E36C9B22B7896 TEKEYTYV
913,023,685 *5F00049590FF24C84CBE1272C0D4DC0EA6913DBD UUUUAA
913,023,686 *5F08FC11451A4F294349712363DF829735EF12B2 uzgqlfiupznp
913,023,687 *5F0A0DDD8BDD214357FD55DE85C49DB9878C5062 TERRENCE.MAHALA
913,023,688 *5F026071DE8EFB1A2A0C8AAF89667DE3F7D6CC31 VAATJIESTEEK9
913,023,689 *5F0263DF92E88F4920FB51A467F83A76B6CA3198 TEXASCONCEPT0
913,023,690 *5F0D86D04B68E5F6FFB5AAD989F30DD9A12978F7 THANKSBY
913,023,691 *5F0FD9687FB90589D9ACB874E1D2CE44563A2236 THATZEPPLIN12345
913,023,692 *5F01F58361884AD33F3FC25A62BD10035EA5243B THE.BALLAD.OF.MR.LAMATTA
913,023,693 *5F0415D5027B307B62BE4B47AF856EC1552C634D VANESSA CAZAUBON
913,023,694 *5F025085A1E28C2012ABB40A17A03ECBE0022FF3 THE GENERAL: EXAM RESULTS
913,023,695 *5F0FBB59684E1844FF19EB395B7006E9A26A87C6 THE GREATEST SONG IN THE WORLD
913,023,696 *5F007563C0ADEA0A84CCDB228DA063BB5C9FB06C VANILLER ARNAUD
913,023,697 *5F0DAC4A60FAC5A70F9BAD609F745AC6321E047B thelaw1997
913,023,698 *5F0CEF2C0852155DA276B6BED0B96F15B3AA34D0 THEO.EE
913,023,699 *5F0B7C37EBB4DDDDBF064A6BB8AF888648430BA2 THESE HOWLLSS
913,023,700 *5F09A16FC9C7642C8EE0711157E5D8CA7D4FDE8B THE.SWITCHING.STATIONS.THAT.USED.SYSTEM.6.WERE.NOT
913,023,701 *5F0826D9850A591273028AC839035C8179FC78C3 THURMAN.PISICCHIO
913,023,702 *5F0221C461FC80E72F379DA76AF7802B661ACEA5 VERONTWAARDIG6
913,023,703 *5F0CE07C18AAAC188C201332B9B6EF64BB5B1AFF TILOTATSING
913,023,704 *5F0883947D009EDAC97B14192F2C68A0566D0509 TIMMYBRIDGEFORD
913,023,705 *5F0561128091823BE52247E0C5F7F54B54F34C9A TIMOTHYMAULDIN
913,023,706 *5F06348C5E66657B7D75AA5BDCD02148321E5060 VICKY RODRIQUEZ
913,023,707 *5F02E96B69FA8397C8FE5B3C5590DDE0762500B9 tina-kalinowski
913,023,708 *5F016DF2CDCC6AAFAB3E9C24AE6A7BC77C490DFE VICUNHAS1234
913,023,709 *5F08EE30200CC2FEB1C54B51BB09A0C59D7CD51B VIHELIÄISTÄ
913,023,710 *5F015521F11F1A6220B4DC640F2BD78272D723A4 tj.richburg
913,023,711 *5F00C4064EB5B0D2B09D359CB90035659D8F924C tlqnldn0
913,023,712 *5F05E00022FE41B0DA9BC58C9A34248E1D7C23C1 tnadragevuas
913,023,713 *5F0F5BCE2091B8CD102B356530435E47AA36D722 tnkschpning
913,023,714 *5F0FFFF5B32F3355CC8D8D1EA2ED4448D1BEA9D4 Tompkins
913,023,715 *5F06509B9E4B596E49BDF06A980C3DA49CE4070A VKKGELDERLAND
913,023,716 *5F05E2C816275C3DF275C9D618E8BABA50BB433C TOURNEDOSSED
913,023,717 *5F03412804962AAACF2365E82D5503F14278E01F [email protected]
913,023,718 *5F06AE65A10762F7F706CF9A1952496434BF710C TRACY SHEDD
913,023,719 *5F023BBEA52FC261A82D57569C09D6C275F51CCF vostra: part 17 pollnischer sablschertz
913,023,720 *5F05DECE323B413B19130A0D024433433CEA958C VSOUKALA
913,023,721 *5F0B46365D5DFAB6D7EBDF9580F21643B0364AAC [email protected]
913,023,722 *5F021FFF8C7B4F7BA6DAF5A7BC91D2DC9ADA65F5 W115272
913,023,723 *5F0F838087B7534870586AD72212709C264FE065 trevorstorie
913,023,724 *5F0DF6F4D86D5E60E4801872119CC9EA01E872BA wallacemensch
913,023,725 *5F0E4F22AE0E545098DD97E94E21565F85573B50 [email protected]
913,023,726 *5F04D89DBD0EC0303BCF33AE8AE65ED0BF2BE1C5 TSALBORT6
913,023,727 *5F06D8D18B0C8A1EBFA8D47031B78D3A8622CCB4 tshepisomoholo
913,023,728 *5F0DDED19A2AD816AA4E01BCE68A1BBE245C5A3C ts$q
913,023,729 *5F0C1EC49032B6DFA155A62ACA304D0D24F8CDE0 WARRENPALADA
913,023,730 *5F0D1C43DF2A69CAB616C2456B069FC6A7B5027E TUAHPEMBELA
913,023,731 *5F06AFFA542E6C50342CCC11E9C2C8A7C48A0F60 tumeric.sahara.gaze
913,023,732 *5F0744D6734BD3E2C1A4FCC7A251B6EA9B36934B tumijaharwib
913,023,733 *5F0C90CEE5B4CA39E44915C0499D4F78F01A2AC5 [email protected]
913,023,734 *5F0BFE30714F83D55473406EB198AF71C925B2D0 [email protected]
913,023,735 *5F0B16C837CC34159A9310A1ACA312985EF65E89 WEITA CHEN
913,023,736 *5F00D738337D23DF0ED3ADCC432EB228D2293DA5 wendy-waifung-wat
913,023,737 *5F0806D7A136D61715DDBCD182C8DC7B7B9F596A wendy.wemyss.mcleod
913,023,738 *5F0407062ABFE45C322AF094594FFDD69BCBD732 TZE-HANN-LIEW
913,023,739 *5F05A60FA9351DC1204719465F97848EAD8BF39E WESLEY RAMLOL
913,023,740 *5F04877A156281135130FC747EA27AB987E2F24D [email protected]
913,023,741 *5F0C850F7587162A644CCC2C73D9F9BEBEDA8730 [email protected]
913,023,742 *5F00470163D7257D98E1320C77840C5D8BA5AC5F what am i doing here with you?
913,023,743 *5F04A38C906A2ED6786CA672D03CA05086CE3BC3 umbrellatopped
913,023,744 *5F0A973D246C8828B40D0CE3CD9F6056BDDEA466 WILLARD.DOSSIE
913,023,745 *5F008A1255FBE30E7C9931841FF26C6B893002AA WILLARDSTARKSON
913,023,746 *5F0537D71E7A4D3853AFD22EDA1580FBCF3363AA WILL.GARITTY
913,023,747 *5F0C86D3501059EE84FF4E898A745B68C23F28A8 [email protected]+3m3n+$
913,023,748 *5F0B0D5B6A3B2BE27A1C498D3F813F875CF1D592 WILLIE.EGET
913,023,749 *5F03D04BB0A5978DD59187390BEDE2804B7679F6 undganzdolllive!
913,023,750 *5F04E39AF143E714E12C6F5CC776F4A3ECE763F1 WILSON.KAREN.KEATS
913,023,751 *5F01A23CCA272E5975A8D7A8B737345503C5ECF6 WILTON.FREILER
913,023,752 *5F07E0EBA03359A9124F238180DE1818B74E9A53 unquailingly
913,023,753 *5F0167DC943A23663D126C94DA4101DB97935846 WITTYNESSBSW
913,023,754 *5F05920DA76CF8D5465358316ACB23B72E243715 wmcaiazzo
913,023,755 *5F02084C768D6E38BB6E361917FE5B51CC699B53 UPOV
913,023,756 *5F02C016206BB9AFC051338804FC971D7E0DB31E [email protected]
913,023,757 *5F071503A7FB327B76811C7C2E4DB0BD5CDF8066 [email protected]
913,023,758 *5F096B9441C4CBB5523B4CF201F928951B0F7F60 UXTCAA
913,023,759 *5F06986D0120B7D4E5BE9367D41A4225E689EEE8 WWWSTANDARDATLCOM
913,023,760 *5F0C127927B36CF941FD973065B86DDE56B89437 VAKUUM -- VACUUM CLEANER (FORGET THE PHYSICS)
913,023,761 *5F0E35E109B352B1BBE3D827D9C69749564158DB VALECIA-OSBORNE
913,023,762 *5F0FEE371E926986FA22BE7F7CE9453447286FE2 valentinabarzaghi
913,023,763 *5F04FF883052881E01EE56E274228BA387CC95C5 vantare
913,023,764 *5F0C3739993464E951B3466F2C93C0B2B53E6ABC x+j)
913,023,765 *5F0C4A26BD8BF7A9AD4A79CCC5E92C89806D1DBA [email protected]
913,023,766 *5F0A7D372372637446FBAD33A07233C767DE9610 VERN.LEINHART
913,023,767 *5F078BAD7E77163353A823F09423EFFCD76553EA VERONICA.MARTIN.FLOYD
913,023,768 *5F01537E35C01070BB6887D5CD75AE180411EC46 VERONIKAKAMASI
913,023,769 *5F07E1A31739F741AA8877824F940EABF5CAEC09 vetri.1.0
913,023,770 *5F0100FFE05A9CBEE11A32D193E70FED9D555D31 vfyxtnbg18
913,023,771 *5F031FA1AFA376B803763D8F9114DF683B410697 vincent-ventic
913,023,772 *5F0CEBB9E842079DAA307241CFEAD17C9F1857CB VINETOR3
913,023,773 *5F0825D7D870C1029767259DA3DC140166DFA3CD YLIENIZE
913,023,774 *5F0095A243A528863B218EBFC7950575573DB5AB YOUCHIPIT
913,023,775 *5F0FF2E73C541A6383C84B9887C7E3E1F2A2A058 voetigh9
913,023,776 *5F07A6CB3189A591C25A8C82A2533C704694D3D1 VPCLIMINGE6
913,023,777 *5F0405CEC270DB4AF1F9884FC1C7F662B1B705CE VPW13
913,023,778 *5F055FA78789C7FB744A025E92CB16E7A044AA5F W59611
913,023,779 *5F063038D062644692B71B14B7A7D71E350D9F0E WABASTAMINE
913,023,780 *5F03D00086D8D1B3AF2812A84C591BEFB194EC2D WADDELLSEAN
913,023,781 *5F0F15E86BBED7DAC856B6B93CF2F279B1F3EA68 zackaryrocasah
913,023,782 *5F0A2D07183887E448202839277FDDA334F3752D WAELANDARY
913,023,783 *5F0451311B1F95A6F3440398AF1626005EEDF95D [email protected]
913,023,784 *5F00D7BE05B6CF21FF4F5F08222B5EF67ECDC44C waltonsiurek
913,023,785 *5F0716BD38D007A1E24F5A4E5FE5A26F00A1023B WANBENJ[email protected]
913,023,786 *5F0896332C2747B242C19BC7E5DD4828D0B36A8E ZEENAT QUIDWAI
913,023,787 *5F080BF8784B19CC96CB5F18C720FFCBBB462CFC [email protected]
913,023,788 *5F05F34589F419459702DE82F6FFF332FD5E09B3 zengtzengt
913,023,789 *5F087338DA4D1212A8001696BB913E1423A15805 ZHAOXIEKUI
913,023,790 *5F09309A2183800D266652CCFF3A0F8CBAD09BEC WASH.DOWN
913,023,791 *5F02768949C3E5A8DCC00595AFE4AA488B6BDA8D zhurnals
913,023,792 *5F06467351333D8B8CC68FEFDE1C4DDC93FD5F19 ZOEK DE ZEEP
913,023,793 *5F0C1EF114C79D7AEFA322E9570BD26C3689F093 [email protected]
913,023,794 *5F07E9AD105EBE2B3003EEC484D1D6FB2C411AD3 [email protected]
913,023,795 *5F031E4278A3749A769FB480CCA7B9FB41E9A9F6 zurdo.cabrera
913,023,796 *5F0B9C6D3BBA84865A8AF35A6A69FDD2956A0F6D zwischenhandler
913,023,797 *5F0C671F4D84A0FFABCB18C0193A29B539BFA0B0 [email protected]
913,023,798 *5F0178A45BB160B783DE1B0E11CA06A15E9D39C4 ΑΝΆΛΑΦΡΟΥΣ
913,023,799 *5F018B403A65EB73F6CABD2DBB97DDE0030708EA ΚΊΛΟΥΑ
913,023,800 *5F0015C94DA11653AFB7830C0A3986D4B6C03827 голяновци
913,023,801 *5F0EF31568E0DAFEA3703D37D37CD11A67588419 wilbertdenenberg
913,023,802 *5F034D9DE91D35D82DAC0648723710A0FBF21F8B WILBERTSAMIEC
913,023,803 *5F0D4BD225B2533E8FE6A2F097EF786D341D27CC wilburreyelts
913,023,804 *5F09875FBF3AEF3CC61E9A98E3394679065AA39F WILEK0
913,023,805 *5F04BD2339B9D9324D805441932D15DA8D4B8E84 ИПОЗЕМБАНК
913,023,806 *5F06D5C28031B780BA0A70BAEAFE14A49D0E9D12 william-eades
913,023,807 *5F084EF3C9FC33F3A6D38E5307241BF003279BBC МОГУТНІВ
913,023,808 *5F079B8B49BC6A5CA093651F61302EF80289B5DD willismcinture
913,023,809 *5F0D665903BC1C30FE529A083FDFE2A778DF9641 WINNITENG
913,023,810 *5F0A4D1A689DFA024EF381F9754F245912AD815A [email protected]
913,023,811 *5F0DD31B26D02EBC2E65C2C6C173D13546F8C614 СУПРУТНОМ
913,023,812 *5F0AEDBCC22FE5FDAB5D86F8C9D2835AEAB08777 w_sz
913,023,813 *5F0FB05ABA070495A8FC33EBA488D0F0CEC069BF wwwclinbiocheminfo
913,023,814 *5F0005764FB7BE275DF6135994F2E047ABECFDFB wwwgjncom
913,023,815 *5F01991F5AB1169F4EB0AFD5822F7DEC38E4EDC9 WWW.STRUCTURED-DEBRIEFING.CO.UK
913,023,816 *5F0955D5F64449103E003F5000373C0E14451DBE X2A028
913,023,817 *5F09773D1C0DEE7B8AA8EF0D85DEA9DD01BFA44C +X3E
913,023,818 *5F0E280AEFAFA21F4ECA6C8EB462B8AE45099C3F xavierarai
913,023,819 *5F0AEE00B78A281483A3A273CA94883FB793772C )x(~.q###b
913,023,820 *5F0CBD79EB9CC21B09C30B264B4143305659A3C3 舷側:70~150MM(水線面)
913,023,821 *5F0EA9575765004190205A5E7EF53A7E4CE503A7 の補助エンジンとしても使用された。より小型の関連派生型である「RB181」は設計計画としてのみ残り、
913,023,822 *5F07F838BA0D022232A7D5EBB21AEED2B1D88E2D yaaaa
913,023,823 *5F03B2403DE6144CF643B18C762B849FB035CBBC [email protected]
913,023,824 *5F0346B9E9DAE81E46486E2C1E228914082552C0 [email protected]
913,023,825 *5F04DF003B77A216B0E419DB5163B0CDD3B2F14F yanyandomingo
913,023,826 *5F06405EA3E8F0AD4B8EC44A48576C9F2A9C2B87 YESTERDAY'S:BEATHITS
913,023,827 *5F0C2534C3EF93F731B6A09C6F720C94B8F7CA19 yllebelkceps
913,023,828 *5F0FCC0CF39341B75EF69E9A49C5491D4281243B young-ghangsta-ross
913,023,829 *5F0AFBF3E60BEB977CDFA16D9D39A4AA3618124E YPERIAHT
913,023,830 *5F090F4B2B95287818A4B1A983B8855702815CD7 zabrina.bailey
913,023,831 *5F037E4025602376DC281F554B97753428906030 ZAC-BANTER
913,023,832 *5F02AB36A26C6EA947C755C81281A726BD6CE0AC Zamr
913,023,833 *5F0D75B5E1C9428DE45515112F64564705CB60A9 [email protected]
913,023,834 *5F059F56480542296FF4CC0DF4B5268483A4DADD 0iloveperfect5
913,023,835 *5F0AB76E3F2F00DC94F6A04556FE68BFDE5834B3 [email protected]
913,023,836 *5F0AD4476532C1EDB74F8F0E57626C83FB86DB05 1031495
913,023,837 *5F0362B8C92FCED984DA4BFDAF80735925F5FE64 10JULY1151
913,023,838 *5F0DB430871BDBB20A929754D9C7CA0E68EF0F67 ZKJFZZJQKVH
913,023,839 *5F05D8CC1C91E81EFF7217A714F608049C65A935 Z*MX
913,023,840 *5F0C10AFCCF3BB5D36B4C9E2606C1B5AAD8F7CEC zu.^
913,023,841 *5F0AC620B04020453F8229FF0F6B9DFC1D2E4892 ZZLLYQ520
913,023,842 *5F06832512AAFE75F848CBFAB749B88B90B66A7A 14.SCOTTISHBORN
913,023,843 *5F03920870EA2DF5FD777CEFF26E51FC9743E899 1576375 lay.on.the.inflight.movies..
913,023,844 *5F0617BAB7AF1A06CB5BA14DF8236EA4BC062751 σοφιανοπουλοσ
913,023,845 *5F04A0F55007313D3F8E8D02BE93F4E5E2DF1DB3 беттен
913,023,846 *5F00F202D0A5AB15AAE8FE03B22FEDA03CECE652 ГЭБЭТ
913,023,847 *5F070646ACF4E91C35503477006A0A411BA620A9 ЗОГГ
913,023,848 *5F079F9CFF67B9F7EAA1550A563F0AC4C325526F «КВАСЦАХ» —
913,023,849 *5F0879F440708EB762BAE95EF6A07E50DB931074 кельттердің
913,023,850 *5F0F9561EA3C063AB148BFFE5B2E1FA8F8F6C229 19.REDENDEN
913,023,851 *5F0C84F041AED7F006418FB77255CF6212B68950 1 alohkokaaro
913,023,852 *5F0143DC640BAF095E500B3B4CE9038A7AD9863F 1ARRENAVANO
913,023,853 *5F05916F892D70555CF3BA7F9894923C75C0ABBA 1BORNIEZ
913,023,854 *5F06E8B07AADCFFD7991F9C3B4203ACCBAB531F1 1 CAMPHELD
913,023,855 *5F0B38B19278607F86EF4125FAC05046C76A8851 1 CD-E-G-A-C
913,023,856 *5F0EC6D8B946E170E9879527B0D4982AC831C66B 1.CHARLO
913,023,857 *5F04A7AD0BDA742B78FC3BEFD68F151CBAB446F5 сервантэс
913,023,858 *5F077401DB7096740B5B93CECC7FA7F7518C4723 1ESVARTTA
913,023,859 *5F035B4618252C36DB490105C65A7BE6DD099565 ФЕТИНЫМ
913,023,860 *5F065ABFC1081C8EE4FE7F329C6BCC52C2572566 ШЕСТНАДЦАТОГО
913,023,861 *5F09EF8733EF52BDB45D93B0EDF71568C9771C2B 1-FUFFZIGERL
913,023,862 *5F0F3C3DB2C3B45FE6428C681032A03C76242056 1GARRIDURA
913,023,863 *5F0A706C09DD074C3DCA59CBDCC3F7B78C4550D9 1gurrola123
913,023,864 *5F0541E75ECC900209C98112178FE457739277FD 1 HELOMA
913,023,865 *5F0384E137B44AFD2F8B11DAB9E57FA17F8FDD1D 1IND0RM
913,023,866 *5F0E5F5B86862DAE1805D63B97CEB2010A851BC6 (削除)neon氏に同意。
913,023,867 *5F0033D14E25899E0CFFDF3CBD2FAD6E56EE65F8 1-KURSSIOHJAAJAT
913,023,868 *5F0803FB7B66F29400E1A02AA158178784561323 1.lastenlipulla
913,023,869 *5F07B6D49A75EB9EE03FC46883AAD1DBC7CF4AA2 1 massayksik
913,023,870 *5F0701C21C7475EDE90D58EB5F92CF104D2797F8 1-ruotsalaisketju
913,023,871 *5F0E15BEBFBCBD55C7493B376C5D59EDDF8E5966 1-salaklIGI
913,023,872 *5F0AFFD8D070FD7868AA53F431985034161210DF 1 TV
913,023,873 *5F01AEC5D05D572171D431D749C922C7B2CAD229 1 VELKAANTUMISPROSENTTITAVOITE
913,023,874 *5F0E6C8685013CD30136A1BBF172696A61266558 1.vorrundensiegen
913,023,875 *5F009FE27FA0D1F0AF049F4C9167724F6E1701F8 1-WORD-ABOUT
913,023,876 *5F069B07D6E61542DD41CA857FF562DF20130A52 1yhteyskoneiksi
913,023,877 *5F00F4F145A96072740249F1E8C41B5FF6D46F4C 2005270 before-long-,-it-went-out-of-business-.
913,023,878 *5F067D330E4406ADF8E21CB7D5A1E4B23D697EB1 20-ansaitsemaan
913,023,879 *5F05DEDD2161543A05A0C9EE04879A6833F9DDBD 20NEDOROST
913,023,880 *5F067DE341E64F694BD7860B6468B4494E9561E6 2226763 ROLAND-JUOKSI-3-.---2-.-ULKONA-.
913,023,881 *5F0DDC035EB62AB9D2434DF93ED89F9D672C5114 2234515 im.vordergrund.steht.der.sport..
913,023,882 *5F0BBA9CB8C45F7791A19A4F79382E531D44DF3D 225bl
913,023,883 *5F01B6FCC9FBF8AE7EFBE90A04B94F0AC06B60FA 233682 HAKEMUS HYL
913,023,884 *5F0D5C5BC86EA59EAE24B00676F7192C4128FB1A 235CATHERINE
913,023,885 *5F03D6A95843C37B00C3775EC077DB0667429249 263KRYSTAL
913,023,886 *5F078525B4529D7748CA28668B79029FF1DA33BE 27.03.1685
913,023,887 *5F052E7667AB9E20F3F7E1A95DD05DCDE08418B0 2FINGIDAS
913,023,888 *5F01103448033BA186FCC0442E7F6EE41833EDE4 2HYPOFYSEN
913,023,889 *5F04E81524BD4A8987D052D076352CD80186DA2E 2 MEHUTAUOLLE
913,023,890 *5F059F08763FBAE8FEC4050830241A8064E6BB0E 2.metastasierten
913,023,891 *5F0F77E089DCECF57E34880C9361769AD50345B6 2OHJELMISTOTEKNOLOGIAYRITYS
913,023,892 *5F06656F433909B456ABF973F955112C7A9AAEEC 2-oloneuvosten
913,023,893 *5F09B9BF6681B64D0E83CF36F65983C688E9AA8D 2staatsfreien
913,023,894 *5F0C870AA4C14A9995979BC8B80E4316E0EF11E7 2.tanImlamISsanIz
913,023,895 *5F0B76EC2FBDBFB519F51C159B7A0C26A72B071C 2[[User:Kalki|Kalki]]21:17,6June2008(UTC)
913,023,896 *5F0A2F8305052D6D0CEBD55B77442BC5143A3CF0 2ZWEPENS
913,023,897 *5F04E3F341922B4F8A5B5E60D011110A0F28A362 322046 ADRES-(-ADDRESS-)-:-ASKERI-FIRIN-SOK-.
913,023,898 *5F0EE04AE5741D9CB2EEE964EE1C950874C63CE8 345chelsea
913,023,899 *5F0E2459DD5F4CB79A2B31A99241E457A1088DD6 3--B.~0~O>-<
913,023,900 *5F054D055FE83AE3189287D97AC6FC8BDD4F2CB3 3.Bunnies.in.a.Balloon
913,023,901 *5F0BAD49AC3462BA199FCCAB4C920834A70DF688 3.freiheitsgeschichte
913,023,902 *5F0B45B76D50AD1362AD23F0F1D8DC470C7BBF8C 3iamnaruto2
913,023,903 *5F0C8B19AAAB87B4B6EB1420ACE4BB87D83FD55E 0PT4B4T
913,023,904 *5F0E3FAA5782F0BBEAF4E9553C9D1CB260BEEEFA 1061561 aoppim
913,023,905 *5F0A2254ADA7472FA89C887CB6BD223CB74F2DC3 111582 1980'li yillarin baslariydi .
913,023,906 *5F05D74335CC282E9D1A734E28A9FCD92084D168 12345SD
913,023,907 *5F06BD13D0FB19EB75D1FFA9E1A94937A1C42301 123ND312312
913,023,908 *5F01CFDB7D6F6034CC64B2A8557331FB2CF4593C 419jadon
913,023,909 *5F0E9C82C45B151D179B4486AFC40907D79907BA 14.savoyer
913,023,910 *5F01C7CBF2C2DEE9B1E012E3B0B76CA46B1F4BCD 151301 ( BASILI ) 15000000 TL
913,023,911 *5F0D1B740499C2A4A3C908CA3D56CD7E16F051F9 1514544 CAMINO-DE-VIDA-MISION-CRISTIANA-ON-NOPEASTI-KASVAVA-J
913,023,912 *5F0A6FBBB1B847C56020C7658762F987553AD86B 1567379 JETZT-SIND-SIE-ES-
913,023,913 *5F03700585D11C2DF17ED32C0A05A800BF9DCB31 4ETSOTNAK
913,023,914 *5F01FC81A1F2773925426D199A442D4AC9A996E8 160edward
913,023,915 *5F08430867BFA54917B4ED376E7B14BA5A92C433 16grock
913,023,916 *5F0B92C6F8ED2973982DE2A7B9BEF74024E73896 18051812
913,023,917 *5F0178870C11AA0BC71A7B82BE2911284AD4CE99 4MELISSAPOPCORN
913,023,918 *5F062583A399D15E8D3F085867B4DBE93B7EE7B1 1.AINUTLAATUISTAKOKO
913,023,919 *5F0755C5DA11476013F97C04EA5A02A2D66CEAD5 4PICASSOMERLIN
913,023,920 *5F0CD0427BF2F31936199BD365A1D6F8C1AB7F74 4SANRAJMA
913,023,921 *5F08A3FAA7A88D3C567DA3D439A70E3077F0B67D 4SECLUSIVELIES
913,023,922 *5F085B02B65C48EDB9C158AD42863B6599EAEDD5 1CSSUATON
913,023,923 *5F0CE956462C26CC4C408C0057F94DDC9C70B3D0 1 DDRGRENZBAHNHOF
913,023,924 *5F06314605F5D5D8417DC063982497F3C4D861E6 1.EAGLECENTRAL
913,023,925 *5F02CFF3E515AA800D6983E37151E509F902038D 4VETTEROSIE
913,023,926 *5F08EDBB884EF36C20D1215031F1CDE8C13B84EB 1.EROTIKKULTUR
913,023,927 *5F027EFC1689BEBBE580E901A87BBAD1D2F4FEDE 50C13TY5
913,023,928 *5F09636B6D887783E90D74FD5CD3ED7762B147E1 1-geliSebilmesini
913,023,929 *5F067487A4C2BF34513FBDF95B23D7840BA9E443 1-GONDERENIN
913,023,930 *5F0DE0573F276545E27CF45789F937C91A0B3771 1 HALF-POUNDERS
913,023,931 *5F098B604866A1CE4C8669639BC6107476E3FC38 1.hellenistiseen
913,023,932 *5F0A080E763DD3D98750AE5BA21E0FFC18712B51 1HUMUHUMUNUKUNUKUAPUAA
913,023,933 *5F00ABD36F82684E38973E8AF0213DAC4EDF4F58 5AUTORITATIVNICH
913,023,934 *5F023EAE16574E3980F09EB1B283519A620FFEFC 5BEFALSLAGETS
913,023,935 *5F0462E74BCFD1A1CEA7B8AFD6E63DE46D45A169 5BSWSIMICICHBSW
913,023,936 *5F046FCCDF471E41D04D45EC1745F6716D16285E 1 KIRSIKKAPUITA
913,023,937 *5F08C84974CE554C1742F1B13BC5D39EE5ACBCB4 1KUNTORASTEJAKIN
913,023,938 *5F0218ABE10BD5D28FF00D6B2B18977443BBD7AB 1leslesmis
913,023,939 *5F013607D9643F004673742A024D451D1C3F222C 5EINNEVEN
913,023,940 *5F0B86BCC2D97CF24A22C1665542869A7385B263 5ETOILESNOWBAL
913,023,941 *5F0E3717DF0605987DE250F23539046B1A4E769D 1-mildredist
913,023,942 *5F007281FB5DE0B0665A876FE6C65153CDAF4463 1.MODERNITAETSORIENTIERTEN
913,023,943 *5F0D09A637DBE57CC435E6025772E9D0542C8D1A 1-narusarja
913,023,944 *5F0C10A962D133838AC147C99B1A41B85B270ACB 5-HERABLASSENDE
913,023,945 *5F03FE26A555471A3EAB0D1EDAAAF6D1CA5DDB79 5IODAMOEB
913,023,946 *5F025CFC584500FCFA79035B9158136326E60A21 1ORANGEGRAUEN
913,023,947 *5F05E60DE6CDB03B52090F8D67A28A538F49B9A4 5LAPENDRI
913,023,948 *5F0AD9440871AE1D3C21FEA9DE2FC3D782437FB9 1POSTFUHRAMTS
913,023,949 *5F0BD6FAE9F65935D888F75137851B5AD43A48FD 5NOVEMBER1149
913,023,950 *5F0876120D45621443DA130AC6841C2C46A7EE31 1.snowbugia
913,023,951 *5F0B673DA3C8208F060842C55363D602F06A2A27 1-TILANNEKARTOITUKSET
913,023,952 *5F0E7E4C89F4F03176913D8F9B5E339618146650 1 TUPLATUPLAA
913,023,953 *5F07A2F27E65A8ABB468EFEAC185CD7899B47377 1 ULKOMINISTERIKOKOUKSIA
913,023,954 *5F0DD90F48C900254C9977206E10A0E9B33AF4F7 1.UNBEZIFFERTER
913,023,955 *5F030F1473E0F33B65CF97F0C5B03335F969A227 5VAPAUTUSLIIKETT
913,023,956 *5F05D14050B1291CCD022BB9D235AD3CFAC41F3C 20MARCH1119
913,023,957 *5F06F2BD4F9951F1623F20316497480F70AF4E92 2189331 on-muutoksen-aika-ja-valmius-muutokseen-
913,023,958 *5F0A8715C75B5B6A607867229D3D6EB03B5B808B 22JULY1049
913,023,959 *5F0CBD8C4907743E68739DB016E5607E9D561240 6depositation
913,023,960 *5F0096E4A542064E4278BD481BB6013074060DB0 6een
913,023,961 *5F04E829E71E617C3618CD7AF1C79C6BC7011C08 245CAEL
913,023,962 *5F053E6063890281E96109325245A36E85682967 25.04.05
913,023,963 *5F0AB5F4CA04FBD893072779A0131B30FF32339E 6HAIHDUTUSTA
913,023,964 *5F010676792EDB00E47314866962ED4F38C9CB00 6KAESIINI
913,023,965 *5F0435F3F2CBD2CDDCEC406830B4A22AA013BF46 2898134 TV CRUMSTADT 3:2 , SELIGENSTADT .
913,023,966 *5F0CD6F1A198EE6239B3D9315B9282D4C09312A5 6QUADRUNVIRO
913,023,967 *5F09CEECA904293E0EEC5B7417C689E8DC23E3AF 6rifinisse
913,023,968 *5F02A90DD314301A970EA1F28D846085E7FC1884 2.DIENSTVERTRAGL
913,023,969 *5F0C325B7BF8B56EE07F9D53271110A623A220D1 2ESPIEUR
913,023,970 *5F099B4A52C45F7F642C3113910BE9206499E7CD 2IMPORTEIS
913,023,971 *5F0AB3D25E2CE97C4CD169E2AF1C5F278CA8F627 70489 ARANAN ABONENIN ALACAGI BIR OZELLIKTIR .
913,023,972 *5F058E0BE368132CEDCBA7F6D4D4BAE27A6A515E 2MYWARCRAFT0
913,023,973 *5F014550810BB0896652AD59EEB383895F72B4A3 78AFFA57-7491-321F-A9F0-A3290F6C09BF
913,023,974 *5F01E663AECEB71089E02E6F9C3CC0BBE7830DDA 2.PRODUKTAUSSTELLUNG
913,023,975 *5F00BD2C623CB8CE10D0EF03B8D378A08A0D5CD6 2SPIKKELDEN
913,023,976 *5F036A57280E1CC213747BFC0C28F09DAF81C31F 7CAFROLL
913,023,977 *5F04C4D90449F00508CE70BD9AB00686EEE35B65 7DEMOLISA
913,023,978 *5F09E7788FE6F8CEF196D34E8C6FEA247DDA6AD9 7FEOFFMEN
913,023,979 *5F02A48154487D241C183394D6E84B2D0D5AF88B 316013 ".welcher.club.?
913,023,980 *5F0F26C352013BD1FEC52D06AE343972C1C5D155 31PITCAIRN
913,023,981 *5F0D53630F222504183890F62CC79FFE8CCEFDC9 323207 -nasIlbulursunevladIm?-Cokkolay,baba.
913,023,982 *5F0E072997EC579EEFAB59DC7C49591762BA84DF 7H4BAA
913,023,983 *5F07D77E9EB7E0259D3FECA49B6675058914E38B 7-hallintomallista
913,023,984 *5F046577536AC31BADB5A806A3D3B7720FBD49B0 356.NORDIC
913,023,985 *5F06B6645D55CCB7174E3F50D63EBF97959564DE 7JUDITHLINDA
913,023,986 *5F04E8B1BD8A915C47EB24B6A5C71FF3D261FB94 7MEGRIMN
913,023,987 *5F0E9A5B51A0714150E1E3B7A6BC9A37FC6AEBCE 391F55
913,023,988 *5F0FBA1CD5B8841B7D6765D4F132C6531BB81792 7PORTLANDEMMITT
913,023,989 *5F0AAEA6B738CE840BBA13233E51BE91D7162E07 3.computerterrorismus
913,023,990 *5F0311E48F727BDFAE7C2C0DCC81914543FF2115 7REBECCASLAYER
913,023,991 *5F090556FA3D06E1361DD2F8A77BAB4C9CE2CD36 7REDUPERAEN
913,023,992 *5F05D9005888CA5BD4A55B83B0A58E400A5ED36B 7SNEGLOVS
913,023,993 *5F074E1D81E0E01E01017B5F302F71A1808F6CA7 7TAHITIED
913,023,994 *5F03BFE7554E91383B6BEE84470BDE7DB4023B94 3 k
913,023,995 *5F0C2064456C46D036A94A3F46D065107DF10442 3KUNGSAN
913,023,996 *5F0BDEB00B02203AD10851824209DE8BAE5C04F5 8====>~0~osplat
913,023,997 *5F0EB4BE55A99F38C0203A706A917CE98CC15FDE 82LA8K7QVUDW5DLGACNQMWW
913,023,998 *5F041989B42AD1E590FD8EF82F8B117FF56CDDC0 85FE86
913,023,999 *5F00B8CAE33B2E2264A45F58DBE271AD68DB329C 400924 nuorten.omat.hankintaehdotukset.ovat.tervetulleita..
913,024,000 *5F0DBF22F07CA3233E6CFCC5EAD81A33EB74392A 8BILLYBUFFY
913,024,001 *5F00727CAA0F723842C66C32B301CF16B86918E0 424225 OPETUS LIVELUOKASSA KESKITTYY KAUPUNKIYMP
913,024,002 *5F01F190DAD47099397BFFE5D81E89BEE6674925 8BSWLQIMPLIED
913,024,003 *5F067BF328EBE90B2207B5B4E71B17C96DAE7D49 455250 JAAKKO AHO OKF 5444 24
913,024,004 *5F00ACBFF492182EAED1A2049C1E4B27A4451093 465K。
913,024,005 *5F08718C78D51A528FF08D86A6BBBF001CECF48E 8####D~0.~O.)O(
913,024,006 *5F06CA154B07B88160EB5950DB72772DD1437D8F 8DOLPHINRACOON
913,024,007 *5F057A1C8A26A768990D54CF973F2C83EA0262D9 4ILOVELEMON3
913,024,008 *5F0B0AADF598090E734E7F9D42E7D462A65F22FF 8PRETEGNUTE
913,024,009 *5F014F0D7B150A693FF27F92621F268B080527D1 8====P~~SPLAT
913,024,010 *5F0D9877DFB5569410BEEB5E751C31E5AF370673 8RONDSPRONGENS
913,024,011 *5F0FB81F4E2C34F918015C9DE7635B7C5F773FFD 4ROTAMYRH
913,024,012 *5F01F72AB7A0A5CCBBC4869B13C2BB3AB5D34B25 4UNICEF-BOTSCHAFTER
913,024,013 *5F0AB3F1449B506779E22D37BB28CC78CF425EFB 8VIJGEPERENS
913,024,014 *5F0A6D76027545A6164647E8967984901C7CD54D 4VERDUGOCITY
913,024,015 *5F0892597515723ED8FD6D283DC4DC605652E8F7 4YNNEPYTROF
913,024,016 *5F07B1D8D027F33537AEBA3B65527F52BBEFC31B 910jack
913,024,017 *5F03F4F4C924BFD27CB9FA091D50D2610EBE7AE3 932BECKHAM
913,024,018 *5F0918F29827A581DF0580F82705FEBEC0EA5B77 948066 huumeista.vieroittautuminen.v
913,024,019 *5F0E31F4FEE9209DE7D3DFC67278B800C9DB279F 981B
913,024,020 *5F06FB86A6178E0B50EA9A46145FF9216BC27D3A 9ELIZABETARCHIE
913,024,021 *5F02803E2C4BF7E6B6875ACEA42CFEBA5DC6A2E5 9FUCKOFFPENTIUM
913,024,022 *5F0AF708AF47B917B486CE767B155BBB453C5273 5ENQUTERAS
913,024,023 *5F02D6CDB4F6315E94D74BE4859F10AAB1132F06 9KEELBANDEN
913,024,024 *5F004D5FD7C9164A94126015CF70233A7DD1747B 5H188O13+H5
913,024,025 *5F0A674A51535FDAEC2B0682647B9321109D02A3 5ILUVSASSY
913,024,026 *5F0206BCDDD1B6CE0EB9DB96469286C4A9FB82FE 5.KP-TEK
913,024,027 *5F0835FC5F669F56DC73336B41D672EB484445A9 5MANGEOTTAI
913,024,028 *5F04C0E502517AE1039B43EF1CA242D0EBD025D7 5MONEYPEANUT
913,024,029 *5F0DC7550BA938F04556E8A5B23A0D4B119C8C67 9SFORZERO
913,024,030 *5F07550474BB4E4EB71DABE3CC0CB5EB31F1499C 9woolfell
913,024,031 *5F03F65D38AB2377B83D08FF8C6C514E4C4FDBA7 5TRANSOCEANS
913,024,032 *5F01AF10DDE13523929D34A551E6EB96C649AC73 5TROTSEGTIU
913,024,033 *5F007F389B7D94C14DB8B79E298762B8BD0FF913 5UFFR4G4NO
913,024,034 *5F045ADDF5DA09ED4E62368E226B501428B82401 a4p6b
913,024,035 *5F0393B125EA54ED1FDDCFE794ECE1F1E551F0EC 619georgia
913,024,036 *5F0C9F8901E1FFC05D7A63EF5ABD025309C9B594 66 uctan
913,024,037 *5F05DCD277B7CE18BA45142AFD7B5AD8021CAC27 674873 lezzetine.ise.hicbir.yerde.rastlanmaz..
913,024,038 *5F0C077E296DCD3F4829FAFAD30180A55973B638 6BASERNES
913,024,039 *5F0E29CCDA134C83B1A8C5509A6FE778070A802F 6GENERACIONALES
913,024,040 *5F0CEB2CE70098DEA6AB47311A176FE9118848B1 AAED8U
913,024,041 *5F033874DA3FCC7BA90035185BA408E26F50F50A 6LOOPFLG
913,024,042 *5F03C75EAB28BA8886DDA518DA28CB2BAD0A7AC1 A_AGG
913,024,043 *5F0EB77ED729320F44781AAD89FD165F48F63C24 aasavaanh
913,024,044 *5F0F16C3B6E390EA29CDAED92BE3BE3CF9D47098 734CH4B!1!7Y
913,024,045 *5F079614897430C06E9B157D810C84526612CE55 ABLASORING
913,024,046 *5F0269B08A016782DF7EE0D596183B7308A0FC1E ABOHIYA
913,024,047 *5F0D890DBF475A138DED0ABDB41BB1073CBAA34B 775048 ABER VIELLEICHT WIRD ER JA AUCH ENTDECKT
913,024,048 *5F0BAD144A2E51ED8B4BC453BDF1794C182E94F5 abortaising
913,024,049 *5F0A5667696726ADE112080D4F3C544B1F7F88F9 abrahambourns
913,024,050 *5F0303BEB499B424E2DA0AC855FB31AB4AB858E6 7COMPUTEBAMBOO
913,024,051 *5F0CA1EF63E61D099CB0DA23ECC509D98667F4DA 7CONCEPTVICTOR
913,024,052 *5F022B2A3C71719A6DA7602A432550484626C4B1 ACENEMOSED
913,024,053 *5F05D9E1B3EA4A224DB579CDA4627BCF947C00D1 7ETURGEON
913,024,054 *5F0F81FF54BC9C5E4FB9603BE59728397417F4BA 7iamgreen9
913,024,055 *5F08B1832DA74F87D58297E9A2FE52744656322A 7LAIRKIN
913,024,056 *5F0D40FEDBA5B4ADFE0AC623FA0DF1ACA5D9D680 ad4pe
913,024,057 *5F02F5F9D9CC2B4E9374FE241F6315C986CF8B1C [email protected]
913,024,058 *5F022F88CE5F6C4E1EEDCEAAC52A0DF06B4C379D ADILENE.BELTRAN
913,024,059 *5F097889EEA398CC0D113D724A4A4E8EFFFF5C62 7sawbones
913,024,060 *5F0B8CCE802201F1BF508BED16DEF11363DCBD16 7THEFUN9
913,024,061 *5F01AD2A74AC001CD17E3947630876D5EE847B76 aeritalia
913,024,062 *5F02CC8381F8AFB2D6B268E60C6CD181BC8F9307 8CARDFRAUD
913,024,063 *5F09BFFCBF4396AF0B919AF435929B6E886A7512 agacezs
913,024,064 *5F06F9DE0284B66FBBA6A9C6C090E4DF3C1985EF 8ilovenorton9
913,024,065 *5F003790685C4E8C24C300A52DD5758652B775C5 ahiihdon
913,024,066 *5F08B620D8A28D6240D51200F0E2041362DDB55C 8LUFEDEGA
913,024,067 *5F019FA562B71827189605BCF2370F6EB65F75A5 ahvk)
913,024,068 *5F0557D8B5587587D590184ADC75C6435D72B316 8-----p~o }o{
913,024,069 *5F0BC2F3945166C4893B7A16C6ECAB41198D695F 8PUNKINFRED
913,024,070 *5F02D10797D9D466AB89D4F793E87BD1E784BE0D 8PYRENOLICHEN
913,024,071 *5F0CE43DE2BB4F85E41507352C6449EBF9B9F2D1 a)k
913,024,072 *5F0364B7C6777F731F385C99B3C3DEC586D7EED3 9afgekoppelde
913,024,073 *5F0FC26CD3FBCBFF13DA56DD51FE1B2C652CAE71 [email protected]
913,024,074 *5F0572D89C99E96A9BF83C57AD4BFA83706DB577 ALEXANDER_SETON_1ST_
913,024,075 *5F0B6C208EC4605B7D213487F8C46AE2E992FBAF ALFRED.KITTRELL
913,024,076 *5F0737F33A3C6949B62D6BBD6A58C1EDB161DBC5 9ESSAGUIN
913,024,077 *5F0604C94CD7C9954F47BFC5165807041000D15B ALICIAMONTIJO
913,024,078 *5F0599605533FEDCA1749A6758255B15499C0B32 9GOLFINGTEXAS
913,024,079 *5F011C2758E0B9E69A5A6C7BF4F1BAD2CF6D5DC5 ALLEGANZA1
913,024,080 *5F06C1E5220FEF7F70C7B803ADA5F4FC043D3404 9MENZAIFU
913,024,081 *5F08E5709E99392A7A292577908A58DD163296C6 ALMSGIVER2
913,024,082 *5F0189349015D4CD151075F47D63D12DEA4E3493 9ORANICAMI
913,024,083 *5F0ACB54F82D169916FCA10D66A6C261EF2547BE 9OUWELPRODUKTENBS
913,024,084 *5F083C016B94E421443844835B0AA14E474CDD56 9PARWDIA
913,024,085 *5F09A041AB2E84CE7E3A93D6F433FC8C17098C0A ALTERNATENESS7
913,024,086 *5F079DAC99C6203D4F47FC5ABC9948E4E6B3FD9F ALVAROHEISER
913,024,087 *5F01755F8D3066B1CD396707C17EAC2CBEC87921 AMADOBUDKE
913,024,088 *5F0A62B644A863381E32834145D67E06BCFA382E AMADO.BUDKE
913,024,089 *5F07A66A151A17C1DF4CF5DF622115DFA558D94F 9SHELISA
913,024,090 *5F0B2AD2A2CF564A979F935E0554D7B2AE1838CF AMENIZASSES1234
913,024,091 *5F000B2A4FFAA8DC27065782630BBE38A0D1DA1B A&MJT
913,024,092 *5F0D66CAA532A5BA5C772BF80F0EE8FD2F701A54 AMPFTYCTIONIC
913,024,093 *5F073DEC83E6BD25D25FED4D18DBF31CFAEBFF92 ams
913,024,094 *5F03650A2890C0181CA5B9B1C90C49ECBB5125FE an9++
913,024,095 *5F07CF62F558056855156480ACD6BB7A1C6CDF8C A3am
913,024,096 *5F0CF2FED57A1DC0FFF9DB3D2CD4E89458F8DBE5 ANIBALCARRE
913,024,097 *5F0AAC5C1DE0B53A8D3682A582799CAFAEC1A9C3 ANN915
913,024,098 *5F04D1AE50B22A4B37A80ECB03C5C27DBFE4385C A/A=
913,024,099 *5F07776033C605CFCD2025911D432591D8F2015B aabe1c
913,024,100 *5F061030933B1492FB3DE14D7E40B8A1AE9DAD9A [email protected]
913,024,101 *5F0B077A687C2AA0CDB9E3D3AF424865E2FCA796 AANDEKIN
913,024,102 *5F0EC46FEAE1251F072272BB5311135BA4584E2C aangeroepens7
913,024,103 *5F0CC2C1C29063AFB06DAE3D4E7A01344CE38CCE AASKDARED
913,024,104 *5F0A405290A026493BBE0679142C8E98EDC735F0 AQK;H
913,024,105 *5F059CB1861BEEB4581177761C845597AB9FC99B arabella.evangelista
913,024,106 *5F02CA7DEFE18437CF933B6578CCEF4575A14156 [email protected]
913,024,107 *5F074B60BE064CF758028F74F50458F389DF7863 ARCHIE.LOKAN
913,024,108 *5F0347CFB90D3B7BF683E65980A9A4D129C63B67 AB{GB
913,024,109 *5F0A50C02D8DFECB8BB0F4F2CD41C3341CECAE3E ABMONTIOEREN
913,024,110 *5F0FA7019B4A26FBB505CCC9E3F46028EB496944 [email protected]
913,024,111 *5F0CB4BE04773A8932A091F80D18AFF23CF021D5 a;civ
913,024,112 *5F01EBF3E9E9140D828F805F14F5598C6000564B ASSIJATT9
913,024,113 *5F070D3F50630A2DCA2CC3B3F4EBBB6825D6FED5 ASSRA
913,024,114 *5F00BC550833B09ABBDF2570C819669FFCB73C80 AS"%X
913,024,115 *5F0086226FF600C1450E1EB6E4CE49CA1AB0DCA4 ATERIZA
913,024,116 *5F0EB51C07D65550687215FBA898DA492B5BDF5C ATOGENIC
913,024,117 *5F010FBC8E3252509B39C9119B29972D5F9065CC afbel4
913,024,118 *5F0294B9BD0F73CD7ADAAF27794F2386DAA089C4 ahe
913,024,119 *5F0C6979662D6AE39560528FAD21D238DCF0AFE7 AHMAD.SARRACINO
913,024,120 *5F030076B1D7B68FE55D6AA2B5600E05317C0CC0 azi#+
913,024,121 *5F01025AC7F5D2F60AA10571A98D6EB6EE2D5382 AZLQ;
913,024,122 *5F0D119A3B9D06CBA13139A1CA755039F8CA6DDC aikpq
913,024,123 *5F0836D6462AB1BB5A804C05C5FA9CD1AC9DF286 B33116FD74AFA58D270F0E4D57D7448EMEOWMIX
913,024,124 *5F004887C3699F1C810190E18D53DB15B47D1408 a)k
913,024,125 *5F0AB7E46237BB26FC14BEF3FF9CCB512FB195B5 b3;o
913,024,126 *5F0F696C1B2F1AABAA5DA9EDA427244C61DF8604 ak-dn
913,024,127 *5F02CDD5269125AF6B83E1E9780A48A11B6B9B46 AkZ7
913,024,128 *5F0797E459CFCB4D082A9CEB0C3A71D382A4EC91 ALF-SILK
913,024,129 *5F035B372A7B7CCC758FA1161AE99012A96F92D2 ALIFARES6
913,024,130 *5F0C20ED08D79303806FD4B92CAE2341BDA73759 ALIJARJOUR
913,024,131 *5F0ED70568BDDEC8A61F3871057B2A3AC4D18589 alj
913,024,132 *5F013FF26637DD15B259A863A07BC5590029944A BARRETTKORINEK
913,024,133 *5F00B55BC0745A6A7EFEF51506855AC18A8AA0D7 AlsS
913,024,134 *5F0F35E7809D1E34E4D5075DD7EC80259FD8BC10 BCF4
913,024,135 *5F09C3BACF9C2BBFBEFE3A3FF738EE4C28B57E61 beararieled
913,024,136 *5F081B7D5826FA80684BC16DFF828B982976C690 beb8h
913,024,137 *5F02763A751282E67C673DC28E573AD4BD0EFB18 [email protected]
913,024,138 *5F0AF80990EDD1EB2BAC1121196A1D42E51B6909 ANDREW.MCGINNES
913,024,139 *5F00EED86BDD7D15D3D67A39BE8769F3FF126BBC BEGAIER1
913,024,140 *5F0C9621089C503407BE8243E14B97128DFA5714 begintheend
913,024,141 *5F049ED1484A12191B5CAE413C9811D7092D8E60 anh-thuong
913,024,142 *5F00DD1426086FE4D03A90A4DD1126444EC3CCAC aniston-donates
913,024,143 *5F0DA9CD49C4CF373A0F9F6EC5187FC6D873ABD2 BEN.SLIFER
913,024,144 *5F03C416409CEB454D6562D82EF8D44FAD0F48A4 ann-abel
913,024,145 *5F0E82ABD3B894377A969176B670F6B7696A8DC9 ANNLAMORE
913,024,146 *5F092F9BA673FE2757253E805CDE431B741F4393 BERRY.BUTTITTA
913,024,147 *5F0AFD043E7BC9EB8692DBD2184CC76BB4434A97 BERTSIMKULET
913,024,148 *5F0D38CE9E8AB6089E05B2A9B3CD2B6B64E95A4F ANTIONEEDENFIELD
913,024,149 *5F0D6B20721FE71E2EA0C95C9D11776FC28D3CE1 antoineparinas
913,024,150 *5F0F9876BFE4282171636CF3D9266FCE2D9D8DA1 ANTONCARLYE
913,024,151 *5F025300E32E4ED4053B5CC0F555AD2CF5146D7B BEVERLY-THACKER
913,024,152 *5F00DA132270708B9FA88D3F48DF89A458E3A814 BEY.D
913,024,153 *5F0FB3BE98F4547E35211A0403B20D2EACFAC50D bgsrk
913,024,154 *5F0DB8FC9441655D28CB10D19BA2AF993365FA78 BHWC5
913,024,155 *5F0EEE360F6A2963A55DBA9C25E70F5B61AB2E65 BKWHY
913,024,156 *5F0D6B84ED9D623C23D8963E74AEEAA0898387C7 a$#s
913,024,157 *5F0DE1CDD10BA14FED5F897E0DCF687A1B294E91 ASHWINI-NAGARAJ
913,024,158 *5F05777E38E76A41C9B8EF5CB728C2043D67B15C bme=c
913,024,159 *5F0CF51F06F5BEECDF120A583BA2D46B61D6FBA1 b&npg
913,024,160 *5F0D5877CFB05066D231F2161A9AAA39B3E84830 BOGIEZ-1-0
913,024,161 *5F0257E9AA326E003957FC55046E9A1D39F8BB0A bol7head5
913,024,162 *5F0361CB37006E730DA07B9D12F25DF6CED55998 BOOTER77
913,024,163 *5F0EFA544FA426C05D44642010E6C26BB5355CEB BOTANINI
913,024,164 *5F0818841E9CDC5E168FC664D7C2ACD7B349AB08 avcb
913,024,165 *5F0A7DAAC45B29E04DE357B897FAD825926BC782 B====P `~ `~ SPLAT
913,024,166 *5F05C30270DAF1C3978EB92EA64D5A9872D4B908 A-WORLD-OF-OUR-OWN:-WDREM-1039-FM
913,024,167 *5F055E9319AEEED9F9F5FB7607398EC448F08D6C A%%WQ
913,024,168 *5F09E20DEE0551EF3487D0AE259FAD59AACBC43D BRADY.FORNER
913,024,169 *5F07143EFBF652930516D547F982FD76A24F9BF2 [email protected]
913,024,170 *5F07CB8263AD49DEF9FCC334650605BF3181ECF0 azd17
913,024,171 *5F0D3DF5BB0B8BC13A1D073642236B48B56E217C b0&tq
913,024,172 *5F0AD7E3310D57CB3E739C447B78467DED807829 BRICE.REIBER
913,024,173 *5F03D2281BA8D791D5A03741F0EC638723EFFD8E britanyadan
913,024,174 *5F06E1AF2417213129AF5E2A05F5F569888C6DED BRUCE.SCHOLTENS
913,024,175 *5F0E47F1F28B95B14332444B1CF62DEEF21EBA3D BRYANTVILLARI
913,024,176 *5F069EF95A1BCE9B5403BBC654C153FFC1DC04E5 B+_SJ
913,024,177 *5F0335CA7269DE21CF5DCE41F4F259217F8467AC b"9cp
913,024,178 *5F03432EF5B99BB74FC7636F2D1D4952D73B992F BaB
913,024,179 *5F06774B2B36BDC00917EA6343E81E089EE771FD BACTERIOPHAGETALKMIC
913,024,180 *5F08267FE527EF16C3EC7DA9E8FDC048444775AD BADBP
913,024,181 *5F0579CA91FAA1C47B1F6C5F97EE66AED33A2429 BU"AP
913,024,182 *5F0351628AAFF3ACBEED2822B83BD05337214100 bamboo-(goleo-iv's-2006-fifa-world-cup-dance-mix)
913,024,183 *5F0CBA8B201B64D4779283539B4009364DC17499 bangzirl
913,024,184 *5F0318B99FBE65CE42B5EA94072225756F5B67BE BARFFED7
913,024,185 *5F0C4F1D8FA0B0A618EBD7DFDE8F938F503E42CF BUNCHER
913,024,186 *5F0F29CECCDD45C97693982A1C626DF28D2677F3 burchtsanghers
913,024,187 *5F01ED89F2AD41B276A957626BC14243C58FB24E BARTON.WOLOSZCZAK
913,024,188 *5F0B5FA45793DF41CB26B484426D23FEDA23F655 BART.PLANTY
913,024,189 *5F0C11626288DBC82B23433A9B58CE2F990FF24D bustertromble
913,024,190 *5F0D1D6F51CE08AAD2F25EC49B55F083AA3E6A85 BASIL.SCHLITT
913,024,191 *5F0BF86EC409A7B2DD502A48242AA239E8DFF02C ba.tầng
913,024,192 *5F0EEEB61D12C3BB2926F5278FE7A7F1990DD88D BAYCOOTING
913,024,193 *5F0B167591E8413CDB211DA23DB5C4E0FE5C05C7 BB7L7
913,024,194 *5F0DA5BE3EAC361EF7F28F00F36B3F0539FD653F b?ypc
913,024,195 *5F09E40D9E39D46D35793C47EF4BD079D3325CF3 b!(&e
913,024,196 *5F001BB5DAAD586E5244BE14DD5A261C9585FB4C [email protected]+i0n
913,024,197 *5F080D97C24F5C4062A548AE18E786C23A7BFEB8 BECUNYAN
913,024,198 *5F08AEC70CAA50EB275D7CAB4AA53D61AF29F3A6 c2."x
913,024,199 *5F0BE4B05A93D5E028C5F4866095A2BC0F1385BC c3gdd
913,024,200 *5F0F51764340562E07D3FE294E144C5D4D7825BB BENEFICIENTULUI
913,024,201 *5F0EA1598CC3466B360A61E40AE2BD48C3BCC35E BENJAMIN.DUNNINGS
913,024,202 *5F02A3F55725E0B6778B770CD446891148B97CC8 C%61T
913,024,203 *5F0EA4592FCEFEA68AE0DD36598F32F2A62F1102 c#82$
913,024,204 *5F020E94B0ECFAC9FAFA0F79C30C434F82DBEE73 bernie-healey
913,024,205 *5F0EDA0E9347E14945BD80815D9B275025B76842 berytidae
913,024,206 *5F090D621D7DE0FEFE47BA1EC895DA3843319CAF B#F;9
913,024,207 *5F0FD7DAD9C3E3269AF49F006C36FAE6C1997F8F camille-wagstaff
913,024,208 *5F065565B1A0494B01F88906AFDE48D5B7284DD2 CANADINSE
913,024,209 *5F0C153C8444B2AE690EAE838B55823604996543 carltonroal
913,024,210 *5F0785B0BF2FCFA2D09C53EA0CEC25C866CDB2B8 CAROL.ZINCKE
913,024,211 *5F0D39D92014C6A84276216E8389A7E110A49E05 CARSONSUGRUE
913,024,212 *5F0F1D3FF0897743520725F684A74D8D8E237A6F billy.the.kid.(complete.ballet)
913,024,213 *5F0BDE3751E43CC8EF6E8A7A9A03454378569290 [email protected]
913,024,214 *5F09C85449A4454B9DC193859E0B49BDF7FDC50F c=bea
913,024,215 *5F048490AA6E81B3A2C08BDFF7A59559C8373F5E c.c8d
913,024,216 *5F08E2F3CD5CE6ADA6BAD11ED945053025D8E00C c"d3r
913,024,217 *5F05C7D9E2D11CA5A7EAEEB6C87A5650ACEE5125 cdanc
913,024,218 *5F0FCEE575A0F1163B3D897D41A39CB30C7566F9 ce+l
913,024,219 *5F0271F23656F06892AC8B22DE24CD8174821224 bobvalente
913,024,220 *5F06EC6C9CACBB1CA8BE8153A97CE485C80B4D36 boisean
913,024,221 *5F0EFF1CDB5EF336159F10E49F6B1F83EC605661 boot.c1ea
913,024,222 *5F0878A43B0CA7E8929A83BA2386CAF1C6A88CAF CHARLES.BENNAFIELD
913,024,223 *5F0E1A6F3FD066748B33C914873489AF8888C76C CHARLIE.RIETSCHLIN
913,024,224 *5F0A7503EF5B0F666F051F3EC2C2A605EAA06142 [email protected]
913,024,225 *5F02B1A494171B3D31ADD5E18621E6F76E6C0CBF [email protected]
913,024,226 *5F073ACC601A24EC90328B0F001F9DFF3C2987E6 bpl+/
913,024,227 *5F037229940AADE1A0DCBA476E30930FB44D9C8F bradlyfurr
913,024,228 *5F0C6CC2B3FED23EDD08A515CB6D0A5134996576 *CHONG*
913,024,229 *5F00F6D7F3729ABDD4F7C3172403C26095E1BFA9 CHRISTS.CHURCH
913,024,230 *5F0ACACCC9AE667A1AE5B2AE4BD52AC7E15997F4 bretlionberger
913,024,231 *5F024FEE3E1699D58887AEBDAF1784A1B11AA192 CI5B
913,024,232 *5F04694BAAD9264B99564C513D682367612AA94B C+\J
913,024,233 *5F0E6008129D2A09A952807F3A94E4A2117E580B brq-j
913,024,234 *5F0E9377BF54C928808CB814A832A40679C06D5F CLARENCETOMSICH
913,024,235 *5F090343215F107242A4CF2D085ECCB09048A61D bsu
913,024,236 *5F09D5B9F50A481E28454DCD3315EAC83294AE6E CLEVELAND.AUTHUR
913,024,237 *5F07A39A71433BA878397C0F9261BFB0C9E3C7F1 clmlxpittuwccglp
913,024,238 *5F09509D9A3B611892D1BB89F1E5CA8F6A349AF8 [email protected]
913,024,239 *5F0744E2C772C344A322AC159F8C718E3856981F CMP9N
913,024,240 *5F0D73ACE5FFB34D2B3149CAAB6F80DDA06EAB6D c/o/2
913,024,241 *5F0CBE2F2DA339384D96AE0CD4D068E9A11009ED BWEIDDV14
913,024,242 *5F0A0D0655BC8967C02911E65BBF4CF807CDC944 compatta
913,024,243 *5F04EC113FB6082D0A8E5A907ABB933F2A45231A bz19r
913,024,244 *5F06D512CBB40706B089B9D2D0770B35917BC933 CORYJARRAR
913,024,245 *5F0EA726CAB47FDD5642721DF33495C99F32A180 c3g4+
913,024,246 *5F07366ED4289472FDA7FAF0AAEDF2B98B12E914 [email protected]
913,024,247 *5F0B12915DFAE7781AC6083395E9C6B093D2D03A C4P4RI$0N3D
913,024,248 *5F0E2A27EA1AA8C62D4E663135203F37847AF1A1 C5L=
913,024,249 *5F05C2A8A68116AA792D7DBCA9D63C94B0455718 c6)h
913,024,250 *5F0785F4EF78AA0FE52381658E8677599CC0E1E7 cq5t7
913,024,251 *5F094D10DA4ED26319FE1AFD0236732688D5CA65 c-9g2
913,024,252 *5F0D575BEF984403BB8B5A1B2EF484B134A32A3F CQQWV6IMEVU
913,024,253 *5F09C085B79926B239FF52AD7DF8D2360B370D02 c%rc#
913,024,254 *5F074D22A5E77E4C72234DD06498F7287BCEE044 CARMELO.PRINCE
913,024,255 *5F0C3371080DDC921A5BA49DE8FA39A0935EBF1C ctx5t
913,024,256 *5F09582DEB19500F61B267D775169B7F9D87B406 CARMINEFRETWELL
913,024,257 *5F08CB4C936178A02BA09AA983A5968B5CD9951D CAROL.HIGHSHAW
913,024,258 *5F0C8D66EA9FC5A838DEB6955C57AD6ADE7B9B40 cubsptrain
913,024,259 *5F0B7F27CA9281C6FA5363E2D59C0A443664B7E5 cv+wc
913,024,260 *5F0E39ABF177BFBF75169A25DC690B3D0D528D89 C)DMZ
913,024,261 *5F0EF7558501AF866025826EEC0A5E79D1674BDD ceqh9
913,024,262 *5F03B54FBADD38C2DC3BDF36DD805FFE1CA0D4D1 CFJCONRADS
913,024,263 *5F0FE75BD4F10935444EC80875381BCE583244F8 CFJEI
913,024,264 *5F044AB75193D3CE01019999E803D94075A9A477 CHARLIEMAILANDER
913,024,265 *5F06031923105D43E0DC127787EFAE31445C9187 CHAS.SHUGRUE
913,024,266 *5F0625D75632ABBE26BDE5CC31AA493D8759BA93 danawrinn
913,024,267 *5F02BFC5BC2E7B7F301CBC62BC01E82D57CECA34 CHDIEIIC
913,024,268 *5F051D645B09B5B879BE730880FB9F173CD9EBED chequer9
913,024,269 *5F08A25E6C47651D8F4B5DF9A57AE53E10540B06 CHONGFARISH
913,024,270 *5F0A54DD07C1412A098A1F7CA589D4EF939E91DD darrrel
913,024,271 *5F010DD13B4A98C0325D3A1FB2902E5ECCFE2E78 christophergariety
913,024,272 *5F013A771D8088D47C88E8C6DFE40E30E5FDF0D0 chris.zentner
913,024,273 *5F03CE75C75D3EBC074A1847E8A7F2DCDB77A751 dazz (wicked)
913,024,274 *5F00701BEA50F7FD36F4A0382AFEBD1E1F09BAE7 ciao.(remixed.by.front.242)
913,024,275 *5F07FC1DE746AAEA86641E83FF7E9225AA647A96 dbo#f
913,024,276 *5F0634CCE8128F419D052F3F91DB3ABC99B5F661 DC/S
913,024,277 *5F0BFA9E48DDADE52CA7A72C0A437E681EE8F2DD C"jm
913,024,278 *5F0A72212A10EAB169C6B10926EE95AC7FEDD784 DEBRA PAINTER
913,024,279 *5F0CC1C5BA04E8144FD878B68C7FED576C5778DE ClassicRock:1982-1983(disc2)
913,024,280 *5F0FCD3DFB2267C89DC7A1FC4BD913E870478C66 degonfles7
913,024,281 *5F0D3DDA580934DCCED9602ABF19200E5A7FC139 DELALI
913,024,282 *5F0E2B919B12086E8CB2D871E8AB51E3BE3CA5D0 DeLuca-Jr.
913,024,283 *5F0A8A125A979DF2CA84C8B0E7D5107F8CC83BB2 CLINTONNICKOL
913,024,284 *5F0F49FE20D48088E70D9556B2EFA3C90BDF904B [email protected]
913,024,285 *5F019103A5ED63A0847245336A61B77BC38DD780 clubrotation,volume13(disc2)
913,024,286 *5F0DF32533C59756A3E3D300A83605C23469D801 C'MON(B)
913,024,287 *5F0CF5E2A3E22F0567E1CF79365F11E9DF6AF108 c;n#6
913,024,288 *5F07FD0E669BA84A8C90E255C9257D9AAC08C3EB cn_tc
913,024,289 *5F04D77B5951B6B2089FE197ADD497EDE800F954 cnvlsnt6
913,024,290 *5F006FF97FDE60458CF5F46FD1FF10F288D0CC2A codymarchione
913,024,291 *5F0B4EB8DBFC76122F8F1144E9C2E70E2431DC59 DF7NZ
913,024,292 *5F086E58313DC3C74CDEF5C1F92B6D966E230D06 colestones
913,024,293 *5F0CE25AEE2D882F5A2747A0968C6E5BE90E837A dfkb,
913,024,294 *5F0A5126DD392796A128243909D46C7590E2581C DHAVALNANDU
913,024,295 *5F037FAEFC1A0AE259CCD1B1C754A6EC08C091CA COMPO51TAE
913,024,296 *5F0E324EE1E9BB329ED2AAED962A61E299ED9F42 conc3p71v3
913,024,297 *5F0AD5E80B58391ACE1EA12AB756AF816C7F5177 DICHLORI7
913,024,298 *5F0EDE78FF42AA5E6719FA049A9821256ACF46B1 DIEGO261
913,024,299 *5F0C5AD9224B9C8189095AE743D839E012644658 COOL-TIPRFCOMWWW
913,024,300 *5F01BE8945C1269C49506E8C2BBA03D753A1AADA COREUTAS5
913,024,301 *5F037A4FFCD3A508FFF6D34738A90B2453E9DE17 DION.FLAMER
913,024,302 *5F0DC4289B6536ECB2BF9552067B471FCB24CD0D DISCOVERY
913,024,303 *5F0B6A24078A03642346FB43D71E037E3B0349D8 djs6i
913,024,304 *5F0EA5639AD2F87C93B05B3967720A6CCCF2925B dln,s
913,024,305 *5F03D787313B6E7A0089C9595D69CE4B082603FE dneduten4
913,024,306 *5F0338E7FE00A930D3A63D433A7429FCF274B1E3 CROGDE
913,024,307 *5F099CA377E7A49792E8DC1AF147CF5D98812946 DN,S
913,024,308 *5F084C032B9338DF67EAD96A7F121EADE6BD36D7 DODII
913,024,309 *5F0FEF8505631D30F24400CA4196239C39B2CC09 DOMINIQUE.TORRES
913,024,310 *5F0A770D48D556216C2B3A605082F8E9D4E75632 Cugr
913,024,311 *5F0C0868275E22428103AD7A764E61893D648C13 donnellfrymark
913,024,312 *5F0783CBCFD4333B3F3036E001345B9CA433D0D4 culturegym
913,024,313 *5F08DBA14DF8B61AB6365840BCBCF02F6CE25E17 DONOVAN.CATTRELL
913,024,314 *5F0D39124CAAD7C36D1C7481A284CD3347FCE1C2 cution-transcendante:-X-Allegro-agitato-molto
913,024,315 *5F0C2B70B2E7C42FAFDDDAA66235D79FDF5AC65D DORSEYMANVELITO
913,024,316 *5F0FC1673290B3B0B767CCDEF248AFA53F43A012 CVJVP
913,024,317 *5F0FD556B0F91F71745426B0B80C06B5D6504F3D D,.P&
913,024,318 *5F02AAF56A6220569969E857632E9966C96A2A06 c:-z?
913,024,319 *5F0A897754D498AF1075D0FA48E24E786E812570 DREAMS_15239
913,024,320 *5F0E4F031501D19439B1E67345B621FFEDF71771 czi2b
913,024,321 *5F0160A099E64257954A66E48287D69F3D925545 Drumbeat
913,024,322 *5F0A85F8451C70276A326FE598740B9457ADBF3F d3rm470109i3s
913,024,323 *5F0FC153F206E862570EB1B812A3CFEFF1BBC52B du9vj
913,024,324 *5F0FBE118DEE3BBC5DB48547AC6CB3758F0B61E7 d7mha
913,024,325 *5F06BE2BBE26C295D8D4D26258BDDBC479480607 D"-W1
913,024,326 *5F07BBA86831126869E2B0FA13829878AA729C8F DWT,
913,024,327 *5F0EA0B42786E1BC0E53B5A1D5D0499340303D82 damonbergsman
913,024,328 *5F0EB79A984C793D1C459D9B682AB46D9F6F530C dx.41
913,024,329 *5F03F78B29736C7EAFE204AFC9C75816DE6EE551 danbrodhurst
913,024,330 *5F0AAAC1B99A466AC6DEA702AAB17B2A7B729033 danialflinton
913,024,331 *5F05403A925F88049574C4E544F89FD3B09532BD d-zwh
913,024,332 *5F08D2418956BFB499C1E4989C781E15DAE18404 DANTECLEWELL
913,024,333 *5F00EDB4F002F6E2CDE42D158F8E74A4205F6E45 dantewestbury
913,024,334 *5F0F7535EFAD18B2B7D4859CF7C25D53636CDAD6 [email protected]
913,024,335 *5F0C5A9F64B16C983FE1838F9954AE4ABCF833A5 DARRELHOEN
913,024,336 *5F05F508030C261120D5ECE246F3687D45605A53 ecmz7
913,024,337 *5F0CADA8E6E31F3D501D40ED9F317B2B174FEDD0 datacollector
913,024,338 *5F0467A705969AA7AFAF18B900E6B63B0EAFA442 d"bh"
913,024,339 *5F063202917EF0EF14717320D9BEB182FEFDD9C5 eg6
913,024,340 *5F0517DA1D1566695DA0AD9520DA3083B45E184A EHDOW
913,024,341 *5F03CA85A2AABD3BD57E4DCB013CA738363277CF ei1vb
913,024,342 *5F03022463E166FEECDE044D337D152A9EBC5A13 debzh
913,024,343 *5F0C5529528309B7E1650C6DD9A7EF9E6810C943 ejtrefic2
913,024,344 *5F0451BEF3FE269D7A8F1E50DCA225F0522A8B14 DEEJEER.TROY.GALATIERRA
913,024,345 *5F081CF432449A1E87AB9977D567CBCBB2A8B406 DEGW
913,024,346 *5F038326ACB52D9491EBD2BBF048FB9F8E2CE04E DEIZAG
913,024,347 *5F0FDEE817FF8D7394B6049B8F093C87C3D577DB DELAUNCE2
913,024,348 *5F0F422165A1976C76DD8154AC57BCB6EA9E4AC6 delbertriesland
913,024,349 *5F0A704689F204FD5AD7B3697FC4FB2E34F55952 ELEKTRONEN&DONAUWELLEN
913,024,350 *5F0BC8D7169AC165ADD70849ACFADBC2D52E7D0C DEL.STEICHEN
913,024,351 *5F048311E7D1B9551636E00A5E207317CAD60BED DeltaHardware
913,024,352 *5F012FF8C5B89993D97637784C717C4CDCDBF392 ELISEODESIYATNIKOV
913,024,353 *5F027B2B0283107CBAB0A2DA3DDA43A7CA621094 DEMOCLARK0
913,024,354 *5F0AE0E5C8B8A614F262518A200150D6E41DA98A denaturationrenaturation
913,024,355 *5F0671BEDADCCF285A8B30A95A913CB1F67530C3 ellieallam
913,024,356 *5F0B62CA4B23AB7CC45AA03BCD4518388FC41132 elmosamanlego
913,024,357 *5F097EC4DD3A56D1CA1EF4E3C76704096F30BFE9 ELMOTELLINGHUISEN
913,024,358 *5F0741F1F382E62A07BBA5393FCF901B862601B6 deporton4
913,024,359 *5F03B44EDEBCEA8212188839CEAD797A8151FCBC DERICKSEIBERLICH
913,024,360 *5F07A03F5C80FB8310C66E3209825FF5EE54F049 DESCRIPTIONCAMINITO
913,024,361 *5F046F6404073C0B520BD09EF8D8B50084C276D8 DESEDUCVEIS1
913,024,362 *5F0B603D6BD1D6D8CE08EC777DC4111016E04CC1 DESENAMORANDOME
913,024,363 *5F05D86E082CD4D92B71CF760A887588C010BE8D ÉMERANT
913,024,364 *5F09B7ED0B16071CE12E86CA4A7AD9E4ED75001B emeryknipp
913,024,365 *5F00FDCCB6B74C1FB2F1DFE56B410608BA73ECE1 emerymichelet
913,024,366 *5F0C11983D962AFB775E4074280C2B6C76C621D3 EMILYBUZZ9
913,024,367 *5F0F516061662E81D4AF90B42BB6E160DEFEE820 DEWITTBOEHRINGER
913,024,368 *5F0FD57286C7C411970D85298862FC63E0B375BC DEXTER.DOMINGUES
913,024,369 *5F01BEE9187D71881924773DE3C9A2C823C326DF DG&"
913,024,370 *5F053234D3A0FE93EDEB0B2AC5173D03BF06DCB4 dhar#
913,024,371 *5F09F83BDD3C22823585CBC7E5DE801D47E1FB3F d",hj
913,024,372 *5F01911C822434A32AFD0D58C1844AF0E2E31F8B E$P4N$IVO
913,024,373 *5F0A4CF1B0914880800F24AEFF22B5737FE1E50E epipleuraed
913,024,374 *5F088669C21F4E53939AA4B7E280DC93A93162E2 ERICK.BAGG
913,024,375 *5F0B81A4F668B1C5040F39303E6BF26CC93A46B9 ERIKAMEYERS
913,024,376 *5F012CABDD0514ADDEF3020ED9A1C9443867CD7F DINÁMICO»
913,024,377 *5F0D8AB2AFF5EF894CC0C78C26B2CB149B575B66 DISCOVERY
913,024,378 *5F04D8068C4DEC89EEE5D8B6F4837CB9B129A4D6 ESTHER073
913,024,379 *5F06FC30C026FA82D7C203A459ADCA9CEC0477FE ESUHARNANIK
913,024,380 *5F09361C6A00903C9C7C168DEDF97471971A0D65 ES,YI
913,024,381 *5F086D5C4733CF19138C11F2602310784060859B EVEISNETNI
913,024,382 *5F01E452AE2CF87693ADE44CB8FE33761603C289 EY$.
913,024,383 *5F0526ECC14257139B5B19EC2D81774F213899DD ez_2
913,024,384 *5F0BE846D8BF8EBF35621D350D6E98C3FD54C3C3 F4TGU4BLTE5
913,024,385 *5F05684752C00EFF72E03393BE2975E2B96B35D5 donderdae6
913,024,386 *5F02FC6D7EBBB89FD068305D4697E3EE45C306BF [email protected]
913,024,387 *5F04EE194DC48FA75A220B548AF406E4BBBEFECA FANTASTYCZNO–PRZYGODOWYM
913,024,388 *5F00F4471EA8426C4E520817F7CF40FA02BF01F7 [email protected]
913,024,389 *5F0392386150F6B3D9F0B70E1C2972187DC931E1 donnyhamontree
913,024,390 *5F00F07BBC6B840987A039D4ECDE339E70682F84 FEELINGTHECOLORBLUE
913,024,391 *5F0A53EC0A3EE8E8DF0581FBA4C75430C9944E33 FELIPE.MCCLENIC
913,024,392 *5F037B71FA314AE51DE39A50D63E1FDE5143A367 FELIX.KEMME
913,024,393 *5F03EEE08CC5693623C5A516F0A61DDBCE0B0206 ferminbarrott
913,024,394 *5F09E31664E72422098DA52C6F49D9888A12BCFD FERMINHIGGINBOTHAN
913,024,395 *5F09D0EC40760BB5172BB558C60953C6652EDD01 Dovn
913,024,396 *5F011CDF04CB5A4134311092136BB917D263F4C2 doyho
913,024,397 *5F07499A473494F052571944D800F1DB8CB8370B FINITEVIRGIN
913,024,398 *5F0113094D6B11004343AFA74DF7BB8E740B5B76 d$quetn9ly
913,024,399 *5F0610F2F28A04D9F2009394745C0391D9792C32 [email protected]
913,024,400 *5F0287C923B7DC3EDB52DDC8B3C600D663DF1780 FLYERS1SANJOSE
913,024,401 *5F0908DAC4FBE3D244692AF394D7B185FFD0745C dtrw
913,024,402 *5F05F38C23401BE007B3D3A48504642959537D3A DUBBELTAL.
913,024,403 *5F071D80E61BF308601E5E2BC82AE5694A89D23F D_V0T
913,024,404 *5F05D6303ECE3EDA693B0B63AA74561B6D50DA6A d(w6w
913,024,405 *5F00A720080A0444805DF05B9C44AA7CEB5D9AA5 frommylife:ivvivace
913,024,406 *5F09AF97A7AC02D6ECCC472F419250BCC280FD46 FUBC
913,024,407 *5F07A222F1253F3BB8362EE7971327C0B2C2A092 [email protected]
913,024,408 *5F0673355DCCF0B1D16A7E6D13DB7D021E0C900D d%(y.
913,024,409 *5F0D51C01262B9B57312EFDE097EFA8A1EEFBD7A dycd5
913,024,410 *5F07BE23EFD68471305A8DCC141EB7BDF44CD064 G4RNSHEES
913,024,411 *5F054C54E5868A0EE6B4AF93B11A5242863D508A dzv:
913,024,412 *5F007F1A91412C61C6C0955725FE093D0CDCE95C eaditihp9
913,024,413 *5F0F0697C51A4A278FC22D1E6DD287F826C493FA EAMAEINLOVE
913,024,414 *5F0FAE548ADAF0B7FE2DF41921493B969AB6466E &>EBAA
913,024,415 *5F063BBAB355050EE80B4AA20140B2E23717ADAA GARTHBUSI
913,024,416 *5F0F1B6ECF9CC801E03F8DA904C546FDC7DFDB2C gartz-feiler
913,024,417 *5F0895730903051CCCEE6B4CEC5EC2D0A8B9FA43 [email protected]
913,024,418 *5F0768772EDF29A532C23EE592387FF445428217 eddievoit
913,024,419 *5F0E7DCB34D884406E3F26F1840AD2BE3858C3F6 GELARELED
913,024,420 *5F0CCA3F032FDE8D91A7818D69AFEBB85A0D3FD9 EDREECOV
913,024,421 *5F0015CCCBC9A6F05B1238B2D5F4874F6161B434 EEDILAV3
913,024,422 *5F013BC36FF16C64BC99BAC73BA63E55EBF7D817 GEZONDHEIDSATTEST6
913,024,423 *5F00348AB2782FF707B157EF7DD3DF91D2807B04 GIZZARD
913,024,424 *5F0D8446228EB1257D02C43D274FCB5308844A3F gnahreen8
913,024,425 *5F0055CDFE968E1F59C9122570DE6834BAF2FD46 elliotlockard
913,024,426 *5F03424E426EA5AA4E52BF71FC0680410938158C ELROYPETRILLO
913,024,427 *5F06ECCDABC02E35C53FD95A3BC44262C632CD3C elvadus1
913,024,428 *5F0FBCE4AA250F01591F2054F7D80FD09C9CD471 EMERONGI4
913,024,429 *5F0389FE8235368FF0F0BD926CC916BB9EC9210E EMERSONREAGEN
913,024,430 *5F0CF2F4A72CF5947DD4A8B3A95E53499EABDB89 EMERYWATTSON
913,024,431 *5F0B052367E11B4E468451C9D0BB7EF12D8E487C gregoriowendeln
913,024,432 *5F0AC69B2C4DB7EE051E7FC39C5F6103AFD68800 EmilioA.
913,024,433 *5F03D8EB3837A2514E92CB7B245B7E4ACCA4ABF7 GUINEA.E
913,024,434 *5F012C2DFBE0A8F01BAC0027F6985D7E351DB8D5 gu.j
913,024,435 *5F0C05051E965B7C4F559386A3623883EB09A750 gzhp
913,024,436 *5F0DEA6CF01F1884AE38BE28D6BF5DE51AE05FFF HARRIS.BESARES
913,024,437 *5F0443717753DDAF60F44FF73BB999793F4B52B8 ERIN.HEDGEBETH
913,024,438 *5F0A0DC5BF9FB17B7A4601A3657468462EB7EA0B ERINNARD
913,024,439 *5F007E34CFB9FB568CB6C05F7A760441715EBD52 ERLAN-3-0
913,024,440 *5F0AC20F7BE0712CDB68896D59D26B72EFBAD717 HEAD/FOOT
913,024,441 *5F07F8C51BEC1D131F6F3A60D5F2C6A3B7FFC947 ETAMASLOV
913,024,442 *5F0AF6C0BEA907EA8E81478209B11E3EA63064DC etesomim6
913,024,443 *5F060198BD099BAAF3B10D1B1A3A28CF7847C1C3 ethanluette
913,024,444 *5F0B5C5A7A649E10FE97907350332CFFD7E17804 HELPNANCY7
913,024,445 *5F06D79D7A0C7C864183F296A4A746A2E1D76A25 ETUDES-TABLEAUX,-OP.-33:-VIII.-GRAVE
913,024,446 *5F0A39C41B1E7C742048EE43E9A478FF9BFEDBC4 EUGENEGILLUM
913,024,447 *5F06E2F931C965CF98E99E6DBA29390C3E19145C eugenioschreckhise
913,024,448 *5F0C35928C3054966DCEB9A81BB93389C8C44C05 HERFOARME
913,024,449 *5F080153F6AD6764ECA99692B6BF06D2DC5B621B euvkv
913,024,450 *5F0589F6F0FD14E099247D3605517DCEABC6CC95 H]M7
913,024,451 *5F05966B226BF393272310FA3526C7C90348CE61 F14MINE$
913,024,452 *5F0D0DA8AC9637CA72B6C6649B1F1BACCB42FBA4 [email protected]
913,024,453 *5F0DD4487DBBE4725C4254DCF37455D5FF2DE435 HPPLL
913,024,454 *5F01856C39DFA7E80CF67DB63FBF3F729DD66D87 HREF="/SIE=UTF8&KEYWORDS=LATHED&RH=I%3ATOOLS%2CK%3ALATHED">SEE
913,024,455 *5F004DDD22BC5993C23C0C60412295F21CEE2606 HTTPGREENDAY.CO.UKAL
913,024,456 *5F08B377F645509430A0FC61A86CE57693AB9012 FERBAREN1
913,024,457 *5F0E72E0764F9C1C9EE73C355C6BA5902E3FCFE3 fermincopus
913,024,458 *5F057205F36220DB57E6DADEBEE3A9CE9189F99A HUGO.KIRBIE
913,024,459 *5F01A1CF5AEC7FB5060E41988B5166567C6DE6A1 HUMBERTO.BARANSKI
913,024,460 *5F0DA52D225485FDE0011D371C7E8B76D6220818 FKXX
913,024,461 *5F052224E07E3A1542193B081651825F880462FE ibwt
913,024,462 *5F0C43380A36FF17D36CBA9F9B3E04CF5990101D icsascompersonalgaguero
913,024,463 *5F01C3DC230D7CBB0C698C0446F522C8DA4E5A9F forrestissa
913,024,464 *5F0C7D8906DF32DB3E6AB8EC79298660A20EB25F IERIDELAM7
913,024,465 *5F0DA0A6925159BCE678ABA115782F601E6B4C2B franklinolivo
913,024,466 *5F0DAED048131E10E7496FB6BAF4729484B9FF5C IKE.PITCOCK
913,024,467 *5F046351A996BA16787E62A27D629E3F3FD64F73 ilovehitler
913,024,468 *5F037AA6BD2287179FA11C7E73A9F2ABB065D32B iluvexport1994
913,024,469 *5F0DBED6B4BADB98AFB8CF96E285BD2576BD1E36 INDOLFO4
913,024,470 *5F0F186DB5525229D608FDEFAF01872DD57CBC6B FUNDACION-PADRE-VINJOY
913,024,471 *5F027FF223E2A64F3341EDC7B6B4CAAD2FABE274 INLINEWITHWIKIPO
913,024,472 *5F0E7C17BD2A4CD2C690924FEB219C7A58A5D1E0 INTERLUDE/THE-CONFESSIONAL
913,024,473 *5F0674EB30C0DC2D3A608E2272B5E62A941211A1 GABRIEL.BOILARD
913,024,474 *5F0D01E85FCE3B17E9208E300BD793AC5410E5D5 gabrielle
913,024,475 *5F059F64C3C7B6A2387CBD21426C2824778D2973 GAM.GAM.(MILAN.VERSION)
913,024,476 *5F09020E1CFC04337C71E340BE397CAD7D389237 GARFIELD.SALDI
913,024,477 *5F0F6C600A646682C9CC482A0895D756F4056902 isaaczentner
913,024,478 *5F084C63B409F487C284CECE13654664E7EE6719 GARTH.TROISI
913,024,479 *5F09217F38E36CF33040415E01B11A887FF2AC0A ISISABC5
913,024,480 *5F07824EA67F32A36D2B0B6645388EA88E8ECEEA israelstvil
913,024,481 *5F0B84F3C2027AC4B124BD4A53D7F898A6D330E1 ithashappenedbeforebutthereisnothingtocompareittonow
913,024,482 *5F0951F3D10944BF2230DA60387F942B131BC6F0 i've-got-no-time-to-lose
913,024,483 *5F03A8D89BCE3A2E41E2D46668BFEDAA4558EABC G]B
913,024,484 *5F0858B6543E0D53717564C4AE9432CAFB94E6D5 jacintobartee
913,024,485 *5F0B4423A7B46D864D72B02FD66611C6553EE9E6 GENTLENA
913,024,486 *5F054E29ABF3AC8CBD041AC788AF6CAA864A8FD7 GEORGE.NORCROSS
913,024,487 *5F05D8836EA195CBACC678B5C5A7D9528AC45F2B GERMAN.WEENUM
913,024,488 *5F0E84CF2270329AA5851208C400C9ADA476E2DB gerrylasko
913,024,489 *5F02B2E64A75D2DDE6C7F694290099E8ECA8827E jamalkhan
913,024,490 *5F0D2DE65CEFC310B15EF425E5258E1198A6CAB2 GETINLOOP
913,024,491 *5F07F9519E19A4E656580271E0A8A8B1EF41BE7B james-antrim
913,024,492 *5F0182F254BBB4050057B5F31DA427B55763664D JAMESPETRYK
913,024,493 *5F05DF6EBAFF41F90ABC55DD529EB73FE0CFEA97 G-I-BLUE
913,024,494 *5F0F44797D46B5115D6B51F0E49D03C0D49B7E03 gilbertsanderford
913,024,495 *5F0F595336E73996F22DBB8A1E372ED1DBFBB521 JANNORKUS
913,024,496 *5F02889DD9428265DF359A1E27C3C86EA7E1530D JASONANDAMYB
913,024,497 *5F0811616661F842E9B9CF11CD3920EF03003E91 GIVELIGE8
913,024,498 *5F007F4C204464C1BDBE65F3632B1EAC9A052474 GIZZARD
913,024,499 *5F0870FC30AD2F2D3420502DDA5999F938765E56 JAWED ASHRAF
913,024,500 *5F0BDC37637F2753497183DFFEA7F387C0746EF7 JC0205
913,024,501 *5F014131387F0F1CD425DE87755D90F41B17835D GNLMKAT9
913,024,502 *5F0E390AC0D4CEB522AD3D8DF2DCB545C6F0F05E [email protected]
913,024,503 *5F056CEABC1E33D0CFEACFCC5A6FD1454B2DB9D2 JEAN.MICHEL.AUGUSTIN
913,024,504 *5F022D93A9FE0E64DF062084CE12F386F0BC6973 goh7
913,024,505 *5F058EFE1DBC5FCCE29622A7F330659FBF5AF979 [email protected]
913,024,506 *5F0970B8469E28F082AC7AD15F877F9AE949F204 jeffryschrumpf
913,024,507 *5F0E074586AE6B1EC39280AD85CF0CC9FBD231F7 JEMMALIN
913,024,508 *5F0B503A4DC45D15D9665EFBA007DE3C813FAE7B JENNIFERNOELL
913,024,509 *5F09612C90272F3BEE1072AF8E4695154F507281 JEREMIAH.GREENBURG
913,024,510 *5F054A4AF6E59DB0ECCED4FE19B1CA675C0E3616 [email protected]
913,024,511 *5F014AD4832EC6320550D1DFBE99489F5D7EC3DB grahambielicki
913,024,512 *5F02CD2DE8C49FA8DEFE87B48CD241B1954CF962 grahamcarnie
913,024,513 *5F0AE6F9366E207462B0D7EB8AFA60D3A627BFA8 JERROLDWETZELL
913,024,514 *5F0B59E7A29973C200E9CAF13FA3AB2405F3D69F grauede8
913,024,515 *5F0DD024648DCC939D1084CD16164469824C9C65 guillermocerventez
913,024,516 *5F03B4EE9BA425DF4FCABB05FF0EE9181A088D0C [email protected]
913,024,517 *5F05BB1FD9182D621E17D141A3DAA9D38025D55C GUSTAVOBERTRUM
913,024,518 *5F0EED6AF7C6B4B99C61928256433AF1CEADFF60 GUSTNE
913,024,519 *5F0A76C8A9AB2C5969022A341A75D33E26E5818B [email protected]
913,024,520 *5F0E242AE9EEDE4A390ACBF0A1995C9BC91F9F9A JOEANNETALLENTIRE
913,024,521 *5F065E0EFF6A11EA97D0E362AABC5C819247028D HADAR.OZ
913,024,522 *5F0987F782991E8FE0B53D3EA391B3988E622AC6 JONATHAN.SPRABERRY
913,024,523 *5F0276AD82DD613D9C3E4ADB7A09C82809823A94 HANDKERCHIEF,.SCARF;.BIB,.TUCKER;.BOA;.CUMMERBUND,.RUMAL[OBS3],
913,024,524 *5F078B1628F911A4EF25F7F956CCD8CF080442E9 jonathonunterseher
913,024,525 *5F030BEBB6AB6F7C07F7A2F824B3C11752E324CF jon.duey
913,024,526 *5F08D630493FCB6D76410FAA7A9A1667C0691D3B [email protected]
913,024,527 *5F04BA05448909FF74654D823E064D570C5BAD08 HARLEY.BROMBACH
913,024,528 *5F060E1C44F66D1A6CC9DFCFD4A3FC1D0CC78C3C HASLAM71
913,024,529 *5F02EAB128671C01488A97FFE36A8F5D6EC80C78 josiahkenwood
913,024,530 *5F0C170E32EA92AFA99B0ABA75B13899E765D2CD [email protected]
913,024,531 *5F0CBE3F295D41C55EE5233F00376EA2E98C2ED1 JOYCE.MAGLINTE
913,024,532 *5F0E0FA29D6A9F79AD105EB0EBD939DB5C8C77EB [email protected]
913,024,533 *5F03FB16C1C69FD01ABCC8FDF826F90F2036D8FC J.STOTT
913,024,534 *5F0182C43430572C58FAACAE80C4B8388ED9331D [email protected]
913,024,535 *5F015D0AC8831AB88CB246D2B7B0BF8AABC472B7 judsonvoisine
913,024,536 *5F07081BA3A235F23C1BE5EC4908ADF7A3B43E88 julianspyres
913,024,537 *5F0D3184189EE63392BED85FED13A42440169079 HERMAN.WIG
913,024,538 *5F0F83FD71D0BCE1FE0D9DDCFEA265F466BDF5C8 hero-higgins-in-our-lineup
913,024,539 *5F083CFA15D709CD1EA7453ADB7B5041D9825D2B HERVORMINGSOORLOG
913,024,540 *5F0E8EE0C96C29B47CD662484E02CD2E7EF99F07 jwq`
913,024,541 *5F0E2B48F717888EDEF56109AD7CC8C2E58DE898 HGs
913,024,542 *5F095A68C6384CB74A8125BC6B1846A2D606C7F4 KAPETANE1
913,024,543 *5F0247940915A94DB3387FD4E52EEF5ABD754433 HITETTVT9
913,024,544 *5F05E4009D3B6229EE3139838E1A5F78891C2848 KARISHMAPAI
913,024,545 *5F0C8CC98CB4457A99FF7D8D01871CB9658F2109 HMARTOCCHIO
913,024,546 *5F07404781B2314E50AC600AFBBC54BF8C7666AA hncsocial
913,024,547 *5F00BE3C72AFE16854A17B55A91829A79D7D5103 [email protected]
913,024,548 *5F0F4418E9DB4E0E2BF92A255FF0F1F47E3FD3E6 KEN}
913,024,549 *5F0F8FA761C167524CD3271E444CF74795779566 H+P!
913,024,550 *5F0E6D0B256FC3FB61A20BC8640818F65D2F3F2E KENNY.THATCH
913,024,551 *5F039FC5B521356C3F28F5AF8B3C375BB8385A77 kentq-dee
913,024,552 *5F0CD1C3332DEFC2ED87D83CED451A6788E4FEFA HUEYEICHELBERGER
913,024,553 *5F0BD909DDE71B56C327A8E4B12E66A276042F30 [email protected]
913,024,554 *5F00BF2A9B658B14A44A4AF907D57C7A255FFF13 kipvancott
913,024,555 *5F07E4B575762DCC96D5C7A750567AAAB955BBD1 [email protected]
913,024,556 *5F0FAA0CB332233B0F3CAB08996ABF933F8DC462 KL.=
913,024,557 *5F0766A3FFB228BC67676103C597F8C1AAC8C003 KoKo(DJBeats)
913,024,558 *5F04821140BD4FE3306150EBD5E26276E384D2AE koryzahorchak
913,024,559 *5F0930CA4E2A5D3D8C6C5C35903AAFB4B44B78B5 IARETEPMOC
913,024,560 *5F0035DE85DCF849E0A7DDC5FF48F9AF6AA73150 ICAN'THELPMYFEELINGSOBLUE
913,024,561 *5F0C003D3283965ABAF0931DB24BCABE7C362AB9 kristalvorm
913,024,562 *5F0F680D4F5514E4952813EB132C9D4BDC048D29 KRPHYLLS6
913,024,563 *5F0E513380741627D284C74F57BDA3CBA8204A0F KYLE.MOSLEY
913,024,564 *5F0DF2A42CFD1EBEC173668552EF3FF032350FD9 KYLESNOKE
913,024,565 *5F0F8C8C156D8D954748E0F427827DD7E51B834F ILUVMENSUCK32
913,024,566 *5F02B235F212842603EC18193300299736E2313E [email protected]
913,024,567 *5F07773211991CB3A2A032BF5030D45005114711 LA-FLORA-(AIRTO-TROPICAL-REMIX)
913,024,568 *5F02D7822F46FDED2E2A5F81E3BDD5AC1A1EB6E6 LAMAR.SHAPLEY
913,024,569 *5F0DE52017744E2C04A58C9A3B529F8FCFCCCA97 IMPOSONSES
913,024,570 *5F08F67B53A47592E31EA45ADA26311517983BEB la.serva.padrona,.part.ii:.son.imbrogliato.io.gi
913,024,571 *5F058A8B47D912EF72DD73A59672C6CCEDFF0036 [email protected]
913,024,572 *5F0425BE5C3847773E977A47DD6E4955047B5536 intelligentthere's
913,024,573 *5F0B8C47D1AAD52EE053C6AD1BA3EA2E6012116B INTERDENOMINATIONALED
913,024,574 *5F0636BF28088242E1D896AD6438814CADDC6478 LAWRENCE.LAGRENADE
913,024,575 *5F0D35F4CADF9582FEBC44772592424D43327070 INTRODUCTIONSANDINTERRUPTION
913,024,576 *5F0620F326147EB4E4EC9C6B8DAED42FAC788707 LEADMEON(LIVE)
913,024,577 *5F07040A319F6C40F67EFD93124956CB7E444871 irqaaa
913,024,578 *5F0623FBD2FE0CAB7EE3C775A765DA8D88BC69B9 leoncalhaun
913,024,579 *5F05737E9624727DE3A669A501975AE78955A538 LESLEY.KAYE
913,024,580 *5F065CF9C397478B02E02E9D380EE74B1468B325 j,(a
913,024,581 *5F0451E3A683AA3849B468BE8C7B3551C77E0321 LIEGESTUHL1
913,024,582 *5F0929EFFA217E868F709586A10977EF97513271 LINDSAY.GIARDINA
913,024,583 *5F0DBF37B3DFCD0EA151B13297E4EA6C62B6FD04 JAMESPALFRAMAN
913,024,584 *5F0066E149EA811AA1EA8659AEF3F730C3684756 lisatony6
913,024,585 *5F0F482CBC1A98D4E6D46431011CC97C754C11E1 live-at-the-fillmore-(disc-2)
913,024,586 *5F06020B8B11B984D89CEB04EE2429195A8A3296 jason.eckart
913,024,587 *5F0B03FFC106F1B4773CD3601ABD220D26162168 JASONRAMSEY
913,024,588 *5F0D83A3373884BBCBBC234522F5BF2AF072A553 lj)+
913,024,589 *5F0A35DCDB63390CE75A1685882F1B206DE24A9F jayrlozada
913,024,590 *5F042B331A84C0A59F47AAFAE250A98D46F9129F LM2-
913,024,591 *5F040AFA027712025FEA202D993627B37F7A8365 JBOSSENGA
913,024,592 *5F05374BFA9D49D23F0D4BCF0533BB8959A1BEBF JBOTTAGLIA
913,024,593 *5F06EABF648F4F978E5408AC9152EA59FD257EC3 LOLKSTER
913,024,594 *5F072C3197B096413DC6D6CDA530C3DD71072772 lonesomeinmycabin
913,024,595 *5F02E7038B3428F4A409815E259A302CF0BB5205 LONNYSEAT
913,024,596 *5F0629574913D87B3F4873375BB163C1F5E8119B !jebaa
913,024,597 *5F0C7F3BF62D8E0A3F91364D4069BF2483730313 [email protected]
913,024,598 *5F00F4833340AFF610FA10313ABE250F4ABD399F JEKKULI
913,024,599 *5F0B4A517CA07875F69A6BD0C69DCD01EAE218D2 loukhoum
913,024,600 *5F096AA6279ECF1B3F35F80F010B9E95FF43A196 ĺströmde.fina
913,024,601 *5F0AE5217C7FB48DF7D35DD644966E329C8868B5 JESSEKIPP
913,024,602 *5F0D2685D8726EB5A33D8A093C2A712E242CFC3C JESSMAZZUCA
913,024,603 *5F027D0270ADDA44F82AD2F099F3B9C270AB0379 jet.black.man
913,024,604 *5F00257DA8889E19E38708DD79E98563622ECDE6 luisswatzell
913,024,605 *5F0BE06478F299E42FE1DE09313DF324978F2CAB [email protected]
913,024,606 *5F05C6DB1837201EA88AF3E36C7248945A771B15 [email protected]
913,024,607 *5F0386A8AC573AA9FF80D4ABA03ACE7DF090C5FF [email protected]
913,024,608 *5F0B1A355F001C9767340BEBAE312F2222F9B421 [email protected]
913,024,609 *5F05D4613467DE3DAF5F4DCA071C3FDEFBF2052A luude
913,024,610 *5F02ADECDFC530F517326A08CF3257CD326AC342 LYNN.HILSGEN
913,024,611 *5F0335C96BDEC857B6850BA1F6540602D7E85055 JK;/
913,024,612 *5F06A40BD25A8070B3791B6393E299383428BA68 JOSCELYNNE
913,024,613 *5F0211E9A9C047FC05363AE31BABF020E3D4DE0D MARCELHAKES
913,024,614 *5F0C4F413C4FDDF43F77C8794681634FD4CF847A JOSHRETARD
913,024,615 *5F0CD03E631923CE026190BDABD72BCA3B983FD8 JPAREMSKE
913,024,616 *5F0FF8DAC1AC3BB0CE218265FF4054233DEE784F とJSATに営業譲渡。
913,024,617 *5F09F5D5E5DD202B2244280D7F9F0FBA4735D2B0 JUBILATION-NO-BASS
913,024,618 *5F03321B5BF95DCDB208C10B2267C0D6EBDB4635 judsonclaughton
913,024,619 *5F037B76F383189DA77195BD6F6C74BBFEC0E348 JUN FREZ
913,024,620 *5F04074760E27C76E00CE8993AEF8D8F5DC80B5D justine.mcintosh
913,024,621 *5F05DDC1AFDF6773150A25EFF98E5B648C751360 MARYJANEMCCOY
913,024,622 *5F0EFA2AB96C1065F3E88B03A562FD4D42812F2F K290409
913,024,623 *5F061D65AB82785FC81EEB9BB24296EDEEE9D650 mattcarty
913,024,624 *5F09B9E6B9EF607E1BB859246BD8FFA81D6ECB93 MATTLUTFY
913,024,625 *5F0C1D6864B524F1175B481D12F65354832987C1 mattmole
913,024,626 *5F0BBF30B5687329CC6894B2172B7DF4A35E3E7F [email protected]
913,024,627 *5F0DD9281AB8C9D34907B03D073EA268D784DAF8 KATSKARAVANTHEHISTORYOFJOHNPEELONTHERADIO(DISC3)
913,024,628 *5F0D8482328A7D679623F9F66EA3E2DBBC364C1F MEBIC扇町
913,024,629 *5F08A351C6630B5C214BE521AC5C2B0D73038A11 KENDRICK835
913,024,630 *5F0B2F8C898E73CD9CEFF78460AA7887A6BBC443 ken-ewing
913,024,631 *5F04B8E498D882973B0A966B71CB31745F5CB398 kerks0
913,024,632 *5F071EF4DCA2CDF48FAD9BEFA757F94968293583 ketolyti1
913,024,633 *5F035BC36A658731E9F3441C79F5C36C1F73F2E0 MIGUELSHINABERY
913,024,634 *5F0FDFF64BAEC5ABD2E497D0F7A78A430E70C4D9 MIKECOLLEEN
913,024,635 *5F0A890E183B652A36105418B4A7874B915A13BF MILAN.RITTENHOUSE
913,024,636 *5F0E3E53882125609143F6B7E462BF0BF78B18CE KNIEGEBEDS
913,024,637 *5F0317FCB93C9D3F9762313CEC205066AC59A577 [email protected]
913,024,638 *5F01AD9FBF4D5C8B2CDE9D3750296F5470FCFB24 minimoog
913,024,639 *5F08EA8E321BF37441E33C031A779FF94E2DCF53 MISSAINLABOREREQUIES:I.KYRIE
913,024,640 *5F0762BFD78C52C24450EED8E0939C76DD0F8129 ksiegarz2
913,024,641 *5F08B948677D89FBB971A531B8E387539FF4E507 MOLLYHENNING
913,024,642 *5F09A16F3BC81CAB4D7F8764125F2828489B8E6F MONALISHAROY
913,024,643 *5F0BA8F178641125763E50BD9F31D4247BB4C4A7 kyc,
913,024,644 *5F0ECE654753C756F30781B8D0FFAE0FD6472B01 LAGITAMTE
913,024,645 *5F0F28431C28D7BEFFE25216DF3664953C53008B MPOMPIRA8
913,024,646 *5F037FF15A4F8EC7A9321491760A004EB2FFB3EC MRVSTR
913,024,647 *5F029366B255BA2AC2AC8A7804074C7DDCE18489 m`ty
913,024,648 *5F0CAF4FE40BC217B3869B35F0A415BF80912CDF LASPBRETTFAVRE
913,024,649 *5F0A921D1FB5182E33013B88B5E9F1DFD28861C7 LAURA-BELTRAMI
913,024,650 *5F0C74A94E394D369025E83FDCA785829EAE6DE5 LEIF.ROUHOFF
913,024,651 *5F04F8A8852EB21F533DFB81EE366911908330DF [email protected]!81ES
913,024,652 *5F064622CB4830A089B491234237CE883ACF6A9C LEMUELSTEBNER
913,024,653 *5F04BE3873A7613BF1CC1DAFD4AF837242C41A6F LEOMAMORAN
913,024,654 *5F0496A722E5B3C51BB9E6F3EC64DE13D68F2F68 LEONLIPSTONE
913,024,655 *5F0033975DDB6E6369B155AA3B3BF3EC75DCC22A napier211
913,024,656 *5F03628D377B57FE9DD6DF3BB18280096D1003FC narimane.haddad
913,024,657 *5F082FACDFED126D4519135A446126CB911B90C6 Let'sgetrealgrass,baseballshouldbeplayedoutdoors
913,024,658 *5F03B495E4E7368FF08AFBDDD10A8157CB4749D3 NATHANIEL.TUNGUL
913,024,659 *5F0F3A219E1D8D9F06995170773FE6B9B86BB4CE LEZIKHRO
913,024,660 *5F069376368B7DC5DD05E67D078E10AF9BDBD7C3 [email protected]
913,024,661 *5F05957EA72FC26DD75F8724835C97863E76A521 NATURALESDEALGEMES
913,024,662 *5F0D8173401EB06D4DA620D299F58F6F6848ED6B [email protected]
913,024,663 *5F007AE442E005A97949E1715FE15B5CEC7362FA NDI?
913,024,664 *5F0613EE7155ED0EDB7A536A43F5DFA3B7351795 nedelcuciprian
913,024,665 *5F0652FE4B0E0CD98196CC3A337F6578A232C91B NESTORGUADALUPE
913,024,666 *5F0CB4C1A7CED6D2C176699071A8AD4494275B94 linohuettman
913,024,667 *5F0FAE96E8A0A3C966DF1D2435C91F3414985064 linwoodroser
913,024,668 *5F040D96CA5E1816F97CBE7202E9B1C7A9D90FC7 [email protected]
913,024,669 *5F0569B4CA1616E36CB01F15AFC6D55EAD0EC416 NEVJIRDNAA
913,024,670 *5F01F2E382A9E1FC1C36E7613E1B862A4414754D nfmnsngging
913,024,671 *5F099EDB183948B1F35CE8DC4E8D58300F12AE4E NICOLE BIGRAS
913,024,672 *5F05DE1EEB399179E8EE888CC89DB78073D8F9F8 [email protected]
913,024,673 *5F0E7ADA60DE4541BF55BF7C6D03FA51ABE48E15 LJOR5793
913,024,674 *5F02D55A14375139FDFFF2BF0ECB8E68A585909A NONSUSCEPTIVITY!
913,024,675 *5F0D2BBF542C162B1825457B0C544E2B0BF509C6 NSPRSDNG2
913,024,676 *5F076EF84CF8D91D8C99C4AEA65995208F2E933A NSYAHDI
913,024,677 *5F0A4C11A7252DCE5042765172DD99DC2B254E25 luchterses
913,024,678 *5F03A03E0D09A560BB54D7604EA5B912F0578B5B NTMPRNCSING
913,024,679 *5F00687B984A8A651F5ADFB8698D1B81AC1A9184 LUIGIFINLAYSON
913,024,680 *5F0ADE279564066123FB36ABD5114E4F39B60336 [email protected]
913,024,681 *5F037432D850AD9105AFFFC23F169654CD894FAF NURS3.MOT
913,024,682 *5F0BA8699DF6EFA9C9F306C3CE9CF1CD112C65C7 O-DE-PAI
913,024,683 *5F061D8DA749C6E2205DDEE0B37EBDF0F8C8CD72 [email protected]
913,024,684 *5F0FED1079FC26F276A43460986D35D7AEABDDB6 MACHALIK2
913,024,685 *5F04EB6723D6C823E1E179438269E3D5AED7CE13 MACK.HARVILL
913,024,686 *5F02D8817323982E49C077BFD8F161A0E648ABE3 MACKSAMPLEY
913,024,687 *5F0FD2706157FB312C994BFBF2EB4B8C47443948 Oh,-by-Jimgo-Oh,-by-Gee
913,024,688 *5F0070B761652F46E79BB2F80125271635C2F550 oldenglishsheepdog762
913,024,689 *5F0AC391EE44EC9380F39B13CCB127FC542897DE olliduac1
913,024,690 *5F012C2571AE16E35D2D3C73D80922AA79C0CD2B MALIKRATKOWSKI
913,024,691 *5F0D64E6B17D7E8C72B9E9C8E1FD798B8B1088CF man071397587
913,024,692 *5F098CABFA0E8CB2FD76C4334398B61363A77C21 manuelcolasacco
913,024,693 *5F017BB687E2987C2D92EFC805772C4FC6ED3A95 MARCELO.RELLAMA
913,024,694 *5F0F736F12B02DB0C6282DDB3DD22B33A4F28C45 marcus1974
913,024,695 *5F00FF9FA0BE9A505F5D61E5E81FCD2B2C7A5EDB MARDOG412
913,024,696 *5F0450F1B58F2A874965D03512F6BF837E1E2785 MARIANNE-HOLTH
913,024,697 *5F0BF216169F58187B90660050646DDAFB4472C7 marianomelson
913,024,698 *5F0AF409778722C0E4F7BA5A59807418552907DD MARIANO.MIERAU
913,024,699 *5F014064A2FD5848B4712FE94179522F3E6631B5 mariejosie
913,024,700 *5F0E85BBE91A6E55755F31145281F80AA14F55E2 MARKUS.DRANE
913,024,701 *5F00C6F6BFCF0537E0EEB4207A957D8573DF4A72 (^_~)~~~<p
913,024,702 *5F0218D19989A1651B322F601544398E5AB50205 p4^
913,024,703 *5F0C320E282349A2A9C1EFC7F9CE0151AF17A54F paillassonner0
913,024,704 *5F0F693B91FB74749521FAF527544384EBB80A1F MAUROLACE
913,024,705 *5F074271613E78DC59498CBC7513CF589CB498AB panji.arya
913,024,706 *5F003A3291974D8EA291A73C4110F2B1DBCD3E13 MAYNARDCURETON
913,024,707 *5F01017305D0AD0526124696CEE12A1A823BD2E1 parenthesis7
913,024,708 *5F0D483975DD61DD2E7B8DC080F707EE8A26012B MEDICINE160EDIT160TA
913,024,709 *5F0B6319D02E5AC256A2493DB08806843F8B0DFF me(disc1:mixed)
913,024,710 *5F02197F93F6B4F2166A52832ED0EE56C6E2BEDF PARUL GOHIL
913,024,711 *5F043502A554CF35D0DD829C1103F7E689B3BE5A patenkiring
913,024,712 *5F0C41F3E223A3A66F38647617CFEB3D9D55E942 PATRÍCIUSAIT
913,024,713 *5F0C17BA6E947B516E0C1846D1AF0BA948445276 [email protected]
913,024,714 *5F0B74D96956DAFC055484AE46C00208378410F7 PAULIFERMI
913,024,715 *5F0C63F327325D518AE3A78DA97934024A081E38 MERRILLRIVEROLL
913,024,716 *5F0488FCAAA2BA2993C66C4AB378BB2EB32F2B50 p------b~0~o splat
913,024,717 *5F0797E6A307E90FEAB69DF4FFBBB2C8DE2C7AB5 MICHAEL_IRWINVERIZON
913,024,718 *5F077E9FB96747B27EF310ED80590C54FA0E6FFD peer gynt suite nr 2 solveigs lied
913,024,719 *5F0DEB5CC8719E7750A182C1DE9857E8DBE48E2B mikimaddog
913,024,720 *5F0D2F7E02C0C673EA4DA9734983C36C0247A57C ph)
913,024,721 *5F008385DE4E573D5AEFCCEF44B5F0F2EBE8DE19 [email protected]
913,024,722 *5F0EA728EE5F2E2C940516550370E141347F272C MIRACLE(FEATKATIEENLOW)
913,024,723 *5F0DC9068191B0C10C8B939D39A915285F61EE2A MNNMEFBBED
913,024,724 *5F0EF341AA680B7A5352A910137E7D42DA0F5435 MOCHIIRARERU
913,024,725 *5F0D101FBE1A7B149BC2C147111FB260FB98784E modernmanners
913,024,726 *5F0A80497FA6DF9D9226520F1AFA2D4BB392F894 Moi-je-sui-tango-(Libertango)
913,024,727 *5F0DD9D558B82A9F731A8BD1B98F8D0BC9A56FD4 moldar
913,024,728 *5F0DB1F07F7FC6CAC98B4F8D4F8C322316B01BA1 [email protected]
913,024,729 *5F0C172F29ABC4FA7ECECB4AB16832AB7CBAE77E p======>*}O{
913,024,730 *5F08EBCF0DA0C921FB03BAB4B24CDC26C2D47032 POLARBEARSFLIESTOFLORIDA
913,024,731 *5F038FD4CDF849DEBD9415F0678180F61694F5E4 MOSES.SAUREL
913,024,732 *5F0399732F0A52A1CB6A7A20E4C0A2DFA81F73EE p)~O~o(0_<)
913,024,733 *5F08D9A9AC52DE18396603E38390957AE6F14108 MOUHARDEH
913,024,734 *5F0CC2A63A6A2F1B463F44A72A17893578373516 MPAGINASRECOLHIDAS
913,024,735 *5F01010949A03D7E05DD6E0C74B00F9A7A947B69 POTBELLY
913,024,736 *5F07062A1BE1C3CA064338872114892F2849AA3D muckraker0
913,024,737 *5F0F0E6CAEA68230A4774C970EB180F29D689A90 mufinella
913,024,738 *5F01AFDC5F9BBAC15DA6D583C2C0A06E3CE68B9C PRIYA CHETTY
913,024,739 *5F067709ACD4B0EC225D99DD5D8D9672B28844A9 PROFESORZY
913,024,740 *5F0F9849C9FA043A0EDA9DD9A00475458D982DFB NACELNIKOVYM
913,024,741 *5F086837E8ADE67A408D37E3826364575B55E838 NATHA096
913,024,742 *5F0ECB94A4968D87F4BA843E5E83AD9BDB66D999 nathanrezek
913,024,743 *5F0F4CD15989B8127F5E2E8355A7CDF660913234 PYRALIDO1
913,024,744 *5F04378E271AE18181430532D57A27D1DB786244 q##b~o~osplat
913,024,745 *5F00081589F0A29A3E8B95B515120A69CE76129D [email protected]
913,024,746 *5F0ACCC97C2B700C0655B2F430F74920E4783932 qkcq
913,024,747 *5F06EB3497816DF5E6CA6C9609F853ADAE306E8B [email protected]
913,024,748 *5F0AE25BEFF0381C5EC857CE228A86F462EC826E nestarej.se.kamar
913,024,749 *5F0CB8D82EE32C9A79F4318C9687B71D7DE721EA qP.~o.)o(
913,024,750 *5F0CCA9981234DD4C738EBD48FC463AC04009EE6 QUINTINSNELGROVE
913,024,751 *5F059D0B2D918818AD9F7D4EF8166675F3E52835 NICOLAS.DAUER
913,024,752 *5F05A7FF7E18E6A6648AC6542AFE5EF1AF7DCA30 [email protected]
913,024,753 *5F0C7723DB43352AB070292602DEDDDEE1BCC3CA NIMESD
913,024,754 *5F01C391F0EDC715ED25CD4D5FFFA17BCFFE32AC +R4++4VI
913,024,755 *5F0DDC2A1624013B1056F9DD688D7F59356A0975 r4mst4m
913,024,756 *5F09DDC01807579D70D069204B9AA6E488719B7B racia1i$m
913,024,757 *5F05B778BA7DDBA1FE374E7491D2B0012EA35AA3 RANDY.PFOST
913,024,758 *5F0F83AAFA3B814BC7A79F60ADC3CBE412C6ECA5 NORMAND.CLUBB
913,024,759 *5F04C5BC8DF54C9255AC16116417672D0F81ADC9 RAUBPOLI1
913,024,760 *5F09AD25087C7D80FD320E06313D27389D6CF5C8 norrybsw3
913,024,761 *5F044C0E9C26ED56F2C0DFF5CB365FFFBE247EE8 notionalist
913,024,762 *5F0119DBCD0303FF43B28A0A550610FB0BD7F9F7 NSTWRDLKS
913,024,763 *5F0F2823187F0078AA1D30DA7E9A11020B1BB091 NYÁRASDRA
913,024,764 *5F03C902007FF4B9B6B6EEE8D23B8A0B6335AF50 REDKAREN7
913,024,765 *5F0B602FD6851CADB171F113C2CFEB576C19C1E2 oku*
913,024,766 *5F0358286E0FCFB4BADC4CD74A038E4256D23333 OMSORGSFORVALTNINGEN
913,024,767 *5F066AE901C452D9E6EC5886DA10CF11173B698F ON.NO-ONE'S.SIDE
913,024,768 *5F0D17E056042100E0BE764ED32CDB603034AE16 RETRUNYEN
913,024,769 *5F0547BE199E2DA49E09F752BF320A7A000AF8DD ontkoppelden4
913,024,770 *5F0A71FF0E08C5A336BEA8FE0B5D2076491B4C0E reubenzellmann
913,024,771 *5F0B80AADB886795D8070C3629B2FC1B9230F459 (^_~).o~.O~.qp
913,024,772 *5F079DCB2D56A04D7DB109F36763A0144C40D985 ORENMOTTINGER
913,024,773 *5F01EF93A68AE4BE906E336332493D2DA49499D5 ORLANDO.CORDIAL
913,024,774 *5F0B5B98C24D9932BD90F29E7358659B507ADF62 RICARDO.WEIMER
913,024,775 *5F0AA6161AE26D0CC61B7C009C126D4C426242FC richard-ezra-tumangkeng
913,024,776 *5F082845F3B6D2E5A81CDF91843C7703FC85F1BC RICHARD L MARCHANT
913,024,777 *5F0FBF9520A3465BFC452557413E18AF4CADBCD7 ossuroloc
913,024,778 *5F0F389E4AF38709AA2DBBE4410137F24448791B rigobertoherrig
913,024,779 *5F0D140B608B83EA3420BABC621D6BD9BD127A4F OTKIDATE
913,024,780 *5F0157FBF9EEFE3EAFF468446788DF1FAF0B0B01 R-MIG-IK'-I-DET-DER
913,024,781 *5F0962FF5A8EF8F12B31C5A983D211C4F832180D p=)~0{x}
913,024,782 *5F0CDA07FE2513D00613B9CBCF81C4A24D7F3441 P4553N93R5
913,024,783 *5F0F67EB0380E67D37536890A24F880DE4B4ED2B ROSARIOAKAMINE
913,024,784 *5F089EBF2A288084E31D47A95BBE43FCED0B0449 ROSENDOUVA
913,024,785 *5F07866B9D76ED4304FC5EEC32BA3BF326DDCB1A ROTASNEDNOKEDAL
913,024,786 *5F0A8578B4718EC0FF405A589110006A54DF1B0A p===b.*.*.(^_~)
913,024,787 *5F0062ABD9B248ECF2EB1D06EB72DA4583C7997F PB*.*.*(><)
913,024,788 *5F0DD7B9BBD19C50ED408CBDEA450FB558944F53 rubenburth
913,024,789 *5F0120377C04D34BC73B476BEDDE3551990DBA82 [email protected]
913,024,790 *5F02C9AF9B9188FD00CEA7C0FF36B5127D22037B [email protected]
913,024,791 *5F0CAE19E68201AA5E235CAA988A396E89BD64A9 [email protected]
913,024,792 *5F0D0513A99D3A82F9E07242FDFB9590097BA4DB penguinforest
913,024,793 *5F098E60E96062876DAABBEAEA52E7144397C19F RUDY.CORREL
913,024,794 *5F0EE69CB27A4BDA3D42A69BAEC883EE1702DABD RUFUS.POLLARD
913,024,795 *5F0546DC18B92B5C35D6EE82F5E55CA1EEEAEFD1 PEREDVIZHNAYA
913,024,796 *5F08474F96089876563D367C95F95CC6AEC880A0 RYHDYTTISI8
913,024,797 *5F026ED630EB7010E4D5FFE383940E1F9BD8DE0F PHILLIP.JERDEN
913,024,798 *5F027D8327487E3C5E2DCA1B8567D21169A514E3 [email protected]
913,024,799 *5F0C98A0EF2A2B8E9432B8DB64B68856187A4DD1 SACRINGE0
913,024,800 *5F08E5C25BAA0FC9F30B9D01DB5902122C0CC30A Sad.and.Deep.as.You.(live)
913,024,801 *5F01513C80600A7FD2A0A1A3C5F3277C43AE1304 saimeayp
913,024,802 *5F0674BF8082E904A9CFAD875C0207014220FACA S ALTO
913,024,803 *5F0C8077F50C3277CA3400A1BBAFFF5D2C091003 salvatoremonsrud
913,024,804 *5F03B63458AF40CC1F8225BB2407A210E8B6252B PLAYBOYMITCH
913,024,805 *5F05EA32964E8EB94EB9867C7EB08895724F5735 PLIGHT8
913,024,806 *5F0ADF942E332554FC316B2F355CECF669B77C10 SANTOSARMOUR
913,024,807 *5F0CBBAE329E0986AA0A7B4E694691CEB21AEA89 SARANG.LIM
913,024,808 *5F054A6415550CBE99BC015D54813CE2F2E50E34 PORSCHE9BENSON
913,024,809 *5F0D50A5CE624F8345E8226E0061101A08C54F78 SASSYSEXY2
913,024,810 *5F0545D99A10F296FBA8F3C80F72DE504D62C791 [email protected]
913,024,811 *5F0E932DD4BAD484FBFAA9A3502E9BDDEB9F0C5A postostru
913,024,812 *5F01553E967D9526AB1921C38B72E81268BAA089 SECOURREZS0
913,024,813 *5F03814402028C88FAB732B1BF772235ECA94F5B sedereis0
913,024,814 *5F09F7EDE1D184B56F10E9553DB5CAE114568985 sehcsnem8
913,024,815 *5F08E9A12BC1CEA3C13A0FE605D698A8BE920B8E SEKASORTOING
913,024,816 *5F01ED970D33C3C92C1CFB66036CB9B4BF43FFA7 SELVITTAEMISPROJEKTI1
913,024,817 *5F09F7504D76521E20676425A3F0EC809F5BB279 [email protected]
913,024,818 *5F09A83D176FFA58889DC6757D3885DE64DE3450 [email protected]
913,024,819 *5F00E0FAA00C6BAAE6BCCBB3323778D3A5F66A78 PUHAVONALÚ
913,024,820 *5F0EEFC02F020C6BA6DEE45A2945A74DF1D7089C PULEYNE0
913,024,821 *5F0C24802B6BF58D0E18A034A4BD2FDCFD3EEEC1 sethroland
913,024,822 *5F0A266FCC5D48B6348DDEA18439842E144A1316 SHEENAJKM1
913,024,823 *5F0D9D855E8045F916641E9A750CCA3F18B15207 Q=====D~0 )O(
913,024,824 *5F0157A5CF1187AE747889551FE00555A46BB0CD shermanshockency
913,024,825 *5F00DF818DD78FB0A79D3C1F3131251C75B88BB9 [email protected]
913,024,826 *5F05BD34A87F25158FD798C2CA27CFB04557D7D3 SHERWOOD.ZULLIG
913,024,827 *5F0631A6D6FF5FAF4551980D96007C59E6CE2838 shieldtoolate
913,024,828 *5F072D977A4ADD8A6EE619B544BA308C15961F6B SHONBANSAL
913,024,829 *5F095976C16CBA4CA559A0267807E76A041E29C4 SIMEONĄ
913,024,830 *5F0A2A2AE44E6B35483D9CF9238DE30A8011763C R4VIOLINEN-I.ALLEGROMOLTO
913,024,831 *5F0A937AD5395C9FD4EF407D25198A228478ACBE SIRIBJORNSTAD
913,024,832 *5F05DC29C3CED4651A0B341FCB38B2136540D75A RADIOREPORTAGES9
913,024,833 *5F0437E44E8A3643E73D2223F4E0861F28580226 SKOTTRET5
913,024,834 *5F0092572761ED363EF1E4E6065D0539C66CDE10 SLAMETSRE
913,024,835 *5F02D3B410FE0443718E8AD9F3A04CD439C9F97D SLUSSBASERAD
913,024,836 *5F0FACE3A3F71BE9C593039C7720761C0B531FF3 rbrdbsw3
913,024,837 *5F005602BB918BB002264082E018080B65B34F87 rclj
913,024,838 *5F03DB482FF8648CFF5F858535219F5867C855C0 READINGBOY
913,024,839 *5F07E06AE2FC877B81737DFB0442B51168D080C3 SOLLICITATIES5
913,024,840 *5F07FA25535276BBA06F13CD4E8BDA3750E245D3 somethingimportant
913,024,841 *5F059BC614950982197504B193E83D9B22CD55C3 SOULFULSESSIONS
913,024,842 *5F0ABB46395687CFD467B9F7A2250EFF605017D9 SPARKYMADDOG.
913,024,843 *5F0009717B0813EBC0A13847777B5C1D855D71D8 SPILLERS
913,024,844 *5F057995F965F2E217BFE5A607771181481340EF SPLAT~ ~(###P
913,024,845 *5F0504021C7489AF664CD9740993D63F07EE45CC springjoshua
913,024,846 *5F0C032C8D4832AD6B6A22E3310D00EA9927486A [email protected]
913,024,847 *5F04BAD25D7605EA7F953FEA269CF813062CB1CD SREKJILEGNO
913,024,848 *5F0DF76976BC8E387FDC9EA36177C41E0B204191 ssenhcra1
913,024,849 *5F04B6AF7E65038BBA1027801E4D864D56AA080B [email protected]
913,024,850 *5F0D8DCCAE31F0C6B610A32B4EDCDB012FDFEEE2 riibert
913,024,851 *5F0C4EC46CDE9D3DEFE4977B605DCF0178B34B8F STANTONENGERT
913,024,852 *5F0105E922A360E75072C7C2382AF91C6D8AC65C riptides
913,024,853 *5F02C52A012F2CA4C6963BE4F3CC034865612F40 R/JZ
913,024,854 *5F01FB855326B1D67071E08D3468857AADFA6BC5 stevelahaie
913,024,855 *5F08FC041DB16D40FCBC037F72F4A851FD8ECF9A roccogelber
913,024,856 *5F00761558D5518ED25082D612B525DD77DFC812 STIMULANTNA2
913,024,857 *5F0FA9A9E3B52906066D713F3A7367FF0CCF3487 STLUCIANS
913,024,858 *5F06D9EA5911C0DE2703DD2016F606C498C5292C rodgerdoller
913,024,859 *5F04880FF2D63A08D1B1B2C48C931C732A3C190D RODGER.MURFF
913,024,860 *5F003F3B4EBED95C08D52C0683805195EB0E8618 STRATEGIAPELE4
913,024,861 *5F0B3AD6D13E685A091866F78C7474E190CB04DD roffelzaag!
913,024,862 *5F0A3AB2EFBAAA0DE00001CB3C87D81275322A35 STRENYE2
913,024,863 *5F05CFBFEAF844E9C6F70BEED2D993CB94ACB079 STROOMSPIEGEL2
913,024,864 *5F0827C1F19C5C9B1A7F066A8E4F52E913118E8B rolfhallett
913,024,865 *5F045B84686FEBBB8597662F2EBE4B47B89A77D8 rollandscribellito
913,024,866 *5F03876D7AF65B1366EFC24A440E7ED8942EB5CE SUBJECTHEADINGSES
913,024,867 *5F022C2EDCFE86D9337D44D22B772AB84567D6E7 ROSEINFORMIX5
913,024,868 *5F05061B82815A7B91B66F4A6AB843C5A073CEDE rosemary-borg
913,024,869 *5F0ED879DF797D5CDFD7DBC97E6728EEB43E026B [email protected]
913,024,870 *5F016D7C47E859864AC28FA2B4784E75C69FA9F6 SUOMENTAMAT7
913,024,871 *5F0C804F136F812AEB38FEE4D722A34BC64F326B ROZPUSTENYMI8
913,024,872 *5F0980317FDCFF3403220AD9585E4FA06E39B366 r (roc)
913,024,873 *5F0E1BB2E4F1EFB3F7F67D582A291AC66D33B3A4 RUDOLPHGEISER
913,024,874 *5F0A3E85A1D4C5451055357487FCC15F96ED1614 swethagudipati
913,024,875 *5F0F9C85E6D051EC213440A17D3A6537C2ABD252 RYANLARRISON
913,024,876 *5F0E5ADB367718A243134986CDE6D9E09FE19961 TAATLAIS8
913,024,877 *5F02BDD25115AD727C15429690A7B9B1A2955E1C ryoマキシマムザ亮君
913,024,878 *5F0CD01B013F437928F9E677901C1B026A5E3B93 TACHIKOM5
913,024,879 *5F0B94A7CE541191FC77B241251CC979DC1626B0 S3JTR
913,024,880 *5F0B2DC017F6D874EB98A698258AECA7ABFF44FF SALTATIO SANCT MARTINIS
913,024,881 *5F0110F6D3BA0BD4B72652A03AAA59F7CB9EBA18 samgaron
913,024,882 *5F08E692AB56BDAB1FD9F42428A0B2FC67D4A7E7 SAMMYSBACKONBROADWAY
913,024,883 *5F02707517258FC17A959EAA36C3158295845CC4 sandy-favors
913,024,884 *5F0E9BD35C7C3B88BD226393E86B3B1E419BE063 SANDY.TAIRA
913,024,885 *5F00B4F246E3D065940B71EE0699AC0E35828D27 tardspasm
913,024,886 *5F01E69FBB72449BFEECF7CBC591F52C2217CCE4 SARUKSEN9
913,024,887 *5F0B1CFB1277B29CF4D58126719D5A9DA324B6D1 SAUL.SHINES
913,024,888 *5F038332B160546D24E54F5211C3B59F0A7C9DE6 sauteing
913,024,889 *5F0F232B0CBF7C2D8C4C5DFD295BD929409923F4 SCALAVATE4
913,024,890 *5F01AE4F7C833700F5E790443F437065BEB1871F TESTINGBASKETB4
913,024,891 *5F0D8ADB6FB0A22182FEFB55BD27BE422D9113A9 THALURANIA1
913,024,892 *5F0697B1993BD026A3EB641C7D3B883E0EF89F00 SEFYU69
913,024,893 *5F014E55815F464C804CB55F0E91E6C433CA5229 SELBARUS1
913,024,894 *5F06E44D629E79BA56012D67A8C11449A768735B TheBuddhaExperience:ZenChillout(disc2:Planet)
913,024,895 *5F0797D24DF8BDDE082B9D1A8BAF2162D920A64F SENGEPLADSERNES7
913,024,896 *5F0D93B3B838059AB99E39BA161F13E0D20FF402 the golden year
913,024,897 *5F063E7CA14ED566B18F2AF0F2E3F8940EDE364C SEZIDIUQ3
913,024,898 *5F018F084A13A60CD5CD054845C8E40D2620EBB5 SH8574
913,024,899 *5F07B9498E4E07A36B0C56D2292403AE52B8521F SHARON.LAMB
913,024,900 *5F06DD2517A535F7722EE4B08BDC6FD0469445D8 SHELBYFORBES
913,024,901 *5F0434642DEFA3A3CDAD9255CEC6F656774BAAF3 SHERRY SAMMY
913,024,902 *5F0B822AD550CAECC842373EA6B0BF207951642B SIANG-LOH
913,024,903 *5F0BA5D72D76E4F0C3AFFE07D042631813BE42C2 TK3333
913,024,904 *5F09F6A3B570E6A2C8EA63EDCA6720B853A88D11 SILMLASIEN3
913,024,905 *5F0D03ED8CAF8BCC651828AF48C9027C4F75259E tobiassparks
913,024,906 *5F0C55953393F546F8CF054445A8B0ACCEAD7B8F SIMON BENNIE
913,024,907 *5F0DC882D8F0484B3236FDFB86DBE9D00D218835 tobyfranco
913,024,908 *5F0183C693EABA857828DF648ED6234BDCDC2C11 SINORHYPHUS
913,024,909 *5F0838086834BDECC22CA158797FEDFD5DD57FFE tomvoodoo
913,024,910 *5F007C1527FD08C3C795CFF09788E33EEF46399A TONYKOHNERT
913,024,911 *5F05CDEDC812BB38B07EFA16905293E4E7DA5441 TOPIENIE5
913,024,912 *5F0AECCF7D98AA9FC2E30502B475E3E122D89EBB tor.arild
913,024,913 *5F0278EF48143879849C16FBE41EEE970F04B631 słowiańszczyżnie
913,024,914 *5F0E39B54BF9432F7CB4213562F0474D17067086 TRANSMAT1200
913,024,915 *5F050C63AED5EDB5BB168C532E5B99B0FB0262E4 treniece.campbell
913,024,916 *5F0E5541E9FAAC5EFF995AF3DE6DEEC5525DA657 TRENT.BOEHME
913,024,917 *5F0911329038009965A0FB6D54698952FB9B81CE treyrohal
913,024,918 *5F0751E6035D25EA862EDFF672779656313BFAE1 SONORATIC
913,024,919 *5F04C3FB76ADC46253F905D22D081088479A6253 TRON2-243D
913,024,920 *5F03B5797DB3C76A32136FE173673A8FAA4D0051 troonsbestijging2
913,024,921 *5F0C222B347FA7A6879DAAC39350F0C7A7CC5C4F SPACECYNTHIA?
913,024,922 *5F0DD76154D331650BCF71BF573F04791C068008 SPANAGERGÅRD
913,024,923 *5F0480D9235436F7641928ACB739F218D67D781A TSHISHE
913,024,924 *5F083412B2C22881CEDDF2213642857813CF5F8D SPLINTRES3
913,024,925 *5F014D9100D0A374F15D6A419DC01831004E9551 tuottokin
913,024,926 *5F090FE86FA6C0318280526E5FBED82C19965045 TUTTINGEN2
913,024,927 *5F01DC7A1B64369EE8CC57EF3BDCCBD186226DCD TYLER.ESBENSHADE
913,024,928 *5F0D9F3FE792B754BA5694626FAC9E2A9A1EA298 TYLER-VALLEJO
913,024,929 *5F08F38D62BE64BFEE06259278D037E20A82DF52 tyreekranawetter
913,024,930 *5F0E720D242AC321C2A980D957EA02C16276F922 tzhz2021
913,024,931 *5F00EBE7F93691F4BE7BC38637B2D02D0FFAE324 stephen.burt
913,024,932 *5F0D1660A4664B59EC630016FE5FE660377D9F0C UITWERKENING
913,024,933 *5F06005476EA61247F5EBE743AF910EAD7F74C23 UKKUDAHARISH
913,024,934 *5F006E56848137F9EF3AD048C767D1E385E8E025 stinking-toe
913,024,935 *5F0DD82A3D5CADA3D594FCBDCA76BDA3824BFD3A STRKNPPL6
913,024,936 *5F05AD9950C3A53BF809D59AE049844D3C37A8BB STROPPELSE
913,024,937 *5F052B532A41F58C4FF562E5B7B8CBF00D4DA269 stultiloquium
913,024,938 *5F0D95743956B2952E8540C7B784B7BDF10F5181 [email protected]
913,024,939 *5F0362CD390E292FF63AF7193BF891825F9A831B SUBSTANTIESES4
913,024,940 *5F0A287682D2F1BDBB68D913D9245B5B366D65A1 Unshocked
913,024,941 *5F02BE1B9916717BA7BBC2693E6C565D31EB6108 UQPQBB
913,024,942 *5F07D6F14E2434842849A87C4A6492DC53E5B5AA [email protected]
913,024,943 *5F0200F49C0BDFBAA34D5F721CDB0014ADA47775 SUNG.SCHWEITZ
913,024,944 *5F0E45BC2D7E4D11C7834DBFD3F24E28663144CE URSIAA
913,024,945 *5F0D1EE11E8668232F1BCA059DAA46CC62383A6B USERTHE_ANOME
913,024,946 *5F0D6C60BB34BA1152D9187C8FD2A07FA1D3F725 SURFS WATERS AT SEA EDGE
913,024,947 *5F050AB69206E25097CC5007C54B02BFD849FC9C utibbsws
913,024,948 *5F03880A61D9662D510DDBBBEDD7858F9753DF1E suzanne-ripley
913,024,949 *5F02094E764E5BBC636AE01D989FC7B37478AC59 UUO~ O~(Q
913,024,950 *5F0A079C888B68DFE745CB1B34A38E187F6BFE30 SYAZA AMIERA
913,024,951 *5F0283EEF791200B70D5EB5EA9F7FF45FDB9D97C SYLVESTERARNOLD
913,024,952 *5F018DD416331138C09140542C2F39C2C648A89D symphonie-nr.-8-in-f-dur,-op.-93:-ii.-allegretto-scherzando
913,024,953 *5F06022BEC94D8711F5D6D7E333AE552ABCB558B valerieriddickguess
913,024,954 *5F0AB2FBB0A0688044883B265959342D4900591E symtomology3
913,024,955 *5F0005E440B583A9119D4AF1EC12735F32C116B8 VANESSAVALANZUELA
913,024,956 *5F0C648E80A34965CB7AA467CE448363355F7DDC TAHAGGAR6
913,024,957 *5F0038F7BDBD20B436CD24FA4CC7EE08D92172B5 VARONESAHEDBERG
913,024,958 *5F09DA1AC53E46C95AAA095D5857A978889C478C velma.de.la.cruz
913,024,959 *5F0BD4AA9243820D9FF1E7735BE9FBE31C0FCF53 TALKRAVISANKAR
913,024,960 *5F0932320B6665D63D50B6C15E49CCDE34D71C70 venereus8
913,024,961 *5F00521939B4B661B453F275523CDB4E3EA2FE5A VERDICTCONCLUSION
913,024,962 *5F000A009B09932FB686EB2C9521F7E4342429C0 [email protected]
913,024,963 *5F0AEB1C98B00585751840A7F142AF35F3C10744 [email protected]
913,024,964 *5F09EFF57238B638DA454078AA3E9B7F4CEDE7E5 VERLYN.LANDUYT
913,024,965 *5F0B535A3479F4DA7A5F3035D01A9EDB241C44B4 TANNER.GRAFENSTEIN
913,024,966 *5F073A7D24D098B20585C7CF32FB32C106441D08 VERNETTA.RICKS
913,024,967 *5F049A5E3886CAB9F895D3223BF42273A6AFCEB2 target007
913,024,968 *5F06EA52CC022F90B8B225825B16A32C5222CE3F victoryvenus
913,024,969 *5F05712AF6D8D80F1A0D0DF2B1DC45550F1A9465 VIMAN.PROMSOPA
913,024,970 *5F06FFB2E53DF891C690AF40075C36217321E97B VINCENT.MEIS
913,024,971 *5F0D1A852431085D052EC4C656C79614F33D2F7F TERRELLFRIDAY
913,024,972 *5F04E5597A6EDBA834C5072E8F446E3384EB9CF0 TEWFARTS0
913,024,973 *5F09E5D4B32AC33868211EBC64FBC80182EDC446 VÍZMÛ
913,024,974 *5F002FB89E65ED5C75CA8EFE197331D742824012 vonacoppin
913,024,975 *5F0A3DD42E62281D68CE3ACEEA6AEFB388CBD55A thekirk
913,024,976 *5F0A97C924DCAE41EE2D2AD2576D1F560A3AB95E themoroni39
913,024,977 *5F0E04EC987D2FA48C5F080FF612EE600689CACE THIPPAIAHNAKOTE
913,024,978 *5F06245D7C7481D5772F495F31600BC686AEDDAD wangetal2005shandgolarctoids
913,024,979 *5F0E687A57F1B0579749D093C50488B34B8F7AFB warintohs
913,024,980 *5F0A45EE29AEAC21C625383E4D2D826A0D63D187 WARRENCARLEY
913,024,981 *5F030BDD4FE126F868A43C05EEB51AC6B99722D5 tim.wunder
913,024,982 *5F0B3A9177B585C314F27389CBC12D4F1C22F5A8 TITONMALIK
913,024,983 *5F0372C022EAA1AAAD329EE8C5929D6C2D9052CC Well.Rounded.Ravi,.Part.II
913,024,984 *5F0B746E29AC97974A96481D1AB6D5C9F1401B21 WENDY MAURER STROHL
913,024,985 *5F0A23C1CAC24AEEAFBFAC49729A7CC12652F93F tobybisping
913,024,986 *5F03813B286EF55586F8288B4EECA631FB183CE4 TOINSIGHTINVALIDATEDLAID9
913,024,987 *5F0A4DBF49FEF229FAB7B3B31D30379FA5AEF626 [email protected]
913,024,988 *5F08225C7779D32ABEB392FEA035603C698895AA WERLEYGLICERIO
913,024,989 *5F01EA899BF1599D8D50D29D38D2E1A6BC73FA3A tong.wing.kin
913,024,990 *5F02E51D79C460A00B19A55E2207C1237BDC4D42 TONYNASSEFF
913,024,991 *5F072E905D688A147C758D1ED3F71189AE88B155 toptens5
913,024,992 *5F07B7DC433A492F25BFD956A4D83E8888709650 [email protected]
913,024,993 *5F0C2C152EC7CA2F8CB74EC89638F5351CCC36C4 transparent.(future/past.mix)
913,024,994 *5F07B3A70CB76EC45C6DA9B25234D4E4ECE322A3 TRAPFISHERING
913,024,995 *5F0B0972C10E46DC0DC9705CC38059D6C897CAC9 wilfredrinjifred
913,024,996 *5F0B50C21CC5327112A99DE445782B8AA19E6950 TRENTONFIREMAN
913,024,997 *5F04AAC305FE9C39CD6CCC2034F848BDD9ADBEF5 triciafeyler
913,024,998 *5F058680563FCE37C572494EEC9A6352387E851C TRITERETE
913,024,999 *5F06616A93859A30AA110C76FD007012995295D8 [email protected]
913,025,000 *5F0F8B7E474C31759050FC785D37B3DFC1CB8AB0 TROUPSBURGS8
913,025,001 *5F0607DB28E62091AB253522781A39DD2841F819 TROY MOLANDER
913,025,002 *5F056462D165396FF648403AA21EEE724EA71924 TRUNG162
913,025,003 *5F01B557B4531262DBF98B3CBECAB953FE90905F TTTCATAGAATGGCCCTGATCCCGAGTCATCCTGTAAAAATGGAATTTACAGCCAGGTGC
913,025,004 *5F03E2D14A0288DED85FBF9E0B1C9341237FEAB1 [email protected]
913,025,005 *5F02BBC0E8DF16779649203106E364DF7A74E3B1 WU.GAIZHUI
913,025,006 *5F07D97F7A042129BA4F64C93E95CACD8492E022 WUHALNS83
913,025,007 *5F0285CC057511B8D10A9C6495EFE7CF400D959D WWWACUTABOVEEXTERIORSCOM
913,025,008 *5F0D8A53FEF1D678151F41B9E28C5E0924EDE6D9 WWWANTENNANL
913,025,009 *5F05E8151A631F456CE032879635C235556AE4C9 TUTENKHAMON.
913,025,010 *5F0C31736709559CF717D8C62A4028D651F8A9DA TWEED.TW/I/D
913,025,011 *5F037F4718FD2DB44DD9CBC8FEFDA16C016FDC70 X1]!
913,025,012 *5F0519992BC48BFAB6527B5EAFF02C4158F25BCE x2a43b
913,025,013 *5F03813533BA38B27E47B9A11D1F456E8A7DA43B xaviereconomos
913,025,014 *5F0A057699828AB17973BB07A8445839643E9C53 ugonda
913,025,015 *5F0FAB7F8039CCC2A979B4784718D2685626CE7A [email protected]
913,025,016 *5F0F70B3C0E47EC0F8AD93139D8FDC037629C590 UKURIGUMA
913,025,017 *5F0EEA4FCDB8BFED68AE1CE8CAFB733824FCC44C [email protected]
913,025,018 *5F0F50E62B5F0BDCF54FD41AC1B1E15D1836583C [email protected]
913,025,019 *5F0895B05D1F030D4AAF8649B83A41ED510A31AB [email protected]
913,025,020 *5F09B821F1B0BF7872420AA4A4FC3578FDCF7048 yadseutydnac
913,025,021 *5F0A6181EEDB6D544F60E7BC83DCC959C1240A03 [email protected]
913,025,022 *5F004611BAB4549EEE35FA7CCE8FC23C31D20B84 UNREFRACTING8
913,025,023 *5F095D7D99763CAF485A98A8FC30FEECF1C93C38 UNTAKABLES1
913,025,024 *5F0BC3FD6EAEEB0FB7734C21D4A281F19C0D67A4 [email protected]
913,025,025 *5F0BFF6E2763E8497300CD4D95CAC3BBE0FD52F3 Y/C2
913,025,026 *5F02B3FCC8264750967306E719F33ED3AEAD1C95 UROTOXICSED
913,025,027 *5F0930F0FED4DF6C6F06A90ADAD5BB90B711BA2B [email protected]
913,025,028 *5F0E194CB46F8A9C2FCF532975389D059D50B489 YLT
913,025,029 *5F0C7B3F3D4681F35EF5E426E61647E85DC5923A yrosuled6
913,025,030 *5F075FF6BDF6BA403F2A4D75D14DFFBF9E7B821D VERGEVORDERD123
913,025,031 *5F03F0B3E010B0A73CB37AF3517081E4D8604B68 yzi;
913,025,032 *5F0B54B63529FD2BC11B2C66D5E9CEB015D3C7C6 ZALMEDKURNIAWAN
913,025,033 *5F000784E051CCDB904FFE833ABDF43CDEF92870 zeinab.taha.abdel.sayed
913,025,034 *5F0F901D6663E18540D4A38024653D4447FEB85C victorwhatcott
913,025,035 *5F04BB2081BE1AE503477A3F2A3263B3863AED63 ZELDINGBSW7
913,025,036 *5F0B09CD052D6EE5FF9138AC2F0F8FBB4FDCDA63 ŽELJEZAO
913,025,037 *5F0E610BB2C7C0DD73C64E3D8A1665B7065B04E0 ZFILLINICH
913,025,038 *5F005DD8AA57656C91BA4752768BA0688D279A5E vikum.sirivardhana
913,025,039 *5F0C499E67D0B1B3566C304B22199950E5459204 vineetsyan
913,025,040 *5F01CC55A602C15D45BA545360E0BC6426A0EE0B [email protected]
913,025,041 *5F0C1DBA26DA05C63271968BE8FD46DA2DB10B92 VIOSVERONSATU
913,025,042 *5F0E3C94C27E99EFA1EEA8756CB8E2822B40744F vira.neny.elvira
913,025,043 *5F016C881AD9F915FBA9AFA09DA30DDA06D0FE0C ziggyspeech
913,025,044 *5F0A9A790EC1B96B529730307980A49F7C99F073 ZOVLOL
913,025,045 *5F0851AE46EC891FAFEBD8BA2F228B280730258C VOGHERE$7I
913,025,046 *5F02B1AF1B2D373429A1636276BF27CC031B6422 μαριό
913,025,047 *5F0D3A7732448E2014BD5505082570A5CEB1FCF6 [email protected]
913,025,048 *5F078EBA188353F6D0083AF582AABEFC0951F869 безименима
913,025,049 *5F0CEF38936AA00AB326C6B9A440E9DB5C22F2D6 [email protected]
913,025,050 *5F01EDA6C251BFE083153A1F948DEFBB20FEE342 wa1+z3$
913,025,051 *5F06B23F4D523C213BB10BE59FFD492B23E5CF41 гоань
913,025,052 *5F08C552D6010F1BA167C17B8EC60A263EC7E24C WALLACE.NARRO
913,025,053 *5F079F6A1FBCF39389BF54F04A05C195502F7DEA ИШТВАР
913,025,054 *5F09D98B92CE1FBF5961832D7B5480A37D535B94 карминым
913,025,055 *5F07A6727A869E56C98D5BCC27791E59475438C0 [email protected]
913,025,056 *5F0EDD19C2295838F24942F37E03BB553CCF16F7 wardsiming
913,025,057 *5F057DFAF7EFFC8631422EE6600E8F3535366C81 мунофф
913,025,058 *5F07ABC52CBCEDDDC14348BB3AC3FCB45938B213 WENEEDFREEDOM
913,025,059 *5F0E95C29E1E8B19CE9D97EAD227D5C551A78541 ХЛОРОБАКТЕРИИ
913,025,060 *5F0B995E09797F93D8CDA3D5C57176435ED9F8F8 WESTON.FORWOOD
913,025,061 *5F0903661191C212D28F9DCD148678E630FB6F56 WHO'S-AFRAID-OF-DETROIT?-(DEEPCHORD-REMIX)
913,025,062 *5F036CE8CF07BE78E6B62C94E7948CAD1744C0A5 WHY-WOULDN'T-I-(FEAT.-PAUL-CAIN)
913,025,063 *5F03225E460D7E59D379AFC2B2A3C0F66E9C7B00 wileysano
913,025,064 *5F065582E7653A6382AFA71DCE21B91739160AA9 WILLIAM.ALVIZO
913,025,065 *5F0D925A18E23B2EB9FCC5D4AD73A41D2F358F76 williamdeitman
913,025,066 *5F065C98CD3C3975437BB5255FC81A86A201B785 WILL-SAHATDJIAN
913,025,067 *5F05DC4C3FC912BC7BA23FBA5B960BD5BD218CA4 wink-fm
913,025,068 *5F0E1A8A93AEF14558FF7A913A1D94360CB0126A WNZ24PF
913,025,069 *5F00174FFE5121816AD3477AD41E7E3565B14F85 WOODROWUDO
913,025,070 *5F0405375895956B2ECF946BE35A564F0F6FE8EE work_force w/[@]/rk_f/ou/rs
913,025,071 *5F0EAE7839EC74900E507270E5ACFBC68AE06F19 [email protected]
913,025,072 *5F0A542D6AD4146402115B81AC2E75CAA2F624EC [email protected]
913,025,073 *5F0A4FFF0EBAA16654261E557942AD87B797BC4D WWW.TITLE-3.COM
913,025,074 *5F03954C4C547A96B11843EC2485596A8F5F2622 [email protected]
913,025,075 *5F09EE0331262C4E2744FB0F04D02ADE2337069F {x}~.<==8
913,025,076 *5F0ADD3A5F34935BE755D1651813106D8DBEA6AA xdh|
913,025,077 *5F02665A10FB2CE6BDA3C1109B220EA6ABF9D12C [email protected]
913,025,078 *5F0B61AA0748D93DE7D17BEA2D57FE0E75ABD57A [email protected]
913,025,079 *5F057EA6D216E34004B909BF8B78EDD1A347AA65 XXXXJAMAICA1
913,025,080 *5F0FAE34ADC4BD8858F768BE6F1A7C1400E63E80 YAMAHALASER7
913,025,081 *5F0BFD8FA3C7328E3682CA825B622D9245B25BF1 [email protected]
913,025,082 *5F04DD1F86CCE0E60DB144251BAE2C8AA0DF4DFA yiphoipan
913,025,083 *5F03EF9C21197908D4E72A5F7F699B0438FEAC13 [email protected]
913,025,084 *5F0611531E39BD317CE815DFAD529385EDCB96DA YKF
913,025,085 *5F008E34F769FFE8511F8C0446E2F96DE56FE1B5 YLT
913,025,086 *5F02D2FB86066272D43043ADAB7B4507D8F4236F YUPABSW7
913,025,087 *5F0188905B3E6BA3D013A1C5F3F03C7977211BAD zacharywarshauer
913,025,088 *5F0AC0095D7F88C8F806B65F0B5D38DBC9938F4E ZACHEV
913,025,089 *5F0D8C80BB4D0A3610CDF1767524E56684ACDC46 ZACKERIAH.PATTY
913,025,090 *5F04693C8EC01ABC34B457C3F32CBE73FC4E8D7D ZAMAHIMAS
913,025,091 *5F026E9B0208FE8A9F0D16F09CE2DD129F15F80B ZAPLITANJE7
913,025,092 *5F043865152252B6AF549FA6BFE3EC0931395E81 ZEREDIALING
913,025,093 *5F06D9C18CE3B1785CCBCB20A8D2D114A327C0C9 [email protected]
913,025,094 *5F0686CD21AC5E256117EFC6479527EAED281F85 [email protected]
913,025,095 *5F025AD98C413821A63901423957BA0CD86A2A22 )0(0~<######p
913,025,096 *5F0A9FBC8E1984E056C90E6F6828AF2059F01476 (-_0)**@=====3
913,025,097 *5F06CA6B01BECAD28960BB73905A056926BFEE6A ZRUSHZAXQUISIR
913,025,098 *5F0FD45D56BBCC1DF213870633D4012CB72B1867 žuvingas
913,025,099 *5F065C24AAC167AC0462B92374E8BB1F9D1A3201 БЛЕФАРОФИМОЗА
913,025,100 *5F088C914B1BC2ECFD0B51EAEB49629BCE96567C 1035242 liikevaihto.vuonna.2001.oli.1,3.miljoonaa.euroa..
913,025,101 *5F0CC0CE080DE5D93BBF9E4AC6AE70100CAD78DB орлинським
913,025,102 *5F074BDC02B42F827EBDDC2A81D1623D64A92494 1357471 schauen.sie.nach.oesterreich..
913,025,103 *5F0FA811822E3F25C12ACF9457EC8B48DDEB1B1D )。主打單曲「不是開玩笑,就要開打了」(this
913,025,104 *5F0252FFCC54AC75CC7CD185CC7FC6FE4DA77AF0 15 PAULMANN
913,025,105 *5F06259B0D68531F13A1B241AB05AC83682828CA 166406 "-WE'VE-GOT-TO-LEVEL-OUT-THAT-PLAYING-FIELD-.-"
913,025,106 *5F0CF738D59F84515CE3BDEBF9D064A864B072EC 1755208 nonetheless , only token opposition materialized
913,025,107 *5F058CF54D28830EAED0E8E96B262FEC50E88E56 17 spdfinanzminister
913,025,108 *5F0208AF33B8D8566A5D4D9C1C2748A553F29B71 1 ADETSIZ
913,025,109 *5F058F96A20182BF9371A0C4E6AE71D99EC201E3 1.ajoitusmuutosta
913,025,110 *5F04299D57D4CD3EAC3D6B7D645A64C449032BE0 1 bebuehne
913,025,111 *5F0FECB7D12DC00ABF806E1C804CB8B4580FCBBD 1BRUSTKLAMMERN
913,025,112 *5F00A28B8773BB536F3BF2B2869A671A16B1AA56 1.damenfeuerwehr
913,025,113 *5F0B9784B7C8781101BCC5BC48428201BE90FCBC 1EETIRBA
913,025,114 *5F0C4E73253660A5985AF0A6043EF90BBA72AE28 能力成熟度整合模式(CMMI
913,025,115 *5F023DA834BA75D14CA45E2EBCE153EC66F08A64 1KAISHAURI
913,025,116 *5F0B7EF4E4941C46DCA317DF9E9BD3C5C35705FE 1lauluduetoista
913,025,117 *5F01724FE7F5252B1CB4AD8A22B412BA2E326FF6 1 MAYER-AHUJA
913,025,118 *5F0415FCDD39804C59026993696020BB2D9777AA 1.mikaik
913,025,119 *5F0C27DFAC09B575480D57362E9CA546CC85C218 1NAMUSY
913,025,120 *5F03122139AC335D1B1F8C5E7C25E54EECB8229F 1.puusep
913,025,121 *5F04EC68C596A126F442273E31E92D68623B9DC7 1redorange
913,025,122 *5F022B4C3FC60E28171AAC104E60CD8ED19668EA 1SCHAUSPIEL-ANFAENGERIN
913,025,123 *5F075AA555B5EB7755FC71C3BAA73C7E7C112622 1-schmunzelblaettern
913,025,124 *5F0E3C514CE341EB61C4A80CE63AABE7DEC3DDAB 1TYHTIL
913,025,125 *5F023D9C3E3C97DAF2043E10222655277D4E591B 20013101
913,025,126 *5F0AAE57ABD56005E3329D04AA3B6A8380EDC46B 2560684 MITEINENINVESTORSCHEINENSIEINDESSENEINIGZUSEIN.
913,025,127 *5F0CE8801E6E2CEBD140EA3C97E66F866EF2BFF8 0eomm4gsr7ioo
913,025,128 *5F0B58371E2B8A02D6DD8F3A738415A763B94F97 1115292 MITLUDEWIGSPRACHENRALFNEUBAUERUNDHAGENSEIDEL
913,025,129 *5F09493AE10EF2BD50E78D4747E579FA43AAB66E 116ARTHUR
913,025,130 *5F0A99E8FAD7088644A9409AA96FAB85CBA7269A 2.darUssade
913,025,131 *5F08944835A4E6160F7E202AC15C7172D2A51B4B 2DETRIKSI
913,025,132 *5F051D00BEC51B556D96EC8ED91B40ECBBBA1F0B 1211033 helmut kohl : nein
913,025,133 *5F0D05E0C8A74C8F553471D09420EB54087FDD31 133amya
913,025,134 *5F0DE93C9BA9FD9E45F5B8C8CD7E6F7C64A96293 2ONTDAANH
913,025,135 *5F0BD455C6BB729D8DB806879FE242DF782EB194 2PACLIVE
913,025,136 *5F0F4D1FFFD048DC515CD84EDAE4FAD9C6270EA7 2SCHMALFU
913,025,137 *5F0EBF321492E27A4C8A91DE7BF85BE0109CF8F0 2SMALTIRO
913,025,138 *5F0321E9829948961DEF4C2A965458AFD6689EB8 153465 GEREKTIGINDE PAZAR GUNLERI SINAV YAPMAK ICIN KULLANILIR .
913,025,139 *5F01F7F80CA5EE409920116DD51B585E1E445E8C 1622579 seuraava-penkka-,-onpas-tukossa-,-t
913,025,140 *5F0B614703FF1DB25317EC168011DF1D2A3F59D8 1667958 SEMINAARI ON KUTSUSEMINAARI , MUTTA MUKAAN MAHTUU VIEL
913,025,141 *5F0D98A053D0B20A59218A4B6D6A3C56E8931912 1854517 WYLAND KID'S WEB HOME PAGE KOULUTUSTA JA VIIHDETT
913,025,142 *5F00E9E912E8D225F3F5E8262497BA129A40BC84 1880163 DANN-HAETTEN-WIR-HEUTE-VILLEN-IN-SUEDFRANKREICH-
913,025,143 *5F0990CB8B0D8A5B94EFDCAC81E5DBD769B297D8 1963年に研究の母体はCIMMYTに再編成され、
913,025,144 *5F0FB1F97A63F9E637B036DBF966CBB4628A8C99 37efe5fbc55afcb7
913,025,145 *5F0434550D5B5258BF6E6DBDE4B32BD17907BA7B 1BEVENS123
913,025,146 *5F0418655B6547E9E8CA7EF5C334EB353127DA8F 1DAEHYAB
913,025,147 *5F029D89366E8CD4D94F082EB3481B2BE92E4ACF 3b<o~0~ <p
913,025,148 *5F0EC75B3ACFE425D2A27555178EBE50C3793ABB 1DRMTPLSTC
913,025,149 *5F0DCFCED6422C619980123DFCB616804094C6E4 1 EBK-J
913,025,150 *5F01C7C1AD2DAABDD963D60EB6858F50EF31FA3E 1.EMOTIONAALISTAHAN
913,025,151 *5F01672E4EFF1897A2CA387217F82CEB23C86D99 3--D~splat!
913,025,152 *5F0BEFCEB93BD848F0291292BF4C0CD43CE6A62B 3.RINNAKKAISMALLI
913,025,153 *5F0982139A674E52A6E6ACE1367D84BBD7ECEFBD 3##>~.SPLAT
913,025,154 *5F0E0333B3B08B563732B7DFDC639F9C34828C08 3)、加藤グループ(SIDE1
913,025,155 *5F07ACD1D18F90262097DCD6C995285F762AB35C 1landesaktion
913,025,156 *5F0CF6A2FABD194B6374EDF746D66D852D812B59 1 LAVAKULTTUURIN
913,025,157 *5F0BAE4B60B3B924AD1D009391FC5CEE3EB39C3B 439ellen
913,025,158 *5F0F1C29CBD5A4E505ADF38A09C4F07EEC62E7A5 4776519
913,025,159 *5F0E28C9DAFDD7BC6887D1C1890A32B7BCBFFFBB 1.pflegehaus
913,025,160 *5F0A21D5F30686BB6A5D0DCC5692247E39FBB763 4FG3STORW3N3S
913,025,161 *5F053D156763286D1DF2F27C8E0EBC428E4FBE67 1-saadan
913,025,162 *5F057BA638A367E7C3A9B38D9FE8097D5955C2D2 4KELSEYJERRY
913,025,163 *5F03EA6001AA3E2602A8799C93B2B332D0954B1B 4MYTHMAKING
913,025,164 *5F0E49261FD2B9B213853072483DB800A1DF0B1E 4NOLATEPO
913,025,165 *5F0AEA45CDF73D027484B637DBD365F3E743512B 1-STEINESCHMEISSENDER
913,025,166 *5F0DE219453B705E285AAC1B4120570CFBB1D640 4OBLIEREMMOS
913,025,167 *5F0CBBD67CE4E0C13211B56CD0C3DB6466E11246 4 oultmanu
913,025,168 *5F0CDEAB8E842984117D4371F175365BD90E7C1A 4PADSKRAPER
913,025,169 *5F0956606312B1F8CD386DD5B69A50B91F35FA38 4ROM4TIZ4RLH4S
913,025,170 *5F067DAAF7A37A02087613A9CF0054550F8E1684 1VATERSCHAFTSANFECHTUNG
913,025,171 *5F04A9EC8ED3ED368C4447BFC2399B05E2D6AF74 1WOPAHO
913,025,172 *5F0F06D57A9C1774BD59396884F9DEC3C9246773 1WUCHSSTOFF-HERBIZIDEN
913,025,173 *5F03260F2181404EAC413271826118E819379967 1-yuksekokulumuzu
913,025,174 *5F061D8463E9E03630789CD9C568AF455594D72D 4UNHITCH
913,025,175 *5F0B26A0ADD14070E3896996B93F0FC9988431CD 4VOORGEGEVENENS
913,025,176 *5F0345D27C8AF575B55B453F1FFBB62472FC22DC 4ZEUSBOOGIE
913,025,177 *5F00CA08EB3FB62AE5FF024D7979C72103A3F30D 50BIRDSCOM
913,025,178 *5F06CEAE6FEEE68EBBA4C87422B0BC2329E53D1E 210054 taskutilastoja voi tilata tilastotorilta
913,025,179 *5F02A6BF10DA66336B0F9BCD48FEE23DD1537916 22JAN1867
913,025,180 *5F08FA0A1A77D82C8C493789ECF8857C5A06F2F0 564maribel
913,025,181 *5F0C407B7671B218F686DAB294D9483CC5DF90B8 5BSWHOLLANDSCHEBSW
913,025,182 *5F0B776DE37FC0DDCF6F100B13C90C18EB7918E0 2657761 LUOTTAMUSELIMIIN.LASKETAAN.LIS
913,025,183 *5F01D588BF32D470420E6E16F908565AE7BCC636 27H00MIN
913,025,184 *5F0EA8726BA89C5BCB731F300EC230B98CE386F3 27MAY1306
913,025,185 *5F0E5FA6DDF70CD98D6644C7A111DEC2AC7A6F09 2967683 when the price rebounded , they rode it back up
913,025,186 *5F02690B672169499C22CD324A66E06E03F02E6A 29UK
913,025,187 *5F0234D48DDCF779518E49539B53CD7D87E0321A 2BILU
913,025,188 *5F0949A2AD9C0585E7528434190234C20498599F 5ICRUMBSW
913,025,189 *5F0E1AB66E4E26CB949A7517CC55F50BA67D64C6 5JOELT
913,025,190 *5F061D9CC57E95708EBAA8CC1C127DF818ABC3F1 2.BYROKRATIAPERINNE
913,025,191 *5F0494BE0BC9E794DCDB3E3262CEDAFD3E947465 5MACFAST
913,025,192 *5F0913CD6BD5E0D22479145B2A28ABDADFEF25C9 2fboistrudan
913,025,193 *5F0E96BE7B99A4D13AE99971E9F45FB80D8A4F0F 2-MANAGIN
913,025,194 *5F062C304E1587802DD2BD74F33FAB176D8B3A9E 2NAIQUAN
913,025,195 *5F09674523C165CBB8963BE722FCF4EDA2B9BB6C 5SINSINAW
913,025,196 *5F0C4D642A46C3C3B381BAA11EAE63E7819B3A40 5STANDHIE
913,025,197 *5F0A10FBD214E4F9425BDDFD3C2EEEA79ACF68C3 2PIAFFE
913,025,198 *5F0CF82D4994906A8FD31F9653B1495B03622A2F 5thegone2
913,025,199 *5F0F0005C0F10DE865E768709905558B694E258E 648707 "weissichnicht",sagtbusse.
913,025,200 *5F0F8201F5EE92F2554CE677C6DF31614667BE7A 346552 gUz'U hem severim hem de hUzUnlenirim
913,025,201 *5F05ED6A1D6D82AD7C07377B48000B9AE4CB7840 6ANJANABSW
913,025,202 *5F017173DDA44B1DBF579EBEF9C3309ED3DFAF43 36 edist
913,025,203 *5F08647836D6395F50F9275BC0F82947D52AB3FF 6-ELINYMP
913,025,204 *5F04EDACF9A47635549CC027857FCB064F8FDA19 3 HILJENT
913,025,205 *5F0117223A1F979FD39F69F7163A82F0FDAB9DE3 3ILOVETHE5
913,025,206 *5F0EA7864C3594EA164B22C4AC1E41D08EF07539 3 k
913,025,207 *5F00F6B4CF32E4B03F5509182E75C55D40BFB169 3----).~o.~o.o->-<
913,025,208 *5F04F82922D2B494DF3267945D46E02DC7703AEF 3SAVININ
913,025,209 *5F0D5869F8FA3834B7A433D6B2D7DFF3CA0B1539 3===>~-~-Splat!
913,025,210 *5F09CECDDD0F088C54369DF85D1AACC2DCFD9D26 3TENTARTE
913,025,211 *5F042D47B2EEE57B9589F2629C3C1D22C01FB619 3TWELVER
913,025,212 *5F0473059A10BCB5D421B7522B2340DD9870F7FB 6SEIFITRO
913,025,213 *5F0AF7CC068BC6B0F5C51C1358D317A72BA0C34C 6SFITARUP
913,025,214 *5F09E6F3988FED75FCE2148B6DE538F629186FEC 3WRAASTE
913,025,215 *5F0749E8C1D895A103DA2B4159542C0AB80C926E 6STARTADRESSE
913,025,216 *5F0B5CC72C873C652207291E45C0F15AC890B777 4IASIFORM
913,025,217 *5F043AFB48A00987722E81E9B300E5E2B2CB37D7 7COUCHEREZ
913,025,218 *5F0913739147B9C497C60C5574FD9D181D263224 4PANNUHUO
913,025,219 *5F095FC1CC187EE1FD0E1C977C74243D00EAAB4E 4PEARLJAMMERCEDES
913,025,220 *5F009DE50904B9BF47C91D9F4107C04A04F14923 7EZZONIT
913,025,221 *5F093702842E869517D580D0C0CD1754711D304B 7FUCKOFFWESLEY
913,025,222 *5F09504B624FD698AAB2447D1D2A171B19052928 4RELUSKIONS
913,025,223 *5F0CB41388EE26D4C5E58256A00B400B4413F166 4SEPTEMBER1488
913,025,224 *5F06BE6B42C2C6444C4444A371074F4AF567B469 4TINMANMOTHER
913,025,225 *5F02C2CBDD29758A2FA16B3206EC3973FE2573A2 7NCLMBNG
913,025,226 *5F0496B966CD45C55E4520C12E223CB39824D64F 7NONECONOMICALLYV
913,025,227 *5F08F4552AF67F5C27A2E38E4AC39B8F0BB1B7C2 513088 SOWIEWIRJETZTAMHECKMANNUFER.
913,025,228 *5F0E0CE7075DBAD331704D4B6EB62CB9D740327A 7SADIEBFI
913,025,229 *5F00B04887A35E3B8A068BBED3F62C027521C4D5 5aac991f65bafcbb721cdbb8859d2bc5-water32
913,025,230 *5F093ED4678FBC8846CBB2F138732F58ABCB7942 7TDSCAVENGED
913,025,231 *5F0FFAB456B6E397C566E155599C840A41EE03AB 5BIBLENBIBLEN
913,025,232 *5F00C4767B4190C2377F73A3A11822A8119181CB 7TUHANNESOSAMILLIMETR
913,025,233 *5F0C76B828037AC33F4BB195836D68341EC83523 7ZAADLOBS
913,025,234 *5F05D8D417BE7B8E535674B6C8F5A9B3D8CD97FE 7ZERETTEV
913,025,235 *5F07E275A6370668B148415DF1CAA87A1ECE1253 [email protected]~0(^_~)
913,025,236 *5F01C84C4638D17C6F11AF0F85A472C388519BDB 5GIEKKEIG
913,025,237 *5F0F6E5233C59DA4BDBD34BDE12352C0BA3E0587 5GNIDLENK
913,025,238 *5F095FB8B8D2243F8B95031A849BD9AF8158B7B5 [email protected]$
913,025,239 *5F0B7A1DD10E6C1646B36FCF9B4B2ACDA52557D7 896886 some.analysts.saw.signs.of.strength.in.this.pattern..
913,025,240 *5F01D08051AEF4EFB10CA217A742071CEC310CC0 5INAGRONE
913,025,241 *5F080B4DC8432C138C16418DE9BAE84C969EDD87 8BALLIVIN
913,025,242 *5F04DC197A68291E9A4E1B3E11A6CC63A65B0D35 5NORDHORN
913,025,243 *5F0B8AE6866515C110DE0E12B28C2F51F558B819 5OSAKESIJOITUK
913,025,244 *5F014D44F86C68EA106DEA9C5A1B8EFB6A7CAB2D 8------D.*.*.*.~0~O)X(
913,025,245 *5F0ED8017E6CE3AB91B66CD4807B53FBA6FAC744 }8{~d####B
913,025,246 *5F07800692AE3079E2A889C007A8FCEBCCFD1628 8FRIKATIIVI
913,025,247 *5F020E65A302FCB0BC849FF282EE35D01E02DC24 8GABYFIONA
913,025,248 *5F04382FA4632A03B46FA71E48131FA42BE5B4B0 8iluvford6
913,025,249 *5F0A366C335A537B2B87C7EC2EEB133B458AAFF6 5THUNDERZXCVB
913,025,250 *5F0F9D519911B6D3FC514846E6DB0F47AC74ABA2 5TOYOTAMAGIC
913,025,251 *5F0B65E89A6BE50F8D4E5BA6D1389699E18B4F96 8LIVERPOOROMAN
913,025,252 *5F0E8646670B5EBBB701F09088F2FF1FA8B5CEAB 5untrusting
913,025,253 *5F02C15A96FCA355575A5592356C3CB2B11BD705 8 NALLILLA
913,025,254 *5F069B04BEA2056EE4FF39D0D67F8AC32BAA3146 656590 secimbildirgesinihazirlar
913,025,255 *5F094EDB55CF5AFEF4572DE11AB2FBBFAF8E4861 8#p`-(^_~)
913,025,256 *5F0B741141CD320B61B9419D50ED8CD7D7073B81 6BADBOYLESLIE
913,025,257 *5F0AB265D332B504CA959D90BA96C611654262EF 8SCHALTENED
913,025,258 *5F08D69195CA3A7DCE27A976C2407B78183CB8D6 8sep1182
913,025,259 *5F0555FDDA388497B5404041125899CFD49FF679 6EDICATRA
913,025,260 *5F051E830D1A86F1A62B681FC0D410FB800C4CC1 6EVIRDNO
913,025,261 *5F0AC3C7F632CA6D3D15D40CD45ED4CA8F6BB7E1 6FEROCEMQUE
913,025,262 *5F0F747684BA67B694761271FDC51F5D9E59DD2A 6fuzz
913,025,263 *5F01581EB889DFD3D8D352243693C215D5B7CFAC 6PRYSZLAKBSW
913,025,264 *5F03178C7E401E59B78DC6A8DDE47A95DC64C782 9DOORARCHWAYBACK
913,025,265 *5F04E2745545C6A6758134AD8A7998E98BBA8282 9EMATICS
913,025,266 *5F083D378672FECA1F3E900DF81D105B5AABFBD6 6SSENHSIPMUHC
913,025,267 *5F04BF1427FA68676E077C3B5559BF33D1D1C39A 704611 neye-gerek-gileyler2-bu-cabalar-,-bu-seyler3-.
913,025,268 *5F01C91FE85267288F95857C4CB3DE8B9A472CBC 70nn4g3s
913,025,269 *5F04631F676E7A7616551A09F6148EA96171E8B8 9OMISTAJAPELISTAE
913,025,270 *5F0EFD75CEB3BB542986A0177E3FAB4FAE4A258F 9RHAPHANIA
913,025,271 *5F0C4F74C3A6F0C8BB523D3C0F32120C46406CAA 9UIXFZCVVNAA
913,025,272 *5F0DE13B7D4F0D7BA7B52E00247F2DD09162AED5 9WOLFGANGSBDC
913,025,273 *5F089D57D41F0C90A0D33A102674F4D5A28F1382 9YRSABSW
913,025,274 *5F021AF50D57736F18B9972349DED97D62E5F65B 9zi9r70z509y39p406
913,025,275 *5F0D330647BE8E30E1BC8F37C9022AB55BE7F5AB a|`\
913,025,276 *5F0A9109F8AD8D950CC6CA6B95C95C377C2CCEF1 [email protected]
913,025,277 *5F04E9E719C4AED2650862DC8878A514990CD60D A1A?N
913,025,278 *5F0A2ABBB3C272712DEE71D335B042BEFB49DB5F a29b76c12ca03e96b08d0e1a6bb6681e
913,025,279 *5F0CDFE00077DC0515DB3C0FBDA8EAF37747EA2C 7MEMORYS
913,025,280 *5F0AFC1D5BC468BED81BC32CBBBE513204204A97 A3eE
913,025,281 *5F031D9B85422B8728809F957AA31D2357A6EB19 7PATIENTEM
913,025,282 *5F09169A3CDBFCDC101578B8D40F12267FC83197 a8wo)
913,025,283 *5F0A6109D2DDECFE0EEA3E2258272AF96C2954A6 7.skizzenbuch
913,025,284 *5F066E38A177DF148F5099C3EA370FD26D37E09A 81d500ace498811208f6421c9ebe7f63
913,025,285 *5F019FB93EBF247BB41F00A6FA6B714D06209FEB 8ABSTERBEN
913,025,286 *5F002B56582889AB23E486C62E023CEBEC92D38B 8ACINORC
913,025,287 *5F0CD39187712AC1020E17F64E34CBC30232E946 a=bj.
913,025,288 *5F03C903BB20557970406015F9582446E9982C46 8ENBAARDE
913,025,289 *5F0B06DE52939A6A491404F85F05F67BB7EC1890 ab:sl
913,025,290 *5F0142285F98C34509920FEFEA5EACFEABC2E924 acajoommic6
913,025,291 *5F0B23CF1ADFCE788D25F19D9A5BCAC1DCBFDBD0 ACCLN
913,025,292 *5F0EDEE68821D792DFE5AC1FE687E0F90072439C 8KSIMONE
913,025,293 *5F0547236904B133CB1B03F7A503071A4917806F 8LOVECLOVER
913,025,294 *5F0B5A7FA6042D655E4EE16BDB53E8AF013DB06E ACFOXQEALD
913,025,295 *5F0E427F530EE9A2D0D181380F3F545D900A909A ACXQ7
913,025,296 *5F0185DE929E096E525E413638A7199045D1F846 ADALBERTO.GHANT
913,025,297 *5F059657966325F03DE57B2602F57D851780A263 ADC:F
913,025,298 *5F0C18E20643555EF3C8E45D7A241CEF2B86AB95 administrator/contact
913,025,299 *5F0887287A4E0F19BDA36D9C26751A6DA999A5F6 ADNP_
913,025,300 *5F08CAD1534BA83DAA3230049DD3073D7EE8317B 936034 kalanlarimizikurtardilar
913,025,301 *5F04A1D24461599A0C20A8CF8FD68F175562CB40 957052 pakkauskoko3ja10litraa.
913,025,302 *5F001528A0EEFF07AE9534E955B67A040DB60D27 affliggo9
913,025,303 *5F00FC3487C49E838193FEAE21C42FDF3EC81D17 9CFJSTRAT
913,025,304 *5F02846B0597DBD0635166A69325EAC5C76E3418 9DESQUITARER
913,025,305 *5F07DD84D5081B4041517ECB3F267DEB7C7FF3C9 9DICHISER
913,025,306 *5F0E2D98D93EA839CD324357CFBB1E73F95C7C4D AG0;
913,025,307 *5F0F7458E4D3517D925C05898A2E82C143EBFBB4 9ILUVFISHES2
913,025,308 *5F02B8A7C8FFCD4AABA87CA1CA926E8015870171 AIZDN
913,025,309 *5F0004E9A26D2864BFD7681922083BA890C8416A a)k
913,025,310 *5F0C26DE2CD57F8A6FDA30C68C4904AB8C19DF60 AKU9IZUJSWC
913,025,311 *5F0374CB9109FC16BCC0A88B6529A50CBFB8CE29 9thescotch7
913,025,312 *5F0494F974C767CBF618EE1826A6F9A0D817B0B2 a+5#
913,025,313 *5F0D781A92D6244FE31860935D0F7FF1AFF9DE0E AL.ROACH
913,025,314 *5F024A4540C12D66EA4BEA22EC78ABFC91BA20A4 altonormandía
913,025,315 *5F0505DE522B192397C3B7931F8449ED9214A566 ALTON.SKWAREK
913,025,316 *5F0DAC6E52A5CD6800279699E68C8156E7530A4E aaa=64
913,025,317 *5F07F1A8F4610B8BC2B38B2AB5A45D02E2FF28EB aace$q
913,025,318 *5F0BDE8A67EB2C71DB295627B1374DEBDC895337 Aa#E
913,025,319 *5F0713181AFFA99096F44ECEFCABBA56353DCB92 AAG5:
913,025,320 *5F08C73A271AD62DB9AFB8273461497A321CCAD5 AARONHIBBARD
913,025,321 *5F0782C7396686F5010034C7D62E6C2D8D0A9156 aaslfx
913,025,322 *5F075F20BFE6D2603335460A31E02E1D3214A1ED a,b)2
913,025,323 *5F0A5F3FBDDC25B5AC208D25F03928B38C687C34 ANHUGGERINGS
913,025,324 *5F0D337F3F3CDFFF351C1A68825C7C49B28BE79E ABJUREMOS6
913,025,325 *5F0EC940EBBE275D4AE441957051D97617CB9749 a)(bp
913,025,326 *5F0FC2C79ECFBF09FB0543158A560EAB05763745 ACHARTEIAS123
913,025,327 *5F02D2D9DF2C3C82234830259065413A5EA52006 a.chornet
913,025,328 *5F0E05C7306FF70A15AA1CA6B6186B73B40B98EF AC/J3
913,025,329 *5F0A12C7406CF3609E4501EC11AB2CE5A5F98B11 ap#p7
913,025,330 *5F09F2D1FC6219EC04AA557F7DD0B40F641C1BE9 AcWD
913,025,331 *5F022733011475CC1CA1CFAEF54F6B0A8BCDD70A ADALBERTO.LOZE
913,025,332 *5F0E790CFEA216C7AD205ADF2A1927050EC16EDB ADCOCKROBERT
913,025,333 *5F051CF81103A1887962D128B43331200A25409B ardenmatters
913,025,334 *5F0EFB1DE3A2771DEF7BF7D32319DA63FC7F86C5 ARGOMAL8
913,025,335 *5F0819EA4B2CBB77A805F453598E3F41FD409B88 ADOLPHLANGEL
913,025,336 *5F02809FC50A80FBB248A768903FD21E6D86233E adolphpannone
913,025,337 *5F0054FBA54B05C5F9338993FEB399791C386ABF ADXG~
913,025,338 *5F0822B04443A1EBAB6F43776A92E8C75817B9A5 AE1YQ
913,025,339 *5F0562D16C8912F00B873F8F99655822DDD90EA0 ARROWCSG4
913,025,340 *5F047A9B3B7F88663ECBB3784098111D4235254C ARUNASHRESTHA
913,025,341 *5F0E105DCA823A7F925FA30F2E1501DA70F92485 ATF
913,025,342 *5F034D11BBD4B4C3EB3C826ADE6166077A802962 atuh=
913,025,343 *5F0A626AA6EDFA58F630B3E84D0A90FF0BCE2C93 AUGUSTINELOWERY
913,025,344 *5F03C3760FF9614151B5A7B8243DAEA6C0117B32 A/UH
913,025,345 *5F0632126269F17653968D4239FE64ACF3E4F9AB AJS6,
913,025,346 *5F0BAE411CE79F50DA38EA5D5052ECD13F650A43 avens-'/&/v/@/nz
913,025,347 *5F03FB0CAE83EB4161E16677E36488353FAD30D4 avízů
913,025,348 *5F06FA46B9F4C1FA97023840ADE9160C0CF2285A awal&
913,025,349 *5F0FA77A52AA9C62932AB7E2B3F745B526AB5B96 ay7ml
913,025,350 *5F01B381214851B90C3CA06ABC3BDD1E859CBD28 alj
913,025,351 *5F0194FAB6E3F3E90E9E46F2701FEF2CC7CB2068 ALL-OF-THEM?
913,025,352 *5F0E8BF2454567AC4228D3289EBEE3336850AF4C Allshap3
913,025,353 *5F0D5A09718D34900121D27DB6875AFAF0EE41A4 ALMUESPROGS
913,025,354 *5F064910CD876D468E9B12857991438F577177F0 ALONZOMANO
913,025,355 *5F0F778230F52B39EBFF1A1AF1C46C4D9E31BBE7 b3#t%
913,025,356 *5F01D9748A63320678F3FE52FDF40A5901F161EC B40QF
913,025,357 *5F0F8D332E7B55C27A86B00760F1DB0FEA2D985D B5RVE
913,025,358 *5F0B399EA2CEF884B11D7415601566A2E57D08AC ambitoprogramaci
913,025,359 *5F004F93431CA7FAAB8AC98C305D029D0D4A6EF4 AMERICY9
913,025,360 *5F0352B6669AD84E733280170E1A2580B893DA22 BALLESTAR6
913,025,361 *5F0ACABA0BF64787F18035576D1BC2FB5C736B29 BALL WITH ME (FEAT CHAMILLIONAIRE)
913,025,362 *5F0E81796E52BA884AD3AA06622329FEF1E44369 ANASTACIA.ROBERTS
913,025,363 *5F0D2E18165655B0C430B48532BC1AD354A62EAF ANDRE.CHIOMA
913,025,364 *5F0BB93F58F8EB76BCB33A9C30AEA0C103FBF5B4 BBO-4
913,025,365 *5F02BBEF77A0987BC6A29F049CC74D0AB44C9835 beernaert's
913,025,366 *5F02B5DED0D1DFF45D1C315F201920ED286E0993 ANIYYUT
913,025,367 *5F0404E6410286374988F2028F4BD1D7401705C4 BENKUL
913,025,368 *5F04618AAEC960DAF0E13418FDE642B3550A71B7 [email protected]
913,025,369 *5F0A9E3005C5E65D3D219471D89C8BB71168E958 ANTOINE.RACITI
913,025,370 *5F0B65B39307A9DFCB079D6E357527A942C28DAB BERNARDOPPEL
913,025,371 *5F0BAFF771D9EA95EDF374F2800A2C69784551F1 ANYAELE9
913,025,372 *5F0771A9170DF5F17258DB7888DE4A0E7C4019A2 bertjubyna
913,025,373 *5F08C1FDDA01293E3ADFFDB65B9C9D466ADE7013 AO2WP
913,025,374 *5F0C41ACE35D00A9987A9E38CC6276BF44DAD958 apayaane3
913,025,375 *5F09407472B9C0C2579B5CE6289CCBDDED0A3306 apnegnah8
913,025,376 *5F0C9535FC37E74290288571509F21806B0F66DB bg<h
913,025,377 *5F0E994A0DB05BDC84303EF74A02ED4C13406496 BIhW
913,025,378 *5F0190355A744074D8991F6B4AC728E35DF7D4C5 BINTS0
913,025,379 *5F00FE83440042ED192585E94EEB37D8E62D26E9 a$rlw
913,025,380 *5F09A5D3A74E9748C2DB79A82921923E2577BC56 ar#mg
913,025,381 *5F0BA7321CF8074093C72B37DF34997F98950D95 BK4+R
913,025,382 *5F0D8EBE5E00DE0382997EC893399B05234536B1 as7m-
913,025,383 *5F024223AFDBD8F9C75C7B947D7D3F56972A11E2 ASHLEYGIFFEN
913,025,384 *5F0AF831B48940F0CD8501D37D0772B12C7FEADC BNve
913,025,385 *5F0197B3ACF1745878186E99C8ECAF4E5B38D384 BOOK-LOVERS-FLOCK-TO-BROWSE
913,025,386 *5F0F21E8423788F23521F69E3FC38C6A57197AF8 boudnik6
913,025,387 *5F0183AEC5BF0B4100833FF77463A73AC1D8D7C6 B=QH
913,025,388 *5F0DC638CD75FAE8F3D274724B5166F47438F160 AVERYPERLICH
913,025,389 *5F06124582813C4DFCE1C88C6D40E3F2BB2A5A9D bradymova
913,025,390 *5F05C0C85D241E4AB623E1EE07BD8D53BF65D5C6 Avida(Roma)(Stylophonic'Samba'remix)
913,025,391 *5F0DBFF1F54B9F069B3506DE03D0EC6AAD37341A AWQ4B
913,025,392 *5F07AFE729CBADB74288B8689AFDED3C09403C16 ayj82
913,025,393 *5F0FF66B8F4BBED11A61C7F4F4066A5EE7CBBE76 brr$0
913,025,394 *5F0D266C799D68F3E4B755C95073D1DB0AF6A608 br"ru
913,025,395 *5F01504DC0839F5C9DFBB4A323DEB39C35294B09 BRYN-MAWR-PENSILVANIA
913,025,396 *5F02240C4A41AD1B0F8EC0C0C7EF6ED68976374F B0FC9C2303CD3AA1AA993BB83B1318B6
913,025,397 *5F002F5116F6FD2C6F9BEB002EBEC618F4CF80BE b0g!#
913,025,398 *5F0A58BBEAF49D3390C9EC97A9E8D721A3D368B2 b1om$tre
913,025,399 *5F0A41A9527F3A4D29FD8C0E2DA684BC4F544D8C B5OC
913,025,400 *5F05A257659DB2C21445AF811207E65300CD7F29 BADBP
913,025,401 *5F0542876F023D51D54FF9681D0860DF52D2B36E bvkg
913,025,402 *5F0262881266246F235ABE55EA88F57E7DBE0E63 bz+p"
913,025,403 *5F0F930102B000F029A49369AF20D58610B44014 BASFPASS9
913,025,404 *5F090C011FEEEDEAC3F3AF9EE16A3A7A0AEC331C [email protected]
913,025,405 *5F08277BAB95D219ED5BFC9D7CE29929CBEB9DD5 bcwvf
913,025,406 *5F0CB707A88F101660BF180D9AED8B9D496B9818 BD-4
913,025,407 *5F0F17597F50E3C802425BB47342CD6BBA94990E CALVIN.MERMELSTEIN
913,025,408 *5F0BFB050658D8FA12777DD8CADC4ED384EE0838 beerjessie
913,025,409 *5F0DF41AA0E5F2973879ABCD91C75E301845FB11 CAROL-DRAEGER
913,025,410 *5F0B87008A7E855781A0B3151542B0BA2A68FF55 berbatov05
913,025,411 *5F08609429D3DB0A658CF9B574087E3565BEDC4F CARY KERR
913,025,412 *5F09E1BD6D522FF9CEF1556B16C8756488A88747 BESEAPR1
913,025,413 *5F00A3C33CF1D3DCC5B2CFA1E6242B3E8BB26EEE catch 'em in the act (feat dr john)
913,025,414 *5F033D26BBEA803C6972761DF89FA7DCA79325BC b/f1l
913,025,415 *5F0D536C5F30ED839390CA2BA1747CADBD4D40C8 birger.lambrecht
913,025,416 *5F01F6FD0CB43ABD1BCDD9FF1D35CC8E47CC5C67 CENTORE9
913,025,417 *5F0D78D1053CE2A52EAA8E095F1522A15AC57A16 BISSELY5
913,025,418 *5F0F5F1219F3798B376BE4062B5F916344312DE6 BITHYNIS
913,025,419 *5F04B4B07DD04ACF454B77E3D5A096456BFA81FF BLAINE.WEISEL
913,025,420 *5F07C5AE0F3E5B1CD907B143122FD797C7EA91F4 BLAKEIGOE
913,025,421 *5F0738A58251408AA2581962D460C510A4032995 BLAKEMOOREHEAD
913,025,422 *5F04E7573A68B2002DD75CFECE7F99FDF96EB63B BLIZZAREZL
913,025,423 *5F06D7F2002671FDFAB94AA140F07EE0043B3859 [email protected]
913,025,424 *5F005DD0F98D7A7A4B979FE230F6A653BF47BA8F CfZ4
913,025,425 *5F0BEFF9880284E8C48771C5D740D6A21B2E9DF5 b=mhz
913,025,426 *5F02CC75DC4A8D2158552E2CF6D32BF2477E121C CHATEAUSTÜCK
913,025,427 *5F04FA2D9E9199A174BC0678FAF73FE341477C54 CHẤT-LƯU
913,025,428 *5F01788AD426A9FC74C66616703A89E932B70A50 chbtu
913,025,429 *5F05D68AE76C427C3BA4AAA726CB5E1815C9B1A5 cherylm
913,025,430 *5F01C6E5BCDC888A8A3DB82380BBE4C998C60E77 Bo"p
913,025,431 *5F00633A6C03E9628824073363F3D6A6680BFAEF bouh2
913,025,432 *5F054B9C016E4E59AC4BEE942D06F6138A83A2DB B-P~0.~O)0(
913,025,433 *5F0A8F90087F97DDDE2FE8F1CBACC1CB6A2FDDAC CIU=+
913,025,434 *5F06C036B270F80164C474F7F29CFBDACD022EA0 ci)v1
913,025,435 *5F07D907C20E0666C8B31F28BE24DAC17F6FF827 BRADGURWITZ
913,025,436 *5F089DF377A288A5F725E910A6E7F619096E6487 CLARENCECASAMAYOR
913,025,437 *5F02FB9ECE9F184DB1FF32DD09F5148AF7033FB8 BRANKAMATIJEVIC
913,025,438 *5F01D4BD61D17C9DF2AE1B3BF87B8BC0C2B09A7E clauderuthers
913,025,439 *5F03479277A472E1DBFE5FCA939E38BC16C37DFD CLAYTON.HUERECA
913,025,440 *5F06BE48369BACCD754F890D366F1BACAD2AD965 BRENTON.AMYS
913,025,441 *5F0CD121449D7F2FBD30C505F08A8EF8459698F7 BRENTON.HESTERS
913,025,442 *5F09AE9AEA2309C281FEE8E92A220B7DE9A3E117 CLINTON.FISCHHABER
913,025,443 *5F05D1A49E4A38DE43D84218FFE8C0CF69BD3EBD BRISHENO1
913,025,444 *5F0FCEE5B79597007AC44CD7C6F041010336813C BRITTANYMCKIM
913,025,445 *5F0C0EF840E12C3469F43B3FC53BA42D1D052CF8 brlm
913,025,446 *5F0B9A93126BE1BAF4FB68717DA1BC4C3311FBBA [email protected]
913,025,447 *5F002D615BD54877D808DD477DD805B93D72A9BE co:dq
913,025,448 *5F0897E82103A1AB8B0C63E469D45991B5281459 bt0e
913,025,449 *5F0B25733614651897EE0A5E6A6A9E963C2F5145 BTB.B
913,025,450 *5F0FAFD56971352DFC3E153455A55821C73F3030 BURT.CERMAK
913,025,451 *5F0F74051BF32FB2388527C9AF614B2156E99996 CONTINÜATI
913,025,452 *5F04038080AF6EE73B56505B1CC347289BE1F415 butzheim
913,025,453 *5F0480CDB17D0EF1816C36CF4FBF64751B5473CE BUXAE
913,025,454 *5F02B1B3D3F02CB0CE96A552E65E8ADCDD16B8EE corneliusthiel
913,025,455 *5F02688FD880243D9EFA06929A14C81FFDE09E88 bwvrv
913,025,456 *5F08D2FCB5AEFAE05894892F97F982E055EEC3CA c)_&p
913,025,457 *5F063DEF4020D51C45E2E0322399442E2ADDBE9C C1ANNI5H1Y
913,025,458 *5F0D78C89E8C5187AD532EBA07227C59303D1E29 c23
913,025,459 *5F046B8EF07FA7081B9D196F46950FB7D485EA4E CQ_U
913,025,460 *5F006AB88A2C00565F0557D881AE388DEFF001FE c)6u5
913,025,461 *5F0B6E186A82DF954B5A47EB6DC14B32A5054730 C791C
913,025,462 *5F035D14E8072D24511B74B1C6EFFD37AA1844BA CTKT
913,025,463 *5F07EAC23BDDCA63353026F711A18B288F98D9B5 C-_UM
913,025,464 *5F0DC2172C52B46B15DE67E542D68FB75FB09D7C CANCERWEBMASTE
913,025,465 *5F0A0C6CB1EB8011E7467A6515EA49693CD9EA52 cuvelier.trouv
913,025,466 *5F00D40F94AAD1B3501FB9ACCD0A25BB728DB1FC cvfr6
913,025,467 *5F0B915BF61771A710B1BE145AA704E99419BA6D carinostoma
913,025,468 *5F0F9A1963F710D1BB1855FFF6656F2A9F76DEAD CARY MAYS
913,025,469 *5F019098ABE8A7097DE7BE4C3E740A30866DCF52 czot
913,025,470 *5F00955511329E9813AD7B34C8ECCB3EAB184D41 cb89p
913,025,471 *5F000275B3CB7A9ECF3E425E3525E183B8310F0E d2-q
913,025,472 *5F0247C1EC04D79E99B3C3465C1119B2B64A553A [email protected]
913,025,473 *5F0F965F85D759CAAC13DA103CC349D874E9477D cc/2#
913,025,474 *5F0D0ABDFBA82AD5662246E2A7DBBF9854C629BA C.CL$
913,025,475 *5F0860D1F7E23E0BEEFAC907C52F217DEC5CA462 CEMA
913,025,476 *5F05061AE9539AC48DC686C63B5B6DD7AF441BEE cfixqrkldfe
913,025,477 *5F0C457F7817E3ED8A06ECCDA2DDC128EB91D807 c?fwx
913,025,478 *5F0F28AD501ECC258C00C66EB1045C040AC68995 C"GG
913,025,479 *5F08D01282C7BEA86929B694ADF726A3F4656C3C daulman4
913,025,480 *5F0A9ADF96BC904BAF4DE937416AEE8AB62253EF daxlm
913,025,481 *5F0FA625BD773EE14AFF9944EE292A74E87744A1 DB+99
913,025,482 *5F0B1B9E7D542D690C234A9D83E22E0D9521D78A d+cd=
913,025,483 *5F06803E10E9AB9EE7648B6C1A76286704E16EDF DEANDRENUCKLOS
913,025,484 *5F03FFB730B3EF7205AE1AA5E9D525C35F2A78D6 CHONG.MITRO
913,025,485 *5F0A0E9AFA421C161EE07C42035650BAB8B18D25 DECRASSAGE
913,025,486 *5F0528F8CCC340495063AA555E285639F1E70C1F DEMIVOTARY9
913,025,487 *5F0E94AE6E5541D67437DD8F13D76DA2E8CA223B CINGEVI0
913,025,488 *5F0824B4709ABCC33B64D0C83AFBAF5E1DF30767 CINNAMONCOLOUR
913,025,489 *5F05477B92E547B7178D35FC11892B791755E1C6 cj?fr
913,025,490 *5F01B6E8EC91E4BAA77CFCDB559F32C4DC2BD425 cjkr7
913,025,491 *5F0EA3A0222406CD100EC22FAE8CED28DC5862FF desmondtanikella
913,025,492 *5F09C3FD731109963E1AFD033D6202402ABD593F desvestes
913,025,493 *5F0FF4058EEF96EA3DC1F4A1ABFA39574A5B0D6E deweyturnball
913,025,494 *5F0D13B98BE0565200570CE0F8B35B734B0A5381 DEZIESNU7
913,025,495 *5F0915889EEBAF3F1F81BA7410B60BBCE4AEA271 CLASSICDOOMCOM
913,025,496 *5F036844466E5E115B52B59133439C20C353FC7B [email protected]
913,025,497 *5F0CFF336782D906527FB9D539FB16F24B67B56D CLETUS.STOKEL
913,025,498 *5F08600B232013C6DD8DE9D1898202E9A7122307 DH6RC
913,025,499 *5F0E9D3B722A3585E5CBD8A7A7EBCD9A770A1685 clydeillingworth
913,025,500 *5F0D0A6114B982716AE589259CC78C41174179EF cm8k0
913,025,501 *5F0ED5A2F23DE3ED219C1B0ACD5A7162C4200D6A CNIMC
913,025,502 *5F0B9E34B43336EE26BACD30214E353D76A5FFBC DISCOVERY
913,025,503 *5F07F0F7477F91CB8361919E616FA8FF5681F595 dk+$%
913,025,504 *5F0C1DBB5C91801F7F00CED1AF0AF1B056784794 DK1WA
913,025,505 *5F0F1D10FE2E86C5C6F73D937D9EC877718C67A3 dkba=
913,025,506 *5F0E3687BBB5A41B6E8E06BFE0036A7467E51484 DLHNH
913,025,507 *5F0D51FE886861043165096816EC2E467D651258 dmdop
913,025,508 *5F0DD4FAD82A98AD717B86FD8E7A9D5F7B60E210 d?o8!
913,025,509 *5F0EDDDE1888E1D7862BF1DB11F291FD8EDB1AB9 COTAALIED
913,025,510 *5F0013D6ABCC29554BAB4E071B2EBFB6773F34EC COTTONTALKMILLE-FLEU
913,025,511 *5F0C2F1E476BB084A750AA05AD7B7382308B62E6 COURTNEYMCQUIGGAN
913,025,512 *5F0330B8D575CF0B5F601739A996C04B4DFF2435 c:p8d
913,025,513 *5F0CF6DEBA50CD814D8D9A76FFEF821639822ECA DOUGLAS-CURTIS
913,025,514 *5F0F0C2A20E2EBC5C40667425D8CB942DD422494 c:\program files\microsoft visual studio 90\common7\ide\itemtemplatescache\visualbasic\windows forms\1033
913,025,515 *5F083C2F029333A28A2E3812DA01A0A3E0345193 DPDT
913,025,516 *5F048134B9EF47B5B51A56D5D8DA303857A43A40 CUR1OUSES+
913,025,517 *5F0334D42657D01EC3D93E4B6EC48980A40D58B1 CVc5
913,025,518 *5F0B2234E8C58EB72BC87135EE1D91C86CC5799C D1ZAQ
913,025,519 *5F091AE9394B19994B2B8F2B7A451953BC0D20FE d2-q
913,025,520 *5F07C0B9622DADAEE25860A44A0CFBCD502C6FB6 d4f1)
913,025,521 *5F08F217E9A05BB2F8D9102AD3A130E4A368C3F9 D5WEP
913,025,522 *5F0518853B01EFD10BC9FFFAF7CA4C25B23546A0 D6STV
913,025,523 *5F0A823C9BF78AAD89381047D07736E1D2109345 DAMON.BRANTLEY
913,025,524 *5F07B396374BCCF496662EA375C5D96FE1F53833 ELIJAHESPIRIDION
913,025,525 *5F07E3E1B8C1D0C53C9A6DF4E4BD4E62F6086BDF ELISHA.BLACOCK
913,025,526 *5F0482FD38D43B940F8D547A79EF2DF3246478E6 DAREN.BARN
913,025,527 *5F05EEC706B6FF77794432CED154BC374C23307A darinfurton
913,025,528 *5F0F554C6ACA68E22E110F3549E483548D9FABDF dariobilliott
913,025,529 *5F003189005EDB30661590537631143C6E7A3E3D darnellmcquaid
913,025,530 *5F0B896D78B2711A242C70F5071FF77C9A7FE6CE elvieagor
913,025,531 *5F0D42EC980654511C5A9885BBCCBA719A18DCD7 ELYSIAŃSKICH
913,025,532 *5F04BE0486A4D86D0B193EEBA1F5CA20CC863F62 EMI;J
913,025,533 *5F0B779134A2325075E239F10FAF98A128F6DD19 EMKH;
913,025,534 *5F024A3A591141A6A777E431B57051312B8F6B8D davemainland
913,025,535 *5F01A43A2165CBEA88E58A21B5FE2D3A9A7B04F4 emmittmackedanz
913,025,536 *5F0AAC8180C16A8AE8F0C6521B6DC5FBFF4617F0 EMORY.COUNTESS
913,025,537 *5F05AF66EEE3A0EC7262ED281935A03898E3F0E9 E+N,
913,025,538 *5F09DC8AD88F54CC4F5D7ED87AE58FD527DE26AD ENRIQUEMALATESTA
913,025,539 *5F0CCEB005933A20B68178FA8A37E5DB31C54C32 ddeh
913,025,540 *5F037F7522E87E13D5D2F0938CB409F567056B0C ERASMOVELK
913,025,541 *5F0C10E3795CF206018787C6AE72C521B0C4C664 ERENNOD6
913,025,542 *5F02B76B7B3E3F722FEBD6AA31C7C88BC44D97A2 DECYDOWAC7
913,025,543 *5F09046C4F9C3CF033FA34C4134412662A55B7E1 [email protected]
913,025,544 *5F024D26BCFC73DF8FF3E9D732D7152AE7A5CE0D ERNESTOROLLYSON
913,025,545 *5F07B41A1DA05898A8AE5D6925EAC3245FBF78B6 DEGW
913,025,546 *5F0E2724E21C59CEE3769331A44E07E399F9FA1C DELMERSZEREDY
913,025,547 *5F02D6B13548FFEB1B432967B298946CDF28EAC1 esuednoting
913,025,548 *5F004F8E112751018FCA730FD0B77A0F2C549E48 [email protected]
913,025,549 *5F03EC0922B7C8C757135FB36A6258082C53C348 ETGASEB3
913,025,550 *5F0B2AD9AA2E54B61C51A2617FBEC8E25D780703 ETHAN.SEABOLD
913,025,551 *5F09EDC9BE29583A4E8BB0F349E3A21EAAF4636E DENNY.HERDA
913,025,552 *5F0BB4A6AEE5C133C474D30DF2E454A76C2DE055 DENRSCH
913,025,553 *5F0D7B7E2C94F5571CE199D507AD4C6F689CC21B deput
913,025,554 *5F0B773FFA4F621575C7C10A27B091FAF0CCDEA6 DESPERTOU5
913,025,555 *5F0549C42AF558BBC2F7DA1953CFE345936BC10F DeT
913,025,556 *5F0AB3A2F597C3718A0C9D1C78C455234D1A3ECC DEVIN.BOLINS
913,025,557 *5F014E2E88F4E96FD53DBDB1786233DDDC97098A EYABMAG2
913,025,558 *5F0F095C3966BA8C01AAF1998612BA085EF5B7D9 eyhv0
913,025,559 *5F0EE606E74916F2EE45E08CE14E3D2E16DB0FF8 DFDOU
913,025,560 *5F0A5C2254D49BDB37FA87056EDDEDF6A1307167 dgbf,
913,025,561 *5F0AB63899348A3AD6B205AD4CB274F495D524BB DH3Z;
913,025,562 *5F01A507EBAE9DB8431605A6BC8895C6F8E8FC47 で、オークションサイトでのネットショップ「diamond
913,025,563 *5F061152D92FD6F7A50E06A37CEC072E77E5D823 FELLOEWING
913,025,564 *5F09126E979FDC72AAB4AD83E3284F0EC24DF67C FELLOWCHRISTIANS
913,025,565 *5F0BF16BAC5FBCD24C8E91B679B57F198CE9A99A DIMITTETH1
913,025,566 *5F0A9E651A0B331E90B393F59F1A2BA4F3E557B3 fhlrsched
913,025,567 *5F0CF847692D0B02200CA96EC47A5FF89EF849A8 d?jsl
913,025,568 *5F05207AFF70345953A0C8E7D40BC51C7C09FA15 DLC&G
913,025,569 *5F0F5894CD56C4686CB84CAC09962FB4D76F04EC DNRD:
913,025,570 *5F0D5949C166EE66E24A12808717890EB5AC0888 DOIBUOIT
913,025,571 *5F02FA1AA57ED994D4FE29BDB956385D8022C78E FREDDY.ESTESS
913,025,572 *5F09D8E510806A463CC48910CC9A0E7111A097DB freekland
913,025,573 *5F08DD4F42F7E2DF886EAB95E712BB48AA831691 FREQUENTATIEVEN
913,025,574 *5F065E23B4FC0DF22DAC89EEEF327999FFBD3315 [email protected]
913,025,575 *5F04DC8E302C789A01E1CF2877CD4368DCCFAB6D DONGSILVERA
913,025,576 *5F03DA0FE6EF461807F58A3ADEA9FB8D2B101386 FRITZ.HAINDS
913,025,577 *5F0B8837444D8092EA1AE2893046BA34C5A8C9DC DORIANALLENDORF
913,025,578 *5F0DE49BB30AA09D91F1028216E803FAE624C98E dougcasteel
913,025,579 *5F04FE67E1B6CE09CE1A6336E949ADE8A9D42A88 dpw6$
913,025,580 *5F08529774621635969E69A42EE7CEFF15A50558 DRAFTUDALL
913,025,581 *5F0C1074D3FD9F0072719F8368326B424CA5DDF7 drkqh
913,025,582 *5F0376E9E3A5B54855D09F849D2EAD41FB20B149 dr#nm
913,025,583 *5F08CA3F876AB1B61C4A23E95FDD8FACBAEFFC87 GETUTOYE9
913,025,584 *5F001E1DDC1ED3E01EE28554FA6F829CC0301EB6 DUCKTAIL
913,025,585 *5F0FFBFC1CD6AE8A366DC81C16F8C83D306B31D9 D$+US
913,025,586 *5F060BF64166F8ECF4235B7B36AE4D91099ED4DB D?.Y
913,025,587 *5F0BC42AD0102E7B032A0B6B3134988CC068D19C d;yw.
913,025,588 *5F018D8720A0742633DEDF5FFE19856CCDCE6A46 [email protected]
913,025,589 *5F08369AB03D789BC87913A38CC8F83FEA306DCE GRIGGSSR.
913,025,590 *5F062D9B3A782041E20BEAB5EA62FD2036AF2134 EAECAOZI9
913,025,591 *5F0E8BA39FF7468169512C7733E00AA3696A4363 gstshdng1
913,025,592 *5F01C1B13705674ACA4523162685FA3DDF6D55D2 gustavolandmark
913,025,593 *5F030FE7ED4622EE3D2A9D86B7B372BC4ED5BAA9 gw6w
913,025,594 *5F0479FE6513CB18C86053BD4A4A7C5C813AEEB0 H41R$TY11N9
913,025,595 *5F03F53591E1AC70170A4F9D196D9535691DAD0A edmotley
913,025,596 *5F0FFA594A6FB816AD12B9BDDABEF32229368877 halherrington
913,025,597 *5F00A9B3F6EEFD1F2D4D778F5CF697D5743578B7 EDZKK
913,025,598 *5F0BDCAD9C9E9707BEC681D152AD8110FAABF552 EEDILAV3
913,025,599 *5F0067453582916152FE10BE6A240F720D239C02 HANKWYATT
913,025,600 *5F0AB90AB03DE869D2C80F752130FA0245D6DA55 [email protected]
913,025,601 *5F006C5FB5DC1E081D1B9DA2BD1250EBA1A905CB hanstrosien
913,025,602 *5F08ECE9AAD1A41E68EB74FFF54C0CC195845563 EFaK
913,025,603 *5F0993787CA79808768BC47365A7E48FFAD44116 eg6
913,025,604 *5F05ED57A9A944D76CA6D2D89801904007B1C369 HAWAWINI
913,025,605 *5F0F1B843AD3A883BD80344C04BBCD88849899D2 [email protected]
913,025,606 *5F0245C920C041166C09356FEA45246D3E26B17E EKGCV
913,025,607 *5F00EC0FF840929FD88B65A259180C36BCADB03C HELSKOGS
913,025,608 *5F0E01CAD3EE160B6E5EBD1AC1A52D112BBCA145 [email protected]
913,025,609 *5F01798C655EDA8C959C597EB2C3779CD4AE3469 EL1C1T4T10N
913,025,610 *5F0A35C005FA372D5B1AAEDDE0A3F260F6A51EFF ELDRIDGEFLESSNER
913,025,611 *5F0088A156E5A9EDF9B5B4ED9ECFA7BD7351C7E8 HERMANLINDON
913,025,612 *5F0E3897ED0F8AD5999E89304B02729728D6CD77 [email protected]
913,025,613 *5F03415057F3ED21D1DC261079F831752C10EFE6 elkepivi
913,025,614 *5F0EBD94241AD54FD1799D58FD6D91BD1E05120D hj0v
913,025,615 *5F008C3B3F880A4DC54C1727F2939B9381D70A1B HOCHRHEINSENDERS
913,025,616 *5F043909F61DB854DF5EC12BAEF7E41415C66ABF HOLLIS.LAIRD
913,025,617 *5F0F85666FC5CBC8C9E46DC6693A35069568DAA3 EMETONED
913,025,618 *5F096E5F2A47EFC570A6C7189C379A52FB40F38B HOWCOME(ACOUSTIC)
913,025,619 *5F0A7F1FFE917CD9650BCAD5758DD0BBAF5A9D14 EMPETRA3
913,025,620 *5F02F614A3F02836BC5B070A180C292424487BE6 hre mich nicht" (jochanaan, salome)
913,025,621 *5F0A59A15BDB106CAA9DFD7C85F6E0CB3A335D03 ENBFIM
913,025,622 *5F0849947A70E5F507E5837733F891477BBCA036 encb
913,025,623 *5F09C7F1EA8E894E889CDEA0CD262376C8C9428F ENNAEKAJ
913,025,624 *5F068BE5880AD0B6D6D9E583CCDA280ACD4881FA ENRIQUEMILLSPAUGH
913,025,625 *5F09E3FB0F6A7A8CBCDB1CCC0C325BD5CA8D1E8D HUMANWELL
913,025,626 *5F0483D148D1C6C0B616CA1E9062A9919533BF38 huwelijkskantoor5
913,025,627 *5F02DC80968601617C3C2A505BA682175C8F9E1F erinjanocha
913,025,628 *5F02E336B8D7F14859B1C8E96456A932401D7886 idomeneo:no,lamorte
913,025,629 *5F05A4322A720130079BEFDF3E8C5B49DF257EF7 erroneamente0
913,025,630 *5F0790B5B32DE1160E050D02304CB92DA164DC47 ijbic
913,025,631 *5F0B44C85653762EF375E94F9DF166AB0707C8E6 estebandunmire
913,025,632 *5F0BB87AF1131539AE9496A5463F5C8F3431B100 I-LIKE-JESSE
913,025,633 *5F01B1B13764928D6E67641A6BCEB9933D8376FA ETHSTOVE
913,025,634 *5F0F0EB93F5EEF821ED24437C33C067540611B5D etsim
913,025,635 *5F0A5C601FCF8998A46051FAE9F201487D9B89FD INDONESIAFURNITURES
913,025,636 *5F00441F0759B0A98620AD7FC9BC15D3A61AEB16 EY|R
913,025,637 *5F0819935F9DC65D6659BF3F2F6EE01971D14B61 f,9/
913,025,638 *5F0F2AE4F5DBF74CD381D3504E2E91F269DBE2A8 Fair-Haired-Molly-/-Farewell-to-Milltown
913,025,639 *5F093CDF01A97CA2475953691B0EE2E39B37AD7C FALSTAFF Want-no-Mistress-Ford,-Master-Brook;-you-shall-want
913,025,640 *5F0EC159D99B6BA6952B6FB8C8220DF657DA2E83 [email protected]
913,025,641 *5F05EFAFCAF9A13AA5B311FC27F825513931BFE3 iotaphic6
913,025,642 *5F0892527D1A32DDC4C73AFFA09886FC58B7CE5A irkutskojė
913,025,643 *5F00AA10D81C9141A4706B161B5024A4269CEA63 i\@s
913,025,644 *5F07B477263822A7B193451778BE2CE2BB1B80B6 itatirem2
913,025,645 *5F072767AD015C4891CA465F8147AF45510243EA it-was-the-best-purchase-ever-made.
913,025,646 *5F0A03247FD1EB3501B9E6A2731E3EDEAE07AEBC IVANSUNN
913,025,647 *5F07043FA1F799F68EA6C6C8EC93E125207831B5 IWWERHËTZE
913,025,648 *5F0FFDBDDF39E4E5684988D918F6A0528688589D FETISHIZA
913,025,649 *5F0BCDFD8D5939304B63E7663CBBD1FABD594B1A JA992638K
913,025,650 *5F05B38C08A1C42CBF075B91C60480B5DB9CD8AC FIREBALLCHALLENG
913,025,651 *5F0E69DA858C756A1DBE1545495054ACC4B87DDD JAKEMANOZCA
913,025,652 *5F0335655D9ADB08E77E7E415DF1E6D5C336EFAB [email protected]
913,025,653 *5F0B4D9D3EE32E0EB4D4BCD74492133A1B556E0F JAMEDURETT
913,025,654 *5F00023B83AED4CB7D08AE3BF633741BDC9EE4BC JAMEY.LENLING
913,025,655 *5F064F1D4BEA38D6DEAC54D80F8B018C9D3EE9EC Jane.Go.On
913,025,656 *5F04DDBD47BC374E202215F0EB6146D32D453853 JANETTEL6
913,025,657 *5F0DAB483D62CE647223DED1BFBD83F68C5B2FA2 foerlora0
913,025,658 *5F0AF64C68AB95BCF5221366BDDA423D44816809 JASKCH
913,025,659 *5F05DB85EE4C809A5585456D0163FC17EFD9ED9E JAYLAKEY
913,025,660 *5F0E4BF3B6B2C71A067959805A8498D8A059C34B FRANKRAL0
913,025,661 *5F0CA3D60FDE90A5B494E71025049DA5F4369C9F FRANKSPURLIN
913,025,662 *5F0B93E4953A596A3F468B3323064745176E6C15 FRED.BARD
913,025,663 *5F0504DAB9760A23679F5DED6ABC238A3A878477 JERROD.GERDEL
913,025,664 *5F01747FD492DDAE51AE275AECEFE3D5BD510CE2 FREDRICK.DEGAETANO
913,025,665 *5F0AC816A70BF88300DCFB6EEA1257E79ACD247D [email protected]
913,025,666 *5F04DEDDB819B5414D1A7CE3C8BC2FDBB8A789AD fubar説
913,025,667 *5F093D4CAFF6E5007ECE86E101E99CFDFE18E24A FUNKLUB
913,025,668 *5F0E75071F40FBCE6930EAB6030E2B31E3E4F8BF jjnc
913,025,669 *5F0F7EB3C3A0ECFACF8A12489B23FBBF0B03CAFD jodityppi
913,025,670 *5F0CD2756C8643CA507A09214C29BA6829634328 gabrielderouchie
913,025,671 *5F0F9BE18F54A9310096C25D5A9D2E174484FF77 gabrielle
913,025,672 *5F05F9477EDDD586705D76EF27A702906C1461D5 JONAS.JANOWICZ
913,025,673 *5F0E9C8FCD293781BBB039559FBB14201A7E559E GARCIAY2
913,025,674 *5F0C20AAC17E6842D1D5DE68157BE6E294629E86 gary-arbour
913,025,675 *5F0911ACB530F635BA91488CEEDE7325A9B1A3A8 GARYCECCARELLI
913,025,676 *5F05FF3DD42F4BB10F2B3B1D01537D8231E3B198 GCKC
913,025,677 *5F09029D99D97E12BC727D13096C139FC53B3D11 JUDEGRILLOT
913,025,678 *5F0D90D082B491D371DB061306BCF1D87188B3D4 georgestudyvance
913,025,679 *5F0BAA552B05F4459170A7E3DF754DB318F18506 GERARDZACCAGNINO
913,025,680 *5F0E898983D93C53D75CCCA46F0D847AAEA77269 GERRADL
913,025,681 *5F084BB7AAE258DC2DB54E4A294E1974135C341D [email protected]
913,025,682 *5F00334E0EA8CBD7E8D23A7DB532073B9D8452E2 [email protected]
913,025,683 *5F024A23ADD150F91673FB659E626738F6AB6F70 [email protected]#
913,025,684 *5F02A6FA245189B73196048B6CE8639C811F0791 giolzp
913,025,685 *5F0B7A696DDCB225ADE3D00D3C1F550FFB7F371C GIORDIOLA
913,025,686 *5F03AC9BA90621A2569D6E9814F95F35E069CB78 GIUSEPPEFRANK
913,025,687 *5F08A4F0235F52DFDC471E176CC30E836B770A9C KarnevaliCaracas
913,025,688 *5F0AF10D812ABC27AE8F162599357D02044F2432 gniredagrevstun
913,025,689 *5F0835F6EFBC91A1AA87035924E48FFEA1B978E3 [email protected]
913,025,690 *5F03B4A762646C6C5426AF41CFE5FD442D6F640D KEN-M-WANG
913,025,691 *5F054A36795A18B2DD5C000472CDD99571447CED KERMZYJD
913,025,692 *5F01C5FBFCB39D95775FE02EF4DF2270A9168721 grace2301
913,025,693 *5F0D34FFD6E904E89A58D599BDE3CD00D21640AE GRAVITYH4
913,025,694 *5F0DA0257258B0207DAFD3C364CC3D5F4F135F32 greg.bruce
913,025,695 *5F0D083605C82EE7656914990E94466A816F93E8 kirjoituspalkkioistaan
913,025,696 *5F00A1F4EB1B6507AB025823243EA82FB6BFF9CB [email protected]MOCOMTW
913,025,697 *5F0662AE0CB5238C7BA106CB3FC4211FC61F496B KLEINJ029
913,025,698 *5F05B37AABC634DAB11470342773ACBF9998A44D GUESSSENDIT
913,025,699 *5F0C6229C429073A03014CFDAB78ED3E355E7807 GUSTAVO.DEBOER
913,025,700 *5F035A27BE57F81658975A48477981A0B5528A8C GUWENDONG
913,025,701 *5F0ECD6C6704135C84007DE96C7C31C6A751C384 KORYNASALROAD
913,025,702 *5F0E67A95E977526EFB9C9EE6BBCAE697EAF1B34 [h
913,025,703 *5F024AC8A1474DF9FAE2201F308F363B5A89EA2B H4B34TISQU3
913,025,704 *5F073B425F9DA495330DAF5D104BC79CE947A2F3 KRAJNČAN
913,025,705 *5F0A79D41850FBC633A754D9776078E4595482A5 KRISTOFERMCNAMEE
913,025,706 *5F01B17301AB970BA039212BEAE7081D9F3E7764 HAGSTRÖMINSTRUMENT
913,025,707 *5F018C77DC76FC3E46EDF4858B066251931374A9 KRIS-WARDROP
913,025,708 *5F097CE195A8F80BC1997D88E28F08F613EE6B98 krystaledward
913,025,709 *5F0F990C989B5618CDDD85E0C4DBA1C42BB4F353 KUPENGPAT666
913,025,710 *5F0C51D7C2259A0DED5561A19820992C139A045B [email protected]
913,025,711 *5F053A85A0046DBD88F10879817527B1FDD88574 HARRISONCZECH
913,025,712 *5F0559A94BCF0C82ACAB55B9357B064DD5B32A00 kyuuyaku7
913,025,713 *5F0C2DB7284FBF690DE3E1F34CD24A8313017076 HAUNTEDPHRASES
913,025,714 *5F0C16DBC4A4143D53098AA93A316E768889D474 lanalpib
913,025,715 *5F057BC96F9E25CA6704DF913D113374DE495A7D le0270
913,025,716 *5F03065E303A3ED14DBDE5F1194D2E7BF6D4FDE0 HIDYHXBH0
913,025,717 *5F043C89D9389EAA6784C64733B8E832C6C28BDF HILARIOLIPIRA
913,025,718 *5F090E6A6B1D06359E9DC658EE6EEF05E79CE2D1 HINEINDENKENS
913,025,719 *5F0395D5FD644E00EF748708A56B7B1BF9EDF1C7 HIRAKARE0
913,025,720 *5F09A1DA0259A9721EDB012298D05472FA6D2F8D lenguas-de-escocia
913,025,721 *5F0969390CB65E43E459E462CD8EDCA9B31BF783 leopoldine--l-eh0-p-ow0-l-d-iy1-n-iy0
913,025,722 *5F0FDAC283448A21ACE34A3CDE816CF24E1677E2 LEPUARG0
913,025,723 *5F0C1AF056032D69A53DC255F6107D24450818B8 hold-a-candle
913,025,724 *5F0923AFF4B92DE099BA41DD49CAAF56D5F432CA HORACE.ACHTER
913,025,725 *5F00BFAD29B2BC08E7A157EA5836528E4C6D6DC3 horacebrumback
913,025,726 *5F09E3AC68F23C69911B57D998D33FFA9A593CB6 HORACEKEEHNE
913,025,727 *5F0650A244F76E0C0478BCDC0304BFE9F7A5C4BB li94men74ry
913,025,728 *5F06C46A7B1A228237AFA851E1A800D74A441902 HOYTBALOCK
913,025,729 *5F0F088FC55B25F96F75204B7669D6079F11B976 [email protected]
913,025,730 *5F09CED6153E04FB98310547990450532D14F89C linolafuze
913,025,731 *5F0416C66AB3E64646E8450DDB1F3E8F384D7D16 LIONEL.RODENBOUGH
913,025,732 *5F0DFB4F3FD69F9BBDD62E79D8B183F6062AEA6B [email protected]
913,025,733 *5F091EA53839EBFB981A55BE5C3FD78AA42C83BA hueyseremet
913,025,734 *5F004791D8AA43BE42E48E40CB2AD46239051D38 HUGOCARBON
913,025,735 *5F0A9097B9409A40464E52F3D5C24CAC7DD462C4 LIZETH220
913,025,736 *5F0614350198EAAF3D5CB673D5CA8CBAA2301E09 LLCMULTIMAN
913,025,737 *5F08DAC57114D9682A23830EED4546FF1ED9A459 hvalkjoett
913,025,738 *5F046BDED8358151D6C025EABD1DDAFFEAEBD5DC hyper1
913,025,739 *5F001E366144E4D415860FAEA053E02A11ABBA65 LORENELAZEGUI
913,025,740 *5F0EFFFE876BE3611A634032CC0C296F95CCD7B1 [email protected]
913,025,741 *5F06023A123F59A65C25D99D43588F047C9D1035 I.AM.ADAM
913,025,742 *5F04B16AC9BD4D5ABC12D475272035EDEE1BD20F iambharatqwer
913,025,743 *5F0DCE89F6956D9678537A119CB06D80D632D825 LUCASZAPANTA
913,025,744 *5F04D770EFFEB212DC9F895D1C8CF1B33D8E33E7 [email protected]
913,025,745 *5F0F055E6F877B71DA9E60723ADEBBE44260FC96 LUOHEXIE
913,025,746 *5F02FE5FBE0E4F6E048468E0E47A38E4E7FE9BB2 [email protected]
913,025,747 *5F00D0F9C37471B430C9693B26C44339DF7DD2C1 LYLE.ROGAN
913,025,748 *5F0EAE0ABAF797CF37DBE99CBB09E6664C8885FA lyndoncearley
913,025,749 *5F027A6736DE27703F38E06B91693D8D6BC3FB86 IIBRAHIM
913,025,750 *5F081243B69CC64E463FE0F0BE2C42ECB516BD30 ilovefaculty92
913,025,751 *5F02A685F3527232F395ED13F38EC74DA3E5B890 ILUVSCOTTY23
913,025,752 *5F0D3484E5B4DFC2F83AED272AD7415B58C7757F imiwukoc
913,025,753 *5F02BE3F75E07F4D6E7BA9D5A5566AAF2641DDC1 MARCO.CHADBOURNE
913,025,754 *5F0E2AB29B177D94D1C5D424A3484CA59FAB94B1 MARCOSCANADA
913,025,755 *5F041DFA90B041AF90A17A29F2A100A44A551CFC marcuswyche
913,025,756 *5F0BF0B29B3C202368996608155A6241D69C499B intentness.
913,025,757 *5F0820E895E07641F3B4891334B4BA50190D4F35 MARQUISWHITEIS
913,025,758 *5F0F88B17030D37CC56AD3450A47F92B91C5F537 MARTIN BALDAZO
913,025,759 *5F0E38C32D4F3CB0C6B75704BDF778DBAE905E29 in-the-order
913,025,760 *5F0656267D9B1BDA522C6E85CDE104611736DD8A MARTIN.JIMEREZ
913,025,761 *5F0B19AADBCF282B822B73A61B3DAA1DE8B0F6D5 martyhelbing
913,025,762 *5F0C50F9D545117C86B7373C84FE864A045C7BF9 [email protected]
913,025,763 *5F0214969267396CB37C1DD45CDC64DA02EE8955 MARYSCALDERONEADVOCATEOFSEXUALEDUCATIONDIESAT
913,025,764 *5F0F5F6705B6E9C5445273A7C168A34094B2995F inzaagde
913,025,765 *5F00590DD4221B6A31105118DEE6F1A4364B3DF4 MAURICE.MCMICHEAL
913,025,766 *5F0CC7B1F955F063CC5D691E3502DEDE560359FB iraqpaul
913,025,767 *5F044F30B83794E3E1BE4EABBA3D90C74D3AE57F [email protected]
913,025,768 *5F06089E9C7EFA154BA069F34D44A0411A5EEA6E irwinhosteller
913,025,769 *5F0EBCD6429128701EC262DA45AF4F94FAE74F50 MEHARZI0
913,025,770 *5F05B2E2D8D886156266D4AA46AF722C2AF84973 MELY-SOLIVEN
913,025,771 *5F010B7E33096D7AA88E3A8170B453F2A8498748 menisci
913,025,772 *5F0823DCC8224A6EECB499BD08927A6A09A72DF4 ISMAELCOPHER
913,025,773 *5F09001D70C82D47C0C4335CB9C05683E2FBBB56 ISMAELRONCSKEVITZ
913,025,774 *5F04DDC77ADBBCFD73568EE16DC84FD3DE9BE9F8 itamuenp3
913,025,775 *5F05A82FAE09274B4B9A4D04B40F7FD87F0B120A JACINTOGEORGIANA
913,025,776 *5F0BF9D4C5139AC4A540F7B006494FE5787DEFB1 jacintokivel
913,025,777 *5F03156D0025C0726670DB87D904D18F6EB3611E MIDWEST-SCORPIONS
913,025,778 *5F0FAFDB47D5F58BB68739C0DD025A7AD6B0B59D jacobtabb
913,025,779 *5F045FE0E85C0F4C36B04BB5D275C89B4BAF831D jacquestalleut
913,025,780 *5F00ED9C1303CC956144B657049F8B0CA577DC68 JAKE.CASIDA
913,025,781 *5F066DC73CA194D48E937C7F7BD3795B3AE3A5B3 MIMAREMOS
913,025,782 *5F0AD7388A595A22E58FB0624CDE3C6DBF66883D miscisco
913,025,783 *5F0E7C0ACBD53D748A64D6AF027C277562D5D3A8 jamienapp
913,025,784 *5F0875C87B337644E7C6F61D1917EDA9771298E7 janewelcome
913,025,785 *5F0FCC12CB6546BA086DBAE2FA5A257283DDB1F0 JARRETTKARNOPP
913,025,786 *5F01803FFDBC1E7B0155C5C09B426AB14A70FBFF JASMINE ANSARI
913,025,787 *5F050326757231AC1B2B60AE9376522968E92940 ほとんどのJAVAの
913,025,788 *5F09A0AF53E7AE264D1BA159D3B0ADF6D2F355D8 MNGRLZS3
913,025,789 *5F04428DB781E38269BED004148208BB7EAEDE18 JEREMYHARLAN
913,025,790 *5F09A2C4EAC8B65BB6B06364AE4B600D8EC8EA52 MOHAMMED.MIYOSE
913,025,791 *5F018EC9D98D600A5214B92CF4EC03BA465E43F8 MOLDOVENEASC.MIHAITZ
913,025,792 *5F0C76ADC934AF623FA992D916A2330D5E32D386 JERRODSANTOS
913,025,793 *5F0DD6F2CF77386A8AF359A5B42247D10A1A18A2 monarchwhitecapped
913,025,794 *5F0A8565D3480F90755F1BC0CC1590110CDBB851 jessetafoya
913,025,795 *5F03368ED827F25F7D596E31C81538EF08DD75E1 MONROEFORMAGGIONI
913,025,796 *5F0C4CDE9BA5288FA51D552B2245B1EE3B825C51 JG:W
913,025,797 *5F09F4AA680C47B70A1966F25BF29C4ED1E393C6 JOAN.REIO
913,025,798 *5F01A83748BCEE997C1E40188DC610FFC7ABC9DF JOE.ANDEBE
913,025,799 *5F02A54BB9351A706F03C839F7EDA603AD812A3D JOEL.PLEMEL
913,025,800 *5F0EBB5C9304AD05C9C80C2E4C3FDEBCDAFECDC3 JOESPHSUCH
913,025,801 *5F06C3751FF086CFFD2D322EA35F47260EE07B70 johnieknesek
913,025,802 *5F01CF4DDD3D56CD1D77420AF73ABC4117984B0B MRSTEVE1443
913,025,803 *5F09CA5937E88BA393EF8368FB4855C648188F98 muddy.aziz
913,025,804 *5F08DF23A5280A1C688E28EA07271B3EDC7FD476 JONATHONKITTINGER
913,025,805 *5F0F581E754EE80307B0F7DBC9C5991BE91CAFC6 jonilamb
913,025,806 *5F01310E8B05E54F6BB653F9A129585C5A3F0D00 JOSH-BENITEZ
913,025,807 *5F0FC81BC77102221D5D3C6EDAB967FEBBFAEC84 MYJOEY1995
913,025,808 *5F04FA4D3A8A7F4CB9B775D12A16CB57BE9E2219 joutsenas
913,025,809 *5F0B6E6B0C76FE2B329A616E307688ACE1D775F4 mytony23
913,025,810 *5F04767678EE077121D86B318376D78E404A9046 N79783
913,025,811 *5F0652EBDDA73FA4E1910FABC2809C87E527FFA4 [email protected]
913,025,812 *5F08BFC8019BDCD2D38800D5657A971B8E4EAF9B juliovarieur
913,025,813 *5F0835D668B626EB0AEFE8A7C68FE17B9DFCF8E2 jv$9
913,025,814 *5F09E18CCD57204ADD2A0C65506FD41EBBF904D4 NATHANIELSPINKS
913,025,815 *5F050E3BE88FD6661DD8FF2CEFE4103086633D77 kakke
913,025,816 *5F0D3ECA9D86EBD5E46AC46B905FCB5B0E534E80 [email protected]
913,025,817 *5F02A4B9FCCFE3B057BAC08AE98C1CBF502BC01E [email protected]
913,025,818 *5F08FB586E1350FF17ED76DC8361E257F902B4D3 NEGLIGIBLENESSES
913,025,819 *5F08ECFC1A7BDF73954B17339A44C6FE4B5A8588 nflblackoutpolicyangersfans
913,025,820 *5F0958851DE73739FD4A17E03550A732A9981E2D N%FN
913,025,821 *5F06753E60C8CFBD0E85FE673039044F86252E5D NICK DEARMAN
913,025,822 *5F0903B56AB13CC0CC1C771A5D6F81BEBF2C013F kettengl4
913,025,823 *5F00BDA9C0A7AE353127480177CB7B03B4395B22 N JUTRAS
913,025,824 *5F089CAC2954E01B7F1B74D462E3BC6D12C7AEB9 nnchkbr
913,025,825 *5F0FC310F0F85EE8A37FDC6A6FC6C4F49E31B354 KIRKRHEINSCHMIDT
913,025,826 *5F0DC4688AD3BFBE51A1B84384E6500DA18CC0E5 [email protected]
913,025,827 *5F00A44EE95F8E294DA391F5C873D43B5FD8C626 no.neo.bastards
913,025,828 *5F000BC1092AA5315ED26F0EC5A52CC91D9B9918 NOSIEV
913,025,829 *5F011E17F73CA365E0AD0EE08F883EE4BA1349B6 notionalist
913,025,830 *5F0CC3DF0951DACAEA89FB2E98F552C4FA1BF3B2 [email protected]
913,025,831 *5F0FD625AC96702338D397551E39C349F8C1C269 NSMOES
913,025,832 *5F0BC30FB10E0353F1E7CA514D5274AD6287704F koreywilmore
913,025,833 *5F09F883D83A3823980BCFF97FE97E308ED31307 Nurse See-where-she-comes-from-shrift-with-merry-look
913,025,834 *5F077477288B8FF1A5F21AC9D43520778F191AE6 kostas-karaxalios
913,025,835 *5F0E23E40FFC56231126259180E33BF3F3CF2705 NY-278.SVG
913,025,836 *5F01B524FFD05C06CD5A0C36DCE8ADF9C15CD4CB kräkön
913,025,837 *5F012E85B4530BB3304658B0FA762813B1ADAD16 K/S
913,025,838 *5F01E24B6B9A7303863CA09F06B385AFCA79F487 labels(viz.,divisionsaandb)must,asdetailedinthe
913,025,839 *5F0D11290EF24F02F9AF6FB810CEA7A60B30294D LACY.PEETOOM
913,025,840 *5F0E56E03E492E130D5F8249A08689691F77E044 LADYLUCK2900
913,025,841 *5F066BFD27714A69DFC764897E98597A4ABF13EF OHONA KHAN
913,025,842 *5F0463254D6B958FA371D9627EEF4C30AA257EB1 LAMERWEBMASTE
913,025,843 *5F0B04AA54915CCCDDA16E2E19DA8085CE63C94D law023
913,025,844 *5F044FCED2CC8568B39FF247B15CADD08FE6BA3C LEIGH.PAPAS
913,025,845 *5F0664B4F8F6F71DB2A18A8FBE379DD3ACBF6F97 orfidal(intro)
913,025,846 *5F0AE94D502B8900B6382B8A4D3E54AF133D779C oscargoon
913,025,847 *5F0F9CFE5BDEE2888B5FF5A7714EE270B4AB2674 OTHAWOODBRIDGE
913,025,848 *5F000F6BD630A2932E1384B67E2160C9A6992192 LE PETIT TH
913,025,849 *5F0E3BFA8617DD27D3FFA83D2DBE4CF2DB5E0000 LERNPROZESSORIENTIERTEN
913,025,850 *5F031F7542CC26D93E4685EDB6FA5A48518987D4 LEXIGRAPHIK
913,025,851 *5F0672200BB6ADB2E3B3DB0BE7FE4482F4798BAF LFLATTER
913,025,852 *5F06080197C2A002FA322AA4A6B2758DA348F54A [email protected]
913,025,853 *5F0340E42516C54D44ED4A6EF0800D22AB1B21C9 LIBRARYNOS228,470
913,025,854 *5F06302744272A468916E8E59C5C8973DC68A538 LIEVE-MERTENS
913,025,855 *5F0B9769B903F84EC037A2F59CF5C499D38DBE2A [email protected]
913,025,856 *5F0883AA74C3F258BDE464D02DE8EA11B5A7E9FF $P4C3-P3N
913,025,857 *5F0442448CEF089E4E940DA3CAE54F471A39A89E PAIJEMP
913,025,858 *5F0544D65CFA28E9478EC4A974B960F80B0DB912 PAINTER68
913,025,859 *5F0F60949055135F1E470B9D416D02552724AC8D pantelante?
913,025,860 *5F0E8A055663A56A20437A965E4B2787993DA9E2 PASCONI112233
913,025,861 *5F03AB6C84C4B666C6C38105F2001661458A5565 ljfstkkning
913,025,862 *5F002D9046144324045E6CDA6CDA3D7A5E19EF2F LLOYD.MASO
913,025,863 *5F072E327D07D773233071F3AB06D860239B0C2C PATROSAE6
913,025,864 *5F0842FF908B5888A0C449402E060D581683ACE7 PAUL.UNG
913,025,865 *5F0F1C65E93AC84B0D6F4F9B87041449E4A271EF LÖKDÖSÉS
913,025,866 *5F020314027B961F005512D3818E4A70D32D6CC4 LONGAPS2
913,025,867 *5F0D1AD9CA6337CCCE61F9CAB917FE03D277B06E LORENZOERDELT
913,025,868 *5F08ED339F1D12DD12CAA44A21730D1A1D8339E9 peace,love
913,025,869 *5F088C1062EE157E50C4133DA940334F4376121D Love.Without.End
913,025,870 *5F0BFE30258E45EB4823E36429F42591CF7BC115 LOWERCASEINRUNNING
913,025,871 *5F07B91F9F7D0F6E2D9067CF085478C715EC953F PECU1AT!0N$
913,025,872 *5F00C7066233F426F496B4C33EC52AA60AF5841D PEDROWEHBY
913,025,873 *5F04972C86A73356F01D9A38C568BA107466BC6D [email protected]
913,025,874 *5F090025015A525FF2656FAC918D9F583122F834 pengvin
913,025,875 *5F00FE856AF62BBCD25CED4B9E48F41C00186AB1 luciusrobblee
913,025,876 *5F0E3C3BBC23DF1DABB814A15FAD52C8491F243A PEOPLETALKTSAMPA
913,025,877 *5F0671F3158864DD0EE56BC8C20A5DDA84898135 PERSPICTVE
913,025,878 *5F08B025E7B260A75219EC8D4A7AAB48D89EDBBD PGHAFFARY
913,025,879 *5F02F8B0DDAA71E1EAA86C19B4064A85A844728E m0n0$y1148c411y
913,025,880 *5F00548F260FC5BDF0CD7BAC9A8B8D1B7DD4C8FF MAC.KILDUFF
913,025,881 *5F02C2B05EE19646534FF4802DC988BEFC7F6E9F pierpont—in
913,025,882 *5F05838EC4D6CCFBC4AFC2AFB6F90D2195267B40 maher.ahmed.ali
913,025,883 *5F09D15353813ACA4464538A31337697B4DF534E PIULARA6
913,025,884 *5F01617CFF488A970712572C7FEC22F271F6FCD4 MAIOR---ARMANDO-FREIRE---ARR.-CARVALHINHO
913,025,885 *5F05B9D487824D14E910A366851CBF807451FFFD PLANARIA0
913,025,886 *5F05A9296A311E6DA11FEF035A7429A7129A1633 ploppende-colts-ii:-der-bankraub
913,025,887 *5F0F60E99A512659366DF671A7A7F0DD766E0E54 portersustaita
913,025,888 *5F03FF3C9E01FBADE6CE1FA4627B24244F5E7235 [email protected]
913,025,889 *5F0ED1B4295C32AFA1F0FBD2FC7CF25033D44A5B MARCELO.HEISEL
913,025,890 *5F0B6A2ED96D28E364A311FB37FF5E6010AF5A1C powerapobbs
913,025,891 *5F022E914258B3AC2001483DA891C43107D4D868 marcelschriever
913,025,892 *5F019C65748B3A83BF56E00886F8521FFCC3266E p-----p~.`Splat
913,025,893 *5F08489AF6F66FC6023698A4A97E9A930C539336 MARIAH79
913,025,894 *5F07E4CB4F1CC07EB7E42016C2D24E729F1A3788 MARITESSCHAN
913,025,895 *5F02FC3C2ED514EED77C0523C37A425D1A979674 marlinloessberg
913,025,896 *5F02F17E07A47393B80EAE7B4A5C023D40BB9EE2 PRETTY-LITTLE-LILLY-CAN-DANCE-NO-MORE
913,025,897 *5F087FDFBA82EB4DA18BAC7FF24BA96465DDAE7D ptik
913,025,898 *5F0AB7D3E1A640C36EC107D0ECD28A2F9EFEFD6C mauromellekas
913,025,899 *5F02C21357FDDA4A1762C54BBCD68B5DE997080B Q1SRIL2433
913,025,900 *5F0BB1F44B223727006EE7F6FF90944E1F70E0A8 Q5ZU
913,025,901 *5F08ACD0AC19A60FE7DCB160C97586E4E23E9A47 ME5NE
913,025,902 *5F0A60971BB085A08BB5826B2EB64F3777FC6A4D [email protected]
913,025,903 *5F0AE539FDC3F69AC3A344EF96D298248AC2EDD1 [email protected]
913,025,904 *5F0171DA7B123E502A47B35C247F8AB75300FF24 queada
913,025,905 *5F04BD42F7F85DB0FA0D0A0F8160BA9E279A98FA mervindemario
913,025,906 *5F07AA48FC4892FD744674D4FD0B4D69EA3C84FE MESCOVAL
913,025,907 *5F0E5BB4290332AB785D4601DFDC20D56D7E68E3 MEXICANHOTCHOCOLATEANDMOLINILLO
913,025,908 *5F07A9469CDC629C636415538951FB9FEEE25749 QUINTONBUFF
913,025,909 *5F0F6D5B91F2476CD9E5B0E95059D94720679B8F quintonmedill
913,025,910 *5F0433997F8E9618C4E24188C90E4285B5A28672 [email protected]
913,025,911 *5F0FAD9EE9DF8EF10C5E34FEB8A592A698A06337 [email protected]+11N35
913,025,912 *5F017EAADB8C99824ECA72B289137D855A029D57 [email protected]+0R
913,025,913 *5F08E7DE3EDB3483FF50DF0B7ED8C96232900563 MICHELLE-BURNER
913,025,914 *5F0A097C636FC43FF53289EBA50EADD2C66E55F6 michelle-capello
913,025,915 *5F062EB0BBF220C5A5B3B2EEDD57208CA5D9F35B RACER》可以在LINUX和WINDOWS平台上运行。
913,025,916 *5F09CDE3087BF2CD5BE19CDB27708CFDA7394D1D rachel.salyers
913,025,917 *5F0A3C9197F2F40065909A2A825EE5C956C95704 MIGUEL.BERNEY
913,025,918 *5F0F92190C6EBAE03D4316C95ACF873A7477640E miguelpomposo
913,025,919 *5F0DB218699270AECA0684E2FE2E7E9E0704F2E9 MIKE.BANTOM
913,025,920 *5F0932CD288DC6F2D509A2AE0F8340D8D1755016 ragnor6912262231
913,025,921 *5F09AA3C7F0609D047D87AAABBE8F6A409DAA379 MIKE.TERSTAGE
913,025,922 *5F029E6630397A4EA64DB88A8674A5EED936E806 RALEIGHARDUINI
913,025,923 *5F0F8706196A2D119496601D38183FE01CDEF3A3 MILO.GILRUTH
913,025,924 *5F0F519B6CF94BAFC6108014ADD0D1F9DF71EB11 rancissement9
913,025,925 *5F06D8B371425A867B65DAB77F5675A41BA737E4 RCHANIAGARA
913,025,926 *5F05F344F01A7591BB6B7CF6F78D06F4A6698B51 rclj
913,025,927 *5F0A471E29B7824E6E4EB686E961FC7A2EF0F8CD [email protected]AILCOM
913,025,928 *5F0AE03CCE3068AF0AEBBC67926FB095CBCA9137 RECONTAGEM6
913,025,929 *5F0CA2B9A356900DABF7C642C8E50B830C5422A2 RECOVER4UCOMWWW
913,025,930 *5F099BBD59E715EEB70E161B5C4BFA9A78540D71 re-et-lafolie
913,025,931 *5F0F8CD539A6B43E873930E07C9AED902B6B01D3 MOHAMMEDGROSZKIEWICZ
913,025,932 *5F077D15185E1DDB6F72F2D02CF34EBFF16EBF49 RENFREWNORD
913,025,933 *5F0C84262BFD61B8B24093B99D1FDB30D55DB1F2 [email protected]
913,025,934 *5F0E0B36F414025A1DB58489157D27169F7A87BB repeatsentences
913,025,935 *5F033C6722CEFD82625B251FE8FA7E6BDF0E0721 MORE RADJA HO
913,025,936 *5F0F0AD7EDF75B4A42E54193F5EF174C8A00C4E1 RETARDABIGAIL0
913,025,937 *5F0CEF05AF22FD1DAA3CB43AAE0FD3171C8C6B71 rez.de.guzman.y.fernandez.de.c
913,025,938 *5F0C6F78A12D25E8A5B7D5A10105D783AD9FEF9F MSNGERONTOLOGICAL
913,025,939 *5F057EFF048ED2A118CBECCFB18767C72F019A49 mtazman
913,025,940 *5F07D6BD92FD70D7D84CECDA36FBB70ED149BBA6 RICARDO.TRABUCCO
913,025,941 *5F0B1ED5784E9F9804C894222A338656D6444024 ricegrowing
913,025,942 *5F00EB4DB3E4E04EDAAADD9728BB968303272A45 ricodobis
913,025,943 *5F0AD8608305600D188EA1AD3EFD59FC6B7F2F38 RILEYANELLI
913,025,944 *5F05FFBA93265C46E87ACDCA28ECE9582784975A risciacqui?
913,025,945 *5F026E0FAD86043B87D979DFB4F49A94DF4D4D57 ~-N
913,025,946 *5F0B97C25FFEB485C356546BE91021B92FA73389 N7O1ER481Y
913,025,947 *5F00BF2E9C39B8533E51A01D1138DBFAEA75D383 NACELNIKOVYM
913,025,948 *5F0F59AD0B0AEEB38AEFCF34EB84D6E2D02BC73D RLEQUINAS
913,025,949 *5F028A31B01A0D78833E0ADF8B1CBCBF4EECF5ED ROBÁDIHEGY
913,025,950 *5F0E823A24F4CFF94A550395D6A11E56F40C1EF0 NATHANIAL.BRAHLER
913,025,951 *5F0D6C7ADEABF2C0B9F4E9BC9D1A9E92BC5D9CEF NATHANIELPOPHAM
913,025,952 *5F09666365125D76E96ABCB039FFBD9BAC663405 ROBERTPASCAL
913,025,953 *5F0D035BFE8F6BBA715CE81F96E108FA9E3675C7 robtremis
913,025,954 *5F08003EDACA9459B27F8F5CAB9D9452C35F12C7 NEAL.CORWELL
913,025,955 *5F0D739D1D7258ABF1619A216A2F6752104E195E rodrickmeints
913,025,956 *5F0A4C77FD54FCE178F80FBBAFE37F68EFB579DD NEIL.A.LOPEZ
913,025,957 *5F0E387906AA686809DE1135A70590B90D02FB36 NELDENU8
913,025,958 *5F07963249A3207E207A002594D3B1566A7D2BDB NELSON.MIKITA
913,025,959 *5F0203B2E178D6D26884BB95E15155817B1DF372 NEOLANA
913,025,960 *5F0583FA4860BB52DF084BF72E7FC15858E49E7D RON-(VARIATIONS-ON-THE-MARCH-OF-BELLINI'S-"I-PURITANI"):-THEME
913,025,961 *5F0B77087229DCBCB7DFF1F4F77C75546276F1AF ROSEBUDGABY0
913,025,962 *5F07546E73C0623EFD016D2636ADF75DBF820F5E rozliczania
913,025,963 *5F0550739F066658C983AA45B2CC55E1F1F5F1CE nighat-azeem
913,025,964 *5F025F10F9938F012509F5069481C9A84A2076AD NIMRD12
913,025,965 *5F0A1BAD51DBC76C5FAB2612C4C617977801D238 RUINATION OF THE RUNAWAYS
913,025,966 *5F0569271C476C9F6BE0E6A41272D524B42AFF1B NIX_V_HEDDEN
913,025,967 *5F0B6E74584B334A044837A3AC1E8D8779AB9ECD NKJO
913,025,968 *5F09F86C19385E63E7E2429043E70B584B1C78DD RUTHETA8
913,025,969 *5F05B805E50C9D1B1E787C754C172410601158FB NNMNBLSES
913,025,970 *5F0CD90E01570F3DBA732017E173009E2DE15507 RYANGUINA
913,025,971 *5F0D11640957F92DB902B4585428CF633D444C23 s&0baa
913,025,972 *5F0306A4031700151102D748F23562C574A99BF5 SAHIL KHAWAJA
913,025,973 *5F0104CC8A695E107AF5CC6AEEEAF8174023D62F NOTACIJE9
913,025,974 *5F0C701388A6EBE7B599175AA61C0448690DB871 NOTHING LIKE VELVET
913,025,975 *5F031A5167B71E6CAE70946DE542066774980DC1 SAMAHARAG
913,025,976 *5F037F3A631508CDF9DBC08EADCAFFB3F4EB29EF SAMANTHA-MILSTEAD
913,025,977 *5F0F5E2E69C5EDD2E43644DAA6B1554E2E361A43 samething(featmaiyajames)(vocalmix)
913,025,978 *5F05A4DC38CCCD213483B3E9CAF54284E3B67BB2 sansevieria.
913,025,979 *5F0DA5365A818E79D57CAB58DCEF165CE7AFC89D sauteing
913,025,980 *5F04274E7B75AA373374EE09A99450DEBB7462F5 SAYROVÁ
913,025,981 *5F09662F9E9C1CB166F41774668DBB3327E69D2D s&bt
913,025,982 *5F03D85AF07BC672C6C1406FA9C0B257505EA79D oletkos5
913,025,983 *5F0DE741035D377DF9421D41C75E0E397F030895 onihcat3
913,025,984 *5F0EE8EDF4CC0E0BA63C5B864853C460A6AF7F42 ONOJOO
913,025,985 *5F0F8915DD1E942B756D9D1288A5BBA682594E9B :sdleif.gniwollof.eht.sniatnoc.kcolbbus.ehT
913,025,986 *5F00773D7985E0E3B62C33EB21203CE3C402A5DE ontologe5
913,025,987 *5F07D62384AAA3B94F8D92AD1E91CBBF6BD75F02 (>_<)-o~-o~(==b
913,025,988 *5F00B42E5EA290659E6E101FFA08B6A8B7DEEBA2 OOKKA
913,025,989 *5F0E39886A25F19DBBC4BD2BD3DCC0B6B37F144C second-half-intro-/-red-clay-(reprise)
913,025,990 *5F043BDDBA9BD256A846953EAF94F95956D6420D SEDETTELF
913,025,991 *5F0C9F05CDD0A2B55D7FBAE41EAA41BA019E9D61 se-eu-soubesse-que-voando
913,025,992 *5F004E375B949ED138DB68D7CA4D4C2D65243295 OPGESMUKTE.
913,025,993 *5F042ADC9FBEF1DAD2ED8885EF6665622BF059A9 SEUDNOFER
913,025,994 *5F04D950455E194F304E242A153E75FC97FCD587 SHERRIE KOHLER
913,025,995 *5F0E6543B9D5D02770197AC2A360F3D956BF79C4 ORENKOCHERT
913,025,996 *5F0A7EBBDC5AECD709E13648288C13BB682C4E4D ORIENTAL-ARABIAN
913,025,997 *5F03141295BE3C976DAA9A20229AB4CDA8E92909 OTIS.MCCREIGHT
913,025,998 *5F034E0B57DCDC798E80B858B31AABE5687C5400 otterapped
913,025,999 *5F03AA1852206A499EA67CE13C421BD7BE3A929D OVOGONIING
913,026,000 *5F013839852E16C2AF178CB5F3A198250C74C224 o,-what-a-world-is-this,-when-what-is-comely
913,026,001 *5F0E041D0990F69B5430D7DE168C5D233964771F SJAKTENED
913,026,002 *5F0A753A6E77FB4025948303B5FF289EFCEB6697 p>.~0~o(_0)
913,026,003 *5F0A6DA610A0D4FC85A82A60E68843348711E043 p######)`~.`~.3B<-
913,026,004 *5F029FC7B3A58F861132B926A17BA3506BDC54B4 P7895PAS
913,026,005 *5F0248D82FA612873B50DEABA774FFAFF7A6B3D3 [email protected]
913,026,006 *5F0277498315E50B5632B8F4BDD7C0C8ED19BEE9 [email protected]
913,026,007 *5F0125A5EC784E40FC926871F22B90130FA1D7DF palmerpicton
913,026,008 *5F0F05C24CB51D07652A6E9B1307BDB6CD1A41E3 SMILESUCCESS
913,026,009 *5F07AC086DAC4DF9F3A01457678FF5D84A385DEB snoiricruoccar
913,026,010 *5F06DFF59017AC339C40689F3CB01FCE7B72662E Part II: 33 Lift Up Your Heads
913,026,011 *5F0AB2F2B6A0502446090DEBB109C2B5A5F6A234 PASXALIDOUP
913,026,012 *5F0C6C2827D5A750AEE50262C980F35400899CD5 PATONSS3
913,026,013 *5F000DE5FE776F439079C4071B2D94FCDB835FD6 patrick.clare
913,026,014 *5F05F18EB527C5C7E197E3A1018E572875620C19 SONGS7
913,026,015 *5F059144361CE24B71EE0E5764E00C3D86231D45 pcjpruxf3
913,026,016 *5F071B5628E0A946E8A5ABB0179750A22A043354 SPIDSGATTERNED
913,026,017 *5F03CD97321B7F5B4983E432E73B854EEFC2175B SPILLERS
913,026,018 *5F060768DEFCADCE8B1A511299A266B0FB464F4D splat o~ 0~d#8
913,026,019 *5F0B784F8542335F967FE38EE82177056304B984 PERSUASION」(BRAZZERS)
913,026,020 *5F04A636E15A87237B4DC1C122C22EF871E228A2 SPOKOJENEJSIHO1
913,026,021 *5F07F7D3FCBF66A40AF9E52B84718928C092A16C spolite5
913,026,022 *5F00225D423C0B301E282094AEBC3788D0FDE797 pianorockfinal
913,026,023 *5F03D483C5A0FF92A62156660693FA8CC7E26359 PODUPRLA2
913,026,024 *5F0D51A2A1ACCB741A40F526DD2F8186470D7C91 sterlingloehrs
913,026,025 *5F0581B2C11315F1E4B3617D756AB6037D80EB96 postostru
913,026,026 *5F02883706AC167E8A8DE250946A5BBA303197B8 preadult
913,026,027 *5F0541407CB4976A769B55D6790F84BB5066CB3B PRIORITY...I
913,026,028 *5F096E870F32149B20548BD7F6E0954C6824751B PRIVERAIS?
913,026,029 *5F0519B67D65C2A3D0D796A55A6DEC7BC53BBB83 PSTASEN
913,026,030 *5F0A1AA50990FA73796613A91881C8F81A918ED6 swinhoe2
913,026,031 *5F0E9E6E8575EBC0410453EBEE1BCC5C5491731A q4]
913,026,032 *5F09686654CDD6CA27C9D63C73E87D2B23349BF0 SYSEOGG
913,026,033 *5F054528EBC1E697E852500381DCEE7BAEFCE7DF q======d*.*.)x(
913,026,034 *5F06ABB065BF886178A52CED3B32E4A3B75043EF t3が外板に採用される理由の1つである。
913,026,035 *5F0A45E3C2D9338EC5EC569D2B7C501951F0245A Q##P* * *SPLAT
913,026,036 *5F0BD5AC047BCD0F238C06634845E492AAD3BE7E quentinoshita
913,026,037 *5F02C6DCD76E468AF79A1D7C224A2CBABA3EF720 QUINTINFANTER
913,026,038 *5F01DFA09B8F9BD71A7BED3269586AE050266E14 [email protected]
913,026,039 *5F0089FD9EC77E976A1A27D9E2E96681CCF04FE0 [email protected]
913,026,040 *5F028EA5F7C5B89B430AA43AA424196E11D83EE0 TANIOSANDRAOS
913,026,041 *5F01E8320D4AACAD0CF31CC9FF4912E6CBD26641 R+^0
913,026,042 *5F0D97822A2DB6F43D5E5C128C652842E230784B R3J3C7!ONS
913,026,043 *5F0E3CF993F266DD9BF3203B89B579BD142AAE97 RACHEL073
913,026,044 *5F0324FFE116BD10866AA6D701EF79E2727B2467 tedlulic
913,026,045 *5F04A217479F8ACA9210EE3DC8623E6B6FFACA40 TERPUSS
913,026,046 *5F07ECB93DD8E694C4B1FA5087901B9FB4E851A5 RAUL.YARBRO
913,026,047 *5F0ADCD7BF9A46E9C0690923500520057354526E RAVIJOIT
913,026,048 *5F021BFD8A0EE8B7DDF7888E14AB3D6721CEC390 tfrzwyg8
913,026,049 *5F035065F5297ABA7D8A77D8B9148C529F2695AC tgstftn9
913,026,050 *5F00FF3EAD30E4249DB7255C5B7B6C055454B7ED REALITYBLOWME3
913,026,051 *5F0F4EA7CF45D99DBC33BD49A39C11A410C92826 REBECASOLIS
913,026,052 *5F0E244602DCADECB2F5B3F1559CB2047C08A691 THE-BIG-LIGHT-(LIVE)
913,026,053 *5F04EDF52C4A8DE17EF77FBE847F751FA4C2A110 refugiogiegerich
913,026,054 *5F019C945FA16BDF985EF638DDC22FC8434BAF2E The-Fight-Club-Song
913,026,055 *5F017267C3259C75984EDC2277FFB595B687C6AE thegodmoviecomwww
913,026,056 *5F0CBB64AC083090BA8229E0E7AACBAD483CD1F3 THEILLUSTRATEDMAN
913,026,057 *5F0E2EC15EED821EAAC8F94F7B154FB573CF8DBB The.Last.Day.of.School
913,026,058 *5F0366679E78D3F50CA08A1AD78FC03B3C86007A REINALDOBARKLOW
913,026,059 *5F0FF28A6F05CA4E9642E252DCDA9DEB2E0253FF THEMONTROSE2006
913,026,060 *5F042CF2497A46F9ED63B6F63BA0AA11B2198499 THERRISHB
913,026,061 *5F0F4F1E53DBF3739EA97EAB059754609B5F42C5 REMOVAL.YUBERTALK
913,026,062 *5F07568EEA0543685F149ECCB96CD34AF4F5BEB9 thetwo-traceproblem(alexxxremix)
913,026,063 *5F0C196552F6A62F07EA7597AB5D3F3A2D1B3B21 [email protected]
913,026,064 *5F05BE3E4D69BE08F1A1281DC8B07B30B5E12C76 RESILAENING
913,026,065 *5F0614766C6A86A404F9F3DA93D1C38FEFB34AC1 THORNEBYRDS2
913,026,066 *5F04E247A8E6ED4466CE8A8480C4C1D2E78158BA RETALJEREB1
913,026,067 *5F0612376F3CBEFD55E2E0FB11643E08DE876AD7 TIAREDICED3
913,026,068 *5F00726EAAD4BD28888DF8D57BDCC7643C449EC4 REUBENYELLOCK
913,026,069 *5F03E1B57AF6610B8C32E00FC797703E46DD007D REYNALDOJUENGER
913,026,070 *5F00FBCD51FBF63CB03E6665A73CA76B8E99903E TITULEI6
913,026,071 *5F0799278736A99C9E9610A464A3BD1F108E05B8 RICKALUKONIS
913,026,072 *5F02604F6F0532042C282AE6290827DC542C3389 RICKEY.WOELFEL
913,026,073 *5F0D8B154F419A3FF329D1451980D4F46F9B97C3 ricksmiles
913,026,074 *5F078EA2EDFF140F1AAE5256201C7892795C2E8F riptides
913,026,075 *5F0A827B714031FE5701CF7A4B27907DEE01B620 ROAMELE
913,026,076 *5F04A9DA4B2FAAD52D47FCE55B2B2142119043C3 ROBERTMALEHORN
913,026,077 *5F03197F65575EAF54E80ACEC6E8E23E17D0CF20 TOPHERKATHY6
913,026,078 *5F064E4408FE168E68128FD0E9782F9CA1C1ECE0 roccostitely
913,026,079 *5F0A743106A2CCE430990AAC256997666A09B1C7 ROCKYULLRICH
913,026,080 *5F05C8653EA1B964B2F353CA848CB237590906FF RODHANGED/NIGHTSTALKING
913,026,081 *5F07267686E6833BAE55E291380D89850918C376 ROENISCHED
913,026,082 *5F00D8CB6DA5D00CA6A0E06DFDEB17C9BD8F048D ROJELIO GARCIA
913,026,083 *5F0D00D3A1C21743903D89ACC3F678FA8D72A19E ROLFHUSH
913,026,084 *5F0D59772214680F6A670BD5348D098BA02E3D40 TRAVIS-BINGHAM
913,026,085 *5F0E753D4D0ACB16CACBCEADE77E7A7761FC8352 TRCHYMDS0
913,026,086 *5F07962B9B9281B9F93C12111D77A92B1577092D TREMELLAMESENTERICA
913,026,087 *5F0B934C71C1A9BBFD14F95B63035ADF66BA6CA2 triangle.charlottetown
913,026,088 *5F05276EF37E550C4EB8EDE02E8BEEDBB4D081F3 trixie-belden
913,026,089 *5F01716B5D26EA909C9AD64321B2715756F8D220 TROWCILRAG2
913,026,090 *5F04597D258C7F893AA6495431729F53CF4A82BB RUDY.SCHOECK
913,026,091 *5F04FB535EB4ACDBD4B4B685D48E841FC249076C RUSSELLHEUGEL
913,026,092 *5F0D3293F867F5F7553B8DF7AFB3E75413F6DF4C S104521
913,026,093 *5F05A31D5579E1606FF3BB7C992CB85070C345DA S3PT3MPLICAT3
913,026,094 *5F04710DE4A0ACC2ACA25E9A08197D4221A58E09 TWIC34NG3R3D
913,026,095 *5F090935BF6436DCD397FC195C5A13B476092BB8 SAALEEA
913,026,096 *5F070DF91201403F31B87EBC555E467B3A2B74EE SABAINANG
913,026,097 *5F03BE3D29EE1FBE1B92786A7BD7E9CF0FEB5991 SAL ROCHA
913,026,098 *5F0C0C8CDF86B7F2CF74C27E71160A1014AE5F6B SAMMENTRFFET8
913,026,099 *5F013EF1E991F1A506AA21592076A350F28CDBE7 SAMMY.LEHRMAN
913,026,100 *5F08FF04AB971FE1E9DF63849BD91F39CB737A3E SAMUELGUZZARDO
913,026,101 *5F0EB34BF99A68627EBC84503D9E953D70517613 SANTIARDI
913,026,102 *5F0F4B7669C7E70FC03B1E3151B4150294C6037B SANTOREINKEN
913,026,103 *5F09095099D2A8809EACEA5F9755ADF1EEAED743 [email protected]
913,026,104 *5F04080462352D950BC80A6668B07271995FFB5F u=m2
913,026,105 *5F0CDDE65CEE4D7D8E2E4182E8B369DFE5A574E0 saulsepulveda
913,026,106 *5F0113F7E2332EE63B5171812110164391EEE78B SBANITALORTEPWSB
913,026,107 *5F031FCF509E5DC5C5B2816BC6A4A35BB9B7AC2B SCEGLIS1
913,026,108 *5F0944312E6D20AABA3CB31F55CE1E4DF4EE25E9 SCHPINKY
913,026,109 *5F07504A772F3EE76EDE521D9CCE8CF64473E2C0 UNYBS
913,026,110 *5F03705D162B063C3DC6FD5C2D7F459D6CA6DFF6 scuba1me
913,026,111 *5F08BA6A1C3362DE5263EC03AC0B8413EC2FC39D V68066
913,026,112 *5F06577ACA71E5EEE23299DE560F6B3A91C94B61 SERENITY12345
913,026,113 *5F00A1CB6ED276659A0F7D25D78BF8915313B92D VAINCRE3
913,026,114 *5F0927CD37E40A15C23F983D17E5300B8D3BB2E6 SEZONSKING
913,026,115 *5F02C30AFA6C7E3DA8976D72D7EA75C273B0B6E7 shanedragg
913,026,116 *5F086AB3BC655D3DEB54A594183EF195E28E2D52 variety turns
913,026,117 *5F0CC9B604497EDA8C6A29DA637E775231A4DC07 SHELBYXAVIERS
913,026,118 *5F002C5BB9F5B6DCD1E571EF9FB1CA35FB2154C6 vaughnshellenberger
913,026,119 *5F0F26D17121A5028E218AE8A67D574AEA7E40DF shelknams
913,026,120 *5F04812CE33740A853DB2AE0707E9ED352D823E8 velevried
913,026,121 *5F0502D49BDD6EE315257AB09EF216AD6CA89542 SHONKOFFORD
913,026,122 *5F0036474B91478599BE5B29B729F5DDEBC04ED8 SHOW ME A HERO AND I'LL WRITE YOU A TRAGEDY
913,026,123 *5F0CD9B46DD985558B256BCFC7F6550140D69E1D SHRTSTIR9
913,026,124 *5F0A0C06A9954483E6D336C7466A89701FFF3716 SHTIÚRMER
913,026,125 *5F04C923613C1712CAE6B965D692AB348D1C1DC9 SHUT.TIGHT
913,026,126 *5F00ECC0CF3D43203EFE18C57E0FA544A88F3C51 SIDGOMES
913,026,127 *5F0DB2380004EEE16878B604CFBB335C767D3F41 S?IE=UTF8&KEYWORDS=RICTUS&INDEX=BLENDED&PAGE=1
913,026,128 *5F0ABAE270FC577A39E192E72F676906CCE6FE2A vicki-bowhill
913,026,129 *5F01ABB01E5CC123AD17F4CEFB6476A1800EE668 VICTORIA ANKER
913,026,130 *5F09E01FC338C821ED06D448F66226DA957D15C6 sisalpflanzlingen
913,026,131 *5F0DA5F763BDE0C7723CA0C477113F7E0EC4AC26 siti.zainab.kamarudin
913,026,132 *5F0E5D0468E80A93F28902AE7AE1FAB3AB74237F vincentjarrett
913,026,133 *5F0A86ED29B165C80961E5182947AED6CE92D746 VIRGILIOPRIEBE
913,026,134 *5F0441D35DF744FD099299BA796F72EFF943197C VISANETWORKING
913,026,135 *5F029CF41FEFFC4921C400CAE755F7526FD04762 [email protected]
913,026,136 *5F048862C3C682D528F87107F1A64402BB3C6C9F snedahcs4
913,026,137 *5F0E0BC60608F3546299688F2B5FA1070BDF0DCA SNETSOKJIREVA
913,026,138 *5F0A5E157378DC985F330B9B7587176C747F3738 SNOIRERCASSAM2
913,026,139 *5F06B5AC180E3951104DEC4798A84124CF0ECAA5 VOLVOSLACKER8
913,026,140 *5F0E3F1D04C3D8D601D96A30A1C6FA6698E75F17 v*pt
913,026,141 *5F0D1B9A34E9E3080CC30FE7B9C133D3C0BFA228 VUOTI4
913,026,142 *5F005D13123AF52B14BC2CCEC090837A51CE0097 SONATANO.3INEMAJOR,BWV1016:III.ADAGIOMANONTANTO
913,026,143 *5F0B7FBDAD651D066E92DE16E0DC439193ACC07C WADEEYNON
913,026,144 *5F0BE47D165FA4A6F5C6DF338F32DBFEF3A22D0A [email protected]
913,026,145 *5F060F8E4169FF00B5BBDE740CC026E8CB238219 walead-aldahshan
913,026,146 *5F0047D17C6BBE7D36B50C6E6BE3842F374FD508 WALLACE.KIMES
913,026,147 *5F0CCD7D19FDC80FB8A849BB459A468CB65FD061 WALTON.COLLORA
913,026,148 *5F0AF5D03BBA5ECB776867255A16AF171C74B478 SP00TYBOY
913,026,149 *5F06B951C005DCDDC8773EC9466235E7341764D2 [email protected]
913,026,150 *5F0D536B2CE5F29C3D3CD017319CA46D2E19EAB7 spitfireundead
913,026,151 *5F09920E63846FBBF80EDFEC981DEFEB9BD585C5 SPLAT-*@----P
913,026,152 *5F070B4D53942107D5E7B9D20493DA419ABA71F8 SQTUMO
913,026,153 *5F002AA58FCD10F732124ED8CAE106B61D246697 SROTAGEN6
913,026,154 *5F0039747E0D1DA237A1F6F235411BA91F3D97C5 SRVVRNKH
913,026,155 *5F01FB152595944909E38EEDB71F7579B9023AD6 WHERE.THE.TAIL.GRASS.GROWS
913,026,156 *5F006995287DB258957CE16E6B382C1447393390 stacydoeberling
913,026,157 *5F0022A785816604400B51CAFA5111562108AE3C stadtkerngrabung
913,026,158 *5F075BD60A45DACA38140D55E966BB29EA3C5257 WILLIAMTHEODORECHOW
913,026,159 *5F05F726EA2AA3EDABC10F75D612A001C63F2D5F willysarber
913,026,160 *5F07B446E3C9089856F9B5CDC7D4D38964A83DD6 stefanhukill
913,026,161 *5F01A7E11827A877C5A79D1997C46DB7CA4C7A86 [email protected]
913,026,162 *5F0222D241CA9757AA88EFCC46D6462AC38A4EB9 STEVENKROPFF
913,026,163 *5F024D4ED49687B43435BB8D485BA29D047AD3FA storithing
913,026,164 *5F087321D77B218E5B084CCE0FD3E4CB31E4BBD1 SUKKERVA
913,026,165 *5F04D5E59A8E7F6644E0C96A803538742DE967E3 [email protected]
913,026,166 *5F0C8C2FEB0025C22574E5DED6C49962306C2949 SUNDAYCLANCY7
913,026,167 *5F098BB22F61C5A98F73D2C8B48B3915A0C95E20 WWWSEEDBEDLOUGHTONCOM
913,026,168 *5F07C3E3FA8DA2F02FC8B5CA4EC0DF54177A9421 WWW.SEVENBASINS.ORG
913,026,169 *5F0EB9A6CF0A28B73CCD2A91F558EEFE4EEC4EE3 SUOTSYCORETEH1
913,026,170 *5F03020F619DDB624BCD123C44437D18E992A408 supertramp  ベスト盤
913,026,171 *5F0BC500A2D0B0784A8A99E33B912DE020BF6F4B [email protected]
913,026,172 *5F02B7B8753C871133D7B8BA00A66BABA621D7A6 x$4o
913,026,173 *5F0E0397CC604126E3855F34E24E46F194548AD3 SVYRUONĖLĖ
913,026,174 *5F0609965B0D35A75CC5D9BE1883A21FE5DD6001 XECELIYENÊ
913,026,175 *5F0C4630B18B7862F8D8A54CEE9DF52058A76AAA SWEET UKULELE / EXIT MUSIC
913,026,176 *5F02E885C5977A09ECD560CF8A1DF10FCC7BF88A xianechalas
913,026,177 *5F06FED33608F7BCC4200F3B7B22CFB0ED3C3ABA SYMPHONY IN C: I MODERATO ALLA BREVE
913,026,178 *5F04F28BD73770C69A46C811128220FEB45CEB1E )x(o~o~dq
913,026,179 *5F0B21CA253C151278D242EEED672DB59C263851 TALKSAINT-AVENTIN
913,026,180 *5F0EBB144C56A2FC7DB9A765FB167888DE612451 TAMPICOTRAUMA
913,026,181 *5F0287391A2F4972AEADD04E38FC39A65B01F1E6 YEEMINLEE
913,026,182 *5F0AAF2146D1532DA329BDC78037612C495AEFBA [email protected]
913,026,183 *5F0A24EE69D36A62D9E9931478B2A3B4B976627C YLTNARUGLUF5
913,026,184 *5F0AAC79DD9FB56678406055F4402307F89C10F3 [email protected]
913,026,185 *5F0ECA5220273D11223CD5B61623CBA46BFAB553 TEBCACOM
913,026,186 *5F0A6E97565FA00A57C950E6C0A5D02F7AFAD5EE YOURFLAVA-NATHAN
913,026,187 *5F0DCC8CEEC294FEC8AA518EE41B792AD15490B5 yrtnuockcud
913,026,188 *5F0283D4E69D3FCD23C846571EE9C7E7FCB18C4C [email protected]
913,026,189 *5F04DD8C6CE6C8D8A5C36FEC6257E00E96404473 TERAGRAMTYUIOP
913,026,190 *5F095A49DBCB7B79920CF66EC5CD8B6180FF9AEC terenceschexnayder
913,026,191 *5F02BA46DE047DC4546A292FCC75F5F16E87324B TEREUS1
913,026,192 *5F078FA18DFBFEE4471E5FAB943F8A2CB72D53AA TEŽELIE
913,026,193 *5F0215E3B32F82C885C944DD25F462B7481D0ABB [email protected]
913,026,194 *5F040102D019C30A3734A0174A793A528474AC73 zachariahbankes
913,026,195 *5F0A26C1D63BAB596438042968445EE310E26329 THANHLAN1
913,026,196 *5F0269E80959444E6DE71F86F0DB56F6C1558B1B ZACHARYCHEVAS
913,026,197 *5F0991F12EBC8B853366129EC481D0659CF35E9C ZACKARY.PELLERITO
913,026,198 *5F0683BC2476C325CD0CFAF18F8075C689E5F711 zaldy-israel
913,026,199 *5F0E67A7759392CAAF0853149A82CFAE465B25EC THE-BEST-OF-JIM-BOB
913,026,200 *5F0334A28836200B5037153E54C56D8DB42116AC zapovida4
913,026,201 *5F06250B47B4715ABA8A4E4BF87C349C2D9DC593 zemplínem
913,026,202 *5F0926E44D5153E4E191678D63D174AE624542BC themaxine666
913,026,203 *5F0FB50B3AC1232266BD71F2FA9A117DD925B748 ZGRADOM3
913,026,204 *5F0EC5949BA78C139AE341738A4BFA225F509A69 [email protected]
913,026,205 *5F055B801B0113FBCCAC953EEF9880F25FA62260 [email protected]
913,026,206 *5F00423A048C6B5CC66B42CF9DE0A6810D46D44C [email protected]
913,026,207 *5F05DD3B1DC77B88A2FA242F112584A9E4053CB1 ZUBASCU-NICOLETA
913,026,208 *5F0DF83F199115C6E386B245716D0572D517A6A7 TIMOTHY DELANEY
913,026,209 *5F0B9479483F64618826ECC607F0EC6F3BF764C3 timothylatzig
913,026,210 *5F01BAD8ED99785A16F590C182C28F69CFCFDF46 zusammengeschlossen?
913,026,211 *5F0CB6E84F71A3FFE1D14C03F97592BD93C96FCA tischbongarisch
913,026,212 *5F0EF74CE517296C2A2C7E6555935AE20E387489 έτεροσ
913,026,213 *5F0EF4F1628AF8190B6579B4B488366AF3709762 ΧΙΟΝΕΝΙΟΣ
913,026,214 *5F0936589F5C404B8846E88137B846E48DA8F362 tolipreh
913,026,215 *5F0EEE68DCA0F2124F6407988FDD5F7BFC720D66 TORPDOVKA5
913,026,216 *5F09D85B1E30F1C8A17A26AF76DC88A4C289ED74 космополит
913,026,217 *5F024BD28A164861E8C06E2A18B5EBEF7D18D85A МИСЛИТИ”
913,026,218 *5F030E77AF22C17F620834A6EF5DDBF49BB7BB33 TRACEYWILLENS
913,026,219 *5F037F89563ECF399E3B06F3149E50C73DB46947 TRACYMITCH8
913,026,220 *5F085CB327610199AC6E2E48B95995ABFAAD615E TRADITRICI”
913,026,221 *5F0DBCC2422AE0EE11F2BFA7D8BB2500B40458DC travis.corkill
913,026,222 *5F0FDE5D4A67095187C9250707D6E847979E6E7F TRBIGTEN
913,026,223 *5F04D13588FE63BC18BCBD43514E23A82A81A61E TRIPP055
913,026,224 *5F0A384D28CD0100B7A1F9F6BFD2B6D6005C14DD TROYPETTYJOHN
913,026,225 *5F0D9CE3CF0F3A42A7C4985DC32BCCD12C8705DE tsakwákt
913,026,226 *5F00EADB4EA60BB4CAF9E0A4C13C223D45F67DCC tsneid.1
913,026,227 *5F079D45D1ADDE241C610AFB940480CAE41FDC4F tumaini.lukanazya
913,026,228 *5F08B6DF542A18ED64BF68AF82EF7AE6F89CF9ED [email protected]
913,026,229 *5F04DBEDD38F1FC4C9A4A1E010A4C438B5E8C458 tyhorak
913,026,230 *5F0EE5DEF53509BA7E022A4BFD7761B3C94779F2 あなただけに贈るlove
913,026,231 *5F0FBC3A58DDDB7AF8A2B9EFC35CCB5601341B44 ULASOLIN3
913,026,232 *5F036DE0B5E0FA7E4D3225BF2C6FA66C779ABE2D UNDER$OIL
913,026,233 *5F0DAFE90B402951DB66DF8802518B0B14C56E9B UNEXTERRITORIED
913,026,234 *5F073A35993B2DC7AF196F07269A3E7FEA24E2F9 UNHAPPYNANCY
913,026,235 *5F03A472FD0620AEFFC8CBAF6BB277DD8260B347 UNLOVELY.COMWWW
913,026,236 *5F08D090659821FFFC866CECC90D73ADD9AA6BBE unterlahngau
913,026,237 *5F0B8DD7206B21109F3B1D776BDA09BAD31E7E11 USERHAMIDKARZAIFUNNY
913,026,238 *5F0982DA62BAD81EA504DE0CFC866FF8C6A6AE35 utmapdotongreenriver
913,026,239 *5F0F608758BB86216EE4D80056AB1C2AC1B60D7A V164535
913,026,240 *5F068FFD524264F1768ABCD4E8D1E9202A7A18A4 VACANTEYED
913,026,241 *5F06161C10BFA46F0D715B9300AD7C3EB6109E7B 1112849 da-kann-man-besser-schubert-hoeren-.
913,026,242 *5F05A8F4652643897B3B550070CD20F86047543E 11oct1205
913,026,243 *5F043E0E7504C43AF6DFE817BE6088AA08999A4A VELENS
913,026,244 *5F0D03C4A6138294341C7CCE56B04E961D80423D ve.orange
913,026,245 *5F062A57F3BD48C4DA5382BCF606780F87FD0319 VERA VARLEY
913,026,246 *5F0CB6DFC10FD1624BD8013201E951A96D677037 15558SERMON
913,026,247 *5F0AB3FF553731BDBA0B3A70D94CCD3D09E9163F VERNISSAS9
913,026,248 *5F0B2153BB499AA914B046E3077902AC9BA27D81 vettecarol
913,026,249 *5F03249B3D77F60E1E1656C6FC9C5E49F0E64EDC vikram-bhutani
913,026,250 *5F032D4BC57D3B3C6AA7A04817636D46C3B89957 VILJONGING
913,026,251 *5F03383F173AC2F26F463E2D340D3D74BD9A8DAD VINAY-L-SHAH
913,026,252 *5F007346DF4006D022BC14E0114F2E0D52E8F684 1 bayss
913,026,253 *5F0CA01483DB5E224106D829BFF81A5D2CE422CA 1BRODOLOM
913,026,254 *5F0047C89F7B2A04FA506FAA0867DBFCA97598D7 VIOLETTEDOMINGO
913,026,255 *5F09B4F8301B7F6081E18F23EA2E4EB8F5C41353 VJORGO
913,026,256 *5F01C34286E5F1E339F30394550271DD230B46E2 [email protected]$ing
913,026,257 *5F0D6C7545DC29C4CDC80D3823AF92DBE907FF1B 1 fschachsenioengruppe
913,026,258 *5F05A7DDB1EF1CEE880EA07CB6A962500E02A1B5 1GISSLAR
913,026,259 *5F01959B99095DA453889F8A9E99E705C2DA27C6 VPREYSE3
913,026,260 *5F005FE24E4C2ADEF511D8F5B7772A348EC9D40C vratimo2
913,026,261 *5F08C7B84E72F89452BC37586ACDC6F6264C1C22 1.LESKEYS
913,026,262 *5F033F76FF0DC18CA9A63CB4B27C941D8C36AD46 WAGGERYN2
913,026,263 *5F0F7099BB66736781F297254EECCC90F82336C1 1LOVEK]
913,026,264 *5F0A347A3EBA599E9A7F0B00F4EF65218A4D0AC6 1NIKOLAUS-TONTTU
913,026,265 *5F056427523BCE4FB128964F3693959F14685277 [email protected]
913,026,266 *5F00166B63691331EC027747CC771BFAB1343000 1.PANGASINAN
913,026,267 *5F0E451DF5AE80563B70473765AE23DEB62DCA59 1perusteellinenja
913,026,268 *5F05AF01922CAC4A3B04A7D6C3B798019D3B0E23 WASIM RAWAL
913,026,269 *5F0DBF627F92161DD9093BCE669D4334BF5BE25A 1QIRWBSW
913,026,270 *5F060CE52B56534A26DC8E8EE28C8BF322ED38F0 WAYNE.GOLIGHTLEY
913,026,271 *5F052E3FB886F91AB75D4E4D00EEE8AE7A06302B w,b
913,026,272 *5F0DE03E7B9A0091783760C4D753AD027EC6790B [email protected]
913,026,273 *5F02F0BC31C28FAF64D835A58208DDC8DB49A01A weiterzubildung
913,026,274 *5F0EA2A5862BCA15FE2912245570262023BF67C3 1.tarkentamatonta
913,026,275 *5F01BEB74C988F13890D80D5B3F3D2C658E4D41F 1THATCHINOOK7
913,026,276 *5F09BE459C7B1D2033E213D22711B15D1D6B724B WES.BANH
913,026,277 *5F076324943AF4FB6BF9614360E7BD20D232A4EC 1 VAKIINTUMISILMOITUKSEN
913,026,278 *5F032B308FABCD60B8C14F4E9EC8C35836E994CC 1-verbandsliga-sieg
913,026,279 *5F063AA567B36B57F4B59CB9FA2E14B8F4B81F28 whateve369
913,026,280 *5F050E04CCA8403EDC738E3965F4D64EEC47B6D5 WILKES-BARRE_PENNSYL
913,026,281 *5F0153C5907809CA7D0178D9FD0F657C3E007A35 WILLIAN.STEHLE
913,026,282 *5F07BB283209AD0303185B580DA1E0F16F78948C WILLIEBAUMANN
913,026,283 *5F0E3AB4ADD2C0C40AAE69EACAB1040E26EE5DE4 willysalowitz
913,026,284 *5F042DE32F6E8AE1EA049458FB65F8292601681B WOJKANVOJKAN
913,026,285 *5F06B175214528A3BA757D54E5ED3AC4DE39A058 writeifyougetwork
913,026,286 *5F02024A928464382B8F722A429B6529A258A8A8 2ADESIONE
913,026,287 *5F04A12693CF42486DAB122452DB17674CC7CF2B 2ATSEGNIR
913,026,288 *5F095BDAB4BD8CB913BC5218092261ADF764CC90 2fdarfur1205
913,026,289 *5F04F69C7D3B8804F4656AFF35F7E8356B03CEF2 2FUNKY(RADIOVERSION)
913,026,290 *5F06E4E3C0F5CDBA3B53AC039AC6245E4C73DD38 2HOODLUM'S
913,026,291 *5F015E0F54948C5A8596A978D5E2A977D3D3C858 X135618
913,026,292 *5F04CD0AC74E5EBEB303A812D2728A89BEABA8EF [email protected]:COMTECH
913,026,293 *5F04FF82EC5E8DDBA37BB267D465DBF0940FC50A [email protected]
913,026,294 *5F02EACEBE6B4EDF82D2B93B0CA4CF4A185123C7 [email protected]
913,026,295 *5F0820B2C5C81FEA0915CC7801CCCBE775CD5CFF XIMENA CASABIANCA
913,026,296 *5F03F2605793C8FFC49000E9099FD9ECD0632BC2 2STDEVON
913,026,297 *5F08572EE172261141DC54E77FFF9462CD50EA5C xokwokieox
913,026,298 *5F01CC6DAF4B09890E40B1153681CB61D1F8E258 2WSTAWIA
913,026,299 *5F065C27D9CD6729FEF32179B892E105C07DB241 [email protected]
913,026,300 *5F0ED6E16E6A4E8B4059349E57AE3B982F26F15D [email protected]
913,026,301 *5F03F0E7810EF695B7FFFDA5199C62298822457D 3)~0 SPLAT!
913,026,302 *5F0C019DEE2F6576E705C2416C0969EE23ED12D3 yantisona
913,026,303 *5F0FCE381C58B3E655D33FEDE2EFF44298371DDC 3BIJVORME
913,026,304 *5F0BF49C736A0D2B512285503D0F0D6FA22B3D9C [email protected]
913,026,305 *5F07D4A26810F97C01465AC95FEC7EBCACB389D5 yingkimtsoi
913,026,306 *5F0F345614320288A0599E40A9566E60AF7C0C07 3 k
913,026,307 *5F0CD36DD5A839B657E0B156CEEBAE1D0E63E539 YLGNILDN9
913,026,308 *5F0364AFBF962ECA3398648A93C3B6E9098E1B89 3==p~~o><
913,026,309 *5F084309CCF489A844CB817E49568A05E5AB5630 YOGIT.PANCHAL
913,026,310 *5F0399E404326D802EEBBD859C66CB0952A87B7B yolwwp
913,026,311 *5F0FBD1A1EC61EB633259787E05F1E1E0472E6FC 3-WWW-INDEKSEJ
913,026,312 *5F04AE7E50CA3A9C5E1765E0B6DBBD7E9C59CE01 yra0y3ncfypu
913,026,313 *5F0A9A06166E510995E277D219BE53E892810DFA 4.armonici
913,026,314 *5F04D2AF0A07ADC9B81B661FC3AD58AD55F68843 [email protected]
913,026,315 *5F05BA36EB3B951D6D40D0DDB72D430F717F6510 4DRUMSLER
913,026,316 *5F0A1F34AD6B6BAFBEF60FEC549A8234E4DF2C85 ⁴HE
913,026,317 *5F09A0E8C6B8BF154B54B0AD0FDA5D08077389D4 4ISGUZARLIK
913,026,318 *5F06A64E4116B42B453C54321F9AF7BECDBE66BE 4MORRISTOWNBASED
913,026,319 *5F0C0DB7FF44191411CC3A8CFA36DFA84830DB1B 4MOTIVEPUPPETPUT
913,026,320 *5F01B08CDA56C6FF7B8575DDF114B7C33329B4E0 4ROGERGOFORIT
913,026,321 *5F0E717299AB8E5AE4DEF81378B6848E6A6A3449 [email protected]
913,026,322 *5F0A33C51720B7B2D51A2CE5CC568198B596EA15 [email protected]
913,026,323 *5F0AE35EF90B0EF2FF70C8A7C0735A1C4627CA4C ZIANOURANI
913,026,324 *5F0CB44C217B15418AA2B3FC98569B9107D5D90D [email protected]
913,026,325 *5F0082BC8EE12209F4D44D1BC6AD987DF61304A2 ZIGGIEJ
913,026,326 *5F0DACFABD3808C3F9DD68DD9243311B51F1CC0F [email protected]
913,026,327 *5F0EE09BD9EACBCF6F2AC0FDD224B6134DABAAC4 zmaragda.tsami
913,026,328 *5F06AA2D2C73D3B35CF75E449DD6F020FB7C8B74 5317 hukukun.globallesmesinde.ikinci.alan.insan.haklari..
913,026,329 *5F0126D874135935334AB8A95B42FA855B265FA5 544PIPER
913,026,330 *5F09EA68E10266E58D201B7C8B46FB543C918CFA 553351 alIS-/-satIS-iSlemleri-normalde-3-iS-gUnU-valOrlUdUr-.
913,026,331 *5F020847C4D8CB10AE807F90C2EB08842050829E 577HAILEY
913,026,332 *5F0488C072320146270537FA952B08F03FCEDC5A 583930 ...ne.fark.eder.ki.?
913,026,333 *5F081A8F34E9469E6606DA20270B78F1B391A4FB ZULIMARYEISET
913,026,334 *5F0BAFCBA5DA726D268D100555ADA99DACCE2AED 5DOTEROS
913,026,335 *5F056D641C65454F689F476F6B0CA758B7B24407 гіпопігій
913,026,336 *5F0D7726C4054255DEEEC54437220294C4985CA5 круденер
913,026,337 *5F01EA0E53F92ABBC30C30ACBB995A8E8C854A8F 5MILLERBIGRED
913,026,338 *5F01A307A8FC1C4A4FCA3F9DCF45312326203D97 «ЛЯГУШАТНИК
913,026,339 *5F05EC701BAFBE4D597823182D66C8BD2C978E1F металлофурнитурный
913,026,340 *5F00FE48115A9D9E5BFEA5890DB0805CFD5793E0 СААТЛИНСКОМ
913,026,341 *5F0F533BF51FA2C778D95DF47F96A52B61F285A5 5SERSUCHT
913,026,342 *5F0A44511E031531F49581722E401A415AB7341F 5SHKLOVSKI
913,026,343 *5F0677CCC6F959D9A8D9B30A10A64AB2EEDA42F0 5SUDERMANNS
913,026,344 *5F0D0CA3E98E3D17FFE5448EA5E629860312D035 5SUPRAWOLF
913,026,345 *5F0A928539F0B16927CBD0F454A153DB9448FC11 5THCILEGR
913,026,346 *5F0BB60F3F486928DA8CA7329DD9D5F5EEBF8C6F 5UMKLAMMERNLY
913,026,347 *5F098796DA11EE8A0FC6A42A63C457CF2B34083E 6193 THECOMPANYEXPECTSTHENUMBERTOQUADRUPLEBYYEAR-END
913,026,348 *5F0AC5309EB51C23A1857290E60601C648AD0000 6BRTTSHNG
913,026,349 *5F06D9E8ADE48F58A092CA1D5B31FA2AE4EBF7CE 6BSWTNANIMODBSW
913,026,350 *5F0FCD70C1B27C99D7B5299487D8EC6F67BD6A3F 第一首單曲《whatever
913,026,351 *5F0DC5CF1D1BE6922B59C444859ED9F873ECD1BE 6TWEETYMARY
913,026,352 *5F0A26F78670B58E4D3D02F21D0A3D86AC42945B 6TYOENTEKIJAEN
913,026,353 *5F0127E6C6F3A1DE0F38F8EF093A18D00DCBBD9E 6.UMVERTEILUNGSPROZESS
913,026,354 *5F0394CAE0BC145050B3CDEFB8A876019FE66326 6WEKSLARZY
913,026,355 *5F0DB5AF4CDBFA3C86271F6EDE3F943D0B79E3CC 722julianna
913,026,356 *5F0157E0B587D1ED6948F99B9BD19426A16AA894 7HDERLIGHEDER
913,026,357 *5F0FAF7ED05F7DFDEA15B2F7238A4AABF628C9ED 7HEARTSMELISSA
913,026,358 *5F085F6765B7073CBC117F46CE630EA2011B3B9D 7MAXSMILES
913,026,359 *5F0F66D97A4622322870DED74F932DB237BE02C8 7NEPOLEGTEEH
913,026,360 *5F07FC8A68F26770F998449011AF8F3D183E8AAE 7NETARIFNCH
913,026,361 *5F01AF4E790B7B9F048D4BEC00F653E86AE6C14B 7PGXAVIE
913,026,362 *5F06A6A5A9ADF72042CE7BAE70231A304F08CCE2 7PHYLLOCHROMOGEN
913,026,363 *5F0BC3A03C794E5F7980A813697160EEDBD59CF0 7rehypothecate
913,026,364 *5F0E7FB44A92514351F355874BCB91D6818AAFA6 801965 ANDERE GRUENDE WAEREN ZUMINDEST VORSTELLBAR .
913,026,365 *5F0BD1D2027EE06DD06B44DF54C1D623335BCC2E 88LVRBABE
913,026,366 *5F093046EBBA546D84AA11568A23C97FF35F8710 08-23-1802
913,026,367 *5F0DF5D39905755C6632D1FA0808C0A289BC3C81 0IAMJAMJAM6
913,026,368 *5F07883D5D341B6A5CEF01BAC9FEE445FAED932B 8EOBENNOT
913,026,369 *5F0F09D03801039784102F238B45DCE6E9BFA9F2 1005440 cdrom.kurssi.on.helppok
913,026,370 *5F05D52D288674F3660C60A7247BCD0B80C005B5 100milestogo
913,026,371 *5F0A310C6C052489498FD7A30EF147DE5FB8C54C 1090364 miksi.ei.siis.yhdistett
913,026,372 *5F053040B6E09CABCE3EF9219C6220DD455AD890 110x110
913,026,373 *5F0A463E0453CAEE4D4C7F7096E15BC96E2A2AF3 13-STRICHEN
913,026,374 *5F007D4A5D7BFEA42842D3698F56279F4832B043 8#####p~0~osplat!!
913,026,375 *5F00038023334EF5F5B4A52733D9FE7D298E5864 14RYN9EC+0MES
913,026,376 *5F07FE1F7847D507380330AEE50B67ED46F359C7 156:.................$FILELIST[$FILECOUNT++].=.$FILE;
913,026,377 *5F0ACC242CA0A82461EA742CF7553647812379E3 16 BELAECHELTE
913,026,378 *5F0AB35F46B2E3728C40B811CAC10F45E291C200 8sep1182
913,026,379 *5F071A66B393A07F6BA55C76A847DECE690EBB6B 8SHMEIOYMENOYS
913,026,380 *5F01AEFBB6C27E7F8F5E965DE51E8DEA9AFC4F91 8SNIISIE
913,026,381 *5F03D0D65DCD3A86DEDE6E030AAA34FA4D49620C 1869084 lukion-tokaluokkalainen-tai-tokaluokkalaisen-
913,026,382 *5F04A3CDEF6070F0B1935F5BABC3989EDEEDD465 18-LIIKETOIMEN
913,026,383 *5F0417C66D899817119BACC0F71D1375809922A9 8VEINULEN
913,026,384 *5F00B57749D7E2B86FBFA972AF1D07C96F89231D 19121744
913,026,385 *5F03A45987F4DA9F58906AA88AE228D2095E14F0 1991418 upm-kymmenen vuosikertomuksesta selvi
913,026,386 *5F0911897BE62A336AA0DB50CC1734538A456DCF 999KM(有料部分)
913,026,387 *5F00E17C8322A6A26DC556515EBB0F9ED574FCA8 9AWESOMENESSES
913,026,388 *5F0C3F6AE075C0C0986975EA950EFD162737FB48 1.ATOLVESILENTOVENE
913,026,389 *5F007AF6CE32F34CA618BACC39F58C8081E94ACF 1BLOUISSEMENT
913,026,390 *5F0EED9D579C2B7D3DA4D5862240C50A435931D6 1DIYAOG
913,026,391 *5F0431596FFC155E91AAB6D15872E3E3241B4852 9FROSCHSC
913,026,392 *5F01E6318CB7C31CF64BD186C58F6C0F69C727D4 9GOCOCACOLA
913,026,393 *5F048FD9DA60AC28169A3AB618D3B7EB3AAA69BA 1 FEUERWEHRSTIL
913,026,394 *5F09FB9B9FC825139D833C0F545A3FA43B2F18A8 1FUSIONSMODELLS
913,026,395 *5F06CD102E1152B57D995CB74499DE5145DE7008 1GONEVICKY
913,026,396 *5F0F4C837D027116D33FF1E042AD305E62712FD5 9MADELYNNEBSW
913,026,397 *5F07AD39F605BD51758BDD50CCB92AE027306198 1INNKALTE
913,026,398 *5F0DC94C1BB9684B4B2DCD507EB4C85DC5ECD3FA 9OFFENDERLOS
913,026,399 *5F0E8EAE9F0D1A820A35F34EEC0CA1035BD7E66E 1 JOUKKUEINFOA
913,026,400 *5F0AA34FDCB4C9D65F1F4F2743DE056C751BC6F0 9PEUGIAN
913,026,401 *5F0F1012BAE62E8FADF9CED88FB6A60C6C859A85 9SINDELFINGENBSW
913,026,402 *5F08C81A72D35E49DC3ADF6BE9ED8181E52EB6E2 1-LISTENZWEITE
913,026,403 *5F05149E49795F566B42EEC79A45E8C390C9B1FE 1.LUONNONELEMENTTI
913,026,404 *5F0A327B56A533F2DFF23F8CC90B7647F2672869 9TARDISANGEL
913,026,405 *5F03D1E05388A7C567BCC96793C032A2BA35BDAA A/?:
913,026,406 *5F0E6B9D92E62813BDD10071CE89F2D98B3032B1 1SARJAKUVAALALTA
913,026,407 *5F0E2B4FDC38E7308D7A24C77ED7E7D9A7DF513E 1-verrazano
913,026,408 *5F0A8EB9849F646E3DE6B128349B4D9195BDC67C a9n(0
913,026,409 *5F047CBF1B3655A914E86D1A10736191431EB2AC 1WEITZURUECKLIEGENDE
913,026,410 *5F0BDE1055535D9B764B18D0EA560197E17F26F1 AAAA\G
913,026,411 *5F0E0CFCFF99D5B3CCDD21E5EE9EC92F8FD4E455 2205738 AINASTONMIELEST
913,026,412 *5F025024097F7FBA1ACA8FFAB54C48C8A885FA7F 221377 interestratesarerunningatabout20%to25%ayear.
913,026,413 *5F0E4867AF1CDD8560E1D09CEF9E94FB6EBD7709 AAB7->
913,026,414 *5F0A25D02839CBDE76C8AC4DA17B032AA002797D aabgb|
913,026,415 *5F0EFCDD648AB313EA83E12406039CA1A1B53F50 aabj:1
913,026,416 *5F04763B5B0CE883632AC53FDB8E884FAAAE6E44 2667175 PELINENSIMM
913,026,417 *5F0EAF0769D8E787C25122EF616B075077081586 AAELYM
913,026,418 *5F023C4E263DB3EEFF49D093CE7799C6F97DE5E0 2989263 yksiensimm
913,026,419 *5F0C5504F0EB7A1E6842C7939EFBAA2D36001E4C 2c989a0dca7ed01943629b10b795fea8FsCSYdlY
913,026,420 *5F07B6FE7B541B6EDBE51C28EA17779A06770D69 AAVATOUJ1
913,026,421 *5F029AF3F5BF2460744D0097995D74F7425BFA54 aa,w~
913,026,422 *5F03237683AA8B1FA775EFCDAC05C7B9F8191452 abfnx
913,026,423 *5F0AB9685C013CBD31251CE10BAADFE9BE336972 2mysweetie
913,026,424 *5F098B06D0D61C165DF0E3C5EC4688CAAFA13FF9 30AUGUST1169
913,026,425 *5F04DFAC28954B3A23E4A63057740883EBB52DAF ACHURERO
913,026,426 *5F037186F67EA3FB6C044FC67918F69A24FBF6EC acronyms
913,026,427 *5F03686D2876435C646CABA5730B0106DD8AA38A AD/D)
913,026,428 *5F0BC7F413F4FC10DE06179F141A861E5BC0B72E ADELPHOP3
913,026,429 *5F0BB2C78017C80BCB7DCE118DB60E3EC0E50DEF 3 k
913,026,430 *5F05283D5630587472E68A535DB2021FAA5182D9 ADJ..INDICATING.&C..V.
913,026,431 *5F0A2AE7993C6B88A46075AFD4E491344C2AE1BE [email protected]
913,026,432 *5F08AC5DA57E21C6D0304AF80CA229C1CB5A039E ADONIS-GONZALES
913,026,433 *5F051F643CE81C8B78A46B918FCA276B30610BA3 adreg41
913,026,434 *5F0774AE38210E8DD506DEC1C575619A710847C8 3 WOHLSTEIN
913,026,435 *5F0CF115529F1B424486B3B0802DE5819DC0014D ADXG~
913,026,436 *5F0D61452C4C380A3146F5417FFFA8B6290B7226 A?EKB
913,026,437 *5F0EAC8173D145B5C996C0BA8BA5E11A235558B2 affr%
913,026,438 *5F0703E98D883E73E8D49E371E80F1C510BE445F AFIV.
913,026,439 *5F0258ED65ABB6D426DE44DD9AEC44AB1D54FF6C AG0;
913,026,440 *5F0D71DF522E7B8EA6CF1252916ADA21911FC777 [email protected]
913,026,441 *5F0F9F9221581914933B2D01F766B1E7AD4AF87A ahe
913,026,442 *5F0D186D20274F7B7E748FB0B22BF837816354D5 4KEYPASHINE
913,026,443 *5F005DFF0C908F7DC49C97ABE60FEDA6B3473DF5 Ahh, go shave your ears! Doggone
913,026,444 *5F00E109E69D9924DA0E409399FD2D30324E6EFA <A-HREF="PROCURE1.HTML#HDR6.7---3-93">6.7---REFERENCES</A>
913,026,445 *5F0BE3EF9CA19CD7FF6528F990FFDD5EF2EA4D49 4NEFUSBSW
913,026,446 *5F06F3161239CCE19D5DFA371E2C25BFCD270EA8 [email protected]
913,026,447 *5F0188D80788796BF61C5094F6E034A205B388C4 aj(;9
913,026,448 *5F038A2878777B52DD120322CB9296AAD40DEBA6 4RENNISEE
913,026,449 *5F052ADFA140A32D59E58C71272EB5E940202555 a)k
913,026,450 *5F0852D5ECCF9B0ED2EB27E86CC41CE9BDE1F9DE 4VSSEUAIV
913,026,451 *5F0B9F40FDEE85CBA1F68CB06D588C29D109D610 4ZEISNEDNOC
913,026,452 *5F02290AED165C60B007CC36F3FCFFA7408DA7C7 aktantenzahl
913,026,453 *5F0042F278791B20FA3B1132FC18B40D8B74696B ALAN.LAVALLIE
913,026,454 *5F0D598F268785A90A667E0E726E42A3FD122B8D 5225JMILO
913,026,455 *5F061D9FE9AC666E0DDEA2A1BFD3046DA679EAAC ALDEN.DIBRITO
913,026,456 *5F071EA254BEE08199688414EE7DBCD710A62A78 ALEC.HEDGER
913,026,457 *5F094A19DA78C16E61BFE5E254218BF87BCD9394 alejito8
913,026,458 *5F04CE0C850462808AC5945F1FD702135DE86380 alfe/
913,026,459 *5F0567E3FF0A4CD9020A88FB27C11CC2FC0DF6EC ALIKNOFF
913,026,460 *5F0177EA2FE1FC5978BF7B612A5DC1375AB973A0 alj
913,026,461 *5F0A87E344F9345715E0D9612AF81B811B34097E 5EZILAPICINUM
913,026,462 *5F018B382D24BCB5708585814118D2F9C36E4069 ALLEGRO,FROMSONATAIND,K284
913,026,463 *5F0547A710E23D27303E4EBC264D055F649490BC 5rikkomattomia
913,026,464 *5F09D7D7166C4C65FA3252C69BB5FC86D341B9DB 5SABRINACOMPAQ
913,026,465 *5F03D2F7B610FDF9B2999943E2A68285036BF033 5THATBOXERS9
913,026,466 *5F0AD4B9B38BBBDC9ABF49876DA0F97FA4A28DF7 ANDERSON.PARKES
913,026,467 *5F0C00109D963C28D0ECBDAC86B07822284A4F16 ANDREABLASINGIM
913,026,468 *5F09FA0D50FEC6A0019EC9D8858C227C6AF30980 6AMPHIBOLOGYS
913,026,469 *5F0970919BB372BC833EAB97D20C5AEAC1867571 6BERCHAL
913,026,470 *5F013F458DFC2EFD30F2ED3F9BA1DB5FFE52526B 6BSWVANOVERBEKEBSW
913,026,471 *5F0E9CFEDE507360EADA8D35EB564743578BD15B androides.
913,026,472 *5F0A175992F631E35E25E4F27C87A8974C52C4CB a/nf_
913,026,473 *5F07F7E6A76A012C8B94DCB374A9EA66335BE736 6EAPBOOKLET
913,026,474 *5F0767CF6D039D6C7992F43FCD7ADCB4E6147E6E 6ECROFRET
913,026,475 *5F0DD4034CA1F0859A6ADBA66F31E759D17543AF ANGEL-KREBS
913,026,476 *5F0E0D6E86E11769D424A25BCEAF53547C659819 ANGELSCHAMMEL
913,026,477 *5F056C8B011DD55126DC1BBED56D373A214FDD0D 6ILUVIDONTKNOW9
913,026,478 *5F002E1A6E384374E35DE948DF2FFBA8F73B9A32 anl:h
913,026,479 *5F016DCA356CD2E7ADF78A868C544D64B3D09675 ANSELMESED
913,026,480 *5F053EEAF1F341A7BE8F071C8D96BCD8DAEB3ABA 6PROPHECIIS
913,026,481 *5F059F3FC2033D92A16E71CE328ACDD82BC8CE35 6SMARAGDICAUDUS
913,026,482 *5F095C672720D7471C83DB721322964FAF71EC9F antondaiton
913,026,483 *5F0BA0F607D3308197BE90F511E7FB78ABD17C1E aofay
913,026,484 *5F0F55433AF7E8128FD4FB4BA0B0A525A81BE57B 753MADDOX
913,026,485 *5F098ACC448122C3DA3F6A44A1833919F9B1AB07 apple,-the-dragon-slayer
913,026,486 *5F0C2177B4F005C65346133C793324942C74174C 7BSWCORNUTUMBSW
913,026,487 *5F00E73CE4B49A149A1E31B92109282EB32E2986 7chinerei
913,026,488 *5F0D79EBB39867D5D7C0BCA26265E1019B770BAD 7FORFINENDE
913,026,489 *5F06BD03E5A330581495B9380682ACB36023EC5D 7GAGNATS
913,026,490 *5F08AC292DC29A5D52E147280C2D4E4F1BB00333 7GNILUOFEB
913,026,491 *5F05EBD0E84122C84F444207B81EA0776D672281 7JOSEPHKAREN
913,026,492 *5F02C2AE9429EBA7B714644AC3A102AFDB5B5F38 7KARKOTETTAVA
913,026,493 *5F0F784A8F5E3795A8CE6AFF250B177EC16E3AA8 arianemarilyn
913,026,494 *5F0343F44946CF80A2B656AF390307E7EF2680F1 ARLEN.SANGSTER
913,026,495 *5F0CFF7F1D43DB50C1D2EFFE70FBA17A506C30D4 AR!M+
913,026,496 *5F08C6F9D49A55AE755175D0A96EDACBFFE68B88 7OVERHEERSERS
913,026,497 *5F06FECEA319781D3B95E3B8FB5F4D8C180ADFCA 7RESECASEN
913,026,498 *5F053E943D3EF333B4796561D722D33B25040701 artimelh4
913,026,499 *5F0406EDD5F53AA158E7F51CD1722266C6FEC1EC asarutoraifuru
913,026,500 *5F0EB646283085CD2543589F0C1FF1C5437C4FE2 ASF#
913,026,501 *5F02FF930C1448803068A60F7BA77CFD38BF3AA4 7WOHLUEBERLEGTERER
913,026,502 *5F051DBA41DA4FC854D67B13706CB56B03CCB117 ~=7y
913,026,503 *5F0D22DB0411983A71A03D2645AED30526DD5177 askpq
913,026,504 *5F0044FF699EDD0B0C99150E3CA49937E7412A08 asze?
913,026,505 *5F09C5CC01FC3B3CB1CA2AACC988069591C8BCA3 ATF
913,026,506 *5F08A6647D4E3DD16B28FABE85322FFE8B6E52D4 8BRQSQKRMOR
913,026,507 *5F068BD530D263D05578E5C4184F440B7E3A2406 #8cat
913,026,508 *5F0AC7500B83F7E135ECF9E49DAE478F345D6917 8EMPHASISATIONS
913,026,509 *5F040202A74346AF25FF16B684A76A6F46DF618A AUD;
913,026,510 *5F001119CBA717BF8B3EC7998452519C826E9E18 AUSTINHOUK
913,026,511 *5F09C44A2F7FF12F0398208C6AB5555D38855F6D avcb
913,026,512 *5F0FE7ECAE6EA9DB6B15AC502F633C5DF6F963F1 8SNEGNOJSPEEHCS
913,026,513 *5F07A3A0044B8FCC8DBF4EF2FFD6132D668258FE A&WFH
913,026,514 *5F0D6E841CA6F328252757233A9900E15AD68361 awku"
913,026,515 *5F074D72DCD3C45C002D886B8A7156CA059DA7B2 AYANFALUJ
913,026,516 *5F071211F84FFFC8DEB0946183E87FF772CC9FAA 8YVONNEMARK
913,026,517 *5F0D45F7601370C506A23AE17713E10A03686A23 azba+
913,026,518 *5F0CB3A9021385660A4EC505D03C079BD888737B 984513 TIETOKONEENTAIINTERNETISS
913,026,519 *5F0A5AB76368895C57481F70DDEF0EB488BB8920 b3o0
913,026,520 *5F00649625B1FB919DCF0BF100EE4672B3FB5E96 B4K4M30W
913,026,521 *5F0F4E175FCC318B9E9A9F2EE1E0E1294929A23F 9iluvmidnight9
913,026,522 *5F0BCA473B3BB117CA692908790840E39578FA60 [email protected]
913,026,523 *5F028D97042FB94242C4FCB90714A7E76C3A8402 bacrm
913,026,524 *5F007CAFDF8685217076E059A3731D8E06CF6148 9STEUERSIGNALE
913,026,525 *5F051779E410F4D7460CD13077219A274B84C444 BARSLENS8
913,026,526 *5F0ACF3103243E7B67047D05F766F68DB319DFA9 BART.DIDOMIZIO
913,026,527 *5F0060B35733936F0FB329E4EC4CA9A3F3DEFA4C 9ZOUTZAKKEN
913,026,528 *5F0739FD79875328DED1D5AFCB7059FCD8616B5E a:6$q
913,026,529 *5F03E0423B0F67192586E8C85C6B1296B75B3F43 BD!DK
913,026,530 *5F076ECAE9193C4F64E3F56D677A98B00B5FA279 BERECHNUNG
913,026,531 *5F0AB1A4AA256141223CEACAB982C7DF3CEC8EBC AAEBPS
913,026,532 *5F08318AC61EF01DF38DC9E5662C0F51A7CD4FFA aakq2
913,026,533 *5F052BCE1B59B50AC5F6F4F45E9B91404FC6E034 BF_TL
913,026,534 *5F0A4B120D14EBD9CE5BF7E19B64AE7F5AAE950D [email protected]@
913,026,535 *5F0AA2EF8CBD966A9C1A9FA1B832776D56209817 BITCHWILLIE
913,026,536 *5F0652D2754BB0463C47569C91EB2E927DF802DC BKVV"
913,026,537 *5F0B851C4B33E77AD13D6B797D05F29D292920FC BLAIR.SANGHEZ
913,026,538 *5F04AFCA94436034FB1434EF038E22BC56485EEF blais-whitney
913,026,539 *5F024F18400A826700624F5B307A91E4A098DE62 ADJZJ
913,026,540 *5F0C80993125B38E33A7D90E4DD88FBF95159192 adolphstoot
913,026,541 *5F0DC477F37D08784938C97E756CBEEA11263FBC adordotepui
913,026,542 *5F0844ED350B60775589EFFF7CE9FFB6953AFCB8 BM%T
913,026,543 *5F0FED191B20BF90486F24DC010A25E6C872809F BO7QT
913,026,544 *5F01963A95AFF3755F7A0924D0D5CDCABD26AD3C AG)6Q
913,026,545 *5F016C8BF68542DF42538F2A38BD4989527E4A4D BOYCE.MINNICK
913,026,546 *5F0FEF8492BCAC308B8C99EC1F8B14FE31A87C67 ahe
913,026,547 *5F0D3736796CE3FBCED75D271C0B12CCC59AAB41 bp5%2
913,026,548 *5F090D6F1FBF8F0106224BCA0D482EFF6D623362 AI&29
913,026,549 *5F0596CB0B1655481E88BE829E5387C2C0092893 branchiopodan
913,026,550 *5F0606A9CE5560D18E66FF8EBAAD0EF6C63162FC akita027
913,026,551 *5F00EF21822ECED1DB0DF79254AC906992F4C809 aksigren
913,026,552 *5F00F22420FADAC23576C92BDB15262C453CAEE2 ALBUM-TYPE
913,026,553 *5F019DDACC0928D81954A8F7FB236DE7A7A7254C BRUCE.MUSTAIN
913,026,554 *5F00E5C71D48733EDE85DB68BAE1617E0AFB7D8E ALICIA GRACIA
913,026,555 *5F03D4D0774863ADD2B91F93A99C2A2B5A860F8F bs+d6
913,026,556 *5F0E768D66EE800EE6CC9A6E15049F8255F49F77 ALPHONSEALTERMAN
913,026,557 *5F019540E6915F598296E15F0CA0C16B467EEB51 buckcahn
913,026,558 *5F08ED2C91083BE4F739C1D3B1412E75C78EDB99 BUFORDTES
913,026,559 *5F0FE865A4815119248D74ED6FA9A0E626434A1B ALVA.MENDIETA
913,026,560 *5F076D838EB503FEE4676BD30741BAB459DED112 ALVERBIALES
913,026,561 *5F072D30DB5F0F12DAFE9834AA710AF11C512730 amaanii7
913,026,562 *5F06F5C46C8F025C5A5DCBB27FC94DF1995FECC4 burtonmainord
913,026,563 *5F023FFB74603CAA283C1D47C20A729E6EE97EC0 AMBERWILLOW
913,026,564 *5F06870CCDBB94F0C1E633F8149D6631D6D90F7F b$vc/
913,026,565 *5F0FE810A2B0502D817F81F7B9ECAA5602EA4F7A bvkg
913,026,566 *5F06ECFE4A7CE48BE91B8F54A65019F6706662AD amol7
913,026,567 *5F0E25F995E6CDC983ADED5D7097CC6152961C84 BvX
913,026,568 *5F0324EAF295BE858CE76EA8D25B874A9904D64E by-tim-clark-june-8,-1998,-1:00-pm-pt</p>
913,026,569 *5F048EDC46C3DEEB1757C60EA330EF77136BEC45 andthenidreamtofyes
913,026,570 *5F0160F5CA2D2C9FA5DC09C3E35CB6314DADE7FD C0NVERS4T0N4L
913,026,571 *5F0DCBA9209BC80D3C3355DF7E52DEF733F6ECB8 ANIGZ
913,026,572 *5F025054415367FE2215E5D1206F1436A7C15881 c4tchp0ll
913,026,573 *5F0BB0558282F86F888BE44069A79A93807B47B1 C8F0FF09CC67A80C2155299B3824235D ANGGA_SI_UNAIR
913,026,574 *5F0640F6F3329C2DFD14FC2168F3D714C1A9D96C c9u8+
913,026,575 *5F0171075F20229173EDCF1C727A54E2E9C896EE ca7abo1!$m
913,026,576 *5F0E70BCD458E36A3520AD081E8EA52616E1A049 [email protected]
913,026,577 *5F00503DA34AC3672151DF260CADBA530E1D8B48 caimb
913,026,578 *5F04BC19B36C172F49E955F11EB45FE410CBDB86 CAMERONSCHUEPFER
913,026,579 *5F07BDF6880EF646D522A86C1BF3A4272DA598BD `CANELA
913,026,580 *5F0F03D63DD50714892FEFA4E086E08FED1D211A A,PFI
913,026,581 *5F02B2F64D9E352C6771D3921A0227AB0F9A922E apuryhmi9
913,026,582 *5F0257A6324C3F22263336DA2775326F516F1E59 AQ#OC
913,026,583 *5F0772A77A2628D2C2B0099B60531811B47655B9 archiveeclipseorgarchive
913,026,584 *5F0E3AA5B08A0CA8845BD626B826B38B2FA5AF00 arjej
913,026,585 *5F038F849EE06AE07E958B653300A7BAD967A048 arnoldopennig
913,026,586 *5F0CC52E2D883B21B7BBB468D5E2A5882FD0F791 arnoldvillarta
913,026,587 *5F00575073F896A4853C1B4E7A4041F1A2741C1A ARON DICKERSON
913,026,588 *5F0C43D33601CCFB2025492ED608C3EF4E2804B7 ccv$?
913,026,589 *5F0BFFD0619D17C9D37A975000FE421DA2E1C821 ARROHMANIYAH
913,026,590 *5F0033C9269B5235023032D605B146E620B32E1C ARTHROBOT
913,026,591 *5F09866169036AFD979278C1F653AD981ECE7D53 ARTLATZ
913,026,592 *5F04997004B1C4AA84CCD60A917FD2CD84E0FBA6 ARTURO.LAPOLLA
913,026,593 *5F0AF3289B90264C98BE006CEA43115A9EFF01A7 cdonv
913,026,594 *5F0DF771FA9DA2D71FC0AD1588C9D222F88DBB04 ASHANTI-FARMER
913,026,595 *5F0773CC993748664A23AF812C58C4E5A247604B CELICAEDWARD
913,026,596 *5F0732157B3E44401A77248B574191AC3CF05268 cfjdougie
913,026,597 *5F07A9A344D056900EEB685E66AD9D3F022B13C6 CF/P
913,026,598 *5F055D93ACB3717A64FFB64DC7348F9EBFDFCBF3 c#g30
913,026,599 *5F065CFA1FED22C31C37C7D3B3F3D8C775912A16 ATAMOXYM1
913,026,600 *5F0DC40CD8E7C3BA32C7E6E6596A16C98AE3CCEC CGDDX
913,026,601 *5F0DB2DC542B7926A4D5B0DDC3F2A0E7BD22668A chad.candelari
913,026,602 *5F0B39413308D8DEE2FED245CFB7020FFF137186 CHAD.MAYTORENA
913,026,603 *5F055108831B8DE69DDAA3EADA5622BD5D280B33 CHANGEMERANDOM
913,026,604 *5F043F128E5451E3E889C807A2DF3B3033B52387 CHASEGOW
913,026,605 *5F0F3585991DD43BEFA116A15725721515933314 CHASSIC
913,026,606 *5F0806304CE0049BDA6238EFDA6748FFA89A67FC AVAREMUNES
913,026,607 *5F07CACDA031FA87B113BCCDFE003E571AD73251 CHESTER.BOWARD
913,026,608 *5F068F4E291B24C2CA8C67FB93B90B683FE83F88 AVC4D
913,026,609 *5F055FE0DF0AA47E6132D900A8B52D90247D3265 C+-HL
913,026,610 *5F0E9B81E034708F1B06B829AC0983C52442F41F awal&
913,026,611 *5F0C83E7C3C0A1D2A88F9CCEE5C71830C6A5C1B6 aw.q3
913,026,612 *5F07FFB6562ED89B3012925B4F9D2999620B83DE chris-navalta
913,026,613 *5F08EFC0A1C471EA8CF74BBA71846B116D7C58CB CHRISTENHELLER
913,026,614 *5F0D6276ABB8AD168398A263C78A52CFDD81DC0E CHRISTINEBRELAND
913,026,615 *5F0F195BB52DD274B5430B2C10EBA89933B3A35D chtt3r1ng5
913,026,616 *5F05EF86B734B36DAF3720E57727FBB495F9ABC2 B27WB
913,026,617 *5F0E667E9D18EBDF8FB9505637D7057E518C46F1 [email protected]
913,026,618 *5F07DAFD1C4016B5DD187307E0BC36F685272E83 c'kh
913,026,619 *5F0A505BA467765515B0DA4832DDE147841A8222 CKQ!3
913,026,620 *5F06E4AECEB31253FDB82BD1E51356A8882E7B5F class-lottery
913,026,621 *5F0189AC70B444219F20632F5A8541C51D1652FE [email protected]
913,026,622 *5F0A79108673C3446DEF1F4210FEF178BF958920 CLETUSSAGUIL
913,026,623 *5F0D5F9277DA7355793338E5D5C115231013D4E3 b,?9o
913,026,624 *5F01D45E275FB9EFA1810AD5E1D339C44A880BAD BaB
913,026,625 *5F04166C0E23EF47D4A0CFEBD2CA27337071FF2E [email protected]
913,026,626 *5F0E9795E85E6751DEE747F838335F58988A2B10 [email protected]
913,026,627 *5F0526A245D5AA2E01CC59D679CE4C795FDF2BA4 B;ANP
913,026,628 *5F0BD9A92C5648EC3BE50BE6BDB654D407850AC4 COEO1
913,026,629 *5F0AA800235C0D67F19CC3C533E4BA217226767F BAŚJI
913,026,630 *5F004C51DD922CF94D0F5CAD84BC659DF7D750D7 BBC=K
913,026,631 *5F025FA351F52685D5B76DCBBBCCA128F1D8D1AE CONDITOR4
913,026,632 *5F05B9E760F73E5EE790F7A48DA47A71B7F8E258 conradbrumann
913,026,633 *5F0A73EF1B4D849863A6631C7E78FA066231320A [email protected]
913,026,634 *5F098964FC3AA070AF4F364400C2003687A458A6 Bdw_
913,026,635 *5F0D80A1C91278B463F24D4C33C14D4BE566F3A4 BEARGOLF9
913,026,636 *5F08ABD88FD13C02B1FDD46BFF7E164FF15189CF beaudeboe
913,026,637 *5F0A0F215F8C46C02840B8A52D132FDA4955F290 courtney.evans
913,026,638 *5F0DA8D493307D54618361AD058EC90D86F6A53C COY.CARRARA
913,026,639 *5F03D062E0D8202617EBDB524936A9D32F43826C [email protected]
913,026,640 *5F0B4D8CD2C882E2A154DDC6EBE45D57AEE16D73 CRANTANT5
913,026,641 *5F074BFA35C0AA4C81AE0C0C7A694B7C5D6B2F00 CRITTUR
913,026,642 *5F00AFAC1F6A69B5FAED472C6D9C8769DFC18A78 BFD/I
913,026,643 *5F072CF381AED74AE6E0D9B40552DEB225AE2889 curtain-dam
913,026,644 *5F080739DF384BC12F7AC3235FFBC1AC08871D08 [email protected]
913,026,645 *5F0A3EDCE66544E253166BA9837863EA55CBDEC3 CVPL$
913,026,646 *5F04DBADF16B1153158A534E210D6177308D20BB [email protected]
913,026,647 *5F0116B5852BD21AC03969509F85FB1D70B1C04E c+wl;
913,026,648 *5F01DFDE6270B33B3A63EE3E004444121DD28361 BKENDGRI
913,026,649 *5F0FC384104738AEB61168BC6D216A161A2A8499 CXVLRFEL70
913,026,650 *5F0D397C05CCE4DF269343E7525494540A12391E d1spu+4b1l1+y
913,026,651 *5F0E06C5ECDFB4DB454E716D757D6FA03C9088F3 D(4g
913,026,652 *5F0E8216DC7EFC9575EAC60AFC4DD11F91E3F597 bo6m
913,026,653 *5F0880FBFBF00AED85CBDEC22FEB792CA7D4514E BOI30
913,026,654 *5F07E9DBA0FAAD61B3A2887DA7A4BEE988C74228 da6ea
913,026,655 *5F0909F2ACF8DE3676EF86C5A3D3CF89BFCC53B1 BOUFFONNE
913,026,656 *5F0114C46280F225B6F6F373BF5235CD8CFCBF32 damonlangolf
913,026,657 *5F0DDB537FF28DBB44E49FB03FD2DF6382FFD3E8 DAMREYTYPHOON
913,026,658 *5F06DE16E4471DCFEAD2008B273CAC2CF02BE001 dandelagol
913,026,659 *5F0D982B1E72594861E06CBA3B0FA517399EC5FC danselden
913,026,660 *5F09356864EB9EF1AD1E97DAFD6E98E9EE20E9D6 DARIO.DICAPRIO
913,026,661 *5F0011C0F080BF247A50B6CA9CEC297DA6BF9806 B-----P ~ `SPLAT!
913,026,662 *5F0190AF4DB9BBD16C434F70F24D90937E1AC500 darronkamemoto
913,026,663 *5F0D377BBEEF8E42E57C368526173BC3DAD86E18 DARRONMERTES
913,026,664 *5F07EB7C8C6557AF613B04361F0980E00BE5FA1A DARRON.THALLER
913,026,665 *5F0353296CB2B6E3F3537C45F65C16E5BDFCF65F dart-
913,026,666 *5F0671F77B7A9388D9D5B6CC52FAC6CC94408F01 DATE20050717
913,026,667 *5F0FB4F374EBC58A0A04F2C8C83A9305E7752D35 br56j
913,026,668 *5F0543E17C6AA053F0DE88ECD5BE2387E155AEA6 bradleylamberton
913,026,669 *5F07334CBBD027CCB2147D89FA93FFB9CCBAE12B DAYNAVOGT
913,026,670 *5F0ACF6A58EDBFF8BC897714306C43FBFFF7B58D bradyterzian
913,026,671 *5F08D50421E05782862AD9BA0A88E32C397EAA7B BRANDY COPENHAVER
913,026,672 *5F04658A0BFA77BC0ED88BCF989094E5A0A3C57E [email protected]
913,026,673 *5F082F81E8AAD22A6AEC314B70D22295DFCCA242 dd#gg
913,026,674 *5F0ECCDD2E7C50DF804BE99F47B3570D0030BBF5 [email protected]
913,026,675 *5F0FAE1E7483417A6FABC17ACA1B7C3841CA8406 DEANDREMOURE
913,026,676 *5F065CD4FD4E390D20694174A63A8CA0BBA5E5ED brucelunch
913,026,677 *5F0578BB01F3ADCC0CC9EE9CB027DF50E4064E18 BRUCE.STUCHLIK
913,026,678 *5F0FC2D1901C47AD69DC6DBE4570DF224C047DAE [email protected][email protected]+ed
913,026,679 *5F09ECF2B3F271CAE7571D2BBA7598A35F864F15 bs+d6
913,026,680 *5F096E0D5D7655798F65B3E3F821522A45B4D0F6 derivavos8
913,026,681 *5F0FEDECC037681410734A5A2FAFD7DBACF1E933 DERRICKFELTS
913,026,682 *5F0863DC6F59AA7747547B156884D823E21DFB6A desenflees
913,026,683 *5F02A485C2788B0C42DA858E35959C8A3C6484A2 buddylee09
913,026,684 *5F0245CEE81D3026EB834AE7D3364E1BACACE246 devotionmeasuresstrenght
913,026,685 *5F0B813B45BEBC8BA768BE59046383A4ACDFB72D burn-down-the-pleasure
913,026,686 *5F021D08C1E4A7AA4B5C1440D5DAD9D0A955D4E7 bvkg
913,026,687 *5F02DCFE2FCE968A1C63807DF234A27D570B5D49 d_he
913,026,688 *5F007DEF1B95F1082BC0CC94B49755DCF8E58A9D BYZFQJJED
913,026,689 *5F0EBE4E26E71A26FE9277DEE1B5222FFFCFB840 c0b"m
913,026,690 *5F0436B45CD6406C3BB07BC1DF81C29950F2D9BA dilgb
913,026,691 *5F04065C9FE236805C633057303BE2DC183D0164 dionblaster
913,026,692 *5F0EA631E83F4CBA5802317167D60BE1BE15CB59 c4chh
913,026,693 *5F09AD321D2C2B853911339D1410D9F1B940C494 c4ymk
913,026,694 *5F04CBEE72256A55E5E7EE840DA1144AC9786394 c_,"5
913,026,695 *5F0D720DEEB7CA539048072F4B311A188C955FC5 DJ;SG
913,026,696 *5F03F21097A606A1501A2FBB8A8E644A61BDF588 C7nF
913,026,697 *5F0BD6FD6DC175A72F22E81E36C16280BE44853F C9&MW
913,026,698 *5F09A3B45DD372AD1508BC8ACC522D9CD053B906 caimb
913,026,699 *5F075BCB70B21D514488FE52E1B82BC089BEB204 DOC1L1+13S
913,026,700 *5F0B82F2D2D9931A8C95E60C668B27E9C9C6FFA3 do.i.dare.to.fall.in.love
913,026,701 *5F053417CC036BB7F01DEA48A022D62431C10CCF domingomacknight
913,026,702 *5F0771AC755271BEC71BDF29D091093A8E3A3956 [email protected]
913,026,703 *5F06AF7A34BDF1CD541DBA243976C438F06BB59A CARLE-DAVID-TOLME-RUNGE
913,026,704 *5F0D44A5942BE159D2C5743925CF43F4DDA602B1 CARMELOBUMGARNER
913,026,705 *5F0C989465311DFB8BD1DD7E448B405138114947 Don'tSleepWiththeLightOn
913,026,706 *5F083A1A398C0B202B954F4671175E8974E60747 CATEDRALDENOTREDAMEDEPARIS
913,026,707 *5F0DDC3E40FD7CEEE4732AB6CC248714F0B1F031 CAZZO2000
913,026,708 *5F076A7740A1D475DC606C00894BC0BBF0190494 CBAQ/
913,026,709 *5F04404292893500DF6DF080DA96602518B7E9F5 d.r/a
913,026,710 *5F0D5AD3FEF7EDAAE50512621DA04FDFAD2CD4A2 [email protected]
913,026,711 *5F077386EBE3BF0786881DAF5E57E74059335891 DRFJI
913,026,712 *5F044FA17AA44AE07422DD864770A348B6D21C3E [email protected]+on
913,026,713 *5F0B724CAEDAB08F421DCF9FF7C1ED0B99A3C0D7 cecilrigdon
913,026,714 *5F0D0B9A7DCB0690FC48EDCA4BE8A8AD1879BF67 CEJQC
913,026,715 *5F084B790A1B7E5A9EC7E9C072D7839794A5A34A DUCKTAIL
913,026,716 *5F011EEAD90382BBC526485E2C2A1BD75A36FF9A [email protected]
913,026,717 *5F0AC618795D18F3EBC5053308E499B779BF8CFA dvadesetšestogodišnji
913,026,718 *5F0659A3245643FA4C7AC0B3A5EDEF1B8F3AA295 CHAETO
913,026,719 *5F09F5CFD750A4439D759AB22764067C6C4C3C1E dwkb;
913,026,720 *5F0E26AEADE38D9B32A0A6CA29D30067BB5DDE71 CHASFEBBO
913,026,721 *5F061C48F2BBFB3BA6192E2457778E5426C19058 [email protected]
913,026,722 *5F08F7612A23AD3D35A3E5B3A720B6754F17DC1D dylan.van.zyl
913,026,723 *5F0D2F86EBD93FD25CB4B60429A45E9B841CA9FD [email protected]
913,026,724 *5F0C7A181CD01BB17C2D55BCA149F97E5FC9C869 DŻUNGLA–OSIEDLA–LUDZIE
913,026,725 *5F0F96AD04A2A5F70D34035A7DF640887B0955CE dzv:
913,026,726 *5F020B3D94AAFA7E64DEC4137AEC705AAACD9FED E1308940731
913,026,727 *5F044C7C70F5792772551997AE64ACF2F9805371 EARL.FALLEY
913,026,728 *5F037B1148F3EC4ED9397A3CD1808576A5F4E0E5 chk-o
913,026,729 *5F09F359DA27AFF0D77E1F14877999D0CD26CEDB eb_%9
913,026,730 *5F0F615DF5BAA4A4CEB3FB3C3361E91D8CCD9B6A EBADI1234
913,026,731 *5F0294718ECD69AE85666CEA526AB6F442180327 chmt
913,026,732 *5F037D0566A02D3E079FD2B16D01846569EBB464 CHRISTOPHERFAGER
913,026,733 *5F034E54486970907B89680B0CD1AE78BDADEA05 EDISON.MOIR
913,026,734 *5F0B8D2F66360E8B283E9ABBF8E87E58F3CB5A52 CHRONOGRAMME.
913,026,735 *5F08A3DD8A9A7E25F730CCAAE0BB8335EDEBF23B edpb=
913,026,736 *5F0E9C370102BA7A4E739697A499E9EA002A0A5E E&E*
913,026,737 *5F055DC44E9528428777DC3E611BAC23D44B55BB ehsw_
913,026,738 *5F0DAF891F724A74D5625C2D9BD28B92015C1881 ei"$!
913,026,739 *5F08D8C3D4DA30E800A1C8347EDC07CC7D6AF741 eia5h
913,026,740 *5F054F1D01032003BC453FAF7C7CF6F77F586FDD cjjnc
913,026,741 *5F070375E706AC486A3C628AAD6C10366AF1CB82 [email protected]
913,026,742 *5F0DF8AB939CCD32EA6A9D0E33DF95E6D1199F76 C%K5
913,026,743 *5F02642302F5DA977CA44FA47B83782D68D0C5AB CK,PK
913,026,744 *5F02D6E4FA5F1A8D0660E065320BF37588C5B77B el%.3
913,026,745 *5F0D961D897889A2702E560FFB9EA7FCCA6B2078 ELDENQUINTON
913,026,746 *5F0D11C4EC4947E4AB9FE89611825FA69426219D clayfigurine
913,026,747 *5F079BC772CFF83C927D54CB611E17D942DBEDD4 elibissap2
913,026,748 *5F07732B11B00D3D4C657EAF25D2091985975EDB elisegurney
913,026,749 *5F037199B7D870C357036B1426195B836AB23E24 CLEOLUBELL
913,026,750 *5F0BA3304C3C3D528B4CF0E13058E8B32252DFDE ELLEN-TEN-DAMME
913,026,751 *5F0F41A417358782D72D66EF124B6C4A21E0C9C6 elliottsewester
913,026,752 *5F0369ADCC2F81B832AE51154C8330236E6DCB7E [email protected]
913,026,753 *5F0E0247DE1B0764574439E4288C890C60E1F3DF CLINT.MATTHEIS
913,026,754 *5F011479431244B36E259DD2744FB40BFDD4185C elmigdad0
913,026,755 *5F09E5C29CC279AF46069436868C51BD49ECF2DF CL)NK
913,026,756 *5F0A07B8BD31C1A9F86B8B7920B2F579087D9CF6 clw0-
913,026,757 *5F02602EE88997E031574AAAC628368566C1B571 CMQ:G
913,026,758 *5F001BEEC0C14E5BF6434831C5DC98579C9CAD3C %.&($ CN
913,026,759 *5F06D267443A6392B42F05B5C788AFD59A170BB5 ENFRAI8
913,026,760 *5F0ED159D8FFC822E6BA27F5F905100717FAE5EC collectivistically7
913,026,761 *5F02134229DC9CD6B0086EDFE65FC46C67393310 epadx
913,026,762 *5F0980130445E647B5B2BC26201EEADC874B9C30 EPLATREZ1
913,026,763 *5F0F821EA795E7FCAC370A0122A1859A1F3F4A12 concerto in c minor, rv 480 i. allegro
913,026,764 *5F0EDE2965339DF558A7E796A359BEDF63FB187C connor175
913,026,765 *5F0FEC3E47608E93C01B142E3CE9513B23B809E3 CONOR.NEVILLE
913,026,766 *5F076D742EF8F3E0C328CB0383D8AB3B1EBFC4E8 ERHEBE7
913,026,767 *5F023516EB8AA254CDB8A8AADF4433C77A1030C8 [email protected]
913,026,768 *5F086CE5A4DFC1D0596837B1F7DB7B53249E2E7F CORTEZ.KRAHN
913,026,769 *5F088E0311B2C6A772D72897888FA09E725A42E6 CORY.SCHY
913,026,770 *5F0FDDAD70C7C076AA5BDF377998A283EC8AC9C5 ERWIN.SCHELLERMANN
913,026,771 *5F06B6929D8B9F4A80D0BD4C20A7B3178A2D9664 c)o)s
913,026,772 *5F0DF7F6E0CFE725C4750CF0B20B86DBE04DCECB ESIVR
913,026,773 *5F0DF5F2A06F37788FACCD78ECF2AF2E96A90680 ESTEFANIA88
913,026,774 *5F08524D8BBD14E7487BC24F0992FF597FB050CD C:\Program.Files\Common.Files\Adobe\Help\en_US\Photoshop\11.0\images\P_Gradient_Lg_N.png
913,026,775 *5F0A11DD4EDE6126431F903B94872C716808CCFF ETIMITNI3
913,026,776 *5F0C95217FAD82EDBBA493E49D447478FA0F4F35 ETM:B
913,026,777 *5F01E139054FD6B6AD4BF2822C7A8138F485B950 [email protected]
913,026,778 *5F09D7FEF2B986379E801282448B084B8683C021 cq(6#
913,026,779 *5F0DCDFD8849CE090700FA15F7831D2F33216EE8 [email protected]
913,026,780 *5F06832F9B8A9675DE3B090CA9ED4D772288978B EVAN.MOCERI
913,026,781 *5F0149F7CB06862800A6B41AF1420920F72B7F23 CR9V
913,026,782 *5F0388D9700952D0A9DA54597D85AB483A033D4C F33B13MND3D
913,026,783 *5F03F6B37621B0EE40949ED640D318A3BC46C439 csiga2000
913,026,784 *5F0EDC85E04BE128D96C7E776C8F9B67DD562D0F cthomas8
913,026,785 *5F0ECE7B1256B0AFB6E52FDDA98667C6CE88085F [email protected]
913,026,786 *5F095768E4C97B242BA4C1A24D743E25859EB4FE FENACETINEI
913,026,787 *5F06408BE5A3A681B6DE4CFA5D18D9BC8D2774B6 cuminol.
913,026,788 *5F082AEBAF5397F773D5ACD8DCFC5CFC5D9ABE7A CURTISSCHELLIN
913,026,789 *5F0E1FB85AC1542A96292585CDFDE68012BB4BFF festsaugen
913,026,790 *5F0B3123108DFB8DA2DF56998C24A87BB8430AD8 CXGOP
913,026,791 *5F07AB197B87400960ED43C00EDB2A45B598C374 flangedsword
913,026,792 *5F0EEA0F4AF9EF8A2FD0DC1766BCA7901DC42494 florentinochio
913,026,793 *5F0AAEB5106110E1057C186B0035CE573EB2337C flowery-necked
913,026,794 *5F0957FC66D692F861ED81F87439B43F25F01593 D129517
913,026,795 *5F0660E51034E6881501FF1A14D9D3A2CAD21002 d1mj
913,026,796 *5F0E3054E3FE9AAE69086A2210018B6DB3D80C42 förslövs
913,026,797 *5F09303389919FE5AF29621EEFFF641A153D3077 FRANCHA4
913,026,798 *5F0D2CA4C08787748D951E3CA170946B9D5A49AE FRANKIE.MARGOT
913,026,799 *5F08DA6B1D016FB41D85CB467A554FD123F0C17D d5qwa
913,026,800 *5F05C8D5B0451B52184D9344C59102671695822B D7M8Z
913,026,801 *5F07D2795024E26B66CC4100F49DD3569BF5F5C0 d-8w1
913,026,802 *5F00FC7F5F40EA68FF83393DFD2640D09B33FD68 DACHAMOGHAOIL:AMBODACH'SANDITHISAMADAN
913,026,803 *5F016D8D66E0093367488C4A8CB2E7C70962CB16 DéCIMO
913,026,804 *5F051BF3B7790F5A32B60673887BC28B83B911BE FSHRGRL6
913,026,805 *5F037B734C3FFC6571A0D77CB5664B27B3B28C46 FUGACES5
913,026,806 *5F00185D8D50CA3919AB8ACBA1777E10E2D97033 funktiossa
913,026,807 *5F0CA0702C1FEDAAEA1351E673EE3B9D557F034A FUTRONO.SVG
913,026,808 *5F03F9388ED10DD5BC2C8E7F5C7AC5A66128DE78 FWIETOR
913,026,809 *5F0B2CD8AE31B73865FEC7C2ED6A2716D08BD7E5 DAMION.LOHMEIER
913,026,810 *5F0C453A088098EBECF6F636222A189FA261B902 gabrielle
913,026,811 *5F0C01AE3834D6A0A3D2288F8026AF8CDB9B5043 GARY.DOWNING
913,026,812 *5F030BBDA087CD22B54986C40C4563465857243F garyspiroff
913,026,813 *5F00B0F6C24E53C9FC62A9D09BBA63AF9DA733FF gaylebienvenu
913,026,814 *5F02535B16E4F27B94435F72A5C996F739BFF0EB GBI-FM
913,026,815 *5F0E36C5D8C1F7AFF7C4DAFA778CC70246F3266F gedunsener
913,026,816 *5F06AF96A69DB21ADC1BE0BD21D42EB4DB03F387 DAVIS.DEMASTERS
913,026,817 *5F0B7107B03D3DAB673770C115010296E901DAF6 GEOFFREY.DILLAMAN
913,026,818 *5F01C2429DB27118C2AE782DF2E7AAA940B82B42 D;B!!
913,026,819 *5F08C669826D1E87E7BFB093B53F2A3E51EE9A40 GIGOGLGL
913,026,820 *5F0B458B36EDE7AC3CA54315EF91EA979EE00DB1 GINOEWENS
913,026,821 *5F044175CEB14D26C74DAA7F04D468318BBA5F2F GIVE-DUB-(JUNIOR-CONY-MEETS-A
913,026,822 *5F0A21530F06F58364D1731294107B6D99F318CF DEADWHORE
913,026,823 *5F085561D539B4F2D15B64110F26D7DE3040035D deanherzberg
913,026,824 *5F0C53C2C2F7F81DFCC514C00C4CFBEDBA57671B [email protected][email protected]+ed
913,026,825 *5F0289FF94AB9A343B7926404417C45BB833A60F GOBLUEASPEN
913,026,826 *5F0BCCEFC325470C1ADC3E0E86E412435C9432AF GPQYAA
913,026,827 *5F0C858E721B2C49A10A62FC669FDAFA324569BE GRAEME-ARNOTT
913,026,828 *5F09D2EED8838C390DE0D2E6819C53ED6342CB95 GRANTHUBBS
913,026,829 *5F06734E7BDF246EBC53DA9FAE67B5B5AD0FE931 dennisdease
913,026,830 *5F09DB22BF01847B2922F32E868D348B6933D98D GREATIYK
913,026,831 *5F0C65E9EC085CF851240A4F72F91170AD76FE13 desenflees
913,026,832 *5F01529AA22DD3AAD29E72175AA36EC77367627A DESIMINASE
913,026,833 *5F00D461BA2409AE808C100F0966FCBA8A794569 GUĀNHUÀ
913,026,834 *5F0F1123FC6A3C8F37CA284AEE4473111399FF74 df9q_
913,026,835 *5F0E497A7C4A2D36F0BBE8E2A2A5CCC443D4C3B5 dg"lt
913,026,836 *5F0873375367B6D46D2235ACF57C0FCF14CBC6E3 DGOH1
913,026,837 *5F047F93B15FE409DA14AE25BBDEE0553422FBDC DIFFERENCESTONYTHET
913,026,838 *5F0ABB9BECD425D3674B7066B6DC39BFFD9072D9 HAROLD.CAHALL
913,026,839 *5F025122E234BC7C444E4A3D99E3869FD3608B48 DI;H
913,026,840 *5F043CA894A8A89A9EB8317F49855F5E04DB2905 harryalee
913,026,841 *5F0DA9699ABACF4C5E074531115710FA78FC829A dil;d
913,026,842 *5F05A618B54B0F34DBC6419B53EAD4B6E7CAEC11 hawkins-smith
913,026,843 *5F04155346D335AA4B4062738467BC865F8E6960 dirbyhyl1
913,026,844 *5F05A453ACDF97D71D7BEBDBF20DE6F5AD8ADA10 DISCOVERY
913,026,845 *5F050433EBC90379703C15447572FF047643F85B HEDENTINOS
913,026,846 *5F0D875137FB5035522AAB62DB6140808A42CA24 DK7G3
913,026,847 *5F0944FB5D30FBE8D883664A992F32D15B1EC085 HERMANSALAZER
913,026,848 *5F0FF2EA0560595E117ABF93B65E418E1EFCC05E hermanstolarik
913,026,849 *5F0CB4BDD84D39B27B0D9A728AF3D90F4908C777 dl2(q
913,026,850 *5F0273E5AE43502707EB09EF5FC382069EC07243 DMXAM
913,026,851 *5F084E9BF6E16D07C026A100E518E798923B3803 doggieamanda1
913,026,852 *5F093E09B78C3DA0C623314D2AFFD0D230EC5E26 HOKEYPOKEY
913,026,853 *5F012A24043C5A00A3E132E5D6ED89FAAA11674F DOMINATION(SHORTMIX)
913,026,854 *5F02064C2308E7A8815F3F35A428A5871B2C1A93 HOMERBERNSEN
913,026,855 *5F0E90FB8989A1908C9A4C6E28F636B8399F7991 dominickstrawn
913,026,856 *5F0D2E105E0923A6BCB2A99B050448FC793A4BEE DONALD-AUGUST
913,026,857 *5F02FFF76054847C429279F7BB2FDF2F82E268E7 DON GRAMMA (REMIX) (FEAT. DA ROTTONOUS BLAK TWANG & SEANIE T)
913,026,858 *5F08FDDCF0A555876305C1D084E812D61432E390 HOTTINGROOVE(DIGITALLYSTONEDPEOPLEMIX)
913,026,859 *5F066B6AB17F8B868775FBA8E40C4E4E54245824 [email protected]
913,026,860 *5F07009851346F57F584B1AB4650138387B5D30F DOOFINIA
913,026,861 *5F0E4C6BB34D8606BD212EF0E963C4EA74299176 HSUKARUKED
913,026,862 *5F0024A0C762827E05FFBE03E696B7124DA7566B htasevarb
913,026,863 *5F0AA7E5AA109806AA93115ECC04D29D0A9F51FC DOUTTASTARSFOOTBALLCLUB
913,026,864 *5F06427BFE2F552397F7D7641176E26B15C063E1 HUIXTOTIN
913,026,865 *5F0811A1731C707F4A2C4713806BE9B3004CEBA4 HUMBERTO.SOLTERO
913,026,866 *5F0CF68E689EF9AFEFB2436CA505F5DAD69CAE71 HUMBUG6
913,026,867 *5F084693C06FC1C4217A844793758BE4E902D732 [email protected]
913,026,868 *5F06FAE60211FAAD00D818E83A04BA8DBA4BDFFD I26091704
913,026,869 *5F0F37D3B0EDC7C49CE38FA539E2D869B26AE387 DRIQS
913,026,870 *5F02AA37D2141934ABBEF3D83F83882703E7CD6C [email protected]
913,026,871 *5F001ABA0C6A835AD60F9F4BA627056D35D3F754 DUA
913,026,872 *5F060AAFD771F3234F38C4E98B4B85F2F7AAA5E1 DUDLEY.RUVO
913,026,873 *5F030FDC4AAFB1F30D21871322D9665E440774C8 ILOVETEAMO13
913,026,874 *5F07556C0DA5EEB9A35BB65835E5607E7B434C54 ILUVGASTON87
913,026,875 *5F0978D2D66ACACD910644E97999B32CE47E0159 D,(Z
913,026,876 *5F0B4A758FD45AF93CDAF614A0A57B0106A32363 ECKFRAGE2
913,026,877 *5F0F9FD9EB6E2AD3BAAE442DC5C43775BEC5D064 iss013e79892
913,026,878 *5F0004865B384282C42AF5C4BC4DEB8B2534997F eddiedunovant
913,026,879 *5F0C140181E2A3B3546F3FA05C821D9A04D47C75 ITAPIKURU
913,026,880 *5F0074A22836F62C4B19D9899E13F7F7E4186AB9 edgxsocnesrjae
913,026,881 *5F04949A2B6A3B1538997DAFB6E2C917910F524A EDLANOUE
913,026,882 *5F0962E95EB8FD6AF5915276B596B464EC3A4525 ivy-spray
913,026,883 *5F023715F36F54402F1EFC84D3580715216A2831 I.Wish.I.Had.Some.Money
913,026,884 *5F0C397F7808A57523FB08A983311A5B6FD6C862 EDVILLALOBOS
913,026,885 *5F005A48AFD433400B04DED8313B82E9DF7A29AD JACKSARAO
913,026,886 *5F0E7DA9FF2CB61F503177E59AE156F1B94EFFC0 EF7&
913,026,887 *5F07F5E57FE4E70E68E8A08E3DD6CC75D1A1B3F1 EK;U6
913,026,888 *5F09BC82FF8998785AE31D76A88B4E5AAA271A2B elena-dussaq
913,026,889 *5F05695C7A763E5A79282CACC20EE3E5347F94C5 JED.HUESTON
913,026,890 *5F0F8172E2BBDA98834289BDBF7D729EA6A70F56 ELLISHES8
913,026,891 *5F08E6249800A59DA8591234F57D0B9F1CA58562 jeffrey.windsor
913,026,892 *5F0384AB8B10419D58A6470DFB3EF6F55B0E731B ELOERUAL
913,026,893 *5F098B5E8D907048DEE5B6174BA89A4D766DDC61 ELWOODDALPHONSE
913,026,894 *5F05F69A1B563CFB7B1F6C7C0595D22FB0F56117 ELWOODGERACI
913,026,895 *5F008672479103435C6C4034E49DBDCE32946166 jeroldvankampen
913,026,896 *5F00BC9F3D391B75B4FD4074DF94C9631AFF78F9 jeromeasleson
913,026,897 *5F00432BD289F0E1B4875B8267E07C2C1429F350 J)@G
913,026,898 *5F08FF607728F17344457AD4D692F42BB2F6DC7E jimmymcgrotha
913,026,899 *5F079DDC3A2CA6763437B7CA17723ABA60196EB6 ENERVADOR9
913,026,900 *5F0DB06C8296AE0DF7B3C96679DE5CDAEF37C08B j_js
913,026,901 *5F0B881A0485C5479F23CEBABFD41E5B365F4178 JOANNE.ABRAMS
913,026,902 *5F0DC41C6E5004DD5B3AEEBCB42BE2276326237A JOEL.VERMILYEA
913,026,903 *5F07A564F374E0F48AAF3D50B488D427F575F896 EPPALKMU5
913,026,904 *5F008CCA7302742BE2F99A4C92527C6D07413F85 EPWFELEIS1
913,026,905 *5F0CAE778C054B7E58A6A2138A1BD599E79FEC66 John W Fountain
913,026,906 *5F0767FF2C8A1123AD2BC1B7F1A7FCDE4F458B87 JONAHANDWHALE
913,026,907 *5F079323082FEA7BBE7BE40AF2A8DD2C8457D283 ericktyree
913,026,908 *5F0B23FCA592D53231AAAAE0330498BD33DB19FA erictibay
913,026,909 *5F04F235187C9664D719DA4902A0027EDE887C40 espermaed
913,026,910 *5F05A1A36CD94840BE68F1AE76661D1203594679 ESTEBAN.GEORGOPOULOS
913,026,911 *5F06B9AC7BF1298A399BCA794941147FDB6AE083 JULIUSTHACKERAY
913,026,912 *5F0312BF04F2683D468E6C1EC3C91235F77D626C [email protected]
913,026,913 *5F0BFBC4A21FB289707A84987CA9B88BBC32FCDE eswmt
913,026,914 *5F0B0C5440C9EBB7B5D276ACE06DDA715F880F07 KALJAKELLUNNASSA
913,026,915 *5F0BDAD051A3F3B461E4D13488134F6678AF1151 EVERYBODY'SMISSINGTHESUN
913,026,916 *5F08E38079533896EF4EAE23C79C890481ACC2F7 KARIŞMIYOR
913,026,917 *5F0D0AE54A1FA1C8A08C96F0C158649CCCACA885 KARNEVALSARTIKELN
913,026,918 *5F0292B58BF55C44612DD3F9CB5C77CD4E5BE247 ezekielblume
913,026,919 *5F0E1CC0EF94D888ADC6BDDFBD230FAC10E4CD70 kati.watkins
913,026,920 *5F0D5356FDC15A670FB0A54C35F165E6B033582C EZRA.LICKTEIG
913,026,921 *5F04A4E72DA10A43185DB086E569A2BE27D14A99 F4MELE55
913,026,922 *5F0EAE16DE0664AE6B6BBBDCF6F0953C9028A142 KERIHICKS
913,026,923 *5F0246BBDC3E98F1F518157A5679D2E8D4AA6A32 fenlandns
913,026,924 *5F060445CFE49DC6E6792524D21942019AA74B81 KIKITORE1
913,026,925 *5F0347CA09E66FBC4089358C4D30D8D121992D2A kilojoulefree
913,026,926 *5F03248F26D399F6DA8883F53B05CE494F004173 KIMONOED6
913,026,927 *5F002DEF130BD6BFB1212892962F3BBA9B305229 FLERIER2
913,026,928 *5F002CCE3ED8DA8F2A3B3796E256A45230831091 FLOINGA5
913,026,929 *5F0A0F4B630BBAC2AACDDF52517821E4AF21A206 FLOYD.SALVADGE
913,026,930 *5F04E88BB4193348947D3413C0DE0E71D09D649C [email protected]
913,026,931 *5F07E3A9332370FDD011BA21060E92B802FC96F5 KRISTI-LE
913,026,932 *5F0FA96B4B0B3D41A38B738E81382508994C1E61 FOREIGNERS-IN-VZLA
913,026,933 *5F021F91A172C8D005A601DCD54A2403F2CED40D KRYSTALVANBUREN
913,026,934 *5F009E21BEF8544321C363AD96473EF18CB38297 KT?1
913,026,935 *5F0865C1E717EC6F51663AB91334EB719F3A1451 kvisute5
913,026,936 *5F01872D5794E3F1387C6076D05761146A8399FF k}x6
913,026,937 *5F050E9E02D27BAE3FE8874EB79C6C54A0BC030F l\8o
913,026,938 *5F0DA009CE85B9DD81F9FD6AC24F143766088455 frescos
913,026,939 *5F05B0D52F7B5A35A9EA16177DF3C32CD9A0F6C9 frontrams
913,026,940 *5F0488EA68FAE7D3AC99F192B99FFD1005484280 fvnd
913,026,941 *5F0AC8F4BD4DC8AC897B7F59855C6E47DABCFEA8 GAE8KOMVDQ
913,026,942 *5F00BFE16824B6C9BCECC0FBEC6CB5D5E738E121 GALENSOLOMEN
913,026,943 *5F0DC105F425582A3BC64C2872267F2F449B3E0F LAVABODA
913,026,944 *5F0C8EDBE3B94757E851D27D66232D223668121B LAVEREMMO8
913,026,945 *5F0C12AF9958A031C5B13FDF55FA1BDE93792F2E LCSGBML
913,026,946 *5F0CB636A7B78265A80A333FBA739178A1A94B6E garnetcracker
913,026,947 *5F0EBA20AA45B1671276978EB2FBB1809BF7F347 gayleable
913,026,948 *5F0285F8DB96F22FE308D10254F225E1B9F16893 gdcモバイルとシリアスゲームサミットのコンテント議長が、それぞれrob
913,026,949 *5F0E354A83B77E8FCCB7059301EF12D0DF79BFB1 GELYSETS
913,026,950 *5F0455FD8BF6C72124133E3AA7988E04EDB3B261 GEORGECENTANO
913,026,951 *5F0636B4F8AA5AC077D65379780C88782317897D georgehoe
913,026,952 *5F040C3D551A27CC98DCB85AF5A883CD1EE0851A levelheaded9
913,026,953 *5F0306E8E5BB1CBB073E3A54E749A83AC3BD5598 GETALLPARENTCATEGORIES
913,026,954 *5F0AB0C5E5FA58D93E7B16A087BC96E5445C60DD li./
913,026,955 *5F027FF4C760A966E4A501CE9A9F7126500992EB LICUDINE1
913,026,956 *5F09FD1C7E3E786E85ACD73176982981B86AA738 gimme-more-(gimme-a-short-mix)
913,026,957 *5F0F0FD9661610BA927DCEF258523F614DD73DAA LINDSEY.HAMBERG
913,026,958 *5F096A6DB5CD67EBCEEC3FD44CB7F47A6483AD50 GLEEPCKIT
913,026,959 *5F0019C69DD21AB6A47FC9FF8E54BD67617F406C glow-of-love
913,026,960 *5F0384F313D553BC6D601189A2F58BD5BD648E46 llafieb6
913,026,961 *5F0FDAA27FAF4C4D61F7E1667CB5CFF14EB08273 LLOYD.PARADOWSKI
913,026,962 *5F0C2816D618BD229C2CB7554CD1C93030B6E600 gooberdancer
913,026,963 *5F0F8610573C4C983A2A85A25D856D8BA0EF758C GOTTERDAEMMERUNG
913,026,964 *5F0EDFFF247A5EAA9172C8CE19A9A42CAB0439B5 [email protected]
913,026,965 *5F0414E00CBCA8257764512B1BFF92A7E4186E06 GRAHAM.ZELEK
913,026,966 *5F0A9541213016C21D4586F8D8BB63D8E6FA767F loodlood
913,026,967 *5F0DF5F2306BA483F19D05561FEA6F3BA3E287CD LO-UNA-ILUSI
913,026,968 *5F0122A17702264182CD3CA7745C62E64936C628 love feelings
913,026,969 *5F078C4A456055437A5E3A92A115BD9BD8CF228B LSD-SPECIALLSD-SCHL5
913,026,970 *5F08E820FB0151DDC243BB4A48DB9ABB95FF2E31 LUCIUSWALLOR
913,026,971 *5F054855B68FDE17CCE58EEC8D5A0FD65CC372A0 LUIGIHOPFER
913,026,972 *5F0DB4ACF4C135BAA0EC762E81C9B54165826E78 LUISA-GALLO
913,026,973 *5F09ACEEB649C19C1C284CF9636991FC06D90B50 guruprasad-cm
913,026,974 *5F0D0DF616D9A920314756AAAD564D456D378C5B LUKTURU
913,026,975 *5F0A398CDB490B74D56908076BC801471DAC67F6 [email protected]
913,026,976 *5F0B33DF7710F361E1D6432EF7998EE6F9DE4964 GYPSYCAT0
913,026,977 *5F071C1F2CACB19F4299BE7E9BBE58C46548D14C [email protected]
913,026,978 *5F01B22C5FBC809B6A6A07C2426FA9894ADCA3D1 m\\
913,026,979 *5F05B6DAA1ACE5D7A6B08597949456B46510DB7A m4lc0n5truct10n
913,026,980 *5F0C90466B375A9DD719DE8E91EB53881B57EF6F HANK.SWERDLOW
913,026,981 *5F03E86033A8F8F4294E4D59BE5FC9E81886E4DA [email protected]
913,026,982 *5F0DBC04D995B78172FE2224C492E0148CBC921E MAGDAS
913,026,983 *5F0C66EAF1E72B1D4DFC8FBAAC8D96914EF4A223 majorcatello
913,026,984 *5F0210ED1B6D50F1459544EFFF1695A732910E25 HARRISON.LEDFORD
913,026,985 *5F0391D30217BE0DF0FEC1595139249379645467 MALCOLMCIESZYNSKI
913,026,986 *5F04992C3C0B3B0F691E83A57E80441E9D1FD279 MALCOM.JEANS
913,026,987 *5F0DC9FCC23884ACF2C21DB8C229C0D47DBECE80 HARVEY.STEPHSON
913,026,988 *5F0ED640959004413760049B448A3FFED4D753A5 [email protected]
913,026,989 *5F00B3A65D6A72E96103728D5F3285835B99C738 hb%.
913,026,990 *5F07EACEA14CACBBB7C7DDC0D6371B1DA703A73D HEADFEATURINGHITOMIYAIDA)
913,026,991 *5F0702D5A0088039D207B98426C1FB284106E121 MARCIAMATT
913,026,992 *5F0DE87042438B78F9D855F7AF161824FF9ADD28 marcslayter
913,026,993 *5F07D4094BDB7253D7936E5EDC23BBE275DD7045 herbsecundo
913,026,994 *5F0CE43CC662371C1139E9035C4053BEF6476E19 HERIBERTOSPOTO
913,026,995 *5F096A92287E0027105857CC2B8514B1DA37CB98 «HERLAUG»
913,026,996 *5F069B8D603399C1AAEFDED911FBA6B6DF15E1EF MAR MARY
913,026,997 *5F039D94AFBA3EA7CEE23C3FBD4CF6B11B19A51A marshallheppler
913,026,998 *5F09CB95F52D8C652DED6F19CF3600785E539F5B MARSHALLJURASIN
913,026,999 *5F063F24660E636B66C433229D480DC367BDED7B MARTIN.LATIOLAIS
913,027,000 *5F0AF41BCFCF2E09B83B625B1C8ABE76A9B809BA HIMEKA12
913,027,001 *5F07990B2108B07BA6CEB57D446BBE6D7BB1CB24 HITTEKAR4
913,027,002 *5F013A401CD70984B0D26D8204A8D35D81B77B83 MATH122008
913,027,003 *5F04746C1E8039DA9EAFE2B5291E74EC1BA9C2AC [email protected]
913,027,004 *5F0C003E9594B87E26ED3511A2815D8266D9AFA3 mathewtela
913,027,005 *5F0E9236D2EC0802191597DE66D25704D5CC232E HOBERT.ELVIS
913,027,006 *5F0EC66235AA28FC9A1D800C2CAA977E494EDA1B MATTHEWLONJIN
913,027,007 *5F0A06B7A8AE81E0C890E4E933105303DD07CAA7 hoheischweiler
913,027,008 *5F0D4C0C61CD4A8B5302CF6DF519D0B7F52F3F2C MCGILLOWAY'S
913,027,009 *5F06FD028F24223B8628DAD5DFCA07DFECAC9EE1 [email protected]
913,027,010 *5F02698C97F1A6EDAAA35CD77A955C10AF67EB6D [email protected]
913,027,011 *5F0EECB01B6F4291FC23107A83FC623EA8C78933 MEIHUILIM
913,027,012 *5F019FA458D565E53B755BAA6FF9F7E66AB7082E HTTPWWW.SLU.EDUDEPAR
913,027,013 *5F05540F93F03CB8423C8DB8AC068B5D13719821 httrwwwpagetournar
913,027,014 *5F025A50F58BE206B844BAB22B44D38EF5DCE684 huntercome
913,027,015 *5F0C658D14454B91D576B8801DCE475C67AE204E mest1z0s
913,027,016 *5F0FFB772F290C4513E10D376F2C1880E6D28CBB iamtimothy5
913,027,017 *5F0BABC53D12F2C8D0EED9A56C5FAE37127CB4D5 ibaguay
913,027,018 *5F0B55FBAE3BDD0436E4621D64AE4A743770DA02 [email protected]
913,027,019 *5F033D11946F0608BEA45D5C83307CDC62401B78 If-the-Death-Penalty-Were-an-Olympic-Sport
913,027,020 *5F0F5BA0B14D88689FB40EBC0A13F33FE9AF730B IGONDIM
913,027,021 *5F06F0D9EC7EDD28DA2E0BCF415AC7A0386CFD8A MISAKI SAIKI
913,027,022 *5F082B1EFF2752420E8D02CEDBC6AACE4A806B32 MITCHEL.RESEK
913,027,023 *5F06D7F93D7838379C5BAA83C8C0071A8083C72F ILOVEBABY86
913,027,024 *5F07EA658BE0DC7569DB497E3F74C07B8736060E mitra-jafari
913,027,025 *5F0CAE696A790B13C6EAAE2DF5A2A1A464B4A080 ilovejoy22
913,027,026 *5F05837B051DF8E43297104AB00E0A1D944BAFE2 MOHAMMADPRINCEVALLE
913,027,027 *5F053D6D96FF755724510892EC3441B24EA5A8B0 ime-Hi
913,027,028 *5F00FD30427A3397EDF551FDD714D5BFAEBDAD40 IMIDAZOLE-PYRIMIDINE
913,027,029 *5F0DD54F06525A03617087B8D83A30B8E2B642D2 mordellistena.gina
913,027,030 *5F073D287E67CE7479A03451EE131B80B0229A16 MOSHE.GAUB
913,027,031 *5F0E55C0A1ED4CA07522FDAF8BAF50714BB20372 ionidii
913,027,032 *5F02CD7153988D9F207D177833B24BF3B7BA893E multilaterality?
913,027,033 *5F0121DDA46DE92DB72BF39DD0F0EDBD8162B83E ISAAC.SHERFIELD
913,027,034 *5F07156E7F80620B845E0211AAF9C6C272658CC8 MURREVASLÄKTET
913,027,035 *5F0455D2935C6D504D10A2B91D219BED0EDBE2A5 [email protected]
913,027,036 *5F038323C6BA3A65585DA761D9CF6D5F67C9246D NAGILEN6
913,027,037 *5F0005103437E1FB74E974592884591584F3420A NAJKRU
913,027,038 *5F02CF9570C15A9CC39C91ADE20B15EDE7AC300F JACOBLYLE1:
913,027,039 *5F09B5F7D972036B05A2AAFA7F9A6833AD8EA09B JAKEBASCH
913,027,040 *5F08EF558B3CD7C3228CDE511B8EECCC0DD2A39F jake.hinson
913,027,041 *5F09BFCB174B257E1A43564D1DE78B3BABF56FB8 NCAARIDER
913,027,042 *5F0A2FCF311789BA8BD4EBB0D5DE4D30D9F92A6A JAMIE.GRANHOLM
913,027,043 *5F000B328AB253AA7154275DEDF3605893163DD3 JAMJAIREDLACE
913,027,044 *5F0A656EF22AEB6E442826387D53DB22F2CE8919 JASPERVITELLI
913,027,045 *5F093D32640F1E69F3F8AD3911EE92842BD33C8F nejsouhrnnejsim
913,027,046 *5F0B7DDC923E22F12FB8F07E6191727AC537304D JBEZMUTKO
913,027,047 *5F042089B4E8CAF5A6DDEE05DDA9B0647444A54B jeffcantley
913,027,048 *5F00D1C09439D9CA5E51D9A5A3570A66074B9601 ngravid
913,027,049 *5F0558C74F2EF8ADB201F8B3A68FD67BE5B41069 JERALD.VARRELMAN
913,027,050 *5F00CEF2DEA132B90160AA73FF7ADE7D951D1293 JERAMYHUBL
913,027,051 *5F09A9EA3D8BF2D6205055A668D9529267196BA9 nicholaswyand
913,027,052 *5F087F7909887E78CC477B3A2C2EBCBD739AD463 NICKOLASROBBLEE
913,027,053 *5F0B3D17A12F9B54A5E9AFB9B4E897D59E730F4F JEROMEDUMONT
913,027,054 *5F08179A045B5540C9D5306BE17596E25C9F3172 [email protected]
913,027,055 *5F0D88793473A38ADA617707CFEF43A7588B02DF nixotoiretcab
913,027,056 *5F0F28426CE4CD247EB932FCDFD0C516FB381659 JIM.SINKOVICH
913,027,057 *5F004250CB8959429F5A024F6E257ECA93F5EC72 JINWEIJW
913,027,058 *5F0D70534D6D56E07F7582EF22D15E808000DBC4 JLOOTS
913,027,059 *5F06D47197EC1F0D7861FFE3A5EA8B0232F5761F jmqt
913,027,060 *5F05DF249A4854B28DBA6B8DF7E2DC9FAE166898 nrpaataa
913,027,061 *5F0F62587E55117B89BF8E079583602F7B820370 J+OH
913,027,062 *5F00DEF249FF9A41EAA976246D7EC8BD7E2D180B NUMBERSTOOTHAKER
913,027,063 *5F043A53524C3CD7270643451F1E5FB29E613A3C nurmikentät
913,027,064 *5F09C8C7F1F5BB00937D345A52D457D4BCEABE3E [email protected]
913,027,065 *5F06ACDCC069F8330D8158B7807A09BD84D2A097 JOYENERGIZER(PSICOMIX)
913,027,066 *5F04BA9E0428749A1D4A60522637A9266C125164 JULIOKLINGBEIL
913,027,067 *5F060291835041305EBFD884306928AEFDF053DE jumbonicsep
913,027,068 *5F03EFD7360202701B17115338FFA46B5B1BC486 JUSTINPAULDO
913,027,069 *5F0115859BFCD40C0B6CEF0DEF22B1D0ED0DF544 OLIVIERCAZENAVE
913,027,070 *5F013C01A65051DCF37B80D4AAE5A7CCF70AFA8E onyekachukwuka
913,027,071 *5F0819436E875E2371ADB9FA56A86BAE2D384BBA o->-<O~(######8
913,027,072 *5F0195F8EF486F2C75FF2A9F9E5C57A60AC0323B (>-<)[email protected]===P
913,027,073 *5F0D50D6246B7FEB747E7A5AB42748A7F47E4666 kellypecoraino
913,027,074 *5F0E18FDCB8061BF64893CC6CDB645A071B8C8F5 ORACLE-FLO
913,027,075 *5F0FAF47A35907654D79F0E01F530C5FE1E005AB kendallumin
913,027,076 *5F070C0E64019DE3274B72B53EC026A13575C872 OSTWESTV
913,027,077 *5F001D2D7C5B105D0754687D6E31E6206605AEEB KENNITHKUSHNER
913,027,078 *5F0A2577818A1395278F5C5F7155A2917C56AE43 kennyhulon
913,027,079 *5F0571063E3C78146AE3B9E0C2184E12D4114B8C KENNYJAILLET
913,027,080 *5F00036BA30FE7DC3DD52B8C99765C0A54F2D007 kenoz1
913,027,081 *5F0566213B09FE77D8A092EF616B199266D2DCBB KESKUVIA7
913,027,082 *5F02A931F267FF55D47DD711436E13B27474B839 OVERBOUG8
913,027,083 *5F0DC9CDBD98590B78FBC7612625F741A6EFBFFC kg?v
913,027,084 *5F00EBAB46FA3BEECAF23FD91F6B76203B92B699 KING.POLISKY
913,027,085 *5F0912D4C798FD3288AB058D4692F100764A3244 p53ud0!nt3ll3ctual
913,027,086 *5F0B85C4CC0390919049060D4E600E44B90B0B6E KIRK.OLGVIN
913,027,087 *5F02DCA4BDC8DC60412CC2567497855E60090763 KISSNÖDIG
913,027,088 *5F02D39567111960200D60A846A9ACDD541E4D3E [email protected]
913,027,089 *5F0061958FAC8113CF24CBB734498B0E15712762 PALLADIONJA
913,027,090 *5F04409983537268C406B63185043EF73C2BCB10 KLEURSTOFCELLEN
913,027,091 *5F08AE905793E9077F202359126AA928EA165386 KLTREV
913,027,092 *5F09D5155C9E24F2E64715389B9EC0ED280AD4D5 kopeissa1
913,027,093 *5F0310359C608B30720863AC788B5CE4A1ADD955 patriarchs
913,027,094 *5F01D6C213B0823EC9A85A6F3831A10D5F99840E [email protected] `~ `~>-b0
913,027,095 *5F01DE2664174C55B3441727B44160B1C8BEBF83 P###B-~0~o-Splat
913,027,096 *5F03061AB1DEA6CB56B9C5D2BAA5D086F2B52631 P===B~0~oUU
913,027,097 *5F0C45FA0724E4BBFE6ED8F2BA9C185F08875FD6 pd.~0)0(
913,027,098 *5F0919EA93E3790191F0D73BD3C9F97D430908C8 PELOBEDON
913,027,099 *5F0C1543393B0FD30E88F79FDD7C615A3850CD44 [email protected]
913,027,100 *5F0D6F8DB1A67A510DA407755725872DA85FE106 percyklang
913,027,101 *5F0C5E41B7AAA2BE1323B84196EA341157E4B1AA [email protected]
913,027,102 *5F02F0D47F48FF407F83C8588F7BF90770802210 [email protected]
913,027,103 *5F087F8AC0946D2B646AEFDA256B5354559550D0 pezzica9
913,027,104 *5F048FD47180294F73C92FF8681651FB4C812BA9 la secta
913,027,105 *5F00467240E00DDD79E47A1894F67B73F00E75CD LAYOUTMONRE
913,027,106 *5F01305F4EFFE7E0BE7B809E8DF88ACCDA4C5C6C pierreadolphelesson
913,027,107 *5F091AE6B23BCAB50B898B44EB76D66E77AABC7E PierreNicolas
913,027,108 *5F0FD8F785CEBB4AF180F9A25F121DAC23B268B8 LEAXD
913,027,109 *5F0A229F3074C3090B6B4145251D9DF5C3BF32EE LED~
913,027,110 *5F099E490DF2D5D45732C10C98D6AADAECFC3135 leigherp
913,027,111 *5F071B507E8B9FA351D3F1A6E49C31E5C4C7A24E lelorge
913,027,112 *5F06C90A0457E41AA010325320A9932149B257BE lenoxdale9
913,027,113 *5F03F78FA43CF31E4DCD68D51A15BDB1C31CD098 POKRTILIS
913,027,114 *5F032903DA5F481D50D82A05466AE3BB9A84470E porfiriodelk
913,027,115 *5F0E6A87FFFCB999128F82F603D0ECA4EF6B855A LEUNESA
913,027,116 *5F02B0E233ABBD7EB1E39773092DF52F33BF57D7 LEUTICIA5
913,027,117 *5F0AEC8271812BFB525EE9428D00C7F2823355BF porvirio3
913,027,118 *5F0152EF731C9D9B793B5A4C7208EE205BE82159 LIANALIAN
913,027,119 *5F0B2B5C08E6506F555EB0A018475259D846F0B7 p-P~O.~o(>_0)
913,027,120 *5F0BC3AE92BAF063B1D8524D3CA0C7EE37E4C950 p------p~o~o)o(
913,027,121 *5F0C80841441356FF7E7B9B43A75671891149E9B p=====p.`~.`~.splat!!
913,027,122 *5F08CEA9D5678D36B51E24FB8C94F4A10788627E lightcatcher
913,027,123 *5F00C1905DA9B6962C7F7166B6144A92034B9F86 profilejonmoxley
913,027,124 *5F0435F9B971A912D623F75294EEC570513913AC LISTA-DE-PRESIDENTES-DE-BOLIVIA
913,027,125 *5F0E25D6D3FE890AE65A6CC216A3B98C34621992 LITTLE.SHOP.OF.HORRORS:.THE.NEW.BROADWAY.CAST.RECORDING
913,027,126 *5F021430929ED88D0DD8BFE64FB14F0AB79E5226 pydcfrbgd
913,027,127 *5F0C97CCF34AE791EB8D97A8A757002EE50DEE1F [email protected]
913,027,128 *5F0089A8D714DFE539E4199CAF021249C705CC85 QMEANINGS
913,027,129 *5F0E286525A373C51B454784B8728F7CA186769E [email protected]
913,027,130 *5F00187AC2217A151240BB6DBB7E50DFADF99082 LOU BENJAMIN
913,027,131 *5F085516173552A8224635844A183513E02B3509 lovelywelcome1
913,027,132 *5F00E0AD521D2A6B22545D20D42D7CBA8E18795A LOW PASS FREQUENCY
913,027,133 *5F025A230BDE1943940C8B5F39B6D10D569D1587 [email protected]
913,027,134 *5F05CCCE818CC3F81F449069256F0933BB277E0A r3l483lln9
913,027,135 *5F0CCA198D5B2B71D66F6640DD87D79E7BC7F9B4 LUNOHPIS
913,027,136 *5F00616E7D5767B98B2FF99191612E91786F690C ly$m
913,027,137 *5F0DC68A8845BE262A1096994053868EC2E923FF RALEIGHCORIC
913,027,138 *5F0088366603CE6FCE01C7218660FE440065A3AF RASBRO
913,027,139 *5F0C2850754C8B3CBA67D291CCF0B805EC62FE17 raumfahrtelektronik
913,027,140 *5F0497193941A23BE16378342F64B6557C7DBCF4 [email protected]
913,027,141 *5F005A4AE6C92002DE76A9CA93C1377386B6D71B MACROJE0
913,027,142 *5F005902B71CA69006C4DEE7C5C3B9D40A727EB8 MALIKABEE
913,027,143 *5F036DB1B3CC3EF486F7AC9885CCB4A4211F9A48 malikbleier
913,027,144 *5F0D207C4F316511C1924848F2B4C782F02028EA malucciing
913,027,145 *5F064E767826D7FC4CD224DEF91491C67A1DA09C MANUELHEISHMAN
913,027,146 *5F0519CAC0608B9A65F914A3EB86E3E8BD2FB561 ”REMIKSI”
913,027,147 *5F05E1EB21BC467EEDEE07FF2515DB2B3B65E5D3 MARK-BERNSTEIN
913,027,148 *5F0B05A21EC8748727ADDEF70718E278B118F857 marques.braggs
913,027,149 *5F0833D024558DAC50B4BF4C4DC88E0A8FBD62C0 MARS.GRADIVUS
913,027,150 *5F034CF4BBB74AF6BE96DA9B87C85FBB4647ACC8 RERLSNOITULOVE
913,027,151 *5F000A732BCD548967E920EC998FD76E23D6D8F2 mass for 6 voices "missa gaudeamus": pleni sunt
913,027,152 *5F08CC0461EF8139CB10C07DB0782D55C1399882 maurocastellana
913,027,153 *5F0138C7B27DC9F4531A1DCFF6DAC4115A73D8BB RICHARDDAVIDGREEN
913,027,154 *5F05CC6329D242911320EBE84FAE67DA974FCE0A [email protected]
913,027,155 *5F03C030F5538D48DD519E7F9029B4F16955457A medespel6
913,027,156 *5F076D8EE1EFA4D6BE53A277F508035B76DFEEA9 RICOMPITE
913,027,157 *5F05D48AC93175F76A0257458EEC4F1E1A123219 menchacha
913,027,158 *5F0FDCE2F07E57F1DF6D0315620228B56A45444F RIGMAND4
913,027,159 *5F0BC151746418A872242C9EABF05F55736E57E4 MERRILL.MCKEITHEN
913,027,160 *5F006B0388C36B68B9F942570E99C14C1CC028B6 MERVINNESLUSAN
913,027,161 *5F02BBDBB7A87AFC549869E776239873F0A0C4C0 RINA TALIB
913,027,162 *5F0D718B01D18ED175A96FC4BF5BD0C76E71FD48 RIOCHEES9
913,027,163 *5F016E2741CAE9A5A11868F09E8DC0083A2F360A METRIDATE
913,027,164 *5F0EFAF3AC31F16909583772061D7621D9D4A772 risciacqui?
913,027,165 *5F0AD15EDFDC0C6BA3871AF6F63F9CD8FFEB600A ROBERTDEVAUGHAN
913,027,166 *5F06CE7CDD7241F08DD14D0F82EEEF76C7AA2DF7 ROBERT.FIESER
913,027,167 *5F0BB0C611C6EB033B3E379AE00D5603445CC46E ROBERTTAPAHA
913,027,168 *5F094E351C2D88E4B6281D1A68E54E78A1004825 MINH.AREA
913,027,169 *5F001D6447F7DCC38BD8E383D782967D32F1CE69 mitchell-kinner
913,027,170 *5F0D893D25EFA1F6F0F79F34C37C8D46A6B8120F rodrigobulcao
913,027,171 *5F089A4049A958ABAB4DCFBA03C2A1A9A5F4E4A3 MITCH.RACIOPPO
913,027,172 *5F0AD514C6F4AF4A8742FDD76A0C2F0F254D1836 MITHILA-JOSHI
913,027,173 *5F05B972CC33D207AB9D8C254BD1E33A7A9BAA2B modicorp
913,027,174 *5F0BBD2C0E5DC60D902F48E5789617CF78AA12FD MOJICAYAP
913,027,175 *5F0FB7B2BA9740089436C311C999073EC8D1AD6D romanfranca
913,027,176 *5F026E6C9A11AF81DE82ADA7202DB1D54886AA95 romanraderstorf
913,027,177 *5F035A9894CA5E61E3BFFF07FAC702880C84DE83 MONTECOREN
913,027,178 *5F0D45A9A8C50AB6988704AFF539BDAD56127471 ronniea
913,027,179 *5F0FDD4936D23B3693851E7E4CA13E4C17B47F98 morriscabler
913,027,180 *5F064DDEF89B6BFA9F90C3A2B31C1B0AB6545341 ROSCOE.NIEWIEROSKI
913,027,181 *5F0E1935B78EAE74D5C91912F1D45A707EF3A520 ROSENDO.VANANTWERP
913,027,182 *5F02EB85A34CCEE13E6D66EE9C72414A839BFE35 MREZKALLA
913,027,183 *5F0488E3558AB41F6B336A24F959D94C51023CBC mufinella
913,027,184 *5F062F4982680DA826F404895306A59AB286F4FB MUSICAL.INTERMISSION..GOTTA.GET.SOME
913,027,185 *5F094A25FF8E85FD98A84C76DCEF70548EB767CC rumpe1s+!1+sk!n
913,027,186 *5F05F8428B203990984A1C90140FDC1EDEC1FC5E mynallmyn1
913,027,187 *5F0E9EC5512013C22852D0C3CF55B711C07D3FF4 NAP$
913,027,188 *5F04BC67DFD6CB4676D2DBEFFEDDD7A3A591F4C6 NATHANAEL.BEAULIEU
913,027,189 *5F07B182486D0C6E511DA8CD71C9C3F488B97318 NATHANIAL.GRASTY
913,027,190 *5F0F4967FA7C0A17BE5650149924612C4AA400D0 naundorfer
913,027,191 *5F0300A3E49385B8F70AD12A8EACE57A97723AAA NE0P14$+1C
913,027,192 *5F00452E2F312E92CC14B043AD90964ABDC41C62 nedjiteg5
913,027,193 *5F0ADE37D1392A86CA74406E8C139931C3876BFA SANFORDBLAESE
913,027,194 *5F0FA21F97DCBB080A5A5D2CEF708FFD06AC17B9 SANJA-VUKADINOVIC
913,027,195 *5F0DC3935339C2F523CC0FB322E6BEAC4E19A849 SARAHA
913,027,196 *5F0EF1BAA939BDF014ABAFF95ECB64A78101B472 neocatechumen
913,027,197 *5F04ECA18826149BA8DFDA01D0BF4AE2A167A74C SARI.PUSPITA
913,027,198 *5F04585237AB2794DBF2B1860825AD3D6ED1F463 SATOHARU3
913,027,199 *5F00E86E769F7D54629149DFCE0B52BC2DE1CA20 netledning
913,027,200 *5F091026C5716F13E75D86F416ABC9F758E967A4 NFWBN
913,027,201 *5F09F6C3AFAA74D67F853931AB320B82FF29CD3E  <nhkライブラリー222> 「シリーズ-漢詩をよむ」の1冊 
913,027,202 *5F0861E4B9FAE346F4D38367D789BA739A3F5723 SCOTT BEEBY
913,027,203 *5F0914DDDC7DD4694DF33E84D2ED0F11FC3B3547 scottiesymkowick
913,027,204 *5F05DF912049175BA8F0C2871A7279C29444235E SEANSKEETER5
913,027,205 *5F0011DED80DF0DBFDA525352A25E1CED5E2B0BE SEDINOMIAM1
913,027,206 *5F04B9674BD454459C133B589D89C697F2FB4159 nickolasfreerksen
913,027,207 *5F0EB779E87420D6FDD1D3E45E3CA1BCE0DBDAA7 nickolasperrodin
913,027,208 *5F071E07FBA35461950247FBDD9570513271E35D NIEDERBAUMBRUECKE
913,027,209 *5F0DA80F6D74C540126C00B79BB80740FD2E5110 SEPPATUE1
913,027,210 *5F067FF6BC0F4DE2F7E4F35468725313CA42B1BA SESSENSUOILLEBERS
913,027,211 *5F0845FDCAE8665E585F6CD6998E506E64C8AD03 NOAHKLEINWOLTERIN
913,027,212 *5F024F790734126878743CDCAFEAD14A934AB1BA SHAHIDROSE
913,027,213 *5F041566D87C2E30293701FDC8A3F5B5E0730B80 noorbatoot
913,027,214 *5F0BA7C4573834EECFB8E942AC4795C78610F984 SHERWOODMEETZE
913,027,215 *5F0B6F443D3D759E8336A2447CCEC548879D0462 no.worries.(w-beenie.man)
913,027,216 *5F0C5993CAE09C5261FFDD1ACFCE1EDC4654BDFF [email protected]
913,027,217 *5F0906ADB58AF408DBF853280695E68CC2C1D2EB nstrahy7
913,027,218 *5F0F74EF0CD3B3E7204E9154C67D86A4FBFA4316 NTINNARI
913,027,219 *5F08A1CCDA9EDDED0DC804B3E90171F3BC9C8FA7 SHORTGETS
913,027,220 *5F08054D7EA9EE015C478F816BFB75D4A3FD5439 NUMBERS.RAYNOR
913,027,221 *5F02C29AFB4FA00CD3F61B3765C1195D34546AD3 N..Workman
913,027,222 *5F02E74394C51E0D1A0405B228C9D9A824AA9373 SICELIOTI
913,027,223 *5F05BC63ADC8AA33E8AB5DC461C095B0A27BBC7B o->-< ~ ~ ~<-b
913,027,224 *5F08322952FEAC45147835AA0040B411BEF8E789 SIMONMOLAND
913,027,225 *5F05ACDDB8DFB2F49918721800DB61C40365C42E o['c
913,027,226 *5F0CF1879F494BA3403BD78229BE37F075520A80 OFFICIAL8
913,027,227 *5F048D04B668B1E67EC1973C0857D99B785AE46B SlidingParticles
913,027,228 *5F02B9CEF8440443C3FE034549A9BD5A0268D736 SMILESUCCESS
913,027,229 *5F02869E47C0E49C052E7E18CB0AB73F34C1D4CB SOMUCHAS4
913,027,230 *5F0AD7F95E2BB3338DCCC5A723D60531AD947F7A SONATA G K547
913,027,231 *5F0638E5CD51731E3980303F0A1C86F44DCCFB9B OPPHAVET
913,027,232 *5F038FBC4C3204E766B9A6B993A27CD5CDD1AB3C orca1933
913,027,233 *5F05F425860B7B0EC89870A09FD34994603D6BBC ORKUTNOT
913,027,234 *5F0C40D1B05715CDBC53AB0B603C8EF747B10746 ortspitzen
913,027,235 *5F00560E5EA4F3B5FC33C45712D4ABE56DEA5463 [email protected]
913,027,236 *5F02B7E706EE15837635DDB836E26D3B3183789A [email protected]!ST
913,027,237 *5F0F2F496AD955200DB513B53703573BB8B2B7C3 P93508
913,027,238 *5F0A2C2226EDB7712B310BC421C6C3B58C2C6022 PABLOTOBON
913,027,239 *5F002536140A6B191EAC0B0C9C57A0E970172291 PAGANYTI
913,027,240 *5F0F1741BFB1DA472D781E294D7188222602B778 S.SAAA
913,027,241 *5F091CFDB13025DF93312E2AF7FED552BB955BD9 paisco
913,027,242 *5F0ED9C13D3EC721C2C55704F3F6949041485351 PAM COSART
913,027,243 *5F00045FF66F3A855CB064810F582092B3EDB5CB PAM-HAGEN
913,027,244 *5F0F34305812F70CAA823B07F11F3641349352EE PARKER.BOWARD
913,027,245 *5F0A72C75418165F200D09D5F03275967426C78B parkerrenee
913,027,246 *5F0030CA8A781403DB154E05471041E1C149F82C PAULBATIS
913,027,247 *5F0C92BCC4EB7F251D2EB0C94E0120FF5B7BC42F PAYRAISE7
913,027,248 *5F008DD90AF9C04F52D77D1E426BEDCCA928BBC6 steuerungssysteme2
913,027,249 *5F07D72A692A5052BC97B3F2C3B98BA208FE49D0 STEVEROWLAND&THEFAMILYDOG
913,027,250 *5F007C2131442AB801C626F6EC6A45C708D4957B pe/?
913,027,251 *5F0F78BFAEEEF2E8F7B3F7FA70BEAEE4AAC13AD2 PEE40
913,027,252 *5F082D4061F9BADE3190275F1B9DEF45D8E22102 stonebystone
913,027,253 *5F037A8325747441DAA87D435895F0B90CED4769 stopverfsatijnzwam
913,027,254 *5F0ECABF754E0D7E3E5D6C38ADD510E7CB769385 STREAMSAGE
913,027,255 *5F08EF88FEBAF377AEC8D67A8FF893F806D959F7 SUDITALA
913,027,256 *5F00F7D15F31E87D3C48933C481C467D698BF4EA SULPSULPC0
913,027,257 *5F06C5D173E51A42A25F6AB7D0531CA60D379373 summer of love (original extended) (feat. mc onyx stone)
913,027,258 *5F0DDB8B5E275AAC935DC3D0C28EBCE20EC29D9C sunil-jayaweera
913,027,259 *5F0B230055BD3E9552ABCF1174586B00B342EFA6 PINK_TRIANGLE.SVG
913,027,260 *5F022CA3421FF70C375F77A00550FF8B1B5E5863 PIZIKA
913,027,261 *5F0C5040B438D212950D12DF8379FECB3A663F86 susie-hanley
913,027,262 *5F00493E883FD2EA21FB15EC65DC82D230BA5D5B PLEUROTOMARIOID
913,027,263 *5F0C4F35883C1CC3379BE2D90D1182957C97BBBB poauiuiiun
913,027,264 *5F0806BF04F48A6462C7E1256FE22A8B876F1F8A SYMBOLSMILEY4
913,027,265 *5F00B38991C28ACF53A297EEB8B048902B2E5D2D SYNNYTTAEMAET2
913,027,266 *5F0E8EAD949A6D091A56CF2784C61A219768CB78 PORFIRIOSMEJA
913,027,267 *5F0421A1E750F8BF426A85F984C09D3F7AAA514F P----->.~OSPLAT!!
913,027,268 *5F01F1B32F45701602DD6321A97EDC845B915B9D pp~o.;)
913,027,269 *5F079BF86A42A0D475C7984449C56C888CC19A6D TALKMUZY
913,027,270 *5F013D8F6158046727F645F69F2F172B8DC26A76 Tamarindio.(Thievery.Corporation.remix)
913,027,271 *5F00F2C2D60F55B762925649E415468674BA17F6 TAMMIE COMPTON
913,027,272 *5F06AA24B97C20BB48541726AAF2CFD22FBA8F23 preadult
913,027,273 *5F03FE2D470F5BA2574DEDE8E0C1DDC24CBBCAA1 [email protected]
913,027,274 *5F0C271D41F86DE42E153628B9FF7955785C92CF TARRISH2
913,027,275 *5F066D0594565284895612CAD127BAAD6C71F1EE TB9<
913,027,276 *5F0B7D5A8DF7908F5DF4C6E3464DCFECA4E7816B [email protected]
913,027,277 *5F055CEDBFCAEDCBCF279764A44CDD1517E577FC TEIJOUJO3
913,027,278 *5F0BBE21FA063F1D07B3F4B83308956FD3A9A793 PS3UD041K
913,027,279 *5F011FC2ADC9C77CD042D39ECD6156B3BC11A193 P).~.~.~splat!
913,027,280 *5F0F3ACCDAC927F66460B87FC684F2040D3B429C PULIMANGALAM
913,027,281 *5F0EDF218BDFACFDC65EF3B3826F50CD596971BA [email protected]
913,027,282 *5F0E8E755A741C72D1A5F402E57245D0A0924FC5 q---D-~0-~o-)O(
913,027,283 *5F05CF6CD8350EB2B383F04D9E2DB21295F93EE8 [email protected]
913,027,284 *5F0B255FAE3C98D7EC06EA611ABE13A29CEEFB21 q======) ~o (>_<)
913,027,285 *5F0187DA3607DA29782BCCF56AD33B4867814D12 quetery4
913,027,286 *5F094F70404D46A2EBF90D0E2CDF918154C6382C the-hipgrinders
913,027,287 *5F0363FF362ACB1305F76EA3438A4BA3DBF418FB THE LOUNGE BOX, 2: THE ULTIMATE CHILL OUT COLLECTION (DISC 2)
913,027,288 *5F0991D324F319C157101C3A7CA02825D2437BC7 THEOPHIL.FORCHHAMMER
913,027,289 *5F0C767E75FB8ABF153EBE7F16C13472F911716B theresa)
913,027,290 *5F0391526CBE728B5CCEB0251C4EF12BBD071D97 RALEIGH.BAPTISE
913,027,291 *5F07A2598ED87179D0D0C58846EF87FA0E703ECE RAN.ARNBERG
913,027,292 *5F002E89137698169DF2C56AFB4A9C7DCD872E97 RANDOLPHHYNEMAN
913,027,293 *5F0A9663F2E93ADB57FC8DAC49DB7BBBAE3F010B TIME-TO-TAKE-IT-BACK
913,027,294 *5F0BF90305AC76094DAF05F5DF050B5F3B460538 RAYMONESTELLA
913,027,295 *5F0CFAD3FF8A049C323A1DB88BACDD1472EB1A9A tin-liqu0
913,027,296 *5F061E8CAB014ECB6991FA03D226B800A86CCCC0 razprti
913,027,297 *5F011A59BCEAF5DBA450EA1BCE6DD3E8E455873B REBETTS6
913,027,298 *5F04A2F6C8BEF22908FCD4CDF2133ACA28CC1EC2 TOINNETBSW
913,027,299 *5F03D58F49EC6EB4B522B6ADD70B0E48EDC93464 TRACY BURICK
913,027,300 *5F070CBCA91090D214CE1CE8E8570B03CE9A827A tracyguzzardo
913,027,301 *5F042F0AAA8088D90549B383FE54442D5F9A1E88 REPREZENTATIVNI5
913,027,302 *5F00347020615582901ACBE4C354C04A5530389A TRE5AIE1
913,027,303 *5F0D31D01EDAE5DAD0BF3644BFF3C996861D0674 TREVOR-LEE-SHAW
913,027,304 *5F048A33126683E2FF133B82DD0EAE5369494D05 RETNIOPNON8
913,027,305 *5F050D7101A562A8CE2BE119D414E6EE41AB3C11 REUDVANDE3
913,027,306 *5F04461880E3552C9665E275C11CF590570CC168 TRISHKIESWETTER
913,027,307 *5F07440332B0C3141563AD436A115574079ECC9F REVENEHWBSW8
913,027,308 *5F00048DE95A8E72E6479D204682F99A855B7D3D revenge.remixed
913,027,309 *5F06896E46905E6F7858424AC3BEFCEF9096CB2A REVIZIJSKA9
913,027,310 *5F076B89737DB87242600D447DC6710BF9018008 REYNALDORIKE
913,027,311 *5F040CA2D2B44CC601991209A82F301E35E670F8 REZERVOM
913,027,312 *5F016E11C091C935B1C3D7DDAFDD6C9CFC52A44D RICKYORAHOOD
913,027,313 *5F0876E2DFB0488D6EBEFAC98DD59EB9A48946BA ricodufford
913,027,314 *5F02C7B37F910E031516CE19C8593C8020E10326 RIMPIANGO
913,027,315 *5F09ACA2C140632AB81D25A2FFFB9050A046AECF [email protected]
913,027,316 *5F014E018FAF8805B2734AB2D3BB6652F2D35024 TYISHA MRSFOX NESHAE
913,027,317 *5F0A0766679B94D9021B4EBBE2C55BF62C1A2AD8 ROBERTOZOMBO
913,027,318 *5F0DCDF839B39DE01B25646707ABFC253812ADD6 ROBIN.TOWNSEND
913,027,319 *5F06DBEB1D6EE16F2160A9D3836D932D84354864 ROBIROB'SBORIQUAANTHEM'96REMIX
913,027,320 *5F0BF8FF227CB564A209D6E3B1F1B643D215B752 ue1]
913,027,321 *5F0D95B0C085A86C0CE69B326B2B7777BA5B533F ROMBERGER'S
913,027,322 *5F05FEB5A7B997302BE7A233522BCB6F917C0E47 ronnie26
913,027,323 *5F062647298E5E509493302B31721AE0D24BDF35 und3r13g3
913,027,324 *5F0E663AD913F196E4E4D6A6DED06B3867AA29A8 ROSESPARKY
913,027,325 *5F0FC8CBC055C6E34A163F5B5DB3C4A92CF56DE5 ROTARENEGMORTSLESHCEWED
913,027,326 *5F0B98648BD12BFBC1AEBC51CD744A28C0AAD297 uptling.bill.(stolzerwilder.indianer)
913,027,327 *5F072BFF9093AFB244C7E54BAEBBD8E86D0BD97C URAIWANKONGKHAW
913,027,328 *5F0F441E9DFBB4A7E80638E508CADA27F5511DF6 RPMAPR12
913,027,329 *5F0BBAA1EA7235446ECDF42509E666A1248330B7 URBANOCHTUPPE
913,027,330 *5F0A310BA0E2A9DE54BD24DF8AD74DCC7BD4DCEA USERROCKINROBSANDBOX
913,027,331 *5F03103BB9CA1EAE1C8A8C91664FFBF59D86E399 rudesby
913,027,332 *5F0F1FB8D2BD3ED7F163743EA5DBE3B39053E644 RULLSTAUHLE
913,027,333 *5F0B9183B87B85E31517E67F6CCC7AE50FBB5AF5 RUN-ON-A-HEAD
913,027,334 *5F03297E5749F7609F8BFB057C2E69B516FB04EB S57706
913,027,335 *5F086EF07511091538A445E8F3F592659904C506 SABBATHORUM
913,027,336 *5F072ACDC36AC3201D2A17E27927BE2DAD229179 SAHAVET2
913,027,337 *5F042DBA3CD366C7CCA0C2BDE7548CF3377401DF sailing-for-adventure
913,027,338 *5F0F77E8893A69615C6AC4B82EED9BCFE7424935 SAMBA-TEMPO
913,027,339 *5F0CA1637E5649FDE81FA97046D3C578D4A1D8FA SATTEHGUF
913,027,340 *5F0F41E274616275CFEE578827C216512DD3443C sauteing
913,027,341 *5F0E0BB369EFC9A8EE2E9D1582D0584165BDAFA8 [email protected]
913,027,342 *5F0B0E87CD8832C659B9A6361E118EDB1D543ED3 SCH001.C1
913,027,343 *5F06AED358FA7436FD7984BCE12477785A0BCB37 VICTOR-OKPALAEZE
913,027,344 *5F03524DF3BD406E1C5DDCF82FF93E0BE231421C SCHÜLERRÜCKGANGS
913,027,345 *5F00F2E7188DFA4513A0855604F67DB869095401 VINASTE3
913,027,346 *5F094F12478BA4DB1A5FC8C8F739B71AEDFBED6D vincegoepfarth
913,027,347 *5F0D4899B3D538FBF1F610368AA76941E0D44AE0 SCRONIN5
913,027,348 *5F00CECC0BC05331F6AEBAA7D6D73EEE66B42D91 VIRGIL.STINETT
913,027,349 *5F071489B0D6FF9748BFF62FD278E79CF9142ABE SECONDMAIN
913,027,350 *5F072CD06BF3CEAFD2DF3DFF2CC4DCB4A04CB157 SERGIO.MOOTZ
913,027,351 *5F0DDDDEEC57C003A5109E00C8B6DDBFE0456859 sergioshu
913,027,352 *5F06D462190F3564F72E29FE1FA7F0054B84E62E w9p9ua4z
913,027,353 *5F003F460E87DAC9573A3ECAED4D603F4F081EC9 ses & ta en b
913,027,354 *5F04C85E35A8ADD0E80FE274B019F4E77ACF16A8 SHAMBREEZYK
913,027,355 *5F0420EF8504C2811D799CDCE881BA9C16A097B5 SHANTE GRANT
913,027,356 *5F029CA08FA2CFE594AB1EB58CA410D60A186FBA wallaceberzins
913,027,357 *5F0A718B6AA988DAAB6F318ABBCEC5EFA038F558 SHEDRICK-AQUILIZAN
913,027,358 *5F0ACB28707142A47B41192913161CFAFC867165 WALNUT.$C
913,027,359 *5F043CCD2AA453DDE173515F94AD6747593F805D [email protected]
913,027,360 *5F0D859ACC0877095B7BAD2AF1D3CABFAEE0E5E6 SHORINJI06S3200
913,027,361 *5F07C9D40307F78954D40FD287781BD41F53BDDF SI ESTAS SUELTO (FEAT. MAGESTIC)
913,027,362 *5F0F8616ABB1618F8A2D47DDF56AF1ABDC0266DA WENDY-OUTERBRIDGE
913,027,363 *5F05C7E6CA4AE17566FC1004D847BC1C7C801C7F SINISTAJ1
913,027,364 *5F0EA2538F75356A7A6B0942C475D0EFECFC42F0 [email protected]
913,027,365 *5F03EFCD461A635FC998E77D4C0743C9DFA70C55 [email protected]
913,027,366 *5F043580959607275895D251D21E40BE9151CCE5 wesmcirvin
913,027,367 *5F02352DF210F7853AB1106C1870A32E9ACD8F84 SKIANTS3
913,027,368 *5F0C329EDCCB3B0714DE42C2094D70A7889CD795 WEST-INDIES-2
913,027,369 *5F0F057A3A2E3FCC9FC5257C6B29DD8E9460C6E5 SKINNYSHELLIES
913,027,370 *5F0F697F81D05043D7F96D4F92FC25B126C1C7A9 SKYRTSAG
913,027,371 *5F02FB86CB10D4141A271C9ADEE5F56D225D9BEA WILBERTEIGO
913,027,372 *5F0602B395FCF7430061DAC2E0D036390E4A3DE6 wilfredseveri
913,027,373 *5F05AA16141761305CEB342CF6986111C90923AD SMASH CLAUSE 28/FIGHT THE ALTON BILL
913,027,374 *5F023FF76A59D0ECC59EC685C26DC8F8A1DB6986 snow-pallet-(off-vocal)
913,027,375 *5F00286786DDCD2207EE83494609C383EE7FF7E5 WILTON.ROWMAN
913,027,376 *5F09BE56EE260DE7EF771C15599E9769363D531E solquema(buler
913,027,377 *5F06A02301DB5082F02D400BF21F2767E2BA7E22 SONATEPOURVIOLEDEGAMBAETCLAVECINOBLIGE-II.LARGHETTO
913,027,378 *5F0DCD7BB0A86ACA635B33D3F5C8621F6D1BB771 SONDOSBSW0
913,027,379 *5F09E5C8F8C7DC666DE37533099F530CD08B48BF [email protected]
913,027,380 *5F060C1B605119B04454457292329601519E1C49 wl!z
913,027,381 *5F08031460935F8E036F2DDE6253615CFD4A8CF2 WOLOGIA6
913,027,382 *5F02138A8D425FBCD00207BBBEE1FF0142B92241 soundzap
913,027,383 *5F088FAE6FAFC7AD457D06B0D91A5F8F84043F50 SPARKYBOOBOO?
913,027,384 *5F006E460F1F274E8566786CA8D6C1BA318AAC2E SPARROWWINNIE
913,027,385 *5F0FC33C72427E7346D7E1379B2A976D630C476A SPICATINERVIA
913,027,386 *5F06971B452BEB8AA56BD1BA0CC8221714A5880B SPILLERS
913,027,387 *5F0E343C978069680DDF4D5B0A70E6E31FDAAF42 SPLENDANO!
913,027,388 *5F0270E112A5741E907161C0F6F620BEA458A2C7 SRETHARAN
913,027,389 *5F0FD93E653C506461E6F133E533105B1BC05184 srvllrs
913,027,390 *5F097C7C04DE6253B8B8DE2DA17BF5F8F0B52526 STANISLOVASA
913,027,391 *5F008BF4BBC7D5D2423F3607916376C2EEC483EC [email protected]
913,027,392 *5F03F35A83AEC2CA41D36DE340E600CB71323A4C }X{.o~.O~d--P
913,027,393 *5F00F41FA88441F1B72C965558CC75F61308961C (X)-O~O~-(====P
913,027,394 *5F098276F28C2895C8AF81CE315BBEB18CDD5CE7 [email protected]
913,027,395 *5F0CFBBD589587300DEA5A007E05081602215E36 STEVIESTROEDE
913,027,396 *5F0F395E4F8E521A99981C9656EDD4E9DD6C03F4 STEWARTALLOR
913,027,397 *5F025C6A587A487E7546F1D54DAEE396493D61C2 yinka-sanya
913,027,398 *5F093F807ED0B7FE1979AC194F7432DF6224DA75 YK GOON
913,027,399 *5F05F7296425EAA57A655B1B5E16FEBC3FE2933A YLT
913,027,400 *5F0746A1AA5E79E399269089ADB3C57D91C542D9 [email protected]
913,027,401 *5F0B3F8C1C6BB75A67ED781EDCB316073E414E65 yorling-gomez
913,027,402 *5F0ED154AF0A75E16CA04E84E099029A5B57F2E0 youngmoney(featlilwayne-youngmoney)
913,027,403 *5F05E8B64150FB95A8A00433D9FC641570639B88 SUNN2000'
913,027,404 *5F032CA30B75597E737D85362886B1B73D8D759F YUDIANING
913,027,405 *5F0D530F13DB107BC0FBDA8D3D2D8E158AC415B1 SVAZAKOVY
913,027,406 *5F04C47A707CEDFD91456888ED86F173E97563AF [email protected]
913,027,407 *5F0C1C4831D7266E635CE76878A04B64DB1E25D0 tadeakatemian
913,027,408 *5F00CF20EF9197F5CF1A639EC6B13A341E559B21 taffylike8
913,027,409 *5F08A91340979BBD738A802BBBBED964C2D0DF18 [email protected]
913,027,410 *5F07B294FC518F932DB9C99164D0D9859CC5D746 zianazizan
913,027,411 *5F0AE986C982E71C822D15B77827FEBAC689662C „ZSCHILLE
913,027,412 *5F0CC16F9ED7DD28945AB603B6EC6A87F219E29D ZWAARGEW
913,027,413 *5F0F3304D14EC3DF548744E6BD12D80799F9DB90 TEKSTRETTELSEN2
913,027,414 *5F026851F028405E6613FCCC5ED0E0CAFAA351FD TÉLÉPHÉRIQUE2
913,027,415 *5F0BA66650B70638D585664AC134B96479FC4783 TELNET/NETCAT
913,027,416 *5F020422DA1AF01484E139FDCCB5CC70175E9B65 σοφιανοπουλοσ
913,027,417 *5F036D88CA0C1064B5705A1A54FBE46708409682 TERESABYROM
913,027,418 *5F01FE24006C4A96A2819F85E4D030D138737624 [email protected]
913,027,419 *5F0C025C2BB3A156A3E716187E9CA1CBA444CF13 БЬЕРКЕТВЕДТ
913,027,420 *5F00B958C862AA109E37F49B9C663A49CEE3DE26 «ГІПЕРПРИЗМА»
913,027,421 *5F0533315171BDBD7E627B1ECE7516C8D5BD5D21 ЗАБЫВАТЕ
913,027,422 *5F06E8472601D557B2B3D4523A622C04E747FEDD ИЗГАСНАЛЕ
913,027,423 *5F0310778EE2F154B55FE83CC7FAA82EE177C435 КӨРДӨӨБҮТҮН
913,027,424 *5F03F8ED19F64C51CA0D540C8301A9360343BADD ПАЎСТАНСКІХ
913,027,425 *5F0AE3F5AB2B5E799DAF969DA8655D2CE6830143 The.Ice.Worm's.Lair
913,027,426 *5F08DC1AE7205283D475E94615059A06FB404DA0 THEORIGINALBIGDEP
913,027,427 *5F03BEE9A29E7ADE2BA21EAA1621BCEA66A4EE32 унсіті
913,027,428 *5F0738B2B4E3A37D1D598711AF1E235FB9B7E2A6 этимология
913,027,429 *5F01113CB04CAD57113B6E4C045A91FE9569BB5B thomaspe01
913,027,430 *5F095A09DE7C924B43A6D7D80B688A69CB114CC5 TIDHEIBEH
913,027,431 *5F061BBD9E22821BFF9516B186C46326C0325E65 tiffanylynnmartin
913,027,432 *5F0CA9574E1573CAB1551C149B0031057044576C Tiyul.Leili
913,027,433 *5F0862125174D8CA449F774BBDF217299D7AAB1C toda.la.noche.oliendo.a.ti
913,027,434 *5F0A7B94DE8D8AD5491C8D1D860E932C9F7776EC TORNAPUNTING
913,027,435 *5F0B2631639696F1E8963E5230B484A2340B67D9 TORY.KUCHARIK
913,027,436 *5F0F723A3889D060DDF610EECC59092EAB4F113C TRACEYHORSMAN
913,027,437 *5F03236378B8568A9733587A68E544B7D5149C1A train recorder
913,027,438 *5F091F4CEC589F00EADF8D0A6FBDF2419FA6B3A1 tristanwolves
913,027,439 *5F04EF7506C9E71B2018EBEE5605A87842B9ED5B TT0090309
913,027,440 *5F04BD5E5005A872A5774ED64636560697EFDD09 tttltjs6
913,027,441 *5F04E2D7FDB278BC456D2A283616AD74B4885D6E TUNTIJALLE
913,027,442 *5F00EB6C99A3363FC718A55B4BC0DBEFCC9372E8 Tutto.crolla
913,027,443 *5F0F8432500B530E7BE06045AAF65E1FD6A36C30 TVLEGENDD
913,027,444 *5F0151A22CFADEAF19C63C53C80413E17DE627BC TX1KQQ3BADS939G
913,027,445 *5F09A5996078FBFC27D9B751BFDE09D1B1D20AEE [email protected]
913,027,446 *5F0E9BE54D6ED79FB4ABC67FC8C9BD67F950FC4A UDMMIINNP1
913,027,447 *5F0197165FECA32A9007FDEAD27DBC4E44BB317F [email protected]
913,027,448 *5F0BBD520E7CE6C5E872FA4969C7ECA0BB3D0D17 uitgooide7
913,027,449 *5F0BB13DA6C83E4CEB51A101895D07D4F9C3C27F [email protected]
913,027,450 *5F000A0A0BC46D9CBBDD7AF6755C69DE55236A01 unitore8
913,027,451 *5F057F14679260DAF0EB2003D98720735C9A9C18 USERPATHOMASUSERPALA
913,027,452 *5F0FE0C4118F98A55EE45B80AAC165AAEE7B46EA using.the.definitions..provided..above,..the..following
913,027,453 *5F03B58EE6BE4440BD332F559E5F677D82EDAB3F VAARIJAANH
913,027,454 *5F0743FDCC67DC83560C86109E4C1DC27385563A VAN.FLEMINGS
913,027,455 *5F0D07114FA83DC1517607CEBCA14C647701F123 VARMEFORPLANTNING
913,027,456 *5F03CD0C000DFA657C24059561A07BC714F89648 VASANTH JANA
913,027,457 *5F000461F0089ACC03AB49C6285ECF62450B2274 VAYKZ PAOLA
913,027,458 *5F052271BC9D7531FA912877FEA0BCD538BCC55C Vctr
913,027,459 *5F08EEE6E03290BF303905DB3D58454BD5A2722B VEREDABRAHAMI
913,027,460 *5F05FED7428A6595D498B7A8D7E7A3E0E34853CE VICENTE.TEJEDOR
913,027,461 *5F0F3210B019C9CD6D6AF9D6E9FE24602FC95046 viciouscircle(v.666version)
913,027,462 *5F0C8B8D1FDF5F3397EE85B91E598F99332DB48B [email protected]
913,027,463 *5F071E3454CC9E8EFACA0D3606108C7792C30D0B VIJAIMATHUR
913,027,464 *5F04EB8B4AB2F636BF870F9017183DBC1632B68D vincent.sauve
913,027,465 *5F0896D836C8C34B08ECD80324A90161410D29DE Von.mengden
913,027,466 *5F0A2DD2E09DFB7C8C9468DBA154B64DFF60772D VONSHAE LAWRENCE
913,027,467 *5F01C5797FEFDB02B47CFDDD8E2FB55378E4ADB9 VONSWEIGERT
913,027,468 *5F0E0829CC415F812816492408F46D5A979F1F1C vrejisx7
913,027,469 *5F0C01A5D06FCBA8FCDC20499F4268B45BF79A46 waldoemerson
913,027,470 *5F051D77D64DE87946ED936DB2C2DEDFDE5C0247 [email protected]
913,027,471 *5F03D29A0BA360F14EB8FE70B9E33F8CD951F4F0 (^_~)[email protected]##B
913,027,472 *5F04AEF815F483930316BC1B1BEAA6B544CF6B74 0myjenny19
913,027,473 *5F062FE4BFA050EC9CA3C08CBC9E9FABE13995C8 WANDEE-PHETCHARAT
913,027,474 *5F0571E84FCE75F504A8711263413082DEF21499 [email protected]
913,027,475 *5F061786C9BE23D2AA0774ED570028AB69F29212 WANILDA0
913,027,476 *5F0049605D9B3E88C978CDFE9E472962A4C61DB7 [email protected]
913,027,477 *5F0CC02A041D04A6A3EF4BE85C1BA5FFCA2A34F5 103498 " SYYT
913,027,478 *5F0F4E7098437662144D09C54F3A04D0B358D68F wasimsaifi
913,027,479 *5F0B0D5EC2FCF6465B16F99E37C44B8CE68B0517 1474971 THEIR-LEADER-IS-CALLED-A-"-SKIP-.-"
913,027,480 *5F0600ACFF0B87ADD0D23ABBD792BD1AC19F535B 1492044 PIENET EP
913,027,481 *5F05C93730F7B92592CDB9B92FF7CD408668BF25 14RE
913,027,482 *5F039C3EDEEFBADDFDF4A8E95F876ACA5A51D391 [email protected]
913,027,483 *5F0BE9D05789BCD1F06EC7E9E79FBFF345E6C51F WERNERDARAMOLA
913,027,484 *5F0141B419E6E50A3E23C994262CC160AC344DB5 whitney-robin-roffe
913,027,485 *5F03F771B1C16C594DAB435CF7FF449EA04CDC4F 1968170 malminkaarenpuolellasek
913,027,486 *5F06B27378687DD9643E3BF450E49BA9E8E99028 WIIDYAPII
913,027,487 *5F014AB91046526AF77B0A8B9BCA5C1BCEC59DD0 1ABEAOUT
913,027,488 *5F0598F59E24B0AEE13F890F18F71E2B87AE80E1 wilburnchhour
913,027,489 *5F05A6F04858D83EEF7434B1C8CDB846A5B759DC wilburscollard
913,027,490 *5F07CD2F7F40BD6C56F8EDADBC694C3BBDACA8F5 1.agenturhonorar
913,027,491 *5F00B6D34CEB90B5A5AC36F6598FB028C66378EE 1ANC-WAHLSTRATEGEN
913,027,492 *5F0C0351D87A40C8FD4CD31F02DD1B193FA0F13C WILLBET.K.PIMMS
913,027,493 *5F01320A9474A3F0E7B1A38B1E1C9F982692D881 1AUTO-ABWRACKPRAEMIEN
913,027,494 *5F03407816744D2E20398C38B8E5B04401273CAE winesquad
913,027,495 *5F05B32C803EA104E364B1B71DC3DA970071FDB8 winikusumawati
913,027,496 *5F086F0A0F90DC9A2FCAFCFF80B2895FB39D6B0C 1.heubergstrasse
913,027,497 *5F01E20EDD74980295C6BC2E3A6237232B3D9532 WORDUPWEAREMULTILINGUAL
913,027,498 *5F0DFAF24E2236D4C93B193B40A1A244CA676BF1 wrythit6
913,027,499 *5F05C3B9C076E25C1B1DBC55BD2BA00C96441A7D wwwagwoodcarecouk
913,027,500 *5F010710E63D52D1C444747B64C6AE1BF5101C98 1kohdekartasta
913,027,501 *5F070D7E7C337C1D77C235A7D82FA1D36FD7D86B wwwenrichyourlifecomau
913,027,502 *5F09B8B8A2C675A37FE83152A9C5F0625E35606D 1kuorosinfonia
913,027,503 *5F0C6F683F89FFB56377EFAD504227ECCC6AC2A0 WWW.HOSTAHOMESTEAD.COM
913,027,504 *5F0145F7A60F37289D2BD82DA6B21DD1C0DAC7AC 1-lahkaks
913,027,505 *5F0A19FC2C9A6B1F94BF26AD24D27699AEDED0BA 1LAINAVERTAILUSSA
913,027,506 *5F0010534D5DABCDE16B9F4ACAEAE61BA5499699 wwwuscaworg
913,027,507 *5F01D797CF94062D1C7892384520EF75B223C391 [email protected]
913,027,508 *5F011D8784544240D641700BA4CF9EC3DB7A8B29 1MERANESI
913,027,509 *5F0EA95637091359C3601882EAD2A9D508CA1CFB xanaanobaarackibir
913,027,510 *5F05F10ABA6779C7F368C88A0728CE73D5CF04F7 1MYDIM9
913,027,511 *5F048B2D595519EF37CA094340A35F7997B04948 1.ohjaustilanteita
913,027,512 *5F0DF17ACED179644C92D7A03871B23635C7937F [email protected]
913,027,513 *5F025BFA02C08D27C9A10082DA8F2FA1AD75DAE9 1-pistiku-liide
913,027,514 *5F05AAD81F04E452B24AC27DDACB89C266A1E776 1poolvossen
913,027,515 *5F03295B4014FB02B419846398B0C41C2D65A82F XLM3
913,027,516 *5F05AF18E40D6240ACFA059851CBE2E824743EB1 1 STERIILIN
913,027,517 *5F04892A9BF0EB731485AADC23810A586A7A7539 1-SYYSVEHN
913,027,518 *5F0EAD6C5D379AC40625BBA2EBA41763C1A52CD6 1universalowned
913,027,519 *5F06A93459139789ECAE87506C6B5063A631DE78 Y5RF
913,027,520 *5F002A27A7862D29323B53B1191602389C641C45 yaʿāruba
913,027,521 *5F04D5FB1148DBF900C5CED5C67D67A963A423E6 1.wiedereinschleusung
913,027,522 *5F0E1C22B3FAF85D49B01A98D90C9BC5EBF257AF 1WOHNNGSBAUGESELLSCHAFT
913,027,523 *5F032E19F16DAB71738DDC5C4F2FC68FEC70E71C YAMPIERDUPUY
913,027,524 *5F044B3673E344D84F8D2487245C16688CD16247 2003255 ES.GIBT.ANDERE.GESCHICHTEN..
913,027,525 *5F0620234C4D7E240B863EFCAE395B2F2FCBF46A 20-05-1674
913,027,526 *5F0FF27EAF1F1148164BC8B3A7022BD2EA19FEDF 2275269V
913,027,527 *5F01054CC60D6737B5043B924BA5EB44E4DF6DF6 YKIGORE
913,027,528 *5F0CE596EBF7BCAE63387474D436BF05BC45DBA0 YLFNARETEV
913,027,529 *5F0B333BC196281F7B0A9C95BF966ACF7F52E881 ynnad-corpuz
913,027,530 *5F0D7439202893CCE0C6281C35EBFA2EFC6C3E7A 25-jaar-top-40-hits,-volume-3:-1973-1976-(disc-1)
913,027,531 *5F0F7D6934EA0165982E081FC406C0003C359F1F yordy.rivero
913,027,532 *5F052D98701511C9D801D02F6C4D6475D918A5D3 YOUNG.ZIEMAN
913,027,533 *5F00ACE55500A4048868FD725A52A1AD41933A89 26a7cc37324536a293df60d7087dfbaa
913,027,534 *5F003AEB59B6B379F35A11DFE9770930FC1ACA54 YOUR.VANDAL
913,027,535 *5F00B6E230C93E2AEE9606672B5D784BD0F0D028 2728259 HIUKAN HAIKEAKSI VET
913,027,536 *5F00F20A16AEE4DA6F3DFA291D5DF2ED454F7985 2822872 was-steckt-hinter-der-lust-am-pruegeln-?
913,027,537 *5F0535C0397C07154855811EFD98D775287C5127 YUEFONG
913,027,538 *5F079761B390A6A8FF13325DDC6F3C3D1C729640 yvonnestarrlett
913,027,539 *5F01970A75FE6FAF0B1B6E70DD13D08C326F60E3 ZACKARYHOLUB
913,027,540 *5F0201AAEFA55DA5D3CCF4AFBC940BDC8F69A798 ZASZNUROWANE
913,027,541 *5F0A529A003EFCC5480B7DF0D7A6B8DF0ED0152B 2IOYURAW
913,027,542 *5F084C33D85BD9DB11E8797F0BEB7DE53B2DF57E 2january1360
913,027,543 *5F0220BF08C9DEF8FD9D51C95823A29AEC17DF0C [email protected]
913,027,544 *5F019B063BB25A49C28A3DEEC22FA22BF9B9DE09 2ZAJMALY
913,027,545 *5F0FA474504B01A8AA8972C977DED0E93E9DA09A 3####@.~0.~O(0-0)
913,027,546 *5F075A3E5556CB4EC9DAFBD37FB6DB7F620DAA7E 31JULY1920
913,027,547 *5F0407A8746FC4D8F9842ADBC327E759FE674276 335bryce
913,027,548 *5F068BAEC514E9EFF58E90E098CCD4E3C664E71C 38-JUGENDINITIATIVE
913,027,549 *5F07454D569B471D3B5AA4DF13B177F103E82097 zumba09
913,027,550 *5F03912C2E03D0AEF251CCF69264CD7D3312DCC2 ZWAARGEW
913,027,551 *5F02515690E5C2E54F004061EE66AE6ED0B04AFE асаш
913,027,552 *5F04AB994CDCC4798823A8BC9F9E7EF2A681B90A ВІННІПЕЗЬКИЙ
913,027,553 *5F0D440DD4BD5B9B24389660BC06A6FCE668C02E 3VERGLASTES
913,027,554 *5F032500186AFF2DCCAAD03ABF021BAA05FCAE15 ДОШУТКУВА
913,027,555 *5F032DBE644A3F08EBD9DAF0A020FC3ADAC039F3 3 YIFTER
913,027,556 *5F049A349CFB7EA0E73F5B655422437CEE61C926 415971 NE.EIV
913,027,557 *5F008E9684C0BFF3FAB12896915596F5CE350664 426REED
913,027,558 *5F023694D592A2E08588A162E4C31CC3EB7325F8 427transparenten
913,027,559 *5F07A454145CAA325D55355A2F9C004CE4F86253 ЛАЧЕНКОВ
913,027,560 *5F00A2C2931FBE0756AD5E0B1129521A97CA8F20 4BAKUSTET
913,027,561 *5F01B400E20D5FEA9B6062A6A0D192584B337050 „ПОЛІТИКОМ
913,027,562 *5F0D4E8A199DD66FAFA7B78DD10994E035B9F802 ПРЕВЪЗХОЖДАМ
913,027,563 *5F07860C7816A4B3A19F230EA2E54D019AE1836C 4DNOVREDN
913,027,564 *5F00587F97306F3A0B4ED0A2015BC089E5804BA5 4ERFRISCHUNG
913,027,565 *5F02D92F35853365C9323DB509266761AD53F822 фанкфуртера
913,027,566 *5F0D1D4F88EE7975A3752F74ADC9DE2D68A5BEFE 4MEDICALSHAWN
913,027,567 *5F0AADE69C1B57C3383724445B9EF1D7C634F73E 4monday4
913,027,568 *5F0091AC9217E861DE19F0B945212D68CC0E755D 4-rattailta
913,027,569 *5F0C8F90653AA8C237FA367E27EC29967B64BD02 4.RE-INTRODUCE
913,027,570 *5F0EECC446351291890A9F71CCBC07ADE8F25408 4ZBKM1OTCXO
913,027,571 *5F0576F47B9D24E2F2A1B1B0BA206DCEBA22401B 570003 EV-KURTI-,-JI-BO-NIVISA-IRO-BES-E-
913,027,572 *5F039057CE37C7ED1BB30261B4B103314C5690F4 5AKIZNIZ
913,027,573 *5F04D3D84D64A25578171C77CC944BA31705ED67 5BSWDISCOUNTSOFTBSW
913,027,574 *5F01B5B8A5A24FCBB4525A302716DDEF1AB3AA07 5BSWMEGAFORDBSW
913,027,575 *5F05CE3C6B8B9379FF705711ABF9E9262528359D 5CHAMPIONCOWBOYS
913,027,576 *5F0F66C988450293BD2E039C1EFC7E2189D3D4B4 5consommaient
913,027,577 *5F0E6C99EB922869AB7C3AEA919C47A6A4E4E8C4 5ISSNATAJ
913,027,578 *5F08CA70A42F7B3ACEF40B526253EC90FE1A5F59 5jan1312
913,027,579 *5F0E8751694E6E490B5C52924057F8BEB4B21C5E 5KILKENNIE
913,027,580 *5F010067BF38EFBE632F46A22886BD740EF981D0 5MOMENTANEOS
913,027,581 *5F0B5F785D49CBFF3453ED36D482A8FC86BF1B01 5PA7H!C
913,027,582 *5F00A8060CABB6D6327A2B04E771BE3922CE5AF6 5PRIVILEGIATS
913,027,583 *5F0908296156FA0450940A4C5F2BE33978021FCE 5RESTAUROVAN
913,027,584 *5F03066A4DB862CC154DF03E7AEAE5E9F20C9AEA 5STAGNAMENTO
913,027,585 *5F0520D9B6434FA60691C09CB4153B90EFF0C5A7 5VLOWINDE
913,027,586 *5F0D14269C3ACAD9B3546FD4BBECFFB6B5F424DD 6DONKEYCAMPING
913,027,587 *5F034E6F4B53C9E9ABA147717A7AA5DC06209DF4 6DVIPSXDVI
913,027,588 *5F0F7A6067A3898DB07D708E8248F310E102991A 6GIRLTHEO
913,027,589 *5F006ACB8D199047274FAD9F17AB8B6E5A6EC16D 6MISSIONFLIPPER
913,027,590 *5F04A425EE45591017E1E3A5D017682CDB64E268 6SEEBOARD
913,027,591 *5F05C53171AAA17BDE2B33EF735289DD6510FCA9 6SILKEORMEN
913,027,592 *5F09080E82DFAEEE4ED5ECA06E2A973E92BB2DA7 6TELEBRASILIA
913,027,593 *5F0E74FC45C22E1E21C702B1F739E5688E41409F 6TSREPEGPO
913,027,594 *5F0D4DF57E47AF30C91F100091107A2AEA8B1070 711kammy
913,027,595 *5F014EEE7CF991449C4AF047720952E79737A972 7IAMANDREA17
913,027,596 *5F07C94E3F7675F67591FB9BFABD7546FC3ED1EF 7PREENJOYMENTN
913,027,597 *5F0FDD688D67CCFB086D08B4AC874C7EE0201EBC 7PSHFOFORWN
913,027,598 *5F02FB01C2711EE65E326A95E0E679EE7300BEC4 7USIOKKUT
913,027,599 *5F0801C16EA7D02ADC2F85CDB4FEA96F48EF9309 ;)-~`-~`(-----8
913,027,600 *5F0BD3D87CE41DB0B1E100F3C5427D57E5179C17 8==>~0-~o)O(
913,027,601 *5F0C1B2C632F65DF6E7BD4972F787000922DDA02 [email protected]~0-SPLAT!
913,027,602 *5F09F2A25C0FA86E18A655F5FA645B22CF5E61A0 [email protected] `~ 3b<-
913,027,603 *5F0246C69ED164CF838C6BE90B88F3F23D463656 [email protected] `~ 3B<
913,027,604 *5F0FECB3D6CC694BE6A4D2E3FA6EB48596EE2A4F 8805A3
913,027,605 *5F0DA2BF182E569465AB5D31FC180EFF14FFDA39 8EESLUPXE
913,027,606 *5F01F29BBB03963DCE8C8C782AC57908B6DCD123 8EUOMORPH
913,027,607 *5F03320917982096F00B52EC2789601D9CA04E91 8FREHSARB
913,027,608 *5F0B758BD7D50AA18631C00BF5A1FA6A273C89BE 8MXAPPLYTOSELECTIONBSW
913,027,609 *5F0F180F32BF0E8F7D63A1A45E512B89A20F146A 8NNPRPNDCLR
913,027,610 *5F0803F3D9159116A98661A73807775C257E9957 8OERBANNA
913,027,611 *5F0DF5ABDCD19838FFEFF139FFB7CF73613B089F 8ONSAMENHANGENDE
913,027,612 *5F07E3040E7889BFD8A47B02481D5A6143BCA76F 8TOALLOFNORTHAMERICA
913,027,613 *5F0C7D827CAF4D4A03738EE2C8BB0831B3E28D24 8TRICHLORALDEHYDE
913,027,614 *5F079D95347EB1B5F84D5E453FBBB254B0B7FDB5 8TTTHISTT
913,027,615 *5F04B705679B8F762E16AE5CCFFAAC713782ADC4 8WEIBLICHER
913,027,616 *5F08DDF4D1F0446D259B725FE02FA323935FFEEE 911marin
913,027,617 *5F0130A3F8F779B1DE9240D87426FA3611F0C79C (-_0)~(--3
913,027,618 *5F029A4F1F7FA069EC7136B02E7EECEAFBDF68AF 04.19.1447
913,027,619 *5F03A4BC0AAC36D8A487AE223CBDBAC170E255EF 0C0D1CD7D8C931E2B69A78E004639D87
913,027,620 *5F0CD0048E86BCB2D97CB8BC9ED6BBA42BF181FD 0iluvjeremy7
913,027,621 *5F06CF506C64A1DAC980A0283A64E30E59798F5F 9ILOVEMAILER6
913,027,622 *5F08FF12433389AC7F06F044964E2BD54169C0D2 9NEBRASKATHERESA
913,027,623 *5F00C530F903EB8AB88B3E97ECC1A4ADE02CB7D7 9PIFZP7U
913,027,624 *5F02CC704FE3F229C581B363199F648D31E600CD 1388992 sen pit
913,027,625 *5F0D24D3DC0ABDA1F1E9468C1B199334A3D47935 1456779 kerttu-kyh
913,027,626 *5F0FB2C5F5ED3C9B7D69CF33E53FDD88D32DF67F 9UZKOSTLIVE
913,027,627 *5F0ABDC158106DB7CA5764E701B8484A5E0588D0 1535011 kun-kitee-ei-saanut-mit
913,027,628 *5F071583F475E8362F56C3A7A1BE25CE68C4F0C9 1607544 sie-sprechen-von-einer-irrefuehrung-der-bevoelkerung-
913,027,629 *5F048B5772652DD61582D091DE88A99C0136E2AD 17-CAMPAGNOLI
913,027,630 *5F09B89935BCFEBB3DB2F149188F72ADCCCE80C4 17 MAAOMAISUUS
913,027,631 *5F037BC7A54EF7AC3F8975037492E261B8A968B7 a1go!
913,027,632 *5F0756508A4E87C6C9CF31E6D3172C45C134E5FB 1.ALTSTEINZEITLICHE
913,027,633 *5F0790ADAC44E0F87A87062E67554EF3745C5640 a4pgr
913,027,634 *5F0DB97B229C0715DEEB46617135E347CCF733B1 A71WN
913,027,635 *5F04679F1EFB30A38A9BC589D1C1673C67AF3478 aaaj,h
913,027,636 *5F0B995C0DD468106A3C9F6E7626C5D5938727CE 1KIJKERTJES
913,027,637 *5F0E7A6B1B6106A3C011D065C225CA672C1F9775 1 KOVAKANKI
913,027,638 *5F07B232EF14E51E771352A4B89F91BE26044C7A AACUG3
913,027,639 *5F0C664A517CCAA13AA9FEB72D9407920AE07BAA 1 METAKERTOMUKSEKSI
913,027,640 *5F03962C91CE64CA791024569866D4D93A13EBD4 AAD'>I
913,027,641 *5F059BA8775A6D7829B97A7F1C915F976BAC48BD 1-nilbarschen
913,027,642 *5F000142FE50F6B0D3B6137EE28A9731F965684D 1 ORIENTIERUNGSPAPIER
913,027,643 *5F0FD306E337A385AE429BF0C0A458C5B0C3385A 1-PALVELUTASOKIN
913,027,644 *5F0AF92640A554A01131B0096794D5091E7884DA AARK5
913,027,645 *5F0D876EF0A49E4F499E0C4A78EAB926F97F3E14 1REGEN-RADAR
913,027,646 *5F07B05E21A8E726EBFD17FB64EF949903C32BDA 1SAIRDAY
913,027,647 *5F0CAAD925F94516C11E61452537F62EAD891502 1-scheinwerfergewicht
913,027,648 *5F05E8DC7737F367CF39E24CCDDE4CCC9F6053F7 abelluhman
913,027,649 *5F0D122254CEE44967B4D5B1504C042A6C4D92E5 1 SYRISCH-LIBANESI
913,027,650 *5F0EADCB6C09BFA4596D2BD538F87F7061496001 ABHI
913,027,651 *5F0FE2EFFA98E267CCD893ABAE32EEA7E72D09DC ABLAUFABLAUF
913,027,652 *5F06EDA03AF4DB94F7E3ADE3E1FD7B6DC33021FA acronyms
913,027,653 *5F0D8043DB09E26588B781693530FA7B6DE3F5B4 22MAY1147
913,027,654 *5F0849236570F30FFB878DDA58CFDBFC3D8DE787 ADAMDURRANCE
913,027,655 *5F003E531D0321718DE853F26C4690B8F8BB5FCD 2672378 wenn-maurice-l
913,027,656 *5F0EE3D634BA3CA0349FEC367A6620C969BF8750 27051204
913,027,657 *5F0A64CB4D2BF705A305A6F68940A87CA51392B6 ae$sn
913,027,658 *5F036536E98295A3020E904E032DD1E5D2744C71 afan:
913,027,659 *5F04BF3B77743E77B93B51A8AA1CBA28D6C4900E afk9z
913,027,660 *5F026ABAC10BAD100A31F800988BB676EEF28C38 AGBOVILLE5
913,027,661 *5F0D4C78647053D6C63EF5F2B10A83960FCED95D 2-OETV-GEWERKSCHAFTSTAGES
913,027,662 *5F0C29DF512C2304D068084274322419B25EF423 AGrowingConcernB
913,027,663 *5F0EFA16F509ED625228B46BFEB08327577F3B9D 2-schulstaatsrat
913,027,664 *5F0349080247FF9F62EC9AE412C23B7C0A3770E2 AHA1B
913,027,665 *5F07E6F159E383BC48679E220F518D5DB6CBDDE1 31OCTOBER1510
913,027,666 *5F0F0A893E913714F3CBE71253216A717876984C 3ATSINOIZ
913,027,667 *5F04EA130B14AF1638FE6EFFAF03BE3A3A4FB4C5 3.AVAINALAT
913,027,668 *5F049BC0E7690F3C56216A23C4D7B3A6AAF41FA9 3B<-.O~O~D----P
913,027,669 *5F080E57FAD658F41250AED82B3B126BB7F2010D Ak62
913,027,670 *5F014E6176E68F9E6F8D71B33DCE442DA3226BA7 3 k
913,027,671 *5F0691499158F90B3904065F5CB0A21989D15018 3------p**UU
913,027,672 *5F009D24036C9AE2B95D77AA83FCCDE4AAB024B4 ALBUMREMASTERED
913,027,673 *5F09A89B40BAA9F9DD4FF1D4175DCC63DDB4D7D6 3.schauernaehe
913,027,674 *5F0C9CE292314BC9B8DC4E8BFB3AD691749AC862 3SFOR4RMOS
913,027,675 *5F04D2909ED3DDFE383E2EF74FD98D4F46B4E9E8 3THATSUNFLOWER5
913,027,676 *5F0E6D42401A7723B4A9210EC17579EDAF73DF11 41-gloag
913,027,677 *5F06BE26807C2158E09FE3BEA862BB15B4B85327 [email protected]
913,027,678 *5F0074FF7E6A5BD33A611CF562D23DE1445579D8 4CCELER47!VE
913,027,679 *5F08CC31CBFF8ED28E021CC78612C39E75D07A1A 4MELLEMLGSSERVIET
913,027,680 *5F00261FE4362198C5D074CB6F878CE18617DF6E 4PHALLICIZES
913,027,681 *5F0573A97DB8B2FEE1336AB4A9A16A78FDEA1E3E 4SAILINGCHALLENG
913,027,682 *5F0EDC5FE6BAEE9C4AF49E4EF437B66C1E0D039B 4SEDELIGHETEN
913,027,683 *5F04AEADDE4E84CF788A683173908CBCC9895F3F 4SEPTEMBER1488
913,027,684 *5F0E1929BF4993FA78389DEC61DEFEA46D095EC0 4UNTERSTELLTEM
913,027,685 *5F0BCFD9F023571BBF9528864D9A4BED8A86083C altonbloebaum
913,027,686 *5F0F90C799AF523F4B159ABD97B7A8E80FA8C5CA alwn.
913,027,687 *5F03FDEE62BCD2DF43D3AABFC573B2807B21D51A [email protected]
913,027,688 *5F027FA66F4E7870F74D71A802254E8C75DB8473 5ABIGAILKOKO
913,027,689 *5F0C427810CB202EA85CC6F269CB89D5FCA233DC 5BLUDOVICA
913,027,690 *5F0C9D19BE2D76CD2E952572E0513A9392716B33 ams
913,027,691 *5F0271F8B0AB6C0C183D4163D1425C1F0E4CD8E3 5CORTINELLUS
913,027,692 *5F083D4FE2AED2B05866588934536DE9C1B690E4 5CUEOBZZG
913,027,693 *5F02F45943E69DF02698D38D90FF707453D7E3CC 5EHCIOTS
913,027,694 *5F076D878DCBED148FF24B7F887BF29386DE777E amy-leitch
913,027,695 *5F0E38D36DCE2222A2AEDB9ABDFFA39BF7E2FBF9 5-HOUKUTTELU
913,027,696 *5F045F83254C56B984C4FF0E3725C25DAB8CADC0 5ILUVEXCALIBUR8
913,027,697 *5F069CD595D788148CA26B62F30F1CA1D91A271E ANCHOATE6
913,027,698 *5F03E2FF6EF6A5AF9266638FEF6CE2C9A85CCC17 5SUPERAESTHETICALLY
913,027,699 *5F0A524333945AC480CC628B8857C3AD9F9E363F 5TRUCKSBLONDIE
913,027,700 *5F0D15729AD3B987342E6B1B7847389A7CC1C343 5YLDEROVASNU
913,027,701 *5F07E484D231548E5970895099091215DE3728A7 630869 kur'an.okuma.ve.tecvid.iii.kur'ani.kerimin.nuzulu..
913,027,702 *5F04DC5690ED4C4E2C176EC62BB876DD7EB4BFF9 640MARIELA
913,027,703 *5F00A20E389C811355150CB4F281D9977737F08C ANNSOUTHAM
913,027,704 *5F0FF8D37E3FFD0EDC297AC34CDCD051839F66AC 663716 denndieplattformbliebunten
913,027,705 *5F0474ADE95D91D65426EDCDF72770A4C0CA239D ANTOARIYANTO
913,027,706 *5F0D9AE7A62A1F0386AB99480C8DAEDA38D5AAD6 ANTONIABROAD
913,027,707 *5F097C6A585CE70EEBC3A4A56178722F54E4C3D8 ao8hh
913,027,708 *5F0526AE8F0D3BDBBEE9AF149019D3091FBA1DEF AP!#
913,027,709 *5F0CA1432752B2418F7724447FA828CFF281D0FE APERIATQUE1
913,027,710 *5F0247B8D2EBB3BAED34865AAAA218289A8E34C7 6MACHAANNE
913,027,711 *5F02A781E21AD6282FC8DB5EC2D32F8E46F93BF4 6NAIRANIUQ
913,027,712 *5F0151A1554B2E3B4FDAF761148DB768D117EAE0 6PROTISKALE
913,027,713 *5F08C795911836189763B5BDFF0EF21A7E10F094 AQ_9#
913,027,714 *5F0228530C6DB59B5576223DE0DC55E35AA1386A 6ZZYEYQHV
913,027,715 *5F0C55D5A80057BD33102FD215DCFEFDFE166D57 6のアップグレード計画も同様の問題で中止されたため、2008年現在アメリカ海軍は、f
913,027,716 *5F0CEC7E50DBEC51D3786128F7D619D306B15035 AREWEOUTOFREALITY?
913,027,717 *5F0F1207CF1878923E0792970616BC90106A9F61 aristeased
913,027,718 *5F03C0E0AE1FDE78AEA2DAB216C17469C4766169 7FROGRAPER
913,027,719 *5F0F8049E106CE7509A5D67A908E7DD6FE58BBD7 [email protected]
913,027,720 *5F04B1B643BE9D8580AED69AB530CD1C3B8E09E4 arturomackellar
913,027,721 *5F08E387C9672990739B22FB55F24C2068B1D3ED 7m8q20z3198f3
913,027,722 *5F043DDEFF3CF