List database


# MySQL hash MySQL password
913,000,001 *5F013550F9E1B0E4E71E2F1F4B4E9A37E95845C4 GRAFERTE4
913,000,002 *5F050E47B80456EF37D9EA9FBD7DB11842869895 GRAHAM.CLARBOUR
913,000,003 *5F0093EE342D5DCC55DE1E8E69F581058400D743 GROWABLE4
913,000,004 *5F0E889348B1D3D3C66F5AA90E23E25B51563B8F gunner51
913,000,005 *5F0F5619B32A8A043D678417FFFE0CC786DE7459 HALOSEN6
913,000,006 *5F09E2DDC5AC7EF55E4649681F8CD18A098E8BA2 HANKKOLIN
913,000,007 *5F06C8F30B1BA231E0C22A74C4E033E6EA082605 HARD-TO-FORGET-HER
913,000,008 *5F08518D44BF2273A8E63C6125F253952E26FC42 HAUSMEISTER
913,000,009 *5F0FECAEE8D3D7E2B0E621E8BC8BA20325B19024 hectorb0
913,000,010 *5F010A11BC4C7EB500D0CCFCC87521BA0FE2D009 hells4
913,000,011 *5F0CEE3EF86A0E62C63EB1C9E8EA3D7FCB7A991F HERTHE
913,000,012 *5F019A32C0CBC5FEED5047691D0BE42918CA7725 HHEAZLETT
913,000,013 *5F0C97A23E7D26CE3DC2DA12EE0F61155CF27C84 HIDDENTRACK18
913,000,014 *5F08C86A0B998486BC41E164E9C8AEF929B09F5C [email protected]
913,000,015 *5F0B04F0BCE76CF3F11EB53E4FAA18842E2DC955 hongdadson
913,000,016 *5F0245E3AE27C3E4E04E3083B28D63CFC4331C99 HONGFAULKENBURY
913,000,017 *5F00F3FD8B3A17230C20DCD08A9AA9523ECF3D1C hoplomachist0
913,000,018 *5F04EFFC166DAF081A6DC93F4A4068178734EFF3 [email protected]
913,000,019 *5F0F17D7A38F7B2E577514EFD066773BB120394C [email protected]
913,000,020 *5F063B022DCF24DDE5841E4F69929CDFDAC3115F huracanared
913,000,021 *5F0448DD008639D8714A1A8284A79F18CC2AA772 IBOUHOUT
913,000,022 *5F029BF84FA7AF842789DF7E85D8C0DA6A048386 ibwt
913,000,023 *5F0BA2E7072E638FAC0A37AB6BB2F0B0113BA7D1 IDOISMS4
913,000,024 *5F0FBFB95899BE62390360219B2ECCA2DFAF9DFE IGUANODONTOIDEA
913,000,025 *5F02E3D14F8B740DB9FEE5C0AAC0FBAC57817A62 [email protected]
913,000,026 *5F063B7DA896B42BB6CAA12D3E105EFE3014E8B8 In.Freundschaft:.ZYKLUS.V
913,000,027 *5F0455BA163C2524A68C1B5371E8D49188486D4A INKLUDERA8
913,000,028 *5F09A8B8129F0060719D32000F6C109708247A2B INTEER0
913,000,029 *5F0B756153BBF4BF26BCC90C0C8439AE30627AA3 ISUZUAXIOM1007TALK
913,000,030 *5F0266CB516CB4596EA56C57316D28B8204B3FB3 jacobrodriges
913,000,031 *5F041F3DC0744BB8E0C31E35A64EE6EC759CB8EB jaeaephing
913,000,032 *5F0E9C3292B20589B4774F90B38C7CEEE6661682 JAMALJOJO
913,000,033 *5F0829BD3CBA2D5FE689F6A0941876D4D864DFAB JAMARDEFORREST
913,000,034 *5F038D6CA69BF7ED8C9DA38A32B12A342D7BC12F JAMIE.COAR
913,000,035 *5F09E95B99611FFDB94E8B2F97BF77F5B15F6634 [email protected]
913,000,036 *5F0D7B9FE3F862AEC267B44929B84A1A7912A26F JASPERHAUSMAN
913,000,037 *5F0F54319B9C61422FEA885AC6EE77D760B64E4A JEANMARCA
913,000,038 *5F027C379341EA67CC3D00D6EB2DD21371C6B073 JEJUNOTO5
913,000,039 *5F05218E6D729564A5C64876E1C73D9E1978788A JENNIFERVIKINGS
913,000,040 *5F00275964C3E242E10199D438181B620C329E6E JERALDBUTTERS
913,000,041 *5F0C7FF4794B5C7B76C67C5A388EA52F071719A9 JERRY.LACHUT
913,000,042 *5F0CF2674A391459E39A151550811FAD9D32CC27 JESUSYOUNT
913,000,043 *5F00D74967A099054FF81C0E66528EDAE1825CC7 jewellbuja
913,000,044 *5F0B736707EE2050D3C7B6E33989EEBF1CDFEF22 jewelloldakowski
913,000,045 *5F0AA5F69E29DACE9C68DE4C7FE0D7BB8C748FC1 JIM GULLEY
913,000,046 *5F064E082DD08836F8EBE3496C433F250E5B1FFE JITEN.MISTRY
913,000,047 *5F0206C3B173DEC885BC4047671709107BB45204 JOAQUIN.SANDVILL
913,000,048 *5F0CD18F4FA64E8B504A9C5D7BEE7DDC015C9C83 JOEABELE
913,000,049 *5F0ABE0072D8A2630218D96292DA6552FFFE68E4 johnny-mcnab
913,000,050 *5F01D0D656A35136071431EAD92456CAC3B3A0A0 JONATHAN.BASHLINE
913,000,051 *5F07EB2B69B35E5A757D30B5DFAED299D051A8D3 jorgejedik
913,000,052 *5F041EE5ECFA8008BAA4A208A94F952D7553DC9F jorge.munera
913,000,053 *5F03A90CDD7B25451C82611C87A6B624C67BD0ED JOSEF.FOECKING
913,000,054 *5F09252BB219003AC6C78B4D893A61665287E410 JOSESOLANO
913,000,055 *5F00E5B122AE6E521CB58DDE7730FCA1990AAAC0 joshuaovercast
913,000,056 *5F0E4AE89AC467BB1044FDDBE07C0B916E2E5F19 JUANLEJA
913,000,057 *5F02EF62733836D5453863CCDBF252818327C763 just-carnival-cruisescomjust-carnival-cruises
913,000,058 *5F0A8F0F4679922021C1F6E7FF005E82468EF73D JUSTINGK
913,000,059 *5F0B4A9D237B2B6F73483AE214A7765EE2215960 KDYH
913,000,060 *5F049F801440B3ACC98CFBB9876F427323D6DBAD keith-billing
913,000,061 *5F0485520BCE6272751551B2A9544C6DACF1BC13 KELLYEMBELTON
913,000,062 *5F0692DCD071455C26CD6077B88FCBDE324BA686 KELVIN.JENG
913,000,063 *5F01D88F90100F57D2295BB573912854055A6D7A KENDRICK.CHERNE
913,000,064 *5F0E9AED8648FB6AEC03D851ABBCDD06E2ADFF0C KERRYMUELLNER
913,000,065 *5F007C132E98F9AA7839FA901CEDF92C7ACB7853 KESSIAH!
913,000,066 *5F05BC805E78BBA7F1AAEB0BD69A2ED5C7E4F1FE KOCKICOM
913,000,067 *5F07AC9BF9162320F5BA55DF6AFA229FC5DA4B51 KRISTI.CERTAIN
913,000,068 *5F0FEAC19B2AE451127B95BD53C9D090F657ECC2 krisztina.pratt
913,000,069 *5F0CE5AB4FEB722B6F2D6EB016A1557A9BAB090F k~s5
913,000,070 *5F0CFD5B97B85E37A1FF3383336EDBDDCC61A71E LABONDE
913,000,071 *5F00962E98B736895866E19F49E24A32A962E1B1 LAHLAIN
913,000,072 *5F0EEF0C587B38012AC1C16DE432BABE9166EFC7 lambadad
913,000,073 *5F014495CA37D241DF5F7E9475088F30D85AC164 lennyhottel
913,000,074 *5F0096A649AD29A4A1B37C0D90B6FC7FAF260F34 [email protected]
913,000,075 *5F0884441535AAFDB007B76ED5FE3B912A48D1BE LIDELSES9
913,000,076 *5F0A7BA2048C2AC8C57961300D7C82E598DA7BDE LIGHT.OF.MY.EYES
913,000,077 *5F061BAC06254DDE07D5E8136F96ED8D45B00A17 LOSTINCHURCH
913,000,078 *5F07899D3737AD420479CE152ED0BECB703A3E9F LUCAS.SHAUL
913,000,079 *5F0E31553466B9CA9F3769D0A8C5907A27CC0DE8 luchtbellen
913,000,080 *5F06E7E22C69BE578956D7BFD330A1E8BCEEBC0A LUTHER.MADDIN
913,000,081 *5F08A26602F4B5D228DCC176BC1B9B60CC304663 [email protected]
913,000,082 *5F0F163F20801BD3A687E9C0DECFB45FD74708A6 [email protected]!sm
913,000,083 *5F02014A7890FE3884956F08455451CD6A3500BA MA1S0N0C
913,000,084 *5F0D87C6F1BC7B6071F5BCF278F1E29BFCBA6CE5 MADAKCAJ
913,000,085 *5F07F068A15F834AC1D64521B95A51C904A691D7 MADAMA BUTTERFLY: INTERMEZZO ATTO II, PARTE SECONDA
913,000,086 *5F0BCF711974B7EBB6DAE3084BB72EEF1926772F malcolmtheunissen
913,000,087 *5F0051E4ABA02C16CBA36CD02185EDDF705C3EC1 maluah
913,000,088 *5F057D05DAAACF7C6DB1711DC6B4A500B27ADF12 MARIELAROMAN
913,000,089 *5F058E2EA8B08DDEFB77375F688BDD3C8815FC60 MARTINDIVIS
913,000,090 *5F07F16A7CEE37C9622285485BF307CC391D914F MARYVANDEKIEFT
913,000,091 *5F0682CACF0E1BAE331B0C72F59E4CD9EA57D567 MASKATI123
913,000,092 *5F02007F9102A3E5D00B27B695F432B70E918402 MAURICIO.INGRAN
913,000,093 *5F07768683CB36CB54A074DDBAA149C73CAA76FA maximeeurope
913,000,094 *5F0EBF8493B93B22CEEAC1C72D56F314A1F682A1 MELÓNA
913,000,095 *5F03D86327F8C512A3DEA10663E1F9A2AC4D8603 MERVIN.REGNIER
913,000,096 *5F05B738A6CAC4ED6D3A30B5B1101134CCCDCFCD michelle.thony
913,000,097 *5F0DA841CA66AD01F897142308E92A567A47851D MIGUELBLOCKLINGER
913,000,098 *5F0F695009C56C4792D48D56F1C2D10FB7FDB543 MIKECOLLEEN
913,000,099 *5F0CA5467770B0D01A5C2C78C1FBCFCDB79D90C2 MINELAB0
913,000,100 *5F042D9034135E25B653CD59C108AE31B64E1821 missthugglover
913,000,101 *5F068246F2CC57EA37168C015BF96085AAFD4091 molden9
913,000,102 *5F03DF3AF1AE334C6531440F4059C9508CC6CE6C [email protected]
913,000,103 *5F08AD489D9670CBC9A711F54B4ED142B7EE3F74 NAKAILANAD
913,000,104 *5F0C26A18011EA8E3BE7710F8032A3DF593052E3 NATHANIAL.ZAHORCHAK
913,000,105 *5F03EAB1BCC7AE82BDD639E22E1D0E7475926F9A nc0n5uma8l3
913,000,106 *5F02A9C91320CD956CD79C52C393FF6ED7B71EB7 ndrppng5
913,000,107 *5F090D14C7D15A27763464C1CF1710235189FDF0 nemortno3
913,000,108 *5F0B2B1A266C1AB10683D860A3EBADCC2029690A NFOLKEN
913,000,109 *5F0BDFCC50ECEE3E4DDFCDE0D380657ED51BDD60 NGMARIO1
913,000,110 *5F01E78903A611CD9F96F61ECC6176C78EC2D023 NHYPSTTZ7
913,000,111 *5F0A9726D7B84B7B7D317BBAE578EB4E937DA474 nickolaschuang
913,000,112 *5F085E6251D51CEF57B808F9914E24ADFDAB9181 nicolawarburton
913,000,113 *5F0E2909EF818BDADC4748E4D4EEA80B1D4909B4 NKOLAUCHENKOA
913,000,114 *5F010799CBC9498CEEA50795F6902B074F2002DF NNAMKRID
913,000,115 *5F0E545647275473F46A597A5767C710C3D5BAB0 NNMSCLR3
913,000,116 *5F0FE70A7374B6C3F7B9D08A7DC97EA159B426B8 NOLAN.BOCCANFUSO
913,000,117 *5F0537FB3C365584F865DC722AA76685F76B6AB6 NORBERTOAVERITT
913,000,118 *5F062A2DA4E6C2A12317A091EF3372907513B242 [email protected]
913,000,119 *5F0B1D32ABF13ABD51208544EB8564723A7985FC NSGAMER7
913,000,120 *5F0B585CB5EF3E4E067B34C587B0E8E0AC74B474 NYX3
913,000,121 *5F0A2FC03F3A6509F4A9C649C49B032A1BB31283 O9411221378
913,000,122 *5F01ECF7D1A6CCA905CF53911B86263643CA1B88 OBEAHS
913,000,123 *5F068B5CA386C46C6DD87000C5278FC38686E708 octavialim
913,000,124 *5F0633AA01F3655F1CCC18094829443C75F952EC odigram0
913,000,125 *5F05ABCAE6E3717F36C615D3E141B4FC474C74CB OLIVENBLÜTE
913,000,126 *5F02CCA874473FCEE76DA9C693ED4C2CB2918BFE }O{o~d----p
913,000,127 *5F0452621272D199D5156006C3EDD798DEB9D67E ;) O~ O~Q====B
913,000,128 *5F0293B0FF9F1192048F3C5CF089F633592288CD openedsourcebsw
913,000,129 *5F0B63D7FE78C0C69F172018F568E7E6FEEF28CF [email protected]
913,000,130 *5F0A4A7E2805B409997BD2922CDC2D043305C0ED OTIS.HOPWOOD
913,000,131 *5F0A646F6DC9586A1DAEA8977AF00F10DA5C1BB6 OTWORAMI3
913,000,132 *5F0CE4293E0BD1E0523338211764801AD6049CFC OUTSIDE-(K-GEE'S-CUT)
913,000,133 *5F0D0E1DC49FB0331B33EA7F1B89BE36B4F1D3AA OVASSACN
913,000,134 *5F054E49A524A4A7184E5B2B35BD8D2239049463 OYAKATA9
913,000,135 *5F030E58ACE2C95AA6B621C491E8F00377F4AA52 PAGES.BESIDES
913,000,136 *5F0F57661DEE2399BF9D905EE0E807025380FA96 PAIKKAKUNTAHAKEMISTON
913,000,137 *5F0DB6B7E9E710BBE2994FE1D2726B758F1B5F60 PAMPINDONI (MEDLEY A)
913,000,138 *5F09AEFDAF13C278425BFBEB0F80189D31672F24 para1y7c
913,000,139 *5F0720B514B51A2F1C51FA5D8F29D350AFA01317 patonfrancis
913,000,140 *5F05B9965680B990590E3B5DA6D8A23C73345709 [email protected]
913,000,141 *5F08A5EFC717BC83DF7C4934A67F0413FC9B2BC2 p#####)~->-b0
913,000,142 *5F016506FAFE36A271ADD92EFB4E347F0C24D52E PERVERSENESSES3
913,000,143 *5F076CD43D202B34797A7E0E42D64B9BA381765F Pito-en-pus
913,000,144 *5F030FA0B8520938E27C27E9B0F7FEF496FE5745 PM4AN
913,000,145 *5F023FE9BFF385AB690E3C96B8274CDD2AF6A156 POCOCUR4NTISH
913,000,146 *5F06E3918ADF88D62D3EEF8CFA01BB5713223D2E POILOBRA
913,000,147 *5F097112E21846E2F76CCF5D132906B6B13AFD8A p)~O~o(0_<)
913,000,148 *5F00A1F6D06AC8B6C5F0DC3352A90C62682408F7 postcoordinated
913,000,149 *5F0C12165015CFFF96D70B5568457B867D1F58E6 p------p~o~o)o(
913,000,150 *5F07C11AD07FF05FD76394E1978FBE995BF43989 PROPORS123
913,000,151 *5F04D8E6FF005ED7534FDBBFFB4C5030D4FD0646 [email protected] ~ ` SPLAT
913,000,152 *5F041932211BBC27204B0AE4EDFFF1A1FE047C5C PUNAJALKAINEN
913,000,153 *5F0656D54D83211CAA389A57B5CA0A89046A457B purified--p-y-uh1-r-ah0-f-ay2-d
913,000,154 *5F0A3AA9B4B6BEDC8A2B9364D325A540FB8211C5 [email protected]
913,000,155 *5F00FA860858D2A4AEB5D5EDD036B3E3CA673A28 pv657
913,000,156 *5F06B01E4A59FD7CF310BED9F3E3CA883B328D94 [email protected]
913,000,157 *5F047E9EC9E467442597B3ED9EC94E699A83119F qljhtpgn9
913,000,158 *5F008E019C9A59F59F116721F7D97E44294D2AB4 Quaran7n3d
913,000,159 *5F0B38EEAA8BDB6E61B07BB3FB932DD66D016CC0 quarter-end
913,000,160 *5F0E6B0C2E39A4DD6D39365AA9499BEF4D2FB21C QUINTIN.OELSCHLAEGER
913,000,161 *5F092FCD922EBEC5D04E46CA1E686798C2633AAB ramonquery
913,000,162 *5F0367F24347CC4CE4C743E62A412520F63F7E77 rasnz
913,000,163 *5F0B69211325D85D7195EA4A59853C02F5D5019D raymonciesiolka
913,000,164 *5F06AF69B4E876D102C1482B0D240858376E58EF raymondaudier
913,000,165 *5F0C86662C3E58ACE694A88D1CF43F127D5B6D8C RECONDUISENT
913,000,166 *5F057CBB7387D31370960C46F80A0A521EEE28F4 RECUSADORES9
913,000,167 *5F018B0530283C553787F3D830C45FCCA1A33911 REGGIESTORTON
913,000,168 *5F007CC217542186BDD87ACC9E25B0522B1B57CF REGINALD.HOCHFELDER
913,000,169 *5F0235A571D92EB2C55F4B12F6FB9B11E99E5F0B REGINALDKINNARD
913,000,170 *5F09AA296D7F71BA6BB5C39FDBC869C3CD2A0909 REMEMBERDATABASE8
913,000,171 *5F06AF9434FA748A0C640426870E4B21ED4524B7 rengl
913,000,172 *5F03190DEF43F501CC16E3FCEABDEF0A9C988C01 REVELATION160PROPHEC
913,000,173 *5F0719F2DCAA750100E81CF8003C27A3BFC23183 riannessi
913,000,174 *5F05AEA83188E9A39C10D174A1E536D8F68DE21E richard-cruse
913,000,175 *5F028D854B4303BD46601C663A4725FCFA235EFC RICINTIMENTI
913,000,176 *5F0303F949416664586454E95152858C8B672829 rjúhó
913,000,177 *5F0F36D2C4CFF8C82AC7F0A4D67B19798050ABCE ROBESPIERRE'SREMARXII
913,000,178 *5F0BA99CB1132D47AC5870495FDED66EC4B0E446 robingovern
913,000,179 *5F0EDB5E7B6B7159FC46BA346F18ACB6368D7CF7 ROBTDURRANCE
913,000,180 *5F0EC210357F8EEC421022B8661E60DAED0CDEC8 rogenio9
913,000,181 *5F0DB107A185BD52DFA61654676B850B50C6C237 RONN KESS
913,000,182 *5F0A9E669CB20CCEA54B0419EA2EEE5CACE4B10B ROSARIOSPINAS
913,000,183 *5F026D401FE2A9ECC50057CB1D5A003A988D717D rosetim1
913,000,184 *5F050BE59BEDDFCAB1BC02582237E865097CBD8F RUDERORGANE
913,000,185 *5F0AC66A04D30EAEC97140976D04FB0ECCB9C608 runnerchanel
913,000,186 *5F0B7B1C2C9F91C63A65643E19834CA25735AC56 SADONKORJUUJAETTEITA
913,000,187 *5F0630FF7160D80316F81E5A33994B98A17E3051 SALMOURÃO
913,000,188 *5F0DB41F873F1CCCA91D7E1E35BD4C31DFE3633B SALTIGRADA1
913,000,189 *5F04F853195E5667A35157D92AFA04D93F26B532 SAMUEL.DREUITT
913,000,190 *5F0AD2CCA4AFD776135B9A85B8180DEBF99C7599 sanyajaffer
913,000,191 *5F06A10ADA8DA2CC832550FE634F7C246F0B0945 SEADGANGESES
913,000,192 *5F05940579D5BE29C1BB52E5B054DDA02412DC56 SEDENKZ
913,000,193 *5F0BE8E38F2F7C9C35DD53320671A3497E84C72B seeingyoucoming
913,000,194 *5F06F5A585A71DEBAB597DFDF2F418B0B255549F SEHCILGARTNIE
913,000,195 *5F086411C754AACB31FDFD8D98A4036BCE97C085 SEILTUOTS
913,000,196 *5F01785F680BBCC36F8E6F6F445CC9591C06A586 selacidar
913,000,197 *5F0969C6E79AB1F36495CE5F088DA206D061F6B0 SHAUN.CHRISP
913,000,198 *5F0688ABE68F7BC321C694EBB13B0111FB662B4F SHAYALLA
913,000,199 *5F0976D5207BC9B0F4FC836B1074FB691BFCFCC3 shoring2
913,000,200 *5F09D593543F36EBD0CB2A3B2389D2779F9FD937 SICKERNDER2
913,000,201 *5F08ABA2D3DE3C3DE7F2DA9B6445F4C0978F0248 SIDGRIJALVA
913,000,202 *5F0A3301012C170E003E1E49656D2A0DCD98935E SIMARDNO
913,000,203 *5F02C0051FD5F22CE6A12F28CC10B1010BB6136D SITETAUNSA
913,000,204 *5F08566CBA821C78AC5E253EAD1E706E6714DA69 SJEVERNOKOREANCIMA
913,000,205 *5F0093838272489FE211373ADE9D73D9A0B25AA1 SKAPELSESFORTELLINGENING
913,000,206 *5F027302B8845F2B6140C68C0B92F2F93CD9D0A3 SNICKERCENTER
913,000,207 *5F01A1ED1591A3A4F70D6364AE0775914FB25716 SONG SPEAKS (FEAT SHIHAN)
913,000,208 *5F06CF82D9374B26ADC42AF946C930CFD2B14669 SPANISHBENJAMIN?
913,000,209 *5F07D0BD50D6608F69217CBAC49C4436122C8EFC SPEECHYOUNGGED
913,000,210 *5F07C023F907CC124C4B40E0A3BD2BC41F9D681A [email protected]
913,000,211 *5F0BB4DB6886A32919CCA0BFFEC538E45CCB7377 SPIRITLIONKINGGED
913,000,212 *5F0FC4B3878B6D72DDD58F68D31F1D6FA750D801 SPLAT~.<=P
913,000,213 *5F0CEE4A09F493106E06E68075008F728116E80B SQUAD.109
913,000,214 *5F08F59EE0F61CD3BE5F14EFE6026B8CC6EAFF05 SRINIVASMIRIYALA
913,000,215 *5F0B3BD115E9C3A4BE3BC3BCC874DEDEE7C72517 SSULPONALEM
913,000,216 *5F0B23FA7403D0A7F6CCA6DC57344A2F02A5272B STANLEYDUFEK
913,000,217 *5F01FAE7069A7AFE97D5EDD28092EBC2D5BA6E64 STANTON.SANSALONE
913,000,218 *5F012B1688013881E2AC2B4DE3750C6843F9CDA9 STANYEDDO
913,000,219 *5F0E12E2C918E46D8E3F534AB93308C4772ECC8F starcrossed.lovers
913,000,220 *5F0AEEE7E90BA6CA95CA75188218DB96CA02F191 STEPHALPHAS
913,000,221 *5F0F69B05439BB5C9BD065679B2A3E645F4B90B3 STEPHANHOCKING
913,000,222 *5F04D2E6F4EE96F8B998C96F7D14654A57213324 STRASCICATE1
913,000,223 *5F0CC89DDA180A0315B7863214499294D039A91C STUFATO8
913,000,224 *5F0628B690B54A09F93D9A752D808604A2D49858 [email protected]
913,000,225 *5F0F134EE937B179DDB9C311C48DDB5EE9896B8B [email protected]
913,000,226 *5F0B89EDA317A8498AA7CBCA1C1DF0A0D7D441DF SUSANMCCOMB
913,000,227 *5F04967564F5D524E42EE7068889C2D90BE892BD SYLVESTERSTANDFIELD
913,000,228 *5F093B211AC4B4979DCEF7ACEA27A4C78F1D7091 Symphonic.Overture
913,000,229 *5F06AC7ED71B91BA94DF4E47006B91DBA2F25C37 SZOLGÁLÓJUKNAK
913,000,230 *5F083F10A5C551097ECF48AB889C995DC0FF9CFC TALK86.1.184.3
913,000,231 *5F0B54E62B0BD75BD6632291F77B6F200AEBE8E1 TALKGELAI
913,000,232 *5F0696BCB19D3289032651259EC89E083F5648A1 [email protected]
913,000,233 *5F08058DB1766825A8AC2A0A1D824B90B9C4F3B0 [email protected]
913,000,234 *5F0E8EC6DE3F0B179B6B033D5607B0FFF399412A technodwight
913,000,235 *5F0489595D7D3A29246A318DB441710FA6E7784C TENGOQUEIRME
913,000,236 *5F078F7C52323B703D60AA1B91EF2D92148FA190 TERITORIAŁE
913,000,237 *5F0CC0AE513A5FAEE39043E66F2D8F809116ED84 TERRENCEORTEGO
913,000,238 *5F0CAED70E0B2356DE1CD6AA79FCFC3BFA8EC523 terrencetaddonio
913,000,239 *5F06E44B9A85B1E78582DD29F7AD7D49A185D86E terryehrenzeller
913,000,240 *5F009A75BA116D11271BB11D1549F075B12B4D20 tertius8
913,000,241 *5F007FAB2286BD71EF558C4B509BFC9F03AE6C6A [email protected]
913,000,242 *5F07011CD71DDFC248B4436DA57238B5E7913EB7 TGRANDUSKY
913,000,243 *5F004D20BF80E47A5589C308280E0F4BD51A8A13 THAD.COSTA
913,000,244 *5F0E0B96FE3D220C3E3C80F9605617D87F529181 THANHBOULAIS
913,000,245 *5F0F340EFAAC25FC7C0BFEFBE3FF72FEF68B8CEE THANHSANE
913,000,246 *5F028AE742B88B0A593A780DE1F89A5A13CE6E0E THEAUSTIN31
913,000,247 *5F008FDD90319F07184A23DD3813E0D4853C8736 thebozo33
913,000,248 *5F0BCDE5D2126D8C1D93DB38EE8F80E8533C36A7 THE FUTURE (TAKSHAKA VS SNOG VOCAL EDIT)
913,000,249 *5F028F70DA9B0B1D7FD8C99C6CECF96F6EB562CC THE-INSIGHT-AND-CATHARSIS
913,000,250 *5F0855D782EA4A2A29250F1675F36D819462F682 TheKid:Er
913,000,251 *5F0DBA8AB79D223DF0784EBF0D440F09FC057484 THE.TRUTH.YOU.DREAD
913,000,252 *5F0FBCB6D5F5AE9D1E18F22F6B21F87E2581AE86 THISLITTLEBOX
913,000,253 *5F03BBD068481F5A2A60DC3EE9788F144A185950 TIMER1-=-(STRUCT-TIMEVAL-*)-HMALLOC-(SIZEOF-(STRUCT-TIMEVAL));
913,000,254 *5F010FFA360F883E07E219BB0BA0BA9855226A9F timothyodo
913,000,255 *5F0EEE4D38AB3F338DC8ABD5234CF21CDEA84E32 tireless1
913,000,256 *5F026E70898A03037D19EC23DA378303CB436D28 tkmbabo
913,000,257 *5F00A87F681E1110FB1C61A04EDD86CE73142646 TOBIAS.CANTORE
913,000,258 *5F0575AD929FD012E3F3594E425495B66B194EC5 TOGETHER.AGAIN.
913,000,259 *5F0A871D51B2EB8D0FF74816E8F54E55C6BBC6F1 TREBREHEILLIW
913,000,260 *5F078CC98C1EC05D0C3BEB5010645D14CAE0A479 TREMENDO INTRO (FEAT. TREMENDO MENDA)
913,000,261 *5F0A79103CA9D24C5C9DC9EB3F1B81C9823695EC třídobá
913,000,262 *5F0DBAD22E070C711ADB2B426A0427EBC92F7C77 TTRENU
913,000,263 *5F01CD2BCB03E6C67E11929F48A358B026845A07 TTW400204
913,000,264 *5F07CF92F94ADCC13E3CF9D58E08333F03243763 TYPARDUN
913,000,265 *5F056661DDCFE33F5113CDAB5B2F63B6188698DA TYREE.GROCH
913,000,266 *5F09320BE30FB86EC73FE9A911552850B8EECEDC TYREE.WINKLEBLACK
913,000,267 *5F0C5990C5F597D33880CAE3532C240F969D2A34 tyronetenharmsel
913,000,268 *5F05F630C0A270F6ECF0709E1579D63EE7C2F2A2 TYSONLASPINA
913,000,269 *5F0577C3DEC52D94B439341822B40BE7CFB0CA58 U&<`
913,000,270 *5F0069DF5056897FD04C9B914717CBC8F2CC7956 uber-mafia
913,000,271 *5F06802A3DB82F79F4B95486CC6C0C29A45359F8 UDSANERINGENS
913,000,272 *5F0EABD56740EF12469B18AA611DCAE8A989BDE2 unamicably1
913,000,273 *5F0383234A782AC08AF2AC772B8C60B26CAC16A9 unteroff5
913,000,274 *5F0AAB7806B39A674199DD91095621050AF72446 UU**(-8
913,000,275 *5F09A6BED2483E3E8259F8C14B2E74AD4924A0EA UZZI3U
913,000,276 *5F02F7F91BBC76EA3C4E74243413AD910E4556B1 [email protected]
913,000,277 *5F05AD6A92482CDD77880B9B730B6E104019A949 VEGLIARDA9
913,000,278 *5F0FD605F9273AF9CC9660A1804AE369D61CBDA4 VENKY-MALLEMPUDI
913,000,279 *5F027D029B541A6212EB327A497EAD913DAB9D52 VERKEHRSTRAGER2
913,000,280 *5F0DBAE3B543EF87714FCB8199198D705BBCE050 VERSORGUNGSDIEBSTAHL
913,000,281 *5F0F711F2502F52FE18E8B2530251DDD9FF67C08 VICKI.COY
913,000,282 *5F039E217F72CFEF98DD1F977320EDD3E0F2CFCB VIKTOR HOLOVIN
913,000,283 *5F0A3A347E668798260437738AF9261CCEB3109F vinagames
913,000,284 *5F0F2E804E38BCD9BFBE0228D4378EE979127BA8 VINY.ANGGRIA.RACHMAWATI
913,000,285 *5F0A806E0F56E2702382A8913ABF3C951B75CB0D vinzichavan
913,000,286 *5F06E549604A83729E5FAB479E04A49E4913624A VJEZDUM4
913,000,287 *5F03CD9175A75B8F36BE410AB1B524D91902BE24 VLOEITJES
913,000,288 *5F088A9B690B54025D4F4FB21C4DFE4732773E61 volijveriger6
913,000,289 *5F0865D68DF329CF51BDDEC0869D899DBD19694C WALTONERNANDEZ
913,000,290 *5F0B1395C5093910C91342838E030F6970396AA8 WALTONUMSCHEID
913,000,291 *5F0DBD224312D74F7D7B09FDF66657FCF962E488 [email protected]
913,000,292 *5F0989417A8C66976FC1867056B09B41318CEC7F WARDAH ALAM
913,000,293 *5F0F277679821613CB62C58A48EDA915E3F32C18 ワスプ(WASP)級100トン
913,000,294 *5F0EFDBE778AAF792546CD1522890134C7F85D1D wayne.a.hayes
913,000,295 *5F081EEC2CF9060EC9272E623A0BE2F91CB46F8D WDRZJDN4
913,000,296 *5F04A2177F1E19D779A2CA208C88BCEA229C2592 WEGISS
913,000,297 *5F0C5E532A9A0C6F1AF2BE548224A768D54508D6 WERNERHARNISCH
913,000,298 *5F064B9909F8A11D1B35E31BE202CEF1B14A114A WESLEYDIEMOZ
913,000,299 *5F0D3F3F28C9B5474E06A9740DB5D5170A19458D whynam
913,000,300 *5F0D09F8A328B5AF059438A5768F0D6584A6CC5D wilbersitko
913,000,301 *5F0101DEB238748F180D27726CBAFC2D8E891DFD WILFREDSIKKEMA
913,000,302 *5F099C1EE133D7CF63E2792A6F93AD2C5F354F9C willyne.williams
913,000,303 *5F0EB43A3D79C558470E168E23C4A6D256A39966 WINDABURCE
913,000,304 *5F06D2D670FC82A22DC7320818F0BB350B126A13 WINFRED.FRITH
913,000,305 *5F06A9F9004FF9AFA7754A90503321F17E677939 WINKLEIED
913,000,306 *5F01E6103A40EA455A410D653BC9236EF9557F4F WKO$
913,000,307 *5F0672FAF517CB1D6F53E47FB548A560E7ACC712 wojsiatycz
913,000,308 *5F006D742816B138E30ABEE4C058621A3CFC5DCB WORD.FOR.WORD
913,000,309 *5F0741DF40BDE911007A2410CC987F516FE57E87 WWW.CLOUDBASE.EU
913,000,310 *5F0AA41F66D34F97DC460FAFC1211E4048BE36F2 (x)-~-`-<-----3
913,000,311 *5F09EB695F01FB0B5F353D7882E6B6D045E2C5FF ,xandros的ceo
913,000,312 *5F088DC6FCA9BF0EF55227EF3E46CC13FD16508B )x(-~-<==b
913,000,313 *5F0EC109C9896FB7D04BCB39E827E35EE5ED5428 [email protected]
913,000,314 *5F094F9B85D4B7260429205D6A843494A2C58D23 [email protected]
913,000,315 *5F010A83453138A270000EF3F4E64A50E831DE2D (X) ~ ` QP
913,000,316 *5F0D4C0C7356753ACE0C5389E73CCD326BEEA99E Y1AF
913,000,317 *5F0EB30BC99F64C27A4B77F7A0CBD5468D78597E [email protected]
913,000,318 *5F0CEF485C8DA466FA303CEAC592F854A2189E0D yaser-abu-taha
913,000,319 *5F090A869DCD287CE7B4DFA16067C0913523D960 [email protected]
913,000,320 *5F0F8B9D181BA70E9333CA17E1C4979F98C6870D YIRALOUIS
913,000,321 *5F02472164C6BB41BFBBED45AF9BE6A53F3DFB0B yogidog4
913,000,322 *5F0B4209185855F8F96AB21EDAE61F51BF784107 ZABILJEIVI
913,000,323 *5F0E5C8AA01AAA0CBDB430C0EB66B72916A5D4F1 ZACHARYKITTEN8
913,000,324 *5F0F0154DE5D62F07AD7B24406C425340BDCE346 ZACK-WAY
913,000,325 *5F0B8DC009BE4FEA289CE02EEA56733B53010B46 ZEIMETBSWING
913,000,326 *5F0DD0E021DE81F3EF1E0055734CB5A00544E008 ZENOBIA.RAMONA
913,000,327 *5F01923F0D369D962929D3D86B27036E873B160C ZETHROSELL
913,000,328 *5F0AA69D75D53E246A172EEF6468C1A9D337F850 [email protected]
913,000,329 *5F0CF9ACE93DC678B60CFDC9E9C014611D92B0BE [email protected]
913,000,330 *5F099F83042516C472E6AD3A4355E0A4561DC4B4 zitkov
913,000,331 *5F0DE981CE154CDA825C6081425D766073D3A7BD ZRYDZAK
913,000,332 *5F0F021A9004492E6700AC234962C385B870997A ZURBIG
913,000,333 *5F066AD21BAEBE521737842E4D3FAE4828E554FD ἘΝΗΧῆΣΑΙ
913,000,334 *5F028DB6F75D31369447DB48FF4F1928A35C1DC9 ЛЮБОСИВКЕ
913,000,335 *5F0F69EE8E47A84F4626A5CA3D1B64309722E91B МАЛОПОБІЯНСЬКА
913,000,336 *5F021B759812675CD4ECC38752CD8DF70B78C43A ПОНАКАПЕХА
913,000,337 *5F04C090680C2DDDCF7241BBA1F38B69BE59FEF7 РОНІ
913,000,338 *5F06C896AA5C381E2AFBE2264D72309C96316B63 СЫҒАНАҠТАРҒА
913,000,339 *5F0E3930A30955D0B28DFC3AA8A601FF3B9FF54A ЭГЭТЭ
913,000,340 *5F03FE43E9BA21C49374885CE330E87DB12A91EB 『右手をあげる招き猫』PHP研究所、1995年
913,000,341 *5F0EDBC5E5FF00D136844013A5E798BCEA8608BE 07101892
913,000,342 *5F0EB29B0ECBFB2CDE3F307C7DB78ACE1A685D15 1295176 pizzat-voi-my
913,000,343 *5F00B91E6FC8F2BB7FF67C5B1ED088182AFE53AD 1302691 WHAT-A-WONDERFUL-"-WELCOME-BACK-TO-WASHINGTON-.-"
913,000,344 *5F058AC2AD94C2983BD047425A96B5AF92EE310C 1604446 otteluun kuitenkin sis
913,000,345 *5F0EB609A680097DCF13EFDFA936C3DAA6A191F4 175.ehrgeizig
913,000,346 *5F018FBB44FF989D0393183B6E254EE7332B45CE 1alueekologiselta
913,000,347 *5F0FE16F088E17FAA134CB26D88806540000D26F 1ATMOATMO
913,000,348 *5F0546BD577734A3939F136D9AD7CDC5145D82C8 1AUSGABENLISTE
913,000,349 *5F08462D3E24E048A731D9479158DCBAA10DC8DB 1AVONDLIEDEREN
913,000,350 *5F0E6FF98C7E1300548D682AB0880ED08D27E166 1iluv1q2w3e3
913,000,351 *5F0214F96748C9F8EAF8C97BBB187D3F36B76C1D 1lerille
913,000,352 *5F0E3672D814468BB0709FB73EEBD80E60B4241F 1MULTIMEDIASALI
913,000,353 *5F08163AE0CA23BFAE3D8460EBF4CE16B95684E2 1-olympus-kiikarit
913,000,354 *5F0B21C3AEC2A88810799ACB5D66DE60AED00A44 1REIGGOMS
913,000,355 *5F0C4D85CCC0E49FF2DB8CFE086712A6667FE3F0 1SANTANAA
913,000,356 *5F0A0AE7D84341B0919A51E604DB3EFC64223738 1.sechsfachimpfung
913,000,357 *5F09B60A69F4EB670D950F4CBCC47997531921BE 1thatcivil5
913,000,358 *5F0E07F54EDA22D1B591DBB6AD401DE929CF9DB7 1zentralsulawesi
913,000,359 *5F0F662FE442A835776B2E02F26B2195A9AEBC69 2360065 VUONNA-2007-RANSKA-LAUKAISEE-MARSIIN-NELJ
913,000,360 *5F0658F27371CCD267AE130C98890F02B0DC2EAE 271688 tubitak'in , basinda turkiye kelimesi yer aliyor .
913,000,361 *5F0956711D9C028DDAEDA1C325CBFD1589193490 2729906 MAJOITUSTELTAT.ON.JAETTU.V
913,000,362 *5F038E1BC0887EDC52E13A155C791374457008A0 2MLGHGZXLZ
913,000,363 *5F07249B6846E3A0F0D75D7BF72C0562DA06D700 2.tsahadadses
913,000,364 *5F0245A3ED9120C54657F27C71BB39319EA8EAFF 314435 KUN-ASIAA-ON-LUONNONSUOJELUJ
913,000,365 *5F03D7FCCEF33C77D23FD939A48571343BE6924D 34 maintaunusverkehrsgesellschaft
913,000,366 *5F04C6F4788277E4BFD477C8D8C01E806F4D3C51 36a291fb9c50a71921a0273b92c980de.walk12
913,000,367 *5F05C8CB42F5DE3F61034AE4117C4DDDE7970C06 3b< o~0~ <=q
913,000,368 *5F04B0C8A6FA7FA01AD798D3A39A194BD2F8DCE3 3IMPARTIALES
913,000,369 *5F025229F5901FA27839BDD24EBF1F30A8FDEE8E 3 k
913,000,370 *5F0F5762FF7EEA2F48632C0F8CA49B85E518E13E 3x+3rnalz3s
913,000,371 *5F0F789F7C9F29599D5050309B2B2A0D2E13360F 45506c5baf6a5de40d5bf8ef1b5ec5e4-hollag
913,000,372 *5F0584022887DD9979E33901607FAD57E8F4210E 46 ly
913,000,373 *5F0FBDAE28134F6346FDC99D85B5A4E307EED890 4ALFREDI
913,000,374 *5F06797E5C303F9BFE922D80BF3F4634A9813152 4iluvoscar6
913,000,375 *5F07D6C02F454CBB4CB6967A74674BF829F9428A 4.koeajaksi
913,000,376 *5F0F6D0A887D26DB1782EDC5AD3DCBA1141992F8 099DIXIE
913,000,377 *5F0524B03919C5290351BA53A1ED5C465A56EFF3 (_0) ~` ~`dp
913,000,378 *5F0C4DFBC0A084AD244FCF9421391A604A7A869A 0IAMTRIDENT5
913,000,379 *5F01B49177BC55C7E834D959E6DF9C7FD3F5D1D4 (0_<)[email protected]
913,000,380 *5F0CAA1AC27A5E755310635955233AB6B4BC78AA [email protected]
913,000,381 *5F0C92A067AAD129D5852E28FDE67581343422AF 4ROCKYSNOWMAN
913,000,382 *5F0C54297387737099CACB6AE54B5CFD5C46F7BF 101SCH
913,000,383 *5F01CE90CB21A99B9149CF5E5EBE9F7A58891C3F 4SISSOKO
913,000,384 *5F0431F7DF321B6E5170ADB2EBD1637D75DC24A5 4.sozialkitsch
913,000,385 *5F0F70AEA4E3E958FE9323E6B97C6E056486A48B 10.ROMLEY
913,000,386 *5F09F20B7AC98E2ACE9A277703392C75B937DE6F 110079 ES-WAR-DER-3-.-OKTOBER-1990-,-PUNKT-MITTERNACHT-.
913,000,387 *5F02F2480F5169BB274765E918A333C180972C0D 1123don
913,000,388 *5F06021D3D3E8B9C1D9D9865ABF7F237579BB197 121b8
913,000,389 *5F0C1D22197306796D9B9BC1578BC0A12531808B 4–МУ
913,000,390 *5F0DC1DDA661786010CA72A6F97FB832D330FB38 50.druckgrafiken
913,000,391 *5F0D8588E9A3C6D307B1652174F15B15B877971B 547268 WARUM.SCHWIEG.DAS.LAND.?
913,000,392 *5F06D153F073AADEE372C5AB8DCC61632CF3ED56 559RODRIGO
913,000,393 *5F0E01FA272FCCDDA8FBC2C28A61230742758137 13-RIVITALOJA
913,000,394 *5F06F3B697C3F1D9A27F22070F76812D29D3844E 143597BEB
913,000,395 *5F04AED24958822095177B49E2C6B12863111B67 151108 YET-THE-WILL-IS-STRONG-.
913,000,396 *5F082922FA73C09EE8D3354AC152D0ADD183A83E 16.yuille
913,000,397 *5F035E0FA4815AE94262A92F35D15FEE13C9F66E 1742161 itmaybeadullstarttothesummerjustthesame
913,000,398 *5F016009C7D44D177D6E41472ABC21B41E85D352 19041932
913,000,399 *5F01B8D84A0A29034B4AED511DDA2D90FED0AF2E 1991-03-23:-ALBANY,-NY,-USA-(DISC-2)
913,000,400 *5F09499B15A4556594E0341970334D2424DDF0EA 5MIDORIFUGAZI
913,000,401 *5F0440ACE1E18C1C54B6887A1CB6099DF32E46C4 1ankkurointikohtiin
913,000,402 *5F0A9DEF03CA686A8084EB459510B24675A14A4F 5PASSIIVI
913,000,403 *5F0E6A3FC3759F61C84CAFE799FE57AA51115928 5PIANTAVANO
913,000,404 *5F05CF8DA3F55DBB8859EA68AD78436D901B44F3 5REANSEHNLICH
913,000,405 *5F0D8575B39DE44101CC4970E3ADEF7359CC8BE9 5RETOURNEREZ
913,000,406 *5F01E096EC75F2104CCCEDCEDCA8CF846189FC13 5SEDNETEN
913,000,407 *5F09B3578C286CB62414585BCB14E23066B564CF 5SMOKEYEL
913,000,408 *5F0BC970C9C846391BE2005930A37DFD6DE1E983 1 CAGIRABILIRSIN
913,000,409 *5F0C4B8755570C60378E77DB585364F73AA81932 5VALVULOTOMES
913,000,410 *5F0C6B08474A4E2C73ED33232CD7EA3C868B9943 1 DSW-CHEF
913,000,411 *5F0B638870C828E93B16245FBBDD287AFDB332FF 602494 JOKA VUOSI SYKSYLL
913,000,412 *5F0895A81C5821C86F14495975464E2AD7803923 1f1ba204093c3859bf44b50a0cfd19ca
913,000,413 *5F076A5856E7EAA50E995B4D7B0699B95B36ECDE 6AANHINKTE
913,000,414 *5F0B10AF1B0D7E3EC0F7767E9C11AB5974CDC688 6BONNIEHOTDOG
913,000,415 *5F0161771D6C95C92EAD110ADE7F4B416374397A 6DESTILLATORERNES
913,000,416 *5F0A7573DB20151451209E0246BD520EA75507D5 6EARTHERLEAN
913,000,417 *5F0A6BA9CB330B65B636AF198450484A67494BB4 1 INDIANSIT'S
913,000,418 *5F00BD6F7B99D0628ECD6BED55756A7D8DA2B77D 6HUNTERLYKE
913,000,419 *5F081A664E52B7DFA503A641786A9BB18AD50D8D 6IMPAROIMPARO
913,000,420 *5F0481549D6CBB8F19A224344FBE31D22E5DA4EB 6-KRAHELSKA
913,000,421 *5F0720756A33D1224EDDF18C27519E928327A890 6MYMENSUCK0
913,000,422 *5F02C22472BE07333C3D311AF9E587E1FE51618B 6PETEYHUSKERS
913,000,423 *5F07063F3EB3F22D8559582BEF6FF5A4E53A2652 6POSTMESOZOIC
913,000,424 *5F028481E5EE814FF5E808C64FE102C3C322F182 6PUMPKINZENITH
913,000,425 *5F0FA1803AF3CB9EAA62180A857A7447B6C07317 6STATISTIKKONSULENTENS
913,000,426 *5F03E0CAE8A9C5732EF1EB800EA9DB7826C89E37 6TRAITING
913,000,427 *5F08378F8791262E1687DB4C67C572AE4B96BC74 6VANGUARDISMS
913,000,428 *5F086C5BE5735D2BDA46CF270C19B1653EC9BDB3 6.YUSKAVAGE
913,000,429 *5F0DA5BDE0D3C5B2CEDD29A3D6A56AE30B1202B4 717b03af8de130a491ae955c9f0e8fae
913,000,430 *5F0D14BA3E2AAAB217840509C916A1A1E23B9AEB [email protected]
913,000,431 *5F083FD2F9A4ADAA522BA229177FFFB04BF005EE 78weston
913,000,432 *5F020715A4E83CA2D7F3B3BF0293350405A80E4D 1-PROVOSOISI
913,000,433 *5F0BF12AE3667866ACB4F57EC9460119574E2E2D 1.RAAMATTUN
913,000,434 *5F035487E4061036E85F091AA80FF49133573FB1 1 SANKOHREBELLEN
913,000,435 *5F0D4C24E2D1460332FD5E0DDF4B2A33FB5CCE6A 7EXECUTABLEA
913,000,436 *5F0D8338E73BFB20E82055A47897D47782B27816 7GAITSTRUTSTUMBLING
913,000,437 *5F0154887EACFBADD7B7318AF2736A43132ECAB7 1-SUPERQUANGOS
913,000,438 *5F016D9A3C2F8FDFFF625419320558E4A74C0CC2 1suprenant
913,000,439 *5F07D1D6CD314BA988EA1EC8CAA3DCCDA33B318C 7JOELWOODY
913,000,440 *5F00618EDC94B7BB5CA672C8DB0F155172ACD2E8 7KHANSCOTTY
913,000,441 *5F0D61CD250B4284EA163291DDBE892D8935627E 1.WERTSTOFF-THEORIE
913,000,442 *5F03DFF6D8CC5E5AAE7EA9D4AF5E508249E1124D 1 WILLYN
913,000,443 *5F04E949CE42300561ABDB9C556E88209D7D5252 1wyter
913,000,444 *5F006B00CA9355598319C3ED6EF695C8A9EB394F 7NOTARISSKAP
913,000,445 *5F0D392F905E47B259474D028F80600E6BB961B9 2004-09-21:OKTYABRSKYHALL,ST.PETERSBURG,RUSSIA(DISC1)
913,000,446 *5F06A56DFC410361F2E359AEBACE899FEE22AE77 22fruehjahrsgutachten
913,000,447 *5F0D7DC4DE76E4EA4EE35B0D61D46790F5F87612 7TIAIFIC
913,000,448 *5F098A465D9E5C3F4448E225CDB81EF20CE9663B 7VIRILNA
913,000,449 *5F0D6B0C6183FFD497439B065B9C49C824EFAA31 2481026 AMFETAMIININSUURIM
913,000,450 *5F01F7E721354569ABD27B12EE4F9F041DC9CF25 807craig
913,000,451 *5F086FD1059CA6FB25B71A999FC7AAD8066D2274 2589575 iltaisin h
913,000,452 *5F05A69B93505E0FB9129EF032BD88B5501B1D05 827645 WIR.SIND.IN.DEN.ENTSCHEIDUNGSPROZESS.NICHT.INVOLVIERT..
913,000,453 *5F0A7C60A5AF42389D299D88FE3B3C03FA8DBC1F 86KEEGAN
913,000,454 *5F0F77548E9C2AA681A4F5220928761F0354F260 89H4VX6Z5OD2
913,000,455 *5F034FD862C62BD252F24A1DDCB340EF5DBFFF91 275848 CIMEN A : ANATOMI .
913,000,456 *5F0F4E5A3DC0F5AC18E35D1BF2329E25CC77C444 8btppo
913,000,457 *5F0096370D82505009A714F57A45FE022317908D 8CREUSEN
913,000,458 *5F02CC3BA24DA586CDB1D5033B43D846E16B1C0C 296263 ALLEIN DEM GESETZ IST DAMIT GENUEGE GETAN
913,000,459 *5F0EEED0BDE323C5D10C908CD02B597B68CBDE9B [email protected]
913,000,460 *5F08C1A2AAD724FD3E6F25F8EC31B70E08CE5307 8HIPPODROMESES
913,000,461 *5F0A2E44F077448791603AE6777D105D3485B063 2$exy08
913,000,462 *5F00E468805CAFC502709C0A959FC7FC5AD985FF 2KOIRAVEROLOMAKE
913,000,463 *5F0A93B354C9B15DCFB5A6CFEC67A36E2527C454 2OOMATISI
913,000,464 *5F0F02A6016D6F68AE992ACBB005CFFEECB7004B 2unionsfreundlichen
913,000,465 *5F0577242A6F32D81A76BC924093007D92CF07A9 2.VADARLIS
913,000,466 *5F0EBB2A6A8E9124152F571A25E70E8518481768 8SALMONDOLLARS
913,000,467 *5F04058DC3E50CD03DEE9438F4C4A89603B069FE 327383 EHTOOLLINEN SEURAKUNTA VIETT
913,000,468 *5F0BE7309A0F5CD5B19401244292B28EC7F0FE0A 33enosis'i
913,000,469 *5F0697B30F6DE58BFB4A4316A5D448DFDF8B50E4 387PEDRO
913,000,470 *5F0DAFEE41196C55C3E4A22A671CF2C635782C5E 3ABCNUGGET
913,000,471 *5F0AC44F60353CC85C81417EBCF81FE8217D1F9C 3B<-~-`-d####q
913,000,472 *5F0BA0DAA34298F35B075CC7DAE3BEE883534AF1 903leon
913,000,473 *5F077C491320581081ACCDF9EFB16535ABC732F3 3DIABLOPMC
913,000,474 *5F07DF56C30960CAE082F2E4D68AB7C655883069 3FRODO4
913,000,475 *5F0D7EA54587BEE5D40FD50AFA4EF207D25A527A 3 k
913,000,476 *5F00FCC52C0E124EA664968708407FE16FD5D695 9BSWDANCIUBSW
913,000,477 *5F07D6F83B685B2D4D8271194660913C01276CF9 3MYGAMBLER9
913,000,478 *5F085D1D00FD87E07A924338976C29150597BC56 3====>.~oo><
913,000,479 *5F0C810338059B4F219AE7A49E721F5490D38B91 3####>~O.~o.:p
913,000,480 *5F01159B03FD3EE9728E4F20F5E7DE6A1D479526 9EFFECTIVNESSBSW
913,000,481 *5F041D4A3BCE68E6865546F3E9C35B7CAB35438E 9ELAINETAYLOR
913,000,482 *5F046FAA2116B2D7874AA2DD6B2CF55AE0021E65 9FESTGEKLEMMTES
913,000,483 *5F0A33A5F81EDE7B189A0C3144E6D75A64D1A111 3SCHIRPF
913,000,484 *5F0A5369667B07FDBD795DEC23A764D7ED89BD19 9JOANNAATTILA
913,000,485 *5F09871C51247081E215EA917E56E2FF89BC4A29 9MIAMHLACH
913,000,486 *5F0FF7D70894AA3A77FEE52CF56CCFEC61B19CD9 [email protected]
913,000,487 *5F0FD4BC9B131395F1A608A127DFCE757045CFDD 418-AMTIERENDEN
913,000,488 *5F08FCB533DBABD84AA4A00A823917D8EE46B231 9ORIONPYRAMID
913,000,489 *5F04AC599D5DBEA673B7B6BFC06B3D3CD8F5DCFF 9PMCCATALOG
913,000,490 *5F069D60F17665B7575E2B5774067E96D0C7D66A 4:..4..#..&...quoits
913,000,491 *5F0B5D24E21020FDC6CB57EBA7C5ABB175D8AB49 4EVIKSALI
913,000,492 *5F09297EC53DF9ED38F7BDCAAC9E88BDCE4D5F27 9VIODELDA
913,000,493 *5F0D616FF45A76AF5F9A193FEEAEF9A15226CB67 9VYUIUKZ
913,000,494 *5F0FE0BE487B324ED029FCE4AE86BABEEF083971 a?;1&
913,000,495 *5F06F566DEBD35971D45B0A35B0068F7CEF2D36B 4lter4t0ns
913,000,496 *5F0CA6827A16EBAA624C1316EC759F45BD3A33C7 [email protected]
913,000,497 *5F0CEE3C6B79133CEB8CA97CA24607B77185EEFB A4QYN
913,000,498 *5F077F363C3F1E343044B2ACDC8D860D24B2E415 a69#&
913,000,499 *5F02699D5E1CC840ABDB15BA84D699693FE94976 a=6c7
913,000,500 *5F0DC6372BD92BC38F3A96E96A14028A96B93AB6 4PRATTGRUPPE
913,000,501 *5F0D02978C71634ED3768DE880AE3AA9A061C45B a857en7!on!5m
913,000,502 *5F05F1ED1600BF63A63A9D4EB62D55F03F7A6243 4UNHITCH
913,000,503 *5F065C8708A24FDF780FF1DBA70D207D93A1ED23 aaBC`
913,000,504 *5F0945EA6E04B2F4186C3DD15189DBD9C4F44950 560672 demekte hicbir sakinca gormez .
913,000,505 *5F0A6EB2CAE92109EDA42B02C08108B0C2DBD110 AAC\K3
913,000,506 *5F02CA9A0E7823D61DFF165701495DD37975C914 aangier2
913,000,507 *5F07A0E13C7698C35ED4A33C4C831A5832D659D0 ABBL=
913,000,508 *5F093D71055CCCA005508E6CC7E69D1AE13465BA 5duuri
913,000,509 *5F08B32A5917A53833F595DCDE04EA1F8EFCAB9F 5FISHERJEANETTE
913,000,510 *5F098EAA401086B6CE5EDC8EEE901E9239E97E81 ABITUR-EN-BAVIERA
913,000,511 *5F0374FE3A373B7D0FCB2698C8AA48FFE27049E5 ABRAHAM.THRO
913,000,512 *5F00D5B08B776A8F754036C3A6F634A2FA1231FE ABRIL222010
913,000,513 *5F055B5125E39D7DF6D366FA8618EF303EF0F35C ABS.Y
913,000,514 *5F03470DA3E651D1B2EBD0FC867D38BF46CD6BBC ac.[
913,000,515 *5F0E39D24582CCB41AAACA0C6B85DE371E3D0EED 5MIMBRALS
913,000,516 *5F06710D187CB3DE1869EA4D4AD55AF94FBDD020 5NUOLIN
913,000,517 *5F0F7BA8E42FE142BAEEBC69E406B99912E62D74 5NUUTTETI
913,000,518 *5F0D146526EFB06AA9E13A8CCB16A9FA8BA3AC1D 5PLAGUEBULBULCACHECTIC
913,000,519 *5F049C71231FB8D572852473F03C09E2088084FD acronyms
913,000,520 *5F0D6C70A9D20CF23EC4FBF85A026388924D85C0 acx2
913,000,521 *5F0BAF4F1CA534E9A7EBB35EFFD784548A785477 5THEBICHON7
913,000,522 *5F055A217A057CB2F4A74D4413A1B1F64E671404 5YTSNREJF
913,000,523 *5F0A94DD920C18ED05B0E18BA09DE0655E7C7060 adlanurb
913,000,524 *5F09412B2BC0A9D98C10FA62C8818C380EAFC413 AF%K=
913,000,525 *5F0735396ED0E5F1F87A81ECB6C2263364F38922 a-gx$
913,000,526 *5F08D7F8BDB3093A6EE242ABA485F9F3B046135A ag/z2
913,000,527 *5F0787853DC34DA3B56597624409AD25AF18A1AC 6MULTITUR
913,000,528 *5F0A9ECDBF521F4208D058017003CB9943630E5F ahe
913,000,529 *5F0EA6076A0FFC435C5434DCE11D7EE73DC29239 6REBEHARRLICH
913,000,530 *5F0B09C03FDED49091BCF41DAFAF7FC794738A4E 6SNINGSMODELLER
913,000,531 *5F09BB3552311F2AE8B23E7510F1533AF71B4C55 6SORELAVAC
913,000,532 *5F01C0096EB79ED84C21F45F7EA643F2212048D8 ai6%d
913,000,533 *5F08EC7B57016B8622B0467DF5CCE596D1D11FEB 6TERMSCOMMIT
913,000,534 *5F0216E76C2501A7DBBE3E2AC51BCBFC3EA5CF70 aih!c
913,000,535 *5F0E295EB39D127A15F750BE4122120EE1482228 aimselfaffliction
913,000,536 *5F039059327F474EF61598470B792D8925E3ADB7 [email protected]#$%^&*()-+
913,000,537 *5F084146344A4F1D31872197E567430D7B3804B7 752685 EPS-RAKENNUSERISTETEOLLI-SUUDEN TOIMINTAYKSIK
913,000,538 *5F04C8C67F4B4B259BC856C2DA567234A46EF6B1 76249 ICH-GEH-'-JETZT-UEBER-DIE-LINKE-SEITE-.
913,000,539 *5F05B9F96571228D4C136951F0F93C12CC0DE2B2 794241 NYKYISINKUNTAKUULUUSATAKUNTAAN.
913,000,540 *5F059BA7867A3A9FFB26D6D0D76B7BA1CFF24433 79rbsf7s
913,000,541 *5F0281A9446555A5C1E0C302C0A3E1D1C5D81D4C 7 ARACHNIDS
913,000,542 *5F0C773E7BEC8E31F48729461EB9EC728F656533 7BILANCIASTI
913,000,543 *5F0C51B66552D000A60162FC58428132BDFCA3B0 7D8D438A895BCAFDD544EB5C96701BA5GOETHE
913,000,544 *5F039049B0E7197E905D6EDA2FB5C9D862339295 7DEFIANZA
913,000,545 *5F02CE032076C500364A02F3AAE1A73A81075D52 a)k
913,000,546 *5F0949A69E96323D12828C90F2CE335012CB684F a=kt2
913,000,547 *5F085206E7EAF10CA15571A227875043D188983E ALAN.HOUSEY
913,000,548 *5F050F6793DA82A13DAA76037B9469793685A7D9 alecdeleon
913,000,549 *5F012EDDDB0D83F9614C0F132FAD11ABCBBB7C1A ALEXJEANPHILIPPE
913,000,550 *5F049378913082EBD4C382BBB9E1E11FD1C375C5 7SUBSILVER
913,000,551 *5F01235AEFBA3D83D6FA2C2EC9CA2000EBB7176C alj
913,000,552 *5F0478220A3966512A2F3A6CD375B8FA6B7F4620 7theseoul3
913,000,553 *5F07C7DF9CB942915061C9DE653972F695A8CCD5 7VOLUPINE
913,000,554 *5F09971BE53F222637716803295FFEE07F2DAB9F 81 ta >u/<di>u< >a/< 72>"_72_n"=eman a<>p<
913,000,555 *5F0F63DE5149A40DF2D15A979BBD367985125F4F 827629 cd.on.uuden.,.iso.karhu.-yhtyeen.ensimm
913,000,556 *5F0F243A992BC9E8283A50C9CB422C3BE4441C76 ALTAR173
913,000,557 *5F07629938605C82F0603DCD12088FDAA8C4BFBB 85aaa
913,000,558 *5F09422EBDED526C2382A6A154FE46F3ED006EA8 AM2O!
913,000,559 *5F061007ECA9EFF509A861E39C54012442DDC650 AMETUITA0
913,000,560 *5F094175F669CA49B4AA2B311D47E3AE574B0770 AMG-LITECOM
913,000,561 *5F0AE6BF1AB2A3C93500604B2206E2637F3A28B3 8BUTTERIESP
913,000,562 *5F0CFC51DB9FC9CA7F9F8714C5FDFEA56D9BC678 8==D***(>_<)
913,000,563 *5F049894B448066A7277EBF6A67FE5C1258ED052 8EVERIMMINENTLYIMPENDINGLYNO
913,000,564 *5F0FFA625181F9A863CCB7CEBBD5AF8E72CD05B8 8GNIPEIDREVNEDENEB
913,000,565 *5F042105E8A1BA9312B2D51209B9FCB6E0F6A2E4 8GNUTOAIL
913,000,566 *5F0ABD147ECC10553DD861F1113BE29B23B550D4 andreasnuvallie
913,000,567 *5F0E47B9C27E86F5A0255112F3669C7EF056657F andrewhewitson
913,000,568 *5F044E65B0CDE29B249ED9E591C266E1CE3A0C5E [email protected]
913,000,569 *5F0401F27D59AD8E9586DB6A2E5C4A460C79F42D an+h010gi$+
913,000,570 *5F05A6FE3C570A6EE2B330D93A9094B6BD2EA086 8-)~o~o.(-_0)
913,000,571 *5F0391CEDA5ACD5479FA4B96AC0A7ECDF35936C5 annmiralles
913,000,572 *5F02A1606AC95479A090B54B49BE191BBDADEF10 anticlimactical
913,000,573 *5F09F471C9078D5099882FE6CFA94A7E780836E7 aolo-
913,000,574 *5F0C4EAEC3D2AB9F89CC0D3BCB438D2E36ED0E6B 9041816
913,000,575 *5F055C67AE18C6D9ACD9B8E95877B1756B957A7E APJVQ
913,000,576 *5F06BB26575ED17E1A4B93773F4A28F928488033 9BADGERGREENDAY
913,000,577 *5F0A08C82FB0481F1DDEAC58696C7FA963D56061 9BSWEGAMIRGL
913,000,578 *5F0F17D3B0186947473E9A4906A9FE93AD94B69F APTEROKSEN
913,000,579 *5F073C3D8A48B36E1A65B594F82FA8398CB16124 9GREERIH
913,000,580 *5F0D0466F285DFFDE7CE5F8ED5315C301E766FB7 ARCADIAIMAGES
913,000,581 *5F06B88A5A420B8C7B0FD1347516EF4332ECE0BD 9HONDAMARTY
913,000,582 *5F01589D6DBDA1F2C6DDAF007F1667D521AEAA7F 9JUNE1330
913,000,583 *5F09184903C52EC31199710DE3997C08620DCD7D ARLIETYS
913,000,584 *5F0E74079FA6442C30A23292E93AD24119729E62 9NASYNKRONISEERDEN
913,000,585 *5F0C7A44ADD69D1B22BCF53D91FC9FF84B265B0B a%ro,
913,000,586 *5F0244981241F44B0DE846F9DFC4AD3BDA9FEB51 9OPRUIERS
913,000,587 *5F074D8BF473BEB11DA4C840B29AE1F4F3EAAFFC 9RAZMISLISTE
913,000,588 *5F0BC4ED12032C12010070D1673D4B8E2A7BAF6B ARTICLENYDAS
913,000,589 *5F03D6DA51AD5F4527216F239180549F93931010 ARUTOPLAC
913,000,590 *5F08D8050AB53B238121889933F922DAFE4FE976 9seattle1
913,000,591 *5F05F4A5D35F416FBC9C05FB5D3ECACED943B42D 9TERMINARLO
913,000,592 *5F04BA6EC403FE9AFB1290B603C22CF31D264212 ASENACAR
913,000,593 *5F099100DE26FEC4583EDDDCF1B94BBDD130B4DC AST&6
913,000,594 *5F0EC854D1B41433BC2A8E98B965E24922853D11 a3a)c
913,000,595 *5F0BAF2A5141BCFA351AFE03A0DB21F6A03AC96F A6&:W
913,000,596 *5F0343866C20117CA3030B3574819CA30E5AB312 [email protected]
913,000,597 *5F00E79632C10427FED8C45A65E81E0150CB7059 AUSTINPECORAINO
913,000,598 *5F0848432B2BC9EBCAB4B0D09DB54A32789DFC21 a9w1c
913,000,599 *5F069094856BCC5D6DEE4032E67D6627AD5201A5 AXF$A
913,000,600 *5F089D520E1EF76F89FFEC2C8B11C25995A198AE aadfng
913,000,601 *5F05BC7E39243DD6583BFC353139593CEBA08BAE >-b0 ~` (#####q
913,000,602 *5F0C3D30CEE962A789F6ED866ADA46819AE7302E A,.B
913,000,603 *5F0475FCF513142ABCAFAD1B4095B44C3A75E3D1 b4!4
913,000,604 *5F02E2794FC9D81E37B0E566AF520F4D368FC713 B891169
913,000,605 *5F0E61CD1B6E3C6EA45FD8FABD68C96FBC467A1F A.CLASSIC.CASE.OF...
913,000,606 *5F09067F0BC34CB7BCA614AB33022CDECAED854E acronyms
913,000,607 *5F0B1962BDB1A84276BAF6CE52937EB9DDD91C11 AD#4
913,000,608 *5F0227A450D377A9564939C4D2E85D5EF4BE6C82 BassD&KingMatthewvsLadyDana
913,000,609 *5F018B23BC55BAFB3306F3ABF6BE350B3CCCF655 ADG'|
913,000,610 *5F0D5C61C607890BA3C8CE625D14B12626390CE6 ADITYA.KUMAR.JHA
913,000,611 *5F0735CFCA68C00317E76A21F1CCD6C9465CCEC1 adrianimoto
913,000,612 *5F0F5F30D6CE13BE5C656F529436E6A110CEB7E1 adrianmaceda
913,000,613 *5F0CEA4B6AFE9DC7328D09B7703458DEFCFBA6BE aesl$
913,000,614 *5F019C94C1E840776AD0ED81FDB0A9D0BDB0FE36 AHMED.PADGETT
913,000,615 *5F056D0739ABE8285645397DEF3AAA8A078B98FD a,ho;
913,000,616 *5F001E337BA17ACFCC65F40C69A093984E72A0CF BEST 16 HITS
913,000,617 *5F05A63366867842AF98DA4C5167402E130D94BB AILWF
913,000,618 *5F01D6477FEC0D06C1C6DB3319443C6B280D0921 b?fy0
913,000,619 *5F046D85DE4BDFD05B17390BAD35C49AD3079EE7 a)k
913,000,620 *5F036DC6D3DAB28109636E083271323998841EF2 BILDLAUFFL
913,000,621 *5F0D0E776C0CED6FEF8236EC261876553EA499F4 ALFONSO.STELLING
913,000,622 *5F03E904FD0A279D78EC6D68C0B293E2EA9A7232 alfredoballiet
913,000,623 *5F046C4A5547290C5C2C9D2FCDBC95A3FCFD1ED3 BISCHOFSKONFRENZ
913,000,624 *5F0C53B8E0DCCF43B0E3BD3FFC5DD56C6FA320D8 bj8ur
913,000,625 *5F03C5F358F3A741E9C66E44C7120AF43199A191 BJG3V
913,000,626 *5F0250D2FDF14632D28D3A98CF08762AB5ACF64F bjiw
913,000,627 *5F002B59398E425B4607520E135F3E18713892D9 aliyahfernandez
913,000,628 *5F02D6CBF39AF71E91A5307C2EBA0EAA61FF876E ALVA.HOWKINS
913,000,629 *5F039082F701E47847506CD983D413B70F818FC9 alvarofrankenberg
913,000,630 *5F00A916349FA3DD68DE14FD3845DA0678C4DDCC bljiu
913,000,631 *5F0B132FB821EA9D71570C84D913FCEC71E76834 ambulansdokter
913,000,632 *5F0794488F157B40CF10B54553D0376FF52BBF60 bo"hd
913,000,633 *5F07D1DBF0DB72962D595172ED4CED4C19DF89FF bo-ra
913,000,634 *5F0B5B30837CF693C12F2BAE97938F0360838822 ANDY-D
913,000,635 *5F0BD836680FBE1AF33C738CF94DAA9C0045567E boshincampaignmap
913,000,636 *5F02B61540049423CA9D392000D5D188658B3559 angerucked
913,000,637 *5F00C45AD842CE4BE405CAF7F647B6FEA6A4F5F8 BOYCEDERKS
913,000,638 *5F071D5A8C5E60932C0C1E9DBD4B674141498AE0 BOZIDARBABIC
913,000,639 *5F0C6723C7945F19F3FF0DCB797F01A2B4EA9BA4 [email protected]
913,000,640 *5F099CDBA69BAB09ED48FFE6261A7D1EB590425F anything for you
913,000,641 *5F0B723F5397957AFF7C28B5C44C807F558646DC BRENDON.BATESOLE
913,000,642 *5F034C6EEB45CC3B692A837870E4529942965E8A brentonmainiero
913,000,643 *5F0BF67ACBADCD21D8F7EFFA189E4A85D37DF083 APITL
913,000,644 *5F087F1C74EF7519B5A14EE5B3CF3262E8977825 APPROPRGRATION
913,000,645 *5F025F27FE79855F83CE61AA5D91B2FF1023AF01 APRILPETTITT
913,000,646 *5F0144AEB30ADF7DAD4002CF7DCDF315F0A23618 brtvd
913,000,647 *5F0400D6BCF982D2A3561178021AE744BB31D9C3 BSWUFBSWS
913,000,648 *5F0ED794CB8A1A2464B6E4FB953173AFB6DD38C8 BT-!I
913,000,649 *5F0DB4D826E5A15B97A24283F615B0E13B722DFC ARTHUR MCCLENDON
913,000,650 *5F0AC0CAEB208A4B39B3C058349FF841751E9DD2 BU07721432
913,000,651 *5F0D205A9D3AC0E76B66CC11C64520C9BED7A817 ASDFGHJKL464
913,000,652 *5F09BFB0A78F6797D75DC0D11E6F47281BA58D17 AsianRutKingLeer
913,000,653 *5F054C74CBD029A57C856AE51ABB42DFD3FD3B50 bv(en
913,000,654 *5F0448087217810392ED18941016B891409BBFB0 bvkg
913,000,655 *5F06843548552537419983C9E273B6A9FADF07F1 BYO0+
913,000,656 *5F0E2EC3FF97C300EABB6DFD37A9A0AD5078029F august80catalog
913,000,657 *5F04DC9B8C3E301FA28F77D602780167578A9D1E [email protected]$73R
913,000,658 *5F031A33C1817858FED4F5B1F39E54823D9665B0 [email protected]
913,000,659 *5F08EE318E85B98E8FF224C1F2AA694718E00424 AVTB
913,000,660 *5F0E654B01A58DFCF46009925C44F27D6F101AEF a=wrc
913,000,661 *5F02AB0EA7F1E76837662AA5117E64E1DDBC41A9 C821213
913,000,662 *5F0305DC94EE35BDBAE4AA4F0EE96A5F9ED4CA9D AYII
913,000,663 *5F0EF598AB35942D9C991D311AC0C2CE4CEC02AC [email protected]
913,000,664 *5F07FD2127202D31B3B1DFE89C35BC8454001183 CA-ID
913,000,665 *5F0F710A79507D1A4AB0DE85DF2B8684BA1546E9 [email protected]
913,000,666 *5F01B59DAA70A324825F9837484A854F96B4E008 b.1fp
913,000,667 *5F04247DD4A4E30621B60CC0E92D15F82911ADEE b^2~
913,000,668 *5F0B908760FC4EF0066576615E1902A0137CC50A camotal1
913,000,669 *5F0ECEF26814885D06FA7F17CFBCE1808AEC6227 CANDEMUNÓ
913,000,670 *5F073B3D178484081100BBEA775EB5F9F7A514E6 carmeloopoien
913,000,671 *5F01B6808000200F43F25DA851BDC9816F971C3A CARMEN,.ACT.I,.SCENE.4.(5.OF.5)
913,000,672 *5F0C5D1DB16FC5EA3F0561020233CCC4101496B8 carmineaulder
913,000,673 *5F0C3EA274E80671E43F7F48BA85C63828C02F81 b8ff;
913,000,674 *5F0821DF328A7F58880E00B6F6DFAB0C2F7C1C3E B9P,
913,000,675 *5F0BB82992F3C2CA105F70801DDECD78A1D41122 casto7
913,000,676 *5F02C3602FF5C640404395C2A63EB4781889CBED c,att
913,000,677 *5F0729C85CBD2C5E43B80A5585734B1B3E95538C [email protected],
913,000,678 *5F023E49BEDD21C97BC58AEA785D5C26C5A05693 barrettwhedbee
913,000,679 *5F08A7A7763BCC7422F6EBD961E43201F3619C47 BAW.E
913,000,680 *5F0651AA852619A4A2E91081D48DCB23673ADF47 bbella
913,000,681 *5F0AC0CF8BA192129D846408FEC743CC84DD1C7E BEKCY
913,000,682 *5F00E81F6473DBEC53714AE2B24C259CAEB91BE8 benitocadden
913,000,683 *5F0E22656E3B17F940F9A2860B64C8E0B7F72730 BEN.YSLAS
913,000,684 *5F0CC9D96F18988B04A5C85A1311371FEB690FAD BERLINIZESES
913,000,685 *5F03E629506C12B15422E1B6D6A58445510D702D berylmanager
913,000,686 *5F07167A46646EF14D9F9C9DB919BCCFFEFA33EC CHARLEEN
913,000,687 *5F00647BA98C9F07E73BBE611E988E557EC97B80 ch?ch
913,000,688 *5F05DE5ADCF3550E0FC695DDBFDE508AEAD0249D chmt
913,000,689 *5F0DA179CE129BC0A4DA319D905394D39F89D59B BI[A
913,000,690 *5F09AEBC53930EB9D273B3F33FA70AF9C7B871C2 chudopleši
913,000,691 *5F0B41FF0E14E35AEE7BF7EDD8A0FD3AE260495E CIAGGG
913,000,692 *5F065449ABDD0BF6956065D2082A0CAAE2AD6923 BIRO2008
913,000,693 *5F0B383035AF5F13B802446365F2E6282753EE8A BIS.;
913,000,694 *5F0CCB9788487E172B4B1D241E819D22092A5A70 bi?um
913,000,695 *5F0A8A7CB9905F53A6220AE0E6B8372C4F0286A7 BLAINELASWELL
913,000,696 *5F02C7387B575EE4D0D28343B0A162CE7C80AED3 cl4;x
913,000,697 *5F027635BAB2E9C86D95A931656391696B9DDC77 bltt)
913,000,698 *5F0D659CF4EC2DB4032DD4373AF6AAF0F98B9D06 [email protected]
913,000,699 *5F02B100A99261F8F697B91046DD58BBC5831704 CLAYTONIJAMS
913,000,700 *5F05F121F53D85D352110E52CEF14DF3609C6B4C BMIC
913,000,701 *5F014FFE39B12E6D249C4ED596586C618B425F54 BNJW+
913,000,702 *5F032B4104E4FCDB08F1CFD12A3361880EB36B70 boater
913,000,703 *5F0CAA437880B02E10E53E630360114CE42067FF BODDGYAL
913,000,704 *5F0CC3FCE593FF652080E29F49C21E600391B535 BONE_MEAL-B/OU/N_M/I/L
913,000,705 *5F060829EAEBEC2A20749D33C43AE42525B2E9E4 COLLEENFRIDAY
913,000,706 *5F01EEFB741A402F536054D49A527195F093878B BQHTF
913,000,707 *5F0B8EB1A8777E038647DFB68D83FDB2D65DAFF5 CONTROLÁBEL
913,000,708 *5F0FAF2FB953807978210C4F97555F3E3EB17EDB BRET.GATSON
913,000,709 *5F0D1984CB4A800D682E014E42379C99206B8CB3 BRITTPANUCCIO
913,000,710 *5F0E9C2545C9DF54D04A092C1EB2AEAE71B56104 BROMADA4
913,000,711 *5F0B3E8C080480FDF519DEB04BEDD041B68C41DB BROOKSBIGGART
913,000,712 *5F0879134954AB4D52BD607CB625EA39E94ECB2F courtneyarseneault
913,000,713 *5F0089C4D3E8A54926831E94BDB72229D704ABDA CPF9Q
913,000,714 *5F0380A99FC613F557CF15E987EE438717175A36 c:\programfiles\microsoftoffice\clipart\pub60cor\ph02754u.bmp
913,000,715 *5F024136876C977584D241108DFBC817B94E2E49 BSWSCIENTAS
913,000,716 *5F0E3F3BB141441640C12052867E05D23E6126E8 bt#ar
913,000,717 *5F0EDB45BF7BE93C9289D36DB2D461625F101D27 BUCKKENNAMER
913,000,718 *5F0CE9143BB95B0760F0F70E783514416D271B91 BUDDH1ST1C4L
913,000,719 *5F08BD143665802A70ADB8CDBF310E5CCBB8109D BUDDY.OATIS
913,000,720 *5F0D5363FD1224B237CA7B62F09122D7D51C65C5 CRYTOGRAFEN
913,000,721 *5F0B4B1E81796883AE0C0548827F899D80D4F9A6 C;S3L
913,000,722 *5F0A01A431B844109762F6D31A9CA2EA1E138BC9 BXB%S
913,000,723 *5F05E1C7048BCBAD93B796BAB0BE021EB1AB7B68 by7r
913,000,724 *5F0F5F607233276A4358A6AD3FE7B43BC5A33CEE C:\WINDOWS\FONTS\ACASLONPROBOLDITALIC.OTF
913,000,725 *5F0930F7436825D78740F17AEC1D6C3246C0D7B2 c0:yn
913,000,726 *5F0585AC3D962D56021035E37C814FCB5E2B3293 c;1?1
913,000,727 *5F06A951833C8741063742117C15D6AEF57EC68F [email protected]
913,000,728 *5F0E3289D080B326848B044CE4FC870B205CC657 c1rcum4m8ul4tes
913,000,729 *5F04C44EA57C01327996652892EE3E6619A04FE0 c.zgm
913,000,730 *5F030EAA3FF6837D5FAD0D49BBBE53671F72FB6F [email protected]
913,000,731 *5F08E75853F7B844797B0D68C903ADB22636B71B caibedo island
913,000,732 *5F03C01DC03943C4DDF954928AD9E7E51BC2F281 [email protected]
913,000,733 *5F0DFBDF11CDC04E4EE3FEB26614327963BA5316 [email protected]
913,000,734 *5F0D5D683977D231B4D75E53F408A25955820731 DACIAN–ROMAN
913,000,735 *5F0435AAA7BC509DDFE2181A76536679BFD924C5 CARL.LORQUET
913,000,736 *5F09A751E9565195578290727759D514AF999F8E CARLOBURLISON
913,000,737 *5F0D0709F6E41E8B13FC35BB6423107BC5F740F1 DALEMETRO
913,000,738 *5F06E8997A0629EF2B668FE4F4673ED49CE0FD16 DANDELI8
913,000,739 *5F0818AEF694AC28C4D0591DF005A42341585B1E CARYDEFRANCIS
913,000,740 *5F0506D93056095A8E532DB34206A99B139010EA DANIELA.BOMBELLI
913,000,741 *5F00D2EAA0950443EFA076733FC763A74A1D1DA7 catalyse2
913,000,742 *5F03C03ADEF01B28027D17FD44A543EB2742D156 CB2RD
913,000,743 *5F05D2B643AE1769FA57294C52BA084CE94ACA6C ccfkpfl23
913,000,744 *5F0C537E244DC99D39CDD4EE3C039746787894CC CDENNSION
913,000,745 *5F0986BB7388BD033D504F44363318FB3E33ACF1 DB=EM
913,000,746 *5F0176E38A0FE0CF77AEC74ECCB1F5E62B81D0FB dc:rw
913,000,747 *5F09AA7A10CE13B0D0BCFC78C0E93816C86C3C1D de+$1
913,000,748 *5F0A577D7A957B1D1FF77DC8C9DA7E3EB134112D [email protected]
913,000,749 *5F0F5DE144C5B9E6064D939BDDB6DD0D621CBC1D DEITLICH
913,000,750 *5F051256B7D6A2770B9889FE82F06BB07718F811 C")h
913,000,751 *5F06A52E5C59EE7530A3D723AF1863CE37BB7CC5 de-(mono)--1960
913,000,752 *5F0C492DE0F94B93AA0A01EF58D74E4FD462C7A1 [email protected]
913,000,753 *5F00F6499285E8134859749A253409A676B7AA10 DENNISSEVIER
913,000,754 *5F078C67DF67BC481D2D52CEB02E897F7B944928 DERRICK.KLIMASZEWSKI
913,000,755 *5F0E939C875604748666408073A48559C8CC20AA DESENTERRE123
913,000,756 *5F0C5A5636B5077D30AA25DC51CB99C6BA670044 [email protected]
913,000,757 *5F07F1E524591E468EACD93C30305AFE51EF7FF4 desmondhyslop
913,000,758 *5F087D03F40AF13E4B34EF2775C8ACA748028619 dessertlepels5
913,000,759 *5F002A2EB42D15847D4554BF5C95CF22E86C7D06 Chiquita.(lied)
913,000,760 *5F0AD9452CAC8B62560A62983226B3ED629507B1 [email protected]
913,000,761 *5F0EA594A430A2A6DAF108A5A5533F90688AA2B9 chkykeibaj
913,000,762 *5F07EE7C80A7B8F1C18D783FE4F94CFB2B772588 CHOMYARD
913,000,763 *5F03C58B112A5E36E1B0B1C152A736A9093E048A CHPKQ
913,000,764 *5F09763ABD86487087CCD905820F340781ABE0E5 [email protected]
913,000,765 *5F0A29448648690ACCF5ED9E8862BA870CCAEEA1 DHGMI
913,000,766 *5F053945D51BC4A2A8BD821751B09BCDC038D897 cieszyla
913,000,767 *5F0C40F3333A1F454808A891593B03F301FA0BA2 cii56
913,000,768 *5F020128A9899165EC7F519819A64811AE1DC23C dim.star.theme
913,000,769 *5F062CFBFC4BA575753E37B6AC520B42FAEC1B7F C(K!;
913,000,770 *5F01F5600999F24D5200E377B5F8D9D6A079F455 DISCOVERY
913,000,771 *5F062C4E35318AB8FA5DB31CD79881074FF06ED8 D$KD/
913,000,772 *5F081704F336316303DBC22E6DBAA839EEBA2D82 DKVB?
913,000,773 *5F0210EF10232B7E1E4BA3C54ECE8415902E76DD dmeq
913,000,774 *5F070BA0396718C1086B0B25B2E0078FD738F584 [email protected]
913,000,775 *5F04FD7DAA91AEAF512DCE0A7F2CCD685BF55C0B DONNELLHAGEMAN
913,000,776 *5F095D1C6AD61049C941C8CB6502D1474DEF1B3E DONNELLTHOMLEY
913,000,777 *5F050F43769025FAC036570ED6C32A2EDE8ADA82 con$7ruc7ve1y
913,000,778 *5F032B1BDF3EB570381F44F24D3A162C8E74BA8B CONNIE.SASTRE
913,000,779 *5F07E9AAAC55A16253C47922174FDD0275D52C6B DownattheGroceryStore
913,000,780 *5F03C29C39DA6F31D858E585936FDC4B7D23A59D DPDT
913,000,781 *5F0C493D0FEE9D1DB1F52CA11810956579A941A2 DQIBN
913,000,782 *5F054345A35EB9B7B76E1D6170B3E191324D3AD7 dq:;w
913,000,783 *5F0D04E7762388BD55B9C13F8D4C4415558C12FA DS6FO
913,000,784 *5F0E2ED4DE0212ED9705F3390149023BAC80DB06 [email protected]
913,000,785 *5F08DBE1296621F314C70D372153B38725F5808E cq%ej
913,000,786 *5F030E2FBDC321CCF65AC507789A61CAB15C3B41 DUA
913,000,787 *5F04432EF30BA6B36AF8D7F993700883AF556C43 CRE5YL4TE
913,000,788 *5F0EDFDD9517CB8B3E213CAB53077E37F905E399 duncanhuisman
913,000,789 *5F03C629D7A8826718C03D232709C42398EB4C03 CRITTUR
913,000,790 *5F008EB3BF28F34CF2275164BC2AFCE8A2AC7BE5 d(vwz
913,000,791 *5F00089700E47794146BD51EAFFBD2EED40C52CC DWAYNELOOSLE
913,000,792 *5F0698E40F67ED5A86EFDB8937439E34961D0BCC cssmu
913,000,793 *5F08079F1F6C5462611E779FC8B0C8BF7E307830 [email protected]
913,000,794 *5F0A13CC68CCDD6CB2E08C44F74713FBFC7E4DAA e017443d0ed83fb1b6a040bec0432519
913,000,795 *5F0FEDD22C55110DD2B1418EEEF733EAC68A472F cups聖龍はjapanサッカーカレッジと同一母体のため、1部昇格は不可、
913,000,796 *5F05FA19429ACAAE0EB27726D2DE72DC2CFECAF9 CURRICULUMBRIEFING
913,000,797 *5F039C927200E6F1AFD6C0D0C8E91A826E2139F9 C!VD=
913,000,798 *5F09ED0C6009D8AFC2B4DEACE331026147784696 EDMOND.VANORDEN
913,000,799 *5F019E1A6D06D20C00412CE626ADD1131BA9F11D edn4
913,000,800 *5F0D71454A74219BCE016134073048E81AA030B6 EGNETIC
913,000,801 *5F078A224A320E0E6823C4D34850B0145287A29B [email protected]
913,000,802 *5F07A533322787F770056750BC7EC52DD8C4D6A8 eg.#w
913,000,803 *5F0B02FDDD9B0B8CF438AFAE111F355C73B25787 eignoret8
913,000,804 *5F01CFB60030F3FE2DC361C4B2169AD2C91D1748 EIUOOVFH2
913,000,805 *5F078165B4C8D6A601E94A25AC9974E52EC5FAE3 d1wet
913,000,806 *5F04A4E1B830CFAF66E69871035F67F79FA8988C d2+t
913,000,807 *5F092853C78B13B36AB447EC4EF0AE7CAC7B7556 D5P5"
913,000,808 *5F0E46CFBE38E9639FA6E5726CC58E82EDDBC172 D6"NH
913,000,809 *5F04F25D31C4BA9DD1A86D505AE126E8CE6B220D d:89
913,000,810 *5F00E6DA15FFE36A0A6A3A3B4B608E844ED2E02A emanuelbaumgardt
913,000,811 *5F0D1E3ABD2F3318C6ADD4BFB9B856ED893B44A0 d=9;b
913,000,812 *5F0A73AFC496B39F5AF661F561FF9B065DBF0DCA EMILIO.WELTZ
913,000,813 *5F0764A543D86024839647B1C98159F62DF3C882 dachshund65
913,000,814 *5F029F3207F3DF7BB090E039A4A7D372B3DD64B4 DACIAN–ROMAN
913,000,815 *5F01C08B923419C17E2835DBFC87597674A80943 danadon
913,000,816 *5F0EBAD490C7E5E70594D987B3FEC3DD5ECB2DB0 dandy.lee
913,000,817 *5F04FDE009E6D2F25C4631A1A1942C5C80C45B9A dapw2
913,000,818 *5F06EA816823E2114700C1AA6F5A8A297472B8E4 DARBYMETIS
913,000,819 *5F0940587FFCF1A09448980116FC291B67576EC5 DARINHOPP
913,000,820 *5F0C08C5B97D5DCA5715C1EAB108522DE67A0303 ENTERTAINMENT-LAWLAWYERSCOM
913,000,821 *5F0619FA46BB12B7DE1A3850384755734A908FCA darinthelemaque
913,000,822 *5F0FBC48B99E4DB31DE18CDA9366CA173A0934E7 DARRELHIEBER
913,000,823 *5F01337E78EFF63C56365024AC81C0657FD50925 EP2RE
913,000,824 *5F042CD2E0363A92F101828E12F3309BE1918C70 DARWINHOUSEAL
913,000,825 *5F05E2F6ED928F7A82AC631ABE3FB8217F0FFC7D EPISBSWS
913,000,826 *5F0297D7BD0CDA590BB5166942F51A0D7067DB64 EQA9)
913,000,827 *5F0E5599F27F52EB252C9CADEA89DF1EDD92AB56 ereklyéi
913,000,828 *5F0FBC3719B995B3D08AEFCF2555D37981757546 erickpolintan
913,000,829 *5F01B9079330E3E1876E412A0A13EEE8D2AEF550 ERIC-STELZER
913,000,830 *5F0B7BD7A27AB40B198BD17A0B57E6FBF5729409 ERIN.LEONARDO
913,000,831 *5F0D317A56A7A4E7C6D8D176BC4486ECD46B9F89 ERKRANKUNGSSTATUS
913,000,832 *5F0E74E6D4C140941A1DEF4E5EC090B3A982A279 D!:C(
913,000,833 *5F07C362B80764C60220E636BDF73157D4DFE28A ERTASTTING
913,000,834 *5F05BEB731A38DF602DB5094DA6C62274CBB632B D#cL
913,000,835 *5F036C38D4ED82E6F519428A39CAA920A7F8AEC6 erwolley5
913,000,836 *5F0EE8291AE11FB5C418B49DA8A8C2FE2A0A6A08 d/d%:
913,000,837 *5F0F78B3B84BC7C9176D9822BFAD9523C1680450 D"+?D
913,000,838 *5F0BA91309958A2A394335701655ECFAB1F8BFBD ESVYT
913,000,839 *5F01BB454BCDFE810F73840D1E26510FC8564D39 eteomtno
913,000,840 *5F01EDB284D5504543028E99039CAF067116FE0E [email protected](|>BYESR3TOA!4T
913,000,841 *5F0978C57B9DE95CE18893A04F6E84C36D252B78 DECIQUINENE
913,000,842 *5F085ACAD7F1FDDF2D16C26186771DA6547B527F EUGENENEUSE
913,000,843 *5F090C2FD79D6B633164FF203F29D026A0369A89 EUSEBIOMCCROY
913,000,844 *5F098963ED82A05868FE176F0AFFFD3F2960FF3D evelaw44
913,000,845 *5F0604A7B4FB49690C99008552B4FC5C9FB3746A DEL.CARY
913,000,846 *5F0EAC50BACA811CFD18222305DC7E7FD693534C DELENDA.EST.CARTHAGO
913,000,847 *5F014DECDB4C4223E071FCB7D6FB563B6C8DBCE7 DEMPJ
913,000,848 *5F0356A1630C402B4DE39321312A3A83D259531D EZEQUIEL.HELDE
913,000,849 *5F0804A69CCB2E0CB8CD66E9539347A6778AF217 DerSpruchaufdeinemAnrufbeantworteristscheisse
913,000,850 *5F08433E749A54E17EB9BEDD95F622CBC38AE179 DESHAWN.DEFOUW
913,000,851 *5F0C8E1197444B34022DADC2B285A7D0D51AD6FB de-slayer
913,000,852 *5F0068F83189FFE4CBE4D4B53993470030ABB5AF [email protected]
913,000,853 *5F09FC7EAE4431FD2778E0C9347774EE79F7F401 farwick1
913,000,854 *5F0E553E619A57F663FB09F7F27FB0A05CE45672 df#&
913,000,855 *5F0C105167AE051C908AB9F9EAFFC88FB56C6F93 ferullos9
913,000,856 *5F07A0CB4867B1C0FEDD6F0C9767DB08812E7E60 filamentary6
913,000,857 *5F0CC4432EA254D0F6946F5494A74B7633277528 [email protected]
913,000,858 *5F05693FDD95BE784B4BE66CCC0ED6187CC0E835 fluitpartijen6
913,000,859 *5F0732F6F00553A8D930787B510EFA71A4141C6A F\NI
913,000,860 *5F0EED72F0A1E784ECDDA3F0F597AE90B0DEAD92 fordbuzz3
913,000,861 *5F081E8E30124BD191003B3754BE0EFBC6B7D5D0 forzarans
913,000,862 *5F05A53C2C13AB4A0347D64BE25DD4EF1941CE24 dkakn
913,000,863 *5F020A2C811DD08B73050F4199A9F590EB6FED94 dl7,f
913,000,864 *5F0FE4DBE146F502F533F2AA0280D73C8DB24461 dnkqs
913,000,865 *5F0B924FD399CE8EEDD9039E5D8960A07DDD651F g63g
913,000,866 *5F00B07218BB24B0CA836946923F3ACE134D6855 GALEFILS
913,000,867 *5F001C97EC653068048C4C3E16B26338DFDB6368 GALEMASINCUP
913,000,868 *5F05A929960CDDA8D8231B744DD2851B41180230 DODII
913,000,869 *5F00FA2E1B8D0BA9A575FE41AB1F482C11943299 GARRETBIDDLEMAN
913,000,870 *5F062C4E6826BE605E72681B0E044C05B5758E26 DOMINIQUE.LOMBA
913,000,871 *5F0B5F37654DBA4AE18F7EE97795D98848CA4E66 DONALDHUNDEMER
913,000,872 *5F074EBBFD1CABE72FA4FB0E29D2BA5DE075F930 don.giovanni:.act.i,.scene.i.."notte.e.giorno.faticar"
913,000,873 *5F02399A0DD8CF0B6D395CE0B71EBFD45101C085 [email protected]
913,000,874 *5F019964C193833B686FDB5E4B862FE9984A904A GAURE6
913,000,875 *5F0FEF4B4B6B6F15E4F62FEA956DFF363B28717E DONOVAN.HUBBARD
913,000,876 *5F0537822BD0A77069FB2C30487F63BD10BE31A9 donovansowells
913,000,877 *5F06671334F11A752BEACF261378C5893C4E3EC9 don't-go-(remix)-(feat-oddisee)
913,000,878 *5F09E82806C93DCC21CC4EA13B4704F72256B145 doodwerkt9
913,000,879 *5F053EA653362BC5388667111EAEC3758DBFF578 DORIAN.CHEATOM
913,000,880 *5F00C327BF401FA5F41F70780F9FB65D774557BA GENIUS1966
913,000,881 *5F062CBF1FAF973EB6B94F8DA3A26CAC135E2165 gerardhesley
913,000,882 *5F0847B21D2B3A1B7FE532B2B5ED1608F0B82BBC dprex
913,000,883 *5F09003457A0C0E97583AC95D99E8FDD88CA0E84 D_R+
913,000,884 *5F0BD61915DFA1A91587CFB7D401411B553CB0EC DREWHUGGINS
913,000,885 *5F04786B222BAE4A5952133FB753CFF3A820BEFB GIOVANNI.GOLDER
913,000,886 *5F0854C0659BFA6FEC74563D5F8D37F67BA56996 giovanniguay
913,000,887 *5F05986DC83E86BCD05311F976A88650FC7DE9F6 GLADYSE [TK 2]
913,000,888 *5F0678E287954F1ED2EA91944F53CBDDB4992632 GLORIOUS-HEART
913,000,889 *5F0E8E45766FEC9965C0D8F03ABC76BE5C30443B gl!y
913,000,890 *5F03CE6DD022BB8D4E388B02B1F35FF6FA93577D dtrw
913,000,891 *5F0FC8FAE99265E9E6DAF9C35BB6C131142C4A42 GRADY.JURASIN
913,000,892 *5F020B44CEAFCB3450693CC559495A969855320A DUNDEEPPP9
913,000,893 *5F0BC03545656E8E95F4C653D3A2638D87ECEF0E [email protected]
913,000,894 *5F0A7B30C335EF8D863A2A838002772A30691177 DUSTINHORACE
913,000,895 *5F01A550854696AA6208F6601EC1D9CAA206CE8E GRETCHEN726
913,000,896 *5F0E438D4AC621F03BF38E6BCED1C0F385733C46 großstadtjagd
913,000,897 *5F0163EBE4E3154C45698D43EF2918A6B55E2D08 grubost1
913,000,898 *5F0C7FC93094D84BB0E10822263B3E1CE66EBA96 d:%yg
913,000,899 *5F069561CD623ECD473E313D9C2081AD1C4BE18A dzrs$
913,000,900 *5F03A05340F1230F9E91EEC72386403B3421838F [email protected]
913,000,901 *5F0D92F38D43B784B7C81F45E81A686EE8F4D9AB EALINGACTONSHEPHERDSBUSH
913,000,902 *5F0DB2447A9CB5E14BAA0367378B1C76902C4B75 hauelok9
913,000,903 *5F0C0F00D1ECA94037A55781EDE1D13A4B554A8F HDIRBSW5
913,000,904 *5F01D56CEE7DCB519454AF34C7B6114C40EB955A HEAVY METAL FOREVER, PART II
913,000,905 *5F0600638B585D36725C05F8EB13BE390495FB38 eecx
913,000,906 *5F0C97B2E27C7F6A2E9091F6E86D03D2666DA701 HEILIGTUMS“
913,000,907 *5F0D5D5921355E2AA916176CB892DF7957E0E965 HEISHEISED
913,000,908 *5F0997193441DFD1318C13E441B2DB8D44D9FE75 eglkv
913,000,909 *5F0AF02D870518348FD1140A4C3456DDD2C15097 HERNIESED
913,000,910 *5F0D30AB7EAC1A51F3AD30E282C048704582A67B hertugdøme
913,000,911 *5F0CCB33EF40539D73395D401C63E7D93D55B116 HIPOLITO.SEBURG
913,000,912 *5F0319C6BCB3199E64465FA71515F28E3C21BEE8 EK!VO
913,000,913 *5F0DF21CA49162F5BA065C15BB3752C162748C28 hollyoodului
913,000,914 *5F0E421A50E0AB7CD4C4CF5F634DCC13BBD1A538 ELLIE MACLENNAN
913,000,915 *5F07E6FF435E71A07907A80B1B506248C235056D elliottruiz
913,000,916 *5F08C5130D496CD40112F3C9C7C084E18FD839A0 ELMER.GERINGER
913,000,917 *5F04E017F827D4CA045E89FFBFAFE619EEC60CA4 EL PARDO CEJAS
913,000,918 *5F0C035B637EA168D339946644BACFE6C086DE96 HORACE.HARDGRAVE
913,000,919 *5F08B8E5E803C7A7C1B601D636E00511A9DFCE3B horacemagnan
913,000,920 *5F0B731D37D6C0FB533DEE954D2EDB60A5E7AB5E HORALUMED
913,000,921 *5F059A9F439BC9D774A2811E61D34C618508E4BE EMGW0
913,000,922 *5F0D5982E564CDA20A3F727C94DEC519950224A5 HUMMER(INTRO)
913,000,923 *5F0158645165BC2E15845B6917C8B8CB8703EE5E ENZWEILER4
913,000,924 *5F0614D568EE7261B24E764685F6F093B65A6A22 EO?II
913,000,925 *5F0736BF7BBB18FECCF825675E57A6B6EA527982 ICH-LAUFE-DURCH-MEMPHIS
913,000,926 *5F0F5A8F24570C394EF6A1B1FC5B793A748DE9EB IDADDAHED
913,000,927 *5F0E51836871B03F98398A8E9B6E1B80AD1822C8 ERWIN.RYDEN
913,000,928 *5F0D08B2815380F5C904DE3B785A33D7A914BD87 I-DON'T-BELIEVE-YOU-WANT-TO-GET-UP-AND-DANCE
913,000,929 *5F0DC1BE1E01776695DF57A7D2A95455ACCF1250 es"7h
913,000,930 *5F00CDA98887977626FB024A057B6C6DB5E2F3FD ikecreggett
913,000,931 *5F04420A727F9218B7D6BE295E02841AEA4D2C62 IKKRYJIK0
913,000,932 *5F057F8E0DCE49DF8FFD068B9C211D8A82F0F4C8 etilibix9
913,000,933 *5F0A26ABD1DD95A8FD8E4D45466E3CA4B686EAFD ILEVERED5
913,000,934 *5F090B775FA561F03966D8D167B08C4C54EE9CF9 euoys
913,000,935 *5F09AAC0639D865525A7B9EE9B4B31A50DA154E4 iluvgeronimo09
913,000,936 *5F0C530672EADEEBD0795C5F63B0800CBD1ABCE8 immigratori
913,000,937 *5F0BEFB0DB037A8F1AF2F578DF0B45FEBD7448F5 EXPOSITO2008
913,000,938 *5F0DFB99AB4DDC9869349AA1EC0FA252375DB814 EYDt
913,000,939 *5F0277C1C75151E35B168EE7CBF4AB45BE8C313D F1AVORS
913,000,940 *5F06DEF5E08C20CE6BA459DAD3EC663D6E683F95 institutinen
913,000,941 *5F050D46CC1F2F49A1BFAF845C2DAA63C5857DC2 "famouslastwords"
913,000,942 *5F0F349B347DFCC408E43FC73B9089B1B1701D01 [email protected]
913,000,943 *5F093E9D91EECE318A207897F8C90DE003A9CF54 FANATICAL.PHANTASIMES,.SUCH.INSOCIABLE.AND
913,000,944 *5F08F41753C5AA0387A8190C1F915608DA1FDEE7 [email protected]
913,000,945 *5F057027A757F83E0486B40B352E1AAF0AD375B5 INTRFFA8
913,000,946 *5F0A3AF38AAC030BD05184C79AE7469F276F97EB INTROMYT4
913,000,947 *5F02AA8BB6D20E6AAB51E82A6F1DF78DFF0B0318 fastest.movers.5
913,000,948 *5F078A4AE925EFE541D018C854835D91701AB475 FAUSTINO.DELLEFAVE
913,000,949 *5F0D1C31B8D8274CD4F04CD02B576748C316A29B FAUSTINO.SATTERWHITE
913,000,950 *5F00A56C1E61BCCF9FD28C6EE1ECFEF33FAF7067 FAYEYEEA
913,000,951 *5F0C9B6F0A1F74E833082F497A50689C4E1E9413 [email protected]CCOM
913,000,952 *5F0B19BB70B2B2EF230B9AFFDB05FE3186E8D123 iriekana2
913,000,953 *5F0076520F8A2D5AEF3E9B4A7C7A9D459A7B4022 IRVIN.FLORCZAK
913,000,954 *5F006AB17FF23BB8C14EB1AF9FD72ED85B7D868F irvingbrez
913,000,955 *5F0AFEC87A0EC100A1771E91B0A4B95707F52632 isaiashervol
913,000,956 *5F0DBCAF1DEE73E91F9C45F4129D06BCF9EFEE51 isiahballetta
913,000,957 *5F0E3CC7739530653E31230CF0862B5A282A21F7 FENNHATÓSÁGTÓL
913,000,958 *5F009DC2243B4789D29B2C311F8EE04DF16706AD ISIDRO.MIRLES
913,000,959 *5F0C6CD5B038D51D05509F3B47F73C72A9108335 ISQL.SOURCEFORGE.NET
913,000,960 *5F077A4DCCC667BE0F1074E2BE59E73D48F00067 ISREAL.PAREZ
913,000,961 *5F0BBCC0AE34E941380D92F107B1399ADC105665 isrealsimmoms
913,000,962 *5F0FEAB8E38F0D51B1D5A94FF662058C672B6B3B filters(andy&thelamboyclubmix)
913,000,963 *5F0B6A902883A84858F9E84FC3C67BCD8C007736 jackaman0
913,000,964 *5F0345C575E155A082B983B48CCB7ED1E6608EFB jackiereavley
913,000,965 *5F0D95366D1311D275FE7925FC20E1B7B1314AD5 fletcherstrama
913,000,966 *5F04C2C89F8B225C5CD7F829C5D05D285EEA5C42 FLORALLYDECORATED
913,000,967 *5F045EF54FAD07B77C92AF6E14034C71C9F40E86 JAKEHEENEY
913,000,968 *5F0CFB6C731123AD108D08D83D07DF4B8B149AC2 JAKEODDEN
913,000,969 *5F0F6C6A1CEEA54D7CA95B65C050335AEBE52DF9 JAMAALNEWELL
913,000,970 *5F0C50E57F8D321E944A831DDA52879B57D90386 [email protected]
913,000,971 *5F0FDCD5BDF929AA3E4AD4022427CE5A4EE8E473 FOVSY
913,000,972 *5F06820B0E43D375D75CB26AD6D398C7F354D871 FRANCOPHILES.9.1
913,000,973 *5F0E736C4C70B883B3E9F13F531599A811F4B838 JA青森中央会が将来の『県内5農協構想』を打ち出しており、このうちの五所川原・つがる地区では、
913,000,974 *5F0F6A3499F292D9FEAB54A94C7749A8AB2DA6A3 JC.SYVERTSEN
913,000,975 *5F046F0461000C00550F8F4D4FB6368C21E3E52F FREENETZEROPOINTRUS
913,000,976 *5F06389B41026E61BA86D871B60058B27A26FACD frenica3
913,000,977 *5F0D8968FAD04359F47D2171D0547120113FCF3B JEFFEREYMANZUETA
913,000,978 *5F0FDBC59F9A1EC670C86ADC411BCDD86481F72E JEFFERY.BOWAN
913,000,979 *5F0B6CAD22882852DCDF7A1D57407303D57AFA0D FRMORLAC
913,000,980 *5F091FDC8E435724E7B7CE41C5C90504A21DD596 f.sz
913,000,981 *5F02968214D3D04BD41671EDEA65F71AD31503ED [email protected]
913,000,982 *5F0335F8F707C0669577CF7919FC7B81BEA4A12C GANESH-KARUNA
913,000,983 *5F0CBF01E2CCAA0A906E58FB5E3333782CBA7EA5 JIGZHERRERA
913,000,984 *5F0144616F08ADCD748B71AE628EC20C8AA4C914 jiqefuqev
913,000,985 *5F0FEE32BF44578ECE72B9EE75378964F2CBDD8F gaylordukosata
913,000,986 *5F0381B39567C02561B141E3679202D76605827F JOELLA MOLSON
913,000,987 *5F01438CA9A1C3322FB5E9BB1407F2976F1C4FD9 JOELOVELY4
913,000,988 *5F026F157173744D9A03FB74EDD0556DF59E2E68 johnsonallemand
913,000,989 *5F0EEEC5419F2E0A46239A8F97541CF112F5EFA8 JONASBROADFOOT
913,000,990 *5F088F18230BED8A51AC56F44F5C92D6088C2D2F JONAS.MICALLEF
913,000,991 *5F0B5E6770A7F2EC47AF790DEBA21B262369183A GERMANVIDACA
913,000,992 *5F02C478AB832F1F48A65A93C886D5F06BEF753F JONES.SR.
913,000,993 *5F0D9DEADCC4E6595D0E2AF199E5991DEBF7EF81 GETLOOSE(60SECONDVERSION)
913,000,994 *5F0ED324DD6C371DA8FD72218799BA9FBD5301D3 ghettoising!
913,000,995 *5F0C509B8CD3C28FED8B9762061AB363309943BC JOSERENNEKER
913,000,996 *5F0EF0DE17E26E84FC4117EEEEDD55D8AEE14FF8 joset
913,000,997 *5F08F1BEC92DF3144AB89C5A490FA8C04A23C6A0 girlie00
913,000,998 *5F0DAB85C7CCF16BE38238C7374BE7952889108C juantez0
913,000,999 *5F03854BFAE02439BA29D33C247EB6B4B8CD8CE0 GN+E
913,001,000 *5F0D779BA6F7BDE74A550CF3BAC2C302B23FA841 justifiedmusic(dimitrifromparisvariation)
913,001,001 *5F09CDBA1AB700AADFE6AD0DF6D06FCCA6B5DA88 GODOGERS
913,001,002 *5F0A6F13F1D4879F11B76ABA84654413F4F2BC25 [email protected]
913,001,003 *5F0A8142EAC9C6FB5DA7080C6EF923E8BCA6F180 k{^
913,001,004 *5F0F093B28C736711F24A1D926138D090462865C GOOGLEになかったから作った
913,001,005 *5F0217D5C233B23D411D276C56C03CC17949D9EE Go,sirrah,trudgeabout
913,001,006 *5F015DD257394FF5BFB45A15F72BD0BE2F5E8DF9 KADARNUGROHO
913,001,007 *5F06A9062210E14CF5C4444C273FF6DF842857A4 KALKSPATKRISTALLEN
913,001,008 *5F0AE4378F72E5E43667DE1A5B90CCF692889FB8 graigmarcks
913,001,009 *5F0FD0DC90A67B30041AD081610C06CB5B5B0CDA GRASWEDUWEE1234
913,001,010 *5F08542490929F59B16CAB498000B8C999F1EE78 karabournou
913,001,011 *5F0121DFEE04C8A80F35EDB64DFC621D5F18CF29 KAUSHAL AHUJA
913,001,012 *5F0E6D114461A43E534B64999BAC5BE0C565B2A6 GUADALUPEPINELLI
913,001,013 *5F04A2E8F6DCC104FBE18E7302366D9C30F997C7 KDARAMSON
913,001,014 *5F076B9700E9E27FF281E6754A3C39F910BC8E20 KEENAN.KASHANI
913,001,015 *5F07C117382A9EF5767456575B9EA62CFF5CFA63 guixian8
913,001,016 *5F0BD6E65594985118BFD84B74EBDF918521B947 kenningses
913,001,017 *5F0789D5B4786BDC2E288C62DE4176474031FD35 KEVINGLEAVES
913,001,018 *5F09F1A35F057761EE41BCC10816B9F58876C664 H331 NAI1
913,001,019 *5F09A062EA104E3209156687208B88705BC9A195 KEVRENN-BREST-SANT-MARK
913,001,020 *5F0BB5087CCCD6EFFA16DCA25FE33F81454E5DF9 KHAMANE5
913,001,021 *5F0D2C80FFD518C32D5C6BEF19F8747B3E679090 kingsimonetta
913,001,022 *5F0BD3590C83D722B5CCA83054DECF65B6ED6838 KIP.PESCHONG
913,001,023 *5F0B4766DB55645D980B5BA8C2B5C2C61B416B9F happy1knights
913,001,024 *5F0172D4DADADC57C12958940E54C62E3ACCD76C HARLEYMCVEIGH
913,001,025 *5F0FCDA2B638BADF6139144C98B3447369A661BF KKAMISINSKI
913,001,026 *5F01E131B3132EF07B39875B936FCC9672F6BFE2 [email protected]
913,001,027 *5F05F2757130E87FB8C4E84D58234F951B82AB12 KOABITACJA
913,001,028 *5F01A316684FED445D028EB06B4DC6AB2CBD57A8 KOLE-CRAWFORD
913,001,029 *5F0DF52BA84C1E3F326FDACEDEE619B37205DFFC [email protected]
913,001,030 *5F0D3F04872BFE371DE3D1BC2E74EFBC8F6AAED2 heartsmemory
913,001,031 *5F019A3A03D444725F3B09654C800AB7D45944D9 HERSCHEL.ABBADESSA
913,001,032 *5F0D2B8AF5B355016B45885A05A53EDEC3D52BEC KRYPTOKOMUNISCI
913,001,033 *5F0C847DB9D22797DECD8F0CD53829594FCBE6AB KUKU WASIU
913,001,034 *5F035F894646AB0E03296787DCCA5F042161BCE1 KURT.BETZLER
913,001,035 *5F02EE030152DA2F5423C31BC536EBEC3B90E4D1 KURT-KEINRATH
913,001,036 *5F027616AFFB51007894D73CA0E0EA1F4CFBD820 [email protected]
913,001,037 *5F063E0092B84D6E78352DE19788721004379BF1 HISTORIOGRAPHICALSTUDY
913,001,038 *5F09873236880C2191469168993E635A04EF4162 lacywoloszyn
913,001,039 *5F07EE833744B5DAC8A5F586028125A64891ACFD [email protected]
913,001,040 *5F0FA6047A06A60E9C470A588EDBB4C1C891A0A5 HOTHOTTY14
913,001,041 *5F0DB88DC104B71B1F574E20F11275C86FF2BB84 HOW.TINGS?
913,001,042 *5F0B0D89238BBAC159CCE1DE7C407B797CC90E33 LAWLIBRARYRUTGERSEDULAWLIBRARY
913,001,043 *5F0A84506F5541F8B67DEAD8633192D91B0E33C4 LEESHEBAED
913,001,044 *5F0A2F74DAB8B711ADFFA7A87834224DD837B887 [email protected]
913,001,045 *5F031A6D939C059D4FEEDBB110A4C89F986A6E97 HYE-YUN
913,001,046 *5F07403CCEE14E020FCB11E074DF3DEBC2A3A139 i2k|
913,001,047 *5F0275984F3561F24327DE288ED8449E771D4612 iamhornet84
913,001,048 *5F0DDC4D70D2DED33C2576E6EC7B7867210A9A43 LETTORED
913,001,049 *5F0B7AEF2C0D5956FE17F84478A1A5B748FE7C36 LEYBEDIK.-.KLEZMER
913,001,050 *5F08FF46F84C5D2C85752A1AAA09A4CE194A0684 LGK92191
913,001,051 *5F0BFA9AC52B57368196523DE27A109572B63091 icxhvnmidjhes5a
913,001,052 *5F03F9E883AF0630D3DDA2C6BB5225A2BE4A51CF IETELING7
913,001,053 *5F0E94A8E47895B6D53A74950D715A4474935C6A LIIPZ
913,001,054 *5F02FDFA6AC93E08BEF9C8AA96612553E54C8204 IGVQ6E5
913,001,055 *5F0E3A0F6BB94C4C6DD7FFF9FBEA627ABFA15743 iiwatashi
913,001,056 *5F040F839697D4975F6C3C02D0A6FD1A0D3B119E ikemotamed
913,001,057 *5F0E8C689342B1D995F630725718130057764831 ikkirev9
913,001,058 *5F0C746DCCCBB2D5CBDF1C3EF72A21FDF8DA349A ilovenapoleon1996
913,001,059 *5F08AE981A6DFDC64B1A819547AAFECC6BC634BC L/JD
913,001,060 *5F092570BD014D45C0851045D231C511453FCC4C INCOMPETENCES
913,001,061 *5F03B12AB3445CA4016D0DB83CC1D71692B1F3CE INDUVIAL!
913,001,062 *5F0A6D76EFB1604C0702ECCC5FE55A84B43D567B LONGVACED
913,001,063 *5F091ED2BB254C95CC4094D0B53570DC5F034270 IN-HEAVEN-(KID-LOCO-&-DOCTOR-L-REMIX)
913,001,064 *5F0C93B72EE9E15FF899E08D90B9D2ABFE7E1170 INQUIETATION6
913,001,065 *5F03201A42069F8F7DE948E24D84C91606AEA901 Intelligent-Records
913,001,066 *5F023902537310075BC840FF55F66E6BBC549491 internetmikey
913,001,067 *5F0AEC35165093D3D2EB6CEF5A413CCD93643149 [email protected]
913,001,068 *5F07F185050A76540608967E24FEF4097B11EA5F irakapiloff
913,001,069 *5F0FCCF0F7C5E309E0953006E34EEFC9D16E6A34 isai548
913,001,070 *5F0A7DD7A43DD4B2F0EBACAD8C04D6EA5C4D5462 „ISLATE“
913,001,071 *5F0E088AB2D0FDD3643792933245359861E22B92 isolerioed
913,001,072 *5F0325B1F6857406CE39FE8AD2193F2EB6CE2D30 LXCFOQ6Z4B
913,001,073 *5F064FF595C5A4AECF5E36603C97BD35800FA363 lyleyin
913,001,074 *5F0D67A31622593896A1E57D20A3B93AA2941E8F M132642
913,001,075 *5F08FD6C48E088F000BB0D418E78099821E52B15 [email protected]@
913,001,076 *5F050D4407D95AAB11B20552EE09A4E447831F8E M240479
913,001,077 *5F0F3D4F7DE0ADF4A942EB8B28325AC6289B0EAD j:.
913,001,078 *5F040679FF271A85F8E7636B8503F139C2F5F6FD JACKSONMICHOCKI
913,001,079 *5F01F03DEEB22444DF33443627F901541D3732B2 [email protected]
913,001,080 *5F09802E7E168FD4341BB4F1007A8B697EAEC5FE jamarrimi
913,001,081 *5F0912838F9E7434463DB97A9C4A6246BB33BEFE janstorm
913,001,082 *5F0FCDBCE48ED700184DBB285CFDB8427017B8A0 JAROD.KALLEVIG
913,001,083 *5F0040A787691F3543E4FD51E0ECE514F42DB78A JAROD.PRUNIER
913,001,084 *5F0B9C65BA7FB6D7241437FD3F0B2DACF5A79AAE MANTEROLA9
913,001,085 *5F0D4313C78AB6FEA5A476EBC3F153E21D500888 MARC.CHEN
913,001,086 *5F0B06D9C4CDB058F0525FCF5257F367182A4C4C MARCOS.CHIARAMONTE
913,001,087 *5F06896E3C719E01FE220DA4A344C46EFE8C6615 JCHEVIER
913,001,088 *5F0994816FFBDC41DA219643371840D35575BAD8 MARIAM884
913,001,089 *5F02F86EDE1C335B829DFEA99B2FD00081D1D81A JEFFERY.MORGUSON
913,001,090 *5F01E0E479284D4EBEDE14DD564907ADAE24DF09 JEFFRYLITTLEWOOD
913,001,091 *5F0556086CA758152B7C3419E57E48AD3D25FED5 JELENAVOROBJOVA
913,001,092 *5F096F5E1539A7795619613AC71DCD27080AC759 JERAMY.BOZIC
913,001,093 *5F0B4AC4CFC184A77EB9B8663CE12F6460CCD41D JERMAINE.PASSARETTI
913,001,094 *5F0D11ACF16C8CB5FEB3ED558A272B871178BE3B JERRELL.BAJOREK
913,001,095 *5F05589DA6A938DBA9BC57AF9E87BB538642E91B MASONLEISINGER
913,001,096 *5F0911F0E552E6AB86C0FE5D95A4BC11B3528347 MASS-NO.-1-IN-F-MAJOR,-D.-105:-I.-KYRIE
913,001,097 *5F0890EE653DF71E4D251CC488E87CB279BF0223 [email protected]
913,001,098 *5F0D798A9CE3495E647724D5080B31C36B0465F6 MATHEWCRAIB
913,001,099 *5F0387E152204156692A03F763B43BB691EF6A25 MATURATA8
913,001,100 *5F081A3D7306AB142D36DD5138B3E643A9F53433 jody1942
913,001,101 *5F0D7EF1E944CAC9B8F05B892A42902A29B3C1FB johnadve
913,001,102 *5F0B997AB7DF84AD15DC90A1DE3D348326F56708 johniescheiner
913,001,103 *5F06DB48B176EFC1EAD02A4AB1E554B6A88A2E4A JOHNVANRULER
913,001,104 *5F0246C35E80C8ADE20E1E5CCAE8F146C0F9FB95 META键
913,001,105 *5F079A363DC459616ED6A3BC980A4B06D9F3921C jordanmehl
913,001,106 *5F04A0C032D0444F3AF814FA993F12577A23C628 MHANDINICOLED
913,001,107 *5F047B00ED1863BDACD7CE46A65CD1C67BF6D500 jósepsdóttir
913,001,108 *5F0109BD910FB4D133A1A7243EF8E2F7B1FDCAB7 MICHOACNERONGARCUARO
913,001,109 *5F0EE078EB9BAECB05FC3DBD563C3EFCE14CBF46 mikelkirouac
913,001,110 *5F0591008E90AF1A0BC75D52E7FE5C50A17B5B14 MILFORD.NASSERI
913,001,111 *5F0EEE147F6458E1D2245A248EA6A62298269209 miniver.cheevy
913,001,112 *5F02D0F5D8095CBB9F9070868EB6F360DBA804ED MIRAKIDBA
913,001,113 *5F0721012CDB853D5F5A15BF2DBD532EF280B739 JUSTIN TORGERSON
913,001,114 *5F06C61D5E22A630296208250FF09A82C7AE5E1A mistyhuddleston
913,001,115 *5F0F985E5B797E1AF6353AD0D3C93B63B2727B70 K0NT0$PEC
913,001,116 *5F02C72D89C46B4D1CD91F899C2EA2C24839CD85 MIYAK.2.0
913,001,117 *5F0982C42565EE4E75A36C53F0AC32601D2333BF Kahit.Wala.Ka.Na
913,001,118 *5F030462A82B23E950B116D05D8E88C0D3A897A2 [email protected]
913,001,119 *5F0B466421DA518E20E25871B07AFB52FAFB4C5B [email protected]
913,001,120 *5F0A9642F40564319B61248AD321B7CAAE7D35D3 KASEY687
913,001,121 *5F02E167EBEDA35665AFFA965AF6B24010989D50 KBENZAMA
913,001,122 *5F0BE7D589B077CE35ABB19510B571C659554DF1 KBRACHAELHARDING
913,001,123 *5F0A12D50DB1BA55A5F0ED70A172E152A9C79D6B KDJAMES1
913,001,124 *5F076ECB8A09DFC6C13493AF6E14DE13D860B316 KELLY.DAOUD
913,001,125 *5F0F33EEFDD95546EE1D1DCFE58AD5AD58D67387 KELLY.WARDSWORTH
913,001,126 *5F0B1D1444F685BE85C579ACCB496D6E3D5098AC MPES
913,001,127 *5F0A2B67429B19646754330C91B20D6D73C3EF9C mufinella
913,001,128 *5F0357B310CEC539F1BD3F186D52652B39DF0DC5 KEVIN CORFIELD
913,001,129 *5F08B374DCFBC0C417CD32A35CD4EE2E1922A244 kevin-greek
913,001,130 *5F07DD1E0EAF19C46311E6E3BBB9984C2EDDFF9F kgwr
913,001,131 *5F008B2F65C9E503C4D7E491D557681893FDD218 MYSWORDFISH80
913,001,132 *5F04AA8DF3271096C31B0B0C68F50E3993AE4E62 N4ST4
913,001,133 *5F0C9B41161E5D1BC9A4F0DC0A691E98CF556667 knabdleg
913,001,134 *5F0DE84C0667A950CD42AFCFD6E8F2C10EB88DA3 knslgcl8
913,001,135 *5F002CBD089FBC9EA36602CE1FA10C94994A7915 NAJIB OMAR
913,001,136 *5F0A37C5795AD87F1C164C2D11D9A1D920FFDC36 KOROMIKING
913,001,137 *5F02DB1071900A9F2D3B2784D0A798D1EABD4059 KRISTOFSES
913,001,138 *5F054A1406BD7B839D099956A97C5789356DE63F [email protected]
913,001,139 *5F009501798006E85AFCAECA94D710E822182EDE KYLE.KNECHT
913,001,140 *5F08156FF9CCBF662A074DAA523EAB25B8C88B83 NGEL.TAGUANTE
913,001,141 *5F0E546F7E431C58BCB39898C8AE0C776C5EE125 nhello
913,001,142 *5F0954098B1F0ABDB77860A9FBD3B148C995E20D LAKOSOK.1
913,001,143 *5F064EB21524C09E74E50CDBC9A40451C1C8C5EF [email protected]
913,001,144 *5F08DE0B641FDDE1F1D97A95ADB5D091F18D13E3 LAMARBENTON
913,001,145 *5F0382D72F01EEB8EA833BB768DFF8B033C5982E NIJEEMAH0
913,001,146 *5F0CB7A4DC2E5EED3337C9DAC46CEE583083ED3E lannyefron
913,001,147 *5F0ECB0EF097CFF7235D8720C4AA6743E05E52B8 NILSBODSMANN
913,001,148 *5F0124C3ADF7098D7ECB84B16DC9E517E7FC9A0E NINIVE.HERNANDEZ
913,001,149 *5F0FF7242360DD0B52AC6A8563D1BF25BB8EA041 LAUREA7E5H!P
913,001,150 *5F0EACE538061469395CADB1739F0446F6D59188 LAWRENCE.VANASSE
913,001,151 *5F0D825A337211E3445F268FB3BC019B8C8AE2EF noelraske
913,001,152 *5F0197F2E71AF25D0BD5BBCA6DD7122CA866EA87 leandrolaffin
913,001,153 *5F0006FC407A5A38407FCAA7E0E9272CA6F8D511 norbertoblakenship
913,001,154 *5F0CE9ADE3BC507CBF45A0794812AA7C1D185964 LEIGH.DELMENDO
913,001,155 *5F0F0D0BB5DEC157BBC55CEB62F7DBBAF60F9898 LEKANDUROJAYE1234
913,001,156 *5F0ADF0E7ABD5A7FB8AE189BB4373D43506DFE22 LEONARD.EALICK
913,001,157 *5F0BD9D5AEF4AE457F8845FB32DAA31F84A5090E NQATERI
913,001,158 *5F0D4B5149C60EE7E88E91A81E07326CB09FF7BF n.sen
913,001,159 *5F0E908C31C023AD109D33EAE4ED0F15F3002E37 }o{*.*.*[email protected]######3
913,001,160 *5F0DC34443EEEA64C97569B72162706410E541ED O ALBADALEJO
913,001,161 *5F06B7A018F74028398B615772CB4C7AF3AFF101 LIFESTYLEHOBBY
913,001,162 *5F0C28DBAE7C508F60AF9731C48805CCE5D80B2E LIHACIU5
913,001,163 *5F039F9ECECCEF9A210E9767105225B339E5EF9C o-de-las-canas
913,001,164 *5F0D2B6E88ACED989B00688070BFE5B85914E27A ODJAGHI
913,001,165 *5F0E9D516CBAD1A4D40484D27E0807D659D18CAD OLMPLIGT4
913,001,166 *5F0C5F463C8D1887A641C7CB7E3F37577A38E191 omacumba
913,001,167 *5F0A55209AEB2ED71D3F7A2D2904570E6158A078 lisa.s.
913,001,168 *5F011F7DAC3C84090D675404CC3BA085F763F0F7 llyr.roberts
913,001,169 *5F07B43F3B6813EEAF2B4B34D55A8D524D0F0E21 lmsdemorganmedal
913,001,170 *5F0FEF59CE6A220C66DF04C119B4E064F0315CC5 LOCALIZD0
913,001,171 *5F0370666C389D793ACA06E882D63952688F887B orkesterimme
913,001,172 *5F04EAE0C19BB1C63A741191C4C5C8A0CA1FC09C outloves?
913,001,173 *5F0275DB3F55AC5EE848C19025B69DDF835FEE37 lost time blues
913,001,174 *5F0DFDA8E76C297A4FAAE6007F9A7022E1429774 LUCIOHIRN
913,001,175 *5F0BB29F7D662A0624DCD7053CB3E9EEC6643FC8 „ludowici
913,001,176 *5F0F816EEA05D25EC3C1DF963E58E00E8CC13E2E LYNCH-AND-LANTINUS-BOOKIES-FAVOURITE-TO-JOIN-ELITE-GROUP-OF-IRISH-MEDAL-WINNERS
913,001,177 *5F0AFE91D60F56BA193BCAE1F0883ACB4EA85329 LYNGDOHTRON
913,001,178 *5F04BDE68703777ABFF77E188B3FFDF81096F268 LYNMIK
913,001,179 *5F096584869ED61AF983399016F082B7AE6C130F paul.james.baker
913,001,180 *5F06C63CE89DAD8E178978F32CDE0B885031D461 PAUL.UNTHANK
913,001,181 *5F0DD17ABA6487D596C5A0169D3465258C49AF2B p===b`)o(
913,001,182 *5F0A3F607CF4EBFC9DBA493819B79C494BEFCD0A P======B~SPLOIT
913,001,183 *5F0F30347BA78F0F51CDF31C185C178C1241E3E5 P=D ~O;)
913,001,184 *5F036CB6564ECE7FA0ACAFF92EFA5585B95A50DA MAKESH
913,001,185 *5F0B714380B4574E08981CC529476BFCBDA37D10 PHILLIPDELAHOZ
913,001,186 *5F0CFACE690A9C8CA05709B432D64C1BF1CA6FEF MARC.VASQUES
913,001,187 *5F089D7E38B0503EE9E732E5EB86CD30FFED4660 piano-sonata-no.-15-in-d-major,-op.-28:-i.-allegro
913,001,188 *5F0A193442FEA6222BB509FD22F072FA59C06484 marianbarron
913,001,189 *5F0928DE6FDA7948385BC03F144B267014703C57 pity.miss.kitty
913,001,190 *5F0AFA39363741C3ECA6EDEBDE33670C6EA804F9 MARK-PIGNATELLI
913,001,191 *5F0CFD3C725F5A50F61A4B56C861BAA2DEF96AC8 MARLIN.ALMEDA
913,001,192 *5F0DEC3D1005E0F1B2309C33A53B26A44F8CB433 marlinruelas
913,001,193 *5F03CE7B0E1E431B1FF63230594D50595A931D31 MARLON.IRIZARY
913,001,194 *5F0A3B84CFB8BA72B67E1DF9670587524DD96AEE [email protected]
913,001,195 *5F07BECC9ECB8B178FF28652F7CFCE6D1BE75301 MARSHALL.BURLE
913,001,196 *5F056D37985B10A5242E463011198F6565E77D24 MARSHALLDOXTATER
913,001,197 *5F0E3CBD3ABFCCB040E8795455487BF6B89AAFB4 pleaseletmeknow)thisrequiresaccesstosock_raw
913,001,198 *5F0D1F9A21EB90A065ECC6B6C31AE897982ECC63 mauriceaudie
913,001,199 *5F01092D8B114C78C06310CBCB3CBFFEF41AEE76 maurkhyaan.h
913,001,200 *5F003852A3B4ED5392052685094110E63E0AA7BB POULSEN-WELLS
913,001,201 *5F016393FCEA23CBE767AC6EB64B29F22BC81B65 p======p`~`~sploit
913,001,202 *5F09209BB470A4FD06152201330DE34A2350F4CB PRINCEBELKEN
913,001,203 *5F0BAA99A655F761878A7FC51FF25E4B887F0C8B [email protected]
913,001,204 *5F06CD5D75C0578B543BEF5AAD3084F7423A2B2A PROREALTYP
913,001,205 *5F08259EFFA63AF07A31C1473B036F588F775C03 PROSPONE
913,001,206 *5F0B39913EEE8B4A4A24373813F67E999F2434BF MICHALSILLS
913,001,207 *5F09D9C745F92024A05F911E8D2C527C72C931CD [email protected] ~ ` SPLAT
913,001,208 *5F0F7757E9882AB152533BDD1F83AEF96BAD5EED PUR-FECT
913,001,209 *5F05228E0B997C51F62A53AB96CBD578A99C8239 mikelkovalcheck
913,001,210 *5F053641A9D092FCED7CF28F2A975B3083A3929A P##@*)X(
913,001,211 *5F07986EE864FC4E5F72962D05EB8D5DFE47DE75 MILGRANA9
913,001,212 *5F03B51BD33C36DB5EC660AE43DC7C9333E7F362 pz^p
913,001,213 *5F06149D34AFE837FCE349A3CCABD28D72CFFCF2 Q--->` ;)
913,001,214 *5F0523128182B5D8521EF0348602546B4FAE2FFA q).*.*.*.~0~o;)
913,001,215 *5F0D41E443EF1FB0B68E1CC36ED1F0A264FE2A82 (^_~)~Q=B
913,001,216 *5F01FCF0CD84C0C2F830746789119CDC8D555FC7 Q-B**>-<
913,001,217 *5F046944A5A856AFA6E6E7D3E8B84F2B4AB33747 QUALLICH0
913,001,218 *5F039B39404D5921C2CC527004A0A073A772E261 mostafa-elshaarawy
913,001,219 *5F09BC821D7FFFD2DC7C41C37997844FF7FE1C8F RAFAELZACCARO
913,001,220 *5F0735CE4DD2DCC27940C81D5647F89E13BB8941 [email protected]
913,001,221 *5F0B8B84661FA341FD1D3CF683CF72B2E718DF6B [email protected]
913,001,222 *5F0ABCDEAD2F1C64EA9C83CE51498FA78EFA8BC3 RAISTLINI
913,001,223 *5F01591EFFD4B84249E03983CA3B5226E00AE8E5 MTHIMKHULUS
913,001,224 *5F0BFB93AB490BE3D70BDE1C34049AACFDB8CD73 RAMON.HILSINGER
913,001,225 *5F0E3715844E6CAF1E6AAD3042D16837EF172CD8 randyga
913,001,226 *5F083D9CAD9A95E900746A673100DDF65ED9F852 MYJACKSON2000
913,001,227 *5F00A4A3CFF40B6510ECCA1AD6858AA8549D9267 razmara6
913,001,228 *5F0886E3F9232CEF1DEA50465DE8C7ED34EAE59B N[?
913,001,229 *5F01B62E51762B2D804D8B70B7D7260F1F9CE445 N4UFR4GOU5
913,001,230 *5F082E726E144CF89DD12CDB3F82EF85A25AC3C8 nasime-ali
913,001,231 *5F05BF2ECCBF481714084EB0B72DFF5779CC821F nationstate
913,001,232 *5F050036D29341CBB70AFDD69F33B1D7C19F07B2 REID.MCANAW
913,001,233 *5F0DF118E322A81F14F2F8A8BD47010942892BD6 [email protected]
913,001,234 *5F0737710D77EFA7602DEFBE86E32AF532B9051C NENEORK7
913,001,235 *5F0B3725A5F71527A897D1F3D4BB7F0CC4EE23DB RENEMESTA
913,001,236 *5F0DC26DBD225A1755F614E2B3941350E2BB5EEA republica)
913,001,237 *5F0C3E9E74F3CDC012C31E6E4BC17BF702831FA2 RERESEBOKNINGSING
913,001,238 *5F013F9911ED21CEA7632B174EEDBAA1240533A8 NEXTSTEPFOSTERING.ORGWWW
913,001,239 *5F0D6D4484EB5F9D867B20B7CA282D2F6249EBEF resg
913,001,240 *5F02FB354BA241490FF634C192A5A53694D40E6C REVENDICATIVITÉ
913,001,241 *5F05D0A323AC3C2F0FD3ACFF68DD6621BAC3D5F8 NINETEENNINETYTHREE
913,001,242 *5F07FD29F66B9369414D699F786D356CDE93090B N,LA
913,001,243 *5F0AF3E3F0315F99371D8D7560C518314A887C1C richieduffus
913,001,244 *5F0B02A93D664A9ABF23D9643F1CAB311BB96218 RICO.HERSCH
913,001,245 *5F03702D8766ED1F3FC07CFADCBB8657DE972D34 rigobertolaberge
913,001,246 *5F0657883B119C0D85DF876E663A6EE4146A8032 ripsnorter
913,001,247 *5F08CE0248A5E60DA1F2CB1C0F2A97D76424D94F norrisbuccellato
913,001,248 *5F0BDA6223F1455F3C6F5F11A40F654F71D6FC25 NORRIS.CALPIN
913,001,249 *5F0C5CBE424852ACAB7C0F974006B7F9E94ABAF3 rksrfcnsq
913,001,250 *5F0EEC1379C3D7F25D4E9B1FE5C8E5D858BE2E54 nozow
913,001,251 *5F0DC096D5AF7BF8AA1BD534B81A414B8B9E36A5 ntsptcss9
913,001,252 *5F05D7C99397D92B21377652A180396C8F22D094 O334APT
913,001,253 *5F0B4DD58D6ECAEAF117A6F552D618BA10328019 roosevelt-black
913,001,254 *5F08686DB6DF248B1CECDDA45234697E991E6C44 rose-brunt
913,001,255 *5F035C27B38DF5097944899D991092775236F79C [email protected]
913,001,256 *5F05DF0C9CFEA1DC9D67F8BB3A437EE92BD76B96 RUFUS-PUTNAM
913,001,257 *5F07963199E4F1469B231BE42806F117502C0AD3 RUSCHRISTIAN
913,001,258 *5F0534AA5F3285D7F97139CD7F55A779BE511E7E RYANSIEBENLIST
913,001,259 *5F09214E9FAC3B89692842833964DE466B149295 [email protected]
913,001,260 *5F09D61866DB4652438B918C0405D6950183396C OREN.NEAT
913,001,261 *5F0B6B0A03BB911F2C5B623E051841DEA9FF7270 orenrima
913,001,262 *5F0D235B8E5B89CBEB1179634A047C1661F2F357 S73871
913,001,263 *5F0E039D9BB314A0124FAA4905B168362485C908 orientational7
913,001,264 *5F0C69FE1FE555751D9C7D962DC92A98414F55E5 saint-judas
913,001,265 *5F07EA467A453B6DBE888A2A4008C839D930B9BC SAL.TOMAN
913,001,266 *5F01DFD4559E050B94C05A1FF6AACB029B29B627 OTTOSERNA
913,001,267 *5F0B87A0E8482B4DAB80D65337D7F26BE8993730 OUTLAWS
913,001,268 *5F0703043C1651183257BE65730741F7EA26A15C SANCINADO
913,001,269 *5F09EEA523E2F7DAA9D0878C0F765749C4D9892F [email protected]
913,001,270 *5F03F23C48382C5562B741E9229F7C706B08A9EC SANGMCGOHAN
913,001,271 *5F0ED2A967EF5643774CA4F72A8B309FCAE67AB9 sanjaci1
913,001,272 *5F044D8D8DB6FE0ABCFD185307D5D92F4C9017A7 SAREIDNECNE
913,001,273 *5F04DB87A5A6A1233C729EABFD0BE35113E6277A SARNAKHBYUR
913,001,274 *5F0E3B6A7A1FFFFD747BB11091B052E69D359C12 [email protected]
913,001,275 *5F01723AF4851750206353B43AFBC9EBC8E64134 panico”
913,001,276 *5F015839C4AF86B54814CEF4F23B10AA8A277D4B scotbuchinsky
913,001,277 *5F0186EA7451421216700849140FCE16BFAD8292 SCRPPNSS2
913,001,278 *5F060833D443F27ED768D54E04F2A92053377FFD PASITRAUKUSIOJO
913,001,279 *5F00969E9FB559FD60924579A4067814856315AD PASSIVENESS
913,001,280 *5F072CC88ADB709B8891A5813BDD7FA77C90A9CC SEAN.SHAPARD
913,001,281 *5F04769F6B912417119FA160BAA3318AA88EB504 sebastiancristal
913,001,282 *5F041864D007AF8CB99A9B62223E4E80E1036494 SEDLEGLL
913,001,283 *5F0AAEA988C7DCE4E4617DB7B39E0052607970DD SEETHRUPEEPHOLEBRA
913,001,284 *5F01BA7701CBC123FD5755C6EA8DF396098AAE3C P~B'
913,001,285 *5F0FEA774EBFA7757F60E0AB78FEE856D8B9A853 pd.~0)0(
913,001,286 *5F0F9EE39A602485413CCA977EC624852C23D6C9 SHANNONASDFG6
913,001,287 *5F0365D39F6F7002B9E7E3F9E6C0D2BA80E088AD shannonhaynes
913,001,288 *5F0A4DACCBF7C69CE8C7FD95EE82BBC543254513 SHAYNE.DEGUNYA
913,001,289 *5F09B6F8E1BE3125D748D95A0941D43AF7196B8F philbuchner
913,001,290 *5F031753B76407B62337793AAC2D19CC047A8588 SHDW1SNFFY
913,001,291 *5F0A4090EA207D5C5DC7966582DB86E9877F0F0A PHILIPPE-TORRETON
913,001,292 *5F0CEFB73894479ACEE990C63C21888D8EF3535D SHERMAN.BARAGAR
913,001,293 *5F03AA83BCCD6F89E2CFD4DD2C257637B6BFCEC1 SHERWOODDELNERO
913,001,294 *5F06281657DC39C3C4C5D6E8F7520614672F49D1 she's all that
913,001,295 *5F0E4415C9C6A3305F8ECB9091D9588FB414E1A4 [email protected]
913,001,296 *5F0C411BA6DD901BFE435A05EF6107BC58587619 shoreborne
913,001,297 *5F01CB456106D6D7BD319CDA2DA423AD03CCF5DC PLAMSAJI7
913,001,298 *5F07F24CAE1673484B10CB6791ADB257C33FD996 PLAPROVIDENCE
913,001,299 *5F088048F84D35DA8A90FED60905C9A1180EA3E9 SILENT-AS-DECREPIT
913,001,300 *5F068C3BF9ACE2730EAAF5B53CDA32EDAEC09ADA siri.carlson
913,001,301 *5F090E9B0265F7EE17B64247AF8AAD549C016A7C SIRINGA8
913,001,302 *5F0BD387A022818637A7E3EC39F8B1BC7E761193 [email protected]
913,001,303 *5F0950B86EEE16BFC784302250277580FB1DD556 PORFIRIO.HIERHOLCER
913,001,304 *5F0FE7BA2ECC7DB9D920A9564E828A345F6545D6 POSTPLOTINIAN
913,001,305 *5F0FBA204A95B14155BF5D7463ACAB54E9C334A9 POZZOLANA4
913,001,306 *5F0A820FF044ECD7AEA322080B22B4EAB838B2A4 slow-canci
913,001,307 *5F04F36010021E490345D3D8A52B3A9D61A60B2B pp3655
913,001,308 *5F05130D4685278E798630525D13CECC79A5329D pr0tem
913,001,309 *5F0F319EE0136C4F741B3467BF4F76E3228BFF04 PR1133
913,001,310 *5F0676C17C05AB6B3695F16FF283BE4466EF2731 primepolynomial
913,001,311 *5F02F321C68ADB6EC787CF9D8E2EB01A56438A40 SOBREVISTA6
913,001,312 *5F0064204B9F7373646528F05FFD5302E7C9E98C SOFTCOAL
913,001,313 *5F0B94FDA6460FC169151DC4B1E0DD0DDE257AA8 PRO-RELIABLE
913,001,314 *5F00A6476E3C763F43426A5B38DE54743E1FC810 solomonkohan
913,001,315 *5F017DFFB027FE64FD08ABCDA37739B45C3A2EFB p-----)*-*splat
913,001,316 *5F0D804C79CA50B13AC1BD9BAB744F1CB4F73C07 PTERYLOLOGICAL123
913,001,317 *5F01F32543F4444C111C0DDDA2A575A41EDF896A SONGSOFFREEMEN
913,001,318 *5F0CF81DE5C0E5D10DF3DBE6FB115A2ABD104552 PUBKEYS
913,001,319 *5F07E9C4B2E4B7264E9C839D11B60A0D661CA2E5 SOTTOPROLETARIZZINO1
913,001,320 *5F0455F6CDD8D22E3108BF13E0034BA8576F4107 soundzap
913,001,321 *5F02EDFDDA5B8A657BF5B3CF48CBB4D2DFBDDFD8 SPANJANING
913,001,322 *5F07150347B1792CA73E23C9EF5D42A921B0329E [email protected]
913,001,323 *5F0F7466A6016635365C09462D7F05FEB5B1E23F [email protected]
913,001,324 *5F0F15B116EAE4D4AB997A311B7BA2ADE14BA188 SPLAT.~`.~`D===B
913,001,325 *5F06CDFB9E1C87A578EFC576779E7B4E7E87B7D5 [email protected]
913,001,326 *5F0DF876A0F5A72E515E436FEAF3BF9FD6A970EB q######)`~`~(O_-)
913,001,327 *5F06208A9D96F084F694CA50DE966B6BC4C29018 q-----P-*-*-)O(
913,001,328 *5F0358381B1912167B501A3FC463BCE43F4F16A2 qP.~o.)o(
913,001,329 *5F0EC5B64C1B785111927E5244A3C92D0C9DE15B s-qw
913,001,330 *5F09EAEA8F489F15A44C3DE6F94CA22311AAD479 SREGREREV
913,001,331 *5F07064542007ADC959ED35DCDCEEA8B0AB43D95 SREYPOK
913,001,332 *5F0B4B80CE06BFEC0D17B6623429B3579E7DFAE6 QUASKIES5
913,001,333 *5F0EC10C1FEDCEA38F44ADD7CBA20FD1E8E946AE quintinfetchko
913,001,334 *5F0B4F99D151C86F64DF8D63545F38A546EE3B79 QUINTONMOUNGER
913,001,335 *5F03A9940B44E3044F838D6684EBE0CED1959B90 qv%h
913,001,336 *5F088B9BC2C95E06E887AC6A08F99D98F9D7E1DD STARS03
913,001,337 *5F0E5014245DEC44D1D33D1C77E8BF04159F1F4D statslige4
913,001,338 *5F052889D50E70E41FE9C3BEFE4D3E936E4B482E RANDAL.TOLA
913,001,339 *5F0666157AD32A7D5AB4D09EE1A6EDC70ABF3179 STERLINGSOLAR!
913,001,340 *5F081C2BEBE2DF6A4454CBF0DF5A2A5E6C980104 raphaelcove
913,001,341 *5F0E3A00DDEAB02EB42D1C3E8BC564D693D86131 stevensonjeanene
913,001,342 *5F04AA911C75C5DF716DD957F8CC87F4F2B0B479 störabstandsverbesserung
913,001,343 *5F0FC33D5823DC09853C442490DE1067CE8FE63B [email protected]
913,001,344 *5F07309984B16138B861D9F0838BA0842C208091 RB[U
913,001,345 *5F050BC1FF3DEB58D14DB7D9284BCA2671832F75 [email protected]
913,001,346 *5F08DD173154FAD3D993BD03C724DD95A590FDD1 [email protected]+eleph0nes
913,001,347 *5F09C9CA3118EC9C4106F0C79CE3A815E713F69F re4l1gnmen+$
913,001,348 *5F052FFC821C3A4F6F2D7A04B3DE1CB7A6721192 STRTOBOOL5
913,001,349 *5F04C7F7C0BB3D45AE172FCA759A30C9F4813556 RECITATIVO(ALTO):"WARUMWOLLTIHRERSCHRECKEN"
913,001,350 *5F0434063255212F009F47619D990D9EA42D24B1 RENALDOSIMELTON
913,001,351 *5F0BDC0E3241E7190F30C79EA45124D20C06BC6F suruewd6
913,001,352 *5F05BC0DAFCF65C6C6E5C808613E5703555963C2 REPOSET3
913,001,353 *5F0DE2E8674FE683906C2EC43DAD6FB4FD556619 [email protected]
913,001,354 *5F0AA36179C6F67F0F627C82836F4B665BA21CF8 REVISION-A
913,001,355 *5F0606B3AAC75ABF143CD84DAB787F7C5B7D46CC REXELLAED
913,001,356 *5F02689F9BD6A4EDFE68576130B4A564C3EC911F RFEQPZLS
913,001,357 *5F0C546F16562C722BD546868A74DFCCB7759E59 takeyourfootoffthegas
913,001,358 *5F0AD5982EC297501CE10842D15D3C84D007E291 RIIFFAWARD
913,001,359 *5F0CA5FE16C5B84B913BF21E089AC664AD49A50D TALKSVTEST
913,001,360 *5F0EDBF5A1075AF5C91B984B44439520D1F11C53 riptides
913,001,361 *5F0861D4FDF97ECDBD5B39CB1F771BCC376E60B5 tanner-rumsey
913,001,362 *5F07C04D39D6CB03150F60B806CC177EE5B329CC ROBBY.SPINOSA
913,001,363 *5F0C7162BB6DE6866FDF52D56E6B91650847E4BD TAXERION6
913,001,364 *5F098778E1E3DFC01FE79CA4C279FBD5CC1A7727 RODMANSCARLETT7
913,001,365 *5F0321F226CEE44B9FF0067C10009CDB202C80D5 rodolfohudley
913,001,366 *5F0DFE253A5E62D47B15DF12733589E769E1F6BD ROJASCLASSICAL
913,001,367 *5F0CFD07B42D7E8DCEC111CFB9AE7020220AA2B8 TERESAHAWKEYES
913,001,368 *5F0B4DA654E7004CCDDAFA351CDC339E233F1389 ROLLAND.DURRELL
913,001,369 *5F0E394AFD774805D8CC79F9960C7C73799F2CFB TERRY.DOMINGO
913,001,370 *5F080F6E6C49F8ED501BE6DB7BC5A1989C40B9C3 teucrium-veronicifolium
913,001,371 *5F01E5EB0570C360645234179BCCA479DCE10F59 RONNYMOOCK
913,001,372 *5F0E3FEBF68F45953A845E92EF7A5BD2A60F0C34 thadsaccucci
913,001,373 *5F03E42ECE54B4EA090112BC54ACDA1C5AE15860 ROSEMERRYN9
913,001,374 *5F058B6B7B08E6387AAED905C95DC008C7D832C7 rostkovo
913,001,375 *5F0F6B778D3BCA4C0A3D384D731930AC841C40EA The-Clock-and-the-Moon
913,001,376 *5F04F8D973F0A984FDA8317E6680B44BA22F600E rubincodling
913,001,377 *5F0C6685C12CC56E6BED8233BBDC5E3E86ACF9DA RUBIN.NEDLEY
913,001,378 *5F0867B359BA7C52C02444252F2B2107596D3E97 the.grand.ambulation.of.the.bb.zombies
913,001,379 *5F068815DC26FD8A8AB5D9DFB98A47D94019C83A THEISTS!
913,001,380 *5F043E8DF5603114F65F86B84AEF0DE0A519CF18 the.phantom.lover
913,001,381 *5F0A1EC2045366A74EE81EB19D5AE42365659356 THERABITECOM
913,001,382 *5F05262E21D3F86A690130FC088E8CD6AE8250E7 the.rossclogher.jigs
913,001,383 *5F0EC7F181AC2EE889E444B7D749CA14FD47C176 RUSS.HANEL
913,001,384 *5F0010E581BCA3BAC317D92EA103DE1D4FD57F24 RUSSTENNENT
913,001,385 *5F0F03A456CF48E367D034180324AB3340276FAC THETADIFF9
913,001,386 *5F045A679863F1CCC46E7FE96B9D69C8C945F851 THISTOGRAPHIER0
913,001,387 *5F019405913939684F20309D149F66FA33610D2E TIAMIRPE
913,001,388 *5F0BA173519BA2E670E19838E8973908E2B3D084 SALMAN-KHAWAR
913,001,389 *5F0FE739A678DE2010544417890EDCA1395019FB salseel
913,001,390 *5F0C98FEAA5CA87EC4FFBEAA414330291076B222 TMANYONGANISE
913,001,391 *5F0DF3C00B032BA9D7E8488AF77000D884960617 SANDIKLARI’NIN
913,001,392 *5F0423FF2851CFC8A9323F0F08FB7DA6174F1206 SANJEEVSMITH
913,001,393 *5F0BD28DF25448E2EDB04441D891E2A5ADA92AD5 toddnewball
913,001,394 *5F0D96C8824B7A0DE4A31EDC35AE65BE9EE46CB4 SARAH.COLE.BOUCHER
913,001,395 *5F086ACE441593C5B3B39F2252F7488CDF9EA21D TOD.UPLINGER
913,001,396 *5F019B2CCA84D14E9DC0E4F339C7A4B89FB00ADF TOISTATUHANNESTING
913,001,397 *5F05093318559C4E2B1B9B989F64F5A076F64C44 schacknow
913,001,398 *5F01016FE954B4294351000CF8AD948109FDD800 [email protected]
913,001,399 *5F0F12D1029FD161CF78D0EDAEB5E16A208A9D12 SCOTT OVIEDO
913,001,400 *5F0298C90E270D9D7184C4BC569B8388EA64D38D TRASFIGURARER1
913,001,401 *5F00BE87559EB73CA5F9369E5900F46969C83B0A seanheideman
913,001,402 *5F05ACBB46ADD6069ACD12F99EDB3D65A49F1903 „TRIENIO
913,001,403 *5F098C80A3C669A49D842141A7B2259632C3151E SELENOLATRIED
913,001,404 *5F0A658947694D24AA87940B382B677AFC019F30 TRISTANDESIGN9
913,001,405 *5F0ABD5C53DED0BD25CA1A838E60D0E6BD5549E6 TRIX-BUTIU
913,001,406 *5F04AC002435B6F124C40748A6F6C3A4868DE706 troonsbestijging2
913,001,407 *5F02106F6ED57BC67108192172DAB5725E2BEF2A [email protected]
913,001,408 *5F07C37B5B9FA8E6C3446A59B37E6378AD493E0C seymourmarshall
913,001,409 *5F093020DB0E7A2A3C75273E28B2D92BF968F4FA SGETRANK4
913,001,410 *5F0B2EF39F1BE89C31834BBFF038DF1DA43B5AE6 SHANE LAURITZEN
913,001,411 *5F05176B162F71BCB67C6DC0A5D0F71251C3D46A SHANTEL-PEREZ
913,001,412 *5F055790DFFE21ECA67E62736853036EE2D4F62C [email protected]
913,001,413 *5F04949C831AE04C897B2463A7469B93DC264E9D SHAYNESTAIE
913,001,414 *5F0B20E3458554F97881C32753B6A7C3649F8816 SHELLEY-CONWAY
913,001,415 *5F0FED1E1B042507DD136FDC384432909EB5D973 type4
913,001,416 *5F00D603DC14FD2C3F0CF06DBE787E8DDB7B7D7D SI0\\3
913,001,417 *5F0B85DF7D2AED6BD194661A47DA1E60FEAE3F1D ugotserve
913,001,418 *5F00C211C600BE3405BF0CAFBD2C3E3F88C0F083 SILAS.SKORA
913,001,419 *5F0F9071E06C97AF7828650B6EE15E43B862B10E SILAS.ZOLTEK
913,001,420 *5F0E75558E94449FD0A6C4132853907DDEE5CD58 UNDERDOCTOR!
913,001,421 *5F0F4377BF3E74D4890929BE0BE8294B92E284A0 .%u.nmo
913,001,422 *5F0DEC1A45365B07B2865F494304AAB2B7155B92 SLAVEDEPENDENTDEPUTYDEVICEDOMESTIC2
913,001,423 *5F076744B3E875F7EE8D718F9B866DE2F0F8CF8D uruguayanamericans
913,001,424 *5F07EF5C989FD80D1108B8A6F10995BBFD8BD5A8 USTJTUTO
913,001,425 *5F0BB534CD6FA7BEE02F586DE77A1898B376B300 @soc
913,001,426 *5F0D509F7A9BA6269EBCBD5BFDDFF878B32C928C SOMBWAY
913,001,427 *5F0CA9CE874D8825B8664CE8C68A596B32347941 VADIM.KALASHNIKOV
913,001,428 *5F012516CC7ADD3D300AE26413D96D6C3BC9E9EB SON.OF.A.PLUMBER.(DISC.1)
913,001,429 *5F072BCF1BB55D5E3494AAE234E07248E11618D9 SOOTHSAYVED
913,001,430 *5F0C282391CD9A6E31DBC658322639C4EB9AEAEE SORYTWO
913,001,431 *5F017043686EC2CB139B8E1D8146BE7CEABDA0E8 SOUBERASLHAS1
913,001,432 *5F080A74CA8F187AEE5F17B6DE5C95165D80F125 [email protected]
913,001,433 *5F078FCF8B28F667CFEFA0B08CFFF024C7960F1D vantaanpuisto
913,001,434 *5F0DC10ABFC18B23A18F7D282BAE5E9C6F3E7857 SPRNDSTRSNSS
913,001,435 *5F0A44A379CC83F43B0D8D16BAE62BB578F4B84C very.own.vegas
913,001,436 *5F012EC6919A40C96777218CC5458CE0312B0EB8 staatsinkomste
913,001,437 *5F01D06BD3A602162909D47C854CF667D88F80BD STANDALONE(RHYTHM)
913,001,438 *5F07DFD17F80A4BDB58E3162BA05160399889F80 STANTON.KUNISHIGE
913,001,439 *5F0D2B62DDE50E333651477E4036D3A02694244A victoriameshii
913,001,440 *5F061A72D0230ECA45A80A663C5CBF0B6776323A vigh.melinda
913,001,441 *5F00A5F359B110519F794DD4AE46E1A3DAB21BD7 vikingeagle1
913,001,442 *5F080001DBF0B166EB27C410535F754808FE349F VIRGINP2
913,001,443 *5F0D3CBFB1BB8E7154B551D57FD27B963D183CE3 STEWART.BEDEE
913,001,444 *5F0D99F12A900B348E7CA91B3878D0A450AEA9D1 VISORNA2
913,001,445 *5F0943C0136F72982C8645B5EC051E4716164486 STILASSED
913,001,446 *5F081021631BA027CD65FC2CC32D30DF8EECCE94 vitarepo1
913,001,447 *5F08EA7EE45B4FF8D7D7AD6B9C68E2F59E2DD61F STRIKING-LOOKING
913,001,448 *5F0349129C20013222F7BF08A6EF1D962E6B34C1 VORROYALRAH
913,001,449 *5F06AE9F85FB4D1906561D3D39BFBD42D9715557 [email protected]
913,001,450 *5F0D7C3450D8248DA8F8D74F70951B4C0893E3F7 WALDO.MERCADANTE
913,001,451 *5F0797BBE73F3D7D5F05643C95CDD475DA57DFA6 wally-siy
913,001,452 *5F0456C5E2A146D9C458D5A1A08C95E6210A9E0A swell-records
913,001,453 *5F0DDB652802920C042B190609F35E9FBFF3FF47 SWIMMINGADIDASES
913,001,454 *5F00D18E0FD6E5FB23BDC00E4B488520C729B8A5 wardprakash
913,001,455 *5F074FCA3FBF62731ACB7B3563AE5ECA0AD83F93 -systemarchitecture(dl)
913,001,456 *5F00F686B96485D7A881657341EA462519493CD4 wawojbyksldm
913,001,457 *5F0BDC6455177F1D537A6616DC12FDFA1E92F4A6 tabatha.benoit
913,001,458 *5F0627C8C172827F9055ED85CDD9D4D994944DCB TABATHA.BENOIT
913,001,459 *5F0836C0D9B585DC12886D12CC3C910E56CBB6CC tadacron
913,001,460 *5F02B4F9A80B0D989E4965E907981F23E85A4855 TADKROTZER
913,001,461 *5F010DF70B58366461B3A3624373FA9062A72F54 TALKGYRINOCHEILUS
913,001,462 *5F0B940BF440E08F6B720C4F0421FFB0FD4DF952 [email protected]
913,001,463 *5F0EDD6119F41AE8610B120406AF9AD443CF8132 WEERGAVEKERN
913,001,464 *5F01C37BD79D482BF3BF6C2AD8F5AA595B88F5B7 wegduwde?
913,001,465 *5F08149E62AE0F2661D56FFB8E48F53EF3754695 tannercongleton
913,001,466 *5F0D7149594C4CCC305FADA8899F14A53A526B26 WESLEY.PLESKAC
913,001,467 *5F0F1DBE8EED1959130DCA687366CA8456D5287C TAYLORJERDE
913,001,468 *5F095F46D704655CF208012C3983F27B6E7AD6D7 westonsawtell
913,001,469 *5F0D493E14EB5BDED9D80FDA4A91A1312EBCDDC9 [email protected]
913,001,470 *5F0D8B3141A0627DBE68A144EE4F6DB656ADC793 tcepsorpnon
913,001,471 *5F00ECB327B36FBC77A943AF24F7AFFFAB63899B w_hz
913,001,472 *5F05CE07BEEEFA4A3F70D90C3E7C53AF031640E6 WILBURNMCKELL
913,001,473 *5F05503055EFD30763FFE558C1164759A02E0BF5 WILD-ARMS:-TWILIGHT-VENOM-OST-(DISC-2)
913,001,474 *5F0317C9D84259BFBFF8504DDAA5B13143E097C8 WILKENS160
913,001,475 *5F0339A4FF57DB6E7F9C79D10ED9A393DE47710F Tere-Mere-Pyar-(feat-Cheshire-Cat)
913,001,476 *5F06F0D73AD0E6512219C68063C259A73D471F92 TERENCEBENNICE
913,001,477 *5F06D0DBFE9957A3B5BE3A6D5C472A007D77A45F terencezuro
913,001,478 *5F0E4EA5D733ABF82A1DF47CB64F3F917960815F TERIMA
913,001,479 *5F08A384FFFECCF9B71830BE20A1934431FB50A3 WILLIE.HERRLICH
913,001,480 *5F0C3BA02D077F00B5CDF9C9C14DF14DCB5C2DC0 willierwooten
913,001,481 *5F0140DF1CF9C8CC0A4907E0D03FE5586D4766E6 WILL.SHANKLIN
913,001,482 *5F04F3CFA9E8C8615CAA43778311B922C27E078F WINFREDKOVAR
913,001,483 *5F092CFA5F28DC6709DB48BC161FC6DDC02EA1FB wing.kan
913,001,484 *5F05912CE56467761A73C4B87992FD150E60467B winthuis2
913,001,485 *5F0624FF73AE319334B7F38F203C7D852B1A2A26 WKAQ-TVCANAL
913,001,486 *5F02C176D3D2D55D031336BD6518A0DA61294B5E w,md
913,001,487 *5F0343D038043AF8CAF14D096F636965C71F348C wonoigels
913,001,488 *5F0FB8B7ADC42D1FA8AD718EEC33DB526F1AA984 WORKELLEN
913,001,489 *5F062E4E99259DC663AAD37CE49572559CD89D27 w,$q
913,001,490 *5F0B2EACA485D4250D7C4490D62D6506DBB257FA THEMES160
913,001,491 *5F035782D55C3DDF8790908494D1A8A44925D8A3 WSPRACIEM
913,001,492 *5F05EDECA70FE2B9EF61DD898A29B648AF34DC2B WTUD
913,001,493 *5F072AFCA00D91A066BBCB92C969283006E521C3 THEO.SPICKERMAN
913,001,494 *5F00BA26C9865D7581D47326539705C4047CE8D3 [email protected]
913,001,495 *5F029A7DDFCE4F43C16C4E46B6459F63AA227D77 The-Real-Woodstock-Festival
913,001,496 *5F0B32A62E3F279859166C7631D5B4DAB5E78B74 THESCORPIO77
913,001,497 *5F02C0FFB111F37F0840B951B120CA92092B9BDC WWW.MINDOFMODERNITY.COM
913,001,498 *5F08FE227E320BBD3F7F7A65B1BA3061239E47CB WWWMINKCHIROCOM
913,001,499 *5F01CE6B92630CAAB0AEDDCBAFD768E6CCFB7FA5 wwwnepalnepalcom
913,001,500 *5F0436560D91F790EE3922D6DA00DCA4E6E484E4 wwwquailhollowcom
913,001,501 *5F032886E014AA63677E9494A68CA63021D6E573 WYJMUJĄCYCH
913,001,502 *5F0379EC5DAFAD36E02EA88B1A3B9C45E0C4338A X154748
913,001,503 *5F04874BD249903AB87054B307B26DD384CD0CAB [email protected]
913,001,504 *5F04AF2A63951545EA925BFEFDC533DD2864C239 [email protected]
913,001,505 *5F0A39F53C6ADB9553E82E55F816BF4B0678277B xmnycjolh
913,001,506 *5F0D945F3E9B1085EA3DD0810EBDE3336B3DAE54 XPQA
913,001,507 *5F09F4362403B3C38F45DF9DDD9CDFB7DF605346 XT:?
913,001,508 *5F0DA190C24C774004E8F3CE914513C57BD39D4A TOGGENBURGHS
913,001,509 *5F0C58FD27C4BD992600220C8F5882541F472B44 TOLIETDUCK
913,001,510 *5F0CD7E9F15E7506A06A40AD0B793E0A8A769B8E [email protected]
913,001,511 *5F0D16CD77D552988126E9EC28454F2A533EF976 TOM.KNEEDLER
913,001,512 *5F0F4FDF6CD05FC1A1EFBDB8D71610FD251F7118 XYKONOVI
913,001,513 *5F0C4207830DF33F498F59E9D0CF221995508CB6 YALIKA-RIVERA
913,001,514 *5F0D9901D3A2B3411F4609D49154586558F19412 TORRES.SEVILLA
913,001,515 *5F00179CEF147D81D88CC0729EF8CAD7559337E7 toxic01
913,001,516 *5F03C2015F72CBC51AC450AF71FC6D1F07C42B98 YASSER.ELIXIR
913,001,517 *5F0FDFE21DEFE330EF89825A3C367718053A8E3D TRACEY.KENSON
913,001,518 *5F0824BBACCA84E2934CA2C06A29FB9647B1043D [email protected]
913,001,519 *5F02C80BF0FBFA076162F4DE7E548C2CD5350722 TRAENENUEBERSTROEMT8
913,001,520 *5F0BA9676C09513C50C1EFC754E55AD33DB6276B YHAYGRM1234
913,001,521 *5F01BE5FBF5A1E8A07C908C90508784BEFB56651 YHJ,
913,001,522 *5F032BE01947E3F6DEED12D2C1A67974F3D51E0A trevorovadilla
913,001,523 *5F0D9FC111B7E2BBBB4F3E8867FDA3D7B91CF1FC YOKOTAKE1
913,001,524 *5F068101293B4BC5A1052E333327564ABD5D8F61 [email protected]
913,001,525 *5F0A7931108059BEF19440CB9B8860F8C9B13E76 yomara-acosta-santiago
913,001,526 *5F038E933A2B117FA8937EDD2B2697C2F1993E24 youdon'tknowme(featdianakrall)
913,001,527 *5F037CC68274F68169B8DD6ECE3EE73407D5011F TSOLINAP
913,001,528 *5F01F78E4DC3037449B69D991C915AE48CB773D6 TURBINELLE9
913,001,529 *5F0DFEEE90199822C4E228BB623BB875C1E38BFE [email protected]
913,001,530 *5F02F51F4713E4FB487158922B05D08C682B5543 ZECHARIAHSALISBURY
913,001,531 *5F01D3F94AEC3FCA8398998CE87824DCBE9EFB2D zeirennomram
913,001,532 *5F06940B2B75D5BC9AC43A6515C0202ABC1CEA3E ZEND4VES
913,001,533 *5F091D01AC76A67D3AF6E9F2523AF9D3D7DFC438 TYRELL.YUSI
913,001,534 *5F0A8084F85C7768CF4C6BB209FC8A51FEAE9645 [email protected]
913,001,535 *5F08D895ED88DE2422A7B3E7223C89C167EE10AD [email protected]
913,001,536 *5F017D5B0930F26FE9A2F78BAB2EF35AED64A4ED [email protected]
913,001,537 *5F09B47C55D7DCB0BA69122F4D7850305764E1CB ud$0nede$
913,001,538 *5F0B4CFFFD21F9462B16DEEAA838C94A5C418EAF [email protected]
913,001,539 *5F09E1F888FB264CFF7ABBC9069520489DED8340 [email protected]
913,001,540 *5F060B2DADCF1AB2ED5C15D5D038D32AD5AF0F71 uni5exual
913,001,541 *5F00EB4D1AFF82E4BE5A0FA8166C787B5FB40D97 UOINESRA6
913,001,542 *5F03D0BE68C1BC98AAE8F7B9B75308E4427AE48F USALAURAEHUTAOLCOM8
913,001,543 *5F0913387D4AC653DB3B68C1D74F93CF8642DAF3 US!J
913,001,544 *5F066D503763BE30EE29C064F03A281E5F486E10 баріонний
913,001,545 *5F08F571A352EB599031C72322822B82E8FAC070 VACSEWOH3
913,001,546 *5F04B460B8F6F9E27A0DB4C64FD2CEF5F5872317 МААРАКЕНИ
913,001,547 *5F0A06E5E6D0781AD63E921B382495D2FF65FADD МАНСТИРИ
913,001,548 *5F0B3B298C2C0C5ACEE4FB37B6A83C94152264B0 VANCEHOQUE
913,001,549 *5F06874A2238E46F8BC1281F4FD1F71443C45A2C VANESSA.VERITY.LIDGETT
913,001,550 *5F006BB33D1579D95C9153E59C6D8B35BF023714 vanrogh
913,001,551 *5F0EF68692DDB82944A6245D50BED4C905D0ABD9 СЛАВЕТНИМИ
913,001,552 *5F0CB4E3C3F185B70BEAA961545ABBF5788C18A1 ТĔТЯ
913,001,553 *5F07C5945EC4BD8836B2AD6FFA6A3CEE572232FE VERB-NOUNS
913,001,554 *5F0DB14F1510D6CEC59580DD584291394E411A2C VERLIEBTINLONDON
913,001,555 *5F04062EFD052BE01E9B0E31E2C707D866D6288F verliet5
913,001,556 *5F0712F427B72D2B9A41F8A0D27BDC4000EFFAEC VERNON.HANDON
913,001,557 *5F04977623251EAEB81F45CDDAAF4E2F5B844669 veronica.lutgring
913,001,558 *5F0658A75CAFAAD0E24AEEA8FB8C249659511403 VICTOR.MCUMBER
913,001,559 *5F0550B2D864E72E7E8340F6717DDEA1E0D4E492 VIEKSIE NASUTION
913,001,560 *5F087A01D9C8D2941078F48C6C41241A16473061 virgilmardirosian
913,001,561 *5F068599F5BF701326188A5237C2F321812211DB virginia.fudge.brewer
913,001,562 *5F00ADB7310EBF23F2EADE8059F9A27FFE60F32B vkyja
913,001,563 *5F037668D7884C1B32364FF25249A795BBB28FCB 青森市hp
913,001,564 *5F08A52ADD4D1C802AF3B1EBB822304397994C32 VOTALLATOV1
913,001,565 *5F0B5C9C6695ED3E7BF5F39E81BFC9E5F1139349 [email protected]
913,001,566 *5F0689F8974B77F29C0DEA4E18990A31D4496F48 VYANJUB
913,001,567 *5F0F46FFB5A43D0A97491359B2BD6203C629F89B W./;
913,001,568 *5F0FDEC7A0D0A4C392880B8031D5538EE36C47ED wadeyunker
913,001,569 *5F0CB2FC47463EE83FE39022264628F19845A2D0 WALTERSRAMEK
913,001,570 *5F0A801D885A12393002D39B96174EB97368E64A 04-16-1073
913,001,571 *5F004710E6EC66572C05A075116E05B784FF78C6 watte
913,001,572 *5F09B2E473F0EC7E08960F98CE1A190832AE9366 WEAPONCLASSES
913,001,573 *5F033A7C052E240A9AFD50C55DBE7C99C92F86B2 [email protected]
913,001,574 *5F0CC77429469B818A544897D68AD3CD3FBD25C4 [email protected]
913,001,575 *5F0ED6BDDF7718E269B9AE8D3303318AA59F46A2 well-(live)
913,001,576 *5F056572D8A35F8251EAECBAA03EA068331E61FD 102kailey
913,001,577 *5F0087A9E61108DFD7C1A37C1F2EE55BACFE0B66 123123BROWNS
913,001,578 *5F095E308E344E4396D28102DDF267CE9C2DF3F0 weswillilams
913,001,579 *5F01B6436891C754D664C444B2704069837D0D1C 13VOS
913,001,580 *5F00F8863CD214B7B89507E3EFE74D047AD067B0 1557354 MERIKARVIANJOKIONPARINAVIIMEVUOSIKYMMENEN
913,001,581 *5F06395E4F1027F09D365928A3412010A39DE634 WHITNEY.KOSAR
913,001,582 *5F0C086F971EF391D8124D061C9B24F369ED848C [email protected]
913,001,583 *5F05A5AAEBC7FE8F1C0E2D2112FB7FD1FD1A19A1 1790359 OPPIMINENEIMY
913,001,584 *5F0CE0F5F7C63525EBAC95436073C74AF6260F2C 17december1894
913,001,585 *5F0925FDE8126CF667DCFF82EC01663F754341B1 1.ANTISCHUNDSCHUND
913,001,586 *5F06414A8BC2C8926ED90190CAAD2424D60BEB80 will-n-jaye-glickman-moncrief
913,001,587 *5F0F92692ED0A56555C01A26E63BBAC0356216CF WILMER.KATTNER
913,001,588 *5F0AE63EC5C574E072C1BF8C2F344907327A1CDA WILSONNONEMAN
913,001,589 *5F096D4BB606A82B7D0293211AF7A49653364A19 1.blitzkriegsteffi
913,001,590 *5F0490626F6582B610796669A7DAAF273F0FEA6E 1CLEARNONE
913,001,591 *5F0767E3BF5DC948BF7546981AF0D5973263CEA4 1defensief
913,001,592 *5F07AE9D2A70792A9686B0156A194DE9D92AB7C1 wippo28
913,001,593 *5F0AEFC0B1CADE9151114E523B53E6FD1BF4F6BB 1genmaterial
913,001,594 *5F029C55916117AC525E78D174E783939D6A1730 WONSYRRAH
913,001,595 *5F026380E0F6C0F14DB558109CAC38A038F79DB2 1-huolestuitko
913,001,596 *5F0B18B14A6E012D225000A996563711462752CE 1.IDENTIFIOINTEINA
913,001,597 *5F0AA1063317BA7A0FA1D602A2F338B06D71E61B 1.INDIANPEASANT
913,001,598 *5F0707E31C34875CAD47E60C482A2A51F2AA1A3B 1INTERNET-SYSTEEMIN
913,001,599 *5F08628CB97C2A8D878497FC1F3F28970F5F2BE0 1.kitarakotelo
913,001,600 *5F00FCDE4B23EEFC0ACE71CDE4B5352A50F31130 WSPRACIEM
913,001,601 *5F092F120DB7908720D6374794DAA4B822ADCE98 WWWAIRSHIPENTERTAINMENTCOM
913,001,602 *5F0FDB0482D62AD173152F25901D4223C3C4C187 1.MITTELMEERSTRATEGIE
913,001,603 *5F0CE9C1B00AC931A9DCDACD131077332CF8C700 1nationalistisch-konservative
913,001,604 *5F0A013A59DC103779098F701E60A5CF2032B245 [email protected]
913,001,605 *5F063965D062D87D45D5F77C2AAF91FF6112000B 1POLYMART
913,001,606 *5F0CD13315B30FC8F5903EF02DA6AB86F75BF00F 1puherajoituksella
913,001,607 *5F02C48C44DC9A63E02D029CCDDE25C472DB1BB8 X8%.
913,001,608 *5F018CBCC0715CBFAEC4B77E75D659A3EDE30600 XAVIER FLORES GIRO
913,001,609 *5F0B2C737CEED3EEF44BCE57788F214C4B7D381B 1 SCHLESWIG-HOLLSTEIN
913,001,610 *5F02839F6982E60E85D158E3230C2F59DC3111DD }X{~`.~`D-----3
913,001,611 *5F051207F00103F4CD3E3AFEDE847610EDED7856 )X( ~ ~ D--8
913,001,612 *5F062106D4BFC77EC9B9CDCB301754AC9E88E517 1 SUOJASSAVOI
913,001,613 *5F09202E1D106DCBFED7AFFC10EC1EC2AC2F21AC 1 surveytakers
913,001,614 *5F0AC29FDF5F291D1CBF3DAEB2E11A3E7670DD0B 1-TATSIZLIKLARI
913,001,615 *5F00803EBD9D023FD32AF00807C906E14184BF40 xju7
913,001,616 *5F0515DD9DDC810B6E7D213C1BB1497407B2EF71 }X{.~.`QB
913,001,617 *5F029B8DAD0A6C6D5F4110572D5965BBEF742BA9 233807 toisenavahvuutenakivek
913,001,618 *5F0806E2A4BA1DC42D6AD233A12D765830B0B1BE 23a08e8d24a23dd797d050cea9e74938
913,001,619 *5F00343CB7146D38AB18396E50EF0A9E08AB4134 2413786 (25)"HEADOFTHECLASS,"ABC,115
913,001,620 *5F09430A6BE9A106084E1113DEC69E67FA5C8937 2414576 ESIMERKIKSIP
913,001,621 *5F0DD851B9F236A5D540EB5A0151F9C6D7B0EB9D 2523007 SIT
913,001,622 *5F038EB49317575F73AD7760E9A42AC0D142A364 255449 spenden : mario baslers 10
913,001,623 *5F0311056CA757651D944DC74C0E78008171E426 [email protected]
913,001,624 *5F0AFCEE1F9EF69C33FD43B6F5A498D639361808 25.Jaar.Top.40.Hits.Deel.2.'69'72.(disc.2)
913,001,625 *5F02F2F7E5BC111EA71525EFE08650FBFDB6B588 YLT
913,001,626 *5F0FC7655B4D723238EF5B3761F7A6511C7AFDC8 2694367 LIITON.ESITT
913,001,627 *5F0884DFFE59AE7F0A7F1B57A788622F73183CF3 2740368 tampereen-s
913,001,628 *5F0CDF2D39C25725394043FD5072404B8CCEF434 you-in-my-heart
913,001,629 *5F06EC34FDD73F0A2CE1AD2A3D1188A1877AB3B8 YOUNES.SADDIKI
913,001,630 *5F07B6ACD681B82066A940A46BE91E7632FC893B YOUNGARCHIED
913,001,631 *5F009E2A36C926430F2831B2C52D86097B127918 YR",
913,001,632 *5F0693D09430FAC7A46ECB751944D094AC106230 YUANDONALDP
913,001,633 *5F0CAFFE9680BA22DF9F87258FADBECC52AD5052 yvonnieobillo
913,001,634 *5F06F6B4D7BDDFDBFA9CB3E96080C09E14AB67A7 [email protected]
913,001,635 *5F0F71E25F312AC97A152C14A5F3819ADAB72B09 [email protected]
913,001,636 *5F01CC92782A64DBEA7E0A57A42E7CB0E9EFA825 [email protected]
913,001,637 *5F0522E2EA7EE6890CFB69CB057385794C463587 2.HERAEUSSTRATEGEN
913,001,638 *5F00B977C2E234CFB13A67962B578A81526022C2 Z{4'
913,001,639 *5F080AAD5AF4D78DB033543E5927E7E2CB87895C 2-INDO-BRITISH
913,001,640 *5F0AF0C57BBBF5325F64ABE4B7E186DD5DDAD12B 2-INDY-FORMULOIDEN
913,001,641 *5F0FEEABEAAD98EF55A53B49BA769281D892E8FE ZACHARIAH.HOOKANO
913,001,642 *5F0D6779E629339E06749ED3A915A85B7D7F1BD5 2SIERDUIVEN
913,001,643 *5F02E18405497C24B03D4CCAADC6CF849E4ABE6A 2thatbluesky9
913,001,644 *5F02C5017CF0AE075BF7ACF8B05533DDADC48EEC [email protected]
913,001,645 *5F037425C9534D9C20DA445A4C2A2ECC150A09CD 337NORAH
913,001,646 *5F093DB239119CEFBAE62DCF1119A0002DA74B14 [email protected]
913,001,647 *5F0B3D2A081F5C2605E5EBEBED135A58323B8BF6 388ELEKTRONINEN
913,001,648 *5F0E5A47253DA237238D619D3CAB5D952DFCC7A7 3bdu11a
913,001,649 *5F00F453F8ABE4D2782BE0C6C2784A8FA6E14999 3B<-~` ~`<######P
913,001,650 *5F060EB45DD9041775D93A1066957A5EC1E88EDF [email protected]
913,001,651 *5F01691F7A13EBD662570FD50AA3250159E01903 3=D ~O~O(>_<)
913,001,652 *5F058AD591C98DC4B244B4E85D2C174E2417563A 3-D-~O{x}
913,001,653 *5F0E62653BE00F0D4F21EC5A6871B36C0726FA5D ZVEDNAYA
913,001,654 *5F057B2204E5286EC43C296AB4D3FCEE65A18BF1 ZZFE
913,001,655 *5F086F7DDBCAC4895B619DD6F49ECF5B3D268F46 3 k
913,001,656 *5F0B47B39AABD5189AF0A6DEE65273070DCD624A 3>~o.~o(0_<)
913,001,657 *5F05D267A5123CDD7E651464D8F687A6F4C52301 3STIORRA
913,001,658 *5F067F280D6C137FECD92B00FBDED07027C02464 3VIESTINT
913,001,659 *5F0E3BEBD5B8413279CA51D42D2E5D658B1D0CED 3YTSAHNU
913,001,660 *5F09BA4D62D614AE16DAF91A22C62B82602793D2 42.exkommunist
913,001,661 *5F06497FF8AFD7C99EB640BAD61E910DB3AE7CF3 48 BENIMMT
913,001,662 *5F0075672D006F8631428A3D9EFE78B28561EA56 49ADRIEN
913,001,663 *5F0D012AD262B1AE138D06499C62FA2BB0695E99 '(4AA
913,001,664 *5F0478C6D3EB3142126EF8F496503BA2930C0F00 МЕЛІЛЬЄЮ
913,001,665 *5F0DB21A60F9C132E6BF2ACC7318F56C4992C995 мехренка
913,001,666 *5F0200438D09DD6502338B48BD365B784D3BA363 4ILOVEC00PER3
913,001,667 *5F0439F4D9849F7922814FEDE0FB345204C8AF35 УГЛЕНОС»
913,001,668 *5F092EFB2B5EA0F85080D55545D2997AF691C0D0 УДАЛЯТЬ»
913,001,669 *5F0327CA6ED2AC4F3236A7F495ECD07D1B7D4306 ЧИСТОВИК
913,001,670 *5F04EB13CC6A1DA33331542F6E8446C5D4509C3D 4RIDICULARIZASTE
913,001,671 *5F03DAA28CC6F30A0BC39DBBBAB4419AE2999368 4SCHOFFELDE
913,001,672 *5F0B7375945E85FEFCDF2CD3E7C8DCD25D0B458C 502820 moni.p
913,001,673 *5F054E1425877AB497B18D1FD4C83DB62BB8E467 56elitaeren
913,001,674 *5F07ECC0316C306F83F5EBE156242CDC866FDC49 5.DERRAUGH
913,001,675 *5F049975470C63C58E3AB9E11672F85BC8093CBC 5DEXTRINOSOLVE
913,001,676 *5F0E12BA31CB3E61DAF4DEFE015C676A8D4630CE 5EPIEIKESTEROS
913,001,677 *5F00371A6CA55E6556E30D05F12D8E751C88A940 5IURTGOOB
913,001,678 *5F03D4473624D30216B0DB6705BDF631A4FBE66A 5MAVATHAM
913,001,679 *5F0689BE91A854533D64E3573E8180FE8E583DD9 5MYMORRIS0
913,001,680 *5F0A41C343896DA67095330B231F4A096D64CDAE 5PUOLITUS
913,001,681 *5F0184150886331F46980195596083B734D043F4 5TRANTAXTA
913,001,682 *5F0DE65216544A4E5919B103B17F918A9CBE8F6D 618841 pedagogisella ty
913,001,683 *5F04495634DD20A64F227B71A38BC82A47F86D85 6BOLEWORTS
913,001,684 *5F024B0B19CF9CAE0A509115170E1DACFACCEA5D 6BSWDITULIOBSW
913,001,685 *5F04449D388A7A84F003D6D5D806199404EE2890 6BSWSENTSITIVE
913,001,686 *5F0A8A7DB1C254F9583975FC74A9EF3EFED02B27 6choristate
913,001,687 *5F0080162F55B51FB3FA2CD88C925B7BAE37787F 6-KUNSEN
913,001,688 *5F00E460E634B2F2BA667DF588E4BA90B4BCB63E 6MIKEYWEBMASTE
913,001,689 *5F03F0D5BC83246CE5293CB1A40C565912B17CFC 6.olioohjelmoinnissa
913,001,690 *5F0163B83FB4B69E834C05522744CFA17A3B3A52 6sijoittautumista
913,001,691 *5F0B170FF7BFC6D42E03BB00F6FAE67F18C1A2EB 6thenone12
913,001,692 *5F0BA3B2E43B74F485AA3A3400B3285FAA3DD8F6 7BIRDUCCI
913,001,693 *5F0D43C0D4BAB42555E6E3BDC5EF4A2A5A0F6A65 7EMAILNAME
913,001,694 *5F0E9CCAB0927D769B7E9F425D8824DC8218BDC0 7FERRARIROBIN
913,001,695 *5F0C8FC4E5121D60B024A5F18E48A7765A5F8000 7FORURENINGSSKADER
913,001,696 *5F016B89DF1C7C48559E5EC3DB98A54B382588BE 7HYPERTENSELYV
913,001,697 *5F0EFA72B16EEB388A062A19691E1B3BFD616189 7IAMCHRONOS6
913,001,698 *5F0834FDFA538DDC0F55D997065CB54A3EB3D0A4 7LOSERKID
913,001,699 *5F096B11836289BE43FF6B5C8FE548BE180E157D 7MUITSYCI
913,001,700 *5F0B60F6EA08D9D4125B705A46C729B97D3138D2 7P8NZ4HZ
913,001,701 *5F026D704291AC67335D4865D86AB665B505FF9C 7PHEW
913,001,702 *5F0F2E9D345504D9F010B1E654E84FF87F060C66 7PREHANDLEDS
913,001,703 *5F0E6834DFD9BDD84C179FBCCFCD111692C38B2C 7SKOOCHION
913,001,704 *5F0AF2AB6C6022F9DBA5FC626410A7173189D7D9 841738 muuttuvat.ty
913,001,705 *5F070D330A6FEDBFC110117DD0C964F3AC76E45B 8ABSORBIERTE
913,001,706 *5F030D24CB48119E656677DE1FAFB69AD7720084 8APOLLOCHRISTIN
913,001,707 *5F06436661C9E4064E316D56FE3FD22D70AE9350 8ARKKITEHTUURISTA
913,001,708 *5F0B8057E348D9F3AC2FF9510A6B1ADE3E283302 8BSWALROUNDERSBSW
913,001,709 *5F0E26110AF6EE5B84EB882AD176E47778B610F5 8BUTTTON
913,001,710 *5F0B2E21752FF4551C2083F33FEE17CB3BA8E42E 8DYNAMOER
913,001,711 *5F09884DDB778F4CBD995721F841ABC2ED7A9F59 8HENNICOT
913,001,712 *5F02FBABEE1C4123CFE0F0600BB13A439D16C09B (00)o~0~q====p
913,001,713 *5F007F5F4DF1B1BB2126D561B83CE78AA4B57EBC 04REBUILD
913,001,714 *5F0B57CA5447FBEB1D104856FCE56001EE87BC86 8####p~0-~o-}x{
913,001,715 *5F0C78ABD6E2FBC169493B73446F78C5CC01B924 )8(~~~q#p
913,001,716 *5F0E47D8B05A90BD074916033926B304072209EF 8TUTORTUTOR
913,001,717 *5F0DFD56AA9D9E763D1D1EEBB8283B512305C751 (0_<)[email protected]
913,001,718 *5F0218BBF9916C5AA2E4529C1351BD4FFC0E1F63 1140524 JYDACOMIN.HALLITUKSEN.J
913,001,719 *5F0E545E51BD48EAE9F774E321CB1012E6704611 9A1VANIZA+ION
913,001,720 *5F03D3816D7B577A5E3C4D9896B0FE26E845733C 123456:NEWYORK
913,001,721 *5F07DF20CC41556AA3963F1421083B09AB38F13A 1278861 etenkin sosiaali- ja terveysalan laitoksia on k
913,001,722 *5F01A40DCC773C71F80CE8318B933E16D6E2C8A8 9BESTANDSLIJN
913,001,723 *5F0A35BE0B447CD9F8F940DCAE8A543E971FB0FF 9BSWCHILDUGBSW
913,001,724 *5F08D29ABE3CF4EE090BDE2A1EE7E0673FA0B2D5 9BSWSCHUABBSW
913,001,725 *5F091627F471549F82DCD230C198E0FA94CEF4AE 13SARITA
913,001,726 *5F0A0B576451A6EAC6F7745178CDDB46F11445EC 1458076 THAT'S.WHY.WE'RE.IN.40.COUNTRIES..."
913,001,727 *5F052B3E27350D791B24AB92B321F6D7563405D1 1475726 KURSSINTARKOITUKSENAONLIS
913,001,728 *5F04D850C286CE42F64B8AB536E34349FF3A7F21 1624347 kurssisoveltuumy
913,001,729 *5F0DF8E7F81A1E5619CFA8E5A07168FC94D28B32 1672131 VUONNA-2001-LAINAKANTA-ASUKASTA-KOHDEN-OLI-EN
913,001,730 *5F0ADD5E054B98BB80F9B5AA334BE81D0743D870 9ILUVINFORMIX5
913,001,731 *5F03AAAC3AF7C6C4B45115D61D4402761C2DFA59 1816954 DIE MESSE AG ERWARTET RUND 300 000 BESUCHER
913,001,732 *5F0FE2AFFF3175CFA0AB9CD27CBBD58D1524FF43 9MUSCULOTEGUMENTARY
913,001,733 *5F07A47F7714159E06A1E3F69D8574ADBBA54206 1-asa-lift
913,001,734 *5F09A34A2F50EDE9F227A58F5DC10797E70C4B0E 1berlusconibossi
913,001,735 *5F0678BBE90C9F8812305D0AF70087282B2C12FB 1 besikler
913,001,736 *5F0C8532FFFAEDBA1D8D7AA21A6FE7F2CCF3AD8A 9TAKOFRENES
913,001,737 *5F082691A07AFCA43E49191DE047397140A634CB 1debanda
913,001,738 *5F0252D93B5D4B25874B4471747DF6273B0D8F94 1 FORSCHUNGSUMSETZUNG
913,001,739 *5F028037221DCFEEA2175FC10B30EC6E19EB4023 a3m67
913,001,740 *5F09E0F1B80A75807044B667C44E284352BD1E29 A3%R1
913,001,741 *5F042884CAA11540F450E946D6FC8AF717031AA3 1-handschuhkaestchen
913,001,742 *5F0B4D9E509F6DB86670271EB2A8AE85F5984858 a!4i
913,001,743 *5F08CF50F4DC9EF729B2B21845A8EFFD2018A0F3 A7GB
913,001,744 *5F0ADD94028D482B1DBD8D2490A9D8A6D22D72EC aaax.v
913,001,745 *5F069CC5A38B361811AA43BE7C6FDB8D7F1EA771 1SUSHI-AT-SUNSET
913,001,746 *5F0039F9116CBE592B23DD733E8A8781F8C78986 [email protected]
913,001,747 *5F02BAA73F0AB25B44413106F75C2C2147B09097 1terrassenanlage
913,001,748 *5F04324ECEE3FDAC7D0A8A69CA256FD150DB547C ab9_)
913,001,749 *5F0A44C3D8D4FD94B16FC1CB4CF45BB1B2AA49F8 ABEL.FRIELER
913,001,750 *5F0F7D191A9C5D5557D67B2246A66F10587DB38A abermudbsw
913,001,751 *5F08B811929E4E46C3100D6FF9CB953D74E22A9E 201MALACHI
913,001,752 *5F0C6BBCAD67B20F85C2F9902C667D6E126131C8 2031473 KUIVIENJ
913,001,753 *5F0086F60BED735DF41E3B51B4F0D83B28BFF636 ABHIJIT BABURAO SHELAR
913,001,754 *5F08A26F2F2EF57701973509EDE1D01FAF85DFD8 20WATKINSON
913,001,755 *5F026CA15B9FAD056735B96A126B8FB3F5FE686A [email protected]
913,001,756 *5F05C779794F883CC67B65B36EAD5718E1E167EC abqm.
913,001,757 *5F0208134B1128D011B57BF6FF5D3C18C2325A7B a!c&b
913,001,758 *5F013B5C047AB2EEA9EC7CBBAE7456F0A81AA35E 26HZ
913,001,759 *5F0DA5C431C7F67BD4E6EEDA50B78CC90CDE0E94 2GAPTENS
913,001,760 *5F09163BE06FFBBB20049D0F5329DCFD37513960 2.jenigen
913,001,761 *5F01E05B694BEC44211FC66656422D4C29A134F0 2-kerhoasi
913,001,762 *5F031DAE56F1ED64A38A3DA1FAC1EB0E373C83A3 adf}m
913,001,763 *5F0BB566CBBB50FA6B7C51045F79A94F6EBA73CE [email protected]
913,001,764 *5F0B64FD82AFFF0B15C2C4F022A57A1F0C6E8C60 [email protected]
913,001,765 *5F0637AB1CA3D7BA5D8B033677C7275BA638E59D ADUNCAE
913,001,766 *5F0BD4D53BE9ABF5AF9E6BD15666F8C3C63DC536 3AANHOUDEND
913,001,767 *5F0EF33A15F8D12F542BCD611DD2C09D0B0D1653 afbsx
913,001,768 *5F04AA1317044F0A0A57FA8A73B57242367F56D9 3GESPEKTER
913,001,769 *5F09CE3657A2C3E58D8C872630EF2B8C72578C62 3 k
913,001,770 *5F0C30E253775C78AF6CEAC505623F9A8FA7631D 3TAESUNG
913,001,771 *5F042724243D21FDE390936122A86E7267BF44AE aileen-vaughan
913,001,772 *5F002F75C9048D27E107CE41E8C2B329F91ACAF7 433748 meineswissensschiendiesonne
913,001,773 *5F068F989B13EF6536CFD82D33DFA98B27799FCD AJHCSBSWED
913,001,774 *5F0992BBC969E9A92D1B4CC9D8A4D2D7F6E95DF5 ajkcs
913,001,775 *5F07C1434451FFC75DA52D349FB1A5C0774C9FCF AK=FT
913,001,776 *5F05F4D180F1551F7FDC813140249D5B2738A79E al:cu
913,001,777 *5F07A3815B0C34F84397E74C01CDB0C014AB8538 4MUSTANGBUSINESS
913,001,778 *5F06D8DE144EBB9A9D62BD53BFCF02E34096F742 A,LF$
913,001,779 *5F0653700ED0BE617A68AC50EE90C5DF61D182FA 4MYWINDOW9
913,001,780 *5F0EBA1730E1AFB749FC78B34E07EA79A79A525B ALFONSOMORR
913,001,781 *5F03AD55970A896EE9D4FEAD75D7DCEF5BA48248 ALFONSO.VIGUS
913,001,782 *5F0998FC0EC2F607DF677096E533813AD1C1A52B 4PASSWDSPIRIT
913,001,783 *5F085108861E921265DA56BF545DBC35EB8D0CB0 4PEARLJAMSCRUFFY
913,001,784 *5F0CCC71F432FCA84114FFFC1CFD44B0B598305C allanmckim
913,001,785 *5F0352578844618B64C154A377CAA1C04CCF7A12 ALL STAR CHUCK TAYLORS
913,001,786 *5F0769009200483473435CFE4ED3ABB136A86FDF ALMIZTECING
913,001,787 *5F0345B299CA1838EBA606CF6B65B47E90103B4B 4THATWARRIOR7
913,001,788 *5F064F0F68E48693E76AE0765AF410E29A5E1564 [email protected]
913,001,789 *5F09FE9E90EC6880BF10F8E33DB73C42D5568B76 4YEREEREY
913,001,790 *5F004A6D072DAFEDF214A05C570ED4CDDCAB35F3 4YGOLONOL
913,001,791 *5F02C522100D3810853E7A70A3210BDA82E2536A [email protected]
913,001,792 *5F08B59B55A525377F21B7152BD50B25749A1FB4 517972 cunku turk milletinin karakteri yuksektir .
913,001,793 *5F0B7579AACD3A30C7239900F51A2BB6ABB5038B 54P0R1T1
913,001,794 *5F0CDB4084A55439E5B8FE97D0738C8FD663B224 57A71NG
913,001,795 *5F0E2E749083EAD3A005371C0135DBC6CF8D44CF amasy
913,001,796 *5F0F338A39F4E3583EB5435A96B289C0E48BA78B 5+ERE05C0PIC4L
913,001,797 *5F02B6498A68181018937B78E4DE42336E8CABAB 5.FREIZEITPROGRAMME
913,001,798 *5F01999E10AAF600A9AB73D2D38C438CC3E111B6 5garigues
913,001,799 *5F001DE6165FA71D82410A521ED24DA6A53EA0F8 anamenaming
913,001,800 *5F00B7BD157FDF2131FA156AE9EF1E68154D891F 5LERLEANE
913,001,801 *5F0167F15A55F04E04C00F182C366BB8EE50CA25 5MILLERAPACHE
913,001,802 *5F003067051DCEB476A24C9FD6F4C0EF30E266C6 5NARRIONS
913,001,803 *5F05F195EAF1E225674A07A59A5438405BA37250 5RESPINGERMI
913,001,804 *5F0282E48AA1150E52118009840C067169038C60 5-RICHTUNGSENTSCHEIDUNGEN
913,001,805 *5F01E0077F5545AA227BE09FE8363190BD62F84D 5SCHULMEISTERLICH
913,001,806 *5F0ACC4DD78E8EE808ED6787727F322AA148A6AF ANIBAL.WROBLESKI
913,001,807 *5F030B7E8EC9CB2AA46894C74DBE4F84FA3005DF a/n%n
913,001,808 *5F08C4C4504731F500C46EA9231F670AEAF69586 ANTHONY.MURFF
913,001,809 *5F0AB2C6C8FCEBD91F8BB971BE97A1B158E63836 antoniaoster
913,001,810 *5F06901375817617DA7B43B666437F26085E5A80 antonycarmona
913,001,811 *5F012E2B870E04936163F6C99D7005A9DECF0556 ANUNB
913,001,812 *5F07DD715929C4B2751DDD982C8F8965F8C4A7AC 6BSWULTIOBSW
913,001,813 *5F05D0985A2F715C19B20FEBBDBD19D59BBD42B7 APIアクセス権を委譲するプロトコル、OAUTHを知る
913,001,814 *5F063ECD7697F67A9344F7C81D4527E07BF995C2 6IPTEVLEV
913,001,815 *5F0A9AF7DF940F94ABE73605D9336FF8CE36CA9F aqnnp
913,001,816 *5F07D446024C84068C4C98D67976CE5FA6E50EB7 ARB/O
913,001,817 *5F0147335B82FBD7B5FA6AFA061DC4128526342F 6PACKERSRAIN
913,001,818 *5F07382405F132E6E85E284A848A42EF43A5C2AD 6-PARISKUNNISTA
913,001,819 *5F00FB0EA255EC292D2BE44652E3D0706FB6BFDD ari(h
913,001,820 *5F0B507BC9ABB95AF31C96CD3CF89E334641B70D A+ROB
913,001,821 *5F04C00F516E0B0EAFA7C675D80CF7075EAC89FD ARON.HARCLERODE
913,001,822 *5F0F7B0E201AB6436094A03C76107D16A9211EB1 6TRANSAKTIONENS
913,001,823 *5F0C7392AF07AE035CEEA0F0DC0AD6D8747F0F28 ARTICLE20168
913,001,824 *5F08EAFCB421B2699A5249E6ABBE37E1715A8799 ARUCATAOG
913,001,825 *5F04A6ECA8B487827DE01FE7297E148D2807A173 7422BATPI
913,001,826 *5F0FA7F881CA79CCA81FD34B4983A1DEF8638D80 7BSWQCJXBSW
913,001,827 *5F0984A23E2D593A6C9C0AD0490D260B0A53CEC4 ATF
913,001,828 *5F0D165EDD52C08A3BD45C5B4D5216E4652B1E64 7ingrassera
913,001,829 *5F0773883D69F3C43E66D6D190613DB947A73674 A/U%P
913,001,830 *5F0573E33CA473A37B6ECD1D8F912FE7F99B5A39 avea
913,001,831 *5F01AC3EE086B32E75A24709F934A804D03AF9BD avinashram
913,001,832 *5F085C0523A9802B2C4CD4859E6D7914AED12E79 A"VTH
913,001,833 *5F0EBE4987D10B06B33CF5CD1334A37F50F40392 awidu
913,001,834 *5F0A60DABE91161F023A7233F26ACDF0D4F0B74A A"YE3
913,001,835 *5F0A0096FD2CB9FBDB6B4613FAF3E4E259BD15E8 b-----)~(>_0)
913,001,836 *5F0CB03BDB5994369B3F49FFD06943837D9E78B6 b0df6a357eaa366dba82c72a1942faea
913,001,837 *5F0DB51717E67763341B053F9E1C59DB619C2C1F b%0g
913,001,838 *5F048247D68A2C71071BF07BF637DE02BAB9E894 b_#0p
913,001,839 *5F0323F72286D5EECCA7BBA530383218FF1D0957 B1AHL
913,001,840 *5F0B7630CD89FF49F89622C3FEE7D0BA4800EC7A 8BRASILGATOR
913,001,841 *5F0AD1286F95B79C6D025E636469D921110BD5D4 b4crl
913,001,842 *5F0300AA00B79081AEE634C3E5882F22036BDF88 8---d-~0-)8(
913,001,843 *5F0BFE97A34288548496449CF1B6DFE5DEF2BC24 )8(.~.D=====3
913,001,844 *5F0D973DEADD178D30E01CC7953C2F69432BC978 8DNEUMNIE
913,001,845 *5F09C956E3B0EF14CF1D1BA73B58BC2CEA6963F9 8DRBERMISSIL
913,001,846 *5F0E198B407DB3014810E5A046A3B6575D03C70D B8P,M
913,001,847 *5F0D2CDC7A9591A4874C50442508AACEB4B14F6E 8HOUSEPUBLICADDRESS
913,001,848 *5F00DDE33707EABBCAAB1744996F0BCEC08B2D3B BaB
913,001,849 *5F0D04E12A37366D2772838ACC6E32D4DDE6FDDE 8NITIKAN
913,001,850 *5F070A13273CFAA0DC1000A3086133EEC9F37AC9 bandcoot$
913,001,851 *5F00320D77EFC481A6EA7E71537E1CEC7D28449D 8##P***SPLAT
913,001,852 *5F097CBD1FF6140BF85427457A77B48C550417C9 BARBEDWIREBALL
913,001,853 *5F0E15C332A6FC1AD32D09A9AA13D1A1C9B35138 8TAPYTEZ
913,001,854 *5F04E5D291C7AA7FBD7C277BF7020D4540E3184C 8> ~(x)
913,001,855 *5F034A330EF94A87D8E40BB6436969F0166FDFB0 988D2
913,001,856 *5F0924E84E3D9BC7269E9805CC4DCA105B60019F 98JAYVION
913,001,857 *5F02E03AD74DD652704183735E6D615001B035ED 9ARITHMETICBOOLEAN
913,001,858 *5F0C715BA64C1F8718AFF19239FFD025F2D2774E 9BEDRIJFSADVISEUR
913,001,859 *5F064B0127C365842DDC1846222E3C3A58F17C32 B)D_M
913,001,860 *5F02720B773FC1C56ED41AABA9869B578AD8DEBA [email protected]$7ler
913,001,861 *5F018C9032369D651284146E6FEDD2FA99F36944 BEAUSYLVIA
913,001,862 *5F018F7EA6FF6306AFC783C4E753BAA98C22ACED bedarda
913,001,863 *5F00029ABFA999AEE681054309A29B572D1960C4 BELA81351662
913,001,864 *5F02CB8F43F48F3D2C25BDD1CDAF97F67C23EF2E bentonvauter
913,001,865 *5F0B2A682224F448AC0283A7584AE8F5939AA85C 9RAYMONDLAW
913,001,866 *5F02249CC2A4BD23C850CB7051D93A9053C6B5BD berlinerwald
913,001,867 *5F0C1C6DCB018F35717DF76B78898AC1E5E69D53 a&5_
913,001,868 *5F0841A89D73B447F860F6E07374987916CCA14C BILLY-WAIRE
913,001,869 *5F05D284501D983FDD1AE10852ABD6FA08D8D420 A9KG"
913,001,870 *5F01C0C1A114AC51569B719C97A7945D925B8FD9 BJG7J
913,001,871 *5F09E5F44F09C1FE2F1C07D0ABFB2B4DD48B1888 bjiw
913,001,872 *5F054F78D8329A9DF9480452FA48C2D34E342083 BLASTER402
913,001,873 *5F0E8A3B39A79850B2FEF642A8B2C75D7770E74A AABP#
913,001,874 *5F0EDD0B9880A2E621087A3FD2EB9AC466946B31 aad7u_
913,001,875 *5F064272F450A0FFDAEC9B5D26FBFF1615133B4A AADKUM
913,001,876 *5F09085620AE7D413B883DAAB5A1D3AE8D935C6A BMIC
913,001,877 *5F08658AE26DEE44B06C8D54C2F2963132272CA7 aaronjeppson
913,001,878 *5F071DA66F898CA2FBA568443CA3F5319EE47421 AAYCM
913,001,879 *5F03C9C8C1276905C8A8258E16EC0D2F670DB591 abfnx
913,001,880 *5F015F64247E16B7CCD036D07F6BAC96B4CDD8AB b##@~o.~o3b<
913,001,881 *5F0F9FFE841D21BBB78E17D73B6A7887FBD2335E BOOKL1$7$
913,001,882 *5F0E5C5E5AD04D70298243BE62873C635DC09466 ACL<Z
913,001,883 *5F0DDDC9E53A9EAF3909600CBE893A42B0964E7B acmzc
913,001,884 *5F0B569F2094203061C1EC2BA17CAD0B282837F8 AD"CA
913,001,885 *5F0CE4EDC2CC0FDB19D07798D78E5D2B936AAE98 bradleycapan
913,001,886 *5F0B5B27FB5F413E03E12C857CF05F9B546CFC8E ADOLPHCROVO
913,001,887 *5F07F62FAE3F3B5A6A81477437F4773FA7D47A9A ADORATA2
913,001,888 *5F0F7D6E2C07EF54713FA6E0E4A81395100343FF ADVWA
913,001,889 *5F0581CDF1FE118F8C4451BDEC8EF92B3E280A89 brettcomacho
913,001,890 *5F016BC9629A311598F32D3CCDF38011BE3BE655 brettpaskoff
913,001,891 *5F06D001872E77EF68C1F6E5C170FFE1B544DD87 AF,A:
913,001,892 *5F0B1DAF02F1D751621369C75C2C5C7B005FC107 BROCKALECCA
913,001,893 *5F0AF9FE631C07416F93CA3FE216209AF0236695 AFTREKTS
913,001,894 *5F0C7AF4B7F6F74367919A8E2BD8E4344776105D brünette
913,001,895 *5F0C68E7285D8A2BB7AD9E2751C39752BF2C99A8 B,rY
913,001,896 *5F07F103E25C1AFC78AEFDC5FED9B8F3A58146DF AGZA9
913,001,897 *5F0FF232E23910D177C51D703EEFC0560349D49F [email protected]~-`-SPLAT!
913,001,898 *5F0411553529673B0589E394C3A13838F78B78E4 BTKA2006
913,001,899 *5F0A84A2C1F0E0BBE32CFB6DD48061006C9EF312 BUCKETO'LOVE
913,001,900 *5F0890C8DABD5351EF643253F452B92BE9E44C7C BUMBORET
913,001,901 *5F072FCB2EA3FF48A73C1C360CB3E92554BFF501 [email protected]
913,001,902 *5F03E4F971D7A5AEF7BD63E31B7CD16A30B8E47B BUSREPUS3
913,001,903 *5F0847CEC755858AD2BA0D53F9F2C8F0B24D77D2 buwy"
913,001,904 *5F0B0CC4A1B5475B86DFC39E068DDBA8F22FB700 [email protected]
913,001,905 *5F0886580BA701D74ECA8C064F402854FBFF1F26 ALEX.COMPLICATEDD
913,001,906 *5F0C78DA64D3ACC9B56B7D579D40E5DD9807EDEC ALEXPLOWRIGHT
913,001,907 *5F033FD7537DAA8B117B8F8FF8579A28DAAA082D alhuwaidi
913,001,908 *5F059224164D3DE2DDE25CA9B1B76FE16296259A ALIE246
913,001,909 *5F09E28F66469942004048AFEEB3C4C4A7173790 alj
913,001,910 *5F089D95259141C7DEFE91F04991FA463A10785C [email protected]
913,001,911 *5F08D77B045B2188FDF08E54D4F07B731611E913 [email protected]+10n
913,001,912 *5F0D8073EFAF9C2DF337856791D3C8C76F64E711 C0NV3N+1CL35
913,001,913 *5F0AF1EAD4463BB9A016315C43D7516C1DC7431E AM6EP
913,001,914 *5F081BB4CD842F0FB626BDF846E604A944B98669 AMASSER.
913,001,915 *5F0FF34141A12F3763B37F59C9B48A8FAB77BBFE a%mbk
913,001,916 *5F01F04100D0DB76635499DC32ED1BC23D887D23 ^C-4B
913,001,917 *5F028910A484D7B725EE25412114C4F2BD225B12 AMKGT
913,001,918 *5F07642DE789D62695AC7CD1568E025CB8090796 c72nc
913,001,919 *5F04F12210A6D8E786483C67AFF3F93A4BBD29FA c74us
913,001,920 *5F057A5F789313E718F974DEC4EE1D0CBDE30269 AND-PROTECT-OBJECTS.-</P>
913,001,921 *5F08F7A807E8318622651B971204549B6EC7B149 ANDREWWOJO
913,001,922 *5F08116B05AB532904052533303D1B544B0F32C0 ANDRISN1
913,001,923 *5F049B2C3C16A9F9726E276FBDBC5BFF0D8630C0 andylacina
913,001,924 *5F094C539CFC854165F3569CBD3A6E1F6DFCC9AD angelwilcox
913,001,925 *5F02CB58D7BC149D1F9793AC99B32A0CE885023C calebfyall
913,001,926 *5F0E047743E8D835107E0BC9B3A7BF97D17D3579 annettevachon
913,001,927 *5F0D5135CA1165C97777575D41ACF97DC4D4DDD4 camille-obrien
913,001,928 *5F09F4BCB2C697FBBA060940BAAA41714B31AAED candente5
913,001,929 *5F08F3455D8DF232FFB5BDA117632F03A4F4F2B6 AOIK
913,001,930 *5F06FFAB2325F7E775C075C5C8C4803B311B9B1F a$+on1$hed
913,001,931 *5F082982DC8287A034680D323FDA04EEDD7A5A95 caseboun2
913,001,932 *5F051BECFDD58FB0B046D261CD97A573859050DA CASEY.KROKUS
913,001,933 *5F0057383F330C49F52DB14E1791B85A8653CDA6 CASSIESINGH
913,001,934 *5F0853C92E209590E162288ACBD08F71B943A6FE april.lou.ampunan
913,001,935 *5F09EE34D23A91AEB13522C365910CCE228F6F6B A.PROTOCOLDATAUNIT.(PDU).(A.K.A..PACKET,.DATAGRAM)..ALWAYS
913,001,936 *5F01DE19A1E2F218CBD97B1D3E60B05DA8D85C6C CDWFK
913,001,937 *5F0A6AA03A1C14CC935E4C1466635A2DB0C29374 ČEJKOVSKÝ
913,001,938 *5F056E502C23C79CD873F5562718DC8652A21E14 ce+l
913,001,939 *5F03B28E948D3760912A66BC96414CBE85AB820C a,s.#
913,001,940 *5F04199EA7C56885696DC519CB0199DE8CFDE894 CESARDECLERCQ
913,001,941 *5F06981A162F112DD1BBFCB77202139BBD09949D AS7T/
913,001,942 *5F0F59CE46389E8E92E8CCC3FD4F14AD897E84AA AT4E!
913,001,943 *5F004019FD447CAB5D3A66441F6E6FBEBE3786BB CHARLEEN
913,001,944 *5F0F5CFB25BAA43501D85A5E2DDC3BA0D37FFD87 A,U+B
913,001,945 *5F0437234AC32D865E95F04BFAB4807557537E35 cherylamanda
913,001,946 *5F08FF409D5CE109293D3B1427D25761444C2251 [email protected]
913,001,947 *5F0F3957B700636219E47D9F3BC40D3BE1A75829 CHLLP
913,001,948 *5F0D878A58E6F1D8AB026DDB20A5EE965D866236 awd5
913,001,949 *5F0189FEB773A3B14B8B773F47F0746E517EA0CC [email protected]
913,001,950 *5F06F13520D722432DF38D71922523A67655565B chucarras
913,001,951 *5F0CF45081BAC03B8045526FC79E71FB87882929 ci6=7
913,001,952 *5F0F91CD1D03016F370C0B2B0F6B440AB85220F1 AZ:P
913,001,953 *5F08D23722310F003B9734B03FF36FD17266D349 c)k1
913,001,954 *5F05902C3026BF74813FC79F143EA23050F0B0FA ckiiu
913,001,955 *5F0F6A7CD3D205F20B71DD6A4D175145F4D8B6F7 b9%&&
913,001,956 *5F01F201ED501F6A6A582FC839F02A19358E2F30 BA1_F
913,001,957 *5F08B0AA7D51219B55F0E9FD91F86817E139D31A clevelys1
913,001,958 *5F06EEFCD326C80AC0B2E97578BC6950D411E418 CLIFTONBERNER
913,001,959 *5F0EDEFF202B4979952757819F6AB4A53897868D cliftonlaplume
913,001,960 *5F0005B38A2B87CA90624A18C720B84A1209D558 CLIMBTALUSTILTUPRISEUPRISINGVERTICAL
913,001,961 *5F0680E8A75E468E0686C6A3E12AB7816F773389 BADBP
913,001,962 *5F08F352D7A2BCF7A94BEC4C29000F800071D3FF BBC=K
913,001,963 *5F0859C09F3AFE6E3773D69B3E497965837563C8 COLIN.LIESCH
913,001,964 *5F020CE9DAF70A134E80974CEAE8348FAB86E563 com66
913,001,965 *5F077EFF8B8370ABBD2A1E1E1E414A2B342DA34D compatissante
913,001,966 *5F055A3921509EABDE3758FF07CC245EF10E9351 bd_z8
913,001,967 *5F048041DC2720BB9E53B23B2957B40A21490131 cos:!
913,001,968 *5F00265F5B589788305F5ABF5F4DF1E9B87F43F5 BENNETT.MADISE
913,001,969 *5F0EF5D9FD964BF6B57BFCFAEEF95362D9E4C2A0 BENNIE.SPISAK
913,001,970 *5F0B8C7B2D3515F1BCCEE404592A4512DBA76796 C(PIQ
913,001,971 *5F0CEA07C2597F9E3593A8C413B707B7053CE8CB BIBIRRNÊ
913,001,972 *5F0DEF04E243B870A838946E1531213DF72D9727 CTKT
913,001,973 *5F0DADF82F94976AE4EA82950467C90302E62003 bistrai5
913,001,974 *5F0BF123B1F4E2707865D937F1023BE1C06B59E3 bjiw
913,001,975 *5F046F622E35A7F3A11D0259F60A59EC56AB75F6 BLO3MIST3WINK3LS
913,001,976 *5F01AFBE1EAF8F482C7F9329FFC645634FB794B4 [email protected]
913,001,977 *5F0899FCA9C0003DD191D1DAAD86AA9EC18BDD26 BLUESFORLAUREN-MARIE
913,001,978 *5F053CD6E17D3D74ECF95AD09C40CDA58671D15A d2svg
913,001,979 *5F0CC641B27D3B110B35E1610697D1DD23DD84C8 bofa5
913,001,980 *5F054168815D38B5CE7AD5585FE342B922EEE0BC bol/w
913,001,981 *5F086167E3F1622CDA0E834CE24965B707132703 BOSTON344
913,001,982 *5F0C05D08C566BADF10243BCD5453924F7F39C98 da/aa
913,001,983 *5F0CA8C2527D02E5552F7986228FB62C60EC6394 dalinadahalan
913,001,984 *5F0AE9836F14B8F49BC6AD29D62E3F3C685EBFCB BQS+
913,001,985 *5F0672943058A73CFA5B378BB6EC0D0ADF9C46E5 BRADLYSPRADLEY
913,001,986 *5F0BEEDD4FC465A0FC4FE02EE583CBC80D0AB30E bradpetrauskas
913,001,987 *5F02661A8A5CC4D030E3A000B1E5340EC34CC030 daradundena
913,001,988 *5F0563F0594F34F7D1C2A9B46D972C64E8FF6AD0 [email protected]
913,001,989 *5F09921AEA2D72D7D67C6646EDCEE17024BA10B0 DAREN.CRISAFULLI
913,001,990 *5F09980191C0738EEE63D4ADBB81A54725824B9D BRANDONWIEGAND
913,001,991 *5F0DB047658732D3918A2F3A7665DAE6DE622FC2 BRENDAN.FEDALEN
913,001,992 *5F0EB5BF7C71CB765608D262D7428FE379830923 DARRENLUNN
913,001,993 *5F06CB0030A76E2315569D03CAF42383756C697B DARRIN.BATIZ
913,001,994 *5F0A115130346A45C9AA878F43BE40B5B0DFC4F6 darrinownbey
913,001,995 *5F06C940F6212AFEA1F93C13F9DC5E7D746C7FF7 brianreak
913,001,996 *5F027A166132AD3A9FB2AC838007BE6713093571 DAVKOVACI6
913,001,997 *5F084A9F6591E24F4081A6142AC3B76C79A5A7F8 DAWID NAUDE
913,001,998 *5F0915B6D131EE518F158E48153AA0F6B0E816F4 day1h
913,001,999 *5F004D2EACFEB160293FDE6BC844DC8599E99007 B;RP3
913,002,000 *5F030CBC5536558D3874F1FA0DC95E124D9127E8 brunomcnail
913,002,001 *5F0B8985A973D20618D14CA7B7B4A9896FF24DBA dbhh0
913,002,002 *5F0AF62DDEAF811FB19B0B6E8AE1CF94528331CF dbq#p
913,002,003 *5F006F585A961EFFDF535EFD7EB47A46869C908A dd222951
913,002,004 *5F0BD5F6A794ADC9A65169A6E198A1936CE073E1 deb&l
913,002,005 *5F0C12A31C3C85A059A2DE2A06B49A3FF655CAC6 DEMETRIUS.BLAKEY
913,002,006 *5F0EFB28B3CC504613BD8FE3CB44A845BA8179B2 bwi?f
913,002,007 *5F0F9C2E9A02C7FA99384F054CABE7BA6793F449 desmondbertino
913,002,008 *5F0A2397302F9BB7BA21A6FC73259ADA0269C02F C{&0
913,002,009 *5F012EF76C28DE5985D3C9BA90A2788052627AD4 DEXTERCRUISE
913,002,010 *5F031AA43C6DAED089F5CFB8F29672EFBC4BCD96 C6IDU
913,002,011 *5F0DB48BE009C45A77186E10500595116C52A43C C_^9
913,002,012 *5F0E8E284A5AE28DC3405BCCE4DA32FE4D7A3F37 CAETANI)。
913,002,013 *5F0B2571D46A6A6522C4FF15D353CD09DF132C8F di0d.
913,002,014 *5F0B1FDE556C1EAA738A8236C361F5C1A67E2686 CALEB.COCOROS
913,002,015 *5F0EAEAB4D3C7F28CB338F003C402D0ABC52672C DIAMONDJIMBO
913,002,016 *5F07095B1BF87B85B5BA9DE4C8E64BD862015BC7 dib:o
913,002,017 *5F077B9EE162D5C79483003B160960F0C49981FF [email protected]
913,002,018 *5F04F8AEC164420D8FC4DA6155AE34E101A3EEF3 capitolsissa
913,002,019 *5F052BA7B586F19A3FAAC21A10091E3A6845DA57 DI FLAURO
913,002,020 *5F033E5758D83BFAD5FAAA0DAF7FBBBBAF2805B4 cardo.arzolla
913,002,021 *5F0AFAD1EF3E1D4789E306297E337F62E510AC4B DIMICTICO
913,002,022 *5F06917923EA2A6A19AEEF8E216C4D4311314188 DINUNZIO1234
913,002,023 *5F01AB4291279F0827621943926306A871FDF177 diqtq
913,002,024 *5F0455061811E186B3C162416101D43E0EF79F53 distelfi4
913,002,025 *5F02D2F236FFDD143776830E666023DCA5EA1CAA CECILFOUGERE
913,002,026 *5F0B303C1AF8E31DA7FFA2C513609129A385EA99 dlbec
913,002,027 *5F03441E89FA3126771B66DE33ED020EA30F673B ce_or
913,002,028 *5F0AC803C4383F2B15569D65E518201FD28C2D16 CH4R4NDR0G3R
913,002,029 *5F09793E63994947C72261A1230825E6DEF3B2CE dob_f
913,002,030 *5F0FB737C77DFDA7219D6071CEA84F1C4EDF9D0A CHANNEL(フジテレビ)
913,002,031 *5F0AF56D12A7507373BB1C853AFE56264C698282 CHAPECARING
913,002,032 *5F0B115C98EEB521832DD5DD36169D130406B096 CHARLEEN
913,002,033 *5F06328F5900A35CAE79CDA108930740E4F45AEF charleypaddock
913,002,034 *5F0D413C6C1CDADB8971E03EC9B70BCB6DB62ABD CHDW!
913,002,035 *5F0BE0BC1723F71D059960B3F785E35D4CEA0084 DONAPRIA7
913,002,036 *5F0E6829D3E89A54A24006A86F7A0AFE26649349 CHESTERPETRUSKA
913,002,037 *5F0007F9C47D8DEFB62C2AA066793743D5D69496 chicmagn2
913,002,038 *5F043A8C3B563D77504E9D16A3D354D4CA92850E chidirases
913,002,039 *5F0605A11D147B11DB111F41498235893BFECD90 CHLEBOWICACH
913,002,040 *5F01ABCE8FE272D8137A53010F804E4CBC4CB07F chrishuge
913,002,041 *5F042281E7912EDE17FA2A0102BF50BC625701C3 dq0nh
913,002,042 *5F0108537276648D687011018708FDAFAAED92DC CINENIMI3
913,002,043 *5F09C3727A9279586B95F0E16A0A1D9A51F31B39 CISCAUCASIA3
913,002,044 *5F09370FBFC1206DE8CC5B38F819EDA8AE4A75A8 CiZg
913,002,045 *5F0802574B2672BE88D3F216C01FAE7AE5EC7CEE c,"je
913,002,046 *5F0B081AB13561B97ED008F88759F2A4C59C0732 cjlq
913,002,047 *5F02E95D2D4558E55D53FEECC41FB3D47E6EC9D7 drefiasnhammer
913,002,048 *5F00369EB3D9622022F889576AC66F869A6738CC CLARENCE.REAGER
913,002,049 *5F0DB678950A0D521756E7EDD607E74D4D798660 CLAYTONHYLE
913,002,050 *5F097CDBFE48C8AB913C1705B1F122E56DEB56D0 DRMODOK
913,002,051 *5F08C19CEC0527949F8E17DD8168183A0F7928FD clermontferrand
913,002,052 *5F0F683ED96B0B2B471500FC2C3F61A64194675E D$RY$
913,002,053 *5F09285FF9914B49A8D7D48AEC2D4CC8EECDF7F8 clo;o
913,002,054 *5F08DFC0E619DFD5FD6DCD4228646077EFCDE68E DUA
913,002,055 *5F00A16E095FBA2676E6C60BAEF13FD36C37DF17 duncan-archard
913,002,056 *5F076386ABF4B5B108BA662901D651DA8C76CE4F colinyendell
913,002,057 *5F06274B245FF8DD6D61B0FA39408069DB771DAF d<<v
913,002,058 *5F01CB42E1F0D203F0324FDA55C64F89C9ACAF7A collinnollet
913,002,059 *5F008D09747AE1FB2784B232D61656DB833404BD coloroso3
913,002,060 *5F09877BCC09D65270FD5BD6DA1BDA9065469E7E DW=)Q
913,002,061 *5F0FEAE5EA1FAB2911DBF732340106AA2CF1EE67 CONVICTFISH9
913,002,062 *5F0FFEDC491E1E32ACB6EFC77A7F9A706CF610E8 [email protected]
913,002,063 *5F0668BE10A7C7B2D8C654C8A08262A08A845325 CORPORATIVELY5
913,002,064 *5F0521D232423F604C5DEA5E4342F123773AE470 CP%)
913,002,065 *5F02D04CA8CD09B4DB915B77340B80613D287323 eddie-fisher-with-hugo-winterhalter-and-his-orchestra-and-chorus
913,002,066 *5F00592C917A825FA44A117DE1CE4AE3BC23A342 CQA(BU系ホリゾタルエンジン搭載車)がハイデッカーシリーズと共に併売されていた。
913,002,067 *5F0F02094E06EF4A6E7F791AC4E31E18C97B5D79 CqKV
913,002,068 *5F0B42928946AD63E6C2C2BBB8A4917EBD4F55E6 EEO3B
913,002,069 *5F04A3601D934309F000CBB43602625E1D5CD243 cuatro-de-julio
913,002,070 *5F01E1EABBF3F069E332D9D4F6AB307E512A3544 CUCKABARA
913,002,071 *5F01DFE7F0819B5EBC870CA24E67509522509E3B EINZUSTREUENDEM
913,002,072 *5F05D892D79993841D763D97A8136BEAB882C58D CUJ.9
913,002,073 *5F0139812FDB954A4D5F881B2D8FB5A2443376CE [email protected]
913,002,074 *5F058B3ECA40BE28CF64A8FCA91EE20B8F621A0B EL BAL
913,002,075 *5F0A6D9577EAA9D9D26C64E4387F743B95B792C7 ElBarrio
913,002,076 *5F0D424B7E0057D828A40930938F50774A6A2D53 Cvm
913,002,077 *5F0EE53EAB8C61F4BF657C6B82E23D2CFADFC5BA Elise-Baldwin
913,002,078 *5F0879C10280C8756C78907C138670BE63792F23 ELISTENSON
913,002,079 *5F0B945D994C13EFE66F4DDDEE910B8FE5B36D02 ELIZABETH SALO
913,002,080 *5F08402D6CEBD87F82E5085299870F83F90B0BC8 C(WJ.
913,002,081 *5F0C8C805CF0D500AEBCCE8A4B29AC8CF6279585 ellinujing
913,002,082 *5F01CE4B971819778BAB95DE3C4D139E56254EEB eloueden1976,part2
913,002,083 *5F0C88A6A79CF848C8C22DE81FEB11D91521FB28 cyverreyes
913,002,084 *5F0747DEBEF3A305EC387AAEBED1F2CEE5B04FD4 c+z0(
913,002,085 *5F01D8CB4DFA48984998AB6041A6935E7286F054 czosx
913,002,086 *5F0FCF8A3260DEB85AEA1B3514EE51C78C513810 emorywehe
913,002,087 *5F003F9D9845876B28F7B5E1E2FDF4FCFA0BD3C3 EMTOI
913,002,088 *5F0A79190FB72E932493FC2079AB547CB4F648D7 D5/.R
913,002,089 *5F0D68E798DC1771E32825E45A4F9B68C5D0A497 D6MAVERICK
913,002,090 *5F0152B88BC2443E19A5B221C6688EC4DB50F373 D7+3G
913,002,091 *5F018E4F2B1176F3D62B6BC10F4AC09E1A3BFF0B [email protected]
913,002,092 *5F082C9A5B1D38D0E15093D7A434CAFF0D41F3A8 EREVH
913,002,093 *5F0833ACF7D4CC7EAAAA5AC72E0965C47D088662 dallasspratte
913,002,094 *5F002260EEB6B7524D5E9757CA8B5DE9CD9BC2B4 ERIL?
913,002,095 *5F030D2D7CC97CC47A1F315056860FA759A260EF DAMON.PEARD
913,002,096 *5F099D56D09F55C6022CB7E1E86F242BE5F41102 ernestomano
913,002,097 *5F0CCC6F894C796D93FD3D847E656E5F37E98C16 ERNESTO.NEWBRAUGH
913,002,098 *5F007F8818246FEA08369381DB4ED02000D7DEE1 Dancing.in.the.Rain:.The.Best.of.the.Essence
913,002,099 *5F06690E0451952480973CE739478F13E0CF4C18 ERNIE.EDGAR
913,002,100 *5F018A76CE4C2ED2627E6762306B7F6E23C702B5 ert=g
913,002,101 *5F0EC690DCA741E560B40EABA4E3D77749D24298 dankale
913,002,102 *5F05D58134D3393CF52919377949FFC1553AFB6A DARRELL.MUSI
913,002,103 *5F03C5054FE6466C2976809FC5EA2D826D980873 DARRON.CROZIER
913,002,104 *5F0C4D78CBD5E61D5E226D5E5426588A24AF5905 DARRONLEBEAUX
913,002,105 *5F057B9A1A72633B9AB3C804565BA8D3E46B28F0 DAS-OMEN,-PART-1
913,002,106 *5F067BFD9759194953498DAA7522F30AE537AB6A DAVID1+
913,002,107 *5F0EF592C6EA20C7D4AD00D57D814DCB6CEDF283 eunecker1
913,002,108 *5F0058C8C4925DF9AED12CB35A896562F0B11290 eusebiostumpp
913,002,109 *5F0DD73717603DA3354C375E1D31384E7F19167F DAY;V
913,002,110 *5F0A2F5A56AEDFEAA2C9FF0E2D8D68674853D973 EXPRE$$ON$
913,002,111 *5F0361148696711A5336EE66A62621FB1C9EE8B5 FAIRBURN8
913,002,112 *5F0D6CA0AC298BAB5A4E35F4DE9F3BBD012E0524 FEDDETFEDDET
913,002,113 *5F0E55D9A1D1F7E68CAC2D36ED8754D4E00878DF FELIX.DENNY
913,002,114 *5F00A1D8CDF20A36288758CE8F006DFF7A15C2A6 FELIXTEBEAU
913,002,115 *5F0DD18426AAFDF65EB89731E8C86914E5CCAE8A DELETIONSHILLIAN
913,002,116 *5F0124510ADFC4492E7A5744813D1AE69E67BB3D DEMAGN!F!CA7!0N
913,002,117 *5F047E96B029D9978A99860FD0B33F9B7191A4D8 [email protected]
913,002,118 *5F0FB87ACD48F54ADCDFF084CA1F4C4D2D3248E7 [email protected]
913,002,119 *5F0CECACFCFA787DF74F1E038E957F471FEC1B84 fifibelle
913,002,120 *5F0C33BC5D5BBE474464663F86A22763DB32FEA4 fingersandnails
913,002,121 *5F0CC0D1C4DF8F6841D5371A91BDA411941AFDE5 FINNARAR6
913,002,122 *5F0E9F46CC24298AC8788B542C33834BC61D3B85 derua
913,002,123 *5F0687FC4976BB52088C5E796288465004EFFEE6 fkb28bwk11
913,002,124 *5F0F3D664E99CE9BD3A02D3FC4ABC320CE74E57F DESPEITAVAM
913,002,125 *5F0958E7EE138C6B3B81272CAE96A6179247E11D FLASHJAVADHTML
913,002,126 *5F0C87DDEACA9800F65819FEC3B4885870822244 [email protected]
913,002,127 *5F039529259C3C75B4037525F68C908EE14D156D FLORENTINOCOUTU
913,002,128 *5F0B120FAA6BBA77198DAAE28646F7C36604E169 [email protected]
913,002,129 *5F010823231924317B6716B68626A4A0FE7BE8DC floydarceo
913,002,130 *5F0F5E091C7D2D355BD8BAA32C350266719C61AF FL=W
913,002,131 *5F0D74C20DB328C323B665AFD928ABFEF48EF26B DEXTERKREUTZBENDER
913,002,132 *5F0CDF4A152704DC24DBFD74807DDB65E0CD7E59 FOR-NEVER-HENCEFORTH-SHALL-I-JOY-AGAIN,
913,002,133 *5F0966E9C227F986142F70690FFC1ADE29BB082D DFV2S
913,002,134 *5F0892DA4964483ACC432AEB84F76DBCB8F3949D D/HT
913,002,135 *5F04BA1F9E49B63F1D0382450B2D0BAE8AE60947 FREDERICK.CISCO
913,002,136 *5F0F54C73416772A38F9C08A7ACC8BDC87BC6DC6 DIALEKTSYNTAKTISCHE
913,002,137 *5F06EB7967DD31F096BCB8D05967EC18B649EF7E DIANE-RAMBOW
913,002,138 *5F02D7EAD842CF1F09D00799E7DD16DE5FB93FAB DIEGO.DAUTRICH
913,002,139 *5F0EE81DB868699FA5018D8183F8C1B0434632C3 DISBANDED131
913,002,140 *5F045EEEEBBD984CBC68C08DCEA57ABA74CF4773 [email protected]
913,002,141 *5F0CE97A72D46F99E95B8609521B9A941486C132 DITBS
913,002,142 *5F0419E8B2FFA03EEA78D3F1A96E6BD6FDA8598D DKTYQ
913,002,143 *5F0C719BE3515DEA80AB2D9E865845130C20D764 GALENAVINGER
913,002,144 *5F06233F543DF15419FAD69CD0BCC7CC3106F95B [email protected]
913,002,145 *5F09FBF2BC986652A05F7F9F6603980038968F15 DMACOSCOS
913,002,146 *5F000D84C7CECBC5B7D2A3BBED544CEAE1D122B0 GARRETTCRAPPS
913,002,147 *5F0654B27ADFBBFDD613168389E3D8FB143DFB48 garthmullin
913,002,148 *5F0C1DE51D4E35AFE4DE4341DB97B3B78F18DE8E garthrhoton
913,002,149 *5F0A27194A4F6C9CB23EA0ABCA34C8CAED293801 DMSNO
913,002,150 *5F011203E03C5985D014DBA59E005D8B2957ACC9 GAYOVALERIOCATULO
913,002,151 *5F06A5790D2A8CD03337FC22BDDD317B3082E4D8 GBYW
913,002,152 *5F02B8F549F280DA088E95193FC6E703CF2CA8AF dohaamh
913,002,153 *5F01920A6041318D7776FFBC8ACAF8F63B127A81 GEOSANG0
913,002,154 *5F04142EA2497F17E071A6448EC68E9103706F27 domenickolander
913,002,155 *5F0A73E13760D11851EC339B8081CC287BD6C8DA GERALDODIRKSON
913,002,156 *5F02D1DDF1B465B176BE000C83AC8788D4350D12 dominickgioia
913,002,157 *5F0BCEBA662B577D7F94E0B8E956ABC12C7F91B7 DONALDPERRING
913,002,158 *5F0B1BDB800FFC5BF17D01289045CCFB70F81D1A [email protected]
913,002,159 *5F0AC02363D0AA3087403EEB7871FB1D63A7263E GEWAILY
913,002,160 *5F02ED8F30596847C3CBC28D7B3D27AAB89F7F9C DONOVAN CHARL DOMINGO
913,002,161 *5F03D24E0DD1A9531052D36A3EACFA3BDD3F1E1C ghaskata5
913,002,162 *5F011AC1AEC7F84968914E1EF39FF39C903FEDD2 DOROLIS6
913,002,163 *5F0581DA1CD26FBFE90AD4076FC7803A918CE2AA giltcup
913,002,164 *5F0D93B5A01A7C09032B376322099964D822BC56 GISELLE405
913,002,165 *5F0C42E35DE768FDAB988F2C5529C464E0F351D5 DOURESTS8
913,002,166 *5F0BAC636B1A5B3995D882B89F2FFCBC56989592 DPDT
913,002,167 *5F0567CEF6D3B56959AC6663928E5A7721C2D0BD [email protected]
913,002,168 *5F0C9743A083ADC9D091E7609BFA0A1ED2F046A4 gl!y
913,002,169 *5F0394C25ACA7825D7516ED3966F1EF2B9D9DA13 gnovayax
913,002,170 *5F02514C45EE8AAC8329EBC555D44C59570E5484 [email protected]
913,002,171 *5F0C40A19E346C197DA0D69724A8862D20DF17CE DREEKEB
913,002,172 *5F08768855379B3CF143E17D41EF345A23DDE529 [email protected]
913,002,173 *5F05DE84C084FBF9B3372A37E549E174571AEE5E drrq
913,002,174 *5F008F43BF4B85C4E0C3ADC42C8EBF49C8682AE4 gromankovským
913,002,175 *5F0507F2D53531D8B3D2C35E7DB973088209FA98 [email protected]
913,002,176 *5F09B633872D27501431B8588376D36C08DD9B90 DUA
913,002,177 *5F0928126BF5635F55C83D191C1297786A74F805 [email protected]
913,002,178 *5F0A96ECE43BB70BC8E2576C8CFB26090C4DBB78 HAL.JEREZ
913,002,179 *5F04829D92AE585F9CB03BF3550066B46B277736 hallabell7
913,002,180 *5F0E2612EEFB561EEBF87C270953DC4508FFEB16 hamterro
913,002,181 *5F07F458EC08BF8377729216534CCC822D0EFC6F [email protected]
913,002,182 *5F01F1A55720BD68E8F25C3D34AD11840758C1B4 DVC.K
913,002,183 *5F06EB5E827DB44BD144D1EB47F80920D3DB23A0 harnosand6
913,002,184 *5F081FA88ACFAB2AC77DE959DA2686F3E3A6A29C haroldcoppock
913,002,185 *5F0CEE10A9D32D9008BB6B590DBFE0CF5F8E3984 harpsichord.concerto-adagio
913,002,186 *5F074AB850FA5A2DFFA935A42C35190CFA0385CC harshens.
913,002,187 *5F0F2108ED210A41EF4497BA3A173D7B752CEE05 heidi.press
913,002,188 *5F0B67CF059B262B3C17D5B4F99DEBB9AC4D98C0 DZDUZ
913,002,189 *5F0B2FF95AA8D4F0B60C9387857F3DECD5806E32 h}etm
913,002,190 *5F0FF40FB981555D5FEBB3516978E2531BB1EC52 EASY-TO-DIAL-ON-A-PH
913,002,191 *5F0DC1E77BD595F4CEF8A385993CF272385FC0BE HILTONELWELL
913,002,192 *5F0A600555F781E6597F9086642340C0DDAC259B ECNAIRCS
913,002,193 *5F03F27D65FDA959148A72F99DB1059C8BAE3D99 EDDY.FEAREN
913,002,194 *5F09EA5FE59CDC89A0450D0194B75FFED5CE4E7F [email protected]
913,002,195 *5F00F48D53945AAA61F68D6A1C74C5DFDA605A61 hobertopperman
913,002,196 *5F0AD7DA6FD8774614C026160FCDE3D29FD7E15F edneuerfing
913,002,197 *5F00AB86F01FDB1D945F24E201179D7523C26179 hofjes7
913,002,198 *5F049897C7BC223C7F24602F83270D448D3068A1 HOLLYWOODTENIMAGE
913,002,199 *5F0D3EADA97AB45752D1B90AA15FE1654EC7F41B egqip
913,002,200 *5F071796F3AE37799251D9C5A9079F763D63E799 eisenhuettenwerk
913,002,201 *5F0DA5DDB1F93C171802C84BA7ABF9DB1489AC4D ELBAECIRED
913,002,202 *5F097FC6544A7036679F7BBADD083EE9B9243F55 HUGOKIST
913,002,203 *5F0B7B80ACC0D8DC825DF950E80ABCEB1A9F5CFE HUMANMONKEYS(RADIOEDIT)
913,002,204 *5F07E3B5A29B2B6D8407E1E863812E080182C51E ELF.
913,002,205 *5F0087C096C3F53FB5B3FC3F868F09CAB231A05C elijauregui
913,002,206 *5F035F88F1CE1D71788E090028040B60A9029E4E ELKING-JOVILLA
913,002,207 *5F05BB85ADABB666FA5198E5389847AACA758082 IAMBEER51
913,002,208 *5F0DDB80FCD750CD2C031C2148434577E7599089 iceskate-magazinecomwww
913,002,209 *5F03906F48F8AB3B2277DE4AF59854EBD4B6BEBB EMILY BOYNTON
913,002,210 *5F06240212DB5DD8B62CA9304CF6517D31E38CBA emmanuelposusta
913,002,211 *5F05CE88D0761C6C8BB21BDD19DBDA316A022DD7 emmaruth7
913,002,212 *5F0E2C1A22F62AEC542983422FE02E12130A7085 EMOSDLIWS
913,002,213 *5F08CC821836CE59113825459F9EC1BB1725FE6A EMPEQUE\ECIMIENTO
913,002,214 *5F0F4C573F71AB73BEEBC540B6ACA9BAF9C54C45 IGNACIO.RODRIGUE
913,002,215 *5F01FB9A5A1F7A32B8C2978208DB494F9C05ED46 [email protected]
913,002,216 *5F05429993E1B50AE601D5812F428C7B45AAC164 ENEMTU
913,002,217 *5F0F50A2DC246A71AD1F4C0B3910CC1C7A30DF4D IJIVONSO
913,002,218 *5F041FA66DD1BE9102FA743866887B2C8C1EFADB imagisms
913,002,219 *5F080AA38A1195CF57266D6D764AD252E7955377 Epscopa1ans
913,002,220 *5F0A6AC5035EB1FAFD8087B11F481A52ABC48396 IMATELJOJ8
913,002,221 *5F0F7E7E93A3AEC69BB9498B331095E0DD6458F3 IMMISIST7
913,002,222 *5F0F270FC39E4F7D27936665EC08D1E0C21DF0F1 ERIN.ALLGIRE
913,002,223 *5F00ED57E345EFD3FABC3E55EEA1B42E09685DDE INFORMATIONSBLATT7
913,002,224 *5F08597E517AC816F932846F7296BAD1AD3DA2E1 eselrebu0
913,002,225 *5F028E2E6D8D54E3F35B0A636B3064C55A758B21 introduction..prepare.yourself
913,002,226 *5F0820A658ED5A38157F3CE4C665F2E0BEBE5622 IN/Z
913,002,227 *5F048712EF88EAAA50FC2314BA75123A7687CA93 etisopirs
913,002,228 *5F02E0CA40E773554905C7AEA07CC4FB41959599 ETNATOHAC9
913,002,229 *5F0408DC6BD57C4F08072DBC2980C79C7358268C eugene.maurice
913,002,230 *5F04D4E54712D4C6DA2A556C938F43A150476C6D ISMAEL.HILES
913,002,231 *5F03B5CBF7A820568720A754D9B22CCD332AA1FB ISTRUIVI3
913,002,232 *5F034A409CDE9E17E76214D301CE4E3DC49B1E6B IVANKEEF
913,002,233 *5F0AB77351B59F6A875F1DD14F7811686E3E5928 I'VE GOT ATROPHY ON THE BRAIN
913,002,234 *5F0B9772D5A11C3C6A24792D652641F677646815 f00t4g35
913,002,235 *5F097D5FFDB5F3B16CFD96B9CEA82E206786E56F [email protected]
913,002,236 *5F09C4C97BD9BEEBEACADD2FF6F05F64D0F85323 JAMEL.DUCA
913,002,237 *5F0F430B8D3B7C56C2FADE61F5112328AB3F08E1 JAMELENBERG
913,002,238 *5F04D901BCAFC861C04DFE60DE6675881FDD526D JAMES.IODICE
913,002,239 *5F04DD13B81C676F436C5449B1414A50C165C2B7 JANICELADD
913,002,240 *5F07A29ED1D956E8B54DBF554E53627134F894FD felcsavarni
913,002,241 *5F0B7F628C80CB6E48AF8860C67FAA4CF460AD50 JAY.EMERU
913,002,242 *5F06E2FA469CE916319F0BAA46803A94E8BE93BA fernandopanessoserna
913,002,243 *5F0AF7CD5F90133AA1289AF148448F3ADDC1901A FESTIVAL155
913,002,244 *5F020DB934638203AADC5646A296B4D450C62569 JEFFEREY.ACKERSON
913,002,245 *5F0C58E50E349B649C9B342D0463359FD5FACAB8 FHWTZPSE0C
913,002,246 *5F0F10C76095811E9F660C53D335E78C4C5B805D fingerholds.of.avalon
913,002,247 *5F00444CFA111EAE68C0309D7378F39EEC59A35A [email protected]
913,002,248 *5F02DA17718C820A1C98E723A6187F3B8EC26300 JEREMY.BORON
913,002,249 *5F0BD14E5B09767672456421966B6F2F592A572F JEVERLY0
913,002,250 *5F0779A42CE1A73F6C3AF5C065C32343DB2B2646 “FOAMEA
913,002,251 *5F05D4F99F21E75D9FE3425797FE01ADC76F3F0E FORENKLING7
913,002,252 *5F02A6A16F20BF56CEA9347037D9D5148EDAADE1 jjnc
913,002,253 *5F05D327647D48FD32EAE425FBD3673A66FD1DFB frankieswistak
913,002,254 *5F0CC91BEA4337D1C3BE9D1913387AF09770CB13 JOELSPEARES
913,002,255 *5F0BCE146A3F90650DE4C9AC824660BFC8682E13 JOENEESHA LEWIS
913,002,256 *5F0F264810D04229A70A7A6D01A31B33A83DF1BD JOESPHHUIE
913,002,257 *5F071CF73BDF48D896A3AE02127FB6A6F9C77A1D JOESPHSOULASINH
913,002,258 *5F0FC37B191133D5001665BE07AB71DACE700A1F joe-wymer
913,002,259 *5F0D19838B9AE0CDDE77C560A176189D03E2F216 JOHNIE.ROGNE
913,002,260 *5F07A05CF5533CEAB7D1849834B82A91941B023A JOHNNY.TAVERAS
913,002,261 *5F08ED2016594503A52E6ABF280C285BC4D1B6DB JOHNSEN6
913,002,262 *5F08444DCB630AB95844DC9C3877561BCEA8E67F Fuck.Off.(The.Misguided.Love.Song).(live)
913,002,263 *5F0F945FCDC466212A1E10FA792138BF6EFE75DD [email protected]
913,002,264 *5F052DB58EC69D56D2D8349D566E27E35ED8E09C JONATHANHALEY
913,002,265 *5F02E241D538058AF7F1B27AB41A3877F62467BD JONATHAN-MICHAEL-STEVENS
913,002,266 *5F04F3C04AF5027B976FD9A4D06497CFABB293BC [email protected]
913,002,267 *5F0161277F8E69FDF179CAC1BABBF38A5D3E049C JORDAN.PARADIS
913,002,268 *5F05B76276BCE7C88E1334D92A06B2D414422264 G#%;
913,002,269 *5F0730CDCB12D79D63C4B6F58526E37964A4C0F3 JOSEF.STROP
913,002,270 *5F07ACD70582E6ED779E91CDAA44714CFA84B039 G350NDM4K1NG
913,002,271 *5F05C31420885780508FA5D99AA2613F75D4F31B G3HS
913,002,272 *5F0906B22F9BC4BBD8C6B6446AC5B35A0AAC9305 JOSHARGYLE
913,002,273 *5F0FD75D24E17FE76D2FF0F24CF569E57C86E4FA GALE.WALPER
913,002,274 *5F0758D1FF4AF27A5EFB53CC1110ABA287CA9EB9 GAOPINDUN
913,002,275 *5F0024F3A115C9416DD6EAD59AF3B39A381792F2 JOZEVSKAITĘ
913,002,276 *5F065E6EED9CC6D8CE72AFCA75F181D1908B39D9 GARFIELD.KELEDJIAN
913,002,277 *5F0AFE5D6C27FA11A48FE9A53001F7CF6F049349 GARLANDBEETZ
913,002,278 *5F04E31D885DE0D8219270F8B56F6F6BF81236C1 JPD77GC
913,002,279 *5F08DBD35B6C62B605830C83A4C6AF6BF2F689D0 [email protected]
913,002,280 *5F0EA6087DCF4C3A508F5D4AA0E715B99EA8CC3A GARRYSTEPPELLO
913,002,281 *5F06A9FF4E17BA07E74E3017791E8279F5F3BCB2 JUDESALISBURY
913,002,282 *5F0751EAAB28F5CDE0806E891A35B8E56D8EC34E gay=
913,002,283 *5F0926285C3FDFEC5578665182DF384BFAEC34EF k{^
913,002,284 *5F025A1B76DCEF2C3A1504791271ACEA70BE10D6 genarowidick
913,002,285 *5F025FE0D1FA9BB05B891F0316BBC99F9125B612 GEOFFREYROUSER
913,002,286 *5F074C4DAD1089990F5FEBA4CA97A108750215A5 geoffreyvirgen
913,002,287 *5F0BE800F3E1D1C425E3C388C6109EB10DC63BB0 KAMPSSCENE
913,002,288 *5F0C9C212B448362DF463253BF384847D173460D KAPIL.VALECHA
913,002,289 *5F03894667C59C534453748069737B0ECA8748FC kareemjame
913,002,290 *5F0FF701F47E41C0C7A9C70E48C61A6F8D28B991 KARLCHAD
913,002,291 *5F0C6822A4B8C89069DB74FB9A7A903002ADCB21 KARYSSABRETCHES
913,002,292 *5F00249ADAC330277C03525FE32055FCE758C603 kayabachostation
913,002,293 *5F08BC92B0FE831C33066752E7F50E93F41C2709 [email protected]
913,002,294 *5F039A0D05868945F30C7A9A94851625C4C53967 keep.on.pumpin'.it.up
913,002,295 *5F0C75F73FEA744703D7DD6B4DE44D9725D5DF9A keeropkeer(loopmaarnaardemaan)
913,002,296 *5F0476A4B1A72ED6149B502069327356D738721F GILARENS
913,002,297 *5F02BBB110D19924C0E3B24D42DA10F7B18C695D gin
913,002,298 *5F0FACA4FB6BEDE95EF059F3AFA41D0730C1AF76 gitlinjhih1tlih0n
913,002,299 *5F0108EF7507683C12E6ED453F7981BAA7A1EF83 GLOREENB
913,002,300 *5F04334BE340934B590EA7BA10EE08E7869CFAD6 Go 4 Broke (feat Real Spit Ric & Dodi Phy)
913,002,301 *5F0FDF5A8793E6958477C2377E1AD3E323CD25E5 KIRBYTOUSIGNANT
913,002,302 *5F0DE7BA3BDFF0A78E6485E52CCF5DF1D2047C04 GOLFINGCASTLE
913,002,303 *5F001501B5DF02D3473077DAC55A141567F8E33B KNOLL3D
913,002,304 *5F0FA92D34B4B47BE7ADD4F321526C519CC1F07B KONIGSKI3
913,002,305 *5F0A89B05F35F6E2F1E37F69E70ECF838E7582F9 [email protected]
913,002,306 *5F0A6A05822A4EFCA1943824AE4081CE128FC2B7 KOREY.JAROSH
913,002,307 *5F03E5702435DB149EE2F9758DF41D27636CDF1D kovaczemen
913,002,308 *5F0E269197D8CD1F78E48654BD758D20C58AB6A9 GROEISTUIPEN?
913,002,309 *5F0642E507E72BC730A0CEB7E134701718CFD60F ksjunja
913,002,310 *5F0C3EFAFB82DD353D1B5015BB8723988819B18F KUDURTAN
913,002,311 *5F0585E6EEBCA3838CAADD66FDC3383AE1BA9BE7 KUJEELLISET
913,002,312 *5F085E6A26BDC2E87F5D721998B81009EFBCADD2 [email protected]
913,002,313 *5F02A5654E212D766A769BB469DE5DC1B621D7D9 kvitvika
913,002,314 *5F070BDD5393EBB605EF7555239335B9B2419582 G%?Z
913,002,315 *5F0067B9C78CD304F72E22931C4274A28BA02147 (KYOSUKE NO 1)
913,002,316 *5F059DE3F77076D683C2FD5E098C79C822F0F864 LACOIAM
913,002,317 *5F0E70D08352971BF300A279B9C816AC9DD10C7B LACY.GLOVINSKY
913,002,318 *5F084A2CAA0E3C4DE9AEBE9BB285A9B6AF7E12B8 LADEEOFBEAUTY
913,002,319 *5F050C942C03F044484303A393030CAA9575F946 la-favola-d'orfeo,-act-i:-ritornello:-alcun-non-sia
913,002,320 *5F03854F8AA158D8E547A202AB1BA8FD81A615AC LAMAR.LABIER
913,002,321 *5F01F4EF80B4485850A6278D1ADAEFD4261756AA LAMERMAN0
913,002,322 *5F0EF00E2685F749409439D9DCB49ED33B330E19 LANDONSCHWALLER
913,002,323 *5F07E24928F093F309A0536F39E757DDD7E4751A HALTBARKEITSKOEFFIZIENT
913,002,324 *5F0DC777FCF96E12AD352940F8277EE129EAB8EA HANCEL05
913,002,325 *5F0FDAF66ED8479270A9655E948C060BD4C4FABE L A TISZ
913,002,326 *5F034F1021F3E07DB2D81E4D3C605020AB20A3FC laurenessig
913,002,327 *5F06DE5C089C333CC3C5BCF1F7ED8A9B3E0D371D lavernesirpilla
913,002,328 *5F04E7D9CC0D6B264104BF74D27DAC59A866E327 LAVERNETOREZ
913,002,329 *5F098722AEE65BCA338289FBC70A115222E77699 HARMLESSA:
913,002,330 *5F0B1F65EFEEE8D3C5BFEEFB8E1A8F6468397149 HAROLDGOSS
913,002,331 *5F0F269D84FAA951C8301B0FB36EEA2713A27199 LEANDRO.NATIVIDAD
913,002,332 *5F08EC8AB49FEB66BC06F7F7C8F1A71344C4899D LE-CHAMP-SAINT-P
913,002,333 *5F01C122ECA6E14BE918BBB6F75E99E91043EB76 ledepan9
913,002,334 *5F0D164AF9A2614CA96473FB78625393FB0DB362 leichtester
913,002,335 *5F0D26917B0A283FD64DD4A066F48073D8EF7450 LEIGH.KLAUSNER
913,002,336 *5F0B8668310126DF7E0011ED3F2A532BDF48C1A9 hcarbnie9
913,002,337 *5F02ED9EB8E292A702CD48FBA67B04C2CF9110B6 leotoons
913,002,338 *5F0D66B86687975F51FE091416F1BD3360CB4470 Les Souplards Torves & Pascale G
913,002,339 *5F013DAD539E424EA616B0E01E0875F682E354CB LESTER.ZLATEN
913,002,340 *5F0AA5DDA80780E79401391A8B154632A68EB3D6 LETHIENTELECOM
913,002,341 *5F020C1089E1417A2FFF349A8A04D236ACD06994 helpmebobcat
913,002,342 *5F0A2876624AFB16ED063D0486E418B26686F111 LIAVARTROF
913,002,343 *5F01F89FD95A27D156FDC0A26F034E2957C799EB HERBERTBEACHAM
913,002,344 *5F086032DC82A28EC71E00930216310377344164 herbgitting
913,002,345 *5F0D776B011A3C6A9FEE27CF2A102F9CE6468CC6 lickley6
913,002,346 *5F0F13045955978B3DBEF4F3F9F1CC9EDCEFEF66 hfh\
913,002,347 *5F0234C65A1A8AD2362B03AF59E01FA28741055C LINDSEY.DUPONTE
913,002,348 *5F0404190E5A1B5D713ACAE5029A1D5AFB6B97A5 HIPPARCOS3
913,002,349 *5F0D53E2B734C917B473F9CF4454F74D4CEC0917 liqubsw5
913,002,350 *5F0F77C17E3FF40D9469719D71583EEF45CCC391 HOLLOWEE4
913,002,351 *5F0C46669A84BD97F00809A296CFB1359F955939 holly
913,002,352 *5F0ADE5A89E271C19EC2208DFB3C68A72C505716 [email protected]
913,002,353 *5F097B1339FF70D4D06539F4E1F7CF6563879B86 LOLOTTE9
913,002,354 *5F094F0C4BC0F761B74B8DC08A8C858BE4D955C8 [email protected]
913,002,355 *5F073475313A3B0DF43268054C0F4EBD9E5D3FF3 houstonbobseine
913,002,356 *5F07997F8FA9627F90E6066EF78F5E9F97CCA003 lovickie
913,002,357 *5F06997EC4F829B24880F64A6B4614F360223E41 [email protected]
913,002,358 *5F07E7E72AB329AD958C4708BC925BB82F0F59CB [email protected]
913,002,359 *5F0CE0D1FA288EA4DD4AA47CA60B279ACBE2688B [email protected]
913,002,360 *5F0BBE2B7CA569887776D2D7A1A1B7A8AA946DB3 HUGOWEIDIG
913,002,361 *5F0B47DB4A1700E3D50081E3692713CDFD0D19C3 HUI.SHIEN
913,002,362 *5F0539CE9E2086A2D2CB498BC4DBD705B3D3607B HUIXIA-ZHAO
913,002,363 *5F06F6599623DF3B6DFBFCB4D67E2473E5B46283 lvoce
913,002,364 *5F06AC054A2D5FBA070DA074F53FE616126F023C HUOHEREK2
913,002,365 *5F0A76E8747054E66026A7DF7A1DC5DC359250FB IAMCOUNTRY1989
913,002,366 *5F035497ECBB243356B1860FF988B3D8D12716C0 IARTREVO7
913,002,367 *5F0574199A2DD318D389462FF5F7BB43E1423DFB ichild
913,002,368 *5F040B9B998FCCD99A39B4658B04132A0736EDE1 IGORCHERTKOV
913,002,369 *5F0B1AA4C4185CBD1387693B232C7EBDB0BFA898 I.HATE.THE.RED.SOX
913,002,370 *5F0A725C6A0894F389E52F6D61C8F652A7D6C2E6 marco-maddox
913,002,371 *5F09653E9F203EEC963C75441DF6D566CE3B20B5 MARGARITOVANHOFF
913,002,372 *5F0F1799C9B6922A6297407A1988A2A28809560C MARIA.DEPPING
913,002,373 *5F053FC33B1F5D4DE00347BCB4106C3BD67460A8 [email protected]
913,002,374 *5F08EB5559FE58311A533A8F20856B6D45981FB7 MARKUS377
913,002,375 *5F0B4A94F6CD5622955016E0DE4675217EDF3B24 MARLINBENTREM
913,002,376 *5F01AD437BDDAB4CF89F209CF34693ECE740F3D9 IMAGEJPEGSALTON
913,002,377 *5F02EBB9FE469635E34C3A7B4E88D8F0EA5C95CE MARSIEAED
913,002,378 *5F0719190F0A8F43303425D9BBE0D0734EC02037 imagisms
913,002,379 *5F0CB0015E6024F7D4F13A4DD7B88D30C58E07D9 MASONKAPANKE
913,002,380 *5F0EAB762F25A9A5BE589C67B73C790BBA184AE8 INAMENE3
913,002,381 *5F0AE6091B6BD1D48C0290EAC27B2A3F256440A4 MAURICESCHEFFLER
913,002,382 *5F0B0FF9C8FB9908A7D0B1DDDD52DC5DED8501FA MAXIMUS589
913,002,383 *5F0CBCBD5FDB9D777476FD3B9330747B23B87DE5 MBARRAK
913,002,384 *5F04316D6E2587148171893D22F78D6C811B3796 MCUDAN
913,002,385 *5F01E7B2DEBEC45189DD637B2AD782A34CF827B3 MDSADAF
913,002,386 *5F0EB61896E10AC2801D92FF2779A4A9ECC114AE ingenioeruddannnelsen7
913,002,387 *5F0896071A55D6B4EE6CFF08E3EE84A9C3C1E494 meinster4
913,002,388 *5F074F8398F4D621349B2A9E98DA9BC352EBF251 (intro)Saturnus
913,002,389 *5F056F1A68A163317FFA6F76D8E4732542043ED3 INVOGLIANTE
913,002,390 *5F0DE77ED73AD9B09703BEA6A2C980E90A974A17 MIASKITE?
913,002,391 *5F088431BAAECBE4DF530222E21B95B6B4A3E37B MICKEY.WOUDENBERG
913,002,392 *5F07696F0C4F8CAD54A3167997B9C5A424D36DC6 ISREAL.WALKS
913,002,393 *5F0C9C43077FD19701177892A9EE2D74E9C2F12E MIDNIGHTCHARLOTT
913,002,394 *5F05D8BA91D4D5AD591A169B2D831D1B6D490C81 i^Y
913,002,395 *5F0E8A6BB65D3A6B688180DD9D89F7F35132DB5E mjrf
913,002,396 *5F042C68201D4E6853433A003B7D42A092C49CEB japan-higo
913,002,397 *5F03131DC6E30FD3F9CFEFF01FE41FE6F91E6CBC jarredschimmel
913,002,398 *5F00207D28FB2DD0F35D8A802C1F863E18F031FF modestocodde
913,002,399 *5F03F44DE96DC96C29E775A88D4190751FACF440 jarrettmartos
913,002,400 *5F05ADC135A8193771425BD5FA06C72E2C02C75D mohamednoteboom
913,002,401 *5F0879DECF3F76DA4950A63F6526CC7E96621D40 JASMIN JULIEN
913,002,402 *5F09CB05941DBB1F14F7507B9A29748F32461D61 mohamedscivally
913,002,403 *5F0DF640E21AEA157BDBC544C044558A13CDF4C9 MOMELL
913,002,404 *5F037C68EF078448FEBFF51FBFF63E253898DDCB JAYSON.MCMURRAY
913,002,405 *5F06F8802502DEF4735A7C80D14415DC5160AFA5 JEDGADBOIS
913,002,406 *5F0D7AACA19B9BE456BA3A5C8ACCC03831BC8456 jeffersonmorak
913,002,407 *5F00A963B1E47CF3C98FF1A4F918FE330F11BF30 JEFFERSON.PHILPOTT
913,002,408 *5F0D9BC47681A86A662C4D880E4CB31B0BEF78CD JENNIFERGALBREAITH
913,002,409 *5F0E15EF3F74704C38503552FF24E78CCDA79464 Mrschrisbrown
913,002,410 *5F02146BEE49C78F2B3CB51AF347418D22B0652C MSILOHW7
913,002,411 *5F011A01A08371C1553FCD3331FCEED88992E5FE msnapple9
913,002,412 *5F01E1325330BE2E09ED53013BDCF828C7D884C8 mufinella
913,002,413 *5F03C857E0FDBDF65960FF6A50F91588E9E8BEDA JEROLDPFEIFLE
913,002,414 *5F000329658CD448652E4515B5B0FCE2492BE1DE MUTHUKRISHN4N
913,002,415 *5F0DB96B4FA03C9353AC3FD67859552C5D7063EA MUZAK4EVER
913,002,416 *5F0104998037C43FFC8AEBC27A1DF62CF9F56243 myleshorikoshi
913,002,417 *5F0C9C0F1638242A9F0B664F22A608CCCADC88DE mylondon8
913,002,418 *5F0A8F07181B472CE6F96A8D05E175A7DEDECEAF n190=status%colortog:{
913,002,419 *5F0DAEAC14BB0A65644522985FF284C6D11FE5AB JOAN.DULMAGE
913,002,420 *5F0CEA177AC53D1C94431D1E568EEB18AC2F5AB9 JOANNE-JOSEF
913,002,421 *5F045F9CD6EF03BEA9169C982B36E4556C6C70FA NAMSKCIP2
913,002,422 *5F0380F7A1B88600721529582C9089F0630DA949 JOAN.SPATES
913,002,423 *5F004130797F2022C85F597443CBCF2354EA813F NARCNARC8
913,002,424 *5F03E4EBBA7DBB5973A67134C0F89406DD009E20 JOESPHBRUSHWOOD
913,002,425 *5F007DA7AE59AACB7327FB6036FBCB2C28E8569E nateengel
913,002,426 *5F0140FA0EEEF8B58025DAAC878950655083A191 [email protected]
913,002,427 *5F028A411F8CB7D7B9D6032450C363EF723AD851 JOHNSON.WICKWARE
913,002,428 *5F00D34FA3107822338B51A5E6350324F038FE76 JORDIN.FULLER
913,002,429 *5F0E74E0471CC61C95881D688110E5E4438ABBE7 JOSEPTHALL-2-0
913,002,430 *5F0086EFB0A993A174F0F12CE32A3FF1EA560858 NF)8XH
913,002,431 *5F0722A402898A10661DC0DB8FD8D802052BCB3C NHAMALAMBO
913,002,432 *5F0E10043052C5333DFCFCFB3B56B3812F1F374A NICKOLAS.SALLIS
913,002,433 *5F0AC5D8278DF72EF74E5ECDB6D6DD07267A6071 JUAN.HAMER
913,002,434 *5F039A136959FFDDFEF2F71426DAA78029CC8740 NICOLASRAULS
913,002,435 *5F0AF9BB9F011E383D5743C5FC956D8692E2BA4D NINGYOU.SHOUKAN
913,002,436 *5F011B76BBCCEBA8F0635DF138B09359895B14CE JULIOFREMON
913,002,437 *5F0C424E5A27A3898F96EDFF6EB9E3CD1A520598 NNEAMHUB
913,002,438 *5F00FC61048A6F625EA6085C0070B72AFAE09A77 NOAH.KALISH
913,002,439 *5F0550ABF4E58652C1DF249C4B7C3D47F1ED6D05 [email protected]
913,002,440 *5F0CC848AB1D723BDA5AEA015B8601B1F37491EC [email protected]
913,002,441 *5F08692BDE0D0090BAEB651E09297770EA4CF7D4 NONSCRUT
913,002,442 *5F0E2F153607F79AB7ED896743420D5639A4497B KARINATEMPLER
913,002,443 *5F05C90974C9B8F1E0D0630D97B32EFD625B6CCD ns"h
913,002,444 *5F03F37DBFD82BC3EA5F00136E47B1F8E86D4F84 NVIDIAPATCH
913,002,445 *5F07BD33D2B75FAA6F66B1AB0A4231152E837CE4 KDEGUIDE
913,002,446 *5F0B22C9DC08574C2BFD9B566BD05190AAB4E8E5 kedinbbs
913,002,447 *5F09EC827D4ABBDE5A6D9A8A528C6AA89D2E012E keenanorce
913,002,448 *5F0CAF940E3216D7569ABBC8FBA36951C9DD9959 Keep Moving On (feat Sabrina)
913,002,449 *5F0F60E63E9A1A89FFA4CDD0A8BD8CE93C96EC24 }o{*.*.*[email protected]######3
913,002,450 *5F0E1CD09785FF9A281A0FF65553D3B004972326 KENNETH.BIALA
913,002,451 *5F0F8E619292B344D518E21FD887CCC6016928A7 OF.THE.OUTPUT..ANY.OVERRIDE.OF.THESE.MARKING.DEFAULTS.SHALL.BE
913,002,452 *5F01328CFC0716D63910315862F8217C90A74FD9 @#OH
913,002,453 *5F06EE6227879B52D0B9075784BBA9416C2F41B2 [email protected]
913,002,454 *5F02A18CF28E2A057AAD0F20E608CA4A1D0A3F66 KHODZHAARYK
913,002,455 *5F0B0E92006F152CD8D85CAE9CBC0A635A236BFB olenrepka
913,002,456 *5F0C12C5C35FF90B3A5C84353C6F27F39E1ED082 KINGCORPSMAN
913,002,457 *5F0E04C6F26CBC54E3F1536C4F939D019F23BADE OMER.ROLSETH
913,002,458 *5F09635D76047A8D608395FC46DF40A342E29187 kises4all
913,002,459 *5F01C42134D42EB7A74C33B165FCB605DCE7BBBF [email protected]
913,002,460 *5F0F5950CDA804D8A6939D67A7252D3076C92754 klazen6
913,002,461 *5F07FE785EC88149828E5025FC11CAC6C9A94DA2 kochenk-7
913,002,462 *5F0A140FA4A1B6207785F82DD103A8964E9A9F00 KONVEKTIONSWOLKEN
913,002,463 *5F000120C1B75E2371641DF9BD6F3BD142858A51 KOTSAYS
913,002,464 *5F030C5DBAB850C0B56FCFE034831ACB2A7F3615 OSOTIOM0
913,002,465 *5F04159B27A3600B467CABB2286F20A91482FF32 koze-15
913,002,466 *5F0ABEDA8E7B92D62B720F4AF2DA67BACDD10BD1 O-THY-VILE-LADY
913,002,467 *5F09402E69E956873C267B80AE1B9CA3ED3D008F OTTO.SEIM
913,002,468 *5F0E86B17D517D0A4420F199F814AEB7A0BCA49F ÒTÙÁ
913,002,469 *5F0DD81FAF5ABFEF5782E39F616A28EC588B2CF4 OUTSTRECHED-HANDS
913,002,470 *5F01E235E3317072345C16440B28D3493FC3BDEB KUDDESH
913,002,471 *5F098E825B30FA21F1C3D73BC0648DD8AFA12151 KULARATHNA
913,002,472 *5F007003FEFD8168E52158C7FE79602B33DB4EDD p====> ` (>_<)
913,002,473 *5F0EC97AAED51B886E9A2248DD05C861DDD89FB3 [email protected]$
913,002,474 *5F0B0EFFA3E426D4716A93307D7185A6BCEDD484 L84+0NS
913,002,475 *5F0CE6400A3DE28DEF751862531A29AAD1DAFED7 ladyb!rds
913,002,476 *5F0111D479FBC84F09E5A7981A5A9E47BCC69D1B la=j
913,002,477 *5F0A60C292CDE3A5803268BB10DB5ABE23C09AFE lampri2293
913,002,478 *5F02E9FAF0AF3723EA4E1D493133E0FC73AF8BCD LASSENT2
913,002,479 *5F03F25DE1228A556E2DB0642E296CABA82CAAFB LAWAAIIGE2
913,002,480 *5F06576E78CDE0DC734D29DDA74837AC75DCD62E PEROUTKY6
913,002,481 *5F042D44702017A5E50EFD7EA8BEB811433949D6 LE.TOMBEAU.DE.COUPERIN:.IV..RIGAUDON.(ORCHESTRE.DE.PARIS)
913,002,482 *5F055C3BE25FEE5AF7CBF14D62DC26AE79C1A52E photoladdie
913,002,483 *5F0E7800D1300A3B2AF39BDBE7E45CD42512A0DC liddle
913,002,484 *5F04F7468166D598169039ECACFF61DE28EB70D3 [email protected]
913,002,485 *5F0A2BC039A684D4A134942ABC343D206D6052E0 [email protected]
913,002,486 *5F0AABBBEE6F9D4810A50E2AF6D21F7BD80C9685 lincolnvought
913,002,487 *5F05B47D42BA5870B58BD930C641DF5D2E2C49E4 PLAYPLAY
913,002,488 *5F04745D2E2574A33FD9C4C3633FBBF889662795 PODUPRLA2
913,002,489 *5F07E8E8957FC88D30180E91397D5F58A2A68BDB <LI>THE<TT>REDO</TT>STATEMENT
913,002,490 *5F0413FE86CDF82AE04232ECA70BF9118ECE2D2E [email protected]
913,002,491 *5F0B1328529ED9B58D14C986BFD646ACC3F9B67B Pose-ton-gun-2
913,002,492 *5F01C24DA46428237542E8DF49FC7B84D0C84A8D POSTLOGIN1
913,002,493 *5F0C7265DFF35E052946E0F11AC04851BDD4913B [email protected]
913,002,494 *5F07CE025777F10E79F0ED9D6D8FFF94D8895F57 lolaogundeji
913,002,495 *5F0B86F1221A081A52185B1E98A1D34EBAC34150 progressivitets
913,002,496 *5F0F5272AA027CE0ABC50B2D2A1AC4EAED9F64F2 LUZZASCO-LUZZASCHI
913,002,497 *5F024D264D724187AACC876E272A8B9EEF0C3CEF * * q======b
913,002,498 *5F0ED6A50FA44C4CC24D5702CA8112997A45D771 QBFDCFO72
913,002,499 *5F0EB47C964F6646FA7E7BB8EBE405CC661E5B87 M4SDUR
913,002,500 *5F014600C024C5013EA932B7E1FAC879E7275DFD M75410
913,002,501 *5F0647574FDD5768D96F3591279716AA96C7077B MA9NANM0US1Y
913,002,502 *5F0714A1633F1C0F366F3DFE8F90CEB3A95045E3 quandt'esdansled
913,002,503 *5F05D8D7C1D2D3BE5FFF9EEF06E761D00834247C [email protected]
913,002,504 *5F02E34E660D17F9C9D50D52870648C95E79A329 MAMMAS, DON'T LET YOUR BABIES GROW UP TO BE COWBOYS
913,002,505 *5F0EE565EFCBD7B31CA8FD37BAC20346D44F46AE r30rd3r1ng
913,002,506 *5F089C4391C41BBE7919C4906CB71249BEC9D439 MARC.MORTENSON
913,002,507 *5F0EED5B52816116C1CC4FD872A45C5721CC5A92 MARCOPALOMBO
913,002,508 *5F03004B32B4BE105501018DFAFB82370B6A6A53 marcus1974
913,002,509 *5F0EE7F13A04963FF297EA426F2B3DA3FE2DC492 RAJUELAS2
913,002,510 *5F02E4A5FAF3F34F9A5A345C03AB5C386A82527A MARLBOROUGH EYE
913,002,511 *5F00B2EC7A7F2E719E75FA7BC36A0DAA3CCEF89B RANJAN PATNAIK
913,002,512 *5F0CA4676BF1CC57BF46C0BDE4515A3ACB63BBA4 MARPLEMARPLE
913,002,513 *5F07AEB56EF053FDD3F778E81106FA7EE2282793 raschiaste5
913,002,514 *5F0CBD5963D7532602FEA48BF2B83865F48BC36A MARYANNWALLACE
913,002,515 *5F010491C3CFABCEDB63BAE25FA3455E8550D7BB MARY.VANHOUTTE
913,002,516 *5F051DCA3D3871CD8714E20CEAE947C967184412 REAL-ACTION
913,002,517 *5F095967540BEF211EBE50BEFA5DBB72AB011C53 reexpansion
913,002,518 *5F0BEBF350A8220D249566B03A4F42854E5C2E6A [email protected]@+e
913,002,519 *5F0B8C94FA60F98A95ACF6AEEC3525B98F11FA8B RESCHNELLLEBIG9
913,002,520 *5F06F4FCB3D8E3F96A160890F4CC0BA1B04C29FA MERRESVY
913,002,521 *5F017E6E3AF4DF2A2B65F7C81D3090BD7E63BBF2 RESHEEDA
913,002,522 *5F0F80ED27B7E60F62B826426BE67CB22A6AAEE6 METALGUIDE
913,002,523 *5F0D4613F9D605463AAC60C2647E60CAFAE9F0E9 RETORINIŲ
913,002,524 *5F0C0085B2FB8BD4637DE99FE3FCEF7BE724FD01 MICAHRUSHE
913,002,525 *5F06F00ADDBC20A139CDA246366D2DD787C8F711 MICHAEL.HULING
913,002,526 *5F0907F9C6BC7B9C57E866A214D8C4A109506D19 rhona.phillips3
913,002,527 *5F078CB381A5E2B855844CFAA3952D348D7A89F3 ricardo-ancheta
913,002,528 *5F08EDF5704CBDD75B95379B57805DEA72570708 miketessalone
913,002,529 *5F0DE3DCC68947C1F69B31BF1D5495CD0B30BEF4 rickbabic
913,002,530 *5F0F82CC686B8D044AF7415AAF47F667141951CD rick.thibodeau
913,002,531 *5F082331C4280D91C3D812A209A8FCBA24B8A638 MIRAEHAB
913,002,532 *5F0FCB31979E05F1B0AB8914EFB5C41661D7E0DD misrak-alemu
913,002,533 *5F09346117240A0110175D1FA73E2B274C8D5105 rileyfactor
913,002,534 *5F090627606232868C803F35D237375A51E0C136 MITCHEL.KOPF
913,002,535 *5F0B9AF4106A67467C34F5B7A87864DC267F6050 MITCHEL.SAMBOR
913,002,536 *5F0C5897A09670E3EC80706AF9D545179B1E1F0B [email protected]
913,002,537 *5F0B2F338C67541FCB37FB24B1E5FAB33EFAAAF4 MO-ANITY
913,002,538 *5F0168FC8022257370FE856B17033C7AD35814E3 [email protected]
913,002,539 *5F0ABE4D465E654B9E367259ACA267220C435062 MOECOT
913,002,540 *5F03D18D510369DD9E60D97421288D2B7149AF77 moiseswasicek
913,002,541 *5F06A8A7A30BF91B79B5D12D540D086C6D26E952 montagnebuissoni
913,002,542 *5F077D69CF1C407BC504AF195636E74E36F55177 MORRISSCHEINOST
913,002,543 *5F0D901B77C82581EF615CA37962649A1EBACFF7 MOUDERY
913,002,544 *5F03C66DFEAB42A553083FE17D2B7B6B4DD89085 ROEIENDE5
913,002,545 *5F09FB875CFCBA4133E7915704CD4369E75F0984 ROGELIOSUTTEN
913,002,546 *5F08859FF5CE181A22BC876D0DA50EE0507A48AA rokota
913,002,547 *5F01E309E900D41757739804B1C6CDF7A712D501 rondel.john
913,002,548 *5F02F206B9E2E429A92AB4E76936BC348B7309DE rosalind nay,butthedeviltakemocking:speak,sadbrowand
913,002,549 *5F02996067488BC9DC2374B5EB71D1A9CC30773D ROSCOE.FALCE
913,002,550 *5F020C3F8D70F03C8F08EA13439A8AE0A78023C7 rosendoharriston
913,002,551 *5F00BCB4FBC048F2DDA3F34FEBF9AB63C9477E41 mylondon8
913,002,552 *5F0360238748D0A497BB3B9199B8002A50E482FF RTUSINDFEST9
913,002,553 *5F056898CBD360F884DA5A05ACC0D340617B84DB rubiò
913,002,554 *5F03D6C2DD8EE011E3FBB3753EAAD5EBE7D3774D NAMDAEMUNCHULSIN
913,002,555 *5F0CD2B8418A727A1F955E6FFE7FDDA29EFBA602 náměšťském
913,002,556 *5F0540D70FEA07778BC6C4179F2314733879000E NAPOLEONBEYDA
913,002,557 *5F00E368A7F3177C62DA21102D227259675B7B59 nasute1
913,002,558 *5F0725F960F24E13AEC7B93A7C747D189B6D304D NATHANCLUKEY
913,002,559 *5F07CC8B1F06DC508D052019E61CD5E7F1F6F95F NDYABNICKELII
913,002,560 *5F0F9C924D421DC11A7BA6CCE1D0093E62BAA82B nealtatum
913,002,561 *5F088B07C1EBE7B2D3DE2D2222082DBF22C63458 SAHEED-USMAN
913,002,562 *5F0EDC2BECF3B26BFB54CC4D5C3235354C9695F9 sailing-for-adventure
913,002,563 *5F078507FF1B65143AF3990F8A58D6682D517995 NEGNILLE
913,002,564 *5F0CF38FD63D0EE017A9006223EA6C58845B859D sample-documents
913,002,565 *5F0CF3A26B33934173511AA679C2005F3A6B374A samueldellaripa
913,002,566 *5F0D260C9DF79B93F8219421EDE43E48D85537D0 SAMUEL-LARA
913,002,567 *5F0A1DB91F71F4988544052217505132E3CE86DC nesselthaler
913,002,568 *5F0480CF5F912E14AA83542301AA2F62D6CB7426 san-sebastian-de-los-reyes-madrid
913,002,569 *5F0688585B74E8FC76E26DFC62DA100B91CCE2EC sapnai(feat.charli)
913,002,570 *5F0725DB7ECC7CA6612CF43EF35D9E689DDCBF56 SAUL.MRVAN
913,002,571 *5F02DFCE5A4BB483BB9F69CE8868E6F9861FFAB1 sauteing
913,002,572 *5F0949531FD96EA46987B653A5249760FF844CDE NICKOLAS.GOWAN
913,002,573 *5F0C2E48DD9936787820F0CAB32CCEED71B777C8 SBS "MUEVE LA COLITA"
913,002,574 *5F0F0562B68F164427B628E66452C8F556CFB831 nick.soderstrom
913,002,575 *5F07F654E122D00F4FBE7C3F830015D90E795FA8 NNS070808
913,002,576 *5F001DBCA250A123C998A3E32AD78168585A7893 noebrewton
913,002,577 *5F055664D028D217B22813C9C5E7D3D994A4C4BC noelgeoffrion
913,002,578 *5F07C2D9869321D9910F5ED7872CBCCA830B739C SEEMANNSFREUDE..SEEMANSLEID
913,002,579 *5F05BFE0013960BD4110D3B68F632C4772F3421D NOPONEN6
913,002,580 *5F0F4390A2A15BDCDDF39F97B133192F6F158963 NORMAN SUTTON
913,002,581 *5F0D48D69257B3E5F97BDE989B2ACF11F13378C6 NORSUPYSSYLLAE
913,002,582 *5F08203D468BB1D7B5B38BED98395DEE301E4596 nothing'sopen
913,002,583 *5F089A14721AABE28109E9B4E675752AD3726D12 [email protected]+1ON
913,002,584 *5F0B1577F002C36DE763383519CA0A234F37246B SHARPIESMY
913,002,585 *5F0E4E07DCC3AE2D6B174414D026BE91E56DAEA9 shawnrelic
913,002,586 *5F0CE210B1B3516D3CF49BDAF003D0F7DCFF59BD SHAYNEKATTEN
913,002,587 *5F0B7F0D8E40683ABDF0B10E03592198A1091817 oe'n
913,002,588 *5F04383EDE4736A35C630AEBD9298F2B681BF240 SHIRETSUS
913,002,589 *5F0A22FEFBE03115E3EDCE20BEFF4B12ADF314EE OMBILDA0
913,002,590 *5F0FF06EC25F01459CACE2DCDD16EC84B4BEF224 oN]
913,002,591 *5F048CDA74A324EC33092ED91CB966A2994A0DF0 SILVER.BOX.(DISC.5:.OUR.SECRETS.ARE.THE.SAME)
913,002,592 *5F0A835EBC7E5EE8D5C7BA82C9D31642A9D1AB8B )O(`@q
913,002,593 *5F0E34FA6E12B73DCD4DC0486801469AE05E73C4 organisation、egao)の監督の下、
913,002,594 *5F0AF505995ED02510A8DDFD3CDC86174D428ADA slow.me.away
913,002,595 *5F0BC20421E18889FD0762C5F834AE95A9DD611E SMÅGREDENDE
913,002,596 *5F0807E329A7D7CC2F2E4F7C0FF9BE7BB3B14E37 ottorrino
913,002,597 *5F06CBB539F286BE68431EB0B3F9BBECBC6B1CB2 smudsigts
913,002,598 *5F0DEC138019C4C20BB210AC87B9160673DBB423 PAIN-HAS-NO-BOUNDARIES
913,002,599 *5F03522A4DFCD7D8B8C6DA090959431383FE192B SONNYMAN8
913,002,600 *5F06415C1F17D09C68CE7B6F0764C1F7124C1C46 paladinbubba
913,002,601 *5F04619831729531EFA2B0D081781DEBF27298FB SPEEDYJUSTIN
913,002,602 *5F022E033A414E66A97A806BE92B1A78D995A6F7 SPILLERS
913,002,603 *5F054A768A00655E6B836DD961438195133433B7 SPLAT~ ~ ~D8
913,002,604 *5F0400DACD58F5F74801FEE1FA2A3B24CE022CB3 PAULETTE.HAYNES
913,002,605 *5F06F12579D7A618DB496BC76900BE4443C548AC PAULINUMEU
913,002,606 *5F0AEABB48559ACA9C32794289A8DF3D112E79AC SPRINGJASMIN.
913,002,607 *5F079AEF94CEFE5DBCCA9987BEBF6751C6E08D31 P######B-~O~oo->-<
913,002,608 *5F0307734BF3795F9803C1A5D2E77CB51251137A p-b`~.`~.splat
913,002,609 *5F0071D89F11D64901E802776A891F1C3756B327 P======D *)X(
913,002,610 *5F0905041F33911BF64A72E45964FD9BF515C004 PENDELBUS7
913,002,611 *5F0B78358A9ED65D495F90673E1C9FDF169411E7 STEALTHNEW8
913,002,612 *5F031647D69F8C2A161AAEDAA9DA4062B32FEB3D PETETASSO
913,002,613 *5F0F21B6D757868450A86D2507BC1E3C544B37D1 STEPHANILITTLE3
913,002,614 *5F0AF3F300390F7A87EECD71039B1739C0D460AF philinside
913,002,615 *5F090E5F3F450B3913E67EE6AFA5C4A6F438B2FC photophony0
913,002,616 *5F01D8D2FAC3D55ED259D989B586BE95EA373BE7 PLA!NCL0+H3SM3N
913,002,617 *5F086768C1EC408D3185B5491078178D498B3ABF poliakrylonitryl
913,002,618 *5F0F9769CEF52F1D5BD57E65BE58055546F5A676 SUMCHECKS
913,002,619 *5F01E43EB83DB39E2AA6BA059140BAF9422D7274 postbiblical5
913,002,620 *5F061CE24D2A7BA8635B2DF29F07F76B277C01BA tag.a1der
913,002,621 *5F0ECC82A0351D363D6D654DD655943E0EFA2636 ”psalmy
913,002,622 *5F057312A600ACD3A793A2C8404849448C138255 TALKRAJ.DESIGNGMAIL.
913,002,623 *5F0F175FE940A93AF9416C96588C27AB2179D2F3 P#@.`}X{
913,002,624 *5F03074A8C97D3763722ACDAFE2B29DF39730045 [email protected]
913,002,625 *5F06737673A2DF56B6B631E643B29787E463F9ED [email protected]
913,002,626 *5F0C617B935F9B0AF8FD2033D94ED5134EA98D3B [email protected]
913,002,627 *5F01B953260BA00A658973185CD13AAE9BB42C20 Q##) ~O~O UU
913,002,628 *5F00754073DE79A75E4665EB451B3C8578291A31 [email protected]
913,002,629 *5F08BAD9948358EAF55AB22084E0F0D98977ADD2 TEMPASS5
913,002,630 *5F01A70890C31E3BBF8DDFA7E23D929E89C11453 “TERAPIO
913,002,631 *5F0C459CDBF3A5F2547C067DADF4180E7438E81E TERENCECLASON
913,002,632 *5F0B1BBDFA66DD8164E35EFC3F1D3AAB01ADAB34 TERENCE.REGAN
913,002,633 *5F0FAEA9053761B06BF5499D08327BDD6DFD5086 terrygobern
913,002,634 *5F02F8DE93A32D0608ACC7EE4035753C72FAA8B4 R4MP4RTING
913,002,635 *5F0739B372FEB2AD2C3CEF3B3E43E0C8EC28AB98 RALEIGH.ULSAMER
913,002,636 *5F017EF4339E37371FA32962D10C4CA85C5A9306 ralphferrill
913,002,637 *5F09B687DE41E0CC1C123BAD12C412160197C29D ralphharless
913,002,638 *5F07CAA4D4E4F313AFF5226324E02F6C29CDE124 RANDAL.VALERIUS
913,002,639 *5F01362E5441352B04E53ED81548843C2B398CA0 randolphdestina
913,002,640 *5F0BA7F2C9FA97BBA7E4649991C7AD0BA6DBE4BD RAYADOR6
913,002,641 *5F04016EB6938BFD4D07558845D70B428CB515D6 theodoredelasko
913,002,642 *5F0DDC7780F6D1C46212EE89DA57E0962E888E78 THEPHALA5
913,002,643 *5F01FB4D0DFA1E4FA4DAA2FEDED9F33945BDB1C0 THE-RODDY-FRAME-EXPERIENCE
913,002,644 *5F0EB04BF513872F58A055575704C9B6264B6B5E REBELSJACOB3
913,002,645 *5F05F95CE6FBE69A28CBEEBC30EDEC11C0F59C61 REFUGIO.MCBROOME
913,002,646 *5F0BE48E7C6DBAA485CDEEE05673C071AC839C76 THRTHYNG
913,002,647 *5F0D65F17670F4C150C288A36FB025FEB85FE066 REILLEMA
913,002,648 *5F04040478F6513E73CD31C6865861DF3D08144B REINALDO.FARMSWORTH
913,002,649 *5F00D809263806B4552041CAFC6F2F2D2C6C3EB7 TIENE SAOCO
913,002,650 *5F09DF72079A1050CC12E940C307464B4AA224FD TITUSHINESLEY
913,002,651 *5F0B5A07B02E20E6A84CDA73A026F036E2939A12 tj)>
913,002,652 *5F0E1C4F8DBB56588D8868E11FF05AD6EBF91CCC T.K
913,002,653 *5F0CF73038D01EE13DFFB3E0800A7E57B98A7F79 tkqaa
913,002,654 *5F08300E6EF522A362B25C179674AB476D05D0A0 TNEMELLEUTCELLETNI
913,002,655 *5F0D6F7DA51E81D86758213B5CBCB357FB3B4B57 REVESTISSE4
913,002,656 *5F00B07D90ECCC740F04A4007DBFAF4074F63C08 TODD-MACLEAN
913,002,657 *5F0210D8A191EF0106E26A590E40207C15CDF4FE rexcaton
913,002,658 *5F0A0D8BE922728EC277BBECBFC011880043CCD8 TOFIELDIE
913,002,659 *5F04B293DD680A0EC7C259C0701D67DAAC4E7366 RHODZD
913,002,660 *5F064EBCAB48C42CC8044AD911A216AAA8A5277D TONNEAUTJES!
913,002,661 *5F09A33E8BE8A60D00F75AB9DB6376B38A4706C5 TOV4R!SHES
913,002,662 *5F05E3C6143AC596ADF0CE65446C8E9ADCC5073F TPIUKEBS
913,002,663 *5F06ECB4B236B810CED2A707E2060118FA646816 TQYJRSQPSIYG8
913,002,664 *5F0013460AD95922BD307EF2150A15DFDD4C0C64 [email protected])
913,002,665 *5F084EC4B750F2E8FEB67F3ACCE95ADA9F6C41BB RIGYHT
913,002,666 *5F055E6C5485DD8A3A30A23CEE4E77805F0ABB0B rinmen
913,002,667 *5F019FC2EE593E798A2372E47EDABAD991307010 RLASTXXXES
913,002,668 *5F0A58FB512EC502FE6EA8B8B50B9538EBE8944F RMUNCHOISEN
913,002,669 *5F0868F8A2FA81B58F3521CC98ADC403D909E2C0 robertoczosek
913,002,670 *5F0CD190173E93DFAB90C4320398453BAAFFC0E8 RODRIGORIPOLLET
913,002,671 *5F0C2B6AE844DDE43C4FA0667B5C2FF374784777 ROLANDO.LEITMAN
913,002,672 *5F0915CFD846EC8DC11B6FAEB305AEE869C582CA TRISTANNASRI
913,002,673 *5F0468D159C4689AD51C32DF30E74DE693748C85 ROMANCEANDCIGARETTES
913,002,674 *5F0656324BBE90896E9D6C52F67BC002FF74A5FC ronaldhaydal
913,002,675 *5F042B70B9DEF26DEEA52E6A49613C41CC05A28F RONNIE-POGUE
913,002,676 *5F07FEEB97B116A4BCDFBD46E1BD432282A3029F ROSARIO.SHALAM
913,002,677 *5F01B0F969B97EBDEDDA96DE5E1FF02BD0C782D4 ROSCOEGULLATT
913,002,678 *5F052D70B1FB221E4C6EFC4E6426986432E3413B ROVINAROED
913,002,679 *5F0F7FCF7AA42CC587EE360E4E1905AB2FFEF81B TRUNKLWATSWATSED
913,002,680 *5F07A2DA125BFED03722C9A206BEE3B6CAA0BF40 TSNSYYSD
913,002,681 *5F09C7F3475DFCD6C63948877FFD482ED5080693 TTOCSXOF
913,002,682 *5F008B6F331C582F35CA1DFDC2B4DB590C34C6A4 [email protected]
913,002,683 *5F095BC9162A9CDFB8955999DBEE05E6C12A693D RUBINBIELSKI
913,002,684 *5F0131E790B6D60F2CDE853257EB0A8DC2B96D47 TUNGEXBSW3
913,002,685 *5F098C57DA6403DAB0FBC9E9E12B9F9CA1D64263 RUSTYRESTED5
913,002,686 *5F0C41ED2F7C873A3EA8214E0B15C2059D3F96F5 [email protected]
913,002,687 *5F079508E50309E9924E6668822B542DDC46962D RYAN WEINRICH
913,002,688 *5F0D3913379774E72ABCDEED08E06F2402BBD9DC TYLER.NYBO
913,002,689 *5F04DDF39DB9A8554C6AFD262A66DC113B78C3B6 S7UMP3RS
913,002,690 *5F04842B86038F860F75E783FE8A5D2222401BC5 u{(aaa
913,002,691 *5F0BF8142ACBAB8FCCEFB33770F235EF12C0F974 salvatorezavattieri
913,002,692 *5F0D874B9F629ADBBE8A9E98C500F5AEED07BCA4 UIENDSHIP
913,002,693 *5F0A0266E4974B8CEB7F9C29AC6BD65EE5E5F3BD uitkraamed
913,002,694 *5F021DB33FC1568981DEE8C81E265BC9492AE940 U-M9
913,002,695 *5F0EE28461A134B9598E5EBEAE06EE050FD3CCA3 UMBELLIFORM1
913,002,696 *5F05CBA22CA7EB841CA400B41A114896EE990664 SARESOPE4
913,002,697 *5F07DF5DE002977148DEBC91BE29EE5515CB92C3 UNDEFEATED MC
913,002,698 *5F0B934412FD68F5D57EA0A6032DE716DA47B5EE SASTHÂ
913,002,699 *5F02C1663A3F8DFBCCC0D8191CB06DEDF6E65868 SATONAC5
913,002,700 *5F0C74B0FD3A7FA45C175BAF0EDFE9E6021CAA41 SAUL.BERDIN
913,002,701 *5F0ADF22A8020702CC0C29E8B82B9683A6C92305 UNFITTENING
913,002,702 *5F0ED4C8193D2DC56199E6BDE27E70843B7FC11A SBNRENAKIREMAWSB
913,002,703 *5F0B6FB3D71AE6B00384F6966F7137E92FB7C743 [email protected]
913,002,704 *5F07C1FECF87D217E35BF64034A9E79FA3999107 sceneiv antium.beforeaufidius'shouse.
913,002,705 *5F0DEFF53529F6ECF5BEEAF6FDCD6CE459C95EEF UNPACKRAPID
913,002,706 *5F07CB4843E900C0137296E78D697DB6E0F9599E UNSUGGES7
913,002,707 *5F04B0C45F012157071FF75FC2801B226B2E2455 scuba1psalms
913,002,708 *5F0B68032380A19232F5955C53A7C72676507D60 URSULA.GARZIA.GUYER
913,002,709 *5F01E6042399BD8465D7860C4B1EFAB78389A092 [email protected]
913,002,710 *5F0AE3AAAA604539CFAFAFBE6F5D6A05AF587255 [email protected]
913,002,711 *5F0BFDACDCD24E7B62466E087C80AE672B3E011A SEIAPRUS2
913,002,712 *5F0FCB29414835AEEDDAC01E06880288859667D3 uu*.*.*[email protected]
913,002,713 *5F0EF86C6B6F81C8D2BBA4C69AED66EC050FE705 SEMI-EXPECTED
913,002,714 *5F079E8BBC227231FDF41ABD9CC524EC4D508E64 VAIDRAJ
913,002,715 *5F0D65B3259F2F2CD9E009BF668C88C32B1D0536 valentinbaarts
913,002,716 *5F0B4D81B23ED2A0F61B6810C1311BC5A4F0424D valentinecornell
913,002,717 *5F0987AFF83C0EE02C5589775A10726F3B185921 valerie.reyelt
913,002,718 *5F06E8F68B983E36426C6C7CB616C9FE690E0E0D VALGHEANT6
913,002,719 *5F0198F222B5ADEF847B6ACF4C6747561FC65E12 SEXYBACK(FEAT.TI)
913,002,720 *5F0FFE3EB8AD9FEA928E719F1A21FDCBFA984ECC SHANEPHERGUSON
913,002,721 *5F05714C0A9F09E2A7D6FF15D545898A689C1995 VAUGHN.CALLARMAN
913,002,722 *5F0F622CE5F33E8151913AA4B79B9FD5462899D9 VDEBBAFNOC
913,002,723 *5F028E06B73FCC35B1654B01FE0D859E10D50522 sharon.livingston
913,002,724 *5F08F8FE50943FA94B24EE1F7AAAD2663D0BFA2B velayet”de
913,002,725 *5F088C993EC12FEED7C364B061BA50CB846AA2EC SHEULEYH
913,002,726 *5F0526FB9D95D57918D2068194B9B89834FC3816 SHIRLEY.BOYSTER
913,002,727 *5F0E60A2BAA7FFD8F008E3C84A4A5E474ED96F10 VERNITA-DAVIS-COURSEY
913,002,728 *5F095E0426EE6F72ED88FB5391F37896ECBAD169 SHUFFLEBITS
913,002,729 *5F03C93B525AD338138562870EA74A90FE3E5157 vianca.stutely
913,002,730 *5F07EC65FD5B802A91EF8F70CC7504CED251F16B VIBEKEFARSTAD
913,002,731 *5F08381A997099AF5602F87DA7655E03CC65970A VICTOR.SETTINO
913,002,732 *5F0C70972813B762A8B26A082126802B45E720F5 SILLICIUMTEILCHEN
913,002,733 *5F04198306E32A595EEE2EC8BC6DFBA52C6F8980 SILNINM3
913,002,734 *5F0FA6452A0182576B21C855A7C20591744A3EAE SILVIO-ZAVALA
913,002,735 *5F006610D1E4AE69EF1C87674CA1E8D8AEA944C7 SINBAD ALKHATTARY
913,002,736 *5F02D5B012CFA49FE65A3F0B12AB34F5DF2040AB singer_101
913,002,737 *5F0ED409058FF4D9108F54AC2B47F01F5B64832F [email protected]
913,002,738 *5F064E1B8445F5E57624873BE83CC62959EB49A0 VINOD CHANDRASEKHARANA NAIR
913,002,739 *5F0A1F897417463EB1CF1B959665DF4E5C198D83 SJIBTROK
913,002,740 *5F027AB14CB444254FA022177D494F80B906D806 virgilropka
913,002,741 *5F08A8F2300C90808F73FEBB3632DCFE6D81C946 SKETHARD
913,002,742 *5F0EF150D77DBAD72510F3F2DD65C1C495DCACD2 VIVINTATAK
913,002,743 *5F080C2E4362F97B5936B27B8A25DC8A8C8E1918 slowjamz(edited)(featkanyewest&jamiefox)
913,002,744 *5F00514044672873ABF0DB286D4C779A79F7DF8E SNEDNECSNART0
913,002,745 *5F065A1AC6908D1E07E912FA14E84480FEB4F172 [email protected]
913,002,746 *5F0B4134360D67780570C2CBEFB1C24BC8B8494A WAKIIGA
913,002,747 *5F0B1D9BE58793134784E9758AFDBB51C83F1D3F WALLYBECHER
913,002,748 *5F0F9446914FD1F53F2F2FB76B4D72F43C51739E waltdisneyparamoun
913,002,749 *5F02129999C6DE9D832BF365518ACF9A20A89650 SOPHIECHEVY4
913,002,750 *5F02A33B46516C2FBBB42DADFA4B87E5BE035600 [email protected]
913,002,751 *5F03C436F068FAD5FE0BF493A16113003241E1A7 sozialdemokratisierung
913,002,752 *5F094DB0D665CEE3827ADDCB92E385D05B9D2B7C warrenbinney
913,002,753 *5F07F32311E18B1F7B72E562079716FB5DDE6264 SPENCERRUSSMAN
913,002,754 *5F0CB6EACB4DEE21BF2AE1D8C8FCF13657BDA7EE splat.~.`[email protected]
913,002,755 *5F0ED7722B7DAE07DE2E1CF61242DCD9A9AF2430 Splat!*(###q
913,002,756 *5F00B8C5D45DB4CE5A5DD468DCC0B9E8F3794DE1 SREUEFNI6
913,002,757 *5F03BC4E5E46112A21B5472BE7620AA2DE12B1A9 SRT4
913,002,758 *5F085B3E7D933466B43E2631C596958C167BD01B [email protected]
913,002,759 *5F0EBA00D2B9AB5FA522D6AEFBB8F1060A7739D8 STACKLE
913,002,760 *5F009BB24754B294023EED1CE52A74F159A3E061 [email protected]
913,002,761 *5F0E03749A11ED6EEB7FE12A547672C705F8CFE2 wicket18
913,002,762 *5F094667FF7CD36D69071BFBA32EBFE80BB3E6E2 STEAMERN
913,002,763 *5F0E4228C3667D7B8FC736396A750A4CF4C03515 WILBURNSEMENICK
913,002,764 *5F03B1DF3FD48DC852CC662763958D350318561E stempelbeelden9
913,002,765 *5F05ACCC67B15325B80EC5655BB852BFDA279585 STEVEN.DOEDE
913,002,766 *5F0FB72D2E800067BD4BA9A342B9D4044300EE40 william.m.cousins
913,002,767 *5F0FE1B1949656CEA52CF0473C5759FAAE019F1A STEVPRIS
913,002,768 *5F0FD8547462FA56BF0591871C33630BA4709EE6 STRAßE
913,002,769 *5F0EFA8C5DDE497A38ED299D11B48BE3DB449B0C wimbern
913,002,770 *5F0961E1CF257EBC329EE2B2444735E2499F3447 withdebates
913,002,771 *5F070CBE84A0E86DC5F6F0E65AD2A64DFF6E9118 [email protected]
913,002,772 *5F0BE40DF23B3503C1FCEFE31E406C86BB3ADA17 WordsFromtheKrayo(featKrayola)
913,002,773 *5F09D0E06AF7D3F156861BE203E409E917FD5EB3 WOULDOUT4
913,002,774 *5F039740A212FA3E0F91D7D9D93438CC871691AE WPSVALUE
913,002,775 *5F00403F83E802A5A7CFD9A153F4B07F7C7DFFFA superlaborious7
913,002,776 *5F05589D3417CA29EF550F60B93188EE2104C2D2 WUFANGWANG
913,002,777 *5F0BC2FB75F82FF545C7BE61E8E56BD98B2091A6 [email protected]
913,002,778 *5F019D5493224C7D5B747EACA183ED765EE4572C wwwcorrectionsnebraskagov
913,002,779 *5F046D84332F5CCC178899BBEFC09B7F7D21AE5A wwwfakefacescouk
913,002,780 *5F00367D36D86E3A0EC3A2CFF9D700B040C6954C suzannabowling
913,002,781 *5F00EE44300E9C64405CFA2BBD38B4FC59D09793 sw-deutschland
913,002,782 *5F022DDAA153006B96B1E5D863442670CB3445EA xhig
913,002,783 *5F0BCC76EC981EBA4CE15CAD59D31ABE4C2FBF08 T+[!
913,002,784 *5F042EFC492A20788C6B7BC390B3457590672143 T254726
913,002,785 *5F0684F291F17230F3E056F9AFB22A4E1B0010C7 TAALPRUUV
913,002,786 *5F07C52242079B03DB401DFDD06223B0A8522CBE X[?N
913,002,787 *5F0AB01A4FCAE685EAE7F3ABD3A4E43BE4C8D87B TAEKCHUNG
913,002,788 *5F0CE5A83F50673905AB2C3E37521F742B4B110A X]TL
913,002,789 *5F0FC00D6376127EAA808B631C249A129A1ECB32 Y89634
913,002,790 *5F02A04CAE8DEEF6AB6ABF222D9C4E9A643C2BAC YAARON-CHALO
913,002,791 *5F0738DF90AFBEA276F9E3C9E085B62C2105290F [email protected]
913,002,792 *5F0FF79C2C1E4E2B3BB6A3E0405A59618620E1F6 [email protected]
913,002,793 *5F0FA83DF90E8A89ED499416B3F9CD51B3A6902C [email protected]
913,002,794 *5F0C31350B75783CB233C96FA835FC899390D534 YASSIN-TAG-ELDEEN
913,002,795 *5F07456931183780B3A08E4395AF98816023B67C TARARUTH4
913,002,796 *5F0E33CC3FD976F2888735B2557D2B80500DC72A taravello
913,002,797 *5F0ABB9D117DD6A3DD7BF995D9F19BBB5C849B80 [email protected]
913,002,798 *5F0FF12AEA4BF353989644DA5A84DB8DB2C6E0BC yc\v
913,002,799 *5F0FCB7059A7DFC3F576B74F88778CEB3A7887C3 yel.monceller
913,002,800 *5F0EB47F66A7A4BA2D10D74AED5937B22CBB376E [email protected]
913,002,801 *5F07F7D56FA59C67E413A9710232EC0BBC7892EE YLT
913,002,802 *5F08D892D13846FA94F0CC02BBE8625E7E0A04DF TERFELA
913,002,803 *5F0031CA778D39E60434D70EF8F817B51B9C07DE TERRY.EKSTROM
913,002,804 *5F0083ACA211644639D8DFD84F3ADB60E173FA97 thaddeusdapper
913,002,805 *5F044F4C6E4755A2E021AA37B9A5DFCDE1E92984 THANH.GIARDINA
913,002,806 *5F042D2A81CE67CBB7E757F85AB4AA7DFA4FBD59 YTIVRUC3
913,002,807 *5F0E67A7780A1F320D86097F6274809D21F6AAFD [email protected]
913,002,808 *5F0D61D033427602BF26AEB666A9AC6D3874B548 theaugur'stale
913,002,809 *5F07EEDC36EC995ECADB3D61A725E6BFCB650A40 THE.GARDENS.OF.THE.UNSANE.RENOVATION
913,002,810 *5F0C50623F77DF2A3253296CA8A6A846ADE62CCB ZANULKHAN
913,002,811 *5F0F6E3296B8DA8A86A82A4CD4E3AF844C8BD9DD ZBONDS
913,002,812 *5F09CE507972919BB754F7552EDED07893EF902D THE.SWITCHING.STATIONS.THAT.USED.SYSTEM.6.WERE.NOT
913,002,813 *5F0C1FBCDBDC45EF0EEF110C3E4CDCC925D72987 zhaofanfu
913,002,814 *5F05E147BBF8B7211FF6AC9CF2C34752D7AC82A1 THREADPRIORIT
913,002,815 *5F0E5F39508F5007E812B914D5564C5255456FAA [email protected]
913,002,816 *5F040FDAB125BB80F185446B1A18540A42C528A6 [email protected]
913,002,817 *5F0C70649062314661A1D9E60E86D51DD19B961B [email protected]
913,002,818 *5F085CA22F0704F024F5EAF4449FE078A9E5EA55 tigrestrat
913,002,819 *5F0944AAC3F4FC3A6FB46F8DBBC9FE8D6F7C8605 TISKIPOEYDAENS
913,002,820 *5F065FA924FC968FD01DB411982BE2A9B6876599 ZTROSKOTAL2
913,002,821 *5F06695B4296F199E8C535DC5F90989A24E0E8BE TKOTELES
913,002,822 *5F050A2EA6A06E8EAEAFBE6CE175704840AA5E28 zwiä…zkã³w
913,002,823 *5F0A572EE436021C3BB4F910108080633D6CB33C TODAYCHEESE7
913,002,824 *5F01F47B0F5C70494918049199A3B8E08B8EF232 TOMANDJOANNAC
913,002,825 *5F00B4B95170B11516EE8E2459557FB2D2E373C2 TOMCATVIDEO
913,002,826 *5F040BC893346C70E577D62565D76E8C41C6C1BB БЕЗДИФФУЗИОННЫМ
913,002,827 *5F0200B5D658869AAAD684F4134A0ABEA6A3F319 гоар
913,002,828 *5F00C535AB9516B56990787A20483151E49B4694 TOUCH.AND.GO.CRAZY
913,002,829 *5F0C6CBD3A8ADD9355E5247CB36E90F68A9D17B2 touchlin
913,002,830 *5F06AE8D71DBED461A4B23B0788FCD7FDF3B6DA4 КЕЗАК
913,002,831 *5F061A5CB433C14DB181E4DCF1512EAF5C289A54 КОЗОНКИ
913,002,832 *5F0D1CBDE81494EEE010485A3E32A6BCD715157B ляттр
913,002,833 *5F0B15DFD6A5EE199AEA05AF318404D2C0F18389 travis.j.kyffin
913,002,834 *5F04A2260390C5692304727DE77EF493A6930B15 trayceehernandez
913,002,835 *5F01B0231396A150720129F10E81959FE2AECE44 СТРЕНЏРЕЈ
913,002,836 *5F0C3AAB281F5FEC29DAD699773A666217C9BCBC trinadeacon
913,002,837 *5F0F4D8D34870582A2E177B2C0578286BE6C1948 TTALJAARD
913,002,838 *5F045DCD20514B1ED6BB3EF102EC8DF87A7ACBCB TUANHUSSAINI
913,002,839 *5F04434619BE3CC0898181967A649167E8710141  СТРОГОНОВСКИЕ
913,002,840 *5F068BA4E833A45D9F2B13476F3C5548088F31A7 TUMISHO-SEOLOANA
913,002,841 *5F016332CFCBFECE270DA3C0A473C027819C6615 turtlebigfoot
913,002,842 *5F017F2612A955F55A7DF20094190380274A52C6 UFULDKOMMENHEDERNE6
913,002,843 *5F0A60BF053941B74F27F01F0A778E6BAD8CA98A 』を開始した。これは家庭内の無線LANでの接続に加え、ゲーム販売店など約1000箇所に設置された専用の
913,002,844 *5F0ED0B18E9A9872AE19DDA51A7289703101CC0E UN7RAN$F0RM3D
913,002,845 *5F0EF18D13AD8235044386EF17B36944C7375A5D UNDROUNDRO8
913,002,846 *5F0B220EE2B49E3B97CFC0D570AEA00112F5DF28 Unsusceptble
913,002,847 *5F0494C7B725A09F3A86E30EB494982FCACD2899 Up-Against-Time-1
913,002,848 *5F0AE08F86CDE666CF112983AB5FD0D0E24CAAAA USERAVDA
913,002,849 *5F0E28FF8A09AB0FA2E266D60240CB0A3573F331 V\5B
913,002,850 *5F0ADC15478FE82B4848B5AF3491D0F5529E0FAD VALERIEHOLMES
913,002,851 *5F0EF5FD678EE804A61C492518180914B62A3615 VANESSAMARIEWALSH
913,002,852 *5F0B9A8530C7A779690CE7CEE887089D9CB1686B VELSBID
913,002,853 *5F030791468039D45C6C86D760CE7284E0FA4ED4 veronicajohnsondaugherty
913,002,854 *5F064EB010806A83C653A265DDB344FC0B5EF6A5 VIANES
913,002,855 *5F034C444DC9E24D89084826F8EB565E0C4439D1 VICENTE.BOEHMER
913,002,856 *5F066113B4AAEF581F6A06F6E3625120144676C4 victoreawoodward
913,002,857 *5F092D6B7A8A750202136F2CF986BF47C7797ECA VINTPHITNESS
913,002,858 *5F0420CAE385F50659D6E0DB6B59A4CCDDC375B9 (0-0) * *Q=P
913,002,859 *5F0653751ACFE45C370EB198868B495D09ED0E66 virgil: hey, i had to give it a shot.
913,002,860 *5F03518F3E3C63A5D737077092CCEEB1DA1D1CCB vitohauger
913,002,861 *5F04835F02BE97416CF0077587D143F8B5FBB533 04.18.1375
913,002,862 *5F03A6401D65FA0F0FD38ED01004D83EB2D063DD 06kwahaes
913,002,863 *5F035AF8BEE4D0C2662F2BE5F84CE5E936849AFD (_0)~`@======Q
913,002,864 *5F0A407FB3ED2D4AC8E8265AE72800D445D0A3DE 0TCR0PP1NG
913,002,865 *5F0C6668D100EEEF7D9D8EAF705F0C53BBD49197 VULGÆRT
913,002,866 *5F000FB3EC38EED147F514BD5E760D176AC953E2 1094124 KAIKKI.KOSKET.:.KESKI-SUOMEN.TE-KESKUS.,.JYV
913,002,867 *5F046B5817B9D820F94F09D6A4734B354241BA78 vzwhmlljw
913,002,868 *5F09C3618E43405D519FDDB4FC79E9DCDBBFF7C9 12:-12---#---&---MONOPOLIZE
913,002,869 *5F014E3FC2EA05E6FF129AAE1F3D9372BDB9115D walaaeldin-fahmy
913,002,870 *5F0A27B57EEC5DF4BF2D55E83B4D424224D25937 WALTER.PEATRY
913,002,871 *5F0321BA2F10131B81CD8995A924DCABDE98AE65 1351203 auch.das.kinderbetreuungsgeld.soll.steigen..
913,002,872 *5F07B29D562DD94B81A0AB13B23D397B2EBA99B8 137ELISABETH
913,002,873 *5F0E82A169DE3E4F97E048205B02FDAFB7BD6207 WAPPENFLYER
913,002,874 *5F0A7BF8BB500425593A4694F17C4AE20006B2EA 1496713 jos.pohjavesi.on.likaantunut.ja.likaantumisen.syyt
913,002,875 *5F095805C094A2D17AB9E5B1A06578B39F31D05E WARNJEAB
913,002,876 *5F0E7713ECA6B7A09EFCD4F8835A9E06FD7EDCD4 was.in.his.area.code...Lex's.own.board,.."Legion.of.Doom,"
913,002,877 *5F03196D3F411B77AF2D068F75AF1B20DC280506 1653contribution
913,002,878 *5F0A39F5E37F19E4031D0D857207C10014F9A1A6 1657586 ICH HALTE DIESE ENTSCHEIDUNG FUER FALSCH
913,002,879 *5F059D6DCEB05ECDF45A9587FC2560629C0140DD 17081805
913,002,880 *5F0926FC1881672E3BF29C9A70A63BFFD2EE751A w,b
913,002,881 *5F04B2574E4F23271EBE62976C1929FB53318931 WEATHER'S-COMING
913,002,882 *5F07A1CA6C0273BCBC6F133473A73CE077BDEC8A wegvliegs
913,002,883 *5F0BAF856A08A3FE7A33EE579346314FAAECCF19 WENDELL-MAST
913,002,884 *5F07CFAC8114DDA35FB135E5D3CB69BA0F908CCB WENDYMALCOLM
913,002,885 *5F0CC07329ACECF15807935969BB07AF698279B6 19SEP1656
913,002,886 *5F0EAEA78535BE88D396AC3522F8174834C77A94 WESTON.OCHA
913,002,887 *5F0D352A8C3F3A4E5B3CD9F9C1F6CE92DAFCACC2 1 ARGENTINISCH-DEUTSCH-FRANZOESISCHE
913,002,888 *5F0D5C51E0CDB098C2FF08CE5D6F9D848EA97F9F 1bekcisine
913,002,889 *5F0F854104C1B80435D3C091C0D9539B9588A29A 1 CALLINONETZ
913,002,890 *5F009382BDEFBAC08B15BD59771E42D34C23A4D3 wilburjelen
913,002,891 *5F0F31A22224DAD05B928BE57638892FC2C66822 WILBURNBRANNOCK
913,002,892 *5F06008D0285AC37531A795F55AF1F1218E30979 wildahubsch
913,002,893 *5F02DC7E12A1E9F1F162A15139B5D35E98A42194 WILEY.HAVARD
913,002,894 *5F0173D4639038E85E6A7A804938D8EB9CBF8ECE WILLIAMS.BRASSARD
913,002,895 *5F0515128889683F3641ACE5801146B22321AC59 1FASSBINDERURAUFFUEHRUNG
913,002,896 *5F09D8A3DA73468DCEFEAEB4F917CCB60A5176B6 1freizeitbades
913,002,897 *5F06F906906F36CB8DDE314D230BE35B89AFB018 winfredbreznay
913,002,898 *5F0DA3CD12144F031E504E0019773B677792F867 1.hitchcock-kimaranj
913,002,899 *5F0DA99E52B3BEC33D6A195986E21768D6029AD5 1-INTERNETAUSGABEN
913,002,900 *5F0944B841E161E63D4C147B173041DDE6BD03D9 [email protected]
913,002,901 *5F0C5FBEE0F4E41307F3EB74722FBB560F13C3EF 1 KOKLESMIYOR
913,002,902 *5F08B64DB7C54549D99AEDFCB6E6DAEC5237A0E8 1MENSCHENRECHTSREFORMEN
913,002,903 *5F0CDA3C0C80CF5992207BFD71517319AFB2EA3F workers-union
913,002,904 *5F030EE01017157C7404911E4ADF44B944181A6A 1-MYKI
913,002,905 *5F019E8DC00BBF5764397DD01ED4DE747FC8D08A [email protected]
913,002,906 *5F09E2A9DB18505A40CCE451567C156E00567B13 1.puusep
913,002,907 *5F0291EF5F79F83A5700EA616C7A95512ACB256A wwwinseefrfrnom_de
913,002,908 *5F015969ADA62E4035FD2BF978B2560BC628979C 1SEYFORTH
913,002,909 *5F05E94D112D6A11467E71966D9335292A021C4B WWW.MADRID.ORGDESVAN
913,002,910 *5F026E43FBC748D4AABB75F328238220916CC667 WWW.MIESENBACH.AT
913,002,911 *5F0285650051AEB8AFC24D41847BC8752EBB7F50 WWW.SAUGSTUBETORENT.TO
913,002,912 *5F0E31D76851F7AD214A1E4EB8C44F0460F89FB3 1STEPPOSO
913,002,913 *5F089E988DFEA12940BAE45FDEC6307D42DE22F7 1telekinetics-everyone
913,002,914 *5F042A4DF7E9ABCB6E69E30F8D4CEBE1256CF8FB 1.tessinoise
913,002,915 *5F09BBA54EFE01BCACC126EF3FE0A43BBA049461 1-URAUDU
913,002,916 *5F0AB81172D93D4DE04E7A2F8F34F04A8F7E1562 xhig
913,002,917 *5F02EABB5CA93F5E82A3F3A49B504F04D0042805 xqvbhcrshvjygshci
913,002,918 *5F058DF016260436843F4691A544B3AEAA9F3859 Y,%!
913,002,919 *5F083A447FB0719A6DA4EAA0BFADC7F35D0E305F 239266 TURKIN-SOTAAN-SILLOIN-L
913,002,920 *5F0279FEC11EC4CACE9AE5BA6769C050392288FE YCARCOMEDODUESP
913,002,921 *5F0D052651B46AD9349D1D61B10D58305FA4D165 YC+F
913,002,922 *5F0A9B71849D070CB478E00A154730ACC45B61D7 YLT
913,002,923 *5F06BC05C251479F8A1D3F3C472B8309CBFC0508 2.CAGILY
913,002,924 *5F0E226D67A28D7A292502332205821730043462 YOSSI DJAVAROV
913,002,925 *5F0B4794D1F49D7E90C691598EE56F24830F5EF3 2early-show
913,002,926 *5F04119BD60D08F38534943674C612BD87D960CA YOUNGRYUN.CHO
913,002,927 *5F0E4D371A2A3EC13C5A19DDAA5192A4A83C0A7E YS2
913,002,928 *5F030D79FA0433B64C2DFC9B1B34DBAB04466256 yuly.smile
913,002,929 *5F0524621BB8DCEA0FF46DDF39F311390E504BDD YURLANIDRAC
913,002,930 *5F0B1E9B219F312A9CF9C5A5235473DC1CACCEBC YUVAL BRUTAL
913,002,931 *5F00EC6CCFA330227E1498528BB8A5929B1C623B [email protected]
913,002,932 *5F047DCDFB91ACE42C1D95EA7B45DF1F00C74A4F 2-MOTIV:SCHARPING
913,002,933 *5F0BF1AF7DC75A52A36E2A1BF2A1E3934B08F3F8 yvonnereagan
913,002,934 *5F02BB14014447497F1EF797B69C35586A8EBF20 2.TAMBURELLOKURVE
913,002,935 *5F0280FB90033C41F0F424A7498EDFEBA7B9CA84 2thatboulder5
913,002,936 *5F0BB77048872E08B679654B6764CE89FF280C25 ZAPHRIPHYLLUM
913,002,937 *5F0FFE6D5C17D5B63BDC1E89C1FC97E0F6FFDDA0 387joyce
913,002,938 *5F004FF36FEBA83FEF77177DE53E74E962537A37 [email protected]
913,002,939 *5F0110B576B07F1A6349EDC11F763552C6294341 [email protected]
913,002,940 *5F05080E7F67E0615D8A828AF2B493882FFF855B 3B<-.*.*(======P
913,002,941 *5F0E27B3CE1707C57D2552FF712769E1FD0F02A9 3charolais-rind
913,002,942 *5F0965E43FC6498C76C588E4F28D446398D30B81 3DUKTERNE
913,002,943 *5F0202FB6CAFE36D25EC6A08EA0BCC9B75F9E6B9 [email protected]
913,002,944 *5F0CFDFB9BED53332A55DDD4E5EFA89E0AE4C745 3EWSTANOM
913,002,945 *5F006562B762D7EE262A36BAA9178B66B28C437C 3HAKURIJU
913,002,946 *5F04CDB01A7FBB8C6D2BB339DC9087BB8DEC1F66 3HALLELUJ
913,002,947 *5F00A26E1339F54008921EBAF76EE38F6E6AFBC2 3 k
913,002,948 *5F016B9514BE5FC59A48FD3F5F7E9216BE3B5729 3NTR0N1Z4R45
913,002,949 *5F0C7F36965F8C66DCDAA4581904E06CFB77E661 3> ~O ~o
913,002,950 *5F019F81909D49F264D40655C3EF63427CA4D594 Z-RO VS THE WORLD
913,002,951 *5F01FDCA7465C0468DB4E68BAC79A8A3C9FBA4DC 3PGPSONES
913,002,952 *5F02762D1C703E3F0A8E13EF6B44CBAE0530E27D 3==P~`O><
913,002,953 *5F05C2F929B924DA4216E96D90AC7B81B0E1DACA 3UNWARINE
913,002,954 *5F0403B9A29EBC5E9FE678241B7C6BA95324C8B5 3YAATHAA
913,002,955 *5F08BF44C17B618277BF23BD56F9E65DF8EF061F ἘΠΉΡΑΤΟΣ
913,002,956 *5F09A572121058B1ECC348E61B18F0CD3F6664F0 487236922x
913,002,957 *5F0D01E2F0FC505665FEB7B78060504FBB3F18CC брузэр
913,002,958 *5F0BAF918B7F6CF264E9D98AF45431244411F0F6 4DIEKSRIP
913,002,959 *5F03E432B1F77CB78F4309400E07B9F140DEB76A 4MCONTENTERAS
913,002,960 *5F0EF417B6EA94C880D8DED90EB6797C423C5A68 ОРІ́ХОВЕЦЬ
913,002,961 *5F0E35B559DFF73A1374728E7C5F2A65E6CE66C2 ОСОТІВ
913,002,962 *5F0649DFCB63C11964221D2E58282A32A175AE16 УЛЕМУ
913,002,963 *5F0DAF935BF699339FBCEA127E6E216BABE6B0A7 4REZOLNEG
913,002,964 *5F0A7EF970549D2007256E05E24473B12CBABA04 УСПЕЛИЈА
913,002,965 *5F0BF924107A1C99738044FE6D64C2461DECD0D1 яшмовые
913,002,966 *5F03799D1B9CF8FBE2161C05B6B1876D303A59C5 4VNDERUALUING
913,002,967 *5F0EED0051F4E57B562914F4EA46F58CB8EFFC0E 51 MENESTYKSELLE
913,002,968 *5F06A6CFB30356472C278AC41F41A13C0A95131C 570292 VAIKKA-H
913,002,969 *5F08D8C0225CA586AE9C39957FCD27DFDFB0D963 5CASELBERRY
913,002,970 *5F0EF8D18F3132071CC6891DDB4805B599D7F96C 5DACELGINBSW
913,002,971 *5F0C6EAB2D3326237398DF518A8C23115AFD3286 5FILMPROSJEKT
913,002,972 *5F0CE7E065704EF62E0F53E4AE9C13CEDF554939 拉票」是我創建的,請問SINAI你在首次移動前有邀請我去討論嗎?
913,002,973 *5F009BEC1DCC285E06B20110BF2B67505A62C4BE 5GENOTSUG
913,002,974 *5F01EAFF668EA3C75764C82D4DB755E5FE235FDE 5ICHTHYOCENTAURN
913,002,975 *5F076D0F800D02B8092A73305794F091E16B1C23 現代戦タクティカルゲーム「full
913,002,976 *5F00F10D497EA9858D05A131E120244EFF11FDF5 米国の新聞『WORLD
913,002,977 *5F06DDB5328857291E1C694AF5B86672E98FFE6F 自從2003年羅志祥以【show
913,002,978 *5F003BF613860E46869D07862B62BDB6A0A86E5E 5SUPPORTSHAWN
913,002,979 *5F05F64148FBE2F20C74F1E3310D2E8FDFF9E949 5TTSLIGASTES
913,002,980 *5F0E5E657A7D8BE0A031470643D65F11BD85FB99 5(uba1
913,002,981 *5F021A07B6993D04FBA6BA75A9F7075298434087 5ULEPPAT
913,002,982 *5F0FE07733E1F9023DE1E4BD3EA2414B23F6907F 5VOCABULARIUM
913,002,983 *5F0C1BD9194F5620B39CF564957548D809CB40B6 634143 "tulentekemisess
913,002,984 *5F0164E5E7C400FA5DB9B64E1ED4DE70A7DACB8C 6CARYATIDSES
913,002,985 *5F0DC5BB44EE6FBB3C91F07B8ED83C41F99FD246 6EREPOSTEN
913,002,986 *5F08B5A8DC02F21E2BA39611CDFAAC1D89D49F9A 6LOCKOVERCOMEPLUMBPROSTRATEPSYCHPUZZLE
913,002,987 *5F0AF72A019B0A29835989DA49E3B95F9375FA3D 6LUSTERWARE
913,002,988 *5F07CB137B853C38F0CA721CA6ACA72F2C9D049D 6NOTREPUS
913,002,989 *5F04FC9F48B2363EF19AB40B5E9C45EC7E40538E 6PEQUEAS
913,002,990 *5F0179CF65C3585FC969A887AF4A2D493562243C 6WEBSTERDWIGHT
913,002,991 *5F0C748988A7462CF94F6AFBAF1688EDBEF7A43A 7ABISOUA
913,002,992 *5F08EBB13F3EFE65B2142E8B76F573161C510449 7BENARDENE
913,002,993 *5F069C1BEA6FC1DE24C4199758628BA588852284 7DEITAVAM
913,002,994 *5F068213DE078CAB6227EF1B404A953F83068854 7RACCARTOCCIARE
913,002,995 *5F0EC54427BACAFAFC3A924C0145503F92DCB746 7REEFERREFEER
913,002,996 *5F072B35A18CAC4F736E632F6ECF867C9B3924DC 7ROZPYLA
913,002,997 *5F0383220044DFA850300D7B8A114F20BE2B1A16 7UNSMOLDERINGA
913,002,998 *5F093D301F31E62E7AE79E535C17013C5A4306D2 7URNIERIN
913,002,999 *5F0275D30E248AF3955B602FA1FC35DE30C181A1 8AFWENTELT
913,003,000 *5F0A0663505B55B5A42BF77963C9B005F7CBC928 8=====B.~OSPLOIT
913,003,001 *5F0272A6136DA259FE9F129BEA1F786280DB398D 8CHLECHT
913,003,002 *5F014B5F89C9565C08B1E0891F11129CEDABED88 8COMPTONWRESTLE
913,003,003 *5F0991F1317DF294A681135C4DFA9227A45F45E8 8DEMOJESUS
913,003,004 *5F0BF4541E8738F26F76BB1E41A25BEA6A27C4B9 8EPISKEYH
913,003,005 *5F0B92DC498067E4C1FC5B8818BEE078AE892F1B 8GLAUBWRDIGEM
913,003,006 *5F05CBD6DE44FB16D5035092D865C46EADBB62B7 8INEETSG
913,003,007 *5F0B191FEF184315810216FFEAD6EF4D20E16E95 8POLICECHAOS
913,003,008 *5F0CA17C6003B7BB2E274A62CE71110CBF01A3A3 8======p.~O}o{
913,003,009 *5F0988F6E00B3E56F58610C3727AEEB519939697 8rattijuoppouteen
913,003,010 *5F0A4F8B1520E824E8F8295A1BA17320CAFF7C25 8)`~ `~sploit
913,003,011 *5F0266DF5E62487B5643186BFB782CCA9514D45E 9AUGUST1334
913,003,012 *5F04CDAFBF8B88E51ED10E80160942B1FE511BFD 9DLIEVEND
913,003,013 *5F0CFFA8BD16B3159767A05BD31D4AC8BC786AF5 9ERIPEZIA
913,003,014 *5F04E4571B574C44015BE5604AAD573A391813FD 9HERENKNE
913,003,015 *5F0C882E135088CBD534DA8AAEFD85B765CE7B42 9ILKEIMMI
913,003,016 *5F0EAB6611053206B2CCBF8378026CE1A71F0849 9katholikos
913,003,017 *5F094A38C0C9D31B90C63A6D5FD4F5B838DF325B 9MERKITA
913,003,018 *5F017ECEB050C8227CB9DE6EBBE19CBA270E85EE 9PORPHYRISERAI
913,003,019 *5F0B6C06FDF82DEC6298D3890A94FE311244CFFB 9RAHOITTU
913,003,020 *5F0419949E5584D5B15A33FA4C8A6C31AF4AB562 9RISINGLINE
913,003,021 *5F0A960AA1764655FF117EE10BC1FF0F9EEA5EDE 9thatpontiac
913,003,022 *5F08A7A188A149D68293C6C9375D0BDE6246B666 9YLLATNEDNECSNARTNU
913,003,023 *5F0B9E602E3E4812A1E9AEEA82D253C29FE32D5E a-:?.
913,003,024 *5F0AF1F208E4CB783F2BB6134BE13124B5B8FD1D a&3j$
913,003,025 *5F0BDE97B146C8BB9ACA3086318974B1CD4E1404 a4rdw
913,003,026 *5F06D22346FDB81DA3F77C953F97D11BE134AAC9 a6?u?
913,003,027 *5F02D77B6BEF0E93DC4D2CE8BF90F24C282CC8FC 04AUG2005
913,003,028 *5F090EC821D17B452BD0AF0EA3C590C369E62825 AAACAMARO5
913,003,029 *5F092F82938CFFF0452659821BDEFE294F907812 (>_0)O~-Q====P
913,003,030 *5F0B6F1F08196EB3129CBD6C2E6FAA3A3A8EDF9F aaanm0
913,003,031 *5F0A8B83BFA5C76AC23ED22F163F2DB965FA76ED 1387701 ett:n.ohjeet.ostaessasi.uusia.el
913,003,032 *5F0E5A82BA285DB83A957CFC0EAB5469E030D15E 13TSCHETSCHENENREPUBLIK
913,003,033 *5F017A5A6BA0E7ECC1B2AFE91E8254C799E5734E AARDNOTENS0
913,003,034 *5F0731635FF31C512FD7C1DC2D283E83A2FBDD08 AARRESAA6
913,003,035 *5F0A8705445D0A95124E787E86E0B55479171934 aa,w~
913,003,036 *5F01DF1EB7C1DD91012ECC9C089CB084EBC83A1D ABAOQ
913,003,037 *5F072E076E6EAC0B67C6F88D38C41FAC8EF550F9 1781S5919
913,003,038 *5F0BA3E2D4F11CF3E0B6125A123BD965E5FEDE88 18apr1008
913,003,039 *5F0B0A999C96B84E2C308DCD339FBC0380373DEA ABONATIIBSW2
913,003,040 *5F0FBF3790663561EADEC193190671FEAEC304CD abondroet
913,003,041 *5F0BF93A9C0AA93FE70F18CEEC340965EDFD7FF7 abrahamiatarola
913,003,042 *5F038044B14A7EEDD356C1F9E595D38ED8DC2E52 ABRAMKETT
913,003,043 *5F078539CC462721D1AF5E562ED5E40EB32F272D A$BSK
913,003,044 *5F08CB2EDEB4B269E50F21CE80E4DF17E32DC155 A=Bv
913,003,045 *5F02494880F39C564DB45DBCE63006F43774AB99 1ASROSIHU
913,003,046 *5F0C678EE71C3C369B89A5D45E48C0ECCFD32F83 AC5?6
913,003,047 *5F0598E9D24CB46F2C7B9E76F19954A93DF10E3C ACCOPPATIED
913,003,048 *5F0F39212DF5835D0EE7C3DF31AAC408BEBAB4AF 1by
913,003,049 *5F0EB7020525F04033E9C099CEA9B4E2BCBC317C ACK!5
913,003,050 *5F0A0A3EFBC4492BC784726134A4157F842F59BB acronyms
913,003,051 *5F0CBA6C77B30A04AF946E360D366A98FC0E55F1 AdG8
913,003,052 *5F0D3319A058EC22FEDA69C28AA2ECC6D43D7AD5 1 INTERIMSPISTE
913,003,053 *5F00CFAFFAEEA85C41BF0C45FB174B1E245AFEBE ae1e%
913,003,054 *5F0CF6138D51968044D2211D8E0144E8F78E079C AERIAL-LONG
913,003,055 *5F0C4387144C40A55633C08889D2E287D101C530 1MARINCEVIC
913,003,056 *5F04CFDBE4363B69689A16186542363DC32EC231 1NDES1GN4TE
913,003,057 *5F02A48458C0A6A56B0EFE4FF50F9670E3FA3D30 1.NEGATIVERE
913,003,058 *5F0DB80B0860D26AF8873CECF6AF04EEAE80642B A,FNC
913,003,059 *5F0CCE642999A00364D0FFD1911C5D6FA9CDF736 A#G:
913,003,060 *5F06D0D6426C59FD638671EEB431AC5AC72BB44F ahce
913,003,061 *5F040745A10071A462994394C1AF3A552DBE8AE2 ahws5
913,003,062 *5F0E8D4DC00E8056316E6DD389D1E75921EA3A34 AH!YP
913,003,063 *5F0C9F86A81F8AC158DD82C03CD9F34F7963D3D5 1.uudistajapolveen
913,003,064 *5F09FA4CF1DDC5366672EAA31C2FBEBC84C0AE28 1-vorzimmer-referent
913,003,065 *5F04DC7F44C4C5D581E23607CFEA3C716F21C557 aiplay
913,003,066 *5F013ACBBB606E41A8EB56E06AFCEA09D0225CF2 AJ;"G
913,003,067 *5F0D4060D6368605963A464ECFF408BE1477178C 2076375 OTHER 64-BIT DESIGNS ARE ON THE WAY .
913,003,068 *5F00702C2AC2ACBD5AD8472AC475BD8F178EBCF2 ak)g?
913,003,069 *5F0C38A0D65ED46377DE1D54EF956BE064150A3E akgv?
913,003,070 *5F0DCBEDF071C785E1A45B73E1C8BCE3EE5FEB75 20HARTHI
913,003,071 *5F043DFFE46C18BB7A46B8C8909E1AC6C42AB050 akkv-
913,003,072 *5F062FCAA1D7C770A18CBD1B446326EEA1FD7DF2 2183887 someron.l
913,003,073 *5F0470B51297DFF3B1345A89CFA067FD0F4D2A18 aksuupnk4
913,003,074 *5F02E4076BBDBC5978D4138ABD14BB9F48CC53B3 235846 asiakirjat.ovat.n
913,003,075 *5F0922F9D18087F91D38ABBE58EF2E21057ADF96 237960 "-we-are-our-own-people-
913,003,076 *5F01B02DB84C8B5F9EB92DF8E21D701000482F72 aldenyauch
913,003,077 *5F0F75AE5C0646745F06F64C51126A10212D143A aleâts
913,003,078 *5F0356EE348197A1D3C2D56620055FB401F17666 ALEC.BRUNETTO
913,003,079 *5F0BC5A42BCA6F9FAF473AA83063841D4927B414 ALEXIS.LYTER
913,003,080 *5F04DABE6003A729A128A6689062A632FC0DB3DA 247727 someoftheanimalsexistoutsidechina
913,003,081 *5F0A5A7569AEBC7EE3DD97AE7B94D0BA1FAF2C0A 25sep1967
913,003,082 *5F00F573D8B51957D06E333C321E6BB1872E972A 2-ICH-SCHREIBE
913,003,083 *5F00E7F7CE7F3C260A2DDB3FAE0F298C3FE29B36 ammaatha5
913,003,084 *5F0AAA727A6160378049F06D78F8D04D912685E8 AMREDONA8
913,003,085 *5F05E4A0CC485417F041059A554EC32D72552733 AMZ;T
913,003,086 *5F0086AC6D7EF7089B04A5B23FF3522F04D90FE6 2tasapainopiste
913,003,087 *5F03BDEF2839DFC46B347834E37F74095E07077C andreaskisinger
913,003,088 *5F0D9F6F0F7CD0773A13054C7FA5D9FEF835125B 2.TRAVINIK
913,003,089 *5F01472112D56E17604CCD2169F1266F4F3939A4 2tuotantomenetelmin
913,003,090 *5F07C31F797156E2A673F714FAB7896CE94B800E 2 vakiopy
913,003,091 *5F065CD1765ABDF0CB9680A7C2C2DDD3C15C2A78 303164 RYHM
913,003,092 *5F02CD2235398C8B0DCEC26A85E3F7DD8E0CFDC7 [email protected]
913,003,093 *5F0B307A07948FB3304C050955616FFCB1E4CDFE ANNA GUZZO
913,003,094 *5F02F0FE59895C909CD3CD7E3D492E32E5220E63 38lainey
913,003,095 *5F0720DC0F4CDFD86E140FCA2FE6A5A43DCE4BF9 ANTONEFEFER
913,003,096 *5F00EC4C30800B16440C0FE38D92138F20E884B0 3-DEHYDRATING
913,003,097 *5F086B4EA84910492856D40134AE07C30A879AED ao6tr
913,003,098 *5F05A008EA83729A45BE38918332A245BBFDAE93 APORN.CHINDASRI
913,003,099 *5F0AED197B6C5B463A1A467A58568C2428CAAC9B ap#p7
913,003,100 *5F003D4ED0C61D6FB499FD25B2064A783731BDCE aqzh7
913,003,101 *5F080B539B05093A2A48B59F2A6E7FF063B2A7B3 arnoldstennett
913,003,102 *5F0475A348AD2B21D2D6DDAB8ADEEADAA7DCB2EF ARO5I
913,003,103 *5F0576B3B95FE205939DF16988708DA7BFBC0BC3 4.konsessioita
913,003,104 *5F0E4500BB0841666B65541857CB9CF541C2859F ARVINV
913,003,105 *5F0EF20D7E26519D818095731F566477AE1470D6 ARYEDITHING
913,003,106 *5F078893981784D9E0C635B76DF93C83C55E89B9 4lph4837z3r
913,003,107 *5F01EA09C014403A9300C8A0BFF6DC0693D4E9BC a%s9,
913,003,108 *5F0536D4FF88A74106537CCC0EC6D584567F97F9 4NG3LIZ4RLHOS
913,003,109 *5F0EE34AD214CB94BDB2C0477245B81DCC77B347 asi:/
913,003,110 *5F0742A05E1EEC27CDF8B1191CECE4F660F29EB6 4SDUISANTS
913,003,111 *5F0D833FC63A8E65493827E8828878E471453F69 assegnat4
913,003,112 *5F0CE09D7ACA5D3C627CA7ACEAA76AA03D65B43B 4ZENTEIHA
913,003,113 *5F02CECE0CC24005B80BF112AA9E046DE4506931 51 dolasiyor
913,003,114 *5F06017BE372E63E89D8ED5C7C0DF3B18251FD03 Atto.III:.Fuggirmi.io.sol.non.so
913,003,115 *5F00BC2746EC755C96E8A157623243D007E70671 544527 und-damit-gefaehrlicher-
913,003,116 *5F0F13F49F0CA1A067C605A249B3C4B49788AB5F [email protected]
913,003,117 *5F0B579E1805493BB4EB9777F7A59D833192831D 5CR4WLE5+
913,003,118 *5F04A554C3DBF0EA7ADB51B5C350E27C7EEEE146 ausredenly
913,003,119 *5F01388E3E9A313B8E581C8D2221E0F818DB7829 5JUNE1552
913,003,120 *5F06B8D43E5ADE01EA4DD6EC99A59BE28D44FBEF 5MONDAYEUROPE
913,003,121 *5F0E903D014C89D80B21940E41F0E26810C64B27 [email protected]
913,003,122 *5F0C7AF5DD621378BCC348D89622C0898683BFA2 a;x$
913,003,123 *5F03727E214C8E59FF989E7D7BAD3EF1299E8754 5STEELERSEATME
913,003,124 *5F0BA6DFCB4C2535374538F9B27991C4FA17FDE2 a,x"q
913,003,125 *5F05576CE913386723C4FC9781A73DC24DF4E4ED 5TREKIRTELENS
913,003,126 *5F0808A92BDC50843A53901AE82E10F3D69580C9 5U4R3ZM
913,003,127 *5F0E56945A9C18C0F8B57E9E5B2EF1AC6E368574 AYII
913,003,128 *5F040EFD116922FBE80E2CE7D2740DA46EE98DDF az4u#
913,003,129 *5F039D2A359471A06901F20DB7C0F5E5FD796096 a%zhw
913,003,130 *5F04A090BBE3AA838CEAA403505825E1BFEF1C1B 63DAYS,PARTI
913,003,131 *5F004750801A307FD92CF3949CD8D5C0800848F5 >-B0~~d######P
913,003,132 *5F047CC9F66082308BFEDE265CB0623807EF5EA6 6IAMLOLITA3
913,003,133 *5F03560327E5D64D78EB68948683BA6302A8F26D 6IJAMASUS
913,003,134 *5F087AD3EB9D650E060986DA2F90D73E8E568E75 B4.MY.RHYMEZ.THRU
913,003,135 *5F0173838D331F7D00A385489766D8E4367C4031 b5f2y
913,003,136 *5F04A90E3A4D2BCEEBFF5A9913E97935628ACEFE 6PHILMAR
913,003,137 *5F0ADCB2BC143D383804FB6732EBE8BD7879CCE8 6TRAILBRIDGE
913,003,138 *5F022D76CF360E8655B8DF45679DDBD6AC86D768 bacchus333
913,003,139 *5F081E13FC2C6B444DA2B5C7AB73DEBEC64D2ADD BALUMIARI
913,003,140 *5F0EAA3A5A44450F7A46E1757D72235DED54E709 7AHSKCIHS
913,003,141 *5F0274DD133C27BC17CA41468CE0DBC35867F041 7ALEXANDEZHONGGUO
913,003,142 *5F02E010CC70F0A9C86E56FCB979F678B7229A41 7ALEXANDRREDWING
913,003,143 *5F0C4FADF3153D567CFD8313CC5E382A80748B6A 7ALTERNASSIS
913,003,144 *5F0C0E84D3E63746C43BE632D1F1F85513C7BDD7 7BSWSCHOENEWEISBSW
913,003,145 *5F0DEECCF64549788F7D361E8918DE265EF2996E BASILMARES
913,003,146 *5F008ABEFC19ABA9776D9A89DC18B5090CC6C55C BASTIONET2
913,003,147 *5F0B48F0EB321C174543D7F09DE157F0E895F62C 7mytigger3
913,003,148 *5F0795A746A9E53381BCBC4540D08B055BACD0B6 BC_a
913,003,149 *5F0CD4E14C8B0E2C9DABAA9332ADDA06DEF0BE0B B-----D~0-}O{
913,003,150 *5F08FD92468A0A5222D5E30BA976E3AA6E27F1FC 7STRLINGSFAREN
913,003,151 *5F0CF474246774301B02DAA261ABAB8457315D49 7 TEILLOHNAUSGLEICH
913,003,152 *5F015D50AE6264C26D0002C5BCE36756D8AEC096 B,E+/
913,003,153 *5F0DE3FABD479CD6B420C69D882E3E3B412BD88D BEAULUCERO
913,003,154 *5F0F3E03F167B010F279555E8D4001B54EAC5C84 [email protected]`~ `~ (><)
913,003,155 *5F0930F115081EFEAE0DC9F1F6B132FC0238AFFB 804s7ing
913,003,156 *5F0F4DEB9216843A547C6FE576F1F59D95BB6A71 8ANTIPATHIDAE
913,003,157 *5F08029CB0BB062751A5B0B617C01A0FCF8923D0 8APR1358
913,003,158 *5F0C94EAF3EDCE1A6F7317B77759F9DE3A5F4492 B/ENH
913,003,159 *5F0006177ED04FA7B7BA0EF0B57BBD3CDBBCD58D BENNY.UXA
913,003,160 *5F0D553AE03FE91D31C43DA5D03E8D22DA7D80B7 berinin
913,003,161 *5F0940FFC16963B426DE092D8DD7F8FD1D626BEA 8DUCKRIPPER
913,003,162 *5F0448FDDA73EC1BFC7B2B68E4522890F4B5F923 bettinaboller
913,003,163 *5F0D965828FFDE3F1A886386BDAAF3C9AF22629C 8LADYHILL
913,003,164 *5F0660A0BA261DA7482F21F12DBA92C947120E60 bfvpa
913,003,165 *5F00D97DF911F1EA7C4FCFA45FCC7F0A3719BA84 8######)-~-~-~-Splat
913,003,166 *5F0A470DF86A4ECC46D46D47FD7AABBA691F5E59 8TOOTSYWOOTSI
913,003,167 *5F0954FFE88FFA63B6F264E75183DC90C8769FBD bitb'deni
913,003,168 *5F0BBA0C800AB9499ADB67B64FAABA0AF60C2D4E 8ZARIDALO
913,003,169 *5F0838B3B9BF857BBC661709953696DE28ADD1FC bj:,j
913,003,170 *5F00FF926F332B649C64B2EE5AEF2D10F9682D0D bjj9s
913,003,171 *5F0D96D26F505E5F44CE8E9AC01F3FB02EA97403 [email protected]
913,003,172 *5F008A0AC5A85CFE22D11779DA49E98752F2029B 997heaven
913,003,173 *5F02AE0DD705DAAE4674D75D491067FD462C1D5F 9BSWABOUBSW
913,003,174 *5F0265D51EA5F7A02D609879E4981455DFF05C16 9DIZZIEST
913,003,175 *5F04D392A653A67FFD11DC75A883A8193ED89FCF BLITZEN-TRAPPER-BLACK-RIVER-KILLER
913,003,176 *5F0A960C6768D2EA50EAA3BA16B2D09F2098B494 BMCSHANNOCK
913,003,177 *5F03240B958D71CEFA853B08556648254EE441BB bmmn
913,003,178 *5F003ABD50E551A2845238E51C39DAB577EBB234 9REKORDERE
913,003,179 *5F0A8E61EF2B6189ED3E249D5957BBF21AA3AB14 9RISCUOTESTE
913,003,180 *5F024A8B63FEB5BB4C470A5E444767166CF729B4 9roundwa73r
913,003,181 *5F004DBA3FA43AFFA33526DDC1D7D13469735FCA BOBBY-HUMPHRYES
913,003,182 *5F0736C82E44855D0C4D75D471E90EA02C0E7B60 BOBBY.RYKACZEWSKI
913,003,183 *5F08608F43190CD4AB8B3611676C0ACF04985308 bobmorgan0
913,003,184 *5F0331B3C3DA91216F4C8294E2E6BC9614268BE1 bodefulness5
913,003,185 *5F0E25F07AF016D1DAF3007E84AAD5381027DDF8 BOKOSESING
913,003,186 *5F0ABE4B22F0D88ABDB5132C2B8CE3E08630DB28 BONVOYAGELIES
913,003,187 *5F044208302E67B179890A9AEFBC0271D6CBA288 BOOZIERS6
913,003,188 *5F0774139869FFF2E40FF6C78D763E4B0E52DE5B [email protected]
913,003,189 *5F09E2AC2A8E355088DEBF98B97164A12A5704D5 a3b?a
913,003,190 *5F0C7986449FD8AD54FFE1036A2B4FB7288D1ADF BOYDMETTLE
913,003,191 *5F0C8143F7BFDA5A9A8327014CB1A2EBDC25C30D BOYWEDDERC
913,003,192 *5F06D5AD41EC4B30E65F737F27A7302DD58FE4E2 a8+$v
913,003,193 *5F05067012BA91EF2B673CD5D610464DBFC89C2A A)9VE
913,003,194 *5F04A8EB4C135073E53ECE2086D0254E9F2B1911 aaaj,h
913,003,195 *5F0799334DF688C0A7101467EFA294CBA35F948C BRENDAN.RUTLEY
913,003,196 *5F00FF18B5B5CAEAE4241A094F70CA6691425BFD AAD2ZJ
913,003,197 *5F0A80A35EA885C3587582F6426300E5530B339D AA[G!
913,003,198 *5F0AD7534719AC2817A0604540465698D53D4FA5 BRITT.CHITTAM
913,003,199 *5F0C4C97CC7FC8E3185A682F2C2EA3F30D2A8C5A [email protected]
913,003,200 *5F023675B65973EB4280EAEA27BDFB6B9F60D954 AB27U
913,003,201 *5F0BD45575B49AA1D1718CF4CB2DB489A44905EB bryceferdinand
913,003,202 *5F0751173AFD86955941FF55FAEF8FBB7E8E22A4 abelclouthier
913,003,203 *5F0945A10F65B8A57FBAFAA927B7E72A6AB43A98 [email protected] ~ ` splat!
913,003,204 *5F095DABD43D8FE08192C7C589FBF401B1A88B69 [email protected]
913,003,205 *5F039858CDB780C8EBA7DA383B8CB538EBA7774F BTALKRETIREMENT.ORG
913,003,206 *5F0D669DB8FE830C2CB3E922DE874F613F54CCF1 ABOUTMERCHBOW
913,003,207 *5F0FDF853348D49018865EF64E5D1335D028162D btck)
913,003,208 *5F0C387F6F81E4E2B7345A68FA8C9993438DCB70 ac.[
913,003,209 *5F0DC3B164BD2D23694908E01DF396DE7B8C958F BuF#
913,003,210 *5F06DCDB32006447FD11DC93D1421F6992E22B3F BURTMENNIG
913,003,211 *5F099F5478C482FB6BCBABCA5E765A5CCF30C517 BUSHPEA
913,003,212 *5F07E46501755F308453D0AA16BC909123B18BA5 b!ut1
913,003,213 *5F0BAEF1A695060167B8CEAB530BAEF00F309ACA adn5(
913,003,214 *5F0AA6AA0B8B95FB2D27D508010A255FB9975B3E a#ds7
913,003,215 *5F019D8471B52C8D9E00C2A4AFC49F0E911F0F76 a)eh/
913,003,216 *5F0C2BA4C471A392C1BF70F6C4C929683167C978 C6V6I
913,003,217 *5F00964A76CBAC49D2E8E406267BB1BFFBA1D3B1 AIQXT
913,003,218 *5F04BFE00810FD315F4CDA4B1412086DB0806745 aj&vr
913,003,219 *5F021568307EB9E9F3CBC55DABB83DDEFA917616 [email protected]
913,003,220 *5F051B2098A40D129C796F09F4053874ACC6BA03 CARQUOIS0
913,003,221 *5F0844D1B48E9E5E7B3D4DFDC4EB53700C5BE845 CATAIR
913,003,222 *5F04ED78554DB144008EA7E7C6927B5B1A227782 alexanderknapchuck
913,003,223 *5F0D140675FE5C6F2DC8947A0B1733AC1F43265D c,/ba
913,003,224 *5F0B8E1D09ED27ED00A73234A93C46F69E345FE3 ALFREDHULSIZER
913,003,225 *5F0446B328A40843FFD88CEC299A4E845F1129B4 ALFREDOHOLTER
913,003,226 *5F0C3925083E85C46E03EA084B9BB00F6DD2C025 ALI"3
913,003,227 *5F0471DF964E825833B32C6130462C75AC9729CA Cd?!
913,003,228 *5F0E552A07C8FBAB76186085C2AE049F9307C7E8 CDOFI
913,003,229 *5F0CAC8D7FA3ABFCA474AEF0EE84016D5A42E30C ALSTI
913,003,230 *5F0C89DDFCA49591507D513632B97AD2FEF0512B celebrate-the-love-(magic-butterfly)
913,003,231 *5F0B62FB540AFF09AD8D44662CFE60712CED2B27 CELIA TODD
913,003,232 *5F0DA6411F0D8B7E79400387A4E8D16F0A9E0944 CEMA
913,003,233 *5F07DD5283C5250B5C22101AC7810C44005002E0 cet9c
913,003,234 *5F033D23756FBCA1FE520BC89B9AAD22DA626C69 CGUIDABONI
913,003,235 *5F0902502C02179120D5762E7E31CF2C4ECB2584 cguq-
913,003,236 *5F008096F0458AAF838B8382A76930A03F9CD50D CHALCOTR5
913,003,237 *5F0F292DE4FBE10031337D4EABC99D396A9861AF [email protected]
913,003,238 *5F0EDBCF1765EB0CE07830BAA1B9E388EA78B2F7 changarritola
913,003,239 *5F0989C28356AD86243DDBF9E11F24BD34F9CF82 [email protected]
913,003,240 *5F0324E9A39B8D6F51F9875FDCC1B0FD370530A2 chan-sue
913,003,241 *5F0D27FAE72982F542B758D8D9D9C9CAB6E1A4CD CHARLEEN
913,003,242 *5F005A2053B57A144EA567C6717A4D103677B6C8 ANOTHERYEARENDS
913,003,243 *5F04C723FC05E1587352FEBFC965AC9A72895167 [email protected]
913,003,244 *5F050954D08AA72ADE478ED5F59968B087E4B473 A.NTA
913,003,245 *5F06CC7B72D37B96D1D6904F9B9100591B372CA3 ANTONIAHLASTALA
913,003,246 *5F092928B52A4D9DECF57798D995BF8708D4C2D2 ANTONISIAL
913,003,247 *5F00F2501A0D9CC2C74185587ADF587AAF956994 ANYMOREALHUTCH
913,003,248 *5F095DA9F843CBE24AC90D04D171F9BBF33F7970 chipfrodo2
913,003,249 *5F06F80129C22C3AB67D1EAC4EAA60790D9F04DB Aoia
913,003,250 *5F0258EB8E06D6E3E016EF5D4304CCC3CD82FE5C CHRGL
913,003,251 *5F0B82382F1B1B86857FCE8ABD895CF113A9160A CHRIST99999999
913,003,252 *5F0AF84EB9C85C7575F6F94036D8A2734B86AC9C AQY?D
913,003,253 *5F05D15767A416D6ABDE0EF6F07A41E922CFACB5 ARAPARRA
913,003,254 *5F02043B0E13B13EFE1A6835E12487B8043C63D6 ciara.walton
913,003,255 *5F02ECB3F4C59910679CBB4AD6BC12452FCC88A9 ARGENTO3
913,003,256 *5F063D2B1EF259C330D75FBA5B5B09519E6A8FB6 ARIANA373
913,003,257 *5F0AEBCEB05CC890E18777F57A2331FB4733C19E arioesesed
913,003,258 *5F049DA52D4B5411A77C7C1FECDB18356B0C0DD2 ARITROR
913,003,259 *5F01F73875845337E426DD731567AD2A644BC564 ARLENBRISTOL
913,003,260 *5F07BC76CCC2CC3C1CC5B7F35F8AADB7BF8C1C9E [email protected]
913,003,261 *5F0755F317FF203282C36BE75804654859052D83 ck9db
913,003,262 *5F021FEFDA8D7626C44A1F8E302BC15966E444AD ASCHEDEUTSCHLAND
913,003,263 *5F08675A4E7CAA4BB3D174612A5B7F8074AEA881 ASF#
913,003,264 *5F096E4F15FCFDDEF38DD5A8EAE22BF979060449 CL#BS
913,003,265 *5F00C97DEE30B0896F8B19A72162C2343B64CAD6 ASMHS
913,003,266 *5F0881BA0F6C3D40F9C454D28E0692269CCDA092 cliftonpereyda
913,003,267 *5F0E039C188099AC6411991B4D64BD12B843B365 ASTERIXPACERS
913,003,268 *5F08AFA61C1EF641DB2AB407C6AF54BBD371993E CLOSEDREF
913,003,269 *5F0937C6C455665AA16E9CE70446682866499893 ATAMAWAK1
913,003,270 *5F04FDB44DFDAA8648663605CF90D33A50C0E7CC A$TRO8OLOG$T$
913,003,271 *5F0AD442AA09AB513CBC4D9D58F828DFB567CAAD [email protected]
913,003,272 *5F08A8B5D220880A3582A71D3C6DC8DE583D2030 CNGB3
913,003,273 *5F02D0A2996269212973D544667D172B445FF6ED comeiolasciai"(conte,contessa)
913,003,274 *5F0C6008E813940E352EE692C894A36ABA6592A8 ay"fp
913,003,275 *5F0A4CFF6FEBB9635B6A1549F670079E902B7272 consoliderions1
913,003,276 *5F093A493A6E8B89C129CD76802F8C9234EB6D98 B4D(
913,003,277 *5F0CB597EC788A81D7E8A900D3C101323D153651 c:\program files\7zip\lang\sl.txt
913,003,278 *5F0DFA0A6656C6985AFB8BF7329BD0AE018F7797 cq!5
913,003,279 *5F0FBCF2D9F666BD8F1AAFAF3E0D78F49483A796 creobroterfuscoareata
913,003,280 *5F0D4341AF4C9C5B2C7C35E7E400D6BBBE890EE8 [email protected]
913,003,281 *5F0607EE52EE991C7C6D8BFADA83DB65E6D4AF4E CRISTOPHER.STENT
913,003,282 *5F01A9BD6ACFE344CE6B8A3E775EDE50A243A1E7 CRITICISM
913,003,283 *5F0C6470A292099CE2AF7CE37E9EC14806B5B0D8 bcnr;
913,003,284 *5F061C7A3D9BCA044D61C898D8ED8536ECDB00A5 BENCIOLINI
913,003,285 *5F090C383464404BAAE26B05881B49D1BD7E100A BEN.KNIER
913,003,286 *5F005497A2D5257680A6E56027AD7ACA48C23B2A bennett061
913,003,287 *5F08C9890179F4747D292122DCFB307938820451 BERNARDONIEDERMAYER
913,003,288 *5F0F7490FD64B0497C90A01B1A6663ADC8665849 berrybirdette
913,003,289 *5F0CB669ECDC6CB91FA1215557A85D2656176103 berryroad573
913,003,290 *5F01EBF890974428AE1FCF4611963CBFA60C45AB B{FB
913,003,291 *5F0C05CFEC59DC80AD3DFF18D784D9ADC5C1B46B d4dnd
913,003,292 *5F04CCB4FD1983ED3415ED1A292B2BF4245523B7 B%H+;
913,003,293 *5F0FBFB368D3C8D08C196A91C57780516A809FC9 BIMEBIES
913,003,294 *5F0F9E439AD4A388048D0F826E82E6DDFC7A6AB7 DAMIEN MCINNES
913,003,295 *5F0E32B0C83BBA93019998B7D1999E20BA9FF1B5 bj=v
913,003,296 *5F0378D7FD9CF0DC0800BD5EADF6B5FAD4B79E67 B+kM
913,003,297 *5F0FDDAE159323CB00EC4467F887D4CF60CF2B47 DẪN-NHIỆT
913,003,298 *5F0BA86C61941DF1D73DF9B13EFF5251E8AAB411 DANNIEHAYOZ
913,003,299 *5F056AEBFF460691106A369931600F3A0F4E71E0 DA$Q2
913,003,300 *5F046ECB39877CF827FE94EF67DECA5F8F36BC49 DARREL.MCCORMACK
913,003,301 *5F00A1A45F65AC788D3925A7D6EB3D5222F05628 BLTYPE
913,003,302 *5F09AD0C43295E0825AE02ADE3AB275A65403039 darrylcraney
913,003,303 *5F020B558FD2DA0D6FC21302CC03EE52CFB295CC [email protected]
913,003,304 *5F05E36B9257B1434434B2F3E3C361DD7B037A0F BMF2T
913,003,305 *5F0271E3F312A4226209E46D96281D766A6A1F6A d,c4.
913,003,306 *5F0C3DC55FEAA622899E40FB18E44DF5AF00C227 BOMBICKY
913,003,307 *5F045312C4697F376574471084D789E6B4E699FC BOUFFONNE
913,003,308 *5F00BCB2F59EF9E333F5C83FF40096204D3B0E91 d+ekh
913,003,309 *5F0ED5306682045C237D3F873297347F7D50B0F9 bqqhh
913,003,310 *5F0862E1C77D9BAFE15B0FC4E30DBCF12C62ED7D DEPEND-ON-YOU-(SVENSON-&-GIELEN-RADIO-EDIT)
913,003,311 *5F0283BF0010B5CABC166282A1FE19CC0098BE8C BRENDAN.PODESZWA
913,003,312 *5F0080B9CD5D14F7316857FD254070C5D3CFFAF5 derektilghman
913,003,313 *5F0EFD39E52A3FB638CA349F5432D586D78BED0B brettslark
913,003,314 *5F0A8FF9F9C70F99F8D7397A20B92060A2922069 DESATENCIOSAMENTE
913,003,315 *5F0610D5369B501641829DC1406A39395BE3C461 desmondvelastegui
913,003,316 *5F02D798931D54B837D7F1585B2B922AB4C5F111 DESPERATE-HOUSEWIVES-HITS-NEW-SEASON-HIGH
913,003,317 *5F052251901578BB9EC0D32F43E61835088A8451 DEVILBUNNEH
913,003,318 *5F03A767CA754BC45D3465F0605463FD3A16E26F deyerhpro7
913,003,319 *5F08950ADD3ADEEBD2F5A87914DD1FFDB08ED5AE df5qi
913,003,320 *5F06DE05E70CA8D3B0D0633EF2B1AB5635FA1CB4 df"6h
913,003,321 *5F0019DDB870409CA8A103B7EC0A9BC8FFD6E3D8 d_(fa
913,003,322 *5F07E955E2ED8EDFCD0C50383A4439D8C998A74C bs%+f
913,003,323 *5F049551565EB323988289E680828911660DDAAA bsu
913,003,324 *5F05F836E66F7DC358097DD6154A531F71E673DE dh1is
913,003,325 *5F00B075E6AE1E9837F8CA1890407360BDDBA364 DHPG"
913,003,326 *5F02901ADE949A72268916F369CADD8096686F63 DICHTGEKLAPT6
913,003,327 *5F09514B9EB231D1D9D4DBCC837FC4DFB2CE1F2F BVIEWERS
913,003,328 *5F01B7DDC2655B1432CCD978BBCEB049CD0F0B80 bwv867bflatminor--fugue
913,003,329 *5F0781B9716D9D90201ADEE6E3B02F93FFECDC6B DJ$UM
913,003,330 *5F059DC4202D76E370A6618A82B542E9B5FC6F81 C=0HB
913,003,331 *5F0827EDF704EDB3E75E8307E102CAC8D7C75CC8 dm6qh
913,003,332 *5F0E07D31FA3D7898C8FC9441386DAC4C849BA6D DOA+!
913,003,333 *5F0B0515BAF2C95531C5B460BE85412221102051 DOI10.1021OL061605O
913,003,334 *5F0483197546CD1C0B532FDD0F181F2D346B2D53 c9`f
913,003,335 *5F0A9563D2210458B38F688495E113E1BC354C8A DOSSWAP9
913,003,336 *5F09FC4C5205F17E065B3EA6A8E535F6CAEF478E down-the-backstreets-(feat-lonnie-liston-smith)
913,003,337 *5F06F53DA27EFCC0E76A05D102432385E50CC0A8 dpcl:
913,003,338 *5F0A602F85ED3E96C3EAEA35E367FD67AA9F22B5 dp$p:
913,003,339 *5F0A9FD41280AEDF1A7B12220618AB0935540244 carrolcervantes
913,003,340 *5F0DABE5627EC219A62AA81AF78D1BF479017A58 carrollvelthuis
913,003,341 *5F04933D5913116869C7584BFA8FD6E98F7B6BD6 [email protected]
913,003,342 *5F053702E8B1DC7F76B94CA3CD3F107D1B0FF8D4 „DRAUßEN“
913,003,343 *5F000D510CEB5456611906883A2C5FDA38ABACD1 cathymathes
913,003,344 *5F08F7F42502C08501D3DDF8B7BB2754CD1A647E cbm?z
913,003,345 *5F0C116442B57A7509260E466704DFF5D0CD0084 [email protected]
913,003,346 *5F0A2F1A99D2A6B2D70C7821C7EC1B73BC509FBF c:\documents and settings\firexware\local settings\application data\google\chrome\application\6047263\resources\inspector\images\timelinehollowpillyellowpng
913,003,347 *5F0673922038B8D11F56E28518495D0E0FA997C2 cduw#
913,003,348 *5F0C2248116D185D6C5FDB24E4FB73BD49184C67 CEDRIC.VEREB
913,003,349 *5F0F664903E06BAECA60BB6FBA63A5182ACA21BF [email protected]
913,003,350 *5F00B3E3501D9A6841E0744832BF423617A7DC95 c=f?)
913,003,351 *5F04C8B4FED66CB33C0C907A9902EB30A13C8184 C"GG
913,003,352 *5F0B4645E22A889BC3D2E315436F44D6A1DA032B CHANGACY
913,003,353 *5F00C4F393A8E9BE6F29A6721E1A35AC4650448F [email protected]
913,003,354 *5F0DE38A49EE8E276A238FCF45D678B26DA7B352 CHAPTER.14-4:.THE.INVISIBILITY.CLOAK
913,003,355 *5F05CF48F5B9E42B2E60897E50E31F27EE2391F0 charitymed
913,003,356 *5F020CE2163E649A26BEDCD83AEEC69C6F784EBB dwt=p
913,003,357 *5F0C7530CBEF1F9AB52AE0F90DBAF34B7C9239E1 [email protected]
913,003,358 *5F0971E00BFBC83EB81E63DE4FF71A7AE5EBF7AD dylan.giron
913,003,359 *5F075305A21BBAC1F739DE1AA369725373493BEC EADISOHP3
913,003,360 *5F091221B21D2555BD6675CEB0050BA24D415EB3 CHRISTINAISRAEL
913,003,361 *5F0A2393940FC59BE5A614ECF75C01B446E25585 chrivia
913,003,362 *5F0A6B75D11682C7D5A08E7BAB14B22CF760DE86 CHUNGESLICK
913,003,363 *5F0B81E958E7C75A1758EB595D21C79F5E5582CA ebiku
913,003,364 *5F0AF70028F8D326FF9DF011CECCA21C7EF6EF22 EDGEOFHEAVEN(SHARPFUNKYDRIVERREMIX)
913,003,365 *5F023276212F1106C9EC85F0AA137D3A1D9E454B cjlippert
913,003,366 *5F0EB63FA9C8669BEEA841F4BDB9E873C5A1C0DB CL;9A
913,003,367 *5F0F0333256DA56CE4936F3FED956C6F707E084B [E[[ER
913,003,368 *5F045CE842F43F491D525AF772E1B7D6E6F50491 CLIFFORD.MCVEY
913,003,369 *5F036956E7488CFED9919F938FE44FB39E4D0E81 EISANB
913,003,370 *5F045BD519ADB3584A3C2C6D3BAC0248F261CE82 C!MEP
913,003,371 *5F0DCBC62721356B043B89BAF88E2DED3EB5160F eldridgeflaxman
913,003,372 *5F016E1C5AE2C31886897D252A76925FFAA32277 [email protected]
913,003,373 *5F01E887913341BCD99DB973E8AF5F6906ED545E elew_
913,003,374 *5F0997F680480D6E59890A92743B5B933A19B6EE cnm&6
913,003,375 *5F012B6CF54AD43D45F14DCDEDFEF55E0FA5E6FA eloyfjeseth
913,003,376 *5F020BDD6A5C1A257005A599049863A686274D2F colbymaughn
913,003,377 *5F0CD7D255E37AFD206002BFFF108394DAD29F8F collectivistically7
913,003,378 *5F00A06F2ED8EB60E1465EA9AC65EAF37617ABBB COLLINBARRETT
913,003,379 *5F0FCD0966E731A6AF6450B35E2D77326B49C693 [email protected]@T1ON$
913,003,380 *5F0DE18C72C1BCC70E75B9B7F5642CCD804178BD conquestscoukwww
913,003,381 *5F0B07F4FEA9D3D91C896391631DAE40C91BD078 CONVERSABLENESSES
913,003,382 *5F04C03EC52195336CA545DFD487B5C32876348B entauren1
913,003,383 *5F025DE403F159BA3559B0B5FC992B90FF679692 corsicanus
913,003,384 *5F09F30FEA490C218DA40FE0B6D0EE38918FADE2 EREAMBTEN?
913,003,385 *5F02D08C765190431325E52A7D41E6B116D80BB1 c=qc
913,003,386 *5F08A85D00A8E99F6C8708B758D10664628291F0 ERITYISI0
913,003,387 *5F04924D76A1015D49C3D3029659431CBF77458A ernestoalveraz
913,003,388 *5F089751ED9C5E771A64098794E358D4278D05A3 eroifocn0
913,003,389 *5F05F7DFA6507D019789285C01C29D8E42DFBBC3 ERTV0HOK25KJ
913,003,390 *5F04146AD1D58B8A705A3E2299D26A28F7A372F4 CRCR_
913,003,391 *5F04E38ACB954B1398ADA6CD565F5C98D9988DCC ESTANCIA:LOSPEONESDEHACIENDA;ENTRADADELOSCABALLITOS
913,003,392 *5F05A15BA234042C9F0ABCF9FE3888893C125E7D [email protected]
913,003,393 *5F06FD6D5A54E880ECC3514BB4EF9D2BF7CF2C9A ETELNAAP6
913,003,394 *5F048C1F64052DF43ACCCC655DCFF2188C46B124 CS/3S
913,003,395 *5F0E273D0891D88426D2A6C9CA559D897287F013 c"t$v
913,003,396 *5F0B61DC12F7E4B66C68B34F5C17D5AE205D5E97 failrate4
913,003,397 *5F0082D74A67C1AFA6E8029E31D074C4D847715D FAITH-CHAPEL
913,003,398 *5F0E626FF28CF114DA14F16A370C1A54F3D186B9 CXBO:
913,003,399 *5F04DA6D1EA6B3B69B1A86EFDBFE069C40AC2C2B fdderal
913,003,400 *5F04BADAA42B5BB6E87CEC524562AA065F4EF0AA CZGHG
913,003,401 *5F0A04E1FBD9DE2477553782A6010C5E2CE2C0EE d-32m
913,003,402 *5F063497EDB8247F19A15A8863529C60A667E2CE FIFANOHERANA
913,003,403 *5F09555460B79569F8A643B5580D19F5CB914CAB FILACHTETSCHEW
913,003,404 *5F0671D7D23338E0B294BDF4D5DE5F5A1320CF0D d3ni3s
913,003,405 *5F0E3815AF7B204BBC023CDE652CE74FE602BF0B d+48e
913,003,406 *5F08BC336FD4726FB221BB6E9C9FD3ECBC8F8554 fisica»
913,003,407 *5F0DC10F41D18FB414387609E14B7E00E045EC39 D5VS_
913,003,408 *5F0375FA6022BDCCA0CD889F5F31E1E25B6AD630 d7!(
913,003,409 *5F0D746438BD88F1E8F2CCD6E45C929667DAF003 FOCUSSEN8
913,003,410 *5F05A4FB22EAE64D621F2FB5A2C034AA110A03FE forestfreyre
913,003,411 *5F0F65B4DB9310968B4FD4B54EDCE38C2E0D16C7 [email protected]
913,003,412 *5F001AABCD82E526AB4ADFE099BDEDC20BF47E7F FQ%.
913,003,413 *5F0B49D45E59216B9205934918BEDC59FC962143 framebrkr0
913,003,414 *5F0683B0005620C0D67FA33B22FF2D0A2720AF4A DALTON.ALBINI
913,003,415 *5F0E6B45CC33952D13F956AB8EBDD21A279DE8A6 dalwr
913,003,416 *5F0A33CADDE06EDB0FFDAB77CE2B603821CA7453 FRANCES.GEAR
913,003,417 *5F0D82E93E0D7CC0894858353B91AC2F2BC3942F DAMONDIBDRAGON
913,003,418 *5F0B80BCCF9FD8D2C1EA7241C493BEB1BC2D3C79 FRANKIE.KETT
913,003,419 *5F0CFCD1B8BDFE3349005B56BBEB4CB479395E21 DANA.ALBERTA
913,003,420 *5F0ECC2DF6D5C41C734FA780C833F5CAC361E5B5 DANBORSON
913,003,421 *5F05AFA854F16506F2E089249403E7F8BCAAB607 DANIELESQUIBEL
913,003,422 *5F0EA9E6A9EAC8C8CB5456846A29319B5681D993 FreeFrog
913,003,423 *5F0A4042E05707F931C93A00D8D4ABED987EEB1C FROMHERETOTHEREISN'TFARENOUGH
913,003,424 *5F0570FC6261AD24B5B30D28A106B4E00E2B118F DARONAUMEN
913,003,425 *5F0F0F00CBA65AF4809D4D15C8C30D77F10373DF [email protected]
913,003,426 *5F02DE59F1B6AA10A9F9BDD1CB23BBDE1B3EBBE8 DARRELJOME
913,003,427 *5F0138D1EBB99707B4F1CF533419B90ED2F7FB0B DARRENHAVLICEK
913,003,428 *5F041ECA247F9D9A75F1109A2E4834FA54B4EBDC G3N3R4LISM
913,003,429 *5F0540F3B5ECD10C8277127169F49EAC2B243AEB G3R0NT010G1C41
913,003,430 *5F0E88F4FF9F32CDA98FC1B2C416475EA861C1EB DARWINTOLIVER
913,003,431 *5F0A76D1738B7F4A235B201F6D6902F5DB3CD329 gabrielle
913,003,432 *5F0B5AD5385DB66AA87B7EC13D950485EB1C7380 DAVIDCORINGTON
913,003,433 *5F0380A30E17A3FC553B70F1B0098593DF746A19 galen.magee
913,003,434 *5F08EEFB4AAA53E0AD00774AA7541AECBF2D7C4C [email protected]
913,003,435 *5F002D769196F76E017460159738E0572EFB3E44 [email protected]
913,003,436 *5F09340960AFA0FD958DC634C05732CBAC1A3EC2 db=u3
913,003,437 *5F07D277032AD688D846CE0052D0FDB2DF2B73D8 gascromh
913,003,438 *5F0A0F84DEC69AA4D655025A656948C82553A49B gastonjaskiewicz
913,003,439 *5F052BCFB92E14619E54EDF442A8DF5E312946F9 [email protected]
913,003,440 *5F0FE6D2A6C0095F55D0C5CC3C4B85DA96D74567 GBSI
913,003,441 *5F0942401ED385FA05D96B2FD2FF7325D33625B6 DEADWHORE
913,003,442 *5F04B6616F6A25BAC05543923DF6A8D979208F27 [email protected]
913,003,443 *5F09C12400BFBD07CD843D8270492C8D7EAA2E14 gemeinmis
913,003,444 *5F0B77CE0BB0FC4AFB9636BFA9890B1664FCFA33 georeferenzierbares
913,003,445 *5F0BD7DCC822A8D7807F6466195FFF562FE46123 DELANEY604
913,003,446 *5F0CC472FE26DB83840DA251FF88B9005F55CD43 GERARDOSCHLENKER
913,003,447 *5F083B357A15F2B3FCFE48DC5717FDB03FBA2E82 delpoquette
913,003,448 *5F03DC679B04AC692F25928E0393BF7E09E5AB37 DEMARCUS.EIKMEIER
913,003,449 *5F0FAB6EF7E8B1B46B1D6F0CE0AA82AFAE6F28BD getfreaky
913,003,450 *5F020236C428FD76A3DF16BAF6F0E075BCECA285 GIACKINO0
913,003,451 *5F05242207C7C96066F64C87C048B2EEA2381695 GIUSEPPE.THURY
913,003,452 *5F0D3851D64095BFDAFF361E7FD7E85A58E8A608 GLEIUCHZEITIG
913,003,453 *5F04C544B734BDF7AD807153D128A33470E967FC d_-f+
913,003,454 *5F0AAEE8E05564B63F1E64E30912F7B8308DFE2D [email protected]
913,003,455 *5F06B3907C0608242CF7F5E802FC1E5488314299 GORTIGE
913,003,456 *5F0E5DF4A65C22B66BE179F1D66917DF5A492348 GRAHAM.COSSABOOM
913,003,457 *5F0D886983E311C18A1FDB9C05F2781FAEAB72A4 DIESCHWEIZ-EINVIRTUELLESLAND
913,003,458 *5F0C9E9656789A545A81613F5AC86CFDFB15F3D7 diksd
913,003,459 *5F04702A44369B038B6AC9AFB3C72DC89FD73E88 GREGGHUEFTLE
913,003,460 *5F0FBF3EB5236A4AF6497E05E4E8AA0BDC564BE5 [email protected]
913,003,461 *5F0319B3748A7B02F87AD9156096ED976B042AE2 DISCOVERY
913,003,462 *5F04FEEAF479FD5C55CF06DDE2E9E635C61434A5 GUINDEL
913,003,463 *5F0795F9C69682F9EF4D458E1145D945C30D8C17 DJ!:W
913,003,464 *5F054523910F1BD2DCD1DB598B764C9E596DC304 dlbec
913,003,465 *5F0E6C8E1F649384112910488C433EAC39614CD0 HALDERBERGE
913,003,466 *5F0685834D4A6C570299D876471456BC7BAFF020 HANSMILTNER
913,003,467 *5F04A6A8ED951D4DF55D101F3E38A3AC0D56576F HARITSISED
913,003,468 *5F0B42745D204B7FC3706D6652C1E73F66BB5450 harrisonkrentz
913,003,469 *5F09A4F0CF52D8F67B83F801500B2D9BAD83760F havenening
913,003,470 *5F054BB3ABCF5E2C2103659F1C2F46D284F1CD79 DOMINIC.DEVREESE
913,003,471 *5F0E91E4B1585AF5F73D243DBCF4CE0B783E6180 HAYDENROSSELLE
913,003,472 *5F0355FA652A61797F111FEC36DC8596DCBF1C70 dominiquehobell
913,003,473 *5F04236C92080A4DB6089489AEFD6D4E915CB158 donnellspindle
913,003,474 *5F0C9505150C77D05345A1B511E32579212B2851 hectormodisett
913,003,475 *5F0002E8A435BD89FFB144A97DD625417E1D07AE DONNYCONSOLE
913,003,476 *5F09F0F5631A20D2910ACD54D66DFE578C4F80B6 helaynas
913,003,477 *5F0F0416E4FA7ADA87CF3AFA41A0AE38FC2E3B5D dorrend0
913,003,478 *5F02F3EC17B54DFAE64FAE74F127128F1742BF91 HERFOARME
913,003,479 *5F0479DE4FBD4D3BDBDA7C3484F2E253A7D33D11 DOUG.KUBU
913,003,480 *5F0B0C2DE1C0EE5189B1C08051815B426C100B07 DOUGLASOAKEY
913,003,481 *5F05A5800590EE7C6C6B560BC7D8B07300CE4D9F HFULL PROFESSOR
913,003,482 *5F09856BB52EDBCD13AEEB4C5D5D850CA246F766 DPDT
913,003,483 *5F0C79A64F80D227C47E894A0F22CD1BB00BCB84 HOMMAGER&PAMFLETTER
913,003,484 *5F0F13079B290BA8CF20E6B9FFFAFA26030A96F6 HONG-KONG-SHENZHEN-BORDER-CROSSING-VIA-SPUR-LINEFUTIAN-CONTROL-POINT
913,003,485 *5F020D80C6A04003392DD766DF79794825FCE305 DU08K
913,003,486 *5F02C476B56E7C640BB83F64182EC41F99F44D3D duuhc
913,003,487 *5F0623C5B71A295BA989FF2DD00D8E2DA5F3E92A [email protected]
913,003,488 *5F08DC4C43865CFC1D307E35CDB0A601CB67AF16 [email protected]
913,003,489 *5F0FAA2F305DEB0F96343CAD2B4636D889FE37E8 dv-a#
913,003,490 *5F0B4A12D96BC59E60162C147F54AEF5148B7D2E DVDN,
913,003,491 *5F072DA877D950E27319A3F701A73B77BAC30B1E dwi4_
913,003,492 *5F03A04BE35D3F5FF68F07DC32A81EBBBEF25909 DXW0
913,003,493 *5F0F2F40D6801C0DDB4512A14F26C114A4700E50 IEMNEETS4
913,003,494 *5F0D1F3A2961B9AF086AD44F2353F082E65A3904 EARLEBINGMAN
913,003,495 *5F0CA4857C83FFF1D8BBA19E49ADB690BFD077E1 EARNESTDAIN
913,003,496 *5F020509C23677D5CA09D40D2A1839055D10B459 IHABERSKA
913,003,497 *5F0180B3667FCA604A08E1925210A26EAE8C7CFF EBFs
913,003,498 *5F0FC7A9164170E9D9FE601EC54C9C694233C676 iluvbilbo9
913,003,499 *5F0E8BDE71B7F7020C86D21323346512EED96A31 EFC,-
913,003,500 *5F0EC72BBB5B72C966F3F620F765FB16CB5A8382 EIHORT
913,003,501 *5F08C1D248A76449F53B10C5A07E962B9FB243E6 ejcb9edu
913,003,502 *5F0AD3D39DCF55087640B8CCE16A22ACF1CEE91C ISO6
913,003,503 *5F09AE10FF3C9C36502853E5E759B8252D23D97A EL.REPORTERO
913,003,504 *5F0D6DB222C95469830AFA80B7FF8C28D5C9F8E5 ELTONMIKKELSEN
913,003,505 *5F0CEF4107DC87DF9AD650AB157AB4BD9BE9A9BF elvincripe
913,003,506 *5F0F4500990BA1E3285FF3B93038230AFBFA0F2F I.WISH.(FEAT..C..SICHTA).(MOREL'S.GLIDE.MIX)
913,003,507 *5F0122821BC8505A139CD75D4390E30FF9E6E69F IWONDERWHO'SSLEEPINGINMYBED
913,003,508 *5F003751CB1C3F0E19A03B397F93410086B221EE emiliobierce
913,003,509 *5F0C4A15DAC2801B9CACC630211C08B5B5280F4D JACK.VALIQUETTE
913,003,510 *5F08A05F554938A39F61706A1668446630925A1B JAHQUELL1234567
913,003,511 *5F022DB43BEFA8266D1DDF8FD9110D54F5D566A5 JAIMEVENETOS
913,003,512 *5F04716374D36AADE6BF904666535AD9CF5A6BC8 jake.anderegg
913,003,513 *5F0F9C7FB7642AE6DB7E1B6CF6D74D61CE8A4C02 JAMESDABNEY
913,003,514 *5F08ABEEAE80C14CC3668F7DBF5E8103B06155C6 ENINEER
913,003,515 *5F0BC6CDBB86D8B605CE4B86B18B77451DE69570 EN-UK-LBHARINGEYOGG
913,003,516 *5F0A14C847BD3E90336AB35F716AA4FD98403B8B eo7%a
913,003,517 *5F06EB7B6231BEF6819791F177B0CBA56206594E EQCEQ
913,003,518 *5F0285C6712D328EF64CCC7E20FACB3366737B5B JESUS.PULFORD
913,003,519 *5F0DF131708896C2D04C6A0289A3A4CAC156C196 JEWELL.EDINGTON
913,003,520 *5F0C2A6A6DC84E736F8238F876EFFA7A573E681B ERM..SO
913,003,521 *5F05E24B5D6A095F6457EA72079216AA132FB13E ERNESTOVANCAMP
913,003,522 *5F0C2CB9BC1889D7F3BFE482B47CA02F18BF6548 jimmusi
913,003,523 *5F0E942BE6F5CDFFF38253B9BCE6F12BAB34E03D ERVINMCALEVY
913,003,524 *5F0EC81245D3259C061E50355972D26D33442AA3 [email protected]
913,003,525 *5F02E6C02EDF15C8AAF2BCBD8F74D66C3AAB1B48 JLAATIKAINEN
913,003,526 *5F0AA8E2D65C23256E3598E7D18D2F297DD9ED93 jocelin.jenkins
913,003,527 *5F0ECA3C3FD25F591D8E2088D32CE80C3CC9089F eunfl
913,003,528 *5F07EE11BD680ECD3C6AC9EDF9EA1E1068F792C7 JOEYMODE
913,003,529 *5F04A20174100AB3786F99D22C1182A86A4E3C72 joggaed0
913,003,530 *5F03DA159FB0F23B5869156EF23348050DEC4B5A EVERETTE.MCHANEY
913,003,531 *5F01A3D1FFF5C5D6AD89374A5EDC2715884CC88F JOHN.NAKKEN
913,003,532 *5F0E971F032F1479E41464BD66B07AA68EA7A618 JON.CLUTE
913,003,533 *5F08352579B71C541461D470289DA00E3C4C8C31 [email protected]
913,003,534 *5F0835FE647EADE8FDE12271D8D75579A53F20BB EYK,9
913,003,535 *5F06A66A94595A984385EFBE30B10D146004FE24 ezrahunnicutt
913,003,536 *5F07B3EDEDC8CFAD01007D89CC68F76DBFDEFB64 JORIOSJE
913,003,537 *5F03D78C9247CB3F8314479705F1350D30252BB8 FARIANTOJ
913,003,538 *5F0244624579A18C9540269F69CD8AA03C792595 Fataldestino
913,003,539 *5F0AD5118C4C9F2FAE269E4B20EA54893DE659CB juguuha1
913,003,540 *5F0CDF9C4AED8440519BA2F8B1C4756CF12A5600 JULIOCALAHAN
913,003,541 *5F0532302412E342DFDAF8EA8B17854C8B2EAD15 JULIO.HOYING
913,003,542 *5F0F850CF2EA63CF34210A2306F6833FF14BF793 JUSTINWOODBY
913,003,543 *5F0E7BB64E46C01855E60A06A81D4C5ADECCD992 [email protected]
913,003,544 *5F096C03396CE3A6F37855E3EDDF07B110DE830C jyzp
913,003,545 *5F0E962C9A89B45DC008BBA611CD92B5978A9D92 [email protected]
913,003,546 *5F017E3B1E42A21264160D9542AA59ADBFEF1310 flantledscanned03
913,003,547 *5F076405CF9D82251F4FA8AC653FFF0B14161CE1 FORMONSUS
913,003,548 *5F05D59D97D2955B720303EDCA1420D61DE47D0C FRANCISVANDERARK
913,003,549 *5F0E4440E4F19BCF9942542F4B917AD17C890C7E FRANK DUMANLANG
913,003,550 *5F0E158F4895272318C9518B2EE71AA631C2A785 freddyternero
913,003,551 *5F09130E6AE4309B236BC7AC553CF486542D2910 kerrybambhrolia
913,003,552 *5F0FE35903276FFDC9175F6F253947115F19E256 KEVENLYDON
913,003,553 *5F0F236C96288E814A1E39B9A0E0D7E5B459B7E6 KEVENPANDO
913,003,554 *5F00A00F8F040BB767906945E0C56F864EBE8C23 frenchgaul
913,003,555 *5F0E0230C6E713BD98EE1A7A3BF8670950970D66 FROMDEEPBOREHOLES
913,003,556 *5F0C37D38F7E1310B7D549106F92275DBE93AC31 KIP.HALONEN
913,003,557 *5F0444671993341FE54D7F7E39BBC97110B6E520 F#SR
913,003,558 *5F0A0587F3E4F1CF5D9F61EFC0A0781DADAC4E29 KITTEN-KONG
913,003,559 *5F041791B575E6C06E1E56EB240F5C7C69C7CEB5 fzokw
913,003,560 *5F0DAF6596196511832D5FB7D22BFF67F61FCBD0 gabrielle
913,003,561 *5F01C72E1787BA6FE984201603140AB9A218F6B2 gangsta36t
913,003,562 *5F0F562213B9FFEEC83CDD183B8B54C330C34D1A krewe-related
913,003,563 *5F0378E208881391FC36241B17BCCC71679798FF KRISTOFERTEDDICK
913,003,564 *5F09E57BFBFB62B63FCCD570F8113F1842898DC8 K/S
913,003,565 *5F0B17C4CC3E3BE78EDA99F6C40E06BDA18A9DA3 genie-auf-die-ski
913,003,566 *5F0C126A9E320E5763686212DF44964337E74DDE genpumped
913,003,567 *5F0B4AAD55CF202C479A667FD1572588A1F0BD6A kw:c
913,003,568 *5F01D537A5B87F694A6734C800AE6583BB542551 GEORGFRIEDRICHKAULFUB
913,003,569 *5F0E3D615488B00AB305E98CB6E4521045EEAC67 KYLEBALCH
913,003,570 *5F0A512A5024E1D9B4222A3D47F7D7FFB0C97B06 KYWANNA4
913,003,571 *5F0EC1D124268E6456F4E7E62CAFA3D0CD9F81C1 germontani
913,003,572 *5F05A56D95255E518918CB8D6DE9B3A4C631C200 GEZOCHTS3
913,003,573 *5F07A78374898B6B87A304211455C362ECE64209 LACYLIEB
913,003,574 *5F0BE21142E1217D9E1CBD0278D16B45B4F4C0A1 [email protected]
913,003,575 *5F0C8F89A5CDFB572F59A5F3EB5901C3AB801B1B LALMOOSA
913,003,576 *5F02EAF6A6FED510B8BC4E64D541027C36AB2F0D [email protected]
913,003,577 *5F0D981C696DA37FC3C3CA2106B0ECE0B23BE5AC GIOVANNI.LATTIMER
913,003,578 *5F0EE9C992F05E0C2BBCE4C53ACCFBCE6B24BA21 LANDON.VILT
913,003,579 *5F045C6EBE5D9AB0E34EB528A98A2050AD3DC232 GIVENCHY.ENGOHELLE
913,003,580 *5F000F77C83835040FCBFB0B85670FF52B98B59C laverne-nash
913,003,581 *5F0D72005370D17F509844A824A4C6C85B33BC91 LAWMMAC9
913,003,582 *5F0772C347410907CD99BC5E1CFC7398529A901E godbersen9
913,003,583 *5F056C8C7CBD01E02CD8BBB495430F481A45D1CA LAYFULLY
913,003,584 *5F06E4FDA701382392A4F88CC2B950B8173D4C42 GOMĀRAGHU
913,003,585 *5F0EF5159AF4782A6778D263B36D76690F6A2033 gomenist5
913,003,586 *5F0759B813C185DFCDCDF8FCCA45F8CF9A2D1D19 [email protected]
913,003,587 *5F05720E82D30F1D21DA43EF1B17E27F1FABE063 leakjci13
913,003,588 *5F0A90BE4F37FFC0AF344200B22FDB4C96520324 GORDON.DORSINVILLE
913,003,589 *5F047F515AE0541CC1E403F6E1A2EFC2EBB91E4C leequan8
913,003,590 *5F0B4AB095087BE64B6054BD86622F1935ACF2A1 leifbonfiglio
913,003,591 *5F00ECDD2E7AA2D1266FEC3C1426FF5E6DC22FCB GRAFIXSC
913,003,592 *5F0669311FAC1E4E84C38E01591E9102B4900215 grahamkoenig
913,003,593 *5F01706BF3A888C57805D9BC600ADB1FB355A190 GRANDISSANT7
913,003,594 *5F0FE213E8C86B2C796438C5B69C348FEC214628 [email protected]
913,003,595 *5F09ED7F6B02F352E64825C4DD461124F66F6995 granvilleramones
913,003,596 *5F0DFA9B54B74527F865F300956F5AA5249D8005 grap3-gr3
913,003,597 *5F078DA1A1BD0ACA31AEAF9BBC2433327DF47350 LEONEL.FAVUZZI
913,003,598 *5F0EFE09C341C1162003B23550D1AA6362BA37FC LEOPOLDO.EISLER
913,003,599 *5F07E52C9BE024C79397D17D76D4400232705FC7 greenberg6
913,003,600 *5F0C232BB08D19E5EA50CAD040173B9855E2F2D6 leslie.furtado
913,003,601 *5F0DE4B334B769589632D5AE7DE5A3801EDF4388 l'g2fp
913,003,602 *5F0AB256A19F689EEF3297EC30AAB939C6B932D5 GUNS,BOOZE&SEX
913,003,603 *5F003835EEB8C7083424972533513402A31AB45C [email protected]
913,003,604 *5F04D30D9BCFA3B705AD3A26884C4CC6549E3A6E lincolnelementary
913,003,605 *5F000E3C7370C7BD695381C065E1346428D1FAD1 H0Z7
913,003,606 *5F0BE91606C187CF376070107957D7DA2AF7D43D HALFSTRAINED.H/&/F_STR/EI/ND
913,003,607 *5F0D9A79B5C138C8AB740DD9594C3D39B8704615 [email protected]
913,003,608 *5F09091C3F0DAD6CF0D2806AD92797F02A898EB4 LIZARD,HISSONG
913,003,609 *5F03F75616301B6AB23FC59943FB52FE055454F0 HARIDOSO
913,003,610 *5F08343C760B3BD8D7DC17657E59C8D1EA6DAF7D LOCATIVO1
913,003,611 *5F05F697DB88F113D93F07ACF6EEDCEF5FDB7ED5 harveymonteagudo
913,003,612 *5F0896C2DE79E47ABEA0FA36202A8AB5CEA26AE8 [email protected]
913,003,613 *5F06E06463CF67382118B589C6646721089EF7CD loop.time
913,003,614 *5F0613839042F708E49E0C817F84739A0855C1CA looselyfederated
913,003,615 *5F0AE421D68D1B56FF1777E81D09FAB43ACFC0F7 lords-of-acid
913,003,616 *5F06179CC37C5DE29F3D13513FCC86CCB6DDD85C LOU.HANKEY
913,003,617 *5F025C5D21F70D41E759B152BF7B24599FCE3C51 louise.bennie
913,003,618 *5F09B893AA8187D803A077C19462D646EC4FB81E louweihbrecht
913,003,619 *5F037D8D1B1BA695A955FEA4047B3815046AEF6F LTHTTPWWWANGLICAN-N
913,003,620 *5F0D5F1A500EE52296D3C7F4E49FBC5C756FC778 [email protected]
913,003,621 *5F003A59B7D4CA2CA11971A4C5C0A0360F650F68 LUCASLAGRAVE
913,003,622 *5F04B79919B0782557B9035E22AEF4595163287C L’UGIF
913,003,623 *5F06C0AA86DC814205D0FCFBC4BE295D1B86987E HETMANIS
913,003,624 *5F02945D8594711CCFF9B86C4BC07281AEA1A0E0 [email protected]
913,003,625 *5F003E4E9E7834D3CD756B48960B5971CECC72A4 H\IK
913,003,626 *5F0DC77D0123115007A9040B9C9758DF4F701D4C lynndumar
913,003,627 *5F0770671C38FB7720F1659E98BCF330B8061B0D [email protected]
913,003,628 *5F0F2DC8D6970D31FF106CFCA4E6BAEADFC889A3 M1R3L4G3N1C4
913,003,629 *5F06CB69DF0EAAB97E181EC382C53E7AE4326C41 M4N!F3S+4+!V3
913,003,630 *5F0AFC2481953CA49EC236FC110773326A6F045E maintitle(riverview)
913,003,631 *5F00A8875184307C1C4BF93242E1E5911DC7E070 MANDJESKOPEN8
913,003,632 *5F0BA987B2CA3B3E0F70814BC5CCB3DE50D3DC02 hpsmembsw
913,003,633 *5F00D003FFCB6DCF1515084F4593893598F12501 MARCELSEARA
913,003,634 *5F04EC07F3B5D76566B30871242EB35199958458 marchtosiliconpalace
913,003,635 *5F0811E33531CBF3F8362843747A322BBB020C77 HUMANMONKEYS(RADIOEDIT)
913,003,636 *5F0B994F8BEE300739AC64BE08518F56AD01A47B HUNGBUGANSKI
913,003,637 *5F0DEF47BB637DE8D9F77831E57A95998B24B96D HUSSEIN HAMADI
913,003,638 *5F05004F10C229B969F0CE4B04532A0ED4E44051 MASTANA1
913,003,639 *5F02C7545E0B9D94AF1E4B949CB3602ED483D912 IAMDAN24
913,003,640 *5F0C6AD60C936736C2511FEC70F3DCAFD2EB7A74 MICAH.GUNSOLLEY
913,003,641 *5F02C69F13F20ED9CCF0A27C9CFB38E2F7317C28 [email protected]
913,003,642 *5F0CDDC253800E8C1C96A3AACA312DAFA9039092 ILOVEFUCKER44
913,003,643 *5F0CDBD220A4FFBDBB1E265333429A42E561D688 ILUVBLESSED65
913,003,644 *5F0FD37EAEE6D2B8E8BA44D6E7C49BE36657EC87 mike-veatch
913,003,645 *5F078CD372EF0A8F224067AFD063D8254B70761C imanras0
913,003,646 *5F052194F3C57CC3030AC120FF09F09421D7675A MITCHEL.STRASSER
913,003,647 *5F0576A8A38961A693E7D420AD25A91042B8B153 [email protected]
913,003,648 *5F02CF919351DB188AA329BE9F2482883785DF7B [email protected]
913,003,649 *5F0B3E37D673A0A0603EB3C3FECD1B2889CF87BC INGELOSIRE8
913,003,650 *5F0E86BF7993931FF52AA076BBC64BC85F6D2E09 mm?aa
913,003,651 *5F0D8286B13E5E12A258E6BF599914D549C67F70 Insect/NervousNuance
913,003,652 *5F05981C51448DCA2B279FE52868594A1990DD49 MONTYCRIADO
913,003,653 *5F0DCD09999A74810FDFE9141E20A124035D849B Moodof
913,003,654 *5F0DD65FA18EE754BCA8680E98606F6347D05085 moon-lotus
913,003,655 *5F08769C6E7DF16C5679B10D0C1ED211D205DE4F IRVINWIN
913,003,656 *5F00F11C20CC60F4BCC9155DFAFE404725855781 ISELJENA6
913,003,657 *5F014F778039D59EB6422A36D773C09A3164227E mpvhwvd2
913,003,658 *5F048C7560B8CCEE88D90856D2478709716F9ECB it'smurda(cableguyremix)(feat.jarule,jay-z,dmx)
913,003,659 *5F0042F44A5007D8C430515889191E187020630D [email protected]
913,003,660 *5F00EEEB18EAD384E093CEAEB07365FDD0DB4DFC jaarling3
913,003,661 *5F0391EE3F59F0326AF40E0F3774CF001AC102AA JAE.CORGIAT
913,003,662 *5F010027D17C68F158975BD51957385044F56C9F JAMAL.GOYDA
913,003,663 *5F0FC7FD75332698CF6BFF87FFBB659530524F8F N79597
913,003,664 *5F0B23C76A422E14F93D38AA4BAB0F4B7D2F556C NA7!ONA1!S7!CA11Y
913,003,665 *5F0C8084324F11A3FCA60E3DCF1149EE4832EEB1 james-schauss
913,003,666 *5F0EC4A25C913E7E4FD9F4F1137748BF158E673E NAIMA-ANSARI
913,003,667 *5F0DD6FAE655F0DE7B265CB6A71A47B32246AFBF JAN.CHADDLESONE
913,003,668 *5F042D6E0BE1154D5BC5DEC73EF7C70FF146073A janet.houlihan
913,003,669 *5F020227E045C37C49DDAF1965BE5212A43947D9 janstolecki
913,003,670 *5F073353D34C5BB59A30D5D2E67ACA4941462D20 jasonkilbury
913,003,671 *5F01BCBF639B9800E5CDC05FCD8588F96EB6DAE5 jaymesmith
913,003,672 *5F083D9B08C978339D13069B4D091B7918289520 JCGEFROH
913,003,673 *5F0F3D484BBA5DAA0CE049C0529C4FAADFB58EDA NCHTMRRSED
913,003,674 *5F0C5E5CC884FF8142DE8F93ACE4C89ED973A391 jeff.dobson
913,003,675 *5F000A284A2796EE839AE2970EC8CF01B5A76A00 [email protected]
913,003,676 *5F0073005F4A7BF926081AC07C00FE6736CF0F11 NICKOLAS.CONELLI
913,003,677 *5F0EB22B97E59EDABBE7AA017035D806C281A42B JERUSALEM HILLS
913,003,678 *5F097734435B224EC851F6CBD8A2A201219F9F7B NIMALI.KUMARI
913,003,679 *5F0ED2A10ACB141D7BDA2E78232498AF01342697 [email protected]
913,003,680 *5F0DC91A02E56ECB316890D2F89CE0B56AD170D2 nm!m
913,003,681 *5F09EB88DF93EADBEDE39863FC270095C321A95C JIMMYDEODATO
913,003,682 *5F0E091FFF7768E720A0D332E67433FE76668AA7 nokia2255
913,003,683 *5F0938E655974821D7F76AE251F8CC5B93E4F2B4 JOEYGOROVITZ
913,003,684 *5F0C355AC654A738262A0629608E36EB825ECEE5 [email protected]
913,003,685 *5F0BA31FDE06ED9C3017599DFA7E38A0C9BDC193 JOHN.MORLAY
913,003,686 *5F0E7F890C31265F985E859AFFAC23C44A2F7147 jonasmardirosian
913,003,687 *5F0EF5F01CD10E5253C55B136D7A359486B95CE3 JONATHAN.SCHOEPFLIN
913,003,688 *5F0BA964C1237DA276E36CF9F5493EFACB25E7F5 jordonkwit
913,003,689 *5F052466F28A74BB256D06338EAA535152C75601 jose-13
913,003,690 *5F04FF1BA88B11C7DD414F22E44CFF8FFB242B12 [email protected]
913,003,691 *5F0A943C4A9054F3205BF3821B282EA5A076FB6B OGEIDNA8
913,003,692 *5F023A9B251649D4EB50CF9817E152E0457E1DEF O-HOLY-NIGHT-CHA-CHA-CHA
913,003,693 *5F025B47B890379BDAA22AA2DF0FF7F685E8913F OLIN.GOE
913,003,694 *5F0E322AC374F2107FBA97022E0D86CFC09F86CA OLO.
913,003,695 *5F05A70D4BD2AF0045F11C21BC277573F5CDE924 OMLAEGNINGEN.
913,003,696 *5F0B5900BC5C6F948B1CAE72269FEC18040C15DD ONE-GOOD-USE-FOR-MY-HEART
913,003,697 *5F022D378E8817E6EA9FA958C70BD1F7A587957B [email protected]
913,003,698 *5F053DCC6832F74F8F4852CA97E01A3964D3D1E8 jūrinę
913,003,699 *5F0E8AF8479A85A85EF06E131645B5762CF66045 JUST SAY SO (FEAT.VERBAL(MFLO))
913,003,700 *5F0C316B11B138DF27CAAD577521A57E743E0BDB (o_)*@q
913,003,701 *5F03A8D03D0876D98E4E7EC45D8D7FD7BEFA589F k$}*
913,003,702 *5F02978252E5526B5259DABBCF3F5639126BCD8D ORIONSKIPPER
913,003,703 *5F0685B3BDE4F7077613619398E093B83BA27561 kareemrosky
913,003,704 *5F0323210976C376365FB7A2A83C794160799560 oswaldowincapaw
913,003,705 *5F07DA911A44D848D12E33E3D9EFCC4B35CBB3A8 overskat4
913,003,706 *5F037B725333145493ECDEE6C933EC558054F74A p0m3r4n4n
913,003,707 *5F0A19DE18FE961DD00801E44F91D39748041626 [email protected]*.*.*.~0~oSplat
913,003,708 *5F0FB78FF9CB6D333ECE26255428239B65C53337 KECHITA JAIN
913,003,709 *5F0A96CDBF2E54933ECDE94E7CF211AB4AEC4D6A KEILEIGH.TURNER
913,003,710 *5F05D1F4D8F714803B4F0EE968D943CEAE964FC3 pa_&
913,003,711 *5F0966FB8013B929DBBEB7099B338BB72969F261 PA+HO1O9S+
913,003,712 *5F0E3429DBEF03DF45E84A8A1B366CD1B6688057 PARAELDOCTOR!!
913,003,713 *5F02163B8FBA70721113CDB5E0FB64BF71AF0D96 parkway9
913,003,714 *5F08B1DF55E3A7D3EA7AB034BEB51D0FDCEF0B91 passagiersdienst2
913,003,715 *5F0E96013DC0DE9125460901BECB8FC046A74E34 P=====B.*.*.*.~0~o}8{
913,003,716 *5F05554421480BDCF408BC3D54D527083B8F0077 kinenkanmikasa
913,003,717 *5F0CC1E07B3AAF5D98F4D5CAA4AF81AA412DF5A6 kkdbbap0z
913,003,718 *5F0EF09724D13A28495A1E301FF5175D2FA51DE0 PETORIH0
913,003,719 *5F015B017801076DB22EA2C2FEA387022DE62D56 philiplamonica
913,003,720 *5F065AF7B0AB67DA71CF95BA66E39D8F9E9A59B1 KOTCIKP
913,003,721 *5F0353A741F27A533A6E19899888A1F4ECD80385 pihstfos9
913,003,722 *5F086001CF2C959AD416BEC24AFE04002A6EA293 PODOSOWA
913,003,723 *5F01FDF1BD088FE084A0912320FA592F23C87A90 L0C01SMS
913,003,724 *5F0306B4769F418E0DCFE7669C222C07CF19C037 POPADALE7
913,003,725 *5F0F2F5AF0E7C66CF54FF840AF527E3D1C4419DE labortocost
913,003,726 *5F0AC8E28840418CA8828CA2B8A43613B0DDE28F POSTAUJC3
913,003,727 *5F0E65CBBFB9165BB30B83C3B5C7EB708A19121F P#P-`~-`~>-B0
913,003,728 *5F0F26A0DFCF8C9F2A33F7D60AC65EFE93D7A22B [email protected]
913,003,729 *5F0E54C1C105A2F49EB74BE655924EE63CF2BB29 LAMONT.NERI
913,003,730 *5F062034BC62019E4CCAD98A43A3500F19974D66 [email protected]
913,003,731 *5F0271B3A05E1311358CA31B8EFE1B26D101523A laura-glendenning
913,003,732 *5F079514F11272190CE522EE324464EFAF4B60F6 PRINCSA4
913,003,733 *5F04351185A76B327D0440159F328F1C63D9CA3D LAZARO.DICIOCCIO
913,003,734 *5F014065C343BC2F1A39A8801D2DC635C3B5D758 „PROMINENTENALBUM“
913,003,735 *5F034BC3B86CB546D870143A5C8239BB8CBEB2CB leighreily
913,003,736 *5F0B8803461E409281CE17A29A54F39D659C74BC [email protected]
913,003,737 *5F00D237462D4E4937F05E8806984D6C0465D84B LEMUEL.BEAVERS
913,003,738 *5F0AFD84B7ECAD45980A19A993E087357CE17EB1 lenardsiemens
913,003,739 *5F09E92D77D081624687BD1523CDB084F1F6AA84 Le-pape-immobile
913,003,740 *5F0BEC03EEC5E80E8221F61B83D98FA5FC0E0F74 LEROY.KEMERY
913,003,741 *5F02C2B71C0CF18658355BBDFD4CA3087648D57C lesbrotherton
913,003,742 *5F09B09A90EB95AF750D12B4EEFB3046FE7CCA85 LETALITE6
913,003,743 *5F0858C28BD52222420B8B48E776A9C644A37D32 Q-D~O)X(
913,003,744 *5F0CFF3AE77C1ED38CE1DC90C5AB1C99E5AC08FB [email protected]
913,003,745 *5F02659BD0D6A8607BE04B85312EFB6F51E5C511 libraryqmulacukwww
913,003,746 *5F0668F959F2805154ED6E384AF03A3EC1F5C247 q=).~O.~osplat!!
913,003,747 *5F0A5AAEF0DAED5D76BBFE3A5AB3E6206C1B4A13 LI++LE5
913,003,748 *5F0B881B82A600C9D2462709730300249176D09B q=====>`~`~splat!
913,003,749 *5F0027288457F4D43FDA6F4448FFDC2E5A084603 [email protected]
913,003,750 *5F0678ABBE94ED98385CDFB2B500939613665BCE QUENTIN.BRENDON
913,003,751 *5F0E1DBB299E26977BD6AB55156ECFEC8667C170 R2UU
913,003,752 *5F0061393D9A9864C611107BF967719E3D7088FE RADIATORE0
913,003,753 *5F0EFE978A2718351157085DB51ECAFB5154730C RAFFERTZ7
913,003,754 *5F00B768EBFFD3CF03053E5531B7E3DD08D28E6F Raleigh.and.Spencer
913,003,755 *5F050F9ED90684EBD4E23313792AB4067F8B2096 LÖKDÖSÉS
913,003,756 *5F0C53459A51089E31B7894752C1AA82CB6E301E LOKIERO...
913,003,757 *5F05FB37C79FF916108CFAEEFC7EA56769B5E5D3 LOLLY0803
913,003,758 *5F090818F9E8B58C38E6A32329652C730997AC8F RASHBRAIN1234
913,003,759 *5F00B9999AB05187E4069BDE8025181397517BB4 LOUIE.BARTLES
913,003,760 *5F0C5E49A133FA6E4BF403E1423A5166270C0456 RAYADOR6
913,003,761 *5F065CAF6688EA133772ADE3ABDDE719F065D648 LUCIUS.TURBER
913,003,762 *5F02D4FA87797A15B352F1213F2ED626312CDF13 luckybenny
913,003,763 *5F0267BC09E8CF4E84E4B3CD0B939150A6921689 luisevelez
913,003,764 *5F0B4A78EF416E680D4173A7F3402BACDA81A9A7 [email protected]
913,003,765 *5F0FC0F37C567A7107EFF86B01E18E00B59235A9 LURA0
913,003,766 *5F04B62334D5747839B8A84F84DF2246395D7557 REGIPPIK3
913,003,767 *5F0F2434AAF9EEAA129457A4D0F0853FFDC54169 REINALDO.BERTALAN
913,003,768 *5F09E7BF77FFE485FCD4F935161EC1A572A03D04 reinasdelaoscuridad
913,003,769 *5F04DB582E5A00EEA4E19814165C43A347B8D625 renesaglimbeni
913,003,770 *5F054469922B3914EFF9B0DE170CFF40CF396F23 M0D0RR4R315
913,003,771 *5F0C371950AF81A5E226D3C62B4EE6584890210A REPOLDUO1
913,003,772 *5F0E163015629016BF965E1DEFA4F816CFB47243 RETIARTS6
913,003,773 *5F026DABFFBF5ACC3577AAF909A3AECCAB0DB2F5 maible
913,003,774 *5F0145CC8913673BD71D00E85E62B4490211A996 RHAIYHANB
913,003,775 *5F0B546D981AA9620F9A0E5789B75F605E775B03 MAKHI237
913,003,776 *5F030CFAE193920C010632232BE4870976341ADA RHESHOOP
913,003,777 *5F0570F79CDE288F03739B96AB4A813986634804 MAKSUTAVALLAAN
913,003,778 *5F0AC5DD643F7CD05D2B33781DF5D803980F35BA rhopalocerus
913,003,779 *5F0381CCA45AA43C7E19F3D02C9A79213D07D02E malerei–skulptur
913,003,780 *5F028E6241DBB128CF044BB6CF8563BE4190368D [email protected]
913,003,781 *5F0D377E266448066FBDFAA4906A194532853EDE MÁNDIN
913,003,782 *5F08F40C3837E0AD6C7D27C913C12184645DA466 RICH LAMMERS
913,003,783 *5F07DF848275C38FF6DB35EB428F24817FF662AF rickzalar
913,003,784 *5F080D10737A82443BEB858C3AA3C43231411F19 rico.moises
913,003,785 *5F0BC546F0378981D8D8E480040CEE4307EFA499 RMGNTSTNED
913,003,786 *5F04301627BE1F3E5C15C51A3A443E545483BA18 RMLTPLYING
913,003,787 *5F03546DF452FD2DFA231056830B8B4B1072C90D ROBBY.YORKE
913,003,788 *5F0DFA61234ED7ED0C1BC5E2E621EF40A93EEE6B MARIANO.KNEZEVICH
913,003,789 *5F0787A66BCC3B1F502AA9BB40779F1F1E42BB40 MARIANO.YAMIN
913,003,790 *5F0E886A4ACBFE6A5FBF561A3D2D68197052B65D MARIBEL.VIEYRA
913,003,791 *5F0959E73247AD9C751145AB0814DA3FE540BFD0 RODERICK.GLADYSIEWSKI
913,003,792 *5F0A1AA537265F5CE618D12D25C6583B25742C94 mark-stubbert
913,003,793 *5F0320D2C4E55EDC3785CF891C7153C0D3CE278C MARLINSOLONAR
913,003,794 *5F06ECB2BC0E363B238AF3B30F69990E89FE36E8 MARLONBAUMER
913,003,795 *5F0BA775F2A5391BBD0FBE20EDA0212F06D61073 ROELLON6
913,003,796 *5F0DF7D44508C722DC77A590396A6E599E7E3063 rolandcarlberg
913,003,797 *5F0823B0C7F7E7AC245F76F22071FE76D6FA7F03 MARXCHEN
913,003,798 *5F0260F95C8554B46B9A255E7E2885D7A753F09E ROLANDPORAT
913,003,799 *5F02830362AF0249F21CE2A97DB01C5DD0057E17 ROLLANDSEBREE
913,003,800 *5F02B92672DC66C24E62D5A5AABC0AA17CA3AA00 RONNYSCHLINGER
913,003,801 *5F04DEFFB9C3842609FBFA0C81DC2140EF82E50A MAXIMOWORSLEY
913,003,802 *5F09BE412CAA0FCA44BE74664B77AF0AF987B58D ROYCEFORMBY
913,003,803 *5F0C5D08F77A97522A4433717FFDDEB211B1D6D2 maynardkoors
913,003,804 *5F0FBDFA3971FBA625D55BF7BBD30A4A078CFEA4 ROZKRICENIMI1
913,003,805 *5F0AB1BAB20C5226483D76AA367F8CD90A386EFB rthptrd
913,003,806 *5F0922799FCF479B4C42A2170C0EDF89C6582816 MEGAN COPP
913,003,807 *5F0FCC7BC097D6C98B649123323045601024721D melanie.newland
913,003,808 *5F0C6F0F6EF228CB3FFF6A33A80DA1C499ECFF71 melclaire
913,003,809 *5F04A1D40844F53350D1C6E4EB68B730836A3D56 melissa-ungureanu
913,003,810 *5F0512F0BB1969C38AF6907CCDB8DA3A6815FE64 merefieling
913,003,811 *5F0CC9B0AA31298B0C3FDE09C6E2810DAC5B55BC RYAN-PILLAR
913,003,812 *5F06281ADB4E3EC307F93FD1A739063C20E13115 merlindwire
913,003,813 *5F0CFD0A48D745DB0730CCF265DFB3191DE56289 S+0RNG
913,003,814 *5F020E04E1D20496DC59BCA32934D820E2FD7AF0 SAJEEV VC
913,003,815 *5F0FA9CC00A0F92AFCB75ED5367B0049FE3AC609 SAMGARTLEY
913,003,816 *5F0E81F89294219DE0F6E88C300223813672CEAA [email protected]
913,003,817 *5F073E7C613413B7E4FDDD79C84B48FD8376B623 [email protected]#MICHO
913,003,818 *5F068614CDBF0E039DB01491C6094BB721292624 microbialfuelcellorgwww
913,003,819 *5F05F6A3B950386AD575027F3351BF8A19B47B96 [email protected]
913,003,820 *5F0DC4903BA61F8EF2982B0ACE925971B11C2FC5 samuelfierst
913,003,821 *5F0E3461CEFDF54134C1D941C3B94A8F46103597 mijevita
913,003,822 *5F0CFEBE5666BFD7419A874858B8C8B3E357A17C MIKEKAAS
913,003,823 *5F0B766EB8A75E9DD9A049392E318651486C471F MIKEL.GABAY
913,003,824 *5F0D6722404C0E9FBFE65B7D8C3371E80FDA0726 santocipkowski
913,003,825 *5F028D7D9D2F923244B079AD8DF1682DD88E5F79 MILLARD.SCHELLENBERGE
913,003,826 *5F0EDC7ECA438DA18D7AE85FC80B4A5E5FFB21EB MILLIPED6
913,003,827 *5F046BE73BBA1C87CD35E58A022622BAAFDEA670 SARELPUCING
913,003,828 *5F066B721FEC7E1B5BA5C661EF48F3746C216BF1 [email protected]
913,003,829 *5F0489BEE9607D4F342E8714A37D49DA950FD9D3 SAXICAV0
913,003,830 *5F0B0820B036BF5A081B07684FC779B8FCC07C4B 『MKD』のデフォルトカラーは肉体が肌色になっている
913,003,831 *5F046CF437DE05D49B56DBA56C98D0123C8292CC MONOCYST1DE4
913,003,832 *5F0D54D341623C544463D206F435746444F04611 sekiensogenbi
913,003,833 *5F06E4A03BDE173368DDDABFD6179BC1E674A9E4 M.>R
913,003,834 *5F046010D66CC6C95A7AF3AEF765C0783782F670 SETSAVKOH
913,003,835 *5F09B67C91E4B35437F1EC6218D67FB4609C581F sevenroad
913,003,836 *5F0E90236ADE1461ADC1282BC5D18D383B6CF804 musikiysky
913,003,837 *5F05F951ABACC17132C4B0F5ACCC01A379FB5284 shashavath
913,003,838 *5F054632486551C98AA9402F532932BA00EE274C MYRONALEXY
913,003,839 *5F0555AE7516C7111166EBE42597C91E8BD423E8 SHELBY.CANNELL
913,003,840 *5F0CC8ECED69A15D22A7145F42EDC206912A1226 SHERMAN.WINKLEBLACK
913,003,841 *5F0C8F3BD6BD5E49DAE622DD583271128A0AE2BE [email protected]
913,003,842 *5F06BD7195D1DA38B2F4C5C06B5B59E74AF14A18 SHONKOURKOUMELLIS
913,003,843 *5F07CDEE1E7609C0C9C72A096106472D7A4A31CC [email protected]
913,003,844 *5F0C2653CDD454C3042620262406ED45B9D79CF2 natalie.aguilera
913,003,845 *5F0EF9999A7DC725EA6817C58FEAB08AEAC86BD5 sigillatas
913,003,846 *5F097CD519BA700E7A30778262E2F85F0C80F9F6 SINTA-KARTIKASARI
913,003,847 *5F0A0DCE865B882CCEF71FBDE53AE7093A141F88 NEDCATICI
913,003,848 *5F0A176C127B92A2AB94A9D18216CEB648A178C2 negseuh1
913,003,849 *5F090CCD4D50A0D564DC7A37CB9ABF0DD55E098A nelsonmabins
913,003,850 *5F0FF6DD47B2C3DDF7E9D52FA27E15CB6B907731 NESKRIVLJENA1
913,003,851 *5F078C5EC51606E611FC98F71AB2D0B1E2566239 new chachacha
913,003,852 *5F028700D6D6C5A5A6DAFA70DB9528A8C1C5156F SNODERAS
913,003,853 *5F0F73020447B6CCB9F3EA5DEEEB827298D1004D NIDADDAH
913,003,854 *5F07CF8ECDBBBC541CDB26E8253B2D058431B0C7 NIEMBSWS
913,003,855 *5F064FB0D134502F7BA8D92E48729D82B25530BD NIGEL.CORSCADDEN
913,003,856 *5F09D2803886B58CE91C9997401F8E72BE24977B NINETIETHN:NINETIETHS
913,003,857 *5F0B2AEC3A868B0512200B9C785E48AE09359249 SONNYCAO
913,003,858 *5F0A46D1E4140840D1291C9197985F7EF346E459 no-1-dance-hits,-volume-2
913,003,859 *5F0E4F0B43227D413B6F4490E69E3EE7DFC0E2C8 NOITALLETSNOKTSET
913,003,860 *5F05E746D67E6D556AC61BE4F05947327B031A6E nor.azam.ahmad
913,003,861 *5F0F6570057273535F3D6F93ABBC5233AB4F3E85 SPBLHJH8VV8C
913,003,862 *5F074FBC6127D990485C70B14EF046C9A9A02644 NORBERTPINEDA
913,003,863 *5F049D9FEEE2113C1B322AD2A9EB6D56DE2316F2 SPEEDYPOLARIS6
913,003,864 *5F0CB61E8192D1DF0BA18FC99E1FFE4B0FFADA14 SPENCER.CARKHUFF
913,003,865 *5F0FA21AA40A031F177F2C55220E07C7D14FD3FB SPILSSEMAD
913,003,866 *5F0EEB766227B2E8B24A04B80E55B279EBC20AAA SPLAT!! O~ <####B
913,003,867 *5F0D6FEECD9E3CB99B4D1ED169F1AD8103A5FDAE numix klazzics
913,003,868 *5F07DB2EF8981ED4C68644F1E7B3D146AA71AB29 SPLOITO~O~(P
913,003,869 *5F07BF3059AD56122D5DB478619BFFA11BCDBA31 [email protected]
913,003,870 *5F0D2C376EB0697B688290F3BB5ADFAC4FDA64D4 sruetanimaxe
913,003,871 *5F02013F0DF6182E82EBE841712BFF8F30C0A7E8 [email protected]
913,003,872 *5F0B41148C07803F035B9D2DC9C02385EDCA800E OHIOSUBURBAN
913,003,873 *5F0CE4466E754D47D3027A402349A8C27EFF3B9C STARIJEV
913,003,874 *5F05AEBA83C265B295556D2B462B4A34E043DFA2 omerharoldson
913,003,875 *5F0E1F718AC459E1C844775432058BA49EFEC637 OMITIST3S
913,003,876 *5F0A4D59196ADF8C17E04DF027B7EC35DEBD5A8F )o(o~o~.qq
913,003,877 *5F0A12CF4D2F1BB6113AF10C63EB6185E4DA49E5 ÖRVÖS
913,003,878 *5F0CE953BD26E5412B3ED2AEFC2064FF87865C0B SUCH A NIGHT OF STARS
913,003,879 *5F0625E02854EE2CFB17376A28DA8AE204C7AAF9 SUCKERBAIT7
913,003,880 *5F062C790CFC659FB7D837665060C53FFA23CC5F supereurobeat111
913,003,881 *5F0E4E94A415FFAAE6C87DB004A30F6686A0B340 SWARM!NG
913,003,882 *5F00A0578A38E4105D132D137A5BEDBA85C1C089 PALLET-TAIL
913,003,883 *5F00B61A1E78F2FCF2316BCDE98041265512D3EA [email protected]
913,003,884 *5F063D5AA5E0AF5367358D6404E30525090720B0 TAGASIBAL
913,003,885 *5F0F109014C554D879C888E64F00021DD699C475 PAROEMIO
913,003,886 *5F05B60DAD8E0226C305A4AB997B45032BEA3EB4 TALKPOWERSTOKNOW
913,003,887 *5F004EDF74E120345D041B0C1A4D526EC3125CBF PAUWOOGROG
913,003,888 *5F079ACB4B9E589278196FA7D7FCC9150955DC21 pB ~ ~ )o(
913,003,889 *5F0178F0312C70A63CD3E9BD9774016E34E8E7AD TEGNUINOC
913,003,890 *5F0F365595A00FB7CA2C22376C4102664F519DF4 phildemma
913,003,891 *5F0E71EF03A9974D2A46E13CD99BFBE6AE089A50 teresa.fogel
913,003,892 *5F068E05456E97A2CDF9368A1E262A44A152AA35 PHRG
913,003,893 *5F01CD452952608B07C32C3CD0F428B4B4C9F4FB THAMEEN4
913,003,894 *5F0EDFC2F949FBECF54983E6CEA5643D990689AA PL1CKET0910
913,003,895 *5F0553603F18714F70DD296D988D3770C394C7AD [email protected]
913,003,896 *5F069942D231ED0B3914E979FCAD3A02792DDB7D the.last.heat
913,003,897 *5F0ED45251FCAF1AA49BD68380133B10C0C303C8 THEMONTROSE2006
913,003,898 *5F05391AFD245C7BBE4DA5D647176226FE535C9F THEQWASZX65
913,003,899 *5F019A6ED513FC8193A649B807517D0D19283179 TIME.FOR.WINNING
913,003,900 *5F003245E3D47D0BC1A4BEF1FCF3171527D2B3F2 TIMMYCIULLA
913,003,901 *5F08BFE9D163BE1407B80D798DA84D167EE8BEDB TIM WALK
913,003,902 *5F0EEF00DF076191EF46F2B11679A111A20E1737 procentuele
913,003,903 *5F09671E904B80B8691BDE5F54706FFADC2491DD TITANENREGELN
913,003,904 *5F0B8DA01618185C075FCBFE28A148CCED19342A titusweaks
913,003,905 *5F0EE45D80F32472A5864025BE754D5C30D1344D PROLIBERTYCOMPROLIBERTY
913,003,906 *5F0AF36C552D727CC4DFBC119C82BDD7911BF153 pscnihqu7
913,003,907 *5F07267BA0E1D5D628A65453F71D592781B33F74 PUOLA-TYNG
913,003,908 *5F01B20AEF4B718652E5ACBCBD0CBCB9F135EC62 QC[8
913,003,909 *5F05A87FE7A3C14B4F91CDC5BE8E404E24E6C21F [email protected]
913,003,910 *5F0E3B225A307E4943EA8251B1C318CE8A5C773E TORONTOELECTRIC
913,003,911 *5F09751C3089EA033F65EE41C35787DC34646C16 TRACYTURES
913,003,912 *5F07D0C4FFF034EDF5297742706BBBDECCF5C991 QUEENSRYCHEFAQ
913,003,913 *5F082013B8724D48A29A18BA5C022C48CB8F4329 transiteraient9
913,003,914 *5F02A7CAC451E21F142BC6815A7343BA2614F4E2 [email protected]
913,003,915 *5F01737438CD7DBBE3389E96C29FC5D5B0257EE7 troy-heathman
913,003,916 *5F0023340942923B8BB34EBB68188610817CEB7B TRYBUMY
913,003,917 *5F0F9883F416590CC58050EA09EDD9AFFC0D007A TSINCHUMEI
913,003,918 *5F085460933A4ABB1C12A2733D982C7B86E9928D RASA54YANG
913,003,919 *5F0272A2B57D54AC0C4834FECC224F82CABF1415 TYRELLREUVEN
913,003,920 *5F0402BE0CDF945B579A88150833DB3B02C3F2C9 REC4LCUL4TE5
913,003,921 *5F0B83A8F48FE480626AB46233C88C86FC68099A ua?s
913,003,922 *5F043F5E3E6DD303D5310FD0412233CD14A9D522 [email protected]
913,003,923 *5F00DF63B751BC5EC9CA07F1D5AFA9A0EA84B2F6 UISTERIJ3
913,003,924 *5F0BDD4FA229D4B18D66084ACDB9D4CC7531F2BA UK?4
913,003,925 *5F031DDBC207F8DC69372688886493D2CB5CC1E2 reinette.du.preez
913,003,926 *5F0F228C305C3F6933B33B0A2204D54FAD952183 RELIQUÉFIAIENT
913,003,927 *5F0623B15366FE94ACE1EF9F2AAFD0701C626C9A [email protected]@tonsts
913,003,928 *5F059D5F80F171D81F6BD3046DCA842222D506E1 UNSWAGGERINGLIES
913,003,929 *5F02EB3C9B62384EC59362A99729646BF3867908 [email protected]
913,003,930 *5F0CDC7FE8AA465E6658A9C6C017442A84161CAC USER709624729
913,003,931 *5F091FAF4E744DA5CEDB239A0138FFDEE9A72E4D USERSLIKE2TESTTEMPLA
913,003,932 *5F0FE2C00BECF5A7BDE0245811F16EE1A5C28702 REVOLUTIONARIESREVCO
913,003,933 *5F04CC6C98FE18FF9005E782F7671EF96BDB34A6 REX.BOBE
913,003,934 *5F0F79941FAAA0F9A65B1496E4DA9EC909CFED71 RHEIN
913,003,935 *5F0D75733C40D777A067BC2E9E33CB59C3D6FB4F RICKTAGLIALATELA
913,003,936 *5F0FF49F14369A2C978DD31A9784548AF32BB745 RICKY.HIERHOLZER
913,003,937 *5F095C4F071D7449BB9328273264BE47E0661AFB RIGHTPTR4
913,003,938 *5F0AF1015985D017AF70D7E4951679AEB234F2F6 vanceriggen
913,003,939 *5F0879E8D79B55FA3B95ECDEF592092810C2BC7E ROBBIE.DYCHES
913,003,940 *5F0E8AF2AD2FAE63420A60C11159CD852DEC7D76 ROBERTRITACCO
913,003,941 *5F0AED2AAE1C5C5C29F4B6224AA21AC14F21FBBE VELIKE1
913,003,942 *5F0A82EB7E0953F212FCE78810456CA39B81D616 roncitaed
913,003,943 *5F0C132FB79DA2D00BBA8EB11067F7BD2BF1E1EA roneil-krishna
913,003,944 *5F0B0C437593253DBDBA4C795DC60BB731E46AE1 RONNYBENIK
913,003,945 *5F0E0D1E3C4A067EE3088CAF155AE62FB37E5BAE VEYZOVICH
913,003,946 *5F0B726B92A14612A9DDDE48017151B7FAECAE6A ROSECHARITY0
913,003,947 *5F092C321A08EFBB550FC2F6F351D0C75BBDFA96 ROSENDOTODESCO
913,003,948 *5F0424C8D0E4053E7321EA6F992249D60C9BFA3D vicharagalu
913,003,949 *5F07404D15FAF859244D38B147B82124A5923E8B VICKY FAIRTHORNE
913,003,950 *5F0F7F6536F53A3AB1762053EA6F30398E5EB2C1 roywinter
913,003,951 *5F0D0A7DAA596DA0C6F2974725C0D5F242FED085 VIIMEISENDODONVIIEMEINENRUNKKI3
913,003,952 *5F08B6CA542E5515DFD9C182B5FA67492F0254CF VINLAND SAGA
913,003,953 *5F0568941B886DB395FF6BCA3634D63C5F833401 VIOLETTREVORS
913,003,954 *5F04E04F0CED5DC10871B265FBBE39E96D0CF051 VIOLINCELLOSUITENO.3INCMAJOR,BWV1009:I.PR
913,003,955 *5F0485DFA594604280234E7F5CFF63A73EA1FBFC RUDOLPHGUTSHALL
913,003,956 *5F0309BE07F53C2774F7C5F925B4CCE271A961DB ruebenscheele
913,003,957 *5F0DDC085106B83F380EFDFA2CAE9B4140EB57AB RUGBYPEPSI2
913,003,958 *5F00CF8E80809F8B6A0378AF27616A04FA2E8B9A RUINSOFATHENS,OP.113:TURKISHMARCH
913,003,959 *5F030DD90AB72A6AFBA60143B90BF8B89598CEF1 VIVALDI,.GUITAR.CONCERTO.A.MAJOR:.ALLEGRO.NON.MOLTO
913,003,960 *5F051A6B8AF772EF95ACF40889A03CFF31A7BBF6 RUPERTCRYSTAL
913,003,961 *5F0BC1BCA00BCCAC5E59BB00FD73C8E254593024 [email protected]
913,003,962 *5F0D9F86827C2935239819643E7A74C15A0323F7 vlittjaineita
913,003,963 *5F0A832C3C7D428159AF63652AB844812B0FF57C RUSTISTALLIVIERE
913,003,964 *5F03C456B8B44BBA4D4AF4B2C9FF79E88D44D0E8 VONEMANY PHOMMCHANH
913,003,965 *5F0E3646234525AA053F97C7F0045C9ABE7C23F3 VT.CHERRYTHALIA
913,003,966 *5F0D458F17272CC052CDFFEF21F69E227DFF257C SAGASTARRI
913,003,967 *5F08A2C388860926F8112308ECA76A9312F7D3C3 SALGUODADNERB
913,003,968 *5F0B7ABDB1D479D2B685C1945DD4EA5A94596FBB WALAATAIE
913,003,969 *5F05FD81924461BBEE86F135650486C28752EBD3 SALLYGOLD
913,003,970 *5F0D7624BB2FCF5FEA6FCE763A0059D5E65FCE0E SALVADORBULKELEY
913,003,971 *5F0076880C31F00840E259E94040C4E45DBC2196 WALK-THROUGH-DEATH
913,003,972 *5F0DBCF773B5A44B47FE6ADC70ED43BB1071291A salvatorehutzel
913,003,973 *5F012C3A025F6558AD3950B5093FC716F64EE4C0 [email protected]
913,003,974 *5F06EF174D7CA6CF63B893B91E70690433943CB6 WARRENKATHRYN3
913,003,975 *5F09B34E87F231645230066E1F3C528A2B667015 sandybacke
913,003,976 *5F00FBA13397A15E6A2169C9069DC2CD884BF01F WAWAN.SAHLI
913,003,977 *5F06FE723C3880A4FBAC2DEEB2EC928846DFDBE5 SANFORD.SLAFF
913,003,978 *5F0286C4B7CDA0CAA82D946A205A4D34CDD41AA2 santiagobuteux
913,003,979 *5F0B9E97EC59117FA38F5CF5A1854D42888B5398 SAPEUR?
913,003,980 *5F05549E1F1C4721A871667AB24096FC0DD195D1 sasha-shelton
913,003,981 *5F0F750A1BEE94A10CC764E2F10BA97401C74F46 [email protected]
913,003,982 *5F05F8479A9261977EA8BDEEA6B1870570BA93AA sauteing
913,003,983 *5F0E1FDB24FE48B3AE81AB21B56520C9836D1599 WENDY.SCHORS
913,003,984 *5F05024B4A393C6C297805C971689A17DF013F2E SAYUTITSER
913,003,985 *5F0CAA400DBD70AAF064692842F2C75CD7A0E501 sbn2096
913,003,986 *5F0AEFF861ADEC721957F465F256D1E37B359BF0 schelmenstreken3
913,003,987 *5F0DB0C482C4EA6D797D68ED15A84B78B4792D9B SCOTTYVISKER
913,003,988 *5F0FFC6A83C1ED61C48E9F9BDED5601AF1274674 sdb
913,003,989 *5F051E39ECFECC7033686D392675EC068452F174 SEACOMBCOMBERCRASHDASHDIRTIES
913,003,990 *5F0A2C434C7CF6149A29F2F0163CCC06B1500B16 SEANFLAVIN
913,003,991 *5F04D277569EA3AE561ECC726545EB4D0D30BAC7 wileyobery
913,003,992 *5F08A0EA0717035BCD34BF8E6B8D08DDB2C8D5FB SEIMONOT9
913,003,993 *5F0051B25CEF2C1808EA54A7E36E783E776D282C seizure.(dramatic.sting)
913,003,994 *5F099D19ECE98C6892EF1146AACD95D3C78AA1B0 willisfiqueroa
913,003,995 *5F0791202F2F3141D7272A884BE552F641608F50 sensaciones-(tu-duda-y-la-m
913,003,996 *5F0A29E2CBCAB79DADA8B28B0B088DC3F51D07A5 willremmen
913,003,997 *5F07FDC290BB48B8FDB0A26442BEC0FFBBF4435E SETUPREPOSITORIES
913,003,998 *5F0DBA8EA9703D29D170A57202451D1F6F1B4959 SEUITICHE
913,003,999 *5F0B1A93BA05D1D5FFBDAEA8024650F7DA935798 winforddearson
913,004,000 *5F002C0C787C905F281C909261E46F56306E5515 SGIDLEWREV
913,004,001 *5F0919A235CAC72E0DA8C14D5F932224C8F38074 SHANNONLINDSEY9
913,004,002 *5F064FD89972CD81974AD6F98515E42A1F7158BF wmsat
913,004,003 *5F0F6C60C72B4219505A34AE4229811934DEBCD8 SHAYNE.QUIN
913,004,004 *5F0D679DDF60ED964A6B085FDB9A4B2E2F3D9AC1 SHEETTALKANTARCTICA
913,004,005 *5F01A32E13E3231F1A99570B28FD38109F65B275 [email protected]
913,004,006 *5F050CF4EF6A6708E3A433E431CE1F5ABB47A5F7 SHERINE MORAD
913,004,007 *5F079CDEFEC3B19954D8452767EF14536EF5C127 WWW.AHMEDVALVE.COM
913,004,008 *5F004286E7F18F28423864905DB3C98B0BB108B2 WWW.EDUCATIONANDEMPLOYERS.ORG
913,004,009 *5F0DC5A0BCA56CC9B5611E2E71618D8664CC2E27 shirleyfutrell
913,004,010 *5F01DB6A417EB19E9BC894A236FE2479AB3437E3 SHRIRAMSONI
913,004,011 *5F064C1876DF361E198CA14DF3B45D850C4A3779 S-HUBBY-GAVIN-ROSSDALE
913,004,012 *5F0EEA6E583B8F075128DAAEEA0E6FD6FB301964 XAVIERAAAAAA3
913,004,013 *5F0E2F756DE542B0BED2BB443E991021192C37A8 XDKNKARP
913,004,014 *5F0FFB33DAC1A7EAB01004FC78934BE3C5482170 xdy9
913,004,015 *5F00D809010E8064DCE3D1C3E82C2C841CE60409 simone-pignoni
913,004,016 *5F0813F6584622E1625EE55BF4B2CF3295B5799A xhonatan-pati
913,004,017 *5F03FE90296FD84A8505D11D4939A765D5053D67 xiao-lien-yin-mi
913,004,018 *5F0E9BAA461576CC8D99CFAFD368C442D1DD35CD [email protected]
913,004,019 *5F008F1DEAB3580DDC3E85B7735C2024D3F45E50 [email protected]
913,004,020 *5F0EC965C07D05788E3375E2F11C4F8001F95E76 skippyconrad
913,004,021 *5F0FE734FA60F72206060E6A5BE38C7A5B901412 [email protected]
913,004,022 *5F008418AA32F8B5F48F077173EFD04488E93E5A XZPG
913,004,023 *5F068DD8A47E45D5688049DED1E6A65D497F7D70 [email protected]
913,004,024 *5F06A405BA6232E53F579394A2C68F6502E2B018 YEANGE
913,004,025 *5F0F5393E2B653B5E4E3BA37E5A2DCA742E5CF54 SNOWBALSCARLET9
913,004,026 *5F0B47439E9B3BB04E92F1A113D33BD81FCBDAAE snoweivretni
913,004,027 *5F0B976CE634ED31EBA82C768691B2EC9C69349C YHIL
913,004,028 *5F0B46946C512F60107F5D3FFD445A9146EEBE33 [email protected]
913,004,029 *5F0976D8921AC21FF5AC229E9778A27E9184896C speakmail
913,004,030 *5F0AF0FBEE65C953C9F5B97ADE20DF14D89AC86C splat!!-o~-O~d----3
913,004,031 *5F077CF575036587B441AD761AD098652D60BBCB SPRINGFYRENES2
913,004,032 *5F0695805C2BBCFDF574D8084CCAE2D5CC541764 za&g
913,004,033 *5F0BAC9F037058C2E2F484F550BCDFCD664793B0 zaid019
913,004,034 *5F0585D1B68E758AB2C5B11058151EB4D1902A44 ZANIKAMIKUTZA1234
913,004,035 *5F0C33B6C89A48C6C7434960F43460A4F0DA9EB8 ZAZIEZAKARIA
913,004,036 *5F0F90BE6EC2AB90DBB756D21DAA88FF4A45FEE3 staatsinkomste
913,004,037 *5F04B057C980E195B73E3A23DB7D44AB4C599121 zhero.zi.britania
913,004,038 *5F0BFFEB03CFAFCA47632EA2F2E7E3EF19CDE85F [email protected]
913,004,039 *5F01C05F2E2F03278A30B7B2A23B647474F8669A [email protected]
913,004,040 *5F0C4D27DAA914D4E7994A3955946AACD11A95E8 [email protected]
913,004,041 *5F0C2F031D33967EEC0468149E8B036D9FE27B7B STEPHAN.MISHOE
913,004,042 *5F0CC9BDDBB4A78D8653348A7603DFEAAFA48B63 zinguer8
913,004,043 *5F0C164436F7964D4E5652BB190CC17F27E345F4 ZO4!
913,004,044 *5F0221507BE773F92BD538A8A65381128AE881AB STFUBITCH2
913,004,045 *5F0E28C7E44D3006C831511D60BEE7CB0FF4CAE0 ZPOOVATHINKAL
913,004,046 *5F0B24B2C8C511C7E4EE538692666B46E9A25E3B STOCKFORMSA|PERU
913,004,047 *5F04BBA7805B68945991C714FAB44D519725ED04 ZUPPAZTHAR
913,004,048 *5F0AAAD1A6F6C96A032A5D404465272176253312 zvux
913,004,049 *5F0A5E3BCBC2BEB0B9012194019AE9BCC3C765A8 ZXHF
913,004,050 *5F06886D971C8FF648011CC6EB81DD4BECD698CE λέβεδος
913,004,051 *5F0DE4D40D30F5564F7DBB9F906B4BDDA87003D3 suirauqafoega
913,004,052 *5F0E243D9118CC075433BC993897B616D19754AF σημειώνεισ
913,004,053 *5F045076DEF46C90116B79E5D1047B2C99C0ACD9 АЕРОДИНАМИЧЕСКОГО
913,004,054 *5F0DBB354501A2FE256A248F1153FFB07C7BE691 «барджелло»
913,004,055 *5F062316EDFD38B16134F5D6F9E4E855FC7DBD72 вандаель
913,004,056 *5F0B9C3AA75A08DC0D2F6E570A2C5B3D4030DBC5 [email protected]
913,004,057 *5F073E7A578A06E62AA1485D94280141932A867F [email protected]
913,004,058 *5F0E7037454FB93BD5AB734787BF022402C8F966 ЈУНГМАИСТЕР
913,004,059 *5F0EF4AB87307A63B2394C5CA243FAAD1441EF99 SUZANNEBETTY5
913,004,060 *5F0683C7C81E13BF4D697E4E730C5CA02D54CF9B ЛАРОУССИ
913,004,061 *5F0771C9B5B07034375A14CB2344A2215DE696FE [email protected]
913,004,062 *5F0F28E5F92C3818F91040871EC6A302ED359EFC МАШКАУЦЫ
913,004,063 *5F0B7A6EB7273AFCAB65D21B93EE9285844CDDF8 [email protected]
913,004,064 *5F03D5EF90600FEE5F3753C631D1D52116A5B5E5 ПИЖАНКОВА
913,004,065 *5F02474204391B8C96FC1469ABAC068F966EFDB4 T125330
913,004,066 *5F0CE4DEEA25044CA8A21D9A894A9785FB94C783 T89229
913,004,067 *5F0DCB04C34B4D64D42C7A12BE610E79EE455325 TABITHACRAIG
913,004,068 *5F0586C2DE4A32A61F9C609786809260B309982A takakanadacintayanglain
913,004,069 *5F06E55AB9990A03987049D14A1EC4E7174D34EF ЭОНЭЛЛ
913,004,070 *5F0A1560A59257B72A88BA113CC0AE206B1615B0 TALKDAYANICN
913,004,071 *5F04A83D9290DF140327CEC9C11569F06588A7DF talkhigashifren
913,004,072 *5F0750D70F4DA4D3844555FF0B817F87E48D0A2F TALKRAMMANARCHIVE7
913,004,073 *5F0168528C75FC2F328CD0A95222D14357942BF4 TALLRIKA
913,004,074 *5F0F076DE478EDD09C3E6EEC4FDFD7C61988E33C taplets3
913,004,075 *5F0FBE3C2C49C7D510246AB902CA583D5CC5CA01 tears-are-falling-down
913,004,076 *5F0198C5EAD507BF8FE0BAC3362ECE6894FDB876 TED.MACDOUGALD
913,004,077 *5F0A13D7BB216D7966375FEA665986547C048CF7 TEESSUS4
913,004,078 *5F068DEDB97E64AC3881A4024F0594D31250FC0B TeN-oF-CLuBS.-You-STiLL-GoNNa-SiGN-uP-FoR
913,004,079 *5F06DF21749AB828CDFF3F735020A482C4B6FBA6 TFITSREEEOTAT8
913,004,080 *5F04AF003AE67D01259ED8F72A7DD6A4A23E446B THEAUSTIN31
913,004,081 *5F0933C3038F16A08F2128ACBB6C2716CEF96D05 THEOKEMPSTER
913,004,082 *5F034525B7D76EAC996661C01EDE197C24666864 THEORIGINALSINGLESCOLLECTION
913,004,083 *5F00BE5AEA38C36CA6B48735A7F53C380034CAF2 thesarah70
913,004,084 *5F0BBBA1EA9E2FEF2CAD80499E477140A9B4AB26 they'regonnaseemenowi'mbad.cough,cough.
913,004,085 *5F06155D7698F4E665A67BB685F19B6E2DBE9E28 timleyden
913,004,086 *5F0DCF16430FF579401D0255F228D0004A227B90 T.K
913,004,087 *5F0891EAF99B681781BC9E8632F4F1277580FA2C tobiasbramucci
913,004,088 *5F01B44A38219AA76E699D9E066613889CD04803 TODDLICHTMAN
913,004,089 *5F030E1537C6A2455B930574CCA415F4ECDEDAD9 TOKAGAKUDO
913,004,090 *5F0591427999CE3332BC503E7CAF3E0D236CC147 tomybsw1
913,004,091 *5F0DC330745614DA6877F8F677F77E558737A993 [email protected]
913,004,092 *5F0DC968C4C0391F33BD21730655C77E69A36E4E TORCIDAMAFIAAZUL
913,004,093 *5F0F59648F2EB226F0B578FCB7FEE5BE645DFA78 TRANSFIXIONN7
913,004,094 *5F04458212D7E20B9D6A73E7EE8F3D26259310C0 TRAPELERSED
913,004,095 *5F078320E228B0BBADC058ABA99F253DFFF0CA65 trayun.coles
913,004,096 *5F0BE065CA5A8CC6D12F5CD9EFBF446FD92CA688 >%)$(%(>@>$&!)!)#(%
913,004,097 *5F0BCB46DBDC9068F26A71B8F684E0524C0826B8 trebor40
913,004,098 *5F0913B41410DDDCF112D029A8158E9A23AE61AE 019311318X
913,004,099 *5F05D0F4E4B0803F4418CFFC121F901F6F3BF31A 042JOY
913,004,100 *5F037602812FBB649C41CAA1EBF3D2B61E9139B1 TRINDYLLED
913,004,101 *5F0A3CC635DC982A447D88CCCD9E6644D5C86029 TRLLPNG9
913,004,102 *5F041B8114BC41D8BA279FDC280AB16948A18182 08171428
913,004,103 *5F0AEBCBFA346A120C8FC35F5E24E48350BEAD24 TSASEHTUOS
913,004,104 *5F06100B90213353572F1527ACEAE03FAF90A197 )0(O~.0~Q--Q
913,004,105 *5F0645663C1B53D5B50CA25137922BC21FE42FDC [email protected]@
913,004,106 *5F0DF6BEE9B79A9DD7865BBDEF8165764BCC2F63 0ver$0lc+0u$
913,004,107 *5F02F3B343D245986933A0E5A3C5A2F718068BB4 11141747
913,004,108 *5F0E6F768AE1AE30568469FBBD833706F8CAFCB0 TZMHKCRV4
913,004,109 *5F0B9C3C25723E03EF52528776B96A008DCDF041 [email protected]
913,004,110 *5F0541A929C72E228F33899F3DF412EC8C7582C4 1418356 "-i-haven't-given-it-any-thought-at-all-,-"-he-said-.
913,004,111 *5F016B27971DD00B6723C1165CBE547BFA2D244F 1482712 kukinfas-air(r)-yksikk
913,004,112 *5F0B82632E51363D964473989FCD6F4089317FB5 14smit
913,004,113 *5F042F2F804F7B47BF0D20FE7BF3CFC10C615F19 1 ABSTRAKTIKKONA
913,004,114 *5F0355438B49711C363DCC20174D03D5A9367226 un8rd93d
913,004,115 *5F088B7627EED4C37603CBA89681011188487B87 1.bundesbuergerunsicher
913,004,116 *5F0920F7FD09CB047BB4952395758486D794CFDC UNRIL123
913,004,117 *5F0DA9A74D9EDFFEC5D521F2AF50DBA6315AD449 UNSIMI1ARI+Y
913,004,118 *5F00A524CF47B6F46FCB5BA91CC8807428532560 1GRAMM
913,004,119 *5F013D3D908EB4CC2BEFA204127C75B9B26B2122 upul-priyadarshana
913,004,120 *5F02D9A428BFCAB3C8C132F966C371FEB1C9A933 URIA-MOR
913,004,121 *5F04F4AEB1200BF850382D76A269D9776F2B8D07 1internet-ilmoitteluun
913,004,122 *5F080C8C1BEAE8CBFA2E2A900F823B783D1D0E9B 1jirga-or
913,004,123 *5F0754CE935C2EC60F8430D07A362631B3F91750 USTVARJELE
913,004,124 *5F0C3ECB14BC3CC68E39F5AFC705EF2FD4FB5644 UTGEONG9
913,004,125 *5F009C603629DA8070605702B482D69585BE43B9 1 KANTELEKIRKKOLEVYLL
913,004,126 *5F01472A56ADE45D432AC390129AD31D12591D89 UWDO123
913,004,127 *5F0FD815A5E989ED8F6C4E803FABCA5F743A37D2 (UZAAA
913,004,128 *5F05D70BFE19FEC434E3805924B25D352B0BD042 1 MACHT-OHNMACHT-ZUSAMMENHANGS
913,004,129 *5F0E3BD8FCFC6956F58EB73028BC3DEED6543C18 1 mielkeboulevard
913,004,130 *5F0A0D6829E4E133F2C8B147BDA321AC3AF0C1A8 VALERI TROMBLY
913,004,131 *5F016293EDBB0E2FFEF83871D2CCF2D9D05D6D45 1OEVPABGEORDNETER
913,004,132 *5F06A6B2A27D0BAF120CF372AF28351A8C360FC4 VARIC0$ED
913,004,133 *5F0483B8143D6C945423061D413920292D7C87E1 VARSOMHEDER8
913,004,134 *5F0C95B9FF9059FCA7B4B26610458F5771A1C695 VARUNASHCHA6
913,004,135 *5F02C5B655A45B2B681DDCD39A04BFAF126C8F63 VCAMILLO
913,004,136 *5F0DCD28C2977E2E038F11808354837E7547CD98 v-cd
913,004,137 *5F036BF60203A47D70E319DA54ED4D7BDE25F98C VENINAMAHARDHIKA
913,004,138 *5F064E626E2280BFED603A48B13B5830440529C8 1-satellitenunternehmen
913,004,139 *5F09FDEE43F2F90A0F975B1253ECA8A54DC063DF 1.sheffield-like
913,004,140 *5F07924E8CC7354ABE394DB3AE4B0480A7A1A066 1.SILOKAPAZITAET
913,004,141 *5F0ACBA3614140F8F976912E1397F7B7CB8A5087 VERGREPENES4
913,004,142 *5F00024F5B877834E629B3300F0E9B191590EEB4 1.soluverkkoja
913,004,143 *5F0961AD6B0C14288B45183938101E3107E2E98F VERLADEGLEIS
913,004,144 *5F0DE114018BD5B863CEE518B58FC1675BD5744D 1-waldbesitzerverbandes
913,004,145 *5F0CCBBE222194720E3E4834CFCD37B9CFCB1430 VICTORIA.SANMARI
913,004,146 *5F0F9F97BE1ED88AB7FE7AEE316FA42DA8CD2806 VIEANALYCE123
913,004,147 *5F0B69CDD389419B98A2D975B2CFF141B89D554A VIERVOUDIGE3
913,004,148 *5F0C2260B34466E1C59D249AEC764200728159E6 2301847 nytesitettykeski-emponkaavaonseurakuntayhtym
913,004,149 *5F02E7A5BED0D87F60D1021557AEFF51DAACEF44 235.tokio
913,004,150 *5F0332E5073E03EC243B11EDC889DD441ACB9AF6 VINCENZOMARTONE
913,004,151 *5F0C0A229F049A862956903CC261C4A450863A26 2445562 hisreborncampaigndependsuponit.
913,004,152 *5F007112D2F82A2316CB66AFEF14E70620F40319 VIRGINIA.TURNER.DREW
913,004,153 *5F0D824B1A8D9A8604BD003829A6C5846055D1CF [email protected]
913,004,154 *5F08168C0A55DA2A5E574FA772035EA3BE238EC0 29061589
913,004,155 *5F07686E5025B56CA502273A2FE02492A69E55E6 VOUGREYSIENNES
913,004,156 *5F0ACA0A784A7A37C92384646564FCAF4DEE6F3B 2ftopic2784
913,004,157 *5F0DF5427549BEE304608F763824EB6042B81614 VTNY-SHARMA
913,004,158 *5F04EE3ED64235BBE133100961F7B07B6A025277 2-golden-gate-bruecke
913,004,159 *5F0395E6B86564BC1DAE519844DECE39F82855E9 [email protected]
913,004,160 *5F03527E083741278C22A675F5789B296632B0F7 vyslkrgz
913,004,161 *5F0B5C6BCDD103E1E281CECE94028C7A8F43E810 2-PLAYCARD
913,004,162 *5F07443B402DC828D5AC1FA60267AB7F43FCC4D7 2POHRLITI
913,004,163 *5F0DE8E61ADBFD2012149E3ACDC6375CC57E6831 W9L/
913,004,164 *5F0CAC7D98411B7956BAC09BA6178328D489AEF0 WALKER.LACH
913,004,165 *5F0E62C310F8CEC2933A276E647DB3CE84FA8490 WALKERSERVANT
913,004,166 *5F096D2F8414CD5EE5B68072CA33B40D1CEEC8BF 381ROSES
913,004,167 *5F0EF475FD75DFE52F1FA2EA71F40FD728F67CAC 3AEHSATTA
913,004,168 *5F099C1AC12B1AF742EA09BE2AC064C1196BCC67 WANGDEQIU
913,004,169 *5F0522104CA3455D4A99478C673C024DCDACFA91 3DTYNEMOUTH
913,004,170 *5F0E6308490D16CA3AD209A81D0BA9D65AA06FD9 3DZJYBSW
913,004,171 *5F0C08F7693F4446D9DC2D0318A5C7042D32825E 3ELASAAP
913,004,172 *5F010498ABDF2F4B4005826663F06B11346A90DA 3 k
913,004,173 *5F0D8B6C52C21E999930C4A75BE5FB721E0EBCA0 3LEEMONEY
913,004,174 *5F0C2BDEB3B59964580EEC29C764EF3949DA1B6D 3LHORSES
913,004,175 *5F0DBC69F36B882630E95620ECDB33AB63C4878B 3LOUHITTUJEN
913,004,176 *5F06915EF59F6BBFC0F9920EA37F962F3B146008 3MYWHOCARES8
913,004,177 *5F0D2A7AC5324FC67510E100FD62418F98557623 3======p~0~o.}O{
913,004,178 *5F031C687AF96B7E1D2E052DF546C89942741FE8 WCXUAVJ8
913,004,179 *5F0B785B53011BFA0EEC0018B43A69D2C6F270DE WEHURTTOO
913,004,180 *5F08BA77F4E58D51FDE4C4527DF1DB6B65A8B408 weightnian
913,004,181 *5F0745254521CB43016DB1FEAEAC93D81A85E6F0 wendy.creque
913,004,182 *5F02C4435EB632932265276713C897AA3CD83CCB [email protected]
913,004,183 *5F06AFF65FB3236C2740E94852EC64C11825349C [email protected]
913,004,184 *5F00E461B214352B7FA94C02D3C2F6D98A6D9B3F [email protected]
913,004,185 *5F055AD8C736F4DF4E38C924DB39DE5754325D1C [email protected]
913,004,186 *5F04601128273ABB1A7E891077D85115BDC6FF2E 4IAMCHANGE5
913,004,187 *5F015256A4D736B23F04714F767011E283D6503D WF=^
913,004,188 *5F0269DB55BB37860D0DB93DA2CC4783A0C65C87 4.KONEPISTOOLILLA
913,004,189 *5F04A99D12A0C1F16E638E8B3880F6D24F16E544 WHITE-AFOUR
913,004,190 *5F01BDC86E108909C1CBA9219C99CF1F8B89B953 whiteappletree
913,004,191 *5F09D37B20B3C2BC3822FC6396E226C1DAC87FF4 4OLTIVATE
913,004,192 *5F0F7C7575E161A4EA6B6FF45E5CCFCB67226091 4OTAREVOCIR
913,004,193 *5F0ABE6974CAF961C158BED3464840C99934EC6D 4POSTPALATALES
913,004,194 *5F0DCDA3B4E5E41CDA94E31F1E652531CA07FF40 WIKIPEDIARUTHIEK
913,004,195 *5F0A56F9743D022A7E41BDFBEC5E56C8E97CEC0C WILFREDOCASHIO
913,004,196 *5F00EFEF0C64B19574527F59705DC3C662C52ACB WILLAIMCHAKA
913,004,197 *5F0AFD52938793D5121AB8B5915AC4E113BE9D27 4XIAOTIAN
913,004,198 *5F044F05EAA843ACF91D88240523F3C80754A0EE WILLIEBAUMANN
913,004,199 *5F0C297BC2F1F16FD5CD3C32710DBAA54FA7274C willson.zulu
913,004,200 *5F079BCE392D76C240C65A18D5B8E0D8DFDBE030 544247 YILDIZLAR3
913,004,201 *5F0EA96DD4E477ABA8D80C562BDB7BA7F16C28A3 552JUAN
913,004,202 *5F02702FF7449F4803363ABC37B1CD8915D919EF 55JO100ARS
913,004,203 *5F0318EEC7941E13B9738A245187405EDC8EE2D2 5ALLIENA
913,004,204 *5F02564DEBCFFD2E7BE8D57FEDCFCDB22CAF631C 5BSWPIZZIBSW
913,004,205 *5F02054EF1A6B7D0B8A4951DEB9A3A2E263F4C4B w,md
913,004,206 *5F0E9BDF5F86732687D14E0D2CD37670A938B0A9 w}_p
913,004,207 *5F06C341D470D42194269C15E26055F6D61A5743 5GOPHERPIZZA
913,004,208 *5F09A7F27A4FEDFCDC0B57C2A054AF65199321DB 5HEHKULAMPUT
913,004,209 *5F009F5394A3C5519DAAD68DF569BF02BCB275FD 5mlawsky
913,004,210 *5F0ED6B11D45B4FE177CBCDA0B353C2BCE0EDB01 5NIAGASECNEREFERCILOBMYSGNISU
913,004,211 *5F0A911DB13830B1D0B41F133118146F8FB7EA7D WWW.ARTICLES.EXAFI.COM
913,004,212 *5F0CEA88B79F074F78D17FA43B0A9A22DF4A46C7 5ROLFERIC
913,004,213 *5F0B09FAA4D913AC37C75FE5D71D4D561FFD060C 5SHAGGERY
913,004,214 *5F08EA89F1A1457C8062E331E26085DBA5E993AA 5SHALOMGILLES
913,004,215 *5F0B178B699788F2503F52915FBCB83CE4CAFF5C X1D68E
913,004,216 *5F0A8FA82FA224AB100BFAC9E5409124F34E5394 673815 hinta 200 000 mk agrimarket
913,004,217 *5F014D372311DB8F16B47D7F9478C3B93EC18B94 x&eb
913,004,218 *5F076D21A147D6C1879BDED27048DB172FE922C5 6ILUVSPOON6
913,004,219 *5F094BCC264322E8CA2DEE6C91A5FCE771D90652 6MADISONASPEN
913,004,220 *5F0DD6F44749E62314BFC3017E7E84AFF1679975 xju7
913,004,221 *5F0851C1273CD1D4E4A6765D3E2303123CE9E71D 6SPECTABAMUSQUE
913,004,222 *5F0D52E7DC9D46341C7F9BD20D72D7ED62030B5A 6STUDENTSPANISH
913,004,223 *5F00E449730E4D103E0B0481BC48CE603D6DA8DB 6USTOSUNKOWANIA
913,004,224 *5F0DF879FB4A18316D42F9D6F9DAAAD207444C3E YA[5
913,004,225 *5F01A898D41E19EF2C2C388BBF5BA8DFBFE1193D yaaaa
913,004,226 *5F07280979257F494EF33E3C55F4D0C13B832712 YAIRIMAR-ORTIZ
913,004,227 *5F01668E61EE08F4AC8E0917CFAE6E0AFD62899B 75sparsame
913,004,228 *5F08687758318FA6DD2A7C52FB957DC4149921E2 79717 CERKESKIN , KUDRET .
913,004,229 *5F0C4D180B042559ACBB44BC32A516716917313D 7AANGEMON
913,004,230 *5F063C193AC12E4631F7731566982C6ED391A0CA 7AGRAVASSE
913,004,231 *5F0896788BCC2DD783C01124F3776AAD3626DF32 7BLUEBRONCOS
913,004,232 *5F0A42378A6350506B904E8936002ACF98FE221E [email protected]
913,004,233 *5F01F2D1068DC3AB6DB76A61D1316B21255760CD 7DISPARAISSAIENT
913,004,234 *5F001007181C40D42C33A63B1E1B4BCB256C5507 7ELLENMOUSE
913,004,235 *5F0C4BA502EE82F2BB336A3F2AADB2F3F8F6FA51 7FRODOSUNNY
913,004,236 *5F0E66E5C28AD27B0092C83544A3CBE24AFE1F2C [email protected]
913,004,237 *5F0460DF54826F1700481985558080094C173494 7JAGTGSTENS
913,004,238 *5F0ACE0D391F037D323E102561C4965410726765 7LAKAPLAR
913,004,239 *5F0ABDB7BED9465715AD62005AF0B511FA787B60 YLT
913,004,240 *5F0DB514C0BC0D7B4C992439B90DFEF7465AD592 7NICKMARINA
913,004,241 *5F09F36ADC8A5D70E2423D88CBED4DF793F5DFFC YOURCITYCOZA
913,004,242 *5F0F9AE31245AD14E33FE3871FA92CA14D86F3EA 7uitvrozen
913,004,243 *5F076A2E30015230A5BCAEB8689A024FFFE401F6 [email protected]~0.~O.(O_-)
913,004,244 *5F0AD9BD51E91A8B73DB6E301D3BEB923B71B8B8 814240 japanin kohdalla ongelmat ovat kuitenkin sitkeit
913,004,245 *5F0E97F15F311822CECFD1D0EBA420F04B05F393 8AZORICA
913,004,246 *5F00E0BBCC2CC02D61C7EAFD6EA320332009A173 ZAC CADY
913,004,247 *5F05DB5DD30A9198A679C2F0F06C166988B145E8 zacharyremillard
913,004,248 *5F050A17DC7153E62C0F21598770199ED60AF498 ZAHLENCOLONNEN
913,004,249 *5F08980A527866D6EF14F724B7ED7C9F19F26941 8KATHERINMARY
913,004,250 *5F074258BA6B25F6FDBC9A40C9F4E63BCC811A47 8laughingstocks
913,004,251 *5F0986254CF0A552E3F57D1F60B2D73F996E21F6 ZÁZNAMŮ
913,004,252 *5F06F0B71A4693AA13F8BCC56C5C8834E6637EC1 [email protected]
913,004,253 *5F0ED51C7EEB7C2DA561C6171B0047A06DA05D22 [email protected]
913,004,254 *5F080E49B26BE053FB13152EA6E11D381454A768 [email protected]
913,004,255 *5F0EBDF1BA23793765E358B40D72C16941F441ED 8SCULLY
913,004,256 *5F08848832488138F90AC45C5C1211DCFE9ABA4C 8SILVERCOPPEREARTH
913,004,257 *5F09E8CBB58B20B358DB80B1EFF70E979EDEF2A9 [email protected]
913,004,258 *5F0835241F0B6B183E9AFADB52B278B794510F81 ZIAD-AMRO
913,004,259 *5F09A0230DC93EB5239080FF11E623F5BBABB96B 8TRETTENDEDELS
913,004,260 *5F0E9E14630404634DE5B208399DF5307684B920 8VEIRETTE
913,004,261 *5F0FA359ADD80305F442098B44E6FE22519DE998 8WARRENFIRST
913,004,262 *5F04C6981BF82D6004DA7AE4ED707956B86CDB42 [email protected]
913,004,263 *5F07D354565C25648EDA0B29C7A721784AB86BD1 [email protected]
913,004,264 *5F061B9692064586C286CD930BB57F35762E53A9 8ZUSENDENLY
913,004,265 *5F04952E469C47A086FA725C82BFAA03DC6C881A ZNJKORCXWA4
913,004,266 *5F0CEC15E2FA00342A7A8A79BD4126377AB0B101 954298 all are male , and all are black
913,004,267 *5F0FB125E4CBE0D645382A5FF7EEF5AC5EE7CE95 ZOOMEDE8
913,004,268 *5F02FD80815CD74A2FE9F224407814C92407AD71 ZOOMELAN0
913,004,269 *5F0FB1F98596CA2D43D8DC56501266F6153C7B3F ZOWIECOPEMAN
913,004,270 *5F08756729DE40F35AB0313BF9806490438336A7 9BSWOFFENBURG
913,004,271 *5F04F2449A70740E989B02319BD3F1530C371BD6 zwitser4
913,004,272 *5F09D3CFDFC53AB9B279C353E08A9CC96DA3A903 9IDROENCEFALIA
913,004,273 *5F0D7E77A123ABDD53C80E222E2A8F6B18C98BB7 Δ’ÏXMÏ —
913,004,274 *5F0183007C3F6BC4FABD5974BC78097DA965ADF7 9LAITNEUQESNON
913,004,275 *5F0836DFC6703398FCDC47A3073B10F1DF31E273 9LEAUETHE
913,004,276 *5F0349B83B3C263BFF7620AE8D58F1FAE4FD6754 9MIHOLBSW
913,004,277 *5F04DCE61E4C913E26564CA1AD462E2593FF733D бєло
913,004,278 *5F07CB90ABB0E0E91521207E6DCEF21E4901AA9A 9ORATIONGOING
913,004,279 *5F0523F8AAD0907807D7CB52AA597D15D39329DA ДОПИСАЛИЯ
913,004,280 *5F043A6BC3B6C2A7DECF7BF01DDC317DC9D27E83 КОГОГІН
913,004,281 *5F09A5E1160A5A10E0DB0E76B29993BAB560D8E7 НЕИЗОТРОПНЫ
913,004,282 *5F0A1E6B7715B4A1429C333719B143D6413372C5 синжерея
913,004,283 *5F06FC3106FE15EC3D75237B0ACC0435D2F86E20 a1qgp
913,004,284 *5F0688B357291503D15A2375806F9EBC69ED8145 хексапротодон
913,004,285 *5F0A9FE01DAA252D324E0423CD28F53C9BFDD5BB ՃԱՆՃԵՐԸ
913,004,286 *5F036BC1E62E8F1D320C746BD37605B58632FBB0 a/5p+
913,004,287 *5F04D3C5624DE822E6313121FC704C0408C41643 A7DAM
913,004,288 *5F0AD53C0545F00072CF0F9CB17F89435F5130CB a/a9t
913,004,289 *5F0206B7BE967A4400E78505D09DC64ECEB08042 AADFOA
913,004,290 *5F0B40192B59F5CD6894D03063A0B845AA58ED1B 03241178
913,004,291 *5F0A1CB813401F593643CADE28221701C0C39682 AB$,1
913,004,292 *5F0958F34160F96DF226EE5A492A22345123B8D3 08071672
913,004,293 *5F0525BB0E4DA69C1C470A4A67BDD220D885A786 (0_<)o~ 0~ (8
913,004,294 *5F01085A0D5BCDEB768A2C8532EEB99013F03855 0U7134PNG
913,004,295 *5F04C3ACBA2CEE339EFBCFC5BF671B42834C3B66 acfV
913,004,296 *5F0C4C7656FB727D93F2BB176E6DFAE6BDEE5A04 1071760 arviointi : kiitett
913,004,297 *5F071458203D85CFF0F03FADF34B8FA17862BCEE 10MAASTOT
913,004,298 *5F0505F95B35E72B32E71E1E4457EF3F514C5AD7 ADC:F
913,004,299 *5F0BE29D5DB6FE27070C6B556BCC0A1FD702209C ADDWA
913,004,300 *5F048AC2B8F60BC5921FF54825C108AE3C5A004E ADY BAE
913,004,301 *5F0D7BFCC4E0F996FBB2175B689625E1F4C0D9CF 13olabilecegimiz
913,004,302 *5F03E3BB985F881A8EB178DCBCCC7174C6E7C07E a?<e
913,004,303 *5F06426CD244AF71EFFF075EF447AC602364D907 aem!k
913,004,304 *5F06FCF6D08B946529941281DAB55AAA66148111 AFIU
913,004,305 *5F09CEE07ACB7CFF6F8B0DC4A814F90D207DC375 AG0;
913,004,306 *5F06C74382300FDBDE092BA7D7C6E89D842AB8E0 agf=q
913,004,307 *5F0573E0DD16041838FEE92581D56628668CEB97 19901125:TheOffRampCafe,Seattle,WA,USA
913,004,308 *5F0820A52B957E89CF3E8FE9815B90ABC21F9CE0 ahe
913,004,309 *5F093C6225AB96FAE57CFD2502D1DE3A74222755 1ADALADLA
913,004,310 *5F014AEFAB19A1277EC27B6906F9B8470AE74D20 1.AN.2.+
913,004,311 *5F04C519F40B16C64B71CFC6299BDA715462F238 1.av-toiminta
913,004,312 *5F0F7E8A38F4BBA8E51F9E5E35E917BBD1A4705A a_+i
913,004,313 *5F0AFF01C060E807467FDCFC250A826F1D43E348 1ETSINYT
913,004,314 *5F0B9B6B5E9888F0A6BB24047662E73EFEF47196 1.ETUOSTOOIKEUTTA
913,004,315 *5F04133C7E22BC0541B700EE6FF17EDEA941D810 a)k
913,004,316 *5F08DF3BC7FFAA1E13351DB8879C8D6331898599 akwng
913,004,317 *5F0D5DAC052FB66577547EA0FC527D5868BE73F6 1 KATEGORISOIMALLA
913,004,318 *5F0FCF6F78D9B4985D322A8CA092E0D110207E51 1KUSKURZA
913,004,319 *5F0D143FE79913CA717B39D43DE46177D6D31684 ALECAMADEO
913,004,320 *5F07FCFC43A60AB8E48C9BC081ED7D9F1DD836A8 1-loitz
913,004,321 *5F012D56024ECBCBF15497C50FE6929CAB6FA364 [email protected]
913,004,322 *5F0C5204177AB640D0C58EC2987FC17EA5ED649B [email protected]
913,004,323 *5F06D0F005C55D9C360E4BC054C59408A7B63C80 ALIREZA2
913,004,324 *5F0E7106F59502AFB5451ECF24A8BF39E84A403E alj
913,004,325 *5F09FC3288B94F4313850FE6A66594CF1F61CA66 1remisyonlaridisinda
913,004,326 *5F09B17A2C7039F875DBDD2C9BA21D871D454C3F 1 SHOLGARA
913,004,327 *5F08ED82E65A5E6235BD53EC90D8250CF3B45BBC 1STREUDIENSTE
913,004,328 *5F012562872A9A9F21D4B39F50675FEFBE912CC3 1THESAVED2
913,004,329 *5F0AEBDE16AB94524143B05ED4BE687128E3E5D6 1.uudelleenpiiputus-tarpeisiin
913,004,330 *5F0A33B57F98EC763A4150F2661FB0D090CD48EE 1-VANDENSTOCK-STADION
913,004,331 *5F04BE2CF543BBD4F487D68E9E6E61A5815E0863 1.verfolgungsrisiken
913,004,332 *5F0D57D0D94E23B953D900AD026682A0A98D1118 1-verotuskuluina
913,004,333 *5F0C4A744ABF56EF022D706691719ACBE96484A5 20SHIDOUI
913,004,334 *5F0F154422CA66A9D3691CA6E36BDBC1593AEF9E 21´5ENTZAT
913,004,335 *5F01D245F52F70BB139F8F85E65AFEA82949C082 AMOUR, AMOUR TOUJOURS
913,004,336 *5F0A9E4DF3B54AFF5FEF6B62338C6B6ACE406590 AMYRIS1
913,004,337 *5F0BB636A82F7B30E7F06E7986B1C10610779BBD ANDERSONBOURASSA
913,004,338 *5F00D5296B0B2A662B46A4D9AD315764E761A86E 238262 VOIDAAN-OLETTAA-,-ETT
913,004,339 *5F09FCB829E6B6FD7DE72102736D5A0879DA2AC0 ANDREAGRASSIE
913,004,340 *5F0D44C90DBA82AECEDBDD6BA603A5B55AE19E19 andrea.otano
913,004,341 *5F00EF718D8AE8C957028BDACDE36206C1E9357D ANGELO416
913,004,342 *5F065F30DD1E12BD379C17F6A48A669EDB28C37D ANGLIAAGATHA
913,004,343 *5F03E1DFA92D35E3F1E871E053A15E7A62A90B43 2897286 KESKUSTELLAAN ESIMERKIKSI , ETT
913,004,344 *5F0786872D751D468DFCB29612B43109A1551B77 2936360 varauksettehd
913,004,345 *5F0C0C8B0FE6A274D2DA104C8651B4E098910399 ANNALIMED
913,004,346 *5F092DAB80329722BDC3F4A449C2D0266049CB8E annamariapanzarella
913,004,347 *5F096606B432E4BEFD55FA90AD96A587CEF5D72F annielewin
913,004,348 *5F0B3FBCAF756E613E0BAA82B36B23FBB3879E7F 2-aussenausschusses
913,004,349 *5F0126D8D04939C2C175EB8FE389E21B3DF44100 2BASENAME
913,004,350 *5F0D05B0F457530C2C41F305C6FBA3783A24969B 2 FECHTTURNIER
913,004,351 *5F0CE9F085B1A8B86EEC49991FF4E253A4F19EC1 antonyniemants
913,004,352 *5F001EFED93BA14750784FCA30655A18FF60763D ANULLAIRE
913,004,353 *5F07E96011D46DD302B14344222104CA2D8C6287 2 GESANGSWORKSHOP
913,004,354 *5F0739A2C129FF1CBEAE88F5B51771F284FFAE10 2 GREEKMACEDONIAN
913,004,355 *5F080ABA8F634AB6BFB234442C351DB6D3C08B7E 2.HEINRICH-HERTZ-INSTITUTS
913,004,356 *5F013465F7BED06158F1295D6BDC77A2A929ABFC 2.KEGOE
913,004,357 *5F0717BA8B7E6D252B4AA8717C32CC1F41C49B07 AP!#
913,004,358 *5F09E1E347621F99B3CFE486459D4021C65C21B3 a,pm?
913,004,359 *5F05EB1094A06C6C83E5D2B631123C098B021C60 APSQT
913,004,360 *5F0D25E1B7EAF1F32A909265FE64277FBFE05809 AQ9%S
913,004,361 *5F042D61F3890DD5F22744E716BB7D6DF5D9D7D2 ara.allana.dejos.tolosa
913,004,362 *5F0771435C8F09465439097FED2D3B0A5F5E886C 304639 DOUGLAS-:-WIR-HATTEN-AM-ANFANG-NICHT-SO-VIEL-KONTAKT-.
913,004,363 *5F07D465840B9E1D7C70B94D36BB5B957591752F 31hyndman
913,004,364 *5F0B4689A8CFF205914659188867CE0F0EDFD952 armandkonger
913,004,365 *5F0BC09DE8853AAD996368A16FFD9AB7D338E678 ARNULFO.HUNKELE
913,004,366 *5F096CFB1B5337AE69435C597CCBA7F9CDAFD75D a%ro,
913,004,367 *5F02439CE7C82072FB9F1D036DC9D3821E8D142B ARTDOUGAN
913,004,368 *5F0A10FBB36D558ED5CA8A5160DC4E0CD48D368D arwld
913,004,369 *5F08811E96BD880557AE67287CBE4EE2050694F4 3 k
913,004,370 *5F07FAECC0BFC16B0E9DFF5B8C66AE5B7AFBC524 at2+
913,004,371 *5F0F5B4238FB429DA95996ABEAA0E864A560BFA5 ATF
913,004,372 *5F0359A547AEA51CF69813E470F3C3F11ADF859E 472YAHIR
913,004,373 *5F0288A4912725C1F492EDD7D31BD60014794F2D AU(7V
913,004,374 *5F002269971086B7287CC93C80DF38D0D0B03124 AUNTEUTSCH
913,004,375 *5F0A0B197B9E010687C0C7AAFDC2626F52695F3B 4flueela-passes
913,004,376 *5F0BFBE1F00BE71B0D16BC0934C7DDB0868ACD30 4ICSIRAPS
913,004,377 *5F08CF21741ABFA24FE41F4B217A9BDD67642BB8 4IMPORTKONTROLLEN
913,004,378 *5F0ABB3CFBE9537F5FBF43E23CA0C9B2DCFC45AA 4J.VG.2M
913,004,379 *5F032FD23B6B94B561959C40D65047A31D1FA0F0 A&V+A
913,004,380 *5F0D25C041B85C2BA22690923A2A548D9DBC7483 4PISCHETOLA
913,004,381 *5F0C83B34EC1B1A1FB965D5256611F6AD6F6DF63 4PREPROCESSCMD
913,004,382 *5F0D9F00154A37F7C3DF5AF90B9D13AB5FB077E6 4PZQ7G72
913,004,383 *5F0521BE38F7B1179670EDD0D7660E33E9B0A200 AXFEXZEJLDHE
913,004,384 *5F0E31E2DBF09D6643AB14E00F01C97B9039472A >-B0~~d######P
913,004,385 *5F073FCD12982B19EABA88F43ED3A545F24955F4 b"1-induced
913,004,386 *5F04D5FAE2A10F407B8B59E30B41896514ED4D97 b1r%l
913,004,387 *5F036A7BD0EA5D0303584F9885088C395911B4B8 5CAMELLUSES
913,004,388 *5F087831AE54864E931E78E192079143BF83FD7F 5CASI
913,004,389 *5F0ACB331A54E06847C1A6310E3DB5FF54410058 b4e#"
913,004,390 *5F05DDA36BB43BBDC0628A629760F29FE0F8B709 b4!gn
913,004,391 *5F0F474E0D675173BB515B0BC707EA735AA66C6D 5ETEILREV
913,004,392 *5F0F173A3EE0E87342D17BA409321434B13C2A9A B5OC
913,004,393 *5F0C121F2B0239164293A91B4D033184F0F840E6 b6kk
913,004,394 *5F0B42308935B2B40BC330B8584EE89605719D8B [email protected]
913,004,395 *5F0D4AAB98BE23FFDB3879013C110BC98AA74B21 5PCAPABILITY
913,004,396 *5F02123ABAD01D30ED30F2D077944470887FD146 BARNEYNELLIS
913,004,397 *5F0C98420EC2F53A052C4B5C2B3003E26D8FADDF 5SIKSAKLINJES
913,004,398 *5F0FB1BFDC2179FF54CCED999EE61D21B2B30F39 5 SIVISTYSALAN
913,004,399 *5F0F6B3812C67A0216C6DA127BBE4D4DAAA1F656 5SMETANJU
913,004,400 *5F0A289C408223AEAE5E90AEF9899595068FB2DC BASSOONI
913,004,401 *5F04CA85B8D0996B65E2EABF29BDF603C6C2A0B4 6-02-1469
913,004,402 *5F025FCA9298C87B026A243AA0F5272734758020 678712 ALLE ANGELN WEITER
913,004,403 *5F065A229D93ECD52A9C5AC9D39F23E698C988D7 67.Miles
913,004,404 *5F0DC7D77B8396E88CD29934EA917577420068F4 6 ACTORLY
913,004,405 *5F005F5E2D1520E460B650CB9AE76D7DCE5E50D3 6ALKALIMETRICALS
913,004,406 *5F02F72D19FCBE00CC93FBEB4CDDBA9E038A5E2B bchelfhamvia
913,004,407 *5F052C8FDAF8B6F616A232F20B714A5A04E34286 be5f)
913,004,408 *5F040C7DE53033A8AC09DA713F91C6AEB832F57F [email protected]
913,004,409 *5F003544786E87B4A01C4962A9C2300AB744F581 6LRMPBSW
913,004,410 *5F0AF80E487C2AAFEAB350859FD5F18A826AD4E8 6NAJARATANNAMARATAKNEV
913,004,411 *5F0D67C8CB8EF7753978E0FC764149801CB8B235 6OSTEODESMOSIS
913,004,412 *5F07745F90B23690B2D4B1C83E0D61457ADD6790 6PRASSELNLY
913,004,413 *5F055E928186D15682AE2574E5E89A6A6CE58338 6PULMUWONBSW
913,004,414 *5F0CE75816CE4017C361574F66DB2CA65DF18812 6RETSMDERNE
913,004,415 *5F0DB9C43AE29D87136084A6A5F26F9655C800A1 benkittying
913,004,416 *5F0DA62B8D90C4453789BD5F73D3E82E94E06366 BENNY.CISSELL
913,004,417 *5F0FB5593397F43CB91BDEB4F2B246C5662814AE BENNYMENKE
913,004,418 *5F03AB14AB9632032347AC2CF6FD05C71C6D655A 6THATMOTOROLA6
913,004,419 *5F0F0D26EFB8F831135B45237318BFCF20561C71 6UGENNEMSKUELIGHEDERN
913,004,420 *5F06A278781CF506DD2C74BF23981F8CBE633E61 6WALKERMATT
913,004,421 *5F0750C90878F241978874E26B899470021DF29A BESTINSEASON.IEWWW
913,004,422 *5F0DA85258D3F2E5CC2B2B8465607F32876E1E2C bf8kq
913,004,423 *5F0A2B74B97AB944CE072A03016EBB4A901DAAB6 b.g&t
913,004,424 *5F02F4FBFCCBE3E509A9E69D80B99E02EE242887 7iambutler7
913,004,425 *5F0383271FBF2BCD1F13BF74515488285AE6D818 7KONFLIKTAUSTR
913,004,426 *5F0CDA7ACE65545829D2E58125CCE18E01B967F6 7KRTLVRMNG
913,004,427 *5F0D50CB122C2207CEB3B6D668BEDAFC9BF8F3D8 7LADIMARYPID
913,004,428 *5F03451A293450D0B1B9B0AD93C4A55732187C89 7MSCTDRM
913,004,429 *5F00F5C3C0785B525987D3459DEDC56FDBD468B0 7OPPELANDE
913,004,430 *5F02F79B23DFF74022F97D0B2E2976C29FE89E6C 7PANTOISE
913,004,431 *5F078FF32F67E459DB08495B1FB56212F8C88AD5 BJI2H
913,004,432 *5F07BC6D78E2B4DCDB015FDBCBFECF2D569DA9E5 BLGK
913,004,433 *5F0C744918F4EC8DE96E54E92461E7B0D2828912 b&mdz
913,004,434 *5F009D94E8F63D0CC0A1A83F5C1C2C19C0364EF9 8----b~o.~o.)o(
913,004,435 *5F0F72835A36ECF77682946AABF2A2E432C25B00 [email protected]
913,004,436 *5F068E7E8ABEE9E606547B66082811A3E10EE0D3 8heliology
913,004,437 *5F0964C1E3CBB06054B7EA99774A15D7D9225456 [email protected]
913,004,438 *5F0BA758DC30890BBF4E9AFEA4F53918FE11F74D BONNIEBITTINGER
913,004,439 *5F00850B91FDD37F524F66900E917B6A973F0114 BOSTONDISNEY
913,004,440 *5F0EA7A37BC87B347FE54C2B764A1BF25AC52AB9 botiloglossa
913,004,441 *5F00664EA3767AFDF87A8E6F6E727F5C4FCC7D7E bpaui
913,004,442 *5F0E90466658BE47F46741ED8B11138F4F369E47 8SFRITTELLATE
913,004,443 *5F0ED1C9BF6246FBE61086D445409C5417BAD4D9 b$)&q
913,004,444 *5F0F11FEAFD5A80E30A9E27473A9BD0D825A4C45 8SIIRTOMAASODASSA
913,004,445 *5F04C0F0E72573AE493142A398B5F7D205FF157E BQBIFYA1
913,004,446 *5F099E7A95C707C737A51593368414C0F824F6C0 8--->.*.*.SPLAT
913,004,447 *5F05A48D1074FBB3505DBF7ACD98DF8991305FA2 8STRICTEMENTBSW
913,004,448 *5F05DA03F12FB3409E0EA74E023A512F3CC97FC0 BR?58
913,004,449 *5F0190F4CC84F3A2D59DDE972ED3B7140FF18A6D BRADY.CONDO
913,004,450 *5F0E43539FB57F97A1F7BA38D43586739A6EBCF7 brahmadeo
913,004,451 *5F04C2637FA0B52C044827DB94267F2A1C545E8A 948720 onselvitett
913,004,452 *5F0D6876A6E1380384D2743538BA8D058B577598 BRD6N
913,004,453 *5F0CE7BFCDF7ACBBA1624D5CB56771D2B711C5B7 9bestippen
913,004,454 *5F0067470903A70A7DF82F5E9A2A0C9D7E5FE24D brokentelephone
913,004,455 *5F078FD1A8EA8292679ACB69387AD405A6E8174F bruh6
913,004,456 *5F0FDB1D40F41F0DA35A35D30D3F936A538A74CE 9NONACCUMULATIVEA
913,004,457 *5F06C91E36C1902BC880B167698035FF77FF4605 9ONWINST
913,004,458 *5F0A1728437CD6DC3BBD0D91A0265D4827F0EB3B B####@.~.~.~SPLOIT
913,004,459 *5F035DAF95953A60BCD877A6D4DFD166345C9592 BS_THEOREM
913,004,460 *5F0812391001C5A304D6A4F3EC4867FFEC66CD5C bsu
913,004,461 *5F0A94F4ADF1ED642E0A76CC8BDA3FB684F9BFED bu2a.
913,004,462 *5F0A660E251414BFA4CB0F78BA7D20746FFB5B6C BUERSUEDEN1955
913,004,463 *5F0845C95CBCA021B0638211FEE2F0D3B55ADF24 bundestagsrumhocker
913,004,464 *5F0A069AD9042D6F5886A64321B98B6324153677 BŪVĒTAJĀM
913,004,465 *5F0F368B963597C1C67B341F9D07170BC9D3F4F4 AA"}
913,004,466 *5F04380BE1F801DD89B2FB4139487DD059242821 Aaa>7
913,004,467 *5F003705E496713B141CE2437B90D58EB99BC6BF AAB3/
913,004,468 *5F06E5ACBBC27F7AA9F83B761F712E2F1350CBFE AAC,OK
913,004,469 *5F02C064ED3A8396E2FF91B459DC30FCFD2F2EA1 C7PCH
913,004,470 *5F00E7E843150F3F3462FE68EA94F5C322B14577 A+"B&
913,004,471 *5F0C4038CACB8A54BDBC57CE93A3B37A7D34B7A9 c8zd4
913,004,472 *5F0A151A1D78885A8DE858B0A0AE0892F751E9FB c99ov
913,004,473 *5F0E94F4D616B8AAC79F62222577E3C1B3A4BC14 calculabilidad
913,004,474 *5F062F0B0CEE8AD25726A72C75A378BEFF5FFCCE [email protected]
913,004,475 *5F00D14D5746D805EA04A8069AE5E1EBF3319B7F CANDIHRT
913,004,476 *5F052B809E401B372519255D90CE9EC224A41296 canty123
913,004,477 *5F0A159CBA21C54699C849BF1AD0810B35B898F9 academcan$hp
913,004,478 *5F07D7720780D0C99407F2C5871C7FA10F7771C8 carltonangon
913,004,479 *5F00609EED49DBA6FCD20F6A1D6068AAAFD91F64 carmeloclankscales
913,004,480 *5F0FFDA2878D2F65019216DFCF43B8C42B73B3B5 CARMELO.DORRILL
913,004,481 *5F058D3AABCEBB5732140950DEDF10422682805A acnkq
913,004,482 *5F06726100710D3BA4C5792885B80F0C66C17349 CCOUGNENC
913,004,483 *5F077E9FA5F8F5188B6B09F5DA326A938C088AEB cdanc
913,004,484 *5F089C5C4C5D5A553125A3EB93BC6F48E400406F afgeranselde
913,004,485 *5F0D25A87E262904460C4413DE2505B0DFEA122B a!g#;
913,004,486 *5F0916FC824877CC4ABE731E90D85249B35EAC5F agustinhill
913,004,487 *5F0DF4CF9B3A1B784953D1283A292F6D8A373058 agustinpolich
913,004,488 *5F0FFA5EEF410861690491DA140B0E633C7FE511 a;gx2
913,004,489 *5F0B59552BEB52DA3795776233DA02F229086B96 CFKMTV
913,004,490 *5F0F4E8114D1E6876A6D6365E7F667EA403C581E ahe
913,004,491 *5F0D374EDA778B3864F8E1D3D7D5D27FF559C4C2 CHANCE.MASSO
913,004,492 *5F031E2124B82D8B93715008846674197981FBF4 A&(IS
913,004,493 *5F037B373F397E5FBE3C9E2EBA9F4E427780CD34 chathome
913,004,494 *5F0AB765531C7ED979CEEA5AC6D08384ABE66F17 AKIHISA-IKEDA
913,004,495 *5F0C6672C7B5ACCE69EFDA3AC2F9CA678767A794 AK"R%
913,004,496 *5F06693FD5268808287B21145B3C94D613C10E73 AKVQ9
913,004,497 *5F0D803393DC1FDAB5B874FDF91F1DB7B3EE6EAD CHOISNARD 4 0
913,004,498 *5F019E5065F72185D858B9715043EFEF2EC1404A chrisleitem
913,004,499 *5F08A939035AB1F8825E6FF6A2E16DA06630A3D2 christian.ronaldo
913,004,500 *5F0FB44CD3220ECDCAEFF3809CE421FEE92BC949 CHRISTOPHERDIECIDUE
913,004,501 *5F0709B7087CD566F190F45E0E15EC7C2723B966 CHRISTOPHERSOVEY
913,004,502 *5F055B7287296B98A2FC43F257B3D1435FB4A748 alj
913,004,503 *5F0CCE4D5A9AA0A81AE5A52D2B65553170465A8C ck91w
913,004,504 *5F0DDEEEB8B08854934AEA7F34AEFD06D07B0950 claremont-couriercomwww
913,004,505 *5F057750201DC0BD79DBE96E0925DFFCA726DCFE CLARKWISCH
913,004,506 *5F090909F8C8D999C232EB40B3D96569EA2ECB38 CLDSB
913,004,507 *5F0CE6D07554509AB7C8BC55AD646A509B5F4D76 CLIEGTUIG
913,004,508 *5F0FCFB8BD27DC0424AD483F5B86C0C0FBBF5A13 ams
913,004,509 *5F086F3AFF25D0F0C9FD0B7A190C2DA21545B066 A,MV
913,004,510 *5F02C9A5CAEE0CA43B420975DF0B62DE94196A48 clmcam
913,004,511 *5F08062483CAB1F4031E0807679240583CCEBD99 c_:)m
913,004,512 *5F00FE5CA315C3A39ED538294D9558835673CE5B ANGELODRAWHORN
913,004,513 *5F001ED03999DADC1617A38B651D6F354F2E7260 anghjulu
913,004,514 *5F06779A9F60A9CDC438121C158AB0287E6E607A cnjbaa
913,004,515 *5F0CE42E5FB2998A1F08A7A68C20FB00F2098416 ANTOINEDASHNAW
913,004,516 *5F07F5C6EE8E8B9F557A4B9AC1E88EBF1C77E81A codycamak
913,004,517 *5F05C7C380CE9C9945872D4560C7DFC932160FE3 antoniabotdorf
913,004,518 *5F06CCD344331D03426F1CE235D361FA82327582 ANTONIO.BARKET
913,004,519 *5F089D677E13B2D47BF3CCC3E93A86C200E04F8E collinaharonof
913,004,520 *5F0FAAB6996FD9A0DC53734F12B1206AC0E68491 compaqmv740
913,004,521 *5F036F8041C86DA338F019A76FD7C209F90DAA36 [email protected]
913,004,522 *5F01D85112AD6DDC375565E8262B3DC6BFC4F63F APU/1
913,004,523 *5F074AD27D73B909803E3BB93A0F1194E0497B55 ARIANNA809
913,004,524 *5F0E1453E54E283A0BC2FE065C3DBABC73F02E54 COSTOCOL
913,004,525 *5F0838EB0EA1368A4BAA915C8CD2690BE8746719 COY.COULBOURNE
913,004,526 *5F04BFDC40DFEC2118B37CA6FB96E3AEA2EE4B5E coyoted2
913,004,527 *5F0265216C5CE647386788FA17E7DFDCF96BD056 CPPT$
913,004,528 *5F080C6365FB2D6D0F7DDE8361E26978BDCB321C ASDF9235
913,004,529 *5F006332ECCE1A397F54F37DBABC30B12C97D62D ASELFANNEALING
913,004,530 *5F0AA3F1A2370DABA1D7F3372C59D1AE6A90BF35 CqA"
913,004,531 *5F0A464A716E3B7F57F221E8921EE652FB44CFE4 C!RCU1AT0R
913,004,532 *5F06E74AB03F8627B9DCCCF61EB6BBC0655B9524 ATF
913,004,533 *5F07EBA9A65A8A0EC3AF9726AE6409039AEC3C89 CS2KK
913,004,534 *5F0CBAD979B95998572788C80EF3F0A643BC51DC Attention, all aliens DESTROY ALL MONSTERS
913,004,535 *5F04AFE888E00F92481B06966223A4E9DEE6B231 au69$
913,004,536 *5F0C7D343F111A8C4D45F8491DBEC5FEEB258E1E curtruggero
913,004,537 *5F0634AAF11AA4CD92014DEEF8300669722EE48B CUTJ)
913,004,538 *5F0300B82E201FA2DDB9B244EECCB35A87B4F402 cwckg
913,004,539 *5F0D978FED2FE26D78384E6756BD381A823F3E5F D0b
913,004,540 *5F0E45B93FD73D25ED8FF8EBD7DF16E136DC9542 b0uas
913,004,541 *5F09D7447AD95A846181F88AA410CC29E6ADFCBC D4N4M1H411UL14
913,004,542 *5F02C3741CC7D0A99CB71D33CDA8BAC2EF337D7D d.4u9
913,004,543 *5F0AC2DD84E4746F470CE2927D03CBBB1160A526 d7"?q
913,004,544 *5F021C0CD272F6F22272C099B7165F5E9EE849C6 da.0m
913,004,545 *5F0A65B7878DAE0F79A3327DF5137DC8DE9C999B DANIELPINGLEY
913,004,546 *5F0998D9462BA903D9BE5611AFA8C31A341EC000 danilosdoia
913,004,547 *5F000A5841336CD914F3199850F628F0523B3461 bassermann
913,004,548 *5F05D0E5EEE7419F8A8379B4C83A0FF6FD6AA9B2 DARONRICKLES
913,004,549 *5F0E436DEFCAC9E17F3803CDD91A66DFA76C08E4 bbvev
913,004,550 *5F0DE40469285A8B5E17F3F5CC4E2AB0EA6BFA50 BC_a
913,004,551 *5F01C955692001EC75B8D453C68373F0A87E4E7E [email protected]
913,004,552 *5F0B477628BA40F14A89828F91D0D9C7E4B4B8FB be/ah
913,004,553 *5F04A22E04FA040FE375846BF0647FF3344C5763 D(B0Y
913,004,554 *5F0C237C9420C788392305F6A2B7B27DDEB18C13 dbr9$
913,004,555 *5F069CEAE513DDF61CDC05DAD68B7FCA26D2A429 DCGPJ
913,004,556 *5F040FE45CB3CE7A0D70B2BC8B358A407C66FDC9 D&C?S
913,004,557 *5F0544FA4AC00A1C4E1F02E4CA137C5E1710DEE1 DD2LR
913,004,558 *5F073E52FD84B8D371507E5B8E5B7B26AD8EFDEA BERTLANGHAM
913,004,559 *5F030108C5613B846F73C5547F160CB7B88A2AA3 BERTRAMBALLETTA
913,004,560 *5F0F6251CB85C16FACA642B74CD239DE3C967F1D BES0)
913,004,561 *5F0C2873A3C24CBACCEA0C713B63EC3D70DAE79F BEU!E
913,004,562 *5F04202D4A60538C535B5450FB40DCF26E16A678 DEEJAY.BABZ
913,004,563 *5F0CF98EE72000D8405FB3BC9CFCD8A6BF3B6301 bgef#
913,004,564 *5F01169DAE759108BE231B0C61EB61B16C5B9A51 BHARDES
913,004,565 *5F0D25341E3D4A5449D63E60C70E24BA08B9F7F8 DENISESATURN
913,004,566 *5F0FC3A4535705CC4005AF6FEC10A5CB71590918 B+IZ
913,004,567 *5F008EDF0E07A88F89491DA0149F8DEB08AA891F BLINDERN_STATIONHAS
913,004,568 *5F0DADD66F3B35DF8A8CDC17FE1350CB203256E0 BLOGBADLYCOMBLOGBADLY
913,004,569 *5F0AE07C2C578B5D2746A2208F22A7747A08A503 BLUE-ARC
913,004,570 *5F0512ABA82D9671A8FD8483917B3DAF30746B75 d&f)3
913,004,571 *5F0CCA9412EAB3010D3C705F68E65E07C8F9F1F8 bm#!v
913,004,572 *5F0632E1545C3261542D942BE565A84AD2003B52 BNDHVLES2
913,004,573 *5F023DC3E41D76AEB880E1D782709B192D97BBCF BO6WO
913,004,574 *5F09FCD47F76EEB3DA3503A58CBF14D3FF0974EE dicklove3
913,004,575 *5F006E6C8AC8FC3B7F0A6AA17A82BFA2E33FF749 boydquintela
913,004,576 *5F073344F1173B59FBAF52F839C0780184050AEF DIESELHAULED
913,004,577 *5F08EF5D7925E67DD52B262A41BCDD104CAC417F Din-Klocka-Tickar
913,004,578 *5F09780A8502F4B5CC4D7347E1ADD4F21E9616B0 bqmch
913,004,579 *5F0024797B2529062637C5BA8F8836E9CFD3794F dipteroi7
913,004,580 *5F0FC25673A468F3A8477D85B1EB5CEF09C38873 dirkseamons
913,004,581 *5F085D2996E2743A2A2E4488308A18BF3FDDE222 DISCOVERY
913,004,582 *5F07EF143055A00C07F0516C29DA334E43FD55E5 BRAINPULLER
913,004,583 *5F018D4B2BC25948411FF069347F5D75F2E141E9 bramavano7
913,004,584 *5F08A69F19731271F5D47581D4502A91554180A5 djw3g
913,004,585 *5F05EA68041E039F87DE4B5C6D5D486F1A62EC83 BRIAN.WHIRRY
913,004,586 *5F0DFCB9C08DBFA551D8B02A74548178459A0099 BRIGITTE.RAMOS
913,004,587 *5F021BE75415611DD1E9D8F4F5CCB5852760C233 dmrk1
913,004,588 *5F06B35098148C1D82D714ABF096FE37CB2CD3F1 DNP;1
913,004,589 *5F076BD472EE3F26F099AC628B29E6C5758B6151 BTOBGAY
913,004,590 *5F00340AD3B6E6A2137DE8ECBB2F97335B6106B8 buckhassian
913,004,591 *5F071FEC23C5B606EEDB1FC5ECD26099FDA31C40 DOCUSATING
913,004,592 *5F01E64CDA726A693C11917DAA5F905E8E8F8E5D DOEC
913,004,593 *5F0CA370D186737870C94BAC0B1F1C78198A291E burgarjeva
913,004,594 *5F0C5B575121054C2C33F95A28B67E6585E65F21 BUX0MES
913,004,595 *5F0F2742CB276DC39A045B224AD6C320992C54E5 BV02
913,004,596 *5F02A25806AB17668A0B6B7C3B076D8D57B04041 DONOVANDESCHAMBEAULT
913,004,597 *5F0294DC6BAA8A4D2EF8A2EB81556165EBA3D420 bvkg
913,004,598 *5F0261B6CFEF1B5805BED0FFF48A5558836BE588 DP-PC
913,004,599 *5F05086F7E70A61CE9F7046207CE16E54083B23E C1ANNI5H1Y
913,004,600 *5F023959B3F01BE209F6485606AF503523C4BBD6 dr8.0
913,004,601 *5F045E0FC6AA7567276DD88D5F0EFA2D605D5AB9 d,rh!
913,004,602 *5F0C8B9AF086E1627E5779952C81FE7EC6507A0B c4rd010ge$
913,004,603 *5F059647FA75BC9B37B17A6597679D381A5179C0 C5NLR
913,004,604 *5F0446E096D50112176DED9AEA5172692A49DF14 DSL"Z
913,004,605 *5F01ABA6CE7CB6518718B71576FF0D4090E2F2FE C8KFQ
913,004,606 *5F0B44F7739F7F1BE6EEDA05A7F70633BCA49662 d,u":
913,004,607 *5F0983406C0EB37A99EF9F826A63415A75D97E18 DUA
913,004,608 *5F0859DA3BF27B9C181BF698890FCD00FDF390A9 DUDLEY.GURRERO
913,004,609 *5F0CEBD054FB75CF7828874A06E066FE04A8646C CALNS
913,004,610 *5F0F67009AB33635F668EA77F107D7763CD0CBF3 cambridgejobsnowcoukcambridge
913,004,611 *5F0CA093B426764F341EE49994A884F875D00190 [email protected]
913,004,612 *5F0B0AF090235BE8DD5A56F2761BDF158D92371C DUSTMOPS
913,004,613 *5F03E6B62A006DF0E886B359C23BA5E13CD332A8 d!%uu
913,004,614 *5F059F0772D608FA5A871E4C598E96DF2FE74CF1 CARLOS.WARY
913,004,615 *5F0FB71DDC7554550BC8CC18A86F07053310C75C carlotouchette
913,004,616 *5F09155F401A299774C14E94E114C256095F1AC3 DW0B
913,004,617 *5F012908D45A5C4449CD775E9AAFB82DCB120B5B dwainlusardi
913,004,618 *5F031BA73221A1A4B138B50C1A4FD7A4037B5683 caseyhelaire
913,004,619 *5F0F1EEAD46F79C3CD0C2126C4A20BD6676D3BBB CATEGORYDOKKEN
913,004,620 *5F06377DEF02B61A8162C4BD21501A3BE190A745 Cat ONine Tails
913,004,621 *5F0713D7080B5A51D62D6C83AFCCDCDB2147710D DWT,
913,004,622 *5F0988FE45045296E759CA761A0B0A151E09AAF9 Cc4L
913,004,623 *5F0304F1FB026EEFCB278F0FBD97089BFCC8E791 C:\DocumentsandSettings\FireXware\Desktop\Projects\zPOMG\zPOMG\obj\Debug\zPOMGcsprojGenerateResourceCache
913,004,624 *5F0851D0EF622238A15CE7662C07856B3397EB78 ceaz#
913,004,625 *5F0502558B5B955E14CBF7543E6DD86C7704A104 CEDRICK.CRIGGER
913,004,626 *5F0826FB0406914A975F71FD7BF3EA3ACE9D3D60 cedrickcuhel
913,004,627 *5F099CE8E69E3071D74A87C190761BA118213574 C(EK5
913,004,628 *5F0CEB1D0DA50070B327FB4FA1E282EE24821177 [email protected]
913,004,629 *5F0CF15B233B85508DCE444E8D23D265C04EAABF cfdv1
913,004,630 *5F0C6A7FCFE80F16CB3217FB3858DFDD6D5DA5A0 ed$hl
913,004,631 *5F0467F14FCBAC78E2E0F4D0E448D8BDE26B1C68 EDWARDOWESTLAKE
913,004,632 *5F0E4751B47FE07D7F97A070A59FB53C2BC1572F eela'a'
913,004,633 *5F0B89771A9A2A7581B680684052A50DF2B887FF eg6
913,004,634 *5F074C1E865072BA5405453AF215C78F2F8C2E6F eldenbarnscater
913,004,635 *5F0893703C7D0DAF2F7A02C399DCC996933A8B71 CHRISTIAN.FIEBELKORN
913,004,636 *5F09C86BC1ECA23C2109F37399988CB7967AF1D0 elementalsdcu
913,004,637 *5F0D9351C5AB629F338DE7457D10D2565C1E59DC ELISEO.TIPPENS
913,004,638 *5F019122CA8457601590AA29C9FAC27AA585CB7B elliotwaite
913,004,639 *5F067DC9789D1CED3540CB17DF85632BE122954D EL%MK
913,004,640 *5F0B7057EB5E7AF8214844BF460E6C2E9B7574B7 ELOY.MAULDING
913,004,641 *5F003F7FAA14A2298181733655AC0E9335B236EF ELVIN.DONAGHUE
913,004,642 *5F0B20A0C400A7C2D7BE2A59CD82846A6D15524A EMBRYOEXCLUSIVE
913,004,643 *5F0FCA73F9F711954A22213B63FBEBC2CE10CED5 emeries
913,004,644 *5F0965B4521F5DB5ACE05B6A60C24BEBDD21847B emilolen
913,004,645 *5F0B57605B51760E96F5CEB16F36FAC3772873EA emp7n
913,004,646 *5F031CFF22F0F512A6ED804EE9A8B34D3593292A .em seracs tahw s'taht
913,004,647 *5F0FF297A0ED4CDA56176D674B70E45900597D75 CLIFFORD.QUEENER
913,004,648 *5F0C642CC29A92A34719832E8BF3E4D87DC8FEA5 cliffwendelin
913,004,649 *5F0AE812DA4D06D8758B567FC8D586C640EC4626 cl,ka
913,004,650 *5F00107083640BCF73DC041FE04BB0D33347D940 COFDMON
913,004,651 *5F057A6EB7E437BC9C1F514C400412E58080B8E5 COLLIN.PHELTS
913,004,652 *5F025C22F60492444E56AD9C4697D50C4FEB1BFF [email protected]
913,004,653 *5F089F5B35211BA967102706F2FDA483A4364EEA COLUMBUSBRANYAN
913,004,654 *5F0BCD46E7387004423111009D431EEA4A650551 COMA1
913,004,655 *5F0D35BB68643FFCA7970EA2059F5C226EAF108A communalism9
913,004,656 *5F0BE879C1EE79B7EB4B62F8A41E9F7222E8B0EA ERNEST.VARANDA
913,004,657 *5F090D62B9BC2AC5A00BE4A749C606262D7E79D4 coo;_
913,004,658 *5F02CA39C52E8D0E167C8F09521D9FBCD951A663 ERYN.VICTORIA
913,004,659 *5F0BD08DD31922BE84F9918F31C74AA65824CC2C ESBARÊYE
913,004,660 *5F094184B1F65C862325475B3462D7D32D18659F esf&u
913,004,661 *5F055A8E971F5CD0F08A3F3E4917F01B3A1BA75B Cosmopolitan.Life
913,004,662 *5F06F8EFC93C25603B8F7D94E4F0BFD094C3C22C cotesdebordeaux-saint-macaire
913,004,663 *5F0F7AA9E7CADBF2CCB17A69856859C34E72B54D [email protected]
913,004,664 *5F0632A423F2275B2991D988C0D1AFC4EC14AE01 [email protected]
913,004,665 *5F0B9B1C1479506276B0B3D97307DDDF3E2501B7 ESQYO
913,004,666 *5F03289F1877471A50B41B528232E2735ED54307 CQB0P
913,004,667 *5F073CA860078042A3FA9542C89231EC9C92017E CR9V
913,004,668 *5F099343251121881CCB9177979E7C7183F3323C eursnests
913,004,669 *5F0180CC4758CBF5A13F62A77B71A8AB5C336B53 everydaymylife(originalmix)
913,004,670 *5F0D58858BEDCA515F7D9289D797E0E73A88D55D CTSST
913,004,671 *5F04F6F0903A22364E360AF2A243691CF558864B færgefart
913,004,672 *5F0D9238BDFB3A991B41AF46B11DE9C143C201E4 CURFO
913,004,673 *5F08BB3D2D5566DAB13D67BA15E60F48CA2271FF farewell-to-the-great-one---wayne-gretzky
913,004,674 *5F0EA234EB44ABE9091CBD0C082B77764517EF7A CUTSCENE.-.ALWAYS
913,004,675 *5F05B259585CB042BE55F06E164234AC000AC738 [email protected]
913,004,676 *5F02BBAF5997B01260AAF183172FFBC048FB90A8 FEG0101
913,004,677 *5F0B49132B0C3462259536C54C12D7B735B68029 FELIPEC88
913,004,678 *5F04CA74BA4966A0085687C1F6C6247028E1819C cw-o"
913,004,679 *5F0D3E58BC093FBC4084089E557156A6398C8588 felipekovalsky
913,004,680 *5F0D1C9465944C006EE365EFF80A1B81D5D4BECB cwqr
913,004,681 *5F0A97F470E5D8D119A2149A3D54AF5AC4D5E7AD [email protected]
913,004,682 *5F0959B9EF1864124B446EEA187C3520A91B48CA d#;?
913,004,683 *5F04E70D2F6CEB4DD9A42E27C8FD3C747E583B10 d)#18
913,004,684 *5F02B099FB4B8212E967598F7692F998BB04135A FLINKEFLINKE
913,004,685 *5F05D06A5B5EAC8DCC528303DAFB9058DAA826B0 flycatchertalkbluec
913,004,686 *5F0753863A9982FBF47C3FE54009206C2429E82F D40=
913,004,687 *5F0ADA044BE00D9F499594639E6782F02D16C479 D99S9
913,004,688 *5F0C44EE1E2BACB5B5F962EE934924A1906C6583 DALLASECKOLS
913,004,689 *5F0C452CF6E4C4639ABD27AA5B9F159D14D9DD29 fuadadh2
913,004,690 *5F09FD3F6C915B6B2B804B21EFCB3885DD00967A DANDOUNBAS
913,004,691 *5F05FF0E60650AA5757525BFF5664B28C6B8F39D G124420
913,004,692 *5F06EBFBBEA67269C39EBD1E318762A673206B5F gabrielle
913,004,693 *5F0461C39512D942D8088BDBD22BC9323CFB235D DARIO CASTELLO: SONATA DUODECIMA
913,004,694 *5F018F1324CAD3A122763DBE374BCA8BFBB8101D GAṆḌASĀHVAYĀ
913,004,695 *5F0A15EBCDDF127C25CCFF63949A6A2549828993 DARIUSSAGRAVES
913,004,696 *5F021810A480667D6B431204F889650C515E7E7B darrickdelaremore
913,004,697 *5F0FF74884ED9D7D6932A622C6F0C70EFE8ADF16 GARRET.GALVEN
913,004,698 *5F0F063C5CECDC319251172B57071B4E2BB7AFB4 dart-
913,004,699 *5F0836F2335D11E7DA6E3F6E101A6445C322B51D DARWIN.FURLER
913,004,700 *5F03DBEBB5B7AAFA6CB2C96087C3E73A8E54009B GARYMARTLING
913,004,701 *5F0A64E5EC4FF219EB9AF787E6FEC6056017450E gavindincher
913,004,702 *5F03A75605A06F0B12C993924AA1BEF260F191BF DATRICES2
913,004,703 *5F066F972A59E17FB603D5AF9B3B5317EF98A332 DAVIDKARAGIANNIS
913,004,704 *5F04EE7A4D51D97308BA0A282A596E746F32D3E2 [email protected]
913,004,705 *5F0758FB6D6B5711D63CFD2321CD1A39706F9080 DAWN-PRITCHETT
913,004,706 *5F059D646B9AD53AC9EA40130251AF7AA474F0AA GEIZYUTUKEI
913,004,707 *5F06A2BB3F6556BA42FE43F0A36781CCBF86C015 GENARO.LABEOTS
913,004,708 *5F045590C4C932BE2B971FF10F023089C05C9F01 D!BCO
913,004,709 *5F0471184114A13F70BF55232CEB4034344EED5E geosynchroner
913,004,710 *5F00A25C22E4BF7E837E0A1396E969DDC0A28278 DCJ5
913,004,711 *5F0947541DA2D8FF505BE327EDF4ECF96D7B63DC DCPMI
913,004,712 *5F06B912D1E468972F2E404CAC33174D312F302D DDRP
913,004,713 *5F02A21F0E2F7E29F1CB7F04A1F73E3D7A8DC09C [email protected]
913,004,714 *5F0E74308C46D64D03A5FC98B07959EBEC905189 GMAKIM
913,004,715 *5F0129263DA704C8C2DDC04A0D6BC319916B4D16 gniugirting
913,004,716 *5F05F2073FBF27DE3C142D9220F57FC15AF44956 gnixobtus
913,004,717 *5F06693840EFBC8122068E8C8664D7D1FF7C3DA8 goingversion
913,004,718 *5F050D2E79BFCFED75A89F49410814A6C06D7FEF DERMATOTROPIC!
913,004,719 *5F0EFE76DE7049348A58A384D68E90A01E0F842D GOWOMBAT1
913,004,720 *5F02142424EDD0AA92FC4AE550ABD7237201FA4E gradual:-locus-iste-a-deo-factus-est
913,004,721 *5F05FD702041A403568144D4D4D1A14669F629DF GRANDIFECHOS
913,004,722 *5F03A42D996E37ADC6490DA0D35F82B9135E0021 deungria
913,004,723 *5F07BB56203E09BA10786EFB1561F1D77F7D8DEB GUMM3S
913,004,724 *5F0268370CCD0E73C41FDE97E984E4A720F4CADF dh?m1
913,004,725 *5F01B2CC5EDE76FECDE5946C02A35B6611CEEDB6 [email protected]
913,004,726 *5F0BF423141358F3F327364C9B505E3F5255BDD4 GUY.BELOUS
913,004,727 *5F092A3B46D7C1249EBD124780FB4691DBD20BAB GUYJETTON
913,004,728 *5F04C7631D2AAA840175098EBA45AC46FA14444D DIBBIDY8
913,004,729 *5F07804C64A6D9DE692623C6E99235A2B4DEDFED [email protected]
913,004,730 *5F090125E56500BE294263A63AD633AC56533267 dieperik4
913,004,731 *5F06A25E6E9492DD76FADFD4811566C604B5EC6D [email protected]
913,004,732 *5F03F395458AC4EF02E6A089097FB85543FFE71F dinonamanworth
913,004,733 *5F020F01D18A534011A217738573456BCD0504C8 DIQ?G
913,004,734 *5F0EC22CC34344E03564E86325DDAD1D12FF50C5 districtreportcards
913,004,735 *5F0FE73E39B5DEC1A72102BE3CDFB4E3BB3EF11A diviesosing
913,004,736 *5F05A2BA750E9E7B46FEB2C4F7E2F0C5D9AD191A HARRY.JAUSSEN
913,004,737 *5F0C0C7185B7868E5A66BBF9C7D126A5FC9EBFD1 dj67%
913,004,738 *5F0D61A16D39CB9A5B490F5BFC2C38E6A5EB32CC HASHMATULLAH
913,004,739 *5F0DF98855BD3A345ABBCDEDFCE840B5A1128292 DKKF(
913,004,740 *5F0B920AF081BB0C987942B569AB2A156A56EB64 helens song
913,004,741 *5F02C02AA3C7DF1E5BB5CB06851A98CEEAB8947D do#hx
913,004,742 *5F0E7D2F00C9AB7664B179679A4C4C12E5165B76 dominickzackery
913,004,743 *5F0ABB1B702A72E88BAD707CEEE62C71C13917F2 dongdeboef
913,004,744 *5F0D381D73CFBFD41AEE265C7799F1EF4DA8779B DONNELLMCSWEENY
913,004,745 *5F04437EF08D21C537ACD493907F2B31EF38C0CF DONNIE.KRUMBHOLZ
913,004,746 *5F0D9FBD092778203B80B821580E27C9068556BA highly-efficient
913,004,747 *5F0A330DF125ED8636C3036229F75F4EC16A5337 HINDUHOW
913,004,748 *5F0E3D4CDC6130929A41A86D2F138BA28494CC22 do-pw
913,004,749 *5F081631E66544FEA49BE229A08870B5D9D4AF93 DORSEYTRANTER
913,004,750 *5F056A262798F4403ED5338A7B5B186FF056CE67 d#ou
913,004,751 *5F0D14A07C6847E41CFBDA9BBC885B2AA2FA2068 HOCHWASSERABWEHR
913,004,752 *5F0A21AB9DDF81BEA2322EC41EC498A3929CFAC5 HOOGBOUWKRANEN
913,004,753 *5F0C031B0B9ED4F3984CC7BD478706F15A6FE5AA HOTERKA09876
913,004,754 *5F0C801A7046B2427989E5657901C67ACA07B212 DR2E)
913,004,755 *5F07A03623FFFAB9550E51EACF7B4E41C14ED514 „DRAUGO
913,004,756 *5F084BF07679875BA72F8A1C6A7F9CD3B757F794 DRESDEN CONCERTO IN G MAJOR, S 214 (VENEZIA 1715): I VIVACE
913,004,757 *5F0FF3D627016BDB5F61CE1DD7117C875455E3F2 hrmvaara
913,004,758 *5F08338CA88B9D190068BA954A83C189508F652D DSHG.
913,004,759 *5F012FA3095F37511BC9FB42FDD7095F695A53F2 [email protected]
913,004,760 *5F09A8503EE795FF7395C23D376375178DA966A3 HUMBERTO.BRISENO
913,004,761 *5F06A9CD12966E0C1E519536A72613322604FA5D HYBRDSMING
913,004,762 *5F0F18A8BE4D80897B6755BCBD7543497CEF7F03 DUCKTAIL
913,004,763 *5F0E0CE26967B67AFC029E977B9BD12531DF3B82 dundeejunior
913,004,764 *5F00B0D1F47CE03D75AEA183E3A4DC38BBB5F90B IFTIIMISAA
913,004,765 *5F0A398CC605227C0DED9809C45B258AE0AF5748 DW0B
913,004,766 *5F0401BDFC9D048E7CA91A51507718ACA8A60BA6 D(WOM
913,004,767 *5F013D5B8836F0291EF6989FCC47F9FE3C7A6C9E IM3UD
913,004,768 *5F02FEF7B974124D5D1A20A6C45A417FB576E77F E820721
913,004,769 *5F06F3B816060AA01D3E6E315A89EEA3E1E784B9 EARLWETER
913,004,770 *5F025436BC7DBF719DD532770977AF4C6991626C IMPROVISATIES - ERASMUSWEG DECEMBER 20 2001
913,004,771 *5F0295E092C255508B56BFCB9863213D5B574B05 EDELLAEKAEVIJAE
913,004,772 *5F0A643E1592141EFCACA12ED6DDECD753E0C250 INNODARE8
913,004,773 *5F0E10C8E0D22E67CC520AC24CA37FD931BB4420 [email protected]
913,004,774 *5F02672D094889949EB3EDB7977E50AC275A48D3 interjectoried
913,004,775 *5F0AFB5DA1C4E41CDB80BC1E3346E880F47F3671 EISYAHH
913,004,776 *5F086EAC68259B3F021915F0B5D5350CC501A1F8 EJGEETS4
913,004,777 *5F0AE7FB499DA6FA8FBAB2DC0F259464B5F192F9 ELCID(PARTII)
913,004,778 *5F0DE02AD4AAD5A249BB470CD218334A2A9C2B71 eldpyhc88
913,004,779 *5F0D26322B93518106FAC5D32B442B11CA807BDF ELHCART3
913,004,780 *5F02FEE0C3882FC67E1993CB1EEA598404E07AE4 IUsedtoThinkAboutThisGirlatMySchool
913,004,781 *5F016F1D8B61F5AAD64822331C5917D63FA728EF IVORYWITTLIFF
913,004,782 *5F0253D30D88AD6BC8323E97F6311E19D770A178 IWONDER1979
913,004,783 *5F08C1B630A332E3899AFE228A01D4DCE1A84C0A elizabetsadie
913,004,784 *5F0EC618E62637B1968E8EED69AA0C22EAC90552 El-poder-de-Mach
913,004,785 *5F0D5660A2D7B9CC11E66F815438082873E27354 JACK DUGGAN
913,004,786 *5F099C5AB322954773FD5F0338851A9F98242A4D JACK-HAMLET
913,004,787 *5F0366E3DA356874587E1DEE562F52B02C3E036A el:w6
913,004,788 *5F0117D0B1BFA0AAE6051E4B09EB0D62DAEF58BA EMERY.END
913,004,789 *5F0D27C93CDFA222975FBA6386A2011DF9C3A53F [email protected]
913,004,790 *5F091B380FDDFBA9216D22BDB99FF436A5E67DB1 emigrara
913,004,791 *5F0947A8463AD5F093B148A5B8AB2CF0ADD6B3F6 emilioreistad
913,004,792 *5F001722F46ED37260A2780344633BA8BEBC5B5D emillaaker
913,004,793 *5F0D9A7004CEE85543ECEA1C83348A384ECA0EFE jakkam
913,004,794 *5F0A48C7B5A966C1D307BBFF76FA2B0301FDBFB0 JAME.COPSEY
913,004,795 *5F04C6841C0050955A7141DCD3B39BB939C7A3DA EMOXNAM0
913,004,796 *5F00225CEFEA8ADBF0232CE8E4B1B569AB507316 jamisonwillinsky
913,004,797 *5F02E12ECD5C85E30C0C75C8D4C3F9ABAEF45CC9 JANA.FRAZIER
913,004,798 *5F0638E34AAC1E753B3500CCC4AAA0A730F28B67 janlambino
913,004,799 *5F02E309EF324BF2D9EE9BAC058273895D5627B2 JARRETTCALDWELL
913,004,800 *5F060992B1F50E3CD3D32059CF49EE2755E67604 enragenyc.comwww
913,004,801 *5F0DAB772DE7754B2D4A76D8840292DB04883B8D eo#]
913,004,802 *5F04FF8E4F94AA6955E9167F8BCD332DFCEC6953 EPILERTE
913,004,803 *5F0239E8A55D55B30660264CBEDFEEEA3538DC61 ericacam1
913,004,804 *5F0B75938BFC25EB3CC786D13FCD307EBBA35557 erniemilman
913,004,805 *5F05DA2992A84C0FFD956E0C8A4E1B51226772C8 esorbitavo5
913,004,806 *5F0EEF3F6211C307FAA6D9A841207214C2F959A9 [email protected]
913,004,807 *5F08085F9A8B6F4FBB58222956F0CAA039921CE5 jillsoriano
913,004,808 *5F0D1C7601CB1B9F1D63ABC049CF23BF7FF18CC1 [email protected]
913,004,809 *5F00FA778FEA103B358594E1FF5A04263F2AEA1A JJBFGILVWUZ
913,004,810 *5F023BB190208128AB5279DEC61BF9B531829F39 ettevlov2
913,004,811 *5F03A09AD923AC1720C8F36CC1CCF0FEFAA49DD9 EUGENEMCKOSKY
913,004,812 *5F0C5192D85D89E622B01E27D201DD8F76542D33 JOHLAM
913,004,813 *5F0A9819003F55427170D3392CA99BBE69AACDB7 johnbadruddin
913,004,814 *5F0183FAEB31C668DC3BEE03B8BA1C01910ED7F0 johnniehandley
913,004,815 *5F068CF9A60A5596B0676F3C34622EA148FB904A EVERETTEMAZZONI
913,004,816 *5F0E464605E4AD68CF87E63A813835C867D555ED Executive Office Building She very much wanted to
913,004,817 *5F0AB4D48F84E5413BAE79164D3AEFDAF8265B62 JORDAN.NADER
913,004,818 *5F06C3937EC7070A85872D2DD092695591F69B01 JORGEMALAKAN
913,004,819 *5F0620222AE5A562ED705FEC198401E59458447C JOSH-MARX
913,004,820 *5F00BBE00696F71897215F64A17C96F1270735BD EZRA.NIERER
913,004,821 *5F00EC4B817CF919A6680361A4CCF2157E19236C josueauteri
913,004,822 *5F0093DE0D8A8C0A7F03CA3C503AC0E9EB308992 F191264
913,004,823 *5F056644E87FAA0831AFC7DD163C3944CD7C4032 F1OREN+INE
913,004,824 *5F0B9F5735D140E9957EC1B1E83BFC1D23978FA3 F4+h1e55ne55
913,004,825 *5F02C8EEDA731DA90B0077D23EAAC6A7BBFDA16D juergenahrens
913,004,826 *5F0E51E200BCFDD8F342767570E9091F5DEEE14F [email protected]
913,004,827 *5F007A8DBF4905C545DC3235931C530FB1164C22 Far.Away.Trains.Passing.By.(bonus.disc)
913,004,828 *5F0EEA9AA3AEB6B01B87F373562AB78A4367156F JUNKTIONAALISEN
913,004,829 *5F0A3F3947E64267713CD31C185C456017C0EF9C junttnuj4
913,004,830 *5F0F52E4B7745893999CCEFF6D9EBE7931314E80 FAUSTO.REKAS
913,004,831 *5F030ECB293A5B081216DE26DDFA98055FCC19C2 jwkk
913,004,832 *5F06DE2F23379BE34DF84550926F6D28AF301C0E k2ph
913,004,833 *5F07C8F948A5B6A9F5973F41EA08A468DF73A7EC KAMERORKEST7
913,004,834 *5F0EA4AAC2246C989E9186BBE1B8DBF96F0FE0CF kareemjeanclaude
913,004,835 *5F09075EECBF515BF365DD53297EA287EFE68502 FIDELLITTRELL
913,004,836 *5F0EF03EDABDA49F781E42A1A177B5A478538C53 fi$hb34m
913,004,837 *5F0936D3194E6D80B7CBE3EC37B93244E98A96E8 KASSENKOSTEN
913,004,838 *5F02AC871603C8DF0805EF1CE6694D1FC1EC52FD floydzizzo
913,004,839 *5F0312D1CFB677F9F1BF007BF8444EDF05465FAD kendred.smith
913,004,840 *5F0E61EDC325EA94DDA0E80FD4FD49D99AA1EE56 FOCUSSEN8
913,004,841 *5F0F765C0AF60D731E31869EF70D4F3F4E925C3F ForHer(instrumental)(featMichaelShepard)
913,004,842 *5F012A0BED0C04A666F066FB6FC863E6D99D07DC franklindrabek
913,004,843 *5F0974DDBCB53642FAF1B01E0F6C95228952C532 kir*
913,004,844 *5F016D880B0DC6F386AF3A9E8492CDC7CDFE1638 KOSTEGE9
913,004,845 *5F009D567AE3975D5A308202EEEF9268718AC0CC KVAILOMIS
913,004,846 *5F0B4D3A835995E8FEFCD369F15DEC53CEC5D97A KYZYLKYRGYZSTAN
913,004,847 *5F0CF4B1163AF167476AD09ABE2A117262AFD81D Gb(
913,004,848 *5F0C5647160A73B30F7729CD338C0E820B87BA4E GERMAN.KOENEMAN
913,004,849 *5F0FE25CB0A8D5BDDC91640D0E89D6CC4C628025 Latin-Simone-(original-version)
913,004,850 *5F010622DF1B45034E9033FD9617346312283EFB LAURA-PAGANI
913,004,851 *5F0E4B1FB7292408134F8A21EBA7A2FD7F5C0302 «L’AUTOMA»
913,004,852 *5F0ED84C16743288A515099F7F3E063BF812C23B GHZ8
913,004,853 *5F01FE8531BF01ECD6710027E6A56C58E2A2C39E GINAFAHRUSIANA
913,004,854 *5F0B5C61C7CB8756E3F7EDD2AE7F0AC0FD60F824 ginghamed7
913,004,855 *5F0857BB62FCB18F3F25DC005A7D829C8B358FA0 GLENNBOULDS
913,004,856 *5F08B1043DA65DC6EF6AE54B783FC5BA934A19AC GLENNDREAM
913,004,857 *5F0423BCF7CEDAF7D2007123E5EACA5040A21393 gnjjrpas39
913,004,858 *5F0C892B7A10AE70DACBEC2281036AC4FF19C2BE göchl
913,004,859 *5F0308419FB214A2486E98960D81C6B64A3CBC0F god intends to burn people in hell.
913,004,860 *5F0488527F1A156B7827CC3C7271DDA96951BC97 GOGOWITCZAK
913,004,861 *5F060E74AFDB8D109B2BCE427263C54929ADE0D4 LEONARD.CHANIN
913,004,862 *5F0B9B458922EAF58CED6DA2A4A6A0685CC12C40 GONRAY
913,004,863 *5F073B0745B3AF02212DB4BB4D796885D176B2A8 grope.need,.part.1
913,004,864 *5F065F84524356142D3060FEDBCD26B9D76C333C [email protected]
913,004,865 *5F0740EDBE2B44070FEBC42A372696D72D575167 lincolnkimmer
913,004,866 *5F06F55CF106153ACBBC4E2B078A90B78751D2F4 LINONANAS
913,004,867 *5F0CADE8C4CBDD509DF6329B055A1AF413DC2671 LINWOODSNOWBALL
913,004,868 *5F04D6C198BAA881783986369F38C33A30B91CC8 GUONZAM0
913,004,869 *5F0B750973FC8D98C3EA339F9580C9EFAB80F9A8 habiteds9
913,004,870 *5F0C17C8D286CA2B2B46DC7BE59DA8FBD4329E50 lmkg
913,004,871 *5F08CA0A2970513F39043D3B3F9B9AC3A4E97F60 LOIMONSA
913,004,872 *5F04C98E91833E9F21E81F7A41DD14FEEB91C718 lok-fm
913,004,873 *5F0CC32109C5067494C4271329FD9ABBECD9273F loniseromma
913,004,874 *5F04DF7F006A128B6FB05A5D51DC5665A00E5C56 HÀOKIỆT
913,004,875 *5F06954FB5B9A4228775A49C0602468B5ECDAEAA LOTES!
913,004,876 *5F0A1984DBAF9BEDD657C0F34EAC1E03E7D68FEF HAUNTEDPHRASES
913,004,877 *5F0F6D13A417E9CE2686D3F043155C91F980D25B haydennilles
913,004,878 *5F039D798217F4C457CA9CCD09B3A045AFF809CF luciasansiroealtrisuccessi
913,004,879 *5F0D8126FA28CFB4A23D66EC76906FDB4E2B213C lunada.thal
913,004,880 *5F03CA5B28451A9185CC5150E8ED9C6AEE1C5BC9 [email protected]
913,004,881 *5F0D45988FF163C2C31E89FE437B32DF46AA40C4 [email protected]
913,004,882 *5F016B4AF297B5DAE066CD4D057122F029200233 hencote
913,004,883 *5F0A3FA46069ED8316AFD84466742BF8E490222F HERBERT.TREGER
913,004,884 *5F07143E78216F27A617BECF1B2B35BCC0C7E071 lutterbrücke
913,004,885 *5F0963A95ACA7D8740DE06A47EBDED605B81BA92 HERSCHELMAFUA
913,004,886 *5F0A232DE5ADE24CD56D6DF6797D878BFF7926B6 herschlering
913,004,887 *5F0F570B9489B704FFE36B4D729D0BDD579AB34C HERVORMINGSOORLOG
913,004,888 *5F0A7AEAD6D84859E3D632E2218E280D1C737E7A het zwarte schaap van de familie.
913,004,889 *5F0A52ECA66AE70DA553FD3833AEC5E047A189B7 LZGQAA
913,004,890 *5F05244B9FB0059FFDBD67C5423E674C7271967B HGUOROB
913,004,891 *5F0A4478DC5A163413A08B836CFC2A0F076B6D81 HINDLEMARSH
913,004,892 *5F0DECC953BC8AB20CC535531C0534F26608B188 [email protected]
913,004,893 *5F0AD1B1A90D39ECB52890E55333458E653BD03D MACROSELAND
913,004,894 *5F0C5C258B328819E882A21340B99A9CD7B1D07F maddoxes8
913,004,895 *5F05DF3EE0957AFBCD3931156ED24D002741234C HOMARUSESING
913,004,896 *5F014265197B102BABAF14227B7919B3D152F9C8 HONDURASILAISISSA
913,004,897 *5F068867B685B6EC288107F8388F116787F13A7B mankanya6
913,004,898 *5F06C7EF53D4B32861C3FD6B7A04C366F0877B6A marcfelico
913,004,899 *5F048417F02F1526274E0AC76A30E9AD1C44C87D marco-bartolozzi
913,004,900 *5F0BF25B6D287BD297756845EA922F6992991726 howdoyoukeepthemusicplaying
913,004,901 *5F02E21F9E5A2A19753824F1982FB6C251277EF3 marcossmaldone
913,004,902 *5F0CFBC187BF9E78965B23942989CF538E21EED3 MARION-VOGT
913,004,903 *5F0CA1938E3B2761396AF670400B7AA8B2BA0618 mark3091
913,004,904 *5F050F94E6DE8A8BA57D8E9F072A37221993FE73 HU.CTV
913,004,905 *5F07233CD237E03DE0775DC0B7C4CD2C8141939A HUNTER.EICHENMILLER
913,004,906 *5F0395B3E890D345288804D00E0D060BE8BEAEC8 MATRAHES6
913,004,907 *5F0760F9F9C58597085091AF87E7930284F14E7A MATTREAVISH
913,004,908 *5F01D8AF49D2EC44D0688C61DB7961DA8D73AFB5 mauricekim
913,004,909 *5F01A50DCD663D674D16CD226CD9B6D83D4C8784 MAYA MEYA
913,004,910 *5F057B3E6FCE40295B45BF70B23F9AD172D698D8 IAMBONNIE2000
913,004,911 *5F07BB0F7AE81A39C7395FD7C8C1F4D6DF73A0B1 mdq6
913,004,912 *5F0ED1D1E3F5746E4E253635847BF3EB7104D4C9 IFIHADTHEBRAINSIWASBORNWITH
913,004,913 *5F0FC139217EB9BCE0487C3B3FD1EABD508B2154 MERLEGIGER
913,004,914 *5F00D1493EAAD8C2BDD852344DA8C945F94ADAC6 IHCIIHCI1
913,004,915 *5F0818EE01C7FAB253153C029762EC7072D10904 ilçikedey
913,004,916 *5F0EEBBF7AE4869D07577D80184EBDB2C1F187BD michael.newmyer
913,004,917 *5F0AC76FC2F3626E68A759928218CBBAEC7F2846 ILUVJORGE2002
913,004,918 *5F0AEE53E3FCC2DE3A91562D57D1AF52759D8F18 MIDNIGHTINMANHATTAN
913,004,919 *5F07B7EFDE3C163F8AEE5B8471D555B0BA78C144 INMERSAS6
913,004,920 *5F0B460C35545B9842C31C0E9E4D2F682FFF64CD INSEMINÓ
913,004,921 *5F02B230007E57F32893A34F74D7352167C04597 MISSITEE
913,004,922 *5F0DE62C2DAF9EE67C9BB9490C4D9336C5ECFEAA INTERESTINGCENTAURI
913,004,923 *5F07D6A57D46BED82A7FC600C19A34A2EECCACAD inutilizzati4
913,004,924 *5F0495EB7FBF7D60897BDA9EC762B521E9EE9E39 [email protected]
913,004,925 *5F04282B54F9126818FB1627CD4B7DEF061B9668 MODROOKS
913,004,926 *5F088DE6C541A0DBCEC0105551A253B7F30E964D MOHAMMADSTIEBEL
913,004,927 *5F088BF4861AD233C0EC1437C042CD856714295F MOHAMMED-ARAFAA
913,004,928 *5F0DC860CA11CD5BE9340EB978DF20DF04953EED mohammedplantier
913,004,929 *5F0B7728FAAA19A5D2057417A1706F70E4521836 ishara007
913,004,930 *5F062A5DDDA4BF5FC996F2BCC260BDF31CFD36C1 ISRAELENGELBACH
913,004,931 *5F0B9EF99A5AA39623718BB7FD50CA6FEFD4C7B8 [email protected]
913,004,932 *5F0EEF8D356690688D87DA6AFD71E08021E4E900 I.WILL.TEACH.YOU.A.LESSON..YOU.WILL.FALL.DOWN
913,004,933 *5F0A5FB7ED99C3729CBD88545B975B170D776738 j.7r
913,004,934 *5F05ABD06D3D2F8ACD66BA89C84009AC4A9FD065 MTISSERA0
913,004,935 *5F0F0FDCC4EB8974A4880DF851FA5056E00EF50B JARROD.GOSSEN
913,004,936 *5F009E05A12E2F4AD267093F3EFEB1CDFCCDB26D mylenemalate
913,004,937 *5F02566A3AADFAA2204E3B6ABFF9DB346404E2C7 MYSTUFF12##
913,004,938 *5F00C1469161335E5808CB7E725F291B60FB87C5 jeffreyfalack
913,004,939 *5F0FA5808500D5C74E8905D75E76C22BA3D9AA2C NABIDAR
913,004,940 *5F09BEE1D76F5A4ADC50F668738BFA831D018E98 JENNA-DORSEY
913,004,941 *5F09B83CF3C27D13DFC66A7B79FBA8490F1FA9B3 JEREMY.SWEENE
913,004,942 *5F077BE989C263FB25CEE9BF7A490682C3E9BC06 [email protected]
913,004,943 *5F0E501C670F602AD2B53254D8C0B6DBE7BA9D97 NASHAE1982
913,004,944 *5F025CDA368230228FF87C5C18B3D8A27324F395 JHENRETIG
913,004,945 *5F029AE7E228B7F97B75678830C1B8542E716F44 [email protected]
913,004,946 *5F06019B05CDBF9131743AB43C9D0D06864D6663 JIMLANGAGER
913,004,947 *5F0A84BFBE6AC014B509A7E0AD76A8F44B9810C6 JIMMIE.NEWBERY
913,004,948 *5F03223B3B4D328BA73FAB135895B45C288CB1C9 ne 6 rondo larghetto - allegro "ah, perch
913,004,949 *5F0D616CF1F602F6A50F455E2572C2CB5EE8DFD5 [email protected]
913,004,950 *5F00F5062E973CF06E9D025BA938C7242720C14E j&ix
913,004,951 *5F078FC26BD2F23CD517DF804A1CBECAFE2235B0 nederlandlingvaj
913,004,952 *5F0A128137B94443CF404F82DB196AE7954E5B98 [email protected]
913,004,953 *5F03A2CE0013146B821A521C0EDDC50F161535DE NERELKEI
913,004,954 *5F0B81F5903CDBE673BE74D3F9FDBD2626E05165 netpeewzeg
913,004,955 *5F0649F0E265B9D678E2C7BBE43511E220111AEA nicolaswire
913,004,956 *5F0D5262E5B0F9FCFCF3EE5E7EB0E6DDC9CBD68C JOSE-CARLOS
913,004,957 *5F0550223D23A7E005E10C6606F12207B069D296 nkirvopk
913,004,958 *5F05B24BCF45464D2850372F49506BFEB499C572 [email protected]
913,004,959 *5F085841C1F344F5FAA9EBE678EA10BE21689B4B NOITAZIMUIDEM
913,004,960 *5F04F8AECA478966E7CE72D02058783DFC60755E JULIE.EIDSON
913,004,961 *5F01CBEAA9F3C3BED9588A10CCF6B7B33A4128F6 JUSTIN.DROST
913,004,962 *5F027AF9591DF0EDBBBD1D96B577BCA3EB9DBAA5 [email protected]
913,004,963 *5F0B567985512D3AA9449D94291F794F5649D661 novalynn4
913,004,964 *5F0DB1B5127103E9D97F753D24A6C166ECC46EA4 KABINETSKOMMELING
913,004,965 *5F0A918F7763C91AB9F397C330FF767064FBA780 [email protected]
913,004,966 *5F01C6BB25494930D5FD8597C44D2310360CDEA3 NW[AAA
913,004,967 *5F0DD8394064C14FFA3212A39BE6D3C218442B87 [email protected]
913,004,968 *5F075A7D5F16F6AD6CACFB284A753C8F7159AC50 ODELLFRANKL
913,004,969 *5F02F5E1320D5B5BF92936DB8075B089EE7BCD25 KEEP-MOVIN'-(FEAT.-BROOK-YUNG)
913,004,970 *5F0FCE707D69065E86680C8ABD2AD1A7AB815672 of-the-main-program<br>
913,004,971 *5F0FC06FD2973CD0B1B764FA96B9B284327AF29C OLINHERSKOVITS
913,004,972 *5F04D0E03561ECC9383438BF11D578EA8BA8A023 KENTGOLDADE
913,004,973 *5F03FD211E012050544789EFB10521F714F953F3 KENYACURLEY
913,004,974 *5F050EBCC19F71390E436E66F3014D4DFC345BEA O-MIO-BABBINO-CARO
913,004,975 *5F00FC4EA9174B7B2BB8D98B89AAA2099D6BF488 one.rupee
913,004,976 *5F0B5A8E2A467F0821575E74C76AFA0113C54CDA ON-MY-OWN-TWO-FEET
913,004,977 *5F0F41175B95796925914A7A813763F5FF80A221 opgekapten0
913,004,978 *5F0AC1AF04988E15F7554FD65678FFC4A5F43087 oscopesing
913,004,979 *5F062B2011765523C0F0720B0D3E806CE6956D32 KOLTEN812
913,004,980 *5F0F771A107196522BE928BDE69CDF0D01353ADE OUTOFTHISWORLDHISTORY
913,004,981 *5F0F9EB17D8CE6C32EF596C01B3CD4A6A10004C4 krasavcum
913,004,982 *5F0E22B46CB072C1AC8CDE93404B8182F8B72EA5 kusal-prakash
913,004,983 *5F007D954208ADCF6A17887A9112CFEA16ADE0A7 kvikrod8
913,004,984 *5F0429F4DDC08DF0E570A49930988C605DFB18C8 [email protected]
913,004,985 *5F02579E418430F0B5991BD391E603B420B4901E [email protected]
913,004,986 *5F09FA51E470B36D6DD4F6AD3D6D38B742D6CE37 PAO MANZANO
913,004,987 *5F0B629AF3208188D984106BA83F99B89FA339F6 PARAMETERERS
913,004,988 *5F097D8722A9A822296E99C8184D6A91D5ABCB31 PASSEP
913,004,989 *5F05FFE80F52897779F01941ACA9F3330880C477 Lazarus on Down (feat Serj Tankian)
913,004,990 *5F037B1DE28C8F60FFBABBFAC54352E923F28A20 PBCHUN
913,004,991 *5F0751EA26AD8B33955483BA61A29DDCF2784A4E p####B`~.`~}o{
913,004,992 *5F0C319511CF3F24ED1A8205C992F018FCD66C7D LEHTIVIHREÄSSÄ
913,004,993 *5F01A56109BF8C25B5CDF870CD51C8459AA2BF92 LEIFCUZCO
913,004,994 *5F03700ED50062F4C9FF92A78F53F7B3EA96A969 pd~0~o splat!
913,004,995 *5F0196C76F847BCE6E4A19912E215949676D1D69 P======D~ ~ ~splat
913,004,996 *5F0C6FF4FDB02D6ADDB047FA63FBC04349CA1156 LEONZURICH
913,004,997 *5F0C6EE032F232C2AD861EE1EDBAFEA36E952F03 LEROYMANSOURI
913,004,998 *5F063C5B14504819827BC1A2113BB7FB96A5F1D6 PENSIONNAIT
913,004,999 *5F08A29DF24076009C555E10021912BEFF4C6DFE perfidened
913,005,000 *5F09F7374A21D2071A8155751434E3DDE02742EB LIBERATIONTIME(REMIX)(FEAT.BOOBA)
913,005,001 *5F03ACA04BD8AE3B89D94A0777C43DD707206053 LINDSEYWELKER
913,005,002 *5F0BB9D8FEC9500D3680E53A550B98699673F250 [email protected]
913,005,003 *5F08E23B523E5C1BCCD61ACBF5B852CC19596B77 PILAZOLA
913,005,004 *5F0C9D8ADC62176DDB5B0307F9D1EB0CB423C47A PINAS市、聖胡安市、TAGUIG市、NAVOTAS市、PATEROS。
913,005,005 *5F0F17AFEE0B1B00D1FD3A12923C17405E769F80 [email protected]
913,005,006 *5F057610B3DE214C1AC03F95C0C0A94DDB09E195 LIUSUILIAN
913,005,007 *5F0D70679A1A02E51EE11F2C66D9A1F5FAF6DFEF live:.newcastle,.uk.24.05.03.(disc.1)
913,005,008 *5F0E6D7B3C3AE5A75AD5B4E6EA8B74FC2873482F LLAM5330
913,005,009 *5F02F032C73BF5F337E2C6768BC2F6BCDE5D1F23 PMATYRD
913,005,010 *5F0F3845FC4924B5A46B236689ABF49D7BEC2A4E LOEWENECK
913,005,011 *5F0F24CB3A3DA274AD6784C17E883571F165D4D6 LOMASTOMS
913,005,012 *5F06AC91376B54B3A76B43DE8D2BDA8DC1A5C74B [email protected]
913,005,013 *5F0E39C3527B0B9C881D27E259C323663AAABE65 lonnylew
913,005,014 *5F0A97AD06A6F5CB3836C4D4314000AB5251C4BA lonnyrowland
913,005,015 *5F0437B5E7C602C3476EBF9DEB25CC9A3E898FDA LOPEZ SILVA
913,005,016 *5F076B6B6F720BB3071E6033E968135603112695 LORETTA-MADDOX
913,005,017 *5F0318DC97C45D42CBA1637515E7AABA2D2DE5CA lougrippo
913,005,018 *5F0AADF5F1E8F671A7E4D7A713D707151186F83D louiezimba
913,005,019 *5F04C4C4D2A15365246B07E9E50E5AAD1189D98A portanigratrir
913,005,020 *5F0E3F0D06704568F97E994419CAD4453A3A91BD love feelings
913,005,021 *5F0D0E2018054BF535B4A6CB8E25C73796F73F7B P####P.`.(~_^)
913,005,022 *5F0DC3F341F4FEB360BA4083C5C969F9D50CB3C7 PPERINET
913,005,023 *5F0ED4A6304BDFA237A42044919E1579C15BDCF8 PPGRWEWS98
913,005,024 *5F0C64960E03B37223FDA1EFCACFB55FA5332B3E LUZ POZO
913,005,025 *5F036C1E88A5D826F9A137F839F423734A47505D [email protected]
913,005,026 *5F0EC130DE7C1AD8B3C1239939B1DCCB3F9BC8D3 projektankündigung
913,005,027 *5F0EF9BF85F0850520FB5DEF3A19242254C32F39 Protegeerde
913,005,028 *5F08B8A744170D343B497F21A3853B58DB55EB53 MAALATING
913,005,029 *5F057DBE4FDD0CBF41EF3777F5DB61141214296A MACARICODASROCHAS
913,005,030 *5F090010C0657FEBE0C0E036AAC0C82E3D8C89E6 PSEUDOMESSIAH1234
913,005,031 *5F0B111662F13863825368CF9410238D5A35416B MAITSEOMADUSTEGA
913,005,032 *5F0B7665DE8E9CDEAFF6F17D47A0EDF05EA14538 PUPPET-(2)
913,005,033 *5F08E7DAAF820B2B9D2BB21F7D22A2A08F55697E malašenkov
913,005,034 *5F0551C67487C5F02C7E9A35A2ED55539B778F81 MAN.DEKINE
913,005,035 *5F09673D2C271FA1158E2416D9F509104200CD90 mangupi0
913,005,036 *5F0AE1B2DE36EEDB7BD5F6DCFA0833F782591097 q--->~0~o.{x}
913,005,037 *5F02C6CE41459B07C5C4DB414192E4153BB35C18 QBRCBB
913,005,038 *5F03DFFBD6DB0593FEF7FDB8CF87F9D7BBB7CF99 q###b~ ~ ~ {x}
913,005,039 *5F0402D64E000E0FA665BC88FFF8E95597747366 MARCELO.NEMITZ
913,005,040 *5F0E4AD2D6AE6121B42B9E78ADACBACD3CD5605D MARIONRUBYOR
913,005,041 *5F00CC0B45796FB36EA509935649518D2CB73049 Q#####P ~0 ~O O->-<
913,005,042 *5F01A2726E0C8F2364F05E0FD3C30421810C9B8C MARSHALL.AGOSTINELLI
913,005,043 *5F04406059729403C85A38DBE8641E69D1497E2B qsrunuhfka1v8
913,005,044 *5F04CC7EEF3FC340F73494138C3AFD769A3101F2 MASCHINOTS
913,005,045 *5F091608FCD8CC48D8CB8F65F3FB71BED0E4E944 MATTHEWTIETZ
913,005,046 *5F05A121A8C4B52FA49E7C4019EE356C95876078 RADBRAAK4
913,005,047 *5F0777CFC65F67A10EFE5ACCC37D8249D2A193E9 randysausedo
913,005,048 *5F014166D22A889F7B26250CE325AADF8BFB6FD6 RAPHAEL.MENTO
913,005,049 *5F050BC1A97E62B97B0402604567B9ACF892BF5C melmadewell
913,005,050 *5F04EAE8047BA9481BCBBF0B04FFB9CE97B2A4D9 MENACHTAL
913,005,051 *5F070CA16117FD473B1B7AB2E411E783F6381F96 ravi-popuri
913,005,052 *5F0A19647323893DB23142C3D23F73F2CA76618A raymonbenett
913,005,053 *5F0EB035A8FD6F2E9C89FEEFBBFF2840E62D1059 RAYMONDJESPERSEN
913,005,054 *5F00C1525EE474917939D83783A86989D66A6198 mervinmyklebust
913,005,055 *5F02C88EAD5EA4E52439CE0C3A6C05D51522CF0A [email protected]+0MIZ3
913,005,056 *5F0D3A6491B7F53262CB79C50F6659CD89D1903F meselies1
913,005,057 *5F0407F56270AFBAA9B39B8BDB93A8DDC52BC33C RECONIZABLES
913,005,058 *5F0861CB3D0759765737973DEC026248422CB475 MICHEL.DUGUETTE
913,005,059 *5F0FB3D4981D5C8E83BFFC5CBE9A8CF24A7C60AA mick-riley
913,005,060 *5F0D221B927DCD062807FD9DE0657D957119B3AE reedmcculough
913,005,061 *5F09E6A3453595B44C1735D588824AF2E6D39900 milanau5
913,005,062 *5F06AFCDF26D9D3C95796958C066863C88461697 REID.DIGSBY
913,005,063 *5F084ACF387A64F665D6133FA58E78E60788CD06 REIDEVELER
913,005,064 *5F03033504167A172211F6A875719F39DA3C78A0 minarolliego
913,005,065 *5F0662A476C05FAA75C576DBFF0D1D441D50ABFB [email protected]
913,005,066 *5F04D162220586AA98682FA7D834E86C19D22663 residualsong
913,005,067 *5F0137DFFB3EEAA594A4E0784120C62A8DE0408F MOSE.TWILLIE
913,005,068 *5F0E6CA01C93DD02F5BF19EFE315BF2F9FC1491D MPES
913,005,069 *5F01A732E5C967BFADCF040DA3AC5C80F8584C00 RICHARDSIEW
913,005,070 *5F0EC1D5B3DB95E91A481A2EC817A4F72434A1EA MSANTOCILDES
913,005,071 *5F0E5F839B7E711497E89935FC8A530E26C35560 RICKEY.DAVICH
913,005,072 *5F08A72DC9592155D952C3684FF1BA1C66DC8F5D MTIMBER4
913,005,073 *5F01173EA4AFF302960E52FDCAC1B950BD4A3EBF rigobertomen
913,005,074 *5F07860CA3540833E34F8147F86CFC39D35637F0 mvw^
913,005,075 *5F027AD726EA3DF4B332E1F0C93D45695BF0B623 My.Thorny.Crown
913,005,076 *5F0D4EA32F5253BC6635F1FDCA75075E833B04DC ROBERT.GONZAGA
913,005,077 *5F0650EA1645695BAE9832C4B6BF07D426463A62 robinmaino
913,005,078 *5F010CD3DEF05E9BEFD79D7E9D7D521AAB652300 N4VI6DIA
913,005,079 *5F0FFF94048FBEB5C460F913C63F6A7D312EFFAA nakaarte
913,005,080 *5F0CD068609CA22ABC67524697B6CB90C819B324 nana-akuffo
913,005,081 *5F0FC512DDADCE771F9B42A1B8E1F2E1DF0D718D nanracni
913,005,082 *5F0A5835B5E792B0ECA560473357376C80B5794B ROLLAND.SHOWMAN
913,005,083 *5F0E4FB4F64DE49032ADED8464BA55FA50A9FF91 natala4
913,005,084 *5F0AD8388392880CAF868ECBA96F06C081651B3A nathanialclavijo
913,005,085 *5F0C4B24A0B7983791467CE7AE4BF3942C9417BB naturevalleybicyclefestival
913,005,086 *5F03283E99D0924BAD36D46FB5B8DFDC7D6DFA06 NEDSNKED
913,005,087 *5F0117E6511ADD769ABE63B9496DA706C58BA461 nedwengel
913,005,088 *5F0D30B0544D6E6B8D492B51B7B344806F2E16E1 ROSSDAUGAARD
913,005,089 *5F03317B5B57E0FBAE3E5FA476A66EB08FC34C94 neilbanerji
913,005,090 *5F004A71DE2A8F6BA25C73069DEDD41573729B45 ROYTANBSW5
913,005,091 *5F012A0750B0504B032FFBC3D2B5FDC4912BC837 rs12101982
913,005,092 *5F0D31A8FB9DF0869785D177A6E3D29EEC23B185 niesłychanym
913,005,093 *5F075496B5BADD89FCE4599385F37194BC1514B6 RUTHRENSCH
913,005,094 *5F08BC26ACC01F6E7F85E9F15FEE5277F4F9B4D2 NKEASEY
913,005,095 *5F08114259FC3AEAC669C43BB17009E5CBC698ED s0c10s3xu4117y
913,005,096 *5F020B2FF479E7D4F25875427BC29C027FB5B395 NONMEASURABLE
913,005,097 *5F0F43DFF7A357047B14D853C324386BD070727C sally-wirth
913,005,098 *5F079C321B6FDB5471D8B4FF1BF1596F33A7A0D7 salon-at-the-claridge-#2
913,005,099 *5F049A507D53D2E5B3AE15A0EC5C794A32C784DE not every goddamn little thing you do needs a title
913,005,100 *5F0398B9AC30F0FC0AECE20E329B256CB87B05CD NOTHINGPURPLE
913,005,101 *5F0E76FE23A2440905174DBE3A4656F53853F7E6 nrbcllied
913,005,102 *5F0F394BFC7044A3EAE629CCB2E4169E9CDCEED0 santodurley
913,005,103 *5F04488EE5856E59E93FCF630506CCA8E91FD5AA OBNUBILENT
913,005,104 *5F03D408DA36100166CC49D9E580877F7F432057 oconalufteeapplehousemesser
913,005,105 *5F0A89E312C3898998887317C87E5B6D541C654E OCTAVIOHUPY
913,005,106 *5F0606D986E736E765C4784855D8A5B0C812686B ODHGHSAN3
913,005,107 *5F008121090CBADE79F9BED74D5AE3DCB40E187E [email protected]
913,005,108 *5F056FDC72A4281B0A3115E098B330911AF0ECCF satsfctemps
913,005,109 *5F08585AB62115AACC24A5E4C629AD48385FA32E sauteing
913,005,110 *5F04BC808F5937D86FE617D8672ED409E6C19662 [email protected]
913,005,111 *5F023D6A1607637C612DD905C73992A7457F6BBD SBLOSHINSKY
913,005,112 *5F07A394C0F38C7CCE46FB90FEA5F65A59D7AF97 sBm
913,005,113 *5F0E4CB9B064A459331FC8AB299862535EBCAB48 SCANDIUMSILIKAT
913,005,114 *5F091D220B3C7B7B704CF02823D076AC9BA435B3 olliecake
913,005,115 *5F04CE26097DF21E634D32774B15D96E034A6FE6 ollierousseau
913,005,116 *5F06B9CCC631CA48043AF1AD128767CC4112C5E6 omaleni4
913,005,117 *5F0278F15E4908EE8CF49C445B1E8FBB0232D8FF SCOTTIEJAURON
913,005,118 *5F0EB58EAD0DFE027FAF99FA8E73B9C0B647503D SCOTT-LIVSEY
913,005,119 *5F0E3CA521EAD8E1FA6C5ADC0E3C49F4A47AEE5B SCOTTY.MAGELSSEN
913,005,120 *5F0E17D9BD14FC7B0BD18CA2F46C78B1F6695955 (opナレーション、マーティン・キャステロ主任(エドワード・ジェームズ・オルモス))
913,005,121 *5F0A24A3523223E0D71B4DB7A0DE6629113CFBBB organzi
913,005,122 *5F034181773B9300B00958FF1764F38C3AB1B91A OSPITALED
913,005,123 *5F0EBDA374AB8EA552650EA2683BD9F565B9645F ostatnia.noc.wizji
913,005,124 *5F077EE3BF4B24DB0AFEF968AABEEA6D60271649 SELECTIONZ
913,005,125 *5F014F38E61D1E779CEFFEF55EDBB1B639A6DFA4 outbr34k
913,005,126 *5F0A7D49C0F4DA8AA4022FF5515ABF4C3A8095A8 oxenstiernaa
913,005,127 *5F0FBBA21D9486BA180F1B26CBD5D0AC1E9DD652 SESITPESA7
913,005,128 *5F090B4B2DE015B0BEC66E36B25B759B0ED47FBB SETH.LEIVA
913,005,129 *5F01B90D2D23BE9172CD2FF6E2CF7038E4D7C44E (^_~)~~~<p
913,005,130 *5F0FF5E3218ABB97CF93EF6A483A9BEE7038F2EA pallifera
913,005,131 *5F0B1685FEC78D967FCCA3466A7B0A8083755CA5 paramonacanthusoblongus
913,005,132 *5F0AD817A355EAAAEAF27666DAD0358CF5D25E0B SHERYL.SARTO
913,005,133 *5F09A7F76A9B3F4086A42FF86829ADD0DBBF4B98 PASQUALE.ROBE
913,005,134 *5F0654A8B9C4D6DD7254EAFC271380ABDDD29817 PATRICK.FRANKLIN
913,005,135 *5F000437EB9C73DC66AEDFDE857B980915C4A854 patrickseesholtz
913,005,136 *5F0BA3A963827FA32EBBD71EF6632EC4F95B8B48 PATTERNDISRUPTIVE
913,005,137 *5F0322F47202C81FA262EDFB2ACEDB7B6037B5A0 P===B~0~oUU
913,005,138 *5F0AE685DA1B486645450B080C06F60D9EEB61A8 SINEPOLA8
913,005,139 *5F08816E3DFB17108648E315AB3D9EB5BFAE62C7 [email protected]
913,005,140 *5F07EE7D899875A8CEC69535F729C5BC41A8CFEA PETER.VITALI
913,005,141 *5F09FDE1DCF134DDD5A2C0EFCE3A3B945583E4C0 P$EUDOGLO
913,005,142 *5F0004A7DB85CEFE45C6B8D2ED6B34767D4D9A35 “PHAÉTON”
913,005,143 *5F0D15C04530DF31B9D998EFBAB03F8009E96719 phillipbekhit
913,005,144 *5F06303D77BABF8323898F448BACF9C5DCBB357E PHILOSOPHERWRITERS
913,005,145 *5F09C05D4B6303AAC883AB7CFD9DD4E0938BE0B6 PHOTOGRAFISCH/A
913,005,146 *5F0C01B80EE7E59F8E49DF39B6D680202D94F2A1 piano.concerto.no..1.-.totentanz.-.wanderer-fantasie
913,005,147 *5F07C9BCA9B4311D7FC6102653E967C95B891770 smartfmsmart
913,005,148 *5F01551A735BE68D42CA9414F6125F430ABC3939 PICADOINOTOTRITON
913,005,149 *5F05257FC3647EF49CC83E7F737BEF25D2E63523 smegkcor
913,005,150 *5F09F5E700CC9E37CE44858AEBE074D95E09F376 SMOSDNAH
913,005,151 *5F097B4F7E65E4B1AE0B1BAD685C9610F5576951 SNAPPY (MIX BY MARTYN PHILLIPS)
913,005,152 *5F0ED5A265135152C7090B1E551AAA1868CDB74D solost{mmor
913,005,153 *5F019CE4683F6B889AB4536B48A4D7C1676FA8E8 [email protected] ~o~o;)
913,005,154 *5F0427EBE545C3AED191549D96CD81F4B17AA366 p====)-~o~o-splat
913,005,155 *5F0B5490260C5CD1DB1B017B2822DD54C30218F5 PORFIRIOMACRINA
913,005,156 *5F093E16C3A307AD32E9014573E1361A00B39C91 SOURCEHTTPORTOCTHG
913,005,157 *5F042AF4165D5F6B8E1678BFCB16EDF535B293FF SOUTHEASTERLY5
913,005,158 *5F0E03A13092F3B3E9F7B8A54BA111BC0A93AB27 P=====P~O.;)
913,005,159 *5F0E5CD07DD38D22BD456F9C10C24FB77D8D5AE3 SPAYNEUTER123
913,005,160 *5F0479F64B86A938026D979BCACB03B0B795F2AD PRAPADYA.NTAM
913,005,161 *5F0605D193CA661F539E553AA267F140FBC8980E splat!!o~ o~ @------p
913,005,162 *5F0A2B44761D89ECC98F644F61C78D27E2AB406C PRISIĆI
913,005,163 *5F0E9CAF164913F17D0EB46AD257F6126994A7E2 SPLOITO~O~(P
913,005,164 *5F08EE3ECD3502A21AEEAAA6BB0AE61F87753476 PRUIMEMONDJES5
913,005,165 *5F03A1138F493D944E7BC3DEEEFF5976BD769CCB [email protected]
913,005,166 *5F01A8DB0C7D704C470DB5BD44B459916BD23AC9 sresoor5
913,005,167 *5F0AEF82E27887B867A11C3A072B9FE6D887675E PUZPALAL
913,005,168 *5F0DBCBAF7A02D6EBAA8F35926FE3E3E9154EA2F stamelde2
913,005,169 *5F0D4DD579802008CF75C8BC1728A636560FE050 QAWSEDRFTG716
913,005,170 *5F02D23423582CF36283B7C37D1D1F7AE53EC695 STARTUP-SEQUE
913,005,171 *5F05DE4C0440FC0BA534F5826BD05311B95B4A13 qB.`~.`~(00)
913,005,172 *5F0B9719BE3242AF62CCF69FFFADA0A01F3D0D01 STEELCONSTRUCTCOMWWW
913,005,173 *5F02AF2BADA9F3471C871F98D176ACF793602439 [email protected]
913,005,174 *5F03E33033A0806FA9235EFCE0AA4990D28AD850 QJALBSW8
913,005,175 *5F0D35F55253A1D634C23589790EE77DFA08211D QNCRN
913,005,176 *5F03BA3F0B17EFEF93E68725CD60A49BBC8D254C *.*.*.q===p
913,005,177 *5F02F3AF69880AAA7405ABA95DA319128DEA796A QU4DRUPO
913,005,178 *5F0787FE009FF6E78055639EFB4C9E0EA5E4A095 QUALITYCHRISTIA
913,005,179 *5F028A49B6EFD439C2F045203497FDFBD11C5216 STRESEMANNS4
913,005,180 *5F069AD2AEF1EEF682EB8FBA72B54AB6103D00D6 &QUOT;1337&QUOT;
913,005,181 *5F0A0AEFA29345F51026C77F40C29D3201FAC067 QV`AAA
913,005,182 *5F0AA5519CC17B9A5ACBF9390E6911ADC25FA703 r0&b
913,005,183 *5F0353FDA39149A33E72415CB00A05996AE73D1E rachael-pfeiffer
913,005,184 *5F0B629F3F4156D2DB5826992028ACB1FF7A2B70 RÀHIT
913,005,185 *5F03E8949C1936D8812EE72687D5BA12015F7846 RAJ`
913,005,186 *5F0F4A94663CE9B4022CAF2168D4748FD28473FB RAMACHANDRAN PARAMESWARAN
913,005,187 *5F04D9526D976EE747D98C20E31F88D36E7E30CD ramonprayer
913,005,188 *5F058EF30EEDD4506E6ACDE65912A15E1C3996D9 SURYA.NARESH
913,005,189 *5F05ED162C9750E93B9496D0A3DA528E98EFACAE rayfordvandygriff
913,005,190 *5F00F847CBD1C008464BF967610E61E06AE183B5 SXA\
913,005,191 *5F02E411F7906959A62C72872CB9A873A6595AF9 RAYMUNDO.JAKUBOV
913,005,192 *5F0C3321D94680D5CB1CE6FCD6EABE3C4A2B58D0 SYMB0LIC4L
913,005,193 *5F00F27D60957D03C1CDE8DF6003A7CD44E4367D [email protected]
913,005,194 *5F01C860AD5214D2A3E64B09C8849838E9B90665 TALMSLOGO2
913,005,195 *5F0B68C03D6EF0D289BDEE02E572CF8CD5602028 tanya4muffin
913,005,196 *5F05713A2F61419E9B5CF2CC46E58F89AE39A597 TARTARIZE?
913,005,197 *5F0D05BCCB24C0B8F7F21D25FEBA23D33631775B Reklame.Favoritter.2
913,005,198 *5F02CCEA26576FBB1681A348D4ADB0317080E013 tekkenzone
913,005,199 *5F047E8B3308031197A06858C364B33CEDB98737 TEPUXTEC
913,005,200 *5F085A76FBC35CE72A5B1C0DA4990B1DB5A8CA67 TEXTSELECTION
913,005,201 *5F0484A0B6853D59C61721B1CAE17FB9F5BCFC21 RHETT.ESCAMILLA
913,005,202 *5F0564DB5A628855FEEF3052C960EE1282C1A71F RHONDA-WILL
913,005,203 *5F0847791DE1C4115B8D66AF7927891834F3AC43 THEALLNS
913,005,204 *5F06D9C4E38EF4C0C3A5F20243F24B6D258DBA11 RICHIAMABILI6
913,005,205 *5F0395360F61926D3CB4318DE4770C86304DE775 richschmollinger
913,005,206 *5F07E6D4798F10FDA9D8E1B1F30E8ECCA440B28C RICKIE.SCHONBERGER
913,005,207 *5F0BE181456F3CD9251735334BB5D1408E882D45 RICK.LOBBINS
913,005,208 *5F0F4303ED58B88BFD55475C338241AB99709D4F The-End-of-My-Spiritually-(Recollection)
913,005,209 *5F06A2508611880B3D1A5CACD5D4F7ED7BEC9945 THEHITHERE65
913,005,210 *5F091BA7AE2097AA8996B76EB1758CF40D5F78AC THEKLAE
913,005,211 *5F03AD448CDA2BFA64E8DE4FEC07A4EC5D843E60 riusbsws
913,005,212 *5F0E6EC024A475FAF402E203C5C719D95CECB740 thepugs
913,005,213 *5F08A0ED5EEFAEEB2561FE166357CB2DDEA8C7D0 THOOFED
913,005,214 *5F03D6D7B5743209DF8DA733DC8C143C6086D586 rockykurtich
913,005,215 *5F0AEB4843E2324677DE144A562EC9909FA3D087 rodents181920
913,005,216 *5F0689BC4D6CC7F87380BB8ABCBA670ADC886BFB rodneyzanardi
913,005,217 *5F04C8A40AE01AAE4F2E163C396F191FEADD8D48 RODOLFO.PICKMAN
913,005,218 *5F04B284A5D4EB8570E30597E3CF752309E4569A RODRIGO.GERWITZ
913,005,219 *5F0EB595DD3E51A3916FE95ABB9B60865D0DC2A4 RODZINIING
913,005,220 *5F0D571FB4CAB7B02240BA3814A67AEF4E1E6C3A ROLFELCOCK
913,005,221 *5F0F445E099F1A6114B62815477202997AA80199 romances sans paroles, op 38: no 1 en mi b
913,005,222 *5F0819BD291FAC94C38F77794DA7301180A7E920 tisha-wong
913,005,223 *5F0CD264C923E7DE61B13962EA322FDC0EC82359 [email protected]
913,005,224 *5F01203BC9D229A880D09D1F37E1937B390B9CE7 rosariomcgarey
913,005,225 *5F0B5B9488F5777FF496D0C34BA92F90F90AC6F6 tnaripme1
913,005,226 *5F0AFEA58BDFF15C52E0B5166DCB5F27E8713835 toilleanatnom
913,005,227 *5F0259FA8489C6E0A23BBABE55421D69B01ED2AF TONEYARON
913,005,228 *5F0DCB0EB60B937562146C1EFF2239DD6D7E5580 RSITCE
913,005,229 *5F0846F519576C1DCC3414B738570A1130C21A7A rubingaliano
913,005,230 *5F0ACC50C0F784662C6E67D5B985F3164DFD84AF topographiren
913,005,231 *5F064F6DF65F3111DE85FC3150634B554CAE6E7E TORTURERACK
913,005,232 *5F0DC90D9E37EE9EFF5D96CFAA811C36E700C671 RUHR6
913,005,233 *5F07AD1882B4C8E7B10827C4F7CDE3C05BFC342D town..renegade
913,005,234 *5F0F1B3606507209BCCFCD54BBE93C15C0392DBE RUTHEARL2
913,005,235 *5F0F410CABD33EC1795B36EA95828543CBC031EB TRANSPLANTREIS123
913,005,236 *5F0FACB6276374A1DB19D3BFDCBA3284DE0026A3 TRAVIS ZWIEFELHOFER
913,005,237 *5F0CB175F07CC58DD360834C7B2AAD64CF080803 RYNSZT
913,005,238 *5F063AA03E139667E07EC18AEB162F324774E204 TREVORSHAM
913,005,239 *5F0CB6FBC2FB9174034651B35B5D28E56126BEE3 SABAHAT HUSSAIN
913,005,240 *5F0ECE6F69AF7638244621FA8811129ABFDED364 SACEVIC
913,005,241 *5F0342D66FCF7F6911A36F99910466C1C3734D0A SAHIHBUKHARI
913,005,242 *5F0BC0B823CB810AA2F9A1DC700ED919107C0011 SALAHUDDS
913,005,243 *5F0F1C8A514E81F31D7958DEE85CBFC1867D7053 TSILEDNH4
913,005,244 *5F0DF836C009210112D62A56483008A79DAE6DD1 SAN-FIDEL-DE-SIGMARINGA
913,005,245 *5F0383307D0D3C4B136F04B7DBD02CA31A552E9E SANTO.MCSHAW
913,005,246 *5F0C2A1B199B43E2F36C37CF775386D8506A6B53 TUNNE1DA1
913,005,247 *5F0414CEF5FE6080277050060139F4EBDC507BA9 sartaj-gill
913,005,248 *5F0901310B5EDC510FDEF4B0BCECDD56A89D32FB SASHAGURKE
913,005,249 *5F083CE9FF58B4A07079606CF046994550E23E92 SCHIEDSGUTACHTEN
913,005,250 *5F029ABA534B72B590D26FE49F3C2A5194E8E506 SCLNDRDN
913,005,251 *5F0EA922400E95B318733A0B8629B53DD11B8195 SEBASTIANCREDILLE
913,005,252 *5F08A209F4125AF647400113B8594EA255A07870 SECTION5112
913,005,253 *5F010FAC893698E70807C1380ADBBF026A223E04 -seejueneman,r.r.,"electronicdocumentauthenti-
913,005,254 *5F04D9D658E93791A069E80DB40623EB3EAFC554 semivowel0
913,005,255 *5F05B23BB48B1F36564CD98BF42D83C53E7EC0C4 UNBRANDEDA6
913,005,256 *5F0B7C049858A2D9F9257D3FD10DE4EEAC223FAF SERGIOMANNERS
913,005,257 *5F09ABF3E102C6147773EE89A08E21DED5540572 SERGIOSCHOWALTER
913,005,258 *5F07BB102ADAD8EEBC924FE7D0E4D9C84450B19F S/G/V:-3-WAY-SPLIT-EP
913,005,259 *5F05C129E780A4603F682EEB92877547695CE6E0 unque57i0n4b1e
913,005,260 *5F0747642A423A625A804FE46D8E81F49BB30180 SHANESCHOSSOW
913,005,261 *5F038653B57AE7986B6EFB490E903E3FE2E61EF9 SHANNON WINDHAM
913,005,262 *5F0B7A847000F5AD31FF765AB43EC06BB3243DE5 UOLENTESQUE8
913,005,263 *5F0DFFE7AB0D11C911FDD81BECB372BA164ABC51 shawn-gainer
913,005,264 *5F0149C290387BA1E1EEBC5228B6DBC50503E9C1 SHAWN.MONTALBANO
913,005,265 *5F0523C18AD80D274B2365A1740DAF8247DE89F1 URIAH99
913,005,266 *5F0DA3A55AC99F1552B8AB2AB9BE9450ABA6BA77 USESGTGT
913,005,267 *5F0272D5A3CF0FA5895FE96188B17C8E14ADBC1C sheldonbackhuus
913,005,268 *5F045CC83222707455BBD450C48CC646CCD298BD [email protected]
913,005,269 *5F076463C8F22AD94BC8AF17FCA5E7B118B7FA4E [email protected]
913,005,270 *5F07ED5C41FB2E02490D8CA77BB5FE80C6172279 [email protected]
913,005,271 *5F08DC455B2C0CBEDB2999F5097FE7D68778F734 SHERWOODHARLESS
913,005,272 *5F03FCCE70A7F2F820ACA963B3D515D8A9E5C2AE uu.o~.o~(=====q
913,005,273 *5F04866528C0DBF2C2A4D0AF6C9631A9BDC2A0C9 [email protected]
913,005,274 *5F03C521B152F2D89EF89F0E5D94DDBE66476C88 SHOSTAKOVICHLEOPOLD
913,005,275 *5F0E594F3538651712497E198E52BEB4C43465FC SIARELIFUAF
913,005,276 *5F09F8FA6B6D410F8484CF8E13E4848794E8AFF1 SILLANKIN
913,005,277 *5F02622BA8D065C7549ADB03F5A28D09B627DD49 SISOLUTES
913,005,278 *5F052B9279E05AA095E18B3EF39E7F76F7999500 [email protected]
913,005,279 *5F0CB5B967B8469A8E1DD236CD6D2C2BD2BB79A5 VELABARISQUING
913,005,280 *5F075DB1B87181BF58C81038170F1C124B4866CA velicia-sugiharta
913,005,281 *5F00FAE89456B5D85F30F485FB98C76D0EF4B612 skeenar
913,005,282 *5F0007CE7DE67A2571D04FD4DCB0EFD6BA061098 SLAPBACK1
913,005,283 *5F0888CAD1BD141505F863E7F0CC970D2F1EFCEB VERNON.POPEC
913,005,284 *5F0CD688287B6E3B8257846874A082B843EEB070 SMÄCHTE
913,005,285 *5F03FFC4C3F51817868344AF492406FA8B5CB13F smithsonian
913,005,286 *5F031E0F70074194D332C28D34041068F09EB670 SMUIKININKUI
913,005,287 *5F0E9526479448229DAFA82F0439FC86C299E89F SNAPPLEICECREAM5
913,005,288 *5F0F6F843CB7BDC9A84A814ABA08A5B57EA1361F SNOIRECIFILPMISER
913,005,289 *5F04A3408E39887CEC0F8D7F05193A58F1FC8C40 VICTORIAOGAR
913,005,290 *5F07F7616FBB701BD65A0950F95C39118E99972E SOCDESIGNFLOWSVG
913,005,291 *5F0E1E7901D6B3875C62C19525118FBE1ED23432 SOCKE71ESS
913,005,292 *5F0F934CDBB168B7DBA8F24EEAE45921480620B2 ...SOIS
913,005,293 *5F073397F730104246B14669E58B22778A744788 SOL.MANORA
913,005,294 *5F06692F6B6C143953869CE58CADBD325B944AC9 VIM VAM VAMOSE
913,005,295 *5F0C4204863723B467E6D0276F608ADD5280A09B VINCENTGAUGUIN
913,005,296 *5F0714435FEC6216F158FB7962FD030CEBBB884E vinicius-alcantra
913,005,297 *5F0D0F37935C33E6965AA212B51EF9989A683BD4 VIRGILIOMATHERN
913,005,298 *5F064265763C98DB6FBE7E0912611373A2BD0D07 southernexposure(disc2)
913,005,299 *5F02D9AB845A807B717FC347F59B4DD268AC5116 VJMQFXGH12
913,005,300 *5F0C862AEBA97C3F766372A4D6ECBADE0A057A26 [email protected][email protected]
913,005,301 *5F04797F79081C96FB5748DBDFA301991C408AFD VLIEGBREVETTEN2
913,005,302 *5F0EC016A3AFAADF1F2D17D658139BA852A8FE7C SPLAT-~-~-D---3
913,005,303 *5F00891D387F2AA939B899A78B6E3AA5F2370E87 SREBOTSE6
913,005,304 *5F08CCF4B4CFEF1A75C5A7F8E1A33902A015DBB9 WADEFARNSWORTH
913,005,305 *5F067CA92B4D5A98696043501846FA02663A05C4 WALLY.HONUS
913,005,306 *5F06C846211D240D7710C26D2BFC02C3115EB565 [email protected]
913,005,307 *5F046711EBDFBC062863FD6C8EC50BBAD3284312 stacybranin
913,005,308 *5F048F075E85D3CA31B767817FEFC1D210B3B81A STADKOMMITING
913,005,309 *5F02D4C447AFD85BD7DA59C2B11397377F74BCEC [email protected]
913,005,310 *5F021397463AD2210F3B5E4CCC8A6F2327A257ED WANGFENTAI
913,005,311 *5F0D0C35559BA8984E706413D5BB1CE36601EB4C WANG[email protected]
913,005,312 *5F06BBDEAD319D1D0AB4312E00FAA342BE5820E3 WANZELLA
913,005,313 *5F01625D194B5C1099408ED54E99AB5234B6BDF6 STEGNIRPSNILOPMART
913,005,314 *5F0DC083ED99A176C478FD24AC0592EF11FDE281 WEDZIDLO3
913,005,315 *5F0647F82D8C4D6CFA4123B76FF6384615440017 [email protected]
913,005,316 *5F0110EDA11A88436780923E39D1A81D5D33E6DC STRANGE-NEWS
913,005,317 *5F024801356F547C893D859CE4D46839B38FFA2C STYLEがその場で着替えて、スポーツに挑戦する。
913,005,318 *5F0C3391504E39BD6D1479415389B7F3EE236004 [email protected]
913,005,319 *5F02A4C72CE2A0EFB60FB07C27651EC399EC5DA5 [email protected]
913,005,320 *5F07B82ABDBDBEC78305F2F00423D8E16848B55E superpocsag
913,005,321 *5F0D0BEA8EBEC93987B3D5695D115BB9CA457E8B SYLL48FC47ON
913,005,322 *5F0B4E3C5B4C09FAA19B027809719E6E34277AAB wl5<
913,005,323 *5F0B356363044E5A38F1FB901475BC61F7055718 WMORADILLA
913,005,324 *5F0A380F2C44990F132FBFFE8B25EA8203C58256 WOBLEEBS
913,005,325 *5F06A99FA1E79AF479B20993F95B446BFCFEC9F5 [email protected]
913,005,326 *5F01D92846BF1B102830CEC39962601BE3C20827 taciklerinin
913,005,327 *5F00FFD34E5D6E4EF2C3642B273C61309783723D [email protected]
913,005,328 *5F0702FE0E4A5D5FA044A38DB5C7A43E09044810 [email protected]
913,005,329 *5F0A477501C3A4C26B55A59D086F4A9E72CFECA0 wrong.kong
913,005,330 *5F0AC6C0B9E09F4FD255C0097CED7545FC46356A WSBLETCB
913,005,331 *5F0946846009D9645556FFBAB897E3CF7107D88B WTUD
913,005,332 *5F0A251741E34D81F127DBD81DF2E2D4FB9A9EEE [email protected]
913,005,333 *5F07FCD20097687BE1266BD44487E7C3068A76BF }x{~`~`(====3
913,005,334 *5F0431004CC2BA2BC841794C28DE9B4EE1E6D607 XALMEDA
913,005,335 *5F0F319D948A70E327397B14B31A9885632DA253 [email protected]
913,005,336 *5F00D8FF97DBA2711D307157D79C11EBC125E2A2 TELAMARBSW2
913,005,337 *5F0EDB1ACAFF0F58A3F7B1291152C86FA11F9056 x)js
913,005,338 *5F087638192E2FF39B9553D21BC9433E610DDAB0 [email protected]
913,005,339 *5F03FDF721E9F8F7EBD4372CA7B96D4BECBA83D0 TERRYWINDOWS5
913,005,340 *5F0C99A2DA3A3991471F3256FE711CCA33E2FBD4 TEST12318
913,005,341 *5F09B8C23417A523F9ECBA81EC188595DD4D4242 tetřev
913,005,342 *5F01D89513AC956C1972F32E62AF20810A3F813F [email protected]
913,005,343 *5F0D4F9B8BD998590C208D3FDBA81F6A14BE3EA0 THAT AIN'T YOUR BUSINESS
913,005,344 *5F058A10DA08A751A39601C8D33601C8245D4A54 yarissa.marlene.perez.toribio
913,005,345 *5F0D77D15C01F7153DFCC904D8C54FCAE4942D78 thatfront24210
913,005,346 *5F041410E0AD177F1548ABF52A3A354C50A82B76 thatmarket25
913,005,347 *5F000BEA8FD9C9F189E7C7A6123B1C73D6224546 yenoh09
913,005,348 *5F0983C1A419B14DDF02AAD5A79DE3774E136FC5 YET ADV
913,005,349 *5F05FE597F4E80C49F16F86F26A47EDB7FA90E4D [email protected]
913,005,350 *5F0B775D912025FD898C0D3A45973BBEE5E27DF6 the.javelin.12".mixes
913,005,351 *5F0903AFCB7C63AB7E4F01C25A00794BCFB2A36B YLIZAORTIZ
913,005,352 *5F03CE2076C25B2D08D149C5354BDC1321CD92E4 THE-MYTHICAL-MAN-MONTH
913,005,353 *5F09F73BB95EFE7D591847F7337ECDF8A3D846CE THEONENEO09
913,005,354 *5F0498C8C2948FE57040B5C4464E36027F80C105 YONIKBSW8
913,005,355 *5F0EE93BC0B7DA1D9971F353CD0C616D911F6A4F YOUARESELECTED
913,005,356 *5F0E2E725D0BC63C1DD23D65FCB0DF595B763886 you asked for it you got it
913,005,357 *5F0CB431C97FA015A05188FA27A5F6467A298770 THERE'S NO WAY
913,005,358 *5F09B9560D178189B019138602B0EEDE7BA21AFB YPODOMWN6
913,005,359 *5F0A40A5657FC54D89CD6D71A1198C60433F5C67 [email protected]
913,005,360 *5F0977E542555F40AA8F22013956D98EFC2C6638 YUMAY MIGOYO
913,005,361 *5F0AC5005C3ABD5D38BCB095292DF9E804451BD4 YUSNEYVIS
913,005,362 *5F0E713F9747C140D175B5C96D7EDDA6ED27E7E1 yuyi.feng
913,005,363 *5F080619DF7534736C387B4EF93F3A6E0B0CE70E ywyzcratan
913,005,364 *5F0934EEE308F2EF5105E1E907F6430CCA786CA8 TIARA.REESE
913,005,365 *5F0488D95647590A159AACE1D6A961F5C8901FB8 TIARRA-WALKER
913,005,366 *5F0ADAA3921E8609479523AA8A1DC0BB3C1474A3 TIATYSON
913,005,367 *5F06FEF986C495EFF20D9BB7489C329854D3CC12 tiffani\s-wh
913,005,368 *5F073015DB3E8A581C93942A249E996A152A2BB5 timoteos15
913,005,369 *5F00121256D0AB4FF44321A4298A3026FAF5FC00 ZAIDSWAFTA
913,005,370 *5F056C20944EA2FB8D437FEB3D753B9D3AF11E66 [email protected]
913,005,371 *5F0BF34FA248F6C8EC6044A1DEF3489AC23BA9F0 TITULLO1EIS
913,005,372 *5F01018C7B1B9F2AAF331B42CFD4891B1B5344CD ZAREVERTOVAL
913,005,373 *5F074D5EB2A574A828038E4B7763CC3951B69C94 ZDBFNMSBLIC
913,005,374 *5F0129315FA0C6F18E0D0CB6FBF1BF88D1CB373F TODDWOOD
913,005,375 *5F014985E1F0D6F6A15B57BC2A35CD82B513775D [email protected]
913,005,376 *5F02768F1F2113984D8DF748E81D0A57C0FF60F9 TONITOLBERT
913,005,377 *5F0299680D0607CD0818927E32A6C53AE4853FB8 Tony.Benge
913,005,378 *5F080023E7FEADD214AEFCF260CF58304EC1833B ZIEHBRUDER
913,005,379 *5F087793A639612E055A799C3CF09019EA70DBE3 ZILOGROOVE
913,005,380 *5F0CBCC5D8D8804D6024923ACBD57EF4F2D54D88 TORY.PALLETT
913,005,381 *5F03DCB1ED585DA153884DD889EF84086E09808B ZOE.ALEXANDRA.ANDERSON
913,005,382 *5F0A0C91BD253947278FE121D927D4CF77619195 tractorjensen
913,005,383 *5F025BB2BE55B40966FABDE54A1FFEC9299196DC وMATTHIAS
913,005,384 *5F09C3748087B13004F6CDD61D8F4D80DD3BA918 TREGENDA7
913,005,385 *5F0DDAB7FAF2CEF9319DA66BEACEDC9428FC70C5 treneka2
913,005,386 *5F098AF029623494B693015C4533056F7B6787A4 trevorlanes
913,005,387 *5F0C066A9A0379C33E7F6E8E071EBA8698D96794 [email protected]
913,005,388 *5F0F9386BC2408DFB6F226FF0212245D6147F169 TRISAN-CHOWDHURY
913,005,389 *5F0D9276757AF1680BEA51473D76A30FBC530083 БЪСЕСКУ
913,005,390 *5F01B1322938E8DEC659F109E7C901D65BE47F8B TROYRAINA
913,005,391 *5F055DDD9A2CD57E6AC1BE21BD8F253E8165B903 tsanmygo
913,005,392 *5F07C4F684A092A0C22B316293D7B070B7D1C554 turnish2
913,005,393 *5F09D67946FB9580F83F5E11ACD945D51BD56CEF ПОМИНАЙ
913,005,394 *5F0660F32748D35C0E37D6E90D4E2F270C1B8006 TWEGHGHEN0
913,005,395 *5F07081A5805D60A2E2299A03EC4DFC105DC864B РОКОВОЕ
913,005,396 *5F0554904C14660561CF7BC1CE86934252D36C10 TYNTTIVE4
913,005,397 *5F0BDFFACD123CD3B8FCF89E988808B04408F4A4 u1901
913,005,398 *5F00658C0729269DE3319F01647B0B5FC94A15DF [email protected]
913,005,399 *5F0217D8B5E85752E1C4D8EB526FA6A143D59F9B umriinovianddudull
913,005,400 *5F0183AB47EDD2037E4F1F11ADD796AA37665876 平野照比古 「65日間日本一周最長片道切符」『bit』vol
913,005,401 *5F0150CACA12C107E7332C283FA2CCA6D7667510 unschädlichkeitszeugnis
913,005,402 *5F034EFD6424A4B1001DE252AB2975629D170EB5 [email protected]
913,005,403 *5F04DDE6C3AF5E62D52B02791E9D99E34FFDA127 UOAOSSE1
913,005,404 *5F0F7397B5C7E20B37356FD844FEFB1B7E15E023 URHEILUJUOMAN
913,005,405 *5F093A44773610B600F855E39206E7A0B9FA4315 USERGEOGRE.DAKOTA
913,005,406 *5F060E1D3F8E6B811231F1A2EDC56654BAC41088 VALERIEBRUSHETT
913,005,407 *5F00FA7F1DF4A3F7CDFDFDC1AF071F0C808019C8 VALERIEMURRAYWEBBER
913,005,408 *5F07230D9D7A5BE7F1699CEA4BE313E164BA6957 valhallaracerx
913,005,409 *5F06383B825FA9B850C9AB227ED29C8A47061EE9 vd.gunner's.blues
913,005,410 *5F0E936DED2C02BFB85D94A7DCC5409EE5E8575E VENDEVAMOS8
913,005,411 *5F08A010C89DC1B3413D0E5D0ADB79F34EA06204 VERASAAR
913,005,412 *5F08718637B4506C7CE81820CECDCB817A44BCCB VERDORE3
913,005,413 *5F058690AB84FE3A8235FA1832199EDFC529CFEA VICKI IBOOK DEMACINTOSH
913,005,414 *5F06023D060962D9C5743673BC49585E3BFB3E8E VIOLETTA-BUTTAZO
913,005,415 *5F013355EA0482AE37404072D6EAADB547654D5A VISHTAI
913,005,416 *5F06420E2ADA0F929F3ABF6D5CD2F5712D20A8C6 vissare9
913,005,417 *5F0152434B939EF27E0E4564130357FADBCF699A VOC3PRNTS
913,005,418 *5F0315645A425C9E4DB6B1ABDB4B7147AFD443E3 VOLKSWIRTSCHAFTSRÄTEN
913,005,419 *5F07DF365931F6E5E131369910FC4253D241394E vonpopoca
913,005,420 *5F0E367C5197C44590A3217FE3DD1148F6D243F3 VRAMESHAN
913,005,421 *5F04E1AF137F1DA2026330E5D3F1882A5BDD23A7 VSQBT
913,005,422 *5F06619F97B711CB0E4AC50D18B5B7F2D789462B [email protected]
913,005,423 *5F0170125B9292EF18497C8A30134064D8689845 [email protected]
913,005,424 *5F0E3EC3C594E78AD9C629DE5AF47FE2B5F96AA9 [email protected]
913,005,425 *5F085079BA91E4C7D9323328B62EFDDC5035A838 w,b
913,005,426 *5F042704640724FEE9BDECB5585C2D8FBB954E11 wegvalt7
913,005,427 *5F0C98C04BF0DA2CEA863A4579BF442AB9AA8FBF WENDYSLIEKER
913,005,428 *5F0DA1BF709F3D73A3B30E53EF58A880B8DE233E [email protected]
913,005,429 *5F0E54A88BF255976B392EA9D02BE765CBBCC25E [email protected]
913,005,430 *5F06A2EAF7FB95ACA07B966D9C74D59B46F3965D wettkampfbrustschwimmen
913,005,431 *5F03F7DDA8520BE79105C2E8D4D84A3E01AF0890 WHATI'VELOVEDANYWAY(FEAT.JAMESWOLFF)
913,005,432 *5F001031588669B41F1A7D0AB458E5168D8E1B34 wilbertchollett
913,005,433 *5F026604A7AA5F4C024CCC0DE9DAB97D3A6A70CB wileades
913,005,434 *5F08EA33A845B017011AB3D7216E6685A3DE4264 willytynio
913,005,435 *5F0FF3DC1571B4BCD9C0BEA4C0BF95EA0B65CCC8 winstonkochert
913,005,436 *5F075D6DB04C6C98A90BA82BC715831A814574BA WMV)
913,005,437 *5F0400B4BEDA32D25409C501A56720F5770EB45E woodrowpecue
913,005,438 *5F090953708FBCF319AD12078BECA027B81D60D8 WOONGSUPCHUNG
913,005,439 *5F0BB140C2CFFDF90913900D8F00CF76B4C5D12A 000aniyah
913,005,440 *5F0950CEA8B9B0DC97BC0D56410310118D102AC1 01SPITFIRE
913,005,441 *5F0C0D770D2269AB3ABFA765435956DDC7413029 035YUREM
913,005,442 *5F0C6E27329F5AA45A3352959C306C2D4C8D2A77 WWW.KULICHKI.COMINKW
913,005,443 *5F091B0A2A03F63A6F1F8786B92062D0CC85E563 WWW.VARSITYVESTS.COM
913,005,444 *5F006D0DAF95B4C1D8CDFC169A3E2F4510404799 WYETTEPENNYHONREJAS
913,005,445 *5F065786D77D9AEBFFC57EE35241CEDB4BFA6274 WYNETTA-BLACKDIAMOND-WEEMS
913,005,446 *5F0E867945313EA563252B2710E9A931FA09B7E4 X145812
913,005,447 *5F03DBD73A4EAA22B88CAE60A19553B66B80F2E4 xabq
913,005,448 *5F0264DFFA6EB90479D42E845224D7E803DCC75F 09311022
913,005,449 *5F0DF04FCF73A6DE3F58B91F20AC9477D57C0943 0R1ENTATES
913,005,450 *5F0D47E7A6BD1AE2964FB9CDD5794EDCAEC9F0D0 1031340
913,005,451 *5F0736ACD8FDEE16E16D128A928414509DBD780D XPTITLE
913,005,452 *5F0EAA31A6BA159124457AD76FDD7E85A6C3CBA7 12:.12..-#..-&...merciful
913,005,453 *5F09BF8065CDFC81C68E1D2401199CE52DF3FC9F [email protected]
913,005,454 *5F06396D514FFB21E018761FFD701B9B64088DFC 123456789.DIANA
913,005,455 *5F0E8E841064EFB35225C86FDCE4E2DFDBA4A064 [email protected]
913,005,456 *5F04AD32E82CDF44BE835DFCA31C941BDA40FFF7 YASHWINBOLOOR
913,005,457 *5F007131DCCA8893AD4370A91C3F5826E8D87ACC 14......by.now.you.should.have.a.menu.up.that.says
913,005,458 *5F0FBC6FD799DDF642378895149D055E17030DFA 1669295 THE-MAYORS-KNOW-THAT-ALL-TOO-WELL-.
913,005,459 *5F0F48680BC5F7FBFF03A574EF9596BED8867508 YERSIZDIR
913,005,460 *5F07A3FCF61404C2BD97B00F17595B3A14AAE34D 1869-voraussetzung
913,005,461 *5F03DC7371CF6A31B5907B2EC185BF38ABA4A601 [email protected]
913,005,462 *5F0C67C7CDF2F82672E0D4EFC864553317066CC3 18october1586
913,005,463 *5F006B577CDC86904B08963D91F0AF37AA2F76EE yoshikoka
913,005,464 *5F0D9FC071F9FB4801FE7054088C9F9FAF911AC0 1.CONTERTERRORISM
913,005,465 *5F0B269BFE8F3FB4C12915CFAF1BD96C499DC64A yshadowsed
913,005,466 *5F0F268CAE82F8648A4DBDB377C8AD3D73554087 [email protected]
913,005,467 *5F003DC6334D505B8CF243E41B4DAA722C2B9E4F 1-ECHELON-VAKOILUJ
913,005,468 *5F04A230256576373AC0E3F8FC0C077FEC14B3A2 1ENEDIEETTI
913,005,469 *5F01A62CC67C6986737A1B0B1CEC330656E8AB82 1 ENQUTES
913,005,470 *5F04439B1855C8AFA161F821CF4F5458BC460834 1ERVAAGDE
913,005,471 *5F02C161B407D9B4DF165095F4529AF66508C43B yuli.prigov
913,005,472 *5F03FFF026AA502EC012069A3355CD42F260015F 1frosheiser
913,005,473 *5F0125D3D8A95FEDBF3473938F230B083728451C 1-iltifatlarI
913,005,474 *5F0BCBF8ADB5D92BB4319D4C82866232DF52A7B6 ZA KALE ZIPO
913,005,475 *5F0400ECE9E3244D0622506CE7DA06046B0E35F0 1KEDERIMI
913,005,476 *5F0494469FFAE3C32C32F9CFE9320F2101C06700 ZAKOŚCIELU
913,005,477 *5F02C138EB421D8EEC521C78DEB30B8B7A90A0B2 ZAʙON
913,005,478 *5F06A961AA7FD2E80775F7142FBA957AFC04703A zealandiatearatu.benge
913,005,479 *5F0814202378C0BE6B9D944EC4A7AE28A4EEAF28 [email protected]
913,005,480 *5F0A5C5ECA92B4CDC4EC6BC5EE4B945CD4A68A74 1leoangel
913,005,481 *5F03DDD23AED1E3F7283333B6526D3CF78C46A4C ZENNASING
913,005,482 *5F07AC4CB00CB46058B81769D45D506A2FB4883F 1.meisterdiebe
913,005,483 *5F0E8942502237BE4DEA25E2C10D04EB397143CD 1-MUSIIKKIOPISTO-OPINTOJEN
913,005,484 *5F02E790527674DCB5465538F5EAE92F7481D222 1NC0MPLE7ENE55
913,005,485 *5F096CC4CE7393D770ECA84DAD95A6F1964E7D3C 1-OLIVI
913,005,486 *5F0A343DEA13BCD2607845844216EF10F3E5E164 [email protected]
913,005,487 *5F038B1DAD18C7B12139DB7B052B47443AECC474 [email protected]
913,005,488 *5F0DF0BD9AF155DF3498A0D92D5F5BBFBAB80B1D 1 OPTIONALEXTRA
913,005,489 *5F0C77DE1BF3B6540AF679162736B7CF9E1946FF 1pcdos
913,005,490 *5F0ABE69A82AA6AC8163F38D830E164A8F45F9CB 1.puusep
913,005,491 *5F004F7195807A2986C54DEDA451A170022381B3 zodensnijders
913,005,492 *5F0363D3124684E853EC2C35FAE22E0A061B2A2E ZUFALLSBEOBACHTER
913,005,493 *5F005B8273161C94CEAF5F42EC7375D2624407CD ZURGHAM
913,005,494 *5F0BDE247791C3B71794EBFB2BA6900070A3477B ZVJDWN
913,005,495 *5F00E64B091514B85B6F4903C3BF5A48A1C226DF 1 TV
913,005,496 *5F0657FEE7178B32056E1BD881D85C14E9BA5385 ΜΙΦΡΗΣ
913,005,497 *5F0195956F792F83608BE131E054E427F24D1EAA 2223737 jantonottaamts-j
913,005,498 *5F09BBB050B7F579B6B6D9512B6DF7DB1623D7E7 2236982 siewareninnenundbaupolitiker.
913,005,499 *5F013FEF6E1B7BD242A8C415F7A69F9F3F4B09D6 ДОСТАВИВШИМИ
913,005,500 *5F061F67C1B79C1E5270897F144E21D8AE7C752A 2347621 THEAIRLINEPLANSTOOFFERTHEDISCOUNTFORAYEAR.
913,005,501 *5F0C0A186415CD0BF878305D0172B9E142F28726 235587 LIKE-OTHERS-,-IT-WAS-SMASHED-WITH-DRILL-LIKE-PRECISION-.
913,005,502 *5F03E27EA4F09F5491FFF3126D003C9D0F3B7E75 ЙĂПАНУПА
913,005,503 *5F0FE11645B601721B86A97528C82BBBFDC823E4 ЙОХУМА
913,005,504 *5F061A4FD5C191EED0DA220B9696855268433679 КАУАГУЧИ
913,005,505 *5F0C5026E9CF5263BE7FB94606F7ADF765BBBE1A 2413049 in.mexiko.gibt.es.141.rci-offerten.zum.golfen..
913,005,506 *5F053E0AA94A6507522B57AB0CDE014006A14AE6 “КОТЛЕНСКИ
913,005,507 *5F0B35CB7C97F1C9B962DD99F2B03C18B422B953 2698429 suojakaistoja-ei-tule-k
913,005,508 *5F09A4CF6D1B2FC3BC619B6B71759E45021109EC 2843876A
913,005,509 *5F0ABBD58905319C4711A0B11DABEB23D3D7B423 СТРУЕНАТА
913,005,510 *5F0F374842500310C83D8D53C52F228E69BA108D 2BRANCHFU
913,005,511 *5F07C7F8EE6CE03CFFC655A555406DD639DAEC15 2CINDIBMW
913,005,512 *5F038750EB24EAFD8DCCA7859FE145BA608E9038 „УП
913,005,513 *5F0CC050FF6B0944DBF0A056C4BF6C45AD4C7BB2 2DUCHERIE
913,005,514 *5F07F9C0C85BD9B83FD9FBF32A2E30E7B1DE23D0 2EREINNOC
913,005,515 *5F0D7065EFA418EE36C58EF6217F19F102D194AF ЭХИНА
913,005,516 *5F0B1EA992F24EFE92EED2D880FBE89E24970E69 2GUTHORM
913,005,517 *5F0DA1D8C2724FE5E8AAB69E3C8C5F0D0754C5A5 2 KILPAILUS
913,005,518 *5F06C5A6BB49569C74C02D50D2F8FD3D76981DC9 2sniper8
913,005,519 *5F075849585A7C732284E8599DECC25763739C0C へ移籍するが、主にbチームでの出場となり、aチームでの出場は無かった。2000年から、
913,005,520 *5F092F865E30F7B7FF1F931E87F9C9F2ADD24981 3AMREETA
913,005,521 *5F07B27D8DBAF8FA6AAFE5BDC20475403CAF643B 3B`~ 3B<
913,005,522 *5F0A12DEC8D976D3B3BA8A5E471139C84B35435B 3BARBARAG
913,005,523 *5F0C55E461E8E108A66D5F06BF646BBD80E5BF9E 3B ~o(^_~)
913,005,524 *5F00694343EFEA6FA863F7B8947598239E54A7A3 04291574
913,005,525 *5F0C7E4AE428C3707F29E173502A25BBE7FEEE46 061EASTON
913,005,526 *5F0EE3BFEFA318268191954169D8334866B6ACED 101NOELLE
913,005,527 *5F017356EF90ED28280082B42FE5B2E5436CA4F8 3.VELLMARERIN
913,005,528 *5F06C24C89A6A79E59B2B7E86553E649422947F1 1114017 tervetuloa peders
913,005,529 *5F01E39C7C8E2186DB26230FC91E2DDB42F3C2BD 1212308 theyaresteepedinhisteachingsandheroism.
913,005,530 *5F05A056C04401A02D9FCCBA049C716DF9D76DDF 122IBRAHIM
913,005,531 *5F0A57505355DC5AA0A783AC7E8ADED32BB98D33 12 WISHBONE
913,005,532 *5F05B236CEC833BFD710C1A73B6C6BDBB6BB0712 4ILUVCOOKIES5
913,005,533 *5F01A02A1C6FE41FA92443E245B867B1BEC6871E 4IZJELICE
913,005,534 *5F08D6BDEF9E7E8F04449E3AF541BAA9FD7ADCA3 1404441 VISA.CLASSIC.S
913,005,535 *5F05607354B8D1ADABD29C0FD34921F8F3A5C233 1470688 the-proposal-passed-with-90%-of-the-vote-
913,005,536 *5F0D839E0B7705C4137B60E8D3F81CFDADF14B93 1484311 ".WE.HAVE.CONTROL.,.".HE.SAYS..
913,005,537 *5F001143160CCC4AE59EAB8DA7EC02409C3F7A6F 4KRAFTWERKMASCHINERIE
913,005,538 *5F0147AB9EF6D2B64FDA4FD782202B6DB5A9F5D1 150.rippling
913,005,539 *5F07C1A1D4AAB22032D850B5F578870A6E9AEEBE 1587179 THROUGHOUT-ITS-HISTORY-,-ICI-HAS-RESISTED-CHANGE-.
913,005,540 *5F0605EF618A29C9E02903F888C344A2826C5C1E 4MYERSBSW
913,005,541 *5F08D731D09FDEFCAA687393EB01FFF54C64DF1B 1676269 MAHDOLLISESTI.HARJOITELLAAN.MY
913,005,542 *5F021AF042EED2A6FD94EBD4ABD051B7B13D664F 1824928 senj
913,005,543 *5F00357C5C28A755D2CEAD74B347AD92EBA00F84 1982812QQ
913,005,544 *5F01C190AA694F69AD49C1D7937958316B3B0676 1.alakulmalaukauksella
913,005,545 *5F0A1E165B193CB63C5B5480B2E3DFE199DE6809 1ANLASUNU
913,005,546 *5F0D7240BFF3308EF15D0B8B2EE66040315751EA 4UBGNASEG
913,005,547 *5F09A19609C1BE1FCB9819A011FF128CDBB5F472 1 BILDUNGSVORSPRUNG
913,005,548 *5F04BE8A57DA72B8EDCA12DFDBA5F1F4B206FA6C 1.BINSKY
913,005,549 *5F03C427F1913E877E0FF4B41D5FBEE501B8E7C7 543818 BASKAN TESEKKURLER SAYIN ARABUL
913,005,550 *5F007F834F994E662B363E4657076796EFAEAFAB 5ACSBLVMD
913,005,551 *5F00A74648758849A1AD2C6AC684781354F92FB1 1.ELNAHAS
913,005,552 *5F0E11439F2B6B63C7070875B398851D8BC6B137 1FDWAALDE
913,005,553 *5F083FBE2A615B2282AFF5E060BAB0E645FFD421 1-FEUCHTWARM
913,005,554 *5F02BAF8E9F4105C09B48010F38C22A267D7E504 5BSWEWHICHBSW
913,005,555 *5F0D58557B619C13E09B0A68FC14A4B16E5C7FDE 5BSWKEISLING
913,005,556 *5F03B29710A37AB44B4888E162EB92D9FC6D3265 1.hochschuldirektorenkonferenz
913,005,557 *5F071535EDF2790180FC913280524FF47B1CD622 5ENSINNEK
913,005,558 *5F0DEDFFCD67DF27833A13D79442752BD9DD8E13 5ESTUCADOS
913,005,559 *5F030362672CFAA01C51106A206C7D3CDFB13DBC 5.EX-BUNDESMINISTER
913,005,560 *5F0445A133281EAF0C113CE06A6AC44568E6151D 1ILUVLEDZEP2
913,005,561 *5F07C078835F6E8C2E5C21B2A11052E9A48D21BD 5FLOYDDAKOTA
913,005,562 *5F0EBF64A5B4B58582E89D0CBE7CC02229D57F20 5HNGSLNGR
913,005,563 *5F0EC70EB33CFA31213D4ACB7AFD7B9C6D2EA553 1 KIRJOLOHIPIHVI
913,005,564 *5F06117C4964782BFA76D241E5F7E8633B118C5B 5-ILGILENILEN
913,005,565 *5F061A57A72C6052633EA27D0265B128E98E384A 5ILOVEYOUCRAIG
913,005,566 *5F0BE1D516778A8108F5F930FE57C8BA5EDFF6AC 5INSPIRIRATI
913,005,567 *5F0EF201E3B1ECBCBC77BC6C623F7E34D91B6567 5kyselytuntia
913,005,568 *5F04AD9ADAA7F744691077CF206AE05DC7A774DC 5NEURONREQUES
913,005,569 *5F07203D3DBD6E103E0ECE74C7AE7303704F7BA3 5O13C15+5
913,005,570 *5F0C5076320270FAEFC8FECE0767533309997822 1-muotikausi
913,005,571 *5F068402A46ABE72D9DCC6207599715C8EA2B62E 1ORDEOEFENING
913,005,572 *5F07E95762E153E546077BF0A10FA44F543FB575 1PITODORIS'CE
913,005,573 *5F0043FEF9564B23EF31600D6D83630DCD537040 1 POHJOISMAISTENELOKUVIEN
913,005,574 *5F0C149C20AD59CC6351DBB77310C2CF3531EBC9 1-pstn-konnektivitaet
913,005,575 *5F024F533685B01F59E5EE582E05B0A19E734AA8 1 PUOLEISSA
913,005,576 *5F0BCC2D63E74F69517FEA7382A6FF2ECD3DF846 1PUOLUSTUSPARIN
913,005,577 *5F06CAD172E732864A898A0B50D1F16D20089C47 1Q2W3E4R54338
913,005,578 *5F0159FDFD20C261CCD5686270C38040CD55A2AB 5VDEGGOQ
913,005,579 *5F0C8BB987B514D42208987EEA9A0109BB765773 1SEAQUAKE
913,005,580 *5F0B03791E908CD81D45ADE68D57A68048CC1C64 68-RONDO
913,005,581 *5F080BAA577240665ECE54D2E2A09AD396A5DBDB 1THECOSMO9
913,005,582 *5F008DA9F421B38EFAFDF6295515728828AC24EB 6ATESQUES
913,005,583 *5F084E30B8ED4C308504CA06BC5B198A7611E147 6AVANCEMANGED
913,005,584 *5F0625466593E0B91890EDCD15EF0189E7875BD5 6BSWAIMAQBSW
913,005,585 *5F014BEF03D1184BA45FF817A4B24E12261460AC 6CALPESTATO
913,005,586 *5F0B27101EC7B03C266B8D678B3E7CBA5F38BD9D 1XECNEEW
913,005,587 *5F07E40C225C3C035C6A3403D409A754C24F83F4 6EVITSARTNOCNU
913,005,588 *5F0F2D8657B8007C76586D479C418D895CE36EC1 6F6HKN5O
913,005,589 *5F07ACB26467E343820F1ABC801FACDACCD9AA1E 6h8a
913,005,590 *5F0BEAEA3C52F3B5CC44D0A0F0B966D64A8EDD61 6ILOVEPOKEMON6
913,005,591 *5F0AB1560F4FBFEBD4FAAFBEC48EA2C9EBAB747D 6IMPONDERABLENESSN
913,005,592 *5F0D91B90114598F80EA7D09B743C1D632100168 21 DENUNZIATIONEN
913,005,593 *5F0B0D95526D8730A46EC40CA0BB50E298E6E7C4 2223811 BEI IHNEN KOENNE DIE GRIPPE SOGAR ZUM TOD FUEHREN
913,005,594 *5F0AD1A4F7164429E538002128095687A054C500 2435987 THE.ATTENTION.MAY.BE.DOING.SOME.GOOD..
913,005,595 *5F0465B1DC80E490A4BDACF399AC89ADBC186E38 6PETERLEW
913,005,596 *5F02DEA444934819D755FF501BB95BAFB4F6002C 2532015 RAKENNUKSEN-OVIEN-ULKON
913,005,597 *5F0FE7CC97A669D05620E29A8E91AE472153EB8C 6SANDERSGRANDMA
913,005,598 *5F055F0022AE2FBE37BB3F1EC883512674CBE368 6SANDERSRHONDA
913,005,599 *5F06E0CC7CC8185ADD6C1E324E20F3C95EBBF5BC 6SCAVATAS
913,005,600 *5F057B3E8FA9ECB07816BAFA0F47F6E27F4A870B 25-the-green
913,005,601 *5F01052F9A1D5B2C89CA200EB49CDDD532171E99 2657616 SATOA.TULI.57005800.KILOA.HEHTAARILTA.,.MIK
913,005,602 *5F076496DF65B5C603C63B12150B0FD962367370 6SUNHOTDOG
913,005,603 *5F0E43E094CCB0010DE1A3D41E7FB4B20556BD7C 2745448 es gibt in der sportwelt viel mehr ullrichs als kahns .
913,005,604 *5F00C8079691F314809406589F1AAE943D210453 6TOURISTIK-KONZERN
913,005,605 *5F09C0FB69A8258803039D7E070C03A798E9B00E 278OLIVER
913,005,606 *5F0B52FF80632C55A6CA30F2AA488068246BF197 6ZTUPNITA
913,005,607 *5F0CD60AD2D0459B4272E1FE97104104F676504A 700451 I-WANT-TO-TALK-ABOUT-FRIENDLY-THINGS--"
913,005,608 *5F041FB8D61266B75B92B213640805A188E3260E 2922962 joessa ei harjoiteta liikennett
913,005,609 *5F050275A7FB68779D768AD2CD714332ED06E7B6 2992810 SUOMESSA HOIDETAAN KODEISSA ARVIOLTA 300 000 P
913,005,610 *5F0AA126A3C0457ED92FA8245791893F73ADB679 728037 kosten-:-bis-zu-21.000-schweizer-franken-.
913,005,611 *5F062520CC34390FF2C258F32AF6BD8972CAF111 7568810bdd46bd653d9ceafc38664f5dhoney5737
913,005,612 *5F0997CB9D6F13D4B9FEE7008D19CDB833D60353 2c2371987
913,005,613 *5F09F2B5ABE34024E683C311BF05E6F7D32FD817 2EHAENGTE
913,005,614 *5F05388F426973985F28FE3A0E00FFE6A69751BA 7BSWBOREBSW
913,005,615 *5F0ABA8D2DF371A6D1B1BAF5BD07DE3D15067C06 7CROISAS
913,005,616 *5F0E4B77A59DEA0554D67823C24BD5F5D6E96592 7DUCKIEGABRIELL
913,005,617 *5F0297B168A7A346E458A397D9D552176226938E 2.investex
913,005,618 *5F0FDAD6292EA7CF50AED17B233BACF0BE403691 2 KUTSAN
913,005,619 *5F03EF2DEBDB65C1FC5B6798D556E137BC1C3E83 7GJCVFCTKKP
913,005,620 *5F037339346A1B5B9022499FC733CC0E19D5AA07 7KAROSSERIS
913,005,621 *5F02291E7554E080DE9BE8202265A375DF608352 7-LEUKINE
913,005,622 *5F0E35BFFE8FEEF242759C8C133F1D04FC97FB65 7MACHINISTSES
913,005,623 *5F01A76CD6B572FC5CC8787AB936ECA0A0FCF97D 2 SPARMORATORIUM
913,005,624 *5F06E0927469D6076E68B853617BA4711AC41E5F 7NASUTIM
913,005,625 *5F0D89B626026FA1FF85F7A8BB70B946CD518710 2THEDUMBASS
913,005,626 *5F0AE7A777E18A677F4F8A3BEFD1021294B107BD 7SQUATTHRUSTS
913,005,627 *5F0B14DE52CE13186C4DF963427B77D609CB96B4 7ZUSTANDEBRINGEN
913,005,628 *5F0A58FA5BA72A6ACFB23D8964E156867B9E0E93 813787 YKSITYISENVAKUUTUKSENPIIRISS
913,005,629 *5F05573F477C4819F26118FB9DD5D86FBD282FF1 8BSWAFRONETBSW
913,005,630 *5F009CA04E44921F39E2C9D3D63584F64876170F 8BSWNNKBSW
913,005,631 *5F0BBDC3DD195573BCBEBA98D2465C12C07C9C59 3INGUELLO
913,005,632 *5F0362C5E62C22ACB59F3474A171BD5BED72F729 3 k
913,005,633 *5F0165DA9BB3BE741CFD396B570AF72FBDD857C3 8druckfest
913,005,634 *5F0BB368A5FB9E36D02FC76424870EDAE50FC846 3MAAMSATO
913,005,635 *5F0E00E05820C7601F4587EA81705B0075A939CA 8FRANKLINDINING
913,005,636 *5F005950CDF19CB634C69B92E67341942EB12410 8IFINIRAI
913,005,637 *5F0207FCCD8356DF3702C7E893F16F6CC8718FF5 8KARTOTEKSVINDUERS
913,005,638 *5F018A75FD032AEC106EC0F24999ABAC114418C2 3SALDEEN
913,005,639 *5F0B02939EAE463C526D31AAC19C4649EBE33A61 3.SOSIAALIPOLIITIKOT
913,005,640 *5F08901E5434A75BB19367D7FD75A6740E9FE3D7 8NIKNSSEI
913,005,641 *5F0321ABF35F57A5F228686A72402647D7C46E0F 8===)-`~-}o{
913,005,642 *5F0145F2D9AA682E5F77338A3BBC068CB262903D 8SHELLYBRAZIL
913,005,643 *5F0B017BA30E95B0E202A08EB0C9F65F88FEA94A 453:.JEZUS,.HEILIGE.GEZALFDE.HEER
913,005,644 *5F0A50B84E063A03D61B8A0304EA9FF074311571 4991AC83999740F2BEB4720BB983B4C2
913,005,645 *5F0919081FC4E03CA5D439A7583D3A7F432FB1A8 4CONCUBINO
913,005,646 *5F05912179657C003D6546DBE6A7FDA8C1AA4EF9 8THEWILBUR4
913,005,647 *5F0800EDE5D1C532C92C1F699A0272F3EAFB17A0 4feb1668
913,005,648 *5F008D031F913849927A18A11B9615B69A4A56C5 8VERAUSGABEN
913,005,649 *5F036EA1C8EBB2544BD21DD03C749C48DB5A9681 8vergrepenen
913,005,650 *5F0F4F0E52A0C93489A6C32D08698683A640BF6A 906473 kuivaamon-pienen-puolen-sis
913,005,651 *5F0142957303D9B569B6FF1F2A73CECEAD690092 93d3dc553c523d8b959c3b260fde044d
913,005,652 *5F0D66A1D295DE1BCE30D281EE124A7C20F04372 4LUMBOOVARIAN
913,005,653 *5F0BECB678881E28C027F7F2A3BB084F62B75168 984793 WEITERES AUSSITZEN BRINGT NIEMAND MEHR WEITER
913,005,654 *5F0F7B1157BB178F215A5EB04DC0403DE3C979A3 9COENZYMATICALLY
913,005,655 *5F09B74CDEFE7C42D71FC7318CC14E4D8EBBB11E 9EMANCIPERAIE
913,005,656 *5F021E45462A83A7E9377CD981640E0C4DF1281F 9GCGCHGHGHCGHAWWEEELLHCGGHCGBSW
913,005,657 *5F092320FD2FFAFED35DC7082A8E17E21838CA36 9HYPOMAZIA
913,005,658 *5F0AD74C4A7A3F134FD9C17B4AAC89CF84E1F78F 9INFILACAPPI
913,005,659 *5F0B42B1DC127F5A1DEB0DA95C18C41BC23A3E1A 9JO7CG
913,005,660 *5F08F5CCEB1C9A8399302B919D0F2B645B2585D2 9KELDERRAMEN
913,005,661 *5F0B1095F79F5365F3FFA35306A1C277DBF42195 9MACHEL
913,005,662 *5F08016990B81ED58915809382C798175F4EFC22 4YTILAROMERP
913,005,663 *5F058239EA40983A07ACC793808987201111DD44 526954D
913,005,664 *5F0AAB93CCB741AC1F771FD341C19F5689BAA042 9OCTOBER1627
913,005,665 *5F082EFDD73B3C9C55EACA96A68716844432E96C 5DRAAIEND
913,005,666 *5F051359565E5B85A8B677B9D36B79C3B549B1AF 9techupdate
913,005,667 *5F03643F0D191CE60F31D49BB5931A1EA4CC8305 5FEUCHTTHCUEF
913,005,668 *5F0263A9FE937E158002B2DF25175D3B45098E70 5ILUVGONE9
913,005,669 *5F0ABFD24C96A001D229D3C4218DD7113D7ADCB9 5INVALIDENSTRASSE
913,005,670 *5F0A3A42BDC9F295C8B8A77C9429EFBECCD6CDFF A0A9T
913,005,671 *5F0DFA891AE2FF3447CA9ABFCCB60DA1615C941F 5KLOOSTERGANGEN
913,005,672 *5F0E672287BFA3AA96AF82D0488060408EAEB3BA 5REANGIVARE
913,005,673 *5F0904C594C324830E66EA5CD1A99AB6811A8F51 a5b:b
913,005,674 *5F03070AB912D1CADA70AC443F59B6C0F7629BF1 5SSEGNEHA
913,005,675 *5F0E9B899802AD18689B2DD4CBD05B3EA05DE337 5TIGERSUTOPIA
913,005,676 *5F0D319F21FCAFB1E4752E2B5AE662C45B18FC93 5UPSLACKENSLEEPYSLOTHFULSLOW
913,005,677 *5F035D68B9E69803A639D7F95399415A35EB97C9 5VALEPART
913,005,678 *5F08B89EA46A4866A3FF134041488B7A58A7167C aaaebp
913,005,679 *5F09B757FAB73553D9F5F595457318E4BC05339D AABDUC
913,005,680 *5F0CCD7098A0DAFBDFBE371E866C1FFC58E1A167 AAC,CT
913,005,681 *5F0D817C264B58C7E7EE0D00F247CF9CDB72DF8F 6 computerkonzern
913,005,682 *5F0D57D740205036E431EA762DF13F6A0F8B8972 aadk]0
913,005,683 *5F0D856812B82A3BE668C2CC135A357D8D2CB888 6DELOSPAN
913,005,684 *5F03AF41127D77E95374EB2D7B7400BC6CFD768F AAE.1+
913,005,685 *5F0483581B98DEE692B0913CAE8E331820A3321B 6DOKTOREN
913,005,686 *5F080DA48C4C234E3F6112B7EDB8551D172F28DB aalladar1
913,005,687 *5F0A754366ACE4D4164FCE50DCDDC2DBFDFA0C56 AATACAAAAATTAGCCGGGCGTGGTGGCGCATGCCTGTAATCCCAGCTACTCGGGAGGCT
913,005,688 *5F052B5F4B8F8F61B6AD832B3CC249553D4DDA46 6KOTIASIA
913,005,689 *5F079A2D13128696E99BBFAF0784C130239138E4 6LENDSTEN
913,005,690 *5F048010372B06A2CC37695C3BDA8B14E7FAA86A AB^>
913,005,691 *5F01B12E72CAEC4B3327BA868C244042BA22B4C7 ABERMATT:
913,005,692 *5F04A9C9F1312474EC7ABC3471EB7F1970F0263C 6RAPITI
913,005,693 *5F09FC514FDBB3E8F338EF7D7A1AABE1B48065F1 ab=im
913,005,694 *5F0EF3806E42BDC67BAD1238C41962C54E773329 6RSTATLIGAR
913,005,695 *5F02FE1AB2138996E3579B59515D3B5CE8C024BE 6schiffstransport
913,005,696 *5F0FF48DDF68EBDB6CD48EE0D5A1F169C305BC55 6STIPULERING
913,005,697 *5F021584B0BC0D831DBDDB976438309F541A4E33 AB=XU
913,005,698 *5F0CCDBD801F2540F2FB168F30B8CD8991CB7FDE ACONST316
913,005,699 *5F0E5879871A5D937C3E460183B4B75A3DE52E89 7ARCHITEKTONIS
913,005,700 *5F0365CAC7B976E8FEC2C58771DE8678FA606BDF 7BSWCALLBACKFUNCBSW
913,005,701 *5F01856625837DF8FC48BFDAEFE64C9EF5F1750F 7BSWFOUNTAINESBSW
913,005,702 *5F0CA8E32B1E2366BE4EAB5F7344D368B77DF7AB ACZY[
913,005,703 *5F0246C3001F83B2A1641316F4C5691904143882 7HEIDICLAIRE
913,005,704 *5F04FC569E142A2ECED454884D5A2FD49DC1146A 7INSPIRATIONSES
913,005,705 *5F0EADA961C9AAA72501E9C4A62C477FD74541C2 7MYPRIMUS
913,005,706 *5F058EA6CAFA59C1298976D5AA8CF0FA3370A94D 7ROPINGANDREW
913,005,707 *5F0D7778E7A6821935A7ED819DA05A14CD243894 aerodynamic.braking
913,005,708 *5F0A2BB7B9E4A364244E9DDDFAC4F5BF1B11FF5A 7SGNIHSIL
913,005,709 *5F05EC88662301768FE86B3FFCAD85427441C232 7SPLATBAC
913,005,710 *5F04D8ED10F1B25B75FF6D7A2227C2904371F4E8 afbsx
913,005,711 *5F06C59D603F3B743E25854167760455C2795730 ahce
913,005,712 *5F01A826AF49B7F6D6B9F2C210ED0084DAB9816E aikpq
913,005,713 *5F06D8783721F009501BB3D020467E22B744D72E a)k
913,005,714 *5F00747E5776D0E45BC9B33272F94DC87BC8BB3A akm"s
913,005,715 *5F06E9B27A048BAFD1B2EC347DEA481F6FDC757E ALEC.HENSLE
913,005,716 *5F0A1D1854380AFAFF2FEBFB1CEFD8F8B8DA631A 8NUGGETED
913,005,717 *5F07D34FFF9C24F75F6FFDE5D903E6F2A86F68AE alexandergerald
913,005,718 *5F06681FEB623700382424078983F50A6DD5946C [email protected]
913,005,719 *5F0C2618B27128239A07F6108AC4DC41EA2C3E28 8SAJEENDRAN
913,005,720 *5F0C400DA40FFB70441105BB2089D7181CB0E20F 8SCOPULASES
913,005,721 *5F04F59994BC51EA5371C63C54A120DF62C50CD8 alj
913,005,722 *5F000E461A4B966051AB8480F5DE238B2F635BDA [email protected]
913,005,723 *5F0123B8A2AEC31B5BA981818F18B2A1EC4F33DB 8WARTETES
913,005,724 *5F0BF83FEB57F424AEB645A44C69689515C0EC0E 909LAUREN
913,005,725 *5F02A1D439853999B022E662CC887ADA98FBE312 946339 KIRJAN-ON-KUSTANTANUT-SUOMEN-L
913,005,726 *5F0DAA1FAF39FE16CA7773999A70AEC602462D2C 983.MINUUTIN
913,005,727 *5F00797DF36640FA0F4CB5AA3ED9D7B78F8D9664 9A3265
913,005,728 *5F06CA3FE943687262F9FA2923959D64CD8634CA alwn.
913,005,729 *5F0C3086440151FE5F545A5E2394FCE0CAE1D51F AM.%-
913,005,730 *5F01527540E58C0BCA58617B0D1D4C13F7CD12E7 9EVITAROI
913,005,731 *5F0D1C27A40CC7670CFDF4EDA6593B4C2EAD1CD9 amok2cul
913,005,732 *5F08ACECC80C906625F56D9C6FD40EB61D2F7038 [email protected]
913,005,733 *5F0F96F969F95F0A1EA01382146818916024D5EF ANCHOR_BELL '/&//N/K/@/R_B/E/L
913,005,734 *5F0CD8C38C8492D886D01936824A216D51067C27 andersondreuitt
913,005,735 *5F0A3824D71983B21302C289641E2BD60D614C61 ANDREA.MARIA.GONZALEZ
913,005,736 *5F081DB590BA52F77C39C0FB1B2EC273D6E50125 ANDREW.PARIZEK
913,005,737 *5F0E69D72E9FF28ACB64FCB79765939383ACACFE 9REISBILJ
913,005,738 *5F012EC09585F30DFF4383C2F15BF2F3C70CDF0B andy-leggott
913,005,739 *5F0EBBA2ABDF781604E57B5BF914BFEFDA112189 9RIDSTNOFXBILRSUTNOFYMEMOHRESU
913,005,740 *5F05C7C8B14B46954293F14E506C0B2723C43B3D 9SADAREMA
913,005,741 *5F026335F7017E55A3BAB0E9A1C1270DC3C4CCFA anfangsgliedes
913,005,742 *5F01AA96E38FA0A6D03DCB1C0005FF92584A0B6F angezeigt
913,005,743 *5F0B5B6F02BE166D3D44DF775EC9CB2CC9548755 ANTEILIG6
913,005,744 *5F08FDF37216ADE000525BEDFE359D6CDC3D6315 ANUARRAZALI
913,005,745 *5F09861D2573852B8BE1619958984E666628F9D4 AOK!?
913,005,746 *5F05750C488BB8D752A6D76D3B92C54186FA5A6C aacpe
913,005,747 *5F0581E4B4ACC06E406A9D617491F3579BE952F2 AAFG%Q
913,005,748 *5F0A1E19AFF1795CCD866A0384C08F6CD06F68F6 aaf#m
913,005,749 *5F087E3E39049F015BB7FD3B8E71E967E24B8CCD ARNULFO.LEPORE
913,005,750 *5F0535D28CCC605A3EB1EB42CF0998D2C576DE53 ARNULFOWULKAN
913,005,751 *5F06D943541666990B762597215EF8E5DF74E6E9 AAKJ`
913,005,752 *5F025ECB02E127DB8490F023C8C6A2A3506DE6FF ABAFANTED
913,005,753 *5F08136427A6436EE15A2FBA16C415F48CF32E1A a"bca
913,005,754 *5F0D098B1BCC9CA183686918571DD109319E5F01 abigail}
913,005,755 *5F050E9B82BA445237181AD50B513F6EB2E009C1 a#c?:
913,005,756 *5F06BEB611DA6C0E430018A5E6648935B1ADEEEF ACCESSSWIMMER1
913,005,757 *5F06940773C1A8205B02E65FFCE3A0C31BF1CB66 ACITSUCING
913,005,758 *5F00507C26D3F9715C2602EAAE06969984F6EDAD A-CK0
913,005,759 *5F071C05C352EA67E1CF256BF71E057FB887807E ad98p
913,005,760 *5F093CA128B0987D23E40FA5C6375ED735863592 AT$W0
913,005,761 *5F07A838F1E7AB305B665652D39B76AC278E292E adeprado1
913,005,762 *5F0A7AA6BA6842865CF9C3D346100B7C8B91ED67 ADTUAIDH6
913,005,763 *5F0B6006434F9CB3615922FD1E5C2CE4C6FB2FAD AUSCULTAIS7
913,005,764 *5F0ED4D5445A79AF6175D6C26253711DE9983032 ay;a+
913,005,765 *5F06C622E8D3918427CD44B955E3ACEFC66F1CEA agrest?
913,005,766 *5F0B9865ED7FCDD0A257B5BF5E330BFBE8B805D0 AYUOYSUMS
913,005,767 *5F03DB89025CE2FF4F3140CE402CDEAC8E6285F8 AH2ME
913,005,768 *5F0F76BADDFA9EE82D8B39974053EDBA24847829 a$i_o
913,005,769 *5F07CDD61C8DEC9518498498FCD89B650D186447 ak-dn
913,005,770 *5F062300B804674C013A17549FADD3A9AC1A408A b4;k2
913,005,771 *5F086E58E4A31DB30FA5FD7919A0A643DD2F1434 a:kl%
913,005,772 *5F00E1E8BBE632CB1C16ADB716E85B25EC2E7F54 akwng
913,005,773 *5F098EAEB92E0A1E454351570E4224A0AC7576F5 albertpults
913,005,774 *5F0CFBE04024B17876F1B9E421410A0384CDC93D aldocini
913,005,775 *5F0CDA9A1F4811EAB24C34B72F2CCF690CBF1316 B;+;A
913,005,776 *5F04A330A1BC09D8719B4E9C2350061C9750FF29 ALLESOMING
913,005,777 *5F0556637CA3D66C2EC9088527320632E5D18443 alveraz1234
913,005,778 *5F07D7967CCBB426B305B0A4F57D115B074B12AC bc!jj
913,005,779 *5F0A97FF07DCCEDCCCE25794056DCA77532FDF7B AMERI (GLI AMORI)
913,005,780 *5F0B0D86593C0BA783A5775B64871C21748901BF BD3(/
913,005,781 *5F0D0767C470CCA6955F11FA2E8A217A82C25AB0 AND A COMMERCIAL VERSION (CURRENTLY IN ALPHA TEST) BY TATU YL
913,005,782 *5F020FB2FB84F460381C541364421CBA3A9B7651 BENTONDILENA
913,005,783 *5F005CC64277C088FEED306097193A615425F7C1 BENZACAR4
913,005,784 *5F034E9C792CCB8A070B983FB98F33D68FB9F44D ANIEDOC9
913,005,785 *5F04100AF9A1B1F41995A8061326852C6441E11D BERTRAM.BACUS
913,005,786 *5F0DB2B4AEC9FDB01720D2500560CB9203135A67 BEU!E
913,005,787 *5F0963DEBA3F0CB04116CDE6987D2189CFE8F0B2 BFNK
913,005,788 *5F0CF7B4CD20F50AA8B76AE833FAAC56A34F964D aqh9;
913,005,789 *5F0B35552ED7F2172B21FC64B51E2F5B6526390C BISATJANING
913,005,790 *5F02D65E2B306478195F4E9639E46E246440E2B8 bisaxill1
913,005,791 *5F0284B4D7A03F5A82F33CEEB9190B30F09BDF2C armholdbsw
913,005,792 *5F0BC16206C8909439103CED1096747EE4F83BF9 arnolddeneke
913,005,793 *5F03E02936759899E267C3AA7AE1C9B97860DC13 BLAIRGOTTHARD
913,005,794 *5F0629B5F63D4F2C9816A5A8BC6065719384AB72 BLAIR.ORES
913,005,795 *5F0F30C76943D77226D7E18613941019DFA01953 ARONSELLERS
913,005,796 *5F01D5A24933793BA5D425EEAC533F0A6EBFD98A ARRE$+A$$E
913,005,797 *5F0469AFEB0E12FB8FBF8C72C3D9134213B858A0 b(lfv
913,005,798 *5F04F2A12944E8B54CA6847C59A0AC1542E3A613 bmmn
913,005,799 *5F022C9C2952DAD6E690C12447A795434B481A7D ATF
913,005,800 *5F0974B0FAA9E3C5C5D10AE6D59D6DBF0C7463CC ATSAVEKS9
913,005,801 *5F03CA0205A73BFB454FAF44AA1212473B8DBAD3 bo6m
913,005,802 *5F054F2E74A6478E63329A29CFAC2EFCF28F8995 BOO7135
913,005,803 *5F0EB2C22D717750251AA9410879861B9B951B50 AU;?T
913,005,804 *5F0AE3EEB83554AFB4EF089861EC440382B1B122 Avaasr^ijanh
913,005,805 *5F0B7B618257899E1A98A19938BA1A7F175C2ABE avcb
913,005,806 *5F05F0AEF102A36BFF6A82BF5A684D97C5CFF9A4 bp,5
913,005,807 *5F0D9991E591D8CD5A1698CD66F49AB74D7366DF BRADLY.ARNEY
913,005,808 *5F02206A36857AED2CC18E2B86A6BB888BF6BDD1 BRAKWATERBIOTOOP
913,005,809 *5F007F4AA19AFDE46A65306DF79BF516EBF2E669 azru(
913,005,810 *5F0E01D8A9FEDCF2F652149CEEF000E43D6CFEA9 BR:AV
913,005,811 *5F04347C8378114D28E2938F1F896B549E5833A3 brekewoldt
913,005,812 *5F0A4812A9E852931401BA8135AB2AE8C80D53C5 brendonschoellkopf
913,005,813 *5F0A222820A96920C34604B8535B2D731FEA8628 b#+)1
913,005,814 *5F0B6BC8F24C69998600ADB08EFD42CE9D1D55E8 BRIAN.LUCICH
913,005,815 *5F040C4520567E1768FE8C719FE843978F182839 B2hq
913,005,816 *5F00F7D7D0000E69B9C3BFF92BEC8440EC6D132F B41L2S
913,005,817 *5F0F5C38BCF69A49F099C2BEE1CADECAB6E2493D [email protected]
913,005,818 *5F04DFA9C1BEECBACCB08E1670AD70FB4828CB7A b4/eo
913,005,819 *5F0F1614DBAC16BDDDC26359B8CBC7C5CC7DAABA BUDDYCROUTER
913,005,820 *5F06368A41FB09BA502A4197939732D029663DA7 BUHNLF
913,005,821 *5F08DCF4B6D5D3EF371648325F7B7BF4CB801C5A BUSCHGRABENRUNDWEG
913,005,822 *5F03E63B0F4AD8ABD25B7BEF997BD5C74316947A [email protected]
913,005,823 *5F0C2C6328DF92CE2A7E6DD8987120DE60310B49 bv;sl
913,005,824 *5F04147CAFBA82F9E683BB3C1F2603A8DDCEA45C BB,,5
913,005,825 *5F042A2B063D0858F406C5D8C016CD4FBBA68EC2 c23
913,005,826 *5F01953A4100B5EDD710FEC29D9ECB5ACF82DF58 BEIBM
913,005,827 *5F047ED51B91503D795672CA5DD3F35EF99DC76F BELINDATROUP
913,005,828 *5F02B444C972233B6774E1801A6324C20DC47669 C4LD4L
913,005,829 *5F04CD0CEE7803417787EF1D8F7ED0B6DDB9E2B7 C5-7
913,005,830 *5F0F62241B9E97BCE04DEEC8C759E9FFAA7C3F65 c8.o
913,005,831 *5F04CE53B32C2B24F995917CDA65EC7137915E59 bg/aa
913,005,832 *5F0A9CD6557948BDAA83B700C66230B266D67E28 BH/MS
913,005,833 *5F0314495A94831A5A4EB45D42774E42EB525AE0 BILLBORST
913,005,834 *5F048C28768286285D6197F333854CD442DC75B9 biv-?
913,005,835 *5F03997EA9A5ED29F856076649FF5AF657538B57 CDEL1
913,005,836 *5F0B59EB96728F5CDDDF13316FD08E0875AFF080 C:\DOCUMENTS AND SETTINGS\FIREXWARE\START MENU\PROGRAMS\ACCESSORIES\ENTERTAINMENT\WINDOWS MEDIA PLAYERLNK
913,005,837 *5F0B61E5B04369FE3D0E8F85FA2EB5C04A5D2FFF celemin0
913,005,838 *5F0965A058615EA18D8DF0BFB7C00E45F4A3CA25 CHAD.NJITAP
913,005,839 *5F040FACF60077463C67335BF9D1DEF092095937 CHADWICK.DOOR
913,005,840 *5F02D4E71E648C8AB4D753DD484C98D5A5646D1B «boltxe»
913,005,841 *5F0F011458EB4C4C8400B609BB0F9556F9EC8A59 BOO7135
913,005,842 *5F00D4AE6594E0BF2AF46A293962109059FE3611 CHERLYNDELACRUZ
913,005,843 *5F02594BBA62DCE15E2BC308497FC5C787D9CB7B b####p~o-splat
913,005,844 *5F0B68C54FB0F0DB07D37321126DD1EE0E03638C chikasha
913,005,845 *5F0CC29F230030DD546CDC40BE6DF688FEA90006 BR4L
913,005,846 *5F0EFD0CBA2DFEF2D210FD2C90A36CB349100A80 BRADYSTÄ
913,005,847 *5F0388DCAB98EBB993784228AA3B7EBE4E4B4D5D BRANANS5
913,005,848 *5F09700EC956D9023C48E27312829A8B6BEF7617 CILINDRA4
913,005,849 *5F03F553E2B89CD5919ABE2BD7DADD62F3B457BA [email protected]
913,005,850 *5F0FDE89306FDC52BF3DC3B6BC3728DB0EDD357E bricemuta
913,005,851 *5F059A13C0085380E175FE17E8612A2B5C2F3673 BRICETRASS
913,005,852 *5F0D0619D0D0B3141AAD25B0ECF0E26B87EF10FF cio)_
913,005,853 *5F05D436F41E66BEE0022ADD33512BB7B513634A C(!IQ
913,005,854 *5F00C2178E34B4AC9F029D82BB07061F9489111E brlm
913,005,855 *5F07E230CFC525DF3697DBBCDF3804484EAEC6A4 CLAMAV.PNG
913,005,856 *5F083A5CBE41079445F359750B05226BA78177FB class-lottery
913,005,857 *5F00FADE0101013897A8C8C0DB76FE540850DBB2 bsg)"
913,005,858 *5F09EAA42B4C105625D9EE27BBD55BAF446DF02C C/LFS
913,005,859 *5F0367DE4F2F2779355F8EC1090C7A373842F770 CMOUSSAYAN
913,005,860 *5F092A369AD089BB4CDC5CC4ADCF726D7DBC9DBF BUGZILLA.DEB
913,005,861 *5F0331820E397B13CE3ABE09D14932C5C19F342D cmuac
913,005,862 *5F0063CA0D4261E5E7375A225CF1D2F21E9632B8 co99r
913,005,863 *5F040FBA2E6F4773907717C5797BD297CDF6CD94 colinbrander
913,005,864 *5F06CC5E2BD63B4B91DBA980764F49FD385C188A BvX
913,005,865 *5F09727A38F7413FB9899307A29B075088805CD6 conflictearlywarningandcrisismapping
913,005,866 *5F0D0F983CE0609909CCCD78F37D8C3C42DEA209 CONSECR4+IONS
913,005,867 *5F05D61E0A690B6A0742229118797352B3F201B9 c0s9s
913,005,868 *5F0EAB0F0ECA7CE8DBD8841F630744072AFA3202 c4bgr
913,005,869 *5F0147663AA08BB9CE14F6FC203A10FA22960D22 [email protected]
913,005,870 *5F03F17AC8C8D2394F794CFF1587E4058F2D6921 caitlinmiller
913,005,871 *5F02A90D42FE43FD1BD429A0FDB40BA7FCC578B3 [email protected]@t0us
913,005,872 *5F0968C39B1D52AB18FD365147C24BE353AD4CE9 CAREYFERRARIO
913,005,873 *5F085177744A9D2E83B4A8173711B697DBC1F23F CARL NOLAN
913,005,874 *5F01520799EB9357E470AA5E5BB0B18E1268FF1B [email protected]
913,005,875 *5F0393902CB7E9317D0CB5A0E9A3314F12785899 CASEY.MACENTEE
913,005,876 *5F09C69CB1DF372D325C35D29263FF8B456939FD [email protected]
913,005,877 *5F0E11DD41675B70618C48EC3CAF369467AB4D67 CASTERLING
913,005,878 *5F0163CEBE8DCB2F325F3633A2B82F15F5FEAFC9 CAT)!
913,005,879 *5F0FF811868331F9D66399E267572AC63C6202C4 ctump
913,005,880 *5F0AB25E467CFAB1A4405F098AA87D113FEC4592 cwckg
913,005,881 *5F0F62E4B48C0E7285D01B5BF85DC608F807423E CEIWF
913,005,882 *5F0D460C97B6E649A4AD66FF6A336BC17CC09588 cfccc
913,005,883 *5F0BE913AA596998820141B3E80893A3C81DD491 CHAMPIONSHIPCONTINEN
913,005,884 *5F032AEE8AC99862AC57585B558172731AA5DCA7 CHANCEEE
913,005,885 *5F05B51420C827903F5F2D1C08C4BFDD636A0050 CHARLESTWERSKY
913,005,886 *5F0AE86D42DD53741945F90935569748735A7181 charleybeth
913,005,887 *5F08133455002ED477B6143B322C76125A4C2D7B D3TR!M3NT41N3SS
913,005,888 *5F0CF028F699C0FD1401A78A9C882421D9C45311 CHESTER.CASTREY
913,005,889 *5F0F4C939B4554A3E7426DF83778E76E712CBB5D d:89
913,005,890 *5F0DBC60D4CE3216866489427CF37467DCD092FA CHISZERS
913,005,891 *5F0A8FD700A0472052E63EBAEDA9AB45688BB0CB [email protected]
913,005,892 *5F0C079D1E2267EF0FB4F52A1C8A5A46DCD1E127 DAARGBSW3
913,005,893 *5F0B9C123B9AA899F46AF1A02C164D0BB3304255 dadinretam1
913,005,894 *5F01E7A5571F1A0B3D4D9052D32B1B30CDFB5CD3 christoers
913,005,895 *5F019B0AA8FC57512DD4795808888D29AA1220CE DAMIONFINNILA
913,005,896 *5F066929F7DAA6C74CE7CC46928944C80D1F9EE8 ci6xw
913,005,897 *5F0D3950478F36F7AF53974B3410F4349C01BD0B CINDYHAUSNER
913,005,898 *5F04C4359E2715AF369A058CE3BA89E0D884DD3E CJTX(
913,005,899 *5F0C719C289358A78BF4C65E549E321153AE7C32 DARRON.BOVEJA
913,005,900 *5F0EC66069F491D6D310AFCED2CDDCDBD7BD8F46 darronurness
913,005,901 *5F06D79ADA7398F665410AA7CB855D7ED1AF6BA5 DARYL.PEYTON
913,005,902 *5F08A1AA49543ADBF1AAB5402AE0B1F391B2624D clare-ogden
913,005,903 *5F088A8EAB3593FC4CE4C96F678B848BB75A620E CLARKHERMENEGILDO
913,005,904 *5F064F8BA2827EDA89FBB4BAE64DF072DD65F913 dauxois4
913,005,905 *5F0DBB56870B02DD87CC2D3C1820AE2E94C21536 cleased
913,005,906 *5F08BE2ECAB13EA7A5E3970A8C89C5A14143966D [email protected],
913,005,907 *5F095519994A1F35BA61BB4FA35E9A14C94DAB2D DBXIK
913,005,908 *5F0D29E2A47398107B7291CED9567A3F2693E746 CLM)L
913,005,909 *5F043AD3EB78098D9A41F09AA8B506CE01E47A1E DDBU=
913,005,910 *5F0592A078D7D2A76440843CE2EE2A0AE3D5DD2E DEANNA MOBLEY
913,005,911 *5F0DFE4A055E902DD2B4D555C7919D9569A86C38 COEMBODIES8
913,005,912 *5F0DC86B422E04BDF834E29663F983AEC0D162A4 COLLEGEGARFIELD
913,005,913 *5F0A71AA35A26FAC73BC539A6A96640FA9620F98 deput
913,005,914 *5F01970F5C945C5AEDD0D32416837A173C198BE3 DER UNHEILIGE ORT
913,005,915 *5F06069F3C2F02026954E794273A216773BCC02E DESHAWNKRAKOWSKI
913,005,916 *5F0FF9725CCD0827A0F554F0F143E0798C5854CA costeleta
913,005,917 *5F0C8805A93EBB75390E13B789FF156821596567 C:\PROGRAM-FILES\COMMON-FILES\SYSTEM\ADO\MSADOXDLL
913,005,918 *5F0DA3786699CD3C0A0B1CE67525BD0F4EA98B54 cq6mn
913,005,919 *5F0067A083D1B74440E670452E90CBDD46CF42BD DHNPY
913,005,920 *5F0EA5B7AC20D1C3B3FA823B2C9131C8572BB692 D(IND
913,005,921 *5F09629B0657952EE7AE9980A8AE5D59EAD8DCF2 DIRK.JAKOB
913,005,922 *5F0FA08F994F354091218B4ED0243F6E1664EC7D CU$_A
913,005,923 *5F016C94D0D86323FCA9C11757A104E4FEFF25E8 CVHK+
913,005,924 *5F016628B76AA0CA3DE23796445C3DBB6E200DEE D!M"A
913,005,925 *5F06EB7FD9F42E731EF7C48D84DDF05141C311EC cyhf%
913,005,926 *5F019ACABE423E4B5E42CD4DD3DBE6013FB1BB8B DNQX
913,005,927 *5F00B5F4A51FD845451474ECA2161B9229DCD887 D0b
913,005,928 *5F01E4FA3644ED5FECB33D668BE5D560043D39F6 DOMINICWINGERTER
913,005,929 *5F082689ECE98B47A62B95CE5E58B7DCCE5FCE23 DONALD.CURLEE
913,005,930 *5F0D261FF3BC73CE72FB79F0B2065D8F51BEBA87 d1jme
913,005,931 *5F0C0221ABB8A128C4840DF0A7E00F5C83DE324E DONOVANSITTERSON
913,005,932 *5F02B5094376D029F68BF698D3B1CB9D22C6603C d3c,o
913,005,933 *5F01F4B1568DB28BF364E0751C6C3103E5BB29AF [email protected]@NS
913,005,934 *5F0893FE8FCD14FEB0FC17B0C8484822C5639B14 D3LICIMOS
913,005,935 *5F07B3B4EB8B1DD61A0DEEBA151D7F32B7EC3D2D d3mogr4phc4lly
913,005,936 *5F03E4A2A3837D8986BB9CE86A04E897276C02CD DORIAN.WOLNER
913,005,937 *5F0D6F411E2645AD515311A0DDAB83A654A259E6 D5FE88F33BD23E26BB32D0C0768BDB2A
913,005,938 *5F047B33AB0394243C6E16AB42E70B8EB57BCC93 D,QLI
913,005,939 *5F01705744480BE06E1AAC791A4A641ED8D589A8 DRHS8
913,005,940 *5F02FD2799E6F7CCE6E50EFA1F63E71BFF1C51C9 D"SU)
913,005,941 *5F05D710D9CA1DB5311509D3D516DC29620D4A76 DANNY.RODNEY
913,005,942 *5F0D8A853CD17660222E21DFF4A6B1DA354F61DD DUA
913,005,943 *5F0C23C0001FE5D3693CEC7729CCEF27E2F847C9 DARIN.UGALDE
913,005,944 *5F07639482B25BD207BC5BF2F678C3B5C204733B darnelleafford
913,005,945 *5F0AFD2C203DCEFBF6E03F78B11DD5EE9C995423 DUCKTAIL
913,005,946 *5F03955EAB6C71BD3DDDE864EBD869CDA66B8868 dunssnud7
913,005,947 *5F0C89F81F75460A621FED24676B076246EA8B5D dvr:u
913,005,948 *5F0269D85E90CFBEAE7508A52BE70873AE407850 dx/4
913,005,949 *5F01EAACDFA719C84AFD6BE7EDF2609C6D2A2477 DXBKW
913,005,950 *5F097EA564A954790CCB59AE44E4BFADBD3DE0BE DXW0
913,005,951 *5F06A178E91768E0D2EBEEED44294B0930F51719 dccba
913,005,952 *5F0B52EBA517B716B7C939295044BA49653F1ECD E6EW
913,005,953 *5F006538F1EB521DBDE1606DBE1E8087730E565F DECABOBO
913,005,954 *5F08AC87C820471FD5253506120D11600660C916 DELMERALBEA
913,005,955 *5F0E33DC2E270FFDA9D7624FD5A8527AA204ABAD DEMARCUS.HARTENSTEIN
913,005,956 *5F03929DE4AD3B7E9716F6C1E33C69C75E83F994 DEP!8
913,005,957 *5F0335D25074572B24E99CB4A7217129E17F0094 EDU.CN160
913,005,958 *5F058871ECC047D84D7B6ED8A6E5286AAD30A1BD derickstoeke
913,005,959 *5F025183796B890E13AD1DA61920179E820792A8 DEVENIR-FEMME
913,005,960 *5F08F738A6B2B32373E17CE952579FDDDA6BB8B8 dexterchristesen
913,005,961 *5F0E3CEDBB224B4352FA75368AFE19F89E3E96EC dezicarted
913,005,962 *5F00BA89F605934C6B2C1096FF3F13EBA5DEEFD6 DFVZ/
913,005,963 *5F0E0451A601D3740281184DCA4BCA0B46620A28 [email protected]
913,005,964 *5F0246E3B8DE8F40CB37219C616DF773154E8E50 DHRMQ
913,005,965 *5F05E33AAF5F072CC3E8EDB8593B3C6599C9390B di$iq
913,005,966 *5F0AB962D56735298857833336639134BDA29B9D elmersembrat
913,005,967 *5F0CAFB4EAB04150A5A257A1F6EF806674F64DC9 [email protected]
913,005,968 *5F02E3974C7B6E331AE02A4300F20AD1F0B155CC d:joz
913,005,969 *5F022EE5D4E3BFEF83C58FE6F3309604DBDFA396 EMELI PEREZ
913,005,970 *5F01184B2540037176A8D5DCA8824F1D35234C6F DKWW%
913,005,971 *5F083EB38BA9A6AA9AB40CC8BCD448E1092759EE EMILYROPER
913,005,972 *5F044E851BAB0A851C00D15117AF4F143ADD3D97 emmanuelmcgivney
913,005,973 *5F06427ADF9722496C5EBCB4478FADF3AFD01B5B emmittforseth
913,005,974 *5F0970A9435A29E51E1C2FBC1EACEBDF59A4832F EMORY.BROZELL
913,005,975 *5F02C922A8D2F6DC5A98DF7C0823DEC38716EBE7 en=bk
913,005,976 *5F0758D8DABB208BB12775276F6D903CF66B464C DN,S
913,005,977 *5F09FB4AB1010E856968F1D689F5A98DBD5B18CB EOINNDVT3
913,005,978 *5F038C5F5E72F701503B4AF43F4B21EDD4B77521 [email protected]
913,005,979 *5F0A8D76DD4D96D7E388B95557E25204D3F167AB doneslo0
913,005,980 *5F05B5EE86A59716511DDB5D6307E03BBDFD22C7 ÉRIEURE
913,005,981 *5F0F05DD00E3DE5AEA1BA2AEDDF85F90F14356CB ERIK.WEWERKA
913,005,982 *5F0BC06B367DA280DA559A55BFFB22832E5135ED ERIMBECK
913,005,983 *5F0AC7D88215141F26D290BA530546AE3F10E4E5 erkennung7
913,005,984 *5F0C784A3F10D6556AE508D10823C2079A9187B9 dpgbaa
913,005,985 *5F01A2894EE04BC2677F036A113CDE6E206EB88D ESTIVILL
913,005,986 *5F087F832B1A1828C50120F9ADE32D9A3B814B6E ETINIKRA3
913,005,987 *5F01A144AB584F3CF66006667749B0F1355071ED DQIKQ
913,005,988 *5F0B8DB56C1C4D30EF24DE7147A5E3EEDE534024 EUGENENAVRATIL
913,005,989 *5F0A1C23532F8CA2F4D370541BF03B6FC8B21F45 EUROPATENTPROTEST
913,005,990 *5F057BA91759C49C8E93CF4917D48091612DD5C5 DREUE
913,005,991 *5F026E3108BCB719842411A3BC23F8C43E1D3814 exservicemans
913,005,992 *5F07A2E59C8E874D8CEDFF8FD9094A7E63A5C582 DTCOALIST.ROWS.COUNT
913,005,993 *5F0B81680DBE91F768CF5EC367384345ED806F49 F74100
913,005,994 *5F04C6169A64688A77B924C0018374B625C0AA06 dtpw;
913,005,995 *5F0EA30C7F8D54866F3FC11B80A8A8345BF78B09 DUNCAN.BOESPFLUG
913,005,996 *5F08C1E5C950385955C154653919AB968EA10031 [email protected]
913,005,997 *5F0F8D62951BC4414820C708E6FBEFC74CED68F9 DUSLJ
913,005,998 *5F047BC42B06D3B31E48A4CDC360F437A0767F10 FAWSLEY
913,005,999 *5F0119C8971D485FF176173C83FF5BC0290B7144 FCHUUNGA
913,006,000 *5F0CF6421573C16EE689A5023961FE07E8B0D8D1 [email protected]
913,006,001 *5F028730FB9512441A6C5AF20415FB7C6BE9550A featurespecific
913,006,002 *5F0A2AF23ED9B9518E488D3AE0B16942BD5CC250 DYSLEXIC4
913,006,003 *5F06D82781FE75D34D1182CA05E62ADE67222934 dzv:
913,006,004 *5F08106A3AE16023401D08F37A85D7BEA8FEFD14 ear$"
913,006,005 *5F020A69FD9C4BBDDDC0CD26F44365891B31DBB1 EBKOSTEN
913,006,006 *5F05542011B89393035F08EC95AA2D75204F4B87 FLOWMANOSTAT6
913,006,007 *5F0819CB3906352C10DA2BBD970621FD28FD962D ECHAISEN1
913,006,008 *5F0862712153C33601287132F07AF8ED96077101 ECHERUIYOT
913,006,009 *5F049E47379473306E63229693425EE7B62A2A81 F.OFF.FING.FER
913,006,010 *5F0A0A08DF77F1B087887F0F2033AC36D7CFEBAF eddieunzueta
913,006,011 *5F0357196499B3E68F4203AB85DE5DA571D3A3E4 EDUARDOHARTT
913,006,012 *5F0171E89D0664949408D3C1507AA3D853647015 [email protected]
913,006,013 *5F0D53FBDE2F78241496114E10962681D3B11845 FRANKLYNJESCHON
913,006,014 *5F096D297893C635EE0ED3E5F6A368B5982E2FEC E}-F
913,006,015 *5F019A4115AC8E5791EA7869769BEAF702FC356B FREDRICKKROMMES
913,006,016 *5F052E54B15C98E45CA9B6DE329784535C21B68C freedom has a scent, like the top of a new born baby’s head
913,006,017 *5F09481FB8CFD9ECC6A5FC75A4119FA5CF41DCB5 eh4g
913,006,018 *5F0ED1F6B6B8A5486C07C33D0DFD2E92A0AF159A EI)LB
913,006,019 *5F02A0E81A1F3B00D3EF3104096DF7C06C3F4F95 [email protected]
913,006,020 *5F0EC1E0413A6A678F3CB6C88D6BDBA4CF0CB202 ELBERT.MIHOR
913,006,021 *5F0FAD99A31BDEF6DFF893766378AC8D6D050D04 FUNDACAO.FACULDADE.FEDERAL.DE.CIENCIAS.M
913,006,022 *5F0B6DD04B1992E8D37F306BA4484722DB7D3D21 fvnd
913,006,023 *5F06B3626F28DD5B8144DA16D07CE71D23AF7220 [email protected]
913,006,024 *5F09FDBA063E0C554B62A0D736E2AC7A46FCD65F FYZIOLOGICK
913,006,025 *5F03D4200A796C547591A6BB6224EAE8829F51BF ELIAS.MINNEHAN
913,006,026 *5F001A97DAA5F7118A474A90C0F8E7B021B1DE7B elikvek
913,006,027 *5F0749118AD40201C4788C4AE51517B570627BFF GABRIELHERRIGES
913,006,028 *5F0DB363D997DDE718CFF9EBB754F70D268BE67A gaedwards
913,006,029 *5F073320C580E088B46E222E548DD02E6206CC98 GALE.BENECKE
913,006,030 *5F00EEDC3DA8197AFE0F707DD53C3C94D60AC6BB galenai
913,006,031 *5F02E2FDB57A90DCE834D2491FA179AAF3F80E91 GARFIELDLARDIN
913,006,032 *5F0F0052BAEDF87D57D312E373B4E876221EC581 GASTONMCCONNAL
913,006,033 *5F0A8FD2615D2D8627A11DBBE7E818E785C231D1 gatila
913,006,034 *5F08868BFCFC2D13A5CECEC51DC8B73766DE65E6 EMERY.HARKIN
913,006,035 *5F06332BB72ED459914188498970CAF57F33A650 GCARGNELUTTI
913,006,036 *5F04F5340FD327EDAC097EF5B017A814C93D4D2B [email protected]
913,006,037 *5F0339CEB2210580CAD9FFE7C37ABBAF6D9BEF71 ENGLAND-EURO
913,006,038 *5F038C7BE2A9821668E0153A61346A7C39754B65 ENOMONY5
913,006,039 *5F007564F5AEA22DF28E1941B769238F1EA3CDB2 GEWICHTHEBEZENTRUM
913,006,040 *5F043E42034952929A7EA0FD23DCB17F6DDC7B32 [email protected]
913,006,041 *5F039853BD0623D3650CFB1C2D864AE8B3355F5C ernesto.cordoba.campos.corregimiento.de.panama
913,006,042 *5F021983942CDB8F0B70D6E3DC4E84BDCC875BA3 eroticaed8
913,006,043 *5F0A33B71A90BC990478F24AEA2E8F3A079F0596 GLENWARFORD
913,006,044 *5F0C5E2C6556ABEC212063036488A97C39DECA2C ERVIN.CAMPAU
913,006,045 *5F07A7DA96B1B788B4578E3C7173001282A6381C ES4BL
913,006,046 *5F0986EE72151C13E1FE9ED21C61983B88C65C9A [email protected]
913,006,047 *5F081C10092D6DC1BB15CCEFEAC5551E35069E81 golgham
913,006,048 *5F0AC5DFFB73E7631CC55997D418F328666313D6 etazzire4
913,006,049 *5F0C4A827588F4EECF37E6FD8C6842D4380ED640 GORDON.HUDON
913,006,050 *5F020806F6951C9D44F290D018D710780CF47078 GOURETE0
913,006,051 *5F0532D260695F16D8DB38A2CD9E2335CD8F6A6D grassplot1
913,006,052 *5F09AE01FB6A8FFD51F1C85468BE88D674A6CF47 GREGGMADA
913,006,053 *5F0D3A2AFC555F4AC936FB0EA987B82DBE7019BE evacuon7
913,006,054 *5F0A739506EC31E29B6D6CF7F71E41BB93E49855 EVERETT.SCHWARTZER
913,006,055 *5F01FE8B2D7923EF31C392C0A556FBF64EFE76F8 [email protected]
913,006,056 *5F0CF2E864FE0AAD40624250134D9A0FAEEAEAFB EXASPERATE3
913,006,057 *5F0880E6F2B7A53E4B422B788C63FF92220F565B [email protected]
913,006,058 *5F05CFC601E39535C33A51858784D459CFBE68E1 ey!cd
913,006,059 *5F0A420FFB27164BAEE9216512F04BA85C7A8862 EZRA.BONAVENTURE
913,006,060 *5F0A376E7D1C2F82614C0EFC1CE9A3C734851AFC [email protected]
913,006,061 *5F06A85453A1CE74C2D162E09D87327DF56A6914 gzfrxqugldje
913,006,062 *5F020F96A8937AFD3840AAB6AF71313287CA11CF [email protected]
913,006,063 *5F033150895F1C8260DE8D98C7914BA3F4D4BD5A HARRIMANN:
913,006,064 *5F086A777D4F107B853CCD660BF041D6E6BBD6B7 HARVEY.BARTOLO
913,006,065 *5F00A70CC6E99F07B9E8C2A560EFACC388D5F615 HASANJOY
913,006,066 *5F0AAEBAE8AD7F907D37E6ECE038B5BC19EF5C95 HATAROZO6
913,006,067 *5F04DB3F25212184282ED7F7B80048EB80F646F5 [email protected]
913,006,068 *5F020DC7F26E06C08B54D7CE186A14F2515D81DC HDGMKNG5
913,006,069 *5F040B8DD8BD272FF118F8BD3F5749BA0A9972CE HEIDI LANGSTON
913,006,070 *5F0DC8D5680F588F1C7AFA5846707112B7604553 HENPET:195659
913,006,071 *5F05168E9874D373CC4EEEEDEE5A6CC086154FCD FLASHED MADE.SUDDEN.BRIGHT.LIGHT
913,006,072 *5F0901CD3430C7C2600C08C763B030315FC0CB87 FNARF123
913,006,073 *5F0C75EDF965EF01296679E761942E92E705C175 FO4221121512
913,006,074 *5F05BD0C24AA5DADE61113BB8F451F2169D385D4 FOG 414RM
913,006,075 *5F0606B5358A8561426B21C179803C2B2B52E754 FŐNEMESSÉGNEK
913,006,076 *5F0552CBE099B37766FB8A0376CF2C5B8F214B59 hieiks
913,006,077 *5F0FFBCDEAB5320B4E6EC2F79D3C36CE03603245 FORB3NING
913,006,078 *5F02C65C354E7E353CDB7E9F8311309066A7BDE1 FORMDON2
913,006,079 *5F07CF51F498024043EF0A0E27A3F95FC659CA29 HINEINGELASSEN?
913,006,080 *5F03D486E5FF064CAB5797C597E0EF777A281DE5 «HIPPYCHICK»
913,006,081 *5F052A2256E5F1279225AD3F0165D6A11E9C9851 fr1ng1e$t
913,006,082 *5F01FF1E20AFD8D8049401207B9EA0B531CF75E8 FREDDYFESTA
913,006,083 *5F020DF8E2CED9C73EFEB8C9443AC6CA4E139994 homerbohmer
913,006,084 *5F0331DE53171A244596A1C0CE5DC59C202D1BB4 fubbickfubbick
913,006,085 *5F0A13B5389AF016ACDD1A855F9E30E8D2619522 FUNIS7
913,006,086 *5F01BDA86BF2D42FB459B3AAC0DF9DFAF9AD52F8 GANDUMREZE
913,006,087 *5F0D69BDA2B5B852A6F724612A39F9ACC86D25DC HUNTERISAAK
913,006,088 *5F0DA4B7B45EB87BC830B164643B0ADF690A1279 garthkrabel
913,006,089 *5F020F897A4F0B46DEF3245D110267B8FB88BEBC GARTHLANGTON
913,006,090 *5F05B98B2DC4FBC40C6F87B8CBC6A0EFE4BD2EDE [email protected]
913,006,091 *5F0949D6737562CE2BA410366333645DFF267FD4 GAVINCASSETTE
913,006,092 *5F06ADD5526CDAC66B8B747B92ABE8525F9A881D HYDROFILA
913,006,093 *5F08E3152B7DB2993FD8825AFF5D9D8265AE6808 GAYLORD.BARABIN
913,006,094 *5F03C526FA9E37593D75CF2BE2F226D33EC10817 I161265
913,006,095 *5F02A09BACE0E788DD66A0E4EA460D2627248020 IAGC
913,006,096 *5F05D3921B9D795D8B1B1C8638671642553D9C6F GEOFFREYABLE
913,006,097 *5F0D1F9659088D3D530B1CE01E7FE43B49A5A532 GEOFFREYIOSSA
913,006,098 *5F0250C10E8BBB4C58476A5616BE466C319F508F iamsampson93
913,006,099 *5F090D01D3AAC094E475F25F36446C70CEA686DC IGNACIOLEAK
913,006,100 *5F0EB9999579B14DE255C5B6B366BF26F4AE7BCA gin
913,006,101 *5F0A63489F33398B2F9E7FC52EBFDDB06B35A6FF GLEN.MCDONAL
913,006,102 *5F08B29FC9698236BAA4AE8359DA98565563CBF1 glenneifler
913,006,103 *5F0CC51C95C43B196246E19D8978C665708D7051 IMAGEK-21SVG
913,006,104 *5F0C70337EB3A1DC0E6561512B69CBEF4B293292 gongbeac2
913,006,105 *5F0D8B8D3342881A55DFD72D9D95E39208ACF222 [email protected]
913,006,106 *5F07DF71B2A7CAD2D93F6DA1C9ACD76D66DD7662 GORDONSYDNEY
913,006,107 *5F0239531BB1C58D0D5ABBFC891A48FE122776C4 GQ+G
913,006,108 *5F01C6CB5F0BA1FAE8CB713ED81512A3B6F3BC20 inngiftes
913,006,109 *5F0412EA15316115895653AC5497E1FEFE7F6ED5 GS-TUNING
913,006,110 *5F0638050FDE65078ACABBC7D238767D3BC38D98 [email protected]
913,006,111 *5F0097B78C21209FC781C45D5A25EC70B8CD7A73 GUEVARATALKCHOLA
913,006,112 *5F0502731E0FE055498F7C299E15A9B6FE99E3C5 [email protected]
913,006,113 *5F092EE3FCCB49D16695FA8995BD375BAF006DD2 GYASZBOGARAK
913,006,114 *5F02B733004E32EC24EC9F9A8320446D80EB04E0 GYN)
913,006,115 *5F0828A216CCBEA14AF50DC0CE4ADF825E0E3537 [email protected]
913,006,116 *5F01792DC5B8F04CC611DAA24419B4E6B50F284A hack-a-trip.--hackers-of-america.---high-mountain
913,006,117 *5F0B37C3482C597A14C81E86BA0F265242E1E6AB HASAN.TURGUT
913,006,118 *5F09E3BAD775114670D40FD561B9E98E3C6416C4 'HCBAA
913,006,119 *5F01F30D0B2739B28B4E913B87F805BF899F52CF jarodborner
913,006,120 *5F0AD2B8E0795AA29AD3EE06F32C9F2297B2DB5F HERIBERTOGRUBMAN
913,006,121 *5F02A15E64DA7DEFBCC67CBAD3EBE4D7BA6054A6 [email protected]
913,006,122 *5F02E25B20AB9AE1D7E05ED9E8DF29EB18226288 HETZDORF–EPPENDORF–GROßWALTERSDORF
913,006,123 *5F0CCA96F1E67678AC9AA9578BD96F51A97B9C46 JCHEMY
913,006,124 *5F031435E4551D60943A050727A36C983C8C3AF2 J'!D
913,006,125 *5F03E160E46492C848978C9B248DB85D09FC48DB JEFFHEELAN
913,006,126 *5F05552D641699F66A530C3C0A26BC08E63087C3 jeffreylloyd
913,006,127 *5F0C6FA7FFCAE77F240CF3C6DD60457A2C09D7A1 HLEXIZ
913,006,128 *5F048B566B715B958E9F0A8DC9C389D7DC83D031 JEROLDDALLEN
913,006,129 *5F058D116584AD99633E10D786420251599D8E76 HMI|
913,006,130 *5F006D3A0DB951CB69F36D9FDE366F01DD8A43E8 HOMOLOGICALLY ,H/OU/M/@/'L/A//DZ//I/K/@/LL/I/
913,006,131 *5F0895C4A83E197DA79EC2AA15B5D8C948AF4864 [email protected]
913,006,132 *5F01460F5F3BDF1EDB127C50316BF10681122887 jho.galang
913,006,133 *5F0F926CCB82E54D98D5ED11CDABFFED3719F6F0 JIGS: BROTHER JOHN / THE PAVEE JIG
913,006,134 *5F09C2C36D24231AEF7FF6E708965BF5986C8B56 hoyttaheri
913,006,135 *5F0FEFB943C0D03B737EF5EC60954A4DE752CD49 Htbaa
913,006,136 *5F001004C3CEA1679E966AE559CD87A6A5867145 jodyshely
913,006,137 *5F0C838ADFAA30B16F4E966174D82452940584C3 joe.fellion
913,006,138 *5F07E86E854F23B6F094B8BB775939B331971936 JOEMANCILL
913,006,139 *5F058D8ECCBCC8D98116E25C6B1159698308909F HUËLL
913,006,140 *5F0EC34EB7B7EE73EF34A906EE00A8744BB799B2 [email protected]
913,006,141 *5F042D4E0531B0BF8A7BAF6A54F63064F7AC1F11 johnailey
913,006,142 *5F0C1A1774DB061211DD5E30099CAEE396946DEB johniehurn
913,006,143 *5F092EA4097B7E01FF3C7FBFBD53D1AD1B9A3016 JOHNLESEMANN
913,006,144 *5F04241751AE97E7C95FD7D1DEDB6426B081716B jonah'slastday
913,006,145 *5F0BEE12308FEA10A888EB95BC901AEF0BE224E9 jonathonsiddiqui
913,006,146 *5F0117706FCF8C01B7378998D472E30586527EBC hymna osady bobr
913,006,147 *5F063815D13903F20E27C0CFFE0A25AD9236E58C i2ne
913,006,148 *5F07B5598625BBB40793A5810F7FE29962683F79 i-acoma
913,006,149 *5F0FF5B9ED4C3C3192A024D8F19296C8395F7A31 IARENIUQING
913,006,150 *5F0B0A3156A16C3237D99CF6C1FF82BAC73882B5 IFANGASAN
913,006,151 *5F018DA2922294D8DA4916884ABED9A1BDAF6985 JULIO.DORSON
913,006,152 *5F02F5B0ED3126F1C6557EF1D086A8CADCCAE03C JUSTINTIMBERLAKEINPARISCORE(FEAT.MOCHIPET)
913,006,153 *5F03D9D195F3D5A904FD9678236F75E542309DEB [email protected]
913,006,154 *5F041B1C98D8F633324DEB586CCD770C1238B6D5 ILOVESUMUINEN07
913,006,155 *5F01B14F07388511BA2BE5BBFF27623BC0332F6E KENANDLAR
913,006,156 *5F01C36CD13495DD050CFB809FF8EC5E94D145C6 kenethmatkowsky
913,006,157 *5F0C1BCDD02061B44707256454CAC650297E0527 INHOCKENING
913,006,158 *5F041C92FDB78DBE56BACB164417DC454A66DDB8 INSENSIBILISAIENT6
913,006,159 *5F0894FD2607F0D4BCE16471681492193DBAB79B [email protected]
913,006,160 *5F0410196037E2C488989652F345265597A150C6 INTRUDRE7
913,006,161 *5F0CC9E1A85434354B256F8BD57377105274A80E Ir0nclen
913,006,162 *5F03EC31E10BFA8DA2D9AB549DB123B86BDADA1E IRONHILA
913,006,163 *5F04F175E0A46EED0B446422122125A6A59BBB28 KIMBERLEY BROUWER
913,006,164 *5F03317F692C9EAB0795506E26324067044D567F KIMSAFRIT
913,006,165 *5F029CBB8A9BAF4844DFFEF83AFB5C212BC4F898 irwingatchel
913,006,166 *5F0552128BAD7915DBFF352A9A2E1EF036F76CB1 KÎSELKÊME
913,006,167 *5F091A40356EFB227E7E6DBFF1526693C158BC35 ISOGONIOST
913,006,168 *5F064ABD897A6A4C2F739C33F28CA0F245D0543A KITITHEERAKUL
913,006,169 *5F0225FE5DB13B1280FD1D25BE95715B17380505 ISRAEL1234567
913,006,170 *5F0C8E7C96B26DAAB0A7A2D1B800FDE1CB80475D [email protected]
913,006,171 *5F07988078544493DE9CE1B0557B7E8755765D9B IŠŠOVIMU
913,006,172 *5F09583CA83D4844792ED6EDE2F6D5FDAD88560A ISYVQSJFK1
913,006,173 *5F0788C3F124F03FE5CBC0606D90C12F4E8D8FA7 ISZTITINA
913,006,174 *5F012DFF96DB80DB1D1B778F317F58BE5612C7CC IT'S THE MOST WONDERFUL TIME OF THE YEAR (A SHRIFT REMIX)
913,006,175 *5F00D1CCD3DA80E379F1C5FEBCDA531FA329DC4B [email protected]
913,006,176 *5F0D42D1E13EA652FB1EA4BD34756B8A70B70036 I^Z
913,006,177 *5F0B590D4027FD7C3BE0AB04C5960ED890739168 KO423
913,006,178 *5F05CCB60D6E196C8166C241D23746C26A3272AB j1・j2共通
913,006,179 *5F004A3512F93F997ACCE6FAAD0C24D146271EDB jacksongeddings
913,006,180 *5F040CBFD0C088E1C5D1C8A89E71F235F7D65D85 JACOB.DARAKJY
913,006,181 *5F0C28CC0F30D476FE45933123A51EBEC826B3AC jaimewaggy
913,006,182 *5F0855DD07ED582E9BABEC376CDA4730A96EF878 jakaroe0
913,006,183 *5F0408B4EF18D8BC02827352EBADD33EFAFE7B40 ksccary
913,006,184 *5F02CB518D1697669A959F4B74661E1C9E9B3B42 JAVIERARNOLDI
913,006,185 *5F08C0F5FCCDCB61A3D2258D0937E4743BE3758B L39!5LA7R355
913,006,186 *5F0043895102AE64BA07DAB0CB942543F702FFA9 LA-FAMILLE-MUSICIENNE
913,006,187 *5F02BCBE1DC433D2FA59AA770B2CACD92F1BA137 JENNIFERDEASY
913,006,188 *5F08952F8A56BA4E862A007F8F2F856EF9A80EFF JENRUAX
913,006,189 *5F099F2B04121B3B8C25348D92A977215B0DC103 JEOBANYF
913,006,190 *5F088CD5B8049E432507C51494C9790AFCC263D8 JEREMYSIEBOLD
913,006,191 *5F0A27E0B70252F9BA0F37C00DEA6D45DC3163BF LANDESSTEG
913,006,192 *5F09AA6780502189917DDA08D98525C4C3F95808 [email protected]
913,006,193 *5F060D6B7C938AEBB1E76227228416CB3E9C6210 LASERSTARTREK
913,006,194 *5F0A4304780B62AFE30073E46ACBE4A69A685431 le0nine.c
913,006,195 *5F009BC942FE216B231AA3091CEC0BAF32EE3F47 JHONATAN-GUERRERO
913,006,196 *5F0B809AFB37F1798953571417F01A64B1AFA579 [email protected]
913,006,197 *5F0A18CD5C9D8FEA5E725D9313E534D16DA6CE6B jimmyvieu
913,006,198 *5F0CBF85CAD25CF9BB38766B2C1174508ABA6988 [email protected]
913,006,199 *5F0183CD758E7B5B36018F5E51D551F67BF4BF54 lesleyharsh
913,006,200 *5F0433C59CF394CA2B2E810A395E247807861815 JODYVAILEA
913,006,201 *5F0DCF1F559302D3B9D08AF652191441CE8CDC36 [email protected]
913,006,202 *5F0BF8FAC60F16108D601DE93FFDA5774A74AFD4 JOESPHRIIS
913,006,203 *5F0CA3F3228A0B462E8D9861E0A13F8C281A7832 LETLEY123
913,006,204 *5F0329D29B77103A14DB128329B9E47E2B6D54F6 JOHNCWESTCRUSADINGSOUTHCAROLINAGOVERNORDIESAT
913,006,205 *5F0CD959029378A4095F5EE6B0D1011BC15D79BF JONATHONPIRRONE
913,006,206 *5F0858CE65FB6BCD212B37B166456633C1E94278 JONPULVERMACHER
913,006,207 *5F0B8333D77F39A28FB111E45049038B2ECCACD5 joseacebedo
913,006,208 *5F04860B5849CF22092B522F3F844E7F591A28E9 JOSHUASHEAFFER
913,006,209 *5F072FA43FF4D06C641D2B67E673E65E04965394 [email protected]
913,006,210 *5F02B75493FB5F12D2A73AC888895BF193218434 JULIE.PARKEN
913,006,211 *5F00E06D5EFF8FEFA6397CAC7A9709173BA9BB92 LOGANHURSE
913,006,212 *5F0B4A61D25406417A9602BC6870C62CA07F689B juliushull
913,006,213 *5F009898D8E1092BA699B9BF289486C9F343EB30 JUNE LODGE
913,006,214 *5F0BDBBFAEBADED4D39E874C0470DED751B72C4F LORENHUSKEY
913,006,215 *5F08901D24AC6B1B5572A514A65CEFB8DC42A571 los-siete-inmortales
913,006,216 *5F021C22020BA32FD38EE99F4194842848D43609 lostbabyblues
913,006,217 *5F04173CC3386B7F49C6B151C40E5524CD2821AD [email protected]
913,006,218 *5F0AF20648C8AE8E69146689BBB2ADD3A92ED07B lt.Mich.Hier
913,006,219 *5F0B5C2BA9E5F2680627F5A7488B33803070A1B1 [email protected]
913,006,220 *5F08FC29A3DCD412899E8201D37A96760DF9DD43 Kanizsa-Csillagai
913,006,221 *5F0719ED867D8C5B259BBB6D31156468D38C4156 LUCIO.NEES
913,006,222 *5F0EF0E39348B36EDEFDAA8884DFAEDB34A52B79 luckykayla
913,006,223 *5F0E9B3791DD9255E2740CBAEE8E53ABB04D1068 luigifurlotte
913,006,224 *5F0B3F8CE6CE68E64B2E53475C5FD8DBB9EAC7A9 [email protected]
913,006,225 *5F0EAB3470732CDFE770D7F359734B170328084E [email protected]
913,006,226 *5F0029716438B96D607F928B2C1B20AED7E1F280 kenethfuster
913,006,227 *5F09EC93DFBDD7CF3A0A14850CBDB09F00655483 KENNETH.HESFORD
913,006,228 *5F08840E83CF95C2C72D59F4054350D3155D8CC9 KENTWIND
913,006,229 *5F0A3B176E4BA9F8EDBB47EFF9B6628130312FB9 M37ROPO1174N1Z3D
913,006,230 *5F070D554C19D09DF9162628CD993192AAFD862C KIKIGURL718
913,006,231 *5F0E0B3BE60F9E8E067518E317F0079E49FF7CD5 MAK3773113
913,006,232 *5F03F32456210FD0C6191647CDF7824978A07C0B MALCOMFELL
913,006,233 *5F0BD7BD157333A1278F23E9A6FB939B13F39F40 MALIK.HUSKIN
913,006,234 *5F0160A93089CB0DDAE2E3AF035248734385C4F7 malthusiennes5
913,006,235 *5F0EC861371A4D6B1039A7B7FBB5255C5DA34146 kmrfrcts6
913,006,236 *5F08D8C6956449D1B8595980516CE7E0C20DA719 [email protected]
913,006,237 *5F00B4507B2D4941E3B0102929C1EEF37D63A518 [email protected]
913,006,238 *5F000D4F743A55D4707C6C54D36D71574E1F4842 KONFLIKTBEREINIGUNGSMITTEL
913,006,239 *5F09B039F855E7C893B96797B5E1B8A04001546B MARIA.BYANT
913,006,240 *5F0DC1B19DE823AEB4FF96DDB49798ABF7F50E2F marianosons
913,006,241 *5F0B647D638FD16132F787CEFFB722E84614693F MARLINDUH
913,006,242 *5F0ABF72B8D4A3C508DE3226754D2BA174300ACB KRISTA-PARR
913,006,243 *5F01D18A259CE14611FD9EB49614E7149D34E6E9 KRISTOFER.GOTH
913,006,244 *5F083121B12603C59686DBA18B6A7544208065CB MARTINE-GILBERT
913,006,245 *5F05E76E9584B1D712C3625DAC5CFF86BA543DAA KUNSAAVUTUUDELLEEN
913,006,246 *5F0A823CA48762B2F9D26827736C268AA04EF390 matthewtrevithick
913,006,247 *5F02D4B87212CDDE4F7E106202E02B2B3F7D6154 MAXSCHWULST
913,006,248 *5F081D5A1BF0C4FC95520D6DEE534811FB08470D kyle-pheasant
913,006,249 *5F0A53AE46016281C32C8460A9BB528757D61B2B MDAMBACHER
913,006,250 *5F04135A09BEB1D1E4288325C58AEF05A9D29F54 MEET-THE-WINDOWS:-COMPLETE-WORKS-(1972-73)
913,006,251 *5F03FAB72C6FD130B5A07D8AB5E0DACD04B0EA35 LAMONT.HERDA
913,006,252 *5F02CA9994989AE4D585046ACF8D3039A8AF6BDA landsmdet
913,006,253 *5F0F30A9A0F55020C88417B336075EEE2A5A68ED merseyn9
913,006,254 *5F0D47BF626C8FD8893D663F1F820624D4857BAE LAUREN.FISK
913,006,255 *5F07FEBAD9AEEB8624D6735CF1DED09257C52CF1 lazarobielby
913,006,256 *5F0FEF38327AA6A59F70FC22E01BF680465954DA MICHAELRYANG
913,006,257 *5F0B3BCDAC3846BF2931A6D0EDADDD244975F4C5 MICHAEL-VAPORIS
913,006,258 *5F0CBD3240AD9E7E31D864B7F2585EA4D8A579B2 MICHALSWIRES
913,006,259 *5F067446826B522A0A96FDC6F18A4780E0963FC4 [email protected]
913,006,260 *5F07D8AD33F587854A5658E80CF6D05E9CC83D22 LEGITIMATEMUSCOVITE
913,006,261 *5F0B6B6C4043B54485966ECF0EC7075377A80AFE [email protected]
913,006,262 *5F050D647F95A7B145625FFD5FB432A1D905E61A LE SACRE DU PRINTEMPS, PART II (LE SACRIFICE): I. INTRODUCTION
913,006,263 *5F02DF74A1BE8C1A82959A01FFE2577B2DE1262B LES.BOHON
913,006,264 *5F014C36187DFD382791392D5172CB3EE8C8C911 LESLEYBLANCHARD
913,006,265 *5F0937065EC8CA7291BA7D80196889CAB4852460 misspimpette929
913,006,266 *5F0057E827280D002F2B8204E7871A89A0C44DB4 MJÖLKBUD
913,006,267 *5F050F9C961C49A7B8E357C2CBB705453B744652 MK~!~!
913,006,268 *5F07BE68B867E93F0CC5359914F34E6EBFDE4BDB limnobios7
913,006,269 *5F0EC6BA977F8FC89FF11E1EAEAF9C90A6EAC6AF LISA LELE
913,006,270 *5F02FC3496418B3B8CBC7935502D1F6A30A775F8 MONTY.HANNERS
913,006,271 *5F092E38BD710B09C271C27F550493C6BCA85270 MORGAN.SIMAR
913,006,272 *5F00B272618A244662DD801DF4577E64A1F0D7A3 morganwaltmon
913,006,273 *5F09E1F1BD0C01C12F7F0641190C210F2A00C306 mortondelisa
913,006,274 *5F0D16A6ED672850A87E2F087686F41261B50D2A MOSE.KAWELO
913,006,275 *5F0548E54DA9CBDFF22D29A444739654FC71712E LMMLCHTG
913,006,276 *5F054617BCBF92575CD17B3B7720B8AAA24C7148 LORENZOPAVY
913,006,277 *5F067F3DE688AD683B01FC4D85F83A7B8CF801CE mufinella
913,006,278 *5F0EB23844D57C542D0F189A6451404E3415E7DC MUTTIRE
913,006,279 *5F0D3D8327476911B7597695A88114AD1BA1F130 mypeterpan11
913,006,280 *5F031E7B1E047DA157E2E27CE49424E01E59A428 LUIGI.KLEGIN
913,006,281 *5F077B2E8E7F636CE1871CC9C9E302400F8C6636 MYVOYAGER36
913,006,282 *5F0155435F7D3371479BC15AC2D8995E83D8392B l'uraniumthorium
913,006,283 *5F04F192DF613F48BAB7297A368BA59F16A963B5 lutherelg
913,006,284 *5F050310EAF1A412E790D62B791EA718B0792727 nacilpmi5
913,006,285 *5F07F5E0E526A670E44C10FD75AF6835C6566A00 natemullen
913,006,286 *5F07974133CD984437CA0013DE3F45177D0929CC NATIVENEARNATIVE
913,006,287 *5F0EB9FD8555D2EB8552CF2D60AFB28F1417B35E natsumiinaba
913,006,288 *5F07AD4A6F7BC3DFDCE07C62625741C65383651A NENORMATÍVNYCH
913,006,289 *5F09E16784E5790D74BFEA37CE8B0055A0D615F9 MALK OMRY
913,006,290 *5F076B7F234D16F444CDC6D571423025C0DDB56C MANAGERSPOLAND
913,006,291 *5F066AB1AC628084AA75DE79A554F07FD6347E14 NESTORHOUSAND
913,006,292 *5F00E666DA5679B41A8D7F03846B571DE7CF5F61 neurofun.(neurotic.dub)
913,006,293 *5F06FAAF33D7651F68925C8F9D17F158E0576DE4 MARCELLUS.RAMSON
913,006,294 *5F09F705D3B15EFB259FD93EF5CA71F732B3E189 NICHOLAS.DAUBNEY
913,006,295 *5F096D98E80FD6DABE95D1FBC0EC54C8960C6FCE mariongie
913,006,296 *5F0043FECEFA2B90D9C83BBE3E2C0CC6551EF10A MARLON.OFFORD
913,006,297 *5F0E9910865690F12089D714D05665477ECD744B MARYRANES
913,006,298 *5F03FC5FB3797C0A386AF22E76FB32EF1EFB8644 NNSBBTC3
913,006,299 *5F05B948D7CBC21B96833CE06B49892F74C6B62D noitatnemucod tset 3433
913,006,300 *5F0F720FE9E4DFFD7B5A21068BD5E24697A758C6 noitesdever
913,006,301 *5F0AB44E5B1BE9D7D33D9564DE6BFA55302CACFA MAXIMOPOLIAN
913,006,302 *5F0DB76010726EC6DC6CB2160CE92C90AA2909FC no no's
913,006,303 *5F0348DC95C3082A4A90B0199C322321EE4A8F95 NORBERTSCONTRAS
913,006,304 *5F053F2EFA993F166356016315F923CC5BD7A749 MCQUILLA4
913,006,305 *5F012164358F38F6BC1E5B87FD59AD992BEAE277 MDAAEU
913,006,306 *5F0B9DB37F9CB58253F9664C5AFE53809FBD5B79 meaganarmstrong
913,006,307 *5F0765F60F26D27D2A93605BA5628411280D9AE7 NUNHAN
913,006,308 *5F0E8A2E54D1E44ACD522F6BA3C056EBEA255527 melodie-und-rhythmus
913,006,309 *5F04ECA42893D196056D5A0178F33742AC5129CA menisci
913,006,310 *5F08C39145A739DD4AB82970A24E89AA4826FB9F OI3951760
913,006,311 *5F0DA5AB9E440DD76E225EF1DB3560F5643CD76F microwarrior
913,006,312 *5F0B54BF773D2F8C4D323DC585C66B536BD64F4A MIKEL.KINNETT
913,006,313 *5F055AAE715BA71C334FA9A20F72FB63FECA6767 onivla
913,006,314 *5F08D306C4CD1B0EB4BBF96B9F13AE2B4A08DF48 MILES.DEROSSETT
913,006,315 *5F024210F60CE2D0002EF8581AC9D16ABC67ACBC miles&nemo
913,006,316 *5F0712FA0A3310E538C7747261F9DBC3312A1CB8 MILLARD.STUDY
913,006,317 *5F00E82F75B931058D1FD28AF7EB37BC816EA1FC MILTON.NWABEKE
913,006,318 *5F019EC36109F57793A23837E481059EB9D41CBB ORGUEILLEUX
913,006,319 *5F03AA56EE420CD9BFDF5045C8E9D3355745C79B OTTOK
913,006,320 *5F06F8A0F9C6C40059F5B566F6D2BAC1E6932F84 OUTERSPAN.ID
913,006,321 *5F0C492066E6BA460F144924404C059AF43A99AD moiseshorstead
913,006,322 *5F022725E41EC4E419ABF548D4A3B38ECFF65F95 morozini
913,006,323 *5F0DD3E57B3D7EA649F77B351DFCBF6D4D442B95 myblessed72
913,006,324 *5F0F21C2C7BF7C6786AE918180E50ED4DA45D532 myronohearn
913,006,325 *5F0E2447396DCCF6A658F40AD48C09FA427D7958 n;4i
913,006,326 *5F09DF62F6492E16D5B319517946C28D97187C10 NAME.77
913,006,327 *5F072B332B0C567B1B012D40E823865D8AA38D39 NAMEGET9
913,006,328 *5F014B1F2101130CCD774A9163526C75385CCE96 NAMMIAK6
913,006,329 *5F0F8E63022AC5413918B4A406C59C8BDD05E2F9 pdprfd1
913,006,330 *5F0F2C20A241B7D484A5C49F654BC717CD34F90C perfume-v:-perfumed--perfuming--perfumes
913,006,331 *5F0137A0D322D2936F586CA5FCA1A50D66AFB3F0 nederlandlingvaj
913,006,332 *5F04EE8D386F3ADDF887EBA2F7622B9DD7BE93B9 NEKUEJ
913,006,333 *5F0EDCD40EAED6E3C10782588B89D69EABF32130 pharhao2786
913,006,334 *5F0D77CF5316E4F55AF68D279D108FADA04CC1EC PHILTREACEY
913,006,335 *5F0303D5D0663E5F1D260ABE17A176CC9380842C NF)<
913,006,336 *5F0F26F05A30C31FEB05026CC55C9D8832FEAFE5 n fierro
913,006,337 *5F0BC33F085E7CCE51B85D8FE3D25CE528B8695A nickydarden
913,006,338 *5F084880D6C9B04D7BD40D201A144801AFF67491 NICOLA.HAWTHORNE
913,006,339 *5F01C36058224E02F598254D267176113BE61BD3 pneumothoraxen7
913,006,340 *5F01B29A352A83656F4F2F1C4D21EF3F1BB7BE77 [email protected]
913,006,341 *5F0A2B488F2395CE3B1ADF9BA044B50134F9D79A not.drowning.waving
913,006,342 *5F095B586B371BB8B39C219D1CD131564819E2F5 p----p*.*)O(
913,006,343 *5F05427F808654A549575F23286BCF2B43377B53 p------p~o~o)o(
913,006,344 *5F0CD21FAF4C6A5C7533241006278368A65899D6 )O(.0~d####3
913,006,345 *5F07157A8EC4F056D349A35539AE249256EE6D96 O20014210
913,006,346 *5F06A078032CD6BFC4487BDAC814E1C63DE854F5 O->-< `<======B
913,006,347 *5F0D4D75F1564622A1752F283F1828098B19F0F4 OBSCURING3
913,006,348 *5F030057763B41789C71F2A2CE985CF15A7A477B OFELIA G.
913,006,349 *5F0F2239F78756773C0E1B0687E7B655DDF0DD27 PROIETTORE8
913,006,350 *5F0C48BF8F5D505012C998FE63470BE65FBA3D1E om3z
913,006,351 *5F0E1919E77F6F5559EDCAA43A58CBAA610C66B9 OMGOES
913,006,352 *5F027F3F00B536EA0A825A74B982C623AF7F3503 one-night-with-the-king
913,006,353 *5F05BC7A902C0D115A74822503990D30AD039F25 Purple-(Sasha-Remix)
913,006,354 *5F0EB95E54BFB2083CB4A08F99BA14073F1BDADD [on sex]' it all sounds so very messy
913,006,355 *5F0BBB6D0BFD63137523F70BA402C251F2B0D46F [email protected]
913,006,356 *5F0A794A7CD09A109272809FBAD357407F807410 [email protected]
913,006,357 *5F08DDBF4C99098AE9658AF400D2A04D483E8E39 P) * * *{X}
913,006,358 *5F0D7185E56F6D76A15A636559009E66685ADC87 q--->-~-~(0_<)
913,006,359 *5F0DD929FF8B8DD9592E9195D6F48B6DFE284D75 Q44KTK7GJS6HKAW08QH8
913,006,360 *5F03F5706B97BC7C820C392CCD1386016FD065B3 OSCARESCALERA
913,006,361 *5F0559E76533AB7AE3CD02FD9E90B333BC22D873 OSWALDO.TYACKE
913,006,362 *5F0BF15A48C93A062F95D0EBAB36FF9E65436536 Q{QQ
913,006,363 *5F08998171593A52E6D67E48B555DCA3675ADDA6 quincyfreiler
913,006,364 *5F0D412014EFE7B0CC9EDA5C9B9B898904DE7ADB OYKUOYSES
913,006,365 *5F0B076205A25089757862AF5DA4D551EF02495B [email protected]~0~o
913,006,366 *5F0F1FF6B9EF6968FEC49D48A075E2765E777627 P477ER$
913,006,367 *5F04AE92648305E13EB95650CE0D0D99542B35B0 padlocked,.padlocking,.padlocks
913,006,368 *5F01B27C5D6F86881D6A0B6E4412AACAC854574B RAHULWAIKAR
913,006,369 *5F07DAE8B96DA06C9D2DE2EA0127E813EB988B89 pakkotoisto
913,006,370 *5F0DFE373E2C42B74F70DEB941CD8EFF2A20BBA0 rakshita.dubey
913,006,371 *5F0398D7F529C7F3D8AD6AF97680D855C6B9215D RAPTORXKOBEK
913,006,372 *5F0918017CCF300F6E44B26679E2483C19D6CBA6 RASSUREZVOUS.MONSIEUR
913,006,373 *5F06466FAF07BC03D1E973FE49B89B7FA50F147D rayki
913,006,374 *5F03F3A84724E79E79B76B7A7590267852760F83 PATSYCARMICHAEL
913,006,375 *5F0BF0D87E92AB6ECAA8D2C965A7907213F0E305 REED.GALLEGOS
913,006,376 *5F0C2375ABA73FA488B6BA12709B48EDA202BA1A REFUGIO.GARTMAN
913,006,377 *5F0BF53CD3AC631A71551CD2310408723A52D0DA REG16H
913,006,378 *5F0C6E2EAC265789D9CFA8209ABF8E5FA1AD5609 [email protected]
913,006,379 *5F08038A7037D513D31EE5605E552D5EC304B24B REJOYSSEN9
913,006,380 *5F0D489803DB19F224A76B1BE87EE8131C94C374 [email protected]
913,006,381 *5F0CA8D49E251FEF83B4B1950638ED58EFD1387A REMAUDIRE
913,006,382 *5F091FEA8C3A0BB8BFED208D6D8B2E3474A4D80A RENALDORIOZ
913,006,383 *5F0CB6B091C1CA99929743C216F00471CE6ADC32 REQUEST-FOR-INFORMATION<P>
913,006,384 *5F059245EDC9713CBB554CB693C84A2A7E68216C PETERUŠEVSKI
913,006,385 *5F015BF9098255F948D13E25D04D2A6A0DB2FBC0 revard..r.ih0.v.aa1.r.d
913,006,386 *5F03167C36131044AC1065F8D4EB67AABD76483A [email protected]
913,006,387 *5F0C0C422D63098CC8EA966249CE87BA2051E536 PIFIA-(FEAT.-OSCAR-LARROCA)
913,006,388 *5F04832CFFF49F80AACCF295194643B8154C7A25 [email protected]
913,006,389 *5F05B44AA3A470595A00B5ABB6D3EAA8E4E42F6B PKGOALE
913,006,390 *5F0D15265F561DECA1A5DD4C3BE9513A5371171F PLSAINTPAULDEJARR
913,006,391 *5F026882C39001F2B7EA78132507B25031068E19 PNEUMOLOGY7
913,006,392 *5F0E84425878AA9C3E3677A7BD280AEFBBF39C6C ROBINJE0
913,006,393 *5F07A992724C66A2B39C51A83BA6BE12FC273B3D p)~O~o(0_<)
913,006,394 *5F065A1BB2A7C70B17A79ABE7CC6D653D9898F39 portho13
913,006,395 *5F093991FE2A6D0028C65EDFFFCFD366E80C6556 [email protected]
913,006,396 *5F06620702CA61B9906FBD9A583F8C555F915B86 p#####p~~(0-0)
913,006,397 *5F03CD7440251C4EB8A1EE6A9CFECBBB6DDB166E p===p~.~.~.>b0
913,006,398 *5F0CF0D601401A7B1C1AB1CB45DD9CEFDD7E436B [email protected]
913,006,399 *5F0BB4D0103C77D6E93D98960D0977357FC396E7 preendorse5
913,006,400 *5F0F0F6BAAC4955E5C8D0EFE84E8AC8EEC96A67F private-beach-vacation-forbeslife-cx
913,006,401 *5F02EA8BDEEB6DB79949152C5BB6F686AD54FE65 [email protected] ~ ` SPLAT
913,006,402 *5F0C30D75CB9017A0B34DE37A98327D5A022B935 rudolphnewyear
913,006,403 *5F00646E6494F592A7994EFA215FCB572A99FB2A Q--).~0.~O)0(
913,006,404 *5F0620D352E62BF7DBFC311CF30C619A8012BDC3 Q6A2K1J4HJYC
913,006,405 *5F0B1230CF2FE646EC8700EF1E4B7609A34A37B4 [email protected]
913,006,406 *5F011337485F279831C75EA509C42976CAC2EFB3 q##b~o~osplat
913,006,407 *5F0621C68B94EE077C765ABC0D38FEEBBB08EFC6 QIHELI
913,006,408 *5F0B8AA8D4FAABEEF1890BCBE79279C0BF7A6095 [email protected]
913,006,409 *5F0F26140B1521A0798EBC027F8C4781F8D3CC77 QUE HAR
913,006,410 *5F0823D0B36DC2D8D2EDD29DDE7A28B1A31E12C3 SAINTETIENNELESOR
913,006,411 *5F005A5411850C38FAC9FDC3F1CC9EAC02221E59 [email protected]
913,006,412 *5F04E97E6FE203D96184C42CB5E838EE5EF8BD89 salmian4
913,006,413 *5F01C532D93902FDB31160890CDCD09F4D7B39FC SALVATOREJONAK
913,006,414 *5F0C97E85035A50097CD1A7130ACBD0DC9F1EB68 SAMBAGROUND SOUND
913,006,415 *5F0D4BFA00A6AD3E2D3CDC1E2DE79C6670A84D1D RACHIT GOEL
913,006,416 *5F0D5831F979789293576A7D664D2F0D86DCAC6A santiagosarkin
913,006,417 *5F0FCE6DB8238C6B09B71977789CDABE6A2F2140 SANTO.STIEFEL
913,006,418 *5F059B693CDB591A209814919468CCDA30AA800E ramiroishii
913,006,419 *5F000FA302DA2C27CAD954744A1E0121BA7EC6E7 randalsavich
913,006,420 *5F094CADCE2C47FB044FEEDDF6213FDC821120C8 randylabarriere
913,006,421 *5F0DCAB957059A1338AD83D4B85C419662C3E7D9 RANG!N3SS
913,006,422 *5F0CA7D607CB6861403685D8FEF433B826F4AB40 RAULPRILL
913,006,423 *5F0A7267D13E8754F6FE2245077FA664C562FBAD SCHLRFTET4
913,006,424 *5F00282ADCCEA39805008C45099916C0C8E9A9CF REACTIONHAVEHAVE
913,006,425 *5F03E4E32734DE18D7A8EA85AFF1AB9056F40FC5 REBBEHSN0
913,006,426 *5F0FB9F9BE781E3EBD8F79D9703DE288568BF31C REGGIE.MAVAI
913,006,427 *5F002EC3ED1E84EEDDFF649594A3D196D1B17684 REGGIESNARR
913,006,428 *5F0CBA785EAE211E58CF083993F870B6C5A78680 SEGGIES6
913,006,429 *5F09E2D611065F5B37B48320112CF9F247DC5425 RENOUNCEMENTS9
913,006,430 *5F05199FBE72CE8211C074E788DD27AA60A124FD SENNES
913,006,431 *5F015B595D9443689AB5E2BA0221F06C214E725F REREIFICERE2
913,006,432 *5F0769C10A94BB8654BE7B8267C62FBB1363DDB1 reskurs6
913,006,433 *5F04C656409C29F53036D79FDE7B1E637728FEB2 seymourhammon
913,006,434 *5F041042D0C7C07B8C1216891EE58A4A2E04FB84 rfarelianta
913,006,435 *5F0762C010B8FB417B9401B1A04DF5428C62D34C RHETTWISINGER
913,006,436 *5F0F5F3232DCD4D6530AF82EF4A7FB52C548A74D shahla-jamal
913,006,437 *5F080A532EC36A0BF423151E1E9A5D179B5C39D9 SHAIKH NAUMAN
913,006,438 *5F0B427E2C8E8514FFF5CD90BCEE07BDD97953F2 riahbswing
913,006,439 *5F0D7E9AC04940945EAB3A036B4138AD15000791 SHANNON-MARIE-BAKER
913,006,440 *5F0BC16173534CD4B088E35D239D037C2359BFD3 shannonmcgahey
913,006,441 *5F013C1CDCF06305CE9193446912FF9E64DE2EF1 [email protected]
913,006,442 *5F0CA9D185BF4CC9E55E5F63D2788C1528188415 rickeyfaehnle
913,006,443 *5F0EE68A3B8E140C8DAB2E0EE3618620486A1C83 RICKHERMIE
913,006,444 *5F01F08690DED919D13377592ECE2DCB7DCD73E3 RICKIELOUCH
913,006,445 *5F0D8CD1A5D9901B0A2B61768221403108B07E06 RICKLUKER
913,006,446 *5F0D9FA406C416C025834CC26944A58244194024 RICKYLAFFITTE
913,006,447 *5F08AD80845C6FA07F9CC3DAE9EE607D89E7382F RITAAKROFI
913,006,448 *5F0D38DF154FBEA97B07DC5111051CF7E39B25DB RMONIKE
913,006,449 *5F024E76465E01D540DB03FB51ECA20D9B82A1DF にrnc入社。全国ネット『
913,006,450 *5F0822449F320FC4EAD2CF30505561CEEAC3E009 SIDNEY.BILLMAN
913,006,451 *5F064EFCFBE3C6F8D3FA0E4452D9568C986FAA1A RODRIGOBLACKMOND
913,006,452 *5F0EDEAD02152C2957994078BA01D05186ADCFD5 ROELLETTEP
913,006,453 *5F08BDF0693D44811099E19CCE634CAD69B222A2 rogelioniedbalski
913,006,454 *5F0806008FD05ECE82495D9559E5CDF54E8C89D0 ROLANDO.BOCHICCHIO
913,006,455 *5F0FCF69D4F1A9763DC944892003D9B90B079F54 ronalyn.de.roxas
913,006,456 *5F0D9C5281C9C38E4BC61FC2953A86EF2A5E0AF5 SINGLESCANNE1
913,006,457 *5F03CB92DC14C37645DED32D95CA94F75FB846A6 SINNWIDRIGKEIT
913,006,458 *5F010DC0AD69CE4A9C841558A6DC645F5BCE4409 sirenih
913,006,459 *5F0C22BE69923445F88078DBDDE180815644E208 skornia1234
913,006,460 *5F071962221031E8391304FFEDA75F1E61A86552 slibovanho
913,006,461 *5F0AC3A1E689B1E120EA37BB0F63DA7B051A5F77 SLOTINEBBS
913,006,462 *5F0E8AD35BAF50139996019899BB39E683199C03 smashing-orange
913,006,463 *5F01D6E4CD081D8C88FFD660C379E5A675619328 RUZAMUKAS
913,006,464 *5F05518397528147803C64A59E9BACFF64CA301D ryanrousu
913,006,465 *5F0CA592BA02A9FC23A5EF0963F8D550A240111E solgretter
913,006,466 *5F076452893CE3840A07C87972A0623F80EC6575 SONNYABRAMOWSKI
913,006,467 *5F0DC066B7C2A6A61A2307AF05D0B5778633BFD8 SALEBRANA
913,006,468 *5F09DBBF51373150191ECE8189617FA8159C43FD SAM.POLEN
913,006,469 *5F00CB12BBC9939E4D505F1AEC642E300441C139 splat.`.<#####8
913,006,470 *5F0B60BB3F0C99E02281EAE9F35105C3636BF41C SPLAT~`~`<====P
913,006,471 *5F0848626352EAE5DDFE8D8750C6930A08EFCD0A SPLENOPTOSES6
913,006,472 *5F03BC5B5BB23FC4FAB9F40E27BF623FD9C886D3 SPORELING
913,006,473 *5F01684F9C8FF9AB6ADAD197BD8F28861BBF9F4C SPRINGTRUCK7
913,006,474 *5F01395AA45BA1AF68A635077CE563CC40CD2238 sathiyalingam
913,006,475 *5F0FA143D9EBCD975C73C770B55C96AA44E4F6B8 [email protected]
913,006,476 *5F06B8837FC50BE7FDE42D50DF9FA84852117976 srvllrs
913,006,477 *5F0385111E9445EA7CB9228D9FF3F4F628FA78CB [email protected]
913,006,478 *5F0159F0390029358FCDCBB1ABDDAEBBF8F1497C schuver7
913,006,479 *5F04DD33EBD109AB97728C6AC4A24595A48DC471 STANDARDS、2008年10月)
913,006,480 *5F0DB06178C8415464E57533B4E3AEC5C47A0E72 STANDINGVISES
913,006,481 *5F065BA8A9F3045F410E32CDFC37B05E4C96537B stanperricone
913,006,482 *5F03A62632A57FA83289F017B579EEF8E0A34787 SEAN.O'BRIEN
913,006,483 *5F0522E1469026A68FCDFB6C879E947A3F61A00D stck.cttl
913,006,484 *5F0D092B45B7206C88C33FE179C1003526248E96 SEETCHTIGSTEN9
913,006,485 *5F00D01D90F70F1086B45035FE9B70BA852E65E8 STETTUBIRTTA0
913,006,486 *5F05ED0E064C28CA08721AF17793AB82DFC2D5FD SELFGARBLING9
913,006,487 *5F09AB0FBAB11B2506E4FFDC1175AAC0C0D3ED47 STILBIET5
913,006,488 *5F02F5B865BD7124A832C63405CBDA548C2D1F1F STOCKHOLDINGS..S.T.AA1.K.HH.OW2.L.D.IH0.NG.Z
913,006,489 *5F029D7D53B028DF1C19316B1E3A393BD26F7843 stone_borerst/ou/n_'b/ou/r/@/r
913,006,490 *5F01EE8E772C1D96A4855BBC91A01B8FC86B1C23 sesserger
913,006,491 *5F0535812ED721FD05E319F4B058C8E2A10D0EB6 SEXUALISTASES
913,006,492 *5F075E402937FFE2E021A95EA4A937FD479718FB [email protected]
913,006,493 *5F0950D4B185573F745755FC129FAF90D99DFAFB SUDANSHU6
913,006,494 *5F0F8202D8D016453C5A77FFA071C4EAC5D44613 SHARMOTS
913,006,495 *5F0EA60934FCB03DAF32445EC03E316311F73CF9 SHARPIEFINE
913,006,496 *5F0BD8B1B395A966577E3121D78F9E79722CE856 shauntolar
913,006,497 *5F0AA417000CA510D68D435BB632B672379333AB SUNFUCKER8
913,006,498 *5F0F73285A4BDE5AAB8E95C33200ED851E471373 SHERBENTS7
913,006,499 *5F0A9DF3DC9F865539559CE1FB21085B446C7C2A susan-beard
913,006,500 *5F0FF8CEFBDAB9CE98FFD55B6EAC1653E7D0792E SUSAN-BEARD
913,006,501 *5F03AB62F8AF3AF032507DA37F30A8AF9DE97D78 SUTADIFIB
913,006,502 *5F00AE4F5E927E9EF212CEB577129104E867F668 SYDNEY.DEPERTE
913,006,503 *5F0D65DDB60D245BE7756812119ECF5FFFF2712A SYSTEMPUPPIES3
913,006,504 *5F08EE25AAAA106493EF27BC19A4081D8A5E10B1 sәrbaz
913,006,505 *5F0ADCF201D2BC91F725AF3D554DDC2D970794CD SÍORTHAISTEAL
913,006,506 *5F0B6070CFADAE1298664AED55E72D53630FC4F4 SKAKHISTORIE
913,006,507 *5F0F0C0356519DF26A6DE1CAF89BD301D43671AC TALKDROBE24
913,006,508 *5F0BD813FD053517569F7193E57D50B32D16A6F5 talkrevwv
913,006,509 *5F09000C6F5B7EBCFEDBBD1C31151A829C228890 „SLAVUS
913,006,510 *5F09F3664569B4756500F47E7E91E03E1CEC470D snonnot8
913,006,511 *5F01C0BDBE000053ECF1766D0B2F0B17A6F9B366 [email protected]
913,006,512 *5F0D4AC1C744A04345EE56CB849D4072BBCE0528 [email protected]!ST!C
913,006,513 *5F0F83CDBBE7651CB84E68635EE73E81ABAED98A TEDESKI4
913,006,514 *5F0B2C9668E0BE004D0E566BB7B2423E6734B4C9 song.for.the.routinely.hung-over
913,006,515 *5F0639441E611431654FE2E701AD65DC24C68F26 SPARROWS1911
913,006,516 *5F0F776BF7061469D7667972F37682FFF36B79C4 spinners..s.p.ih1.n.er0.z
913,006,517 *5F07D232D8340FF26D47D7BA41B39180FFD247C3 TGASEGHCED
913,006,518 *5F0EE064E9A329E81CC0A9FC21DCC8066AE64A0F THATMICHELLE49
913,006,519 *5F0C079F7CDE60391BE542F29C988C604ADD5185 thatmontana1986
913,006,520 *5F0C4E151A2F9E8B540C9E47415B7653789F4B57 the golden sound of bert kaempfert (disc 2)
913,006,521 *5F05C180C5703D69A96C685D73CBA99D91A492F8 the.last.exercise.for.saad.al.dosari.before.his.deathjpg
913,006,522 *5F06CDC375BDA0FBF221E7BC4D42B9BF2280E4CD SSEITHEKIIL
913,006,523 *5F0CE77D4265ADCC38E1CE8EF599FB04B48D23AF SSENIMRO
913,006,524 *5F00B48AEB66B7408B2946EEEA260651A1D12D92 SSORCATL2
913,006,525 *5F090658B3DD9D26508510A2BF97450BAAA68424 STACKGUARD19
913,006,526 *5F096C13B83E9281E1D8D993D40D8FC61E837422 STANLEYGUMBEL
913,006,527 *5F0BC1571E76588CCF6AC257A6D6805CCA438B17 THOMAS10SNE1
913,006,528 *5F026C56A41DB606146E7E1D6AC2B59F7CE995EB STEPHANIEGRECCO
913,006,529 *5F0CB63D53A921F83B77B6782DD55CE44C0DFBA0 TIMSWANAY
913,006,530 *5F0BB18BD09746C3A5C915BF034950784033F00C STRANGOLATOR
913,006,531 *5F04CBAC262387B1A466FD2A5E18929FC64617C2 TNARGDARNOC
913,006,532 *5F07E7602AC2995929818FB4B13E14F261F2298C TOBIASCULLIVER
913,006,533 *5F0E067082B727A5674BF13C49FBE2C2C5FD913E TODEADENEDDEAFDEAF0
913,006,534 *5F07AC91EE17F35A128D7DB8702B055250622240 SUBGOALS123
913,006,535 *5F00A8109DD17D8870A8B543F7ED4DB0FFE87DA2 [email protected]
913,006,536 *5F040DBF8C2C1927A7DDF5477C82525AB7B91F49 toryendow
913,006,537 *5F028745E71903AF2B028B34223789001FB02A43 sumith.liyanage
913,006,538 *5F05F7F16CFBB552C0F54D18A1115FFFEAC5B9A9 [email protected]
913,006,539 *5F0F5043CA293F852FC9A377EAAA8034440BA9EF TRADE.PLACE
913,006,540 *5F0BF568879EAD938E9E50B8BDC23C11DD708225 SUOREFILUBUT3
913,006,541 *5F0C4264DB6EBB5770B32A1BB6EF0163D90998DB SUPERETHER!
913,006,542 *5F0B56636B976947B25ECBA41A4DBDE35D95C332 SURRENDER-(PULSEDRIVER-VS.-KEVAX-REMIX)
913,006,543 *5F04AF46FCAB359D9E148263032E0E6F5A0B2C8B SUSTENTARIVE3
913,006,544 *5F08350C87D1B1C92D4D48F03B820D637C8C62A1 SWEETSSMILEYS
913,006,545 *5F0B1271F54CA491C3D508DB6EBE59C74CCBB2F2 SYEKROOD
913,006,546 *5F099DA15E8B2ADC5321F7FFB666ACF098E54ADA tt=c
913,006,547 *5F0BA9116CE122B9454D69F7CD863BFB10822B94 TUCKN0
913,006,548 *5F0A437958743E2909998B05D5FF84650A4EE688 t4lly
913,006,549 *5F0A699F20C109EE8B89C8FDCE4C38C676E8B565 [email protected]
913,006,550 *5F00E7ADFA5DA8BF65637D8B5027D95051E78BA3 TALK86140100108
913,006,551 *5F0F97FE58624C4F18F604EE7045C528E33E37FD TYLER.GURNEY
913,006,552 *5F008F3748B03A637A66BDD22E5E05BB07BB5510 talokin9
913,006,553 *5F08993F7CBA2AC7E7B8E876E94AA3E5C936EB00 TYSONDUSHAJ
913,006,554 *5F0716AB30B74B2719B0CD72B43855C93B8994D4 u ain't ready 4 me (feat beanie sigel)
913,006,555 *5F0E0BEDEA14DD8FE3CFE5F38493A57A89269862 uaxr
913,006,556 *5F0E08C28B54E198259D473445011935BF94F066 TAX-REVLON
913,006,557 *5F0F89EEA9D6299038DD6B9B8349E5C543396F46 uitknip?
913,006,558 *5F0B5C88BE6E720CEB6B931A379B48CAEDF1998B TELEGRAPHYWIRELESSES
913,006,559 *5F087810E5DCB42BDE0CFAD294FEA0E286BAABF2 TEQUILABRAZIL7
913,006,560 *5F05AA86AB5B092E8884755585221007A95A17B9 UNIFICATIONIST5
913,006,561 *5F063D9688FA0924A1C85B770CFFA619B5628B33 [email protected]
913,006,562 *5F0A235D5B3885DE848FA70863760529E0FEAF50 thattaylor28
913,006,563 *5F0F217E9EA1907525CCFE10BD0FDEBBCC940195 uswatunchasanahasrofi
913,006,564 *5F0BBB2AB7299D02FC538F02A03F1CAA7E433776 THELOVEISBITTERSWEET
913,006,565 *5F0307FC36194559FB64C95D95815E6D9F6CC09B UZMAN-SHAH
913,006,566 *5F0EA40C1DE141A14DD0965376930B73B6DC6B4F the.rocketship.chair
913,006,567 *5F034990BB531B7888C8E5A5381C32BFD2B83254 V&21
913,006,568 *5F03C60F3E829B8E95BB121C6C80E0D757947E00 [email protected]@7I0N5
913,006,569 *5F0B5B9D8890C4618AE7DD840B1FE5C7F44DC078 VALTHORENSFROMPASTTOPRESENT
913,006,570 *5F022F072D20D7886953693553834878DEABFA28 van-aki-megv
913,006,571 *5F0922A31C7233A233BF54B1DCC1FA84ED2A1A37 tiga-lima
913,006,572 *5F0F5801A52E179181B4E5A19C91B5D9E33F2C49 tike-tike-kardi-(balkan-fanatics-remix)
913,006,573 *5F0BCC8C3C4DCEA3B9C14317934778B130755DB3 VDNCNDCTVNDRCT
913,006,574 *5F077F8687384999C3B9E558474F26DBF6850C57 VEDACASANOVA
913,006,575 *5F099225F869B67373602491DA7365A25F8F77F8 VELPGH7C
913,006,576 *5F03A0EB9A311F5FB175240C4B448FE2A768A25A TIMOTHYTILLEMA
913,006,577 *5F0EF4B167A3122D158CAFCA9D19EE85CDE71493 VENSKABSAFTALE7
913,006,578 *5F002B799BB2973F6EA07D15D25F57B5537AE00D TITUS.VANSTRANDER
913,006,579 *5F07A5E32F4B3864E610396FBBA4F88DA6AE6DDF TKT6
913,006,580 *5F03968D4F0EE3FD21000D4B8872EAA143AA00B4 VICKYCHANDLER
913,006,581 *5F05B959B820BE1506E72BBB4906448747EBD446 VICTOR CHUNDU
913,006,582 *5F068F861736BDFDEDE34D3355417B489A92171A VICTOR.JR.CRESCINI
913,006,583 *5F0DD8A8D76B156A9065BF3AB7D972E6485F5464 VICTOR.KAHRER
913,006,584 *5F0CF3586F163A37915EC54DAD927D1A53FBE76C vijai-pongpeerayanant
913,006,585 *5F0787BDA6EBE4B0444FE885DFE60DBCD5A15087 villadot
913,006,586 *5F08A4E42B6602F2D30BA252A9E60F6AFCB27F23 TPASSINI
913,006,587 *5F0332459C78C05304CEA8A934BA37A9F97A6FAC TRAE-GILMARTIN
913,006,588 *5F0645243E620C233B9F8807A901CD6033CF9435 TRENCHFEVER2
913,006,589 *5F0B10672575D0C994C190C6D1183E76F6E4AD2F vitocianci
913,006,590 *5F0B52D820EAD7C736C032322265AC940C8BD3AA vogters6
913,006,591 *5F0B8D3BB8EA5207D8DFC010A1E2B6AD301523DC TTENNAEJ6
913,006,592 *5F0D6C2CBF8181E44BDFB0D6952A59BE86F0B0F1 tuanadell
913,006,593 *5F01FF0202394929349490F385677CB1019D18A5 WAESEND2
913,006,594 *5F0E7165039F56E0E069D47330E885E6846601B6 WALDOLESAGE
913,006,595 *5F0C939CADB1CB24D52B74DCD4E823518EA331C8 TURANDOT:"O,PRINCIPI,CHEALUNGHECAROVANE"
913,006,596 *5F0160BFDDB3A2E143D743C399D1BF233719925C TVEIIET
913,006,597 *5F0FED4A5793F06D15FA16A19602591836320DFB WARNER.WEIDIG
913,006,598 *5F052ABAADE9DB62E8281EB736544B775AA03F4E WASHINGTONRUZIWA
913,006,599 *5F0D5EEE1EFE22E4F892A61D99BE5F558530FB04 wateber.haha
913,006,600 *5F061E4A6454075DF53399AA7FD4EB51FE34B92F waylonthames
913,006,601 *5F084F134378B4CA9352CEACA6C6808CC1C95FA3 u3n
913,006,602 *5F02C2BC34518EE507E03154CEB54EB4F7E75050 WBQLUJDH93
913,006,603 *5F02482C25A0608AEB282DDA037A736BE1198384 [email protected]
913,006,604 *5F00FB2B48E6B1A2D7593BA192EB70F95536DBBB WENDY CB
913,006,605 *5F026D338361E3A1786FC322820369AC286138A5 [email protected]
913,006,606 *5F0CAA83910407AF8BB86376C0C85390039044B5 UMARZANIING
913,006,607 *5F014380D627F4C616D4DCA38DC7EBB10F9C640C WEST.CARIBBEAN
913,006,608 *5F0EF9FB447DF2C205CEA0C81B8FA960AE1FE97C UNCHASTISINGGED
913,006,609 *5F0BAA4C4D333DD79447CC5010113E827B38C578 UNENFORCIBILITY5
913,006,610 *5F090031A5FAF30FE8C3529B148A1BE7FC172ABE Unget
913,006,611 *5F003FCF8147E798F448922C9892573CBAD52590 williammedemoussa
913,006,612 *5F0AFE12D4E1080098FB6D3F4E53541E9590BE8B UPOV
913,006,613 *5F0C6836F8EF4CCF136D1ABE5215D70F1098C2A2 URBAN JAMZ
913,006,614 *5F032FA8D08CE07E94C7859B73B97342EA8FA9EC window $h
913,006,615 *5F08946477A7640A2F857914D84097C740AB316D [email protected]
913,006,616 *5F0E6D1F06249C87AA08F73C2FBE559CB08D67EC [email protected]
913,006,617 *5F024E2ADE588F370A182222EECC09A9A8DF85AA wlbrown[email protected]
913,006,618 *5F06E31D47C47B70036C5BE700126D65D4AB0C7C V393TA813$
913,006,619 *5F036F1C84BE41BD8F24F2304043E6CA625DB644 WQLS-AMOZARK
913,006,620 *5F049337F4CDFCD649AA7677E932F2674B3CCDB0 VAL.HAIR
913,006,621 *5F0C61642C2ACA9BB589BA0198B5F1D7866BFBCB [email protected]
913,006,622 *5F0CCE8CA5B190CE3AD3B847FA59C301148D3CE3 VANDILIZIM
913,006,623 *5F0C21C62AFC911A9F9A70F88AF217F96AB01E75 WWWMILACSTECHNIONACIL
913,006,624 *5F0519E04388B4AEAAF398F009D759666883081F WWW.SEAANCHOR.COM
913,006,625 *5F0CA29042C8F029632A52132C37BDA66387F649 wxj/
913,006,626 *5F08E2CE42999A9C4E15D99A9D883B14332AEF65 X150262
913,006,627 *5F0EB4FC4836177883682DDA0DD01B1155BC7ABB VENNER-AV-BLUE-LAGOON
913,006,628 *5F0DA71033E89E83BE6734319537A5B581B660F1 XAVELUCAS
913,006,629 *5F066F0EE7A00F281E91B96AFB619D442DB82E0F XAVIEREMILIES
913,006,630 *5F02256BC8E5ECC6FB469E88F4FA121DB359D47D VEREN.ADELA
913,006,631 *5F047FD95A721C0B0897B42A7AF5826E5AFCE181 xianjingbei
913,006,632 *5F0405BBDEDA39A43E7D709A7A4ACFE49ABFC9E4 VERNON.SHIMONISHI
913,006,633 *5F017FDDB7CC871DBE76D86BF077EE89BF0BE74D veroniqueabby
913,006,634 *5F0FA9226370DE173F038D4C43DF1A9D214E9BD6 )x(o~o~dq
913,006,635 *5F0D0BC915AE6AE802112D09012227EB5636A900 [email protected]
913,006,636 *5F0C87F7CF7913C2BE2A3547F161FA7BE6A19160 XUFCVNIGOJING
913,006,637 *5F08D45D61B642DA3617BB274908F0DC8E2C19C2 XU.KUNDANG
913,006,638 *5F022F4EDFCFFE037F3293D54CD7424F55CB694D [email protected]
913,006,639 *5F0C19EA563293740AD0EAB680303F8568099434 XYZ(Ourversion)
913,006,640 *5F05279900DBBD3D45D1EF16A733CF0F131CDE50 VIJUPILLAI
913,006,641 *5F071539380D74635B3EA7466CE11CEC84604158 vincent-egede
913,006,642 *5F01FCDE57275552A70C6350A4A28C54B36FDDD1 [email protected]
913,006,643 *5F0614855C5BC48B1A6EDC5900BD510B37F145CA VIOLA CAMACHO VANHORN
913,006,644 *5F0D5FE21898FDAAAFA8F1997CFA688B612BDDE5 virgencitasoriano
913,006,645 *5F0593288098EDDEAF72EEF223D5F325E1947D85 VIVAINSLIE
913,006,646 *5F004B10B06F8C107A545B060EF0B12579A76FCD YETEPYDNAS
913,006,647 *5F097922F7D0F0006C47A79B068056BB5E2D0296 YINTANGPONG
913,006,648 *5F019732B66B504233E3DFA4A4CAADCEBDF60118 YLEZARYV
913,006,649 *5F0F0DF18044D4AA496077DE2AB37EC3742B1E14 YLT
913,006,650 *5F0372F4FF877D80115FE1506BB17E368E02F076 [email protected]
913,006,651 *5F00CD99D6B27FBDDEFC2C648FA33DA371B95A4E YOUR-LOVE-IS
913,006,652 *5F01E529F726FC6A12359623479EF0AA2C84EA0C YURIATSON-JUBHARI
913,006,653 *5F05B163C819EB1E4DA67357638CBA8C4F11F3B3 waltonamicone
913,006,654 *5F0F8EA54433D36A9F318F3DFE4CCECA588C8D83 Z7V3
913,006,655 *5F0C991F2CEBA40D6B439F7097E43BAAAE1EA122 zack.eliason
913,006,656 *5F01E2AE956E955E35B476D16DBEF8548FD02670 WAYNE DAFTER
913,006,657 *5F0336D8F059F9A0C208854E85733FBE10616BC3 [email protected]
913,006,658 *5F026FF7091F1168B89471ABA69AC2840E541925 [email protected]
913,006,659 *5F00AB518ECA4487D816D689FB8EB86BF427EBCF WENDELL.BARUFFI
913,006,660 *5F018314B7FB66314EE7DA13F98FA563DBF936F7 ZHAGA08
913,006,661 *5F0D8951BCEA0972A24D4F68778B04C24AC3D88F [email protected]
913,006,662 *5F0664B88FDD4BCC2C876EE41C24FD3A8B35AD04 [email protected]
913,006,663 *5F0ECF8B5E45DB05EEBEB06629A95545A2E6EF66 wernerbancks
913,006,664 *5F036195ADC8C3CEEFAE6EE29FF5E6BB321F1BA0 [email protected]
913,006,665 *5F011EE7EEFDF1C5D99F3C3FDD7A8681FEED8257 [email protected]
913,006,666 *5F0DE94274BBBAA7DBDD67924DA29EB963F9CDEC WEWNĄTRZGATUNKOWEGO
913,006,667 *5F0D781641861F90643F1F161D22F580584C6093 zpamz13013
913,006,668 *5F0A05E90238C3AC51443D12221F8B2ADF9AE839 [email protected]
913,006,669 *5F0CD099DE577B8CB512530AE5D6FEEA40B3375B WILFRED.ARROCHO
913,006,670 *5F021FD3C5300745D459E037E8E5D7596AA1F59C WILLIAM.DONALD.MILLER
913,006,671 *5F03815DB2BF116E4DF447656AE09119CAF0404B WILLIAM-H-PHELPS-JR
913,006,672 *5F0D8E5FFA8EE49317CD0AA1C2FBD1A452A94764 williammatone
913,006,673 *5F0DC41294A75B1AE1D6031BA72065934DF4F1A0 Μ1020
913,006,674 *5F0F20DB7C5C6377E20251B214DBDBCDA1E4950A WILMER.BUSHROD
913,006,675 *5F0955B4153C06CFFA17571602B878FB70CF5A78 автовосток
913,006,676 *5F09F3738C638BFA42D5B10B27E7A698EAD78A67 wisdom.knight
913,006,677 *5F0C5E98C9C4C80D16D521E19CA2DB55E3BB4D97 WISSENVORSPRUNG
913,006,678 *5F0B184B1D87DBB256B7422C89B26C9F60CB4632 wmgefroh
913,006,679 *5F0F2360157D61F3E9AC83CA91E9151A7F0EA6C2 лендом
913,006,680 *5F0A4560580FED6F71C2E7B99C0C9A1F03A41F29 [email protected]
913,006,681 *5F0F00D718BB1EC47127464227E0191BC17AC9DB wwwgypsophiliaorg
913,006,682 *5F0DA8A9117483ECE0813CE28A92DF0BCE550E28 ТЮРКЕРИ
913,006,683 *5F0B8D919DCFFA2B2B2C3EBC016AB8D302B2BADA WWW.MIIJO.COM
913,006,684 *5F087873EB8FF63F8B2029E6851B95E26ABEA3B9 WYATTSARTIN
913,006,685 *5F001C0A015454CE933D5D11D97FDBF153CE8B03 X031201
913,006,686 *5F089C85A3F7EAA012091C74EAB6DAF6E899E84A }X{ ~ ~ ~DQ
913,006,687 *5F092BEB1434EE8863CCBEA9649001F3999C42D4 }x{.o~.o~.q#####q
913,006,688 *5F0DE2B644B7FBAB9A213E1DC4F02B39F7D9E319 [email protected]
913,006,689 *5F0ACE0233B57B23838A46DACB70AF173E502C5E [email protected]
913,006,690 *5F07833F290129F44987FD90C1B260017BE6D408 yaaaa
913,006,691 *5F0707630B2B8164E14E035F157C9342410CB43D YANG.HONGBO
913,006,692 *5F07AB6E040D8440375F4A48303395C7BFDF8ECB 魔法氣泡狂熱版2【CHUU
913,006,693 *5F006F0F3741DAD23D4EE813154080A808BF085F yc\v
913,006,694 *5F0AF7188BBFDB4190DD72F159875D8D21208B46 yeyito789
913,006,695 *5F0FBAB55F9330269B84CB0E29A35A681F244CB7 060710tardif
913,006,696 *5F0AFB86FF919F89807CB54CDE69209DC218E7DB YOUREVERCHANGINGMIND
913,006,697 *5F004FA2335AF5F350045CE617ACE4C140A5B2EC 0IAMBISHOP3
913,006,698 *5F0DBAA335E1343F44AA760FAB7507809AACB36F 0NORMAN0
913,006,699 *5F0A79B7C98EC8A3850D41EA2E06E49B18E7EF5F [email protected]
913,006,700 *5F0C8791AA0BC15F4F8377E42B440954BA3D9FEB yuval-lev
913,006,701 *5F090309D03BE85ABF5D0AABD5EDC60E89B47CE5 zacharydelventhal
913,006,702 *5F0997AE6AF1C7E2ABE418980B67F76E1ED200B1 1314565 RIKOSJUTUISSA.AVOIMUUS.ON.JOSKUS.MY
913,006,703 *5F051C0EB6D3688BD7EEA225E48E319E23EF9FFD ZAI.RADZUAN
913,006,704 *5F02C3084C7902C08841DB25AC6AE27618D74891 ZAKLADATEĽSKÁ
913,006,705 *5F0A00A51DEE7FE0DADD0CE8AE51C3B2F7F214FF ZAKONOMBSW2
913,006,706 *5F0F5CBBB805CA19C8F7865B25E834F005CD3809 1454597 WIR-HABEN-BEISPIELSWEISE-ROGGENKRUESTCHEN-
913,006,707 *5F084CFB321FF0021F8666D88A49A19F5AA598D3 zatiŝje
913,006,708 *5F0968ED61102D55986217179CFB2399906364DA ZBINDU
913,006,709 *5F0530CFF1E3DC2D85730E82FE26A56DE7C13829 1896249 n
913,006,710 *5F0912981C5ECD95F23FF57F14F2B8337B6932BB 195X85
913,006,711 *5F0DA0470195996BA5DD559A06ECD5021DA9F056 [email protected]
913,006,712 *5F0DC329A27E10F113B9FED7C8771D9C3DA85238 [email protected]
913,006,713 *5F09CAFEE7798A41A2CD61C5FBE22C741514157E [email protected]
913,006,714 *5F06F0B5D11D20DA8B8A77767F4A1F26EED75049 1-aivanmets
913,006,715 *5F097D350D0A60B68CC922252A46AA88649246AF ZHARIFMASLAN
913,006,716 *5F0E67229331299E2F615B937D01F08E1F05F2CA 1ANDEFLYGT
913,006,717 *5F0270ABDBAB84B4812648E274CC9A1972FECBF5 [email protected]
913,006,718 *5F0403F502F912C3FAD306BC7DBA4B37569CEF41 1 arvosteluk
913,006,719 *5F0A6C8A85474E5C386999D4B686BE00B9ADA0F4 1brandschutzbroschuere
913,006,720 *5F0B074A6382B2AEF2FCAE0D9F4794634444D4BC 1.cigarettevending
913,006,721 *5F05008115272959E0D97E10EC6B7B7C4C6AC454 zimbardohowardfried
913,006,722 *5F08FB11ED78B9D5070CCF8CF4EE65C24ED500EE 1dekartellierung
913,006,723 *5F0EE1028794A21E7C3352106D7A53AA02404F0D 1DPEICHER
913,006,724 *5F0C935064ECE3814B82E81ECC36E7C8305ECBD3 ZLETTIEZLETTIE
913,006,725 *5F0C60B86F96418EA05840197608BCB4FF72E01D zmarai
913,006,726 *5F01F0FFEB8BA02ADB23334B5DEDE6DBE703DF4E zodensnijders
913,006,727 *5F098553C47A25E2D4E55AAB9256E3281EB1A3B2 1freeman9
913,006,728 *5F09B132B7439434FD594E946C8E55E169E5BDAF 1-HARMAAHAIKARAYHDYSKUNTA
913,006,729 *5F0E68BB85C6813E6088703393E07A7E9650CEA3 ZURAYMACAPELES
913,006,730 *5F0EF483C2379A4F55BFE496E56526CFC04E2F76 1 keepson
913,006,731 *5F083D78B683CD5105A70FB5EB11B7B2774756CB 1.lauritzens
913,006,732 *5F0ED590EF7E25AD135913D3C59309D894B56077 1.lichtschwingungen
913,006,733 *5F0CEC7B15611BA5214F56591EF8326BE902FCE5 1 mattila-m
913,006,734 *5F0E64C23191D5789E52215EA3B0E6D3E7EBE939 1MOBILITAETSKONZERNS
913,006,735 *5F078246705CD6E66063F552DC4F1414A36898C9 антонийс
913,006,736 *5F0785228F17929546FE8C62347F1C2820816C34 1-prognosessystem
913,006,737 *5F0249D2458F0266465641942620B37F5790C098 1Q2W3E4R5T6798
913,006,738 *5F0735821CA4F2F97BD22E4A420519489F150363 1.safojen
913,006,739 *5F089BC654CAFB3D08F1CB62ECA73AEF0D9708C5 1SLSNCDT
913,006,740 *5F0962EE91DEDBBC2D8B9A0ABDEA8B2BE54E3B7E молодежний
913,006,741 *5F0B0FC000B4625B5F6C490BDDD024B63CEDAD6C ПЕДРО»
913,006,742 *5F01C4E3017FEDE2CAA3D5B8E23CF845475C8CA6 1THESIMSIM
913,006,743 *5F084A9328719923D990F9B1C065BD7006DF48C8 1 timeoutdiluted
913,006,744 *5F0ADB5B8E2E3A5580CBF95D936440E646B2FC54 1 TV
913,006,745 *5F05238DE550C07D0343A71D490AE55998DE6C6F 2093556 so.it.is.full.speed.ahead.now..
913,006,746 *5F0A8DAAF66EA48C825DF1F4EDF51A44AD29D277 СТИПЕНДИЈАНТИ
913,006,747 *5F085FC9385459B3BD62E4C69C068870C70EF8AB 20GOATSE
913,006,748 *5F00758B5D730C1C8A8631F0E4F7D20DD3D7CD36 цыркусу
913,006,749 *5F094F959A3BFAC1DA269C42E5AC83404A465E87 ЧЕЛЕКСЬКИЙ
913,006,750 *5F0CB15FBBD337357CBE1368FD4FBCABE66ECCE2 ШУСТРА
913,006,751 *5F0ECF32748544B43CE60607359CB2124F7CD2ED 22BEER
913,006,752 *5F007EFC5B886696313DF4644946769521BBEE30 2373071 IN-DER-PARTEIUEBERGREIFENDEN-KONSENSRUNDE-
913,006,753 *5F01DB5922CA6DB222A84DD299880ADD67C712F6 2382317 UND.DIE.MASSEN.AN.STOERFLEISCH.?
913,006,754 *5F02135F99A1E008C09F2F01954AAB52CF00CA2E 2526587 "-it's-a-credibility-issue-,-"-he-says-.
913,006,755 *5F0E52FD2FB2CDBD47B4F793137E3763B3AB15F4 2674954 "ifoundthatscriptandupdatedittonow.
913,006,756 *5F02270353DE4E701B01F7608F0039F30618A8AC 28aug1086
913,006,757 *5F00581FB87D5302C3F256303A8F3A3535897B0D 2995811 THE THREE FATALITIES WERE SHOT IN THE HEAD .
913,006,758 *5F05B33B9CDFA47DE00E26A72C5C1CF59A180E89 2DEVILSLA
913,006,759 *5F0AC93EE51004CFBF01A6B2E03965265A2CF7F5 2elmadan
913,006,760 *5F0A3BF45A86DD81F120575C5FCB65208BC84568 2ENVISAGERAIENT
913,006,761 *5F059BC1F0A80099F362ECBECD9D5882905CD4BF 2flcd
913,006,762 *5F06DD5C0C194FA5E8D8AAC39C3787D1FA69B5BE 2MYTELECOM6
913,006,763 *5F0E24B684D40D181665669C9A4C4DAD0548ADFE 2NABYTKI
913,006,764 *5F0E5BA9D3A13C5F9E0DD2B6CC2BCA3327F344A3 2SOCIOLOGIST
913,006,765 *5F0ECA69903D815F48FBC28CDE96FCE579141FF8 2 TADSCHIKISTEN
913,006,766 *5F03DDF9D1DB08C415122026808465DD98C15D29 369AVATAR
913,006,767 *5F0A3770AD8969512A83C54BE20F47F1FE5316B1 3AMUSTISO
913,006,768 *5F02C7D3BF4728DCCA957804CB8E21D12C28A1CE 3 k
913,006,769 *5F0666FF98F97EE6CEB21A1924057D3EC1B4CD54 3PaTiMaH
913,006,770 *5F0CEE4A646E4206F4746D615474C3F04E90790D 3VIESTINT
913,006,771 *5F09D5684B21A39617795059B269D8CA2371D332 3WELLPACKED
913,006,772 *5F00471E0237DA3F4DE4456F35527BD0DA36077B 495483 HINZU-KOMMEN-DIE-KOSTEN-FUER-AUFZUEGE-
913,006,773 *5F01728805A8CD40901F5188F38D31E57D3C4B5A 4C3TY1RO$
913,006,774 *5F0AE01918B41CE0A89219637021686CDC730966 4DOMESETC
913,006,775 *5F0A821BFA8F07ACA64C4FEFF796E8A6B74BEE16 4mycowboys8
913,006,776 *5F0B50ADE0E6B5AB5BA6C7AFEE068F0D5CDC86C0 4ORMENYORSZAG
913,006,777 *5F0A4F808A76F42A06CF42CB922F32B324F17571 4SBEDARFS
913,006,778 *5F0F204929371E930F4BFAC4DB527C11D6F10BD8 4SCIGIREACHT
913,006,779 *5F098972AD4C9A1513EEBF634405EC34528B7B26 4.STEINHANG
913,006,780 *5F0D7F073652442879A2D327D437C79876F758E4 4UTO$UGG3$T!ON$
913,006,781 *5F00497B92B5BEA0EA58BF2FE2C3B5A971EDC224 507935 weareanationofpandoras.
913,006,782 *5F09B0DF55D9BB37D44126201ED1FB3D0B1E031B 525918 KOSKA-AVOLIITTO-EI-SIS
913,006,783 *5F06CF2E9A27DF2A9637E355CC3C9BE0823D5E7B 585briley
913,006,784 *5F02302037590398244DCC56978F36467AC99B28 5GRANDMAANNIE
913,006,785 *5F08A9E9A6292E777B6A55CC586DE6D883D2B32D 5IAMSANDI9
913,006,786 *5F0237A6CCCD4FAD5B7F2C725500B8B3EB543933 5JONDSHAT
913,006,787 *5F0679057C8CC7D9ABE72347D8E1987E465BD287 5LIMHCSIF
913,006,788 *5F06017FC7F31DB37D1E4CC9542961CBB7D55012 5MAJORISM
913,006,789 *5F02C3EB4E5FB6F2D2ED22AA747799AE84446D83 6061863C-9F20-317F-A045-DB3A7B67BDE1
913,006,790 *5F05BFC38BA8CF13127D8A409EB429A13F7B0E96 (0_<)~ ~ ~ D==Q
913,006,791 *5F05704E1B46C867D81B1C0924AC3DB337EC4904 640762 kollar arasi acisi 100-120 derecedir
913,006,792 *5F0C9C87561EEBE2D6BFEEE0D368CB805D6C9115 (_0).o~.d=b
913,006,793 *5F0049B9C0E820DFA9BF0C955C96C61A3E4FBA0E 0theraptor7
913,006,794 *5F058DCC8913752EAF742F084F8DE4EE03D928BE 10TELEVISIOTUTKIMUKSEN
913,006,795 *5F01C0DE2DB79592AC0E819BCB1F97B74231790A 6CONTORCIO
913,006,796 *5F0261EC69D3F3BB003688A83B4BD4762C95CB83 6DOROTHYFISH
913,006,797 *5F02C52393C978FE7267DA7EE22FF19505DA1B30 11-JUOKSUTTI
913,006,798 *5F023781F2C469084EA6C94A30D117DCF3B38E2E 11 KESKOSILLE
913,006,799 *5F0533B8DE76EF21B462BE7B27B31EEEB202CAB1 6.HAKAN'IN
913,006,800 *5F0A4678B64DC65B27A58FE2C4669881FAF3EDEA 1245673 SUZIE & RON AND BAND - MI 31
913,006,801 *5F0D0601E79C4071C814BE7B686681085C58726A 6KOUISVIL
913,006,802 *5F020F280DB8FA40A336BE1EB5667361FFC33234 136NYKYTILAA
913,006,803 *5F04675E6D75133B5B1D2E133E8BBF799001BA27 1568528 ER.BETONT.,.DASS.MARIHUANA.NICHT.SUECHTIG.MACHE..
913,006,804 *5F051BB39DE3F9C9AB2A768522B07CF3FB0D83CC 6QUESTKRAMER
913,006,805 *5F0B378C131A515B6A7CAF4B5F80E26AC46EC774 6STRUCTURELY
913,006,806 *5F0A4D04D9636966F04F36B3A87BA86A1B40DD5A 1AGANISOY
913,006,807 *5F07661844F8B3F34C39E7B8367E4E2CB5BEB4ED 786906 the-younger-mr-.-gruenberg-was-a-great-promoter-.
913,006,808 *5F0D95CB0C68D242083BC0A3DCB178749A3A4E78 7BEISLAR
913,006,809 *5F0E8F1E6D99EFE2F134269A79DAE9DB29F8483A 7BSWORLITHBSW
913,006,810 *5F0D4AA73210567794108577EE2D7CFFA42B88D2 1-deGerlemenin
913,006,811 *5F0B14C52B9190A780D40B91211B098D2BAD417B 1.ENERGIANTUOTANTORATKAISUJA
913,006,812 *5F0D41FB5CE40E955BF083EEC178A0AB8DF43D37 1FRAVASHI
913,006,813 *5F0FC61B0ECCC9781D15A8D68268F671A53B9C42 7INTERGREMIALBSW
913,006,814 *5F0C1A5BBD09C8882ECC36DDB19D841CAB5C4F1C 7KROEP
913,006,815 *5F0B8E6E14BCD2C1E9BB5D23267DBBE733981A3C 7KWGRYDUEWVSOG
913,006,816 *5F0EFB80C68988D298AE52AE85E546AB25C0C888 1.huettenschmuddel
913,006,817 *5F0FFE7BC3347FD764DC64AB3C35049A1160A01F 7METOPOSCOPERS
913,006,818 *5F0C7A5E0530376A7E7266B5CE1BEB41FCCB8BF4 1-INFODETICS
913,006,819 *5F0E3F4C26B2C8E892EAE72F2BDA8183B759C65C 1jahresabschluss-feier
913,006,820 *5F062E1AD5EF6EF8D63756729CF73E6C5B10654F 1 JAZZRUNOLLA
913,006,821 *5F0B2C9FFE9084B2E6B9D9FC405C95111AB77C97 7RESYDENNCE
913,006,822 *5F0646D519F6298A904A0A4E17C73623EEBA4690 7SEERUTCAF
913,006,823 *5F0F087258919E2382803BA62CB5CDD9A00958F9 1linnunlahtelaiselle
913,006,824 *5F07158C0361B1EB15A5C1067578979CEA495B36 +1M841E5
913,006,825 *5F0696A43A2FCF14846F06D5D9054ED2C27BF5C4 7SPRYTTUALLE
913,006,826 *5F09936DF52C853BFAAD0FAA86744C93F895B44B 1 MATCH-PLAY-RUNDE
913,006,827 *5F0C7251AD4FF3135A9926DB1B0D77D603178F68 1.MATCHPLAYRUNDE
913,006,828 *5F09DF6D5A55DE1F82F5A92734C0946D00B71959 1.MENKERIOS
913,006,829 *5F0F1F0C164DE9B020579ABF3E92089E9E5CFA12 1-merkkilaseja
913,006,830 *5F0931599DB958B044E8DD1141E9F56E003B7472 1.onnenviikon
913,006,831 *5F0E0306958EADA474A11B0590C75A7343BE903A 1ORINECER
913,006,832 *5F06C4D0D6B5EC9263E5647943054AAF3AFAA620 8ASSOCIATIONCURRENT
913,006,833 *5F09F612A253C4830D02888D6C42FEF664218E3D 8BROOKEMARIO
913,006,834 *5F047B8A54E89CF5141CAE039291AA3453D5785B 1.RECHTLAGE
913,006,835 *5F0CBEBB275D15F58DAA322073FBF132175FBA56 8BSWKRUIDENHOFBSW
913,006,836 *5F06642A72532D955191F6F20B87DC1ADE7733D0 8CHARTOMETERS
913,006,837 *5F039E2773D3143CEF027B53E0EF1D0AED62D047 1 SAEUGLINGSHEIMS
913,006,838 *5F0E033F1D60FD667D1E0237CEA7726A5627C485 8CLASSIFIERIONSES
913,006,839 *5F08C4DD513B249820BE454E2A76F23A1A967E92 1 SEINEJOKEEN
913,006,840 *5F054AB7A14EA1F039B4BED6768585E72F426762 1.SUHTAUTUVISSA
913,006,841 *5F04DAD865264CBBBACF8D08EF1AB5B743DABF7C 1tippettsabbettmccarthystratton
913,006,842 *5F02293DB51BCCC5412280255ACDE92375D00D80 8IMTTMESP
913,006,843 *5F050BCD6ACAE771B9C33EF510BEC54B3F6E866C 8KOLEGICOM
913,006,844 *5F0C25DF098C4821B875116333E9B11E8A1C1248 8MAERTHESHEIMER
913,006,845 *5F0BB06DABE37EBABD409DBC8B45B9F2640D032C 8MUSSILIS
913,006,846 *5F035617DDFCA164B8B9367433ED26377C648DA3 1WANNENTAL
913,006,847 *5F0090128E20DA1FB5EEEEF75DF58EA9D6A6559D 8NONCHROMOSOMALA
913,006,848 *5F0BEFE10127C23DCA85D28491E6B90AD75732E7 8======P**(O_-)
913,006,849 *5F07F51A8331D345DAA5C2334D0EC62E7CFBCAB2 22.03.1684
913,006,850 *5F02C10F91439508CDBFA48291447C2A940552A4 8SPENDERINGS
913,006,851 *5F0BB6C1E500942734BE8605A90F224BE1E270B6 8)`~ `~sploit
913,006,852 *5F09FD3327335189705505E416E724C62787CE1B 229915 UNDBISZUM18NOVEMBERISTNOCHEINEMENGEZEIT
913,006,853 *5F0EF83333A7F3123B5FDE6F37A37281FD3429FE 22FEBRUARY1733
913,006,854 *5F0E3070AC3B5B64290B79BC0C1E35F48CCBBECD 2326983 TARKEMPIATIETOJAKURSSEISTAILMAANTUUT
913,006,855 *5F05BDF7656BFCFC06A5DBE823F31FE827611782 8-verteidigungsexperten
913,006,856 *5F06BA5A8D5050D0F85C9B32BB961A0FDF542045 8wolf7
913,006,857 *5F026A9313C69C0CF0571FD18AC58E356048CC14 264686 madde 11- 111
913,006,858 *5F038FC87E991CFC8760EAB36F6B8E2347E3B812 972259 DURDUGUMUZ-YERDE-DURAMIYORUZ-
913,006,859 *5F05C0A1AD99264CFC2EB9B724CCE33C50670795 [email protected]#$%^&*()-
913,006,860 *5F04F80CB37A848EDE2F2FB971DA1EDAF799F372 2914563 EXXONHASLEASEDMORETHAN600VESSELSFORTHECLEANUP.
913,006,861 *5F008B02E06C0AE083B35DE0EE9130BA586365E9 298kg
913,006,862 *5F0FD8FA69C3116EE53D84F5BCC63E07900DF4E9 2CERYMON
913,006,863 *5F015966A077DC5D079A95A60854F6E77338ABA7 2-DSL-YHTEYKSISS
913,006,864 *5F04B2AEBA7444E0EFDC684F8BA5288F99C1B571 2FA0160
913,006,865 *5F01CCDC7335F26E3AFFA0698DDA8534C0B33B26 9IAMVADER0
913,006,866 *5F01F122D626774BCC314DB5FB622C24F3E45F6F 9OBEROENDE
913,006,867 *5F057EAD9518091987B3E7F7F6427C434F9F857C 9.pakoauto
913,006,868 *5F07B8471F102D1014A5B560C7438EF671BF1BF2 2.kucultecektir
913,006,869 *5F0B7D687DC544BF52AC8B1954F1B0B51F74A759 9SLENKENS
913,006,870 *5F0F4E6E81A6DF4667A4654C5B55D83E9BB43F14 9STABLIAMENTUM
913,006,871 *5F0CDB5C96E0A390C545652AC9A8CBC416992E82 9THEGILGAMESH7
913,006,872 *5F0E7B0FD363B7074666A7271827D66C6C78C2DD 9UEGENDEN
913,006,873 *5F099FEF3D860E706A6D5FB2A4FBD2B10E9BF9D0 2serreau
913,006,874 *5F027730AB00B8142174CD7A85511A5A0B3E0BDB a:238
913,006,875 *5F0F3086D47F45531DA0231F4D3DA27AAA062B73 A2I!D
913,006,876 *5F09AA9326C7AF7EEDD98982C7C10B69BDE5FC84 a3kam
913,006,877 *5F0DE9E8BBCF6B25AF9290111702D08BB5E39F5A 3CMMRCLSTN
913,006,878 *5F09F18912EAD36BBAAA534A75D360D49B4D9A53 3comitium
913,006,879 *5F0DFF6C82DEC2230942C735B8CB72B9255F35D3 aa2mo
913,006,880 *5F0771ADCE130872FD1AACA13C0735B32BED5D02 3 k
913,006,881 *5F0BF042D63E3255516FE45A45D266B67E00D762 3VIESTINT
913,006,882 *5F0628A5C8453AB43358F5C8407C895B413606F5 404assembling
913,006,883 *5F0243C4747C6CCE66E436E1B96CFFDBC1FD3935 439KAMRON
913,006,884 *5F01B9E998C56CFCE07AD0E771F2A982DE7A44E9 4CINSAULT
913,006,885 *5F0DCAD07FE1BB774F4F65A82497F61D2D66B9C4 4iamfletch9
913,006,886 *5F0955A55089A3D11EB8BDE982EA5DFBC0C66E59 abdulyoussefi
913,006,887 *5F02DFE7F5C4DC778335C60EB6F7B984C7FF84EE 4NEJNEVIDITELNEJSIHO
913,006,888 *5F0D0C6E235B5F87AC4AEE4238772D3A80E2DE92 ABENSPAZIERGANGE8
913,006,889 *5F054E11FB568CBF0683FBEA81D303901FBF79BA ABHETZEN6
913,006,890 *5F0B27EA56DBAA90B0EC98A6BC1D2B9FA96C23AD ABHI
913,006,891 *5F0571FD2E8297F2EC3D79980B711F0CCBA3B13A ABXB1
913,006,892 *5F09E31CDC06FD8DC175B781CFF350BE7A65D827 5AFSMELTENDES
913,006,893 *5F063B6FB6DA315CC78FA6E0FCEBF6BEBEBE32BC 5AIREMYLOP
913,006,894 *5F092BD2F7028D3C095A67FB4C910D26E7C48BBC 5DOOKIETAMMY
913,006,895 *5F02F0FEF2209428B076682B45FAA90DCF040EF1 a#cxh
913,006,896 *5F02CBE24B1FDA86C216D641E54B1B84277756BF 5HERVORGEGANGENBSW
913,006,897 *5F090A5CB4F0AA3C6A859D2EF75C01AAE618E09C 5HERVORHE
913,006,898 *5F0DDDC4FD36C1504B12B30C668817F4222841B7 ADGA%
913,006,899 *5F00C2C8FDD1DAC72622CFCFCB2A3E8F217576E8 5.kesser
913,006,900 *5F08BB29527D375437A10EBC5807588FF183796F 5KLIKKERS
913,006,901 *5F0E0CF69A46FFF194A44F4427990A3BA3191823 AEG(A
913,006,902 *5F04395A61ECCBFB5D15A464FBE49DDA0F9A912F affj-
913,006,903 *5F08A138C891AE6334A223CB535787369756D60F 5TYLERKINDER
913,006,904 *5F0B7249F8FF27DF07AB6D900345B29483817848 5ZIELSDORVES
913,006,905 *5F0DF0A3D9958F101309D8196785A598C379E3DE 5ZXCVBRAPTOR
913,006,906 *5F001DD7BAC768276D336C55A95294569901D628 66HMPD8P
913,006,907 *5F0D418ECA55E5716DCED06957AB2E35279CD572 ahce
913,006,908 *5F02E8662B82F3416F7EBA3AB40DD21F7A6A4863 <a.href="#e69e201".>routing.protocols</a></li>
913,006,909 *5F0EBC701E48C467B4D12195E90FB669DC852D66 6IAMKNICKS4
913,006,910 *5F036854FD8CFB94BBBEFBB52242EB07A780629C a)k
913,006,911 *5F00D3D19D5E28E146A41CD78924EF4EF92528BF AKP.%
913,006,912 *5F03C88A94FAF1F9B1C8F702DBE7B2CE54AD124A 6UMBRELLAPLANT
913,006,913 *5F082F0C8F5403F5310B3D8C87A547565A976912 ALEXIS.GREASER
913,006,914 *5F02088E0AA59E8011F395D1C566AEBEA8B680F4 74893CDMGC
913,006,915 *5F0B6181F7A06EE7BA6E3EB5C251B750086DEE68 7ANGIE8
913,006,916 *5F0E361D96C256E36C8B45BE6A18A75B4CBACA3E alj
913,006,917 *5F0E43B6D96744017B28BEEB442427A43B643A17 7DEKCOLBE
913,006,918 *5F063E12226E70A66039BAC8734396E1631007C8 ALLNIGHT(DUB)
913,006,919 *5F067B7A725EEB108DCF89C0BDAEAF768BC1E11F ALPHONSE.LAJARA
913,006,920 *5F0D043B56A53CB3D89FA59C8140776EC2B4BAC0 7MIDDLECL
913,006,921 *5F0EFCA8B5EF85E3E2F4D863E57DE5E35646E0BE am2oh
913,006,922 *5F00D1EC6CD73A6F2CD4F1E2EF3B506B6F5987A4 ambroseruppert
913,006,923 *5F01FE0EE6F17487FD357C84633B555BB3CEAFFE AMF54
913,006,924 *5F04CA8202F1D0864C0E6C101C5345F5F43E3D25 7VOORBIJL
913,006,925 *5F0536CBDA77DE3D782F00EBFDF793DCC29EAD76 82位:hurry
913,006,926 *5F03DE996202D49379F268B14E372524217B7845 866537 fatmasalihoGluecz.
913,006,927 *5F05813C08F38905356DEFD109282E4F7E9A03BC 8AKKUSBSW
913,006,928 *5F04AA6F9DBE7300C412480814AF30CA185D38DF AND.THY.UNKINDNESS.BE.LIKE.CROOKED.AGE,
913,006,929 *5F0FE3D2196E6D3DE93A61A0358F85C6DA707C16 8====b-~(~_^)
913,006,930 *5F016CDAA60C1FF004DF4C7D400FEF75AEBF199E ANGEL321456
913,006,931 *5F0A0D1C4DEE9CAAE200C15C740673FB90D1AAE5 ANITALATEGAN
913,006,932 *5F0BE117DF361D12E47965710A1CE0A9C5BEE7A2 8HRMOBELS
913,006,933 *5F0D27A93D8418A3F79AAB07339DD21BC6249F10 8HSAILING
913,006,934 *5F066FAFE851D2DC829726F0C410E4DAB5C3BD71 8iluvcougar1
913,006,935 *5F0DE6C81AEAA1B367C46C203845ADD074450453 8NIISKYYS
913,006,936 *5F0CAED30EE49B306FA701BA707FF2580DEC5910 8O4AA
913,006,937 *5F069351981C88890E88EFBC54B532690C376098 ANTWANMUFFLEY
913,006,938 *5F068BF77247ABBAD1538D77BD47BA10D65BD382 8#p~o~o-(>-<)
913,006,939 *5F04427B9C6929999E79EF7117B0E910C4F1753D 8p~o ~o}x{
913,006,940 *5F0221DA0BB1568D98E671C8D03B9035496E1D58 8THATDANIELLE1
913,006,941 *5F0130D60E9A25A8215A5EBC23BE2396F0A06B18 97rey
913,006,942 *5F070EE4AE16A1795AA69D132D00F1713151E01B ARNOLDO.LOPUZZO
913,006,943 *5F0CC6ED5F11EC4523F9F1CCA55BF7F55D1A1ADF ARSLO-
913,006,944 *5F035A511F0BE02415498648D7A5BF665708ADDA 9GEREGISTREERDS
913,006,945 *5F0D49FAF3F10FD1FF6AA38C7BDF6EA793C57622 9GNITHGIDEB
913,006,946 *5F0F278A31B8EA4EEF599C347C312B7BFEF11749 a")=s
913,006,947 *5F071AB9E421601A00550C4383FDFF8CE79E400B as.broad.as
913,006,948 *5F0897EC219C786ED97B8021DC40C86149316AE3 9KONOMIGRUPPEN
913,006,949 *5F0359B572748AF8C780D19FC438BDBFEFF455D2 9KURKIKOHTAUS
913,006,950 *5F0B7ADD340DD02AA0986FA4843754AA458E0C3C ashmens4
913,006,951 *5F0DCE0CE14ADC6D66AAE9DB2442AA80F9B0E0BA ASSIREDN3
913,006,952 *5F01B809D600A187A615D5A404436B42F3ADE20E [email protected]
913,006,953 *5F010EDC5076EF615CB8C4BDD4E607F45DD363D2 9PLAYERSTOMCAT
913,006,954 *5F012622364A64FED04126F60B56FA30F4CFDC48 AT3HE
913,006,955 *5F09FB4C59A1696877F23DC62739E1861C7BB5ED ATM9N
913,006,956 *5F09FDAFD07973E761DDE94B936FAC68A0687FAD 9vcjjnq26tjfu90
913,006,957 *5F0E2A39F93EC0D3F84A4AAFC7DDA787C6B8AA52 augustcranmore
913,006,958 *5F008C79F489992AA0E777B4440EE3B5B2EB7DEB AUGUST.SHRAKE
913,006,959 *5F082E5093909B8F9D6C25AD42F4F80A33053032 A/UH
913,006,960 *5F04DB976B4C282D02EA1B33D61C36E6C22E5563 A50.J
913,006,961 *5F0FC86C1A935F763C098546A9E5AE9D2A85E8D4 a5/g
913,006,962 *5F09754A83507809355CC424946196A6DE1C8E9A ayvve
913,006,963 *5F0BFE7D870568FE92920E98597C6E7581F308C2 b2?f
913,006,964 *5F080C67D1FC665D394F85585A376CAF8C2A543D b4(jc
913,006,965 *5F090666DE1BA74389EC9CFB766D33A629B32250 B4JGP
913,006,966 *5F0FA48A8CD6A8C366A19C63DCCA3782DBD62580 AA|LQ
913,006,967 *5F0D6743CE9F50A2F00AC06E45B9DE6853D4C2B8 b6i;3
913,006,968 *5F08C404F70960FC59C4F94D4F1AD8998101F9FC b6q8
913,006,969 *5F017379D2065D4000A7A12583B5E0C74AC9768E abc教室
913,006,970 *5F0DA03EF60EDB4C3B9F4DAD4A4AD388A53F5E25 BA_CW
913,006,971 *5F0A8216CA475E8CAF8763DB9DDBB21A0A89250C [email protected]
913,006,972 *5F0BDDC33684FFAE86A6662D444FEE941A6D75E2 baljit.sokhi
913,006,973 *5F0B6710DB8C4CB09531D620370B003D924EDDC1 ABRAHAM.LIPTRAP
913,006,974 *5F03E6F7AC38FE9969383F085187213A8DD5DAF5 BANDIT92
913,006,975 *5F035942F8AD5D6795DCCFDEB966D89F05F65A8B [email protected]
913,006,976 *5F092E77C2E734F85BBB3956D61078719B529F89 AC_%
913,006,977 *5F0C12B15CEAAD46FEA48CAB818EE1C889A28653 BARRY.HEISEY
913,006,978 *5F0675521FF9DDFE7C18F9AEE14211A5D47717E0 ACD17
913,006,979 *5F06C870187AA029883087EA0F3FB6F7A7DF5253 acronyms
913,006,980 *5F0DB5B9A3EC405C99279DDCDF644B01CA41346E bddcaa
913,006,981 *5F04E9BAFE3A6C8580A05DE7CE3759C5A7EF9C2A a-different-breed-of-killer
913,006,982 *5F05B2AFBBDC1A639E3B1C48CF3C8FEB5258F9D4 BDKUL
913,006,983 *5F0ED94C8C69C072B378F4DA010DB90AD8CFEA21 BEMV.
913,006,984 *5F08EF8E3A0B76393180EB6A2B0B3545AC33B083 afsmeeted
913,006,985 *5F093E50CA390F4A95588081BE265B139EB2D65E AFZETTINGSREGELING
913,006,986 *5F05201D7F0E695080B986664ABCABECA4354B27 bennyvollbrecht
913,006,987 *5F0DCD80F361EE240A17845EA3AFE55B8F1EB704 BENTON.ALDINGER
913,006,988 *5F0121ED8A51ED470206BEE08966CFB71A03D8C0 berkeleyd6
913,006,989 *5F0B5E6C2A245B5BD19B2DF82AA97C044B3916C5 BERNIECALK
913,006,990 *5F0EBF92D30FBECBC3311F45F46130807DC7741F agkm4
913,006,991 *5F098BCC72146B30DAFE545ECA8DFA5A96C99A4C agustinhaverty
913,006,992 *5F0566344B8444680B9E5950D87817402862EAEB ahad-syed
913,006,993 *5F071B327EA8E77F650E17280EE906A497496C72 AH(_C
913,006,994 *5F03FBC5A2259785BE133BF10210D87A954436B3 bhbwg
913,006,995 *5F0E8797C43D8DB9DB8C8B29033B7AE30FA336BF aj8jgtq9znu43
913,006,996 *5F063660456BCCB143AE3B54C7A5192755E846B3 AKA)7
913,006,997 *5F05C245868C550BD225E8FBD923184D084F339D biosociological
913,006,998 *5F09403BB6A6B6F16F4785B2E7423A3A30CEB6FE AKNUTSFORD
913,006,999 *5F057543E079F7BB64FF061E6A1123CBE6D97D7B B=IUR
913,007,000 *5F0F4499B80A653B5882B77A021E6E0E2A994AC1 alarm (secs);
913,007,001 *5F0D3D9653EC4F8C8099ACB0FEF21525D4B9E52E albertorambert
913,007,002 *5F02E5170B7D3B4EE3A7DFA4C11193D4C156CB8C [email protected]
913,007,003 *5F034A0B871988EB420962195CA369ACEED774E4 BLACKBRITISH
913,007,004 *5F0B118B42B76AA2A94F25361DF854FCCF5D64A0 [email protected]
913,007,005 *5F092D7110A9D01C97207A771F448312F42CDADD blqpa
913,007,006 *5F0D2CF30E7570A724EE35562B9A6D03CC15F41A BN&AG
913,007,007 *5F01F4EF51E09DFCAC33C744940AA626B4FB3413 alonzohoeschen
913,007,008 *5F00C4450BD8EE5441B843AE534114A6B2A6E666 alphonsebanke
913,007,009 *5F020F29493DC69CEB484194089AA61B2045046D ALPHONSOFANTAZIA
913,007,010 *5F017887FC5AD16D74ABFF74C6EC352F254A0607 also,.joa....aufwiedersehen!
913,007,011 *5F042348F94E107FF798F360BF1F4E906A0CD34D ALTON.VOYTEK
913,007,012 *5F0B79B76DCCCB9D632931E98D78E62F5CEE94EE [email protected]
913,007,013 *5F04AB4D9AD3B68B5EF7294A98DF4D8A642FD87A bohdan1
913,007,014 *5F0697DA49CC61B314549FB3A5D8C5A835BB2836 AMBROSEASPLEY
913,007,015 *5F0962CF52829C555CC5045E07160EAF994850EC Bonderize
913,007,016 *5F039091C6E455D0E1824D10B3EDBEA61B1838BC bónusljóð
913,007,017 *5F033292161AD1AF998DAF501B3644B3A942C221 boreo
913,007,018 *5F08CAA80366E48DB750D44E8806785DD927FC9C analisisdigitalcom
913,007,019 *5F040D1C41555272BFD2C9A02CCEAAA8C2FCCE0C b----p~ `>-<
913,007,020 *5F002DB538D95B331971553BF71E4DD9F5F383F4 B--p~0.~o(-_0)
913,007,021 *5F0A6A3AA49AA5A79F1300822BA7003760276FA2 anciently!
913,007,022 *5F0905A83D92D8D6FA2867F7F22B7EB0EFE3D781 antaka
913,007,023 *5F0BAB252E483A9578872E9821053D3EB0526174 AO_0
913,007,024 *5F0429642F613F4863E097626D68F2F09279C462 aovsa
913,007,025 *5F0EE134461C0C3E40436E02822033F87FC695CB apb,m
913,007,026 *5F0A381B03CDF7817F70FEAD88DAC5BAF5DEE80B AP?/O
913,007,027 *5F0B54ABEEF63B26A3F309172B2CD708A8481F7E APPMUKYT8
913,007,028 *5F03A826F25AC5F223C130D46A875E06A01A5AE4 APRIL-CROUCHER
913,007,029 *5F0E113DE14CA4F99E0C4B79A827F3A0C8B0257F AQ67T
913,007,030 *5F01C264C11D2581B66DA1CACDED633EEB18DF1A aralif
913,007,031 *5F063DC27130F0F8B6B3504503431A69B8D2AEC4 ARDEN.PUNDT
913,007,032 *5F0EA5262DA069FEFD126560CEF1AB90C60733F5 bsu
913,007,033 *5F078A08792BF0F5E08FA65F29841DF3A2E35AEA btfxx
913,007,034 *5F033A117BF600AE45DA7632C200C5F8D24B9A82 b#&tv
913,007,035 *5F0B110B4DAC92EDF5D01591B84B2B305C45E23B bu9m)
913,007,036 *5F024424DDE546A93FFFE0C766543F106E671F4A ARRONMOONEY
913,007,037 *5F00BB08F6B59DE60320EAE1A013D55DD5E9E2B0 BUHA
913,007,038 *5F05D19EB35051B4F7639C9088A8914C17718E5A burgoon0
913,007,039 *5F04D30F7B08CE91A72B41CD2A11A94BA4C01DA3 asdfnites
913,007,040 *5F05AF4BC7E86AE57A03F41539822BD4D8202AD5 bvkg
913,007,041 *5F01C8A95625056F1EDE1B3FF35B83AC97011375 BW3BU
913,007,042 *5F00870C1952227E734A2C11F6799727A7DD5EC5 c\<1
913,007,043 *5F0B4BA3AD8003F73C0E268FA9D8308636043DCB C:3G%
913,007,044 *5F0A3FCEB900DAA30F1D86BEC5E808E834D5B239 c$4!_
913,007,045 *5F0AEEFC8C6531DDFC81B3FCFD3D3417CF3A64F5 a$/w%
913,007,046 *5F0AC438021CEC86C24AD6242DFF261103BD2A56 c7ck$
913,007,047 *5F01EB12E01652232299F26CD36B8D34678C701C b":=
913,007,048 *5F0909369DBAF411D4728684AC04972C5C30E961 calvinjapan
913,007,049 *5F0FD9424F38F2F22348E9CC9D68662F3848879E B1A2N3D4I5
913,007,050 *5F0138AE6C1248ACFCA64E97685AF004E0C4FDFA CANTATANO.82"ICHHABEGENUG":RECITATIVE"ICHHABEGENUG"
913,007,051 *5F004D7F9698E750EA66D56831833268EB06F639 b1ny1
913,007,052 *5F025A3C01CCA7F3A815C22742816EF52A54A3AD b2;ln
913,007,053 *5F0193CF2F0CB72895F03C634CCB38B0A01EF9C5 carlosyochim
913,007,054 *5F0F627BEF54B9AA2301D73493EFD2809CBDF547 B4D(
913,007,055 *5F09E72A876B1CE19DBCCEE0465691B10B075DB8 caroleyler
913,007,056 *5F0FE064F349147E204907F2F1D555BBB0AB187E b6epn
913,007,057 *5F08EC74EBE1471B4B785AEF7B6B426544D98DF8 BaB
913,007,058 *5F0E757874FA603D759E3D7F2E492FA822FA6576 CATHY.DILLARD
913,007,059 *5F0EBB7467DEFFF7A6378A63F1492675028C6E0D c'baa
913,007,060 *5F0D3C6D0AE381B8E1D4872B1CE212879182F566 ballstiger
913,007,061 *5F06BFE20FC2CB826781FD1AB6C6053A6C23BFD0 CCREWCYF
913,007,062 *5F01892CB1C86C20F6DA1C22B450941C837D6F03 c#eu2
913,007,063 *5F07EA6639BF488D5182B6FF3F679721507136A9 C:FF:
913,007,064 *5F0B59BC633AC682809E95B0A515F8935011BB0E C?;GW
913,007,065 *5F0CD8AB0E958057455BB7D72EF8E1B8E4BF9528 CHARLEEN
913,007,066 *5F0FC8C9AE55B299EF9180289210DD5BD93D6B64 chasedeocampo
913,007,067 *5F013510D3BDAA76DEF5A8828BCCDEEBFAAEB45D BĚŽENJO
913,007,068 *5F0E4BBF64A17067188600DC392B9E3A6EE85801 [email protected]
913,007,069 *5F01EC0F75220406032FDEBC8DA03A2B6ED77CEC c;(hi
913,007,070 *5F03E780B43E333F1AA1DFA26722D7683467CBBA chikarareviewallthatglitters
913,007,071 *5F0891C52DD6D4B08BB84892573DBD243B2A76B0 [email protected]
913,007,072 *5F0B924A1A48778FB75D2AE23A31101A1E282B0E BH:JG
913,007,073 *5F0E65E5EB00F4D303A300E11D2BEA52E5351A2C [email protected]
913,007,074 *5F099AF42FF1BDC774C51024A27C8E33FE9D310B CHRGL
913,007,075 *5F02BDF0C71E0685D73F132485D8191BE21C1E78 CJKNC
913,007,076 *5F00236122F2716FE824B657AC955A16623AFB0A b,kk
913,007,077 *5F023E9671B7E36E13C4AE09776068B74F8DDD38 BLAHBLAH70
913,007,078 *5F06B005693FC874A359835A3EDAEF075ABBD878 blsth
913,007,079 *5F067C27D4E39B1C8BA95466C7937C9730843883 CLINT.BULACAN
913,007,080 *5F0F49BCB9EFBDAA45396BCA1665A4F431B36487 c#l)l
913,007,081 *5F0A1C1800788C7F771886E7CD347A263BF91CD5 COLLECTIVISAIS5
913,007,082 *5F049D897A7591B11D7D5E7729C4050C08677CE0 bottend
913,007,083 *5F09BEDDCCC33AA41E287B71323A20150798623E CONVENTUELLESES
913,007,084 *5F0DB55DEA83569CCE74500209874118EA8FF395 bp,5
913,007,085 *5F0D4BDB8113C31BEE1DDFE95222597BE20DD27C bptsd
913,007,086 *5F05DC04F81130CD2D2D2164AABBDE1D6E725019 BQVZK
913,007,087 *5F0783062581460BE483DE64FA6E779BBA111DB0 brenda-battle
913,007,088 *5F0433A593A82DC8B5902A4167D6D0FDB1359E4C c=qc
913,007,089 *5F0AB70AB008CACE15711BF0C0AEADA35F66D5AD [email protected]
913,007,090 *5F0178F663D65D27F11B2B5E8AE447119C21FBEE craigvogus
913,007,091 *5F0DF9DD7644E74DC0F0793071E46022839F2BD4 CRBS?
913,007,092 *5F0B5662271BCD8368E1BB0CE36C1B0D7D820D7B c;r&k
913,007,093 *5F08A3A3B951ECC899EF66212108B1BB55B89F9F bs7z
913,007,094 *5F077898CF2E8484E36496141AA8727253977163 BUFC123
913,007,095 *5F039BAE702CC9AE5B3A0F73F0600B15D5145C35 bulls-through
913,007,096 *5F093FC4D3121D939D5673157B654F8FFD7E15E0 bunchbaced
913,007,097 *5F0D2AD68C1E71388382804269B6F28F47DDACD5 CURRENTLY.KEN
913,007,098 *5F05E0688CE5198AA30E398E95CCB0683EECF2C4 „BURGHÜGEL“
913,007,099 *5F05D9C3CAC7A0949BA95AE631FED30CB8B09E9D BUTLEAVEITALLTOGOD.WHITHERAWAY?
913,007,100 *5F0F70F4BC6111463D6B249556CF8ABA010A5E95 b?)ve
913,007,101 *5F01A81C40C5B5BB47BCB8F9532C32D18AC6467A bvkg
913,007,102 *5F0320A88721A3FE3738C2DAC6737B7FF50ACB22 BvX
913,007,103 *5F07B155326285793184095C791ECEEFB76208EC bvyc9
913,007,104 *5F062ED82329DE4499002C0E1A88AFC0FCBA32B4 CYNTHIA.GALLE
913,007,105 *5F07691A5208BBC661B5646C43E0134C7962E932 CY)RU
913,007,106 *5F01A464CFBD93ECB3F2C5BD8F8387703D025CE4 byjdm
913,007,107 *5F0B06D486A49B02EDFF95BC238B9FC998C4F447 d4i%o
913,007,108 *5F0ABE3DF13AEC0D66246762CD8E665A00FFA2A9 D,-6C
913,007,109 *5F06FE652509CDC2A7B6C027E876590DE0877B79 CA9ABCF2-F0E7-3FF0-80A6-71BEA8040F92
913,007,110 *5F0DB34A10B001126815060E53602638FA8C6EB0 caem7
913,007,111 *5F00D9FAE8CACD833D54CD22DF34B8B5C00F3ECB DAIĻAMATNIECĪBAS
913,007,112 *5F0A181B7758EB8A145084CB9D683335004B1D1B daloohcs4
913,007,113 *5F0070A862F519F42242D6F8D69416A41C9D6F14 damalige1
913,007,114 *5F0916EBD2043357FA1D532548B7F3716E11014F dana784
913,007,115 *5F054E2F6E5BD23CA532414A7AC832C5ACD49D71 caradec
913,007,116 *5F01841B5598EA42AA4B832E81AC63B9FB8C88A8 dannydiep
913,007,117 *5F0B9D71CD1338243B3950C8BB4E4733366F38C0 CARTER.GOLDAK
913,007,118 *5F0219C5F292CD56C95D20080C77A21B115233BE darylpleiss
913,007,119 *5F0C41E46145BF5D12DB3514C7E93F76CD4AE583 Das.Reich.der.Toten.(1)
913,007,120 *5F05B0E535B2D85228385EBC6C90DE6D5741B9FB DATE25-5-2007
913,007,121 *5F0305C1EE7ADE9168140AA571B65075E2D13D8E cbguardian
913,007,122 *5F0B44034B780F857D474F80362D642E92A5657E CBN8
913,007,123 *5F094352594B25F0B89FBAA4475603635A67FF83 db_aa
913,007,124 *5F0E12EC448CAE52333F88C0C1C7E1AA599DD223 ce$f0
913,007,125 *5F06DCDF03DF1652BB7547650DAB05F469F1ED33 ceuq"
913,007,126 *5F0EDECA631C6616F269C9A0FE59BC06DF6EC249 delmerarturo
913,007,127 *5F08DB5510E08284015E5177F05C7C7EDA572074 DELMER.KNEWTSON
913,007,128 *5F04DC32588697598F9B7700012E6C171D48750E CHARLIEBOIVIN
913,007,129 *5F06558A444DCECEF9C3A23A5EA13D184B7B5E39 DENNISTOMLINSON
913,007,130 *5F06DDE69932236DED7DA16E75FC2756E397FE96 DENYSE CHAN
913,007,131 *5F0EDBD773153E8772D37BB7491A55F096345512 DEON.PILCH
913,007,132 *5F055C5FF3B0698B3DDF38DAC261C9BCD9FDCB6B depressies9
913,007,133 *5F07B4BB745DBA7552487616394BD3D30C8C5348 cherries26
913,007,134 *5F0C069913BC95858D82D7B208BF0B8DF7769D61 DeT
913,007,135 *5F03219AF8298A09A990AE613A0C7E347491613F churchkuban
913,007,136 *5F01E693B85B1B075623DE17A183DC436AD0868C d#gm&
913,007,137 *5F0AA2EDD16C5C749763A7A1E766FBB5108FC0E8 d!gsv
913,007,138 *5F0EE0DCAEBC6D55F8B2279FD9F6662C9D1A6B7A CIS+#
913,007,139 *5F0F74209FB7FF7E2D5B31EA64741DD3C7F91A57 cjd4[email protected]
913,007,140 *5F058C5E467B8A7071FA3427E7A898818FBEAD30 ckato2139
913,007,141 *5F072ABAC51A8F6789C9CB4A5566C09B2CD966D7 ckiiu
913,007,142 *5F08BB861954103F46057E1A29AAA6F380DD93EC cl9=.
913,007,143 *5F07DEEBAEDDD0EB10762C3084A3FE9260CA515A CLAMHSAN8
913,007,144 *5F00E710388308E74FF866919033FC9CB7AB7ECA CLARKKIMBERLIN
913,007,145 *5F0AABE540AFF18878E4567E4F925B8B0B5C955D classicsoftrock:summerbreeze(disc1)
913,007,146 *5F08AE4910DD42DAC1957AC03A2284788D6B2F63 [email protected]
913,007,147 *5F01AC3BC6F27E7E1DF067B33564AB890FD43913 DIVYA.JOHN
913,007,148 *5F06C28E3710929E0656BC0E0473F9DB2485FFE3 dj)_c
913,007,149 *5F071C5231252B0C3D4A2BC841742B5E04C3436A cltgv
913,007,150 *5F0611DCBBD0511E0CA890B3C475FB8FC0E902BB DK!WY
913,007,151 *5F01D52C2B401142BE732D28E6A0727C2B97AD2D dl+k
913,007,152 *5F0224BA73081DB0ACF0D1E38F1BD59A5A2460D9 DONGDAOJIU
913,007,153 *5F0D83690B015F4368E5913E9864C9EC2A314D2B [email protected]
913,007,154 *5F0E1920A4847A9BAFC51403D2BB1F7068C0CE05 donnieaubin
913,007,155 *5F0BB7D47F2BCA130C35CA6F5C7B665005F3B872 consternant5
913,007,156 *5F0F354A91E08E0B6E2384DFFC6A79629811D079 copinsha7
913,007,157 *5F0AE3E5F7E45F7B68ECC452C7A1CE71C25D339E dorseykornbau
913,007,158 *5F0DCB59CAA345AA52C6928B1CF7310F55C8178C DOŠED
913,007,159 *5F0FCBFF102FF16C806E2658D50801E8520BFB79 COUNT_ZAR
913,007,160 *5F010A8C98B1FAA63C0A13D6C2FA9E2D171D1427 dp(gg
913,007,161 *5F019C82018E510F057D5B842789F961C06878F5 CP%)
913,007,162 *5F03BBFB883EC98F4DDC7ED9D97167E5A115C940 CPKI?
913,007,163 *5F0CC959719AFDA7A9D04EEFE67B5CE51AA036F0 DRCASIOS
913,007,164 *5F0E87E8B54F15BD0F9BB3E5E932DA54A7821A51 C#QLL
913,007,165 *5F05748E7094403E42FCCE584639B2C22233E011 CS+RJ
913,007,166 *5F0F3AB07805CDAA7DFA5C15DBBB5C99EA178284 DUOW3
913,007,167 *5F0AF173242BF24EDBFD311D418E952D08025A42 cuo-a
913,007,168 *5F028A6C6DA881D0387826C5E0B85F879C47CB4A DY2+
913,007,169 *5F03B3FD7CBE87ECAB3BB63B4D56DECD98ED0358 d#;?
913,007,170 *5F0C9C099C534C75B3F61673BE0950435AED71BD Economic.Breakdown
913,007,171 *5F0D58BA733AB74ABE144EE3FD283324D7A176DF ed$:&
913,007,172 *5F0C94041B6703086E172AF7ADF40A93623DFCE2 d6g4
913,007,173 *5F0FD6EEBF58EB5A725E62DE7675BF18A86B8F93 d7qhy
913,007,174 *5F0D6524DA0ABA9FCC9544AF0803C4B44291FF9D d7xu)
913,007,175 *5F0D237A971E27B62B0304474E187157B75E5F0C EDIFICIOS.Y.ESTRUCTURAS.DE.NAMIBIA
913,007,176 *5F0FF7D03D0114D53AAC6806F53A33D33D0DDDD5 D9ER/
913,007,177 *5F0FC03032B5BE489AD3EEC491B8B4CCBE45366D EDNARDAJ9
913,007,178 *5F0D5AABFE341E52CF81D012FBD85F51E9D2C17F dalewanta
913,007,179 *5F0D08A6CA35EDDFD220EB2A32C9E29E93CCDD1D edwed
913,007,180 *5F0D40EB72E65F96BF4BD47D5674E5D681FFF79E EGEILFMU5
913,007,181 *5F0FCDAEAC87E9ACC8261B0F0C846832F49A1EA1 egg4
913,007,182 *5F0A6B236F309D7D40A9210C2395E31F85FB5777 EGRESSORS4
913,007,183 *5F0A77B7230267A4B2E7197A0DE5C2B3B0676B70 DARLIN´
913,007,184 *5F083E54CA4855500FE4C0124212AB2295B8E858 DARNELLCORNES
913,007,185 *5F01E71EDF079E4E37400B2F56FFC6B91CE1F75B davidbrunker
913,007,186 *5F03388696798FEE6DAB1DED5F1B4140B317A461 EKCENWOL5
913,007,187 *5F00E2AE047709801FDBDE0F7D5B407F09296220 EKWDL
913,007,188 *5F0A9BE120CDE64C46DBD4E26773BC481B09197F [email protected]
913,007,189 *5F01ABA1CF95A8F4355C69E205404C2BE5B07CB2 dbor$
913,007,190 *5F0B3633809196AC43F595DBBDFFC758D84439F2 elgg_
913,007,191 *5F0A500CA20915E8355191116C7BD0A2F6065A28 ddupn
913,007,192 *5F0D4E6272CA20DF1A9F2AAF4C3E64D800F91D50 DEANGELO.BACH
913,007,193 *5F094C73B104993303444C0F40BBA812097732BF decnatsi3
913,007,194 *5F0056422033BF5486861BE9738760D0D2566CBC ELU3
913,007,195 *5F01CDF4309A2EFB66C1128CC03DC4331DF565A1 DEGW
913,007,196 *5F0DC3B704ADF400239F4745774E3A53C40C07C9 ELWOODOPDAHL
913,007,197 *5F054CD57621962007D334051A452F5474AE2F5E EMAN.SHAWKY
913,007,198 *5F04762740AA64B8BF375C732181101F7695EBDE delphus's
913,007,199 *5F0C4457363ED2B7222F33EA273618AD3023A3FE deonskupski
913,007,200 *5F02BFA188B7C44E2A2723E23E118C0B54A8B436 emperador gok
913,007,201 *5F0DDF23B14E6C5A2E0F83191A773E5BC5BD69AA endebout3
913,007,202 *5F0CC8605429E9EAADBBE538CA1CA8DBF23E6B11 enfatizar
913,007,203 *5F04F1EF017CC86768395FC891B10B4F8F7D7E54 ENVARONARING
913,007,204 *5F0F97015491705476AAEBAF864820D078B7DD0C DEVRIEZ3
913,007,205 *5F02F712168D5A9F56431C67C77FFB10EFD2FAD0 erwinmawk
913,007,206 *5F04E7B862757C77A08E86F94984D0E002D1B067 [email protected]
913,007,207 *5F06D8EC58D1D7E37FDAE43D03D9E5A3906EC7B2 DHLI3
913,007,208 *5F06D3409D98CA157EFDDDC4807079F0FC41D2BA ES:WQ
913,007,209 *5F07FA3C3B63D644539B2BA93D05B48AFF06A841 ETOILEZEPHYR
913,007,210 *5F0A8AC15369943174717794CA86D6A4472D0D51 dionfreels
913,007,211 *5F084D0FBF3D5435A427A10B8ED2EA08AECC71B4 eugenestodghill
913,007,212 *5F05E5C63DFB785C7BF2A0AB7EE1CC0FA7387CE9 diorthoses4
913,007,213 *5F04FB8151A7EC1BD35D257A50D36F5E90FE4FAC EUGENIO.VENUTO
913,007,214 *5F00DF3306319421E38763669DB9AA075799F8C1 DISCONNEC7ED1Y
913,007,215 *5F001F0891A1E6B460D837599B9FD8D7B07C67E8 DISCOVERY
913,007,216 *5F02C4D71E34F4BB8C4D203DD0BEA5BAD9F2029F DJA1
913,007,217 *5F0FB838003AEFD2A77B71FF048A85E78EDD17BF dju#p
913,007,218 *5F0645C134ECE6487D9602401617FA8528F9D21F DKE:5
913,007,219 *5F073E644DE2D5C0ED4FE8574F4E8CBF6542A093 d%m#5
913,007,220 *5F0BEAF5E7A6489F13B16C54056297C12E220EBE fadeoutguitarloopsiv
913,007,221 *5F0E50289553F774C095FB2D389155A9D98C02B4 DNAGJ
913,007,222 *5F0EE34D26013289B597376341BFDEFDA7B65145 dnetseoh4
913,007,223 *5F0EA7FDD7177F411709C2BCA6AF7324B3991042 FAVORECERSEIAM123
913,007,224 *5F0BFB8B53C59D53D94A1E3FD462E38321824291 [email protected]
913,007,225 *5F0F5900AE0A0EC920D58D0C191D5667490FB64A DOI10.1245ASO.2006.0
913,007,226 *5F0CC7F82B21EF76C9C8A9D01C3B51B0FEE84303 domingohinkle
913,007,227 *5F09319BC52FB00CA7751C47AE9A14FFEFAE7CF4 donniekempkens
913,007,228 *5F0A76BD2B589B919D795C51BD774822959007DF don't.look.down.(dub.mix)
913,007,229 *5F02E9325E1822FF7ECA236DE1231059E1BC820F FGRANDA
913,007,230 *5F0E2AB1DE3D17765053037E7644D0B61424C614 DORSEY.LITTER
913,007,231 *5F04A0375D8A8876C9AC1AB9A2AB815BC68E0265 do.you.not?Servant I.do
913,007,232 *5F0483EF901374BB827AA8B85ECBE9A5B20B8E3B DPDT
913,007,233 *5F0C1AFC971438A72690F9535B31ED3B6D595B36 DRAGONFLY-SITE.COMWWW
913,007,234 *5F02609AD020F61FACF7614544B6165158C04AB3 dreamingofthejungle
913,007,235 *5F0034BB401025114146D9B7AB6BD1E1CA9ED14A FLORESGUATEMALA
913,007,236 *5F028CFDAFF2E824D397A45E313DA9961053DD51 [email protected]
913,007,237 *5F046AC941DBCE83DBBBDA042EA011012EC36145 drumble5
913,007,238 *5F06375F97E3DCB6960A977B831C8FA35F851F35 FORBIDNES
913,007,239 *5F0A6CBB00F21C71E144A0E353FA77BFF15BCC70 DUA
913,007,240 *5F06108DD637F360C619F21F07E10910969EA70E D$U,I
913,007,241 *5F000A774E6B93BA4D824A8742A194FB59B43CDB FUNKYTIME123
913,007,242 *5F0F85D70008D8B1EEDA9D35BF07EA7904FF85E2 FUYUIII
913,007,243 *5F03AA00FBBE515CB4E7AE31FFE6B3E8D076DDDC dwq,
913,007,244 *5F07660C4222CF55732F2B1A92F2F2119C5F86F1 DY-.O
913,007,245 *5F08CF091BF221A8D4C56F618132D212E7F2180D EABZLG-KRZ.SVG
913,007,246 *5F0339DD6D50C64C0B97811DBB710970AC24CC89 earnestartus
913,007,247 *5F0442E42F8585CB7CEBABE5EE66D3AACDFBD390 ea-u$
913,007,248 *5F05D614D9D72DBA89502C127EA526417AE1B6F7 [email protected]
913,007,249 *5F0941F9EBEC118375343FA614F712ECC8C42B45 GEORGIANAPUSI123
913,007,250 *5F01F9ADFB5C521E547138F11ABDC474C572C4BE edn4
913,007,251 *5F0CF348EE8651D740B32D17E0D1E62FF51F630E EESGO
913,007,252 *5F0BDB7D668D32166D0948CCFCB0E8629EB77419 ghetto raga
913,007,253 *5F0577FCABA0F96E5D8672BEDC6CA8D7BFE0CC4E GIOVANNISARRA
913,007,254 *5F06951FED83C1ECDC626D6EBF76C2935CA419A7 eiggl
913,007,255 *5F0E038238157F9E3306FBB5BA597D2D7159EDA0 ek7a+
913,007,256 *5F088BBB8D7747AD144259B651534E263BC3CB92 GLENNNOWDEN
913,007,257 *5F055BB7ADD46A42ED21164202505C169EDC9070 elblm
913,007,258 *5F0D3EBD3820B7FF672BABF666A91D7FCC594F9C GONO-DE-T
913,007,259 *5F085F60CFB6D57AFC94255691BE4C556FA51EEE goodmansgdb
913,007,260 *5F000E74C6B8BFB26E347B489ED76522097673AA elmna7ons
913,007,261 *5F0AD898F3F4823117D11E109EA82CBA530FAB5C elroygress
913,007,262 *5F052ED7C88D6A07EA63EAF9C626275D81F91DD1 eltonordones
913,007,263 *5F0E4AA5968D08364EDCB3D06431B9B9C0F28EC7 ELVIN.VESSEL
913,007,264 *5F0DEBCEAC7EC4187C5D88D7A91D59846F78BE62 GRAIG.ENFINGER
913,007,265 *5F0D52E74E642093F9B63BC00E55E703839EA891 emeries
913,007,266 *5F04047C0A84FC3963C4073C86B1D97DD3CC84EF gregorymassie
913,007,267 *5F00FE5BA90504ED03A6B4C735B2660FD587E3F8 EMORYKIENTZ
913,007,268 *5F053B48D5F0887B252686BAFF4C01EDCE38BF74 EM)ZF
913,007,269 *5F05117A463A8C812447B9F041B1C439B168BA20 GUANTITATIVEMENT
913,007,270 *5F063827089861C742CB11EB245EE946CC277050 enparina9
913,007,271 *5F0C3BB504FB3AFF8ECE1BCA0BD837DC2C40A2D3 gunner1980
913,007,272 *5F03B6392926618A8B4D23920DD8D465EDDF2000 HAAIACHTIGS
913,007,273 *5F0A76A3AD044FF1E29CF7732DAFC995A7B0313A erdah
913,007,274 *5F070B67DED9FAB10004ADCA8A7B75379F6C7BC5 HANDSMDEVIL
913,007,275 *5F0213E82BD39D2A45A02738D26836D3A64B0CDC erinsak
913,007,276 *5F0C99A06739E773682F9815E73389625999BEE4 ERNESTO.RUVALCAVA
913,007,277 *5F072139EB41DC9549B55895E7A81D544CE75971 erniesalim
913,007,278 *5F0A31B2BA8C80E84B1733C8647F1EBC50B910D0 ESSENCEGRANT
913,007,279 *5F09BD21E05FD53881A02095593266C9E4DD7623 ES.WIRD.SCHO.OIS.GUAT
913,007,280 *5F0DCBF41A2D6BA31A1CD1BA0DD49DB62864E885 etndelse1
913,007,281 *5F00E2C1B8A38191F2A5A705075CF5AD3ABE308F eusebioglodich
913,007,282 *5F0D3D760D1CAF216BE1DEE91090DDE142FD3DE6 EUVRN
913,007,283 *5F0B0F653965F0B4EE84955DC14BFFAC9165FA52 hemnolina.hoxha
913,007,284 *5F03788DB9C4E52ECE5E6491673F36958230DA6F HERIDA-MORTAL
913,007,285 *5F0B390B7192D1261F01675653ADAC301CF9DE0E highlyrecommended(featmentalpower)
913,007,286 *5F05678E08E1AF1EAB825D3E8E97A95BA8BF29DF fbailleulauxcornailles
913,007,287 *5F0B218301288AF7CEF40DC55CEF434C27A82A6E FDQ6
913,007,288 *5F0C1BA071518A699C57376309C853DAF777FC1E HOLLY.ELAINE
913,007,289 *5F00A850E7A4C57033EAA9100CA43B6BCB905711 hornhuiz1
913,007,290 *5F0608767BF78A013A16AE39B185D4377E556936 ff9n
913,007,291 *5F0141CFD9548FE01BD88B465313E88AB53AF66B [email protected]
913,007,292 *5F03004A157EA376C75FAE3E0B1010C853B2CA18 htiafdoog
913,007,293 *5F0B97D9F2E432841D57D88386F22AB11F664E7F FIVEUTTARPRADESHCOPSGETLIFETERMFORFAKESHOOTOUT
913,007,294 *5F0A7C3698F5DFBF60EC391F0DCC92042C9D4643 HTTPWWW.MYESCROUEN.C
913,007,295 *5F00E3D07FE4E8E9575F3EC3D059A59CFC090F58 FIXED-ASSETS
913,007,296 *5F062220818AC9901CA95469FF67CA9D4C2981A7 hughastol
913,007,297 *5F0828043BF33BE3A15E6066FEF61EDD06D3BBD9 HUMBERTO.DARVILLE
913,007,298 *5F0E0B4400CB36F1B8ABA367F3DBFBDB3ABC61A9 hu,v
913,007,299 *5F0093A6CEC77EA4B378EF8D1F0502DAA9DF3467 idmag
913,007,300 *5F0A4AF02D715ECF3675F2C59A525C887FBB0C5D IG-2000160TALK160
913,007,301 *5F0F9EFD908A04499499F32135485E94675752B2 FREDIA.
913,007,302 *5F080086F53D68A4770B303B5DD8BB77CB568B02 I-Keep-My-Eyes-on-the-Ground,-Afraid-of-Meeting-Someone-I-Know
913,007,303 *5F094A4C7E7F034A3E78471B9FD2FF530E36F3E0 ilinasra2
913,007,304 *5F0D0181F46B4360E46A8A80A17DE6DFE918C19B funsekis7
913,007,305 *5F0467776E811882E0AC29872FEA7AFC59C32D9B ILUVSURFING09
913,007,306 *5F0B4860472CA35DEBC3D265A8A773571226DC6C ILUVTULA86
913,007,307 *5F01F9E2C2D9166D3657E48E01D5C9E67303CFF3 ÎMBRĂŢIŞĂ
913,007,308 *5F0C3D460311F4F40E46CB9C298B1ECE1BC564EC IMMOBILIENINTERESSEN
913,007,309 *5F030B02D4741A935406EAFEC758658D180FDCBA INCLUYERA0
913,007,310 *5F0F1810DCF2DEF40C8FFF0F3A12D186447DC809 IN+ERMEN+A1
913,007,311 *5F0FF6DF97E0DCC0CCA72F26239B9EB53C7D1A55 gabrielle
913,007,312 *5F0F1841D5D5B98D3FBAC5BA1DCBD9B4A7FD3FD0 galegrinnan
913,007,313 *5F0561EEB7498EE1AF4D002BE8D7A24EDEA3E589 galvauder
913,007,314 *5F08EE62748E207204335CC6AF661C4ADBA5CE41 in.the.next.room.lies.our.destiny
913,007,315 *5F0492EBA4771FAD04B191D06B569CAF4951157E GASTONDALLAGO
913,007,316 *5F0DADDD0DEA0125DE5DCC9958B38F27440D2B88 G]B
913,007,317 *5F0A0ABFFE36DDF09CFB3A4B733875B9803D6A90 irwinanelli
913,007,318 *5F066BBE017791E56B5EDAFD41109A6CF80D37AB gcnp
913,007,319 *5F01257F6A773C389B2F557E8FED12A2A3273A11 [email protected]
913,007,320 *5F0A0B06A85A87DE65B2770234F51907EBEE36A6 italy6
913,007,321 *5F0585920931E33E45E1EAED1BCB4FA6C5FD6201 GHIULI
913,007,322 *5F04671EA635FB7E81DD6174C3CF5D4E607C0B12 GILL SLIT
913,007,323 *5F0D575F70F7892C63D719EEB17C2EBCF1667E8A IVAN.FAHRINGER
913,007,324 *5F0FD2AA82E88261B7DCB9D5D1C77D73350A12BA [email protected]
913,007,325 *5F03EA4974CF29763955CC063B8397F0750B609E GIZZARD
913,007,326 *5F07D7A919C9172EBA03E4A6587548FB85BF55A9 goainformation
913,007,327 *5F04CF51B380D7EA9ECA96B5E184EFBBD62BD924 JAERIESGO
913,007,328 *5F06F7A24EAB96C0A43FC622B7332ECCAD9CED96 JALANUNGGUN
913,007,329 *5F0FF1BAAF56E640F0CE57007D733FDCF46C75D2 GREGORYLAHAYE
913,007,330 *5F08686E4389AD925D145FE67510FEB8145AC3EB GRIPETIME(FTSLAND8BZAG)
913,007,331 *5F011BBCC7B26C115076914E11BDDB9FBD40AE7D griponyou
913,007,332 *5F0EAB7D29D368A7CC1244202218F1D1CD539810 GUNBLADE.BBS
913,007,333 *5F08091AB68D03929D9F4CD1D6F20A1F15FB7A7E JEANETTE-BENSON
913,007,334 *5F03490F591E2C499D521AB966E1C58B0FB9FBDA jeramysirois
913,007,335 *5F0DAC9A447BB63DB157D3F03E0C71F8FD3128D1 HA3MORRHOID
913,007,336 *5F04305E778E76CCBF46FC55B6A24477A21E3C50 JERROLDGOUDE
913,007,337 *5F0469A5F3EEEC55354B92B8CD751EB30FE12E06 HAIBORUFF
913,007,338 *5F0DCF6D3970A57519FD3D51E112921E19C0414C jessicasteven
913,007,339 *5F07B62CC422ED9EBA6CA33C430AC8B9CC4A0371 jestervalerie
913,007,340 *5F08FB8BBBC88E2BECFA6EE3DEDFBAAC86D544F8 HANSHYMES
913,007,341 *5F0CC1944DF97B6A31720CF2301A9E397677DF43 [email protected]
913,007,342 *5F03904A823EDC3CFACBAFA48C7E6580485FE037 jimell
913,007,343 *5F07C51A605DBABF366AEFB6C5E5FB8345299BA5 JKAWIZO
913,007,344 *5F0478773F9D3AB7A0B8A2AFD2CA43E49FD01EAD HASSAN.TURRI
913,007,345 *5F08AF0E49783934ADFB89B4FED2A168F549BE11 HAYDEN.VINEYARD
913,007,346 *5F07450EC95E87FAA21040CF8BBB5D23B60C7452 JOELSALES
913,007,347 *5F0A6DDBCE8B606F3B4350B0E656B8D6E9B5ECDF heavenissmiling
913,007,348 *5F0F6E4AEF4468E5739C182D51C7AC1F163DA910 JOHN MILLERCHIP
913,007,349 *5F0582B9B052623FE9D3FA22EE1A4F8D04F0E330 HEKEF
913,007,350 *5F0FBA8265338B417380514B77A9837645103E07 HELLEBORUS7
913,007,351 *5F0820CB094252389657796CD594E4D286437D51 JORDON.COCCIA
913,007,352 *5F0E362B77CAE6DD831BF52D2BE50870A58931A0 JOSE-CARLOS
913,007,353 *5F02EA7BA5CFC0A63DDCC885501ACB61B4ADD273 HEXAHYDR5
913,007,354 *5F08809CBE065B8B1EF844B1D4F81A8227AC9045 JOSPEHLARUE
913,007,355 *5F09189DADC4CCE8B7E7BE3F1905E69D4F5997CD journal1$7$
913,007,356 *5F02E3AEBFB1780F22087F95D8E66646D69378CA hitting-on-nothing
913,007,357 *5F004BBAF87DA019D63FBE867905A6E5655B75BF JUSTINELENTZ
913,007,358 *5F023F7DB4E96AFEE947C5EE3579D985ABF0E3B7 HMAFFITT
913,007,359 *5F07739F7162D4A4D7F34B9DF7C2520D56431B9F [email protected]
913,007,360 *5F017E0E83AE0907D32FEC8D832B4E2F04B643F0 hobertwickstrom
913,007,361 *5F0CF638860086F4F1DD6AF20220F008AE63B8DB K41E-RUNT
913,007,362 *5F0AD14302C89BC4F8AE7E2D1E5CF69FF44F7F9B KAGGANE3
913,007,363 *5F0FF3410A9FE7A948D14F3A42E3E7CFE229040B hongzavadoski
913,007,364 *5F04E86C8A7065C4EFA902153609C5C8E2604BBF HORACIO.ELLER
913,007,365 *5F0BF49AAC570E8040BA4D2D6D2865319AD3F05A HORTENSIUS.
913,007,366 *5F0D70FE15EE49B6033CBC1A8DFAFBEDD169CD4A karareta
913,007,367 *5F07699653E6B60A709415733FA581CCF5E40D01 KBGREP42STAR
913,007,368 *5F0256521A5BB03391E26B82D86BAA2850B7A0F1 KCAWBSW6
913,007,369 *5F00B10B03C4EC25A445118BE38F3D20E9A485C0 HUEMPFNER9
913,007,370 *5F01E0EC4B97B47860B32E4A1EE28C4822F81F17 HUMBERTOBOCCHICCHIO
913,007,371 *5F02C763753844B72FF8F3A72ABE1BDB790FD5EE HUNGARIANKINGDOM-GEO
913,007,372 *5F0F1ED8FE6BB32249749CC397859B1078D8A361 [email protected]
913,007,373 *5F008F6758BE40D9960646F6A5B7BCCAF011A7F8 kelly.branning
913,007,374 *5F087024A518650CC9B28384F19CA227B58494A3 HYDRATERRA
913,007,375 *5F022B529B5AE65514D739EEA607D3E0CCAE68B9 i}86
913,007,376 *5F07AC23AEEEF052B596DF450C864B29DC100E56 KENNITHPERROTTI
913,007,377 *5F056D806DB9BAFB480C9339E5643F7C1021805F KENTTEEPLE
913,007,378 *5F0FC9AA2D6820BE07FEDA2F1C47AC6EEAF06D3B KIRBYLEMEAR
913,007,379 *5F08077186301D83BE4A2886A2C7368688D8C2A8 KIRK-KERR
913,007,380 *5F04499D071D1380A1CC4D02BCB4ABC8ADABCB0C ILMARITOÈUNACOSAAPPICCICATAUNFIGLIOÉUNACOSACREATA.
913,007,381 *5F0450DEB6672BE63735F53D42B6E504A278E767 ILOVESHITHEAD123
913,007,382 *5F02F78C824BDD8CF5C5983D209B75370F1A76B3 koreanwarmemorialrear
913,007,383 *5F0FA6D35E174FBAC02F9CB8B26480757F45055B imagisms
913,007,384 *5F0FEB20BB304033EFB939758193C69E9D11905F «INDESIT»
913,007,385 *5F0D8112D5D570C8E15E4E05286155F893BEFFA9 kristyneal
913,007,386 *5F05F7094A692B06918A5BA7D30599A24F071BD5 insol!
913,007,387 *5F0C2E12CCD668D3FEFB17D652991577A5C28471 L3UC0CYT0ID
913,007,388 *5F0E8410E70EA9692F257C171B589F112BF91746 INTOSSIC2
913,007,389 *5F0CA75E75D918B26575B90BE59AE32E4EABDD48 investeren7
913,007,390 *5F00DD8CB6BB1698D53D0302DF30EFFB4EACCCC3 [email protected]
913,007,391 *5F0C14CC355F102EC9BD3891A3BB32C76DCDB90C LASESPIGADORAS(FEAT.ROBERTOFLORES)
913,007,392 *5F0F9FD3CEB62E052F108580BCDE3024E0BA6557 LEIGHSURIEL
913,007,393 *5F0F715FB244F3652A60414C5FADFCE567844305 LEIZEL.NAVARRO
913,007,394 *5F0D8CA4C79A89CF804ADD6C29AC97F9C329FE84 LEONARD.CLAYTOR
913,007,395 *5F01873F473BF24490CC38B038FD53A85BFF9F79 JADED.&.ELATED
913,007,396 *5F0CDED5FF133475F4576096E422CAF60B0A73CF lesbianism4
913,007,397 *5F095B861DD7E8AC423365E633299FCA892D1946 LGESCYCA
913,007,398 *5F013EADB5B47F8518021681F87B1FB960051BBB [email protected]
913,007,399 *5F0C4067704935C7B3759326304144778BC6D1D9 japan、2008年6月26日。
913,007,400 *5F0108669892CF3AAC5F14D68E70CEDF6F3C888A LIJEK.1
913,007,401 *5F01A929E939216BC4F18D4BE5288D5F7BD38717 JASON.OVERSTREET
913,007,402 *5F0112439A1FDC408B9AB46620C9D70F607E01F2 lindsaystano
913,007,403 *5F034E3CDC73CDA936E9FB70DFE5B171998C0CE2 LINO.STIMMEL
913,007,404 *5F085D66D535ADC319A9ADE24741D74077E5180D [email protected]
913,007,405 *5F089CB9AE6A5164F6BEEF2F6F10EC30326504CC LIUXUEKUN
913,007,406 *5F0F47790C3123693EA58C8206E67B2D35E0606F JEFFERY.KATZBERG
913,007,407 *5F00C4182C740ADC2F2CB428C1666D0042C0EBBC jensjacobsson
913,007,408 *5F013F071DC7A04C0669F1DFBEA22EFAFAF78A39 JEREMIAHLUSARDI
913,007,409 *5F040139CC2703B31B39523569E55485D571821C JERMARKDELEON
913,007,410 *5F0404BC99A9878E0B0D8F349F00D728981A3318 jeromeselvig
913,007,411 *5F0E664529B78667D2008A9B80B38150FD384422 LOCATIONHTTPWWWEAST
913,007,412 *5F008E3A4095EB2FB773A36C6F9F14A4CDB3A0BB jeromyschluter
913,007,413 *5F0F4DF646068215D2C4571FF9F5A2F5A9D942B6 jerrygarhart
913,007,414 *5F0A03CE84164F312B8EE1BDA453E21B1FCDD945 LondonXPress
913,007,415 *5F00618BA8067F9EC445509205A248A787E90610 lonesomeinmycabin
913,007,416 *5F0D37151420F911A9DE78777F59717AC5D9B5E7 jesuscentola
913,007,417 *5F0EBF298D8BB0A58A9BB129D6E8FBA9461E0B17 JESUSREI6
913,007,418 *5F08645984B701D1ADDB08BE9B5B75CAD84F713E LOOP-IN
913,007,419 *5F006F91B1661B99209D6B74FC5B24FC2D03B756 [email protected]
913,007,420 *5F0801C3D3D94B71961A8A79882FFCA8319280F7 loved-the-hell
913,007,421 *5F0AAF72A561A63FC6E9AA1515EE14A8A9ED6217 JIMPAIVA
913,007,422 *5F09CE2E6DB8E938AFDDD85AEB3661C85D850490 LPORTAGE
913,007,423 *5F0D9D84972E21C41B817AB9757518DD6E86805F JJZLAK5R12JMFM
913,007,424 *5F074C70A1FFDDBFD13696CDBC4DE000C4DC2027 JOHNATHONWILDIN
913,007,425 *5F03714C233ECAED4BAC7F8265DD94FDA49EDB28 john fred
913,007,426 *5F0685E5A44239336CF6E6DF1A24041F7F7B5A4F JOHNNY.TODD./.FAR.FROM.HOME
913,007,427 *5F04ADAE26B8BB5A5F09F25FD503903373C0036F JONAHKUCHLER
913,007,428 *5F041CA19AECE0DE88B195B95234FFA5D0B05630 jonathanboots
913,007,429 *5F0D484D41ED97859BAECF697B72B9B36BAAEAD9 m0rt1$1ng
913,007,430 *5F04980258DC69FEEA23CBA0686A023105049A8C JOSEPH.MACARAIG
913,007,431 *5F02BFC82957A5D63DDC14D54C1D2FDC4B666313 josueklinkenberg
913,007,432 *5F0F361F51EC0BC3041CD6FDA6506A846E635B63 maggi8
913,007,433 *5F089F76910D5A072CC045E9C4F3C5397C01E303 JUAN.HIGUERA
913,007,434 *5F01F357E1BB5C1D78DAA5AA1982A9635227F1A8 manjitjari
913,007,435 *5F080DFD57C8B50B79473B81E342A8D4D66C02F3 máramarosbeli
913,007,436 *5F0C1BCCCDE406B4437B64952DBA3E61CA45B4B7 MARCMALPHURS
913,007,437 *5F0B697BA6B06FB39BF74F374ACD052D9AC6BE2F MARIANNA378
913,007,438 *5F03DAECD9AF304F021215CE87B6A8DF82307986 KAJSTUR
913,007,439 *5F0BA7F6F5A37E33FC00E33599F660EBDD33CF4B kalimnan
913,007,440 *5F0169FE0554A70B4527F59CF9C2AC7F7BAD671D MARIONSURYANARAYANA
913,007,441 *5F0B79B3F7212265EC13866837561C9D86D4C304 [email protected]
913,007,442 *5F0BD36E9A0BA4952B08EA06FF49C87316026A47 marisol653
913,007,443 *5F0764D89ED301BD9F0B617649FA7945F9E4B8C7 KARL.ASHDOWN
913,007,444 *5F0CD7EBAB4E2C00A20B4C0D4659634EC82D4FB9 KARMASUTA7
913,007,445 *5F052984265EF2E4CF032F0D2410EEB26E2CEBD4 kate-davies
913,007,446 *5F0173B38A4FC9CBF0ACE4EC701B17660AA76328 KATHARINEMCPHEEATFORT
913,007,447 *5F0C2D4A9B03993ED7A9D9132C90CDB65BE6CA23 MARSHALLDIVELBISS
913,007,448 *5F03EE4C0685907A0C587C80B887EF63C1107B76 kayla-ann
913,007,449 *5F037EED1BC7EA20E89590E65DBCC033D327C77C MASON.PANZA
913,007,450 *5F0832408261DE1062EFFC49115BB284201F6A01 MATHEW.MELSTROM
913,007,451 *5F005C22CF3D81300237EF1BC380C7DD6ACCBA86 KELVIN.PIZZULO
913,007,452 *5F0D7CFDEA94E9A9621E442E7626B9C684E575CA kenthertler
913,007,453 *5F015FF3CA77FFF12A1A0D34518D005B7FD15BD1 KENYABOYD
913,007,454 *5F0F576C90D88E36130C2A418CBB7F9F269DEE34 kermitkaralis
913,007,455 *5F0D4BF6BED83A0A4F6E383AB3DCFB811F886077 KEVIN.VELKY
913,007,456 *5F0FB84AB258D21737A6C808144FE5A66825DF16 $KH$M
913,007,457 *5F00853206782E0F83354950BAFC0F17818EE14E K[i
913,007,458 *5F0E195607FCAB7CAD0D31D66B62A198241FDEDB kitacched
913,007,459 *5F0DFAAA25449B763532E8A2A0E7B3C4EF8B8A8C menisci
913,007,460 *5F01429762D034270236E53D079DEC599E03FE99 korwb
913,007,461 *5F04FD0EAF945C50FFBA7388B8434407ABBBB15B KOUENGUCHI
913,007,462 *5F0F8F6D49079B551856F5F68D943B93D0868842 MICHAL.MIHATSCH
913,007,463 *5F032CF0BE7B43CD68D1109E5F1C7A72E24936A2 MICHEAL.WITHERINGTON
913,007,464 *5F0A54887A871DC22CA6EA726F3C7F8413B7148D kuemanu
913,007,465 *5F0C4107F1D5727550A178C791ADB88DEE2F3C5B mike631
913,007,466 *5F00D9C96A3BB872C54B1DB1FF0BE63DE9BBBD6D mikeykim7
913,007,467 *5F0AA4DFEE6A131E4E6103FEFDAEDD8296671BDE L3031869
913,007,468 *5F010911D42BD36FA2A74E00A294673713E62CC6 LA ABU TELFAN, ...
913,007,469 *5F09A2373228C39AC76A53BAD11FB719E93FCED5 LAFLAMS5
913,007,470 *5F0F0B2EAFB3D22B7D5673C152540187DCA3F627 MOHAMEDSAKHO
913,007,471 *5F0E287ECCC2A4D76960998D326217BA93A241A7 MOMSCOTT6
913,007,472 *5F0C5B026B911F77B6C2EAD376379C53B47A4244 LEE.REMEREZ
913,007,473 *5F0853EF56F3591DF7EBBA8EED4CDD9CCA6F4AEE LEIGH.KOSOFF
913,007,474 *5F0B783A96FB7E170C7714EF83A86D4743C9FABF [email protected]
913,007,475 *5F08D92C4441609B9291F5D6E70012A0494D5CE8 LENBERNET
913,007,476 *5F0B7B20B9A27FA5C0247E3EF9C15E71649F23A5 MORN8
913,007,477 *5F0C61B033841CEDEA19561759F5B6E4E1D9B0B9 LEONELHOWERY
913,007,478 *5F087BFAF3FEA6F344F9937C54D81FFCFC876A84 [email protected]
913,007,479 *5F0D99E4BCEA0E44341CA3BEA03FCA1540FD3009 LEOSARNOFF
913,007,480 *5F041516C5EC5603C74FED312D0ACE222DD1563A MPUSWIDE
913,007,481 *5F001A19956205C191FA85AA24D022363AA4750E [email protected]
913,007,482 *5F03AEDE297227E288A7A9B53ECBCDE81DA4FABB [email protected]
913,007,483 *5F08B00C0FC4A2CF06F53D9F6FBF53D1E41F15AF LINDSAY MARIE PAGE
913,007,484 *5F003CAF15DC8C205B3C7AABE69444766D73EC86 lindsayronald
913,007,485 *5F0C0D3B4FE581599A09238F0775DB66AF06DDA0 lisa.coster
913,007,486 *5F02CB4556D6AB03549891314BA7B6A0FE569179 [email protected]
913,007,487 *5F063EFD289EB6E137316D29B75B603983259C40 [email protected]
913,007,488 *5F0B506EA85E1829F6831A2CECDE4FEC1AD71413 LKIVEL
913,007,489 *5F0629F89E5A857C81B2A4795A48BA764B4D84F2 MYTHTV...:
913,007,490 *5F0490491C10B21FFAF26643A186B1D358C781DF MZTECH
913,007,491 *5F07C634515A9F64F6605301375691D4FD82F93D [email protected]
913,007,492 *5F0B2BA3924CA17AFDF38133D1E88C1783F88B51 LOC4V3RINT
913,007,493 *5F08A4032613DA94CCCFC67EE7BFAF8ED330FAF4 NAP_HAND N/&/P_H/&/ND
913,007,494 *5F0FEECB4ACCA72EB2D211497CBC1DD23F71C8E1 NAPOLEONVALLO
913,007,495 *5F019002B270B97E46226B4A6D69E9B96E7BB68C LONG.B
913,007,496 *5F01FFC66B0028F8BF3A6E1D5F5288D39866B65A nathanialreichard
913,007,497 *5F064CF72F70F4817DA9EC49FEA1B9E277608AC7 NATIONINAFUNK(M-DUB)(FEAT.ROCHELLE)
913,007,498 *5F045E2E50309F3A4624BD871D6EE2BEA4CC43E8 LOUIE-OLIVER
913,007,499 *5F09F93487C746B81B4CB327368CA3E55DB1F2CD LOUIS-GDN
913,007,500 *5F0D3DCC393C5FC0C183D797E2B7666C96023A1F [email protected]
913,007,501 *5F03C31DF779CF44605BFF8697F25DDF31829D12 NELSONMIELOSZYK
913,007,502 *5F0B06AD734CF280F28CE63CF230AAFBCB32DE8B nelsonruopp
913,007,503 *5F03BA1A571094DC8B4555FE7F9726FEC02E58AE LUCAS.SCALIA
913,007,504 *5F06C5FB80289F7C373B9F36A8CBA5373C8E2D85 lucille-haynes
913,007,505 *5F05169F3CA807B3DE467BEEF4F393AC7FF95EE1 LUD OD SLOBODE
913,007,506 *5F05A402ABB3302D5D6FDD1B6DB1739C7987CF9F [email protected]
913,007,507 *5F073698EF9C43BC1F2F9DAE04A647B10D982C64 NESTAALPSGNIDAL
913,007,508 *5F0A32D4D1DC0578948E17ADE25BA4C266EB60C7 NEUROSTYLE
913,007,509 *5F0D43296B11479016E332174F05A289DFB2821B NEWTONYAUCK
913,007,510 *5F0C5B6EA74D729A3934F890C179EE9F9D525C69 [email protected]
913,007,511 *5F0B5C62104A67B0B00F0E5E337971130A91ABC4 NGR9252
913,007,512 *5F07CC3C65A2843D9855DCFA5718BBD751DBC6C5 NICKSISOMPHOU
913,007,513 *5F0589D5CAFFA856F2E569A9A58E8D327F89C312 M3TR0LN3RS
913,007,514 *5F0F47986B3565E812F9EB0ACBC0211AC4914436 mach'-dir-nix-vor
913,007,515 *5F044DAF8C32BD34C3CFFA23C047698B0C2AAB9F MACNTOSH9
913,007,516 *5F07E8804FA54896B53FCF8EE954EDB1DEE6A9FE MACSPORTING
913,007,517 *5F025120EA833D60CCCDEF2C25BAEE9ABBA357AB NLLYVEL8
913,007,518 *5F06E602723E9DDA0AA4DE9AC16C5AC2189576B0 nnnedes3
913,007,519 *5F01B7B4A3B309DE68BA745B64DD4B9532BE3AD8 NONSOCKPUPPETTYPE
913,007,520 *5F082576D5B7C0181F4AE56052A7898366D149AF manin-drinfeld
913,007,521 *5F0EF28CEDCCEBA7CA1410BE19A6661BB09FE77D norbertohehn
913,007,522 *5F0BAEFE06C2495D7F7790F36016B0D4E116A561 mansname3
913,007,523 *5F0DF54E7B5C30299FD9C5C67D347BAD90DD3D0E MARCELINOSCHWALD
913,007,524 *5F0259190AD84D8B667AAECD0DBD197852503228 marcelluscancel
913,007,525 *5F0E1EF9EF508319A8F60D315925712EDD3A31CB marcellusharper
913,007,526 *5F052E70126FBCE79CFB7A187B7BCE580CBBFE94 MARCELOHALUSKA
913,007,527 *5F075580213327725C740EF6226596EF5463D91B NSTE STUNDE AM TAG
913,007,528 *5F0115331E2081AB3027B5D1764AE22E45C31120 MARCO.SIDLES
913,007,529 *5F09BEEB8E3DA77564CDA889CFC657213836A4FF NUMBERSKOELSCH
913,007,530 *5F0F78E21F7DE0CC032B2EE2CA92F9600BB5A343 nuresitan
913,007,531 *5F05B3B2231CB6A1D7A8DDC19246C1660466DB0F NYURBA160
913,007,532 *5F0649350465ADAE0E4586F1F2F171B630F46BEA o;8x
913,007,533 *5F00375404CD239EB149D169C748DD98A77EFE43 ODIS.BLANDON
913,007,534 *5F0E4C8A16BAC0FF6A9C9D6F4FE2C46CBCB63E5C marucho.the.brawler
913,007,535 *5F078742FD628E5A5A4F4CEAFC943ED01E4BE2B7 MARYAGIN LEONIDJPG
913,007,536 *5F0008141018BED81F1ECEAAFF363C1CEDDBF788 MARYHANDWERKER
913,007,537 *5F0BFAE5804B2F413C1CCD1B0CE1BF14A810617A MARY.SCISM
913,007,538 *5F0133489962479472CF8D7E0D5D269EE03C86CB OKINOMIY5
913,007,539 *5F0FF3137CFD03B51265B2BBD43FEA9D3B4844D7 [email protected]
913,007,540 *5F0AC9F37970C052B5BA40DF3A555FC50392495F OLENARNAUD
913,007,541 *5F07BACA1E99DC71CB22E1076D0D39BE5FDDB034 MATTETEKURETE
913,007,542 *5F0791347F213A97CAA13FBA6D00D5EC43432622 MATTHEW.DINGUS
913,007,543 *5F0F87F8F992DC6CCEB85D14389553D98CB67C0D mauerkerbe
913,007,544 *5F04D28A9A624FE1F6506BCEE1578031499DD462 omainots4
913,007,545 *5F0D6FCE3977AC1A5413A286AE60C607CFA439C1 Ondergelopene
913,007,546 *5F0C671000DEBA8EDABDE6DE417D612577AB6F0B MDANISUR
913,007,547 *5F04209C3DBE3C5B6552F217E8411A36B6983C27 ME:ACTEIII"ADDIO!""CHE!VAI?"(MIMI,RODOLFO)
913,007,548 *5F06177CE0ACCA4098C917A1D9067AE1271325D4 (>-<)O~.O~.Q===P
913,007,549 *5F02ED6523C6F1A6F0667A0BA68F6ED8B090977A opprimente9
913,007,550 *5F012F4EF1E4D986250A9A0D4892D6BD05FA7089 merlinord
913,007,551 *5F00D4331051702067438F35CAB509AF2843A741 mervinlenzi
913,007,552 *5F0A21DF7B19C181019AF599BDF6755F9B813296 micahplatts
913,007,553 *5F07ED556D069A643766251875936917E33BFB89 MICHAELGREENO
913,007,554 *5F04C5E2DD00891326F532F92EF0539294A39772 otispellman
913,007,555 *5F073E1AA19AA57D57C8B1EDB14A566100BA4D40 otpremi
913,007,556 *5F030C80D5DCE7F5E79674765F2FE6E1B8B2922C OUTLAWS
913,007,557 *5F0BFA417BD90D7A313087945262D587B621204A MIKEY ZAMMUTO
913,007,558 *5F00B6544C66CAAF712123A621BCDEE366A17EFF MILANROSCUP
913,007,559 *5F0590C49641699ECB99337FDEC376BECE40B3BB MILITIAS—WITH
913,007,560 *5F046B2749D631F78A5D95892EBEC21FD3651B43 MILLERBRAVAIS
913,007,561 *5F0FB6898DFD1FF8B9D98F7A05A5F9DFE6D15409 P3R15+A1535
913,007,562 *5F08491600E2C6875AD00F5B8B4843190ACBACD3 [email protected]$M
913,007,563 *5F0C7DC991279D6F6BD99F56F595E2B842D64EA2 MINANAPOLI2
913,007,564 *5F0430F7130019032A7237CE80012806FFC6150F packardkillme
913,007,565 *5F009DFB16D7D9101130276DCCC4FB5086465A4D mk1987
913,007,566 *5F04A06942D37700A93046C636B0E3FDFF4F5C5A MLLYHPYRB
913,007,567 *5F0C796D3D65A5E0BA4AB4BDB9D268644F509171 MOHAMEDLACASA
913,007,568 *5F0154EA04DA9B3B1A6A4AEF3E4588044DED1589 PBEAR
913,007,569 *5F0D6FB95B0D28987E9BE4F8B54678353D2E7AEE peacetrain(paul'stgvmix)
913,007,570 *5F0C10F8989C0DED3891091A9DE679422C447E07 mouleerd4
913,007,571 *5F0137B9351DB7D096FB3809954376BCF61C4959 [email protected]
913,007,572 *5F0B02C9551C54822AE099334B61CEB8EEA7C649 PETERHITCHENSIRAN
913,007,573 *5F05BBF793482EB64E51378161C0BCDCDC2B5A94 PHYTESEI
913,007,574 *5F0F720A4F7DCF40E7CA61613059EDA3B34022A9 MYRONKRESGE
913,007,575 *5F07CE1C497D86A15ED323F63F21C9FAD026BADD mysusan105
913,007,576 *5F08F6D443DD7BDBECD61DB704C5C70E188512B8 N112=DCCGETS:/CLOSE-G
913,007,577 *5F085B33A306F4183DECFEAD4782D24457D4DCE5 nathalie.guilbeault
913,007,578 *5F0DA6F5B5A7FCF2DA733882564F4899DBAE5922 NAZAR.IQBAL
913,007,579 *5F0A8E39640E34C1BF2690A2B53758F613EF0A11 porfiriosichta
913,007,580 *5F09BA46875670BAA7F9FB5352977956AE1A4B96 NCATANI
913,007,581 *5F06AD7B262A0276DE11CA65C9F8E22D1C117EAF porrajmos
913,007,582 *5F0E228B519224FEA6C31E4F891CC7356BDCF307 PORTS3
913,007,583 *5F003369CD977F8C7D3E1DBB62106814455CAB61 postinternetera
913,007,584 *5F07F4B5F4EC4C2CE7BF1607A0132FB7508676F9 [email protected]
913,007,585 *5F005143E7D4027104CAC225FDA22858D713244A NEUKSTAAF
913,007,586 *5F08A7BFC4A236C1AE0001BF2F788462E4D5188B [email protected]
913,007,587 *5F02DD2A9C188EACEDBEA2CC0115D6A14FE4CA11 PRASAD.TENDULKAR
913,007,588 *5F0AD24F41B72042AE396B6FA6CA90A86CA8B9DF preadult
913,007,589 *5F08352C6A6358DB705EE527AD501B77CACAD639 ngbulk
913,007,590 *5F011C1044304A05C0A845132B096D6258C2355A NH9221482969
913,007,591 *5F01AB9D032A8A45476DFCE9850B1EC7C9944572 NICK.CRAFT
913,007,592 *5F00372DC38A891512CBAA818D9CD2712C3A289F priks.tyagi
913,007,593 *5F0BD7051E005888145B23F64ED622E5E95CB6DB PRINCELEHBERGER
913,007,594 *5F0ED148F4B93227AAA4C658F0A1D190FD9F0E4B prinsre9
913,007,595 *5F0EFB12A24F9739B26B2C0C5F3A5C3FEC496831 PRTCPLS5
913,007,596 *5F0818147EC2BCA170D52C2CD96B58040B3BE81D N.MAASTRICHT.JESUS
913,007,597 *5F06E178F4563B9CF77D0EEE1F3DFDD9A6DDFD89 no cross to bear (demo)
913,007,598 *5F0F510357BA2AFDF018A03C3214520A3F46A623 putchuk9
913,007,599 *5F0CD916DC1B8A91A9DE011B9CE976740DB3E25E pyramidfiona
913,007,600 *5F0724EC06E8A1CF49DDD87A62BB839EF8E77DFB [email protected]
913,007,601 *5F00F1CF1FC0536EEC7C80CB9C1BF04332FBEF68 number9<
913,007,602 *5F0152410E10E58AF95DE54D7568F9C68FB32414 O024528193
913,007,603 *5F030A807FF8F995248FA40E12883B6F21C73ADE QV`AAA
913,007,604 *5F0FEEB90CB6A3D770ABEBAEBD1364003D43852D r3adju$t!ng
913,007,605 *5F0382DACF568C7178684C1B010392646EE01196 OBJEVŠE
913,007,606 *5F04B7ACD0F48004DECBC5BD558BCD0BD77868DD obligors0
913,007,607 *5F006BB65F23F56626C642243FC2D821E088B41F RAHNERGEBURTSTAG
913,007,608 *5F03EA240141F591FF3106C0049B87066C655DF5 RAILBRICKS
913,007,609 *5F0674CF8A204BD8946DC23AFEB4BEA66F84DB0F RANDOLPH.SAFFELL
913,007,610 *5F071FCDDB2E1CC643971C8280A0F00AD7D73723 OLDLH4
913,007,611 *5F08CBC93B90FE044067064C6CDF48B5F92A6671 OMER.JONDLE
913,007,612 *5F0885F82A87637F1E7C60A4207FD1BB8FA685AB ravit-mizrachi
913,007,613 *5F0FCA1B08E392601C60167791074293432A9662 RAVSIEG
913,007,614 *5F071432CB3E2C9FE60308CFCC5AA52975F24D8A OnaNeck,onaSpit
913,007,615 *5F023567092736798D112CA7B18CF0DAB3B74F10 RDHANDHIA
913,007,616 *5F02086996ECC7C474EDA9D8628DFFC7D80B3EFC [email protected]@p35
913,007,617 *5F01CD1F180A3CA34D4711A44FC94AA823718ED7 OPERASZÍNPADÁT
913,007,618 *5F0EA2A9EF1F18B908C8156F765A6F5130691D25 rec0nnec7in9
913,007,619 *5F0A61C5FFDBCDA70D5F77C34566313C967FCC67 reexpansion
913,007,620 *5F0BA3A1F041B39F55AE188D2896FDA3FE763E93 O.TORRES.PETRONAS
913,007,621 *5F0AE4203C7BFA89E517B7B16E454412EF072916 reh4bi1i+4+i0ns
913,007,622 *5F029D944C0C5753DF7A1DC814F01BADCB33B824 RELIGIONIVE
913,007,623 *5F0484E46D6C5CDBFBA1F3F77EEA341681D1A9B9 relway
913,007,624 *5F0D33CA2A586A7EDBAEB4EC331BD8CCB532002A :P`@8
913,007,625 *5F0D5BCF22653494901A48C262FA58AB6C690F57 REX.MINAAI
913,007,626 *5F0754314B112875E727B1D7FB7C243BAD4BA8F9 rhettphilip
913,007,627 *5F0F59EAE5E946D7DE5C66D81165A3DE2CFC5504 richebourg
913,007,628 *5F069C9AFAA0DF9B554708A912576D1FF6BC9CA7 RICHIE.WECKMAN
913,007,629 *5F02B8CAF708A025EE3E59D2AFBCCFE676721944 PATIRONT9
913,007,630 *5F0C6D735F607589B16C74B618197ADD8C75BC25 patriciamaalouf
913,007,631 *5F019BED758945503366AE71D965B0E180675292 pc+
913,007,632 *5F0DF8B9A8DC989959887C1C83DC8A7422595245 robert-ash
913,007,633 *5F0AC60E0FA3CE5A0E77143728567F883DD1EA07 ROBFORSMAN
913,007,634 *5F096ECD17E16EB481698DC1327EAE2A30A1188D ROBINEDWARD
913,007,635 *5F003C427773DF0BFF0A564E7D01BE600B85BD5D phantasmagorian6
913,007,636 *5F058CC28937669D66766CCE4BFF7CDC925F6A95 PHOEBEKOH
913,007,637 *5F060C815A84A1EBFB2DE3EE33A24C07D6D4B749 RODRICK.BILLEAUDEAU
913,007,638 *5F07725AE0C631D0E5439AC8078B628D4865F50D PIMIENTOSOLDELPILAR
913,007,639 *5F0154BCAF606C1F3A79A388050AF410D503B596 PINDA5
913,007,640 *5F00344A6422CD4C50F61750DD71629A65759D09 RONALDBROCATO
913,007,641 *5F00270944CBA3F2D09548F427562E78708EA53A RONICAVE5
913,007,642 *5F01FE866686223B4A7A21E67F0283C8F09AD644 PLEASURE+PAIN
913,007,643 *5F0B5BE03804FB97CC6BDBC9AD8F2A51827F13AF rosannepriest
913,007,644 *5F07CBE6389AB30F6E5C9ACDB145EC4F90CC4DA1 RUBENGRUNDMAN
913,007,645 *5F0A609FCB80C35F4775F0C366B40FD7F0F9F93F RUDNNILS
913,007,646 *5F044F0ED43C23930B9D8B8C459A7B22DFF0F460 porfiriotenerowicz
913,007,647 *5F08298DBD8BB96695A2CC38F97102F507674FFF rudykalberer
913,007,648 *5F01B19703D05FC6F630AC869FC753D9A11BE67C ruebenphann
913,007,649 *5F01B530990A455D2A956468533E694BEC0F5F65 rueful-A:
913,007,650 *5F0B2C5C25CF25E158E0CF2EE1ACA8D103B8C034 Pout-Pourri:-A-Cabe
913,007,651 *5F00552DE8B3FC34B36593EAD46592D8D4403E89 preadult
913,007,652 *5F0FE23CD463B3E57182A4F8AA94B389EDD3D90B SANDRAVICTORIING
913,007,653 *5F04F106B89C2107627EEF8E7EDBF5DC7B6542AB sanfordgoddard
913,007,654 *5F0A085E801FA25A96D0CF7F750E3820C6F6FC83 SANGERFI5
913,007,655 *5F0A9E04C62A7D1596DFDE5371D4D5063F56B7E0 SANG HO LEE
913,007,656 *5F021346C3E538A67DD998A171B33857FBD03174 SANGOWILLIAMS9
913,007,657 *5F045CEDC16A70D22C1A995B4DA9BA20EA8048D4 puinwege4
913,007,658 *5F065C03818302D5A4A23581F25E260EF7D076C5 SARAH.MARRINAN
913,007,659 *5F085152A801CFDB5C4D4819400415BE01BB864B SARIEL1234567
913,007,660 *5F01B11682BF7B14AA57B8F7986BE0AE6125964F SARPLERS9
913,007,661 *5F06FF799605DF9BB147D0E56CC59131218088A2 q======b~.~splat
913,007,662 *5F05BA1785A258BC0ED222D7F7704FEF90D0EA4C SCHLOESSERGAERTENUNDBAUTEN
913,007,663 *5F0A35BD6377764EC029B1D290BDFD7FED0734DD schrikaanjagend5
913,007,664 *5F05F8049C83BEA907AB3ABDF665EDEC48B97CFF SCHWUNGRADWELLE
913,007,665 *5F02921A74DEDE1203F3CEA105B65D9E4DA49885 SCOTTMACMEEKIN
913,007,666 *5F0C38FDCB0E188D34661E494347F8FCECF6CDA9 SCTLDRS4
913,007,667 *5F04D3E4F0309EBA04B33D65DF34B2333A556C51 sean.stranahan
913,007,668 *5F022CC0DC0399BA52573A37814D57B1D4E4A8DB RACINGBED
913,007,669 *5F06B454D7F797EB9B54A79E69A956EC37455875 RADARKUPOLA
913,007,670 *5F0612B76A4EDED8F7FEDD4DB26EF24FE2FB1BA5 rafique.pirani
913,007,671 *5F0807F6740344F1C2F5F98479FBC252EDD644FF SERROSERROED
913,007,672 *5F0F0318A16E734A77BC1B9FFDBB31AB9FEAB479 SEUQITNAC1
913,007,673 *5F0262546CDF32093CD6808A8088AA149D0829DC RANGESH-KUMAR
913,007,674 *5F02383F72447C1374E20F84F7F5B060007A1440 [email protected]
913,007,675 *5F0AF148B21E1C258D48C1979002214FAAB86FAA RANKALBUM
913,007,676 *5F07C49C3C92F2D4C0F94B930D4434EC2135448F SHAYNE.GOSHI
913,007,677 *5F034617CD223EBCC62C4B497107C866FBCF9AA9 REBECCA-BUCCI
913,007,678 *5F0048957EA319B91FD9E94658B74D2BE6D0FF43 rechtverkrijgenden8
913,007,679 *5F0A027B545B1D18CA856CC0057BD5532A02EF6F SHOCKLE4
913,007,680 *5F004C48EE9C32346CF37824D3A342FC00A41D3A REDWINGNED
913,007,681 *5F03B1D65F5ECFC239A998981F51492CB45CA2A6 REFUGIOWILHELMY
913,007,682 *5F0E18CB335F1AFF380437A02428EF5312CFB737 SIARELIFUAF
913,007,683 *5F014A599150AEFBCBD0DB51495630E54FF0A619 sidoryk
913,007,684 *5F07AB4D4F2B5707012D72694759118DE9011761 requiemnr2d-moll:diesirae(tschechischers
913,007,685 *5F0D0910072906703B61B8F4347D7624539B1F9C residential-cum-commercial
913,007,686 *5F0997D85DA56F6CA421AA4DB7E0095FFB3D1144 ŚMAŚĀNASUMANAS
913,007,687 *5F00190E52011A47562CD4AF58BA34D8793293FE SMILENEWPASSES
913,007,688 *5F0813241C89E35EB8E7BB2561218A228D6D3ED9 smuglov
913,007,689 *5F060878152EB1CF3FC63061219694BFF4E93628 SNMTTIVED
913,007,690 *5F033C41EB16CA219AA261EB01463F03F11594A6 RICKYBMW5
913,007,691 *5F0C4B9EB2EA332FF18474DD89137A8307767622 RICKY.ZAMORA
913,007,692 *5F0599150A39C9614D0A2A538406388254E7F2EF [email protected]
913,007,693 *5F043D71C04E2D1A98E9CD032F8AB12331B26774 [email protected]
913,007,694 *5F05958E22B26C19AECB22B1C233E82A16E5BED2 soprammessa
913,007,695 *5F03F853C6F8DEFD11CA7BA8C9011DDBBA12CBE9 RNTGENJET2
913,007,696 *5F0E28E7718016342689357E5350A77B0BEE7808 robertrockingham
913,007,697 *5F085396069C11C5E51A0587053563263A4120E7 SPARROWSTEVEN
913,007,698 *5F0C0CF8478249F42439E702A6C851BB3C69D0FE ROCKY.BLUMKIN
913,007,699 *5F0B3512CA22FE96FD756911E9822AA617C1C203 RODNEYSANDSTEDE
913,007,700 *5F015D6837B8ED26F3CCA2BFA62C227E9048F0A0 SPLAT~`~`<====P
913,007,701 *5F0170C3AB8EA1EBD510667DCF1E45C5B98F1BE5 statgate0
913,007,702 *5F0AD522E561DF833096A908C6F197438B716BCA STEPHANICHELSEA
913,007,703 *5F03EC79FDDCCBC9281A6D428928055A62FBA160 STNEMEGARUOFFA
913,007,704 *5F063F2EEFFBB21C34400EF7C6E8A35E3AD95835 STONEBITERS
913,007,705 *5F02EFDEE10483F2D7BD81060CA2008A76C6482A RUHR6
913,007,706 *5F0F725626BEEEB26CFBB636D75B32CDEFC1EB62 ruta.del.agua
913,007,707 *5F063B6F2463BEFA260EB6F2F2A015B8C9D9CC9B suecicum8
913,007,708 *5F09784526D725A92302BEB9AED903AB2982CF32 S=;$
913,007,709 *5F040633FA1622FF0EEF09A18534EE3468D0B3A6 SULTANSGRÄBER
913,007,710 *5F079435D3EE5D1B5661AC7549F8CCB603CC582A sungmalloy
913,007,711 *5F0D5821B68D79E433C8680643BB7F3CB9403875 SAHNALARI
913,007,712 *5F0ECAD93596CA10E27D3CC0A2B1AF938A4796FB [email protected]
913,007,713 *5F09BCDA65E3034B440CB197650BE0D46B61B932 SALVATOREBAYLESS
913,007,714 *5F0DFDDDEEDCDA5C09E9AA942CA7EDAA327CA570 salvatoremojzisik
913,007,715 *5F0B0A99A99B5651247907266E0E39A8E7CC2923 SAMABHYAVARTA6
913,007,716 *5F0C48DB61484F20CB61A219B7082F170B752244 SAMMY.SCANDURRA
913,007,717 *5F02557E369DE27EBEA518592973075AE428DA65 SVIKTET7
913,007,718 *5F014A941B2DD9B441BCD80C159B8543D7C3517B SANO-SE-NYT
913,007,719 *5F0867F3F0FEC8578EEEF4461B4AD337FD33C4A2 sanshout0
913,007,720 *5F074E7A197F82E89A5F3A15D69C896F19A8751E SARA FARRELL
913,007,721 *5F048279B8BBE62C681A310E2A3035B19FF919EA SARAHWITTINGSLOW
913,007,722 *5F0675DBBF0F444DC0B5252BB6