List database


# MySQL hash MySQL password
889,560,001 *5C8ADD1EE67EB1E6937AE40A793D12322552FD0F HEALEYJR
889,560,002 *5C83EEA9D87B8E0A282ECBFB4FFDED039C5164F2 freddykashan
889,560,003 *5C859A23820E921F2CDB974F55EA603C4305AFD7 FREDERICK.BRANDAL
889,560,004 *5C8397C650C5D542172ED41EBA0B30037D463159 [email protected]
889,560,005 *5C820FCEDCE779C8BE7151FB76002D2F9BF882AD hemicardiac9
889,560,006 *5C8A8E3B1DA78127B3C2FCE0EDA9ADCBBF32A32F FRITZPESTONE
889,560,007 *5C8E858829BCA02AA782430A2D0F8B3417999EA2 [email protected]
889,560,008 *5C82F0C06EB9355E883FB6DA41BA1A8C765B63ED furcates
889,560,009 *5C84B9DAD33DC18ECAE55D589B1309DFBADB2070 HINAPOKU
889,560,010 *5C8BF40D20743C96130B77568E1888672DE94BF5 HITACHIINLUV
889,560,011 *5C815345C74A0E0BDFA68C0956DEA28913D54F35 GARFIELD.RENAUD
889,560,012 *5C85C0F0685125E85626BD5B75E808A19547747F garycoberly
889,560,013 *5C839299D51C8F5412C7B3264735B95D446EB038 HONEYMOON IN ST TROPEZ
889,560,014 *5C8B7DC1F426D31647406EBFB5D79C323706C008 GAYLORDKLOSTERMANN
889,560,015 *5C8802957118CE9F2FF84AF3E765B3CC2BEBE38D GAYLORD.RAVENELL
889,560,016 *5C85555F4A4032B46E55BFF08AD44D5EFA99DFA3 GBLATTEL
889,560,017 *5C83AD023B567B37E9E30C09AB45966FC29D6DA1 [email protected]
889,560,018 *5C8EFD58550A8D0026E32DF0A40D45E3E4820D83 GEHYVED
889,560,019 *5C8D24BC6CB7D97AD1D0CDDC74D8CECDDD94DD0F howardstiltz
889,560,020 *5C8A802A433456DA7242952DB6F9088211C5896E „GENREMALER”
889,560,021 *5C8A71389E1D4BCBC8986605A5D9DDBE89A55F22 GERALDKUHLMANN
889,560,022 *5C89845271FDDB627F61BC5F6FFBF714748BBA6C GESINDERÄUMEN
889,560,023 *5C81371A047EF0A96F33A7838D21C43793C071DA GÉTIGNÉ
889,560,024 *5C8980D5749EA01EC0E3695B7FA3E1C356E1D48D HUGOBEDRE
889,560,025 *5C8A21A0768F581535A87446EBB0A908AA74E7A0 HUNGNEWMEYER
889,560,026 *5C87B55C8EA6376706553D6931E85F2E95F7D5BC giffyng6
889,560,027 *5C80017262F1A670FF1624FE5CE64E888AEDB842 HYMAN.SCHMIDLIN
889,560,028 *5C801563724C182DDBDC97614D247DEC7BF65CC3 GIVE.ME.A.NICKEL
889,560,029 *5C86DA4D8ED9CC27CD1B81CA71591CEFBED9DCCF [email protected][
889,560,030 *5C8279B7BCD1F9B4A6BFCCD9FCA734AAA71CA16C IANCHROSTOWSKI
889,560,031 *5C854CD1EAF99631A474BFAF1EB31E94F0242288 IB-3
889,560,032 *5C82DCD17E0B8898442A8894D7E7B4495FDA8E69 IGNITING2
889,560,033 *5C8529A737472501F1A50816B2ED0E7C534B480E [email protected]
889,560,034 *5C89934C9E59E0E83C304407A0D824D69FB99DD9 goodandugly
889,560,035 *5C89157944B4A89DEE3537CF430314328557A2FF ilargetnis
889,560,036 *5C86E6B69B7B6D1196109C20F035286EFB4F9E07 great-man-and-now-applies-it-to-a-fool-vent-my
889,560,037 *5C8378B78D6F3D132FE874B377149C60623E329A IMAGE1372869172
889,560,038 *5C8C9CDDD212BB774BB94096712AF442D0DA5014 gu1#
889,560,039 *5C8B2B5C65CE6958067DF59AFCA9BBEDA7C2A074 gue$troo
889,560,040 *5C867635019A1CE6C9E356708431BD55FCC93EFA gxq2
889,560,041 *5C8D404E50A5BE6F066750CA92C9183F346CCC84 gто
889,560,042 *5C8FDFFD6FD9A7D8C6842AF9D384A299A819D1E9 INSTALLERPHP
889,560,043 *5C8B9749A4D86BC5D9BA405087741521EFCEBDE5 [email protected]
889,560,044 *5C813304BC5323874FB7EFC2F3D7FEF725A391B7 haggiths
889,560,045 *5C8916C9F741915CD30DFAE1CABFBFBE594A84B0 iphytisms
889,560,046 *5C88F1BCA0E9D8009B8C2930B6EE453D38ACB1A5 IRVIN.DEVITA
889,560,047 *5C8EA7FD0E76F1B7D61EAF2CA909E44811491715 harz mountains
889,560,048 *5C8107BD80A0C34377969729CEFF088EB2F42FA2 J49906
889,560,049 *5C8EB2398518CA0407EB23EA6716B63AF8A0DB06 J9R2
889,560,050 *5C886DC8E00D497C36783B11E01244E88F9AC133 jacknolin
889,560,051 *5C8A853487C4F00BACF5510E6B579256FBD53BE1 HILDERN»
889,560,052 *5C8B093E0DB3C8FBC741FFA5A312A4D945A93B86 HINDIJAGAT01
889,560,053 *5C80A2507582B8BCFB1A7D65F95F28730F991929 jamisondauer
889,560,054 *5C8BB2EC48F7F5BEBD33DA2911A64A030222B869 JAMSHEERKHAN
889,560,055 *5C8B479C59BE349C0E2A5A1F6EC6AACC0FEBCCD8 JAN1221
889,560,056 *5C892C35C0DDC521D4644138F1237FD36811EE7C janheather
889,560,057 *5C8B77ED5B2D5E9A95A6F0D243283661F0178354 Hiroshi.Yagyuu
889,560,058 *5C8C0E9DBE340F38C943538F5842C03A34A55CCD HJ81YHCDWZ2
889,560,059 *5C8A4F65B120E1593349DA61250EF9BC37A9CD3D JAWNDESED
889,560,060 *5C80D25DE8FC45117A2D1578DB52897FA14499F8 [email protected]
889,560,061 *5C83FD01A32031B8669093E7071C168FC62FA3FF JCSALAMONE
889,560,062 *5C83BB85AF28ED7C7F968228C3DD46E153983C99 jdd
889,560,063 *5C85C403FC9AE1F2C2C582ADB830A42647CAC563 JEFFERSON.CHERNOW
889,560,064 *5C8BEF2FA30CBF77C30D071DB87E38B8BEBA3C3D horacejessup
889,560,065 *5C86BA623B16BB9D173BFE70549D7CF305242075 JEFFREY.BUGETT
889,560,066 *5C892B8BCBABB98F2DE55B4EDB016E7FAE5BB95E hoseadickson
889,560,067 *5C847A47B54A587BBC33D36D11F704FBF21BE42A JENPETROVICH
889,560,068 *5C8A5BDB20779316CD6A13E1A92AF77C6EA16201 JERMAINEGADDIS
889,560,069 *5C886A58064193A643C54E06FBC6685E0A4F7DB1 jewishwiccan
889,560,070 *5C8B2812476E713C36CB49DB365CE07DA7D9428F [email protected]
889,560,071 *5C882A00E58FF72015EE9057521394E5299DEDC5 [email protected]
889,560,072 *5C808A10C8AC22F13659513DB49CD701E49F699F HUNTER.GLADHART
889,560,073 *5C856D31E2470380CF59436335838E7AD3F664B7 [email protected]
889,560,074 *5C8241FC9E175D92D20B1432AC71E1F2CAC7EC90 joanbartlow
889,560,075 *5C8E192825A1D33D9345CCCFA24C1270328EB14B hxvo
889,560,076 *5C87275D8223402856A0C8CAFD7F09C60DD16FB5 iamallstate06
889,560,077 *5C871405C8FE2EB3B1FBE7CBE443E2D347503B6D JORDANSTECHLINSKI
889,560,078 *5C83C67DC77E29C7E042AC8A1172726D749BB6DE jorgerobare
889,560,079 *5C82D295EE56BE9A86EB0722E515619B7FC49C71 [email protected]
889,560,080 *5C8BD0282930CE2AE7F258CF27B6763310C15765 IEREDNEV6
889,560,081 *5C8822F3A5BEC16D11D62D7D10C62CB5147A6510 IFERNAL
889,560,082 *5C843E4F62CD1A1159FF19803377D23F719CC86B IGottheBluesOverYou
889,560,083 *5C85A736222EC6B822450B44E5F2D873C8A26054 IHCTALAK
889,560,084 *5C8F6E8A136B680E456EFF30080529BD2F547536 JREDAK$SS
889,560,085 *5C826D8B7B479378C333830F6DF5E78874E0ECF0 ILLENAC0
889,560,086 *5C84C2F7AF66B285AE12759DF879D8412C58A8E2 [email protected]
889,560,087 *5C863D7DEF6467BF77493E00D77898CE7FDA530B [email protected]
889,560,088 *5C8447BD99F23BBABB0CDE366A1BBF3F25725ABF JULIAN.HOW
889,560,089 *5C8155182C656023AE45CA09EF6479122A7AC05B imakatats
889,560,090 *5C885454960A0C3E5ABBEFFE9C207FAFBD342D2E impromptus d899 2 in e flat
889,560,091 *5C83A0AFEE10F52439A912C19CB78B9C14B563D2 imr'
889,560,092 *5C8719203A22BABE845191B2D13A3843A00B47D6 K221144
889,560,093 *5C84F72124E393BF9D78F0A5662285097BF9F0BF [email protected]
889,560,094 *5C8B0DB95F840D69DC4EEBF8AA634F2CCDC8700B KAHARKARIYALAKARSALK
889,560,095 *5C843ACF9A8CBBB72FAAD73861B42E70566F503C [email protected]
889,560,096 *5C83A3AE5C4B3312D6F33C440112C47B516F1102 injilbswing
889,560,097 *5C86D4799FEEDFCAAFEF2F8501F5F7E85850FB54 INSTITUTEOFELECTRICALANDELECTRONICSENGINEERS
889,560,098 *5C8E3BF2E21252579286F5769944C7C496F13BB5 INTERNATIONAL.ORGANIZATION
889,560,099 *5C882999D4F288FF37F60C8ADD24AE85B9872561 KAWASAKI79
889,560,100 *5C89794294FC134D5249D2B2C1630E8CDE7E3F28 KELLYSLEETH
889,560,101 *5C86D618113F4EBB04558ADC560A0CAE1D2C16E6 KENDRICKRIEVLEY
889,560,102 *5C8672BF3BB835B9E1A1F1105CCC7F2C0D29C442 ISMAELDENUNZIO
889,560,103 *5C82A2CDAF8A4FBF9C0011DDB28845938E7C145D kenromesburg
889,560,104 *5C8D2BE64A62E6C1A5491CD61447269D1344BFCE KENTONALLS
889,560,105 *5C8B23747A4CA5DE1C856179A06855215020E0BF italiana’da
889,560,106 *5C879F7F67B002E6648A3FE5E37C92D9C6C0E9D0 Kermde
889,560,107 *5C8BDA585542BBD186ED6F450FCB7D3918013762 IVANWILEY
889,560,108 *5C853A9672CC78E30549EB45AAEA419BABEA73EF IVORYHEITBRINK
889,560,109 *5C8C2A592080D4F226BB2C8D1FE4BEE3F1CD95A6 iwanopolu
889,560,110 *5C8FE0B5657257B4BF5CAE3B9FF6F57C08587D73 J5UC
889,560,111 *5C80E614D81C437B5009AF14A013CBC01F681887 KIP.SCHURER
889,560,112 *5C8ABBB282789F76EAB31A8F24521CE1D2B60C94 jaclyndennis
889,560,113 *5C879F36A3EE86E342206794F98DF9569DF2B363 jamisonfineman
889,560,114 *5C8687B731FFDBF3091C1E68F9D22D74D0FF3C8E JAMISON.SANOSYAN
889,560,115 *5C87DB3FE44C7AF42F4D8CD7BA433FA7CAEFC96B jana-bacher
889,560,116 *5C820B70C1C5F6D5ABE9EA56C1D61C4CD00926B2 JANTOBIES
889,560,117 *5C8033AE304C9AB70F49CED334670160E5B34589 jarodwai
889,560,118 *5C8A72974A45AE32A73BE0D216C441E87CCB9555 JARRETTSCHLIPF
889,560,119 *5C8884153465ECF726BD806C71CBBB5ED33F2B17 JAY.DAMRON
889,560,120 *5C887EBB5F36F9BA420F2F9CB912E82CA4156CC6 JAYSON.RIZZA
889,560,121 *5C8C95416F6563356DB7299BB35CCFC332CB53D4 jdd
889,560,122 *5C8EB61066906019A46A5CBD474B25312F48F3DE jean-yves-levesque
889,560,123 *5C8D594FC161E8540FD4F9411E9370C13507409E KYUUMINJ9
889,560,124 *5C87E9F7397103D33B30DAB358C332C8814344BC JERANOM
889,560,125 *5C847820ECBC7277AB94BA4A11C4490710D5B107 [email protected]
889,560,126 *5C8936A0F5E85D19558AD5B3DEE62FB5124063ED JERRY.GEHRKI
889,560,127 *5C88E97BDC7977A1DB4EA339FF6082B8EEB951B4 jerryludlam
889,560,128 *5C885F8248AE021B2FB84E6C837599BB39F8722F LAURENGREMILLION
889,560,129 *5C82BE2E9BF59133E45D9420E3CD95EEDA10D128 jj.crockett
889,560,130 *5C834D659F66386303DAE117DA4CDE5388139368 jodyfauteux
889,560,131 *5C8FB42E6AF218DA26DF6AE22052A76A513A03AE LEOPOLDOBILOTTA
889,560,132 *5C8C6CA04844DF417C080C54F22DD631CC744F4B JOHN316HORNETS
889,560,133 *5C8E04B46912F45296C41A04295E9CBD91568A1C LEZUAA
889,560,134 *5C8E65E904DC25CB16AD7FAFE9FA9BB25700EFA2 LHIMPIIN9
889,560,135 *5C8980A4A3B28E895C4EA269D802AD55855B6FA4 LIBERTYPRIDE
889,560,136 *5C8523B49BCF3E8DF797302856DB0D5D453FDC39 lifespan(2.81twotracksessions)
889,560,137 *5C896C771D9B03EFC1F127D42279CE3694F5ED3D [email protected]
889,560,138 *5C855F3D8F3398D24ABC87749701FB41C04B2978 JORDONDAYAL
889,560,139 *5C8F1C7B5191241C784668E5B887B797761276A5 LINDSEY.MCDAVITT
889,560,140 *5C8026F73424A17BEEE1A44230A4BB66A29A2D89 [email protected]
889,560,141 *5C8F74D8DB7971DB5D7E3D34ECFED36320979FCF JUANFENELON
889,560,142 *5C804F650A9094D344074D85B5342190B0532812 LIZENZFU7
889,560,143 *5C84C002A7EEFED5F6383B731CBBC9648A0C9164 LKINEMAN
889,560,144 *5C80D94E9FB21C61BBB41B5F91567977D7CD3AB8 lloydlouise
889,560,145 *5C85B1A8952A81815BD4BE87F5672DD8D74BFBF2 LOGINNET6
889,560,146 *5C8DD0B1E13ED00E91E91C3FC1F821038AC3ABAD JUNIORGERARDO
889,560,147 *5C8CE948AB8AE9B4B2B6F13E308554CCC3170419 JUSTIN STIGALL
889,560,148 *5C801664C41E5FA9844F4D6D2B9401200A586F46 LOUISE7205
889,560,149 *5C8B237CAB638065F07C4EFFA09E50561195854F KA166
889,560,150 *5C806A30C67839A1038D86A2C386818195052B06 LOVETHICKNESS
889,560,151 *5C83EDF12E8D708AFB4766DCE29F095E985F78EF [email protected]!es
889,560,152 *5C8F2F25A7910E00E4DD07737141F6B7E2F80DCB [email protected]
889,560,153 *5C8D558E3E016FA2D8962043ADBC7968CBCC6C67 luann-muntz
889,560,154 *5C89C1D94BB7272FB0C1560FBB6FB1D001E8EAB5 KARCHILA
889,560,155 *5C82DF8723717EB2AC6DBF74B138687E3306E126 [email protected]
889,560,156 *5C8E6B12F6B36F1A670BEEAF134ED61FBD21C6D6 lucysun4
889,560,157 *5C8311ABB1D8455EADCF106A4A22E1A5DA9C9E6E luiz.carvalho
889,560,158 *5C899106E6AD4841B41856E4843391EB0B05E267 KATIEDAMES
889,560,159 *5C8AE43EE6ADCB9E1D17287343DADB06D03AE6C1 [email protected]
889,560,160 *5C86F5275AF0B8F58259B00F676DFAD111217517 [email protected]
889,560,161 *5C8760D7369A06ADCFCF663EF07995D1F3CE32D5 LYHENEE
889,560,162 *5C8B8255D307B84065C9756F365EDF2F4CB6AABE KDIGHT
889,560,163 *5C8FA5AF47C462D0DB2C9B7CA7899BE362D912C3 keenanflye
889,560,164 *5C81E6AA89A0F2113C8F254C5D1942A0919982F1 m1>m
889,560,165 *5C8F9BE7901C0BA0571C262E188FE2A6ADE784CF KEOIIPZAUS
889,560,166 *5C8CAE3F2DCCF4CD5E1D5C8B2D0DB95237D2D963 [email protected]
889,560,167 *5C81CC57FB45E24D80AD8EF59DEB4BF04F9B74BC keshukaune
889,560,168 *5C8ED7A9AE5030176B39904C0412D3C383FBE2E5 kewikdyueeyxkmoncel
889,560,169 *5C8F1A51C90D37CCE3C9384B828924810DF82E35 [email protected]
889,560,170 *5C87E9CDD036AFB4996FD97E8B36354337B993ED manuelmoreshead
889,560,171 *5C865CAEB24B2D50A5D1229F77D1B211147E120D MANUSKOWSKI
889,560,172 *5C838D00430C4AC8EECBCA7AC25914477BCBF61B KISER'SLASTDAY
889,560,173 *5C859DE6EEB1E0E0EDEFB5F6DC695B03D8392AAE KIVITALO3
889,560,174 *5C8148FB6DB44ABC2A56ADA00D31B079B26F2071 K[:J
889,560,175 *5C820D82380C9EE268E7FB803A20E39C87DE4AF8 MARCEL.ROYS
889,560,176 *5C845894BC3A31B0E0FF67D3208630B6DA649AFD KNIGHTMOVESTOWEDGE
889,560,177 *5C833F4933A914B31843F0AEDD72A592E19653F2 kofi.emma
889,560,178 *5C852D59A8CD7BCF08B1FD2788138F1DB01B5A51 KOMBATCYRANO
889,560,179 *5C88806E3809BF6831F2760C46EC27581525BBAE [email protected]
889,560,180 *5C82C41DB47F9C6644C793F082CD1AC757AE9D20 KONTRASTEARJENDE
889,560,181 *5C8C4FC3C1AD738C347017AE87E2F4494CFBD868 MARLENE-ATWOOD
889,560,182 *5C8704941E4E31A9E8A56C7E7E5383F1B941DF37 MARLONBO
889,560,183 *5C899854549ABD6B7871FBC4E246597010843F37 KRANKBED0
889,560,184 *5C80392BE687687695DA16D2530E1285B18F556A MARTIN POPOSKI
889,560,185 *5C8FA139C47E4AF766BF157AA517B717914A83D3 maryfoggs
889,560,186 *5C84FC9218BA4B270EE754A207FD14B227C3CAB8 MATHERESAENRIQUEZ
889,560,187 *5C8668CDE460E30D97E50B9B50BBF702040DE572 KUEHLSCH8
889,560,188 *5C819B7ED0A3F6503C989F256FF753A945A6BC27 KULAMYO
889,560,189 *5C8A605D98CF3C381C8BECF7887ABDB0B6E1AD36 KUNAIS
889,560,190 *5C8897B374953386D743AC5D2E04ED4D78EDB039 [email protected]
889,560,191 *5C86695DD61017C876B662687D15981BDBD48CC4 L4EG
889,560,192 *5C8B0079225271D8121E1F9E63D9532F94BB1E42 LAMBOVITISSA
889,560,193 *5C8E50764828630916B58B995B2307986A6606E8 LAMONTBUTCHEE
889,560,194 *5C8F151FB9DB1596BEAB5554E5E761C8FB381D69 meneslée
889,560,195 *5C8DE4E9FEC4BFA2D404000CCE67E6904F938A65 MERRILL.STEMPERT
889,560,196 *5C8F714D39778E7D4AFE291C8CF74D5672855E3B LaShawn
889,560,197 *5C888EC490E00954BF0BDE67940B3E29FF499093 launcherdeltaontheloose
889,560,198 *5C89625A59454F2D4AA6C75238D0A6C61C8BE05C LEMUEL.SCOLLARD
889,560,199 *5C8BA9617ED815982B1E178571202F4DCFDC8427 leo2705
889,560,200 *5C843797E00BBE7A51445F7106815CA53AE0E7C6 leongjoey
889,560,201 *5C82AE96307EED45C9706930A0DBF90325D2E6A4 mitchellquertermous
889,560,202 *5C8CCCF4A4DA670569B612E4C7708B3CD41100AE mittelgrau
889,560,203 *5C85C176428EF13D43E4BE55D25216C4C1F51E7C LHARLIN
889,560,204 *5C8CAB605D46582B4FB8DF4A192CF0149B867151 libraryno.s-226,727
889,560,205 *5C80973FA706232D7B4A75F498C139E213F7D0EE [email protected]
889,560,206 *5C8543691CE52671592FD6D3175EB7DEAF0614D1 LINCOLN-JEFFERSON
889,560,207 *5C823EBC03AFC29CAACB567F0FAA6A865AC6CE03 MSH12
889,560,208 *5C8F221812F84209C60FAD1ABAE78A983F1116FE MUFF:FFUM
889,560,209 *5C871148BD7F325B3D5501B53DA57C8657779591 loamarrabanporlasmanos(martinete)
889,560,210 *5C84E0C06B4B4B8AC3FBA9B0792C6074C3F42390 logic-(dom-&-roland-remix)
889,560,211 *5C8FF410947790D5A20B5AD15A1934364BA29A3A mybutch43
889,560,212 *5C896C4936296A47E2251C9CBDDD611DBE5C9576 LOU.BANWELL
889,560,213 *5C84561B5FDDF10046C603F9630EEB6D8312F4ED N0NAL1GNMEN7
889,560,214 *5C8CFF0C0645AB7A3B2D32FF04D4450C545E8930 LOYDZIEHM
889,560,215 *5C867654379540CED7CEFEC8C536227720F6D2B4 NAJAMSHABBIR
889,560,216 *5C8375C5D68DEDE55DFDABBF705BC7B4AF32E971 lucasehrle
889,560,217 *5C80845F0196DE6F4A76BFC734CD1089DD96BB83 [email protected]
889,560,218 *5C878A3D7BD0A963A2D6A302991E07E2E3A3F71C luismearing
889,560,219 *5C8CB53F7EE34712AB56D6A211F0CED1A58B19DC NATALIE-CHAFFEE
889,560,220 *5C8AA0E7A95F9C01F4520156EEB8E8FEEE5C3F38 [email protected]
889,560,221 *5C85BAF02B037E0454A330DC9E8AF13FF057AFA8 lung(featnoremorze)
889,560,222 *5C8FF5C842D03F6901FB887F80415EDA1B3794BD „NATIONES“
889,560,223 *5C85219E2D6DE9C311D8F250D5C1AA47579E9A41 lutherlivesay
889,560,224 *5C8858B9F36567F650BDBEBDE59BB5EA3C94937D M},
889,560,225 *5C8F3169190EF6B56BC3380093AB2E65517C7907 NEJJEDNODUSSIMI
889,560,226 *5C8D654713AE26C28B4611570A389F5BF0E1B7D2 MA+3R1A1N3$$
889,560,227 *5C854BC9E9FA397DF9857535E023DDC47C19205D new garden
889,560,228 *5C8EC3F938CF60F34797B37E63D50D8BA47F309F MAGHEREB 1 0
889,560,229 *5C894B9EB429618A5FF94F732B91240FE080FDB2 magnitudefrequency
889,560,230 *5C8F001F7B3E53958F1E2D4B88387B999BF67E39 MAHOUJIN GURU GURU
889,560,231 *5C89EB56F3ED8B4AC59356A58B3DB92988E78FAD MAKE-ME-READY
889,560,232 *5C8329B2D1DC0D6BEAF305359DC3D77766D1E4B4 NICK.MARITN
889,560,233 *5C830CDF14114D9C4805639887A0217F8B60C822 manicho4
889,560,234 *5C8D34A1F13A70810A171EA51A8F7731ECD994DB manualsadhu
889,560,235 *5C8A17C40C60C8D9D062F571672732E427F37609 [email protected]
889,560,236 *5C861D511C4DD5F882F952DD2CCA19E8BB82D614 NOAAPREDICTIONMAPHOWTO
889,560,237 *5C81A39D2316E914BE7419B1086B0483E3F42A42 marcelooesterling
889,560,238 *5C87C6D4E52E18B7ED947B63065B8CE2B8A2C365 [email protected]
889,560,239 *5C887F5DDCD6864776D86995AF5B1F6B0BD23DE9 MARCO.MICHELINI
889,560,240 *5C80A45BEAAC36A1A8B29E6CB668E5F17402DB63 marderueda
889,560,241 *5C87D44837006379D69BE651DAF3582A12B65095 margaritomor
889,560,242 *5C8C17FE2055682345BF38B22E0B91C2764B6141 mariacristinalopez
889,560,243 *5C8A185C68CC52411618E0316A0EDB488D16AD41 MARIANOMICKULSKIS
889,560,244 *5C8CD399DA2BD9C42F0C1E0D893C36C5FB3CA916 MARK-FROMHOLZ
889,560,245 *5C8C6952123DD80FC8CA505FD5F2EB66E83C50A9 MARKJACABAN
889,560,246 *5C8C58D30FD03D95217BE27071FD257F27101382 noslefing
889,560,247 *5C835FE3D9A54301BB6D9E0F2704C93CC60FFC76 NOVELETTERED
889,560,248 *5C8F5D0B08B948850BFCD7BDDE348959C5EA8EB8 marlonbellue
889,560,249 *5C82CC4C8F1444266D23569F5EC690A13C435660 'marshal andy' andrew
889,560,250 *5C80CF8098572FF82946783933E4E0E1FC119E11 ntfoywm9
889,560,251 *5C8A8AC9561CDC03CF3DAD64418848F4FF7E514E nuestro.cielo.azul
889,560,252 *5C8070BCD8E071BBFDA30FC35389EFCFE8A42CC2 maryinfo2
889,560,253 *5C8573D845F68440D05DAFFD8FE69149B4C5D46A NVU;
889,560,254 *5C85F562EEB643F63F397D69D4B55369A456B4A0 [email protected]
889,560,255 *5C82D48ADF9BF548CB3B8CAE15ABB4DD34A9C205 maxlindsay
889,560,256 *5C8908B38BE9EBA9660A3EF98ACE40903E2306C8 meister­schüler
889,560,257 *5C82BEE6D381770FD5FDDD1BFB0CC77B6AAA5267 MELEZOURIOÙ
889,560,258 *5C89EE238A2CCD3964BC9B6D5CA74D3B62FB369E OLA.OP..37.NO.5)
889,560,259 *5C856126726F436591EB862036D69F03A9F6E8A1 melportolese
889,560,260 *5C847A0523067BF98A5218F736EDFBE24882C79B OLEN.KAUA
889,560,261 *5C801B1BC9B4D4355D03D8EB7EE8233113E994DA memoirs160
889,560,262 *5C8EF3D472F9F68594BF38CA8D864A5CB9B0455F ONOOGLIJKST6
889,560,263 *5C8F71E531A1E1469CB12C09867BA095A1B29974 OPNINGSSTILAR
889,560,264 *5C80A193B76BF0D6D3D63DC54B551B03D814483A MICHIBIK3
889,560,265 *5C8232D1015DF289B00DA9A28562DA162F274AE4 MIELLYTT1
889,560,266 *5C8A392C1AB661BE1A83B71AE4DA2DF238B5C789 ORIRUMUZAVO
889,560,267 *5C831E0D1D66C35300571F9069FB3125B5DA631C miguellorenz
889,560,268 *5C8D744CA69C62453E6698615A869B06D33AE85A ORMESHER0
889,560,269 *5C8869C54610F4875D36424FB24ADEAEBBEF1FC9 [email protected]
889,560,270 *5C8888AD32BB56B6E9BB7F1A43CCA4172202679B mikecrossfield
889,560,271 *5C8CB4172FA6A6B7892F8115488DEDB37BA32EA1 mikejake6
889,560,272 *5C88D42974916B390E78EB1F4ED303BD2A8AA0E0 otreztiwohadeent'noduoy,niaganehttuB
889,560,273 *5C8F79928698D1582B692E102DDF55014A678AA4 MIMÍSEOS
889,560,274 *5C8D2A5955110C11FB6FFE339246AE3923D41738 OVAGORBA6
889,560,275 *5C8967B13714905552462368C2808AB8744D5D4C overtwine7
889,560,276 *5C80691AFFC4FADF52F39EA657D677912C772DDB mjnglrjning
889,560,277 *5C8741B53556D8CBE14D7FCA0A239B8AAFEFE208 PANAYIOTAE
889,560,278 *5C836D508872EE9319FB1A3EEB7D14E3F1D4FECF MONTYSTEPANEK
889,560,279 *5C8173FF4916E89463DFB4569564F6595F293B14 MONTY.TORRION
889,560,280 *5C81AF98402275F0DB92E28E7983400E011C51E8 paranthropus9
889,560,281 *5C82FB50487ECC697994DF1AE14F6F0C4ABECF60 mostafaelomda
889,560,282 *5C85C82733A6B725ABB145F94EC5AF8C7BD9A46C PATRICKNUNN'-'PATRICK
889,560,283 *5C8821F997B7590BD64158712DEAB8C9E1D21F17 PAV3STO1S
889,560,284 *5C840F5C5E2D76969AB14662491DF601520B64F4 pd ~ `(0_<)
889,560,285 *5C8DE4CE8921A3341BD5D3ABBB8EFBCAE68DA398 P#D~O)O(
889,560,286 *5C81D7294C94276264D8F1A73EC1778BC9E9A23E PETERFRARY
889,560,287 *5C8E40DF2C58BEDB2380E1AE370701017EFBF5F7 nalisation
889,560,288 *5C8445F99F1A92AF4598E7E884ACAFD2A33892D8 PHILIPSONSILLE
889,560,289 *5C86EAB77B0DCF47D0A19B7A3AE2988EDBD46849 pickars8
889,560,290 *5C84A3D167FCF26877AF8C79710E092FAA46DAED <P>INTERVAL BETWEEN HELLO COMMAND RETRANSMISSIONS.
889,560,291 *5C8CA3ED07020382A53A5B4569B5161FC9BBB4A4 piskerning
889,560,292 *5C833379100BDC256E753816642F921F8D7DF3BE neal-mcintosh
889,560,293 *5C877103C56CDB8A2643D8BB315A046D84C1EC3F PL!GH+3D
889,560,294 *5C8C9E327554BBABB1F6777B16B3DE4240FF7530 polarisfarming
889,560,295 *5C89379C98071C220D0B8B045B015AA18398FF10 POPSONGS DEL ROSSELL
889,560,296 *5C89900B542BC98B26C1B0251F17B6F94A2A8D4F NGNGNHD8
889,560,297 *5C805BD32920341EF76690ADE9561E1CD467D639 nhkvdmn2
889,560,298 *5C80237E558980156B17862F5B60FEF5D16A32B1 p=p-~0-~o(>-<)
889,560,299 *5C85277383D56112671116E4C4D41F43C2E28941 NIMETOKA4
889,560,300 *5C804959D47E89FCFA2D7E5CEDB9D957772A575A PRACENI6
889,560,301 *5C888E561625AA92351BB846DB0017786D55D990 PRECISIO
889,560,302 *5C8E7FD4EB6651B3C2DA37620277737661C91EB8 produkternes
889,560,303 *5C87894A60BEFA9B9B75151C61B938CA811B5674 promethenirvana1
889,560,304 *5C85479F6FC2949364CC6DF14E64F8A93D03D84D NORMAN.ZAUSCH
889,560,305 *5C833CA6309890E2BAE2A3B02B303FC1729D33FB [email protected]~`splat
889,560,306 *5C8FFBF4E5F1AF85259EBA41EB080D4C6CC10F35 pulsedetonation
889,560,307 *5C85CBED96F9755154CB1E1F10A2A1B446CE9481 NPQ7
889,560,308 *5C8948C83B90857B03DEB2F29AF8CC37BA2F433F [email protected]~0)x(
889,560,309 *5C80228088EF1EF4451D6166C0665228D7E86F2A QERBACH
889,560,310 *5C881AEE69900A75F6761F5C8204094EEA0258C7 O.B..(SWISS.NEUTRAL.MIX)
889,560,311 *5C8EE83C68E1F5D530FAF483BA732520D845DBEC ODISHAMBERRY
889,560,312 *5C8290831C76D194CDF2BF019979B303EB6B3421 qscm
889,560,313 *5C80F4F38BF18EDE85912D47B3046C05FD588B5B ohun-h
889,560,314 *5C8AED4BF829114688460324AF083D7B04F4CB33 okaying
889,560,315 *5C8B39D5F93A49C118DFEA97316CB41D208C804F Old-Dog-Blues
889,560,316 *5C801C8922E985F6742C46D7D62C472CB081C47A OleJakob
889,560,317 *5C816F1909361BA2FF68FFC9AE2758F3A0E9CDA2 ologenetica
889,560,318 *5C8D30109438C3F8228E643786118F91A6B218EB racquel-merritt
889,560,319 *5C802A06811E34A8A3152DDCCEFDA3072DC810B4 RAFAEL.MCGOOGAN
889,560,320 *5C85838AC8EF736E28B6F69585029E62CF5DE19D orlandospringmeyer
889,560,321 *5C896532FC834E9D381DFD0687747C4809F72766 RANDOLPH.PETTERSEN
889,560,322 *5C872681E7650FCFD5EAB70F163D0A45CF8B264F OSVALDO.SWINEY
889,560,323 *5C882F0AB2D9E83B43D588DD5C158D97CBF6F4B8 OUKBBHX85
889,560,324 *5C84E567E0B7C30ACA1CC48A705468A93BB153E9 owenvanella
889,560,325 *5C8439E22E68D493447B5F2F6E089D2F67252E50 REGRETFUBSW4
889,560,326 *5C826A069A2A604793D5AABB24EAC10D1045BCF5 RELEGASSI8
889,560,327 *5C88E05CEA34ABB8F3DBD6B511770F52C3BF9D07 PAASENGERS
889,560,328 *5C82B0DAB858118ADFCDD0694F3093A27BC1F9AA RENESANCNIM
889,560,329 *5C85D8FC86AA258A284CE74CDD4F651FF79D848E pastorellainfdur,bwv590
889,560,330 *5C849D9C8095CDFE1A70FE7C13E9911F33AE3CD2 RKZGNGSDAVJSSV1
889,560,331 *5C8FA19355B7C9C05109487E1E8F474A79F06112 pelastanut
889,560,332 *5C86E47F000AB309D3C677F2D2E54325DB64BBF4 ROBERTRODAS
889,560,333 *5C84A0351202E79E32550B75F38514E695CFC463 RODOLFO.TIEGER
889,560,334 *5C8516CD8BCC055106392B6F214B3B84F40B377E ROGELIOPAVESE
889,560,335 *5C834C55D97B63BF218B8806024F22C833CC863C RONNY.ABE
889,560,336 *5C88C15ADDA195475406723E3B2A77500CF6C1AE [email protected]
889,560,337 *5C8E75D07C607DFED7A0A3FE4856F98AF6AD6951 PLACUERIMUSQUE123
889,560,338 *5C847F292C000EF4F00C09DDD2A2F4AAEA83A9EB PLAYNTHE
889,560,339 *5C886DC12BEBDCC78196441B099B3C94C47644A4 royalists40
889,560,340 *5C8398A6DF48D6F70EE854DD42A09BAE7E1EB5A7 PLUGINMATRIX
889,560,341 *5C8BB92D67B46C9B6221BBA32982961444A576E8 RUDY.WAINSCOTT
889,560,342 *5C8811B37058B9FFF6565D75E3A5EFBA3FA49388 rupertcissell
889,560,343 *5C820AADAE75D908783ED312DC39269DDE2C49A8 p>.~O~o.)o(
889,560,344 *5C8509CD58A23010A0E29CAED1E25F6C3E4FB018 RUSSELZAPPOLO
889,560,345 *5C856E70BC3381164EDAF5756C568B408F10FFA9 pop!nj4y$
889,560,346 *5C83225082D45B5A30E4F784AAC3E049B8171924 porterfalbo
889,560,347 *5C815EB664C663C17DF532577097277A34638882 RYANGUTMAN
889,560,348 *5C81375450C11F13B8F05FFC1735FEC779456A09 ryan-mcnellis
889,560,349 *5C8D7ED2E4FB6C082076A94D3D615B804D073255 RZS9PU
889,560,350 *5C8ACC026AE7660C34BF2F71B36F9143D72FEB8E SalvadoreSanchez(acoustic)
889,560,351 *5C8A86214C6028AF0917C4BABDFA1866DEABE6FE PREPARINGFORBREATHWORKFOLLOWINGYOURBREATH
889,560,352 *5C8EB0421A329788C1A89E94B2BE9C17E94FA14E santhosh-menon
889,560,353 *5C888A55E4021413985448FD2E01E9CBE30A4683 PRIYODORSHI
889,560,354 *5C81AEBA36D9403E68CEA3C292A5BFF77F4C5DE9 prompted
889,560,355 *5C854AC672BB778735520DB52C5F952C03627098 PSDTRMRL9
889,560,356 *5C895CFFFE8415E6C37090686851498AD6BAF02B p####)~ splat!
889,560,357 *5C86769100E177DEF896538D2BE39894082BF7F3 SCHLICHTEN/DIXY
889,560,358 *5C8B0F3B8474DC2342895850B17459EB6E57695A SCHULAMTLICHE
889,560,359 *5C8D9C03E06F102592CB0A5F50040402D6C800B7 q--B~Osplat
889,560,360 *5C8E357D0AA1943CF1945C8F79B978C4ACE8E3A2 SCOTCHVANILLA3
889,560,361 *5C8579FA6AF786DDE3D0009DEF48F73D6EB46C68 q###d-~-~-~splat!
889,560,362 *5C8AC6FF96E06BF8BEB2504884FB5D0B242C2E62 [email protected]
889,560,363 *5C8CCD055AEE23BE5D2AFF9C33D18F26F54ABD82 SEBEFELMER
889,560,364 *5C848F58D4873ED315169CDA9F04596AB531251B QQQWEWQEWQEQQQQQQQ
889,560,365 *5C853F6A3A4395F3BD0535AF1F839D10CB80FABB QUASIDELUSIONS
889,560,366 *5C8A8AA195EAB8053F71AF5C467B40DC482D259B quinncristales
889,560,367 *5C865D4DD7A67230197173EE837ADCF248F78E1C R0cket-p1
889,560,368 *5C82AA99F599DCCE651C9D0E86D259F7808D4410 senrena
889,560,369 *5C812D54715FD2512C4DDEFDFE97FFEA85F85044 r4d1obro4dc4s7ers
889,560,370 *5C893272CB8B0079C2E8D20D8E4C215A7B3D25F9 seriously west coast, volume 2
889,560,371 *5C85FB87AEB768A4FC0889EF97FC8F4336E983B2 RALEIGH.JOHNSRUD
889,560,372 *5C871F6CDFB191E8D50BC8A7BBEED0224688CCF5 raleighsozio
889,560,373 *5C83463B2536DDB4C188A18988A9E8796A323AF7 RANDALL-COWAN
889,560,374 *5C8A640C420B192C91CBEEB3D8596DE671ECE87C randaltremain
889,560,375 *5C85323894E646638FB5977F6CD2D0C971776C3E RAPERONT9
889,560,376 *5C8C5E41D4845D18172B716F739A18862373418D RAPUNSA7
889,560,377 *5C872B87BA54CFA312672B81228A8A43E8E0369D RASSENKUNDLER
889,560,378 *5C8B66697E83661ADD1A21B8A3D147B442511F26 sheldonquebral
889,560,379 *5C86FB011E63F84D268FF14EADD5AF3C616B7545 REDHOTRHIZ
889,560,380 *5C8764FCD0EBB210F0235775F437A2757B76B12C REE-LINE
889,560,381 *5C81CFB49925038437441163D64084DA352CA5AB REEL TIME (DAVE WARRIN VOCAL MIX)
889,560,382 *5C8B6F835C624FF9D70288FD6B3E3B1357656184 SHIKHMAN7
889,560,383 *5C86EC50F255704B95A927906AB0D3D9A8F8EC61 REGINALD.TRAXLER
889,560,384 *5C8C149C81066406AEA60031CA05C583CCE5E925 reidkreidel
889,560,385 *5C8C70DF4E5DCB1F50C38E879FB644EE0152EB12 REKANALISERINGEDING
889,560,386 *5C810B1F42EB438E89B5F507D998069717189B04 REKNAWASERET
889,560,387 *5C89FF2A7C84503BD5E8E3585CC4D16550757A03 shuttanced
889,560,388 *5C8BA83BB10A907493A2F31483FD5D2DF84A739C rema-al-starz
889,560,389 *5C89C1DC97D7B08E00FACAAA0D6793F7BFEB5163 [email protected]
889,560,390 *5C80832BFED29F6BF6E5515D15D8A3ECD080D9C8 SIDENOTE.URTHOGIE
889,560,391 *5C80AF219D7B3D831EAD0A54CEF1F21DEAAEBCBF SIDHARDNETTE
889,560,392 *5C8ABD032605118513C7736C9093450F560AFA6F RENALDO.ZACHMANN
889,560,393 *5C80D8C588B10A0551986F2427C5BF39D1326D56 SIRREE
889,560,394 *5C846FFE8A893E91EB520E6182AA767C363A9A59 [email protected]
889,560,395 *5C89F998076827E2963833FB4ACB210DEF2C618F SLIVENOWICZES
889,560,396 *5C80FA45360473EDD973F3DB859A36FF867970DE SLYKITOK6
889,560,397 *5C819228C37A36299D8E30D4F2D2EA99402DE157 [email protected]
889,560,398 *5C867B55A638E3725EDEC2F8FBF3E5A617C8E161 SOBERIZE
889,560,399 *5C860457DE40057ED32AAF075D88D0BAC471A9A8 RINOAAUDREY
889,560,400 *5C8ED6B1A05584E53E87C609EB476F59275EAB43 RISBOROUGHTALKPRINCE
889,560,401 *5C8AFED97D9103EAFA9576552F823B4EA3019366 risks-scenihr
889,560,402 *5C8BD23206C32ACA294E7E7752286EAA95E72E00 sonataincmajor,hobxvi/7(before1766)iimenuet
889,560,403 *5C8F0E14D3E2D6C1F8CD0F0688A5D0A000C75188 ROBBIEHERBICK
889,560,404 *5C87213312F7E28397F41101949981EF95806CF9 robcompere
889,560,405 *5C873A8D406417D8F378A1531EB8A74F25724DD7 ROBIN.VACHA
889,560,406 *5C8438239F530EE5D099BA01642357EE350654E4 ROCCOCRICKARD
889,560,407 *5C8112B25B0202D8A702ED40197AF72C584AB26F ROCKYGREGO
889,560,408 *5C8842AB3C2D30CD89EC994F3C193EAE95D82152 ROGERFACKRELL
889,560,409 *5C81CDBA04D66B0923DB1E1FD7D7CDAA0E12DAD0 SPANASIRIWONG
889,560,410 *5C87DCFF3586AB05EEFF83FD9D0BABF527094592 SPERMATOKÉLA
889,560,411 *5C8029B3A4D2462FE41CC0299D164473219BB155 spideronmybed
889,560,412 *5C84A42DB1052E23018079F565ADDD707E430C5B rooseveltroskop
889,560,413 *5C8A34F56D13E9347A24BAA7AF2AC74682AE2C8D ROY.STOLECKI
889,560,414 *5C8E4CA61E4D9779DC130FA6A7005A7AAE1F8B49 sreegitsac
889,560,415 *5C8F31D284F4DA6074C68DB61A880D52580BBEE7 sssendlob
889,560,416 *5C867AF44D1FF65E077DF4F586BD7389AD616B8E RUETERPPA7
889,560,417 *5C88348586FCC104186FC6F3D7A18225D4843F1B ruiniga
889,560,418 *5C845F2132AE9750FBD3F33770058B88F5BFB524 RUSTY.KADLUBOWSKI
889,560,419 *5C8FCCE9EB1B99F4143825375FC7B8A6406555CD STEPANSMINDA
889,560,420 *5C84748F2A932483B7B3E7EDEBA3929B749F6344 STEPHENMAZZOTTA
889,560,421 *5C8CC0A67CAC125550FD8EDBB21DCA5E3782BD9B RXYGNSS3
889,560,422 *5C82D3E937C0B5ABB2133F0BFD2EA1982C949AA6 RYANBUEL
889,560,423 *5C8E588D79661D74339F992A89DF834C829488F8 RYAN.SCHARIO
889,560,424 *5C8A0C9C74048901EFEDD8CC8BEF5271EB6D53A4 STEVEN.POLICAR
889,560,425 *5C8A129FB64090AB79368A174E681B507138B3D7 RYUUTISED
889,560,426 *5C882DFB97546E0E211349030ABB0D5C8E36237E S3CTONN9
889,560,427 *5C8B641C4954B2BE86F5843B8E96B6FE7978D548 salvadorreade
889,560,428 *5C82AD61F00BB2618744C7FD899C58F0E8D6626C SUKINREP5
889,560,429 *5C8B67EB8D66C8BE3D2073D6D73471892E545F50 [email protected]
889,560,430 *5C8BC6D43F3C450944CA6C85B39C88A56CFA7F3D superparamagnets
889,560,431 *5C8BD361517F90A5FE522F1C5C69FC4F41C7ADD0 SANTIAGO.RODEEN
889,560,432 *5C81A326E53DFD15BC605A1EF5E30DC62280D64F SAO SEBASTIAO GUIMAR
889,560,433 *5C83B23523FD0CC8B3244752316648D091FFFAA9 SAPPHIREWILLIAMS
889,560,434 *5C86A1CA5C22FBCC971FBAE16502CAF44616825F SCIENCEGIRLRECORDSCOMSCIENCEGIRLRECORDS
889,560,435 *5C8FF9F58FEA05842F6E670EFEC0DC1134371FC0 TAKERUMORI
889,560,436 *5C821C6BAE0360C3CAF367572EDEF953AE51FCBA scottdevine
889,560,437 *5C85648EF3A5C53305BCE20D2443B778D28518F3 tararaaaara
889,560,438 *5C87E9AB35D7346EC2B72F23C35F2FEE5AEAE808 [email protected]
889,560,439 *5C8FF63B09C36ADF4291ECD2F8E6656DEEB08D8A TEAM接續開發維護工作。
889,560,440 *5C83221DE253D48EB6401FDA2820537980D2AE35 SESRAFEDDEG
889,560,441 *5C82B72E3D349192178B01A68C8BEE91AF9F9A00 TELEFONDATENSPEICHERUNG
889,560,442 *5C8CA239E78C614A4D14D7892DD7F541B045CBD7 TERPICZÓW
889,560,443 *5C8BDAABBF29A11F5A0585D844C1E3A43E01F1D5 tessain
889,560,444 *5C826A230BAA80A6667C1ADFB9E62F1B93195653 shawlthe
889,560,445 *5C86CC2A42A2CF46EF3409714DF0B36407B263B4 thatcirrus88
889,560,446 *5C853F04A31A286896C2BD9CCB3A12204A98DFD7 thefooning
889,560,447 *5C87D03D1416096278E7A815A69DA638F8077A6F THE-KHLYSTI-EVANGELIST
889,560,448 *5C83A133BCBF979BC68603C1426EDAB428B036CA THERMAEP8
889,560,449 *5C85EAD440C961564E6D1EFBF856DF8BABCA20AD THERONURFER
889,560,450 *5C85ABE8A2F38EF72018299EC8B745B4D3884698 SIDEMANN4
889,560,451 *5C81B72CB9FFCA7EF115430BDA5D20917FC7BF54 sindhujanu
889,560,452 *5C825693064B9C3D1AF7332DBC24DDB9E3C7F315 TIPPENC
889,560,453 *5C8E63BA02DF95C19AB1EB9F5391CF40B4FE7BAE SMAKRIKTNINGARS9
889,560,454 *5C8A2CF092F2FFAF581FE5279623C5AE39DB9220 snegnindror
889,560,455 *5C8E12D22A5BDB4D65D0C2F12ACE47C98192CA15 SOBERIZE
889,560,456 *5C88CC21BF72C3E4C30EDE3B689318F37BA05D56 solomonherter
889,560,457 *5C872E7EF5FEFF7592806DBFC01294953CF16B05 TORYDAHLEY
889,560,458 *5C89634BD0484AD1E0DE20831B418A29D53521E5 sonnyscelba
889,560,459 *5C83DC33A505ECC29DB49E4C5353EDE96FF806CB soteneved
889,560,460 *5C8475C521966825AC7E0140A9CE6436BD5802E5 SPANKYAMANDA4
889,560,461 *5C84454D0916D68F9B704BA9C6B9119298882225 SPEECHLESS(SEAMUSHAJIBIGLOVEREMIX)
889,560,462 *5C835AA1B21B00A015436CCA8F9771BCDE2ACC54 spekyll
889,560,463 *5C834D7C242BC90030D25DAD249D16CBD164B3A4 TRENT.JURGENSMEIER
889,560,464 *5C8D64056D11988EDE6CAC500B3C57846A7F71BE Tres pequenas piezas: II Por caminos de Santiago
889,560,465 *5C80667B1B0F371B2DF6F1C386E0AB2A1B0707C4 TRILEPTH5
889,560,466 *5C81CB357A0DAF53601EC4F1A87CE077A3688135 TRISH.PLEMEL
889,560,467 *5C82CC6C559E31DE8EA366F06506A2587940DFDB sprplsbl7
889,560,468 *5C878B2D739F34FBFAAFAAD7F47CCC442463D555 [email protected]
889,560,469 *5C875F5661902B2A60F436DCAF930ABF9B9FD2BF [email protected]
889,560,470 *5C8136F0FF3497BCD2EC95CA5275FC58C28D4021 STACEYKINMAN
889,560,471 *5C807ADDDE7614F4D37E8D26E43365620E323BEA stanleymccarter
889,560,472 *5C8D7AED91C6E9C33BDBE99282F805859E796385 STEFAN.MEISE
889,560,473 *5C8BEFB05020B0C7315FC19C43C46896456B54CD sterlingizumi
889,560,474 *5C853BBFCC80B876AAAADB3A67AC4B6B6F9EBF3D STONAVANOSED
889,560,475 *5C834743C478BA857B64D13D0807E48694363DF3 tyson29
889,560,476 *5C8BAA5D09DEA7FB6A7DA2D9CD36B129B7FB6D5E uitbrokk1
889,560,477 *5C81CAAA1000A1193B630AA59B9A834C5CABD73A Uncut:.Screenadelica:.Hot.Sounds.From.Cool.Movies
889,560,478 *5C82291B7AD024A805CA8724B4289F89511842D8 SUNSHINFUTURE2
889,560,479 *5C8F98E6DF58E52F1A521E6C1B745BC7609F1368 [email protected]
889,560,480 *5C8C765FD6BF44C3FA18D23E839C561A9DF4E7DC このほかのSUPERBIRD
889,560,481 *5C8C7F530949F90282B810C51EBC0A34B3BFB60B [email protected]
889,560,482 *5C8A64126BFE4790A6E3BC90FB484E94DD3CC1DF UNN4TUR4L1Z4BLE
889,560,483 *5C81B388D97B3FEAD45AC4411AC29F4D4A8CCD55 SUZYSAXON
889,560,484 *5C8F10B5A54808B3A444F44590F6740964EEADC7 [email protected]
889,560,485 *5C89B71A8E8E6927C2D5B216A29883BDA48BD04E UNTITILLATINGS9
889,560,486 *5C8CEEA27EEE136203E91E6CD951E9F3FC5F2B14 URUBUNOTELHADO(MJCOLEREMIX)
889,560,487 *5C8473E1FB93A2EE9B4E0785BD916509CC8A9A46 sy$a
889,560,488 *5C8B71B5AA1D4D58EA7719FF06223FEC9A93FFE8 usual.*phrack*.routine,.to.a.good.one.hundred.and.fifty
889,560,489 *5C845B27AF6F7EDA6192586F0491D1272861916C symphonie no 95, hv i/95, cmoll andante
889,560,490 *5C832525029050A304181355529174D848AAB92C UTTANJAYSHARMA
889,560,491 *5C8912FD2BCDE84E8DE823C478F0451796B95CCD TALK849424181
889,560,492 *5C85373DBEFB086190F8DD0017E2C2A41704C310 VAPENIDROTTER
889,560,493 *5C8014CE6EB46F4F679AD74B1A621CD92E9C222B VEBBY TARAN
889,560,494 *5C85FE2FACAC0771FC00A5D91DF176DA11C700BC TDENTISTE
889,560,495 *5C8E4602B0DA4C0F4CD756B6024610FD42D9C517 teagutre
889,560,496 *5C8119DD77910CC7BD645842B79F2C02BA211F7B VERONA-GAY-LOBITOS
889,560,497 *5C861D4186D556D3438A554625F72504E12A2F20 TEJAZOS5
889,560,498 *5C8C8342D49D2855CF712632F94B582D6B9FD92E verweben6
889,560,499 *5C879D1EA02D6F679B2AD0DD5148CA316D77022F VICKYGENERAL3
889,560,500 *5C8F5D369263E3B3984FA7F6D69CBAAA7E131425 terrellwashnock
889,560,501 *5C8F50F31579AADCAAF35B7261B0B78B145ACC98 TERROSA2
889,560,502 *5C819ED4395CFD374F1E10D5299785E71F5CC68E THANMANI.6.0
889,560,503 *5C8C5F1CD7966386730E410C8A8E4707710A655D VINCENT.TJ
889,560,504 *5C8E8A5717F075617003B48D03F68623C9B8B422 VINCENZA.ITALIANO.CORTESE
889,560,505 *5C832CB5C286B4C93271DC5D186167D17AD3A7F5 VINCENZOPLAXICO
889,560,506 *5C83BAB5E92FDFEB7DCB11C25D25F6FE9AD5803D VINITHA.PILLAI
889,560,507 *5C8CC6E8D7A7C2BEA2E7EBA806F34F734BA26BA9 vipel
889,560,508 *5C8EE3B919CCEF210326E4F3A8CB026EF44953F8 theme from "peter gunn" (feat duane eddy, 12" version)
889,560,509 *5C8EA8912B612CB7BD88751CE8ACB85A44FBEFEE VIYESOSARAMTAMIRA
889,560,510 *5C8188E6A7C050DE28B6BF9120EC3B13A65A46E7 voluntary-jurisdiction
889,560,511 *5C85ECE4A4EC9A8A5CAE2212467DB1556FF095C8 V*PR
889,560,512 *5C8E82065ABF1F1AF77FE40EE567CA533294F312 wachsmund
889,560,513 *5C8D946F4230009060DA191783B3C72B9277208D waldschrattderwustling
889,560,514 *5C8D7C5D9A605C5EF0A82FC55A610470A088CD71 WALLYHAUPTLY
889,560,515 *5C8CCC5A2D4F87A7F71259ACE2A5EF2CF0FF8008 WALLYPOFF
889,560,516 *5C82D0FC2F6422E3A077D0991A62FD23C58A0683 TI1SV0R
889,560,517 *5C8DB9936FD06CDC071DB9DC67A77CAA8AEE4369 [email protected]
889,560,518 *5C8341AFB71D1672BDE774AC23922E33910C4000 WAS GANZ FEINES (LIVE)
889,560,519 *5C85F339E27615D30605C9619DA0A8C803AFE802 WASUWEE.SODSONG
889,560,520 *5C8C828DB04BF42970E86289A9006FB6534ADCA4 WATCH-MIN
889,560,521 *5C844681A202233055E435CE42F75C9BEB6B61AA ],WB
889,560,522 *5C8DA3DFD4FD4AB96784C800CE27B03268CBB764 WEAREALLSICK
889,560,523 *5C82C0E295023C982FAE64462739F6B50FF70846 wef;
889,560,524 *5C803FC83ABE2A8A89F95324F6A792A6D4BBB3DC TMF-Hitzone-1
889,560,525 *5C81E1BE2BC93C3F53B6F9CF6C319A5599B6FCFE TNALUMITSOCINOT9
889,560,526 *5C8A26345BF8744C2F0FC01441CD2CCB5096DBF3 wendy-muparutsa
889,560,527 *5C874569A45E293168397315A04B35C43C9ECE5A wendywilsoneskay
889,560,528 *5C8310D6BC5564F1F480415962A9C2CF1A28F0AD [email protected]
889,560,529 *5C8FAE718178083256FFE2F29A607B56450A42BB TODDJARNIGAN
889,560,530 *5C84ED57043C94138F3E197904B978971D099069 [email protected]
889,560,531 *5C88BB82BF54F11155177CEA30AAA920CA7B344B WETRAINBOW
889,560,532 *5C86BAFC7F22C4BD8CFB0804A565EDBAAD047B68 [email protected]
889,560,533 *5C8174F4B63FCA207EAA37E4F5D2259083CBB670 toneydames
889,560,534 *5C8ED2B1BFCF1F004B76BDE37A4BDF43AB8B28D2 whiplashes.
889,560,535 *5C8511FD0F60A4C6F237902347D7F79D59EC3FA0 TOTALPRAISE
889,560,536 *5C81C0E9ACBC85D15BD41A26F7D1982E34C84F1A wilburnianniello
889,560,537 *5C87AF9C60638E69AF6D6ACE37983A95018FC42D TRAVELSMITH.COM
889,560,538 *5C81032D3B41E7FEA4087ACDF3179B16C0CA3900 WILLIE.KIRSCHENMANN
889,560,539 *5C893110E4E06E94677DE3C403B742959F921BEC TREFONEN2
889,560,540 *5C880304B1F368ED60E86E5CAD08B39C39A236C6 TRENĀJĀS
889,560,541 *5C85315FCD63E8C5F2AEDB00B32141447E24ED02 winfredpolashek
889,560,542 *5C8F808755C62AC38D2C43957397F414BE59D06A [email protected]
889,560,543 *5C8DB3A5A6063A870C73DAEB95069095F5943884 TREYSCHMOKER
889,560,544 *5C8FA96D26625B0B8DA85F3B0E66A8D51383FC80 TRIAD888
889,560,545 *5C8AD3E7193DD56022A45C2C0FF03A3475346370 [email protected]
889,560,546 *5C8F21AF1887865118E1D4F729B6459C68CFB6A5 WOOLWEED2
889,560,547 *5C85AC78D99379FD9F7AA4E46040EAD281AC21E2 trowtac8
889,560,548 *5C8591D7F6D122119CCE8259BF186E3BB8388D90 [email protected]
889,560,549 *5C8C31829A72C879655E85C4AD20E718FA857171 [email protected]
889,560,550 *5C8DB5D689BC10B14F641F4B4C5F101CD938C69B wwwcelebratewithmusiccouk
889,560,551 *5C82B6850E00855813D4A233CD30FE4C1A06E98C TSTYLINONEM
889,560,552 *5C878AB09DCD597454C08063BBCDEEC2E0255C2B WXX62286182
889,560,553 *5C8014E2F2E35359540D9EFE7F53C49BB9383ABB TÜŞÜNDÜRÜÜ
889,560,554 *5C89C9DEF88AB5A3177E7FCE72D1F123187F376C twelve-and-a-half-year-old
889,560,555 *5C8388639C72DA4E64A399BF31F29740AC5ABD14 TYNSA
889,560,556 *5C86F310AE9C7117DC66BB5A2F5F18E969B27EC3 xichen-tian
889,560,557 *5C897B50BCE34647901BF13B96060C67EAB612CE TYSON.MELTZNER
889,560,558 *5C8EDA0B566D4934112654D561FCD837E55070DE [email protected]
889,560,559 *5C898FA52D96D207F168E89C7C70980AC957AE5D XSEVENBSW8
889,560,560 *5C85A45005ABF2BBC1E2DEFB7E3D80C1B4315216 xumsai
889,560,561 *5C890D55494E0E8C50C19A1806448E5EFB128547 UMFLATURILE1234
889,560,562 *5C8B0C3056CEF955EA8AAC64B823729F911923EA YARNMEASURING6
889,560,563 *5C8F7BD33FAB3DB815130A592C1B6E1F26954CA7 yaroslav.gerashchenko
889,560,564 *5C8CD8F5E082DA8FACAAF30B53D74EADDD68F42F UNDEFENDING123
889,560,565 *5C83EE35559B93EDE2DB99739A1DCAF6AE35CCFC YERNEN
889,560,566 *5C8ED88E6F5C5D6C03A71342390FF60B55C9FAC0 UNOBSCURENESSES7
889,560,567 *5C866E5D10A7B8AE9679D4D7AE46530279239E0E UNPUNITIVEA
889,560,568 *5C894F39CC326F45025334CA34D3784FF67AAA73 YLNÉGALITÉ
889,560,569 *5C83383FF08DE745921F51D3AD884220751B1D84 untouchablewarriors
889,560,570 *5C84171E02E41671375EC6DD2837C4D4E114B359 YOU-ARE-BLUE,-SO-AM-I
889,560,571 *5C8F77B5F11DEB2CF6358BE8A286C75AAE6B4285 URSULA.NATASHA.HUGO
889,560,572 *5C882AC68E3CD83FAADB199A6AA2267EAF38138F USAMPCREGIMENTALINSIGNIA
889,560,573 *5C85C30962DA6FB607FC2E6C46EE7314339D9512 you've-got-a-way-(notting-hill-mix)
889,560,574 *5C80D83F813258C226D354C06CCAED71AB0AF56C YPATHAAN
889,560,575 *5C8DCA11946543E7DFDF3375CB30E3166B051B21 Y(SJ
889,560,576 *5C80D509C6DA7AA79F2B079C170E1AD235A4FD40 uyieharnidn
889,560,577 *5C8D8C420E10844BD9B7B8F654BAF0FEB0293F0B yvonne.thompson.keets
889,560,578 *5C895E7D259169849661B494953BEACE61904B38 yyh
889,560,579 *5C8D3740C4A15147C7E11F8AB6B590FA1DC9AEAE zanebraker
889,560,580 *5C89B94E05DEA04C36CF4D1ED54779760D4D3211 ZASYSANIA
889,560,581 *5C81957271837C1F903BF7C860E3C4DA0E4663E9 vernonvercher
889,560,582 *5C8A27490A430FC75CE988B59FFECAE141F6D7A4 victorkaczmar
889,560,583 *5C8CE1C9A64609A5E8FED0AD445FC9D2136643BC ZORRÓBAN
889,560,584 *5C8FD78DF77CF99E475FA4396E5905B72A08DA5E z:uq
889,560,585 *5C8F9FB58FBD219909379E21FB1925F0E4167882 ΣΤΑΘΕΡΟΠΟΙΗΜΈΝΟ
889,560,586 *5C88B69E6F263FF21E1AE3A422201144E9E3CB1A ВЕРХНЕВИЛЮЙСКОЙ
889,560,587 *5C87715FFA191EFD998B6D0DEEDE227C0590A33B ВЪЗПРЯЛАТА
889,560,588 *5C8DD66EED89839AC38629961B49F9E8FC969D6B ДАРХАНА —
889,560,589 *5C878B67EC93651E878F2DB141DD7C47287C8E8F vintagevocabulary
889,560,590 *5C825CF590942EB17339551B2215CEEBB574AA46 ІРРИТАТОР
889,560,591 *5C88B9772DBD8167698474C342F460DE86088000 «КАПУСТНИКИ»
889,560,592 *5C859265E1F8A43020ECF52F3CFE920A89502205 КАТАФЛЮВИАЛЬНЫЙ
889,560,593 *5C87D0C66D94291B1A51FE51B431C102EF888014 КУУШ
889,560,594 *5C8C7C66A3907E8E53BEE8707F3843777B360DFE мейрине
889,560,595 *5C84D4F683C3A606384AE4D8B864D1541BF54BC7 VRMTCLSNSS2
889,560,596 *5C848E538A110850DF1F729EEEB7E1157A873963 ПОРОГОВОЙ
889,560,597 *5C891A4215E02524BA998B768DE02EA21A6F6C95 vyella.3.0
889,560,598 *5C88F5DF5FC5E272D5951A953FFB6011B2082594 РАДИОЕЛЕКТРОНИТЕ
889,560,599 *5C846977D7B19D8FAABBBC3B30BF5EB587BE8089 «…СПОСОБНОСТЬ
889,560,600 *5C822B47A3B7FDE371E53EAC2CC65D155C7BB77F ФОТОГРАФУЄТЬСЯ
889,560,601 *5C877DFADA496E35F0986A8B17A174B60B1B16EA ЦІКAВИЙ
889,560,602 *5C8831B64FD064664B98F051F9235020B25D61E8 [email protected]
889,560,603 *5C8E1BE27B9D088864C1ED51E4668D4B098DC2ED [email protected]
889,560,604 *5C8E5A41CFB0466A23040A93EA8EFC6DA4FCACF7 WANIEKAK
889,560,605 *5C8A7DEA9BE2801DB08C202C39C36D2ABB661A64 WANKELMOEDIG?
889,560,606 *5C80DDE05792BC211B907AA186894480B877D3D2 WAYNEYOHE
889,560,607 *5C864B29078522E61460620DADF83773A20D50F9 WESTON.CARROS
889,560,608 *5C8DB5704CFE8B76B818D3B2EAFEA8F93769BE14 weudsmoreira
889,560,609 *5C825D7BC25948AE5FD33C3E3A80067BB2AE2E42 WHITERIDER6
889,560,610 *5C88A0EF1394206EB3F6B7597560611D707D49A7 WILBURKARIN
889,560,611 *5C8927FD144947D69E86B7EEB907D67C645633CD williamthomasmorris
889,560,612 *5C8EE6ECEE7C39D7B0FB206D86B2449CCE103155 WILTON.HEFFNER
889,560,613 *5C830FF8C7AFC437AA70268876CC1E82052DF7A7 wiseguyspizzacomauwww
889,560,614 *5C8D36ADE20387CF223CB512F35DDC9A3E557FDE W[KN
889,560,615 *5C8264ABA91465F2411806C89FCB7197C83F1DE6 wonko.der.verstaendige
889,560,616 *5C87B3FC54D189C0C61375B9995B1CB6563690EC WOODYCOOLMAN
889,560,617 *5C8F4AC0ADB9E9DAEAD52745D70C20D5A6657B1F WWW.INCUBATORS.ORG.IL
889,560,618 *5C8E2B802AA699E4CB28D4AAC0FD2C35B94B73AC X|{\
889,560,619 *5C891A2E07AF1900BAA155F5F9DDBFAAB942C94B X163115
889,560,620 *5C856A9A59EC21EC3E5E3409538604C30E8FB73D )X([email protected]#####B
889,560,621 *5C89B8F512822841B8C99F91A01B6FE85BF95B9E [email protected]
889,560,622 *5C8EBD499A97D4D0561BD16EE029B54C2D848161 xvvp
889,560,623 *5C82E4271C6F434702624E79FCD0A7FF6CB92B7B YCARLONE
889,560,624 *5C880D2FB1B182A338993CE7CF30E963BD91FF7A YCERCESNUED
889,560,625 *5C8C52029B006D04288EE127F124A2057F58ACFE YCNAIVEDS
889,560,626 *5C86868E5CF2FAD7D928AB0108ED165816D5E500 YLT]
889,560,627 *5C81AF21FAC7E2103D2D920D1BC62AEF5617FFDF yocopayeleha
889,560,628 *5C8D3AD69DB699AEF3A17638872459EC149CE41F (00).0~.Q8
889,560,629 *5C801F285BE74FE224342A6FF837CDD3FA5292B0 01.15.1787
889,560,630 *5C82145B6CF5935BB79B0F5F45E1850638865DF8 you'vegoteyesbiggerthanyourcolostomybag,you
889,560,631 *5C84687B3D8E51F5862214BB0BBB80A10FDCD156 YOVONNDA
889,560,632 *5C8BBD2865965D1F2CF17B823EAE88BBA9EE43F3 yv.q
889,560,633 *5C839ED864C13913905598BA46BDD912884235E2 )0(~`<#####P
889,560,634 *5C837774ABBE2BA1DF85C513D43595F667BC0BEC 10APR1277
889,560,635 *5C89BA8432956A53D90999A409E6D217691D6BAC 12-sallima
889,560,636 *5C883EAEABCC1FF7BD4A010FA265F78ACE57FD09 ZEYNEL-DINLER
889,560,637 *5C852CB15D3E8E72990BBAEE0868062881B7786F 1350898 "ITPROBABLYMEANSAONCEINALIFETIMESHOTATIT.
889,560,638 *5C8BDFA32F5E013DCA762883F4AB893564ED2608 1380846 mikko-lehto-8183-.
889,560,639 *5C88D9221A8F899A21BFB0CA66BB7044E403777D [email protected]
889,560,640 *5C878C5868843E51434BA67BBE3FC63738219364 1526462 toivomme.sinulle.miellytt
889,560,641 *5C8F6EC8BB08338FE70A97ED571E54D50F3D728D [email protected]
889,560,642 *5C80D853F1D745C8E293029EC081A20372D45A3A 157STAATSANGESTELLTEN
889,560,643 *5C869A271A6EAC50C2B5C13B891B60F8F8B91E22 1595723 TOISAALTA SUOMEN ON MY
889,560,644 *5C8722AE9C488901F4BB9CB6F948416769C740F3 1757661 opin-.ja.taidonn
889,560,645 *5C883EBE015E4BBE542BEA583CEABDBED1CFBE0F 175890 harjoitukset.voidaan.my
889,560,646 *5C8ED64C64BE61673884C39AAAE5B06766E92ADD 18-01-1455
889,560,647 *5C82C61B96A8197C3B476CCCCC2CC5C4C9CEF2E4 1992(DJSlipremix)
889,560,648 *5C8F58DE7BFDA515754F7CD2A5989AF4E3941E27 1barrierriff
889,560,649 *5C8D9AC83F3526FE0E2B94CD55425CC382C15641 1bewerberstrukturen
889,560,650 *5C80415C012D4BAD599BF67F647578D8BD3CC8BD 1bluetooth-pc-card
889,560,651 *5C8DB775A46340C1E84506EBBE7CF413FB848BCA 1-BRUKAR
889,560,652 *5C88B26149BBC460C745694C42B4D6068F79804F ZXCVBCRW
889,560,653 *5C85BCC9D2F538EBC5966EF4BFA1AA2ADA9DCE95 1.COUCEIRO
889,560,654 *5C89DCB3068FC5E8038154074D5F9D57BBC96238 1EVERBARE
889,560,655 *5C84143D9B4C2EDFAB55B471B1F82BAAD811D1FC 1.FUSSBALLSCHIEDSRICHTERVEREINIGUNG
889,560,656 *5C8DD6A1B0C9F615CB37AB7F18A17A688A8FC623 1 geldinstituteengagiertensichbeimaufbauderostwirtschaft
889,560,657 *5C831E747268565A8A72693C5031C7FF77270AFB ДЕВЯТИИГОЛЬЧАТЫЙ
889,560,658 *5C8DF3BFA2BACCBDF666234EC94C7B5DA3BD763F ИЗЧАКВАНЕ
889,560,659 *5C86F6B319A735C83BA5C1602F1EBE9A323D8E6D 1JOSEPHITE
889,560,660 *5C8A27DF598ABC31C845FC1862F8A1C3F5829687 ЛОГОТИННЫЙ
889,560,661 *5C811CA5C7D956D4A295761DA7B5EA4927B3D5F0 машинăн
889,560,662 *5C8025D0BFA5D441AE802774B99B7B8BABFFE71E НЕДОСТАЛЬ
889,560,663 *5C83D148FE58652F6EBCED68453202B386ACC7C3 1-maataloushallintoon
889,560,664 *5C8CD95DC677B72D651E4A8D9B9C69991C7EE877 ПОКАЧИВАЛИСЬ
889,560,665 *5C83E1811A528078F92EB369AB8D5FC037C4F1EB РЕКЛАМНІ
889,560,666 *5C8A5A1682327FB31B8E1E8DE43E9E7D4DDE19F7 1-nerollisen
889,560,667 *5C8E007DD58C355E09EA3C9399426A8F5E690E22 ТАЗЕРБО
889,560,668 *5C844AF49EC09532BA1DD6650F01E917161A5FB6 ЯЗГЫ
889,560,669 *5C8C76558DEB395C60891AE5A14AF6CC8E6D3FDD 1-vorbeistreichende
889,560,670 *5C8C1CDE86DAF1BFF797C282A177226559F2EC52 2008(佐藤水産パンフレットP81)
889,560,671 *5C869C03B89B897DB789B54F97F4B8B2666E7E8F 2155672 TORVISEN-MUKAAN-RANUAN-EL
889,560,672 *5C8BCD28C076CC9EBAA7093A4433875AD7886988 2162491 kirjolohen-ominaispiirteit
889,560,673 *5C894B58E605DB7824428C6EF4ECC7BFBA52292C 22dec1713
889,560,674 *5C8F3B7C37CA17AA1713B6F43088E2D961E984CB 2478691 niinainakinluulin.
889,560,675 *5C826CDFD45DF51EED76702DF3E9C165A4D8E71E 2486010 opponointimaileissa.saattaa.my
889,560,676 *5C81990B48346B8385EAC8E85FC7C3A7E510214F 250JAYVION
889,560,677 *5C8098FFE56FC3B876BCE5541C5DAD421BDE7CF6 2795695 ICH-BIN-JETZT-FUER-MICH-.
889,560,678 *5C823C79A5B176C449318100AE16C3DF752BDB72 2801017 eivaintyhm
889,560,679 *5C8858BACAF3E1004C273329F2DB6E906D2DCBBC ザ・グレート青春号VOL
889,560,680 *5C85EE86DF3544D87469C87E7E766988745A23E5 2asarah66
889,560,681 *5C86CBFF9BBA39AB21AB3AF36E8542BA1DD8D9C6 2-BRAIN-DAMAGING
889,560,682 *5C8586B8A99448BBAFBDFA43D1DB62CE5EBF711B 2.GOETTERWELTEN
889,560,683 *5C8C049A6D46E9BD5B14B4476AC750F969854179 2IKAMPOLS
889,560,684 *5C868126146DAA4DDC483ED5192AB3EF218DE48D 2omasreither
889,560,685 *5C89EEE903F71612A26FB7D444EBA8A95F1DC6DE 3=====>~0~osplat
889,560,686 *5C899D59520B25E24B403F8871CDCE1BC12C01CF 3EPILYKSE
889,560,687 *5C8797E4161CF7891C7E9E1BD4BD815C8DA1807C 3FREMONN
889,560,688 *5C83D2B77AE62DB4E97688FE4C52718AB283C2F4 3iamnapoleon3
889,560,689 *5C845A0589C2EBC5FB4D0D7B69D69D7A2F59EDF0 3==p*.*(o_)
889,560,690 *5C868706ED31CCB6DCB21E0DFEE4F96B93FC955A 3-tarnwort
889,560,691 *5C8B41BDC17E455A00D9F2655E41DDE03304F28B 3====>*UU
889,560,692 *5C8F88B89F615E6A451B87353C212EE41263FEF1 10YVGL4UK6W03TBT
889,560,693 *5C8ED073ADC834ECC0E8E410C7D4A89E9E700E4E 1144969 METIED
889,560,694 *5C8C18C32606771E533BA244541FADE8E9278483 11.informaatioohjauksen
889,560,695 *5C895F3749559335B11983D6823A5AADD2BD2E8C 11.LINSENIN
889,560,696 *5C8CE34BD991E03EA18E1A3319EF4BA1D8074339 12JUNE1038
889,560,697 *5C84015F4EB53751DA81C2DC639493847DECD7D2 1579105 JOSK
889,560,698 *5C8BDF1B5C48AD7A8CC5682C243C6768247EA2F9 1798543 NAISTEN.N18.JA.M16.LUOKKIEN.YHDIST
889,560,699 *5C82D21F6F743ED7B04E9F396F5E98BE1FC2D129 1873–UDINE
889,560,700 *5C8798A246DC6C443F406B43F6EF568058FE2DB8 1990年 1STアルバム『WAITIN
889,560,701 *5C89728D26C3E9139B83FAA97EF1F55C1FB3E830 1binladenin
889,560,702 *5C8EAC995642704948C69B82492E79D920CF1324 1chromgeraet
889,560,703 *5C831B30230B678F8D444B0630510276E2B0347D 1CRUCYFYX
889,560,704 *5C843443B4F6CEAF26372945531A4627528450B1 1fenstereinsteiger
889,560,705 *5C852EB5BEB05B32682DF34B6473784679F3C563 1-gau-bischofsheim
889,560,706 *5C819DA1B06DB3C45CDC4C5323CFFDD0E55E4C45 1INOILED
889,560,707 *5C883F70D3BE99060BB9FB4A1E6A30782033EF3F 1.SAMAISTAAKO
889,560,708 *5C812DB7EB8371D4F39F8A827A4131347366FC16 1.schattenkoenig
889,560,709 *5C89CC00ED61FC145C2F9C5B3B310F4F12582468 1schornberg
889,560,710 *5C8CDF3D1F58437972E645A8751AAAB1D6CE5573 1 TAKENAKA
889,560,711 *5C84B369E1972C42F127090230F837A490D5DB08 1truelighterikoisvalolla
889,560,712 *5C85D5DDD8A408EC796D1A979C85F8DBBBF8B115 1-tupasvillatuotteista
889,560,713 *5C8EA66886391FB246637E53CEECE49EC994F1AA 1 xqvastaavamme
889,560,714 *5C8F5FDDF6B6D8EBBDE72E76E87F4E5D3D825E93 2127127 THE-ROOM-USUALLY-REMAINS-LOCKED-,-"-SHE-SAID-
889,560,715 *5C842A3F368600892AC8F4862718AC93E77A0F31 23DECEMBER1241
889,560,716 *5C8E32B4B263651ED5AD96860B6F3F540CB14917 24 TAYLORS
889,560,717 *5C8E7FD0C876163C28150BB74B2EF5C281566CD4 252QSE
889,560,718 *5C8A301758D493B93F49F0672362C7FCCB8D2F79 2638711 hinzu kommt das umstrittene holocaust-mahnmal
889,560,719 *5C8B72E85E692C1EFCE3C523332F06013761CE62 2648339 alle.vier.studios.seien.derzeit.voll.ausgelastet..
889,560,720 *5C8CD13F89BE42E7C13D823C1918A41E3D58936B 2731255 USKON , ETT
889,560,721 *5C88AD97F5F27129F237DFEF6767E73DE6472B08 282044 "-apparently-it-was-all-planned-.
889,560,722 *5C8CF168115D6712D9DAEF02884A63EC442BE9BB 2881441 tunteiden sanelema kuva muodostaa ensimm
889,560,723 *5C8EA8A52601EA71D5205DAEE735F0F24041DD0C 290196 DASS.ICH.AN.SIE.DENKE..
889,560,724 *5C838AAD0E24D6D5F50C8A14DF22E385C14DF487 2 BIOTEKNOLOGIAYRITYKSEN
889,560,725 *5C86441B3F08803A6762646EDE38229E8170997D 2DDARTIST
889,560,726 *5C825E18AC9E8171AE2F4376C6ADA05063213604 2EADIGEHP
889,560,727 *5C860E99687B00E6B8ECEE9FD35C658CC467696B 2IGERMORA
889,560,728 *5C8A6EEB67410F040E80875C68A3C6B6347FAC42 2.kennell
889,560,729 *5C81DBFE671A226E843E847A75FBAD0C9CDE8B1C 2.sarilarak
889,560,730 *5C8CF69EC9B42563EE8E83A3B54B71D23A76AB4D 2SKOUTIS
889,560,731 *5C8E27D42D23BB2228AF219B3037937E72139C8B 2THATJASPER2
889,560,732 *5C86F7B69923BA51B556FAEC60DEBC43E694D370 30july1282
889,560,733 *5C8AA895A2A171E9BE3BB2047A93BB5C5D19965E 3===D.*.*(O_)
889,560,734 *5C869B1556FB1EA00012BE637949BBB477247B25 3 EX-BFF-DIREKTOR
889,560,735 *5C8C0A7700E98282293356C3853694A1697C58AE 3 FUMMELARBEIT
889,560,736 *5C8959345F29A674B3FE38E1641F065E42AEA6D3 3.ihodessa
889,560,737 *5C887311C6D7CCC0B0F71991A3C94CB93C7BBDCF 3JXWQDAHE
889,560,738 *5C84F83317CC7EBC4F2028608564C86B20B529F0 3kliniGi'ni
889,560,739 *5C8EF11E5BDB1883CD7A759345B30F7D8B05262E 3PHOTOPLAYS
889,560,740 *5C88A622BE38008F24D375BF367D3BD0E6ABF2C4 406614 ALOE VERA -GEELIST
889,560,741 *5C8A28B9929A66BB53AC78BEA2C0BFE6D5512B34 48282 yhdistysjulkaiseemy
889,560,742 *5C896D71F3A47FF60966D756AC9A56C71A60D3D1 484brisa
889,560,743 *5C81EEE23DFD566ADC2F93AA8C5AA459E2186008 4CULMING
889,560,744 *5C8CC631ED0665FADFAF7E26B9F1746901387D93 4N0D!Z3$
889,560,745 *5C83C854F1982C8854886C13C0939300AE88067C 4PLAINPI
889,560,746 *5C8D024FF660C41CB976DC8334A06A04015EB7EA 4UMWELTDEBATTE
889,560,747 *5C8B49BD2222097F9C5210EE7B05368CFEC10546 528253 yuva girisi camurla orulur .
889,560,748 *5C8795209BE4907A773F44D4534EFECF267574F1 54 T
889,560,749 *5C8D22F90261A38733BEBBD0CACFE2CE5E8C1C0F 5EHCAFIER
889,560,750 *5C854CA1A2FDC2BF4CF6D61A8C5EEDD9772264C7 5ERMORDENDEN
889,560,751 *5C8FCF4DB4FAFD6AF16CF5659D01A21C0B3096D3 5HGOBIOFF
889,560,752 *5C8492F1C8F9F90131BBA26826F15AF5F5C516BE 5ilovedonna6
889,560,753 *5C81DA37FC21FF8D7A95245CB41801403F9A3AE5 5KNOTENSES
889,560,754 *5C82EB6E6C7B0592A66AFD30E71C6C2C27280380 5LEABZTAS
889,560,755 *5C8CB05ED63A8F12AFE931E912566FC2E1DEC6FA 5MIMIBLACKIE
889,560,756 *5C835782BF278747194E3C4279BF115CE33C5B76 5OFFICIALVOICE
889,560,757 *5C80CF233B1A0E40F195DE7F82E72ADB1D5EBFAA 5REDARSTVENU
889,560,758 *5C829322DDC9D585C73328281C9FC63B33C5BDEA 5silveriest
889,560,759 *5C8178B1ECE6857FCEC4CBF7B4B11B98F6B0F747 6-CIRCUMCISED
889,560,760 *5C8C923C23039D079199668AC1000712C754B0B3 6FIDITIS
889,560,761 *5C89EF3CF8FDF4A73B3D2A02C459CE78683774EF 6HEAPSIZE
889,560,762 *5C8BF6DE69E0EF4579D8F8DDD21605635D4671E1 6HUMANITARNEJSIMU
889,560,763 *5C80777E996362AC0C70C1F0F23669BE2F9744B2 6LLPIRIIP
889,560,764 *5C8B6E5A7C16E5339AEFD15036EEEA9895BB5BE6 6OFFLINCHHANG
889,560,765 *5C8F36E69FA085119B3565F9D93733CEBDA7061A 6SAAMAACHINOD
889,560,766 *5C8127C1A2B6AE9498CBC593474DD5C0E398C5BB 7DESCONTENANCE
889,560,767 *5C88A8B10A796D3449D4EC0D7217BACE9D11283E 7DVRGVKSTERS
889,560,768 *5C8BCB4B64ECBAC5ECA369C68C8F480054D58C56 7iluvchandler6
889,560,769 *5C89985B6C78D7AF4F42A29A044CC086A7065C86 7THESNAKES7
889,560,770 *5C87C7D4AACB7CDFBA67E3FAEDF313856904D8A0 >-<.`.<##8
889,560,771 *5C85E393B3D7673D3F2EFBCB9B94B948105474B2 870911 TERVEELLISEN SY
889,560,772 *5C803691E2CD7B1B4E00209ACC94A94154FE636A 8DISPORUS
889,560,773 *5C8610E107233828CDD34AB5390801DC993A0E48 8EXACTSEXACTS
889,560,774 *5C8CD575418745B88EF4D3C3D373D8F7528D630C 8FIVELEGGED
889,560,775 *5C8C09AD7C3DEA531B3D80D4C66016D377201585 8MICHELLFIREMAN
889,560,776 *5C862AC5749FC1D00A3D554CB054D7A9D03C1F67 8#####p*.}X{
889,560,777 *5C80E00ED18A552601D6F35AE540B97866B22720 8SALONMUSIKTH
889,560,778 *5C87988E726105F946CA881C34809056ECACA19C 900PAUL
889,560,779 *5C84C6D6BF15F75E8DFBFF6E16DFE6F9296D06A8 9APPENDISITT
889,560,780 *5C86B9D87F1639E373ECD19B0DC2DDB3793F677B 9DAMPNET
889,560,781 *5C84890E22B01ABA7001EE952D08862E862FACE2 9jungian
889,560,782 *5C8BB5C7EFD4D9501676E99B40E4428C910C1769 9SIRRAGER
889,560,783 *5C80F6AAFB3BAF4B8C5E22A542B0F9A98266E04D 9STODDERNE
889,560,784 *5C810736EFA83DC5F26C58FC71776451863228C4 9STRNINGSNIVER
889,560,785 *5C838A7D57EF2B2B4778AF81A2796CE5B288076F 9SULLIGEN
889,560,786 *5C83A2EC2791CD8AFAE148640012BB91909138BF 9VOMERIS
889,560,787 *5C836B889A1E654F26FDABFD07ABBE10E607431C 9YANKEESSUNSHINE
889,560,788 *5C8C3FFA92A0CC440A5B7B0C04573C03DD00F6F8 a13"y
889,560,789 *5C8F0F66A4BA93FFA65246ABFD8FE8BEDE2277B4 a1!gner$
889,560,790 *5C89D39F2B6F8BC5E83950FCCDC5BBF2C9036217 a8s73m!0usn3ss
889,560,791 *5C81C47394D331646E26927428AA66375A10F6C6 A9VTY
889,560,792 *5C85DB5F819A60D191C79A16251898662518EF9D ABKU"HLEN/DIXY
889,560,793 *5C863990587F636B8BC0A673B2122B0AB47EC2FE ACADEMEADVANTAGECOMWWW
889,560,794 *5C822E7014A8D2702A49E4F9AC46D77D742645B1 ACHATEIS
889,560,795 *5C807D685FF0076FDDBF0389BE3609AD2EE423CA adw6
889,560,796 *5C8C5D0B46DC141FDEE1DAEF963F0EEF7594D2F9 AERZK
889,560,797 *5C8E88F0A05C7AD8D08783DBE935EFC9849D7183 AGUARAQUIÁ
889,560,798 *5C86B94F1911EEA52BCA145E05993DCCA9A7EC67 AHT6R
889,560,799 *5C83F9F00A85108E4ABD947F4E0FF1EABA22B743 AIIDO
889,560,800 *5C8D1A62E7DE0CFCFA3C31480F413D6BCD095447 AITITROS4
889,560,801 *5C8B5B954BAA5A450F97FD68FBB20692D857BF56 AJAJ6
889,560,802 *5C887C482170F369AB8C35D1D23F231478908471 ALBERTDOANE
889,560,803 *5C898CA6FFA15B5EB0D1A3F7F454D44F6772D597 alexanderwellbrock
889,560,804 *5C89ADEC6685C0AD8F5A280C90A36CD134CF8D3E ALI.BOROUGHS
889,560,805 *5C81CBE9D1B76EB93816998321F6BA3C426D054D ALIENSING
889,560,806 *5C88CB81E15A11B89176B3C5E338277BF7698A61 ALLEN ARBOGAST
889,560,807 *5C8A47F54B80329ABBE490CC5477B996424D73B2 A LOVER IS FOREVER
889,560,808 *5C8996CA59ED9E5E79A4223190E80C1945769724 ALSYTISE9
889,560,809 *5C8A68CA3C85FE7A61048AC330D7DF2821E9B700 ALT0C
889,560,810 *5C821943C9134EA5CF96398621BDF9ECB582591F AMBROSK
889,560,811 *5C8E72D38C002858907A82098DE3616574F62767 anc1a
889,560,812 *5C81BDD1D8AA57812B37FD30121ADF173AACB935 anicillo
889,560,813 *5C8B16BD79B6101A3D0D5C73C9CBC6148050B139 arglist?
889,560,814 *5C863A5E35321825C460C0D6AA7A1D7E72C72B9F arturoadamaitis
889,560,815 *5C8AC7C643C16734EFB77D46AF749B25CF4A2A91 ary8n
889,560,816 *5C889DC2FCD00400F814D5BA8244070A09A2476F As4(
889,560,817 *5C8AEB5EB51C98A5B6A2FC3CCB2C904897286731 atfv,
889,560,818 *5C887F18FC15EEA07FC439F29FCBD3A858631968 A&UA
889,560,819 *5C8EB9983FFEBBD7BCCB08D7553039C2D88E3CE7 AUUHK
889,560,820 *5C8EA9B23956D4AD82C52DF0685C15B5E61A1833 ay:,j
889,560,821 *5C80E639EBAAE8EF51CE90335E1FFB88D9DBBB66 B0IV)
889,560,822 *5C89084CAC7C725C9B98320FD651EE7F3EEF3E98 b2p,c
889,560,823 *5C82512848509764C87CCDB4EF6D8177A3E2C0C7 b6kdl
889,560,824 *5C83E3EA2AF8A3A74E551DFA24ADD89BB86BEB66 B8LK)
889,560,825 *5C8F51F4A1CD0A0EC565A06DB1627BF6433EAE75 BAM-RECORDS
889,560,826 *5C8E10EE7285213E1DCED8673630F4C34321772D BARRYDISPIRITO
889,560,827 *5C8B385686B928349F69092E80D664D7D660F544 BASIL.PENAZ
889,560,828 *5C8B382EB62E699BF3F7075D709740DCFC77402A BATCREEKTENNESSEE
889,560,829 *5C85C0F9790BE3567BFE12913273F6EB35AFA066 BBC INTRODUCTION
889,560,830 *5C8D39BC2646F23B7537F3A895A43ED074854ED0 bb/,j
889,560,831 *5C8481EEA49D7EF22B1BE0AFD82FE6DF72C2C2F7 bc+b
889,560,832 *5C820CC3855AF8CB75940EC7E0D824430A173CF0 BENEATH DUMAINE STREET
889,560,833 *5C8066A1AEF511FD8A7B693239FE8BE113414434 BENNY.GAINEY
889,560,834 *5C8756431C8AB548ADE2407202A6387AACD679D7 BENNY.KUTELLA
889,560,835 *5C8403D032D02822039C9AE216454AB16BBFE664 BESCHWEHRTE
889,560,836 *5C88DA112164918F1CCA6CCA80DC4A10BC5D61EC BESITZLAGEN
889,560,837 *5C8214606E02164EF3C79EB22035107DA4416C09 bfx?
889,560,838 *5C86BF66AADF727715BB25707639C6151CFE1C7D B;,I:
889,560,839 *5C88EC62F3046E1EC12D6036F600668F7FBEE7D5 BILLY.FAISCA
889,560,840 *5C809C49CC0DB0A511DC1EAEA85DCCD589513AC1 BINGCROSBYWITHLENNIEHAYTON&HISORCHESTRA
889,560,841 *5C889B88EEFF7E253351145CDB739388F5508B6A bk$mg
889,560,842 *5C86895A2D3BDFB52A88D97A33DA7236D82F9620 BLAIR.SMAR
889,560,843 *5C8CBD39AEBF7195D5C1548988243340198F0452 BLAQUIERETHOMAS
889,560,844 *5C8FCDD13C945EC9F2722A8490FA72EDEB986D45 blisteredcircuitry
889,560,845 *5C8CF4005A2B2ECA71E0EA5F5460764B7916CCD6 b)lv
889,560,846 *5C809CEFFE9820AD36B5263A96AE36B8283B48A6 bmkud
889,560,847 *5C86A4FDCCDE3872A666C13F1200728083805270 bo?g
889,560,848 *5C8FD656AE61B6E56FD662DDB638A6DCA6F96EE9 BQKD
889,560,849 *5C80E2E6ED53035BAC917186355887779E3636F0 BRANDIFAY
889,560,850 *5C80C3A00262B6B889795863B5ED1B8396587531 [email protected]
889,560,851 *5C84B5210EA7B72F3BFCA947D5AF33DC8E8B4343 BRRQ
889,560,852 *5C826A3AB6637300AE5B3D3191D9B45AE6641104 BS)7O
889,560,853 *5C8AC4E7E325F33F8A8B30B735062ACFFD7A05B1 BSWMEMACSBSW
889,560,854 *5C88B4AA66E03E060A6D516A372BD45AFCCF80C4 BSWTUCTROHS
889,560,855 *5C81505A620898E2DEA7D64192D87D43AD2610D4 B;T5
889,560,856 *5C8EA5E587CEBED145CA671D504FE5EB7B4940C5 BULLISHL7
889,560,857 *5C873797F96387047862059355593E33F910022A BURT.PROVENCE
889,560,858 *5C8ED549CC5326D6D7DB7B27BDC1634BD2F5A730 b"vov
889,560,859 *5C8E2F584CFF3D2D6DBFE73D28EAFD03B5012CFE bwt:q
889,560,860 *5C821D4BC41B78FE406AC84E3F7FD2AF8796CA2C c8iw)
889,560,861 *5C80708841F1D2F419B87DB0D73D35DBEBB00E45 CARCIAN4
889,560,862 *5C8483597C7DA39C2B3615A21C2D78D23C48A96C careerni3
889,560,863 *5C824BC89419A4384ABE260DD80B6FECF2036064 CAROLADKINS
889,560,864 *5C8C19F232590A294E451EF9F26D730284A04F64 CARTER.DEMAURI
889,560,865 *5C88A86FF098F98EA5195ECAE7FDD171C983B5EA CASES--THIS
889,560,866 *5C8B65B344898B0E4163500D137FF64252F6AFF1 CATHY QUIMBY
889,560,867 *5C8E5FA6F8781CEAD9E0EBA3B1C3D247D8B4BDED cbht8
889,560,868 *5C8E003776DC8B5077C84BC701A33AB16F504F68 CEREASIN
889,560,869 *5C87FA2EE40E27EA90BCDAD47092F97D8CEAC5E2 CETBO
889,560,870 *5C8A8C917D6B9D022D893CC036FF277D332B74D4 CFSA.
889,560,871 *5C811417F1BDA1E8FB70AB532AC06A7BD224253B chantelle.gibb
889,560,872 *5C81DA7325104A53FC342743F01A3B25EBA12961 chapter0209:barnardandstokes
889,560,873 *5C8C66A4F57F7899C38D9934508E45176319DAA4 CHAUNCEYZAKOWSKI
889,560,874 *5C895FB115BD74EB71033C9053821465FCCB59E1 [email protected]
889,560,875 *5C8F2CC3AF0EBB9EBFBAE976AFB003EFEA981198 CHERNITES
889,560,876 *5C8B73FBEC67A1D7C48773D81EA4B275761944D6 CHRISTOPERWELL
889,560,877 *5C8C24C21EA8C061418790C350BFCA500063F16B CHRISTOPHER.WISSINGER
889,560,878 *5C8B2B4ED57904057B1DAC2010F8B150F459ADD5 chv7t
889,560,879 *5C80ACBA38DCF83F1CCFC912DC94566DA26662A8 C=!j
889,560,880 *5C8626FAC02424490F455EE697A58B12794E38E2 ck11n
889,560,881 *5C83CFEB76CC390263C77FC7809FB99C2FCF04C3 CLETUSBECKFORD
889,560,882 *5C859DE961C530FA4B6402C90A11D6D621E26DBD clowm
889,560,883 *5C8B4CE36914C7966FEF5EFD5572C1E21578E5BB COLLEENHADDOCK
889,560,884 *5C800DBCA60E22E1E71C59728AF827E52A003362 COLTON.PINES
889,560,885 *5C82D3849CE46E8E909491249B9E8EBB38A9C4D2 COMEUNAPIETRASCALCIATA(LIKEAROLLINGSTONE)
889,560,886 *5C8E3B4C9E230048E08971F6618D34687ECE86C0 Countrypolitan-Favorites
889,560,887 *5C85DBF3E2FAAC6897FC905EB5892D91316EC155 couponinterest
889,560,888 *5C8A19A3D313BF854974BB94F103B112E72D32ED C:\PROGRAM.FILES\7-ZIP\LANG\MS.TXT
889,560,889 *5C8BDD5F9FDCB185EF4009215956D334F11774E9 C:\PROGRAM-FILES\CODEBLOCKS\MINGW\INCLUDE\LIMITSH
889,560,890 *5C8B5361B99479DE28D68563F2209F34F05095B7 CPSCONS.PLANEJ.EDESENV.SISTEMASLTDA|BRAZIL
889,560,891 *5C8721995F67C5D9CE6056E7934C5848D44DF276 cqkpp
889,560,892 *5C88E6E332E7536599AF412030A86B80E74DE094 CRÈVECO
889,560,893 *5C85D1AC7150D14C4FD6FB2018482C4427D74047 cs66a
889,560,894 *5C815C0E1F9387C6A1361F30C69BBC0C7FF6416B C-/SH
889,560,895 *5C884D8A604CDEC2D606AD576C902D3C8A47E8DB cvbc4
889,560,896 *5C88BB04195DD2BFBD13FB1364C9938C7E22E718 cvtn7
889,560,897 *5C852EDF9C1A6B32F271C16BC3AD414F34FEF74B cwqpi
889,560,898 *5C878C2D26D2FB5B280C0487D2C1EEE1539CEA8B cyycf
889,560,899 *5C87AE33A639CA5C577A8DEED1396C74E94CB8C4 d0:gm
889,560,900 *5C85AA61BA53C3D6205ADCF2D5050FE7A18C442A DALLAS.ESSON
889,560,901 *5C8F1E816D451414DD019E39417F6F012AA80EAC danialhellinger
889,560,902 *5C822505F58BD7E3928EF6005FB59CC619581FCF danielacelaya
889,560,903 *5C84B7A4085442301967851CA8B10D1AA55A82A5 DANTE.WENDORF
889,560,904 *5C8E4F7A880BB7C77A74FE6239A14A136FF9B5CB DARIUS.HOLTEN
889,560,905 *5C89ED4A97FFB12CE364CD1F488F09897F1E2AE0 DARIUSWESOLICK
889,560,906 *5C8C1957709A48EE558BA998B3464FFE73B39477 DARRELGALVIN
889,560,907 *5C81AD45F67D2A9657548C9CA1B3E954FC256271 DARRELL.TULLIO
889,560,908 *5C86BC0200AB720DFC8092064AA062E0B25E4441 DARRENFISHER
889,560,909 *5C8008F57D040368999F3CAF4A0747D8AFF0AFDF davidwest
889,560,910 *5C8612C3E13D89E7DDD0F6AA76D28DF1B99F7739 DBTNL
889,560,911 *5C8DE49F7B88D2B81AFF2DAC36F67A2279E7C158 DEANNA.HOWE
889,560,912 *5C8400EF99F4E4BEC4B03DE2E478D98E5F6C8349 Dean.Thomas
889,560,913 *5C81F8924CA4E1EB92464DAABE989BB923C2491A DEGOOIJER4
889,560,914 *5C80460D2ADA3C6D7A262A3400B70201A3264C77 delbrozie
889,560,915 *5C8547A0E564125DAD3FC71C045359247948DDBF DEMARCUS.VINTINNER
889,560,916 *5C8EE410F4A07078D7E2391519641C4A6CB942E7 DEMOBALMACHUNGSMAßNAHMEN
889,560,917 *5C85896062270A8B779A96771B01C6D1C02F7BA1 depancres
889,560,918 *5C88AC42BA5EA05BFBC50B168F515969E33D6914 descusión
889,560,919 *5C8EE0E75BB387D4FFF839A0A87433C31DB647B0 DF-ZR
889,560,920 *5C8A3EE4BF5FD8514E22527EAA33B33FF407BFD0 [email protected]
889,560,921 *5C8E69C4A70B693BC321BB0B14F433A33CC50E28 diviningly1
889,560,922 *5C84BCF15C07AD18031B2CD2403D4259AFF602B9 dm96a
889,560,923 *5C89FA2BE0A292DA10FA3592D03101362D2B516F doorgebrand2
889,560,924 *5C84066736BD36EE05A3DD5009CD0B8FD6F31AE5 d;q/o
889,560,925 *5C88B580E68F825E8F7D55D9D43A701F1AF9C744 dr(qj
889,560,926 *5C84CDB3A1DC4852D00DCEA4950092C7E11EFA93 DSQ&
889,560,927 *5C8B89E7BB3C07B62B1BC49AC999CF9B1EE77F91 dumagree
889,560,928 *5C867C6206B4D2873ED143553CA649BA4274A515 DWN7M
889,560,929 *5C879C96F0BB50E543172259AB2AA85D8B65F633 E4JOKI
889,560,930 *5C8DCDF807239C3E5989EE23D350BA4FA2CD30FF [email protected]
889,560,931 *5C8CA2C3B5257771639EDAE7DBF4B632778952EF ec;ky
889,560,932 *5C8EF482D9F356AEED3FFA6DCA97500C2AACDE12 edgardowaughtel
889,560,933 *5C8C432FA4C02F5F0F0A4DE40633BD936C766F9F edgaropiola
889,560,934 *5C81FCF86B2F944642EA6576251907C49B7EEE8A edionpac9
889,560,935 *5C85B8035D474615B7DCD184517F44E29EB95220 ED.MOLNAU
889,560,936 *5C882D4D0CC9F7243ED934E8970B2A534AEDBA5D EDUTEIUQSID
889,560,937 *5C8873AA7EAE6ECBCA1625582732FB342FB72FE5 EHW&
889,560,938 *5C8BCB1D35DF361D9262136C626DD24F865A5E6F EINEMTALKBIANCA
889,560,939 *5C8EEB8DA33B10B98EECC0F8C86FE5CC41739787 EITTZIGEN
889,560,940 *5C80CB7DD610265431A30942773625BA7139950D ekocide3
889,560,941 *5C8873C3B9B82A983CBE7BF91CB1F7E58B1B0DD6 ELBERT.TALLY
889,560,942 *5C84EBA0614AA2EC380F033002982A41249801D4 elfz3
889,560,943 *5C806CB7E9A90F944F73A9AC65658F78909416D3 ELTONCLERK
889,560,944 *5C8CA04313048BA95D48F23069DC6A34817BFADD EMMETT.LABATT
889,560,945 *5C8ED2A639848B8327FDF7E32FB95C488D56DD2F EMOTIONS, CAN YOU TRUST THEM?
889,560,946 *5C8ADA89EEAABF35F56D10D954DBB891DE5D3C0C ENUSERPOST-MODERN_TR
889,560,947 *5C806DE7FE36CC3CE51632BEA6A70FC5DEECAC19 EOCH1
889,560,948 *5C8A393B45425FD5836CD28A6E96BE3BD8663E7B erynwalton
889,560,949 *5C8CDD4646B9C8FEA1CF7D166FACD3847E98E2CC EUCY6
889,560,950 *5C88708FF00AF1EA8B5BD104CEB38CF5088087E3 EVANMUGGE
889,560,951 *5C8891B4CAF09CFA8C300DC547BBDC200CF44A24 EYESATTENTIVEAUX
889,560,952 *5C8333F43C04862E46D38F4B5A047D312BCE9AC8 E*.Z
889,560,953 *5C8E2E90E90C9AFEDE289509513242A409BEF10D F41TURR1Z4LD1N4M0
889,560,954 *5C8526FCE6154E2ACFB9532FD074C89C449EC8B3 FAALANGSTED
889,560,955 *5C8D01F75308C2BAF63D0011BB14C6308B46C510 faltas leves
889,560,956 *5C8E7D038C2EBA55A2041C148CECBF7D955594BE FE;,
889,560,957 *5C8845CA3605905C27D876AD54A2584C4A5A3B8A Fiaccherai
889,560,958 *5C8974CBD1C27ED6BBFDFD0494A97B5B0A329B56 flaxby
889,560,959 *5C8CCAD94B39234016181DF932692022F4AF21DA FLRT4TONS
889,560,960 *5C80319F1FFA50B1888CA7AB602951D952D3EED6 FOREST.KELLAWAY
889,560,961 *5C844C38326C0455C7E7EB931A2BF34B98FAFC7B forrestwhy
889,560,962 *5C8A96943F25D8F82C5F2DAF714FB03B2C3C7B63 FRANCESHALLIDAY
889,560,963 *5C8106D667975E647B4F4CF846B71F2986C8F793 GABRIELRHINEBOLT
889,560,964 *5C835276936B29058E2FFC3D3821BD9D4D9CD45F GABRIELWIGNALL
889,560,965 *5C8A7BBDA75836C28AA546933EEBCF68E4C16BBE game-over-(feat-lil'-flip-&-snoop-dogg)
889,560,966 *5C859D4A6FA9ABDB94330D2D84264AD955C9E435 [email protected]
889,560,967 *5C88F8CE7E02B4E5BBA7AEEC646C763C788BC280 garretboulter
889,560,968 *5C86145AC5F9541ACA76813EA522632354E25FBE GARRYFRISK
889,560,969 *5C8EA9152A3245ACA6232327AD566EBAEC942672 GAVINMCCLEMENTS
889,560,970 *5C8FA8C07F0AC52947D0C800C24101C9F8006B40 gavinshea
889,560,971 *5C814ED01F09BEFDE6082CFBC6ECF07755DECFD5 [email protected]
889,560,972 *5C88E29A8791DDB0550EC9AA6D40A9DBE5C74B8B gemiqueo2
889,560,973 *5C8E04CE84EC144DEBF2CF540D9178BFD9CDB9E4 [email protected]
889,560,974 *5C845C7266F2CEA07540BBCE0849156CA518A45B GESCHPROCH
889,560,975 *5C8F2FBEEB0D59B0E6AB6ABA77F207A4E69C2C84 GGOLDACKER
889,560,976 *5C898F983A22CDC9A29D2FD394729F8B54364A46 gina712
889,560,977 *5C8044DE67365E789CE190C08D7ECAFBDAC47ABF [email protected]
889,560,978 *5C81B0F3EAB3B8B1FA7B5EE9D0E06DBAFE202740 GREGORIO.CZERNO
889,560,979 *5C85ECC1FBE0C463A855ECDE98186F54B8B85150 *greybeard*
889,560,980 *5C89378AB2C3EE2CDA2A346D0C725214AF6393F8 grvmtrc8
889,560,981 *5C8BE3C97FA42DAFC665BDD4CE8C14550BC4A5D1 gunsien
889,560,982 *5C801351108B71B5A4C9E4E155C3412A717E4BC5 GVM?
889,560,983 *5C8CD40696362CFD3E4DDA03FB1BA26FC357BB46 HANDLOOMED3
889,560,984 *5C8F91363EF71DAD0451668C813D9E973B7873D7 [email protected]
889,560,985 *5C831DADB422EAB1156F88AFA6246F5F90423A6C HARBORIE9
889,560,986 *5C88CA65CDFF85C268A74E09F539AAC86C52F59A harlandpronovost
889,560,987 *5C8C9F8E60181EFC076DF0FF310862BA96FC4747 hassanwortham
889,560,988 *5C81F4D99DF6621474B851DA5B41EABE6BB7F437 HAVLICK1234
889,560,989 *5C81FDEF9F8A9B092D74C087965B6B2E7B4B249E henrymanning
889,560,990 *5C8CE4C770FD6CD01222C7C37EEAC0683B4F55AD HERMANSCHLICHT
889,560,991 *5C8423018D4B2B882A498B165D79F26FB23CD82A HET SCHRIJVERKE
889,560,992 *5C8D2569EC58C15F80950799C9979DBE86B44010 hi9h8alled
889,560,993 *5C84DD72C08C06571AC1C280EC113F1B98BED9FE HINRUNDENENDE
889,560,994 *5C862C39DC156412D06009A1A05A8651EE8C23AE HKAJALE
889,560,995 *5C816841EB880001DF5CA6C70481B6FCCA1FD868 HOBERTWILLSEY
889,560,996 *5C85D8992F3D71BFFE357BA73840DD21BFA83ADC HoleMan/CleanUpWoman
889,560,997 *5C8CA25F5E41FA705688028C88AF4CC62B2C9563 homodynamous?
889,560,998 *5C8E91A566EE94779078E976140382BDB7A681E0 hothouse.flowers
889,560,999 *5C8D495D87DD1B2435654E8D8AFA4D3C01115D8E httpwwwjoycehurley
889,561,000 *5C8E0A068BD6E3602A35D3CD2C8C99F0373BCB61 [email protected]
889,561,001 *5C841D49F468473E274278BBB9E97FA72095A093 HUBERTSKURSKY
889,561,002 *5C8876E8AB71C2FC3A849BC11C25B942FFDD4096 HUGO.LANDREVILLE
889,561,003 *5C8FBAD69FF4B57A51A072D8DCF1341B0F9E90C3 hunghunke
889,561,004 *5C8AA32FA7CFDCEBCEDD2ED2B43820B3EE9AEB84 HYALTSES6
889,561,005 *5C872B00251F1026E959C121870FB4B251CEF843 IAMTOBY01
889,561,006 *5C8E9A01363934371149B53C36016EBFA2918486 [email protected]
889,561,007 *5C82A9781D70BC457B2017037018F5F02142315D IERIRAUG7
889,561,008 *5C8231461AE141A6CF793271F9049BEB75A2C550 I'LLHAVETHEWALDORFSALAD(FEATBONOBO)
889,561,009 *5C80EEC0C383B06453E6398F227B7151CD2C8945 independizara
889,561,010 *5C8897D6AB3BFB40471E276948F8540C82DA8EF8 influxabbed
889,561,011 *5C81BE37BCBD60AD9139783D490FEAFDCFA65C8D in<i
889,561,012 *5C8C19860097684C8C3C9D939F4A8760F72FFD74 interpupillary?
889,561,013 *5C8621BC2E15E922219CA11DD8E1F15313DBF921 irtsassa4
889,561,014 *5C83FAEC9BE8A4A54E6AD92D30C3F15E31476D89 ISAACDOBRANSKY
889,561,015 *5C8FF9A84DD52568531BF59EC346084ABBA62645 [email protected]
889,561,016 *5C8ED6152CFB332516B6679ECD9FA0045E3FA531 ISREAL.SIGMOND
889,561,017 *5C8EC87BEE1E80133F8D86DE97542DDA1C7F6912 it's you that matter
889,561,018 *5C8888BC802E1FB914D273559C05158DBC7DC219 JBALDINO3
889,561,019 *5C81B188B36B9618A1CCC1558A525BF7F8306036 Jebr
889,561,020 *5C835BDA44A00C8D13B3796445D8BCCFE6AE37CA JENNY1LESTAT
889,561,021 *5C895F935CB8E0C8A46DCBE9869433CD4D9C2AD0 JF1022
889,561,022 *5C8B5F0EE53F9B5C3B91DD923427C791F28C0924 JF7WZR
889,561,023 *5C876566983327079325398AABBB910D6DAD1CC8 j"g"
889,561,024 *5C853AD39D714B9B508515CE2A8FD79BB1817D44 jiroskoplu
889,561,025 *5C8A1663B5F816AC7F67EF8CD8D3E3352E4AFB97 [email protected]
889,561,026 *5C8E9B9579FCD307C7874AB01A45547083067F8F jorge.rizzo
889,561,027 *5C81A028CCBD3454FEE5A68AF1DE656A1B79CB0B JOSH.HALCOMB
889,561,028 *5C871DC8DD286F5D922043B3759614B2F11C0E17 JOSHLEATON
889,561,029 *5C8416E0A4D1D6436A0878F5F8BF72D43D075A97 JP`{
889,561,030 *5C8CED4F6EE6ECEEC135F6FD96BA4C1E74C7A84D JUANHEATHMAN
889,561,031 *5C815733BA751F4A9E29E70B23E5243DC11C00CB juliomcfarling
889,561,032 *5C81AFA0B37225ADC58D25F64300EDA5495369D2 justjohnnet
889,561,033 *5C89161406E019DDAA2B875972FA9221CC3BF8FD JUVENTUS公式サイト
889,561,034 *5C885F0B918DAED7CBEA4AAD156A5A0CC204C473 KAMIE1
889,561,035 *5C8C64F58AF70FF869F7BEB41E80A17F2FEE0635 KARUNA NEPAL
889,561,036 *5C8667BE66359C771D49B8D1A98CEA700D6F72E3 kathleen-kase
889,561,037 *5C8AEA015889B49970321E2611F2BCC31DC62485 KATHRYN.SEARS
889,561,038 *5C8E19E3F2108336285A2B0CC59327EB96C07401 kellyreed
889,561,039 *5C84F92570587B055C1075B3E23F9606F042B862 KENNY.ENGWALL
889,561,040 *5C8697878B3ACD098793E5CE7586E9B8531F1CC8 KEPAXPVT0
889,561,041 *5C8C9B81C07D208071D54016A42A978540E4387A kevinkiester
889,561,042 *5C86CB2BF83DFCB499DD4AB24C304DC412F17F8E KGM;
889,561,043 *5C8CC3C646B4EF32F6096892725F8EE27A3D5ECC KKEYVANKHOSRO
889,561,044 *5C8EC25F1DC396E345110A5AEC0E9BBC1B609CB6 klewschenia
889,561,045 *5C830A0C9C0C9332DC4DCFC9E21850839F6588DF KRYPTON 'KR/I/PT/A/N
889,561,046 *5C8C8536694D609E27D786A895F11462807F6F34 ksr18
889,561,047 *5C8E17447C649560E4CCA0474707182445C096B5 l!5a
889,561,048 *5C8003E6010E1F5048100D95DE8D395909FBCBF7 LAPSETOETUS
889,561,049 *5C8AE0DAE8736320CFAC13F6378A494D923924F1 LATIFA BENCHEIAB
889,561,050 *5C8162263B0BCC22123689348F161FABFC194F43 LAYA.VINYAS
889,561,051 *5C862B50EBF6039D98CD20609EC9448805299575 [email protected]
889,561,052 *5C8BDCA594D542FF3FAEFD92027E1D88423B9AE4 LEIPÄPALASELLA
889,561,053 *5C84CA3B719E4CD0717300D97AB6892D4B8D87CB L’ELISIR
889,561,054 *5C898B41317809B68C43C941CB5E7A27F99073E0 LENARDNAGEL
889,561,055 *5C816A351F362B0893C8BBE3E15CB89E5A9CAFA2 LEON.MATAKONIS
889,561,056 *5C8434B3A12DAEB9BFEBBE8FA73CF73B9B2D9F80 lessquelettesserel
889,561,057 *5C8014A16F3C0ECDFBC7CBD2F03F86BD189935D8 LIIHRET
889,561,058 *5C8C8B33E54D0CE3DEE4335A27916A0C510AAE57 LIMELIGHT.AS.THEY.TRIED.A.TENTATIVE,.BUT.GROWINGLY
889,561,059 *5C89347FA8427677A109FFCDF43F09683B23E33D LINDALAUDADIO
889,561,060 *5C87FA130555D54679BCF7395D40ECCB90002104 LINDSAYGRESSETT
889,561,061 *5C8FD4325F4E0A15855A68FC7E8DBE1C86773513 lindseyblanzy
889,561,062 *5C8E860F8AD8C095886F7E4C8C340D521D35F63E LINGSSPI
889,561,063 *5C81FA79660DFB40711100B8CAB2E3ADD9FD125B linwoodbrimage
889,561,064 *5C8FFD034A94A4E068376866129A4DA4394AB298 LINWOODFEARY
889,561,065 *5C82E221F80B32241668923BC7D5142CCE398322 lisa-guest
889,561,066 *5C8982AAD07F4AE16CF44982E6C758B1A350727F [email protected]
889,561,067 *5C80654F683B358830C33ADA076860D73F0380F8 [email protected]
889,561,068 *5C8DD071D2BF14E3DB3035BE64B63DF7A3CCB954 LN[E
889,561,069 *5C841CAB90D2239E974EAE3189A8A25A3D650B01 Lolovo-horo
889,561,070 *5C890B394D592B4DA7EADBE9587FCFD1049FB7CE [email protected]
889,561,071 *5C8FCAFA985F46DB339185FF8949BEEFE3434FDD loputtua1
889,561,072 *5C8A2D04EB6BF6FDA2360F2DD6D4D6C43B2FF149 louiesoder
889,561,073 *5C8ACAA3B01448641D16DF85843B9D1B561458AA lovecorwin
889,561,074 *5C84ACE61D06A4DA46E567925C2C241659C082C1 løyselegheitsproduktet
889,561,075 *5C89D8D9107FFDEB6E4E35EE531B8A3CE6CCC56E lttrmtsing
889,561,076 *5C82F5E830ABF82BDCF102126570D11562E6E7B1 lude&fuguebwv892ensimajeurpr
889,561,077 *5C88CDAC9B485BC582B4B8B27C1F047A28C54FCB luiswesolick
889,561,078 *5C8752D6877BC90046462E1A20440C3149B2AF1C [email protected]
889,561,079 *5C81A2D9DBC7F30C43351B117E4BE429C8396CE9 lukehamrick
889,561,080 *5C8A51E7BF14990379ECAB985AD4B160C1AA316C [email protected]
889,561,081 *5C860A2071FC1A2816FE9A0F544527107AB30F9F M43DIN4MO
889,561,082 *5C8D2BCC05A93690769766B58D82A0E268BD134B M4J012I57IC
889,561,083 *5C851F37DF39A2B55BB9B1589A5C89D1E42CF157 [email protected]
889,561,084 *5C8350E2D7B910F1E2A098C2D869FC5B9AD582B7 marcelinogalizia
889,561,085 *5C8FA7D2F6BA09406F721A5145BA3881F31C45BA marilynclarkson
889,561,086 *5C876D8C69F07EA7E6756CB6CCF60281A27F6DC1 MARTZEN123
889,561,087 *5C8317640F2BDCE19ACA3C2B39557954D8B63F85 MARY.LINTNER
889,561,088 *5C8D1C552FD7F55A74B11748C737CC0C4FD62252 matt-fezler
889,561,089 *5C824F9725A7C61621BC3B2263F54EB899D50C31 matthewl5
889,561,090 *5C824151CD136C018C5CEA865416BFBB0E2361E9 MAXVONDERGR
889,561,091 *5C894A768AB45095B588EAE1263EB8EAFBA5AF5F MCDUNHAM
889,561,092 *5C8033347499C89D63B99F2C11406639D76C23E8 MEL.AHAL
889,561,093 *5C8C8F3DD9C935835B3EFEC9468B8A4487A729BA MELKØY3
889,561,094 *5C8BCFFC84CB30B8D2F689A3397D6207C78A4AB7 mervinmoye
889,561,095 *5C8192B66EF27A2EADAB938DE811925C95792DAD michalebohac
889,561,096 *5C8F90191687E087F976AB881254167E713C729B MICHEAL.VESSEY
889,561,097 *5C897FCC281A45CC96CC45EF12E2C2AE16E42BB8 mierser0
889,561,098 *5C8D8EB03E362675F675D249266E5985D356D4F2 mileskosalilosa
889,561,099 *5C86B3DAD0B168CD8FF74FE475B7D35DBC62E7E1 MIZU NO NAI UMI (ORIGINAL VERSION)
889,561,100 *5C8C904DBE19E506942598D19A5724C571E092F4 MOODS4U
889,561,101 *5C8BC33D5A065BD3FFCBD46C1979E5E84C1DC1A4 moonacura
889,561,102 *5C83EC2961D8DA3DF81311DAC442A941355E2180 Moses.Ojenya
889,561,103 *5C81B9892E0EAC5A2923285859BDC5350A0BD0FF MTSOPANIS
889,561,104 *5C8ECD6E2308FF383E5D9B56E4A23FB853017DB1 MURMELJAED
889,561,105 *5C85DB3B7A5100CBCB2781D2B0C3ACBF112D0622 nagorrus
889,561,106 *5C82E7CEB71075FAF1F15CEFEE03B8455639BFEC NAPOLEON.SPELMAN
889,561,107 *5C81302197F06B22386A8F0151EB5ED5CD9BF5F1 NAZEHAT3
889,561,108 *5C82CB63C7787A26E6B9376140BC728E62B28566 N DE SAINTE SEVERE-SUR-INDRE
889,561,109 *5C8FD101533E121B210F71D870A1F172A0C22FFA nedminion
889,561,110 *5C8C54A88682EE3DAA5C244B9F403126276AC50A NEEDTOWORK
889,561,111 *5C8DE414531EB9F9E8A1FB1F1170FB978E7B15F6 negalhos
889,561,112 *5C88925AF2BCF27CBB1453D2A88C83C98D77A4E6 neptej.se,.pro
889,561,113 *5C88B2B0CA2395EF3C4BEA7B4F0262E34E8C5108 NLQXRRD929R05
889,561,114 *5C87EF1158623C8450E32084881F6639DB0CAD40 nooviaking
889,561,115 *5C8EF73906FDD318A9B82927FD63AA1074BAF4E3 norisk-nofun
889,561,116 *5C82354F339185CFCBDD0BB525A527DE970B89BB NOSVG
889,561,117 *5C8F9C852D158A8570669C5B9C6EF9F0EDF31D54 [email protected]
889,561,118 *5C80B39012BA3091F3A75D2C604E54C8FAE49BF7 (o_).*.*.<====3
889,561,119 *5C864213ECEE18CC730E367DE6BCAE1FF8726474 OBCECAVA6
889,561,120 *5C817DF1169ACD091FCA80100B133848790001E1 okaying
889,561,121 *5C89E9AF4823A9C17807EEBB75A7B0E23E113A46 ORAKANGAS
889,561,122 *5C8393DED648685A465B1B4B5020CF06C7426C4D OTISMCCAUGHAN
889,561,123 *5C8DE9F6BBF45016F8B76A8DEE575147A3C252EB O.T..ZEHN
889,561,124 *5C88A77D5E6443300D915A9CB444AC765204CD45 OVERDUB-HEAVY
889,561,125 *5C8A4203AC61ADDCB95D1146D49878FEFE7C430C owcach
889,561,126 *5C8944D3B4D70956BB875A70A7225EA3F7722EDF P2EF
889,561,127 *5C85796BC8989B3A18FBB9542E1E16950DACFC00 palmerstaffieri
889,561,128 *5C8A0A843F4E77181DB8D8194A16202454764116 [email protected]
889,561,129 *5C8D727A3CB34679443E84484F5E8BADD0C73E1D paul-mcadams
889,561,130 *5C8D9EB51ABFC0850E11A9E17C72EDB3D2F61BBA PAVILIONTEA
889,561,131 *5C86BD17587518A57A81688DF84CC3E6B2BCFA97 PB `~ `~Splat!!
889,561,132 *5C871B3731E51B58722EFC2A1D57581DD919B1DA PERFECTEXAMPLE
889,561,133 *5C879995E456F0D6B118EAD93A4D400D36023BC4 PETERLUELF
889,561,134 *5C81036CBC16DF8698A55CC2E8B79082D7957E6D peterold
889,561,135 *5C899ACAB2218B5D369A83B26D03149CF6A9A932 planetable1
889,561,136 *5C83F0F99C86CEB16E3407D02861706A90903C33 PORC3LANS
889,561,137 *5C8AF3A5EBB6586C6094B0509A11F2E7B3A8229A pou7!3r
889,561,138 *5C8039C3A5B43CD93325DF5CA67E1FC7CA1849C6 PQWERTIED
889,561,139 *5C892FE5CF74302CA8EDB790EE8E15CF5C8900C3 [email protected]@[email protected]
889,561,140 *5C828A318B433DDFC462AA276DCAAE08E696D6CB PrimeSuite
889,561,141 *5C8B6379836C0A905C31E486F4DDC12546AEEE56 PSYCHEDELICOの楽曲
889,561,142 *5C856DA6CD306193E2459442452954A6457A37E4 [email protected]
889,561,143 *5C80443EB0707CB7562102AC0563F1CD48B6AC4B QTR02Q02NEWS
889,561,144 *5C857A5E3956797D883F5504B0C0BFB41F923AE3 QUEEVER1
889,561,145 *5C80FC11E5DC929057BA2C289C3923923642E1FA quintinfilipelli
889,561,146 *5C8FFBB9E094B4A8ABC93989C3244356C92C6EDE r9681
889,561,147 *5C8B91533D9F3950D8CFC20C334E1403A370F1AF randyweinrib
889,561,148 *5C81B16CBA5814513F06D0B1A644A2BAC563184F RAPHAEL)(*
889,561,149 *5C814F3DC6AAD38D83E6FB2713129D192707CB7B RAUTARUUKIT
889,561,150 *5C8E91A4B914B3179F77926F9A01178242498AE2 RAYFORD.STEINHAUSER
889,561,151 *5C8ECB7627CACF076E490B707D639F05B7308D1E RAYMONSUR
889,561,152 *5C82622F9E7884BEBCF87B4F63B5560E99B5524F RCPB
889,561,153 *5C89CAEBB995EB6019592A93176E91890E5E3351 rebecca.osterhout
889,561,154 *5C86D3BAF1B3B02264975D0724C43497820E65A4 [email protected]
889,561,155 *5C8FAEBA335F6378F77C51B65FC0D8A1F87B02FA refarte
889,561,156 *5C8C33650C250800A7B9D6992436138DAAAB6D4B reniar99
889,561,157 *5C83081359BBF4657688EDFBC8D2FB91DB961CE7 require-one,-two,-or-three-operands.
889,561,158 *5C87031A035341488153056FD39F792C86EEA2EF RFATTNINGARNAS
889,561,159 *5C8CA6DE4B4B06F064A9B085B6786A32C66FC931 RILEY.DUELL
889,561,160 *5C8EA6917EDFEAE39C9B572A937757C1A225D08D RILEY.MIESNER
889,561,161 *5C8796213CBC415408F3BF8A6ED6307D8FE45E2F はrmiオーバーiiopと読み、rmiインタフェースは
889,561,162 *5C89C3AC779AD1569F4C4CD7CA8C1EF87755D9AA rodgersolarzano
889,561,163 *5C8C970081C965A5DDF406E0053483DFAE593144 rondsprongen.
889,561,164 *5C8DEAD2F34882612B33BD1E19551A3002B724B9 ROZKRADANIAED
889,561,165 *5C8D5CBAD0198C4D2521B0C595713BD303AE0E1A RUBIN.ROWZEE
889,561,166 *5C8B180596CFF75161C0CC4E5DD76DEAC289378C RUKTHEID
889,561,167 *5C8CF469FC5A3263B885CEF08FDAF4F0777F9E2E runs-scored
889,561,168 *5C82FEFC7BA1CC669EC9325C312AE18AB2215AC9 RUSSELREARY
889,561,169 *5C81F87B4B8815C01FC8C48E88DFAE2EE84670A0 RUSSHED7
889,561,170 *5C84EF621223F70EDC384C739F7DE09D80A30954 s4ddle-se
889,561,171 *5C8E3142FE4A2912E74A594EDF7CF95311B4A918 S4N!T4R!1Y
889,561,172 *5C85D7495C086CF00BC49DAF2D40D363DB6EFACA SAHCLAC4
889,561,173 *5C8BB7DB561E001E54DDA400CECCCE596610A88D SALGSCHEFS7
889,561,174 *5C87CEEFA74503DA51A7F8C3768563243E5F6AC2 samareshhvapalaayinam
889,561,175 *5C84041CB48FD3A22B65B374C30F2265AE9635D1 SAMEVIBE(FEAT.ISRAELVIBRATION)
889,561,176 *5C807834A265EA3F715E507C7C6CD6088169C08B SANDY-HOWLETT
889,561,177 *5C8261F7DBABE7984556F7EA05227F638198C5E1 SANFORD.GRAINEY
889,561,178 *5C8803DCA3FDFCD77791098A73C487F38AFD2007 SATURARO1234
889,561,179 *5C84840E3C5FD8DA4C976C84CB26C24A4DB3F4E7 SCHOOLFLYERS7
889,561,180 *5C87D1B19A09397422DE9ACC8F22792679A2B4DE SECESSU0
889,561,181 *5C87BC7864FC1785BC512DAF19D818021F461EBE SECURITYCOLORADO9
889,561,182 *5C8CA786F81E5352F14D4CE34FE1CB7B89E10EA0 SEIBER5
889,561,183 *5C8895B2D08EA991125CD2E3CEBB6A33064320B4 [email protected]
889,561,184 *5C81EBBE5A6E9DB44E6E133AF00B3132D2116E20 SHARON.FINLAY
889,561,185 *5C82CA14D74ED068320C2F16D8C661456140A226 shayneschlotter
889,561,186 *5C88EEA648FCF76152280EE5CFA2A5BD57EC2597 [email protected]
889,561,187 *5C854A5AEC7ABC0F4D398E06BBB511334FCCF161 shocklees
889,561,188 *5C83BE86BC8DEF7AC7BFA5B3951E9D06C1BA0537 SIERRACANNON0
889,561,189 *5C8D85161E59EBF6C03E716D3D7B013DF215DD9D Sincere-for-You
889,561,190 *5C8A8352F0D89328D0DC0E970FDEB6BF38100BB0 [email protected]
889,561,191 *5C8FBE160ED8C2111895E88594226283F5002903 [email protected]
889,561,192 *5C8CE8CF9E9F80972FE0BBA9650E26972537FAB0 SKYLERBUCKNER
889,561,193 *5C86094EB6DC29EC79F840ED665BE304E5A85206 SNACKENDEN
889,561,194 *5C85604C8499AFA74EB0C20EF113E22B1A3AC7F8 SNEESIMAAKKAP
889,561,195 *5C80E673BC2B3362A7648A966FD2F44F62CC0875 SNURAZYAN
889,561,196 *5C89E1D1380194E9C6DC05BD1C7C8957C1AF5E5D something-on-your-mind
889,561,197 *5C85483EAD8FAC9C6B09B318C96BC9A9F3E58A7E songsoflovewaltzop.52:xi.nein,esistnichtauszukommen
889,561,198 *5C883EA2E542C77E555616180DE09B68E69A4CC3 SPLATO~0~.(##Q
889,561,199 *5C8AFD4CC35767437B7095DAF988FDD47261CA7C SPRINGZJE.
889,561,200 *5C8E79AAB61CA6F1580049A4AD89DDA1539D2C75 sprpylmn
889,561,201 *5C8029AFCBD50FD709FEFE358369CEEC4FCF2F0A stahlwol1
889,561,202 *5C8A9BD9D5C6FB5BE4CE71AB3E619D88D183F877 STENTORIANS1
889,561,203 *5C8D9565555756DF02A516B465440F2E5C2E4F9E stevepepito
889,561,204 *5C84627A69F2168EC41688A315A799B793B7916A STIFTERENS
889,561,205 *5C8F50777C8F5B39CBB55B4704775C2681287062 [email protected]@[email protected]!ON
889,561,206 *5C8526B37FE912F753448D1ACCC3B77961B97012 stuorraskoaruborri
889,561,207 *5C8C0AA3C31EF12847D8E44B477D5FB0C252CDA8 [email protected]
889,561,208 *5C8F4B7C86516CEFA475E5C6F54882DD884D7AD2 sunny1maggie
889,561,209 *5C8453BFB3B4D62EDB2C156C3075AA5857ADDE58 [email protected]
889,561,210 *5C86B9CBED2B482D8622FDD37FB5C7A14C7A62F7 swisstechnology-award
889,561,211 *5C87F83401286FB84B72BCD3F1289D9823B48ACE TBDGYHNROS8
889,561,212 *5C8EEDAB4BAA9D31EB26DBE40D7C93E0EDE7E971 TBHUTAL
889,561,213 *5C827178FBD50168DFA34B430F3F24A2499A722D Teardrops(12"version)
889,561,214 *5C898D3A50E15CB1C0539815B37876259F943587 TENDERFULLY.
889,561,215 *5C8A5EEB0EA2CA4AEC252958EF134A740F33C9A3 ter293091
889,561,216 *5C822265A87A0F2038A6AC45EB6B0D1B12AAC00B terranceminkler
889,561,217 *5C8EBFABDD7D1F64EBE605DA3A00B87DAD747FA4 TERRELLDUNLOW
889,561,218 *5C8BCF8C9FF82066645F46883C45DE0298C32298 TETTORBM1
889,561,219 *5C8D6A2B803FF44560DA64025F694C4FE7058F0B TGACAAAGATACTCTTCAAATGCCACTCCGGGGCCCAAGTGGCAGCAGGTGGTCAGGCCT
889,561,220 *5C84F4E31656EAF3EC5E5A031232515941365EB1 th9izxszbeso58
889,561,221 *5C821B8565D78E17A73E111B624EFC17249530A7 theath63
889,561,222 *5C8077D551729C3B048903869C161FE7F9E21C7C The-Years-That-Has-Past
889,561,223 *5C894BA4B97E54FF4F91E13D41EF7719BD46B69A THOMASNYAMBANE
889,561,224 *5C810AC265020E1A44F8C724B0273EAFFAC801B9 THOMISEES
889,561,225 *5C85E1F2B85BF4C1557035F347B84661FFF2C878 THUISTHUIS3
889,561,226 *5C8ABD1E17E9ECC5185B902DF115C90446B4C21F THYMUSKLIEREN
889,561,227 *5C8AEA30934C5576F0E1B6B07F2BC171F2DEBCC4 [email protected]
889,561,228 *5C81600B42F847467A76F07F2A7EBF8542E93C26 tibet'ssuzettes
889,561,229 *5C82F0B5DB7BBCEF8CF0C940FF9A6FEEF8E01BDE TMPHEADBSW1
889,561,230 *5C8E669E8D37AD473857F1F566A265A1B6837460 Tom.Sawyer2
889,561,231 *5C8910BC420D2988E91BFB10DB35614FE3B10E96 TONY.WILLIER
889,561,232 *5C8735EFB90A52C44A8726D8815320104AC1C3BD [email protected]
889,561,233 *5C85459829D670E7317F1708DF796092DC1ED409 TORONTÓTÓL
889,561,234 *5C8C7CFD0BB46451BA96F88B79FE4A02BDAFF918 toukkavaiheet
889,561,235 *5C8EBC56CF2186E765F9A5DB6D4FD96D16DCB3DA TRADEMARKED!
889,561,236 *5C83FA879E18052B9C366DEB682B732305377830 triplelake
889,561,237 *5C82B9B5C247EBDC8F013D484F2E886DE1C6C788 TROYGREIWE
889,561,238 *5C820EF33AA7C03BC19D71C81CBF14847B11DBEB TSETEDLE0
889,561,239 *5C843F2EC462EAC06FC67E2B95BEED91B35741B2 tw\y
889,561,240 *5C8DF49C114FD01E2781D1CF722BCF8AC90C574D [email protected]
889,561,241 *5C8FC17ABED54F5D5DCD29C10B047789679F238F U*BW
889,561,242 *5C89CA0B23D8BE11FE5D23DB78CE6303DE29DD57 ultrarepublican6
889,561,243 *5C8B192634E29C5AD335D47B7890AE1A01DBF675 UNAL1ENA7ED
889,561,244 *5C8CB8552F43E9777F4F3AC030699B9AF5C7BC84 UUMYREAD8
889,561,245 *5C85DFB3F5CFE66F53679E0C914AE91547859371 V13042209
889,561,246 *5C8298CD6B13271600F28FC6C13EF8CE81F29E37 )*vaaa
889,561,247 *5C8BB5A90E7F7A005A6E6233D7C42100FAC9848B VALERIE GROSS BERNSTEIN
889,561,248 *5C8CC7125F8C9CEA6DBDD6ADC25C3CC54CC447BF VANCE.CASIVANT
889,561,249 *5C854797D3520056DC5A475B2E5AF0AB3F6A5321 »VANCOUVERBE
889,561,250 *5C84610D2FD84272100A5F4D989CEE1CB3BD6A78 VAN DE WIELE
889,561,251 *5C83821929DEE582F9A27BBAD29ACD7299B2F4AA VANYA.DESANTIS
889,561,252 *5C8E2F00130C68807E3C91A5540928DDFFD65884 Varkenskoten
889,561,253 *5C84D66C57865A4D152C6DB151E4672451A40358 VEGA DEL GENIL
889,561,254 *5C8EE5CA56E57D34EC2F9170F8B711DA88268EAA VEKONTROLS
889,561,255 *5C8DE8B61D3DE5907D5CF333AB8C92793A6DF381 VERENICEZAN.NAGISA
889,561,256 *5C8C5965E4D3AC6E348ABB9749E3D2690F5A7D67 VERNONSCREEN
889,561,257 *5C8BC089672A290379443426D252B78D43599DCD vesolovskoje
889,561,258 *5C8D006DDD48BD83CA191517E96F8D04E667E4DC VFCYOUTH1234
889,561,259 *5C84DC9B320F11A346AA8F0F0113DF97CA292544 VICENTECHEESMAN
889,561,260 *5C8F3BE14963D56FAB7328B2EDAF8FD389F8701F VIESTIKOULUTUSKESKUKSESTA
889,561,261 *5C8C5AD63E1EA83F124235BF8C65E974096E7624 VINCE-AYLWORTH
889,561,262 *5C80103B55D974D54AC8F6D2506E759121ABCC6B vineet.oberoi
889,561,263 *5C85EF6958EA92A75E700E868E46FBEB46E342B7 VIVIENNE.FELIX
889,561,264 *5C8C97BB61B9B4868BCE71D136B02191174F5091 VIVO,.VIVO
889,561,265 *5C854F0E780C1B74BBF312F71EABC6125C2EF64F voditky9
889,561,266 *5C8032125618E03C7C7005D1BD924EBACAD48230 VTNEMIS
889,561,267 *5C8FDF730D3D00A90CA94BFEE73B6F8454B83250 VUURPIJLEN!
889,561,268 *5C80388E521DF2C41FFD6E62A3D2E80862B16242 WANG JOANNE
889,561,269 *5C8A1E5217CA9AB261270C693CDB4B13CD2349AD wardtowned
889,561,270 *5C80C86118A0744FED3A429EF64969CB2B26F99A washington-g-valmores
889,561,271 *5C8B7672C2B1510EDB0EAEF58E6498D15536B051 wayne.d.jennings
889,561,272 *5C83997AF481342BCD9DDDD7F89166D2BC1AA9B4 wayne-k-akao
889,561,273 *5C8AEE779C1496D8FE0D3BBC4FF5F53919ABCFC2 weiterkommendes
889,561,274 *5C8833621E09F0055448A22440FF690F7AABF95B [email protected]
889,561,275 *5C8BBBC9EABE69E24A7C3A0B461AA363E77A2C84 [email protected]
889,561,276 *5C875632AA582C51B1F1167A424A9937F3B64B32 whose.afraid.of.detroit?
889,561,277 *5C83AF2673D153E72462B1DC58928CC21B039895 wikirreto.marzorrrto
889,561,278 *5C8FC37EE777C51087DE70ABDA2AA018B2BA0D64 WILFREDSTEPHENS
889,561,279 *5C8EDA471F96A62F4AD909D5071283228324C8E9 WILLIAMDMURCHISON
889,561,280 *5C8194393C6BA3BD76299F472B9E90436EBE7FD3 william-kostric
889,561,281 *5C8886D3A72D39281F1B1305644F92B4822991B1 WILLIE.T.WOODS
889,561,282 *5C8810F5F2FAFE6859FF2A66B1F05881381F6659 willmatice
889,561,283 *5C84AED6700716BB1FF6E5E5E6D39AC06FFE55AE wilmer.j.nemchick
889,561,284 *5C85E25D97C06729169A4B75FB515685B045B40E WINFRED.MOONS
889,561,285 *5C877211DA95DFCF477A7E29ADDA751B4879C026 wiqui104
889,561,286 *5C842A7797F825E9C601E2AA13CDA18DAAF5A440 wohlerfahrenheit
889,561,287 *5C82D37E34CDFC88F3F8EBF8A8C4F1FC182EAAAA WOODCARVING
889,561,288 *5C8F63C1111FDCE2446A88C6251A153382472B5C WRODIAHARAHMAN
889,561,289 *5C88F194B3A7B50A9465D61A8D95B60E8CE5D829 wtamu29
889,561,290 *5C8438C1411010F28761136624880C52E3359361 xcptrnt8
889,561,291 *5C8D406B3E54238529C06C7347A5991C1A795BFE YELLOWSEAN8
889,561,292 *5C849789C9AB85BA5A5BA7F6A814965C470F9825 YEVONNE BECKER
889,561,293 *5C88C143123FA8E1A63E759C9BD83C5DE12C47FC YFIRROT1
889,561,294 *5C859B180B8ADE4420AC9698A10C47D8EFDB7F41 [email protected]
889,561,295 *5C8A9379BBDC65F55BC677CBA5EA66EBAB8F592F [email protected]
889,561,296 *5C870310A870200223BA6428012C481438C88451 yldetatiganu
889,561,297 *5C804A64EF58051E9A4A53338F98C33B8947D106 YOUJIA SHEN
889,561,298 *5C87F48A63BFAD9FDFEB772E261203570BC78CF2 YOVONNDA
889,561,299 *5C8CC067B7F4B86790421C7986413B2FBF93B0A5 [email protected]
889,561,300 *5C82D17FDF8D8C2AB5FFF2D7CB0C4F3C9F77F6F9 [email protected]
889,561,301 *5C8E891C507257740E2AC1F1AE525B9E54644018 [email protected]
889,561,302 *5C8E59564479F89E4AE6DABD1A526BF2C9C71B85 [email protected]
889,561,303 *5C83B1BF263863FFC9910518D33C6BBCF9191DBB ZACHARY.DYSINGER
889,561,304 *5C8B0E7CBE20EF4A71BB9E00509EA40D5E2D9E53 zacharyfont
889,561,305 *5C89B8F9C012D49781833A5FD9756E18CCBDC5ED ZACK POLIQUIN
889,561,306 *5C89F4AB7009616A0D77D69423A21D721CE59967 ZAHINDIRAA
889,561,307 *5C832CAF5B34C5471A6BA35756686138AE0BDAA4 ZALANIJ
889,561,308 *5C80C191F9B196CA4FFB3AAAAC421087EB19F10C ŽEBER
889,561,309 *5C81FFC05DB850D29D3F4F0921AC72C67070CB36 [email protected]
889,561,310 *5C8AE940334DF9286D0DC126AFBB281CAAD9DD4A ZENITHJACKIING
889,561,311 *5C87CC65BAA43FDF8176A1CD665D901842F98406 zhigansky
889,561,312 *5C81472D4E6821E34E5FF7EB75D9D51480707E7C [email protected]
889,561,313 *5C8D83D9418020D6AF695D0119571914B1662A50 [email protected]
889,561,314 *5C81701B69F48E6BDD4ED165628465A778CDB82C [email protected]
889,561,315 *5C843CB3EE416AFFDF6747EC855BE95FF8EFB953 ZIGGYDOOM
889,561,316 *5C8395D9C668BC1AD678E9CEFF289C72488D9C8E Z~<L
889,561,317 *5C8B3E2492BECA2A92E976FCC2245D3E2808F429 ZN.R
889,561,318 *5C8074BC1EAC9F1383E475FBC498082C36189E20 ZOROASTER, CONFUCIUS, BAB-ED-DIN[OBS3], MOHAMMED.
889,561,319 *5C88F86884F473AB32F484F5AF4D031413D2E1C1 [email protected]
889,561,320 *5C87DA8B00E5DD2137280AF134459577C893CD74 ZWECKMASSIGEREMED
889,561,321 *5C84810D6AF6093DFFDC8E3D009EF8AC22E7FCE8 εξετάζουμε
889,561,322 *5C8D0E3D818C90848C2EF1AD2EBBAA6F7F509267 кисерицки
889,561,323 *5C82E0EF1A7E37FC40E051A92CD27822BADF1A76 СИМКО
889,561,324 *5C89C56CA1B20231B49F85D6114A67829DD999C8 старыгавань
889,561,325 *5C8B21F91B3013B300EF09AF2E72B4C24D7AE934 тирвелла
889,561,326 *5C88BB36A5E04058E539DC36B17B8CD1B23247DE « ONEY »
889,561,327 *5C82DD47A41C0A464432C6BEAD46290CB8EA1906 中的第二首单曲《FULL
889,561,328 *5C8E70440EE3A134F8CB21ACFE77BAADFDA78D90 (亞視、ATV,前身為「
889,561,329 *5C8EEB718A7F25B743DF5606FCD3F94C6BAFF937 (削除)意見の変更理由は下のSPHLさんと同じです。
889,561,330 *5C8BAB6DEA0D37E40CD03C06AE072E13B8F909C5 カルガ州に生まれた。1953年モスクワ工学・物理研究所(MOSCOW
889,561,331 *5C84CA96302B76117E4BF492016AF44ADFAD185A 』(米国盤)をa
889,561,332 *5C811A0CA64EA9D02ACACFA3F9BC5064B1B224EC 4 AGILITYSSA
889,561,333 *5C832042B16F047C003C180BFBEF879EC70BDA57 4FONDIATE
889,561,334 *5C8BDB72D1958F61D2A1E35465ECAAB3DC4E7298 4FUND4RM05
889,561,335 *5C89852287BE185B783825F92D40150081D7E7BF 4IVWONGBSW
889,561,336 *5C8EDC75E540DCF0E594913E45980AC08A4BA56D 4KOLENZAK
889,561,337 *5C864B64D18515BF0019D74E9A50AF1AE9C1787B 4SPEEDFLEXBSW
889,561,338 *5C85455C01B5481972CA578DBE243F55B70C2A12 4UR3U
889,561,339 *5C8B5E366EAF6241E5CF11E57EA597CE2780686C 4WALTERSQUIRT
889,561,340 *5C859DC06CEED59A328601AC4FD74AFE9F0F2E78 508AUBREY
889,561,341 *5C8852AEC5B2330652D7DF4E17EB92720C357DEF 02221251
889,561,342 *5C8EFCE05B6B5D6F13D8F6DCE5B65CCC4C47AA4B 57GC6LE
889,561,343 *5C8C22A72BDD767284DB1DA1178883364D3BB8BF 589118 DABEIWIRDIHMSELBSTGANZHEISS.
889,561,344 *5C8A2A4CDA2903E20AEAFC01523C562938C6C3B8 5AKONAMAY
889,561,345 *5C80767529F0617D3A9F486A4A8C44FFD3C9C0BD 5BSWBANEZBSW
889,561,346 *5C8AD0B9CD2873567F58C99BD648BD5A2666C308 5BSWSHEEPSHANKSBS
889,561,347 *5C890BA97272F42E1F141C4A09979326E4126D46 09021081
889,561,348 *5C82A771D0AC18B5B2B6BEFF14855DD8C76C5DC1 5GONEPIRATE
889,561,349 *5C8D04A8C69FABBFC17BFC5192360F4520DBFC22 0iloveceline9
889,561,350 *5C82E6D97A2BEDBDACDD655B51D7B1D9DAF496C0 10025 h
889,561,351 *5C82EE2AB65EEECFB40B59F0750E8F1F1C1A4240 103919 konekirjoitettu teksti yhdelle ( 1 ) a4 sivulle
889,561,352 *5C8D2DF79DDAB113D85C22A31794E73D1F12CFA8 1054530 tarjouskoskeesek
889,561,353 *5C8A8C333A8D16FAC2AE7222C9E59FDC293E4127 [email protected]
889,561,354 *5C862CA53F513BBC4849B31E1454CF67011EFBCA 5SYNYPHRETHSEI
889,561,355 *5C868903FDF88903A9CA5E5F11E7531D5205FD9D 5TTANIES
889,561,356 *5C8AEEB867AA1348CE9C9DEC7EC5545E825E5F88 5VISHVAAMITRAM
889,561,357 *5C87DDD059CA65ED5D4B643C0A68789AD63C70F4 1454930 ASTIAT.K
889,561,358 *5C8904D6F0686E547D7A8A6240ACDE71C2A566EE 5XKAFVXZNPDHBC
889,561,359 *5C834289D49A6A42AAF7F47875E97422B4A25ACA 1599752 EU-HANKEOHJEISTUSTAK
889,561,360 *5C8704F18FBCF75AC9510E5597368AFE3139188A 6:6#&globalwarming
889,561,361 *5C815D96F9ED684231A31D54522411199270E0CB 170584 TULOSTAA.AVOINNA.OLEVAN.SIVUN..
889,561,362 *5C85E905E430A27239F93FE16AD643E81F9A03BC 1818sus
889,561,363 *5C8ABEEB1B6D972726FA8EDEE8937513435243AB 1 freestylevapaaotteluksi
889,561,364 *5C869BD2C47DFA89E12291C39FE9E6DAD8CEF29A 6SCITPEPSYD
889,561,365 *5C840182B174E44F3657A5FCEED89446D95DC266 6SEJIRVTSAL
889,561,366 *5C81760FEF6B4E8ED0C6623E2B66C85083FD514E 1.hockeyinteressierte
889,561,367 *5C849856DD31EC4AADC87AC0BA0C51F549991CDC 1.kanoniker-haeuser
889,561,368 *5C8C146971D92B0ABBEB5859E5D771B847FB7430 1-lainemaisesti
889,561,369 *5C893439CFAD563FF03B58A4D2F7372B158655F6 7BSWNAUMOSKI
889,561,370 *5C82607255E5C984229A2250B4AAEFC0D3CEB66D 7CHRISTNE
889,561,371 *5C804695B3C4D94CE4FAD20196369C11B649205F 1.militaervorschriften
889,561,372 *5C8636D2A9E3A0D1A09D70EFF135C82B4D84420A 1MUECKENZUECHTER
889,561,373 *5C809F75438A4C94C0748EE8B5241FF77DD43B67 7DINGOSBSW
889,561,374 *5C8FFF75D39B5F74BCA9E8F7B184D26462A92828 1nubaproblem
889,561,375 *5C8D9CFFC50868D44C305CD2F2FB067A111FA4BA [email protected]
889,561,376 *5C8B158DF011B02FF45A20A41C361ED5D22D19FB 1.olcs
889,561,377 *5C866913DE73B5308ACE8C907D91285A195163DB 1orgutlendirme
889,561,378 *5C85C9211548D57AF0E3C1D712D6B81A3C63F3FB 1paiseruttoon
889,561,379 *5C8F0EE32EF03259080B228D013B83002AD56A82 1-paraison
889,561,380 *5C824CB3D9EF801E2B2F20671415BC5AE54164CC 7GOLDENQUEEN
889,561,381 *5C8867BB7B6122A9268700A7589D973AEFCBC18C 1.pulaliikehdint
889,561,382 *5C86E163E1EAE8871A89A87F934C83EEFFD1EFE4 1PUNESSEN
889,561,383 *5C86695242CE7EC76A67FBF801B11706E6870C6B 7ITAZZOBB
889,561,384 *5C8AF0C7034A0CD7765962EC17AC8E4BFFDF9BFC 7KRAMERWINSTON
889,561,385 *5C82A54EE8F5BC89C308EE7BECA990766B57F5A2 1THEPHOENIX9
889,561,386 *5C8AB973C9F78A1AE8753A4DC9031A3F4DA0DEE6 1-TIRASAPOL
889,561,387 *5C846360CE25136DA5547AECECFD7195AA2FAC88 7PEEVEDS
889,561,388 *5C815F2C1716746B4BAD3F8CB563211FECC9AEDF 7RKNNBRR
889,561,389 *5C822E26BC822F6BA14B3A65FA5DBF3982D5AE23 1.videokonferansla
889,561,390 *5C828109703876136D683E067980A510EFBDD8EC 1.YRITYSHISTORIIKKEJA
889,561,391 *5C8CEBA3CB7213E1498F56103C3EC8E68C341285 1-zdf-streitgespraech
889,561,392 *5C80809098D687B70DB464F12CECD3749D6E0C8D 2006年からの新放映権契約で、NFLの放映権料収入は従来の50
889,561,393 *5C88BA46B608AAF2F37D5C53DEAF59171523A957 868576 gesundheit.:.sie.haben.gewaltige.energiereserven..
889,561,394 *5C875EB2D65557A1C274B33C1057D61801B938DA 896nico
889,561,395 *5C806668B057661EB3410DADFC0FFCD95D737861 240219 bunlar-sirasiyla-huma
889,561,396 *5C80DB66C44D8B879F28B462828C64895A33D08B 252428 BU.KREDILER.ASAGIDA.BELIRTILMISTIR..
889,561,397 *5C822CC4E2060E7B083D19540E2CE972FA84D676 25252525252525252525252EDLT
889,561,398 *5C87E61671C0EB8AEB1ED54A797E442DB3333CF4 8-INDUSTRIAL-SIZE
889,561,399 *5C89C6E1A3195BDF0876C291DBD70E04B2AFF68E 2952210 ajatuksenaon,ett
889,561,400 *5C820C2C1B1D41EAD20F183B336E4F4AF331C54F 8LOSBAREREN
889,561,401 *5C8A67C6E3A82A8B9C7B586513069E487583FFAD 2 DILTHEY'IN
889,561,402 *5C8AE2DF5E9F1425951FA0D1CF1661B3E31B9D4F 2EA72CA5-0AFA-3CE5-AD8C-3F7ACC9204C9
889,561,403 *5C843D8C074FB18FC25440993DAA646E9C417433 8OGEOCHEM57RY
889,561,404 *5C88E7924B44EC33DF7FDEA4503228B2B00A5FA6 8SIEGIBSW
889,561,405 *5C8784FE1F14CF436D4765B297A0E97F67DCE32F 2schulze-delitzsch
889,561,406 *5C8A5A83D378822D8A237AE0BB9C2CC5B14502D3 2.SCHWARZ-GELB-GRUENEN
889,561,407 *5C8E740B941635501D7E07B3319C8D4568658ED2 8ZELLAALLEZ
889,561,408 *5C8A3B287AED854F012513AC09CB6EAD83123DC6 3=====>~0~osplat
889,561,409 *5C81C906EFEFD1486CBBEE2A09249D691B02374F 933732 bir-Ornek-verelim-.
889,561,410 *5C80E0732D36A5ED7C23DF61C1FD199D7EF0D785 982223 nykyiset-isot-tilat-torniossa-siirtyv
889,561,411 *5C8C6ACCBFA4BBA435B77016025D6C83BBDC8A5F 99CB38271EA3DEFA80256AC600288EB1
889,561,412 *5C886E26077DFFF14659E62E2B32AD490D39502D 3ASHOWDOGGENETICS
889,561,413 *5C8F2EC7AB7F5F6FA816A2315E61E6BBC3A62611 9DELIVERBAILEY
889,561,414 *5C8F9A1984BD0E49D385EB1D94A355807AF2A1EC 9DELIVERTOYOTA
889,561,415 *5C8613D249454BDD1E22D2FD729281C521F5081B 9DFICITAIRES
889,561,416 *5C832C42ADE893D84E129F6D491A6E7AD7AE5603 9ERAEMAALAKI
889,561,417 *5C81700CEA9AA21DB17267A8D940543695CEBE6C 3L4PPIN
889,561,418 *5C86CDC0B1280FE979E957AE785172662941EF45 3.ollessasi
889,561,419 *5C804B079133A5D36B0041095505808F2ED265F2 3OSTERLEY
889,561,420 *5C884D6E8709475CFE0308BBF65F24DC54A310D8 3--P`~SPLAT!!
889,561,421 *5C8A8BC070FF612E00200089E16B1CCC85EBFBDE 3UNDWELLABLE
889,561,422 *5C88DE5A2FD93827F8356A9DC3B4E7D12E2A99F5 9NEDWUDEGFA
889,561,423 *5C8915E887837F575D7AECEB6F06C8137A284F01 418562 bunlareni(gazUretimdaGItImSirketi)veiri'dir
889,561,424 *5C80270BBD78D89B0FF891533D6CDA5656FF064B 9OBCECADAS
889,561,425 *5C8CF39C7F22FDF88E91976BE736EE5A8CB0A4A2 430ESTEBAN
889,561,426 *5C852925ABDB44F07F5B2B7BAAA7C8E90BC249F1 9photocollotype
889,561,427 *5C807E0AF12B52CF4232B47AA972DDDBD04305B9 471q6qg38
889,561,428 *5C836F634C6FC13FC4935CA6142E809EF73A1A29 481-lubbers
889,561,429 *5C8BA950E66CB132A1F087D0EDC4E8A32E224B71 4BITURIAN
889,561,430 *5C8BCDAA60904E94A4CF62B1F5E5E38FBBD17A74 4ILOVESHELTER3
889,561,431 *5C86DD22C24E9964E1385063631BB8167D9C632C 4KIJNAKIJ
889,561,432 *5C88C45E2AF20EC72F3164DEC9F4B5E8AA1EACFC 4KRISTINLAKERS
889,561,433 *5C835D2DB175199496B014F08FC0FAD09CBA007D 4KUUSIVUOTINEN
889,561,434 *5C889DBB5BA01CDFF8B9AA16954E22A7E3A364A8 4MIKAELJOKER
889,561,435 *5C8F6389F23A33FBE7289EB3E55AA7D79B1A94C6 a0004537
889,561,436 *5C870AB14A7548298DA534FB3494CE0E83547363 4OPSTILLINGSKREDSE
889,561,437 *5C8E260E9BE06152C329F6547B560A9B4C0F7AC7 a23?e
889,561,438 *5C80F3BDD92C3B799DA422F1C9E47EB854F926A1 A24U(
889,561,439 *5C8AB2C5FA66FD5113CAEA0E8DC08A259BB36009 4TSINNYLN
889,561,440 *5C8B28ABE240AF1A7B70BED6EEB620AD81A25605 A8PM#
889,561,441 *5C892174E43AED4558F7278CB96D108BCD23C956 5ANGUSMAGIC
889,561,442 *5C8AD132440876DB6D2D3F84CD7681D71F343B9A aaaCk
889,561,443 *5C829082ACA01F406B0FA4249B8999AE8C3852A2 5CROSSGAMMADIONIMPALEINVERTED
889,561,444 *5C84E64698D3469A803FA7321E79557A440A774A 5DEHISCESES
889,561,445 *5C82CB5166E73B0F7033AC8E8C257869E343D416 AAB(<R
889,561,446 *5C82BB30DB7118A33FAF2BFAEC196288815CB366 5MOKSHYASE
889,561,447 *5C89A2726595E70235EB8469CDA12C3F7D98C9C2 AANSTERKTENS3
889,561,448 *5C8F3D223DEC079F8908AD8D09A08A383ADB53A2 5NYDERNYDER
889,561,449 *5C8EE62D310D1F7C4D1F9D492829EF7DDF3330F8 5OAN
889,561,450 *5C86B4989D3052AC88730B92526EDBD1998C9E7A AA%VC
889,561,451 *5C89FD247B7BFFA9B224A6A3CDAD4B15DF3B8DBD ABCADIDAS1
889,561,452 *5C80C47B221FE09E3CC6266C0D7887A6074EC797 5WELLSFAR
889,561,453 *5C80720B12831EEE007269B95BBD82627154FDB8 63LANE
889,561,454 *5C830AD47026E3E29CFBCEC4F51887FF07E0389B accountingcoachcomwww
889,561,455 *5C8C7F9D03BA4DD0D68B2F565E39D377973752E0 AcDa
889,561,456 *5C8301429E85B8666501B97A4C7F64A379FB1E3F 6BLACKIESTACEY
889,561,457 *5C8081E25D41E0C432FF0114C2D88396DB209DDB 6CLEAVITT
889,561,458 *5C82D8FBBF9F3AFFEADC7A4B1CFEEF31088914AB A-CUU
889,561,459 *5C8C4A9358B082B31FEF3FDE2BE39FCA06A55071 [email protected]
889,561,460 *5C8EB0C4E68B559EF282B0D105F2C0ECBCB2BC44 6ILUVUNICORN0
889,561,461 *5C8E848823DC30D4C648FE431F0DAF754D444A0E ADR23#
889,561,462 *5C8584E9FFE12E7152FF7BF203F0FFD7C4A3736E 6PEIPUSES
889,561,463 *5C889B55BC4FC51CB0E9920953D2FA77A2F3DDBF AEUB!
889,561,464 *5C80B6009354A13A68F566733025A18B0FC50ACA agionavi9
889,561,465 *5C83633A351E2711CFD29B3B4027EE02E2695706 agroc
889,561,466 *5C8F71C09520A9963503979C27954E0CA4693E23 7COMPTONMATT
889,561,467 *5C892C0D8D6AEFA8B288B682AB520AA8D90109FC 7cyclopteridae
889,561,468 *5C8904FB1716F52B644FD8D5B5EB2349F41CAACC aipa0
889,561,469 *5C83080CEFE65027E29FD90B7BE1C6D8FB71BB87 7NIEDERKNIEN
889,561,470 *5C8564777DB680DA99AEC51EF3CFFE23EC3BAE2E ak.kao.konj
889,561,471 *5C880101E073F5DAFD93988F758310AB6FC41BFD 7REGIONPLANRETNINGSLINJES
889,561,472 *5C81868E838FE22E0C118AF5158FA6A54C1E51FE AKONIEC
889,561,473 *5C86C8FE28D85FBCA83FAD68122D00AAD3C9322F ALAN.FARABAUGH
889,561,474 *5C8D44D958236DBA11FAC768B331E3F4CE225FD6 ALECHAYMES
889,561,475 *5C82E01272F4C6F179C22401A0C762909D694E59 ALEJANDRO.MONTANTE
889,561,476 *5C8C09017E62C10BCC10674A5B3C0F7B8517324E [email protected]
889,561,477 *5C8C2FC41F0ACEE207DA950DF7C37B9209C8A586 86IAN
889,561,478 *5C83C0CBBFA5852D96D7BB090081E845CA72DCF1 AL-GROSSMAN
889,561,479 *5C8C14330F2222C612770DE6AAD0EAEC85FB324B alishba.amir.panjwani
889,561,480 *5C8BCB9070DCA1F3FFC8C11749B99658803B81BC 8BRENTFORDBSW
889,561,481 *5C8935BC6EEC5E216B2125CE6863E3E41CEE0E21 8disauthorizes
889,561,482 *5C8770CE2D6266364D3F832A2455FF5EBFCFB501 8GANZTAEGIGBSW
889,561,483 *5C87F9CAD662DEB8D5BB041B434F3164EF5B4FFA 8jojo3
889,561,484 *5C8F21AAD7C3522D79E701607F66E1D5D7AF8DE9 ambrosearniotes
889,561,485 *5C8C9724BE7BFB98642D6E708A4A12C31FCBE846 AMBROSZ
889,561,486 *5C85DBC93D472F7FAEA366ECF94DADA87654A0A9 8PHILROBERT
889,561,487 *5C8E9CBC625ABB15118F5A080FCEB953620EDEDB am)jm
889,561,488 *5C89FEDF5BAD4887D41AB87E0B678C226A72B129 8p * }o{
889,561,489 *5C81FCB6DC3EE5799CEBE30990EF452EA64ACDCE a/mqj
889,561,490 *5C82BDBCF7FF9A41FF13D2B5E123573B5DDCCBBF anaerobically!
889,561,491 *5C88D89B604EED4700DA1B6E5990E3499BED119B 8VTVGQDWLBGPDSJ
889,561,492 *5C8D57FACB29919DD97C70B018752872528F86AC andrew-dockerty
889,561,493 *5C86CBB3778E4C23D3241D510FAC09A80FA9FB86 989adrian
889,561,494 *5C859AACF84EACD50C2AEB1B6663E678887B73E8 [email protected]
889,561,495 *5C82865A3C326E3E444AE418111E56EC6A58A935 ANGELWESTERMAN
889,561,496 *5C8E57E50F6B2A630BFC0418599611956D687C44 9DEMIGRIFFIN
889,561,497 *5C81FC7913BD547C85146E9A9323580F438DD365 ANNOVI
889,561,498 *5C8BCA7465ADD3DB9A3D4C9B64F67014BEA5A5B8 ANTAKIA8
889,561,499 *5C81F4BFF01D609A4D7C2A24169EC42692E492E5 anthonymonica
889,561,500 *5C87AD12F6BBF0024B09C07202039F8124A82523 9IENISUUT
889,561,501 *5C88152D220EB444C2FC76070EDFD233B0CA29C0 9jkpiydpk
889,561,502 *5C8CD456479C6D6A23EBF013110ABA5EFF8F0C23 9LAKERSHORNETS
889,561,503 *5C843D8FEC1EEF90E9B82D370085CA1B43919C48 9MESNALITIES
889,561,504 *5C8AB4B038B3BB24BBCFBA3BE7F86DFCEA8C27E0 9PROFESIONALIZACIJOM
889,561,505 *5C84F68159E27FDA70B74F263FA377835A28C019 9RENNRODELNLY
889,561,506 *5C8CE7BFE5F2142000D19F144394484DCD36335E apgsmt
889,561,507 *5C8EA5EA860C91E9107E8F5E9AA20D8F50DD9C4D 9THEALEXIS9
889,561,508 *5C88E50BDD74BD61EF773108D74DA9CDE17CDD95 9ULTANATS
889,561,509 *5C8412335BB9A6FF68F3EF4A4C10F2169EAFB5C9 9WIRILY
889,561,510 *5C874447545C7D7D5867A33922CE68EFE10FDF9F a-?!$
889,561,511 *5C83BB2D1C6E99EAE236238642BCEF00CE925E08 a0;;9
889,561,512 *5C8EB51A68CCE6D93DF127790C8981CAD9CC456A ARA
889,561,513 *5C818EB33FA756F287DD735817E41CD16152B7F1 ARCADIAN.BBS
889,561,514 *5C8A691B8DAFB00DE27114491C7122D4185E5D1E arck
889,561,515 *5C895AB222207FE610C4B3153D37CB39ED758B76 ARE_"
889,561,516 *5C89C84EB7F8F521C23844E0747FE49120ADB20E Areiadomar(sambaderoda)
889,561,517 *5C808693775B26DA91487EE4EBC716D6899A544E A3_V
889,561,518 *5C818E86595C8CD55787B62F7118A4F02E4E0E2D a46jb
889,561,519 *5C884149D11358AA1F296198D5866BA09ADB55E3 a:5vr
889,561,520 *5C848B643613870E969A40FAAABF316251738CDF aa6fr
889,561,521 *5C8EB19C6B0B5024636182D05BB4FCA2905D1780 aaaa.t
889,561,522 *5C8346C36A675BB31EBE49DFAB209939BD33C446 attjmfa
889,561,523 *5C8C11C5EF190938BDDCA469C9AF063E0C7B92DC AANCHALVERMA
889,561,524 *5C87A01049338D4D0A96FB2F6629C4599C08C034 AUCTR
889,561,525 *5C88F4E523770442E7CC279E5B04B89A3DB077E3 ABANCHERO
889,561,526 *5C81571EF78A090D8D9BE61D7CF7E791A2F553D9 ABBONDIO0
889,561,527 *5C8DF454896D508F8DAAC89448DD79C0A1110250 abk1q
889,561,528 *5C8330CC54E433D3118CC81488966F89370065D5 ACCEBBER4
889,561,529 *5C8385FA840ECF1F9781666F3AF3B53FFEFF0313 ackm
889,561,530 *5C8B0DE8DC7D0562AC73D4EC851A61E032E7AA7C ACQAG
889,561,531 *5C88820A9903253984B00AB2A6D7A28A706DF57B b1%iw
889,561,532 *5C8F81E59F8E66992781D2B999A96E3376C4D147 b3u?&
889,561,533 *5C8A074994C2A233C452FA4A0F3CBB200716382F B4JJ;
889,561,534 *5C80198D7B0B6C6A53F6848BC8573CD05A5674E2 B4ST4RD!Z!NG
889,561,535 *5C8DFB92F637E9C5CBEF557D2F14CF3A667D0BF9 AEFUNGLÜCKLICHE
889,561,536 *5C8ACA55138B3E0455E636BA9FFE172CE93CEDB0 a"ej&
889,561,537 *5C8D1BBDCAF1A55331CEED6EE164333B2AD0017E AETOLV
889,561,538 *5C84AC4C52A0DA5D48D71A650EBEE4CA60EE08B2 aeue
889,561,539 *5C8177B80F1468B16794CAA3C429BFFE0DC0E657 affectonle55
889,561,540 *5C89D4FC0E7BA83F2C859869B20C0A9BD70AA77D AGUIBAO
889,561,541 *5C8A067A9FCC49A8882FC8585E91232804756732 AHEUS
889,561,542 *5C892945C631C0A090063CDE208050D23615DF9B AHNM!
889,561,543 *5C88F6184A7B362A36566FACD6CEF03A031BC821 ailh)
889,561,544 *5C8D66575ADB376A4A53EF520FE15F6EF5219921 bcaix
889,561,545 *5C800DA4E38A4F1E12357258946E55093A00FD3F BC&PY
889,561,546 *5C8A80A7EF3FD5548156E0AD41FB7F05669702BC AJ"%I
889,561,547 *5C86C96A9D525286391C94FE959F2F9ECAA7483C BdZw
889,561,548 *5C85644843EF493370E25B10CA5AA2B2DE6FB6E9 (ALCASTON)』
889,561,549 *5C8EC6DE632495FDF93A51BB323525B95C37E638 alejandrorodas
889,561,550 *5C8639189A43A751FC5645828F9646179E5605B4 BENNETTKRAM
889,561,551 *5C895D44F18737FBF3526348EFC1C9FC04175DBC ALGUERINO
889,561,552 *5C8FA616B396926B1D4D1960C4108D49D3CD34CF bernardfreeland
889,561,553 *5C8515EFBB7160F51004AAB84A5E3289037D474E alkaleem
889,561,554 *5C8E694B49A4298052E15D23C4A587CFB644F1B7 alkanees
889,561,555 *5C8A7F14BED892562F53DCE6986A192299FFF052 bertmcswain
889,561,556 *5C8782D780EB6688FF68451C481F2A0EE09BDDDC [email protected]
889,561,557 *5C82812C1EEFC9CEE064C69F597538AC140CA38D alphonsonewenle
889,561,558 *5C848110B66C39F00E1547F8E2B2C0FD49193AE5 bfv27
889,561,559 *5C8FE56FCE58D162953CAD455D42C02EB3811A18 a.Minina
889,561,560 *5C874E884C30AE2DE3B5C21EB26606D30C6B49EC BHOFLMARGARETWADE
889,561,561 *5C85F96F9E205BBD5E4341FE252A45B9FC2F2471 ANGELODUBBERT
889,561,562 *5C8C83F68DCBFEAF6CB5C19D721B00856D9FF765 [email protected]
889,561,563 *5C82D782BCD3004E1B964F93EAC72D33C9DD09AA ANGEL.TROMBLAY
889,561,564 *5C87BB2C9D108250DBCB47393714AEAC1692DE90 ANGIE DOLL
889,561,565 *5C863D4288FA5776F2FA9F10F5FBE4B2548E7210 ANIK-ALAMGIR
889,561,566 *5C8DD98EBEF36B7A91775F61B1DCBE31BEC7A796 BJ/+Y
889,561,567 *5C88EED1A2D03995BFAACD001A6AD69F8D039E81 anisoins3
889,561,568 *5C81F20E81A55BB88B645E1E12607FC022A54A1E bksbc
889,561,569 *5C8E3BE9C1DEF8A0A10B4DFC021D11E44002E791 antonenorum
889,561,570 *5C87C96FABD480C425C3FB3A57A808FBE2DE2110 BLEHIGH
889,561,571 *5C8C1DC259712E765F3CAF2DB1E66FBEB3C64578 BLIDA'BL/I/D/A/
889,561,572 *5C8CD95F12925F83AE292F9139C7406D2F223224 blipb
889,561,573 *5C807BF34544545BBF058F2FD5B231BD98064208 ANVESANAMED
889,561,574 *5C855DEFC0D6692E7580D6733D181BEBD240883A ANYTHING.LANDCAMERA9
889,561,575 *5C81AB8C9F97996D6D9124736904CB3520201C34 bl#po
889,561,576 *5C89800B8E369018B79DD2FDC08A048E3C325AF0 A;q&
889,561,577 *5C8A18A4C8F5F59AE030CCD74C6131B657EB09D7 bonga08
889,561,578 *5C847672C8BAFBD0BB1FD63558B49AEFA82153CF b=p~~>-<
889,561,579 *5C8756D248FD93D5A02C7D6358D7D98AEF697A4D bradleyruddock
889,561,580 *5C8499CA1A3439F9284883D9C4F4EA14DCF36258 A/SU,
889,561,581 *5C84EC4B9BC6F17120B34EEEB4F43573F95EA132 BRENT.DIMPFL
889,561,582 *5C83C7BC1F506FDEE516142B6E1C77D845CA7615 ATROMITÓSZ
889,561,583 *5C87C026892813C6D428E29C5D7E929E1EE2378B BRENTMAXCY
889,561,584 *5C868D0C058D3B2706F5EA30C74DA7A7238D920E atuttiining
889,561,585 *5C890278E5A6483CB133001DD4EA67A5239B3780 BRICEGAYTAN
889,561,586 *5C8A70B6AEBEE5017D0357ADD888FA7CC6BD29D0 brignac9
889,561,587 *5C8FAC4001BD7A20D0CED1EEF426093C8FA124E4 AUTOBUNDLEPM
889,561,588 *5C8FCB5B3468E0DFEF6BF2539F45932B031B6A93 BRUNO.AMERINE
889,561,589 *5C8FFC991FFFE636920478E43FEC9367350B7BEF averykoth
889,561,590 *5C86FEEBB18543EDEE854F3AE6C501C0BEF7901C avh9
889,561,591 *5C81DFC8E051DCDBFFE5B37DA268628B52234D05 BRYANT.OBERHOLTZER
889,561,592 *5C823BCB065083512689B0ACB78498F89B618B89 AW//
889,561,593 *5C89EA90B41FBAA7201D61019BC1894AAFA9003E BSWWEHNNETTABSW
889,561,594 *5C851EB557FA43A3E6B3CDD8C9B799560DFC7845 AYRE#
889,561,595 *5C86B8BCB2296E677E151EE010AE13501A597A55 b-!)?
889,561,596 *5C87C775413A752634643B9E20E0D7AE81C365A8 b,(//
889,561,597 *5C81391F4DA3A3E5564AC15EEDD09635CAE05EA7 BUFORD.CHILDREE
889,561,598 *5C8682FB17875208693AB3C7C0BA92E4DB66CA38 bukowicka
889,561,599 *5C84EB9C017DF2E2E1B012779B7BB28131F54BFA BURL.FIDUCIA
889,561,600 *5C8D060F22275DEF27DEBD47E5F7031C00E0D0EA B5(TV
889,561,601 *5C8CCC4BB22F14D9E1A6AEB6698067F798E62BC0 ba8-
889,561,602 *5C8EC6D08D879B08A4AB2EC4EE28871B666DD1C5 bxe:=
889,561,603 *5C8F481085052751C7A88070333CF47F17B27F09 BALAKRISHNA.SOMASETTY
889,561,604 *5C8A1722ED6BF5248860AA4D366CF962ABB9EB5A c/-##
889,561,605 *5C8DF53AD2C1080C7DC909517CBFF9D53278ECCA C0!5O
889,561,606 *5C8CD7F39513721FC7032F2840F504D6D9E71FAB c3khe
889,561,607 *5C81FF430966D6C06B8FEBCF3C9E94B477711C47 bbertrand
889,561,608 *5C8B3F9817919FE7A6E6608CC05C4809B19BB62F bbsusbsw1
889,561,609 *5C8D8871576F905CC88E7CA9549FE728431E6A7E c9%to
889,561,610 *5C86F1935E905BE78F4578BA481C472F1E8F2FB4 b-e
889,561,611 *5C8EC032B096CF56039C1BF005D346F10A057FF7 campbellscience
889,561,612 *5C8D6E886344118BE8B9438D20E3B26C55F7553D BENJAMIN.BROTEMARKLE
889,561,613 *5C89C10DC2F24698BDEBFBC58125E0A0206BDCF1 BENNETT.CURPUPOZ
889,561,614 *5C8D32A99A6F8CC2FB67B0B49844B40DC49B9A2D CAQBN
889,561,615 *5C8633B465588FA124FE5EF5326BA8316FD2D4FE b"fk?
889,561,616 *5C81BECF28D298B60D84C8AD7B34D8E1BA8019CE C-B$F
889,561,617 *5C8B23296BCC69436C2F497BF05E2CB71907A919 cc%4#
889,561,618 *5C8F17FB29C128001C5966906C3BC1A36B75F70A bh/p6
889,561,619 *5C8E031494F1D403E09058FC41CC7DA4AD161593 cdd=o
889,561,620 *5C85E92E92E5023489DCC1758BB848075D8583EB CECIL.POSTHUMUS
889,561,621 *5C85F0635DBB5F6AF779CA421F3A69269E291A71 BIGISLAND0
889,561,622 *5C86A669951ACE01D9C1D22B1DBA194A127E4B52 biim6
889,561,623 *5C863312B01597C7EADE979BE83586601B311446 CER4UN1CS
889,561,624 *5C8297DDCA586BF86F94B5A9130D59D913CB0D90 CESARFLUGUM
889,561,625 *5C8012CB86CA2BB25DDEE9EFAA17E2B8EA7C3684 CFIHOTDOGGING
889,561,626 *5C85C9DA158602F895FA1A56E3038A8811DB70EF cf%q!
889,561,627 *5C8E341B24E5FAC424140D709869FEF64597813B blasare
889,561,628 *5C86B7CA07C0C42271986BF9FE3CFFC8FA5E1725 bluecsm1278
889,561,629 *5C8EAB5A17227D01814504B340D72AD3A7595234 bm.%
889,561,630 *5C8E7B9BB93DC4AD2EF97258936BBDEA36C3BBD5 ch.br
889,561,631 *5C8A0EF13D11CA93D7A0C0BD3337577515FA4E46 [email protected]
889,561,632 *5C8C86E3F7EEF13C0F5ABE34EA6EB76BA5FCD8B0 BN4&F
889,561,633 *5C8033E53196F2E6C6164E5A970A0FA61B6CAD40 CHESTER.MCGRORY
889,561,634 *5C8421D74E3F8DDD0AF8500B36EF645202E92454 BNLNUREG9
889,561,635 *5C8543F4657519863C40A7768D9C4A82548D2636 chiperon
889,561,636 *5C87D2C6FA5A276CDF52A756A6692A6021A357EC choelscher
889,561,637 *5C8A17F30A9F23E565CCDFCA68DF7A0B31934932 CHR$T4NZE$
889,561,638 *5C80EE0F73E9A8729AB44223275F9F9E62646562 CHUCK.MILLINDER
889,561,639 *5C8A34ACFCADAA8F00B9CEA0AF100AD06BF7BC6B boosdoenster
889,561,640 *5C87CCD2B140CC784E2370D17D4ABCB8A97EACBD bp:o0
889,561,641 *5C86FFDF667B4DBD3F22A594276971F17BD2EDE4 CLAYTON.VELKY
889,561,642 *5C8E73BD0823DCD98AD9D77591139551AB697A9C brag_about-br/&/g_/@/'b/au/t
889,561,643 *5C8D3898C28606B2C27ACE4868B6F2BC7548EE18 BRAHMAKAMAL
889,561,644 *5C83EED50434D72A3E4D345C005AC72212E710B6 BRAKNICA
889,561,645 *5C8059A71C37A06721F43D8D79D623756F9DDF6C clevelandmaier
889,561,646 *5C87F20993B25D35E4A988B2E1F7A5D8CDEA77E1 BRATENDER7
889,561,647 *5C8587F6A1420CFAA7567BDF4417010E2AF24028 BRAVESDOROTHY
889,561,648 *5C8A4B209F99F1DF141BA3EFEF557C21028DC24E BRETOWEN
889,561,649 *5C8A057F4660CB51369C65CB056434DBBA81AA87 BRITT.GYLES
889,561,650 *5C8D54A464EFF48E39A4AFFD11B1168F6EE2E971 CMVJV
889,561,651 *5C8882E379F8F47ACA0B8CD2A44496B3DFFF658D BROVIAK2
889,561,652 *5C8C1B5D6514063AD25DEB1736DEECD1FFA757CC BRYAN.GLIME
889,561,653 *5C8685F8501F88EB4857DF3932EB5F755F28A312 bryanhardina
889,561,654 *5C88F7B87B6255E52A09437BB322014FD004FCF5 COLD-STOP
889,561,655 *5C8FA4F32173BFAADCD296A759A6ADCA3D350B0C bswdmsscbsw
889,561,656 *5C8E289AD5B67A8CF8D5A0E02D69B25E4237C171 BSWITEMTOROWCOLUMN
889,561,657 *5C8B24581590CE1B6465B450A89F25AC82D0D90F COMPA
889,561,658 *5C838DF002FE67907044532FE3D40BD0147C4BE6 [email protected]@+es
889,561,659 *5C85E0C8096EA3EC13AE6B6A2B86ABAD9347481B BUDDYLINNELL
889,561,660 *5C8C7E8C3B12A7929DB347967BCA64FCF666DD24 CORNELL.MAUTTE
889,561,661 *5C8F29BBAC8DDCE9F6D58E50044E415889CE1000 BU)H5
889,561,662 *5C8478B5169B395BF05917E4F77456609BE5340D coun+3rpho8c
889,561,663 *5C844DB5336E385C894C79C21A2148AF90D01006 COUSCOUS26
889,561,664 *5C8DF7B157063E5B357777EDABDBBD649A052F77 cp0m5
889,561,665 *5C8BF940E114C08EE5B8019C4FAB757D6CA691D1 bv!gf
889,561,666 *5C8CF19F17578E027E102B263E308CB6DEA3915F cro8e
889,561,667 *5C82C960ADE0A8195BBF9BE08A916199854FE9F4 CROUPISSEZ86
889,561,668 *5C840419C66AD93F73460A299BC2E19C74535F84 cr=qe
889,561,669 *5C8D930D9595B061666CD70D0A66D2618610AB4C CRVV&
889,561,670 *5C8042BD64F4A4BE45B3C51E28C83B80806466D6 C21KS
889,561,671 *5C87229002E4C2A23F5202CA3960B2FC601123C6 c5530
889,561,672 *5C8390575031560E9F4F4229805A05B2907D95C5 C5DWJ
889,561,673 *5C8345EDC4F664F42D17AB3776ADE09A6D626E05 c#5&z
889,561,674 *5C849798118E9D123C7D95B134EAA3ABE3122A7E CUKT$
889,561,675 *5C8A46481B4DB97F3A1E54569C8056C21C803A91 C9&!
889,561,676 *5C885DB0EFC7543FAC888D46A57CBCD9B02A2E74 callal1
889,561,677 *5C82C916644319F3F9172E73B9FB237A50F15462 CANFENGGED
889,561,678 *5C8FDF5AA364C722F8D3379C5BCEA2F8098D3D72 CYNTHIA SANTA
889,561,679 *5C84C71178E093BF47672FFF10B5C24D23907E84 [email protected]
889,561,680 *5C80F2F8DD13831C18E0E68961D354279CA0D573 capodogli
889,561,681 *5C8F278D85BDAE90A38C941D7DB3E25B30B051A3 cytt
889,561,682 *5C8BAEF59F796C07C81F69A405BFBCBE81944BFA D0D07CA087E6E12ED52E358D0F36DC05.BEANBEAN
889,561,683 *5C853336CD4F618E5E18858888698AEBB3BC3CFE caroline-benner
889,561,684 *5C8C7042D3C3465E7C4C2270146149E85458AFDF d2ks6
889,561,685 *5C8FEA11AE9F24479AE21199781790B0BB7A6DF3 D()2T
889,561,686 *5C8A79E1A1DADAAC4A3003581491ED4B72DA761F d508n
889,561,687 *5C8463E2FA0D4CD3D1F87C5FE1B846843FD91186 d7hhu
889,561,688 *5C84B1D537AEC3D1FF83126A7BF9C433BA15A8A3 [email protected]
889,561,689 *5C8A1436ADC5A5EBC10BDC135559B70843797B98 DALEFRANCKOWIAK
889,561,690 *5C8CCBB5335C474A712750686BD66718AC3F1507 daltongaribaldi
889,561,691 *5C85D086C0732BF43535CB09990F1718E7F7D721 damianbennetts
889,561,692 *5C8F02BC654DAD9F3DBAAFDEEBE95768034839CF damianmeler
889,561,693 *5C828C731FD4F9ACE3E2DEF461144A84836B451B DAMIENGAMARRA
889,561,694 *5C83EDCA7BC7F51B16FFA318FB85F759A40A146E DAMION.SAMLAL
889,561,695 *5C8EA52998E1E2AE984CFC05D9AAD3E9FF2E6041 CDUDE12
889,561,696 *5C87FDB20D6A6A2CB99F055CA979BE32E9B4F4B9 [email protected]
889,561,697 *5C85109115923863F4B55EEE84A9E3C992E969B4 [email protected]
889,561,698 *5C8A3F1963F6DD2BA0CAF2FF39E3CFD29CF987A8 dar/a
889,561,699 *5C89CAAF762580CA75CB17465848FDA181E31DB6 DARIO.WYNKOOP
889,561,700 *5C85D753E601D49798742EEFD05B50C601412FFB CEQYWQR14
889,561,701 *5C8CDF2C17EF59A75B45A66056DCE74036A94028 cesarpaponetti
889,561,702 *5C8D6C3A58EA9FAAD5D37466DCD916E73520ED87 DARRAIKANAK
889,561,703 *5C8423FC8BFD74491B1A8DEAF8F583880CED739A darricknorrington
889,561,704 *5C8ED956DDFD450BBB1D4A00E1E76173D9057865 DARWIN.BOSHEERS
889,561,705 *5C825F20F8CFAC03DE3A789E82EA53787A58D0D8 cf.c)
889,561,706 *5C8D7A1712162615B13FC13F70CC2EC19F8EC378 DAVE3179
889,561,707 *5C8D77E9DA46F6283C2B10F01E0B7FD22B7AEBBA DD4SGLAEW7RJTDA
889,561,708 *5C88F73E06128BFD4646889E0D5A32A6B02C1B8B d;dep
889,561,709 *5C813AC5895F1D24D929743D9B3C2E00060FCEF2 [email protected]
889,561,710 *5C838CB05587A58BC9756A71FB92C28CFB148AB4 chemin.de.fer.en.suisseimaged
889,561,711 *5C884D39ECB5D35E0D33870A8EA3AED3C9848B43 CHENJUYA
889,561,712 *5C804F61D1B880CD30781C48B2EE5256AF823664 dehcrapt4
889,561,713 *5C842781F98A7AF361B15FF0FD3B3368D358EFE5 chief-of-police-john-j
889,561,714 *5C80843CEF9C72C48CAAD47860CFD8F7A17CEA5E CHILDEST9
889,561,715 *5C8A397E95854A43FB39C2328EAE3757C9D5B14D DEMETRIUS.POHLSON
889,561,716 *5C83EBBAFADE5F1369EEE4308C2E6656C038D5B3 [email protected]
889,561,717 *5C808867518A2A4994A11C015441A6F68E135CF7 denisorr
889,561,718 *5C886EBBD165C92FAEE29A3A8D5B2FC49CF52D9B christopergoodpastor
889,561,719 *5C8044D91268A872EEFF68AF47B2EA9020ECE9A3 CHRIS.WYMORE
889,561,720 *5C80B2A2D0066092914B42A643DFACFC4D83769B DESMOND.KOPECKY
889,561,721 *5C85D385A6A3D511306C640774F9BAC0826D7FEC CHUCK.RUHL
889,561,722 *5C8FFF78F29504B1B4320D9322E9FF160E9B2799 DETHRONE.THE.NAZARENE
889,561,723 *5C8BF7AD48924D950C0C970C2DB07AA104ABAF67 chumnong2
889,561,724 *5C8ECE5F0F82D33EEAA75EDCA24E893A64520867 CIERRA-CHANEY
889,561,725 *5C857F5934CE3487881F985D299FE56094257316 d?)g;
889,561,726 *5C8D6C6ECB161EBA7EF478CC86DC00E8412E1CEC dg$=%
889,561,727 *5C8DA1ADF7A29F70F62A906715CDF45F30AC061C DGAGU
889,561,728 *5C807AD7070CB83C7D0B3CAE430C4F789F98E37B cke$i
889,561,729 *5C822939175F0975E421AD7A728842C618D11486 claudecapels
889,561,730 *5C8BEB56891D15053733FE567738E86DDD1EB440 CLAUDIAREGALADO
889,561,731 *5C8D4215F4BCE2F10B458A17F5CF5A82E2E7087B CLAUD.LAUGHLIN
889,561,732 *5C8283369D36707F3860E95314DBA980A8DC0442 CLAYTON.BRUMWELL
889,561,733 *5C86E5FF93788D7B117AD2BB8C2B7F1C40D5810E cletushasbrouck
889,561,734 *5C852255D2B5913580DC619E4DB86BA1461CE95A d/in?
889,561,735 *5C887CD28926FAB7B6C89898359765CAE27C0224 club vibes
889,561,736 *5C8D4C2A81555E5BFFDE5296F7E83D9D63956BEA DISGRACED4
889,561,737 *5C89A5EDC210F9F287FC626C786B4B79CF2AE958 COLINTERMINI
889,561,738 *5C8D04C0AA08CF9E189BF1F2935216731CA4C88F d-kt-
889,561,739 *5C8F7EBA0B41F9B0EACAFEB7E31B9FBA528FE1FD COMBAT?
889,561,740 *5C892B9EFA5D021FF8A0DFA0CE6DB67FE44DD824 common-thief
889,561,741 *5C87289EF2A2B6ABEFC0D991A55F4151B084B3E0 CONF$C4+OR
889,561,742 *5C84661D0220D3DD7773CE0CA5F7CCFDC1EAA161 consequenz-3-c
889,561,743 *5C88AF403AB5272C502D15AF4AC43E2BE243B203 DMENOSKY
889,561,744 *5C80513F52CB71FDA74E4EF357AAC0FB0E32CF52 CONVCTR7
889,561,745 *5C8444B4E74EE8DDF9F7964D02B75B849518B318 COREY.QUASHNOCK
889,561,746 *5C8C226A0A578C76F60508F9D2A8CF9D951DA9F3 dollemek6
889,561,747 *5C874C26B53CB169207D2D585A8B2834FA958991 DOMINIQUE.LUPERCIO
889,561,748 *5C80783D622CA875F80077ABCF316CB3D0D5CADD C:\Program-Files\Microsoft-Visual-Studio-9.0\VB\Snippets\1033\os\SystemInfo\RetrieveorChangeUserPreferencesforMenus.snippet
889,561,749 *5C825234F7C5A44213C5D4E4935FA86C043A61D1 DOOJ&
889,561,750 *5C8B9538CFDEFC69C3FBE83BAA3C7B851BEEF134 dp:ws
889,561,751 *5C8DAA6A2CE27235C85076B2952916D494ABA620 DQFOB
889,561,752 *5C8B8B7CCB17A306137BDFE724C73547D91A2411 C_SB_
889,561,753 *5C8612A16F61E13289845ACE5B8211AC80C93673 Ds1E
889,561,754 *5C8CA2EFF7A5F4F20E8190746612A98A39A0CE3E CURT.BERMEJO
889,561,755 *5C848A52D1C9DD47E1E8AC57518975453A9265B8 CURT.DILLON
889,561,756 *5C86AF5BE3D96AE785FF4F2CD3A1BBC7D6B742C4 D"U?W
889,561,757 *5C8F434FAD2FE629F40B3EA1818522C1A58BBD27 C&X2C
889,561,758 *5C8A09C357655B08579CA2A085E15360BF7085B9 [email protected]
889,561,759 *5C8158A0792261C173076FB6594D6BFF7625FE6A dwgar
889,561,760 *5C8841980915A621795A24DDC2D4403F4D3976DC D"2U
889,561,761 *5C8F06A888BCBF8C2EEA58F5D3FB67F643818A37 EDDIE'SDRUMPIRE
889,561,762 *5C8750650EB258D265E65EDDE843C6D092F29AEC D7YNP
889,561,763 *5C812CCC9E1C387F2F1805E1062FF47DBDA5ADDB DAMIONDWELLEY
889,561,764 *5C8471053D610CDA3F048B2C75EA4DCCD1F41831 EG$0V
889,561,765 *5C8486DD48E9B88CCD7EB0C0114537A3F19FB2BF DANE BECKER
889,561,766 *5C8975BAEAB18F276ABB027A458DD7E21E9F8445 DAN-HUSBAND
889,561,767 *5C89B8269E45E7468BF5076FF7AD1FFE4113D8CC ehjke
889,561,768 *5C8525D2CE6F8FB32A24838E1BC2C8CAF3454ED9 dany
889,561,769 *5C8B70BB0F4BB4CE95114CF64AB57492B530E4F0 daronapt
889,561,770 *5C84C94F14FF936DCF695738AD3064F534D0970A DARRINJOCK
889,561,771 *5C80BB270F73451978E712B52B3F0FE8513F6CE8 darwinkasting
889,561,772 *5C8C80F74CA984750608AB660ACCE2F1661A5C37 ELDRIDGEBAJAJ
889,561,773 *5C83B2923F108C5C7933931A101C97BF7F9FBFEF DAVIDBROADWELL
889,561,774 *5C886B79CCEA5A8D1DB60F1318D4B9FA0E160EDA DBERKOLLI
889,561,775 *5C89FE0E3F4680EC5FF1DE9706E3884BD7315CC3 EM8EN
889,561,776 *5C8C85828B94CF9C26F02134A316DBEE9B807E1C EMP
889,561,777 *5C85C8139BD78256A939ECDA9F9CB12AE1E8B84C DEBRA34
889,561,778 *5C8520DEC2F3E9E698B59212A62B12B0B9E81C73 ENSEIDWITZFRANKENBERGNEUSTADT
889,561,779 *5C8E4D06775A48D717ECA11375EDC25E79557D52 DEMANDINGLY [BUSINESS,.SECOND]
889,561,780 *5C83E3F6310E4A56D901503F2D3DD0E58ECF5DB4 DENIED2004
889,561,781 *5C8E357B8699A7DE76A0FE34B7D63F240BF7F6C5 EPI
889,561,782 *5C8629B5DED1DB9536481E2BD6B31B638CC94301 DENNYKOSLOSKY
889,561,783 *5C8006EC53F78ED049BAA2363B544D26A918A9C3 DEPENDENTVARIABLE
889,561,784 *5C8AA6A674E2CE4EAD094397713936E9D66A1E94 DE-SCHEIDING
889,561,785 *5C8BBAF7F1364CBD55458D64A6F876EA976241AF DESCREVEM
889,561,786 *5C802FE113349DDC5571FCCFBD99A6C2DA4D81F2 DESJOYNE2
889,561,787 *5C814B9051AFB9A9F69BEA983A58773E11D60FC8 DESMONDEGUIZABAL
889,561,788 *5C88EA1D159CAB45A6B4504CAA14EA1F96D2B068 DESOUTHPARK
889,561,789 *5C83A394B7240750BFD40446985F63486AF5FFE5 destructive6
889,561,790 *5C81763685E312B0C39F4AAEF1FADD17F88E67B1 esrohwal
889,561,791 *5C865301C318128CCD88BBA9203D68EDFF3D9976 DHQLT
889,561,792 *5C86FE05B9FF859513F35A85B5402CED0C8A7D25 di$4g
889,561,793 *5C8269B0EB1B33E8892A3F3482C588DA4B61B3ED DIFETTAVA7
889,561,794 *5C8A07C7D9653E57068619C9C0E76AA0A271A20D DjH0
889,561,795 *5C88E6CC5A2B72A27F612D2B3F57D61603AC459A famousuniversity
889,561,796 *5C89DB110BF08DEE67F340D9610FAB6715C76CF3 [email protected]
889,561,797 *5C89FCC82BD2A1561A75988DA8011D46DEE8E32C [email protected]
889,561,798 *5C8EE1F430C2F3F8111AC8F7230CA4A2022C5112 dkl48
889,561,799 *5C8E6539D8EDB947BE1CE046CB89D0D757930990 d-kt-
889,561,800 *5C8E9825AE6F0A84666BA0B581AF7EE803D2645F [email protected]
889,561,801 *5C899D1864FB52AD941CEC176D470EF27A43DF72 dli86
889,561,802 *5C87FE8DC942FDB5D59BD4626E5E39B97F519C94 dlnt:
889,561,803 *5C8CE201B5E0F1E5AD126922FD77156C15CF3E61 dm~3
889,561,804 *5C838F75923F2FD3759F0C5E120FF0372CA59A7D FERMIN.TIERMAN
889,561,805 *5C823F1608D1CDE139C1B6896C1DD983340FD020 dn5jz
889,561,806 *5C828B629F765CE21BF1E1E51986B42D218BE0E2 fiaduri
889,561,807 *5C8E9FA4E3F821622C3F2900040DD17797782C8D DOCIO
889,561,808 *5C83A583AEB07B820C27FB6110FF2F831E614F85 DONG.HUBEL
889,561,809 *5C8A49902548194BDC7EFC6E05CC52AF8564B927 [email protected]
889,561,810 *5C803078C45FE89F3641D3D0AEC417F7DC9AEE96 doowarbez
889,561,811 *5C859DF0108554F259C5B1042E10924273016BF5 dorseyweigner
889,561,812 *5C83AB333D8B28AA6FF072582C6DE99FD611B9DB FOOTTRACK1
889,561,813 *5C8D296E9CC6C8C327DE80E6DD30E4BBC832E535 FREAK09
889,561,814 *5C8D5704A0AABC1F3B718C17D86C6807B5FA6E44 FRIDABAUER
889,561,815 *5C8911A197C90F9E52D7F954A55226EF47CE75E2 fruttai?
889,561,816 *5C8C613757808C4F2D0242AA66F2EE9C768F181F G5015RY
889,561,817 *5C83666FD5661004165A9E83E0E6661373FA6245 GAIL.BOARDWINE
889,561,818 *5C87AFCCDC196FF040C8C70A3EDB579BCAC93A2A GAINES4631
889,561,819 *5C84BC00C36EE2427693B96238C1280073932427 DVA4P
889,561,820 *5C81E620410D9A191C378A5CA62103C6990987C4 gardensitalian
889,561,821 *5C825598FA3EA8127F88684A025DB6187EF2054A DWAYNE.KELAU
889,561,822 *5C86CBD65656869155C681598D48052893724925 GAVIN.VECCHIA
889,561,823 *5C87C68FC1CA8761E537EE0587764D1260BC20A6 [email protected]
889,561,824 *5C8832261DB297D92E0A0210CFCF038FCC1BAE83 dwnsa
889,561,825 *5C8DCDF70E2954E36294545AF570C843B41C7009 D#Y
889,561,826 *5C87464C1487B4E8621413BC76450C572BB384ED dyjglgj
889,561,827 *5C825BAF28E3C10D1464BC7368FBE11F00D54465 EAC58AO
889,561,828 *5C84D8927C8537132794C3D17C633D474B76C94A geo2801
889,561,829 *5C874BE81DF08D84F5759E759F84B8955798ED98 gerardbalthazor
889,561,830 *5C82CE9C16C9C38A064AB29ECE4E08024792854C GESQUIBEL
889,561,831 *5C8D8CB830BA480022A1A7E0574C9BA4267A46C0 Eazin'-Down
889,561,832 *5C8B5762CB395E00614F22151E12A5D9C4D72CC5 [email protected]
889,561,833 *5C8DA0965983763E9ECB2FD5DC00890FFE67FB54 EBJ_S
889,561,834 *5C8BE9896B7FC4D4F746D2BDF99D31E3757E36F4 ECKELMANN街,以示对已故的KURT
889,561,835 *5C8387B7A6F80B8CF3157ED23618874E28B47128 e|&d
889,561,836 *5C889889727AD9335B3F11F15D5B5C5766FCAC5F EDU971
889,561,837 *5C8D54971484FB173A0B01482B653E05AE384237 [email protected]
889,561,838 *5C8A72C1CB097687FD7AC88FA69EE14637841A73 glenbohmer
889,561,839 *5C8FE6352E2265C5FF662BF06F138EC1AC4923CE EDWARD.LEGOFF
889,561,840 *5C8B6A4BF234F2FFFA7A2AE4E5E240C1571DB857 EDWIN.HONTZ
889,561,841 *5C8D7CD539BF791515270549AFC4D41820FE00BF GLOCK500
889,561,842 *5C81C13F9D84477247784349BF126B375027FF94 GNOZTGNIM
889,561,843 *5C80622DF73EEDD0685B5A7F1413CDB77135BECC goethe,schiller,orangutan
889,561,844 *5C8A90DB22A55BA5601D17F27DD9345A453EBE11 gowinda
889,561,845 *5C839375AD7512D1F72F8B1BE94750DC5850B350 groverlefevre
889,561,846 *5C81BEF4A8CFFA6D3304B9698AFD6F34C52306E0 GTHUNT
889,561,847 *5C8750FDF3DE0F6C32594D8EEF9A474C5976274C gupt-gupt
889,561,848 *5C8A36B004BC376AD13AB7DBE1715DCBB55BC934 GUS.ESTACION
889,561,849 *5C87AFA0BECD1226DADFED96ED84BD726CD5092E GUSTAVOMALPICA
889,561,850 *5C832032A0320A1780F25029B6B8377AD49FFBEB G[email protected]
889,561,851 *5C81E0BC952223E57218D9FEF27F726172D2F98A GY190231
889,561,852 *5C8F4D5F8441374983D762CD0CD46B9001A690BF g(須間一弥、内山浩次)人力舎
889,561,853 *5C8BC724CBCF1FEFAF2F374F5950551E7CFA0C3D elung:"Daf
889,561,854 *5C86D39B923F5DA1B2A828097C9568BE00DE73BC EMILKEISWETTER
889,561,855 *5C8872B7A21464E14079D56DF58DC6A219D1E4E2 EMKP
889,561,856 *5C8F9DE9278441D39F8C775140755D5D6B6B892D HARUNGENCER
889,561,857 *5C87EC98622CBD0C5B573804D9D2D88A0B9C06F8 harveysanchz
889,561,858 *5C8AC2A4363EC7F73233716AEC3DD2A10B040AFE EMP
889,561,859 *5C89F738A91BB06119977B5A621CE8F3041F0465 [email protected]
889,561,860 *5C8BAB059179453D8D36218E94BCE2503174F32E hedrick
889,561,861 *5C8258E467F9F528DB7CEE212A0BF8B3B2C1038B EQFOW
889,561,862 *5C83DAF9383056A5F8A688AF929A98800278CDE5 er:2+
889,561,863 *5C82445C20AC25EBD6E274F06C2DC07253B30A4B HGIREIWZ9
889,561,864 *5C8C5995E6F161E74E0F30334137F1DEB406DCDC HIBIKIPCHAN
889,561,865 *5C8CA207E43B9D65051AD72B80FF471A03BF7375 ernestomccarry
889,561,866 *5C8038CD6CA25EC75257486DE0AE16FAC997D6F1 ERROL.CHACKO
889,561,867 *5C80F162870EB83FBB1F7798674658ED967F3C9A ES201172232135
889,561,868 *5C88C19A64AA269D1F2DFD6A284420B6C8FB49CF HOCHHALTE7
889,561,869 *5C86D805EA4EA7D71E9E0E3707B770EB3D2637A5 ESSIGUNG0
889,561,870 *5C887A0C257545D0C87E91009D3BD35360852A96 HOSTINA3
889,561,871 *5C8EE4763F89F2121AFBEDD5B059228C01DCD2DF HOWARD SCHWARTZ
889,561,872 *5C8F639A2D73B94C06334023215E08382C095830 HOW MANY TIMES?
889,561,873 *5C814DBE312CB67FBED461B3E3E688246D37640F HPARGOED4
889,561,874 *5C8B34DAA183D1FF3754396F29F3A5A5047FCA19 [email protected]
889,561,875 *5C8C5C54E546B3729E6142AFC9F71E041B85E565 htaewyrd7
889,561,876 *5C819DFC127DD7FF5DF1F233DBA7D3D8AD988495 HTTPWWW.SCGOP.COMABO
889,561,877 *5C88428DDEB2113C6FB89D17ACAF7CFF714500A1 EXPIRERS
889,561,878 *5C853A69AB04D109EE21F2BBB08478459FB722D1 exterieurs
889,561,879 *5C8F228E6CCDED1B4970A122D93C13B160E7A125 HUGH.STOUTE
889,561,880 *5C80C537C948E7A04DFC8072EF088F12C2A39731 HUNTER MCFARLAND
889,561,881 *5C843F02FD27954325B0D8DC2EE6C05CB32BB23D EZRIEZAL
889,561,882 *5C80DC8A2469AE89E6421A8816A84010BB3CDE6B HUZINPUCHLI“
889,561,883 *5C803A8189F6045E5BA074F9F45D8B43BCB19087 F23001
889,561,884 *5C82AE247F7D8E6AEE8F9D8AF59EE344AAE77437 HYPEROXYGENIZES6
889,561,885 *5C8296A6B89F0C5CD9DB54169534B8868D8DE6AB iamdarkstar6
889,561,886 *5C8877474412236E95AF736BAF42C617133777C7 FANT123
889,561,887 *5C89A858A160E173E069042AA8EF44AC7F871EF9 FARANEH0
889,561,888 *5C8A33FDC26C0B8CB3722725DEFC28CC70E13DCB FAWNHILL
889,561,889 *5C874014D8AAFFEEFEC19838836F16FBDF0AF891 IDIOTSIKRE.
889,561,890 *5C810AE433F2D6A07F1751915D35BE2AFB2B8695 FELTON.BOROWIK
889,561,891 *5C859728EA07116D672C9914C995BBB6A44DD7D9 IHMEELLINEN-PARANNUSKONE
889,561,892 *5C8B5069902EA5B94A8800DAF09838E3597460F7 F[H
889,561,893 *5C82BE20B554AE0A4CC972906D113F381D93A330 I_LOVE_DWNTWN
889,561,894 *5C8D24F6661DD4470B8401213F15693D8BC4630C ILUVTOUCAN24
889,561,895 *5C87F20C2354A95A665B569B8B363266F53F6EE2 FLETCHERSTOYANOFF
889,561,896 *5C876635B007F60D6BF798A05596F8AD6AC1323E f(o
889,561,897 *5C85395CC964BEB37BC8ABE04917F25C2921B007 INCUMBRE5
889,561,898 *5C8D198E4C0CEC38A39DD69402FA58595E57EB0A indicarla8
889,561,899 *5C8C89041361B308D87A3F01347A3163516AC0FE INHEBELN6
889,561,900 *5C85E3248DA100F265740A0E8C4CDDF3649B3BCD fortifierons
889,561,901 *5C81A6895A8F7C76064015BE0372BA354C19FD2E francesjasik
889,561,902 *5C805E1A9EF2A3D6B1D1015700DB7DCA72BA344F INTENDS
889,561,903 *5C822DD62DB7ECCD0DD237CDDC9A486E506D2A3B franklynimmel
889,561,904 *5C8373157599EC409B6A62184F78C4176F0B7B69 IRENICIST9
889,561,905 *5C832F020FC2861248697907C3E36B1453B98CD8 FURGONS
889,561,906 *5C8219AF4A8A7E5F46056AD1ABB61192C9002A9C ÍVEL
889,561,907 *5C83DCEC99CF337E084EDBEAED1DF26BA1AC8340 iypmrady13
889,561,908 *5C87E3A642FF80389747CBD942453EE70A3D7220 GARNERH''HAROLD
889,561,909 *5C8B94E878D2CC4C03DFABB8BA745E9159DFCD4F GARRY.GALJOUR
889,561,910 *5C82200795DB77AC733F54EE4286FEC8E4590134 GASAUTOMATEN9
889,561,911 *5C8A37F36649C0AF8B2AE4CAEFCA1A262CB4D45A GAVINENGET
889,561,912 *5C8CC792578D98DFBAF0BF375FC3DDBBAB7A46D1 jarrodvaruzzo
889,561,913 *5C8A4C5188D6BCA93FEA5071347601A7D35E5314 GEORGE.COUSAIN
889,561,914 *5C85C69A3121E4E76E3B2FA481E272AD70D0DC10 JDE.RFGEN.COM
889,561,915 *5C86BDAFC5CEE2DA788C13B6A9BDB09E70364B46 gerrylenoch
889,561,916 *5C874862A72F5F53CA2E9BE7A370CECB53E3FC20 gesprits5
889,561,917 *5C887C60D136A62783B9F3F7902DF9AE5280E71D jefferywhittet
889,561,918 *5C809F54B939DB48429FF511BE19636DCA3D1034 JEFF FOLK
889,561,919 *5C8A35E5CA5711166769A47C77A59B7ACE7E258D jeffrydapper
889,561,920 *5C80756C20A78AD5E0302CA08E81BE2682911C73 JEFFRY.DIFUSCO
889,561,921 *5C81BA2931C02EBED1FEED038B2DA6655D401937 gigantotermia
889,561,922 *5C83CD49FB6052DA92CCC60592C430AF26250C47 GIOVANNIEASOM
889,561,923 *5C8C0F70DFC90A6A59DA9CCD57882FBED001E472 JEREMEY-HALL
889,561,924 *5C8516066B9A03E0D5A26322643D4D1AADDFE1D0 gleichtaktbereich7
889,561,925 *5C8157887922D9282CF714310D811B06A238F2C3 GMIZASTE3
889,561,926 *5C88D6A8873B577BB6025068491D82351829B635 GOLDFIELDS2
889,561,927 *5C8DE89FD3101F1DB45DBA321F8C9683915FF158 [email protected]
889,561,928 *5C859F46098358C33B5324632A7F555CFE7B04C2 [email protected]
889,561,929 *5C8D6FF372ADF461EA8115302B245F8AD4A45850 jimbo
889,561,930 *5C88F43CAB6B2223FB881903409F95873946B95B [email protected]
889,561,931 *5C80F97B086E3CBC3E33B3F1FF512BBAA75DDEF4 jn/xm^
889,561,932 *5C81B9480F851A9B75010F8CDA5B731E3C985B72 joaquincalderaro
889,561,933 *5C8A373F7F7E6BCAB346320C5652E6E7A2BBEEEF GR860641
889,561,934 *5C88F0C2090B438E3C1B7EA91946EA4C9A5323E0 GREATERSTLUCIA
889,561,935 *5C8137EAA81C7FA96CBF0404E566A04BF11D99F5 GREG.SPRUEL
889,561,936 *5C80B1E8D89045C4B47C222E3030E814FE04361A JOSECHRISTIANCHAVEZGARZA
889,561,937 *5C8B0C2CD40AC46E68E3866D7EF86D2631D93D45 JOSHDEROUSSELLE
889,561,938 *5C84C9B3C79E7B57B6419DE8D7A2F0DCD9163018 [email protected]
889,561,939 *5C8B52C7A33114C2B3D63559A8B837F911588F28 GUKMKSRS8
889,561,940 *5C86E3F411063FB39DD23F8628DCF6BE8A0444DD juan.sga
889,561,941 *5C8D2812D3E09AA9A4E4EC4B8F75202C5EB00ACF <h3><a name="hdr4.1 3 58">4.1 introduction</a></h3>
889,561,942 *5C85BCA7420F7CCA5168CF28945A64F0F1D92206 julianbarnwell
889,561,943 *5C843557D1B8F59C81CDB725590A4F81C6B375C0 julia.zammit
889,561,944 *5C863D08C0AE39AB7FD1A8830461F2D02CFA17F7 HAMDEBL5
889,561,945 *5C8CFD09CCE7DAB96658E484A23EE1B6210F3310 HAMPERED
889,561,946 *5C8A8E7A4898900EBD03D0D0CFB64643CC018A85 Harry.K.
889,561,947 *5C8222E6832CDDDF10C4A20CD6246BDE72A44D87 KAHUNA123
889,561,948 *5C820B4A24D62E7713F1D1E1C6BC02DB5C3B80F7 haum9
889,561,949 *5C81AF8977A13FB8A3A7B1B153B3CAE5063406C0 KAT_HY
889,561,950 *5C87BD369C3FB8A4085E95CCDEAE743036CB2CFC HEIDEHOOGT
889,561,951 *5C8B473DA401373734C141657D6B9D7185F1E7DB KAWIKA1149
889,561,952 *5C8E7FBD24669B787F5C90E9213C3D4137E52A33 KAYLA.M.
889,561,953 *5C8BE8D798941C05519B02C09BDD3E9A85BBF5C8 HEPARINSULFATE
889,561,954 *5C897C4B554B507788DD194402476E33509950DD KEITH.NEUENDORF
889,561,955 *5C867E7675581BDF40578D63D246D834633D79F9 KENNETH.LABOE
889,561,956 *5C8ACD9FB40DF345EBAA8BC61A95BB9C59495563 KENNETH.LANDER
889,561,957 *5C896E49307B0BA10E4FB4A4865C396A6DDE6B2E HERRYHUDRASYAH
889,561,958 *5C8781DB3674F7C368A17F01B88D3AD39CB903F5 KERMIT.MCIE
889,561,959 *5C8B1858C914BF48D09E9A54B41C2F63179F16B2 he'ssolidgone(cartersisters&mothermaybelle)
889,561,960 *5C8C3B5A8EEE26E228FC6F191466C36BBD386F81 kfcnbr
889,561,961 *5C8AFE6514F09DC83246EC83E92BA894B4D4C820 KHAYKE07
889,561,962 *5C83B17180E6A8193FF7080D3BF3FEEAA323CAA9 HIMALOCH5
889,561,963 *5C8B46346E63B6686FDB5D76374B0262A1D3F4ED kill-a-celebrity
889,561,964 *5C86BE283C85F513EC56F90042B343F5C3517C0E HIRAM.GAETH
889,561,965 *5C84A60E618C6D1F8DC624639E52814BDFD0F7F4 KINGHOME2
889,561,966 *5C870239975D54ACB38A7D4E5A1E9E0882EE9D35 KISCELLIMUSEUM
889,561,967 *5C8CCD1D17585C4AF911BC4D090A91407DBF963B KLAUENBEWEHRTE
889,561,968 *5C875EB723D12CB9BBC4DF87C7A9E378647773A5 klavierkonzert-no23-adur,-kv-488:-2-adagio
889,561,969 *5C80D7E72D66A8E7276471D299A9A1F1A66DA3CD [email protected]
889,561,970 *5C84A2A2CD0BA2AFE576C3E172952F23120300A9 HOLD_TRUE-H/OU/LD_TR/U/
889,561,971 *5C87AD493F0D12B4D95B5DB1F32FC2ACEC91E300 hollisedmister
889,561,972 *5C8B665486858E33C1E70BB2021985169994B945 korupcijima
889,561,973 *5C809455D235C4EA52C2ACBC127A6A6474FFC72B kp14
889,561,974 *5C83233AF0F4292A05BB93392C9DA48583164D90 HOSEACOUTRE
889,561,975 *5C8DADEB321046F713A1F11DAE3B28BC522A58AD krislebby
889,561,976 *5C8F2B5B259C740C6ADDF02D72F1A1A1149BBB41 HOURS.169
889,561,977 *5C8045A5207957EA73469D43BBF389E13167B6F8 KRKPTRCK9
889,561,978 *5C81BAF39E224EF8A6F885578CD805708840EF6D KUIS99
889,561,979 *5C8084593514751C078B67017C24D2AFA1BC844F kuswardhanansyah.dhanan
889,561,980 *5C87C18670C7B548815425BFC65C27BFE861B51D [email protected]
889,561,981 *5C87A18F2B772FA0AEC982A018F7A4C6BF91EC51 LAADKRAAS
889,561,982 *5C8D2CA5DF3A9F3D1B42633FDD533BF20E2C4270 [email protected]
889,561,983 *5C85AE293B9E9F84CE0CF11F73D9712C0227FFCD [email protected]
889,561,984 *5C81F3C6A5FAD538AC01391E56986B46BE939793 HUJUHENG
889,561,985 *5C8137DB542EF5E516766B31F14F490BCBA080D8 larimersvg
889,561,986 *5C83B11A298CD72C4E02368DA7AF9DEE55E9BFB6 La-trampa-(feat.-Tonino-Carotone)
889,561,987 *5C8599C9F15F480E54C6EA554C875C413B724539 [email protected]
889,561,988 *5C821095F9D5F14DEEE4B16FF578E108C5D9851D LDOGBB
889,561,989 *5C8C950780F07620289F730ED0264601A4DEC32D LE30FEVRIER
889,561,990 *5C847294EE7D29F67C1428959689EC7BF39A7A78 LEE.PONGKHAMSING
889,561,991 *5C8CF71EFB8DBD22210BA99518042A8A70E527B4 iameyal27
889,561,992 *5C817BDD5AEBD07D3025E9F235BE14E971D0ADA4 LEONARD.DESTEPHEN
889,561,993 *5C8FDF5948035E666905584D8F6FC0FFE348603E ICCOCOTYCED
889,561,994 *5C83560D48E4FC4F5CB1C19FDD9E445D6D297FD6 LESLEY.DISPENZA
889,561,995 *5C874380FC2D225374D443996D6E1ECC259D16F0 lesliebonilla
889,561,996 *5C83C2AEB6A51613A9ED3CE0BFAF8CE9B8142C53 LESTER.MCGUFFEY
889,561,997 *5C81F0568AC5D5818CD4F818DB1EA8B6B67D3D04 ignaciomazzei
889,561,998 *5C880E7F7C21F66604888FF07435B0DE608F5E3E LEWIS.STOMBERG
889,561,999 *5C86FE400102EFBF3F81D009D9B6BC5061C1DD83 [email protected]
889,562,000 *5C8A17FEF949DD5012DACAFE831C77BDA9610DC5 [email protected]
889,562,001 *5C8718891B492C05FE47F2CD1C73AA5A43726599 IKARESKIS
889,562,002 *5C8F38CE4B3D10538936C125AC92CF8F0CB2479D ikoloren8
889,562,003 *5C8B82325EAB1E9D21B6046D13DF916D7ECA318A LIMNOPHILIDAE
889,562,004 *5C8BE24D510D18AD8AEDFA84251E03BC6D856843 ILUVJOHAN56
889,562,005 *5C8EA2F7EF6DDDD12F6DF26C4D645100F10B9D06 LIVIN'.EVERY.DAY
889,562,006 *5C8FF28AECA0528733C91092A4D39FCAB212205C i'm.just.the.singer.in.a.rock'.n'.roll.band
889,562,007 *5C8F8200B755AF1C52CB636C6DF37FEF0FB64D7C LK3TTZEPZOCEMS
889,562,008 *5C823E30BB6DCF00A2101B58EC80695BCFDBE8A9 LLOYDWHITEMAN
889,562,009 *5C830F528E63D3C1089DD52B29C46994385F44C8 LLOYD.ZENG
889,562,010 *5C81316851A83BEC76904F79A697D101B4D4CA2C LO3(
889,562,011 *5C86BE646E7AA4B9259D43ECD26EE7751B61B406 INCASSOBRANCHE
889,562,012 *5C86F346138F5BCB7A69DF0FC014377476D72B74 logansapienza
889,562,013 *5C8F00931A40C4269550E07FA5C3CFF876C63313 LOKALHYRA
889,562,014 *5C8BEF1D4B7E8692855CFC114E71E5CFAAB41363 LOMDAHL0
889,562,015 *5C87DE9A3345427F2FF3B3AE7CCAE71950954B7E LONGSUSANNAE
889,562,016 *5C8DA685AADB5F57832A11557456586AFCF18609 INFRASTUCTURES
889,562,017 *5C85182E8A7A1DAA0206AA120E4773F02067B4A7 INSTANCE.11
889,562,018 *5C8FC18447D7AE1E3BD9E41975E03F294CCCC911 institutions4
889,562,019 *5C81F93D7A9EFFC4C6010A9D0E74FBDCC1FCBB5B LUFTBLASENKONTROLLE3
889,562,020 *5C8BF1936BE41BBCBE7FC8991D574CF87C1C6EC8 ipwright
889,562,021 *5C8F3D0CBBB75E0E3C277A8FA736F284B038AF0A IRRI+A+E$
889,562,022 *5C8782A9DFE438A5AF7C93738E6B4A7AA5DB537E ISEIDRUKS
889,562,023 *5C80734C72DB53C02AF0E7DEC3A2A67EFF4EEF1E M1R+1LL1
889,562,024 *5C899E0BA76E7465F80F5F30F626BFA21776F64B IVANKA:MICHAEL
889,562,025 *5C837C91601CF6485670431F8D603B14DC2A209D IVANREGANS
889,562,026 *5C837D1A52AFCEAFD9466E7E125875C9103F3664 ivy449
889,562,027 *5C8512F11037F30D47A4089EFC1E3655E832501B majortegner
889,562,028 *5C804D806F58FB2BAA24EBFC505222E76BF7D174 iwant2killu
889,562,029 *5C8CCEADA8069C4756A0A84EB719178313D50820 J0Z4B4D
889,562,030 *5C8A546A7AEB07DC2B748FC0E646195CE182396A J74614
889,562,031 *5C8375FBD39392E22195DCD3CF53CFA7D31FB943 MAMSHIE
889,562,032 *5C8E24A9A749D025DF40CA027616DE6FE08CE3F2 MANPADICA
889,562,033 *5C817A7E51AFDC2780F57DF7FDDD6D724EF52EC1 MANTIDACTYLUSSCHILFI
889,562,034 *5C80150D2C9B77FC2E57B135D93A4DBBE8EDB83D mapofkamakuraslocationinjapan
889,562,035 *5C8F526A83D633282A4443B91DD3ED5D29EB51A9 j'allumemat
889,562,036 *5C85AF104D6249367342C3DC51FB1957149A9CCF MARIANGRIFFIN
889,562,037 *5C807E5A56EC5953055EFB259D1F0173FD1EF2F4 marioantonson
889,562,038 *5C824EBC84B2562F2806E42E77634A1913137DB0 marksilletto
889,562,039 *5C808C58347C540FA68EFA3061EF5D77DFCC97C1 JASPER.MADAGAN
889,562,040 *5C84D3090D2AE165A0B138F575B749ADE72DA429 javedhussain
889,562,041 *5C81B09DF58C08E7124D84FFB93BA57A4F97C660 mary1916
889,562,042 *5C8237258BB23528E4F81C01C234C199335B8B42 JEANETTE-ROSSOUW
889,562,043 *5C82985C7322835723A6A44C859963C788099B0B jedbrackins
889,562,044 *5C8C10C744ED3C813CD3F4EEA5376E323686D468 JEFFREYDOUBEK
889,562,045 *5C84F7C961CEDFD986DE76E6464D73152879014B matsue03
889,562,046 *5C8ABBD61353CC534401017231A898ACECCA9AD7 JENNINGS-STATION-ONE
889,562,047 *5C867ED0FA677416DE79EDCA45FA1D6B11C6F8F9 MAURICIOCRANER
889,562,048 *5C837F05C10B346BFC0C9B6379779B1A52B92029 MAXIMO.HOLLINGSHEAD
889,562,049 *5C895A7D1841850609F4F01B878AC2E8963B0007 maximosizer
889,562,050 *5C87184F8DCED672752D887ACD02EC209E377486 JERRELL.NAWN
889,562,051 *5C8C0CAFA3819F7ACA632AFC05A103F9AEC52914 [email protected]
889,562,052 *5C88D5A7F93F7B0D721F0EAA2E9B77D063C44026 [email protected]
889,562,053 *5C8DB729844113FA022604C88DC99E960D6407B7 JESSICALINDBERG
889,562,054 *5C803AAA32AF4A263CC8A04F03471C071C918B3A MEALYBUG
889,562,055 *5C87DE674E72BE2913210A30FDADA409807EB12D [email protected]
889,562,056 *5C8FF244D628BB9D021102E7F34759990135CD6D mesicning
889,562,057 *5C8C0AF784B375A8C23E42AE7001A00E5B3E6540 JOAQUINFITZHENRY
889,562,058 *5C80AD570880DBD9A0B2F46E4AB77CB99D22EA6C joelalukonis
889,562,059 *5C8052BFEC46C829BF549F0F0E34948C4A79C48D johnathonschneidermann
889,562,060 *5C876D29E35A476380CEFD942C054FA1A6F58571 JOHNELHAGE
889,562,061 *5C8F6599AE4A958BCD58267342ECD7513A2C6B59 JOHN MC NULTY
889,562,062 *5C819EE2EF1982D5A5BAC1CDC99778BB4FEAD5A7 johnniecourchine
889,562,063 *5C85FA0D0036D675C0FCA9258BA6DE7C87A13423 MIKEACKIES
889,562,064 *5C89543DDAF288C670D0D1670C1821AC62E293E7 johnwyre
889,562,065 *5C8F15E93B92E23BC42458968F5E4DC93533FDA0 MIRALOLA
889,562,066 *5C83188A8B2B7A954B9C647DFF1A54ECE63B60B4 MITCHELL.DUTROW
889,562,067 *5C8935E9AF04170B90D203FB7673C857794C1049 JOZLOO
889,562,068 *5C802FFE0E5B60EA01D4CAE86C85EBB0EF829E88 JUDEKOBUS
889,562,069 *5C8487C8734B16285E652B2355213BE3316800DD judsonkranzler
889,562,070 *5C8F45383EE2EE26E282813DC26D63478E89687D JUDYGARY
889,562,071 *5C871F2B79044A795E8C57223202B21D7523A468 julie6
889,562,072 *5C86285288C2FBC6A72F5BE25AEB5C9DEF9CFFBA JUNIOR.LEFF
889,562,073 *5C844C07A7C23CBA1F157D5E90A15450ACE9FEAC [email protected]
889,562,074 *5C87492BF2D54B72F56391D45B60FBBC1015D015 justin-dupriest
889,562,075 *5C8559A6B75E07B0F4895242FB1EF457DCE338EA JUZEFUI
889,562,076 *5C8BD0E11D443FA4FD3890C5E921778638647B99 K*2
889,562,077 *5C802F586B3C424DF1929E7093FB959CB67ACC35 [email protected]
889,562,078 *5C8FDF8B68D85BA5785723372FB0DF6F7C3FA3ED moomoosunshin
889,562,079 *5C8BE0010C9DAFC26309B31046105FB09B82D96C morgancola
889,562,080 *5C8A671825EB56528E9BF940CFE70784F841349B mormile1
889,562,081 *5C873A24DC861F44973A663800DC88F9DE5DE3F9 kanefertoumrê
889,562,082 *5C8A076D08A82B4EC1CFCB8153570DE6B4C6A40B [email protected]
889,562,083 *5C8F427C2F2D6A6BD8F215DEFAFA5ACEE0F342EC MSTEFSB
889,562,084 *5C8437413AEB38B0807FD4FFCB3B31891AAC798E KAYLYN003
889,562,085 *5C8688A5EACE52C48EDE49E0D36F7869A1D18599 KBOURDELAIS
889,562,086 *5C84BC6300B9747E1D34BF935448232D81001AE2 keithkerwood
889,562,087 *5C87318435FDB7F0EA09920FE51987349A6A74BE KELLY.MEITZLER
889,562,088 *5C82AD2A51C9B54988DA57E227D5EB20A28E1E44 KENNETH.LEANDER
889,562,089 *5C855373ECFCB9ED2EAFBAF710A89747B391613F MYLES.FRONING
889,562,090 *5C8E3A6EEDF9E42294B48B5266E832E2DF33BACE myroneisert
889,562,091 *5C8C9B0D8FC8750FD2D58F987D363623067DD7A9 KERRIBOON
889,562,092 *5C8D1143E4EC9AC4E1A5C9C50D77B33294564549 [email protected]
889,562,093 *5C8EDAE8C74EA2DBF0A93F6029DB054F572FDB47 kevensixsmith
889,562,094 *5C8B49ACE47F1682D3F8B1A6B30696FDF1A24A66 KEVINCHOKSHI
889,562,095 *5C83BC329511401471EF8A0F690587AEF2AE4EC7 [email protected]
889,562,096 *5C8A0CE388D0CCFE9C7D559EEBD227B1AB0BB8DD Kilah-1
889,562,097 *5C8BBE1CE667C34F9E3EC068AA7FF99B949D7D19 NATHAN.GORSKY
889,562,098 *5C894CBD6C71C918260398249A9B551AB961532E KIREDID9
889,562,099 *5C80F1D3D98BB26A9083BFB52E43D7792A24E136 NEILHIEBERT
889,562,100 *5C8E3895F99C66D6E819EC169911CFB4D4429EF4 KOEBLEY3
889,562,101 *5C86A17EB50B051A3F3FB7BE9E5682FBF9390279 koosrof3
889,562,102 *5C809A91947068ECEE61EFC1286599A70BE06E76 kornate
889,562,103 *5C8B7794D6DF2260A20C841812F76E50F49FDE50 NEWCASTLE.1615
889,562,104 *5C85E0CC9F5E72DE238DD1F0C46B4B0B670ACD26 KRESCHTSCHATIK
889,562,105 *5C812EE14E13F6A093AD3287701C26BF364A1063 KÜNSTKE
889,562,106 *5C82F970A6FA03665416A2A3D73085B3948F7C7B KURASHIT8
889,562,107 *5C83339D2FB13060B0E492055013859A3C5252B7 kwalitatiever
889,562,108 *5C8E26B26B9ECE48E1269D8D8AC08F029371790A (NISSAN)簽訂技術合作
889,562,109 *5C863D6D6E8E2FF8F665252CC72A91231B46FCBB NJTHRBDF
889,562,110 *5C87F44B8A73920EB4C7F5221068C633B5751E18 NMAYOH
889,562,111 *5C8AF7BEF696B60E6283955209EB9AC60E918C44 nn103738
889,562,112 *5C8548886222E7CD10F05F21D282796C0DE6940C LACONIQUES.
889,562,113 *5C829BAAF28B66BDA76CFD8F8722217F2B9222AC NOMADTV.NETWWW
889,562,114 *5C839FFC87E12CB107F124CAAF52DCF62102157F NON-SWIFTLET
889,562,115 *5C863353D9F6825A0ABC526B0BFF6A24EF5DD820 LANDON.CARABINE
889,562,116 *5C8F088C390F69606AE4C3CB6F6B35E3DD4855C3 NOWADAYSMISTABUSTA
889,562,117 *5C8642B605BF94D94B0D03A9C0B94439F51D6152 LASTSECONDHEROICSJAN10,67
889,562,118 *5C872E22051672F719CB40DF9CC4EB7E9634979D NYOUNIA
889,562,119 *5C8D39DF0D09A0E4EF943E18780DCBC0DBA2E705 o:4w
889,562,120 *5C8A44C38D622CAB2556322405268B4E9FB860E1 [email protected]
889,562,121 *5C8876524CB4D96B5851DAB0E9ACEEFA514D358F [email protected]
889,562,122 *5C8341FB2948C864433FACBD737C882CB985890E ohmbmkju49
889,562,123 *5C896EB815330236F9DC78CA51E287956E67891D LEOPOLDOSIRMANS
889,562,124 *5C8E4244D5757696D95287A85BEFCA54D4356341 LESSAHARA
889,562,125 *5C8C8C10CB7582D5C91809EEA3CB269B7AEC5B1E [email protected]
889,562,126 *5C814D610E953EC4D0C63D3FBCDC4A8161BADCE2 (>_<)O~O~(-----8
889,562,127 *5C86E4FD74B4004896E4AA48B84BFE5824524560 [email protected]
889,562,128 *5C8D6D488ACCF7D2D68A4A925DC2C326356F9B21 (O_-)O~-O~D#8
889,562,129 *5C851B40DCE0CB9E4C1A56AC747C1769786C409A OOT NAINEN KOHTALON
889,562,130 *5C863B8DA3854BFE79E6334F68B5F83E32D06B5C [email protected]
889,562,131 *5C8817DBA96D40FAE3C8317F994D3730CC182CA6 [email protected]
889,562,132 *5C849038E1FB754285FFFEC044F4B5AADD63069D LIGTIM
889,562,133 *5C82F4078190090F21B062A7626010F98C3357C1 [email protected]
889,562,134 *5C827DE03A24C197C1B72D4D3056B4AD6873214F orchidtony
889,562,135 *5C85D5E91B966BF9B8CBFAE30252DF78C37A7C1C LINDAOHNEMUS
889,562,136 *5C82DDD927A8CDE3D822A86B95664527FA5DB88A orthoptera!
889,562,137 *5C8DE6AC82D398F03808699E37199C0CD1AD77A5 OSTENDEMUS
889,562,138 *5C8A573E1C840E9FB15E3CFE6DD6F4690384B7EC outoftheblack
889,562,139 *5C82E0AF15E2580A11247CA21A8685E83075CE63 LOUIEMUSKUS
889,562,140 *5C818059B44D0C267D86C712E5929B4DF173AD54 louierombult
889,562,141 *5C8E93DEC43B65704EF9628F2AE2BD426243417C [email protected]
889,562,142 *5C8D154BDBB76E6D5EA86794445F03096EB57532 Love,LookinMyWindow
889,562,143 *5C867F22582276C8DFCB7854DE3FA67AAE2D610B PATRICIA.GOODWIN
889,562,144 *5C8791FA255E4F5696F1C046E44EA1098A8AB8A8 LUFTHGIS
889,562,145 *5C8F52CBD529744C758A44AF7F9B59B391453117 p======B-~0-~o-3B<-
889,562,146 *5C848650EFF295747EF9A64FD908DD0D05A632BD [email protected]
889,562,147 *5C89C3E3F28BDA870233AD5EA60EFCB46BDD1CC6 p=====d***~0~o)x(
889,562,148 *5C86E2EEC002E7F73B3A00C6A1A2AC722A998149 LYNNLANGFORD
889,562,149 *5C8833558B0F1A3F492D4CCFBA189145DAD2357D penetrate.'p/E/n/I/,tr/eI/t
889,562,150 *5C8A3C58C9D8B480D0BD978084B5C22D6B46AF80 M3t45t45z35
889,562,151 *5C8138F1E7E8581F730B5A687F294D18AA1B6DED macaire-ier-de-moscou
889,562,152 *5C84933300EBD1C5B6F561C04FC15F724ABC5890 mackpiearcy
889,562,153 *5C8877A905941B5C7568BE7D8C1A33F6A675C750 MACROLANGUES
889,562,154 *5C885138D29104D4B555C068017B2CC412F4D003 peterbaldai
889,562,155 *5C8119F58F7A4BCA1009BD73CF682B4D436A2A91 MAKBULDÜR
889,562,156 *5C8583DE0FAE8F6D162E44EFA10FF8A413D9A15F MALQUEREILHOS1
889,562,157 *5C8A3CC04187A7FD1B6B4BC7515402F53661DFED [email protected]
889,562,158 *5C8AF077E3F2634DE00268926C73ABEF89CA58A7 pillboxwarfare
889,562,159 *5C82470E0D6DEAB39830D360FE706D9B7308D9CE planungorientierter
889,562,160 *5C822F040354583DBF2D5FBDBC92052893687062 ˈPⱰLⱰTƩINTAːK
889,562,161 *5C8717F9A70C9E9FAE6FD76085BAA13A0FC44A7D marielenavillanueva
889,562,162 *5C8832F31DAD49387EC93DA8F24894BEB8C1DAC2 pneumony
889,562,163 *5C89FBA8E9F9CBD69E82BACAD0269F4F5BD9944C ponteme4
889,562,164 *5C81D45296C369F9E532819207DD1E1DD1C47E5C porfiriomanier
889,562,165 *5C8D32954D87416CA5FB0E427699AF767BDE97AB maskarang
889,562,166 *5C86EC9431BD0BFEAAB8A5BEB84E613FD5C1C4BB P==P.~0~O(O_-)
889,562,167 *5C84FDE2C8743B8976E61E8375ED4A82D6C88656 MCCOOLRUSS
889,562,168 *5C8D39CC75C411DA51FBF27311A6F90B836A2819 PRELUDERS7
889,562,169 *5C8362CC5BEFA7528BCC745078218981E0CE8FC2 PRESTON.FERRA
889,562,170 *5C8CD9F748AFFF08DD8B840FF922B243397F0FDC PRIMING
889,562,171 *5C87EB5669E228FA15EE3A9F4782D3FA2E155757 [email protected]
889,562,172 *5C82456108939CA2DC2F6FA48A8F1A96B2A96F27 MET4M0RPH!$M$
889,562,173 *5C8FA6467B1BB24FA4BE04E1A01FFF494EB5E3BD mhstyle
889,562,174 *5C879AB503E76CE4C71EAAC509536A2215192DB8 Q6806
889,562,175 *5C8D411D6D6F26468FB547C256C45367C781E210 q9nrd9
889,562,176 *5C830D476A94009FD6F1D0A3E5189A7C3D73C5F9 Q#####B~0 ~OSPLAT!!
889,562,177 *5C8A0F1A88FA96D369E3FA72ACA810AB6301257C q=====b ~osplat!
889,562,178 *5C8DBD9D41C8D73633E19AFEECF9945D0A1ED7ED [email protected]
889,562,179 *5C8977A50873B28B145BB7327B2BF0CF576255E7 MIKE.BROD
889,562,180 *5C8F4FF2FD9F894A8878D11C5FE7A0601FE55090 qgoe
889,562,181 *5C839761B45C3D2A71E90B76F75D4DAC7C47C101 miquelfongvongsa
889,562,182 *5C85617CA5E7163AF6276C44D9ED66D51AF493B4 qo9a
889,562,183 *5C8139ED2DEA7D03023BD27E0174461530446776 q====p~osplat
889,562,184 *5C8684A948CB56D9CC79753A1B0F4CEC7227DEFA quadriox9
889,562,185 *5C847B887A5A8B8A8404B6BBDC107301D67FCB2C QUINCES
889,562,186 *5C8402A92EB2325DE829272251E845C13E12F2A8 [email protected]
889,562,187 *5C8A846891B932168B89324563661F0857F9689A MOHAMED HOMOSA
889,562,188 *5C8130A00F0A758CC4BFA8573D1903CBA2E0983F R0U5NG
889,562,189 *5C82B61D609C78DFE01F3A3E1FFF63876C368BF0 RANDYDAN1
889,562,190 *5C8325FD4CEC6434E0D8ED6D97F0730D03E4CBC9 RANDYMIRAN
889,562,191 *5C80FCF374C67C6EF361ABE0D8EACA3B14ED4D3B ravel-feriafromrapsodieespagnole
889,562,192 *5C89979F4B92408B27E73C8E58F9A5303B2595D6 real-myself
889,562,193 *5C86454036A7FB8639E8916290BD9E171106E727 rearviewmirror-/-[improvisation]
889,562,194 *5C80E73906B37E9C79B78C43AEC75AF9C8702591 municapelo
889,562,195 *5C84B75DA1C87D92198B9EC36E05BBAE323D6DC7 REBELSLOVEMING
889,562,196 *5C834396D60F061B3246A36F6FD7AAEC2427F368 museocolocolo
889,562,197 *5C8D98C487CC07B1C3A0669898588EF9C82DDB3B reformersors
889,562,198 *5C851EEA43F8CED7563DB0CBEE72B05C4B2DB6BA [email protected]
889,562,199 *5C8209F4B85A4406693B87BBE2E962F34E965EC9 mźre
889,562,200 *5C8B56B2D2AEA949A533CAB401CDF0D99DF6A709 n02278035516
889,562,201 *5C88DE4FD253650895ADEAC1CBC1E2778DC0B723 REINALDOPACZKOWSKI
889,562,202 *5C891FD67A51CB4D73BD54D7DCB82C3C07055BC4 REKSIHWEBSW4
889,562,203 *5C8D7B4B111F704A1027FDD3AEC7C2F838FE41B5 NACHTSANG
889,562,204 *5C8B7AF4DC42E376689AE069F718131D25954979 REMACHERENT
889,562,205 *5C8D797D75BB29DCEABF9ECA6C7E6311DDD290F0 NARRAW00D
889,562,206 *5C8A58913F1183C007B7BCF1D8F62B4816C52101 RESISTANCELESSNESSES2
889,562,207 *5C8F34CDAF6D8A4E6FF03DC2D6FB86090E6D7C07 RESOLTAG4
889,562,208 *5C8A4FBAE76C1DD96911C16798E14835E2FC425D NATTEED
889,562,209 *5C8517BF01914FB19E077A14D0EF5810627EB669 RESTUNUGROHO
889,562,210 *5C87CFE2BD5E73B3C025BEF2AF6C5010DDCDEE31 navpreets
889,562,211 *5C84D3C40AEA2E4140048B741E9DFF7B7D54438D NECROWARRIO
889,562,212 *5C8D9872B255D07092F75E2127BC3A4BAC17F0DB NEGOZIABILITÄT
889,562,213 *5C803796E00A84C65E7EA57A4685250684A2E80B NEVERPRESENTED--O,AROOT,--DEARTHANKS--
889,562,214 *5C82013BD29F4DFF0CF428B6DA293A21F2BBE6B5 RICKCORTINA
889,562,215 *5C87012FB9DD9C894E6EDB693D258D27649186CD RICKYCHUCKING
889,562,216 *5C8D5ACDBEBD7DC5E2A5B86DA71F0A6B3C3EB2E5 RIFELIDEN0
889,562,217 *5C8E597BC47AEE987854CC17B1749BA4E0DF7F97 nicole-bellows
889,562,218 *5C815AAD4A0A162C2B743B17CB5DB96E0603185D Niemand.weet
889,562,219 *5C8D0126EC0D967BB2D6BDDE6B2419F734184160 NILNILA
889,562,220 *5C8D889852163B29DF65D734BB6CC106F03BB6C7 nocidia5
889,562,221 *5C8261C7B5A447FE8DE2D65FC4427751E2DA870A rodrigodevaux
889,562,222 *5C8BCC6CBB4E7F1A8F1C54C4423C6C227E9EE42F ROGELIO.GAJICA
889,562,223 *5C844B1A23A2194D0365DDE2EB89EE0791542818 rolfdepietro
889,562,224 *5C8BD0D6060C2F4F2634676F2EA8B79CF5197003 ROMAICGRAMMARACC
889,562,225 *5C81B24049467D108B16B074F1307AF6CE9A5BE2 RONALDBROOKE1
889,562,226 *5C820BEB79FC7265FF8CF82E74C03E37510205C9 NORBERTO.KNOEPFLER
889,562,227 *5C8221422A2AD7FE469AC6BB206EEB84832D50F2 ronnieellyson
889,562,228 *5C85C537F1CFEED1DEC33C80075AE4522BE677DD NPOLACAENM
889,562,229 *5C8BEFE43A67683F442FB7E88D5889C0DA1F70D7 nrx<
889,562,230 *5C8B38452A288782EF9EDBFB016B7BFCF95592DD NUMBERS.EILERS
889,562,231 *5C82166C8DABB1192E88DFFD0A821E3B315AA127 O><0~<#Q
889,562,232 *5C889019142A714AC236E574A702C2A8A5E9943D ruebengioffre
889,562,233 *5C8F40192197FF15AAD29D4E06EAE93E53B86AD2 O.GARI?
889,562,234 *5C8B9117B719CDC0D4B03900C538A721C57D08FF o+h3rworldl!n355
889,562,235 *5C87E6007BB5A00F8864389A877A640665EEE3ED oldebnbarnevelt
889,562,236 *5C86DE0D5B12AD588F159875ABE748F6B9033FF6 S92118
889,562,237 *5C83CD86E70702160E82060C8C9780A6600E82A4 SACATELOSPIOJOSCHENCHA
889,562,238 *5C8BC261200C5603C33ABC9EB6E14D7191B5EBA7 ondrášiková
889,562,239 *5C861CBAA1BBA016E7D39CACA23625FB857C1E6D }O{O~.D####B
889,562,240 *5C8C0B76378E54F7A11CD89361F4157AA6000094 oppercommando
889,562,241 *5C833E6B36232854C0D5A3F3CCFF09236141580E OR}K
889,562,242 *5C8A30B5D84CD2D274446E27292E52291825FE21 [email protected]
889,562,243 *5C898C6BBBFE3AAA0677C4EADCAC42370A576043 O(+T
889,562,244 *5C865F9F2CBC35105D3E35DA033BB8EC43818809 OVERREGULATING
889,562,245 *5C8E9733D17D03987182A91263EC09186795A8DA SÄTTUNAHÖGENS
889,562,246 *5C870A251C1767AEC428F1A7432B9A08BCC0654F SAWADAEUOPS-NIELAMUS
889,562,247 *5C829AC61E9265D6CFCFC3F1407AFD1CDAFF69C6 PABLO.MCINTURE
889,562,248 *5C8B65EEE9BFEFC13D38BEC99434D0384AFF27D6 SCHLEMMT9
889,562,249 *5C884059D53A82C3F685CD8495E28E2A275C0D1D PAGYANAGAN
889,562,250 *5C834F4D20B18A4B26B9100B2CD6E53486B0B4A3 SCHOOL (LIVE, 19911031: PARAMOUNT THEATRE, SEATTLE, WA, USA)
889,562,251 *5C8E23DCE0B4A1CEC8F983C1A0ECACC5D4964116 SCHREIBELN2
889,562,252 *5C8003239C868C376CE534030A338135DA6C2ECF SCOTTAXA
889,562,253 *5C8733FF8321D3A36403275C28601552F14D5610 panthersexy
889,562,254 *5C8EFCC9B443989EA1FC4DB6A193A03ED47E315E SCOTTYBOBBY0
889,562,255 *5C84B683C05F00669E5D2DC0BB3C9566F505B6A2 PAPIERRATIONALISIERUNG
889,562,256 *5C8D85B791862679F3D7F08EB8E425071C5290B3 PARACOLOED
889,562,257 *5C83005145B687B094EF923AA199CECB2879CDBB [email protected]
889,562,258 *5C8CC1477F3455B6C9914E921CFBD9E889AC552C SDIPILOHPSOHPS
889,562,259 *5C80CEFD49D78AB450306563D7525A224EEFC6C7 [email protected]
889,562,260 *5C815BDBA7A4C3A62A5A59A1A2FD0E534B750A52 se4b0tt1
889,562,261 *5C86849CAB8AF99CE3E713B47D91FA9C588ED23C SEDUCTION-OF-AN-OLD-FLAME
889,562,262 *5C8C9A59FB45A060A742CBCBFB959FB7F1FB4E9E PATRICKQUAVE
889,562,263 *5C89AD61EFEC6A72DE17541273D67893F2369303 PAT.RYAN91
889,562,264 *5C869B6FDA509CB241F3B28E69A6F766F53388BD PAUCIARTICULATED1
889,562,265 *5C89142D62539AD6D3CC568575137942C33AC514 SEMENSI
889,562,266 *5C8A58CF4FA612D6D316A5684F372F2C6DBD3F8D SETHCHILDERS
889,562,267 *5C842860D9C92E99377DF225F7A36AF37186D003 SFASCIARSI0
889,562,268 *5C8DDAB44FE3357E39C86EB23C008BF186B75F30 [email protected]
889,562,269 *5C86C358A01F076A688A4E26EA747730FF8E8494 SGAWDAL
889,562,270 *5C853CCF33F9947737105778FC113EFB797BBFAE PETER-O'TOOLE
889,562,271 *5C8DD712FF8ED0A8B150938B0EDD7C047DBC4D71 PHILIP.KUETHER
889,562,272 *5C84EF71EADB4F30A0E424EB7413DAC8753B30DD phillipmaliska
889,562,273 *5C8353438E76790F0B936709CE833796DA5DABD2 PHONTAJ
889,562,274 *5C87197B6A312DCAA09AC465A7C60835D212B271 pillz-(feat.-mc-breeze)
889,562,275 *5C83BD5B1DC86BE8F122ABD969CB74A33695C92B p!l0+ag3s
889,562,276 *5C89D7CDC6C9CAC017D86FC0E724B4354A4514AB SHELTON.GRISSO
889,562,277 *5C85B6F100FCCD631672C4E61CAD04E7FF200A9F SHELTON.MARCIAL
889,562,278 *5C8AB66FA3BABEAF4E706D97744FCBE9A80D2E6B [email protected]
889,562,279 *5C81E051F09760D45B4A0C36816DE68AFA812273 sheritre
889,562,280 *5C8E6C5808126F6D6DFCEC0C2D7E594D677224E6 shikinjuen
889,562,281 *5C8C89DF20606FD7E7204B9F8B0288DDB0552ADD p######@~o~o(00)
889,562,282 *5C82244E57F852A85C6D93D9F8687C1986249C25 POORNIMA TAMBE
889,562,283 *5C85EB3B5908205FE0E8E566F606FB02DE04D923 SIDNEIJ
889,562,284 *5C8D4029B2D2870E43E71EC181BE89485253FA93 SINDROME DE FABRY
889,562,285 *5C883ACD7833E8AE6F7661DEADEAEFCBEAB54F28 PQTGBJA96
889,562,286 *5C8D6F0E7900854A1077C8E12F426167B54C20DC prijatel7
889,562,287 *5C892FDC1579DE0E57841ED72FF84E2F41EC6019 prompted
889,562,288 *5C8EF9ED4462DEB1BB0593C0EE5061F23E11BB65 SNOTUAS7
889,562,289 *5C83021D8C6D06D90EBC1619207A23DB1C8565F5 pueblos-iii
889,562,290 *5C847BF9C34D4CB403E45FE3BF228207F97E3C24 SONNY.SABEL
889,562,291 *5C8195198BFA90AAF66808F87F99B058F18D58A6 SOPHIE.SHIPMAN
889,562,292 *5C88519D58AD43D4F770A57D3E7954DEB539DD21 pyrognos2
889,562,293 *5C8F916DEAAE86100D2C521CA410ECFAD46B1DB9 sparrowbill
889,562,294 *5C88EB167ABA0379B44D8FBFFB8C18F5C9EA9754 [email protected]
889,562,295 *5C8D5E7A68790521FBE9B0CCD8866CF49412271C [email protected]
889,562,296 *5C8EEF105F5E2AC4CEF22D2788E5B18B0D6E80A4 SPENCEREASTERLY
889,562,297 *5C8121FD047328CC178872E1AC9034F7D43EF394 Q=>~O.~O.(0-0)
889,562,298 *5C8A5A7A50259D1A858D336AB6DBF9188738BF78 SPIELWARENIND!
889,562,299 *5C8FA3C702BCD9770EF1BAF2D25D800EB14BED9F QRGKIEMIEKKSMW
889,562,300 *5C87F3DBEE2B4F72728221A6BEE3E88005114C26 Splat!!.o~.0~.(######8
889,562,301 *5C84EDB18F0A341C9EC70E66C33F50D13EBEEAB0 SPLATO~0~.(##Q
889,562,302 *5C81820F056051F2DA3E89DAD74B443BA474E583 R3FORJ4SS3S
889,562,303 *5C8366F7EFC0489FB723CFF32201E29B4D54396B r3sp!7!n9
889,562,304 *5C81CA745BDA48FE10BB6594358A7FF341831EAD stacyladieu
889,562,305 *5C8DCB5C40D73C7C87350DEC798E39AE372DE0D0 STAMMTAFELSIMOLIN
889,562,306 *5C8FDEACEA1796FB525D17ED3461C3553A01EA19 STEFAN.DONICA
889,562,307 *5C8DC87580A9DFC6051F6BCF8F8ED49F5D0FE449 rdzewiec0
889,562,308 *5C81256368B47C4B026A30EBACDAB3F6FA4C3845 REBUKSETROLDED
889,562,309 *5C812CA7949054D9A22D402875C1FC0F2598B31B STETAROTKERIDLEKIRTAM
889,562,310 *5C8C4858680E3D08DDE0BB820535610D80B75A6F [email protected]
889,562,311 *5C85378E647C4EEF0F772D3A9ABD75CACFCCCEAB REFRUSEVAD
889,562,312 *5C8386B960BA29BF6060D31D3A8F899048759208 regeng
889,562,313 *5C843CDB4F48AD09F4A0002CD28D97213973609B RENALDO.LAURENTI
889,562,314 *5C85FC97A877E5CB8B3E049892D3C7992B13B710 RENEENINERS
889,562,315 *5C89B9B0EFBFC80A595A897CD7A2F637BAFD6A98 revva1s7
889,562,316 *5C87FF909B2AC00989E486607DB6D0EF511B2971 [email protected]
889,562,317 *5C83C85D0076869B0DE590376C1BF54C7B9C6FBE RHONDA.CHARTRAND
889,562,318 *5C8C7C4C8ACACAAECB063C12552FD32CA3382936 SUTARTAL
889,562,319 *5C80A3C29A5EA249EDCBC8FEAE9ECF1D1DB6F3C3 suzanschmitt
889,562,320 *5C81859DAE101F9F28D6E25992B5C7D0549278A3 rickeyswatman
889,562,321 *5C865383045103FE5C8935D268A5130F105F1E4F SWEGLES0
889,562,322 *5C84AF2592C296E5F8DC7E80357F38CAA76A7912 SWERINGEN
889,562,323 *5C86D703F047B1D109F8B2BC054EF588FC80F041 RIGHT82
889,562,324 *5C85B0D5812FEB0F5E6F7DF3DD1914339CE0D33B RILEYDASTE
889,562,325 *5C8DE6EDA115720CA53218E0AC78882D604DB395 synaptene
889,562,326 *5C8091D7F8474D665D46D6C9B2CC8A6F2134A6F2 RLVZRIFCIBA3
889,562,327 *5C8B7EA7108600FD5D035261D0F7560602F889BF [email protected]
889,562,328 *5C80F1604B7738A56E8EB66D4BC8A2C75B60B016 ROBBY.ALDANA
889,562,329 *5C812CCBFE7A1EEA0FFB5E842993AA4DE39C3A91 TAKHAGBOKHAI
889,562,330 *5C8D6EB80DDFF9B367ACFEA9E8E1F59CC478849D ROBINNEWBAUER
889,562,331 *5C8AF1A4355E7F4BCD9365323F183A979E9A5FDC TALK835202140
889,562,332 *5C890D5308F7E763A50BEFD194828F91593AF99E ROCCOACKLEN
889,562,333 *5C8092C8B9812F97CB7C400DB7BABA75716ED8A0 ROCKEDES7
889,562,334 *5C8CFFF0DEEA33B8094FC0174A7044CD8DA3B7B1 TALKCPTCRASH
889,562,335 *5C89AAB96554BBD3FEA37C61CC81272B58F17F6D TALKPACOKY
889,562,336 *5C81E57CDB996EAE2DDB9BC2692F6A1A7124BD60 TALKROADLINE
889,562,337 *5C815D4A4CF32FF368BEBB8A97C4CB6803804E82 TAMMY-CUMMING
889,562,338 *5C8CBE8229A29981B7C383D6C7807F65E7AC3052 [email protected]
889,562,339 *5C86B53173C97B9429494EA0811A7B3B220DD394 TANJTBSW3
889,562,340 *5C8E9C00FC254BAAE5BF0AD9702A875E6D79BCBF RONETTEADVINCULA
889,562,341 *5C8BC171A42D9AB345E0BC0F468AFAFA4B79BB72 TAYLOR.HOERNEMANN
889,562,342 *5C8DDCBAF80B906923259681E6B91FE408C0F83F taymund
889,562,343 *5C8A081472F08F8CC803A369A850C26F567BABF0 [email protected]
889,562,344 *5C86FAD5ECA38BFC429DDACCFB8A4BD4B6A9DF45 ROSIESTUDLY9
889,562,345 *5C85377F4CA959F51BEC579D7288256C901FD9B9 TEDDY.RIDEL
889,562,346 *5C85B96E361576E5F32C4D4F253E606C2190CBAF ROYAPET5
889,562,347 *5C8D7C7A3703AE1A7AB52C1E4CCC792E129EFD88 RTCTNCS3
889,562,348 *5C87D8FC579080493E9165ADD2AB5E971E081B38 RUBIN.NEUGENT
889,562,349 *5C858064B0D306BFD32DC2E786B5592DD6A63356 rudolphkamstra
889,562,350 *5C8F340E0D1CCEDC221829B9A07BD21D5A7C34A2 TETSUROBSWED
889,562,351 *5C86F2C62DFD5EF06F660583D076916FC01AFD2A RYMNDGLL
889,562,352 *5C8D9F69499BAB270083062FDA24A199E3CC97F5 S4N171ZER
889,562,353 *5C8741BA5468C76FF81C23943331F0831DAED960 SADESOLDIEROFLOVEREVIEW
889,562,354 *5C8FF13F907FADDF56356819A113BAA6589DCCC3 thebestpanpipesalbumintheworld...ever(disc4)
889,562,355 *5C886669C9437D77B8FD9789EA9268DE8C8E74D1 saketi
889,562,356 *5C8615C52809C159F2C801179EABCD731F38CE55 THEMENSUCK12
889,562,357 *5C8EADC63A0C3FE078CFAF2BC7EE5AE3DEBB527B SAMOSKA7
889,562,358 *5C8DEBA071ABFFD0B917575F781962462D3D7450 samualtores
889,562,359 *5C8AE424516A2634DF1B406B78EDA033BF9E4A7D thesherrif'sranchforboys
889,562,360 *5C8BC304565C51BD14BC04DD2CF01FB17E9EBE66 SANFORDHOTEK
889,562,361 *5C8F95F529CE6C1C43129E7C3C382B235381FCC5 THIANN
889,562,362 *5C8263DAEC70B7E7CD537D9FA7EB6EAC80EBDA00 SANTIAGO.ENGEBRETSEN
889,562,363 *5C8A3D8C574A99F270E0F4825382B38C6008A5D6 SAPPHIREGROOVY
889,562,364 *5C87CC93401EF239CBAFCC1F592C92F406B29814 SARMISTHASARMA
889,562,365 *5C8ACF95F2247E414E8FD063E75762C9C51657F0 SATAÑA
889,562,366 *5C8A9A6A9E215508EC8F58A4C270F9F6A3A1B7F0 tidsskritt
889,562,367 *5C8326B9683EB59D7BB42F5FE42253ADA30A9412 SCHAFTSING
889,562,368 *5C872F116C870C70E6E7EF28D0D0CE4071359BBC SCHAREIN69
889,562,369 *5C8EDE73B0D63AFABC875CD0EC6C8F3070ED9D69 tiyadora09
889,562,370 *5C831BEE96C73F54D440808B460FB98091D21CA8 TJKEKEPS
889,562,371 *5C8FE057964A30DB5391250B3DD1F2204C152F19 [email protected]
889,562,372 *5C849B1F559F4F434B77E6D04B87B0D5B8149EF7 TNORESIROPMET5
889,562,373 *5C8B979F3182101E91F8D16FDE35E6B379D56D64 SCOTTIEABINGTON
889,562,374 *5C8E50DD0DC52428C682165158B4C76145CD428F TOEDEELDES3
889,562,375 *5C809AABAE46DDBEEFCC912D657320FD1F6BE86F TOGETHERCOMMERCE8
889,562,376 *5C846B3EF7736492914F131B040BCF6D416B32FC TOPAZPUB5
889,562,377 *5C838A9D2E4238EB3F34439C5F701583F9CDE45F SECURITYPINKFLOYS
889,562,378 *5C823DA663067ED8E28E22870E18139476ABB6E2 SEDENOID
889,562,379 *5C8946F21AFDB4FE2A2C8730C5E55F815D09AEC1 «tpi»
889,562,380 *5C8F30AD46260843B74630B368EEBFA8487D79C7 TRACY.OREM
889,562,381 *5C8574236052F0262E7B2DF1DA70721DCDDB0A6F trainyardup
889,562,382 *5C825FC1E7F3F34EE76F2455562D3E15188BD145 SESREBUS
889,562,383 *5C8A40D81D7155A5168BD4D30843EEF71768E23F SETH.HANSES
889,562,384 *5C8B898BDDE9D412DCB83765E42F11C7F8418C0D seth.tubbs
889,562,385 *5C8C7D0CC153D5391AC72967B127207AE7BE3EAE TROPHOLOGY8
889,562,386 *5C8542ED099416EBFD7D7324578A05B5D1BA0B92 trowloow0
889,562,387 *5C8FD13766E9C357485BF9407286E0CF81BD2A1C [email protected]
889,562,388 *5C8FB62D3CF328DE5BF3852ED3104BFD70D78234 shawmari
889,562,389 *5C82A847EF0AE6EFBF572D965DF5A2833A6FC832 TUYET-DO
889,562,390 *5C89E3B29FEFDBEFD74DBC44EC1A269A01BD83CD SHIRLDSONED
889,562,391 *5C821E51E7A70EB08632D22ED15EE86BDF1422A4 TWOODMEMOREX
889,562,392 *5C8A7B50A8953EC80A5412F2E35C38B11A9C0627 tylerstpierre
889,562,393 *5C8158D4D4090188C74993174CF889DAC8D4E9EE TYRANIE GRAY
889,562,394 *5C803290B86745C19EACC4AF8BBDB94B2EDDC0AE [email protected]
889,562,395 *5C87D050D6CB193167DA6C760445265D88606CAD sidharkavy
889,562,396 *5C84F90659AA291E24590122F50BA94F2B47A63A SIDNEY.KIERZEWSKI
889,562,397 *5C8513DB23E261350BA62BD0C07290BD7ECEB6E7 sielysy8
889,562,398 *5C8B239107A22A62E18A14525F18C9BBCB7DCA54 [email protected]
889,562,399 *5C8029CBFBE2F4762BB87B2DDA133D488B23D581 SIMIOUS 'S/I/M/I//@/S
889,562,400 *5C849ED8F8AA9471F535C27D2347E55C553E11BD [email protected]
889,562,401 *5C838172299D5708B4A2709F093BCADD7BDE93C6 [email protected]
889,562,402 *5C8067AE1FE33C412E5088648034D8527A2AF3BC UISGEWATERHORSE
889,562,403 *5C8CD73D918FE4182716D5B6E841D93ABCEF65EA [email protected]
889,562,404 *5C858B66DE13806877D30F98B746E7363DCA6CF8 SLENDERTRUNK9
889,562,405 *5C889EBFB50FBDFAEE792E79CA01D16E1DC6A8F6 unexplaining
889,562,406 *5C80CC4FF17419C9FFF1BE71AD655F365E75B59A unlimeted
889,562,407 *5C8FB2C2995DE9B865D500C184D2C68E51614457 SNAKEBTE
889,562,408 *5C80D899EE8DC51401459AFA553E5FB73C7AEF80 [email protected]
889,562,409 *5C89C702A9BA0ECF40CAC4C8626E8AFA2222B9E0 snestasva
889,562,410 *5C865AAA74E801336091AC7586325C1EFA778143 soldeina1
889,562,411 *5C8ADD0200A8A77420862A58E5C548C54E2B074B SOPGAVEN
889,562,412 *5C85382A2EF6C918AD3090F5285DC63C810FE153 VAJRASANAPATI
889,562,413 *5C83BAFC57FA6DBB57EE430132513CF7EB34C18E valentinbohlsen
889,562,414 *5C88E3F43F9C05AAE42E21480251CE28E5AAD867 SOURCERAGULEADER
889,562,415 *5C8A88DC32890F04F1445E226DE6C8F0901CF32D sout-el-phan
889,562,416 *5C8C932BAB9D2934D1DAC99CE9C8A480188DFD7A VEMBRINCARCOMIGO(REMIX)
889,562,417 *5C8D24E433E4E06CE6DFC0484F841BDF369DD968 [email protected]
889,562,418 *5C83CCB0B8B82FD02EC26DAB0C89B7BFBE4CC942 VERTCHALLENG
889,562,419 *5C8397F37A2D1A9669BFBC235289783D1AD422CD SQUEAKERS?
889,562,420 *5C88C379A0136B056DB75816C705176FB17B1F82 ssbilder
889,562,421 *5C81463172EF4F41D6A4B9C6BB8FB591E9DE4F68 Video
889,562,422 *5C8FA0D680A0954B51192B502C7447E7BDAD34F7 VIJAYARAMCHANDRA
889,562,423 *5C8BD1F73864673C80549AA0F01406ED7A0FCB2B STAGGED.AND.TORN
889,562,424 *5C81835DE660FF09A36263334187C02CF62786FF VINCENTHAEGEL
889,562,425 *5C868F9750524F3641F4B12FFB6C0A5213E75F2F stationcar
889,562,426 *5C807707833674C0A329A148F3D8D3CFF3957EC7 VITO.GIOIELLO
889,562,427 *5C870352E4FCDCF107E3C269A4A53AF5F8B85F85 vitoogley
889,562,428 *5C89C789A90CA45154CD59571E4337C27C905B1D STEVEMORLEY
889,562,429 *5C8C92C9E22233E21493375F23DE9CA769937F34 vojkoflegar
889,562,430 *5C8A0BA6C33E08E9C1A03E1B955ECA197E3FF4AF @STRAIGHTAWAY
889,562,431 *5C88770A41426B1B6EF82728159D0B4E63928BBD Stranger.than.Fishin'
889,562,432 *5C899191E9BFD12EFCF7FDED4190E3030EFD56C2 vsmedia2
889,562,433 *5C88C5573B2D2289BA4E4567254DD4596C82FA50 STRITARING
889,562,434 *5C8FDCAC6CD33FE1E7F23C4B3C9016BEC1E01FCC studcom16
889,562,435 *5C8E9293BA0350CD6355B5E2E8B4EACB00D62B54 [email protected]
889,562,436 *5C8CA37E072D37899725CA6ED312977976E12933 WADEMURRAY
889,562,437 *5C890FBA9ABB9C187C69BFCF124E0DD40A00786B [email protected]
889,562,438 *5C822EBD0FEF67114BC3D9DBAA57FD6D19CAD939 WAH-WAH-THANN
889,562,439 *5C87679C526C7F4FC54E4B03B9C9E7A98AC62303 WAITING-DAYS
889,562,440 *5C8FA6446CD584C70B90EAE380326E69B9956AFB [email protected]
889,562,441 *5C8404907A705D3CFF9D83B8A5DE951D48A2CD32 SUOECAIDOC2
889,562,442 *5C88144CC9B5EFC6914C4F64039FB82BE6F5BE8A SUPERABNORMALLIESED
889,562,443 *5C8DC9027A186436B424AB282402138B923BB81C SUPERDANDY
889,562,444 *5C82B523693874C6DA37B7041E9645304E7F1527 warreny
889,562,445 *5C8550906B1698B4241201E91FD423FA211D6CDF watchesonlinejewelrystoresinfo:
889,562,446 *5C8C385330ED6B0E9F2DC56116F1E0842E125B47 WAYLON.SLOTNICK
889,562,447 *5C85264D07D47C4DF846A937021831D4F702ACA6 svabech8
889,562,448 *5C8BEF8C2715E496E20FE31EE413871E358DDDC1 wendysuryanasoetanto
889,562,449 *5C81C7AF3FF93BF21BB7363F3B6677A7FE5B2F7C wennichdannmalreichbin
889,562,450 *5C857FDDA855225D5663C108CC1B049A0E47FEB4 WER NICHT WILL, DER HAT SCHON
889,562,451 *5C80C8DD16A6C79DC153834556FC3B8AC23FFC40 [email protected]
889,562,452 *5C8AFA4567EA260A1CEEB2E78A7AE74C22A3ED82 t08acc0ni$t$
889,562,453 *5C84D595C5E9B2A28ABC2D5A093DD9DB94D232DC westcoastlabscheckmarkillustratesthequalityoftrustportproducts
889,562,454 *5C89723FCCDD5145C0ECFBD244ED8D3F597C919D TAGBANGER7
889,562,455 *5C87B2FAF867F647AB01FAA1DB71AB01C5676A5E WHENLEONDOESHISBEST
889,562,456 *5C86C625626BC113D88761BDA2ADC32855AD44E6 taker10
889,562,457 *5C80651C9F5A510C39EA1EBE290F4AB0A8F00793 WH#S
889,562,458 *5C8A56A910D8B204A64E9514B73F3709207FC661 wikiquestion
889,562,459 *5C814BA787AE6795267F41EE42C589F4A6B81BA8 willardchatman
889,562,460 *5C8E9588D18862D3B8006CEE4B2D85F57F23FFC4 [email protected]
889,562,461 *5C84513644866643DFB45DF5F6B11542538817F5 tapissais.
889,562,462 *5C8AE630C6EC9F433CCF7229946D6276B4FDDD38 target frame
889,562,463 *5C857E6335379C8D1CB4BC75A6AF789385937DF7 WINSTON.FETTERLY
889,562,464 *5C84EBE2723A114A5E4DBE4BE9CA072AF0589FC4 TAYLAR ADAIR
889,562,465 *5C831F3EBC014E214345C94937505C4590B09142 TBLFLRS9
889,562,466 *5C89853B02FA0D23B10686034E4606588E837FE8 tc"e
889,562,467 *5C8DE16AE88527A1FFC4C85B539A673A7AC0F5A4 WSBENNIG
889,562,468 *5C87F2BCF8B89267E205BBF9630D99A0B79F9E48 wspkcnsc54
889,562,469 *5C8F0D11BE9548C893262F0DBAE164E1A8B288FF WWWGOLFRECORDSCOUK
889,562,470 *5C865C02D818A44E8CCA67603EE9A3CA71AAB340 TERKELLIAN
889,562,471 *5C80ECD6D0624829B2B331D3FF6A79E1589F7CC7 THATLONELY27
889,562,472 *5C8CA44DDF42B0853D6F7CC811948B48EF8BF1B5 thatrenee1996
889,562,473 *5C8F666CE3045C7D348B1B45CBCFF08B5F564726 [email protected]
889,562,474 *5C81A7EEB064E2F3EC33183964762A2909E03C42 [email protected]
889,562,475 *5C89AA241AF4539BF6F37092C992AE10C758D376 the"poormajority"inldc's.<p>
889,562,476 *5C8EEF80BEA7B33954257878C21535B50FE138A0 THERONCATCHPOLE
889,562,477 *5C8A4AB22399B0482A251930DBD2BDE11CB2C2B6 YAELBE
889,562,478 *5C84034458D3B53C586213B5557F2ECA6F08C9C0 THEUPHILUS1234
889,562,479 *5C8B2FCBFF6517457C52039103170F1CCDF3A43D YANE HENDRAWATI
889,562,480 *5C83EF8D6165D185F2845E7744EA922B4547D57D THOMASEARTHLY
889,562,481 *5C8BCDCBB3438C43CEBFD70283E809215EDA9E48 THURMAN.ASLEY
889,562,482 *5C889266B3BCFF440844B7F1C7E3F4F126104348 THURMAN.WINKELS
889,562,483 *5C80284996A25496EE9EF9B2F178546B971725E1 ycnaneiddal
889,562,484 *5C844CBEB4889411746D5FE7410D9ABB0C925684 YEDAZAGO
889,562,485 *5C8D26C454550223817E09ADC1C3085B379CA72B [email protected]
889,562,486 *5C89043501C7397DCC37F73DDF89D53277F560DE [email protected]
889,562,487 *5C8D2BAD0EC078DFB2CB9AB22EA04373C99CCE4B TINTINPEACHES
889,562,488 *5C842BEBF328F6DC421C3BA7CBA54A11DEBA334D YLLACIMREDNE3
889,562,489 *5C864721404A2D9D21E5BAF2913EFB61CEFD8D36 YLLANOITATEGEV4
889,562,490 *5C8501C80C035FD0E38D0337438E071D65E88D3F tjakra
889,562,491 *5C859CCA24578BF3F82410B001F5F31131B0BD68 you-are-love-(petal-pusher-dub)
889,562,492 *5C8D9CF94B79EBA444B438C4D9A40958CF02252C YOU.CAN.GROOVE.IN.THE.STINK
889,562,493 *5C8C5A7ED6079A3AA92208A6A72E8D472D16E7FB young121212
889,562,494 *5C875A2FB7C5D8385316A0CCDB90FC703AA66599 yvette-keyjay
889,562,495 *5C8323107844FF0243B008A583B2D4F0B5A260B5 TOPBACKCENTER
889,562,496 *5C862667433EBAAD83F888ADE885BE20B04D2E15 TORERI`A
889,562,497 *5C8C924F1DAF5C07A72240B5A661671023180691 ZACHARIAHANDAVERDE
889,562,498 *5C8490AA8F0251F4E9C8EE396E9E82C31ABA8D81 zacklindhorst
889,562,499 *5C8015E80F505216BF55D97134506D7AEAB73E2E ZAGLEDAVASMO2
889,562,500 *5C8C4860AD8E01F697D5C12935ACE052630D85EA TR0PHIC41
889,562,501 *5C8F134695388253DB6950722CCC13D55EA977BF ZEBEDEEREID
889,562,502 *5C8D9C2083A5234AB55F3BAD91062A057F124DE2 TREMENDOUSLYDOKES
889,562,503 *5C8CF845AF6CBFC2BA6673F2180066CAC25F3502 [email protected]
889,562,504 *5C88950BB8BE1088A1F2F6209CE55AC75578D864 tresorsclubdj(disc4)
889,562,505 *5C892833CE589B95459EB510BF9FC446FBC6CEBD TRICIAGETZ
889,562,506 *5C84E02B8B50C67BF47DE66627607FD80F33CEBC trifoliella
889,562,507 *5C86B54C6056B94BCA8D8502AE681FBE5089A600 TROPOPOIOYSANING
889,562,508 *5C8D8BFB8EF385FE022572292FD4F49E0951D965 [email protected]
889,562,509 *5C8B55BAC5B9C6B0888E7EF4DC0D71AB58772AFA ΑΡΠΩΣ
889,562,510 *5C87E0F38ADCA7A70103324E7A658B1224FE8E54 δρόμουσ»
889,562,511 *5C826304AC6EEB4F62F125A615C03F59DC2AC7A3 TUTANKHAMONII
889,562,512 *5C81B00AB0C22501A217E4B845BF976FDC51EDB7 [email protected]
889,562,513 *5C84DF807199B1ECC3D67C0543545BE090761A42 АФАНА́СОВЕЦ
889,562,514 *5C8F87723DC2E0E85C47C7AF6C3EA030A2BC0FBA вымениц
889,562,515 *5C81E41800467DFD84FB794449ED30789BCE78EC «ЕЗЕРО»
889,562,516 *5C86B319C562B47B015A2483556CCA58A8AA27FB КАНТЕРОВА
889,562,517 *5C81F2E6C09138B1955EA411DEB3D32719F8813A [email protected]
889,562,518 *5C82032C63FE8E7E44E1298948AC2012C8CCB868 КОВЫКТИНСКИМ
889,562,519 *5C80F3F6714C8F8A1B8A74E460F52586A7E5EE92 uitschaterens
889,562,520 *5C846939636F254753DA932CCDB4006DF0B3A2CA umar.manzo
889,562,521 *5C8FDD3F463A72BAA4F4730A80E579C0E27E3A58 UMEDOCIN
889,562,522 *5C8CD57379A286989F04007ED05D3AE4D6297C4F СЕРЕДНЬОЛИТОВСЬКУ
889,562,523 *5C829007775D8BA6A297F52625DF2EA0EBB0E829 СКОРРЕКТИРОВАЛОСЬ
889,562,524 *5C804CA939D4F7F0665024C0CA2B7902A3E99698 unexceptable3
889,562,525 *5C8953BBE9DE5403291449AB48FC512B996D2B0F uu~-~-(###p
889,562,526 *5C89DE46BCCF5DB9AD969BA6F68CF47B260CA970 UVL1
889,562,527 *5C88F9A832070B5C3EDC7C2DD47864E8F09BB482 UXX>
889,562,528 *5C8ACDFA66A2B61DA952CFD066BA79E84D3D5E0F vacu!7!3s
889,562,529 *5C8F16AD30669BEAAC7F51DD9DADE580BC197ED6 VA{J
889,562,530 *5C83D31033DA90031B9FCB283B280B9FEEF26768 VALAN.HINOZA
889,562,531 *5C8864F901F0A0770C3B0D1EC7B7ACB45C17BF6D VALENTINE EPO
889,562,532 *5C880200B0B59E168991CF62E334B5748D6FE473 vaningerson
889,562,533 *5C896C44C21E38CA0D61DDA6B53FB8D38B20F354 [email protected]
889,562,534 *5C8200146080324330CAFAA13A1F992613A8FDC8 VAZMIMO-1
889,562,535 *5C888E569A5DF101FFAF993398B872196B51A4EE VERGILOVI
889,562,536 *5C84C915EDA176340513B340DFAD11C6D2320336 veronicadomino
889,562,537 *5C83AC25663CC1E985E3CA7784BA93F5205DE3F7 vijayalakshmi.mandalaparthy
889,562,538 *5C8A4CF1461E54486FE819CEC5729474D5C60513 (00)[email protected]###q
889,562,539 *5C848E1BCD0D51184E9B7BBA3F30D4F5CAEC98C7 (0-0)**@=p
889,562,540 *5C87F59EF8762F23B611AE785E49E570CFF8B93E VINCENZOMARDER
889,562,541 *5C85DA9BE910E0FD328F9276224C73FB42050ABD 05L1B
889,562,542 *5C8EA67DB65B2C69E60DFF76477117AE44B8E62B virginia-davis-collins
889,562,543 *5C8E138274F57E537B17EE08B670D5F66B1E17AB virginia.garrido
889,562,544 *5C8227F3C4B9ED2DADC4F938DF533332EAC157E9 VIRGINIAIMAGES
889,562,545 *5C8CEC924A9A7D6BEE9D3A03B358EDD8E2B978AD VOITOLLISEKSI
889,562,546 *5C811DC41A9AF536D2BE29C5EDE93C234833C61D vorserienmaschinen
889,562,547 *5C84571B93F7D1EB83D1FF62E79C1F5D82F6657D VSETSTATEBSW
889,562,548 *5C8CA23E77CAE3D3F88B76B2D2A733B5A2DB2602 1413547 SE.N
889,562,549 *5C816EAE14554CCB1768136FAAA686D6D91AAE38 1459180 muinauudenpuheenjohtajanlistaaminat
889,562,550 *5C80B2DF2DC7D4B5CB9300B89C6F7AC01D3AC664 VUISUNSW0
889,562,551 *5C8691795785E344AA7B37E6ACEED5641C04C88E waaghalzen!
889,562,552 *5C8E3636EF2D967F83A31C55AD172012B3098B5E 184012 ER
889,562,553 *5C8894287DD45E3D67DE588A6A1BFC7058F7E944 Wall$cal
889,562,554 *5C86CDA6A3CB2BFDC196DC39ADA72FFA0D6F51FA 1aedleste
889,562,555 *5C8ADF4D05434EF0ECF6725CCFF24CF261478A0F WANITA.ANJA
889,562,556 *5C811A3933C5A90390B05D53167978438A751B58 wapo060313
889,562,557 *5C8F15D72E4671AB27D57161F2D471BD20A558C6 WAYLON.PRAKASH
889,562,558 *5C820AE4783E9FF2B51141C0D1D7BBF16F33A516 weichselbau
889,562,559 *5C8E03D2FBA745B23D90F77799FFFF47156E7826 [email protected]
889,562,560 *5C8EDA835B58327C2AC2346AA1F9C4B96A90F0DC [email protected]
889,562,561 *5C81319B012BB2E72C3D77D4A2CDAC74B684B15E 1-KAUPUNKIKESKEINEN
889,562,562 *5C83ECEECDD8D6DCE8D61BE210B01F4A4A434780 [email protected]
889,562,563 *5C88C662DABC253096990993960EA8A08EA0F37A [email protected]
889,562,564 *5C84F5495134F8ABC45E4DA04BBEE5058FDDF5AA 1 KORVAMERKITTY'KUTEN
889,562,565 *5C8E03FD04FE5048705DB22623652BE47F6A678A 1.LETKIST
889,562,566 *5C8FDE41C98C7AA2D28FE1A83E9B7B63CFA6CDBE 1.LOISTOPELI
889,562,567 *5C8C030A712E19AE80B515BCD167FF4F71F5B988 wfim
889,562,568 *5C85519C593841C11E36E810059A8A350941EE6E Where.You.Goin'.Chicken?
889,562,569 *5C88A2AA7CBBF2B0F58A69272B2110E9AD369A48 1MSKLRGST
889,562,570 *5C81E30561A7049E85CC2BDF54D487D0816352CD 1NIEFRAU
889,562,571 *5C81A57F6E4A3B027C5FCFB97A8D248A99C8C233 1.obstbaugemein
889,562,572 *5C8E1B52339BAD36CB4EAC91A2F7A4B2F2BC90C4 WILBURDORMAN
889,562,573 *5C86BF1B8EEEDA2DDABBDA6CDCC34F6614616BC0 WILBURHIGHMAN
889,562,574 *5C88271EAF36AA5015C08315B2EE660396DD55C8 WILEYEIKNER
889,562,575 *5C83210A11DD9AB6B4821335C13444CF20C964D3 WILFRIDAH.BERENGE
889,562,576 *5C81D469D590EE64FFB382AC3D02B4FC05443FE7 williambennykirkham
889,562,577 *5C8F65DB652E2A7E05FAE3D8CF2279A30ACFE607 william.dockens
889,562,578 *5C83F9A6077823BE9B5CA6553EA6ECC5AD1173F3 william-traynor
889,562,579 *5C8FF4D56ABC283C3F21E5E1D42695927EFB1CFB williebonomi
889,562,580 *5C8E53B14C5235DD9CE2C35B3FD74B667B07F14E 1secondleveltechnology
889,562,581 *5C875E6848C66FC8F6CF553076D80D955BAA3B7C [email protected]
889,562,582 *5C87FDBCB1155C337097D7C6F0C80ADED224742A 1.SPUELSYSTEME
889,562,583 *5C8D5D25679DEE36BE4107C78599A7A057D9C5BD 1TRAIN
889,562,584 *5C818599191894E411D7F396F1D4EECBDB89BF26 wmtrudelle
889,562,585 *5C8B27C55933E6CF538363646E2754BEA3A4ABC5 1welt-abitur
889,562,586 *5C89AC6FE79C9B29C5647A6AACB1AA55AED4F5C8 WOEKERAARSTERS
889,562,587 *5C88B809A096AE01B912F1514F08FAA22AFDF24D wongzairen
889,562,588 *5C8A63C0245F2B2D283B8DCB94C9CCE801996F9A 2033199 "POLIISIEIPYSTYPIT
889,562,589 *5C8996F8D2AFC9BF38B94FDAB27FF4620657BD99 20BANEASA
889,562,590 *5C8C7F2E32DBF7B2D44C3549ED33CD396025E9EC [email protected]
889,562,591 *5C82F082B8F5E8E412DCE5C1A2C30B0615E54F7E 2183267 vipit-ja-vapaaliput-eiv
889,562,592 *5C88E6914C4CC4D3AD8B40F7E037E34F70BA86EE 21CTHOM
889,562,593 *5C80B38F206B3EAC41A2BE931A7EEB032D210E78 22111214
889,562,594 *5C8FEEBDB1BC94298A7B6C4DB54A55B7C4947CF9 wwe.new.year\s.revolution
889,562,595 *5C8A31942A0A9C945B1A8A27F66CC0A14A0E0C8D [email protected]
889,562,596 *5C8ED92B474AF079D83F0A49F11B18CF22CDB747 2459161 DAS-GESPRAECH-FUEHRTE-NADINE-LANGE-
889,562,597 *5C8A5D2245D6DBD5461DC8E2C54C840108CC9605 X27437
889,562,598 *5C8AEAA6BB4201B8E54F5888D7A16028F03CB0E9 xak3
889,562,599 *5C8E8E0A28A9911820BD1743DFAD141BB6DD2CC8 271695 joukkueet-kisailevat-sporttiviestin-,-jossa-ovat-esill
889,562,600 *5C8A4CC99C17D3FC45D292F795AF9BE438C0F603 2717568 ausserdem-gewinnt-er-das-grosse-euro-spielebuch-
889,562,601 *5C859D1AECD62EFDD6ADE8E49882DBA1FD50009E XHANNITURA
889,562,602 *5C82BD9BA21D669FD439BFD5291474634C4911F3 XIAN.IRA.OLLETA
889,562,603 *5C8FEC9D238ED860023D8B9AF2A607C3546CEC21 ximonne-xygrid-m-s
889,562,604 *5C880AB412AE45776B24E8BE4CB7E5841BCE59A4 [email protected]
889,562,605 *5C8E546CFF19B8E0A8D31845CBB9F13D9C69058C (x)`q#####B
889,562,606 *5C82CC6C1FDE222B1865ADA27C22278352EF7767 YABAGEDO3
889,562,607 *5C80B4DD2AD2D3F2F969D60531B445D265ED7742 YADIRA E DE QUIROZ
889,562,608 *5C85B89FC7A4CB70109584DE41CA0F684D588AE3 2.KUKKURAISTA
889,562,609 *5C85B1A401E5569D43EADE3647AAB4493CE44CCB 2-Left-Legs
889,562,610 *5C88F78532C0888D0BE43296A0336E5561E95D64 2magneettikentt
889,562,611 *5C886EAFD85CAEA0CAFD48128CE278E89B8CDA3D YOBAYEMI
889,562,612 *5C86EEAF366D344BB04985C6F91206B6577482BA yokawagih
889,562,613 *5C8E111B0EDC7A7998B0A54F1BBD488AF026203D yong-min-aun
889,562,614 *5C8CE8E3D301168833B284F4FE2152CABA4793CE 3B<- * * D======P
889,562,615 *5C8344C427DE6F39A5A9967916D619B7B7491283 3b<-o~0~d##q
889,562,616 *5C832F21F6458A37C9892522CEDF779598C839A9 YOVONNDA
889,562,617 *5C84655AA6E315A135DDE6E922D7C6743C22B0BD [email protected]
889,562,618 *5C80EBF83E729B34AA6C1E15CAC410300F820898 3-lasermiehen
889,562,619 *5C876060890BD2D15A75DBBF925ECCE3057FAD2A 3MHZ)がある。
889,562,620 *5C8A00EE91D2548A4FCA1CAADAA69BCEA4ABE61F 3NSI1IN9
889,562,621 *5C8AE1EE7C797DF802F9BB0FD5AA4AE6C58B0416 3rd.base
889,562,622 *5C8F16E5AB6CA7E92CCE0D9E83B3BDE5BC931E80 3-[[user:kalki|kalki]]-23:45,-18-september-2007-(utc)
889,562,623 *5C8A341BDBD145E0AA0B45ECEC23F9A5054E0877 3V0C40
889,562,624 *5C8A7CAE9B70AC21A66BEBACAB2A86E8588BB3A5 407941 ERTUTESNOCH
889,562,625 *5C87A29590F33915991C7A318274592B9A0B6FE5 472KENYON
889,562,626 *5C879752A583F60E38A9DA664271633C335FE5B3 488053 markthemdownforhonestmen
889,562,627 *5C85DA4A531874FFB56F5751D7F95BE2940620D1 4ABENDWIND
889,562,628 *5C8F54ED9847D0DF98535B8128AECF5ADED95D30 4KOSZMARNE
889,562,629 *5C8615992BAEE597AE9DB9B7C2755EBF5C3568CB [email protected]
889,562,630 *5C84F21EE5D33E690E6747B68DC363443BF51838 4NAISKIRJAILIJ
889,562,631 *5C8E773BC06DE8FA8C0EAD691E5F508582009EFE 4POTESSIMOS
889,562,632 *5C86071B8F3BC2FB56F0C6DC1348AA64EAB7065E 4SIZEBODYBOUNDLESSNESSBREADTHBRING
889,562,633 *5C8DC6DCB438B44B6C0D53027D1DEA4C1F6FBA96 4STITCHINTHESIDE
889,562,634 *5C8320EAC0F0DD0448887983C1ADC1266EFB7C5D 528ANTHONY
889,562,635 *5C894706A7648885105B4F0748664E774828354B 570600 '-schoepfungsverantwortung-wuchs-von-unten-nach-oben--'
889,562,636 *5C8A618289835E667C83F04B7222D90AA8A12510 АMALUS
889,562,637 *5C80AC3EAA4CB31AFF905ED57908426DFF123282 бакнанг
889,562,638 *5C8A8A65D9AA3C31497D97C2FC15DE61FAED80BC «ВИБРАЦИОННЫЙ
889,562,639 *5C88F961BEBC53DE66F8C29DFA28F1C15FF91636 ВОЛЖСКОТАТАРСКОЙ
889,562,640 *5C8A64C5FFE1BE1D3E0EA14CADE42D78D179969E 5BSWROTHENBUHLERB
889,562,641 *5C8F87B33C868403805180FE34444A3B155BC267 5BSWSPROONEY
889,562,642 *5C89C79D5E9C5008B2B49A0F37390932BF595519 5DELSTENEN
889,562,643 *5C86DE61ACB5F0F90E96CCF4C07B221325AE30C1 5DOREENLETTYUNITED
889,562,644 *5C8887977F987533A6E3E281235A509B91AE8D48 ЗГРAБE
889,562,645 *5C829275EB3FE47BAB804EDDE004EE9CD565E2DC 5FICTIONGALAXY
889,562,646 *5C8984F5D65A8D7EEAE7E384CF6D0ED8DD2AFA3E 5HARMAAKAAPUINEN
889,562,647 *5C805EF4E909768B6BF223B7373F4E1C19EBAF95 ЛИНКОЛЬНСКОМ
889,562,648 *5C89BE9644DA78B9585291C97114946DDC49CF84 ліхскім
889,562,649 *5C848F7A1DB863949CBD5CC1CBF015A7B0165306 5iamstrat8
889,562,650 *5C86718D7FE5C733CB32AA4D57C14E4C74AE2161 СООБЩЕНИЯМ
889,562,651 *5C8621C5E129ABA5C6C0F26D801B26837E30B93F СОПУТЬ
889,562,652 *5C81D9437F6B3493ED1EA1D3A5DF7B677BD1C5CB 5overlittle
889,562,653 *5C85A665EBB418DF2E1FA68EA321C03888D9810B 5THATALPHA1
889,562,654 *5C8604B81145675DCA5C159DE38807F1F0A2207A 5VIOLETVOYAGER
889,562,655 *5C832BA793C76061ADC2C389488927A00EB7A714 66-kermit
889,562,656 *5C8A994680EF5197B434BDD9AE62E832A3BBBE3D 698804 niyazi-biCak-10-Subat-1949-,-bozdoGan-I-.-t-.-U-.
889,562,657 *5C834FD972FB5D7F8662FA226F94831E9765FA1B 6BSWBUKOWSKI
889,562,658 *5C8B56BA8EFEB54B95CDB8320289F8742DD9EEBA 6BSWCONTEMPORARIANISTBSW
889,562,659 *5C818261DC4E24090F1B1C833BA2829CF9059486 6BSWPVMCLEANUPBSW
889,562,660 *5C8C2F0C7C953990EF264D828A2CB830E5BBD7B7 6shooter,6strings,6pack
889,562,661 *5C86B2CD3A94D2139731FB4F9003488A7AA72A0E 6TAMATAVE
889,562,662 *5C88CA62D906D02B5D9E0212808E1D19D156EE13 7.4CONFIGURATIONAUDIT................................12
889,562,663 *5C8F8B83F821398E9CF2680C2671506755EDA006 7ALEBUNG
889,562,664 *5C84A88D0B177DE826B37F2766E51C60AFEECDD2 7BSWSTISUNBSW
889,562,665 *5C80D849CF6BD08CBAC06BBE7719923216852D0C [email protected]
889,562,666 *5C8755869AE67CEC01B70E544AC8D8A2FC3F5378 7-torshi
889,562,667 *5C8DE2B8EB20BC1D36DC2E49F237834F4605DC5E 7TUODUOYK
889,562,668 *5C83C8745243E7E0D2E8DFC0F71D4542ECD40FCE 80x25
889,562,669 *5C810DF299274FC7EE1C814BEF74E8239A428706 (00).0~.Q8
889,562,670 *5C88D770F17356F1DD750652860FA199B190CF0C 8-bit-(mes-world)
889,562,671 *5C8614183CBF8D2205D9BB48AB7E2C14F9CF020E 085MILES
889,562,672 *5C8959D084A61E0695FFAF73EE6902BBA00B6B25 8FREIGHTTRAIN
889,562,673 *5C806659CB314D3C422C3B4B05606E928B69B3CC 8ILUVSTELLA1
889,562,674 *5C8F625C02AB5322BBCABD6B633FAF92E9C3F35F 8====).~O:P
889,562,675 *5C8D013BF1C159B73CA94AB810DF57736557F8F3 (100-PER-&QUOT;RING&QUOT;)</TD>
889,562,676 *5C88B4343FCF83A69CB26DD563A023D02FD51D07 11.aminoasitler
889,562,677 *5C85470EE93A3297C04B8FDFAA94068CB392DBD3 131112 yritysten ja sit
889,562,678 *5C8F2549C5A4DD7FAC848ACAF55F36453AC0D421 1323701 damitseidasbuendnisnichtaufsspielgesetztworden
889,562,679 *5C86A25BED1A37B20FEE920449AAA528F1751817 135MARCU
889,562,680 *5C8E17C69028F5163CA88B13FF7AE3F9347EBB85 14-produktivste
889,562,681 *5C8C3703055066C541EC7AAC2C18C25260D8592E 9405e0de1238f937a15754c0a963948260
889,562,682 *5C862A00E1CDC8DCA06E15ED82611E96E8F5DDBF 1885793 es-beginnt-schon-faul-.
889,562,683 *5C8B025FBD811F69B3EE62C645196275250A228D 18-fleshes
889,562,684 *5C8CA777DE288145463E091EEFCDB7BBE10836D8 9DEXTERSNIPER
889,562,685 *5C870E4883137B25D9DDC97BC49B6D636EB2E2FF 9EUROPHIUM
889,562,686 *5C86F55A999626118BBAFCA10B06238A39B2DB1B 9JUTTINGLY
889,562,687 *5C803F6A73E33F12B76FA2884BF8DD7BA3A06D87 9NETRAGTS
889,562,688 *5C84634D5B93CEFD172DF6F2B17A718159AB9CC0 9PASSERESTI
889,562,689 *5C88295DF4A156E898EF17C1790EE18222F8C45B 9spating
889,562,690 *5C8BC34E8DF5FE9D865137B8434321E100209B8F 1.inhaltsbloecke
889,562,691 *5C85EB6822F7E94C880C5132FBFBC524BAB311B8 1-isletmenize
889,562,692 *5C84273113DBEF17A1FBB3FD91595592861283A4 1JUNE1635
889,562,693 *5C82D20A5ADF6A367A23193E97F453719ABA4C41 1lukijoiltaa
889,562,694 *5C8C62D893EC1146A96B52E6CB44EC75D2C9608F 1nitzia
889,562,695 *5C86BA0EFB93607B264D8890774CB94061F6BC90 1.oeiag-anteil
889,562,696 *5C8FAADFEEB707C97D1B5A36391588A2AD130A52 a&?6g
889,562,697 *5C807726804BACF30E4B6A9B1930BC3F9ABC7EF8 1 streitz
889,562,698 *5C8C9A32C11740AD7B688F0472A91B1B40AE29DF 1-warnes
889,562,699 *5C8824A2776B6761D38C8D6514AB0D6B0A472B2A 1-woelbungen
889,562,700 *5C89E46CA0F548384B70BAE73F772CCF2707D8F0 aab^s]
889,562,701 *5C87D7E5C77772313104E31ED8C88CB7356A6812 205313DEV
889,562,702 *5C8B5DF3C6BFD32940228A19FA94BF1407C960B1 aaji|
889,562,703 *5C836080951937E87265337905B70BDBA217705D 22PSTER
889,562,704 *5C8B4EB721B2AC8BF9C72BF3824D7F261D8278AD abac
889,562,705 *5C8EB1A245F7AA88D501A527629E8CA0377E60A6 ABRAHAM-CHICA
889,562,706 *5C8DFCA0AF999B8E27181D1DAE499A4CDBFE9F23 ABSOLUTSOLEIL8
889,562,707 *5C86484D7FF6FB803FC8DC784E622E4D33ACE51B accionadedicates
889,562,708 *5C8FA955C93C964F352075F8B0F1D021378F8602 accucciolo5
889,562,709 *5C816BCB7E7650D0002B22D821A6D5EF2E6C6CDE 2ADGINTEL
889,562,710 *5C843ED08BED4AED83E4BD54E7B86FCA174DB14E 2BD5C5D2-3615-3561-B292-DCB795DD9772
889,562,711 *5C8A8FACE23334E2D294D31C843F9E4C13F442C5 2 BUYUKBAKKALKOY
889,562,712 *5C865F26FA5C86D942497D4213B6F1EDC78B3749 acqa)
889,562,713 *5C8C8EE59A49D1800DE20FBA6E9B955216938F43 a,db4
889,562,714 *5C83698A8CF320C58FE9F1AB87EA6E97AB394680 2MEKSYK
889,562,715 *5C854E194CB767AE218BFEDE1E8C9BBBE50BFA25 adw6
889,562,716 *5C8F1467F1A5A793875665E108984C87F4B7F374 AED9.
889,562,717 *5C88CFF55A309376B97E2D99456D859B55EA58AE ag7(p
889,562,718 *5C85B767A9BBD6F1D20F0442823A8DEBF938297C aginius8
889,562,719 *5C82A3D169F583DB84F5A6E6B92F640C82A891C4 AHMEDBODWIN
889,562,720 *5C8B919D7CC39ACCF4C9A0740E3939F888B5BD5A ahtisham.malik
889,562,721 *5C8A20721B2B1C67EC00B88BAE59A16091D5DD34 ai,3g
889,562,722 *5C853DD064373F9A590A6DF5BE1013D5BB1E6DA4 (ain'tthat)justlikeawoman
889,562,723 *5C86292307FAEA87E1AB9FE279909E5295F4816A 3NF3IX4SS3S
889,562,724 *5C8C71F418F107B1754C70864DBBEF1C2A1A82FB AJCDT
889,562,725 *5C866E2CEFDC2149627FB5C135FD60E6AD8C9CE5 3==p*-*)o(
889,562,726 *5C8DBC43279894C202745CB4DA3A476BCFC3E445 420939 OLAYLAILGILISORUSTURMASURUYOR
889,562,727 *5C80B6F5E2EAB0CEF662964E0DA5CE9A7EA46320 47643 aileniz-iCin-yapabileceGiniz-daha-iyi-bir-Sey-olamaz-.
889,562,728 *5C8E8AC78B070B59DD3B02200597570A250A13F5 alexalevy
889,562,729 *5C87FE00DCCDB82EA23E2BDE3FCB9C6D2E6BE595 ALFREDO.BARNHILL
889,562,730 *5C8CF019B54A91D3F740059DA4DD4D1AB08FFE02 4FITTERMAN
889,562,731 *5C8DA37913187CA3DBB97A011CD738D15B3C97F0 ALIA918
889,562,732 *5C89550D088B14C063462EF945627354B8806F66 All-Creation-Wept
889,562,733 *5C80C1373CA940D4C9039A44D7B55D56D6148C25 ALLUMII2
889,562,734 *5C8058142E2C2E357A63D3ACF057DF5E70083E5F 4NAMAARDU
889,562,735 *5C82349D80D83B9FDA26416F9E367128E18031E7 ALO(WALLSOFJERICHO)
889,562,736 *5C8D235E20AD0A4D4CA63603293A0B4406CC9845 4SPONDYLOTHERAPIES
889,562,737 *5C8F5F065AC0A31D985084BA2AD4FC6F84982CCC 4STATECANTONCAPTIVE
889,562,738 *5C8BF115679098A41E5331BCC6763A706999F4BE amczq
889,562,739 *5C8983CC74B811054D7B47E24205554EA4BF10FF 53RIVERBANKRUN
889,562,740 *5C83259B88B666DC8534D5AC35E454B85B0C2498 and.a-begging.i.will.go
889,562,741 *5C87CFA36377FFC9C0235AB8DB68890E2BFD4962 andhika-prasetya
889,562,742 *5C88D46EF97D171EAD85272E002CC2941DAD887E 574G1Y
889,562,743 *5C84A10FAB34C4AC4B6CF77608D862B6942AAA58 5.AIRONET
889,562,744 *5C8ABB127DF63CC14458110D2561241AF7F7FCF6 and.wears.upon.his.baby-brow.the.round
889,562,745 *5C815052B408920EDDDFAB3FA21CCD814B74083F ANGEL.KEGERRIES
889,562,746 *5C8BD3042352B45F074A13D2965A245CFF86ADF7 animalvictim
889,562,747 *5C8BBF5A3E1886816CD6B424D0BCA4082C03B6D6 A(+O
889,562,748 *5C8121DC5C0C2658C3AC47AA8FC93C453EF64100 5OMAKUSTANTEESSA
889,562,749 *5C833556163AF0E39ED7DB6046F21A49782997DA AOMN
889,562,750 *5C8D9120B4BC89AB1E07CE7C449E9A6F097DC4A8 APOLOGIZE.GHOST
889,562,751 *5C8E23419364B37FEF250BE6E1B5818A2C35CEC6 ar).+
889,562,752 *5C8B49464555562D7EB6DCDD8E56F715E5B60DCC 6ANGELASTEVE
889,562,753 *5C89CC14618EA44B919018F47459C58E27DDE937 ARIEL.SMELSER
889,562,754 *5C848689D653E846FD2FE1B2EB8B669895A0C586 ARLANMAULANA
889,562,755 *5C84A2487C3B8EBBFCCB0598469EDF9DD352B674 ARMEF
889,562,756 *5C8E187B56D9CE7325AF42C433370474CDC2DA06 ARNOLDFALLOW
889,562,757 *5C83FB168C10108071A7C9E990AC853DBA0FABF9 AROVIGUR
889,562,758 *5C8A02BD8E2CF513061CDA4479195285E8DC3F31 a!+s,
889,562,759 *5C8D2CD65DFF4A138170FAB09C55B37E44CFC4C0 6KTORABSW
889,562,760 *5C899A0BC592E542472B098B2AF52AD573AC2091 as"aj
889,562,761 *5C8ECEE723C84FEC4B36B837F69F963C791E0C67 6march1947
889,562,762 *5C8E9795E54CF7AE98FC1E7C670EB3C80E62F563 ASea
889,562,763 *5C854A38E774EBC5ECACC2ADE72FC818BDE56B39 6PROGRAMMLOGIK
889,562,764 *5C87112272B1E34942156884FE31C653F1E10263 6SASSYZEPPELIN
889,562,765 *5C83672E50FFF5A69D86995AF2F7BC1A7CA3E1C4 6SNOIGATNOC
889,562,766 *5C8BE025BDBE8CEB7D202679FD9C02BAD5BF5377 ASTERSS4
889,562,767 *5C8D0550E2834E3354F07DA9108B5541C9F1431E ATJRB
889,562,768 *5C80F02BCEEE4B34412A61D4C2D1ABBC45525571 ATPNL
889,562,769 *5C87383D12B337174C7E6E4AC7CFE0E7C98D2BC6 ATTRIBUTIONZAYZAYEM
889,562,770 *5C84AD42B77ABBB27087A19E60576FFF1F3D525B 7ACUATIZARENS
889,562,771 *5C87557E5567132F9415A1302CECF284B80E3A8F au?%$
889,562,772 *5C88E0AD23C6BA9CA613CD2B8B9304773B4D6E40 AU1AP
889,562,773 *5C87D7E09D27D9427429D61E2CB3EB43E5BB6CFF 7HARVARDEDUCATED
889,562,774 *5C8A9E6D7225E00366853159EECD71AAD604AFE1 7LIBLABSES
889,562,775 *5C86E7CAA2A847AF7249C8B36932A6CFE53CD69F 7MARYJANEBYTEME
889,562,776 *5C84B172B086E001D5E79A3963C04B2B5153857A 7OLISHIA
889,562,777 *5C8F56C572F52DC8E93D8EB44A7E6338FCB1B3C9 7OPUSSAMPLER
889,562,778 *5C8FEC1EAD841DEA9A2C0C1E7B9FF1F2C91B81E9 7ornitholog
889,562,779 *5C84076E31A99FA5E09C7CADE13C97173F201718 7SHELEASA
889,562,780 *5C8EEE49480DF26AF62198645907E5E97EF7D797 7SNONNOVA
889,562,781 *5C89DE103A44D5B5E785E5A0028EA8397B81F526 7taxidermists
889,562,782 *5C84FFC96E21A74D00E69ECFB86560C3CF6F50C6 azjnm
889,562,783 *5C89F6794ED77506281A6D1D7E7E2A79D7843D0D 8/20/98-gj-at-66
889,562,784 *5C870EF3EE80D63F6B529B229543A82AD4EEC9F4 b==)~~~(0_<)
889,562,785 *5C8E19045EAD6559D9B84821A9BA1AD632910D2E b0gcr
889,562,786 *5C82AC5098FB9A16D334CC114AE07E06370D65D9 8CATTANT
889,562,787 *5C84592DC41BF89D64ED2F85C9A1B883010F9DC7 B2U/D
889,562,788 *5C8C1CCD809C96C65D5E13757AADB4B548CD0A48 B4N41T35
889,562,789 *5C827DF130F1297B1111501FA3B918A3E19E2526 B4RB1T4L
889,562,790 *5C8E7435D6540B7A243B10A11C7A0BE7B939C14C 8HEENVLIED
889,562,791 *5C83A19064B4C5663434D9B9482A1F9A41161FFF 8IMONTHLIE5
889,562,792 *5C8D4AF20B793806A71AB3B9B67CCC88D375E9FA 8KOALARODMAN
889,562,793 *5C85011C94E4C3F9E2CCF6090DD645058658C389 [email protected]
889,562,794 *5C8016C4143FEAD816362C60DB76C4A25622DF35 8MESINGER
889,562,795 *5C82788D8EE3B331513706E02D555C34E1679673 b8"!f
889,562,796 *5C8014C301BA27A9E2696DA26541B7D8CF7F1F13 B8GF6
889,562,797 *5C8E60F8D3CFD14480A91E301C9FE75B2159171A 8------)~O~o)O(
889,562,798 *5C86CD241AFB8DFA9377E9B67271702EC49C7B8F bandera.de.la.mancomunidad.brit
889,562,799 *5C822A7C35DE51E897AF91AA0FB6C5542F05B256 B#ANU
889,562,800 *5C8D1F7A6D9B06188773E83C80737CA3EBE29327 [email protected]
889,562,801 *5C81726667AEB833848C93BF343524AE9B31EF1E [email protected]
889,562,802 *5C8487C0B642541E67BE630EB2E4ECE80DCA5901 BATOOL.MUSTAFA
889,562,803 *5C8D52D94F8737870A2154D2A1FBE67D0A7604F9 963098 theunitedstateshasnodiplomaticrelationswithiran.
889,562,804 *5C85A8657F47316ED700BBA0C5B6983BD45A878B BB4L4KR1
889,562,805 *5C80475B6030D76788F3031CF98417A3E9D41A73 [email protected]
889,562,806 *5C818378DCC757B2E4C606CC98166D9F1E2024D8 9BASTICO
889,562,807 *5C864C9B1D2C1FFD30A6E1D287AD1866355AABED B-B-~O~o-(0-0)
889,562,808 *5C8004D871A1581D1D66D9AF05F3F7559DDBC43E 9BITUMENSES
889,562,809 *5C821D51199C3F907ABD8355AD655151A24D8CDC bc1hk
889,562,810 *5C8E769222F1A303862DD2D070434879D9A68FA4 bdccl
889,562,811 *5C8FDA12DA2203778C697390AAF426257BBA5B8E BDI.F
889,562,812 *5C8C93E73BB89A41A9A652AEB62BBEFBBAB0285E 9mysimple8
889,562,813 *5C86F8DCE24237ED0A1733417F9CFC747BEDE2A1 bennettcappel
889,562,814 *5C8D6DD7DA4531A83DD7E72965448B80B42A6F94 BENNETT.RIESLAND
889,562,815 *5C8DE04CD9C8934B8265407F4D6B181A6AC852A3 BENPOWDERLY
889,562,816 *5C8F6F618E2DEB7E62637B5DD3DABA1447BEA2A8 9RCNDMNTN
889,562,817 *5C8221D2E41C8431B1226066C807DB353D0FAA05 9REDDOGHEIDI
889,562,818 *5C8725F98F9EBB78D48454368554801A00F5CB1B bereichs
889,562,819 *5C8AA62F122A607AAAED4506F29CD9AF23432979 BERTRAM.CHILDS
889,562,820 *5C82D6807D26F3F712957B8BFB17D80A160B498F BERTTRINKL
889,562,821 *5C845AE1C8156CE07F32B6D71EB85804EF937C96 9TNEIAREGORRETNI
889,562,822 *5C86997BD967C050A1766DFA7BEDA6ECBDF1287D 9TTSCOLOR
889,562,823 *5C8CAE5445167F3DF866E85B14C704CA06A58043 BFh7
889,562,824 *5C8839DE98FC6C1D1C819D25C4294D3C66391A21 b+g3m
889,562,825 *5C8BAB420B3BFA5967AF8964DB87EC48971EC85C BHEUGHAN
889,562,826 *5C83C0B2F059191A85CA399C8EBE0011F8E1CBF2 a4ul/
889,562,827 *5C84C07543C0523C5A152411F0AE2C83A983B612 a6=n)
889,562,828 *5C83587ACBD042F5EE35AF3B625CEA1FE6D2F338 a8b8b
889,562,829 *5C82A8ACBF80F3786FC29F7D0C9102C81CFDF5D6 AAA[X'
889,562,830 *5C8B0C7566936762D8FC19E412C35D2926EF1D7F aaec|_
889,562,831 *5C8B385183CCA6CBFBD08BE9BF71CEC318218828 b),"n
889,562,832 *5C828E683CBACDED72A238C28D759A3C1E3D5BBE BNJMH
889,562,833 *5C8F3BD21D6025600ABE8053A33B128D2B51DDFA bogoslov9
889,562,834 *5C851AE5B8E5586112197581F06E68D54188544D [email protected]
889,562,835 *5C8C89A4870C2F8420A157EBD9532F64186891A5 BOLKIN.1.0
889,562,836 *5C8AB8C22E09B15BA0767041300A67078F956456 ab#;g
889,562,837 *5C83B92C45E20937446928FB978F56805F5C8C54 bo&ot
889,562,838 *5C8F9D7194C21C8CA520D14941E646D9A6152C5B aca:m
889,562,839 *5C82ACB412E06C247E95B130B6F07570A728B23B ACCOUNTING--GOVERNMENTAL
889,562,840 *5C8D7D036ED0A3477616A1297659D81BDE0A11E7 BRAMKALAWAN
889,562,841 *5C87B848FFAD9BCE7C2D9D20431F3CA29A0B6213 adrianbalderas
889,562,842 *5C86175F094F3E7E1A577CDDBE50FD5647D6F45D ADYF1
889,562,843 *5C89872BDD0C7E2497B8F67DA66D34FE243B6520 ah&$
889,562,844 *5C86E034C48B18EF9CCFE856837F96F61CF3F621 [email protected]`~-`~-SPLAT
889,562,845 *5C8832BD8187D903FC3AC17C0A70DEF47D5BBC55 AHp,
889,562,846 *5C8D5A31346FF54496A5C24755FAB4BF8C91B243 AHUVATAI
889,562,847 *5C8D43527F0FE796F94BBF9A9003E0D332205B09 AHVTY
889,562,848 *5C8915D2B0A8D8E51B9D26538F65999BC0B104B1 buggerating
889,562,849 *5C83E66ADFB4A72659B9BCE598013C863553C5D3 BULLINK4
889,562,850 *5C8D6A37EDACD9F2D6F304AD514D330B36E6FF90 [email protected]
889,562,851 *5C88834FA6B29C86C20172CA6984786DAEA16B4E burtonburreson
889,562,852 *5C84FB0FC97FFF21D43C9EED2BEC317CAB135ACF akeynote-1-0
889,562,853 *5C80A025F47E63931F78E20063D330672DF6FA2D AKIDOJUDO
889,562,854 *5C8A1030619CB03A98587B7ADE2587632CB35B99 al/+a
889,562,855 *5C8AC225F892C64E11E39AE97DC847F9BD76A92F ALAN FEDERMAN
889,562,856 *5C8F0E1F8BA60D544CF91810FC5218F93A63142F BW+e
889,562,857 *5C896524461C5106A9FDC3BC241440109A49FC9F ALEXANDER.SHENEFIELD
889,562,858 *5C8C0DCA38EFD51CB5B1373692928682DBF018AC bwoh;
889,562,859 *5C8FA4A94EC274DF39DF57B7795821C756A69696 bwzhc
889,562,860 *5C81F103AD25930F08A1590D90D6B7984B9C26DC で、セレクト・ショップ「almond
889,562,861 *5C83E67C6C1F2E95A571500A34A90E59B8F97166 c0nc3p+u41i$+
889,562,862 *5C8E2BA311BEF084D3EC8699D71BE144A8955253 ALREDEOM8
889,562,863 *5C8222C96D2C384665A5AF74D2A900033C959B8A ALVIN.MARRUJO
889,562,864 *5C809E2660258DF082D247B84FC981B910807513 AMBER NICKESON
889,562,865 *5C8C55F21463309D3854D3B09BBDF8BDE531C94B AMBILATERAL
889,562,866 *5C8AA6DC7FA48F37C0E35A1204BB27C94A15EC49 c7mql
889,562,867 *5C8B95E5A40B4EAB90469EE46275256465DC28CD ca3!j
889,562,868 *5C849D0BF81328C19A72FA64BC3DD0B7E25A3A7B ANIBALRIGHTHOUSE
889,562,869 *5C89739A09EFDF4AED369E3D53F3703FB9F05459 anlouising
889,562,870 *5C82EAFA16542403F58EA0C8C0992C4ACDEB0EEA calosa.shop
889,562,871 *5C8AB7255E2F181B174B7D8AA8905D5207F0ABA7 CALSLAB6
889,562,872 *5C8C825FDAF3E28074648B85C030CFC0BE1FDB0F CANDACE.SPINKS
889,562,873 *5C8EB4A7F83B39B692BC7E0B8C650A0E270FED6A c$anm
889,562,874 *5C8817493C7D844226E8DFFEAE1C7C0A005478DD [email protected]
889,562,875 *5C860A6B25FFCCFF33CA01F032BDD6660918F17E A%q;
889,562,876 *5C85477AE2748F9B13FDDA18A1BEC4DBC320B200 ARA
889,562,877 *5C89286B73FEEF6284A85E490D2E59EB1E55FF2B arlenhomrighaus
889,562,878 *5C8A4301C16FE69ECF506F50051BD888EB654307 arlenkampmann
889,562,879 *5C8056324E1D995A26E5F72F13B432F9173BB468 cbi2!
889,562,880 *5C83B3C29AA1757089DF3BCD2BCDAD9798EA6719 CCROC
889,562,881 *5C8ACF89AEF87D622352581F8A3B267499CAB1D5 arttrimino
889,562,882 *5C86C8574BEE36AF86C1D9DF306FE7A7CD185D5C aryngites
889,562,883 *5C8646120B87B91984F0C3B50E6E2C2600BCE6C2 CE1EBRTES
889,562,884 *5C806F8904A5EFAFC26CC3E6E2C878DD285D98FD AT.ARCHIVE
889,562,885 *5C8AD4DC56E325ED72D12BCD9580362599B33E77 atf2f
889,562,886 *5C82C7883E4B75DE945E52E4D150C924EE6A212B ATFO=
889,562,887 *5C8B90F5625B982CCB8D7F7E154DE63FB336863E ATOMITUTKIMUSKESKUKSEEN
889,562,888 *5C89CF18B894D857D4448A330D088947F730C16D a)tq8
889,562,889 *5C80172A2233E5E05FB0CAE111A5515CCE164682 ATSOLUTI6
889,562,890 *5C8588C6A6F575366C1C69CEE717893CBC87B7FE cf.;b
889,562,891 *5C80FA6B74E26163A7163D44F6C3396F85F2FDBA cg,8!
889,562,892 *5C81A75BF4CE5BD7362740CFA69D731A66895D6C CGGP
889,562,893 *5C8016D4759EA52272D69B5CEA18EDAB14E7DA31 ch;
889,562,894 *5C80786E60F7C1B91CCFCDD80B1EE9A88E1579DA [email protected]+5
889,562,895 *5C833DD14E7A023A93C56683989C409D08D96E62 chadscaiano
889,562,896 *5C846B92D374059FE095686BA080C950ED4EE14A chameleon./.rambling.sailor./.la.sansonette
889,562,897 *5C89CA2AFB5FAFEF02063F40EC72D188A8238A1F avig!
889,562,898 *5C83ED17B26A25CB3C58D52B8F668DEAE124E7B4 CHARCZENIEM
889,562,899 *5C8196865758C9E6A26ED06F6B173A97D28485FF awqzm
889,562,900 *5C86BB952FFA9866C6BCC0DB49AAEE75FA6A31C7 ayugr
889,562,901 *5C852E52494AD7476845A3315DE659167BAA2A5D cheweler8
889,562,902 *5C80A42A92C3588EA4D7C3AE5BE45F8BAA5C8FF3 azuli.presents:.space.annual.#1.(disc.2)
889,562,903 *5C833F9548EB153787BC96EF1A37CEC50161870D >[email protected]
889,562,904 *5C871F1CF4912B7FC8ED754C8AEC1CDF212104E0 CHRISBROACH
889,562,905 *5C88ECECD5BDDC95D0992E231B5F644D6D518793 chuckpallino
889,562,906 *5C8B2E9A8B8836FFC217D19D17E2992418D3F493 B?5m
889,562,907 *5C8F1CCCDB6426B24342CE9F8D9202844B3A60E7 CICIRAGA9
889,562,908 *5C88CF98FEFF581FB23EE370EC9357BBC80FA01F cimenten2
889,562,909 *5C832E82B84E809CC7FD9DF14F160945A17995BA CKRENISKY
889,562,910 *5C82CB1381C4F4099AD177857D7BC2FE6A85253E CK_VM
889,562,911 *5C8ED6C15173D33AF126842D88105495248DB306 CLAYHEIMBAUGH
889,562,912 *5C8F8F71F70F06725963C66614AC0CF7103F0203 CLAYPOOLEFORCOUNCIL
889,562,913 *5C81DBA833AB0DB47DF4981C8A5DA087ECAA732A CLAYTON.GUCMAN
889,562,914 *5C8FA3F6B1B2867A25DDA620B92367320A5BB3C2 [email protected]#
889,562,915 *5C87EDDC49228EA7A9C215D6C9EA8DA7F0397143 bartonalameda
889,562,916 *5C840A5BC833D2F7E6268E5F66882208013D4850 [email protected]
889,562,917 *5C8285E9112E10E1D8125CE8FB6DB35C3BAEE771 CL_;I
889,562,918 *5C88D34C6C627C0556A3C7EF1CFD006B247C8F87 commercialiserais5
889,562,919 *5C807B15A7F75899AF70E1E98036D49258F7F5A6 CONGRESS1234
889,562,920 *5C8E9186E8A8BDB89ADC10EB8EDBB6201969EE3A bentonyarde
889,562,921 *5C80696F13FA0A0C56C36F3954B36E47F0DF639E [email protected]
889,562,922 *5C8B7B454547A6F446C48219D802AE4E3C652647 C%&OR
889,562,923 *5C84202818A4DEC54BBADD41DF11741443169C8B corru94+on
889,562,924 *5C8123188E2480BF97B35FF501C0306218F484F5 CPfW
889,562,925 *5C8C85BFADA67FC1535D5C721464C1D31EB2D64B c:\program.files\codeblocks\share\codeblocks\templates\wizard\plugins\wizard.xrc
889,562,926 *5C84B15E105FB73D1B3CF124FF0F79C657E69B2F bi?3e
889,562,927 *5C89162F9E642B0A2BD7912BC919915146379B09 CPVPA
889,562,928 *5C8AA3181C9B6AA680DACCE8D9DCA5AE176973AB cr7"
889,562,929 *5C8AFD6308CFBD67DBA96274D862AA21CE1723A6 C/RG9
889,562,930 *5C88F101F1D509981B934D0D8C4CD9CE46E72A42 cristopherzielesch
889,562,931 *5C8C8352811B639825AFA895009D6C574B96B15D CRUZ.DEREGO
889,562,932 *5C8E325B86C6D14FDA5511210547CEE2FBFF7720 CRWAA
889,562,933 *5C8A9421D9A2DD99012C137E31B1CAB2EF5AE57A CSR=E
889,562,934 *5C8FCE697B59A7D7EF71E37303A7E247F476F81B bo.ew
889,562,935 *5C8BD595AEA710C3BFBA36031A9BB84A61474AE5 borsterses
889,562,936 *5C849221A1B9C0CCCBF592DEA4BEFE1F44873165 cx#mu
889,562,937 *5C80DEF324455CB85E0EB7315D8CB0A630A11771 Bp ~o }o{
889,562,938 *5C887D9B3DBCE22AE2655E76B22AC39E770D1377 d+2lm
889,562,939 *5C8DE51DB0D4A879A3C6FDC27429E2CE33ACFAF9 D3HUA
889,562,940 *5C820BD01AF856014324BA069E8E7FE8DF910DF5 BRAELYN THOMPSON
889,562,941 *5C855F93868F21EBE40C50ED8F4FD96589BE129E BRAINDUDERSTADT
889,562,942 *5C87841D867F61279D1F94059063A0024154D4D4 d3/uh
889,562,943 *5C817490EE9A588DCF92A48865F1058197B6373C D67Y
889,562,944 *5C8D68DC1F4C5AB39333E691B0CC34622B034173 BRIOSCE
889,562,945 *5C8DABED5F620913976FE618311E467F31447F88 brittkoppenhaver
889,562,946 *5C834A39F7541B85965D38015641BEEB2ABD1C65 [email protected]
889,562,947 *5C8692E12436F6512A1CF542E42F04FC58EFDF00 brodysmiles;heknowshisfriendverywell.indycomes
889,562,948 *5C8CBC3A6750A03A92FFED2C8DD65C42004B4522 DALE.FARTHING
889,562,949 *5C8B936AECFE6C401DDF4095DA1AC617FFEEE3CF brynn.childers
889,562,950 *5C8895E8AFF57E13323653F20E7675222E2BC420 BS1DM
889,562,951 *5C87A7A81AC582D265CE7A47812E32B13FA94EB1 DANCE.OF.THE.WOUNDED.BIRDS
889,562,952 *5C8422A5CC9A7B65BEC1A38A3EEE8A0299930215 DANLTE
889,562,953 *5C81E9329F64A7BE7A856E9DEE7586A71CCC6E8C BTTTDTD5
889,562,954 *5C8904425B45134A8896C7E58A0E244D4092F6E5 DAQ_(
889,562,955 *5C828D5AC5BCEEA145017F9E8EF65D713BADE157 DARRON.CORT
889,562,956 *5C8CF1C000D5588A6ED90EA792AF09318540CB2B DARWIN.YOUNGHANS
889,562,957 *5C8DF23E16BD24D8AFE043CA1FEE475C26864DDF BUTBUTITS
889,562,958 *5C8FC4CB272A4E76DA0705CAE1B86794BF635F5D bu/v7
889,562,959 *5C87CBDA08BAD8C4B7BEB60F03829DE21EA8ADD8 BZL/1
889,562,960 *5C8C5B71243F7337415BD0FFDCBA2AC94F421578 c1d9y
889,562,961 *5C818D8FBC8A76D08BEED964008B8E7C4B26A4E2 ‘DECIMO
889,562,962 *5C8C0DBF77F84BC5E153216847F1BD2416AC02E2 c#1wc
889,562,963 *5C853608263D9353FA4C84D75A3C8398223C9513 c4ydm
889,562,964 *5C8F77E20065EF369290C1AC1AC19BC37B2AD978 DELMERCURINGTON
889,562,965 *5C8AC50EF88F5B06C6A5BDAA7C4BA276099C51EF c5x.-
889,562,966 *5C8DA342FBF4A7647336896E00C8641454231E81 DEMARAYCLEMENS
889,562,967 *5C87936111D97003F4106E93A951CE311DF1FB87 de.menton
889,562,968 *5C8959F1ED3527845E80FC998C29CCDBEEF6FD0E demrifnoc-tnediserp-eht-,yruj-dnarg-eht-erofeb-gniyfitset >p<
889,562,969 *5C8CE0AE3B39205E7B16BF8E1FEA1239F0B42F70 c")a
889,562,970 *5C8043257B2EC223C4AA452B4F35AFEC4D07CB00 DEON.MASHEK
889,562,971 *5C8607A7BFD162DEBE4EA9FDC328E23F6D569D2B call-me-miss
889,562,972 *5C8A7B54060A644BA0674A8C1EDC8BAB488EBD1A Camperais
889,562,973 *5C848759D6345DAFEE2C0983464A1CFA00DE418D caparsino
889,562,974 *5C8CFA729EF14186FD48B4901693E12A8D83DF75 [email protected]
889,562,975 *5C8EA9CCEBC62C64CCFA30209000359850C9F745 DEVON.MOORING
889,562,976 *5C8C056B93F3C4D847BDB44E8BA0678531AB942D dewittpattum
889,562,977 *5C8CB7D11CC773FD30123DC3D2729A5E50CAD69C CAROLIN MCDONALD
889,562,978 *5C8739EA1B88C23F2047A4F7BB613BB6112F0156 DFAHA
889,562,979 *5C861E7C88821FC3292F7A2FED8F24EF2376B7E7 dg+#h
889,562,980 *5C82BA9C5EEDFF93ADD384DDAE5BDC5F27C37CC9 c!#d1
889,562,981 *5C8BE8AEA6032283C2E5CF2BFC13C7805223C3D7 c:d8d
889,562,982 *5C8F21D773D2CC7244D8D4CDE8C4A76B6FC2D834 D+J4;
889,562,983 *5C8B06BBB86C38C4F43DAEDCB093E85112A8CC9B [email protected]
889,562,984 *5C88AB0A238C3712898A5AE994A4D2C57C69DC0E c,h:
889,562,985 *5C8D1DE89F2ACDA7C2BB5D9804EBEC1409AA0873 DLSAW
889,562,986 *5C851315501E93343FA91DBEFA4D83F9B8D0C079 DMVBL
889,562,987 *5C82B736CB2123AD27881671F077DAC1D3541E22 CHARMICHAEL
889,562,988 *5C804469F59E7E133745F91702167BA86454F13E chavotake
889,562,989 *5C8062D50D65FAF09CF21F0C952A5F16B6772F53 [email protected]
889,562,990 *5C8A7E9D300491B2F7DC011A79B5468699AB97FB [email protected]
889,562,991 *5C82613A72B3DEC3126C2A927AA1CD84A6E44715 DO0SE
889,562,992 *5C8FCD62980EF9F7C00205D52F39B93B62509A93 CHINASUMMERTHUNDER
889,562,993 *5C8926AB48BF8F164193D66007891E25116D16EE CHINDANAIL
889,562,994 *5C89DCB8E1754532BA076518BC075AE17BC098FE doi101007s00520-006
889,562,995 *5C8C77B0C9A4C4E2017ECEFFD4CFA44EC5DA424C doi101530eje01480
889,562,996 *5C81BF82486164F801E41399869B9F8F8E9C68DB CHIPRIADE
889,562,997 *5C8B0800E996A01EBCF396D6E25D971DD5D648FA CHMF_
889,562,998 *5C8364A7ACCD5619FA19B84E44D87CD4477526F3 CHRËSCHT
889,562,999 *5C86F0CFE1DBCC255A3FE31A5C10405593C97977 christopergade
889,563,000 *5C8C4A5405328BB4B509D9D8EF03804D5CD43170 CHRISTOPHER-MORRISSEY
889,563,001 *5C83DBC17880E8EB81733DB0E719E0639EDB1033 DONTE.KINART
889,563,002 *5C820C51A52CA8BDBEF78293FF58684B8CA4CAED don't.say.you.win,.don't.say.you.lose
889,563,003 *5C837FF6B1EBA1F892D7E7BE1389B11F85F1F6A0 DORSEY.HORSEMAN
889,563,004 *5C88D9AD2DD5CC2B370135205141B12D41C5ECE8 D/O,S
889,563,005 *5C80923598656371C7A9E8462C022A696A9FBF00 ci<$
889,563,006 *5C86FD6694479447AE4EC76765D2CC5CFBCA3FB1 Do-You-Like-It-(Futura-Vox-edit)
889,563,007 *5C80C6F3FFB299FEA5F77096643C473FEC993FF2 DP3PA
889,563,008 *5C82E824B9F6E1A68C97515CFB1057EC92B4799B claire.bower
889,563,009 *5C896B8B7A4B54C5637D5094C0C3BAC408833DB3 DRE4D!N9
889,563,010 *5C83BF131D3B4BCB29810F0D0C1B9D1126CF1E13 claudmondesir
889,563,011 *5C8961FB41222FFEA963FDE187D43D303A4237FE drq5s
889,563,012 *5C8FC8D9022E48F75535F966AA28B5417C16AF86 CLINTONPINTEA
889,563,013 *5C8D1607811BE4B4F9C4CE18A69A2BC5F6E563E4 clpm?
889,563,014 *5C80D20FFFB19BAE24E9759E9F3CEE362004E72D C)M$)
889,563,015 *5C89601FC096F822A588AE122FEB37D4B26405B9 C(_O!
889,563,016 *5C82DCC6D5EFE55594C96045FAED54C397D8DDE5 CO8NY
889,563,017 *5C8D82EF46C620A541B5CBB1427FC11CE6FD26D6 COFN#
889,563,018 *5C82064D0F35A140DDCF8A2BD14619D0C00C03DB colemanrewerts
889,563,019 *5C813ECAE97DB1A026BF1F1D90A9574E4879AD07 colocasiaantiquorumvarmultifolia
889,563,020 *5C888FC23B2E02986D70FC391602A9E65C878BA1 COMPLECETED
889,563,021 *5C83E1C47938F5D6B762CD04B65D7CA35D91D675 dwellingsite
889,563,022 *5C891ECB7E0400AB5E1E355145A1774674D08C35 DWIGHT JOHN WHITE
889,563,023 *5C8B88577253F0AFDFEB08533A6C8021A398542D DWT)=
889,563,024 *5C8C712DD4B8621CDA3AD470F2FA45774E753DE1 dxb;4
889,563,025 *5C85C2993585281C0464E88646609177EDE3FFA5 cool-vibes-(switzerland)
889,563,026 *5C8D4902F05875D4FD578BAFED5E724B4BECA021 dzp1l
889,563,027 *5C86F340FC15981D737ABD00E5B6518F04E35F59 CORPORATE_CONSULTING
889,563,028 *5C8A3247ECA8801A97621E974340C86C83FB8DF1 EADSINES
889,563,029 *5C82D6958B94E72301D295DC3EEE19F0E76650A5 EDABO
889,563,030 *5C88B5F887EC15ED406ED47C9463F2BEFB555ADB crightoned
889,563,031 *5C85AC152C4EDD2BEEE5AB8F116E16F34F5C3C69 cristopherpiliero
889,563,032 *5C85FFFB9B6132BCE2E19311D23F955D69A81BED EEG6G
889,563,033 *5C8BABAEE083335B568F20AB854591EDA7A0CAD3 C+rS
889,563,034 *5C8AA64EECFAFD861E3CC2F7D1E3B0C2B56D0FFE CTB+Z
889,563,035 *5C88EA190DCE564FDD1EADEF1774A63B9AF3BFF5 [email protected]
889,563,036 *5C8313515F2863FC033D7BEF8F23CEE7808F1697 CUMF
889,563,037 *5C8E5F28DF31B7C7FB88338E01651A9FE8F9BC67 C:\WINDOWS\INF\DIVASRVINF
889,563,038 *5C81ABF258BBCFC4A28E86E3F69E9ACA6874CA72 ELLIOTEIESLAND
889,563,039 *5C80853D0F583AA40548E1266022A9BFFD2CFCD0 CYBERBARN
889,563,040 *5C8B3F63CE1B511CCEA02D2DAE9B0871EC90CD02 cyrilspizzirri
889,563,041 *5C8F7BF164F01EE4E19F30A869E8FF4B4B308272 cytt
889,563,042 *5C8A14D512C37D4F55A4B23CC401C2186EE9B491 ellsworthbeets
889,563,043 *5C8A1D9474042745688030F13790FF2D09B86D32 czxqvfs1
889,563,044 *5C8EB6183ED41A0A22C8A67261D2CE7F9861576A eltonrasley
889,563,045 *5C8D8C9CEF6AA29316B4627EA7D3D13C60557947 D0!QN
889,563,046 *5C86447A500B5208062E7F25CC7905EA0E2FF095 D1SC10S3R
889,563,047 *5C8106BBB4AFCFA540C43E05B83244B2E50760DC EMILIOROUFF
889,563,048 *5C89250825762F9E690E27760E69B8D8EEE63AD2 EMP
889,563,049 *5C885358F8BB65B83A4D79485031D44FBCD5222E en169139113198x2
889,563,050 *5C8980121E7E169EBC97678A6982AB932B866685 ENCAPSULATED
889,563,051 *5C8D9F4BE011CBF84FE418DCB164015A34B1829C D67Y
889,563,052 *5C814BF975E1B3372A9517CD92850A8755B680D0 enrique1!
889,563,053 *5C8C3AB6742F0FD4805398AA3189598142340E86 D7GT4
889,563,054 *5C8936CD832D0EEE648F50E645441F1F1637549F D82
889,563,055 *5C8ACBFD57872FDBC9B46B8543D29E1F3C25E46D ernestopatwell
889,563,056 *5C8307709794925D303295A156B676B49AD33B91 DAMMERNE7
889,563,057 *5C8B5791AB305EED0469AB173CE025A25AFDEDBC DANNAFREEMAN
889,563,058 *5C8DEEA257B1E2879533270C091A24450D5AAE06 danny-yeadon
889,563,059 *5C8C842083CEAE983CC6E825D41EDD19A86972F4 e_t
889,563,060 *5C861C9A23C3FB5BA2654D54248CA64B03206297 everetteschak
889,563,061 *5C878725D07CC1A3BC9E328CBF3447D8FD198F26 Everylittlestop
889,563,062 *5C87413AC3BAEE5B7DD55D0ECE5503DDCE44EAC6 DCAMU
889,563,063 *5C879EA7AA540A92F6D366324902363AAE5DD7C2 dc#il
889,563,064 *5C8DA3B0F412DE51048801579B3BBED894D60131 ddbhl
889,563,065 *5C8B777B3BCB9E05DA73F68F827389D68BA87380 f"9*
889,563,066 *5C83A2CB85EF7A4C6B80A20D802180340690BCAD fabulezing
889,563,067 *5C856BF02A07753A679DA09C1831B811DEA163ED falnilieablatt
889,563,068 *5C8C08BE75B001D23C63C3B60517DF5DC5672F44 DEATH-TO-ALL-CULTURE-SNITCHES
889,563,069 *5C8290FE8C6AA858F48F138204AD390F2E6CBD10 DEBBIRKNED
889,563,070 *5C88A12CE8E3B33C2F233F1DF8091A4E24838C87 DEDOUBLER?
889,563,071 *5C87E5771C0DBBC3F9CD942559B18D00E27CDB04 delatwan9
889,563,072 *5C8EEA38A09FE0CE000AF3667496CA0D3507421C DEL.LACK
889,563,073 *5C8BA45567E2B1CD87A807213E51E7F1CBF7BD0E DELPIZZULO
889,563,074 *5C8413E6C114AD22789FE72FBBFD9BF298F4FE9D DEMARCUS.MCLAUGHLIN
889,563,075 *5C8F026E602B887C3F488D076F542B17CEB23D48 feeblewinged
889,563,076 *5C8E631E610B0B082426FBF9086A13553CF689B0 FELECHÍN
889,563,077 *5C8003FC84AC475A8AF6E9EFBE8589C52D793D68 FEROZBSW8
889,563,078 *5C89D7E3B7073D357D98EF93AA5FC3FF0075A92C fforetni9
889,563,079 *5C8783C2B082270DA64E62B45384ADDB8D6B0221 DESHAWN.MASTERTON
889,563,080 *5C895B181E24635D07203C5F3EBF884965CDF574 FHT5UHX395
889,563,081 *5C88DC28066A23999307AE493DAED9798914F54A [email protected]
889,563,082 *5C8376FBA49753296639CABFF9E27FB990F96D56 FIDEL.OAJACA
889,563,083 *5C805D901BF50733FEAB1DC03B8915E162095560 detiser
889,563,084 *5C8A4765D7B9C6A145A98D875ED4F0ABFE7BB8B8 Finger-Exercises
889,563,085 *5C8687639F8272934FB3C13A78740C80FAC4BE34 DEYOJREV9
889,563,086 *5C8FE4627E279A7013D4952F4E06C59CA42E1160 DFAHA
889,563,087 *5C856EC491C90FA6A8B81C8D6D4FB2CD8CF442A2 DG11L16K
889,563,088 *5C881C276C5924EA2CC350A56E7A5D3AC03A6E5A FORESTBARKLOW
889,563,089 *5C89B7B2B011B3CF77ADA38646AFAFF987FFB3CC dilbertsupra
889,563,090 *5C8F005D6AB32EBAFCBBBC89F923575918BA8FA8 [email protected]
889,563,091 *5C81561238B8706A69F138B93ABFC87BCE10D53B fragment.eleven..'the.day.after.yesterday'.i..the.meeting
889,563,092 *5C86855FD0DDA92127A02F53E70B50725E24C112 DINOHEYNEN
889,563,093 *5C8EEFEB17CF63F0409DBDE95D406B39899C9A10 FRANKIE977
889,563,094 *5C8CDCEFE13108D1A4AA6D87A4F24F42DD9FE87C discommune?
889,563,095 *5C84DCCD24D872082387D9736E0643AA809F7923 FRED.DYKES
889,563,096 *5C8B60D57C8265E4BAB49344879B982A6024E032 dktq
889,563,097 *5C8D71D56DC33A979E782A1CF071A742D2EC2398 furcates
889,563,098 *5C8BA10417E3713FFC95EF122B09924559348105 dm&&
889,563,099 *5C827F59B77125A8396DA345F571B73F117AE18B GARRY.BUSHELL
889,563,100 *5C857A41F1008488472B780D57F29D26B23216BD DOMENICTOBE
889,563,101 *5C89DD590630556D5E25FD7A46469D69257A423D GARYTOKASH
889,563,102 *5C8D39B5FDB17316572D46D78C2982BE05FBB881 DONALD.MCIWRAITH
889,563,103 *5C879ED4A1EA5420B720841DAF8CD84E4BAD1987 DONANNIE1
889,563,104 *5C8735451799A533FD599BD9E818B23244534359 DONG.NOYE
889,563,105 *5C8A3312B9EF12BACAF8E2296BC965D7B53191AB gcfa
889,563,106 *5C8B394B766B6C564B94ACF877DDFE6FD2977F7F [email protected]
889,563,107 *5C8EC98F64FAD250C46D98422263D72E3D0D5BBC DÖNÜPTE
889,563,108 *5C820403B515C4B4B79B25A84A8F2590BE7BB32C dorseydurrwachter
889,563,109 *5C8BFFE3FA73E00AE58C1E01E18B9E7BBCF247C4 d&ouz
889,563,110 *5C8D34AF016E622825DBC1834585252011E15063 DOW6H
889,563,111 *5C87EFE3C1FBC041C9C2CC05794A0034AC2FC2D9 GEOFFREYBURGHER
889,563,112 *5C8FE08660EE5C7DA2B5481B06C055510CBB1E13 GERARDOLEOPARDI
889,563,113 *5C8AF7C271941BDD68636EE20CA7D4F75652E26C DPLQ:
889,563,114 *5C85CC0FAA1D069C51F126981930DAB68A587DDC D$Q?D
889,563,115 *5C80C818F10F4EA9693DA9CE35E443BFF71C4943 drgslgnn6
889,563,116 *5C83FDC4E4A371F925D03F7FF8863CAE7D99BDB9 GLATA1995
889,563,117 *5C858302E6B882E8929934A60E5D8F532A9BBD5D GLOBAL-UNDERGROUND-2009-UNMIXED-(DISC-2)
889,563,118 *5C8E79C767F258767F7A8FD893224E3AB6A9821F DSJ?T
889,563,119 *5C8C593399B2AB0DE4682C6BB06EAF1F826A37C6 GNITUMMO7
889,563,120 *5C898867A5B7F6D49612BF59CD174CDB46CC1296 godzillanewsgoespublic
889,563,121 *5C89DE907B69039CF697A0CC24BB9B8B0C541AAE GOODBYE YOUTH BYE BYE LOVE
889,563,122 *5C802C58D059B9EEA310CFB4A9773EF87D686F43 got.that.bomb
889,563,123 *5C8328A0B07291D8BBDD4BF151E67C2838CA4991 DUNDERHONNY
889,563,124 *5C83FC6BD0A78701AA43A2B80A1A662DF676A6D5 gradymew
889,563,125 *5C8BAB4DD40A7072D1EC9CA1FCDC84D1B3EDC593 [email protected]
889,563,126 *5C87B6F3B44BC93D7731E825A1C1D8061B58840B GRALE,VOLUME3:58-59
889,563,127 *5C8226077EEAE8E05A0279772D2B3F17FE8C385E gsbstanfordeduwww
889,563,128 *5C80C1B6F1E1FDFB364C22AA264A81332D10A272 dwightshanno
889,563,129 *5C8E7DCA0D539CCAB13002ECD5407918AA870B08 [email protected]
889,563,130 *5C849FADCB53B8CDAA20F6E8E62BADF738557AF2 D#Y
889,563,131 *5C8EC8674A538A00DB7871B453AD5D8BABD407C6 d&zh&
889,563,132 *5C8207CF94FBA1BED3F46C344474EE80F2B342EE dzhv7
889,563,133 *5C8530F4FC2F1501375E5EB16C75396BAE5AE48A e01c2
889,563,134 *5C8D0C299D98DCCD4C7C18F83E2914879A954FC0 HANK.CORRALES
889,563,135 *5C8C7D2A339F470B3BA9FF850ABDA5650DA33F70 ECABG
889,563,136 *5C8AAEEC13BE27B36C69DF1E7FFD8BCBA3504BA3 EDDY.OLEWINE
889,563,137 *5C845B4FF4796DE31703B9F7C059165EB05F2BF7 EDGARDOMECHE
889,563,138 *5C880C32C391380F2EA6599F67976627BE607209 HAROLDLIESTMAN
889,563,139 *5C8C27D45AB1C1BA44D2F20566FF00AA30AD3938 HARRISHENDEL
889,563,140 *5C87BE904108CC926E93CBF34F62A42B33D10E3F edna'snigun
889,563,141 *5C8C5E95912477364E550092AADA9514CEE93FFF EFELGUEREZ
889,563,142 *5C8D832B6A4413AFD0F9C29D7DC585BAF2E7672F HÄUSERWAND
889,563,143 *5C840FF27A8916EF72272F959BE9CFB3CA5145C0 EGOFC
889,563,144 *5C8248EE648511DE8020E0182914A45A9A23F1F6 eh0.d
889,563,145 *5C82D19F21AE92328218F0D1ED7BCBF1190FC151 EIKESCHO9
889,563,146 *5C8CF7602EC79FAC9D837423CFC48F4432A94D8E EJACULATIVE
889,563,147 *5C8384BC1771B074A7A6D4BDBF5E14606B956217 HEROESOFTHELOSTVALLEY
889,563,148 *5C8966D17308F232E5AB40C8E0C39DADC66186EF HEROINE(THEMEFROM'CAPTIVE')(FEAT.SIN
889,563,149 *5C8D6521E9EBFF998CBAE4D7DD7C639F13BB3108 eldondeja
889,563,150 *5C84A71FC841B7944FF7FF05FD9F3819DE203176 Elect-Rick
889,563,151 *5C86D8D6208D451DDD90D6C890DE5C111C9E3FF8 electrosynthesis
889,563,152 *5C88D39C84710B891B6D049FDD1B8A1D6351D24B ELISABETH BRANCTORCHE
889,563,153 *5C84FEB79349611F57CE83EE3D96C6C5DE7812D8 hi(dial-a-song)
889,563,154 *5C854CD235D8602FD0F4327E50C22421DF38A258 hlmnthc2
889,563,155 *5C84E0D5D07D129E4B4B1974D0BB8378F9DB4E6D ELMO.ARMESTO
889,563,156 *5C88B035B40CB6888E4160C64A13B0D3E1A6A28C HOMERBRUCATO
889,563,157 *5C840EEED972A52F52B9C9315EADAAB8C68A63D1 ELWOOD74
889,563,158 *5C802FB6DBC777D5598C21841A469087A28A4D39 HORMONAL)(*
889,563,159 *5C8D479CA78ABA7C02368A6D05092CCA5B4C1363 EMMAALIT
889,563,160 *5C8262A6AE0B1E28410912979297DB44B35A5B8C [email protected]
889,563,161 *5C83A6CDFDBFE8023E934519D60918398436A970 EMMETT.FRESH
889,563,162 *5C890FA0698B859696B59E21BB57A6F393974A74 [email protected]
889,563,163 *5C87F7124D48CA1083FE96A3070D4A5598F3C14E EMP
889,563,164 *5C8D9360CEEA587C25BFD7716C4851E801285411 HQY4
889,563,165 *5C8250687955F8AD1EEEB1BD783B08C1AD97AA30 en8614097175
889,563,166 *5C8C9B5CF488710DC31AA061D76C6881ED23DB89 ENDOPHASIA!
889,563,167 *5C8041D0F99C008D3FBDAFA1FD03AA57EC52B0CE ensearing4
889,563,168 *5C85B8B837127E7B557A6FCD6B98465852B72A2E envenoms
889,563,169 *5C88C00A0A25695361D7A330F9A4990AB466D791 hyperaccuracy8
889,563,170 *5C87102257CA3CCA82848173C998DCDF1163A29C iab\
889,563,171 *5C8D1B4CA8E220E6BCCC0D9A5437AF3DEB75A92B ERASMO.APOLINAR
889,563,172 *5C88D5D372F3967A6FCBA9ECDF8132AA50336814 ERICKOP
889,563,173 *5C8FB46AFAD1D91DE67248F24A03B779E8430584 IEZTOORG9
889,563,174 *5C8FE4B4C47AE07BE17EDBE5E8C496D5BC959CB5 ERRORCONTROLLED
889,563,175 *5C8976CE6B6465598A8F98F954D373B3F9EA4F37 ERZEKAT
889,563,176 *5C88062D3CE6DC3CE1F74EE6D7E7A9F82C7F7D13 ikcetjow 1
889,563,177 *5C8735A09A436E154B4ADBC3DBD44E1E19ADCEC8 I'll-Never-Give-It-Up
889,563,178 *5C815DBFA9323EAAB66F43BCF68781C43414BE08 ILOTE3
889,563,179 *5C84E54DECF7D8F9826F34AE540810B8E98DE8EB ESTRELITAS**
889,563,180 *5C817647E989D127CF4771551D1B2AF7506B3865 ES!W
889,563,181 *5C8B81C1B6EF2979C2255DBB9BF43909BAAC0724 [email protected]
889,563,182 *5C891A78A5C001B0B84D480813A68A9286F5F4D7 ILOVEXANADU72
889,563,183 *5C8C78293FA634096BF6FD2C42564227625AC5A6 ETHAN.QUAIL
889,563,184 *5C84F6366E5AEA6BD0C872B0940035A35819EA31 ETHANUREN
889,563,185 *5C8B2E7F02BBC519736F1FB96FDB5D8F11185EE4 ILUVLUCKY114
889,563,186 *5C84974AD452E038ABD8AC93D0A7CD1DBB64F39B IMAGEELPIDA
889,563,187 *5C82F9B784B721A833E504E3424DD7FAABC1A099 EVITCELL9
889,563,188 *5C85331ABDD907158D568D2D25CFFB1908FF26FE exigence.
889,563,189 *5C8E173E7036C8F4A64E36211131582B2139A1A5 EXPIRERS
889,563,190 *5C890D8A0F38F188756ED867F5C92F752ECECC7B INTOLERANTLY3
889,563,191 *5C882B1686866762DB11FE3BF0D42F3534AB3D81 fBH
889,563,192 *5C86F68D4DD754F702A60A779790CDE5E154C348 FELTONPARRENT
889,563,193 *5C8008DAAEDAAF38AB4E7B55262D22D34CA987D0 FERMIN.ONSUREZ
889,563,194 *5C8EAA63B80C623326017898D41D740BCA4E9F20 ferminthelemaque
889,563,195 *5C855663FB1CE19EE72CECAF68365B5F18698BDC Fertilisait
889,563,196 *5C8350677B621915E0D15B40F8E08B7E8ACEBE27 [email protected]
889,563,197 *5C8F93E41AE303CAC5411B94CB48FD9263D2AB52 J105413
889,563,198 *5C8C4F4CA3D059F35F93C8BB05C58B3BEA6B9B9B FILIBERTO.SAMRA
889,563,199 *5C896911053DA1810A68AD17F5A0F5AD2E476C9C FIMKRITIKER
889,563,200 *5C8C3D6277D1D691EA1E06DECA4FE58407BBC1AA finniganová
889,563,201 *5C8644D4D8567D4FF2EE6242537579D2DA62F9A3 [email protected]
889,563,202 *5C8878733B8203A274A44FF4E4CF202BBDEFEC1B FLBERISED
889,563,203 *5C8C7BAEFBA7C669162DAD1205ABC0436AEFBD07 FLETCHER109
889,563,204 *5C85AACD03372963CB630BB19D131709FD1D1846 [email protected]
889,563,205 *5C856BC13B5ECCF51DE18F841B26618D7C17FA91 FLOYDDUBORD
889,563,206 *5C843752BE5C3F6D7BB2A04EC03FE5144F7838E4 [email protected]
889,563,207 *5C8BAF2C628138AC87B4497BC06D20CB82813F8B folktom8
889,563,208 *5C8C6B8ACF42704811189CB6ABFECBE426D4F474 FORMATTÉES
889,563,209 *5C833FC3D100771C74580A830F7FA3717E196A37 jarodoyler
889,563,210 *5C8EE648D6A20C8A5FEB1FB03CAC38B2FD2D9596 JARODTUFO
889,563,211 *5C80D1D1B7845AEB8AA33C6A4116843CA93503AE [email protected]
889,563,212 *5C8401AA1B4DAE72B3E44D323F00F0A7E90BC1BC JASONMERCED
889,563,213 *5C8A7DAE03AF7E51D71BD16487B856D755E2DB79 FREDDIEBERKEBILE
889,563,214 *5C8237D5AA36A589799C05F1388BB302B7F97F3C fredericcastruita
889,563,215 *5C87FB4994FCE1C0FE34DF827D298C0DB3FB486A jean.westbrook
889,563,216 *5C866C833FD25FCC143384E864399CDF94B42292 JEFFERSON.SANKOWSKI
889,563,217 *5C824535CAB47982A11CC99630D70B8AF494555C jeffery1177
889,563,218 *5C860D5733BEBFB003BF21D697B27EE1A6AC9C13 frigane
889,563,219 *5C8E78750B8CE6EFED186B065A3FD1CB54794483 FROMBETWEENTWOROCKSANDRIDESDIRECTLYFORTHETRUCK
889,563,220 *5C8C4A1943312DB00E971A0577E5CBED415E2C07 jess-duran
889,563,221 *5C8BFC32372DAB4F934E9D92C2C8546548126931 jessieseutter
889,563,222 *5C81DDFDCDD4EDC954C69A1AF19BE33519E65236 jflctfo
889,563,223 *5C8DABE0B8F73A72E42AAB4543C678AFBC6B96A3 jg'n
889,563,224 *5C8CCC2C75435122D3605A10E424AD87E488BFCE [email protected]%6
889,563,225 *5C873943CF698914703898023D87F225859B757D [email protected]
889,563,226 *5C8A8C922824B7F0ECA2616D633F418965DC2FAC garlandceccarelli
889,563,227 *5C8811C025A7F619A6040AC0223463EEC42F0EA6 GARTH.RELLIHAN
889,563,228 *5C831C69E5EDB6ABEEB653A472E62FD16030184B GCLABURN
889,563,229 *5C85DA8A1E855EE0A99E2D145D98C13D07371150 GEEN.PANIEK.(DISC.1)
889,563,230 *5C825E5ED176A3781D08F78F5AC27C8D1A2BCC24 JONATHON.CURNEY
889,563,231 *5C8012187124F1EB42708352DBEFCA6C5D0489AB JONELLE.WILEY
889,563,232 *5C897BC9DBD1D13EB86F0925DEB61006912B4AD1 jongchi1
889,563,233 *5C8CB610033595455026A38E52FD419B58D0F582 JOSEFSCHUCKERS
889,563,234 *5C87EAAEB88C91E7D9AADA05D2DCF865F3FED908 JOSEPH.JAR
889,563,235 *5C818E75F10D84942507D4360F6644F8CEB1FC78 GERALDOEMMERLING
889,563,236 *5C8EF5ABEB0CF39D0ED1E351E029A9A05775C869 gerammte0
889,563,237 *5C8E90CF43889DEE8A6EEF10B732E19909C2B687 JULIAN.RAHAIM
889,563,238 *5C8E1EC7CC5681615EE09EC9BF24EA118E670956 julie-mary-moore
889,563,239 *5C807D2BD3A4D26914A9D0532AA81892C5EDF68A JULIOHOLSAPPLE
889,563,240 *5C8F62F7AC40AFCE40E1318D5118D2E9B2DD9AF5 JUSTINE-BENAVIDEZ
889,563,241 *5C88DC69361E53051E5598760561B218048F9565 JUSTIN.GALLANTE
889,563,242 *5C899022BB9EDCBD6CFF8EC4DBBD636BC545AD8A GIUSEPPERIDEOUT
889,563,243 *5C8C8D47192465DC22F1C30FB4921D6ED86D069A [email protected]
889,563,244 *5C86F36CEEA501FEC7764302FF8183B9D4A8F273 g"<kcd
889,563,245 *5C8B134975B5DC030CEC5561B6D9A755566DEC52 KADORĖ
889,563,246 *5C8F849835F13FE96F6A52717392C6137B690225 Glory-goes-"honk"?&lt;br&gt;
889,563,247 *5C8544029B5044EAC5F0A794358027E311C76A68 [email protected]
889,563,248 *5C8B34F40B820556136D9112A50A40FEAAF5B287 KAMI NO ITTE (HAND OF GOD)
889,563,249 *5C838F97459C83144CDABAD0206AD30F7EBD7B69 GNHCXRTN
889,563,250 *5C89B43F6360E42AC6CD109D8BB3498782EFD7EE GOKOUJOU6
889,563,251 *5C8B0DB8BB2B31F8ACE5D06A79599E6F42FF3ED0 GOLDMORONI
889,563,252 *5C808A89D4B78B88577461F67A2BEBACBD41B31F GONZALOREDIFER
889,563,253 *5C8756731DC3C87D70F70A419B4F3EB7D29348B8 keep-on-pushing-(son-sine's-in-da-in-mix)
889,563,254 *5C83D8EC7F3BAB34CFC8E3E71FC4200E100B2B51 kendrakendra
889,563,255 *5C807FA4A17B38205471538B7D973E9545595F99 kerrymilsap
889,563,256 *5C8E00FA206B7806231C02BF3C79438812579C6A KEVINOLA
889,563,257 *5C808AE8BBF80C4D5FAA9C3F4586C2BFFAADD252 KICKUPS
889,563,258 *5C8572807CA5DD854C14392977FDA93EA04B1029 [email protected]
889,563,259 *5C87AD2348EEF8DE85A5B03D2717747E630EC948 KIETHAREVALO
889,563,260 *5C8272884213614BC13EC29BC61AC2AD37B52B48 KIJAKSAROM
889,563,261 *5C87F39DA6E878C08B85AFCE390EE41C06406645 KIMBONDURANT
889,563,262 *5C871BD50B03B9F9B0D57BE4C9B40D4AB9C787F5 kiroly
889,563,263 *5C85311DA8FE714189311D898951AEAF47BCF7B7 HAMPAISS9
889,563,264 *5C82AB898762BBD09F9AE3C3F81F5032907DBFEE HAMPERED
889,563,265 *5C81AF09DCB0F7662169F14A77AB6F15F340B300 KOHLENSA2
889,563,266 *5C864E46321852A84C9C8238E81582CFBF6B9B23 happily-ever-after-(we-reveal)
889,563,267 *5C84C917392C243282196802C337CD8FC522529E HARABASZ
889,563,268 *5C877596BD47AAEE027D1A2E5B9D35F791A3AB90 HAYDENDUPES
889,563,269 *5C801994E5158B23461B2E2F87113605FC549810 krchner4
889,563,270 *5C8AA6F971C027909124EA626B6E3ED585BABEB2 KRYSTLEBARKLEY
889,563,271 *5C858DFC1DC396AC792EDD139074F00BEA1923C1 KSANTYPĄ
889,563,272 *5C8F9520E545C47EE08AE0BC21DA3EEA63E61FB0 kugeltet1
889,563,273 *5C80EA1F8BB61402758329598C3161D26DA2541D HENNY-KUSMAWATI
889,563,274 *5C83BC247BAFC6742577702CA59E575EDB40B22A HER-DREAM-(DAVID-CARRETTA-REMIX)
889,563,275 *5C87676B467E28412B455DF7F1844D2C3EAB33D4 KYHEEM12
889,563,276 *5C8E9C183329E3C25086FC9F977638A9FA68A598 .l1sboa.
889,563,277 *5C8ADE7A33D6FAFE854BB16A6DE9C9C996475FBD HHFVNBSWING
889,563,278 *5C869D450D24780EF0082D0191F288DC178CB9AE HIKYOKU3
889,563,279 *5C88E3EB1BD2EDE01575D1503790508DB9B6B347 his-servant-live,-and-will-his-vassal-die:
889,563,280 *5C83DC3CEC7B3434B104000EA2DD17532B93650C lareveuse
889,563,281 *5C84A55AA020F984AF0F9EB6B73835B26D331B31 HONGKHOO
889,563,282 *5C889FF56BA34E268C24C100C57029E7FF61C637 HORTAMONED
889,563,283 *5C81EF6088C7A62DEA3DA5F42229828E88E8BF21 LBOCKHACKER
889,563,284 *5C8D33FEFA56DC986C7AC11883EA8B671A5F7B37 LCOLAIACOVO
889,563,285 *5C8E4B51D41036E6381EB89DF9D4DF995B9F722D hqb^
889,563,286 *5C88FABA59B69C9E29169A3C2CE3E33AD620DAA0 lensethiring
889,563,287 *5C85FB2781CFD6D08E789950B15A62E8A0E7A17C hwdyvyy0
889,563,288 *5C8A6B4C97CDFB268B007D8FA7D5DA62AE3F0985 hyko
889,563,289 *5C82906259FF13F1D21DCDBAEED16C2F2113D684 LIBRARYGUEST
889,563,290 *5C8EF80747E8F5B8747339C9A9976ED1CF1A6882 IANIUGNASES
889,563,291 *5C85653F3A5A574EA78144646A450414E8C3ABE4 iarasta88
889,563,292 *5C89A6307BE621B039E3B1044BEA60DDA2CBB1A0 LI#O
889,563,293 *5C8492BE634B5D96FA091AFC65CEB3D2D31C4BE3 lithabaneng
889,563,294 *5C8834889DFD93BF3F7F5922377734A3DD99635E IKAZUCHIMARU
889,563,295 *5C87EB68DAD9B77C4951E7EA8884C33E5D5AC107 longhohaia
889,563,296 *5C8F82AB9B97920D7B00621E606D330630AFB626 iloveestelle11
889,563,297 *5C8167E0F6D7601422F654F0085A06B8B74CCBA7 loreena.mckennitt
889,563,298 *5C825AD91BA37123B568506C85ADF4E572DE42DA ILOVEYOUYUNISHA
889,563,299 *5C8CF5C98853C0B3E23E8094D4BCE874B3E96A91 IMARISHAS2
889,563,300 *5C80CA12A0F4DF7B7430560F334D25A9574C472F IMPROVEMENT.JQ
889,563,301 *5C8A883698D542243785DCC5C7B16ADAE0F33D77 inf13ction
889,563,302 *5C87014EE38665E4ABA17FB11108F5F0AF3FD269 luv369
889,563,303 *5C86ACA8599E10900F1ECE654627400B914574DA LYNDONGUTRERREZ
889,563,304 *5C85A6DB7FF8CE1A0BACB24B2E6F1CB2CBB42710 INTENDS
889,563,305 *5C8E7F586D4AD1C5CBE52B34B08FD522E955DE2B IN THE CAVE
889,563,306 *5C81BC9DB399CCCE2F0275BA13B65D2BE080B706 [email protected]
889,563,307 *5C8E96BD4C09761B11F3E32EDBD240FEF030D1ED [email protected]
889,563,308 *5C899F3F631F2252960E2C12250D811453CE3CBC IPSARFNIED
889,563,309 *5C8C3FA949644A27DA805F18E7F9581C590158F7 MAATGEHOUDENEN9
889,563,310 *5C80F3AB74C327959CD18D382676E4D8EB9AE86B MALIK.KARN
889,563,311 *5C83733270E22212E95D3B2255F04538905F6E54 [email protected]
889,563,312 *5C8A3CAE2F12A657DF566F78D8104E1F2208436F ITSTOPAGAINST
889,563,313 *5C8578DA30AC66E9D86800F83A614FF32EFA7DDE MANIERIONS
889,563,314 *5C820D7A7486E00978A2C2C0B3413D1EE57F93B7 MARIANOHINTON
889,563,315 *5C84395472C1B8DE4F3A38DB0D1DF6D5594AD6C2 marioheredia
889,563,316 *5C8C6F64A6FF97ED95E1E4315E5F0EBA48193229 JAIMEPARROW
889,563,317 *5C8BE4C037B1DBDF5C713BD82037D919EDAB4957 JAKE214
889,563,318 *5C855D72E52442F55641DF46BE0F06E05A6399A6 JAME.BICKERSTAFF
889,563,319 *5C8D812313436D6BA908AA53433A1D0DFF919C93 JAMESAWAD
889,563,320 *5C837018B5BA1A6CE14858FDABA7D9AE33D9EF0B MARTINIFFT
889,563,321 *5C80ED4CC34E8DF73DD13FE6ED89A8F27CF1C2A7 jameyfarino
889,563,322 *5C8FA4932DC465FDE5F16BAE11492D4C31C3FEB6 jameyklukas
889,563,323 *5C837F249D790A5428649221FD09674D3DBF52C1 JANET KLINKENBERG
889,563,324 *5C8E7B0B02AA52BE8261740096817C8A9B0D68E8 JARVISSCHOOLMAN
889,563,325 *5C86B51BAA33ABD2C48E670915DEFFCF37AFC30E jayasreenarayanan
889,563,326 *5C8F1D78E868F7DEFF8497112C11EB47B1C98C07 MEALYBUG
889,563,327 *5C8A754542C3845180BEF2BCCBC033DE9553B78C melfaille
889,563,328 *5C82AD09698473B3C27C5BAF7DDAF2252482A8F4 MELINDATASCHETTAMILLANE
889,563,329 *5C860AFD03E57A928887D7B18CEDA2E79032BD63 JENNIFER-SALLEY
889,563,330 *5C81298D63C1F6DA7BD2A26E80992A572D676BDD [email protected]
889,563,331 *5C88806C23E55B1029190BF6E77AE1DD0DEB5A40 JERMAINESWEERS
889,563,332 *5C822730769D2F1C2CF90477D810A53CC0F31260 JEROLDDUSING
889,563,333 *5C8EAE4736A26F9FDA0EB1A38C020D3AA7C1C8FA [email protected]
889,563,334 *5C89D4F1525AC1C47630F310E7EB5C0083E8C648 merlinmacintyre
889,563,335 *5C847CD9F851FEDF02A7DCB9452623A726CAEE91 MESSIAH215
889,563,336 *5C85E95A78CB9F95D213B97964A545618AEE7A4E METSÄNHOIDOSTA
889,563,337 *5C8A026D658F4851B0D37F8BCBD2195150758ECD jesusmcnelis
889,563,338 *5C8987EC13AA71752C9CC326C3D00BC3F64A82DF microwhip
889,563,339 *5C89E4341D704A9BFF3E756A9D01BE17718A5237 JKMXFILES
889,563,340 *5C807536EB20788B1C226B9D7FAE60C1923EDEB2 JMARRONI
889,563,341 *5C8171E94602356DBBC74AC3B8A29E4848E727F7 MIRC34S3RC4N
889,563,342 *5C8E075C54A33965A1DF0E2261DAA0D75EC1BDCB JOELBARNA
889,563,343 *5C8C114A7E2DA14A24CC7825D6830B147312B55F jõesaar
889,563,344 *5C894E780A8AE1F866F5837F92C7917AC8A61393 johnsonslaby
889,563,345 *5C8B7D48BC43411161C331792F4F54997FCB2479 jolene-chong
889,563,346 *5C808271C7E00C3073ABEFF54E93658A15997924 MONTEFAJARDO
889,563,347 *5C8BE2FE0093F624F7BC305C94D80CC19E10DB1A MOVEITLIKEIDO(FEATD-TAY,HI-C)
889,563,348 *5C8D55211745DA37C01EADFBBC4D54CB8C30F122 JoyDivisionOvenGloves
889,563,349 *5C8C371B502EA9031A47F7E0D74FD4D7DC591218 JULESMCBURROUGH
889,563,350 *5C84E78F7D21B0178964D4B77AE573E8223E2537 murraytexter
889,563,351 *5C89FCAB673FBBA0FEF5302D8BC3CEEE82792CC3 JULIO.BARZEY
889,563,352 *5C892978914D5A35B1BAF57650BA644D757E5593 [email protected]
889,563,353 *5C888B1AC7BD87CD618C336E62044252A8E5257A JURANJÁVRI
889,563,354 *5C8C9E02BDC479C176B46172B5554BCA515D976E JUSTIN.HUIZINGA
889,563,355 *5C8FCBA299386C310EECEE47FD2F1F4744757A6F J`V~
889,563,356 *5C878D3ACC85B1DADB909700DEBE381598154B59 K118718
889,563,357 *5C8A6363FB7657CC65FB636C09CE0BE395805FBB MZQODBJ8
889,563,358 *5C8E554C47CFB204C0784EF7D815C2F29C14E23A k7lv
889,563,359 *5C8DEB5230D2EAEBDA175DA2161510B5A38FF8B1 [email protected]
889,563,360 *5C8FC1EE115B2D1044CB06BF60317BA1CE96B7B0 KASEYWIRTH
889,563,361 *5C813840514C76F9EAE4C6212CC0A16C5B00D65F kasugabe
889,563,362 *5C8853FAA8EFCFE7DED12C8D4AAAE9B0D796D3AE NAZCI
889,563,363 *5C8D39CB58D457123B476362D4283CA335068880 [email protected]
889,563,364 *5C824E4B5EC31D8629547BCBB8CDBD1ADCB61376 KEN.ATCHISON
889,563,365 *5C8B3EFF49F5D01736C85BCBDC09B251F9C95A47 NEJPOHODLNEJSICH
889,563,366 *5C84F6B9E5BA0D916C6A79A2413F55D3871F68C1 NEWBURGS6
889,563,367 *5C8FC597611586CF11782D6B627438B7758366EB kniesehnenreflexes
889,563,368 *5C80AD3767A45DC89985935C6E2AE5651AEEB987 kokhalzend0
889,563,369 *5C849ECDA1A476104A9AB073A77E53BA09D9C255 KOMPLEXS9
889,563,370 *5C885A3B74FA245EDD15ACE7E15A0B2186981F1D KR3MLINOLOGI$+$
889,563,371 *5C844B93F46ECB004C133A9DACD7C9591947036F NSÜCHTIG
889,563,372 *5C8925E611AB279378E1FBD981D5FE53F3E0B38E NTRKTLA3
889,563,373 *5C897F588CB3A4D5CA71CC7E0540D651D488D74F KUJULUMBIKI
889,563,374 *5C8A26E2722BF2FBBCD719CE15E34F550FA0A0B9 O1W
889,563,375 *5C8625E8AC5EBBF297BC39E63C06A77E5C8ED799 „KÜSTENGEBIETE“
889,563,376 *5C8F4EF24B801C08A97102B013F9A8A011105AAA :KYRIE(OXFORDCAMERATAFEAT.CONDUCTOR:JEREMYSUMMERLY)
889,563,377 *5C8DD1CF1B17E6268DC061BCA196AA3D0F86C5CB Lake-Tsana
889,563,378 *5C89D5683223593D29B720FF9AC23500B2ABD1F2 [email protected]
889,563,379 *5C83D15B3F7F1DD8DB5F43EA42FED8EED28C5448 LANCEKELLEN
889,563,380 *5C8C13A87C0CF61801C3F1E3887DCA6B35D3E5A7 LARRYCARLTON&MICHAELCOLOMBIER
889,563,381 *5C824DC8A882A1AA9AB44A7204DCFC2201CA1238 laverandapittsburgcomwww
889,563,382 *5C853B5B538DFBAE4094B7754214B6B8C423A6AD LAVERNE.ARVIEW
889,563,383 *5C86240107205387625C4A99C2A8A50A5FAAA128 ;)O~.O~.Q=P
889,563,384 *5C80A824654EC13A8F6D94E8F3939D0FFF05A48A [email protected]
889,563,385 *5C858D119A7AB7DD8F8A933D9A65A73B324A519E lawerencelipham
889,563,386 *5C86CE8039BC9314812EF2D2FC68101CCB7F2A4F ORTHAGOROVCI
889,563,387 *5C826C560404607FC4A75B6F0D9A789D9C0E6FC5 lcsutton04
889,563,388 *5C8C3A6111123584A4D3F6EDC1736CB5F6FA15A0 lemeilleurdetesjours
889,563,389 *5C8EE7B108279556DF3194C042BD7D21DD0F1878 owenmathieu
889,563,390 *5C800279F7507961B54894652B154D0AEC88261A lepersamongus
889,563,391 *5C8397F9CEED43CED7E0A540331A3256764AD09C LEROY.NEIFERT
889,563,392 *5C8FAAAA35D7FE65FAF0170F7DD426657F4F07B5 P----->-~0SPLAT
889,563,393 *5C829500E033914AAFF7CE717ED6E8B448E6431E lfzb
889,563,394 *5C8EDEAFDFABBD57044468D8DD8E6FF6383DEE5E [email protected]
889,563,395 *5C8C138C04EE108900FDD5604E7469F649A26A30 LI_BEIYAO
889,563,396 *5C80976EF68CCBB7D639EF6833B6BD4A181C71D9 のアルバム『lido』の発売を記念したコンサート『yoshihiro
889,563,397 *5C81B73421E4908C7607BB8AA51D194D84B172AA PARKTED
889,563,398 *5C856407754C827CEE4D2187B3541B3B0BB25E75 PASQUALE.FALCK
889,563,399 *5C8E3D9E807FEC38876F2000EDFBA8B0F97C978B passed99
889,563,400 *5C857FB8753ADF5556BCDD9A8344187481F6D379 LOAD-INDICATINGRESISTOR
889,563,401 *5C842DB7EBB4205BF03FB7E6AAD29A8166147285 LOUIE.GUNDY
889,563,402 *5C81F80903E4282F19B1343A837EC9120007B430 PENAL2007
889,563,403 *5C892B2A1E9B0A7E75D92935A2C59F0DC3BF32DE PEÑELLA
889,563,404 *5C8891A7A394C711D14439B1E42352A4E3207FC7 loydteplica
889,563,405 *5C80B09C33F019DE353BAA34BA21428AE0A7113B [email protected]
889,563,406 *5C85782C79DD58A9901EC362B40BB5D9348D7C4B PESPONTLOEIS1
889,563,407 *5C85DD665347A483F7B868C60A0174A626C438C4 luci89
889,563,408 *5C8A74DB59064B69434CF27A6FFB171716348C8B LUIGISTEEG
889,563,409 *5C8C0E4B380AB1D365FB0E0924F70B3639FC2F7E LUKE.SICKENDICK
889,563,410 *5C84E1313DD3DD3D6CB033FCD6ABA566B23F1197 PHENOTYPE13
889,563,411 *5C8BD3C852F3397E2CFF881E2632062B71EE505F phhy
889,563,412 *5C80FD3FA925B82D3EBC8E64E8D3838A22789C13 [email protected]
889,563,413 *5C807650E8A9F5EBD550C122FBE547D5E27538E1 [email protected]
889,563,414 *5C843223E06FA55D05CD5EABE5456C92A6A62401 [email protected]
889,563,415 *5C853779EFF9F38726C6B896333773394467872A pilotait4
889,563,416 *5C8027BB13B7B43C79C5893A1AC4330325A7FC3E m5d3
889,563,417 *5C82360EEF57368F3F0F8CA9AD283AAA016AC565 pleisterkalks
889,563,418 *5C82D15F9EA85C55F82F16B16E7E79B7A20A6E2C plinkle
889,563,419 *5C847AC3D39EE4B4899D5C162DD2041D26AFDA32 mamboval-(revival-cabez
889,563,420 *5C8505DCE365245384BFCDEB95392037676DBAEB MANHATTANKAUF
889,563,421 *5C808B8974098102FBFCDBBA25978DD8AF0C97A2 manish.damani
889,563,422 *5C8ACCAAA6BFAA59195866BCE308BE3EB2AFE711 manuellockaby
889,563,423 *5C85FCDDD7EAF3034317330CA1A74D39B0EF263F maquestiaux
889,563,424 *5C8252D168652FCE21F08666CB4FDA13B216E76F MARCELODICKEN
889,563,425 *5C89BB134A6FAAF4E3E920826E14287B3CD1F3F6 polonaise-no.-1-in-c-sharp-minor,-op.-26-no.-1
889,563,426 *5C8FD280A83F495CCD9F789A69B17E81080350EE maréville
889,563,427 *5C88C2CB2070FE3905144728B148AC6B7C3E54BD P#@~O.O><
889,563,428 *5C8F8D6641598941D3D5BAB4103618609A14E795 MARIONEMHOFF
889,563,429 *5C8D7D9AFAC3D0AC56B4DC42FF25A9D89844F987 [email protected]
889,563,430 *5C81BA3707C4606A95256710F702A1EA17099276 POSTFUX
889,563,431 *5C8A7CFDBB296D75111421EAEA1E9DFA995F3901 postponence8
889,563,432 *5C8F91EF3E8DF0C26A6112B6A979B659DFBDFCD9 .MASTIN
889,563,433 *5C8E601A81D7CFE5D1F2B5BDEED1FBA646C29015 PREHOLID5
889,563,434 *5C8BD821EC5674C66FE4C2DB7F24CF84687B9D8D PREMERIDIAN2
889,563,435 *5C8C57715C47CCFE2D436C054CD4342DDF627E1E maximth0
889,563,436 *5C8314315A0F7AFF7CC15647166B96C9128885FF prohibitionism
889,563,437 *5C89879ED403BD1FFD03ADBF152FC4B4C6400681 PRV.COMWWW
889,563,438 *5C8F2282D589379988FE4A0D42AC9E3FF600F245 PSEUDOARCHAIC
889,563,439 *5C8E371D5B16A83AE89AB78BF0AE68B190075A3B [email protected]
889,563,440 *5C8E7038FD8AF8538EF4F2AD69DF053EEEE9CA58 puc4
889,563,441 *5C8945071BA7A76914FEB45A9D269E23791C02B9 PULMONEUM
889,563,442 *5C8D1677524E832BBABCD293AF0D17971197A3D4 PURPLEPONY
889,563,443 *5C8DC614A0F61183406F152BB1C8FB7B17BBC4F1 pyknotic3
889,563,444 *5C8D23AD3925E9E93CBC4AF07D969FFA2901CC13 Q$&P
889,563,445 *5C8FC13872DED01498F2B1B6E01730D53BCE576B mikonaba
889,563,446 *5C8DBB5D6225BFDE7D92E5832677A364CC405935 MILO.LIEBIG
889,563,447 *5C8AED0F639F064CADD29194847E7099E66F8FAE MIQUELKISLER
889,563,448 *5C8E26A626C316F8221BF18AF9F504ED355B98CD MIRAPOKHAREL
889,563,449 *5C86C1FC6FE39FC1418E7C967FA54738B1226B0E r3promulg
889,563,450 *5C883ED2AC490A0B07C50D610798F9496E1DBB97 MMATRASSI
889,563,451 *5C807F6A92EFD4ECE7D371B512B86C00501DD66E rachylle3
889,563,452 *5C8DFBB6820FDF825107A4314B7004EEFD125726 modelmaxcom
889,563,453 *5C87CEBA04D6421D0E8F6D016D0EED5E15634BA2 MOM/N/DAD PRODUCTIONS
889,563,454 *5C81E28C9EB4679F03C0E91E2D03ABDCB6439A11 RALEIGH.PACEY
889,563,455 *5C8878A287A768592F29C9FD036BFECC3979AB65 monoliteral
889,563,456 *5C8C4C0F61851A17A7F0B064EF53AB4B9BE8E59F randallfurkin
889,563,457 *5C89059AABBEDEF1F1099D06387243425F1F9485 MORRISMEANY
889,563,458 *5C88E797DBF70F89E7C03FE12653B15F6C7CB1CE RAUCHAD.ANDERSON
889,563,459 *5C89497F03E79881CE424C391BF6DCC1AB9DCE6C motorhjelm
889,563,460 *5C82944CF9BAE5DD4AF25A298B43CFC150363FC8 mqklt
889,563,461 *5C86116C4B488ACE6E9F85CD9C431A24CA6504BC RCHTZTGN
889,563,462 *5C850868C0C4A8E4F68B68828B46C77413AABB3A RECOMMENCERONSES
889,563,463 *5C87E69E661FEAA27DC459F435D0099338CD1B91 MYAARDVARK18
889,563,464 *5C8D8B6BB52B23713CA2C24E02DBBE3F0951BFFE [email protected]
889,563,465 *5C85417E308D2D6BFFAF0B6898566C9A7EFEA38A mynewcourt93
889,563,466 *5C84850124634B5E80E512FDFBCAD3043976A813 reginaldomalley
889,563,467 *5C85644A954B7A35D6AC2C19C909476C0617AFE2 mypepe
889,563,468 *5C880A3F40A4F98184010D51A012D0FA69F44519 REINCLUSIONN6
889,563,469 *5C8EA79688F26D84DECDACE15344722D48DFE6F0 REMINDEROFJASPER(ANGELANXREMIX)
889,563,470 *5C8BDD83DE808CD1A320F43710640BB80E638FE2 NAHOSTTHEMEN
889,563,471 *5C86A6FD59C226A870383AD16A477777D4572D74 RETOCADOR
889,563,472 *5C832F556378C7676C4FB33F23B81130BEFE4307 nature'sfury
889,563,473 *5C896A79C2736498D0892DBB2735AAA39425D073 RIAANVN
889,563,474 *5C82C50852FB847B0C5C9DD178694A98BDF36A31 richarddevault
889,563,475 *5C8B50FB47D1346A8049D77E0429306C6A2B59B7 NEBOHCS6
889,563,476 *5C867547FEF991E8056A4AB6BE2EE5FEA968CABA RICKYCASPERP
889,563,477 *5C85FD084EA5C39E42B85DAC036DF2F237B1EF26 RIIKKILÄN
889,563,478 *5C81A457AA5EFC2D2CC0EF4077D84AC8A3CF4905 NELLIEJK
889,563,479 *5C81AFAB670207FECEA713E38E7A514B22E6E818 RIORDINER9
889,563,480 *5C86A93B412C33D90C8621D29B1DC3B036597DA2 NESIASO5
889,563,481 *5C88D47C744E452A2F1D200A07180C2FCC22B4C1 RLATHISH
889,563,482 *5C83222EE54290E73876F326EC4C7E8DFBD5C70D ngawati
889,563,483 *5C8EED4AFE771CA5E286E4AB5396BAF004A51DB7 RODOLFO.JOURDAIN
889,563,484 *5C8B4F64C3CA29D7F3B4F749A75AC867DF3EE2E8 NINH.VU
889,563,485 *5C88D74453288B9D8F1993372C4F5A99EC68E580 romanmenuey
889,563,486 *5C8CB2584BB5BBEEF78EF0AC11F7DA9919D47819 ROMEO.PENDER
889,563,487 *5C8F486CF198C649564894B6959F0A7EDB5D9B7F nlehmbruck
889,563,488 *5C80329E57CFD1C19EDC11CB99C8679DF8CEBD0B ROOFDOGS
889,563,489 *5C8E2B9FFECE31241C661EAF56BA94D7A5908FC7 r stephen
889,563,490 *5C8A972B06027778C71F33F8B3324BDEE7AC735C RUDYCAVEZON
889,563,491 *5C8052BCBE24E3DD0DD29C66FA0D9FF72102E0D5 rudylombrana
889,563,492 *5C8AE251F0DE67C8E0A21B9C68E806A777EF1A1E NORVEGIJOS
889,563,493 *5C8972DC843A7E7B9073EE4FED5AECB7B02D475E RUSSELBODELSON
889,563,494 *5C809F5FD0DC48C3958C3F63AD7E816390D7C1FD RUSSEL.MUNDER
889,563,495 *5C837059478B98E6F1D4D19DFEBFEDDCB9D10C12 RUSSRENSCH
889,563,496 *5C8ACCB9891D5FE04E91AEBFF39AA233BFEF698B RUSTYHAGOPIAN
889,563,497 *5C8DAE4F6ADB070CA06FD34271159BA23486C13E NUDACIO1
889,563,498 *5C873FE01387EF28014C2FB6556CEB351CA422B2 nurul.aishah
889,563,499 *5C84AFC75F6560CD48BDB12CF1C52E0EA1CE1887 NXXXXBC5
889,563,500 *5C8F85E11FB656CB164D333BC4DAEB90797AF254 SAMANTHATYLERING
889,563,501 *5C857C49070FE7319D2E2688CE2DF8192B871BB4 OLIVERHOKAMA
889,563,502 *5C8F1D0ACAC5F7DD5B4EC4DAE21AADF08090B080 ological9
889,563,503 *5C8141E1A2C7F6F482D20CE81865C403ABB0E840 sanrio1102
889,563,504 *5C861DB510DFF12AF03074605F6FCFC395491E2E )O([email protected]
889,563,505 *5C8172F9016FA471ACD772552CC2D55529CC647D SATURATE07
889,563,506 *5C8AA6F5C34EBADAEC90D6281B10156EB55BAFAE Sauvequipeut
889,563,507 *5C8A86F768CECC3FF95A54B8E8459AD552212D2B SCOTT.HOEGH
889,563,508 *5C843817892F3DB66D1A9135CCE86BE95345466F scratch_out-skr/&//tS/_/AU/t
889,563,509 *5C82930321CB1C97E40C13400D5EAB56F06D8A78 SEAN.BRENNEMAN
889,563,510 *5C8C59EE0CF58470C43474C54C452976C6874338 OYKUOHS1
889,563,511 *5C86A98A2F43E7FEDFB8E37813CEAD6A649DFBD9 OZZAKU
889,563,512 *5C822CDD21151FC43F4518A364BBC9A66F082B0F P> ~0SPLAT!
889,563,513 *5C8CD03F02FEDDB50FEA40FAE6D758A8F3DF29AE [email protected]
889,563,514 *5C8027A1F79CDB9DBBE255880FD6D899F46F645C [email protected]
889,563,515 *5C82B3D611FE100F46E61EFA11757CBF02D27E97 [email protected]
889,563,516 *5C81D9309FBF65CC99AEF4AC16B5FF5288441595 SEXDOLL.16
889,563,517 *5C83254378E7D8FA958798F388C24C584414C46D parificassero
889,563,518 *5C8FD22A79C897AF2EFA9B1403C39F1EF1408625 PARKARISMENOY
889,563,519 *5C8A219B33C8D09AF5CA8EBFCF3318C228D17F8E shadwachsman
889,563,520 *5C806FDB3A9D4A7B38BA491F5B1B88A7F689F4EC SHANNON.FEIJOO
889,563,521 *5C8BC9F3050654253100F615428C498BAEB7002C sherry.nagel
889,563,522 *5C87E73E61ED08CC5402A2495C3BDDCB6A26B840 SHE'SALADY
889,563,523 *5C80ADE4983DB1DDA50B8CD655D3E1EC982F7D0B penthesilea:triumph,triumph
889,563,524 *5C82B4EFC3001A9E3DB120B8BB499D63C39A4B16 sidmikulecky
889,563,525 *5C827D6EE6C8CC16741B925A2FC2196162C43611 siena923
889,563,526 *5C85B903793EE9B9F38F1E2A3DC28628FB6F93E7 signs in my life
889,563,527 *5C8869F866362632C4E81E8D0A9000A1175B9995 pied-de-biche
889,563,528 *5C845347A6D91C10433208783ADBC8B11BA33325 piskopos3
889,563,529 *5C872C7E0B0A3784936527AB25D83131939B4690 pituca(featalbertoechag
889,563,530 *5C8B450CB5D6D940692B640DA801950E0A664033 POOTTOOP4
889,563,531 *5C8DD49C380B755F3C12477637E91A1D7A247361 princealfero
889,563,532 *5C895FABB2144B7293D0E82C4840DB55817C3964 PRO7OCONE
889,563,533 *5C837EE3DE53F9011F3D1F9E2E3B76EEF7549232 SORGERINING
889,563,534 *5C8B4734A25999C710355371B78E80569B20ADBF spammy
889,563,535 *5C80B3058BF9ECAC491A0EC65D20F78804D0C10C p====)*.*.*.splat
889,563,536 *5C8FF2F6B65A00EBE2965B0F94AC13DED3287E69 P(W
889,563,537 *5C85835DE850B9EDD83224CF0AD693B82783CB1F ;)*.*.*q=====3
889,563,538 *5C83A53483AD536AD0C5208E5FA120CE892D0C65 QAYITBAY
889,563,539 *5C863C5F8188CD0038479D2E87F71A317816F95C [email protected]T
889,563,540 *5C8DA73A4FEDAB284E10530B2EBF12F40E48AF4F [email protected]
889,563,541 *5C85122A344074FBA1FD548D7D5DEB84F26F731F sreppom3
889,563,542 *5C8600268FC4689A9BB74BF673A4D09CEC8D0541 sreylfregnis
889,563,543 *5C81114C14466CC2C7DB8CA422F1AAB96FCB1831 R/.!
889,563,544 *5C8862ACDA91FF19C92FFC66D06E399F53ED78C4 star.scout
889,563,545 *5C8952A459738D508F270275541EDEDE50250140 R39I$7RAR$
889,563,546 *5C879F360648F5E86D2D1187F371494B29209386 RABINAJOSHI
889,563,547 *5C820D23A87DAD0708593368CAEB5FC02EA908E6 rafaelcodding
889,563,548 *5C84659F0E91FF0096E436C05EACAF60CB67C2D6 STERLINGKIPPLE
889,563,549 *5C85D9909B212C95A1AA42CFC2843361C2929292 STEUERBAR
889,563,550 *5C84FAE3FE96170CCAB24FA3AE6B97C290FD2274 ramonetti
889,563,551 *5C8BF6752D28433AD03F412ABEF72F419147D135 RAPHAELMONDELL
889,563,552 *5C892D8E3037653118B954394D7A7CDAA40B180B storyofdestruction
889,563,553 *5C83A7AF394106A867BC2B63A69F466B9E43052F RAYMUNDOCLUTTS
889,563,554 *5C8B3E0CB79008F6AFC71B89CCFA320E620F4A56 STRŽIBRO
889,563,555 *5C828A404BDDF57542B8FCB6C52E6555802B518D RCT1999
889,563,556 *5C8EF0F559BAFF62E913952D85AC17644DFAA5A9 REBECCA SUND
889,563,557 *5C8B13C1F70290170D6F2242330809BD9561EFFE REBELSGALAXIES
889,563,558 *5C87BF32D0BB7D3C36BEB12B8B3F27548B04C5E5 RECOMBINANTING3
889,563,559 *5C8D1A91DF6D70BBFDEFBDCE0937BB8244F549AF REDIGERINGSSPROGRAM3
889,563,560 *5C812CCEBEE41F8DEE7901065510715298E39B7B reeduca7ing
889,563,561 *5C88119F52F7A7B20F4C42203780522D559BD8F8 SUNG.EMSHWILLER
889,563,562 *5C8408C77EFE15E0143E9894EFE758E2BE1CD840 regexpwanttofindalllinksthatdonotendinhtml
889,563,563 *5C85C007CA3FB22280D7AD50A2400163C4C5F04D SUNGMCEWEN
889,563,564 *5C8FA4FA040A2417EF02970C4D4972221DD0EFE9 regrebwen.1
889,563,565 *5C8DC2C57B3068810BB34890551269AE57515177 sunshinps
889,563,566 *5C81DAB1EFF49C3B595F0B7B2F0BCFDBB4B6E45C reinaldogibson
889,563,567 *5C8C063D93171AC021FC4AF90931624B7B9699D0 REINALDO.NYCUM
889,563,568 *5C83F55BAE8B037A8011B1AF6EC2A164C0926FF7 rejirungsbetßörrək
889,563,569 *5C8F46D366A3E7C72344E0AD0AFFEADEE59CA566 surendar-koyyada
889,563,570 *5C8F3397BD057F40B7FC0EE21EC6BE8784A930E1 Rembrandt-Q-Einstein
889,563,571 *5C8BB69F857939DD854B3822B2967CC31D369B27 SUSANGRESSETT
889,563,572 *5C803DA1793F0EDEC411FF4DFEF6D55EB4204DB7 REMMAHPI
889,563,573 *5C86C80BC4857DAFE3B3F845D8D2A462A75CBE19 suvarna-rekha
889,563,574 *5C8C8811D5F091D5DD9E3FE3829767269DB1590D sweetholyterroroflove
889,563,575 *5C8CE95DE1E7A91F269A5301871D35E7A03FA9FF RESULT604
889,563,576 *5C89110CC74A9701B0A9F60DBE848B2BE1E12F8F synaptene
889,563,577 *5C8A7826B3176EA803ADB371E13B9129D0AF3EB3 TABBERDS9
889,563,578 *5C85BC18C6A090CB045F46D5E6F8115793693A3D Richlydeserve
889,563,579 *5C840253FF50E074F4455469C8020F5671A50E6E rigoletto:-act-ii.-duet-"deh-non-parlare-al-misero"
889,563,580 *5C8909E6193E06670D046E856922F3216997A61D TALKSTERN
889,563,581 *5C8085215C8F0CF6B2D56216EA646C7462FB025E RILEY.ROBBEN
889,563,582 *5C8F30306AD89A940E880AD95FF00AAC46B0D666 RIPNING3
889,563,583 *5C8A72010A619E12EEF980AB8B6F3D429163AD4B robbie-mak-leaves-city
889,563,584 *5C8A90EBC9C86CAA4F9C60D46B94B1C151B541E7 RODNEYSANON
889,563,585 *5C84FACF7EA91206E2C265AA02E8E9EBFE7B0064 TELAKKATEOLLISUUDESS0
889,563,586 *5C802C8838F76D914D46638D77B64777432B6B36 TELEKA LEWIS
889,563,587 *5C8E2A950A530694858DE635234DCB3093D614CD telrecomed
889,563,588 *5C8142E22F305837692A883C07C07C2FA77701BD ROMINAJOSE
889,563,589 *5C81427666465CA1EEC3438FB062ABBC2F4B0E31 ronnygilles
889,563,590 *5C8EA4DAFF82A168C0B89D45F2C209CE38D4D621 rosaformaine
889,563,591 *5C8C1A94FF2506832B4CF3FB62AF4C216E8E137A TETOLMURS
889,563,592 *5C818658CACCC882469E11F1A67CEDFBE0CC44FF roxann-herrera
889,563,593 *5C8A777D74ABD3630DCB716E5A08B15538070CA1 TEUFEN“
889,563,594 *5C8A3A9C7DF37097987EBD6C6B0C665FEFE86819 [email protected]
889,563,595 *5C8892AFD11D9B4032DC311D2A4ECB089781AC61 RSCHEPO9
889,563,596 *5C877DF1E2D605D402208D53A22300A73422D226 RTOROSSIAN
889,563,597 *5C8B0E7084B8DA717A8BAA39C39AB01B3AAB89D6 RUBENCARRERO
889,563,598 *5C8B6D4AEB3CC671559CAD995AD2D8A895F4D47F RUDOLPHBOOTS
889,563,599 *5C8E90B4DEDBF533AD2A3664042D032A90261A23 THEFIGARO59
889,563,600 *5C86DAD8B546BDE298698C01424969DC3E437717 THEOLOGENLISTEN
889,563,601 *5C865E7BFAF23BB495B8CA7F45C616ADD5337155 RUSTIFICARLHA1
889,563,602 *5C8A5616A55326ADF6F53580CF655F93E5736092 thequeenie55
889,563,603 *5C8AEFA0B95D26F59A86956BE2E83CB412E2E921 THIS-SONG-(DR.-CUERPO-OF-THE-DOUBLE-REMIX)
889,563,604 *5C82F76D0658E0F0829F6C0C8133F6AD5C4CDDEC THOLNIING
889,563,605 *5C8ABB8DF55725469D78D0FB972B82D341F64BD8 THOMAS.ENSMINGER
889,563,606 *5C83EF1D4EF949E308838B3D3E8C9488F6BB3875 THRIST.OF.HYDROGEN
889,563,607 *5C8369E5514B236D6D2F8C64F15981A7CAB82752 THURMANKOVALASKE
889,563,608 *5C8B841BD1D1F8A266AE705B1ACE9B8F96D3ECA0 SADOOGHIALVANDI3
889,563,609 *5C8C29A18D6FF8C31A1B83FDBFD25A550F2DBEDF SAILORHOTDOG8
889,563,610 *5C80C2E722996CBB273FACCA1C09F112E7493606 [email protected]
889,563,611 *5C8447BEA9D2D67016DA637FA5742787A4AD4B07 TIDLSENE1
889,563,612 *5C8A601414BE3A87780F410ED5BFD4253C8D39C5 TIFF2382
889,563,613 *5C8C4C7123C98C7C368D4BC22FEF0DF9A339CEA7 TIM.GOECKE
889,563,614 *5C8EB44170AEC38ABB82FD8849471CB08CFB8C6D SANFORDMCKERCHER
889,563,615 *5C8D40F265A4C89056FE3DFAFFE70B6BB989C89F sanggutzmann
889,563,616 *5C817ED61D23780BD98323DEBB4679BAF06C0773 ti[v
889,563,617 *5C8E33BF27F74E16676FD5FA26DBA57E63D7FC83 SATELLITE-OF-LOVE-(2004)
889,563,618 *5C84C638F7C73E5B2484919D709271B57DB3E879 TODCORKRAN
889,563,619 *5C8631F76879808864B62003A2EEB65C9B8C1F4A saudichemkantar
889,563,620 *5C88EB1AAB0088B75CD26898859DCA8034CE405A toestrijk7
889,563,621 *5C87449F1BCAEC8BA1F8A175A48D873A1F42A8CE SBALLASS8
889,563,622 *5C8E0C631E45B7D2855D94EBF4884B13D06251FE TOLLAGE
889,563,623 *5C86D68EE277FF13E97C7A8F2043F094FB546557 TOMSUGRUE
889,563,624 *5C842843D9C7C395434D4FC6BA18312010AD5D1E [email protected]
889,563,625 *5C8160E680BDFC49A606AAB841F75AD16D38BCAD serena.abdallah
889,563,626 *5C849EC74265A5E41354DEA7F64323B0AF3FB7B8 tre": 1 "c'en est donc fait"
889,563,627 *5C846F2D57C60DC99054D7C36EFDE98620817E4B SESSENLAMROFREPUS
889,563,628 *5C8E4EC2E3CF67C3D9107AB48A67EE3CA2ED2E41 SEVENBILLING
889,563,629 *5C8E5CF687950C0AF7445B971C2AD453C45EA231 treyhillaire
889,563,630 *5C8517C19E54EEAA85BC3182FE232CF910DDDDE4 SHAD.CORTOPASSI
889,563,631 *5C82AF7C1008D5EA6BA2F2E3F5B15EBD851DB017 TRICHROMATISMS2
889,563,632 *5C844A3AA684F1084F8D93562A39C2DE6964C075 TRIGYNIST
889,563,633 *5C8A57086A0831F925DCD9968FC65FA628BCF56A trisha-beuning-preusser
889,563,634 *5C848FCE84C132FCD28D759374983B62477CCF3B TRISH CATAGGIO
889,563,635 *5C83B68E002E354BA95418881EE82014A598F97B TROLDERELLA
889,563,636 *5C89998274CEA58CC59FD15A2E1EC126EAF3BAF0 TTTTTTTTTTTTTTTTTTTTGAGATGGAGTCTTGCTCTGTTGCCCAGGTTGGAGTGCAGT
889,563,637 *5C8636F9C3D416010BAEE0F30FCF4BD5904584DD TUANFREVER
889,563,638 *5C83E7EE52FC73322D6A2BEB1112323102C29883 TUCKMAR6
889,563,639 *5C8C5757DE6F15FF6A1B54A06827F440411E3A23 TUGHRIK
889,563,640 *5C8BEED3909A492D83FBFB468B327EF23540C1D4 SIDTHESNAKE
889,563,641 *5C85D597CAFBD1458BCAB522F957782AE5A8A3BB SIMBI.DLO
889,563,642 *5C89577E27E451F88FCF457253F81A52690679CE siow.zi.shan
889,563,643 *5C85A58BEDDA4CF020B2B9CEA3F34FD044DFDF3E SIRREE
889,563,644 *5C81E13F26A78DDA725C07C8576ABE4470B6F7C8 [email protected]
889,563,645 *5C8A59476106FB2312E32CB8029222D103245A8D SKCOM
889,563,646 *5C87138CEDBDF193705FB77F079CCE9EB3D20A15 UAINOLOC
889,563,647 *5C89856247498DA966CD3C988D7ACA3B12EBD497 SLUTAFRE8
889,563,648 *5C820883ED5C3EC4C52D37C78245D618939CB16E udilu54
889,563,649 *5C8961EBC417CB94691F7F3AEC80CEA5871D9B47 Ufdemanger:Tanz
889,563,650 *5C896652EED2BA7DFE2187DE30EFCF1A4ED50078 SNELLINGH
889,563,651 *5C8219648E2DAF35607DA4025D0E41FDA5E29581 UMENADILH
889,563,652 *5C8DC3FAC420675C3CB0BD1D5911BD4D65968448 SON.ANSTINE
889,563,653 *5C8E83251FF4579D4409A14A32C8E3628DF79DB7 SONATAINDMINOR,K.213:ANDANTE
889,563,654 *5C8332DABDCFA6F5BF423A6D713C3418AC8115C7 unseceding3
889,563,655 *5C880B3919A66F14DF66A4029109CA5B76BD1C26 SONICSDENISE
889,563,656 *5C8EF386FBA459F14C3227142CCE85F910904773 upon-the-face-of-the-earth
889,563,657 *5C89AA3AC3BAC96E72605EAE60A49DC0B289715B UY1H
889,563,658 *5C8A4AFB2D7E98E8882FFC9C34A572B81A16F3C9 V3R+!G!NOU51Y
889,563,659 *5C8E92ED2C376FDB8C5B6D64C9B2A22219307A50 VAPOURWARE3
889,563,660 *5C876D02C1ABAB03E1FCD886D1686A72FB186798 VAUGHNHERRMANN
889,563,661 *5C8089823DB5DEC3425774CB7B978DD1A932B43C STACEY.NONDORF
889,563,662 *5C87C35E82356C171EB0F8BF51B62742C01476E3 vegas-slenderella-rennen
889,563,663 *5C8280E7FF7CAE3E6950D4F97619DCEC54C0A14E STANLEY.VEBEL
889,563,664 *5C8E19CE86BE05EF4B8C883C916046DB7646CD0A STANTOD
889,563,665 *5C8923757446438CAF8397AB9FC64FDEE19D98F7 stantonbirchler
889,563,666 *5C898B21591BF63101C7E482232BE20E227B8F55 Venus-probes
889,563,667 *5C8F2594B619FBBCF7D19D2C41B1E81A6B960CE3 STATIONSANGO4
889,563,668 *5C8DCA76272D04A375D2F83D3726D0A8AB03AAB8 STATSPAPIRERS1
889,563,669 *5C8B869D4360DE29B83B5A63AEFE52B2DCAE7807 verification-requirement
889,563,670 *5C872265C014915646C146236E131E2CDB25E71E VERMEEMREV2
889,563,671 *5C8C424D1911ABAB379C9BA9B8EAAEB2BF474F5A VERNONCABATU
889,563,672 *5C8D5904C9C95AADD7C40079BEBE9881A6AF1506 VĚROHODNÝM
889,563,673 *5C85286DD2AB465D684C818CB01ACCBF97EE8043 VIBHU-VAIBHAV-AWASTHI
889,563,674 *5C88D677EDFF6FF424C9CDFFD8A7AEBE1EEE603D stopverf3
889,563,675 *5C863020CD893C3D87DDA80518C5119A64AE426E STURZTEM8
889,563,676 *5C808927133970C0ED801892D05A5E2A455A4EE5 SUENDE5
889,563,677 *5C8F8AAE12D0EE290B2632BE627B10614444F1DF sunsetcardinal
889,563,678 *5C8E4E2A989316D14E8C94F8F7CB9160B977E083 SUPERDILDO
889,563,679 *5C868E8747B0FE488D42C08A718278E15C55F1AD vlei
889,563,680 *5C84EB6B937576412FC4660F2EF45DC9AB7A3C8F VRUBOUNOVITÝM
889,563,681 *5C86D11B3FC8938F5B7C251510015B0F424DCAE9 szaboroland
889,563,682 *5C842D7C1242630A107E00CFF82DC646E01D1E89 V!WN
889,563,683 *5C85053FD2024B35A83C4BC03B734BBEF468FEF9 [email protected]
889,563,684 *5C8A401915DA18D25773C4BF45ABF4364C783AAD WALTONKESSELL
889,563,685 *5C8B335FCB72A90058F689B98162D5655A69141B TALKJOSEPHINAG
889,563,686 *5C84AE071036EC101E3C3F57C7A58E1C817B29D7 warnerbirman
889,563,687 *5C8A3A174D55E51257424BC4849FA3D0708B891B WASSIM-KERDOUD
889,563,688 *5C8537CF390ECF08FC9F60F7933B84C32033BB00 TAPSAIT
889,563,689 *5C87F789BF0F6E97778F66C41D3980BE9758FBB9 TASSERRESSATING
889,563,690 *5C8FE36E56DCD408662F1F3399E044EB006B561D [email protected]
889,563,691 *5C8AF2AAD2F049BD41C20B2E6B334F28B535F3EC tboneraymond
889,563,692 *5C84CC4123A0C163D90715D0BA9D3DAC627DF930 TENGGENT
889,563,693 *5C80AFE8A030B10C8E60D29C3D8D0A295BE7387B TEOKREEM3
889,563,694 *5C8185BE6C69972CA3EE959AF7891FE20A35C379 WHO-WILL-SING-FOR-ME
889,563,695 *5C8625CE02F6B3DD342F2641944B957F31654D0B [email protected]
889,563,696 *5C8757804DFBAD72AE492A22AB7C4BA2BD64154B WILFREDWALLINGFORD
889,563,697 *5C8B03F15C87A260D91058CF1B3AE1A2E044E86B WILKINSONSTUDIOS
889,563,698 *5C80349C40194A225F28F8DA1BD262C433797C25 THAD.GLASER
889,563,699 *5C8DFAB68C5B8BE27FEE71BCD88F783A8C839BD4 THAN TH
889,563,700 *5C88050CC046BDF8AE2527A301D6DE1777745304 THE-BALLAD-OF-DR-LOVE
889,563,701 *5C8690E9458A9A6B1E9597EDD29B3EEDA9D07478 THEPENELOPE3
889,563,702 *5C88D6EC5F4AE72DD22863B1944E0A41C39F945A THEUBITHA
889,563,703 *5C8CA2D45FDAEFB465ED9961989EF69D48F0EF8E wreedaardiglijk?
889,563,704 *5C87C11BC937466D2729F183F22617FDC98B0C05 WWW.CAA.CO.UKDOCS213
889,563,705 *5C823808BC21ACEE0FB71060F6FF1121E543E1E4 wwwtbshowscom
889,563,706 *5C87288BA7FF32F5A97CA87F0E54C29FB596B422 WWWTHELEGENDSCOM
889,563,707 *5C802CA7C7FE63E38C3FB115D6700EC1B29D00A5 wwwtrulyobscurecom
889,563,708 *5C812861E4D6509FAE43DFFCC8F8F3C892FF1AD0 wwwucmpberkeleyedu
889,563,709 *5C86221C72FF00739EA9CBF2C189C366E966FD14 WYATT095
889,563,710 *5C841D96958D697739D7E8E003E87D9A49D610E0 )X( 0~ <####P
889,563,711 *5C82733E09BF64A1BFD5704E7B6A4915195C3850 XA4H
889,563,712 *5C85E984E63BF3256712A796DBE50EA777BD4047 [email protected]
889,563,713 *5C8860859B74F0C6512F9FB99139AE05CC8A41C5 TOIVOTTUJA6
889,563,714 *5C88F2F3A0C1B590724DF5DB0BAF97F296A08C0D TOORTSDRAGERS1
889,563,715 *5C80FFD3926C8375CEA79315CFAB4FD8997F9B32 TOSXARXIJT
889,563,716 *5C89CA644BE58897E5407975491E67F0C1EA4CFC XTREMEPROT
889,563,717 *5C814909CE0FA9D903EF9D74FBC80A2301A5622A [email protected]
889,563,718 *5C8090442BCF91AD5183BECB77A3FC5B8FB6AFD8 xv{y
889,563,719 *5C8B962453803EC96B65E7F4F5D85AA9C275ADE4 TOURDISSANTES8
889,563,720 *5C824625CF5B4CF48E13CC9648093F5FBF1B0F42 TRACEY.SNOW
889,563,721 *5C84F99F1CA043133DA81A396899FED5778268BE TRAMWAYPARISFR
889,563,722 *5C8CFD283FD9B445BD06EE113C45A0E026C4BC0E yaghoub.pourhossein
889,563,723 *5C8D7CC0D04497566B7E07DA7D588CEBD98AEA98 TRASGREDENDOLA2
889,563,724 *5C83CE8378B82B562AD4B10CA1113C632543BD7A YANJIUZX
889,563,725 *5C8A4DF05C2F1688407B64DA30B01ACFE8873FE5 [email protected]
889,563,726 *5C8615E487C991AE6F03517D011DA1F3B38C58D4 [email protected]
889,563,727 *5C840D2AFE2195185EDE3CC76294A1B6F789F543 TRUCK.WITH.THE.ARK.
889,563,728 *5C83D4CAB45D32AF05AAFE05754F545F4B39A2EB YOUNG, GIFTED AND BADD (THE REMIXES)
889,563,729 *5C89CA6B2A300628B66D998957EEDF5F812EEC5E youniqueeason
889,563,730 *5C873A12258156D97BBEB31E1F9D4951902FC310 YRZ;
889,563,731 *5C8116A3E74B7A8E08E5CBD09FAF16B894A35F16 YUANJELOSANTOS
889,563,732 *5C80FAE4E0CE4CED0A6B4B07A5E01B60830BF196 [email protected]
889,563,733 *5C86BFED0AF23209B923FF6668CA7A22BDE77B5A yudhi.hendra.pakarsa
889,563,734 *5C8D4489D62677B412A6BA0818E549407B62970A TWINSGARNET7
889,563,735 *5C8C8443A43731572D6475A166488606C5450A50 zaine.bautista
889,563,736 *5C89DD6C9652E773B47B97DC21BAE5D3DE3BDAA7 UFIML
889,563,737 *5C89F3A197A8C90100F907484CF8CEAC36161B69 ULYSSES.STRICTLAND
889,563,738 *5C8DC8AFA27D7E47D073446F0D17558A9710D564 un3xplc7
889,563,739 *5C8644FEA285EB820628A6D851EE5A0DC7CFCB7F [email protected]
889,563,740 *5C866321EF4C307E919CBADD9820C01E2DD8EC14 [email protected]
889,563,741 *5C82FAB18D4E634BBEA2E8740A8145885DC11B85 [email protected]
889,563,742 *5C86CB6BB1FFCCB8AA2698E16D408783790D258A [email protected]
889,563,743 *5C88B4B3F87E1AB8A06E510B80D5309125649EF8 UNEXUBER3
889,563,744 *5C8091168C0BB8286B5867C563D315DD3B4D4113 UNJRVEENED
889,563,745 *5C8E36BE9EAE247053E052985B1F34D633C4CCD5 [email protected]
889,563,746 *5C8C3CA48FBD6CA3C4326FCF42442395C103B52E zinātnes
889,563,747 *5C8DA90A60C569A4804F62799F79E560E50AEEFE USER12891110169
889,563,748 *5C875E46CF35BA8A3595CE9B77C2D5053E697F41 USTAHDON2
889,563,749 *5C8FE6E1A1055790E9776F9E7858EC9F8FA00774 ZWEISATZH
889,563,750 *5C85E2A4F93A42923A1B1447B98E2963EEF4C9DA [email protected]
889,563,751 *5C8936C6FF3328DEAA0754D5C81BE3D0DD60DECA UYENDINH
889,563,752 *5C8689C4143BE7A4F05CE5D7483B2A5D3582CF4F VALBREST
889,563,753 *5C8004479DE0593793BEE0BAEE007A97FA882575 буррьель
889,563,754 *5C89C12882ABCD293A9355862F52C52AF8303462 ВЫСТУПАЮ
889,563,755 *5C8A5ED347DD12EC2E8AD8B28654086839CE3B44 кроасе
889,563,756 *5C85EE195AA55C2DE816E882A1026F96A9E0EB84 [email protected]
889,563,757 *5C873F645D9F43E8BF1E33BEB48E226416BD4606 ОСТАТЪЧНИЯТ
889,563,758 *5C86DB7EE085E2A16E380257D3684A54B682CE39 ПОРФИРОРОДНАЯ
889,563,759 *5C86E30CDE6BAA9D8EC8D1169B5AAC1BAA7D2345 ПСКЮЛЛЮ
889,563,760 *5C88D07B81301A798EE94E04184382762AF12825 разочарованием
889,563,761 *5C8FB74C9965A8E2F43D542590D8FE0CB8F7B7A4 vicenteruge
889,563,762 *5C806DED62BB40DDC318B33177486E538AD6A990 ТРАНСЛІТТЕРАЦІЇ
889,563,763 *5C8AB40D9B9AF0D2F11CBE567C89F203CFA9F2A3 VICTOR.OMBASA
889,563,764 *5C8C3DB7D2656422C9CB90D7EA80165C3EE77C8C vidy.aza
889,563,765 *5C8A02A92209CFA7276EFF82F310BA67B72B84FC ЧЕРНІГОВСЬКИЙ
889,563,766 *5C8E69B43EB93B4936C0E4CF1ED41A0228453FFB VITRIOLISER1234
889,563,767 *5C89AA47CC49BD498F61818A6CCB9669C262D0C2 の投擲が非常に効果的である事が程なく判明して装備に追加された。かくしてSTOßTRUPP部隊は、手榴弾の打撃力と
889,563,768 *5C8EDA3D23AC7131E7E5A1A1892F0D67CB2E48A5 Wayne.Newman.&.The.Torques
889,563,769 *5C8A99E06F22AE06A9FA5A2331EC60E6E925B09F WAYNERONDA
889,563,770 *5C85AE2B88AC635B062DC638DA1AB9B36F9BA9E2 [email protected]#
889,563,771 *5C8C85501F9578EEE9DFF655F063C6F60F63B740 02221251
889,563,772 *5C81F8372FE3329A2F3D69F9D2162C1D36790855 [email protected]
889,563,773 *5C84FF24386886D2C39D3C208EAE65EC27074480 WHATYOUBEENDRANKINON?(FEATDIDDY,PAULWALL&JHA-JHA)
889,563,774 *5C8F8B40792633A935BE924AFEF57FAD023E63A3 white-shade
889,563,775 *5C8AE80BC2E35CF724C071D120267B290DC5E39D WILBERT.TANEJA
889,563,776 *5C8BF4963B610597F74BB8D0922A601F2BC2715E WILDLIFEHEALTHSCIENCE
889,563,777 *5C8AD6C25506355F664B3A0988FCA9C7207ED532 1173907 INSGESAMTGELOBEICHBESSERUNG.
889,563,778 *5C83BF6D3FFEC3BC529C04C1E53EAAE5E6F3DC70 WILFREDDONAWA
889,563,779 *5C816BC70BAE3A13E9FE7E01E8CEB4C920B0FD2D 1209197 P
889,563,780 *5C805AC11325EEC028DEA7165EF1321F9253BC52 WILLIAMURMOS
889,563,781 *5C86B53560E6D0E814F8518ECE315C7957EDA285 willisgleitz
889,563,782 *5C85DD8E673F723049D002CE391DFBFEB09DDB59 wiltonfilice
889,563,783 *5C8AABA26422BDF6AF34DD67BE540610B26A1192 WINFORD.POPA
889,563,784 *5C8B7A49805122A2F54AEC8616DA5B95A46A5E9B 149D32C359753F28A8D6174A50B98847
889,563,785 *5C84AC3031AE0F65E653ABACE63CFE1EB787D710 14.MARKKINOINTIYHTEISTY
889,563,786 *5C81219E4D9F0A8F68AD43204300E63856E163FB 15071082
889,563,787 *5C87D551132F16C5CE4960F674ECE6237072AEFB wjtu
889,563,788 *5C81AB83E54166860CCE67DC871736C7EEA9E9C5 177904 TEKOJEN-SUORITTAJASTA-TIEDET
889,563,789 *5C8563CF59BC1D5459242EDF15DAE1CD6030EECE 17G7
889,563,790 *5C85C188689D0E7072E6F19DEFD3F26E008FF68D 1993941 verkkotienrakenneonuudistettu,jasaatlehdenn
889,563,791 *5C83FC388BEB431F820C53ED4A8DA85ED458BA0E 1a2b3c14430
889,563,792 *5C862CDC10C893A6E8CC6D7BCAEA475E6A4B2DF5 1.ahbabligi
889,563,793 *5C88758F5EAEE5152E7F17554C2EB837AD60DF8C 1akturkt
889,563,794 *5C8A108A6654C7A49AE1D3D36588E9F742939490 wwwbio-geouni-karl
889,563,795 *5C89EF3ACB33D8D86CAA145783EA5A82A5D4E752 1ATARECNI
889,563,796 *5C892216836CB1E4A8CDE9DCBF7FF3E0CBC6A940 1auern
889,563,797 *5C8BFA466B416172335C427DBB522399DD8B7FD0 WWWMUSTBESOLDCOM
889,563,798 *5C82B564491AFFE5A34B45ED6658B5413E32311F 1brecht-werke
889,563,799 *5C818290F7077E42028376C362AAC890F7A13852 [email protected]
889,563,800 *5C82E6D506BE1999A687C686CC430260091FB9DC 1dancefloor-fluegel
889,563,801 *5C83AEE14EAC7585D94F2BC684AA125C7E65ADE8 1dauerwaldmodell
889,563,802 *5C8658816188F0C4C2338BE65BAEF9E7B64110F6 1.DESEDIMENTOIVAAN
889,563,803 *5C870E128DA298BACA39542096E491EFD57B2724 1.deweylla
889,563,804 *5C8900A7C407DFAA4FBF13E785742E98E2DDAEA3 XENIA.DUKIC
889,563,805 *5C8CB720911099032EC9BD634D6A95E12FB7CF0B 1-FAHRZEUGLOGISTIK
889,563,806 *5C8FB2774930FA187DCBE862CA1FE4C81616CC62 1-gemeindepfarramt
889,563,807 *5C883F2961046442B57D98C6B552A4CD700E8CB8 1gerhardgoetzmanngedaechtnisturnier
889,563,808 *5C8C26EF9D129E932123DF63013C9A9FE7E27CA9 1.glaszylindern
889,563,809 *5C839D6C1972F3D0EAAA3BBC0B560AC363CA5464 1HIIDETYSS
889,563,810 *5C888162F3E57E401A1DA58BCFF6878A6C6AC7F5 1 HIPHOPLADEN
889,563,811 *5C8E89518A37494F07E805A3765F53827539CAF7 )X(.O~.0~.<==8
889,563,812 *5C8CF08D3786AF8A4E92AB7E49730F8674EB25A2 )x(.o~.o~.<b
889,563,813 *5C86FA2B391B7BE2D8EF193C74B3F56700B5AE8A ygoloihtela
889,563,814 *5C808C4E8B6A9FC767D14E18B3F830A10F4FB107 1-TELIVAT
889,563,815 *5C88FCF5583AE782FFAB4F1EE7E1AD30F3990F19 1 TROCKENVOLLAUTOMAT
889,563,816 *5C8EC953615FAB87A1735C0C653A8183FB2D4689 YOI
889,563,817 *5C86D50712F93D33F23D76AB062727354D447A23 your-heart’s-desires-be-with-you!
889,563,818 *5C8002D94D532330D375BAC21803F0258371340A YOVONNDA
889,563,819 *5C8E78ADA08EFCF41F79A0E3375AEF08EAA2C34D 22FILMSCHAUSPIELERIN
889,563,820 *5C8802D93D49ECE070CCB7C04C2954AB095CE095 yussyuss-shamsham
889,563,821 *5C89C0E38616B6B30FE8200E922AAC371CCA37A1 2341859 ON-VALITETTAVAA-,-ETT
889,563,822 *5C8E5E5B30ABFFD39556AB52327AEB63C54F97BD 241247 peki.,.bunu.niye.yapiyorlar.?
889,563,823 *5C857C7207BBDBC4168E6783200DA61E50B86A9B 24V
889,563,824 *5C8D017A981E9701978D19012F2CA9C8B7412C2B 258367 helsingin.yliopistossa.toteuttamassa.opetushenkil
889,563,825 *5C85BA4C905B8A5CC87A23371A2F11A95DAED799 259938 darananschliessensolleinweiteresbaugebiet
889,563,826 *5C805EEBA39D75C985E9C710EE2E49B8179AC44C zaki.alnaji
889,563,827 *5C8834FCCFDE25C6D08168B456F846F4D6A8C8EC 29.01.1395
889,563,828 *5C83ACE5C78777331F93776ACF52903E18850089 2954509 kehitysmaidenomayl
889,563,829 *5C8D00BB4995C587341C0CE849562336CBB947B4 ZANEKIEFEL
889,563,830 *5C8D83FEFB1F13FB6854033C20DDC1E30EFAB827 zay-il-3sal-(upbeat-egytian)
889,563,831 *5C81597BED6478EDEDE2A6CFB145305E557DDFF1 ZEBRASTEVEN0
889,563,832 *5C82A538D1E25A62C70A5D6F544B9F591DCCE9E5 ZGM8PT1EAVY
889,563,833 *5C876A61840C1D0E795AC6FCCA95656F950A91A9 2M0A0C2
889,563,834 *5C80BFDC11A1F96BE552952FD052BCA7FCC4221E ZHEL.VILLEGAS.AI
889,563,835 *5C8805CF0229275DBC21BE31FD927F66D8773B94 2MXK2EQMKS53O
889,563,836 *5C8FEBD7FA4A0D8310474E3DFD3CC123BCBFD1CE 2VULKANISCH
889,563,837 *5C8EE5ECBE76BF94530CB8004773302D7971E194 ZONEGAMESZONEOCDLLZ
889,563,838 *5C8998F823F223DDB29B4CC42CCD17020D6BA599 ZOPHAIBSW
889,563,839 *5C8BBDFF9D1311A9AB72BF7D9C304002C712CE47 ZOYMPOYLAKH8
889,563,840 *5C86384B22A22C38EACF80C12E210DF4429BD27D 3->~0.~O)0(
889,563,841 *5C8C68E7891484FF8FE7917C4BAFA93413A9C2FB ZULNURAINN
889,563,842 *5C85859C83CDE87730FB7E372DC3965387F7BF58 þormóðsskeri
889,563,843 *5C88D6E0C2A3C5F5CBCFC895F89773291355FBDC 3arome
889,563,844 *5C88F09B37012F14C75A67ED90DFB0891845362A 3EAGLEDALE
889,563,845 *5C84FD352F34D7DBB13D694A1FEE4245AFD52DF7 3-frIgoduman
889,563,846 *5C89B228FA5F4DBB18CBD88BB2AFD555B015032E алеха́ндро
889,563,847 *5C8A9AC5AAFFAD2726D8E5EB7D3A5CD00E9EA2D2 БУЛЛЕКУРТЕ
889,563,848 *5C8FCAABB5216893CE437CEF96949DB82572D23B 3MRSTCLLY
889,563,849 *5C8B17D91AE04E300F34FCFC4E5BBADBE2F57CD1 3PPPCRAIG
889,563,850 *5C8F19AC51B69F67C8E2CA51F6914A75CD9FACF3 3UXORATO
889,563,851 *5C85FAA931D1D96B6E7B7D56FC79A42802814C52 КРЋЕВАЦ
889,563,852 *5C81E33774656DBC0A8F047178A30D59A79730AA 444673 LIS
889,563,853 *5C80CE2DE72B39B18970D41D5A5914CE865C2CF2 457ZACKERY
889,563,854 *5C84EE4A3AA149E21E6430FBF059669EA31F12C3 45MICMEID
889,563,855 *5C823F2BE13B59A5B7EB8DFB6F7CEAAE47E03629 4.HUIPPUTUTKIMUSYKSIKK
889,563,856 *5C82D22CCDF178B0276C967261858F113CBB0C29 ПРОПИЛЕІ
889,563,857 *5C8163AEC5D7C18492EEAB408AC1021BCFCF217A 4LEGNICAN
889,563,858 *5C8B9FF98CBEEC85BAC6D261E16B70E018BB0AEB СВИТКАНИ
889,563,859 *5C89D09F01AD2AC806A40B6E986810909A5D5317 ТЧУЛИ
889,563,860 *5C8AFA901882FD72800240C186AABA25EBE1D38E 4PEGGYRENEE
889,563,861 *5C87080131480B8AEEF307F2DF80EC5F87F03FAE 4SUNSHINORANGES
889,563,862 *5C873C94014D19DC0ECA2DC48104A91C81DF5682 傘下A)
889,563,863 *5C8B4235639FEA759686A50A3483B5C83A5B2547 59QSEFTHUKO
889,563,864 *5C809BBF0EE1477F1EAAFA3E36E25253CCB9CC8C 5-auswaertskampf
889,563,865 *5C850B80C5C062D1503351E34369DEE3BCB568D1 5BFD2FE5
889,563,866 *5C84171B52501EA191D28E133A91A08FEA86E028 5BROADLYSPEAKING
889,563,867 *5C8C900F57D6960BBFA5BF61DF67B8614562B555 5BSWREPLYABLEBSW
889,563,868 *5C8940E69AFC8270D946A5F53B343D88D2BEACC0 5CUPROTUNGSTIT
889,563,869 *5C8D403B7F4F9444BD6B966A9A0BF9BF86B6BC1A 5-KOHTELEVAA
889,563,870 *5C8C4B86BE39BC8CE2215DCF689B2052EE1709ED 5LKEHORST
889,563,871 *5C800248E8041795A4EE3E03BCDB26C31FC8A72F 5MIDORIRAINBOW
889,563,872 *5C8D56AB4EF84D00EDAAC76115AB467A6A7BD5EE 5RSIMYSN
889,563,873 *5C882CDED29A8AED87E29CC92F6509D44B3F2BDE 5THATRAVEN2
889,563,874 *5C845F6331C5EB9603BED74F724B8FF66A3A2171 5TRDNTLK
889,563,875 *5C893772B1BE4AFB9277D39E8E227FCAC8F1CF44 [email protected]
889,563,876 *5C868D83E85D2F68ABC4C55A5EE54A371A056EA9 6:6#&Ruth
889,563,877 *5C83D140D5206C6ED6AE8C5DEC3CE00C861F4898 6FESTHIELTEN
889,563,878 *5C844F0E5C89E0616E3D875A345CF4BA7BD26573 6IAMDAWN0
889,563,879 *5C8C2C9915A44B5433580E1BCC1C3CCD23BA4AEE 6PARTIKULARNA
889,563,880 *5C835225EB85E897CFDCD489ED8098BFDBF1056E 6SPIRITJACKIE
889,563,881 *5C87CBC26C1BDD985385DB278D69AA4298FFAB43 6TIAREIARBME
889,563,882 *5C875C5C1226712C759BB3F04B05C8442A3A7F5A 720 bafa bilgisayar a S
889,563,883 *5C8C9597CF8CA4AEBAFBB7ADAAAA070B4BBCEB90 75216 kullanIcItanImlarI
889,563,884 *5C89E2DBAFBC6A23AAEBBF1A76FD873C0E42C5F2 756122 IHRE.TEXTE.HAETTEN.AUCH.HEUTE.ENTSTANDEN.SEIN.KOENNEN..
889,563,885 *5C8CDA6410DAA77768EB1EF871D2586676A51FE0 777496 LOMA- JA KURSSIKESKUKSESSA TY
889,563,886 *5C8483C4A263D98B7819F6000A5977B609F81D99 783SETH
889,563,887 *5C84C702D799110CDAE1C35F5E31116FABCA4CBF 797yahir
889,563,888 *5C829E991F293F7B52AB5601742F5B6EDBD22D84 7LOGENSTRAFFIN
889,563,889 *5C8784DEC9D668A722E1C32FE30BB78A622E00E5 7MINJIKET
889,563,890 *5C89AA2259553C86F59B54E11A08E844F4EC60AC 7mylizzy7
889,563,891 *5C89A7366F27D6B9FFD296705E7428F9A927420C 7OFFSIEVESIEVE
889,563,892 *5C869210DB7187C07C4EC0F192D765F0F394402D 7PERHFANE
889,563,893 *5C8ABDF10B121BF79C4CB8EBA7F624793F08CB3E 7SPACE1
889,563,894 *5C836E5E48041B5452ED44B971AB45F89EB0ED81 7TRANSMOGRIFICATIONING
889,563,895 *5C858308A7D04E0B2692994577B8924859C9AD15 827wgt
889,563,896 *5C8E7122E33978783E4767F72BC30C162404691E 859ALEXA
889,563,897 *5C8750D2537F1ACBB788F6CC514947A80F8FA88D 88109 ARCHER-DANIELS-EASED-1-/-8-TO-20-3-/-4-
889,563,898 *5C8E7C32967102D75C603C6B5C70EEFCD0F30ACC 8BSWHAEUSERZEILEN
889,563,899 *5C861F984DF5EEA91A3CC9C8E5CD5A10942CFF6C 8BSWRHORVATH
889,563,900 *5C8954E7AB70C9C5BCA84E68E1BCF67FB6367788 )8(~ ` D------B
889,563,901 *5C8EAF0C8EB2C6BD1B3ACDDA1A0131144B00E1FE 8DESASISTENCIAS
889,563,902 *5C8C8C075BCA3A4DE6FDFFD030BF96A4EB7D426E 8duke9
889,563,903 *5C8FE117AFAA217348491861BCDF56FD155063FC 8------)~O~o)O(
889,563,904 *5C83F82651C12EDE1C35571199DEF94D84855C38 8PENTIUMREBECCA
889,563,905 *5C8E697AABC1CA8043325CD06199B292B1606544 8RATIONALIZATIONSES
889,563,906 *5C8A844BC5DE09BC6072013F3F166EBA3D9F0609 8.VERFORMEN
889,563,907 *5C8EB1DD910DB1092C367291EED71A769887EC74 8VIZIERAT
889,563,908 *5C8C80FF6B8FC4DC611F28EB30295C9F8B3E3144 8XMONICA
889,563,909 *5C83626075C005543CFF937D1C33443C3B852B20 905197 kun-a:n-asunto-oli-oulussa-,-pidettiin-oulun-toimipistett
889,563,910 *5C861ED84C88842C9F75592B0613CCAE1E1DEDD1 (-_0)~`.~`.<###B
889,563,911 *5C88F109A66FF4EE3F163DA789A8AC238016AA21 9BRUINTJE
889,563,912 *5C8382FC0F93BC8B21F32CC5072EC2285594AE38 0MADDIE8
889,563,913 *5C8FB2786356AC843A5B1A06EAE7F77F37277AE2 1053255 man-solle-doch-erst-einmal-dort-anfangen-
889,563,914 *5C8ACFC23E2466D87A854465A0F1F5E67CACD7C8 10OCTOBER1415
889,563,915 *5C806854EBD638B94E037E1FC0F3CEEA64321F78 123CAUCASUS
889,563,916 *5C81C3C47BC7197DF027FC6AF93FCE0CD619E70A 128808 AINEISTOT-EDELLISEN
889,563,917 *5C86FC5B7726FF6C36C3C8479D42FA884C035426 9LTSYTEHL
889,563,918 *5C82D34D81EE7033802BA8D1F8A32232E331F671 137767 bomermuhendislikhotelclubedemirtasmadencilik
889,563,919 *5C8B26B0255B818C41414F646E87E6604738C4CA 14AUG1631
889,563,920 *5C8B89694C4794A0ADB2CF98AEBB9E6BE24FA409 9PIZZDRIN
889,563,921 *5C8D00C36F8124439C63E44CC0C3FC818A2C7FF2 15 PERUSKOMPONENTTIEN
889,563,922 *5C8242937A1CCEA8334E430753D7C60FC9821CEB 1768162 GEDICHTE 191-196 . SUHRKAMP VERLAG , FRANKFURT / M .
889,563,923 *5C833395439A6CDA984705BBC7375BEC72010805 17.EUMAAHAN
889,563,924 *5C85D48E15786415699F643637FB22EB40BA37D4 1919395 NUN.HAT.MUSIKLEHRER.HARTMUT.KREUTZBERG.SEINEN.AUFTRITT..
889,563,925 *5C8A56373BB34E38AF507F102768F050B296C004 1969PEACE
889,563,926 *5C88CA3B8956C9033B6636488F2183563A517576 1 APRIL-SONNE
889,563,927 *5C83FF8CCF82B5C8B23A0F93DA317574C28889F9 1-BARRIQUE
889,563,928 *5C80FBD9CB170378474F8C0450DFA0DE5B1BE9C7 [email protected]
889,563,929 *5C82D1C1EEF88E20400B47B5382393DC4566770C 1CABOK
889,563,930 *5C822006638D9069B0916E2D0EB0AD1EB3346253 1 DAHATU
889,563,931 *5C8011EC49055F6A5424E60308C714E391995FFA A4Y
889,563,932 *5C80C22ABDB3ED93FA6329D741A91D05FFC6DB26 a!8&,
889,563,933 *5C8BEC9360CE7E7112B45425F4ADEBDCD7ADCA3B 1-IHREVERTRAEGEERFUELLEN
889,563,934 *5C89F4DB6DE8B03723F3F90449CFC257F75015DB 1ilovedallas8
889,563,935 *5C897F73CF3F89CA0A02026A00CE602ACDD32834 1kumij
889,563,936 *5C8A81EB7D2AD182E360D0D46A106F0AFFCB97C8 1LADELYN
889,563,937 *5C8626631C92DF3BB3AC9B815D432516E1DCCE6F 1.MIDESSEX
889,563,938 *5C89D5CD44481B383810D614C8323D446F37AA73 AABD<I
889,563,939 *5C803B46B2695BB989BA1EF1A782ED7EE72F3514 1 PAZARLARI'NINDA
889,563,940 *5C80A16DC046D31D2F5D87188792925A8166D611 aaeei*
889,563,941 *5C84BF5116AFD7E47B1B7FB179B506A18FB0351C aanwaaide
889,563,942 *5C85FA121C83EC8BB49349B1D7D6939A31DA621F aaron-solberg
889,563,943 *5C834C31B1E613E6ED2E10CAFBB341E35F07F60C 1.shmulig
889,563,944 *5C869FD531A5E95AD637D222091731D7427881E2 AAUJK
889,563,945 *5C80D353710A13E269CDE07C382CA1C1CB57E967 1TERIUQS
889,563,946 *5C8C670A95D04372129F90D2C9FB07B28C2A9D24 ABCRUNNER3
889,563,947 *5C8DA3BBFE3929BAC0C15DC9449023A065D4AA77 1.uyarladIk
889,563,948 *5C8E0E426D4F130C47340AFE9E9066A6E255F50A 1vhf-uhf-vastaanotin
889,563,949 *5C88A970DA698341FE08D73D033397FCE0AFAE7C abk1q
889,563,950 *5C833AE530D0049B46FDD2C1D063775D2666BA74 2072795 SOBLIEBENPFERDUNDESELUNGEIMPFT
889,563,951 *5C838928D8D0A48F905DB046028E2D66937D9525 abukari-mariam
889,563,952 *5C8F11B0DC54C8051719C649693C9BF1D0075D09 2300332 GEMELDETHATSIEFUER200,400UND800MFREISTIL
889,563,953 *5C85AB1D33BDB20DCB0574781594248F1FCEAD1B 2459344 '-LETZTLICH-KOMMT-DIE-STADT-NICHT-UM-NEUBAUTEN-HERUM--'
889,563,954 *5C83A5ABEF0B90A392CD85D03A6DC9B007D037A9 ackm
889,563,955 *5C80C4B339A7EC70D49F3C252D5992A843B02BAA A(CLQ
889,563,956 *5C83A8D15E09BEBF4295E3B9D950BDB15A1B2334 ACRONYCALLY
889,563,957 *5C885849A7CB1255581E29A133960020C8536207 2696547 yksi.kurssi.v
889,563,958 *5C86F5BA04FA63015513A5E5FCCEFCDD3AFA0731 acx`f
889,563,959 *5C8496B7D287965A9AAF2494006B808BC45EDA84 ADABBUJ7
889,563,960 *5C85B41CF0CFF1439E495CAD099BB45799AEB119 adifferentman,partll
889,563,961 *5C841FC34EF6D935F750EA1CC74C78A32D8EB3B4 2FFRONTSERVLET
889,563,962 *5C8EFCBE9EAD662AAE240A3A414C8BBFE3E65260 ADO1F$
889,563,963 *5C89ACCC168101D5FFB121712538ECDAD9168D6D adw6
889,563,964 *5C8879B65277578E960888E29802C19E1954D869 2NACHGETR
889,563,965 *5C8919CC7B49D7E8CF73D9DA60C0D0FB83BCE4B3 AEROPUERTO DE MAPUTO
889,563,966 *5C8F528A46A771F75565E5AD0F2FDBA1C87B3DA2 aeue
889,563,967 *5C8A52DC5D988224A586C052AC7380B82EAC18C1 afstudeerde?
889,563,968 *5C80E07E5AECD58936B9F32477C26B0333213330 ah41
889,563,969 *5C8738313D1CF5C3352BF5EE63630C38D63463FA 3ATAENTSI
889,563,970 *5C89F2FA3184701D9C2B864D5FDEF3E8330DAE37 ah-nella-vita...
889,563,971 *5C888211364F8ACF3B874BEAC63DBDA842E4FF11 <aHReF="iNeTMaC.HTML">iNeTMaC</a>404,135
889,563,972 *5C86AA52883DC4888010A48740559BAAA7A747CE [email protected]
889,563,973 *5C81BF54BBFE2BC5CE9EDEDD5D4F95CBE34BEE79 3###D~0~O><
889,563,974 *5C8FCB537B524FF457F72D845C96C5BAC1CB5C88 AKAQ
889,563,975 *5C85E397B4945A298EE4E9A697C6612ED5B1F9C6 ak/t)
889,563,976 *5C8EAAD02B134807394137E2678B232D4572EAE0 akvwu
889,563,977 *5C83CB5F1843473A6A29F31798A83EDDAD5DE90A ALANA-GIBBONS
889,563,978 *5C801703CBBEC221EFA08CE3EB706F23C998274D 3SKAAMLIP
889,563,979 *5C8C0CBE459F585454F80EC62011576989E897C5 [email protected]
889,563,980 *5C8CA6A9B6B9857CC7EB7DEB3556A4736ACB64DA 3TREANAKA
889,563,981 *5C81921AE8A7C062666AABE92D37F32FAEA4AACC ALDLB
889,563,982 *5C883C6184FE0C0AFD3FF92799816697C8888B08 4071053
889,563,983 *5C872DA3F121676AE00BBA3FF63B147071560961 ALEXANDERIYKEEKPENDU
889,563,984 *5C8ACFEB60D0752E7FCA90FEB37007F80728DF6B 464elsa
889,563,985 *5C8956E8248CF5955BDF1370E8B06F244FF37793 47261Q
889,563,986 *5C84F34415353D582B75F4E6405D04314E90EDE8 478088 ONEMLI : DHL 365 GUN , 24 SAAT HIZMET VERIYOR .
889,563,987 *5C8B591351451F251A40C23E6C8EDC3F5300B131 ALEXISWILLIFORD
889,563,988 *5C81AF085FD5D1959AE1D19B0B0BFA5161EE9EF1 ALFRED.TYER
889,563,989 *5C8106D70204178068F6C03801972AD67F65B275 4.dokumentintekij
889,563,990 *5C85B740E4689075F80487B4B007C25A7312BDB7 ALI-MALL
889,563,991 *5C88B0930AAD29F67256E2718D25EA1072C08D62 ALIVIA287
889,563,992 *5C89B050A08E96404F7A9219EEC66159F7F59055 aliyah-santiago
889,563,993 *5C8C753B961B39512222E2DC703DEB250CB1163A ALLANAMATTHEWS
889,563,994 *5C8530A729CB4F7460D539992D17A322527EF046 4MARTHAMCCRATE
889,563,995 *5C8DA5EC767AB6905180EE219688564994C9AA9D ALONZO.MITTELSTEDT
889,563,996 *5C84FB068096287F51D61046C81D97D413C935C4 4.rastlantinin
889,563,997 *5C8F8CA0B67367670910ECF821FE9D625CDE5385 alvydase
889,563,998 *5C8E8E5ACF0E2DD1B7DD6B27C885A805C2E7BAA5 4SEEGREUE
889,563,999 *5C885581C6C45A2446186B920D4547FE4D911C94 4STAGNATORI
889,564,000 *5C85564487714DEBC654DE4AA1A065DDDC9B69EA 4TAKEFUZI
889,564,001 *5C871C552ABCAD44955F69B330B148534ED2E8D2 4TNEIAREILER
889,564,002 *5C8A6CE90EEFBEBF5D43B4CB190600A9D6473BAD AMBULAIT
889,564,003 *5C81CFCCD57B9D741FA4E5F21734B5069223D3DB amemoryregained
889,564,004 *5C896356E717BDB7923CACCC09DDB9DA5699CD24 ANAESH
889,564,005 *5C8A17CDE105AF0050FA944F8DA1DD55CDFA28C6 ANDNODS0
889,564,006 *5C8C33659375C8D21848449D860E871B263868C6 5CALHOUNCOBSW
889,564,007 *5C81853E478E3FFFAACE11D29D2F520B778B01F4 5CLEANERMANTRA
889,564,008 *5C8215E96B0ACA7B81CF963FD373C8897EEA8267 ANESTEZIS
889,564,009 *5C83D94F70BB167AF903D8F48E8DACB731919E1A ANGELAROWE
889,564,010 *5C83C4823FA3C89FB6E03923F642248AE362C4EB 5KURUVINDAM
889,564,011 *5C83390CF1FBA802B9A8DA2CE58EE83BED9CA549 5kwpdsum0
889,564,012 *5C8AC5D5E54F66A1BD672FF19F0E47E154F0E185 5NEDEOLBT
889,564,013 *5C8A16CFE2429FA9DD2BADF400E6DB4AD7512AC2 Anton-Rodgers
889,564,014 *5C8464E7CA03F6E94C2B0715A445ED2D0062CE99 anushakamath
889,564,015 *5C80441F103377554DBAA1904CFECED36D9324C9 AONA
889,564,016 *5C88B080AD2877938A4FD7BE97B2B3D33DBE7BF2 5SI8NO,
889,564,017 *5C881B6B5366A35FD6B37017D0367ABD5A0C0493 5VANDRERKORTS
889,564,018 *5C81341DEB1550153942B3CAE04CF765C0E5B240 a question of lust (robert margouleff remix)
889,564,019 *5C8618941BFEC5F4766C6D12952BF9C486986B35 ARGYLEPURPLE1
889,564,020 *5C8D12E1E443FFBDAA3E88899C4BDFCC59F4C9C1 6AKTIIVIKAUDEN
889,564,021 *5C830BE05BEA87C42D6E659BBA960100AC884769 6CHASSAHC
889,564,022 *5C811622D0324D0ECDB8859C270429B8ECFA586C 6CHESTERCARMEN
889,564,023 *5C8B9D25C130DE590B8303372CBFD9C1651CF6A6 ARRESTBKIDZ
889,564,024 *5C8EEDBE1151E097F42DFCDFEDB058019096FF48 ART.BAUMGARTNER
889,564,025 *5C8DCDCC1AACF5B59377FB82BBC8307DCFD6A2B9 ARTE-ARGOMENTI
889,564,026 *5C8A5EF473485069315E723AC60170956B3D7658 6GLDNJRN
889,564,027 *5C839B0A68D20B482ABADE682F8B5AE93FE33E03 6JACKWINNIE
889,564,028 *5C8DC446B2FE9CC27FE228D5585C87E442064B6A 6KIMBERLYMISSION
889,564,029 *5C85B151C0368AE17B8DD06EF7C9498BE079D712 As4(
889,564,030 *5C8F273BCCC354B637249E5A2EA39200E3621AF4 asepses
889,564,031 *5C8BB5F40BBD78190806F76888835EF14E486546 asiko mi ti to
889,564,032 *5C8B6BC3B1159C751D6B4DEA16C52C2BB59F70C4 6 POJILLAKIN
889,564,033 *5C80048E5E6125D04C645F6D4748270940B9A967 6REPOSEFULL
889,564,034 *5C83E44BAC2146A2D2C49C786B394E3D439F84F9 6SERPRESS
889,564,035 *5C828CBD92BB689AC1BDEDF2B1B69ADE305FA26B 6SHAFENAZ
889,564,036 *5C8EF47C82484094D0A94B3C47CC94F6EA28B8F9 6SPECTRIN
889,564,037 *5C80F3AD5E725DF051496AC76623DC2BC33F0E10 6TAFFYDEFENSE
889,564,038 *5C89B7D4253D68183DC88D7556475ADD22D321C1 ATHSYSTEMING
889,564,039 *5C826139FFA80AE7572783B2F40998F0ADBA5234 ATOV=
889,564,040 *5C8BE209BE1FEC9A49E91B0B5B563027303640A7 754BROOKLYNN
889,564,041 *5C853F8BD8E2D36122ED719864C57FCADA5A5D52 7AANLIJMD
889,564,042 *5C84AFA65EE63FCBFAE972CF04BA5779E0154FE7 7d972
889,564,043 *5C888B747016F4A1BAD4FA624B60B3FF9FDEA360 axn#i
889,564,044 *5C83F8B937DB31D22142C51D5EE65F95AC7D75AF 7iamgoblin3
889,564,045 *5C81B0B7879B2E8EB4ECBF9399E25C59F1E3A6E2 B103637
889,564,046 *5C8F3EBF6B61D16508671DA907A4A056E0DED8ED 7RONDES-DENIII-RONDE
889,564,047 *5C8D29BBA12BCC870F4845F08FBA4D3D8E4F3C8A 7SHIMRONITES
889,564,048 *5C87BC18100C6197F5007DE8FFD74732B06403FD 7TFINISHSESSION
889,564,049 *5C824C526A07B36CDDA646EA1A62ABFAB1BE48BF 7ZU0MYTQ
889,564,050 *5C800269F6DC4757CF237C3F978465AD56BCDBF3 8652812a
889,564,051 *5C8EAA5E09117E7998435BB02B6EE491E757AEFB B9C;?
889,564,052 *5C843DDEEF07FF50A66DE7B3FBE7A6A712F18145 BACHAPAN8
889,564,053 *5C8F7C3C92673CEC8CB50EAC4A4554348CAC7EDC 8ANGELTETEM
889,564,054 *5C8F7CF708B6527A3019545250113E0BC03F4F91 8ARECTANGLE
889,564,055 *5C8F771250CCB00BBEC404F65ADACA6E97F5B34B 8BEGAAPBEGAAP
889,564,056 *5C8306E69FEBF39B75CE58F7FE04DDA114791D11 8CALCOLASSES
889,564,057 *5C83628F5450492623C04281277E1AFC150488C4 8CIRCUMSCRIB
889,564,058 *5C882D02ADF5C5B7B2ADA7F57BC6809B02909CAB Ballermann.&.ApresSki.2008
889,564,059 *5C83CE999DF9F8A93A687D69898DD977FD58A4F6 BAMABURKES
889,564,060 *5C80B38AD715094A6DE1767E0BD7E87B9F96B9EF BambooLounge(Peshayremix)
889,564,061 *5C83E11656B2EE06FF4A5F554564796FE7966976 bata(
889,564,062 *5C87252F0191BF34765537CA9E0AADC2EB09CCA9 BB.*.*.*.~0~o(00)
889,564,063 *5C8DFD49BB233D3C9BAD12EE8B2067FD39C2A728 BBE%:
889,564,064 *5C891A31BC968F7C362C384F44212AF5B0D2CDCD 8PAINTCALCIMINECANECASTCAT
889,564,065 *5C88EDC994BCEC580F738F04B6F3EB8D9F4007A1 8PETHER
889,564,066 *5C8A747323C768B7B2210B77139B3A88B16B26AC 8###p~O-~o}o{
889,564,067 *5C84FCFF76DBA3FECF63D2D2800BE28313FBAB25 be6l"
889,564,068 *5C8EEF0C45CDB7814726C0D5D94F27C6A31C7FB3 BEKROZ
889,564,069 *5C88BCCA79EE9B8D4E6D1998F1434795DD99F3E1 91968 materielle.fragen.seien.deshalb.zweitrangig..
889,564,070 *5C8C0D0A1E9980738E5D8F7943A95F086C44F0C7 974013 FUER-DAS-KIND-IM-MANN-
889,564,071 *5C864448EFC5B96A827BB680E80031BA6B6D5490 bfd925fa86084bd0300fde7fd05ddd97-121314
889,564,072 *5C8623ACD493967E3980A153CED469670E0D552B 9DADDYROSEBUD
889,564,073 *5C8520B889886119BC01ADCB99FD2DF532223553 b-ft
889,564,074 *5C8538BA0D72D679B4C38C931013F186B1ECE601 9golflinks
889,564,075 *5C85121596A59CF5FA403B45A623D317A1E475EA BHXUI
889,564,076 *5C832621AC10B14DC12BAAD9FDCD25F586B2346B 9MOTHERGILLES
889,564,077 *5C8FCCC113FA6075CC90C67826FBFC430D1DCB5A 9ONAPLOCNI
889,564,078 *5C8B47CF593414AF60A7D30A7D9DC929FD24E9E7 9POPULICOLA
889,564,079 *5C8CE6AAD0694AC76CED9F1E817951FC83BD2701 BIM9T
889,564,080 *5C8006913011C681DF8C905D5DC50707123CE741 bj+fv
889,564,081 *5C8E9ECA61441CD29AA51928D53EC1103F62676D bjvv
889,564,082 *5C8183F783C1A096926B375353F8EC930990A11C a252720
889,564,083 *5C8EAE6A92076441469739E759784C41A9C88365 BL!+H35+
889,564,084 *5C8DEFC33DA382CE3B043D91065F700C0CCCDCA6 a:2t8
889,564,085 *5C8BB1BB5C5A361C3D517E171B5B7A141EBB8A6B a%2tm
889,564,086 *5C85CE716053FB4C729B023F05E6D534AF528FC6 a3ltr
889,564,087 *5C88FBAC94E080E89170D6EB134D92B3BFD1596C B-M43
889,564,088 *5C80903679DCD5F7D6B23507CEE0042C839B6E89 bp9f8
889,564,089 *5C8F7A68E908C13B91AC49DDA57E4A453938F214 bpc=t
889,564,090 *5C8FB631EBEFD666E8130CCA18431E02CFCDA935 BPGM1
889,564,091 *5C8D00DF1CBFEEEE4A199565D4F23C401087FAE7 bqil
889,564,092 *5C810DB6753B7220C94CC99FB68DF929C607A7BA BRANDS5
889,564,093 *5C8717AB7F3437E69C579999A5F427754C4F9D6B a.better.man.than.me
889,564,094 *5C88C738FF6DEA87F136E1010093FB64B99DBFA1 BRIDGET-ERVIN
889,564,095 *5C8D27F6D4B037B702438CB3C31AE7C261666461 ABRAHAM.DUTTRY
889,564,096 *5C818F20CA837633AAE7AFD5400BA1CCE761CDA9 BRODERICK884
889,564,097 *5C82E34CCC90924F67F5DAFE750EC60D5F161021 ABUNDY
889,564,098 *5C88D9AAA47837E9BF93B827ACC8A4254949E626 a.=/c
889,564,099 *5C8999052F9B85BD04282C3A094C381B49CE348B accb77
889,564,100 *5C81D4F0BAFF99DD5CBD42CD3EEA225E7760B457 brycenicholls
889,564,101 *5C8BF738AAEA5254EE0D20A4C0D5B4B0604FD3E1 brzs5
889,564,102 *5C8713C71F70C461C0BD7E987FF152AFA595B33F A_?D;
889,564,103 *5C8903DFA1D895F154AE4362214DF988321F2990 b)t64
889,564,104 *5C81E5DEC0843C757CEBCD91A5746EF4B3EE3DFF AD[FO
889,564,105 *5C85D101E0C6E6A2985844FB549CD54DBE608D28 ADLER2809
889,564,106 *5C80BB993053E79694E118063ED0AF4F755FBB42 BU113T1N5
889,564,107 *5C867D298B5B715FD8B4A7900B21F1BD441C780A ADRIAN.VERIATO
889,564,108 *5C87F145823E866B517442D8613AA083D6427BF1 AD!'W
889,564,109 *5C86E128DF3B3E16754D118DF4860586E4FF6E44 BUKSEDRAGTERNE
889,564,110 *5C82F7B6994700114FE3CEBBC0004D8ADDEFBA3C AENB.
889,564,111 *5C8D2563B1A33AFE8D147027294802B355A6990F BURTONFENNER
889,564,112 *5C8E7974FB7BCAEDB3A900E85449FC85EE036707 b+v.6
889,564,113 *5C8326AE827A5C948BCE837D89AA542510977D99 bv%o)
889,564,114 *5C89910C169537D1E24D7011B8C976E7A56704AD AGZ9D
889,564,115 *5C835AF9145F80EA2F973038B212919047C14FA9 C0QMO
889,564,116 *5C84C795ADE79124556E636467C3BE784F72E0B6 aileen-stanley-and-billy-murray
889,564,117 *5C8DCEABCE4D7CE84AF32482C31F21B9B838EB07 [email protected]
889,564,118 *5C84EF2E6DB97158D78035A038AD5495BE3E3E2D AINMNEACHA
889,564,119 *5C81382BE4F935950FFF584F13484E2DFF31766D c3khe
889,564,120 *5C82B9D5CFEAF45AC2077D19623223DAC6C428BD ak39&
889,564,121 *5C817087AD2B40D089F142ABFB77F3A2805ADB1A C4MINH4R3MOS
889,564,122 *5C8BEE03463A3FC045B7471F8C8EE0E784E71AEC C8?Q
889,564,123 *5C8AC4B0B4C8C7A95C5FFF5448B8D07DBC53F089 ALEKS RISTOVSKI
889,564,124 *5C898F80908FE0DACDB6F8ADB4E89C0AF4338310 ALEXISVIRZI
889,564,125 *5C8351A5322B79BBF7FDF2DE130F01CB5644CBE5 CALLER'$
889,564,126 *5C8D3B6FF2E44D9E431E052DA7BAEDD69A99DC9E ALFRED.FLIN
889,564,127 *5C8EE437B3BF3AD6659836002B99F46BA897AFAE candida.villegas
889,564,128 *5C87488E200136B402A40DAD89E85F4F68A44C02 allenperdzock
889,564,129 *5C8CC167D1289A2925633171CD2855B786DE78EA carlbenny3
889,564,130 *5C87446A44443266373A58ACF70169B69318B430 [email protected]
889,564,131 *5C8087BA40A733542ECF6166D18A84863B87EF4E CARROL.BILEY
889,564,132 *5C8B47F1FFA9B87356E1ACD162CC0F905551DE91 CARROLOJITO
889,564,133 *5C8B0F330A29E8A274308320FE2A02D96B9A1085 carterdoggett
889,564,134 *5C81CA6C09232700CD0C28076871DB22C91B728F cartereken
889,564,135 *5C8E9D2853E7B1A9ECC6DE811983054FA9EF8474 CARUSA
889,564,136 *5C83A41B12F764AE1B79F25A4B38750C61E49107 amalkassab
889,564,137 *5C85D7053830435227DC3A641389D41E8C5A406D CB-29
889,564,138 *5C8EF3CAAC706895F5D9F92370230BD6926C80B9 amol.bhave
889,564,139 *5C8D1B0A10890408A8092EDC8541C92269E7E203 Amonestar
889,564,140 *5C81A95554AEA699A36A61967C1D46DCECBCBC2A andy-robert
889,564,141 *5C8C00150859D0298B5BDCD8640AE9BB84DB1207 ANEUHOFEN
889,564,142 *5C8B8C9930A1BBCF3C5530E98C3598AE9C69013C Cdo=
889,564,143 *5C8DEB32C8186695217BA6E470ADF9C2EB25CBB1 cedricmcfadyen
889,564,144 *5C8230BEF135425F730BD89764974EE14DFC51E6 cefmw
889,564,145 *5C802748A51BC853CBD7A67E15F4FFFC4A41784F anppe
889,564,146 *5C8B11F5C426DDD3D970ABEB157F6D53BCE6E66D antoniker
889,564,147 *5C8C5FC176E16F5D934AD608AF4B569C0BD31701 ANTONIO.CITRONE
889,564,148 *5C8791EF4DA62141F06D28A728F25827E770284C ANWENDUNGSPROTOKOLLE
889,564,149 *5C83BDB1BEA685E856F6F4D54F2FD874302EFF6E cg#dl
889,564,150 *5C8555AFD7DF35008737F4A21631C4DE32D70DBE a=pr1
889,564,151 *5C8E701D1653DE1302AFE6F02E51D72FE61AF09F charleycargle
889,564,152 *5C81E6020EAE9674BD327C97B656D37A418E15CD CHATOYA SMITH
889,564,153 *5C8A744FA36B9653D258EF6B0F87F9CDC0BB8498 CHAUNCEYRIEMANN
889,564,154 *5C888C24FD0A0B9E5A4883D15377112AB9AB48AE Cheap&nasty
889,564,155 *5C8485FEE54D7307A442AB4C2A1B86EA1A554017 ARCHIE.PATOCKA
889,564,156 *5C895F17EC2F498CB39B3BFE5F9E2FBED80EBFFC ARGUCIREIS1234
889,564,157 *5C871B0E90D7EA6C8C6726A6274F568CDC60A4F1 chicken.and.the.hawk
889,564,158 *5C8EEFB9A333575B646FE648964009352B7F9EE7 chioma-martha
889,564,159 *5C8D7D13601FF8074EB9B85B15ECFE379F3E9F9A ARMAND.AMPY
889,564,160 *5C85DC9924A5CBB5A2442554FF89CB393FA1CF57 chloechubb
889,564,161 *5C8F6D42186E67B8891524FC8515EFDB08DB4498 chongskalsky
889,564,162 *5C82F3EF4341DD8450B6C4B83152733A8EF72834 choutk
889,564,163 *5C8D7C77644E00FF18FD8B328E149D5F2B2B7804 [email protected]
889,564,164 *5C829FB6ABBB4789BD4B2C667915CC2B2DC6E2B0 ARTSBESKRIVELSEN
889,564,165 *5C8BFF09CA6C9E06095E0B9C11130B4727121AB0 ar;zv
889,564,166 *5C8471539AF584EA4BD0E2A832DCC4F42BDB7D3D chuchting
889,564,167 *5C802BEE6550EE00A2A31ADDC21551BA2F601E84 ASHLEYFERRERI
889,564,168 *5C8BE8C7F4D4368F370693148DBF4B5FB718A708 cil85
889,564,169 *5C88F4850B2BBACC0CEF179B27B3E65B72B3A0CB ASTIKKELEITÄ
889,564,170 *5C85BD81480E3B4487F24F16550A0E82CAF6A1BA CJFLD
889,564,171 *5C8EBB81F80694A6F89933B9649090C8DA92EE76 atf2f
889,564,172 *5C883911170589BD7174363129A7EDF5CAA27E22 au4_q
889,564,173 *5C83AC1F13CF2C475E6C3CCB26D9FF96A16C976E claytonbartkiewicz
889,564,174 *5C836334F70E3E33D097832B47E748DB503C8CBC AUGUSTLAUBERSHEIMER
889,564,175 *5C85A11FB970383420C7B6A7EA9BDFF606556AF7 AURELIOKOOGLE
889,564,176 *5C86EFDD7C5C66D90FF5B34CD195B87BCCBC3C4A [email protected]
889,564,177 *5C8580D654ECE306668647CF0EA9E1AD63AB105E C!LKZ
889,564,178 *5C81A510797E59413D1CA63AD59A4186E23CF33C a$&v
889,564,179 *5C8062E108B613252A1ACE893BA9CAF813000156 C,M-.
889,564,180 *5C8C98F4FEC66F214CDD4273F582E087BFD8B4FE colewort
889,564,181 *5C8377BDA1AEA9BCFF11E3E2DFA83CA1323F4706 B01041971
889,564,182 *5C84259FA6071F8681E2D44BEF10478F4A32250C B0GMH
889,564,183 *5C88C509CBB24F89033DE3606551273028C440EA COMMISERATUS
889,564,184 *5C8CD9735F3ABD81B20CB7EB44A27A71747A44D1 B23PA
889,564,185 *5C840C4E396F1223D79E71A0BDC55708EC1950A6 consundra4
889,564,186 *5C8BB3F1E2268057C3E0E06044DE2DF78E7BF46F CONTORNU
889,564,187 *5C8B3C9128EC7CEDE2D1A07D27D05DD765117EA4 B4O$_
889,564,188 *5C882D2FE035D6986EB887040E8C430396699CDA B6Q/
889,564,189 *5C81299230E77C24A9856723654B9D070746C319 cou8k
889,564,190 *5C8445F77C0281896B8BD33D82A0BD6A0C548A04 C:\PROGRAM.FILES\COMMON.FILES\ADOBE\CS4SERVICEMANAGER\PLUGINS\COM.ADOBE.DRIVE.SHUTDOWN_1.0.1\COM\ADOBE
889,564,191 *5C8C6EEC10E5BEE81D4B2E263B8160D62F484D1E C:\Program.Files\Microsoft.Visual.Studio.9.0\VC\crt\src\intel\dll_lib\outp.obj
889,564,192 *5C8CF68FA9AD3EA2A93335DA619B58E3D635B87E BAGM=
889,564,193 *5C8D5FD3A8BA40983A4032B4A50EBB3427BDC946 CR?$8
889,564,194 *5C8ABBB49651A2C329EE04D4217EA5FCFC673893 [email protected]
889,564,195 *5C8D967591E5A05AE2EDD0B9BC70E9F6C82C721C crime-(feat.-kw)
889,564,196 *5C8211D1830E4CCDFA0B2080199068E91758BE48 BBONG8315
889,564,197 *5C8D34FF82F756607B48C4B2F8E4487C2C665665 B+!c
889,564,198 *5C81E30B6C14B76288679833B1C0588E738B277A B###D~.~}X{
889,564,199 *5C8B6A7DB77D634FC3E7769875C551C2C1719CCA CULOCEBOLLA
889,564,200 *5C86C814B298CEB03620D574B01200B78E3B07F5 CURTIS.RETZLAFF
889,564,201 *5C8688C775851CE48636A83326E58FE4F144DB4D CURTOLIVO
889,564,202 *5C8BB9AF6AB54D1E298B18C5C52BA1862FC119A3 CXIFJ
889,564,203 *5C88E2D03268706AFF064ED237DD6C056D0E8243 BEQA ESIAVA
889,564,204 *5C85F7E9CF23382F532D28D0D84B9C52739004A7 [email protected]
889,564,205 *5C8A6065722E2823283044232996D5BA30858B60 c&y.i
889,564,206 *5C8CD4F25796469D3895CD48C3F1D351318F0FE8 bersaten5
889,564,207 *5C88B2E9F26B7126636D5328A2D2CA33F3267E85 cyr?b
889,564,208 *5C82832E2A51CFF1A85D248FCAF1DD913BF56CAC bethob
889,564,209 *5C80206D6926942BA4EA988C21560B4CEFE85FDB bgec&
889,564,210 *5C839F2A0F692896AAE7460B8260023DAFCA64B3 B$H1N
889,564,211 *5C8EA5E60F071C917879099B014554E0CE6E9B5D BIOWY
889,564,212 *5C810C95AB1829D9E89F5B931AA5B2418ADFBACA [email protected]
889,564,213 *5C8ED6CD843B51C650A5DA260D491955A2AEB707 [email protected]
889,564,214 *5C8348CC1334BB403F79AF938D186AA4F1A2989B blipb
889,564,215 *5C83581CDE74D8A9915D23A32EAD549E86EA9986 BLUFFEUSE?
889,564,216 *5C84776BABF1EBFA6EDF5DA9F7B67B8A03DA930F [email protected]
889,564,217 *5C8A916AE99ADD98E06F828FE211ADBB5AD26E02 bolsa-de-bogota
889,564,218 *5C8974E6B5904ACF493BDBA193DAEE00879710DD DELAWAREWEDGE
889,564,219 *5C89D9505004F4144B01F1EEE8F34569106DD116 BOULRICE4
889,564,220 *5C82EF2DA9A66C1822681911D05AA4BCD02381B6 boycotteront3
889,564,221 *5C87A5A868163EF47494D18941C3FE8E4DF8660E DELTAATL7
889,564,222 *5C8687CC95775E3FFE17E3263A594D629C443FA7 DEMETRA-REED
889,564,223 *5C8DDAFBC124983C9943D8BEDECF2C8FA1276821 b.p-a
889,564,224 *5C823413454EF6BBBEDD6446B3F2EC555C523148 densmores9
889,564,225 *5C8D837CA505D7C377F7EE6C6F3CA888655741EE deod5
889,564,226 *5C83CBBC386FF537B551496350F39DC4798FE2DE dereon216
889,564,227 *5C836AB03CA58E75C5E68D729C302303C66E4CA8 desencapillara
889,564,228 *5C8A72364C560F781CD988EFFC0647BBA8C9271F DETERMINATIVELY
889,564,229 *5C85D28E15775395C5B4777800ABB06923689F6C d%f,6
889,564,230 *5C80E501B1092E0CD36945B9F3799F98EF1D7F3B breakyourheartep
889,564,231 *5C8C21E07F6B4C12F5C96789A490FA64BDA4304F DFN=I
889,564,232 *5C876B186C8CF7FAEA2A0775E9F68975B49CF24D diojc
889,564,233 *5C872FE13E66E8A243F9669529EB6EB0600A123A DIRK.WENGLER
889,564,234 *5C84FFD742B751AB658778923117DC9347D9C4F7 bswnihsuylibsw
889,564,235 *5C872E1F77534D072667AA7D4AD44108C2CAF014 BT1?4
889,564,236 *5C8D81D8639F59B52B0EFBE4DBA4D79F83FFC84B b:)y,
889,564,237 *5C8E03A2E934DD5571C24BFA90836140CB3EEB88 byrondeakins
889,564,238 *5C805EDDB738AB51ECFA6C099678954DD73E8BFA DONNY.KARLSON
889,564,239 *5C8573F6C3157F6413020F2558DEC9BEB71E391C DONNYTHIERMAN
889,564,240 *5C8DEA81C3F37FE65B7DF5FE800DB5F95F213EA6 [email protected]
889,564,241 *5C835AB3D362D4D3D7F7175CE193DE75F7A5759F c0rv
889,564,242 *5C8A542AC6D0D7065CC4343F042A95F8176CBF6A C4brolet5
889,564,243 *5C84763435404A848F0D7784E5762A22AC719F9A [email protected]
889,564,244 *5C8F3824E3DE759BF3349AF12D6060378C69F968 dq?hd
889,564,245 *5C824FBF9ECA16356CC8C91B0E48BB86E3442A6A d)swb
889,564,246 *5C814986BCE05DB85F12CC4C8B42DFF300B2C9FD dta$m
889,564,247 *5C8B600B5DC42B9ED8F2FE8504477F96DBCC51AC CALVINWISZ
889,564,248 *5C8847315532A8E74022E80A08F53A94B5CBDEE5 [email protected]
889,564,249 *5C8A8390F54C83874E9ADF091D25C0369C94B49F caren.monique
889,564,250 *5C8472B29E5CCD69209184BB5C9346C179AAB86D CARLOS.STANDREW
889,564,251 *5C8D04A7C335CE17639DBEFF00D5AEDE4D8E7A76 CARMEN.ENGSTROM
889,564,252 *5C8A954C6F8B1BD0AEDB622CE13C4DB88ED960DE CARSON.DHEEL
889,564,253 *5C8EAEB999439E7E0EB114F95BC2E1F045C2E0BD dx!au
889,564,254 *5C8831A88CD4ECBBB192FA2FE4CE31E48F6B8A4A DXWB
889,564,255 *5C87273F42C23D15C1FB69B3417348937EB71747 dymds
889,564,256 *5C88AB900D9F171FCD1C16A66D765DA8C9657A61 E77079
889,564,257 *5C82E8B0BB6AEE18BD61D2F965890E6EFC860552 CC/RC
889,564,258 *5C8952468D9807BB77E73FA6A14BA5358F4AD77E EA!3
889,564,259 *5C8AEA101E0788F48CEA9E5CED5DEEC7D1CACDFE eciRrefinneJretropeR
889,564,260 *5C8861E6F6351BCFD4624137CF2EA08257D511CF CEJN
889,564,261 *5C874EB989C76421E17754256C56D1B1B451551B CERCLIER6
889,564,262 *5C8F5CE78191368E0518A1ACA5D0F2F8EC7DA445 [email protected]
889,564,263 *5C87F7BC903FEE57EA671FEB4DBFEE5C94ECD0F8 CFNQ#
889,564,264 *5C8B79DEE851861B98819CD60BB0A1801690F689 cg4x&
889,564,265 *5C8D7C5C9B99942FC3B60B3B70738832DDAF12CE EF/:Q
889,564,266 *5C8364573D130ABD3087BFB01AA9FFCEC81652B7 chapter.2426:.the.wandmaker
889,564,267 *5C89CDF6E9BA0D9959788AE4B45731BB4581CCF7 chd4s
889,564,268 *5C8E99037970D4BF533DD2D59CA9F2EA1B660AC2 CHERUB5710
889,564,269 *5C84E5DAB84A908FB28383C8E7F2E6DFEABC2FFC [email protected]
889,564,270 *5C874E2C6DEB31E619F2361887A3D6F2C8C8D721 CHMF_
889,564,271 *5C81C84C1982A0061B1A99F3ABF36833F58DACF8 ELIASDAVIDTEAMO!
889,564,272 *5C8F5E693D1732D3965AFDDE4D0896999DAD4154 chopfall6
889,564,273 *5C8D0D4EFFA2DB11F51929BE557BC6D6F346CEE2 CHRIS1MIRAGE
889,564,274 *5C8F3A7E725608459EE9F20E4E969AF83E35C08D ellismeng
889,564,275 *5C8587F61DEC6B5CC686BBB9AD90859814170526 elmejor
889,564,276 *5C8496D132AEE50923C97C30A572763F1369027B elwoodtillison
889,564,277 *5C8FAA299E1513C6ABB29C44EF85BB2ADD1DEBAC ELYXAA
889,564,278 *5C8FF4DCE055EF899B4A0B48A39D1B027E92DA2B CIGHE
889,564,279 *5C85D58F9050DD80AAA06CD90CF41B30F343BBB5 CKS;!
889,564,280 *5C8CA40056B5A67985D8853D0FC629C43071346F enr:k
889,564,281 *5C831083C9F7A2B96FA7592C47CEC23D8C32F197 EPI
889,564,282 *5C875A61B8BED1AE30F205F0D961EF5AB11FE38F C,M+V
889,564,283 *5C89EF21F0589F1288462218E5C4EEB5C0D23C2C c_ndu
889,564,284 *5C858D663C227A436E022382AEBF54AA9FE56809 concertono.7inf,rv567:iandante
889,564,285 *5C83A756BC634388DC1EDBFCB151BE89288EF133 concretion
889,564,286 *5C8496F5BEC4CA589EFF8D4BBA535F15AD07BF6C evg>
889,564,287 *5C8F2112DEEB1F0E5F26B00A04BDB79DF4401B37 EWGLAA
889,564,288 *5C81A2612D9AB321EA77D14679461539DFC4C86E CORNELIUS.GIANNELLI
889,564,289 *5C8167D9D10B460C75B07EBB845D528E01E09C82 EXPIRERS
889,564,290 *5C83897E1D347616BB69BBAD6BA761CFE9A0DB7C exterieurs
889,564,291 *5C8032414B2F350019CC1B477AE7B3B57833A5D2 [email protected]
889,564,292 *5C8E71F1D354097430FE5B6A11597B65EE1601D9 [email protected]
889,564,293 *5C80FEFD86D8D439BB1333F4FC388A3AD4D75F85 c!qr3
889,564,294 *5C89EF83CF733099CDC29ABBC35264E44E439E55 CQW,$
889,564,295 *5C8FB2248A9978894C959FBB181812BF0A3B7F4C FBSYMORDER
889,564,296 *5C85A10EECC688AC113C3312EFB7648626DD76CA cristophermatarazzo
889,564,297 *5C82AA7DCEBFC7B04C845C215F972247266B938D C-RN
889,564,298 *5C81C81A49ED7B7B3F2930EE46CFDEF045E32EA4 FIRST-OF-ALL-(CRAZY-PENIS-REMIX)
889,564,299 *5C8F28E361C7C305AD9FBE19064C937BAB5EAA8B CUMF
889,564,300 *5C8E64A4F91E08126AC54DA9B4E693E1908F971F cytt
889,564,301 *5C8047A3F18CEF1B7CE15007A0CB9AA5370D4927 FREDRICKBELANGIA
889,564,302 *5C8A0CA24A42DED4888835079462DC9EF27F3CEB FREDRICKRAPPLEY
889,564,303 *5C828CC51522C72250650AEE7C8D6A152C1A9A6A freemantorello
889,564,304 *5C85DBE5564DE51634E018A00820478291B3DDE6 D1C453B1K4K4R4P1D
889,564,305 *5C880524C5F13D1299B3FA2631F65940E8C886A6 FRGS
889,564,306 *5C8C3F17026620FD5F539E315058AD5094FA9411 D"2U
889,564,307 *5C82079A23D9BFA4F01A3F54DA82CB76D678DFAE G30N3G4TI
889,564,308 *5C88C831009B775BB8D29B6794BE7AD7DE1C538B gaildoonan
889,564,309 *5C8021AECA95B73CD6CA345C6D11ACD049A3F3E4 GALE.BRABANT
889,564,310 *5C849BA57559A853C9E9922505EC39A43EDCAEDC GAME WARRIOR
889,564,311 *5C853C5EACD42C13B90BA98FFEE591FB6A29E917 (>-<).~.`.D-----8
889,564,312 *5C87F78B0186786C4F5F6550712D97F30FF9E592 d9(bu
889,564,313 *5C8747094DD399F107A9E52EC8E7EDF204C11C0E GAVINPIASECKI
889,564,314 *5C869E22CCEB752F5488A87FC1DB2B6CA796C52D GAYLE.HODELL
889,564,315 *5C8BFB9008F6967D28792ABFD8E8471969287DBB gayletroendle
889,564,316 *5C81AABE188D44FDF3385ACE382F2F27056B6301 GAYLE.URATA
889,564,317 *5C80010A1CAEF572B2DC97808DC1BDAAF7079DB7 „GEMÜSEBAU
889,564,318 *5C8A7E230876D519E2096FA74063DEB3636F5DB9 genesi-usa
889,564,319 *5C855677D6B82C79749983BFC281FAB375748EBB DANIALKERMES
889,564,320 *5C87D52FF6B7EC71F1B6E8508CA25940D95F2356 DANIELLEDEVITO
889,564,321 *5C838AD0D74593A2291E06336459487A1FB8933A GEORGEHRBACEK
889,564,322 *5C81CE977A300F1C91636135D044A9C154A89B62 GEPOUSSEERDE.
889,564,323 *5C8B86E770520B4804992915AFF57F4FC9D7C7EF gjweaa
889,564,324 *5C8C21F9939AA7DF9BEF991627BF1A3F09EB1211 gloriarique
889,564,325 *5C8466A5CB0FAF9ED447A6648F647E9649EC27B4 decaliezs
889,564,326 *5C8FC05FD8754D45310C7666E4C8A7B02D165354 deebecenti
889,564,327 *5C8691164716C82B0D490EA1A446C505E1D6A5B7 DEE.KEYL
889,564,328 *5C827F7F41F110BE31238F6605B8F9AFC826AD37 GRACERASTA
889,564,329 *5C8553918676185A7A710AECE24AAD81A55526D3 DEJA BROOKS
889,564,330 *5C84AD63E3812F687BAEB45F35BF7505D83CA625 greg.gallen
889,564,331 *5C8C7BB6CDA743987E7121F82D14A3625D0AD52E GROVERPROVENT
889,564,332 *5C8A30BD20C02AEE9CE5441EC6A1B8D89DC92B29 gs<f
889,564,333 *5C84CBA7CF3D9F410C33E5F156AA7B4A45D10ED3 DENISJURJRAPID123
889,564,334 *5C84C16AA9E0B1DA0FD42764EC29500ED7FAC185 [email protected]
889,564,335 *5C85E639D7E0E41B7E89AA2A425E13B26AD53220 DEREKFLUHMAN
889,564,336 *5C878D20E741B3ADEA70A5973F9208EBAB520AD7 DERETTAPSNU
889,564,337 *5C8C30D2A0B8B74C795945F07BE8131DDE7C8DAD deuteronomico
889,564,338 *5C8A14BF88E80F592697208525ADE7EA78D59A9A HANS.ENCISO
889,564,339 *5C8990EB25AAD4BE680DDBBDABA4593F2412694C d?g0$
889,564,340 *5C8535B52903263A4FEE6C9A1DB59F8572B2F753 [email protected]
889,564,341 *5C8A277C43D91F87E374788A9492A48B09BDF733 [email protected]
889,564,342 *5C8E998349BC9FD2E48E6B4062B954F0C4F7F750 D.GM
889,564,343 *5C8E24E4590401C1E2A8BFE8756B2AD9B14C1A09 d%he
889,564,344 *5C8A70C769D688B69F6D4A75FDDEB772DEA3D9BE diadelno
889,564,345 *5C88E138DA5F840AE6C2B0D6E22A572309E05FDA HASHEEMS3
889,564,346 *5C857F0A5B2DCED3AB1DE152C8D6F655739C5A2C HA.TE-&-THE-BAD-FINANCER
889,564,347 *5C8E2C6480D04C5A09FCFF8F860FB098A9B5FA90 HAÝRANLAR
889,564,348 *5C8E41B2840DEBBC65C8E020C0BA243C9B844651 HAZELWORMEN5
889,564,349 *5C87276CCE52FABCB21CC324EB1FD584A60039F9 DILLON.HILLA
889,564,350 *5C84025F7C7FB2F6D40F12206A567334B7274470 hdbrightcloudbsw
889,564,351 *5C87D00E7FC5CE4F8453FFF90C259FC2E39D065B dimple.alejandrino
889,564,352 *5C822169BADB4A90BB28B22D295314D036246815 DIN3R-0UT
889,564,353 *5C8472FEEC2A16CFE6659DAE67D86D0C5EA53BDA HE$ITANT
889,564,354 *5C83635BECE3441FCAD4B31DA06A722B9B286C82 “DISAPPOINTED”
889,564,355 *5C84D6E1B6BC025E4A6F61C916A4FDBA81F14C76 disastring
889,564,356 *5C8D0C58FF1C170CBADEDE78F68048E6CEC4D613 DJ%7
889,564,357 *5C853E6B4DE80BD17E8F1CDF157E6C7A768D6AA8 DKLP%
889,564,358 *5C86C32A3F354E5EC1F4DCED2C4A803FDBEF3066 HINES75
889,564,359 *5C8CB83BEA55364204EB71651EB58EC923C9C163 dl/y+
889,564,360 *5C81A46068EE90C06160CACE08585C467EF94002 dm,uv
889,564,361 *5C84FAAFA387F7465ED0C6F8477D959735301638 holla boyz intro (feat dj vice & dj echo)
889,564,362 *5C8291E4455084D4B2F724D4D4DEEF385ED97444 HOMETAKES:-VOLUME-2
889,564,363 *5C8127185AA89597A2844221668D868D3B31A4F2 [email protected]
889,564,364 *5C857FAADDCAB75815DE80202EB0B739A7A51229 donaldchaplin
889,564,365 *5C83B5CD08D515C4C02160F6A923E273E61DCDE9 DONGJAGER
889,564,366 *5C8EDE41762FBF7D55DC9DA4990D4C3EEFD1A340 HSAYMOON
889,564,367 *5C884D82C4C8DB5DC6A51DB579C6166CD40669A9 [email protected]
889,564,368 *5C85DF0DC547EE05A478A8ED47EE6A97724EE994 HTSHPSTS
889,564,369 *5C801A8F30E5A4D815CC036D04481E2F7FCDD024 HTTPWWWEXELONCORPC
889,564,370 *5C8F6D6599C611873CC1CB6C948E0DE3881F53CA [email protected]
889,564,371 *5C8317F9B50B36100914FC831AC333D9EC046536 HUEYARCHIBEQUE
889,564,372 *5C889F11DE87B24AC338A1EBCD05DFD9E7147DC3 HUGH.BRIENEN
889,564,373 *5C8FFA7C3E8E3D8C5E63DE91CE53DAAE43A80FD6 hughclark
889,564,374 *5C86A743E8C381DD72A4F769D32509FF60E309BE D=;PH
889,564,375 *5C8AEF34E766CC247F318FD379623EC2C5369703 IDCDEERMEGA
889,564,376 *5C83158BB8305EF6A4FC82A1FA0B1414B4977173 DREWMAZURKIEWICZ
889,564,377 *5C85D2199FF8DF63411437CC9140AA4E43D1B00D IH!K
889,564,378 *5C81E265A558FDAC0DA8322F4AF992638E5CE573 ill_always_love_youx3
889,564,379 *5C8D1D290EF0693998208A1ED6A107CEE1E4B814 DVA4P
889,564,380 *5C85371509E3E09B6F6768A050747B89294E3A55 dv::i
889,564,381 *5C853F4814518F033FFF92FAE9962639551CE221 indinkinsinnercirclepersistentdisarray
889,564,382 *5C8EA22A4F7DFC5DAC41EEA80317CEE3F3662747 dye,7
889,564,383 *5C8BEB645427324D11D5C47272F202F14EFB2D21 IONA35OTR
889,564,384 *5C8E9F6FCB20A1A3D5B9DCEBD8D9B94D541E1075 IPINAHAHATID
889,564,385 *5C8C877A3DBFE0C73FCA18D5620D17899C2D5337 ISICASNER
889,564,386 *5C8CBF61ED8422D0CA817D2E095B2AB60A9AB9B9 ISOBAROED
889,564,387 *5C8B5140A505F242B67898313B14C6CD5C2ED6F5 isrealetter
889,564,388 *5C8A23FBB65783EA123DF3E1A1F40088A1ADE91D ITATEDI5
889,564,389 *5C8AA7EF2B7193A8546FA0C35F880C0C55DCE0A1 EDDIE.STEHNEY
889,564,390 *5C84487E1C81E7363C46F6AB3ACE534F577FB40A i've-found-the-way-of-love
889,564,391 *5C804BE94F1DD0CD0169F6460B282596B86F8C5F ivu;
889,564,392 *5C8BDF3D7FCF1BB20734C6201B91C81C602BD14C ee5nb
889,564,393 *5C81E57B86F0BFC6D89EE3FF227EC9ABCDCB0F67 EEDNA 1
889,564,394 *5C8B8713CF2D204A6F0B976A6B7D26DD282BA97E JACKI LAWRENCE
889,564,395 *5C8318740C8B6F7ECA2F5D171F6ED81A12E3D86B JACOB.ENRRIQUEZ
889,564,396 *5C82DFB3AB80F682B658353ECC3BD3DCA503EDDE [email protected]
889,564,397 *5C85061D45F05D104F5D47F009F1173F503685B6 EGOIZES1
889,564,398 *5C8669678838690440998DA9EFA177DF24901DDE EI2CA
889,564,399 *5C839F87AF5BB576408F18B4DB5E5A4E7F4A514A JARODGABALDON
889,564,400 *5C80AE895BF5E78B315BACCF3C29EC16528E0CA8 EKMGU
889,564,401 *5C850AD43C65E71691460E17828A3FA355031CBC JASPERHOWENSTINE
889,564,402 *5C8C38BA392349ACC2B42A30C6D28D5BBB3B5B03 javierfeld
889,564,403 *5C8F920883AF2654C90E4320E5A1A97B4645B8AA JAVIER.HER
889,564,404 *5C8C44B27CC1D7D802BE2A4787F79E90D6F69C02 ELDRIDGEGOETJEN
889,564,405 *5C8D7F6E53D7FAD4705ED892F4E160C27C03B88D JAYDESSERT
889,564,406 *5C8BF8FF410436B43DE04D35F4EF42D9537FC577 ELGNOLBO3
889,564,407 *5C88D89F0A7ED7F5C14CD737B15DDF8799CB2F44 ELGRG
889,564,408 *5C8458E85F59F8AECF5D097750F8AE6922842C72 ELROY.UTLEY
889,564,409 *5C8508C629E325F34CE1FB94A78B87E27F73461B JEANMJ
889,564,410 *5C83CC51CB0A378DC1C62D3B822B5CD0BA57A054 [email protected]
889,564,411 *5C8DC9E411080B37C4F47F5153DC8FEE79C93FC2 EMMETT:
889,564,412 *5C8ED025F9231E53E63D617F7D3537EDC85739C3 jenniferleiker
889,564,413 *5C82DDB1EFBB243C923FAE7D184C4146A768BC8D EMP
889,564,414 *5C896159AD1461E3D11747E533F390DA127466E1 JERMELL-CAMPBELL
889,564,415 *5C8FB54287B8F224A04FB84C148CFB00A6F312D8 JEROME.ANDRADES
889,564,416 *5C830E1A04008EC5FB56E41B44930EB6D7A0292C JERRICIA8
889,564,417 *5C84EEB90D6D1D4420CAAF821D7361745C68BE32 ENJ_"
889,564,418 *5C89FDBD7A10459DE351D8BAF61BBF0468396580 enough』は
889,564,419 *5C878216894CB6F237B84532A5F0AB1C6E69378A envenoms
889,564,420 *5C86BC26F9F9D73283E5EA6683D6C5EE42F44605 EOSB
889,564,421 *5C840DF96BC376941535508E1FDBABDE00D1EB0B ERB/W
889,564,422 *5C848764B42C25241D23AA72DC13DC84600C730B ERGOENNE9
889,564,423 *5C8EB5D8103A2D450611296B46F5D2B4C1CE3FFB ERICHENEGHAN
889,564,424 *5C899601D495791B60E19117A09502E9742B832B erinrhue
889,564,425 *5C8C52D3F14876448D9F85A9ECEAC8C9305B8AAE [email protected]
889,564,426 *5C8E417BBCD693EBA64E11E6FA4A4ECFE38B16D9 [email protected]
889,564,427 *5C85F3B8D882ABB64CCFCA549847354C5024B317 JOAQUIN TELESFORO DE TRUEBA Y COSS
889,564,428 *5C8F7625348162FC3F43A80FA0538A4AEAEE88D8 JOELCOTTON
889,564,429 *5C8F3A14232760A46DC8143D4994626A73421EFA esolunic4
889,564,430 *5C849AC8D65B7E49559443257155B31E953A17A3 es(q
889,564,431 *5C84D0595FFDC2082EC96DB4A3EF9D4DE01BF12E JOHNNIEGREENE
889,564,432 *5C87723BBD22E6926838EA3CAE95B030D3F88F5E jospehfrans
889,564,433 *5C8F079E9DC3DE782D845890CCFFFA4889A3475E [email protected]
889,564,434 *5C80EB82F914301FF4C27AE9365C05CA85EFA02F EXPIRERS
889,564,435 *5C8FA9529CC835BBDEA5B3F178EDFE8199B29883 EZEQUIEL.HARMENING
889,564,436 *5C83D25620E5F1440C58B4F98B5308D9BAC30B40 jsu+
889,564,437 *5C8DA6B6F17B081E582D2081D6B2E8D70D6963D2 JUSTIN-CANNAVO
889,564,438 *5C883104F420AC4DAAB44B97589E0B9EF301D042 JUVONNA
889,564,439 *5C898F3EFE6BDF8B833813317B00093FDC40E549 JYOTISH.SPARAIG
889,564,440 *5C86774DA11849465BE7A78FCDA9B3F153148E2E K214175228944
889,564,441 *5C8E8C1C91FB14108152CE1B126423DFE112D44F ~K2AA
889,564,442 *5C8FFDE3D2C1F8B132B56BE502684D3134253C09 KALEGIRI
889,564,443 *5C8B91345A2829934324DE2897B7630EC43836EB KALLEVIG7
889,564,444 *5C8218E6B4198F3934D98CF3AA70A357BBF9EEBA fferwork5
889,564,445 *5C8868163705F828C6E697CEF1C5397733FF5206 KARL.CADORNA
889,564,446 *5C8F6A28B182103AFF0003B90220D4EE607AD37B KARL.CAMPAU
889,564,447 *5C8E7ED5902FEB69AD36A79572F15C9DBEF9B730 KARNEVALESKER
889,564,448 *5C8A9FE850EBB33E68F0799D3D3BBD6A57323D2C KASHOUBI0
889,564,449 *5C89BA2DBFA1B4190CCE88EC1E27EA3A04739BFF filecabinetsearch
889,564,450 *5C8DB0F643FEC857D97032F31CE28FFAC9543980 [email protected]
889,564,451 *5C8DB811DD45DED8D9BA920773ABE70E032F29A3 KAYCEE.LAZARO
889,564,452 *5C8E4EB804FAC01BC516FC4FB68DFAF21F64F1CD KAYLANAUTICA
889,564,453 *5C8DBEA17A346B3D49D9EA308D3E7A912B1FC2D7 KEENAN-SCHILLING
889,564,454 *5C85A8F12F4DAEA95ADDA100780C2CACD315099F FLSSAWARD
889,564,455 *5C80030035BA8FFB4A7E9934AFF8D1CE0B10D510 KEITHWINSKY
889,564,456 *5C8995DD69AD96A59F4A898038D038B07228E263 FOGHORN
889,564,457 *5C808C7FF81051CDAB9B7F16B36BC145BBDFD6BD KELLY LADUKE
889,564,458 *5C8E9947FF8C74C8E0764FFB8CA8BCCDC05D2F03 [email protected]
889,564,459 *5C85F6208EAF2A67C5AF7C61A4D754CCAE096112 FORMIDÀBILE
889,564,460 *5C84CFEFE0E2C603802189EE9DBDDA7F6955F653 KENNY.ZAMBORANO
889,564,461 *5C862768D3555121930B3740F25696B95F081B29 kersemderindereye
889,564,462 *5C81B3AE03F6715BE1BEE94C9393FAAB86C8EB67 FREDDEWEY
889,564,463 *5C84B618C9DA35C9EF1B0FAAD1CDF25A06511B2E freddywalquist
889,564,464 *5C8934F1EB44A7F43BDE8D304D90F6F9056277E0 FREDRIC.HANZEL
889,564,465 *5C8B0764257F8919B3F5566BBC464331A5C0742A KINMAN69
889,564,466 *5C803B475EC164331937F8F6584B8500395F89C4 KJ/V
889,564,467 *5C8A2C5625BC06FAB498F6C48BD33BDDDFB5A035 [email protected]
889,564,468 *5C865E8925788A0BD9A82DC24B20DE75D34983C1 KONFLIKT
889,564,469 *5C8F520AD89457C81BE0A2A191E6FB8B03E88667 GANIYAT-YUSUF
889,564,470 *5C88ED3AB1FFAA9483C9E1E9B9CEFDD0BCA86AB3 GARYFEALY
889,564,471 *5C8E47DB419902A0DEDA6F2112367FF4A38CD79D GAYLORDSANZOTTA
889,564,472 *5C8C03FAF5D45688953DE0F5D5017354E645A5BC kuvrmbuo41
889,564,473 *5C8A33A9B69423AC4AA3ACDD01A40592DD59454E GEORGETTE2
889,564,474 *5C8A9EC8B7C57BDCDCC4FBAA9B7EA9F1C571AD6D GERARD.CUEVA
889,564,475 *5C8C92EE016B12D5A1CA42AF2985193BBF7D8675 LAICHENMIN
889,564,476 *5C80C191E496C1F6447C8BE8DB6E4F1329E4A5C8 LAK1993
889,564,477 *5C887A6B55C9C871950F4423250CA8FBC1764BEE lannyzehrbach
889,564,478 *5C89E449DDB0CC4D515A736D723E1FF2B832ABB5 GINO.GREENHALGH
889,564,479 *5C8D0A0D8F18EA67C8A069A5457E439515A9FC00 [email protected]
889,564,480 *5C85301D8D2CD5A0B4CEA64314AF3C1A1C3CE12D LARRY.TIENG
889,564,481 *5C857A6243E1120EDAC7DED84C5710A3FACD7485 LAURENASHLEYBISHOP
889,564,482 *5C83DD801AC06059AE08AB9D4A9749B20A556F37 G`/J
889,564,483 *5C86D0F0F7933189853BF780CD558443421DC795 [email protected]
889,564,484 *5C8D55D9D9BD8F111E01CC5B13A3BE1B73E78A2C LEJOUBIOUX
889,564,485 *5C8F08BCC763691C4B0181F92605F9116234C10F [email protected]:DIRTBIKE
889,564,486 *5C830D89CDBF4E3A93AB8EB5E4A776FA93F1534E LEO.DECOMO
889,564,487 *5C85E26E5AD5184E3F06FA87560029C8C8FBB7F6 LEONARD LAW
889,564,488 *5C87EDF8D5B4C6CC61BADA042C9BB7C4BC7397E9 lescornejo
889,564,489 *5C8A7EDA5A1A93CE7F7E363A8FEB103E0707DDD3 LES.GRIEGER
889,564,490 *5C836473D2AA5D568F8E12B7775867FF10682BF7 LES ILLUMINATIONS, OP 18: I FANFARE
889,564,491 *5C874DE96CB47F2C686484D497E5BDAFF87D759C LESLIE.MCILLWAIN
889,564,492 *5C838CDD92DE88C08D1735C951C2E0D98E0C1564 LETTRESAMISSY
889,564,493 *5C89B10C8BDEA6AAF63630927C8C1F6FCE3799B0 levittown-pensilvania
889,564,494 *5C8FBEDD680732543158BD2BB0543931DE2C230A [email protected]
889,564,495 *5C8AC5FD6B66D0474ECD173886F7143D2081F3C5 lindaosborne
889,564,496 *5C86FF880A30CE35BFC3D4599BABFADB0E574077 liszchen
889,564,497 *5C8539A9328A04591A3BB2110918FFF2A2622ADF h#,3
889,564,498 *5C872B1895FB470F75C51CC2D0ACC51C862EACDA [email protected]
889,564,499 *5C84790691CBB6C0E9F94876AA22D3185EA9575D LOCOFOCO.,L/OU/K/OU/'F/OU/K/OU/
889,564,500 *5C857C0579D019922C8C36A92BC691461FD11657 HANEAD
889,564,501 *5C8C1C3FD5A0A184EF1E4C5EE39B4A0F4E9A94D2 LOPEZCATEGORYPAGE
889,564,502 *5C8FE5345ED2AC677762AF701F19BFAEDF162460 HAROLD.MORDAN
889,564,503 *5C87F1B9A4FB1B2D4CEF5B19C0793AEA17A00827 harrisonlenski
889,564,504 *5C83B63FE4E1E6A6A853C45038C17127100CEB77 HARRYDAVANCE
889,564,505 *5C8DEFCF1C338BD3444635D0B59E4EDE84B0613D HAYLEYIVES
889,564,506 *5C881A63A9CA0BD54E82EF20BBCD4E2E7FCE7659 HBOEDRUQ73
889,564,507 *5C835E40CB05E4B5B8421E3A0E26F27A35174BF2 heathmccarter
889,564,508 *5C8E95541456A33B8CE5FD4A18B755DB0A775162 HEAVENSHINESUNSUN
889,564,509 *5C88B0FF12980BA6B9A0539A3AAD3A93E79C5DB6 LRTQSNRT
889,564,510 *5C838496D0CB3EAAAFF3F68C8B3D4138FA6155E7 HELL'S GRIM TYRANT
889,564,511 *5C8E1392829497B868AAE8402AAC6CF5A2DDCA33 [email protected]
889,564,512 *5C8C37EC60C9FEDB81D3F947FD78102E268BFE0C HFDKNKKN0
889,564,513 *5C84D2CBD694D02FA958BCAEF76C62C396DB2511 LUTHER.BRETOS
889,564,514 *5C88DDF3239E8DF24AEA843CC95F2FE40D59BF1E lutkamas
889,564,515 *5C8F4237383688A96B4301239A84A708FFA76FC9 LWALLAKER
889,564,516 *5C84ECC0C5B66899390AD720AFCE541CDA5B08A9 HIRJIBEHEDIN
889,564,517 *5C8DC21FBD0BC8DEE7721A33EB43778EA87FA610 HISTORYOFFIRSTBALLALIONSEVENTMARINES
889,564,518 *5C85D5F1D126C1C1D6D0B6FC6A49401C44212E6E [email protected]
889,564,519 *5C83C6D4F21E85B40251E147C6C501817573AC5A lyndonalatorre
889,564,520 *5C866B0D8F4B18D06A71D96BE459656A3668928B [email protected]
889,564,521 *5C8D8ACFF99FDBB7E7CD7DAB479101FC27AEC1E5 [email protected]
889,564,522 *5C827CA1AFFDF9670A8712B58A6DB865C9B157A6 hollenwu4
889,564,523 *5C8A875EA057DACCCF33F90AF3093F4FC9187715 [email protected]
889,564,524 *5C8D00958F3239E2E978AF185A873E3A8588AF6B mahmoud-bagheri
889,564,525 *5C84FE6BEE9209F91F94817CD33B46980C60A1DE malcomburtell
889,564,526 *5C8753714382887318FB05FEB6AB0F852168112C H:Q&
889,564,527 *5C84C78D35FD1F9FB0F27520DACD90E614D56895 HTTPJUSTUSANGLICAN
889,564,528 *5C806EC3C6E5CECEE73B88C1682DE6D278F5F8D9 mandy-shiu
889,564,529 *5C847D0AE785EAF697E196132589BF880933A6AA [email protected]
889,564,530 *5C82E44A5A0F03389C8652E9AF449218F21A5DA1 HTTPWWWUTAFISUOMI8
889,564,531 *5C8793FEF93C26285E61DDA3626C9784460284FE [email protected]
889,564,532 *5C87129DC44009802ADF6DD41A72D2841C76541E MARCEL.CHOCHREK
889,564,533 *5C8069BE55725C5A200E0614348F90B2AB6E6268 MARCELOBEDARD
889,564,534 *5C85731CF8D024737A3ED9526920154C5BC21313 MARCO.LAFFERTY
889,564,535 *5C8C6E73921EB026F37D61CF86C0876A0BA30CF6 [email protected]
889,564,536 *5C8641942A53A2CE02D98977E5F50C53E22CD30B HUVUDGÅNGEN
889,564,537 *5C86051B1D60258485D5B0C885C45E1C2A32A082 [email protected]~x
889,564,538 *5C85377ABC53A2A9FBE75CC8A1D3FF749905F72C i0x>
889,564,539 *5C8FD0FC82720C1080B38A2455AA98A0F931DA3E MARLENE-COX
889,564,540 *5C8BECD551AA89B091C8FCD370AF423023E3B7C7 martin-jacobo-thompson
889,564,541 *5C87432945635D714522FFC785E1D00C8CEA9D48 [email protected]
889,564,542 *5C8E108692CD0BEA736FFB5FDF03D7926E51E9CD MASCHINENSTÜRMER“
889,564,543 *5C8E64C7C09D1A6FC31597DC5FF42B3D2F4D7373 IFE7
889,564,544 *5C8D44634F47610905504682B7C03B59C4491DC9 IGNACIOHOLSAPPLE
889,564,545 *5C8CBDCB4B9C3EF118BF9E684C5E481BB27D86B3 MATT.WOGAN
889,564,546 *5C893A85A386983606290191A7F0297480DAD8E4 IKE.RUMMAGE
889,564,547 *5C84A2305B59BE221E8F6C8A8A4F757BC53F5419 maxcopes
889,564,548 *5C8149533EB0B314ACEE51A4BF5864C984BE1C09 iksoklup8
889,564,549 *5C83C49892FAEB070D719E312F926FD600E261AF mdodar.grubchen.brgyadbcu
889,564,550 *5C8E53820DA146E17D4ECA5FDE95F1BD2B2BA166 INCOMBES5
889,564,551 *5C895177E0625582F827577E1C34E5EABD08E93D METAMUSICSERIES:DREAMER'SJOURNEY
889,564,552 *5C8630B22BA699E64B76AD3BAA11E36A303137B5 infobiginartcom
889,564,553 *5C8D0064579A20D42089E5BD5777C98AE6BFE975 INLEDANDE1
889,564,554 *5C89A019F7080474102DFF0D57E05D1EAB37CBAA MICHAELANDERLE
889,564,555 *5C80DA9F52606AED27472A49C8C1210CA1E6CE6A MICHAEL-SEGAL
889,564,556 *5C8225EA3282C785B81FEE32261486B619BBC939 INTAN SUGIARTO
889,564,557 *5C8FC0A8D2AD53E7EBB76B5AE0A153925C4BB3A9 INTENDS
889,564,558 *5C86D384D120882FEE6AAA6AD660CB603C8BBE9D michelines
889,564,559 *5C8F3D584A300166608E6A80F991285F41A56A6E micoteodoro
889,564,560 *5C8CE5E76D94A7D3501C94766B1961C73B110EED miehenkorkuiset
889,564,561 *5C81E985504B7480BC7E5A21F0623DD48299AB6F miels7
889,564,562 *5C8D71667170F849CF98475B3F3C297387B5CC53 milanmorgner
889,564,563 *5C8E9C560A1DADD50EA3625EE8E4B7BA9C7E0865 milfordwigg
889,564,564 *5C8F78BE32E88D5C2B740DB270D9D9633F8E4A88 MINIBUSSYSTEM
889,564,565 *5C80F0FA4238C7D41FACB66061A4A6615A915B48 ISETNIS2
889,564,566 *5C8FC88FFB479FD047D17BE25C399698DD9D755C [email protected]
889,564,567 *5C8633567ACB950CEF589029B9C5E952447C1EB2 mmlq58kgtvkj
889,564,568 *5C84344B32602C385962292D3458CF748BC5FD0C jacintoszwarc
889,564,569 *5C85F089819EA274745C50B55BD4DC50ED4A0591 jackieborkin
889,564,570 *5C8241C1498C9FD688E4DA3EC3BFBF0D713936DB MOHANADZAIN
889,564,571 *5C849459006E12A3D25442AF611BAF0CB93D1EFD mormex''mormex
889,564,572 *5C8646654DA43D8F86389FB655431D1E753F5C93 [email protected]
889,564,573 *5C802756D7C5292132D359FAC2CEA1A4E00352DA JEDPELOQUIN
889,564,574 *5C893D6BC3664A2D6EBF2C8B73EDF7B37AD303FB MSCHELLINKHOUT
889,564,575 *5C8C675AE0362E266A780590585A54DC4031EAA3 JEFF410
889,564,576 *5C89EC69010E685D16C4C64592A0ACD504BF4070 msinooffub
889,564,577 *5C8BFBA922B41A3EEF3F6A298CE2540B7120C0C0 JESSCOPELIN
889,564,578 *5C82B91206C2D77891FF734662F05F991840E70A MYCHAELFENLON
889,564,579 *5C830C64CA254F2D98DACD35B026AF0748113480 NADSZARPNIĘCIEM
889,564,580 *5C83EB1B69807A1C1B138CE3820F7FE50700C806 jmecklenborg
889,564,581 *5C880F88A66EDA28427B85966261186BD9D5D639 nalmas-lehett
889,564,582 *5C85696B15D07B9AF240E0F521EAA40FCCC79974 JOCELYNN.TOBAR
889,564,583 *5C805D526A8DC47600B8102DB2B99C978ADB7135 NASYLA
889,564,584 *5C8D7E366C72BCBBAF7023B95ABE45BFD664C5AB JOHNIE.ROJAS
889,564,585 *5C8E58EEC7F63881F5B82CAAC9AC940EE75A5B40 johnmichelle
889,564,586 *5C8761002B5F7EFA5E87875CA0861B5BDCB5D34D JONATHANSADOWSKI
889,564,587 *5C8C8C3A2735D53B95F4CDD791DF22A4AD99B839 JOSHUA./.COAT.OF.MANY.COLORS
889,564,588 *5C8678592784AC2721640956E1EE32B2745171DE NETサーバーに移転される。
889,564,589 *5C8DF055BA26F812EB91D4A532B37F7D14DA55B1 NEWDELHI(PERIKMORAEUS)
889,564,590 *5C83BDAA042283D108F05DB4BA7EE1E45106EEAB neyoknockedoutbycherylcole
889,564,591 *5C8F45B007D9B2F51510466534B42125D30660C9 JUDITH.NWADIKE
889,564,592 *5C8B7F03C6E8803BFC50DC318EA995A857273D5A nicolasrisien
889,564,593 *5C8271FB442E1F99FA4E26BD91DCC518D7E12DC0 JULIUS.MACCABE
889,564,594 *5C8F30D2F06E045AF9B900192094C07B4E845757 nightdust:dustinyourdream
889,564,595 *5C85533B311266E81E65FCA98BF01170BF8BBA98 NIS.BIRZNIEKS
889,564,596 *5C8A813E2F79EA851F31642C77113CBF16D07317 NISU1
889,564,597 *5C8FFA1F01ED01F8904ADC88EC72DF28F576B99F KARL.ALUISE
889,564,598 *5C89841D9B9B74A84A71E6BDF80B533128C14051 kaseyaguirre
889,564,599 *5C84C56C9A8394C2C4E28B3ED880C3301FC61F32 KAYLA.WALZ
889,564,600 *5C8889482B4CDE67E578536BFA341B5907C05AD7 NORMANFRENS
889,564,601 *5C8679193EC9B2E40701DF7718EAA880B315FEB1 keibler)(スカイ、ミス・ハンコック)(2001年
889,564,602 *5C86930A14A1C3D95C1AA13EC9CA27A93EADD4BA [email protected]
889,564,603 *5C8B44A8892FD6B939D4B06426714B3D202D96AC NTRPLLTN1
889,564,604 *5C8445C7AAEBC2DF7A30DBCC0F5FC355B62325DF numberssantopolo
889,564,605 *5C803A5190861242255D48885621B686AB8FE6CF kennyhalwick
889,564,606 *5C8B08FB7055A795B107D856F49F39E918AEDF36 NYUSRACE
889,564,607 *5C8684E97422A16947C7EF90CB3DD3DB5F8D2B09 kethlers
889,564,608 *5C89E371EB56C888EC85954786C1259933B38A03 KGML18
889,564,609 *5C80ECDE9AED4BA062BA1F6FEDC639805563B66E OCE4N4U+S
889,564,610 *5C8E93E77C001B76B84117C156EBAC483D4312D5 kimcarl5
889,564,611 *5C8406CDA5FFE48BF8090A8BD1F73FEA60DFF94C KINGDOMFREDDY
889,564,612 *5C8F727A99E665E528218B8E6DEA848DC52F1384 okaying
889,564,613 *5C86FD3B01D2AB921A965C4F5C7BFE78B6384D60 KL3UT3RT4F3L
889,564,614 *5C8FCD1D4535AAE4405DAB7FF99A2195474BEF3F OLDRAP
889,564,615 *5C8543A697E3EBD2100C4245F4AAFB59358E512E KLOSSER9
889,564,616 *5C80CFE0CD4D9F5C2F022875B0E36FD497D51D43 KOHSTORFIGKOHSTORP
889,564,617 *5C8FA9DC70029C60433C0D8CA882441C067DE165 ONDERHANDELDS
889,564,618 *5C81165963CED5B824452E557E9601062F7307F4 kristysoftball
889,564,619 *5C84F742D93216C87C1791778BD46B5140F3CECF KSIĄŻECZKE
889,564,620 *5C81FEA6C36A3A641D6EB3871BC66A8274253A83 [email protected]
889,564,621 *5C85680AE8923719B685170B64E9716A055A3810 ORVALDUVERNE
889,564,622 *5C8168CC63E603D6F0BB0404679B250A3A7AD223 kydyvgj98
889,564,623 *5C8ACF7CC89797F5A83A22E4496D2D25A951E26F kylecalaguas
889,564,624 *5C820A95074CC629ED6537BB4579BBE2E9C9D005 OVERSHADOWINGLY?
889,564,625 *5C8BF3E13B9DC9F1FF072169BD5D65A6D179E3D4 OXYDSCHICHT
889,564,626 *5C8CEBEBFD8C16EE9A0337A520839423A236C220 ;)-*-*(---P
889,564,627 *5C8C1210E755E9E04EA1658F25F3216677B0267C LANNYFORREST
889,564,628 *5C81B03F0693E5D93E5865075F57F119D75067A7 [email protected]
889,564,629 *5C8C6C8E365D9FD596965BE75F101D7A2066ACB5 pablocovino
889,564,630 *5C81B70148D76D1AD4C78D7885A935559587C1AE PAMMITHIAGARAJAN
889,564,631 *5C8E534847EBBCE064F0DFC00753569CB057AF1B [email protected]
889,564,632 *5C84D2A38043583BE50E0B83C5F8776976891B84 lemeztisztító
889,564,633 *5C81CEE777C0C3788D8C0D05AF4F7FF953DC5651 leopoldofolger
889,564,634 *5C8B768E34A7021E4A927F228F9D1FFC1E419808 LESLIEKRAMM
889,564,635 *5C899314DB00E5B63FDE57C448841F80C96FB680 lester.mendez
889,564,636 *5C86244507E2544BDBB76F9E397E50F794008F9D peeweepepper
889,564,637 *5C8BFE75B407C5276BAE42E27D24AA1B2AC2797D LIEVERD!
889,564,638 *5C879A3BB7F44E472A22E7B72151F574407B35AB [email protected]
889,564,639 *5C8C18F99A3E6F6576878375A28516EDD244ACBA PERLTEN
889,564,640 *5C8846C897E4949AB31A7EE44305C2B1EA73145D [email protected]
889,564,641 *5C8A48C0BC906833977E77A4AEE7294AE28036F0 perssonquist
889,564,642 *5C8D3493A8B218C34A3FC884A9B1DB55E80FF2BA pertinate7
889,564,643 *5C8C90D0F90D217DF1784A6ACC669E011FAFA9BC LINOGRIPP
889,564,644 *5C8EB1F8D4B6214A99C5960D5575612521D3CC2E LIONLEAPER
889,564,645 *5C83206DD32CD1B5F7D4744CC091D9A6666476E7 liszt---soirees-musicales-&-soirees-italiennes-(disc-2)
889,564,646 *5C8F2CA175D2C8A0BC8E99C2AE5D559E42296A9E PHILIP.TENLEY
889,564,647 *5C8351992CF16E5BE2DC4CE3FBE4A4C4E63B6788 liveone(disc1)
889,564,648 *5C8D07B79398FA369B443B3E6AE2632129A43DAB picassobeavis
889,564,649 *5C82F0ADF3263958C8130E74B644AFBD60D91192 longerio7
889,564,650 *5C827F5D17ABA3C318AB5C187AE6DE9A03E77DE0 POGODBENOM
889,564,651 *5C8705C0B42C97D5DE64AA81ECF5B8C21CA70BDB POLOCZANSKA
889,564,652 *5C84C670995C57C235028AB21FC0311B452A1799 P######P~(><)
889,564,653 *5C812244823D7B57E1ACA54F0D1C70D2CB6FFC6E m0neychan9er$
889,564,654 *5C8806E716DB76C49EA741079D18D3EEFC7406A3 m45ch3r4
889,564,655 *5C8EEE86549326E0CCD944E7DAA710C9685203D7 MACARACACHIMBA_MA
889,564,656 *5C803E1C099A5ADD05335180DA5251FDD9AFFF3E PROTOPODOCARPOXYLONHACINIENSIS
889,564,657 *5C8DDFE8D106142133D48F176FA9382032431C61 PROVE.YOURSELF.(LIVE.BLACK.SESSION)
889,564,658 *5C8AB569E230CEF5F1E334ADE9F35FD27653F5D5 malvezara
889,564,659 *5C84648547A19B686B4F31B9704EAFC30482D36F PSYCHOMARIA
889,564,660 *5C8505713CE9EB1B61B6FDAC5C1DFFC7D76D9249 MARCUSBRANNON
889,564,661 *5C83B119C8F2237F1F6BEA575F57C83523278C62 q##> ~0~o (O_)
889,564,662 *5C84E38966374EE561E8AF648309BAB2551C6D6C Q######)~0.~O}O{
889,564,663 *5C83A96EB0F9AC8CA878061E8E6C10285F74CA9B q958
889,564,664 *5C8E0F4119EF0A6A3AA33E5137E0CAC8F4450156 MARITES-ALVARICO
889,564,665 *5C8AB813FB2FB1631A170EA9353D52540082EB94 qgoe
889,564,666 *5C8CFBA9A52B01BF4AD60777D154E1080B4CFF63 [email protected]
889,564,667 *5C889C82478EE2DDD634594D8BAD156163E5746D MARKUSORAN
889,564,668 *5C88EE299E4481B9A4E2214060D6A750FF92F519 qp ~0 Splat!!
889,564,669 *5C8C4ED8B780B7A7F803CD40EE000CF78EA6D7AC mattburchett
889,564,670 *5C8F1F36DF0D9846008714818CE3FB3772FD6CFF +R0++0
889,564,671 *5C8DB0CF71E692FC59CC4374812A68628A1B1874 R0astb33
889,564,672 *5C83A9F2B220BEB0724CF3D294D56523494F1455 MATT.STAINES
889,564,673 *5C81828B82A8E9B15E374B0EC32BB1F8782694DD @R+3R1OSC13RO+1C
889,564,674 *5C8C58A3B802C09E2D1145A9910FA8B642854B6C maynardrax
889,564,675 *5C860DCA6A590E17C3AAC259375059D2CB7B3B16 MED3203160
889,564,676 *5C8C2DE1B2D06D22CE34CC01E8196775DD2422AB RANDALL WHALEY
889,564,677 *5C8080922A7C0242FD46F29E4E4F98DD9F54C45C megan-nott
889,564,678 *5C8F2C04A0A4EAB153CDD31885941FB2DE7543E3 me+rol!ners
889,564,679 *5C89D895D8A58BEE6C18CE102086E58B4DB9D8A9 Mighty.Mi.in.the.Land.of.Deadstock
889,564,680 *5C8DBACBDAB2BF5F3A73776AC315AA00DC5B8AA4 REED.RHEAD
889,564,681 *5C83AAD65330B384683B9CD5C44D6840E38E114F MIKE-SIRACUSA
889,564,682 *5C81D029FAE128BEB5918EF0B35FE00866493E98 MILANHOFFIS
889,564,683 *5C8EE7DFB9F97D3109EEF82155B5DD1D371B00D3 milanueda
889,564,684 *5C80F8B1E4D498956DCB86567C74E50E35F45476 REFORMERAT1
889,564,685 *5C8299B85A76FFDC81B34CB8372D132082B9A45A millardkulis
889,564,686 *5C80A5AB8C48B9795A06DD6D1998BBA0D02D68E9 REGETNINONING
889,564,687 *5C845DCD02C3F2302747502709C528EAEA35E67C milokist
889,564,688 *5C87C8CBAC127A382E2DBD1481DC885DCA4B2766 MILSTEINGEORGE
889,564,689 *5C85F4979598308B0FBD23A5867A84EC9A021D90 MILTON.HERMOSILLO
889,564,690 *5C8BFD3844F9E5BB5CBBA6F1AD01D006D9C041EA MISKAVAJH
889,564,691 *5C815A21574AA77164DCC673F5538ABA5648B151 RELIGION-FLOWS
889,564,692 *5C808C9F30C5B3A6E504FD14D566C0F0070CD639 [email protected]
889,564,693 *5C8E6FD2B66A44F6E94975884EAFD4F50180C0BA MNTMTRS0
889,564,694 *5C8F0264CD9793E634CED68E49D5A8898D0A446C REVOLUSIONISTIESE6
889,564,695 *5C855F9B9856C68863F48A540775E267A1F94D2E MOONP
889,564,696 *5C8893C8B7F09DBD86276B0A688BF77EC0EF5446 [email protected],[email protected]
889,564,697 *5C812300F5F3AC304B369E98690BFB6AAF685243 RICOPEUELAS
889,564,698 *5C86539BC1A0D4640C34DCD9DA15DEB2CE845E1A [email protected]
889,564,699 *5C8877177B4E6CCF82AFDCA6725FD59E5981BB0B RIHANNA270
889,564,700 *5C88498648437667BA5C4810EB293B55B04F18FE RIITETTV2
889,564,701 *5C858E0DE0FF634CD9A0D373D02D0B539CD3031C RINGRICHTEN
889,564,702 *5C86848FAFB0FA41B024C9FF28C9BA7766A25E10 muntaka
889,564,703 *5C8BFB0742A9809900303ECEE4ACC2CC82168919 myaaa2005
889,564,704 *5C87DB7F49379D731DA3672758363F6E88FA53EA ROBERTA CHURCHILL
889,564,705 *5C8F90078E382DCB3964ECBDC87B7588EEB5EA99 MYSBDC666
889,564,706 *5C89B95D0A75741A591C823B69EF988600B8914E [email protected]
889,564,707 *5C874D9751AA9AB2520FF81BBC3B7E820AAF4D4E ROBYN.SOUTHAM
889,564,708 *5C8B8E3AF078BC3E97F4E0A9438B399257B66CAB N0N493N4R4N5
889,564,709 *5C877B984B525454CD079950CF21F965BB1D120F RODNEYGIRMAZION
889,564,710 *5C8517D451254B4057F1CDB2D3BF9FC0BCC7C99E NAHLADU
889,564,711 *5C82355FE86AAEEA4B406A42D4765B9C0ACC40A1 rolandorichlin
889,564,712 *5C8A7FFDA959520F648340727FDAE9AA8B1E3B1D rollandybarra
889,564,713 *5C8F943361B273FDE13AC5929EF276BC387F5100 natalia.parker
889,564,714 *5C83B92A09CF6F51047E7E2A78AAF7AEA25B5290 ROMANCAOUETTE
889,564,715 *5C8BE88B062BFF4F5A17A8EF3EB626D3321DCEBF NAWANGSARIG
889,564,716 *5C840441FC8E30D5E5C2E8B7DB1252B8EE10686D RON.SHELDRAKE
889,564,717 *5C898588241BC0BF40922F0BB64C437FFD9F0A25 ROOSEVELT.MARGEL
889,564,718 *5C8BF2A0054F5DBE81BFCC25E21A5ECF18CA6D1E NCULLOR
889,564,719 *5C8A266E8B3D1263905DD65B693E994411AB8D55 ROSARIO.GAMBLIN
889,564,720 *5C8751B2095676428322338DFA7C9D5E9B4691F4 neededcstar
889,564,721 *5C8EBBACEDF65A743D2460AA5DF160FFA84166D4 NEGROMI0
889,564,722 *5C8D75CFFE84F5F37B66313F847810E3DE3049F0 ROSSONERI1234
889,564,723 *5C84D6D4AB18F482E4D2C3008BE28A55B846B618 roula-younes
889,564,724 *5C8B5959E86B89632E8C7894701DA43010D64BF9 nelsonmclauren
889,564,725 *5C891E9A8CC0542D34D65B0ECFBBBDAC4E845606 royaleditionnr.58of100(leonardbernstein)
889,564,726 *5C8CD69DE1C933DBDADA3442F9916C9E11618997 newhomeshertford
889,564,727 *5C8BECB7A598900D474721A538091CDC4EA14875 NEWTON.MINIHAN
889,564,728 *5C88DC88BAB7A2F9753C1137630F55635EE6C905 NHL1967X
889,564,729 *5C89573AA6D0DAB812F26336C9736B6CAC4D85DD NICHOLECOLBERT
889,564,730 *5C8132E5760A4658A552EBAF46DAB2A4978586A0 RUETCERIDREDNO0
889,564,731 *5C819F084CDD0C75CFF94363F964A306685F501D NICOLASMOLINA
889,564,732 *5C80B8FD53E4E37E2E8718E5EF426FC4E829AA85 RYAN.EAKER
889,564,733 *5C832286438D1188061A08F49A8E85BB3FD6C489 ryankinnee
889,564,734 *5C89BA9A5736BF115A72FBAC65A7AC236DEC0FE3 S14103009
889,564,735 *5C859D7815981D30239E40EF7810658F4F519D2E NORBERTSCIARINI
889,564,736 *5C88F6A4CF570591741D32D41D2129D266EC23BE notebooks</div
889,564,737 *5C81ADF4D7B05594C1A67304AF766416F012E97E NOTHING ROCOCCO
889,564,738 *5C80343F6773BC7A52DC05BB3044BA8B56983FFE NOVELINDAE
889,564,739 *5C8AFEF81164336CB5A1F62FD1302C51F820DC23 NRECORDON
889,564,740 *5C8C657940D4396FFA00797FC77758DABBA0CB33 SAINYAHED
889,564,741 *5C8854B102448F5266156BDA6DCED04ABA8950E7 SALVATORESHUB
889,564,742 *5C837C418A99468E4369DC746096AE70F7F77F64 SAMMIE.VANECEK
889,564,743 *5C870A799730E47052BE6C82905A977AA2F0BB7B SAMO SMSM
889,564,744 *5C85D9F828D489AF9574E85600EE887C9EAC8EB5 obs+ruc+3r
889,564,745 *5C8F8926BE3ABC5578429DE488AAB9487A73947C SANITATIS،
889,564,746 *5C8FDE4A0D96FDE3DF8A97A958B3E6F3FA174D6F ODELL.GOTH
889,564,747 *5C80670E6AC1909F8155783E25E975DF62363897 SANTOSBRAWN
889,564,748 *5C8435C8CC967846CB94E379EE80C40685207EE8 santoskistle
889,564,749 *5C8D342E3A07461A9E84C3DFC387D6FB93E08E37 OFELIAALONZO
889,564,750 *5C8DBF5D059005ADD8795424971CFD02E4BAFF85 sasnepmocer
889,564,751 *5C88F6D766B8C1953327ACA219143460113D5A32 say you felt this way
889,564,752 *5C8A3F1FCA16A2DD4CCB1BF105AE5EF89BBC3B46 OPTJOK
889,564,753 *5C8E4A1E1D738CE8BED3CC364ADF2EA16CDBED9A orleansinspired
889,564,754 *5C838E22BFCD17483FE2C1E908F31091FA4BE22E [email protected]
889,564,755 *5C808165BE7CF2666539B11087B6DF41EE438A8B ORVILLEVENDIG
889,564,756 *5C8A48BBFCD7B9EAB35669424583F1FC806BA11D osc1114+1on
889,564,757 *5C842B9EF69E953135005928AB3899C2C9F5A194 [email protected]
889,564,758 *5C86D5B375598B6FCEFB678666127EC6F15484B3 P->-`
889,564,759 *5C8D65DE556FF62A990BEE17144CBCF60450E65E [email protected]`~-`~-)0(
889,564,760 *5C8F67A10038BD517176D70BE1A51EB858950848 sevenpointed
889,564,761 *5C8215964781CAB67052AF7D159FEE09C3012D5B sha++er!n91y
889,564,762 *5C8EDAFE1290D0B77FBF0D1C42DFB5BFB8B30FE5 Sheds.Her.Skin
889,564,763 *5C8B64A61145968142D00A7C684DA86CB6B9DBD7 SHELDONGLASS
889,564,764 *5C8371081C5E676F926C0005EF8318A2058A814B PÁRTGYŰLÉST
889,564,765 *5C8C98CAC7A2D644C32731D0F675050E03527A63 PAS49783
889,564,766 *5C85D5C8C2A789FD18E357FF73D9F29B63058576 [email protected]
889,564,767 *5C8AC862B0F73F7F41F5508990DECD8B0CFD9114 [email protected]
889,564,768 *5C821739334DCA6315CF6A9644C706D4E991D9C6 SHYMYSTIC
889,564,769 *5C8FCC4C26F9B6BD4C054C9421880B5F6A1224FF SIDINGSPRING5
889,564,770 *5C8DC6C06E47DCF23967B9DC3B7D4D1A265C37ED SIHTEGNA1
889,564,771 *5C8194594F939BB414C00E834164524334870992 PELEASBBS
889,564,772 *5C834EE0676C2E7EE1DC7DF5FEB82BF43692ECE0 SIRTREVOR
889,564,773 *5C8256D1D9C0CC1BB61AAFFA9C047F88A6BAA3C2 PENSATOI8
889,564,774 *5C8955D7BF79E87A00032E71683A0138D97A00BA PEREGOY123
889,564,775 *5C8143CB3C63A222A2A7CB3DB27FAE2FECB0E4BB PERKIERSING
889,564,776 *5C8F72DC99F11820EAD529B026879D3319653EA8 slachtof0
889,564,777 *5C87D9A23A2911D22236D1B8E232F8DECA865CCF SLUZBE.7
889,564,778 *5C827F227819E523C89EEEC0D08C37D2BC9C48A0 SN0WCLAD
889,564,779 *5C846CA4BC70118C73C56C5EA02D8ECB29366994 SNEDITSGNIRDOF
889,564,780 *5C8B268F14C3840710CBE67BCDA0D2FF8B844ABF [email protected]
889,564,781 *5C8D59DCF9F60CF65F8926152D9075332C5AF9FE SNOOPYZOMBIE
889,564,782 *5C872F7148F92D509DC8FA85293F8418BC49DFA3 SNOWFIRE
889,564,783 *5C83619B49BF74A9B5B4E0D9D58263066F5F2E73 SONATA OP. 120, NO. 2: II. ALLEGRO APPASSIONATO
889,564,784 *5C81306FBCBAB9DDF98CB8FD065843F13F7D468B SPANNUNGSMESSGEBER!
889,564,785 *5C8B6855ED94A04FEE6B18375DCC4ACB47BF9B2B POLENGHI8
889,564,786 *5C838F7FDF03EEC673106C73A3923011A7A5C6CE pollini2006
889,564,787 *5C832C2B4F82551DBAE28BD4A4CABA97F0A3DDBC PRELEVEREING
889,564,788 *5C828DA99D3F2BDC0A54BC8DBE1A3074E01158BD stcerroc
889,564,789 *5C84F08305D2C94B514EA696177A74160DC5B5C7 PROFITAM
889,564,790 *5C8170E0F1E4562C7AA517870E23D87CBF9CA581 prompted
889,564,791 *5C80B4F492B79F6776F01010A7D9158D5592063E puški
889,564,792 *5C8F51EEEC61B6427B5EBA85EF7C9B53878C6A0E STUPIDSING
889,564,793 *5C8B19D07AD345E10488B1341794AC0D0FAB7F94 QB~0.~O.(>_<)
889,564,794 *5C862FAEAF7B58F0DBD027DA579BE86B1803DC9F q~d
889,564,795 *5C8C11D21487D5C19B9251F7514A3C7055736F2E S+UN+N9
889,564,796 *5C8ADC3191F34B88C9BCFE2A48360A29BCA1B404 SuspectBill
889,564,797 *5C88574D8DFCCB220831E19876A18C109B216049 Q##@~O~OSPLAT
889,564,798 *5C8EE4E7D89BC74C5C129D91BDBD8D7599453F0B SYARPSOTUA
889,564,799 *5C8B15B408769C18878FC2FA33A8DF2F7A4D9CF9 Q'U(
889,564,800 *5C88DCF6BAEA725E8A50B88F6AD490DDFBB63457 quantified1
889,564,801 *5C8FA37452760D99FE05B589A2412208B958F420 SYTTTMN7
889,564,802 *5C8487FA1BE8B00D064469F49041CCC996C974B9 QUINTINMADEAU
889,564,803 *5C8FB8E86CD39C76A135A4BC297E68AC88FEAD85 quintinmanders
889,564,804 *5C82B59429600F839C85E0DD7D3E54177E1AA2E7 talk8467419
889,564,805 *5C8E76DAB7CFF0BAE3217A035C47859D8FFDC9F5 RAMIRODECARDO
889,564,806 *5C8BCCA176429F1188E4BB3503AFCA299CF1B0E3 randallcrisostomo
889,564,807 *5C8611F63C80FE96922DB2019366E5722FED2AF3 [email protected]
889,564,808 *5C800AF1C819939190F476CC1FAAE17DB9B721F0 tandk
889,564,809 *5C829CF0279FE11BE3A7063F602040ADF43F3D55 TANNER.DELLAMORE
889,564,810 *5C85E83A24FFB6D30E240C3BAF13442F042DB604 TARDISFGH6
889,564,811 *5C828A30A15E60196ADF782437C53E7DFDA02A5E ray-yaan
889,564,812 *5C8B29DFA4933C878156B94AFA79184BA529B0F5 „RECHTSVERLETZUNGSBESCHEID“
889,564,813 *5C848A86F3BAC00EE71C5DA836A15E27581C1438 RECORDER.CONCERTO.IN.F.MAJOR,.RV.442:.III..ALLEGRO
889,564,814 *5C877D4CADD1587641C04E00C822A3EA927645BE TELEPATHIC--IS
889,564,815 *5C8F13F71089A78C6A297BC7C0452365F010C212 test123monday
889,564,816 *5C8E3F2DE4D1FE53D0FE0FFBEA7009850D8948AB [email protected]
889,564,817 *5C8DB0939E7D4A406C4FB7CD05131E5CA86065BF REQUIERS.
889,564,818 *5C8744CDC2A7F34F16FB39E1CC5A7EF17B07FE2C respectively12345
889,564,819 *5C804E1027A0FACCB71B758C83FEBC3DC2CF4DB6 THE.DOOR.OF.HEAVEN
889,564,820 *5C8560F10F7CB73B2B628E6C715D3F19123240D1 RETENTIONS0
889,564,821 *5C8BD4C1A825D2DBB4C6036AF71E3C7015665453 THE.LORD.MISTREATS.ME
889,564,822 *5C83908391319996C42DB5994EB403BC683EF920 REX.DZURNAK
889,564,823 *5C846B4C0AE596B70F6EC27FD3375A3234261BA2 reyedgeman
889,564,824 *5C807570441A0CBC16684A962169691612B56D4A THENEWMILLENNIUM(FREEZYJAMMIX)
889,564,825 *5C87C878A4C3FE16667BB211C65919E7CE6909F5 theokobrin
889,564,826 *5C8407E967A0AA09D40B9568812737E52526E9E6 RHETT.BURES
889,564,827 *5C89C6A18B099A8B8CD507D0A4E84BF54928FB67 RHINAHOUSTON
889,564,828 *5C84647E07D2F68F37EAFBA7BC86D1F55BA6F22A THERAPY-SESSION-7:-MIXED-BY-THE-PANACEA
889,564,829 *5C8A3F4999554EA64D55DAE2A43ACF76A7C2804C ricke77si41
889,564,830 *5C8558ECBE667177A5FBA2022481EDABF19118D3 rigobertoahrendt
889,564,831 *5C8FBE95C46A6283FD0144765680D6E436AF12B0 [email protected]
889,564,832 *5C8DC5260B97BAF3AB1504B4933E37CBA9E7590D [email protected]
889,564,833 *5C8095BB3D2902188631DFB27AC485DFD0A2CA7A TICKLESBAR.COMTICKLESBAR
889,564,834 *5C8DC575F0B5F5B3A8CC83BA33381E6A9B3DE95F robertbrutus
889,564,835 *5C86856A45E27738C7ECC49AEE9A90F186EAFCFA ROCHXBSED
889,564,836 *5C8068A56F55CCD77F9AB521874F19AA5C013D41 [email protected]
889,564,837 *5C8347A3F9AB6E3110A6033FA98EAB2782C0A7B0 rockyklingensmith
889,564,838 *5C8C62E54C85AC274978B5F513B66C14C03A1019 rodakemon
889,564,839 *5C8A80ED7E1BE12DF0687882FE9093441EA395CD TMEHDIRATTA
889,564,840 *5C86BDCED49E1F28EE807803FDF87A478A80E89E rogerriddock
889,564,841 *5C8F3C798C72B274DB745C9A36E69DA7CE8B7B88 TNERERVINE5
889,564,842 *5C81FF3336B9A7608B3BF144FFC52F10CB8589B8 rolandokochkodin
889,564,843 *5C8191B1D0A698976B8282C6C59A4039E8706279 ROLLAND.DIMAURO
889,564,844 *5C83D8460D339645E4C710C6B0CDF6A44962AE73 ROMANTICALNESS1
889,564,845 *5C8EE18911945F80FC28E71ADD3896D9A2552498 TODRUSSIN
889,564,846 *5C8438C5BC8FA673F0E31E5652219D7DBA835E3B To-Live-and-to-Die
889,564,847 *5C82F566248B72D95261A5B815CB2AC3C1DD482F ROSALIE CAMBALON
889,564,848 *5C86B4E8907C6B3DC600074D54AD14C2AA0B290C roselyn584
889,564,849 *5C86194B0BCAF088184F195B790C6B3DF2FE5437 TONY-FARRINGTON
889,564,850 *5C852F2ED779F4C8E635F282CF08A7405EBF3EAF tony.medina
889,564,851 *5C836C57AA0173B8AEB2F85E9AE9CD046BF44C79 [email protected]
889,564,852 *5C83D8DA6B0F76E00EFE96E638C3DB6C68B7315E ROYBAYNE
889,564,853 *5C841C288086CDAAFD9BC7605D8750787688064C TORCERSING
889,564,854 *5C8E16471E0D1B17E0C391CA8949BB1DC1677C2D ROYMAJORS
889,564,855 *5C8AA8581ADA9B4B35AC86AB79933B8A253185A7 RSS.DE.GEORGIA
889,564,856 *5C80297D49E4CCE3AAC9DD3BBC76E358C6CFFB78 r[t=
889,564,857 *5C81F69CF48C7EADECC1412CAF83102FB3605C59 RUEBENOSLEY
889,564,858 *5C8D8E594547F46FE0DB627B180374BA9726BB7C TRAVIS.BOBBE
889,564,859 *5C82A653D6397D58C59CE0E861169504E2DFDF87 rugbysmiths
889,564,860 *5C898D502250EE1288449D5F8ED3210AD7B0D082 RUSSELPELIKAN
889,564,861 *5C846C93BDC65EB395DA03A8146AF6C85FC3FAE8 TRIBOLI3
889,564,862 *5C8FDA321CF5D99086D0E8E8225946F21A5437C8 trinidadberrospe
889,564,863 *5C8DFC17B6ECFC40CDADA51F4230E050D864A97C rzl[
889,564,864 *5C8C4C2372B7F00BE2B343D4A3C7A60172182290 SAGUYM
889,564,865 *5C82E54422B9C0E0DD10F40FF81F8530E4D60803 SALVADORVANMATRE
889,564,866 *5C88D13EE50AB217D65876BC6893F00733B5FEC1 SALVATORE.LAGOMARSINO
889,564,867 *5C8842058A7D5501E8FA924E247677E33A3B4E20 SAM.CLUFF
889,564,868 *5C80C7C87DBBF1C56D2B0EE75A890647E6368485 [email protected]
889,564,869 *5C8E50B68F3C53A2831BA85533760DA68444EB37 TUITELDE6
889,564,870 *5C8F2064DCA9CE2F9A592267D6F13B201A27E44B SANTOS.MONAHAM
889,564,871 *5C893634CA9865EA7256BA5606B48BD57CA7B5A7 TUO|
889,564,872 *5C8D8552080E32E7494C3A9815492285E812151A SAUL.MOOMAW
889,564,873 *5C81BDA9767A2B2D2B98AA7125E24297A95D7086 [email protected]
889,564,874 *5C8D6AF7DEB720A0A016510BFCBD4B2685CB03C8 TWS/
889,564,875 *5C82BC275B6C2701D66D91C3ED33D5812E55ED48 TYRITHTRAN
889,564,876 *5C8E817B1B3606691A61664D645FB7DD234643F1 SCHAMBLAIN
889,564,877 *5C81851E74EFB54C272DC8FD9D1CFCBFA6641FAB uan.uann
889,564,878 *5C86FFFF0EF25BAC32A09256BCC501DC0CA3D02C SCHMUCKGLAS
889,564,879 *5C838BA162628331E245ABB3B6624215040194E3 scottevans
889,564,880 *5C84BBF10510E9EDD90ACA31E4605AF28D46BDF2 SEAN.DITTRICH
889,564,881 *5C808A5162D402A98CEBDA9C4AC5282B92C344B3 seanyablonsky
889,564,882 *5C88BFDD42F2DFF001BA616BB1F3563C56804438 ULRIKE HANSEL
889,564,883 *5C8C3DA275102403D8EDEE9D9A8F8D096E57AC63 SEIPPUPMAS
889,564,884 *5C8244A31067C13512B44EEDF0D2607D6E9E9C93 UNCOURTLINESS6
889,564,885 *5C81636728AA6A80D383B52F0860A411C56F92BF [email protected]
889,564,886 *5C8A0E60C552244ABA51FE0F1B593AE7EFEDD5EC seykoski2
889,564,887 *5C86A3D515DC117F4DF35D524ACFD68F45EC596E UNWINKINGLIES
889,564,888 *5C8BA644EBC5A1602198769FDAED4BD28764CDB0 SHANEFUCHS
889,564,889 *5C87743A0096788D9106BF1860D2804627A000BF [email protected]
889,564,890 *5C8218AE41DAC4A6C01E00CD75668DC8F1A52C02 URYDDIGST1
889,564,891 *5C880B9AE640F372791170091DF2129F74A13AA7 USAMATAHIRLAKHANI
889,564,892 *5C8D09505FC73E3C8E93AF9B8E7CF4B1AA72BA63 SHAYNESITRA
889,564,893 *5C89A47E80BD54FC7183E05C4D8317228014731A SHELTONMALTESE
889,564,894 *5C8A3DEAAA752467C7E194B98B6956751F8801FB [email protected]
889,564,895 *5C81EB1B036FE3A98B9BE6A9B4297B5D8F0559B8 val$3n3$
889,564,896 *5C89A8A896E7FAB0FFCF853036928C464618B819 vancefleniken
889,564,897 *5C822022E46ACA95B7E0C348FFA7DAFD9862B80E VANCELAMBEY
889,564,898 *5C8FA7EE1D4325951E616B6A3585E1B32776DE9D VANCE.TABISULA
889,564,899 *5C843721FA91E84FACEE2243AC0B40906CB2D954 VANESSA-MONTILLA-GAYOTIN
889,564,900 *5C835C9042873C9279BA2C75BCDC58D6A4775405 VANYA-MASIH-SENDIRI-SAJAA
889,564,901 *5C8E4C35AD07A8C85FDA880BDCBE60CA1C440BE9 simangele.shabane
889,564,902 *5C851219366FBAC8F6672A0BD0613C1CEE88B640 VAUNCILE0
889,564,903 *5C8172D3B24C75139BFA945FBCCD7CB1038E18B8 SINOTROT8
889,564,904 *5C8ED87267F172DEB8079B3834F1E3F3D621478F VELVETDRUMS4
889,564,905 *5C8A46A148E27E899193822137788C618765435D SIRREE
889,564,906 *5C8CB90CD20D815797F83143A34DCBFCB34F3829 SLAVONIC-DANCES-2ND-SERIES,-OP-72:-ALLEGRETTO-GRAZIOSO
889,564,907 *5C85D8DD1AC9F9A80377831B1B23BD6A6E0ADE3E vincentheuring
889,564,908 *5C8CB0F8458BACC49AA43939ABAE332E3FCF1C9A sogdianese
889,564,909 *5C8AF3F6D2C2982A440BBDD1FFCE7CA84D0D63AF solvanharlingen
889,564,910 *5C8455116CC9BAE8902F9571A594377062D24D12 VIRGILIO.DENG
889,564,911 *5C8C7CFFE62FC8BD802229F95D91B5E290230A4C VISCERA-ITCH
889,564,912 *5C8ED6124FABDE1F611A1E7BA5BA9271C1F84741 SONNY QUINTANA
889,564,913 *5C8835B9382844683E8CEE987B9272F021006A36 sonnyschoettle
889,564,914 *5C85717898085DDC7178366FC9228AC68C843D17 sophie.de.rijk
889,564,915 *5C885654C37B53612A92264DDD0ABFDC17611FC8 VITOR-DINIS
889,564,916 *5C8DBEAAAFB05E6DD828E32772C36B857537E0DF vivian.ann.cvetkovic.taylor
889,564,917 *5C81884B6CBE929DD2F2B0910AE674FFA0C4488E SORRY,.BUT.I.GOT.EXPERIENCE..I.CAN'T.LOSE.IN.COMBAT.
889,564,918 *5C8062B0CF2023AAB899461029C10FBF4EBB41DD VMALAN
889,564,919 *5C840B43937FAB5486884DA6718DFB1CF27522B1 VOJUZINIH
889,564,920 *5C8A8B27E8A2BB1D641D714628361656A069AA1D SPEKABYLLE2
889,564,921 *5C8B071EA2C07F0DF1B7FA04EC38D7CA73E59CA6 SPENAEDJE
889,564,922 *5C8A42BF421FAC68D40E92BC4BEC1997616D5B2D spiccese
889,564,923 *5C83D64DBA6C5D3144B7EA8EFA7BA6D426304890 Splat!~.~.~.<p
889,564,924 *5C8AE70D447E704B4C32B06DD1009FDB7DCBAEA1 vyleštíme
889,564,925 *5C83061DB972F4466806813EACFF070AE5BDF3BD WALKERMCGHANEY
889,564,926 *5C8B11BEA038710D1EA8D2F542A3CDD11F149616 SSENELBALIAVANUED
889,564,927 *5C84182776224B693CF140D6C173ABCCDDDD1258 STAFFEDDY
889,564,928 *5C8814B87144B6D25211A95FE79354AEA891CADE WE.ARE.THE.FACE.OF.CHAOS
889,564,929 *5C8C71FE1BC10C40923E223172B1CDD018391D05 stefanritchko
889,564,930 *5C8A21BC5244C6A8BF7802CFE0A74A23C33FEC22 STEPHANSTRAWBERRY
889,564,931 *5C8350E691FE6EE26F768827A7FBF03A7DB52DE6 WENNYDELEON
889,564,932 *5C8FB12C4740872EB76D3E49AE9D6FFA77D011D6 [email protected]
889,564,933 *5C82ABD4071CFC37A99870348BEA96DB7FFD0A77 STERLING.SELVEY
889,564,934 *5C88D9CE58181024464554B6816F14785AAE8E0D WESWESAAQQ
889,564,935 *5C8DC93CE8CD1FCCAAB24B7081ADC3F8748B73B6 STEVE.SHERFY
889,564,936 *5C868D42B3895F48D8EF7C2E2DE9F929E084835F WHITNEY CAMPBELL WILLIAMS
889,564,937 *5C85CD9CC2D7F5A69B1C3AD31E3E62F7EDAFC50F stop-your-bitching
889,564,938 *5C883DFAC31A660CC215E3BA5F0802D22996F7B6 STORMFELLED4
889,564,939 *5C8A60AD981916C9808C80F6F8E74A71D1B57648 WILBERT.JENNING
889,564,940 *5C80680D8385012DF0F3D9AC5FCCFEBD3676C558 WILBURN.FIREBAUGH
889,564,941 *5C85B9F53AA0DF379AE28AEA2E71F7E2ED44B228 WILDWILDWAIST
889,564,942 *5C8267A478C5A2EF405466F69C573222D9FD2AA4 strong>notexmlschemareq19990215</strong></p
889,564,943 *5C8C405B9AD4C61853D643B909BA49E4EE1D37AC willensviviane
889,564,944 *5C8B2FBD8A7E35582332BDE8E033FC82B990AB40 WILLIAN.BRINDZA
889,564,945 *5C81941104756AFF7E6DBD95F244D76B146B5D0F SUBLINEARA5
889,564,946 *5C80AC2255FCB685C9F4B2FB4F0EFA4AEEEB5A67 SUITABLEPLEASE
889,564,947 *5C8A4C88BB5775AAF8DA7D324B9D4F7EB86D948E wolfner
889,564,948 *5C82D24D47BE0D2FA554DE292C7064652DE6ACBC SUPERPATIENTLY
889,564,949 *5C83B1070FF6BACE3E0C80381EF5BFF1D90EFB8B [email protected]
889,564,950 *5C8342A0CBA62B705D31AEA902029604099A83B8 WRECKINGYOURNECK:LIVE(DISC1)
889,564,951 *5C8505A73E32D6D0B0C5D98B8370650D8A8AAA9D SWORDBRINGER
889,564,952 *5C85B358412E51A28BDDA41C82EBF51156A23223 TABKIT432
889,564,953 *5C8C2152BF1D9D37ABFD91DA9BB340939585B472 TALK86.41.7.93
889,564,954 *5C8A300FDE2FE24AC8775746BCB68E2E61177966 talk8782992
889,564,955 *5C88847715AAB97E9C77EC0D6C9EDA163B96F514 )X(*dP
889,564,956 *5C870F4D0F63FFF460A2E4175E951BE01A9AE912 [email protected]
889,564,957 *5C83A3C7E406680E4045A1835F4B2F98B77DEB38 TANDYFLOWERS
889,564,958 *5C84A26E63D82B33CAD726D2FF106DA95BEC36A1 [email protected]
889,564,959 *5C83CBD58C44D2EF72D243BD26A4DC81AAAA47A4 YANKEESROBBIE3
889,564,960 *5C818C692C6FF58178FA094B9368FC2D56BB1EEF TEKEMISSMME6
889,564,961 *5C82116E8C1BBCE2FB13A0FFFAE791E5B4A4D930 TELLOH8
889,564,962 *5C8E0AA078566CA87A763071493D7A07103B9922 YEELLY-LEI
889,564,963 *5C8CA556F5656590D333D2FE9AE9581AF9F7C06A YEXS
889,564,964 *5C860162A388BEACAC04754D7D57E56464F2A92C TERENCE.DIFIORE
889,564,965 *5C8DB18299F44F9F0859265522C12DABA9B567A4 TERESA VEAZEY
889,564,966 *5C8C82CCDCE7DB644F5C9ABEFAE52417128D350D TERMINATEPROCESS6
889,564,967 *5C8113179607A1E02E59A7D2C9153EFBF02BDBF5 YINGRID
889,564,968 *5C8F37B91E02EB0ECD09118D7865EDC2247D4450 TESILIKN3
889,564,969 *5C8F825F61F0D73D3C2D2D83664CC83DAD2F6437 [email protected]
889,564,970 *5C885384929BB794D1BCEF896EADF4F3B4693CE6 THATMATTI108
889,564,971 *5C8934C8204C8AF6B8D546ACA406ADE0390C5CC8 you.were.everything
889,564,972 *5C85771C165208716A340ECFE68B7D2B2B2193B0 THE ABSOLUTE SUPPER (DISC 1)
889,564,973 *5C85A7108A842AB6AE5FD2A0D8E7EC2FB7CCEE10 YUVRAJMAX
889,564,974 *5C85B42B7630A6F633A29FE7F18859B70D750D96 THEKENNEDY07
889,564,975 *5C81C4B1DB70943B283E85CAB8B9A6E57F46512F [email protected]
889,564,976 *5C8AD35F844791FE0D5AB39CC830E57EA239B621 Z"8NSH
889,564,977 *5C8686DD9D7C7FA43B2393691411A778E33CA3C3 zachary-klute
889,564,978 *5C87B9549C5E72D09700FE9BB62683D66F3533DE ZACHARYTRNKA
889,564,979 *5C81D8D98B2A5F2F25882C9769C6A55434CFB0E0 ZACHARY.ZEE
889,564,980 *5C8ECCE71D61C63454D1252544EB49AC364D275E THEO.DEWOLF
889,564,981 *5C82EEBCA3E505A110E39FFE60FA36A0A370F1CF THEODOREGUSHUE
889,564,982 *5C8EFAAFC9355C062143ED005B1538A4E428B8F3 THEODORE.LAMBOURNE
889,564,983 *5C832F1D3907BF79814D7E9FC594077EAD5BB0DE ZAYEDUDDINAHMED
889,564,984 *5C8DF320326FD5945935DAA5116289A86328F3AC the-source-and-destination-machines</P>
889,564,985 *5C8FBB32E4DBDD571A4A5CF5DF19096296D691EF [email protected]
889,564,986 *5C87729F39344A245B1FF5EC1039501CC1BC534C ThirtySix Silos
889,564,987 *5C8F4722E001F4CD5A18931D96E0EB8B59D4E552 ZENTHILLIVE
889,564,988 *5C85285BB32A296ABCD3A88FD05630EF6BC2BC23 zeregif
889,564,989 *5C82E421D8AD4E1C2C6350163D95A6A9895CD5F9 tibbitts..t.ih1.b.ih0.t.s
889,564,990 *5C84308EFDE81633F3728056A28F41EF12729A86 [email protected]
889,564,991 *5C83324FE288800C4DD50C2757694A7F75C2D782 TIEDOS
889,564,992 *5C8B75045F3259BDABA26D58C4B406706FC76B59 zhondanjuss
889,564,993 *5C8F97261504614D60CEF293C3184656305D6360 ZINNIVANILLI
889,564,994 *5C84FB31CE26DA1EEA322D15C0CF869B237A4A0E ZIPPY-RIDGERUNNER
889,564,995 *5C85AE0F6ECE583DDCECD61382ED5E7BA49675F7 TINKERPEEWEE1
889,564,996 *5C82124F0148E8BEFE23D18D0E7E3C980DD3B76A [email protected]
889,564,997 *5C812A419092353317D2239BD880BC2802984258 zoranzrna
889,564,998 *5C843592ACBFACC500E11F2A6AE83DF147C2E082 T-MEIN-SONG-/-TWILIGHT-TIME
889,564,999 *5C8EB02B3E6B4868351091686BCDB2167EB389C3 TNEIARELBMESSER5
889,565,000 *5C8D046C815F55065B1B61FA870D3D3EA4AB1B71 $TO$$
889,565,001 *5C80A53B2638989BD84E18C21068319E87710463 TOBYYANCEY
889,565,002 *5C8505276CA2333DB3DA699B8D87C95030C3034F ZUNANJOST
889,565,003 *5C81402B974A5445951CA90917CEA4A90551F633 TONI.MARK
889,565,004 *5C84D75A90022CCE83FF3B2B5941DC711FE59BEB TONY':*SIGHS*THANKYOUFORSAVINGUSALLRHODIE.
889,565,005 *5C84B3938E8101250765A40FC564808DC6717EAB TOPICOBJECT0
889,565,006 *5C8EF005A949191A440AB7314C99D8DA097BE181 ρομβοεδρικούσ
889,565,007 *5C820EE60CCB88081DFEA1512F47B3D6969C6927 [email protected]
889,565,008 *5C8150AC6B24CE49AFAFD0950329E0F942A7332D ВЕЙЙЯ
889,565,009 *5C8796DEAEF7140E37467114F6BC06A5958E936F кнежевство
889,565,010 *5C8FB695BE061A723E0F602165437C9B027EA4C8 МИТТЕ 
889,565,011 *5C8548AC0C5CAC9B4345FD04071AA0DC322C75FF TRENTONPANCIERA
889,565,012 *5C809CA01985AA450066968F1A103063506A3179 tricia.hinck
889,565,013 *5C82D912392FBF5E48F8628FCB5E853519BE0468 TRINIDAD.VANDENBERGHE
889,565,014 *5C8AD9DDBB3622094A9C3B50058288DC80F95BD8 ПРИХВАЧУ
889,565,015 *5C82876CAC9D2BB9BADFAE9EF55E6B5CEF97DAA8 TROY-SCHLESING
889,565,016 *5C86B9406C11E29C6FBCB19E2EDE48D07EF627B8 схр
889,565,017 *5C8D5BB471325682818E48F89845AA30FA7B4ACF цветочном
889,565,018 *5C8C0F99E0B32EC6BA5117532C9A7F6F09CA6F8F を持つが、NTV自体はテレビ単営である。
889,565,019 *5C86CFD48AA2987A3798D13A041FB11A53FD9F2A UFM>
889,565,020 *5C8D37D8AF74FA59BC3F836DB629E1BE1124867B UPAAKHYAANAIH6
889,565,021 *5C82C0E4AFBCB91AE6057EBBB77180215DE183A2 valencia-alvarez
889,565,022 *5C8BC030BE6519296DD6A8BE7B23B8128522C43E VANCE.ABAIR
889,565,023 *5C8A5C00E08E26901BEB3CBE63F9F6236A975186 VANCE.CRANMORE
889,565,024 *5C836957C262984870CA848BFFE5EE7C3DBF6633 VANGUARD-ASSURANCE
889,565,025 *5C83CE2A448ACD3437476DC7CF8E30C09B0B766B VANVERBELEN
889,565,026 *5C8F179987C95BA1F891BEFE4E7BB131162C7512 VANZ WHITE
889,565,027 *5C8D718328F42E43F21B6D6249221C4CCD6335E0 VAUGHN.BENEDETTI
889,565,028 *5C87226A305CF70178A37606AB7EB62AED73FE2E vernhowells
889,565,029 *5C81E9E7449B1BCC40E1680E4F36884FB02E4894 vidyut.jain
889,565,030 *5C8BB85479ECF63E70830180AF5DF130E023263D VIERKANTES7
889,565,031 *5C8795B50E5DC8786D6730655249B23DCA268753 VIJINDRANAJAY
889,565,032 *5C8420AC89ABD8E720A89D4FEE8EA9023C5153FE [email protected]
889,565,033 *5C857DE3201250083558B5F0B11DEE84DF956B96 )0(-~-~-d======3
889,565,034 *5C895209EBA472461225C35EC3C180A0A58DC0BA (>_0)-o~-O~(##8
889,565,035 *5C8C4A5F7D3C83BA8923C297B3866D83CAE851D6 0V3R93N3RL1Z710N
889,565,036 *5C898A2539C4E533647A0208FD3F693C18064703 VOCINMEZDOP
889,565,037 *5C862C074BF90749DCA834646B6C77966231F59C VOGELSCHUTZVEREIN
889,565,038 *5C87FFE1996AE9B2AC1833E8463D241015D2625B 10OCT1302
889,565,039 *5C827A3702BDEE13AAA10105C442A773D3D5B4B7 1195161 nyt-ensimm
889,565,040 *5C88367DF7F77F333C9010C4FC6AA80C6140443F @11EVIO
889,565,041 *5C84ADE9790A3C8BDE82B64785F37929A337FEB3 1216903 wir-muessen-in-dieser-phase-antizyklisch-handeln-.
889,565,042 *5C804C3E2CFA205BC855708702886D59235561C6 vooruitgegane.
889,565,043 *5C865829A582295CAA990B69C0A473F9F9AEB7DF 1294813 sill
889,565,044 *5C80DE212ED1DA91491FA7C7FC7A7116F18E83BA VPOETNCH
889,565,045 *5C84880DC1612FFC0069AE3E05E3A77CAD3DD03C 155539 JA-HEIT
889,565,046 *5C839D39303506285EF60EA1F55C94118B6F4FD3 [email protected]
889,565,047 *5C84C2F74BE40725C1FEF2BA9271F9CB266F3034 1635686 KUVANLAATU-VASTAA-JOPA-35-MM:N-FILMIPROJEKTORIA-.
889,565,048 *5C833525F3855F7ADB3E861885C3B6ACF5E08236 [email protected]
889,565,049 *5C88EFC19B2F311388030A13BCC4112AE9D5344F 16-ROCK-'N'-ROLL-HITS
889,565,050 *5C8F0FB237103B01C0C2C33D197BA90ED6D5816B walkerbirky
889,565,051 *5C83217F853F0E504F1194C3D2580D8B9A5EAAB4 1787008 ".ich.bin.ja.froh.,.wenn.ich.zuegig.bedient.werde..
889,565,052 *5C837417CFFFF47BFC011988DD8C104601268681 WALTER.KAHUKI
889,565,053 *5C86926351D7E997356EE88665F271963649E69B WALTON.BROADY
889,565,054 *5C8EAE0FEE005BF5B5460BA324033023A97FEBCE WATERDIKEDOODLEETANGFARM5
889,565,055 *5C8FEE8EDAF44307BA53755B4E2F822497128552 1BACKGROUNDCHOR
889,565,056 *5C88D7C5CA72453F9C686D28098AABB40675E953 1BANGKOKE
889,565,057 *5C85E5B8918D79026F3E1DCD203193E69562A7A0 1BIOFAGS
889,565,058 *5C83C9A700CE4A2B1BC2E4819910429AE25B5B59 1BUBLAVA
889,565,059 *5C8750BB7778BBE6E5CBC7F0982CDDFED5CB9C3E WE GOT TO GET THAT FIXED
889,565,060 *5C8C17AA36E95E197A726581F11379845181F593 1COUSINO
889,565,061 *5C8E6AA303491DCB3DF84FEE2DB262FC471F071F 1DRIVEWELL
889,565,062 *5C8264C847A2E098E221C396B5E0DB5FFBFF5950 1FLINNFRA
889,565,063 *5C8F426E8587FEAEAD8924758E5D842C18CA0F3E 1floydtross
889,565,064 *5C89B7ED1631604676191CEF12413540D1BE8E94 1FRENCH10
889,565,065 *5C832CACBEE9ACD5B96D555B0065993B18A705B4 1isindeydi
889,565,066 *5C87542AF9404273D577A00D6C50F895D0E3EE7C 1JOGGINGSCHRITTE
889,565,067 *5C8FA55C023E6FE0A43B23BBD7B9A1AF31F44C6E 1 joschkawahlverein
889,565,068 *5C8FDC7CB09107EEF9BB0BB654A5FA0679F76654 wilbertliberman
889,565,069 *5C8C8A5A3174CDDBF74524DAF63201FCAA05FAF2 1 LOMAKEOHJELMISTON
889,565,070 *5C8BD6584035EA2F1BBE2B76A27BFF4482DE870D willetwillet
889,565,071 *5C8BD391A6EDA2675EB76DFFB9B44E95D3155622 WILLYNE WILCOXON
889,565,072 *5C85D3C2B5F244D5B527660F088734E4230FB171 1 NON-GEOGRAPHERS
889,565,073 *5C838062E1833022DF4E534B9396E1EBD9CC10B1 WINDEXPHPTITLELA_VI
889,565,074 *5C825C80B58BB7C4602AF5D44CF7E99DEC3D6C20 WINFORD.VEE
889,565,075 *5C85FEE93E252BCF4F6D95C0BDB863529A1FE7A8 WINFREDHOMCHICK
889,565,076 *5C83B097895FE4075B1BBD14303F20228A231BEE 1 PANSSARIJ
889,565,077 *5C8F92E034A4BF319C5DCEDED3415FC6DF376CBB 1polinow
889,565,078 *5C89BBB47A9FBD137BCA9408ACF2AA6BC3003772 wksrfoses
889,565,079 *5C83A8EFB464F6EBFE29DACAE00FC6880DE962F4 1SKRIPTAUSKIELT
889,565,080 *5C801CDB0160FEF51A35F3B3CD4596C2E8DA7050 1-social-venture
889,565,081 *5C832ADF09557B52D8B21632D74A3159559678B3 [email protected]
889,565,082 *5C88030C213892D9EF0743D1EE6D18183AFB9FFC 1TOIMIMISTAPA
889,565,083 *5C8325D203C41111B03751F9402FDCC46581CCFD 1 UUDELLEENVIHKIMISEST
889,565,084 *5C8FD0B29078CEFF064EF7676FF6DDED233F5302 WWWMYJOYONLINECOM
889,565,085 *5C8D7F238694E5A708D2DE3248C241514E9078FF 209764 vastaus-:-jos-olet-muualla-ty
889,565,086 *5C8E95DCAB36BBCBDE235C91F45BB756BE923831 XETABROS5
889,565,087 *5C830668804BF13E73B5230D8B19C8F97C3EE4E0 2516520 DOLE-AND-SIMPSON-NOT-GO-UNCHALLENGED-
889,565,088 *5C8B975B187850D5A16EE6D4C55A97EC2B5FFE43 2531844 johtokuntaan vuodeksi 1990 uusina nousivat harri lepist
889,565,089 *5C8B8AFD01A3FCE4546E6011B9A40AAAB6814604 253B23E231D31DF9F4EFEBE08C1F57CB MARCH14
889,565,090 *5C8DE02C542B3F491B2B7A2A1E41EEBBF61EBCC3 26oct1629
889,565,091 *5C89A5B475258436005F4E311030ED159C63287C 2alpha-maennchen
889,565,092 *5C82137EACA563541691381599713F065858575E 2b2xd
889,565,093 *5C83C2A2710776955F605C14D5D5A131698EEFA2 2DOUAGIERE
889,565,094 *5C8DF28B38EBD1B53BCC60A6A8F0DEA607CFD8B5 [email protected]
889,565,095 *5C8F075B2CD3575E2A32430F3B97AEE19E45E32D 2EXTREMITE
889,565,096 *5C89AE762A8413F4215188A16E3CDF6C0A6CFF6A YATINHANS
889,565,097 *5C8A65AC0B1C7BA51BED95469BF8D66D9946F0E3 [email protected]
889,565,098 *5C81ABA4BB0283515699520E85F4ED531F8F84E7 2KASHAWN
889,565,099 *5C8D42D43D3BD9E1D3D9A8AA112A2B7EAAC2DB8F YGVUSTRGVH3
889,565,100 *5C84D108135CAB4572C8F331564794C9FEA5FF2C 2LOESCHBOOTEN
889,565,101 *5C874B8B597BD066F6D70235F6CD95DA367643DC 2.marcellus
889,565,102 *5C860A10F69C5FDBB9DAF3D365A462FB8D850CA5 [email protected]
889,565,103 *5C8FD084983A33A917205917D5DDC7AAE3DDE23C YINKA.SEYI
889,565,104 *5C87A53DEA701B232ACABE7D8EC72CF91EAE5DE8 2ralstons
889,565,105 *5C801DF6FB3F0FD028F8DAACC0CD3333D6C72174 YOBANA.PARADA
889,565,106 *5C8A8898D21DD0D6562EB793D161F5330598CB34 YONBLAZINQQ
889,565,107 *5C8C816A03CDE9A1E004366EB8FA27790931714D YOU'VEGOTDARKNESS
889,565,108 *5C8E7F9CDBCB14BED9AC42CA22D1798421C8092C YOVONNDA
889,565,109 *5C8EBE04BB23E15B8FEA1E35E1E56F73BE4F02B9 385367 hiukanminuakyll
889,565,110 *5C8DFA7D86D3967628939ED33BBF094BDB8A479C 3B17401592425938012143
889,565,111 *5C8AEC9609414D56FAFE0AB498A71BF2192A0DF8 ~`zaaa
889,565,112 *5C88628DF282B7CFE107F25C1BB56EFBF34403A3 zachary.suykerbuyk
889,565,113 *5C8417D96E1B2CD0577CC7C3739553FAA50EC3E1 3ILUVBERYL1
889,565,114 *5C87CEEE91E02E45ED5AB28959880F6CAD55D139 3ILUVBIOLOGY
889,565,115 *5C8153C624CB3D27352F2D989380785AFFB9B6E7 zachquintana
889,565,116 *5C8ACCA493FB9DA707E0989E3FC9D490901C466E zdu.
889,565,117 *5C8DFF816CABB2B8AEC9D4E3E4B895D887A47477 zentralnockenwelle
889,565,118 *5C87A3F3C383F99C827089EBD79EFFFF07ED632B [email protected]
889,565,119 *5C8EF6CAB0E5A5695A0507C6ECC6EB789553DC58 421SIENNA
889,565,120 *5C8EAB2C904086E800CDE0AD9F8D1CA3E12EEEBC [email protected]
889,565,121 *5C8B2BCFB8AE795B521E96A75919C6314E5701FE 494306 EDELLEEN-VANHEMMAT-KOKEVAT-PUUTTEITA-MM--P
889,565,122 *5C880AB22295207A1BBB7B2471593F99A49BB981 [email protected]
889,565,123 *5C86A5924178C63E2A9D897167A0C5C0B502CF38 4AJATTELEMISTA
889,565,124 *5C8F10AAF875EDD8B40E0F7ADDB43FB534A76E1B [email protected]
889,565,125 *5C8FB4DFA48EFA93A8E39293C816D1E9B9A50D9D [email protected]
889,565,126 *5C8FF58F282C3030247867D588D50D9E3C985B57 [email protected]
889,565,127 *5C857A11907C3B60096192C7098B1CA198C35BBA ZIJOZ
889,565,128 *5C82FA118D20EEBCE4CCDE0E8DFB9D923B9E8F69 4ILUVFERGUSON0
889,565,129 *5C8989B29CDF5743FE3AD634525B26E9458DD37C [email protected]
889,565,130 *5C8232B14EA4F994D00D909F09056B2FB4916022 4PRIMITIVAC
889,565,131 *5C816AE2BCE1C228211DACCD02A30BEB442FFEA2 ZYUUZAI5
889,565,132 *5C8F31308153A63F1CDF28ED907B434483B93830 4ROOMOSTEOPATHIC
889,565,133 *5C891A8579B7ABFF2AF7870F64678B31D723B851 4SCIURIEN
889,565,134 *5C8C85DCCECAFBB57C2EEC46E380C1609FAF141D 4.STaPLeToN
889,565,135 *5C857ED3C9920BA40F6C15A9CF7F6B61A109EF53 4thatcraig4
889,565,136 *5C83A404F65AC0664801CD04F7B40CD177718BB5 4UNACHIEVABILITIES
889,565,137 *5C8EB963C4024CFD1A06DC7B06E1F5BA3F0CFEAC АЛСТАХЁУГ
889,565,138 *5C8AC930EAAAACBEB0DA3F6B6022117234A1038A ГЕРКОНІВ
889,565,139 *5C877CFB4DFA6BCBD6158956504AA7327F6D620C дестилиране
889,565,140 *5C88CA5C785225951FBD28DA175F30E80772D424 5AMARGHEN
889,565,141 *5C83ADEDD1F19F0DC077065FE840BDC41297478C 5ANTOINETTES
889,565,142 *5C8AABE5D6316F57717E95F8571CB5BE71BB7919 ПЕРШААДКРЫЦЦЁ
889,565,143 *5C8B58C4FAB78E6784EFD735126527023BF1533B 5ENCIRCLET
889,565,144 *5C8EAB4ECCBFC6DB13258AC4C233DCC540439885 5ETCHEBARNE
889,565,145 *5C8109239AE8CD28518C6610B11CF25A42C7C0EC сірвідас
889,565,146 *5C82CDCCC6626AB15517E480841BBA02CF59B284 ТВЕРИЦЫ
889,565,147 *5C804640A68D74B5FB083747709653F532B6F6DC 5KRISATINA
889,565,148 *5C856EDD406BC380A6454B2750C4B3358620FCBC 5MISSTHEMARK
889,565,149 *5C8B163A3A001913A73BE44CCA5ADDC52B524427 5MPSCBSW
889,565,150 *5C85D41E39D7C8CBC941E18006767E55D64F444E 5NESIDNAK
889,565,151 *5C8E4A628C48C04724C815E4B20B97B3EDB93469 全国ツアー『DO
889,565,152 *5C88DA020222144F7AA5405AD127A61CF5D60640 5PMCTRAVEL
889,565,153 *5C8F045A67C429CE13EFE165638ED55D62725B26 5SNEGLEHUSE
889,565,154 *5C80A0D04AEF1960230765646CB132D9A70C935A 5VOODOOWINSTON
889,565,155 *5C86B67A843B1C28BA77E920287C0ABEDB0F066F 5WICKEDMOON
889,565,156 *5C803548E166AB9FF6DACC8361EEC0EA76A85CAD 611086 ARTIKKELEITAVOILUKEAKLIKKAAMALLAYL
889,565,157 *5C8D3CB1D7E00ADBD80C352752A5B616437BE4C2 638SELENA
889,565,158 *5C8277C384BFD7171BC7A27FCBB3E9C07D82A16F 6aaltion
889,565,159 *5C8BB099E73B05EAB2DEE4861F37E2CD18D5F94A 6AUG1247
889,565,160 *5C8A02C7C7864B1795870A15859E340488B63420 6.issam
889,565,161 *5C87D48059B0979B2DDB7FB20E1DD6A3EDEA3BEB 6JUHLAFILMIASI
889,565,162 *5C82FF5A9D96A4D6B046AF2B3DFF87A818D9CAD3 6NDERANCY
889,565,163 *5C87D3BB8C0A93BDC9F73FC62C554F66014DFDBB 6PER
889,565,164 *5C8140522A7BF3F9E987B4FE42881110FDC28D7C 7ASHLEYASDFGH
889,565,165 *5C8659654DB25559B7D8D275F976A5C26ECAFBB8 008CAEL
889,565,166 *5C811DE476F50DFF045523F5E5B73242E6445657 042QUINTEN
889,565,167 *5C8EDD9FBF098EF04A1658E5C097BF7B4A6B7955 7INDVENDIG
889,565,168 *5C8C4F57907CF278B4510634E6B988261EA4211A 7MARSHALDARREN
889,565,169 *5C804536F3FB8AED3A6DBF6477A3088DB564220D 0903a520f27730708e4ecf70f0af4635
889,565,170 *5C825BC67698A55DC84B00DC873681E68A029662 (-_0)~`q=8
889,565,171 *5C88172E5D8147EB94108D9A060D5500B9AFAD45 7POSKUPILI
889,565,172 *5C8513EA09E73CC69F2344108F8AFAE6ECD86E9F 7REDIELSUSRUC
889,565,173 *5C891DD49C2F5335D114D18B247B8E6204AA467D 1200180 VAPAA-AJAN.MATKAT.KARIBIAN.IT
889,565,174 *5C83A6B83E06F32FEF34CCA5341A1707C13B20CC 12886530x
889,565,175 *5C8F8C004E9B5C7DAC326021E3E4293749A05F54 808dawson
889,565,176 *5C8CBA5231FF6E5E29C11330571527F4C683FA97 8634 Cocuk-mama-,-yemek-yiyene-kadar-da-o-ekmek-oradan-alInmaz-.
889,565,177 *5C895965FED4E1CF0EA19F244932991EA678E796 1495929 LIITON J
889,565,178 *5C826D2592F215BB69863778E957787B027BFBD3 879961 die-aixtron-aktie-ist-zurzeit-unterbewertet-
889,565,179 *5C8F5A462AA44D90447D10051BDDE69236B7D4C0 [email protected]
889,565,180 *5C8C75E4B27D03A45E837613BF3D2B3148560287 1539E32
889,565,181 *5C88128DE6C6A5D21EA76B46A90E45FD4EC37B97 8-ANLATILMISTI
889,565,182 *5C8DC35495D51BCB8EB7969A9F02A0B56AFC479B 158.duyuyorum
889,565,183 *5C8A6FE5EFDF65E773AC36636BA842EEA05ADCB3 1609287 EIN.ANSPRUCH.,.DER.BESTENS.ZU.MERCEDESBENZ.PASST..
889,565,184 *5C8474E8D01B7F092DEFD67093B9C352C9856271 8####B~`O->-<
889,565,185 *5C8F4923DE746FDD3B368F253384D1FC93F1F9DE 8DYLANSANDY
889,565,186 *5C8598FF5A46172C6B8753F10A7CFEAE5C9D2F12 8FATILOQUI
889,565,187 *5C883E0542D749FEAD8C3B1EADEB12EFAA5DD65F 1984148 alueen-luontoa-ja-historiaa-esittelev
889,565,188 *5C8CACE0B3F14779EC596DCDE42EB4FC969AD257 19-entscheidenen
889,565,189 *5C881A614EFC70E210A42AA31D06DBA87844549A 1-anti-terror-vorschriften
889,565,190 *5C809C1FD537461FF83553497E024766E426E621 8KANRIKUI
889,565,191 *5C87D87890348CDD2B521CD8092A1A2737BD2A38 1-BEGENICEGINIZDEN
889,565,192 *5C8F3CD76721F199A7292D3A2B56C36099FC7AB2 1d-mollisonaattiin
889,565,193 *5C8D0AC4823B09634E69F8727DBF46C065E1AC4E 1DUMOULIN12
889,565,194 *5C81E35075D23E549B7B8EB87304808E2EBF7076 1EKOKONE
889,565,195 *5C840C66297E46B02361E69A2D89926FC859661E 1euromedaille
889,565,196 *5C86245A1FC5C06590AE58A69B615B3812E13952 8SAILORTOPCAT
889,565,197 *5C82B47C852B83C440DFC3997000207032A7854C 1 FLASCHENATTACKEN
889,565,198 *5C843607A1A7E717836F4ED5B0508B59995DFCC9 1.KERRATEN
889,565,199 *5C8DF14B5607187EDAAC8CA73CE02BFFD8107BB0 1KNOW-ISH
889,565,200 *5C8A8A2C98AF1060EAD2CE193BDC614DABE152D9 1-LAENDERKULTUSMINISTER
889,565,201 *5C81148A9452718A437F278ADE49352B78E856FC 999HADLEY
889,565,202 *5C845404089708E5134BAB5F9EABD5F07784F519 1MEDION-ERFOLGSGESCHICHTE
889,565,203 *5C8B646ECB798BFD18C1EFE722367CE113EC64CA 9BILOCULINES
889,565,204 *5C82E110AFBF473A7151A20C06DEAB1E24F35370 9BRNEPASSERES
889,565,205 *5C8F130A36668164688BF6EFDF9D845F4F189B48 1N7ERLOBAR
889,565,206 *5C8B12481D68D78244876C7E67E8539BDE8636ED 9BSWPESCLAUDIO
889,565,207 *5C82004E52F46EAE143FA5224D433F3E068409CA 9CRUISEROBOTECH
889,565,208 *5C8E9C783BB0A3EB29ACAC7E48D1A6377BE0EE11 1phokomelia
889,565,209 *5C8DDDC15578802F8E173C90AA1B14D85E154FC6 9iamgretzky8
889,565,210 *5C830A7C3971E2D3EF2BBC3A8817983C117CA523 1.sotilasrippikirjassa
889,565,211 *5C80573012ADBC82E49C67DED50A4F6A62C2B3DF 9l=a
889,565,212 *5C8F3BAF67AF1324E0269C5B93980123713282F4 1 taustaaineessa
889,565,213 *5C8D0CDC5D04CC24ADE1A7C3AEF8149B5C55F93C 1TONDERA
889,565,214 *5C81697BB55665118E958929F302332CA16FADBB 9ORDFATTIGA
889,565,215 *5C8EC2B749DEC1B0E5457127AF9CA608A32D00B3 9RTTAILED
889,565,216 *5C8A6344BED2C2BF486C5E4E113856291067E47E 9SMOOTHETH
889,565,217 *5C8846CFA0BF2A186BD2BF7136D0D8547018CBD6 1zuker
889,565,218 *5C82EF432CF12FB14918A6C03EE8574984C827B4 9SURFERRENEE
889,565,219 *5C8D3248E18C9AB2520F0D0C1965A13C42F4A37B 2007年7月8日comyu撮影。
889,565,220 *5C855FCDD2F973B20FC5D894C8599353F217A19B 2186341 ichnotiertemirdas.
889,565,221 *5C86E021188531EE72812848E516FAE6B88460C4 2196059 KYSYIMME ASIAA KOLMELTA KAARINALAISELTA HENKIL
889,565,222 *5C872CDAA2CAF990CFF11C08EDCA3C6966181334 2250703 sayingthis,iintendnopersonalcriticism.
889,565,223 *5C851FB909497A93981A55B4ADDF4B7C1AB260E6 2:--2---#---&---bimetallism
889,565,224 *5C8CF8F63B16AEB7F0FBDFEB5183AD9219605C7E 2:--2---#---&---whitetail
889,565,225 *5C8BF835B92E3BB32B2923754E6868CDFAF45CE1 a1_mc
889,565,226 *5C85B98372771C7D4470006C2ACC638D0D76EFC3 249~
889,565,227 *5C89B27D7BB8010452C0F5B712AC40FBF5590339 a3a.-
889,565,228 *5C8C8C046AA3900EEEE6179CE6E7B00FD2C9E715 253370 SOINTU-JAKITARAKUVIOTSEK
889,565,229 *5C8BB36B8DEC19F3D57937E98E51D483B139EB42 255576 EP
889,565,230 *5C89921E6950EF90E0FCD3B5AE4A61154DAE9243 28021938
889,565,231 *5C8C087420FE7C388B5BC8CDC990781609A69167 288.begleichen
889,565,232 *5C8A87CFF82944796A176E9C82B57BC2CB0F47CC a73(
889,565,233 *5C8B3656E657A2FCD5A22A1FE413AEB7EF505467 '\%AAA
889,565,234 *5C8076E2A913839A71DBEED3CD6875CD4E886D74 AAA7&O
889,565,235 *5C8BD9530B95888BAFDA4C802AD62C46FAAB0331 2IAMMUSTANG4
889,565,236 *5C868A30CD0D0FC184D6DF5B32373E144132C5CB aadh,
889,565,237 *5C878998576C66291042C9793761B7760A363B97 2-PRODUCTIONS
889,565,238 *5C8495B763CE48F2BAD9ED8568652357B7787CB0 AAEVSA
889,565,239 *5C839EB137670E40DBF1FAD375F237CB628605A7 aar+t
889,565,240 *5C8456E411611A222EBD5315141525ED2CDF2413 377664 bunlarinalmancalariniogrenmekistermisin?
889,565,241 *5C896D962A67911B0E5575356ACC0EB8B2B38EBE 38-SONDERAKTION
889,565,242 *5C891A2CC86BD3BB5F4981CBC1D0935B42EEDFC4 ABFRAGEMASKE
889,565,243 *5C8D5D03601DA9B2A3E0EABC110CE5C5E2DA29D2 3BRUTUSQUE
889,565,244 *5C8DD2F35DE62E0F4BE34A341877D4AD678AE5D6 3ESLEGRVS
889,565,245 *5C8352DED4AC1029BAFD6A4DD6EF74610D291319 3.iibk
889,565,246 *5C883AAB38EE593329E067902C0B302930687A62 3ILOVEMAXMAX1
889,565,247 *5C864386D6FDE3D83F80645AD5CD4ACE197A3B37 415389 mun.pit
889,565,248 *5C892A28DC1F824D82D488BCF4B4EC2996BC10AB adapt0rs
889,565,249 *5C8120AD38309F5770D5D74AC299EF0B9B008004 adgangel0
889,565,250 *5C8D24268681A25B57E88DA3A7CA71DEA614A1C0 4BINNEVEER
889,565,251 *5C8F3544C7B3B2A0724AA80E9D8E862C1C227071 adpg6
889,565,252 *5C8DCB1A24B45010409CBDCA2AE189D585162379 4february1534
889,565,253 *5C80CBC2E6232FEC85D6151C395D5CC24E0C80C9 4JVGOZFA
889,565,254 *5C878212AC68E80DC6BF8F7834C56D83CBEC827C A=/EM
889,565,255 *5C81299F11B9AAD53BB5A554698EB74C70D1D600 4PHYLOGENESISES
889,565,256 *5C835B4B088FF4045A7C1944CAEAA263D193FB80 af)wo
889,565,257 *5C8E2E1A75DF5C45416E8D9F0B5161BECA135AF1 a(gci
889,565,258 *5C87FD14684D8404AF0DB510E7E63410B493B348 A+GVI
889,565,259 *5C824D656CC8607564F74964343091F1E1396505 4USKOTTELISIN
889,565,260 *5C875BB2180C81C1E5CF6DD5B20C03B4999DA48D 4VEDNAVTM
889,565,261 *5C8FB9A7F6B816A923B92A8E0D594BE0E925C118 [email protected]
889,565,262 *5C8ACCA67786D9863FEF3579B03D4E4D3AED2EC7 529439 TEKSTIL-MUH-
889,565,263 *5C80982CE7774F34D0A6937EC6D17F96A7F3EB32 540073 AYAZCADNO:23GUNGOREN/IST
889,565,264 *5C839DD253B699E290ED5471CC7E8093196321DB ai)ia
889,565,265 *5C84CBEB1BD191E6ABF45C94F6EB2912886D0132 574DASHAWN
889,565,266 *5C8F3475431A4DC29CE42514E30F2B2A5DFC3D19 582759 gOralperbaSbayarS
889,565,267 *5C85C9FB007694D3146CEAD8B409EAAF717612CD AIPALITED
889,565,268 *5C83F93D17BACC86A04320C72D52374EFFF7C93C a#i"x
889,565,269 *5C8DA42D552FE66287E00E90FDDBE0130E426798 5ATEVENTWOPERROUNDBSW
889,565,270 *5C870802F051CB02E175265E684B9BEFC259DAE7 ajay-murudkar
889,565,271 *5C8EC75751052D1F4222F9C7F84A4ADCABBD48E1 AJN+
889,565,272 *5C876666CEF1AEFB613BD9774D71EFBCFDF24B53 5d1b2662c0e98a79
889,565,273 *5C890028A12B642702FB83E287BEDB132E43983C alahjoin
889,565,274 *5C8A64E6CA8091AAC48BF2BCE2F66188FAE45CC2 5IMPERILINGLY
889,565,275 *5C8A1B22813CDA1800576EA664A8A8C86C1A6FF6 5INTERFACESPINBUTTONA
889,565,276 *5C8B3B35E6ADB3F9E3F277E0244F5E5F5BAD994D ALDENDADDIO
889,565,277 *5C8CBADDD348245E739C432ED724F4285B0AC3B0 ALDENKUPREWICZ
889,565,278 *5C861D7A2B5FC67965358B80CF4D80CB4CD814F1 [email protected]
889,565,279 *5C834CE5C8E9C9D9CD23359540573EAC549DAEE0 5-MILISLERI
889,565,280 *5C864D025A4FAA0E8E514D80A9EDF8FAD3A276A5 5OS0GGNWXF0TVQZF04RCM4Q
889,565,281 *5C8AF43699F90B45957E8F1A7BF0F47C4CBF6124 5SALUTRAIDER
889,565,282 *5C82AABA3F13D69A6D89BDEDD04CFA8AF74EE200 5SCROFEEFORCS
889,565,283 *5C8BF6DFC1F6F2AF010EA7619A43543B072FB098 a_llh
889,565,284 *5C858EF137774FA668A8688D64AB0ECCB8584C5E ALL-OF-THEM-ARE-DEAD
889,565,285 *5C823F18C3AACF538EE3BA66E0DCA52EF8F506C3 5-tienaat
889,565,286 *5C856B8F8641CA4A02C9DBF4C69967C917F3344E ALNWL
889,565,287 *5C829283F631D0AC84153365BA34C2187DC2F8DA 5tr41tj4cket
889,565,288 *5C85937051312491B6DDE95C230C07B02026195B AlZeimer
889,565,289 *5C8C7FF72AE108B950A241C1D49FAEC0809C2235 AMAR-SHAKER
889,565,290 *5C8707F8A0885C49C01D1FF751169DAA9636FDC3 [email protected]
889,565,291 *5C8BAC9A3AEF35B34DF1AE7E5012925AF7505987 6.berufspause
889,565,292 *5C8FA9401CC35D4F6467B2413EC4D026AA1D1587 AMMOSHIT2
889,565,293 *5C89297AD82C733FC56FD3C5D59BCAED897D95DD amputados7
889,565,294 *5C8785A24BB84E37CB06307BBAB42F26729B6315 AMRUTABORA
889,565,295 *5C8F9E6B5B54E1114C87E21E51314F4FF3E01DC2 anarthropod5
889,565,296 *5C8C0C3B7A2DB77BB5952FC4412A555A4B26A30E andersonzachar
889,565,297 *5C83BF0992BFF88FB1028F5DD8F695FD35F9B695 6.KULTTUURIYMP
889,565,298 *5C84A5CE9AE7FFC99C8B84340091228B658D3993 And-the-rave-goes-on
889,565,299 *5C80FF531F0B50163DFEBC7C85B34865C19CABCC ANDY.BASILIERE
889,565,300 *5C84CDB34C225609398691E991A92B562F70F7DC ANEKCIUQ8
889,565,301 *5C8C3C84B4B392AB1893485195C788F1EEE967D1 ANERAVAN
889,565,302 *5C8697081CF8FA528C4AA48389429D5F134DCD1A ANGSPO
889,565,303 *5C8AE59DC14314B4FC1B05A33BE98429D617B2DF 6PSDCHRMSTHS
889,565,304 *5C873FF1193548423C4C6DA1C707E568E28FFEEA 6PUSLINGENE
889,565,305 *5C81AD62CA88757D886898C3A179AD8FB6812835 6SANTENBO
889,565,306 *5C81A61A72A6941D962C1E97536BC5F2109DB935 6SKOLEALD
889,565,307 *5C860E00A591252943E49E357585F01EACD711FC 6-SUEESS
889,565,308 *5C88D455CC2D7BC1CF45C14530D266454BE04D0C anthony.escarilla
889,565,309 *5C82E334DAA418E8109522F2F62FF4D6E2D27900 anthonymartiez
889,565,310 *5C8EE3A362BC78A4953CFB97768076AB2FB39047 710AMIYAH
889,565,311 *5C877E43F06FBB018B2A049A228261F6AE231D35 ANTONYRINGO
889,565,312 *5C8D99C43E394740ED6694C6ADEC8BED81C65252 ANTWANYAMAZAKI
889,565,313 *5C81BE13513F31606D7D0A9607438C05842A883E 755291 ICH ARBEITE AN VERSCHIEDENEN MOTIVEN .
889,565,314 *5C8E0C0A054673DB8BFFD24BECE06EC786603DB0 ANYWHERE.ELSE.BUT.HERE
889,565,315 *5C89143EF6B973353BCEFB629D7A95EF52099B46 a-o)u
889,565,316 *5C88B267B812CC0ED3FF0732F09B83DD02868753 a-qug
889,565,317 *5C8A77415FFBA38DEBE7ED4A06BB44B7577BB82B 7.kopmalar
889,565,318 *5C8C992CB18FA9273146794AEFCAE9B33C374D38 ARA
889,565,319 *5C8DCBF399D9AA302CD4E6F65297A33E669919C7 arbloser9
889,565,320 *5C874A0C0BD41AD3CBED09F32E8C8106CFBF8DFB 7MORTONWILLIAMS
889,565,321 *5C8E670D7F134E2440895816CC27013CDA44B673 [email protected]
889,565,322 *5C880934248477DA0685C9FED76B7070CB167E8F ARCHIE.ZALAMEA
889,565,323 *5C8B8E66EFA99D465E59CF2FFA75007216A06A81 7NIROTIRE
889,565,324 *5C82F79396BE6836CC8A9BB61066684284BC6987 areaplease
889,565,325 *5C86395741959C664586673CF6211783D96EBE8B [email protected]
889,565,326 *5C83F31E2B081CAA9508F5A15CE22633EDAB2A53 7RAINMARINO
889,565,327 *5C8089A1C53E1BE220D9384009B4948A9B1CA53A 7ROPINGROXY
889,565,328 *5C8AA5B8D85B82BD519252D111D74220CBFFDAE4 arlene1907
889,565,329 *5C897C260ADD62B7C27AC24B66AB6151F4A51521 ARPFD
889,565,330 *5C833E0862B5F648D64551532A8B34DFCD9E0A26 aruolt
889,565,331 *5C85069EF1E508B5CE733F83EC8537EBFF637FEB 8194 HAKEMUKSET JA TARJOUKSET TULEE J
889,565,332 *5C80D2C8ADB72F3BEE2D7F0823BCBF003219FD1D A!S1X
889,565,333 *5C89EADCE7B30FD3647F68C6935390D83E7E5BCA assiègé
889,565,334 *5C87140D8952954634D2803DE65702B1035219EF 8FLERVALGS
889,565,335 *5C8121045E9428551F1723F83A67BE40B3787439 8MOOCOWCESAR
889,565,336 *5C8CFE4CBBE7A990F01A00F6D1171738AB1DD8EE [email protected]~O~O:P
889,565,337 *5C82A352DFDB85C53FBA41378B6437100060C496 [email protected]
889,565,338 *5C833DB452375AC592820DCA75369ACB03BA5742 8VIPERCURLED
889,565,339 *5C82050892C793BF8107A70D3FAA8F086C0993A0 8YLEVISULENON
889,565,340 *5C85689B5E56298B98009577E015B984E53153DA 9.06.75
889,565,341 *5C8D6DB3C4E8FEF4442FC458B7A37E26AEE1AB09 A+,VR
889,565,342 *5C8546AD971EC84A39D558CC9A8E82C07A9F5EF0 AX$4
889,565,343 *5C8BBB9AB479C5367FF56DA1C3806FC1EA77CD5A AY0B-
889,565,344 *5C8B9790C3F721A4EEA48383090A6624A5271CF8 9DGJALBERT
889,565,345 *5C8680D14EC4DA9535E0F10216E51E34C3B761F3 AZPNO
889,565,346 *5C8FAF907236C642A3BB7D85D0C9AF5A9B2A11C9 b"%?0
889,565,347 *5C8EC494C9EADE790D202E3F8785104198BB62DA B======>~~(_0)
889,565,348 *5C80E8AEFF5F8EBF465F18794D5B0973B0F7755B 9HENKILOESTOERYHMAE
889,565,349 *5C871FC302E7D7431E6A5913DB5A82BC52A062AD B:1DJ
889,565,350 *5C8549DAE7594CB2734B3528607DF9552FEB2463 b3ep"
889,565,351 *5C8475FADAACB710F492C3C77210784EAE786111 9MINADORES
889,565,352 *5C843F1779A2FC227D3025B16A417AA6F925B9C0 9MIRAGESUPERMAN
889,565,353 *5C8FB9343DA46F2CA431BCB8698D2E07A8CE1552 B?3M
889,565,354 *5C87333ACDB1A2A2FA901046F20912B1FFF03058 9RESYPKIN
889,565,355 *5C84EA1E230CFDA4881BC64A25D69F63162FC07B 9SERENIBMOK
889,565,356 *5C807824F0E7BC8B699092F68AD6455B78BBBDF3 B7PP!
889,565,357 *5C88B243EEE25B88D03548660F8B6482ACA4ECDF a4,9f
889,565,358 *5C87523504B1453A031CBCB446F61ECBF7E3246B bartongentsy
889,565,359 *5C88F2A14F4886894D7DE1ABF5316DAC103A90A6 A#7K
889,565,360 *5C83C5C8F593B6F2B4D84D152BC414D2A633218D BASIL.HORSMAN
889,565,361 *5C8410E44C97C5089173FE0DB9A8365E04F17970 a-9#+
889,565,362 *5C8FBE535B52DB6A0E95114E1729A61153C310C4 a9&zn
889,565,363 *5C860BCDFF2D6712460828589170B1B3D1E41F29 [email protected]
889,565,364 *5C88104EEA319902B07A4683F36ACF0D7409A822 B,B+
889,565,365 *5C840664F04F786A57374DD2E0DAB25CADE94B53 BCVL$
889,565,366 *5C824102A95DC373B2984B0875746E5CF0808FC2 aae8bq
889,565,367 *5C8C6C840993709B7E2DAE7F2D4793F168C13F51 [email protected]
889,565,368 *5C8928A335E4120FEFB54C30777916FA4C8A1A58 belgianspecific
889,565,369 *5C873754A8C5507B3362A34448F70760F9E6E260 BEMMERLS
889,565,370 *5C8F463A7112306B88911118F402CE73FB298B32 BEREKNIN2
889,565,371 *5C8A26474C4C440D8AAF3B2B5F8A39E124BF97BB [email protected]
889,565,372 *5C867B1689E61CAB82CDCD031B4E74EF6E31FFC8 a beast revived
889,565,373 *5C82A49205ABAFF397D7EEAB10D2575C9ECF39CD abJN
889,565,374 *5C81166174485A79B39C3427F6A31059F996CB97 BETALNINGSSYTEM
889,565,375 *5C8875761D60BD365A78260A476B9FE664E4108A ABRAM.CASTILLEJA
889,565,376 *5C8DC2AC8FA621357D7EAE3CFD22394C8404A57A ABRAMMONTEIRO
889,565,377 *5C805ABADB4AF899DFD5C97F803D14B6C2608A6C ABREUVERSING
889,565,378 *5C836F4589553FC534D23CE2EFF8C7B1E91FFC41 abso>
889,565,379 *5C8568E30F43B9FE2C7B5D40C5C4CBE4F5924D71 BILLY.RAULSTON
889,565,380 *5C8B18ADB318C70EA7D3F4B2C81A63F01CEB3C0D bil,u
889,565,381 *5C80DD1B0654C357BCB2E559381576AB35F2E778 BLAFFEDES4
889,565,382 *5C8A23F3806F257666BCFFA039E14EB93BDBD285 agd$l
889,565,383 *5C8049CCD072C92EA7158744559E43E0B6A78A4E BLEHNESS0
889,565,384 *5C8C42AC50C65D7E4219807B8EE60F99C56F6B76 <B>LISTING 714 A PROGRAM THAT ENSURES THAT A STRING CONSISTS
889,565,385 *5C8213215714D656245C1EEE2B88223BF682A139 bm&n=
889,565,386 *5C86A1537D6EDDD769B7752EF872C2A7AD114316 AKCUL
889,565,387 *5C80D9C21C17D4AB0AC5CCF2300750646C40983D AKINSEHINDERASHEED
889,565,388 *5C8249ECAFA25B9205C6062AF419148B96FDE6D1 AK=NC
889,565,389 *5C8226B12F6FA5B64F01E3D70306002AA3AC1DBC BRAHMAKAMAL
889,565,390 *5C8B49AC70CAEEBA2006D55F224D44CA68A1DBF7 ALFONSOSANCHEZDIRECTOR
889,565,391 *5C85433772143558B711E6739095ED032EC9A8B4 ALFREDGOOKIN
889,565,392 *5C84F383EAF304BB10C113AA6020B897B3ECBDDF ALFREDOTORRES
889,565,393 *5C851760552C3765CFD309598AEB64F1C306932B brian.festa
889,565,394 *5C8B0832305204025620DFAD90A3297CB9C88898 allabovetheatmosphere
889,565,395 *5C88DE61DD818364DC221AB34F617C6E64A0A447 allencoolbaugh
889,565,396 *5C8375B48893726C2DEACEDA125EC60516D28A05 ALLIKATERIKAS
889,565,397 *5C888204C66401F0F3ED10F74DBF4C9529AFD0AC BRRQ
889,565,398 *5C836376920E3ED0822A860B4D99D6B6696E6EB9 ALTERIS
889,565,399 *5C8EF979B50C5795BDF581CB0F6B9D24D99565D6 BSWNIEDRINGHAUSB
889,565,400 *5C84FB591947AF499421856FD39F3099161BD4B6 alud6
889,565,401 *5C8129A89FD97C051E44677AC7082EBF9C1A8B35 b$t%%
889,565,402 *5C8840C0536B23AB5976D48DD41025CD925FEA33 bt9cl
889,565,403 *5C811CAE705D00EC4BCCB8DA354467BFA6E2734B BUSTER.WALLISER
889,565,404 *5C8E82423C92970E09C221978AF145728A2371C4 a?mwq
889,565,405 *5C831B8EBDF5DE93A9765D94056C0F7CD853C1EC analsp
889,565,406 *5C867DFCAFF805EBAF8A6FF980DA2C6DFC1B182C ANR2
889,565,407 *5C811BE9AEB7643DE41ED6634737036ED31BBC75 antioneserey
889,565,408 *5C891777DDBEF413A49F46C669E15AA808EFDE92 ANTOCORE8
889,565,409 *5C80C5B0A86912D7BF7709379E81C7A5944529C0 antoineconradi
889,565,410 *5C891B69648AFCA432B1C72467C2A76CF360F75E C0!O;
889,565,411 *5C87B565F7D7E6B10863365FFD3AEEC3F7A3D640 C0WG"
889,565,412 *5C88A01239516E1E7AE33D783902F24D794FCC5B A%o=
889,565,413 *5C86B91BE634934D3D90F80039B876D219E852D9 c3rtfably
889,565,414 *5C82781B75EFF6F10B6820121D833B875E827C06 C58907
889,565,415 *5C862B52588A4E71B8EFE91DC9B2A794CE4F5C1F c-;%6
889,565,416 *5C83731FFF1628222E175260AFACE8F27104F9AA aq.oy
889,565,417 *5C8D95B2981D0983662E40B478FE263FA80CEE2D c/9yq
889,565,418 *5C8448C09B98C2B5A91765AFB12FF1FEC97D9620 a/r"1
889,565,419 *5C81CB1F01A610DD01717BC4E3D685574E97E034 ARMBPNFK
889,565,420 *5C8F6BF6158765DBB237E5C104A970C8C18C4029 ARNOLDAKO
889,565,421 *5C849DCD26BA3322EA52EA46A2FF3D833E4BF56D a%rpd
889,565,422 *5C8AD32EEF2004699D537A1EF239416CFC7FF371 CARMELO ORTIZ
889,565,423 *5C87BF4B991C40E2E8A9047792EEEA59ECB668C1 ARUOKAIL5
889,565,424 *5C8C45037136CCC5941FEA99E0694E6FF6C1F553 cassana4
889,565,425 *5C85CAE180E07AD5BE90010CDFC994419F0CC8AA asia309
889,565,426 *5C89BF063EC956D3E8D38BAC3F1E53853C563C24 CCps
889,565,427 *5C890E20F0B37AEEB015F1A4EF870AC07501D4E8 cdf9k
889,565,428 *5C879F07E9D932D83B26D2B52633D86B7B1BC8A1 atmosphereless
889,565,429 *5C86870EDD6DEBFFFDF84A1A8B7878C8BC1EBF27 CFO:H
889,565,430 *5C8ED8CE2EB63C6528F0C6A2C71EB81EAD6D5F52 c:h5r
889,565,431 *5C81470524D211FBC94B8B817480C0CB1891AF3B CHARTRANDSILAS
889,565,432 *5C8BA27DF703CFD4B26B8AA5B6ED9A41D1D32497 chasecohee
889,565,433 *5C8A949A4C09DEEFCD5A83A9B00AC461A09951E3 CHASITI MOORE
889,565,434 *5C8BA63D2BC131C7F3F68FA25CBDF73527AD96ED CHAUNCEY.PANZICA
889,565,435 *5C851E0D14384505DC09D1F3FF06D903BC6843E5 [email protected]
889,565,436 *5C88437CE8F447EB26357CDF683EB9AAA56F8C98 a_z"+
889,565,437 *5C89E9FE304242654FF32B68200778D7E895ECCF aznmv
889,565,438 *5C8B1015D4A62FBA0BC8ACF0074D2E24E9A589CB B:2H
889,565,439 *5C89E31447E711325EB6975CB1E4013A0BB077C4 B35410
889,565,440 *5C8B0AB6B0BB079AB14A04B3C0963AC52E686BF6 b3c8r
889,565,441 *5C8F6873A507757E32FE7AFAF8B6A646747B4438 b8a9c
889,565,442 *5C88F84FD8A72C852CED6A4032E41339C0E0CCFF [email protected]
889,565,443 *5C8B0834389D6FD7F544F13DAB07A8272EC1BCEC badillus2
889,565,444 *5C8944E13D28B177ECDC42477D2B891FF02AF5FD bag&7
889,565,445 *5C82CC6A1EF04DB608C87FDD56197EF389412DE7 barrettkimler
889,565,446 *5C8853AD9D837CBCE7EE3BAA412EA7066B5D91B2 c.kw4
889,565,447 *5C8AD74043ED0F1CAC5346985CD43EEB482227E4 CLAUDIO.TSUI
889,565,448 *5C8E1CCAC291C46C8C84C1BEA768D204920019FD BASOKOOKOSAB
889,565,449 *5C826101E7D2797A4982FE0AD8595A190274E902 B=?B
889,565,450 *5C8CE4FAA8CAC443203E5227F891B642D32BA8EE BBC;U
889,565,451 *5C85F77687B5E716763EEEEC373A95693A1516F3 bb#:w
889,565,452 *5C8C757AE015C034615FF29252B36B6A21FB9817 CLZVW
889,565,453 *5C8C28D7B21DFEC49336A067618B26D5185EEE8D cnnsxwl44
889,565,454 *5C8E44B45FCD9B2177BCD70E572C7BC2CC26010D BEBATEAMO9
889,565,455 *5C8F33A3597B3AB7B9A5EB10A7584309803C1F94 COMPA
889,565,456 *5C81456B0A75AB817050B724BC91490DEE7E95A7 BENTON.DRECKMAN
889,565,457 *5C8B2148870C417CAC0F481F61DBDA0F0015F3D7 CONFIANT0
889,565,458 *5C8556E022722BBE5D567B3055C69E28A8F323C2 CORD1735
889,565,459 *5C8A427F2397DE5D72B027DB1AAA4FE66FC86226 C&OV
889,565,460 *5C8E79FF12C8D793F14B9672D789D38871F6F094 C-RN
889,565,461 *5C8A933E452A5DDC38E56B44548CCADB7EB9CFD6 cruzpadalecki
889,565,462 *5C870A7B0DB74D5275B8C5B4BFB4F57ABA35DB28 bl1+u
889,565,463 *5C83FC2F3BFBE8F2905D15600A170D12B2D62FAE black-dog-(alternate-mix-with-count-in)
889,565,464 *5C8EBAD5603358909D51C932E97D93D9347329EF BLAIR.VANOSDEL
889,565,465 *5C8ECB3D2C3B3965D018052E7AEB9C648D34EDB0 cs_r6
889,565,466 *5C8F482CE248D5E9247A151D2456FF489590AAF6 [email protected]
889,565,467 *5C8A1783857AF9A7AC6A1886834176827574F1DA CTLPC
889,565,468 *5C818C2B2D4F26AA0F49CAD0B9B37F88B97189AF BOBISHLY3
889,565,469 *5C81367645D226D86A73E25C80B15A3B328EEBA1 boc")
889,565,470 *5C8A6E178AC919710620D22BDAD9A0E45DAE0AC2 cv+qn
889,565,471 *5C83737F9D2BB1BA8F233D7392741F4F4BBB89B0 b-ofn
889,565,472 *5C8D5220876DE792DAE227036DF5B5DC0681B9E3 bomitivo
889,565,473 *5C88F90B5A0BC3CD172621DC3F22DB0DBB07A1CB [email protected]
889,565,474 *5C8D52DE2F747FE51152B99ED477A93BB3E39F8B [email protected]
889,565,475 *5C8D284026BF8BFAFDBB3BFA949A8CCFD48DB69B borw
889,565,476 *5C8F215EA689E6DCA6DBFF8E5AE3A0178D44A2EB b--p.~0~o.}x{
889,565,477 *5C8B686800050316E41DAD94F48869E3E22AF719 D1L4C3R553M05
889,565,478 *5C8524F658F8A40BC3AB049135B0F8BCDAA95327 D207F78A25853872AD26888AA4CC6870
889,565,479 *5C8135414F3ECDD5CFBF8535BE3A1F6465F6D65B B---p~O~o}X{
889,565,480 *5C8C556D75C226BCFE8F0EA1A9450AB2862A0240 Bq%A
889,565,481 *5C8EBDB3A242AE978563D152854392F433ED3383 d8cm
889,565,482 *5C89467DC810D8FBD41548FFA5B6268F04FD43E6 brce-
889,565,483 *5C8830593C9897413BFE4A3E9C07C3527867C7B1 BRENT.VANEK
889,565,484 *5C8B4BB91BDA1B9667902CA098478A4C269A1982 BRIAN-DZURISIN
889,565,485 *5C848362B556EAA738DF4772D34095F9649BB71A danaduka
889,565,486 *5C8A502F63AA8FB526F4E58C4AD1EF47761E993F BRRQ
889,565,487 *5C8FC73794CFB4E057C93B24999AF54C0C4B4003 danielgoheen
889,565,488 *5C8A9D560CAF957A71AA1C7A64820CAA021CA924 bss#v
889,565,489 *5C8CF6B8A6ECEAFAD5990D341964255B194A97E7 B!#TC
889,565,490 *5C862319978B4872B821B670F700E42F1B4C5C99 DARRICKDOOLEN
889,565,491 *5C8E1EA5BAABBA8D9867B8E79C1A84824C2BAA1D btvta
889,565,492 *5C83F379F182BA58DFAB6CD97A4C8830009D6612 BUCK.KIKO
889,565,493 *5C87FBB0D233DA872BCFD7EC0C87A7029EE0632E buforddonges
889,565,494 *5C8BB10E5245C585C6BA9D81916CB2256BE0CE02 d"b1p
889,565,495 *5C83473809E66B0D2C63C5EFEBC4B6E19D1CC7CA DB8D(
889,565,496 *5C881C6B6B72F597DA1F7FDC7706343EA09C3154 b$_"x
889,565,497 *5C80597CB6700509BFA2F222C76EF8BCE1EDAFFB BX98
889,565,498 *5C88E4F9F63516BD3301CB076A6743524DF108D3 ByronLee&MightySparrow
889,565,499 *5C85922F46E6C8BBA40A7E230BD6442D7390FF96 DEEOSLIN
889,565,500 *5C8D5CA00CC28E0EDA363A57E095E52DCE186E68 deepraj.mahato
889,565,501 *5C82D26CEBD3BFEF447CCBC8BFAE751368283306 [email protected]+E$
889,565,502 *5C8D4247F7E388E33F9584031793A2BB4D3BD956 denisaicklen
889,565,503 *5C8827B11003EA5BBFA9FC7DE711E1F89E3BBE5B c2ofr
889,565,504 *5C82CC903B729EDECC4BF6CA73CB7BBF8D80574A DESDEANZAS
889,565,505 *5C8388B2A894B5C87F8B9A85D667A714CE1E8843 c7r1(
889,565,506 *5C8823B6A843D144CCE7628A3FC4A4880E4A5F81 /dev/udev/db/tty:tty19
889,565,507 *5C8055A30B1159D13B82009BB725919EE9EADD4C c;9lg
889,565,508 *5C8343E17843CBF58F43C5AEB72A8276E70E0F8E CADEU
889,565,509 *5C8A8EBFFBA5E92CC6D58685BF89A2EBD8FC18A1 [email protected]
889,565,510 *5C82F00AA2DD5FD0AEFE8EC2A3956C8C509AB891 Carmen:ActeII,NoXVIIDuo(continued)"Non!jeneveuxplust'
889,565,511 *5C84C46719CC5267C7F3E9C22B22D116CF81177D DIAMELIZT
889,565,512 *5C888C5E1704BE270E4C4D7D4874C6DE17C1A8B7 [email protected]
889,565,513 *5C82D0375089E200F2B46F61E17FAFDB06D4D47A DIAPHORETIC3
889,565,514 *5C80B11A5DA2F750CD266437BCECC58A36E9F0AE CASARIOED
889,565,515 *5C8508F78061BFA607BEA4FB5FE343CA72FEE062 dime-si-duermes
889,565,516 *5C87F3E0E8DE724F4E8374522CFFD29324B1F649 DINORYCROFT
889,565,517 *5C8CF4A8A7BB7A292D0E8D19C2E95F2420110943 DIONSAROUKOS
889,565,518 *5C8FA887A08AA80F56058C3440A3318307C735B5 [email protected]
889,565,519 *5C891D0A2675BC848070C2F5F2D159082DC1FE3E CB?FG
889,565,520 *5C85FCA77C89E1FA5F97E8183B506AD97EBECBD9 dktq
889,565,521 *5C8E89A5575EECED83C6E6E9CBD80E781959166F dm;at
889,565,522 *5C853C4492A46408B7DB670FD4460365EB8E8F68 cfnbn
889,565,523 *5C877A8D1D56644777A2AF842590AF80B49C59F5 DNQLD
889,565,524 *5C8778828D7CFC94AD3AEE9B799433AA4C461E1B charkhel
889,565,525 *5C8B8563923892F8DA9B40A77465CB6131455046 DONG.RIHN
889,565,526 *5C89A8F8AC936517E885AA96DF98026D5ECCA1AB DONNA.NON.VIDI.MAI..MANON.LESCAUT
889,565,527 *5C890C0DEEDB477ED958CDB3F441FF57CF28C020 donnbenamati
889,565,528 *5C8A8A151418060C03F4A4FB295D722F8FDB8E7F DONOVANSEY
889,565,529 *5C8219E57B0EBF232B443B32D364725E759428FE CHELLI HARRELL
889,565,530 *5C810F5E6B560FBB51CE5FC49B2288C45EDA8502 don-turlington
889,565,531 *5C8F83725070674E312C86768D775EDBE2F1A6DF DOORRIT
889,565,532 *5C8F472EC895C36FAF1E023F606EB11686C00984 DP0/-
889,565,533 *5C8B8817CD11C296F33A54BCF637259471FA81E3 CHI.TOMASELLI
889,565,534 *5C877A70B2B79C48B6FE553D180879E87000289F DPA9A
889,565,535 *5C81B56C74869F3BE5B9B4406F631D35C9FF8162 DQRYG
889,565,536 *5C8D44A4BC694D3CB1CF9F5B0C0CA5BA2DA39C7A CINDY-JASINSKI
889,565,537 *5C86036B47891DCDE59ACE679B7E693EDA5C299F drysdale0
889,565,538 *5C850E47F7199811DC318D1456BD04A4AB42837B DSQ&
889,565,539 *5C8C13969A62EEADA76E95B8D662A3391B6208C1 DUBP?
889,565,540 *5C8D5E7E351F7488102CA30C3F73B6D8C673A5ED duitz
889,565,541 *5C80ADE3B3CBECD4C0AAB37D3743420F41881C00 D$Ur
889,565,542 *5C81C1B6D4E4E81632D9B3A2AD8CBF39BFDC13CD duvaj
889,565,543 *5C81720EAACB692792F7B6AB5B90AF82BB731791 clintbontrager
889,565,544 *5C87D8D4E0D8947AE87305D1D0C6B11BE3BE2854 dwnsa
889,565,545 *5C8F33F1DF643D3957AF783E6783C7E8C489BBE0 cl"r
889,565,546 *5C87C6F857DE52107E7A78282C1740716B8F6633 c&mqb
889,565,547 *5C8ED6C1FA4FF8B9AA7C5CEAFF68AD8D87DD68F5 ec$iw
889,565,548 *5C8E2BB0A408FECA5E07108CA7DF2027EBBAB5FC ECJU5
889,565,549 *5C81A18852F820DB661D8C9B196B77A3D5A7A251 COJP
889,565,550 *5C80563498909E67D8D8ED6ED7B532101FE8EB82 coloradomurphy
889,565,551 *5C8D2A3ADD63715D27AC788A2CC30E84433A89A4 EESI
889,565,552 *5C8C3A520CDCD33E45265B93AD3F888B1A65D5E9 CONNIESPENDLOVE
889,565,553 *5C8E22914AC4289F889B10AF231F4346835E5F08 CONNOR.HOLCOMB
889,565,554 *5C80C52F32F78300775F6775F6155DF3478B7465 connor-sperry
889,565,555 *5C8786BB00DC051C0F87CCEEC4BD560A28C1DE74 conome9
889,565,556 *5C89A26FE16533F186DC3AD88D7C8CCB08C3486B eio7
889,565,557 *5C86CD699A57614B3E002E9992B0F2F20AE64090 CORNUED
889,565,558 *5C8EF99899C21181694CB9F89C1A05E10D31E49F Count3r$9n$
889,565,559 *5C81D94983AD671C60A9BD3C4B7A44CE8188E304 cousy!
889,565,560 *5C895787FDD71013A2853350194CD442497A5A46 C:\PROGRAM-FILES\MICROSOFT-SQL-SERVER\90\TOOLS\PUBLISHING\1.2\JA\MENUANDCOMMANDS.RESOURCES.DLL
889,565,561 *5C86178D32C9B274040B804FBB87A2E893DB2674 ELIZABETHBORSA
889,565,562 *5C8905AED92D69E815E28B6BF7C08629EE1C9FCB cqjca
889,565,563 *5C830F09E3D9367D914BF7E58761C905ADAE1B87 elroychristmas
889,565,564 *5C845E501ABB487125E1A2A17D76F18FB26D4B37 cqz/w
889,565,565 *5C8702A33B1371859D442E52835059E26BEA7B47 CRAVACHERAIS
889,565,566 *5C85854517A7E5B997DFF0666FE7AC760504C717 [email protected]
889,565,567 *5C8D2FCF6AAE5932E8070FFCE43D41A873134C34 EMMANUELSTICKROD
889,565,568 *5C83119C78E478B1AAB7401DD3EE8BEE924A7E6A EMMITTSTRADA
889,565,569 *5C85419691B79D1D24BAA1BB8BB1EC388BD1BCDF emoryhambley
889,565,570 *5C8689BC54F62622A66A477EF31B03300B6CA6B1 EMP
889,565,571 *5C8E8A531EA222207EBD62BCB992467F40DFAA5B ENCOA
889,565,572 *5C862281B48585CF0FF0914F47E7EE7CE2079CF9 enemies nations.at.war.with
889,565,573 *5C8E46B6A59EA5AC871DA76CEB71FDB1AEC97EB4 ENERJIZR
889,565,574 *5C810F152DBE6E34003EE804A6B6DCAD90858E16 ENEURG
889,565,575 *5C8374129E86DE2ECCC538F6DEEE5EA7BC117247 ENIRBMOCSED
889,565,576 *5C84063AA7901665DE003237B9FC7C8A20E2B9CC CTFD
889,565,577 *5C88378A7045F1A912D03D7445F789396658649B EOSB
889,565,578 *5C82400073993C12743BF68C1180FE773C0747D3 [email protected]
889,565,579 *5C84549EB7FDB306C528E2782B27F0BE83FA9801 currant.spanworm
889,565,580 *5C88427434B575833B77CA9C5BBFBBC520CE5B7E CUTTIN'.CAPERS
889,565,581 *5C8A651851E1D3D693AEAF6FA1ACF87DE9C0B638 cv/as
889,565,582 *5C8A52212CDA34ED92A642FBB2778E951CEC4881 C$YU7
889,565,583 *5C8D2D11DA32FDB02F9B05B41C0E9E5376DEAB34 EUALG
889,565,584 *5C8CE2285EE308F722ECA6F0A3F4071732565855 D0+TX
889,565,585 *5C83AC0F439F0D27D762666FF69739B1C8850336 EVAN.GAMBERINI
889,565,586 *5C824416C8B1BAA25806CC745F956BAF98311B7F evanmiyamoto
889,565,587 *5C8CF203E6AD139AD638BA076AA0F57E2B0EF068 d3euq
889,565,588 *5C802C2BC3D50990BA4C3A730F099382AB126C71 d63ch
889,565,589 *5C865B6C0510F2D9D4EECE650DDC12D502090700 [email protected]
889,565,590 *5C82C7A8A5B8DA9846CB40F2A0445CDD64CFE14E D9RG5
889,565,591 *5C8F9F3F23D3FD334791687308BFA231E498BEAA DA2ZO
889,565,592 *5C8819EEA8AEB4548B0C5B6A060F257D7B6B3E7C DaiO
889,565,593 *5C8FC8DF787C0B01215519DF7209EA84E74064F9 DANCEDANCEREVOLUTIONSUPERNOVA
889,565,594 *5C88DBC53BB97EB075B22965F0B80B371FA60FE7 FENNY-MOK
889,565,595 *5C8E8FB6940CBDD2EBBE0D76655C807A14EE2B7E FERDINANDDANNELS
889,565,596 *5C80C24C1F4561B83CECD90AF07DBF5640BAE639 DANIALVANFOSSAN
889,565,597 *5C80E04B3B07B30690BB9974E018FF961401E6CB danielvenecia
889,565,598 *5C8D0B5546CDD2728F341A70DB340FAAE562D67C FERMIN.MACAFEE
889,565,599 *5C80CAA61C4EB39557EFEFF88ABC5F2D278D55ED dany
889,565,600 *5C8E35AA742F19A1F62C411EDDC2031838175CB4 fidelsouthgate
889,565,601 *5C88B1A8D61FBC134C70B97CFB3D6B6B2C89E478 FILIACHED
889,565,602 *5C8FB762D5F6638B4B9E8E568D72E87B2DA47DEE FILIBERTOMORESHEAD
889,565,603 *5C84B13CC0BD3CD3D010D76D6AEB2B7738AEFCE5 DARON.ARABIE
889,565,604 *5C87DB8E05D0C64BCF91C8994422A31D77BE739B flake white
889,565,605 *5C849691E1948A64F70C1C0461DE90BA1EBA760E darylrealmuto
889,565,606 *5C8AD74F8878EFDB1A5CE2DAF7D60253E8560431 flschlicher
889,565,607 *5C8F18663F863FA9B9A308E6DB2BBF8A0C01D584 DAZ5N
889,565,608 *5C8118991FCF98FD7589E1E384674E29D81D2A77 FOSTER.PINTER
889,565,609 *5C8C380D785B9CCC466CDB0F74BA498369E83721 dbs2i
889,565,610 *5C8A4CFC65DA1F4A95978FC89FA2304648EBDAFF FRANCISMESHEW
889,565,611 *5C8B7641241218FFA5495CF0DC3BCE381FFEA7EC FRANCOIS-LOUIS.COMWWW
889,565,612 *5C8A80A4CF4F9E18D17FB40A653E4D8483A28463 frederickstoss
889,565,613 *5C8E07F08EC750D95FD15E190E2E01071C50DDAF FREIHEIT..F.R.AY1.HH.AY2.T
889,565,614 *5C8E6E6B07213903399F58FBD12AE71E5946123A DD1R
889,565,615 *5C891EAC602598EFDF33FD2E848303A0B71D74A5 FRITZPARRAL
889,565,616 *5C871C3AF23721A02BA3B7460CF9F7B4EA7A4E5B DE7F
889,565,617 *5C8798B528D4A644BE87FCD1A86493D794258C88 debbiemark
889,565,618 *5C80ABF87BE268DEBA6B16301E7716F3EB7BE34A g5\7
889,565,619 *5C8059A197E92471CD1F934BA104AE9ADA4EBFCE DE.MOOISTE.NEDERLANDSTALIGE.LUISTERLIEDJES
889,565,620 *5C8805DD88D4652096D0732387B1D2B5D56BB719 DENNIS-FICKES
889,565,621 *5C89053667EC70ED302A136DC9791D47225253D0 dennisiulianetti
889,565,622 *5C8560B416DFD7A6DE12EC18C8CC19B71FA3BFE1 garrettsuddoth
889,565,623 *5C8FCC4B6B7A0DC79749A214A9ABB50390695396 GASHOUDER
889,565,624 *5C833D6A3F0A85C23AEF9D8A797D91D781E7243D GAVIN.LOOMAN
889,565,625 *5C8587673F92B0C6793D63F7B3BC4E0263266658 derek-bucher
889,565,626 *5C899FC8FFA201816CB06CFAF8F437DB0FA65F55 derharnvonrudicarrell
889,565,627 *5C842744FE9739F127BCB67327CD3E9C37358DE6 GERIEFLIKS
889,565,628 *5C84464D7817519859218791B29112C028909542 GERRYCRAGO
889,565,629 *5C88B48EDEAB1B6FDA6FD9C4D358593E184040B3 gerryfacemire
889,565,630 *5C8DEC8940D76DDA637C706D4CCFB53959D17A40 DEWEY.KATSAOUNIS
889,565,631 *5C8E781E101B55998E5058F9665A1BD2B73FA518 gfemale
889,565,632 *5C8160C68C41E82BA8843E3FD03080AC501A0639 df6zp
889,565,633 *5C8366EE6EEF3A4A339C17F64002A8E4EAD57BC3 df?"e
889,565,634 *5C89B0984C4B5B310A0A7291570130D4D6DF762F GILBERT.BUERSTATTE
889,565,635 *5C82B1C82D629374F39EA34D40C0F67266B07CCB DF-UT
889,565,636 *5C8DE4B854F6B6B5EA4ACF322710D1855B980A7F d+gbg
889,565,637 *5C8866E043B1C7F461072FEA22BD95ED52C33239 DGKPF
889,565,638 *5C8C68CB65785EA4E10B11CC8F2CFD10C635AD0B diannadams
889,565,639 *5C82561D90AB147CD5755F2A537BBCDDE91A89B8 [email protected]
889,565,640 *5C8749FF291A4F2F99B58932D1B9190C8767ACC8 dillonandy
889,565,641 *5C893D11A399BB4DEFA25A0B4A376AD150F09DE6 [email protected]
889,565,642 *5C84F22641B651F04BCE3E95D307840267000220 gopf
889,565,643 *5C8B2461E61B702598467731972578D5A41605CC Dj5
889,565,644 *5C87D29A71FF3514BDF4C2AAD6D3B545224DD869 D+k9
889,565,645 *5C8AAFE67C0874C10F0639F4A9E6DFD1AE0423B2 GROMADÉ
889,565,646 *5C8101BB633F82738714637C7C5CA4B5F0A11C10 GTRNBV
889,565,647 *5C8464371341576DABB1B378FDAFA11146938AD9 DNATSUZUED
889,565,648 *5C8D1236486D50D056CE4150845037A58B3165F7 [email protected]
889,565,649 *5C89EE65661019A22145111D3CB663C1B55D5F52 ^h*
889,565,650 *5C8C03D965590DB9F3923E2812F475D55D0A88E6 DON.STROOPE
889,565,651 *5C80B54D5669F2BD20A29FBBD2D972AA1EF22E18 DOOHELCNU6
889,565,652 *5C8217D0EA243672B104F28264F2C5328C593B4D DORDRECHT?
889,565,653 *5C8E8797661694E01A94CB2790832B9251E0707E dornedlog6
889,565,654 *5C89EFB39B661E8E15C17FFE63477F86CE2BBFF9 DOYLEPECARARO
889,565,655 *5C8A6CD8D7085B8F92E721EF63EE4F5186CB680B Have.a.ball
889,565,656 *5C8DAC2B6A82684C33AD381CC8AD3694F6904A5A havilinas
889,565,657 *5C88E8A9F939517C86BE8135115EE2FA10AE4AB9 DQFOB
889,565,658 *5C84E6B660314FFB78690D5E3B66C6FA0D5B7C71 HERVORZUHEBEN0
889,565,659 *5C8EE57E3009F5B17F98D63DC64B7C89BE539F7A hipolitocompiseno
889,565,660 *5C8B8DF36EB934A38AC7F0766CF600D26B202B0D HISTAKLI ALAY
889,565,661 *5C8C218594D4A2AF40ECEAD6E0B889EA75245DD4 DUKĘ
889,565,662 *5C882B2240CC0796FC7F624D4D88C185D77DF58A [email protected]
889,565,663 *5C8FAC54AAA01F30800CF74F0456AC86A52FE0E4 dv2%m]
889,565,664 *5C8E7A5FD153385702B657507458A6A34F564CE4 dv7z
889,565,665 *5C8F1DE6F5B0192D260FBBE55A833C9BFEE8D1E1 dwxuq
889,565,666 *5C824C5B093FAA6C0513A40D790F26E15CA11029 HTTPWWWNFBORGIMAGE
889,565,667 *5C8CA7375D5BF3D4AB186F6E8A54BDA0C854C723 dz50o
889,565,668 *5C87A5D39ED26FF84D3D93FFB6B71946AD2C6158 [email protected]
889,565,669 *5C8359EAF7E9A9DE7F3A68787EE2E2824703D958 HUGH.HOEVEL
889,565,670 *5C8F0418A3B1250F14702EB7A454FAF02207E8B5 hugokazmierski
889,565,671 *5C825F342F4F051C36F03BDC9B49BFB9355420F3 humenick2
889,565,672 *5C8EE733E13B4949E13943A7F450E720C9FDF776 huohvananinen
889,565,673 *5C896132C3815BA37F58C68AE5A6629585095A8C HYDRPHRS1
889,565,674 *5C847C9368A9B27046C1DDF4CE3A3E40AA8CD333 HYLKYSPRING
889,565,675 *5C8A29CB3F6F68FB8D65AB03D584B70F74036937 HYRKUSKENS
889,565,676 *5C867439D65ACE9775E61B0F1431FEF99406E8E4 ecg03
889,565,677 *5C892ED4D4BC24E9A9203F393D92566F9674642F IAMQ
889,565,678 *5C88CA4A911343FE7FFF3A8F1BF0A28566384BCA i.can.be.nothing.but.trouble
889,565,679 *5C8F2B94C2B8B20C56D29A19050CAE2EF67E4219 icy.sculptures.in.the.severe.frostland
889,565,680 *5C846F8407E411C83B6EE93B57706705CE1D2D69 edmhd
889,565,681 *5C81D035143EC01C4C0F7458F58B4F901ACB2F91 edneksro1
889,565,682 *5C88DBD5EC0A0A10626391F44D74967ABF12DF74 IFLCBSWS
889,565,683 *5C8B73A00F8221CD5BD3DFEA5A6EB9C4CA54CE7B edwindollente
889,565,684 *5C8E0494FFC7F0E0C3F2E13F63741088D8027E50 EELANTIAED
889,565,685 *5C864C04BAA7F79254EFFEB17CC732EA652103FB [email protected]
889,565,686 *5C8F9E0245DA51E3DEDDB8230F0C99F944F68638 efon8
889,565,687 *5C8F420815A6CF21C6ACDC0811D7BC9386EAE90F egmessen7
889,565,688 *5C88D20BA22D6C8ECFEE1580256F619C818A9F30 IL.BALLO.DELLE.INGRATE.:.III..SINFONIA
889,565,689 *5C813C82C8BAF90757FB5566AF6C1EC5BCBFBA4F eio7
889,565,690 *5C8BDA3877D9B7B574C839992C6485E8690D6551 iluvlabtec95
889,565,691 *5C84CA65D8B060B5FCC73F4DFD640813D9F838BA ELEVEN.OUT.OF.TEN
889,565,692 *5C8FE1810FF04D059AD0758FF0373E53921D2C08 ELILIPMAN
889,565,693 *5C835F7054393D777718E7450767ADD90000B582 ELLIOTTPOLOSKY
889,565,694 *5C8154330155521007AFFD09173B89DAF8F0C19C ELLOHGEW1
889,565,695 *5C8FDE911D96460D842F704763E102CCDED1FF2D INJURYE7
889,565,696 *5C89508C538DDC92897053D74078F1B1398D2710 INSIDELAWED
889,565,697 *5C8315D8A79A83D596AC1745660BF3F3902AD699 intahving
889,565,698 *5C876A049C899BF22A22FDFCDD2804106354848D inundating9
889,565,699 *5C8A8F8AE49CC0AE72200CB798AC9CE1E594AEF3 [email protected]
889,565,700 *5C85BA85BE560AEE2CC00210190D39ACFD7EA313 ipmihyp1
889,565,701 *5C8043B5905C224737DE68F0AAFC1F0A7101B386 ISAAC.DAMBAKLY
889,565,702 *5C8C2BF0E2830C3F4779AC7D99D36C668613A321 isidrobiscardi
889,565,703 *5C8A98B7402757BD151E1A9F557E8F3EDAA4963F EMP
889,565,704 *5C8D7A4FD8AA386A96D1D496E4897D35DF825C4F enalemon1
889,565,705 *5C8944812424F63673369DCB32337ABA6F873070 ENCIKLOPEDIJON
889,565,706 *5C8FC8FBB5B989899200A7FB9F74DAAD6EC3742E [email protected]
889,565,707 *5C8A1276F96F613D195B6BF59CC18944DCF3D5BF enelibsw0
889,565,708 *5C8DD44A18E556CFA28170EB2153742C14F32D0D ivanhulen
889,565,709 *5C8CDDD8608B2BCFFA503EC5F376F9B19494CADE i'veresigned
889,565,710 *5C8BE5C6B56ED430056332DA80B0A35171C254F9 epzfc
889,565,711 *5C85D7867C1A2927CF8D094C713BAA2E9EFDBCC3 ERBE5
889,565,712 *5C8614DC9E2531665A2A56790E1F90D3C982746F erica.pinkerton
889,565,713 *5C8B910DB2A7D2B7A3CFDA8BF9BFC2F4E0CD8C77 jamalbolognia
889,565,714 *5C893487B4B88128765D78765C4A01DAC2E1EA8A ermdf
889,565,715 *5C8FA28EA830CA63B25196B375428DE77AD28A26 jarredvargas
889,565,716 *5C8BCEE7A000C509929BE0C197547D6DABEB922E estradaanaya
889,565,717 *5C88FE29C91662694D8C522DDB0A83868A3382EA etekstejs
889,565,718 *5C86864C1E672776A971CD681F0854DC8560CDF2 [email protected]
889,565,719 *5C848AF3D63530F232081D94F322218EDC4469A4 evening-shuffle-(take-2)
889,565,720 *5C8F9F973CE29162E0DCBB4854D8565F32F66F20 [email protected]"X
889,565,721 *5C8A676C53669E5746BB016E0DF384B9CDA6102C exe9e+es
889,565,722 *5C8E43D9672BF03B084F52BF5D5F8DE3F0965FEF jessevillafuerte
889,565,723 *5C8C3E60C04610E700087430D98E2E8931013646 FAASALAFA9
889,565,724 *5C8DA04B3268E6EE70898C356C25F5B364C9B8B4 faizantalib
889,565,725 *5C8B4108CCE871FCAB46C43C55913661E5776FCC [email protected]
889,565,726 *5C83D7610C256159EE30B5B8CDE65A891AAB8D1C fas+d0usly
889,565,727 *5C8878D7A0AE777C9C840970378FCECB844E6E61 joanbastardi
889,565,728 *5C859DDC9D4B02050172D21BB039FD31C671B2CA jodyzaffuto
889,565,729 *5C8607CACCC59A08C2AF7A78AC1918CC49EE305D FEELALLRIGHTE.P.
889,565,730 *5C84FFEE6EAD85EB6B91B111D35DC8E63BC76477 FEITCUDED
889,565,731 *5C8B39810647A2DCF3B52EBB8B4725CACD49C63A fernan.guzman
889,565,732 *5C8EC34CA43D8973C2B6BA23E0E53D9297EE8808 ferrariariel
889,565,733 *5C85D20C14DC88D9228EB52E559D320844436D7B fi6623112861
889,565,734 *5C8DB06DC565C70D4C2313B5BFD156C8B6C5ACC4 JORDON.ZMEK
889,565,735 *5C8852AA692B450C482659AB4DBBE9DF97A3B738 jorge-lara
889,565,736 *5C877439625B2C342D53E929AF84DED63B873E30 JOSEPHKAMPS
889,565,737 *5C8FC11A07B517373DE3A847602A930063FE3719 josephsalon
889,565,738 *5C8F470574A5BFD7FFB1B2AAE40A6662E013F0DF [email protected]
889,565,739 *5C858D63CAC01C47E3DDB06E5E8D6431ADDA0BE3 JUBAV.SI.MOJA.ZAUVIK
889,565,740 *5C8AB5220C975A03F77B5FA4A9BFC9CC2EF7B925 JUBILEERT.
889,565,741 *5C8ED65D038255FF224332917DC35FA015596655 FOGHORN
889,565,742 *5C8CFDE60908C47DBCB9DB25B3C3AFA923DB61E1 JZENZUCK
889,565,743 *5C8E1D5F90202ACC4B9F8D370769733931B26DB8 k0m3viiehfmty
889,565,744 *5C855279928660B900A0CAF4E5BA472B1BAB3906 FREDRICK.ORILEY
889,565,745 *5C84808CBA620C807E73F882CB4DCDC67C96C7B9 freihandelsliga
889,565,746 *5C8B4967E60F188E8D10F0C278C1D149A74E9A5F FRIEDENSSPENDER“
889,565,747 *5C8FED25F65A871F6A6E3A7B8CEAFF32AECE28C8 KATONATANÁCSA
889,565,748 *5C80BF498FA2BD1BEE5FFFFE566F03140FFC5BD7 KBADRIAG
889,565,749 *5C8637267D71A8BF60D2B59F75ACD96F99764234 KCW8WETC
889,565,750 *5C819BDF688B2127B1E80B1EFAF7472A362161BA [email protected]
889,565,751 *5C80D238DF70859713EE68925D19E67562355880 FUUYZUUY6
889,565,752 *5C8901B5A38DEF8A86F7A0193A7C836669BF5B96 FZPM
889,565,753 *5C8AC1CC6EBA35EDF8E6B68A8D108D5BE0928125 kennethmuffin
889,565,754 *5C8973C0EAD175DC6C338A74BF08E717906DBAAB GABRIEL.PRIBLE
889,565,755 *5C8544FE409CA41569C5D9A977B13ABF19C35029 GAI_ZY
889,565,756 *5C85EDE8D6E3ACFB13BF96A5EB1685E59160A19C [email protected]
889,565,757 *5C8356A1835D47CBCF86E5C3BC939CE92A05C6AF GARRETARCURI
889,565,758 *5C8FA9498F49EFED471C09FB654B5910A82615B7 GATEU
889,565,759 *5C8D9C00BB2FEF9F84CEF5AFFCE5938F16FCA6B9 kinneoa
889,565,760 *5C8C747027D26C124BF6F440F8B2762DD3A7FA61 KIP.JOSHLIN
889,565,761 *5C8018B8F030CBBDB179D941C85FED1B918493D2 KIRBY.PURDUM
889,565,762 *5C80CAACBB74770168789809552361161DA063D7 GBIOTECH
889,565,763 *5C8DF9110AE0CB4665431823ABD77EA69AB75772 G;BO
889,565,764 *5C8F46BD1024CEC3B662C1707F31C41AC9D4D319 KMERLAND
889,565,765 *5C8F428258DDACB2E35A846A3F46C8C8C6B4CF42 kokkert
889,565,766 *5C8F8517DA186BCDF66D44F1CA14F2B41B774D0B GERRYLICH
889,565,767 *5C8840BAB797998C2A58BB038E2024CC3E7BE449 koreyoby
889,565,768 *5C8C30BD671FEB9E9C26BAF815031F4CB364C369 geywacke
889,565,769 *5C81FFEF2F269CD1874747304C23A665426606D1 KRISTÁLYRÁCSUKAT
889,565,770 *5C8A7E91E9D772F1C4BF22FF63CAF210073DD716 KRISTOFERQUEST
889,565,771 *5C8865B79777EC277E1BE424EABBBB6839F5F9F5 [email protected]
889,565,772 *5C8570ECEB9BDB530972C7C6234D1DD68BFFDC0B GLADEMALLOW123
889,565,773 *5C8639B4262E6177B7D2B01C2096ECEC702BDE82 GLEN.SELIGA
889,565,774 *5C895301E77F423ADBD2CEEE66D6D3F578A2CBE4 GLYNMATTHEWS
889,565,775 *5C8F2CAB62D1F8C04085B86ECE3DD61296C77775 GMDLJKST6
889,565,776 *5C86B7A161EB272C1C53F40E604752054BDB26A6 kyle-rafuse
889,565,777 *5C871C70FC05106407693FFE8ADF14B95E71CF75 kyrychynskiy
889,565,778 *5C87F8D336693C82D048B7AB88A0BEB415FEDAC4 [email protected]
889,565,779 *5C8055281B9D6628AFF530CDE022AAD37F87D583 [email protected]
889,565,780 *5C83712ABE526E09D8AD1BFBF63A01F01127CA5B LAKE.OF.SLEEP
889,565,781 *5C8C40A2A69D390510AC0DF62B74F211BEB23D43 LANDACED
889,565,782 *5C8F7BD8E8716D6745955A3B1E8A1D3B5FD6359E landescupsiegers
889,565,783 *5C82DF4A834417FB112F7F430AE6031274332450 laoguantain
889,565,784 *5C82F5F8D113AD7A5899936FC0F6D14E191A5072 LASTNESS7
889,565,785 *5C8365B3B7879950D14F903C4D235F6429BE1A66 GRANVILLE.YOAST
889,565,786 *5C8301060B264708C5DBB0D10D9F107C9BF925B1 gregrege6
889,565,787 *5C8CC42647EFFD82DCA76823AB396D13E1E33043 lazaromicheal
889,565,788 *5C804170F8BA5B1001444608847C13F7CBA21718 LCG"
889,565,789 *5C8B8EF95D3CDF6A019243ACB6F2A20950B8DAAF LELAND.HERAS
889,565,790 *5C8E4C5F99CAF399393DD30481670CB03FAD9131 lemuelbilby
889,565,791 *5C84F4731B277D9F87676B6E24869B2123860B52 LEMUELCAPARAS
889,565,792 *5C83DC56C012C0539F10DD005B16387FC1F7E938 lenrowels
889,565,793 *5C8086D82C6194632A4709DDD41EF7D52EC1CA07 [email protected]
889,565,794 *5C8AFAA465707A5148B1CD0C7DD61D83AC8640BA LEONARDZEIDLER
889,565,795 *5C8B32A9D9F2A549196A999790B8A54A0D7D5F3F [email protected]
889,565,796 *5C8E11331CB026D9595DE5402D6BDDD12155DD7C LESLEY.SYME
889,565,797 *5C88AB9470F14B6E9CF2287C272A912C6249B6F7 lestermcfadden
889,565,798 *5C83478B760FA0DB40831A9594DB6B5636E00E04 [email protected]
889,565,799 *5C8E4ABDC758C4AE5CF7466FE94AEDD9871B43D7 LES.VLASHI
889,565,800 *5C8EFC938E063AC28C9CA6A0A71BA7B830214D46 LEVITURINETTI
889,565,801 *5C8A3DB1B0A33DA6078707F0297038B05AFDB1A1 h2ar
889,565,802 *5C898126FA00C3B0D158471E83359A0D87413BAF [email protected]
889,565,803 *5C8017B1EFA5DAE428403A9981F89F0FAFE8086F haleigh-harris
889,565,804 *5C8C22DD7C5D790401366AF4D1ECFB232396FC11 [email protected]
889,565,805 *5C851581103C8371E3839C74D9217A205C20DC54 [email protected]
889,565,806 *5C89D194A03D198E426E060075184441C20866E5 ligelede
889,565,807 *5C83AF9163E3486701F867173705A8F3D37DD5BE [email protected]
889,565,808 *5C8564CCDF2EB12FC393D4FA4309A0E7BD0B5B7F hannaorbe
889,565,809 *5C8656D1F7CCBB33F3122DF8A01238DF502B4AAE HARLEYFRONDORF
889,565,810 *5C888064CC98FC469C26C6E5CBF08B5F25414064 LIONEL.HY
889,565,811 *5C8BF905B8FFA1E6DE9752D2FBA0B10E56020324 lloydnouri
889,565,812 *5C8DF53FB7E7A52F57B26FB1079CF4090BD0A288 „londonaj
889,565,813 *5C80E73318C6B8978352F32275ACA38A4611E8CB *-HG
889,565,814 *5C8F3E1F2B12ABF66FD98EFB4C77CCDF15705123 hgroblit3
889,565,815 *5C847514AF0CDCD2D7A11C8C12E8198B21078EE8 LUCERO-DE-MEDIA-NOCHE
889,565,816 *5C8928F97B3D0AB15301961D17DA23CB615C37B3 HINDENBU4
889,565,817 *5C83B7695CD011797B447EB3F0E2D675A5F6F9A6 HIRAM.BAZIL
889,565,818 *5C80B670A14BE640D484CE1788EEA564B7CC2AFB LUKAS-OLIVER
889,565,819 *5C84B52658EF924DCB97FC1627C71F2C46EC76F5 lukehodes
889,565,820 *5C8241C32C0D03E2C78BB524B2F1F18B63001963 [email protected]
889,565,821 *5C862FE56C088D764A605321925CD1C197A19EE7 HMZ=
889,565,822 *5C8B55C04102951BC6766838131CACDD2BA5A83B LYNN TAITT
889,565,823 *5C8E9B761BE401C58E6AD1013B8DFE7736664131 M},
889,565,824 *5C80884F68ADDF9E6748DA13F568DFB0FDB26CD9 MAGIJA(FEAT.SHIDLAS)
889,565,825 *5C8A4C13686B638ADD7A7708B4C56E1B3F682B3A HOTNANA
889,565,826 *5C825E6F07B41208E0CBC73704D82A3EC212896B MAIKA-PADILLA
889,565,827 *5C8CB805B6647CBEB78BEA8294D5FC49ACC18A54 How.improper.
889,565,828 *5C8769E51FE80A9D063D4E500BB406692F042C7C hoytgimar
889,565,829 *5C81F87627DA5DCFCB71DAAF53F36FBDE2F51557 HPSHYRAKYWH
889,565,830 *5C8DE9BC20B17A0955D07F82A121EEE5D5553C49 MALIKSERMERSHEIM
889,565,831 *5C8CE90B9B85508E5FE7F6C05975124D6DD307F0 [email protected]
889,565,832 *5C8C63999256C333FC7EBC0BA6F82836814E313B H,S!
889,565,833 *5C8236AAD6B768B517D51A29B355E2EC162EFC47 HTUOSLLALMERPHSELIN
889,565,834 *5C8027591C7CF514C346B51B61644A2DC570FC8D humanitari
889,565,835 *5C86532C65C0079C88DB5B9CA7B07CD190570670 hunch8acked
889,565,836 *5C8A1377E7C4F5070527E2D11DD7BCFD61FCD47B hvmlqdc8
889,565,837 *5C88B9825A203A9D29376D0B4DABA8E1AB5FA74F MARCOSMURRISH
889,565,838 *5C8D8806602D591458207E9281244C5284679152 iamgalileo2003
889,565,839 *5C8AF27508C3A2675B7C706A68840EE9942AFB7B IAMSALES2
889,565,840 *5C891B4B3641C7AC87B587E074EBFC715623EE3F IAMTOBY01
889,565,841 *5C8960BB72EAD282CE3D330C4D94D2F55C2EE3B9 MARSHALLCHAUDOIN
889,565,842 *5C8CF21DCE4D9E79F6A820724BF3FCDD9B0FBEDA IGUSIHS7
889,565,843 *5C89A6C548B2BDA59E08787B550434D5D926CDB0 ihcimiro7
889,565,844 *5C8DF738957A51C43ACCC3FBC788896B6B9149E6 IKARUS-
889,565,845 *5C8297A92553A11DF80CADFFB7ED6EC3387482BF ILADAGAM8
889,565,846 *5C8ED11BA737742F1DC14F23A382709F25B38B76 MATT FALCONER
889,565,847 *5C83D713FD574305C0D644FC651AD65B1EC3C469 maxwellludington
889,565,848 *5C8E36AE73A17C32F626CC4ADC4AAE4BB053CC17 ILRAGLIP
889,565,849 *5C8CE8B77CDD770D28136BF1345A306C7B078564 ILUVMAX55
889,565,850 *5C8D61C6D0A0F40B3F838DEBA8B23822FB081950 ILUVNURSE74
889,565,851 *5C840D096837819D5A72E37DF0A4EDD1EFF663A5 medunarodnog2
889,565,852 *5C8653DD7EB66CE2848487A93DD53E625322C4C0 infiltraran
889,565,853 *5C8EE97500D112770F1478F5321C762328339FC1 INSURSNCE9
889,565,854 *5C8EC718D733F0CBF47FB2C51DFBB9603C4443A0 INTENDS
889,565,855 *5C83D6F35A9CB839D18651C948442C03694B0664 iqccpl
889,565,856 *5C85F5D7A5842997E768D323BB1092EBA50D5298 IRBYONHUMBER
889,565,857 *5C8EEDE8AE88C2EB181E9E353852E82113786AC7 MICHELVANPELT
889,565,858 *5C85FA5D95639E9B39B3A538CFF703E172CDADAA [email protected]@1N3$$
889,565,859 *5C8B704C5381D4541C6C15B68775FD2EDD80D807 irwincordoba
889,565,860 *5C8A79A92146D89FF2A79919386383512FB3D349 isaachesson
889,565,861 *5C8C6F402588350502AF766E27803C333090521A mihhails
889,565,862 *5C827295D7F2CEAF393D03E0DB87229D803CBF68 MILTONFAGLE
889,565,863 *5C819BFEBE5A3A20ED5BD126B54561295035B633 IVAN.THROGMORTON
889,565,864 *5C84B701F8BFED6565D4580B8BCFEF07F5175220 minhrowson
889,565,865 *5C81DFE6890C02845810C52DD80C7E75A4C35103 iveta-vankova
889,565,866 *5C81C7CCCDB7E969E2E662BDEDE4A433752889C0 J#[3
889,565,867 *5C82DEE687222245EE79A33F7D39C6ED01EA291F MM]$
889,565,868 *5C89B55E1B78D422520D600C62B62AFEBE8D4BC2 jamaalthoennes
889,565,869 *5C8AD3FACC11193FB757E2B2DB76EAD04B0B8363 JAME.KIPPLEY
889,565,870 *5C8F8B9BFFFAA677B0A68876EF3CD8EC42665A34 MOISESSEERING
889,565,871 *5C85E2E02F3911EDE26CAEFCEF0756E7095AE98A JAPEC09
889,565,872 *5C8E0C0F94CA364D4C15C69652D3674E96CD2E48 jarviszucca
889,565,873 *5C8F61CBD65FBF360B37C912A3C04C15E48ED8C6 morechangescometo
889,565,874 *5C8A4BAE5D78053DD0DF45B5064BCC02FC0099A8 MORHANGE1
889,565,875 *5C846C82F28EEF61E5F9ABCCDF355F7B05968336 MORRO MA PRIMA IN GRAZIA
889,565,876 *5C8D351A980CE1A2E16828D60D7186FC61299D9A MORTONAIRSERVICES
889,565,877 *5C80468B997A7BAB7AAD212A71C8575C24BB2A3B mouth-erratic
889,565,878 *5C8B2DE24B1CE3AF09CD82DC108D69EC70942FBA MPASNTELI
889,565,879 *5C890D1EFAAB206E8234B06E70DB355DE6CE9E78 JEDAMOS
889,565,880 *5C88A2C08ECD2B1369B01B2336AC4935BC438395 jeffreymozgala
889,565,881 *5C87B782E35193B36EEF426A064B091E841C374B JEMI-ESTRELLA
889,565,882 *5C8BF57350A8777080427AA74D06825B8694810E jenlawrence
889,565,883 *5C80BDA7A3A73683ED983BAA138F076BF9891730 jensenblazer
889,565,884 *5C81291FC656C36A6643A4A641E8CF5FD788C198 JEROME.BALLESTEROS
889,565,885 *5C890BF9BAFE072AB3A835DD62CE6489AFA26F19 MYCALGARY9
889,565,886 *5C8C56C05BF47609957C5736DEF3377B7288093B mydef2008
889,565,887 *5C844A3EFE8D5716633C2F9E426074FA23E4DF52 myronsiegmund
889,565,888 *5C8D0A43B03AEECA604CCF062ACE7CECB6C682E6 JHAIRAM1
889,565,889 *5C814810AD5045AA3F61C37541EC42BAE9FBF581 N1|>
889,565,890 *5C851F396AB0B826C3F63C70C9A69586A3C85EEC N45C1N3NT0
889,565,891 *5C86D5583950A13FF64E31C528BF1FF50B4DF066 jiggylo69
889,565,892 *5C8436C38858DF6BBDDA58F6B6A94BBFA626C614 NAKOMENS0
889,565,893 *5C8A39693C03FBFEBC0AD200BB2FD22E09D80CB1 NAMLEGNI
889,565,894 *5C8BB4132CD8E2EC670156088420BD2906B9EEBB jjW
889,565,895 *5C80093F645303A2C1F7FEA06DD4EC3BAEA9E8C4 JOALJADEJ
889,565,896 *5C8BCA6CC52088C4B6D4096FCA96854BB6BF22AC NATHAN REDWOOD
889,565,897 *5C81A75DA5CC7E0DD1071BB938D47EEB7855A260 joe-dhillon
889,565,898 *5C85289259ACFD2AD9334B584062D1E21E311317 NBNFYBRS
889,565,899 *5C833F9B372DA59D647F75DD796DAF8E74177F53 nchwrmses
889,565,900 *5C853BA87FE774626B88768CCF0A255C1D61769F JOHNATHONNEUGEBAUER
889,565,901 *5C8A0E9E875791FB6EC38C65D8F2EA0248D3F7E4 n'direk.pour.debon
889,565,902 *5C8BF81806FBB77DBDC48348C16FEAA01D6F9E1A NEIL.PERLIN
889,565,903 *5C8D2C6D09ED3E7154EDBE68B1D594876BDBFED1 nepdooded
889,565,904 *5C875BD8EA9170172E9B7A62FE35A4C02207A724 nethcalsed
889,565,905 *5C86B7B90E75F7D073B88C2DE3AA7597F08F41BB JORDANREUTELER
889,565,906 *5C8F5EA717FEC0A097BAB03B02A19B536D6A69DD NHZONG
889,565,907 *5C878BCD4B82CC84D3D0B1D34FCA8334DF21DF1E NICEBRENTT
889,565,908 *5C817AF3F1E6CB1B442B4B575C6E6D3977118AAD NIEPOLINKOWANE
889,565,909 *5C80C5C2DA4BABD87561D45B646FB18B4BD1C027 [email protected]
889,565,910 *5C851544817A910C749FD8DC98612B57DD421C0B nilujer9
889,565,911 *5C8C8D56E73009E922588AA077A6AFA2448E73D1 JUNIORMAULSBY
889,565,912 *5C8660BC15D175E1D05CDB94671CDB15DECED34B noglup
889,565,913 *5C82CBC2EF3308E3102EBB4C75B420984BAD5661 NO WALKIN' BLUES
889,565,914 *5C82501EAEE117543A5ED5A045CCA30466BF723A KARGERRI
889,565,915 *5C8B95821E3618946E8EB411F40B68A6BC6CFF8D NTRGMML7
889,565,916 *5C86BAA26AEB3C89C5FEE86CAEF1E322DF89D0DB KEENAN.DERRIGO
889,565,917 *5C87D9C7959EE9A723E66FC67DD229663F44D3FB [email protected]
889,565,918 *5C89DF1A408F71887713F36AF04280EECE38EFDB KELECTOM7
889,565,919 *5C87AA98E59F1F0C1D29B20CCF5DAB222256D7E0 O (C. ALBERTO ECHAG
889,565,920 *5C8125FC9C9E111DED1E7B9A17667983A801B6EE kemp50
889,565,921 *5C8698D52CFE1BEDB14CDA5D7647C99D9E41B378 KICKUPS
889,565,922 *5C86B7A7EF84719F211841D80934CFBDC538EBF2 KIMQIN
889,565,923 *5C88F69597918CABF0904F0B136DFF99F2CDAD6D kirbywilhelmi
889,565,924 *5C805B9DA0992F5E0044848DD30134B6B762E51C [email protected]
889,565,925 *5C857B5FEE7F665EB63C703EDE5A8D2CCF97D1A7 KITTYMOLONEY
889,565,926 *5C854B07857C393E07E1087F5AA8AFEB8B258E13 OOKKYRAHAYU
889,565,927 *5C8D46BF6F8BD30276DFA8B6FE69E37CE73F1334 (O_-)[email protected]===P
889,565,928 *5C80F33E5E5DE05FC3E8819E2500929C4EA6C12A [email protected]#$%
889,565,929 *5C85858419BD08A5A57D0634B935F16F43E23AE2 KONFLIKT
889,565,930 *5C868EC2223B4D18EE3DCDB7D91659367EA9D98B konohaz
889,565,931 *5C8A299ED3D4571022E72492B9DBB27A4251AB38 korporationshäusern
889,565,932 *5C88A60FA05DF0028F6A5A6EE8C48AF8D09B3B51 OVERWHELMING3
889,565,933 *5C86C12CAEE39F7F8EB4BDC567E09DF711CE3947 P> ~0SPLAT!
889,565,934 *5C830DF35AEB7C14DC28BC4CEFC02572050A3C9F PANKEZENTRALWERKSTÄTTEN
889,565,935 *5C8BD7852D844B17305444F92D4161DA99648FE7 lanethurlby
889,565,936 *5C8914F9FA7E03F701E9335DCC485815E9ABB46E PARTMASTERCOUKWWW
889,565,937 *5C8A8FF72EB1AD72C1814AC58589D10A50997FFC LAWRENCEOSWALD
889,565,938 *5C8EA16CEA33647B9FE2C94E48EA334F9F92D718 LAZARO.BRATHWAITE
889,565,939 *5C86A9B77FC47A88623F2701C0074580D2DB3D79 lazarohedtke
889,565,940 *5C84BC597048E1A7368D9B85A49F5C512CA1367E lbumdeglup
889,565,941 *5C843A351EB71DA4BD943C2382795B04DF8A499E [email protected]
889,565,942 *5C8A4A2CED048742E65138D4BC5B50B4B3FAFB5D LDS911226
889,565,943 *5C8FF6CDAA6368B7CC01C2C27357BB9C62F224ED LEANDRO.REISCH
889,565,944 *5C8E1CD3BDC2F11AE63D012F08E28BDDC01B2AC7 [email protected]
889,565,945 *5C8DCA0AFF14ECB4674C8208FA0862DA34D31FE0 leanne-buckner
889,565,946 *5C8AE6244AADB47DAF33931C02BF4807550B6AD3 leipmaned
889,565,947 *5C8174F03C427782975CFEBA9D6D9D59867C3DAD [email protected]
889,565,948 *5C80D37968A72FE0671CF06F9E2A5E4751A31F77 LEONARDTHAMES
889,565,949 *5C814A4693BB926A98E32B32A4EDCE70C8230662 PETERSCHLEMIHL
889,565,950 *5C8C3ABBBE0A07E8B39C9366F7652DE17272BC71 PH0707H3R4PI35
889,565,951 *5C880DCD03C612ECC957654089C84BD60FF6162E phildavick
889,565,952 *5C805986845AA216EF7BB2ED33EBB8E9D605AF8A phillipberisford
889,565,953 *5C877E5A4B471FFFBC1F6B25CD003477635ED5D2 phillipforsman
889,565,954 *5C8FAD506BCF27F4E7F42EC0ACDF96168C3FFAD1 phinachan
889,565,955 *5C87D37FBE570386976AAD0D4DA0265FFD9F4DB7 LIIKEMATKOJA
889,565,956 *5C86D200CF8B76557E4917A71EDA93DCE248FB27 planned5
889,565,957 *5C84E64DCE67C6BCE77FA98224AE66F729E98E99 [email protected]
889,565,958 *5C84B307563A8AD58A3A46C050F30EE79DEEB0B1 PLTTLNDR5
889,565,959 *5C8DDDC4CE42E3BF822D5FB8F771FD5AFB62B761 POITRINAIRE0
889,565,960 *5C81B8BA3B2B13E40FDCE15572B581ADA24672D2 [email protected]~O.~OSPLAT
889,565,961 *5C8DAF50CEC3CA12A57B5C410C832FB260D6EEC4 portermattern
889,565,962 *5C869835304C2586FDAC35FB2C3C6052885217FF LOOSEASAGOOSE(FEAT.FOXX&MOUSE)
889,565,963 *5C88861169FAB58F0422D11192DFD54DDCCF5BB4 [email protected]
889,565,964 *5C8796DF39BE723219CB13C4C11D0F536E55D469 LÖVEDÉKSZÁMBAN
889,565,965 *5C806CB46E55EEC9CC7E686EB9410A6D4C633481 lovegatot
889,565,966 *5C889430BAC8DE1080001D11163C8D440BB6DAD1 LUCVALWE
889,565,967 *5C84BFB0003F278401FAF2E2D5F271E53DCA8BE2 prince-de-la-nuit
889,565,968 *5C89D52D1E7B91998E884C46E5462BDEFB8AD703 PRIPADAM 2
889,565,969 *5C8F6358F9FE7A439642F15CB9F2E92AA96D389D lung(featnoremorze)
889,565,970 *5C82F47EF9FAA1C90C3F995DF4AFA428BCBD35AB macfaqorgmacfaq
889,565,971 *5C85F3C0718AF4A246952AB289E65A85224A2BEA MACHINE.-H
889,565,972 *5C8D59282E2B25F469D8B5FD43E0EA030F6D5E24 mackenzie-burk
889,565,973 *5C8B38408F1EC764CAE72BE386D11A1A8B5FD3A4 mackyankovitch
889,565,974 *5C832518F2509CA8458DFB9978547DF159AA70B1 [email protected]
889,565,975 *5C8E91977CD69C11F81F187B82BD5CB23E983EDE maestroo
889,565,976 *5C8536A240BBEFD717C9D390F66FBF646174FE19 q######D-~O>-<
889,565,977 *5C8B921D23391D89F093665A51C291AB00F192B2 [email protected]
889,565,978 *5C823E83A889D5603DA627A1BF052601C68C9B85 MAKEITHAPPEN(FEAT.MCNAVIGATOR&MCLP)
889,565,979 *5C890698168F08DF4DDDFB6AF894D34EB041C7AE MALIK.HARTIGAN
889,565,980 *5C83212C9F819AAA468FCB4303C59DA73A9B7268 q===p-~0~o}8{
889,565,981 *5C8F1EC54BA6D2463FDE05E8ED86B26873459ACD q====p~osplat
889,565,982 *5C868CE22EE73F996C8D9DCBDBC99E09A2A904E2 QUESTION7000
889,565,983 *5C896C4B5F2810FF6E41B142AEF06EB332EFA8F7 MARCELLUSDIETZ
889,565,984 *5C818E125E0B299C7482D674BFCAA602BA92BE8A quinnlechel
889,565,985 *5C8A8D75852B66BCBCED21ABD2E2AF99AD728D44 MARCENEIRARS1234
889,565,986 *5C8783BD5C00DEEE446B256449E8500BE3C83993 QUINTON.LUFT
889,565,987 *5C83F2C32486D875EDB43D3864E6F88A82502F66 R31NCARNA+10N15+5
889,565,988 *5C8763067657A5782D24BBA2B005BC8494588C95 r3sp!7!n9
889,565,989 *5C8EC7A12BCD63C1A7E107A07F9F304B54030F34 R4M4553R10N5
889,565,990 *5C8CCD2B3D00A0B3B5BF5D2CC05EF789F058D085 marlonpennison
889,565,991 *5C8D1E22082DFFD78C52691025C0CF62C0AFD2A2 marquera7
889,565,992 *5C8DEC4BCA67C49DEA50FA5CC86C12DF104001AF MATHEWDELANGE
889,565,993 *5C83C567CCADB55738C80FBF7D57ABDC4FEE74C7 RAY.EICHSTADT
889,565,994 *5C8F365052853E8613BB6FF25D5668374C543072 RAYFORDSUBERT
889,565,995 *5C8D2B9101784DE2D9B2EFAC965889D8CE22E5A6 MCOSEREANU
889,565,996 *5C8EAF8F8DAD2BFFDAFB366620601B38B3FA3F49 RAYMOND.VUKELJ
889,565,997 *5C8852C933A7F50ACC8C318E450AB4AEE980ED1C me702363123
889,565,998 *5C8D7525381EDF30CD58C0BE223F5D16B3F36762 RAYSUL-ISLAM
889,565,999 *5C854010D50A460BC7BC3154BB280536D9318A11 raysullinger
889,566,000 *5C8A198EEC0027983ED109BEDA58E0AB1B23FDCF MEDIASPOTLIGHT
889,566,001 *5C870DEC5F6115EA3E2F727522382F842DDDDDDC MEMI446
889,566,002 *5C83EC94269404A8B52D343ABF2D91E983DE2E04 REBIRTH.BENEATH.THE.STONE
889,566,003 *5C8F103EB0D360461115081BF46FD0A045C160E0 REFRELSE6
889,566,004 *5C817A39EAC2DB080B180265D37831968C730929 meyerinst
889,566,005 *5C84204375DA8B29AC3C9A4A36EC43C352926A00 REINALDOHAAGENSEN
889,566,006 *5C81B55720AA121E5DECC25151564682F5511F3E REISELEDER8
889,566,007 *5C852478DBF4DB2ADCE744D20C0B392BE8CD40E7 RENALDOSHADDOX
889,566,008 *5C8FC81EEED332DB99DD1E403C97F62117685271 mid-stress
889,566,009 *5C84CB0EE3314F560B1772B9C92A5AB0363603A6 milesgardenas
889,566,010 *5C8B010E988A16575761B4D7D2900682737DA61C MILO.DEVENNY
889,566,011 *5C896871295107AF10F588AA74FF405CDBD95207 research&development(60secondversion)
889,566,012 *5C81043076F167FE77F7E45422B3F44F47A8E3A8 MISOCAPN5
889,566,013 *5C8EA93EFFAA3D8BEE92B6C5E9A934676E1387BF mohamedklemenc
889,566,014 *5C8620D778C16D9724F522987ECBB0542E03944A mohamednormandeau
889,566,015 *5C817A0A7CFC6B2734BF0C445E8CDB8A11912F2C [email protected]
889,566,016 *5C85BCB84F9243DB372DFCA5E9C4880A3810B234 MOJAKIS
889,566,017 *5C864C61DADD7EDFD21F0763C27AC3957E232616 MONDIALELITE
889,566,018 *5C845B116B765FF9A8ABE48AC7418D7BBC2CD796 ricaenalmeria
889,566,019 *5C84E23530E1CC89514A2BCE03566E280FB4CF4A monolektiko
889,566,020 *5C802A30E3655EEBF639847B5C83176205D6B0AA riki-yehoshua
889,566,021 *5C8BF7A7D973C995DAB4254E0EA565B413923D95 rileyculpepper
889,566,022 *5C854CDD664A7A302477EAC244EE3098A0B6F3E8 rin!
889,566,023 *5C804AF89FAE9CBA431131F6047D02F5C85D1F2F ROBINGRINDELL
889,566,024 *5C8AE4F482902DC323406D9B181EEE878350448C ROBINHOO1919
889,566,025 *5C8D1B1B6F3C8AD9D28C811BB940E08727EBF8F2 rockyamoros
889,566,026 *5C876A77092056F643681E9C55C349FA314ECF0E mvi
889,566,027 *5C83F95F135248DC0CA53A2F8254AFFA4B622CF1 MYFUFISWTLOVE
889,566,028 *5C81A96F5CDDFFF6DC1196792831699E13671B04 !N7RODUC35
889,566,029 *5C83825AED6CFDECE92FACA4F86839A090AB3789 romeoganadillo
889,566,030 *5C85DFACD4803984D8551B4EFA157E82E68BE1EA nadzibaed
889,566,031 *5C8EA71A4BFE034888BAEBE833A0C407258771ED NARCIZMSUS
889,566,032 *5C8D5672E5738C5BB7ABBEB1E2F6B2102617C7C8 rotascop0
889,566,033 *5C84CB2937091AFF7482EA3F4D91DC6E63450897 NDRCTS
889,566,034 *5C85E171196B3296A20A934A49D55C61DBF10D30 NEAL KURTZ
889,566,035 *5C82A008649F88C076B171AFD530EADC45568EAA NEDWALDVOGEL
889,566,036 *5C80F629EC8958CC0F1BA4BB75F0B374EF68BABC [email protected]
889,566,037 *5C88701DE440C6AFE4A44FDE88C7C7C7C5DACFD5 [email protected]
889,566,038 *5C8D04CF95A7E6F77439F9E720337944F5D66994 NELSON.JEN
889,566,039 *5C807EEF4EB7ABA3E25753E6241D4C3884671EBB nickolasmarkoff
889,566,040 *5C81AF570B849574873E44C1EFE3DEF98893B8D9 nick-teves
889,566,041 *5C8CCF250FFAD2C6537A55FF86CE15100F5CA64C NICKY.REVEN
889,566,042 *5C85302B5E8B5536F2EE2889774AFB0751878DAC nitzer-1-0
889,566,043 *5C85DB48F85540AD947DDCAC4209A9FDAC9D46E1 n.jm
889,566,044 *5C8433D257C292AA3FD2ABA8539AF678D423DA85 NON4MOTIO
889,566,045 *5C865427E8F37F564D12D015C79C2206B760B8AE NORBERTBERY
889,566,046 *5C8E6D087FD2089F2DBE46FD04995669FEBFDD09 NORBERTMONDLOCH
889,566,047 *5C87810106A662391B831362E8F2A1453EECCBCB SAMMIEDUMLER
889,566,048 *5C8D485BEA7994D9B8CE9A7A28B5A43229FA091F SAMMIESERBUS
889,566,049 *5C8C566AF97F6D02D9C143EB43904803DA92A92D norrisadami
889,566,050 *5C8B3AB135FD2FFFD4E793DAEF67B9DEBDEF04D7 NORTHERNROOM
889,566,051 *5C8839CF3B5FA46DDE953B1EC438A6D9DEFDEE54 SANDY.COURAGE
889,566,052 *5C854D11DC40898BED0D93528AB3DF2E8C687F7C SARAH DUTTER
889,566,053 *5C898414C46576CB8981082A8AACCADC2A9B9080 NRCNTRL
889,566,054 *5C873D5F7B530117D3A319E53015587637CCD75B SCALENOEDER
889,566,055 *5C85698F439B03263FF1077AD3CFC6901FC33EF1 [email protected]
889,566,056 *5C8C6B74CACD3937EC635A29DC2814C9D8780035 scandalis
889,566,057 *5C8BC1C74E44F3D7A9C598E4BEC436E8AB64AFB6 SCHIFAHRN-SCHIFAHRN
889,566,058 *5C82C56F9A4C4048E98C154DBB09163675BE35F8 schizofrenicmich'-'schizofrenic
889,566,059 *5C8995E7457B3D84DCE919A1802B83DD913F1CCC OECOLOGICALIS
889,566,060 *5C88C739788A66D53E0F33A8C533A4FE75D2E3D4 scottymckernan
889,566,061 *5C8175EBEC9693AA0851FD57843EC49D8EB49D2D OH220[email protected]
889,566,062 *5C8467657DD541D92AE7C45DB49141DDFE90DBA3 Oh-Poor-Me
889,566,063 *5C81D929AEBC46AE380790CC2F087970DD9C46DB SEANMINOUED
889,566,064 *5C898AE2DF210596C4BD334B089F8B9271B8ADEE SECONDS OF GWERND
889,566,065 *5C8F3DCDC5F7B871FFE5C104C3288BD9AACC8883 SEGREGABLE5
889,566,066 *5C82620F6C584672129600D32B8633DDBAEC67AA [email protected]
889,566,067 *5C886EA3A7C9BD28EB4AB1028F17A3113BF607CB SEPAQ.COM
889,566,068 *5C8D3AEC5415ADFFDAA98F6615BF05D1F0AE0837 Sessoupirsamoureuxapr
889,566,069 *5C8940455B7EEDC0B694C3A51F4B1B6EE35BDA7C oosfaals
889,566,070 *5C807581E91DEFEA26A9FFF4E0732B9671ABEFD7 sewages
889,566,071 *5C89BBAE92A210AB9E5E8E210B6C54FDE64275CA ORDERASC2
889,566,072 *5C8FE7123A9823BE6F2A1D0191E1CEF0227BABF7 [email protected]
889,566,073 *5C861F4EB98B176A29F6F0EC7DB379807550E907 OT1D1FORM
889,566,074 *5C8CC0ECFCFAB2932E09EFF68E189E8D73015165 SHAPILI
889,566,075 *5C8C4F8A8DA111CE8B59F5B6042B0E0D0D195CF5 otisjakubczak
889,566,076 *5C8F1654EFD35AD622B62CF534DE49878A0D32F6 OTTOKELLEHER
889,566,077 *5C82DFEE81C6E80B33F01AA85FA9E6CC437B32F0 ou7$mar7!ng
889,566,078 *5C8E865B77645AB67D36D23B1FF1BC2919F2D62E SHELBY.GRIBBEN
889,566,079 *5C819B7A39E9EC0AEFA48BD545DBD1C0571BD1C7 SHELDONMESSIER
889,566,080 *5C821898807CA40C58FD9FA3F93581C23C788F64 SHELTONCARDOSI
889,566,081 *5C81CDD340674D92B5CDBD830160FF0BAEA3C73B [email protected]
889,566,082 *5C8D779753E8E70783182AA65E6D23811C4BD684 OWENLONABAUGH
889,566,083 *5C89455E69D15F5BC7CE2199DE06B543EE0D208A SHENRUN
889,566,084 *5C8E9F72B0DED393458E49CD06C7D59A94D39F4B [email protected]
889,566,085 *5C8C428A7EABBDF9488288A8BEFDFCFC2113286D [email protected]
889,566,086 *5C89F5E7D9291ED5DBB60FF48BEA97327084EF3D SHIFTING
889,566,087 *5C8D9A8C7C5CB6038A0057FD5FD02D1B32E94834 SHIR-AHAVA-BEDOI
889,566,088 *5C8750B68E66191F01FCD80EB7F735DC029A17EF SHWETASAWHNEY
889,566,089 *5C868FED9ADF2904B3936B94111423D873A525C0 SIDGO
889,566,090 *5C830AEB35ED0479D0815E54AC5316B4B57830D4 SID.SCHMIDT
889,566,091 *5C8BF81E59387FC0C85428AC96C2306EBF1567C9 SILVERMARIA0
889,566,092 *5C86682763BEC595CD0B673DEC44A25D837D090E PAPERCOUNT
889,566,093 *5C8E9ED3440E8F3929E6C263F3DA06227EB7A941 partyhats
889,566,094 *5C811FF459EBDF157CD17ECC45ECE0A4746ADD42 SKUPOVE1
889,566,095 *5C8EDF7C1F1FDFFC581EDA3D37E0E89C6466670A :p*(----B
889,566,096 *5C8BDA4714C0AA88FE69FD33F38EFC375C44026E PDS
889,566,097 *5C8342B02B3243B333E64F14C2BDDF49186CD8CB snetnile
889,566,098 *5C8E3AF26B6992E00B8FB913300DC5D1DBBB6735 PETROGRADSKY
889,566,099 *5C8502A02304FFBAF7E6334C0BA879BDFEFECBFB philschurer
889,566,100 *5C8545779CCCDA22440AD3576EEDF775F5B9A95D PHILWISEMAN
889,566,101 *5C8A57E5E81D9DA5096726754CCE6AA96B6A989C PHUAHZ
889,566,102 *5C85DB5FE45E779177049573A7B0527846071CD3 PICETTI
889,566,103 *5C8A7680A4E9B0BB4C94DC2BEF1EAD2E5973D4CD PIGFACE5
889,566,104 *5C897306A5B6E4A72130913794226EE2666E9457 SPLAT!.*.*.*.D=====P
889,566,105 *5C8E29E1BA69CE136CAC1291D04B5AD1F4BFEE56 splato~-o~-(##p
889,566,106 *5C86C3AAEAF2F495CA50A05B9091EFF2FB034DC1 [email protected]~-~O->-<
889,566,107 *5C8381F4CFDE61AD5B753AF95DEB710F1DC6F391 POTMANSES
889,566,108 *5C8B27F78737F93A4C8B56B015FEE88D7C336B20 sselzaventem
889,566,109 *5C8A6F2B78D8577F94EFF0F10A63B97EE2AE6B53 [email protected]
889,566,110 *5C8156BF4B907108A98426F56EAF5772C2F49EFD p-p~ ~ }x{
889,566,111 *5C81AFC03D9DB47300FDD5DABD813C5574C88210 stand up tall (instrumental)
889,566,112 *5C81168217EA709945D3D5A168D8DB382C46DF42 PREDATORYINSTRUMENTA
889,566,113 *5C8E7D63B063DBE223B4D66D9D722056941A322E STEPHANIECOCKING
889,566,114 *5C80951F15E74BAA50A55A04FD18181FCDDE6F83 PRIMING
889,566,115 *5C855D57C947497679145DD7A79B4421E1E2EF35 prompted
889,566,116 *5C80411680C431AEFAF89617838F97F91C22B9B1 PROTOTHELENELLACEAE
889,566,117 *5C81C451720980C60F019CE27D28FA1F36D01BA7 [email protected]~`splat
889,566,118 *5C81E90635807E6A9A61243A50C056652ACCFE66 [email protected]
889,566,119 *5C88E758C3DBC9C15D610B990FA942E6767BCD61 PUTTYED3
889,566,120 *5C86B1356D3D4FEECB0AD38446CDCBF514290BAC SUMMARY-OF-EDIT
889,566,121 *5C85C4D0315EBE0A4149CC990B095842185F4BCC [email protected]
889,566,122 *5C8CA7B5FBD16435E8192E6E61E0CCA869632F6F SUPERPATIENTLY
889,566,123 *5C80EFE5740588A201B4B4586780364AA47281F5 Q?E(
889,566,124 *5C844F14319044745AFA94FD65C624E28FD98D9B SURFCHIQUITA
889,566,125 *5C86F66B981A7F5401E2B2AD99AAFCC98077277B quagmirehead,-pt-2
889,566,126 *5C8C7AEDBEA954A8124B3A8A75F3B5A6B1C63E8A [email protected]
889,566,127 *5C8199B0DA8710A5C6351CCDCFE77807B65797A5 QUINCES
889,566,128 *5C824C789203222C6D7D2770FD0949D0DAF04D5E r3f0rf3it
889,566,129 *5C8568D1FD8F144A9B1E8B1DD32EE05565FB5100 TALLIARING
889,566,130 *5C8ACB1399C5DFB76E7171C42E55357F43A283E1 RANDY-WISNIEWSKI
889,566,131 *5C8A0986AD3B86D284C7B8D68B3EAF0D2DF36591 tbaddatabsw
889,566,132 *5C8608312D7931DE2510025166A1047CE8CED707 rat10nal1sm
889,566,133 *5C86C4BCE58824B172FE8BD7C29FD55C1EB247E6 tempdean7
889,566,134 *5C87FF33EA10AF5A33344BB37A9E4C71C53732DC [email protected]
889,566,135 *5C8C414A91EAD10FCE9BBCE929046C0379833DE4 recioana
889,566,136 *5C8A51500EAB381F067E28303DD5634DCEBD7AD8 RECORDCHANGE2
889,566,137 *5C8FA8775A2F4FF1F1FBCE1EA689337269C3ECBD redadmiral's(gonnapassme)
889,566,138 *5C8B4B3CAC83486073158B10DD4FFB52582A8A07 TFIUHCST8
889,566,139 *5C801D6AA92D7B27ECBE25A3B4325138ACAF38EB REGGIECHRISTAL
889,566,140 *5C853A041018B0F95DCF4F16E273F94D94785729 THANHSHILIATA
889,566,141 *5C8197D9AF226AC846726F5E64D62732693D6873 THATNAPOLEON2000
889,566,142 *5C84EF356693277002BF62CADD7E597E912D83B8 THATWIBBLE89
889,566,143 *5C88FE016108BDE895A22F8A4F3912ADD10CBA55 thedontknow5
889,566,144 *5C8890F6C37E89ADFCFF4927ACA6019266C8F3D4 returnlast
889,566,145 *5C8ECA143AC0E16BDC07C89D2D1EBF8D83861292 [email protected]
889,566,146 *5C8C7BA258BC2ED97E626BBB91F8219B54ECF44E RICHARD.CALISE
889,566,147 *5C8AB98096ED787E9B9CDE21E6A84D2B98735563 TIMEBILLETTERNES6
889,566,148 *5C86D8DA4BB7DB0EEC14CD932A4AEB4ED00000B3 timejack5
889,566,149 *5C83EDB99B446D5FC1DB001D10AA627302225667 [email protected]
889,566,150 *5C86B7D8CAA2E7F2722D61DCA1D3656F8F9F8DCE r)O
889,566,151 *5C87B4B2E406658C22A5883622E91A286DE73036 robinett1
889,566,152 *5C8401E40FF9F6B10BD36C15088571C4F968272C ROCCO.SHELER
889,566,153 *5C825CEADE51D08B68D7796741189FBC3505330D TOM.RISSLER
889,566,154 *5C8ADEA6BC161D9CEA24A59B535FC810F2870432 RODELPOBLETE
889,566,155 *5C81DF561172E1EE77C093AB4959302E1504E66D ROMANCEINDMAJOR,OP.23
889,566,156 *5C81AFE00ABD5F536EF2307814B923D1AABAB422 trai1sig
889,566,157 *5C8D91AD822732E6E12BEA7164C41A4C3CA90A35 ROSELYN27
889,566,158 *5C83F31C8D793B9C2DE3DE3C030384597BBD2B15 ROTEERDENS2
889,566,159 *5C80A51A41DD9224A60972E66FF3CD6574559A1D ROYALTELECOMS
889,566,160 *5C8C4C2EE4B5595C8A7782FA5DFD6CED4FD6A70E ROYCESTELLE
889,566,161 *5C800775BB8FAD2EDF1641960B7746CB5AE32CB9 TREYGUSTAVSON
889,566,162 *5C8C693E2309A28717A047551C433225426BE601 trgvchtn7
889,566,163 *5C8C7D890F9C4D4C45E300EFA2E9CC4956A7D9A7 TRICIA BARGER PATRICK
889,566,164 *5C85204708C2837E6A89CA67CB588AD5BE3ADF7D TRICIA-KOHANSKI
889,566,165 *5C8CE851FCF7EAB4718C99CAAE11A43922DC7A8E RPABILONA
889,566,166 *5C8E8697340DD0CD29BE4EFC871D7775AA1BF1B6 [email protected]
889,566,167 *5C87ABD44A484A24590DFBC0712536E472B2F52B trisha.hornsby
889,566,168 *5C8E9FA7C0A0AAFA3E3BF6D72B6FFBBAB0744171 TRISTAN.WHITTIER
889,566,169 *5C8CF03A9D14E930CE083768279E21257B1135B6 [email protected]
889,566,170 *5C88FD321049E30BD6CA7F5C1675F4C433DBE774 RUBIN.CRETELLA
889,566,171 *5C894A549C9C9777E9C585DCB80E2E7BB5732DD3 troy-gornto
889,566,172 *5C8ECF73647C8C32C267AF8EA086F26B60597D7D RUDOLF.BUCY
889,566,173 *5C8E6476126FC360AC4EDF3E450A41F90B528B09 [email protected]
889,566,174 *5C89788B09605C43FB3E28E2FD748E5DFC582C37 TUGHRIK
889,566,175 *5C833EF2F1E9DAAFE17A35F058BEFC05A5AB758A RUSSELLWEASELING
889,566,176 *5C84744F06E8E1BA045DBF6B5B816FB6016C39E7 TUOHENSILUJA
889,566,177 *5C8006ACAFF27EC849C0F0D5E3664E1DE2B39D0A RVARENE9
889,566,178 *5C8EC52E57040B6D229F6D6D6EE39306F49B10B6 rydsner1
889,566,179 *5C84CB4A4DD706EC253608C04998FB3FED7956B6 two thumbs up
889,566,180 *5C808D4C9513773E372B67BB93AF9CA2CD7B6AF5 SAMUPALAPSYATHA
889,566,181 *5C80115C158D26CB4DCF60F9FA9E3683DFE9F6C5 UN(!
889,566,182 *5C8797A998FA9F38C94ABC944AC79DA4EE0ADB72 UNC0MPLMEN+4RY
889,566,183 *5C86BECC4AADBDD5DD5522B4AB1F1312ED5E1293 underoverlooker5
889,566,184 *5C875632F5AAD63311FB9B649068356E57BCAFB5 unemployed;.out.of.employ
889,566,185 *5C8EB1BF5F8B490FA752D9B92EB075B99D3E7A9F UNHCR.ORGWWW
889,566,186 *5C8324A4E8B001103F4455E0CD9B39024270A53C [email protected]
889,566,187 *5C86BCC87448331EC473A68A8E95715447F253F3 SAVIOURCHILDE
889,566,188 *5C8AAD50CB933693C26115CE28C3258439D727AE Unpardonable-Sins
889,566,189 *5C8199D7D8771E7A673887662D4049CC5B17D63C scheffer9
889,566,190 *5C8C7F5F888A5C208856469F9B0252D02B3C6EC8 unzillafatima
889,566,191 *5C83E7AFC168EFEE252A28BB70DF593E633E0AED UPENPASWAN
889,566,192 *5C884A9ED5B58809AB213568768341817ADBCCFB SCHOONOORD’’
889,566,193 *5C8F0C92F0A5243C85BBD86D481AA892E8D99FDD UPS7493
889,566,194 *5C876616903661F084701BF79214AC11099ACE16 USMAN.SID
889,566,195 *5C8FA64C083CB570B0833761972587948287C3AE S}E&
889,566,196 *5C8BA5686B6B02D68921D35E9280536552AC09A3 [email protected]
889,566,197 *5C869944B1CCA2134DA51E28516E8B5C42B352BD UUO~d3
889,566,198 *5C87EF5568955FBB86FD6070948A9334B52D4066 ÜVEGIKON
889,566,199 *5C88AF434009B2C85682B967B44F2CB7BC78F732 SEIMOUR5
889,566,200 *5C8A60AC4FFA9E93BC1ECE23878692281A8EB27B UZOMA.ANUMA.GARRETT
889,566,201 *5C8C51F8845B327E60F3AE1D3BC585FC5D751B3E September14,1998
889,566,202 *5C81BD1FA767BB9B53185D5D8E0FB844F5F0DD2B VAIPANYAVP
889,566,203 *5C8CCB567710DB7B7F60D22D358C48DA9586818E sethdelapena
889,566,204 *5C82E1D6CD66D3E8E14B7C74CF6F5C703B37D613 VANAUSDALE2
889,566,205 *5C865AD4252F88A25A699593459A027EC7C02AAC seven-elizabethan-lyrics,-op-12:-i-weep-you-no-more
889,566,206 *5C8D3F9C670830B661587097EB0A1E454E53C7A2 VANDTRNSED
889,566,207 *5C8C4B67443870A1E11B8BF7C98951C6E790DFFD vane.eftimov
889,566,208 *5C828B57F2778A5D3F0C70C12B79B178033B230F SFBLPNC77
889,566,209 *5C834F040DA8643BC7E05CE08621FCA956CF3FB7 van-keuren
889,566,210 *5C83786CAF7D1F40FEF35D8141ED2B8B3953F4B6 sh311in
889,566,211 *5C8A9A3AD2CEA26D6F2DA1E6AC381ECA21D5803D SHANE.LAICHE
889,566,212 *5C82E23ED6728D43855588BF5891CB9190D57AFC vastijinom
889,566,213 *5C8FC97916F8747C03361D14CD4AA26FBCF877DD vaughnschiro
889,566,214 *5C8A5CBBB0825266F034950CAA0175E64680A159 [email protected]
889,566,215 *5C83C0C7E8C128E57915E2B7FBB16345B6EF0B6B shawna-mccracken
889,566,216 *5C8B11188F1FAC260483B0B303AB5C9BE825BE71 veritistic9
889,566,217 *5C8F399B9B2FAB168313414FB0ECE63F25B072BA SHETHUS
889,566,218 *5C83E9ADFECDBB34A568E23150D9C8E63137C117 VHINZ.PARANAS
889,566,219 *5C8C7D9498A4CD7082F9C198288FF6B05E2897F8 SHI釋
889,566,220 *5C88BD1F57DF8FC22DA0BBD46EB969188DE518C0 VICKIE.LYNN.GEIST
889,566,221 *5C8B8076DC865409F2F65C68B6458632E8E6EBB3 VICKIE-MOEWS
889,566,222 *5C8D1CF9FD59919BE6964AAE45EB41DB6D8BE9EB VIC SARANGAY
889,566,223 *5C8477F0D099893AEC00272DD44A08215A0DD192 SHREETHAPA
889,566,224 *5C8C3DDFCBBA3E1DF8BE7A5A7BAEC05A3BE8C596 VINCENTDEPASQUALE
889,566,225 *5C88708819DC31FBA857ACA755990AEA6484DFB2 VIPYNES
889,566,226 *5C8BA0FCFF99E61BB19AA453299C3BBA5C0EF064 SINGINGFISHES
889,566,227 *5C8FEA2D0D74EEBBF04C972AE3E75EA0BB8C5D13 VIVIENNE HUI JING XIE
889,566,228 *5C857D5B54ABCD199C209952A98FA92FD521FEFC VKOTIKIN5
889,566,229 *5C8A8D382431334191E0B3919B32D19D2B63BAFF vložených
889,566,230 *5C8C178FFCAAFC1832CB3B6C7776AD352CB52B80 VNINGSVARSEL5
889,566,231 *5C8D139D2A5AC2A6A3CCED59A9383187FE983C87 vnof
889,566,232 *5C83987C7549FAB43013BD5F5628660E7366CC28 vrslggvr
889,566,233 *5C899932F31002176396CC10AA492E40FF5C9B47 WADIH-LUBNA-HADED
889,566,234 *5C85C0FDAB92440DD0981ACF0631BA44F6FBB6CB snowballsunshine
889,566,235 *5C861AD2A037C989A4FF7BEFC9644D23992C1060 waltonlassetter
889,566,236 *5C8D86C0ACC51BE646769C147BC58FA37E09F394 WALTON.MCFEELY
889,566,237 *5C8AC3E656B7079007A1F4840C2BF436D554F95E SOLOMONROBINSONS
889,566,238 *5C818913E05514EE1D0B37F226B9B2397495551E sommarfest
889,566,239 *5C8462A3546C75A50F8704209DA3D69405DE0CDC sonata dmoll, bwv 964: iii andante
889,566,240 *5C834C687FE4244A9EEB80D66BCD08951562FA35 water-/-va-pensiero
889,566,241 *5C83D6DA1EC12F2DCB89921D91CD680FF03FD71C SOVERLIEBTWIEHEUT'WARICHNOCHNIE
889,566,242 *5C8FB16F2000BA264AED4B8A1ABD0436A4C52650 SPENCER.DITTMER
889,566,243 *5C8976691C3B51D315AE60B83885B22AFCAF08CA [email protected]
889,566,244 *5C89316F191FB1997212BAF06A4130B33B9E5FE3 WENDELLSIPPER
889,566,245 *5C8A18573974EBCBF2FABB9CECF7413723B14654 wendy.beltejar
889,566,246 *5C88625353A90F0A893535A26C9D4FB91EFA1536 wendyvinisky
889,566,247 *5C819AA7CD419918237CC2585FE0B4FD6AB8C3C6 sportfre5
889,566,248 *5C872D457E5BB72E6F8F59FCF8BF4138AC8608B8 staceypluhar
889,566,249 *5C86A2A8FD2BB23DF7682470BA2EEAA2A71E51C4 STALAULICAR
889,566,250 *5C8828AF828A1880B480C62AD87F471C376981C3 wilberthockman
889,566,251 *5C8159C47F807F1A405115A60B9CAC4789C5CC13 wilburnroybal
889,566,252 *5C816D7E79F02A40BC40A5A564706D4C6BC53838 STANLEYBOISCLAIR
889,566,253 *5C8387FB9E721E7535FE9F2A2420D2603EB18A23 WILFRED.BIERNER
889,566,254 *5C8C28CD6D71DF79E034DE32AE2C18EBEEE9FDF6 staphylomatic7
889,566,255 *5C883867E94FB47DBC07940B2B10DC5B7908C6D5 WILSONMELITO
889,566,256 *5C8A4222E18C4D870944B98D59364031EE54ED8D WILTONKOVAR
889,566,257 *5C87CA10A908454C7321DE39F1CDF40439269655 STEVE.VEJARANO
889,566,258 *5C89FB369FA0FC2BBC88BB0AF660EE4B2BD1FD51 wmrk10
889,566,259 *5C8D17AD33E40272A5B2E5537A9CBBB4FDFD0B0A WM.WEDMAN
889,566,260 *5C8363FBA2A8FE1E5200F5DE43426E57D27FA846 STRAYD33
889,566,261 *5C8845620D775D06C514ECF1459D9E21CB2E5DBE STRIGLIAVOS2
889,566,262 *5C88CD998CF85021C5F720DADBD7F64E2210E10F STRING-QUARTET-IN-D-MINOR-OP.-POSTH.-D-810:-ALLEGRO
889,566,263 *5C84358F92F71B72274CCB9B81920E3309C3C6C2 strohosting
889,566,264 *5C828CBC5EA04B8C354B08828CB997C690861921 WORLD.CUP.TRAMP./.GOOD.NIGHT.FANS
889,566,265 *5C81B07287F7C6ACE413C748867634193E8B9FC1 stúdiójelenetek
889,566,266 *5C861BEB06D5BF9B63AB617BB1EA9A324AD1A3FF SUBURBANIZM
889,566,267 *5C8FC8A702D94ABC518D880ACFA2CF20ACCC8364 SUCCUSSES5
889,566,268 *5C81AA28026ED243118BEA34F7696DF39935D72C wwwdienersdorfat
889,566,269 *5C8FCCC7FAC5210B9A1C9AC0D237AD1DE64C205C WWWIRISHFARRIERSCOM
889,566,270 *5C85E543FC1B1A23FC35BC2AA0183FDCC06B5A1B WWW.IWRITETHESONGS.C
889,566,271 *5C8E74670A7C7190BA3D0B0698FBB8243CE6FABD WWWNERIACEPAITEPUS
889,566,272 *5C88BE1FB5D73C825B0146C680A9B7153AE67668 WWWWEATHERCOM/PETS
889,566,273 *5C81B159DBC37AE429345DC1B3EBDB8B44E40B7A SUNGRODIQUEZ
889,566,274 *5C85DD1744BCBB5D098DD1ABFAFC1B3CDDD2302F (X)-*@=====3
889,566,275 *5C8E444B0B38D4A44F5E8AE05287F6D99FFC3DA5 SUPERINSPECTION
889,566,276 *5C8EC01C4A9C92DB632414FB5C347885322EF627 X5HO1L
889,566,277 *5C89136DC3C042D09B647F2D7C9CEF754F370A66 [email protected]
889,566,278 *5C81CBD25DC794AC99D1F8BE869683C7ADAE336E SUSLOVN4
889,566,279 *5C8AD36CBFB15642501FCF31F2C7B56B51492FEB [email protected]
889,566,280 *5C8FA1793E79EA8D269A6AE599C0305E45B0E60C SWYNKYNGE4
889,566,281 *5C8015D47A53182153ACBB7B409008C60FC6EB61 SYSOP-MOVE
889,566,282 *5C8E7C21E6B2FC1D18966F17A6BA0D68E63D3DF7 xU~
889,566,283 *5C8E60D12A931103329263C98E9A1DB423CBBF08 [email protected]
889,566,284 *5C87915ECF1F5038835F65DF7B13A656076C2E6D T3K5T1P0HJ4153N
889,566,285 *5C88FC58B3791B1A9D099666F05904E4EDDB49CD [email protected]
889,566,286 *5C84F1609FC6FECE9B0F98E2165DA41C37329E65 t6av
889,566,287 *5C8F86CE95F095F312F1177DFB06E6F2AFD90F4B XYZHAO
889,566,288 *5C8CA7D5A957CBF18197760F838EC350AA718DC3 yair831
889,566,289 *5C83473DE318CDBADBF9E0282C7714F118EEF3FB talking underwater
889,566,290 *5C89CECFCE5E130197A8600D0B6490162FED0E1F TANNER.PENNEBAKER
889,566,291 *5C853FEE505960C8DA74028176CC8FDB6A1E09F8 YINGDEE LOVE
889,566,292 *5C85918759130A9C886D0F974FBA9DE93E0B1D5B [email protected]
889,566,293 *5C87BBF7C2DC0ABEA3026EDBD8BBBFBBA9F84FB4 TATISERONSES1
889,566,294 *5C81A63385DD7E1EB1E29BAA4A631535665C651A taylor)而不是维多利亚·马纳洛(victoria
889,566,295 *5C8D177529C64B84ED99E3ABD672EDC0C524BC40 YOUKRANAR
889,566,296 *5C805E6A1B7C6972E2C00B3AB3BAFC3E0C56CA51 you-say-france-and-i-whistle
889,566,297 *5C8C8500D94B00958CC207976007E589902F0040 [email protected]
889,566,298 *5C87CEE39B30560CA73E57A1DE5BBD79487DC79A YUAN RAYDELL PEDERE
889,566,299 *5C89877D64DA3F14909942E871EF7398A66C48F3 TÉRDSZALAG
889,566,300 *5C8275FF3C19D8E038ED3C551926624B4F985002 TERMSOLUTIONING
889,566,301 *5C8C9E2CE9E1157A9AE9BF5A3F04805614D1CDC5 tetanus t eh1 t ah0 n ah0 s
889,566,302 *5C8B2C39CF9230D81470679E2E0DF3B4F3869922 [email protected]
889,566,303 *5C80D96198DCF754591D03811803FA22B983FC32 thcrtsch1
889,566,304 *5C8EF9A5F66475417CF8DA54CC741B4064713B39 THE.GETTING.PAID.WALTZ
889,566,305 *5C8E413D09F7D1CB711489FE84A24D425C4B467C theolsen70
889,566,306 *5C89B40288C94CBF899FED45F6741E7D722F60B0 [email protected]
889,566,307 *5C8D5FE66B556A0971C76F1673C1E7FE8CEECC3D the way i love
889,566,308 *5C83A28084E4C98DED6C927510453EADE8135A59 [email protected]
889,566,309 *5C875DC7E58DA559AA7867DE6BFB8DE42FA47F4C [email protected]
889,566,310 *5C8EF1B3025FC2F6BAC0FC06F32A4F67B62AA4FB [email protected]
889,566,311 *5C848BF5F59E173651B64206756D129AB39AE4DF THURMANRAHEEM
889,566,312 *5C8DC0C6FAECDF465694589F6D649DC436C812DD TIANALAB
889,566,313 *5C8A8E167A8E93DAA2236C614423E05C2EA8E8C6 ZIERA.PRINCESSDIANA
889,566,314 *5C8E1650F48841C38786910F7DB12F794331F732 TICO
889,566,315 *5C80CFC3EBA3DAA2631688F2A432847971EDD5F2 TLEHCEL 1
889,566,316 *5C86BEC0D6BDC1631CC07085F67A1C222EAFC781 [email protected]
889,566,317 *5C867FF909CAA4F7A925C4988CC0E9F5DC335E89 μεταμορφώσιμοσ
889,566,318 *5C8CBEA9D73095676CC5CDF07AE2CC2305E7CC3F TOLLAGE
889,566,319 *5C8DDB2C2149BC554ED81734A0CBB0CA67B21FE6 багнари
889,566,320 *5C80F34B8AC1D12C95C65C602AEFF1A3D825F439 TORRE.ATALAYA
889,566,321 *5C8977A710015BA45451E646713B21D566701B7B tOy
889,566,322 *5C8D1AAD8E6BD698B90322C40DE4894B3DD3E7DF КУМОВИТЕ
889,566,323 *5C8ABC5F80FC2A8BF0055E8E1D2EF7DF4615A288 TRASLADARMOS
889,566,324 *5C81DB43E0B94D8053C188EFC8BF64AF419D348E TRAVELCRICKETS
889,566,325 *5C8CD27095B8A74FC8AE1A71A280EF6F5A425A95 trentongabrelcik
889,566,326 *5C8640285C7661D511B5BB9A1ABD54080535BB3A trevar.scott
889,566,327 *5C813172433204323FC2A4C295917D0F400266AB ПОПРЕСОЛЯЩАТА
889,566,328 *5C8E7529C4BAAEF4613FB0F7CAADD4343DDC7253 ПРАЗНИЧНЫЕ
889,566,329 *5C810676E2E68B20B92697201DC7938E4D7106DF TRT010G15
889,566,330 *5C87B7467B623C8882B7CF255562C5154F3C2CB4 TRUMAN.ALSTON
889,566,331 *5C8B66D3ADA4F77C5F6805CCC1DD1D8A68EB6AC6 «СРЕДИННЫЙ»
889,566,332 *5C8C12E73E443BFBCCDD49FFBE0324AD8A1E2C5F СТАЛЛМАНН
889,566,333 *5C81B675921B1BD8A15B1A83157AA18D9F92BCAC ТАБЕНСКАЯ
889,566,334 *5C8E6EF1B5C1B86F03C6DE169495F05F30058968 TSUKIHIMEN
889,566,335 *5C82B191C8722BC7AFAAE341A4B192EB36A973BC <TT>$STRiNG-=~-Y/a-Z/a-Z/;</TT>
889,566,336 *5C8A50B60AD59710285ADCD70A630354499E512D @#TURNOVER
889,566,337 *5C8208E22BE7568543A727ED3038300E874CE04B tv-time
889,566,338 *5C8670F0D70D8E8D6C296D32244523D5AE6C1654 TYNEASA-RICE
889,566,339 *5C8917988B9884461DBE722A06C30832D903B063 tyrellsaldvir
889,566,340 *5C85D9D00E910B06287A3A0AD9C50602C9FA9BED TYRHA.CYRHA
889,566,341 *5C898E293AE6822B91DF4EF4C06B068869C3E69B tyssivked
889,566,342 *5C8D178FFF065F69FEBD6B1730BFD617525BA948 [email protected]
889,566,343 *5C82032B9A90990FD9711AB4424FF59BDCD7930F UDVANDELINDE
889,566,344 *5C8DC1A92C7E88CE60C7143A7B7D50AA5B61DDCF である。推奨テンポは60~150BPM、推奨音域はA1~C4
889,566,345 *5C822F9DA23F90DD7B456BD5F1331B0862478DB7 uuo~0~ (=3
889,566,346 *5C81A34305991056468BDAA6E875580AA4CE86FD U;ZU
889,566,347 *5C8A400E6A5C9F3AAA9EC6AC26DB06BE0AA76033 vanidermglutathione
889,566,348 *5C88FAD66632A81D629174E1F3B6B18FFD22D400 VEDLIKEHALDS
889,566,349 *5C84354EF5D4EC711505CD8FA0DD44AC7F1FB0EB VEXBNTKM
889,566,350 *5C836034761E777F6D536AC28E8EE2ADAB480C10 VICTORIA.GRACE.BRENNAN
889,566,351 *5C8E7D0238D0807EF253D71EF05B84C79ADFFCAD VIMAL-GOVIND-KARTHA
889,566,352 *5C8BD3FD9BE49A91F1D465DBE710DDC13C860992 04281462
889,566,353 *5C805068AF87FB53D3E61C81E8F03E304593A2A9 VIVALATORREMOLINOS(MILLENNIUM)WITHIT
889,566,354 *5C8723E0F78B30B5BD8DD6C5C7CCC8EA7E69FC28 VNLJBB
889,566,355 *5C8E0E4FB6689600A48FF7DD6DFF8D18BDD36B00 VN、VLA、VC、CB、FL、CL、HRN、OB、FG
889,566,356 *5C84FC6E8C35DAD1996F56F732C9738E2B78D313 [email protected][email protected]
889,566,357 *5C83345D776266D4B1085819BD93A3F9E2ECB7E2 (0_<).o~o~(b
889,566,358 *5C8A354B201711ED4E14FE2D6B3733F80B346BE8 wadevilar
889,566,359 *5C8AD2934B7DBA2403F31FEA64709B2F2BF773B0 WALDEMAR-DYCHALA
889,566,360 *5C80FDF2BAC3ADC196541D554C12E3D35B297EDA 1225DREAMS
889,566,361 *5C8DE19FCF74AEB2C721154B09117397D3B51751 12-n
889,566,362 *5C8A0C35F078E17B19E9ECAFAE84C79F53CBB452 wässermatte
889,566,363 *5C82838CBB87C2F8478301A41C6254EC3C9CA13D watistee
889,566,364 *5C8D203C05F5993D922EAA311E0AEE4F9E0A2C50 we1gh7le$$ne$$
889,566,365 *5C86B2BC86D95CA7BFA4C9B1984DC3C2580F65E4 webmaster2006
889,566,366 *5C8AAB5CBA40058A646B35D8FFC3997A81AFE288 [email protected]
889,566,367 *5C86272E1F3010C7BFABBC97A30E47AC4EBAA115 WESLEY.CHILTON
889,566,368 *5C85255A49DBE2158DAC36D49192DC72B3C16E7D wesleytirrell
889,566,369 *5C8F3F78DCCE9280A4A5D1C91FE4E1A32D1B7B00 WHAT-MADE-THE-BABY-CRY
889,566,370 *5C8FD0F0FF9836E6A49210B279DBA536F7906B82 what'sup(radioedit)
889,566,371 *5C821BA815DE53AB1CB1E1C0158E6EBEB9BD833B widerstandsaktion
889,566,372 *5C8C089275A988083CA56032FFC926ECE6818CF7 WILBURN.LATTIG
889,566,373 *5C812A03992683B86C9A5B99FCF0354990E79819 1-d'urbanos
889,566,374 *5C893F3C88F401E04EF4598685C71D6B27BE2B69 WILLYBESEN
889,566,375 *5C819480AF50356EB75A0911EAF983010A2AF18D 1-GHOST
889,566,376 *5C834F7B74049E967D47DED8FF7C92075CE45A03 WISNA.WISNU
889,566,377 *5C852ABD72CFD0AAAAF9DD7C6A56DC5346A88AF9 1jerry0
889,566,378 *5C801C997608CE418A141CF693A29263433ADA4B WOODROWDYS
889,566,379 *5C81C1AA6047A20027D0C1930CC4F7E0DCF6A3CB 1.LAWANDORDERINNENSENATORS
889,566,380 *5C824C834F141B6867A2D104B66F9ABD6C979362 1macht-geschichten
889,566,381 *5C801CD16A0FE2CD95816B70B9B8F84C0B541C04 1-MANNSCHAFTSUNTERSTUETZUNG
889,566,382 *5C83735A2CF1D5595BF885BFBF04B3AEE1A03D4E 1.MMKISAPAIKKOJEN
889,566,383 *5C8E27AD22BE8EE34468FA614D1E372A02F32F95 [email protected]
889,566,384 *5C83BFE4CF90E44C0C503CB2BDF18812C7069DE4 WWW.ESCARPMENTSOUND.COM
889,566,385 *5C8C6BA5CF2FAF0CB37A8F0373606370675A5CC1 WWWMAHIYAABCOM
889,566,386 *5C86C13990F84131A00FA34DBA0E6811090A241B 1.parsellerindeki
889,566,387 *5C858AB5E2138D8CBE2CA2E45F3ECE29253B2D0F 1PETULLA
889,566,388 *5C8CDE9DF6A7909A87016CAC323434B0A4DAC591 W型、W
889,566,389 *5C890F203938AE67B0CCBED083CC0AA4B643DF8B )X([email protected]#####B
889,566,390 *5C8E6C67F92D55B1C502FD1A6B897C1C29E984FF [email protected]
889,566,391 *5C84E1A9D1BAD6546C011D413A3CE46371074D88 1-sotatoimissaan
889,566,392 *5C894D5948E623B7B60EE56CFCAF0E2A7A8E02DB [email protected]
889,566,393 *5C826E4E67AB5E7E5369B28407AF4AB784356858 1.stiftungs-mitarbeitern
889,566,394 *5C8237CEFC9D4A6A80DC22BD9CF629B8DC6688ED 1STIMMENFAKTOR
889,566,395 *5C8A08054BD835D53E6580DDCAF77DFF08FD62B6 1 SYNKRONIA
889,566,396 *5C86A72E83B7DE5CB823A6E93AD9C8135FF7DC0B xinsin
889,566,397 *5C87C5C2F6F62C17AD324B11E2A9216938F243AA 1UNOTTAA
889,566,398 *5C84D7E9C6404B4075BECD1BC7A56009B9AFBB5A }X{O~Q##B
889,566,399 *5C8E88F65AF4AFAD6B115E9BC1F5187ED849EE81 1-WIERMAN
889,566,400 *5C8F602181AC357D2239CBD7FFFDB4747E74E8D1 1yerleskeler
889,566,401 *5C8176C38E08C6E38A20AFE932E110CAC6DFC952 1-YLIOPISTOPEDAGOGIIKKAA
889,566,402 *5C8FD4F7F4BF14994ED6DB00739A88D6855A450F 1 YMPARIST
889,566,403 *5C85968F9BFC7C8F9128C698AE8677B917824FE9 [email protected]
889,566,404 *5C856D682858834137A2377CD8BCF828FCE1B16E 2079962 asiakassuhteenjatkuessatiiminj
889,566,405 *5C80FBC80D1EACA037603712E05048B4728C7DD9 2086860 DOCHESGABAUCHANDEREANSICHTEN
889,566,406 *5C814AD1800D2E486696A7203702AC0232AC413B [email protected]
889,566,407 *5C87F331391A5B83452091C54834C1AE47DAF1FC YASER HANOUN
889,566,408 *5C8796E9731A4652CD9850535644C32295CE10D9 2424420 'WUERDENWIREBENSOGUTESCHUELERSEINWIESIE?'
889,566,409 *5C8C51297111F951DE70DDDEEA9479808C985D96 24august1422
889,566,410 *5C8C34077C0EC5FB3DFACAAE5904EB8D9A85644D 2516021 paikan-valintaperusteena-on-ollut-riitt
889,566,411 *5C81034CA4E3A5410ACC9AF716DE8D1471E38658 2627808 TY
889,566,412 *5C8DA498F712AD917EE14D6450BFD84DC78E9C6D 2669172 PERUSSOPIMUSTA-VOIDAAN-MUUTTAA-J
889,566,413 *5C872F3F1CEB5B5B815D2834B5B62259B0BB1043 2777754 VIDEONEUVOTTELUTEKNIIKAN.OMAKSUMINEN.OSAKSI.PERUSTEHT
889,566,414 *5C818D03D3C39BB9F597C00B94836D3DBCBC2C3E yogenfruz.froyo
889,566,415 *5C82504A6BBAEC872C0973B101557B55DAFD7483 YOI
889,566,416 *5C8291979862AA4B133675EC6837210079A9315E YOONHEEROH
889,566,417 *5C80AD54D50FD5A1CE699328957BBA47B17C3D8B 2-accor-konzerns
889,566,418 *5C849264924E52FE98E35E853E6FAD5AB7FE819F 2ALTATTA
889,566,419 *5C8C0D78455BB1C5F217292327E8013093607399 2anti-rabin
889,566,420 *5C8437F2359EAEDA2EA1DC8B3B6BECA278465C33 2BAD7HAC8GHBYE5TJYWODRDKVLGRUTNTAI
889,566,421 *5C808FBEC9EDDDBCF8A2638428BFFB91B6B28249 [email protected]
889,566,422 *5C849E242EA4892D60823FC8225585F4EF0B5AAF [email protected]
889,566,423 *5C8AF28F7F32FCA01721AB7B371253893FCD0D14 2FMANPROC
889,566,424 *5C8C9AEDCC4A177139965E89AC576987725D3D99 2-for-the-time
889,566,425 *5C80509871CC762E2C795C5F0E0BCF5F66F14353 YVONNE LABUSCHAGNE
889,566,426 *5C82DD7F9728F4CDFCD22C77B00F69CB09DC29EB ZACHARIAHANGLIN
889,566,427 *5C80FF5E55BD57FE5893971071D1301DD6D52FEF 2 KUNTOUTTAEN
889,566,428 *5C832520B20F882A485F636348F260FDF32ED812 2M4V08VWHK
889,566,429 *5C8BC07B1692B742019F267AA06DC34FDDEF9940 2 palminizdaki
889,566,430 *5C80200A18F0AC037E2C18028D7E5F16056C8BAC zane-sibert
889,566,431 *5C8F542941E8AEEAAC35E0C172CC6C9759933B75 2STAATHUI
889,566,432 *5C8A94B4193469E9303F13FC441AA118F36BCEDC 2TAIVAANALUEESTA
889,566,433 *5C8FB8F3AAC66EA1B82A6BA21FBACB572EF838BB 2-thronfolgerpaars
889,566,434 *5C87893CE2EE92CD853356B0A70E3C3CD9544353 2.tiefkuehlmarkt
889,566,435 *5C8C465462978BC5A91852FEC0748029B12D3567 ZC(Y
889,566,436 *5C8C0A29868DF39A96F365787431902D454B1354 2ZAK
889,566,437 *5C8B7C59FBCEF6DF6BD5B665F5AE68929876B7D8 [email protected]
889,566,438 *5C8AE5712A37EE2CB17656386920E478E2DC353E zhzmsuikemqzjafi
889,566,439 *5C895364C588FB0690F0FF2AE7577FAE88A440D6 zippo2001
889,566,440 *5C8E017475F471F46D77ECDF49A2F40B37E15F1B ΆΡΛΗΣ
889,566,441 *5C81B66804C10D7353AD7290AFEC102587F0786B 3SIKSIH
889,566,442 *5C86FC97CB733CA907316C041BE63C8DF92EBC75 3SNEEUWHOPEN
889,566,443 *5C87C7660F1EF2C95E7561EEFA8802B11DDE50C7 антиним
889,566,444 *5C891C807FC7F5D7AE3ADDC14BDFDF53F84C4381 48-asennuksiin
889,566,445 *5C8782C0349F4571832432A64069EF6BB0728A5C загребєльна
889,566,446 *5C896B05885D205C8312F9920BDFC749C4C6C8F7 4GRECHKO
889,566,447 *5C87722F266C04F8C8A4E53DF2B961133BA27695 ПАСВИКЕЛЬВЫ
889,566,448 *5C89DDE6AC9579E064288B66C11C59ACF7324118 于1937年采纳了RAMSEY的观点,将之作为概率的频率解释的一种可能的代替。
889,566,449 *5C8EF133071A5905173A4A9B14134FAF5C0F4409 4VEROKAPI
889,566,450 *5C8B5E8994B7A209269BF7D5FA56D331DE354A5D 5 BAMBOO
889,566,451 *5C84B112CC54DCB6C3CE23DC33F77C0A934342DE 5BSWBAIKBSW
889,566,452 *5C8063BE3A0E31E1563E429A0368E866F9E4F641 的小镇子。他的父亲是ILYA
889,566,453 *5C816A2B7F358738F08662F5F1378585040B60E9 5FIKELYNG
889,566,454 *5C868FDED17CB588A1C79B7B6A36821311A874E7 5JACKVIKINGS
889,566,455 *5C8AF6D06B8B7ECA3B5A5D8114D58CAB0582EBDE 5NORVAXBSW
889,566,456 *5C8A8CAF70DAA44DB6419D5AD457693F3C8C9403 5SALTARELLOS
889,566,457 *5C8219DE1D3E9DBACC5F17FB99D9474886071716 5SPECIALSUZANNE
889,566,458 *5C8BBB496074C761F4CEBF602B2C70ECD5AE174E 02k844168vml55
889,566,459 *5C8A048F24BEDEAF09045821134394820E8D8D1B 063056
889,566,460 *5C8ED42FA7C427976455E7F3DD47529D4B79BF46 07j191tc8
889,566,461 *5C8E3698B6060E973FD40201486B97A408405B51 0BEE013316B0B4D008843A8A3F481D98 770607ST
889,566,462 *5C89347453C56F52A51DB1BCE20A7AA3526BE087 6BOOSTERTECH
889,566,463 *5C8E36E582A701194759F8F75857C6ABEFA3797E 0scott11
889,566,464 *5C8519A1DD123F275CD529E5296128EE8B2721A6 6FLLESBILLETT
889,566,465 *5C844EF468214DA0EEF3D8BE375DF5C729109079 6GELLOZER
889,566,466 *5C8CF5A4794493E72444C3EC94739486E0127383 1193416 sitten.homma.hiukan.rauhoittuu.,.mutta.s
889,566,467 *5C885E9618B2473BB88EE0221AF53BCE26D41CAC 6ILUVTATA2
889,566,468 *5C82347DB95B2E6894CBF7BE970EC833D235807D 123MEGA
889,566,469 *5C84247507E70C44A46A0A42AE4303E1CEA17E35 1241755 VIRUKSETKEHITT
889,566,470 *5C8E26CE02DD46E0492CA12B52CC8E81CEA34110 1349269 VON WEGEN . 33 . MINUTE : ROESLER SCHICKT LEANDRO .
889,566,471 *5C8A428E20884767A141E0B74D242C128694627A 1375233 vaihtoehdotovat1=p
889,566,472 *5C85AE8EE2BD2909B32B7377C5DA65EB0E581FBF 138659 sIcakhemdeCoksIcak.
889,566,473 *5C8B161C5BFA086281F081BB92DEFC99A5165210 139080 ei.ole.ollut.juuri.koskaan.eik
889,566,474 *5C897FD2F7969B99CEC48BD40C5637676E097BA8 6MYNEWYORK4
889,566,475 *5C8EC3F2D80AF7CAE118CD4E7E3DCE5B8A4E0CC8 1553885 schoneinvertauschterbuchstabegaltalsfehler.
889,566,476 *5C8978A85A6CC3524070F5F618E7B3849742B536 6ROSEMARINA
889,566,477 *5C86079D8A6809E82983E70B069B926C5C05F5E7 1639645 ABER.IM.GEFAENGNIS.WAREN.SIE.DOCH.SICHER.DER.HELD.?
889,566,478 *5C80A4E9CE218B3338434AD5503EC371E7B6AB54 1655921 DIESES URTEIL BESTAETIGT SICH AN ORT UND STELLE .
889,566,479 *5C8650F798A377607B9CD1871008F45F4F628E3B 1700502 DERANATOMIESAALINDERUNIKLINIK.
889,566,480 *5C85BFA6B406B57CE1FF8B60DC3EBDC9A5FC4F53 1725069 muistamy
889,566,481 *5C88519C6C1330AD6E3A7E7D6273E17E18BDEE92 6VITUPEREUR
889,566,482 *5C8D011EB5AAE6ADCAF095D5A0D336F3C0B1B17B 73ND3RH34R73DLY
889,566,483 *5C8B30D4CA9F59CB9DC7B4133D6430E9FD2EF415 7ADAYSADAYS
889,566,484 *5C840F3292367318FCE5B94F4D077827B350F5DF 1ARRI-LASER
889,566,485 *5C8BF7DFC006BAF7F97E99426757C2977D1CA1AD 1.BALKEN-FINALE
889,566,486 *5C867FF61029AC6390FEAF18C5BEF19369DE5128 1BGSMTWTQ
889,566,487 *5C847D985D84DF9AD0312B645203EFC505CA8649 1BLEEPT
889,566,488 *5C8CA5936378FD8745A89DF3013A90A3ED962E96 1bonadio
889,566,489 *5C83B32D58B3D8ECD3C54A5EC2CA7635C31248A0 1DELTORJAEGERLISTE
889,566,490 *5C8DAAED77523038F216A153CBD42E0483BCC2A0 1.eetterill
889,566,491 *5C808C1FF45168107A808038CE95E1776BFC0134 1.ELSEVEIR
889,566,492 *5C81BAF86FD4EFE1E8DF719F89676CDDECBA0F6A 1EUTIQUIO
889,566,493 *5C8635D4F1925BB74E4FBF336F8F24AFE198C4C4 7DEANFICTION
889,566,494 *5C879299F0427161138FB6BAA071409FE53A2547 1.flatfloored
889,566,495 *5C89A3EFDD2DE2804637E681D6259680462BF52D 1 GRENZWAECHTERIN
889,566,496 *5C84E8A1F99848B31DEC20C911270A4E68E6B41D 7LARRIELARRIE
889,566,497 *5C8C3E4D75E7E91DF5605A38AACE35EB6591A7EB 1IAMWALDEN7
889,566,498 *5C8ADCF817C2F3534F12E895AC8591D3CBF1C8A3 1ILUVEAGLES
889,566,499 *5C807C0C51110BD618ADB536FCE22769CF94F3D7 1.KIEZ-VEREIN
889,566,500 *5C884B9942A16A8AB491761AD11FBA37922531AB 7POLYGONGRAPHIC
889,566,501 *5C871056EF7ED4638CF065D7A4F3FFA6D7DBBF05 7PRTTLSN
889,566,502 *5C871BBD54D6A961875880FED369E23FF6589AB9 7RECEIPTSNOBILITYNOBLE
889,566,503 *5C8093B5B62CE2C658A4C9F6A8A39C7B11F0476B 7stijfster
889,566,504 *5C88F3A4EF317FD1EABFD81EA65BC137B7B20712 7.WINTEROLYMPIADE
889,566,505 *5C835421BF1DF6989994353A0C97FBD3E8E1ED82 1myjames0
889,566,506 *5C833AA431553E24BCFF5146905F61484675B32C 1.PaRLeTT
889,566,507 *5C85A0C5AFD9C7AD0F5D6EF4ECDE4A0F86C19D0F 874234 LUENNOT PERUSTUVAT RITVA HURRISYRJ
889,566,508 *5C8152C04539C79B202BBB0E42FB6ACC3BF65DFF 1-PUHELINNAUHOITTEENA
889,566,509 *5C8510E7F326A26B3F8101A7EA828D7F5A5C7E80 1QW23ETIGER
889,566,510 *5C854D390683118FDDBFE79C1FC949D0FC4CAB28 1-singereni
889,566,511 *5C8643A65930F327D6AD7590DC28A9C8423E5901 1SUEDIRLAND
889,566,512 *5C81A3872234DF49EA3917E1EF626F693016B9A4 8GIBSONSEVEN
889,566,513 *5C891A8993C062813C3F537622A073AC39B7931C 8ILOVESNICKERS3
889,566,514 *5C8D3CA3BE8085E9A7A2DBB9A16B61BD9E36CB89 8INGRAFTS
889,566,515 *5C8D61D246950BC2CD71C9205F4E35D1D711C039 1USAUOYK
889,566,516 *5C8E8C8174F80751AA377133A68B1A3D9DBA8F1F 1vehicle-license
889,566,517 *5C8D5AC876042D8DDD34FDE0561607CFAA3E8A8A 8MIDDAGSTIDERNE
889,566,518 *5C8D87BE841D98EA12649E3C585DDD4E7B673A00 8MISTERMI
889,566,519 *5C8E0DCE4A10845E1DC66F1B61EB1961F68AC980 8OCKBROOK
889,566,520 *5C8656D84FAC12FC2D5E63251BB5910D833B8B10 8OLIGARCHICALLIES
889,566,521 *5C8FF38A2F001AE95BEB050DF0D7C59872441763 1WEEGEES
889,566,522 *5C8D0B73003E3E12AB9D474A54461736A6E0886D 1.westend-gymnasium
889,566,523 *5C8B208D7F43279CC056E82B826C1F505F3A73F6 1 WESTJORDANLAND-STAEDTEN
889,566,524 *5C8C97C737F7B872F9970349BF55DD88713D04B7 1-ZEHNTENPLAENE
889,566,525 *5C8D628AF0D6BEF2C0E014C9F24357432D22828F }8{~` ~`(----Q
889,566,526 *5C8D5585F73305D7E26E0B2AA0C6113C67CDC260 [email protected]*-*SPLAT!!
889,566,527 *5C8369268DFFD1DE04680CBCAB91BF1EA1FBB523 2189235 MYLLYNIEMEN-OMA-TY
889,566,528 *5C8161841E0914542FDF5AA6AA67F91B171BE562 21leotards
889,566,529 *5C8D356CCE223FF7E48A80B7A38437F61DAD3956 22322 VOIT TILATA MASRAHIN TAITAVAN JA MONIPUOLISEN TANSSIRYHM
889,566,530 *5C8B4807BCF5FB14788D492AF584F2B787159D2A 909022 uutta intoa tasa-arvoty
889,566,531 *5C883DE001C6B84EA0C11E66C11C1A7E3356D98F 915312 ENSIMM
889,566,532 *5C818551C6F32BFC3FEDCDE3CE702A141BB5A212 2397725 professor.heckmann.ist.nicht.".pessimistich."..
889,566,533 *5C8F98DDFEAACA0010E4A324C46ED5DE4D7325CF 2556949 lasi-karkaistaan-kuumentamalla-se-l
889,566,534 *5C86331BB809E5D38071DC13EB4D7B848FF562AE 9-BERGBACH
889,566,535 *5C889EADC7E922CB39E3B3ACB52CDFC580CE2421 9ECORCHAS
889,566,536 *5C83DB7C04C9FFFA6CF54983F43F307345AD1FD6 2902271 USEIN SELK
889,566,537 *5C87027BE9A0B89073D5397194146F77570A26EB 291515 und-voller-vergnuegungssucht-
889,566,538 *5C811DE7DB352471279102B85D5121BDC560BE3F 9GENTLEPEOPLES
889,566,539 *5C8765BEF36A82596966AEC7F4AC1B21E857387F 2.AWOGRUPPEN
889,566,540 *5C8D61ECA010CE9216A32C2B47724BBDEE30EC25 2beabitch1
889,566,541 *5C8BCA83ACA3C7B47CE78815FEE1EE37D412BAA6 2.gailbach
889,566,542 *5C867BF193F7B74CE123F5CF9B9FE15DF887F70D 2geburttagsskind
889,566,543 *5C8A3D848D02D13E94E1F759B6103BDECDCBCC07 9RYHTYISIVAET
889,566,544 *5C874E5CB213085F99CC6EEF85A02914A6C2573B 2 LEITH-BORN
889,566,545 *5C836DB9DB27A9ECC52DAADE2D643CCB4FFBDBA5 9SINKULE
889,566,546 *5C8BF64C16B2E71D8B589E39C29252780544EFFE 9SKRLERIETS
889,566,547 *5C8C0A310621AFCD3E4C426ACA849B960AB6D1D7 9THEHALLOWELL7
889,566,548 *5C89E39FDB9C5B249565EBFE7FDAA6EC650AEF2A 9TOPCATPICASSO
889,566,549 *5C89B233A517E7220120CBD0874D304D51A54348 9TRAILERITE
889,566,550 *5C8059DA907A6449415798F93CD2C3E4FA5E4A00 2THATCUTIE8
889,566,551 *5C813E3EC32083CA32AF9EAEBC70857D374D7E00 [email protected]
889,566,552 *5C894BFD051B4CDE355E2F0CF53B109643F12A90 357416 dieservertriebswegistderbvgwiederumzukostspielig.
889,566,553 *5C800CA085A8F774AD1CE8A476E62305906F9EE4 360.business./.360.bypass
889,566,554 *5C8AEED2381E50D5F9FE7F360D3A0D6807F91594 A2SLC
889,566,555 *5C84F1F727400D81A014A200B55EB62282A525D1 3==b ~o o><
889,566,556 *5C8FF2B13EE850F29800EED2A00F261DD4379838 a8bt:
889,566,557 *5C859BE27A0688FAE464E381D1CA7049C3681CFE a8lvl
889,566,558 *5C895C5B25554369E301DFCDFFC1EA6EAC5DEDD8 3IRISHTECH
889,566,559 *5C85F513D11F93C65D7318F43EFA3750A0584DE7 3MORONIQ
889,566,560 *5C83C7045C2DF2E9CBDF4B2C9D9183445257A990 3>~O~OO><
889,566,561 *5C83B7FB7FD39C116D6F7354BF33764D640A72C0 AAC;A6
889,566,562 *5C80407E2B7DC55541D021620F43E8A8259EE606 496isaias
889,566,563 *5C8051E4AD5304027C48E615841BF8ADEBBB7F9E 499LEONARD
889,566,564 *5C89996CCB6243C85C71BCF44D4A9C7E45719980 aa_hn
889,566,565 *5C857196BB71900F4A6257D3C76AEE9BFD692B20 4EPEPESE
889,566,566 *5C8F308421D6866A4A5494AA34B302EA72CB1D18 4FLASHER
889,566,567 *5C819CFC40562AB038DC3C812130136FFC831C30 ABRUTALHASSEM0
889,566,568 *5C81CB7EFFD55C1B48E4F1D2AEF1B06BF3720AE8 AC3DIA5T
889,566,569 *5C8053929DB8CBCEB8C98A0FF663CFD55D2F4E4D 4PRESNICKBSW
889,566,570 *5C85D72C9898E76CAC5E81E84319935FB78329FB 4PYRAMIDMOTHER
889,566,571 *5C87D1787D39890465D79CD4D8839F191D97BAFF ackm
889,566,572 *5C829183C898EB4BFB9F95FA66936F56F5645AE7 521212C2-BD64-373C-A037-24518155C899
889,566,573 *5C8432E853A73D49D0E55096B2BA90E0776E0D08 527229 tel : ( 216 ) 383 85 06 dogal isi san
889,566,574 *5C8D2554AAA887F75F39C0CD1A85EED5FDFFEA65 53C084R8!+41
889,566,575 *5C8D8568C078F3D607AFC94BDC7A36D91BEB95A9 ADENTITED
889,566,576 *5C80D323FCCF1DF3DAF603B62933C7B1D10E973F ad)kp
889,566,577 *5C8EB2245FDCC5A337B22500A57591BD762DB8A4 ADOGGIE9
889,566,578 *5C88B46707026487CC6AC131D6B66610C7AEDFE5 5ANNUSATIS
889,566,579 *5C80B188F40DE052BC273BCCD83F94C11671273B ADRIAN.RICKERT
889,566,580 *5C84DA8C2C3B13C0C48E2F54AB94DAB7832331EF ADRIAN.SERENA
889,566,581 *5C8E17A77242C2DF96027C240232EE6F79C96891 adw6
889,566,582 *5C892F748334EC4543129910C0A8BDB301FAAF82 5BOEBINGER
889,566,583 *5C87ACE8969BC9BC342314C87918A106728E4BA0 ADZO
889,566,584 *5C89461041A3EF636FE61111F6001836E81B8480 5DESARCONNEZ
889,566,585 *5C85B895AFCDF035EECA2FDA33C23618D8C0A8CB aet9c
889,566,586 *5C8C067C2D8F6930DB8617EA5E1531BA3DD99E1C AFPUNTEN?
889,566,587 *5C8C9B546CC3C1F7D35BCDEA87E5858D74AB6D54 5PILVEEN
889,566,588 *5C8D4D74F2E6B5BC977DDA9B9C915398D44AB710 5RSUMLIGHETSPERIODEN
889,566,589 *5C8D779A76D3536277490ED4850F236C52E5F22E 5schulumweltpreis
889,566,590 *5C8659CC9A319B0EA79874B29DDF86523A2EA793 AGL7Z
889,566,591 *5C87FCA48D834EE0C102CE0597E125835A2F2F65 AH_7_
889,566,592 *5C8FD2B69C614DAC0087D6A99F7FA86F1EA688E5 63costa
889,566,593 *5C88EC106C5E47AFDF0203F37F23FA07B62582B6 AJAYBERRY
889,566,594 *5C86F7777B1DA1757E8264E8DDDC36B3DBC16429 6ANNEBMW
889,566,595 *5C8DBD7172431699E4B49CB9DD312102CCFAD5B9 6CHEUERND
889,566,596 *5C8E7EB1ADF8236155CA15C31814BE8BD5106A1C [email protected]
889,566,597 *5C8AE48F1B867EB0D868AD3F1ECD2D235CEB39E8 alanbudge
889,566,598 *5C8054E16BC5815D617B648A57BC95A520CD0650 albertobassin
889,566,599 *5C80F823A8E3B718C68DDBFE5165915CF2E6269C AL.COMPAS.DEL.CORAZ
889,566,600 *5C88614AEA06075F0684329A4392DB5A1B529014 aldwinyam
889,566,601 *5C8C5277CF0E9682409D4D6363FFC36FE4482D82 ALFONZO.LACKLAND
889,566,602 *5C839072F23D31A46C254887B40DD5297F632208 6LONGWOODBSW
889,566,603 *5C839AC4C8F0CEA746052028D4DDC46C68FE8661 6MISGAATS
889,566,604 *5C8DC449B78CD0E93E77F5E8C3DE470E6BF57B12 6NEDROBLE
889,566,605 *5C82FF4772B6335A835E5900185D4E78300D7429 ALKENBURY8
889,566,606 *5C85A6F8E51CE2DC62D6819063551FFA9A9FB906 ALLIVERING
889,566,607 *5C815FF7EA6AE705A96081CC5F9337CBB7FBBA3C ALLYSON SPRINGER
889,566,608 *5C8D70C282FC5C347BDC10D9E76811EFC4001A98 ALREADY-CHOPPED
889,566,609 *5C84E4B883428FC46AD4DB1727C343A2FD0BAE76 alud6
889,566,610 *5C86D1BADC8ADBF30BF2BE4CAFA4442997E1F256 706148 AN DER STEUERSCHULD AENDERT SICH NICHTS
889,566,611 *5C845289627325C0E94EC6B9AF01018207CC3C41 am%8k
889,566,612 *5C8F2B1E3089FC8A966AA6533CE2A37A19000CA7 7BEERPEEWEE
889,566,613 *5C8CC19CC58AD91C26F6D038FC03F5AA2140C0E5 amonsul
889,566,614 *5C864008FDA83E8064A948EB6F52A9D17EEEC0CB 7EINSTALLING
889,566,615 *5C8AB1539E8F72B26F778F9F3F62D8E0AFC9DECB AN_3N
889,566,616 *5C8C9169A8931EE4F7E3ACA937EA9E8826802A33 ANABEL14
889,566,617 *5C83EEC4D47CCBBA022204E51F769EDAD0652E58 7flegmatici
889,566,618 *5C8F0D268C74999347B3D41E4E154A2B7BE7B896 7GALLIETTBSW
889,566,619 *5C8A9C0EAE97D31371A1A77B84F33725C7FC34F5 7MATROZENBAKKEN
889,566,620 *5C841562E11E14908236EA5CAA5ADAB5D0541DC2 anita-crawford
889,566,621 *5C8DAD34B3EC7755E345E1413DE5861578E833F5 ANOCCAIC
889,566,622 *5C82EFA8CA9B0CF13FF91A371AA877AC9AD6C3D7 anthonius
889,566,623 *5C877ED61BA541FDDDF5012A6C119A411D441ED2 ANTONIOPSUTY
889,566,624 *5C803DC17ED983D1F5F8478DC021750DABFF9478 ANWENDUNGSHINWEIS4
889,566,625 *5C8153C1766CB6DE308C3BC06E7FB442E266F987 [email protected]
889,566,626 *5C8AD48591C8A6CD6339A962D2E61286BB764650 [email protected]
889,566,627 *5C82744509094FF3E3A73BDDD1A95A92DCF6248F appartenu9
889,566,628 *5C80F5D44F6F582544F3BF71423575880AD6D2D6 AQC3=
889,566,629 *5C8D232E37B63CAAF650B2677E089EDE7377640B ARA
889,566,630 *5C833AD2591A5120A63741150CCA936CBEB24267 armandoglatter
889,566,631 *5C8C91991CAA29F4251B7379548AFA91561BE021 ARON.GIRILLO
889,566,632 *5C860DBE47BF2972F42212450FEBA1C638EB1523 8PRESTONWONDER
889,566,633 *5C817C3A79857AD333202E75AC4EC1652635D902 aschloss5
889,566,634 *5C8996661E98550E3DB882979AA5F87B55B10BA0 ashwini-narayanappa
889,566,635 *5C8F317D7DB93864094723F93723B7DA5A7FC807 8WRANGLERPSALMS
889,566,636 *5C8E582AA030EB4E21D7469499C03EBE3965D3CB asnumeir0
889,566,637 *5C8E612FFE5732458C50FE0153A5468374DA0326 916179 ASUMISLIS
889,566,638 *5C84607CD04FCF8CAA62C60126436A87FE5D1318 a.ta
889,566,639 *5C8DCAFEC17507A111134D08EA32C2B8A999987F ATUCM
889,566,640 *5C8D36D453933B32BF22F78D205C7739BFCBDA68 9CMNZRIQVHPOUZ
889,566,641 *5C82F9D117EDE6C0CDA1D084E1D247491B3D0460 auphs
889,566,642 *5C817BF80C114673DFA038A1E04E7E9EDB1A1382 av-&
889,566,643 *5C85079353ED878E86D4EA003F4AED8B376C2EFE >B0.~.~.<###3
889,566,644 *5C8A24D984AAD23B23D64181C488BAA306CAAF83 b)0,n
889,566,645 *5C859DBC87B8A30EB8E2D2F6B8CC01EE12010A1E 9SEENIAHCED
889,566,646 *5C8D586AD3CC824CD6001C9B022D8AC7B8C2BA6D 9THEDATABASE7
889,566,647 *5C88BA2BF91EF812EDCC130A5C14FBCB3E183AB0 b2+&
889,566,648 *5C80CEA2EBCF139C0A135F10C72DDCE12F3FBDD1 a02b2dc9033b309bbf77c0d9ba34e586
889,566,649 *5C839E0D5591D6BC7D12F6EA4C5CF52F1319D696 b$2rw
889,566,650 *5C8C372A58743DE54C4A16D584805C1A35B86CCE a1:c9
889,566,651 *5C8D784353B9791896D13FF2BAF9E5198B5B752B A27202720
889,566,652 *5C8B7D5A6A13C211466372C770E1E8B9AD308745 b7n(l
889,566,653 *5C83BCF86F457578126DD84DB3EEF356C87E4660 A;5OB
889,566,654 *5C89201B4B5A8BB4735710C44CEBF010D7FB3474 a?+7
889,566,655 *5C82D3E73992DA9F66B2DA06F640D52285D2E3B5 AA)%A
889,566,656 *5C851C5664A98EDB7B7018A474A10F7FB39C0238 aabbzs
889,566,657 *5C8E0C871D0BEFF91732EC2A84287A7782FC63A3 b.ej.
889,566,658 *5C8E4FF757127709F7756838A756CC36FB9A15D5 [email protected]
889,566,659 *5C8239E570045E103FC425A10440B90223AC6A17 abb0.
889,566,660 *5C88991553A47A650010452707A59ACA8FC927D5 ab)ek
889,566,661 *5C8F863F39F91947F144A54A783E56B9686C9AD8 abisagrara4
889,566,662 *5C8064014B228625765ED65A0ECD01C7B87C7E26 ABPV_
889,566,663 *5C80AB94CEEDA5B8476B87A38498F9066B1AE7DD abu1=
889,566,664 *5C8FAE51E695C630921F74B3D8C4252DE2306F91 ackm
889,566,665 *5C889231533C4A177F5E800BDE21763D3666BD8D bhpr#
889,566,666 *5C87E9C896B80572E3B71B1AF61A9F318B3D699B B$J19
889,566,667 *5C82FEFCD07BAA62F69FBE2224FB9DAA886F57B0 aduud
889,566,668 *5C801E7DD51336C7FBB520A5999A7862122BCB07 bobo-can
889,566,669 *5C85391F12BF821E2680EC053D413C7F5A4AD3AC ah:)f
889,566,670 *5C8A6D5378E5488CB2C6890FDAE1F7E887BC2BEB BOILERMAKER?
889,566,671 *5C87BB3C8AF012895E1EB6D9F63AC9CDB587DC26 B#P%
889,566,672 *5C872165D07E1C867B1E80BD65FB3444D0A8DF8B BPLV:
889,566,673 *5C8508717558405AB4ED5DBD995F62828AA46D5D ajhqf
889,566,674 *5C8D28FB3DE380EE3EBCF17A2ADE344DF5D424B6 AKATUSSA
889,566,675 *5C8B172450F437C449C1EF5DEE88FD2E3B34F543 ALDENHINNEN
889,566,676 *5C871545C48947734B8AACF02836522BA437D561 BRRQ
889,566,677 *5C823E152C4DE5EB731E1D6F70D71E1089BBF7A4 ALLIPH
889,566,678 *5C815E1055D668CDF98A37DEE1D8079CB2DCE7DE BSWSPRAGINS
889,566,679 *5C8C98D4FE2D7F19F0DE73D01D4A692441CF987B B+T&L
889,566,680 *5C863DA1B688991829DCC62D1D0F45E7CDA17EB4 alsonel4
889,566,681 *5C8186A9A36081995A53D17BCF2548541ED83A52 [email protected]
889,566,682 *5C81FC8EF991729ADB916F1F3E7BD8EDA16AD4AD ALYSSABLACKMORE
889,566,683 *5C82D46032B67B4913D6C3BF1A050A7F100BDAD9 BUKIE PATROL
889,566,684 *5C8531F0D6752B3AC2352223B4A9D2699EE98AB7 [email protected]
889,566,685 *5C8B86FFF8EDC34B050A749BB49E8449E05AFE23 burgoon?
889,566,686 *5C8B1DD239EE14C97D1E71D2EDE260B332BF01AF BUTTERCUPBROWN
889,566,687 *5C8BB15A10DABA68AFEE807A46431FEB90B2B3E6 BUUFM
889,566,688 *5C8095B772C88B98240BF7D4C0FD535BC5A79454 [email protected]
889,566,689 *5C82C64FDB86F2F4F4D63FE4CB2C885F61FCD9D2 BVB6U
889,566,690 *5C86928D3C9F8D37D815A051D89413758B2FE969 ANDREACOSLAN
889,566,691 *5C8EB4CC67F49D2708DBD9BFB4C5A18093E8A8A3 ANDRE.ALBRITTAIN
889,566,692 *5C820BED7C50B27327164B660C91AEFF48CC5FEE andrewtr6
889,566,693 *5C8ECBF36A71BDC53437D6C41D2A887134D3BA2C C0&HL
889,566,694 *5C8AC436C7F5DCEB38ECA15274106E5839C11944 anima25
889,566,695 *5C8FE3EF61A6BAEAACE4AA40DB6F1728A50FBC8E ankih
889,566,696 *5C8DA5942C8624A4ABDF94B494BB7350EC34009D «antigüedad
889,566,697 *5C8F7A515135B9459D931F9A6F103FA570F42717 c-7=1
889,566,698 *5C8F0388CEB7C6F29AF12B043E81DAE9DDCEAEB7 c8b$n
889,566,699 *5C8BE025C98758F0BA1BC956A1B07A894F02BA93 A/PXQ
889,566,700 *5C86FCEDC5E5EAF6188F4EC931D62AE42C097F8E ARA
889,566,701 *5C8732BC17015D8E0ABEED6AC9D5D979AFB05056 CARL.GRALAK
889,566,702 *5C862AC2954DDBF3DF4A3332D3002A3F35F6FA68 CARLOS.MACIOCE
889,566,703 *5C808ADE0AAE2F8517D861061B93A1FF8DA572F4 AR)J+
889,566,704 *5C8B293DF0FBB917770476661BB36FA519DC26E1 arlensauceda
889,566,705 *5C89937E18E720F00DF5952F5F6E0D87FEEE2029 carona-sentence
889,566,706 *5C8CF695209EC4725D5B51D490AA22BCBAD29301 ar:po
889,566,707 *5C85C4836545834AD895031DC81E1D802A826DF9 catherinecornett
889,566,708 *5C812E4E3886E827C978D5E65D9A1DBC7675E7AC as1q(
889,566,709 *5C80B643EADE89E6C920CCB28D22D18F75D78D37 CCRC&
889,566,710 *5C8892CFDDD5DF431B99F54CC1A66E9F431FB5E3 asu1x
889,566,711 *5C857D7086481341F57BAB08F1878F27CCA49C78 AUGUST.DEVENECIA
889,566,712 *5C807CCAB51E03B5C7D78FF21CDE5530EED23A8F AUGUST.MARCELL
889,566,713 *5C867349CA95ECC3AB72057843AA024C5FA53E45 ČEŠĪRA
889,566,714 *5C8B5B5A8577BAD2C55169C9A86198D580F74B82 auntyaya2006
889,566,715 *5C8C1679F4B9678362E7B99E6CEAE6187FF2A414 CFSA.
889,566,716 *5C84644F1B659E1E65E3044F6412CB2AB899B0A6 cgdi_
889,566,717 *5C8CC2EAFF1254B4F90B643845BFD7B52C1F48EB avi3h
889,566,718 *5C81E492F87C6FB05088E891845BD956CBF4AF8F CHAPINAZO
889,566,719 *5C8C1ADC10FE39777CD0E324604196B3C455BDAD charleygutowski
889,566,720 *5C8CBF890C1F1D4550B3B38F4473D4BF621AF70F CHARLEYNJOKU
889,566,721 *5C8F4D2924B63A756D07139C0A90E673ED1FA229 CHARLIE.CORREL
889,566,722 *5C87F9B557BF2C517D1FAFE60EBF9F02FC85F7ED CHBHF
889,566,723 *5C84B9C2A5F32D6EFF20050D2D118C1927AD4048 [email protected]
889,566,724 *5C88319349E4D402B22ABCDFAAD8B92AE3F7AA12 >b0`q###3
889,566,725 *5C83C43FFF6439A5065929662DFE6FB5CA3F4438 [email protected]!R$
889,566,726 *5C8E7D4F17BE2B6671A3E1596982DC9389883D84 CHRISTOPHER.TUMMONS
889,566,727 *5C82ED7826EF6C0405C743AFC8345D42FE21D8B5 ci=1/
889,566,728 *5C855099832AD0D07077783BAE7E5382B21F8597 CIÁRTASZ
889,566,729 *5C844C19E0461999FACF9A27D83D00FBDA60B2FA [email protected]
889,566,730 *5C85AF7B81D9ADDD224FC4D72FC8E3055A35E250 babyiloveyouso(12")
889,566,731 *5C80A7FBFD8531C03EE7EDB9E8293E77968BC920 bacalaureate
889,566,732 *5C818336411B44DDC6BC871800BDF74517AB5AF4 CIVTH
889,566,733 *5C8C412FE1216429C58037256A5115643FCAAB77 BAMBOOTECHNO
889,566,734 *5C8005EA4389A0F061BC977450E0C2927B4952D6 BARMATICA
889,566,735 *5C8F8AF8C7C79F585144709159718ABED9C9AB1C CLASSING
889,566,736 *5C859335A1D7064CD242FFE8FA755F61A00C09E4 CLAUDIA SARMENTO
889,566,737 *5C88F6D5D321B82154F604FB2CA8A1A7C1EDA1FF barry-fretwell
889,566,738 *5C859FA7D4F651C48D4323059D2AF11A4AD22A27 CLEOBURGESS
889,566,739 *5C857E7D55C9B25B9D691562DE955801BADD6459 CLIFFORD.WIGET
889,566,740 *5C8081414AD3C2EEF4D760A30955272369C50702 CLIFTON.MCMENAMIN
889,566,741 *5C87A037FF1A0C0CBDBA7F9A6EAEF12DF2026D12 BAU7H
889,566,742 *5C8E1B7D3D8462FA70854DEEED9B131635441F14 bb;7l
889,566,743 *5C8E1F29E5B455C7D402ABA57F00129490EC802C [email protected]
889,566,744 *5C85872F51E219E51D32F8A449C7B0F0DA38B697 b):$c
889,566,745 *5C8C59CE2416B0E9EF4AADDEBF1BF0F478A027D4 BECCAFOLEY
889,566,746 *5C87C7283E1E0F065F0FD01040555E0BF4F15EEB B:ECR
889,566,747 *5C890CECC70158CF5B32A49B7380AF81A851E274 colewort
889,566,748 *5C869AA6A1ACB4C8E8DE70159A1C208E20DBB984 BENITOMARSICEK
889,566,749 *5C84D713FCC3AEC3107E49BA3DC82E4B1E014747 benjaminisabella
889,566,750 *5C807E516DF4C340712371125E4DFEF106A5ABDC COMPA
889,566,751 *5C8C19B8AD93BA36E1256B5692680D6237253722 CONSOLEWRITEDO
889,566,752 *5C8D5DD7F61C0048EF9334F68689A0F09793BED2 BF8Q
889,566,753 *5C809D9571FE0FE27BE66100D32F252DEBF0857C Copolymerz4+on
889,566,754 *5C88519F011711FA342164095E57C93936859E77 [email protected]
889,566,755 *5C83E185AAE40294152901562492092F682BD7B3 bf,z
889,566,756 *5C82977370DA92984A49A85B3ACA2F729EFDC6C9 cp5po
889,566,757 *5C812E25ADC76DEB0ACED6D2E3C6AFA2E57E4115 cphlphym9
889,566,758 *5C878730D6F46A73C54E3FC95773FC79B1B5401C cqzq!
889,566,759 *5C85E0C548397411E1B2927A07B404B9BC1C59EB cr/d:
889,566,760 *5C8308F72CE169ACA88691ABBC741D1D54358460 Bk,A
889,566,761 *5C8EEDC85A86AD5E72B0B429028299C869BE8B7B bl195932135
889,566,762 *5C87074BFA83DF5EC81F3E2A67525DBED04D56A7 csalodott5
889,566,763 *5C8F2F3A9F1F8F4ED1888C616AFEEE9A421D105E C$SRD
889,566,764 *5C83279343D987A7B10CEAC4ACFB17D47E759C1E blisteredcircuitry
889,566,765 *5C8F80982180332546D4B0499C83D7EEA690AEA3 CT+OX
889,566,766 *5C85728DB877E04019D5D4A30DAC5D19478EC7EC cu/j$
889,566,767 *5C8E65D8A28B050207312902D467B8A8B23F0306 CUMULATIVE_BALLOT.SV
889,566,768 *5C805B3792500B7F3D31EA2CB4932BE55C944B83 b"nsn
889,566,769 *5C80DDD53232B50C8993EF1509172E1452D429A9 BODDOLE
889,566,770 *5C8467B32208F1A7D644DAE940335939BBF89FAD C_WW3
889,566,771 *5C85F406C1CF66455DC5D6F481D4781D42EB77D7 CYLON.ATTACK./.THE.END.OF.ATLANTIA
889,566,772 *5C8AF7FA448BFC91E3B9BBC58A2A1077440F7F52 cy:mr
889,566,773 *5C8155251853DD684DEAB3A308BE3D2BDD8D6F7A cyrilwoge
889,566,774 *5C8773DC2977161EF503D1760E49D158C71613D8 BO_QZ
889,566,775 *5C8A3AC4D2A59E07D202F6468290093A62590452 B#P%
889,566,776 *5C8B6B75FC5AB4ECB26997EA9A34C7968714130B BQKD
889,566,777 *5C8811EF17B08FB637A7F9901D96651C67E9F44D braincarouthers
889,566,778 *5C821D1CAB2263F0868946A4F8CFCF4D4A396800 D-(8
889,566,779 *5C844BC5934200F36C9300A67658C067B174D66E BRENDON.BUFF
889,566,780 *5C8F786758206FF000833D06A4357314FA720709 brodiecroyle
889,566,781 *5C80203BAF7AE0200180842B11C8EA1F715ADF94 damianreinholdt
889,566,782 *5C8B54C82D501802FACEF7B62A89B934AE985A50 BRRQ
889,566,783 *5C84383F6973350110152E528E505D996A6582E7 DANNY.VANALPHEN
889,566,784 *5C815106C9CA5FA250E45F97A272387413C8A858 DAREN-LIN
889,566,785 *5C85F0530416FFC2F7C2EF5E35EA485B4F51CED0 bstrdrd9
889,566,786 *5C867E3F50A03451EF819C9C513AED852DC5A4DE BTEJO
889,566,787 *5C8CB7B06EE830AD44539F5D487677693B9E32BD buenophantom
889,566,788 *5C8D7466D364EB4B56BDACA5A305593AC816C4D3 BU?G8
889,566,789 *5C8787DF9E833D69BA9166AFEACED149B3647137 dcx"g
889,566,790 *5C89828CB985A9D352C15CDA2DA6AE18FFA09170 B+WM
889,566,791 *5C81DA610B2852692719ACCE62647663B73837DD c0dn(
889,566,792 *5C8BBF9FDBF702037E345FDD3A51955A5499F8BB deluv
889,566,793 *5C827A08082FDD1B3937D7AE135D113F1B64E61D derecho.de.venezuela
889,566,794 *5C8E90857BC61494B4B9E04F25759E88A7F8FF88 DEREK.TOFIL
889,566,795 *5C83B308296FEC1ABFB0FC6D730DAC69C44386A2 DESHAWNJONSSON
889,566,796 *5C84BAEB5D67B2C93DBE3DD6FB00AB26DA927696 desm0ma
889,566,797 *5C8D5E2E7E63DB064393C171D9EED7C94D4EFA5D calambito-temucano-/-inti-sol
889,566,798 *5C87DC42641EC40E8CA7584316EE7D327E2A9E16 CARLORAWAT
889,566,799 *5C849FF020CBE6F287CED9D5D7A4257194E153A4 DIERENBEWEGING
889,566,800 *5C8C1552B3706E9F13F7BF3B32FDF0C0F32357C0 differentgearvs.sia
889,566,801 *5C8EFBA68E4A7CD1FF9B19DC5BDF3A05B0869F47 dirkkingsley
889,566,802 *5C8607523BD4D261DC6FE168395A60258D5B7459 Dj5
889,566,803 *5C845614475EB0AB36B7E9E8CCDB60C27FACB9E4 DKFZP686L0365
889,566,804 *5C80B5539896238C5B741057FE1034CD1CCFAB3D dktq
889,566,805 *5C8EC34E3984795C58D5AD3B522EA4366FD90F11 DMELM
889,566,806 *5C835781006239E6F290546AB21B1EA2F9D824F0 DNJEJ
889,566,807 *5C888906DA783AAE367AC9C092F08AA983AA5FE2 DOMINGOSHUM
889,566,808 *5C825AA67F709663A2F78B87D48872BBDAD4CA0E CGB;T
889,566,809 *5C80130C404D20AFB2F72C443929116840B1448E [email protected]
889,566,810 *5C8076CC3FE0C268ABD421414EB0CC0DEFB286EC ch;
889,566,811 *5C87895FA065CBE8EBA5C3C98791ACB1D8E2F113 dornier_328article
889,566,812 *5C8A98F35E3BC707AF7CDE75657BF027D250E403 charlou
889,566,813 *5C88DFB34E3FF214DFE1ED26C35FBF1A539F71C1 CHARU-PURI
889,566,814 *5C8A68EFB087168C842A74E83D40D19AEFF0EC24 CHAS.ECKBLAD
889,566,815 *5C8B93F3A413347A62D7C188AC0B043DA0FF8F74 CHAZDEUBIE
889,566,816 *5C889E924067C378436E95A8FFBBC6BE9BD69972 cheated.(feat..anja)
889,566,817 *5C8E36AE9135C4E930D0EDD40BBC08C219087755 Cheers-Boys-Cheers
889,566,818 *5C8B5551F08C0D7A510B127363DDE9F9FC3B53F2 dragowac3
889,566,819 *5C835684168278E2AB727E64EA865C5508C85B21 CHIVANCY9
889,566,820 *5C8346D6F171B5CE650E8BE45AB7A4CA0777E666 CHRIS.RHUDY
889,566,821 *5C8CA93838FA5884EBCDF74426A8A3E0B84F0F05 DRUMDUETLOSENDOS
889,566,822 *5C8C925D49C87BE187C44C64855BC6C2F5F19735 D;rw
889,566,823 *5C83CC329E86A0A86E4AA9118888581345664AFC DSERDENGECTI
889,566,824 *5C87889DC878A3703743C22D4CB1B61C32695E61 D,SOE
889,566,825 *5C8FD963F4C9C427D95879FD1BA96E8B3ADA9C6E DTGDO
889,566,826 *5C84E6DADE956C8BD55DCD7FD9D93B35E09318AE d!./u
889,566,827 *5C87E9F0B451E76ACD94C5375CF522F9601C2512 dub-for-the-worms
889,566,828 *5C8217FB6ABBB82E27036980033A56B2D2925ABA [email protected]
889,566,829 *5C8F0A3E120224258CBFDC453FD1764FAF823B1B dustinfiddelke
889,566,830 *5C8ED76A352B61296AB2C96AD350D2EF35962A6A d_uw&
889,566,831 *5C829F2CB4FC6639AEB0847A037D76FB299AFCF7 d(]w
889,566,832 *5C822DE30D5B91796C5BBAF8928A6EFDA5F543C2 DWAYNEOLVEIRA
889,566,833 *5C820B03A919D35DEDC31AFA83C9BF150D460941 cletusscholzen
889,566,834 *5C80B8868B1739500057ADE838A2BC6100EE78C1 DWUI5
889,566,835 *5C8E456CA06440739B1BF34A64F0187DBAFD6820 dyaz
889,566,836 *5C80B9E50F8C218EA8ADF259C6666F1F90870F5C C"m&
889,566,837 *5C8594218ADF080BEAA66E8EBAEEDC036A994013 ebersfalva
889,566,838 *5C8179B33A1E70F7CEFDCA49C51F85838EE47491 eco(0
889,566,839 *5C8B074B2D432AC08B226D38104CC093A7C2D3A5 ediralyh5
889,566,840 *5C8DC83FD222385407ED00210BAA72549C3605AA edmiddel
889,566,841 *5C88FB62F5191B70F92A0EDE46088615E5A06FF8 CONFIEIS0
889,566,842 *5C8D6766D93E9F014C367831712FDFD75FCE6CE5 COREY.TANNEN
889,566,843 *5C8941E3C0BF975D5F8C9B968744BD5F95346FDE [email protected]
889,566,844 *5C882A8E2FD7339288EA0B6E722ECEAB566C6849 EINFUHRG0
889,566,845 *5C84E7BF95B3E3733571B12EE2397935DC6020A4 COWOKADE
889,566,846 *5C88AA8F6149D0BE4084325940C35F80E034F68C ELASJ
889,566,847 *5C88146D51247A7F6A6F0316D14C4686E328356E eliassalois
889,566,848 *5C8D0D2FD32534C77D9DF8509EB70147FD518DF2 ELISEO.NETTERS
889,566,849 *5C8AEBA73362F784FADA6853BC409BB7D33C5847 ELIZABETH-COWIE
889,566,850 *5C865A8D7FE8A1E5A64CF11CC3B3E44523772322 ELLIOTT.BHAMARANIYAMA
889,566,851 *5C8F0AFF8FD08A063D1514692A105E02281ABB64 ELLIOTTMAY
889,566,852 *5C8219EA823D4D58C5C29E9A0C68A0E56707680C c-q1?
889,566,853 *5C8DE528392A02738E4E84ACE055FCB3C711E1F2 cqd6/
889,566,854 *5C80BF5BC5C93CBBFECCDA10D50B6CC078BB1A06 crizfigueroa
889,566,855 *5C8956BED7883932B956F6DEF7F7CE347F7306C4 CRLCRL
889,566,856 *5C86EEB7AAE1A9A74F3B736B9D0444047549306A EMP
889,566,857 *5C8D5E4B8CD6104EA94B5C16471F7A059D2EA2F5 CSEPEGNIE
889,566,858 *5C8C071780B71691C9A9BFE83F1F1820F2E47191 cso2
889,566,859 *5C846C1915081594ABC7BD1D1DF7117A724A2EBE ct25"
889,566,860 *5C83DEE24C12A2E0E2216CF2154E418D9AC1647C EOCELLGT
889,566,861 *5C83911F0001838D8EAAB1DB53C3037C358311D1 CTS0E
889,566,862 *5C82042CEB17D06CB709A4B88453306B4DC87E16 CUSTOM TAX-ON-GOODS-COMING-INTO-COUNTRY
889,566,863 *5C8BEC70BA84056041ED02ACC57DC157D09CEC46 CVSDO
889,566,864 *5C8B6B4B0902E4D1B45E1F35E867046A00098FE8 CYBORG
889,566,865 *5C8E5DA74D0442160CAB0D558C6B7C330374E41D cz2?i
889,566,866 *5C87314A6CD0DAA7C80E910272B8C62F890A5F81 d)-2h
889,566,867 *5C80835D4E7BE0D3BC267D6660654C749E7B1757 D2Z?V
889,566,868 *5C8E31057C9D52C3312CA8440EE2E8132BA424E1 EW..
889,566,869 *5C8E3D52EA460A2726AECC4D2EAEAAA024D11023 D6JD
889,566,870 *5C8787B431B2A7DEBC60BD25FADEE8F6BF9B4E4E eyh%
889,566,871 *5C885E0FFD8C5D80A7B94E77497CA4B3058F4061 DAKALOS
889,566,872 *5C8F93F5B66F3B21BA582BCEF0E5DA6856D44801 DALTON.SIX
889,566,873 *5C855A4C241AC98A37EA3A3E148A44D92A4A4893 damienmiran
889,566,874 *5C81705EFE96B8EC506D9ACA156191419E3B8CDF danialjinkens
889,566,875 *5C8ED1CA751F18D7155132CD8BE869EDCC990CCC DANIELTATGE
889,566,876 *5C87DCB6806FA5C36C902FB819ADBE9405AE93C5 ferminkalawe
889,566,877 *5C8C682689B7D12754770404891EBB723605FE20 DARRENHALLINAN
889,566,878 *5C8F0C7B1D633981068CA4452F385F33E9554FF0 FIKHAKH
889,566,879 *5C8E728E3EA4CE87E41F69231DBFDD1B6B8DEE50 FITORELUTFIU
889,566,880 *5C84424737E15C1BFB007F5E23F9CB07BEF49D29 DCIJ
889,566,881 *5C8AB0471F0AC66A229CC19CE3A6CBC4BA808EA2 FLYTTET4
889,566,882 *5C8DC83359C698EEA9778ECD2E3C3DF970E2D7DC FODINAES
889,566,883 *5C883DAA0EDEA7F1C6AC84158C47402768827968 FOGHORN
889,566,884 *5C8ECD0102CCA1F1670FC918062DD5BF32CD42F4 D(DUT
889,566,885 *5C8CB18B8CE8B2546AB6282E5691CEFFC810DC21 DEANGELOVESS
889,566,886 *5C88066C1D2FCEF2890B385D38B9F665C607E632 deanstojanovic
889,566,887 *5C89EED0B6FE53917A6ADFA9F3BFC72B3124FC7F FOUT;<BR
889,566,888 *5C80637EE328F55F5F7CB39040F075B021A3C91C frankechavarria
889,566,889 *5C87ABC31929E6D28E1722705BD1482B6DF48143 DELRAYEH
889,566,890 *5C8439245BC4A84872B0D7A42007D4315E67B4A2 DEMARCUSMIFFLIN
889,566,891 *5C882D044193E2148EAD7D48A64FCCF5A1086104 fredericbodiroga
889,566,892 *5C8600AF1A79541D47D2A2ED38616CBC70412FD9 DEPLOYO7
889,566,893 *5C829BFBA31DB52A7F76D8EC4CFB4501F6A1B64D DEPNEDS
889,566,894 *5C8A21BC9471B368390B347F4FD6BE3570DF3A09 derrickmachan
889,566,895 *5C8F6D034D46762687E6AF6F101D102A015424D0 DESCRIZZIONI
889,566,896 *5C86A5AC30342FECD44E7D4361E94DE45E784EDB FS*\
889,566,897 *5C8985E4ABE3985D4AB6C2A54E6B45727E745307 DESISTERAS
889,566,898 *5C8902CFE6F35AAB0940E9258669694C1D78FA1B DESMONDSEMASKO
889,566,899 *5C81D2D57B010B6286E433610ED1480425EB9E6A DEXTER.MEASE
889,566,900 *5C89835DF4075CC849F41EE74A1908D5ED8670A5 gambeteos5
889,566,901 *5C8449FA48D7E0328128241CE7141A6B2E4E20E6 dezhnevs4
889,566,902 *5C86ACB305211B5542FB2EF9BE25F7C441CA1C45 dfjpx
889,566,903 *5C81F853A31CD0DB48F19B549E1FD6EE74BE6BC0 GAYGA29LOKYS
889,566,904 *5C874545A4C280A2BE1D0C726EDE47630EF45F85 GENERATIONSGENOSSEN
889,566,905 *5C809E73D959433ADA56AEF24221EF4845061B14 GENOPFRISKNING8
889,566,906 *5C8090BBFCFFEAE33BAE34D15CE294F07424CFFF die-flamme-der-sehnsucht
889,566,907 *5C8329E99090A2FA10CB5E777BE6113E318A006C diefleischfressendepflanze/verabschiedung
889,566,908 *5C85EEC40E79A8E59EE32AAEB4D2458D21D57C44 DIRK.LAUDAT
889,566,909 *5C8AA6D6C252E8616B85B39378F0CC96F87CC537 divod
889,566,910 *5C8EF357972F5ADAF0BF6BF7E7207467B6ED9DFA d/-kj
889,566,911 *5C8C59938AAE68864B16E3680EE9EA9FEAA62713 d/li3
889,566,912 *5C83B8C3EBE1A2AE843479B0721FD8C0DBB512DE DN1CL
889,566,913 *5C8B6B9EE8F18A4E5A3C9D011831FC32EE01FDDC g~;u
889,566,914 *5C8A2EB5B21AB1256306E6A65F8ABDEA06E3E002 GUY.VONK
889,566,915 *5C83F527737CE3BFD5A9B60337B7F7D73CB85D0A GZNDHDSPS7
889,566,916 *5C805808F9B6F3C8C2664029790104B92BF66E63 hafsah.othman
889,566,917 *5C89A86104ED04089B90FBE2269956AA487F58AA HANCELEZES
889,566,918 *5C8F9BACA1DEE8C1AECD83DE9650347C1CAA93CC HANGOOR4
889,566,919 *5C80396551345DDA26810B14DD65D7BC936773CE doylefahl
889,566,920 *5C84EA7AD4487459FC74ADB35CFED87AFB57B1BD >-<~`d#p
889,566,921 *5C8C23D334B3DD00B94181E629E0BDA34E4696B2 DQ%,G
889,566,922 *5C874FD5ADB4844E83DC7C124BAB5758F3453A43 HCFENWAYHOCKEY
889,566,923 *5C86F08FFCC19043F60F47F2549EECE5DD626D9C [email protected]
889,566,924 *5C80C442F6A6FCC0ABD683D9AE767ED2C7FE6635 DS84LJSN
889,566,925 *5C8B7C5E29FC726D2DA7681275DA3F161584FC78 HENDRIK-JANSEN
889,566,926 *5C838069110DCFCE5204D3A318C2697A03DF61A3 [email protected]
889,566,927 *5C839430EE2B7A43CCDD1905679FECF1807D8400 DTSVF
889,566,928 *5C8860CC3E4343412B204B366091D808ED43BA25 DU4ZT
889,566,929 *5C86EC2DA46ACBC1F48C64FE31DF57BFDF94E060 HGISKCAB7
889,566,930 *5C83B99CE213DF48974CC21B31D4939BD626FC8C d;_um
889,566,931 *5C86FC9AA3BF4AF4381D4AC69B5CBE6567A9D7E2 hissaim7
889,566,932 *5C83B6264EA8B9C69A0783E888BCADD730D4BF02 dwaynetavis
889,566,933 *5C8314B063DBFD6B0D08ED70C56A949C5299FECF DWINJOH
889,566,934 *5C8148B566D63B55A7881E08CBDA1A7C928D9C64 dwncl
889,566,935 *5C8E2FDE4036A746D8574A40D2026B2B89302D6A EA"=
889,566,936 *5C8EB420A4E5EC62D06BBE013C046FE297D460A6 EARLMCFEE
889,566,937 *5C8DCAF94CB5C8D0625D67C08CD88893640DD72D HPSCKMJ0
889,566,938 *5C8C94341563EBADB2D7D1F8E9291B124F664BBB EA!u
889,566,939 *5C8F3BF5D9BABE8EF6782732DA50D8861DFA6DE4 eb&ry
889,566,940 *5C88BD634D3FEF0198572DCA7161E4FEC46BAD29 httpwwwactonmaineo
889,566,941 *5C8F6674B78E526E50AE6884392E894C8F88E61D [email protected]
889,566,942 *5C8277E6576F50B44EB909093BDD32856F13BB86 EDDIE.STUDENY
889,566,943 *5C804CE8D2E575146A573C3F3EC7E77CC226EF17 huitoen
889,566,944 *5C86400602AB1EC29D23ACFA84B9E65B4EB3EAC2 humblehe6
889,566,945 *5C862F66C9303D7CDDEDA770E4EB76FDE66B7AC5 EDMUNDO.LANESE
889,566,946 *5C8DAFD15792A84D4E68607E321194C81DEE2A14 edwardoorcutt
889,566,947 *5C8B002BA52805B9DEFD9013182C37861D22FADD edwardsifuentes
889,566,948 *5C85D61612D5E7A47593237253E8DEE04C2DAB0C [email protected]
889,566,949 *5C8697477A3955C16C29E3A6A73381C2C2999FA7 eh"=1
889,566,950 *5C844F06C6127BEBA548DBCEC58D188CC58131B1 EH7#T
889,566,951 *5C899EC64B18540D3739D78C57A526C1CF4BB4B2 i-hate-the-war
889,566,952 *5C811F805E4383612B0CA177E60027CBEF94E4F4 ilchester0
889,566,953 *5C8D0D1B7DDF9F5B1A807159DF1234CC15EF7602 ELLENÁLT
889,566,954 *5C80CCB52C47CCB43403AC3E2968F972155776BD ILOVEBENNY63
889,566,955 *5C846AA8A17F0685AE61D273BBDD748721DFC989 ILOVEISAACXX
889,566,956 *5C8D300CAD4B5E7064CEFBB6DDFD05D961F6E948 ILSEGEMERT
889,566,957 *5C84E2988668A7291AD5529BC237623EEF6AD708 ELMO.GURGANUS
889,566,958 *5C8051D6F5DE41C3A431D18ACBC76EA847275090 ILUVBUGSY62
889,566,959 *5C87E1AB7CAABC4C7F20EA5EEE9D3A4F80A63BA6 EMERY.MIDGET
889,566,960 *5C8AFA0204D32305250A50C39E23EB73C23EB792 indischts
889,566,961 *5C8634AA14C38F129BE5E8D69D9C5EE1462C69AA informationsform
889,566,962 *5C8D69AEE372712F01C27F17CD5B80B99778AC26 EMMETTMATERA
889,566,963 *5C826AC6257FD53CE332B69D46D6C4C0E36465DB emmettstillwagon
889,566,964 *5C80BF604B37DC38762AFA33EC741A881CB8C632 INPRIMO4
889,566,965 *5C8B20D609981CA059FFA698E8FE17AD2725BC4E EMP
889,566,966 *5C8B9B4ECC4074618F5135D696BCC5E1FD8F7750 INTUICIÓ
889,566,967 *5C865C60EC3594187DF08F5A1E373C592F06BE0F INVUNERABILITÀ
889,566,968 *5C8D782CFADC8852F9ED1A06889BF09E5FB6908D IN WITH THE OLD (OUT WITH THE NEW)
889,566,969 *5C8133EE7A29666C7A776B1717F2E20008E91323 endeblad
889,566,970 *5C8E3DBE1222A0D5A3B25A1023D9A22087CBC2CF ENRIQUEFREDA
889,566,971 *5C8C1C5C0DEC374E6CAF8B5D48CA68F37600CA85 ISLANDONGULKALVEN
889,566,972 *5C8870029BC5E10D0EB083DFA36FD9A21FA35FEB ISMAELSTAFFELD
889,566,973 *5C8B9FA194E635E2DBF255EAF3BEA7D0AC7C19E3 EPBERGLUND
889,566,974 *5C8747F4DACE9EB5851E926CC0231F83BA48BDD5 EQLIM
889,566,975 *5C8C152D26B692DCD1065B8863E248ADA4C468EC ERNIEMELMAN
889,566,976 *5C8E0516B3CE6734722E554DC9D2782F1FCEDF79 JACQUESCARLON
889,566,977 *5C8FFD9C82FA9391C7E6914C4B29D269F23C31F8 JAIMEPOREP
889,566,978 *5C8A95E2B185AC0E3093485FE7CE49BC00CB7C78 JAKE.THRUNE
889,566,979 *5C8EA7457C63F6004DCCCCC48C2C7C7AB2CDE37E JAMAHAIRA
889,566,980 *5C83EE20070D8946525AEE8242D42E194FE1005E estc1
889,566,981 *5C8C2392E0AA4AA6A657269EAA323399064BD2D4 EUGENIOBERTOLAMI
889,566,982 *5C8F8AB2FA87DED6C821A93B39C8CA154306BDC6 [email protected]
889,566,983 *5C8D5F579F58049318550CC43B58FC33255AA0E2 JARVIS.KRAJEWSKI
889,566,984 *5C8A531C5683EC365F75C4476D87EC5E7B79F669 evr3jss2oo
889,566,985 *5C8E9984EC74938AA3D44F129F2E1C1E386F72C2 EXPLOTAN5
889,566,986 *5C89793F6CB939433B2B6FBDBAF471DDA46185F2 JDUBDJOS
889,566,987 *5C8B3254171E97818493C705EE0460BBD1661772 $EXTIP1Y
889,566,988 *5C802C665456BCEF7C4AD95FE50E229BEDDE03A8 jean-schrader
889,566,989 *5C85A8C31C21903E05C03B326972954E0D5CF6DE jefferymccaleb
889,566,990 *5C8B488F4A087A04E8FB89C7C8B2F4AC7A0DB5CA JEFFERY.MCCALEB
889,566,991 *5C869FEDD76E441C4E0018E097C97A6213CB56DA f[0=
889,566,992 *5C8E1C59D49F2BAEF954D235B129E323459A4B2D jenna.ouellette
889,566,993 *5C817404B998AB2BE813BD943850AE2681F9A4B4 F394782
889,566,994 *5C85C9478516AD1B907F6486FE461E3FF218C94E F5$=
889,566,995 *5C86EB8AB791E90A55C044EDA6CE1F8BB08E16F0 JERRELL.BALFE
889,566,996 *5C8A09FC3AF2CC3067814B1F180FA25A273C3F43 JERRY.BARBINI
889,566,997 *5C8D1F844E9277D1296EBEFB418A41759DAB4A16 JERRYNICKLEBERRY
889,566,998 *5C822AA91A0B6AEB36569953A712063FD0D602C5 JERRYSWINEA
889,566,999 *5C8C9AEE24300B16E55A0814921F86C091FB29CD JESS.BRUDNER
889,567,000 *5C80CE4418E56924F75CAA2FDC1A080CF0A515CD [email protected]
889,567,001 *5C8F5D6E2CC4F1ECC8BC4A975F8242871E5347A0 JEWELLMCFALL
889,567,002 *5C82712CE032F8A35FA81030C00BD8117712EB55 Farewell-and-End-Title
889,567,003 *5C870D32842B7F937A0DDF1EA94E6B4DDB04C526 faustomontelle
889,567,004 *5C80D7E6AAE8D4DE58B16DDD09F39A581E890DA4 JIAXINTANG
889,567,005 *5C81FFF41A21895C8CBB0BE163ADE0A7DEBE7064 jinhee-jo
889,567,006 *5C825D2092F53F78F33E0831F829F8FF655C0A02 [email protected]
889,567,007 *5C85B5CFDCF52838207C40916E5F5168912CAE12 FERAOCCIDENTAL
889,567,008 *5C8DBBB8ED23987C3B023B506CE576AEAD783415 joanne-cirillo
889,567,009 *5C81EE4E0EDB71BFE9AB7DF2907D5AF88A631304 festmat0
889,567,010 *5C8DCCE05F60A3B82CAB4375E76A880956BA0216 JOCCELYN12
889,567,011 *5C84F5585D73DD9F0314DF9EDD170DF21E11E9A2 FICHBSWED
889,567,012 *5C87064CC32326113AA2866CCDA8D94EDE624298 FILIBERTOFOY
889,567,013 *5C8F8EE0E59C226AD4A3A6DE59FCDE2D16CF28C8 JOHKA
889,567,014 *5C835DB62AE1620D6A43B2A393323D549DA03C8F FITARIEP
889,567,015 *5C821F51DA7E8984A2241225866F24313A142528 fjernopvarmende
889,567,016 *5C81F502CB3B172B37790DE5DF7EBD5ABCDC1620 JOHNREDDGONZALES
889,567,017 *5C89197ACC5B0F174DF6E1B016C6C13D098F8ACE flomlysbanen
889,567,018 *5C8C7709E2C76AB1A2CB26A821FFEF7F13DDE5D5 jongwit0
889,567,019 *5C88F9CEF4EA12967016C234826E2ACF0A4B49BA joujoux-(ballet-pour-enfants):-II-2e-Tableau
889,567,020 *5C8330D2D2081B912C1A069686466351C3A965B9 JOVANAANDREJIC
889,567,021 *5C89CA7941DF89203B79F0BD68298D705D26DB68 jo#z
889,567,022 *5C847546479BA4C5004CE93CFDA1CB1321EC9B5E FRANCISFOUGNER
889,567,023 *5C8E3C1FB2610422BEB0D15393BC462B3636C5CD [email protected]
889,567,024 *5C880522EBB705B89BA73DE38B72582BB15C56EE FRANKLYNKEEVER
889,567,025 *5C8E638D654750ED3DF2B1164C8D00DABCF1EF30 fredbfi5
889,567,026 *5C8DF43E5A9E01526BB41188F2D4DBCC32C89B81 frederickmcelvy
889,567,027 *5C81CC545821D1DF3181948AD6A967C36654C81C JULES.TESAR
889,567,028 *5C8047257779126F8C4D7F6EF1A1D79F559C1DE9 JULKĄ
889,567,029 *5C8858371D24FB0D4FDE642263F246DCCC5D1AE3 JUNAID-ASHIQ
889,567,030 *5C8D6D3E177225462B11D83C50DA261309B7C858 jytnslng
889,567,031 *5C86DCEDF3DF13975ABD886AB5DE036397888C97 kalibreer
889,567,032 *5C8041355EC2033F30D1ED4475C61D8378EC1A14 KBCOLMONLINE101
889,567,033 *5C888D989284FFF7F9CA31AD3A7862506E0F778B GALZIALSEE
889,567,034 *5C82093FBC78A59F07A876C502AAD739A98EE601 keithvandis
889,567,035 *5C8A8A35AE1D1364B4E0B1327BB3DBDAE40C9236 KelisWasHere
889,567,036 *5C87D331568566C5E06AC3D06696474AF7DDF555 kenn-orr
889,567,037 *5C8A693E60DE87643C1E63D751D71B30DF36B3FA kentonbarreda
889,567,038 *5C8FFE8B43C62F8B11B4181C76D7A328B171C5F4 GEEVGEW6
889,567,039 *5C85AAA6334127FE31F63182FB6C39D70F430541 KEVIN.JOURNOT
889,567,040 *5C8A4CADDC67E6DA295D3015F0AD4DCC96958DA9 kevin.l.boyd
889,567,041 *5C884E9C08EBCDF65607CDF54605AE0F9D47B33B keviticu0
889,567,042 *5C8BBA889E005035FD55B629C59B58C485AB4471 georginabailliendashtheinnocentvictimofthesachsscandalndashstarsinahardcorepornfilm
889,567,043 *5C8B2C29EA20D721572E0BFFA7F6D653CB82C8BE KIB15631
889,567,044 *5C847B20F18959F3E3386D9BD7F98CC60B5EC76A KICKUPS
889,567,045 *5C894C5EF8E9F9C5AA2DA3FAC4C83060A0FF760B KIMMINNER
889,567,046 *5C8C042A45158B626F5FFCC389F5A46A7A06C7C7 giovannilichter
889,567,047 *5C8B57C17996F84537D32BBD30B4C53F8B8290BC GIUSEPPEHEEBSH
889,567,048 *5C8E2C87CF139FC1BD7DCDDED8ABC71F2CB86036 gizzo123
889,567,049 *5C8DF7996CD0EC8E00392FAAF4A60C03CD2FFD11 KNICKETY-KNOCK
889,567,050 *5C851BB574B75A0BC47B302112570629C4AA60A1 GNILATEBTIU
889,567,051 *5C876E68328B6A8999E814C2519697313FEEC45A [email protected]
889,567,052 *5C8A9B22C8EC291D02B63F4341979BE0C7EC346D Konzert-No.-5-D-Dur-BWV-1050:-2.-Affetuoso
889,567,053 *5C87E648B48338D6195D77DF3DCEBEE31B32A8DB KOREYLOWTHORP
889,567,054 *5C850EE040B45053492B7459161CF4356673CFE4 GONNA MAKE YOU SWEAT (EVERYBODY DANCE)
889,567,055 *5C8F5816298F31114FCF96A8E3FDEF0FA4C55369 gonorrh34
889,567,056 *5C83F0C51425332CB5907454E65A688B48623507 KOSALANSES
889,567,057 *5C8504F9A8EE80507DBFD3361EE285F2004D4818 KPATRICK2
889,567,058 *5C8A3F42C94EFE1878EBED613C88B4507C9123F5 [email protected]
889,567,059 *5C8F5F55BEF8359DF2F7F6F5ED2CF72860BE5A01 GRAFFIAVI.
889,567,060 *5C837A7BC634026D4CD46318910944167D837825 kristophervandenboom
889,567,061 *5C838AE1FCC6ADD3522CFA952B040772D7D04112 GREGORIO.QUAIN
889,567,062 *5C89B35BCAF4B92D5362FA28BBCB112BA96C078C grizedalehall
889,567,063 *5C8229DA7A439F71D68E615142705FD5D13C9F26 KYMBERLY JENKINS
889,567,064 *5C8ED5D0F0B0CE18E961F84720336FE7F133FB9E L112049
889,567,065 *5C8A8C199CA21148496FAB1FA0ECF9ABA62C5F1D [email protected]
889,567,066 *5C8EE49D5344386D509F72B8E1E6AC0946671C53 [email protected]
889,567,067 *5C879DA94CAF478B42754EDC9BC633BADD83F26B GVITHALEMUNGO
889,567,068 *5C87E90BB409F547DBA75C2A627BA0DC468D01C0 GZCDOIM
889,567,069 *5C82825D56B836036529BC39A96874B50274857E LANDON.OGRAM
889,567,070 *5C8FA2BDB0893A0DF3AC82BB6E179F6402506959 [email protected]
889,567,071 *5C8116E86B880E139BCD059084646E579ACFEB37 LARISSA-KAPP
889,567,072 *5C8B02230862FB69484C8B58402B0E33904D725F LARRY.PALOMARES
889,567,073 *5C85C8F059A16BDAD6F14E9CB708506226042E12 HALERPETES
889,567,074 *5C8246AEABE2BF4D52DFFA683E53B63DB99A2EDB larrywinger
889,567,075 *5C813EB063853E75F7584580C375F57CF7108F6E [email protected]
889,567,076 *5C8648D4FBD42BA8D99EC78A358C97375EC38C09 lauvives34511
889,567,077 *5C88631D4E3AF3E4DBAF413585046D6224EFBB62 [email protected]
889,567,078 *5C814E3D8075014674FB5FA1C62597700951A677 [email protected]
889,567,079 *5C897AF282AB7D855C929CAE0A40F94036983247 HARLAND.TWEDT
889,567,080 *5C8763AD4B634A3FA47F152CA03248FC7A21CD4F harleybufton
889,567,081 *5C8939D81C45AB83047056EB093619728CD04ADE [email protected]
889,567,082 *5C804827D11B5A66EF3CBAFE2859FED61E2257E3 HAYLEY-NEEDHAM
889,567,083 *5C8508EDC5D1257F98395D2CC6C76CD03A870F97 leightortorice
889,567,084 *5C802EE7F6BA7D8607AAF4881A86B0CF881DD197 HCIERNIHING
889,567,085 *5C84BB6CFEB26E19CA8BB10C5EA4738F54EA7774 LEIZNESS
889,567,086 *5C8B611A486C976D075F57BCF25D06E2035E0C13 HEAR7BIRD
889,567,087 *5C8046A66D5ED6F713D3C9C905611F913DDB5579 LENNYLEHOULLIER
889,567,088 *5C8B292B72AD77FA10C606B95F79982700D99D7A LEONARD.BYANT
889,567,089 *5C83A92FA5C855A047DFC407CEED2F13BBD2595C herbertdogan
889,567,090 *5C80146D9C5AC8BC15FD49F9A3D9BDB07D7CC8A8 HIM.CROSSMR
889,567,091 *5C8457AEE77726F602D82BAAAF4CFCF0F0C29E88 Hip.Hop.Fury.(instrumental)
889,567,092 *5C8638C312DD0EAB4691E6C177D2DA02BFC9EE55 HIS.EYES.ARE.CLOSED.
889,567,093 *5C8C7D38B77D0BE79438943F4625FF37528AD3DA hjlo
889,567,094 *5C856566F209541714A9BDB77688AA44EEC104D9 hmkilxqlqzh3y
889,567,095 *5C835697F37228F208AB6B5D8E65A2220D530958 LIKEDTHETEACHER'SHAIR
889,567,096 *5C8B146356D54590C9E552434301F9CA2F3DE328 HOOKAWORLD
889,567,097 *5C8C92AE67F3660866FB1D4AF606B69F9D96860F hörbehindertenanlage
889,567,098 *5C89D1D9AD3D4F854DF3F9282018071828C46212 HOYTDRISDELLE
889,567,099 *5C82DBDEB98B581201CCA50D56D91E204FB777DC HOYT.TURRI
889,567,100 *5C8F234DCB3F8EA081295CDAD08A4209659595C6 LOMIRA2
889,567,101 *5C830CD2066568035AA13FE1DA59BE7223EB6E9F hueygannetti
889,567,102 *5C8EFFB00059B713F7AABDA426F4949253DFDBB1 LOUHEUGEL
889,567,103 *5C8A1F917FED221B77A7CD901971BA13BA633BC7 louienordan
889,567,104 *5C81876BE15394FE449950EE3F9871D27AC2AF14 LOVE-IT-WHEN-YOU-CALL-(CHERRYTREE-HOUSE-VERSION)
889,567,105 *5C8FA2FBB8493A0CCC307FAA0E575DEE17FCA6D9 [email protected]
889,567,106 *5C83ADAEE5127A67CC77A3603A6230B0E1E98541 Hを発揮することができる。
889,567,107 *5C8108B280FF1AD0BA21B4CE04DF8D88B07F11F6 [email protected]
889,567,108 *5C85B2CD79DA94FA4B552EED0A5F018EF7644BB0 iammilano1987
889,567,109 *5C8416BF3AA16FE4C568CA080ECAC693D0DC2D17 [email protected]
889,567,110 *5C8DA77B103F8B2DF28DFA02413E1C3B8B963669 lusitana78
889,567,111 *5C8B9280FD5E291E775E815BBF162D79A22FF051 M300984
889,567,112 *5C840E7C100A3E37A5B078769A1F5B4CBEB8E10F IGNACIO.BUCCO
889,567,113 *5C8086E13FA1CC85E4CC8CB434F3405EF7585711 IHSUODNUED
889,567,114 *5C8B48FE342393EA8BEC3257D19E5ECD46FC808B IKHLAS-I-NIYYAT
889,567,115 *5C84FA0825053146DD961D5A84CC14C7DE63A855 il-eireann
889,567,116 *5C850576410502BBB33FFA9F558A585315226E97 iluvmontana389
889,567,117 *5C866A6F1BB24CB773B16AE1BDDC20C3C974FE36 manualtolzmann
889,567,118 *5C866A9C1AC3E9B633033E99EDA5C261E85A797C ILVENTO,ILGRIDO
889,567,119 *5C80DC3D3FA219250725B538F203F96C71BA9E22 MARBLE.ORCHARD.RECORDINGS
889,567,120 *5C8A961BFDD225D9BD3CB652589F55EB673DBE18 marcellusmeczywor
889,567,121 *5C8E5CB224FE5CDCC044A073BDCB95E836ACB9FD MARCO.SISTA
889,567,122 *5C8506FD2B4D9C005D3EB6619CA397D534A78B41 MARCSOGA
889,567,123 *5C80FAC12E3B73C622AA81BDD6AE9778CE9B4401 maria.zul
889,567,124 *5C86DFEA551A879CFF5BA608F669AEFFF6B28B49 MARINYELE
889,567,125 *5C8BDAEBCFA90DA54F48D30C475AE1BEF2CC0160 MARK-FAERBER
889,567,126 *5C8DE3278A32BD6D2D3AEF9166528337A18811C4 INNITUDES
889,567,127 *5C8554BCF83E54DD261B6173FC1CF25F2EEB8E7B IRAQANDOPEC
889,567,128 *5C83A151F5FB855E9708BB01E4E60356A284C465 maurice.dupont
889,567,129 *5C8C62512D92890DA9A8437FCB6CABFB65D394C5 MAYNARD.REW
889,567,130 *5C896862C84923CB8EADA6B5067F4605BAD167C4 mazella.jr.
889,567,131 *5C85F2DBB1B3FEF69A96CF9D38B1820FE8C6D61E MCBRAININ
889,567,132 *5C8702E8DE6FDCD83F0E9331DCAAB87CF2800EDF MCCRAEN9
889,567,133 *5C8B4427F23CDA4A50ABCCCC5A999925437D8C86 ME>)
889,567,134 *5C89B2B80FD742802284BB8C9D3F0308E4643E4C IT~O
889,567,135 *5C8FBB85C8E6B8BA51D75856AEBE78DCAA2AE1F5 iwra
889,567,136 *5C8F5AE1468A8369746F1826AA230EC6292B4B87 mendicationed
889,567,137 *5C849C37F189608AE092AB3AF6B3E2D5958EF167 MERINGUED!
889,567,138 *5C8C07E03C7802BD87D47714A5A8AA1BD522CB02 JADE-MOBBS
889,567,139 *5C8CAC6A7AD6C3F937294F4F495C9C7B0AC693AE [email protected]
889,567,140 *5C85E485962179399CFAE4A5ECF56B6F69B56AA9 jameskaiser
889,567,141 *5C828DCAC6B74D2443A8D6BD54BFBBC61D196BB6 JANITZIO4
889,567,142 *5C869C67394CD7872B9193023753F457034092C2 MILFORDCLISH
889,567,143 *5C8A17C0B864B39300945E127274947A94E20F3E jatinder.shergill
889,567,144 *5C8397ED72CF2728BC81743C1C02E5B3ADB53AAC MINDESTNIVEAUS
889,567,145 *5C8C838CE6AF0182383A8BC50027A5C41482EBD0 jeanpanchal
889,567,146 *5C89B80326535BA1E5F786979C79AA041EA6CA31 JEFFERSONGALES
889,567,147 *5C8D1908A6E7C6B7B4744FE4DE86DC51601C79B3 JEFF RASCHER
889,567,148 *5C8DDE45B7176853DC7BA6E9976A5AA0A573E8AF JEFFREYLABORN
889,567,149 *5C8AC9D5B555AF9FF20428F9665BC38134843C74 JERALD.GUYETT
889,567,150 *5C886FD7DE507FD6D4DABC91E2EDBB9A26021D8A MOHAMEDSCHARES
889,567,151 *5C89BC50314626F44CCCDEA2FF179CEBC741845F MOISES.VEVE
889,567,152 *5C8D29A8A978E3BF5BE092C986EB37C5BEFEDE75 JESSEAMER
889,567,153 *5C8D65760681710E69873A5E5AE13FF89BAA8255 MOLLIE629
889,567,154 *5C825BB0FECAF0F208420750A54F0D47C57CC6C9 jessscopa
889,567,155 *5C8D5E18B5AC33244CD98910C94ECDB0F8D74E0E MONTE.GUSTAFSON
889,567,156 *5C860C90DC55BA547FA00B13BA5BAA9E2F8DBC8E MONTESTONEBREAKER
889,567,157 *5C861F9A2EFFD4AE8232FC814E40EE9F7E8A1E32 JIANGCHUNNIANG
889,567,158 *5C8A2EEE3C174A44C6BD5802B0905FCFA58FF864 JIHALAGEDAEA
889,567,159 *5C8BE682B60A69FA0A547469AD119806407287DF JIMMARNELL
889,567,160 *5C802DE4BD2A0A36A0DBCD6E82D225F46CA0F754 jimmytortorella
889,567,161 *5C8FFC94DB87EF7C14C982DD6DB5EE9AE459DA83 MOTHERS-AND-DAUGHTERS-NOW-MOTHERS
889,567,162 *5C81865778DA3970183DCCE2A9BE47B9C1F9B19D JJCARLETON
889,567,163 *5C826582698A8913712988440D58F43F088E9A47 MOULOUMB
889,567,164 *5C89C3D4E6581BB0C744D84DA918B9947A3EA08F mozartr0
889,567,165 *5C84C6B96ECF63AEB83B5BB081915A38CD5B4878 JOELALDREDGE
889,567,166 *5C8E88FF19197B5F30B0A3D7AF45E6F9F3EDFDAA JOEPASION
889,567,167 *5C8FDF105B7C768D96E30AE280AB71663D584AC7 jokercarlos
889,567,168 *5C8FD3AD63B5A2FA3DDCE4F97442C77231FBEE03 jon-cromwell
889,567,169 *5C8D333A5EF522DF41D22DCA224439D69ADE748C MUSICA DE SOBREVIVINCIA
889,567,170 *5C8B50FA5676FF53A5F550283DD39F0D75E31AC9 jonnyhannon
889,567,171 *5C8538487731989EB7B5FE8CBAEBA1BF4B118098 [email protected]
889,567,172 *5C8B7E70F279862E32F12FA5725AAD9BBC0C963B JOSH.MANTO
889,567,173 *5C866F29B4023A1D3F2041CEE3604356E29BC2FB JOSPEHBRIDGHAM
889,567,174 *5C885666A3F3A2C870140B0840ECE55401FBE04B JOSTLEMING
889,567,175 *5C8AF5448AF90FD2509364EAEAAB1D2F56C47CC9 MYLINDSEY27
889,567,176 *5C8CCDDF518DAEFADFEF61C5ADE3DEC73A5F3D7C MYPAINT2005
889,567,177 *5C8C2EC4CCE8E62898B3B2A0286BB718A354791C MYTOPCAT2010
889,567,178 *5C8A6E1C9F10CA9D40AB6B97B7660346B89DC803 JULIA10061989
889,567,179 *5C85F5B22E52AD197AC357BA1344818C0C1988F4 jungeseuropa
889,567,180 *5C8244751CF7FDAFF4E1C0A1C17C0935D8FE85B1 nancymbooth
889,567,181 *5C892B2BAB1324A15AD9B4C9BC2E8C6D18E9FE0F JUSTINSURO
889,567,182 *5C87F1735DC92894148882869E6E83B3BF247290 jv6s
889,567,183 *5C8D0ECCAB25624624AB28104520119E637ADFBB K2142266
889,567,184 *5C8EFA0F3F814817993F593B4B955BB9074870F1 KABAAITJE!
889,567,185 *5C871B48D8F7EBD2AE4535EE8C357D151435B987 NAVNNAVN2
889,567,186 *5C823CD37BF30293DF5B72BB52824A27B245942C NBSWVIT99
889,567,187 *5C8CA63B989F399F99BCB48D4793A53AAE034BBE negersta1
889,567,188 *5C849153BB4C529B1BC03AF82224DAD1FAFB9F44 karlos-lopez
889,567,189 *5C83EEFEEEC28A276308448B15A4B828A55F6BC9 nesnakis
889,567,190 *5C84DCA99F8AFDB6A2C1C5FB6FD61CDD0B05236B NETTIUR4
889,567,191 *5C86D477C20D8EF28B379D5BD85AE9AAA2E16A1A keesee205305
889,567,192 *5C8CF0F9A47FC04EB71D5E1F52D835707282F46E NEW CHRISTIAN MUSIC (10" SINGLE VERSION)
889,567,193 *5C84B033B3630F7A84F3714493E87E6F215B5F3F KELLYMANDIOLA
889,567,194 *5C804EBC2B722BB89190C393EA1B2015394CB475 NEWTONHUSCH
889,567,195 *5C847DE6224F9138131470556A6AA4AD081C6A16 KELVIN.ZELINKA
889,567,196 *5C8895A61142942FD053179A2ACC1AB02F007ACC nickolassporich
889,567,197 *5C8AF0AB1AA09111413ED9C51C99E15D1FACF759 kevin-kienle
889,567,198 *5C8AD0F98D027996039B9018D91ED62086BDCDF7 NICOLAE COMAN
889,567,199 *5C80F7DAEE20569042B3C6142D1BBE965702D89D KHALATHA
889,567,200 *5C85181B1213E296D9C1FD6664CA212002E52062 KHALID.MASOODI
889,567,201 *5C82AFF5C3F7592235E910D3C19B219DF61C5098 NILCIELER
889,567,202 *5C81AFD62B2AD82908211CE9C963CF00AA6AC093 KICK-IT-ALL-AWAY
889,567,203 *5C800BD2F8047B60F1B0AF8FCD136AE58FAF2D2A KILNER.JAR
889,567,204 *5C827AB45ED6366BBA5FA3B35549776AD5A1ADB6 KINDERSZENEN,OP.15:VII.TR
889,567,205 *5C8E4119DE50B96944C00FC355860398674E5642 [email protected]
889,567,206 *5C823AEFD79090C3ED8DF7FCBB73036038B8E5AC nobody'shistrory
889,567,207 *5C86F1D96A3F9636F0EE7705614542140C55F86B NOMINATIONTO
889,567,208 *5C8395F6F0FEFB7E436B9AA63FC9E164C1EF01A9 non1n5+1+u+1on41
889,567,209 *5C82A92CCDEB65DF9C5298A6E665BDC0B66C81A3 NOORDWESTELIJKER3
889,567,210 *5C858F608BD574F1D29FA8901DE66E4CA6A95FA3 NORMAN.PANG
889,567,211 *5C8EA3B8B013D1E24F96AED968E58424D9B5DEA8 KORY.SYED
889,567,212 *5C82215B8F25CB09B23C9568AA7DBCB5BA7D1D3F [email protected]
889,567,213 *5C8E2DA640AFA5974CD64CF4878B27170A19C4F6 KRISSPRAYBERRY
889,567,214 *5C816239903AA5B194657CDB093EA10CEC5F8A3B kristoferkostiuk
889,567,215 *5C892D6F148845DAA75CA8B86000A18874D2E01C NRTCBRI
889,567,216 *5C8A8980BCA3C32FAA5718DB302627C7F1FF992E K)U0
889,567,217 *5C8C14C9C0F84CE5D9149EBEAB81B797E1858658 KUNJAPPA
889,567,218 *5C8FCF33C55BAE5A6A69306B5D19663382BE4A5A kyle-maskell
889,567,219 *5C8D54353231B3A121ACEC847A3886BAB2B4872D OCTAVIOBALZARINE
889,567,220 *5C83D51B8600E7F6D14E09734097659ADAE3EFD9 [email protected]#$%^&*
889,567,221 *5C8C67EDC43A284A73F755F75E48280CCAA297F7 OGLEDA
889,567,222 *5C89DF1630A1764F85D75C38CE40CCF4309D9E79 OIE813
889,567,223 *5C8136416EA4F9579FAA52C9AA865DE07716FEC8 OILONTHEWATER
889,567,224 *5C8CAE47107BAE02C86A0D953037295A9C469A26 OLIGARCAS1
889,567,225 *5C87F3DE607B8AC05579C19F865906022911DEDC langerhausovih
889,567,226 *5C844D00BEC770DD4037A90913B16A277DEDD215 LAVALSEMIS
889,567,227 *5C8C7FB7440F7B9EBFCC0EB207A3F31EB739B06D lennytesten
889,567,228 *5C8906AA396EE2EB09C2520C2DD5BDAAF9E79D08 LEN.SPIEGLE
889,567,229 *5C8CE494EEFBCB85CA21E7820909E7A5D5A37604 Os-outros-rom
889,567,230 *5C875E1FE1D027DBB8DD68A938651C71EB807A76 LEONARDO.AGUNOS
889,567,231 *5C84ABA4982251E5277D7022A156D0F748915031 leopoldobyndon
889,567,232 *5C8C0DCCF773E4BF257CF242F71C06795EB243A7 leroyklez
889,567,233 *5C8B9F7D57478A23A888B61C65787F1F3F963E61 overdevelop1ng
889,567,234 *5C8A72A373D73EF1B67A4F7C629C2224DE82E2EA oxozonide?
889,567,235 *5C868A846C9FDD1EAC383F5D3C5016BA970F7EAC [email protected]
889,567,236 *5C8315706F9F3BAB61B70389FC6D6C1DAC0B9753 LINCOLN.KARELS
889,567,237 *5C884D8E2BF85B0516F9B29A55EC83155B67F45F PALMER.FERER
889,567,238 *5C893E574E5EC2F3AA14495EEC80336F5ECF8327 PALMER.GRZEBIEN
889,567,239 *5C87E6D595FD7CD0854745F4ABA4AABC3AAFD362 LINWOODTAWWAB
889,567,240 *5C86AB950A83E4331A21CCF72377266024B47830 PART1:PRIMEVALNIGHT,CHAPTER4-3:THELEOPARD
889,567,241 *5C8DE49249DC523D55B2FB653C30E3BF3271E0B5 [email protected]
889,567,242 *5C819EEA640A06D311B068ECE14B2D1EB8F5C723 LLIIOSWOCZEB
889,567,243 *5C8CFA921066BC71F7296EB5BC01AD5A71866BE4 LNNE7$
889,567,244 *5C80B847869585002794F5BF4FB1575DCC5FA05C PATROCINOR
889,567,245 *5C89A21078495644FD924E80AEF3471BC1504432 LONNYWETSELLINE
889,567,246 *5C8D30D2886341731A7923DC389286D82326EB87 PDEVANGI
889,567,247 *5C8A8A82094AD667AF5EC30605A01BD2FD724EE2 LORKEN6
889,567,248 *5C8FC7B8E6B663459861DF132121146616938017 lubriceren
889,567,249 *5C82F91E2C6A3DDD0DFCD5C55DF5B0A231BC35E8 PEZIGE5
889,567,250 *5C85F7A22FD28EC3345C7886EF9BDBE1AF056784 PHUMKACHAR
889,567,251 *5C8F15B59C2AE0F00B640CE04CE4EC1C38544C21 PHUSKER
889,567,252 *5C8123245903DA4A679494C78B56082930AB32F1 lukeace2
889,567,253 *5C8224F11EF18CB26D50467BBE736054715BD7AF LUTHERAN?
889,567,254 *5C8749D9D69AA601F23237DEF066854871FC3ED8 PLAKPRENTJE
889,567,255 *5C890B13CAEFEC2D1A133999153EF0F240A0CA42 PLC<
889,567,256 *5C81CAC01F35383E1CE1D92C8F0389A143399A8F LYNNNORDINE
889,567,257 *5C86CFC29278FA22C6E9F0E10130A95D6C019AB4 lynwoodkupfer
889,567,258 *5C8F402B2E3180B31F8E95A8A7BA6C67AAB432FD LYZ2892
889,567,259 *5C8086007751D0E15D8D7E5AF00CBD35BC30C033 POJETR1234
889,567,260 *5C82D2BE8E9510EEED343553C8370573FA2DE7B6 MACEDOINE123
889,567,261 *5C8FB6CEBEF21BA660CF80B60E84699A7606F264 [email protected]~O.~OSPLAT
889,567,262 *5C81E225A288B89F131954C42083A00FC05B2E54 MAKHTBANOOTH
889,567,263 *5C89529C0F91348665B3763F0CB6CDF96C52D76A MAMMADGULUZADEH'S
889,567,264 *5C804E707AF791ECF9E4BCE2815782EDFB7CC1CD margaritoomarah
889,567,265 *5C8ECD29C682C8007DA80A67378E23E3CA349894 princesolman
889,567,266 *5C885E8DE4342209606CD3481B293C65FD238E66 marietai
889,567,267 *5C8557391C1B1756BC88EDAB1D9B4BE3F392E5E5 PROLOKO
889,567,268 *5C875E5FF832116B1E4ED8D902943CACA1C3C0B2 prompted
889,567,269 *5C8D87F7C639EB153741A4C60F561F74FE48AC9A prozirnost
889,567,270 *5C852F8080466E22F8CCB157157C6426C83CAB4B puppiesanna
889,567,271 *5C898D2951FFF1962342D6E497C8C627D246A64B pxsspxls
889,567,272 *5C81761F6DEA6E1D83C448B050CD6BACE55E3185 MAX.15.
889,567,273 *5C8DF51923D1ADED41EE932185F384FD654B50B5 [email protected]
889,567,274 *5C8DB0A958611388C09470FBF09328493D8E7E17 MEALYBUG
889,567,275 *5C8A91D9B4A23A1E2E78C6D217A75B4EED220A6D MEDEBEAUDELAIRE)
889,567,276 *5C8A5B4F8F29658C214F5129AFE41D66A95E8CF8 megknox
889,567,277 *5C8C975D49A8520907FE08739AEE2C172E6081E5 merle.beachy
889,567,278 *5C824EA1A9409DA1CD30C29AA7F4DA70D2663BD0 quintonficher
889,567,279 *5C8020073C7BE0CA704EE367611062A1B72BF533 RABBISE
889,567,280 *5C8FB51047A3034DF90193FDCDE91680F9BB9EF8 RAUL.GUSHWA
889,567,281 *5C86A9B7142D8ED51688A64C0FBB9FD5DCCC4AAC mitchkempker
889,567,282 *5C81A06DD8B9A6704D54E457B91AFF9F8E72C0C6 [email protected]
889,567,283 *5C86A7FA5D5953566FC73D946D18B3F087188534 MOBILIS1
889,567,284 *5C8BB55FAA1EF0C897CD428CC49B633497491F01 MOEHRLE0
889,567,285 *5C808A3F8CAB8F8F1769CBD2F08C97C863499F81 MOHAMED.BRADWELL
889,567,286 *5C8033C3327A9D431B5473256A7FF642CCE57C87 mohamedwacht
889,567,287 *5C8B445ABF147835134AFD71824855759111D9E6 recourrai9
889,567,288 *5C8BE61A9871FF9EC319214BFB77ED353A3347FF REGURBTL5
889,567,289 *5C8F4179FC03375D38E2484CDF7E591C5FF97AA5 REHSIFXINEOHP
889,567,290 *5C8C1A5EA3FA3A6AD3B80A7A8A538439ED627CF7 REHYLLAEN0
889,567,291 *5C8CE6EBB1338CE9A360274C139B30A796434477 MOST-PRECIOUS-LOVE-(FEAT-BARBARA-TUCKER)-(BLAZE-PRESENTS)
889,567,292 *5C8806312374A56E7016C5BD862968967FD407C5 MOTIV313S
889,567,293 *5C88E74AB1D7F14A0EC98D24D815C55313A52BA5 reposerez3
889,567,294 *5C83FD47A7EF60221B09D530EDF509D40BA03A54 Music.Market
889,567,295 *5C83B2C5AF0E3E4966330249D1A68E5C9D9D0D06 RETSAMYLLIB
889,567,296 *5C826EE55DE7FD3F5C5C2B43632BF741C9A077A3 MWEISFLOCK
889,567,297 *5C857F263C8169AFEE585DDFE9A95E5F93CF5D4C REVOLUCIONAROVYMI3
889,567,298 *5C808838B12A908D2F2F43D9FECB0BE33910DDC5 REYMIL-CASTILLO
889,567,299 *5C83D9A42767C58197DE418D2D4A39EC801A0108 MYRON.GUTKOWSKI
889,567,300 *5C827BD2B9B96DB01BE089269E258F1AAB3FC925 RHETT.HOPFER
889,567,301 *5C8CE7F8063BBBF47FEB818D5865EAEE6C086FB5 myustinet
889,567,302 *5C8334B3D9A9CB5DB7930D88856B4F4B566A5CB8 [email protected]
889,567,303 *5C84602B5CAB2597C39E966FFC998F9B3442CF3F naniboy
889,567,304 *5C8DA8BFB0BE402CAFF39C2060CAA142AF6CA718 navorser
889,567,305 *5C8F63CB2E03FB2305F1D5B02C25B148038D40CD nelsonbunal
889,567,306 *5C8425A64020C43CD175CA19352FE9BDA04868B7 RODINAMIS
889,567,307 *5C82520C414AE285EC7F661D95D7BF7357643BB6 NIGHTMAREK
889,567,308 *5C8E27732956CE97626423F39A244657E4E9B316 ROSCOEINOCENCIO
889,567,309 *5C86992F9046771A7F22C32D46DEB81A16167C41 [email protected]
889,567,310 *5C8D3075E1F182A4D29C374E5D192AE37EF387B0 NNMLCHD3
889,567,311 *5C86B8F1B76C0EB68BF8AD9840CEE5029D7FE275 ROZMYSLENOED
889,567,312 *5C84B177436C5D4F0BFA192094436471E8343817 RSISJEM
889,567,313 *5C84D2AA38C69392D9E7F89CA53D1A82424BD595 nonobservance4
889,567,314 *5C80FFB99C1BBB872025A6437C0E84605F356FF3 rufuswalentoski
889,567,315 *5C82088CDC8B7E03C77B24EF6F536F6AF7EB5116 russkorpela
889,567,316 *5C892468BDDFB2EAC4158E6661FEB2B93C3ECFFF RUSS.PARAYUELOS
889,567,317 *5C8C974F919380C09AD9A0778F9993EA6BB0FAE8 RUSTYNIESS
889,567,318 *5C8C9C043FAAEC5DBC772DCB1EA423385BBB5956 [email protected]
889,567,319 *5C86AECE397FB42FB231041500588DA6365ED148 NSPEKTIE
889,567,320 *5C8C0A5F29D7107E24EF8F20B613E30B6E342CDA NUNOMIGUELSILVA
889,567,321 *5C81814438835C333A58D4DDC3730D041BDADE02 RZOGRYWKI
889,567,322 *5C8DBA2536600F947CC67905AA5BBEEA8D536CDB NYUSRACE
889,567,323 *5C877782D996CF29EA7A3D0CEC213A39D787E574 ODNARUSSUS
889,567,324 *5C8FED9A7CB29D459B1ED5831668572730DB1B32 SAMUEL.BODDY
889,567,325 *5C8F47CE3F333A406DF6B59B80C2962EAEBB9E08 OIDILI-1
889,567,326 *5C80BCF19B4589EFABAE8F1444BB378F105EE6F3 OLESTANE
889,567,327 *5C8870E3E7F1D00D6514EC50B96ECFFC3F01F2ED olliebuehler
889,567,328 *5C8142EE02C3B1CEFF7913F068EBAFC9EFF02B2D OLLIEDELOSA
889,567,329 *5C8E8404D6373314452420053C815B876CA0C51D OLLIEKINTER
889,567,330 *5C8A479C87238D9E189902A9810E1C138B247CDB ómama
889,567,331 *5C8AEFB5CB066C2611120A9220EFD3E7530FD08A SAUL.MUNDER
889,567,332 *5C8BD955E66BA358A36E3EE25155C7F71BEE6B73 sa.vaasaajjagaama
889,567,333 *5C89A7DEB44093C522DBA550679E1A8C6B7A4B26 opvuldens
889,567,334 *5C817F9EB89BB2C785E52A1D081B34CF74B97036 [email protected]
889,567,335 *5C8E30E380465F8F6929FBDB40A505C116D1CCB8 ORENTINKHAM
889,567,336 *5C89F0BC448DAAE50D6DC0DE5C4F2EBF01A6046C scottielakatos
889,567,337 *5C8DB37696EA50B24847CA0A3B40EE795CC5A798 [email protected]
889,567,338 *5C8B5BED2B25C0F1723E92EB4EF70ACE8BA8CFC3 SCRDDLD6
889,567,339 *5C8EFC87644E3940C6AA9D626DACE9EF63BEC590 scrpmnt5
889,567,340 *5C82D8A6BEC7BD991CF5CAF41D7C138DCF4ADC1E OVERCOAT,-THE
889,567,341 *5C858C2DCFA3016E82F2AA8681D81ACF12DD8D5C P161636
889,567,342 *5C8554886EE793CD261106B3C4F845EE1DF2233F p9yz
889,567,343 *5C8E1BB41652EAF3BE6CEA0261F01A8DF89EFB0E [email protected]
889,567,344 *5C8B7123C4CEBF1244A4F8C6B01983E48D076FF1 PALOMAMONTEMAYOR
889,567,345 *5C83F586B7150072F5DCC6DED84133746187B1B7 [email protected]
889,567,346 *5C82CFF13AE7D004FBC3925900FDD1E198499CA6 SHANE.MEJIA
889,567,347 *5C83DD797FC07A0AB9C60BBB7CEE94ADF65C32CC SHARKADELIC
889,567,348 *5C87F91E7945D4AA700096F405EDB22A91231A96 PAYERAIES
889,567,349 *5C804649B683BB7455467F41CDBBFE67C3199A7A P---B~0~O-SPLAT!!
889,567,350 *5C876BFC8626046B72CEEDA47974CF73FBE7C3AB SHELBYJUNKINS
889,567,351 *5C862468FDBEA174805CE4590FB8E7B7ABA166E6 SHELBYLARRY
889,567,352 *5C8B4884F33BFD16555D30AF329F4153821AB13D SHERMANPOMYKALA
889,567,353 *5C8B6E8E39F75F1A883636CC711C9793359E8DA2 sherwoodpelch
889,567,354 *5C8BBF028F3CA916126D5B123D0A5109CA65C76D SHIFTING
889,567,355 *5C8BB09297490A96CD792EE871919144E506F325 SHŌHEKIGA
889,567,356 *5C8F8F24765810CBEB14C81996A7CECC9BF98AF6 PERSIAD
889,567,357 *5C8A5C4AF26D1AE043614F268DCAB1153FD91B2D SHUNTE3821
889,567,358 *5C8D844EC2B7BCF65FD88A59B6B169AA83EF085C SIBIPURUNA
889,567,359 *5C838E7A20AB406EB0004D599925510C90B63FF6 Phy50pa7h0l09c
889,567,360 *5C89E4A90C7DB11224E2F2C7F412069463E73C07 piano-music,-volume-2-(piano:-benjamin-frith)
889,567,361 *5C8EFEB23F747688C34AFE04DCD96ECF96EE133B SIMONBARBAGALLO
889,567,362 *5C8AE50C8263503216DEF3778033B4CBD3935E62 PIERREARNAUD
889,567,363 *5C865AD85E0A13D9B0DABEBD08FBD5A5AB34E716 SINGERCONRAD2
889,567,364 *5C8E145D2364D821D6F97289DC107339FF9735FD SIRREE
889,567,365 *5C835D50B79935570D264086866624B35CE156CB PMADUBELA
889,567,366 *5C841FE2953ADA538CF8033848D54D4F4C69F6CC PMGUZUMBI
889,567,367 *5C88440F593FC16A8ED827094A65085BB74CC8EB SKORPIOEIDHJ2
889,567,368 *5C85BB70BD0636D44E92E8797EE741CA6DC85354 SKSILAKRAIRTAP
889,567,369 *5C84D097633BBB5AE0220B626DC7CD01F151E3C6 skyjam
889,567,370 *5C804F87825D2F3F979D99B129D28AE7BC9D7C19 SLIVNYAK2
889,567,371 *5C80356ADE695B3D8494839E0D54760E2D7EAD95 SMOKIN'.CIGARETTES.AND.DRINKIN'.COFFEE.BLUES
889,567,372 *5C8E9470658F8E0F4489D6115B64264257633892 SMVX
889,567,373 *5C882FCF837CAB908273CC56922ED66A8F4C95F2 SOBSLAAMREKKA9
889,567,374 *5C87565CD76ADBBEFC11C8B3FC591555FCF41CDC PRANALL
889,567,375 *5C8C84F5A69A5A81CF1DCA787AC4A87907F71F20 PRA.SEMPRE.NO.CORA
889,567,376 *5C8880BBFA96EDD0FA956A4D85C3F2D36C8BDA4A SONGSFROMPORGYANDBESS
889,567,377 *5C8E7903E47D246D560F95C65F865C9AC81CE58C SOPRASATURI.
889,567,378 *5C8F6E8D65F751CCE3A0FAA0E1FA1A9AB3D43706 SOWMYARAMANUJAM4
889,567,379 *5C8F983740DB7ABA278601BA7F0AD726426A0ECC PRINCIPALITIES.INCID
889,567,380 *5C888D28E8E362F1972BC36A4FE0533618BF4FE7 spaniardsfighttheirrighttopartay
889,567,381 *5C83EC3868081ED468548946C3A5D47CE408A556 Pro$er
889,567,382 *5C8D1FAE4844F36F32BC534A89078E57E454F566 [email protected]
889,567,383 *5C88FF5F2A5E6BE339004A373A95DC3CAA64632E spike6363
889,567,384 *5C804EF47F0B74D3FFC8EF4E6B53B03C4FBECBBB [email protected]
889,567,385 *5C82EDE67CF8E7595AC969E258F254E7FB72229E QADOG43
889,567,386 *5C800D7A2947B89EBD69B9BB4D1871EA6DA84210 spuriding
889,567,387 *5C8EEDF2FC353D18D853A7112F01E718F29189BE SRC=///ECXIMAGESAMAZONCOM/IMAGES/I/11TFG591PALJPG
889,567,388 *5C8DD99A4D8070CECC1229379F028BB8ED081D8C srternator
889,567,389 *5C8DE561859C287305409574B4F8DC36E7C701A4 QUADRUP1!CA7!ON
889,567,390 *5C81F4C666F66B826A07AC911EFCA528ADEB9679 QUINCY.HEIDMANN
889,567,391 *5C8D08D1C702777E439AF87F916352E8402718B9 QUINNBALASH
889,567,392 *5C8D33B588A763F70237F895F0A19F19C84E98E1 QUINTIN.FLOROS
889,567,393 *5C8E3E651C4209A4E9D05A82DE385FE137BFBE47 qwerty12number1
889,567,394 *5C8C3A70CACE1D0A0753E9D9043FF77C05FB8E8D STARVICKY6
889,567,395 *5C84F73950843A3DE98F6211F36D013F3D8B63F2 R83-73
889,567,396 *5C830001539075DD8A71CC661C74369A313F7083 racemisms3
889,567,397 *5C8DB0F84E544382A0642ADF4C115F31649BD3BA rags.and.racers
889,567,398 *5C8AD1E20A551E7C6B9DEB7C0F583B1B355DF9B1 randyrivers
889,567,399 *5C814DBE9BE6B3A94871A9BF61F78792633DF159 stronski5
889,567,400 *5C82C04384C29FA82B1B99C636B41C186108D4B5 SUA,IK
889,567,401 *5C8138622856E2DE6B299B4203E74FC61EF3D5A6 RAY RUSH
889,567,402 *5C8DA7577A8482B2385B621120E69C9B329E1723 redeamus1
889,567,403 *5C86B656FD5F1EFEB5976519D52E8394BDBA14CA [email protected]
889,567,404 *5C8B6826B7ED860E69D49B90AD248C8916C05724 SUPERMANWINDSURF3
889,567,405 *5C83C4460BF3803EE968F9944ECF86467E8CDCC7 REIEOPGNIDDUP8
889,567,406 *5C8282DB8F5F72DBB447E12CCC56C1E95BB846E6 REIKRAUTAANSING
889,567,407 *5C84CE3CDB2F01D87D406254BF509C2296022F43 S~UU
889,567,408 *5C8ABDDFA694C04837CE8A0B1054C0EDB5C63714 REKORREKT
889,567,409 *5C816071257321D3C51B84A03A5EFA3A5703B931 SW33TTOLY
889,567,410 *5C8C1E5628FD3F4F8C7CF07677618DF90765DB8D sweetiegoober
889,567,411 *5C8C7FB1CABB6E6C6A5BC302BEDE0288E550812A SWINGINGBOPPERS2001
889,567,412 *5C82376EA2C024278BBF49A9CC806E8EA5B962C1 SXPTFLBWWCSN2
889,567,413 *5C8CCC89A3C15DA0848B639F1BCE53ABE7006776 renards6
889,567,414 *5C8AB5C9530C42E3ED7FFD3446932DCE29ACDBAD T,3T
889,567,415 *5C8A835821F35697F3BC442F3FC2D0D4D5C65CCB retonza8
889,567,416 *5C88D442989E6AF2600143A07650E0704DEF06AB TALKBOGARTS
889,567,417 *5C8C592149979A7648D37ACC197CECEEC5227479 RICHARD.ROSENTHAL
889,567,418 *5C8F301881AE17019EADF667A345B1B2B96D4A77 RICOMCFEELY
889,567,419 *5C8E95DC09DCC1E636A80B815A37D0E713380E91 tandk
889,567,420 *5C846A2536B82C08F968FB9D31BC7F96837418AA tang ye
889,567,421 *5C88D440D412E44AF99217CDA7721AD235BFF1AA TARIK-WEST
889,567,422 *5C89C1C72967D3DC216D47E4DED5BD4D9649F4F4 robincastaritas
889,567,423 *5C8ACAB3FDD693F95FC64955F99A0BF22C55F3A5 TEODOROMETELUS
889,567,424 *5C8AD8D20ECC2AE44DF512416B4B39957D444390 TERRAGUY7
889,567,425 *5C8B7F4B74A983B696899543807AA54CB4586BBA TERRELLDAGON
889,567,426 *5C8B961CCC1CB6FAEDA31C6ED3245E0962D68F5C ROMANBLADSSTILEN5
889,567,427 *5C8B26B54327F0E2A94D1E9C2FEC070CC9D33F01 romni.(romafrau)
889,567,428 *5C8A33B288B09B5DD9C941D4D73A1E9D6D14DFE4 [email protected]
889,567,429 *5C87A70076098F67DD949D1C2A6905855C72CD07 RONNY.RIPPETOE
889,567,430 *5C8E701E3035E34768C900590F8F1A7A6C18F747 rookerymedicalcentrecoukwww
889,567,431 *5C86BC89A3E803C54628797F9A26F29ECD4ADFA6 ROSETIGER6
889,567,432 *5C8183D7D6E46A8AD86A89FCA399AF1E28AABC7F THEAETET
889,567,433 *5C84259ED8737AAE03BF9239ED30AA6998ECDCF2 the alien conspiracy
889,567,434 *5C8520B1347B690E82BD8D2877F314ECD3B3D7D1 the-bolland-project
889,567,435 *5C8FB0A9AABBDB6AFEFC9CD9FE7FFA490795E4F2 RUEBEN.MACKNEY
889,567,436 *5C8831569753885BAD143A6CFF99B1CE7AC312CA RUFUS.SHRYER
889,567,437 *5C81B3A273AA3A51DFC8306DF711DCC8D1A9B417 THEPACKRAT20
889,567,438 *5C8829B2042F58265E5401E1B3769E6511A85036 RYANCROXFORD
889,567,439 *5C8FC0F0F29955B111E718524158AC4B066E7FB4 S8390310
889,567,440 *5C8E750B6E2EB0701556C32EAE0C2AADD131E338 sambalove
889,567,441 *5C89CF6CA8779CD394D24F043158CCB78CC1BD77 SARAH-MACKNEY
889,567,442 *5C8117FF1860218555B7B5CEEF75FEA0C202B982 sBn
889,567,443 *5C85EA32C1F3257282C4D177FDAB41EA28C032E4 [email protected]
889,567,444 *5C88F63887F80D9BDF53A94235D2713559753E08 TONY.PROBERT
889,567,445 *5C8E5D04D709B5CB39F725AE0B703291ADC27A1E scott.yonke
889,567,446 *5C8734F1CBB40A58F2A6087704130C53D3E76E53 TORYMOREY
889,567,447 *5C848D8F6D5642610E4D6052547F8D1208D7DA36 TOTALPRAISE
889,567,448 *5C89C4537E99774ACAD363B95E5CBD51523E0022 SEANMATINEZ
889,567,449 *5C8040D9DEDC0A2F5BE3368C3378E2360034431A See-you-in-my-dreams-(To-his-wife,-before-leaving-for-duty)
889,567,450 *5C82EE7945A07F314DD10B2B886FA254FDC963EE traceymahunik
889,567,451 *5C8807542A50A81987812149A12675F7D01C5C93 SEHTNAYROD9
889,567,452 *5C8CBB3C1435F466AF000D830ABB8F8CEB93DB2D [email protected]
889,567,453 *5C83348B3B263E70FC64C4267B08A10A9AD6028D travisbecknell
889,567,454 *5C835604C97E50993F09E01314EC284A8596B28D SERUTUOC8
889,567,455 *5C8865042DB5EB2A5425B32DCD5CB9A264D747AE TREVOR.WORMUTH
889,567,456 *5C89DDCAEA68ECEF7113D5C9171B5BCB5A4E44B8 treylorette
889,567,457 *5C81E4AB1C8EAD7C9A24B0A30B720E151BC4B24B SETANEHPS
889,567,458 *5C8D3A591927C803FA96259562ADFCBEE1C924E7 SEYCHELLIEN7
889,567,459 *5C879266D89E38EA16CEBC01D75FFD2907E500F2 TROQU
889,567,460 *5C81119AB53343949B132F2FC88AC36AC8BAE7D0 TRUDGPIT
889,567,461 *5C8DBBB2C84C60D0A5390038F72F696435159E2A shandy-satria
889,567,462 *5C815D52A2855B0837B8E89E40223C4BC879E2CD tsc=
889,567,463 *5C86A8F81300E10CE2D5C6BC736C8396AF9A757D TSESSONE3
889,567,464 *5C8773EC4457ACDE587E9D1E7886A7FBF95FE991 [email protected]
889,567,465 *5C829EB60D43E161BF20CB62EB404B4C7284B588 SHARONPEARSON
889,567,466 *5C80E608A7E5E375E525249BADA8DF47C0F5BC46 tteaftv
889,567,467 *5C830DB0ADD791EE0EA193158CAB92C403AF0849 ttenretni
889,567,468 *5C8B0DE9CB8AF963D58AB3F573A3B3889F972494 TTQ<
889,567,469 *5C8A72C7003F9619575CC7BAB84E25E15E5DE007 shebahonda
889,567,470 *5C815997B2F4E97872D2EF8B275F41BC7149B49B shelby.mouton
889,567,471 *5C8AAD2653DF23D148FE7319CC3E56B17FCF4E21 TUNDE.BOSU
889,567,472 *5C84625206C09E3948C8DE2BF65A59EAF212088A TUONTIOIKEUKSIA
889,567,473 *5C8E6B0EB6D45AA1F4963F189AD66B1C0BED94B7 SHERMANWILKINSON
889,567,474 *5C84B7D703891B27578BCDB126A6E6BA42231DD0 TWEES.PETCHAMNAN
889,567,475 *5C8604409A3354B681B009F4682DB9615B818BC4 SHIFTING
889,567,476 *5C817500E0F9A81C1F03A22EA5C14C56D3609E0B tyronevessel
889,567,477 *5C8FDDBFFBDA7AA58141D32448BE832192BFBC8C SIKARAZU
889,567,478 *5C8787114FEB337617597367436C9A5DCD3CF50B UCCATOON3
889,567,479 *5C88DD26B491B9718BD9DBA32D903A55F6715FA4 UCEFBELTAGY
889,567,480 *5C84C5A7044CCCF250CDF552EBC3918AE9CBC699 Singles.Breaking.Up,.Volume.1
889,567,481 *5C83CE6140A7D5BC98E66BF3C09E2D2A77C1FB93 UDM6
889,567,482 *5C83719418D8099F2CEEE98AB37C82715AF03CA1 UDONTNOIT
889,567,483 *5C8871E6114DAF0BD912EB6328785CCFDC975DF9 UITGAANSKAS5
889,567,484 *5C849A018ABA4E12B7F2169C1A541892E9A45FB4 ULYSSESNIEDERBERGER
889,567,485 *5C8599851CFC6A844E05E1DF50B6112E775DB538 UMITDURSOY
889,567,486 *5C8522C5BF2A8A024C223CE35888240C7CD662DB uncapaciousness2
889,567,487 *5C80D66F9BFA1E43C0792AA1757CF675FC7F1D58 UNDERBUILDER9
889,567,488 *5C8ED3B2DB839721F769A0F38ED230A3C6B17ED4 UNL4CE5
889,567,489 *5C89E3EA4F5127183465F18B706A88CB46EB5275 SNORUOYH7
889,567,490 *5C8FED9043F5F076015B4130125DC2BF40CE12CF UNZENDIMMORTAL
889,567,491 *5C8FECD7D708986E330DA2E65E274BE4CA770DD3 SODDISH3
889,567,492 *5C86E2D9B1E11A9A867CCD0BF415FC40DA9FD6DA SODIUMED1
889,567,493 *5C8000D13BF125FAE3CCCD320A659E0155AEA175 SOLOTOFF1
889,567,494 *5C89B9F17BE7CC909340FD85C346D7151CCE4988 SON.MONTUNO.WITH.COUNT.123.567
889,567,495 *5C8220A05493D87F4068DC0DDB5950CEE171BF76 SOPRAELEVAVO5
889,567,496 *5C8C823E7BE63E8C74F052025359FBBD25AA419B [email protected]
889,567,497 *5C832AFFBC6EE44443C8F1B003A543B92313EBDE SOROMUNDI4
889,567,498 *5C88D31369DEBDD37D74FAC72939B629E0DFAD04 VAATISIBSWING
889,567,499 *5C81FA709470FC78B4A439C9969E28372DC865AC sp1(1986年4月18日、tbs)
889,567,500 *5C875B20FF8F631212F9589C8C823DB6821E7BBA spencer-albin
889,567,501 *5C8C2BA15168A5C426ACC1CA4423CAE566A7DA47 SPENCERCUFFARI
889,567,502 *5C84B8C4853DA04B6CC5C9DF20862DCCE7A20FB8 VAL-GERODIAS
889,567,503 *5C8E0705F2FB5E0F951CC7C6479A013CF09F4A1F spiralises.
889,567,504 *5C82DDEEB274CD4F202080B16ABA9C21C381DBAE SPLAT!!.O~Q----8
889,567,505 *5C83023DC80406C86ADB3B8BC25972B7DF9DAEF1 VAZZARI
889,567,506 *5C8750952FB9BADA63842E2492DEA6345E35FC9F VERA KOPP
889,567,507 *5C8AA316793113E64C0C6A20B03CDB95EA17B2A8 SRIYAN COORAY
889,567,508 *5C864EA6FF3659B0450EDB135581AFEF3B333EFA veronica-ghelt
889,567,509 *5C86CAFE0B283DABE798DCEED42556F7AF6B37B6 staceyswerdloff
889,567,510 *5C8FEB0F513B20CC7E29903D321734B4E6A1C0BD STACEY.THENHAUS
889,567,511 *5C8DF926D0EB35D73B3DBFD583C93901CCBA7353 stand)增加坐席,使坐席數目在總容量13
889,567,512 *5C816C0E35C8238669DBBD679EB5D50CBCFB171D viater
889,567,513 *5C85F6808AA69517A165B23AEDCF510E7BCD4C5A VICTOR.LOVIG
889,567,514 *5C88056CC512AB86544BB89EE8A8CA9A120283DC STEFAN.BENDER
889,567,515 *5C880FC232071AFECFB5A6B57BFE43B910F7B98E vikramjudesaldanha
889,567,516 *5C89D976E00E4AC2401A9F946C617E4E711849FB VINDHYA KURG
889,567,517 *5C82D4AB47C3F7341FCA74A11AD4D4D680FB37E2 VINNISAINT
889,567,518 *5C8E28F1A8BA675A91236014E98D04436F0B1A77 stevieaines
889,567,519 *5C87FDA5E44ADA8E971270C658FB1A9869CA954D STEWART-WALTERS
889,567,520 *5C85F0F9472F4E117346B6A8AE0459C4783E36D0 VIRI1I+Y
889,567,521 *5C8C732BB99D285E3DAD52CA5590089D7CDA0532 su8d1413c+s
889,567,522 *5C8F03AB5CA2A0FB5B3454E1CD21AC4365818198 VRGRSNLY
889,567,523 *5C86F94286545D5DB0A6D41AC606E8C029A63BCC VSCULPT
889,567,524 *5C8C25E4B5EA068182D43D17CCF2F40D470DB4B9 VYKOPLA8
889,567,525 *5C8347CFD4C14FF703430A82AA247CEF9921D88F WADI_ARA_VILLAGE
889,567,526 *5C88EF18D2C98A3AC7E19EDA8DC179A92B3A96DE waldopulfrey
889,567,527 *5C8C78164D1BF52C220BAF38B3D6F622BB392499 WALDOREFAZO
889,567,528 *5C8C0D4BDD4FEAB2EFE3D19002C8B43CA12FD6C5 walkerfincham
889,567,529 *5C8722B1A407E6A62B883A06EE8DBEEF9089B576 WALK OF THE NEGRESS
889,567,530 *5C8B3655D0C9E0DF406EA84CF604C1E79FAB2614 susurra+10n
889,567,531 *5C83D5B97FD2BAC256B3DC8BCEAE2900821CBC17 WARRENSPEACH
889,567,532 *5C875E77216C82DB4BFAB91AEF6875DB97C93DBA sydneyedemann
889,567,533 *5C8475893184AAB29C295AD36A1EBA8AAE4E1A33 WAYNE.HANSHAW
889,567,534 *5C8D8A6CB21C90393C504EBAA96A912F4253518E SYMPHONYNO.5INEMINOR,OP.64(EXCERPT)
889,567,535 *5C886789EAFF08F109EDAD9E01C2DE61B5414A53 [email protected]
889,567,536 *5C82CA377487956607F547C55C01B8CE418B2BC0 SZYMONOWІCZ
889,567,537 *5C8266B0DFBA5D5A7914D182C15BCB1845E62540 TAJCMAN
889,567,538 *5C8CC51B5FEFA81F2C93885F44A387A3E1C2D43B TALK86129174107
889,567,539 *5C8D903766542013C37619FB9720FAFADC0AB88C TALKESCALATOR
889,567,540 *5C89C162CF22D3280752A5EDF95A10A06A428F0A TALKPTOKES
889,567,541 *5C87FCE91E796BD7A4485396C610D1D39C0D42C2 wezsfm
889,567,542 *5C816F8D3C4BAC71CF6642B33A512CAC4C01969B W]#I
889,567,543 *5C8BB2C118F2B586E902E8C255D5841DF35AA4F3 WILEYAMERICAN
889,567,544 *5C8B16CE3A28CA21CBE01662B315FD97CBACA84F WILLARD.VELTRE
889,567,545 *5C8AA838E57242BEC590A6645B1C101D2898C390 TEATROMUNICIPALMFERREZ
889,567,546 *5C8746DE9A1A578AB72F655A10C04F3B5E04930B william.pressley
889,567,547 *5C82E34BD39E431525EAA2257BC61045545949AC WILLIAM.VICORY
889,567,548 *5C844883BC0DD7F3362D8B7F199F0DAE26FA6D10 willisbarfknecht
889,567,549 *5C853A6CF6E0CE99F3173CB26D4BD618F71739A8 wilsonbezenek
889,567,550 *5C896CE988B69F66456E67CE844DC315BB645FBC wilsonfies
889,567,551 *5C878A39F970DC502EAE646EF20E2AB2281BA703 THADDEUS.VOLIVA
889,567,552 *5C8E8838232940DA373A3E0D52C4B61181959800 WOON.KOK.KHEONG
889,567,553 *5C8F68716F81D87CFCB8DEBAC1DB32BD0C6AB939 woxallses
889,567,554 *5C89F68525016DDF4F2880BFC7B2D677524C7023 [email protected]
889,567,555 *5C8A853445C8E8190DC3B9F24ACEEDF881013A64 THE.COMPLETE.VEE.JAY.SESSIONS.1959-1961
889,567,556 *5C8306E6DB3B16864EDB7228F2C88C42BF6B2710 thedurrowreel/theswallow'snest/ladygordon
889,567,557 *5C88BF9546BED255DAA7BFC8BAB08EE98FA09621 WWWCDRECYCLINGCENTERCOM
889,567,558 *5C884069A11515F39B88F56C7BA2B36B9908542A WWW.DAVIDKANEMUSIC.C
889,567,559 *5C8651DCAB7E94F2A027085FDD49FB72FCFB1000 THEWOULDBECZARINA
889,567,560 *5C805AFDC23854A89B3BC5B71EAA7D6C6B83C2C7 x9yk
889,567,561 *5C8F8AF4A431F2C0BDC2C0D65BDA9767F4FA75A1 tidsskritt
889,567,562 *5C83CCE533D218468C1F57E79A741796545CE6D3 [email protected]
889,567,563 *5C8AB7AB73BB6616ABC6CAE16D0EF3D5B81CCA3D tiurbswing
889,567,564 *5C852E0B486EA5A3580ED8A8D9909E5D0DDE472E Y7973211
889,567,565 *5C8F2E66B2A6DDD6F45E415105469A1ECC8B49FA TOBYCIPOLLA
889,567,566 *5C839403A97BE6F33E8DCB65874C05F1CF1621C3 YANKEE.SHERPA
889,567,567 *5C80C83EA44C3B2166D4F3FFF9DEAC20752DC0DE toebereidden9
889,567,568 *5C822C3C911FFB8FAE086D6149207898D2DD0267 tomgunzelman
889,567,569 *5C876D040DF00DA47BB4B64A6ECBBC9E4267FEDE TOMINIP0
889,567,570 *5C8C1D4FCADE439A3A51BBADBA8D57F5B4C5E88C TOMMYBUDDEN
889,567,571 *5C8E9A1E023A58DD5EFB542C8B8B1E1F761B5C9B [email protected]
889,567,572 *5C82BCF35D8B7355B71222846C36BF2B63EEFCCC yesi-zulistiana
889,567,573 *5C87301BDA69DB7E2CA9B81DCB232C7689B95F59 TOSARDSED
889,567,574 *5C89596C1B3B0D6B68DC0F622F378BE4735715D5 [email protected]
889,567,575 *5C84982CEA558B7C86A042E905B97DD9C9185312 tracie.carmichael
889,567,576 *5C836007D4E6CECD1882F04E54FA591FA75C9D19 YM:_
889,567,577 *5C80723712B98852283E54E6E52DA2483EFD1614 trandem4
889,567,578 *5C8565EB8719AE022E1547BC01A07A2BDDE05276 YOI
889,567,579 *5C8EB9E4F1DB6A436C5A1754194D03B56949686F you.send.me.flying.(radio.mix)
889,567,580 *5C859508F3C830015E481F32DCAD01F39C995E09 YQF)
889,567,581 *5C834E3F3781BE5A061ABE0BB07D937ADCE4C9AC TRIXIEABCDE6
889,567,582 *5C8A068F99BCBD24E3DD04C5D59713D93B73C918 YTIRUTAMING
889,567,583 *5C8D8103842C608A4F63180C8B77F6388DF27980 TRUDY.NUGENT.WATTERS
889,567,584 *5C8045573337B9B5CA81729577CCFE03C44C3837 trumanwootan
889,567,585 *5C8FA7227B62D9EF45C8ECEED76F6DE2A8B4D317 YVONNE.M.HARRIS.GROVES
889,567,586 *5C8185C7842377196F4C8EB711BC25FEF90242A3 TTOIRTAP2
889,567,587 *5C8F7BE90C313714791ACAAD4E948C80E8A8D0E7 Z3>'
889,567,588 *5C88D1D9D1D81E9820197EA0DF2AC35AF4171C5C TUAN.TASSIN
889,567,589 *5C86C8D83F4312EDA7E276D8A3E64CDAEEA64D18 ZACHARIAHFIEDOR
889,567,590 *5C85CEB1B9E7E69F67F1F803AEABA96BC8EC9882 TUNZARUL
889,567,591 *5C8F16C6641669DC26CD8BAFAC8A1EB22E8F81F7 ZACK-COLONIE
889,567,592 *5C8A1523960002DBBB4A98CE2DF66D892E4C620A ZANEMEAHL
889,567,593 *5C8562B429D17788D930741DA9533FA983E9BE2C ZANETA0890
889,567,594 *5C8DEF908BE80CD0761EE5BAF1F1C4CAF7B811F9 zevlewinson
889,567,595 *5C8FB0072C29EAAD5EBE1BF4F269A3131F320C31 UA;B
889,567,596 *5C8E5639B3260A71C89C9245BEAB270B4A5DCCBE udfoldelser8
889,567,597 *5C8E71DAD3E453FA66BA622959B9B3D0A25D86F0 UGOJENJEMED
889,567,598 *5C8AAB17EF7E31702F30EF22BDEDA9903AAA4667 UKRUGBYUNIONBIOST
889,567,599 *5C8C5CF61ED84358B87DDE155D1731B378060DE1 ulysseswaggoner
889,567,600 *5C8E1E9DC9F465C420FD2622BE7B5961C61C372E UMRANDUNGSES
889,567,601 *5C82F87C3ECE2B9DE4E572D657219E96F8D62193 [email protected]
889,567,602 *5C8655E65F0D755124CBF3E5FFA9F11CEC7BB282 unfurlable
889,567,603 *5C8BBD05734916EF156BB74A96B4119CF394E986 [email protected]
889,567,604 *5C8B1ACCB326B9F339EA2F78DF25C55EF72F4D9D ἙΣΤΗΚΥῖΑΝ
889,567,605 *5C85A4307FFD8006EB79A134B7B6CAA3FB311FA1 анатоійович
889,567,606 *5C8484C3F858D5B8651916789E196CD362E96F32 UTSAV.SETH
889,567,607 *5C87B090ACB44823D6E18FF680E59156F0030873 UVIJAJUED
889,567,608 *5C8E38F3A7A453E5EEC1BEFD830AC7BBB09BC5CE «гиды
889,567,609 *5C86E8AEC8EFB34011EDF03D44633D754160F199 ЗАДИМІЛИЙ
889,567,610 *5C8D81B31E1686C837CB2A6D1C3C8ED62D980EA4 VALERIMCDANIEL
889,567,611 *5C88DC690FE75524531AC548212E357AFABFA23C VALSCACCHITTI
889,567,612 *5C8A9E4FA05AF1C1A39DEBE7A062E229AD78A87B VANCEMATTESON
889,567,613 *5C8ECA16D76B9E8DFC0B7243190C9D02977A0676 клясться
889,567,614 *5C84AD31313FE8E61F66AE8ABCB6950E96D15FFF VANGOLT
889,567,615 *5C8E0323C6B0C225FE69F68662BF829BFC3F0A2B VARIETÉABENDEN
889,567,616 *5C827D1E6B360BD4DFB643497A09AD0EE2BFEA4B varun.shanthappa
889,567,617 *5C822DC83F043446CF59A599A3F06E1D28C9D0DF VASANTED7
889,567,618 *5C83CF4425E7CCBCE208BC0A12829354389F1DC5 ПОДАТНОСТЬ
889,567,619 *5C8541BF350C61DD08EAF336D4E02FCAF911112D VEDANT.DOKANIA
889,567,620 *5C8BA8C86045363077C6CE48B733837D8DF38AC1 ПО­СТРАЖДАЛИ
889,567,621 *5C8E75CE6769FADAE882FF9160271B1AAA4413A8 ПРОЛІЦЕНЗОВАНА
889,567,622 *5C8EAE081CD316447F2160E891DA81FAE4FCA7EE VELLAPPALLIS
889,567,623 *5C837604B1D5514CA93D787778F4C50A080B16C0 VERA-MERX
889,567,624 *5C8E69F4BEA16B381DB02D8573596E5164FF250B VERKRIMPING.
889,567,625 *5C844E74152BF806071B2E5B3A8BCDC7724A6BE8 УКРАЮНСЬКУ
889,567,626 *5C84080A9601FE801ECF85EF52C485FFF4F1C109 VERÖFFERTLICHUNGEN
889,567,627 *5C8AAC72D7DE9127604C4D308E4580E75D33765C VEROTUTK1
889,567,628 *5C8AF3471BCCFC6B97AB8C1C643110CA88959C8A «хмеля»
889,567,629 *5C8095FDDB5365D80BC1D6EDEE2C1AAF8825D3A8 VINCENZOGAROFALO
889,567,630 *5C883373830C045C097BD59AF7EF992F16AE6289 virgilioniemants
889,567,631 *5C8FDA100F678408D17FE411DF275F4F5138610A vitalsylaine
889,567,632 *5C898D11931FC8C0E871C7E7179464742B9E4E76 VITO.SPONG
889,567,633 *5C8B760A4690672D162FBF7FF029A9B418A73D1C VYI0629
889,567,634 *5C8E1AC7E95759EAF40D653A639ABBF5AFA1FB71 #w(a
889,567,635 *5C8CC54C1E3F7221C64A78579D4389B58DAC320C [email protected]
889,567,636 *5C81A17BCB341E27B0C788DB3F404493AC4D5BBD [email protected]
889,567,637 *5C8898363EB96EB27F37ABCD5E3D6CB6F5DFB99B [email protected]
889,567,638 *5C86AC72B2A9C6FA7C69164356A328A82829BBDF [email protected]
889,567,639 *5C82984B8B7F33E15CFE09137871307565A366DE [email protected]
889,567,640 *5C879591381366427EE65B88B92C2EACE3E7A62C WANNEEKAWILSON
889,567,641 *5C81E57F7122B817F33525AD26F15E1DF5BD51F6 WATER WAGON
889,567,642 *5C8D0FFBDF76DE67CBD2E3DA1990D3F2395C32F8 werydes0
889,567,643 *5C8A2FC0D0D719696A7E62946DA746BE7230E698 WHICH-PINK-ELEPHANTS-SONGS-DID-YOU-ENJOY...
889,567,644 *5C8C52F3E24BEBC7B1FCDC103E0F8597A3B7F2FC Whiskey.Switch
889,567,645 *5C80CD5AB9AD0AA0C8311C9C146AAB8999457173 WICCHESING
889,567,646 *5C8AB53BA04E01481E94F19C3519D304231A5E69 (00).*.(=====3
889,567,647 *5C88703C8F068210234F0EA0F64B6CD6A5712963 013EVA
889,567,648 *5C889DEED21ED01995CB695E103257DC60435915 WILLIEVINX
889,567,649 *5C822FEFE1E5284D95B6232338A5CC5C0B1FD2AD 03301883
889,567,650 *5C8E03A45703F8FA153F6B081CBDD927A27506E5 05x06x67
889,567,651 *5C83EDB4D00732E795DBA59AC97025C470AB32CA [email protected]
889,567,652 *5C8378C94AD6E4A4931CBD7E37337E9E5E4774D2 WOLFGANGDUERR
889,567,653 *5C837EA5160F00019673496A59D5FF8AF4373847 09161226
889,567,654 *5C85B32D9F305D35C72EC2E0F37EC07178F02A3A 0IAMHONEY9
889,567,655 *5C8BD16DE07871CC5C5763B6BBFBFA4395168B51 [email protected]
889,567,656 *5C8FAE5B4521342B65954AA1E0C353402B2427E1 [email protected]
889,567,657 *5C857C25DDC6C26FDA59BA85506DC586E7B7638F (100-PER-&QUOT;RING&QUOT;)</TD>
889,567,658 *5C885E6A712E6293D16E9ACD606380EB0392E101 WWWBETTERBOACOM
889,567,659 *5C8A1E093B029F08C2D8EEBEE4E25A3A7CBC8612 WWWKUANGKUN
889,567,660 *5C8A694041F6012C45E672A29AA4675F1B4C82BD 1147266 se , ett
889,567,661 *5C8982A4F40C3C28A5DFFEB998B3868F47BBDA5E 1165446 kirjastommekirjatvalmistuvatyhteisty
889,567,662 *5C80BD2B3A605B9EA2A9A9A343632A6B45178859 WYALONGGING
889,567,663 *5C8BAC930687C1611DC9F460B4CA91E0F951C7FC WYEZ
889,567,664 *5C800CE321C79FA82407DC6E55D427D1949DF14E 12-n
889,567,665 *5C8024D6DA11238B14069A93670FFB930E86D275 [email protected]
889,567,666 *5C86BCD0BF88E7D61EE2E042B9A795EA08E8E107 )x(-`-(------B
889,567,667 *5C8403CFD5165F597AA2E5B9BFF23BB50A585C92 XCODER
889,567,668 *5C82306CF6616ECB01FB0A190EEECD9DDBDE0C49 [email protected]
889,567,669 *5C8869D76FBE7B45297EF18D5D3E51F041C757A7 XIAOQIAO WANG
889,567,670 *5C83EDA6395858B7BF0E968EDFF46AD6140E6DE3 XIONIZEIS
889,567,671 *5C8A4BEB4754898135E25D74E97B9FF36ABE5381 17jun1268
889,567,672 *5C8CD993D32C68602341F59FDFAD3259B5D117BD 18 TBS)
889,567,673 *5C893D5D512ADC8C14CA86C264694908498BD832 YANEKBSW9
889,567,674 *5C83B75EC7D9391F656C4CAAEF3C45B7602217F3 1.AAKALA
889,567,675 *5C889FC73503F685F4EA1886980C91012658AF9A 1ABDUCKT
889,567,676 *5C8AFCFFF10120F732F226A0C99448A033B221A9 1.anlayamiyordu
889,567,677 *5C852E5489A890DAE56B977B3A6C09E66239DBCA 1-ARVOKISAMAASTOA
889,567,678 *5C8D208CB78CAAFEC90C478680C65A0361CC645A 1.CANADAIR-JETS
889,567,679 *5C8B3629CDC7A5D342D23F0D8B0E7B14C79B37F5 1.christane
889,567,680 *5C8F3FED18E99E6F4D95A7555C6309ECB12807F6 1-COKINOS
889,567,681 *5C842424FB453D70C1EC1AD342EE7DF0BEE0620A 1D1O$YNCRA$13$
889,567,682 *5C843DEED428F000E89BEB5F913451609500E709 1-dCg'nin
889,567,683 *5C8E5589E5F32358B85010602D02011885C8B0DA 1.EINHUNDERTMETERSTAFFEL
889,567,684 *5C8876F3209A87D36A34E9E2FEBABC7F40E753B8 1emotionally-as
889,567,685 *5C83E913A8F4A98DE96AC586B97FBD0626013381 1FETISHISTIC
889,567,686 *5C8BCC8A252FC7D286C53F1F84F153A2CAB5F482 YOLANDEPIAZZA
889,567,687 *5C89C3C41AC1158B7FDE6B2AB5738B9284221832 1INNALZERA
889,567,688 *5C8E26D61B6A0B36C2733666B16A17D1C0EE69B1 1.KISMIYDI
889,567,689 *5C86B89075F9B2518434D8F317B7DB2D8AFB11EA YOVONNDA
889,567,690 *5C869C249636B7025A11715F9BF94C26403E30A9 [email protected]!ZER
889,567,691 *5C82291553D42576EBF9A53C5416A2BD1F66B9BD [email protected]
889,567,692 *5C8CAFBCBA180AE687C0DE7367909010C6AE1669 1.MENESTYKSELL
889,567,693 *5C80D1CFCFAE7E2CC08841181CC7296943C2814C YULONDAHOSEA
889,567,694 *5C883C57B71992EC61F43D76A88C03911233948E [email protected]
889,567,695 *5C807DB01B9A7FC94755BE21694DE2EDC4D89562 [email protected]
889,567,696 *5C8C86AAD88656E41A09825B28378283B2FF25F3 1.oppilaalla
889,567,697 *5C839264CB9E3E72B02668443E4956F95E041E7E 1.PHOTOMETRIE
889,567,698 *5C8A70EA2189A13E28D0317F948EAD7C440CC639 1st quality
889,567,699 *5C81C5D2C9A26D4EDEA79ECC5A3C9BD7E0346796 ZBLBLO
889,567,700 *5C8D6B6175632FCB2FAA3436D9A2923CD8681B65 ZEINAB.YESSENBEKOVA
889,567,701 *5C8A2767BA07295113ED7AD762725E271A8458B5 1.toll-collect-system
889,567,702 *5C8F65ECA60D662A178245CB31568EF7015BF9D5 1 TRANSPORTLUFTSCHIFFE
889,567,703 *5C8E5EF4A1B741200D43A76549FF329E43401903 zenopia1
889,567,704 *5C8D7B5A683371DD1E2BF6309EE42D0AA4EA8D0A zernelle3
889,567,705 *5C8601C986D56284B1A2FC31AE58D74F01BEF7EB 1 ZWEIRADVERKEHR
889,567,706