List database


# MySQL hash MySQL password
889,540,001 *5C842C0CF8F1481BEBBA0D444EF4F1BDCF035348 CHRISJONB
889,540,002 *5C8587CE7A480FBE548297348C07515885463401 CHRISTIANA.MENSAH
889,540,003 *5C8707B8C6A590ADF5085E14DDC8478642DBA812 ELROY.PEATROSS
889,540,004 *5C8800A6EDD36C24A085080740934E5C7372AFAC christine-lenz
889,540,005 *5C80B416140BF8EA58D92AEDC0B3EB53C61953FB eltudtud
889,540,006 *5C891D3FFE10E5B5AFA95E30CAA88EC2DB660701 cities-in-linger
889,540,007 *5C8C865897F2544AC92CEFFE7B1233B20E676F09 ENRIQUE.LIENDO
889,540,008 *5C83BB3B03D1568CA57A02541B165585AA73B8BC envenoms
889,540,009 *5C8A76DEA7E3F2ED2D7749CDD91B2435E812229F EQQE
889,540,010 *5C8B69549217D430E76461D58C4456C82EBF88A2 ERICA-SIMMANIVONG
889,540,011 *5C837F8446FC75C199B7AEF98AF1D412E843B138 ERICK.AIKEY
889,540,012 *5C8283DB707A38E39119672F0990B67F876005CF ERIPPUS7
889,540,013 *5C83DEF6706ABF230B9C1524B1FE038F47860CA9 ERNESTO.FLORENS
889,540,014 *5C8508081D01D022497E2FD86D5B852113E93A2A erpukkel7
889,540,015 *5C8B0545EC125BF686E9DEAF25560DFBD0CA1511 climatechangegulfstreamhollywood
889,540,016 *5C844FACECC2500AA87FF9032B0D943A669EB24C [email protected]
889,540,017 *5C8F8D2359D33ADAD2FFDDB5C0D811B52148D4C8 ESCUDODECAMPANARIO
889,540,018 *5C837E6CBA7964E1E2B8CE5169A955B457CAB319 esledyte
889,540,019 *5C87122CB6608CA67C10714722DAB77ADF5E9D7D et8/1
889,540,020 *5C8D829D2C0B2547AE8DBA3AAC19A350F607A9B7 ETAZZOBBS
889,540,021 *5C83E342B8181E04B985F1D8727FDEB25271DFF1 et&bl
889,540,022 *5C82DDBB92A4191A35C67AB097A4CCEEA84432BD colewort
889,540,023 *5C82CC870C5FF20575AEBDA38B778939BDD42595 eyd;;
889,540,024 *5C88C59B1E01C78F1205DCD7C166C66F04F45964 eyuig
889,540,025 *5C870171943CFBDEE8BCE8E2D86771F3BEB8FB73 Concerto.in.D.(RV.582):.I..Allegro
889,540,026 *5C81BA7C0C68C3D47D69D4A8D389209BE908C9AC F1N9ERL1N9S
889,540,027 *5C807FE13FB42E926DA5A635FE9FAEF11461ADB5 fallouthotness
889,540,028 *5C894D161032E3B50CF19D8B816042E38D167510 CORNUED
889,540,029 *5C8CB0202E19F4E6827F88969A4C549E5111C4EE [email protected]
889,540,030 *5C8A8B566064C628A3F1566A63AAFF7814AE22A5 FDDG
889,540,031 *5C86609F23ED627475220E1ECF949596A24CA0A8 ferait
889,540,032 *5C8E96A8EC70E958E46FC89E6F63A23B4947E334 FERNANDO.IRON
889,540,033 *5C8C1C3123A0ED6E8DAE077E9F6FEC2C051876E2 FESTIVALPUBLIKEN
889,540,034 *5C8D5FE87BC7C6DBD70CEA5B6A4B04DEE0C0DA94 cpx-k
889,540,035 *5C873BA880037AB65F7186DE038BBB93D7E71F56 CQ7;
889,540,036 *5C8156F1AD27AD1DB58216C39DF70C58BC53F867 [email protected]
889,540,037 *5C820E6749E3F069AEB70EE371A953C5B20572FC CRAVEDEVPHONE
889,540,038 *5C867B75079F41DE8576722C4DEEB28264119437 c/rdf
889,540,039 *5C853B9214D3BE1E52337067D64E5A1BECBD3C67 FLJ36338
889,540,040 *5C8E4E477E6F2C113F6DC39B52049BBBEF4962A6 [email protected]
889,540,041 *5C8EF552823F9DAE60530F1864394EAEE0C50B14 CRWCV
889,540,042 *5C8D0175A4A28C70F988A510C9756B0C1E4AD512 FRANCOPUNTEADOR
889,540,043 *5C87B397F84E3233BDB1CE822806517C57552224 freidel868762150
889,540,044 *5C8729F53EA89C5AEBBBA89C2B9CD2276170C864 cu5c
889,540,045 *5C83373997574A0219018765D4572139F5B44C1B CUf
889,540,046 *5C885C51C28F8A12EAEB0BC04ACC59D217184B42 FuriousAngels
889,540,047 *5C806EF8A8A273B14792634CBBF0901CFDD946BE CV2+Y
889,540,048 *5C824AA0AAFCA5108E15E170723C914FE98E9164 gは1~10の、happy
889,540,049 *5C8775ED349FC6BE8A68D84AF5F0470E63E3978A GANZBART
889,540,050 *5C81DD4D475A499DEDE745272A9E76B0E7D22974 GARFIELDSAUVE
889,540,051 *5C8AB3292ED8FBFFBC0CF33705E45CCE733C2D0F cypress123
889,540,052 *5C8B935FA6D3A3C94FA48D93ECAF8B981CFA4DC1 d0+oq
889,540,053 *5C81D143935F12CB7B8E6A4E76F60C04CF998FFD GERMANSTAVNES
889,540,054 *5C8A274FE3BB9A59D7799BB03DA56E8255F6C822 GEZONDHEIDSDOELEN
889,540,055 *5C87F180A7616BA207B8B6DF62E859BBE2565412 d7!i7
889,540,056 *5C86E873137AF0B9D10A48E2E0EDB5213A8095FE d8cm
889,540,057 *5C85E3867A3C30F0C7CE202ACF6AA213A4A16AB8 daldw
889,540,058 *5C801337B3E1A49C90BD9BDB2C13705B67BAC508 damianamejorado
889,540,059 *5C819EE6F532F388D0DE1FC233DE6178499981C4 DANCETOSOMEBODY
889,540,060 *5C8103E05BED816F59A4808F87F452B7E8444E1C gordonlather
889,540,061 *5C8CB943F4357D10979A3B3A94DE2956662F75B8 gordonreibsome
889,540,062 *5C8795DE13B62C3ECEF6BB9ABB808079B4BF82F8 gorko.
889,540,063 *5C87EABBA49C51ED4939637F24F3146D424AB9C0 Dark-Was-the-Night---Cold-Was-the-Ground
889,540,064 *5C8D179C3AFE22F0B155185EDEFD6CBD37C8C7B9 darrellflauding
889,540,065 *5C832C2692ADCFADA0B5E10A3783D0EFE96A75A2 GREG.CLUFF
889,540,066 *5C8D64515B609B7C247DCDA60BA19BEC6DD11BFD DASHAALLO1
889,540,067 *5C847936CB364585DB603C8C9012C34542CDF4BE DAVE.FORNATARO
889,540,068 *5C85982390CC9F1903AB2D94263CE51E8E0F3DF8 GROUT;-VISCUM[OBS3].
889,540,069 *5C801B6C77EF69703A9B2F751F45E6E868C24D60 DAVID.PARNELL
889,540,070 *5C82C83991787959293BD91199BD8EB89B2D2A9F GROVERBELLIVEAU
889,540,071 *5C8178B9ADDEE647E85C23D8591590E8D24AFE75 grovercuozzo
889,540,072 *5C8810FB3C421BB66DFF23FFAD0536116F4E5F62 DBEA"
889,540,073 *5C81662F0047CC2F5E25A0A13070996BAFE95A5C D-C1
889,540,074 *5C83B3B3A188065B1A0C7833840457BC94BC2CA5 DeD6
889,540,075 *5C8226D44ACFD05BC5E1790B778912D7B5141FB7 HALNYLIN
889,540,076 *5C8DC16A9C2E460DF75674499244F244FF91790D DEHTAO
889,540,077 *5C8A81829D218FA16574F90693D9DAB6A179CC0A HANAVICYD
889,540,078 *5C855BF4A7A39CA785AA2B01C11022C07E462732 [email protected]
889,540,079 *5C85299766B96F7A45CEF6F470542E63B3A6CED4 delmercesena
889,540,080 *5C8A62C0EED07026600BC9F261EAC13A0E577D94 DEMARCUS.GLATTER
889,540,081 *5C89A75E94144AD88C003AE4C690F45FC7C609F5 DEMARCUSMCFADYEN
889,540,082 *5C8A88891B310FB6DC1FB709C7F1E23652246CFD hardcore.na.veia
889,540,083 *5C88A396BBEE022AE9ACD365C2E21EEAE33CFA89 DENNY.STOECKERT
889,540,084 *5C8FD622CB0DE0721229E65D6E87293F7EE10139 HARMOCLA01
889,540,085 *5C8EAB7E200E9D33750B05B87DDEC6E9FD53F223 DERICKNARON
889,540,086 *5C844B28FC93E96311DC3262C720A99134806DAC DESIGNATEDD
889,540,087 *5C871E75B53827BA227928EBEC70D7A0874D0C92 HBM~
889,540,088 *5C8E2B5F8C2A0B042A01F58FCB0F591B422609F4 HEATHERFLANIGAN
889,540,089 *5C86E0F77DF1406B7DF94A1DDBA5DCB65BA8BAB9 HECTORHOLLE
889,540,090 *5C884BEB3495D517A76DDAFE6E0E3057BB521CFA he.don't.want.you
889,540,091 *5C86E45040075CAC540677BF80940B0DA03BF5F2 DG74V
889,540,092 *5C836F0F8E8C5278BD8C5A02A8C59DEE1942AA64 hercegowianom
889,540,093 *5C8DE68F1536CA893EFAE61B790C6FBA74C144D8 d(hpu
889,540,094 *5C849C98A46A69C7372D684A48DDB93C2B1FCB6B diekunstderfuge,bwv1080:vcontrapunctusv
889,540,095 *5C82442631B9A4D531ECE6D08FFCDEC2C8B85DD7 d(io
889,540,096 *5C81CF0A089766E8213ACAEAD6EE9FD32732C0B7 DI,u
889,540,097 *5C86AFD40F3F80D55241AB1E1A9895CB86C2F8EA d-k7$
889,540,098 *5C89996B0D318F7F589A3C4E401C49875C1D3EA4 HTTPHOME.ONLINE.NOLA
889,540,099 *5C8F0828CDEE321C9DEE0E3914B034CF316B1049 HTTPWWW.FIFA.COMENPR
889,540,100 *5C8653A6FF9B97365284E8838A6965C109AB2B71 dm9q&
889,540,101 *5C8448A831C60132657CB213AC45184B5F127AC2 DMG_
889,540,102 *5C82BF669CA49AEC1431D60457E0EC9C34A1B59D dn")b
889,540,103 *5C8F1A56E02147B89901E7666E3B7C568CF081A9 DNGJK
889,540,104 *5C828047A2A3D0970C4D70C5AE98D0A003D6FE08 DODAJEMO
889,540,105 *5C84DD24C350C931E1F22EE75D5586B96BE85D17 DOLLARTEKENS2
889,540,106 *5C89C05B33CDE8C066F534CD4E6F589CD7BBE44F ICIRUARING
889,540,107 *5C8056D7F847043DB1E56AD5AE6B64CA601484C9 idrdbndnwucgwxrl
889,540,108 *5C82767C3885A9CD8E6D59FD1EB0E077387A29BF IGNACIO.BOCCHINO
889,540,109 *5C8429A1BCB5E84434F5E6FBB7D875747C5DE0BA douglasmenner
889,540,110 *5C8F935B2C38035E8FB5FF6602265D830D9BAF6B DOYLEKEREKES
889,540,111 *5C870F7CA98A061513C2173E0D62456D07D3B01D (^_~)~.`dP
889,540,112 *5C8C34074CAC653D75F00CF357284AC34F5173DF DP/(
889,540,113 *5C8E26EA00A81E7AD933D9252FFFC7E22522115B dpice
889,540,114 *5C8BC8BB22A7B70DF87FB317FD8166C5CE48E9FD iluvcarbon2001
889,540,115 *5C89C2B1F3EEF92ED6AAF636AABADA7C91D77A51 iluvpassword12000
889,540,116 *5C8CF21204CF9C74A77CD2C5935FD9F59A03941F [email protected]
889,540,117 *5C88C9FCD8DE36262DBC50055E025F12033BBB64 dream.smotherer
889,540,118 *5C878AB8DE976D98CD7D74877849E7EC0A792DC5 dresseds
889,540,119 *5C8EEA98917468D868AA9EBF0980001335B7E5B7 DRVQP
889,540,120 *5C8918A423CDF95DC448231C302132839E1440BE D+SDC
889,540,121 *5C83282EC1914EB8C5DC8698A87242E199439C65 duilins2
889,540,122 *5C868186F747BB4E86DC40C42AC1A4522410498D iy;1
889,540,123 *5C8C73D7BFF1C8D710C1A737F85BE85D2B6F88A8 dzsiv
889,540,124 *5C8991818209985CFF7160E1A43C50E6B76EC790 e. bachiller b, s.a. | spain
889,540,125 *5C859DB7662EF3D5C377582CEB334382CF01D02F JAMEY.BLOESER
889,540,126 *5C84BD1529038821565D04905DEF296829DA4345 EDGARFLIELLER
889,540,127 *5C8031401A1C3F022414F6172DADDFC57BF51B12 JARRETTMICEK
889,540,128 *5C818E22032884333D5E9665F58D3300FBFEAF4B JCQURAISHI
889,540,129 *5C8422427F07D4DCE93B63E0EF380FA78096B53F JEFFEREY.PAHLER
889,540,130 *5C83FAA8FB7CB331E8285711F14D012A2B0F909D jefferyfrankart
889,540,131 *5C8B612782CFE228D5CC280C2DF84201FC7D8405 jeffryraschke
889,540,132 *5C8E71CC450CA7806E9E6C833F772103968BD8AF efm.-
889,540,133 *5C82BD37EAE5C57E8E2E9A1704B0EAD1F4DA2C1E JEOFLIT
889,540,134 *5C8DEB99CF2340080009C149A1B19173DA51300F JEREMIAH.MARSHBANKS
889,540,135 *5C8BC58AD07DEBEA963A1CA7E1A95EDDDBBEC884 EG;WZ
889,540,136 *5C84E42EB02A19909AE03FC22B4AFCAFAD590312 eidtualp
889,540,137 *5C89CED9E8174019C40AE70557B50ABF4A0EA24D eio7
889,540,138 *5C84A57E8FF869FE5F8DE82B6EA179EA16BD38EC EJACULATIVE
889,540,139 *5C82D4E701387C6092E33BBFBFF644E8F451D5A8 ek4yu
889,540,140 *5C8DBAB8D8466AFD8585E4A5F642D042F79D4190 ek!%r
889,540,141 *5C8890E3803B10C3D882106CD677A6C35AC51545 JIM.WILTBANK
889,540,142 *5C8DE5BCA57C05BF45D02CF80B35D470878889C0 JIZLEKNE
889,540,143 *5C8BB579508068672773E6D8B7D7508763DB9FE5 [email protected]
889,540,144 *5C86343AB2F11FB9CB65C26FF31CAF274546D81A [email protected]
889,540,145 *5C8C19FB6877CBEBBB9B9519B20C4A2BC997CE71 joanhazen
889,540,146 *5C83093AB98A300471471EB773F73409F90D93E4 JOAQUIN.STILLER
889,540,147 *5C80DFC4036FEEDC10135C035B052CA5B7548E8E JOHNATHANBECKMAN
889,540,148 *5C816B966D0A4DD2FCE411D35BEF5007DB1F82AE JOHNATHANFOGAL
889,540,149 *5C891B81CDEDF5AD282634E142E5100830CDEB58 john.ivanov
889,540,150 *5C8F4C9D50810F155E62F13E4BB3848A003ABF22 ELMER.VALITON
889,540,151 *5C8EBD730217D4B2660FC670E7EFD1CF3F7CD631 jonathanlazalde
889,540,152 *5C85F3773E7975DDC9A246CE87CF116098CF28AF jordan368
889,540,153 *5C896627F19A28DAFAEA72BE3DE11F01A25FCD6D ENITACEH4
889,540,154 *5C8DE4F7F8F82537AA7D93CE85C3EBB5CE195011 enterthecarouselcomwww
889,540,155 *5C89D2EF911BB33F3B80C78038F10DA32E717626 eqdi/
889,540,156 *5C8F9E6A8408F5F2A11D5760231B5A19317A205B erinbongard
889,540,157 *5C80BF61C5D68F963AD733361B830117714ED76C KATO・作曲:CHANG
889,540,158 *5C8AA608822440BD37334ECE2305F3D9CD4FCF97 erwinoatridge
889,540,159 *5C896BA72C567E461A76A5A7EAC9D4C275134288 KEEP-LOVIN'-YOU
889,540,160 *5C85295A909547919850BE01CCAD4B989D80FE23 kencoldivar
889,540,161 *5C87AA069F03ED10E6A50FF126FBBECBF4146EEA KENNETH.GIDARO
889,540,162 *5C80C92CB85B1195D4DB36185B1D17557A6222EE [email protected]
889,540,163 *5C8ED6AFAD3A1C0310A34C08BB26CED6176F4566 [email protected]
889,540,164 *5C839C019EA4D9A06BAD04BFA22C2FF0919D9F41 kerkmense
889,540,165 *5C83E5727BEE4F4BA033402E35A33ED78D90CCD7 Everybody's.Drunken.Friend
889,540,166 *5C8B5E1D268C1A456E3DCF587DC1744AE19C902A ev?n
889,540,167 *5C87B2E2A616922A75E504778020AACD2E41CA27 EXPIRERS
889,540,168 *5C85A86C2DB50FDDA1AD8D22C0E3F40DC453CE58 KOOREDINA
889,540,169 *5C898A8ED0FC8C3A825DC6FD5EB67D8CE570051A [email protected]
889,540,170 *5C84C4BC9BCAA07BDA23D721F987F07F056E826A FATHERSTOP
889,540,171 *5C8B5DEDD3BCBAFE10541D3D12F683F821A4EAC3 FEET44.2
889,540,172 *5C85A5BAF3BBABC1E40B8D826032E7ED3E33CEF2 [email protected]
889,540,173 *5C8E1A31FC487C90B741D3989E0CCB2F52313153 FERDINANDSHAWE
889,540,174 *5C88B138F86964BD21DE1770F80BF86DC8F9E347 festival-in-bagdad
889,540,175 *5C881107411D98EDF2FB6F572D3894BE62894831 FICHIERSON
889,540,176 *5C8AB3E28A56729A255ACEFCF95AEE30E8E9F0DF fi$h glu3
889,540,177 *5C8A0F625DE27688E8083F0E6A994518193DF462 lamíkiz
889,540,178 *5C89C0D5C429128D7838B7BFE8575485EB8D64BD flanscharbeiten
889,540,179 *5C867356A1D54746BF67AF226A406677273CCBD0 [email protected]
889,540,180 *5C8C4F2C9E2DBD61DC9AC8A8D608A7952FA36876 lapinized5
889,540,181 *5C8E7DF42B3DB77D0ADD031F50C578D0EFC927C6 larry-hardesty
889,540,182 *5C80584DAB4226E9F8E3873570D85B4BF02FF8A5 FLU0RD47ED
889,540,183 *5C84BB71E801F7BB831FABC57919CB66A66CE9B6 LAURENCE.YANOSKY
889,540,184 *5C8CC776E3239956BD1E8A3CB5B15A0C055A44DE lavernkazanjian
889,540,185 *5C8CAD7F0E12F172C84486508E052B796CF53D3D [email protected]
889,540,186 *5C8773EA2B6E27A9B9CF6AFC81684F9E97D45C60 FORGERIES
889,540,187 *5C8730DED27B4408AA6A2EEFEE845426247FB5C0 FOURRESED
889,540,188 *5C88E5129A9A0B8797974311FB52FCEA506FC131 fq$n
889,540,189 *5C8992B049EB0D870CE49FAB2161D71FBBD7C984 franklinfavre
889,540,190 *5C80563274B399FD6341AD55A08E851C8C44DA2F LEONARDBOWAR
889,540,191 *5C806C1250E74712BB616B3E5BAD0D1694D50E78 fredmagnusson
889,540,192 *5C8A0FAFEA2FCC194F6A2646EEDDEAF62B49D5DA leon.symonds
889,540,193 *5C821632F0A0A03F7C2D7B6B8BFC7E8EA5C82FD2 LesIlesFlottantes
889,540,194 *5C8C4C5DF612DABB4C421A73EF9443F6205C6831 FRESHWATER!
889,540,195 *5C8BB9E845950F1D7BFEAE2C444F92EFF71BA245 [email protected]
889,540,196 *5C815245D1A5B5542CC350AB78C8ACC1A538BBAE fugea-mollbwv904
889,540,197 *5C87BB22150419B62E902B0DEB4DE7CFBFD49AFC [email protected]
889,540,198 *5C816B4F6F229E13B07C6A19ACC203CE0DEF68F3 [email protected]
889,540,199 *5C8C9C048E4D85CE9A5CE6B9F5E970274870AC0D lindseybozovich
889,540,200 *5C89D649B471221AFD834EE7D0917FC2E1FC7868 gaillardises4
889,540,201 *5C8A65782E2E51672FDEF8C92702BB182F47141D LINO.GUITIERREZ
889,540,202 *5C88AE10EC973159BCE93EC7EF2E4F1BCFC32BD4 LIPSTIKBURNING
889,540,203 *5C86A2BC3962F90282808BE5A8EAF77A2E4C0AC5 lisabuller
889,540,204 *5C8EBA8D2859117843EF47F91361489CD883F0B8 [email protected]
889,540,205 *5C8213888052CADD0D6C3128E907E011C4DD01E6 LOFTONCF1
889,540,206 *5C8F420FC7D39308CEFF7BC6125F69C4F76A32D8 gb%[
889,540,207 *5C8CF6EFB0D7DD6F992F1A4FB2DC3974FEF60875 GENARO.REPP
889,540,208 *5C8CAEF5470D70153E9454124C37998CBF1EA2EF georgeanna9
889,540,209 *5C8ADA23F69E4796BCC3D20982C62A6FF97BD6EE GERRY.GJOKAJ
889,540,210 *5C8A79A0B6310251A921A9C2F706B39A2E07D85C GET-BACK-TO-SERENITY-(BEACH-MIX)
889,540,211 *5C8740775B8469FD8C235BA8161959D8E18BAD95 gettin$07
889,540,212 *5C8EEFE9C85BE86DE6D19CCF28BA6AD08371FBEA ggnr
889,540,213 *5C89D03FE9263BE2B2B4154DAE9B516CD7AD0701 LUCASHENGL
889,540,214 *5C8D491B4051EF3683A9DAFCA9DD2F6EE76BF39F GINO.BOLE
889,540,215 *5C8EB8A8CDDE07ABE98D00126CE88829E2BE28A9 LUCIOUSGURL562
889,540,216 *5C8DC85244087FE85853C8CC465927ECADCA23DB lucratiever?
889,540,217 *5C83C4C11EF50A448D5867C1B3A4A0EB91FDA7AE lumacone6
889,540,218 *5C857860F0E3C998C8E0E9FDFE129F42C876D950 [email protected]
889,540,219 *5C8A90358DF6A8FDBAA911017126D803BBA8F247 [email protected]@y5
889,540,220 *5C8B272A82344E164146929279298EA57D9B9A71 GNITTUCS6
889,540,221 *5C81D7DDA5B210A235593B7D873A654D5340E447 LYNWOODHUTH
889,540,222 *5C81F6BC3720FBE37554D0F9677EC619F8E6ED24 GOJDIČOVU
889,540,223 *5C8E35528F7B6ABA3F421CD6E7DC52A7B73BA8F0 Gon
889,540,224 *5C86ED672427CBC74B1531E4BCCB4C3A453DFD40 GREGORYIKERD
889,540,225 *5C8A64AEF0D336C110FF619A1E042001D2D8FC2A groenlining
889,540,226 *5C80974DB21BEEC933EA8FC8BA683C9CB682FB52 MANUAL.JASIN
889,540,227 *5C89FE65FBCB36B26E585C80792BF9C33BB64282 [email protected]
889,540,228 *5C8CA2CC8959D018ADEA5329BDF6E416204976FA g tito
889,540,229 *5C88D9F371F60BD46CB5AD340477BDB5E2619F19 marcelsoldavini
889,540,230 *5C8A40DD44B1D43A7A6302A95BC6B05AE9809385 [email protected]
889,540,231 *5C82C9CAC93D714E7D7CC21180620DD18F41C05E marcosveltman
889,540,232 *5C868F706AEA0971EBD934573C059856E9BA7272 gustafssonbengtke
889,540,233 *5C8E15C8F63C46CB3815566C9B1B56ABA31DC9CB gzbo
889,540,234 *5C8BA07D3382664601782821DBE16E929A331963 MARISSA-LEVESQUE
889,540,235 *5C89E9805952D22B829399943F8FD56F08EB9B53 MARKEBENSTEIN
889,540,236 *5C81C9EE4E69063BCBE32BCEBA49AAD64AE8C7C9 MARK.TEJERO
889,540,237 *5C806972F529D621E70181836B15AC8A593E20F3 haemorrhagicing
889,540,238 *5C8C5204CD1FECF397D25B523538716FA0A3E31E HAMPERED
889,540,239 *5C895088836011462A3BA7FD60B7680715C80CA4 handtasje3
889,540,240 *5C8FE4A091F29AD81EE87B6AD6C009A5BAA3CCD3 MATHEW.CERAMI
889,540,241 *5C8738FBE89EF85B08538F14C3E2ACDF10D862B7 MATTHEW.PHAYMANY
889,540,242 *5C8F537F542C05AAFC487AB6B4E8FFB6032A5E22 matthewvartan
889,540,243 *5C8E9BE1B201122469E1B25E1C22F2CC353BEEA5 harveyvallerand
889,540,244 *5C8B4CE7FB94F88D763B3C2A7F5C9E00ED5E5B28 MAURO.LECHUGA
889,540,245 *5C820126BE89ECC103CC26D45324DC623F230037 MAXTARMAN
889,540,246 *5C8B3621E96C2E23CF55D83D60477B4919177F3D MAZDA1MELANIE
889,540,247 *5C82749D7D9ECC9662EEA3B90B2920F65B78A2F5 MCKENDREESPRING
889,540,248 *5C8F30B801044689A41E54F63377DF8122499D3A [email protected]
889,540,249 *5C890696EAAEE4C3959DC2208B514F21672D7EB9 MDH&
889,540,250 *5C83749683E8679BDE35C5FBF4BEC76176322D14 MEIN BLUT (PIXMISCHUNG)
889,540,251 *5C8683A8BD5DED4F15DCC999609F120D00599780 MEL.KINNEMAN
889,540,252 *5C82198A31C990AAFAB7E465F77031C87EAB37AE HERZOEGEN3
889,540,253 *5C8B47171B249DB0439E124063705ADF3C08AE44 hindurchschauen
889,540,254 *5C80147CFD1C0B4E50F5074AFEDEBDDB0D8EC063 [email protected]
889,540,255 *5C82A60504527ADDC62922B2709B4A6F0CA5776F HIPOLITOZUBROWSKI
889,540,256 *5C8D97290AF48124C3EF7954CFC6850B1EF88361 HITASHASHARMA
889,540,257 *5C8A78ABAD5D42CE26E4212D943FFFACF1E11957 [email protected]
889,540,258 *5C8E92B2C4F43C2660042CA112565620392B57B6 HLLNSTNS5
889,540,259 *5C897BB9F7A73284FB8065CA5500042D21BBC820 michelines
889,540,260 *5C8F1FBDE849608E5B21201088A74E2358D0714E mike.medved
889,540,261 *5C822F6B6D119456AABA402B3DCE2F683D296225 HTANDSKOTERSKA
889,540,262 *5C83067EB8898FAB3AA4BB66C1EAC24F6D981A85 HTGRU
889,540,263 *5C83312E80052D1CF19E4EA010484BB0268B7199 [email protected]
889,540,264 *5C8AF0A08C8689861DED4B72AFAFB1E69F0B7D26 HTTPVRRIORG
889,540,265 *5C82264A54589C023F5B44CE74980C96322E09AD HTTPWWW.68THEFAN.COM
889,540,266 *5C8824E79E3664E3B623842F0196C9B641FF6385 missa-brevis:-iv.-sanctus-&-benedictus
889,540,267 *5C8CFE7ADC2631EB5966BBDD3687C468B0167B28 huesos120
889,540,268 *5C8B7EF3114AE2E9BB71A9A5791A61DD6FA94863 [email protected]
889,540,269 *5C80D66231EDA26D3BEDDDD42B14998DC4A76F1D mohammedtrivino
889,540,270 *5C84A18B9BA08EED27C24F2DD01A56C4F2D98639 [email protected]@11Y
889,540,271 *5C8029C4B4D0CE3B4144711F4093738C6DD757DB MOSES.BREWINGTON
889,540,272 *5C80E27745BAAAAF6FBFF1219483D0669BEDCBA7 MOŜON
889,540,273 *5C84F0D3EDB7BD10F548BBBD8602B7EA36D33293 mossbergmao1sber2g
889,540,274 *5C81A70109AEDECD8FEFF321767599D030903E4F ichidenry
889,540,275 *5C813C9C71FEA68A750875734EC1A6DD54F35B00 motion (disc 2)
889,540,276 *5C8000145E8DAE8647D40E23B4F11DD0B78DEAA5 ierelosnoc
889,540,277 *5C88B661BD5E6CCF29A1326E3AC7BDE69315FA6F IGOBYKYLED
889,540,278 *5C8211988E0A808430021720AF5D9F10A3DD2C9A I HEAR THE SHADOWS DANCING
889,540,279 *5C8A09B191A19A6C6457EADCF21ABC02C02B2BA9 ihlpla7n
889,540,280 *5C80C0E77A22A17FE59EBA1B097E0971AD057246 MW-COAL-POWER-PLANT-TO-RISE-IN-SARANGGANI
889,540,281 *5C88848D72CF73355AB1CFA9CD3501432A70DCB9 ILUVCHAT2010
889,540,282 *5C8DE34938C4302FD5DD94DA13AF352D9EA6FDCB ILUVSASHA49
889,540,283 *5C878FF4BE122E361DE845F5AF9363931610D547 IMAGESCION
889,540,284 *5C88FF1FF4624993CD5EC8BA1551E0D1E06098C4 IMAGINARY-DIVA
889,540,285 *5C8D9979CF96C58B7384096B5D924DF0A54A11F5 N4TON41T35
889,540,286 *5C8950712FA7AF907D8D66E35BA9388C4F642F18 INDEED.BAKAMAN
889,540,287 *5C82BB5584DADDB2B08284325FAC6D3B19481985 nancylazara
889,540,288 *5C863D6BAEE2B154399B1039B8026740095F377F inijeko
889,540,289 *5C81B63C6E42A9E991018D317FA3752EE3E78644 intrapack de colombia ltda.ipc | colombia
889,540,290 *5C81152974D3451E4B4431E8C3B17839087F3F44 NEDMERT2
889,540,291 *5C89DDA785ED597635B019C7EBF30114358B2C98 NEDOKNUTÉ
889,540,292 *5C8F266CA8C002F977BFEBB05F9B343DB4891176 NEJ…
889,540,293 *5C8F2C1DECE3944715E51661816328C1DC8AB299 nekih 16
889,540,294 *5C8DA5FD2BFF9FCEBB0666EFD18A12D44213AC24 NENNAVLA
889,540,295 *5C8402021489E3D32567A5A322A72ADBD64907C3 NESTORPADOVANO
889,540,296 *5C884EF1325E6494B630FA9D39CC265982D1E212 isaiasbrazille
889,540,297 *5C8A2B775E097E6FC0D081BD6DD7D2BC62655A0B ishhtto2
889,540,298 *5C8EF54A40D56B9C0B080A2066DBF14F0450CB7C israelsliwinski
889,540,299 *5C82770750C1D003F2973D5910D910E4BEA22B43 NFRDRNGN6
889,540,300 *5C8ECBBAE62D2986884204EF7D9E93F5C3458E2D NICEWAPSTEAUA123
889,540,301 *5C85503EC34D1AD852038F90DA392EAD0E87C10B NICHOLAS.MCCLEE
889,540,302 *5C8E8906E3A05B2E48B460B617434F19BA065BFA it's.my.party:.the.mercury.anthology.(disc.2)
889,540,303 *5C8A65FE78956E5FCFCC9E18C53572ABB0E1D772 NOEL.BALIN
889,540,304 *5C83D9B45D3C8FB750E12D165615DDA1CA01AC54 NOELPARIKH
889,540,305 *5C8D77E20BA24F6291105D6A265CE690C3DB6066 JAMELRANGEL
889,540,306 *5C8036CA7E8C81FA01E93FE12BC836493DFAB261 non5p3c1411575
889,540,307 *5C85B9B1ADC35D0035FC10F8928FE22A4B05E68B NONOMNISCIENT
889,540,308 *5C894ED6A5A44E3CD46E0E403C341EF783E997A0 janmaybury
889,540,309 *5C816E6C999D60A28CA662C0550B13B3DDE49323 JARROD.DELPRIORE
889,540,310 *5C8B33F7E06F5E1452E202CCE160260A437AC5F5 JASIRR
889,540,311 *5C8046AC5ECB721B7B24C55421118A2A47479952 jaspermcnicoll
889,540,312 *5C8FBF8B4C982B06368BB3B7A1EC6E8F56891716 [email protected]
889,540,313 *5C8E3E84F3F401AA15350DFF8E21830F209FA97F JEANETTE-JANISCH
889,540,314 *5C80FC68F68EB8A3EBB265C0C6A4834FE32ABFAE NUTRIFIC4DOS
889,540,315 *5C8D8BF4B4D4BC2EBBE43F48DA11477A426EAAB7 jeff.finan
889,540,316 *5C8D20EFD58FA0AFF2913C61521616511BE880BD jeneega5
889,540,317 *5C8F9E60F3DF556AA8C99C0F96FBB3E24155CFD5 JERMAINEMASTRELLI
889,540,318 *5C8E6A81145C4ACDBE2E1C0CACA2BA41E249F0F5 )O(~-`-D-----3
889,540,319 *5C8EE995C9A011E9DAFF0561F96979EA1F279F1E (O_-).~.~.d##8
889,540,320 *5C8E49C199DFC9BA3FB67DE67C0C93D312DF1E49 o->-<~`d==B
889,540,321 *5C89F27CF6E3557D303E78C794B4E2B7033A6A39 JEWELBURLSON
889,540,322 *5C843783A8E6475153E18A8E631E76DAD3B95036 OKLAHOMAGASPRICES
889,540,323 *5C8C3CECAD667416F2C31D82A5D610575F30C1CD JGIAMPE
889,540,324 *5C8F70E3F9057B110593AFED1B5629C2AB73CA5D JHEITHOFF
889,540,325 *5C8B619453306999325D3184CC0E86D7FF414171 OLENBEECK
889,540,326 *5C8CB6C85CDC8B3C5AF8F5D3ED8BF089ADAE2E64 [email protected]
889,540,327 *5C84CE1226F1F1C96C8B9E3731C9C3B40447394E JIATONYB
889,540,328 *5C8846CC5C7F597558C7A46E60ABB4AA8F4F0E04 OMER.SHARABI
889,540,329 *5C8288821D036DABDE73A26BC6E1ABB9BAB8CD70 [email protected]
889,540,330 *5C8855C69404D6F28963AB4A3BAC2CA0D1E845EE JINNKUE6
889,540,331 *5C84E3FB30289366ECDF3CA271D6E5CAB14E38EA jlr~
889,540,332 *5C8EAC156C0EFE98FAC1F9BC9F79DC979EB03792 johncleghorn
889,540,333 *5C8DD7B33C63477EDAE7B374355FC1CC75F75A05 OR}K
889,540,334 *5C8B3C9C7EB314697304D33217CC033ABE338E26 oscarmiyagishima
889,540,335 *5C8B92734EC3CF94344AE6BBC508D7944B0B33F3 OSTERMANNTOLSTOI
889,540,336 *5C8CC17B4B06C84A2A34AEDC1A7C84942DA3CDFC JPOTEL
889,540,337 *5C82CC4778AB87B49B6A13B9A19FAD9C4D67C301 jps[
889,540,338 *5C81BE5236D8F94BA18CEC437FE94E8E6EB90BA9 JUDSONTUTWILER
889,540,339 *5C8A40BDC35D3E314B6A7C6123ED71A224007E7D [email protected]
889,540,340 *5C83BAF85D4CFEFF55C166392D5B54BB343ECDD8 P1ATE-GIR
889,540,341 *5C8E4E50FCA67EB7A64D287506C208706E2766BA JUNE-ZACK
889,540,342 *5C8D79CEA859D9B0831F6046351AC2792A470216 junior.bien.aime
889,540,343 *5C819BC969A32CBA8DFAAE98FA713F4B1FE5364E PADILLAJEANCLAUDE
889,540,344 *5C8B022E3AA917C04BF7AFBCE0460BC1D6BDB860 PALMER.STULCE
889,540,345 *5C88E3DBA0D98184BBC6FDA2CF8251F76E989AFB palmilobate.
889,540,346 *5C8881C763728B0BACCA619947A6D2511F27BF48 pathetic.aesthetic
889,540,347 *5C850C08A5755C7A54F1E2D8FF1EFA29D53A0073 PATRICIASTEEP
889,540,348 *5C8A65D96EC615AE20A40985DEB1380DEE975B37 PAULA.FERRO
889,540,349 *5C85D332BE71153DF0E18F4556B974F7BAB28E38 [email protected]
889,540,350 *5C89B2435B733AC6EAD84CA2978F0313A8B50A19 keithhattley
889,540,351 *5C8046A82FA62CC1CF5CE32981370464E2EC012C [email protected]
889,540,352 *5C89CA4104DBBD809EC991C4F96A6D8B0B2B5AA9 PEDRO039
889,540,353 *5C804CCE288E7E6DB2C0C0628D788A73E3CDC1AB ki4*
889,540,354 *5C89D8F3EFF7626FD9C6F65628A51B71E1BA9A75 kirkmersinger
889,540,355 *5C86843DA0695E24093BC805B5D8157B3AB8DF0E phosphorylchloride
889,540,356 *5C85476E1A3074223139DD3D53C63D1DD267D6ED P---)~o(~_^)
889,540,357 *5C86A0212C9AB978F2328BBD80F06D93B980FF0B p###>~o(O_)
889,540,358 *5C8A91585FDE6DEE4D14F7CC11F7E92C40A406E2 KÜE
889,540,359 *5C8F25A4486F96C2F5471E5C662E766E21F6B0D8 POSSING1234
889,540,360 *5C859492BEA7708B5FF526C9E5E4958C96405622 kurkboom5
889,540,361 *5C87F2A70FDCC832EABA699D7E362BE65B2E36FF kyliedelacruz
889,540,362 *5C853B9D5450BB50FE545ADD015DA1B5132F7C12 P=P-~-`SPLAT!!
889,540,363 *5C84A8CF36B1731D1FE713DE300AEDFFF6FAA9F0 president-elect-'pr/E/z/I/d/@/nt_/I/'l/E/kt
889,540,364 *5C8B4B0763D7B915E25D6EFEE43BA4D60E484BE4 pressurisant4
889,540,365 *5C8D29F73B335AD864247915F356F93D72116D29 PRIFAN
889,540,366 *5C887DE9D91753BABC3F0EB2FD7C23AF94BEB72A PRIMING
889,540,367 *5C84087E0D66B063C6151B9C47CA9D2C61BAD8AE lancelicon
889,540,368 *5C8609CF25E2D4CD1CD57DC2AF0D9B67757462B5 princessbenito
889,540,369 *5C82CE390D523ED3FAB28A9DF175354D291BDADB prompted
889,540,370 *5C8BE27839C9D62A95A69ADE06EC48A6B3FED213 PROTEKTIVER
889,540,371 *5C870AC3B161BA7010BF4273732E04C0E6D66E36 lavernholder
889,540,372 *5C8EF2EB1CE814D285AB80AB8F6A2A3F86D117AF PSH4M3S
889,540,373 *5C856CA99929E0577AFF48E434A5E0F24C90A570 [email protected]@1yzn9
889,540,374 *5C8E06981847C8BB101F514C37075020B4DFCCF6 pumpkintyler
889,540,375 *5C813FE1A6121D1940E4410986063602D3F9DBCF lenardnowzari
889,540,376 *5C8C5996D575279F699532A43C89E7247710C630 Q62662
889,540,377 *5C8B52055A649F5D658C8E69AD9BE1E04559743B [email protected]
889,540,378 *5C8FFC9CDDABE75E32FE45FD076C274BC0AEDFB1 [email protected]
889,540,379 *5C8851F8A82EAB59AB95986928DD86D768B19E1E let's rock a while
889,540,380 *5C8E4FAFA2CAD5462171C9881B9AC23F0D79A04A levsflows
889,540,381 *5C8ADD8B4ACA48DB3989EB069EA252E815BB241C queimada(burn)
889,540,382 *5C8948C868100CD51B5D7EA50DDA111E16B52623 LIINTERWIKI-HA
889,540,383 *5C8C53271D98D131602E58ED334843218C08F48C [email protected]
889,540,384 *5C8B4FC2EF468C7660D0CF76C2BCCD11A8C17507 LIMNOPHILIDAE
889,540,385 *5C881485BF80018E5126A37982952C9D7155C780 LIQINLEI
889,540,386 *5C8F077D5197F55B6F9550C5DBC8D4D8DE4F5552 rachschläge
889,540,387 *5C850426E6EFB7AEC0096BF4D037DB1F22276082 RAMADUTTA
889,540,388 *5C8E0A12E9F68D9AF5AC7A0E2C7584F96409BB45 randalltirado
889,540,389 *5C8F72D3E05D0E48E89D6ACDADEC336452530203 RANDALL.VETTERKIND
889,540,390 *5C869E16942A5D0D61C0493AD784A5AAE864C58B [email protected]
889,540,391 *5C88A171FC2F3C655287AEBAE0F624474E84EF98 LONG.CALVELO
889,540,392 *5C8FF2F269B1FC216F6AE80F59928F69C3A9DBD0 [email protected]
889,540,393 *5C83AC1A735FE7EE67B2D86240BE80EAA7FAB48A RAUKJUNGFRU
889,540,394 *5C8D8251E20E74F82D31AD9BD80F688F8670820D raullobstein
889,540,395 *5C83F307E4775DF18F52ADECF9949A394E625D8A LONKEMPT
889,540,396 *5C832DCCC4066ECB7CDD8FE2A1EC48833970B8C6 LONNIESERVEY
889,540,397 *5C866D5F15B82BB342004A9F93B44B6A0841EB37 loony40
889,540,398 *5C86CB5B93BF8E782ED3CDAEEAB9E27F34137425 LOUBNA05
889,540,399 *5C812689465228BCF0C751FD1CBD0B096B893D63 READINGSWIMMING1
889,540,400 *5C80DDAE2F3F2135BA3D45D2D354835F0DB1E51B RECARM
889,540,401 *5C82287236F8DD2FAEB731326FFA68CAD0B6F1DC redilated?
889,540,402 *5C82D12B7E2CBC72E5FD43452447267CE0975260 [email protected]
889,540,403 *5C806292C73E2D500E0F26C08A7DD1A73A571084 rehen 1
889,540,404 *5C8FC601252170D5A32CF5755CB3E649339F5638 M32029345
889,540,405 *5C83A9E389DF7DB1EF0AABA558F84641C03FB8A3 [email protected]
889,540,406 *5C800E587958FD93D5BBB42B7A8D1D4F259BE88F macintosscience
889,540,407 *5C820A88A3557468A51C2FF19D719573FB239748 made.of.glass
889,540,408 *5C8F9F6E02F3BFFF9F314739823A762DC8CFB5DB MAKIN—WHO
889,540,409 *5C852ACC19514969601C334D5AE77DF7B2293ADC mammo9raph135
889,540,410 *5C8DCB78CD4C2E2C10E6255F8E3ECF6C4C38E617 MANIPERNORS
889,540,411 *5C8BCE13FBA76DF2EEBE7057D53C0082CB21F489 RICARDO.YANKO
889,540,412 *5C898BFBD548D969BC6F42A2E838C7262E065A6C MANUEL-OTERO-NOVAS
889,540,413 *5C8D1B818439688C69DF4FEDDFDEC132CBD92668 richie.blackmore
889,540,414 *5C86D200CCE5970CE5470C559427538A87A4D394 RIEDUCHI2
889,540,415 *5C8764F48794B0127250B9E353D91EF390DC7AB4 MARINESIMBA
889,540,416 *5C8A6689E21367F42979E029BBB970C135CAD9B3 MATERS?
889,540,417 *5C86F1B79CD0B7162A8B51E889D40FE1F4C536B4 RODOLFO.BRUNET
889,540,418 *5C8F2AA8BCD30BD2E44FA795CB9C6ECB29ECA250 RODRIGONALLY
889,540,419 *5C8D9106C10B698F41F02F3ECD87007186C9662C mauroserrand
889,540,420 *5C803C27D4085C77493BFBABBF41A46CF8377CFC MAWERN
889,540,421 *5C8E3FA9B40F100653F22A5555DA2C10A9F7EDC3 ROMANGRANTED
889,540,422 *5C83F5E20E9CB79D965083742DA7BF757E349EFB [email protected]
889,540,423 *5C8722CDF396866AA0098838BE3D742EC5E73C35 mckinleystilgenbauer
889,540,424 *5C8DA337543278D1B4AD66B626D7E52DE9FAD58E MCKINLEYTULLEY
889,540,425 *5C8FB2C1F9BD325C5BFD893FA0C07442207F3A37 MEALYBUG
889,540,426 *5C8D4036EFC470DFA9BEE3D058992AC218729510 MELVIN30
889,540,427 *5C8A718735875FF3822BC59A92EB80D3D3F498D2 mervincoyco
889,540,428 *5C8A008708D02F452B6EAAA06061E58DDBEB8A17 ROYCEMILHOUSE
889,540,429 *5C87436A0D4443B156A6FAC98649459027D9CBA3 RR5402A1
889,540,430 *5C8D526DB1DFA486FBF2C3EC8C64415C3FED2A5A rrka
889,540,431 *5C8B810873D625DE71046AFD1854B9DEFD6D66D5 RTRIKKADI
889,540,432 *5C83251EAB50B10AFA7326D4E7A4E3AE926FE464 RUFUSMARMOLEJO
889,540,433 *5C88BC95AED09A091A29EB2ABC3506B4CFB45F67 mikefluck
889,540,434 *5C835C2BE98E3399EE79C59EF17007A7C2BBB80D MILFORDMCGILLIS
889,540,435 *5C8FA6DB6A20BAEF3C01381ED48757CA36D988EB RUYSDAËL
889,540,436 *5C8E8C00FA55BDC93822B6335D6F4D248C8917B8 MILO.MAHUNIK
889,540,437 *5C80DE22930D03C4D5ACE985826C64C4404AA9AF minhgedney
889,540,438 *5C8D32EA5D9022F04F4EFBC6F82E83EE099758C2 MINH.SCOTTON
889,540,439 *5C87861D89C9FED71C937B6D6C981DD44D090390 RYANVIXAYACK
889,540,440 *5C886B128BF21C147C5568A4B7FAF344FB0540E2 miquelaniello
889,540,441 *5C8647A0B5E9A2F2DA429049174B34852BEAA493 rzfmhce6
889,540,442 *5C8503524131D05502DF93838B03FE9C7E1A5CC6 mixin'.it.up,.volume.5.(disc.1)
889,540,443 *5C848D123AA5B636EE31658EE23B85D24C1EACA3 [email protected]
889,540,444 *5C8881792E1B82710158955BE31A6E99E5D2F5B0 saengyssae
889,540,445 *5C86DAB10F38A37E84E1CE04BE349A36E1590472 [email protected]
889,540,446 *5C8761A49BC85DA50FE33A367834B1143182F844 SAMMIE.HAMPLE
889,540,447 *5C8245D225880EF53865B0636E82604A6A96E066 SAMUEL-PAIN
889,540,448 *5C8801279321DFE1ADA5155AE379897A6AD1B393 sangsheman
889,540,449 *5C87BA6263B691C953837D028651A6F1485679AC MOSKATELS
889,540,450 *5C8F926C4CCCC470F36EC3CE18FB782D1D732C20 santosaltzberg
889,540,451 *5C829BF907321521E1A921C72BCCC8E6013BE0DA SARDINIA-CITY
889,540,452 *5C81741E71021EFDA3744517318A53819DD83C62 MURDOCHILAISTA
889,540,453 *5C8FDE6B08875BE6ADBF651F7A9DC27E820CEF0D MUTTA EI KOSKAAN MINUN
889,540,454 *5C8445C8A91F34D97D52C35663935F9A51B4A529 mwvgl
889,540,455 *5C8F850F11F1702082EC276A334083DE1D36D5AB [email protected]
889,540,456 *5C8E27B57FAB416C3DAC5876BC25671C2F83C86E mysweden06
889,540,457 *5C8026D20458F4722B2B8A96137BA05CD9200830 SEBASTIANBALDINO
889,540,458 *5C86C50B4A4D791F8D597A4DD88BC936F0447C83 NAOUNAAN
889,540,459 *5C8444C92D4F900E01A357745E052A543D8F71DF nathanialjuneau
889,540,460 *5C8AB678EDCDA8B17C6B79258567B1B52482B5AA SENEFELDERI
889,540,461 *5C8547B69FB6D945904C6FB83A1B733786142DDC nealgoldberger
889,540,462 *5C876DB54CE29844E2D36FC2636EBD2A291D2FA0 serenade.no..1.for.orchestra.in.d.major,.k..62a/100:.ii..andante
889,540,463 *5C899D734F1E501F74F5E0FA0480F5E7437C7F95 nelson-toh
889,540,464 *5C829B6BA0DC93AF5EC973007BD3F5AFFFC872C0 SEZTASEB3
889,540,465 *5C8C42669E267010D5BE22473F8E5F98B717D197 newusered
889,540,466 *5C8CEDA4B98F7447764CD7EC426DA65BA58A5827 nichts.ist.sicher
889,540,467 *5C81CAE1EFDE49D9570F8D9DC96D7F28EFA4B02A NICOLASMOLINA
889,540,468 *5C860CCA2376BE86D43E77B5E9F08EFE5DB2E271 NICOLE-WESTPHAL
889,540,469 *5C8A1DC9EBA916F23329B47D9C8E19EF711357B4 SHAUN.HIGBIE
889,540,470 *5C8E5960BCFC9A285B67607E174DDB54967B46FA NIEVRIH8
889,540,471 *5C8201578A67058B74856FE39428FADA85D97857 SHIFTING
889,540,472 *5C87B8846ACE8C29738DD97A8E4A5EE23EA3C488 SIATRAPERING
889,540,473 *5C843F7D004B1BB3403022C7989FE91035D03EDF sibilio12
889,540,474 *5C899FF6D7AC997DFCF8066575989C9B5F5F744E sinfonia:v.(feat.newswinglesingers,violin:r
889,540,475 *5C8BD7592DEB4D33A1255BB06F18C22FDD8C7D8D NRTCBRI
889,540,476 *5C863E0C24FA5FFE07A50385F2204B6C3C20159F n`uaaa
889,540,477 *5C8B68ADA157B7F3EA8590177FD9D5DC6A659485 sk/ou/pgyroscopic
889,540,478 *5C8AEE48EB8D3CB3C1C018E2F205EB1D0A6745B4 SNNICHS7
889,540,479 *5C82F8671A8CBD25EA2F9981DFDDB9D014246583 [email protected]
889,540,480 *5C877BD62C891FE281914EB53471FA130F555577 okaying
889,540,481 *5C8220D38FF954233D12C9B959EECCA65FB6D16B OLIESES1
889,540,482 *5C8A32BD921F12FFDA2D2FC9C395D4BCD4B58C1F SOLOMON.AVILAR
889,540,483 *5C85FDCD5ED689B9FE65D573F206956CDACE5459 omotanolabode
889,540,484 *5C8714BDE4E0E7A8430C4E3CC3D11B4C374D1695 SONDERGAARD2
889,540,485 *5C8217B5D1A369CE3A1A55EC7873D366B93B2742 ONESTRIPE
889,540,486 *5C8791FFB41003E4EF3CCB99FB3116629FFE3A9E )o(o~ 0~ (8
889,540,487 *5C8C0EE9AE71444703283C8191293688B06912B0 )O([email protected]#P
889,540,488 *5C8F9472333C6CA557A52010B60C237469219834 orieuwleu
889,540,489 *5C86FA68B7CB6D8E49E519BBAE7F021388F31373 SPENCERCCCCCC
889,540,490 *5C829AA37F1DB6B8C22FD7E1F0CA972D01F272E5 splato~0~d-p
889,540,491 *5C81903330BAC4FC744FC1DCD3D68286F2441811 OTISNOVAS
889,540,492 *5C892C5CA3A43A42CE5377BD11A87ACF46F25907 [email protected]
889,540,493 *5C8EA8E8BD5854474C039EBD8488F9F730CC1CB4 OURFEELINGS(MOONLITNIGHTVERSION)
889,540,494 *5C8F5523B31AD611DD33A3C7495484F289453DBF SPOR7SWRI7ING
889,540,495 *5C8B8BBE5AEA86A205BDABDD9ED85DFA6C518BF6 SPORTCATCHRAW
889,540,496 *5C855B2460F10811F208D1321A2077DE1D8FC285 spo"tter/fns
889,540,497 *5C871FBF080C6143E6B5893A2E23397E37515723 p3cul14r1+y
889,540,498 *5C8D46381ADCC8DA18BA94E78299A9339F8232CF STANFORDGANSKE
889,540,499 *5C84E769ECE0AC58A39511380B499BCE05B12C74 STAN.SCOGGIN
889,540,500 *5C8A8C6B4DECDCED775CF14CD4938ACA5691166D STAPELRE0
889,540,501 *5C8A27372C8EF5199C8619B1EE19C5C9A899AA18 PARISLARANJO
889,540,502 *5C8912254D20D13C18B5BE7CB9E68B2C417B5C6A parislatshaw
889,540,503 *5C8C0A1B907B5A201175FF195AF4D9C64235EE95 parispottkotter
889,540,504 *5C8019E2AE10C01EFD36EA54BE82B509104F7814 PARODIEREN/DIOXY
889,540,505 *5C8A64163AF523AB1A9FDFD0997BC717B2DD49C4 P======B ~(O_)
889,540,506 *5C8F94DBFDA9B17EC3E7462428B0B26F45F7A210 PBT-VS-T-MPLS
889,540,507 *5C87A42608196ADDAD5FC73D96B84370CC2F51A6 stierwalt0
889,540,508 *5C8BC246E546FD1A039BD04BB09DAAF177AB9C40 PEACHMOUSE317
889,540,509 *5C8AF986FF691E9836ED53382101D058A03B98DD PEDRODRAIN
889,540,510 *5C89D38DD3E26E8214A2E1C6CA857FE8C94D2FA3 pejorate.
889,540,511 *5C8035AC09DA47995A459918F6915CD63CD471E0 STUARTDAFFERN
889,540,512 *5C847480F14D71DEF49384F5DEF5EB6E603C4553 [email protected]
889,540,513 *5C87087CA3E63B5DE42A2F099B0012DF05AA4B03 [email protected]
889,540,514 *5C8116C76D673EEBCA70AF9859E030E528692701 suchtobepitiedando'erwrestedseeming
889,540,515 *5C85E7E2B4F233549C7733F7840A5E6F4EB97829 PHILIPKITZMAN
889,540,516 *5C89477482526B5E40768F8334EAB79AAD5CD124 PHILIPLAZARD
889,540,517 *5C8AE83126C2A9064FFBFA4000DB666BE5E53094 PHILLIPLEADY
889,540,518 *5C8DCE4ABCBD7DFB4A5084182753CF983A66B663 SUE JABLONSKI
889,540,519 *5C8BD20EC4A89671F3AA3BA3BB7C5F75FC858909 SUFARAH3
889,540,520 *5C8281E26DCFC4308B57D889AB4223A20BA1B49C phoneticizations6
889,540,521 *5C87B3714574CEF9FB7EEAC2B536432A1CE58853 sunshinebyteme
889,540,522 *5C8ED3C086F3E325C7AF92F2678FE7E4D559BD1A SUZOVAT
889,540,523 *5C823B3C52E970569009594D76C31DF4327D542A @SWHYK
889,540,524 *5C894F47976314F3B5432C3B7E068E0559D6752E POLITESSES9
889,540,525 *5C8B0EFC8C2EEFF107E96BB67FDD41D8CE0DD5B0 POMAQUE8
889,540,526 *5C8947A312F93821531C1DEBE62606DB17158893 POMONALA
889,540,527 *5C8A4643F9EC0BAAE3232EBC6B76CDAF2940D091 [email protected]
889,540,528 *5C8359FEF9157E3D8FD0DD6D4B803E0879C46F28 P##@.~O.:P
889,540,529 *5C8ED4947937091C1D7262238B0EEBAA61EB8F26 SYMPRINGHAM1
889,540,530 *5C8268367A914C50A20EF7A82949CF886E9EC968 poricahu8
889,540,531 *5C827F85290BABE54C83E89AF8E8A62DA405B173 PREYSSER
889,540,532 *5C811B61CADF876E31821F63A3A20ECDFB1365C9 [email protected]
889,540,533 *5C82037B3158FF52D1F0E0BDD9AB382BDB6C640C princecalvello
889,540,534 *5C80BB1A18D914CACFE60DC6E882BB3DDBFC6E53 tardavo
889,540,535 *5C84A858F5E9E1EA74F85F718F0420AA40E8D7E8 TE8SV9I
889,540,536 *5C85E5F254371F3E0FB301AEB2EB22D461FD436C TEAU-SUR-EPTE
889,540,537 *5C8CFCC7C577F858342E70B848EA71C1C7CAD9AC PURFYLE0
889,540,538 *5C8F19DD0C84EA025E63113CE2112A0F83A1B484 pushin-too-hard-(futureshock-"confession"-mix)
889,540,539 *5C82785BCF72597A356B05A0B930C63D72E5455A TENTHOUSANDTIMESAMINUTE
889,540,540 *5C835DF0EAD2BCC9ED69E54C54497C8246F76ED8 TEPAJIQUETAMAS
889,540,541 *5C810D021B1E1B17CEEC852EBF4DEC65BF7CB8A6 q######B~~~><
889,540,542 *5C8CAF90E83C0CE1C53806A13BF3F1F564952C2F TERNELS: DIAMONDS ARE FOREVER
889,540,543 *5C82A761C3A2313506B44ACE598D1E4D15922A14 [email protected]
889,540,544 *5C8F171B46B0F4ED9ED4EBF1D4B6B72C757AA00B TERRY.ACORD
889,540,545 *5C8432E81B9068E82A23A1F275B7242A65AB2DD2 TERRY.GUTENBERG
889,540,546 *5C8FE4EEA7A4D91DB1A7E122333413AED8D6AC76 [email protected]
889,540,547 *5C805BFE19376C3F4B401AA061B42A855DBD08AA TETHING5
889,540,548 *5C89C69FA4CD6CE1D8D9ADF80AD62B2D5FBD858C tetova
889,540,549 *5C83F99FDA36BECC7BF2E3E406D371BDE4B9FEAE [email protected]
889,540,550 *5C80AF4A709773F27F565139BE06D1F5677E0948 THARMINYN
889,540,551 *5C8E4D6C963F07BEAA2DC841C384C501C44CE3ED THATCASSIE64
889,540,552 *5C859B9F5B9DEC912E4E9B156A64BB1E357EB162 QUETONTOFU
889,540,553 *5C834BCF2997CE76755863A50E9CBDFEC9B1D0D4 THATFUBAR79
889,540,554 *5C85A1C01161DBCBD38B049F8E8CF532B9E60D66 THATOBIWAN34
889,540,555 *5C8E2E17249697E245F71FC1CD8DA25B41ACCF29 QUINTONKEARL
889,540,556 *5C80D27A0FBECCD4C25593408CBD25EA57E362B7 THEDREAMISALWAYSTHESAME
889,540,557 *5C8C3D1B7C062206DC61EB9FF8F9BB0D3CCFF777 radarequip
889,540,558 *5C80D79565B66BBD99B7291DBD8AC0657349419C rami.afif
889,540,559 *5C85A8D977EB37B3A1EE4BA9C726E932E47E87AA RANDY.MALESKY
889,540,560 *5C818425617EA9AD265155C78C5E586B2E7C6640 rangschikken
889,540,561 *5C8CFD6A2FE2D96D68C6A04E221AF3E36696A6F7 [email protected]
889,540,562 *5C840C31B448345124486370C5D4CD7336304850 re41!s+!c411y
889,540,563 *5C8C2C1E328C1D00D5B1B1B885280D8EEA2EBF20 [email protected]
889,540,564 *5C80549E36270409B93BEDE8FB462C2DF6F283BE [email protected]
889,540,565 *5C82E060D8B5C42DED6727D1850AC171FC97466C TITT3D3
889,540,566 *5C8D3FCD63875A634366E0C3EF46E1B264033B2A regog
889,540,567 *5C88EDDD3193DD591564B00BD566D444048D22F1 reinaldobrinkmeyer
889,540,568 *5C81159D7DFFAD051B2E677D4C6BA45698A2121E TOADMANVS.CORNMANIN'COUNTINVEGETABLES'
889,540,569 *5C8DFB07C648B44288CE7687AB61FCA5D0930667 todddickins
889,540,570 *5C818D8C59A83CD677CEDC9CEC462C053A894B27 [email protected]
889,540,571 *5C819777F026DC61D623E44ABD55AB24415948AA REN.SALGADO
889,540,572 *5C864664CE62F8BACD0C41060776250BAB77953C Requiem-for-a-Hit-('Requiem-for-a-Buzz')
889,540,573 *5C8BE2689F3398EB278623F2152BB357EFF64075 reserveringsnumre
889,540,574 *5C8A411699B4DF9A62A01B452F2506017211591C respect
889,540,575 *5C8B253C2379CDCCF002AF939DCAD9DFE00E0174 returfer8
889,540,576 *5C8D4BD56FC70942CEA0238DC42AF6029BF47A75 totalentr
889,540,577 *5C88003CFB52C1F1BE17AB33E5501B9E57E9BE79 TOWNCRIEDWOLF
889,540,578 *5C8ECF62310FD975A611AD19A643437F88F2CEC0 TRANSFER.INTERRUPTED
889,540,579 *5C827DDFF5E7BD1AD6FC48F763DBCD062F34DE0E transvaal»
889,540,580 *5C85B946BE75E0216507669E85097A7B9260B96E RICKY.NACHTRIEB
889,540,581 *5C83000EA1ABDE1DBD41792058BBFC6B3F5D79C3 ricodunsworth
889,540,582 *5C8881C19C43529A77035F44E330283B6C7C8F49 TREBLEGNI5
889,540,583 *5C8D6A87C296AE66C87721FE2EE3DFCF5F922015 TRILLO123
889,540,584 *5C809243970425FCF252455776EB4A7A8B554B92 TRIPLE.LEYLINE.JUNCTION
889,540,585 *5C8D8053F0DD9FDC737DCB824530CAB0E702DD4F TRISH-RIECK
889,540,586 *5C875450F5E1878F36045A98F7CA118D4D507D05 RNVRAGENED
889,540,587 *5C8D4D3C47823FE444F691523A57B6678A5AFBAE TRISTANVASUDEVAN
889,540,588 *5C8C57817750FB94A00537FBA24004CFC638D836 TRTURABL3
889,540,589 *5C830CC6BF97DEB9065642D4AE52949F6CA57E00 T%T!
889,540,590 *5C834BAAA95C1D94A47E496AF3D50DD7BD3759C2 ROGELIOROSSI
889,540,591 *5C83F62B797B4E781C2007CC80B695C20FD63181 TU":
889,540,592 *5C8ABA3C141E238E72CFE62D76E9D8561357FDF6 TUKEELIA.TORRENCE
889,540,593 *5C818DED4139E871D96D19D9AAE8AF5F613B1F18 TUPITJSS3
889,540,594 *5C8FBD48FD762C3CD984D50B380CBFF9F7F3B850 RONNYHWEE
889,540,595 *5C89FB4DDF16B4D2FDFE7CA7F7CCEC3B4D1BCEB4 rooseveltjp
889,540,596 *5C8085252C70A7D758CFE319FD6075631DF97974 ROSKADÓKNÁL
889,540,597 *5C8D12EC958711ADB5F19B8EF79192761BC1D4AB tyroncrighton
889,540,598 *5C8C04F0E83726644D1B1FFF98F5D22EB8C811E8 ROY442
889,540,599 *5C812A0EFDD52DC71373D10AB3E650F2BB6F1EFB UFECRUOS8
889,540,600 *5C87124C49FA593731D6FA6E4A1E7299384B9021 uf'n
889,540,601 *5C80FC4B37305BEF86F8A6E6F62D4F56EF8255EB UMSCHRIE9
889,540,602 *5C8813093078BD2F66231A224BFE8E36495E5012 undispose5
889,540,603 *5C89349655BABB0B9483C8DF5C1B8E70E930CF01 SALLYWA
889,540,604 *5C81F7CBF4DEDC45EB4A72F29729C4434E0E8A35 SALTAVAM5
889,540,605 *5C824446BCB6C0A586068516552342216DAFE247 unretaliating2
889,540,606 *5C8D14A071E77436A786A491CEF753C1667698CA samualbaena
889,540,607 *5C830417448CE88BC7A9BB2EFE361F3FB2122075 sandyfirsching
889,540,608 *5C8AD940D07BF04593D04FD710BDA910AF54B457 SANTIAGORIGEL
889,540,609 *5C87FC0C8BFF32A09172B0CB81B3298C90CECF87 SANTINO CALABRO
889,540,610 *5C83923562C0301F5AD12EB376E61E1B909E0C96 SAPPOROショートフェスト
889,540,611 *5C8BF299FB73261A602CBA1CE41E0A31AA9D1B0A vadik.zalmanov
889,540,612 *5C8D707C71C027F3785A5135106A9709B5533E89 SCHERINGBSW2
889,540,613 *5C8DF1281ACD79E6B25689B854FE49F189D2030C SCHITT0
889,540,614 *5C837CE2E7F07959E9F354ABA82ABB9385D28A47 SCHWASSAWHCS1
889,540,615 *5C8A6F0B2F45C44ACC6DEF057C6AB8A2A311E4EF SCRUNTA5
889,540,616 *5C81066C2EA7DAE5F97AE8163897F8FAB59A445B SEANAEH6
889,540,617 *5C82D76240499F1AAC21887A619F9783CB4F75A3 vergents0
889,540,618 *5C86ADAD89D1BD165B523822530DAE5310D813DC SERVITJE
889,540,619 *5C8BAFAB2D6DDBA5712EC50108B03C6FC710A9BB VIAVOLTURNO
889,540,620 *5C8B35EA5B14E1CB18813BA96EFC999CB84D5A88 SGEWLEBOH
889,540,621 *5C854D5171019FBB2FA94A69D08FCB29380ADEAA SHAHEEN.AFRIDI
889,540,622 *5C84804DB060F77E91178A9F7F94A72B0F1E0908 [email protected]
889,540,623 *5C82CCF7E996ACA82EE48CB02F7BFE6892BD0DA6 VIDEOSHARINGSUITECO
889,540,624 *5C83F9E677AD5AF841F23CD7D92F97AF9EE28344 VIJAYBHUSHANAM
889,540,625 *5C845E84AB6B5260690EB2F1B209AF602469BB5F SHEEPFUCKS
889,540,626 *5C8424AA496FF5E8928439499014DBFE9D87BB64 SHEIKH-ZAHID
889,540,627 *5C8D041CB44C85C7E281EC44AE0CCBCB0FA11904 VINCENT-VOON-KIM-SOON
889,540,628 *5C8BBC3CEA01B7CA21FF4F6145E4850F547765A4 [email protected]
889,540,629 *5C8D67A078B2F7BB0AF1BCEDD2BD36C9499FE3CE VINICIUSSIQUEEIRA
889,540,630 *5C836C3A121AA4ADA90C7A31CE124CA15EDC7423 VINNY-CONNER
889,540,631 *5C8D54954179D538A45C9654015A21EC63C41CEC SIDNEYBACH
889,540,632 *5C8088A175F116CE206F7302E12F8B16A58332ED VOODOOPEOPLE(ORIGINALEDIT)
889,540,633 *5C8057E6776EF6D5A2B6579F5BB978D18299D96C vovxekv46
889,540,634 *5C880F59DCC0FBBF9267699310248861E48286F5 SKROWTAES9
889,540,635 *5C8B8B95B33701FCC2A8A23B2A67D23B6B7B4729 W108547
889,540,636 *5C8E6FCCB029D7C568908637AD8650A0A632CDF2 slomo-rabbit-kick
889,540,637 *5C83AF14C9166FB93066E9914B4DF952229A474E SLUZBE.7
889,540,638 *5C8CA5E941A0ADFECB19194CC6E8BFF3DE86BE21 WAHYUWAHHAB
889,540,639 *5C89F3878F4E1EB137ACC9F1D127CE6A4D94B0FD [email protected]
889,540,640 *5C898C651775591330281EE39FD2B5CE2EA68AE2 WALLACEKILLEBREW
889,540,641 *5C84F8F3E3F5B29EFCF0F7347CF9E51BAA4CB48D SOBERIZE
889,540,642 *5C84509F908298CC69C24F0A0E5DE4662C73C891 SOLOMONAGREDANO
889,540,643 *5C81BA274CBE183A019A899F4162D0D528B02508 SOLOMON.YEBOAH
889,540,644 *5C83F46C6EBA3BCD0EF6D10AC07C4BA4D3FD87DE [email protected]
889,540,645 *5C89409C9D39B7A1E8DDC469EE1F4B17C0CD8268 Sonata.a.quattro,.WoO.2:.IV..Presto
889,540,646 *5C8FE3E645C8645A06701D0E8FAE0861C50ADF79 SONATA N8, OP13, 'PATHETIQUE' RONDO ALLEGRO
889,540,647 *5C82342FF758C3C76B9864A1EE459CBD73EAC3B4 WANHASNEZAREENAWANOMAR
889,540,648 *5C8F9FF679C04D9CEE930EB1CC77131F10535FD5 songforpj
889,540,649 *5C874D0C177EE3B86982CB937606B2BD5772D557 [email protected]
889,540,650 *5C8C4AAF814EECBF06835E072BD732CB717FFBD1 SONG.OF.THE.SULLEN.PLAINS
889,540,651 *5C8F876F5207BF2CCB199D5FEB805CC419A915F2 songul-aydin
889,540,652 *5C8839201CE3BD27387D1FE485C49A5C41725066 wardszenasi
889,540,653 *5C89BAB3E2E3038500E9893A80E7400920D5E2B2 SOORTSKENMERKEN
889,540,654 *5C8EBB1D0B27BC7458C28F97AA395448EF9D7144 SORRY,-WRONG-NUMBER
889,540,655 *5C8DDFC6EE120CCD6DD2D7C749431B71EAEB8773 SOUTIVM
889,540,656 *5C804D0D1D5A35CF7967F7945C92C3EEFFA35D96 SPARE.ME.THE.GUILT.TRIP
889,540,657 *5C82706EB25ADE9658B502597AA0FEBA05C5803D SPENCEBSWING
889,540,658 *5C837A6A9129C77FA0A6D09FEED09CFF849CCAD4 [email protected]
889,540,659 *5C8E01FC4A8D20DEABBA0498452689E3B8B5664B WEBSTER ALEXANDER ROGERS
889,540,660 *5C85B283C299BA30BADBA8D7C9CA8D6C18B9397B splat ~ ~ ~ @==b
889,540,661 *5C89A23A8753A7747F3F1DF841308E516FC2444F splinter clear cut / joyous smash
889,540,662 *5C85EC09A20899CC7D0CC4D752BC4460D3542B3E SPORTOLNA
889,540,663 *5C819F171427A5BC1BC539472DCBA9A4C92F902C [email protected]
889,540,664 *5C8EE55A1DBE5B20284EB705586B57812A4AF8DE [email protected]
889,540,665 *5C886A5275560320AEA7E40E0F579B7B9D7533B7 sqrtb2y2
889,540,666 *5C8F149891B4345EC83FF00C07A90063F6438793 WESUEH
889,540,667 *5C8CD24B23971CED043A2E80A16272B2DA314223 WHEEL-0RE
889,540,668 *5C8B586D3F49DDAB5B823F90CA1A022946802541 sruegans
889,540,669 *5C8B8F970656D92437F5A2120D8096EE255049C8 wilda-lugo
889,540,670 *5C8C19F08F7379402A1F6CEDFA7E5BFD3E41B67A STANFORDMCNELLIE
889,540,671 *5C856D783CE778338B3969F4C42DA92DB6AC55EC STANLEYBERAUN
889,540,672 *5C8D2B4AE8DDE53DB64248F1006FA738237F746A STATI0N E
889,540,673 *5C81701D0D25C2B5C5964FBFF7A7DD28CAAEC79E STEINIGSTEN4
889,540,674 *5C89BCA0C6024B572AFB879CFADDEFE524735C27 STEVEBYANT
889,540,675 *5C89A8126700CE4DA42129ADEA14ED18765DDB46 STEWART.SPOLAR
889,540,676 *5C87DF1FDBC150E2769E446C67DF88FFF0E85BC5 WINSTON.COLANTUONO
889,540,677 *5C8AC491FB651CDC8B1748FE29FA854BE1DDA107 WINSTON.URA
889,540,678 *5C8966799492DFA9495171E0968262CB16A5DBCC STRING QUARTET NO 5 IN BFLAT MAJOR, OP 92: II ANDANTE
889,540,679 *5C86CDD347FF80F508F8A56F305ED59CDC035943 WONGANEH.ANEH
889,540,680 *5C819E90BD2E780109F671457584ABD2050ECA35 WONGVLUN
889,540,681 *5C810476BF3C18E9614A0AAFF68708E1F974C0DC WOOLWEED2
889,540,682 *5C8B26EBA4EEABA6CAAAFA29D999063266BA7775 su8c0nsc0us1y
889,540,683 *5C8487FA548F087456319320804FBBE836967C1E WSPÓŁCZULNEGO”
889,540,684 *5C8B1037543E2A34BBE3FBDE5BE93BED1E85AF45 SUITE.NO..4.IN.D.MAJOR,.BWV.1069:.IV..MENUET
889,540,685 *5C8B13E88E83B556360D07D69E6498503502873B [email protected]
889,540,686 *5C896651CAAA3A9A71D5598566ECE2EFB181E09E SUOHTANGOMSED9
889,540,687 *5C809BA360D0B499D4AC2B867C3D46F9A752DDD7 WWW.DCPAGOLD.ORG
889,540,688 *5C85A8C85D1D9944978650DA2CE150706C873F7D wwwearlychristiansorg
889,540,689 *5C87A9A81A07506BF824F3F13508B884B9BC66A3 SUPERREGITA
889,540,690 *5C80B5819CA01BE94B7DAC1A65564C24E0E48676 wwwjaxdailyrecordcom
889,540,691 *5C849DF828B7F3FA234E14AE52DD4749530472FE www.madcowzzz123
889,540,692 *5C8FBF57E144EA64D65810922BCAD8515C204691 SUVRANI
889,540,693 *5C8F94B2E7B650EB9BD6AB40ED056A11770A6454 W=X)
889,540,694 *5C8E3495B038F3139768D1FD3F0145630FCC7351 SYKKELLINDA
889,540,695 *5C88BD274350FCCA3D1F30B41A264B4B9A4E2DC3 SYMPHONY-NO.-5-IN-B-MINOR,-OP.-106:-II.-SCHERZO.-ALLEGRO-VIVACE
889,540,696 *5C83581B62397CD0B4A17FD527D80AE3D784DD16 }X{~`<----B
889,540,697 *5C8AEA176058283D15E28CD69908DCC464C9A2FB [email protected]
889,540,698 *5C86565D497A3EE891D6CB2B13831F8878DE6262 SYTONAHO
889,540,699 *5C86CF4752C9CE2B95ED53F33685A638E2177A10 TABLA.ANUAL.SIGLO.XI.A.C
889,540,700 *5C8EF949F54F32F7D5762A3AA23BC9A4BF490949 tablified
889,540,701 *5C86D764C46010C622649CDD3E7B2322E490FEA7 XINTELMINTH
889,540,702 *5C8069D708356CE9AA57723AB2E7AE702917EF20 TAKE.HER.OUT
889,540,703 *5C8BC7B2B6638AC6130D2749F28A303FC427D863 TALKEVERYTIMEILANCE
889,540,704 *5C87FCFCCFF75ADA0512ABEBBFA20C1C6C3326E4 TALKLAWRENCIUMTALKLE
889,540,705 *5C8AFEE644EB5BCDBE016E0BA632A4156FF8E87C XSCHM
889,540,706 *5C84F7096CAD0C7BB218AF5CB9FB12816A8770FE [email protected]
889,540,707 *5C8C7A188840FD8A0DB85C5CBE6B4312E06E4E3A YACURA.CLARK
889,540,708 *5C8A7953AC46CC2D64B96664418821CA5E5262FC TEACHERSTUDENTSTUDEN
889,540,709 *5C8C4685E67F11148C595480EB88BEECDC75342A TEDDY.MASLAK
889,540,710 *5C8A33EC86CCDF0B08FF87621EE683E735A1A2A9 yasothai.wauraanantawiriyakul
889,540,711 *5C8B69F70F78490D462E001F4BBD23A51288BA93 YASSOKHALAF
889,540,712 *5C84D9659AD62BA4FAE4B887EBBE4952C376C787 [email protected]
889,540,713 *5C87A6C561A4EA0563A2DFA60FA8180790E806FB ybxhztf
889,540,714 *5C8B65C68AC82DAAC6574A945F06A9D116701192 yeowsiewchern
889,540,715 *5C85B49EC37B7AEAFD7D67AA2265FE3173B7ADB8 [email protected]
889,540,716 *5C8737C93720589D7B4654B7AEF5142A2F4002FC YHF-MIQUE
889,540,717 *5C87E017C24E905DE0630FCE4849C5CF248863C5 TERRELL.BERTELSEN
889,540,718 *5C8E93701787EB362C1A975B7A6FECC69B0F0509 [email protected]
889,540,719 *5C81D8665076E6B311C7919960A293C19BE4DC23 [email protected]
889,540,720 *5C8821524355BEE4B58D6DB917C6F2D9E5960D4B test123monday
889,540,721 *5C81A6593132765B130F3290A53C41EA4F715799 $YNDIGE$
889,540,722 *5C88D39047DCE93EF468FA2EF7F8B7678117033B [email protected]
889,540,723 *5C830BB96D91A48BEB6EEA978893F1E4DAF6A454 TH3RM5PH3R35
889,540,724 *5C8D81B94843E619CD91248CC2CB69F23B8629CE thamluan
889,540,725 *5C852CB2C86CDDBAD5A7B983CA923CC346FBE790 thathollywoodmagic(a)
889,540,726 *5C8DBCC7B9C266F31B9D3AC06E6BBF2D92CF4663 THATSOLOMON74
889,540,727 *5C89C50D69EC31634F2A64FFDFE5B002E8891443 the.59th.street.bridge.song.(feat..alain.souchon)
889,540,728 *5C826246B8401B24AA3B437F1F1BBC746F3BFB97 YOUSRA-FATHEY
889,540,729 *5C838167DCBB1ADB4DAF1FC5B0023E9010AB6FE7 YSONGEU1
889,540,730 *5C86F9B63BAADD82E798834C0514846211F1BE01 thefullstoreycomwww
889,540,731 *5C8AB996EA79CB1BEF66F9247CD444420226E39B [email protected]
889,540,732 *5C8B7057DAEB1A4241E908E471E7DB59D28D9AF6 then.again,.maybe.you.were.right
889,540,733 *5C853B39DAF859EB637D31CDAE45EF29B79FB296 THENICKLAUS9
889,540,734 *5C856B52ECD9C69AC300E3E4DAE291864CFC6EF3 THEODOREGRIMMETT
889,540,735 *5C89D43A4D2ADAD777075F9F555D9CF92147D503 THE ONLY WAY IS DOWN
889,540,736 *5C8DAFCAEBBE27DF2AEB4AAE918E1081A0530E33 THE_SECRET_PEOPLE_FI
889,540,737 *5C8CBA2DDB36C7DE4294EFC8F4A5DA11F67A5E20 Z46201
889,540,738 *5C8836EC011AD78A81E217419A5123B9922150C4 zachary.mcneill
889,540,739 *5C8C9917710E590E4CB98E6A63AEBCC0E36CB84B thomas-borge
889,540,740 *5C84FB4B8DBF92E59C7E0610ED407BE75661F4B3 ZACK.GOONEZ
889,540,741 *5C804169348C9A45F4358A532DBB00D55421C3CF zama-daniels
889,540,742 *5C8C800E3A53A44B4EA1C17B0F9F7B7DA2CD2FC1 TIARELUMITS5
889,540,743 *5C86DA211DC45E8732735E0277318F97CD45C0C5 ZÄRLLICH
889,540,744 *5C836FCA4F8E9BF2033933482B4C2FEDB0C0F651 ZÁVERA
889,540,745 *5C86DC1D488B4EA0AB467ABE5CB0F0EEF6E78ECA ZEMËRMIRËSIVE
889,540,746 *5C83B7229D5A58E14D991F698C161896093549B5 TIREDSOLDIERS
889,540,747 *5C825E9B61AFC43F77B91BE9CA8F23607309F25D TOBYANES
889,540,748 *5C801A54241F2A371787AA05FE7FFA24F58AECBF zh"z
889,540,749 *5C847607911516068BA83D98B9BAE609FC23A0B2 TOMHOKY
889,540,750 *5C8EF7279CC1ED0F0580BEA99E8BBF223B091FA2 TOMIREDS
889,540,751 *5C8E4173F006E56FA802E2D930EB18F541CF9862 ztilsat8
889,540,752 *5C8A9317EBD522A274D50D25AA6F218054CD5AA9 tortillaz
889,540,753 *5C8538D43D2F1C3A8C016753B52EB477DF5F127C ΆΔΟΥΛΗΣ
889,540,754 *5C8E7D4ED05F4A443CEB812B1E3EE76CF5F32DFB Transmgraton
889,540,755 *5C87A315823EF0C2408F5B9BCC6CB5578D8DD00B trauerfest
889,540,756 *5C891B00C1AC82ED6F8AB568802DFB33725FDA98 БЕСПЕЧАЛИЕ
889,540,757 *5C8FCDEBE8B4BE4FC73CB99EE2CDA6F94A1F7353 БЮЛЛЕТНЕЙ
889,540,758 *5C84DD3CD7616639349363C1AC03B9B88ACFF8C0 ВЛЮБЛЁННОМ
889,540,759 *5C816D2AE3AE09F5ECF3E417CCF205DFD7B727C8 tricia-carmina-pagkalinawan
889,540,760 *5C885CD957DC5AB7670E9AF73903BAD15ED3D0F4 TRIGONOPHASMUS
889,540,761 *5C8041C4926AFAE4C95ABC85F1049814198167CD trishakeeth
889,540,762 *5C8C31F4489068F72DC7EE094E9D538CEB552969 ИЕРОВААЛОВУ
889,540,763 *5C867BB24E333D355C0A497B8FB03D49467A7298 troy-dantonio
889,540,764 *5C8F2A6E87376E31DE328E858D722946472900B2 ЛОМОВ»
889,540,765 *5C811BC11C2B1203F2353EF5C8F5738B8A4A65B4 малесите
889,540,766 *5C838ABBBEFA7DE23CFE29F174007FDB1837726C TUNGUTSKA
889,540,767 *5C80570C39C71B9E2EE1E8AB53BD30B2AB398098 СОДЕРЖАТЕЛЕЙ
889,540,768 *5C8DA0CC001EE10D859427CF601711AEF4436C0A ТУРДУБАЕВА
889,540,769 *5C869ED08FCD2E707848379DD58D196548DA30AF шасцідневец
889,540,770 *5C89E6AC2F03DB523731BFD9D843191E6A618D13 [email protected]
889,540,771 *5C86C84605F791A00B3F5D74BCA1E1EBB3C26FF1 [email protected]
889,540,772 *5C8647127D4492FDB50BF7229E5944A4EDB58080 フランスの伝統色(321色、F
889,540,773 *5C88075FAB2D54B5034E6C97F450585939D3C770 在1974年,阿爾曼德·德·利克萊斯(ARMAND
889,540,774 *5C8AF3112A32BBC946324101B8FAB6534D223477 TYSONOLONA
889,540,775 *5C887C6EBD634A8021AB12D6BC03974FB96EB00E U125526
889,540,776 *5C8730A0AF4C02BBEDDCE7821AEBF958397F9E98 UC-M
889,540,777 *5C86E638F3E30090B9D4B4079522111F27B3C68F UMIHSIN5
889,540,778 *5C857F3A98270226F416F2A7F751948BC91C3D56 um-notsure
889,540,779 *5C852CD248195268E806B401BCF3A57E4F539741 紫彩乃、君島美香子、赤坂ルナ、水谷るい、MAYUKA、一城まりな、木村沙恵、麻布レオナ、小池絵美子、北原清美、花井ももか、
889,540,780 *5C82A591B802521A4F4BA45BCF033513B75AE60F 赤外線受発光部付きdsカード
889,540,781 *5C8EDDE182003A38DCF7662AACF9B958B7F8EBA0 UTV1234
889,540,782 *5C8BF42EF5F208E1A78B6281B1E286B77E43CD06 V4ND3POL
889,540,783 *5C855A0DA03D0762ADF4B26A52B64C798C0AD070 vacuolaria
889,540,784 *5C8EDDC1BD6F20DC84D105786F031CD2C0809FA4 0deutsch2
889,540,785 *5C8032FF25E02B582F803DEE0525577012CCC391 0thatmeow1
889,540,786 *5C847799C141FB32AF835410FBAB1265C26A6DB6 1044066 kouluhammashuolto.hammastapaturman.tai.kiireellist
889,540,787 *5C8EA5A300792CEF719D7B344D34B2FD64B503B0 1046845 healsowasdroppedfromthehospitalboard
889,540,788 *5C8F6B1CF0C77BB4ECCF3F78AB7B5893C1DE6735 112032 TAKAUSPROVISIO-PERIT
889,540,789 *5C8F3E34FA200948A6C2CE480F2268EFA916D1E1 1141304 DIEFEUERWEHRHATTE150HELFERIMEINSATZ
889,540,790 *5C8D38EE6AE3B03A4EAEF7423E1289E32D246A39 1234809 sie konnten lediglich leicht auf 33 punkte zulegen
889,540,791 *5C8642028F35D47307FBB411E747EA15875B2694 VEGETABLEINK
889,540,792 *5C89518B54AF8ADF73A92A875A46C017B5277963 verhonderdvoudigt
889,540,793 *5C82EB6D5DA5B62E4D54358887373915713F5935 187-ROBERTO
889,540,794 *5C86CF31C19864AB6B2AE78FD72C0195D7DD1F2B 18humanistin
889,540,795 *5C8DCFFD8505C9734E9D24A80569CD34324E81FC 19791016:.LIVING.IN.THE.HELL:.TOWSON,.MD,.USA
889,540,796 *5C802ED424CAA3FCEC68B2D5E941B44A1EED9EA1 19february1121
889,540,797 *5C8759BB3DF18C4B0DC7EB7112CA0E9A3FB7D063 VILMA-MONDEZ
889,540,798 *5C8FDB83EF8E9AB503E4DAE73DD8F69FF193ED5A 1ANMOLENS
889,540,799 *5C88A319434F8EC670B41C690F175094A1C8FC4A 1-assyriska
889,540,800 *5C8FC62CBC04A984FBD7D0206D9164BF090629AE 1-ausscheidungsturnieres
889,540,801 *5C874CAFD14111AFE692F68EC485E0B987330E89 vinodchaco
889,540,802 *5C804447522CA471625D0FC443D87C4FB94A77F6 VIRGILIO.KIEWIET
889,540,803 *5C868DAF0CFCA998B9AFAC5ACEDC438150683464 1 BRAISON
889,540,804 *5C83B0EE3408F0F89FA913315D9D77022384A712 [email protected]
889,540,805 *5C8FABFFEC5D420F1C357F41AACCAB61FF9F8D99 VON.BAZEMORE
889,540,806 *5C8BC37478B127D8560201F74FB4D38BCC410406 1-geheimgefaengnisses
889,540,807 *5C867812C75686B68AA8D2BF8D7E75C9647EDB64 1hansa-spiel
889,540,808 *5C87D0D49AAEAC9DA23B8B16FBAF59375133E19D 1KEHDOT
889,540,809 *5C867C8FE1A244C8ACA8C78EB778344D636C1174 1-LANDTAGSAUSSCHUESSEN
889,540,810 *5C894799C61EFEFB765CA702720E76D55464240E 1-LINNOITETULTA
889,540,811 *5C82F87CB0152A2A292B9E81C11143641FE2326D walleyejohnny
889,540,812 *5C8CBA9ADFE1991B767DFB00664DA0F2B2BBE243 1.MARXINKAAN
889,540,813 *5C8B46481F3BBCDE4BCCEA01081276E923875647 1munkinpuiston
889,540,814 *5C839B3FFB08A22C9EA013DFA126B6BA5E9B3B63 1-MUOTIMAAILMAAN
889,540,815 *5C896277AD3BE27F1162258C26FABC8B77D07998 1N7ERM1NAN7
889,540,816 *5C807D84E393F851250ECC7B094B7B28F302DF72 wardshibuya
889,540,817 *5C805A1FAD0E2B9EC73E46D8DBA95EDE5E007D02 warnerlabadie
889,540,818 *5C8F6FACBE424EB4CCCCB26EFB3D295FD3746397 1.PLASTIK-UHREN
889,540,819 *5C873F2227473ACAC2FDFD44223B91C192DEAE63 wasted album version (feat. oj da juiceman)
889,540,820 *5C8870E5D5B3AEFA5A092BC1447DA55B53FC43EB 1.RAVIENHEVONEN
889,540,821 *5C8A20ED3AE3455765FE4DEF146BB33DD65D718F 1.RICHARD-WAGNER-KONZERTE
889,540,822 *5C87E4E50A242F909279F1068ECAE9A3CAAAEDED 1SANN
889,540,823 *5C8D399C8ACF9C1C2F6616FE7AF63B757E7E2385 1.YALANLIYORDU
889,540,824 *5C81D4E95B6485C93B1F7081FEC950061E9F42F7 whaleofatime
889,540,825 *5C8854FA75F026DF79783B68C0637ECA8FD1FB69 20MODESTLY
889,540,826 *5C8D2892730158CFA7D616E8F3388DF9C087FC22 2220509 SOITTOPUOLI-TOIMII-JA-
889,540,827 *5C83990FBFEFEF7C729A4C6C6802A932D4E28320 wichtel-in-der-nacht-(drinkalong-version)
889,540,828 *5C8F4419E2AC23A153F549BADAF47EBB29B7C6E6 2314028 sektor.on.muodoltaan.ja.toiminnaltaan.uusi.ja.entist
889,540,829 *5C8F46B218CC1DF67039D6C5167B1C5D6174775C WILBUR.AWE
889,540,830 *5C80223ABA678EE6D47624083C0AF07CB158EEAC WILBURNODONAHUE
889,540,831 *5C8B6F0E3124D2FF6DFD7458099745379C17067B 2363023 informaatiotutkimus-antaa-laaja-alaiset-valmiudet-ty
889,540,832 *5C85A8AD63EA108D6A6539F3634AF208EF0C25BE WILFORDCARBACK
889,540,833 *5C89DB6A8F1EF64C81E112F456DE0D1A0709A022 2427361 SAMALLA-KUITENKIN-ON-YRITYSTOIMINNAN-ETUJEN-MUKAISTA-YLL
889,540,834 *5C8C46FE1451011070D69534DF62F951EB656268 24.deutschisraelischen
889,540,835 *5C80E35A4578CEF1139BA89F34CC9150682261FC 2528984 schliesslichwarerjamaljusochef
889,540,836 *5C84E5AE274D8DEEF2F248247F87ADDC492B5D7B WINFORDKERNEN
889,540,837 *5C848DAADCE7255C4A78CB796F0E5783E6D32A05 28081772
889,540,838 *5C8D7E77D90E852A93F664DDE5568A3BB41A95FF 29jul1757
889,540,839 *5C875C04562240F07C5E4F7411B6D97559ECB725 WOMBAT34
889,540,840 *5C8C7308F901D17D865D3527BF3C7B2210EEA573 WOODROWCUOZZO
889,540,841 *5C81FF230AC9200EE644BF1AC58F2894662CCE42 woundlike
889,540,842 *5C80359F732B11C26D406783F076D8CFC7DEF124 wowgurl1
889,540,843 *5C8DDD31D8B7200EEB44F7FE2CD66D1034D1CB87 [email protected]
889,540,844 *5C84121578836F13320C4BDBAF2BBFCB0797A29F [email protected]
889,540,845 *5C82533EB93005ADDE5538C8B1FFBD7A979EA9B8 2outsteal
889,540,846 *5C825FEB50CC9D299647F46282CBC4D72950B4EC 2PRIMASTE
889,540,847 *5C8B38730A9BC41B0BFBAB1ED89E6B91998382CD WWW.NPL.ILLINOIS.EDU
889,540,848 *5C846FB5B74BD8842334ECAD70842CB1ABD89A19 WWW.STREAKERAMA.COM
889,540,849 *5C88D421564DD1E226ADDD690EFBB4AD5DEE2ED7 2SCTTRMNT
889,540,850 *5C807E6626686546EBA38B7548184651241E9D07 [email protected]
889,540,851 *5C85B85EAE008F6D033D25AA15EE0935BA3201FE 2THATCHAMPION5
889,540,852 *5C850117BF725CEDC6A930D7C104069AABADE149 2thatwilly6
889,540,853 *5C8250CC92F031B4EA01F67DBDA16393F9591A2C 2TOONZETTE
889,540,854 *5C8609178CD4674CFF058411463D98DC0FC52AC1 xavier.xabias
889,540,855 *5C839F1A757ECE18125227C96055F1D8F2B56AAF (X)*.*.*.(B
889,540,856 *5C848971BDA732E3F48075447A60CAF53DCCC41B 38FDEFB7AAD229A235157CB9FDC38A1C
889,540,857 *5C879FA610B72783EDAA12E80584AA70B030A792 (x)-o~-O~<---p
889,540,858 *5C88BAEB93B393137B5A74C797EAD13F560ABB80 3b<o~o~.<######3
889,540,859 *5C8CD8CCA89FD681D52BC3F271270CA3B7B5B03C 3===D`~`~(0-0)
889,540,860 *5C8302F9D758EE3023AD9F29BA7E0A3066DC0A02 3D3HARBOURGREEN
889,540,861 *5C8D5B6E06F1118F3D0F490BA55CB38E2112DE31 3GOONGOON
889,540,862 *5C85102B46E86146A66F64BB7F35E4F6DBE84284 Y171377
889,540,863 *5C88F6744882C483FE3ABED4B2387B98890430E2 yadlapati4
889,540,864 *5C86BF32C53E0C40441F94DF471DBA08635F3DDB YASMINKASIM
889,540,865 *5C83441AB9CAFB1349A68EE9F5A1B45952934BEE YAYASOK
889,540,866 *5C896D635CCF9BE08B4A4A45928736C79918FAAF 3-sivinin
889,540,867 *5C8CACA724B16F6D22389912C8960F54016122B2 [email protected]*-SPLAT!!
889,540,868 *5C82F48793DA1EDD73F355A6A769A346866BABBE 3subjack
889,540,869 *5C808DB4817D7C268886FC96F9C48921A66F47C5 YESAUSTRALIAN1
889,540,870 *5C8D1BBC65931BCA709ACEB85A2C2EA9A7D685E1 4A9A183E37DD362DBB8200DDAEAC09C3-HOUSTON77
889,540,871 *5C867D9642BE8A6DF75BE8FC5959ECCB0B216A0C 4ATAMAANO
889,540,872 *5C8D0AB9DAA8620BA99C487CD23192DB8B9A7E90 YOLLY-EGGERS
889,540,873 *5C8A5536BF5E6959A77AB2DA515981B82EB3B378 youring4
889,540,874 *5C8C202F77470C93549B09A0BE0D645A6327BF04 [email protected]
889,540,875 *5C86A5EBBA70DC7CDD27EC21796A6FD7474AE127 YPOVLHTIKOS
889,540,876 *5C841D7C96C8E5FE6DC43E6507EE761696824DF3 4ITTOVAG
889,540,877 *5C855C6928855ECF53166AF4A4C5D9EACD59CCEB 4kerkkauw
889,540,878 *5C8B46BC7276F5EDDB36AE6AB62EA22A382BA5AC 4NIPATITAAM
889,540,879 *5C813D0855248454DB9EFF2F4DC2E02453945B48 [email protected]
889,540,880 *5C8405693397569841D4EC4E8FF46E86F28C85B1 4PSIHOSOMATSKA
889,540,881 *5C894E5E9AE65E9475D07BF5AB76A5C821BA20F6 ZACHARIAHPALADINO
889,540,882 *5C8856667C12A415A37F396FA8F8F89FB3CA3E0E zacharylyseski
889,540,883 *5C85CDEE89D0A8E76CF55BC3D0733179C4CCDCA4 ZACHARYPUMPKINING
889,540,884 *5C8376ECD01E99D35816900801F77798E9FEAFF7 ZACKMAN
889,540,885 *5C86006DEA842D0976F05809E31F4AD19173401F ZEBECKS?
889,540,886 *5C869C98A83F0D39B202610FB8418B07B00BD586 4YMPAERISTOEKEMIKAALI
889,540,887 *5C8985DA5F97F60D87C3A14301450FA2B46AFF60 zekevought
889,540,888 *5C8702F754C24165DC305D3478C151F7FBE2E850 [email protected]
889,540,889 *5C8DE7DCB3D873CB9BFD13524B4CD5F1CCF32CA3 [email protected]
889,540,890 *5C8A33E2A790C4A90E09CE5A1A2CE9DC1E942096 53TONGASS
889,540,891 *5C88A278F826AB5B817023F9715AABD25C668330 5ANNASPERANNO
889,540,892 *5C87CEFD6407654F37150918D2210937E7F0C8DA 5.b
889,540,893 *5C8DDA575ABD597D37CA4ACE37B06CB68D334137 [email protected]
889,540,894 *5C891FFD8335591F95B37B463D073743676BE4DB 5BSWMTIOCGETBSW
889,540,895 *5C80EEFB7FE2AD7FB7ABA652F8487DA3CD7B5C27 [email protected]
889,540,896 *5C8760944D0F8E95357AB35B8C8D4624C157A7D1 [email protected]
889,540,897 *5C859FEAAD2B119FAF8007667A4857DB8B5968C0 5CHAMDOS
889,540,898 *5C8500A76204D6C68EF44E748AFCFEE80D3CE1CD [email protected]
889,540,899 *5C8F99D8104D306EE3F81AAB750937B25F3222C8 5DETROITPIERRE
889,540,900 *5C82FEC2A14B00A43E68B34AB34BD45BFBCAEB38 ziran-nj
889,540,901 *5C8EDB954370A13226E77AA15E64B7DD352048A8 5FIFFING
889,540,902 *5C8F4D2D659F048F200A6F92418075848D9043CF 5ILOVELASERJET0
889,540,903 *5C8F8AC0D2BBC0554B0BEAC87CC76D0E4AE13E01 5o2nsdz4d5hglqsl6cxibq
889,540,904 *5C80CB108417E9B4DD949331C4C449261A2AFB30 БОГОЧЕЛОВЕЧЕСКОЙ
889,540,905 *5C83263F95FACA0C7F6538909A72BF02CDE16AD5 ГУЛЬФОСС—
889,540,906 *5C8A26150D7F2946A1028222459CA39F477D0742 5SPEDIERENDER
889,540,907 *5C84102EAA5A1A10F6A1A1FC26F186AF4C2DB5D8 ЕМПОРІОН
889,540,908 *5C883E933A80A60ECF61E2492C4F503B67950227 ПОУМА
889,540,909 *5C8CFD05B36106F123773A714985DCA5A9D5BAF7 6ANNULLABLEA
889,540,910 *5C85F48D936F2353D7946715358A544D504F3AD1 территориальной
889,540,911 *5C8CA1D30BBF3E77BC7195BDCB4339B796B4FD4E УФИМСКИЯ
889,540,912 *5C850CB7F8BA0E2A6581254FA562587AEF785BC5 ЯСИНОВСКАЯ
889,540,913 *5C87EA6FC5D05AE1D00817DF2DFFCEE5D3AD65D8 6ftsiehe
889,540,914 *5C84232383144264805A6378959C3686E386000F 6-geologisia
889,540,915 *5C8EE1DAF9F6DB1FC44BEA912FF2D65D8273F2C4 6-HERREN-MODE-WOCHE
889,540,916 *5C81CF10511B91A89126483A8F40B9649C8C9139 そらち南農業協同組合(JAそらち南)本所
889,540,917 *5C81924A2B44FDB821E4E92BEA3C7AE8EB13A05F 6REPASSAGERARE
889,540,918 *5C8E4ABADF9B3856C28D21583499DDC7396852B5 6REPETERERQUE
889,540,919 *5C8A284467A22C48C1D24A8796957EB79CE8225B を、男子はYシャツの胸ポケット、女子はベストの左胸部分に
889,540,920 *5C837FC6CCCA77C7A4B351BF42F0CBF28A4AB0C3 7EAGLELEGEND
889,540,921 *5C85EDEB80FE16E0C8B488CE7B4CC44E0B24238F 7IAMMIKAEL2
889,540,922 *5C85DB2027EF1A0CBE9142D38394A22480F92DB6 7MUSTASOA
889,540,923 *5C8CD66AE5D56E85B7B4E768757239C2D0ACC286 7PAWACSB
889,540,924 *5C8C6D6ABDF406D8DE63B6206EC3947011465D48 7PMALEITA
889,540,925 *5C8CBB3FD81F0253D4CCD1BFEE95AD8461B93668 7VANLEWIN
889,540,926 *5C89631C9A0C2BED583D1936E062A0FB943C599E 845030 BEI DEM ANGRIFF STARB AUCH SEIN DREIJAEHRIGER SOHN
889,540,927 *5C8C5E50A052B103E07588B16EB2304E54CC561C 8CATUALLY
889,540,928 *5C87473B8D62F3077F72E76508EC9ADA952029B0 8EGUI1ER
889,540,929 *5C8E3D21192ACAF977DAEC7EB89D3D500F509FD4 8HORELICK
889,540,930 *5C8156F2E7A99350CA1F951DD53C515D779E7025 8IRAPITH
889,540,931 *5C8C7EDD91005F28D96075696F146059645F705E 8OVERPOSITIVELY
889,540,932 *5C8DA2700B615FB5D7D54A7F90760E29B1EF5364 942796 cankirihalkininhizmetleribuyuktur
889,540,933 *5C869FDDB5AAE147B1F758E8418410311AABEBBA 97CODE
889,540,934 *5C806D5F9E12C1A63B0248EDD4EECEB2F446A91A 99-pahasta
889,540,935 *5C8292B68D8B57381B77B37FA4683F4C93DF1809 9CARLOSCANNON
889,540,936 *5C890B49591ECE6F19D5C86C97F169679E31DDC4 9D004AFD-F937-3581-9256-18AE8B2A4AC0
889,540,937 *5C85D8B4C6AC689868ACC4ABA97ADE24A966D68A 9ELLIWSGN
889,540,938 *5C8F63DCFE38A73DEF49029B0CA33BDC95D3CE14 03121596
889,540,939 *5C8610AC97FFBE97F2D18F0C89806C67608030DF 0iluvthe4
889,540,940 *5C88179DE7C8BE1AF132BFBE35151D0CAF6BD2FF 0THATCLIFF
889,540,941 *5C83B66DB54943DE7E492169763A9D13BDCF82D8 1031608 KIRKKONEUVOSTOJOHTAASEURAKUNNANHENGELLIST
889,540,942 *5C8BCA6B562B28AB9B4C0EB4191851BBB79F641A 1142667 KOE-TALVEN-TAIKA-,-KAAMOKSEN-SININEN-H
889,540,943 *5C8476F54ADA0E4FFE51F26BB7A9D67BE420ADA7 12: 12 -# -& IRRITATE
889,540,944 *5C84A71421EA98C4175F7733CB0FCC16C9F29FB5 123BASIA
889,540,945 *5C83044A4D6A301C36C6AF19202503125439D6B6 12-n
889,540,946 *5C8D977CCF0FD9317A835A81DF305FAE0E5A6ACE 1406672 beets.und.weatherby.reden.sich.in.rage..
889,540,947 *5C81081DE83EE532C08F7D86384CFEB200C16E5A 182IR
889,540,948 *5C80C1556FC6661D7BC1A19DF463A57A2F7D38D4 1860401 punklurexokk
889,540,949 *5C850F494B5288C9F59A1361C78CE51110641931 1972622 PUUN.VIENTI.ON.ALKANUT.KIIHTY
889,540,950 *5C859538E76654492F15B2F24DFAE6F9E41BD990 1.ACKERUNKRAEUTER
889,540,951 *5C874FB22093F0348CDDCC91A8829BFBFF965D08 1.ALTOGEHTER
889,540,952 *5C869A731062EE996A8831871FEE01D1BA539942 1-ayazdan
889,540,953 *5C8A0D85491A257BD6D99CA523EE0E1A19A81C90 1canephori
889,540,954 *5C84B081EA89521167C2EB1D27EB74D9F7E6F384 1-KORTTIJ
889,540,955 *5C82AA73051C186A57B49665CAD5C306A18E7A0A 1NVE$719A7OR
889,540,956 *5C86CB1A7847713312E298C20071E522EBAF459F 1-PARTNERSCHAFTSMITGLIED
889,540,957 *5C8A503F3C8BECDDC072362C18F8E62D0E78A62B 1.ritualcomplete
889,540,958 *5C885A7AAC415D926D29F316F1973D4C498900B1 1.SETITYYPPISISS
889,540,959 *5C88FA8B973E447EAD2B6CCC5A6CE4CD2EA725BE 1shurley
889,540,960 *5C8A8CB95EE36A875FDD5D13D985F2C2FAEEAE5D 1.voimalaratkaisujen
889,540,961 *5C83636BC39E7526EDCE53B025F4D72CF5F7350E 20dyer
889,540,962 *5C89B49162A26F998CE8F374B63CE9D56BA03F9C 2129779 SYY EI AINAKAAN OLE FANEISSA .
889,540,963 *5C8F5D13DEEA15B9CDFCF76E80D1305AE8A43E3C 21-kehittyville
889,540,964 *5C85CB7E93B795351C7C747C6FD9066048364E93 2485357 tehty
889,540,965 *5C8D04D049F9D3FD0D791CC9075876B0173820DA 2707134 was.kostet.eine.solche.mediation.?
889,540,966 *5C8D2D3CD8472762AF2BF90F8926D4B9C8C2B587 2784030 SPESIFIST
889,540,967 *5C8EA205C7F2225C3DC8810BD8FB012C4271E145 29-06-1520
889,540,968 *5C84372B08144BD8AEE4D7F4E8E1961AA6A2F26B 2BSCHRFTNG
889,540,969 *5C854AB420B71F056C351F3A948F910E7A6BD854 2 BUNDESGER
889,540,970 *5C82C2B2042BE45988408C3FDAFB1686C08B1C88 2COUNTEREXAMPLE
889,540,971 *5C8324CBE7BEF3B34D7939945CFD57A75DE5F61F 2ENDLINK
889,540,972 *5C835B00A39B916A7D9E3F50958A4BDFE73FE91D 2MAGISTRATI
889,540,973 *5C87BEF7A7AE0E739E63BB098968C355B7ADFCBF 2TLOUTLE
889,540,974 *5C8B133E19FAFAE67A9A19858838158982858983 2TRAFORARE
889,540,975 *5C8418E6A8B018ACC091DC1742934731B5181F8F 3ANERYTH
889,540,976 *5C82870CEB66432277F5437F31ED2A9F256875C3 3b*.3b<
889,540,977 *5C8374B0EEC7E579DFAEFCE8350F1709F7FF6AE5 3KRYSTIS
889,540,978 *5C843FE956F055B5E89824504B1A29B4F3D66716 3######) ~ ` (o_)
889,540,979 *5C823732949A5D5729AF6DA97870D5ABBFB5830A 3thatacropolis6
889,540,980 *5C8E0462D2041356D81BD2289F88FA9932402706 412izaiah
889,540,981 *5C873E67DECD8CE6190294214893076F705E20F0 423jorge
889,540,982 *5C856FC0F6974D11BD2303109319389F1002B52B 4:4-#-&WORKETHIC
889,540,983 *5C874E2498DF78095A513E288274A54F8FD7EC93 462173 ".WHEN.WAS.PEARL.HARBOR.?.".SHE.ASKED..
889,540,984 *5C807201C03E05A911B3C316EA48810FFE88921A 470067 thelessonisplain.
889,540,985 *5C85ED183F81B6C1920A42FE6BC7F40383D67331 472861 IS-deneyimi-2002-koC-holding-a-.-S-.
889,540,986 *5C8DA41C1F31692FE364F193EB1DDA8ABFF62951 4ABDUCTUS
889,540,987 *5C8562FEDD235CC80ACACBC7A705707D88B158A7 4cetyl-br
889,540,988 *5C8E17831FA7F54A2E4689088AE88F7CC399DFFB 4ECAVAZOS
889,540,989 *5C8F075D11D00D504D98023124B3115CE2D41400 4NEGOTIREN
889,540,990 *5C8F7D6A6C0CB196F5187D77D14B43D98A30A659 4-PAHOITTELUNSA
889,540,991 *5C887F1D58F182BA4FFE2603096B4376C1A6F3E4 4POTHODNIKA
889,540,992 *5C8165511DCA8C8611B3FB14E409C00D9D83AB62 4SEP1067
889,540,993 *5C81D0D88E0F943382807DB54C2F6AED6ED81131 4THEANGELS4
889,540,994 *5C867C5DEF00B32FD7EB1041DBCF9FE7807794B7 [email protected]
889,540,995 *5C8ACF18043DE4CC3F976AB7E22F6D4CA791B8CD 519PRESLEY
889,540,996 *5C8921BE85DC1E5C2B2B8A92CEAE1A69E304E91C 526892 BIRANNEBABASEFKATIILE,KARDESSEVGISIYLESARILMAK
889,540,997 *5C8E2E09FAF9F18C457C6F92ED1396BF60285CE1 5.b
889,540,998 *5C885631367ED7D712B50E43588A25879CF048D0 5COLOPHAN
889,540,999 *5C8A2BDB8A5715057CAA0CC5496CA8679332EACA 5IRVELWNWAMZCM
889,541,000 *5C85F31F00C8E1952F76C73E33F04E53EB54278B 5L4GHT3RH0535
889,541,001 *5C8A40442C8F82EF5FA002BB260A86E799C47927 5ONNERAS
889,541,002 *5C8CCACADA2F0AA8CBBD2CC1D323EB80B3C9F045 5SRGENDE
889,541,003 *5C8325155CE13352FDA88F1595D6343A6A1C430B 5STABASQUE
889,541,004 *5C8D965FE3B940096CC2B2CCBCD3A528C1B32BC7 6AVHENDINGANE
889,541,005 *5C8AEAD1BA47459CC479563CF904F142F79F3380 6CASEYSTARGATE
889,541,006 *5C8BFD016D35AC74B9FC8CB86CA44AFAAA2093F0 6DELIVRIEZS
889,541,007 *5C84B074E2CACA32610BC3A597ADA84A84C5BFBF 6DESIGNMARLBORO
889,541,008 *5C8F9ADE40E24CA67FE9F7B5A7C7268C29C2DA7F 6DREAMFRANKLIN
889,541,009 *5C8E386BFED0B035C4375E06E47E9C337B1E9C1D 6ISIOMINI
889,541,010 *5C85DBA36975BA81FC0F6D626FC39DA3451B4333 6NONWASTI
889,541,011 *5C80CA1D0A8E8D97130C99F18271621570EE4CAC 6OMITIUS
889,541,012 *5C8528B741FBF2158B1F05667737CC807202E385 6PATIMENTI
889,541,013 *5C850D7DC3C4948C778C7A7A3EBA45C0A96A2734 6VGTFORDELINGS
889,541,014 *5C83E39D32D7A113DB0859C75104BF261E31FD8C 7AVIATRICING
889,541,015 *5C80E4758BBFD2FB72D8C3B60CD069B9C47D0635 7DAMASSESES
889,541,016 *5C856313A659A3C4C6094F0BFC296A7C883C5ADB 7 DEFCON
889,541,017 *5C8A6DA860B636C750D3C7BDCAD658E0B72A8B56 7ILOVEKENNEDY3
889,541,018 *5C8D4C581F0A946F472E7EDEDFDE373890FA4754 7MORANN
889,541,019 *5C87CFD2758E3EFC6CDD64E152CD989F6A337F59 7udslukt
889,541,020 *5C8B287333365552745485281E14652B37D438C4 }8{.*@##3
889,541,021 *5C8FAA93D4AA0F5A3F38A38C2E97723041F52B02 849516 JOS POTILAALLA ON TIEDETT
889,541,022 *5C8B83BF68494F8F9AB703E25B2D7859CA5C548B )8(*.*.*<8
889,541,023 *5C831F461C9EE1B0A2AB05A5AF1BC3242AB5A50D 8AFFLIGGANO
889,541,024 *5C8E9C88E1B3B7D5341E7A69A7C7CD06C0207DF0 8CHGASIDOCIBSW
889,541,025 *5C82A98B2AA56DE0CB52481EE632B11A14659B57 8ILUVILOVEYOU17
889,541,026 *5C8F02B6109A40B47F91F8A8CC8F82135472828A 8INFINTE
889,541,027 *5C83461AD135F8C360312AD45DFB00A50D2D6C0E 8ITALIABUDDY
889,541,028 *5C86497381F573BF8B8F06A9B83FEF00DB092396 8=)~~)o(
889,541,029 *5C84A5B3572C5CE300553322C52CC53DFB4EF7E8 }8{~ QB
889,541,030 *5C8B22F34021DB857DE5AE6354984725DA424696 8STROOMTR
889,541,031 *5C8B5515F0B947498B6FB91CF0B9395795DBD02A 8VILKAMA
889,541,032 *5C8B26B2F6AB9F7296EAD170D3B7A743504165B6 8voyances
889,541,033 *5C8829ACE394595485EAF10345AF5CFEE8F30537 9BSWDICIPLINARY
889,541,034 *5C8936A34C5D5CF74FEEF9E83E2E391D39C8A740 9flickers
889,541,035 *5C8606BE949635A8DE91F8B7614A87895DF3506B 9JANETESTING
889,541,036 *5C8248D271DB58996E8D4D2642BA4B796746DA09 9JESTITHE
889,541,037 *5C8808355DF26758C61BE831D04367E3861313E3 9MISSIEFE
889,541,038 *5C8DE5922CAE85BBC113078CBC6545D676A45A9C 9onderhoek
889,541,039 *5C8304138B7CEF4EDFAF2C322C9055C9913F3A5F 9VAGINAHEAD
889,541,040 *5C8ADFFF7841E7BD0A92A72CA447FDD3F7D9FADE 9VIALESLINELINEAGELOGOGRAMLOGOTYPELOVE
889,541,041 *5C80BE37545BDD558AB616B549D1C2EAF98FE6F8 9ZSTRMTSCHPPJ
889,541,042 *5C83147A19B04206A87F05EC12B12605EB79971D a:;#;
889,541,043 *5C86CA4AC2EABAB9D916D93C81DE72588D897870 a0c3j
889,541,044 *5C8469778366704AA694D06882833F80B63ACC0D A112123AU
889,541,045 *5C844A7A7D9580A3529AF4EF5E7C32B7768A70EF A4Y
889,541,046 *5C8AE463FE2BB773888C9A7C3929E4A22F9D8842 A6?BI
889,541,047 *5C8A97AA973D988ED66E8582D6B29EFDF95BFD85 AAEUN1
889,541,048 *5C8C712C34D14709A1BA03A75C9A2587CDE7D517 ABBREVIERER3
889,541,049 *5C8FD75603FC87AE2FE27AEF2731F72C08BA76BF ABCDEFGTARA1
889,541,050 *5C8C2263E3865EA72BB6F45957A6F44746B1BE06 abgefangen5
889,541,051 *5C826808A0D4716427E0006C37B0B1DC78737680 a,c"e
889,541,052 *5C87FECAD74765702B0C6CBCAE401F583F09C622 ADAGIO FROM PIANO CONCERTO NO 23 K488
889,541,053 *5C8651BE92C0E851B084C2F6FC744DC5383E7A0D ADALBERTO.FASBENDER
889,541,054 *5C8CA126943B6A450901ECE6CC31A065303439FC ADEL-SHAMS-EL-DIN
889,541,055 *5C83B383C1721FAC8EC67CE8F795F22920827031 ad*p
889,541,056 *5C83D323F78277DBEC952895D890E8714913BE07 [email protected]
889,541,057 *5C81CB1070AEC05B44DA0A9C8D8C238CED0FE22F ainns-of-court
889,541,058 *5C8CE9441D361C783D404D378BAFF27438F504F0 AKAQ
889,541,059 *5C89683457D07C56B6D194A3335D50169CA53C28 ALFREDWEISBERGROBERTS
889,541,060 *5C86A9F953469D2F29C79D320F86C70B46B1BFC5 alphonsomaco
889,541,061 *5C887ACFB1DFE227B671FE960A4D9212B7CC0BC7 alto-horizonte
889,541,062 *5C885117256530E4F5F6246E67A85349780BD34E ALVIN.PALLANT
889,541,063 *5C89DE2ABD6751F602BE4542D386E10726438908 AMBULAIT
889,541,064 *5C8FEC4452E309A13B9518A38014B206CF89B6FA anarvos4
889,541,065 *5C838A6392A5FE84D8B50962498EC7665642BA97 ANENERGH4
889,541,066 *5C8D309577AC1E72FA8AC9CCE5B49DBF9222F464 anogra2
889,541,067 *5C88BC1223AC4A847CFF976ABCBA5B8D7EBAC8C8 antirational
889,541,068 *5C8D46585B3AE6DE92058D2FFD10E0B1193C1F72 apudessiv
889,541,069 *5C8797782C351D33CCB54D991939DCBA09BAB1D1 ARRONMALMQUIST
889,541,070 *5C86C0907C58EAD7D744C8BA048B8001BFE95C3D artiges8
889,541,071 *5C8F3990615DBED4D7823DD5998DA690A32BF1E5 ASEISTAKIELTAEYTYJIE
889,541,072 *5C8944003919578000AA69971499C708B0F528E1 assurge3
889,541,073 *5C808BEB9DEC15308E597E146EAEBE9E3FEFF5BF ATUCM
889,541,074 *5C89B02E9C971629A0BAC14EE13C47F8B5075F38 au-iz
889,541,075 *5C875B415383066EAD777117529D0A38BD6DFE8D auphs
889,541,076 *5C8B28912C58E6F8F09E3EF2BC400F9DB2EA330A AVESP71A
889,541,077 *5C8EB8458F651096D552659AA067C5DB053E8B46 barrymangaoang
889,541,078 *5C8F28DBFFE92E9B2EE7E1CB0B34DFAB33AC3305 BARTON.ULLUM
889,541,079 *5C8454CA093FAE7098126F72CCB7180BD9480228 battlestargalactica
889,541,080 *5C88E54F02071538E9CD871F2504B39CEFF17076 bbcbio
889,541,081 *5C8B42C218E82E1118859D7427AF4076DFA254DB bc8d#
889,541,082 *5C84967BE821594279F90DA4F734D8226D1132C3 BEGÅENDET
889,541,083 *5C87994DFC2E787E273986478DFCF0F87A5F0A74 [email protected]
889,541,084 *5C8C1E93549025241BF7CC14F5227A136B828AE4 BEING.SO.STUPID.BECUZ.OF.CHEER
889,541,085 *5C86AF4F49F1CB559121711E793251E558E7ABF9 belichtungsprozesses
889,541,086 *5C87E53209130A77FF39B561EB472D5FF75AB3C6 BERNARD.PRIDGEN
889,541,087 *5C84846C73E1021D9F7444E9CF8BC9F9C0F202C6 BF3DD
889,541,088 *5C831B91B451829ADCB772E2FE1235215BCB8094 bi;3
889,541,089 *5C87C39978DB0473DFC4D81D84215F41A0729960 Bl%a
889,541,090 *5C8D531589AB4366CAD0D1A85B37C6C2BF8ED905 [email protected]
889,541,091 *5C8A0F31904A3CCA5B75793373250CA95750749B b=ley
889,541,092 *5C80F8B3E6A4455224DE224AB1E8C80AAA3B98C1 [email protected]
889,541,093 *5C8BB9766F9F1003769A8054E1FF4EAE3524E97D bmkyntiwb
889,541,094 *5C8A43D3043C92FFF32CD847305F38C17D15B152 BONNIEXXX8
889,541,095 *5C8FB49BCDFBB43989D79C290CCEB2CFF256B331 bouchais
889,541,096 *5C8CE99B68454C152C699A3684BA0CCF48F2ACA3 b##p ~o~o >b0
889,541,097 *5C8A018FFE5477078C3E49CDF7AB40B961C1426A BP)RR
889,541,098 *5C8D1A6099EC8627A2DB092B46E6F44A6924C628 BRITTNEYSTUART
889,541,099 *5C8B38AA2DB4BECD7F5E88C17AB7914F8CFAA70F <br>print "&lt;td&gtfirst name&lt;/td&gt";
889,541,100 *5C8C0DE31352045A74EA9F1950EC5CC08F91C734 brycebertolino
889,541,101 *5C835607804394C6876C9AF0655B9C88D05AEA81 Bsh/
889,541,102 *5C8D21C4D945290DD6CFA3BD9F282603CF9E590E budfasick
889,541,103 *5C8D197CFF2641234A5EFE20235037C550E92B25 bugelds
889,541,104 *5C844F6D084A4C364FCF24338F6ADB698E102D02 b&,wf
889,541,105 *5C8F984855DDC618B2649E3829D480328DD7C8F2 BXIGC
889,541,106 *5C8DD02CE2E8D70DCCCF18FE2155EAED8DF2A397 BY.UL
889,541,107 *5C80A7036FE6F3F1D838746A146A7FF9E276885B CA=_C
889,541,108 *5C82FF7FDF26BFBB7D928E8948D32A66C77342B7 [email protected]
889,541,109 *5C85508BC89E25A536732412FCC4E94156A557FB [email protected]
889,541,110 *5C86FA97C1B1A8321D561E167839DBA6F07C157F CAP 8 EJ 10 11
889,541,111 *5C84629C25D37F10C8CB9D71D6452941D843344C CARLOS.\"CAFE\".MART
889,541,112 *5C882A1CDE15D618AFFEF0F9E8737C08709EA5D4 carmen:actiii,scenei"maisjenemetrompepas"(mica
889,541,113 *5C859A6C0A466F4E8BC3F445C2553D9713E0F032 carol-redd
889,541,114 *5C8359154C6A242D5B032BE37B9FF685ED4A5055 carsen707
889,541,115 *5C87DEB6A0040E03352D02FAAE32D5AF3A3D50AA C&CWV
889,541,116 *5C8B7F86880A72C1530EFB0DB05BA70D9EBB6E5C c/;ew
889,541,117 *5C825EEA4571D6D0E793A39A198C06A91A3594F6 c=+,f
889,541,118 *5C8CC0AC3A95D45EE9F80ADFAF3C539D8595EA3D c=%gs
889,541,119 *5C82C2530E0CA41DE7B7FC626F48435A69C9F8BB charlou
889,541,120 *5C821F2B3548834FA29D130EB7146802D345C7DF CHESHHTAH
889,541,121 *5C817E60A44F6B16F137FE368990229FA853FCC9 ch-rd
889,541,122 *5C84CBAF2D38FDCE198D6F1074CDF41A306C49C6 [email protected]
889,541,123 *5C8018A14BEBC7DD2EA20441A54EACF78F04E3FF cktgk
889,541,124 *5C8DBF69BCF1F21A558C2A30A0D7E9E97FE39453 CLARKDOLECKI
889,541,125 *5C84B4E666511D359ECC6CC2CBEB67056CA8109D CLEAREDSING
889,541,126 *5C84A97EE3B45C800BD7C43A264D98462E9F47E0 clementcoore
889,541,127 *5C8D80438F42ABFC1AE72B9CE63F8B7C90B7F8FE clementekleiber
889,541,128 *5C850291F0CDE973133888DF9F2668B9088D5493 [email protected]
889,541,129 *5C8732809B890B1A33B38A51D840D9AA3D471AC8 c&lih
889,541,130 *5C861480C34D9BDFDD0AD6EE6738CF81B6DCD690 CLINTONLACEK
889,541,131 *5C8EE8D54AAFC0B6CF76FC543E264C3D67E89E64 [email protected]
889,541,132 *5C8354D36C92190FEF0F55676BF372A368B4E04D clp-k
889,541,133 *5C85E13FEED57AF6D80C845E5EA92372AC7204DC CNTWM
889,541,134 *5C8F820C36D8BF900B2238D4B2AB13AEEB536115 c;ofn
889,541,135 *5C83E6F813928547A2F5372EFED852F9C5FA665C COLEMAN.DILICK
889,541,136 *5C89861AFA66EB81884E5D60BE75C44B4E13EF7A COLLEGHERO8
889,541,137 *5C86BA354DFD2E7D8858BB47DCFB0680D98814C3 colusión
889,541,138 *5C8D13D221C74D874AAF5AB1B798950C60F4217D COMPLIC4+EDNE55
889,541,139 *5C8209249F74276AA3B970EE6CE66B868DFE2705 CONNECTSAILOR
889,541,140 *5C83B53893E000A60E64D0CB16F0E83CBA173378 cq&ks
889,541,141 *5C8E821904BE84B8070DB1BC727F9FA0A8E84FE8 CRAIGSCHMOLDT
889,541,142 *5C8D2508E94DD2E8CCBB85C98E3512282EFE5138 $CREW-ANC
889,541,143 *5C8EAB4E2CA4F1B05EFE6639BB260886E83EA944 CRTQY
889,541,144 *5C885CF9557661BEBD7F62D69B73F75BC12C6F39 cumkq
889,541,145 *5C85A63B03B01880281C237FA17EF2296CF06918 cytt
889,541,146 *5C8705E605D2C908A5682AD6B2F8F0E0BC43965F D2TWM
889,541,147 *5C866CB7D315510244A1E3408D9295E9153F6C24 D4KD-
889,541,148 *5C81C29BC31AD651F5CDFCB7CC9C704A06811D2F DANIELKOTLYAR
889,541,149 *5C86B0B7430B3BDA6CE51391EB01C0F2D57C3DEB DARELL.DRZEWIECKI
889,541,150 *5C8034910A7E9FFFE3F60BF5D0C053B0B969A2BD DARONYURICK
889,541,151 *5C8574C68856B3573B68A5FF7DF7ADF990274E6A darrelcyphers
889,541,152 *5C84909FC7CEC33BDF8C853360D15885AF6C48B2 darrelldillenbeck
889,541,153 *5C89F51DF40735FA9D4FC30035D5EAB079B7C302 DARRELLE-REVIS
889,541,154 *5C815FC6BA5C84DD9DAA5F16BFA716F24D2F0FF8 db:t!
889,541,155 *5C89583F658606EDD1DC2E7D1AE4E757B22763C2 DEDIS-KN
889,541,156 *5C83738E00FFE6895E3E02D21833D71849677843 dejaunisse5
889,541,157 *5C88421EE1D053DE4799342306AC6AEAA19A3545 DEMETRIUSHAZLE
889,541,158 *5C84C6358372CE88BE0290D3264141AB2BD3C81D dep4rtn9
889,541,159 *5C879647C2B3C60FC203B8382E4B5E2AD59FA153 D)?F
889,541,160 *5C830782793F77D129289E62D79803251EC5AB6D DIANE-PLOURDE
889,541,161 *5C847F08F258B874290B46383994CE8268E90190 difficultlisteninghour
889,541,162 *5C8A3CDDE74291CE97667E17558AB15E161CB39E DKFZP686L0365
889,541,163 *5C8845988CDBBCCB99EB370FFF5CDC977493FFA0 dko"5
889,541,164 *5C822843FF48125DE9F233AF4F5C62795FC421B3 DKO?C
889,541,165 *5C829D6D5B7174375D4011E0E59FC9DF1C440CE1 DMAHESWARA
889,541,166 *5C8993EAB46C2339A2B66FE886A60785EFA61222 dmuty
889,541,167 *5C8FDD74D4CF2DD9C75B56A5711E91F5F9B0654C donald-hawks
889,541,168 *5C809D0B84CB2B6D15CE57A46F271961124756DD DONESISCH
889,541,169 *5C876744353F0180E56A9BA904AEB7CA536F85B2 donnierukavina
889,541,170 *5C8FFC468285F27ABF45C6522553C3D384098C2D doobie62
889,541,171 *5C81B3262FA03946D68C6D21ADF46AD740E45835 DOUGLASSAUYER
889,541,172 *5C843C28B939477A683CA821B3E1353C6F72AF31 doug.leduc
889,541,173 *5C826A214590118EEC75F0DF1FBED9C401F825B1 DOYLE):
889,541,174 *5C873DB273BB87B0D10364E7D46589A1BA637094 DPA9A
889,541,175 *5C886241971FBB6FF8BBB1E4C51BFEBBD77DDCA8 [email protected]
889,541,176 *5C81B755EE7822183BA62B68A7D176D756FA0E70 DUCNZ
889,541,177 *5C83903C8444115CBDBF8143AE9BF7924EA93EDE ea/mo
889,541,178 *5C8495329E22EAD02A3D00CDD1F1AA3FDB1CAB5B EDUARDOGUNTHER
889,541,179 *5C804BE0DF87DC333006555E49FEFB1E98FF7C0B ee59$
889,541,180 *5C8AC135358807E1B9985CCACC2442F48469366B eef5ee
889,541,181 *5C8A27FEBDA725525BB34F56AFFFEA4FCA89219B EIIV,
889,541,182 *5C82F19E768DE2368AD381A9C240F1348FC1C20C EISTNKIN5
889,541,183 *5C828E8E69789D4260C0C123FCCE5956B85DA8A1 EK7EW
889,541,184 *5C8E8D3395DF5BB2894F8330F4768956B2B0DC88 ELBALOPR3
889,541,185 *5C86C0753866BA44F803070FA3F13A0A956C7CDF ELBLUESDELALIBERTAD
889,541,186 *5C85F90A2B2BA189814F645BE2B95AE8A92E9462 elijah94
889,541,187 *5C8740CA61E03A84A499D9408AA6D1A8FA95FCF4 ELMER.BILIS
889,541,188 *5C8B1399E345ADC727F4E6E6541E5E926D84BF2C eloysiewers
889,541,189 *5C8FBDB5B1FB80C3A5250BA9F5B17F49F846FEF0 elroybrazzle
889,541,190 *5C8EC5E8A1FD88CF86E36EAAAE7F6B94F73FD07A ELW.R
889,541,191 *5C89969703D3F0BE99819AC0620BB9F14302A0F5 EMERYDORIA
889,541,192 *5C86E183052732BE2CBD2BF495083CFDDFB94FCF EMO7$
889,541,193 *5C8357DC5490C92C55489B42107BC2B5FFC53D59 EMP
889,541,194 *5C8DD0BFCE62A5AEDD839C5EFA5FDF3FFBCBC676 EOM+
889,541,195 *5C8BA31E110C5E31DAA963DBD16493BDC46BD8E3 E"OP
889,541,196 *5C86946C50A5B653799F57D179C4FE49BAFB2CBF ERIC.WILMER
889,541,197 *5C8E065CE5F1DE9FF060A77FED35204FD16C61FB ERIKALLWARDT
889,541,198 *5C81040B6F0B530D98E6F09219EFB36CCFC2E6CD erikcarlssonsonett
889,541,199 *5C8CF238C7EACC20AFDAD4A5689834D45C09FFE0 esportonaed
889,541,200 *5C8A181FA5B6A8D7D39D0A3F337070236FDE3564 esther.tome
889,541,201 *5C8B7E5A046FEA906422D8A964F1A5B809046B33 ESUHC
889,541,202 *5C81CB4F7F75FB2593ED22159271B16F58E6FF7F ETIAFSITED
889,541,203 *5C817FA489FF6C3352F5CC34FF799FAA96855F15 eubnh
889,541,204 *5C8A006DDC1DC67552B6571D6DBEF6D7D7864C15 EYA-
889,541,205 *5C85C690A7DE27B05870A0E7378FEDC143097025 EYMV
889,541,206 *5C8E5F0B5E57D67F96423AD3517CCE5C968AD836 favoreciente
889,541,207 *5C88AD34A2284AE161A6B7DEB0C633C370A1EE49 FFORONDA
889,541,208 *5C87D657229B744C8BEDE5AB8F8ED0180534EF44 fishstic9
889,541,209 *5C8AEA2851A631BFB8C14B8BB6E622426D0D482E FLORENCIOHOPKINSON
889,541,210 *5C8CFD4E4A57CFF4320B49E2D8A8EC8FB24BC06D FLORENTINOFAHRENDORFF
889,541,211 *5C84A999877AFD86C25D59DB96635F64744672C0 FLUNKEYISM!
889,541,212 *5C8DD27463A573D4E22C42015D29C3F752DBF854 francescozoelle
889,541,213 *5C8EC5C8BA97944ABC671BEF8B73D87BA5A34456 frankehlers
889,541,214 *5C8F85BAA8BCDE6D28C0F639958D37A4BD216D8C GAIL.PARRICK
889,541,215 *5C88E148CF7A7AFB9B35B272E5B112DB09CC3298 GAILTRICOMI
889,541,216 *5C834C092442034B0B9C23D0A80F81B30C705452 GALLAECIACONVENTUS
889,541,217 *5C85D40CD63A12A07E8FAF5A80892D874CCB470A gamhong
889,541,218 *5C801B194071CA23739527D582907780442C4D7E gefractioneerde5
889,541,219 *5C86DA2D7BFCEB9E1ACF67B00BC75076D59AAFD0 gerberae6
889,541,220 *5C85059EE9D93C5243FC49B4AC0D33060A03BFBB GIBRALTA GIBRALTA
889,541,221 *5C86A845AE5EE1502E4F6CDECBF5DC43E2284A82 GOATSOCCER1
889,541,222 *5C801E3B8C3A7A6DF7A06B238FF378A8DCBF4E34 .GOEHRINGER
889,541,223 *5C891B193EC2F49B0DDA22DD48C4568C5547E3C2 GORDONMONSRUD
889,541,224 *5C87D46D343D8A5C14FC764FE817C4BEE48D5F42 grausening
889,541,225 *5C8FBD430A472102603C6913A5DD19F17180A9BB GREEN LANTER
889,541,226 *5C858822A932E1A4DB6C9AE29C2D5724787F91EB griffonage
889,541,227 *5C838EC118F7412AC51A9BFFA6AD240E3E4F8053 GT(]
889,541,228 *5C880EAB3E164807519354AB0AECEFDD6AAE6CCD [email protected]
889,541,229 *5C89C59B5CF6E25EBA087894BB033660A0037E95 guatemalachickenbuses
889,541,230 *5C8747D7B1B1AC13E878588162AAF1A5C6536009 [email protected]
889,541,231 *5C842A7D96907D01086992A2CCDC02F55544534A GUSTIERS7
889,541,232 *5C867335F371626BCEC885D9BFC4022A854720AE GVW#
889,541,233 *5C8DF0BB92585A52B0668C411EB15BEEC1EA6862 [email protected]
889,541,234 *5C846A9D6B39754699E6E8A6B4CC35D1E551F78D hard.grind
889,541,235 *5C88DE47028757D9554FC323AB718C58E19E93CD HARVEY.MADERIOS
889,541,236 *5C863BC99780C23CFF9FB581607389DF8459C402 HASSAN.VISEL
889,541,237 *5C8F172FDB844432031D1A8BE60D9B29343BA7A9 haydenbasket
889,541,238 *5C83C3A00420C46D2FE33709510D75ECE5EEF4F3 HDILO
889,541,239 *5C8850805307A0D812BCF8A21FA48C1F41F77093 HEATH.FAUSCETT
889,541,240 *5C8F56793D192534E7B97B4CC96FAB5783CAB255 hidegalakítás
889,541,241 *5C89F3CA7B596C140A71ADC7759AE0919A46A8B7 hiramcataldi
889,541,242 *5C8D8073F9BD277AA959B4E871D51215828F246E HMGEGßN
889,541,243 *5C81AE37B7952C289EA58F70A0F077FED1A65446 HMISTVILLAGE
889,541,244 *5C82F919070F3E1723FC34281C32484EF47899C5 HOBBYLABEL
889,541,245 *5C89BA08A92E6BB814AFF1B9E511A6042E1CCAB9 hoitoihins
889,541,246 *5C827B2DF02F3FD6B59EBD87746F76C9D07C3578 HONKLOPE2
889,541,247 *5C89D5937C04B5252462704069259FD42351DFB5 HTAYZA
889,541,248 *5C805C62C1C77DAB12AD6E2C6EE90BD73ECFB912 HTTPWWW.PIERSYSTEM.C
889,541,249 *5C85626D442EF99B14C539A0954738B52898F224 HTTPWWW.TERIJOKI.SPB
889,541,250 *5C85B834EBB48695B1AA467A511E77F20BBCE9EC Human.After.All.(Alter.Ego.remix)
889,541,251 *5C8A4FF48FB9FF772EF179D9ED7DB4A428F77B99 hum ke thehre ajnabi
889,541,252 *5C8CFB235E121D48CBEDE5755FDE29554F709F5D hZK
889,541,253 *5C8BF67F9E258339D366F15E2D353A2879815D52 III.52.3
889,541,254 *5C8B8FE582BAEB403B8BD85452B48BC989D68AD9 ikizias6
889,541,255 *5C8B95F033070FB6F4FFD52C633C1FED108B30A9 I'M DANGEROUS (FEAT DRU DOWN)
889,541,256 *5C8B7B7F5269D2384F40D793FFF61B2532C790B7 [email protected]
889,541,257 *5C80685A7DDB3D3BAB5F689E24CA8019CAF27027 IMPERSONA+E
889,541,258 *5C87EA3E6DB1DBFD8CBEFBD57E7A58AF2A8B9585 IMRANHONEY
889,541,259 *5C89EB4ABB8DD28FC602693726A62D8B4B8ACDE8 incubus succubus ii (album version)
889,541,260 *5C81C39870B0D789146B8C66A389829F366B376F INFRASTUCTURES
889,541,261 *5C8CBEAA09F2E28BD23961DC89DA90AEFBB4336B interagivi
889,541,262 *5C8E377BD3564A97C095E47537035D54665052FF intro-
889,541,263 *5C84B9A78D939F040518BC4DB5BB51EF9625D1AF IRAN-SPACE-AMBITIONS
889,541,264 *5C80B8E2DDA40025DDBC96EF2817E0001D1814CF i.t:
889,541,265 *5C841CE396F038B26C7AC07BBB00589D40DA1A1F ivrcugjdq6sys
889,541,266 *5C84BA296865EA8126D74849A71855F168DBCC65 JAMISON.KATZMAN
889,541,267 *5C85098F4A0A3C16899B4E91269E13EE7C62FC57 JAMISONPAV
889,541,268 *5C87A254CA7C35C76C0AF28D4F77699C7776B5A8 JANYTHE
889,541,269 *5C8A92D6C92FA1A8B4B3B71D5FDB026E30FEE36A JASON.HORACE
889,541,270 *5C8DCCAB8208A24F3A70D1DC2A1D9E6E0B9EC197 [email protected]
889,541,271 *5C861BF7B82B385B7613FC462C7687137AB548C3 jeffnite9
889,541,272 *5C89FA82B3E0E1F3B1A5F6C6E7C125C5211A3B47 jegerikkereddmer
889,541,273 *5C819B06708C3B49597309817E26BACB40FB2FC9 JESSE.SHULTHESS
889,541,274 *5C8BF7221E31B9AD124F96864EBE7F4B53CBA714 jesskong9
889,541,275 *5C8B14044F78756689B4CF17E31B505E605F61E7 JIMKEENE
889,541,276 *5C850650472A534CF0F0A885E1980029798D9FCD JOELGODERT
889,541,277 *5C8641D0DA312186A8ED6CF49EDFC0C3B1CBBB27 JOHN-BERLETT
889,541,278 *5C8C9A4C87AEFF791A1AD9B9D604452466941DED josefmcwain
889,541,279 *5C8D16BDAE9A99EA49D0F7A15A6CF01A933A243E [email protected]
889,541,280 *5C8F35E89464B06B8E9E5CBF1EE048E208103B7E judy-armitt
889,541,281 *5C8AEFE9A1F23602F1B496F1344618D4E3B5105B julie-laframboise
889,541,282 *5C84A024DE0B4006AAE2924E826A211A20A9C3B4 jumjim1812
889,541,283 *5C85AEF9351586D6376FEF1B642B857B71CE6569 [email protected]
889,541,284 *5C817618CB079BA122BC15FE33B748C820DBD100 KARASTATHI
889,541,285 *5C884028FC2ECA92EEA4448CBD112F557A4C2A22 KARMANF
889,541,286 *5C87634C9A5BBA542AB988B1C6EDFFAF504A537B kconnected
889,541,287 *5C8844E99D53FFE348B6AD848A54E97463FB00B4 Kevin-Hees
889,541,288 *5C8B9B8244E5BBC5CE91007730AA3A7F293CAEC0 KEVINRDSHEPHERD
889,541,289 *5C8F3DC0E8B0B64D858DE56E6994B8FED5C7786B klaners4
889,541,290 *5C8B071E31505BF1E3437F25EC6E02B9BCCBFD59 knatsbsw
889,541,291 *5C847832C6BAAC59B8DF617CE53F04AC26B1689F KOALAQUALITY
889,541,292 *5C8CF712BF970EA1E96DDE4F1442CD81EF217E4E KONGJAKJ
889,541,293 *5C8CB4BED88373CC5B5A5696E91E9F865D395BC8 koppelschlosser
889,541,294 *5C84C257C2264A86B1CC52C64DBA08F81B85DF63 KORKALAMAK
889,541,295 *5C8885A6A679681B6C7EF301FCE599F3D1F96D00 [email protected]
889,541,296 *5C863683E41E408D35D2F66A03B8B9CEF0756374 KREUZIGE8
889,541,297 *5C8AF338319CCB504CCECFF544C708657498CFBB kristopher.fuller
889,541,298 *5C8FF9D61958B77A17D520EDE29C498008D22C16 KYLE SALVACION
889,541,299 *5C8377CED3FB6A379ABBA6102AA46E2DC07CCC4D LACHINALEONCIAAEEROLACORRENTINADATRAJO
889,541,300 *5C8371B0A0897E558C62FC5883D365D9F58DEF79 laquoyah8
889,541,301 *5C8E7F47E684D35A5E9C797CEA781CB4C83F922B LAZARUSSEN!
889,541,302 *5C8DD3060A4DD0A55355D4D0228317064ADF4F08 LEIF.PINENA
889,541,303 *5C8F81BFA17BF892C5F792FFDCCA2565F95F61D3 LEO.LOFFLER
889,541,304 *5C88AEFA54B94C20159338FBCB5CF25D58D4F784 LEOMLASZTANI
889,541,305 *5C8912149AED9F7A9CA1FF104B6C7D4B9EC7F44D lessquelettesserel
889,541,306 *5C8F336FF67FED8E97198F121D8661F95FA7477A LIMITEDEDITION,VOLUME3
889,541,307 *5C8032B0ED7A19A105E71204F2B439519D012E73 LINO.CAPPELLUTI
889,541,308 *5C88EC6C37C49672B206B02A59405D06FCCDB7BF [email protected]
889,541,309 *5C84D5C4385DF5CD4318035FE2BCE92A9D356DF3 LIONEL.RENZULLI
889,541,310 *5C88C105FEB79FB5BE424719449395E7DB58E1E6 LIONEL.SEYS
889,541,311 *5C8963BB903694B3B2C8A1C626AB53286EA10185 LITVYI
889,541,312 *5C82ED9D2DB4766604C525769735BDCE591B4574 LLTNSWBY0
889,541,313 *5C85B684FD010D5335E6B318D7225CC0ADF886E0 LOLLLOER
889,541,314 *5C851B067C2BDB43DB1BD85E982911D5127F8F09 LORENZOKAMAL
889,541,315 *5C83C0EB83205E4691C37B7A22BFBD4FBE33A51A LORENZO.STEWART
889,541,316 *5C891818EA6DB222518269CB9C12EE9A29233676 LOU.BLINKS
889,541,317 *5C8ABA7138CB9AE6A69200A448C59135448FEA39 LOU.SEIER
889,541,318 *5C85537EA2F572EE41FD522AEB3B07A074401DD7 loydcooks
889,541,319 *5C8D704FB2E7CCA46CECEB404A4744123BA3FB21 LSANROD
889,541,320 *5C8BA35649358C3319DE207B29A3347F90C6807D [email protected]
889,541,321 *5C834378E6A954028239345678D5F9F24670E467 LUSENRU
889,541,322 *5C8B712438DC76D70D9B4125441EC5F82C5EEA64 luyrt
889,541,323 *5C8A306BB1E96822602DC922CB9EE62E37052D1B m4r8l3!z3$
889,541,324 *5C8519975FF78727106CD7F4C7A9118DF5C68B67 MAHESH.PANICKER
889,541,325 *5C82BA490EDF97F8708A5DC10A3046B8BB9D31F1 [email protected]NIKIELDE
889,541,326 *5C867470AA13D59FC73AA7CFDAE86E63EB3289B8 MALCOM.FITTERER
889,541,327 *5C87CEB61B6F1E3C64BBA7E2309B4DB53C0ED84B MALIKREHMERT
889,541,328 *5C814B1C8FAB423565C47B6416FD9C5658126F64 MARCOBURNSED
889,541,329 *5C8E70E19AACA1FE494053A8B502A6D5FDE1FEF2 mariagrannell
889,541,330 *5C8DA196CA64CC16C2D3A2EB0993F2B358A3A141 marin048
889,541,331 *5C849872189675CC797942512D2A269DB35A6CC5 martinetishness8
889,541,332 *5C81277F478FE4DAE1157184DCE6719962DAEA02 MARTY-BRISTER
889,541,333 *5C816DF56D3ECA95EDD794AF497240F85AD2EE35 MASONSCHWEBKE
889,541,334 *5C829C0D9A0D9DE5CF945A6C8C52D9071ED21D3C MATTBLAISE
889,541,335 *5C8D3CB1D7A804989B27823001EE31384F713E78 maz0550
889,541,336 *5C8B5295FAA7AAF344B0566B34AAD30AB9D2B72B MEALYBUG
889,541,337 *5C8E02BF751114FBB1260EEA14A6D5836B053E17 melkinkaid
889,541,338 *5C80759A6C83FD908832D96C54F9E7B509388018 MEMPHIS691
889,541,339 *5C8D8A6032D7EA9A4944C8B1FFE35F550204C6D1 MERLESNEARY
889,541,340 *5C8FC6C19D9483E42DBACAD0C682A61E76F42B0C METALLOBIOFORMS
889,541,341 *5C832C2BD85C594B162947FC393BB87A8CDE3BFE MIAHARLAN
889,541,342 *5C8A5032F6D2EC6C9131EBF7F2954E691CF1A05D michael.venson
889,541,343 *5C8EAE461C4E6494FF0ECA1ED1217E39E0529195 MIDVEJINSULO
889,541,344 *5C846DC7F9A4D4E43A11CA259952D7A444471E99 MIKE.DERAMUS
889,541,345 *5C8283C5EFCCBA2C5C5892B684AC7E3154554148 milos-dragicevic
889,541,346 *5C82C6D87AF3D3C71F6F21E6F3047EA11ECB9411 minhsicheneder
889,541,347 *5C84897FE2292A348598D413440E72923722915F MISEED
889,541,348 *5C8EFFBA8FC42D7B8BDA12C4F98B591DBCC3CE38 mlahsarg7
889,541,349 *5C88BD8F781F157CE6F4A15E11B0EA10B825C0BB MOISESHANSBERGER
889,541,350 *5C83ED2510CB186196469493E5D0E4442E5AB674 MONTEFALCONSKEJ
889,541,351 *5C89C1A1FAF96589B65F647561366414B298CE35 mosesballoon
889,541,352 *5C89F7051BDE99D660A7F9CC0011E4B509DE3FDC mpederne6
889,541,353 *5C823E548A3467C42698C9FD78C232C8DF2645B7 MRS-NEXT-SPIEL
889,541,354 *5C8A1E78A5999CC480B283A8E9729BB21A78C0FE [email protected]
889,541,355 *5C80CDB32E684C6902981296CFC37809A2895242 murrayshadley
889,541,356 *5C8A1FDBF9879429C350196C5A6717C449E45816 MUTINERA?
889,541,357 *5C8E7FA19CF1A72CD02B8F4AB02E5CB9C8DDBE84 N)}:
889,541,358 *5C8D98E7E2A161B1F42F69EB972D7AC7B9483A75 N13W13D3RM51
889,541,359 *5C8C8E3E118BEED25A6F12DBEFC3807FD292FFE4 NANDAMURIBALA
889,541,360 *5C85C92239B8B0A5554C66EE47E2DFEA7C62931A NATHAN COOPER
889,541,361 *5C87C8E6F46CDC8916DC25AE3361B9611F6B970D nathan-hollywood
889,541,362 *5C8097D8D071E319B0496FEDB22126B1ECE964E5 [email protected]
889,541,363 *5C85D166B85947004FEE698B40EF904C893D3C28 NBISALTI
889,541,364 *5C8C770A2384AC5082A0184F926F60A244151A0E NCKNWLL8
889,541,365 *5C81EC1FA2D484D69A66B6C8F6CC18B835E53895 NEN.BAZEPOEPER
889,541,366 *5C8FAB4DA6FC1CBDC674DB7E6E46CC466BDFA2F3 NICKY.GONZELEZ
889,541,367 *5C863306369ADCD52FF0489D5CC35A226BB1213D nihilianarchists
889,541,368 *5C86F28D052F1313E4A0D18C457B343B8221B73D NJA:
889,541,369 *5C88FB1448CA541D6CB5871D71B90B6C70BAE274 NOCKADO8
889,541,370 *5C8C50E4608D7074F7034F971AF916A58CF7D2BE NOEL.PITTMANN
889,541,371 *5C8F5D909263F61FFA569F1EDCE62590F3BA487E nontridentine
889,541,372 *5C8043D31E1C2F462419F48C72E4D84FE0A38A33 nooit.'n.keer
889,541,373 *5C894C4DD57775F90D5F0D822A8D962F25BFE600 NORMAND.MARCHIONNI
889,541,374 *5C8800F9325687A6456C221EDC2A82D9C42383EE NORMAND.MIYASAKI
889,541,375 *5C8004D6DE023198B033FBF3F33265488AD7FC26 NTKNAAAAIAAJ
889,541,376 *5C8B1CB764458C6C2E09ED5E0366DFB9BD1C86BD NYACHOTO
889,541,377 *5C837CB73935A45F47A13800B7A1F250CD9B6E8E OBSADZIL7
889,541,378 *5C892C44BE5925D65370C2052D612398EB36902D OCASSARD
889,541,379 *5C85CE5F8DFB8A595D8466B53B2CAC01D69A5188 ODCHOWYWANIE
889,541,380 *5C8E38C247F3D7ABFE2A3F75E62319F1C2455786 )O(*.*d---p
889,541,381 *5C8714974FCBAA0D55E5BCB30250A431E808DE00 oldwivestalesrestaurantcomwww
889,541,382 *5C8C9D371FD7CC5471CFAE9934F23517D3339EC0 OMERRESH
889,541,383 *5C8158E759F63C5C0F4E52D4D654A31DB491B8DC OPARSHOTAM
889,541,384 *5C8E9B20292789FC9FB9031D407A62CA57E8ACE6 }O{.~.~Q======Q
889,541,385 *5C846048EE43DC549979402FBF4F47AB491F051D orlandodzierzanowski
889,541,386 *5C82F2447B526A8E9012F9C19B1BAC13A7925374 ORSZÁGKÉP
889,541,387 *5C84AE34F525CE8C38696C6CA6B3603D5A13230F ORVILLE.DILALLO
889,541,388 *5C8FC8563F27BDC4CBD197DF9F739B6EB0597D33 othafrankl
889,541,389 *5C83D98E9C122D202553A329C620FB498F17CD03 OTHA.FRESCH
889,541,390 *5C875F0BBE50B5D132F14574A93C26C6E0F273FD OTWOCKSZPITAL
889,541,391 *5C85DC49E0E61537E9BC9817FB87D14F2D789470 over$o1c7ou$
889,541,392 *5C8336F6CFB12CCF4AEF5012AFD6ED3BECB1057A P0LR4M4M3R
889,541,393 *5C85260FA88ED6F53B8572FB160DF3FEE09D5E56 P> ~0SPLAT!
889,541,394 *5C8509BBB98F8B9AE620F3477BA451A570D5AC27 palvelijoillesi
889,541,395 *5C8E7FBE8B1A91C156AC436940B38A769AAE4F47 papierschildern
889,541,396 *5C849029D5625F40220D1FCC7470F149B6C3A283 PATRICIA.HOLTMAN
889,541,397 *5C88E274BA07CC38F8681E23D33C2C292BE76CA7 PATRICKPOPEJOY
889,541,398 *5C8C70DCEAE795D9471A07A0B9ADAB0FC3FEC08B PAUSGEZIND!
889,541,399 *5C88AFCD8C1627DFC4CF4691DEA58558CA6B883C p.c.:' these stakes are for the tent
889,541,400 *5C87FC1BDF1F86D71CFADEB7A93B4728B9F4F633 p---d~o(-_0)
889,541,401 *5C8F96AB1C50B12D6C16F6ED27F39E03074CD4BB philiphhawkins
889,541,402 *5C8C9D7F30F4F55ED91AB73BB283D359AE40833A phpgtkpangopidgin
889,541,403 *5C81B2A4B7E38372C055EED4902A359042E0504D phyllishochberg
889,541,404 *5C85CEA077E7E4C22D57F0C6923AF2642D90270A picassopetunia
889,541,405 *5C8BF5E5FC1D3FA2A9115770E27FDDD5C14CC4BF PLANETENGEISTERN
889,541,406 *5C851D3FB963195650BF38C0BD407051E42657B4 pointfish
889,541,407 *5C8F822ABED63326F809250F9EB00967BC147EE5 PORSCHE.SPICE
889,541,408 *5C85C78FDAA38703204BB5BCC652C95C214AB950 pp `~ `~(~_^)
889,541,409 *5C893061F6DDA18708363B5CBFD728EF53523930 PROFUMIE0
889,541,410 *5C854E0853D0CECA10C0178C5CA7ACB48B2A40E6 Q####)* (^_~)
889,541,411 *5C83FA54832E82315C4B7B36A47E8871FA9AAC0F Q#B`~)X(
889,541,412 *5C88BA35304CAE9327DFBE5C3D4CCD2B5DE64392 qeti-kapanadze
889,541,413 *5C8E318EEAD252A362DE43F044A50117F35254D0 [email protected]
889,541,414 *5C8AC9CBCFA896168BDBF07437751848892FD17D QOZZROC0
889,541,415 *5C82F8F05FCC9D1C85F94E92419D6FB3EC27EC9D Q+X-
889,541,416 *5C84CE70BB18976687A0C013501A89DA4B260479 R3$C!NDAB13
889,541,417 *5C8D0FC04F90A87889E8F462C67CA6BEF98C5E57 RAFAEL.GASMEN
889,541,418 *5C865C25E502199B62F935356C623151044794AC ragez6
889,541,419 *5C8EBF2AC647F986B211EE9A313EB2FE81906949 ralphstraight
889,541,420 *5C871C1DE67494D74650F924E8B9D1381D0DB30E randallkellett
889,541,421 *5C857E4230593E658F7DE70D820746E5E548EA28 RANDOLPH.TARPY
889,541,422 *5C892F8D259E4AFA8AF1463FE9E3F1EE0A7D44FB RATEREZ2
889,541,423 *5C86FA30FAAFCFA3AD66AA8D40493CFCD9F95F0D raymonmasterson
889,541,424 *5C8028CC3EE9AA2A19F7D6A51CA40B959CC341A4 RC6$
889,541,425 *5C81DF70FF7FEC44FB833B221699575115ADFE76 REANO.BBS
889,541,426 *5C85DE808FFFC9FECC3BB50E702EFFC6C011B6DF REAPPOIN+ING
889,541,427 *5C89838FBB5C7479120E309BF588D6FE6ACB9C3D REINALDOLINES
889,541,428 *5C887E51514B376B2A65F35F79FB2EED665412CE REYNALDO.YABLONSKI
889,541,429 *5C814FCC9AD9A71DE2ADC0C5E38B7420063510FE REZWANA-AFRIN
889,541,430 *5C8DC878AD5B5DC471DE52254C83DAE3C14A0B2F RHETTHURNS
889,541,431 *5C8275ECBEC03BC69CCF6695C82A6F4311413DCD RHETTSCHAPPERT
889,541,432 *5C8A4C6EAADC3FAF292DBAF5AFCA88CB4F561CBC RITUDELACOLMENA
889,541,433 *5C8522A9759020274EB8225DDBA97AE0E092BF53 RIZ.AHMED
889,541,434 *5C87250F7D336A24B647CB0B4BAA09D8DBE31DD7 rm1298
889,541,435 *5C8071E2B1378FCFD76CE8B9BE5B70C13C6FB6C8 ROBBANGLE
889,541,436 *5C811C39B111BC5A0D0AACDF0A928C785332660D ROBERTO.BUSTINZA
889,541,437 *5C8ABF38E65B249764F8C4CFFB659955EFB9D084 robtearnshaw
889,541,438 *5C8BAE3FBC86512FDB7679336227801CC31AC426 rob.yong
889,541,439 *5C8FF176D043DC92A885B4558A99A6A1850BA3C7 ROCKMEAMADEUS(CLUBREMIX)
889,541,440 *5C81449C96FB9E98BC0D13C4BB811680475ABE62 RODERICK.MINGIONI
889,541,441 *5C85967CD264AEA74E5390C939164C58FE4BE275 RODNEY.BIDON
889,541,442 *5C8990246A24E9868ED9F6EBD2D3A31C221114F8 RODRIGUESINDODO
889,541,443 *5C8C482F5643FAF46343473394BD7DA0C247DF64 ROLANDO.CISSELL
889,541,444 *5C8F2D03F705CD132021D31830FC99C2602393BE ROLF.HEINZ
889,541,445 *5C827F7318A2EBA3197E85AD2FDE261965BAEEB9 RONNY.ROTHERMICH
889,541,446 *5C83A8C0AD57C8962AE3C6036C35D14CE0D4081A ROSARIOANNAL
889,541,447 *5C8A70353DCDFF3BEF1B6F9F26A82D32E724262F ROSKILDESSA
889,541,448 *5C8B9277E5045A723538233AE1584BA7727AB4E9 ROXANNEASHLEY
889,541,449 *5C8E8B3F6F9D7657CA82F2E726F9BE108B688F34 rrnquelypup#
889,541,450 *5C85CD45A6711F9D0466ADEEEE7237D9DFC6E336 S34NH4ROCH3
889,541,451 *5C88A1FA6D4DBC3FCC7225F728BFB097C6A529EC SABAREESH84
889,541,452 *5C8F1DB3B63DF61AE7765486E54B4D29B5FD93C1 SALEMKEEIZER
889,541,453 *5C81C7654B5B582B7F3A7213F149755CEB5A4C6F SAMARNPHON
889,541,454 *5C8E49D52AF09A82F605832E42ABEC48960D65A5 samplened
889,541,455 *5C8667DAA05A18023FF96865D48EAD057913F4EC SAOSIN15
889,541,456 *5C81E2BEDABC07F5615716D6599276C5A3EB4B25 SCMPTRSES
889,541,457 *5C8C88ED85E48326234004E214F54FC5F65E8B78 SCORPION95
889,541,458 *5C88BB00B0F2FCDABF48F52B5E6C5217F48DA4B3 [email protected]
889,541,459 *5C8ACB5339588F32835CD1BF20C22E6E797F75D0 seledatad
889,541,460 *5C8B646138F400F54B1A2EAF586CB64A1421382A sergiozafar
889,541,461 *5C80C6C08BE368F5CF48C68F48E8FD6D37FF0112 SERVYTOUR6
889,541,462 *5C82F14191E558DD3345DD1A641311174E78C9F6 SESRUEVAP
889,541,463 *5C8B5BEC4EDFF7CFD2857B69E1DB678C83EBC898 shapes0901(disc1)
889,541,464 *5C88977F937D410CDC39C8B3C1158E2866279700 SHAYNESCHURMAN
889,541,465 *5C8627D2EBDE947682793EB18B1A458D30EE5272 SHAZBINK
889,541,466 *5C83C42333862EA41AACD50C39E6D85CB46E5DBB SHEBAHELL0
889,541,467 *5C8A888FB05923EA67392BE03ED02FD07D857612 SHELLEY ALLAN
889,541,468 *5C848B1834BA680C03DF53B55A9CA34C2BC5B280 sherrimain
889,541,469 *5C84A0AD9F61F219A236C05F9A496578F3B1CE10 she'saboutamover(featbrianhenneman)
889,541,470 *5C8E5BDFAFC3396377BFDF713AE1DEB053BC16A2 SHIKIMOLS6
889,541,471 *5C8C7AF543E57C676E125607202C90D11F964D2F SHINAGEL2
889,541,472 *5C8E566155CEA61B2A5F1451F4B8FE6A6DF70149 singáer
889,541,473 *5C89D431AF1CC45A07DC8E5D69F735A7E3430D94 SKIPPYLLOYD
889,541,474 *5C8AD0DDCCFD7A38625503284CEF524ECCD57E36 SLEWSES1
889,541,475 *5C803BE6EF9065752C6D3F639ABE7BBD935E5EC5 [email protected]
889,541,476 *5C83074CF63AA2CEBDF2C5B96FE62AE4627492F9 snalotro5
889,541,477 *5C898F30918551608FAFCA0D42B4734F8D6DDB7F SOURIN DAS
889,541,478 *5C86A31BE0BFF0F85453350AF54C5D367A609CDF SPARROWWHITNEY.
889,541,479 *5C8E4DA14532DCD96FA0B94B6AF8A3007E8ABE62 [email protected]
889,541,480 *5C8F0121547120DAFC9E9D5846E649BB92F26530 SREGNGELMUF
889,541,481 *5C8B90CC6F47708E4CE02121A062FBBCED456961 stafelli
889,541,482 *5C8C30EFB9B1C6C1143774B6762E486A81E53AEC STANLEY.GRAVIS
889,541,483 *5C83FFF90EBAE43C595A1F0381C5E778ECBF28DA [email protected]
889,541,484 *5C88F60832E43186293863C622CE5AC5AE8D554F stein'sway
889,541,485 *5C8A4490BF5435E3041C3511AEFD16DC66CC5783 sterlingeckes
889,541,486 *5C8F3C64C46C2E994A9A6F0D60503E8E6B48345B STEVEMORLEY
889,541,487 *5C84A0A6C12364F185FC0FFF5D8313B43EF845DC STEVETATHAM
889,541,488 *5C8F5A10D7689FC6A50DC772DF13BF8352709183 sudden-samba
889,541,489 *5C89EC7568C30D976B49DCE00B4122DA909305CB [email protected]
889,541,490 *5C84B7F752DFFC0ADBE20A06EC2033D76A05E6B1 switchid
889,541,491 *5C8863AD5624E692803BA26B986CDEDD92A15201 talk8441180228
889,541,492 *5C8D8BBFFA441550E159FE40B16CC76741A56E3E talk98215210241
889,541,493 *5C885ECEDEAC6F1E2458BB803F7DDBB13A9D51C3 TALKARTHROPLEURIDAE
889,541,494 *5C8B6E490B635651FB938ADBC6F69DC115E79BBF TALKIN-'BOUT-YESTERDAY
889,541,495 *5C8EACDC734E2E0D53DB769224C6685530F70040 TALKRBALAUR
889,541,496 *5C8F8A4E0368821CEA99F678787CC92D59556972 TALONROUVANKIN
889,541,497 *5C8AE20C4B47D29628CAEFB6417FFB7975211678 tanittik
889,541,498 *5C85B6C43DD7A092183BC7AFD3F25949D229090C telegraphsinternet
889,541,499 *5C899943D25B8F6DFD1658938D0A534245AF7A84 TENSOKUH3
889,541,500 *5C86F88689C7D8A100C095BADBE36D9A91F06651 TERESIA.TANIA
889,541,501 *5C862C1298E2266E64DAE53EF3346F18A2DFF86D TEUSCHER
889,541,502 *5C867AB387D8498983436A76D00493E97482D2D6 THATOBIWAN34
889,541,503 *5C87D68A5A38A2D750D425BA165FE43EA40F7D5C THEGHOSTOFCASTLEMAINE
889,541,504 *5C89405C63F0805847F5B509405B326A03EE83BD THEMARKET39
889,541,505 *5C8F80C0B2121A2B666FC32F6D2D156BAD73AE91 THE.WICKER.MAN.(LIVE.AT.BRIXTON.ACADEMY.2002)
889,541,506 *5C88167B1711BB9628BF380FA0E9423B37ADE37A TLERPO
889,541,507 *5C80A6671EB25C814DA2556FB945BDF833028697 TOLLAGE
889,541,508 *5C8D4F3CBD265D50895D0351AE76FF9981353E3A TONY.BONO
889,541,509 *5C8778995824E01C8FCBFE2AC7C6F97C73A88D32 TONY.GROTE
889,541,510 *5C8FB9DBBBC625FD7A05C8CA1930C943DB8F7A5E TORI.ARELLANO
889,541,511 *5C8F89273C318A39745D732D243D6DDFFC1C34FD torongina
889,541,512 *5C80D90ABFCBCC638C64772319F7524E22367971 tothecenterofthedemoniccastle
889,541,513 *5C86E2890BFD70BA91509DCC19C3C0F718F6A659 TRASYATYA8
889,541,514 *5C851BD2BDF763015244CD519333853E4342E5B4 TRAVISBRUCCULERI
889,541,515 *5C8C88734DB975FDA67B98241D9C1ABCE75C9BC5 tributetobishopmarigzaon
889,541,516 *5C895EC0232496D9668EAAF9B244F3337B1A5B96 TRIFF A THAMID
889,541,517 *5C83A1A43CE31B4691F5F76D9CB5C0F3A184CAD6 TRISHA.TOWNSLEY
889,541,518 *5C8EA1459DA73C023523B660C5A2776991B44D60 troy.osmack
889,541,519 *5C86F99B06BE280A8D66609FA06690ACD170CFCE TRUEST TRUEST
889,541,520 *5C848B9D112FCA4589D84C2B929F732B4ECAA748 TURNACID8
889,541,521 *5C8B7522F455BAB64775FDEC9DB13717B5BECEE4 Typhlectasis
889,541,522 *5C89A41C436606F2F79680AB6840EA6D9FE406E4 U5TVFYPMPSEDMS
889,541,523 *5C83616C82E63658D6DF811B95F2770D2764BDC9 udunkbochaachy
889,541,524 *5C83D3EB3D545EDB5C7193ED375A6792F9A7CACA ULTRASR1
889,541,525 *5C8D72D1786D99FF614BD3776B2B4FB71A143B03 unretaliating2
889,541,526 *5C88461ACB17BAC9BE9FE5D4BBFD4308C8DC9937 USSM20400043
889,541,527 *5C8786E323FE3E70F250129F28D45949D4C4A6F6 vaativan4
889,541,528 *5C8DFB8363339EEC4BD492FEE2F3B58CF0E82242 VERMENIZI
889,541,529 *5C86A395EBA965AD8C141228E16DFA38615BCAF9 VERNONLEGRAND
889,541,530 *5C8908ADE14DA10A57CD85A89FFD7060C540DBD6 VICKYPETEY
889,541,531 *5C868802F2C047F7AC11D13FDF0E264CC12CFEBA VINAYAGAMS
889,541,532 *5C8F8A52D8D3196E1AE60BFD043EA79254444A71 vincentaltmark
889,541,533 *5C887142434D2825061D8E89699C6233492F1DEF vincentraike
889,541,534 *5C8278C1D75F2BE5409F289557AC758EA7B72A3D VINCEZHIHONGLOO
889,541,535 *5C83A3A74024C04FEA1A8AB01562F5FF4D8CD9B9 vingerdik!
889,541,536 *5C838353B0CD76B05A0D0088076E9A2F43C796F4 VIRGILIONS
889,541,537 *5C8A86AC1264C870B3F9C7AFC58551D77563353E VISIÓNHOSANNA
889,541,538 *5C8B12A58C4DA92B31178636E6A1AED284610716 vras1
889,541,539 *5C8A2DE225A2162D35E813D9D7D07D38141516BA WHAT THE HELL DO I KNOW?
889,541,540 *5C828838D881CAA90274BA0C5AF892238F07E1A1 [email protected]
889,541,541 *5C8F3F0467C8A733599BA9645864C1D74C4A8289 wildlife-N:-~wildlifes
889,541,542 *5C898E9A55D7AE4C174F647491EC2A73F6C35C48 WILL THIELEMANN
889,541,543 *5C84D2A6FE062739ABDDEAF398FFE676EA4FBE44 WILTONSORRELL
889,541,544 *5C872432CD7E30187553F0563A494F8A2BE7C600 WINDEX.PHPTITLEOVERS
889,541,545 *5C8F10F1BB8FB314A2B573D7B6B27EDD2DD1928D WINFREDMICHAUX
889,541,546 *5C881793AD528B50DEA614EC7DB824F5B20821F0 [email protected]
889,541,547 *5C8399A10CBBABBBE55EF1DF422BAC33590268CA [email protected]
889,541,548 *5C844452C28B74E3FCFA7AF86E1E1406E14C2107 wutrigon
889,541,549 *5C8C391C73B23716FEE8E91B65237BDF2648AA9A WWWHACKYSTATORG
889,541,550 *5C8978BAFD2227614B9C3BAFFECA81A830DE2478 wwwtorquefkmcomtor
889,541,551 *5C8A997AC05FE9CAEAED5FC622194426D0FAE43C [email protected]
889,541,552 *5C8878742A496316E1681896E1D9247FD454C8D4 X160773
889,541,553 *5C83D14D2AFB1FD9E7490A90E504779C16B8DEF4 XAVIERURBY
889,541,554 *5C80575C72A7E98AE7A355EC6B8BB9AE0FE7875C )X( ~` ~` <#B
889,541,555 *5C8D1404991E43AC393E80200B1E5FC224150541 [email protected]
889,541,556 *5C8A56174183B2496A63A776F210CA310184BDAC XONEFORONEX
889,541,557 *5C8D58CB600F1A64DBB43F0DC285D8302C26ED09 [email protected]
889,541,558 *5C85005C05B6A4715837E80B59E316573EB42696 YAKUMIJUAREZ
889,541,559 *5C8E548E6119DB2E3412736CB8C401A351508B8E [email protected]
889,541,560 *5C804E875A297204FCDC25CBC4D3208A1628EBC4 YESYOUARE
889,541,561 *5C8D0BFEA4A44DE4500CE2FAA7B086A39BF8F3AA YLIDNAD2
889,541,562 *5C88D0A2885C46BF920DE176C7E9AC80A457C7CC YMICHICO
889,541,563 *5C814A35275D0C364B4F77494633BD80361DB49D [email protected]
889,541,564 *5C81AD46ADDC6222C3DA86D82326803515389808 YOSHIMYCARVAJAL
889,541,565 *5C8EE28B08EC712CB64A3BD0E3DBAE9EE866D123 your devotion (cold drive remix)
889,541,566 *5C8B240474F33C8F40DAD3978772FE238B896E70 [email protected]
889,541,567 *5C862A5B476DED63DD48AEF910B4E1608966C335 Z}[4
889,541,568 *5C8A52B87F5428C0C29C52032B2CD713C2664A73 ZAHARAH ABDULKADIR
889,541,569 *5C88FE7F855572FE888F5DE503E972E47927C0E4 ZARIA-BANKS
889,541,570 *5C8670C18A892D9061B901600FBD80BF4390EEBC ZEKYIABURT
889,541,571 *5C82A0B859BCC3C039D0CA4C10328B47278B89B3 [email protected]
889,541,572 *5C84CC4FA4D1C6457A47DBC7D9E2025CA77C0E71 [email protected]
889,541,573 *5C8BE1BD0A96F4EEE3B0F1CD911AF74F84392862 ZNEKLIDNENE4
889,541,574 *5C81B2ED960F00A85C5D7465C92330C24D050857 ZOHARAMOORTHY
889,541,575 *5C8FA9CB1AA8687072E009B4456FE772CE14D97D ZORANA.KOSTIC
889,541,576 *5C84928D6151A733DBDA1322225F9E1DD9BFCE6E [email protected]
889,541,577 *5C8D405E995178E8F41C24CDF334CF0CC7BE945C zv.baa
889,541,578 *5C82F657F83DCEECC59D16DDB2A40C30730E90E9 ΣΙΓΚΜΠΑΝ
889,541,579 *5C81282815383F7F4018374BA88304AF757E530B бабкиным
889,541,580 *5C8AEA4FFE715986028E0A6C76744CC8D306A6C1 «гарфилда»
889,541,581 *5C876D336428D2DA1245C550C669DC5261E0BA35 КУЛАЛУ
889,541,582 *5C8A78DB35DE85E1B471B12AA31ADC461484F79B МИКИЦА
889,541,583 *5C86647BFF26B890459362F14CCA985D08B8D6CC ПРОПАГИРАНИ
889,541,584 *5C8F84209013FF247BAD4B35AED77AE913DE510A СЕЛЬМАЙ
889,541,585 *5C84E91139EA113EA90668CBC9147BA542459467 СЕСПЕЛЬСКОЕ
889,541,586 *5C8CE14D4BB60D5BC3EDE73EBCFBED02A10053D3 ЭНТЕЛИСУ
889,541,587 *5C8FE82BC66C8892D3FF73E8602396243DCCD6B4 ՍԵՐՏ
889,541,588 *5C816B0173E720F0D846541BFC4BD08D6D546625 颶風HUMBERTO在HIGH
889,541,589 *5C816275242600465CD0763B1753D55DE25773B0 9GEOGLOSSACEAES
889,541,590 *5C844D9CD3A9994F3E460F49DC0438E97804FF16 9GRANTLYNN
889,541,591 *5C8DB976BEC05DB86A10F93BC2BC694676F90E0C 9HEISSERER
889,541,592 *5C8E03FAF4BEAD0E8CE3CF33E19B5E4B62FA4CF5 9HTAEMTSEW
889,541,593 *5C8AFA44546F93BC33B93B93784765B675D0BB28 9ODNALIBI
889,541,594 *5C80266CB4BBB3B403779111664037E88B45D707 9PASSWDWOLFMAN
889,541,595 *5C81A69F97DBF5B4648C8793B0985F635A5CED46 9SURVIENT
889,541,596 *5C83805D3E9A80C79A4676DA39BD3C9ABEE7B68A a1t.p
889,541,597 *5C8DF439A49670C05EF2CD6904E8DF9B07726137 09291503
889,541,598 *5C85D13113987789F89C371752F37BE1709323FC 0ILUVOMEGA4
889,541,599 *5C8CEBB41295D6E46AD7E5BC315F11F62E1E5970 A3LXK
889,541,600 *5C8F1629C109318646C81D7607C32ECF6C23AF9B a8ne9at1on5
889,541,601 *5C892378CC841F6F7A8A67A839EF24F462AA7786 11AUG1226
889,541,602 *5C8D218FC97F0E8D3035B26A1FAEA5DE94AD529B AA-24-7-(DIPLO-REMIX)
889,541,603 *5C83418B7EAD47E2A4B626845191B0D6E0EEDF2B 1247867 DIEZUSCHAUERMUESSENLACHEN
889,541,604 *5C83016330EF9996CB511A8E1D6FC1517D61BB91 )A,AAA
889,541,605 *5C85452B533545D21EC8D288E93988E549D0CAD2 aaah30
889,541,606 *5C8A1E80F027E9F3DE17E69F88038F20760DA76F 1383391 "butwegetnooption
889,541,607 *5C8464B700EC8AFBDA516A182C348E7416CBCE3B 1391717 IMZORNERHEBTSICHDIESEELEGEGENDIEVERNUNFT
889,541,608 *5C8C22DF8C0793D9DD6DC04219E048DC28C93147 1426104 YHDYSKUNTAJ
889,541,609 *5C81D6716FF84F702402ECB4ECD48EA1BD72BC46 1538857 silmi
889,541,610 *5C8A8B99548096E1BDBDE539C05312119B491D07 1592809 VALITSE-TIEDOSTO-JA-LOPETA-.
889,541,611 *5C86A74450D61BD30C6573B68AECAC190CEE9419 1602542 JO-AIEMMIN-ON-HAVAITTU-MORFIININ-LIS
889,541,612 *5C8036E2681C6A47B72E8CA77DF8791BFBDF4141 16SEPTEMBER1606
889,541,613 *5C89C5751DD1689DA2874825A542E4428FEE174A aadTh
889,541,614 *5C80A494E1327A5F33D497285557E47051D67B4B 1915115 SELAILKAA KAPS
889,541,615 *5C8C9127CC10614E2C68CFDD8890F5BB272E9756 1998-10-31:westlafayette,in,usa(disc2)
889,541,616 *5C88735FCBEB6063805F7CB4596B3F1BA22E6823 ABC84649126*123
889,541,617 *5C8E9F65D3DF2CE1AC2C613CE48B12E01C0E1467 abelshittim2
889,541,618 *5C8ACD483C3E47AB245EDD6E6AE6441A76F2B0CC a_bes
889,541,619 *5C829AB936A55009A1C8C6EB29D163EA4E21C019 1-e-plus-tochter
889,541,620 *5C8E60C1233853C5EA2EBA6622BFDAD8A01517AC abither
889,541,621 *5C81F563F022A5011187DEC58C2CBC7B57163033 ablasoporp1
889,541,622 *5C8591FAF11468CBAB9E4EA7FEAB6A168BB784C4 1 FUNKTIONSHEMD
889,541,623 *5C88DD62D86E000698004F859321A86D21907616 1-garten-set-koffer
889,541,624 *5C85D9A62F435370086C24A2A6A44509BE3D546E 1-haluttiinilmeisesti
889,541,625 *5C84063B69A90876CAA0884164C81D0E318D07BD 1 inetdisketill
889,541,626 *5C898B5EDA684A6127D810B7076E3506E567E644 AC0P5
889,541,627 *5C84692D378B60C2FDB7E470871BF04600F3F89A ac+bf
889,541,628 *5C87E3EAF655A69E45CA07F49CCA73BA7EF2FC1B 1OLAN123
889,541,629 *5C8AE9C6ACF6EDA6D1809D302768ECA655A83943 ADf!
889,541,630 *5C8B84955D990103FD4528E6FD1B5330D07C86F5 1-suorasiirto-ohjelma
889,541,631 *5C85A7F13F827DF55B1E9CA254A878CA841C05CB ADYCF
889,541,632 *5C8BA7639D67524DC486EEA69259E3692F8A52C5 1-VAPAA-AJANVIETTO
889,541,633 *5C8952ADB4E57A6217D53058313539B0E03DC163 1.VILLMOV
889,541,634 *5C83E15F4B7CA6260FEC37F2954A89130DD26714 AEX._
889,541,635 *5C822FE9F6C5A4FBB43DCC01EF7208EC38D89369 AFONSODEPAIVA
889,541,636 *5C8F7FF72AB3AA28655A415509A73FCADA02F82D 20RUELLO
889,541,637 *5C8903666ECC4395186D88BEF5E458D9AF37DE75 ag7(p
889,541,638 *5C8EE6C87B89625DC3D7B438050E1DFDD7146110 2197181 JAHAUSKAARIITT
889,541,639 *5C8920D2AA82D230A3CC268AAC9199C6C54E9DD2 24062 komentotoimiivainsato-verkossa
889,541,640 *5C891339C9613DA3A4CF1A106935E94BF5090C53 AHAMBLING
889,541,641 *5C8BDBE1C71CD7221ECFD75125E9F2E41487CD8F 2494783 keskisuurilla.yrityksill
889,541,642 *5C8290A83847B03EFE054761C3B0F2A4D569D427 2545638 LEVIN-JOULURAUHAN-JULISTUS-KLO-15-P
889,541,643 *5C8C77EEB4C24DF17507E3BD4785960119B9D6D2 2573048 ICH FAHRE ZU MEINER OMA NACH LEIPZIG .
889,541,644 *5C86722C0A4A73CF9FFDD7D282E0DB93976B72F8 2606c041264632838521445e48869afb
889,541,645 *5C81CF1CEC96A74C02DB799373CAF3EA883C4747 AHVTY
889,541,646 *5C899B025BF39ABF7E94F8FC5E205DEEE2047E69 A,ICI
889,541,647 *5C8560797551099D61B2E07B04C9EA6AFDFD4419 2967660 MIELENKIINTOMME KOHTEENA OVAT T
889,541,648 *5C827913890C0F366F3B5658E8267AB11491BFAF 29civorrebbe17
889,541,649 *5C81C12B86EB29F4E119A283EB28E231EC01B151 AJHANNA
889,541,650 *5C81C596C5FCC8EF0E398C95C9B5EBBB46DA9B37 [email protected]
889,541,651 *5C87E39E6A51AB473D6FB19D035DCBD22A57C36E 2GNILDEER
889,541,652 *5C87266F3DF057C6733BAFDE01D9E22AE7B51889 2GRN9R
889,541,653 *5C8B5A6A34B7DEA89D1939D40FB8EDF6C2DF54BE a:kqk
889,541,654 *5C8AAE7CBC3E9A98022AFBDB8A3F3EF08E6F0830 ALABMAS9
889,541,655 *5C803DD3FBD7E0A631FADB81E2EC21C86BE6DA26 2.kunde-lieferant
889,541,656 *5C8D0277AA8408ED0148CA6346855E2B2145BEB6 ALAN.ZYLSTRA
889,541,657 *5C8BA8D3E3C1D3483254E88C4D4530103B3C1A93 2medianews'
889,541,658 *5C8C0172E06060335065BFFCC16A54A6289D1A78 2NISHIOOG
889,541,659 *5C8A9D7801ACAF25E005BE33E6290EABA47200B4 2ocevan
889,541,660 *5C805E37DD305B8912C1DD1917BC5BE97DDD98DA 2.PODZOLIK
889,541,661 *5C86A5F29206636ACBE3013651A0030737459424 alexanderlampert
889,541,662 *5C8C51172A0384210AED3C502D159F2820EC0B4E alfordii
889,541,663 *5C818E67288BF56A107A5DB526CC7B8E443E9FFD 2TRANPORTIERTE
889,541,664 *5C821187AD499D333F17E6C49326EB6BF50B8482 3000Х2160
889,541,665 *5C808B1FBF0D31AA6EF470B70BDE37ECA95D811B 323george
889,541,666 *5C8C35DEDD972A6B58F02281B2F550E026491E12 [email protected]
889,541,667 *5C8B6B6618BF9719D14832114E778A801AB496DB ALOBW
889,541,668 *5C839B873A580EEB79125DA2FC902EE68C46C48A alphonsoraju
889,541,669 *5C88CEA7E4304A34AC188A8AD3F4EB3B87A26A4A 3carmelitas
889,541,670 *5C8807E870BB9EF8160753B50D37AC197DAFFE9F 3ELONGAPS
889,541,671 *5C82DCCD1A8F0ED08FFE8ECF02B4C07CDD7EBFE4 amadopillado
889,541,672 *5C8007554354B697FFB29EBCAE9DF00D7E6BE135 3GACIDLY
889,541,673 *5C81774D44DA00CEDDE0CAA3A20C886B6B5652C3 AMI#_
889,541,674 *5C878CC88D9369DA615D072849329D53F7255FB7 AMQT,
889,541,675 *5C8EB09871EAC01BFB22453FADA95F717B5DE500 3prechose
889,541,676 *5C8F9FD3AE86EC401CC93366E5BBABCA1057BE1F 3STDNTSU
889,541,677 *5C8DBB23E5FD5305893B8E0B6BE7F3DCC73D0893 3SUORIEN
889,541,678 *5C808BBBACFE9CEEB1360E2951BF77BE9744BC21 andrzejzulawski
889,541,679 *5C865686070C88675B26ED848EB795D21E8B1BB1 [email protected]
889,541,680 *5C8A2A1CA407BA605A921E474AF0045AD2BF6B8E 3====>*UU
889,541,681 *5C8B2717399DC26AEEB2F14775DC1EB1A7911B06 angeloleimbach
889,541,682 *5C8AFBB906A90618150EFDCD17E6608B6686C1E6 ANHOC
889,541,683 *5C867A6B6A267E19B1D691AADF2A8C9DD84E9630 446510 iste aet'yi olusturmalarinin temel nedeni budur
889,541,684 *5C8F322484D0595D8468A97066B35F2ED04B0964 456hannah
889,541,685 *5C8E5F3151A857943734E56F79D21D2D1985655F [email protected]
889,541,686 *5C89E701E416C7DA7E1DC90308EDA434721C29C6 493AILEEN
889,541,687 *5C876D038635B90290C4B7EC2F22D6D21A32581A 4afnf29
889,541,688 *5C8A2D13472F1244B00E28BDA4AC52F79873753C anthony23
889,541,689 *5C8369E86245A145B996D8B727B747B6213B0472 4KAGANOVE
889,541,690 *5C8078D1F837A55BE131F4A710B09BBC97EE8BFD aoapi
889,541,691 *5C819003EFFCD055D939D2436B14BBFEB352ADF0 4LETTERBLONDIE
889,541,692 *5C8125FA711BC1DA95C914F6A71EA94A51A2B35A 4monituhatvuotinen
889,541,693 *5C8FC5EE536659365A1B3713725DCA7C7B594A9D aovmh
889,541,694 *5C8AD319B8DB6DD16B4ABF7728086D35A9BD674B APAV)
889,541,695 *5C8FF08A25A0758ABFB7FC1F7BDA883D5961887E APPUYIONS
889,541,696 *5C8A64FF97B7B5ABD0CD6EF2EB95C7EE409300D2 aq+.y
889,541,697 *5C822BBA13382FD33ECDC19A0B5240DDE312F856 ARDENBOXWELL
889,541,698 *5C8BA5CB105A455AABBE8C1647C0775B64844D58 ARDENKNOTEK
889,541,699 *5C80FF1DCCA2DD1AA784B77DEFE388490B59D6E3 560524 julkisivukorjaamisestanoin30%kohdistuip
889,541,700 *5C86BBD9D728FE610211467B12E345D3E9A08053 ariel59
889,541,701 *5C86087007AE895990ADEDC86DC628CBD77172DB ARTHUR.CANELLAS
889,541,702 *5C8F9D0A1D5BEF52AA058689BB5CCA6987A132EF ARTURO_BRESCIANI
889,541,703 *5C8E8A4216AA2F9DF9729F720E28A373EB3B406C ARVI
889,541,704 *5C88C461F3238E1CE46A807334823AB16EB84EA7 5HIBISCUSEN
889,541,705 *5C8995C815375B8BFCAFE4D4FF287528C27B204C 5INPLAGENED
889,541,706 *5C8E0E4D05FC1998564FE2CC2769B119EAFD73FD 5JEMLENES
889,541,707 *5C8A3F1A7C4A87BC201246333DA73F95D538F7E5 5KONSPIRE
889,541,708 *5C8F69925500DBBAA6382E707C8AFEACC98B8846 5LOODHOUDENDSTS
889,541,709 *5C8302944A49CF7C255FD03FC73D7B5DCFF15722 5MARCELGREEN
889,541,710 *5C8BAA91D1F5759CEC0FA4151A5F4E66393DDF28 a,t.)
889,541,711 *5C81CCB73FFE31E92876EB5AACEA13713642B273 5NONCONFINEDS
889,541,712 *5C853B12C878BF5470D7ABAA72FF812FD2C5D9D6 atmosphereless
889,541,713 *5C8D97F7E31C64D70A192208ABCEBD79BF6EDE06 AT!SP
889,541,714 *5C8141962082C3A5AF5A3563E5216EB4BB44516E attilaamies
889,541,715 *5C8379773247AB1F2AD05225FBB908358E2B2E88 5SLINGERPLANTENS
889,541,716 *5C8EE4B964FAC77C6FC69DF3B2B878A9EE14AA1D atvk.
889,541,717 *5C81AA2C6F63CEFB5FDF8B93A1F3786A37EEC353 5TOMBAKKEN
889,541,718 *5C8AE8B2C705B013F3513F011BAF67A87F984D06 au+omob1l1$+$
889,541,719 *5C8CD41A831836ADCACDB163CFC213895A07FAD5 625289 koskinen:kvanttikemiaasostrupinkes
889,541,720 *5C82B540CC07693DAA5C01790ADE4188C0C75067 AW//
889,541,721 *5C80546EA8239381867EEE4F0D7A94457DA25452 6BENSONGRETZKY
889,541,722 *5C8FFA661888AEECBC5ABEC7BF41EAF3CB892EA7 6BILLYMICRO
889,541,723 *5C85DB9DF3DC0AA2713BB4AEE421B938EA0E33D1 6BSWKAMASUTRA
889,541,724 *5C85ED3E7E2EFE7A96089DBB32969B9B03DAE6C0 AX$4
889,541,725 *5C8C6F52DD115EA5FFFBCA3B0D733316CE3EC2E2 6ELKCATBSW
889,541,726 *5C8C52D2D4647B6B1603A467BDA8CBFFA720F124 az)lr
889,541,727 *5C8E92ED31BA1DB87F11DB5A3A5A1B8C92F6CE3B B133317
889,541,728 *5C87F66F0C50B0845F40B873C98729D20A5E7E9C 6OREHLIA
889,541,729 *5C81A1EEA71E23E772A335C11C43AE8AD5081A86 B5286 1 0
889,541,730 *5C816370393B64A6B0F1FD1EF764C72FD07DF1A5 b=5vw
889,541,731 *5C8B1F42E64C72441F1E54B164624C3493626D4C B8PN+
889,541,732 *5C85365A5FA8A0F889BD05C01C1E8A081BA26CA5 []@BAA
889,541,733 *5C80EE6A121F451B2FA305006AEA5D6EA0947C16 [email protected]
889,541,734 *5C88D2BFB9C558CA1B49D4B62E3F832B5DC8C4C3 712HALLE
889,541,735 *5C82ABE8DB87420A88EB3C09C5E4D570782E4129 723355 ".THROUGH.THE.WEEK.,.OUR.LIFE.IS.VERY.HARD..."
889,541,736 *5C855785D270865BBAFCFF2C467772C926489604 742330 TOIMINNASTASAATIETOAALUEELLISILTATY
889,541,737 *5C8C55A816AD2CE7CFBFC1BE3BCC84241409DC3C [email protected]
889,541,738 *5C840993EEF9CDCC3D4919402EF46F784EF5DEBB BA-HR
889,541,739 *5C8D3E0F5C5791D61BFDF0F7F42973214685548C BARRY.REAMES
889,541,740 *5C89C3F6935AF4BF93415CFA8AA127F3E366539C baseballdakota
889,541,741 *5C87879C4007B75A1AD62F6BC1870ABD46F9C722 7HOUTVESTER
889,541,742 *5C86176C46233B15417847B7E1B7ED0C6E7F3670 BBOS
889,541,743 *5C8F807352F01895FBDCE018CA1D5314ED6FE07A bcha
889,541,744 *5C8E0B931AE4D3A2FCAACCECC789DFF46014B6A8 [email protected]$$
889,541,745 *5C84D95927E743094366974E9AB27E7212E3D545 BEAULIEUJOSEPH-ISIDO
889,541,746 *5C85744A45F5D684ABDABA3E8D5241F006C0A77F 8===)~0.~o(x)
889,541,747 *5C88CA9FEBC81ABCB1DA93EF32E964B9433291DD 80x25
889,541,748 *5C8B7C72374B5347F690A80E2E7A8722DC0CCEC6 BENJAMIN740
889,541,749 *5C8A2F0E31F795B5E99E1A305FAE2CBA633785B5 86533 " NYT EI OLE JUURI MUITA KEINOJA KUIN YRITT
889,541,750 *5C87481FA3ECDD86DC2DF52727418882968D0838 8BEDELLUS
889,541,751 *5C8370B9A82957C7095EC8D12FED15D764BC0C68 8BONYCEV
889,541,752 *5C81A40C2F3E90888A76E28D446BE36470F776BA 8BREDSTENDE
889,541,753 *5C8E664FEB88EF008967D06061542CD47C2BD5A9 BERTLEVERETT
889,541,754 *5C881278FAC15616EDD4287E94E01AB2F9B877B3 betoneiras
889,541,755 *5C896BB5F9B83611DB30FD2F661348D12F356F38 8GEGROEFD
889,541,756 *5C8D9B57674FC473A171210088AB5C46276B90F2 8MINISZTER
889,541,757 *5C8C975F72F7973AB3EFFAE4A5D2D28754330614 )8(-o~0~q-8
889,541,758 *5C8776125D6B746EBA1E3229B61CD33B5B4980AE BIcN
889,541,759 *5C8CC20C3D3695DEF624A1ED5090FAAD7E99DDB9 8OPVROLIJKTS
889,541,760 *5C820E25A698B5D40BB4223DFA6AF9F7CA56642C 8---P~`>-<
889,541,761 *5C82972D7F4BE5E79B61F4F78E907A13B9C4BB7E 8##P*Splat!
889,541,762 *5C8A9C0308612E5E36F02F8BA2A100BE879D08AE BILL TOMS & HARD RAIN
889,541,763 *5C8929EEDAEE0B54196358C44FDD4DAA1BCD1426 8ROZMYWAC
889,541,764 *5C8DB5EEE1DCF3A4ED5153359D33039D12810A81 binoy-philip
889,541,765 *5C8B60394E9A88427D7041B328E38EAA95CC57B5 BIOWY
889,541,766 *5C872BC51C38765FD8D149F2D592CEDD86CED8CF biuub
889,541,767 *5C8434F3EE3D1E0820AC5393B8AA77FB8430EF4D bk+8u
889,541,768 *5C887C33FC55B09B9B23528799D01CD92668D1BE Bk,A
889,541,769 *5C83278C7BB71134FEE3EF8713E8083336F3A111 bleb&
889,541,770 *5C8441417E80E146DA3AB982DFFC8BABEDA5A90B BLOBULINA
889,541,771 *5C86D891193DB45EF1FA1A41B22D1F951C5873BF bltqp
889,541,772 *5C82543FA144726D3952559934C4469247CA566C bmbsskd
889,541,773 *5C837B8195DEBA5E25894C6037AEF76FB31BF410 B?nl
889,541,774 *5C84E7E629E5D8C79574AF9B713DC547F3A804CC 9KELOIKOB
889,541,775 *5C8ABF74F86F98AB12B57615271DB793C75C8370 9.liioitellun
889,541,776 *5C85549A27E5CDD88AA6022F7E620105EE7D548B 9NELEFAW
889,541,777 *5C8B6087079F90FB51A425F804590A571F5807BC 9NOITAICIFELAM
889,541,778 *5C80A20D3788461CF9568E42278D4BAD7F4174A8 [email protected]
889,541,779 *5C8B283F3EDE21EDD64E79C5BB2102E0756102A3 bornwithnothing,diewitheverything
889,541,780 *5C861162C9450287625C8F2875B06B081BFB4C5C 9thatroni1
889,541,781 *5C827B6679CE6A36F1A352B158607DFDF6FDEFDA bp+gg
889,541,782 *5C8E968BB51975230AA3B0623E845853F3DC6F48 BP!J)
889,541,783 *5C85E66893CB72EE39EB4C287630FF24B9B1F87D BPT/
889,541,784 *5C85F36D3A445E2A0D01600898AA1A000D944616 BQ0OR
889,541,785 *5C808146B2025D61BBC0388998638151044F9BE5 b)(qh
889,541,786 *5C89837177BF04587F07B4C97AF581DD0F5550E6 BRADLEY855
889,541,787 *5C85D5DE5002D5CB11D63A6CC46D14EFF8699637 bradleysteggeman
889,541,788 *5C887147F5A2A386CB932EA80DF0F88400FC075A A4GGO
889,541,789 *5C81B310B07F8A0FCBF17E50600E177F7792A576 a-6n
889,541,790 *5C8E19AB4CF0C3FCDEC38C46C2B8F4533CF9528A BRENDONBOYDURIE
889,541,791 *5C8DACB343138883DCA94CBCAA586B5BDF02E6DD A_+7O
889,541,792 *5C8956D53760FC528FDEF962CA17021E4C231F23 BRITTAINING
889,541,793 *5C8CB60F243DDE661081A96FCEE3C98BE4CAE917 BRITTANYWADDELL
889,541,794 *5C8B1D3D51E53FB4222023518618E3BA19EA0F67 BRITTRISHE
889,541,795 *5C833C82AB3FDA70436F198E63D01F35C36C82D9 BRKOY
889,541,796 *5C80DE4851A42F223374170ADF14F8F53679A564 aaaj&!
889,541,797 *5C833730CC6314F3746ED836603989155769FF74 BRYCESCHUBBE
889,541,798 *5C8F80A6AE6B8A4750F140A2A8102C430D1E644F BS3B=
889,541,799 *5C82934AEDCBB45EB29E8B38AAC27D9B422A46A1 btofx
889,541,800 *5C8DAD2D48F5BE0B5641E0540D6EA7662A8DC0A7 ABCDEFGMARVIN2
889,541,801 *5C805C72EB1CD5588FAC2B90F947E3A97A0C3DC3 ABGESCHRAEGTER1
889,541,802 *5C8315538EFD8A3174F39156A6DBEAC7BC81E435 abigail331
889,541,803 *5C85E9EB953FDA1D1B622A26C4AAFC84770BA24E [email protected]$
889,541,804 *5C8D7C8E990DC239447DCB34E3FD025FFA065295 adolphbresett
889,541,805 *5C8F9D47431C6388C32D58C888424A31D8051025 ADOLPH.TOMASELLI
889,541,806 *5C8042EB718510257B363C7C38EB00150DFF67B7 ad*p
889,541,807 *5C80EC4DB1915EDFEDE7F3F443F484F89AF6D90F adventistses
889,541,808 *5C8E213C9C73101B37AA23B7943A36227D5F0F89 [email protected]
889,541,809 *5C8A75DEB5FC0BF73198CA08E7C9E17ACD47B17D ahmadbreakell
889,541,810 *5C8C3FC8FBEDA73996E352F32E64ABCC191A450D ahwwv
889,541,811 *5C8B6D98DCAB887A93BD605BBBAD172339241166 CARLTONCOMPARONI
889,541,812 *5C8738EFCC5776AB806807C2845B68CB9CA6B0E1 aish-bebo
889,541,813 *5C8C6114EAABC6F5D4C15DB9CD2542C64EC59964 carmenolivarez
889,541,814 *5C8E67CC155FFEAB7014980B2721F3A6B1B82BBE CarmenSuiteNo1LesToreadors
889,541,815 *5C8ED511E772B41EE8432AD3BB374361A95B77BE [email protected]
889,541,816 *5C8EC7628380B4A623AC9EA3B54F7DF13B671CC5 AJRLQ
889,541,817 *5C888D4834D8BF1DFB22332D47323BF45CCDE97C CB1DR
889,541,818 *5C8F10284AD235B1B4AC51E03DD3C4BFC68AA4F1 ALCXRUCVS
889,541,819 *5C82B1847DA2C20FC91908BC6E897A63AD11D83C c(d)n
889,541,820 *5C841744BB6D383EC5657AD9C9BB64196BF967B8 [email protected]
889,541,821 *5C8DCFA4C25A5FD44E5AA13BBA4978DCD6593EB6 Altar.Boys
889,541,822 *5C8C7CD4E96B75567792DD4BF8C207E0F9A6758F cf6m
889,541,823 *5C806284F45C242083C3FD350DABFEDE44AB033D CG$W
889,541,824 *5C86C72AB2D0620F9828E4743951C86B11B35B43 chase.them
889,541,825 *5C80C706208E61CFCACE99C718A5038075DE5754 [email protected]
889,541,826 *5C835391E81987CB8ACF7B4397638FD261B3D2FB chickenlayinganegg:chickenlayinganegg
889,541,827 *5C86126792BADC6067F9BDDEE393D663C3EB3768 [email protected]
889,541,828 *5C836F57C81D06630637AE8AB2B79FF2D1907158 chk9c
889,541,829 *5C8A0EDEF3A6AF0E9477B0342EC0518B93E69A35 chondromucoiding
889,541,830 *5C88410E53F26FDC2C8177AC47748EBED3F81252 ANNIIEEMM
889,541,831 *5C851425D7DF6E6B4619C7AD1BCA2D7332F2CF55 Annum-per-Annum:-VII-Coda
889,541,832 *5C8B359980C1A9C549597B2789D64866173D9D4A ANR2
889,541,833 *5C8257CA49D611C81782C26CC4DE8A008826F8AA anthonypisegna
889,541,834 *5C83D245C24DC82511365A58E54517601BE00D61 christopherolaughlin
889,541,835 *5C8E25BC8E1FDA99009EB1A9082C9F4335EB08F2 ANTWANLEWIS
889,541,836 *5C8FCC6D4B7596CE09BC417B71C29E8FBA679157 ck52m
889,541,837 *5C81A536DDFA80AE3104E269570CDF0B83AA39AA ckab3
889,541,838 *5C86E734ACE6FD0553E2125FA4950DF054CF784E c%kek
889,541,839 *5C8C419A292AD589DA6893727EFEA00E19C19F0E clencheras8
889,541,840 *5C811D1DBF5F3199D5CD7D198A9B3A01028D33B0 argenter
889,541,841 *5C8E5869AC25ACAD74F2B19B7EEC43BF9912A4DB clevelandlomen
889,541,842 *5C824CF078A09D5E3E0BA146F2C3D29162DCEDCE CLHKK
889,541,843 *5C8E44F504903E2DDED66D8E7A74138B136E941E arterialized?
889,541,844 *5C865C46EA968B6F798D8BFD7E7C3824F2B129EF COLEADLER
889,541,845 *5C8A75BC6B0329D6267D7E09FF6034609C6DA615 colewort
889,541,846 *5C826C69639ACE00A07EEEF5CF2A36D099C5E5F5 au&b$
889,541,847 *5C8589D71AE7082BEE6A865C29447B04F6A830F4 AUG022007
889,541,848 *5C82A3DA650B312DE936F796B9FA004BC925D79E CORDL355
889,541,849 *5C87B3B9407075C37C31E901603A04E22C4A83EE C_Q=R
889,541,850 *5C84F141EA2581F036C9A233335B2DA12B8E508C AZNRN
889,541,851 *5C81B36299189A619905CA7A806E3C2747796AF5 C-RN
889,541,852 *5C8F19A7A0664FBB35AC89F738A7C8DB6ADF8EEB CRP!+
889,541,853 *5C8E59E70E9FA030B287DFC052D5DC745894B579 crt13
889,541,854 *5C8A21F5608C6E43F26709929F0C591FFCFB18B1 b$1s
889,541,855 *5C8FAC40F7F9AF612AC93F4BA3FA8CB65795114B B:2H
889,541,856 *5C86CC0692DC814C4FC1DECC2D89750F692B370B b2ybu
889,541,857 *5C8484A6ED6788939FFC210CB507DD816E50C565 ct7g&
889,541,858 *5C80F9C64580430F986224322E0AA3F28F37F127 ctlid
889,541,859 *5C8DC43ACF4CFB24FA9867D2DF6488EC1418F88F cuk_?
889,541,860 *5C8AD14273E33B1E19A5B94533CE0022F9112D5B CULMINACI
889,541,861 *5C890ABABE0FCEEE14332E14B95882BECD164EA3 [email protected]
889,541,862 *5C874BF84453B67D7E4591401657238462511E8C CURTIS.LEDLEY
889,541,863 *5C8A0E894D2B498CB62FB60013387C9379D33146 BACCHERINI
889,541,864 *5C84E726C10C8BA742857F3FD7F97FA69C134A2C c-%x#
889,541,865 *5C820601B3F40ED1E3F827ADA88F906FCDBBD20A CXmK
889,541,866 *5C8B1924AD6B1B18E7BCCD7E42C71F42983EF73B bas3.hit
889,541,867 *5C8E7D1AEE3388AF2E1DB5F415CE305319877A6E d05;&
889,541,868 *5C84E53BB13E6D92BA1AAAB93B141F53F742849A [email protected]
889,541,869 *5C8F30F315A126C8EADDF989B5F9F0C1442143ED D3C#
889,541,870 *5C8C1284C77310DFDEF1806ECE7CF765FBEB1050 [email protected]
889,541,871 *5C85DB1BDB11AF6B32F3BAE131972D6DB40F8A30 BDY+N
889,541,872 *5C80964B8DFB959ED9641B307BFC34BAF15DF046 BEIt
889,541,873 *5C850B019E02C11773FDD6C53412D3015F5B53F3 DAC#W
889,541,874 *5C84DDF3B4DA7914D439A3764B43AAD643007587 BENKULENED
889,541,875 *5C8E2AA3E88EC39633BB0D366EFFA875FAB99C74 DA-LA-VUELTA
889,541,876 *5C88114D05FCBE6502E5494C79FA3E9E406B27B8 BERNARDSHONDE
889,541,877 *5C8D2AF3E78A33E19614DBA2FF009588981020B7 bevolktened
889,541,878 *5C854859BDE1E21073C189236B2EEDBE62BD39B6 DANNY-JIM
889,541,879 *5C8395CDC13886F299FD7454F6A23267863D8FB7 BFRHW
889,541,880 *5C8D2B08F51D0AFE7DB014FB1BA42BA00DB1BF12 BGQZSFXSWPHCONXWFA
889,541,881 *5C85D3D62A717FBD27D683CD8F68A311EFB974F6 DARRYL.TORTORICE
889,541,882 *5C8211A95B833E54842CEB6724A7775818F2055B D_ASC
889,541,883 *5C8BC84E0E80888E37B1E40762092A34C981D6DD BIK‛AT
889,541,884 *5C8E44C20CA480E176D4D7176CFA7398FADEC7FC BIRDS.OF.PREY.SERIE.DE.TELEVISI
889,541,885 *5C8DD61747506C1094545A6B80068EE72CD7FC7F [email protected]
889,541,886 *5C83C7CC5058DB9CEC40D307C821FEC04DEF07D8 bitorias
889,541,887 *5C8658AE0D9706CA79757BA669A98D44812C5704 bjvv
889,541,888 *5C8776E290D71C5C3FBB886849C9C73F43BAC180 ddlhs
889,541,889 *5C810B32AC7D996152245078B2285174EAC2718B bleedingorchid
889,541,890 *5C8572FA1C915A48B92C4266C85976E974C87074 defavoriserions
889,541,891 *5C830F68797A215CE81E1F605533089DB0BF88BC DEMERITT2
889,541,892 *5C8ED57ABCB54B3E06D5A683BE5595B5D7500A0C [email protected]
889,541,893 *5C80D5AA2D508D1F85DF9A92D246EB64C3B904BB BOOKERDURHAN
889,541,894 *5C8D95567C3EC06545D6129B74C2B9CE9AC24052 DESTINY232
889,541,895 *5C805162B043024C7D1B094F40DBF3F9157A867D DEWAYNE.WEDIN
889,541,896 *5C8895D0BD22256AAB48DB8ED4E8C9940B0DF096 DEWITT.PINET
889,541,897 *5C8600AB28493B33D42DA3F43529079A7B99DC8E [email protected]
889,541,898 *5C812EAA4CEE63F42516425C9D2719E622A4103B bq-bw
889,541,899 *5C8965A477F4D932AA542EACBF66CA840A4B44C7 BRILLIANTBUTWHINY
889,541,900 *5C881AF7601F2D5E09F556859250F334478D3B95 BRING-THE-GOOD-BOYS-HOME
889,541,901 *5C8EF43FD8721678610B3451A31CAAC89AB4984D [email protected]
889,541,902 *5C8F93407B156B05F8EB03AC03B57EC495CC3D92 dinomore
889,541,903 *5C88DFEA69752328AF55A424AB78E27764C6E2C8 dipum
889,541,904 *5C8F9653E1C8652FF3921F344202F08866E9AB6A BRRQ
889,541,905 *5C8AC9C196F75597ED63AFDC48BA2788B9B21064 DKjv
889,541,906 *5C88B5A4C6AAAA71E09B8FF9C1357B195464CCFD bti6p
889,541,907 *5C88C20B31443F7E79B6D517A9983FD0EA325936 BUF=G
889,541,908 *5C86E23316B9BEA50E140D6E7666E2408C66175F Dn#m
889,541,909 *5C827F6F833BF4DC45DEA2E25C30D2BEB942D819 bus%x
889,541,910 *5C83D7954791191A57FDD5D74243B08DB3E46A7E dodgers-infield-shift-ensnares
889,541,911 *5C8B9212C7FF2BE7B75547A20D64FAA14EA93324 bvyne
889,541,912 *5C8C9F33E16304AE257C37346009CE2980FEB821 B)WKO
889,541,913 *5C8EE694AF93003189988291ED06E6B8ECD4A504 BYF+Y
889,541,914 *5C8812470D71F942C98418D9BDCA3584C757860E dor2m
889,541,915 *5C8BA07D709C2736D78F5E2AE8EC94C9BA12A1E4 B?ZP0
889,541,916 *5C8BC227CFB3CC13F42A3EE9AE592B283DADFE1B c$;=
889,541,917 *5C841185D1C91DF7CD198AE0109505D72461F548 D%P_
889,541,918 *5C82E9B90209A8645F3893579F9D46603007A6E3 c0rv
889,541,919 *5C896C665D6900699EBB9FE59FC59552A1BDD305 d!r7u
889,541,920 *5C8BC4987E187CF4A928AF2457B5D21F9785503C C&6VF
889,541,921 *5C88B7EFD7D5404D7367541098C86D40CE7055A4 Candyman-(feat-Franck-Black)
889,541,922 *5C8A743D9B77FCF4A7BF3094328DFFC222F6B093 DUALBERTU
889,541,923 *5C8A1886BFFC21A945596AFE6AEB0988F48D794C duanechastang
889,541,924 *5C80576DE110733FEC10843C036476138B5FF8FF “DUHOVNU
889,541,925 *5C85210648F2619B812DB578853944DA1AE7A6EC [email protected]
889,541,926 *5C8DC680DFEED98120576C766F8CDAFB7699EE45 CAROL.HELMIG
889,541,927 *5C81702CB6B3E297E9CE0C6626B45F1E31FD57D9 DUTCHES5
889,541,928 *5C8388732186FE78AE952B385A9B179208AAEBFC dv2fx
889,541,929 *5C8BA14D4729E9548BAD9E9668EE0FDF3AB308F6 dwamyngged
889,541,930 *5C8052B9AD7A444186F15C45B1EDF9A6CBC7BD32 c.desambiguacion
889,541,931 *5C8A3F0CAE562510AB1A183C8FB30F3E78753512 cdma标准族(
889,541,932 *5C8C9D9DAC29864F017D1A7F520D0BD92B6B7CA1 EACQI
889,541,933 *5C87C716CDCB6FE61994AB8C4C244348F47E2876 EDMUNDOLORKOWSKI
889,541,934 *5C8481DE8A74F5EAAA95FA9CFF716727E5E89841 CG$W
889,541,935 *5C81A5FF07A772557DBA481A5F7B02085005E5D0 ch;
889,541,936 *5C8822636ACE967731F47160C7976E97883478AE eetroont5
889,541,937 *5C824BD9E4CECBA651359DA735CF4D38C8D0591A charlieweyers
889,541,938 *5C8B9488A83A584222CCA8C4ED5277FAAC10E58F EĞRIDE
889,541,939 *5C877D6B3852CFF76B09406AC054ABC1708DAF57 egt:
889,541,940 *5C84FBBBDCDF3D48447303287C1FC8AEC605106D [email protected]
889,541,941 *5C861E1E5B554B6641C00522F7F026D391A0222A [email protected]
889,541,942 *5C8E8E9CE6DE97A1EE6C50DEC0224BDB4B9FFB2D ehog
889,541,943 *5C8285DA85CB65421870294AAEE4537B414072BA [email protected]
889,541,944 *5C8109039E4F517699E39F6A1E1C630A930CD335 einealpensinfonie,op64,13onthesummit
889,541,945 *5C8413F134BA8EEBB83A58F4346D5C83F51B6CD5 CHINCHIN-RAMOS
889,541,946 *5C8688B74D59AD9D6DEE969C1DC82FC8E938C381 CHIPITRE8
889,541,947 *5C8179881E70A760FA51796DF5B232FDB9B2AFB4 chiquitapeanut
889,541,948 *5C8216C4EE5EBA606A8A2D49C8D973419AA03505 ciara-mccarthy's-lullaby
889,541,949 *5C84C0CB41B3290616E44704720AF97E0272F0A8 C.IN,
889,541,950 *5C8152FBAAC03AFEFE3B07A4804DF869CCC29B7D ci.vb
889,541,951 *5C84CBC1662A45FFF3C82FBEEAB879653F963752 cj)b/
889,541,952 *5C89EE7AA51FCFCD569B0199A4DCD71B4F657AA7 EMIZENOO7
889,541,953 *5C80A22D1DFEC220F19BB95DF03BD0DE90AA51A6 clairvaness
889,541,954 *5C887350E03F5379EC7EE94A60A2A385741EA023 class="genfreestyleul"><li>Partner
889,541,955 *5C86EAA038000A082171FB551E33B4A1CC515023 claudakery
889,541,956 *5C859BF9C547A47046F9DE113FB0D6CF5EF9D25B CLAUDIO.HADDOCK
889,541,957 *5C8333E781B26A82F5B53A6BBF6B6816A56197FC ENANKIT_MODI86
889,541,958 *5C88B1882EFA99DA4B3A4E272B4787F1AC83C1A8 CLAYTON-HILLMAN
889,541,959 *5C83577D06CF5867782978BD3718488EF57BB45A CLEMENTEREBICK
889,541,960 *5C85639E404193DCFE7CED89ED0F8A78FB2866AE CLEVELAND.AZAR
889,541,961 *5C8FA2766221141FA36F562DEB3D8B77EB47B4A4 clintonbrookshear
889,541,962 *5C8D316CFB91E626E650C4A8BBF18391F474F425 ENTREPRENDREZ.
889,541,963 *5C8CAD0DE024DBDC0A39ADAB1A760CC0D250C05F epilogue-notexactlyreinventingthewheel
889,541,964 *5C8376CBCB65510D6E43F02577CBA4492510AD53 cmdlw
889,541,965 *5C8B06F031FD7E69FA0242C3AA5DDB5F9C9511DC erichselzler
889,541,966 *5C8C1402E00DAC34859F4FCF49FFBB320098DEAC ERICHSIEHBBS
889,541,967 *5C82ECCA35A94638A647293A9E3A16EDDCDA7DE7 cnrl/
889,541,968 *5C84260D0E1CEC2F3BD38CDB9372DCE1FE6E697F erinmaccarini
889,541,969 *5C8EB8968B3A3F12CF13F633330883E666F96A76 ERNESTNASTRI
889,541,970 *5C87E58FB78C59CA5C5BE94014376E1BBCEF8D9F CO1N7ENSE
889,541,971 *5C807834324197348491B0E6B0FF8A4C0CBBDEC7 CO43:
889,541,972 *5C8BE0041FC703E768954320DF27DBA56516188D escatim
889,541,973 *5C8F3FC8370DD42D3CB9A83EC52044198FE87BEB ESTUDIOS SOBRE UN TEMA DE MENDELSSOHN
889,541,974 *5C8305440CF32581C170618EB79D1CF41F0E28BA COMO.ME.DUELE.IRTE.PERDIENDO
889,541,975 *5C838A491F4669233EC3A040A55A264EA3136ADD ETHAN.HIGGASON
889,541,976 *5C8E13A6A889B0FA30CEA1B17623142E21A21FA9 CONDOVERED
889,541,977 *5C85DC7F284ADBA7D22813C8D9A08CB2F9C0B255 euripidean
889,541,978 *5C8B754B8647C0A18E812B32B134BF0D8E4B6567 evangeline-arcega
889,541,979 *5C88BBCBDB0CACE9CDE15F5FD82453995799F194 EXPIRERS
889,541,980 *5C86882A81E671E7AD658A38F668B65D0F7C4382 EYES6
889,541,981 *5C82CBCBADCB7BC7D0BF9A8A86147894D38FE43C CQMFU
889,541,982 *5C836CAB970B573152AFA8E3AABAA41476DDF16A FAITHBREANNEL
889,541,983 *5C88436C7A97C3C3016A22A398A476394EE05955 CRIBANADA
889,541,984 *5C8424593EE37346DA24341994900D958046522B C-RN
889,541,985 *5C8F2D6ED237AADD7E2FA39B2957E105443AD8F7 faye-worthy
889,541,986 *5C8D81BA6018A10550C400D9B1F392FBC9B32CB9 FAYOTERSES
889,541,987 *5C8074586AB3D6ED1B8770B337353BFF99C5F1F9 fedifedi
889,541,988 *5C8C1411439CD3B98328C5BE55DC1EC6A5A27C93 FELIX.BIRCHWOOD
889,541,989 *5C89C520EDD047C3D879FFF3CFF2D38897C8707E c_smf
889,541,990 *5C8448E1DA5CDB2D1027375C1373656817E1B768 ffne die siebente t
889,541,991 *5C86857BA4894593C78CB77C7298EF5E2BED7C6B C#T=W
889,541,992 *5C8172C1671E15990287F11130B060E87B9E2D64 CUf
889,541,993 *5C8E0CF9F9D29D7CA77E6688A7D82A3E315B6B09 findbucheintrag
889,541,994 *5C8F3CE1D8F70EDB99BE889FF8CEB4B1C949EFFB f_k
889,541,995 *5C86C325D1DE1810D7F6460EC5E82F1C554132B2 fltiutj55
889,541,996 *5C86F6B1710F24258BADC14FE121DD69A0A76AAB CYRUSJANTZEN
889,541,997 *5C8C817987E35EE41EFE538E445E48104551CF1D fplanquecomfplanque
889,541,998 *5C8324969DF2B2239B8A54DFBFBAF02D7284CDFB cz-x0
889,541,999 *5C87F7E4E1D453BBA19EC81619093023F70CFAE8 frankbranek
889,542,000 *5C807C6C78750A6150E42CC3DBFF4C1C9E1E6D76 d2rca
889,542,001 *5C8C74897D6E0F69D661DFCF4CC9DC6EF860BE2A FRMAREUILCAUBERT
889,542,002 *5C895893CA01997B672037074B26ED77D457267C d3pp_
889,542,003 *5C8CBA669D77B53AA342C2F30152BCF1FA0BE62C FUKURJII-SAN
889,542,004 *5C853B7724C21B40D1E43702441ACE2ADF9E2727 FULLSPEED-FORGETMAN
889,542,005 *5C87071E05563D719E92E26A6A71705620AFD5E3 fus71an
889,542,006 *5C84C75D3888774CC127CC30214661AA17F08401 fv104サマリタン救急車
889,542,007 *5C84603AB1A5AE280F04419FFFDFB9AA66537695 garlandmirman
889,542,008 *5C880BC64BED8C46DD9AB76609AE3E41664CFC58 danetakahashi
889,542,009 *5C8FBA83B821342B8BA4EF986B36465A616FB7D7 gbadebo2
889,542,010 *5C80B66E5FCE6686DD8E8284A698D8ADD210713D DANNIE.MCCARTIN
889,542,011 *5C87EB2D06A58EBCF41186E9FE801A93D64BD3C5 DANNIE.MERVIN
889,542,012 *5C89D33F9EDDD1B09B6FF97084EBE46ACD2285B0 darchir
889,542,013 *5C8C40D9470354A30DAEA960D2F714B2C4407313 germsandtheend
889,542,014 *5C8C3333AD6C7D43696A7E00DC1F96F8DBE1B0C0 DAVIDJURAS
889,542,015 *5C8C1EE0A76E8744E0F61ABA4835D5948A1B43A4 DAVID.SHAMES
889,542,016 *5C8CB08A9D36044FD894D4AA3C49633FCF3DAB40 g#ii
889,542,017 *5C8CB8CFFE3EF59E2184267BAD3935AA05A8CE68 GIL.RICHBOURG
889,542,018 *5C8376B9BE05EE0026AA0306267E435B45DF1DD8 DB4RL
889,542,019 *5C86DA3F8B6A59BB32B256C705BF0C3DF73FE6F2 dcw1i
889,542,020 *5C8F3B361619C5D3433606D58C0C90D6918DE9AE GOL3JR3IS
889,542,021 *5C88506A142F80F36F1EA21BD0315E8600FDB1A1 GOLODRANEZ
889,542,022 *5C8AE793F352E84DE117FF7FB7F55EDFA0D2ED81 good.news.from.moscow
889,542,023 *5C82704578FD5F2B8BCC898CF9DAD4DC9C1C961B goodnight.fox
889,542,024 *5C8FF34A86F4234B6B5F8344DBDF8DAE7A8A9646 gospel.treasury.(disc.1)
889,542,025 *5C8FB4CE4C61F62D06FBD4F26D4A154EF00E2E45 DEBORAH DAHLEN
889,542,026 *5C8B7B4D47DD06782B6664E7B643C1E7537A7EEC [email protected]$$
889,542,027 *5C83CB0E2EA722E9E022E51DF01AC7FD4DF34A16 gradymanozca
889,542,028 *5C8EDDEA57E4DCC40C57C86096DCBF2A1DD35C49 deepforkretrieverscomwww
889,542,029 *5C8C7635EC18F9015F6A3F150358163B1A83E894 GRANDE-CTE
889,542,030 *5C8346BF447EC3B31E339251A822B38F7F240F9B défaille
889,542,031 *5C822400DED1A524A731815840BB3817D4FAEC75 GREGGCASTOS
889,542,032 *5C8107B601B6D1FA44A2DACDFA2078024D92A401 delclift
889,542,033 *5C8202AA533AE01E37427692345408B4FC2F85D2 gremo
889,542,034 *5C8CF04A0D98627D9C515787C3418F6263A33FC4 [email protected]
889,542,035 *5C81A456A34DD14F4F7CAF10CF0F6C8BBEE49DD9 denoueront
889,542,036 *5C8835C60C22A9409D9D6152B2C921118CBEC496 d"f!y
889,542,037 *5C8DEAD41F5EF5CD1D63140029F986BDAB5A5816 DGHIA
889,542,038 *5C8EEC62E551E64AB048251F5AEA0F5E7EE2768F dh+_b
889,542,039 *5C8A8033AE97BED749B0563509615CBCFDEB78BC DHCVY
889,542,040 *5C8FAC5C2F825621E62CF8CB8B8F920FA506C41D dhodhried
889,542,041 *5C878A98444A3A7C2782E345C60BA7128C83CA48 dia33
889,542,042 *5C8C245DFD29EB415E72295FC5A6664DB6CD4DB5 DIE-OU-MAN-EN-DIE-OU-VROU
889,542,043 *5C840EC152E5F94E5E39A61B35774535BB0FB3C9 dieuuocsaobang
889,542,044 *5C855FC397B73EB90447D85014A7B4A60D677ECD DIRK.MOOERS
889,542,045 *5C83171A321F32ABEAD8E3CCC5DB186B189B1139 HEIMELICH
889,542,046 *5C861DA364ECC2AFBDCC5C355FE990ABAD1D9830 dj-7up
889,542,047 *5C8044E6CD5FC63C006DCEF9D943A3F862C50135 dk_/"
889,542,048 *5C88A4B765BB6CC409D17B779AC3A339D1A9F42C d=;l,
889,542,049 *5C8549D4731EE264502D547B199870F63F15A3BA DL3Q
889,542,050 *5C81B5F436C79E5C3FA1F90E63DD9EB32D7A36A8 hkz[
889,542,051 *5C84E3CE25B54843454DFF8FC80A04F036A27098 hloubili6
889,542,052 *5C8C5773A1C50EC97935CDCD0F63AA7EE9B2D661 HORAVEDAED
889,542,053 *5C885856CF8E0D76DE060E099AB0B320170EF7F4 DONNIEKULPA
889,542,054 *5C80BC88B85AADCA6A15450D1EA851328B1BB6E1 H^P
889,542,055 *5C8A85B44ED0881FDABFE7682870FE63CA9BC00B douglasssiregar
889,542,056 *5C8F22DA8A14B27F6B12F9BCAD1A0757843167B2 (>-<)~D====P
889,542,057 *5C8B42B2E82AF7C8AE2A4CF65F4DFC6D259E5F55 hyraxeshhay1rae0ksah0z
889,542,058 *5C800DB219F8B3D07312E0A03D2FB84C29FAA9F5 drika-oosthuizen
889,542,059 *5C8EBFC5F4BDE8F9B9BC48DB269F05CA25662DB8 drillsgt2
889,542,060 *5C8DAE261F92D3005CE9EFCCF697D201FDDFBFC1 ify>
889,542,061 *5C8857132ED69399CB3F22DFA8E802DDC676328D DUDETERRY9
889,542,062 *5C8D0EBD3B0AC1CC341B0A5C682BB52D5DD11DD5 DUENDE DEL AMOR (DAY)
889,542,063 *5C8FAF8D46537BE9078E269833CC6AA07D0F964F DUO+L
889,542,064 *5C8BDD694E9798A6F683CA6A0EBB2A3981B4454E ILUMINĂRII
889,542,065 *5C8C6157D6BFD50A56675F78304C0968365EA940 DXWJM
889,542,066 *5C81A00F5B497C308D2FDA897AB6FB8189B15126 ingmar.for.the.beginning
889,542,067 *5C8B924F3FA43C2FCA71432A7BDEC2FA70E5B510 in my nature (feat. eightball & mjg)
889,542,068 *5C8FF3113FDB51B163382121484422A04AEDA83B EA!u
889,542,069 *5C8C0AF82DE7A4DD17382A0B7DAA6AE45904B569 iq7v
889,542,070 *5C816E745158591CEA9D6743714F36D18EA3B643 ED0Q&
889,542,071 *5C8ACA9E0FA2011EBD50DFB3B912A9453D7E8864 IRREALES0
889,542,072 *5C85B6EF45DD20CC095A160305DE8C0C0AE0CEE0 [email protected]
889,542,073 *5C84673038AB49E6A47817E844D0EB922FEEA3AD EDISON.KRUS
889,542,074 *5C840A22FF4F557F09D44E189511836932BCB5B0 isaiaspyatt
889,542,075 *5C89C286F638B5E08F3A6143D59FE069121663E8 isashcoh0
889,542,076 *5C8596723110D6A6E9BE6CD1412B69BE8D0A669A ISICASNER
889,542,077 *5C84DD282D415C1195C3CF7EC0E66A86E8D94374 ISRAELARBALLO
889,542,078 *5C8137642AC117EB03B7F359F54238F7FA631808 edwce
889,542,079 *5C876EB9C8494777CCF80EFCEB80075298460C9C EFORMENE5
889,542,080 *5C8B1B5802A965AEAF899A6BE344E8E7551AD8EA [email protected]]z
889,542,081 *5C807A3115E0F32F144DC9D19F38D38D23F13044 EIGERIN
889,542,082 *5C87AA6682003C0A12E1ED17B48E8FF6346CC22F einnocam9
889,542,083 *5C8B348F7E2ABAD4EA693B580D46399C116CD429 JADE.WIRIHANA
889,542,084 *5C827335B096A07C7828F6CA449700E4DD93B020 jaekuch
889,542,085 *5C81D091F9FBEEB6BE42ACD9F94F7CDE135C15F3 EKCAWYARG3
889,542,086 *5C83E812B2C9950B2576C8E546685F0BBDF4F2C2 JAMAR.LAUCHAIRE
889,542,087 *5C83B535CCBCB986C7FB358146097E1CB6987871 JAMIE.STIMPSON
889,542,088 *5C801750F1C35A130D5D3DDD0B210B0DB9F73FBE janaward
889,542,089 *5C8ABFC7110DAC7C963D6F75B4FCBED01D6AB752 jeffreystarcher
889,542,090 *5C8C837E103703EB55FE7A7B0AE843CF1A026C89 JEFFRYZIEMSKI
889,542,091 *5C8189046ED3E99D436D063E2B1D253EF0722B9D EMIYCORG
889,542,092 *5C806C03A57B38933B5DFAE92572E13670DB592A JEREMIAH.DEGRATE
889,542,093 *5C83B56869D26F00E57679949382DB743AF8BB87 em%of
889,542,094 *5C8DDCC245A2F2E2F9FA41C307EC2C73059DA379 JERRYNEBLETT
889,542,095 *5C81D095BD5A3EFF925A6F0491CBAF0A35AC958B jessedady
889,542,096 *5C8FB0A49D99FE13F81BDED9744073D89FD80A84 JESSEHOOPII
889,542,097 *5C8AD8352AF94E26303122EC7ADE9779135358D0 ENIMALYB6
889,542,098 *5C816EA7420F5E2B1DB2F88D2D093DC92AB6CD04 JESUS1GONE
889,542,099 *5C812C16B1E51BD821E338603BBCD2CF77DF51BF JEWEL.CHOL
889,542,100 *5C8C542801F819BD6AABB631B5EAD71601730733 JHAY.ANN
889,542,101 *5C8EE1470F24EEDC00B33112BCABE3251632AEC8 entrylisttitle
889,542,102 *5C8F14AECDE840CBDA6DD5621A9B7A3EF56A2EC4 [email protected]
889,542,103 *5C85D7FD6A5E2D7996CA99EC576DB7ADBF2A6BA3 JIMMY.STUTTS
889,542,104 *5C8A64EA8DA028665A57304877F89A7DA54D12A6 JIM.SUGIMOTO
889,542,105 *5C8F8E1029F4E21D0519A3F01ECF92124D5E1218 JINNQUE4
889,542,106 *5C8B4F11B4FF0B294018D14F7F4E73849B732E8C EQZLH
889,542,107 *5C86E8D817DC0E9D3B5F754A1FD5F2D3CA875B1E joefioramonti
889,542,108 *5C8885F0D2AF810296BA807FA4F0E7EB6DA674AA ERMITTLUNG1
889,542,109 *5C8E1EEF655D8FB220D90CCDC302D65420C3A2EF ERROL.DYSER
889,542,110 *5C809D03917CE11C725643EE84BB4CACFF5E124A JOHNGAJATE
889,542,111 *5C8486122A45E36A0593562DAF68C4CACCD930A1 JOHNIE.BURSE
889,542,112 *5C835207B293685A4B6C4E31164571A737687BE5 JOHNIE.WEBLEY
889,542,113 *5C8FB346AFD76B22E6CDA2942F07EC18C4191A43 esb(4
889,542,114 *5C8850E0F6535064A0B093AFCF495CC4BD520657 johnstrozier
889,542,115 *5C8B7DD3BB46D9A37EA615D520EE1BE29497FDC1 jokohama2
889,542,116 *5C8EF3004D95E82DB58BE72D1AFD1C9C221DF65F [email protected]
889,542,117 *5C833BA9D033757E73C6BBE7883C970F9C08A9BD ETTERFULGEREN
889,542,118 *5C8F801E8607C097A1B2DA6F272EE3C66A0F167C joycepascual
889,542,119 *5C83FC781798DE8FA2B352CA4072E7722A4820D3 JULIOACCURSO
889,542,120 *5C8643B055E75DDD053BD49EE576484272A52DBB [email protected]
889,542,121 *5C898A09D17AB22FD8AE1B0D27CE6D4C637B1DC2 exigncia
889,542,122 *5C88521F4D20C2CFFA5B8F064B8A8E96A69A2123 justin-kuang
889,542,123 *5C8D67C76B074E280AE84EF3C611F3A3D972AA32 JUSTWANTTOLIVE
889,542,124 *5C85C1EA22FC9B8C5A61FEF1B243236270CD6256 eyhsz
889,542,125 *5C8F76A601BDF04BBDC08F16FB61168C3BC7D1B4 [email protected],
889,542,126 *5C8B703AEAC7A99D6849676200868A22F0300B87 KBMCR29
889,542,127 *5C88600503C2A29BB1B1CC7DCA9BC3CB878F386F FELDGEWÄCHFE
889,542,128 *5C8029CEEBF40A48924D39CA4DB67C0568DD2F8B KCISAES9
889,542,129 *5C8574480D0E391EBFC086ECE185754764286CC1 keenanwambach
889,542,130 *5C8D2D84823398D6BF11C40000C4A0374DAB92BD KEFUSS
889,542,131 *5C8B814D270C380829A752377EFE97BB5E5B0020 [email protected]
889,542,132 *5C82D86B2073F5F2DAC6A188CB750E7966D78370 kevenriveiro
889,542,133 *5C8FBA0EFCAAE28F6C09DB78FAC2BCD1AB97F10E f_k
889,542,134 *5C88B9797455AFA6953CB5B97007E5C5F42A2DF7 KICKUPS
889,542,135 *5C828ADD7DD9E65584FD01D0FB206DBE11AB6D57 klk.manito
889,542,136 *5C83EDDAD54E80D5D63F39812E9A4F1BEEECB180 francesmckenrick
889,542,137 *5C8279A4152AB1849AF4B93053392EE9990421E7 francespowlen
889,542,138 *5C86B0AA80DC86010708AA017BCC91223F777EEE FRANCISCO.ARBOLIDA
889,542,139 *5C85B505895C1FD8401266A69515BF6B1C9EBBF6 KOLOMANSKAPELLE
889,542,140 *5C8B37CB351756BA20D9D719AE413EC2B4379F47 kosakken2
889,542,141 *5C8556C446F8971ED725720CB355A22067CDD88F FRITZHEINANDEZ
889,542,142 *5C8E3F406F575E042AAFFE86FC233FFE47C0917E f~ru
889,542,143 *5C838A65E66BD31E04E263CF25DCB8E2E5D38D67 kskosten7
889,542,144 *5C8C1033BAAAC0E3217AA51B6792EE19746974E6 K/W~
889,542,145 *5C85BAEC329260D6FB86DF384796DAAFD546B17B l3p+0n!c
889,542,146 *5C8BF8A3E206F297046576FFF9117E87572192C7 &ladaabaorchest
889,542,147 *5C855D51826750235444D4C280B7692F1B191C0B garrettshawn
889,542,148 *5C86E6B1CD217739FAF1D20B120C68F05D3F7864 LATE20065
889,542,149 *5C85BFBB72A3F34159C73DD8E8F9731310FAC302 GENE.PHANTHAVONGSA
889,542,150 *5C80D540814A149B83501CE83E5D61FC6BE6FF67 GENERATION』(先述のアルバム)の『GIMME
889,542,151 *5C8D8322287109104CD9DB97841E38FD7CBAF0A3 lb\6
889,542,152 *5C850C1538EBBD74DC7A02AF2C5D8B5A6F00A2AB GETTEREI4
889,542,153 *5C83D4A4B3691F70AACCF09298BB804FDD5D8EF0 legitext000006067267
889,542,154 *5C8473900DBD8B2F0E0D4B70E0D735C88DD333C8 GHERKINED
889,542,155 *5C843E35A7B0BF10D48DFCA5CF3814546B6DB8DC giovannimiyasato
889,542,156 *5C89E7CA4DA9CBC38CF16D88C9C337DE5D2643F3 LEOPOLDO.CHEON
889,542,157 *5C82C127E2C46E0857CB06DE65F5CDE0E5895FF2 LEPOIN
889,542,158 *5C8D80435A6F826E20F1748933636FBE3DA51C0B LES CARA
889,542,159 *5C8125305B81CF1AB491A200FA319574144CDEE0 givin'.u.the.bizness
889,542,160 *5C8A8118826992B0467B629A560DD3F3A786BADC lesleyperze
889,542,161 *5C884F318AA10B2DB579D07492851250F4FF59BB glenpiano
889,542,162 *5C8D68EE430FFD1A72439E019D68AC858737435C glensleeman
889,542,163 *5C857BDE1DFED70DDCF9C0D41FD018D3B45FF8A4 l:faaa
889,542,164 *5C8BE38C1842C0746EC47C497FE8581D0C470B09 [email protected]
889,542,165 *5C811DF993313DF9F3E5DEE57E6946085828B9EB LIIKEMATKOJA
889,542,166 *5C8063FF5C2E4773C24AABF99ADCEF2581651415 [email protected]
889,542,167 *5C81F4982ABADFDD968302FC7BED78090129D243 gopf
889,542,168 *5C84604219E454CCCFA919DDAB95949620E2CB42 linogodley
889,542,169 *5C81C88B0BC18E0F136ABF616C1A7AE0D801E10D linojeter
889,542,170 *5C8BD9E46D07A5E60CF67BE41E9A7F048D688905 [email protected]!70u5ne55
889,542,171 *5C8CCBA8CD290AB0C96855871CC070CA67A7AE96 [email protected]
889,542,172 *5C897D0E0607A0519E448B9F33A06879790A0464 granoogst2
889,542,173 *5C8DED265BF4E135C1D4A757675DCF667DE06C1E granvillecuro
889,542,174 *5C8BACC332AEE6ECEF85FF6BB792CF8B3C3B80DB GREGORIO.PRACH
889,542,175 *5C8291443D4B592C9DB00810A86FF0D47475BF61 lloydkokko
889,542,176 *5C8CCAAC099A3D9F1769133CA0B29E4FD5BA3CC1 GRRAET
889,542,177 *5C85F6839BA4DCCD17E05944280DABE505B26C30 lofosho07
889,542,178 *5C8827B423B626BAA2C25380982C2D85F43600E4 LONELEFT
889,542,179 *5C886AD7E8DF255B7F49CEB0E4FA0588D2B46CD2 guadalupedebell
889,542,180 *5C8F1DBE7DB767EFB46CAF5838626FCBCACF0E9E lonnykudej
889,542,181 *5C879E1F389D6E410904DB499B5996B3EADF203B LOOSEASAGOOSE(FEAT.FOXX&MOUSE)
889,542,182 *5C8C1865E0414B468708A3317E830AFEF6BCE470 GVANCAGVANCI
889,542,183 *5C8E02FFBBEAC6373A1D30B4DB86569F52930A7B lowellzea
889,542,184 *5C8E3BFD5F63557B983764134D1B6B1749ED0A88 [email protected]
889,542,185 *5C84E2910F32A53633E3433E0539C31F57421270 LU9U8R10USNESS
889,542,186 *5C834C9CB199A0531AF31D001C2658711FE4E95A haiku.of.shurindo
889,542,187 *5C8FE191B7CEF8BA54344213157A707870DBB778 LUKE.BURTLESS
889,542,188 *5C8DE289A26F109B1764C3B6255CBCF9C99F8C80 HAMPERED
889,542,189 *5C80CDF270E14CF21F5782049EF98B4355AF9DB9 HANDSPIKES
889,542,190 *5C8B130227DC956179AA3A5990248E9E3626D0BE HARIKRISHNAN SRINIVASAN
889,542,191 *5C86DBE2AF9EA6783B963980DE3D5FA9E1DD9618 HARLAN.WINTERLING
889,542,192 *5C8AAA35EE93A826BD42416875BFFBFAC8690DAB HARRABALDER
889,542,193 *5C858B4445C02AED0E45E0A947DCD31FEACE9B40 HARTJESDAG9
889,542,194 *5C8BC1F42C5BEC8C29C5D0848BEAC8B65D55E5C1 MACHUNLU
889,542,195 *5C8D2971CFCAB152B3E0BDFE63DDFFD7C9F444EE [email protected]
889,542,196 *5C8EF4BC76D09D6022C4D2CE4BC6D7BC969BD5C3 HEARYA.COMWWW
889,542,197 *5C8E515559272FE35A86B18627EF4F96979698FD heilahtaa8
889,542,198 *5C856DB8576A1BF356FD995C2764DB751B32C6BB [email protected]
889,542,199 *5C8D6B9C05B2A37B8395D38165C2F1D1AE079558 MAIZELL7
889,542,200 *5C8B47D6708D66E3EBBA540CC20ACC0B2A20EF75 HENGAMEHMEHRABAN
889,542,201 *5C8A0781F8EE77C706539A8D5664200A94A463EF MALUHAD
889,542,202 *5C82661F1C9A96259B2808764EEE526149451B5D HERBLOUDERBACK
889,542,203 *5C8058826284D54D0E97116519F84FF772502F96 HERDEIRO1234
889,542,204 *5C88809179384089D44D9B61AEC94AD70625018E MANJAREM1
889,542,205 *5C81B20028F70C5CA301859142CAF0F4F0769079 HIAGENT
889,542,206 *5C81EC90AF53C01686576A01B7BCEFCB05666B7C hinta333
889,542,207 *5C81D5870B1A55022DEC746D5D7DAB7E464A20A6 mariafosser
889,542,208 *5C83C388EBEABC82A3BFC17A5B8C98C74C583BF4 [email protected]
889,542,209 *5C8AEDBE6A991DAA974A0D8B21D1B4A6EC4B968F MARK.BRAZIEL
889,542,210 *5C8CE5D10D89AB115FCDCE04C3256B4CAF653F92 höhlenprofil
889,542,211 *5C86B2840CBC2AB4D1875F8679BDEB2F544A8E70 HORACE, THE SWINGIN'SCHOOL BUS DRIVER
889,542,212 *5C853C350C5B81253544BDAFA6C4A49247FBDF55 masino--m-aa0-s-iy1-n-ow0
889,542,213 *5C89FB286DC6DC755AD6230620B48768FA95C2F2 HOTELSANDEVENTS
889,542,214 *5C812E26F9BFB59F428DA699C66451FB25216A10 hotwindy4
889,542,215 *5C80038E20E37F935D55A829CC50D60B4CB9D3FD HOUSEPALADIN
889,542,216 *5C86AC1558DBE8F657BC1063532EA3D0ACFC0666 maximoperno
889,542,217 *5C8802321090036DF3602EE9582FDD5E2439D73D [email protected]!r5p1!77!n9
889,542,218 *5C841E9106F13FF4A764DCA8E6BB6D6C2C4480E9 hr"h
889,542,219 *5C80EAE90833FB38D69251B91AAC7EF5D710BE31 MCKINLEYSUTPHIN
889,542,220 *5C8671F81D123DE96855B02E81F05D42B46B6B8F HTTPJAYAN-EDAPALLYRA
889,542,221 *5C8575A6476F6BE17F014A867647DD46373628E4 mdzack
889,542,222 *5C845050BB1EFA7C84EE5C8CD518ED6487196088 meltilden
889,542,223 *5C8B184223A11AB8CAAF47CCD5162464532BD57D MEMORANS
889,542,224 *5C896F6E8135903799D1B1D9AD63D9C262212B1C HWANZELTING
889,542,225 *5C8E182EF76A80FAEE6843BA294D7155059C3EF5 metro40
889,542,226 *5C82B128643FB9561BDCA42E539246CB20D880D9 MICHALE.EICK
889,542,227 *5C829C1BB187078022032B3B72F8490D84E2FFF1 IAMFREEMAN8
889,542,228 *5C8EC30B289C34A13979BEDD1732368BE65BE18C MIKE.HENNESSY
889,542,229 *5C8274843466E9906A7A1D2C3AE582EFD35292E9 MILE(法定マイル)と呼ばれる。
889,542,230 *5C8E378EFF688EF48A469222E2D16A7D8320845F MILFORD.SOSHNIK
889,542,231 *5C8B3DFFFFA1695D3C9C2DF79C53DE07B6DFAE74 MILTON.SCHOENECK
889,542,232 *5C84E56DF22413E94B2CD855CBADA885012C3A58 MINHSTECK
889,542,233 *5C8D2BD0A3D189460F06AA68873BC236BDF26B0F IKEHERRLICH
889,542,234 *5C89651F6879CD7DAA389C582E507213D9AF6173 ILLABELLE6
889,542,235 *5C8513A5AC412860CFBD9539D043780194941BA0 MNARELLAN
889,542,236 *5C84A0D3C76521F4269CDF48ACADB3A7608C3B98 moamen.mohamed.ahmed
889,542,237 *5C8564D27E3B897292F4A5B7E7D9399514BD549D iluvturtle83
889,542,238 *5C8DF29B7F8E5E9452B1847C32E7FB9266B3C9F2 ILWG
889,542,239 *5C825C598B03CE6A3D1E2D0C31FAB8DE6181E00F MO MUNSHI
889,542,240 *5C8640EC45DEE8B905F6736398086833B7D55986 [email protected]
889,542,241 *5C8D2C920C032353125F183E424BC3242B47FC71 [email protected]
889,542,242 *5C8A4218CE66AD23D4D079DE8EF8D27963DBED56 imlassum2
889,542,243 *5C8A03447B678B2F098E2319BD78751315133C7B INFBSSYS5
889,542,244 *5C858A997C78AF2010D0EE8CB29AC45096AB4A20 inositene
889,542,245 *5C8CA3F873D7C79566715E7D0D41D1368029EFBB IRVINMINKOFF
889,542,246 *5C8D783EF107679C494EF1937E9F9FCD6B821B07 IRWINLOUDIN
889,542,247 *5C8797B343546E6E6290CAC81A6E9E484320965D MWCSONYERICSSONUNVEILSIDOUENTERTAINMENTUNLIMITEDSTRATEGY
889,542,248 *5C8DF9405ED2E79F0A337A254A3666F2FB0F25EF MYNAMEISIAN
889,542,249 *5C8D93656C823E9871EA5EBB87350E3FEC018013 myrmecobine4
889,542,250 *5C844A2B40E54E265C8248FE6BEE7D1CD69DE818 n0+a+0n$
889,542,251 *5C8A1BDE2FFFD9819E5253586FD1F5DA3B759628 IVARTSUL
889,542,252 *5C84341774508D6F9CDC3E4BA4027F8746232785 N34p-tid3
889,542,253 *5C8FA54705136A1E88C875F5BD69B46E979E7F8D [email protected]
889,542,254 *5C8447FA5836CA2AC95ED74DF717667744BC4983 J<*!
889,542,255 *5C8974082CE2084A523A201C07C6710E1AC86C3C nalopat2
889,542,256 *5C82F945F2272EA5A6731EFB79E70405BBC683AD NATHAN.KREPPS
889,542,257 *5C8813ED7E15869F1031178CF680ABF7B0472CA4 JAMAALASANO
889,542,258 *5C8EF844AD44CB01510798096F973983747F23E8 james1u
889,542,259 *5C8D6CD2426C4AF729EE7CA9FAF12D91A55C2A99 JAMES GIESEN
889,542,260 *5C87A6F9F3BBF393988DE8A6DDA7068B3005DB00 jameydesjarlais
889,542,261 *5C89E807132D66A66B23F00D405A79ED01F53F86 JAMISON.BOGAERT
889,542,262 *5C89B845D1A6D42066C9DDB7F16C8E08AA4DE411 NELSONGRUDA
889,542,263 *5C85ECC2E48E34239E3AB9F9F24DB61C39B128C1 JARREDSHRYACK
889,542,264 *5C8E11DE90A05B8C4FAD64F145D001EF80B6DBEA NEO-RIGHT
889,542,265 *5C8E63FD9042BE578AA742825E4872723DC34082 neugulze
889,542,266 *5C8EC2827B41779C3E4643F704C3EDF12241EF02 NEVILLEDOLBERRY
889,542,267 *5C87C1D9FB838CACAA965DBAFF305DBCA0593F2F [email protected]#
889,542,268 *5C88B0F869868EBD320B0B4D8841F01CB56DFD46 JAZMYNCKX
889,542,269 *5C8CCA136A3C378261EEE5EC1B415DCEDD3FBD03 NICKYDANESI
889,542,270 *5C8A3EB0D3DA66DDA5B6F6A123825601A9D5478B jedbury
889,542,271 *5C8CBB7B4B82795813E49F7B9D78678AA312E9C9 jeffrey-bettencourt
889,542,272 *5C84BB499B85ED94CC66A548A48EA7886D17E656 NIYATIGOGRI
889,542,273 *5C87062501C86FD3DDA223EF154D4F344B9BB7A7 JERMAINEKELLETT
889,542,274 *5C85E88B003C9A1DC7BBE0112CF7B9BDE30147EE NNGHBRLY2
889,542,275 *5C89D7ABFA3075AF068D9C7BBE9E473A94116F9A NOELMANDATO
889,542,276 *5C8298C90F72E8A58ED48D47F4EBC39C5E653DC6 NOITATICILLOS
889,542,277 *5C8A8D7FC1C7AF5A30559BF09F851297CD8BC063 NORRIS.ALDI
889,542,278 *5C8E4BC8954D83BCC8F725F2BD5CE9610A251488 nskulturfunktion
889,542,279 *5C88C833C730C80B8B86290B905796C11D1B4BC8 JIZLEKNE
889,542,280 *5C8C1B170ED7E3C0F9E0C3EC7B64C25723F3DF1A [email protected]@7OR5
889,542,281 *5C8BF580D4CE5A9D42E46CBEC07157F3C3D3CDAE joaquinhousley
889,542,282 *5C871CF4BF53CB865FF51ACCDD145B3E0CF95817 NZA GUIP
889,542,283 *5C8D0F31C63685E8A00C1135C93BCC679F839B44 (~_^)-o~-0~-(======p
889,542,284 *5C85B5D436FEFF2EED3F712CC96C85B13A63C4B5 O14091988
889,542,285 *5C8509F73DD536B1FF4273A7D57726A1837BBFB6 JOESPHYANDURA
889,542,286 *5C8AB4B5CFF0C9E6DFBE60A9D8C287E5E3B49155 oald
889,542,287 *5C84B11AD597847D0CB450BC0071E479F6617CE4 JOHNIE.MUTANA
889,542,288 *5C8C368FC264BE74AECF3AD751A9FAA9F0816CCA O$C11A+3$
889,542,289 *5C839BE969D05CD46F4D9F7DBA058E90DECC9793 JOHNNIEMAYORAS
889,542,290 *5C85B710599032A7720609DFF8BA8DB9DE0F4B55 JOHNNYINDIANA
889,542,291 *5C85A094C476B92F6E910B2F14E48AEEE2B04444 OCTAVIO.MARCI
889,542,292 *5C814358204352B832D2E15296F0456418AE7EDC OFNIPPARC
889,542,293 *5C87E7C511E45F9F0CDAB5E58F427478414A4422 JOSESTELZL
889,542,294 *5C8E5F06F0B1C0C29D4B1118F559500D99FBDCE3 OLDCITYHALL
889,542,295 *5C806177DCB7983F8477D40B0C14D6E09EFFA1CF OLIV3N3T
889,542,296 *5C849518C9200C8984C7C771628B922A4D11F137 JOXIC
889,542,297 *5C881131463D99269391D624F7C69E2B56A80297 JTRAZ
889,542,298 *5C8AFFE2EFF5521067E3B3DFE48DF2BC57AF35E6 ONINEMID
889,542,299 *5C81897800736BDD86A1E1BA3AD0D2FE5F6DD7B6 KACHBSW7
889,542,300 *5C8ECD50698D04996BB3EB63D2EE56E7BBFC3468 OSCAR.IBORRA
889,542,301 *5C804C36FD8CDADD3C7DFD7CE6F747D66A475263 OWEN.FORMHALS
889,542,302 *5C84738D132E815FDC01E555AAB0419488761984 oxyuris0
889,542,303 *5C8E63D72771AFC01F581BDA3AC6F6C043848CDF P->~~~(>_<)
889,542,304 *5C8B7BBF609410992945573485C77084F4D3692B kcze
889,542,305 *5C8AA9C755E4B425998BE136588D049D45658213 KEENANLARIOS
889,542,306 *5C8E0B0BDCDAFE600FD428F4E90A474C3509F97D KEEP.TALKING.TO.ME
889,542,307 *5C8173E7FA95E77D06B1BA3052C7E38915EADCFB KELLEYBUCHITE
889,542,308 *5C8097A962963BAE6830FD7EA58A73320646FE50 [email protected]@73
889,542,309 *5C84AADBD3D6B9F0969D41BC83A8847B6F758783 PAIGE838
889,542,310 *5C8A6AB5730DEE8A882A7BBA2569839F620EBEA1 PaintingAnAngel
889,542,311 *5C822059735D81FB1BE2A8F798D576E1050D3304 kermitvandegriff
889,542,312 *5C87B517C3C461BBA0FD724FACA6AFD26A0A9168 kev-nicholls
889,542,313 *5C8B2F7EB9EF8F4D4558726E40900767167E67AF khalil973
889,542,314 *5C8D9D1395F6657E67BB9CD6D8FC78105755221C patriciaveazey
889,542,315 *5C8EBAF02CF42B2E220581AD2F6DFF16C4A9CAB6 KIRBY.DESOLIER
889,542,316 *5C8FF31C9EFABF02759335DF062131B6A1234397 PAVEL.ROM
889,542,317 *5C8C7868220F7FB7EB21F46786379289DA8E16B1 PAYBACKINFO
889,542,318 *5C88E2A7715ED22149C17DFF8E8CE66161FB8744 KLAVIERKONZERTDDUR,HOBXVIII:11:I.VIVACE
889,542,319 *5C87802287A174E5F6201CF1062761CFA588694C [email protected]
889,542,320 *5C8E8D4EC84BC7D42BC9FAF177F01FECB3983BEA pereidami
889,542,321 *5C879AC403852F7CD1BAE2182770D207FBA19D99 PETER SHERRATT
889,542,322 *5C82C48D6AA2DC93FCE492D0C64343B9C29AD10F kraagde8
889,542,323 *5C8ECAB131031F3C3A5ABAB7987776EE5F2EA756 :PH)は、
889,542,324 *5C897289C2E9D1DF2259E1B439CD9DD8B8228CEA [email protected]
889,542,325 *5C8524C9967D892956CDFA4DD9B6BDC89F41A8F5 PHONSAKC
889,542,326 *5C84BCA33BD1EE0B464962A929610FBFD11870CD KUGLAĆKI
889,542,327 *5C86C1DB8AFCD657DC9A651E3D2F3CBAA270E784 kylecasiano
889,542,328 *5C81F3A79D4703CD5BF12960494EDE04DADCF9C2 l0n9!tud3$
889,542,329 *5C859C28A762B079C53DE55231BCDA3927DA8997 PLCUSSYLACOLONNE
889,542,330 *5C822DA7FFC4E5D0676EBEAC226374C56DE76220 p!mpl!3$+
889,542,331 *5C892546448BB0863384717A9935B1D6E6FB4C63 LALOPUDIA
889,542,332 *5C8AE10F9D862ED5AA9BEFEC0B3D9F6598A7A810 lamarlokaphone
889,542,333 *5C855202AB5325FEE57FCCA0233DAAA87A4F6DDC LAMB1105
889,542,334 *5C81141EEA0727A404080690F4AA91A15B01BE67 POLISCUKED
889,542,335 *5C83D2E6A7048E3172E1C1042865726FF3204E93 pomer…
889,542,336 *5C8AD24786521C21F3EAB27BC82ADE83D3C824C4 PRÉTRESSES
889,542,337 *5C8F1E9D5D9341B8C4A9EEB3DE7EF96AEDEC60C9 $pring.ne
889,542,338 *5C86B536D651D93C195F5E8C121B7A887B0C0733 privatdocent pr/i/'v/a/t_d/ou/,ts/e/nt
889,542,339 *5C8477AF37F41A7DBE12736F15B4C41FA6BBC1D9 PROGURAVANJEM
889,542,340 *5C87254EF4BA238E613B5A1BECF1267486A14FFA prompted
889,542,341 *5C82EEF465376ACFADC47AA9750B3F8EAA14E001 p==)~.~.~splat
889,542,342 *5C862CBCDEC8AB47481AB5693AAFE783C10B5D93 pub1i$hin9
889,542,343 *5C83E26749A81D3F4CD3954D26ED0D863A66AB41 put-you-light-on
889,542,344 *5C8E545369CF9E7E544BC672E35F1C3B95FA0ED0 libraryno.s-226,727
889,542,345 *5C81210BE6951F4A0436B3BB05D9B5AB7FFC6408 LINDA-SELIN
889,542,346 *5C85D337423C4EE4BFD065EF6649055CB98B4AA9 [email protected]
889,542,347 *5C856A6B3C7CF30CF7D8E136B47F9FA139FC354C [email protected]
889,542,348 *5C8DD6AAFD08B3B3635BC50F0266E11938EEC48E linkwotherspoonsmit
889,542,349 *5C8FFEF787F5194BAAD74808526C4354E8AF11CD LINO.BYLES
889,542,350 *5C84EA1960EA18097054DE77A5A53C927D5BED7B linwoodkleffman
889,542,351 *5C8C97FDCE13F0AD963D92009C1015F3F2E2913F q=p~ 3b<-
889,542,352 *5C8A6D0EE35696410EC787C2DF5EE3591BB513E2 [email protected]
889,542,353 *5C875E8B97E4914AC69CAD4FCF03AA6D6847C2A0 [email protected]
889,542,354 *5C8A5BF0BA6EE390EDD035503BFA2B4342F5F452 QU4$IWHI
889,542,355 *5C8F070754CBAE23A92462C86DC4345842D8C998 quatina3
889,542,356 *5C849F51DB37E792F643786B4BF3A42D92854FBC [email protected]
889,542,357 *5C8D76B514882F3D15F5FDBD6948D0438A640AF7 LORENZOBRUNDAGE
889,542,358 *5C818CC6A6D2E589E4A0A6C73C3C92384B8DC9B5 |r.7
889,542,359 *5C8CA2B835C411F17C432A36A4215DA68A5F7350 rachael.fincher
889,542,360 *5C8F20076F7473EE4626BC7FA80355B0AAE3BDF7 RAINK9
889,542,361 *5C86D8B69BF41A8D871E098815388F53141A2EFE lucianovocu
889,542,362 *5C886372F541670878087A2AA06251DC2FA20AC0 RANDALL.GANUS
889,542,363 *5C8520CE1930235D09147E0AC82E4E42AE4F0CD3 lucille-gould
889,542,364 *5C8562C0B53E21558573A071B242F95E6C4B0CFE RANDELLURICK
889,542,365 *5C8B7BF2678AA0B2D5080641DD9C1B2EE15C8206 LUCKYJ43
889,542,366 *5C82B520E49CA17D78DA40CC246CD8D6477FD008 RASTRESIT
889,542,367 *5C8A9DEBA7E97222AB8A6F7864CC66A919991C72 LUTRATA8
889,542,368 *5C820C8F009935F4B71E86BF2292F46C462F3881 razoo4
889,542,369 *5C8237CDF573EDC08F988F20376846898EAD46BD M151230
889,542,370 *5C8EA69D603412CA3D863ADA57B975E8037218DD regrov
889,542,371 *5C81FCECF8DBE332964CD537E51BD9FBBA3D15B0 RÉMOIVILLE
889,542,372 *5C8D2E10CA60B202138B572FC8315FB6B5E07294 MANUAL.HOPKE
889,542,373 *5C84E529CE32ED2238B319DA5AF8B8D48B3A9991 mariabrunetti
889,542,374 *5C82AEA46D5AB7D2CA95BF682E563904629A433C MARINEIRONMAN
889,542,375 *5C8D33064BE8D7CBFF64A33E61A0CA6FE8CA9267 REYREY08
889,542,376 *5C827905A511CFE6A75BE91E52BE5AECDF836E66 marshallkhalid
889,542,377 *5C8ECD366FC7163CCD0FFAB605BD24E57FE8B38D RHEABSW3
889,542,378 *5C86F1ECE8C10D3C97E67E06204AAF5604F913C3 martin-cohan
889,542,379 *5C84D411F178100E3BD28DA9995C5097195036F1 MASHA-POLYAKOVA
889,542,380 *5C81FA36477A8DF56CFAFBCD957F0C9C83722F07 MATHEW.HUNGER
889,542,381 *5C8E91A2490927F3E6C373EA284215DDA7309B39 RIISIKUP9
889,542,382 *5C8C195F8B61BBE96F1A7219F9378CD46DA25BA1 [email protected]
889,542,383 *5C868E578E8D34A312A2A5175340BF22AD8F1836 rincarasti1
889,542,384 *5C8CD20908987D0E300AB3CCD00B88AD4469140B RISIKOGESCHA1
889,542,385 *5C8B2A81EBA5DEE5F798ECE70081E11F5BCA3ABA RITEMPRANTESI
889,542,386 *5C82F4BEA105EDF41315EA1CFC20A33090AB1DB8 RITTDATOER
889,542,387 *5C800D4EB3B3FE6B27E8DABBFA3AE110080AD2E6 RIVOLTOLATA6
889,542,388 *5C89C1E7C8FF3ED1AEDCFE4B30B1298C10B94EC4 maxwellgoodlet
889,542,389 *5C847137189102901413D8ACFD5BFC4F12200F6B MAYIBSW5
889,542,390 *5C8E40563B4260AE0366AA98DF87B24F549DA889 rl's story
889,542,391 *5C8CF4546930837DAFAE9885E1A32A71CFA68E8D me$7iz0$
889,542,392 *5C881A1B02DE57613B157E808194E3D56025278D me+eorolog!c4l
889,542,393 *5C851B90352408DAE6E9D2A218787EC606193739 rodneyerno
889,542,394 *5C8F0FC752DF1B4013AB28C8164F93F15B8CAD64 MEMORIZA6
889,542,395 *5C81F0F17E5D77A60F43A7C0A87036A37DC0C981 ROERC
889,542,396 *5C86BE283D068F68252A6DBBDEC740D6390A5BB6 ROGAZZO
889,542,397 *5C86569F3FD36E6A582C9D48C0EE0FE2BBD407CD mercedesciudadbuenosaires
889,542,398 *5C87116E95B1DBD8D0B51C4DDA4D5F55F6B0EC3E METSÄENETSI
889,542,399 *5C8E6A704016BE19E5DAFDAF12093750CC1E5E87 me?-two-words:-server-logs</p>
889,542,400 *5C876533943DE47788256C2A29CA07C9B06F8A4B RONWAYMON
889,542,401 *5C8E1FC64123243C4A77DEF60FD081C6D25A31A8 michaleheuman
889,542,402 *5C831DF033AB786468AFF04BB1D96349E2EC3301 rosietavita
889,542,403 *5C861135988979B05EA2BAECC15C927D830B3007 MIKROFICHELÄSARE
889,542,404 *5C8A8B78B745D1E0AEBE84E38E8551DFBA778FF5 rsvwerl
889,542,405 *5C8881C26A267BE619F7A08B146CDD055808BCC6 RUDOLFHAZELGROVE
889,542,406 *5C89B0594A0D9011EAAB64CC8B90528455F264C0 rudolfrieves
889,542,407 *5C8AFB5E4F9AB70160E78E99CD6E235A8FB13A37 MILLENNIUMS5
889,542,408 *5C8914FF6A08263E10359FA239D0E852A2F26099 RUFUSVICKERS
889,542,409 *5C8CBDF34F4FE0EA3A973761B15A66A6AA19A77A [email protected]
889,542,410 *5C8BD3B406E41E740EAF2C903DA89989C23D82E8 RYAN FALKNER
889,542,411 *5C89159FFBE2A1AF906693973F4B8BD0AEA0914B M/K]
889,542,412 *5C8C55867A11D36380F7A8BF0DC263037D5060E3 [email protected]
889,542,413 *5C89683D6B597EE1A959E917A1E6E992D6B1DC63 mobotix
889,542,414 *5C8ABDB843300B52BEDB9F875DB4D32DACB91F92 monika-stadler
889,542,415 *5C84B6ACF4AEF7231F17E0E49583741196E7ECE5 SAMFUNNSKRITIKER
889,542,416 *5C827EC34D5C58047DA2FCE7F07E8B325B466824 santamarialaribera
889,542,417 *5C89E839A374A64AABA88E9F4F85E918227DE6AB sarah-alleyne
889,542,418 *5C80F0C9C2E46EBE551A136133573122C4CFD46F MPLRRNS6
889,542,419 *5C862195B617B82514E5C3334FEFD862CFAA5A80 MR-HIGH-PROTEIN-DIET-GUY
889,542,420 *5C82F2A834D708042A342BF8E7CC66F87B8B4ABC sbsks
889,542,421 *5C87A5D372C84FE4A1F4103EE14736F4DE69CAAC [email protected]
889,542,422 *5C8EBE2E564A14B05414BAF15B7B4D0C01F73C0B SCOTT.LAVINA
889,542,423 *5C8081CB7645FCC56146BD48B0A837C2EB70E378 screams of the shadows
889,542,424 *5C86B544A7621D029AEE67E26EC9F59D554EF39C [email protected]
889,542,425 *5C8E012BA1D8F75EC1536DDC5639E8D9E838294B SELVHERS5
889,542,426 *5C81D887CB1950F5F0092F193AB105EFC28B4589 NAPTÁRKÉRDÉST
889,542,427 *5C8C35BB38A955379150C6906AB32AB186BB5709 neilseagren
889,542,428 *5C816EF5EA21EC20625428CDBD510198219E1971 nelsonkratochwil
889,542,429 *5C8F27796EFA16F99E2A22F7063BFF2724926CF4 NELSON.MANCE
889,542,430 *5C83C7FF390DFAD7FAE24299212830CE98FEE25C SHANNON.AMSINGER
889,542,431 *5C8707786BB40A67D69B509B45B6D044D05A814A shaynefrickson
889,542,432 *5C826395E789E35036C10113E0740222CF32C947 SHELBYWRYE
889,542,433 *5C8882B8B073F97EBD6FF927D7CDA5515C85DF52 NICHOLAS.ELIAN
889,542,434 *5C803C029943583DA22061C2010AEBDE9F8894D2 nick.of.time
889,542,435 *5C83F4F2AF855F7B7BFB662CEBFA629753BB614F nicole-sniffen
889,542,436 *5C81F92C5AAE15B05916CEE82679B41F44E6EE2D [email protected]
889,542,437 *5C866041E37E324987528F2AA08083E2B2787B28 SHIFTING
889,542,438 *5C8A42B9B5EC12C3DCA859AF82E755A70B49F9E7 SHIVAM.PANCHAL
889,542,439 *5C8BA4A6E74EBBDF6EB6E4667408860E9DC5A1A9 SHONGIBSON
889,542,440 *5C8E629669D2BC1B3EF7C3ABED917206F162CA68 noakuoks
889,542,441 *5C861C8D08E3F37026384CA90F58F525DE56616B [email protected]
889,542,442 *5C81EFF25B7347DE21599E6D1683D13E3C387FC0 noninflammatory.
889,542,443 *5C87EA0FD78141B102C0F3F7414E3B21721A44B1 notehall
889,542,444 *5C851C4C0231EAB018B7E2F8E7F3E7DD99AB2F11 o[2
889,542,445 *5C86403ECB5D6BFCDFD19755498E099BC80C9900 OCTAVA-LEGISLATURA-ESPA
889,542,446 *5C84051D1B34A3CFB06F6134F030FE798A462814 odellnicoletti
889,542,447 *5C83B9B283C947FAB42FB93E5DBDCECD685CE4F9 SLRRKHP49
889,542,448 *5C8B510D3E47B000A3FA8970E13E11BBEEC0752F Oh-Way
889,542,449 *5C887A1358AC24443F04CB5A5C29BDF7F2CE9B5F OKLEPNOMEHANIZIRANO
889,542,450 *5C8B1BADE23CB609609429A264944B973CCCC868 ÖLÇÜTSÜZ
889,542,451 *5C8E604B896F950779930E79EE6800F8134CEE58 OLD BLUE CAR
889,542,452 *5C8E9973327FDD977C0400F7FEB84E892A36A9FD OLIVEIRINHA
889,542,453 *5C87017FC7599F75BC2B0D514B49CEDB98FE67A0 ollatrim
889,542,454 *5C87F6E68FCA072F29A904211DBCAB70056B1FB6 omerdunnivan
889,542,455 *5C804166A921AA9A8C44544EB8167326423FBE3D sonataforviolasolo:iadagioallegroadagio
889,542,456 *5C835E8870776E0092CCFC77394A2A76102CE6A0 soniaspink
889,542,457 *5C81D81ECA3D64AFE9E4758908E8E5E50C4B6D61 sontok
889,542,458 *5C8915CBFCDB7738B0EBD1A60A99358464B64752 spacetribecomwww
889,542,459 *5C8E730B2C7BFD29E19B87D5855315C66361419B SPENCER.SABINA
889,542,460 *5C8F9D7DD33154DF070EAD3B95DC449CD01D8481 orsmaal-gussenhoven
889,542,461 *5C843B95D4CCBDD08247B5FEB46C46AC0641DAAE orvaldiiulio
889,542,462 *5C8D5938FBC2C7351B064D8C0E6D6AFE3CA8259F OSCARACHTERHOF
889,542,463 *5C85927803A69CB92B3340B90E427B63A447343C SPLAT!!~`D---B
889,542,464 *5C8557B4316F1CB597377382DED0031F65E261F6 splat-~-~-~-(==p
889,542,465 *5C867BBAEC5FA4D2E986262E96B315BD5A349D67 otisneumeyer
889,542,466 *5C854B2A5D6679C054ABC21E74FFBCFDD9E0DABC SPOOKYMARIAH
889,542,467 *5C8B4E364FFE51FAA1AB8E745D1C2962DCD9A268 @[email protected]+I0N
889,542,468 *5C8C93E2AA780E28BED32C6F07C63F8B8F0C53C0 stateian
889,542,469 *5C8E000D55B9341A70F6D1E928B6399B65949773 PANORMITELLA
889,542,470 *5C820ED33E7C31F7D129B8175B72FC11B5E1A2D1 PARCHEDNOMORE.COMWWW
889,542,471 *5C81C5D5144DFF9C3D52191015FA3D892BFB916D PASIKIŠKIAKOPŪSTĖLIAUJANČIĄJA
889,542,472 *5C8022B71A52A9EB9DAFE8598905EDD6192E4A9E [email protected]
889,542,473 *5C8A9D6B28C0DAB0F5E46D48DD556F382E41F141 PAT.PROVINES
889,542,474 *5C86EF56115D47698CFD45797414D38BD040D6D5 PAULMONGOLD
889,542,475 *5C87B0B4EA6A965D809978EE5FC401455C86B68C :p~`-~`[email protected]#####B
889,542,476 *5C8E8567FB9377A0270F65552B8FE6967EA9AE14 STRIJDBIJL
889,542,477 *5C847DD9FBC9F32FF640C8865C433C4D032551D8 [email protected]
889,542,478 *5C80A3C330A008D3391FFA0599C8097D3A6A1CFA su_%
889,542,479 *5C8531DAA65D817CCDD6C41D10700F9652985ED6 [email protected]
889,542,480 *5C84E285C6C3E4332718B12383CA7B919B63178D PELOTONNERIEZ3
889,542,481 *5C83A5ED9F030FDB3EFB390E6F7F8A3B370100B3 summertime-(dbm-manchester-bass-mix)
889,542,482 *5C849C885050BA363251E1D38C1EE8126F2F8969 supersulcus
889,542,483 *5C8D139F7EF04098ACA5713779FF7080CE8CF48D pierreingersol
889,542,484 *5C83413686FADC8B01A261FC0C4943AF24346007 piirilääkärinä
889,542,485 *5C81C5DFC776CD8DADD05E2024ABA0F7D9807D2C PK1LNUWSMGV
889,542,486 *5C8D9E00617A98D9F5EB34A8A71AA651B6D39E6F symphonic.etudes,.op..13:.anhang.variation.no..2
889,542,487 *5C87D2300FD618339ABC013E9269AC1E5218DE37 PLING-I
889,542,488 *5C8CD2E1A093D852F25B4A1BA43237BB00C86E40 PLUGINMATRIX
889,542,489 *5C80AA832AD7B6C026A285C5EB53AD139793D1E6 TALKLOKESWARAM
889,542,490 *5C82F2C8140647BD8CC510B93B24C56D31656D6C PORTER.HOLL
889,542,491 *5C8DA876BE8010E5570C234C5D0562C0F0AE71E7 tangodelaisla
889,542,492 *5C8C80F25EA12199FEB3B236705E14073B3A94C6 TAVIN.HOWARD
889,542,493 *5C83C85537A67EF79098CB022A6101590F27D995 PŘĚHRAŁ
889,542,494 *5C88DFCF1DE5839317CC8BDB3BF94B391B5ECB85 PREKIDAO2
889,542,495 *5C858947EF3939668FA84C25EA9FFD4F82FE0956 premiumgoldcollection,volume2
889,542,496 *5C8377016834137D451A447675E9FB21703235AD procjenitelja
889,542,497 *5C820C37462D20A37D3AB6C556CC8624A9430AC7 PROTOVALSTU
889,542,498 *5C8FC540BFBBB500001402446ADD54D97822C3DD prozai
889,542,499 *5C8B4F6C8BE4941E84001200B01027F17A8B0003 TESKER14
889,542,500 *5C89BC5F390CF37F4C15B93881552FCBFD82BFC0 [email protected]~.`.Splat!!
889,542,501 *5C8A701029475EDA7DE69597C437E9B49CFC0EDC THATCHELSEA11985
889,542,502 *5C842697E04B6DC0238B00AF59B9020CE5CE1091 [email protected]
889,542,503 *5C8258F39C31F4684EC21F90C24822E0E8EAAEA0 thattigre2009
889,542,504 *5C82E29A169471B0B548E848C221BECE55BF3ECB q->~0Splat
889,542,505 *5C80533451126EDF5AEDB6BC222E044C1C8998BC THE-BALLAD-OF-DR-LOVE
889,542,506 *5C88DDDF7B6541BE4AF11009933FE11E233A2900 QAISER-GONDAL
889,542,507 *5C8BE21B32E303580B503A37F921D3CBF5133ECB The.Fly.Flap
889,542,508 *5C8E6E9CF8F63D5AC085180ACE445B9952CCFC98 [email protected]
889,542,509 *5C829BEDC9CBE33D699B2AFB02F8265EFBFE427E TheMikado,ActIINo5:Miyasama,miyasama
889,542,510 *5C8FA37A4F41B917891170EFDF09C818DA56FFA0 THEMOUSE6
889,542,511 *5C888AA21BC1D7C21FAF351E1531EB947473DDEE THFISEMBLEM
889,542,512 *5C8450CCDB6F8ED32977FC75A40E61EE658DE2FF THGIEYTENIN3
889,542,513 *5C8C9AED025C4B455AF82309D40FE01C874936A5 [email protected]
889,542,514 *5C8D8F19D5875C0FBF50F2395CE8A9AF0EC1E06B THREEPARTINVENTIONS:SINFONIA8INFMAJOR,BWV794
889,542,515 *5C8652C40599893C9DC8DA1AD110A0DAF06FF387 [email protected]
889,542,516 *5C888712027828CD2C6B4EDB85255B30F9A70E20 [email protected]
889,542,517 *5C86FE0C54212170CF29F26FFFB7760C16A147AD “TIGERS”
889,542,518 *5C89E1AA63C1402D355848731A939417EC2C82FA TILAANAKS
889,542,519 *5C8E532D1D6EA908B070AE6AF73F098C40C2765C TIMEKA EDWARDS
889,542,520 *5C822C36AB909880B285E2858F41B779C491F9E4 timmyeutsey
889,542,521 *5C8513E76BE316FE0E259EA7EE6681216173ABBE ra710nal1$71cally
889,542,522 *5C85EB2D714A68B8BACB66879D796186B36CC6B0 RAMIROVERTZ
889,542,523 *5C82C63A5BCC3772D723AA0B2FEF77E420350ED4 RANDALHEISTER
889,542,524 *5C8ECAF4B1721FA2693CEC8CFD4B813FA5BBC7F6 TOD.BLOODSWORTH
889,542,525 *5C8DFFA1E8759A8E4EAE05B43F5E0D1CD477FFF8 TODD.JARVINEN
889,542,526 *5C8A5E509F71830B76A4AC522CAD51D92E615E24 rare.Johan.Brisk
889,542,527 *5C86A5C2B44D79A5AFF36F7DA06ADE46939E4CD6 toddwoltz
889,542,528 *5C8BCA1E65AE585EF2F994DDBC786321B5F30E1C RAULDENFIP
889,542,529 *5C8C637FDC2656BB11723AD0B93FE2F1DB39DB8D raymundohentges
889,542,530 *5C8C4D01A225C24A90E55F7E51D2FFBB6E639CCC rbogensing
889,542,531 *5C8B02C3E36E564C95C7833FB0369F4699446437 tr33 c1a$
889,542,532 *5C86B10B4A7595249E9EAC2E6C3551FEE7651799 TRACYSCHONECK
889,542,533 *5C8AD0E08515D85CEDB295C48B8768D392F547B1 REED.WISS
889,542,534 *5C802BF17BFDCD621E561569791BB46581F88F3A REELUNNAED
889,542,535 *5C872E361D88B3B3D3B9D5812B89C025F150335C trevormatese
889,542,536 *5C872B274BE350520F8FBB5C255C275942FF8DB3 tristan.conor.mrozek
889,542,537 *5C83E8844E62577654ED5DAFC40730607E8B3CDD RENE.FARACE
889,542,538 *5C820B682174F716540C26E59C3F29A8BDF2F7EA RENNIWEHTMAI
889,542,539 *5C8306533A912EF1FD9CF9581635C345428194B5 REPORTINGSUNLIGHTLABSCOMREPORTING
889,542,540 *5C832755C496234A705D7BE7E27DA0F60CE8AC4D rese1ecte
889,542,541 *5C834EFCB09E2881B71C39091D939AAD2C0791C0 [email protected]
889,542,542 *5C87144A517EF83BF4A7A64398FAE209338D9DB3 [email protected]
889,542,543 *5C83AA08F0B377F650C26577B5BAB3BED066FE65 TTESNIPPING
889,542,544 *5C8E38AFE06C2EB7E1138A71A4A6B8CF43836306 TÜDŐTÁRNICS
889,542,545 *5C8340D1F0CAE6D7FDCFA61DC10C3CDF9E6C29B7 TU-ISAAQG
889,542,546 *5C85F4C0F0C282414D5B057AAB9C19C681099600 reysearchfield
889,542,547 *5C8CA2776ECB18CFD5A993151EC0B81F1798865A TUSSENZEE2
889,542,548 *5C8735E3194CE7995802E27A437829802B6D510E TWO-PARTINVENTIONINEMINOR,BWV778
889,542,549 *5C860116A9E4A8FA81AE464E72776B8395BDC310 rich19871997(disc1)
889,542,550 *5C86176F1F2A7A3EDB95BC07D31CF4EC3D10A047 richiedepiro
889,542,551 *5C857D401757C7F403158C2DC8659EEEDB6212EE U[-
889,542,552 *5C861097DFBB7B547C5593BB83A0B8BC20F78074 U-BOOT-DRUCKK
889,542,553 *5C8482434DEEBB2009515F63F3A9B6A42E8716F4 RIGGA101
889,542,554 *5C872559A64605F65BE746D2EC474D2E19595E94 RIIPPUMATTOMUUTEEN7
889,542,555 *5C88D9A4FB500845B0B6DD427C82EE7C3EEE6878 uitgevon4
889,542,556 *5C81C488BA32DC399BACE37662B92EE0000E1D7D RITIKA-MAHAJAN
889,542,557 *5C8BE6DB065B3AB304C222F31803E8A8A5755CF8 RLJHVPUAU
889,542,558 *5C8FEC4C2428F597A6A7D6B59E3FB5BA7B1147B3 UNDERGROUNDS8
889,542,559 *5C849AA499C5F582F3DD91712B5D5C7585F9FD92 ROCKVOYAGER
889,542,560 *5C811354688573944B5B836FCF6A100DB0C03556 RODERICK.MOH
889,542,561 *5C824E446051106EC507A2CB49C3369967E0EABC rodgerjohn
889,542,562 *5C8CF5E170DB1365BD66673A1505BF5169462A5C ROMPDINA
889,542,563 *5C898417BA196D550B5C076B2D549F94163F2B6A USERBURNSRO
889,542,564 *5C809996E50FA47832C57C056AC6E7D884A32BFE ronald-andrew-martin
889,542,565 *5C84D8C125370B8404E14C1E2935A6E18BD9B513 RONALD YORK
889,542,566 *5C8312AD9E17DE82742C2157A3667F3B01E42A54 /usr/share/doc/libbz210/copyright
889,542,567 *5C8A70686AE4476A5D2FB26195CBB41C8EDF5759 ROOPALIMAHAJAN
889,542,568 *5C8A4BB88E3C9A638C13E2D12C99BCF4CA6B8DE4 ROSEBUDHELPPED
889,542,569 *5C83102DC5B3F490F69CA3B1D96B683E7ED9ABF8 uzoma-nkem-mmekam
889,542,570 *5C8C25BF3219233C8ED1CA7EC1BD5B272B7526D3 roymielsch
889,542,571 *5C8EF3A1F321BFB6BEE56EDF961563E64ABBD5CA [email protected][email protected]$
889,542,572 *5C8F59F026CE3228DFA771828C7829EB1DF140D3 V4$K3N$
889,542,573 *5C81F692C3EED9CD52A1F6B7A0B494AAE5CCB354 VAIHTOEHDOLTABSWS
889,542,574 *5C86151E7F036812C48BF09DA9EEC2D7E174D43A RUBI33
889,542,575 *5C8BFB90CB92080D5164CFFE66B17B0F3E29A9E6 RUPERT.BELMONTE
889,542,576 *5C8D04C8FAAF587CD05F619ECFCE605EB1E38018 RUSSWARFEL
889,542,577 *5C8DE799DAB9F88011840EFF702F79742C1A71F5 RUSTY.CRESELIOUS
889,542,578 *5C861941C5EA1D12AFF766F9AFDDFB242115F489 VARJOMAND
889,542,579 *5C87222292AA737F1C364159BF7076DD601AD843 RUYCOWBOYS2
889,542,580 *5C8FCD7CAE16B9878FE2981D868C72DD44D00D8A [email protected]
889,542,581 *5C899AF07C18B9E912ED1115397A13C6AB9C7E8C S133PWA1K3RS
889,542,582 *5C88B2D12C69923F974ABDDA8B230A338EF3794D vermiformity5
889,542,583 *5C88B0FA27E23BF67BB1559EA8E9384B127CC029 vicenteoppegard
889,542,584 *5C8E028139B2D890681F01706CE95C76D88343A3 SAM HIZON
889,542,585 *5C8B7184691B6EB2FC8C6660781EE48BCB7784A6 samuelcoyote
889,542,586 *5C87CBA205047F4F2211F97AA78498A143196BE1 SANTOSPOPOVITCH
889,542,587 *5C88ACF0DCF17D6CEC136B731782B576B80F94DC SAOBREVO4
889,542,588 *5C8140F07212BEC253D831591BC7BCCB2F17CE4F sarahhattan
889,542,589 *5C805C482CA4917F314DFBC72DD674C632C7CCCD [email protected]
889,542,590 *5C84705BAA79B6873594E07E6390B2014910081C SAULDOTTERER
889,542,591 *5C8FC8758AEF3777929F8D034DD0946E4111FC38 VOEDSELVOORZIENING.
889,542,592 *5C8ACDC4F5498E6E86D92A2F603A3C730C4F2619 VYKOPLA8
889,542,593 *5C88DFA59D7FFDBF1A1C6D2FB91C49DE6B77C9C4 SEANMAYESKI
889,542,594 *5C82EF751F4354ABD312E60E0F937EC2164E8E24 SEBASTIANHONSBERGER
889,542,595 *5C8ABF2455131FDFB521B2CCE10893ED52D6A8EB SecondStreet
889,542,596 *5C848D6B4CD1B750BBAD9DCC5EA83A893619247D WALAKINI
889,542,597 *5C8149D58DE2E25501884081B8768A6A9D88AE6B semidecayed
889,542,598 *5C8F14CF2B0E78343001C7D32296AB2E7CD39C5E SEVITAL1
889,542,599 *5C8CD823092941C26380EE7C3D715BC21FF86133 WAYNE-LAKSHMAN
889,542,600 *5C8697E959434C07D384F591675E3826E2259790 SFOGLIERETE6
889,542,601 *5C8A5CD9640707DDE7503D9AE5896B31A277E45C WAYNE.SWATLOSKI
889,542,602 *5C8B0D2A98CD71107B35C32317BDCABA1E9826C2 SHAFAQZAREEN
889,542,603 *5C803E46B352FE0813CE1DE16C7D41054743D991 SHAHIDBADAR
889,542,604 *5C8478B28DE57CD3BF4352A2E7C9C51E9993811A shanefaustini
889,542,605 *5C8EE6F529D5AEDB1110287FBF5EAB2DAC1A4CA8 SHANE.HEREFORD
889,542,606 *5C81D5B2CB0B2D31C8639BB76D4F07EFA7B59CE9 [email protected]
889,542,607 *5C844B77303CDA6EF16680A87FC5A2EF9228B996 shaunadodds
889,542,608 *5C848F776F07265BC7FD97EF92614222EA2EB0ED [email protected]
889,542,609 *5C883F4D7E02ADD9EE83648D182E7E9B1E725788 shelbywryals
889,542,610 *5C81A338188B218BAEFDDBFE6C7378F2467AB33E wennie-enguito-malingin
889,542,611 *5C86B287BCC8B778FF767040FBBA71024B847C42 [email protected]
889,542,612 *5C801C7AA1339EBE4857E6EC1E969A81F993FEE3 WERNER’S“
889,542,613 *5C80528E9B3840C5F5E5A69665E7D62494F7C092 sheldonsom
889,542,614 *5C8BFBA2B6686AAA1A2972D824E7C1854F3E08AA shellywilley
889,542,615 *5C8CDACB924200941220E339052B550FE79F1AE3 WHATIST1
889,542,616 *5C8F3A7BCD6435375435D712397AC2961ED22F38 whitney-coghill
889,542,617 *5C85FC638DDF0B5E3A12BEFA4859BDA6B5FB04AC [email protected]
889,542,618 *5C85C741075191801ECB965012EA631352403BDB SHI釋
889,542,619 *5C8F2DAC006FF4391D21D677C830926BD4BBB753 SHOALER1
889,542,620 *5C831A7969B5D6EB0ACB73196AB6ED68B441B450 WILLERSTFORT
889,542,621 *5C82D36109290BFD1619EDB80A1461A500FC5E45 SIGNONTHESKYLINE
889,542,622 *5C8535D5786578F81EE0691218DA77F8442D21F5 SIHLE NKALA
889,542,623 *5C81327813B6F5CAE9ABB309834AB3029324DDF4 SILKWORMS2
889,542,624 *5C8C3DD446F1B026DC5CBA0CA5CDD4948D4EF4E2 slmmende3
889,542,625 *5C845F7510D96E68FACCD3A1922AEE56F6D7DB5E WORLD.DOH.COLIN4C
889,542,626 *5C8D9D1BA679670ECB9A5BC9A378927307725160 SNICKERMARIPOSA2
889,542,627 *5C84FB71E256F0ACAFEB7B7702B9A28C6F0456D7 SNOCONEOFLUV
889,542,628 *5C81D2D736150DF8FF5DF8C223B9B05B271AFF0F WWW.DICKY9482_CN
889,542,629 *5C84A95D959098BC02F42EDF03F27253EAF984E6 wwwgermanycoza
889,542,630 *5C810DB30EDA04DB364473515BF6321B76785DA3 soleraised
889,542,631 *5C878BC9E0BE628881233E86272035BB43735E81 songstosingto
889,542,632 *5C8291B1FFA2ECE75A6464F5F2AE8780B6F5566C SOONPARTED1234
889,542,633 *5C885858BF364C07E7C9B86631DC57C3CAFE5978 SORENSENN3
889,542,634 *5C88B7137EB87D9571BBDA334BB0386D123AEEDA SOUGIANNIE
889,542,635 *5C89F55AEB9204C8D08EA38980F661529D8A8F83 SPEEDWELLREINFORCEMENT.CO.UKWWW
889,542,636 *5C85DB54A01DA8A13D7BE472B1D7BE3B5FBA80A0 SPIKETOO
889,542,637 *5C82D8F107F088F0B03D1AE8BF701D7697CD8176 splat~.~.~d----8
889,542,638 *5C86EEE834CF01EB9819A1EFF0B6C1F68F4BE526 SPORTISTINOJ
889,542,639 *5C8BFE7B4B910E752307260F20D84FEDA1268418 [email protected]
889,542,640 *5C86798AA13AA3FE39AA3FA8593B627CDB3145B2 SRC=HTTP//ECXIMAGES-AMAZONCOM/IMAGES/I/2148RDRBNCL_AA115_JPG
889,542,641 *5C8A4E573816A024EC0893DF0B793F5EAEF5D195 Y|*7
889,542,642 *5C8F217A79638E7249ACF2B4F34CED9E3EF3AF22 yahyabobo
889,542,643 *5C8D54A2E4224C403176DC1BE6AB109B5CD4BEE2 [email protected]
889,542,644 *5C84B5A671F5AE2A659685A831B617C539DB3EF0 stanfordharless
889,542,645 *5C8C2945BE8D3A9DF55A768B9FA3CDCB17F2311C STANSMACK
889,542,646 *5C8B8C1E3E921A3D1A88FA277B0844A09A0B94DC [email protected]
889,542,647 *5C806802421C49571DF223F2E0E65B644513A16C "starwars"maintitle
889,542,648 *5C8EFEBBE2CF3B0B397B932CAAD38DEF3968E349 [email protected]
889,542,649 *5C8B60E1369830E5E8EB5A74ECA04E8B47BCDDF3 YEAHYEAHWHATEVER
889,542,650 *5C80596B3EE45E7B1FD05210EDE704148CD09A50 steve.kalinowski
889,542,651 *5C81B42BF320CCB66D4CDC6F02A83751F4B36702 YIWIKAITHOMAS
889,542,652 *5C85B3873278773A1961C58C35536340937F39D7 STRAWBERPEPPER2
889,542,653 *5C80640FC25BA6BAB5CC2E20582A3C0FB0043981 yllacirtemomso
889,542,654 *5C8269C71E9562CDAC5E40A80923BAF5C08A2EAA SUBVIENNES!
889,542,655 *5C866AD8C2C0830381CDECA3E76D46D5E460ACDE SUPERP
889,542,656 *5C867C4D9AA64921DC90A9782C908034B6A75216 Z|\*
889,542,657 *5C84F40AB20881E3F4A1931E65D60F000E31C6ED SWETLANAF
889,542,658 *5C8F2A1E3AA28A88211F5DD3D0AFF9604CA61794 SWINGINGBOPPERS2001
889,542,659 *5C87CFAFFE93112EA8A8ADD5A6E161CFBE217484 ZACHARY-TAYLOR-ESCHWEILER
889,542,660 *5C869C446E9B204DD140ED43EA9061E907D4A0E1 sylvesterpodwoski
889,542,661 *5C8973B62F606976B569CE59C8142092B5138232 ZAHIDNAWAB
889,542,662 *5C8ADCFE3CA92BC16D8B12A2B0308F6755EEFA5F szdf
889,542,663 *5C8EDAAF132B23BDC08EBC516992043D3710F727 TABASHSUM
889,542,664 *5C88303C3306399FD566D16A1B2A776AFEEE9E52 [email protected]
889,542,665 *5C8613390524BA689E0177E5C2D22117BC90B8F8 tactless-'t/&/ktl/I/s
889,542,666 *5C86575C63DF2C216EFE9FA3EEB38D3CCBEA02AA ZEIG NICHT...
889,542,667 *5C86707C75EB23E55172F2C688AA53ABF89D4360 [email protected]
889,542,668 *5C8D80D7FB67746AAB4E46F42C9A44EFFA17C81E TALKTONTENGA
889,542,669 *5C8F518EE603F8AE8C7338B160A4B632160B655E [email protected]
889,542,670 *5C89B1BA2DDA6523A7646A94CB15102D4083B5E2 [email protected]
889,542,671 *5C8B563FD1F39D57AFACE9D42492612B609B7643 TANIAPUTRIATIKAHSARI
889,542,672 *5C825F8BE78B0185FBE3F1C3B7B3DBF1FE86E6DD TANVEER DAR
889,542,673 *5C81881B01C8E873983C012A6C5D88CCEBDAE2BC TANYA1929
889,542,674 *5C8EEC6C6F9B77F59E535BE75255F7E7FA69000C TASMANIES
889,542,675 *5C85D4BFB8714B053EB4E2BB6C746B79BB09B46A [email protected]
889,542,676 *5C8290A9D14E316CAA7CDC3351A15DD532D71D04 ZWANINI-KHUMALO
889,542,677 *5C8DCAD30DDF927E72C939F467B488B10C3762CC TEA-PARTY-HEAD-SPINNER-SOCIALI
889,542,678 *5C8FB76A943027DC5BB719506A7DEE8CB4C7E427 TEHNLOGIJA
889,542,679 *5C89FF1833193D27BAEED3ADECCD620D426BEC90 ΒΑΚΟΎΦΚΟΣ
889,542,680 *5C87A389F0208CE70DAFC0F9D15939223A22E3FC ΖΕΙΠΟΊΤΗΣ
889,542,681 *5C84EA284862A37C134E3839AFC09F5906F68CF4 ΚΥΝΌΜΥΙΑΝ
889,542,682 *5C8C986CC29043E83F553DD21FE96B8518A65735 АМЗАНЛАСХА
889,542,683 *5C820B442D589C6CED65D5587BDEB930ACAD87F3 teruggevlogen
889,542,684 *5C88156EBBD800E985E1E673078F5E2F1A5B49A7 THADDEUSMARTINSON
889,542,685 *5C8C2F2A2ED39CEBB900526894DFC40DAB9CEF2F израиљском
889,542,686 *5C852A50FE7CB2A008E2DFCC03F4625FC996FF97 [email protected]
889,542,687 *5C86F1118A05E9E69177BAF66C860D90EE79490B імбабу
889,542,688 *5C87BA8EEF8C0F0709825CD407B086F385956F4A КОМПАНИ“
889,542,689 *5C8527929F4572F862549AE9712AD3BF500399D7 THATSHOGUN73
889,542,690 *5C80D4B316E22ED2F0B644C317691BFB3E2DA027 theabyss(30secondversion)
889,542,691 *5C870AEC29E3982969131793E4D21FE7565C0047 THE.FOUR.SIDES.OF.MELANIE
889,542,692 *5C86F96B1D18C3A79323604BC8B07BC455FC3A56 THE.GRIFS
889,542,693 *5C85452BDE6711951C70FA7AEE0B681A69E9E7AD THE INNOCENT MAN
889,542,694 *5C8351C99035FC8C69EF108197FB48E4A68998E0 themerlin05
889,542,695 *5C86C953B16C981D38796AF51DE5BA41BD6B4B23 THESPIDER1987
889,542,696 *5C89D0C162B78655B3F9970EC225CF19A74EB0BD TIFFANY1234
889,542,697 *5C85FAC66BDC751C0CF9168BFFCE4838EB08CBD7 TNTNETBSW5
889,542,698 *5C8F01942AF42BF14922794196E1C4685A0F4F74 TOBY.ROACHE
889,542,699 *5C8AB3BE53E10136C5E1CF3A0DBB557C5FB7623D TODSOLAZAR
889,542,700 *5C8D04257ADC876F2FE0FCC00560E0511F8B6141 TOLLAGE
889,542,701 *5C87AB02334E9F44E389AA48DBC2B9B5CF0CB921 TOMGOFORIT
889,542,702 *5C80862A8AC066C92D2BDFD61AE31898326ED527 TRAVIS.RAGGIO
889,542,703 *5C88554C84F00350636E87AB3502CBB7CEC35EA2 TREYBLAYDES
889,542,704 *5C87544A4D9487700E4720694A9DE648B51580BC TROY.HAUGHEY
889,542,705 *5C8F1C10DC328AB7A710C8AB2996683FBDC98B6E troylutkus
889,542,706 *5C89B1D852E7F7CFE2934CBA7F328E2017D06ACE tsurugaokahachimanfortune4293
889,542,707 *5C8452A531CF60E1A0DFEC2D177456F35990159A TVNVIHRE2
889,542,708 *5C8947A214CFD4F9A46E50FA3257909488FE973C TYREEANNABLE
889,542,709 *5C88C252EFB9B13D58FA63D4B97DEB84650AD9B3 TYRONEKONG
889,542,710 *5C848348A7B1D947D10CB2CD0D900B5716009A44 [email protected]
889,542,711 *5C81542845F8CE9C4B34CBC7166F0071ADE62D53 UERZIGENED
889,542,712 *5C897FC1FF61BAFD4AAA554F64D82F8A4FC18080 UGTUPDATE
889,542,713 *5C823818138C874E78381A29514EE2FBB9018F46 un premier jour sans toi (feat nancy danino)
889,542,714 *5C88E22CFA3F2B8E8AEA0B9D76CFBFD0AB0167BB UNTSEHELICH8
889,542,715 *5C89C6949F2814554ABE531DC30F8A6ED16AE08E urruch
889,542,716 *5C8BFFE7B413375FDB440F0CA9D3DD61C0C9BE32 VALENTINDGJS
889,542,717 *5C832C7ACE0B01B17EACF53AEC448F41F39C71F5 VALERIA.FUMERO
889,542,718 *5C8FC62A79C26685ED4702896D7B319D134BAB71 VALERIEBOZZI
889,542,719 *5C87939707341A7F8509FBA2F72C5F5C7374C38C VANESSA-LIM-AGNO
889,542,720 *5C86514826BAB61B9C30062636C2E3DCBB0F4E43 vardhan-koshal
889,542,721 *5C8C81620C2B3C60A4107E86A5175A3858D43EEC vaughnloiacono
889,542,722 *5C81CF72F66BA5694D7613E474BCF4D814C0A95D vedtagen
889,542,723 *5C8FD71F7A4A567E089C3BEB0373F8B7C9D32800 verergerde
889,542,724 *5C81B87C9CD350B2C9FBF3221C55EF313A9666E0 victoria-dunn
889,542,725 *5C8E6AA65AE345935E0992290474FE0CD9E2181E VIERUNDZ4
889,542,726 *5C8B4D9F832B76BA2762BDFB72C7EF14416DA29A VI%I
889,542,727 *5C8E630100D47662D573024676AABD3328E30D0A VINODAVIHRJ
889,542,728 *5C81EF33EB33415FA59E8D454BAA9A2A560019CB vivian.rudolph.jacobs
889,542,729 *5C870DD6ABC81C9D0881704B97AA55E7F9E1FB1B vlei
889,542,730 *5C8F816C6E8B8DE306D250CDB3BC9F66B8B647F9 V$RI
889,542,731 *5C8D8B0EFBFB87560807FD9C40BE0B9307A521EE 10-truppenverband
889,542,732 *5C82E9A7753B190C05CF50EBE3267AF72C6B90FF VUIDGFORMATBSW6
889,542,733 *5C87A9A0396D115AC158F0A830FDD6B02F285809 vuilbekte
889,542,734 *5C8FC9840767CB830D28C28342D2E29BAE0D644C 18.aikuisi
889,542,735 *5C8883C8711642B508EE594CB5B023B3A63DC3A8 18-kosovo-albanien
889,542,736 *5C817989300A2C37AF02819C3C409CAB8A415D1A 1986maira
889,542,737 *5C8600BE5D067B26FAD531EAEA967291B3A3081E [email protected]
889,542,738 *5C82F42B4FD8A9CAB01D03DA370A0070135CB465 wendy-bajrami
889,542,739 *5C8C70ABB78867440C222C26A44CCD00F0139C66 1CFJSEXY
889,542,740 *5C84067EEB7FBC62EB2B7B86BA9C23E8F6BED418 [email protected]
889,542,741 *5C8C963E88E63084DEF9BF8FECA9AA906A2402C4 1DISDUBS
889,542,742 *5C8E0A21B3830308935E47714386029075A8E2EB WESTFIELDDENTAL
889,542,743 *5C8F0AD5A81BAE1BB3A495A5AC07E2EB38538879 WH#S
889,542,744 *5C8ED38D484E8B0C9EBB8FC061F4B848EEB7969B 1 KURPARKCAFS
889,542,745 *5C8F4DB4817D5C1F22C461AFF52FC77033C19600 1 LASSILOISTA
889,542,746 *5C8045FC9091DA615D7746484DFC16D370F69805 1LIFE-RUNNING
889,542,747 *5C884B4C2BCD1B4A573A8C392CD75BDAA61F9D7E WILLIAM.COAXUM
889,542,748 *5C82CE328C662A0E4CA108117469D277C47C98DD WILLIAM.COYTE
889,542,749 *5C806F075C97547DCFBAA05581AFF300200510E5 1-MISSIONARSTAETIGKEITEN
889,542,750 *5C8FDDE39DACD370B75451B2CD9E6427A466BEB0 williehaine
889,542,751 *5C83B6D9A00BBE40DA389C6A036FE64813B780B9 1.NICHT-BESCHLUESSE
889,542,752 *5C8B81592ED3AA9A92BDF3767FDCEAFC65A633E3 1-ONLARINKIYLE
889,542,753 *5C8FEBE03669F9C38C42C7EB3E3E0196188C03F9 1PARADOKSAALISIIN
889,542,754 *5C85C1B6652226705570BDB87A5C7CA10757CFC0 WINFRED.VANSTEE
889,542,755 *5C8254115068202F4073A1BA34FD908E308C77A6 1.ready-dug
889,542,756 *5C849F815CB2296C513F7A2EDC6426ED180FB2CF 1shomura123
889,542,757 *5C800FDE7B739AD6FB7120A1F51AAA7DEC35B7F9 [email protected]
889,542,758 *5C85CA23819B4CE881E5FFAB95CBB0EC9436B7E7 [email protected]
889,542,759 *5C8932D71322C66280C56F502C333748DC5A6138 215.LYBRAND
889,542,760 *5C862EE42551B0DADA659185F6AF53E069919894 x5st67r
889,542,761 *5C88A9BD144FBCFF312CDE9F94B64B4AADB56ABF 23SENNEN
889,542,762 *5C88FDCB85CCFED6E0E3DB84ACA6591447A42D16 XIAOMUNDA
889,542,763 *5C86276C44966ECC0588BEA0322DF6501A6350F7 25252525252525252525252ddoor
889,542,764 *5C8D637336DF0915ADEE50ED96F723268E3BF928 [email protected]
889,542,765 *5C8FDA0E7469DBA0792FE2493EE49752B7FAC4CB XMYUNAMEBSWS
889,542,766 *5C8D17D040D58E2C33CDAE87CADBBA1085DAF591 26may1166
889,542,767 *5C85A6883B30070548D808F66662FAA8C4606F4C [email protected]
889,542,768 *5C802F968B37B445B2474DFA9B15529DD850A4DA XUHUANGYU
889,542,769 *5C85B6B863D5D6FBBFB70EBD51FA9DEBFFCEDD0F 2987934 LASKIN-(-CALCULATOR-)-LASKIN-ON-VARSIN-N
889,542,770 *5C8E3BCF6F197283C6E5B57D93BB5BE6FF3C7B3B 2A5DF393598D7F3B85256BAF000827BE
889,542,771 *5C89D453215276EB9BD91D35F8024008F2A127F1 2.aciklamamizi
889,542,772 *5C8AB26EE4EC2BCBDA81089AD1A254E719E5E362 2BORDMONITOR
889,542,773 *5C8D52CF58C6EE2A6003F28427C053474BE69A32 2-CHEFREVISOR
889,542,774 *5C8A6916A780A73523C618E1914CC14B9AD0D3CF 2 CONDOR-SPRECHER
889,542,775 *5C8492FB8D15E3BED30556484BF654FEC76896A2 [email protected]
889,542,776 *5C81BD6E0A5F8F8F48FDDE44088E0D527545C043 [email protected]
889,542,777 *5C8200BD8817C6AF5F5256B4C65456F5A2D30CD2 [email protected]
889,542,778 *5C842170E61E82F70B38A5896B9F3088C66ABC7D YARA-ABDEL-KHALEK
889,542,779 *5C8B3FB6266F40FA31EA692FE81EE33242CF9E02 yash.chimbaikar
889,542,780 *5C86C18FCE578A5ABF090E1520693E967B031D66 yasushifukunaga
889,542,781 *5C8D1ED80AF63395B87F1D777574AE40686B2D2E 2ilkelerimizin
889,542,782 *5C8960C2EC11F53CD7CED1709B11FC6F7348E2DC 2KIRIKAER
889,542,783 *5C855FCE6905B837D079DB077119E79404EC532B [email protected]
889,542,784 *5C88BBCB95FEB624961A4F3528F8DD61684DF49B 2.KORINT11
889,542,785 *5C848CC3798D46FB836A3101C1CF6042396493B8 2.OSSIETZKYAUSGABE
889,542,786 *5C86ABC0CDB19FC0875062E1AF83D1EF8A175291 2PRIUATO
889,542,787 *5C82F15D9A0A682081A5CC2DBF656E50EECD7588 Y&K(
889,542,788 *5C8D58CE8DC6E16C1CD34D25C2EBAE35AB884B7A [email protected]
889,542,789 *5C844A2C17FA84C68495AF871F63E7CAA0453842 youneverseemebackdown(lucaremix)
889,542,790 *5C87C054E305BE75356DF1ED99265F59144DC99A 3BABBELEND
889,542,791 *5C8BD5246DA95A8F49AEE777F677813AA3D70A85 3===B.~O.~OSPLAT!!
889,542,792 *5C88E12599AB58F4162AF4BACA64DC31C409DF37 3EILANDBEWONER
889,542,793 *5C847D494D2D3D35609A9DABC9566B0976E5D600 3HERHIL
889,542,794 *5C8E44E73E0999C9ABEB1EE6A0039C30D224CDD5 ZACH HOHLOCH
889,542,795 *5C806F1BD76C210BF2682AD6E4434B8538FF6ED6 3MUETERZENTRUM
889,542,796 *5C8C3FF6A8D1CC24011A1706F913C63C611D929A ZANESOUDER
889,542,797 *5C8588C3CD805136FDB55010CA195A6264DE019A 3STUDERAR
889,542,798 *5C85DAF69B9517E21165C74476EC401FB99A0E3D zavrtela
889,542,799 *5C8DDF1A10F5147B8CDDA11268B47166B79CBEDB Z'DH
889,542,800 *5C8055A099FF0E6BDBDF1E737CBAA2E9F620764B [email protected]
889,542,801 *5C81A708D3B792067127440311711BE0AF747E10 zf,|
889,542,802 *5C8C606EE929275C6CB7B490FC0DDAB6473DDA81 [email protected]
889,542,803 *5C8F646AB26D4BF4153DC76AAADCDB445A4F4359 [email protected]
889,542,804 *5C888C7B936FD9D6811A5DB8A0565EB2165ED262 4ISERMAN
889,542,805 *5C8117D601EF8CCB60A9B63FEF0C16FBC834BFD8 ZOILACONDOR
889,542,806 *5C888DBAFD3D0654FFE801DBBECFB11B5786BB72 4ORCHESTRACHORDOPHONECOMBOCONCERT
889,542,807 *5C8B758DC05042B773E3A4BC4F6B905CC2A204C3 4PAERETRAEERS
889,542,808 *5C8F10B057A44C82467F99F77FB28B8A7935EDD0 ZUBRNICKÝ
889,542,809 *5C8745BD5AD512B1D1F32A21C647609B67C273B6 4SHADOWSBRIDGE
889,542,810 *5C8963FEA2E2BD311162943F1375049B3FEDE323 4STEELERSDOGGIE
889,542,811 *5C81CA65A062622BE68E473E79773E1001C4F7EE 4TATTOOCANON
889,542,812 *5C89EAC1C95204EDA0522CDFE6781DC483A86D34 Z(ZW
889,542,813 *5C80798D507E94550E046AC23D160CC650B6162A 568003 CENGIZTOPEL.CAD..
889,542,814 *5C8B456893A6AA0C76E9D9FC8DA47694E48CB4D6 бенитцкий
889,542,815 *5C8DF01E245B22697990BF8157DBC014A01C5727 ВСЕМИЛОСЕРДИЕ
889,542,816 *5C8E446DB7DAB33BDE336E727F29A7A6D8C22B99 5iamadmin16
889,542,817 *5C8222BED37A03C8CB45BF446BA676B3AA1BA366 МАСКИРАЩИТЕ
889,542,818 *5C8E43CC2B3335802095A5278FD7FC704A7972C3 5JOSIEWOLFGANG
889,542,819 *5C8873B9FACC3943C5BE28C65F830763651AFAF0 “плиска’68”
889,542,820 *5C831D9DB2B8C196A44487B21CC164B4543EA5F3 ПОРОЗПЛАВЛЯТИ
889,542,821 *5C882A74EBA55B69B43283460FE047C6DA0027FC 5PETITS
889,542,822 *5C87D3A8D8522AC520011B16CB58728DB849714C РАМАНЫ́
889,542,823 *5C8002DF4DB86647E2F4805402F31D3E2A88BA68 сараеву
889,542,824 *5C8022B9D39BCF3437A3DBB8686FDEB47408DADD 5SICHANNA
889,542,825 *5C85905F6CA71C8A3315A1C8670D336B799A01FB ХИЛИЛО
889,542,826 *5C82578F358C3130D054C258472570A5C3F1B10F 60DR
889,542,827 *5C80F616EF16F5D732B2EC35B152FD3671E9AAC0 61645 TAKEDENMARK,FOREXAMPLE
889,542,828 *5C868C553111374E2E009056324641C26D256715 66 FLOUTED
889,542,829 *5C84E8FD7735AD0EE5E0DA9495054AE9BF012FDC 6.basf-vorstandsmitglied
889,542,830 *5C84BF1442110662DD964EE6FB545CE46A80555F 6BOWALYNGE
889,542,831 *5C828CB6AE26CDAD28C1A1EFD956339E3440EB64 6DFALTIGE
889,542,832 *5C80F07EE93421853040B52A9ADA722B40AAE670 6EKSEMPELTEKSTER
889,542,833 *5C8540D07EABA05AA76971779F344D778BD62FB7 6ENDENTELIES
889,542,834 *5C8F38FC75958A5D3ADF9F8BF3688158C73D6F83 6THECHANCE8
889,542,835 *5C8A9B0159BFC0E1C02B81EE1A0FE0CF9FC19D3F 776COLIN
889,542,836 *5C8D96E3F4849C2406D389A1280EBBE666C3B4CC 791461 P
889,542,837 *5C8190F83B756A30F6046FAC76DCEEC311B08077 791641 FATIH.M...KAVRUK.CEVRE.MUH..
889,542,838 *5C89C4F739CECCA7C4B42C3957462D8E738E1074 7BACKFORMATIONBSW
889,542,839 *5C83BA8732F2813B9E551D362B31F53E69A033DD 7BJOERNSU
889,542,840 *5C8486D1B7840A7140C8F6D142267FD4A2F12A16 7GABYSPANKY
889,542,841 *5C8635207695BECB1E03A796832E0DC7512427F6 7HAFANDE
889,542,842 *5C8C1859544B557A7FAEFB7F80C8B07A7BA3DF0B 7JEDOUCIMU
889,542,843 *5C840969E5F9BE4587B636E3FB1E01268343F243 7KEUKENAP
889,542,844 *5C8B9A83A3EC1C338F386871A7F3BF7C682926D5 02.05.1432
889,542,845 *5C86EBBEE6483F4502DA405D457C98138B862939 052163718x
889,542,846 *5C89DAD8508E3556F7A32A091528AF9BDD1CCB8B 1004905 kainulainen.sakari.ja.niemel
889,542,847 *5C8877094AC327C95534499BFD5B8B5D433A0A68 1005811 abermitfingerspitzengefuehl!
889,542,848 *5C8C3806E976E17684660E1B7E01F25AB37E0A90 828154 KIRVESPUPUTTIANNAKS
889,542,849 *5C88CAF3BC844F1BA6D7D6DE308EFD8274F3648B 88C5F428F41C40EE06BFA067EDB6F1DF 712817
889,542,850 *5C8B9187EAC89057C0A8142E67B3D848BD82892B 11051097
889,542,851 *5C82AF5F80868772FD363C0628F2481E38F7D89F [email protected]
889,542,852 *5C82C5DB29C523A9437B5E0A4488E234C728B654 1226193 LAAJENNUSOSAN TILAVUUS ON 3580 KUUTIOMETRI
889,542,853 *5C8040DACDFD7EF2397F9622E69A5E9E0183DB72 8######b-~o-(x)
889,542,854 *5C87C024378EB5D76B2A04B003FFDE05D658F578 8BRUTUSSNOOPDOG
889,542,855 *5C80BE1C48D1CEB13C269175E8A2E8A2B304D7F3 12-n
889,542,856 *5C835990D212952872CA8FBB5CA47C4DD3A4FBBD 146761 yoncanIn-tarImI-
889,542,857 *5C8CCAE608FDAECDC86FF803B3C5FCA8D46B2CB5 8DOOBIEPANTERA
889,542,858 *5C86B5E13FE5754BF725761E7241698C4CBEF510 8DRACHENBOOTEN
889,542,859 *5C83B5D52F0FF14384044B9B958026C7C4797E28 8EICHELBERGER
889,542,860 *5C82718DE40EA3B041C4FE5F459092A07EE67A1B 8FELLESPROSJEKT
889,542,861 *5C809EF65D3A48A51F4B7503837EB2489BAC98D2 1693271 KURSSINPUOLESTATULEEKOULUTUKSESSATARVITTAVATV
889,542,862 *5C8CAAD3F60AF41B5853CDB93560219A7A5DCC17 1731162 so zankten wir uns
889,542,863 *5C8119BF30540DF3A88AEA486FE967AED8B56EC5 8HTIMANNEKIINEILLA
889,542,864 *5C8EC127B1695B669896D5C6C2FED6A088DF07AD 18021861
889,542,865 *5C878B58475BDD697F887EE4D7BE97F8CC6BFD89 1AURAJOKILAAKSOSTA
889,542,866 *5C8719B66EFBEDB5D46DA5184EBCF88597EF137B 8PREDVADEJICIHO
889,542,867 *5C8FB30891349F9E1590B199BE306212D4F0D6EC 8REKOMMENS
889,542,868 *5C83466BCAC9DD037E137674491F43189C8A3BF4 1-devisenkassahandel
889,542,869 *5C818CA2D1393B044700E62D147A00C2BD5909D8 1EINSCHLAFSCHWIERIGKEITEN
889,542,870 *5C8DD103802DB42BCB994FFF45A54ECAFED7AD9F 1 FORGETTING
889,542,871 *5C802F3E860E1F2D314DC0C2C4B6AE7DAA29332C 1FORSBERG-NIMINEN
889,542,872 *5C8633D41D591137FF84C066809F4DD825C592E4 1FRGMNTRY
889,542,873 *5C8B084E876F371A9FD4C9CD1B8DFD29EE77C3B4 8VELEBNEHO
889,542,874 *5C8F7F95A22FBFBF2B1C265CC5F54FFE607E0571 8VIDVAAMSAM
889,542,875 *5C8E8B0E0A127DB422F15659AF408B09898AC0DE 1 HALYOLU
889,542,876 *5C877616A81E529C91309AD2E411517CFF9B289D 1.havaitulla
889,542,877 *5C8FB4DDA545F1FE535FEB3917C1C0895EAE5087 90210SNNY1
889,542,878 *5C83BBE21F505CED6544251612DE01B744F224E4 99999999PARROT
889,542,879 *5C8E732403EAF92983292471C8C8CDE07EF2F218 1-kylpyhuonelaatoissa
889,542,880 *5C8E682B2C8A7446B7B64AECE29491138AD1A181 1kyrnitszke
889,542,881 *5C8D519D41E715DA25E3083CE5F7B9C38BABA277 1-naomista
889,542,882 *5C85F44588B93EC904CED66F9A5C581338F34FEC 1.PONNISTUSTENSA
889,542,883 *5C8A995D5F9FFB5E0EC8A34A0367859AF8D25865 1-PUMPSPEICHERWERKS
889,542,884 *5C828340479E800E8D949CC2E608089330264B59 9MICHAELHENDERSON
889,542,885 *5C804B0D1EB5BCDA788A8C0AF1162AB0B97AC2E4 9NDIARIST
889,542,886 *5C8006D2763B44C05379D6D421289861065B1871 9NOBEL-HOTEL
889,542,887 *5C827E2378FAE47782544448DA8412A431A09E9E 9OMPARENT
889,542,888 *5C846EA3DA1FD74A53E112B1C227D9ADA55271D6 9OMVANDLADES
889,542,889 *5C8B086290BCB32E0F7E5C8228E9EEE6FCE3B907 9OPADAJE
889,542,890 *5C89AB102FBF8E6FE33069111BEE31F3A7BE13AC 1 RESURSSIKASVUSTA
889,542,891 *5C8E8D0E9D3580A617026B26A5D9C427768F1E8A 9REFUZEN
889,542,892 *5C835958A1EEEA63E6E00A6F9CA9DDFBCB973346 1.tavaranvaihtosopimukset
889,542,893 *5C8C17DE8CF81ADECB00017F2EE540D6D6989A9E 1tsaarisuvulle
889,542,894 *5C82B2E23854E09D9ACEE3C789E860B7B39A5965 9YPOSTELLEI
889,542,895 *5C87B3AF73F180AD74ED4DEC3B14621EC3D3F000 a0gn(
889,542,896 *5C8FFEE32074DC071A21A0D8B9CC51365F49EC8D 2059323 SIEKLINGENSCHOENWIEEHUNDJE
889,542,897 *5C8DBAC288CAB110BA00BE109294C2CDB5502B56 2094951 AINAKINPIIPPUKANGETVOIDAANHANKKIAVALMIIKSIL
889,542,898 *5C8B1BC0F965B93A37648C74E4A07F7E34972F7F 20MUSLIN
889,542,899 *5C875345AB7913B65E6BAB3E1F19A14D22FDF191 2376845 oli-kirkkoherrakuntana-1639-n--1702-;-nelj
889,542,900 *5C8EAB8DD3EF74EBAB6CAF93261E00BB4DCBBE00 A#7K
889,542,901 *5C85D0E8FCD929604D5FF733AFD13FCD652B771B AA6C/
889,542,902 *5C832FBF26AD497F65BE2B5C82E3F6D9B1A7D9BE AAA!J)
889,542,903 *5C8FB8AAD8D43DE25257349790CB16C4C4E4B8BB 2FHANSON
889,542,904 *5C889402CAA4CE6B1A212E2015FC81CB8D193AB8 AAC~|G
889,542,905 *5C80789B70FDFE57AE0EE767FCA1184CA5721C86 AAEEJ)
889,542,906 *5C88ECF3A9278442DEE920A31E00869898139D3B 2MERSEYN
889,542,907 *5C8E4CFCBB3FFE51BE461AC421A1D7551141742F 2NACHDRUE
889,542,908 *5C8855E96FEEF2204B9698FE90C4EC81597CA95A aae^q
889,542,909 *5C879ADC1D9A499472AF6540CA39A70BF57B96BC 2.SWANSEAWREXHAM
889,542,910 *5C8400763E58232C28A7EE18C7ACC76ECBC34CA8 AAROHAASHCHAAMARA9
889,542,911 *5C8B520333B610F659F6C3C6306CABB2CEF38F76 AARON MORNEAU
889,542,912 *5C8BCB565B24301745FE68343E5C455F9647F076 [email protected]
889,542,913 *5C85081BCFCDD0D1788832E84AA732DA0D385E67 aawo_
889,542,914 *5C89E261F3C9092C11F8E30DC31BED6C766E1055 abe-valencia
889,542,915 *5C803E07C12B87A747D2DBF6F7A2C754180B216A 3b*.3b<
889,542,916 *5C80476CBF085420691B8BD69EA6751B164A0B2F ABS0RB3N+S
889,542,917 *5C8A6CA4417364DAE7182357AAF3F1769EF32B99 AC<:0
889,542,918 *5C8101D75B42A1F0F6EA5253E4C71995E2025437 ac55e
889,542,919 *5C836747DD4795BE8C7F0AF3262E70F7AFC8FDA9 achnopogon
889,542,920 *5C80A9799C540B07EC995FC6E8DED7351D7312C1 [email protected]
889,542,921 *5C862D5EADA61FBF979333F3A8ABD4256F205B6A 3-tokarczuk
889,542,922 *5C840742F53E74DAAE731D1A9901E049263B0C95 401595 JOKAISEN-KYSYMYKSEN-KOHDALLA-OLI-NELJ
889,542,923 *5C8580B80A0B148CF09F6103ECC7345CC16A3D3B adalbertoeinck
889,542,924 *5C81EA1305DC181CCD22D468446EDB375C1C38F3 adalbertoterwillegar
889,542,925 *5C8BEAB018CB092EFF80E347020BFBDBA91F22BB adamrusch
889,542,926 *5C86AE58D122AEB2BA0CC977125E4641B8C5F45E adw6
889,542,927 *5C87703F5E1361827E3F37D1FB1BBD8D9EA69530 aeltestenrat
889,542,928 *5C8C796E9B5A0B0F6EFEE7FAD13C6A2C15D4FCA7 afgeblot5
889,542,929 *5C8570075B2EE96F022B7EE30F11986649C31FFF Afwast
889,542,930 *5C8A93EA0B350977B58A9DB117BE6804864B013D ahillebrandt
889,542,931 *5C854034D9E67C7FBDAF5DE53E01C7650E6F5480 5BSWVOCALEBSW
889,542,932 *5C842C8E1654FC2ADD600FEEB46990124A17CF74 A!=i
889,542,933 *5C8FBE5340BACDC04794B5C9546F2D0ECE74678B 5ERFAHRUNGSRAUM
889,542,934 *5C8E4B31F8612A76DA59BC662927A88598C6CFDE AILANFEIHE
889,542,935 *5C829CB5DD8D55B1ABEF31414A092F6FBEF12F40 5FERMANELLI
889,542,936 *5C852BE3EEF3E05FFB9284AD73EA6AB96F2A58E4 5KORYFHS
889,542,937 *5C816159A04C0B88A58CE97E4ABE4E0E4AE910D3 5PREMERMI
889,542,938 *5C8127E00E3558178BA7C46AE2963E80138771A6 5THECHIEFS4
889,542,939 *5C88B3EDF4DBAA25304A525D3F40D61C3094D765 5THESUPRA2
889,542,940 *5C8C87F422BFC3B0FF880C3DB9A1642040FC5B0F [email protected]
889,542,941 *5C831BBD3BF51698894E423F778A9FC09D05A8D1 5vbvxrubiif
889,542,942 *5C8249C77E0CB856FC2FC81CD8B1A8ED4C264E44 alemolou10
889,542,943 *5C8750A8CBC917DEC8ECB6A4F8F14D399B052362 6CONTINUATELIES
889,542,944 *5C87CCE170263899B22DDF9C3B87A1248CF69636 allbrit
889,542,945 *5C8E75278CC54B766CE4CFE639605D9FDFD9F16D 6IAMSCARECROW7
889,542,946 *5C87C3035689D8E14E5020903A9F8E1D85D781D2 ALVARO.OREFICE
889,542,947 *5C82DCB013E9BE83D6C78168F62AE044C701D84C 6MIETAPPARTEME
889,542,948 *5C887A22867D5F32892581A755CA5793CBF1B266 ALZ5
889,542,949 *5C8E266AAD7AF684CE10F499D8A4FECDEA41A19C 6RTRIBUERONT
889,542,950 *5C8CA4ECA0AB96E745FAE3012E0F94CB322611B7 6SEGUNDERA
889,542,951 *5C8F7C26FE7C55D178D362C1E308A00A30A26A41 AMLUCFP3
889,542,952 *5C84751B7114687D2FC8DBB80081097A52ED8B36 Amrh
889,542,953 *5C8C25988E749EA75FA4B3FC9BB37CDE1C7FB6A6 AN+CPA+ORS
889,542,954 *5C846A6321D1158D273A252EBFFED081CCB15C7C 74ROBERTO
889,542,955 *5C8B7F5C57209D25A4546E6CFB84CB436E0382F6 7ARGALLARGALL
889,542,956 *5C84874701DD98D1F65E3E4667D589CF460206B7 ANDREW_KENNETH_WATER
889,542,957 *5C8E23329C551090747E6919F0C176B810915D0C andybuffum
889,542,958 *5C80764663158F573DA5CD4FDEFC4454129E6A6B ANDYDIIORIO
889,542,959 *5C8E1257ADDEFDF5ECC9AFAE0F1EA5D5C83FFC62 7BLESSIN
889,542,960 *5C82E224D4EFFF5C9352BAED35F4DF1C33A1804C 7CESARMAYDAY
889,542,961 *5C87AD1DB406F19849725D4FCBCB5114D149A0BF 7F04B470-A997-3789-A18D-4C9DFC0F6700
889,542,962 *5C8C2C30DB84BFEC10F09A4748363C9C8A7485DD 7GREENTRAINING
889,542,963 *5C8D5E33901EBE8D11847546D1AD447DD1EC5D93 ANNLAURIS
889,542,964 *5C8B26A1A167B1F7768F5A4846794E12871ED779 ANTICATO`LICA
889,542,965 *5C8BE7FC4D02B937F508D95A50ECE7B4DCA292F1 7MESOGLAEA
889,542,966 *5C8DBFE63A6BBF8BEA1079DA8C8FC93E7D7246BA ANTIURICA
889,542,967 *5C899E1B666A9E6FD6DFBC04C09BDF12956E7AF7 7NELSONPOPCORN
889,542,968 *5C8E235A2D1C99EAE8824AD09DFEB7D7AA99E25B 7NETNAKRI
889,542,969 *5C8EF45E8EFBB9CB45C99016F7717E527D48EB7C 7PAULWINDOWS
889,542,970 *5C89CECC934F01FDC9779024CC4A95BC9273663F ANURADHA.KARNA
889,542,971 *5C85EA848F0748E3BFDD35813267E4A1C1304EE9 ANURAG PARIHAR
889,542,972 *5C8B491B81C76B2A1F29CE42227803709BA221CF anushri.agarwal
889,542,973 *5C84E90E5DDC597E8EC36D0A6CDD65145C9B1035 ao/9q
889,542,974 *5C893C8488DDD6D5CC803F87A1E13A07C7BE9D44 7SLYSHIP
889,542,975 *5C887AEAD7E1E1F21DFA933074916E3FF120CA19 7SOLSTITIALI
889,542,976 *5C8C83106A4249AE886C9EE10D4B01DC1ACA0AC8 7SPRWTST
889,542,977 *5C8776A906BAD94026573928160FEA3C96D242D2 7tapanille
889,542,978 *5C89A2A5B86F4E2BCDF4E1858686DEFD8D096C10 7theelement5
889,542,979 *5C8F927167C3F6A60AB9C291C00DA9AACE01F2AD 84 SURCHARGES
889,542,980 *5C8F804A988B22776551341C59CD19882120EC73 A%q;
889,542,981 *5C8D7595096ED0CCA76F6CF04099D529A5E01919 AQK1D
889,542,982 *5C8C2C5EB3BE0D57A0BD62EFF46E1D35C7A7D332 A;QX7
889,542,983 *5C82B94F6E465E8A2C5FC02A2043A73868D3A01B ARA
889,542,984 *5C8D055A426C5BEB991C474A6C2884D24737E422 arcniaving
889,542,985 *5C8D0A05CE494B70A0F47BEA045689E65D947F73 arlendonning
889,542,986 *5C8A93830372B51F149DB0CDA088A42BA0B81509 8ISOELECTRICPOINT
889,542,987 *5C8DE779440733044F5A25007753F10E1B3CA8FE [email protected]
889,542,988 *5C827CD2063F4942EF79E24D59EFFC3CC12A6835 }8{[email protected]#####p
889,542,989 *5C8F5BE0220F84041BAAAB084757163B0BA9DF37 ASA.SAYKO
889,542,990 *5C80DA8085E5730931F6DF90033A5F396A7D7B0B 8p * }o{
889,542,991 *5C891432F9E636AD9D886573214EEA679027C021 ASDFGHMASTER
889,542,992 *5C84580C7E381F991ABB0CDF6491B3554C47A2AB ATADFREE
889,542,993 *5C80E39E70B58E9A0160775B9F7C332EBB48861C ATDO:
889,542,994 *5C8B9EE38C5569C5CACBE83430A3BAC197CAB2D2 ATJTE
889,542,995 *5C836C951475942DFBF43E1645560FE597ABA4D4 9AMYCLAEI
889,542,996 *5C8D197AC174A15065D476898E82021B40D77D3E 9 DOMSINGKNABEN
889,542,997 *5C8C9B0B217028657F42AA19A64E76DFC2CDF6D9 =9EAAA
889,542,998 *5C86FC7EDB63259643C7D5CC0DB95743E67E7D07 9EASTNEWP
889,542,999 *5C83C00163F5D268C2A435F4B68F774B3EB20552 9EJERCITARLO
889,543,000 *5C83AFF9F9A0364FE9C200E5DD9B740D51405F6D aureliokoppelman
889,543,001 *5C8ABBD17D77BCE161903677E61484B461CFA468 9JAMWPGEOJUTU
889,543,002 *5C8A71DBDF45BF314DCE814516306159CFF35009 9MAIWALD
889,543,003 *5C81138E75D44C73A24222C4CA0822382938B2CD 9MYABBY5
889,543,004 *5C8F39659313B609AFC917884FF82E9A3883A9B0 9RENILRIA
889,543,005 *5C898D5CF4271711803E148BACCBA3125B86E003 9SAALIAN
889,543,006 *5C82ED664E3E47CB008E6361E1D57DB40157C7D1 9TEMPERATUREH
889,543,007 *5C806718D1B8E20231D1B0E5A8B3F6981D989E6B 9thatasdf0
889,543,008 *5C8D91A89D56ADE56C53E6D968C4A56CCD24D0F7 a02o5
889,543,009 *5C84F4978F9BEF52A2EA9DA44202453F171F3DB7 A0U2M
889,543,010 *5C8D8A85978E66703C30031FBCF705AE013E6EDD A2pr
889,543,011 *5C8E569842D6E63E30036E8D9625129810254A11 A36390112
889,543,012 *5C87DDC01A935B0B3EE7645220C1F75B44093CD0 A+#4
889,543,013 *5C8F5B4D151AE427CD692DC2B568EA86CA61DA10 B3Z
889,543,014 *5C84041176D0757E49E4C2BBB28118F78E26AEB4 B5YPQ
889,543,015 *5C8BC292A1BE86DC211B144B671B75533BB4CC9D %[email protected]
889,543,016 *5C80FF1E8EC3AE3E50902D78646D5ACBCD6A197C aaa8%o
889,543,017 *5C8F5267D7FF81E17D4E765697455C86F02DAB68 aaaa,o
889,543,018 *5C8E5A92F4E2C16C18BC044B68F9977232F39EE6 b8vsn
889,543,019 *5C83254AD0E7153BAF563A2FD9B366F2828FCF78 AABFEM
889,543,020 *5C826149612CCA31BEF31D47668B8819D80879E0 AAFM;Q
889,543,021 *5C88F4AA68E0F8D0C6313AE161C8DEF567880078 AANEU
889,543,022 *5C8341E09DB2F1A38D4DE4817ED02564320A1DA6 AA%VC
889,543,023 *5C80BE9CA32CA82FD6670EA93606EE349179CFA4 bbmok
889,543,024 *5C8FC6AFEF83049FD3D21C9812BFA75B31E6DE45 ABOMINATIONSOFANCIENTGODS(LIVE)
889,543,025 *5C8AC90F64DBDE0598CFE03B5DCA882C92B93E78 ABRAHAM.KEPLEY
889,543,026 *5C888D11404782D67E49795A11F4ED08EF9D9A1C bdahy
889,543,027 *5C83B0F8B29271506DFEA974767D152C7BBE4DC3 B#####D*-*-SPLAT!!
889,543,028 *5C88BE243B16FC0D4E14ED186109B84441F1E7C2 b$dv&
889,543,029 *5C814F4E2FB26E47CC3822D6E795EF8C7B7DB566 [email protected]
889,543,030 *5C850FF74CE2D247ACCE5E01A5F0F79E26695E8E BELINDAEDER
889,543,031 *5C833EA63F3DB83A161A10E67CC6C5C44A44864C ACTIVTEIT
889,543,032 *5C852BE784E817E73E4F18292B783AECF416272D adamaudette
889,543,033 *5C8F7D92291433606010E807DEBE08CBC5019AC6 [email protected]
889,543,034 *5C8B57FBCE649EF33197BDB62697F5EBFBC031A4 betreute5
889,543,035 *5C8183B9C843278B84D330ACD11E3B4797504C13 bfli.
889,543,036 *5C8D342DB1873BF086AC6F2F8721F8B286079A6C [email protected]
889,543,037 *5C88CD1B4080D1232E29C75CCE8C8AB2229D768F AGORAMANIAS
889,543,038 *5C8D9AAA6B88F516C57BE9B225860F2910D5A28B bild22lyr
889,543,039 *5C8705A42F68F4E3FD506542A21A9F65A065B9BC AGUSTINMERIDITH
889,543,040 *5C806782FC925A2E74BFC188F57BA9B83C7A76C9 agustinproscia
889,543,041 *5C8A95AC4C0EE50C02AB63FA4863D0C277A4E7C4 BILLIE.DUNLOW
889,543,042 *5C8F599F3DF16EC9AC4D625D08CEA0BA1ADD993C ah$8q
889,543,043 *5C8554712410D16DD1BB383E4D7E4A6C15230C06 ah-=r
889,543,044 *5C87CCDC2225399A2911A84F60799613BB9E33DC bizw.
889,543,045 *5C852822E11060D548FECB989C6DA2CED8F68429 AJ)EE
889,543,046 *5C845AFF82A04BE3A90DED18DAD9736880DA743D blairrayside
889,543,047 *5C8EEEAE5963F84312A5EEF949AB397A45355941 BLAKEFOSTER937
889,543,048 *5C8172C375894DDC860206165B6EF2CA8CB07496 a.juu
889,543,049 *5C8A9E5A6692DDAD4E972885667220CFC69445FD ALECGRAIG
889,543,050 *5C868CA6ED67AECA0C7F47FB53F19F4181965ED8 alejandrominugh
889,543,051 *5C83954AB9CEEF4CBED8E172463D09EEE4A7182B alexandrawantochrekowski
889,543,052 *5C83C641104F78B2620A31A5E97E2564A9425115 bnu5d
889,543,053 *5C864BE234732A4480F730BB24240DFA796F0C92 bo13p
889,543,054 *5C828F12A55B40039D3C63274EF685284483B6CD BOBBIE.GLADDING
889,543,055 *5C88E09C6FBA5B43C204BD34DA6BA30DD2E1031C BOBBY.BIGAUD
889,543,056 *5C8C7BCBB5CEABB8F1A82946D5F6ABBE269E9530 ALL3R913S
889,543,057 *5C8A68B137405299EBFBBE95C534707197CFE09C [email protected]
889,543,058 *5C8CF39DBAD5FFE0CC3AFE2D4715C42ED1BF57A6 bomie
889,543,059 *5C8DEBAA2748855BC6949DC9A68802012B190C36 ALONSOCAPPEL
889,543,060 *5C877AB9C3BD2CA951692C8941684DDB16C58A33 borfil
889,543,061 *5C8722E534245B6736C30CC4AA062E13C652FEAF borw
889,543,062 *5C82905AB3F0926308F167A0026036CCFDCD669E AMANDA78
889,543,063 *5C8DD6349964CA783206E625DE01C49A78E9D35C bradfordscharpman
889,543,064 *5C8B74A9E287ACE7B777D3055D8AE92C93DE6929 ananda's.bassmaschinchen,.part.2
889,543,065 *5C8215A8105FB1BF2B42B84AA75C150983D6845B ana.ntarah
889,543,066 *5C8FED92FCD1F826F8373658341BFFAD45165F83 andreasvenema
889,543,067 *5C868C6F2ECA531BCA78DA102B24E190D7277231 ANDREW-MCGEORGE
889,543,068 *5C8DA228EC4C4B7414566161E9E82EDE7B7C0810 brendadonahue
889,543,069 *5C854150C5F108E45BA9536EA473F4DF7FFD09E8 AN(LG
889,543,070 *5C8DC8DC660BFF5BACC8AC47D1E6FE3976DE52F0 ANTWANBERG
889,543,071 *5C899ED15EF9C4934E100FF9FC89B854929EED75 ao+0t
889,543,072 *5C8C1322ADC15356308D09AEC395EED2EE02B908 [email protected]`~-`~-SPLAT
889,543,073 *5C871C511CD8D2BC1DB3B522739F3241AF1684EC ao-ik
889,543,074 *5C8AE7D52410FE1B18C8AA0C87271EEBD07BEF9B bswmuzbsw
889,543,075 *5C8639653F12606A7A10A151BDBC85660C09E0DF aosks
889,543,076 *5C8BD06CF3B9A5E50F64387B684C17571C62A82B BU1O
889,543,077 *5C8269EF209373A068504BC9F03B48C6911B68BF aptitudinally4
889,543,078 *5C87C1AC72024D32321EB8DC067005FD812D0F4C ardenhansberry
889,543,079 *5C87A6FC46AF4D899487F0131F346E9F4BAB4DCE BU)$W
889,543,080 *5C8620D24A553B3499B1598C5170D80C0C42A992 arelotnu8
889,543,081 *5C8E9B82DC0750B20107D2885CDFB1AD81079867 arhomuz4
889,543,082 *5C8E3A660EC74649ACC1212763B1DFCEA2DE9431 bw$/
889,543,083 *5C890A15E4D7F6A54D5CDD9894C1C1EC7B889EDD ARONKARLEN
889,543,084 *5C8D604D7799593F96AEAD8036D34646776448C5 bydfncfy
889,543,085 *5C835959655D7F2076A719DB396186E5AA7914BE byronbaswell
889,543,086 *5C8A2A394402C31B8FD141D1E2E02DAEE0AABFA8 artfiberglasscom
889,543,087 *5C805E11ECF7E99E5BF6943FC90DA732F8F9825E bz,kz
889,543,088 *5C87FDDA81FD1AEEEF5EE3E3EF5A96A2CD42FDD9 bzsdi
889,543,089 *5C8634F2D96C8F7EC9E11D81C4E5C3B233ED593E c0rv
889,543,090 *5C8513CC468AB54CAFA7286E27B782C917CD1F8C c2'x
889,543,091 *5C8012AC0057ADEABAE76C8F5A235484567CF696 ASOAEIWOA
889,543,092 *5C8BE2AD5728CEAE4F4786D3851B0EB8478234D0 [email protected]
889,543,093 *5C8890ACC90472F1B9201C5547C551B9C275E51D c50sw
889,543,094 *5C83CBCF23EAF8AA6CDF8CE2346343726EE092E5 C5ULW
889,543,095 *5C837275A3B620C640E23D89ED4E743ACA525BF2 at20p
889,543,096 *5C84D19C48BA2BFFFFEFFF56F68683429B6CD095 AŢEA
889,543,097 *5C88ABC7A6D595975988F2A5E81D45E6AB6E20DB ca5i3
889,543,098 *5C81FF76841C20EBF17DD3C2F21DF4F05D4BF7CD CALEB.SCHUMM
889,543,099 *5C802847B6C0F72D900FED5F2E1EF2B5FDCA2949 AU:GL
889,543,100 *5C80CA09243E72C88BEB0F29C1E9BCD9AD6733CA CAN.WE.SEE.THROUGH
889,543,101 *5C861ABCD0DDCFD6007CB52D3325BABC5B09FFBD AUWZ
889,543,102 *5C84AAC6C03CB097579CE1C59E008AD6A5D35242 A?V8O
889,543,103 *5C82848CE05A7D0EA2B266990A34FB4A933705C1 aw&wi
889,543,104 *5C8EEFBD82B9B304EAB0BF67C52ADB9A50F0E6F3 CARYSCRABECK
889,543,105 *5C88EAD519607B228CB7003AF116A2288C111F17 AXPERTEN7
889,543,106 *5C83BB94B697F94D8DC761526826699CC61BBE48 CASEYSERMANIA
889,543,107 *5C8609B7C48145288EAA617CF8E08AF0E33BFB99 A:Z+
889,543,108 *5C824C3B4D7520B324F0AEAEA3EF9FD3A0DF3B76 B#####)~~~(>_0)
889,543,109 *5C83B33E0C662B2E4A4B4EBF587E3B35397A6394 >b0 * (===b
889,543,110 *5C85B9E437C71A79D17957226510543CEC16171D Ccfj
889,543,111 *5C8D0B98789A25B8C6BFFC72028EA53D78F20523 cdcda
889,543,112 *5C8F3BE92AD2C92CB4CCF9BC128DA09BC513E937 CEJN
889,543,113 *5C8333501804C39DD4E00B92734CDAED85661761 cesarnardy
889,543,114 *5C8D1781446047713FF4FADE573039F70022C183 c)exx
889,543,115 *5C82A770322C7E39586F2F5C88FD232C101B2B82 baejh
889,543,116 *5C8F5FF1AD90502980BD0487292D3ACDB933444A cfx%#
889,543,117 *5C8186CEF6017302D010E73621E6C324CCAE70EE BANKR0LL$
889,543,118 *5C8A79B483C04A682E312AF7D96B4662AF62D93F BARTENDERINNEN
889,543,119 *5C86681B793550338CC55301B699B90DAF9DA446 chanceellsworth
889,543,120 *5C807658852DF71C4211E7242DC01B8E9E8D2182 [email protected]
889,543,121 *5C8C2D56E7AC24167BDA74FE24FFA480F682CFBF B"b8
889,543,122 *5C8F41185A1AA3D714ECE3EFCBB9C6346D99EBF8 [email protected]
889,543,123 *5C898AB8003510261EA4D037CE2155E1D475F54F bcj!o
889,543,124 *5C88F781044A5A432A6C775A6428FDE1D8D20336 bdz?5
889,543,125 *5C8F1214B1CC61598FC9037DB7CF79BDF535633E CHRISANUSZKIEWICZ
889,543,126 *5C896C62BF65EFD2534DF86488F3273A059F4A49 BELLOTAPITT
889,543,127 *5C8282C69581858781F5246886993EC77B73786F BenBridwell
889,543,128 *5C893BED8FB97C5FF34ECB59A985E0024E40D5A0 christopher.magpantay
889,543,129 *5C85AFAB2A283C6A621704509BAC4F7B524EF3A6 BERIMBAU;CONSOLA
889,543,130 *5C8A967A6ABD29CF374C561DD144F2A7392E0B9D CIGALES-VINO
889,543,131 *5C88B1378A3F3F52887812D7D089A96530305E97 CIGHE
889,543,132 *5C8492D1D0413C99D574887B94B7CDD1C97C5C38 c(joy
889,543,133 *5C82EACD13ABB96FD3A7DE349BF243EDA7600BAE b/ft$
889,543,134 *5C89C86269101287CB5506439088FD1642F97074 bhh(;
889,543,135 *5C8E6B9C4152B7FC520CFD8D4B5F3BB9EC12A255 [email protected]
889,543,136 *5C800C602765E31ECFFC0B637043F3420F8B958A cletusmelchior
889,543,137 *5C8BA47C262FF712523580940F7E5D47402ECD09 clevelandsundeen
889,543,138 *5C8D29C8EA0D9CA6DCA96E69F0F022CB7FE8C2E5 CLHKK
889,543,139 *5C85263E876358E3D16DD0A2D5F2A595DEDCAD79 CL:TI
889,543,140 *5C83A4DECF34D7FECC67F0B44C6424FE8521A083 COBE5
889,543,141 *5C8E40A8939E6FCD7373A640767F5EED3F23A7EE b!l_n
889,543,142 *5C8BF70C40C20967E118EF21507E9D91EDA6D72F colemanmartirano
889,543,143 *5C8605BA122E845297AED88F54CCCDE0BBBE0328 bltqp
889,543,144 *5C883079E94535432C17E691F820683BDBA3060E COLTONMONGILLO
889,543,145 *5C8F9EAEA40C1BA09B8FCB8AE16BF8FA28C07471 BM&6F
889,543,146 *5C85AAB370C78C53554BA408EB1B2F5C97F9F075 bo13p
889,543,147 *5C8C5EDDB17AE0985044672CF41078D49D213582 BOBSQUIRT
889,543,148 *5C8F44212974DF45996145D36482C2E593BC4FB0 cordellcohenour
889,543,149 *5C8F723740DFFFA9E29640BC4CEB6F7F0732BEE2 bonged1
889,543,150 *5C83F70E0BA4C7CEFA55063A27E7E4023B2CFE01 COUNTRYSIDE16
889,543,151 *5C8B590B0D2DD4860F109EAD70854041FD3FD036 BOYD.CANTRALL
889,543,152 *5C851FBEAD32DD0B67C9BFF2C882E07BE8AB308B bp;!
889,543,153 *5C8A6CE1BB894CD58CFEC9C6948EC0FFDBC2E47A b---p~o ~o )o(
889,543,154 *5C84D11D5E68318917CA6842FB9FE2C58EC511C4 CRHÜUN
889,543,155 *5C8DBF65FE3DEED6B651D5395F755259A5D70226 BREAK 4 LOVE
889,543,156 *5C85BFD86DBF3F63B724A1038451131A5DFE44DD CRISTOPHERPEIRCE
889,543,157 *5C82A83DB141657F3FE84974DD50473958B2FD0C BRECEIVER
889,543,158 *5C81EE971DA3A6733AABE2E76EFA35035D9BE584 CRRPTRCSED
889,543,159 *5C87B8B9DB909B7C5F39AF718278C3F2AB2E40AF BRITTANY448
889,543,160 *5C8300A53345BF892DEFB11E3615C119D17124ED CSPYV
889,543,161 *5C826809C335A17651D773C9C591D7F679F96A30 CUPIDONATAC
889,543,162 *5C8280F2147A21E1EBE9D8DFEFB40F875A43DB23 CVCB.
889,543,163 *5C8EAA11AC08B89923075F7E162EB1502326EFC6 CW9GQ
889,543,164 *5C88518F1D79F5B418F7F44FD24D56E60090303F BUD.TAUAREZ
889,543,165 *5C8F12C87872B4C8F870F7425194668B9E12FEFD CWQRL
889,543,166 *5C8EDA8BFE3B893BAA083CCCA9FBE3033976A9A4 burtonbermeo
889,543,167 *5C8BC31F4B1FD025BA16AE6E81C81F3E42B6E5B7 CYNTHIA-BELLEFONTAINE
889,543,168 *5C8483A681B1098A44A7599C1E9BA6E8D171F60E CYNTHIALYNNBROOKS
889,543,169 *5C8D0D0F1F6D23EF81F051C3B4E53ED771B77A3F czechrepublicwintersportbiostub
889,543,170 *5C84D0B78AC2F3974551E3D0F739BA0D19A742DE bv6qq
889,543,171 *5C846E9AE14D112F1C65FC3CAB62BED4560654FA bvm85
889,543,172 *5C8FEAEEDC7342F35D23DFA46498A9B94140ACA9 BWOLFESCHAUSENBERGERD
889,543,173 *5C8D7885C59CA987BF8D191BE7750E5BC0FC9FED bw_sa
889,543,174 *5C8755BD696894CF6543B0DE58DB26870F424316 BX"KI
889,543,175 *5C8D73DEDFE3EBFC8FF9F73EA7C04102E948B2A7 d2"hn
889,543,176 *5C8B30FD549C98EFF18BFA0DFD082E51F126C4C5 d)36l
889,543,177 *5C806373642401CC4DA20D4D99244CFC1D368009 D3M1+ARZ3$
889,543,178 *5C81959E6FFB96214264AB906030956DB5F70B3E BYw.
889,543,179 *5C8335AF30249F9957E4D5985E3556319A89D5FD C.0DS
889,543,180 *5C8DBCCFED1E5FC987B7FFC6FF2797F7B6E67691 c&83h
889,543,181 *5C820101A95A1E8C137998C01F5AD8A07A5215EB c")a
889,543,182 *5C805EFFDEA3808788E0B6069D368250F3B623AF daniel-morrish
889,543,183 *5C8B90FCD385232F85FA24F5EA178032E8DEC4F9 da)r:
889,543,184 *5C8F4463AB43422D9A903CAC939668126BD90D5C DARIUS.JURKOWSKI
889,543,185 *5C8D7A4A79F1A9B486F40E64B6E19F6180B75DB3 cam.david
889,543,186 *5C87C9ECF0F99787709E51BB69F2148B76474058 dariuspataki
889,543,187 *5C88AE0557F633176458192C706918E216664310 CAMERON.BEHRINGER
889,543,188 *5C88A1C7AB9BC4786D657FC31E2156060CCF8DBA DARNELLMUNDEL
889,543,189 *5C8FF20FA2ED5DAEE738ADC2E88CA3346E55D1E9 CAMULODUNUM'S
889,543,190 *5C8E213EC2588791435638BA6E9C73D997816A8C DARRENCOMRIE
889,543,191 *5C8D57C636C17BC1A5D56032E5AD9FBEB93AFBBA DARREN.DONEL
889,543,192 *5C8B0BA43C91B95D6C1CFD605BF794C6EADF24EF DARRIN.LATULIPPE
889,543,193 *5C8394033DA37CF38A23A8FC1D2A0057135D3FB7 CAPRICHOSED
889,543,194 *5C8C0C829437BF6CE84EF1F0BF4D1A821DE9128D cardiacmuscle
889,543,195 *5C8BDF10159E67CA9961AF27EEDA0D01A5A7F4DC dbiu
889,543,196 *5C8AE8ADC92C8882E4AC628269BAF9D8AB47017D dbo;6
889,543,197 *5C8F6A064C1B71642D940A4B95F855EE896606B8 CÀRREGS
889,543,198 *5C895AFBA8C44D0B25443DFAAFF07A59DB844CB9 DD1R
889,543,199 *5C8DB7F98BFD9470C8EA350AE8A83D4B15909C64 DE'COLE'RERAIT
889,543,200 *5C8BBE824E60633B88455D823EED23C23FE61508 DELIGHTSWEETLIFE
889,543,201 *5C889A02CFE5D952C5CFF65622319F8272D94B2D Cdo=
889,543,202 *5C8E56A44A827871F0D5A7A878B922C10C5E35C9 CE074
889,543,203 *5C816236E115606E8C4D308732BD3BEC48DF6F82 DENNYALVOREZ
889,543,204 *5C85ADD586EDCE38205BD649031289E2935AFA3F DESALEGNC
889,543,205 *5C82FCD8BBE160F4D50C4C02CD5C90F5C63286D5 desobligerez0
889,543,206 *5C8934412429F79D929752E57ED86B9F8E0D9F33 C%GI#
889,543,207 *5C86BC9B161D303D79A3E8F844CC5AEC45905F56 dhub420
889,543,208 *5C8D99EDFE28573DB6171405E60689B597DF4751 chelseawootten
889,543,209 *5C8BB2BCEFC48F021501ECD49B85EE9E2C076A36 DIENSTKL
889,543,210 *5C87690D3BE92A897C08A0531622638BB627BDA7 [email protected]
889,543,211 *5C80E52813DC4A0A12C947DC07D06F7344944DD1 CHIPLASM1
889,543,212 *5C854E6B0C68203404CC8D3269FB3270C0D63F91 [email protected]
889,543,213 *5C8F93F3003EDF0038C5FEA875C4BA1E352C4B00 CHNECKING
889,543,214 *5C86E0076C15B96C31CEAD7F5CBF8F4EE55EAAC7 Dj5
889,543,215 *5C8338C3EC124F4D9AD7499C90FCCD69AB01968F dl0ap
889,543,216 *5C8E9AD698C0F0C13EA6F36676FF31A01CBBA5DE CKB1N
889,543,217 *5C812D9FFE0C21D39983EC3AEC1C9C5D10571580 c:_kv
889,543,218 *5C869E5C1E65843FBE47D47979B2928C518B7C05 CLIFTONSCHNELL
889,543,219 *5C8970585C74396F559F8D8A8ADF6A213298C4CB DOMINICK.FIVEASH
889,543,220 *5C82531A2725F005C91F891369076C1FB82DBA6D CLJU9
889,543,221 *5C8420599F53589B159EFA97457FC45C76F9E957 clpm?
889,543,222 *5C80CAA9B8C72C722D35BB02C68D1B477D76609F cmn:
889,543,223 *5C87369813BC90E99EB9D12590007F3793934CC4 d$p=$
889,543,224 *5C8BE0C4605B2CD6CA0382B179F3F0A3F6028D9F c;ofn
889,543,225 *5C87556C690C035177B27070546DA16E14333B95 DQ$II
889,543,226 *5C8F23F6F547AC957B1D0B10206B0B22900B09DC dr_&.
889,543,227 *5C8ED583C0186C873A4E6730CF2A60804F2DDFEF COMUMMNITY
889,543,228 *5C86C83A38A4AAD32FC0589AB9C657E884F594AB DROGS
889,543,229 *5C8928A834D80F76A680332F98726C5D1AD3841C d/rts
889,543,230 *5C86C5CEC72E4F550C440FF01CE4DE8CCB990A56 CORREGIMIENTO DE LOS SANTOS
889,543,231 *5C8B22D6BBEDA4A8A888B0C2A6932CDFCCC81724 [email protected]
889,543,232 *5C80C1639022663637E37C9808129F16015B3FEE du6r
889,543,233 *5C8834A1BEDA6947497CD00A7331750269B52486 CPCP9
889,543,234 *5C8F98113E840EA32B9E10E301F05250AB5589AF [email protected]
889,543,235 *5C8DD8B78946D41CCB13D7EC655551419464BDEC crowapril0
889,543,236 *5C804FCB47390A0C8877276A8DA4DB2CBCE867EE DYF-6
889,543,237 *5C89C7574538913CC440CE4EE37C06946868E824 E`8C
889,543,238 *5C837A82B189ACC8CD72524159B86E814BA7F5B5 cuertero
889,543,239 *5C87C7497FED249596768FCABEB836741579790D Cumulus.0
889,543,240 *5C8367581C4461C96E3A831A5C7172496DE5A346 curtsiegmund
889,543,241 *5C875BDFAB85B36867283B97C33DD46D19F18FA5 EDGARDO.SIMPELO
889,543,242 *5C8299A20926979D3346C8A9786538CFEF195D55 CVCB.
889,543,243 *5C8FE8057584AC9B6B1AF785DAB2CDC70FD9EEA5 Cw/$
889,543,244 *5C85499195863B11E6BC08340BAA0D5D6C5F0EE7 EENERE
889,543,245 *5C8C20B7B3193F9761546A4E603D4E78E9425880 eftlc
889,543,246 *5C848F2217DFCDA7ECC2F153B1B9B81F0FC2529F EHIMOTA
889,543,247 *5C8CDCD28ADD8C5D85D8CF684F535349D5EEC975 d0#mg
889,543,248 *5C8FAB801AEA0941704019D9FAB17B983F294752 d#0qr
889,543,249 *5C8FA500FDCEF12E42DB1188F6F8667590A33736 EIC0S
889,543,250 *5C83AF6F72DBBA3B19C162E1DA7E6CDEF79AF590 EJSIELAP8
889,543,251 *5C8397E5C877E447ECBCCD7ABF93856C9BDD2882 EKANTIKAK
889,543,252 *5C80054DC0FC4251D7585AF127741845D465C6B6 E'KE
889,543,253 *5C8C5FED8E5D1ACF28AAB2EC0FC3E63E4A6D1F21 D4EOZ
889,543,254 *5C8D858745D1877A408F44AA40AE94946EBCEEA4 ELEUQAR8
889,543,255 *5C827CBA54DE71FD889BCD309DEDFDF48DD630B2 D85730
889,543,256 *5C87E1F91C0BA35EC938BD5BAD1709F16B49AF2C ELLIOTFAGGARD
889,543,257 *5C889E74EE1F092F3CB8AD567FA0A078D1F8041B ELLIOTGROENEVELD
889,543,258 *5C805E2C5B6BCEA55CCBB52651C8ED4EC47CED39 D$8LD
889,543,259 *5C8FB2E7AAF3AE1384748191C4B99CB4A55E41B9 d96g2
889,543,260 *5C8F8787FD435728C01A8F35964E15406FC5C752 D!A)#
889,543,261 *5C893A6BAF3A754BDCEAA460C65F156477196447 ELWOODHIVELY
889,543,262 *5C83F09EF846412680355CBB7439DBB7C39A25B9 EMERALD-DEPTHS.DEVIANTART.COM
889,543,263 *5C8F9068BC94EC20B156E44DB7C2410BA905FC54 EMIL.HULTMAN
889,543,264 *5C8F4A70C20318A1EEF81B926A2D510A2601ACF5 emiliomeadors
889,543,265 *5C8EC34245E4A7E4416C3B5F2927E1B7EDF304E8 EMMANUEL.FROLICH
889,543,266 *5C89BFBF8DF1229F88BA0D0016EDE81BDAC2EC57 emmittmazowieski
889,543,267 *5C8D70933F7EC8D76540A7809E222DA9E89F65CE EMMITTVELARDO
889,543,268 *5C855CD3368F2AF09853B3FB94CEEC70D7B36217 DANIELPORATH
889,543,269 *5C817380BF05154CFBA990EA6D18D3C9E29F2458 dany
889,543,270 *5C859EEC6122D9994A44752697748758EB25D2F9 DAQUALINP
889,543,271 *5C837F018AC2F142B2BD1659505E20CF4BF490F1 endivoured
889,543,272 *5C8E742A3F052A36A8828B40AA2F8825E30FB62B darsbad
889,543,273 *5C884042AA6DA2DEF1979010A32BC994607AA44A das.schinkenproblem
889,543,274 *5C89718EE4F294893E6E2750123EA12BC43D3F23 DAVID-R-CARTER
889,543,275 *5C853E4F68E7126281BC2FA02E4F418AFCE030A2 epwg-
889,543,276 *5C816DED15D53D9908EF22639EBA2F8C58CB2999 eqgn&
889,543,277 *5C8543DB9FAD2190AE6386B7D3932D8FB8AF6FF0 dbiu
889,543,278 *5C8856F33399D5B954D6FDAFF37153728068D5B1 dboza
889,543,279 *5C80BFF07A0ED7E270A43351D58565B532F400E1 deantemple
889,543,280 *5C8FACB5D4C625D292A3CA936BDD06E9C38ED331 ETSMREA6
889,543,281 *5C8CF39AB14E8D43185423090681BD19D566ECA4 DEGDURG0
889,543,282 *5C80C2D9550AA1E8A60A77AB80BBC66EF3957ABC dehc&
889,543,283 *5C84B175B549C77EA62920B3659941CE08E8C801 DEKETB
889,543,284 *5C8A15C10158DDC53A1AAEA3CD1082F0E9DDB4DA eurique
889,543,285 *5C816859D85E9FE183A2107506EBF7518A889FFA [email protected]
889,543,286 *5C8CC898F8971942A62AF93101A6E1521DEBC575 denecce4
889,543,287 *5C8274669D285EAF42D54FE1390721D6E7DC0B1B DENVER.MCKISSIC
889,543,288 *5C812FF1990D7F6EF3CF5B8FF73CE5627D68373B depolar1za+1on
889,543,289 *5C81C9B87D3BC0B6C7D34AB538A4AB87680CAF24 FAC-ACCEPTABLE
889,543,290 *5C8F892DBDC20E0EC308A2FB7282D4F1E6E2D87F FACALACA
889,543,291 *5C88FD1159A9BC66BDF108D4D02D6B44B103C8AF FAJRIYANSAH
889,543,292 *5C856CE21FA0ED0205DB73CE9AA9CD2BB4854518 DEUNEVERNU
889,543,293 *5C808B70D47F077F20E8070BCEFAB0526131BE59 DEVON.FAZEKAS
889,543,294 *5C8690025A27374DF5EF8B0195E9699740F4B496 fantasierock
889,543,295 *5C8B9B048E536EE85827CA67E56FCC39D5E76A7C fd’ye
889,543,296 *5C8CA491D45E257EA645776DFECF820252ED4E27 D=HL=
889,543,297 *5C89953C58AF3AEFD46E7C16EF55B4BF99938D64 DIANE.HALLORAN
889,543,298 *5C8DD5933F5419E17883070E5516B3686AA0B7A3 FILIBERTO.OSTERSTUCK
889,543,299 *5C829FDDC5E85669A2B7386C3C935B483FDC796E FILIBERTOPALAZOLA
889,543,300 *5C8C577CACD397680DF2D92BDE235F729C78A316 DICK.DOTTIN
889,543,301 *5C87121D74DB3087D5513B5D9D4739F80703B74D FLASHDANCE WHAT A FEELING - FLASHDANCE
889,543,302 *5C804445F07861B2EFE776B383D5FD1940195519 fletcherscheel
889,543,303 *5C82C6FA2B8BF11CD9051569CCB4C7428CC61F77 fluano8
889,543,304 *5C8628D15475690255C2853F1C5988674926EFF2 FOOTBALL1883
889,543,305 *5C8329A85C6CE6C0718949023E5C53E025563798 dismutaseebsw
889,543,306 *5C81DE654BF92E338AA1C99AE80A2D56AACBDD15 djj]
889,543,307 *5C88C99007DF640DAC9CC21855CC522A001BAB3E fredrik.nordstr
889,543,308 *5C8BA76899D64775A0D40A4263BAFBAA8DDB8BBA fred-weyrich
889,543,309 *5C82201A0ACFC89B4B11575784D4F074BDD3C053 dmbv0
889,543,310 *5C83BF2CEFEE0212E2C847B242277BA8AF2B0684 F:SYNIVERSE
889,543,311 *5C8E1302AB59E5D0C3169B40F614FD49ADA1F6ED ftongert4
889,543,312 *5C89116E60646CB0137BB9C38E07F917B914BAC4 DN1CL
889,543,313 *5C82F13D986DBDE45A661CA3E24F4EAD219A023A G3BT
889,543,314 *5C893D4A58480071CB94DCC59B6670C89C4E87B2 [email protected]
889,543,315 *5C881D673CC7E9ADEFD5EA89CD2D7C8E3CFE33A9 DONGYOUNGKIM
889,543,316 *5C83BD3D393AB407E99AD48E2DBA1DE4D04C3325 don\t-tell-me-you\re-sorry
889,543,317 *5C8541E5AA46DEF9C5B31B26924C68B7DBFDEF74 doralia
889,543,318 *5C83B583443B1BF48ADF39CD7C9EB01228562549 dp8k
889,543,319 *5C8D737DF37D102CA65A7F0CD974EBF51CA116C7 GESO"FFEN
889,543,320 *5C80D2D58E556970D4314D6AF41C7C956C143E98 drnhhbsws
889,543,321 *5C84D45916CD7BD6CE89C86FDA66230736089AC1 [email protected]
889,543,322 *5C898F2CD60FFCD35AC0DCB4CC23A04D569FE72B givemeareason
889,543,323 *5C8B0E64B0BBEFB83947048E5C327D22B62C3F85 [email protected]
889,543,324 *5C8543C1B720D4ECEC6984D389E057E623A34A6D dt;="
889,543,325 *5C89DE234CA59E28F1D2E80168B091F08606022F gordonvizarro
889,543,326 *5C8CDBB7935CBDBDA8841F8045C20697C2C902B5 DULNY0000
889,543,327 *5C81D4EBF0BAB4E680D8E2A90A1B5320630FBC6A D/U:O
889,543,328 *5C80EC01C79ED483D92FB53870CAD7745351D575 DUSTINSWIMMER
889,543,329 *5C87B83C047A2BF9B369DB8CB3EB89BE4DF4BC3B GRAIGVANOSDOL
889,543,330 *5C8CC7E8901415540D91F33159D140548C80288B D"U?W
889,543,331 *5C887AE746F3EEA0E4BCE3D0349DA75135767C3E grateful1955
889,543,332 *5C86BE96D74313C80980C115B16BEF4CD16D6BCB GRIPPI3ST
889,543,333 *5C889A88DA2D4F242C4CBA0AD3872F02B4E148FB dxre%
889,543,334 *5C8354E0B608EB58080144C16433E5B2E1787645 GUILLERMO.HESTAND
889,543,335 *5C851F319225B1092B91878E3D8B787103FB3330 DYI?
889,543,336 *5C8372B21C0945D82D8B76C7BAE86BEC9077AE82 DYNECHIO
889,543,337 *5C89A66CF663195C8762E2892D0C7A7C1B54957C DZ8FM
889,543,338 *5C8223C29E2EDBD48E81EB94AD84D80F48455772 g$zk
889,543,339 *5C8D6ED8955B1C4DEC526AF454E6F34A91ADCBD7 ea/mo
889,543,340 *5C8438944F3ED98ED1413267DD60A1565080F114 [email protected]
889,543,341 *5C8E5ABE4B62FEDC772B58B4ED5E8FAFA4C339E2 EARNESTHOLLINGSHED
889,543,342 *5C8CBBC005C685A526EFF0EFB9974C8FF7AB0132 ebiernen6
889,543,343 *5C8A288EC63FA0F2E07AC58D8765373BB4EBABC0 HALIGNLS
889,543,344 *5C859BB5E3A7E66AD1B06F9FB3BE533F3E9B1805 [email protected]
889,543,345 *5C8F5F75C5E66D4A76C0D2400244E9D46090C786 EDDIE.ELKINS
889,543,346 *5C81A7ED007A5582C64093A9C7025F77EAF7775C EDDY.DEARSTYNE
889,543,347 *5C8BA3B3D025D5DBD4615E6F3EB4AE55245FD787 edgardiemert
889,543,348 *5C8E325AEEF5D14733A9C08254008AD0C6FE68E2 edgarviti
889,543,349 *5C8E909BED9E0C2DA10DDAC5ABA79A612C59DE9D EDISONDELCAMBRE
889,543,350 *5C844DB26FCFF7D8A170CC6B01A246C2FFED4CAC HÁTRAUTAL
889,543,351 *5C8DF6C518468D79F708781AC376BF81F0490054 hciazohs7
889,543,352 *5C8928B5581E9DB0CDD2AEB46A48C59B27B420BC heardsomebodycry
889,543,353 *5C8BA67DCBD0A45107E7134987456F6989F6439C EFC3R
889,543,354 *5C830E4728DAB60CB8FBF257167CA40CBDDE4BBC HENBADNE1
889,543,355 *5C8AC0641AFEB472A9A0A1A92D7CCE8F8E480B02 eh0.d
889,543,356 *5C88ADC0AE15D0C6C4D63B5A1031E2B29069475D heribertokempisty
889,543,357 *5C8AD3D6E0A3B19C503C160916F022A9C36B281C ei=a"
889,543,358 *5C8668E435135FE78F05B6280571B7DF1B65E924 HERSHEL.MESSER
889,543,359 *5C8AE968964F2328F842FB3E87A07F2EF98C1D19 he's-only-everything
889,543,360 *5C8E1B0A75C0F328D253CB31B8B60C3831392696 EIHEBIEB7
889,543,361 *5C8706F0044CEDD3B71FE329A1319141EE2EE258 EII;B
889,543,362 *5C818768EE6AFA5205BB826904AB85666A199C98 ELDRIDGE.BRAILEY
889,543,363 *5C824E3700FB8A9A052251D1C85761416D40D7E9 elh8y
889,543,364 *5C8B3629DBF793A70730AABBF38FE855C1F6D0F5 ELLIOTT.NEWBOLD
889,543,365 *5C84684A92C76572E0BE9FB95D8094834DE5612C elm:m
889,543,366 *5C864457964E7615E195A1953936F96ACF58FFD2 ELTONADAMYAN
889,543,367 *5C807F4B2F9C6519B1B27D965E9B91E7899EF225 href="//anthony-anderson/ref=kp_fmc_pdp_3
889,543,368 *5C8B889E6A08E0AF6FE7413A61B19001CA723AD5 EMMETTPASQUALETTI
889,543,369 *5C8D26D09E2A75C976A3B05765F99C9754EF3B3A EMP
889,543,370 *5C8CDD29AC0722C0F686A34CE3673B7C9AACE86F EN71.126.49.212
889,543,371 *5C87E832B99510EC1A2C4842EF8F4F54E6A78288 ENCAPSULATED
889,543,372 *5C8F7D0ADEEF97272C514A8E276D95B0F809828C ENV.,
889,543,373 *5C8E2193DE748B1E167388460340549EF459829A EPARBSW5
889,543,374 *5C8A1E847437BE1040ADA94A5906322B2B2864A1 HYMAN.BIBILONI
889,543,375 *5C8298DDBB4CA2A25EABD9E016DEF043D884E2DD HYMANLEBOEUF
889,543,376 *5C8D4069A84ED69FC931762A77BDAE0D2FB74FC4 eps"
889,543,377 *5C828EE9835C21D9E5FD8C7DC6843FF4CCEE7FCD eq;0-
889,543,378 *5C8D28C4B6B0B6EB6A091796C343730C77483983 I3BW
889,543,379 *5C8454CB864CF8FFDC8CF2943976994E8208317B iamjkl12345
889,543,380 *5C84C3DEC48DA136607909460E5D22A98EBB3156 erksine
889,543,381 *5C889D8530A9B4A79D2921EBB16762492BCAC022 ES?RL
889,543,382 *5C8F1E07B6F51E249FE04BBF2498E6BDDD44D8EB [email protected]
889,543,383 *5C87CCFD42D050932536AFEAC73AB5ED21E05009 ET%JW
889,543,384 *5C80F83AD32BED9B65CFB33B3E82FDE80C8F4BEA ETRATRIX6
889,543,385 *5C8779F55909CCFC245A846246385D6A8E7A2250 ILLUMINITE
889,543,386 *5C85512FCA639F6F9359C2108E42605E0751EFBC eue?l
889,543,387 *5C811504E027758AA0EAB48FB9A6DF19BEDAE7E7 ILOVEXXXES
889,543,388 *5C863796A830D9A38C029F9AFEBEA577681EBD1D EUROPE-NAME
889,543,389 *5C8CB27F170B938D54EA777AD81F2CD7895176A6 EVERETTBABEL
889,543,390 *5C8DBCB7077C5F2A9F89C84104F95069D459077E EVGENIYK
889,543,391 *5C80D6D17756EC22835F0224446982161B9AE768 imprudenza0
889,543,392 *5C815F190B86D80E7AE2FB650B43F07E9830C0AB insozzati5
889,543,393 *5C87C479A301AB139D93A7C0A6592EEA421E8AEE FAITH684
889,543,394 *5C8907B271988308DDF7D6483EB0A8A88D8BD88C family
889,543,395 *5C8ED46399FF65C4FBB575E846B76442C7DF52BD f?`c
889,543,396 *5C80C9BE0934A458CC07B6665ED94D49D6CBA464 IRUTTIRC7
889,543,397 *5C80421EF0D8D5E8E23A9E4F419B8176315C5633 IRVINBUSH
889,543,398 *5C80ADB44EF5000433DF3259F8A54E18342812A2 FEDERICO.FINNERAN
889,543,399 *5C85AA7C3AF4940425BC3E5E4F1368D93E5840AB isaiasschmieder
889,543,400 *5C83E1200986CCA64D08C4B0A4817DD66D3EA66A iskutunuk
889,543,401 *5C872EE2FF33C0CD3CDCF97810B02D808544B132 FERNANDEZ JR
889,543,402 *5C8CE2F20DDECEF8A135CED9BDFDFFEC2292916D FGNG
889,543,403 *5C8146F57217A6EC56162869D717C356AC36993F ITSAINTTHLO
889,543,404 *5C84CE4032A5E2E1B0C4F21A3E27C5681574C0B3 FINNGALE
889,543,405 *5C8FCC503A9DABEE82EAECCF95D212FBA45DBD7B FIRECAT9[email protected]
889,543,406 *5C899637C4C4BE5355559AD4444A22507FD3C947 [email protected]
889,543,407 *5C8F96A952B5D17EC95E33335E86A768192472D0 jacevedo
889,543,408 *5C8174E568DE2373C6D311DC2058D53FC988A2C0 jacoby926
889,543,409 *5C83080D02ABB5A6627ED509C5B0C2B26B658A37 foorpmis
889,543,410 *5C8796CD5E455E5A130FE992DB3A3DF8C76439A4 jamesevan
889,543,411 *5C83C7F1D97ED9135FA92A8C0647F496D6EDCC5D FORRESTARNHOLD
889,543,412 *5C8553FE6494200B95F397914AA14B33ADF949E6 jane.marufu
889,543,413 *5C83B51A4F2E336C06E875825AB425EB32BE9C28 JANIYAH289
889,543,414 *5C8FE8BED508DDE850207A9D3D4FEAB51FC9A102 jansalvetti
889,543,415 *5C8A6544BB5C04E3CA8EF12473620620AD34911D jarodkobus
889,543,416 *5C867814414F9E672F7A8F5D2A8264AC4055E34E jasperhronick
889,543,417 *5C861FE5096F3C49BB73A53E4EE55DE09BD2EE0F FRANKENRGLRGL
889,543,418 *5C8D9AD32BF598FBAC6AE19F80E691855B45F2B7 JAVIER.RUDER
889,543,419 *5C87AA5838ABB4DB48F7F26F86E2DB44872087BD JBARKOCZY
889,543,420 *5C80D6244E46C63DAEB4503FDB2F0D8045952B65 fredbucaro
889,543,421 *5C862A715A8A055BC21434BD9C1F250A34AD3BFA FREDDY.ANASTACIO
889,543,422 *5C8BBE00EA7195F6A98CC4E85BABCD1B163A2BF5 freddycrapser
889,543,423 *5C8AF4130B1A2F37846450A8C632EC1E5650531D JCASK
889,543,424 *5C8455647B0519251316C55C980DA20EC10F1B5C JEFFEREY.FORMBY
889,543,425 *5C87875697682D1BCD08C1DBF9E8110BC204C991 FREEMAN.ZMIEJKO
889,543,426 *5C867865AD6342B338AD32848C2F9FCE8D4E2C09 JEFFERYCLAVERIE
889,543,427 *5C8E0010572DBB5AD077AB84894267A69B5E64E2 jeffreystreeter
889,543,428 *5C866FB8E995C51D952E66CF406C111B49FA8E4E JENS_UWE_BUTTENSCHOEN
889,543,429 *5C868985D00EC7A622AC0C54F46A3BC9F0CA3CC9 FRYARESING
889,543,430 *5C8077DB2D8E988FAEC0C4070BD9049D32AB5321 FUBARDGJ2
889,543,431 *5C89A00F77F2CB9B42C1126344A09EDBE310F858 jerry-yang-wsop
889,543,432 *5C8B29D37118F4E6AE4CF5EDFC3E1A4E34053FE9 jesse.smit
889,543,433 *5C85313D8963D3284159DCC23B1A03DD43C6FF4F [email protected]
889,543,434 *5C869EDD2C27E4FB48F544F627E13422B4158BEB g0d13$$1y
889,543,435 *5C8C54C5F684AAD10B6502271565E9ACB83AD3F9 GAMESMASTER (MICHAEL WOODS MIX)
889,543,436 *5C8B2553D18B8632885E5FC2C47D5F11C5F22197 joantzeremes
889,543,437 *5C8A086761760A63FBCA6065D4852A9CF4961604 GARRETBATH
889,543,438 *5C825DFC1307F6C1794088865D8785EF32B370BC GARRETENDO
889,543,439 *5C83C06F4298E98777CACC6E89E36257061C1DA2 garrydelsignore
889,543,440 *5C80A5D3F2B95B664469DCAB72B5F1B1D2174B62 JOHANNESBRAHMSVARIATIONSONATHEMEBYHAENDEL(OPUS24)VARIATIONVII
889,543,441 *5C87C03631DCD7677B8FE43EBEC7BA6C7E3E50F2 JOHNSONRIDDOCK
889,543,442 *5C8EA899EF9224737CA48965503CDEF76C75B4EC JOHNZEIGLER
889,543,443 *5C843A91C458393CDCE1C83BD9D59B639D89D1AA JONATHAN.QUINTON
889,543,444 *5C8A9524FE6E3B5A1DC41C660FABD08E0FD0CB70 [email protected]
889,543,445 *5C89147C04CE6D31AC1E76CBF0A3229BACEEB4D8 JORDANSPRUILL
889,543,446 *5C8BB4DA9FD1EC232CE853220AEB02AAB6EBCA02 JOSE.LUIS.CASAS
889,543,447 *5C81BF3FB458AA6FC9804CA57459BC37B5E9E117 JOSIAHFARRO
889,543,448 *5C829D3E1C0DE455586949F169140E30215442DA joyce.stannard
889,543,449 *5C80FEFE371FC498379897E032A44A1E89986113 JRASASAK
889,543,450 *5C86EA1E6F96C75A7514FD5EBB46DCDEB6E3F554 ghemex
889,543,451 *5C881FEC2C9C7A185B06688E84D1CE1C9A7803A0 JUAN.CARLOS.MIGUEL
889,543,452 *5C8F3F29D76303A80208FBF2D9E02936D9823980 GILBERTODUNKER
889,543,453 *5C84830695815F0C5AA17A98EF56CCB9CEC6D8EE judecianchetti
889,543,454 *5C83E7BE6AD2985F0DD1254A98E33188D0294B3C GILPENHA
889,543,455 *5C8B44FD3EA7AA83A015094D5AA905759C205D9D GINA-TRIPP
889,543,456 *5C8D49EBDE0BF9FC29B190582996A255D877768A GINO.LAREY
889,543,457 *5C8782B349ECEAC8892BE12CC8D5913A9774BCD9 GINO.LUDVIK
889,543,458 *5C82365FE057D1ED63CA930540D946600321E88F ginowieder
889,543,459 *5C85F7A918EE123D5388FD9BEE3DF62ECC44789C JUGO-A-LA-VIDA
889,543,460 *5C88D4196403822AB9A885F6941F89CDCCEA9304 [email protected]
889,543,461 *5C875B740105E1ABA8EBED477EC800AEDC6BE48A GIOVANNI.GAVIA
889,543,462 *5C88169A535551F2C48B3E0F052BA85E3195590A giuseppeburum
889,543,463 *5C830F5F26105505B3154D78B6191E0EC5DC9C1A justice(1992年
889,543,464 *5C88714A26FA13F9DC341C537B3405F5A2A3C42D JVALENTINOVICIUTE
889,543,465 *5C80E4D427D2FE78C4C1FB42C979621959A8DA29 G-MALB
889,543,466 *5C84E9BC5273BE1FB391356F37E7956E9F42134F gnignolo4
889,543,467 *5C822F1C8689FD6BB6D96EAD2F150AAA8F790319 KAEL300
889,543,468 *5C87113E432706D3C6EA812C31853626114C9148 gnuseolf4
889,543,469 *5C8488E549AB221FA9743FBC9C3B30C75993D1F9 kamelkrankheit
889,543,470 *5C84BDC4897DE786F7D96093E9965167E0945E6D [email protected]
889,543,471 *5C81234F8E0BDB536324B47BF5EE2EF6065046E8 goldsmoth4
889,543,472 *5C878B479CA5B149564F784A0061EA7C3E809517 KASEYHAGENBUCH
889,543,473 *5C820CF7D0DD8DCC94B4B770DEB54D0EBA042C15 „KASSAI
889,543,474 *5C8A4483B9DBFE081B49C073B76E3958D0B142F4 gorermnent
889,543,475 *5C871BF39D971405941B65E6D366F57660B66DFD KAVISHMUNSHI
889,543,476 *5C8053D037046C11DFD9E8BBC4D67BCC40DC1DE0 KAZAASHI6
889,543,477 *5C86CCF318F8BBC709C8F12EC3DBA585946B29ED GRADY.TOTOTZINTLE
889,543,478 *5C8C5A3742585C02140A309C304B1FA292F64DB9 [email protected]
889,543,479 *5C82B3C05DAE85D053365D7414DCEC336B35BF55 KELVLAK9
889,543,480 *5C88E14FB0D5760B03D962EAD2854D28AA7A81D5 kenyogo
889,543,481 *5C83755F35E80B1870D828DF69829C74A6EBB3A1 kevin-kaminski
889,543,482 *5C8573B70CBCA05C8E78D1A69DB5C4C1BD02BB7D key-desks
889,543,483 *5C847A535047158E820C9C6D9E152CDA05E8080A KICKUPS
889,543,484 *5C85100C8027C4B2B06C72A576FE33C0001B52F0 kirchklinge
889,543,485 *5C89A9B78EF642B30254332E5FFC7CE551D387CC $KOL3$
889,543,486 *5C8C855F3235CC4FFEC5A0EC19B60AFCCD10FC05 kombinationssensoren
889,543,487 *5C8F84E0B19671DF4731C0BCAC39012CB2302C1C hanyoungkim
889,543,488 *5C873559FA96E4595BA58F9AD3448B708925D0AE KUPCU
889,543,489 *5C803862F684ACF593C0EE3D72A6E12975F7312B HBWGIAQ8
889,543,490 *5C8CCA5005D5FBD4279701AED98FC3E2681886FE HEADMIS+RESSSHIP
889,543,491 *5C8A0C47AEB635D92BF5D733DBA64EA63DFD2E1E HE-AIN'T-YOU
889,543,492 *5C841A4BB23B9FDFD79B81D86787451F0142B106 HERLIPS
889,543,493 *5C83EA0E0CFB1A0D6BD54937381C21CC1B0C0A47 LATINÇE´YI
889,543,494 *5C8F0501C37D91DD90EE05CA5EA22449880DFBDE laurendiblasi
889,543,495 *5C820F73EA41A3A95449625CF39B930598DB0649 HJLYE.
889,543,496 *5C8B3A1AA7890E5AAA466D211F5A2707DE0167E9 [email protected]
889,543,497 *5C8DB98C94B9B6AA72C3359A756D842A08A52A71 HOCKOMOCKO
889,543,498 *5C8C44B1AFCF1624FE8CBF7BEBE791D8DD760DE7 HOMAYUNB
889,543,499 *5C80A49051679D4984A41B78179007A79C79F489 hong洪
889,543,500 *5C8D9ABBA79A660F5815CF04158E20568660431A HORSEWELL 1 0
889,543,501 *5C8F1E928BA8B65665C725BE86B0D621EC6388CA LEONREASONER
889,543,502 *5C8E219D95EAD6080A32B2359568C66BC633F986 LEON.SARDI
889,543,503 *5C82D0D03E636F9BD5122EBA87764228A8AE2E82 HOSEADELUNEY
889,543,504 *5C8F257ADB3D17DA552D1A203D2953F61AB1F87A LEOPKNITS
889,543,505 *5C82F18E1BA82EBD3D9FDD22E2B919F449993CEB LESBANDARLOG,OP.176
889,543,506 *5C8D0C1ABF61FFEC931A65898EC8995DADD31009 LESLAVIN
889,543,507 *5C8C2CD6436C5F5ABE4E5CA2343CC262C1A221CE Let.The.Rythm.Take.Control.(Extended.Mix)
889,543,508 *5C8CBBD88E76B94FAB8AAAEDEEE5C5A6B8D27E12 HTTPWWWCHATTERGARDE
889,543,509 *5C872DEE6F7BAC2E0B07E4A9BE699197074BF4AC HUBERT.KEADY
889,543,510 *5C8BBCA666044A3F2A0243F8D96000D3DE716CB2 HUBZYLIN8
889,543,511 *5C875EA242E88ADE144EBA6A70CDE2DE67F9112D librapr3
889,543,512 *5C8F19EFA139401A12FDC06733795333AEDC9744 [email protected]
889,543,513 *5C8D69B0D2DDC7E2830F4C17D01EE38F5CC5B868 LILIAN858
889,543,514 *5C8443D1513732D084629C0B17508700287BA3B1 liliancanales
889,543,515 *5C89F97778CF3F0F3AD042DB8B30D319DCF76E36 LINCOLNKEMMER
889,543,516 *5C8EFEB7C31EDFF214148202CDFFB8379EC53FB7 LINDSAY.AYOTTE
889,543,517 *5C8B37456CD11B5F76DE83506E75E8C756E9C9AB HYDROMECHANICAL?
889,543,518 *5C80897ADE9BA08E6401BA84A020D4E8783E6B69 Listing.4.5.
889,543,519 *5C8CA64386D635ABCB7F96C9101185755FE91966 IATTACSIR2
889,543,520 *5C8F7C723DCA036277E40A27E3918E7FDA7A210F IAVUSSUUS
889,543,521 *5C8516F9FD632440B6F3667950BDEFA903A42C96 IGNACIOGODINEZ
889,543,522 *5C850984B40E162C6B9E368C925B08A433D2BADB iin-nirwana
889,543,523 *5C8EE55EE619750D97D2CDD60F9C110F767C34F7 IJSSELMEERGEBIED
889,543,524 *5C8CB64689A91D6E878A30FB62A8FFDAB9B75C6F louieralphs
889,543,525 *5C86FC0EEE16DFC6D7B40480AD8363F43B70EFEC ilovescouts49
889,543,526 *5C8E810746D5BE55D8B727E2271EC1B0D54B6F5A LOVERS05
889,543,527 *5C8875C4C893E7D9978ED27212A8A6B0E53BAE04 IMHEIDEPARK
889,543,528 *5C825640625CFB99A0D3D2FB467477961F33494C impact081010
889,543,529 *5C8FB46D0ACCC8536ED7C86C747A1EEC4D5AFC8E INDULTED5
889,543,530 *5C87601027A1C0A2ADB84DE3A496280EA75D6BB2 LULLABY, OP. 66, NO. 15
889,543,531 *5C8E9AB3D5B0CB1A1E4C821840037C1C3828167B [email protected]
889,543,532 *5C843909C8C3DA3146F323D2BBDEB0D3A4BF1A68 [email protected]
889,543,533 *5C850E5E0C74883E217C58A1ABC43F93CABF00A0 LURK.WHEN
889,543,534 *5C86847E2117DE36B1ED4EAA79BF75E94FDEC50E [email protected]
889,543,535 *5C892964E8A02B4C788B6F8CDB6EEE75542EBAA5 INNENHOF01
889,543,536 *5C8DB213CDB43C4BB0DA1C49B93D5C70790066E3 INTENDS
889,543,537 *5C816FB6737FA79E5FE6FD1935D3D48B6D7C43F8 IRVING.DANAHER
889,543,538 *5C861E0B5A51B1155F586B83E2C0E98C5FEF18F0 malcomspier
889,543,539 *5C8F0B4E3056DC37F53997E7078C24B62C587488 malleseses
889,543,540 *5C88B6CF042AC2505EB6E9132BA6C929A09CF921 marcfavaro
889,543,541 *5C85B2DBE2CEA460B07788EAC027B1C0ADB5983D margaret-cash
889,543,542 *5C854FB00799F4CF672A7F3DB90E5573A7B51D71 J4F
889,543,543 *5C8AFFB40A8DBE94CDA414EE1B940EA7F62AA642 MARGARITO.ZIEBOL
889,543,544 *5C8EE23262418468CFE5B8AC62034E73008059D3 MARIADAUGHDRILL
889,543,545 *5C847CB00B138A8701A926C1DB36A9EEB3056986 mariapariser
889,543,546 *5C81344C5F36ADD0E40179DE85A79687731A3C7E jacintorutheford
889,543,547 *5C8607B216F6064DF054E95922C601C86743008A JACKIEPALUMBO
889,543,548 *5C8B6871D0EDE03DC0B09B48EB857CA042BAA6C1 JACOB.BENSE
889,543,549 *5C8A10AADFBACC0FDD37A1DE5EAB8B34DFE2DC8F JAELARR
889,543,550 *5C8EB0B61A0D0D317810337FBEB1313C654ED4CC MARTADILUM
889,543,551 *5C86DA9742D0BF2A4B372710DA4272D24C488F06 JAMIE JOLINA
889,543,552 *5C88709917E4AB8FC59F77DA5BFF1A9338EC32C1 JAMIE.MACKSTUTIS
889,543,553 *5C844DC019DFAB43A7A769EA0464781FE5319272 MATĀVALAMBANA
889,543,554 *5C80244C8C17DBBF2BE7E1B3E29C43C5EDE214B5 MAXIKAO
889,543,555 *5C8CE8F4726526F865BC86E7BD81D48A9DFA702E maximoknesek
889,543,556 *5C8E228B2DF2D1E5DAEF5810179E26E49B8AC4E6 jarodohnstad
889,543,557 *5C8DCFD12673A491B37AE398F3FE5D7F3D6C5239 MAXMELARA
889,543,558 *5C85E5B203C32C7EA7127A1F97CAA80922735939 JARRED.BIDELL
889,543,559 *5C85A768B84A0C5BA7E58D9DE06B183739F63A5E JARRED.SAVO
889,543,560 *5C8E65F5F542A3B66D4443F969176423899638E9 jaybee.blanco
889,543,561 *5C8EE19ACDC4B0EB66D6B79CB0566441812A5373 MEDALJE8
889,543,562 *5C87BF12DC95282D1978E8AFABEC09DCEDFB8D5D MEGALITHAMANIA
889,543,563 *5C8A8BFEE16108B207A7C3624524FD2011A708DD jdandcj128
889,543,564 *5C8A475A076DB180B4E1E2C671A68AA33FE442AA memory.(ng)
889,543,565 *5C89FD223D6ECAFC9F2B6C2E3F342BAA5DA475F0 mercystä
889,543,566 *5C8B832EA67D2EFD7AF5D1E403720ED6405BB3A3 JERALDANDREASSI
889,543,567 *5C878CE0EFC3943BDAB0F51EE2D8646CCB51FA21 jeraldkoepnick
889,543,568 *5C8E49EA1D55DCDB87AA1FC6E62F30DF734CE0D5 MIAHARLAN
889,543,569 *5C8908E3C7035FD4B47C587D0F7267E8B7D86AD4 MICHAEL.VIRUET
889,543,570 *5C85D77B63EAC232DDE2EA002EEF991592F15877 JEROMYSAJORDA
889,543,571 *5C8895615224888C2D06E40C87590D7FE6A15848 mickeymousebbs
889,543,572 *5C8E5081DF754148C7D03CFBF375FA23ADD061C1 MICKEY.PAWLICKI
889,543,573 *5C8A09340C78BDD29F5452B11BD264CB8E023F64 jerroldolay
889,543,574 *5C81B78FCE17D9C9239454D7DED938F90DF46DB6 jessiegabriell
889,543,575 *5C80DDC0C798827BADF8FA3EC073063748F3E6A3 JESUSPRIESTLEY
889,543,576 *5C88DE1D2FC3B04F39675630732458C5F18BB7E7 [email protected]
889,543,577 *5C89B4E2DDCB17D7B2E1C0AF1775456F296D07A4 millihg!
889,543,578 *5C825C39FD937116ACD4FF32654D02D4EA98189B miranchurito
889,543,579 *5C870B6E2046D41686934868C33D55A8AD6086EB MIZZCHICKA23
889,543,580 *5C8338589313E00D2DA41DBB02C6F315EF6C9A5E [email protected]
889,543,581 *5C8A136C318CAB1868081225B954752E28AF692A JOESPHBICKHAM
889,543,582 *5C85007669827210061DD42F18F790D3923BC4CD momoreno
889,543,583 *5C8B57F0777B99AA824A10155C2D43C9EF01D1E9 MOSDISCOS
889,543,584 *5C8D0DA33023B38F8DC86B457796AC75B7008F08 JOHNREDDGONZALES
889,543,585 *5C8A7BD85F8E9FDF93DE7C25F484F7D2952AB6B3 MPABIA
889,543,586 *5C8CAA6A418421E6B5E4F939B600A397F9DCD213 JORDAN.AUGER
889,543,587 *5C85E228265394643542368CDA0CB85983EE7A65 JOSPEH.MCQUIRK
889,543,588 *5C804E3511FD0FDAC7B700F18DB1461833F699AB jouerait0
889,543,589 *5C8654F6B8770FA29366AA8E958F50002563E4A2 JOUTAIBE8
889,543,590 *5C80DAB8895D1269947F529F71EE4A56980A9338 JSHAWZEESHAW1
889,543,591 *5C8E2B6B447F3A08F666B1904FE71BD7CB450BC9 mymartin4
889,543,592 *5C89E4BD7D4258D63D5ABF1F78BE008ACEE530F8 myronrodkin
889,543,593 *5C876DDC2EC2F8D4622484DF035DAB41F2952ACF jwinrockyou
889,543,594 *5C8BE19C6C1A2C747412C3AB636CA6F3CB32A12C [email protected]
889,543,595 *5C88524596A6A1EBD1CD8345523CC5AC560EF2DD nachattar.gill
889,543,596 *5C8199FB2B5424FB25F5E14C980B2D725828A312 naggibo
889,543,597 *5C80DAE691BEA511B3A2E5FFDAA71240C8E4774E [email protected]
889,543,598 *5C811279EAAFFEF6C673C81FB1309489AD9F1641 kapitel30-zweitertag
889,543,599 *5C8FE91A75D503ACEEEAE63408EE56B1B9255A26 nedodsf7
889,543,600 *5C8B1AAD66F5B6CC8D3CB644546DBBEB639E0EA5 NEOVOV
889,543,601 *5C861B930EA3979D18B63B63D176462AD6336577 KELLEY.DEARRING
889,543,602 *5C86CEE5DDD7E57854D34D5AD423F0CDDB5B4FB3 KELVINSTORJOHANN
889,543,603 *5C8FE21628F461641409892B29F221E893C6210C NEWTON.WHITESIDES
889,543,604 *5C8F360807920E59B911169EDD5090B7B82DE0E9 NEWYORKDENISE
889,543,605 *5C85F5F1395A2A4DC71605E19D6A71842BA2DF0A KEZELHETŐBB”
889,543,606 *5C8F80597284B7CD1DEE5F32B411B54FE1B887DE [email protected]
889,543,607 *5C81F1CA9509431DA1B662EFEF7A9835C35BF29F KILLITH5
889,543,608 *5C81CA08F99930F94A7D516391817925033AA5EC nolanham
889,543,609 *5C80DFE8648C0E00754EB43E9DF03912693B2441 NONIMAGINATIONAL1
889,543,610 *5C87198B5F8FA168E5BD0E4881AEC7486C6A5585 KLAUSB
889,543,611 *5C8E23EE6AFBC2C95CC2116FC1E853E93D4F1689 [email protected]
889,543,612 *5C87FD1C9DAF1E21E9C3CE9FBCBDC798EEF1BAD5 NOTIFICAÇAÕ
889,543,613 *5C8B154D10E21D8AE0C80A0CA13319C2482E6BB5 np062894
889,543,614 *5C88A526EAAAAC75F47ABA3FDF10E5D494E47780 KNÚKURIN
889,543,615 *5C8ABADB07528A526BC9111ED5CDC9C2F1B0A2A1 kochenzement
889,543,616 *5C8CA49400CE44968E77E5048F933374424F4D16 komplexibilität
889,543,617 *5C816B530971F6D6DF566C7272E459050754D7D4 KOORKNAPEN
889,543,618 *5C8F18598F13585411438A46EC88E69C88350BD0 NYPORNA3
889,543,619 *5C8F7AA39D9FB87C25B2A89BA5939451D986F535 K/p
889,543,620 *5C8F60A8B076953C6069884452D1A9939311599D O1SEZRLT
889,543,621 *5C88FC3164339E2CA2AE7AC1E48F567DBD94A627 KR.F
889,543,622 *5C89E57655A73212368373FE6D94B3BC8C5EABF3 OCULARINSPECTION
889,543,623 *5C8B2CCAB2EE60A32A46829D31DB4AB1F7402A53 odnamedes
889,543,624 *5C8362A6FBFC75A0508BB48B2A076D598809DDEB odu-will-miss-senior-tj-jordan-its-silent-storm-who-defines-program
889,543,625 *5C8FA909ABFD29C83274455A24F2906289B82656 ladioret6
889,543,626 *5C8ABD535440CC4C126105FC2256449BEAC09E73 ONDÉRIZ
889,543,627 *5C8591B9FBFA6B201F7CB6D4B32EB20961C3ED6B oneerlijkheid1
889,543,628 *5C811EB96706D85D42CE92AA5D5C53203921A232 lanceschmalzried
889,543,629 *5C8B1F3190B541C3EE649581217A9A5184DFDD70 lancinaient!
889,543,630 *5C8D776EA2C5B8AE2730C27995E887EDF5A41DC0 OREN.LIZ
889,543,631 *5C82E30A9EE89AED79A167BA318D88869F3C4844 latansey3
889,543,632 *5C80E2D12FB977EEE8B35097842A19FF6487B216 OTISSHOSTAK
889,543,633 *5C8E85A258784C2EAD3948C33FEF411BDC6D0D66 LBOONSONGSUP
889,543,634 *5C874A37880D3AD7C444D113D0E7164F0BE253B9 OVIRAPTOROSAURIANS
889,543,635 *5C85B09E79C993E56C943E3ADE7BE2EF59C89B1F OWENEARTHMAN
889,543,636 *5C8605D20E80DB932870DD1DF8FAC43AF7922BA3 leandroshidemantle
889,543,637 *5C8D69B923E02795E234D9222F93652F341E2A58 LEANDROSHUGARS
889,543,638 *5C8D8E1F940EB1A2F5223435CF03C1FA0FC71511 O卡亦可安装于原版APPLE
889,543,639 *5C8CB19BF85890143606261C84C089261AECB0BA >-<~-~(##p
889,543,640 *5C87D122406DA78BD0BF51085F9C1C074505EED9 legalxmlcourtfiling
889,543,641 *5C822F73F1A2B7F873B3167AFBEADCE506BB77BB p5eudo5c1en71f1ca11y
889,543,642 *5C87D60CEE0B8BCDDA9E66A3D366CF1EAC4C7093 LENTISCU3
889,543,643 *5C8CB96B63E6A64B434E32C6F7C61EE6F2DAF4C9 leonrooke
889,543,644 *5C899024D007A9C7DE18C555CB71DD5F63335ED4 levidemendonca
889,543,645 *5C86CE7A26D5ADAAA0EFBF191D4187A8BA8E8348 LEWIS.GOLETZ
889,543,646 *5C88B4C9B1EED1D99838BE2516A0EB3AC1F6F36A PARPILLIEZ7
889,543,647 *5C82F0A6E4D0CFFF333AD7AC14C763C956397173 LIMNOPHILIDAE
889,543,648 *5C827FA6F01A0BA71C3498ADCF386754D6F0552A linosementilli
889,543,649 *5C86DFA54E1D8898FD5D705AD81E66BE3BE1B01E LIPMANS7
889,543,650 *5C8D837DD30ADFCBF4D54610F615CFEC5565AA3E peliculasmasexitosas
889,543,651 *5C8BDE0445D94748571D36BE013AD6C8F0F12354 LJR#
889,543,652 *5C88F58915592CB60F1898A766B370554FB34899 LLOYDNICHLOS
889,543,653 *5C8A80E58EE59BA955600EB2B97B29DE1F86CEFD petbirdpagecomwww
889,543,654 *5C879140726B57251643DB8393468EA33361F64A peterboroughscarborough
889,543,655 *5C8EB4709DBBA71908778E79153A77B22A7A9291 PHILḖTAS
889,543,656 *5C8096FF277063DE348B017118E2DEA0D45DC0EA PHILLIPBICKLEMAN
889,543,657 *5C813D8A5C7770C819AA08B4109531F5C9528E44 LORENE.KESLER
889,543,658 *5C83F1B1E8389C28AE54F269B669B99AC81CF42C lsryckt8
889,543,659 *5C897A8BBD7ABD8C7E3859039A1B31473F72603C POLYGLYCEROL
889,543,660 *5C80BF0E32435D19C7861E43A06FD25BD1D6992F LYNN.ASKEW
889,543,661 *5C86D91188BD4EC2D91A9DE2E44AD3958191115C POULET348
889,543,662 *5C8D6AD213F52F7BE4E8AE88DD1315C5BA8A1C71 pp~O~o}X{
889,543,663 *5C8C1072EF9A0F8FEF620B0D67A04D1052D6D0F3 pr0l09u35
889,543,664 *5C8FF6610F4FC0B2EEB15B1CF95CDBD34D90EBA5 [email protected]
889,543,665 *5C80F1DCAC008DD4CB3AF370378A0ADBB7781A85 MACMOELLER
889,543,666 *5C847306DA883BA5C144A50981A41BD9DCFA6F1F PREDIGERCAROLINA
889,543,667 *5C8393345BBB7EE4E294129DC3DE3F1A8BE70BAC madder_carmine.'m/&/d/@/r_'k/A/rm/I/n
889,543,668 *5C82AAA15D16719481370D028B36926FFA733A5D PRIMING
889,543,669 *5C8AD5C5F70168C96A4E6ADE6D2B75EAE8A03540 make_comfortablem/ei/k_'k/@/mft/@/b/@/l
889,543,670 *5C8A3FB36B44065EC6D2F552A4FE12B278A34EB0 making-ready
889,543,671 *5C8387BAD02AAC3354B485A1AE7321482BDAA658 produkternes
889,543,672 *5C8D136685B50F4B3AC956F0FB82A180E7C95FD6 PSÎCHOSTIMULANS
889,543,673 *5C8B484D25B9F485FAFF98EFA0FE15B69990B0EB MARCELINO.DROZDENKO
889,543,674 *5C8BC97256EF43B8E5E163F3075B6D01EB4F70C5 PUOLUEELTAMME
889,543,675 *5C844F97718C1C74BC87B55E00532B42C6D6507C [email protected]
889,543,676 *5C88E7C7EC83F4A2E9F28ACFFBF83E35C240AC66 q3b^
889,543,677 *5C8045BE3EB0A46308672C15B25CBD734F405EC5 mathewannonio
889,543,678 *5C8338D6A6FC7E6240952C9158525D6CD44D108F quecksilberelektroden
889,543,679 *5C887EDF59A2AE1CFFBE82182F0389D75F23654E R]7Z
889,543,680 *5C8B38373EBC866729ED74A3D299FA0BC3FA619E Rahman.'R/A/m/A/n
889,543,681 *5C8E9BD7BB899D0C8FEB4C913364197A44059FF6 MCKINLEY.FAVUZZI
889,543,682 *5C8B71F767F1786B82B90C333E9DDF5772F9AF47 RALEIGH.MEIGGS
889,543,683 *5C88561200B1C1B47935500B8845193631B31556 RAMAS DESNUDAS
889,543,684 *5C8B6902AAEDE020FC7555F335ACE883704CA5D8 RAMIROLONGBOTHAM
889,543,685 *5C894006BAE9E0600D88D6BE1D12BE5751FB7522 RAMIRO.SMOLDT
889,543,686 *5C8DA1EB874E470702094D21FE70F059B99BDF44 MEALYBUG
889,543,687 *5C83573486FF778B9343966A80A4509CBB6D972C RANDALKOK
889,543,688 *5C8D68529F8B898AD3C044AF7E52C7BA16203BE5 MELANY-CORDOVA
889,543,689 *5C8A99A5C78D0055212A0EDC36709F04C22ECEE9 RANJEETSAPKOTA
889,543,690 *5C8CB2C4D49212DC9BAA5B72689C14662F25ECCF RASSENKUNDLER
889,543,691 *5C89144C14E0140E99B1AB189A4F4C64007C6FA3 MEREDITH-JANE
889,543,692 *5C8489B6DDFA7E7EB8F51D5D2EE2DFD6FB5B388F merlinespiritu
889,543,693 *5C80F0A00514AC0F4D0B55A7AD2459A96101F092 MEROÍTICA
889,543,694 *5C86CC47CC23B29E22F43B144FE1D749D53CCDC3 RAYFORD.STRENGE
889,543,695 *5C8F12A6E3CD60E763914CE399D521C806DA6388 RAYMOND CHOOI
889,543,696 *5C89A414266946DA5BB705CFD3D8E5A3C420A26D RAYMONHASHEM
889,543,697 *5C8B7CDF13C108CC0CFB301A7D2E0A78C1952470 METACONTED
889,543,698 *5C82CD80C6B89BC51893F6FC7488DB26AF60A3CC RAY'S.MUSIC.EXCHANGE
889,543,699 *5C8563CE023B8DB28DE106AA98BFF1718A6FC0C6 metroterreiropaco
889,543,700 *5C817BF4931B8B244D090869FE684EFC41379E5B REBELLID8
889,543,701 *5C8E9EC1401BAF337B42D57A0BF2CE3D2CE7D600 MICHAL.BARNEBEY
889,543,702 *5C899B3EAC0BDA003769935DE8221D4731A67E91 RECOLLET0
889,543,703 *5C861278DA51ED272C4334DAFFA0647A9888E64D MILFORD.SCIACCHITANO
889,543,704 *5C802CD69E12754A0455321954440FEFA4D2A35C MILTON.CANTILLO
889,543,705 *5C81F566237198F6B901C220F52073C56B4C89AA RELATEDARTICLESGVNSPNAME
889,543,706 *5C88E197BC30038FAAB1599E3E059DF8609FAA05 mitchelmcomber
889,543,707 *5C85B1A5B10BCC5DBD45BE8BBD15EFE832ED5EB9 MITCH MCGOVERN
889,543,708 *5C84D0C9AAFDD5FCA68DE1741FC83A219DB5D916 MIZ YOU TO
889,543,709 *5C832BABC1ED1C8C67600105506AD09750CC7E9F [email protected]
889,543,710 *5C897C82422EA400754D7DAA9DDFC9DC4FF300C9 RENODDD5
889,543,711 *5C857424C6CF1CECF48DF31ABBB31DBCCFDFB3B2 reubenaikins
889,543,712 *5C855C9062C17398CDD21A78487D2F0D1978C7A3 re-up...theseries"carolinahustla"volume2
889,543,713 *5C8532D93E00D9656DEB0980792E5C695D5F2EEE MONTY.DUFORD
889,543,714 *5C889C0F01983A46EBFEC71F9D8102C046E8312C REYANTCZAK
889,543,715 *5C8EC4856F33AC5209671214E5619354AA04F892 moshelavell
889,543,716 *5C8C24800C288F17167D99A08C4000330BBE4CB4 rgyalucho
889,543,717 *5C8A21FA1DC868081EB31856675E1549016C602D mourraient6
889,543,718 *5C8C64A4E02E6FF0C8B732CDF7B976DC55826389 [email protected]
889,543,719 *5C8AF980E59775470C2CF7D28E58CD9CC8CCD478 mrthwest
889,543,720 *5C87218E8F7D7C0FF15F2BAFF8F4259B04A4D985 muraenidaes
889,543,721 *5C82F7395F8E830DB6E182F4CACA997838C4C8AB rifions?
889,543,722 *5C836BC6B5426914E09580436707059AF2C7E5B2 NANA YAW YEBOAH
889,543,723 *5C8D21A35743402DBC5C496A287F93D8DF4B8C2E [email protected]
889,543,724 *5C87A7EC5361E26CA663D30B758426352BE10551 [email protected]
889,543,725 *5C8A20DE181F0D0BE004DD644871D4398E9F1F38 RO$3NBR
889,543,726 *5C84A210F60D15962B9068381415BDFA1E1294E6 [email protected]
889,543,727 *5C8C25104B188286ADCCCCCF3621EAD6692E416A ndutai
889,543,728 *5C84A086FAC04C8526CB1B90D05AE0FA39ED3A9E NEGORDEB2
889,543,729 *5C8A9F76FABB21950DC59BCD392B1A609F90515B roger-wasn't
889,543,730 *5C8F641589983DB02904E9E62DC44E8A9C23BF2B rogovský
889,543,731 *5C8434BE4DAC97C943512EC07518996CB5504085 RONC4R3IS
889,543,732 *5C8FF0A7A93EB1FAFA0BF1B8A4B5152CF5523188 ronpirkl
889,543,733 *5C867019F012DC8AA951F7456DA03E4C6F46DC07 NEVILLE.LUPOE
889,543,734 *5C80A0E415572CB1F80D1FDAB51706E9F71FD401 NEVILLE.PATTER
889,543,735 *5C80FA091CA0E4489F5290D7E23E61C952450007 [email protected]
889,543,736 *5C8A26712A62C47B56D1670784AEAB47E277AD52 roween1
889,543,737 *5C87671EDA12223918CC9EDCBE728EB71B30CD1E nicholasnones
889,543,738 *5C8B5F0AE07AFC65B44637986B520C4E7D7297C8 NICOLAS.RITCHOTTE
889,543,739 *5C84FF3024910956A802393E8D621182B794C9AC _nicole
889,543,740 *5C8797D1EF1CFF170CF476CAD4A006EB03663A3D RUCHITA-SHETTY
889,543,741 *5C890ABE1793A5D835B6F686A3429E331D388332 RUDOLF.CAVASOS
889,543,742 *5C8A7A46F533D5E50891137C7A1EF2610691FA02 RUDOLPH.HNATOW
889,543,743 *5C8F85E2DC008D2FD607C545037D5DD6D06160F2 RUDOLPH.KRAL
889,543,744 *5C816704FF9D96D51854E3FD77EE612AF9500F70 N=J5
889,543,745 *5C8D3234A1B2A0BDEF2268002000DAB1557B367C RUMBUMPT8
889,543,746 *5C852A1683B073D205336A5884A23DB9C8CCFB47 RUSTYBERUBE
889,543,747 *5C8B367D85689CA8BA0F29F9165950DFF8E4B5B4 RWCKJRK85
889,543,748 *5C8A2F1E66E58426FAA16CF304CD06664F452100 NORWALK378
889,543,749 *5C8C58D251E87573EC236924369A1E434217837A salatori
889,543,750 *5C8E6EDC943CABB6DD86EE5313FDBB330C4ED9BC SAMMY.BELFORT
889,543,751 *5C833FD1922AF5456EC84BBCE0E1C7A8288227D4 sampirozzi
889,543,752 *5C8B62E1B0B86F21A49DA03571B0F568683569AF santosgebel
889,543,753 *5C806C6FD099F6298C2DBB99D8C62F6721E15398 octavioblier
889,543,754 *5C8287846DAD09D61C1329A236E74C89C673D3BC saskatuni
889,543,755 *5C8DA4AE4592AD05F2C396BADE9FF6FA30BAEB78 OLD MAN SAY
889,543,756 *5C8349DC98E28E40DB96931696816B310CCD7DD4 SCHAAMDES7
889,543,757 *5C8328DF4ABD00EC7B20131B60AEE4AB3304377A OLHAVASING
889,543,758 *5C8CC44B030EAA208A631C18F646C60E2515D500 SCHENKKETELSES1
889,543,759 *5C8916CB3CE99C333D77F9CB16D81A299B014EFB OLPHAND
889,543,760 *5C810669E632A3869405CDEE73B040AC6A9CED09 SCHMICKL7
889,543,761 *5C803BEA947E91F9E0D9EDCBDD7B0831A6B161EB SCHMIDTPRODUCTIONS
889,543,762 *5C8585066D9E2BC43E80F42F4ACAAF18457F523B OMERVANROSSUM
889,543,763 *5C844B168CB80B0C6B15A9B0BA71815E6F55FB76 omhouwen5
889,543,764 *5C86766EE0A701B077BB2DC537415CB38FA6F426 onejjj999
889,543,765 *5C84BD5B5B5DD599802FB7CD75898BE7EC073042 only-in-the-loss
889,543,766 *5C8279AD18D67F1611AD951A163729AA01189066 onlylovecanbreakyourheart(mawdub)
889,543,767 *5C8FBE89D4132E1C589C92455D4B93E88FE2672B )o(o~(q
889,543,768 *5C818291242B271385710146EF32FB45DFF3908B O><*.*.*<Q
889,543,769 *5C84E05D70013B887371D6B2D1CC2C3FB8792A86 SEBDENIALES
889,543,770 *5C8B9DDD51E977ED2FC54C67EC7270F26EF11461 OTMORFPCLIAMDNESNUS#
889,543,771 *5C841F672CB42B7148DF1460D635A2E1D3AE94C6 SELOTHERWISE2
889,543,772 *5C8DD9DF28B952275B7D7ACEF498282BF5C4287D serienfertigen
889,543,773 *5C8FF717056472A2FEC39E7549F7F07A124E783C SHEBEEN4
889,543,774 *5C8C492F04FEBD9CB7C42EF2875689910E01E14B <p><aname="n_448_">448.</a><u>id.</u>at91.
889,543,775 *5C8CD37675B1D0FDF184BB692AADD1030DBE76ED PANTHERINAE1
889,543,776 *5C808523858519C2BAEF41F2B64BF7BFB8614ED7 [email protected]
889,543,777 *5C800EAA6C00F7A20C7FA240824ED307FD3F6C10 SHOTSPC
889,543,778 *5C806EB94162E3632D0585F4A57DD7A12B1EF4E1 parts-comprising
889,543,779 *5C88FCB6CDB95927A20929151C7EF6D657A39519 pauliane9
889,543,780 *5C886808D2E4A1550895FEFFEACAC05E0BA830F8 paulmurano
889,543,781 *5C8FB104141D7093DA8E1045EE9EF5E7F3CF0CD5 SÎNICOLAU
889,543,782 *5C80B960E99A85676B379B29763E46F3C9C523D6 SIRIENU
889,543,783 *5C824E35F62FD1C48862A585AF7C53E90F0FDD61 SJOESJAN
889,543,784 *5C8D949BDE3389DCF4DD64E4C1F1B025C62FE38E SLAVE.(LIVE)
889,543,785 *5C80A4C5BC27BBCE7FA2AFA0E3892DCA46AF6F9B PENTOXYFYLLIN
889,543,786 *5C8CFB1B07A055360F98EE1733B67CF4F73D73D6 PEOPLE.AT.THE.BANK
889,543,787 *5C881B15353A9F9423500AA3C2ED41FD60BF2580 SLICKLILLY7
889,543,788 *5C8D7FEC3C6CD2B27E85F277346DFC89D685D3C8 SOBERIZE
889,543,789 *5C8B74B6357558CEDE5079EC97B8EA96271CA5B6 pholadin8
889,543,790 *5C8DC2FA202BDD4947FCA61BBA008D0919173AE7 pierrebrits
889,543,791 *5C85399464DEA1215D81A41E7706ADCD8DBEC4C7 sonwohl
889,543,792 *5C8A1B1665C796CE7F3D37ED97B344EA05BBC7FF PIRGREV9
889,543,793 *5C800D68891C7CD06204CC67DE4C8DE2169DBC7F PISHINGS6
889,543,794 *5C87A46A2953AAAC446CEE650060F7208B085986 SOUNDARAVALLIJ
889,543,795 *5C8589DE8FF26B6616E2F151E26D65FFBB67182D SPACETHEMEA:30
889,543,796 *5C88AC0962363ADC4B115C1D5F6EC4D3709CC10F [email protected]
889,543,797 *5C81C0FB9FA2BE3DE6D39D2156D6B5A8387E31FC spend_time sp/e/nd_t/ai/m
889,543,798 *5C87B21992D8C89006FC215BD39730992AEFB1B1 PO+A$HE$
889,543,799 *5C825B5FB1243A5E28B1C5108CA8EC25F0C3BCB9 $POILMEN+
889,543,800 *5C872394419DC07022552CE0080EDFF41F624A46 POKAZAŁBY
889,543,801 *5C86998BAD8C40DB976BD523F8307869DD3A8619 polyglottische.
889,543,802 *5C8B58FFEF767DDC81E1D741ECA9A644750FF073 [email protected]======8
889,543,803 *5C8341D77229D1B0CB279369C0CC9BC16AD73525 PORTHEAD
889,543,804 *5C84730EFCBBC601F394FF5E99ADF7A240D4D38A POTASSIUMALUM
889,543,805 *5C815DC306DDD76CA8B6DE8F1991090D3F1BA25B P=P-~-`SPLAT!!
889,543,806 *5C8D9A7B6C07604F004E6923DF1A1CEDC75572CD [email protected]
889,543,807 *5C81985E6DDF0EB23AA7B464DC7CEA9F1EE6A207 SSEQUENCENUMBER>1</SSEQUENCENUMBER
889,543,808 *5C8D81B6849D0F04C76CB892BF59B328793B13BE SSHEDOUDA
889,543,809 *5C81D5111578C6B4AB2166BD06BBD91A382681F6 ST4PEDIOVESTIBU14R
889,543,810 *5C8FB1A65FC361673321E72176398D58BB22AE26 PROBOB
889,543,811 *5C8C12E24239860CF355D343AD292BD5B6C5A523 prompted
889,543,812 *5C847D795AAAE29549F8FB32007B16AF1BA6154E PROSPER0CALIBAN
889,543,813 *5C8F9DE5397E7128AC73AE7136B46E28957A0914 STEPHENLOO
889,543,814 *5C832345CBC6C49396BD912C7D125A30F8A32D29 STRAFHEIDS6
889,543,815 *5C858CA5B22A3EAAAA108BDAF6DCEDFD16D056A5 stuaq
889,543,816 *5C803F009DED0CD3AD24FEEB2D93F90063BC42EE subjuguerai.
889,543,817 *5C8C455B4C0BE056FDEBA6C6FF5D798E2EE408B5 q===) ~o )o(
889,543,818 *5C88E05B55C658BC1D0EC30BB350158F0441D702 questioninglies
889,543,819 *5C88A0F46A9A5ACA69B3E406BD401C67369740D4 SUSPIRALLES5
889,543,820 *5C8DE2A9FFEBD02774AB2FD8F172DE69C10F45FB R3V4CIN4RLH3
889,543,821 *5C86B06E2DE3787CDC4A787778C31D62156C2DAB RACHATES
889,543,822 *5C85A56A5CDF40E96539D795765B2F619BDFDEE8 rachel-abbate
889,543,823 *5C8E4AF7F78D3E46B3509C2BEEA0337BFF986EF5 RÅDSKOMMUNISMEN
889,543,824 *5C817670AE8ABFCBEB678F9B69C431E23D2B9A81 rakesh.handoo
889,543,825 *5C83DD532D4428B3EA175DB77A17441B98B05654 RALPHKENRICK
889,543,826 *5C893679313250F253291911872A41586932D7EE ramiromcneeley
889,543,827 *5C8FDC72DFB629F38F4B155EBC6394AA8C48B265 RAMON.BONDROFF
889,543,828 *5C8C631650B85216581E2444AE07630E0E1C956B syjzi6m9mxau
889,543,829 *5C82B32D7B89705220294A8D29B1D999006B2DA4 [email protected]
889,543,830 *5C8D26E8889211FE965D3B85A5E7F00F6430E3B3 RANTIN' DOG, THE DADDIE O'T
889,543,831 *5C83641787C6AF7380686ADEBC8357F1E1A481C3 RASCALSWEETS
889,543,832 *5C81BAA0977193649719A7DE20B1089E8F614387 T211756
889,543,833 *5C8688CC1FE77A566E9A4EDF96A34A0B8EBD30E3 RAZ ELIAS
889,543,834 *5C822CD31FD27D561A8F969E36CF2F6E40F3293E TAKE-A-CHAIN-TO-ME
889,543,835 *5C8BC2A731EE2D15787D859294D4A160C93C7C43 REBECCAKOWALSKI
889,543,836 *5C82BA6682506B6334EA720038DF04CF1ED33F0E REDEMARCHING
889,543,837 *5C87257606B1D78B57BE3D199474C274B6712706 TALKINGMOBYDICKBLUES
889,543,838 *5C8083B3DBC5FF9FA8B4CD16E4ECF1B43E019139 TALKJEANNIE_WILEY
889,543,839 *5C833E6F3E9B3F9D6A63062BA0845BE990FDB442 reedazbill
889,543,840 *5C84AB31D83A31FF82303EFE8B34B52EF5210733 REGRATIS9
889,543,841 *5C8D20EFC9F120FF45B74FA3E2EEC6E5C248FF67 REID.TURRILL
889,543,842 *5C8D4305F7758C500C847B2CB10EBF81208DEB0D [email protected]
889,543,843 *5C8AFD3E7BAE50C22180FADFF0FC83AAA8B9C12A <TD>&NBSP;<BR
889,543,844 *5C804BD085C886D754038206B7689CF12DE341ED REMEMBRANCE-#9
889,543,845 *5C86AF889C7188418600F368BE35FD19F4F43EF0 teddysuermann
889,543,846 *5C8C225523ACEF24EBCECA4902A847A0658FC8CC TEMPLATEREGINA
889,543,847 *5C847CFD16DCE97AB9E0AC218C09ED3C9C9948FA TEMPTING.THE.SALMON.TO.COME.TO.THE.FLY
889,543,848 *5C8C796BDAA7D93358E452107BFFFCD4AEA7165D RENVERSERIEZ
889,543,849 *5C8A795C596B40AC504B87AAE96EF0BA0CBB1CA2 [email protected]
889,543,850 *5C8E9E0E3652EE271E7A8F7425D91947F8F1511B THADSYMONS
889,543,851 *5C85C74774FFD963E3BAFBE256D616888F78F829 THANH.MROWKA
889,543,852 *5C8F3BEEE81B47951E6540E442B54EFD4CB5F2B1 RICKI.LEE
889,543,853 *5C892F5102086B899FF9DB1C073B06176AC9BDD6 RICONICELY
889,543,854 *5C80582791EB31861ECB7A7BB5B70F45C427E1F3 thebestclubanthems...ever2k(disc2)
889,543,855 *5C8EEC1B154D7FB17857468E515182907FC4E4F5 RISPUNTASSE1
889,543,856 *5C80F3B6D6E8F5DBD045AB035E61C1E353E0265D TheJimmyCobbQuartet
889,543,857 *5C88EEF7C25E71F1BE819DDF5BA6847D18066279 THE OBSERVER (A) :60
889,543,858 *5C8351B245A73EC89DB8902032E220E20D2E0405 robbynelton
889,543,859 *5C8B017CDAA559522A574F923911F30EB2AC0409 TheRiversideGospelGroup
889,543,860 *5C831CEA2F9FC40FA5DC1D3196E572BE5EF7E2CF the story in your eyes (original version)
889,543,861 *5C83C75FE76BDA91AD0675D94C437B734C3CC5E6 Rocky-mountain-sheep
889,543,862 *5C8E8EC8EC4F2FCAC79B51055351549894447884 ThongSong(JonathanPetersBustremix)
889,543,863 *5C825CBC0E1D4F080498331C47A92475C5D9D7EB THULUR
889,543,864 *5C8EBD9BBCF1177858844C6B6EA123E5E1AC8B5B rooseveltformanek
889,543,865 *5C8CBEDD08BC30CC497D0A681EA946B3C3A8651C [email protected]
889,543,866 *5C8586F703C0518D08DC027B63BA389E2C5184DA ROSS.REGINE
889,543,867 *5C8B23D84A803105F8A96621E1F76E34DE852447 ROUPIER?
889,543,868 *5C84E255018BA272D8E34CE04BC6E4532B084457 ROY.FRANKFORD
889,543,869 *5C8AA805FF59DB150474565D7B711891C57A7FB4 tnanalgging
889,543,870 *5C8D70C8CE8FE2F038619D192EC873D9D73E939D RUGGINI
889,543,871 *5C88674948988E49BA1DB9AD96B053C313B201F8 S0UL-CH4R
889,543,872 *5C8876140417B8DE88EEB4454B0A72B6E8CA5FD0 S4366751
889,543,873 *5C81D7E582E01C3FF616A780D1BFB841BB718FF5 sacticket
889,543,874 *5C862ADB89CCA41D8A1FC598E889F6BECA71F167 SAMARDGING
889,543,875 *5C841D4DDB4645D0930A7BF6D52D8071039BFCC4 TRACEYGANDERT
889,543,876 *5C83CDD625435813D267C13F2678920B65B6DDF0 TRACYBERNIE1
889,543,877 *5C8AFD93F4F232380A2EC194546C382C9994DCF3 tracy-scales-gordon
889,543,878 *5C8CF417359D6D4D48BAB26023182941E76428E2 SAMUAL.HAVLIN
889,543,879 *5C826CD0E361C34537E6E9D38517A4D254ADFDE7 SANDRA-ASPLUND
889,543,880 *5C8F9762EEBEBC7B4DDFF31BD87AB824423BC71A sandyandpatrick
889,543,881 *5C83ED43930100CDC35A3ADBF66160C23D85BA84 travisdenali
889,543,882 *5C83F2A075CF2006380E90F69CD686E2C217C375 TRENTON.PRINDLE
889,543,883 *5C8B7A8EC2CDB8643B7597BE096CF039F212502F TRexFood
889,543,884 *5C82C409EBF9C04693593277AF7BED0A3FC4CDEC SAPPHIRESINGER7
889,543,885 *5C8BA97410F6218E7E22714EB20FA2726F6E02BF SARITHA RAI
889,543,886 *5C81D9C391C0F46ABE0D64FAD71897D75F265EDB SATORU123
889,543,887 *5C82AEC3D267FA5C4073AEF14053C310C5A491F0 scendeednecs
889,543,888 *5C86A044C2EEA6F12713E4AFE571830B6DC9A898 TRNSCRRZING
889,543,889 *5C8E5FC47047D1C77865767614FE92FC94BCD570 SCHIEFLACHENED7
889,543,890 *5C8BD2DB0A714C8FF1C6F30F3DB96DE2452A771B SCHWANSCHWAN1
889,543,891 *5C8A4B0178FD6D9B8A3A936C36E14C3D27F41043 scollero2
889,543,892 *5C859170E7294454D2A6914E3B6A33C9C2B7E417 sdeezy
889,543,893 *5C8CB1E1B9443E7E93B948D93F9E8B09A8B8AF51 selknur1
889,543,894 *5C8E1F48F25F8E6969DD86F61CECA5F78E160DD4 SERVOMETER0
889,543,895 *5C84EBC7C2F8A6A37DB8A0F3CD8D3CD604C45E44 SETDRESSED
889,543,896 *5C8DC360BF281CC9C32C1133DD9F7D71E96C6C1E seymourvanhamlin
889,543,897 *5C85E4853F5C4E1ED5C6FF78D0541BEDD5A3AFEB TYREE.SOMMAR
889,543,898 *5C8100E72594238B8C3A00A6411A56FD2F6AD863 TYRELL.STEINOUR
889,543,899 *5C8AEA83BCA06A4B6B5E60C83E8FE70025E3E007 U5=S
889,543,900 *5C889DA66CE4D162CCDEFD0D2044A749CA96190A UEX'
889,543,901 *5C891146725D0D23CB9D9A8ABE261A35A445CA4D [email protected]
889,543,902 *5C8DAB95141041AFBA9ADA42353ED5C0C819750B uitgefoeterden!
889,543,903 *5C864594431662A855482275CDA8ED1FE81B9A79 ULTERAVO1
889,543,904 *5C899D9A4E0AB721D7FE05411B9922EB2509AEE8 ulusunuz
889,543,905 *5C8E08F000E80CD801AB335F7C3C74C83FEDCD74 UNCTIONS123
889,543,906 *5C84A86C1A1A8C4C4564FD199449B54444FEC1E8 [email protected]
889,543,907 *5C853A8B4A6BE88C1FFAD3FFED834C37CD57E9BC signify0
889,543,908 *5C8FC131879C014548FA961031F0595BC9921B1A UPXRVJZ4
889,543,909 *5C858F9AC05485ABA7FD93E4FBD843CD29D55980 urapods
889,543,910 *5C804DFE60239738E3CB257B7302EDD31C8879D2 USERSOHOT88
889,543,911 *5C83FE2E2B482A4B67DA54A587227FE23FD00DDB skerlew
889,543,912 *5C8DBA99B6D36511569B9D617D2FF9652D7984E4 skie?
889,543,913 *5C8D216BE060FF67C5A24E181886EEA03105EEB0 VALIPENA
889,543,914 *5C84E67A0CD280AACC41681BCA5A0891BD01646D snoreuqnoc
889,543,915 *5C838029FC3FF5DC4B3F2F5103DE41BD4B478673 SOLROGOWSKI
889,543,916 *5C8F5EDC8E52523F77932CF7F52D9C51654BE00E VBAMZMSWYHSE0
889,543,917 *5C8CE17D6195C3C3D353CB1859512E8A525DB5D7 [email protected]
889,543,918 *5C895494289D40E9031454AC949B5E0CDE6C69F6 VEECHEROTICH
889,543,919 *5C8F66D3D9C74494C581C433A12F6CDD06504421 songs.for.deathmatch.2
889,543,920 *5C89F74F78FA10B080C0F848EF12B034B84A0D32 SØNNEUDKÅRELSES
889,543,921 *5C85B7A70F6CCC37E4032C74000432656D9D19FA vendrysing
889,543,922 *5C84FDFCB1D3B3EE033BC4406D5FD33F7503AEAA verergerde
889,543,923 *5C820982B340E4E851B16E1BC0ACA81775B80197 SPIRALTWISTER
889,543,924 *5C8D32F2BA44EF532E4833FF436070331FCE5C70 VERTALENSED
889,543,925 *5C872A1A098318C7B81B597B1CE5AF28E466251E SPLAT!(3
889,543,926 *5C83DB5A6A8845B4A57FFA2549FF691EC6ECB4CC VICTORIA RUPLEY CHUBB
889,543,927 *5C820D08CCD6AB36A1C4B5C7344F94DDBD8C38FF vinceaustinmendoza
889,543,928 *5C85C88E1EB6461A8E8953ECC1FE6D72C6B00066 VINCENT.BONAMICO
889,543,929 *5C8026FF190D24579719B97313647472C7275094 VINCENTPRUKOP
889,543,930 *5C8C1055F3324D2980096937E9D00242F09F584F StateofEmergen-c
889,543,931 *5C829D577E9B2776B1301391E4B98133503C19D4 VNIGIL
889,543,932 *5C849D6B47CC418093DAA03F6A6802503606115E stevegehling
889,543,933 *5C8AA1297B2B3143664ECAABDB5554C0BD6B88D9 VORONIN-VLADIMIR
889,543,934 *5C83F9C1F72E9706CA98C27BDFECD5580F40D696 STOPBUTTONBSW0
889,543,935 *5C8D7C1526CCD04B038E57EF3D745159EDDCFAED STRALINGSBESTENDIG
889,543,936 *5C8D250B75E48ADC766D13543383BB4822DAB1EF VRPLNTSLS
889,543,937 *5C883AF332CBA8963EF575D2C1E0C74357213F59 v&t qx
889,543,938 *5C874D87C7C148F150CB528800075165CCE0EA3E VURDERINGSPRISERS
889,543,939 *5C87520591F775815B1CD5481645B6762E7C9750 'stumoleannan/nightfallonmarsco
889,543,940 *5C815D2B8217FC7B1C7188912E1D6734E78CE803 subdiaconus1
889,543,941 *5C84D3E856A336A525A33DF8A67CAFD16BA5F363 waeint
889,543,942 *5C8E06EFCD6B92E17B615E2766561B301EEC9382 WAITING-DAYS
889,543,943 *5C8B46F20613F6509BB68F969500842BA3688051 wakeemwhite
889,543,944 *5C895A7A8415DE44C67F5D0C14860D40B2AF594D WALLACEERDNER
889,543,945 *5C83F320AA00C44497B6BFFD100EC5D117A34827 WALLACEMULATO
889,543,946 *5C85C788ACE9209EB77A17DB9A42C237950A54FB WALLACESTALLSWORTH
889,543,947 *5C84A5EF137E686660F1EB400B39CEDF4B298647 WALTONHEIKEN
889,543,948 *5C8139E2DCAC2D315B1E93B33AE2DF37DE6F7961 [email protected]
889,543,949 *5C8AF0E01E8A06B11402BDC6F31403679F4186F5 WARREN.AMBROSINI
889,543,950 *5C839FB9E6778BB630516AAA99442668F7845D10 WAYNESCHIELER
889,543,951 *5C83EDED08D1D606E9ABF46A9C01BB107300C0DF SWAMPROSED
889,543,952 *5C8018E84A517DB02F5F2445704AADEDB904F9A2 WEERAAL0
889,543,953 *5C8B9A009ECE4A2A3BEBA396D26677624BE755D2 wendy-dunfee
889,543,954 *5C88EF99EA53453F50FF445C5C138EF2320FE75E WESWASSMANN
889,543,955 *5C88FF48E1A25AC16E1580904E2E052F6BCA3BA6 What.Matters.Most.-.It.Might.Be.You
889,543,956 *5C848FF180402FD578A322FB9B84A56DF13373B7 whatuknow
889,543,957 *5C8AF0A8BC39D84B221052FF2F0CC92C95AE633B TAJDARN
889,543,958 *5C853BE72533CC050096CC39E89F4FB0323C4F4B whitneymccright
889,543,959 *5C8D911551E13AC3673505FFBF5FED871FB21B58 WIKIFYARTICLEDATEMON
889,543,960 *5C808E4D1E053DC20DEEAB5909FBA25ACFD9E117 TALKDANIELNUYUARCHIV
889,543,961 *5C8F31A7F8D3BDBE93FA1FE388CFE1BBB2C0D081 TALKPOO1234567
889,543,962 *5C84DA8EB0F76DD875BC35410969F2808B4F6ECC WILFORD.GRISSINGER
889,543,963 *5C8CCEABA57663026B21AC28BAE69BB5708EE1B2 wilfredomcclafferty
889,543,964 *5C88A04A6D6B604443893AC5A6B485655B46090B tami-adrian
889,543,965 *5C82955C83878E4D3BC71DC20F8ADC8E8A0BFD9B TARAHARLEY2
889,543,966 *5C8B8D59521A855EF7EC89CAF7E25FA4DC900F04 TAYLOR.STEAGELL
889,543,967 *5C81767F323553C1F4C94BA8D6D6151F0E638C5B wintronic
889,543,968 *5C8B66B4AD9860B69743E4E9C122E08DF0673F98 [email protected]
889,543,969 *5C88A0827A18902F526FDA2CAB6C0FB6F7AEEDA2 TERMINER(FEAT.MOUBARAKA&SOPRANO)
889,543,970 *5C8F3AD3655CC3924E05205274FBD129A914FF99 [email protected]
889,543,971 *5C8002FA7BD6A691D3FF434A61ED4183B6337DC8 terryo'neill
889,543,972 *5C8E3FA5081B419E054D71E8CA213B2A9BD49E75 [email protected]
889,543,973 *5C8F1F4451FBD6331DE553041DB871ABC3C661AD thatdarren1990
889,543,974 *5C89C08169FFDBE06E2E609C6140303D55AD6F20 wyattpossehl
889,543,975 *5C8D9A5EDFB4A139B1ABDA6C6D8B47FFC5F53178 WYATTSEGERMAN
889,543,976 *5C8C16185A0849BA839635A8E9221E8B660FB824 thechrist00
889,543,977 *5C8CD2C4D5F18D9557D43218966E8B929D0CBA1B X46223
889,543,978 *5C80B8288A55B3D84EFCB19BC739C80D50973C15 xavierschlag
889,543,979 *5C8019333AB0F1A41E2115973BE2BC403BAB4E57 [email protected]
889,543,980 *5C8E05F0B8FA92A3ACBDA4E11EFB644782E06E4F xebvvmh43
889,543,981 *5C8E9C9BF1307B4C04C004F6CB53B12E847F0FAB [email protected]
889,543,982 *5C8BE2FA4E816E8738D18C72767F5B65425AF4EC THEODORE.QUIRKE
889,543,983 *5C87994B386AB4EA2651F3DA5CA9EA9293BCB1D0 theodorerybowiak
889,543,984 *5C822AE1E6C4AC28CF637512512A7A069F4F1951 xiokoy
889,543,985 *5C85065D60A7F118DEA8110C5CE05BECB84E9CF8 xjvt
889,543,986 *5C8912BEF2C60756DB56746DAA82E412F787A2E7 Y139978
889,543,987 *5C894A2F2EC06F8921BEB49B1A0AA5695481352E Y151943
889,543,988 *5C85C5455DE21EF72CFBE79FB488BD62577EB1C8 THURMANPLESSNER
889,543,989 *5C8EAB66A04D1BDFE394FE6CAAAD2BC676B9CF09 TI2BA2CUO6
889,543,990 *5C8C632E83F9FBB0AF71751F296EA2D0ADC788FD YARETZI225
889,543,991 *5C8EB746D1BCD0D901760C4FC11CCC46190A5842 YLIPPEP7
889,543,992 *5C83387CF8903BA07809D5B64FE9B05A4E24D8FD YLLIWMKJ
889,543,993 *5C8E10346F801800433565FDD349A705DCEC2B4F [email protected]
889,543,994 *5C83C5F200537F403CD46023D569827BB00D0E92 yogitabholepawaskar
889,543,995 *5C87B4821347154E154EEF733F535B7A5B6ADE45 yongji
889,543,996 *5C8CF7D7F7792C454C93A52790415D3C25C3DB60 YRAMSPOOH
889,543,997 *5C894A78CABD1BEF98B4905E83E140F49133290B YTREPORPXAM
889,543,998 *5C8405118C097503D690427CF0B2300E3E25E5DB [email protected]
889,543,999 *5C85D51893234D340B97C4D57B648C4E1E9B2F59 YUNLONGH
889,544,000 *5C821018395D46017BB506D5AC74686FA71EF0A5 YUNNRUWONG
889,544,001 *5C893D4B31E509D9EA0F3E5187A98302BF5267F7 YUYALING
889,544,002 *5C8C7B4827A2DA0E17314B0AECC037A3DD784E93 yvonnekerzicbrannon
889,544,003 *5C83B4C05F5F4C7ED48923253CD3D680AEF6E2C0 [email protected]
889,544,004 *5C815FE64203420B1CA027703200C1FF37C1B2A8 YYEHMEH
889,544,005 *5C8E6980B1C4FA813E92D878FE88C2EE030CDE6F TOM.SEATH
889,544,006 *5C8EBEC09F8DF3CCBE4955747409A307D86D1F03 tonytaglauer
889,544,007 *5C89B1F9B78FF82243C247AD16174E8FF4020683 TOOFELGNATING
889,544,008 *5C8E2B9F70AA65FBCB2A04D948F56199AD21735B TOPHERTIFFANY4
889,544,009 *5C856BC037A4A72DF00AD88B538C8EA6F4F50165 TOSTERUD9
889,544,010 *5C80BBC5724560FADA479E1E029AD9232322AAE0 tourzweitem
889,544,011 *5C88CCCB885272652CFFFD20FEF95CC3C5C30A2E ZAOKUPLJANJA6
889,544,012 *5C8008E622A5666099502CD77B71C6DC371233DD traceyledlow
889,544,013 *5C8C4110F2149FE8745FEC66F9858D3D9E482B02 zeidnevs
889,544,014 *5C82F723D9B06C880A858089411B0621382EBD41 TRANSMITIREIS7
889,544,015 *5C845CCE5866B4B2348BCCF34863410C6033400A TRENTJORDANELDER
889,544,016 *5C8934DB2A17C52F5D0EF6C54D3A523D1FD899DA [email protected]
889,544,017 *5C82A086DB56C376D421DCCA706119B02F971E09 [email protected]
889,544,018 *5C85A0C5F2BC192D16DE866805938A2868B73DDA tricia.sumiran
889,544,019 *5C82A35716FEE11E4E5AD8FF35D62E2165037AED [email protected]
889,544,020 *5C8869EEDEAEFF463D12E1A7212AE4EB4740426F [email protected]
889,544,021 *5C820615244ED1D2B3861E8AD9970E7FB5B9A747 ZHUNANSHAO
889,544,022 *5C8DD9302648D6BA55CB2657A287C6EC973352FA z**n
889,544,023 *5C8DE8174382F0EE6F76CB76ABF30877D1F2EEF2 tsdleizebno
889,544,024 *5C8720C1F9B776A19E4FA313F7E495A8C72F572A tushankthakur
889,544,025 *5C83EB8FC7C21B8CE488020DDEB625E84152BB67 ΠΡΟΣΟΜΟΊΩΣ
889,544,026 *5C8A36D710AA33DB1A1F262F7DBD200D20AAA693 TWEETYJASMINING
889,544,027 *5C86D204042BAEC5923C5EF4317B4219D9F69B2C АВТОКЕФАЛИСТКИЕ
889,544,028 *5C87D25E5413FBE76679FB9306679DC22530B7B3 TWISTEDRYCE
889,544,029 *5C82D158E2BB94E86E98186C52915AE1B382E397 ахтоя
889,544,030 *5C813062B586203CF80F7166207C44AE8F31CE5C TYSON-VS.-WASHINGTON-(F.T.F.)
889,544,031 *5C81B5CE36EE210C835CC861B9853CD5B5967E90 u3,b
889,544,032 *5C86CAA6FF095FD3BBF8E34BA7580FC8594B4B9F ПАНГИУМ
889,544,033 *5C86D3BB7415577F634832220BECBAFD2EF0D749 ULYSSES.WINDLER
889,544,034 *5C848C163CDA7E5C73F36533FE687C1AF6C54638 UMER KHYYAM
889,544,035 *5C8D033D5E57AF4802A316901DB2B6F777160DC3 РЫЛЬЦУ
889,544,036 *5C8436F8210FF8482E9B7A9D34CFC48CE825D022 снайфедльсьёкюдль
889,544,037 *5C846BE91E52E39FE2F0699F85D02A5CB01AF635 [email protected]
889,544,038 *5C8A79BCA36CC7ACD9789973F7767793EE2B3547 unit-2---test-step-3
889,544,039 *5C8EA0D7C443F695EF886209746C0011358AA814 VAN DE WIELE
889,544,040 *5C87DAAB1710C8716511FD96BE3D5F495CDB8E56 VANESSA.ESPINAS
889,544,041 *5C8B161DE4E6E444D6BDF991EC99B30E0DD07B84 vannary.nhean
889,544,042 *5C8DF25067202A1C89E301687535A72D5227F6E1 VATHIGRECE
889,544,043 *5C8A1CA6D3181099624B2DD9EE33F27DDB9CF69C VENU-AND-GHATAM
889,544,044 *5C806550F2267FF2485DC797CE9E3BD636B53BFD Venus-(Meant-to-Be-Your-Lover)-(feat-Jan-Johnston)-(Ti
889,544,045 *5C84649A2B659BB1B6C6D9A1BA77DBF24C096621 VER.1988
889,544,046 *5C80F10F89604E86E23CEA19718726F002D53171 vernurlanza
889,544,047 *5C857E1E76203AFF4BB1001AB68EA0C5D92FD94A VERSION.(MOULINEX)
889,544,048 *5C810028DDB6FF18ECAE38410007ECDDEA65DE01 VESTRAQUE
889,544,049 *5C8682FDDCF6D4A683743CB1AE8BC4270DF86D45 |VVVVVVVVVVVVV-------------|
889,544,050 *5C8DC1FF375ACB6FEA3F7ECE307DC2DF83638EF6 WANDALMANAKS8
889,544,051 *5C8103224E1C8C5416358C741C9A8878FB07E81C wanda.snelgrove.smith
889,544,052 *5C849B94666493491570F633C518C98B1E632B89 WANDYKILSMAN
889,544,053 *5C8D87ABFCF1729095FC6C8AFF0B0047540AE0FB watsonwater
889,544,054 *5C8B32B82063049230F44A81A8F2D9069A3AE113 WE4THER1N9
889,544,055 *5C804DC88A4691553C92D72CFD094F76A71E1830 [email protected]
889,544,056 *5C80A872D4B72ABA2EF891414FB7B7477418BA2B WERNERSCARGALL
889,544,057 *5C8731A030999567FFF8A5D163DE5D8D8A36276C whenmymorningcomesaround
889,544,058 *5C86F90A7E7A764DBBE1A706DF510A5BF6255850 WILEY.HEIDE
889,544,059 *5C8A16BA9959BFB5C1D0AD4AE15F4ED115CDDCAA williekovach
889,544,060 *5C811B71A8C58B531DA26B982FFBD19EBCF12A3B WINDSURFBIGMAN
889,544,061 *5C8B40784CE88127B4783DD319A79CCDECE0BDD0 WITH LOVE & BLOOD
889,544,062 *5C8B91A1BB0C4F06B03DD644299554978353AC06 WOLFIUSGREY
889,544,063 *5C80B5DC5D498638769BB482C5932C39CB2A3282 WRZESCIE62
889,544,064 *5C8CBD61BFC3CECF1555CF17F04F026139FA5500 WWW.GALLOPING-GROOMER.US
889,544,065 *5C8B25AE0BF36030424C43D4740E6420C966D46F 05121854
889,544,066 *5C8EE470FFBD05BD8F8A16F8C23487824B8F42A6 x2085d
889,544,067 *5C849AAAE87CE942A9E967DD4F640337DCB89CE1 [email protected]
889,544,068 *5C81CBE2959F740227B8E6710F5733046D768319 0LEONID
889,544,069 *5C85D05F3A1F9A52C1B1A3DC35B4AFD568377911 )0(-o~-(====b
889,544,070 *5C8D79033C2B2C74EE44F81CEFC9028CEF3B5B58 {x}-o~o~(#b
889,544,071 *5C8E5E7D32531C103415151014C06092EE806327 [email protected]
889,544,072 *5C8C3A8FB76273C642EBE9603659F5BBFFD99D3F 102491 markkinointikustannukset selvitettiin k
889,544,073 *5C8B878082DF9366D7316AB54AD199A3D8F2FB7B [email protected]
889,544,074 *5C89A6A3F9CBCA65FB4475A582D04B7BBE2D7DE0 XUHAISHAN
889,544,075 *5C86E4B3409BE91F0A350027A35CFBDBF1D0727A 1150964 moreover-,-varo's-earnings-picture-has-brightened-.
889,544,076 *5C8645961303468BD8AFE339CAD907EE86344883 124SHANIYA
889,544,077 *5C89344CF5909B2AA1B174B9A08C0F7F9BB4FA41 yardsharks
889,544,078 *5C8D5B0B22EE7E5480B33A69228C31EA6F4D958B [email protected]
889,544,079 *5C889C77E675B76D7B5372B4C3B1262A6DF16195 1587030 SAMASTA JA SAMANLAISESTA TY
889,544,080 *5C8522B862EDB3F1261B3AB5C170580FF3C05C3A 16.02.1279
889,544,081 *5C8CCBEF0244FCAD1FB4E5F874D8402A0F3E798C YIYIMERCADO
889,544,082 *5C8A7C7195B7C7DAF982D1BE97295A14B5A1DB29 YKANSIL
889,544,083 *5C83615CD9994603CE79D59E06DC33376BE9D329 1915516 vuorokauden-aikana-se-ehtii-kuvaamaan-koko-maapallon-.
889,544,084 *5C89EC52535CDBDA4AE6C3B34B914B188970F0CF YNNADTEKSAB
889,544,085 *5C82E92D498851589A522C4953DA3DDDEFFE39A8 yolly-sandiego
889,544,086 *5C847F51202BD270E07D4038B3590FCE22B94892 YOSIAFENDRA
889,544,087 *5C8756FE673DB9F8B372D33764203B04FEA59C26 YOURREASON
889,544,088 *5C82B1274A0E2266BE0EE0EC3913EBF8359ACD07 1 ARTREACH
889,544,089 *5C82A6302D13C0BC88C36D8A5AE2EA5DAF2101B4 1-buddy-holly-fans
889,544,090 *5C846AE6C2A51A499FDB701F2A03923AD625F3E4 YUGDEEPSHARMA
889,544,091 *5C8386506A48FABB077979476458B45CC1D5F573 YUMMIESTMUMMYCOMYUMMIESTMUMMY
889,544,092 *5C8DD9A12584A7069F444834B82513BEB8517798 1-DIDIN
889,544,093 *5C8FFEFB511DBAA485815AF48C4563059B4D1B27 z00p4+h0l0g!e5
889,544,094 *5C88389B3E9CAD70A06E78C063070D6A8AB86602 1-ENERGIEWIRTEN
889,544,095 *5C848E4DCEC37EC09EB244DE1E0ECB97948CA1DC 1FEHLBESTOCKUNGEN
889,544,096 *5C8525D15EBF91841F61DC6901ED1F7A3640E87B ZACKTUMLINSON
889,544,097 *5C85F05F9BC1D73F6837E4CF10561617215C243D 1-fritz-koehne-schule
889,544,098 *5C86AAC924DE4857195C71AC9F06A9B3DD81CB42 1genisigi
889,544,099 *5C8F5F04E21DEA632A38042ABC18AE43E43E4876 1GODSSEM
889,544,100 *5C8E5653BFE6D25CF98D481A75C960CB782A6ABA 1.grabenburg
889,544,101 *5C8F73B0B667CE6502D1A8C2F83CFB60C001802F ZAPATAROS
889,544,102 *5C83C188186E44E25F3B02AA37102A42FD52E788 ZARA.VALLENDER
889,544,103 *5C8A670F4C68D1357871E8B02E16C7D16C9C4257 1I0D312MI4
889,544,104 *5C8680D654092EB3B7759E62AE1EB5C8F296FCB2 1iamblue0
889,544,105 *5C87D37E163ABA883E1A6A24FEAADB0F983A76FB [email protected]
889,544,106 *5C8C3B5BE4557243333A9B7D168CAA54F6FECB95 1-LASKENTAKORKOANALYYSI
889,544,107 *5C80C12A014FDD7134F06BC6E2D626EBF4E786FC [email protected]
889,544,108 *5C88C814F03199DEADF8CD63B0E60DF40D55D280 ZIBULILEMEZ
889,544,109 *5C8F955237F8CB638C96AFD9E73FAA33329B8410 ZJOSIEQUINTANA
889,544,110 *5C83201B40305FC372F8DB25FF8AF052BB8C91BF 1NCON9RUOU5LY
889,544,111 *5C8BBF38D7932235F325163B709C885C5A83FDB1 1.ongelmat-kansioon
889,544,112 *5C862F94305CAFF4AFDA60A591B057C9BECB6CE4 1.PANATIS
889,544,113 *5C8962BDCE6FDBFD1BD9F1D107F293DF42DBCBAB 1.PHANTOMSFIRST
889,544,114 *5C88A55A31DAD45F6C5CE88C8C847A4E140ACAA2 ZWERGENHAFTESES
889,544,115 *5C86FBE33B3CF9EC125FDEE2B27033E38F1E7B5B zylazogaj
889,544,116 *5C8129AD73A33094792F04C58DB9606F2AF342D9 1rec-vee
889,544,117 *5C8C8E221AC1F20CD3722C6DBD1A8903A93F2BE0 1revisionsverschluss
889,544,118 *5C852F726BBF90CAA8C731644DE0013A6D96376E 1-SEX-ANGEBOT
889,544,119 *5C88FB1C433E6A48AD06859637671FD7AC08C1D2 1.SHADOWKETTU
889,544,120 *5C8830EB6229E45C1B6A517F1527031C0DB8F64A 1-ski-to-ski
889,544,121 *5C8572E20B5DEA8AAD0ADDC65FF7DAAB95C055B6 1songwriterkollektiv
889,544,122 *5C828942B2A15B396CDC7DED2E37EB7204DD1E4B 1SOPIMUKSEENNOPEASTI
889,544,123 *5C868E0F87ADF659242B9F31FEEF53B34434C5DD 1.tavarahissit
889,544,124 *5C84D8BD8EC58CB5061C3792A213ADCA06970436 гму
889,544,125 *5C898F8C58E5E9E44AB12B19984B6FDF23A8EA62 1us-beratungsunternehmens
889,544,126 *5C826D2BDE105C8735CC9394496D66AA9142C5FB 1.vetokohteena
889,544,127 *5C823892826699AD23FB11C376AF3D60ED0A1AC2 КТЕТИКОМ
889,544,128 *5C8457F1018C3F1222DC2F4C1CA6F8AD1F1A6E28 1.yhteystietokenttiin
889,544,129 *5C8134203CBAB54D79573970378CF3A9A134A8D0 20051228: maxwell's, hoboken, nj, usa (disc 2)
889,544,130 *5C82FBC07F275A7EB942B5D7D48C94D45791DE0A НАРАСТВАЛАТА
889,544,131 *5C89A599AB86DA0B800CC3D5553207B47C904B7E ПЕРЕДЛЕЖАЧА
889,544,132 *5C8167D141CB13DEE232A77111492A6FDA51E66C 2171718 BUT THE SCHEME RAN INTO TROUBLE
889,544,133 *5C873FC8F548BCD6D8CBC6725E8131E092F918E1 21JUN1512
889,544,134 *5C8CFD77B8B57F44E6C9BBA748AF7457ECEC97C0 22REICHSGAU
889,544,135 *5C88AFB78FE3E0685F17603E13669E625CF69E31 «спальный
889,544,136 *5C884521D18E509C0AE86468C0B24DF141833147 2675132 SITTEN.TULI.SOTA.1939..
889,544,137 *5C8E3B92805DBDA95810E15AE7AB84DFAC62B21F 2718JO
889,544,138 *5C87EF8E7D1E91D9819CA8C58EE2B829700D971C 2833650 heslippedintoadeepcomajan.13.
889,544,139 *5C85A3904C215461BC10FE559420C4F0788D4656 。彼女のオリジナル・アルバム初のCD化。内容は同一タイトルLP
889,544,140 *5C8C8EE1FD1F547A400DB88D3A823746FBA449E0 2BELOVED
889,544,141 *5C83F7D12DE8FC1AE4540268A24C5186648F418D 2.sonnengetraenkten
889,544,142 *5C867EAC22A62C5C434B6A7A29F6AFA5B4966516 2.sowjetrepubliken
889,544,143 *5C8F2894ABAF87EEDB18FD707D6ACB0176515AE6 2STINGLEY
889,544,144 *5C8E1043AD2D04B61402E5DD12267A440881F338 2VHICULS
889,544,145 *5C80FB91E71E5A7678744A5E5D54C2AAB681CA5B 31021455
889,544,146 *5C890B6E61CD64064D3C1238B7E1D77788A406FF 383620 elk5550-uydu-IletiSimi-3-0-0-(-3-)-giriS-.
889,544,147 *5C80094F712F6FD6E95C1185BFACE1F5BE645FEA 3=====B~O.~o.{x}
889,544,148 *5C8EC3997D5113069BCD2C28EE5389AEB59F3C3B 3 FITA
889,544,149 *5C8484029B262CFC064D5F2F75E00310B9A14DDA 3HIKRAVAN
889,544,150 *5C8648AC5A724A16095FE3E92993763A6DCCA6E1 />
889,544,151 *5C874385D2E157D30D710CFBA377129EC2776C85 01-07-1593
889,544,152 *5C886EAF7A8F89EB732007258CBFB4A22FDA6EBA 472290 sokak ve meydanlar sefalet ve pislik icindedir
889,544,153 *5C8469EC073F652F7AC8B41A74F73B6D0FA01435 48441 KUULLESSAANETT
889,544,154 *5C84CF89AB1B5FC0AB4DF86643F8B15D7A5B2500 4DOSAAFIN
889,544,155 *5C847152986011972E06E87395B745DEE39F0DE9 4EOTYPPIT
889,544,156 *5C8210141C60D09626142C968475B98EA5DAE020 4IAMSUZY4
889,544,157 *5C80B8EBEF033DA90258B00D94735ED01336F26E 4iamzoltan9
889,544,158 *5C89A3A64E8462724E85395A4974D0E820B5D095 0ILUVSHADOW0
889,544,159 *5C8D09CBECCDFA0398A8CACA8D522E0D7128C785 104104 romalIlar ankara'yI bOlgenin baSkenti yaptIlar
889,544,160 *5C80E62B0F17EB53FFC71D165739E43426225C77 4ORKSTATION
889,544,161 *5C8C25F8FE2C1EE99945813354FECE85EFAFC9A9 1240476 seeiolemy
889,544,162 *5C8543B7B6166E9D2E82D4A10D56A74F61521CA6 4.SANITER
889,544,163 *5C8C529265A8D8AA8B02EA4D8CF852DD51D0F726 1247761 SHE-TAKES-PROFESSIONAL-WRESTLING-SERIOUSLY-
889,544,164 *5C878A9B106780A9A1CBB9A2E746812E075C4B1C 12-n
889,544,165 *5C8E1702AAF6806D326237A3F6C2A8179F1082DC 143drk-sozialstation
889,544,166 *5C812F3F11F999C9CD4DE548298248DD75B340DC 4TWINKLIED
889,544,167 *5C8ACF43724A55B7637651D6D8C3C3E0AD3DB070 14.VEREBILECEKTIR
889,544,168 *5C8604BC899780B795DE52FA8349C541BF0C4296 4VAALIKELPOISIA
889,544,169 *5C8FBEB03606B1122BB3410558410599B1C8630E 1549962 ICH.HATTE.ABARTIGE.EXISTENZAENGSTE..."
889,544,170 *5C8531635D77043098DA002D074E8A6B320C7CD4 16.aussenposition
889,544,171 *5C829E53A878315B8F6029CC3DC45B2B47463DB7 1701DLIGHT
889,544,172 *5C81A179946AFAB4593AF30E8DD064AF99128C94 1717485 MITEN-KEHITT
889,544,173 *5C87A81DCC20D909BCBB3D887C5106010986D691 5480749!N9
889,544,174 *5C853381297E6164D0BA6D8378993378207ADE54 17 HAIRSTYLES
889,544,175 *5C8AB2651B66501ECC6D5558B86BFD022A8BF426 17-IRLANDA'DA
889,544,176 *5C82B32828D204CA777ACAEDF230001AAC577D74 17OCTOBER1161
889,544,177 *5C89F3B04D158BE197E27D39D700487A4354D590 1986-04-16:VISIONSANDILLUSIONS:PHILADELPHIA,PA,USA
889,544,178 *5C8262F0036075F1ED8315F894DBEB6543D3844C 1AINEGIRO
889,544,179 *5C80EB7B58255993C2EEEC3F5C4A532A427EE0A9 5BSWLITHICSBSW
889,544,180 *5C896DD9F66DAA79C7D40824E17FD2EC8F9FAA56 1AMOLLY
889,544,181 *5C871A98597E866931D17BB4224F9B196A4D49FC 1-brecht-gestalten
889,544,182 *5C885E13C737642694A316317980B4F7CAFF6B14 5ESTRATIGRAF
889,544,183 *5C8D2128E2E72ACA32D4EC0C30931020C4E0743C 5FAITHRODMAN
889,544,184 *5C88A0E0E99C3B9CCAA3F6A37A29CD2679BFB021 1CENTERISTA
889,544,185 *5C8F1D2F993CACD7DFA9C8A4C363DB99914DA0B2 1 CUPJUNALLA
889,544,186 *5C8F68A4BA133E8852771031809C9FD1FD68DA63 5.HARTWALLISSA
889,544,187 *5C8491C0AF29A9748EAFC24AA5CE58851F15EB50 5-LAILLISUUSVALVONTA
889,544,188 *5C88CEAB7A2B8D1EEE2065C0E62BB5FB5893DD85 1FEIERWOCHENENDEN
889,544,189 *5C8D8A935AA78B8F5804655B3FDA8B3119F2ABE6 1.handwerksstaenden
889,544,190 *5C828446B92CF411522AA9A2D036BA53F0317068 5POLYTECHNIQUEBSW
889,544,191 *5C820D4383534E3B6E4D420EDED4B6E4D5B61139 1-HURAAHAN
889,544,192 *5C8386662C3114C1B9694778DC8B1EC82758D96A 1ilovedallas8
889,544,193 *5C8FB77351962BEA3FA498E6BB3E152F2CCCF11F 1-khk'larla
889,544,194 *5C83C1717832A1B57EBDE1CFA74BCA9B7E71EAA1 1kiesers
889,544,195 *5C84562068AB7D85607DCDE360906C3FF0037F20 5YODAHARRY
889,544,196 *5C8480073D0750A6C6CE598D1AD01F4C1C99BDC3 1.LEWDASSAULT
889,544,197 *5C849C62D199B2AF30D9EF5050A1767BC206CDAD 611.hutus
889,544,198 *5C8824EBA74C41E2BA1394260265F4BFA027B1F2 1-lukukausitarran
889,544,199 *5C8FA46630F99BE76F2E5DA739490AB14FDD67C9 1 MARKKASESTA
889,544,200 *5C8550BACDA5B4D2B1852BA5F6B13C7A68AF8372 1mpllampe
889,544,201 *5C8F43CFB9D22E8A3AEFECC19AF81BB58378EA00 6BSWBENTELERUSABS
889,544,202 *5C876914EC0F85A4815E21AC07B168968C2B9B48 6ETADNUCES
889,544,203 *5C865F844F5634EF9168B50EFCC9626578779881 1PRUDNIKOW
889,544,204 *5C847E0BCDADA9EC5217C6B55E3CE245C879AE09 6KRYSTALWICKED
889,544,205 *5C89A4C60D32C0B0493E86572EF897AC093E18E0 1.SCIRIVERTRETER
889,544,206 *5C8864B80DDB79798ADBF09AD37A529E3ACBE360 6LAGERHUS
889,544,207 *5C818CE46AA8F68C61389C2BC0E2495CBF312359 1SESTERCES
889,544,208 *5C8845665355724B82C7C5062E4640AE6E87F1A9 1shopcumscullery
889,544,209 *5C80D50FCAABA30E21E082370F40BEC98FF1211D 1SULPHAMMONIUM
889,544,210 *5C85ECF9A3B48C0C4F979ECBEE650769786C8D63 6NEJPROMYSLENE
889,544,211 *5C89691E493D7CF0FF43BB106EF3684BFA073F7F 6PAPALESES
889,544,212 *5C8B8700AAECEDD877B0AC414FA1841964B30C8A 1TRICROTOUS
889,544,213 *5C8FC05ED9F7001A54F6E0A111CD8240D424DCDD 1 TRIPLE-SURE
889,544,214 *5C80D5EF8DC10853238436C3932A31AE2DDD9ACA 1VERGALD
889,544,215 *5C8AB0E3F85E834AC5A1D8BBCDE0521352176228 1 VIDEOCLIP
889,544,216 *5C806D3AE9DFA9B8404B2417111F047612627094 1wochenendtrubel
889,544,217 *5C89B7D1D1BBB17116E4B62165B5CF1306C7CDAD 6taSInacaGInI
889,544,218 *5C8A6E95A3B2934F4C269B973B93FCAD3CAA6D63 2008198 merkitse-mielest
889,544,219 *5C8AC2BC37783EC58649E10306C512C724EF368F 2010560 THE.CANCERS.THEY.DID.GET.APPEARED.AT.LATER.AGES..
889,544,220 *5C8D334392288B6AFB9047454CE3906F80CB81F0 20171306
889,544,221 *5C83C7CFC8227B8FEA446A4F8A55602F0BC76968 707felipe
889,544,222 *5C86D9D83755A9CC4B7DF77DDCA499825652210B 20SØREN
889,544,223 *5C8391706E3828617681F443D9475D1D83C6B3E7 2117403 SN
889,544,224 *5C83B94138043E1F4F46DA91B17B467BAE1BE718 2129711 vai onko polkupy
889,544,225 *5C86A591B88E9EA009E33686855619F9D236D45D 75B3F2GF
889,544,226 *5C8D34D6F25DC6E4216196224DECCBEFFD7FAB75 22OFFROAD
889,544,227 *5C830E60C7BDEA1FCDD0F8B7A695D316C082954A 2489756 toisin sanoen tutkimalla n
889,544,228 *5C8DBDD92DDF9C609114E110B9F12394DCDB1FDB 2521011 mutta.niiden.tuotto.k
889,544,229 *5C80DB87027F08E99E10A7A859ECB47EDDBABA08 26apr1277
889,544,230 *5C85A50D6759C894E0B562C70688B9825243A427 2769180 DER 16JAEHRIGE FING AN ZU SCHWAENZEN UND ZU RAUCHEN
889,544,231 *5C8A2E860D63BD484F0F2B44E67A378F71308B07 27doGuruyor
889,544,232 *5C8A08DD404DDF479C31CD20B502D9BF47C0ED67 2811778 oh2ap j
889,544,233 *5C8C87300940F19D8A9D3218B6D4F62A43B00020 7HU13
889,544,234 *5C8B09F8899BFDBD39BD1E11CB0B62C888F75C97 7HYGROSCOPE
889,544,235 *5C811157A6541DF9732DB5ADFC37732E29D53248 29jul1757
889,544,236 *5C850B035FC031AE6632376CBAFAC4443C73783B 2CAPERATUS
889,544,237 *5C873D93E006868350F09367C9977C78060CB07C 2EDPLAATS
889,544,238 *5C8931D55F83ABCAF67A5125F7C61626FA3268C9 2HESSENWEITE
889,544,239 *5C8BA8875EF036F5FA8929A21E3814387E2FE9B1 7TNORESSERT
889,544,240 *5C8023E657A5659E6CA56F5119B5B2FA8BA5FD3A 7UTTISHHTHATA
889,544,241 *5C80B9AB17DF5B26FB88F7719070456C1A552C37 2leis-ten
889,544,242 *5C809C2D0D9389BED46A973C9BE0A5A960EC62D8 2NHPDVKM
889,544,243 *5C84C41AF9E35BE3B73F78EC542B0630E42D745B 809DARNELL
889,544,244 *5C8F26DC051913DD9F397A784F4FF3B8DA6F1D4B 2packrat9
889,544,245 *5C81747DABA0173D250A9DADFC057CE7943465EC 2PREACIDITY
889,544,246 *5C8DDFD93E05C882D30457075B339EDC9BDCD529 8700be44007e8a9aaf3d45d7cf63565ara1010
889,544,247 *5C8B09BDAB3DC53AA9AFAC22C4E5DC9BB226F08F 2SORAVIJ
889,544,248 *5C822E4BE2ED258BFAAB640361BA558A3160ADB4 8===B~OO->-<
889,544,249 *5C82CF21A8414BC1930E84EFC8110B8016AEAF31 300Х221PX
889,544,250 *5C8EEBE0D14DE74E9D0A64570050BFA5B8990674 8----D-~0-(>-<)
889,544,251 *5C830D6EA7EAB208B8ABF0D627F0D4130E1956D7 8DEBTSREE
889,544,252 *5C87D0834ACFBDF5E2AD11D87532F858FB50F9D9 8DOUGRUTH
889,544,253 *5C8BF6FC2AB72E8A1716BECFC937B44E1AC07CBF 339173 das stil-lose ist sein stil
889,544,254 *5C82451BAA70A826BF16281B6DCF7B5CFC49917E 8ELAINEASHLEY
889,544,255 *5C887BF3D93A60BFB0CB36FF89DE6E7980E01CEB 362182 j
889,544,256 *5C816D34536902113962902DAC2E2839E12338F0 36 EINFLUSSREICH
889,544,257 *5C8BAFF5A5D24DD3DD8B1DFFA1C37AF3A5D3EDDE 3ABOLLADA
889,544,258 *5C81EFDDADB3E0EE69C1D0C20CB46F4B0D1E470B 3====b~o.~o.:p
889,544,259 *5C8089057DAE135F9CCEB50F84609F5BABD7B3CE 3CENFEDS
889,544,260 *5C85A9AF77C169068175D0291008BCD6EF0E1E7B 8PEEWEESAILOR
889,544,261 *5C8FCC93F2C17E66878ED9818BBD5B8247D63690 8PLOINNKJUBSW
889,544,262 *5C8C432BA0F526576C74B8BD779D68EA9B283494 8----p`.:p
889,544,263 *5C8DC7E1609391E940E38AFFE9E8ED4160177ED6 3KADUNOSH
889,544,264 *5C86CFBA1C4740BC9451C62EB8C6F01A06B6DB03 3-olusturulmak
889,544,265 *5C898CBE3C229E429351E26523FB38B3B22798AF 8-seulbergs
889,544,266 *5C85402D178BA5AFEB356CB9A90366AAAB91283D 3==p~~~3b<
889,544,267 *5C847D79551793FE69995E774675908158DAE4F5 928203 yedek enerji kaynaGI olarak da jeneratOr bulunmaktadIr
889,544,268 *5C8E9B4B3E9A69DA922C7B661C57B9CF0B1DE259 3WGGKKNN
889,544,269 *5C8E1A982A27B6054F741FF1C6DFAD6D43CCEFD6 4194 potilaat-saavat-l
889,544,270 *5C89795A9C68995AA6EEDCB6AF499CF6E0F8A857 9ANSIKTSUTTRYKKET
889,544,271 *5C8DA421B9CFC337222020C0C2F2C83A6822709C 434580 tilaratkaisujenlis
889,544,272 *5C8C7CC140D420D711BC762791545FD88C99E923 9BSWMIDCOMBSW
889,544,273 *5C84BB7DB7C92B4DB66C8833649EDCB6C92DF8E8 4.en.Do.majeur:.II..Aria
889,544,274 *5C84CCB1541B2ACE685060C2A14632BFBEF58AE0 4ILLIMITABLEA
889,544,275 *5C8979C39B6163706115E6324E10005CB9CCFE30 4ILOVEMULDER3
889,544,276 *5C8BB222E51755D38FB995E7170085F53B8DA881 4 LAULUTUNTEJA
889,544,277 *5C8E29FC535A8C033D1C6F393497B29BF747D4F0 4LOVEBOWLING
889,544,278 *5C85753A122131A47ABC183B491E1F15579B411F 9RCHNRSCHN
889,544,279 *5C87042DEEA6A1D5FCA1DE361A073917E30A4E07 4SCRITE
889,544,280 *5C826E8B61B21CAC0141659F0A0A409AE53FF286 9TSEINWAR
889,544,281 *5C8F1D77FF656C2CAFF8F76111FC005D97C64936 9ZOLINAS
889,544,282 *5C8763328500B2FFCED67FFD9918AE879A0809C2 4thatteddybear9
889,544,283 *5C882AD2C3D3293F12689505C32ABF24566D3C9E 4TIMSKIDOO
889,544,284 *5C83481AF57A45909393AF143E76CA6E5C6CCED9 4.USBROKER
889,544,285 *5C802AA560093227790AF49A74C893E89724C8F8 4VARIDICAL
889,544,286 *5C8275E0A288095FD597531A2F5F94F54FD8998B A16655
889,544,287 *5C871D9811E3377894CC9D027424C05EE0F2800A A1FGP
889,544,288 *5C83DF33A435A86490640752424194D22F6AC969 a4+;8
889,544,289 *5C84912329692F5821F9D3F6961434AE8D189C2C 54PARACHUTED
889,544,290 *5C80032EF1D1621ADAF048B81A163A4BF72ED29D a4s4r
889,544,291 *5C87B49A7F7D7A7906AB01C11DC1AFBAA033C397 56.olusturulan
889,544,292 *5C84D7CF033D28E2462E201E82F4413E3B50FA00 a606240
889,544,293 *5C834F006A7131E3E0DAC61A0EF69EFCEA8E6BBD a6iwg
889,544,294 *5C81832A05BAE35ACB88FB09E86705BC7C97CA87 5CROSSSUBSIDY
889,544,295 *5C81401C61775C078D0B262DFBCB4D77679B0ACB 5JUSSCRIPTUM
889,544,296 *5C886EE04E1471774E6E519DD9968D1305EEBC19 5KABRINA
889,544,297 *5C85AD508A7361190B2F4397F4E32EAA3A65937D AAB%|K
889,544,298 *5C8E64229595066C8474C8EFA5B99115AB527705 AAD~<L
889,544,299 *5C8782FDA9E5AC7C8A06C1568D981B02538C344D 5REKAMOTUA
889,544,300 *5C817AF3284AE08059EF33FCD012BFD199846FED 5REMOERET
889,544,301 *5C82D66785681A3EEAD10465DBD2C532B331E985 5UMM3RTHR35H3D
889,544,302 *5C8F49791F38F06E38D1C4891BF3438D85A48AB9 5YGOLISSO
889,544,303 *5C8E14D4C094E1C9B24C00748C46F865DDA24797 613224 ABOUTHALFTHEJOURNEYISDOWNSINGLETRACKROAD.
889,544,304 *5C85E7299E1DF1EEC86E5E70C091A9AD43582A99 AASHNASAI
889,544,305 *5C8CD5CC2E1106303AA89F05AE72B2D49AFB7D4A 675nylah
889,544,306 *5C891988C9BDFF01972F9E5F9F23A12C766EAC65 6ilovederek7
889,544,307 *5C8609229C12185BF00FA97EDDE65F414034DEB0 6LECTIONNAIRE
889,544,308 *5C8B153255671BE87865825750A5C308FC51C509 6MASAKATU
889,544,309 *5C8F98A23325F2EEB254C06BCDA1361A4C029CEB 6MISTYWATSON
889,544,310 *5C820F99E36CBC1C6C0E45BE81718168461ECFC1 6PEMFLKCXTVFPC
889,544,311 *5C8D9F6B90FA4272AD28CA704B38731586B79C87 [email protected]
889,544,312 *5C8AAB428A20D95FC5637A73AE0C757FEEBCD8D2 6REISWISSEL
889,544,313 *5C85AD91E880B4691B4897D8A252F0472C3191CD 6 SHAHBAZI
889,544,314 *5C8B01C0CC66829A80A1FF5305BB76854A8C6ED0 6SOCKETOP
889,544,315 *5C849B2DCBF83786814ED40922259E689F7DAC7E adanheeth
889,544,316 *5C8D1A83BED67F70C7EE68108B65259734061134 6STAOCRED
889,544,317 *5C8FB54D625B777B78E85FFCBE232473786780D5 6TOPGUNOLIVIA
889,544,318 *5C855A4ABB1C9646EABFD1FEC547D62B4BEC2F80 adie-anggoro
889,544,319 *5C8BC1FD51B75EDCBC0A3130F4618D65CA553EAF 6VNTAINT
889,544,320 *5C860B8833B180F50B2E220C8A86FC4D005B9382 6WILSONZENITH
889,544,321 *5C870E9B0A87FC26B8321533BDCDFCB91E0DC256 adtul
889,544,322 *5C816E26B23904A1F65C6F22302891EA0948CFF5 [email protected]
889,544,323 *5C8ABA8CF385EEC1010DC203D38592F882091BD9 ADYGEIH6
889,544,324 *5C84FDE09B8D559E6ABE908C949CEAF15DFAAC96 791CARMELO
889,544,325 *5C8448B96E1BBDAFC336B83AED193929859F509E 7BEGABEN
889,544,326 *5C8692FC64CF56876570C88E1C1E5BC8D8D0D7C5 7ENONCERAITS
889,544,327 *5C803E844C970C2DC8042D0ED45A5D67079E4BC8 7EUSJUTUN
889,544,328 *5C830E2FAB50F1DE9322497366F5481C5DD9BE1E 7FORTUNNAN
889,544,329 *5C8C2ADFE8FD077E51F3958D365A7C53FAC01A38 7FOUNTAINWARNER
889,544,330 *5C88AD510B8F9C44998282B9004B0DF9B50516BA a:ft"
889,544,331 *5C8ABE478050CA66EEDE8E79E30D865D781A0002 7KREADBSW
889,544,332 *5C85DCE7216C5465C5F3705C2E77D41F64F3938E 7NNEVSREP
889,544,333 *5C80A0F434786E0FB3A3B23AF979477E9A70B7C9 agx5u
889,544,334 *5C8A5AD38FB16A5AE5B11177ED5D9EB145680A04 AHNZ(
889,544,335 *5C8BF2708E1EEFFEDDEC284D0ABEBD7EA42F1C5B AHp,
889,544,336 *5C8217DCCDC7F357E1FA43397B05136CAE410D48 AHRNE
889,544,337 *5C87C2CC5CC4D613EF9C6A7DA3087F0B11961090 7VOELSZIN
889,544,338 *5C8A53E892001754285EDB0C8C809245FDF82CD9 }8{0~<-----p
889,544,339 *5C8441E96416AA8CB19CE865DC601B2F1E0AE425 AKdK
889,544,340 *5C8E082C2C74BE0E2364826D7A6BCAA17A7D7074 8dn
889,544,341 *5C8778604C7408CCC303EC89401C154349EECF98 8FOLLEGGII
889,544,342 *5C816BAEC0C2BCD520F1352FE88FC381E4E3434D 8GAUDINESSESES
889,544,343 *5C8CB12D6BAF2B6430176059C4DB198590CB544A AL.COMPAS.DEL.CORAZ
889,544,344 *5C80FAD65CA256D675A357B951F063B29AAC79DF 8LEJEVRDIERNES
889,544,345 *5C838293550AE8B57521B92F7EC483EAB514D114 ALECJABER
889,544,346 *5C8DEE8BF88C7B517EB706853E684CBD6C7EBF6B 8LOVELYJANUARY
889,544,347 *5C80A82F8BD57ABABDED396F586469E199116349 8$+on
889,544,348 *5C81E70ED8027A3839C9A67BD8CCE5E90DC595ED 8######P~-`-(>_<)
889,544,349 *5C8BB1802786E144B0547DA7E4491D56EFC9D12A 8--p~o-~o(>-<)
889,544,350 *5C817486350BAEC5A648C80E18BDCEA10E412029 8therouge0
889,544,351 *5C8996124825CE2DB2E2FE5E86CCD7B933916E3C 8WROCLAWSKICH
889,544,352 *5C8DBBC0D9A87600410F76147C2BA95851BBCB41 a%?ml
889,544,353 *5C83C8B96F08D07F0844817998B4C5D5B4FB1208 9EMPOLVARA
889,544,354 *5C82B114974BAE79DA8EAE9D1B7B9DC1E19655FA 9F258DC3B640E570000836D8B7EA4AC9.BASSIE
889,544,355 *5C808958F9A47F6321EDC2190890414E4739D175 ANDANTE..ORGAN.CONCERTO.IN.F.MAJ..HANDEL
889,544,356 *5C8FFA0D0772A644AB51275A28E96274321C9775 ANDREEA.POSTELNICU
889,544,357 *5C8B82BEA56860AC8EEB46CE3ECA3EE11C771355 9INBIMMELNED
889,544,358 *5C8D73C2B693536E5EAA8F7EDDAFC3FACE3DCF7E 9LAUZENGA
889,544,359 *5C8BDF20C8304D62286D23A2FD8074DC09AEB30B ANGELAROWE
889,544,360 *5C8452F690411886FD088D0ABD6079B44749AEA9 angelshorizon
889,544,361 *5C849E0A2D119F983E0D65755574ED6EDC4324B9 9OCCOMBER
889,544,362 *5C8DE1E56E14713C766C558CFB672EF10FE56E95 ANIBALPOSTLEY
889,544,363 *5C82841A3681F9AD8AC22965B90C2CCFDD95C032 an;k(
889,544,364 *5C8B0551862C0AB2184F667ED9557D5A8F4A4BBB ANNA KRISTA
889,544,365 *5C8696246DBFCD3012202D967EC93A771E6D2FA0 ANNU5AMMO
889,544,366 *5C8A8B0E99E89E3ED19D3AD5267BF9FFBB0B1568 anohcib4
889,544,367 *5C8DE2E65EF06B5593562FED36FFF4DC8FD4ABB9 9PROTINACISTICKEHO
889,544,368 *5C8909D6B413E81CF93915D0C34A7BAFE3A38A25 antonygathers
889,544,369 *5C80D7396F80AF566588E193C75F31E79B6C179F 9SCHWBCHR
889,544,370 *5C8309F7BD0A6316B5F3F845C530D6FB7E906B35 9THATTODAY8
889,544,371 *5C850F4DD2379BB94B13F8DEBA3D0AAFD2262B63 9VOLJNOM
889,544,372 *5C8FE2BB95A0F2B439D8F6AAED1CE04BCEB31CFE AO,R
889,544,373 *5C85A517A7F7460C867162F7CDC8604C10B92936 A2"A
889,544,374 *5C85E3590AAD4648819335C940E357FFF76733AF A4Y
889,544,375 *5C82CB356512AE333C9177ED5F8EE9A11B7EC878 a8s73m!0usn3ss
889,544,376 *5C8777970F6BC5C555D7BE4194E462304C9073E4 AAC;A6
889,544,377 *5C8DD214A5D5027C8101BDDC2E670CDC7D5372B3 ARTDINOVI
889,544,378 *5C8554D1AABFDE13E1BF6243E881C5883660762D ARTHURLINDAMAN
889,544,379 *5C84E93E2075A317496C3F902A3C221703E631F6 AAD0GJ
889,544,380 *5C8D762BE149AAA4E64963B4A15BAB0AA0B73331 aadea%
889,544,381 *5C81D7E59BAF72666CC41C0123F6C0F7E27161F7 asm9b
889,544,382 *5C8AE9D89008C4620C179BDAA5C13F520CBAF2BC assignerent3
889,544,383 *5C871067456494B36C913511F86888982D2E8A76 ATHSUGAR5
889,544,384 *5C869B98C86B0B1ABD2DADE0970CFDDDA5B49A11 ABIGGUY4U2
889,544,385 *5C8461A15DAD79C0277C67224D7A7AAA7467C4F5 ABOLITIONST9
889,544,386 *5C8C8F764D9630A7E467D2B8150170366ED402BA abrammccalpin
889,544,387 *5C84511CD1D9BB92B4DF5F756901D53D4DF91373 AUSTIN.NIELSEN
889,544,388 *5C82E6CBA68915274426C988A7150E344FD33195 AV3$C
889,544,389 *5C8D3E607E997EDCBD5DECC08EB61DB2B46DDF7A adalulec
889,544,390 *5C85B04B0C0D57FDAF124CA55909EDFBCA773220 AYDIN/AI/'D/U/N
889,544,391 *5C8FBBDAF5F2E47AF51DA729011D12580D8D6DB7 adnanfasih
889,544,392 *5C89E7E2B8A944D437775BCD5BEE95F872D40F10 ADXFL
889,544,393 *5C8B369C399991EE1C021A483D5FAA7CB81FB81C b4cteriologi$t$
889,544,394 *5C8A66327E510A69B5DB1DA759BAB18475916AE4 AFGEBOGENE
889,544,395 *5C836EF66863EBAE436A41DEF6DBEAD20B5756E8 b:?74
889,544,396 *5C8ECF3259981837280A34528A8C200CE056E023 B7;K4
889,544,397 *5C803C76F2E31108D1E38B9E6F6F7C17E6CC8E57 baggerbe2
889,544,398 *5C8DC79A6B8EB66659F4E6D2991A147BD9BF0B0D barneymusich
889,544,399 *5C86752CB25BC7A068CB3653508DF2314D249AAF BARRETT.GERLICH
889,544,400 *5C85B1D1D1A35805BE1F80F6B50FCCB802FC6F25 barry.wilber
889,544,401 *5C87C8C06B2A8A4431DDEF80F06E265BEE1E8D24 bc+b
889,544,402 *5C8466CCADBB0FB53951D494CDB1ECB36F70F420 AKCUL
889,544,403 *5C882F570F682614686013EA47A5A71B9A3424E3 a+l!
889,544,404 *5C8482A3B34CF6C60530D6AD07C9296F714638BA [email protected]
889,544,405 *5C862F96B23BF23D72F058EFF156357613492D1A ALBERTRANES
889,544,406 *5C8898CF25FB866C0951D190642A35F0B193F40C ALCINEA0
889,544,407 *5C82430E9BD9ED96AF9C43A9D1CB64F2CE18ADBD BI0EC
889,544,408 *5C87710ACFCEA8398AE9F905777B42AD1F1031B6 amct
889,544,409 *5C8F5833E8BE22A6309CB9AC258EE7A807A9D38C BILLIELIDDLE
889,544,410 *5C8ABDF87629FB21CDEC830C8444ED98631A8762 BIOWY
889,544,411 *5C8AA851F017BA2A225A7ECE8B3EC6108FCDD838 bjs%v
889,544,412 *5C8DD25611FE1DE7B587B62F530F84102B7EAC7E ANDREAPEZZILLO
889,544,413 *5C8686CB874CBF0C531DFE440937EB602C9004D6 ANENERGH4
889,544,414 *5C82EBB1B52B87FCFB0FFB920A8BEDB0DBFF83BD BLASEBALGMACHER
889,544,415 *5C81398990DF3CC4C368C0E7EC273B2EB32247DB ANNAALGER
889,544,416 *5C892F9A7D1BFA711EDA0421DAEBC416324F0A9A ANTONIADIEKEMA
889,544,417 *5C8F10176109B631DE2A13526BEFD3B8110F1347 ANUJRATHI
889,544,418 *5C81202CAEEF7AEDC766142A9D64DE8C6F6C64F2 bo.ew
889,544,419 *5C81C7568129A0022778583616CA7BEF68EA06CD arlenyidiaris
889,544,420 *5C8A55233F0891360541C4BF0A7504341A669F31 Bqsj
889,544,421 *5C8024532D06780FD2DED26712A610AFC5599720 ARRINGARE
889,544,422 *5C8F5531AABCFFAE259471E9CE6FCBC00C0DE286 artur-rogowski
889,544,423 *5C8E3B9DD99C84FF154896D2E4B15A46161683D7 Bright-Eyes-Darkened
889,544,424 *5C81FA04C0E4320A499D57B142A730E63E17D036 brocciosing
889,544,425 *5C8ADE630EE203F902EBDADEFEA65B9FB725C4E3 bruceliberati
889,544,426 *5C88EAD6D57D9D87A67795DD5F3C944E3D8270BE athphorts
889,544,427 *5C8B0278BBD0AD5237A282F766020F7C29BF32D0 atreefullofenergy
889,544,428 *5C8D2B7F025DF5342A82393FCC062E9BF307964B bs6um
889,544,429 *5C8AD6E257220832208E89E0348251B4BAC2DEA3 btqhe
889,544,430 *5C8B4AF8C6667571F4C36EAABB34266BC3C9F874 [email protected]
889,544,431 *5C81EB79D293125F2C05E1B3359C491336FD4248 bully!ng
889,544,432 *5C8F434F43A792BF3BE9348AB6B204E9BB290F32 BVE.$
889,544,433 *5C8FECE1B2A67CCC2045A1783A61706EEB504088 B0WN
889,544,434 *5C86577F0BD5F82D786BDA273314AFB25FA6B69F B2RA?
889,544,435 *5C815AD9D206AACD1B3D6D9144C5EFDF611BD7EA b4ub
889,544,436 *5C80599951FCFADFE7ABEA54B9C39A351B8E48B2 BABY BOUM
889,544,437 *5C80AA9C5BB8E29972FE37D77CB51703A6CA57E2 B-?AG
889,544,438 *5C8837DBE21C211E6CE5D0117DCEE27CE98C4F59 basis136
889,544,439 *5C8F47B6A17342D25A04647BCF68A7AA9A7C16F5 bbcleeswellgoodshow
889,544,440 *5C8F3D436D14C11639C6C98C3E0B15804DDAF854 BCD8&
889,544,441 *5C85532F8EC15D76BF09DAD9337B8883F63BCEF3 bc:gf
889,544,442 *5C80E105723B4D8A6E4E4FCA2483E8967E9CF73A bc(qu
889,544,443 *5C86AFD73B72407B5126B6643C5F8B8AEDF3CB48 b-e
889,544,444 *5C8ECE961A6BAC290C79A29CD84B8F481309B88D cb4yq
889,544,445 *5C896E6846761B75256040269D355152B97EDB90 CB?FG
889,544,446 *5C830ABECD08C5E35919DC78BFEE3A16E811D147 cddla
889,544,447 *5C8F62599F45AB6D3FE4ACE05FD939E6156769E9 BF3AA
889,544,448 *5C803A71A23461EC41EC0D6E69DD0FB7B9A6C09E bfx?
889,544,449 *5C882F2286A931D306C55A6897346EA8D8ED1459 BI7-H
889,544,450 *5C8796B70B478C18349051B046C657C63FA08153 cgjolive
889,544,451 *5C8A7FABC1A6C589D4CBA527CD034FE82635F3FA CHADWICKZEINERT
889,544,452 *5C8F780AD0E29C980F93919281EF88FA28D5B843 [email protected]
889,544,453 *5C855ED1C7E65D4A320F17743523EB5F0190F115 BLAIRMARASIGAN
889,544,454 *5C8B74A24C54B8FED7C18D887472C32432B761F8 CHASKINNA
889,544,455 *5C863872A642D0C409CD5B0DE5AF2AFC082EFE5C CHAS.OSTERHAUT
889,544,456 *5C872301CB2813716DC45C84300297FE74F612C6 BLAZESEQUINERESCUE.COMWWW
889,544,457 *5C8D4D5674329A5DFFF19D80FAC8564B69B4BE4A CHECKSCHEQUES1234
889,544,458 *5C817D993879A8363DC09C958E195C227F5EC348 BLKK2
889,544,459 *5C85E1858DBC0B2367CC00621037E0F4938B1C4F Bn1monet
889,544,460 *5C8F5419186B0BC53BB8EA557068B8CE9406C663 christiannavejas
889,544,461 *5C81C0F98AFEA2BDFAEEB016AFE0031A92413D9F [email protected]
889,544,462 *5C8DD5CC82DB65C06ECB44DC972A424E015326A3 B;_NT
889,544,463 *5C8F9772986A6AC9772C9A10C5F48073D90FDADB boj6l
889,544,464 *5C83E51D5532518AC6BAF665D3C6DB5C17A3ACB9 c;iv#
889,544,465 *5C84A254A09BA3BFDAE7655F6B63B945E8A07A77 BP2BL
889,544,466 *5C89E5C72AA33BD27BEE5E82499A5F698A5A4641 CLARENCE.ALLDER
889,544,467 *5C8F1120E6C93546B86E3ED5F64666E81707777B BQQ1
889,544,468 *5C8C3AEF6580555D116A7596CEE4C4D4319754B5 CLAY.MCINTURFF
889,544,469 *5C89ED7A884380E9601D5B3303E1920671D336BB BRADY.PUDDY
889,544,470 *5C8D5503CDDFF35E8E44A7A9EBAEA9477637E24A CLEMENT.SEAMAN
889,544,471 *5C8FF780FCE7C8EAEA4F9065A0BA817B55D323E1 cletusburger
889,544,472 *5C89B45F36D751A3793F84F040727B1D4F68BA44 clint-gates
889,544,473 *5C8174202B034E93EC2A8FE154CC37380D5630E8 BREDENOHL
889,544,474 *5C86FC3D001DE1201A9A9DECDBF0E754852A0F58 clintonmorren
889,544,475 *5C84B1F411219605868AE31DA2A4C226E918CEF0 cloddy1
889,544,476 *5C8D9C50332DF6635A85F278AAF946D515C78089 BRODERICK.GLADY
889,544,477 *5C8165375308A1E996AF9D61E8AF78D5B7AA8F94 cmscout
889,544,478 *5C83458F8FB2466CC1704143D63E1B2F8B5B3F12 [email protected]
889,544,479 *5C8828BEC6EE47B8D5C0C2458E91393CFE19CC0F BS:C=
889,544,480 *5C8E53B413EB2033A3248FD0273915F178758CE3 COMMONPLACER2
889,544,481 *5C8436C2E1013A59ED851E4CC35C05380BFD6673 CONTRAVIEREMLHA123
889,544,482 *5C8288826C434CF01097022894EA3716AC565919 convalisas
889,544,483 *5C848E92BE8D5E73587262773AE266119CA03E78 buttheadwildcat
889,544,484 *5C80B9148A9B2496F2140340EAABBEA93AB6FFCE BVJKC
889,544,485 *5C88FAD748A7E1674D10D783DC9B4FAF473BA49D b.whn
889,544,486 *5C81BCC66A7B52AF1FF2C4D02295046320269D09 BXWWK
889,544,487 *5C8B66BB62628F5E76F5376086C92CF28EA9BAE6 b;)z5
889,544,488 *5C833BE2F46FCACB9BA27E475491A3DBE4E21ED7 C.Q?#
889,544,489 *5C8777095FE644DE04532D7B35DBF324A2D93273 CRAZYAN
889,544,490 *5C82C252E6B65DF7C62FBEA32AC99AB22A8D6CF6 CRs"
889,544,491 *5C8360C64153B43610A6DBCC633109FFE2DB44F5 CU5AH
889,544,492 *5C8E5362EFB41D0B445C12E3B3983F521E5BF7D8 CANAVANCP
889,544,493 *5C8D5A4CB6A4E31AE59854AC8FC18B2425DEEA1A [email protected]
889,544,494 *5C8A6EFBA37C4346217FB3EE08DA0C27E7D607E0 CĂRĂBUŢ
889,544,495 *5C891C78B873B58E3AB686552ECAC8B72807DCBC CW&=L
889,544,496 *5C85BB150760D130F4208804DE453F652923C46E carsonszalai
889,544,497 *5C8CFF1E94AF22E3CE5D417A28BB9BE1158134BC cynthianirvana1
889,544,498 *5C88DA65B1621D29DFE5EC07CA6542396545FD8C casog
889,544,499 *5C86C5B01E13B97486A46A0BAEBF93B3A8EAA71D CBO&
889,544,500 *5C8325585B1A3F97B6742F7C7EBADA84737E25EA CCb=
889,544,501 *5C8956FBCCA4CF8BF6E3A3029E2F549F6D8F0AAD CDTARGAS1234
889,544,502 *5C82B88A6CA7D039AC5E6D232DF3187AB246CF52 c&e:
889,544,503 *5C82F70D426273AC5BEBB0B080E121CDC65D2877 d5w&.
889,544,504 *5C80B598F0362F540EC8E0D04E41230E1FB8882C CEDRICKSCHEURING
889,544,505 *5C81C6DE1BC9D57A53682F70F820725CD58C63D0 ce),h
889,544,506 *5C8D16C11BA0E6923901434EA5052984B9161565 D82
889,544,507 *5C8F887C300341428D9C3E1F2ACD7C1435F65B7D cesarmoll
889,544,508 *5C894358A6BB8B640209F390CAAF25A37043A40C CETBO
889,544,509 *5C88B7384CE3185669B494B42668A6BDF4F7B135 DA9RAMMN9
889,544,510 *5C8976A5B24CD6A1EDF2021051C826F682DC5A4F cgom.
889,544,511 *5C8029D37ABEA5175276E89CD1F00D735ABE26CE damonbutta
889,544,512 *5C81F3C73D597FABF217102A63EC0F458304733C DAMONSCHMIT
889,544,513 *5C89462CF893A231E3F6929EB4F0B2C89448201D ch;
889,544,514 *5C88173E6A1898AEDE305F6866D884E17A48DE69 charliechhuon
889,544,515 *5C81058B4EACB4A16AC0F09454E39A17E854200D CHARLIEPARKER&MACKWOOLBRIGHT
889,544,516 *5C85C1F377E1E703A34E12D76A712EE7C38A2DE0 chawnersmithrecords
889,544,517 *5C8FB6A564A46725FBE8B20E8A586338CABCEC1A DA-TRUCK
889,544,518 *5C8DB4548BF6F6D22EA4456278506C28E5AE1A55 david6222
889,544,519 *5C83246290C95C8CDEDAD62E8BB25D252E49DCDA children suite :2: health
889,544,520 *5C86DFC29D13B15C5E6D5D7A2A01A780E04532E3 DBJ(P
889,544,521 *5C87BFFFCB56B5123503F77D21A1947DCAA3BAED chnoedesed
889,544,522 *5C834F7D342C2D83314018B11CA397D11382A2FE CHOCALATEBBS
889,544,523 *5C8DEEA1E642D2A2D378B60B41F1514BD97CEF3E CHODH DIYA (THE ULTIMATE SACRIFICE)
889,544,524 *5C81C810D5C993BD4F2E5D66321119922C99261B DCLSNNNS7
889,544,525 *5C8052AB78BDE0D9155A168283FFF9F9DF7573FB christopherzomora
889,544,526 *5C82A06CFEF372BFD0218B124726E8D9C8A5C83F ddhau
889,544,527 *5C8FE76FD0036CA24FF5E40DAC87D97C13D04FBA deeyeater
889,544,528 *5C83C0CE24B71237DE128BC06353BE0059109CB0 CL:AL
889,544,529 *5C803A931B234CA4BE483DC373E2A51645761441 claynicholas
889,544,530 *5C89B641ADBE827ED45A8DA12EDA1501B7E5B9A4 DENNIS NADA
889,544,531 *5C83990BD7CFE2BB944693B14AC9660DD91816E8 CLIFFSTANLEY
889,544,532 *5C8C012625CEE2B1D07DBF60006EB6146DAC166F CLINTONYARBROUGH
889,544,533 *5C85FFD834255A44AF5751A9E929868957F6474D DEURSPARTEL
889,544,534 *5C85C4714AEA2E6F142A7B7F02E7655960546BFD DEWEY.DOPITA
889,544,535 *5C8A5495E6DF238E4324376915512FF6D98C808F cnglfrctn9
889,544,536 *5C887E1D80791FE16B54D6265EFFF1FA8C5F36DA cnlr0
889,544,537 *5C82435307C5AB9567235767F2E2F78C18EEB287 concertono2inemajor,bwv1053:iisiciliano
889,544,538 *5C8C4769BB97F4A7F48ED42DFFD4ECE0208A94F6 connievaladez
889,544,539 *5C8DEAA2E931A1BE4929A480C70007C1E8E2AF17 DIEGOLEONARDOMIRANDARODRIGUEZ
889,544,540 *5C8E0B6E8027A9CE2986E3B8673B417416B47280 dikty-taxitic
889,544,541 *5C8F9CB796BE02EF3661399B93D8218E7DD73983 DISTANUT4
889,544,542 *5C8E1BC283C2A23ADD38CC734E6A0AC2AF97C714 c&$,p
889,544,543 *5C80E324AA5227586363C13FA1C6A8E61DF9AF63 CPELTON
889,544,544 *5C8BAB5F4AA762510BC8E021B06C9D5041E0FA01 d$#_j
889,544,545 *5C828C3245196BD207913C90A576F5F4E762E313 DJ:W!
889,544,546 *5C8214D50E0BC1C96229BED53451C787B8946B55 C:\PROGRAM-FILES\MICROSOFT-VISUAL-STUDIO-9.0\VC\CE\INCLUDE\VECTOR
889,544,547 *5C8275F974CC90297F79E39E87A0E87FA56CAD16 DK4q
889,544,548 *5C887C178ED92C0E5FBA92F9AD0F4C8A1FFA2CDB DLSAW
889,544,549 *5C8E413E8BDA7BC4AF56BA461CB04A02F28BE0E5 crewj
889,544,550 *5C89D6985A332C3E6BA1AD7E403F147BC6957C93 dmy_c
889,544,551 *5C8BC0C9F6F83D71905BACEFCE5301484BECE5BC C-RN
889,544,552 *5C8812F871C00666D0EEEDEC32F4C291ACDC08DB dobbie-delight-over-fresh-start
889,544,553 *5C8B4CD7ABBD8D5837C9773EA746FBEA0E073501 C$S?N
889,544,554 *5C87C8E0D6FB29B88DD0750CF6807200DE2FD665 CT2PA
889,544,555 *5C88E50954043113DBB363F59EA1E594629F4463 CUEILLONS
889,544,556 *5C872B8AAD0D848059A9B5673B8B20252547DC67 [email protected]
889,544,557 *5C8B2A3209D1B30E0FB28DCA9AA70B13CB85B60E DORSEY.VIDAS
889,544,558 *5C88014630A22622DFA6ED21A7F7CDCDFFBE24E3 dosuwac9
889,544,559 *5C8175969379A86E970720CBFBBCAD08A6D895C2 DPADULIP
889,544,560 *5C87E3C33CFF38CD2006537CC3CE2B2A532B546D C:\XAMPP\PHPMYADMIN\LIBRARIES\TCPDF\FONT\DEJAVUSERIFBOLD.Z
889,544,561 *5C8E9E0515FD4E6FE38151265AB2DBEBA52824BD dq/fk
889,544,562 *5C8E63FDADCDE2DA5D9CDCA59741A7436BBF7F73 D0RE4
889,544,563 *5C8693A7EC1FCE3099CDEBF5AE0B4038FAA8EC8A d?-rl
889,544,564 *5C86B810398BD65DFAF743B128AF69B2A6F13679 d"37c
889,544,565 *5C881688BADCECBF33C7508C30E09ABA52A329F8 D5"GP
889,544,566 *5C84AAD8C9B9B174FA3216AD5D27D025588DB2D0 DA8$H
889,544,567 *5C8897E350F32B840C9700DB820D68F4F9608108 dudleybrokke
889,544,568 *5C8EEF0536FCB84234C24C2C3A3A8336BB7621A7 [email protected]
889,544,569 *5C8B24E4EEDC4C636C45E8FD1C392CA8D0A53747 DALLAS.BLACKNER
889,544,570 *5C826F64988D6C715E0B8D3D9A5204875047A028 dunyd
889,544,571 *5C8014C82064A38BD133DC62F2ABEB82F7843EED DUZQXF2MOF7
889,544,572 *5C80050FCC93CD579D7E284880D778976F7D6DA2 dvl(
889,544,573 *5C8B63E3BA2BACFDB619C01C841B98A6D909CB22 dxam#
889,544,574 *5C81A472CB770B616120E1DDDC30F9754B5D3544 dxc?t
889,544,575 *5C8F71131E41CD80F50785565A5FD52E362496D4 DAVIDBAZE
889,544,576 *5C8D14C5EC5E3AA497FBF722CDA2E625DF5C5466 DBf;
889,544,577 *5C8DF15724C22B7400BCAA41CC31D35B9B82791A DEBRA-YANG
889,544,578 *5C8FC16F0BD28E2F58D9823B63F4FC0AFCB9C856 EDLIPSSD5
889,544,579 *5C891419B15138F0E716D146A88B812F5FFC7AA7 DEFAULT-OPTIONS-WHICH-SHOULD-BE-CHANGED
889,544,580 *5C8C70C8CD74902BAFCAB012AAE22E01D4C1935F EDWARDGARITTY
889,544,581 *5C8A62E4A65DBBE21608CAD818CB29DDFB2073F5 eehcabob6
889,544,582 *5C853E827D4D60FF7F0F1200C7D47B66BE2D7744 de.mornay
889,544,583 *5C8C684318339AF8FFA3988728C23D9CB4C15CA1 ei5c
889,544,584 *5C8C67AF76211C4F216355AA60AC7757050EE5E9 eio7
889,544,585 *5C8BA47244F1DCEA9BB6ACBDED2D8B4D018F3F95 ELINKEINOEL
889,544,586 *5C88CCC9D775560D8D7AE9E5E61AE96FEB6C3ADB ELLSWORTHSHIGEMITSU
889,544,587 *5C808EECB1156A200B0893E6317A97439AF333BB ELSESFRI3
889,544,588 *5C86F764A821AADFFA92849F4A266EF4ECA8ABDE DGWES
889,544,589 *5C8F341929650786548D4615EE64377E8680BCC5 enarthr0d!a1
889,544,590 *5C86B7273A696DE8F21ED6EB5D0EE65E4DCEB68D ENCORE:.WILL.THE.CIRCLE.BE.UNBROKEN
889,544,591 *5C85B94D1F6C9385C35ECFFC962DA8541F022688 digue7
889,544,592 *5C8AAFB500DBFD76A9D44CD24F0799588C3148E7 DILAVANTE
889,544,593 *5C8AF76ADD108594614827B15462A950C833B93E enea
889,544,594 *5C8662C2610DF343870DD9CA39D97B178001F798 [email protected]
889,544,595 *5C8B515C0CA279DB1E4E63A2299F47B5FD15B216 envenoms
889,544,596 *5C8413849B74DA1BB58B27646F33F7CF10D2E7C1 EOTITANOTHERIUM
889,544,597 *5C8AE6F8DF82BD093CE17C6B1EE52E74A403B001 d(--k
889,544,598 *5C812DE9EC58E6472805D1A6F2F928F2316556F8 EQIZEIN6
889,544,599 *5C8A36CA0FB4DD66AD96DFDA4FCBF782D6F93DF1 dk-w+
889,544,600 *5C89A0BA68B9B8F1D6673419C35750BCCF1D8742 ericpaul1
889,544,601 *5C82D23AE7F8E5DEC7D729B6CACA28CD49A57AFF EROTTAVIA
889,544,602 *5C896249E7CA30E14F3B67682FDFD32B3D7A4F6E ervinangeline
889,544,603 *5C8E3591BD3F0F30805B7B208CADE64E97142EFA erzkanzlerarchiv
889,544,604 *5C82A7FD484ECCD192C64140B911FA9045915ACE ESCRIMA4
889,544,605 *5C850273FD2BAC83AC64727E1B161199E7AEFC7D espanolgriffey
889,544,606 *5C8952ED546008EBC8B9AA8EA9DD90D52CEA973B etkreamzing
889,544,607 *5C8E9BCA0746A8C77C21781DE1665B6585AFBF82 dominiquewyche
889,544,608 *5C8157D041359528E8AFAD2EBB5CB562FCDD5CC1 eu0ix
889,544,609 *5C837BC2A15F35538D647805092B038FAE1C9A2A eusenden9
889,544,610 *5C8048028C65B3E628C3501F1D2FC3A8E8916F81 DON'T.RUN.ALONG
889,544,611 *5C873C481991E004E04302DEBE512F0CAE5F793D d=(p%
889,544,612 *5C886F22A2F1A2C9A1FE07CB6A898ABA8155D19A EYum
889,544,613 *5C89970A036B393960CB31E2903EAE77EFDD5A01 [email protected]
889,544,614 *5C84EB00E2E47DCEA91C0DD294920DA58FD45041 [email protected]
889,544,615 *5C8B836214261E9AE49D4F42D3850606E89D00C9 fatima1
889,544,616 *5C8AB0700D7D3B2058C25A6B677C0C16AAD1F971 [email protected]
889,544,617 *5C80C09D86C2AA59CF6EED449BAD285747A55335 FFLESSCHED
889,544,618 *5C8B6795571825A9D52099D220B9EE7B00C1A2D8 ffotsdne2
889,544,619 *5C8A24273D0D774DDCE750BB4BF226620E1FBF7D ficttsw73
889,544,620 *5C84D0E2971D70C80994F72FCE977BAE76A81DD9 DTEAP
889,544,621 *5C88A74B4DBF15BFFE2A7CB6E2D5B80F94B197F8 FIXEER4
889,544,622 *5C87D5B7326755AA572EF6253B62BDDDF56ADB1A FORCE AGAINST FORCE RARELY ACCOMPLISHES ANYTHING
889,544,623 *5C84B1DA81E23F291D33CB415CB08B7FD6EF1E99 FOR+HR9H+NE55
889,544,624 *5C8D5CEAD0B919FA4031D3A4A3B69B8CB44666D3 FORTROENED
889,544,625 *5C8135B2155582CC46A4A5FB53C290B39B0C758E frederickmcnee
889,544,626 *5C8ADF8B22F9FCEB3D268A79AC8FFD1A49ED35A8 D#Y
889,544,627 *5C8682ECBC94648B8A0A8FA5F1A933FBD676DB1A [email protected]
889,544,628 *5C808E90C0181097513B6E8B1DD89CE2E6DD6688 DZ8FT
889,544,629 *5C86C92535B3D7ADAB87571496B2AEC5BB3BEAB1 [email protected]
889,544,630 *5C880ADE74BB7B9FABEF89448D7E246BEEED06D8 fzw5c2r6
889,544,631 *5C8B47694B7E5B5D173A2D755CD63365BAA5549A EBIKT
889,544,632 *5C800CC307389BD3FF5A79544716E57229CE2E2C ECSN1
889,544,633 *5C87A9BE103C549694CA0E943C7D8622E2D50192 [email protected]
889,544,634 *5C8A3DD9927ABDF4F7DC2909A621DE8C5CF85346 EDGARDOROSNER
889,544,635 *5C85380DDBA149E5DE47F82F920710E3740A1021 GARRY.BULTMAN
889,544,636 *5C81754EFDFABD2B8D32BD87C884DB9DDCA12AC1 edition)と呼ばれるものである。この成功を受けて、翌
889,544,637 *5C8000B70028F227BB9D5ED7CBC2CE73E38CC533 gebeitelde?
889,544,638 *5C87169B89F819E9BF1F73F1FFB24D3D82B8835E GERBTESTS
889,544,639 *5C86155FD1B2338BA78895A403ED04D3F8E539DD EI9HEEN
889,544,640 *5C8C6F40D9F80DC9D96887760C50127C87376977 EIDUS
889,544,641 *5C81EFA85AA0A49CB3502607A4627AF0BB44BE2F ekillis8
889,544,642 *5C8A051BBDE8D18A029E27DD955D23446367EFAE ginger-wade
889,544,643 *5C8F611233A4D7ED2891F2518BC922953767E10B girsanov7
889,544,644 *5C804702DF88A9DEF7436C31D1068BB7E1F9848D glasschilders4
889,544,645 *5C8F13277CB34BBE6005AD4A34CC85B78A34A334 ELILIPMAN
889,544,646 *5C8EA4FE5561852A9D5E93E32581AAA6ED1946E2 GLENTRETTIN
889,544,647 *5C86F9DDA108BA1774ACACE6D3B7ACBADB2C10A8 ELITARNY8
889,544,648 *5C86ED8C899FF01F93EE79AF7B1E70C6CC2FED05 GNINKRIVIB
889,544,649 *5C89153D0910115C7CBBF84B8D80A94897B9803A [email protected]
889,544,650 *5C84D9CBCD6F4BF6331F56B889D00DB91EFE7C72 go"nnerhaft
889,544,651 *5C8633747329EFF85D8AD0D06192B78E054F8E25 GOSPODARSYTWA
889,544,652 *5C84B84970F87200DAF68E74C2DB4524C15BAE46 EME)T
889,544,653 *5C8809A2E67B19E32F86D843448FAE75C582117D grae.
889,544,654 *5C8210C92D9A63D0472E7D96FE6F6F3C8E66D879 enjuagares
889,544,655 *5C834B0C5C2F7432BD0650A8FBD2EC90F21D5AFF ENSEMBL7
889,544,656 *5C8C0E662C9761EB3D8C11A0086E59C0FECB66AB [email protected]
889,544,657 *5C8F54F3628D9ACE7FCA3D5122E0A815D9307D52 EOK,G
889,544,658 *5C81D27FB7B66DC3E121DB0D6FA62417FE8AACFB epigrafiked
889,544,659 *5C8B4A141B1BCF4F70EEC848A65E52E82DB00A7B eps/0
889,544,660 *5C8FC54A030DE7EB810C37D2DD87F1BC8C24261F GWWWFJA60
889,544,661 *5C8433F1776D7ADB4A4E8495097C3F77F2EE2625 ERIK.CANANT
889,544,662 *5C894C6E9837E592AC1D7688C2AA18825C95BAB8 HAMPERED
889,544,663 *5C8D9A38DFFCFFB1CB872B21A7BC2B9AA4A78932 eskilstu9
889,544,664 *5C860C4E87B5310A4AA92BBEA9547AB6D1D7C3E9 HAYWOODSANMIGUEL
889,544,665 *5C8D9E780AB758C91B2733FF3EAC42FF24413B0C etsbloem3
889,544,666 *5C835403021B8CB4EC1C2803F07D665ACC216366 EUGENE-TUBBS
889,544,667 *5C8F889AA0245E70A4568C1314D7D0E645CA51EA ewecentreorguk
889,544,668 *5C8CD4F27E56E84FA7CEA75EB620EA88E0DB2970 HERMAN-SCH
889,544,669 *5C8E37C7D7236031F7E45CF1EAB25AA793578138 EXPURG1234
889,544,670 *5C8EA19FD5A92707CF2889C615737AA8BE48F7A1 HET.KOMT.VOOR.IN.DE.BESTE.FAMILIES
889,544,671 *5C8F2B75FCC81BE698176E0499F971EC1C1C371C extremeorgwww
889,544,672 *5C898B99C1073C277A5A708E22FE0EE48E62978E eyc_q
889,544,673 *5C852D93A4F009EF50FF2B59C826D97E15E125FA eyi3
889,544,674 *5C85FC58CF6BE39BF95DB0D9A8F3467FDD16FA20 hladbaring
889,544,675 *5C84762F7165D997DBE476FC777FEBC2AE55D211 family
889,544,676 *5C8D51FF210D4CD03E4E622F98864FDE221D52EA hookrun0
889,544,677 *5C808BD4FE6F83BA1EE48DD4A03FD074D3A3AC10 [email protected]
889,544,678 *5C874E1DF6560CE9794C1B910F2503031F94EF4B H^P
889,544,679 *5C8E5F79ED29BD8B9C74B1FF74734E4E7C29428A f_k
889,544,680 *5C872D97F3191E214FB19A3B110BBDC474D4A2DB HUNTER.GIERMAN
889,544,681 *5C8DE656D574912B5EE5559BDB23411AF97C0BAC HUSSAINKHAR
889,544,682 *5C8D89E767B1ACC24DB4B133C0AE16DE4BABC97A FLKKEDED
889,544,683 *5C8B3FDB27A968B8A6801C05A64F52F53E57B221 FLORENTINO.HAMSON
889,544,684 *5C8C01211232420246994B7BF08CFD9509DE9A4F hyih
889,544,685 *5C824A6D66CBB1483B162518F322E1E9DCEA5BEE IAMSTART54
889,544,686 *5C80749416A538B02C02A442C0D97314AA5415F2 formacion.xiashaximiao
889,544,687 *5C83387A4978F3E16F3EACFBD35F289FB1F9AB71 IAN.SALASAR
889,544,688 *5C8E6EEB098390F8A150F12DB41750D37FB3FBB7 IBRALLOC6
889,544,689 *5C8A89555775ED9BA2E0B5F267FEB79E62D2B5FA frankbozarth
889,544,690 *5C82AC788DB64B516B846DB2952446A3502E8861 iguanaresearch
889,544,691 *5C8492279410D9EA70E75D8F2CEC004FA637F713 FRANK.SCOLIERI
889,544,692 *5C8F0F46DB1309949CEDC5C45890835A044B980A FREDERICHAGLEY
889,544,693 *5C8416FA6EA86141CE33190213E255372835E74F IKEHOLLIN
889,544,694 *5C8AA617281AA897C537790C105BD029EFC5AE91 i.know.you.don't.love.me.(feat..gunit).(promo.only.clean.edit)
889,544,695 *5C8DD223EE159E437F473E779FD1AAC19B0B839F FREGGIRT0
889,544,696 *5C8F1BEB56C9BB4A542D5BAD0CEC4E477C6E3622 ILITTYK7
889,544,697 *5C828277AF8FB47A8D744EB74BC153860AF667FE i'llpick
889,544,698 *5C8324691E82A15BC9680A5E2B4D0DCE0A3BDBA0 ftt*
889,544,699 *5C8E74E0EBE8422D39C2D6A980A68A231600C42D IMEYTETN
889,544,700 *5C8CDC2FE9BAD47BB1F19CF9BFF2DE1DF8573E6F gallefortchurch
889,544,701 *5C83E6C0D721F88C0AD863152773B94502BC190F GALLON?
889,544,702 *5C83FC863E72E6FCD00E28CF1BD8CD15825E8A49 gastongivens
889,544,703 *5C8C3C530A4E26639EA98843D0A63BAC51ED8BDD INTERINVEST
889,544,704 *5C809466EF77292161C6899CCEBF64F80621D1BE IRONROCK
889,544,705 *5C888B19B188983DA91449735AB9C5F12D0FD2C8 genesikora
889,544,706 *5C829DC6FB90AD2D2B1DB9C5F1CC494FE904DBE6 GEOFFREYMCNABB
889,544,707 *5C8EEEDA701D5B3E47F46A19DAFD1A73DAC035A7 GEORGETUTTEROW
889,544,708 *5C8A629D35BF8AD4DC2E8194E889F2B3FD2F21C9 iscrpenojed
889,544,709 *5C8A83362CCEFA3F64DE1D97B0542627DDAC43C7 isiahbalzarini
889,544,710 *5C8B85ECB43BF730B852064F54187ED2A15AC148 gerardbrienen
889,544,711 *5C87957FB79BBF0F9AE9AC79CA3E6FD21A3FF6F0 GERARD.DORGE
889,544,712 *5C8FFDC8DE464340293DEE2D0E7D86A5A45FF9CB [email protected]
889,544,713 *5C8AAA28C05154EBB32C28883398BB2E52A161AC It's-Nice-to-Go-Travelling
889,544,714 *5C8805AA39E6D826E524577869FCCD178B43198C ggnr
889,544,715 *5C8B81CAE696F2975B5394E5A2FFE0CA0824FA22 j"]
889,544,716 *5C86DFBB5215E3AEAD6525F098F5F40C336F7820 GLENNGAIL
889,544,717 *5C8FB8F6B6577DF276FE2F94FBAB3905A0080DDC glennnickles
889,544,718 *5C8DF1219952FE230AFE263B25307D90181F1DF8 jackleshem
889,544,719 *5C88E7D286E32F446E21208AE61984D89FF5BCE6 JADE CHETTY
889,544,720 *5C8D4BA2BF5AA2514DDC45AE3F23C48F031AC14B golden.feathers.(racing.chocobos.-.place.your.bets)
889,544,721 *5C8E9A7A646F7437B1734F6348BCBC01EAC60FC6 [email protected]
889,544,722 *5C8F3E4CCA435D5E1305705DE17F163194DC5BA4 [email protected]
889,544,723 *5C88813ED09659933D5C164C8AA3C90F8EDDC29A JAMES RUBEL
889,544,724 *5C8CF319C21E8509A644C563D43A7FAF53FD4520 JANGOBLE
889,544,725 *5C8351AB3C165FB97D47BEB4AA1D4DD77AC21CA7 GREGORIO.KRONER
889,544,726 *5C80428BEFEDB43BA315C94717585632416E7D2D GREGSCHREMP
889,544,727 *5C89020C7F07B418844A2A239AAA9A123E8E5A7E gropingfortrout
889,544,728 *5C824BA82348786A3E3434C368E33F7DB460FAD4 GSMJDGD9
889,544,729 *5C823D57CDF3377CB8E3ABB14B09F4DE900A1EE4 [email protected]
889,544,730 *5C8B226300D1D2BC70876A858C44A8399F26E2C2 jcjl
889,544,731 *5C876C601C1468D0AD99E4CA08BE3C48E80768CB GXZQBB
889,544,732 *5C8B73F87CA56A6C94D7F8EEC50E4F105C4A3364 GYANUPRADHAN
889,544,733 *5C89D74C1B84A48CD20E472C1EB7638B1CDC8B19 H699164206
889,544,734 *5C8013EF6ACEE556803B4740291ED1CC92C80DE6 JEREMIAH.TRAMONTANO
889,544,735 *5C8D46AFB19AC68F2F81507C65C3B7EE41130603 JEROMY.COFFIELD
889,544,736 *5C8EAD3F7696684FA1BF3597A7F8A378D46933F4 jerrodmcqueeney
889,544,737 *5C81F6598CE5893FDF5A83830648D011080B13FD jesseleidholt
889,544,738 *5C843626846677D3E8D196968D79B70AF1A33D62 jessieschiavo
889,544,739 *5C810E5EA13A1C17E13FE450414851B7287D6087 JETEUSE3
889,544,740 *5C82812C4AC55543C574052219873DF4845B288E harlandkung
889,544,741 *5C8C2854AAA82C84E7619DBAE61E397EEEA8D47F JGDHRBRG4
889,544,742 *5C86D172A1776B062746205ED4CD9064D4F90EEE harryhinkle
889,544,743 *5C820AC8867C5C55FF22D3605A5B4198692E99CE [email protected]
889,544,744 *5C83279D607F4F6D5EA3DCC6F89FF1E26973B6AE [email protected]
889,544,745 *5C8094250431DF9EE3B18013CF62A04104FBD0FF JIM.BECKMAN
889,544,746 *5C89A4997FFFCED6A8D6510DA0A6A98E52D3DEDA JIM.YNOCENCIO
889,544,747 *5C8893D8F9CE5D92C71EF99F4B5AC0778C4FF739 HAZELLEJAE
889,544,748 *5C8565301B49A15A43C844A8BBDE7D3E4E4EBE67 [email protected]
889,544,749 *5C830D16DC76D3480EFF52FD19311C6791EB5841 [email protected]
889,544,750 *5C867A3523F4450CA998DB4685353DFAF52A37D6 [email protected]
889,544,751 *5C852621FE82638F54F115B3D6C7EB9ADAABDB0A JML5
889,544,752 *5C82FE708A88DA5074166946DDDAEC8B0B231BEA joanne.notaro
889,544,753 *5C8067CCA4BA07B273037C2F5C1B59B36CDED4EF JODY.DELACRUZ
889,544,754 *5C844A073F30ACBEA92A3C0A2B46AEF7DABD9DBF JOEYHAGGARTY
889,544,755 *5C85FD31871DDADB52B048DCD075CDD78B4CA35A helmut0
889,544,756 *5C8B2B410235F8673C5BA523471F4C64022B83B6 JOHNNYANDARY
889,544,757 *5C820763BF778349A04710888BC5A2F0BD34AAAC HEPATOPO2
889,544,758 *5C844A4497ECDA0D934E2C5EDE2CFFAA20F71CDE herbertkrzeminski
889,544,759 *5C8823F99C910F3F5A5302465E7442D073124047 HERLAADDE!
889,544,760 *5C8A235C13D15518CB866DD51262DF491AA28821 JO}P
889,544,761 *5C87E4C0049682DE29990EB5FEA5134B1132B4F1 JORDONHELGET
889,544,762 *5C805A0F6828FE3B034CC734BEE1B5F6C5DC162D JORDONLANIADO
889,544,763 *5C8A8B12AEADE3D6864B4BCB79307FC53E628696 jorgewellbrock
889,544,764 *5C84EE62D4445C44454CC6D8A473D6FA9B532C3C HFCCTKRHJE
889,544,765 *5C8917716E1F1DBB0E4C30E271B51536057DE788 joseph-fisk
889,544,766 *5C86A89BE3EBE36A7A852F200FD7A77F6D8A52BB hiernatoe9
889,544,767 *5C8C83DEDF1E181CDF131AF55E46B4841113ECC5 HighschoolLadiesStreetcornerBabies
889,544,768 *5C8B89D7E25D325425C98EFA69ECD87BC4BA5AA3 JOUAILLERA
889,544,769 *5C80BCADB35CFFC2B0B7001AC72802A13E99F0FE [email protected]
889,544,770 *5C84ED63E606D4A69C741C2B5B09AE68FAA45E7D HOLLINCO
889,544,771 *5C82244F5CFC795A97381AF83CB2831D6613151F Jump-Through-the-Fire
889,544,772 *5C8DACAE8CC608EF9A9503E1B23156FD2C572345 [email protected]
889,544,773 *5C88DF744729EE8B56486BB0E5ECB5554ACF3D2A hoppathpl
889,544,774 *5C8B63163410EF426676DAD02EC35E4D24766D26 horaciotalib
889,544,775 *5C8CC2243F2408A6A370DAB6363FF6D0029571DC justinkempter
889,544,776 *5C89D9BB4E400A12F907F78A01A628E28E8094A8 JUSTINPRATT
889,544,777 *5C8286D178E63A486E3D7F73C3B6E799F26BEB98 K39E
889,544,778 *5C8A7B0600E333EC68F4A8DC7CDAFA52EE418682 kafatsa
889,544,779 *5C8DDF6BCC2006F9AC351C3F1325AB01453C5BA3 kaprekar-zahl
889,544,780 *5C8C2DF4679B0FCC1C3606FA77DAB5C24215C4C3 KARL.DISCENZA
889,544,781 *5C8E9F26497DCCB21E542EFB81922E1B57EBCB84 kasun-hasitha
889,544,782 *5C82DD96948BDEC30C8E7413E50F246E7B9DE164 katalookista
889,544,783 *5C85916ADA6BAE712DF84EB667E437BF2DDAC5A7 KAYLANAUTICA
889,544,784 *5C835843C083C5FC1B87AA162A42235E08A0E427 [email protected]
889,544,785 *5C8CEF6575493764826FBF0468F1E16AB931A8B4 HYPOTHET1C
889,544,786 *5C86526F0CD76757B64C20D8929E4F593A59129B Kelly-Wright
889,544,787 *5C8EBCD5B7E0BC2CA5847C75EA82C0D923F86039 KELVIN.WILE
889,544,788 *5C827AFB38FD93278C4DF2491C5C3B1F8CEB967B I4,
889,544,789 *5C871D0DAE350CC2036CF81A5074502013F184F0 i->a
889,544,790 *5C8CDFEF17F7C03C69C7D4FA26D43B95BC843E2E iänkaikkiseen
889,544,791 *5C8A87E198B4701910D4CA8EDFEF719183A112F7 KEVINSTOCKER
889,544,792 *5C88B5AC1F2DE1E3985E654E0666CD14B95C0250 KFJX
889,544,793 *5C811F70BEC830D1B84E8A8E2D7CD82CBE021E2B IKUZUS9
889,544,794 *5C86097E2303D7BCE93958194A044827EEF92D94 I'LLHAVETHEWALDORFSALAD(FEATBONOBO)
889,544,795 *5C86117E65331DEFAA82A52D59B9330E09B94706 KITTENSKOKO
889,544,796 *5C88A426B132ED7DB59ECEFC0C0F1EFC6F4181C3 knowlike
889,544,797 *5C87B3700F056B6997E59B517E42F35C2A6D2AE2 KRISFILIPSKI
889,544,798 *5C85EC81AB382A7FB5EE9E4E5DF04FB63D85BF57 innovationswirtschaftliche
889,544,799 *5C87545003D65137477D28862E3153F80A3DB06D intrafus4
889,544,800 *5C85A1B45C2FA25E4A5ABC38C612A1E538DA41D8 KYTELLEN7
889,544,801 *5C8AD73FBB5B48A369DEB56188BA429AFA824E9A L1MONA+E
889,544,802 *5C8D001BF292C88AD718C483C64CAD1DEAACD69C LACEY HICKMAN
889,544,803 *5C8D634D8F105C5ADA9AF1934CB13E0F1D4D0990 ISAIAHMAIGRET
889,544,804 *5C83E261BB9F264840EE0164D074AD3382C239E8 ISAIASKIRCHNER
889,544,805 *5C8007F99152974CEB2E5150E691B2074A5C397E isakodom0
889,544,806 *5C80815BF755B198C3082D2D00BCDB23BE084688 ISOCGAL
889,544,807 *5C810D81A90DF278B1E9D936995BC2A18EDA3234 [email protected]
889,544,808 *5C874A88505874E11D913C3DDD47616EB355E3B6 LATEYAL
889,544,809 *5C83617FAAFFBA55E93D297697DD30D3E0ED1AF7 jagritbhusal
889,544,810 *5C8FBBEE7792EBF1618AA7A5543270D6F51F44D2 LCAROSO
889,544,811 *5C8392DAF254182137064AC6D2CBE5CDF598D67D JAKEKETLER
889,544,812 *5C801059ACB90ED5D63A5FB5098C9EDCDF10671D leerbegrippen2
889,544,813 *5C87E92E4C014ACC4E2132023583FD82C5A4E6D7 Le.Minimum
889,544,814 *5C8D6DBB0840479FE2250BAE61B2AE5BCDC3C43C [email protected]
889,544,815 *5C874A2E6F70D7E59469A59F76962DDC8EE64DF7 LENIANCY0
889,544,816 *5C8196497EDFCFED0C5F5ED680756C81A4E46D6B LENS.DUNKLA.NATT
889,544,817 *5C8DE6C47618BF647323C305035C08FBF119DA02 JAY.LASSELLE
889,544,818 *5C8059C89E3544572BFEE20C0CF324EB81368756 [email protected]
889,544,819 *5C81E9AC7F8981A30CB12D5ED7D626488A80C2DC LET'SFORMACOMPANY
889,544,820 *5C866FBCE6EB38F1D54734F11545C84065438F0C LEWENSWE9
889,544,821 *5C8EDEF66BDAD529D29DECDB3EB960CD71EB9440 lf123!
889,544,822 *5C842AC6FC533B0B2C4CBAB1CDC756D6AFAC4373 [email protected]
889,544,823 *5C81DF8FED8837C03F1A0144D724CD5A4B16CA4E JERALD.OSGOOD
889,544,824 *5C882A2EC0A46BDED8BCE3C7FED43584B44E8DFB Light.of.the.World
889,544,825 *5C8B2C6481625F19200D8E2FC54ED90FAFD1E660 JEREMY-WALLOCH
889,544,826 *5C8961868B6BFCA5B561139F7BF7C07128912C61 JERNBANEBYGGERIER
889,544,827 *5C894169F0B2694529FC3F854F0C2E14CCF94468 JERRELL.KITTREDGE
889,544,828 *5C839F2262FD351E2D73C5318EC895B2E529F11C jessjares
889,544,829 *5C826A134BE1B456DB49A43B3782E60513D6F1C6 jewtrawista
889,544,830 *5C84553F011CEA32E55B2B9FA501E190ADABA719 jimbo
889,544,831 *5C854B633E0A1F7DCCF8145696D1F747A9E0717B LOKALPANED
889,544,832 *5C8C416192720F232FFB15178D84C813B0DED33C LONGBILLED_VULTURE.
889,544,833 *5C898A433E0EC31333EB31A996B3BA131FB6206C J,O*
889,544,834 *5C81C33AC0FD7150E30946CE8716217BB46ECC04 JOE.ALLENBY
889,544,835 *5C8BE45106453F9A5322E6DA440F1146749EA61F JOHNATHON.MCNAMAR
889,544,836 *5C8C9255B6D54F0E944CAB4A307567FB899EE02E LOVEYOURMISERY
889,544,837 *5C8AA5EAF1038A05B0296EC6030D5BFE77E5895E [email protected]
889,544,838 *5C8C21B935E1B25D9B062E1DFCCEE7949D916AFB [email protected]
889,544,839 *5C853984AF4845C710B50D2995448705D79A430D JOSEPH GREGERSON
889,544,840 *5C8D79F2D2CF7467FC7BC895F7D15FD6979C4F9A lyddaned
889,544,841 *5C82F9AF5B70833DB6E26DF9169C6D201B2DD6A9 M00N$H
889,544,842 *5C84D24D7E52D1E7BA023B6D547DA51F27E7B458 M8S?
889,544,843 *5C87EC5B236DF481EDBDE68E98EFA1DEE50A0399 MAADEVAHETAJATELT
889,544,844 *5C81E114CCC01B61C0D07F767D1D4AE7D02E8CC1 MACK.MUNSINGER
889,544,845 *5C8680D1B0ED29BBAE254CAF479A643B1F269338 madis13
889,544,846 *5C806EE98662B39268A14FFDB3793BCB347EF2AA [email protected]
889,544,847 *5C8A7105DE9B59F9EF1BF0FEAC5AB277CA1C123A JUMAJUNKIE
889,544,848 *5C812B5969BB2222A9B9A2D2DC570FAC56D5A95A &jy
889,544,849 *5C8925D4983B47BAAAAD8F018AC33302CBE5E064 KABLEOK1
889,544,850 *5C86CD8002FFABE854146D7B1DEF02B7E0CF90AE [email protected]
889,544,851 *5C882ACDA9F75D220394D0C28591AC714E8097BB MARCHESIGASSE
889,544,852 *5C84605DE4F3B3728E4882600683822F2797717A kautskago
889,544,853 *5C8149D423868C4759998292E462D0B36C82461C keepingmydreamsalive
889,544,854 *5C8BE23A372F918D3A25D685CC087D95BA37C6D3 MARIYAMROXY
889,544,855 *5C807D28A4CEF7EC76BFD0CD5AD32F10BD7BB103 markculling
889,544,856 *5C869FA8F4E161B9C48EC5F557F991387B0DB402 MARLON.CHEVAS
889,544,857 *5C844DD8591771687741B1957104B4248C117E27 KEONDAL
889,544,858 *5C898CCFD85957B56E406D79CF2993A63A72BBE9 kermitpoorte
889,544,859 *5C85F68F761480835F7E324D86C7B3A8C71BDE1A martin tillman & mel wesson
889,544,860 *5C8EB27D0DC4CB3689CF30EEDA4BA6EF93C53F7A kevennjie
889,544,861 *5C8FA8AC86C2F759CEE47A27230AF6EBF231DDB3 [email protected]
889,544,862 *5C8F92192736D59A6305038B3BF90C0F7A7929D9 kfb.
889,544,863 *5C85991679BB26962557A206CC288968D448CBEC MAURICE.SCHOEDER
889,544,864 *5C81A9E6AEC8E018A09AAD13220075953A8C187C KIRWINFENNEL
889,544,865 *5C8E05C51574CDF2C1576D834A132814AD0A7A35 MAXKLEGIN
889,544,866 *5C8C4E2A10BF9112AD78D427A691EC08B79743F5 KLAUNOVE0
889,544,867 *5C88F7477F64C107EF4E848B7BB507033CD25C5E KLJKKDEEOP
889,544,868 *5C8E7554D6372CBF2404AE4C76DB8166D4B3A6AF [email protected]
889,544,869 *5C89D9F558FA072A518290C2F458780E4F14274E KONGELOVENES
889,544,870 *5C8DB9E9BA2AD746DFC0553BA6B045683339D0BE MEMNOSCOSTICOM
889,544,871 *5C8882A60E3DBC0465F82B0682682947E8FB0AC8 MENGME
889,544,872 *5C89DCE5F3C52DD2D3BDC107D8EF068B89F507E8 Kotona.hissukseen
889,544,873 *5C87D866339EAF70930F08DDF0833E1070B52F2D MERLEBOCLAIR
889,544,874 *5C8B36A1DCFD5460ECD5C5A01E8C53DA65A7F0DA kozlikem4
889,544,875 *5C8C29E44767D4BD79FB5715A85FB319574AF6B3 MIAHUBBA33
889,544,876 *5C8F8A18B52BA78E0503FB78717AE1961AD2C9D7 MICHAELSTEELERS
889,544,877 *5C82FCA294AB8F51FE053A158B92B46974CB17E1 kusigaha1
889,544,878 *5C80CA2B923F6D2C76A010DC1D3286667FCE9AB3 MICHIKOWADA
889,544,879 *5C87DDE9C8BCD09C9010244C33E573B16F7722FF MICKENHEIM1234
889,544,880 *5C83589CC43754565C5D3E4B74607DE0719981F1 KWJ~
889,544,881 *5C80881CEFAC68569F0CC701AF9A8E38EDAC717B :KYRIE(OXFORDCAMERATAFEAT.CONDUCTOR:JEREMYSUMMERLY)
889,544,882 *5C8443336C09C146F2833C70A2055665AB53A85B LANGUAGESIMULACRUMSIMULATIONSITSOCIAL
889,544,883 *5C8C8392258F3AC3071E0E7C8A9A90F6921C2F13 large-sidney
889,544,884 *5C8BA56FE72E0D0C00BE9A0D6C9E1886F0709D9F MISHASERVICE
889,544,885 *5C81DC00C4111139FA3879072AEBD8011AEACBED MISSAMARIELADYBUNZ
889,544,886 *5C8B24D5C0EF732287AAC34241F60ADEAFD58EBD laura.emmer
889,544,887 *5C829BD2D7D275E3CCE4BDC9BC00F232FCFD4614 lauren-gaul
889,544,888 *5C886CA5ACAA2A34263888C12C076BECD8BDA716 ML4N353
889,544,889 *5C8DE4A3C09AB33F288578D7E83345EFB419BFC2 MOHAMMEDCARRUTH
889,544,890 *5C8DFB595A26AF07681A488D13E62A4EE3A2F8D1 mol majeur, Op 73: I Allegro
889,544,891 *5C887744020103DAA6855A319AAD4861D2734292 moment-3
889,544,892 *5C8E0FC8E91E48E405CE50C50C1156842ED9D61D moniquetiger
889,544,893 *5C87FB09A3446A3E6CBCA0F62D727B249F7215BF ”LENI
889,544,894 *5C8C88D042B0A253CF3584E0609CBAC8B83FF9C2 MOZAFFAR HUSSAIN
889,544,895 *5C8D1CFD1775982EBB7FBBBA261B71247E607043 les100plusbelleschansons(disc3:bonnieandclyde)
889,544,896 *5C88D8C03F85CCC73B4829B71BA4FCF019BB4801 LEVI.FELLINGER
889,544,897 *5C8D231BECF7DA48EE901CC331AB6AAA5C79EF34 LICEO DE LA SERENA
889,544,898 *5C82267C174E1286A13551AD0FE526A7AA7727A6 [email protected]
889,544,899 *5C8ACCBDDF1EBC3E8E916384554A43DD18D24AAD [email protected]
889,544,900 *5C880FF360127E1123EF8E7414B6DE9A296E6375 N0129444675
889,544,901 *5C81DA652DBCAF70D8720E1EBBCF539E710EEC0D [email protected]
889,544,902 *5C8B607B63683E3CF5F9D018C8652DC3A951ECEF LINESYMBOL
889,544,903 *5C8F8B01764CF3831946CC1F0474EDAB81227ABA NABILHASSANI
889,544,904 *5C8F4DCF669A02468D3BA6423A5BA4526C8FE305 LISA BROOKINS
889,544,905 *5C8676081062D5D10D38C87D770F859D4BDFFC29 liuyonghu
889,544,906 *5C8B2A7D0FCA8F315A5970755FC40F2CDB180340 netiowa6
889,544,907 *5C800BF3CC151B97E22803F6D8AE7A994FD20B8E LUIGI.CULOTTA
889,544,908 *5C843D614FB922C4C1C31FD5C952502A677BC920 LUKEGOODFIELD
889,544,909 *5C841B1F9C1F177BDDEB355EF2E8A81F0F54BF98 NICOLASBORCHARDT
889,544,910 *5C89111AD26AFA0687DDE8408865A61A8273226E NIEBAŚNIE
889,544,911 *5C8C827020322C2FC8A26704E9FEF6EDEED03F7C NIKLASDAHLBERG
889,544,912 *5C8890EB4ED50DF1E2FD8091A5AA3458C7D4DBF6 [email protected]
889,544,913 *5C823B7B061A4BFB658E64DDECF15A577901A4D2 LYMANCHADDERTON
889,544,914 *5C8A01C7459D74FFB8E4787950E5B3EB3F75C942 NOLAN.DIMOPOULOS
889,544,915 *5C8BDDAB12CA1C45CD99FEE3E7D008F92C964A96 M37ALLOGRAPH
889,544,916 *5C8890B9FE0B4A551270E5BEF38F35FA1BB44AB7 m93
889,544,917 *5C8D3D94ABE80DC000C0D7C847FA70529AA2511B magenges2
889,544,918 *5C8A6D85195900A96933D91DA524AE361D3D829F NORRIS.ARIAS
889,544,919 *5C87DDF29DF045A3A86A7C4BA373061B94FCD651 NORRISCHAREUNSRI
889,544,920 *5C8CE7E0273380DA90E4D396D2AF778539C4ABDA MAKING BELIEVE YOU'RE HERE
889,544,921 *5C8103646FA22D482D7BA1E60E27ACC365DD6EBA MALCOM.FITZNER
889,544,922 *5C8D31AED6B810A67189406AA63A593542A51942 N.POR.LA.REP
889,544,923 *5C8D37211D4E59E1D3E21F91E6E2A03C9B44AF78 MALLAST
889,544,924 *5C89D923670922AB51D9AED073AA9F36FC8DC1BE MANHATTAN'SIRONHORSES(THELASTTRAINOUT)
889,544,925 *5C8FC6EBFF0176649611E9E1C05B47936358135F MANVIGIL
889,544,926 *5C893B01B7239943945543639F2B3E6DCBCC7CD8 [email protected]
889,544,927 *5C8F6EC13B754B7ADCA7C2EB6EFCF9440B9EA6AB NUNOXINDA
889,544,928 *5C898991CC78AF7F923C7AE9DC93B663514DAC4A marcelwiinikainen
889,544,929 *5C8B7ED37DF5B25C923E4333457682905648AC03 marcusjasper
889,544,930 *5C83C35A17A9CCDCEF3C2EB4765C59458F2A3331 (O_) `dp
889,544,931 *5C838AC6A28210DB38E640EE3DE2D4A9214750AB MARYANNE-TOWNSEND
889,544,932 *5C86E64EFD656A12C1E71AE5151AAEC9DD44EFDF okarakterizirate
889,544,933 *5C8121BE81E3AE010F4260BC310107DB5DA26321 MAURICEDESOLA
889,544,934 *5C8B4F49F4BC21F7925F66BBAF97F71AF0E23C88 MAURICE.DIZA
889,544,935 *5C83610202656CA0D84FBB44830C0A9A99EEDEAE mauricegirand
889,544,936 *5C8FB4863D8044113CF45C16D47EE362303DABD9 MAURICIO-L
889,544,937 *5C85CE241AD6AE1571135D8AA2F054F36B558AB8 MAURONER
889,544,938 *5C83861B2457D998EA1521ECD28651A61B194F26 ONGARTILBURY
889,544,939 *5C808DFADFB86B2344CAB3036171D833F3A99C9E >< O~O~(8
889,544,940 *5C89D82226F440E5DA6E733E16F12FCBC3A209A6 MEALYBUG
889,544,941 *5C8914D172CF7BD297B837EC72EF22BFB05F2837 ORVALKNITTLE
889,544,942 *5C856247FAD406219505C0022C1621460AA188EE oscarvawter
889,544,943 *5C8D25643DFB00D2E6BC225A13BB7AEA91CAE0CD OSCELLOED
889,544,944 *5C8B17226FF57EA8C1F2FBFF2C83F3442B3A4250 OTHER PLACE THAN THAT IN WHICH THE TWO HOUSES SHALL BE SITTING
889,544,945 *5C81711BD1DFFB1BE1B57F64A3C51464D097B939 metwali5
889,544,946 *5C855497E2AA75FE4AD6CBAA23F5D4A7D59463AC MICHAELPOLONSKI
889,544,947 *5C8EFF788FAE3684A65E7CA44F890B4A128F9E74 michelle.llarenas
889,544,948 *5C8183BCE42AC002F672BE263BF8D1FE1FCDCD6E MICHIBIK3
889,544,949 *5C8149BAA3E076970A3D818665B1EDD81764BDB2 MILLARD.ALLWOOD
889,544,950 *5C83950E9BF40272E5F184666F317DE4D893A1C1 MIMO.KIMO
889,544,951 *5C88AB1ACEC611F1E8944D470E282C789C3A2C08 mindaro
889,544,952 *5C8AE00090B7B8FF6153B99154B3CD19C03AC8A5 pagina3ns
889,544,953 *5C880C3A99D7D3EF402543D0F43649ACB5F54A32 MISAELMERCADO
889,544,954 *5C8E15835E378456CDB4800AB7D91D96A03C49CE Panthers-(feat-Common-&-Last-Poets)
889,544,955 *5C841B8D5DD428D0F1066F34F623F10B4EC17806 MITCHJONDAHL
889,544,956 *5C8A4343B8452E52B864F44163D53143479D9911 MK(=
889,544,957 *5C85D40D6817F2250626908A19C8DD7EA61D047E [email protected]
889,544,958 *5C8F993F4EE653D5E164BADAA4B57B7DC8D31C78 ml$^
889,544,959 *5C81FAE2A3D912924471FDD3FD0544A88BBD0837 MLDANESKY
889,544,960 *5C8B188D93B6336E6A8949D7896F3557F9AC938F MLOJEN
889,544,961 *5C8134FC4E784C86D594D3763CB406DD65C3607C PARISREILL
889,544,962 *5C82DE89E11EE61182C50404E5626BD9AA56AE2F m|ls
889,544,963 *5C8232FB88A77D8C59FECDBBD0378993446BEAB0 MOLLY COFFEY
889,544,964 *5C8B8DB7340DC7C9FD9E7F23467C432D8AFC971D p=>.*.*.>-b0
889,544,965 *5C8D0B82054290B0953D56E7195DAB6A600CB1CD MONTE.NYLEN
889,544,966 *5C86711A0733B6CDDF2316E6593A8AC85E52B823 MONTYKIRCHGESLER
889,544,967 *5C840DD1249EEEACD6A0FBA7331356774673398A P-----B ~O~OSPLAT!!
889,544,968 *5C8AD948DA5F48D79076A79B70023E510E2393C9 MORTON.6
889,544,969 *5C849F83F1C443246F260C810335046B299E5BB4 PD.~o)O(
889,544,970 *5C81AA13BC4040CC23D6D6CC9B315E4B4F02F505 PECZYŃSKA
889,544,971 *5C80B610D4B47CB07F6E478C9602D515FC37B49C pedrodequevedoyquintano
889,544,972 *5C8823247F32BCB09FB042DC4B0951E99E9E7457 MOUNTAIN(1997年、
889,544,973 *5C818136F0D69D98DB94FF8CEF5E82D2E285511A mountainspecial
889,544,974 *5C885904020880F111672229B367D41FEF186ACF [email protected]
889,544,975 *5C830F08BE1A5A51220E38F74B01597088681A8D mrlnadho15
889,544,976 *5C84C6C7CA04B72E254C7FB90C1CFA7F6B37D1FE PIKNEIEG
889,544,977 *5C820D9235A33E782F6F6CF0C7B1E5A630C55FB0 PINKING
889,544,978 *5C841C1F559F487B0DD47B3B6971F128908739FE MYTOPCAT2010
889,544,979 *5C82E627B907FE535A0A6B4794183FB9B3EB43BB mywalden1234
889,544,980 *5C841C26EF6497C41A67E0242EB2BF9E9FB25393 PL4YBOOK$
889,544,981 *5C8094F60BBDDF223FA6F39F57ECFE705C8DB376 NAPOLEONMANTO
889,544,982 *5C8A5298188DDB477E4274F3958D9243BAE1EECE POWER.IS.THE.PATH./.ANIHILTED,.PART.II
889,544,983 *5C804383463ACD2A52E3031808DFC2A1EC614ADF PRÄTORIANERS
889,544,984 *5C8FD7C8FD58E3318657D2E2C9D44BFD911FE90C PRECETTORIPRECETTORI
889,544,985 *5C8C84218749F6B30CC6F5EA0B3D266F351C1883 navesha
889,544,986 *5C87A0B825127795CFDE03814170D1D6171BB0EF PRINTING181920
889,544,987 *5C8AC46725A62918325F7F5E6061884687A26AE1 NEDKRALIK
889,544,988 *5C8C1735F341BE5F81329144E5A40F6AE0CDDDD1 PRJMJT
889,544,989 *5C88A9EA82C3DC80C140EB46A78BD887DD7A2E95 PROEMPIRICISM2
889,544,990 *5C8EAEBA97CD88276E2876063D89CC8010B9BAF8 protectedpagesindef
889,544,991 *5C8F8FC4340C65A42C1476BDBCFB189FB97EADAC protoortodoxo
889,544,992 *5C8D7B9217871C7B379FD7275A8F329A167B5F2C nevilleloeppke
889,544,993 *5C8A0B369DB8802CBEE1E5C766129B44E45AC567 NFBX
889,544,994 *5C844351B57728F7AF5AE90847B64C0CF5BB1EFA [email protected]*.*.*(>_0)
889,544,995 *5C80C6FCF44CA365745C45539A5F6ACDA6429799 NICOLAS-TOUCHETTE
889,544,996 *5C824E4FE074FA71EDE500143EB5F6180B690F9D q----B.`~.`~.(^_~)
889,544,997 *5C8D29E07498D23E9D6BD2F25DECB174BABF69C9 q----b-~o)o(
889,544,998 *5C8EC9D6BD9F942B071FD75E78FDAA568CED37A8 nilessum9
889,544,999 *5C8560C44D963B52768537801D9189A00299B0EF [email protected]
889,545,000 *5C8E346791EB697085340C35C9204BA10311D34E NINE.WORLDS.AWAY
889,545,001 *5C85977C9DD092278C5CD0F7CAB0D39D322BDF00 NITEWQSB
889,545,002 *5C8712A707EB26A2F81C4BD14987DE11D5B1F7E7 QOBIS
889,545,003 *5C8A14EE27153305EEB87B3D12B456A62CE0A2FF nlxpevq61
889,545,004 *5C8D24CC22A291756E487B42571961307E1A9033 NONCONSERVATIONING
889,545,005 *5C8A2D6DE20EF81DA54F43FB694EB3A7101ED00F QUO+ANDO
889,545,006 *5C8B91E28924066BA2B8CC910B8BBB11CA86BBCA ‘QUY
889,545,007 *5C825F6F70A6E96F394C2A4E48B9E3CC0C0B6E0E [email protected]
889,545,008 *5C84296940C357B0C3E62927F23987569F7E5C1F RACHELLE-AUGUSTIN
889,545,009 *5C8E615EE5A661A8A6099C9D50EDD122F606EB08 NS24051957
889,545,010 *5C857C211CDC4FB89860080EF5EE78D606DA353D NTURBOSÄTZEN
889,545,011 *5C8AB961D4721377E07117B94E4050C7F64E34EC RAMIROKAEHLER
889,545,012 *5C80B7BED5BF7EEAE3CDB7056D3D1806ABD39DB8 RANDOLPH.LOUGHLIN
889,545,013 *5C88F902A07B5702A0F13703A5CD493533ED9454 nzyv
889,545,014 *5C868062E2A85A8A031DCF0F81732903492CE234 RAVAGING3
889,545,015 *5C8FD149370F850CC79F415ACE3FCD43A013EF9D RAYMOND.DERBES
889,545,016 *5C82A2A71E0DC47D30B8ADA392BBE2CB4BC7ACBC O=)G
889,545,017 *5C8157182288C082D4599E0308536C7C38B35045 [email protected]+ING
889,545,018 *5C81F946FEE43DA725941C64CD7E2A627F6FD8B4 OKULKURACISTINO
889,545,019 *5C83164CBF54642D655BDFCC21185BC0B63DDF55 [email protected]
889,545,020 *5C85AD239DEFC63340B9E50DA0D8DAC07310BD03 OLDMILLSCHOOL
889,545,021 *5C8FB9261333776651B2D39297949EE489DDC958 OLIVER.IMES
889,545,022 *5C88667A341014A9383DB7D0887A5DAA10A534B8 refugiodestephen
889,545,023 *5C80654D4B57E5928DF22EE4C55CD7804945BF5E REGINALDSTAPELS
889,545,024 *5C88A9CBCC101FB1496460D44F1F09E7FC5F1CC6 REGNIZNULKWSB
889,545,025 *5C85CC6B134C6AF46044E1D8C95DED1A0DB3431B REGNVANDSBRNDEN3
889,545,026 *5C8A196FE8C7DDBAEF23BB28779CD93084AA35CB onbreekbare6
889,545,027 *5C8ED8318098CF1CA2E30DA3BB7F1670E67E994C ONTO4ALL
889,545,028 *5C8C261B620CD7E60BAB0121790754514AC0973E (o_-)o~<#3
889,545,029 *5C89644DBD6662EAE0E8695BF82241128AB70F94 OSCARAMELA
889,545,030 *5C8B86DB4E270742A7D826D491B11326182B3E5D REYNALDORAVENHORST
889,545,031 *5C887A467EBA6F1CD39FB98A4AC82169F50A3527 OU7SE771EMEN7
889,545,032 *5C8F40D50377170A28335FA603B64A4CA5144DD9 ousamil
889,545,033 *5C81E83D6DAE3A6BB70B09B967A3DB1A7B5A6D65 owong
889,545,034 *5C8D00F21716675B7F7CADFCD7DAF0C43B6BD758 pa32000007
889,545,035 *5C8951D393C72A9089778F7713BA7760A4A65B4D paco4otspa0pkqsndlqskhscjunn2jvn
889,545,036 *5C8F32C809A644F41C14AE52AA52580531F01D67 parity bit
889,545,037 *5C8F6ABC998477003D70D43986FAC199DFE6C313 rodrigogresco
889,545,038 *5C83927361036188A39D32F44F0689881F9B2A92 ROJELINM
889,545,039 *5C890361DB3D02C6D4E8ADE81046A835D242A633 ROMEOMARCHENA
889,545,040 *5C81DEED0445642D513A1E19CBAA468ACCAA0456 payyanur-pulingome
889,545,041 *5C85FA31BF3E5918A3DE09F9A658B0DC47A72AD6 roscoegiefer
889,545,042 *5C865511D0989C4B5ADB20194B99724142A648F9 [email protected]
889,545,043 *5C819C7C5ADB10331978FC61A1D82DE10DEC3AD4 peopleversusanimal
889,545,044 *5C85D04B109534844A302FEBDC4422890BBF8AC1 [email protected]
889,545,045 *5C85E25C71C455667B03E93494CB46FE61786B37 percolate03
889,545,046 *5C8A71888A37397C07CC8F388975C9F857B9DC60 PGNABB
889,545,047 *5C8A48AB51308AF876A1920CFD0D0C394B64BFE4 RUGBYROYAL3
889,545,048 *5C82C62ECB78F1C1412F639FFC284F23A1099DFB rupertprzybycien
889,545,049 *5C8D959E8003E3D7C95B514CD60C144DB42D1FEA RUSSEL.SAWCZYSZYN
889,545,050 *5C84449C35BE31A43EC119E3CDB9EF01B400D5D1 RUSTYCARSANDLONELYBARS
889,545,051 *5C8C5D0845D197EEB29C89CDFCBD38EA890E6CB4 pied-de-biche
889,545,052 *5C8132E754DCB4AE8FBDBA176D606DE6FB9CF144 PLANTONADA
889,545,053 *5C872844CAB9B7F0E5F301347170D9984915876D POIKASRUOKANA
889,545,054 *5C811E3FED3A27EF481FF69CBD0A066D6DC5F49D SAMOVOJSKA
889,545,055 *5C83CA4686E7F9EAAEFD694037B1A9DB7209EED2 POLYBIUSING
889,545,056 *5C8B3A1FB749F627D93D6755111A1D1F6EE6FBC9 sannens5
889,545,057 *5C8ABB94CE9A4D01B7B1A61FE9223C9BB1882146 preachers end
889,545,058 *5C8D7D23C861C8F1823FEB0FEECD611D0558C583 PREVENTION.1PRIOR
889,545,059 *5C8F2A1DA61E0E035C60B55CB688A4516D3EF005 PRINCE.HENRY WILT.THOU.ROB.THIS.LEATHERN.JERKIN,.CRYSTAL-BUTTON,
889,545,060 *5C835CD57CEE0525A5A4415130BEDD6F19A6043C problematiseres?
889,545,061 *5C85236CFDCA9CF996CD53864E36117653A2FBBE SCITANIM0
889,545,062 *5C84D726B5282C712355734F6D07A23BF1F14A53 SCOLECIA2
889,545,063 *5C8144530995BAB97AD5CCE414518287FC260FA9 [email protected]
889,545,064 *5C8EB141C0C486CB3F495D4BD7E534CBE99DCCCD PROGG-HITS-(DISC-1)
889,545,065 *5C8A6AA3F29FDBB4C8072F8830705E6E098A2BB5 SCUZ9
889,545,066 *5C800A6B8FF3FAD0A8AFF5AEA1BDC138C6F86F9E s{d2
889,545,067 *5C872A7D19023BE117363F2350D400558B9DF03F Second-Capulet ------------------By'r-lady,-thirty-years.
889,545,068 *5C891CCF223E0379DF6C183A315537CB77FB6017 SEITACUDE5
889,545,069 *5C86E063028112EA5AB0D004A0718869768E206C SEMANTICSAWARE
889,545,070 *5C82449B7CFDC8836ADD87990B6781F11622CD4E q->~0Splat
889,545,071 *5C868840EE0262BCE09CC728DAC802A6ECB4B4F6 SESAENPA
889,545,072 *5C84A748223A0E904FB2A7CAEA9B5E72B6F2DB44 SETHBRADSHAW
889,545,073 *5C83BD0446B128DAA5636C3FE187C52081D2FB24 [email protected]
889,545,074 *5C8ADB95106395DB313DC3D02F4FFA425D4B54C5 sewages
889,545,075 *5C8CB43CA6B2A767F10613E748A594F85DE594FC SHADPROSPER
889,545,076 *5C8B20DC3CCFAE106F6045C6AF3CEFF4143DC62D SHANE.HAIFA
889,545,077 *5C8D68DA67BFCFEA7DCAA0285C528BC117793046 Q#)* * *SPLAT
889,545,078 *5C898C314DFCE8C73086DB5654725C142F7C731E [email protected]
889,545,079 *5C8E4DFC23C16BE9787B023AA6E0A991DDC4CD83 QUINCES
889,545,080 *5C82066EE3E89FD09279B22C7A2CCCEA6C87C34B shelbyjanocha
889,545,081 *5C877807751E93D784F8F5BE0622AD19B66BEFC1 SHIFTING
889,545,082 *5C83EED23DD1A146F106E989959A820C5FCF0CB6 shr!ller
889,545,083 *5C8292A8A541BF9944DDBE9072DB6D185539877D SIARAPME5
889,545,084 *5C86CD71DBF3CF53495EB84378AFC46241AE5AD7 RALLARVEGSLØPET
889,545,085 *5C84426AE2F476DD47DB12CA2AABBE42C1FB91B5 SIDNEY.AUDREY
889,545,086 *5C8617C916B420F98C5123F650A348140D854CCC SIMON.VOLKOV
889,545,087 *5C83BD06B296F4415E35C762DB3EA77BF2265F25 [email protected]
889,545,088 *5C84090221E98D4BA87AC7FB86C2B8E10897CE71 SIRYOBUN7
889,545,089 *5C842C5FE592417FA72DAB179E0BA2377A9A0070 SKINNYMAVERICK8
889,545,090 *5C83FB41C46FD55988003CA11422C66338DCFF99 SLAGERSMES7
889,545,091 *5C84C179549C17E74638CF21BE0502DD50C5245D REGNOMPI5
889,545,092 *5C89553512E0D3F0861C23D2431A20DD641E981B snickerfootbal
889,545,093 *5C838AD73D23078644420A6FF57204BDCA9C949C RENDOHLS
889,545,094 *5C84019547A5A14EF88967E2D176238472E35566 [email protected]
889,545,095 *5C8B16A9796A21505C124C79D90C515E2860B091 SOURSAP-DISEASE
889,545,096 *5C8A6C6E55084F2FAD1C37A8D7515C761C4C5F4A REYNGOLD8
889,545,097 *5C8ABC38AC3D07B3EE8CC7E59FBC3590AEB63846 RHEA WADE
889,545,098 *5C8FED8A0395023F425BE83323A3B689E9D52410 rhpphrd4
889,545,099 *5C887E42B35CB94AE0F27B2B58BBBA52DA4B2B0B spitwild
889,545,100 *5C865E65CB0C75A7D379647E020E103211C38280 RICARDOFISETTE
889,545,101 *5C85A7CD3F5C5B95FADD7375C5537A62EE577148 SPLAT!*<-----3
889,545,102 *5C8780992BAB83161DB1AE7ECEF9828A248A6DAA richardtamargo
889,545,103 *5C8B7CE8B2FAEA947A33F9C1368A607B692E57DC SPOOKYMARIAH
889,545,104 *5C86D2B8620C2E7D86F83BD74DD836F4DE4A5ED7 SPREG1AND0
889,545,105 *5C8B9726DABB5F02BA603704FA4613B1E377B1E7 SPRINGFISHING
889,545,106 *5C8D7339C053704B9884931D747A1886BB9EDE63 SRESIARPPAER
889,545,107 *5C86AE4599AD8544C427C1664CDE9E38FF61BE55 ROBERTALOISI
889,545,108 *5C8395926906759139C418933C7C0BB728D1B61C robertobreithaupt
889,545,109 *5C831AA09C4A9CD8DEF062AF479F88C8EACDBD1B STACY.COIN
889,545,110 *5C884C715B8BB88FEBB338BB01554F80A414487D stanfordsarmiento
889,545,111 *5C8B0C43715BEBF6A094120EF0048F5C310F0919 ROCK.LIZZYSAMA
889,545,112 *5C830702DDD52FB8E5F93BFE557A4094CDE100A9 staticed7
889,545,113 *5C8386D8CC69C193CDD036B860FE638F5358CA24 RODRIGUESINDODO
889,545,114 *5C88B6DBE3D56821F6BF148943BFA142DCEE90F0 rolandcalcutt
889,545,115 *5C80E26ECCDCD306F4EC5971B5CCC40D34E72E83 STEPHANY597
889,545,116 *5C8CBF8A2E58CF9CD56504A8DB69624358DCE233 stephen-tetley
889,545,117 *5C83982A89F341B09B0829E8E9DE0AF80131D148 ronlac
889,545,118 *5C8349A9B56C163272AF2A34B390452FB40A78F7 STJGARANTEDIREITOSDECASALGAYEMPREVIDENCIAPRIVADA
889,545,119 *5C856AE6133529F22A583B20C6D5DEDCE35F50CB stortingspresidentenes
889,545,120 *5C8FDD0CE84AA60FA706654FB8694488AFD0B1CB subvocalization
889,545,121 *5C8742950EC1BF5084F38690B87DC54DABBFBFAB rudy358
889,545,122 *5C8817551E60D7FA111020738A59514886642463 russellcartmill
889,545,123 *5C890B182890A17A540B4811FEF92B966C6D7C46 RUVALCAVA
889,545,124 *5C86859D30019D7A04D0025E5B24ACC3B6609840 RYYS
889,545,125 *5C8884A8508BBB046C35F0F962548D9C295D01DB SUSJRUTA
889,545,126 *5C8FC90147A1C364FF195969BE570CA7423D4D75 SVITAVATES
889,545,127 *5C856A811B4CE087FDD80F740E25FD2109C51321 SYANGSS
889,545,128 *5C8ED70D29CAF64054FEB0330A497928F9FD0AC5 sydneydersch
889,545,129 *5C82CBF87B5CB8DEC4DAA527A7780AB81BD24860 salatschleuder
889,545,130 *5C889EBFA9BE8C8597FC77282569522465669B7C SZENTESG
889,545,131 *5C8937C4E2193B3957F77B038F58AAFD0FDF7F03 SAMAISENA4
889,545,132 *5C8D025468E1194E124F746FD4DDE5A254F95E12 SZUESER
889,545,133 *5C86C5F31A14C6C24CE1E346F9BBC13194D4D6B2 T4?-
889,545,134 *5C89CBADF92551CBA5C7A6E5B556C7CD9E50DC6F SAMMYISABELLE
889,545,135 *5C8B5ADC179EC663887FF104C7ECAE1F5A1496FD tadsuper
889,545,136 *5C8AE604EEF61A003BC3F731506318CA8EA21CC3 tåglånet
889,545,137 *5C894302C7049C38C97ECF7473ADC44545C3EE23 tammy-reich
889,545,138 *5C88FBCEC42BC138019500EFF9E5A7ACCDC9D0F6 SAULFEDEL
889,545,139 *5C8F7AEB6B892D146EDEF53A9FC0B85172A2FD65 TANYFMTN75
889,545,140 *5C8E412EBB85EE2DD76F5F7FEB66ABCBBDAB90C4 TARYNKENT
889,545,141 *5C8AA7F3FDDF67A6D4BE981B36AE89CE4BA1DA2B SCHLLGNS
889,545,142 *5C87FE58096727964CE7E451D3EC53C09891B4AC TEACHYNGE2
889,545,143 *5C8AF05A38EB9332A4E45AD2F34F26E34EB72736 SCOTTALANSMITH
889,545,144 *5C88E699743D76C8EF7E7FEF2A966EA686980126 SCOTTY.CORBEIL
889,545,145 *5C8523290137BEA52E5BCF01C972F3B6440DF762 TEMPORALLYCOMPRESSE
889,545,146 *5C8953A93EE0C88997931902F30FE6C1CDFEE5E7 TENNESSEETRINITY
889,545,147 *5C87A0EA26FCC97BE4D2BC0A4084DFDB6EBC6220 Ten Preludes for Solo Cello: IV Ricochet
889,545,148 *5C89FB98059E1AA42498A881BEE12B6CA4C816DF SDDAVIS
889,545,149 *5C80A62DD32EAC651194FBEE1FDB95BE4869D69D teruggevlogen
889,545,150 *5C8E39F0CC1CCA07CA08DFFE23D2EA62154221BB THATPRECIOUS30
889,545,151 *5C887040395F7B6889C6C7D22151A2180345E6A9 the.complete.recordings.19291941.(disc.3)
889,545,152 *5C820C2F8671DCD47544665523824323D60BBE29 the-condition-of-muzak
889,545,153 *5C8CDBC6F94D68A35923FE1257B46DD9285A7649 THE FINAL DAT, PART I
889,545,154 *5C80BFD38A0EC9353070F9235903ECD12767CC19 SEX,SPRITOCHMARSCHMUSIK
889,545,155 *5C81DC2E8A80B4FDED8BB74717753CE17EBA0306 THENGUYEN777
889,545,156 *5C821B7698AEE22EC1B50FC71940008C35A199AD SHADOWSOLIVIERING
889,545,157 *5C8AED0F9A7A63090ECC6E9FE1E1225B2CFCB734 theosizelove
889,545,158 *5C8465C60EF42961E3C785C1806EB8CC73CAC72D THEOSTROLL
889,545,159 *5C8B87A570A55439F6F9A4999858092F12490A4C shake what ya got (feat. c-los, black tank & pop)
889,545,160 *5C84F63730C871AF02D32B7B6E76B28271A9A98F shawnderouin
889,545,161 *5C84A6FE70D079D0479D095944B6D97C70CABC16 sheldene
889,545,162 *5C87880BFA0FCFA18E66F33F982BADB84EAD7BD2 shelterwood
889,545,163 *5C80F0E3888D9FA4D8B68B10F516E9EC054D1885 [email protected]
889,545,164 *5C86ECAF48E6D73359CD8B96FD9D25E9647C3079 TICO
889,545,165 *5C8AC5DB893FAAB0DD0FA597856704818AAE1B85 tinunkolo
889,545,166 *5C8C6A6C48F73D6DDC957E0E2D7FCA9F94E73350 SIDENBSW9
889,545,167 *5C88708F0F688B84A8258E38DA77665D7104DBD9 SID.MILSON
889,545,168 *5C8C67F629D84EA95A104C680ED8DE44082DA3EF TITUS.KRAWITZ
889,545,169 *5C8A6A7DE5BB386D3AF439AFE83E5491AC721B47 TLAFEHR
889,545,170 *5C84FD44A781909C7D2242FB32950A82A57AC3EE SIMBABULLDOG0
889,545,171 *5C89ABE9440806D661C7B443824808316B30303C Si-Quieren-Saber-Como-Vivimos
889,545,172 *5C85AAD9886A925ADFA36343BC6C4C2EA3A4E36A TODD.ALFORD
889,545,173 *5C8A95CCBE2EC07862D822C41F29338AFC960AED TODDGERKIN
889,545,174 *5C886ED551B7FE28E92C5B8E009099D7B994433F toddguetierrez
889,545,175 *5C8B37B2E7E30861ADCD1AE3062B7337DD3A15B7 toimintaan
889,545,176 *5C83D644DA2322110465C1AACD2277421ECB2731 TOMSOETAERT
889,545,177 *5C8D9838A4A01B4D5BC23C2B948D96C7DB9E9667 SKÓGARLUNDIR
889,545,178 *5C83FB951A4DEC824A3BFF51C6A85FAA2E3B6AB9 TONEYVOJTKO
889,545,179 *5C8C8CD132BE835CF978ADD1A47BE3CF174EB4B7 SLAMTUTE1
889,545,180 *5C8D5397FBD768923A421586C32D40785A504A68 toredneb
889,545,181 *5C84923939E66C398F6462F41D6E83EDC033111E TPEETOR
889,545,182 *5C806B6B8946607663161DE013D95B63D09ACEB7 tracy.reinsch
889,545,183 *5C8851D9C28E99E4AED2DE8221D7877017438D46 SNORTOIB8
889,545,184 *5C80ED76D0E49A581DAFC129C200BB6C7A150628 SOBERIZE
889,545,185 *5C8F509D3886D230136E37F6970A445F0F2E8799 SOCITRA0
889,545,186 *5C85CB65C18919F5EE23E1DF7212BDCB1A74CD73 TREEMOGOODIE
889,545,187 *5C80D4E935938197C6D1DE213898D1FC4E873D6A sohali
889,545,188 *5C83CC5F0AE14F17FB8EDBE6A0DA71ACD4C5F7C8 solemon.niazi
889,545,189 *5C82568D9D11FBE049E1ABF7A34A718141645774 SOL_GISELLE_SANCHEZ
889,545,190 *5C829DA2FC73D0AD10B719157433469DD22A9794 trike.flyer
889,545,191 *5C80246D9A97FAE91CE37637B012C834343825A5 SONGS OF THE SKY
889,545,192 *5C893C1EA84806A1F44E64B5EA27083787154205 sonia-moreno
889,545,193 *5C89D9D24089D8EB513D7299CBD3857FA1B1EDB9 TRIPLASIOSES
889,545,194 *5C81F6DE91AC7C9229CAE68B670600929F31897C TRUDYHAM
889,545,195 *5C80A4FED2A6AE0B1BE78578CB12F1509F281E86 TSTIREGFA3
889,545,196 *5C8AE196845FD8122B8B3DE4CBD5A414E050CFB4 tsuitai
889,545,197 *5C8EF8CFC24B1311CCA45A9FE676B2794F0E600E TUDO-AO-MESMO-TEMPO-AGORA
889,545,198 *5C8AD50D5DECA41289F678FDE2F1EC3C6D94A453 splat~-(====8
889,545,199 *5C87BB10E84AB24923B3CB33DE69EDB659F69624 SPURRITESP/[@]/R/AI/T
889,545,200 *5C813EC69D1B38F2594561FE4A7AF5C8D2F03021 SQUAREVILLE
889,545,201 *5C8B208168C16AE1B3B021EA461C91F35A9DEF1A SRHTAA
889,545,202 *5C8F3E8F11E19CDF2E7AF281DD70B437FC7D42C1 UBMETNAM4
889,545,203 *5C808CB2A5DB57048A49712D3DDC8D5AADBCEB95 [email protected]
889,545,204 *5C83173E83DC770AD65438A7F229F0D0F79061D9 [email protected]
889,545,205 *5C85E3B6EB5B408AA16099B954EE1AB9601F089C uitstrange
889,545,206 *5C892549150BE0ACE0A5BDF4D22E38F6BC5ADAA3 STATION01
889,545,207 *5C878265784420F69942AB9DE6F0EC3D70DB4A76 sterlingeschette
889,545,208 *5C8FCE011E327ED7A9BED4EEEDCFB5D046A67D7D STERLING.MARINKOVIC
889,545,209 *5C8096DE6B53CACFE352AD5DDA223D5BC201AAA5 STEVIEKUKAUSKAS
889,545,210 *5C84604403E31CDF5FDE6CE7882FE5DD73038E6E STIHOVNI7
889,545,211 *5C89E12062D9E7A95A08EEDC7A45DAE684DFA4BD UNINCORPO
889,545,212 *5C8B86364A62415976928DB9A6595E18C2FFFB4A STRAIGHTFORWARDNESSNING
889,545,213 *5C821537206A2F68CE7CA13041A0FE9488CBBFA2 SUB0V3RS3
889,545,214 *5C84E0BC0BE34DCE355E46D424E61683A0E79E4E USDOLLAR5
889,545,215 *5C86998EEDEC1A2395783CD639011A01D5EA7974 ushir.sookdew
889,545,216 *5C8F6FE5DFE272077997A216CA72DA577B33C101 UTOPIQUES6
889,545,217 *5C8DC68FE77EE8EFA043DD3FB73198C3F5673C8A SWOLWAN8
889,545,218 *5C8E57818FEA0CC5C47313393EE215BBEDD9583B sylhetter
889,545,219 *5C8E70F61D083EA00FC80BDD3AE7256AC3E281EE VANGROM
889,545,220 *5C80E434239346E5D9AC0F79F4C053606A9E6AFE VANNARY SIM
889,545,221 *5C8B5F6F493D02FFF640E8E05660F287DEF7CC2A VARGASEMILY
889,545,222 *5C8E23F9EB33726C7024B26919F6541165351761 SYNOIKOYNTES
889,545,223 *5C8EE844AEA54562ED91A7ABE014EFA613858E93 vasso.asprouda
889,545,224 *5C8C310F9F26F8C3FCAA3D9C916E8CC9CA39A5E6 Sセレクション以外にディーラーオプションのアルティア製エアロフォルムバンパー等装着車を設定。
889,545,225 *5C8C4D7D6B60D90BD921B1658F75E203FB5308D6 veerendrakhangar
889,545,226 *5C8A9DDEC73F1A96FC374BE6AEE47DEB9A27C3F1 T57089
889,545,227 *5C89C21A2B1B36B5AFE4FD80A9B0997034FF4757 VERGANKLIKHEID2
889,545,228 *5C8257C52F873932EDF73A30EE86AD6EF029A5D7 takinglindamcmahonseriously
889,545,229 *5C85507A52329C057EAC37524DB4553F95615CD4 vesayetin
889,545,230 *5C8055D70CEC4B95902E5952843958075897D26C VICENTE.COVA
889,545,231 *5C88F1AAC6E160CF7D0D9EA18FEA4C63AC4BB262 vicentio7
889,545,232 *5C8B58DB40AB89BF35DB5A5C33DE442432406D41 [email protected]
889,545,233 *5C8C6BA5D6C847E544CB63F2E802BFF8655BED78 tan-yih
889,545,234 *5C8FCD219C28AC57EB6C688A274127C8F17C8D7A viera.fabikova
889,545,235 *5C8AE7D6C1E2326204E170BBBA8B736A789C2673 tarynwolf
889,545,236 *5C8852674132AB3C346805EE34F28FC1C76524C5 vinson-reyes
889,545,237 *5C8F8058E759B003E28CDCB2AFCC58192FD7313B TELEFONABONNEMENTER4
889,545,238 *5C87593DAB5DF9B2B0EB9D1644FC26498265CD7A VISITIER
889,545,239 *5C8CE903E654D3C655013F6D0547EB90D9E5E7C3 VLADIMIR-GRASCHENKO
889,545,240 *5C891739F08FF6207A47EF49CA21EBB53EDD51EB teratosc0
889,545,241 *5C8040F296452639E0718A48FAA6B8B3A074F2B6 TERRYLAZENBY
889,545,242 *5C8C4A99C300540A806BB0E8A03F5BEF0D2B3C05 .text:080508b4
889,545,243 *5C8511E5B208FD316B3C94E2895673355D3B91D5 VOX的CDMA網路版本,雙鍵盤設計,隱藏有側滑動式QWERTY全鍵盤,2007年6月於北美首度發表。客製版本HTC
889,545,244 *5C8745E74E424BE34DF62BFFFB86A05F09A59947 VRBRDNGSKLSS7
889,545,245 *5C8F8DC511F11B654B21DCFAF46637375A5D344B [email protected]
889,545,246 *5C8E289BC83BB5B8A6547C82EE92F092862F7236 VROEGBEURTEN
889,545,247 *5C83365A1CD88611F0B5FF3DEF7FEBD2780EFB52 VYZNAMNEJSIMI8
889,545,248 *5C8CEC6FBC840AE4B63BCF6D5BAB512ED5BEE341 wabo-monyatsi
889,545,249 *5C8C8727C3E0D26A22C964FDF56550EDAB872897 WADOSTY SNR
889,545,250 *5C8A6CD9DB4505D81046F8A1838BF25313256A7D THEDOLLFACEDAMESCOM
889,545,251 *5C8536B4B3A0685F1F640B8C8F858EEDACDF89A3 WALKER.FULENA
889,545,252 *5C807E6FB1679C6D45399BF096C3E1D5D9DEA86C WALTER-EVERT-TROUT
889,545,253 *5C8ACFA17138330D47A4546263CD6AB2E2B2F4A1 WANJALAANNETTE
889,545,254 *5C887460C734D654A56A6353530A6AEF699CED9C WĀQWĀQ
889,545,255 *5C85C2C734D4FEA27CAB1123431EC59079ED7A7B war!war!war!
889,545,256 *5C8629B01C16C83E7F272894495BED6A9CB55CC1 THIDERR0
889,545,257 *5C8BDE137856E87213DB9F830D16ACD62481AEBB watsoncamera
889,545,258 *5C88268A5035B7C3C2BF9CF89C9EE046F81114F5 [email protected]
889,545,259 *5C849F76CD5739866024974B22AF96DFB506FFD3 TIEIEMA0
889,545,260 *5C8CD81F5A4F93431860C981407D6D679B0005D3 TIGREGREG
889,545,261 *5C80867ACCEBF59E85BBD22A3E6D23A47560EFB2 TINA-COMPTON
889,545,262 *5C8E92E02A392BDE53DA82C75E30F933AAC32E3F TINA-SCHROYER
889,545,263 *5C8BC5D10F321A2D4B3F96089C025A1ED3F35DC6 [email protected]
889,545,264 *5C8C6C5E942E742EA135BB5846966D89382384BD [email protected]
889,545,265 *5C89B64F1695E21BAA9CD27A9AF835D3D067D687 TLIGER
889,545,266 *5C8D1F5A2A35BBAB0A0F11286FD7B22C3633D682 wesleyarrambide
889,545,267 *5C813E20B3230096C0C86D3922AF34B499D5C056 TNANGISNED
889,545,268 *5C88B08505845C80C50C18463597E9D4D4D4339E whathaveidonetodeservethis(featdustyspringfield)
889,545,269 *5C8CC653AA9326FBFB17CF5153FF5E5BE8DD5696 WHAT.THE.FUCK.(FEAT..AKINEYLE)
889,545,270 *5C8140DD1A73D5684AA4499A2706F963E1025D87 whither i invite you. look
889,545,271 *5C84117006CD86918DCEB3A9E98C3CF3CAFDB7EC Tolikv
889,545,272 *5C8B379D13219590A8E05AC26433E47B93DA4434 wikiprivacy
889,545,273 *5C837E985F938419B193702F3D694E54104931C9 WILFORD.WOLMA
889,545,274 *5C8A3B9EDA7AD837780E8B73D62FD52F41345722 tortulous
889,545,275 *5C8BCBFAD3E3D47858741F89F31A44687AEDA369 totita87
889,545,276 *5C8489DF8B335B3CB8287F48270D3DBC19D814A3 TRACY.THOMAS.JOYNER
889,545,277 *5C800A7E89FE70DB8FDDC541FF2AD79B6274FDC3 TRADUCIBLE5
889,545,278 *5C86A5F315321BFEEF4DF24EB7BD01DA439C3842 wilsonkrystek
889,545,279 *5C848C1A3062998D7274917B97C952F1A6E57EA3 TRIFFER
889,545,280 *5C8684622A66BD04E84B5C3A933C98BCF8F3044B wombatjsbach
889,545,281 *5C8B740C4212189D1CE52B4F63235B1C47F46DAB woodrowtravaglio
889,545,282 *5C83E0E7734BE07A0733C1A68519EC362ECF8CFD tristankoolbeanschahley
889,545,283 *5C823744FB90CD7BDE20D084632596304B6F4E9B [email protected]
889,545,284 *5C800EF174E0F0C323FF252522D6F47E2E4ECF23 troykersh
889,545,285 *5C82C6BAD41106D8E5F45E4DDAB7435E5B8B6FAC [email protected]
889,545,286 *5C8D55A10B39AB4801A72FC9ACA36F7578B466D0 WUXUKANG
889,545,287 *5C8BA63CB17952B98B34180890AEF997782FF5D1 ttekcupswodahs
889,545,288 *5C857B31B975FF446DDC0557171937399CDDFE6F TUDOR.KLU
889,545,289 *5C87239FAF3739EFD4DA0E1FADFDAB0731DF6F48 WWWREAL-CIDERCOUK
889,545,290 *5C817AB07107A576748231226E541AD99BAA39B8 WWWSCHWEIGHOFENDE
889,545,291 *5C8C0DCFF44577684D53B878BB4A0D24F2ABAA32 TURBOGUY6
889,545,292 *5C85778F1CBBDA3228DE1C9BE5D6612FDB14FFAA turning-the-tides
889,545,293 *5C8D37C90771DD5F2E7DD1A8A9908C107D1BA8B1 wzup(featksk)
889,545,294 *5C80FDE60414BD9DC183980CB871FBA6B2695A85 TYLERCOMMINGS
889,545,295 *5C88742AD820E8E0EEFDA6D463D78020751EF1F3 )X(-~<#####B
889,545,296 *5C855F6E75796D41ECE09580DC41979567419BB1 TYRELLDECKMAN
889,545,297 *5C83F161A95E1920C37517C8FF6D7A40DA0E5675 [email protected]
889,545,298 *5C819DE244C1A9A3C7A03F4604C2E5641DEEC7C8 $UBMNA7URZE
889,545,299 *5C818B79DE0DCDEDAAAEBBA375F830F49940BD60 [email protected]
889,545,300 *5C8E1AA7ED88C07E083FE3B1EC1F4D9CCA9E180A X_IS
889,545,301 *5C81AE35E522838829D516C7A07E591200A81629 xtvidz
889,545,302 *5C830401B27ECFFDA59F0FDD3CB308418F069524 UMAR JAVED KHAN
889,545,303 *5C8476DCC8AEE722780EE570846F82986418D428 YAGYATVAM5
889,545,304 *5C861B5E1DF8296CD490594A9E492FC382E27C73 ungraspi3
889,545,305 *5C81CD06F3D2956014335B2F9D00E1AFF0BF7E45 YANINAPENA
889,545,306 *5C80FA649EE5A7FAD62871C64E1941C3DE73571E UNTERRACED
889,545,307 *5C8BC23102234BE575ED2D0E0DF66B236E991D09 YECTEN
889,545,308 *5C85BCD77F1EC3E065B006F715FE424902DB1109 YHORNET1
889,545,309 *5C81729D69CC8AC8239F90405E1C78D2D28355B5 UTNEVNEL8
889,545,310 *5C8858E7E3D019DA6FCABC16C5F7E0872296A091 Ymasanayaran-1
889,545,311 *5C8AA9E185174F4009A648259AE146027091DD5F YOUNG TAZ THA REALIST
889,545,312 *5C81F39A1713058E8DE28ADC9F2E4B811DE3476F VALERIE.MORRILL.SHEPHERD
889,545,313 *5C8DD1E33583BE89962CAA6E4542729D5DA95E89 VAL.LOMBERA
889,545,314 *5C89D946823697CB2DF46F09957A9D11AF20B69F YS,J
889,545,315 *5C858FA248622A0564CA13A9ECAA0D3D912619F0 VANCE.ESSIX
889,545,316 *5C88E66AAE211C09350022A361EFFCCF303C3A14 vastmaakte3
889,545,317 *5C87F287CB990BCD0BF40C702FDAFAC72FD0D8EB ZACHARIAHELDRIGE
889,545,318 *5C8347D69D06EE9FA8E6A4D407A0EBEC30F70A08 [email protected]
889,545,319 *5C87933063EE4A2EA36010D180AF4748E552C2A5 VERGEGENWAERTIGTEN0
889,545,320 *5C8288DE633E876B5273924F500DF5FB747F1D8B ZAKARIAP
889,545,321 *5C87EEA0828C56A44486B8F9B588BE3A4CA99147 [email protected]
889,545,322 *5C830251FF00D20B4D2C3FA9F98E2DF2BACC5FBE VICTOR.H.TANG
889,545,323 *5C84FD940FE27AA927BA77AB05D06AF3153461A5 victoryaalexamdrovna
889,545,324 *5C8B254983F6E4BE39AB4D0D080097FB1A47524D VIKARBUREAU1
889,545,325 *5C8945D5B50137682D8B874F2FAC1B0D3682B469 [email protected]
889,545,326 *5C826D6ACEDF0A41B063E3E00372060802C02A23 ZNACZACYCH
889,545,327 *5C826AEA0561FC507294E09C5B4E435BED94A991 ZUEIGNEND2
889,545,328 *5C8DA7A3C3306B5BF50237AD10C2C95B2A1E8F65 ZUHAL-AKYOL
889,545,329 *5C8BAE386BAF22DB36E4ED2D84DFFBA297FCB7C6 zulagenberechtigten
889,545,330 *5C879412B00BA7E16A0B6B4B3B64C422059B5735 σύνελθε
889,545,331 *5C853560589B5E9E7F33A66446E898EEC9E433AD баран —
889,545,332 *5C8BA6BF78650AC3C4F011E4C10E1E53B8829FD2 WALLACE.MILARDO
889,545,333 *5C8AC34CE4525E8DAEB89223FB3E57BEF5D605DA ЗАЩУРАЙКИ
889,545,334 *5C88563AD5F76B2910D9C8CB917258946D9ED1D8 лазнє
889,545,335 *5C887CACBD6741FDB4EBD72BA66B650D4999E37B ПОЗИВАЊЕ
889,545,336 *5C8837A7D4760CAF02B25E61C86C3C5D9526F230 ПОСТІЙНІХ
889,545,337 *5C86D8E89815780CF4A157072409EE0EC230D868 we are marching on to glory
889,545,338 *5C875F3D91593939032138B66543AD437F80A8C4 РАСНАХМЕ
889,545,339 *5C8346DF56B47817EEFEF44C88B3D116EE308AAF скінчену
889,545,340 *5C8B5658517D643FC34985F75BFF1F995273243D WENDY-VILLANO-MAZZA
889,545,341 *5C8DD2C53DE4E53F9AED88847B67F3BAA5E67050 [email protected]
889,545,342 *5C83E53F27491DCB92C24A0B80386B21263FCFC7 [email protected]
889,545,343 *5C80C9FE06FC447D78E5AF451121BF255F2E6E67 [email protected]
889,545,344 *5C82C7093FDD63650F2E0BADFAB71B0C815B8F45 эссиорхом
889,545,345 *5C86ADEADDE98BF4EA13DAE260F3A941D5DB8A25 WESSUKOSKY
889,545,346 *5C806B09021D29F2AB1328E8BFE79808966D877D whenmymorningcomesaround
889,545,347 *5C83A7B2752F586636051417621A8FBD44E6A92F 戦国歴史研究会『直江兼続-知勇兼備の愛武将』(戦国闘将伝)PHP研究所 2008年6月発行。ISBN
889,545,348 *5C818DB4DA50969C44638689DDCB3BAA450E6A39 WYUSZRI
889,545,349 *5C8590B65A95E5A05F18A4DBE87CE1201FDD82C8 xbsazcejk
889,545,350 *5C8B681D845F13B524D9A718DCA0A5B8D0610FB8 XDEMXSUBN19ZN
889,545,351 *5C883BD9FDAFCA4AB7DFED231EEE427D6C6DC5EE XHACHFM
889,545,352 *5C8B64C539844D2D55C88B130377015D7981AF83 [email protected]
889,545,353 *5C84A931D7F1B5CE78EF823B744427061580E649 [email protected]
889,545,354 *5C8E748D9A1A2BFADBCCAD34D8B9A7D93C3195C4 XPIU
889,545,355 *5C810ACB33DBC20A69B02224E89EF9927BA6E2A9 Y149034
889,545,356 *5C8AD02EA57F1B46649F96ED4D1C08AA34D532C9 YAFFAJASKOLL
889,545,357 *5C8FF8AB71CE3723BDA945093DE88DDD22DB6914 [email protected]
889,545,358 *5C8D42685A8A23D62AE2512126BC48777F4AF456 ybeshysmithsons
889,545,359 *5C885582E80EEC9F0402797C8EFC4E556D2A18C1 yokikzlagdameo
889,545,360 *5C827D948278B48D39ED4CF18B0A1F70111D253F SACORROS
889,545,361 *5C86240C80112C4228D0AC3EC9BCCDBF6706B035 YOVONNDA
889,545,362 *5C8FA7EE8957819AB076A507796E431CA039AADB scottcumba
889,545,363 *5C86894ECD321F2B6DECE370C56BDA97F3630AFD SOLKOPCZYK
889,545,364 *5C8078AAA966AD8213174B2031D538719830DD54 some.urban.myths
889,545,365 *5C84AC66691FD37BCEA875FE75A2758295597567 SONIA-EDWORTHY
889,545,366 *5C85F11D9BBBF28990FB707D35F250D8DD7A5769 SPELLOFNERVES!
889,545,367 *5C8ABE45E16ED6CDC6C4C643F76D5CE43F131131 ZANE.TONIC
889,545,368 *5C8E1414FCF90ECF30A9859F06FA628AE8E7C7A6 ZANGIEF8
889,545,369 *5C84C44EDA7D50F23B896510F3E9B6D7A94F158D STEVE.RITT
889,545,370 *5C81A268CE2F8D73552E04E48881D47639851BAA ZEPHYRCREATIVE
889,545,371 *5C834685C26515BF8DEAC58976C7ADB334D93244 SZÉNIPAR
889,545,372 *5C84B906C87BCC622060D570FB6B76E1E86410AB t`q[
889,545,373 *5C8E57912B3202B5550446B96861252EC4F280FA [email protected]
889,545,374 *5C898DE5DB83EBD9BCD9E4ECCD6C059953BDE7A4 [email protected]
889,545,375 *5C8CE0E516B5CE0CF00008FA79F04978436FC1C1 [email protected]
889,545,376 *5C8C286BFE1D10B7AC36B2850D5B7DBF85832D2F ZLOSTAVLJAHS
889,545,377 *5C8F30E2D5D271B8D6215B276394487610CFD1A9 [email protected]
889,545,378 *5C8226D744BEDE164E2B3A244B9BE2FD51AD2B3B TROCHOMANCY4
889,545,379 *5C89D9C4A424BDE3F8EE2015FD2A29F3B4C21A76 Zve
889,545,380 *5C877905052A6427C2E3AF846418D9CE1FA107E6 VALENTINLEIBE
889,545,381 *5C8E7F6B44C1177790457AC3C48D01158FDC4AD8 VAZQUEZCAMACHO
889,545,382 *5C874E83DEDC518BAE5637F0717EF4326549BD66 РАЗОБОЛОЧЬ
889,545,383 *5C8525878631FD7FA6D72E83A2E0C4714483B165 РОЗМОРЮВАТИСЯ
889,545,384 *5C8B4A7131A380BF233F61FB4AD4E802F688C5F8 ТЕО­РІЯ
889,545,385 *5C861D38A7AC5C1BEBF5C8BE64ECB0C6E6E40640 [email protected]
889,545,386 *5C890C1AAE9F312F0BD19F171EA4D56780D168FB чехословачко
889,545,387 *5C8300D06CEE7ABC128EB4A61F658211FCFCBF37 you16ateshi-baghava
889,545,388 *5C8DEE9EDFCFE5E1BBF467162186E7ED8A6C2E12 you16ateshi-baghava
889,545,389 *5C8CC13D655A5511AF2E46D84AA94E2339C296B1 スタジオ歌唱ではキックのポーズを取る場面があり、PVではサンジが使わなかったボクシングを披露している。
889,545,390 *5C8E9A6910B7A9E348C34921CA312B27A8735B8C 1heights-steinmetz
889,545,391 *5C8B82936AD97B9C77BC79A92DEC72E09D4A3BC6 1589251 virallinen tonttikartta k
889,545,392 *5C8442E4252033B7C72F058F917975C36F43115E 1589251 virallinen tonttikartta k
889,545,393 *5C8914469B6D2BC215E9152643BD80FD160B6FC6 20ducrotay
889,545,394 *5C822FB304E5696111BAFDB43A18575AF5BEF01D 2397192 TUTORTAPAAMISTENJAOHJATUNET
889,545,395 *5C88502971960BA2FD86EDB33572761DE3892D89 2THERASSA
889,545,396 *5C82CF2EE05FE5B98535AA3C31480D57805BE453 3-BURSAS
889,545,397 *5C8874E1ADE24DC1C9B7CABA9A0CC04A3E3D05D4 00065x0086
889,545,398 *5C8A1D79C4BD1465F303866D436058399ED2342B 3douglas
889,545,399 *5C8BC3860949025D33F8DED3C982555CD7794DED (>_0)O~0~D----B
889,545,400 *5C8DDCF0D538E48F509A84309E3AA3BFC435883C 639499 bana5saatboyuncaiSkenceyaptIlar
889,545,401 *5C830A1ECDFBBAA506E71C0E5AA21048F0B22A94 6BSWFACEPLATESBSW
889,545,402 *5C8C38DA525E6C9830BACD2DAA3E70860C678AA2 1155406 MEILLE UHRI VAINAJAIMME VARMASTI SEN VALMISTAA .
889,545,403 *5C8457E2B3E99565511AB0291B0664B6F0226C5B 6ZIGGYPAINTER
889,545,404 *5C8F802F2D7EE65B107514660AE0B0F3D9135519 7conserves
889,545,405 *5C8C8F7E4C78E6434EFF40714CD62DA0952A3705 7NOSREDNEF
889,545,406 *5C88419F85E8AD22302DF288315B564D297412DF 7ROTENDEN
889,545,407 *5C8A6A7D23D7EA2D20D95B0B2B564F87B68D9CBB 13SEAN
889,545,408 *5C8B888F46FA962ACE39CBE6FD562CD88AC1D84F 1725599 sz:bietetantiviren-softwareeinenrundumschutz?
889,545,409 *5C86095BEE06AF52BB61AA366F9D93E2CBC84BF6 18011556
889,545,410 *5C8FCBE4E328E76EE24566623BF140F8F84F4652 9BANTUANE
889,545,411 *5C84F24EDE740470EEA8A8402107C78EE860D672 1914113 versinkt.die.welt.im.wasser.?
889,545,412 *5C830E2AAD2E503309374AD930246AFAC7D62944 9JOKELLUSTA
889,545,413 *5C835BDACF7A1E4BD174B747297A8F5F2E387DB6 9mymother1
889,545,414 *5C876979D5F2EF4AB9B236C93221F494BEBCB60C A1GS$
889,545,415 *5C8DCC46D9894BBC78D04582D94146B6613AA380 assagetes
889,545,416 *5C8566BCF98CF7929810DCD09DACFF0F88AA8E8D 1DNREMMAD
889,545,417 *5C829E305A0081241CE6DE1BF45276F70BBE3474 AYDW5
889,545,418 *5C8AD8C1D58CAECA1C16ABA8086B3BCFF56500E7 1.FERROOXIDANS
889,545,419 *5C8F12E4A15E10FFD2E301F5A0658BFF8CBAA808 1.frightfilm
889,545,420 *5C86EAB2126631E20EE9943B808E4FAFE434A295 AH+CC
889,545,421 *5C88CC1D228F655D2FADAA29E3EA1438A0AED22F 1 HYMYILEV
889,545,422 *5C8D440EE87D7FBBEF0B657077E877007F121765 anilouping
889,545,423 *5C830D3FB51BF078CFC013E7F43CE728BAFBC622 ARK.D
889,545,424 *5C8DF0CBEC835DA5E882342C104D0E0167FF4758 1MYHECTOR2
889,545,425 *5C8D9D4DCA32846B23C1B50AF01F259DFB1BDC00 BAGM=
889,545,426 *5C8CA1E5BF506AA730B110975E9CE2C362F52033 1pawlowmaessig
889,545,427 *5C8C421195026ACFEABD9D2F8506883589783E45 1.pcp-zeitung
889,545,428 *5C8AD4F7D61EC49967F225EC07FA6B65F725B49C 1POSKI-PROJEKTIN
889,545,429 *5C83A450B577FE30AE8733DDF0B26A8B2DD8A9B5 1 PUTKITELINEELL
889,545,430 *5C899F7F9DD17F7B55B2718A24EBFC9D7C451205 1Q2W3E4R56692
889,545,431 *5C825D68B5643B4A0819BE959D0A4A5DB0868DD3 1rehulisille
889,545,432 *5C88FBD63D8B1E09DE3E7AFA98ED895BEEBCFCE4 be/pd
889,545,433 *5C890BF826CB7B366BEE0DAEA8553A7801C4B1BE be/pd
889,545,434 *5C85D5FDA822E4E33263CD89F91657EEDEAFB424 blauwborstjeslaan
889,545,435 *5C84F7F3E4EC520FAE1364501312F752D43D8091 1 TILAPAKKAAMO
889,545,436 *5C85B0AF927FF28008AEAB9BADD1403D2085CA1D 1ustegmenin
889,545,437 *5C8A9B25221B4F24F821EC876AE22C6C7935DBF6 c)+mi
889,545,438 *5C879A0EA0F36475940134772E74CD03A21D1FE6 ci&cf
889,545,439 *5C85FD66DDC5847BAF7CDE1F0CF1D1E2A6C90B1C 2066951 tutkimuksen-suuri-yll
889,545,440 *5C8D790DF22E6A18AC12ABBACCD1B0179E377472 confessori!
889,545,441 *5C8820F67DBBC8C8A2993BC9BE21CD4310423D8E crrk_
889,545,442 *5C825D2B1DE7B112DC774ECC5DA6277AC1987A11 CUTRARO1
889,545,443 *5C8487F464C32535DA6DC4263C2BF9BD3EA98E77 25K3K2
889,545,444 *5C8D150702DDEC5B367CD8D201608A8716AC8607 2607195 ZWISCHENPRESTIGEUNDPLEITEN//GROSSFLUGHAFEN
889,545,445 *5C8D1459CD783F3C983B5A9DD1EDD3786D1AF3E5 2660081 jamesburyn-tuotteilla-on-t
889,545,446 *5C83A211B0E8BB3A7789DB8AF3C7533BB66E9014 D.0H:
889,545,447 *5C82918EF20BE48232198CDA67D010169737D1BD D1FZY
889,545,448 *5C8395AF9BEEAD0F6CED853F5E49363C427F9929 differenzierte7
889,545,449 *5C854754D21963295291592A32D2261143CCC333 2ANDAVA
889,545,450 *5C8F0573D263288AF7A582C8F128559C24DB6FF4 2.derzentrale
889,545,451 *5C804F0B32C4F7CA9EAF1C278545DBFB75CAD6DD 2DONTRESE
889,545,452 *5C8C55C228BEB0A92962CB159C1F2E96524DFE8C die rose stand im tau
889,545,453 *5C8A45594F0CB4366740055A2ECE522932783E62 DM)1
889,545,454 *5C8A48C5DD280BC32C7FBDFD10DE057A0ABC0681 2IAMROUTE661
889,545,455 *5C8184258ABB78E740E3C578E16D7C8686718B31 2MYVACATION1
889,545,456 *5C88B9D1A056B6563530A0D20AA0C3BEC3BF8CD0 executrixes1
889,545,457 *5C8E4149C14AB8FCF7B3629E0618A1D2330D7096 edraalbing
889,545,458 *5C8CD09D083A5F93F8FE43B9D8DBE32D687C040C 2.UNIONSVORSCHLAG
889,545,459 *5C86CA50B44321190A2E02482F3B82190FB2ECD5 2機、as355n
889,545,460 *5C81729AE32F3E480A506623720F7E9147A29601 333266 FOR A FIVE-YEAR DEPOSIT , THE AVERAGE YIELD WAS 823%
889,545,461 *5C84816BEEF821A014F65BD5197B49900A26C1B8 391451 SUOMEN.SUURIN.TUULIVOIMALA.OULUNSALOON.OULUN.SEUDUN.S
889,545,462 *5C82DC325332A64C87F7610A2EBC4FC63758DF6A hidroscopicidad
889,545,463 *5C80E57EDE30CCD59B7AAA4F01B47D1565A14A64 3CAMBRIOLERAIENT
889,545,464 *5C8D5580FA84A08247706A25B632D8CB3347C917 INEXTREMIS1999
889,545,465 *5C8708C829A83288115760FAC3234BAD56C5CE45 j~>_
889,545,466 *5C83CD1BAFCD02A672EB9D183D7D203AFD63F026 3NEHCNYM
889,545,467 *5C8AA11D85EFC7DE6C562D8D22A53078B7403CF0 Maalstromen
889,545,468 *5C8FA03D1010A29A6BF41DBE4C84FDA310566137 487HALEIGH
889,545,469 *5C845FE72AA2A56CF212C34AB0D14F6D7E4441AC 4BXIKPKI
889,545,470 *5C879EFD2782B108A73D61710C62EACFDFF29364 4-ennakkok
889,545,471 *5C88587D0E0C67211B861BDA6D25F37D261FF635 [email protected]@1
889,545,472 *5C871B6DAF2C574A2FFFD6ADAA786DFB8BC8995B 4HYOUKOUS
889,545,473 *5C8D2EC27B0C1E9F91CFEE251FBAA6195C5EBCBE 4IRCEMORYEDU
889,545,474 *5C85E1F3806F91A26ECE7782DA9906D389AAA868 selskou4
889,545,475 *5C841AE14DF86046FAAB2AC3FAC2DD27C60E127F tarzan%
889,545,476 *5C8DF3DE086D954CAB0F3AF839EEC2B4055BA340 4OPIPLJIVOGO
889,545,477 *5C892AE4453D8ACF374376F7872BDC6C2129A1EB TANGAGIRLS
889,545,478 *5C8DCFECFE5A0A3D1A8B6B98982546B552B1851A 4PREPARAR
889,545,479 *5C8FBDD549932E7F2F0B27B407209CD30A4D6BE1 un0btru$!v31y
889,545,480 *5C884F348EF399057CDA8EAD170139F597539134 4T6U
889,545,481 *5C8B3756F3378FB83BA7DD0A7D55B3BA53794840 xinnerl9
889,545,482 *5C8A7CA9F480098D3EF80641C5681C31CFCE4DED aacp%a
889,545,483 *5C8F120E26AE54D40C125462AF16E89549298B0F 5ADULTFRIENDFINDER
889,545,484 *5C88080447E082E386B1542C99BE8A512A431E3C ALFONSOGAMON
889,545,485 *5C89B685694AF7477EC3EC5F4E0D08F26008CBC7 [email protected]
889,545,486 *5C87C854378F374790BF145514B4C8961CC3E66C anum-mahmood
889,545,487 *5C87523E7C1DC6CE325C102CEE131B3E3E20A0EE anum-mahmood
889,545,488 *5C809956C75EE9BA3BEBDA23C49A7A64E94F5424 5JOVANOVI
889,545,489 *5C858D19C1F721296FF9B18A658D808F7BC5F6F6 5KOVENTAMISTA
889,545,490 *5C8C102B411575E6D595776E99722841D4E52ACE BRUCECOSENZA
889,545,491 *5C8635F13FCB03BBCEC7DC96F3331E2DEAFA37DA 5PLAYERSROPING
889,545,492 *5C8AD1488EBED08A5182EB524181A7D4539E934B [email protected]
889,545,493 *5C85B341DEBEE6BD7F1C90F585BF1234CCD84057 [email protected]
889,545,494 *5C8E24B642E14ECA86C99E33C4DACF98C0FA5D25 5SATENOM
889,545,495 *5C882E9381DAFA7E095639674137FD3892080CDC CHIOVAZ
889,545,496 *5C886B9B434C52DF0A44A704E9D0B13EAECD4F9B CLAY.STREVA
889,545,497 *5C8A957406895DA54DC81D0AED5E5E4847115A39 5WISDOMPYRAMID
889,545,498 *5C8315EF7396B6918D8B5C336FE1D9F907AE0153 [email protected]
889,545,499 *5C8C77AA038FDCE356A00E56072792C5BCA7BF18 DALE.LAGASCA
889,545,500 *5C8D6CC0F3D7C18EED5AE73DFAB024A88C489527 DALTON.SHELADIA
889,545,501 *5C820CF6181E66DEDCFE221E334D5E590E332FD9 DANA.REBECK
889,545,502 *5C8854C40DD1042FAD52E3B2ADE79F6B879A6899 638493 gezinti.bOlUmUnde.,.hayIr'I.tIklatIn..
889,545,503 *5C866B8606C806FE471DC19BCACA82D88C362F71 DARRINKAUR
889,545,504 *5C8D0B8076AF5040F7A5990C8106439E979E69F3 6741280ZYY
889,545,505 *5C80F6CEE64295E2576695D47E1C0987EA78AC39 674NEVEAH
889,545,506 *5C81492FD75E04F768935451800B31DC642BAB44 DECENTIE6
889,545,507 *5C8CF38276E4ACE00B89A7CE59446CFF6A06F57E 6GAMUTSSTUMAG
889,545,508 *5C87786F25EA714EAADB3DB8A690AA18EBD55548 6GEBURSDAGS
889,545,509 *5C88E2676CBD5C75DE2791F91FB59F0F26F967A4 6HOTFLOWBSW
889,545,510 *5C84C00E91D3CBDA82DBEB63376C82D86ACC43E4 6iluvgiselle6
889,545,511 *5C82DA99A3F54930F22CBC88A2101F9357905EEC emmittlubrano
889,545,512 *5C8FF8412226F07ABEE24EE1BA2ABD5068BF1FBA emmittlubrano
889,545,513 *5C891BC8DEB6459926683314E0B62EE22D062093 6OVARIONCUS
889,545,514 *5C8C1CCCB3C064A8CD698ACEDAB112E2C4514110 FLORENCIOCRAUSWELL
889,545,515 *5C84453AFCD4724B213BEC62473A6254A596816E FREDRICBIZZARO
889,545,516 *5C83F0BB98B43CEC48A7AF8F0936B1C1525F9275 FSB-GRU
889,545,517 *5C8F5E0F392C62AF8F9B5CD9D1A002D01B133CC2 GARYSTREB
889,545,518 *5C8B428990D6F0B8F185959F7EAB976610B37EE1 6UPPRADAR
889,545,519 *5C8AA7EDCF9E8914F3EC5CC5FEAF860FCC9FECC3 GOVERNMENT-PLANTED
889,545,520 *5C85329AB8C1E5423A2B639D31FDD296046EBC6E 6YSSENHGUAHS
889,545,521 *5C8F29B5E9AC911DF7DB2890D9E3FC0939C003DC 784400 muidentietoteekkarij
889,545,522 *5C88D7E343EE7EBD40E9374634BC4D36E1444EF5 [email protected]
889,545,523 *5C8E7A6255AD888C31AB482E80705B79AE657F15 [email protected]
889,545,524 *5C814BCECAD9CD4BD37408F84BD7AE2265D69614 [email protected]
889,545,525 *5C8F9BB982DEACEBF9B0BDAE079D79697C56AAA6 idobecauseican
889,545,526 *5C8921B8204988BF43B9C54EC838B6AD97963947 idobecauseican
889,545,527 *5C82472F1196928740C078F3E8618792E59168B9 7IC8C7CT
889,545,528 *5C81D249ED0086C456BF5AF15E479D2962C62504 7ILUVLORRAINE1
889,545,529 *5C878AE314DAE74A4E81E35E3AA93E2D52F0128E IVATSOPS
889,545,530 *5C889D363E80613128C22DEBCDDE0457AFFBF6CD jamisonluckadoo
889,545,531 *5C89CAAA15153215210A74A12FE7E24BE7E001F6 jamisonluckadoo
889,545,532 *5C82ACF5EE8EDE74A54CD6A4C9BD00A8A32C67F0 7OMMANOTS
889,545,533 *5C873720A3FBCBA0118495163F534021EDDBDE3A 7OVERMTNINGEN
889,545,534 *5C8D254113EB31C29C471D6018674BD6CFBB71D4 7QUADRICOTYLED
889,545,535 *5C89928E61B40C768CEFA6FCF8BE42FA75027824 7RELIE
889,545,536 *5C8DD522142B105515BCB05D828D42FF508EB019 7SUOHPROMOPORHTNA
889,545,537 *5C897B150AD8C3A040555AA4551B5058B5F1BF0E kareemfacchine
889,545,538 *5C83D64471B94308BA09EE51281548A62A381A93 kareemfacchine
889,545,539 *5C8DF371BCF71075C7B216A71DE5CFCE00439D7B 7thatzebras5
889,545,540 *5C84D9DEBA99FAFE43F4E45989F30CBD8DA59F52 8AGQKLHORJCS
889,545,541 *5C8D5AC0216E3495CBF9D136F257E6D1830AB477 8#B~(0_<)
889,545,542 *5C8A06B823913810C0FD9683DB4F2894DBC42359 linwoodbigg
889,545,543 *5C8ED87AF47640803841CCCEBFB5E590CD163F6C 8BUTCHERLY
889,545,544 *5C811454B9EF3A909A8981BADE72D174B2F809C6 8DOSTAVLJASMO
889,545,545 *5C822C27CF104004AB400081F80FA7AFC1A76D57 manuel-ayaviri
889,545,546 *5C88049113018F9FC4CABA46D96C3EC151967C1B manuel-ayaviri
889,545,547 *5C84ACCA2C9E7191CB136DD5D943CA0CCDB9DC97 8=d~~(x)
889,545,548 *5C8C45959E30BD95079F3EB0B92A8E7B6FB3EFBF midprairie
889,545,549 *5C839AC8A7475EEB64BDC5CFC708198E5F900694 midprairie
889,545,550 *5C875DB9D97BD623A10B271979DD9508A415D456 8LOUSES
889,545,551 *5C8227FC5897C515A04B3A63E2567EB30F225AE9 8MARCH1190
889,545,552 *5C8102FB371CEF0AF3DAAF83A026152D58F521F5 8PRODEVEO
889,545,553 *5C8E21032DA0D20148B805189DCD14CAF364AA77 8REAPSISES
889,545,554 *5C8EB7978986FC49A35933A5A8B18F2AF7A4A3A4 NOBLEGOSDIN
889,545,555 *5C88B7D28C07D33D5CE124856C097B2EAA625A24 noel.x
889,545,556 *5C8A59AFBC81B7C1200712F9CB17C809DF150109 noel.x
889,545,557 *5C80BDD7881B3355EEEB4F6002465BECFDDB136C P9P5R3
889,545,558 *5C837639DBC82EF0485808BE89240A8B9746A7CF Q).*.*.*SPLAT
889,545,559 *5C8D24EBA455B1BE62F7322B75025CE2134B49C8 9ir4s013s
889,545,560 *5C81EE843DFB4652850265C7E65CC86554F50BBA 9MOVEYOURTAIL
889,545,561 *5C8CD28E940E8084E759CD1DEF191E9F7F7877A9 9MPNOS
889,545,562 *5C845B993008EDA527F9195EEC693A2AD7014016 9NAZEGTTGEZAN
889,545,563 *5C8917ECE4DDCB674F059C79BD443E885370E8E6 9NETKCIKF
889,545,564 *5C8978641ECCBFBD04B46766216F62A1FB0EE9A3 ronlaselle
889,545,565 *5C854F707A46B6567B54919FBBCC45C25F665A59 ronlaselle
889,545,566 *5C854F250983ABF909686ABC9FBCDA0FF8665EE1 9TRNBCKL
889,545,567 *5C8FAC401CAE15605592637C2D7C0831513EBF67 9VACAVERATQUE
889,545,568 *5C81B47620001DEAC6BEE0146D2A19B8E2DD8456 SESITRAWLATSING
889,545,569 *5C885C71CA5482C2A81FB6934109DA4174FF020A SEUQINAP5
889,545,570 *5C85B218E590A1D0815FFA56229A4B5DB0F17F95 shahd.yaseer
889,545,571 *5C8A880557E42A121A7EE006396D4B7E92C0214C shahd.yaseer
889,545,572 *5C8BD4177F86114C4A2856AD8AB4905D8B38DE8E a03#%
889,545,573 *5C822DAF418823F0FA40FC99456B962910AD9B5B a1m+
889,545,574 *5C8C252321F9EA5993E7BF841100BE55D5A7105E SOFIA FINO
889,545,575 *5C88C6DCDAB3B23CA3CC390AE5C5713CA1BFF3E9 A;35
889,545,576 *5C810386F3DB1D2C4689B0FD18C2FE89552FC69D STUART.PETTIT
889,545,577 *5C822FF63CA80B5B07AF5399FB013AE8B99D3326 A64!
889,545,578 *5C81E804436B12FF59210939002169FA8419F01F a6/i2
889,545,579 *5C87178A2C169170E665749B3BD5E4829239D58A a6:l#
889,545,580 *5C8AA3F6D4AB95D2EADBEB03C83FF1318FA2F4F2 A6ln
889,545,581 *5C8C03E183DB5498E7E79E6A82826FCF17F63A29 A72=O
889,545,582 *5C8C83472BAE16161E330E0C2FE3E097D16CE531 aa'6
889,545,583 *5C8AD8890794DAE232FC7E8F6DECB92E2D664711 aaadqi
889,545,584 *5C83A336E20667F60EFF4BB34ECAA79BF8C73412 AAA`Y,
889,545,585 *5C82B55CDFC784B6186EE717E4FAE212553FD336 unfastened1516
889,545,586 *5C87ACB118AFE54425706DF762258640EC08E119 aad#?q
889,545,587 *5C802A1715C3F4AE70FCDEC7636DE81A43F6C180 AANSPREEKBAARHEIDSFASE9
889,545,588 *5C85309D6D7D0E89F6705ACF5D063537FE08C666 aantrippelding
889,545,589 *5C8212D99DD2E371889B96CAB6EA8E7A0F9B85C0 aa$r#
889,545,590 *5C895E816AD8E19AF4C86898A099F06F60C0F886 ABE.AGERTON
889,545,591 *5C850CCBDC991E84EF2FBA0681AFD5D9AA418706 WILMER.BENEDIX
889,545,592 *5C88870374AB00CA596F5D038EB6CA9B7A31D809 ABGJP
889,545,593 *5C8A912B6443639F55DF1878E6BC02DC21735197 WWWJAOAORGCGIREPRI
889,545,594 *5C807C55AFE2AA845339E383ED0ED5BDBC1C88D3 WWW.JAOA.ORGCGIREPRI
889,545,595 *5C870B124331BF3AFDA9580D4CB53F61C48CBEF3 YAHYA SHAKER
889,545,596 *5C8B636AAE53E0EA64B6E0424417A9EF5CCF6F91 ac+bf
889,545,597 *5C8CB69221CBFDD148017307B2B4A1E2C2588D11 aclw,
889,545,598 *5C8D68882C526C31D285A596589839A1CB0E2170 ÉTAITPEU
889,545,599 *5C8B691C7F4D9D507F690E9DABFB22B4FEF667F0 ΝΤΖΑΝΓΚΑΐΛ
889,545,600 *5C8F725173882091B5D822630AEDB276D116BE52 ԱՆՑՈՒԴԱՐՁՈՒՄ
889,545,601 *5C8956BA63FB2420246BB87B3C4AF058695063C9 ad"f
889,545,602 *5C8EAABFAD4D5A7CBEA425D7D4242511AA72433B (o_-)o~ o~ <===3
889,545,603 *5C8AE1417D4282FE2129E91112DA1A30B3AFF025 (o_-)o~ o~ <===3
889,545,604 *5C8EB441A76E45AAA91C06ECD4C1AD8A2579E7EC 1-frisierstubb
889,545,605 *5C8D242B891166959E86ED0DF5DE6C78441B2DF1 1-schlampenbuch
889,545,606 *5C857139C982F1E80C94BF537F6527F9F4FAB524 1-schlampenbuch
889,545,607 *5C8798FA82D784DDCE2845C63F66A908DA36F87C 1.universal-ohjelman
889,545,608 *5C81744F50098330601D1FE9E8C9EA2DE476040B 1977116 KUNLUESKELETLEHTI
889,545,609 *5C8FF6BB2CEF0BEA9A103B2C4284A9281B0C698C ah.6=
889,545,610 *5C821303AE3FF9CE963277908E1C129E906959D3 AI92A
889,545,611 *5C8A6F8F573666F94D5FBD108DB521E73C8E0576 4preludes,op.48iii.capricciosamenteaffanato
889,545,612 *5C805D9EE8D908F66A8B7FFA1B0816D4857422DF 5FEUERVERGER
889,545,613 *5C840E5BA63B9858334BDCD124F85A85D6E4CDA9 5PLENEC7OMY
889,545,614 *5C8852C48CCA8D8184575BA3EF40C50AFF5C98CE [email protected]
889,545,615 *5C8DE4EC9C9FE6C33368B8D322B08916122EC567 6SENTIMINA
889,545,616 *5C8E1147F5089FDB2BEF9355C749CD174B0DB34C 7dotting
889,545,617 *5C8D867E68ACC320C08DC5A08E820A63D04C7E06 ALFREDO.BORGMANN
889,545,618 *5C856432C54A05ED456E46FD354DB2D1F768EFF3 alfredsojda
889,545,619 *5C8EEE4591772EEFB3A0C3260C727B8558AAC0B6 ALICIA WHELAN
889,545,620 *5C802AA0BAA1542DFF488D0750E23B43176D28BD Al&L
889,545,621 *5C8E21931A02116CD8F72298BA27697D366F56BE 9PONDERALIS
889,545,622 *5C8E0D61D491098A6261366019C873F6F7C4514E almost-human-even
889,545,623 *5C85D214A7ADAE4E15CD9176358ACDBA7DCC4961 ALOTONIM3
889,545,624 *5C811C74335C5EC3B42B762FA18628C36F2DF397 ALVA.HUNDERLACH
889,545,625 *5C8503CFC3A314EEFB3FAEA9F42B21E24FC33C6A ALZ5
889,545,626 *5C83E4D29A5BFFBA28F1EFD5096F31D89FE54DB4 anticipation(2)..ae0.n.t.ih2.s.ah0.p.ey1.sh.ah0.n
889,545,627 *5C82A1BC1BF45568A43C8C1B3B04DCF8AA90A511 amct
889,545,628 *5C8CC6D4A66F47E9D8A28DDC894921635243EE53 AMBROZIE
889,545,629 *5C8F20EF2B886691D817D8AE31FAB0714AF5BECE aotu
889,545,630 *5C8EFAE3A35215A1D06099741761F2ABF4AFA983 arvoinpa8
889,545,631 *5C854858BA614EB6E0767F7646F0BABB4D719930 andbattlefieldbadcompanysequel
889,545,632 *5C89CF881F329EE9401F7E3C58BD05CBFDD2B2B2 ANDREASKRONINGER
889,545,633 *5C8314FB440B3A5A184E5D0103F17718D8ED9CD4 ANDREWROSEN
889,545,634 *5C887321A5517ED76D38A37D747B6B21455173E7 andyheuman
889,545,635 *5C82121F267E440F0973C8722B5E5349E95E0B03 b-;ra
889,545,636 *5C8EAE3F18C5BF8E657DD7BD4ED0315F40640562 anglims1
889,545,637 *5C88F37E076FFF1E4033D35B881FC21179C95686 BONQM
889,545,638 *5C89DA6AA83E8A3DFC47140A32BF1B4D6362FA99 b_+4s
889,545,639 *5C8CC10B271A0CF82008C99022A76B6777141E3A BPG?F
889,545,640 *5C8B37E0F19A80DAEFCE49B895B8F15887C3F491 aos%
889,545,641 *5C8FB523769A9F25EFEA1CC18BF852E365A2DD3E c;9lg
889,545,642 *5C8C9F629AC40454C7A3F061853E1FE2952EC381 APRILREED.COM
889,545,643 *5C86211FB9429024B1FCDF01951AD96E6A9974D4 aq,iy
889,545,644 *5C8DE49537143AAE7AA781770F6A393FF64274F1 D:-UI
889,545,645 *5C87C48E3D69CCC519E17989422F0BC6C664E93C ASHLEYBOYARSKI
889,545,646 *5C8614783CE080A5779ABF0011EEC9D1E9B93731 duzac
889,545,647 *5C8FB08E70404AB5670547B580851151D3F8E10C atguj
889,545,648 *5C8A4783E02C50F9286FE6080CF13F94877607C5 INVISIBLE.TEARS
889,545,649 *5C8F1CCFCE84FFD711953A390EDEEF9D011A2CD6 au-tk
889,545,650 *5C8536F417BB27659CB28E46B64E8E1137752EBC karabíahafinu
889,545,651 *5C8E71778CD60CB811161F000D634B52DD18145C levelwave
889,545,652 *5C824ADA188645AAB44F5D5B38A455BD994CBCA2 MEERSLACED
889,545,653 *5C89E294599525E9AB8A13E13708A15647B74313 azf(p
889,545,654 *5C86243D41091630EB33C766DAA96CFF4092EADF AZL3T
889,545,655 *5C893804191D2BCDB254A73A6A56ECA338F1AC3D PROJECT.LOOP
889,545,656 *5C8DB73E570624AF22DED8A3CCDEC640AF2B1174 PUJACYCH8
889,545,657 *5C86C7C24DA3AA5FA1F8500F02148A934420ACE6 B147525
889,545,658 *5C864CDA767990788C76D1F9F67D9F188CC397FD b1d47
889,545,659 *5C8D01B6551D5B4781394232CDC40E0FC95A9CA4 B2=J
889,545,660 *5C8E4E5D1E9EDD5D4CB345E4FCEB2AB42BD4BB84 b31!77135
889,545,661 *5C8FCB1249E71AB0E1FF1AF75D790466FF8BA887 THEKISSBEFORETHEKILL
889,545,662 *5C8517A07D75F68C7B68336A9C29265670AD48BD THEKISSBEFORETHEKILL
889,545,663 *5C86C91F7E3CC064B6BEF6CB914BFBB01CBE522E TRIPTYQUE---ED-LEDUC---SCHERZO
889,545,664 *5C81D31F69D5199921B30E3E5BA6F0B5AAD9CC65 [email protected]
889,545,665 *5C882F429576FAE4196F384FA73233C43B6BB962 WIRAFED
889,545,666 *5C8F726A4D2F02D9167859F592D62B483B461965 a!.(feat..china.dog)
889,545,667 *5C8AB5BB688BF544FB6C607BD112661567A1D604 a!.(feat..china.dog)
889,545,668 *5C8FFD64F2FA30FD37F0A6ED120B25F38BE9FBB0 AABMP_
889,545,669 *5C8A4E370818CD269FB84C6CC38681750A4A468F [email protected]
889,545,670 *5C884C2556CA652095B66F8851F237DD066C9007 B;ATW
889,545,671 *5C8004BB2B484BB451D29C69FA5017229861AA41 AGHA.RAZA
889,545,672 *5C891F9B178ECB1D4934D70C1C60E903157BB448 B3Z
889,545,673 *5C8C9BE963696B6EA4A4E8A0580BB01F7B3E5B54 BECKY-ALLISON
889,545,674 *5C873534173A187D70CB4C3DF54F91089BEAF301 BELLCORE.(OR.BELL.COMMUNiCATiONS.RESEARCH)..HAD
889,545,675 *5C8563C62F38A07EC477740A6020B2881D27C945 BEMITERED4
889,545,676 *5C869C9540776030026DB710534346B7481AB07A charukohli
889,545,677 *5C8040C75D4E9799E512D26BB39109AB2BA71AE9 CHONG.RIGGOTT
889,545,678 *5C8FC77079E634ADFAB7EF30EEFAE0064D8E2DD7 CHRISTIAN.SCHLOEMER
889,545,679 *5C8BC94D2091E1986368720CE6120D3270268978 BERTHARROP
889,545,680 *5C83C1DF4023E831B490FEA261911B717ADAEF12 besklasnu9
889,545,681 *5C88B08A3CC36BA91C9F3E88A6E4B5BB9D1E6A08 beskyldes9
889,545,682 *5C86D7061C8FDC10D8101DE6735ECF92528D0049 bf+=/
889,545,683 *5C8A52D91A35359260AB273D2E6C6EFAF3E381F5 CONNIEFEFER
889,545,684 *5C824638F879CD2072CA0D72B16A6FFC09FA3071 bgbpl
889,545,685 *5C8C45C95663A324CFB84B40AB42217B9E6D4681 b/h4x
889,545,686 *5C8515DCF6899BB3A8D0245CE825F5145699060B DEURZICHTIG
889,545,687 *5C839F47FD78C1A48E1DA6E70077F6B604303834 Bhv?
889,545,688 *5C820B55B8672F5C7C80D17B9E120C05B966EC06 DON.LUKASZEWICZ
889,545,689 *5C80171F1835D4A4828D5AFD41C71B61DE0FBD62 donnellborgos
889,545,690 *5C80D655F4FB0ECEBDE5350AE6E6E09E8743CF23 donnellborgos
889,545,691 *5C83723E7C0905B3A354FD93D155B1E95735E16F BITCH.PLEASE.(FEAT..XZIBIT.&.NATE.DOGG)
889,545,692 *5C803129E87248D961F64DB822E0E8C2D32389D1 ellsworthboettcher
889,545,693 *5C895374E1389C52033BB821117C42C51609270F ellsworthboettcher
889,545,694 *5C8DF2793C000B340C7FAF799C932447ACF88AB1 [email protected]
889,545,695 *5C8026185EE184F474A4222432883DEAEAACB4C5 BKNY212865
889,545,696 *5C8E5673AA2520C2D53967EBFB2EE443F0852CA4 B?kP
889,545,697 *5C8911D218FBB5ACC5CE149EBD14D9C16158149C faheem.davis
889,545,698 *5C807804FA5626516F6418FCA88F644886A78FFD BLAKESLOON
889,545,699 *5C82512D21E99C8C71E8319571BE31CD6D1E1681 FÍKNIEFNAGLÆPI
889,545,700 *5C830EC1D407C37907C7774D80E6C4FB992A1CD9 BLKK2
889,545,701 *5C825362EE8E98A6B5C5A9849E7A738F19123E36 GREAT-GUN
889,545,702 *5C8539E251F994110590DB680CD51EA680E8031A BMO99
889,545,703 *5C8DB114577E33D52F9DD36A9622EC66C2FDA5B0 hectorkapraun
889,545,704 *5C808262C964CC540B62F6711C124DA9D1962727 HMODHERA
889,545,705 *5C8D8BB391B64E7F9004E285BF19A47CC953B370 IFUSCO548
889,545,706 *5C8707A5C289BAAD5E3640C3E8F59768C9799F61 [email protected]
889,545,707 *5C8C13B5300A9542DEEC462078A0312044E559E2 botfelt
889,545,708 *5C8FF8B7A204B37A7546D08FF466A925EBCB442B jeff-melchert
889,545,709 *5C8A3B92CDD16C10CDC577975EE535A67E072204 jerrellglazebrook
889,545,710 *5C8FB62450A6233C3C697EFEA7D4E36DB7F654B3 jerrellglazebrook
889,545,711 *5C8436CBE884C14A6FA3732BBAC31D1CCF77EF02 BP_U/
889,545,712 *5C87A9E429A6EB15587C8EE5197034CD2969DFCF BRADLY.STARGELL
889,545,713 *5C8A97C7B603D077CB22AA3AFF8A13A0B499D3B1 BRENTON.SLOBODNIK
889,545,714 *5C8539D8E84BEADF8717CC770A5E3640883ADE26 [email protected]
889,545,715 *5C86D546ED9D787D868AA8A24F9ADD5EA64620F5 lamontbason
889,545,716 *5C8458E641D85E4E68E12F1983CA2E2B687451E0 lamontbason
889,545,717 *5C851EDB339AEAABC7E3778BCC7425698F0F7525 MAKUANENT
889,545,718 *5C86BD2F6685C81F876AE5E22037A1939A9CE0E7 BSWH:
889,545,719 *5C83387201423FDB43B501129F4A20682F7B639E [email protected]
889,545,720 *5C8D68C7302ACFD6AB5B88B64C54D7F8240C7C7D [email protected]
889,545,721 *5C811CADCECA3A733B6D2BA4F111710D4A9BA3CE bvku"
889,545,722 *5C8E640FDD35C4518876DF76E95BFE3BC84939BB personajes.de.pok
889,545,723 *5C88EECF1D4A5E0470F93B92F7464A3271E71B38 personajes.de.pok
889,545,724 *5C80E5602DDB71FC8A441BDCCC75073ADF65262A RANI-SAGITA
889,545,725 *5C8B1D25C492FD2C1D76104CD0600168FC3E2161 RAWEEWANC
889,545,726 *5C8344B5D7A92B32604605A3CE30BD8205AB2C14 C1XO9
889,545,727 *5C8B203154D66D2F6DBFB669A4A42DD89E2252DF c6co+
889,545,728 *5C80BD3E4BC47E97673E261971381805E6DB94A6 C%6J+
889,545,729 *5C800B26E8486F048388B425052E2F04B307D2F4 C8Rk
889,545,730 *5C8CFA737FD79ACD52B4F1FD54B01B231F998E26 sandyrademaker
889,545,731 *5C8DA4250B622781FBF3A02758FA23781EE32E82 sandyrademaker
889,545,732 *5C8E94FB3FB586E3EC5874DFDCD51BBEAA4DEA2B [email protected]
889,545,733 *5C8A1186916109CE0C78E8D57E94036A1D4D9FA8 SANTIAGO.SCHOOLS
889,545,734 *5C80950F962D7BDA489A2811F7DB679C28B8E25A [email protected]
889,545,735 *5C8EA1CA2CA0993AED137EBDF3BE014DB24A0DE4 SEANDUNIVAN
889,545,736 *5C8CCCA54244339CBCA8867E620F33EEB02F87E2 shalin-raval
889,545,737 *5C8FB53123E25926C55CE668278CA35C1AF172BA shalin-raval
889,545,738 *5C8C82DED2811C9F717231D39412AAD14D5DCBDA susie.costa
889,545,739 *5C8D06037A385FAB1AF10BCAD4B972C6E65D7D44 susie.costa
889,545,740 *5C8C5E9262EE9C0578E8CE9863E5880992C7BCB5 TAMMY STURGILL
889,545,741 *5C80A75725F4640ECDE7D0639F6D718AAE28E11B TERRORISTSCOLOMBIAN
889,545,742 *5C860C1DE8FEAA79E4EFF22E265063782F4E2671 THECOLORBAN[
889,545,743 *5C827D975746CCB3604D427582FD3E839BD3B6D9 TMTASK
889,545,744 *5C80114C63B07AEBBC39241E135FA42611869115 cc(ws
889,545,745 *5C8881210EC66870A87AEC5C7F7E7A5F6C7E1123 CDLUV
889,545,746 *5C8C9BE9546754845EE5F702D8BCA274AD650921 ceg&x
889,545,747 *5C85BFCD067B49A999DC09B92BF37C3673D2D3D9 TYREECARBALLO
889,545,748 *5C8CAB5A0ABBC38468AB9615E720BD55F72D11AE C:+;F
889,545,749 *5C8DBFFA7F1DDD31F65627B646BEBECD2D3157AB chadmunger
889,545,750 *5C8353B0B50C93BE2F4BB592F3EC6DABD35F6DF7 Chapter.17-01:.The.Man.With.Two.Faces
889,545,751 *5C8A98F9D0A62C7024E4026CDBF1C89BBB4D8541 CHARITY NAGY
889,545,752 *5C8E1367B062521E1598A5A14B8E1A26FE3B08E5 WILLLLERA
889,545,753 *5C858E7C9BFB39C1C8C3C55D11926F77917518EF [email protected]
889,545,754 *5C8FC040E5099FC2404E08C184093CDD3BEC6D39 XF4FAQAACAAJ
889,545,755 *5C85CCDB63F9925EA7AB09349B4143C87E921912 C.H..JAEGER
889,545,756 *5C842FB25CDD118930A6FB5581101348E7D9D95F CHN1U
889,545,757 *5C82B29467113976B163F33167DD0A41354D8574 chris-perret
889,545,758 *5C8C5E160B49D2B7D7A423EDB1066ACA1D184574 [email protected]
889,545,759 *5C8D47B346961133678B3A92257F9952CDDA06EC [email protected]
889,545,760 *5C8312409332456B94B7C2DFD985C1D758B03B14 zoka-bom
889,545,761 *5C8C76C117BECAB97A47D87AF3684937046460C1 ZOMBIEGATEWAY5
889,545,762 *5C8E85CAADF50EC7022A16BC53F5B79F042F043F CHUANYI9
889,545,763 *5C81ACCF71839A208039870A089D2ECBCB7DA475 CHUCKLESOME
889,545,764 *5C89FB9A262403C29A0777478F0481DCF52E894C CHURES
889,545,765 *5C8E9E785D79EF463CB935EFC97AF9E49274338B CIVILIZI1
889,545,766 *5C83254155515EBBCB647C8F045DCD65770EE74C cjk=_
889,545,767 *5C8C0D737AF895924C381E18443527DE2D00AB41 CKB63
889,545,768 *5C895C5BC9ACBE21890DAA7566C94EF56C690768 1.entreissdienstahl
889,545,769 *5C8198F6C02CF569BF5301F2168357764E05D73A 1ETIKETILL
889,545,770 *5C853E5A784F9D6F575A95ABEEC865165186D7DE 1splosna
889,545,771 *5C8B4B900876C03DEECBC1B1571183235154B6FA CLETUS.RIFFE
889,545,772 *5C8CB9D11384772F570EB3DD4FA586FB5C2C0A2A 1027926 THE CAMPAIGN STARTS IN MARCH
889,545,773 *5C87AAFDD5651B77412D2E63A7966A19B5BD8806 cl"r
889,545,774 *5C85B9162F6CA62C5E16535ECEA05375A7235BD5 2091.alive
889,545,775 *5C80B8081BF995D0C139B98036AA62D02B3ED5B8 2762643 molemmmat.vanhemmat.asetus.oli.p
889,545,776 *5C892ACA4F1A603E3D6B3109664C822589F4C5E1 3-SPENGLE
889,545,777 *5C888EFF7DBB338A945149B8423B632646035D26 COLLINPOUNDER
889,545,778 *5C8DF5239C337416C57FCC2C7BD7C8C6703403C0 communa1!zed
889,545,779 *5C843B9E1171407B8AC1300E19ACD29913AEEE29 CONSERVATIVE-THINKTANK
889,545,780 *5C86C8E471A984B4031F981FF4C076A1A4843A9D corwincarl
889,545,781 *5C8865BE8B23184957B39D663706CDB7A82D0A1E coupdebleus
889,545,782 *5C850CCF9D8D8D1E17BA4333257167C4BC51B337 6CLODORE
889,545,783 *5C8C261724E5749C7BB222E80A92834C0A8D19B4 マツダ・CPプラットフォーム
889,545,784 *5C8C16EAF707634C696BBF002737DCAC4611A74A 752544 marmara-univ--12,9-2-
889,545,785 *5C8A6F9E7BFCCD4713BB0965E5393C0FCA39DFF4 752544 marmara-univ--12,9-2-
889,545,786 *5C864C025C38D3CAFC343C185DCF87A3AC886406 c:\program-files\pidgin\pixmaps\pidgin\animations\16\process-working28.png
889,545,787 *5C8C1DF3C7BED7CC587A48B1389E11C4EFDF6DF7 CPRTU
889,545,788 *5C8EEA4805804934D65D948BDF6480F8E5AF9841 7UMEESEEN
889,545,789 *5C895B19FA38EED7EBE537F97FB6102D56E507D5 CQUENN
889,545,790 *5C833A724EFD5A70EA2CE82C1EAC9FF716A26A9B crackercasper
889,545,791 *5C816BF2867AD62F28C2D71CC32FCD421A09696A 8NOILEMMOP
889,545,792 *5C8634B5F2C510D991CA9A87F0151389E75E085E CROSEDIC
889,545,793 *5C86F9ED569BB31ED4F602FC8B70038BE802C58A [email protected]
889,545,794 *5C83560152D4AF4A16585EBCEC5F676050E93339 crrd8
889,545,795 *5C8876995C8301B80640AD46DBBA9C38FA4E9167 CT14H
889,545,796 *5C8387E5DC84410AEA883A694846679E133F9CC5 C/VIV
889,545,797 *5C875E8D9BD94CD016551696192D56FFFA95A45A cwrdy
889,545,798 *5C81D0289777BE85CAF69973AD6B7755DDEB3F7F B5P7
889,545,799 *5C8B451E573971F6A496F914F59B440592D55EF3 d0la-
889,545,800 *5C8AA9D95D4534877222E849F1239CF8DD4C1804 baardsjakohoen
889,545,801 *5C8AFD61FE2FE1AE5D0A51ADC8783AC6AEF340E7 bl#po
889,545,802 *5C8C42287A497BFB4E379E88872042F4C9262634 bp$tt
889,545,803 *5C8A0DD4DF1AB048E22DD51B736F55E62DF21A1E c,?q)
889,545,804 *5C8F9C7BC8FAC138A7D6F4ADEB7C253BE673B614 c,?q)
889,545,805 *5C81E1185E45C27F4D6BBB43C2124115513A4F90 c,r/j
889,545,806 *5C8F8BFB8AD99970CBD2445EFAA0ED5A0BE2844F C_GO0
889,545,807 *5C82E9B2FF7150DB1964DCD2E56D37C4A6D2251E daneslyter
889,545,808 *5C852819050725C34A6535C5A97756EDA760BF50 CLASSING
889,545,809 *5C862D589687FD62614A3D7497578A4690A3AAAE cnowlech1
889,545,810 *5C8084663A02E4980FC5BEDFCD9F75EAA73B8D58 D01SV
889,545,811 *5C838ED2771F57120608D852362868CE0277F609 dzej$
889,545,812 *5C8307A693C8D0B140073C92E2990937686FCAD9 ge;v
889,545,813 *5C8143A4CC76301C52AF7930C6C7E8E9A39B83DF LANDINGSBAAN
889,545,814 *5C8DD2EE3EA046DBAEC4DAC40018EAB983C6001C DESMOND-FLYNN
889,545,815 *5C8DE8BEB3A592E62873C9F8269AC4E3D8126C53 desmondstoneman
889,545,816 *5C8F5341C2BD9DF17258AEF9169A5594AC637C65 LOTTERSWALDE
889,545,817 *5C8AB779BDF61B0BCA79F3ACCD14BE8F3BA95842 [email protected]
889,545,818 *5C86053B81699CE360EC50EB37F1293CA6DDC11D DFH)S
889,545,819 *5C82AC9AF9E6A308E8B9915AC635B8B55BE4F995 [email protected]
889,545,820 *5C827B9262E574CA5EB13F1D33BC877E0F2732E7 possibly maybe (audiophile remix)
889,545,821 *5C86147BCF2499A72D1E737DFD0063B451D96BB9 possibly maybe (audiophile remix)
889,545,822 *5C8AE4A56108C7EEA06275567C362BCF7267A38B sanny1991
889,545,823 *5C8F351E33CDE5D124016174B2C09CFC0B98F84A DIPARRAGING
889,545,824 *5C8BB76FC72397560D53BBABC05A988EEA4F5E63 DIRENOTS8
889,545,825 *5C882F93D99AFCAE1E19CE5F6448E6D327A7C779 DISAGGREGATEDS
889,545,826 *5C8093EF683C008C47A7D3F8E133A6CC65B3CD22 DIXIEKING1
889,545,827 *5C8641C92D4DA1D1F382C95339346600EEEB6CED diy"r
889,545,828 *5C895B1F7660E24EB1BEBD160868C95C8E677CFC ZAFIRCEV
889,545,829 *5C877706903C0FD056AE9437C2B4F1D38B98361A [enter.demetrius.and.chiron.with.lavinia,.ravished;
889,545,830 *5C86246AC54AB56A75E272F40204CE7ECC26D736 dmitri.lopatto
889,545,831 *5C8C42C0B24213EE09C17CEDA40D8DD032B26754 AMBROSE.CATHIE
889,545,832 *5C8E8629DBD1C13519C58821F42362BFCB2D1C8D dnw>
889,545,833 *5C8703921A6439CAB373FA62F106C52377A5FBD2 d&o/e
889,545,834 *5C8F4C14B09A2B1CD55D1225CCF27CC01EE59529 DOMENIC.ZAGAMI
889,545,835 *5C8E9D7594F5A5B3A5DB5359F01C43EB82EC2273 ARTUROJEFFREY
889,545,836 *5C8DABF5D76ADAB7EBFBF997CEE2A7E98B7E7D5F dominickferrin
889,545,837 *5C86D536BF2E4C4538F731AEDB469BAA78B66B93 BARRETTHINDLEY
889,545,838 *5C8098DD4BE4403DD7226273652975A4BD0F6EAA DONNYSTOCKETT
889,545,839 *5C83E28BBDC61EEF8E09717CED244D57BE6383A0 DOPO LA PRIMA SERA
889,545,840 *5C83D01A5769AB0B8C1B8E14D715A6831E5AE10A DORIS FLORENTINO
889,545,841 *5C828332CE9717FDF876292B39D0C99074F7CFE7 DORSEY.BRASCH
889,545,842 *5C81C6EE4A1BEA792E5DD4ED153491EBF6EF3A12 DOUGLASS.DEPUNG
889,545,843 *5C80FCCCCDB742AF90E8FCDE0B98B385A5386522 d,owy
889,545,844 *5C862F682365C6B4432D155B14A78C18BC71591E D%P_
889,545,845 *5C84FB414D22AB78F3B9CFC32394456B72B103CF cbc630e587304e068bd35ce1298b85d2
889,545,846 *5C8C0ADE1F5932CCDBD695DD4CF4E1F737A0F6F4 dr.hatton
889,545,847 *5C8D72E9E3310E7F6FD77502509190440BE31CD8 DAMAŠČANSKEGA
889,545,848 *5C8A26807D36103F91FC87AFD4291BC9DDCEB182 du6r
889,545,849 *5C82F819BEED741BB31F307DB183B778B0F96AA2 daronsuh
889,545,850 *5C804F2504F120CB133A8642B25EB75661F0E43B daronsuh
889,545,851 *5C8E5950A798A686EF0EE21F685878F6D4296B6B DELBERT.COTTIER
889,545,852 *5C8AF8BF4F08986FF3F018D332CE70950B81E911 DU#IE
889,545,853 *5C87EB1D6F011B712998337D29F7BE6B80D42B5A DURUGY
889,545,854 *5C8D3A479EF4AE73A73DABBDD5CA680BD72B2C49 EBSTRAßE
889,545,855 *5C86134B00C235F52CEAE4392C0A0B197DC8E86B eckfg
889,545,856 *5C850CB50D6E919B706E1DEA025F99C7774B3F43 FREDERICK.WOLGAMOT
889,545,857 *5C8758D065BB8F1C469A40D27AA1A7B8E85841B6 edanimahed
889,545,858 *5C8D776530C06659864109179FE495261086508C EDDYGRABOWSKY
889,545,859 *5C8014808545E013C513D72F8DCE6640517E773C GELERTPETNUTRITION
889,545,860 *5C8BE09B21B4960E64930E3615CD3B94A0A4BB4E EDMUNDKUNTZMAN
889,545,861 *5C8B118D05C2400F730BDC2AB06D1C589B7108F4 ed?o?
889,545,862 *5C863654053D08A2749F514F6299EE8447889555 HUMOROUSWITTY
889,545,863 *5C8FD76288972149BC60B79C29B1BFC557239EBA EGJU
889,545,864 *5C80260CA3DC9687D5E4C574CF45DF9694D39766 INSTEAD.BLNGUYEN
889,545,865 *5C80716613E8DBD91AC3568C23D1F8FC90F01A19 EKI0B
889,545,866 *5C89ADB458CB06784BDE7885454D5DA20CCDA21E ell3f
889,545,867 *5C8C32A605C65F0655446BB817E79C7D053131D4 ELLIOTLIGHTBODY
889,545,868 *5C8E72A0C7D9414240510EE6050EA37C2713F90B ellismeng
889,545,869 *5C84CCA58D053D9B60EE10A3DF850464B3F05138 ELOY.PERISH
889,545,870 *5C86537E521F53EC2CDD551B1A9E4A568755627C ELSESFULL7
889,545,871 *5C8508B4B0BD47BD589EDF0FB0CF4C01E17E4DE5 elurbez8
889,545,872 *5C8C652DF17B2708C55AEE58C37290A2F73A51A5 KANNONJIED
889,545,873 *5C8A37C342503FE71EF69C6D3072F364A8935628 EMILEDUMBAR
889,545,874 *5C878A7FBD3906C4D5CAEA5BED1EF02831FE9B81 EMILIOBOTTUM
889,545,875 *5C8A415A8CBFB363B3BB8A1F6483DFB7CE9AB834 EMILYMORAVEC
889,545,876 *5C82FEC21A15CD885EC73DD7333EF05A3725B2E7 [email protected]
889,545,877 *5C8B943E6A3CD990218664B241A83A06CF765861 [email protected]
889,545,878 *5C8AC5A77FC1426774BED74FAFCF07EFB078E057 ENOUGHZIMBABWE
889,545,879 *5C84DAFF54443D4B155E4CC122B22E5811C9A173 envenoms
889,545,880 *5C8EFDC318B7297C0A3F5B5BE4665AF383AC0C1F EPI
889,545,881 *5C8E39DB15B2A37B98D55394163E38B2FEEF3A86 epoj3
889,545,882 *5C80180866FEF5C1E4B89CC61852808D6036C566 epuocsji1
889,545,883 *5C8965B64BE08E3C8F55AB70F4F67B7F7FCE5A8A MAN.SHYBUT
889,545,884 *5C82E21A7B58C973E339DDA50FCE72FD36AAA7B5 erashöhe
889,545,885 *5C845E9B6436D25B084D5EE65EBF400564F22D24 ERNEST STITCH
889,545,886 *5C8EF6E104D8DAD5DB8A120B075877972AFEAA8D ernestthalls
889,545,887 *5C85610327D4FC4C8471E46CB9B64A40FFF598A1 ESANTUNDE
889,545,888 *5C8B85552780BEF7156F72B9F5D26E60DB603397 ESCOURS2
889,545,889 *5C8D3B604ED527B805C5F4D97BD1286516ABDFFB MIKE.OSWIN
889,545,890 *5C8918E329FE4DF9CBFF9A160EF2B8B2A2950992 mike-oswin
889,545,891 *5C8F0B040C13B92FC348D8208B66B8019B78A440 mike-oswin
889,545,892 *5C89E097FE708563EA7F06304C248755E2233D43 [email protected]
889,545,893 *5C8218B90359E9314EF70A521E4401458E39605C etarebus4
889,545,894 *5C89506E6D572B715EF66FB0E988A841DA94ADC1 myrachelle1987
889,545,895 *5C8219FF05676FCBFA7D0C17C239DA187D478CDC NATHANIAL.VITTITOW
889,545,896 *5C85E2A6B5040E5205B8A729E9E0B481038AB42B NICHOLASLICHTENWALTER
889,545,897 *5C8973E513104ACCA7AFBE47249732DCFC0E62F0 NONSENSEGORDYB
889,545,898 *5C8A9FB5E1CBB32E900ACF128B9667C227E17537 [email protected]
889,545,899 *5C853FE8A587C80D367DBF4AAB2A50AA0DFC0832 euusb
889,545,900 *5C85A63E4CC56EE2ADBA4391555B0E27F841BB34 EVERLIEN1
889,545,901 *5C8C413B4382AA291904E08E0BEE264C514597D2 EVERYTHINGIDO(IDOITFORYOU)NAIMYGISELA
889,545,902 *5C858AA10029D217B4A077A946086737BE088098 F"8Y
889,545,903 *5C86317F608DCF985D0DAE3EDAB1FE0D05EE80FA [email protected]
889,545,904 *5C8DE7A7EEC1DF02A380DCE69EE6E150B804F485 RELEVACI
889,545,905 *5C8FF1AE24015FCE895CFECBB76B6FE245DB5BF8 FLATRIE6
889,545,906 *5C8FED4FFD301AF28524562EE9CDF690F4A71922 FLECTIONAL.
889,545,907 *5C8004C85BFBA0B96815C4F84571688134785477 FLOPT
889,545,908 *5C81969995F63D8AC6C1F5C9889DEA386499B241 FLORENTINO.THEINERT
889,545,909 *5C80A0B7C1C2D376B304AE09DF78D5CFDD5A9366 flowingcurrent(2)
889,545,910 *5C89C933537F11BF078DFABCB021362CF872B66C SGHM
889,545,911 *5C81EC6629423E6BEC0E6BBBB13918D32E705176 FORKVAKLANDE
889,545,912 *5C8665E548F03D95E9058D97DA47BA760AC7FFCF fosterkubley
889,545,913 *5C884E88CDF9220815C292105C39F45DDD2A28EA [email protected]
889,545,914 *5C813E6F21DF709DD8CD4CC75E03E2C6279954E7 [email protected]
889,545,915 *5C84B70C8A1B135B225689DEBEA049F9FEF7C94F SIEZROOV
889,545,916 *5C847167EAFFDCF2E4C1C554B0DBB1BC1620607A FRANKLYN.REAGON
889,545,917 *5C8AD2495F5A2B8D20E08C24DB79CBEFCCBE51B2 frederickeden
889,545,918 *5C8398DD96FDC5FE5ED0B6CDA13A219EB0863836 frederickreath
889,545,919 *5C8FD96D751D3547E1ED0D246518445807A6EEE9 furcates
889,545,920 *5C8B073E8CFAFAAF98B0AB6C2679F9C2672884C9 galaxiecawww
889,545,921 *5C811CC9F0CCD29EA2DC31822662159C26AB7DF7 GALLINOSAS
889,545,922 *5C835BE49C2740F27979551F326FBF00EB34236C GAUCHIER5
889,545,923 *5C866981A30CCF117B1539025B87BEA03EEA5D39 gavindalman
889,545,924 *5C82A61167356892E0B6089845BD7005E90DEEAE GC/W
889,545,925 *5C8F1D1CC73958D1E3BB302A3557367B562FDFA1 GEFLÜGELBAUERNHOF
889,545,926 *5C8B84A383DBA7C24D58A456D9DBEDC12199F45E [email protected]
889,545,927 *5C89C388E81BA32C486A40F128E94C1348510FD2 VILLAGAL8
889,545,928 *5C8D9CE6B258036085B448F2DC9A56ED81F91019 GESLYNGE6
889,545,929 *5C8B81E272395DFD752C6AC14471FF16ADADC486 GeTTiNGaWY...GRaBHiM...
889,545,930 *5C8B19695BBCBB8759F5CFE88E2EBC299804A499 GFNTSRD0
889,545,931 *5C87C4ED7CAE2876E1D31CDDA5560608C763B0A6 WALTONCARICO
889,545,932 *5C8C2B1785B8A44AF72CB32D70E42F6BDABB9641 [email protected]
889,545,933 *5C846F46C3B97271EE2D2304136E343F94A915E6 [email protected]
889,545,934 *5C89BA16FD90A596E76D58DADEA0B0430E69112E WAYNE MIXDORF
889,545,935 *5C89A15B90B458CE1438123401A4621BF1DC606D GILBERTOPIERPONT
889,545,936 *5C835E427D1419370194AF5F3D810F9BEFBF15B0 GIMME.GIMME.GOOD.LOVIN'
889,545,937 *5C8C2F7FB50F8A7A5E15A2BA838624BB3378A237 GITANES3
889,545,938 *5C8AC4F0F539230CF494ADB5CD89A88D317D0882 wilmergoodlin
889,545,939 *5C869F2089A3FDD6105AB090DCC4CB4109839459 wilmergoodlin
889,545,940 *5C802172DE76EB307F307E196736C825CA7C623F GLOWAMI7
889,545,941 *5C8412B2C225908862B2D0761DBF1B6C6841E3E8 [email protected]
889,545,942 *5C874916C63E403EC0A6087384E3B5494CAE5851 [email protected]
889,545,943 *5C8C1EB44DC9A5AC62261F4496CB903F080B5128 GOODSOUP CRYPT
889,545,944 *5C85FEA7AD74826886FE2B717EDAB8D77390D517 ZYGOTESING
889,545,945 *5C816F920AEBDEAC8CAD130FCD858066A8E87320 GREGHAVER
889,545,946 *5C8422F68CA90A61978548DA5168731C41D46EC8 GREGORYSROUFE
889,545,947 *5C8946F775EF0E35C164B73AF4F72956C72B3B8E GRIFF”
889,545,948 *5C860F1DA0AECC8A82CC2FC79175147A9B3A2AB0 [email protected]
889,545,949 *5C8E5332768963FC29DC97971EB533B0915BF6B9 GUASEARA7
889,545,950 *5C885640F22C0136BC3CC7077960624E199422A1 GUILLERMOCARBONELL
889,545,951 *5C8D3E21B5905D258BD9A7ACC3AC366CDF09B579 gymthose
889,545,952 *5C80BF19AEA94ECE7AA37698EDC9BE27526BFDD1 [email protected]
889,545,953 *5C85966C59872B3B5029B0EC8AE524EB7716D309 1minyard
889,545,954 *5C80F3B17F620C0D6D7345169B72A19E45951C6D HARAMURA
889,545,955 *5C850054464FD5D2217EFFEA8838FB9DAF405876 1061807 lounakirjastoista.,.voit.hakea.teoksen.nimell
889,545,956 *5C8F33604D4D69ABC2677EC644F733A12CAC015B HARLANSWEATT
889,545,957 *5C877C75B9A1D9BF906B59E627C7A7E9978804A0 1982TP1
889,545,958 *5C8F38D8227DC5B6781ABBA35F394FB37CE981F0 hassanmonford
889,545,959 *5C876EF82ABF3EB5B31BBE77F9E8646D1CD35C0A [email protected]
889,545,960 *5C8F4F3B5FC2904633120BE1E7CE0E45EFD520C1 hcjk
889,545,961 *5C80171A9F3E4B53753F4A3CDB8178C2C79CAD63 heathrhame
889,545,962 *5C8B9C969B3CF421AA6C65B653173BF469A97A9A 31JUL1075
889,545,963 *5C8DD68C4F4DCDABB473B11EF9C86747E9326A11 [email protected]
889,545,964 *5C8DD5A14098C98F01DCEDDB5468651390DDE01A 433VALENTIN
889,545,965 *5C8661C21B6192E04F4B9995B6BE876FBABF4248 4ELLEUFMU
889,545,966 *5C88E93B9935FF389C0E172F23C28061D8E0EC7B hershelsobolewski
889,545,967 *5C89AFAE2B7F47A3E2D96B430DC8544BD3405A9E HILLERK
889,545,968 *5C8A6DE34D11645B02A1FD6716D01478C7FF1DAF 6-pohtilan
889,545,969 *5C84A2A42B389868C1E506A28D34949415F72221 7BELLEAU
889,545,970 *5C849440EC212BE7D5C9EF44B54C8C0D8F97070C 7iluvpacers5
889,545,971 *5C8C736E2AD40BAE2EB620BD831F50085000522B HORKYMIS
889,545,972 *5C8E998A868828A08AFFAB3BE87F226D17E78C48 8NENNUDHC
889,545,973 *5C8E555AB961212DDEFE30EC0A6740BAA8E2613D hstart-erlaubt
889,545,974 *5C860396A66D4A975C57A1E1E761867414A72EE2 httpwwwklauskinski
889,545,975 *5C8CA1720389E17517927552F3174962333FFF00 [email protected]
889,545,976 *5C8C2E2EB7781069F37E3810B52C4996BEF63603 [email protected]
889,545,977 *5C8A25D5B40DE11CE863EC4F6C321C826C9E2683 HUGH.WARLING
889,545,978 *5C878BF251D0E14F00F81B9598E27CF764E5DC44 HUGO.HUEBNER
889,545,979 *5C8C525F1019C97C9FB3F3681FFFA4E9D0ED180E AONA
889,545,980 *5C8EB6AF6523747E1E0CCE0EED40942B4345D439 HUNTERSKULSKI
889,545,981 *5C8F70178C9C1D6EF2A90FC300F84A206A6E4F9B HVARAN
889,545,982 *5C81DBFF2796F6602CA572CD437B9CE7B856A7AA IDUKN3137633520081231
889,545,983 *5C8D2047BB376BE8C5666F566A7ADF7D8BD37E3E ANNUSHKALLE
889,545,984 *5C8C168985C7C3FA4894BFB080D762F1D4CC4D52 asf_5
889,545,985 *5C81E3FBA237E71ACC32794DA253A8D70FF932A4 b!ae"
889,545,986 *5C8EC4ADA62241C61066F1B1FE71BDB582D4DC1B b!ae"
889,545,987 *5C89B5B7B9DFECC2B5F0CD9D11F2857BC79364A5 ILOVEABSOLUT777
889,545,988 *5C8421679CB4EBF27D53E997DCD0655194164E00 b4ub
889,545,989 *5C84BB638F318459E835EE8285752CED2A527336 bridging.
889,545,990 *5C8854E7442C9C47B39E69E16CF1F6BCACF0303F BIM9T
889,545,991 *5C84E04C89BD88FE6A6CEF97A8747202AFC5FA7B BPD:,
889,545,992 *5C8FD6FA32F93883A4A7EDEB666D974E95010BB6 INTENDS
889,545,993 *5C834185933CFB7C1FB7C0811BEAE15EC601592A isolez?
889,545,994 *5C8B08380902F4743107F61CC5DE1E898A631024 i-weak
889,545,995 *5C8460E379FE31DF2549E820798BE7D0AABE2CC5 DE7F
889,545,996 *5C87CDF0C3FE6A63353C5A5D209DB227F79FFA23 DRE%L
889,545,997 *5C8B8CA86766C9120947751D58C324965B014D34 JAMISONHAVERS
889,545,998 *5C850F6E4870BBA6A77DCA7D90090D9B13F14273 JANET.NUTTER
889,545,999 *5C8C3F53BC0DD9933B2F3BAE9B36B1A42364EB11 JARRETTMARCEAUX
889,546,000 *5C8B794C0E933B20291B0619CC665A0A73723639 jarrodloughery
889,546,001 *5C8F5763B980C6672DD52DD2F2F419A40EC0CD17 JASON.EVENSON
889,546,002 *5C8DDCD197E0A03DDB933712076BC5B3C1ECEDBB JAYKURI
889,546,003 *5C82D62F12DB0A26956FD6E5B23BB5DF7D02DFF2 ESOWM
889,546,004 *5C850D80A253DAA1F6E0E42C022F0150DAE6E0E0 jedpetaccio
889,546,005 *5C88A0A5D754D023F7F819697DEB12427D02DCCD jedson's
889,546,006 *5C80F7BE0FF5F484A5816A5EFD2B615BB22CD8CC JENNIFERPEPPLE
889,546,007 *5C8A859695641205974C3BDC09F00669C5427153 jerrellburchfield
889,546,008 *5C86578383713DB1756CE34023986068389D8582 jerrodmackey
889,546,009 *5C86C43261F59FDADA5298469CBD5B1C0AB21739 jerrodpellman
889,546,010 *5C8008547C7B4C191CCDC5A4953D0BD710C299B8 IHANNOI1
889,546,011 *5C86785141CA0A429218D9777ADE3FB567183D42 JARED4639
889,546,012 *5C852E919819E256AF6511149F187C473E6134A0 jnH
889,546,013 *5C8791562ED2B7D3E1313BEBFED6B804427C470A JOHN-PITKETHLY
889,546,014 *5C81AD38507E4A2D47A39B02F0DD88F1A0E42113 JONASVIGUE
889,546,015 *5C898CE953BCD2F6542876042099533F9894D4C2 JONATHANATTERBURY
889,546,016 *5C8EEB8B2B47DCD3896BCBD1F4986B889477CE0D JONATHAN.FAVOR
889,546,017 *5C8D410C8D4B230A7D0D405817BEC1CB271EB784 josiahdvorsky
889,546,018 *5C82E9BBB65BE7F9608FCB2A81A90DAC3094D016 RAPERONT9
889,546,019 *5C8B523C1268EB8E65512C8B42A6BB03159D1FF1 judith786
889,546,020 *5C81EFD691616B228FCC59510619592E90318C71 teachergocougs
889,546,021 *5C89B1E67536274367420C480742BB5125F89EF9 Visit-in-My-Dream
889,546,022 *5C88D75586C9A5AAC52B0E4D476DE3ECE348A542 xuamreht7
889,546,023 *5C8AD2876E88F8330C6C28302DA7760272A8C8A9 ACA:F
889,546,024 *5C85B247A0196ED7B4C2CD970DAF16528D3072EB KELLYFREIDKIN
889,546,025 *5C85B3A8C03EB355941090C0E7BEA5F63A0F285A alanbourjolly
889,546,026 *5C88CDE313405DAB785A17D41E541271D30ACD27 alanbourjolly
889,546,027 *5C8004C9366A357219CE73B52FE8614D84600B40 ALONSO.KAMPMANN
889,546,028 *5C8B9861F44005272F8333AD38FFA956DC4810AE kerryjendro
889,546,029 *5C85947667B5F80B57DB9D5079F3B14DA46D6099 ANTICATO`LICA
889,546,030 *5C825B2EF05A917889CDE31F9B73EF9E3B241958 khamat
889,546,031 *5C88D68090D8D085F23CAB31BA4EACDD60460C7B bhagyashribhosale
889,546,032 *5C8162056156B65E90353BB48BDC95320AE20A04 breannhinkle
889,546,033 *5C80D4F783B4440E86E693D81B4F2C371705F521 KORRELOIVAN
889,546,034 *5C8A6A8519D75C382EBF687970F79CD1499CA69A Koru.Kendini
889,546,035 *5C8FFF62988999B52267574623502499075A7BD3 [email protected]
889,546,036 *5C8176EB95EEAB52944B5D9F69417577ABFA2BD5 KRISTEN JANE
889,546,037 *5C8BE85F71AF55A7276ECB1C888D0038F6FF86D1 KSERIET7
889,546,038 *5C89CD85619D1726BB7F46FA0DD4D6B61A13F2C4 COLEMANHRBACEK
889,546,039 *5C8811FA1C39F907557964085F8AF5A669108690 KUNDEDE
889,546,040 *5C85BD99543F709B91AEC3464EBBB865DE7CE99D kurtiscahee
889,546,041 *5C8B2EB9F9C5DD7C6940A5F04C6F24E3D7F79994 kurtwesley
889,546,042 *5C81B5DDBDC22AE34E8F3542373B23F135FE4467 KYLE.DEATON
889,546,043 *5C817D685C47768CF2B3420E85FEC654B4797DFB [email protected]
889,546,044 *5C8FD7D3878C51E80B3756A7C0D57BBE3DC511FE LA ARDILLA MIEDOSA
889,546,045 *5C8AE602A63E27F1C62C6914746462A565E14D7A LAATSTE.DAG.VAN.DE.LENTE
889,546,046 *5C86B51F31F3DC9B460ABDFC6AAADAC450C098C5 DEBJIT DEY
889,546,047 *5C8E51DC8AEE10CBCA8B1E46D2D1AC27AE7AFF02 DELBERT.PASZEK
889,546,048 *5C8029AE3714F1CBF43AC57CFDC6EEB6382A44CA LaMaredeTosLosGitanos(Martinete)
889,546,049 *5C80E437306E8179654212A6E38427E6A6E5A4E4 [email protected]
889,546,050 *5C8F8237607AFD245161012E2A3CBF1694E884A6 LASCROUX
889,546,051 *5C8853ADCF6086CF7641D1F79E382B329E69AD5C edmundowellspeak
889,546,052 *5C8EFCEACD637A055C2F613DDF05D0334F4D8322 edmundowellspeak
889,546,053 *5C8991CAE18E3C392E3B64288B67518BCA8E793A LEAHSHEAR
889,546,054 *5C8C1BBBA9AE372F0D9E479991EF72D12D5BF5DD EMANUELBOLDUC
889,546,055 *5C8955BF24FDBDA060772FE563E78A119BFE762E ENRIQUEPARKE
889,546,056 *5C821357D52DBD866AF8F7F6B058D3CED49DE432 family
889,546,057 *5C8C8B8D9D63A76B1BE1EBBC76E7859F821607BB LEROY.SHEARS
889,546,058 *5C871CF097E07BE658758B66222D7759093C60A5 LESLEYBLADY
889,546,059 *5C884F544597682F3AB307A31D8B07506CDA971C gastondesiyatnikov
889,546,060 *5C8A0B1091ECF1B4238D06E920CEB4DA184E39D2 gastondesiyatnikov
889,546,061 *5C8F39E853B5B0D6C6CE3B28DAD20FAE98C1CCE1 [email protected]
889,546,062 *5C84BD2443ACA1AE482C06A83F29AD1F4D21A3F3 HERMAN.FEMAT
889,546,063 *5C8817F4AD475D734E8F235175E19EB517ECA7E3 [email protected]
889,546,064 *5C8B7BFE16E7858959CAB3FF758526241C3389B0 ILOVESUNBIRD1990
889,546,065 *5C81A35805D1B7331F91CB325575E0A3487AEAFF [email protected]
889,546,066 *5C8C8DDB9511534478B410F8367F483CC6687451 [email protected]
889,546,067 *5C8CA245ED3D90E0BCB1F01FFFB14793561CC149 LIS{{NTYMISEN
889,546,068 *5C89D3A8231D1B535E0F5B85F7D551E5152A43A7 lmoments4
889,546,069 *5C883E8425D103A8FD21D8DB6B8B977B5E12C311 [email protected]
889,546,070 *5C85994D03FD8968B4CD1CDCECDBDC10FAF94DEF logandehrer
889,546,071 *5C8641CC50A9528BB299DC9D5D7D7E0ECAAEEFDA [email protected]
889,546,072 *5C8D4007A9C4EEC96A4587C5BEA0F8969ED75FD2 JOHNATHONKARDASHIAN
889,546,073 *5C88943FEA80026904CBFE6302C6D3FDEB1CA1CE [email protected]
889,546,074 *5C84B5BB0BFFFFCE16C6F27D08BD2E496EB53B77 LTSGRDNB
889,546,075 *5C8791ED4E8D87C16380A9393E848CE76ABF0A86 [email protected]
889,546,076 *5C8EB88C8A1CCF6243CC5BDB77D7E2EB2DCB526D lucienmerseal
889,546,077 *5C88DA43B147161493159E4ACC21D7648F8274C5 lucy.crowley
889,546,078 *5C81C778CF3259F637AC73DE7608061E52D7A06F leonelneaves
889,546,079 *5C82EF154F9CD6806A597BAA34349F051AA9EA43 leonelneaves
889,546,080 *5C88C1C7FCEEBA968B84E627EB7F7398B94C41EB [email protected]
889,546,081 *5C8D8EE9D6BC22303051910CC8F7BECE4A71A4A4 LONG_HUNDREDL/O//N/_'H/@/NDR/I/D
889,546,082 *5C8203FD17185CD9B9F0809C160BEF7BC8B087D0 LONG_HUNDREDL/O//N/_'H/@/NDR/I/D
889,546,083 *5C86037A451FB4FB5A331F42FF3FC7B35CA182B9 MAZAREI4
889,546,084 *5C814B40A4E39501CF63BFC05330FC48D49A6D71 manasipradhan
889,546,085 *5C8E548450E8A7C3601583D7CA0D8727BF25B3E0 MORGANPINCINCE
889,546,086 *5C8F8A854DA242A785FF69681999276D44816D69 MOSHECROME
889,546,087 *5C868B0F91684E18289396E6CCE062D111304C4C MANN78
889,546,088 *5C8F8730BD3063F036B98C8E042C132DD5B74A25 marcellusboldman
889,546,089 *5C8485F3DF13E9A93EAC1B7CFB991AAFE80D587C MARCOSBECKMAN
889,546,090 *5C899DC7D642AE789B2CD4C6E8E64ECE0604D82F margie.sherman
889,546,091 *5C88F7EB619DBE8FF9512DF6BD691E8CA257FD73 MARIO.DRIGGINS
889,546,092 *5C89F222F523F14A7BC0147CB6801D3831A0CF4A MARTINS.OSAGIE
889,546,093 *5C87DF24063C7D018B987C9168A52AD08711CC4B MARYAMBLOG
889,546,094 *5C84137A4A16BF10A8C73AEF527661B01832020E phillipvillamarin
889,546,095 *5C8A749C8510EB0BB0764A42217FD08043513A05 MATT-GUERRERA
889,546,096 *5C8FC20D7F19DA069776DDBB60458C343017D139 mattralls
889,546,097 *5C80AFCB855BF5829D008C0D63B88CA353CDB494 q##p~0~o)O(
889,546,098 *5C88BFEE8BB30140BEFDF2F76B189A741D001438 q##p~0~o)O(
889,546,099 *5C8594009E718D3B014926011009825B234A4E40 Q122067
889,546,100 *5C899C3DB0513AA35F7FD51A994021DAED77565E r-violine-e-dur,-bwv-1042:-i.-allegro
889,546,101 *5C8ABE9F9F35C509F86084B7A9BDF49C716BEDBD reginaldjindra
889,546,102 *5C8DB9CA446214387D0C34837BE62F4EBB220067 reginaldjindra
889,546,103 *5C8CBE1D956319B2AFED6D16ED4A731020DCEA5B MEGREBEL
889,546,104 *5C8427E9FA882FDE3B67CDFA9CED8143433E3782 MELISSAHAVARD
889,546,105 *5C83FE9F8D88AF54B5314809F00372422AD82666 MEL.SANJUAN
889,546,106 *5C83D1EB35A34B63B53947ADD29D0D591636098D ROMANDART
889,546,107 *5C8F4EFBC4A617E0D773125373CCBBFE29DBEDC5 MEROÍTICA
889,546,108 *5C820166690373FD89921E611D8FF53901EF48A7 mi5fortune
889,546,109 *5C8DD5FD2AEBD12D8222ACF3D447FB9B2152F006 MICHELLE.SINGER
889,546,110 *5C883BC6C49C8DBF0FD45AB946657988D45507D0 MINER'S LAMENT
889,546,111 *5C885F17F1D9A900A198FCF08BAB21F0ABC2824D SM3RIG
889,546,112 *5C89FD5086216112982DB4C067CB6D335985518F mitcheldozar
889,546,113 *5C89789696779AACC35C1DE5AB4470286CAA5D13 MITCHELMASER
889,546,114 *5C8DED323B3EA6F765CC68DBA0BAE6BF9D9DD2AA MITCH.ROCCO
889,546,115 *5C86734F0292DB794A2DC979CAED2E90DF0D41F8 STARDUSTER!
889,546,116 *5C8E12B23FA6F12F809F1E3798AD9343C7D9508F SUSIRANDAMOS
889,546,117 *5C8B8E306096F46915C06ABA8AA0F0945A8CB1F0 TALKJACKSONJJ
889,546,118 *5C8C83E3FDD0BA0048AFAEE1B833D4C1ED1F75C0 montalbo8
889,546,119 *5C873B8D9223DE968AAE7C3E480325C60BA8B50C TEIO-A.
889,546,120 *5C8995FDF9CE22D2EC58B755CAE35C68F4D887C0 MORAVIA1234
889,546,121 *5C8CB89B95988D5C9D2EAAD9E7AB99B56BD384A8 MOSESCROLLEY
889,546,122 *5C845A47E75B7804204E6DA416CB4AA82F4406A7 mosesisabella
889,546,123 *5C88235E574F23DD59722266F7E1F5CCF64157F5 [email protected]
889,546,124 *5C88287C51C5693D12531AD6CFD7213742794CF8 [email protected]
889,546,125 *5C8E78BD9BAA6543A7D8537A71335AD90BA4208B TRIS MARYONO
889,546,126 *5C820A245C737C2D45FCE32FC599F6D3C1628295 [email protected]
889,546,127 *5C85A1E9637A8723EECECB3E0924196970E2FDF9 [email protected]
889,546,128 *5C8527FC1AEF5070A85CE606F703BCC115A90824 TWIN-BOWED
889,546,129 *5C82D1C8D3DF5C21697DCD797478A5B7C04AD3EF MULTICARBURANTS
889,546,130 *5C88C2A046CFD4BF15A934255B1937DAFB6B5AAE MURDER OF
889,546,131 *5C84E82962A37D7C02C43E31E1876E0D5EBF846A murphitys
889,546,132 *5C8A64ED45058EC588C805C84B0444F467F25122 mxiiivskilgoretrout
889,546,133 *5C852DB37CC7FC521CE146C3A59B50E1759618D5 myricic0
889,546,134 *5C853EEBE5B1BA74E2E2A6F02819570D42F19CFB victor-popp
889,546,135 *5C89F98E7062015148469B0586E61AFDF92B678F NAMFRUT9
889,546,136 *5C86AC61AF26ABB4CC0D268A7208C8B325C2B9F8 WILFREDHANNAFORD
889,546,137 *5C8B5D969162FD9E031F257A7A198DF57B39E8DB natalia.oriero
889,546,138 *5C876325BCC08D38B31261BD30F2B7EF15F69B0D natalie-olguin
889,546,139 *5C89AB111CAB5C0666A5B298C03A4577FE728514 x.4hg
889,546,140 *5C8F9BABB02B633A92E70FFB8C4B04D229AE9764 x.4hg
889,546,141 *5C8B5D31373E75492FB4845A0C3F41DC1E0043A0 YVONNE.OSEI.ODOOM
889,546,142 *5C8636F62A354622386E1193532C60A2BDD519FB NEUAUFBAED
889,546,143 *5C8032A4AD7EDE21FCFE1E262D5A05415E31C63C [email protected]
889,546,144 *5C832D18F29C49BAA137ACC7B5A7545C441589DB [email protected]
889,546,145 *5C8295798FC8113F767411509D547B6513ECF6DA NG.LI.EN
889,546,146 *5C87D80BB2493C6F1B72594C246835263865CBEF nicely done, fox
889,546,147 *5C8CC5893058C29D3526979115B4E147272D59B6 муиззи
889,546,148 *5C8100906088CC5ECD1D843012B3B848B7A53062 Nofuecasual
889,546,149 *5C8A0B06BB9ED4B26A740864EC52927D60FE4824 1buehnenpaar
889,546,150 *5C8DA2C16DB4D72B248EC242BAEECAECB99F415B 1.nhtsauntersuchung
889,546,151 *5C8D576A440C232282AA95E04EC76D67E3FE67FD 1.nhtsauntersuchung
889,546,152 *5C8738C45C5526DB5E5D0D1FC8C19BC4432A2D2A 1.simiatkowski
889,546,153 *5C8F6319E2C54C38EFEDAF60BC40AEE24487B6F8 1.simiatkowski
889,546,154 *5C85E3F5665ADA25F51310A87666A511A1E36D09 nothingbuttheblues:40bluesgreats(disc2)
889,546,155 *5C8EDC9EC87F6D07A44BA97035494BE93454AD36 nrlnqshded
889,546,156 *5C876EDB4EA34493E45164F8D68C54A957367504 1988bebot
889,546,157 *5C8CD45D79651DFD331F64FB3AB3101E48CEE1DF 1ENFERS
889,546,158 *5C8D631650A1A0DA716040C5A109A7C0DBC1F957 NUSITVĖRĘ
889,546,159 *5C88EF1446A5BBC1015C31BCE6521CAC11FE418D 28.05.1754
889,546,160 *5C8D526837EB16465407886307CEE712EC9A23F1 2SCHWIELEN
889,546,161 *5C8EAD0B4CA18D6D764148916CB9CF1A093F75DA )O(~~~d#####3
889,546,162 *5C8FB5C3EF1DA494D0107A2F50B176290354E1B6 [email protected]
889,546,163 *5C83F5CD4D5FD60F7F3CD66F7DAF033087C76B54 4PRERECONCILINGS
889,546,164 *5C8711573414DCC9AA29B66490761C91D1C39296 oliverkrance
889,546,165 *5C8AEFBA21CBC85B4419FB591A773062BBE36ECE OLLAA
889,546,166 *5C84D823064C85D5339FA443B8FCFF20286DCE63 5ANNIERUGBY
889,546,167 *5C85165A4B22E90D60ACB6459F41D8BDEA190037 ÕNDSUSSEISUNDIT
889,546,168 *5C82C95A752D85F0042D6E94991CF650BBC029E4 5WONDERNOTHING
889,546,169 *5C8A4F94A0BEC75D8E22F21412AF3A07B43C5B75 6AGRADECIDA
889,546,170 *5C859FEC41CE599F1601467070E646B81787E4B6 OPPOURTUNITIES
889,546,171 *5C8813EE32774B161F93A85EE16F8839E2C952BA 72neme
889,546,172 *5C8483C6A7E3E975223421D33A4ABA1A983C82AE ORGANISIEZ
889,546,173 *5C88DDC2D2F2BE752966684B69F0AB56D3B83CF7 7ILOVENEMESIS3
889,546,174 *5C83B3F80C29B9099E3A826760C7E3BDEA8D92EC „OSNOVE
889,546,175 *5C8F9BC0E2CE8FA6DA1AA4E3F4340A160C13643E „OSSEGG“
889,546,176 *5C80E43677A6D34DFB98F48693EFF01772DE09D2 8DESMODROMIC
889,546,177 *5C84B7E7CFB2173AC4615F23237D15B11701CC26 [email protected]+N9
889,546,178 *5C81D8EA90BC8E2D389A050A67FA3563F8B8AC53 overoptimistic1
889,546,179 *5C8C2538030076A018296AA1BA2B21915F9CBB32 >-<~-~(##p
889,546,180 *5C8FC1E3571DD4907E6DE3955A7FCF390DB1505B <P><ANAME="N_349_">349.</A>921DC00000045966.
889,546,181 *5C8B08CAB312E45736AFE44BC886A17671037216 PA1M1TONE
889,546,182 *5C81CF262A2A33A5582941F7CD2AE576D85EF24E A&-TZ
889,546,183 *5C8567A9C5BB65547931AB07760610AB5D542847 aak0%
889,546,184 *5C8291E8AFB118CC9F98508BFA1AF94FD565FB0A ARA
889,546,185 *5C810F60142F7866EC13DAF870173B4AA0E7E9DB adjonjen4
889,546,186 *5C890A4D9534332FF838D17D837F46515D5E6437 P--D~(>_<)
889,546,187 *5C8026756CCB1FB9D2B9706A711923983772F6E0 PENNELLATE-DI-POESIA-PER-MADELINE
889,546,188 *5C8689612134456CC9B66FAAE20224DAE6B2D772 B0WN
889,546,189 *5C88F7864E5F74F9E5F2619A7F0CC4B91E978F59 b?svm
889,546,190 *5C83D6D9009A45A1329DC056F30627FBDC1FA29E bdownemd
889,546,191 *5C89F8A05D15F98F6C8F0969445CCE42E1593A5F bu1)q
889,546,192 *5C82BD5CE1BC7167BC92750F7DF30E69A2229BA2 PIRANDELLIST
889,546,193 *5C8CAC65D6C605A1FB4C16672E2CC1483F0B03BF BETISA'SWORLD
889,546,194 *5C85AB45C08EB4A21EAD15535AC518C4955A3F20 BETISA'SWORLD
889,546,195 *5C8ECCDD4C2687B5E0750CDD55C3CCF59365703E PLANTILLAS DEL COLUMBIAHIGH ROAD
889,546,196 *5C82CA62BB53DB09CA912D9DB23E8422BED0AB13 PLETENS0
889,546,197 *5C8D24DFA78B0915DC009232D679B722E3F3F844 BQKD
889,546,198 *5C8EEE35770C01A3B557332BE236A08B422B9B72 c?q/?
889,546,199 *5C8F185DFC32B54A4F6CBA3D17CDB39D447E3826 cifmh
889,546,200 *5C8B992E14C6D1912B6966A9AE81B0F3B114BC01 prelude(nochoir)
889,546,201 *5C827AF8E8450E1BCCE725A66C9C988AD68294FE produkternes
889,546,202 *5C8E3143C20C18C737AA0DB44A2585B2B0518D31 DFAWTBHP35
889,546,203 *5C83FA3EA85000E45B785539F8741DDD452246E1 dx_8$
889,546,204 *5C85D412E42D9B4F37C15C06B3B45F9CBDC5E695 [email protected]
889,546,205 *5C8429EF0E3E0F178EE23BF74762749DBEB60FCC PUT YOUR DRINK DOWN (LOUIE VEGA MIX)
889,546,206 *5C892778C897DA06C919D58157F9F5A835D19648 [email protected]*)X(
889,546,207 *5C8B6A4234235CD19BDB3839F7D625B6605D89B7 pyxeqdk77
889,546,208 *5C85790E9D29268B60D5BE3565AE47FD7B69E57F q======d.~o.(^_~)
889,546,209 *5C8BB6EEAFC4FEB0305D6E540B556896A0A549AA ee7bd
889,546,210 *5C88478AA16FF3D779ABD0062A36E313B49A3C08 ee7bd
889,546,211 *5C851BE6F627654D8CE97C04FD4BDA76A31EBE53 F\XE
889,546,212 *5C8094620972B4AD22B44D0D597A29122F0E311D GILLESBARBARA
889,546,213 *5C8FA7441BCBD038B44C3609051FBBE81EE002B7 iaretrueh6
889,546,214 *5C8BA4C16D6E0ECD3B11A2E20B0ADAD863357A0F RAYFORDGRAHAM
889,546,215 *5C8D0E9AAED73477E21618562EF414C89E0317F3 mávtr
889,546,216 *5C80C08377DF3509D5F3BCFD286ED2019533EF4E nazihah
889,546,217 *5C85537AC6D81D0FF118F10638559679ABB7FA03 [email protected]+ions
889,546,218 *5C8142DFE957AF3051E51F817F406E136B0670B7 REELSKERINGS1
889,546,219 *5C8CA1B18E8FE55EBD437E0CFBA2CAD57E3F01B9 regionalredlist
889,546,220 *5C89A186E260FA7184F1682EF347B94BF3CC7FA6 TBastow&GeoffBastow
889,546,221 *5C8F3E3AB30E773E1023A37A43DBD2A4EC62DF3C TBastow&GeoffBastow
889,546,222 *5C8B23DA4DA84DDCA35C7D40B0093C6AC5E48F7B richbrau9
889,546,223 *5C8EFDF3B477A7E211D7179959582DFCC8C4EB22 rickieozga
889,546,224 *5C80759129F1AB3259D515B113727DE474B3707E RICKYBROTEN
889,546,225 *5C8513523B639476395BD8CF2ED525502A923A7A ABEGLÖST
889,546,226 *5C8317B128D1447CF6E70CBD22816994E6F48CC0 RIGIDITA3
889,546,227 *5C81AD3307F9E5A2087C94F42794ECE5A88399F1 RISHINSAY
889,546,228 *5C849138D8BF3A77564B5F802AE2C54D735A04EF RLAGETS5
889,546,229 *5C8360F717CDC873275AAF6DCAB3365B57C8830F rmcleod7
889,546,230 *5C884F91B291ECEED6F5021C3BFB90A366E8A737 APYUTTA3
889,546,231 *5C84A62B89709306800ECE7B47469C024A9A4443 ROD.FOULKS
889,546,232 *5C8493A9C67D38697D4A7B157BC2F1F6A5CEF4E5 RODGER.FANION
889,546,233 *5C8D54A5087B466C4699C4BFBDB19D40E30F1AC7 [email protected]
889,546,234 *5C807719A1090DC8E80DF3CC9B1705B897B5A2B0 [email protected]
889,546,235 *5C8BE63AF6DC7C9586D1A599BF3F2A890D5DD5E0 BIGGER AND BOLDER
889,546,236 *5C8A2EDB668ECD821CA9E688FA3961DB142BF5F4 billiesoriano
889,546,237 *5C80B3E4D4FDC403EA5BAE5F11CEC92C04859CE0 billiesoriano
889,546,238 *5C855EBE5B6226077FE2A2B0A8BDAB82100B7782 ROMEOWEBLEY
889,546,239 *5C8ABAFE786AA8D3559CF3BE5E7445BC3B667DE9 ROOTNORMALFORM6
889,546,240 *5C8EAF860441FEBB186487FA04E89D35C4A7967D rossuhyrek
889,546,241 *5C87B2BE16331FFA1A5ED6C7C8E5387DBE12CE43 ROSUFLORIN
889,546,242 *5C83E03708B8B7127264618788A9487C50AFAD04 ROVFISKERIERNES2
889,546,243 *5C8E7625FA598F293896CFF05EDBC5CAA1A12B8C ROZKAZOVANICH3
889,546,244 *5C847868F2F10427B9797B073DABBD3C27AE9803 CHASEGALVIN
889,546,245 *5C889784AB1D5D171F61A9AFB077250422E0770E RUCKESS5
889,546,246 *5C85631DA0503C6BB18990634083967196334AFE ruizperes
889,546,247 *5C83DCA12F118CDCA5F5E27455113D6D1D18FB2D RUSSELLSKEETER2
889,546,248 *5C8CD78FA2AC35F8FE6FA0356A9AD1F71E159766 [email protected]
889,546,249 *5C8486AF34E890258B5212D7866DF5FC9F918B5D [email protected]
889,546,250 *5C81B194D81E2EA69597801F2D97913F8108337A DARNELL.WESTHOUSE
889,546,251 *5C8F5ADA7A05678F5036A9BB3B7B7446EA4BDD0E s1[c
889,546,252 *5C83B9954C7EF3A13460CDB01C7BF7B30CEC2B74 SADAF.HINA
889,546,253 *5C8DFEB3C2CD9F8B50540F07C80BE5379F2303A7 SAFETYTAFFIED
889,546,254 *5C8F7793EBAC09A860BA50B7E1BA8C27DC14C1C8 DIONUMLAUF
889,546,255 *5C8C5D5F8EB03484208F27605199AA6822F4DA94 DOMENICBALDOMERO
889,546,256 *5C827665E1B479D17AFEB032B21DD44AB1F3C4CF SALAISESED
889,546,257 *5C8A5A75FBA5C045C1E56071162A577530458C59 SAMMIEMEIRELES
889,546,258 *5C87AB1493BFDFCA22F1B7F07EB5B49CA8290926 EDGARDO.LIESKE
889,546,259 *5C8931573A5A5B38FABB9A7B413201F14BCAE91E [email protected]
889,546,260 *5C8B4E3880F8E14DB40F98F90455A9F83050C2DA [email protected]
889,546,261 *5C8FB54C8A208BC6E79BE36F7EF3F545359CAA83 SANTO.ROBB
889,546,262 *5C8AF4CC0BE9F6408CD50C690EF4E65F8AD01892 SAPHRJQN
889,546,263 *5C8C3E551A5918F36CD90AF787BBAF44AECA6F07 [email protected]
889,546,264 *5C852C4F6305F6E1C419C494C54E912F55590586 ERNESTO.KUGEL
889,546,265 *5C8AEF3AD6B8CE2EF23D4D3DC5D64080EA11854A SARMISTHASARMA
889,546,266 *5C85501ED03D9D17FCC13983CF3BCE74D9A8B62A SATWATER8
889,546,267 *5C8C700C7295EF19D6EA719C69E26249BC80ADF5 [email protected]
889,546,268 *5C8E90A08590F714B77C32E29A28BB286594EF8C SAVINÕUTÜKI
889,546,269 *5C8CFDF37700D270440C069C05F7687D5FEFD98C sayma.akther
889,546,270 *5C8234F497DB7B03FD64E88DBD465CC499E49CA6 FIRST-OF-ALL-(CRAZY-PENIS-REMIX)
889,546,271 *5C8B6D700CA3709FB90429D5A3340FA41FD55563 sccscdc
889,546,272 *5C8FB5BF5BF1DFE70B0E9D10DE9811A422A0F7AF SCHOKOLADENTAFELS
889,546,273 *5C89CEC8BAA3B1608508E81B8323938F588A79F6 GEORGIA–AUBURN
889,546,274 *5C81CD47D600249BEE671CBFCFC0AA494DA69E82 GRANVILLE.PALAZZI
889,546,275 *5C8E03F013907ADA3A2F4C710A888DF519CDA2B5 SCOTTTHACH
889,546,276 *5C8B98567727D311B8FA31DEE117EAF75ED698D6 [email protected]
889,546,277 *5C87F3B5BECB4492A1266993AFACDE816BA482D3 [email protected]
889,546,278 *5C897C59C0666A90F088FE959ED62740AAC089AD HAIDILEY
889,546,279 *5C8E74F7EB1C1E5F10CF930F97AD9AB188F715A5 HAYDENKIP
889,546,280 *5C8F98359903271255A949ECDAB9C6A601488B62 HEKATOMBAEON
889,546,281 *5C8F7D4C93D19A9E7985E132D457325C3AC7108C HERSZCH
889,546,282 *5C8933CC86C7EFC51DFFBB84352551A14EBB8440 HOUSTON.DEARDON
889,546,283 *5C87171B1EE7EA2C540AA73D2A653D2B5EFD14B1 [email protected]
889,546,284 *5C873898C05758BAEA92903CDA2BF8BE4E8B7FC2 HRUBY
889,546,285 *5C8C48D04B3711D858878D2C98C1EE1290FBA0CD HSECONDARYXYLEM
889,546,286 *5C8166DB5614DBC39669E660A11DCC2A12661F0A ilovechangeit1999
889,546,287 *5C8F0EFFCBA158004ADCCF4107B941E82BC62119 sewages
889,546,288 *5C853FC7C33CFE8A66153AB3772213A9208BF531 SEYMOUR.DOLAK
889,546,289 *5C8F410C07CF0421B87A0BB553C0EB7A4B0BDCB8 JEREMIAHKAVANAUGH
889,546,290 *5C88E24B978620C581333058C82DBA617AE2703B jerrydelaguardia
889,546,291 *5C8B5921147431F7190C5DF315543175AF261EB4 jerrydelaguardia
889,546,292 *5C8A4D852FCC05C3F6B4FC6C9CE322CB54294FB9 SHAR-KALLI-SHARRI
889,546,293 *5C8AC2D49BF6518537D9F23A72F9FBF9E2336D6B JPRUDOM
889,546,294 *5C87FC4FB127ECC3E7CF4128DE63CF3FB85F9A3A shaynemoag
889,546,295 *5C8F82E7C589CC523043FB92B1921A552FABB2F0 SHEENALIGON
889,546,296 *5C81011614BC2F8329B61E37F264B595DDDB0649 [email protected]
889,546,297 *5C8420259A319D74F5CCC9C96953CFAF89AB06E5 SHERRY-BOAN
889,546,298 *5C8F9DECA15B90B0A24B822BECB267972141DE4A KIELCE1
889,546,299 *5C86E4B5F5BAD3A6906F602E7ACAE4C62D40568E SHON.MASTELLA
889,546,300 *5C8DA7511EE157F1FD64CAAEB7012E0E3DDBF50D SIDHINCHEY
889,546,301 *5C8FA88D422336D236B0B29DC4D57C57FF2AD18B SIDNEYPECTOL
889,546,302 *5C821FD832CED2D277A503FB8C95548FA97EF462 sigillassi?
889,546,303 *5C8D8A30959B2A3561B20F98AD18E4C9180D1258 sitevw
889,546,304 *5C8676E85946BCA005E32A3B7250131F045188B5 SKARPHET6
889,546,305 *5C8A0A9468675A3B2354B5BC123F517700CA99DB MARIANOGOODMON
889,546,306 *5C820D37B52679C10EB21BFF205D4F4E7D899766 marlon-cinense
889,546,307 *5C894EEAD9CB473ADB28227F2DEBB251093C661E marlon-cinense
889,546,308 *5C89F43E8D417F0C075DC84705970E132BD4865F michaelkessell
889,546,309 *5C89C271CF4723DBDA9FD5A84B955706B291E7A2 SLEFEVRED
889,546,310 *5C8B09BE93441A84A5427A539CECE01BB991E01A [email protected]
889,546,311 *5C890BE2020113C06573200C27139440C9346F1D SLYY
889,546,312 *5C86FFBCC3F7F527A0C8FB12716CFC68B8985CAC SOBERIZE
889,546,313 *5C81F165FD0E673FFF3DEA8ED9918F93B6C70C10 SONATENO2ENLAMINEUR:IIPRESTO
889,546,314 *5C839BAC7128ACBDD832BDFC3C0A6259AC7CF231 SOOVY880226
889,546,315 *5C8D077B543BC67F2C2E4F5CDCA22031C7019F9A [email protected]
889,546,316 *5C89273D6A6BCA215E87D90D7E65592671B4413B PETEWILLISON
889,546,317 *5C8266E653C176BBF267497DB0EC998E475DE814 PHILH4RMONIC5
889,546,318 *5C86F581988A142D10EE6C061FD4152181943E93 SOVNARKOM’DAKI
889,546,319 *5C896986791FCC25FA933AE3726A09D509EA6AB2 PORFIRIODATTA
889,546,320 *5C86F12DF120D328DCE41A0F7FB52C263AF795C5 SPANEGEOLE.
889,546,321 *5C8B392E13274EC093B0E64F75E0CCE6BEA78DDD SPATIABITUR.
889,546,322 *5C8F0EFFC14FA7E3BD4A655F870C94A3946AB976 Q==>-*-*-}8{
889,546,323 *5C8FB08200E53F60BBC0AF34FA888D87C9BD11FD SPLAT ~ ~ D#8
889,546,324 *5C8055C29AF399124D2AB857CA401126D95EFF1C REMPOCHE9
889,546,325 *5C823743C56FCD0A0D9FD18EDDCB491CD4864CBF rick-eby
889,546,326 *5C889D2122EC843C48788D52E15C8548410C63A7 rick-eby
889,546,327 *5C8527F265B475322114DA3671BB68FA5911CB56 rufushohnstein
889,546,328 *5C85A6C4CD70A6AD0DC5DA710F2CF81557D04F18 rufushohnstein
889,546,329 *5C8B2287FDA5C499DC5E5E3AAA3A3E2B7C7DC03A SAMISHARAHMAN
889,546,330 *5C89B925A849C2457FCA10D539D9458D5C6E5331 SAPPYSINGH
889,546,331 *5C84E8171E7502D46C1B85590D2D64BE69F7AA79 se11ingp
889,546,332 *5C80F0250CB43CB08E141064FA459C8E076F5C0A se11ingp
889,546,333 *5C8CD5CD392C08528331E94D558F9F08A61FBA90 solneuenschwande
889,546,334 *5C8EA9A9832E875FA4482E4AC7724576600FCD94 solneuenschwande
889,546,335 *5C87DFF5BF9754E7A6FC04CE504F91E3A13C9D9E SOVISLUPER
889,546,336 *5C83D20B788522B7E7FBB941096943425DE0111E stiangierfne
889,546,337 *5C8947D91C7649BA42EA0909BB461ED6D3BA9940 strangersdieeveryday
889,546,338 *5C861A149E5FF50D5781B42C078E22E835E6F38E studiesmoosh88
889,546,339 *5C82A8B003A14C0597670DD35AD6F67E63477B28 TERRYBRANDL
889,546,340 *5C81D61DD435D89A18348003780079D5A1C8B537 [email protected]
889,546,341 *5C81E53DE3B53BCC72D78BC25D7FC7E068BCE4FA TIASNADED
889,546,342 *5C83DE09253581A28C0506146F72915F0CDFCBA0 SUKSESVERHAAL9
889,546,343 *5C86E9C1691FD0747C0ACDABE8FDC84653778ADA TPONGKITTILAR
889,546,344 *5C8278667BC7A285212A906B6AC597B0A4EFA543 TRIXIE W QUIRINDONGO
889,546,345 *5C87C0DB9B9FD87269EBA39552302E080EF9558C SUNWOLFMAN4
889,546,346 *5C878B28BDFD8E462F282352531F980CDB9D3565 [email protected]
889,546,347 *5C8A60E0BF47D3509AEDF1F60D9D68D78B10CCDA SUOTURVERYHMAE2
889,546,348 *5C8160D526A09966FDFF69FB9DABBFD5676F9394 TUAN.ROSUL
889,546,349 *5C85316030EB149ED7FC9905414CEC1648AE4A90 SURCHARGERAIS4
889,546,350 *5C84109092DA446198F242B4F625436A40CD008E USEMDOEFYP
889,546,351 *5C8F7657E618C9548CF13F0759A4B65668133ABB swientochlowicz
889,546,352 *5C8C75EEE7CEABAA8A255E22F1682C59791BA416 SYDNESS9
889,546,353 *5C8146C303C9B5BFCB9A14EF8C373ECEBE63BC37 [email protected]
889,546,354 *5C89CE6753B2A91324E654DB7E1F320BB025957D SYLVESTERUDELL
889,546,355 *5C8ECA774CD6611EECA650202A8CEA905E22E28A VNCHECKT7
889,546,356 *5C875E215546E0C373AC5735A3CCD7891F15B72D TACBOBMIK
889,546,357 *5C8C19E999355C6538CC660A055E5E3810FC317B [email protected]
889,546,358 *5C8F61494EC1F53BE0464A879D5ABBB1C7BF2165 taifa-de-zaragoza
889,546,359 *5C8120954D24363E461727C62601131DCCA72E2A WILLIAM.AZULAY
889,546,360 *5C8B95B8B67DBA350C4E5E847F3A35E7FF09154B talkincasey
889,546,361 *5C8E138E6E3129EBAB94AAD06282A65AB3DC8FC9 TALKRIETBROCK
889,546,362 *5C856C9FCDDC20C96D17293DE56560A0F390D921 TALKSAIYUKI456
889,546,363 *5C8487994F6FBAB0026BE628B214723F5B992519 Y548791
889,546,364 *5C8537D63153035A52E547CA7DF684B69ED5A71A TANNER.CIBRIAN
889,546,365 *5C8234B3B22A1C9D50559877C85259492B91CB12 TATVOJASUKNJAMALA
889,546,366 *5C8493DA6F72BE85CE86EA9EFB3DCB7075923D62 ZACKMIRAGEAS
889,546,367 *5C80BE27E04CFE205C7073EB82067986EF2898FC «КУПАВА
889,546,368 *5C86403A75676BCFCE9E949E97BF9151740CEA6D tegenpruttelden3
889,546,369 *5C82B8CC9311D9E74B0E8E735D0756685DFF5899 TEKCIRCM0
889,546,370 *5C8C7A7E41CCF02B3D57EF31F27B7136AE50938B теце
889,546,371 *5C8B71F32F48885CA2363DFE06BC4623C42FD5D2 TERKELLIAN
889,546,372 *5C8BE5A6E19F2027C052699A481E83F967688E80 +H3R4P3U+1C4LLY
889,546,373 *5C8D38695CEB45C4F5DE5CA145AC8FB915D27AF3 THATREX92
889,546,374 *5C80500A2CEA3B4432237C3A9B8A0AE92B8E9AC2 the-achin'-kind-(by-michelle-phillips)
889,546,375 *5C8B48E71A3885BF30CF1D0002520796D1F8E0B2 the.big.come.down.(get.back.mix)
889,546,376 *5C861A00EEC3063AE503B1D970B01C017D390D82 the devil and i
889,546,377 *5C8D8E717D821C5B9D8CD75AC1EA5F5284A19208 thejenni1
889,546,378 *5C8AF4CC4BE4630081868410E8F212F51BD4400F THEMISLEADINGHISTO
889,546,379 *5C8D7BE188C24ED221C06E6B9E80499DDAEBDD0F 1287870 saatomaksesineliv
889,546,380 *5C802F77ED674C15B30E9D762832C0DC166C29A7 1287870 saatomaksesineliv
889,546,381 *5C8701A9B3497FD8EA87B54BBD7E3EDE7BF9CE3C theresatrucks
889,546,382 *5C8F02DA656AFE50413FE04F5DB995712C4598D8 THEVENONBSW0
889,546,383 *5C870590322C60D55E70A6BDE646C3E5541BF2C5 [email protected]
889,546,384 *5C8CBA0DA5335B5CB66E6C21FB4CD146AA673ADC tiettiet6
889,546,385 *5C88CAFF9123661AE11A2639B94E72A9DC92A20E 24.karsilastilar
889,546,386 *5C835F24E521793E039BC0BB5343E781890BF1BF 2fmcbios
889,546,387 *5C8D8387444DA5F11998D75E11F003269305AF69 [email protected]
889,546,388 *5C8EF1993122ACB538F4CE2F5E4ADB2096054562 TLEMMORF5
889,546,389 *5C83AF796B66FFEB38A0A594E833931E5EC02773 3ROSSINAN
889,546,390 *5C830317282BC1F635BE024B33F32ACD5D3CA6A6 TODD.EGNER
889,546,391 *5C8173614DBBEDD5AEEF57036DAF2144C05B138D 4NETUOYAL
889,546,392 *5C8A779C37B512CFD99632B0874A020AEC453A0A TOLLAGE
889,546,393 *5C853BA6A3B5D80A538D7C7F5709522EE321B952 tramelli8
889,546,394 *5C81447B6836A74EBD7C7C794ED36FEE7AE1D94B 8.WACHABTEILUNG
889,546,395 *5C8D1A93007F54A27B81C477F94510756454068D 8====>-~o-~o->-b0
889,546,396 *5C883E63AAEB81F09835F7DE8C393259936D010D 8====>-~o-~o->-b0
889,546,397 *5C803FFE5B14003DC9CCB6BDC18D0242DD5AB593 TRILAINE8
889,546,398 *5C801394BB74683A8950BB6939046E43DF8312E2 tri.widiyatno
889,546,399 *5C865B027ECC524F61B187A496186CDD667EE120 TROY BORER
889,546,400 *5C86AD8042DDEB171A825311A75C1BB915B2AA51 troygrigo
889,546,401 *5C828B927BD4D46DC5380F28E45C7A7727FD9819 9SYDSTLIG
889,546,402 *5C89145E2FBAB38A5A4E8989ACE96EC12F16F0FB TRUOCHGI
889,546,403 *5C8A202F038A029E080A4E4D993731769FB6624E ttapearôari
889,546,404 *5C8C8C0E7E24B7952D3FA3BC80DEE7ECF6A47E60 A5)Z
889,546,405 *5C82A827EC5EFFAAB3383AB96B3CD2B08FC4A59B ageenstijl
889,546,406 *5C80C20AEA46D4062089AAF373172A402983F3E3 tutoy-torio
889,546,407 *5C8431ED1CA6703346DFD44B8F7BCEC24C026A2D aotu
889,546,408 *5C8D01A6301EE9889A8718EA9284022934FB8A51 AGBZ
889,546,409 *5C8B945F91B931F7BFBBC1A77F223E1E391BB7CA TYRONE BEAUCHAMP
889,546,410 *5C8BB634C4EA210C645D929D6690C41ADF9FE0B9 tyrone.goen
889,546,411 *5C8EA39DF223D0C850B385FD4284232A1F2884BC arellirpping
889,546,412 *5C81BA336A92D1F2B4432B3CFC0CB41C9455AB02 $U8L1MA+3D
889,546,413 *5C8571C0FF59C15508489662D0FA745887F9DBEA b3t0k3n!n9
889,546,414 *5C850F6EDFC789B656D498F5B421FF8DD088E14F ba0s!
889,546,415 *5C89B080C1BE2E8A74C773F08C9422038F387715 UNREL1A81L1TY
889,546,416 *5C826E1B71446F15E249FCF920D46B391B6AD131 UP80
889,546,417 *5C862E4BD1ED3507768F540C49AFF7ED520DD929 us-passion,teili:xxvi.underkamundfandseaberschlafend
889,546,418 *5C872D3457ED4CEA9D4201E072A384D67F48B9D9 cdqmt
889,546,419 *5C83A4FDBCA6E097DFDA70E32C8BFEEA1B9BAE92 cloitrenotredame
889,546,420 *5C8ABED394020DAFE4F0DF57E34B208464751118 concertofororchestra:ii.cappricionotturnoeariosovivace
889,546,421 *5C80E7613FC92DD9388430409D8D7D86FD2B565C cseta
889,546,422 *5C8E6C5DA4B3D54D1D1914F8B359E9903A7BF347 d7c/3
889,546,423 *5C80F39AFADC7096376F972C60CA812CC34D25A0 d9==
889,546,424 *5C85733F728F649352AFF9950727690F4C3120B9 VAZHAKILADZE
889,546,425 *5C86A7BA5D811C0988B85710B3D8A505969DD3EC danzavillalon
889,546,426 *5C8F50775280D99543D2611F868A5D21E27B2BA1 d_jwe
889,546,427 *5C8A1880A647A9B67427B7AE495E8D7A8FD26676 VERNON CHETTY
889,546,428 *5C89CB43897071B9A5C1A5E55CB52215D0D8801C veronica-marin-kelly
889,546,429 *5C824C9E44391E50478EE78FA0A2A38DD912DCDF vesapapraniku
889,546,430 *5C850CA44C160A448AD69ECE8A92A1C3071BDD9D DUMMY,.SPIT.THE:.GET.VERY.UPSET.AT.SOMETHING
889,546,431 *5C8AB176CBB9D71E034670ABD6064E184C1C69B5 [email protected]
889,546,432 *5C8D84A96C2AF03ECA7EDE072FC4876B1A05A1F1 Video
889,546,433 *5C8659F4F608CAA2E6FD74737A8F2DFF159185FC VINCENZO.DEBROT
889,546,434 *5C88D6DDC11ED7491F8A27041D046FC939C8C4B0 fguantanamo-detainee-lawsuit-claims
889,546,435 *5C80EAA9E68E82F13B9C20F723710F403968D868 VIRKISTYSKESKUKSEEN5
889,546,436 *5C8B442C85BDC240E5F353398BBA1AD451D32292 visokoskolcima 2
889,546,437 *5C8AD0208B24E6ABC088A0D746CCFAA5EC1FF50A HOWARDGRATE
889,546,438 *5C861BA0A0E469E60015FB6F3C8AFF7974274B07 HOWARDGRATE
889,546,439 *5C826D7349E1940AF68B7A530C9D338A75F84A5A ilpqnwpehdu
889,546,440 *5C812C47BF7C53F74C19A40FCBD531A9168C9F70 VONGCHETRA
889,546,441 *5C820E673092EF44B51B9A7BCFA1CC4FC3E04C2F [email protected]
889,546,442 *5C8307A4906D5897FE8015A961D677706B7AA7EC VRCHNICH1
889,546,443 *5C851DCFCF98703FF750FC96885331EB407C30C1 [email protected]
889,546,444 *5C89F14031E115C73C555D01ECE51EFFE03CED2C KSERIET7
889,546,445 *5C85AD13169A256DCE41B959F022144F2068C73F waggle!
889,546,446 *5C88BB2B057FE3AD45C8D1A774B3FF666CC3B1A6 [email protected]
889,546,447 *5C8F3D0CFC130C2CBC27E5E3425AE1BEA4674264 nishanth92
889,546,448 *5C8236F1825E280B090544CF1F4FF0634169ABEE WARDDANKERT
889,546,449 *5C894E328CFA518EC73F97471C3A984E6A242CDB WARRIORELIZABETS
889,546,450 *5C8924750E555A55F5B80ACB8E6EA03F814ACF82 polynomialists
889,546,451 *5C88369D1421B306CA5632898E2102C9FEE356C2 PROBLEMOMRÅDER
889,546,452 *5C8A03A4014473E41914104245547A93432A9C46 [email protected]
889,546,453 *5C8D7CB9529C6606A83BE60E9B3D9005C4548A47 rameront
889,546,454 *5C83134F24082E94DDD227902B4C1F04AD5A62F7 [email protected]
889,546,455 *5C830F3441E44250B5C7E46F2CA25971C64B05E1 wernerzunker
889,546,456 *5C8FE60C76098AEDEDC6D1E3EAD456909E66214F WESLEYLEZER
889,546,457 *5C8CC9845B13CDC65BE004ECB266DC0D15340A1D WESTANIOUS
889,546,458 *5C8529ABF9078CE189CDE68759311D56B767E4A8 west.end.girls.(extended.version)
889,546,459 *5C89A2C3AABF023491F15F719225E5D9B03DF49E WHEN.THE.CHILD.WHO.WOULD.GROW.UP.TO.BE.ME
889,546,460 *5C81761B671DF1B8A5C9CD41BEE3157BF676D0B0 TNEIANITSBO
889,546,461 *5C820118A7344C54BF22B4FFCF76D6CE0F412C5C WILLARD.SIEJA
889,546,462 *5C82E1ECE4779360B74DF7DECBB49B69F6DEAD34 xb8jutl8qlchw4
889,546,463 *5C8372D40946A7B5251270ABD73C64C6A999570F WILSON PARDINI SALIBA
889,546,464 *5C8EF7A4B88BE11E1EFE3097FB0D4B45644E7892 WILSONRORALDO
889,546,465 *5C8F10F110CC23F27D2D57C57814830667B0BD26 AGUSTINTERRITO
889,546,466 *5C8ECE777EAA80C047D694A032136589D0ACF12C winnie-kermorvan
889,546,467 *5C84C4E059AE6809791C69587B497EBC80658CEE WITHJ
889,546,468 *5C8D2CD06C1C2EE1C794C7FA6307FE9A9D6EADBC amanda-wagar
889,546,469 *5C897A18F864B1685E2CC1AA5C329F61CBE9153A [email protected]
889,546,470 *5C8C5FBF3865347BC4F48CA6E8B020F080C74941 angelofthemorning:thebestofninasimone
889,546,471 *5C8C7B8FACDA93D9F03C1A0377165CC3D6C30AD9 angelofthemorning:thebestofninasimone
889,546,472 *5C86BA9DFF00ACE6E6AC7AED7A428215BDD6F963 [email protected]
889,546,473 *5C8DD589DA387A0087520D8C7FCC9822BF03DC48 ASTAJAN
889,546,474 *5C8D278F6502F10A136F0B9D800D4C3D147C7919 AURELIOMITTMAN
889,546,475 *5C8E603590B5BD778FE1344B41C1FAC0C7136583 AVANI.SOLANKI
889,546,476 *5C81B673A02DC3AE4F1AAA0B1642A35C57351A3C [email protected]
889,546,477 *5C8326F5927F0DD53F9F487C7409F5C7D11EA657 [email protected]
889,546,478 *5C803F05FC399F005E1D46282F8D4AFFF573FF40 w('p
889,546,479 *5C8032E1EAC3E5F51E509083B20906632F46788C [email protected]
889,546,480 *5C82BD01B9F5828D6B7C221B5CF9F3DFDFC59A23 [email protected]
889,546,481 *5C89AA6820940727915C9535A4584584F2C22FA3 WWWADIRONDACKCOWGIRLSCOM
889,546,482 *5C87FC2DB4F2321D467DC40D89196FB77712F007 WWWBABYKITCOUK
889,546,483 *5C89F59A6CD5D34564324D0B6C2E5BF13EBB75ED bobbieanastos
889,546,484 *5C8A8FF7E7E2FB529ECB29F9057C688B0B249AC8 bobbieanastos
889,546,485 *5C83CB2638FC07F1270891C6606119EDCEB236AD WWWVISIONSOBCOM
889,546,486 *5C81644516A06E04C065A117B6776D31445470F5 [email protected]
889,546,487 *5C88C28A04A744876E723CC12B4402B0E10CA585 [email protected]
889,546,488 *5C88D7CA8AA36C4EA44FD2B6939EEB5B347B9FED [email protected]
889,546,489 *5C8E22093CD7BCF4D96FF8DF4E6D9AFBD441D95A XAVIER.PANNUNZIO
889,546,490 *5C81E43F55F20116BF1C3E81AD8521734243E69E [email protected]
889,546,491 *5C8BCC71BF30E75D7ABD5F908BFB4B7AB17137E2 clintonoyer
889,546,492 *5C8A5DCB19DD85A747E367315EEBCD2667E23A81 clintonoyer
889,546,493 *5C8DFB54BFA360447A9CE1EADD6B2F895C6D1EED CWG1924
889,546,494 *5C8D7F573127D6AAED78354B2A20FD17953CDD5E [email protected]
889,546,495 *5C8C3067554A8FBC4D5B9B71584EF92C0551E015 [email protected]
889,546,496 *5C893F95DF16527FB379A7FBFB773A75F53C784A [email protected]
889,546,497 *5C8190E4968445B2F7016BB3582863F2D83A516E [email protected]
889,546,498 *5C8E248A5D13D2494BAC16EE3E057751E4FF11AB [email protected]
889,546,499 *5C823628C1AF1C64EBF9D2AB39A7217525CED235 [email protected]+!E5+
889,546,500 *5C8EC91CA82CB873FEFAD139682E4A4E1247956D yk#*
889,546,501 *5C86BADFADE8B8DB406DBBBB82D0AE34459A651E YOI
889,546,502 *5C83A134715C292E7E0849DF79F581D9B206746A YPATS
889,546,503 *5C81F1F651A83C15667F865D509DCD00A46B756B HCTIB.BBS
889,546,504 *5C8D57226A4518EA6F14E3B98C3B5CC8E28DB480 YULIANIAYUNDA
889,546,505 *5C84479581C735EB34D6295012A6C08D047F9B2E HISTORIA-DE-MINNESOTA
889,546,506 *5C803A324A7721F3098B5A8B358414571BECF898 yyh
889,546,507 *5C872C86A8EE1244AE31C6E312B47668D81BEA88 Z6YO
889,546,508 *5C865B66DBBF9C3D90DB2CA23D3A6F226AC46A9B ILOVEEASTERN59
889,546,509 *5C84D403E87DDB793160F19E7D992571030C0467 [email protected]
889,546,510 *5C890194B5C3A8987D546DD9B1F6CF6E8219BB74 IRACAMPTON
889,546,511 *5C864E10BC0C07E1FA619CE4D20C5C72A6E3F096 Zatst
889,546,512 *5C88A71AB3CC1E414AC25C6E91AF51EF7E365588 JNICEM
889,546,513 *5C83B393B00EFC726D4D01CBCA92F7657C860B65 [email protected]
889,546,514 *5C8B02ADB5200941B0C0A215F725E5D23452067E [email protected]
889,546,515 *5C868F21B03982C754C3A594DC6D51CBA015C731 [email protected]
889,546,516 *5C83C7A84B3BDB19401CC2A446ACCE5136C5CBAF kellyshores
889,546,517 *5C8F801B9FA9A9C8B436E4850B9ED43A9CB54930 ZOE.Z.BARBIEDOLL.STEVENSON
889,546,518 *5C850E3C422A685994E48FD4CCD8F8C99BAE66ED [email protected]
889,546,519 *5C8994FECAB234D3104000224EFFC33D94590088 L^}=
889,546,520 *5C8E41CFFC8F953FD14645CBD4BC2B8884E51E1D ZWIJNSKOP!
889,546,521 *5C827C72877BD49DF03367B6B4FCF272AAB6D08A БАНГСУ
889,546,522 *5C88073C97B2FACCE6EF282E6C50B33E0B1E5129 «БАРРЕЛЬ»
889,546,523 *5C8334689B263DFBBE17DAEE0251B85C21B13E6C ГИБРИДИЗИРОВАННЫЕ
889,546,524 *5C8EDC4412E225C9C48757F5E0B8B10DBF97B096 ДИОНИЙСИЙ
889,546,525 *5C8A6AC8915EBD75BAFA2087E9A2F6EE9E5A6F65 «КЭССЕН»
889,546,526 *5C8AECEEE7068A6D7512987B39D2639DCA3A54C2 НАЈМАЛИОТ
889,546,527 *5C8A7CABB57CCC4767471E281901084EC9EA4E49 ПОЄДНАННЬ
889,546,528 *5C889110B23FA51022A8AA18E7F0FBB7ADE26355 примењивати
889,546,529 *5C856628DE675A1FE258A88B185CA7015D3A3C32 MTKXZGFHNZI
889,546,530 *5C81BA84D7E26C67D7A03EA1696F7EADD8511FB4 умбрский
889,546,531 *5C8C2633C6CB547481776E28369C0433B54E9F16 ЭКМЮЛЬСКАЯ
889,546,532 *5C815340750F016136A2ABFBD7702D778C87990B ЭТИМОЛОГИЯЯ
889,546,533 *5C876488EC8A41ABF8B8CB593B8F4BB33693C30D NICKYPHARRIS
889,546,534 *5C88A5636BEDD51590D6973FFE06720D44A71A38 作曲・編曲:BEAT
889,546,535 *5C85D75F5A3A169CB289D5261D9668953E114F1C [email protected]~0~o.splat!!
889,546,536 *5C8757690F454BB31B866A5A824554EE0C9382D8 [email protected]
889,546,537 *5C80778A2A64DBF4687F6B55D751D6A4FDA4326A sarahlen07
889,546,538 *5C822D08B49FC095F83B7E67C67F319CE0F3D808 sarahlen07
889,546,539 *5C847FD0C3A3AB16BC297060687E5F301853A3CE SIMOLESTES1DB
889,546,540 *5C8FDD6B5051D65BB08862B47BC7392273481184 spreadsheetb
889,546,541 *5C886AA5DFB5ED4A2CAF5475774BEE03398913E0 tk(x
889,546,542 *5C8C4AA03B18EFCA1C503730F91D3FDF6293A0FC theodorepaciorek
889,546,543 *5C88690C2B329119A1DA519C6A5D39B5E2B98CB7 UNENCLOPEDIAIC
889,546,544 *5C846692EE802580A25B7C5053023FABC7268CCF urlseronegative
889,546,545 *5C8B0CF23E2FF7FD8C5796FA4D3F30E8F0B3CF40 vintagevocabulary
889,546,546 *5C8229A2CCD11BBE9281D67ED38EEBDD72E9848A vintagevocabulary
889,546,547 *5C831236D9F0F0434A1759970351E7948E422047 WILLARD.ELMS
889,546,548 *5C877E415F3B26342F1E39E19662AA82D303F82B НАПРАВЛЕНИЮ…
889,546,549 *5C81D3DABF7896041364DBC0B52C4401C48B3EDC „GEMÜSEBAU
889,546,550 *5C85482827DA281A8CF3A707E713F17AC5714756 舞台「錦鯉NISHIKIGOI」吉田役
889,546,551 *5C871F33DFDF3B207739AD72855F0008060467BF 0-oaaa
889,546,552 *5C8144BF9928F1574D005537F144C504780A05CC (0_<)o~o~q#8
889,546,553 *5C83C843A17D7073ABD765EEEB4CCC5673A7ECFB 0VER9ENERA1IZE5
889,546,554 *5C826B956A771D0C613DF35A5F5582AF17D32BAA 123TOROIDAL
889,546,555 *5C84BBB1FCB711D2D1634940E7D5295A9D58F225 1293705 sukuseuran.j
889,546,556 *5C87FED4F8A73F5E7A0069E76A49EB4553790941 1369008 frontpage2002sis
889,546,557 *5C84717013785D2C739D7AC9B7E8DC64BA8A6312 1835871 LUISTELU.ON.MUKAVAA.-.JA.KORIPALLO.,.K
889,546,558 *5C8FD3F113B4CC21F88184BFA04481E5B5718518 198457 "-THEY-CALL-IT-A-RETIREMENT-.
889,546,559 *5C89B60D36760B996AA989CC97FB538C9B66818B 1 BEBILDERER
889,546,560 *5C8F063D74C2C1A2A8366FD5908A8656F57ADC8A 1 BILDTEILUNG
889,546,561 *5C8ACFBEA5E0D45E597D6ED5B7D17E7CE6D5A9CF 1-bls-preis
889,546,562 *5C822DCED314FADF1723A9BA6CDD72AEDFADB94B 03CBB5B5A3473BCC854FB09133A94C87
889,546,563 *5C81BA981C18BB126BE8819A5E0B3FEA3FB5BA21 1 CD-MERIKARTTAPERHEESEEN
889,546,564 *5C88659C069BC5D586312E4BD37C54D68AA1F3C4 1.DEPOT-VALMISTEIDEN
889,546,565 *5C8BADC2D2AFB02A7EFDF348ADF9AAF5AC81DBE4 0BAC8E46-E4A5-346A-9061-72DAD2A1470F
889,546,566 *5C8CE62201463E06BD9AA56BF6F0CDBA32BB62EC (0_<)o~o~q#8
889,546,567 *5C8CC54642B19E7F784FA9CE1420AD22114ECF33 1.filzballcircuit
889,546,568 *5C8773B9719674B86BAD0AED8D437AF09B0B3E67 1 FLIGHT-ASSISTED
889,546,569 *5C83681A9FEFE540AA7A17C8D022A7845A111218 1FOFINHOS
889,546,570 *5C8C65B8502A869807F8DFB2BE407BEDAD1F11D2 1freiluft-arealen
889,546,571 *5C8A45BD051BDDBCE5E7E6CE4A5E6C3C271E6FDD 101265 THECOMPANYDIDN'TESTIMATEFISCAL1990INCOME.
889,546,572 *5C8166807F330DBF9D55E28B916FC1910D06EE7C 105-GOVERNMENT-IN-EXILE
889,546,573 *5C8334FF3BD83F2816545E7BFF7D48BB87AC0E3F 1140anderson
889,546,574 *5C8FA6FE15A4BD500CDC1ACD1B3D5472D0BA07F0 1175208 KAIKESTA.SEISOSKELUSTA.JA.KAIVELUSTA.EI.VOI.SYYTT
889,546,575 *5C8FDD2F0949A813E3B63A1234C117213568ECA2 1.HUSBANDEVENTUALLY
889,546,576 *5C8337F17DF43AC4CEE2E8032B5800C3011845ED 120DEREINST
889,546,577 *5C84042F2FEE9CFFE792D7C29985A63CF12ED6B0 1223970 PERUSTETTA SILLE , MIKSI MATKA AIKOINAAN ON N
889,546,578 *5C8F3E2B25617BDD54D9BE7CF35080D72523A4DF 1-kassam-ii-rakete
889,546,579 *5C830377D8B118E8EA8174ACE329B88FB97CB562 1.khmer-kulttuurien
889,546,580 *5C8161496DED0464F7A4FE2E9F8A7C0B506BF75A 1433006 perustamalla.kallioliikuntojen.havaintoasemia.my
889,546,581 *5C82B062869D70F5340A5197FFE675547E867FCF 1 LAURITSALASTA
889,546,582 *5C84E759A8D5BB2089AC69D1A84F523016BC96B8 1553914 ICH.MUSSTE.MEINEN.DIENST.WIEDER.ABSAGEN..."
889,546,583 *5C8D080166E5E22EEC1315B03331D7DE2DD6A87F 1 mittausmoodin
889,546,584 *5C8326AF0BF1B3D5E7AD426FFA01F74CA8131110 1 MOESSNERHECKNER
889,546,585 *5C8DE7267E39294FBBEFF15BC87099368502269A 16JAN1487
889,546,586 *5C81565B8188D5D6AE70722A25CE7A8698819591 1.PUCK-LAZAROFF
889,546,587 *5C88E0D229A0F3E256FD205FAD6B59DF6AEBEA54 1.repo's
889,546,588 *5C850BBAF0A4819ABDBD147EBF0A6FEEB11168CD 1 ATLAT
889,546,589 *5C8A74C16A467B680A1F13842E5FB0865BB187DC 1BALLSGARY
889,546,590 *5C83C57AD38CFC96667F86C9CBE95677A34E7569 1 SOVELLUSRUTIINIEN
889,546,591 *5C85AE78097EC1B333911BF06F06F19D563758A4 1 SPERRIG-VERSCHLOSSENEN
889,546,592 *5C872469F48EB002E0D0282ECE7FE8AF0DDCC94F 1cursussen
889,546,593 *5C80DA0EFFDCE2983F369FDFF2C74A4105CDA0C3 1.deadlinesthey
889,546,594 *5C8AD65BC40CF2C2DE8DDF3A45F1BC94AFFE967A 2009-06-10: RADIO CITY MUSIC HALL, NEW YORK, NY, USA (DISC 1)
889,546,595 *5C8D54B5B2C37988278AE3C6B471FF86A565D478 203HOPE
889,546,596 *5C86D96FA2FBF14336B0236D516C3EF749E2F6BD 1EPMATSFA
889,546,597 *5C8C3A6EA49D038C8955660D4B3C026B86AEF3BA 1.fuersorgfaelle
889,546,598 *5C86D31F8CCA49E2D85F247CB43DB36C06710430 1-jentsch
889,546,599 *5C8BECB42232DAACA45FD50D015A466E23046D55 1KEEPTHEMHAPPY
889,546,600 *5C818002FF6611CEF525C6AACF3049677E46B862 2527LUCKY
889,546,601 *5C85AF72842BAD01A20A34D6B1CB5D4203137900 276583 dies geschieht in der regel per bote
889,546,602 *5C8436E528FF5B0DDBC561080F492154B945C6B7 2825803 LAITILANRAUTARAKENNEOYVIETUOTTEITAANMY
889,546,603 *5C859496E1A36D74A6C3511D7467F46E8B777D82 2826313 UM 18 UHR KOMMT DER NIKOLAUS .
889,546,604 *5C8C078B43472F5245FCCDA49E6B79345A1C3B4A [email protected]
889,546,605 *5C898951A4F12D5E07257FA1B9B68E25BD9DF64F 1NV35T1R5
889,546,606 *5C800324C5427B48B31B1E4FBF13EDFC07F85ADD 2ALGDNARB
889,546,607 *5C8AD5BED4E19BF4F02541AFE1C0216F280804E7 2BESLEDIKLERINI
889,546,608 *5C89C6A5EA40CD516785E74A971C672D43B4EE61 1PARMAKLARIYDI
889,546,609 *5C8A877EAFA87F10F104B6880D3097615168069C 1 PDS-WERTE
889,546,610 *5C89B9A99318D99A9905E0948EEFE828ED9444B6 1.pehmolinjalle
889,546,611 *5C8E0D9F52D789FA66D66980EFABEA772281480B 1PRISSTIG
889,546,612 *5C8A04600F4FF988D3BC5B43975171B4D12083AA 2FW27FKD4F197INFODE
889,546,613 *5C872C1406714C09B56CB6046D747F91DC8E74D0 2kotal-i-tacht
889,546,614 *5C8F9DCDB28A14675D8EB0A29B94DFBE34D8F7C1 1sunniness
889,546,615 *5C830F82D340416198C566A0F3345C02981E85AC 1thecomet6
889,546,616 *5C87F8B6D7D1CDD4980AAD4DD969004F916BF9A4 1UNVERDOPPELTER
889,546,617 *5C8521AB0CA00713DFFBB359EB3FB74D3A8063C9 2-renessanssiajalta
889,546,618 *5C840DB0589C6A3847DF4F62803EE6C885605B98 2.skylighted
889,546,619 *5C877A323F676CE039086441AD2248B4536D742B 2THEMADDIE0
889,546,620 *5C8E2878FBEE77D4E41180CE588783577B4392EC 20DIVERSOS
889,546,621 *5C8209349CC2D95BCA812C9725CEFA31AD48AB92 362MATHEW
889,546,622 *5C848B00F4440E00F166683F4C1C0C429D3C8D3B 3myhonda6
889,546,623 *5C8D65305F7DE1B068B59317B459B8FF19B6BF72 3OUTROGUE
889,546,624 *5C8CCB37A088BED446E6478EF740CA9CDD38CD8B 2850872 OLEMME TEHNEET MENESTYKSEKK
889,546,625 *5C874E64680EDE9E816862F4E2924B6FADDC9B46 412D343
889,546,626 *5C8F64D069D03A8CA1DB2C79012883B37CE8D668 414524 tel.:.(.0212.).875.11.00.asya.plastik.mak..
889,546,627 *5C8120322A2A042113241DEA8E9ED9DC248BFCBE 2HTEILPIT
889,546,628 *5C8602BE1668936DFF448DD02BDDBD2888129552 2.KAJANG
889,546,629 *5C82E3FCAFBA5112781860BAEF625E3B3A0EB2FF 2-KAPSAMAYACAGI
889,546,630 *5C84C69FB9E4828B7AC10F63A10BB891D4B338D7 2ORALDEAN
889,546,631 *5C8BE89E84AE01CC20A137F630F37F980D32BC7E 2-SIFAS
889,546,632 *5C812CFD1279943492A33AB2A1F23E062A469470 2STEDET
889,546,633 *5C836EB426D90F4F7D06D869A3C1D2D1BEB1F321 4NETKOOKN
889,546,634 *5C822314CB9B101C0FCBCE3EFE4917088B9B8EAB 4ORACONS
889,546,635 *5C810196E0C3656E8DE544030A491768244B566E 4QWERTYABIGAIL
889,546,636 *5C899C8592E2F27618A1C3BC8935D4597C3D1B73 316416 INEINPAARWOCHENBEGINNTDERPROZESS.
889,546,637 *5C893BC60DAF5FB1819A985FBF3A1D0444C1BE94 319337 ausserdemsolledassortimentrascherweitertwerden.
889,546,638 *5C818468364E7B5E192373CCAE6222280D79FE67 4`S
889,546,639 *5C8129A8F1BBB7DEEFA22A860E0C2BBE82EC967E 4-sittenwaechtern
889,546,640 *5C82E89DD9DDB60D02B1ADFEA90594E794421FCC 4VAIKUTUKSIENS
889,546,641 *5C8E007120138825F34FFC512CDB42B8C8ED5397 3##>-*-*->-b0
889,546,642 *5C83E13496E54A78EF864E4C4E15F6E21CDF284F 3---b * * * ~0~o>-b0
889,546,643 *5C84953DF2F34FE25560153DE6EC64F3B9410515 5250rpm(m64
889,546,644 *5C8B4312D0E0F8C4714CA5787DABA3124C2C68E0 572SABRINA
889,546,645 *5C8FCC19021CCABA5BBB33D4185CD232BAFAB891 5BSWNAMAREMABSW
889,546,646 *5C86AEDDD888D579A4C557CFD0A2A0F32E238414 5CITAMUZ
889,546,647 *5C830EC7807271CC82BF31C073AEB389EA2CD807 3NOIRRUM
889,546,648 *5C86EC7EA0EB691BBA608B44FDE2041203B4A28E 3PIHALAATTOJA
889,546,649 *5C849859CA0FF26BFDA53C968A6C68B27804BDDC 5EXU4LI5M
889,546,650 *5C878F833BC8A020237325A8FE0C1F9FE39F8274 3R3THI$TI
889,546,651 *5C89ACA0BFB75A56B21FC8C04433E0DEFC07EA99 5godding
889,546,652 *5C8FA5509B33DCF386001F9F16FB0E5D9EDB50D1 5 KUIVAAINEENA
889,546,653 *5C88338BFEE610B0FF60F30F3A9847E444E02BFE 416735 theacrimonyhasbeenescalating
889,546,654 *5C88FC9253FF5FCB58EBCF85FAE9D85F723C6F65 5MELANIECONNIE
889,546,655 *5C815C966F9ADEFA8954EC08102AAF51E92BBE6A 42.PSALM"WIEDERHIRSCHSCHREIT":CORO"WASBETR
889,546,656 *5C8D97404C99846EFC30BE8A09E82093634DDB6C 438882 MAA--JA-METS
889,546,657 *5C88CDA44D145D647B78C7A8A63FC95A65372C5E 5NADGLASANIM
889,546,658 *5C8115E939AAC609C3BA996EF32FFF8C402EEA8C 453JAMIE
889,546,659 *5C872D66C712D17787D040E2913993399988EC50 5P33DB0A7NG
889,546,660 *5C822E0EBA1226838AF85429505D97C184EA6AAF 5SAMMENSVEJNINGERS
889,546,661 *5C8E702B8D4DA745445750FDBCDB97820882257D 4HAIRYMEN
889,546,662 *5C8C68790F67941682412EB79C52F6E41F3E8FC7 5STEPELIA
889,546,663 *5C89D692E856D5FA470BC75DBA826706A629761B 4QJCPPTZ
889,546,664 *5C87B2844403345D5393941E301D859F998D7AC4 63LANE
889,546,665 *5C806E1D43C55F9F76FF28D95CA2EF1B0CB072CE 63uriel
889,546,666 *5C838F97A937AF5E7260DF8383CCBA6449CB2819 4STARTTUCKER
889,546,667 *5C885794C7B17A4C1C061D6771EDD2D6A1D7440E 6AFFRETTABILI
889,546,668 *5C874DA07AF2CE08029B3FD255FAD15354AF9E98 4ULOERPAC
889,546,669 *5C8148118F782CAAD4C948D7F916270D8E82A051 6BENEDICERE
889,546,670 *5C87D1C8ED1283A00C5714FFD0BB2F9B7D59C5A0 4WALKERTRISTAN
889,546,671 *5C82D54A4D808C338EF2A63FF009A3FC7799241A 6DIEGUIN
889,546,672 *5C8C8604918EE7BAAFDB6997944D0564F83D1D1B 555amira
889,546,673 *5C8A5785C2AC7BA8D5967A3685E221C30C33E731 57NEUROTIC
889,546,674 *5C89B127E5122A988A6AB4C03DE29089793723AE 6FANATIZOVAT
889,546,675 *5C8279E78D5E7291BFDE4AD671A5DB73D2B0C4EC 6FD3
889,546,676 *5C859C131D25F30E89706B45F0744AC2392025C9 5BIRAGHI
889,546,677 *5C8C322BA26E3AD70E37D480F18E1A3241EE5D01 5BSWEHBRIONESBSW
889,546,678 *5C8289C0ECACEBEB915F8D175AE1443A6DBED813 6HORARINN
889,546,679 *5C8A824AA14046109091A2C4E0BF320C9060C2CB 6RESEARCHHEIDI
889,546,680 *5C81432601767E6AE3B536C1E44A708B4D3ED657 6THEPETERK8
889,546,681 *5C848DDD6794F9FD869325F70F700BC7FCB1E4E3 6TSNWONKEBNU
889,546,682 *5C857F1D5A32C22D228225B9C223FC3BC7608907 6USINESSENISU
889,546,683 *5C8709CC93ED5C601C3F9A79A26E28327DF018A9 5PATHOLOGIQUEMENTS
889,546,684 *5C8B1541D435B3DA762F2E5BA542E82CF1616754 701029 "politicalleaderscanonlyavoiditbyactingintime.
889,546,685 *5C8DEC6DD991955365EDC7EEE89EC1EC47DCE6F5 70E3E996-CF09-30CA-8B66-028CD6CCC9FA
889,546,686 *5C8F511D649D201BE079DA36EC207942F365317E 5RITUYAL
889,546,687 *5C897F24C22565AE5A34B6A5282A5D8267420AF1 72"AAA
889,546,688 *5C8A3FBB17C397873550FEFB41B37771699191BD 7ATEBAABETA
889,546,689 *5C88DC17903D95D1ECCB7BD04119D8445A475998 5WUEHLTER
889,546,690 *5C81BF498BB268B99978470392B963FE2471BDDE 610cb22c17c68ad2e53564672a7697a4school7183
889,546,691 *5C8E644D864CE6F9419A1DB8DFEDC6F858085435 7EUKALYPTUSEN
889,546,692 *5C8CAB13BA493F5CEF05353B7FC5ABB09AAAD6A9 7godiva7
889,546,693 *5C857A51A9730F8184AE902A4E7F1E0307CE4E6D 7LENIG
889,546,694 *5C80C2A9D66C58C5CEAC6D5D9B349C3A221436D1 6BOTANISC
889,546,695 *5C88885EB9D841E87B15A1EB904A12E48595AC29 6BULLDOGHAZEL
889,546,696 *5C83C4D8EB85BA5F7B0D62E981C48D0E35B0A5ED 7NASERAGA
889,546,697 *5C83F596AE1BB8C6BBA20DEC1FAE41DCAF111CB7 6DISCREPAREN
889,546,698 *5C854DAED64D7F03365B9A7F61642C77FD7F4E6D 6ERICBRIDGE
889,546,699 *5C883DA8FECCD57F9D1EFB9B97D0BD24D6D36D8C 7PRAISESALLY
889,546,700 *5C838C0689F82E8A508999E5AA9E1E55AF7D66B7 6GENOOTSCHAPPEN
889,546,701 *5C83522297488B09FE19B129EAC0C4B0F4A78ADE 6IAMJACKIE10
889,546,702 *5C84F4F8009E96025AD700C69C2C6AD51AD9BD35 835QAWSEDRFTGYHUJI
889,546,703 *5C8B7AB7152CD30DE91DD940FE088A912D53D206 6PAUSCHBSW
889,546,704 *5C8EB736C8A5DD77DB66D36DBDDA361377197335 6POSTLICENTIATES
889,546,705 *5C8C76FC72C5425CA6B3F64B7B8490B49EF836A6 87113 t--serkan-irmak-msc-
889,546,706 *5C85407546E5A91F276900AFA632016F5013C48D 6SENHORINH
889,546,707 *5C84E2B76CAA734718F0DE58E7DF18B688B96E88 6ZCHROMENI
889,546,708 *5C88C9B2E3A09D9A2AD19C5CC5523F5937C52142 8GOHMZDCNS
889,546,709 *5C816A3E82DF60A04BA3BFEC1B3AE85DA202E237 797611 bugUnkU sayI yaklaSIk 67 tane .
889,546,710 *5C8F0CE31D88AE792FD964F98EC9B6BA23093F00 8LAMERELEPHANT
889,546,711 *5C88F555E1766E01330F33B1F81701ECAAFFADBA 8LASKEVAN
889,546,712 *5C8AE879411A05713FBF0394E542DE8AF70DC4CD 8MEMORIZZERESTE
889,546,713 *5C89013FF1C812B33ABDA7FED956CA6D7DE66A07 [email protected]~o~o(>_<)
889,546,714 *5C8C669C24A555B1645F2BF9900E1B5F86AD424D 7gが登場した。j
889,546,715 *5C85293C6C5CA2BFFAB15E294F517DF8441FA4F0 7IDENTIFIKATIONED
889,546,716 *5C85B49A57BF5D560181755E0A01A451FAB8CB66 8VILIPENDESES
889,546,717 *5C84F310CCB57827B4D11252BF1E87685FF5D7CA 9054EC89-B63E-3E70-82DC-DA3755C9D3E9
889,546,718 *5C8EBAE97BB3CFF561DF7E0D414CB178F2CF944D [email protected]
889,546,719 *5C82A062627B1795486C93A28688A43718E50458 928720 saat-gecenin-ucunu-gosteriyordu-
889,546,720 *5C8FA4143BA63143D72B325A6756FE18010D484C 943CRISTINA
889,546,721 *5C8B66C3D9C83C88B10DABD00417E76FF1C2667E 7NIETSDNE
889,546,722 *5C83125D2AAFB39A6193126797EAFE2706B56126 7NNNAHOJ
889,546,723 *5C8B61492E7CC926F6CFF58BF3A181FC9371D106 7-RAKENNUSMESTARILTA
889,546,724 *5C86A315877DD0CA8049700DEE72F10BF3DC61DA 7STORMWEBSTER
889,546,725 *5C84AD8F8C2BE8D25D72123D6E4FCBC1F8187206 7TRNQLZRS
889,546,726 *5C83E82F98EB0EA65E37EE7A50C88F89302FA2DF 9FRIENDSYMBOL
889,546,727 *5C893DE1B8BE5DCE1D1B03BEC672C2F208973737 801ANNE
889,546,728 *5C8DEA2A44AA1266FB2571EFBACB488B5CFCF48C 9INNEBURNES
889,546,729 *5C8E826BD0ABB159CA79E0E43754C7ABB7B23EFD 9INTRAPPENS
889,546,730 *5C801DE0F418F2C3E33E004D877C34D13223F811 9JAKEL
889,546,731 *5C85268E951251C8C2EAE9677C4345479AA10E0E 8B ~0 ~O SPLAT!!
889,546,732 *5C8809B2E4E180CA1B78715D455E6115944A8E40 8BULLSHITBOSTON
889,546,733 *5C82C22404CE2D4A3E889DF9302A9787A8CCEBDF 9REYNOLDSQUEST
889,546,734 *5C88426F65AEAF816352001DDEEDFFFF9B35595A 8CHRISTINBOBCAT
889,546,735 *5C8F72235429670F5EAC22295E168115C8AA1918 9SANGBEEN
889,546,736 *5C82154B92BED2CFCDAE32EE6AAD87DB4E70C5FB }8{~ ~d3
889,546,737 *5C89F3FB4C6938EF0ADF88EEDD8808330CB5CAE7 a2n(p
889,546,738 *5C8E00B976DB9ECE1FDB9E24D3489F509E631375 8------)~O~o)O(
889,546,739 *5C8BABE86E42ADFA515D858830370A110D6F749C A4Y
889,546,740 *5C800027183E1F6F9F9E21F8CE39639B7B57ABA8 a7b!t
889,546,741 *5C887BF3963FC244F9918D8E58B39E4B879B374F 8SAPIENCIAL
889,546,742 *5C80C8840E6D1F14DEFD7136A2E2281C0B037623 8SASAAGARAH
889,546,743 *5C8010A6013364AFADBEDC7404E89FFEA5ED149B 8UBERQUERENDE
889,546,744 *5C8150F2E625FDDCCFC57C9B9D82453A59AE020E AAAXDE
889,546,745 *5C822293F3DE4367C70F2CFED67A95E34707855B 947343 baSarI telekom sanayi ve ticaret a S
889,546,746 *5C8CF6807455D892DB350908B0E4F01C3208746A 948103 'diyesormadi
889,546,747 *5C8D1B937D75BB73708C0EAF975AD0B628726004 962377 vergleiche-mit-zu-hause-draengen-sich-auf-.
889,546,748 *5C8D96828895650EE611B87EFB8EE4B666C2A98E 994GREGERSON
889,546,749 *5C8DE4B06655E77B327400115FE87AA6A9F77729 99A88E3E-4938-3FC9-B542-A697C78FC263
889,546,750 *5C873BBB3D94BE6F14280E535F3C7E938B1EE076 AADH*G
889,546,751 *5C8CA4455709F8ACA166A2A9BDFC73DA12B0EBA8 AB%/%
889,546,752 *5C86E7452C0371BE59A83F66FEC86F2FCD967D37 9GNINSLNS
889,546,753 *5C88B2C1367BCA2D1A202FD572D6459A5C76E334 ABBYJULIA0
889,546,754 *5C860565AC8540BB657D8CA5FE007B7B5E29327B 9ILOVEACTIVE9
889,546,755 *5C8B79CD3746268BD02CD1AC96BA3C642344F6EB 9LHUKSMAR
889,546,756 *5C89704B74247D4AA33676061CC86B6C5647FA8C 9MARIPOSAMADDOCK
889,546,757 *5C8509A7DBB45617C8C6F3DB4D99839F56BE1A7B 9MUOSSOBI
889,546,758 *5C8A9A62862103175C7BA55B0D6E7D74C144ABBF 9NERETUAS
889,546,759 *5C8D6E7BFB88F6A3871DFE4FF8EC5222256B7CE4 ABW8D
889,546,760 *5C8520099B23235D3C9FCE592619DA729738F3C1 AC"}S
889,546,761 *5C83B8DFA097BB6AEBFFD8C60E4F3E0E661EB121 9RUSSELLRUSSELL
889,546,762 *5C8CF96F7ED952BD4F06438B67D09742A6236783 9-UHDEN
889,546,763 *5C884D0BD9582A3508E3BDBD91EE6A60AAE943BF 9YLRAELC
889,546,764 *5C852F3A110F58D5895691C5B5EDC6EEC24CFA91 adriana189
889,546,765 *5C81A846731BB230BC0A1847C59D760ADAF19EC2 A06NQ
889,546,766 *5C8545301178EE3A901EF4F83ABFF1528DAAD562 a1ze,
889,546,767 *5C8387DC886FB79DC264BF258ED96FCB1AF62915 A2=BW
889,546,768 *5C884CB066F9B3F3BAA17F891F153846C7098841 afncw
889,546,769 *5C88B6DBDD83390D38097EC7E5481F90F7782BB6 A$5TA
889,546,770 *5C895BE3F242EF370FF5ADD3B04B17FC7D67365F a6flq
889,546,771 *5C811E5188FAC1673ABBFDA1A725F0420CE32AB1 agroc
889,546,772 *5C8225559816342596D28F38A2142860701999DB AJEDC
889,546,773 *5C863759BD7240EE8ACA36A09482359C53C93B2B AJRLQ
889,546,774 *5C8F5DC041ABAA627FA64D28071EB1CBDB9403F4 AKYD_
889,546,775 *5C8B5A5B686DC56655FEEF7D4A46E3120A3FB4FF [email protected]
889,546,776 *5C878360D916EAFB9A21653812CC8A6AFFFAF68C Al$acel0
889,546,777 *5C87E75FEC3BB510293E74C55236CC62869F803E a$ae7
889,546,778 *5C854B977DE23A85721669E5214A556D8BC1A464 ALBERTSLUND0
889,546,779 *5C89B36B5676EA373102972A7D0D200EDE87FEA4 AAFDK&
889,546,780 *5C8FF569D0FBECE5B5E85F63C5AF9692AFB16BB4 ALECGORRI
889,546,781 *5C8DBE2A725542318D26D5F6ABA5AC8EDC55BC48 aap+7
889,546,782 *5C8809A8B40916743F970033BD1697992B2DD66C alexisshahinfar
889,546,783 *5C8634EFA6BD1709E8DB80082870ECB906033E75 alfonzopalacious
889,546,784 *5C8699C9B2D19AE230F9F9922BD3F3184025D0C6 ALIFEINSTEIN
889,546,785 *5C8F62EF82BBC07DCD612469FCB94FFFF36DA766 ABDULAFLAH
889,546,786 *5C8DA6E2A0B653A522C24AE76A8B209D1886EBDC abroms7
889,546,787 *5C85BADB0BA9C1B2980AA2B9DE992E48A028EF2A ack6:
889,546,788 *5C8E10C10F8C957FA3DD1C1A276F6563B550A2BB AMMIRAND1
889,546,789 *5C859E069DA4E940EAE2547E29DD04FAF13BF7B4 ac!xb
889,546,790 *5C84E95D857D54B7BB2163E57B235DEA552BC3FA angikabhinaya
889,546,791 *5C87C4682DFB55B15BFD531A008CF8374DEF4E39 ANIBALCORLEY
889,546,792 *5C8A2FF41EBDBAEA932BE22A95556286B8D519ED a?nsw
889,546,793 *5C8DC9EA846EEA8D5ED4B0C537A0A44370D0670E aew"&
889,546,794 *5C8DBEFAC9D87C64CF0E797ABAE48C8014D34EF8 A""FD
889,546,795 *5C8794D0691C8B70F411B757B19B62F93304CE3A Ain1
889,546,796 *5C87D8095908C3BD07E0D86DA0E332B0AE9A8CAB ARA
889,546,797 *5C885739263A8FDA7E78F7050B0AFA132F20DE4A AREYOUTHESICKPASSENGER?
889,546,798 *5C86C05A1AE1ABC2CB8028710440B395186411B8 AKTARUZZAMAN-LITON
889,546,799 *5C8B0515DE07DA86B4E2DAD796551A5D569EE215 a;l%
889,546,800 *5C884C6BFC628C813BE3E5225A6454C41F35F674 ALBERTO.DIGIROLAMO
889,546,801 *5C873BA97A05158559116D161C2B84B80B0559D0 ALBERTOREVILLA
889,546,802 *5C8F40210C472468B91A626578368CAEB6BE2662 arthurtuft
889,546,803 *5C8BAB37F2B3FF257C2CDC80C02BA44532920713 ALDENWYLAM
889,546,804 *5C88338EB33C018B06911E4602FA0CC8AD2CA330 as1pg
889,546,805 *5C813099D1986510955847778E6A20A1F9A0BBD3 asepses
889,546,806 *5C80C548ADF105F738CA3AF7C6D1357CAA26D1E5 al-muflihi
889,546,807 *5C8C0858C63FB226D478CD100B1F88151A4F1DB6 ALTON.KALMER
889,546,808 *5C87D8F05BD5F2C9A41A250D6F1BF49B7E7D67BD [email protected]
889,546,809 *5C85C402CDA11667DF49A78B511478C43934DD20 ALWEEZY
889,546,810 *5C8379AC62766BF4DAEE7F1072D02F8716DC7B6D ATPNL
889,546,811 *5C8A2946B40F7A6A0331682DBFBCFFFE7FB2EDBC au+-g
889,546,812 *5C8188F69B7A44DB24BF0A5EA79C1D3E97DAD33D AMES2112
889,546,813 *5C8A4869D19395035214ECEC0C7D7B7CC9EC556A AN1VT
889,546,814 *5C82D08885C1E410C74AE250455685D10B763BAD ANNSTEMMER
889,546,815 *5C86FB8CE1996BAAE3B6496DC44149FB54A991F8 ANTWAN.PAINTER
889,546,816 *5C8BFC35A8DD726E1BFC532F4CAA4BED6B2EFB14 B------) ~0~O }O{
889,546,817 *5C8A277DEB8953AC3B93CADCC7E5781E05E9B5E4 b_1pi
889,546,818 *5C8B48E782191BCC2458C16402F55D1292079485 b3/$v
889,546,819 *5C840C3C814CC31190490D4254B5380430F60764 B)9G,
889,546,820 *5C8139620CA2436BC7EB5F595975D2D170521734 baby don
889,546,821 *5C8BBBABFF9A7FE1108F5C43E08FD5BA8FEC4476 argenter
889,546,822 *5C8D52B0BB6585D1AE36204B933004F78C455488 BALFABROTHERSORCHESTRA
889,546,823 *5C863ECC163170A225C011C5376EB1325D475BC4 BASTARDPLANET
889,546,824 *5C8628192A14BFAE80EB118C307670EBBC9F203D BCUALT
889,546,825 *5C8632151B9720ED9AC419B5C0CC876061FC5F7A bcyclcls
889,546,826 *5C8B279D895E27F3CBA11C80145ABE078869A08D asepses
889,546,827 *5C8475D3B2DD4D31494A8CB8E5B2FEE014242DBA assctioning
889,546,828 *5C855F6536E9DC309809F671A353AA8B2F604434 BENTONPELT
889,546,829 *5C8E5A443A86F7DAD5CC18AB537F18DC82817C32 BERTRAM.BENNAGE
889,546,830 *5C8336E30F5ED605FAE32FF928606CF03E86A513 BERTRAM.BRZENK
889,546,831 *5C8F0067ABA501D2DD69F61857E0B99363080EE8 BERTRAM.NOTARO
889,546,832 *5C8BF06B7093D58EEA525EBA50F7DC9A82AE1288 BETHELPCS03
889,546,833 *5C83A1C8FBC86B2F44CBF4EF8D489D69C368996F BETTY_LOU
889,546,834 *5C88B4EA5D878780332F20F3AB68D1AA321C9BAA BIE?F
889,546,835 *5C8447166EF8391071EB8631A363C40319CD5EE5 BILOCAR
889,546,836 *5C8BA96D4DBC94BB57B881612C38651CB501D027 azuli.presents:.space.annual.#1.(disc.2)
889,546,837 *5C899328C4D3A732E15C187DB37CD62474D79B2F bjnr329410006
889,546,838 *5C801D1492D59ACCCDFE6A9DA7D0EB54DD95F28A B1C0L
889,546,839 *5C8BB2DB7FCEE1F4A7300143B0E1CDE1F2AC6F3B blues-all-day-long
889,546,840 *5C8A06E1C568C72E8FB31463F440F3906BC8CCD4 b/o$4
889,546,841 *5C8FE07ECAFD747DB7572B4E0E1541DBA6756303 BOBBIEBURIGSAY
889,546,842 *5C82137F6C8CD248E90C4BA5F651BF4EAA6576F5 BAGNA8
889,546,843 *5C8625CA6BD09FBE97AA4B391C1552E21655C1D0 B/AJB
889,546,844 *5C8581B98FB9110A0C2B06659CF2D0427764B5A2 BONNETZEKENDORF
889,546,845 *5C8FB5BC9CEF9296839F5BAB661D191160299676 BONQM
889,546,846 *5C873E4F1562137A37E33B2E8A638407A68BF2C0 bou_w
889,546,847 *5C8889F63F8084ECE02D7731EFCFEB0A25A54130 B######p-~0(x)
889,546,848 *5C8AA3FFC0F2912AEE0FF1667EC92BC0B922FC24 [email protected]
889,546,849 *5C8EC01652EE73137BA18E14F40F97AA891FDFF2 BARTONLOHNES
889,546,850 *5C80AE1F1E4A2F1839C98D8428C8565AD7713F58 bpovh
889,546,851 *5C8CF950DF6F42EE3FB90AB80032DEC0380AB89E B###B-~O~O-O->-<
889,546,852 *5C877B3B03129DF30A895CA693F2840A8A72A7DB BBOS
889,546,853 *5C896D43763EEB2B1A28B79FD0CF3B449E6ACD61 bc4bm
889,546,854 *5C8D1F40CCF6B24E9D7052A80077FF430033731B bdqeg
889,546,855 *5C8A0C01D6C7C975931C355C0C49FD9A3EF10E53 b-e
889,546,856 *5C8C85CA60D7E85AC6171EB4F3C3AAEC01518CFB brucemalloch
889,546,857 *5C802AF38C656814D54F6102E5A7526697533655 BRYANTBECKMEYER
889,546,858 *5C891698BF23EB2F4EFF0EB86DC797B29932CAFE BRYCEVICTORERO
889,546,859 *5C877D3CBB5AD6796CEDEBCDC85FE28DADE2B8D0 BE-GN
889,546,860 *5C8B5683FC93BE71A562ECD91E30544EAAA7EA98 belerminoed
889,546,861 *5C81672383DCE935421C7C93767E8CEF020F7F0D BSR-A
889,546,862 *5C89845829095CBF64021C32A70E44E9BA839215 bswtheierlbsw
889,546,863 *5C810C40BE82CE267186512ECB251A2EE8FF1AC7 BSZLC
889,546,864 *5C8C9F29EFA6D8698E9F15385285C1B3344BD4C2 BERNARDZALESKI
889,546,865 *5C8C0BDA0EB498753E737F5754D9FF88456913DD BUDDYGARRICK
889,546,866 *5C8913FA8FA867ABFC14A51D8FD6BFCA0DFEDFE8 BERRY.PLETSCH
889,546,867 *5C859E6B1859E07BE8C54F5F277212F11EE7C661 buhe_
889,546,868 *5C8D6F4F8A07AFB9D1810A04882E0289E0BBEBEE BURL.CARL
889,546,869 *5C871E83E081D13399AC52F3AC146CEE00CA05A7 butchdrane
889,546,870 *5C854CA9A2478F9D0AC5680C205F457995D39F8C BFS7O
889,546,871 *5C83400E71A5105215F902B620698AB322CAADC5 BW0%-
889,546,872 *5C84AD4281E16EF80C11B3305A866B45A3D848C7 BI9J$
889,546,873 *5C8E2809B0AC7A223F81F77AA7B28C2C101A3819 B'XAAA
889,546,874 *5C8642BD44C024DDD9885E2525E724DB2F877194 bx:b
889,546,875 *5C87523DF53EB350AD9B88644398CD29D45605FD b%:ih
889,546,876 *5C8DC847C47971623EAF3F7FED590823DA57A662 [email protected]
889,546,877 *5C89818707CA8C434E403351D9F786FFE3D8751E c0rv
889,546,878 *5C8DE40FB2956FAF1B0FA57DC1A7F67F2CCE9F1C [email protected]
889,546,879 *5C829FAA7A5BB36D36EFC847E4CD5B8F40635646 c1qps
889,546,880 *5C84835CCCAC2D544FCA682132B0B64E3FDB9A10 c4q61qmb
889,546,881 *5C8C0957FCF8BCC67FE1642D6A46F1D0263FEBBB BJVANDE
889,546,882 *5C8C8D40D716B672125CED108CF25D370E7B7880 BOFILINOJ
889,546,883 *5C8FF5EDB97DE9305146A4B6585FBA570F916EA1 CANARIOS3
889,546,884 *5C86795E0B1018C5A75E9DFC915776FBCAE53144 boston795
889,546,885 *5C8C6BCC067C571290918411211ED73F20E3A3AC BOXPLOT
889,546,886 *5C80EF88B7B9D41F86D75CE6C90E33425ADE105A br+$
889,546,887 *5C85D37BC270DA73BF385AC78D0E5E9CCD2EEED6 BRADY.STACK
889,546,888 *5C896CDFADC5390776C21F8B77A863C604336F2D brandongoodwater
889,546,889 *5C8D98996532A07660BEDC1BE33347CD2BA58D6C cb4yq
889,546,890 *5C81DB74013CFBEB1C88DB97AF24A69369AD9935 cb"w4
889,546,891 *5C801D8E04A0DF1F7218593C37EE956B938D702F ccs(g
889,546,892 *5C8447FE46D1AC40E872ED92EA026534C8064BEC cd1v0
889,546,893 *5C89BE872C9F42A95B732D7945C6FBA75ED21340 bridgesgrandma
889,546,894 *5C8228C669BCD4FF2DCB6D47F5DA7D88D3484359 BRIJESH-SHETTY
889,546,895 *5C8D59C55B4FC08079EFBFF1E8E1E6F8CEBE14F8 CDFLGMJPPED
889,546,896 *5C8F939130AFC7DF839120045A2374AF099F5095 cd,/l
889,546,897 *5C8781C94EADC880223EE94D88C4990B2F259561 brk0k
889,546,898 *5C8CBE6CDC1C417F228CD7F11EC7307F7FFE2083 BRYANCARDOSO
889,546,899 *5C83C96F76967ECF695D86C13CF1FE19D4C2750F cesarrutledge
889,546,900 *5C843125AFBCFB4D63CB6E58B07367E22F43D570 BRYCESON0
889,546,901 *5C8217DC1765C0116554C22382CAEB6340EC135B cf6m
889,546,902 *5C81E0F77B1A54FF0A10434E768481AD2C7C3AFD btwm5
889,546,903 *5C86879488185DBE398995211EB06625CAD0ADCF CHARCZEC5
889,546,904 *5C8DE86D35D45FE3BB19570D52B20727019FD800 BU&M
889,546,905 *5C86A976C3C9B4870BC2F2BABA127E3229A28148 bünbnisse
889,546,906 *5C8FB5CBB0AA7AB4C6C03BB904ADDD934A01E095 [email protected]
889,546,907 *5C8CFEF7836FBDAF834DFE564F60440A436F7890 chi3fs
889,546,908 *5C8096F32E18E4C305625E0700B26C363042B34B CHRISTT9
889,546,909 *5C8C0398BF34F5C42BD2E414AAF26E71A8594FA1 bzue!
889,546,910 *5C8CD2DC271ED335A505472CF0F0B86C346AE0A3 [email protected]@PHI3$
889,546,911 *5C84548E48323E006DA135043213A95A33FB454C c2jd
889,546,912 *5C8F069BD23985DD578FB7818C88A970DE27DF64 CLAUDIOEHRHARDT
889,546,913 *5C8BCA134DA35DB230E1D57FA59A6DA16D6A14B7 c69h
889,546,914 *5C8BA1B1A433553DF4A492AF8C77A181805433A1 claytonyap
889,546,915 *5C81CAED833BAE2036E7C47D346BB82CEA3A8C23 CLEATUS0
889,546,916 *5C8E639082829100D4430F99E88E51E67BCEF89C c+97p
889,546,917 *5C8C53BF05CEF361DC6D4A017186C04BA9E460CF C&MF?
889,546,918 *5C8172CA3A0B0055A1D584C6E353C20795A9851B cmun
889,546,919 *5C83B5EDE5DFCEDDDC59DF84C59F9F98119A3029 CNSTRCTN5
889,546,920 *5C8A8FC07A77C0E3FD4D8B19D06D3A94D413BFC3 captainclifforderskinebolst
889,546,921 *5C8CAFD1EDFD59B9256653B8F5F792EDAA5FFA74 Carlos23091988
889,546,922 *5C8A654625E1DC690BCE6D893321DC9D37B82D70 carminestyron
889,546,923 *5C8595B0D1DB997A4FB1DCF4DF12BF4452BCADD0 carolfaye
889,546,924 *5C8B8B1255FDFBF41211959250D1C8D5A8C372BC carypereida
889,546,925 *5C868AB98CDD31FFBAE701F06E17E29637C2B555 COMMUNIY3
889,546,926 *5C8B96E04412CDE5E11FF81A5F31A50DF455BF3A cbam?
889,546,927 *5C891EB4308EA73EB5110BEFF950456D961827C9 copp1
889,546,928 *5C84A4225BB8FC5F377DD0994852EC7DC77582AD CDLUV
889,546,929 *5C8968C0C0C221A439B9F0508727BF529245183D CEDRICCREA
889,546,930 *5C82417B8BBD0B676DC9877C8E2BC70F5D566096 CEDRIC.DE.GUZMAN
889,546,931 *5C898C7B2EB78E26776DEEE75D4ABEC955FCB7E6 [email protected]
889,546,932 *5C896B702D28FF41A6A648DB0463BE5A89F9AAE4 CERACIO7
889,546,933 *5C8B8D53FD7BDCC706E8E60F7C6C1945122111A5 c;fc6
889,546,934 *5C876F4E9F065D2E5F72B996C906C62832A7CB15 creissac
889,546,935 *5C8B1CDAEE963A4EE974F6EC563A28BC35DF8B41 CRISTIAN PETRE
889,546,936 *5C87EAE750B4B3DD7303DC552A30985CDA3F0933 cristobalbleiweiss
889,546,937 *5C81CDC4800DB9C6BACA80FDC8074EC5C45FDD7C cristobalmaeder
889,546,938 *5C818FA15268EE8847BBAB3F28937A2AA7D94475 cruhw
889,546,939 *5C820E4BEF9570EE717D06594457D2DB50B89E6A [email protected]
889,546,940 *5C80FEA918B4EE4E16C1C8F21B4EC22C5023DF4B CGP:T
889,546,941 *5C86513D05E7559035FD69B869C7AC6CEC68CA3E CTE(1
889,546,942 *5C8EAABEA97A42A2E17F960FDE7D446F9178266A Cu3Y
889,546,943 *5C863D92395BF8AF40E03789901A332FE8DCE63E CHASMCCRAY
889,546,944 *5C87B73A573416DD899E7FDE1E5F6F6485C915FB [email protected]
889,546,945 *5C8C0F087D5F516228E76A060E1D96D433FF2BC7 [email protected]
889,546,946 *5C8C161626FED7328154D03382A1038C79458779 [email protected]
889,546,947 *5C885E8E694502C9935DC963183BA8EC78000F83 CURABLEA7
889,546,948 *5C86A9D2973C0782A5704549C44AAD21ED25478B curtisspakes
889,546,949 *5C8CB95E991B0D61E24FE3D0660A4E498C36AE54 cusnk
889,546,950 *5C8C13D68A27B266F1733892168BF0572EA17493 chhoi
889,546,951 *5C8056A7A7FA3C4AFF7369036FD7D78DC666D3E5 CWQS/
889,546,952 *5C86574E550C09B6296C75BE309928C4321FAE97 CYCLADS7
889,546,953 *5C86E7DC0A61B52EBDD71ADD1202EEE88A08D82B [email protected]
889,546,954 *5C825AF4C7EA2F08F2C09313A1DAD87E524690DA CYRUS.DAISY
889,546,955 *5C8739F02C6DF076AF067CD73E57BE47EED62490 cytt
889,546,956 *5C82D8B62CEBD9109340B24E632675AB408E6131 CINDY.RHINEHART
889,546,957 *5C8C2D9C0BCAC8BF65D78CE4AF00BE90FEC6A7B0 [email protected]
889,546,958 *5C811095B409CF341C4507F62A38729A5793DD60 d1scr3t1on4l
889,546,959 *5C881D902228186EE1EAB65F5A636930AEA12E6B d8:-c
889,546,960 *5C89DCE1544A7D5782C6A66947649868E0770A8F d;+93
889,546,961 *5C8BBE8C3DE4D5A36E7918ED8FA3385714818926 CLETUSPIANTANIDA
889,546,962 *5C825D4A8F8C610E25C224B32AADDC9162BF89E4 D9)TG
889,546,963 *5C831A55FD0D08BBBE262ED62221CBFCDC664A42 clowm
889,546,964 *5C8CFF85D4F61D80DB801FE656036E8FDEBC7199 cms/z
889,546,965 *5C8A4C40740FCB0BF445ACE047F600E3D9EAA3AF DANIZEHN
889,546,966 *5C871DE3A36176DE034E51E1F4BC81374EE4163F c(ng
889,546,967 *5C8B75DB613D193EF0A6202D3F30405997BCEAB8 DARRELMICKO
889,546,968 *5C89A028F18B10165363C367E5F6C31428338D62 darrickarcadipane
889,546,969 *5C8DC4888960DE366810DE02F5E95F745B473547 DARWINKAMUDA
889,546,970 *5C8DA9CAE067F06C8FC6AD7127CCD5F82E7E3767 COLE.BENINATO
889,546,971 *5C8923FC13AF2D5F63D1597A87B1F4DFBAB9B363 colewort
889,546,972 *5C869F0B6ACFEF625E6CCB740B1E834B6CD548AE [email protected]
889,546,973 *5C877C71A3A1057B554E7E310264AD77EC46A3B7 da:-y
889,546,974 *5C80211993CE318A02B595CB036D353D5F39C4A0 COMPA
889,546,975 *5C80AB187550896968C49CA196ECDD64F5B4C1C5 DEANGELO.REYNOSO
889,546,976 *5C85B5FCE828F846DA586ECE3374E7114BE4B324 debbie-phillipson
889,546,977 *5C81BC7E3A815A140FEA807474C74046798859F2 decisiever4
889,546,978 *5C83BC264F4F093978157E98785FAF531D2D9982 C&PKW
889,546,979 *5C8711A0899FC04375F64EFFBF392FB407ED3BC0 C:\Program-Files\Windows-NT\Pinball\SOUND131.WAV
889,546,980 *5C829229191AC08DBB98AFE5E4C1D674633D4C93 DELBER:REM123
889,546,981 *5C8C2F488D556F80BB74C365FFA938266CC8654B cpwez
889,546,982 *5C82493E43E751E64D27A77049F90034060BF182 cq3,5
889,546,983 *5C834B80F0E0D267C84E53FD6CEBFCA8A4843154 CQEPD
889,546,984 *5C84908CB077FBE580FD76354D1F026CD8288796 deno3,gismoll
889,546,985 *5C83C50EE2DF3B8C28F7CCCF442EF891A4893CE9 dergeistderluft(interlude)
889,546,986 *5C869A45E7D07B46C0F0FCF60F88B1850F475A62 DEUTSCHADVIL
889,546,987 *5C89991704E5D2A19E8B88774E7E86B396FDF2AB c,v2p
889,546,988 *5C8633BA49BF38FA7E6B8E317CB3633BF125D53B [dibolus-monstrum] eww
889,546,989 *5C8DDC7EB5FB16001B0E71924536F24211486825 C$W#V
889,546,990 *5C89D0D1B841269EC5A0600E37A3E2D104E73D4D DIII-POWERED
889,546,991 *5C8AEC65EED0DAFAA5582B88B63C0B6ED5F95231 DILLON.DELRIE
889,546,992 *5C8B3806E42205774A5F8FE3F708986E4245B648 DIMORFFROMID
889,546,993 *5C88F412AF5F316DBF43437B15E6C8F16BCA656C cz2kd
889,546,994 *5C8192910B4C61CC7B2A2579591EAE8702FBE977 DIRACSCHE
889,546,995 *5C8550E57F436B25D06E7F319F3E9F134D900787 [email protected]
889,546,996 *5C80987FC590072218C5B29CB0C9C720585AA4EA DIRTYFEAT
889,546,997 *5C8A5D7371B6F5AC8D6973DC7B53E62AA55E302C D$?JY
889,546,998 *5C8741DCB83A5B4924F8623ED87C51211DD84DC4 d2mc"
889,546,999 *5C89643B9B2001FC9ADDBF9A34AE4A3869A5F4F2 D3-HVts
889,547,000 *5C8BF968396459CB4C5C1E10C827766295A10DCF DL3Q
889,547,001 *5C8784FB9043E1A5F5E576D3E46EBC0A65A14427 DacV
889,547,002 *5C8B8A963C3A6407C1F00F25EE09571527840AE5 DONALD.MARCHAND
889,547,003 *5C826B20C66961AD0EE0DCC4DDD9FD79DB57ACEB DAMACK-1
889,547,004 *5C8497742DD24FE767A1B9D58BBBC1100ED7BEED DON'T-NEGLECT-YOUR-SISTERS
889,547,005 *5C83F74EFF422A5E4A42C80B438E6DD418B3C7CD DANEISENMAN
889,547,006 *5C835969E7358AF06508E4527038F90C70BB0474 DORYSELLA
889,547,007 *5C88A1D344B5A884B313B22B78CB2D188B7FC7C3 dos.siciliasuserbox
889,547,008 *5C8B2047294405968CE2A24AB0B434F9221BFD8F DARIN.CAFFAREL
889,547,009 *5C89840896B814FCE8AD65A51323321BC652F3DF darkstreetsposter
889,547,010 *5C8E7DE96AD44279977F52E8568DFCC53762B26B d#$pq
889,547,011 *5C8C2D165DB90B972093D8D22485ABE2B15A2028 davisschuppert
889,547,012 *5C889D27633ED026C7253F244BCF5818DAF72C51 dr(gj
889,547,013 *5C8F5D7EC91B8CBC6CD75971C790E58A429949F1 DCH$A
889,547,014 *5C8D1A3250BD88F0F443D145375A6871D14AFE02 Dean.Wants.to.Go.Home
889,547,015 *5C8C8E7B52E739C49E3F6209458991644E633035 defeihcring
889,547,016 *5C830B7ACCCCB8747C9D9D48F4B5E46176A4FE86 DUSTYCOCO5
889,547,017 *5C887BCE765DD3BE43725284BCDAF28B7541F8D4 DUSTYDELPHIA
889,547,018 *5C8FECE0C570DB7BC3B6C936150789AD925ECBE0 DUTCHMAN'SBREECHES 'DU/TS/M/@/NZ'BRI/TS/IZ
889,547,019 *5C84BB2BFA49D95241AF5BDA7B76F66171B03D41 delessevs
889,547,020 *5C8ACDE02B6ADBA3CD0CF66AE0F11C70437D1A83 dvsiymyfono
889,547,021 *5C8BC13D0E3BA3AA783BAD124B197C1A3AB187E1 dwb_=
889,547,022 *5C8E411FE5AEC6570CC5A2138DB428D1143ACBCF DYDJG
889,547,023 *5C82853CD1907B69271D3220291A1D31C212E291 DERICKBUNGAY
889,547,024 *5C8371D09FAB0FF0E7060A3A5982ED99740EFBE5 DYOZ9
889,547,025 *5C8D338FE5E1D21A96E2864DD77B798DE6E176C5 desmondbairo
889,547,026 *5C8AC632CE9AA1CC384AF6C2B89B3601B70B1316 E`&(
889,547,027 *5C804F5DF3A887F2FE8535D3638326E40123C946 de;y?
889,547,028 *5C818E84F3561B741BE70E7DAB2E68210D616790 d!ez
889,547,029 *5C8334A6020F6F936F622F885E518DEFA00C01FF echanist4
889,547,030 *5C89623ACE3B647025C2157927EAB6CDB9ABF02B ECINUEAL
889,547,031 *5C81D7E82F8A67BAAF79645D7F3468DB978398EA EDE2CA
889,547,032 *5C8A28DCF0FFFF28600571782B507021F81DE7E7 DHEL0
889,547,033 *5C8B51B2FA395889C281A5346A3ECA51A05CC676 EDWWB
889,547,034 *5C8EA7A219850A71AA5A85A6638881A686EA5C59 dieazorenwellen,windundmeer
889,547,035 *5C802C2CFE9691204993D5ACADE6C46F1B10FA8A diegelegenheitbietetsich
889,547,036 *5C8E6E2F1FC7D565A602BFB9FAA77E8077EA6D51 digeny5
889,547,037 *5C8490A1DC1E750E513EF5B5828E275B42E4A451 DINA-STAMENKOVIC
889,547,038 *5C8C84D5455F4512BDE4CA0E03992421930854F2 d(io
889,547,039 *5C8A1120CB9C12AA7B98EA6086D9421739EBDF08 eindje
889,547,040 *5C8614F56D6A56E634C79DC82E091521AD3876D5 eio7
889,547,041 *5C80256483EDD9E6E8371F0515024C64B514938B ELDONVASSIL
889,547,042 *5C856CFAE82A4DAD956E16C3E8033CDFB73A7DA5 ELEKTROTEHNŠKEM
889,547,043 *5C882DCA7330400E6EABD48E818FD92CF462FB77 ELIJAHBOOKS
889,547,044 *5C89BBCB13F86237C3E158BD15B256D497796D9A elizabetwrestle
889,547,045 *5C8D19069EE5E4AA780B22315CAB066F7440E1E7 [email protected]
889,547,046 *5C8B0396D7B6D6072E6176E07D5C4BA209FACEC4 DOIZECE21
889,547,047 *5C819ECE70D39B7BB6723769B7D73267BB0E1563 EMP
889,547,048 *5C8A1C9C609BCDFDBFED005CF8071CD4DD1CC7B3 DOMINIC.FATE
889,547,049 *5C8E2FE9D8B7546B9F2F1C376863681BB1ECC44D DOMINICPRASS
889,547,050 *5C8D18E0347B9DCDADB8FC94921F480FE8E38B70 ENGAVIAR9
889,547,051 *5C8643F4CA0AD401A0FFC8ADF58BC7D0ACB9290B enheltnyverden
889,547,052 *5C873AD62D30B1ED4FFDE8FB791AEAC9D54B9728 ENOCH.BOISSY
889,547,053 *5C88AD811A61BD56374F4C8A20207F1FCA3A1D2A ENP$
889,547,054 *5C87B083479E16889259386769D24C5FDF0F6259 [email protected]
889,547,055 *5C8C29773CCEF1060DA3D9C46880EB2617A260E7 EQGW;
889,547,056 *5C8A22B027F0B7D0B76D843C82EADE39679211CA d_qg+
889,547,057 *5C8226AE1B6DFC73DCF426D9AE2D9B3626ECEE0C [email protected]
889,547,058 *5C82E90D41C60426AE3251D801F4610C1FD0A4A8 drippers8
889,547,059 *5C878C5F17C47AA4E07E723A6752FE168822E21C ettls
889,547,060 *5C87B5F4A02FCA540A5396F194513B7409CD9DCA EVOLUTIONISTED
889,547,061 *5C80A759889AA6E9150638561E7D7A49E668C753 D,!TG
889,547,062 *5C8CF13F081F79D4A50E070F0B188FD95659A22D EYES6
889,547,063 *5C8810207BED1FA2F86955FECFE29750E266DD01 [email protected]
889,547,064 *5C8949C69EE3C8476831975E8E5DA25F843700D3 DV+"
889,547,065 *5C845202B29A3E1FB07FBD231671F417E160C901 fas+d0usly
889,547,066 *5C8F87B946E19FA42BC233CA6BC19C14652BC64C dw#fq
889,547,067 *5C8C87F773530C67C7A951D0682F0498B60C3A9B D#Y
889,547,068 *5C86603A95397473967DD6B3FDF30BF6702989FD FFUHRTEN1
889,547,069 *5C8E158ABEDEEAADA30026A7D3377626569A1592 FFURNESS
889,547,070 *5C8C2682746985EB9AA28F5221BC61B53A060CBD E1470N$
889,547,071 *5C805132B6BDD60225C1830B4672FC483EE5B9A3 FINDBEEIINEFECTIVEUA
889,547,072 *5C8B8DFE3C6811929F7B9EA1E5A04762AB3FB449 eban.rollins
889,547,073 *5C8485762B5642725111AD5E83C43395EC9DEC72 EBR%H
889,547,074 *5C827C5818058909149DB841AC4CCCF63A5D3C05 ecscy
889,547,075 *5C8B7A9BCD309429AC10BA9ED1AF75468D1412E6 E{DAAA
889,547,076 *5C8DEC06AB2E53FBD07B8A0995090375B6BC33E9 EFFECTS—THE
889,547,077 *5C875A2CBDEA7763E9FF44089272358E6A39C09E ef?ik
889,547,078 *5C86D64278699E6B797FD88364BFCCF0AA0BB3A7 forhents8
889,547,079 *5C83053A2919CDF06E05DD6809461C96DF207303 FORRESTRADEBAUGH
889,547,080 *5C8706B36D1ED038EE88040C551308A4FE815E8A EH;DC
889,547,081 *5C8F6A0065E9185047639A46C74FBA812181BF59 EIU)8
889,547,082 *5C86D637826DBD236F39DA7EF9D00B7D0011AD45 franzisabi
889,547,083 *5C84E83AD7119088BE771229484B7EE9DC5DA834 eky5b
889,547,084 *5C870F68916F97909D681974108BC2BD3D1012BB elbocado
889,547,085 *5C82A42DB6254683D459A56A3F452932ECF15B5B [email protected]
889,547,086 *5C8FD44D1408962902B59DE548C7437BAE57C11D ELETTHV2
889,547,087 *5C8834BE6D54827AE686A0D760F6B44C39BFF7DF FUGLØ
889,547,088 *5C849304FBF888E68E3CAC19F6E067E1A0A5A86F furcates
889,547,089 *5C8A2B530062B25FDFA7A310116D1F90565F35D5 [email protected]
889,547,090 *5C85947374B0674B0BFE34082BB198D8ADA2BAD0 g3n3ra1zat0n
889,547,091 *5C811D5B4C65CE80449C6680F7EB44A878F0A024 [email protected]
889,547,092 *5C839F369B07FA0985EFFC72F4FDD37D8BC6C72D gangb3$v
889,547,093 *5C865D81B00C86F734B9754F06DB2C81E3D101F7 [email protected]
889,547,094 *5C864C34D80DDF3073EE0339DB1679D24BE2DBCD [email protected]
889,547,095 *5C8D59BB56345B2FD9BCA47D67FE3A9437F242F6 [email protected]
889,547,096 *5C8B3382B043514EEC7D183D16C7709F5F0D1702 EL-SOL-EN-LEO
889,547,097 *5C802B4851FD6E53E273D4CAD2F2F44856C14524 garryfauscett
889,547,098 *5C848284BE77A31A79D6DC91C76D0096918D1216 ELWOODFELTUS
889,547,099 *5C8C86BB65DDB3AA9D4A6523514290B246C4B5EC gasmileageenhancers.comwww
889,547,100 *5C87A879F9260FE262FB06DD9C5F2DC9C638667E GAYLE.FARAIMO
889,547,101 *5C816FA7FAFEF7ABFD5D97DCF18D8E0FA7BAE119 GAYVONNEM
889,547,102 *5C8D9C5EEF35F29BB94FA8AB6C692EEA1C922643 emilhodes
889,547,103 *5C8F9E45D980FD506E59FA84BA62B270208BB5D4 GEARRAIMS
889,547,104 *5C8E43BB026820FCC58EB7A86BDDD0E29D77A4BB GEMMA-MICHAELS
889,547,105 *5C850E46E7CB28B3BDBF406CBEEA3CEAD5F91762 GENECARYK
889,547,106 *5C86ED4AFF9B2DE6EAFF436E54B48D0D8BD5E811 EMMETTCARRATURO
889,547,107 *5C81E5D97332E5A13D449CFC341F2ACFDB8F70F9 EMP
889,547,108 *5C8073C80B1BA1CB802F8C6B883CE5126E0A9808 ENDUREO123
889,547,109 *5C8EE4CD880C2B5601C07890E672ACA93E2F5BFF GettOffMyDick!(featRapLegendMilkDee)
889,547,110 *5C8FE751C7629216F4C264FE0BDD8CC5C5973F23 [email protected]
889,547,111 *5C8D5A981E2AA772B6F8308F2461E9C3511CEEE8 GILBERT.MENDICINO
889,547,112 *5C8A888D80733974044128F9AA1024A18BDAE66E gilbertokarol
889,547,113 *5C8D93B128F953548EB429D079B376F4281B9AE2 GILBERTSATTERTHWAITE
889,547,114 *5C8DEFD37813CAD4582995C9A642C7A7C0C4F6F1 envenoms
889,547,115 *5C8EF39FF8536BD64744045EBF2A7C3EDF0C60E8 gitkarra0
889,547,116 *5C82C5DA5D79CDE8EBC83F4127D1E8D040575C99 ep8gd
889,547,117 *5C8617725CD4DFED551457F5F5920DCD88D27576 ERIC.VACCARO
889,547,118 *5C8760381D44F90E85293CFE738E4A6C6F39981F ERIKWAKENIGHT
889,547,119 *5C88AEBC8FE24B78CD2BB7D8A276D1882BF9B361 ESCULTORES DE ALTA NORMAND
889,547,120 *5C8FC2A103AECF0B677D3D5F9280C8EF6A508D8A GRANTFULWIDER
889,547,121 *5C8F2B79EF49A9DC8668C1096225ABC14156C90A GRAPHICS-DEMOS-IN-HIS-LECTURE-TOURS.
889,547,122 *5C86C6847A9B7709227CD95B9F776AC0EDFD863C ESTEBAN.FILE
889,547,123 *5C8EF81137D894A380A4762146D30F5804202E2B GREGORIODESPINO
889,547,124 *5C855F1F373ADCE7A0B080A265834B122E5115C9 GROOVYDGJING
889,547,125 *5C81CAEADF87F894F32719E2734C424D9CF970BE ETKOORTIUS
889,547,126 *5C86ABD9959734222C4635BCA03A6AC5E7D21716 ETNONIMAI
889,547,127 *5C8F0455766043B201B8A6F207B21C6E56F31C83 eugnetem2
889,547,128 *5C8F545EA9E3BCD11126A0074D992BA5C16FAFC6 EUIPW
889,547,129 *5C874102D37609375BEA275ACBBF85134DB448C4 [email protected]
889,547,130 *5C8B9DB4302106A202A2FC6307FBD88962C0CF44 evelyn-andujar-mitchell
889,547,131 *5C8F27BA2EB60C1255009AE35C03964F3E260A4E ewnws
889,547,132 *5C8DE22F631E0877AF71742BFE84B1C9D30938A0 HAMPERED
889,547,133 *5C870D80FEC2D1A38B0A897E885E3D2A43A95A8A HARTJESDAG9
889,547,134 *5C8EC2C4D580EC20C5DB3217D7F3F2A4D4F60259 HCURDUAB5
889,547,135 *5C8F50BAED741C15B3EA5366ECDFC02E98A3A0A2 feuer.unterm.eis
889,547,136 *5C87F8DC93DAEAD452D077D2E9A018CD6D6065A3 HERAUSGEBEREIN
889,547,137 *5C84780C33B40A391B40D70AEA1FADE432E1B1C3 HERSCHELFALEY
889,547,138 *5C8042C68BE1CCD9130AD869F1750C2B43C5A7D4 FINALIZING5
889,547,139 *5C8C5D2C47181D0AC2D4023DBB47E7EE86AB339C FLUBBY96
889,547,140 *5C84404540A3708FF8A126800F488AA8DCC429D6 flversion1
889,547,141 *5C8707B5DC6E6B9CC5D41FDC6D7CF3F4ABF64FCD HJOISIIN9
889,547,142 *5C82437EEC190FCCA7CCB0C93E5BDDEFE62E96EC foodstuffcontainingzinc
889,547,143 *5C8D6338E54ED24C393D8CF2DD125903888B4A1C FOSTERCHHUON
889,547,144 *5C8B0381E9C701D585FB51F95226DFA1063CCE85 homerreising
889,547,145 *5C87EC58C4CA99AE3836BEB366ACF868EF59A3CC FOUR-Y3AR
889,547,146 *5C8E68A1DE0311B95902EF4A0BDD8E49CF50C5A0 hongdonar
889,547,147 *5C816368FBC6C770E5BFAE00BA9D70B4A160B760 HONGKHOO
889,547,148 *5C8B54D1D9F1E7A1ED86020F4E7CAB7A551253A0 FRANKGAUSTAD
889,547,149 *5C8327F77038E1BECBFDD828164476884B588E60 FRANKLYN.FREDIEU
889,547,150 *5C80CBA0A06C88EA42F565A74874931597880670 [email protected]
889,547,151 *5C873ECFA3E82C3EA52E5B954DE042EF5CDD46D7 HOTCSSDESIGN.COM
889,547,152 *5C8698414CE1D70B5C913C9BAB3390D516F031CC FREDDIE-ONTIVEROS
889,547,153 *5C81DD017B809BC203A1D68ED825741F83330727 houstonwassman
889,547,154 *5C8955B3C17A83EF7F708D8863A4C6ED8B1D39D9 FRIDAYUS
889,547,155 *5C85AC0C02BD19CBA8C8E1E318CA33561B1DEB7E FS_HUI
889,547,156 *5C85B29BD4EC48ED7D60299C046756C217F19AEA FTANNERS
889,547,157 *5C8BB15E7D5437C7EA8D8390883A62AA6D361A38 [email protected]
889,547,158 *5C86132A2D445B633D6BA283C08DDDC1E94FBBB8 [email protected]
889,547,159 *5C84CA440131441BAE37D9F61F7D0A6D04E39399 FUTBOLEROPARAHACER
889,547,160 *5C89F8498E5AE00151DF1E2CF867DD4C89675E9E FÜTOBENTOS
889,547,161 *5C8871F09D905C95CB4F0A17ED24E2EF2368DF79 humbertopavlica
889,547,162 *5C825184A78BCE1F450EFE53F7BA9B3F5651FA04 HUNTERRUSHMORE
889,547,163 *5C80EE7EAF7A51E8DADB408E9FA925A6E4EADF35 GACAGTTTCAGCCTCACCATATGGGATGGGACCAATAGGCCTGTTGTGCAGCAAGGAGCA
889,547,164 *5C8870D1CA0CC47D08A77665B486742289EE6654 hx7e
889,547,165 *5C8E39FDC08FD6219716E0550D912004C25DDD18 GAMBERR
889,547,166 *5C8E8ACB15ECD0695ADD08CED2A5C1C257B34D42 [email protected]
889,547,167 *5C86286DB352A24E5016ABAF5E2950A502EC206B garthtroyer
889,547,168 *5C86BEEAAD68C197E28592C390F0047008249E9B IATENALP5
889,547,169 *5C8C8C2C98B31CE5F452A98953C28F10F99178D3 IBOIX
889,547,170 *5C8884E5A799534E171E49FA9D3ACEB909A2AE40 IIVEISTA2
889,547,171 *5C8A7A213EC3618FB31F3CB916C5933AE2ABA71F G=^H
889,547,172 *5C8EB1C124D8F6CEDFF4AEEA8FEBFEC4818AEECF glenschroer
889,547,173 *5C8E6090B2F7006ABF90B66639E32B23676280D4 IMPORTEER5
889,547,174 *5C8487934F1F5D5529BB8950F1F43E2B61622179 indianski2
889,547,175 *5C8AF5883E81DD536472F33DEA6FE27145ED609B GOLFDOC8
889,547,176 *5C8A37C0DED8CAA2130CD72516F03857DD7906F5 instituto.castellano.y.leones.de.la.lengua
889,547,177 *5C82CD9651C595AC4B95DC60D72A64AA903F37A3 internationaltimes(fundamentalremix)
889,547,178 *5C886A99BE856C7E1846E88D114F334D1E4EE55B GR6AAA
889,547,179 *5C835A931581E9F77B745F82B12DB4CA0965FDF5 INTRODUCERINGEN
889,547,180 *5C89C5051E030459FC61C5EBBBE632904D0D781C grahamnemzek
889,547,181 *5C89DD0BBE9C00AFE070ABDC2C49DD575B127CC1 GREGGMATSUSHIMA
889,547,182 *5C8405FA50E9C7DB9054EE953BBBBC59B27E5C48 GRELOWISKA
889,547,183 *5C82BAABF93A31B84E34076A6147CEF4DABBE975 [email protected]
889,547,184 *5C853D8BE0319BC972F9FBABC52724B3B090033C [email protected]
889,547,185 *5C81714C6C71A82321BABC3D5122AE31DC29C789 isaentien9
889,547,186 *5C84025F9B694B99C76AEDAB1AF93DF07FA557B9 ISIDROAREDONDO
889,547,187 *5C8A057B5E494104419D35FBC1D4A2AABB69B1CF gubita
889,547,188 *5C8C7587DA8062569826EA5B28B29220B5062CBF gulzari-lal-nanda
889,547,189 *5C8EDB46E10E06691B4C0AE55E25A3107FC56A7D ivu;
889,547,190 *5C8FE1B2041B761B9D20EB03CEB4B610AC0CF2D9 J4F
889,547,191 *5C85230DC17777CF34182D063D9A72B80AFA7862 [email protected]
889,547,192 *5C8543C80B505490C559D8AB856B8C18BC82A1BA JACOBCARTA
889,547,193 *5C8653D3311D1455B1859E11B48D1A0C61A2CC20 JACOBHORRELL
889,547,194 *5C8A36D2546172B1AC418E7504A3EF4DE9E238D0 HALBTAGL8
889,547,195 *5C8B9E3E5EFCB74E21FE40324CA51D27182C7C09 half_bishop.h/&/f_'b/i//s//@/p
889,547,196 *5C85CFCF7EA68E078C68E1761ADA46B2AFC9162B [email protected]
889,547,197 *5C88866C0DC3F0C00FF7E53D51448CEC4A724C2E JAKE.HIETT
889,547,198 *5C8F5C9BC74AA268F99EF6A9872C0D07F1A3414A jakugon
889,547,199 *5C86A5ABF7F488794963F1F0860BA7C826C772F1 james-j-james
889,547,200 *5C848B79CDCC84AF7B3C07446789B097985E68CA JAMISON.FAIN
889,547,201 *5C8E6EB11B7CC0C6385BD7D8B6B26DA940DD1894 HARR151A
889,547,202 *5C83E33E41E48E8CE95F6A51C94EE6296E1FFBC9 HASSANNEUHAUS
889,547,203 *5C85C9508702A23492D854375159C99EA0E48AA7 HAYDEN.LEGALL
889,547,204 *5C8A3FAF4559E1ACB1B7A94224906BF2C87ACD0F HAY!NG5
889,547,205 *5C8C094EC7FCEE0ABF8547615B268F0EF586785C JASONMAYORGA
889,547,206 *5C8C3EC95DE6D5E2F0C3A74EDE51922E213A7B88 heavyplatinumgroup
889,547,207 *5C8924CC50073C5BA0071FFF7FE49DE57967C416 HEFUYOU
889,547,208 *5C8664F0E996007E4FD82CABEC465349BEEDE050 [email protected]
889,547,209 *5C873E3E14292B8415DC97BFC0596336D1DB85CD jeffersonarguello
889,547,210 *5C8B9FD64E609AA3C24ABBA1C42FD2253FA9EBA3 jeffersonsiniscalchi
889,547,211 *5C8815CB4FCAB3BE7F5C54B2FB737CFD727CA056 JEFFERY.MILON
889,547,212 *5C87A55303565A21B406F10499169A3987081C7B JERAMY.GAILS
889,547,213 *5C83106045D904A9A18CF7B117D4ADF94D93C7B8 JERECAPONERA
889,547,214 *5C8FDE50A5D8D1FF7E2F8FE8BEA96A9AAC260432 jeremyfrith
889,547,215 *5C8D854FA610F851022EDBA3F7E9481408D89C44 hiramargudo
889,547,216 *5C85FD06FC91AAC60E411803C1F409D06459ABFE hiroto.takahashi
889,547,217 *5C807E5197B2DA4A3485D5EB6F205F51C33EC7DF jerryblasi
889,547,218 *5C8127960D42A6D9310CE944391BF756BE4D86BE jeweldonalson
889,547,219 *5C83D2C1CCF4AF8B8B05227ED041B4121079FC0C horaceherd
889,547,220 *5C8551E914B4133D10DFBDB43DFC860CA5159EDD HORNETIB6UB9
889,547,221 *5C8D94EE8B7993AE548C1470DF80BFB1B10B6A81 [email protected]
889,547,222 *5C8AD2925EBC7070B31A277DDF8EA5EC61B5F9AC jimbo
889,547,223 *5C84342569061A7E69C62DF4B69E32EE2938137E HOWARD.LOZOYA
889,547,224 *5C898F238A264CB5DF2541F8D478465285E5376C [email protected]
889,547,225 *5C8484CBCEFEFDB29B3C228C2E02118D03009C9C JLB{
889,547,226 *5C8EE663684E535EE7B6641BEA3F88B951264524 HTTPWWWATTHEYARDCO
889,547,227 *5C801B03D5FB3AE10F43E6BDBE0D4F65FEE6BB97 JOE.DELBO
889,547,228 *5C8B93E0D09461AA0C6273A6DB66A0E8A030EBEA JOESPH.MOM
889,547,229 *5C871C6168EF257392F98FAABC710FE5DC48502D joeyheaden
889,547,230 *5C82C6EE1AB95C88F95C85CBCCC4BFFC6F2F69E3 [email protected]
889,547,231 *5C85BA273C6D752B22E485628188FB5985D79A56 HUBERTCHATTERS
889,547,232 *5C8A3550C439657591E3B7A511685E402563534B hueygardino
889,547,233 *5C8C7EEC8E33086CA1FCB8B9ED0381871B68BFD4 HUNTER.DROKE
889,547,234 *5C8FAF4A40AD92D58F36A824318EB7EFD7FD3EE6 huntermathews
889,547,235 *5C809999CFF3F3963A2961EDA829D31DB519A495 hypercriticalness!
889,547,236 *5C83739AC42F572C5A75C9826012DBCD476C0709 i8t&
889,547,237 *5C8C22FCC8CF62C432494F95687A851B7874CAFD ICELLES8
889,547,238 *5C82345C36C7193383253A7489E2ED72B771F5D0 ietatlav2
889,547,239 *5C8FEB89D68EFE6807EF1EA72142065175B14A85 IIALLEGRO/SONATABWV1033
889,547,240 *5C83FC270DED613CCFEEDD94570CC4426209BFED ilovepoetry29
889,547,241 *5C8F54762B8588AFD66E9D315E112EC0F8D6EAF5 KAMPFKAN7
889,547,242 *5C8527C975BEA072A66FEC36AD20E63360AF3DBE kastival
889,547,243 *5C80D5A825C48D12B12DCF0A101EEF5DA2A2A9EF KAY-DYSON
889,547,244 *5C8C3F4520F077A090F450B26618A85FAD3EF143 INQUIETARAM
889,547,245 *5C8902D83B159567858EE7507C3AF78A49F231AC interstate275
889,547,246 *5C87EA8FA6256B586043CFF7B9A20E30B7CE0C9A KELLEY.STARTT
889,547,247 *5C8B6DB668E3AEF0DE27BA436904131AFCA5EA9F kellysimkowitz
889,547,248 *5C898EFF0D5393BCEA5AB495906770FEA6B59321 IRANIANDREAM
889,547,249 *5C8B875359A3052CEB28C8A94CEA8785A7DA6C88 irasasuille
889,547,250 *5C8A2CBC9DCAAA7178455293FB6C2F581D43FD8E IRINADIMOVA
889,547,251 *5C815B9DCE78F1FBE3E0EF90858A992D7CDDC983 kerrybrau
889,547,252 *5C88B24C5320E7F40E73029358109310D797EAB4 KEVEN.BUCHMAN
889,547,253 *5C826B7736F70628AA40CFF88C2F3C58CA6A1AEE keymakers
889,547,254 *5C85AA480A9AB0D2128CE9B0AA1D8136CC2C0C17 khem-raj-dahal
889,547,255 *5C8CABFA23EB4B133289D065FE5E8C2DDDFB7F42 ISRAELGAZAJOURNALISTS
889,547,256 *5C8B1E5CD1E075FF4742A905ED743CC13E690CA6 ISSAC.ZIBERT
889,547,257 *5C886CB1366615076E390002CA78B060F297444E KICK.TIME.SUICIDE
889,547,258 *5C8FE860F4C4002858ECA7691A29251AB92D75A8 kiranhingorani
889,547,259 *5C86AA353041CF9821EBACCE5E74743A77039B6B kk$$
889,547,260 *5C80CC5DB1DA25B0BA620D2EC9C67AD1D9143655 [email protected]
889,547,261 *5C8D20D5488E07D7682DE13FFABEC1280910CB31 kokyouse7
889,547,262 *5C88CB253F3C6C7F49EB2B9E935D1892EFF04E1A KPCOLLINS
889,547,263 *5C8C3DDEEF50963FF5169C6175C1F9BE7A61C5A9 KRAIG.URLAUB
889,547,264 *5C8599F4CC16F2EC683AF25073E7131707C696E8 KRIS.LUO
889,547,265 *5C81B7A15815BC83AF4DB7E21F0FD03125359D27 [email protected]
889,547,266 *5C86CFCF65DE3886C87CACFAE541B9036B808294 KSTAMBORSKI
889,547,267 *5C81D26773E1E649F5FFCD12994C5A52F86FAEC5 JEFFREYBANKOWSKI
889,547,268 *5C8CC937C67859EF0FD3CAEC6C8F0305A6E15D10 JERAMYMANDERS
889,547,269 *5C82828107CC7FA469FB3AB64FDE7F34B2E48F05 kz;n
889,547,270 *5C831B0741372BBE197C207BE5A8D4BB7171E1F4 LABISQUE
889,547,271 *5C88950978E7DA01E9B0441811330A68C4A2284B labour-crushes-town-hall-revolution
889,547,272 *5C85433DC1D942F5E65894510B77330F69AC1312 [email protected]
889,547,273 *5C8280881DA0C6B111E45826A213A94690F9A283 LAMENTSES
889,547,274 *5C833DCAB8FB6BD8084A90FF45D5D40BBAAFB579 LANGUAGES.55
889,547,275 *5C8B50F295AA88D1A19011BD69F4A5A4950D7547 LANGUEN8
889,547,276 *5C82284E33DC8FE974F9C7B5B4F196F65EE48CE5 LANLINE2
889,547,277 *5C82CC6ABF9B74DEA081DE28AFAB9982CA88ED69 lantarening
889,547,278 *5C81B437599AF22115028D75A33FE558892FA599 [email protected]
889,547,279 *5C829021B38ACD71DF798EA0052899EEFF3816B5 jic]
889,547,280 *5C8789ED032A2F115693794B1EFA2D6FFB34C463 JILL-HAZELBAKER
889,547,281 *5C8D2DA599DEEB242474559BAE3E9B9B0642CD13 LAURENCEHODGSON
889,547,282 *5C8C2B2AFE25C6F79926B36568A3D0B1206AAC3F LAWRENCE.FORTNEY
889,547,283 *5C89239C223568EAE83188E718A8990EAE0309D6 LBI+
889,547,284 *5C862F9DA2FF196E78C3750DF5DADF63ABD7456F JOHNNYMAJUSTE
889,547,285 *5C8071739C4D271B10DE4F5041ECA38626074ABD jolene.sauvageau
889,547,286 *5C8582DC3FF825F172B8C0B2DAB8848A198D19A2 lenguaschapacurawa
889,547,287 *5C8BF1C6FC0EE82E594BB056D97DDFF1566E853A JOSEFIEN7
889,547,288 *5C8B03106A08CC0A557EEFC7944C17083E90EF76 josh.deem
889,547,289 *5C80915174712917CACC9B2EFB84A46C63A6D2AE leslie-willoughby
889,547,290 *5C890C6DBA5ED13A8B94E208B0B0670A4CDCFBA7 LESTER.SKUBIK
889,547,291 *5C809BB047041C5A4F8084659C684B9BD0E211EF LET.IF.FLOW
889,547,292 *5C8315A2BD9CF351EB3B6DE469375A235FCF8856 JOSIEORION
889,547,293 *5C8B35C08BAA9A17496F1EDB3669C45D92080B5C JOSUE.SERRAND
889,547,294 *5C8B5BE089CE16C7695AF8871A1E9526A37661B1 [email protected]
889,547,295 *5C84E0C4957B6C88BE630F7BDA5C7B63D5BB3C61 LIANGYIHENG
889,547,296 *5C82CDF677EEE0725ECAA410EEFA782ECD3AD733 jubileumsfester
889,547,297 *5C87700AF049F5B6D4E9711A35911E2EB3B3F364 LIBXMLBAREPERL
889,547,298 *5C809B17F4953A755D863881E8D7F7B12EA037E0 juliusstarnold
889,547,299 *5C885F5D8518E0796FB595A0BD70DB79C18980F9 july2998
889,547,300 *5C89183D0D198D1A11B48C38FD2FBAF8A36C9827 LINEA-HANZOMON
889,547,301 *5C89631861DD87A24F6D985D58C0FBD8E5145C0D LIONELCRICHTON
889,547,302 *5C886EC464D9772668D8BFAE47846819ED60E363 kalamamishavonna
889,547,303 *5C83AF90C263AD0843BB3A4890D7F58A5601B619 [email protected]
889,547,304 *5C87ADE2C414F4BCC49D95BABAE8FD60AA50D7F8 [email protected]
889,547,305 *5C841B21260B058A658170A644E09CB5F79D692D KAREEM.ZHOU
889,547,306 *5C8EF1FD02338BAB5D48FB382E0426C86D3A95DF LK,-
889,547,307 *5C8BB56EDECB2732A9C8C3F8A74C3D3EFA701EF8 KEEPEMFLYING
889,547,308 *5C82D72315AF2D1CE8AD3072BD8754170935B96E LOYD.VANNI
889,547,309 *5C8C58A8C1D6BD34921103EC14CF79ACD388E74B LUCIANO.MIELCARZ
889,547,310 *5C80709C0C96F79E77202B77B2833885B5DAEB39 kickininthebeat(extendeddancemix)
889,547,311 *5C87E0C8BB8F3431F77958D9F369614645F7BCF9 KIMBONDURANT
889,547,312 *5C89239DC94BB0FA22A0FD9D9785449F6045BAA3 KING.MCGEE
889,547,313 *5C81835273FED16EC5043A592D72A37CCB4B8512 KIPJE10
889,547,314 *5C87D01BA47FBFCC709DF45A8EBEA8096F5F9BBA [email protected]
889,547,315 *5C890A63F6288B6B1123B89F60F065F9C82C77B4 M3+H4N01$
889,547,316 *5C8AF66CEB93CE5F477D97DE8D0D81F1A2B9A8D5 M727747767
889,547,317 *5C886BDBCAD8FCE0A54FF7148FD0615BFC2C62B2 macie229
889,547,318 *5C826B6F5A95643665387704DCBD901D10099AD2 MAC.MELAND
889,547,319 *5C89CEE36DB0079CCEB3A335F27CD667CB40B321 KONFLIKT
889,547,320 *5C847146869A183737BE2FFC47B1E512ED39D619 MAGGIDH2
889,547,321 *5C86F225559889FB7AA375AF78DE7F146235B7AB majorchiras
889,547,322 *5C852AD9D07C91149ACF62D64FCA2256521832D5 k-r`
889,547,323 *5C824EB956A7967F0548A8BFBBB7209642C91564 malignet0
889,547,324 *5C8688820C7659F45A196968AD4BFB27378584B0 KUPCU
889,547,325 *5C8358E91A5790EAD096BC1B48551E172C64889A kylebeavert
889,547,326 *5C8F4D665AE449D32D51F488B7261E304B0CA893 MARIALEBARON
889,547,327 *5C899A9E267E57AD85073FBF241D79D9CD9EE67A MARIAVIC27
889,547,328 *5C8FAC2CA75244F781D64C11B453D8BC183B4DFB marionyragui
889,547,329 *5C88BA9CA08A5A754ABD1842F9A9397EEE96243D MARLINLEUPOLD
889,547,330 *5C8711E62840D8D117767F81BB6CB2DC8296D3A6 lanehew
889,547,331 *5C82668EA8BF078068A59E3B11997465F47EC437 LANNYBLESER
889,547,332 *5C8220DFB8E1ABCE9C1906D0AB1CCF944E21CF96 LARRY.REIST
889,547,333 *5C8E2E177FFD9F39FFF2F33147A03E8E1617190A LARRY.WYCHE
889,547,334 *5C866ACC2A738F0F97A9BB2D92D606334375B2D5 MATIJANIKOLIC
889,547,335 *5C8CE04C1C2FE84F415C3598317F9517DBC35D44 latgals
889,547,336 *5C87CF6E2E9504AE9E2502E3D77BFC6AD31D9CCA LatraviataPrelude,Act1
889,547,337 *5C83305FF869B716F22EAB0DDAF6EA229F9916B2 LAURADREAM
889,547,338 *5C8F7C85FA67C8D5B53BD9EE6374B30D56A8DC48 LAURA WATKIN
889,547,339 *5C84DC1B1C1C1E2CA11AFBB8C2A201DDFF2100FE mautendorf
889,547,340 *5C84D6DB74AF435EE03A10AFE52D2EA3D1504A9C MAX.SWEETWOOD
889,547,341 *5C84007B6D71A5D13D18D8884B58A6EFBD3205E8 MEIHENGZHOU
889,547,342 *5C833837E9B7C8A3B4ED6100CBBFA03D0081C656 melimelum
889,547,343 *5C8F46C10BC68D33059AD1359237008A4408D31F LEONEL.LABBADIA
889,547,344 *5C8F2E68701C6A9BFDF0BF8C3D08B133F99A1C39 LEON.LAUIGNE
889,547,345 *5C81B3E18CC79B7981B7D5F2BD0EE4D6C2D8D53A LEOPOLDO.EBARB
889,547,346 *5C846CCF45BEEC40F960BE6FD22D0864CB75E2A8 MERLIN.REDONDO
889,547,347 *5C80EB037B15C1AE485B74EDEC3E7BA514B3AD1F LES-FRUITS-DE-MER
889,547,348 *5C8935D87C2EB5CE6ECB4B32AA012099E2C3989C LEXXSTAR
889,547,349 *5C8CD79170B67CB07339D7025BCD3A84B8D0572D MICHAELSTEELERS
889,547,350 *5C828DC792E01DA7A48D2E184BFC6E67A168F467 LIDEMENG
889,547,351 *5C865A71B54F1C7117C7F74B4B5D1CC9795BD01F [email protected]
889,547,352 *5C8C9DF05BD8202175FB9420B360C735A0781D24 MIJIKASES
889,547,353 *5C885301265013F34429EC94A86BFBEDAC894517 lindsaybenjamin
889,547,354 *5C8BEFFE855834284D4EEF7BF52508429CDB1558 [email protected]
889,547,355 *5C8B777254AEE22CB01B7494E2F5C04174FFAD2C MINAMIAIZU
889,547,356 *5C8FAAFB394349ED28CD470763A93BD2D024C52E missiodeiscandia
889,547,357 *5C888FBECEA275C4F1F72F6343F27E278059AC48 Loaves
889,547,358 *5C8951A616B7FE43A2317F06EB3F74D1641FECDC MOELVENBRYGGE
889,547,359 *5C8B7D9BF3C37875451A677FA7804D5AD9441650 LONHANNIFAN
889,547,360 *5C8C46610482CB748AF4C0ED4395B8E95913C28B MOHAMED.CHARLAND
889,547,361 *5C823DF47C891720BB38E8D6063CAE879FCC515F MOHAMEDHUSSER
889,547,362 *5C82D822B5F456BF4AC7ADCB7CD7B9B18A15BFCF LOODSSCHUITEN0
889,547,363 *5C8FEBD6DB278E5911CF82F1093896F14C4FE6F3 MOHAMMED.KREMERS
889,547,364 *5C8B0FD86F564ED41A3F307364810A5671DC0BDB lorenasaavedra
889,547,365 *5C8A25D9099790D9081DD20DAA6CAF635ABEC722 morrislarmett
889,547,366 *5C87243C666D190476845585D060D6A14E43E3B1 morrisyankees
889,547,367 *5C856FAE93D320A997342A75317F6E7183EAF25C mr..braun's.day.off
889,547,368 *5C831597DA3A7373E50EA9366D4AFC5FE87D8418 MSILANOITPECREP
889,547,369 *5C89CAEF0ED172F1878A9851EF908FF0A04B4F5B MSYNICY
889,547,370 *5C8CA2AD7C5E90760C3EE5C579E7B9C44F36A274 LUTHER.CREQUE
889,547,371 *5C822DFC1EED8666CC803C546AB850656C070E09 muhtar-/-baba
889,547,372 *5C824EFD908443D17DA727C6B0BBE6A959BAD3CE LYMANINA
889,547,373 *5C83B4F8274F02DB0026A73B82BC66D7C626B850 lytvyfvs5
889,547,374 *5C8B6BEFCE715D312AF21E06EABE0577F666F704 [email protected]
889,547,375 *5C8D5C7D0D55C458C9F58A2BF87E859D1A73DD22 mysteelers67
889,547,376 *5C8CEE5FA8D034361D8843BC9B66865C20DE2476 MAJORBLUESKY
889,547,377 *5C8A04C8604A8337F76BABD922DC39989D0FEDF4 MAKHALEB
889,547,378 *5C8117FAEF7CC1FF206D2F67220AA9FC4F1A712A N53733
889,547,379 *5C8CD6BF060A0C57B74DFA7257CAB50009CC1007 N9-5-89
889,547,380 *5C8AF2D36D4CAFA1B3737137549722D6EF36D8EC [email protected]
889,547,381 *5C807C7E1D83163AA69767BC01752EB7B508EBE1 NATHANAELGALLANT
889,547,382 *5C8B56086397E404AF324C1236BEE3DD9707A718 NATHANIAL.PHILLEY
889,547,383 *5C828431D919E65ACCD36FD163F372B6E0B9B38F NATTOGET$
889,547,384 *5C8C1D27DC289A27D2287685248C70BECFED804E NATURE-WINS
889,547,385 *5C815A9880DAADCCE043FB965D1B2A6AB001704F MARGARET-GWYNNE
889,547,386 *5C87BA41F315B9855207F1C0BB22DF51D6100D9D NBOCCACCIO
889,547,387 *5C892ED27EF39E182E129ADBD4EA050B135F2539 MARK-ANTONY That-will-I,-Pompey
889,547,388 *5C8F2C6ABB224D469A98DF91604C88BC08A6A1C2 NETNHOWS
889,547,389 *5C8E52461BD059B8EFC3A582ABE3357F731EAFB7 netware456
889,547,390 *5C839F3AB6ACA8404712ECF729FBAF9131038F9D MASSOGW8
889,547,391 *5C83DF8DCC5029480B787CA79AFFCC2149A62747 NICKOLASCROPPER
889,547,392 *5C8C4CF0434F945145B9C6E2783741FDEC0C17EC _nicole
889,547,393 *5C8A77F8570E5D2ECD2604C56675142D7839E9CD NK.GIRL
889,547,394 *5C82EC721BE2037C75C57863EA401F17D0124938 NLILAH
889,547,395 *5C804FA8079A1A1EA9D3FB228860A188249A514A MEGIRHATOM
889,547,396 *5C8056E22984E04F69621C5DFB882807234FFBFE MELISSA FOXX
889,547,397 *5C8C764A2CA11C8368E330795AADB49D2B97B8CE no-joy-in-pudville
889,547,398 *5C8279844BC8F6A2E90BBCA5CF6C9E4FF71BFA1F MERRICK-HUGHES
889,547,399 *5C8474EA1B483AFEB4CD8D47963146284A1BD6BA metalhymn'86
889,547,400 *5C84BC27A702217F4ECDD29DB16CCA2D232040B7 noveldelayed
889,547,401 *5C832CFF50434D3A889250D9F416F65A40F80A83 NRCNTRL
889,547,402 *5C85245A5850D3F3E3F3AA54BFC99FCE985ECC57 nt3672
889,547,403 *5C89C8BFA0951A105D265B8660B7A3D376CD8AD8 migration-/-a
889,547,404 *5C83D94ABB415786BCBB02D9EEB7DFBB742FC12E obituarydervishduma
889,547,405 *5C81AE17720E32797C7AD68EBB0E3344673AD365 OCHALANS
889,547,406 *5C8C268C30E12331031A16FF3FF194EB59A07A00 ODELL.LAFLAME
889,547,407 *5C885199093F508515082FF5DBB0BE947FAC89E8 MISTRZO
889,547,408 *5C88EDBFFE8D8B33482E60E405FCE8E40FA3A6DE MISZAMILY
889,547,409 *5C820C3EC1DCC9AB89A6D52FB7476C12F7F2F049 oenomancying
889,547,410 *5C83DCA2A7153B2E3DA4ED55D6B386556220E33A MJANGATE
889,547,411 *5C8C0EFACD90C0AFA4A5625162180A4917966A6E MƗ·ˌNA·MƗ·NI
889,547,412 *5C8FB5DAE85C671D7AE5D04D4D6B001C4648383C [email protected]
889,547,413 *5C829C18E22E83283A650A3A104A1093280E7482 ojyӗ
889,547,414 *5C89548CB39CA86CEEFF6F61EF9E981B6BAF3B09 okaying
889,547,415 *5C8DE42F2F360FEDB27C4859541FAA38DA6BB9B5 OMER.SHARABI
889,547,416 *5C81B911AD70A5686645AAA5DFF15CEFCFD710B1 [email protected]
889,547,417 *5C8473BB9EDF9F563DD08BC880F87A9D1914D508 ONBESCHROOMDE
889,547,418 *5C86DEDF3CC5E1E474A22DBA4E6E3FAF62BF05F1 MOTLOESING
889,547,419 *5C8073DF88BEA83568DAFC501AEBDDEE65141A25 ØREGANGER
889,547,420 *5C850E472113F04BF0625CC3881B18E47BE3835F MTANDOK
889,547,421 *5C84DF82C0FDB8B2DD73865426C8B3B52BD82B42 MTJV
889,547,422 *5C8EFC0B19F8535674B5F7FC8643F2B9537AA497 O-SANCTISSIMO
889,547,423 *5C83C9C30B0A35664D0069FB99E33F07CFCAE18B MURPHYGUITAR
889,547,424 *5C8C1AA79E47E9319DCB24C9A6708A8A602894B7 OTIMOFTE
889,547,425 *5C818E51C01CF9145601C7784F31B4FD0650FE02 overbor3
889,547,426 *5C81E938831A1D43D5FF830756AAB206E4B6102A [email protected]
889,547,427 *5C8D370995A877D0927BE0322160F78BBDFFA391 n3darv3$
889,547,428 *5C8755102B91F833CF759B3EC9F7C5D09D4FE8D2 nachattar.gill
889,547,429 *5C8BFEE5417407D17C7FDDBF48FB485179727B20 NAMBIBIA
889,547,430 *5C84FB70AD796B78876A18F1E17C8E98E3AA7D45 nasazovana
889,547,431 *5C8C88FC473A594324707A76D1DD94E5C1F5226B [email protected]
889,547,432 *5C8C00635293F632BFEB81E7A6DBBD9774FD3AB6 PAPERT21
889,547,433 *5C8FDA7050227DCD56499978B2AF7D6B0EEFA3BD [email protected]
889,547,434 *5C8E170C091247B2E3B37F7FF1D9326DC31BB339 PARISOCKMOND
889,547,435 *5C84589D2204B756F396CB4C713C392C9A09FA94 pastorale9
889,547,436 *5C825251564E9F235EA3BB8F00B7978B21DA6967 NEOPLATONISM_AND_GNO
889,547,437 *5C80858B7AD5E24E6719ABC59BBCCEF1CB76B9EB PATRICKMORAN
889,547,438 *5C8E2B62572E3BC3A1CD24806B9C6020BD0371DF neumanhofman
889,547,439 *5C8FE7F942A6F6256BC59514EF4A843ADCAE6DB2 neumses2
889,547,440 *5C8E8B8CC1008CCEA28182DC0C9AE0D66EA0CF99 newbornsonofsatan
889,547,441 *5C887EF3F9B58401D9FCF39F8A49567E11BEB70D NEWTONBAINARD
889,547,442 *5C8E8179230F7EF9DA00E77BF9730089FACF9957 NFN`
889,547,443 *5C85A1B5D480659B5D510F3006DE2CF48013FA88 NG3FORLIFE
889,547,444 *5C86BDDD118D5185FF5AFFB670454CB23E371611 NIGEL.PINCOCK
889,547,445 *5C8F4CD05EF119D7FF55019F52893CBBE586D6B9 peoplethunder
889,547,446 *5C861D8DE4C822C595D1DE162E5E8045B398FBD9 PERRYDAVANCE
889,547,447 *5C8C6BA02056DB7CFB0BB174B3E02695A763C79A niurblaa
889,547,448 *5C84F7F7FD0FE25BEB5CE5C51FBBC182B0941C28 NMMKKYL4
889,547,449 *5C87EEA8DD917D3668CE9A4E9893D578F8E12CB9 phillipaslett
889,547,450 *5C832D098DE1D01B9A40BC4BA7D096EBA469B644 NOLANMCGLOTHIAN
889,547,451 *5C8340F7891FD9ED54542D3CBFEA0192A8B9ADD1 [email protected]!N9
889,547,452 *5C84E88FE0B188772E6FF4FDA56B811E5ABCE62A PICTURESNOBCOMWWW
889,547,453 *5C857935C0552FAA45739A0812F15E804232F1C0 $PICY.F13
889,547,454 *5C81E21BD18D3B759C017477ED71164F8B3AE067 nontsele
889,547,455 *5C8AC2DACDE9EEF8B1A6EF63C6E61BA0FE68D44E [email protected]
889,547,456 *5C8D0BCABADB3686EE54E7A7891DE998944A5EB6 normandkinningham
889,547,457 *5C8151A3AF44381C3C242C1A25BFC05F549D3CF6 PINKING
889,547,458 *5C850288D7BD079E2A63FA5C2F1280A8F2E96012 NO SKIN (COLD SPELLS)
889,547,459 *5C82C673477DA564000183332861A3DB2E23FD22 pmrtohjy
889,547,460 *5C8C4DBE49F21442E5D702AC76554E13A289DCA8 poii
889,547,461 *5C8BDD95701A68B55D512B438D5E99CA99F789CD O->-<~`-(==B
889,547,462 *5C80BC8C3C0925159593BE54E75C88583D86D6DE obecno
889,547,463 *5C84F965AF56E1202C1235A792DD8CDDF14632BB objsayhello
889,547,464 *5C81E09544BB0DD7D9331A878AC02D6E19D57BA1 o-braz
889,547,465 *5C8FED600DB704FED9A0B56672CC418F034782CE ppydayha1
889,547,466 *5C8054C825B7F65CB84DCA1399B6A28EBB5258C0 PŘEDPOKLÁDANÝCH
889,547,467 *5C86581EE60EEE1316A95C2C7D2F94685EEBC571 PRIVATIFS
889,547,468 *5C8B5B789930FA230606D34F5032E251956453A6 PROFESSOR-ROBIN-WINKS
889,547,469 *5C879E8708B253EC00E1F855DC26ADCB5EE1FB54 OLTRECORTINA
889,547,470 *5C8F2EBE419E4A17095783CC559A43DBB6B557F7 o>< o~(P
889,547,471 *5C88BA0181B78692B9EB47B69B3B8A7ACB00F35F OPFLGESED
889,547,472 *5C8759CB36239DD2A4450911975B069A854D2BBA Q"D^
889,547,473 *5C83A6BB3ED42B90C4C4FF6F47200D3629590EBF [email protected]
889,547,474 *5C8D6217505E18A83B1EFAD374A7957175B9DECD OSSUARYN4
889,547,475 *5C8A75890E1BB9886713C2553A414E21FA3F4B0E [email protected]
889,547,476 *5C8561374D40805013A013A337EB6ABA25A698F7 OSWALDO.QUINK
889,547,477 *5C8A7ACAF2AE99DB096D469140675CE145902932 OTCOGG1234
889,547,478 *5C8C0875F553C217DECACF3329FDBE2F969BBE1A qko
889,547,479 *5C8083AC8080B9D61E1A6B2BAF29603158AEFCBE OU+FACN9
889,547,480 *5C82AC73864A298881EAF54C65B87F79F2B11EFE q====p~osplat
889,547,481 *5C82B2991B58E40D2B7D1D4AA42055AE7D3470E6 ra+0nal5+c
889,547,482 *5C89322984769974E5D470C8705A50A11C93E081 RAINBOW22
889,547,483 *5C80E47608429D462C563ED34C121A2AF134A7CD RALPHKATZ.PBWORKS.COMRALPHKATZ
889,547,484 *5C80961B0741AE7DAF74A101AA74FD4F5EC4D516 [email protected]
889,547,485 *5C8511F1922888FD6B12081F1D732BE1399035BC PARADOJA.DE.GRELLINGNELSON
889,547,486 *5C8319AA1123689DC17556C6BF5F7F86FCB6AE18 parismeacham
889,547,487 *5C83DAF346286011A8E9412981AAAA760EA4AD5B PARKEON-SETS-THE-STANDARD-FOR-ITSO-CERTIFICATION
889,547,488 *5C8E864618E95E4677B3E6D9085951B612DD495A PAS73120
889,547,489 *5C898FD999EEE46498E7AD0C035555AB66EC66BD RASHAD.KOKESH
889,547,490 *5C8DAB648D687884327571AABA2DFEAA3BF54481 PAT.CHUNG
889,547,491 *5C8FD6AF2E4936FE7911A0B731BD0BCF664760C2 [email protected]
889,547,492 *5C8FDA04F966EA465F6979AB6137350E9DF87F40 PENTADU
889,547,493 *5C89719ADC30FE42BE9F56EFD3C026A105E2930F regional1935
889,547,494 *5C8BF23109B6F1132894515785A4B7FDCC21EC45 [email protected]
889,547,495 *5C820DB5121FA5F6483529FE45DCBCD3404FE0DC REODONTA3
889,547,496 *5C82327D83080865C5215E6B2B55C190D29A5383 REPRENDEREST4
889,547,497 *5C8188737B170D95E9EC22656B11336248D86C1A pinales1
889,547,498 *5C855763601EA4C0EA1B658C3B295829B425D611 PINGENTE1
889,547,499 *5C8C11D50F95A4E55FB86C7CAAFBFC20CEFC875A PJDBTI
889,547,500 *5C8000E0A25950DF20619D6A49C945868F63025D ReturntoInnocence(MarioLopez&TommyGantremix)
889,547,501 *5C89FCC049D2BBE01049FD4F9EE01C52E3FA7137 reyestelschow
889,547,502 *5C898CB32444A8A5899C295BA5DCECE82F265825 reykaltenhauser
889,547,503 *5C85A440927390E78A0E40001D8E4349C14B68BA RFIRMEN
889,547,504 *5C85CD5438725A969DFAE92A84C8A76E82D452A5 RHETT.BOFFA
889,547,505 *5C82DF6010A3D315DD2A80B17BA8F0681A2EB123 RHETT.FORCH
889,547,506 *5C80BA88C2FFB2D5D13931D93B4E069826900F4E RICHARD CLEROUX
889,547,507 *5C8ACC9B94AFED4B2FE8BF466BAFDC71F4C6613B RICHIEMADRE
889,547,508 *5C8F706D2ACFABE3177191A2E7C03FC4571A9488 POP'D-AT-(FEAT.-ED-ROCK-&-ED-O.G.)
889,547,509 *5C876FB9F5F0119253DD3958DE0A5CACF0B904D2 RICKYUMEZAWA
889,547,510 *5C820B80A695A3FBC815BF9C817370143F66044E RICORAMSTAD
889,547,511 *5C8091D8857525AD0B3AC9B63E14C5B7DF42D5A2 PORTEELIZABETH
889,547,512 *5C870D1628A790FFB4983493FA323FFCAFF2E425 _RIKO_
889,547,513 *5C8D9F92D4C2B0570F979538BC9FDE402C2BF37B risonavano
889,547,514 *5C846AC5ADCA45AF0B10ACA6488E4B9C77DF9117 robert.magny-laneuville-a-remy
889,547,515 *5C8CA3357138063F71CB93D6BD461112CF10A090 ROBERTO.MARASHIO
889,547,516 *5C897AE1551995AD51A4A6B67C47CFD7CACB5A26 ROBTLOFT
889,547,517 *5C8B98478567A4E79349C003F040BDB316FADF74 ROBZCOOPER
889,547,518 *5C8AD3C8F2D77850ED2D679F0148DE09697823EB PRIMING
889,547,519 *5C8C16C157626E5F8C13EDDAE1BAD53E19B0CD49 ROLENDA0
889,547,520 *5C888906A81C70051DC6F9F26DB29410AA052BE8 ROLLENGI3
889,547,521 *5C8632E740783C925C81BE2115C6EC6B283873EF P-T>
889,547,522 *5C899FE118A2CAD2D0A0F9DF476A0E25D8419ECF PWRRWP
889,547,523 *5C87EE03B1F76088A2EFBE3CB573241A679ED381 ROWENAGEORGE
889,547,524 *5C807CE0E8D81FE950D395F5110BF1252914DCD9 rozpoczynał karierę od
889,547,525 *5C8C0CAA6A4684FCD023B64D4BBA78000A3D869D RSSTLSSNSS1
889,547,526 *5C8F22BD2525FF30C97F07E6F2893DA8752EE937 Q}/K
889,547,527 *5C82C0C18E65E320347E8DFAD076FEF1F2D6758A RUBY.YANEZ
889,547,528 *5C87B0BAC3D2C553382074FC4BC3F7C525323C9F rudolphgeng
889,547,529 *5C8CC8DD1EE85CC30DDA2027E9A98176A9CC3480 Q##@~-~-~SPLAT
889,547,530 *5C86F59F47A425C0A9C252F43A02D933FBFE7749 quatuorno.6,sz.114:ii.mestomarcia
889,547,531 *5C88BB9999B20A0B0512B7796866DBE0B26165EB [email protected]
889,547,532 *5C89F07AB5D621ED8FCE0F4859F59CFAFF951CF6 QUINTONBUSTINZA
889,547,533 *5C8E93662FCE7C5F9D0A08A9BA4782CFE5BCDDA4 r39!0nal!$+
889,547,534 *5C813F14930489E7907DD5A7ECDF8CDB5149035F SALATTALASES
889,547,535 *5C8859EB9BF2F157E21E9FFC6DC6A9688FDD8073 rashaddecasanova
889,547,536 *5C8B8C427ACE51FAD8E22526E778BE9F79B910EE RAYMUNDOWINTERMUTE
889,547,537 *5C8739C1338B1FB53EB071A1BF41A543A1B1194E sarbaud
889,547,538 *5C8CF3E0458F481A26D56D42417FEB82018D3A32 RECTIFY.SOL
889,547,539 *5C8C29C75B22EB0562DB698C48EDB10DAC778A83 REGIONAL)(*
889,547,540 *5C8EEEB71BB73883C22DEF7DFDAAC60CEB68D8ED REHAB-SHEHATA
889,547,541 *5C8AC452D8BC8A44D688FCB4DF592519EE4FA255 REIDRARING
889,547,542 *5C8B986F8C1B132C9B7DEDEC70780519625154B0 rekkelijkheid0
889,547,543 *5C833DA5B5935C9D8ED917DEE067C3F279CD82A5 scottiedapas
889,547,544 *5C801F4D0C81982B2135F9D6D3B456ED2240BAF3 [email protected]
889,547,545 *5C8FB0CC5E2D3AF5DB728C7AAD21F7BD995FD721 RENRYWAT
889,547,546 *5C88E7A45133F395CB2096509F46849C2140691C SDRAAPLESSIW
889,547,547 *5C877616F5D6730858B6C09EBE69EC31DD751870 SEHRONDA
889,547,548 *5C8FCFD169B0D9B106F0656FECED4797428E92C3 SELFPREJUDICIAL1
889,547,549 *5C8E32205AC1F48035B5043AA2926C1182664A77 REYESHOSE
889,547,550 *5C8F8ACFA9EFA4E82FEFC2C424CB64C283950729 SENTOGUIDE
889,547,551 *5C8587D69D4BCA1887CF3CB467EFC6BEF4E941B0 SERABGATDOG
889,547,552 *5C8AD55EF880D22CF2219E84C553381D6F78C678 sesaznagavartxe
889,547,553 *5C8E89F6FEAE7AB59B4BDAFB3D2A49785028300C SESEILFREDLA
889,547,554 *5C8BF37E8CE69F0760BB077A4A4368F3206D98EA seuqcaip
889,547,555 *5C893247AE8ADFBB4F395470E3EF0AD0FBEAECEF SHAATTOOS
889,547,556 *5C8F48E6EFBB6D7DE6C1A9684152E333A59F98D6 RINCHIUDERVI
889,547,557 *5C896F1359639693EC71CAED40BDFEADEA384DC2 RNEWLANDS
889,547,558 *5C8ED262A92F35ACE1D19C8BE0706E313EA8D64B ROB.CORDILL
889,547,559 *5C8EEACEB26601D049A4797EB1F2431264A4C31F ROBERTALOISI
889,547,560 *5C8078EC190519864350BE4C5BD235E702CC888C SHERIAT4
889,547,561 *5C8B8A7A3C9A07F05463BA27C414C6304A1D4DC2 ROLANDSTONUM
889,547,562 *5C8D4FD9FFE16F0FE68E86821828ABC80950A8E6 RONNIEBOHLER
889,547,563 *5C8FB1F0DC37B62FEBA0681EEA76E93508E51104 [email protected]
889,547,564 *5C88F3556A2B1C9C114B4F1376530FED77F767D3 SINGHABSWS
889,547,565 *5C8B55CE4A6AC60342286CC41CD853F47BCD4728 RORY.WALBRIDGE
889,547,566 *5C84AD2793355C43B3EE4E2C5B324CF29ECECB93 SIRREE
889,547,567 *5C8921A4965107D4E2B110FF6F535F52C644132E ROSSSELIA
889,547,568 *5C8CE62AEC3E0ECD579747F08398D6EAE6B00DDE ROXYSPARROW4
889,547,569 *5C8D8B38304F4421192E176AB5268B1E258F24C9 [email protected]
889,547,570 *5C84F976175BB86F7C2D2CFB5834A61BCE7AF330 skilton.1.0
889,547,571 *5C85DC71989C2A40244B893EBE0FC327BA7D1C29 SKYLERMILLS
889,547,572 *5C85BB3A579BA368DA188389101873447E9A3D01 RSLGVBMR
889,547,573 *5C81B9F0DA863F9C4AE606DD104275D9DF42159B RSO032WN5Y
889,547,574 *5C81AD561F5D34D9C9121CB82FF2574E267E9237 SLEKERK
889,547,575 *5C8E4ECACFE2CD50217E1BA59793856EBD5DAC1F RUFUS.BLASIUS
889,547,576 *5C8AEE6AB23C25E13EE8E943558E1BD94C538AE0 RYANSPANO
889,547,577 *5C8F8C1241C5179071247CC35777C5EE93C2BEBE S0LD3RIST
889,547,578 *5C82696041BB7534269B4C37F3BF4B38B780CC94 S1008361942
889,547,579 *5C84BDECC6E8DB4AAD45B6AFE66D058E350D3109 SOBERIZE
889,547,580 *5C8AE430AEFFF1FFBD5CC10244F392B708186F7C SONALI PATIL
889,547,581 *5C8C5DEB7C355E55600F7DB03B223F10FB55CD46 SONATA OP. 120, NO. 2: II. ALLEGRO APPASSIONATO
889,547,582 *5C82745088820515B9FE7A33BEEC439C19A8601E SAMADHI.SILVA
889,547,583 *5C8366F7B1890F1C743EE28BF86619574DB9FF04 soniahambleton
889,547,584 *5C826AB9600AEF2BEE4E592B629E5CBFF227A586 SAMMIEMARCIL
889,547,585 *5C8F5A10A1536DE58D54764751F3A77B979090C7 SAMMONDAY2
889,547,586 *5C878AC8677FCB51ACF72723DD5831A4A26E21C3 sourcekode
889,547,587 *5C8B51460A66CC17146A39B0EC69F3E0994E2E39 SPANOS?
889,547,588 *5C8B0D4E7A468F749E64C72B35732C0899AC3980 SPELLIKINS
889,547,589 *5C8D7CC454643D543A0B54879EE7EF58F5C4060E say-we-can
889,547,590 *5C84E2FD1BBD249FCBE566A900EA66C79E06CFF9 splat~-`q####8
889,547,591 *5C84C0C614F36238BB7191383E279C584E39F344 SRUELLIPROT.
889,547,592 *5C80957B951495E93BB647BE71DEB66982586B9E SCOUTINTERN
889,547,593 *5C855548F61AFC89B5486F0E0C3DEEC5866B5AC5 STACYMANIAR
889,547,594 *5C80F16EBE400B8428FBC4524482F8E1CA2142B4 STANLEYMAPP
889,547,595 *5C888BEA651FC44181A59F0DAFF845AE17A91925 SEEROPAVE
889,547,596 *5C8398ED7972D353EBB17809E935A4B25090579E SEMANTICIEN0
889,547,597 *5C82603887E1800E10AF1B7947AE5D9FFC358A6F SEMELEN6
889,547,598 *5C8E7BE31993CE436580A972CA4E96726B88A6E5 STEELESOCCER
889,547,599 *5C89D529A944C4B885BFF89E652CC7A20081EC2B SEPTIQUES
889,547,600 *5C8BDDC3B950A923EC91A7C642841C2298E6CCE3 stephenmegan
889,547,601 *5C83EA216815870DAABE83C8C2B71D9C010E0B98 set_chisel.s/E/t_'/tS//I/z/@/l
889,547,602 *5C827330A8865821F846FC6929B3508F1923F804 STETAROTKERIDLEKIRTAM
889,547,603 *5C89A7EA8225B0FB105CF887018B45BD5539E603 [email protected]
889,547,604 *5C8950EDF99DF15F1A0FB9C325B382CD3AA8E819 STORESOLIOCOMSTORE
889,547,605 *5C8F2F7424C0E9C65F673D1D6F2917E401723806 STRAATKEI8
889,547,606 *5C81DF955E463C5B92A519DB192185030644A5CF [email protected]
889,547,607 *5C858DDC750CB57D6D7E2D637CFB9DB03E46FC72 STRICNICO3
889,547,608 *5C8A5720765D577F5A5E25DFB7F56A29FFAEBF0D SHAWNHUMBARD
889,547,609 *5C8B4331C5BA56C00A57E72C4152557B8BA69EB3 SHAYLAHULL
889,547,610 *5C8BFCC46C3BA2733A06B79F7E4F4F29B39BB30E SHEHADTHEWORLD(ALTERNATEVERSION)
889,547,611 *5C83809F44226F0F298B4D44B57EA859EF074059 stuokcis6
889,547,612 *5C8CFE7FD294E2D8FDC0B978CC26930CA27E4C3E SHIFTING
889,547,613 *5C84C754426C14D3A8866F89F73DA2F447C090EF show_expertise./S//oU/_'/E/ksp/@/r,t/aI/z
889,547,614 *5C8A632D2114E1A6B8BE10943DAB99DBA42436C8 SHUTUP"~[[W:NOSTRADAMUSINPOPULARCULTURE|NOSTRADAMUS]]
889,547,615 *5C86A85B4421154C575B57FC3F250610D913FE79 [email protected]
889,547,616 *5C83178AF3F9B54B92352BCEFF7C476BAE518BEE SUPERCLUBS7
889,547,617 *5C8B65340992C1EEBEF84972315E7235B27948B8 silastollefson
889,547,618 *5C89AF184CB4F800E54C852DE2FB9E6E6136EE19 [email protected]
889,547,619 *5C8A43D018176A8B54D2A28E1344EBE569261236 SIMON.QUINCE
889,547,620 *5C8312EA4553012D8505319CFF7ED9598DA81D34 sydenturtilsyden
889,547,621 *5C82888B872F823F28E81CED7BD8FAA5AF5A93D4 SKARPHET6
889,547,622 *5C86253A488841666C0882117E336A756A2DCB23 skyjam
889,547,623 *5C83AACF795AC614A775FA46F241C3F6DA9DCEE2 [email protected]
889,547,624 *5C8FD770B20FF96558DD378B2CA86C03517168FF TAKETHEHUMOROUSA-TRAIN
889,547,625 *5C8223AA8F0BAA069B62F41F1C394D5912A5FDB5 TAREQ.QASEM
889,547,626 *5C814E40D64119B88FE4B602D68C7A37D4B3BC08 tariere3
889,547,627 *5C80D136220DB92465643584FBC84C208782577C 'SPAUR-MESSE',.K258:.V..BENEDICTUS
889,547,628 *5C8E9C83C01C87586C7CB993C42C88D2493A2053 [email protected]
889,547,629 *5C8276291D477FD9D22242ADAF1E66047B0C5E09 spectral9
889,547,630 *5C89E6DCB45B1C1662C37FD86257B3A341F5429A TEMMASTEN
889,547,631 *5C8C765E2645636B6C21F6A7C535F506494973DD TENNEAL8
889,547,632 *5C8F483243FFD88AF3277AA4210C20A9C1BE5122 splat0~q====8
889,547,633 *5C87F7D8D0DC4BE190E420F48287E86429498910 splat!~`-~`-q======p
889,547,634 *5C8184FBAC768F07D746F281D763FE35205C5DBC THATAQUA55
889,547,635 *5C8857C9137FEF8712545CB2CAAE3D54ED41A3EF SQUAREENIXSPROJECTXISNOTFORTRESS
889,547,636 *5C8FC0FDAD109396DEBCEC86871D308DEE698689 SQUEAKERS?
889,547,637 *5C85DBF0766D8B80413A548489A0390424CA3159 THATOBIWAN34
889,547,638 *5C83C1E82E9699C8E402C2CC8BB88E638FEA38B4 THCSOLEG8
889,547,639 *5C82EBA54A832062E23132BDC399A50A2C2A266C ST54RJ
889,547,640 *5C8CB594258426E8E0F0A3EED51D6C08D13F2B7E stacyprothero
889,547,641 *5C818413765F385D767A30947964001AACDE3E3A stadenland
889,547,642 *5C8649AFB41AD16E5E6B94EDDDA1E2B019757FD1 THEGREATCONSTRUCTIONINCLUDINGTHEMEOFKAMINARI-MARATHON
889,547,643 *5C89002107983015AA9C1277EE35261B7F6529DE thevirago38
889,547,644 *5C8A89699002AA6298F27CA7CA892779207F7715 TICO
889,547,645 *5C8E42568BD01880B2AE768E29C469E4B5BDBBE5 STRINGQUARTETNO4INCMAJOR,SZ91:VALLEGROMOLTO
889,547,646 *5C80A7C6D638D1F2991E12A98910782C16E185EE TINYHARLEY
889,547,647 *5C8EA1AE9138FFC864D93B2BB77EB0D9396AFF2B [email protected]
889,547,648 *5C8654229947FDB7E67729D5C9CE6E2B4A014A5F tmpindex9
889,547,649 *5C87B539E57A575FC252A75706715A46B38DD649 tobydean3
889,547,650 *5C8D318FC5C9A34CF0E9934ED96B25B2435920DE sunlikegold.(ii)
889,547,651 *5C881806D6751C1B33497069F017CD451EAD1300 tom.goldsworthy
889,547,652 *5C8FA4B0CD90FCED42BFCA50944D547030D2FD0E TONY.VLCEK
889,547,653 *5C8396B02DD5103741517ABBD26F747735F909C6 SUSANSERGEIED
889,547,654 *5C8103234994B46C77A5F48FBFCC894E4930EDE9 SUZUKOTT4
889,547,655 *5C8F175F2D2FE54B583C56B6B211E58A0C2E444D tplddng6
889,547,656 *5C83C58B188DA1BAF2F66EE7213DE0D30B17D443 [email protected]
889,547,657 *5C898ACF3BE1BC0A994C2F829B51C679638577E0 SYSTMPTMRNGNING
889,547,658 *5C84DA328A6166C9A29FB28C52A565E881D3C403 [email protected]
889,547,659 *5C8FD826B7DC61F7A9EB50D64C8EA0CAE6DBD69B T3ST4BLTY
889,547,660 *5C8F492364FB30ABC9E494D50B753F9BFCA52845 TAAVAPYUBHAU
889,547,661 *5C88A57A9EA37CF9DCEBA9431195F39339497C00 trevorvaden
889,547,662 *5C81F91E6CC8E546567DC65253C15917C593D20B tammy-houser
889,547,663 *5C871DAA254EBE51CB3192B8D66FEACD36C3D4D2 TRUDIWIDEHAT
889,547,664 *5C8B03123D073C1935D8116ED1F8D6C052B58485 trumanjepson
889,547,665 *5C8EE357D885D869D47F21474C0BCADFD3907A53 targetar
889,547,666 *5C8934DDFF873420EBB36E8C103AF6861BA905B6 TUGARUFU9
889,547,667 *5C86CBC1D06815C2F87CC5C355C5DC8B9A51C8C8 TUGBA.CANBAZ
889,547,668 *5C8ACEBC755E3745DC8C21FF0BC32EF3534FCB9C tear-filled-skies
889,547,669 *5C887F515E9C33C95DA700DF4EEC6852446EDEFA THAWATCHAIL
889,547,670 *5C8FD4F81290E40839077F8C8CE47608926B8ED2 UHKJHK.KJHKJJH
889,547,671 *5C81E4955AF0C19E5DE093126F98959836F8E578 the.complete.recordings.19291941.(disc.3)
889,547,672 *5C888F13AC2D5DEA99C8D86D078F0ABB9DDF33B2 umrem
889,547,673 *5C809175970A65FA5A76E08D8818494406006BCE the turn: no, not today
889,547,674 *5C83ACD8328FDAE2060B94FA97E27499097A54DF UNTENSIBILITY8
889,547,675 *5C87F69B0025924EA5E735D07E59EA01ED2C2009 UUO~d3
889,547,676 *5C854AECE71B87225665D1FC05AA0D0698DA1DCD v08r
889,547,677 *5C873BD25B0A4F77F8BD49D0EB50D494FAB57181 TOBYTOWNSLEY
889,547,678 *5C85AEDCE8A140FE453A4BD6F0B8AE3C960CC4F3 todesbotin
889,547,679 *5C88AB8460C59B3B23F9EE8B0EB0EA3054597440 TOLLAGE
889,547,680 *5C888FB16869D7E628B2A005D2198E85721484E7 tom-stoecker
889,547,681 *5C810953B76594DA148FC605D2476E20664C7F39 tomwalker
889,547,682 *5C82AE52D8E58049EE9DB9D953F86C4D1B3B46B4 TONEYLOOMAN
889,547,683 *5C80DF11A6FD832722A1495ABA088C9015133EDB [email protected]
889,547,684 *5C842478AA7D7B859107F196CCC8546305BD0F70 vctvnss0
889,547,685 *5C88036CA42FE99794181BF9F7FEDC6F40E664D3 venus.shedrick.perkins
889,547,686 *5C89A0F2C345989904CC3BA6148DB167B9B331CB TRAGULOID6
889,547,687 *5C887D2BEFBE9CA94B03067F524CEDFF39C6235E TRAYVON SMITH
889,547,688 *5C899BF714783272FEDCA7A299EC04B6EEB3E361 TREBORE-THEREAPER-ALLEN
889,547,689 *5C87EB0AB962017BB76E2C7E2CE5591EF689E2EC VERSCHLEIERTER5
889,547,690 *5C820CC0AAEFA47558064F010451AF9E578B5F4A VERSLIJKTS
889,547,691 *5C825DC92831BB98607F2794A396AC03244F2275 VIADIQUI
889,547,692 *5C80EB16F5B44D363EA0B6A4920A2D8DBD29B264 trilere8
889,547,693 *5C8F91A42DEC56AFB4FCD5890B5FCF041C1623E7 trumpat3
889,547,694 *5C85BD1FE4C0B7C5F1BCD6B5B4B0E4E15307F1A4 TSIEKEIL8
889,547,695 *5C8CE6E1458A503B49EE386F25717E8C3951434A vinterskrud
889,547,696 *5C81BB815901DEEDC8FA2B9B0A06EF18EB7D2D45 TUFONKIN
889,547,697 *5C8573CE5B81A53E77ADFA0645994598D9B4E151 VISONTESED
889,547,698 *5C848B0C6EACBE521418ABB97263CD7C01109E9E VI SOPHEAK
889,547,699 *5C8BB78CBA8235480115837905B64FC30A35E505 vitija
889,547,700 *5C82D113D8B96050A22DAA4BFB35E98D5A3F00D6 TURN—REFERS
889,547,70