List database


# MySQL hash MySQL password
889,530,001 *5C8482F3AF75F860AE85C4BC6E7A7141449DF8F0 TÜNDÉRKERESZTSZÜLEIT
889,530,002 *5C8F8ABE9193E7F89EB9825BAD76DE00107DBECC SUBTROP!CAL
889,530,003 *5C8697015B75800F4D4D594A780AABAD36EF872F twelveteam
889,530,004 *5C8DCF31A916668F2068D29DE3D94DA754254E81 suoinole4
889,530,005 *5C8BFA039EBE99B1A2F549ECC3B514D0325D7910 tyroneharney
889,530,006 *5C8A9176EF668A1605E014351ADC1B1B69C25B90 sydneybuilding0040
889,530,007 *5C87DAE243107C39AA574342FC2969483D37B73A synsaysha
889,530,008 *5C858872BA5B59116348F107E9925E63B21B4826 und3r$747ng
889,530,009 *5C84E41DC439DF8673B016CA6F5F20515C4F52CE TALK8320878249
889,530,010 *5C8851B6E8B712CA91D1D916642E8D602B0CECDE UNEXPIRINGS7
889,530,011 *5C84C287F282D0DCCFF9B301C9B413D55A3A7C31 UNGARERNE5
889,530,012 *5C84C4A6DD7E534936DEA9E07BA924D8AF01BD58 TALKJAMESDS
889,530,013 *5C813DD581098A03EE27C56854BFA74ED282922E TALKLONJU12
889,530,014 *5C8808E8D63E81FEEC7CF98704B77ADE4EE53A16 UNLICH-DUNKELGR
889,530,015 *5C8AFA8773D6799C00873019902A68D60931A961 [email protected]
889,530,016 *5C8AED58A88E656C99D964735EAA4F2B36B27C1B [email protected]
889,530,017 *5C85C8C702BD6D3C6E624A38923340DD00343BC3 TANZTABLEAUS
889,530,018 *5C8199DF95BC43CA1E48BE22C3FB395F15B8E516 USERANUSHEELBAJAJ
889,530,019 *5C8F3FA674F189CC84673F4964D18A08B7843CC4 usercycoticmonobook
889,530,020 *5C80E7EF7C5CF0B682EC18F06D3187D4F34D40E1 USHOULDWEARKIMINOS
889,530,021 *5C8AB4A1E7A0422821CB17AEB51FA6282CBE9004 UUSIKAUP3
889,530,022 *5C804915CB4AFA3D4DF5FE2483975B3A44637581 UZNEMIRIV
889,530,023 *5C857E41E7549B474A83930627D7D666799FAC45 terenceinsalaco
889,530,024 *5C8AF99D3582C035025E55895467096C4791C898 VAESTERAASIN4
889,530,025 *5C80DE9D3D43B1EED43101650DAEB7FD4D6F2723 terrellvanderbeck
889,530,026 *5C8EAE0A9F317F82B300554ACF970638E75CEDF8 valakiškės
889,530,027 *5C8C1BC49275C7163FFA745B0A67AFBAB48929FA VANDASJ
889,530,028 *5C827D46523030CA05BDD3D34F6F5B570D45081E THATIMAGINE1997
889,530,029 *5C8B00275F0E9E3A6EE54F86C1AB64F5846D310A theatrejason1
889,530,030 *5C86D514A460E68D29F46DE1860D56CF64EA1F4C THELABTEC2005
889,530,031 *5C8179C507BF7E97284B609B520BE7D36B6DDCD5 VENUSAEH8
889,530,032 *5C8D4F4165A26EF43E8FA537928EDDC25C69444D The-Magnificent-(feat-Pauly-Yamz-&-Baby-Blak)
889,530,033 *5C861C9345E981FE5031F7CC51FA3B475447BC9B VERGOKTES6
889,530,034 *5C886B0D94815F083C934A6C13B985C84B631499 THEPINEYGIRCOUNTRYROADSHOW
889,530,035 *5C8061F831B12A4562A550110C0BA4CCF3EE2EDB [email protected]
889,530,036 *5C8383DEA67E4F214B4D27B8E06B5452AC1A3309 verteken7
889,530,037 *5C80B1822033397FA68C3A2A6A6CC6B823495B43 VESELINCHOLAKOV
889,530,038 *5C8D37420E52035DE4F43B8EA0BE6E4C455B18AA THÔLỐ
889,530,039 *5C862D1D3D2A8D4290C2734C8353E70C51DF397F vicki.sheibley.larkins
889,530,040 *5C8BDC58F81FDF4922CFC213E8F89A84BD00FD10 thrstone
889,530,041 *5C8333093CA805134245C9C488DFD396E6FA1279 VICTORTALACAY
889,530,042 *5C8AB06304775D2BA5B6EDE361FCE7F0A1247C7E TIMGRIP
889,530,043 *5C8320A25C503947BAE9ABE5F20CC68F90A73300 TIMOTHY.ACEE
889,530,044 *5C879D49E913EC7AA7A0C11799F9346544B637EE VinylSyndicateRecordings
889,530,045 *5C8E3F5B56C6E5C763E3F9097BBC8F312B979E4E TLCMSLND
889,530,046 *5C86185E56EC730EDA83330C8E1AA1425A88EA18 [email protected]
889,530,047 *5C800446B97AEBFD9FE1333BD21BC8B273F008BF TOCARAS4
889,530,048 *5C86F8601CA1B0083E72043AE26AE481AEA622BA vivek.kumar.upadhyay
889,530,049 *5C88CD92DBD64B454A5B71F31F9E78B2B4EC25CD VIVIANANAVARRETE
889,530,050 *5C8AE026073F814AB9B096DBF521961967667DB1 TOLLAGE
889,530,051 *5C8F61F92FEE0536DA5CAD119484C305E8C66993 TONEY.CASOLARY
889,530,052 *5C8EFBFB95AEB8C030C8FC22103B7A387E67BB71 VORAYUTS
889,530,053 *5C8AB9673F0AAFEC25DC45129583BED538386A9B TORMILJ0
889,530,054 *5C86C9246202543ABDD96654111BFECD94657115 V!RO1O9!5+
889,530,055 *5C897AB993A75719DC604680DA571614FB7CF43C VT-E
889,530,056 *5C80EA055BEE05FFFAF64F868040FA630EFB5DBD TOXICJODY
889,530,057 *5C898578451D6F7DB0226D122E3A617A9DE7B944 VVANDERHOOK
889,530,058 *5C8FABEE3898027CEDD54D8360BBCB7F9DB24A2C TRACY WEGG
889,530,059 *5C86434909AE793F3B3CB0D1E6B7FC46EB46DF55 vztazich2
889,530,060 *5C8EBD85F1DD560F1927FF7FB517593FA30F8B5B wad.elmak
889,530,061 *5C84719AAE4D26D4F82D9790A432205F4D93223C TRAVESTYSHIVAS
889,530,062 *5C82E39FA6CE414A69AF53BEBCD4E8B8BF1FCADD WALDI-ANSYAH
889,530,063 *5C8E1BCDDB177D58C099FEE5C10878CA2A2D5506 trenors6
889,530,064 *5C84B70AA77E70EC038322E60FF081E6C8C2A2A8 TRIMAR.DAGANDAN
889,530,065 *5C852C7709602578374D46F7C4A9C7576883BFF9 TRINIDAD-TURNO
889,530,066 *5C8502129497E33AF1DC7365661CA58C6F7746E8 [email protected]
889,530,067 *5C83BE15E9652DC102C958FD4C39A56E9A337686 trisha-taran
889,530,068 *5C89634B854E205C22ABE44AF65AF829449E37D0 tristanraviscioni
889,530,069 *5C8F60BE3553450C4AE322C22AAE64815A6AD130 $wappn9
889,530,070 *5C86B1383EC9170ADCE8264B55090E05DDF9C2D8 tronics-ncube
889,530,071 *5C8C5BA6BFAF1755E8DCDD3D75FCDF174E6E905E WARREN.A.BOWER
889,530,072 *5C8F96816930AA3940F15711825B2FFDBF5C59CC WARREN.FUKUSHIMA
889,530,073 *5C87F37F4E6954A0521185BB987190D44D763F1E WARSINI.MARTAREJA
889,530,074 *5C80FCDFF9F2C86CD39012FE0848BA67657F2A7D warszawskawieluń
889,530,075 *5C8707B7D814DCB870DD0AD023C17F9A14F530D5 wasserentkeimungstabletten
889,530,076 *5C84BD33E45675A99E84250761F44E5CF41C45A2 tsisnockrowtenafoerutcurtsxelpmocehtfoesuaceB
889,530,077 *5C8F8658176B5BCC87F101EFEEBE7EE2461036F4 webjp
889,530,078 *5C88DD9341EA3A38EE738066B8073353567E74C5 wendy-niejadlik
889,530,079 *5C8370526BF7B22D6DD7AF89BC2DEE2AD1E0455E [email protected]
889,530,080 *5C8F3B7786181CC6707BFD92C5CDB86C847BEED6 tvishhau4
889,530,081 *5C87DCB0AA02C3258324302FE4ABCEAB8ACF64DA TYLER.GOWLAND
889,530,082 *5C82859A6A464A7A8A15631195E53E8388064D7D TYLERKRAKOWIAK
889,530,083 *5C8DC03DC2BBB6E89E922D72876ED682DE25C412 when mika shot puts
889,530,084 *5C86CB53E064909920250DE2ACE699E3BE030E9E whenyouputitlikethat
889,530,085 *5C872BF894DCF08EB3043B618749A3829E47A0E7 wilburlampert
889,530,086 *5C8F10FCEE73198A8E0F41E97CD9ED175FCBE0F7 WILBURNGALUSTIAN
889,530,087 *5C86DFBCD933A75C3A7FB07858569CCCEFE22649 WILFREDJUSTAK
889,530,088 *5C8B553F6CFAC2E93326D31F151D826251A2306A UKBULLION-JEWELLERS
889,530,089 *5C8E9ED3CB0C64CDB872217868099AC0B2457292 willianzaffino
889,530,090 *5C874833830A1B97631F93E6572F52BC3D5ADFE4 UM NOORAA
889,530,091 *5C84A96D81F7F1392FA8CEA6A1FF85BA1A8BDFE2 un3as!3s+
889,530,092 *5C8E9483AB09F83A17FE16D3F220E7299C0F3905 WILTONSENEMOUNNARAT
889,530,093 *5C88E5856BBD94F72E22379FE3B8E1075C037523 UNDRAKH BATBOLD
889,530,094 *5C8A1DE018FB42B272F7E72EE534A67DA9305540 UNICORNBULLSHIT6
889,530,095 *5C88B39C4674785BB581202F97382678DA9BAA0F UNKNOWNO3
889,530,096 *5C83CC5B62DDE83F202BC6F8EE7477121D0B27E5 w&k$
889,530,097 *5C8C2ADE11BD7AA307712B7F66364AEFCB6BE7C4 WOBI1720
889,530,098 *5C84D868E6C98783A3DB6F404E3576EB4D9EA2A2 UNSECTARIANIZING.
889,530,099 *5C80928ED08D05F0289ED94AA8F063FF3ADF5220 UPBLUFIVE
889,530,100 *5C8F446B0E572099FEC5C31B16311E6BCCCAE202 WRACKSUCHSCHIFF
889,530,101 *5C839B51777137679E0EB9CD1DC9BFC125A303EB wresini
889,530,102 *5C81E2D0A54D46AD7AF776743F458310BC82110F url.edszil.dyhokares
889,530,103 *5C8B097FF88B673047489088CFD33C63CFC9425F WRPPNGSES
889,530,104 *5C8D0B4FA2FF6399FF65C06F5C34FB04A059748A www.capsi.ca
889,530,105 *5C87BE18B74FA3B015800DDCB65F3DD06C73C70C V165412
889,530,106 *5C8A956C067C69F41A01D96BAF6A486DD6A09590 WWW.VILLAMALY.COM
889,530,107 *5C8666DC3ACE44FF9974CDE6E2066B8DEFBB37C0 valentinhomerding
889,530,108 *5C80C64ADBDC787939D6AFED90A304B21D986D84 valetudo8
889,530,109 *5C8CF601E1916BECB51B96E97F08A82BA7203A67 VANERNP
889,530,110 *5C847260C97B9EEFDFB758D2A4C8A7F6D4A49F84 vanessa.paver
889,530,111 *5C88FB72CD1E9AD1241DB31B596172058A521FB6 [email protected]
889,530,112 *5C83670C1F5A96421D0E3D904C47515BA5F74145 XMASSAMX6
889,530,113 *5C83E0290CA2FAE8E01405ED0A46320D36A37E24 VEDLIKEHALDS
889,530,114 *5C80DC987D60B15568299F3CB9F4E328612E346B [email protected]
889,530,115 *5C895BCC603C5EF73C1AC412613D23479F0DF318 verification-requirement
889,530,116 *5C883C2444A1D350176A7C4E02F9A89F5D7F90E8 y!&
889,530,117 *5C89D3421F78588B859D52F5F92AC204274B4618 YAIR-EVEN-OR
889,530,118 *5C830A3266883E229DB5FF921061C982F086B6F1 YDCB
889,530,119 *5C86944D4643D01D6FDD06C2C8B9B3276EE03B90 y>/f
889,530,120 *5C897D2210407208171C039FF2326034E648BED3 [email protected]
889,530,121 *5C852AA59784B22B6A844E57F32B7D1DB9D96777 [email protected]
889,530,122 *5C87823C6CA202EB7DA9FAA3BD2968C8AD9B1345 VITSIKSI8
889,530,123 *5C8A6B3DEEE85C193A3A11E55578B9ABF41BCC59 yongzorman
889,530,124 *5C8F2E50E463594A76B4B95F08F69F22870F2250 you-sing-the-hits-of-andrew-lloyd-webber
889,530,125 *5C81A4E46AF9649E7B48402448F98BD146823CBF YTEGARTS
889,530,126 *5C8179831080D6A4BC2ACD9DEE46D89AFB08B417 YUI.ZHOU
889,530,127 *5C8A87AEF10244F9B185174BF1412CB8272F78D0 YUNZYUNI
889,530,128 *5C8D786C9900C7C53E0E2442823F8318462CC6E4 yurka.baturenko
889,530,129 *5C8B31DE6EB1D9718B24DCBBA026806D07126D7F W167076
889,530,130 *5C85C8549C7ADA715D158A479370AD2A8839AAD0 W22?
889,530,131 *5C834CD623B822DC3283192957285442968D7482 WAALTTLAAWING
889,530,132 *5C8DBA3ABD84368476DB976969E89EFA00D0B0B3 Z112970
889,530,133 *5C82D28C47AAFD6146D30C9A83615CBF96E272A9 Z81336
889,530,134 *5C83FB5150D71D5A933B3540243D16849BED2C6D ZACCARELLIED
889,530,135 *5C81FAED642AE09E64621B63D5557C1531B03FE7 WALKERSTEPHANI9
889,530,136 *5C816508B985318E68B340128ACB216593E4DACB walsend
889,530,137 *5C8105FAD4B99BD985D1A05FF63C164F4E8AC7BA ZENDIKITES6
889,530,138 *5C89367D475E9939D0D7D7740A4D2D3EF7D13B65 [email protected]
889,530,139 *5C85128C8107B4FD6F1E59C5CFF3C58BA3BAFDA4 WDEMETRE
889,530,140 *5C80C19EE359F86CCA2C095E46FECC930B4ED602 webswebsalon
889,530,141 *5C852871E470D4A6AC4E147127107492DCB70964 wendy.midmore
889,530,142 *5C8448A0A77DE4D5F6ADF7C6FEBC8660B78DCF54 WENGAN[email protected]
889,530,143 *5C85EF413ECB053D4A35461AE3892E74ECA715B2 ZIMBABWERECORDLABE
889,530,144 *5C83F54E5DF06C8006259930895B96D7B62CDCF3 ZLPROMO
889,530,145 *5C858DC845A4E5AD50894357175F53CFD74C16CD [email protected]
889,530,146 *5C832EC5212AC7EFFD12B27A9D6805DF305A5F4D westonkouns
889,530,147 *5C8448A64D3C68A5B2EEBF67D1FCEA5C1B36E40A WHE1D0N
889,530,148 *5C841B7717EB47A599335EF3378771E7C147FC10 ZUROQBVIBNQA6
889,530,149 *5C834AD09370982D367373D3FB8624255C2786E0 wieners.n.beans
889,530,150 *5C8618E013133603646D2E52C530020A96087A12 WILBURRODERO
889,530,151 *5C8ADEEBDC1BBF28CF9A993F5457AA2800F7B5A9 εἰδυίῌ
889,530,152 *5C88BE66B2E73B0CF0CF2D5DB8F8983F619B5BC9 WILLIAM.HOVDE
889,530,153 *5C8DCF04B9EF076D8C7204ABE6DA62A6159557D2 ΦΕΒΡΟΥΑΡΙΑΝΉ
889,530,154 *5C8794C6F1AB9DD41852EFC5E1BA588B6F77F5B8 «БАТАЛЬЯ»
889,530,155 *5C82130638CF316838D2385BFADFCFCB2D2F7C5A wilmerplessner
889,530,156 *5C8CF39FE4312FDD59E9C3251FF0D5954D84E2EF вълинските
889,530,157 *5C84552D19CD8992613CCC61E52710E9B8D957B6 инстракостал
889,530,158 *5C8601019030A8264931C6F60C1DA68453A0AA84 ІСТАМІ
889,530,159 *5C8E6420B73D8161476FAE75C8688EDF4EB4446B ‘WŁADISŁAW’
889,530,160 *5C8576E2677BD108AAB324A5CD61BA08BEE78967 wrhq
889,530,161 *5C81854564B6FAE7716BB293291B2568888508C1 СВИСТНУЛИ
889,530,162 *5C882338ED1D455516A1B4FBCAB0CFAF5DF8C056 СЕРЕЖЕН
889,530,163 *5C866BA7AD26132B3D4465673C8C7AC0EF3B8B62 «фитцжеральд»
889,530,164 *5C8A997A880D2CCA2E60EEEF909F95BCFEF37999 X86_MICROSOFT.VC90.MFC_1FC8B3B9A1E18E3B_9.0.21022.8_X-WW_A173767A
889,530,165 *5C8C2451103E166C7FEB5AD0D1548FF258F826FD XANDER-JERKIN-ROGERS
889,530,166 *5C8F37EE1581705679D900817CA1B8E4BD86C19F )X([email protected]#####B
889,530,167 *5C8CFDDA96C29A5B5B47B308A0182C59C588A99D }x{o~0~(#b
889,530,168 *5C8A049B720ED49DF90AABFD88CFDB38E1EB5BC0 ya?m
889,530,169 *5C8AD221FB32DEE4C870CE076EBFD04695ECE0D9 YO.MANDA
889,530,170 *5C85B67ED07D9BE34A68EF654D479A1684F1447C YONG JANN KAE
889,530,171 *5C80778B7B27E9EF9FEF78EB215C74AACE678D18 YORTCHIKOV
889,530,172 *5C8005DC0D526E69E0CD099FE183D6562CF7938F YOSHABELW
889,530,173 *5C855FB0F3434916C472DE19C9CBF232F8485166 YOUMAYPARTAKEOFANYTHINGWESAY:
889,530,174 *5C8909FBC6583F052D6CF3C0A9EBA3B318FC5EC0 YOUNGURSIAK
889,530,175 *5C82EC337F4689E7AAFE2ED779F426E18C87CF06 You'reasPrettyasaPicture
889,530,176 *5C8077AEE1A04BC293C05C33C50FFDBC85FDBAA4 YRZ;
889,530,177 *5C8E7BD2FD7293920984CAF735D8B77327606182 ZADLITO.MATIN
889,530,178 *5C868DE5ECF2554B5ED2CFE6B9C8AA500C80C6FB zainyshayss
889,530,179 *5C8E04C8C8B3E9E64473F34F645D7B99783277E7 ZARINE CAROL
889,530,180 *5C8059AF73730362BD876ED68F6555A25D206E73 [email protected]
889,530,181 *5C8CF68996337D2A1A5867397AA193CA9FE3FA47 ZHOUYIBIN
889,530,182 *5C8535B5384B3001D3B9C84B27F4A713C4EBDA73 ziggy-zabo
889,530,183 *5C86F77F61D7496A2F36270857F5DF6F6DEB6E42 zjsxmfl
889,530,184 *5C83600DA458874DD9BE99A614ECA35B6AC97E69 ΠΡΟΠΥΛΕΝ
889,530,185 *5C8294F46E074A14C7220D4FDB4FB8D1C2050FCF ГИБЕРНА
889,530,186 *5C89790DAE6880F34AA8BECDC9D8ED0E0BCAC350 ГУБАЧА —
889,530,187 *5C87A3A80FB70C3EA2FEF00736D17B0E2846267F ЛАМБЕОЗАВРИНЫ
889,530,188 *5C8011F5D5FBFFDFAE5EAE9685795957988F506E 0ILUVCRUSADER9
889,530,189 *5C824B7D0A1C56CEC6524E5BA3EBC5A38B5F4F0C (_0)~` ~`(#####p
889,530,190 *5C8BA3E95DDC690A8433FC1A660F1FCF8D656CCF ПЕРЕИГРЫВАТЬ
889,530,191 *5C8681B32669F1F53FF5FB3B62BD56957FE907F3 посеймье
889,530,192 *5C8E94A6E2503DC52149D7F5C5C1F7FC471D3E57 10vakuutuskirjan
889,530,193 *5C8C6B9731CA974B99F551B8357CEA83174DA771 1219434 INDEED , IT MAY MEAN JUST THE OPPOSITE .
889,530,194 *5C8AFBDAC491CCAD877D326AAD1BBBA5C6AF2FE4 12-31-1152
889,530,195 *5C8FFB5842BC91D2F33D7289A7157F564F02B9E4 141CENTURION
889,530,196 *5C80475B3AD108CF0D8A0398E0F9F4540EDA2E52 181414 on-suuri-etuoikeus-tulla-johtamaan-j
889,530,197 *5C8B0A01B94FCB437E5C0380CE1555F940EB6E7A 1823205 timmontgomerylaeuftinparisinsziel.
889,530,198 *5C833C6B574EDD9C43F1B3F28AC33D65AA28B80E 安裝來自ILLIMINABLE公司的
889,530,199 *5C8B992E6C9404F26B266A355ADD6920B73FF2C3 1EMOLLIENTE
889,530,200 *5C886D753B7BBD602110D713215C85B6D39ACAF2 1 GRUNGELOOKS
889,530,201 *5C8ABD6A209555875795837C94E0772A106AE28B 1 HYMYILEV
889,530,202 *5C8FA5082AD65A8B3F858E02C0340CB0ED69719D 1.INTELLITOUCHIN
889,530,203 *5C876AC6179F64185DB3CED44C7B98E146A74560 1.lihasvoimamittauksissa
889,530,204 *5C8BB0ACF15B8961BB120DCF83D7D5EE32B93FFE 1MEMORABILIA-SUCH
889,530,205 *5C812E3036BE25CFAD25F9CA70FC4FC930DB98E0 1-MERUNG
889,530,206 *5C82F10A68A0384232E8EFE500DB6179AC904CAF 1-NORES
889,530,207 *5C8B67F93B709A8168F203837B9529268EA8D8DE 1 PARADESTUECKE
889,530,208 *5C850958E3CE8BFD855B14536C0B2B8149A810F9 1.pihtiputaalainen
889,530,209 *5C8824980B513E4372F6974007EC22D467C21397 1-PIONIEREHREN
889,530,210 *5C851BC7117D0A9F576DDF20053F5458B008F137 093J3JGOPL1XYPXE
889,530,211 *5C8CA47FA0DBA76C5F3BC674B8270B10B5BB48E4 0cdyq6aewbw
889,530,212 *5C8A7B0A83705C17C8ED4D11E0CC1D85D9489D02 0THATKAT
889,530,213 *5C88F54BDD42FD69890319748E32CB9A253C59D6 100-Billion-&-1-Rappers-(intermission-break)
889,530,214 *5C81367DDA4F649FA38B645DB2C987E5391A8661 1.tyylit-luettelon
889,530,215 *5C8C19D75E494EA6CD8FFF24B4AB6CB63907B790 1066544 NACH-1945-WAR-DORT-DAS-WOHNUNGSAMT-UNTERGEBRACHT-.
889,530,216 *5C8BB677DA627ED58577DCBDB0C1138F43E43CC0 10FTRUMME
889,530,217 *5C8A27DAD9E9853B8A04D20410B643F168FC16E1 1 VUOKRAALUEEN
889,530,218 *5C84ACF121DC794FEBF136D3B634FC412A04067B 1.ZEDIERENDEN
889,530,219 *5C8D1B282E1F9EBAF4CA95E4D2F0493FFD9C62F6 2027206 OTSIKOT JA UUTINEN SEK
889,530,220 *5C84B883F6DFACB21FBD8660803DB84659B2B00F 20minnesota
889,530,221 *5C856F44F556BC3466447378E070EB6FA88911CE 2412921 KIRJASSAKERROTAANETT
889,530,222 *5C864D03A8A6F769D7B1D0C161DCA9988D06B222 2511752 wir-kennen-da-ja-keinen-.
889,530,223 *5C8B0411E87A1A033E1FC1A510B87EFEF2BD417F 163576 lineaarialgebrassa tutkitaan teoriaa , jonka ymm
889,530,224 *5C824C9630860BD14DBD43864D9228F0DCF64574 1653452 mutta t
889,530,225 *5C8218E8770C75AED5D3A880736BE31F4754D272 1734661 TUTKIMUKSESSA SELVITETTIIN MY
889,530,226 *5C8300ADA7C00236D9A61E45DFB454835CA8169C 2654044 abstraktitutkimuksentarkoituksenaoliselvitt
889,530,227 *5C85CDA2F51DDCAFB813943F98CF49220030E111 1760044 EU-KOMISSIO ON EHDOTTANUT , ETT
889,530,228 *5C83F945CAB191FFABE522A020A12FEFE2B6B146 2706206 kuten-ministeri-satu-hassi-sanoi-,-nyt-on-suojeltu-enemm
889,530,229 *5C8A5F398F0EA25AA26933FBDBD438BF11E9DF79 18verstieg
889,530,230 *5C8E9401D629241F3E33871C1BC5AE153B4456E3 1932340 uskotaan-,-ett
889,530,231 *5C808AD2A6B14F70227A20607AD210216420D6A5 29241 und.dabei.ist.skispringen.so.kompliziert..
889,530,232 *5C8202FD5923922445A1AE93B9735692617545ED 1994-NO-25-"VIRGA"
889,530,233 *5C8831B3F1709EAA8AF0FF8C0792925AFD2D9EE0 2bilder-collage
889,530,234 *5C88648D9E733C907F3A3C6A013180C2497FA02E 2cahS
889,530,235 *5C82F4B2215DB5F92A2F470FF54A1C52017E3E12 1-am-burger
889,530,236 *5C894F67C481152C4307D7FACD070D3F5A4C1AFC 2 fenollu
889,530,237 *5C82E7199B7B25D5D51A18A780812A7E9D0EBF45 2.ferde
889,530,238 *5C856653991CC6530377107805F78B0542B25B54 2FTAJAN
889,530,239 *5C8ABB40BF928D78C851E04C9BCA466D2662C595 2GERMANCHURCHSONGSFORVOICE&PIANONO.2INCMAJOR,K.336C/343"ALSAUS
889,530,240 *5C8D74DB076F184E84F7A6EDF2125511ABAAD672 2 IZGARALARDAN
889,530,241 *5C8E33EC7802BA45AF7806EBB1EFC4D884F92BCB 2.KIRJASTOVENE
889,530,242 *5C86407CBE40BFFD227D161355A2A191D67F84CD 2LFENITE
889,530,243 *5C8C6E317FDE2863809364F33A5401AF4147196E 1 DRUMDUAN
889,530,244 *5C86A17509A502DCB66C4A335776775507EEB4B8 2-neuraaliverkoissa
889,530,245 *5C8408ACBFB77DBA35973FA19958952E7D98C681 1gaskammervoll
889,530,246 *5C8FF885D645D12780E26DF22506D25F4C9E1D09 2THATCOMET9
889,530,247 *5C8DF59BFD9E81607241D7F11C624A55685E2E6C 1-hakumoottorit
889,530,248 *5C8E712225DBE37B8E1EC886BA97303D18E0D913 1.HALBJAHRESSOLL
889,530,249 *5C8EF9B05FA0FF3BE549926F7D5B2755B1791D4D 1HEHLICH
889,530,250 *5C8443318F7CC051477867D74FFB313FC30C1712 2versicherungsbetruegereien
889,530,251 *5C86DC11B5E759A44831310F72F241BCCDDFA201 1.hochorganisierter
889,530,252 *5C8291F67D841091AA95746E847AB69CB78CE78C 1.hukmolunmasin
889,530,253 *5C8427D7693FA8270744EF33455D60ACB0DE3E7A 1I8RE770$
889,530,254 *5C8CB102DDC427656DE332D8C5865237822F902B 313BRAXTON
889,530,255 *5C8BC02E9C50B2D2332BE424537E756A6E750D1C 353RCITAR3
889,530,256 *5C8ECE9DA0F773885E8945C53249D703163EF3B1 361810 MAKSETUTVASTIKKEETSIIRRET
889,530,257 *5C81041AFE2240D76600FCF5A80001B8C414CA87 1-kuba-touristen
889,530,258 *5C8B81EBE0D6C1F7D02F0FA5F80284D077E44DAE 3941F2E5
889,530,259 *5C8C064F89BAFF8877D06D8CB1293242A2737AF9 398A5054
889,530,260 *5C84C956BB99F31D93C72E6BD9F74D02A86BAE2D 1LUBBOCK-MIDLAND
889,530,261 *5C8F1F67B8A8F0E0A0D6FB146C46AA47B815E7ED 3b<[email protected]=p
889,530,262 *5C8DB988CBF1BA6E32D5472228B1E59EEA46C339 3CAECIASES
889,530,263 *5C80A87B3076CA71E59485A0D6E30200F48474DB 1merja12
889,530,264 *5C8D00DC5E7617263A354EAF09DA953F48A8E12A 3 EUROVISIONS-TURNIER
889,530,265 *5C8FF177C99747F70D40F3A7D57EB069A03B5288 1-ogger
889,530,266 *5C88DD6541B44A77FBB317C620655EFF2461D7FC 1ORGANISAATIOTEOREETTISESTA
889,530,267 *5C81DDCC25100E1A5EB4F463DA4377B8EC2AF5CB 1ROLAND0
889,530,268 *5C88A5AAB12F3222A3EA68352706687795B11312 1.SCHUPPENSHAMPOOREGAL
889,530,269 *5C8D347CF20F03D3EE3D750EA9F2EFFE25E2A774 1SYNRGSTC
889,530,270 *5C8A9A1C5EDF3DDE793B78701DC643CBA45847C1 1TELEMEDIA'S
889,530,271 *5C87C853A41B79E053775409E682F266878B6DA9 1tipasojantie
889,530,272 *5C859D86D630529737A60A815A0E433ECCFDB65B 1TURUSET
889,530,273 *5C8B6775355E7CBF6B04CF8FDF0CF62E7D80A238 1TWINKIEFREE
889,530,274 *5C89507E113FBE3543F98A13F0B7FDF218363BAF 1UNDISLOD
889,530,275 *5C836F769A95EC849FAE6104C617BC0411434AB9 1-uzuntusunun
889,530,276 *5C8160D50A93E1A0885267F50DB95670A4EE7F2B 4A66DC5A535C306592E7E9EAAC495540
889,530,277 *5C829D19E13423A51921C61E1393095A46E23812 4AICOTYXO
889,530,278 *5C835269A6438955E25FB3C732FBAE050A89E7DA 1 zaaflarinin
889,530,279 *5C8D4B5BE84FEEA70C26CDFF2E553509A0A7525F 4FALLBOARD
889,530,280 *5C834B0E12CEDE9FD5D31F8077708B084C0DB116 4KARHUIHI
889,530,281 *5C803D86AB5B1F96954543DF029350E1C12C5A7C 211081 bilgisayar Cizimleri bUtUn bunlarI engelliyor
889,530,282 *5C8517DBA8FBAA18BA4EE3972BA2C4542F83EAFE 4MERSUJA
889,530,283 *5C85F3D9E2ECCE1CCFAC349EDEC4E0E14FCC8EBE 2245901 juna.saapui.klo.16.50.,.ja.p
889,530,284 *5C8227EE8F4274F92131E0028D913E11E7363E30 23101605
889,530,285 *5C8F7A8AFAE422F2E60A368A9F032D69FD1EBF4B 2488995 yl
889,530,286 *5C80B92189702C2EA968203A72128AE14D0DC6D6 2555281 MAINITAAN.VIHKIM
889,530,287 *5C8A37BD68651119BEA09F14B9B1023A5D80CD93 255---I-CANNOT-TELL-WHY
889,530,288 *5C81C952940F95E9B8382BD3AB088EEDBCB96D11 4SAHSARC
889,530,289 *5C8E384CF977F58EF203DACC24ED82A86138A6ED 4TSEGIDREVO
889,530,290 *5C88CAC5AB197941FEB09D664F13A80401910F84 28621Q
889,530,291 *5C83655EAF5D8CCF38C4781F37723F4740781140 2882179 ALASEL
889,530,292 *5C82D2F2C30B7F244B50CEDE0284F9E774C20BED 2CHERBLANC
889,530,293 *5C8995F09943C7E8297927B4C787B709D5261698 [email protected]
889,530,294 *5C8FD1884D925322D388FA64A6AAA95EB6643DF4 5AYIAGGAQMFTLYYSE
889,530,295 *5C8A6BDA17993201EA85CC29D262B7BB0EC28542 2FIZBINS
889,530,296 *5C808AB21EAE8F36E1A71820842F67B535DAA3D0 2FQUICKPAR
889,530,297 *5C8347AFA3DCA4204128B0BB28FE4FE5C5672152 5BSWUEFBSW
889,530,298 *5C803F7043859352BF6CC1A3045B25BAB65C2691 5BULLDOGCONNECT
889,530,299 *5C815808ECD345FFCD8A5A4DDC9E402E32166939 2 kallioj
889,530,300 *5C877615D752B8B19BA12456AB55816B73EF0C4E 2KOULUTIET
889,530,301 *5C8C7F0C01A29E728BB0BC3797C7E44045C0276F 2.palvelussuhdetta
889,530,302 *5C83D6A1F3E0452D3701E411CAF6B413B83D0ED3 5MARKETDIANA
889,530,303 *5C8D2C90CBA1FCFEA4E449BD78F9AD92BED56B7E 5MYME4
889,530,304 *5C8C91C0D2D2D87987AC55928D82F26460C2E170 36c811e2364d35b393723f433d7ef15d
889,530,305 *5C88E49B388D5F9AB58A82027575FAA822204944 5SPEECHEASTER
889,530,306 *5C8BFF642226979CB9F9CB98AF5CEB18D59C777D 5thattnt
889,530,307 *5C82856F6978BDA2CBD11EC5C724FC6F132B2DD0 5YVONNEFAMILY
889,530,308 *5C845C32EE4350611FEB95FFC2E8EFB4868A403B 3DODIRUJE
889,530,309 *5C890FF5137D31CB7B6FD457AE1B427AFF9867AE 633111 kuuskyt ja risat toiminnan tavoitteena on pit
889,530,310 *5C8947D3CB40B6E93C24236D23EA5A4A7248A879 3HMIE5ECQVKH
889,530,311 *5C83B21C7902AA17D42C06531B6B71DD2D572722 6ELLENINSIDE
889,530,312 *5C8B26AFFB824E40F470946240BE58CBCD230FF9 6ENDZUSTAND
889,530,313 *5C862437BFBA44A09DAC88371C8E429476C4F57B 6FRIEDSBSW
889,530,314 *5C8E05C3DF58D61A55F59887B0CF6E6DA761F50B 6IAMDELETE2
889,530,315 *5C8010FB55988F1FA96106D1AD553FDAB85BA56E 400LUZ
889,530,316 *5C8C80063A5581AB0F2944CF1BF8B26CA7D9BEF2 430 DISLOCATED
889,530,317 *5C8CDF409233BF2A40E5615CE45204683EAD1A19 6LOUTZENHISER
889,530,318 *5C8D0BF08CC04BA389C5A61C258AA47F2B087C6E 6MROFGOLAID
889,530,319 *5C8DF5095C30EF5E19B4E6250D7409099DE61516 6NENEVEGEGNAA
889,530,320 *5C875F76EF29138BF40E107BFB437EA31CD8873C 4ILOVEBORIS5
889,530,321 *5C8B40F34280C303BF317E48D8F34F576EB5407C 4.kaldiririz
889,530,322 *5C82632765B1213BA868D6F9B1464A57C8FB823F 4MXP
889,530,323 *5C8218CE032576664D528BAC03519548742382FB [email protected]
889,530,324 *5C8708E4CE04DA05DEAE5146B63A47B0B3B23EFD 4PMCCHESTER
889,530,325 *5C8D19059229C632B2F5BEC4594EB6F3453C1F3D 7AVARUUSLENTOKONE
889,530,326 *5C872BDBB76765B798B0E7E48D713392934331F3 7CFQLSPW
889,530,327 *5C8FC3EF01187902EC035E7157ADEDC5E857CD34 4SEP1067
889,530,328 *5C8E64863D10C8A6CD7D98DF94BEE6100B3B255D 7HANSOLOSALLY
889,530,329 *5C8141CC152254EFFFD17EC7225B96900A6C643D 4VOLLEYBCFI
889,530,330 *5C88A549A3C9998B9CD344BB9A13AF94A0480CFE 7HVNGLDN
889,530,331 *5C8569CA28E875ED60990445A3093B047F13C697 7ILOVEBEAVER3
889,530,332 *5C8B9683AC96B5F8AEEB61E1616D10A89546FB01 4ZWORYKIN
889,530,333 *5C8B6DE824A267B9824CF96C2ABDFDAFAE7109E0 5:..5..#..&...MESCAL
889,530,334 *5C8AE1D3EC07F6E4AD9E5FF935F08BF993BE2A7B 5ARREUGAT
889,530,335 *5C87317E9777B90EFF72E866081C5BE70B36A991 7RANGERSMILE
889,530,336 *5C862E4078117B0EC6788A914A67FC65EF3F8615 5BYBEFOLK
889,530,337 *5C8FF872394D006BA9662DAA9A39B57E8346BF7F 5CORONAGRANDMA
889,530,338 *5C896AC3C618BD59F1D03179146DBF934CE46DBF 5D04171BF831E7A63728A9A8C2559C79 072219860
889,530,339 *5C8A86B314B69FFD499B36F4F67560F52B94C839 5DIANACHAOS
889,530,340 *5C8A2E161EDBF9698FE0421A6A5BFBD874F320A1 5ESSEMBLA
889,530,341 *5C841DB55687F5E3BF79987F93E536A21EE021F8 5FINLEMMAD
889,530,342 *5C80BD34F34B5329F5655670F4A424F8E7C1D97A 7w1574813
889,530,343 *5C86C6A89A5F55DD325C5C4BEA25559C47D8DB91 7ZONDAGSDIENST
889,530,344 *5C8CD859C217AEA8D8322D5DFFB120F380735CE4 5ILOVEVIKING
889,530,345 *5C81A8F7FC3E79EA72AA634A49A05AA66E1F7D44 5INDSNIGENDE
889,530,346 *5C8BF0696EBF749E77E73D1D48466600D50AB9B5 8amto9am
889,530,347 *5C8ECAA034770130CCFB18148FD8950CA7FCD8B9 5LOREGFUA
889,530,348 *5C87DB0590979B038F09471C591619983C74B3DA 8#####b ` (_0)
889,530,349 *5C83C3691B955B0051452C37D41A11E033147142 8B ~o (_0)
889,530,350 *5C8905E2EBCDB39A06EAD7E7661D1C9CD81CACEC 8FNOCPTNGRM
889,530,351 *5C86E84088E8423F20271D3FC04E1D603BD2725D 5SEPARIERST
889,530,352 *5C884E958B203D9459C4603BD88BD54D11973EB2 5.site-www
889,530,353 *5C859CBA5AF301EE0A23EC12329270E481963390 5SOUSENTEND
889,530,354 *5C8E43EC10B36E7EAF4C6CEF6E4B7F852DCB311F 8HILLPOT
889,530,355 *5C818C6C31BC5CE385C81128CE2107A7DE8983F7 5TENNISSONNY
889,530,356 *5C8B14C5692A8AEF5F4F8C9395B66CBE7E896578 5TIMEREI
889,530,357 *5C8DE19C0FF6C06D4272DA5CC6C91A470B4225A9 8LEONARDJULIA
889,530,358 *5C8303D089A7B139651104194040FFD021E08E20 8monnaies
889,530,359 *5C8621A4A545296B620EE42545ECD6565EEC1B4C 8##p*>B0
889,530,360 *5C81BF247A7BB9DDA71C26791A509CB7D8177870 6BONERSSSSSS
889,530,361 *5C88B71A1635BA711DEA76A1BE704267E9E1B73F 6DECLOISONNE
889,530,362 *5C8C7E3E6DE69B0C159F409459CDEBBF4BB463EF 969XBE
889,530,363 *5C88F0EF6197E16DCFC8BE06A7E2F0458A921B9D 6GOPHERORION
889,530,364 *5C8A799E182B971A24C38DFD1C31A8063965081B 6HSITAIS
889,530,365 *5C8F0A5966F7599B2CD0BE95DA37063AEA67732C 9BADNJACA
889,530,366 *5C808AA6D2046CDE38745767DAAA543547BD16B5 6IERERIPSOC
889,530,367 *5C86CA1576F4597D3C7C822523CC9D350C1DC0BC 6-kotiutuville
889,530,368 *5C85C95EF44269F16B33C56B4E4A3A1B5DEFFB20 9CUDDLESDEATH
889,530,369 *5C8A6616504E98F12128464BCEF78A88603EC39E 9EDAGSDNU
889,530,370 *5C83C9F9A1BD8B3EFD980E86434E4859D58CE30B 9GOBLUEDREAMER
889,530,371 *5C891B9CE8FCD7BC119A8E7021CB6C3F1E0D6893 6PECTINIR
889,530,372 *5C8EADDF6A7B41FDA802BA29F81A7197C216E91A 6prophet
889,530,373 *5C86FCFA88B20947AAA297D63D9255A4F9A9F9F0 9MONTANAJOEY
889,530,374 *5C84FC160FCCFD87E856DD21C47F4BB58E70F9D0 6TANKREDE
889,530,375 *5C8DC0453A5CE697EA2DA380995D7847926087C7 6 TATSOI
889,530,376 *5C87D3B967CB6F8D692E9686F548A0004435AFA1 9RESTAURIRANJOM
889,530,377 *5C81B526E8B9B24D10462EDFC877370F6074A8E6 6VALTUUSTOPAIKKANSA
889,530,378 *5C8D0A00973CF9189F3DFCB051C97914720351A3 9SNIGHTIN
889,530,379 *5C8529EF5EACA99D4F2F69B90D7D2C0204D1880E 9SUBITCH
889,530,380 *5C8459DC921796AB3B34E6475DED71DBF70E068F 9tykist
889,530,381 *5C8AD06C1A31F2D2A9248548EE31DED741B4CC38 9VALLITSEVIN
889,530,382 *5C8957C7C676ECFC8606888DF2379D17477A4468 78303135OP
889,530,383 *5C8DADF28842F096462A01AAE3680A88D86751DD a!"&!
889,530,384 *5C80496EA50590B1D33BC2B2AF3D72FDF05172B0 7DOGGIEVOLVO
889,530,385 *5C8D50F1B028E6F7195F52D9F314F2350ABE1779 A+#4
889,530,386 *5C82BA3978F849296DF274FC79175FC55425D675 7HNLICHERES
889,530,387 *5C825C6A1469E35CFF0B063B8F92DCEB8E0A25D1 7iaminsight0
889,530,388 *5C8EBCF0B6D3757E47AB93D166FA82E2AF061CCA A8WO6
889,530,389 *5C8C55EB73B4ECD4D5EBF6FE0F91890F433800CD AA!5K
889,530,390 *5C8CA9C6EEB06A070E7B84E600E21D520723E6F2 AAB3D
889,530,391 *5C81F33549D3AA18624DD58CED122FEFD2A0D78A AAB!L:
889,530,392 *5C859C5EB3FFB42E5765E6FB4698A2D2CF556990 AAC.)
889,530,393 *5C8105474F7935798DBA4D6011910C07835EF265 AADCGAZ
889,530,394 *5C829ECCCBC34DD2ECD2EFD184E24AB8473EAAEF 84AZSXDCFVGBHNJ
889,530,395 *5C86342117CD8F38121A325F17BAF61308E6BE68 8BARBIERAVEN
889,530,396 *5C8298962177D6AAC8D65EF36D59F0C699A9215F AAS(
889,530,397 *5C8B21E06CEABE8548DB2E9637E5217E02728F67 AATTEGEL0
889,530,398 *5C85EDD782D17A338D42228ED5C5A8089B94FF7D 8DALLANMAK
889,530,399 *5C828ED71CE57E99044C8FD5395272A6D0ADF8EA about-a-murderer
889,530,400 *5C8F8616B65D826019F5692AABE083BA93437B8B A+BPJ
889,530,401 *5C80AB24C418B4E2E0E410E469B27003235C50AE ABW8D
889,530,402 *5C867A68A78CBB9292A628C3B4DD2CA8203C8184 8LJI8MIU
889,530,403 *5C831B66A77DCA28C9109D46DCBC33B366EF920D 8LJUOKSUN
889,530,404 *5C8B0001DFA4CCFC19DADD127F57404D2F879BDC ac+bf
889,530,405 *5C8507888414F551CB438B81B859194F690E48B2 8SCHNEIDKOPFUN
889,530,406 *5C89032F36C43D263181931D6BEC39284CBC5D19 8SSIVTHN
889,530,407 *5C8DC7C78CDD7014A51990C4DAA0B16DDC031740 8UITKAFFERT
889,530,408 *5C8C12F64EED5239AA469C0CE1B6EF782A7DA442 ADZO
889,530,409 *5C8D48674192F50556E1B9B935F35995529D5AC6 9ARRENDETE
889,530,410 *5C8B36E29F84C7FD585826DAFD73378290EF35C5 ae#t
889,530,411 *5C8A27D60014AB22220D2D6C8B24ABAC005CF083 AGU!T
889,530,412 *5C83306788E4D02A86AFC6931B3FDF45BBB2A0A7 AH!$R
889,530,413 *5C84A4C218E0CD10A1FCB20D612F41B4AACCE98A 9SATOCCUS
889,530,414 *5C8491F88C80C00218D94A7388C4C18589A5AF20 ajbmj
889,530,415 *5C8EF0D48BB5AC039FCA5658A1970A296DAF9E81 AK7W7
889,530,416 *5C82C925BAA32737A46591F477EE2E9689AF4E5D al61k
889,530,417 *5C8697BDF425797FB57CACB2B3374AE72474000F ALAYNA787
889,530,418 *5C8776CA12F7F17206C4573232960CF5EC62F476 a0w8&
889,530,419 *5C8EBA5B16D1F46A512530DB4C0285D314DE4D16 a26/6
889,530,420 *5C8C2A3B1AE06A46E24A765967CE5100DB523ECE A?2U
889,530,421 *5C8EE64F8ED73375D04E4CFBD4C3EFD4171298C7 alfonzomackall
889,530,422 *5C8FBCBD853074E8236B546ACE57F1CBEAA7EA27 a3n&
889,530,423 *5C824E640DF553358CBEB6E50BF2F31FA6C8FE44 Al&L
889,530,424 *5C80CD820EAB411DE58847938684B4FEECBC18F4 altelisi4
889,530,425 *5C8092AA0E235F468A92FBACA19F60A31346816D amandavelloen
889,530,426 *5C8EB5F4DDB169F281630EB5DBE1B85CC0382BAC AAB8(-
889,530,427 *5C89FDC1A12629C7F6135BB9E0520710D61FF14A AMY-HOLLIDAY
889,530,428 *5C8D5C6FDD972199F4B05F73C6F496BE414A2A7D anadadd3
889,530,429 *5C88830D76898CF9F47411DE93679D7048AB3331 andyenciso
889,530,430 *5C859C999523F76E791D2DE591FF6FDF67D35628 ANGHUICHIN
889,530,431 *5C825BDD5650A430A6064FD7FC3C9E1C3D5C7F85 ANGIOINIANA
889,530,432 *5C8DFAF28968B591A8C6F138A36BF170877DB300 AANBRAKENS
889,530,433 *5C89B39623606F796F29A8189D61B60FDCF661C4 ant-bank
889,530,434 *5C8E7558BE2C92CCD1AC04182CA94FF88662ED10 anthology’s
889,530,435 *5C879B34E0FD47CD6E31C5BCE2F0DCE1F5DDAE39 ABBOCCA71
889,530,436 *5C8672627094185EF753649AC41F3C2107364856 ANTIHEROINE
889,530,437 *5C8C2247C316949A9F60518718155F288706FAF8 antydede5
889,530,438 *5C8856CEACA5314B07B535B9B741A6768C714A34 APOLLO13SYLVIA
889,530,439 *5C88EDAFF06DAE389F7A7663979881BD800B5497 ARE.DAYLEYJ
889,530,440 *5C81EE71F4407BE3A42C754F0F9743199EDBF90F ARGENTINEAN3
889,530,441 *5C864B186C22EF93C65D8A5D13B2D8C733D766BB ARIELNATHANIEL
889,530,442 *5C87A20F132833EB74766A890E799DC720C21333 [email protected]
889,530,443 *5C839C32A45023B60F272FB1E7EBCED1DFDBD13A arioso:qualportentomirichiama(ruggiero)(scenai)
889,530,444 *5C8D6D3F52D33A5957265B98A97C1B2EE620E78B art03558
889,530,445 *5C8AEC7C8B7F8030EE4D9BC181D3980F40C28F6C adset04
889,530,446 *5C8981185ED6EB9304448C69CB8EA0055D54C71A asepses
889,530,447 *5C891983F6689AA27151B577D95C858771FA2ED2 a?fmw
889,530,448 *5C873EE0ABFB91943284E27CADBD95BA67E828DB ATTICUSFINNCH
889,530,449 *5C886648FC0E2FA67500C546F8D8E7DB02B90ADE agony-and-ecstasy
889,530,450 *5C8B4F9F7BAF7BAD97AEF950E08B49C05286BC34 AGUSTIN.BITZ
889,530,451 *5C8505F37A22C49AAE7A30873424B5749F055C59 au7od!a1ed
889,530,452 *5C8BAD6CE07C914A202428069D7F73279A737B38 avh9
889,530,453 *5C800030647C7CA4AE0390749539DFF66682DF59 ajustents9
889,530,454 *5C8AB7C4C2EB5AD62AC44200EEEEFF0930DE6A84 alcbg
889,530,455 *5C809F537268258B843BAF54236D733AFDA1153F B0U4RV05
889,530,456 *5C87F028C16BA7E478A91CEC544FC26DE366308B B10U2
889,530,457 *5C892FE5EF4F0663980ED17EA96B9E2579088499 alexlemere
889,530,458 *5C897CCF602DA740CFB16DAB4EB12F71AE6784C1 b2kya
889,530,459 *5C8C746D25824F401E8DD616EF7283497E77ADF1 [email protected][email protected]$
889,530,460 *5C8677AEA56B219B8470C3108BD4C16A9C54A4A8 b7g3
889,530,461 *5C89C53867F533BBE27C0E8C8231A65D6C24B4C7 alumniconnectionscomwww
889,530,462 *5C87220D744AE801E3CEC5E57EDE9BB01A9F96DD ba1))
889,530,463 *5C81028FA8B358F42D0FADB0214D09C94853E84C [email protected]
889,530,464 *5C883F3A91A5E582F023F16EC0C55F9B4348D1B3 BAA5I
889,530,465 *5C814C6338F68E781D1DCB73CA6DEA48BF476EE8 amczq
889,530,466 *5C8D820D4D6CCA5980D1B21C8B137666EF6F78AA [email protected]
889,530,467 *5C8CC70946BB9289AF2A5C1C02BDD7CCB7BF98B1 AMMIG
889,530,468 *5C8BAF373A6B108A79F08583AF2ACD84C0C7DFCD BART.BAADSGAARD
889,530,469 *5C8E26FE42EDFCD72DCC8E5E3BD1F3CABFEA0D3D ANATHOKE5
889,530,470 *5C80389C2BFBF644E98E41C0D5AD359FE975264E andersonengessor
889,530,471 *5C8FA3FE22CFCF3FC2DD6284D87FA00C89A4B1F2 battletrap
889,530,472 *5C863DC88D883E8EECA0899DED2B8629E2CB43F0 b(bq!
889,530,473 *5C837EDBF5F86AED5EC287E471720952F6AD45ED bc+b
889,530,474 *5C813B652040650CECEA41EAD16A30DE7D1FAAE7 B--D~0.~O.)X(
889,530,475 *5C812D20607F432F692115BD20801AEBCC0F0C53 B:ECR
889,530,476 *5C867FC230830E71E5A598502A7AF8199C4F022A AOJRJYV72
889,530,477 *5C84CFE1E1B817D19E107EBB195B1CD0A067B0EF AOMN
889,530,478 *5C81CB755C279F3E85C96D032D7CE726251378D0 AQ_I&
889,530,479 *5C88480FB39A2B44F77B57F5E167A3C75E7BE910 b)fk9
889,530,480 *5C83DC6BC9495B33E278996B9925E72C47DD06D8 arlenvalis
889,530,481 *5C80369DB561E66D89A9D8DD915203CC9175DB25 bgrvlsr6
889,530,482 *5C8856EFFC89353C90E81DB9C451DEE56F513258 ARRINGARE
889,530,483 *5C834A0FD3F746C5A795729F3F82926A49A74144 [email protected]
889,530,484 *5C8C7C7972A24FA306E7CC057EF9D6FDEA7512D4 BIDEZELM
889,530,485 *5C895FB3B91A1FF416BF3E05E604273BCF4EE689 as7rob1olo91es
889,530,486 *5C8BF87B4D417E53E0BDA332CCDD12E1B257CCAB BILL BEAUDRY
889,530,487 *5C861E3AFF4F39A9CDEDF16A765A366D2D897649 ASAMPERI
889,530,488 *5C8279875938FF6FD74AAF6FA5EC2130AECC0FD5 asdfjkl;seven7
889,530,489 *5C84CA4437CF434C16C05841AA3D39CE7257F73D ASHLEYMARIEPRINCE
889,530,490 *5C8E48132DBDE0D55F49E0654B9D703B3BD893CE b.ipz
889,530,491 *5C8585B0B3543DC5F4D2FD8F9F1E3F6F020F8426 atgid
889,530,492 *5C8C5F57C9893C619271047077E5249FF8D43450 ATLAPOOR3
889,530,493 *5C880CFF751D7AFFC457E44CFB2738966782CA75 BLAIRWILCHEK
889,530,494 *5C84AA0A07FADAF112800868AE02512BC76592DA atsilota3
889,530,495 *5C8180C05F303B38249F053CF3F16BBF019FA263 ATVA8
889,530,496 *5C81A3A2FE61BA58AB04974F0F7C0B7DD2B9739F A&UA
889,530,497 *5C81C6D4A816A7F0B42E585824CA8ED25038570D bm5$6
889,530,498 *5C88D2C244F544856AA63D5DCEE885F388EC18E0 auni&
889,530,499 *5C8C6511956FF250A78C9CD1138CE98F9313759C bmvcmsas
889,530,500 *5C8D053EB78CCE33CF3CF9102CD5DF44A03FD001 BM|Z
889,530,501 *5C8B3CE91E5BBD9F59A1CC94621D8C7E62674C13 av?&6
889,530,502 *5C81783CC1F6767A20F606FF63672D9215A35A6C BOB.LION
889,530,503 *5C810323D5CAA6BD5F959F617E190829F4D2B453 BOLYE
889,530,504 *5C80A152C82A306A9EC0A5B8FB10D8A6EBF34F73 AYQs
889,530,505 *5C8074F2E16BF3909AEDCEC7760BC9AE6733ED1F b0lt4
889,530,506 *5C848DE94FF3AB9B99E1789B91E905D68749181A B32n
889,530,507 *5C8B2BEC5C19BCF40A1E66D05F21D208537AEBCB B3WRAYING
889,530,508 *5C849506ADDE17A96D97DA67BCD740694E838158 B4GNU
889,530,509 *5C8B60CE8FB38B9702EC819DDD83B13296D54FDF b7g3
889,530,510 *5C8548B9D253D77317F29A1270F540335C840149 ba0s!
889,530,511 *5C82CC1BA0FC4A88B9C340F8B47C0007E837C3D8 babatunde-owolabi
889,530,512 *5C817C5A65A8A19F9CB8368BEEC6728CE42AE0F3 BRRQ
889,530,513 *5C87508BE76489E70068229949E3FD8906C09CDA bruenjes0
889,530,514 *5C8CC5B12C4F1BE0F70FCF19C4A7759F9516981E BANGALY2
889,530,515 *5C8750E8908F3579A422FA31FBFEFEED62CAB6B0 bspcs
889,530,516 *5C86F12A4DC2B125E57A89311C6C70782F3ACBD7 barbariousness8
889,530,517 *5C862853E881BECD0A66586151DA725EEAF0615D 」 BARKS、2007年6月25
889,530,518 *5C8141EFAA793D59F3D14151D21ABF1D400D40FE BARTONBRYER
889,530,519 *5C8C89C721DE6FEF1CECD0B5F05DE637C8BF36FD BTEAMJIYOCOM
889,530,520 *5C836A00C449262E3EF1C01CF7981BD51063D757 btqhe
889,530,521 *5C847B9AC62179EE9AF0D38AC1F46F73D0744120 buckwiltbank
889,530,522 *5C8DE137198D133317DFC174322E0E78EE5E3912 bb;7l
889,530,523 *5C80E4B28EC91CD8FB17ECFAC268AD950FC77BCE b&clt
889,530,524 *5C82F1C8F68F90DC4B61EB44983BD573B95CA2F5 c!"+(
889,530,525 *5C817C2078567E3C19C633CFCB236AC6414A9FAA c_1?,
889,530,526 *5C89CD10C85A98C42A53D68ECFF90259407102A3 C119504
889,530,527 *5C8E377E535F17D5403898B0B4747C877FF87462 C14V!CHORD!STS
889,530,528 *5C8334D0D60BB746DDF67F644B61E1AF9EA536D9 BERTRAMHARCHARIK
889,530,529 *5C827967DBEB1F0348F0E7AC33C8F3C05A7A49C5 BERTSWERDLOFF
889,530,530 *5C8540FA6D53215E99B83A958370343308CB5F74 BFHDN
889,530,531 *5C89C124DEB4BC7CBB8D421185087F3815573FB3 CA6RF
889,530,532 *5C8FB0A09CA95AAFDA59426CF5D338C4171FB7F1 caeb4
889,530,533 *5C8A560791492285D83884E761345B76953BFD68 CAITRINA2
889,530,534 *5C851BEA743218E42AABEFA6398F21DA340E188C BIDBG
889,530,535 *5C8E8094067D1951B7F61B20F56F68A8F6963B08 CANHOTO8
889,530,536 *5C83ED1EE1D00E83CE4E9F537F41572FD700A410 billbzkl
889,530,537 *5C80D1E54341B89AB48317EC532B38A508003283 BINIOU
889,530,538 *5C81E204A60FEA27DFEBCB0D3785B422BCDAD6F5 bizgoogle
889,530,539 *5C892135B76026D59E202A3DA90019FF96ABEE6D CARMENPURAVEGAO
889,530,540 *5C8953E7811F0A58A9BD827F259D269FF6814C8B CAROLRAVOTTA
889,530,541 *5C8F7CDE7C16B8708B7FA788D456512A81BBE24C Carreras,-Domingos---Carol-of-the-Drum
889,530,542 *5C8A3AFEC7C78B2B71155EF012E6E059EA992EB4 caseyjungers
889,530,543 *5C8F7270BF029EADF297D8DA4E433145006965FF bkkps
889,530,544 *5C8AA0DF212B7BF82FB4E1445BD82FFA87656230 cbwpc
889,530,545 *5C80995E1A563F88C02B8AE4A89E534C519B880B BMAS.BUND.DE
889,530,546 *5C8B53DC55DD9906C503BEAEA45E82B45858C4E7 BMCLOWE
889,530,547 *5C8212AA4C78CE233F6A0EBDCDC78B813A143E38 b&n4=
889,530,548 *5C8C377DCE2B2AABD8F98DA20DC1A2712BA45CEA cf2fa
889,530,549 *5C8EBAC879012F022462F3F78D4F5AAE5237999E CFQ,N
889,530,550 *5C80BC43CB5432ED14067517975DA0FABF4CCC0E bos6j
889,530,551 *5C807989B9E02E9C1B054A9BAF0D8E58340101D0 b`pe
889,530,552 *5C8F03917070AAE20786A1D9B3D0B90981AE8615 B#P`SPLAT
889,530,553 *5C8C4D3FCFFAA52EB5E222265053A4CACD557565 bqil
889,530,554 *5C86B1500BC966D1B20C44883DBDF3562D32A548 bradleyazim
889,530,555 *5C8B2AA929402AECD31DC964BD235ACBD5C6268C BRANDON-ELLZEY
889,530,556 *5C8C2A722ED30DB5184CBD549DDB715B9CB45B3A bredabus
889,530,557 *5C8FB3B658118294E7787F792B9F2DB2226DC93F [email protected]
889,530,558 *5C851D4B47A2375D0F6084BDD85A2EFA17A5340B BRIMMING2008
889,530,559 *5C863E58CB83E4CB6034BD483D51A1F3E7096A41 BRISCHE8
889,530,560 *5C84DDBF81ED2E665871D3934507DDA5E1D79E6A cigarinfoguide
889,530,561 *5C86D72D74C6F91D28EE133BF91883ABE9439B45 C-IKG
889,530,562 *5C8AD13FB0B2EE7A43E905A277272E12439F960E BROOKE.GREENTREE
889,530,563 *5C87EE38DB5DC01256A61F16395A153FD7CA0329 c)klb
889,530,564 *5C8AF56F317733098777086F2AA5E5D11A93D5EB bswgriesebsw
889,530,565 *5C89BB949E7334713754200C757EC1BAAB24794D CLASSING
889,530,566 *5C83C8A181D652B08D4524FFBBDC74D563AF5A02 bu5n
889,530,567 *5C822541C1DCDC3BB63F7FF0215B117062A2A411 CLOVERSEED
889,530,568 *5C84CD6EB35D9A925B1BAD8C9DD23428C6B341AD [email protected]
889,530,569 *5C8F7AC7B3E7B95FA7CE765C5E99BFC26A164585 bvbnd
889,530,570 *5C84A6E75D5958AF56CC037D46022398EBDD5318 [email protected]
889,530,571 *5C8A72FF4E69F12AB63482448CB29C08395E6A9D B+WM
889,530,572 *5C862DF78138618FA23B54828B03FA74A304669F colemangoetsch
889,530,573 *5C8A618435718D44993CC7DD27C0B9419D313B34 B!XPE
889,530,574 *5C825AE94C0CA2D57DBB3C6D2AA4CBB557AB57E6 BYRONGEBHARD
889,530,575 *5C8847E26BD84AF8725A04BC0A26AADFE9F39CFC byronrudicil
889,530,576 *5C8E24B630980BEED4E6F3960EBFD053E76BCAB5 CON3CT4RT3
889,530,577 *5C86EB5E3966F5A16CC42C0B8126732DB9021455 bzttrghd9
889,530,578 *5C85274CA4193D0E2745ACDAD51D5D101E0DEFF9 CONTENTIDENTIFIER
889,530,579 *5C8774720EABA93EC0D0DD0795D174A775CACE8B corneliusvallejo
889,530,580 *5C8DC0D879C346C73894866B78CF93A170EE5D05 corroborates
889,530,581 *5C8E1165BDDA2E8C7D8858165290F19DA118491D cor,u
889,530,582 *5C8C81880330BA477CB9BD7A1C4F459ABEBD65F4 [email protected]
889,530,583 *5C81342B3B7C32435AE44E707D96A9637502B6E1 c4-j9
889,530,584 *5C84B29B95820943D15F1C47C9B204ACA212B1B6 country-usa:-1950
889,530,585 *5C88EA95BD9CF2D3D94D6F9B2E1B3548439E3EDB c6.;j
889,530,586 *5C8FEE6B00EF8CA7039BA2FF5FF89FB3B88F780E c:\program files\notepad++\localization\hungarianaxml
889,530,587 *5C8630622A271192CA8AB646987A8EA5B8E487BC craig.lawrenson
889,530,588 *5C8D4B888F6902BC2CA6129B8537246E2BFC454B CrF#
889,530,589 *5C865F8DE11A149B2C9664F3A5FA3D3333AE855F CAMEDISNI
889,530,590 *5C8B876BA70427B7D1FB12926D21ABDF006A673B CANARIOS3
889,530,591 *5C858829EA5B8A7F1743B4953F8819E49EB34819 caniremo
889,530,592 *5C8D19E73C88C4E7832F711D5983394718CB2038 CRVV&
889,530,593 *5C8B7104AD55CD253A2247C658D5AAFAEDA0E9E6 ct9&h
889,530,594 *5C873D4072E9AA8808417C44996A0094A3E0A9F8 CARRIETURNEY
889,530,595 *5C800BEA1A719D58169446C2D44F219E6D3BB3D5 cauj,
889,530,596 *5C86F4D6D8EC45F036203C7683CA874714665BE6 cbo(u
889,530,597 *5C8BCDFA3C4DD90CCBE61F01133430431C1C7A36 c:?w3
889,530,598 *5C84D1A8D871F509332C92796A7B52296F1DF722 cwdr
889,530,599 *5C86541A65DE26FDF7434E6C5E45431E98FCBEC7 czw4k
889,530,600 *5C8E302AC8841A07C1AAEDB99F94940788B160F7 cerfi
889,530,601 *5C8217FD3F792BD7B74521E3EEC4AD3F0B70FDAD d2cj(
889,530,602 *5C809CFB4705B63AAE2D353C49811699D9419C71 d2rca
889,530,603 *5C8940C325223BC6622A94B0049DD137C0BF0298 cgha3
889,530,604 *5C8023A1FE7DE43434A4794EF112AA2898F34015 CHANG.NOLIN
889,530,605 *5C85CB5A0AE8EBAC945D6D5A95DF1188B6D1D016 charleshouse
889,530,606 *5C8AA2096E0DDB4171CA560209DA89979B40F689 CHERIWILKINSON
889,530,607 *5C8CDAF9573D2BBF6FA3C986539D0C0E8EDCACCB chin-wa
889,530,608 *5C8647DDE8350B186AB02105AAEA6D07E44E935E daniellis
889,530,609 *5C80F629A11ED7A9C50A58EBBDC5927FA9C070E5 CHS;
889,530,610 *5C810F969A35D1CE0A1B08AB614DE73E070B1597 DARIOBEZ
889,530,611 *5C8567740D00F3C2F5F56A1FEBAF7070E6238F82 ci0sx
889,530,612 *5C8A373843CFE405A66D4A40F83DF3CC215995F5 daronrackow
889,530,613 *5C8BD9A056166B6C39D77D0FF5227E3129814CB0 CIARAN.MCGLINCHEY
889,530,614 *5C894DD9A9A4DFE84A9354CDF5C6BA750C192606 cig/u
889,530,615 *5C8EC3BEAFED7722C4F3F71F53918BD8286C827F DARRON.FLEISNER
889,530,616 *5C8097060E7641A7845D558553AD17CE519A0C51 CINNYLS5
889,530,617 *5C8C0EDFA73989009CFE3BA8FAE03790B8AD9874 darwinhinckson
889,530,618 *5C81F1D91ED7D1863E8E493B2741E674507342F3 DAVISCERAVOLO
889,530,619 *5C8D4B277B6F731764D5D93D7B9086AF929EF8B6 (^_~)~ D####B
889,530,620 *5C82DB678270C18D9C9DDE67366DF78F4EAFE9B7 CKMUC
889,530,621 *5C8B26E86D00B1A374353E270677AE4E076C25A7 CLINTON.HARTMAN
889,530,622 *5C8688D41E72C59690AF502901D6C04987A0EAC5 DEBORAH-HARTIG
889,530,623 *5C8DB7D47B7FCDD61ADE3BA59821523A8FB6C2D8 cmkyqnw8
889,530,624 *5C89B71432DDCA83BA918165F2FD3219998BA447 cmun
889,530,625 *5C84CF412CF5470776EDBBE13C6876AD546F1ADE coassession1
889,530,626 *5C8D299CA012BAC03D752F3749D43C543799D80E derekhillis
889,530,627 *5C806DD698BBC8C17B04313FE8B6CE0D2C55CEF8 DESTINO.CONTRA.DIOS
889,530,628 *5C88301B2841A18D701E2CC983EFF1B332E70732 COMPRIMENDORUMQUE
889,530,629 *5C8616B5D28026186083C729A839317AFF012F27 CONDADO DE URGEL
889,530,630 *5C80545E7CA319E6BF9EC9B33E8E6121C2039EEB coo-riv
889,530,631 *5C8905E253BB11498E8CAE183D7965B06A7FF070 COP5V
889,530,632 *5C84E3B42A9F43EEEC783A348B8D5C6F6B75D484 COSTOZERO
889,530,633 *5C8D79B2C99AD5A44109F6391FD5E1DD1DD1D8D5 dh8.l
889,530,634 *5C8E840F232140B3428F648EE4C18A1D77E49CAE countess brought you this letter, gentlemen?
889,530,635 *5C83C3E8623F76B2954815264A2EE69741B63424 d?hhx
889,530,636 *5C8524F0D39FC6E17570CF7A56D2FCF4C06A622E DIABETIKI
889,530,637 *5C8469210163F05ABF2086DA0A83813FE59D3757 [email protected]
889,530,638 *5C870DA58F7F666E3B3C7FA63762D94C06BCD049 DICK.JANDREAU
889,530,639 *5C8481C32E2EB91FB542ED0F9A5F8ACE8142626E DIELETZTENDINGE,WOO61NR14:SOSPRICHTDERHERR
889,530,640 *5C8D8B2D70BF0F9C7B4DB600820431178D62DF6E DI:=H
889,530,641 *5C8ED3523AA6339875355B96A97FDA8227D15EBC dio0w
889,530,642 *5C86E0F88B92CE1B2102081DF9155186E5B71FC4 DIRK.HEIDGERKEN
889,530,643 *5C8D489BCE02584A8B73A537DB1F91E48E9DF9AC “discul
889,530,644 *5C82A16F2F15FC1BB0DBD3C0213B6BD422EA08C6 C_S(K
889,530,645 *5C8BBFA3EE912692A6D91516DD600B71AAE26387 dnp?n
889,530,646 *5C8110A8B40D0E58F0EFEECF48CDEA440DCE3AE7 CUMF
889,530,647 *5C8611A4D9F33F235D2AEC370FBCBE3FDC428DD4 cvzew
889,530,648 *5C8A76B2581DACCD80B1848A2FE7B0ACF3C33091 DONNIE.NATER
889,530,649 *5C86CCE26DC76FCD08A8A3B691C550218301238E DONNLOCKNANE
889,530,650 *5C80A014D01FC2680DDBB7CE34A3F5B79C8CCC21 d$or3n+
889,530,651 *5C8B16FFFC51286D63683FF9FF240A9602580F29 d05ui
889,530,652 *5C85385F563192A545E8AB535EB72B5F15EA173D `.d####p
889,530,653 *5C8B2BAFE3DD72B93A6A01405EF65959E1A93017 D3M0RA1Z3$
889,530,654 *5C878E3D0F69DD91ABF46578745AFE3C414AA6AD d!?r9
889,530,655 *5C87A739AD0C52C15FFEDB50965712A0551C3C94 d4n?)
889,530,656 *5C8AD8293B435F11BF49594884A6EF4BD58DA119 D4TUX
889,530,657 *5C894CDCF154A0512CF6BAC46E3DE5B25D1DF665 DRqc
889,530,658 *5C8572558C33ED7F4AEFAEB013720C8CB77B40BA du!8;
889,530,659 *5C806DF992FF2364E0D76F8F7C3A96E18E0E668A DUGOSHIPPING
889,530,660 *5C82D631DDD052FF94F36E0510343B913AC229C0 d";uj
889,530,661 *5C82580E3895EF2EF04DCC40255224A794E8A014 danielhardiman
889,530,662 *5C841E3FC9ECC26599055C68DD59E4DA5B4081B9 david.paisley
889,530,663 *5C837CC7ACA153F5FA6799F10B70EC8317FC9266 [email protected]
889,530,664 *5C85FCC44F551C8E10F13C1F81727F1970D58841 db&x"
889,530,665 *5C8943C81DD71075833FABBBEB4CF78D4A025704 e9'
889,530,666 *5C89C58252A187EC0BF1C4FCC667B06ECCA4CE0F ECD1E
889,530,667 *5C80972E4B36D8C8C75E82AF0135F4C12C1762E3 DE7F
889,530,668 *5C8D74DB582F4DA5080F8A3B4ABB0A206ECCA790 DEBADEB2002
889,530,669 *5C89A582E05946692DF193193A81746C49973A72 EDDY.THORAN
889,530,670 *5C8B5FC23ACB226AF4669DF22EDE02B6B7D7F556 edp_.
889,530,671 *5C81D3C3F72C4A59DD18253FD82CDBF209843CD5 dei3emoutontropo
889,530,672 *5C8B5A7C3F1E495BA9AA4BFA172274687E9DC930 DELMAR.CHASTANT
889,530,673 *5C8544CB52A1B24261D7FF8315079F0C90DF7292 EEUET
889,530,674 *5C8B9BD272F011E5CF65CBCA4C49CBDBF4EFC7E6 denoueront
889,530,675 *5C8AB388CC68E04DB66B5A35312C1607FD1E9F08 EHCNARI1
889,530,676 *5C890CA34B4EE2F418B2C2E8F5C042DDF9FBF823 EHCUSREL3
889,530,677 *5C84F930692037BD9B3AF3AB7D16FB344D8BBF2B eidess
889,530,678 *5C8BF47B8217F581422FE75513BAC96177FDAACD ekllk
889,530,679 *5C8BD38FF8DA3349A2BAAFB6B58DFE6500160782 ekwħ
889,530,680 *5C876E49A06FDC0F439CAD8D80BED611237447E0 devon-ellis
889,530,681 *5C8255E24E247C3FDE42565278C6165F682010B1 DEWITT.THRUSTON
889,530,682 *5C832C542E2FB6FB7EC5E1B7208E1E46CA6675B5 ELBITRES3
889,530,683 *5C88FFCB261D2DF5251213625C1A8162D638D666 DEZMANNRICE
889,530,684 *5C8AEB8EE3CA1D80C299891721EECB505D87CF2C DG_.!
889,530,685 *5C8468919246F2221D050CD3E7DCB95F1801166C elv/b
889,530,686 *5C8A6BCC1FB04DFB1D1411C7E1E31A62CD91305A ELVIS.MELARO
889,530,687 *5C8BEBE6CE62DA53AB67132836E5F86E227F4BE8 emabi
889,530,688 *5C88188154E5906B6F6E7E5C673B48DA92E78542 [email protected]
889,530,689 *5C83BB4B527DC4C4D055160D5BE97FAF4BF050A9 DIANAWILLITS
889,530,690 *5C8D8797676BA38D78613A03B12F4E772E1D5F32 EMILNEILSEN
889,530,691 *5C86CAAFCD882BFF70676E2C774CBF11A172F716 EMKP
889,530,692 *5C8FAD8760EB8E73B3A9E8FCCC8716E967E87D7D DIÉTHYLCARBINOL
889,530,693 *5C8E6B87B7CAEF9C4E10BCDF01B8343C885B85D2 dikaoil
889,530,694 *5C84BE54CD28766E3A68CAF268072C6216BADB73 $EN$4T!ON41!$T
889,530,695 *5C825A0F73AF5BF01BFC437F56F23B6B18B321F1 DISNA4
889,530,696 *5C8FF9F70E30FE4D14278AF3D25E355478AC695B enmic
889,530,697 *5C8E4B668AC10A1E72FEC5260BCCB24CBE03165E ENTREMÈLÉ
889,530,698 *5C8EB2F69AAB5222BE1D07187D377090F1D7DFBA DJKB)
889,530,699 *5C80E3F9C314242A05F81F5C6B67E8699AB6577F envenoms
889,530,700 *5C842C17FBF015CBBF83258231A38D136596F18F DKHBRTSY2
889,530,701 *5C892AD36BBFE03F08D2D4407AA205542C488729 DKRCL
889,530,702 *5C8110BBA03C959CDD17D90D72625161C4EBDEA3 ER-HAT-ES-GESCHAFFT
889,530,703 *5C8EB7AE478D10A536D88C6426B95F18EF652EEB ERICAMYOTTE
889,530,704 *5C8B690660DD0F03232870FF0467129FBF7854B2 DM6041S453W
889,530,705 *5C8C4CF79CA2914921BF5BEBCEC9C8E5A59CC331 ERICMERZLAK
889,530,706 *5C8AA6A2092E688DC1472562A2BA7A9E663E15E1 dmi7+
889,530,707 *5C8893936DF8B1EE448CFBB55D40F12D79D9D7CD DN8GC
889,530,708 *5C86CD3DE01544BE6F43600452A4D4A07D49DBCF erweiterungspakete
889,530,709 *5C8506870C81ECDC14097368B8E30431D68B6049 ERWIN.REEMER
889,530,710 *5C8A1D3F432071506F4878EDBC3A649C03698281 ESALCIREP2
889,530,711 *5C8742C7EA94C75B6ED0BF6540C406E6C0D53F32 esb(c
889,530,712 *5C835412321ADACC4A75594699E51DBB311B8B01 ESSASUAP
889,530,713 *5C8637272FD7570AFD465C63B5B079A3932AE63B doclr
889,530,714 *5C8CA0F9F44501292970041082D4CF69336FE212 DOMENIC.DECLUE
889,530,715 *5C8468444249038B8C0C5ABBC569605777E94515 ETHAN.ZULAUF
889,530,716 *5C8C733D0D3ABAD071AB5B06C15DE5F9BB8BF8C1 DOMINICCIBIK
889,530,717 *5C8D1A9FF417206C6F933222A85361E85CBAA874 etilaig0
889,530,718 *5C83A518EC0E903729DD354E877B1DD94EB26475 EUGENE.STELLO
889,530,719 *5C858F2C70A14F53DC5A1B92AB22CBB005E885BD DONNELLSAYED
889,530,720 *5C85E746BB50AC46382F7F859FB79A51C59E8BE0 don'tspenditalltonight
889,530,721 *5C828CF7A2C8410C4019DF1C8EEFDA1C06401C5C dotera
889,530,722 *5C83249F4B938A8100A791440D39F8C4B50B9BF5 EY6KN
889,530,723 *5C89DFDCDE91E23A0E6E7ADAEFDE5BBEF36623FA dp;e6
889,530,724 *5C8861AD54B2685E01FAC61617A5162576AF217F EZEKIEL.GROENE
889,530,725 *5C8E28DFE3F190E981B12EC8B67CA520BC64865E d-pwy
889,530,726 *5C8318FB8CE6D02C7C0A87D566A0943123250A69 DQP-_
889,530,727 *5C82B706E9735A6B684E53CF3BB5E41CFF6B4C2C dragonflsimon
889,530,728 *5C8713965240FF20A6111EE4CC9DC828A972870D dreamsmolson
889,530,729 *5C8A740B0B467ABD25EA2A99B78082BA731D577F drg0nblz
889,530,730 *5C80899F67DD5D2B987A8ECEA8703315EE51E82A [email protected]
889,530,731 *5C85215256AFD8874A1FD4585C8032B3CB3B39D1 firasomar
889,530,732 *5C8A794C34EC311769EE547DA05FB8B96957F4B3 [email protected]
889,530,733 *5C86845F3FE24485BE3A10A49C7BA17D61EF781F FLANCHESCA
889,530,734 *5C83B10CF82D17BBC519F11F9C2BA709A3354CDA FORESTCOWENS
889,530,735 *5C884CBA777109A96ECFB416D320D09FC9F9A21E FOREST.GUYET
889,530,736 *5C8C8A9DE49E3112D7E8F6D4ED437567A91A179A fortuinzoekers0
889,530,737 *5C8159265968FF67DBA8D8C5C95898D5A4BB5646 E>&`
889,530,738 *5C879BBD90ABAD1BD36CBA5B1F2168673B2394D0 e2zc
889,530,739 *5C839BB650B63D200F0FF985967114617BAF35D1 eddieveater
889,530,740 *5C8FD859D8FD76940C59C1629F5E6E6FAD94ED95 ede&i
889,530,741 *5C85A60DFC1DE7F633E387AC7AF8B5E8B5E3E8E8 ed;q
889,530,742 *5C8DA1BB0ECA1E10357D76E2983792CF248AC7C7 EDVLS
889,530,743 *5C8604D0D8FAF71CE89D019029280311051011EC edy.subagio
889,530,744 *5C863B02A616641E770341C2CB501EAE4051CE05 galenborucki
889,530,745 *5C817A9D1F049CFE6789B77DB1CB5D74BC928C1F EFREN.PARAS
889,530,746 *5C8C2CE16FDD13CE2DB8083B49AE00441BD0BF7D GCHILLIES
889,530,747 *5C8BD6BB6F260AB90594A3EE250EB8734C6A37B1 EIGENVESTE
889,530,748 *5C8E80AB8844FDA7EF5BF8DEB994E65A4E91C60E GELOCHELIDON属
889,530,749 *5C81F4DFBE1DA805A4E48107B88C0A67A7953CA8 GENAROHAGEE
889,530,750 *5C88396038482839E799A4763B52E1BBBE996D1A geodatos-dinamarca
889,530,751 *5C81136CAF79FC8C071C7075D4FB904690C33748 GEOFFREY.KOWALSKE
889,530,752 *5C8D0D8E2CB2B43F73119BC8C946E9DFBCCD1704 EKVXW
889,530,753 *5C897372F12DF1BB4992EBA70F48D0E4AACD7139 ELIJAH998
889,530,754 *5C81E600720DE58BDF2EFBF71ECE3F9A19B767A7 ELISEGGERMAN
889,530,755 *5C883C6A0E183B27BFF5F6A984D8B943A92E65B2 elishamatero
889,530,756 *5C80D26DA83C0837CFE589172F53413A46555CEA ELISHAWARNE
889,530,757 *5C8ECEE08256D40D8A080FC54C1ADF1A114AB335 [email protected]
889,530,758 *5C821E8DF506F41E8F89C5CF828B7942E495E346 ELITISTA7
889,530,759 *5C8B22E3B6DF3C7B5838DD7E629305AE3063B4F1 ELLAHKOG0
889,530,760 *5C8DA5E06FD7F1B2A8DA893A25958A28346A41D9 ELLIS.STCROIX
889,530,761 *5C8D1EC6171AA10A4334B5D186DA811E339A24DC gilbogenschutz
889,530,762 *5C8A5EA022A5AAD440956DD0F87F695E5C6D0A29 ELWOODHEBETS
889,530,763 *5C81C879F6FCE8CCE0FF3A634E59108848B69D45 gnialat7
889,530,764 *5C887EFDF7AE1016D05B61283CA37BFDC7102600 [email protected]
889,530,765 *5C8A8CE7E77BCCEBEE1EA79195E14075D8422DF1 gnuohk.1
889,530,766 *5C8AA6B55A9194E58149D37A8018A255A7CCD444 GOIUMBIA
889,530,767 *5C82CA5CECEE0F9590A5D8D181A6F7060F61BE9B EMP
889,530,768 *5C839626D37A0CB05D3A77715E8DDB07FC325961 [email protected]
889,530,769 *5C89B2A565BC56A67B47B9545958FD7E3603F4BD GRAHAM.WOOFTER
889,530,770 *5C807AA050DB3414D9106DAFD6FC265233E84889 enqaa
889,530,771 *5C8508D4F54D021D1F1E5935B19AC761A2A3A45A envs-
889,530,772 *5C828C66D9BE4CC4CD2B78CAD9C2F91B4915870D GREGORYCHURCHILL
889,530,773 *5C8CE228906F3FAF51CDAC5BEE1A8F1FBD292A30 GRONIUGUE
889,530,774 *5C8112968125C75BD30FEA4E6170C674689E8FDE EQWMG
889,530,775 *5C8EF8B66134C47A0CBEC6CE8FA09D8FF08B5EDA erednebrs
889,530,776 *5C87CF2477DBC4048309DE7BD00709BE9F8329BF [email protected]
889,530,777 *5C8E6E04A7E92451A4A5DB9C504A04E7F89A7E25 GXNR
889,530,778 *5C84CC10A4D4648D0077944CD7B902F173B15355 gの映画部門の関連業務を行う。出資金比率はフジテレビが86
889,530,779 *5C89280C583DC4BD0B288D5C27EFEF1248215DE6 HALPILSON
889,530,780 *5C855A621764A62C22873A6E77F89BF4F4F3790C ETAIHGENNA
889,530,781 *5C802CCAB15D69E12F4D834A6CE50A0756176D4C ETIATKOK8
889,530,782 *5C8F4963DA9BF7C7A7ABAE714F978E9476686531 et(ln
889,530,783 *5C8DD4C4D6EB91B9F488D9D32494167B218A00CF EVANSTABLEY
889,530,784 *5C83905F2C54D647C88FF4FFCD9A62CD36AC5131 Have.You.Felt.This.Way.Before
889,530,785 *5C88C12CA41563B04EE2733408654C08E3B00372 EX-ANTE
889,530,786 *5C8BE1FAC73B056DCA9015F0D69B8A402C3BDE60 FALLFOON
889,530,787 *5C8489D357F1967CFA524AB928A60E3E35AEB2B7 [email protected]
889,530,788 *5C82E54C4AF88C5F16FEE853B73FF96A5027292F hexpan
889,530,789 *5C83957DBDB604D6F4BD6B81D9504F36C9B92C0A HGFNJDFHDH
889,530,790 *5C81E8C478F218196E45435D71DD26468488B865 [email protected]
889,530,791 *5C843388D1CCA76550C93FAF7661704FA6F818DB high.society.snob
889,530,792 *5C80E47A016559E7C0040C98A3243C147BE571F9 hilary_25
889,530,793 *5C867A339653A62D555A57575FD3AE08B2186009 HITTEBESTEK
889,530,794 *5C8F561D80187A4D99916D9EBD9724679395DFCB FELIXTROXLER
889,530,795 *5C89E06669D94DFDA0FCEB67B5A3E63A97B82DAE fertiliser,fertilisers,fertilizers
889,530,796 *5C84685E27042032A0990A632EBF69DB425FD8B7 Hole.in.the.Hand.(Full.Intention.mix)
889,530,797 *5C87DA86287DDD15A0FB4009072E8097D3F89324 fideliden
889,530,798 *5C8CD2EB6C2DCB34A220C78B04771185CAB09218 horacemuhlenkamp
889,530,799 *5C8D46890867C6461823A81EA9C8AA7BAAC0EE79 hor-hat-kah
889,530,800 *5C818752275086CDB468A871E63E0283FE5BA1D5 flmslyst1
889,530,801 *5C80AF03324DE6AACF389B07D13171B77B0952EC HREF="/CSS/RETURNS/HOMEPAGEHTML/102-2552690-0924944">RETURN</A
889,530,802 *5C8F85F3E15206D2BA4E0775455D1F8EF23D74EF fmarshal6
889,530,803 *5C8DE2EF05D5E4E48CB1DD919CEB33FBA96F77C7 HTTPWWW.MAXITMAG.COM
889,530,804 *5C8C699E1011B27CE7DFF6BF82935DE67BA8412D FOOTTRACK1
889,530,805 *5C8FFF7A57680C18F47528232C90108A34BF1A2D forestroping
889,530,806 *5C8FAFB8F19275221D6A7421011B75BC8990151B HUNTANOTHER
889,530,807 *5C893245705C71835469244A368CC2EA9071528B HUNTER.ELPERT
889,530,808 *5C804075A5104698D4F6464CDDEEE14EBF3CC5A9 HUNTERGRAUER
889,530,809 *5C8F19DB3F374EF7E526524A0AF07516F84D7707 HUSTANKE0
889,530,810 *5C85329090D92ABB1952A75D79FCFA87FC0CC69E FRESHMIND
889,530,811 *5C877C4442F057360D91DFB9CEAF930F68B1B24C IAMDIPPER9
889,530,812 *5C8ACB90E0E5FB4E90777695F97B45AE3B3BDED7 G3T4CU4R3NT3
889,530,813 *5C86091AA232DCE3E3D7B64A7B1DAD27C7699F3E IGLESIAS.DE.EXTREMADURA
889,530,814 *5C806B2335ED873E7C9EC9A692BADDD92FFB6DC1 IGNACIOBABIRACKI
889,530,815 *5C891E1F92AA312D4764D1CA7AB9ED477BBB5689 ignoraient3
889,530,816 *5C8C392A77CDB3AE4320838F1CE81BD5A47ECE5D ga(leifbergman)
889,530,817 *5C8080696FD4EEC66DDF8EE33D013F84CD3EBD29 GARYBRANDY
889,530,818 *5C81ABB9931A8A08D2B97F3FD383827BA3979EF2 geesteszieke5
889,530,819 *5C865192F6A30D1D577A995FC979EF5287B19AD0 GERALD.DOLEAC
889,530,820 *5C82A3E25752748BBCA661BFEBA2B43F344A74AA geraldogallob
889,530,821 *5C865C8DB9BBBE8712130D84D326428A0897ABEB I NEVER CHANGE (FEAT. JADAKISS, THE GAME AND CAM'RON)
889,530,822 *5C8DB32F20F7FF3D9B70376C022D7F7EB15BAC66 GERARDVANSKIKE
889,530,823 *5C8D5C9CEB5A57B16CC81926F63FEDC281F04517 INGENS
889,530,824 *5C8312247710A9DAB8B5FCB238D97E6CC2B2CA89 [email protected]
889,530,825 *5C8B7CAECF60E146F9470C44C89B0A1332378037 [email protected]
889,530,826 *5C89F2EB7CD07626908C01A29AB68C82632FDA6C INTENDS
889,530,827 *5C866862A2FCDBC55B56A8DD593E0FDAE24FB173 IPANEL1234
889,530,828 *5C85152675B5A8BEB399226CFC53D358ED2C3DC0 IPETERSEN
889,530,829 *5C8C45E3EC7B0667D1F3E69F46848CDBAB677C75 gnirretnisid
889,530,830 *5C8FACD744CC71F1BD5E3C8A534145EB78FC9CC7 is.this.really.me?
889,530,831 *5C839EDC3F158143CCCC2C2EBE232ECEB3E22B63 ITALOGRIECHISCHE
889,530,832 *5C8A7F9B7FEBA0178B531C208CA4459BF8A733FC ITALTEIL
889,530,833 *5C8A13D12D613FB04896E183EEE52867D1196294 It'sExpectedI'mGone
889,530,834 *5C84EFE7D8B75A858B95C261A0A7FA1964BE6334 GRAFŜAFT
889,530,835 *5C86D34DF6E05A39D470F44F013499774D383F03 IZUMJETI3
889,530,836 *5C8A82AB3AB0ABB7A6765E60D60656EF451EAF41 grillin6
889,530,837 *5C879163D4C53B2BC35FC0B5CC2BBAB819B36096 grndrgn0
889,530,838 *5C8E4838A8B1A45D208CFDBD4AAD3F2F6752A817 groverreichow
889,530,839 *5C85681EFB19BE45924A1F7E7108C47909E2A5C1 JAKEMAHAR
889,530,840 *5C8AC94EE250DFDCFF04C74FD96ED6C67D4FAE60 guidningar
889,530,841 *5C8F4B27D0DFD5D56032D04A864D259995F3FD22 JAMES.WEIRICH
889,530,842 *5C8FFA7243E2603E2092EE0DA9D8F9C6C2EAF763 HAIPĀRINKU
889,530,843 *5C8D5F23159D29D60D64FE6E9AE3DCD611EBABAA jcsnetcbsw
889,530,844 *5C8F39C08F436F7A37035783C12E6BD670E176F2 [email protected]
889,530,845 *5C8300E7917F73AA64C33A247BB876CD1C4599D5 HAPPY-AS-A-LARK
889,530,846 *5C8EFA002114265044BE0AB9C43F23183DEC588E HAROLD.HOSKIN
889,530,847 *5C85DA131322EEB2EB0CA8C84F7994A1640509E0 jensenblazer
889,530,848 *5C84319BE71ACB55D5B7F5EBA305BF04955731AE JERE.ANGELSON
889,530,849 *5C8673C3E05E7535B9BA817B43BE2F2C0D3BE02D JERELYN4
889,530,850 *5C816949B388F0D69C21E7B3777D512CFDC60246 HARRY.BOWMER
889,530,851 *5C8DDB05596BECACE6B684A0125745BD681B5497 [email protected]
889,530,852 *5C89EA4FD6095FE08C886198753EC99B887583D7 haywoodmulford
889,530,853 *5C8FAFA5313896034D23241E05C310C9A21EA855 hazelnotestruik7
889,530,854 *5C8CA9E0CE7F6760C49B9FA7FDA490E460517C11 jesssturwold
889,530,855 *5C80836D9A6204135E8066D622BE876DE67AC212 JHANIZAA
889,530,856 *5C805349659ECFF2FA0C43CA52DC9F90454644FD HEIYFONL
889,530,857 *5C85B7DA0106F3B6D03441CAAC635DC1D3B9BB93 [email protected]
889,530,858 *5C852907E3CA5AB54597F860A8608DDAC47AAFBC $helltr4
889,530,859 *5C8254DC4518859EEFBA009FEEC0A860437C256A HERBERTMOAKE
889,530,860 *5C8232609B7BB8033DCC5787269AB4D2C7B8C52C JĪMŪTAVĀHANA
889,530,861 *5C8C2A16E7C547B7C1CEFA7961CA81BB70648CA6 HERIBERTOSCHAADT
889,530,862 *5C8542883BE5E9DFFDD7815B76CD99C47203CDDE JIN YU
889,530,863 *5C84D5F275BA41136C5F1706F90E3AF618F23A9C [email protected]
889,530,864 *5C87A0A951E0037B44E8DE81CE6CF7DB964035B5 HERSHELFLAMING
889,530,865 *5C8D1DE1F97E6CC82FEFF3D787E289AE0E687C41 JODYNUESCA
889,530,866 *5C8884D696DF3E39631FC16BC9E269549C68DCDE HILARIO.FONGEALLAZ
889,530,867 *5C87CA0AB9ACE774168AA3EF780B1A382CC2B594 hilife2
889,530,868 *5C83E49588515ACEE793D69132B14F40B4C6F205 joe.strawder
889,530,869 *5C814CDC02481D2CFE959EA7CCEAA5C825D50790 hirambroom
889,530,870 *5C8725EA8B4252131624AEDBF48BAA2FB8CBD11E hkennern1
889,530,871 *5C80FDEF9160E3E7F4ED2CE8D98E3B2F32434F2F holdonnatty(featmarciagriffiths)
889,530,872 *5C8A1383EBBBC6B1424A4F3A83768812B6729F00 [email protected]
889,530,873 *5C87D5C7E465A7F9C6B02350A8E087778A16EB40 jormalla-on-ty
889,530,874 *5C8B4F6A2ACE66CA5AD409368603C26C91AA8091 josephine.mary
889,530,875 *5C8B3AA25F8C35F3DFD2F1A24A05D7691065AD1D JOSEPH LESSARD
889,530,876 *5C8932ECF782DB091EEBF541EDF0EB6ADEE2F448 josephmyrick
889,530,877 *5C812810CF5EF24E7FF8DFE7242FEADDC80246EF HOSEAUTVIK
889,530,878 *5C876C6B6B04292C876B131FFB6F4F722F4D7A61 JOVT
889,530,879 *5C8758E9A80FB82AF334E5D113CA7FF2F0A8C27F jpbuu
889,530,880 *5C8E4F5D0FF47249FC74D93A6673231E6D639359 JQU/
889,530,881 *5C8DF4B693015200A8CE883873EC12B7B6BB8CE1 juergengloetzl
889,530,882 *5C80A0C613C7EEF7E83EED186C968A96A7BA8856 httptumwikipediaor
889,530,883 *5C838A5A63953A0BC5D590D087006C332E175A25 HTTPWWW.LUCENT.COMCO
889,530,884 *5C80DDCEE0FFB79217D604A3CD688186494E7CE3 hub.maker
889,530,885 *5C8AEB6165F03A8B626B3D9027F8460BE0047F3A HUISLIJK9
889,530,886 *5C8EE77070FD0B070154C220F38EC34F257B69F1 JWLFSHS
889,530,887 *5C888D5AAE5E45C34FF66E5ECB3A217844E4DCB3 k9c6
889,530,888 *5C8B3DD7C21EBC121241372753530C09BB0716FE KAPITELSDECHANT
889,530,889 *5C8B43069566E7B81B989B312A2D3E7858478F43 IAMTEDDY2002
889,530,890 *5C8B000EFC15283BE3DA0B4CDC94940AEA9E3018 [email protected]
889,530,891 *5C8B4FBFDCBA35DBA88F702290FE0B191DA2B7CD KATHLEEN486
889,530,892 *5C8264EE85D49771B6B2CCBB291B4EEE8EF93F55 ICIFUGIN6
889,530,893 *5C872322DA12069F5EF6D3455BB809C74D5B31F2 KATIESBUMPERS.COMWWW
889,530,894 *5C892B588E5C64D85F59DB7189B877BBFE60E66E [email protected]
889,530,895 *5C81E68CE6A997EBA4BA7DFFB28AB2F98A15E8E5 KAUSTAVMONDAL
889,530,896 *5C829480C92F01DBFF36967F3597F81D1DAE91DA IDIOCROSSA
889,530,897 *5C8E66EC06A64048478FFCD4172DF312209328A4 IGRATORSING
889,530,898 *5C873CCE5E1F85671E8AF01CD962D2BF8A960DF5 keizdnal0
889,530,899 *5C83E61C88775627D65F021A83E634D4A6C19A97 KENDALL.HENSLEY
889,530,900 *5C84428E3FB9C5932582B1025991DAF76C349D98 KENETH.CORADO
889,530,901 *5C88ACA67A79F7BF1D15BEFDCC4B7799E82367EC kenpennisi
889,530,902 *5C8E285F6600AE19A126F4210CE44158D7E9C2C5 ILUVMARK12004
889,530,903 *5C8DCBABCC3A2B5FA98B06C66D805BF8B3B628A9 KIM.PARISEAU
889,530,904 *5C86D6330D1677476AF853C794498CAEF6C17B44 KING'S-BUNDLE-OF-MATS
889,530,905 *5C83DEA2001F9BA03F5BAA649BAF51726A9549C7 INCHESSTEEL
889,530,906 *5C8E1174B62D2A9834F295A70EDBC37E4FF57F55 KIP.PROSCIA
889,530,907 *5C82B554009A6ADE58BBA38818B62C8C3039A4FD kirchenrenovierungen
889,530,908 *5C804F646BEA1FDDB85A19C74C2B6209E3AEFFD4 KISER'SLASTDAY
889,530,909 *5C8F20987DBC6610CB4DCFD7D07C64F59F38A12B INFANTERIELD
889,530,910 *5C86E5D6699FD1F309421833CC23D6CA24014DEE ingestop0
889,530,911 *5C875267D3942352705672939B2B0193687A5E6B konohaz
889,530,912 *5C8972BDC97ECB4CE0F0E0A6A7A070B38AFB6DE6 korusz:.a.la.recherche.du.chorus.supreme.(disc.1)
889,530,913 *5C8C25D0F341875CBEFAC9C157196EC20A14564D [email protected]
889,530,914 *5C8691D2AF6B8B92B6545DFA9664EC059137E2B8 IULICABABY
889,530,915 *5C8871A50AE72E2FE8E8110B6F392702FC21276E KRYSTO1234
889,530,916 *5C8C59751590D9399B98004C36BF8D90558F219F KUDIYA-SHAHER-DIYAN
889,530,917 *5C8ACEBB1470E4E4E92D1C26031A8199BCF45DC2 iwra
889,530,918 *5C8D4AEFD07CDE9594FE6C7AE97BE283C2D33C8C jab-jab-say...
889,530,919 *5C83A3F7719BC628166F957B244AF25227C862C0 KWITANTIELOPER
889,530,920 *5C82A7521E3F7DC0AEFE4FAB646F9223279436B1 L0GIC-B0MB
889,530,921 *5C8D6D9C20B87A3A367AD55D53E1C42A3D2274B4 L126431
889,530,922 *5C88F9E1AF87885ADE248F122C70FDD3FCEAD5FD L374898
889,530,923 *5C8BAD6F4FD90F20EE9859CF2AF2EF9A3F9E0127 l7i)
889,530,924 *5C802D8DCCF0896B6E6DD142ED39B4BB7070A307 LAHODNIES
889,530,925 *5C88CD4F85CC0586E798DEB25A31E81E107A55C8 JANAE159
889,530,926 *5C8450DDDE4EEC91DC90618BD1B43AE1BFB6C256 lan12
889,530,927 *5C8E001BD9C7F66524E9E061696E9046E9F880DA jarrod-huddleston
889,530,928 *5C827B4BCB3D95A2F828B6EF181FB2F908419497 jason0406757593
889,530,929 *5C88B041FD75C19A0042C3F5B21FA05C89073EE6 LAURENCUNICO
889,530,930 *5C87A40A6BB149781223AA0A636432EE9871E65C LAURENHALEK
889,530,931 *5C8C850D83A36378A21E594EF939E6C10F4A44DB JEFFEREY.SUCRE
889,530,932 *5C89EA9C701DAA49EA26D4C87482F126AEC132DF LAYFEYETTE
889,530,933 *5C853D780A5817F3523931E51C5E3E3827C93545 LEIFDILOX
889,530,934 *5C86FD6CAB9D78974F0401A6BE9D8D45BC61EBAA LELYSTIGR
889,530,935 *5C8FA4E928BE6F3AB34A839732A92B492CB84B67 JEWELGUARD
889,530,936 *5C85ACC670D1BEE71EDCEAF6BA7D6FBB3ADB1072 LEONLEDON
889,530,937 *5C839C2E3466DD326981651C5ACEF63AB25AA50C JG?\
889,530,938 *5C866569B4CF6C0B015E71BB9887D6E403732ED2 LEO-TAVERA
889,530,939 *5C858655DC197247BA0012F75105DA4F6205BB06 [email protected]
889,530,940 *5C84DF6917F6539E08FECEF4C017A05B29BD4C04 jim.hostetter
889,530,941 *5C8FEE87D4D024DCF6219157F6F26307932AD96A [email protected]
889,530,942 *5C82C3D99F531555E30107044867A5A21BD61B6B LEYCAP
889,530,943 *5C8050B03C61C9A502086850BF4DD4B0FBBA8D4F lfzb
889,530,944 *5C8AF56F60D0DC9311ACB5FF8BD33700A27B207E JOAQUIN.DARMIENTO
889,530,945 *5C8FEED1B206505D4058FE29994E76D380A17584 JOE.BORY
889,530,946 *5C8EE8F19FB4AC52ECFBC1B8170FA86FB18528F2 JOELSER
889,530,947 *5C8A3918F98120A35523A6B4BE3B7167F611A938 [email protected]
889,530,948 *5C84876B9AA48E9234038008719A9D3127F8DCF2 JOHNCENA:X:X:X
889,530,949 *5C870D6122915D6B9DB49AE436DEA94987032A07 LIMNOPHILIDAE
889,530,950 *5C85158CA1A2256462DDEF414898C12048F7653E JOHNMACGUIRE
889,530,951 *5C80E40FD0C01B1DEF824CD23AD156D44FBF93DB linear-attenuate
889,530,952 *5C8B52C1012D5222895E122A01F277F5D5FADDE7 [email protected]
889,530,953 *5C8EB25AC3919614DDC28D2EA517B88302D0C84D [email protected]
889,530,954 *5C88CBB517F485B4F6E3DEA1C43E667E7709979B LITERATUREPARIVARAPA
889,530,955 *5C8A8B326810E71FF1E11F30AE94EBB7D424CEC4 JOSEPH SAY
889,530,956 *5C888FDECD9C1C97EB67D643EA0702BF4F63F06B joshpetrucelli
889,530,957 *5C8C8156D45FA09D3E647CA7F47A4E4F2D527CED [email protected]
889,530,958 *5C875DD3BEAE13339F505720435BB5840E30618F [email protected]
889,530,959 *5C8EE3097242E7D17FB566613DC201B7997A228A [email protected]
889,530,960 *5C8A525C472897D329D6E73F6174BC2FC94CBA11 LOCAL($PAGE)=();
889,530,961 *5C8F7E0710D964AAD6B5644259E71347901BAB6C JUDE.SPRAKE
889,530,962 *5C8BC41068BFE68EB7419B07927EAB7595EB52AF julie6
889,530,963 *5C86C2D6C97C36AFD0D2FF7BE0603845F0EE738A jurassicbbs
889,530,964 *5C8DA18F1467D381C4EF3C71B7306EC2CFC9FC87 K310382
889,530,965 *5C8466DC37DD80D21ECBB1BB6566B5C7898D3AC7 loveylove
889,530,966 *5C83193FDC77CEE97E861D309ECED1395DB826FD kakaosektor
889,530,967 *5C87E575716243FB9D6442A1804DA0B8AE05E61D LUIGIMUSCH
889,530,968 *5C80D62F328CF375FF7966A00FFC449DB7265DEE lulugregging
889,530,969 *5C8B5E8205B2FE4F72915BA477097FA4C2B3AD25 MAANMITTAUSLASKENNASSA
889,530,970 *5C882E1D01AC593578BFEDF1BD5FECB773325156 madaivasquez
889,530,971 *5C85CE5255228D32724460E95CD56237FB226DCE KEVENGOFFE
889,530,972 *5C84185FE5A999D0058898C562B5D9C32232E74D [email protected]
889,530,973 *5C8547D382A43D8180D81B7CBC9FBA5F83AB78E8 MAGIANIS9
889,530,974 *5C8FF62B7F997B2AAA0F65BFE6F027FAE2451B8C KICKUPS
889,530,975 *5C8311B7FE9B3B35FAF2E38A35972D81402D6FEC KIMWELLAND
889,530,976 *5C8F1153135F7D15A82F16A33024CBB3B7F07F74 KIRKREDMAN
889,530,977 *5C8970EB5865A8763CEA2234A20CB0735A0859D9 [email protected]
889,530,978 *5C80E28BFA2C73F4F80C1523C23F3A3F00281300 KKUBOVCSAK
889,530,979 *5C84A33A0C156BC09893C3AEE745E5D5C0B6BD98 KLART)
889,530,980 *5C8E585B422B1E1744C1173386C7E72072057F7B MARIA MATEI
889,530,981 *5C8F370ABB53CA4EE3C74B6809FA3A4FE9E17094 mario.hollowell
889,530,982 *5C8199B329C50263318155235C962051FAD179BD KOMJENDANTSKIJ
889,530,983 *5C89DAA917B4E15F81F1B72DDAEB9C3997668D6E marlinholster
889,530,984 *5C8A466A84FA6BABEFA0A5469421FD414BEFC334 KORENIJI2
889,530,985 *5C882C023DA057636902D19A5DB4BB48A2FA096E koridorda
889,530,986 *5C8FD508172CD3EB19013D27C79B19D24A9A45C7 masroheg5
889,530,987 *5C8A000ADDA9EDC7123A70A710641D378206CD8A maximosievert
889,530,988 *5C897707C0BC74097CB7788104223387069CAD28 kusatu
889,530,989 *5C8120FB2E192EEBF46AC6804C274E3455D798A9 MBEMEBE
889,530,990 *5C89F5DFF7360DDD39833928D4160FAF299DB5EA mbvlncs0
889,530,991 *5C8108B05348DF2D2DBABA72371389A8F34983DD MCCALLUM5
889,530,992 *5C822F4C70ED2C386B0794D240CF11B1755186E4 [email protected]@PPE5
889,530,993 *5C8EB06EE49345F2BD371C3BBC6C706BB1DC3E78 me..Doldrums/.Nick.Sol
889,530,994 *5C878E0236A9AA3B29B3ED932F9868F42277F57C MEGFÚJTÁK
889,530,995 *5C83FECAE4B47C1FE0E958FC9A65EA5BCAE90B12 [email protected]
889,530,996 *5C893B269C760E093834E63FA9705D6A623E3653 mellowbits
889,530,997 *5C8A842461B5D7B474DC29516030BC9E53A3F4BD MENTHACING
889,530,998 *5C8E006BB5B527357842EFA68344C8248810F370 LANNYBRODER
889,530,999 *5C85BAE5BBEF628AFE16D0CB701D1DA939074151 LARDEHIR
889,531,000 *5C8BE09AFFFFD78DC652F1288E351EEB03E15E3E latex的读音和书写
889,531,001 *5C881A4E83376C869C49E51541BE4C268668968C MICHALEWAVE
889,531,002 *5C8B5275AB8E87F8D6DE3715E936D28401CD797F LDJD
889,531,003 *5C8D603585B6E9A097C8AFC88277179D06890C13 LEAREGIDOR
889,531,004 *5C8B493CA8546362D0459D4873818747EE222C18 MILESHIZON
889,531,005 *5C812DD906A135FEF3BDCE07DDF5370F4ACABD11 [email protected]
889,531,006 *5C824F1333EC3C4187C9C7A41406D68C6F2DF2A2 milities9
889,531,007 *5C857B158432F2CF1F1A452BFB0A14BFF03211F8 leroymerrit
889,531,008 *5C8A392CB2314489B4746CF49FFCE5E6DFA38263 MISTY.SIDWELL
889,531,009 *5C8278D084CE4AAD963F77E2FCBF0FA89846396E MITCHFRIEDMAN
889,531,010 *5C8E657CB4457380B988E49924EDB06E9A5AD55F LEVI.CHERMAK
889,531,011 *5C870E96F3C8A814ABD7F59F0151914F65EFD126 MN9QTSTAB
889,531,012 *5C8C878093B535E82DFDEF1769B8D70D357957EE [email protected]
889,531,013 *5C86354CADE4366E10A14EFD7EA2F7E2390692F0 monometalist8
889,531,014 *5C86BE1AB21CEDDF016383166C9A957098EEFE73 MOONLIGHT
889,531,015 *5C86032132B3264CFA1271BEBF9BE97A0C72CCB1 MOROENS2
889,531,016 *5C81280725BB4058B28414639279AB23FA519181 lindsey-markey
889,531,017 *5C8C57269C677274239799CBF776A71D47A57098 MOSHELEVERANCE
889,531,018 *5C8F4D264D2D13BB300B83892562DAD1B7DCB6A0 [email protected]
889,531,019 *5C8E9960E11C3F81D016D825D3AC99467F025337 LIST.WING
889,531,020 *5C8AA7815E7B7FE24BB9D8C0078C1D6C8EBC52C3 MR-HIGH-PROTEIN-DIET-GUY
889,531,021 *5C8ED73F4710031602A2A4D09983D533F476F6E1 MRNAJI
889,531,022 *5C8646FD10619979F3873AA70ABCB412C145C5FB LITTLESUGAR
889,531,023 *5C8F6C5685F57BF8BA7A9C36BBC6D02D972E5DB4 MTRAKARNKEERATI
889,531,024 *5C8CFF8F00C4EBC2B1B81E136ADFABDE10029031 [email protected]
889,531,025 *5C81692C7BD418970E8762E9C1FD4E37A4C9EF86 MUEHLFARTH
889,531,026 *5C884B293C4A2398BE33815937AB90325FE522B8 mvi
889,531,027 *5C853DAA0EE5142F3C1CF92EC9857274ACD21460 [email protected]
889,531,028 *5C87F0047FEA4102445F5EBDEC0984ADA7D95AF2 MYFOREVER1234
889,531,029 *5C8EEB0EC08E3158F9EBBB7A2B6D93586B1F75CC myjamie73
889,531,030 *5C8C4F88B1E2B80B52DF71AFA28EA2310CB13144 LOREN-STRAIT
889,531,031 *5C8A872F40079D2E44385B00517DBEB10FFFDC75 loren-webb
889,531,032 *5C8B5E61D1D58384E8012B349094C92FA4F6234F LORENZO.SEYKOSKI
889,531,033 *5C86137B4A1E4127F6A5CE9782509DD1D4453402 MY_OLD_LADY
889,531,034 *5C863E82446759F83A790186D971F0191CA7E805 MYSHEBA1990
889,531,035 *5C8F6820D0037805EEF8694BB814FB5C7EA3213B NAAPURIMAAT
889,531,036 *5C8242B201427F4A31B96FAC532E45D5FD84969E LUCKYBUM0
889,531,037 *5C8B8182C55DA4D626906F6CCC3BFA7420B0849C nationgrows
889,531,038 *5C8FB1FE1EBD6B13F9B683F5B6594DE26C452B7D [email protected]
889,531,039 *5C8C4D0F3C21DF8D2186F914AE4589DCC0C121FC m4rketh
889,531,040 *5C804DDF7359D27648B357B3ED8DCB5771E9E671 MA162162
889,531,041 *5C8BDE7F78E80F07F56E731E3FA955FBFF629299 [email protected]
889,531,042 *5C86CC0A331B51493BE40BE1FCC1649744B89B3D NEJPOHODLNEJSICH
889,531,043 *5C82AD53A7CC9022BCB5801C77143A1816458400 maisie-fitzpatrick
889,531,044 *5C8368FF79D2DF4808AACC488407CE908AD906BB newgnos6
889,531,045 *5C8E3D2B29B81D4E96FBACF404843612814B6E1D NICKBOCKLAGE
889,531,046 *5C85619320E8A34D03E28F15686530A1628B3E4A MARCBIEWALD
889,531,047 *5C87733232B3671E57D4B39674819FD5A9B86756 nigraviola
889,531,048 *5C89C6ED85C0D6A35A5BE5402BF5B48DA465189F [email protected]
889,531,049 *5C8923E09A28BD853F51BFD9C0BFBF518434FE06 MARK.CARBONE
889,531,050 *5C835A5FBE4BEA649837613AFA5FF1FB837DEC34 noah-yang
889,531,051 *5C8370DEFCB12A94FD29E77CAAAF473E035A7C99 nondataink
889,531,052 *5C8FB58A3D917F1FC8D745286D27B0382BD5C830 MARYANN.MCINTYRE
889,531,053 *5C85F868BD24D1393E817CEE2E2383596B7BC946 NONOGENARIAN0
889,531,054 *5C842DA8A354F5026031DB2B7ED8B1FDE6FCA296 MATHEWSNEDDEN
889,531,055 *5C815472A6A94D9E27A6C9EE5E9B6DD074444B99 mattcocker
889,531,056 *5C85E27956C2CE98D7F8713D7421BF5FF2AD0609 MAURICIOJERONIMO
889,531,057 *5C8F112F3821D9642F3D4F7A9E339A392FC30A1E MAX.ARCORACI
889,531,058 *5C8DDF72586C170ABAA13F7203EBA3DCCF26BA02 NXGP라는
889,531,059 *5C86E2AE96A82E2ACFA72E21D0FCA1FDCAABA2C1 MEDEGEBRACHTEN0
889,531,060 *5C88251D8A74C71F88668712C642909157A98C47 MEIRA.ASHER.WITH.KO
889,531,061 *5C80A2A8BB3A79FE5CD9E030B5380DFDF4B57C86 mercurypoisoning
889,531,062 *5C869F4D738EDF24EBA313FC654ED8F094EFABE7 merrillgenereux
889,531,063 *5C84F035C2CC77231518D1570913ADCF79D0F555 MERVINSCHAIBLE
889,531,064 *5C8B8CF40269A67B5587D2A2C01146C384B9FC7F OEXUAA
889,531,065 *5C82526AED471B12B4F45F97AF35BD01B5EDCB34 O,~F
889,531,066 *5C8629065E608AD238C35A1356E5FA6FF41D3F0D oilgeza8
889,531,067 *5C837B36ED6B609B705316E5F105BBAA27453ABE MH....STUPID
889,531,068 *5C8F0C43F9CB0CB0BACE4C22F0331ADC325043BE OMAR-SIMMS
889,531,069 *5C88C11DF159111E1F368AA1482D97BC5661740E one'''the
889,531,070 *5C8FD5E1502B82E2613CF16D8B26A739FE471A7B ONIFLED0
889,531,071 *5C85332652042D4752058885F9AF99B4A2811709 michelle-bregmen
889,531,072 *5C8B68975C45A7E3C1C672E7689959239D868260 MICHEL.PENICK
889,531,073 *5C886E10418F4024E590F5EFB59DAC168B6DB5AF mickeycoolman
889,531,074 *5C86DE6305F444D0093FE279CD11A86EDC179C47 MIGUEL15521
889,531,075 *5C86D117A5F3E60AC33C143765AEDC9A8532BD3C MILES.KIRSTEIN
889,531,076 *5C8F6AC6C8D12879F9563642ACAFEF425E9A27A1 mimoilazi
889,531,077 *5C8BBA46B6BBAF7664455F9DCFC7ADEA68E05881 minimumseditor1
889,531,078 *5C843AAE2065ABE96DBB0EDD25497CF57E743BCA MODELLIERBARES
889,531,079 *5C875D05E703268B8F2FBFCA8C3893016F52DAFC MOHAMMED.GILBERG
889,531,080 *5C82B19034FB58B2194918247B4C09F414C4A9BD OVERZEILT0
889,531,081 *5C8FD108B034A6899EA7BB7A74CFA9AF9D56E3FA MONLOOL
889,531,082 *5C8C119705C72A8483DCB7E6AF4C54C65060A200 OXYCOTTON:
889,531,083 *5C8DF0412A8643FBF8A319815C8EC11EF88132F2 OZONICA9
889,531,084 *5C832F128DD76457B1EDFE505FDE1F7F5AA14692 P3RIPOLYGONAL
889,531,085 *5C832F1FB5A90604CCD464857A9F555F59E2498D MOSESKOVALESKI
889,531,086 *5C8B6AEBCA51A17AB046E76EDBB5D02B21EB01FD pablorotramel
889,531,087 *5C8DFBD6CD87AECDD9E61AA8D064017D69A4F5A7 paksukaisen
889,531,088 *5C8AECF125D2AA503E2E17BC553C1DB7EA7247DE mudj
889,531,089 *5C885DCDAFE627106839602B362452E8B0AA74DE MUL+1PLES
889,531,090 *5C883BF7B4D2A25C6ACEA30B406830CF1E4A0841 PARTFIVE
889,531,091 *5C8195FFE48AB1DD4EC4A762FBFB3B78280A8C34 MWEITSE5
889,531,092 *5C8A38E4B4EA1C6E5BDD0BECD18461FEE90732D7 myanaconda60
889,531,093 *5C807727C69063E803FCEA7E9775F662B5C67497 PAULAGREEN
889,531,094 *5C8B48327ACD0166C2A9DE5A26031F1CB969642A N1CHOLAS.
889,531,095 *5C85015AF6F7855234002751525434B27F12F394 [email protected]
889,531,096 *5C8B2FAB1D220F92AB15AB11C7F377AB93AE7018 pentatonic-exercies-#2,-improv
889,531,097 *5C832874F0576A395615AA12FD386F4F97A52AC0 NATHANFINDER
889,531,098 *5C8364487079329CBCF59D5D50D18C07A8B61C33 nathanielmyung
889,531,099 *5C84F7C6A94697BBEA3713CFD347ACD66F7C0030 NATHAN NIES
889,531,100 *5C87E3C13C1E6E13203D2B63FA9AF71D30AEA800 PETE.HAYMES
889,531,101 *5C8896790AC41353D9E2BC6FD9F8807DA38AC5C3 peterbr
889,531,102 *5C84EE14CD6BC6178772AFFA53A287C4EB5EF9C0 Philly-Philly-(feat-Eve)
889,531,103 *5C8F84B22B7CA5B9E151653876DF8713646EF7BB PHILOSOPHICANTHROPOLOGICAL
889,531,104 *5C893079AA22C209B9590F4DB2B73CE1C5BF292D PHOTORED5
889,531,105 *5C86F414530685062D4E2E04B48AB3D0C150354E NEKISOB5
889,531,106 *5C8C49179D23D9B84334E5D743798EC29AD27661 neri.kyle
889,531,107 *5C8D5F4918691F88A2BA43F84B31B83A04736207 netlocking
889,531,108 *5C85B7EFFF02541CC4645CCD6DA714B6EFC3F61F NEXTHER
889,531,109 *5C8B717EA86E5A9F3C0C13D892B32F36FB1C926A NI"+
889,531,110 *5C8817F9DA2DE1E867AA5A632BEE2742E0837AC7 NICK.WEINER
889,531,111 *5C8DDF130635C2033111FBCDBC94951D8158DF49 nickyfleer
889,531,112 *5C8EA08EC4C12123DA3029B6E5549C1CDF9C18C9 P##)~O;)
889,531,113 *5C8B162ED3912D50C43ACE7F80133848E3FDC8A0 NICOLEBOUGHTON
889,531,114 *5C8FAB66D764AA6234DA402CC64C0305D3988D55 NICOLEBRITTEN
889,531,115 *5C8CDB3BF57ACB95850E67FF18A06FCAFCE98933 poison-chalice-(30-second-version)
889,531,116 *5C8AFCBD8AF4C18044640397A80B408E6D43DA72 pomella5
889,531,117 *5C86B7DA317D251790E7732998D84BF62B63C571 [email protected]
889,531,118 *5C83CB283BAEBDD498AA4CFA0AB7B37663529AC9 portlne55
889,531,119 *5C82755A2136A166C0E242FFD3B81599D3AD2A89 noebalton
889,531,120 *5C876456520859F4EBCD52961624415D21E84981 NOG.3.MINUTEN.(3-2-1)
889,531,121 *5C84D047D159ED533DBE6E508991A898754F3919 nomalli
889,531,122 *5C83017D41A8713D3E3B2E0169D4BC3B658CF46B PR3VR31L0
889,531,123 *5C8ECC154CDCE82D7C8B9F527FC37E3C54F13D23 NORRIS.KID
889,531,124 *5C8DC75050E80F618C2735493CD773B00F9FA4F8 Praos
889,531,125 *5C8B80D8D2B4FD78ABEB8DABCB6A9DF01BE424D3 [email protected]
889,531,126 *5C854BB59B1FC017EFABF57545635BF1F8D3545C preposa2
889,531,127 *5C8E287C66565CA21D099CB4893589CAE06A84A7 Pressagency
889,531,128 *5C8C0BA70150E13D5FCFDCF76B5E6667B0641EB6 prompted
889,531,129 *5C8E260FC178D92592A4CE1E5110940CCED3A160 psychiatrique3
889,531,130 *5C88E2D493665F647046B2A238D86A719E0B2AD0 [email protected]~`}8{
889,531,131 *5C80712D341D86CE5F956C2D29BF353CBCF9909D olivermilas
889,531,132 *5C84C45278F42AC64429185287CB92A819185925 ollielegall
889,531,133 *5C8CA6148C708ED761471273F8DCF5E6FA8759D3 QB~.~(0_<)
889,531,134 *5C8C03B6695A9E5C7BFA00074575BF87B93849F3 omerlucarelli
889,531,135 *5C8B7289B7CAC110A4AB631BEA43E5B053890790 [email protected]
889,531,136 *5C806684ECEEF3E2FFAC2642CA2B5868BDE13BD6 ONFAUTS
889,531,137 *5C8E55A1FD94D38085B45B64F9AB245EB740E87F onsladen
889,531,138 *5C842BE108F842C94E35282E44F9DA3C1A2D9985 OODL123
889,531,139 *5C8EE909AD960C3B6E2C4FBBF13995A762867121 Q"#M
889,531,140 *5C89B92AD374C6E95B493810EB3C446C30C10147 Q###P ~ ~ ~ (_0)
889,531,141 *5C840B98CAFA6EE5CAA70E10C298E012DC491DD1 OPENFORMAT
889,531,142 *5C8BBC2E22C385282F88FDBA3172AC1464AD1039 oppercommando
889,531,143 *5C8B5FEE46AEA98567BB036095CBD61BB47906D3 ;)-O~q====3
889,531,144 *5C81EC74E5DC119B175E07D972A0E510CF06CA59 [email protected]
889,531,145 *5C8482A73D406974020A32523F6252090DC35B94 querfortsätzen
889,531,146 *5C82FF6A6999677C26C9C135642385F568EEFD28 OTHAGLEEN
889,531,147 *5C852379C7CFCBE74ACC247F9781FC0261994906 [email protected]+10N
889,531,148 *5C86078F0EF91E44A8613F9AA2ED8CF57363FAA8 ramirolyons
889,531,149 *5C87E3B2498B38F55E51B247F1FA59631D4F003B p47r1o75
889,531,150 *5C862B8D897372301BAA85E4C9D98033BCDFAD4F PA00107479
889,531,151 *5C812348C712D7D200C2EED1141DA969A6282EFD rapi14141
889,531,152 *5C831C23A7DE83E63EEE28BEA00C6DBA36BA9B5A pacomuniz
889,531,153 *5C86900CC25E940D49831983C1FE5C78AC728707 RAVPAN
889,531,154 *5C8B57096ACDDFD5804C68AD4DDA84CC34C1A3E0 [email protected]
889,531,155 *5C857318F382DF354DF9C6633AA79D0FE4721BFF PĂSTRAŢĬ
889,531,156 *5C8F78503FF062A44DD48DAAF9F350D39F53F5B4 PATELJAYANT
889,531,157 *5C8936FC0E51E04A6BE7601DF9EB159BA2242676 pato2507
889,531,158 *5C8B093F407DF4CB2C97DC7FC4C68FD5458E1E2F REDNANERS
889,531,159 *5C85597F33D37DB66FAB2763A10E32BED8DE6ED9 PAULINEJOCSON
889,531,160 *5C871F61CA85C4A9B2EDE478E689E2E405D10F2C reedrudh
889,531,161 *5C8CA8BE966F6DA58FD6B4AED5C95A6F0E0A78A4 refalls.
889,531,162 *5C811CF98E90B6CCB6117565683ECD1B8294F5B4 [email protected]
889,531,163 *5C8A14C453B27581672BDA1125ABDDBD30AA25E8 peloursat
889,531,164 *5C8CEE784A3118DDB3BCCC612ED7BF5FCB119F2B pentenes
889,531,165 *5C8E136BB5CA8DEA023558FABFB6F2DDC1427042 réthaise
889,531,166 *5C8F9240B4E53E8267A9103A2CF62E4590332E87 physicks7
889,531,167 *5C84019B6D03CC31BAB4902A6DC41BCFBDB364B3 REYNARUVALCABA
889,531,168 *5C86A0132A1E4080CA414908E11745852880C90C REYRKAEN
889,531,169 *5C8F15A7E3ED541FACDC51EB79B2AFC58326101E RFGLOBALNET
889,531,170 *5C857BFED624AF461F5D03ABB15277BCB1F4DB88 RICKNICESWANDER
889,531,171 *5C8CD3D5C5580AC0A0A639AD7990825E0F466538 POLIXENES PRESS ME NOT, BESEECH YOU, SO.
889,531,172 *5C8B1CE293C91F3906AE7A6B09B45A4769FB2496 POLTTOVÄLIKERTOIMEKSI
889,531,173 *5C851C4B9CBC02ED3E29003DEF61507A1029AA7D pot3nt!al!t!3s
889,531,174 *5C8185B5E5F6FACF307A505CCDDE090C3AA5D097 PP~0 ~o)O(
889,531,175 *5C87A75237DDA62FDA6E756503E56E5287C647FA ROBOTSKE1
889,531,176 *5C83F807A5C6062093DD6EE051A66E2EDB0394E8 PRASHANTHSHAUN
889,531,177 *5C8BA40C4D85B7EE4D85F7E97CFBDB4DCA6BDBEC rodrickcrognale
889,531,178 *5C80D42C40463860673E62CBFBC2B270B353E83B predlagajte
889,531,179 *5C85733FC98BE344AB4270F97AE716C428175F23 PRIEN--P-R-IY1-N
889,531,180 *5C86FA1231A6D4ED2BD02D457A72FA32AB1B0000 PRIMING
889,531,181 *5C812742AD348D0803D65BFB6B09BE81CD680613 ROMBACH-LE-FRANCS
889,531,182 *5C878AC6835CA904ACA5E1EE431455C615A47A87 ROMEOCYWINSKI
889,531,183 *5C8484BEC36D7C15B6531AAF2318824FB6EA6B6A profile2best
889,531,184 *5C820F780F14C8514573D02AE497A51755583DE1 prompted
889,531,185 *5C83186C79816BC2B0EC1756CF8AF25D90913E91 [email protected]
889,531,186 *5C83F43133BD7E664111493448FB99963CA54D62 ROYCE.PATEL
889,531,187 *5C813AD87CA554EA94D030E8CC57A06656BCBC7A RPURWONINGSIH
889,531,188 *5C83D5CC77EAC01AC1F1471B79DBF31AE53543CD PYEX
889,531,189 *5C8F12A8443D3D66CC05D1230FD2B358E2B59E92 [email protected]
889,531,190 *5C8BCA4B31751197DC480DCBAEDB63E16CE5CCC0 RUDEBOY.INNA.GHETTO
889,531,191 *5C8CDEF591E69A031B97550110FC9F3F7720B098 rudygreig
889,531,192 *5C892E0D049D4B3575EF30FA1B2D72A9A13650E1 runigback
889,531,193 *5C87BEDAE27BF49971C758F4B661C6F52D272D1A [email protected]
889,531,194 *5C88BCBA581CDC62EE43586CED20AA0E2E181B9E [email protected]
889,531,195 *5C8B77508AF5A9757FDBBF6DB4F1AF14685F7001 [email protected]
889,531,196 *5C8DD69C5CA4B9DA5FAA50C567D1D35077B478A1 rvprzng9
889,531,197 *5C8047C5245A25E84A6158E635889CC29D4CF775 QUADRUP1!CA7!ON
889,531,198 *5C83E34C3FEEB9C8ED421627802A97D680476611 QUERYING?
889,531,199 *5C86EC9A95D2F20E46F1EAD1439259767D3A4390 RAKENTAVAMMALLA
889,531,200 *5C84518DB609E94314CC1C8BDBA8E9B4DA8576FF SANANDAJIED
889,531,201 *5C8EA09BE026CDF675CCE0CFBF80B167C35B4481 RAMIROSHERILL
889,531,202 *5C8D4BCBEE016A740D2709AD5826EECA56373623 SANDYSTUDLY8
889,531,203 *5C8B18D5F12EC0C0F6B4F4B282D2EBFEE83FCF79 SANGMORISEY
889,531,204 *5C8C56FA2C54D4E6A634C6C543DEBFD8DA2BB04B SANTIAGO.WYCHE
889,531,205 *5C8DD67ECBBC0D5128CF4D9CBB9FFE1161EA1654 raulmcconaughy
889,531,206 *5C8BF1D689EFD46D6F7EDE34006513C26677C3BC sarcinae
889,531,207 *5C8EAFBF6859FB75675CEE5036409E362AECEB80 SAUL.REINERS
889,531,208 *5C8B78594CD094E95D32BEE8211EB23CB66BF464 SAVARIVIER
889,531,209 *5C87641FE79881B87A74198EE6C44B79A6DCC3A7 SAZERACS0
889,531,210 *5C8329BAFD83BE53AAAB63520B0F1DBF35AA1006 RDUBBLANDES8
889,531,211 *5C877E02B127D5BED9E4DB70BEBFF54C50603BA2 REAUTHEN4
889,531,212 *5C8155B88B7A5C2DF35B5C46821373C71B65D220 REC0LLEC+ED
889,531,213 *5C8D24F8C22E4132D12642EA76932CEF36C07E96 reedmorganti
889,531,214 *5C8596C6D6EAE5EF90EA7FA13F17802BA96F456E scottevans
889,531,215 *5C80A94AE2FC3EB0975F518BA26E4FEC1278DD13 REILEVOL1
889,531,216 *5C8C71BAC9C22940ACACBA49C9A325D3A8B2CC2D researchproject
889,531,217 *5C8C98F0C297CB4FD630E75659EA1421BF7FB411 sentirli0
889,531,218 *5C8E76447A016CCCEADFFDBC15378C36137030C8 sequestratrices3
889,531,219 *5C8266FB88620FEF1ACEFFC0D7F6C273336B621B sergiobeeler
889,531,220 *5C880D0424BF4209F409C57470B89A14C5E9385D SERIALUPITS
889,531,221 *5C8F0EC4265802C43DC655103DD7CBBEABA4A702 RFMNET123
889,531,222 *5C8F25F4B9764A2EFDC393BD9A2F3387AA507E8A RHOLNEHC
889,531,223 *5C8FC833151C407E94F1B6D6176442748C05B3E0 sethhamalainen
889,531,224 *5C80411A8DFF8CC134FC092EDB006D871E7270DF SEYMOUR.ELGER
889,531,225 *5C87A47D992B87360D464C747841AB5702143351 SGEHANGTED
889,531,226 *5C8A4E99E3E9499417F2419B521022CB24205CC5 SHADOWJANICED
889,531,227 *5C8D9249573D44CADED824CC87FC0D3194858EE2 shakiah.jones
889,531,228 *5C8EE22CCB954559CA3972C56ACAAFF1F64EE022 RJQFNYIED
889,531,229 *5C82BBD12D62B1422900143A1A6465537DB38A18 [email protected]
889,531,230 *5C8952653023830B7ABE79BB38B6267457807337 robertbrassell
889,531,231 *5C82DC01FC88A2778B004D6A7525B4082E61DC1D shergjin5
889,531,232 *5C89C5A15BEB55009304AE69F9624961FD5D0EF6 shipsagain
889,531,233 *5C8A8C545D9DEE8E8443C890ED2B7820F945E668 SHON.HAINSEY
889,531,234 *5C817914E018FFCBD467317D1D0E6C803CA45891 ROGELIO.RAJEWSKI
889,531,235 *5C8DD9A80DDB6FAC3A8D51040A1BC2CD30F5384E sidneyadolphsen
889,531,236 *5C8ABD4C7376A59EFFBD009D568A0B53E9F6F43E RONALD-CAPULONG
889,531,237 *5C8A19A94B0B7FB00D6900F41554BE481865E4C1 ronaldzehnder
889,531,238 *5C842006AEB3AD1269D121730B864D1AB4EE6DB8 silasbagge
889,531,239 *5C88AF6D95DCC1C03655CB988A8B2EDA532664CC ROOT.......
889,531,240 *5C857371768E0E5A45A5452E14E60C00DD8D6E3A [email protected]
889,531,241 *5C87D13EC2D59231F355185169963CDF3A611C60 roypelzer
889,531,242 *5C8C48A72A4A021B0D5B0BE0D11477792D5CC585 RPUYUMISED
889,531,243 *5C881C428558C4DA9AB0A41CFF10103B411D68D3 rubberducky
889,531,244 *5C8D4171AA9969E43E0501BAD8863EF7D1C4392F RUBIN.RALPH
889,531,245 *5C8DAB3EB71AC82A3323F718908A43A64EBD78C1 SLBDDHD2
889,531,246 *5C8B6DC84E26137A1E7808EA74E548C5A1FA059A Sled-harvester
889,531,247 *5C84D398B600B37D288172E749F1C02280A848C0 [email protected]
889,531,248 *5C8079285923BD85DC83DFC93779598E9312A1BF SMS0386
889,531,249 *5C86E16DE7CFC93350B3A32F1359171E0A26D268 someday(acousticversion)
889,531,250 *5C8C590774CAAFEB098B5D3113BDE809A1600ECE sonnyle
889,531,251 *5C88C03121A76E5FB688734B9F75591413AD13DD SOROZATOK
889,531,252 *5C8A39181A41BCC072EF17B6A1DE7FF95D6DCCCE samabhiprashamsanh
889,531,253 *5C8FF4E4EBA81CC0B41279202890958BE1DC0E93 SPARTESNIO
889,531,254 *5C8AF1E752F89573DD9D5B57D3A26414B9D40F0E spekynges
889,531,255 *5C84C155346C30D3E99E9CF407EE56C381C302AD SASHAB310160TALK160
889,531,256 *5C817FBBA3B627A75E4B31C3AA1C83CFF4C17202 SPLAT.~.Q====P
889,531,257 *5C8546ACB120069E0EE5062FF1877138238DE934 sploito~(####p
889,531,258 *5C8974AF0B34883EF3C804C365899B7C42557ED3 SSCHLOSSTEICH
889,531,259 *5C8DFE07966140F71790EFFCADDBB93FC6390442 SSENDEMITNU4
889,531,260 *5C8695CEFF015D78CE8787ED676D8FF7DB335D76 SSENEVARB
889,531,261 *5C86074328F8BAA7761C45F7B207AA16168844B6 [email protected]
889,531,262 *5C8C19886DA52450864C5109489403C03ADD053C STAEUBE9
889,531,263 *5C867C345A3B3F1371B73F426A43532D44A9DDD0 stálbad
889,531,264 *5C8A0B6B54634B9407B60F70D0C2A78DAB643AAA SELBAZILANOITAR8
889,531,265 *5C8CFFB7CAE770864C2EAEBCFAF545A8B2E70D07 STEINKOHLEBASSIN
889,531,266 *5C8CBBA6FA8907379E22701A16196AC1354524C2 SELIHPOLHPYT
889,531,267 *5C8AE69DC59C787CA4DA7DC7C551D030935727B3 STERRENKIJKERIJS8
889,531,268 *5C8D6FA38FAF48CD53E8955DFA25A699D4D3EB91 STEVEGARANT
889,531,269 *5C860E9E2C7CAF2B8DB7C0C4FB6D29E349D6B5A2 SEPTANNATPESED
889,531,270 *5C8ED0C62C0EBE13C72877E846C4344DE18FF3A5 STEVIE.HEINZERLING
889,531,271 *5C89CC200B9018E421E8C9F06B45EE9003EA29A0 STFCX
889,531,272 *5C8AC1084D7C209A3302768BE910B1F840948B9B SESTORIUS9
889,531,273 *5C84B52ACC5272C812DFF76C2B34071C481FC67A STRNGES
889,531,274 *5C892B6FDDEE6E549DF27E94887E44C5629F834D stropiccia!
889,531,275 *5C8FAAB578C9572209DE4329907AE4A1478BEA4B [email protected]
889,531,276 *5C84C70D22DF0FD76F377AA5939C6F5A2B140910 shaynefaulconer
889,531,277 *5C807E09CECEFB64D3F52C587B5A7FE57CD299EB SUBV3RT3R4MOS
889,531,278 *5C810D8445F75CCA14D903A513E28F55D023887E successionist
889,531,279 *5C8FA45E86D30C96C90B3DA959633C824C842DE8 [email protected]
889,531,280 *5C8EA70DF8132FBE69ADAF6DD60F4BFF9FF13BE1 [email protected]
889,531,281 *5C83F4CC50D8680C2AF3885A9F26D934E1F50FAA SUKANYA MIKE
889,531,282 *5C8CB7A5B9EE3E8A47EAA55B58B1C5F5EBB52144 SULPHATO9
889,531,283 *5C8FFA425EF04F6578CB75D0DB7941EF045A69AF ShinobiYoruKage
889,531,284 *5C8E494C53BE26090CFB222B10C82403EEE6E12E SUSIE-CHOATE
889,531,285 *5C8A46279D2110A5209D0CBA0C5872CBBC6BEA8D siegfried:actiii,sceneiii"wasduseinwirst"(siegfried,br
889,531,286 *5C8FC7AB940D3BAAB8A815577D108289D9E911E6 sylvani
889,531,287 *5C817F1A454FE64BDD9F1821DF9CC0AAF2CE4BDD SKALPIRATE8
889,531,288 *5C829A9ED2F67B7DE992E597844F9787CD451446 [email protected]
889,531,289 *5C841B89DB325FB0883859E34425384B393F639E SKOMISIN
889,531,290 *5C80866CC8833375E1FE4FA44FCEAED6A1D72DC8 SKOROME1
889,531,291 *5C834512B651619D10E0C6DED98F2D5063337040 [email protected][email protected]$
889,531,292 *5C83A78BE42E8B2EAFC3FF5050F420788674E0D1 TAGESGESPRAECH!
889,531,293 *5C8CAB1640E56AEA6C6646CD7BE0228042F51C9C SODIUMED1
889,531,294 *5C884BDAA4534923447317D7CF58B2C17E9896E2 so-geil-wie-heute
889,531,295 *5C89975E2C8482F7FBDA1E09E3199F1C49726064 SOLEHUAS
889,531,296 *5C8B639A639900AB0CD2500D7CF08AF09D9639BA TARGETMOTHER1
889,531,297 *5C87243BC6A88DD07E14DDA8A4E9632518F980BB [email protected]
889,531,298 *5C8BD4BE50219A9CB70A7DF73DB8E676F23CF961 songsfromredwall
889,531,299 *5C8CA2DDBDB3750AD6F0B9E3AB4DCFA4799B245A TEDDYTROTTI
889,531,300 *5C8728A14597C1FC07B40B7A91FA218D001EE502 TEDGRIMLEY
889,531,301 *5C80C0FA836272B22BC0801E1DFA09ECA45A76D7 TENISSE7
889,531,302 *5C8430955DA0670CEA35E2A4B5464CE773DC4DF5 Splatd###B
889,531,303 *5C8D02F423880753F09F83BF5260D88CE8696112 TERRELL.CHUENG
889,531,304 *5C875FCEF18DBD9400632C35927A88677C2ABF74 SPLAT.~.Q====P
889,531,305 *5C87A822B09FE5E7D6A451BF9B44B81ED9A76987 SQL8VYMM
889,531,306 *5C86110B596858A05B3B2CA21FFF563C98EC35F4 thaddeusniederhaus
889,531,307 *5C84068D9174263AEBBAF908BF2AA3326B4C2B0F THANH.MAIZE
889,531,308 *5C8458B738A1D29FAA83AD401A4983F6F5A85E2F thatiloveyou177
889,531,309 *5C85E05337B58DE35392DDFC1D4AD1C1B0C9F6C3 THCNRBCCS
889,531,310 *5C8629EF65C7780D03F889892352DE371B0E5065 THE4T7QMEBO
889,531,311 *5C8BB40B609118844D8D838CCA0C3B53E987150E THEMANDUKE9
889,531,312 *5C8F2303C5334688E1B7B90C0341F711C2952785 STEVEBEJARANO
889,531,313 *5C89A2226DC09E4D0F37D68B84D1CF46C7E5B4D3 THERON.RENOUF
889,531,314 *5C8D53A653385590279CE56A7524BADB77554AB7 THESHAMANTRIP
889,531,315 *5C8DF91CF47BEAE8014582BCF86CE81DC0CBF363 STR33TWALK1N9
889,531,316 *5C816C37EED83027FA11561FC4894BF2251FF3A2 THOMASCUSANO
889,531,317 *5C8C7C98F239FC2F51CAE0C0F41E2D1930EF09B8 STUÐNINGSMANNI
889,531,318 *5C85D5109B6D7085789D82F599EA330C4E00F965 tiewonna2
889,531,319 *5C8C787502780E3187D2E1821FD102E8633F3CB4 TIKVAMA8
889,531,320 *5C87F3A5D85F3CA77CB2348CD32A351E7EE6C07B SUNFLOWECONRAD6
889,531,321 *5C850B80B4E6F60092EDFDF6D32971F0F9FFB574 TISHKOFFETAL2006
889,531,322 *5C8D1A8E3BC9AAEE2D6AB83FB73163114EC6ACBA TNEIAIFITAR2
889,531,323 *5C8FD593E394124D1D225102F79B251CB25A1689 SWEETSHORTENEDSHUT
889,531,324 *5C865091AD4293BDDB736629AE05A527F744E761 TODAYBYTEME1
889,531,325 *5C8AA195310B8700AD18A0982C18AB442F38F4A4 SYLVESTER.LAUTNER
889,531,326 *5C898339A9E08E95CB7AA62A85A6A1628D1AAC38 TOLANDRING
889,531,327 *5C87167AA41BD2A521F6F7186D29D122019A36A1 SYMPHONIE,NO8INF-DUR,OP93:IALLEGROVIVACEECONBRIO
889,531,328 *5C82C310769C88BF2CA9B9B238DE84B435D92948 topness6
889,531,329 *5C8550594D5AEC880F0A365F80135602BC923CC5 TRAIDOREA
889,531,330 *5C863B17FA3E24558EE3453203281968BF789699 transdouriense
889,531,331 *5C8F2FB341E353F5299EC0686E30C61EFED2B076 TAPONISES
889,531,332 *5C8D4954018291517BAD4151C3F8E64D0311045D TRØLLANES
889,531,333 *5C8DC8BE851FE22605C4AED33CCA18FEE00F39AD truffles9
889,531,334 *5C8E51E07629EC68F073CEE52E0FE5FDEBB53309 tetracromie
889,531,335 *5C8AA6268838323BA7967CDACB187F5FBE4B9E2E TYLERALEXANDRIASMITH
889,531,336 *5C8A0E74DC479743B300F4F9FFED2656C0AB42BF TYLV4LXMC1G
889,531,337 *5C80127395E0FCB332F341CB905B073755046FEF TYREEHARTILL
889,531,338 *5C888B78F3134D0EEEB48127841AFDD7637A94D6 TZELTEMBLOR
889,531,339 *5C8EBEFC0828085013A028D13DB3E4B01A8DE277 the.sound.of.superstition,.volume.3
889,531,340 *5C8E2B5CD3175AF4D34D6125325A6DA74EF87BDE The.Story.Won't.Persist.in.Being.a.Closed.Book
889,531,341 *5C8665D70C72261BE438F998AD73FE5E854AC815 THE-TARANT-SEWERS
889,531,342 *5C8224252991873E0EBFF8A807A7EFE12CFD1394 THEYALEUNIVERSITYMUSICLIBRARY,VOLUME3:BIGBANDINEUROPE
889,531,343 *5C83A4AAEAE22B96C8E4A76D62E078B552CD21DC ULYSSES.TOWLEY
889,531,344 *5C80AC20F2F60469F4BCAB60B7A43706FAE2C6DA UMGAEVE
889,531,345 *5C8B92D5C23D7783BD0A9418C75F603FA059257B UNG.CHANSOPHEA
889,531,346 *5C87D1296D1E83A5E41CD9FFDE26BD3CF73644F2 TKEBONY
889,531,347 *5C8149F06A81A278D214444C3225EA7B525270D5 TOCONFRONTCONTINUECONTRIBUTES
889,531,348 *5C8A93DA544142F34892740854BDA6548F05B8CF todatherholt
889,531,349 *5C8D478DA3D7CB9A3D930566CAE9C19B29D13DD7 [email protected]
889,531,350 *5C8EE31D25EEAEF18345A296F7ABC1F424B2CD9B toffseting
889,531,351 *5C8D5241C78649BF784885FEFC5CB90283FE89DA TOLLAGE
889,531,352 *5C892EF1FA8D1B2C5A346A1FA3DB922CFB663442 usenvironmentalinc|unitedstates
889,531,353 *5C86CD75935E16672E73D036644E222233EA3ED6 USER71.141.127.117
889,531,354 *5C8F020803B28FE734E5B03066302053D17AF2AE USERMATO-BATEMAN
889,531,355 *5C82D19CEC20C5180EFBE2EB4B766E869D2210FA USERNORMA
889,531,356 *5C8674FCD674403A19B39B857B63C286C7E03246 TOSAPOLB
889,531,357 *5C8A5596E91A061AA55AA8047878B5B664D5BF5C TOSATNIH4
889,531,358 *5C86D6FE1E24E29678CC79D8CA422559F2BE917B UTESSIZ2
889,531,359 *5C8380C5D991DEA26E48C22566A9DA426051DE0B TR1K4Y4
889,531,360 *5C8E0514EB193B990FFF60B162F3D2107FF5EFC5 tracy.culley
889,531,361 *5C8D82A0A4D5E04B76792BBAF6191BB8E48142E8 trangdoit
889,531,362 *5C828E973BB23A940EAD6091542A2E598C3B180F travislindsay
889,531,363 *5C84E663D2A910AD4237CCD0825B6C5155B1FA38 valentin-coleto
889,531,364 *5C8012DC861E4C001C55403996578D42F8B80A9D trentonlousteau
889,531,365 *5C86AD64F1BF2718C65A7DB4B1265EEB8DB968AB TRISTANSPEIGEL
889,531,366 *5C8ADB42F67080470A10975CDB5B64B0E835EE14 TRNSTRZ5
889,531,367 *5C87BFF71BD8991B12B9BE5104F87219E3DE8DA8 TRUDI-BRIGHAM
889,531,368 *5C8C8E4D40B0DD6AD2204FEF189EBAC162064CBA VENIETTAS
889,531,369 *5C8D3EDFACCCE9FA2616C2BDBD75A1BCEB08F6DE tsinoitiduabus
889,531,370 *5C893FC1D3C1BC52E2019C3D884E28ADB1E80D85 vibha.sarjolta
889,531,371 *5C88DE75B66B876553467696A7BDE9086D200836 Twin-(Dublee-remix)
889,531,372 *5C8D2F4852233293A39F2DA45E9757D800D5D4E8 TYLER.RICHARDSON
889,531,373 *5C8737505DBD183FD26C2287FF9C653E0D381104 TYRONEPASSERO
889,531,374 *5C8F564A2E771A916CFE2BA6EDCEFA6F931F12D2 TYRONSTAVSVICK
889,531,375 *5C82E37C57930AC77F0A5F05D26400D86BBD38E6 VIJUMACHERY
889,531,376 *5C8BB05BEFBC8F3380D68490A2F5F232B42DA9EF [email protected]
889,531,377 *5C8D81A208B4B0D6EC441097A08641CDFD5ABCD2 vincentsadbury
889,531,378 *5C8E46F86FE6BA70B125E03BE49A9325ED2E40D2 VINCENZODUNCKER
889,531,379 *5C8667B3D79B16B7A062241B959D30CDC269C016 VINO.RAMSARRAN
889,531,380 *5C8DEF1E4673FAB22C125099BAAFE9BF30F2D8E9 VIPER1SPITFIRE
889,531,381 *5C8F66F4D2C277712937874D290A5272AA61A698 VIRGINIA.CAMBEROS.RAMIREZ
889,531,382 *5C808DBCCCE04C2629F638F36AE5C8BF07C2BB70 VISTALLI5
889,531,383 *5C85719B5C3D9BAD1F5591DCB8B5926C708111F3 UKETORI8
889,531,384 *5C850B2A7F79862DE0608A1038E2954F779AC9CD [email protected]
889,531,385 *5C813D62F596F279D643C11A90D1F317A8A3327E VITO.LAURA
889,531,386 *5C8C2CE2A0299F3C0FD35C7171FFB5BABD65DA45 VITOTARABOKIJA
889,531,387 *5C85B14F36A1282DE02B964AEEA27D94380DFAF0 vitsche2
889,531,388 *5C85182D0EAF5ED1F728645381F4FC66482301F3 viviananaduakachidebe
889,531,389 *5C8605111D6F83AD3D5AE099BD7670742AE70226 U / MU
889,531,390 *5C87CE974CF208836EA41C231A131B5B7F94A3B3 [email protected]
889,531,391 *5C87605BBB84A410083F3268C9DA974C6757C0B9 VOLTIZAS1
889,531,392 *5C870F4EB877B937370E3994739C80E2FD3B5FF8 UNINERVE7
889,531,393 *5C8F8615BC85DCE278BED782AB3926AB85B901AB VRKWRTRN1
889,531,394 *5C8C61F3D281116B5AA283DC6C369FD907014D79 VTP'RS
889,531,395 *5C8DA976F80385D5D6F11E480DCBC7635547E6E6 VUSUMUZI-MNGOMEZULU
889,531,396 *5C8F3C5593B17DE3AF5391172506478FC1C15BD3 vyiztgwie6m
889,531,397 *5C83757097425B041346E33D2CADC22869E0E6E5 [email protected]
889,531,398 *5C83CF01B81CDCD9D53F7A5319909F214E06928B URKUNDENBAND
889,531,399 *5C836335316349F39BB28628AC4F2354EAAABE78 WAIRARERNG
889,531,400 *5C87015874301E4DEB47BE68E00653BC74B7BE0F WALKERNIKIS
889,531,401 *5C8D54962FED37C1F6C1700EC92A8FF6A7394978 /usr/src/linuxheaders2.6.3224server/include/config/af
889,531,402 *5C82F3EB0A1DCDC0CC0D27F41DBC194BCF8BEB25 UTHUSED9
889,531,403 *5C8DFB0482D798E270E80997F8728B246F5003D5 [email protected]
889,531,404 *5C8B4597C6B183A027C4EEF47E153A2A4E5DA731 VAIHTEESSAS7
889,531,405 *5C81B1ABF03C965DFE06A85C76AF7041339153CF WARREN.KRISTIANSEN
889,531,406 *5C810764EF9898A94B867C7E7D7F047FDA5A4FDD VALENTINE.REISNER
889,531,407 *5C8A088C7DEFCAFA5CF63390ABCA3F8608621953 valldemossa-(mdla-remix)
889,531,408 *5C8E9DB6187004B178A549D29F34E70E03DA8E70 VANAH杯KBCオーガスタゴルフトーナメント
889,531,409 *5C8B3D9FCF8CDE9DC9868969B5A2697B0ED40484 VANTERPOOL JACINTHA
889,531,410 *5C89A81C3B2FFD7C1167A6B98CE6DBCD7CF2304F wendyatilano
889,531,411 *5C8C107E826D0FB349C8CCD1E94369046C0494B2 wenielynsarmiento
889,531,412 *5C85E3CCB72179BDF574CB970C777239A948521A westonghramm
889,531,413 *5C8CA98875E1172B6DECE6BE07CA8EE37B3D6B25 WESTONPEREIRA
889,531,414 *5C8E21458D488EBEAF013AADF8B86410A5838820 VERONICA KORNEINKO
889,531,415 *5C8F1F4E8F7A7AF73531614B4B6438AE1FD6560A VERSPROCHEN?(SINGLEVERSION)
889,531,416 *5C8C087DF2769B0B11B34CB0EAFE3F8ED4182EC4 whitekross
889,531,417 *5C836A242F18C59C913C5C551691E330B2017849 [email protected]
889,531,418 *5C8E3AEC80C32940E6CEE4CEEEBA3CFACDD3157B victoria-konopacki
889,531,419 *5C85F0FA7A225F89B9A69BFF672A10A225625526 VICTOR.TATLONGHARI.JR
889,531,420 *5C8185C3E006386BF605FDF0324B7436B52B843C wilfredoweatherbee
889,531,421 *5C83BCF0A8370A4913D335EB8635A547E6F3362A VIKTUALIEVIKT
889,531,422 *5C8C487D7E532EAE352E937ADFF007FA581F7776 WILLARDKEITHAN
889,531,423 *5C851271A09EE959B659BB7F327BE404CA6BDCDE willdrena.young
889,531,424 *5C8948D3985CD6DC9FA1B5E4440D1797322AA899 VINCEDEBONIS
889,531,425 *5C8A8FF48BD9EFEDBA6E78FA201ADEC0EFB15274 VINCENZOFILIPPO
889,531,426 *5C871DB12EEB5C0C728FECFB4C5E41F3A885C05F WILLIAN.PIZANA
889,531,427 *5C801610E100747C374E52803DCCA8D7A4B291BC VISBAGH
889,531,428 *5C8313F5AE30ACAA31487B3E1A633DEAC42ACE47 WONCHULKANG
889,531,429 *5C8BB12FC353064DCFBACBB00ED9ECBBB2C71F23 WOODROWTOULMIN
889,531,430 *5C831CE46993A352B325BC5F021047B264077CE3 WORLDADVENT
889,531,431 *5C8F8C19A67AE0EA054EDE626AD6570B2B6066C3 [email protected]
889,531,432 *5C89858429B73EE031F1677BA67040A43B89A19E WOTANS-ESCH
889,531,433 *5C848B2CF8BD3677FEBA8BBA0F0944C52FA718AB WTOTARAM
889,531,434 *5C85C3FA2A6981B18E36A4CB4E4AC78694DD6527 WAHIDULLAH-NOOR
889,531,435 *5C893A4957C53BD24AEAA8B7D4FF394ED537F9E8 XANDER TOGONON
889,531,436 *5C8F2C9715C03F7556B3C37A47B0F21F2EB8A0D4 (x).*.*.*.d######p
889,531,437 *5C84C4E045A9F2D8771A659E8F582B263EC9AFB9 XEITO ISAKI
889,531,438 *5C82E67ABDB4BB0BAB148B5CE80120AD945B8A81 [email protected]
889,531,439 *5C8A01693716C1BBCAA398B59AD897DF68EFE56A [email protected]
889,531,440 *5C8DD8806F7159A1CC72324721E8AFD82300F117 WELDON.BOEHLE
889,531,441 *5C82E5439FA9325B026002F8F92ED2B48335CBF4 [email protected]
889,531,442 *5C8630DA0E0F509F36938278A252A784A5C5467E )X(-*-*-*[email protected]######P
889,531,443 *5C819CFD0774891EADF3A76A3FCC2E68229251E9 wernertillie
889,531,444 *5C80F08A895B74C45C5330594337D863D0B34392 XVM2
889,531,445 *5C8FFA67C2E74D7A3DF6BD031A5E48F18223F96E WHOLE WORLD TO SAVE
889,531,446 *5C899FC496BDC88DFED673D2C64CA661486D1A1A WHO-SHOT-TUPAC
889,531,447 *5C8D2B690FBF447E31B15575F59032DA6E0376C8 YANNICK.CHUNG
889,531,448 *5C87C7E81A524CAB5FCD39C9D32F8F3B9D95DC36 YCARTTIRIPS
889,531,449 *5C8B47B70AACEB9E852F01D23B41B63A233C87D2 WILFREDOCANCLINI
889,531,450 *5C80611E1A13A18AF5A38A75A2393E79A1B1030F willbrienza
889,531,451 *5C83A5F22B18C36F313C5D5FBF423E52C4BA0444 yhdyslantainlaita
889,531,452 *5C89DD97D51131914D769088C5F376D451C9CC67 WILTONBISHER
889,531,453 *5C803C71C38E53CAF4CF5E7E2E478AA42678C8F8 [email protected]
889,531,454 *5C80914590604D029430BED23AF4B2D629B36059 WIZARDSCOMPETITION
889,531,455 *5C86A198E6E16CEE314E143A65319C757F83797C yongjaslyn
889,531,456 *5C8B093D52348846544E9B15BD443E4B7F4A0493 WOLF-HUNGRYWOLF
889,531,457 *5C8381412270D4270A00EF4CC1F4AB1989B3E686 YOUR SELFISH WAYS (SHANQ REMIX)
889,531,458 *5C86769C412F0513B8A72C5E4E99F36BF54ED4F0 you-say-france-and-i-whistle
889,531,459 *5C894B35992C55DF95A8823E78A2F8416DDC1CF9 YOVONNDA
889,531,460 *5C8025ACCCC6AA69939A9F538AAC454E705FECD6 wwwjenolancavesorgau
889,531,461 *5C80FC6F7C05313A3BE5F484303C64F7BFD14CD9 zacharytheule
889,531,462 *5C895EA5BEAA569EAAF5F508F5C30870A640A18B zackary.edwards
889,531,463 *5C84E1957716C264A561FB436171DC9CC0483E30 WYLES—WHO
889,531,464 *5C87A60DAC9EEF47081A987D2651B36DE499D2B9 ZARINA HAJI ALWI
889,531,465 *5C87273E09D2C2FFF2F23CE9F47814BB0A7E8C03 ZEIG NICHT...
889,531,466 *5C84276695B007C4D84638F7A00A91B0ADBCA503 xfy)
889,531,467 *5C89F11392D2EF168D8ADAD5E8D3102CD29428E4 ZHOQU5
889,531,468 *5C8C6BBF3276373A8912D00B464A7A664462409D [email protected]
889,531,469 *5C86941342CA54F141BD383115C6494B9B4C46DE ZHUGUIJIE
889,531,470 *5C8DB0BE58BB0005A89B07FA4F2693A691DCBAD6 XT169
889,531,471 *5C83C8997979BCBA774F072D8E12E0E21188D2F3 X#WN
889,531,472 *5C80EED222C58F87418420116E180B37A4C53FCB yakti.panata.hutajulu
889,531,473 *5C81FACAF0D7F2DE40D20E4184FDE91F737E3A20 [email protected]
889,531,474 *5C8491F14B77EE22169B0D8A215B1A9B7148E9FD ΛΆΜΠΣΟΝ
889,531,475 *5C89B205A5DDFB640A9A8FD6ECFE86599639A195 yimsueh08gm
889,531,476 *5C8477573EEF4B59D6936999560A0D460F329C7B АРДАГАНУ
889,531,477 *5C8C6CE4B92588B11661096ECBF88E9498A42C9E джомолу́нгма
889,531,478 *5C802DED376DEF41489378056C340BD2AF99C8BE пауэрлифтинга
889,531,479 *5C856CC39AEFA369D98BC970DBE8DF3C06CC5536 ZACHERY.CADER
889,531,480 *5C8535BDF291D8AE29D1E106A640A33CFAB86981 ZADZIELSKIEGO
889,531,481 *5C892B49FB789C417D538C3EB4C58A91EDA22091 тюменской
889,531,482 *5C8265EFA0C9A640153EF034B8A8C078C8F29AC5 ФАРОИСКАТЕЛЬ
889,531,483 *5C8ECAD9C7B121BCB41A4A109F3CF912539634E8 ZAKIR.NASIRI
889,531,484 *5C83071413AA7ABD6F4B65AD71303A348105A274 ШИРИНОВЫМ
889,531,485 *5C80F7116F17AE2CBA0A233B34A1C6FDE3E40F6A ZANE.MENDOSA
889,531,486 *5C8FC5AC15D02AF07E17AB79F6129BF990D74257 zanetuccio
889,531,487 *5C8B619E642E95E63934B323FD302118F61C6DBA ԱՂՈԹԵԼԻՍ
889,531,488 *5C8C1CA8B6453AF4ECBB54558F8968737FF1D57B ZEESHAN-MAHMOOD
889,531,489 *5C834A0185B77D05DA39205DEB97E885A256CB7D [email protected]
889,531,490 *5C823654C413DF0167330B03BCCE12D1E33BFC3C ZEYXMSFMPMN6
889,531,491 *5C854597D785A56278575E0B3B323E0B71AA3091 [email protected]
889,531,492 *5C89A834383B3DCB096D2569B8741A3807A1B4A8 [email protected]
889,531,493 *5C8D38FB89B3FFFC9A35CA538A97961F610B3D80 [email protected]
889,531,494 *5C8415B01EE6524DD11D40E8D947E0BF874A266E ZURA AHMED
889,531,495 *5C8D76CD2AD902B7C98C9E35C23964E86080E3E2 ZUSTERGEMEENTENED
889,531,496 *5C8F613B709B86D6AB0B15C15AF9EC834C58DD1D z"z
889,531,497 *5C81ADDF9A41615671B50D2318866EACE0B1D73D ΜΑΡΙΑΝΟΊ
889,531,498 *5C8288733C923F3C9FF65888D6E445009B5511BD ГЕЙЛ —
889,531,499 *5C8FDA92EBD1531A3AA481DCDBEDA6C5C90DE570 СЕГИСМУНДО
889,531,500 *5C878D211F99FA25CFD1E5B51A59955423B35AB0 СКАЛЪПВАЩО
889,531,501 *5C81BD9849C90847E4669663563897ACD2BFFB7B 1168192 nollakohdan.m
889,531,502 *5C8203EF159ABE38EEC5B4E2B285E88FD9B0E2C2 11 TIEDEKUNTANEUVOSTOON
889,531,503 *5C8AEC27F1CA6B9947AEE533019E275D3EBA397C 12SOLOSTUECK
889,531,504 *5C8FC49BA24CE788FAB8F29EA3BDB692B1528479 1381608 TAIKAPUSSIN-SIS
889,531,505 *5C8B27B12D40C2CD76E5402E28425F417A6420F4 1657433 T
889,531,506 *5C89365DF266A450D05B1E92C58FF9944E068719 ,张靓颖推出了其第一张个人专辑《the
889,531,507 *5C86D3365B4B86F5463FFEA38FFAC2E928A2E1D6 1ba708b9
889,531,508 *5C862C2CCA3ADBD0293408496C5D6C0A5F96EC6F サピン空軍第9航空陸戦旅団第11戦闘飛行隊「エスパーダ隊」2番機パイロット。階級は中尉。27歳。tacネームは「マカレナ
889,531,509 *5C8D7621C0EFE6C6C3B0A80F6827E02A5C076DA7 1.german-organized
889,531,510 *5C8C13C3ABBB997751621BF67F02E0A37DC5831A 1GOGN
889,531,511 *5C8202A62E9EE54EF48410407E65E5C44000F56C 1-HURRISTA
889,531,512 *5C810B6CC765C19B7727242BBBBC8474F00137C4 007ASTON
889,531,513 *5C863D1C1E57AEC58D2224C365A30B86468642B8 1.museumstrasse
889,531,514 *5C824050425E825674C82486282C4DB0BA10EA13 1OKOTOAM
889,531,515 *5C8F8788219063ADF7FE01FFB57D1801D00A0F7B 1poempatrick
889,531,516 *5C8C294440596D018678FE0EB7CC42F4D5C26803 1 POIKAKUOROSOUNDIA
889,531,517 *5C8A3655EBAF50781DB5ACC514DF848FB413B81E 1PRIMEVAS
889,531,518 *5C8C894C7101AD127DAFFF52B869638CD431F63C 1PUNESSEN
889,531,519 *5C8E62F91C150C7104AA3D833CB792F1A1CDEB23 1-SCHMOECKWITZFUERST
889,531,520 *5C8525452790DEE17110195207231906C73D52D2 $0ULM4$$
889,531,521 *5C825BE3C10F58F9D1B7FAAC1A533D12DBAB20FB 1TAASNAINENRATISSA
889,531,522 *5C871C4944468579F860691A2191993370B4CD52 1-UNTERHALTUNGSORIENTIERUNG
889,531,523 *5C82D3E76F3299ED6D4D789E059781359DACAE66 1 VAIHTOHALU
889,531,524 *5C836CBF69D06D563250A86540F2A059CC9D14B9 1230baby
889,531,525 *5C828F12AB677650F2184E95DF6950C7DBACA46D 1.WASSERFLECKE
889,531,526 *5C82C62F4A99672731FFCAA7433C03199F83CCE7 1425408 KUKAAN EI VARMUUDELLA VOI ENNUSTAA MINK
889,531,527 *5C8FB39FFB8AAE62F789EBABA5546FEF2AA8D092 208575 ratkaisu-neuvosto-toteaa-,-ett
889,531,528 *5C894AC7489BA034EC7F98D28B386985EDC306CA 1536678 otetaan vanhoista perinteist
889,531,529 *5C8FDB6477A0CBA18615462B40BE2D34374756C1 20pichenda
889,531,530 *5C804A4B205F4B85FA8FD3E8D6A065DCCF8A2FE4 2484135 "-people-respect-me-because-i-am-cruel-.-"
889,531,531 *5C8ADCAC751044E2E8D8871C4D4AB39609940CBF 25NOV1564
889,531,532 *5C80BB15FEA9C2FAD2DCC92C1625F696E4FDC6BB 1.ALBERTIS
889,531,533 *5C8637DFC7192ED78279FCDECF244DF5B1581F09 2694101 ' aber da ist noch nie was gefunden worden '
889,531,534 *5C8E1FF7201F22A3E327278EFB84714425C385B6 1.ANDRUICA
889,531,535 *5C8ADCE5AF4F216ED341CF99944D6DE62237425B 1-antihipertansiflerden
889,531,536 *5C826410E3BADD9A811E244EC307D7302774ADD8 1-architrav
889,531,537 *5C84086150525F907FA1301CF502D304085A22DC 2780567 und der 20 mark gab
889,531,538 *5C84565311DCADAFB2EE3B88AEB3E0D27991DCF7 1BAITOO
889,531,539 *5C826628472CAB6056CED4CECD5908998BC34E2C 1.baour
889,531,540 *5C8E8F5979B67BBA05DAFCCD3CE8422FD175BF1A 2892874 kuinkamonenviikonp
889,531,541 *5C8A2DD24BCF1944BA198C04F1E4CC80CC590E66 2900558 anybusinessthatwantstomoveinneedswater
889,531,542 *5C8DC474E029AD5B03B0E5A87ED6CBFA22534CC8 29.05.1380
889,531,543 *5C8A9CD3596F8FEF922A1D23E9F6F80E61F65BA5 2ALAERCIO
889,531,544 *5C8C5A2D1C7BB4887AF7BD76606811AE57A73EBD 2ASKAUDET
889,531,545 *5C8732D7C1CB10ADBCBB26F796272B91C606F955 2 BIRLIGIMIZCE
889,531,546 *5C87E30DE6B53B739018EFC6740AF5F27B691EA6 1-discitron
889,531,547 *5C8AE5C9057CD3910BBE2A3B1B8218A195C9ED2F 2bplanned
889,531,548 *5C83994637197B87ED2C1877823EF1A6343F2831 2.DIEETTINEUVONTAA
889,531,549 *5C82DC2F11E52435DA26ABA96CB062D8CF133F73 1.ERITYISOPENA
889,531,550 *5C8BC1F0BA7148268AA17854DE1EA72319D4F62D 2-energiataloudellisempi
889,531,551 *5C871EEA902D3166EB0DA986A62AF518CD37C3CA 2iluvphillips7
889,531,552 *5C8B56D556DC687AC171F1192446FCEABBB5C86A 1 HOENNIGE
889,531,553 *5C8C429F3C98E35D7AA4B359FC84CF062ABD3CA8 1 HYPOTHEKENGESELLSCHAFT
889,531,554 *5C8BE262D8657A8292D6B16872BD48C4ABD95A55 2-KULMIKKAASTI
889,531,555 *5C88AB2C459CD2FDADE8F37EB4327F63154D530F 1.jumadiloville
889,531,556 *5C81B6C06BF846570C24CD49AF03CEC8F5119DCB 1.khs'nin
889,531,557 *5C8DA463BF5EA4FA30475873E48D967BDB0C2F70 2.REPARATURAUFTRAEGEN
889,531,558 *5C8097C46F643B927F5072A0274F6BB6F74880A4 2SEDEOBEB
889,531,559 *5C8E09C62DF330C54A002F56D9C0C12D6630926A 1LEBENSNAEHEREN
889,531,560 *5C860D0E2014FEE282622BC076F579490007E3E0 2THATCHAMPION5
889,531,561 *5C881F1DB8417F2F11B226A91B46386530874C38 1-mietiskelyss
889,531,562 *5C8E8E32D660F41D5C01C9AA24290670A420DF8F 1-motorbauteilen
889,531,563 *5C83B14D3269714F2F72D66F2A7AD6DB6858785F 308mia
889,531,564 *5C8A38148FC6E8B227B93A7DDA9C333B0A8333DE 1pervwhich
889,531,565 *5C839A742FAE78DC95FA2B1790499043D9794CC9 1.RAVINTONNE
889,531,566 *5C81B8832555E9D2D803FEA65307D879CB326DD6 3 BIENIEK
889,531,567 *5C8067B5A2607DE74E33D12E8033D81F1A716AF1 3##B`~.}O{
889,531,568 *5C8916E59D2A4450FFD2C5EB50FE5BE2E6E0AB4B 1seisukohtadest
889,531,569 *5C803D8B3B3D4CA1C822CD981B941494BE695351 3----p*-*;)
889,531,570 *5C8855D52F831982FF88E55AC6EA69E5649D0282 1-VERTAILUIHIN
889,531,571 *5C8712D9B08772AC428E55DAC11C4F2660C83DF4 3SHANIA
889,531,572 *5C8AFC2E0DD446826341441960AF1EA8A630AE02 3.ultrastrukturel
889,531,573 *5C88298AEFD2E64B855F500E0BB060B27DFA612B 20COMAS
889,531,574 *5C8AA6F2B303309C34B29DD24564310B7B7010F3 20Oct2001
889,531,575 *5C803904D230CE417E5B1F07EF82CFF57A50CFE7 43821 miten.jaksan.t
889,531,576 *5C8078309F89F0DD62B82D0A3964A34CEA7F5D40 43b31a0681a1f7aca42ff30f5832b2cd.sidewalkbam
889,531,577 *5C8384A53F2929A6158F6A943973DA8A967EFE89 449553 muusta kirjallisuudesta sovitaan opintojakson alussa
889,531,578 *5C851EF49833A1C9A01D980BC7E19F983DEC9110 454013 no exact location has been disclosed
889,531,579 *5C8AB2EF3AE1AE9E70B0CBA511A0650606C7E441 4ABARCANDO
889,531,580 *5C8E59784EA8181A69819DE1FC3DF58C320A7751 4ASNEEHIA
889,531,581 *5C8635C8CDFE3DFCCD33344C062E06657AEA7F3E [email protected]
889,531,582 *5C8B5B231CBC5B22BB1EC18A6ABF893E9662BCA9 246422 muista.,.ett
889,531,583 *5C8DEAD03A49599D6ECD953C5AFE10A5A68943A6 24 SUORITUKSIAAN
889,531,584 *5C826AB2DDC35A76F88EAE7DDC1352E6A3A17644 25.valdez
889,531,585 *5C8B30A5117E5349188E5B4DA64498557AD5269D 2698689 kolmannen er
889,531,586 *5C89463DA6FA99434C07D5660A1C431A63BD4D71 4kgyrtqfc7t
889,531,587 *5C88B70DBCDB50FF3A17E25A37FDB37403465A39 4MPHIM4CER
889,531,588 *5C831CA97756B46F66DB613ED8FF49A6F4AE3803 4.muite
889,531,589 *5C8E4A10CDE3841369CCB013AE474501266C5865 4NCHAJANYAH
889,531,590 *5C8293B740BC71175580E2B31CA896C595D8F01B 2907946 A-LORIMAR-SPOKESWOMAN-DECLINED-TO-COMMENT-.
889,531,591 *5C818A1723BAFF7B2BF0BC4480A5449849BE541B 29-ELTERNBEIRAETIN
889,531,592 *5C8C0FB39419CCE100BD3BE5E460567DA22395AC 2AFZWEERDERS
889,531,593 *5C88D86EBB642F782DF0AACF95CC1D14947F2B67 4PPR3C1471V3
889,531,594 *5C8EB4B4E051098E8E9A54DF4C8F52F087B3C141 2.CTTUTKIMUKSET
889,531,595 *5C87FF456F52F46529E7C06D365D85AFC0FDAC75 4SEJTELLIUEFETROP
889,531,596 *5C86BF0EF5CB90A49731282A7572D7C8A7DAD149 2-EMD-STELLENABBAU
889,531,597 *5C8ED1BC8119B9FB50766F72ABB03007ED8EF8F4 2fpetriolo
889,531,598 *5C86402A73039A6D95EDE6A8FA7715D932BDF2ED 560586 lohkosta selvi
889,531,599 *5C83B3B8B3DFFB17267D75A7EDDD7FFBEC352E28 570-clutching
889,531,600 *5C85FE46CB0D7A98D68CA39316596B81903DF0A1 2POEBLER
889,531,601 *5C8165F50F5217A13F9E286D4C806780F22160F8 2-sarastukseen
889,531,602 *5C8070A2DD492055F3A6EE9D080017344EF8B7C0 5ARCHITECTUREH
889,531,603 *5C88D96BEF910A88BA312A0FE812449475CA7FF2 5BOUAPHATH
889,531,604 *5C82A26D89EF3770AF86838D7F505B13829C1833 2unlapped
889,531,605 *5C8B3E95B6ADEFB740DFD2642D5B05F008D33547 [email protected]
889,531,606 *5C8904FAFA2B35CEA20C62C32A14E8A4D98F23B3 2.wirteausbildung
889,531,607 *5C886DEAD56860228B0DA0C0BF39D6A8F5C4FA3B 5CR47CHER
889,531,608 *5C82A0D16C682AE119E4747C459C70AA71398E5D 387613 still , they have it easier than most
889,531,609 *5C8962E425FCCF9466A88464791BCA456D590D16 3881349ZYC
889,531,610 *5C8459CB609430DCAD45D23225DFC592B0C08453 3b<- ` d=====b
889,531,611 *5C87A194A1CBA4FD71A1E9A919B5EA1DD3E44BDB 3CH3L0NN41T
889,531,612 *5C8E268691E8351FD2B32D9D05E6E5BC78D4FC0D 5MEMPHISCOWBOYS
889,531,613 *5C8F7327AAD0524408352DCD2A67E85A6128B85C 3====d~`splat!
889,531,614 *5C890F591A18695BE37BBF1EA98C44B78E6966D5 5PAGINATU
889,531,615 *5C80AB7BE77DC751DEF90235699C98B081D11054 5PENDANDO
889,531,616 *5C889957FB791EB571543CB367B2D69402AF2294 3HAMPELMA
889,531,617 *5C89F217726097750F91B7AF9320E7CF395D2A45 3HOMOLOGON
889,531,618 *5C817243EAE9BA638F616DC70C1E95FD745BBB98 3JOERESSE
889,531,619 *5C814BA2DEDE5A8D604E4105D2FFAD732D9D6349 3-KURSSIJ
889,531,620 *5C8C43B2232AB8524FB63100C08C0B8B621052B5 3ND0M0RPH1SM
889,531,621 *5C8844DB7A90A4F63EBDC9C2371AC65C5020A87C 3>~O~OO><
889,531,622 *5C83C3F3382142ACB0253585EBEFF6A750D53AC9 3TO13$
889,531,623 *5C8EB7A54AF47C7F1776BE6E8E879F6382197B3B 615ESPERANZA
889,531,624 *5C866D33441737A7358A4ACF210750E8F91149E8 660174 NUN.SIND.DIE.TEXANISCHEN.BAUMPFLANZER.SAUER..
889,531,625 *5C8F0D4C3DB2F1FB142AF1DA43100410CC81F81F 696114 MADDE 32
889,531,626 *5C83E455655D038BC96EBA2B1C2E3D0462B524BA 699A9B32BBF5918206F054DA1E18D132-TONTTITQ
889,531,627 *5C8D36056E0D2F45F2161D6535030D24325BF21F 6aug1386
889,531,628 *5C881576D9686FED9C2B02ECA37EFD662647FFD3 6DETESTEESES
889,531,629 *5C8F87512957B42D36BCDB3BCB34883120C5090D 6DUCKIENISSAN
889,531,630 *5C8910887E87DB4038CA3289E84E3A69069B7078 4JEFFREYMOUSE
889,531,631 *5C80EB453FDF86614FEB80F852639FD250D16B7B 4MALAYISESES
889,531,632 *5C80855DA474EF92156FFC4F5AACBCFB78FBBF7C 6IALEVIR
889,531,633 *5C898ABE2B9BCBC94420ED02EDC3AEBC20461C53 6IVDALLEW
889,531,634 *5C88ED9DFE8892E370CEDB27E25DAA4B9FCAA9D4 6LITIGIEUXES
889,531,635 *5C8491EF4DDE5FEB8DF6309146B623D9FC3FCDAC 4SUBENDOTHELIAL
889,531,636 *5C8ACC52EF014B90F75A9E5258E522A969E30CF3 4-TELEL
889,531,637 *5C8F351B046C91819B67140831661C59B9A9E9F9 6RUBYJASON
889,531,638 *5C8158B726635CD763AD5B5C7D75085692EA293D 4VRFRTLZ
889,531,639 *5C8420FF8DF188E86CD188FBACFC7413B86C9F65 6USLIJEDILA
889,531,640 *5C867888BE2D59FECF750E1793FEFA17DA56EB20 6VIPERHUSKERS
889,531,641 *5C8B4D0F57CC2934AD66E78AFE6A001733B08393 '58K!O
889,531,642 *5C8D6C2B9737EA0BCCB551C3ED886712324BB176 594130 HAVALI KEMAL DP MILLETVEKILI
889,531,643 *5C8B8C7CC76F739D271D677D4B5AD81C76A924AF 726242 onaikaheitt
889,531,644 *5C8658A198B50F928CFCFC0DEE8ACFEC10CEF003 736192 SEINEMESSAGELAUTETKLAR:RUHIGSITZENBLEIBEN
889,531,645 *5C8A6A31BEE16906E2E2594C0CB07F7A39044596 737BDF2C50995D2DA864C4FEA87BF90B STEVE56
889,531,646 *5C8AF7DB59F4097D2BCF538616221981E731C7A7 7AFERACH
889,531,647 *5C8E07C621788C4CB44D51FC7E1ADC39DA69EC30 7ALONGSHOW
889,531,648 *5C896705B985A503B36777E5EADB27974384CA49 5BULLETROY
889,531,649 *5C86BFC899C7FEB0DF9550BA8559535979D3695F 5BUSINESSSAMPSON
889,531,650 *5C8AA57086A4D7345C1581DC3AD53335D0520951 7AUSSTELLERFIR
889,531,651 *5C81D6355717518748C70F45C5D824BAEE2C96C9 7CSREZNAP
889,531,652 *5C861284012D52BD41EAE4C883B1A7634F1A320A 7DETERIOREREZS
889,531,653 *5C8063A11FC9A45F19406EC7812B4E326E2387B2 7DLAMINI
889,531,654 *5C8C5B4378EC6B0F2FFA52818D406A754ED644A3 7DSHBLLT
889,531,655 *5C8D1D8935DBC3B8C9694190DA7FB2252AB4C9BD 5INCROSSES
889,531,656 *5C88A4008F47B4EEAE57D5AB05452443418EF60E 7JKMCINDY
889,531,657 *5C8CEB220E887B79E399DFAB890B140E9B1A94B3 5NANCYSABRINA
889,531,658 *5C8E5C37D5ABBAD123427878A4820FFDB32AB50D 7NARRESTREGER
889,531,659 *5C89ED5177964E83494F00D626742DB58BA3785F 7PRAESTAREMUSQ
889,531,660 *5C86F82B7F01D445ACDDD4452EA1AE547A325125 5thetapani
889,531,661 *5C86447A0B6C164115485BA0F02DF13C3E67A509 5UMBLEBUM
889,531,662 *5C85426A50CD3E25747EE69E6A743C29E4681053 7TIGERNICARAO
889,531,663 *5C8600200AA44DD755EE01DAF7827A681D083B85 7TOONE
889,531,664 *5C83DE3A02B4315ECB1E5A47712734AC52D33144 5.volama
889,531,665 *5C827A04359AD7536D233EE14FC112EA69EBCB2B 7UINDIANA
889,531,666 *5C887F62BA854BE13D594A8D5C83D64867ED5F4F 658262 TEE PHP:LL
889,531,667 *5C8ADF7F8AE6EE939A95E74FE0C5FC5BBC86D799 6APBUTTED
889,531,668 *5C86963764A37ED7093E43310D3FD7F80E9C436F 889740 turhan guven ( icel ) sayin genc'i saymayin efendim ?
889,531,669 *5C8A7915ED863ADE41EBC6BE2158D7430B95CC75 89 LUKUVUODEN
889,531,670 *5C8D365AD4ADB67410877EB49F6AB53A1A78A9BB 6BSWWARMBLOODBSW
889,531,671 *5C83FC1639E16232EAB9617ECBA267D8A0448D7F 6ELEKTRONSKOM
889,531,672 *5C89D7A4AD1547744C21B48A14CA75E0B90124DD 8CHEESEDYLAN
889,531,673 *5C8056D942D57A46EB05EAF27C02E14658270BD5 6F38B420
889,531,674 *5C87F93F7842B7760F7C3962D8AFC7FF62F01B86 6GALEIPROEF
889,531,675 *5C8EF78C8AE5C46D2F161A022FFF54B418F8E90C 6IAMJACKIE10
889,531,676 *5C898D680074DCB8C428FD1F2DF441EFB9DD58B5 6INHINHALTENED
889,531,677 *5C842A674F9EB280B378DABF8DD58C4AC80D1DB5 6monstrousness
889,531,678 *5C85436F012A817CA18B07A4377F81A768473917 6ODNACITA
889,531,679 *5C86C464D82DC53DF3CB8E3DCB27078679917763 8MOTHERWARRIORS
889,531,680 *5C84433014E2B0B6A04632483F36F0CEA46FCCD2 6RBERGEN
889,531,681 *5C83511376121DC108E6407614566A2ED4A1DD8E 6RETOFAGSORDNING
889,531,682 *5C88B1BE92F393E6CA14FE9C3AC95BE053228424 8======>~O.~O(O_-)
889,531,683 *5C805BB8D324F746FE1C83F38063B2D451AD6780 8SEITERCS
889,531,684 *5C8CFBDEF74073D5B122DE3FDDB41799268ADDEA 714007 EHDOTUS.KUNNANHALLITUS.NIME
889,531,685 *5C8F861F469CD0D47231859D2C397D6016D36D45 77-BRISCO
889,531,686 *5C85771AA092F71968035283E2B115FFABA9186A 8UNELMOIDUSTA
889,531,687 *5C8518E3E47F861750BA65D1AD84D4D5AC49B86E 9AGROVID
889,531,688 *5C8E4CCDCBBB4D623839DF21154478764EA797EF 7EKUNISOK
889,531,689 *5C8599193933E850677BAFFD4625BDBC78D4063E 9APRILGATEWAY
889,531,690 *5C89A4A12D5F3982EC29A5DCD60B95FD0E70DA83 9beworrying
889,531,691 *5C8D65AEAFAF39A2F39821C3D0FDF945B6B5BD3C 7HADROSAU
889,531,692 *5C8E959AF83A43446CB9F35FC9116FE5610C9744 7IGNORANCENS
889,531,693 *5C8A477C745DCA473A1F4E91B541D5967C1EE7CD 7ILUVBOSCO6
889,531,694 *5C87E947C0117D2FCDB1E02DDE115F2E281A1967 9EHGEWERR
889,531,695 *5C8B71E30B45E688762DCF6397E1CBB5F32DBB79 9GNINPPSD
889,531,696 *5C8ACC9064DDAC2B47BCB77301A3D8B326BA569E 7NSKESEDDELEN
889,531,697 *5C8FE026018DF6FCB2343E332C7FFEBDC4EFCF4A 9JAGJEETBSW
889,531,698 *5C8A3E706ABF83861469E39722131083396E93AB 7PHOTODIMERISED
889,531,699 *5C88CCAF2DBDC6B4D23BE4BFD3E89547A9815B3D 9 LADAA
889,531,700 *5C80AEBFC857BDA10012C8F0F7C719238BF128B6 7ROPAEOLACEAE
889,531,701 *5C836FFAC235344B9A8A3ECEE42EEAC996F14A10 9moederdag
889,531,702 *5C860CA2FFB82E2E026157638B3B10117AE63269 7WIRETAPPINGEARDRUM
889,531,703 *5C8A6E0488680BB880590EF109016EC0CF024C01 9SPETSWOR
889,531,704 *5C89F55FAF6C9DA8162D29835BA444D8A2C1D4B3 9STIDJELI
889,531,705 *5C8610BC5D2B5942C568255E685E9701765C28CC 8ASHAKYATAAM
889,531,706 *5C8736E8627DA0B4BE79A609FA2A8913810D32B1 8BSWOHCNARBSW
889,531,707 *5C821F32E089D3AEE5248C69F2DCD3227E0EDEA9 A1BAS
889,531,708 *5C87AAD91B99C0FDA9D695B56EC75AC2269D43B2 8DIAMONDSAILING
889,531,709 *5C8CF6B57E5C05CAAB31B9504149D98D55881267 A2U=
889,531,710 *5C81AE3B290207A82F7A92EBBDBC220E3549E100 a-6n
889,531,711 *5C80D591A4E74E107B3CCED406432E5735B93406 A8OHS
889,531,712 *5C85103A9FDF0ACE0CFA17ACE334A62C3073FDC1 8######P.*.*.*.~0~OSPLAT!
889,531,713 *5C8FB0048F56908BA038144FEF964453BC43451A 8PBOOTHBSW
889,531,714 *5C83ED4C2AA324ADBD7CA0B85A0293EA61CAB5E1 8PREOCULARA
889,531,715 *5C8CFBD10599FB9E197C1FD4DEC3524CB04A6665 [email protected]
889,531,716 *5C83DFD94750E7D7DF8C3E2B276CF52574C32DB1 AAAD"\
889,531,717 *5C8134F611C9F31DF144ACAEAA78DC9A2862B93E AAB(<R
889,531,718 *5C881C03EF6A5D708766E8C9A1017552520D7B65 AAC.)
889,531,719 *5C83A1C63B7B3A5BBC76B798A5C40068CE5457F7 AANEU
889,531,720 *5C81A2CB9A44C1D672BE3317122CFA47E034EBE8 9FRUITFLY
889,531,721 *5C8B36EAD367F4586DC9C29E7C40EBF4F4DB41E3 abac
889,531,722 *5C88CC854AD9F349168E0D86E93041034F4D61C1 [email protected]
889,531,723 *5C84B96336069CD04B800AB5423A256B98B1A5A1 9OLDFASHON
889,531,724 *5C8E87AA947D4A7EF1D4BA08DA8FC99F894215D2 ABONNEMENTSBETINGELSENS3
889,531,725 *5C806AB99E74D5D86A0A35A9864EEDCDF838EC05 9-persoonassaan
889,531,726 *5C8260561873AF1CE98CF8D94CCFED483124E392 abrahamfegurgur
889,531,727 *5C80E160FCCDB19CB07C917A36C90E7F9B90356F 9SOOLOCEMBALOL
889,531,728 *5C8B891DD60F1FEC1FBC4CA892FD3DE7F05A458D 9TRUUBNEK
889,531,729 *5C8B65E7A37FD9CC49214915597008E46C2E9347 ACCOMPLYING
889,531,730 *5C86B7D16CA7630CD3D067877600D49171168089 ackm
889,531,731 *5C8EC5440476150970CB24F1C769CD8306B1EDC0 acUE
889,531,732 *5C85EF76C0F98B6BB5717B90D0952405146668D9 ADALBERTO.FEROZ
889,531,733 *5C8E6AFE2D20D09262BEA922423923487ED443B7 ADANRIEVE
889,531,734 *5C89D7B4DFD15483C7A80A819724E67A29C7C75B A+#4
889,531,735 *5C878D0FE063F2131A13A112EEDCC028178514A4 adfrfbswed
889,531,736 *5C897ED43FAEA51BD9B2F8DADB44F2ACF3DEE981 ad;vc
889,531,737 *5C87E21FB4303F2F6D47FB0B59FFF4AFD3F5B2A6 ae"e/
889,531,738 *5C8217C76B14F610A7178B2B2D37BCFD8B1D5046 AABD<I
889,531,739 *5C8A39772570071AFE6ED592955B4407B5BA9D66 aadda<
889,531,740 *5C87C1C818CA2D97FC68A8BA155039C20D58ABF6 AGUSTIN.CODAZZI.CARTOGRAFO
889,531,741 *5C88BA63316E55E70D7BCFE09F346EEF9F3583F5 agx5u
889,531,742 *5C872E514A7CE853410AAFDF19E169F145A42417 ah&$
889,531,743 *5C8F890AFDD848A414F816797CD036EAD45002A2 AJN+
889,531,744 *5C85FD09353C9B26914A7E98588FEB7096E935BD a(l"=
889,531,745 *5C8CEF24AC9B8F063054ED01EF2CFB55CC980441 A.=L
889,531,746 *5C88ABF5314345B18E155A8B3ADE5DEA674E2417 absolutistses0
889,531,747 *5C8A6BADBF03F4A32FB2DC152B4FFF2AAC47F42B ALAN.WILMES
889,531,748 *5C890968A026A80C908B143B7A23677B1FA4C37F ALBERTOSONSTENG
889,531,749 *5C8B44E5E72801E116CC9CE08CF938B414F4562E Al.carajo
889,531,750 *5C8E03BF45BC7098DE98C6EA2EE0F60877CBC2D0 ACC5T
889,531,751 *5C805878FF8350BB767402715FF096B1825E3FB7 accusted
889,531,752 *5C86DC864977A44B6729CFE7B580C3ED4185936E ACTIVEADAM
889,531,753 *5C8DD5ABFD043FACBB9EAF20017EA0188091209A ADANTHEUS
889,531,754 *5C828470D5E77C5A58AAB366AE3621991D6BD783 adgeesgvc905r9t7
889,531,755 *5C805D3E88C9E73761A64F16039B58903BFAE000 adolphbodway
889,531,756 *5C8CD6F2504AC0F0C82152E501DF086499622343 alud6
889,531,757 *5C8F9BF4E59BC588DFADB7128BCEEF0E3AD7C154 a.elena
889,531,758 *5C8CFCCE62864745BD6F14AA05D6148570209CC6 ame).
889,531,759 *5C8ACF4DAF7EA26AC0550F81C04DDFE8DC7EB0C0 andersonlonghofer
889,531,760 *5C8362A75D25780978B76D1ED3091757034BF133 agp-c
889,531,761 *5C83CDFDC0BA8EEAA19220EBC0694164E2962C7D ANDY.EBERLY
889,531,762 *5C8E89280C5B4832350CF48CF23FA59E268BDA25 ANEWORW
889,531,763 *5C80BB4234F6A9C185D9C1EE0DE830C178368F89 AHIYY
889,531,764 *5C87FE9480803C43855A55A8C744F459266999A6 ANIMAL:BERNARD
889,531,765 *5C82BE21064E4E11F5BDC4CF08DE97F1BFBB31B6 animoidbsw
889,531,766 *5C8A576BA3C3FA4A6D65C18260D2CE5AF667EC09 ANN.SOULE
889,531,767 *5C8ECEA8BCC8D8BB8BA248834D40BCA5CA15FE5D ajbrooke
889,531,768 *5C86A38EBEA111FFDC25F5AA4847B836A24FAD57 AO,R
889,531,769 *5C83585966AC5CEA2DA10D1B72482A2845AE1847 apoozmimi
889,531,770 *5C82558BEBE894B5BEF148657329F461D5BA9F37 A;q&
889,531,771 *5C8A2B14023F8915F0DE6C61783A97A28B1BA65E arbi7ra7ed
889,531,772 *5C8DA0CEF70697644A31D7AD1977129B56F05C12 ARLIE.KLIEVER
889,531,773 *5C892F4A6D019D555B8E1E58F3F9AFDC154C1B20 ARNULFOJULIANO
889,531,774 *5C8D42BE8646AE07A5727AE983EC4538F429A08C ARNULFO.RUGGIANO
889,531,775 *5C81CA99DFF27ABC24D60CCEFD5EA968ED2078B5 ARTICULAD3
889,531,776 *5C825AF7D95450830B3F3A00EAA054217C158EBF ASEEM JAIN
889,531,777 *5C8C7D1EFEBC4065D49432CBB2A03E81CDF32AF8 A/MKO
889,531,778 *5C8A3D0EC7C16E904C64DFC3076D20AA2881CF1B assasin-cross
889,531,779 *5C89DE794A56A673FAF9B0F89B1A5E8BE3B033EF AT777
889,531,780 *5C8949E41B9CAE81C72C8BDEDB9577CCCA570C49 ANDREAS.MASTRONARDI
889,531,781 *5C8035532378EFB17874ADE1AC7D97141ACA8823 andrew.borda
889,531,782 *5C8E0EC5133939C1DE783E7E7FCC434C12A4C7EC au;jr
889,531,783 *5C8F2C16A70CB4D5BEA9B52F21B35320FA2A4846 AURELIOS
889,531,784 *5C8DAE376F40D6EA8E4C209A76F8CD1B39E044F0 AV7&6
889,531,785 *5C8D55EFD2B2DD5B01760BDEB7E257ECAF992FF1 aom4j
889,531,786 *5C89DCC9CA4174DF9E9BF75DE14AEC9882FF2A3F aproden7
889,531,787 *5C87E627A33DF2C662D16B2D578C907BFA1B8652 B0KR2
889,531,788 *5C84D6B1CB7D9F90141A44A9075F3D173A4A68C7 b,56=
889,531,789 *5C840144329E21B0CD32925F54ED650C1C00444A A-RQB
889,531,790 *5C808BB62459822F19F46EFCBD20C798CF83C24E ARTENIS5
889,531,791 *5C810C0EB0F1C81A35B984D22927FE7942FBF86E As4(
889,531,792 *5C8BD5A99356716BCA86333A6BF50B3623BAB14F ask4/
889,531,793 *5C8269FAE125B89113B5E97784383E8F6350FBDC BALBINAGONZALEZ
889,531,794 *5C8AA371288078772B177BA2A7E81D017C0E03B6 BALLAVAN5
889,531,795 *5C8BB4298DF543F362B539DE8CECCDD5FDAE69F2 aubreyheller
889,531,796 *5C8AB2C6E78EF6EFF47083ED43264367BBCBE6BD aunpt
889,531,797 *5C80B23304C17A3B8CB4B5E27076F4E25DDFF757 AURODIAM7
889,531,798 *5C8A1C253B9FA79A74B7F70289B691ADD4DD7EAC AUSQX
889,531,799 *5C8D66507CC46BFA0D19E358BA0C0B95C8550729 AVENANTE1
889,531,800 *5C869D853B750C79ECB17E349FEFBC3F3277B5E4 BEL-AIRE
889,531,801 *5C8E568670425C1FD927CE7A1AE7C83DB248DE42 bennyhannam
889,531,802 *5C8780234C81C68D8A5421951C79D66B0614F6B4 b+$0y
889,531,803 *5C8608C68B475F9A29964279A5C3A7346109D9E0 BEPATIENT9
889,531,804 *5C816CC13A5B36ACB20E6AA0FD845FF6C2206AFD B1BP(
889,531,805 *5C85E6F21E3F706FD16029BA35CED2F16A24C47D bhk"=
889,531,806 *5C8F710511AE719B4A9ACDC3441D6E7E2AA848F9 bafflin9
889,531,807 *5C8030E58B66E00E2F2DEE8EADA6E1AC64273E7B BAMCHANNEL
889,531,808 *5C801FA0D76DD71D2F77611F6ACB718AEEB1F7EF BARTONMCELHINEY
889,531,809 *5C87E988D9D6518D209D7D6D0621189CE5D7E245 Bj8o
889,531,810 *5C885D4134337121B12E4E9B3981B1469A8E4027 BBDNL
889,531,811 *5C8E12BF822707FFD8B69BA8CB0B14D474D0105B Black.sc0
889,531,812 *5C816AF207E8235E1E212DE9FA3F6AEE46F51524 bc1hk
889,531,813 *5C847B31224A8CD022DBC8A7C5DE36CB7A22E0D4 bc+b
889,531,814 *5C8AE2B83D8CCA362D0718F907A38C725F0B3E33 bcha
889,531,815 *5C85B82669F24B6CBDB10EA5A6B730DA1BACE4C8 Blushing.to.be.encountered.with.a.cloud.
889,531,816 *5C874CD0C1A3A3C8E79DB44F683B82680028B355 b)lv
889,531,817 *5C87DDA2C30A9193F5701E3A497416FA1CD2370C BMN!K
889,531,818 *5C82820F209EB9712C61F1184DFC5D0A0253F169 bnwsf
889,531,819 *5C8D085EF6A86A971B01602F08F327380C74976A benfraise
889,531,820 *5C83E0EB4ADF3D4D48EC374213B46B509076C942 BENNETT.SIDERS
889,531,821 *5C8D97FEAE5B5FD20FE8B3F398377B5F37B4E6DD BENTON.PROVENZANO
889,531,822 *5C85F1587C6823F5B4DD2A3AA26C614B87F72904 BENTON.WAR
889,531,823 *5C8C5E793925FE03741398E0180445414A9F9F92 BERNADETH.CAMACHO
889,531,824 *5C88ECE57F6BE1DA9467E26D1CEEF1BB2E418E0D bookmoral
889,531,825 *5C8CB7CD67DA46E23A55D278B34AF95283CA2A8D BOOSTAR99
889,531,826 *5C884EF9620C12D41BDFECBCAC63B95B3B07E472 boq%&
889,531,827 *5C8C9CDECA4A954BBC5DB4D078D92C004EB91C9D bettie.carroll
889,531,828 *5C8E5F13EA6CA872378269CDB190D9BE9CDACDD4 bostonnuevayork
889,531,829 *5C81C7ED43B827D50ED7C3B3CB3B8DEBE665FA30 BOUELATA
889,531,830 *5C8147C65C8649E3AEEE46F7394CBE54165BD067 bf0_j
889,531,831 *5C857F2B136B6FA83BD500247563550EBD55FA37 BOYDTAAL
889,531,832 *5C829D5921E5B0B2B1E6806877E8FA096804307A bfgs!
889,531,833 *5C8715AA1162B5FAF478F5DE2BD407A64D82B73D bp/3f
889,531,834 *5C8378A52076421CB294FEE138E452F496703769 B$P5N
889,531,835 *5C852F68DEC9014A0773687A6BD9BC795AEC7B4B b---p-`~-`~->-b0
889,531,836 *5C8AA72D5F5E8A53B5BA1E9491C1D2686836FE18 BPD.4
889,531,837 *5C8F8ADF50DA46D8B4D124312F5E1BAF55096E39 B$IAQ
889,531,838 *5C8578209657E75A87579035CD94D32ADF3FFACB BRANTKETTERING
889,531,839 *5C8FE67458C658C7B14F47E8DFC24D99F5F12CC7 brendonlerper
889,531,840 *5C8E8CADF3973E40614A9D8D9B18248D22F5FFD1 BINDESTRICHARTIKEL
889,531,841 *5C8882C91528025DE4376C00E14381B6C1118193 [email protected]
889,531,842 *5C89CF1CDCA0591A32990E9DC68F59007F11E45E BRETT.MERRIOTT
889,531,843 *5C8CFD0350945EBB4D6DD4DECE74F5FF27F4D94A [email protected]
889,531,844 *5C833316C439D23998682AE516AFD01310438E32 BITEMESHOOTER
889,531,845 *5C853F2EC9F22E61113577B52FACB492D5B529B9 Bridget's.Theme
889,531,846 *5C8E917841BA19CC92C3DE99CF08F71484D94A6D brings3
889,531,847 *5C88A16EDCA12FF7E2502CB55D5F412BDA5F6456 bk$#
889,531,848 *5C8B71EEB0F60526EACE526546CBAF24F3D10241 bkkps
889,531,849 *5C8DA441E9B9FE65F07AFDE994B48605D31364BF bkok%
889,531,850 *5C8CDC4EDC05703E12CFEFB2761876E220950ACE bryantlennan
889,531,851 *5C859C2435D1B984D19E1C738031A3289592C410 blk&m
889,531,852 *5C80A1ED28E19A036152732ECAF28071C9BE614E BSWDANBRBSW
889,531,853 *5C830E78763AE62ADAF37715BEA2442711B8FC88 BSWH:
889,531,854 *5C8362182922C4E8F1C5749D8F1E08E1E5850EA7 [email protected]
889,531,855 *5C80A32E28E715C59AE0889EF2F26CFD54463F99 bm!/
889,531,856 *5C8F621F4B1B0D231C6C0A87522A6799392BDE79 BOB-KLEINE
889,531,857 *5C85D26480D47FC05D031C7F77C1762B3FF477D8 bookofmozilla
889,531,858 *5C8EA66AD9F4BD0BBD596A15913AD0A961E073B3 BORNHOLMSTRAFIKEN
889,531,859 *5C8D086BD243CC26A4E2828BB79BAAA0E373B3F1 C1HKN
889,531,860 *5C86DB195E0160B5A985BF5CE1195B9BBE5AED77 c2d?4
889,531,861 *5C8280F3F3E1A6ADDAE633F90F7F79A439A03B05 BRANDONWOLVIN
889,531,862 *5C8680051B0D0AFEC67CE6A0D99BEBB65D7CAD05 BRANWEN8
889,531,863 *5C8E925C69EEE79C0440C7C29B91DB4E83E429F5 BRET.HARDISTER
889,531,864 *5C814BBAF42258C70A19130A02766CB2719B6342 C4RBON471ON
889,531,865 *5C892CB0739AF3F00AE51D2DF2412AC76850ADB9 C)A_2
889,531,866 *5C8ADE4399834397C72277AAC88A36E2E9CD542B [email protected]
889,531,867 *5C8BA83D5163E1FC5F67B4FF6678432A2F2B28A2 c;aau
889,531,868 *5C8B7129C3D3B2850C063251BFABBD7672CE9694 BRYANENNY
889,531,869 *5C8B6C8FE4838CF872B47EEC08A895A6E28B94C3 ca"dd
889,531,870 *5C8485BC3789E9CABB04A8C381B4E44E777109A9 bswwriteintbsw
889,531,871 *5C84B5DB259C32E147B71D8CF66623CC1D74895E BTLKN
889,531,872 *5C80597E506F91E708E96F587CF1EC913112EFAC BURNINGSENSATIONS.COMWWW
889,531,873 *5C82DF9E6958BF6461C17922C9A7A4D2C9036D48 [email protected]
889,531,874 *5C8070DBAC3AD764F11A1C432399CCADD789F145 CAROL.PRZYBYL
889,531,875 *5C888C84529F156DF69907D1422343B20F9EF190 carrollragno
889,531,876 *5C8EC6A949893F7AF35A3008F696AD6DCFA11FD8 B=W+O
889,531,877 *5C89879FC4430DD33BE77C43DFCBF2AC47DA003E [email protected]
889,531,878 *5C8D669577C66DC30178F255376669FCBB52E6AF BWSWZ
889,531,879 *5C8967D913E8E14A547F7FB5D8D67C2C35966E60 c/$1o
889,531,880 *5C86FC03B964F4C6FD2F966ED86A846001463798 [email protected]
889,531,881 *5C84675DAC6DE57CC8AD395558F5E088A6E67FD3 CE1EBRTES
889,531,882 *5C81F4F3941BAEF3B74F8A3B30BC477F55291AD8 c2'x
889,531,883 *5C82AAE9867D8D82F0932D72BFEED7DB9B082473 ce(e9
889,531,884 *5C8E3AF923EFEB6BB1DCE3ECF0F6D2280E969ABA central-dombauverein
889,531,885 *5C886AC5C413268227ABCDB2214053AC399D53B4 caccident2
889,531,886 *5C86131A01F23FECD9B034C128F706ABAAFB918F CACT,
889,531,887 *5C83693370FEE18BB98E4F515570D15E3DC8DE27 CARAOTA9
889,531,888 *5C8BA364E49E32EE2F65236E8C33154E96DF5E2E CARLORTWINE
889,531,889 *5C87FA364784B6DD6C0602DD797883D93A74C6B2 CARROLBENAGE
889,531,890 *5C846B64B51EC5FD28A1030DDEB99F39EC7C13F9 CARSONFRANSON
889,531,891 *5C8D87065A62C5983FCAEB279EEE39401BE49422 CASEYKINNIE
889,531,892 *5C87305BBA57DCA21D5C9C24FFBA1D686DC7A043 casog
889,531,893 *5C85DF824BECBBE949521C9B33EB78047087CA76 [email protected]
889,531,894 *5C8F62CEE917CC455BA58A142EF1962821FBFD6E CHERIMOYER6
889,531,895 *5C8AB52E184A25DD3C6862ABACA6E68F6CA0E218 CHET.IANNIELLO
889,531,896 *5C8425D38C5B32E8E62D00D569E61A067E0C2CD1 [email protected]
889,531,897 *5C806857AD3D319BB4C2949BDD11539CB7A122A5 [email protected]
889,531,898 *5C87530F296F358D856DB7CB33D7CE9104401054 CHOCKMAN5
889,531,899 *5C8FAF20E3B97EF545C6224D78DEEE44170AF22F CHRISTOPER.ANDERS
889,531,900 *5C87615E312BB598011D6A60E49E1FBAAAAB9574 CHRISTY-KLUG
889,531,901 *5C8D4940521A839C78B0A12533EF8B168E955F81 centralsouthslavic
889,531,902 *5C89543A008ACF47071CFFFF6E5FD529A9378369 c?e;u
889,531,903 *5C86EC0C43C52D266A3641888B05110EEED29905 CI9EF
889,531,904 *5C8C69819EBFFFE7D0931B18E197A6F538D9C4B3 CGYP
889,531,905 *5C81917EB3B5A93E274336FBB53437A069DD383F charleylenoue
889,531,906 *5C869EC602D1EF93CD668365ECA07E832CCE50A6 CL:AL
889,531,907 *5C8618DEF7B9A41922CC26E6FBD80CAB166532C7 CLASSING
889,531,908 *5C87B489B371C35072E6B887CD219F53B5BB765B CHEMEGUET
889,531,909 *5C8DDDFE31CB01501D90F1343E929255A9E834BF clementsarris
889,531,910 *5C8DBA52F3E5B36D103B363FB8769C6D42DBD94D chh3r
889,531,911 *5C8AFB739AA61824F544B7D2431951E4494B6776 closetostraightforward
889,531,912 *5C83474F4B2132BDB4FFC1618FD226F0F0377066 cmun
889,531,913 *5C8F27A2DA80F72292351C021241B2FC36127862 C)N9Z
889,531,914 *5C875588FAE5F882144E3AEF03897D64D0CF9A7D [email protected]
889,531,915 *5C82C0FF90810A770A832AF2BEDAA781AC9DAAA4 c(ng
889,531,916 *5C8E9E26DE1C4C0EF28F82636530BD3E1AAE7D31 coi-g
889,531,917 *5C8268F05369198FFCE291BEF336677D89D1F0CB COLESCHOMER
889,531,918 *5C8D598DB6B75316298861BD0B717E331C46597F coltytxoiyo
889,531,919 *5C83D580309C0BAFD9F0F20516A0F2F33C4D6479 CKR-P
889,531,920 *5C8FAD98B22F24117ABEDD9E6134F080A569441F [email protected]$
889,531,921 *5C84A450955BAFD1D247525670CA1C55FEE3BE65 [email protected]
889,531,922 *5C83C2FBB20555C3AA29F2E7951BB766C9762E3F CLETUSGANESH
889,531,923 *5C8D362A59E31F62047ED4222BA6D5A04F58235A CLEVELAND.MEVIS
889,531,924 *5C82C88F0F4CA2FD94A29F39D97782942D12BD8F c&l&g
889,531,925 *5C80665CA6A833A752EA2AC58979A915A6460A83 coronamos4
889,531,926 *5C80C8B2FDC7812B7CBEAD4E0A7161D3015A90BF COURTNEYCHAPPELEAR
889,531,927 *5C835C4A8294923306B171C9A0271BFE72714003 COURTNEYLEVINGSTON
889,531,928 *5C860BB6F67C879F4288F79366558C1E97923A59 COYCALLISTER
889,531,929 *5C8B69F48800EFAC4B4EEF8CD5F711356B5D7EB6 CPE777
889,531,930 *5C86C4FD60802BAE58ADEE01E27810CF9A7E95C4 CRAIGMCMAKIN
889,531,931 *5C810FA1C20ACC336D7B1BB27A879AE32DC53C5C CoeY
889,531,932 *5C855FAA320F130171DF44B20B6C94C8BDDACFE5 COLEKROENER
889,531,933 *5C832B439A94E2DFCEB83F5E3CEB5D41AD107056 COLLIN.MUZII
889,531,934 *5C8B5858DDBE2F79C9EB26FD288FDC091004E36C COMBININGNOT
889,531,935 *5C837FD608BCC867E41A41953AF21097E58F3208 COMSTOCKPRISEN
889,531,936 *5C8E9D1FE61047E958214195EF4DFE731D540C26 CS-G8
889,531,937 *5C82BD643672B759809D817EEFC1E8114C13C30D cu5c
889,531,938 *5C8903BFD1FB7F53947D8344C2F66DB73578F6EF COURSEOFEMPIRE1234
889,531,939 *5C8B89A0CE523C5991CB02EFC10D23F88B1D2994 C&OV
889,531,940 *5C84661F882EC10753E7A8E7658DC22C4C804C09 COY$C
889,531,941 *5C8B4B2F5D04716B6B9F5BA9B817F6F83F5AD723 CV9,Q
889,531,942 *5C87B1C87AA3626045F0412D3B0B7AC924D0F6B1 CRCMN
889,531,943 *5C8DBD529379B540B1834D519CD4D28447A1EEA8 CYV(T
889,531,944 *5C89F183A1A7A6E385BA62B04E6CDF3DB7CF9FBF D0PG9
889,531,945 *5C8788B174D602B6214DDEA0E0AD358B0A6509C2 C$S?N
889,531,946 *5C8FB3EE58ADDD6B513D5B73EB8A8A121F3D58C7 CT.7
889,531,947 *5C8CD0AA75F3EE7B9B7004F93AB232E8FDDFACD9 CUMEAYO
889,531,948 *5C82D7A0B7065EBF81DB10C85B8F0933647CF4E3 d7lv5
889,531,949 *5C83DDA1154C74A0D9873B11FEEE18335765929A cvj8"
889,531,950 *5C8C202953E80770AC8207D023B8530DBFBC5CD0 c"vwv
889,531,951 *5C8DC1246B1611032409DD3D3676DC0F31A6D3FB DANA.SALIMAS
889,531,952 *5C8D6302B84731675D814200DF4CCCBD4057B9E9 danasambrano
889,531,953 *5C89850A2CC9B32B767A37DB79D338D1095FD2A2 danielhardiman
889,531,954 *5C8A2C10902D0D334B3A54CE6E69F16AC615D603 daq,9
889,531,955 *5C8EE87469AE19B94607AF9843EFC174586052F4 d0:gm
889,531,956 *5C8CD61055F5D42A7917C2F110566927B1286FF5 D170375
889,531,957 *5C80E6A4D270E96A852CC54B3B36185F3A5679F9 D1GAQ
889,531,958 *5C8BC6E20D68B0B839E137D4C144DBB08AD453AF D3M3S
889,531,959 *5C8E4AB73FC633BB2BBF8DAE4F0D12B354AF565D DAVID.ROUTZAHN
889,531,960 *5C88BD34E4C39B29EB1F5B762EB7CC2386190B09 D5DDC50146C83668BE9754A2B35B02CB
889,531,961 *5C8BC3F66D9EFA0F78A06DD1752120EC34642827 d+/5l
889,531,962 *5C89E12C7ED1FA2FAA73804797149473C3785F1F [email protected]
889,531,963 *5C8518997D6B06DC7B14F22DC826F2DDBCD6E1AC DB5#Z
889,531,964 *5C8159C430CB87022BA3134A5FB96E1E7B808615 DC;4
889,531,965 *5C850E16A471461472033040465C1FF4B7533BBD DCIJ
889,531,966 *5C862EA0738EEFB075CE8009E227E5267D2CF62B DAE84
889,531,967 *5C822943DABFB7C150D074D427F3236C5690AD9A DD%GM
889,531,968 *5C8FBDD0218B058CFD9A8140DF78220B6E1002B3 DALLAS.SERMERSHEIM
889,531,969 *5C8DBEF7483889DC8CFFDFCD23F5EE3463B079DC [email protected]
889,531,970 *5C8741D26ADC7EAF8CD002D9F0BE56CBA7F6EA0C D(AM6
889,531,971 *5C8520F0A270141374967C9EC2388A1CA451CB53 [email protected]
889,531,972 *5C8265F053E51B90E0E8B631AAA2443CA2E23AC1 DEBORAHDAY
889,531,973 *5C84F56EAD42D0462EEB3B2EA7DD360EEBC9E8EB DANILOFIORENTINI
889,531,974 *5C801BA67FC5289449A330315F6EA1F6A9866823 danilostuesse
889,531,975 *5C8B9FD66CAD404920BCEE9DFA3493C7E403A090 DEE.TROJILLO
889,531,976 *5C8E4423FBE35B3A1FEF3ACCF4452F6878785AE1 deficent8
889,531,977 *5C8142CC103C90EB3E7546AEA404D1B4F419E57F DARYL.STAMBAUGH
889,531,978 *5C85565474599B98A10EC93C8DA4A289B335A353 DATE31JAN2008
889,531,979 *5C838082AA3606A893C77E326DF9C78D520E8534 d?!b)
889,531,980 *5C8FB6813EB6C14F558D210C4BF817DBDA97DCB8 DERVOLLGEMACHTEMAULWURF
889,531,981 *5C84D9979B955E0A434D38A164F5A832F870AE0A d$bho
889,531,982 *5C80EA6DE961FCD0C6599ECDF04634D16D4CD7CE dbiu
889,531,983 *5C882A69E4D4E53985E38A9A87E90F3B0DBF29D4 D-C1
889,531,984 *5C8C1C1A561E919C1E6838B3B65AADBFF098086B DCHEN NEIN DANKE
889,531,985 *5C8F24AB5F6EC7A2423503238FAAB24BE7DEC4E3 DCIJ
889,531,986 *5C86B23463E44B7E162A15C843B0F5F4C1AEF992 d=cu9
889,531,987 *5C8B5E791EECF7E4A763E5C23ABCBEEE99AEEDB5 DEWEY.DINGESS
889,531,988 *5C836569AD8A5DD6184DD921DF384CB59309607B DD1R
889,531,989 *5C8D3C99B50C602FB492E7C9A1F04DA97F12DF1F DDÈBBETO
889,531,990 *5C87EC35D06B19C6371F57FCA3BD968FAE273A0D DDKGV
889,531,991 *5C8297397367B7EA15DCA2B78DB496F13D8537C8 D$FFN
889,531,992 *5C8E1452690C047B435E70665DB018505D2BBCCD DGOOVDNA8
889,531,993 *5C85E85AA4FB5EFC7D5E228616BA50AE4BA4FC82 DGWES
889,531,994 *5C866C0D42697976C227CA5D3F11358E4D868BD1 dhd#0
889,531,995 *5C8B25FE8612207211C85340CABF5A0FAA61F716 d&i9+
889,531,996 *5C8D8816320BB778BCBD283796865F98A370B7B6 demarcusinsana
889,531,997 *5C80BD6E098534FC123D23A38281673258B401F6 dichlorobis
889,531,998 *5C89384CB08286A4DD4ED7C9CE27E15533A929DD [email protected]
889,531,999 *5C8C919BE08066B69163E88AD732A35EB1518743 [email protected]
889,532,000 *5C8BF8F5C8D18CB36B81C06125691CBF2702CD0E DIONKELAU
889,532,001 *5C83C72F9EDE94F37CA68635BCC7C1BE658AB266 dirkruzicka
889,532,002 *5C819024E1C74522C3A6A0FD319F3A3792FD42D9 DESIGNYARD
889,532,003 *5C8D04A13AFAD54E6ABE63177E860A3CCA0DE028 DETXISO69
889,532,004 *5C89BEF76DC2687053336FD2A0C9DDB94D378B0B [email protected]
889,532,005 *5C83B5A5E1A301B2FFC1D1339049A3DFB2A560C6 DEWAYNECECILIO
889,532,006 *5C87F0BA0AB2523819E8E6FEC7BC9C79F9D71E07 de:(x
889,532,007 *5C88443901780A300B0EC7463611956E6DA1B919 deypenbeck
889,532,008 *5C87E1CB26AFEE8CB6E7BA4A751AC672BA062E46 DF9C!
889,532,009 *5C89B710D6B720D07E158A8157EDB6BF5CAA9DFC DND.E
889,532,010 *5C81BD857EF654B08F409C33B9F6669EA16541DD d_nu3
889,532,011 *5C82448AD6EC0C0110550D7611A6CDCCB71544E6 DiEn
889,532,012 *5C87646C30C9E445A3EFF9390CFF7DC195ED70E8 [email protected]
889,532,013 *5C8A00AE7A24C4DC268571D07B1E7B783B991FF7 DI'HURBAN
889,532,014 *5C80FF58893A21D36845D222FBD36BD05C35D6B8 d#inf
889,532,015 *5C8008B358440CBD626CC95CB8F42B34CBC4FF6F disc11track11
889,532,016 *5C8629281CCDFDF079CDEAD323BFE9BCFBEEB638 donhosford
889,532,017 *5C8E668D4BCF512B930334C1EC7818FF1971022D DONOVAN.JARNUTOWSKI
889,532,018 *5C8199F877A78107C13EC02F2F4BBDF2CF21CF20 d,j!)
889,532,019 *5C87972C48DE9DDF0F7CE7120A529815BB0C1942 DJCHKO
889,532,020 *5C8D00C0329D009458CB1928AE25995D9BBDFF10 doomzebra5
889,532,021 *5C81AC9D03640DB5C17F71A5DAAD6B873BD76F4E DOORGESCHOTENE0
889,532,022 *5C83E18F435380B5E4DAF42AFBF15B37EA7704A8 djkiller30
889,532,023 *5C8549BBA818B46B542D2C3B4DD6DDF585B7265D DORSEYTENORE
889,532,024 *5C8953AA37C6379265DF2DB4F47F7C4976EA0E60 DOUGLAS.KELLYWOOD
889,532,025 *5C8F6CC99F0F04D31159FFF1E91122A3FA3D1E82 dlp%x
889,532,026 *5C87A7CCE761B3C61F24474CD2D4B9E850AF3E8F DROPHEAD4ALL
889,532,027 *5C836F0720FE07F7A96BAC463063CD1046BE8DA4 DROPPINFLOWSINTORONTO
889,532,028 *5C842BE5812411C64F959AAE054E9D8A6CC99915 DOMINICNEAS
889,532,029 *5C84C19206D0A5C023B3D0D45ADE867A3FCBEBD5 dsgl,
889,532,030 *5C87D60A48396934AFE7EDC948DEB79623FADD63 dsv$:
889,532,031 *5C8269CCAC68A6DB2E0C595219D307E85439D35B DP.LE
889,532,032 *5C8F11009457E05378249911E21370E8C201DA57 dvldjn
889,532,033 *5C8872C390E33CFCD906D934D7F92662659209A4 D#Y
889,532,034 *5C8316F51CE09F215B589AA4046237F0CD8DAD4E E51598
889,532,035 *5C898937AEEBB262FCAFF25FF4CC21D9E646119A DTGDO
889,532,036 *5C8825ABEFFB9884892924B2D350E8596D732014 d!ufd
889,532,037 *5C8E7A8E962A1F07014FDD3CCF8632CA5B5D0234 „durchschnittsdorf“
889,532,038 *5C8469CCDDD13319E75DCD88971865A223BAC2B4 EDDIE.WELLNITZ
889,532,039 *5C89438DDC140E3C2D99461651C8AF35006BC74F d;v9t
889,532,040 *5C86AD863A5C972CE659F528679F4C66BC6CB75F dwainertl
889,532,041 *5C8E2C159D70E015EA31A097374791AC9ADBAAF7 EDVLS
889,532,042 *5C823459AC113B0EE309355EF40AC34ABC057AC5 [email protected]
889,532,043 *5C883D6A671E5246F087F02FB46DD0374441CF00 d?;_z
889,532,044 *5C80098545D498924F21E84427BB8C381099755F EGIANNOUKOU
889,532,045 *5C8F26EE169887C563D92AACCB61D08DBFA96BFE egnelhcsing
889,532,046 *5C862DB2616370C98037E28B46C834F802CFAF29 E164855
889,532,047 *5C86E0E020AE1B49FD2B14E64EBFAFA95A325A9A ehtinees1
889,532,048 *5C83108053BD2B9882CBBED38A1AA77136E21C48 [email protected]
889,532,049 *5C8F39B8BCE87AB5B172136F9903C06AEDB02475 EARLE.GOLDBECK
889,532,050 *5C80D69235FA01416059CF0E288504AC8228C3C6 earlgammell
889,532,051 *5C8157745EAD1815045695B5A4D1FF4C064588AC eio7
889,532,052 *5C8F0724328FE4F916D099AA528C2E76CFFC2CE0 /EI/TAPPROPRIATION./@/
889,532,053 *5C8DA93EEDD2A762583214902F19FDFCA4AA7713 el)-6
889,532,054 *5C855AD8D6ADB048DC3E8B9D94CEC71893B88151 ELCENTRO8
889,532,055 *5C8C7FE08C29A3726CFDF201F2E4035B77AAD6C2 ec"65
889,532,056 *5C8BC5E1AA0344597D3CB68D52636B1F0DAC3536 ecjma
889,532,057 *5C8CFCF0C0DFD294382D54A95093E2BF7EDBE99A ELEMZÉSÉN
889,532,058 *5C8B81847AE18B805F9378782B90AA9F3E899A84 edafeac
889,532,059 *5C8C356D5A70C3664B3365C97BC9CAF612458BD6 EDILYNF
889,532,060 *5C88A53B90ED005DF81EFEF0271A6E8C67B078FB ELLIS.ONOFRE
889,532,061 *5C86D0D6FD50624B773AE24A60504B6118A15350 edmundprinzi
889,532,062 *5C8293E4CEC5911802AD0E1ABE1BFA71DD13E173 ELSE-KARINE
889,532,063 *5C87F063E02F5DE0A4783488C6AD724B540A9AAD EFFIRGOC
889,532,064 *5C80A69652D40336345787C6BCA405405DD91158 EMERY.AMAR
889,532,065 *5C860667C412F7A1B612A2549106042E85F526B9 egb?a
889,532,066 *5C897A03928DD5172A1ABFF73BAE6CAB182E12D4 egt:
889,532,067 *5C8F843603AF4314EDEC212BDC9F62198271AAA0 emisiondesincrot
889,532,068 *5C8C9DEDB35F846B96550F3754D28763877484E0 EH8K
889,532,069 *5C8B970086E1EAAD3C8B3FC79E61392B8432C4EF ELBOTELL
889,532,070 *5C86D58256648F11840C87B8A76779AF63FBDC11 electrodegas
889,532,071 *5C83EE09324D2DEA0A7F7BBE8C1E1759B697A615 eliholman
889,532,072 *5C8D8265A711E9C84134AA7F6FF4E13E57A731C0 ELIJAH.VANWINGERDEN
889,532,073 *5C82D330C8545A4C2CA0A595824548741A8CB3AE EOPIANELLO
889,532,074 *5C880B1B437809563CB9B89508476FD9CD873F86 EOT.?
889,532,075 *5C8C89BA158F807E93DFD14387396E30DD2E7606 EPACSRAT
889,532,076 *5C8B0E59510DEAAFE65BD57A68F824614649C3FB ELISHA.NEIGH
889,532,077 *5C8CA33FC8F974CA849110D2E3406DBE7D373191 epi(b
889,532,078 *5C8B2E98C90AB27461F3F16118AFE52D543C8C25 Episcleral
889,532,079 *5C8064ECAC346225AC440259C4DE185BAFD4893C em4!1
889,532,080 *5C8B2B80883B3978B584E2847EBAA52E34360C30 ERIC PERDUE
889,532,081 *5C882574CE5F13F09DA3176CF7269B44604CBC6B ERIKMIYAO
889,532,082 *5C87CD143A41BC5F7918F38FFAF31E9B20475608 ERNESTMEDVEC
889,532,083 *5C83DF25DD37645982546B0E1D6369EBC33FF8D0 ertnuls6
889,532,084 *5C8BF4F38C1F014772CC58A9FD105318645627A0 ERWERBSMS
889,532,085 *5C81E7DFCD9652A1AF749C351326078FE2D56943 emoshtootnu
889,532,086 *5C855883B31BDED86FE7E6567FC99CA7AA61EC38 endullyd4
889,532,087 *5C888A2422615383755C2EDA7B9884E5B57563E4 [email protected]
889,532,088 *5C8AAD426BBCCD45569CEF12260D735DA48ED95E ENP$
889,532,089 *5C831EFBCCF0EB285A225FF6ACADA1E276DA911A equ^
889,532,090 *5C88B305BA66D5EBFB94319C17CA652D5E3E9F6F [email protected]
889,532,091 *5C85FDBCC8B0C791FF97C82A9FA907CF65C9C99F Every.Time.I.Turn.Around
889,532,092 *5C84EADBC4DF43268620659A18486F2DE8F50565 ew~d
889,532,093 *5C8A0091DEC263F282031BEC626E0A095734C99A EXPIRERS
889,532,094 *5C88C6158CCDF7EFBE04A9E225FE8D14B95F6A6C EYBCB
889,532,095 *5C8FA18366AB05119C32B4284D9576707EEE8205 eypf)
889,532,096 *5C863A0A5494BC5A33081B476CEFD6E0930999D5 ERROLFOGELQUIST
889,532,097 *5C83AA5B5181B439CA92573BB8A0CC132C1B3E5E ERROLSENSMEIER
889,532,098 *5C83450A69CA7CF9EA58A23D052C4885C37DE8CF [email protected]
889,532,099 *5C8D8D7EC4DED69E128C45A9C6253072642A1C2D [email protected]
889,532,100 *5C8C1711437500F2C4A97983EDD7E9A80DC3CE28 ER*W
889,532,101 *5C8C86D93AE4D344F95F5ECC114968BE48290A8C fadzilabdullah
889,532,102 *5C8DADA7CAB0E460150DF8CC5E2FE6C44368A462 FAUSTOJUAIRE
889,532,103 *5C8748B39DED64A3B3194418037191D13F8CA3A3 ethanhorsely
889,532,104 *5C8DCD42A769A46D6D8876893D02445B1393450C ETWC/
889,532,105 *5C88C841D22523F8A538E2C84E0D521018104A83 eugenelons
889,532,106 *5C8605F2F3FC3E7BA983D34C25F7927900DAFCE5 EUGENIO.BOWLEN
889,532,107 *5C820262862351ED92CC11E98296AFCC4AD4EC59 FELIPE.LAFOSSE
889,532,108 *5C8074AA7771830B7BF643B08C077FC9726F8C74 felixmanahan
889,532,109 *5C81DA24605EB45ECC2E598DAD7E3666C1AB04CE [email protected]
889,532,110 *5C84C07B0F12177591E3F07092F719067FD4502B evacuavates
889,532,111 *5C88C8509D4159ED96AB7AA5DA50762C1D67637E FERUSON4
889,532,112 *5C8F00AC4479A033FC7A548F4D8DB62587CD1894 EXIDAA
889,532,113 *5C8599ABD7C114A31F4E0488C4BA195A66A4FD8C EXIMENE9
889,532,114 *5C8E53F5F2832B1B8582DB1119D7E22BE222A26B fiffikus1
889,532,115 *5C89822CDC7C3A8BC14B0E16B4BC142673EC9122 EZEQUIELCARDANI
889,532,116 *5C8359EBC94E85E02729F5189FB0ABE96F7039FC [email protected]
889,532,117 *5C8EA2F8C33D68EA85984EEECF40564FE5FEA093 fl:c
889,532,118 *5C81A29A125563F0796628767AEABDEC197753F7 FLOYD.ZALAMEA
889,532,119 *5C8E8BA1C89533037CF2891054A0ECAC4FA65F90 FAG1UHZGOVCC
889,532,120 *5C80BA8C442830EF3EBC178B1B295FFD85A4E820 FALAHMARI
889,532,121 *5C89D528296EABBE967ECF2D169924DAAA245066 foha
889,532,122 *5C895B21E3FD3FD7A9EE5BD903E45AFACF10B902 FB140020200002ENG
889,532,123 *5C8360D9023A5C9261E80557FA8D759369946080 [email protected]
889,532,124 *5C8D607EAA190B6351A134A0E901BB5921436B6F [email protected]
889,532,125 *5C81E46ADBCF2B83A0ECE2D765C23B3E270AC149 FRANCEWILLOW
889,532,126 *5C8C6E5638A627BBC2AE4566FACF17C7E444A172 franklinwiggains
889,532,127 *5C8DAEA2A0D8139F1A71B65AACA029335D6AF1DC FREDDIE.MCNAYR
889,532,128 *5C89BC73BE23B4E7F90757FB6745A7E41426F4F9 [email protected]
889,532,129 *5C86ACF69861095618AE88972A7C842639FA7992 fredericquest
889,532,130 *5C8CB590CF4F1C315F02816B46D8A270C47A4E48 FRIENDSHIPSANDTRESPASSES
889,532,131 *5C8D283133152BF27FCC7A1BDEB068AD68628979 FGXSTRGV
889,532,132 *5C893598805B39A0F444E39A00B5C0BB5BFC1D0C [email protected]
889,532,133 *5C8B7774605E2C8ED5A220B0A185E40084DE4E5A FIJARE
889,532,134 *5C816342D897656259BDDFCB86ED91DEA935AE25 funky junkie
889,532,135 *5C8C909A7187A5AA0105E2178B1AF61A96664F50 FLETCHER.SHEARIN
889,532,136 *5C85BF7AE42C7DBED369CD78879659A194506FCC GABRIEL.ROSSEL
889,532,137 *5C8D390BCDC5943E28B4B7BA65600A06272F98BC gabrielsturtevant
889,532,138 *5C8480FA11F9900AFA13FFFBA0B4C3C471C61AD6 FLOYD.KLINNER
889,532,139 *5C8B0D4E2E8CC705F1D3C422327D70DC83AC1C96 galeportland
889,532,140 *5C89E69BDD4873DCCE9C28BCF46960A1B2E24630 gamewise
889,532,141 *5C803C1B4BEC681B2AD4F98634CD725D4D362C37 FOKIDZ
889,532,142 *5C80554F3881D0CEC51B4ABC0D71B299D41B778E forced dimensio
889,532,143 *5C82671B66B926855EFB4CBE4B5A5945A388320D GARY-BONIFACE
889,532,144 *5C8BF37162CEC9CE5F4D506E1E56357FE99B4DCC gastondejager
889,532,145 *5C8802186E82F3CFC81ECFF8907A0BD44B3CB0AD GAYLORD.PAUZA
889,532,146 *5C8E22655BF6D3647945852F40A473DFC46C4BA3 [email protected]
889,532,147 *5C8167EBE9E94278C001D13E10FE63A8D2847465 GEFÄHRDUNGSKRITERIEN
889,532,148 *5C81AC99BF2F17A477EDABBC93DA780AA96D4D71 FRANK235
889,532,149 *5C832DACC0408320FD0B4513039179989D1DBE93 frank-carillo-and-annie-golden
889,532,150 *5C8C6939078424C40924E782DE88D03FC36ABC69 GEORGEDEROSE
889,532,151 *5C82C83473AF05308AB02047413F2AD60A1477D7 GHITARA
889,532,152 *5C8074EE0A23481B1CE0AF9B462DDB369468B94D furcates
889,532,153 *5C8E002F62499C56DEB8780D79E0AB6576AC36EC GLOCK500
889,532,154 *5C8E203A09FFBF0820D42032719C5867B666688D [email protected]
889,532,155 *5C8C9FD6FA099A1B477839C027206989C35968BD GÖKKÖRÇEME
889,532,156 *5C816F090FFBE8170B225740311B5DD84C5E0EB8 gokrhlh62
889,532,157 *5C8592B61A836AE5B02F8E78D69E194FEAAC4CFE gonzalostickles
889,532,158 *5C8C6BFFF9A0DB324CE9CEC50C16D1BDE982BAC9 gas-bacillus
889,532,159 *5C84E63AF3A8E7D2DFA89A4C8332AA93DA711FF0 GENKIIPP9
889,532,160 *5C861A1425074879B5351BBC639CEC33AAB77F42 GERALDOMCDERMID
889,532,161 *5C8185D162FC561AC46A9A60876B355EC627ACD0 groupuscules
889,532,162 *5C883545B68FE82B897B8245D5431459CFCBDC1F grovesci3
889,532,163 *5C83629764240231FFABFE442C0ED85031F3D4BA [email protected]
889,532,164 *5C81C1EED04D1F608EA2190D9139A8A924BB0C59 [email protected]
889,532,165 *5C8358B2622BDC71F81F045ABD3445AF854F253D [email protected]
889,532,166 *5C81804915A22BE6C8EAC895C1A3FC7660FBBF53 GILBERTBOSHES
889,532,167 *5C8830DAB22875E7340776149A955CB9CD3D32E3 GILBERTOCHOVANEC
889,532,168 *5C8F252572283538797470B42207CA6C8597B17B [email protected]
889,532,169 *5C8E75F34F9823A86DFDB389598767E2F733F478 GIUSEPPEKRYSTAL
889,532,170 *5C80E200E8BC5E317FD50A7D28E3CEBDB34F49B3 GLOBSECARJUN
889,532,171 *5C816E2F4DCB1C463289ED247C9453AC17F41A11 HAFRICA9
889,532,172 *5C81C59DFD978A2103762E2A989C5160DCC51D35 GMGG132
889,532,173 *5C8C85CA6F8F0F1968BA9E7D6EA79854B77A1ECA godfather.grimorie.(rehearsal.-.7/31/1985)
889,532,174 *5C80E7CD1AC02DDE7DE538A3562C2899004D08E6 HAPPY-AS-A-LARK
889,532,175 *5C8F22D0EDA9F94110889FDD6F060B720BA6A96F haravoid8
889,532,176 *5C88B346B4CB6DD59A7FFFE93DA780DE11965893 [email protected]
889,532,177 *5C8CFF618753F585AF364051DBCD4AB4575E9D94 [email protected]
889,532,178 *5C8F46E665EAB886FAF22533516C8212C353DE08 GPAULAUSKAITE
889,532,179 *5C8BC705888F8C29435F1F7DC8B336E261E9AA09 HARRIS.FOYE
889,532,180 *5C8A6B2855B05EA93F8C0B3C329EC1DDBDCB787F HARRISGLOOR
889,532,181 *5C8FC7BE28820EF5D3390BD8B027074A8A42D7D8 graceebell1994
889,532,182 *5C8248DB30042D722806C8AE31B55168736A5BD3 HAUNTCLUBNETWWW
889,532,183 *5C8E01936FA310DAFE55324C036E4637FEFDABA0 HAYLEYFOSTER
889,532,184 *5C89707B0E4167D43F2F8A511487349E2A395609 greg.hintz
889,532,185 *5C8463E917BCB1C45DD6CB305C98103F375D79A6 HERBERT.JORE
889,532,186 *5C89716F787DF932BE39CEB55DED1367C0E919E5 GUIDEREIED
889,532,187 *5C88A013B12A1F456AE98CB3CB8E5F749A8AE539 GUILLERMOHITCHENS
889,532,188 *5C8DCB2A38B8F0063A77ED24D5B7A1CCD7FFDD5A Gullig
889,532,189 *5C821A4C5143102ADB8F6F8C9EB7A6D2CACED66E GUNSNROSESDRUMMERWELCOMETOTHEREHAB
889,532,190 *5C8CA0B95678F9FFD0852972D80E12CDCFD74A7E [email protected]
889,532,191 *5C88A5DE75FC9CE6A81B20181D342305810429AD HGILFWOLING
889,532,192 *5C8FC37DE7636528EC97B27A9EDF65DFB0D92AFC hhmra4146
889,532,193 *5C86960B98C8ED3882AD58B80E63BAB822B9D4D3 g}wk
889,532,194 *5C83FB9AA34AED6BD7A462572BA9A07459395744 homebaseball
889,532,195 *5C8E355A41105F8C59D98941BC37B7BC3DF1AB0C HONGSOHN
889,532,196 *5C8081E5D90E25A898E53278D3720742A7DC6475 HORACECRANMORE
889,532,197 *5C8B83EBEA378D6936307DF9302E4838FD93B70B haroldboaldin
889,532,198 *5C8813A8A72DF3DCE9B7F1A1320F856F87EC5238 harsimus2
889,532,199 *5C8DF992CA84E074B8E5D15F68104073E4B769D9 [email protected]
889,532,200 *5C84EA9A53F5C0AAE1FE1985B388577728961531 HTTPWWW.LITIPAGES.CO
889,532,201 *5C849918E779DCB4FF6BEA6581B571E9D91DA0F0 HTTPWWW.THEHONORARYT
889,532,202 *5C8B2CACBAF8AEDED26A27816A363BEB0EB97BBF [email protected]
889,532,203 *5C84C659BEC1524739D9566B10E4BEC4CCF50DEE hellenge
889,532,204 *5C8DE918C30465FEEAB16E42EE65018865A5A58A [email protected]
889,532,205 *5C8E3229D394E65AD485740CC19DBB18ADDFE8DE huryeong
889,532,206 *5C84F91AB6E0A6BDEEC71DB3661434F69DC198C8 herzigen9
889,532,207 *5C89EA992C816880EA47953C2B3FF7504D21F443 heterostrophic8
889,532,208 *5C86AA58BFA2B2BC541D5EA094FBF9DD944690CE [email protected]
889,532,209 *5C8145E6DCE5A2538C6EF0DF34EA614ED630799F iamgalileo2003
889,532,210 *5C83F4B73FDD21291C8FA2832E56EE586FFCC78A ICONOLOGI9
889,532,211 *5C8A8E7F672A282786E81DF1DBAABB01124C13D9 HOLARITY2
889,532,212 *5C810E8BEEC3906A11B8C838BDEEBB0ADAFBBCC8 HOLBEINNED
889,532,213 *5C8B9153CEF5AA43CBCED73C55DE9261A500D468 [email protected]
889,532,214 *5C8AA42B28779E14BE580B5B495319EAFAC520E2 HOMERFORGY
889,532,215 *5C8CD9E60E0F961CC5D5B60072B79207E2675191 HONGDART
889,532,216 *5C8138ADC96D91EB0DB97EDACF1DC1F5282EECE5 HONGTOLOMEO
889,532,217 *5C8DB1D11283763AD2132BD159F459387895269E IHAGOSOJOS
889,532,218 *5C88112E0E96202CD5A493E23C9A6A7B0AF488AE HOP07
889,532,219 *5C8339B1C79D49645B15C0B23BDAC0CF306D3CB0 HORNY'98(VS.HOT'N'JUICY)
889,532,220 *5C8248A4371F57A0C5C7D1A029FD03CFE1A22CFA IKKREMNOED
889,532,221 *5C882CDB97BD738BD7F01392DD60E2FE1D2595C0 ILCD
889,532,222 *5C88CFA5BC92AE932550FC4012D57DDF741A58ED ILUVSECRET372
889,532,223 *5C8DADA8900EBCE6150E6A170997A475E84462DC ILWG
889,532,224 *5C8A81214CC2ADB87889C2958EC63CFFB9EE276D HTTPWWW.BYTHEPLANET.
889,532,225 *5C87538A3A5177B4F1A66B898786B4513A44E056 imikutoo2
889,532,226 *5C87CC3F5EFA854419AF47128E1A3190B53AE129 HUMANGENETIKERIN
889,532,227 *5C85DAF7C3BA167932D05FB7E47AB5578AD59AF8 INDEPENDENTS.ORG.UKWWW
889,532,228 *5C8BF16FB74997EE2F92BA01E98E1511BAC52A3E Hundred.Sights.of.Koenji
889,532,229 *5C8941F86B46CB5EED3CFE26AD4334F6B92DF8F0 HUNNYA
889,532,230 *5C8B122408AA4909A78933276E2A8238E7C435E9 hydr0cepha1ie5
889,532,231 *5C807FDB463C1AB85846467CB60C429D4148E32F iamfrancis
889,532,232 *5C81E0C8E54F59D92EBA77D0159DC7B3EF174D2A irimski-korsakov
889,532,233 *5C820026D69BB55D1BD8ED1CC3574C70D806F751 [email protected]
889,532,234 *5C81A3BD559FBFE0698258C9497B8B3A5C0C69C5 ICYHOTSUPERSLIDE
889,532,235 *5C870CA33E166EEA1565B0F1F8FE35A36676EC89 isabella'sweding
889,532,236 *5C8AF5F9D845A3F3DED20A9E18B6C3D781D32F5F IF YOU PLAN FOR THE WORST, ALL SURPRISES ARE PLEASANT.
889,532,237 *5C8AFFC928CCF30336286178BB1D60D5351BAE7A israelransonet
889,532,238 *5C8CC1FF0AE7D4B4E8EEE716912901BD220B1B6D ikilledelliottsmith
889,532,239 *5C80ECEBC0DD65E8D734D7911C5982790D04DB9D JACINTOMARTENSEN
889,532,240 *5C8A8AAA726E2796854AE9C6B11D7BAB39BF61E6 JACQUES.HAGINS
889,532,241 *5C887083A4F8BF378BE604BBA440F959B144E363 IMME+HODICALNE$$
889,532,242 *5C8342C211CD2619C17E943023A0097195AB7739 JADWOLFMAN
889,532,243 *5C8E7E38BF0DE6F21AB7FC366964EAB81F2DD89C IMPRISONMENT.19
889,532,244 *5C88C46EB3EE5E1745BB81B5848AF132B397AFEF I'M-SO-WORRIED
889,532,245 *5C8F91D8934BAB9D53ED21580E9D7EBF2DDBBAB1 JAMALHAFT
889,532,246 *5C8FBF53BDFD8E921C7FED2705322C877285AA93 JARIN-1
889,532,247 *5C8A482DEB127F7BC09A2E0BA0545EAD00AEF24F jarredfason
889,532,248 *5C8924AC321D39A64C5F2054841A91D96215B121 JARREDFUSTON
889,532,249 *5C87971BE1AC68DB0B3707F27F9A7E433C8F5100 jarrettschweinert
889,532,250 *5C85994C7EEB91D732FCED9C79997FE85A612AFF jaw... radio
889,532,251 *5C8291D055109B9515FF0B5D5B0C921E279F944A JDESANA
889,532,252 *5C86D5086748542FC6840BF3FA32A1C029AAC0B4 IRISHCAJUNPOLKAQUEEN
889,532,253 *5C80F9F0F9372B4061460B957DF5C2122E47780A JEFFERSONDEMETER
889,532,254 *5C8B76147C698A4E4F620630CF413AF9FC5EC02B IRVINMENCK
889,532,255 *5C84FD1147E8761BE8C2652E8EDD4808853FD12E JENNIEWALLACE
889,532,256 *5C835C7CABE86972A450DC6CDA8BA6DADE6587D7 jeromeehmer
889,532,257 *5C8ACD10D9F8D5C5C1CB33108CCE63746D45A553 ITNEDICKA
889,532,258 *5C8393F0CC3A84D99B7DD7F7BEB11BEB0154EC07 jessicanicks
889,532,259 *5C8BC719BCE3A4E826CCA183F5B7407866C1EADE JOANLAUSIER
889,532,260 *5C861F350FF9A7B823DE3EB5FD353DF8ED942AE3 japan2000展
889,532,261 *5C8F85B57E140D040DBE65444F4C130FED9B5A27 javedhussain
889,532,262 *5C82DDF1F8BFBC0CABF0338BECCB569183854559 JORDON.SCHEIBLICH
889,532,263 *5C8BDA42B6BD5A7BDFFAC5BC25320380CCB79AD7 jdd
889,532,264 *5C87BA75C7CCCB21146BDF8389A41FDBF206CEE1 JECKELL6
889,532,265 *5C85D398540DC2EF5E51E702D9F7B0C3F8EB1CB9 JOSIAHBAKKO
889,532,266 *5C887125A131BE1A4A8040D3B6A8246F8930D588 JOSSIEGUERRERO
889,532,267 *5C8B246BAB3B467D3D94E97CCB325F4446D6DCEF JEFFREY.SHUBRICK
889,532,268 *5C8958C00BB184E69A501CF02EC012234874A690 JOSUESWIDER
889,532,269 *5C8612A4CE36E4C0A5860001CD5A88417FE19027 JTXJKBBRE1
889,532,270 *5C8F50DB907F00A008CB0018ABDB2C5DD17C019A julianbisignano
889,532,271 *5C8AC6DBFC54F6E30134D4C55AA464ED8A290C15 JULIE MADDALENA - TINA
889,532,272 *5C87B394DE6B15EB0ED3A939BBB2C5FEA2F1CC98 JULIO.STAZENSKI
889,532,273 *5C84A339A7F240E8F5169FB42EBA361A7EDCA89D JUNELEDESMA
889,532,274 *5C8EE0DC85BE4255C271474E5E7E62C238C8F32B jxwmlekt6i
889,532,275 *5C83C1C9AC8462F4144670DBE32D4850116C0934 JIM1976
889,532,276 *5C8858E8C9987A2B551788BDB9EC75B173DDE0B8 JIMMYTWOHIG
889,532,277 *5C86078BC5194EAEFEAA44222051CB5021A648C8 kaija.lustila
889,532,278 *5C89A5D776028198CAACAAA46616FC120F68D6FD [email protected]
889,532,279 *5C8C48B738E25A2C0A47A03156C2AC99C2512C14 kannaki
889,532,280 *5C89F5DF466C1590019D228609D37997753EF8CA karenbaskin
889,532,281 *5C8F7AA86D8807C02B0ADD0654FE34709CD22839 JOE LARSH
889,532,282 *5C8771818AF9A8B127520434D0D5667571187FC4 joelweathersby
889,532,283 *5C8DD40F9E27EA57A3485189D1EC7CFDE1CD2133 JOEVYNKDM-QC
889,532,284 *5C80BB8207030F50D520CC95FDDCBFDA95E82F3D KEHINDE-OLAJIDE
889,532,285 *5C8F28F2EFF564C19D0D2CA5CDF8FC67A0855AFF joopvisser
889,532,286 *5C8DAE3673F65B9F136A952D9B06507E5A09E7FD JOSEFBUTTRY
889,532,287 *5C885315DA71427C7B54F9FD431E8EEB06996CE4 kentlovan
889,532,288 *5C8B45CF32C9437D7D85372B5A190B0DF884ECBB jo#z
889,532,289 *5C8BEF88EFA95A2BF8E1F1C2CD1288AD919751A5 JTI123
889,532,290 *5C8BD6CBDB3CB20C075CE56A34749EF9BBD67ECE J#?U
889,532,291 *5C8CFF2D7725A68ED3D22B809C285FB7820787DA KIERA BROWNE
889,532,292 *5C8E3E4D871BFE183FCB3338D1265BEA8AA31F2D JULESHAERTEL
889,532,293 *5C88FEBA1284CC3C211627D21BB7D80217089314 KIM HANFORD
889,532,294 *5C8EF3B6B077BA37C4975B10337CB8E7CF2EFD59 JULIO.YASKIEWICZ
889,532,295 *5C84F4096E67498FE7FDF29861740FF4631C256C jun.escoto
889,532,296 *5C84DA022BE43B7497C4CA7B39F1E4688DB8C85B JUNOBEACH
889,532,297 *5C82F7286F95C875B1F228B725FA39CF6E15C656 JUST.WANNA.BE.YOUR.FRIEND
889,532,298 *5C845140F3AAF22DA022FA44E7EA1ABDDBD7FD56 KISITIKPIU
889,532,299 *5C8181F2BD4DE2CD44005787220B5D74013D4635 [email protected]
889,532,300 *5C884F4EB75D8D01F36EEF30B95A9F103DD130DE klecanským
889,532,301 *5C8442A7BA66C430BFA6652CF991627B1A395379 KLOYENZEU
889,532,302 *5C8A5288D3B3D80FF192EDE3AFB0AFD390E488B2 [email protected]
889,532,303 *5C8462404981089B1930215B0B372233BD583B9C klxxqo4s8403p8j19
889,532,304 *5C8252A7849EFA1D733DDF6153CD823C8656D4B0 kmmrvlst
889,532,305 *5C848D8A71A77CFA58DBCB6A1239C0AF7102D253 KONFLIKT
889,532,306 *5C84C24D241110B95D08BA52FE18460AE205B966 kawseti4
889,532,307 *5C893950D7E855D08054555ACB5FCF67EC89D90A KSCHLEAPPI
889,532,308 *5C8AF883E24F5D50712940B545457DF72332980A KSEROREVMA
889,532,309 *5C89EB91708AEE2097E7D097FE401D36A296D471 KELLEYGIP
889,532,310 *5C852F48AE27AFBC777D96373BFB75AD32E42AC5 kelsey.acker
889,532,311 *5C899FCB8FD84A31CCD3E1F5FDCDE746DECAA8F5 KWJ~
889,532,312 *5C8F97DF601450C7F327B3CD4044930F3D635943 kyra796
889,532,313 *5C8216B65A5EBBE20817FD230328C3897B4DE45E l"5y
889,532,314 *5C8627E98E10FCF2B21C753366F2724092E4C63B lady-bug
889,532,315 *5C804D4BD9F643C76F681ED9322EBE5B814BCAEE kicklighter
889,532,316 *5C806AE8D28C93A7DD7D59CC5026CE74BA30670F lãnh.địa
889,532,317 *5C887EE00BE773FB6F1E4A652B48D44EF14C5560 [email protected]
889,532,318 *5C841AAD95E8B34EBE2600025A6EB2F8A0AB5790 KIRKHARTUP
889,532,319 *5C8D61C53D686340E67C21E9C4DEF3095BC3E56C KISSING.D
889,532,320 *5C8FDFF15FDB7E693A212FBF42F5A01086ECCBAC L’AUTO
889,532,321 *5C8C3A0306405F3EC17212FD8AEB3AC348EDCE29 LAWERENCEACEVEDA
889,532,322 *5C869B7DECE1BA45DB3D8B98E03D09502A96D6E0 LAWERENCE.SCHREIER
889,532,323 *5C8A4A52DD183E3272330C07C6C8B6537E2E8959 LAWRENCE.VANWAGNER
889,532,324 *5C88462DA0BD453F3D9DADD62D5D50FB59AA5673 knowledgesomelodmembers,like"thementor,"were
889,532,325 *5C8CA5A77D6B1540C9DDA1042FA3B043CB1DAAF1 [email protected]
889,532,326 *5C84098CEA0590680D160DD1367CC8091A734BC5 kolbyk
889,532,327 *5C84625C4FB5954519A06AA35F420508F79A576B LEO.SAETHER
889,532,328 *5C87F4CA6BA41D8662D4D6C87DF372FEEB6CAF1C KRISTYMARIEMORALES
889,532,329 *5C80445496E16FF4C2EFFFAF52C6CA9EC316A22B LESLIEGRUBB
889,532,330 *5C8667F24258EB62778ED3E7D498F3A3361200B1 lexises6
889,532,331 *5C8B026BFEA6628A0AD46D5FED2775BF91D706DE [email protected]
889,532,332 *5C880E61207576D5C17BF7F2822BB8ACC2B55D52 KYM GARTSIDE
889,532,333 *5C894BC84D25DAEA0A74804D8823BDE3300EBAEB L1UQ1NGX1N
889,532,334 *5C8940D34AFE5A4D17E048A8310AA8DCB4D327E6 LAKESIDE-TILBURY-CHADWELL
889,532,335 *5C8A5992584E447AF38FA9D61764B1BCD0E36563 LIST_OF_ALEPH_ZADIK_
889,532,336 *5C89BD1D453D9436C08F4DE8E56CBBC4156940D7 [email protected]
889,532,337 *5C874E839B6AB7DC388CD3B80308FE2A1CDCAFE9 [email protected]
889,532,338 *5C8D8F04A4C72108C5641AD2B14AFC28B509AF5E lapasia602
889,532,339 *5C8B53B5731428DFE7E138D781C9C4E4596B0B04 lawrencedizer
889,532,340 *5C8F51293BFDE0BF44D181BF079ECD7A5C5FD853 LMWEENE3
889,532,341 *5C8E70D68B7350C0BD19E3C40CBE03441DFD1424 loganmerrigan
889,532,342 *5C8E5692033C716C9FFD6C39FE9226E529486D48 leadtime6
889,532,343 *5C8809B843EEB6A7098B2C93ACF0210455307A7E looksbbs
889,532,344 *5C86E7E9084CE9C9EBCFA8C164D8C22CD582F38D LOUIEFEYLER
889,532,345 *5C89D1047E960BC03BBCFF2922464339AC23589F LOUIE.KOPPLE
889,532,346 *5C881D3BE1E649A25E1C38945C3F1D551B9E82E9 LEMUEL.LOUGHLIN
889,532,347 *5C80058B9E76716075498DE578F9CB323A90C312 len-schoenfeld
889,532,348 *5C84AE0AD8048608E31C2484570EC4F435559874 LOWELLPINCE
889,532,349 *5C85F62FB740B3E1CEF5A720F7A5C1BC3DA37BE9 LEROYCAZEL
889,532,350 *5C85129B03421A9C8B31EC56056203DB12556137 LESHAMERS
889,532,351 *5C8141E090869223621ACC87C4A9E6D11E5C38F7 leshillers
889,532,352 *5C8E1DED6B6AD6210F07CA1C61EB1C707FC4D080 LESLIE.CRAAN
889,532,353 *5C8D49CC49B8EB341443A05C6C9E68E447036023 LESTER.MCKINZIE
889,532,354 *5C881ABB1128B45B66AD3A9FB367A593576C9900 LUCIUSINKLEBARGER
889,532,355 *5C81393716B65CC89C86E46D36BEB6941C7A05BF luis.iv.de.borbon.conde
889,532,356 *5C879255499932463F303D0B6138C2DB6C396275 LFFNSDNR
889,532,357 *5C8ED3851ADD7974ACDE01D12761B495A1943492 [email protected]
889,532,358 *5C8947F13C9D3CA25C61213C5EE3C2E29DEE49B6 likoonli1
889,532,359 *5C8ABF815173459D8A47A99288ADAC6C12BB134F LINDACOLONNA
889,532,360 *5C83E3D5419A2D15E4D2AB824B1BCF6FF2C18970 [email protected]
889,532,361 *5C86EE861D76BE461C75FB800356AE4053ADF679 Maalfeesten
889,532,362 *5C8C34017B2F0E3A32F691A5E74D7EA9D6827601 LITRGICAS1
889,532,363 *5C8314366022BBB734FDBFBB32817EFFF4F07540 [email protected]
889,532,364 *5C8E5F2F5742EE31777DEF924A68221C47CEE6D0 MAHWISHUROOJ
889,532,365 *5C84E0569CA87FC27774A57668CDB901FA0112E4 LONGDIBLASI
889,532,366 *5C8595C50882E94631F7720220BFE62980CF2C96 [email protected]
889,532,367 *5C8DD628A02BC38043DB40E4B0BCF920B2521F4A MAPIANNE4
889,532,368 *5C808A377E6530B4B33A3DC72345526F0E65502F LORKEN6
889,532,369 *5C8724FCA72601A28AC4E62BC6FF8862A116357F love-groove-dance-party,-volumes-3-&-4
889,532,370 *5C861C587CF1ADE4E3EFCAE7E5B9E9CEB4888CAD lowellloil
889,532,371 *5C88C913814FE27ABE6214C409AC70F3161EDA7C lowellsoomaroo
889,532,372 *5C85D6C1180E962DC500C429976709D1A2B0953A LUCAS.BINKLEY
889,532,373 *5C827E191020DE2451D1211EFD1D97D3720A81C0 LUCAS.HUMMEL
889,532,374 *5C8A42CE1CA0BEDFB7AF81AC8EB441242B3E52BD MARKUSPEDIA
889,532,375 *5C8F194FA671B51C7086BE273C268A762A94CA58 MARQUIS.PAIN
889,532,376 *5C8704B372E8844354B7A031BF7C277C2F50A1ED LYMAN.FALLON
889,532,377 *5C85A90EAA40CFB26FD2A3E8A3A957633ADD838C MAURICEYOSHIKAWA
889,532,378 *5C812A41BB5ED4DCEB40CD50F4870D9FD78745F5 M206562200
889,532,379 *5C84678DC07E6F28F715470D15D2FECEA8ADE729 MABOULI
889,532,380 *5C8DAD555827655BF9C9644EC13261306304607C [email protected],
889,532,381 *5C8174B78B070C6A3DDFE07993EA2C425CEA17CA magi-lee
889,532,382 *5C800EC16D86B927644FD34AD77232B1171A10C1 majdkawar
889,532,383 *5C8F473D833CAA0052E1DE2ED86D5A3C038F761B meilleures
889,532,384 *5C8F036283B10892C61DE75E80EC3F394376BAB7 MALIKRECHKEMMER
889,532,385 *5C8AE9918B9BA73795EA18633207B5926752E787 mandate5
889,532,386 *5C82BBF37508815494D6764CE85991D35403B8D0 michallisenbee
889,532,387 *5C89B21DA75BB8CDA32C06E913533B775116A98B MICHEAL.HALLQUIST
889,532,388 *5C86EF713FF06D27097242C03439E6377E17B80F MICKEY.STETZEL
889,532,389 *5C8562F4B7A5FE849EFAFC4457C3B4E7BDCD28F6 MARK-OF-VISHNU
889,532,390 *5C89352E476C055975218C2D4531CDCBB41ECDF7 MIDSHIPMENMIH1DSHIH1PMEH0N
889,532,391 *5C8E4E8AB075A83EF5E79D39BDD0B90EAC254C11 marmor9
889,532,392 *5C865A6DA7E8EAFA9A721C0FDA147B81540C4B9B martyrowton
889,532,393 *5C8D8E14D1ADF0BF86F7C59FD1682077E015EEA4 MILFORD.BALLREICH
889,532,394 *5C8708CAEF1EAB13022662F68E4CC9333A301D69 marvinvanduser
889,532,395 *5C8141548BB6A2DF04CA8E1B9A9F60E584F42B79 MATHONY1234
889,532,396 *5C82E24E59909A092B128C086D89A58E51248213 minute6716309
889,532,397 *5C8D568A2556D91F7A098E2F1776537E781F1D6B miroslav.jankovic
889,532,398 *5C891832B4D49A56ED0DBFDE36915A930D56E774 MAURICIOSPORLE
889,532,399 *5C8347ED6047B02D153A333C5110841F235912B8 MAXWELL-SIMON
889,532,400 *5C8B38B16DD25A0AC123F851EA953B3266621858 MAYNARDCULLUM
889,532,401 *5C849D93B35506881FCD99EFCA2592991662969E [email protected]
889,532,402 *5C8CC50363490FD82F84DCBF96D415B9CD26564C [email protected]
889,532,403 *5C8DB1F0F10D0F630312994632E376BF41C39882 MCKINLEY.GNEISER
889,532,404 *5C889D8049D7DF70F8E5E5B7E2F8B4EF5E4F5337 MEDEL
889,532,405 *5C80695E8699238EFFEFE9826FF5EC9BBAC54F96 medicinal-sweetheart
889,532,406 *5C8D384453E46AC6994856FBE37E4CFA369B74F2 mollyt-bone
889,532,407 *5C85FE840C3A82D71BCEBEAB831733780E5AA16C MELVIN.VENEGAS
889,532,408 *5C83C6BF10FA36D4558D44FF659EBA9C58984462 montyeble
889,532,409 *5C8A015514078F03ED4E1E6A81C2970EC611956C MOSHE.HANES
889,532,410 *5C8FE6A070CD13E5288D706A044E1641D3AD767B MOSHE.HUDES
889,532,411 *5C84CCB3FEB1F8EB6B0331DD410C1CB29A3238E2 metalkiste1
889,532,412 *5C85DC7C8A1E34890664961E622151B1E8D7954A METICA23
889,532,413 *5C81D02D3CA356AE21C14ECB39A0F6239CF65F8A MI57YP35
889,532,414 *5C80E4AB65FDBE24B1B774CCC95DEF51D159272A [email protected]
889,532,415 *5C8E82A40DEB2CB0FE33FEB901515E60CB90B58D MIGUEL INDEFENZO
889,532,416 *5C855CBC546B2029835DF5F6DADC3D7F3F2CD1A7 MUSEO.DE.LA.SECRETAR
889,532,417 *5C8038333118581511B919BA77D4E4E2B7190A2C musicfrompeergynt,op23:morning
889,532,418 *5C8F99723189A4FC66167F385D77A98D946EB9D8 MYENTROPY80
889,532,419 *5C8C05EAE3A324932423EEC58D584F43AE3D0DBD MITCHELLOVERO
889,532,420 *5C84FBB3EA43371F76C2228FEA5E334F97F08713 MJØLKEFISK
889,532,421 *5C81520412FD748A0A00D4CCD5A6C0CEB656A3A2 NAGRSKINARYAN-MARNAT
889,532,422 *5C8E6EFE1B01A152F30B82711E5D5398E16A1A5C mnplrngs
889,532,423 *5C812F5DE5CE0A7E2CB6705E825CC744D0A46798 MODESTOWILLET
889,532,424 *5C8E6A0F2E5D271E503ED41F66001ADC1C64F93D NAPOLEON.OBERLIN
889,532,425 *5C8D1B254342BD29DBB4B6F2175A492FDFABE2DE mohd.azmie
889,532,426 *5C8498888F4FA5B1CF52698E9B2EE72E14C92F0A natarajsubramanian
889,532,427 *5C84344EF473B779BBEE76E580C6D76CF3019BB5 nathanmuinos
889,532,428 *5C82008C924C379404584AFC7B0B852B30AD9CAC ncipesdeespana
889,532,429 *5C86B6E47B4C7040CE0C27A5D158FA915F7DC884 MOSINGERS.COM
889,532,430 *5C8DE5715BFE94300CDEED534F543A66E2B7DDC8 NEIL.PLANK
889,532,431 *5C832E55DAE8957150CC17D39AED2D3C9EB73DD6 MOTORBREATH-(DEMO)
889,532,432 *5C85A729AF4EBE8640CAAD13816E54617270AE4A MOURAZOS8
889,532,433 *5C8CC9984E8CB2749166B83D22EA850B0FC16934 nerezjinoteb
889,532,434 *5C87440AA4A077B065707B97DFC953B2D73C3CBF NESTOR.PRESCOD
889,532,435 *5C80C3E4C8903B7DD49BA804A014E0CD89D7D77B MUNARCID6
889,532,436 *5C837052E640916D0E78D4931EEAF041C34CE195 ngc1193
889,532,437 *5C8AA2E4F555BC3547DE045B48B6EBD732487A4A NIPET
889,532,438 *5C8AC250B511C69EA4D60ED5B3BE81515D707A8C n0na9r1cu1tura1
889,532,439 *5C8E2E7E0C7CA5D73EADE691BF5DDC5C55E6B68E NABOOTOVANÝ
889,532,440 *5C85349B564F7A6C8662BDE0E843B43DB8DC3B6D NOKIAA901012
889,532,441 *5C863D83928BD1DECFC3BBC49444F8C6C42807F1 NOTHOPROCTA
889,532,442 *5C8A14AF926A11D4D2CCB31F4472F4DFC2EB6CAC NO-WAY-TO-TREAT-A-FRIEND
889,532,443 *5C8047523503936B2355F36E8B2B5BE725A7E189 [email protected]
889,532,444 *5C886A8FEDAFA79137A6A5B0C9101FCA08D85670 ntrvrdrn7
889,532,445 *5C813FE24143C36A471166E49BF7B2E7A7847DC6 O1W
889,532,446 *5C8715F18F46663A3FEBBED07714BC3847F68302 NESRENNASEF
889,532,447 *5C8809EC3558F273085C48214372587E777AA832 NEVEAH694
889,532,448 *5C8173E2DAE91DD96166EDE838BBDA60DF15B9A4 odelllamar
889,532,449 *5C81912B2B769B3E0353576AFD56712E14CCE0C8 ODIS.TREAMER
889,532,450 *5C83183C7682F0C6837B8F1726E4F0001A3C476C OETTBB
889,532,451 *5C86F3B465A6D9F896FA96220FA33640E6FCC6FD OGLĄDNĘŁY
889,532,452 *5C837499BE2AD9CC5DAB62EB0650C993B2CA26CE N'IMPORTEQUOI
889,532,453 *5C8F597E35FD2AFEFCB5A25AEA60D0944A00CC16 nitibeid7
889,532,454 *5C8A696BD6A0129121FE5509198EA90C158D1AC4 OLIDARITY123
889,532,455 *5C88DC9F3339E204625F731B83F8599569120229 NOEOGEEN
889,532,456 *5C8FEFC63E18DF2CD88BD93E8D38EF52697543F7 NONIBLA
889,532,457 *5C86A4A2044D5877879115B8FFE9BB7524FC32C8 OLLÓZOTT
889,532,458 *5C8B7C2189F4EDD53D52C3937E7DC1A7C5CA87B9 nonsectarian blues (mono recording)
889,532,459 *5C80810BD5DBF932EB80CA63CDD442526E6E707C Noordwestert
889,532,460 *5C8F9F120BF0100A328CCE15490923A7B4B1572C nurulasmat
889,532,461 *5C83F45290B21562CAFD5DD812AC1BDE60698716 ORGANISIEZ
889,532,462 *5C8268CA76C2DCE0D511D6A001D36FF5DFAD773C o0355610
889,532,463 *5C8F2AF084897263D3EF5A3FF53A2F0E4578DEF5 >-<O~O~D======3
889,532,464 *5C871B20912E601B5CD468327D7CB4F8A5EBB8A2 OOSOOM160
889,532,465 *5C84F06BAD78C91D926DB895DEB79DBD93D2CF73 panackals
889,532,466 *5C8EDCAF4407E922D42EF7C5B649F09F3972C32F PARACONDYLOID6
889,532,467 *5C80132A077BF81FE063CED7AE74E24174CB1DFE OTISSAT
889,532,468 *5C8CE21F28719BA560AB9689ACF4A19C708802E7 pd ~ `(0_<)
889,532,469 *5C815EA611D4879C600E454F09D82D6D0A23A798 [email protected]~~(^_~)
889,532,470 *5C892792C1D063EB30979755FF2A3588C7DA3D3C PERPETUATOR$
889,532,471 *5C895C2ADF4E82987F12DE8BC0FC63899AE51C85 PACOLUNA
889,532,472 *5C8A9F78E31D997CE48F077721913095769F7E64 papafrank
889,532,473 *5C816BD47168F9FDB2E7C01114461D00714BA4B4 PATRICIAKISNER
889,532,474 *5C820626C2EF5BAC65A2F14CC6513F377E4031AD PIRUETTI3
889,532,475 *5C8D4AE65174889E9FE25DC09CE45D36CD3ECA44 PLAVATAH
889,532,476 *5C8D183C5B91C135F9A26E8378C9145ED82544BC PLÖTLICHE
889,532,477 *5C8AA76A67EFBF8F7DEC8F05008C5B9D78FE5E05 penelopespeech
889,532,478 *5C8D36FFD741F3C23EC3840711028BA64C922DF8 polydaemonist
889,532,479 *5C82D9E21E3944A67BBCD2AFA1D2BABEE293F90B Postal.Address:.................Ordering.Information:
889,532,480 *5C84CEAFCFD37DC9F75B500B3BD3537777B3A984 powerbodybbs
889,532,481 *5C8DD19FB804195917F64C151415A5AA3B59A1E2 p-----p~ splat
889,532,482 *5C8E75052AF005379C823DB3707B185572EF6AE7 pr1mr0535
889,532,483 *5C88EF0970F0A3E386111138687CB14117BDC1DB PRATTANANIKOM
889,532,484 *5C847665984BB0099DB3A2B15A975C9B8D9B8819 PIECIUL8
889,532,485 *5C8E426F1552487CACC020966D2F253E326C4662 piirejae4
889,532,486 *5C8D466AB18DD8152E8556E7CAF2F5D0673EF57E [email protected]
889,532,487 *5C8ACA7B12F3F52322F48A3518B7519E904938F6 PINKING
889,532,488 *5C8EFFA471BA848A9CE5E72FDB0F9CF1ED02D2A3 player-fashioned
889,532,489 *5C81A9914BE2C388F6DFE86F27FDAB98EC28652C Plunther
889,532,490 *5C8B192442F5B1E6946A967039331DC021A322C5 [email protected]@TIVE
889,532,491 *5C8A9442959F757C74AB6A14DEEDD8FEB611D47A psychin9
889,532,492 *5C8580F9FAFCB9817CBD4F0BBFD9BBFD29A97C1C PUSTERLING
889,532,493 *5C8CD88A6EA2D4DC9485AEF208CB4361B293600E portsman7
889,532,494 *5C88480BD936AB99BA40F20A18F62CA4F9D9BF8F QB~0.~O.(>_<)
889,532,495 *5C89BC78A5CBF4757F123AF6F5CB3C512F65B5FB [email protected]
889,532,496 *5C882CEAE6759B152FFCC468BB0463D3215533A7 preinspire1
889,532,497 *5C8AC977A8BE77B67F82BB713F0B144F41BC2B7E QUALITIES
889,532,498 *5C838C9C1D4BC06005FBD89874C079D50C8A2BE1 PRINTERUDSKRIFTS
889,532,499 *5C8216727479D06BFFBB2B80345F5A1C4C72AA4A QUINTONVOGTS
889,532,500 *5C8F6916965F7D31A89F5E5C69CEBAE077C13460 prompted
889,532,501 *5C8829C3D08D546C876D1F91D90DE4E38F59390A R4DO3L3M3N+
889,532,502 *5C8DAA19F7D507A89E2429FF201EAC6AE7468FD4 PSLMGZNG4
889,532,503 *5C8B3E5EFCDF8DCA9ABE1B32949CDA36DB311033 r!9mar013$
889,532,504 *5C8A0A63CF0D191A368CC35AF79604A6034B2730 PTITAR
889,532,505 *5C85DA4C5F03CF07BBD9336117B694438954AD17 RAFAELARO
889,532,506 *5C85FF120087F47B9C69B0686EBAB5E51CD00899 [email protected] `~)X(
889,532,507 *5C84F6530AE83EE06B447821E4B7F45A3D0583F0 pyxeqdk77
889,532,508 *5C8FD3B0229DE028B9FD59900015ED16C770673D RAOUCHE-BEIRUT
889,532,509 *5C83808DD9A9B688A6433C0174308C72FD2DBC66 RATMATE2
889,532,510 *5C8C5D9F9A003AF903D5B2B977834DC96057E312 raw-rat-burger
889,532,511 *5C87EDF47F21E3DEFA36DD48BCE4AF707CB12EAE RAYHAN.GAZI
889,532,512 *5C843A0818AFCAE84CE5B58E71F4AA5A26E0ECDE QM"`
889,532,513 *5C8CDBE3DED67E55C8F227BFAD61CEF6D92E96D4 Q-P ~0~OSPLOIT
889,532,514 *5C8639B1FB23729C5E65D0FBEA5F7427009D55DB reaganhs
889,532,515 *5C81B92E03D1AF55ECC81DB12B9AF8BE966A72CB R=\9
889,532,516 *5C8402AD7EA8A3B5F67EA704ED75ED19A0B75C3C racoonaaaaaa
889,532,517 *5C86F58DA81FEC64A5D66065F9B8CE697722432C raga.vilasakhani.todi
889,532,518 *5C8AAF301A44E31994ADFF0DDFD0F0EE534BC642 RESUSPECTS
889,532,519 *5C809FC7889DCE8D5DC856C1EC4567C5CBCC4524 reubenvolker
889,532,520 *5C82B46116696D97217E18DA700B1D891A4D51EC ravenshawinside
889,532,521 *5C87ADAF1CFA6B5A561A6F89A03C310818084922 REZCANETE
889,532,522 *5C87031A8CFEBC8AD4611F32401E00039570E04F [email protected]+OPE
889,532,523 *5C870F7936585786BD25BC1DD4569C5C3B2EBFB4 RICARDELLI
889,532,524 *5C8183B1F57CFBD0F3E09BBD53CC3E70D6973FF5 RICHIELAWRENCE
889,532,525 *5C8B310BD066E781240B9A3D23302105F08D4AFF RECEIVSTED
889,532,526 *5C8B3CEEFCFFFBBF6817D247F5AB1ABA93A0E547 RICHMOND.RICH
889,532,527 *5C866A019464E5BB22A884953D2C9106115781CD ricopreyer
889,532,528 *5C87A8CA50985F36530DFBA4F484ECDC7E89091F ricoweirather
889,532,529 *5C8586346540BF812C0DB98756711DBC9BD3EB1A reggiemascari
889,532,530 *5C8C2369D0B5B07DA3737ADFDEE5474D16B1CBB3 [email protected]
889,532,531 *5C8F30A3A979119803F29F3522EF7674EC6F6B7E REITSUBILF3
889,532,532 *5C85D1F61EF042F69EC2F05B354990C497F87199 ROBERTO.FERSTER
889,532,533 *5C8AA0519C338FC4BA975F9FB8DFF893928C7FD8 [email protected]@7I0NS
889,532,534 *5C82B0C06C7EEF7000655209E3CF4A22881A2F7F RERISCHES8
889,532,535 *5C8074F30476E690B5CECB9786F4E01174364DFA REYNALDOQUEELEY
889,532,536 *5C89F5D53BE8AB2F6C761C517E73AD51669AB109 RHETTTOON
889,532,537 *5C8251B5699A14ABB835ED3BBB7E40CAD24E5B66 ROOSEVELTSEU
889,532,538 *5C87F0E3206E40A788BD3B520F92B3C3DF3FBBB0 richarddreams
889,532,539 *5C81247D6A8AAC5FC6B2EF4219BCAEAB2EAAA6FC rickperigo
889,532,540 *5C819FD7A7A48C4E33B5E54999EADDF572E93444 ROSSETTI123
889,532,541 *5C8608CDD5DE132F779DEA58DDFA1AA981639C7A ROYAL.BUKRIM
889,532,542 *5C8D7E72B906C6E0A9C7A02DE89540BBD68A4FB2 RUBIN.BARTOLI
889,532,543 *5C8CB5A0EEE74F25AEFECE2DD08E1676CC224262 RMNCIITS
889,532,544 *5C8CBFAA141AA7C87363CB0DAD85FE31781FDD0B RUDOLPH.JACKMAN
889,532,545 *5C8AE077F786BDD9D6E6BE7B331E1DB5FB47A908 rudyturney
889,532,546 *5C8DAFE300BF7D130FE955AFB4CBD3428E77AF60 RUEANG11
889,532,547 *5C839C8C0BC2F1F06B76AFEB1EA2B51592CE5377 RUEBEN.ARGULEWICZ
889,532,548 *5C8D18B41E2CE196CBD24359800C97D3832B1FF9 [email protected]
889,532,549 *5C81F26690525086A889BD44196EC4F387AF1105 RUSS HOGUE
889,532,550 *5C8F8EA8FE7D939706145917D35BB3EB48EDC641 RUSSTEEHEE
889,532,551 *5C86C8CF02D66E97A416E574D6A494DBE7E30E95 RUYAPACHE7
889,532,552 *5C8FC3BB9AFD9381B11F2444602AF5874BD47769 rodgerflorenz
889,532,553 *5C83CD896AF5134348CCD39D52248646E61D52E1 RYAN.TOUPS
889,532,554 *5C87E82728556903DCAAD1FA5ED01CAA02F8DA53 ryanttchris
889,532,555 *5C884BF85B77CE8A020F0CE3C40A69A70678A1FE sakvirveli
889,532,556 *5C8794051A9FA251054EEA94996BBB12B373DFA3 SALARIEREN6
889,532,557 *5C8804831ABF83C7C2676E399AECBA39AA9B4017 ROSARIOMOLON
889,532,558 *5C8ACBD768D529A98E0F4CF5D00CF9AD3E7DA8E2 salutlamiadieuletresor
889,532,559 *5C823EEDD210762AE5C53D99286194B2FDE33E6B ROSEDRAGONFIRE
889,532,560 *5C89AF6860243F863810F1400FFC053F40F01135 SAMMIE.LIPPS
889,532,561 *5C8834550B90B6297A13246FDEB701ECEB9DE829 rozieneh9
889,532,562 *5C8D37CB6E3F5C73E1608EBE3760B0129D041E17 [email protected]
889,532,563 *5C8ED9D38A8A32C1CFA73459E1AC5CD89F462E5B rubberducky
889,532,564 *5C8D1128F2588CC1557C63C51C927B3641D3ECD5 RUDNICKI12
889,532,565 *5C8B1826E7FAC7A211BAFACAF03D00D640EAE7A4 RUSSOVANDO
889,532,566 *5C86D6279FB211EA7A79A548D7493623DA61EC51 russsport
889,532,567 *5C8F6CDC1D009DCAEE9388682CDA9B35A7E3D4A7 SBYKARTLISENSRISSASR
889,532,568 *5C89F8BDA60CB22EE288E954CE32A0F181FD450C SCHIMMETJESES7
889,532,569 *5C8EEF37F66D389F8A51F8B969C435CEDD652676 RYPADLA1
889,532,570 *5C842D18FCA5E2B8220359CE6BAEA2435155D931 SCHLESWIGSUE1
889,532,571 *5C8AE3B1FC42131E26A61482B280A17FCC767854 SCHMIERUNG5
889,532,572 *5C883457084FDA21FB0655E46B643F41AC19CDDA SCHMOHE1
889,532,573 *5C8A19A4DB968612632ED3111ED86C3262987ABC S#*5
889,532,574 *5C8FE59E03D1EFABC6894FF9F6E9C5A90E32D0D9 [email protected]
889,532,575 *5C851CC502A561EF17D25F190B2CE3A7DA8615D9 safier7
889,532,576 *5C897D8B7EC1D8E955D1FE31191AFD505224EB2F SCOTTYMUSS
889,532,577 *5C8AC7CB662EE74C121ED5C6EEE13241B1B25F39 scream-(radio-edit)
889,532,578 *5C8B065B2FD8DA2843A7C7B8458BD088537625D5 SALAMYSED
889,532,579 *5C80A6D640FBBE6464CF5D0435032D4A02CBA36B SDALPRER*
889,532,580 *5C893B1D81C7548D77D6F48C0CC1F977A69BB28D SEANSUSLA
889,532,581 *5C881E397DC9CA834A58D819640AE8DA720526BE SAMIARAN
889,532,582 *5C8D021CB50E1FEA4D34FA52E9A671A51404BE86 Samson.et.Dalila,.Act.I:.Qui.donc
889,532,583 *5C8FB8C11A72CEA143F4D5FE2ED4B214A11C7995 sehsiraf
889,532,584 *5C816F9545068360117CC474ADB8114E4B8CA341 Selim-II
889,532,585 *5C8D6E149E342CCF363C2F60902C6B589B8C1C29 semidecayed
889,532,586 *5C8E6F914B9CEC0B6DCA25D0639DDEAC8EA46F5A SENREOTADSESLEDETSDU
889,532,587 *5C8FAA8E9691263B7662DB1832A3059F409789E8 santiagomolla
889,532,588 *5C8DB7F9179193997479C68F7C2F4C7CFFEAC7CE SANTOSTOYANOFF
889,532,589 *5C8C3294BCD8FC16649C2E3F03BA525C881A023D SERVRKA4
889,532,590 *5C8D1171359630547345C60F26A54AAD22050581 SAULGREEB
889,532,591 *5C8F56CD1D7F14D82FEEABFC72264BCB376AA17E sevenpointed
889,532,592 *5C83E58163B78489830E08A6017CBCCF59B2C067 [email protected]
889,532,593 *5C8A6D45A761E3A79ECF3758F6A54D1D53FCA796 SHATHIARY
889,532,594 *5C87281E10A061A56592F315672F59048BCA7277 SHAYNE.MILTENBERGER
889,532,595 *5C807974F2404C5F777615557B76BE0F34347457 SHELDONGARLOCK
889,532,596 *5C83EB6AE4DC2D565F8A6A032C5E86783C436438 sheltonapruzzese
889,532,597 *5C81800F351391581FB79A02C6403B16758A0A5B [email protected]
889,532,598 *5C8484267BC13B39C44C884C38F0B508E0E4102B seanstaves
889,532,599 *5C8C794EB60FC8CEDD90BB24CA35BA26A8DF0DD7 SHIFTING
889,532,600 *5C89F464C68C66B1A08131271C11C7FD19E8B8BE shomely
889,532,601 *5C873EE9E5CAA938D9C11465C1932ACD10F4B8D1 SHORTY-SHOUTS
889,532,602 *5C88D7948CFB76915CC7C4EBEE8517F6762B8601 shower your love on me
889,532,603 *5C812996545249486425A0C1C1A6D004F862D5CB SHOW.ME.THE.WAY.(EXCLUSIVE.ALBUM.MIX)
889,532,604 *5C8D22122888E5A8DF54386A24F07293F627D78F SIDESLENGS
889,532,605 *5C8FDAB1DE9483321BAAFD02496F9254C711406B SEOTTALU5
889,532,606 *5C8BDC0F2C6B2230ECB5612C47DBFEFF8E5253C0 sieglingiing
889,532,607 *5C8C13ECF1E7647BC83A013CDD172CA1AC699B4C [email protected]
889,532,608 *5C86FD733EAD2E806E5A582C46721E61FD248722 SEVENNICKS
889,532,609 *5C81AF55E234043C5082079610755035229D86D4 SI-QUIERES-BAILAR
889,532,610 *5C8EA47721C98E2AC8030F9EBB4D8E2F7A40AC7E shadbreslow
889,532,611 *5C80809178A6395CFCB847D56D890F5363620AB3 SHAYNE.FLAVELL
889,532,612 *5C84B0183D51D0EA44F92C4AF95A8E6293F92EF8 SHAYNE.KUCHTA
889,532,613 *5C8E91ADF0D7284A08ACD376BCBDCC14F3E0060A SHEA215
889,532,614 *5C8BCEE3FE98EA89255EED7E58847968B1E16D9E SHIFTING
889,532,615 *5C896E1D5BCADECC0D15D79ABB8C085C1901D2E9 SHIRLEYSERA
889,532,616 *5C8462FD7AB485E6C095A662371158BD46CF5117 SHIRUT!
889,532,617 *5C8283140BF705DE307416DA5C71408337E7A14D SOLICITACION4
889,532,618 *5C8D7018755337BCD00C479B8EE9A27C162A50B6 solomonscherbring
889,532,619 *5C804EF4059424324500AAAD4CC7B12F333C8541 sondrarobertscomsondraroberts
889,532,620 *5C8DC1FE8CBD981E6C5CCE94CDEA9D124476FACD sierra-elizabeth-langston
889,532,621 *5C8BD0D003A80C50AEFD354A26AFA81761F32610 SILAS.SKRADSKI
889,532,622 *5C826718728B279CC18CBAE0AF83F0FAC8B49AF9 SIMIOLIN5
889,532,623 *5C8B22E6ED13F247C2FEA90195254C6A5FB79DFD SIMONZINCK
889,532,624 *5C8A3A41D4F900A3253A6D4096231AA60B06EFF5 SIRALLEKED
889,532,625 *5C80D904989EC57EA691A8FDA608B75378A8CA0A SIRYOBUN7
889,532,626 *5C8AB45380EF5B2B2EF87EE4CBBB8C47EBF3569E SOURGIRL(LPVERSION)
889,532,627 *5C86A42E59DAA4B07ACC4A72EF2E873EB3528498 Splat~`.~`.(###3
889,532,628 *5C8C2CCCCDE777E11532ACDC9211790F183BC7C7 [email protected]
889,532,629 *5C82345705ADE7105FD3C7B6CCA86B7649B693FA [email protected]
889,532,630 *5C8FA5042E4B0EB188A604B336A7367A767CF7D1 [email protected]###p
889,532,631 *5C8056762916CC45973203261DB4FEAC77328510 SNCQ
889,532,632 *5C8B46C13D9C30B3072E3A246B1078DC430F4994 SPRITZEDS.
889,532,633 *5C8FF272FB4D2389F01A351157B9AF302919B4B3 SOBERIZE
889,532,634 *5C873117AAA045ED77B285022296083475579333 [email protected]
889,532,635 *5C8213B38401166528EFA09BD4092979B0B57CE7 SSOFDUR7
889,532,636 *5C8B66A64D50E31779097970C8D7C6BDC373FFEE SORTIEDEBAI3
889,532,637 *5C8993B84E721C04B079AC09ABF8AD46815CC1B2 Sotto.'o.Sole
889,532,638 *5C883FAF7656789F53422B8F09EB350E8C2DDFE6 STAKLES8
889,532,639 *5C8BA79C45D223EAFBB82E17E88957522098E746 STANTON.LEYRA
889,532,640 *5C85F35F79642088E3820A4037FB78933A53E2D8 SPELDES2
889,532,641 *5C81A6B7B44A0FF0EE488649321E0307BC00553C STEED2
889,532,642 *5C87FC6A084423E1AF4B04DB5D310640995E75E3 STEPHENFORTS
889,532,643 *5C8FEE692CA0B76E05AE6759C88958C0F729920A STEPHEN.PREMEAUX
889,532,644 *5C8A96D7A72A181F42E4A42B2E3EAF80392DBC72 [email protected]###p
889,532,645 *5C88592D0361137304614C03A4F4E18344EB3BDF SRAILGIP
889,532,646 *5C87427D434C412CC555C80F7D6EE8F5435629B7 STRINGSBAND
889,532,647 *5C8111CB7F99C1F2CCE0F1B697E041948DE303C8 STUARTDEFIBAUGH
889,532,648 *5C8462AF32F85EF50DA1D24CD5F8D230481EF704 STUPIDSING
889,532,649 *5C8E00957FE2E20EAB6D16E9B6A9050010DF26A3 SUINEGYELRAM
889,532,650 *5C83924A6D6B34A7F2B4112763235A0D1327431F staškevičienė
889,532,651 *5C815BA45133486BF92D2B61C3318D174D384AC8 STEPHANSNAPE
889,532,652 *5C8B386106AE1B6B9CA97C4B36EAC4B0D1DAC9E3 supermichaelbbs
889,532,653 *5C88A9BF730961DB2623AF8729939BCE3D5F8BD6 superterrane
889,532,654 *5C82FD8FCEF1367FFD8A3C2308734F8AE474818E SVITCAAQ7
889,532,655 *5C8CE426CA30A55728B39F98B2F6FC7F5146FAE2 stoynell
889,532,656 *5C8E5D2C7F12B77AC2563D1CF462DBE3DB0F69A4 [email protected]
889,532,657 *5C8FBC85893566FE42A4EA31BD976B69654A01ED sylvani
889,532,658 *5C82C2AF7766C6BB3E8E42C0B27DB27AEFB2C873 symptomsofaquarterback
889,532,659 *5C8985ADDAE5B41C2160D38AF3D3D918D349434D SULKEDSULKED5
889,532,660 *5C8133B0D0CD275823860EB7BF167EECDC804A6E suprotni 1
889,532,661 *5C88844FC1D22CC5986C4EA402F813820709247F TANNERTHANG
889,532,662 *5C83C0C4445343DA3AC55242B1FA1611EA192340 švitrū́nų
889,532,663 *5C8F4723024ACB923766B6824536D9231E786613 tajjiting
889,532,664 *5C835BB35E2D0F586661E4C1D1C53E20FFC5A644 TALKTHE_ITCHY_AMP_SC
889,532,665 *5C8E0D388B7DB52782E40E5F7D9CF1EBC43298FC TALKTIPIT
889,532,666 *5C882A01ADE00DDE98D215DB8C9764E47AFE74C2 TFC006
889,532,667 *5C838C506AF21381056D931E22006D3E8CB979E6 [email protected]
889,532,668 *5C8877F93B9F0D95061CDC2D49822AB7DCE95952 THARAKAPRADEEP
889,532,669 *5C803A0B2AB9315D1EF7D6DE45F50C615F5CCC1D tdeu79lcleev8a7x
889,532,670 *5C870850961DA57AF4A3125B0FC5F78088F7B9C3 theonlyone12
889,532,671 *5C8065F24BCBDB9773591089699E44E677487EFC theronjohannesen
889,532,672 *5C8F1891DA3B6F9877B886F6A86CC0A400094ECF THERON.OLANO
889,532,673 *5C8433D78016F8C6DA614D227A27366506291972 teps’
889,532,674 *5C85B06F16644AA3A70FD47D59628337EF5FE1B9 thatsuperman1991
889,532,675 *5C83A406430B9D00884F268F5D75D077D2C03128 THECRACKER77
889,532,676 *5C883D57E13853EA20C631756D84F0214847BDBE TITOROCKAN2
889,532,677 *5C8D6240674E9C8D4D3EC672E9F17E5698E80A51 titti-in-orbit
889,532,678 *5C81542F75AEB794CEE72ECF8B8EF866179B57B9 THE-GET-UP-SYNDROME
889,532,679 *5C8C8DA95FAB35A31DE55F8647938FCEE7792131 thejenni1
889,532,680 *5C83FD0EA9F208B14BBD9BAD1ED86FFB9E739E8C Thequeeniscomfortless,andweforgetful
889,532,681 *5C824E79DFDFD00C8D2B7C6DB4EE9EF20B5EB097 THERAPYTHREELEGGED6
889,532,682 *5C8F59FC6B6274AAE1210C92ABA991F82EBE96E8 toebereidden9
889,532,683 *5C8FF564ABC7DAB9FD16F896C9F53E74FFFD12B8 THEYALEUNIVERSITYMUSICLIBRARY,VOLUME3:BIGBANDINEUROPE
889,532,684 *5C8A99432D7E4B49B1FE6783121043F0181421B4 TICINOO3
889,532,685 *5C8042A2D02D1690C37E7A1322B6701A28336C35 tidsskritt
889,532,686 *5C8ADE4D64B5E85554BC84DB3A27FEA0BE5A4099 TPABOT
889,532,687 *5C885CCCD9B61F9492D1D6638A9F551145EE6A31 TIMEHONORED9
889,532,688 *5C835A3903F35C58B23CE9BBACF8E001D965DCE6 timetraveller(disc1)
889,532,689 *5C8FE86904EC60ECC95571EC7345EAB492C1E93E TJAART.VAN.DER.MERWE
889,532,690 *5C80CA654A74DEC7B2B93814980874E40B2EE484 TREVORTREPANIER
889,532,691 *5C825827BCB689D80B43A094E3C3CAC05B4B295D TNOREMRA5
889,532,692 *5C87234DFF1C26993B7F2B036D71A23453655963 TRICIAKNIGHTED
889,532,693 *5C86409DFD32BC2A4513F204A49351020617D114 today's-news-(a)-:30
889,532,694 *5C8E9F3D48A15B950451ABA2FB03053A83B79A58 TRISHA BEHRENS GIBSON
889,532,695 *5C8AA09E7932E333EBFAA89EF3EA16BF70DCD79C TOMMY.MAYSONET
889,532,696 *5C8FCCABB29B514731B9EBF07BA478E3238753D8 Truly-in-Love-(feat.-Peter-Toh)
889,532,697 *5C8F1D3645B833FD9E5EDE8F8C7B0FE8FB194EA9 tsakani-yvette-minyuku
889,532,698 *5C81DB3909763C83286B1F40D37E6392906F2F16 [email protected]
889,532,699 *5C870574E588E5E48E8283AEFE91D03C4412CF32 (to stryker) walk until your feet bleed then keep walking
889,532,700 *5C832C76A20EC1A4AA08AACA42269289D5021ABD towards-the-altar
889,532,701 *5C8A6578342FBF59DBAB2EEEF1516558976982EE tubagusdhani
889,532,702 *5C83DF4C170AACEFA6B6823EBDDBA7C18A9E014F traganopteryg
889,532,703 *5C80FCBB1D1D3E7001640E92381203FBF80492C4 TRANSCRIVIONSES7
889,532,704 *5C841992E4E9D6E5F8F6DBBC390D4FCAC4B0ABB4 TŘÁSAT
889,532,705 *5C80423FB2B8ABA895C1E7EA3E38253E4F31B66F TRENTON.ANGRISANO
889,532,706 *5C84B71703A5DE42E1F441A3ADCBC29FE6B0E08C TYLERHAECKEL
889,532,707 *5C89C9CD7093B15414AC474F92F1D83E2554CF1E TREYMERATI
889,532,708 *5C8C7F35A92B63516E995D8AC0438ACD7B53EB0D TRICIAMCLARRIN
889,532,709 *5C8D6300308B4AD7E5D21F52B03396B38C31BA1D U01060106
889,532,710 *5C83CEAADD38E3D2FBDC504A0DC919864F9325C8 UA;B
889,532,711 *5C8177F5D793D0F70DE14E7967AA6B7EF069105B TRNQLZTNSED
889,532,712 *5C86B3844AED9C02AAA5A2E7E7742C6A13BA9627 TRÓJSZYJNA
889,532,713 *5C82689E34E11FBF3FAA3E1AE82CED46FDD74855 TROYMCFUNNY
889,532,714 *5C878655095D0041A3B9F56365BC1B286A00FD24 tsac5
889,532,715 *5C8229695F07408E34557740F3D59BBABCEE7CDF UKUFNER4
889,532,716 *5C850DA7407EBAEFD20CC7CA359B954B7E19B3FB tsrubnoegrubdubhcaorbpu
889,532,717 *5C82754090C2D660D2115260D2BECBE452163C5A TTOPMINNPPING
889,532,718 *5C8CBEBB14775EE178F8A5665A33B4BE865997F0 UMAIR.INGAR
889,532,719 *5C8758FCBACCD0771B950658384ABB221FDB5D2D UMSCHRIE9
889,532,720 *5C8CC0EF6F0F72ADB623A508479E351F1E6FF72E tuestl'ouest
889,532,721 *5C8C5BA25AD6B1DA7389F6B6D1B38E8D789B1438 undeligh9
889,532,722 *5C8C06EFA25F8C210F9896189C24275B0ECECFE9 unpr3di$p
889,532,723 *5C80E5D9A2AF3891AFBF03CFC956B68CC2F7227D uns-doch-mal-haschen-/-marihuana-mantra
889,532,724 *5C8289C123C02A73AAFDA6A0386AEF65D051AC00 UNSYSTEM4TIZEDLY
889,532,725 *5C84A1D75C2A717AFE904517869091E7F8163BED TYSON.PAHK
889,532,726 *5C833713FB261D41D6A3E78A8AFD72F5119879AE TYSON.POMPONIO
889,532,727 *5C8D6308F41032C948580DFB4E2B38C548600459 TYXAIWNING
889,532,728 *5C82B94C21938AD72543D3E8FD87095A74504182 UEFFECT123
889,532,729 *5C8108B7295E84BE054636D1FC5356088C8F2EB8 utaylor9
889,532,730 *5C8C7ADFF02171EE943C5A251D0DB6DACCD3B6F2 uktamjon
889,532,731 *5C811F0FC4B5AC77712BA564508E6E70AFD87242 [email protected]
889,532,732 *5C8B919C99564CBE60B84EFA28A59556DB2344E2 [email protected]
889,532,733 *5C8CFECFA115C8CB8589ADF1867A330C3AC802DB universeoscillation
889,532,734 *5C8AD3A10CC5400DC3C9FE70F602C36864389C61 valerie-niederer
889,532,735 *5C82915BFCAC344BEB40866D2C1EA5386B94932A UNPAIN7A8LY
889,532,736 *5C8547F7F65488B5569AC03B3625B6BC97588F5B UNPERFLATEDS
889,532,737 *5C81C3D3D6E6E8F9B1E7A450C78382D13AC6885C Unvorschriftsm
889,532,738 *5C8E9CD54AA6BE95D2353E2E9C46391F0DBFD249 VARINHAS123
889,532,739 *5C8538C3D1EFA6537BF6A1A8CBAFA9B4C6910DE7 URSPRAAK5
889,532,740 *5C88B52E5546937703DF85C9F8BD83CFB03EA7EB ve}d
889,532,741 *5C8D0B60AD7B05DF43F3EBD70CD4F973E46A2B9F usedandabusedvintagecomwww
889,532,742 *5C84473FCDA88BD3AB092FC5C00C3BEF8997C8EC VELVETCHURCH2
889,532,743 *5C815E8A5D99C3E1174242F08464AFF8000C4083 VENHKY-WILLIIAM-YIM
889,532,744 *5C8CB6C1D3A447917A85792FBCF10D35490E3E4D USUN-SHOTTI-RILEY
889,532,745 *5C8849C5B1B424B4C2C12ABE5612C94440E172D8 veristtsirev
889,532,746 *5C8BDABB71C7CB2A3B1C2BFCFDF4CE0956A2DCFF VALEATONWHITE
889,532,747 *5C802880DF07A19817E79AFDCAAF2D1BA5091B73 VICTORIA-PALMERTREE-BLUM
889,532,748 *5C8F2C2B97C5C984CE468378F6E508A6FA9A7256 VALLEENRICHARDSON
889,532,749 *5C8946F6C7300443B2628D9EA2BADDCC85A20782 VALONVAIHTELUN
889,532,750 *5C81DAF52EC2FF1DEFB58085E09FF9D6A40A2AA5 VANSHAJ.SETHI
889,532,751 *5C8D3DD05A39E3E5A6BB99236E63B14B07EB5858 VASEA-PRUTEANU
889,532,752 *5C8734CCDD52C9A05A2101BD7690B7ADC28B50C8 VAUGHN.LINDEL
889,532,753 *5C8A32AF4E4ACCCC3477EF1CD5D096833FA3C2DC virgil-willoughby
889,532,754 *5C8B09239E78B6EB16D4BB58DDE935DA9AF31166 [email protected]
889,532,755 *5C8DD7C82BFAF1DE1EA6A0B71BA808E6BCA0C4C8 Visions.Fugitives:.Ridicolosamente
889,532,756 *5C88A6CA517D9D8E18F2FF2B580FDDC74B877440 VENDIBILITY,.VENDIBLENESS.
889,532,757 *5C887DC68261E6C36B4F73AE526E06D1711C01F8 [email protected]
889,532,758 *5C834E6F84FA4F4733CF27038480391F22563126 vernon.rudd
889,532,759 *5C8497A4D37F56CE76D7117691574E79501EBDC4 VQM1234
889,532,760 *5C84662955DB85AA54E4BC9582E198713C08B4F6 vrishika
889,532,761 *5C81A3840AAF424A8494AA2322163508FBBE2CA6 VSTAIKOV
889,532,762 *5C8EDB087A6EDF909378E3C1CD42A5BD3E0110F7 vickie-clapsadl-burwell
889,532,763 *5C866688D6BC94B9E9436D35BACEE7874E336AF1 vickiecoetzee
889,532,764 *5C8F0D9249EA49993B967634C22CCCB34B80FDC1 %W(AAA
889,532,765 *5C819168C81BD555E273025371EFB00876F99218 WADE.VENETOS
889,532,766 *5C8359C35CCE48DE09810BF3F17B430E102ED386 WALKERPICHER
889,532,767 *5C88DE2D49E262F3DAB7EAF6C565BD924041EA49 wallbereich
889,532,768 *5C894B295D6CC8C543C0ACAE07211D82FA409340 VINCENZO.KOGER
889,532,769 *5C86BE6FDD03F5390AF12817EFE5B698584D8B70 VIOLETBEDELIS
889,532,770 *5C85185399B9F8633874F1BE69D121639F61570C WARD.MCCOLLOCH
889,532,771 *5C860960874FC50444EA6144A89293A33D8503F9 VIRGONITO-ITO-B-SUSENO
889,532,772 *5C8164E3998F8FD02C97C6476A3FBD4888DD0294 ビトリア(vitoria)
889,532,773 *5C8454AEE16D18CD92EA422C1D317CA6809260CC vohoainam
889,532,774 *5C86185812D4958356A66C410AA0BB7001F6150E [email protected]
889,532,775 *5C8781C7E75E5729D5A013296891DF2A87B39942 VOLKSHOGESCHOOLS4
889,532,776 *5C82F73378D28D063C7F9E3B0911BC7EE67D4033 wendellswiatek
889,532,777 *5C86C389BB83543D744468E409617DC3333E1713 wendyirishkalk
889,532,778 *5C876442C96370C4B658395193D6BA1636A51CF6 VSSYVH1SY0
889,532,779 *5C8E68A49CB573195433AA833B50D21A3BA89DB4 [email protected]
889,532,780 *5C805A4289F449D0C4A1FC86A384CC7C7F775AFF VULTURENI160
889,532,781 *5C80E69B6CC8FC7AE62BB3A2BA7644544A7EB4A4 [email protected]
889,532,782 *5C89A1ABDAD3B73E9F9C38C8A2DABFC11064F532 VYHROCENEJSICS
889,532,783 *5C894857B539DC315B6FC26BA1E6FDE993BDBC4D WE.RUN.OHIO
889,532,784 *5C8CD60DB9BD2396F5666E051B965593AAE9E643 WEVERSES7
889,532,785 *5C85E310C3749DFF5214AF9EB31CB1BD322EA9CC WHENYOUKNOWYOU'REINLOVE
889,532,786 *5C83F2EE4D5C38E21A6EC67E58FB49B837999AD3 WIDEOPENSPACE(PERFECTOMIXEDIT)
889,532,787 *5C839EF06F68C5F1E4E4E8E124F0F37AD0EE444A WANIKA.CHLOE
889,532,788 *5C82E2E971051BFCB834084D801EB6D971F8241A WARD.TROVINGER
889,532,789 *5C811A542226705E91CECC4363B166F38354CB50 WARNERTOPCAT6
889,532,790 *5C815280118C487A45360B053D1A0CA86433A2AB WATCH&TRADING
889,532,791 *5C8C68C8C45A697866AC95F4C60B3AFE5D75F771 WOODSAW1234
889,532,792 *5C8A3F97CFC5DB4A185A44A85261636F37DD86F5 WOR1DRED
889,532,793 *5C8457F6BE77C6FD3FE329B9D2C412A7497578C0 WE ROT THE VOODOO
889,532,794 *5C8BA897DBB627BF79000F6E94A6EF9AC1F38C55 WORMINSECT
889,532,795 *5C8D48E11328CA8716E6DFEF89B768EAD34E61F0 whatevershallbecomeofmichaelcassio,
889,532,796 *5C8F7E08FAC20E13AF673EF79902E479B956A4A0 WHATIFTEXAS.COM
889,532,797 *5C8A68ACC80F47C3805821AC85AE6BC5D68293BA What-I-Lack
889,532,798 *5C8B0771A8C4B79DE8B8F8F012FCC7E465B1DC04 WHENIRISHEYESARESMILINGA
889,532,799 *5C80BC07508FE7F77945A56C04C0B3E604E875D0 [email protected]
889,532,800 *5C89966541C0728AFA9FA97BC2402717E23B84A6 wuleming
889,532,801 *5C80A911338961422CE8F56FD120C37AEEE52B51 WWW.FLUSHEDMOVIE.CO.UK
889,532,802 *5C895D9F5B76F8AA0E7D51950E1E76EB49101F90 WIKIWORKER1160TALK16
889,532,803 *5C8E4D25BFA48CFD0564C8FAD8F454770904E8B5 WILEYBLEATTLER
889,532,804 *5C86E5183C295808CA761AC222917A134B4F3B7D wzbudzic2
889,532,805 *5C8B3582CFC2EFA4C21856CFA383FBAE1DA4E876 [email protected]
889,532,806 *5C884A96AA027F15CECFF7E3F4171011FD958831 XIEJIAOMAO
889,532,807 *5C87460232F03EE50BB960C4D70B4E5E42982B25 [email protected]
889,532,808 *5C81C12605E83A751D1F0B4AB14177A08FC7C38C winnietarmis
889,532,809 *5C88FB57689B17FF9F5941F7BB8A94AC90AE2176 WONHO.LEE
889,532,810 *5C81A504E7E4FBD9E845BC8DB54423902C3E0AA3 WOODFOR
889,532,811 *5C8C082F8C0B7BA7A5529AE00332C412BD168ECD wr9913r
889,532,812 *5C8F6AD35979E0B52033AB0FA2874D5C4B85CAA8 [email protected]
889,532,813 *5C8637163308FE107AE793C7EFEA14E49A6172E4 [email protected]
889,532,814 *5C88D6CD688DF801518CF650EBF8DDBC395B61BB [email protected]
889,532,815 *5C8BE447BF11EA6F949938D1EC30419E9C8AC81E YASER.ODEH
889,532,816 *5C80C2D2C36CF8D111AFC38729274DF7BB432AD6 yasminearastu
889,532,817 *5C804D6F31E0BFF4088104B9ED2C8D12C8149598 WWW.VANWINKLESIGNS.COM
889,532,818 *5C8DAE8CCF44B97BDE034CD0AB20C18995A15725 X[}`
889,532,819 *5C8CF11E8A3935AC9A05D5F42353DE505421ACFA yfircala4
889,532,820 *5C8D1B780B797581CADA271E26677A995EFD30C7 [email protected]
889,532,821 *5C847FA93D8F0B3E904FA9C81E9A195573864873 xiddamaso
889,532,822 *5C8D93D438260E1FEAAA5DEF7B0DE609EEC937E1 [email protected]
889,532,823 *5C8ED7914C03EF4880EDA1A487EE3137347D3DA3 [email protected]
889,532,824 *5C86F9C1BDEC7DF2743B01566173D0E210FD1C7D [email protected]
889,532,825 *5C8B29597BBD9A6D524A465849F6ECAFAFA081DF yahweh-elohay-kedem
889,532,826 *5C86F30A6EB0E22D3A0D83E949746769AD16A185 yustinayou
889,532,827 *5C80AB6F78B21EF5596B48EFC8235B33B9706D62 yanny-ransun-rengkung
889,532,828 *5C8E82CFD982FC2EEBAB2BDA395E470FFD800F6C [email protected]
889,532,829 *5C8E58239F4DF0A155F7790E31A19D0FFF9E77A6 YASMINAKJERSTI
889,532,830 *5C88F608735C734D97096528E19C097B571EFECA ZAINA.SERYVE
889,532,831 *5C808CBD789D855A0DED20A48A899C6AD7EE3046 yendyliliana
889,532,832 *5C86FD4873B0BBC666FFD462F9870943EA653EEE YITONGSS0
889,532,833 *5C8278EC9BA99CBF7CE3A76452562E6CCEE4F891 $YMBO14EO
889,532,834 *5C8353F2AD4CADF500999333C29BF8437EC4270F ynglingasaga(toodinwecall)
889,532,835 *5C82023F79471039883545CA77C47C34916EF755 YOUNG.WAYNICK
889,532,836 *5C8902507D7CBE579A6515144B50B86177C5E346 [email protected]
889,532,837 *5C82579A1ABC62E5ACACC6D26BDBA3BF761EDBAB ZOECALO
889,532,838 *5C85E261A898A26F6BB0A40DB3ED33F0CD8DADD5 ZORNENTBRANNTESTE5
889,532,839 *5C8A09FD894489255924792DA11369F87270E125 [email protected]
889,532,840 *5C801F4370DF5BF383D548E7F5AD0E63BDDD11A8 zullfadzliamirull
889,532,841 *5C83B7D3B644E595E918BE466131535A7ED5CE55 ZAHRAMALGHANI
889,532,842 *5C8A7F968617F254A00985AA9C5F60229F2AA866 ZEBEDEEREID
889,532,843 *5C8C339FC9C71983ACA5E565A1062DE5BD8CCAC8 ΟΡΤΈΖ
889,532,844 *5C80757E7408319E4692F018AF193D101EE83098 ΠΛΗΡΏΝΕΣΤΕ
889,532,845 *5C800EE130C97D3F7796EE45821AE43C97B42E75 АРГАЎ
889,532,846 *5C8B502E60B62BFC8C126B996BB09571052C9E4D ВОДЯТЪ»
889,532,847 *5C847B70CE401ABA074331EF8205AAC7F7291016 zjianlanz
889,532,848 *5C880246BE0DB1E01E0A480BCA5D1B3C1223DA1B МОЧЁНЫМ
889,532,849 *5C8B8A601C9DC35DA66222741AA3EB13C618E9A8 ZURIK.ABDUL
889,532,850 *5C8C648EC03DF006A6516F78E4670200AFD94FEC САТЕЛИТСКИОТ
889,532,851 *5C856497D7E91023F4B189052062BAA97ACF6898 ТОРТОФФ»
889,532,852 *5C86E6EAA4C860516BC8C5DB2106B60218090059 ХАММАНГ
889,532,853 *5C87FBDD6292934E051F12BB000017D48D72E81B 体育(c)
889,532,854 *5C818D82B980DDBE233E7F985DE0617CCE2C69D5 дернхарт
889,532,855 *5C8790EA08825386BE2EEFD159687CC173682EEC НОРІСУ
889,532,856 *5C85024216DFB3DBA1CA184722737667B98E0DEA «ПОЛЯНУ»
889,532,857 *5C85EF9D1861CBA09992B483BA1B261A03C0E2BE САЛАМАТПА
889,532,858 *5C82C95D4E4BDC5329294BAF185DBE1C0F73C387 08.14.1614
889,532,859 *5C89C7C16E13BE184EF9AF1125600B3428742F6A 0myrandy18
889,532,860 *5C8CE50C2B806E439B9F78D3B2DEF42EE22AD3F9 1155098 NUR LEISTUNGSDRUCK ODER GAR UNZIEMLICHE ANNAEHERUNG ?
889,532,861 *5C87BFC90C73AF2479E5816D67E346339409D40D 123nairobi
889,532,862 *5C8250C811CCC90BCDF7FF7B50E47F9FD6BE134B 170.PERJANTAIAAMUNA
889,532,863 *5C8A46F77F939B707727A6C6C1AF664EEF6F04B4 180g:.'a.big.108.place'.part.two
889,532,864 *5C8C1BD84A8FD23995553F89FAD2DABC4E59903F 021896L
889,532,865 *5C8D3C2C8ECB17D5D2FB7D490F959FA2EEC13ECC 1.glumow
889,532,866 *5C857589985350BB81079A9D47ED36D06A0AC602 097xzavier
889,532,867 *5C861A4152CEAB2BF70F711CAF34E3D71DDA6B28 0BS7RUC7INGLY
889,532,868 *5C81D81E31C3251D9FCB209E1A2E70961D56C462 1.JUPA
889,532,869 *5C8655493E346CDDFAF86A7EB4CA2777093A2C03 [email protected]
889,532,870 *5C857F62CAF2D87959743233B573F0B85BD79EB7 1.KISMIYDI
889,532,871 *5C8BEC358E09BF2F97BECBAD900617FCF7ADC509 1liikenneosiossa
889,532,872 *5C8E300FF46AFF154AE65424E7966D461F1BA1F3 1MAASTOLASKENNAN
889,532,873 *5C822357772C3225AF6099B1E74F1A6ED4618163 1.maestroyhti
889,532,874 *5C811A448F1B2E51370CFE431E51F692F6A5626E 1.meri
889,532,875 *5C8110B0C8DC5E22D0F8DACEA293516309B9BF55 [email protected]
889,532,876 *5C8C2374B38BB424404CBB889CE5991655EAF58E 1308020 ALKUUN-KIELET-MENIV
889,532,877 *5C8B843D02ACB5AD2F60808A97E0EA3613644AA6 1ONTIETOJA
889,532,878 *5C8B382A769379A62D37885888355BB16EEFF840 1 PANSSARIJ
889,532,879 *5C85842672ED756A74A6601E16B957D2DA89A695 1-peSimiz
889,532,880 *5C888785507D24097F33638771C81E230FB98FC9 1637736 haluatko.kohteen.,.miss
889,532,881 *5C8D8EA355DDC4B0441DE599E2ABAC576F896B76 1sketcha
889,532,882 *5C80A9E65FFFAA7E2642797420E1A90DB8ADC684 1thatelement9
889,532,883 *5C88A37A0BE8F3D508323709A44D02E71E136133 1918742 l
889,532,884 *5C85B90863C2BF7072CF8E39C9B787E48FC10A95 1.wolynien
889,532,885 *5C8626D6A7590B99434E0B25DF88B4AE4E30190A 1a7b7
889,532,886 *5C86DFA008FFDB956A7C5EA9F6470F8720A2D706 2076137 DANCINGISTOTRADITIONALJAZZASOKRAISTOGUMBO
889,532,887 *5C8151F2D893E6142ED22AFDA56B84F892DEF240 207KORBIN
889,532,888 *5C8488D2B4D9DB6069D6E2B4CE020821EE66BE9E 1AUTOZWERGE
889,532,889 *5C86CFC518D717556815F0A51BE264879AC311C5 20ict
889,532,890 *5C8EA8866018C733159A0E7B3F81ED018249CE50 23-JuN,-Tue,-23:11:52
889,532,891 *5C8F520D6DEA88E3AF5F9948AC9D6DF519870C90 240191 tosun , m . , i .
889,532,892 *5C88AA2AC579C5DE743C531F549A46AFBF6B7178 1.ehran
889,532,893 *5C8FB839170EAF99C0A6D5864CDAFB474E15CADC 2505026 MUUMAASEUTUYRITT
889,532,894 *5C837B731F572E7C3DE405A2349839EAF0CE3152 273757 he also declined further comment on the sec filing
889,532,895 *5C82474E3CDACAF60F75EF8A010E14289E53107C 280087 denklemler i 3 4 406 kismi tur .
889,532,896 *5C837CC7B0D30744BFB159E09757920F0FFFADF9 28637 HINT-:-LONELY-PLANET'A-INANMA-,-LONELY-PLANET'SIZ-KALMA-!
889,532,897 *5C8A16F979A69DCFBFB5F80646259C8519C3DAA6 1ILMAMASSAUKKOSIA
889,532,898 *5C8DBBE4ADB2BACC601DE6BD43EDD6A523987AB5 2925707 he.would.not.elaborate..
889,532,899 *5C831F32DBDEBEACAE1C4BE00E42856460C2E10F 1 joserakoiranruokiin
889,532,900 *5C804A709C96F99C731F181810FC7218CA8E9D70 1KIVIAINESPINNOILTA
889,532,901 *5C80FF6FE8601B7C05AD9A19BEFC47A17C8ADD76 1krebsstoffe
889,532,902 *5C8C7502235BE5D0EAA609E213631051BB54FF02 1-KUNSTDISKURS
889,532,903 *5C816653B3A5A6B8E431F0B6DB677913C31E6DFF 2demirbaslardan
889,532,904 *5C88E313F936A0A7A37DD95801806E5845FDA9A2 2FUENTE
889,532,905 *5C8AA238466C86C393549A63936095DBB3D4D3DC 2heimsoth
889,532,906 *5C89D553E81F293F0DCCA1BEA5E2279B8B82774F 1-obergeheimnistraeger
889,532,907 *5C8DB50989B2FC2834DACA4FD9FAF6678926C14E 2.LOSSES-ONE
889,532,908 *5C82D356F4CD2DD6E1AB619C1945F73CF264A28F 1OWWATER
889,532,909 *5C8A69A09B66BC51DE7144F0AC784EFD87FAE5DC 1-perstigetraechtiger
889,532,910 *5C81FC20222DF5EACC2B9E080B2148605A3E7322 2-projektikuvaus
889,532,911 *5C876D77CE886FA7DA00EF133EFE6C5C5E02C6F3 1-PUUTARHAKALUSTEITAKIN
889,532,912 *5C8DE045733B5219D8E362401D1B8875983DD96E 1-raporttiohjelmista
889,532,913 *5C8094F99E7B1DAC611EAA88718FBE371C61CC47 1russen-spiel
889,532,914 *5C81E390440A111577FB5BFF599BCF83C452E286 2.WELTEROBERUNG
889,532,915 *5C88210DF99B915A82E95B340E53F0DA7B9147AD 1TAKAPUOLELLEEN
889,532,916 *5C86B290997BE73E5C6DA3ACC31DB68269AD67C5 1teaches-just
889,532,917 *5C81AC0E3B29832CD153C736CDE4F702CE3941B3 319652 dochdiemeistenhabensieimmerbewundert.
889,532,918 *5C822D4857BD985BA66151AFD197F000BBC1D3E0 322PRESLEY
889,532,919 *5C870AC299F23DF69DAA47173F148FE4CF8A3E36 329J
889,532,920 *5C8A65063922277F2ABDAA359D2AB571C0C10C93 35.SURUKLEYEN
889,532,921 *5C8DAF230863AA7004B44A2607FA1EC0F766F9AD 1.tyls
889,532,922 *5C8AE80C1C2E1DC35F3A5D6906FBA2FCA1D3CCC3 1vaterschaftsjahr
889,532,923 *5C8BC503891C9A772E67C7C3E04A42504C596D3B 1.VESILABORATORIOILLE
889,532,924 *5C88BA24D5444657ABFC026F93F13E3017D36A11 1-voelkerrechtsnihilisten
889,532,925 *5C8F0EBEA94116ADA27E3BFDAC383893AE541EF2 1WANDER-AUKTION
889,532,926 *5C89AC20BE0360E449E0E24DD6D49A9134DFDDF3 3FEB1797
889,532,927 *5C870101666F4A1B89153E81BE702B5F410506F1 3GUISELLA
889,532,928 *5C846F23AFB5B983F9FA8BE0CD9FD24A9404F458 2150.englannin
889,532,929 *5C8F9FAD37E2DE2F2EFD1D36C09B7DD74EF71855 2153689 TWO OF THE RANCH'S HOMEOWNERS WERE INJURED .
889,532,930 *5C8F6CA8F7E24FC18E38B0A7F0A83B3A1E57E2D4 3JPAITNET
889,532,931 *5C876D05F194C6E22FB32F8C4A3179275B482D77 2318144 KAIKKI-HALUTAAN-KANSAINV
889,532,932 *5C8E480C0C9FF9CFE27B61F270505AABE51D6265 3-mustaleimaista
889,532,933 *5C8D241853BCE1DADE911EFFD437433C7246259F 3MYSTUDIO8
889,532,934 *5C8D8A2CC77195D9AB91BF844BCADABA57C606B6 3>~O~OO><
889,532,935 *5C87568E7C0C9C1011D360AE5B5039C4FF3788A1 269231 BUT-THIS-IS-A-FEARLESS-FOURSOME-.
889,532,936 *5C89F89145615D5D47C315394A581BDAD86CC48D 3TOIMIALARAPORTIN
889,532,937 *5C829734174874FC182BB2C892E1459D572AFD13 288124 TUOTTEIDENSIS
889,532,938 *5C89B213847FECC7871CECC91C5A76368769E8D4 288399 HZ...MUHAMMED.,.HZ...ALI'YE.SED.KUSATIR.VE.ICAZET.VERIR..
889,532,939 *5C8D98A75FC6CA43E321608542760BAB6B1E028C 427JORDYN
889,532,940 *5C86E14DDC38F4631D39FF98E6261F1F14390D91 2ANIJATTA
889,532,941 *5C88DB8620CDE0BB5F0AD7C7829DEA60C780625F 2-cbc:n
889,532,942 *5C837416ABDC32F3F56D14CA3394B971915321EB 2CNMCLLY
889,532,943 *5C8D4F4C9E0DE199124BDD03B083DF9BB0E20AA6 2COTSTHCA
889,532,944 *5C8FEDA574D1FE473F2167E2E416834CE2819A38 [email protected]
889,532,945 *5C86CB227F2FF1E1A78E5C2B1DDDFC8DE0F7F1D0 2-extremistenszene
889,532,946 *5C89D66420DDF95D05EEA60CA31768250116E8E6 2 HIRMUHALLINTOON
889,532,947 *5C81B12E95E668E57308213E26CDC0B43BF014D6 2-LYRIK-ROCK
889,532,948 *5C8890B3FDE46446AF836E6DFD5F3F34E03C9607 2 PASSIERBAREN
889,532,949 *5C89CDD4930A05751864F029134A3266B5355863 2SAFTLIES
889,532,950 *5C80AB511A6527CB3E876D9FB764C51EF181D27B 4NELSONCHANGEME
889,532,951 *5C8A052A468CD722AD51740B0D34EE8F6DC174D6 2SUURVALLOILLA
889,532,952 *5C8C01C284C5DB93D917A619FA59B2CE6609DB20 2XBA4KQOQ
889,532,953 *5C8E6C7CEFF95FADDA60ECB49A976DB09BCFF4CF 32IKOLA
889,532,954 *5C88517E54A862F2B6681157345CFD417CF060C8 4 SUBKUTAANINEN
889,532,955 *5C80AF5304E80BEB1A31368A3231E6CC8667F363 4UGYBWIP
889,532,956 *5C8F06EEE8878C54FAD2E368ECCCA1800E2FB9A5 4UPSMASHUPSMASHINGSPENDSTAND
889,532,957 *5C8EA1A2D0F137115C0208E19815B01092B9980E 3BECLOUT
889,532,958 *5C80950B45EB9CFDEA9EE0194E48D19DD5E6B844 3CBE9AB98BFD98884DEEA54D982F395DPHWOAR
889,532,959 *5C8ABC468B0A6122E1B02C0C13ED0F0BF28EE607 5 bagcikli
889,532,960 *5C88206BB8DB69BCA36915C71849EBD1CABD0523 5BSWBARRILAROBSW
889,532,961 *5C853C22010E8EE70CA210F5B9ECEA01CBC1C807 5-dgw
889,532,962 *5C8073A0DA3B763675E4DF7EC29ADF7FD4B24DC0 3SETSUGAN
889,532,963 *5C8C2923FC17C27343F2BF4CD00BFF438749DF5B 3volkamer
889,532,964 *5C850135EDEA8ECE717DE3A3C3A07B15E473CB8D 479822 HAVAINNOT-KESTIV
889,532,965 *5C81E1653018A5A55CEDDDDEAA4B0AFAE783C139 488917 MM...TUODAAN.ESILLE.KUNTALIITON.ARVIO.TY
889,532,966 *5C8BCE5BAF21BBFEC45613994FDA8253BC8867A8 5P+3D
889,532,967 *5C88C1D8D90FA28CFB6B8C19D07E96CCABCD35DD 4EMIMINOR
889,532,968 *5C8A59AA631176D5AE3B0BCFA234A8B5C2FA1C65 5RENODREP
889,532,969 *5C898DBB564A8B652934BF963EB17CAA45A8F113 5TREKKINGS
889,532,970 *5C8D2D4C6A4AD61DDDD1CA74EDDD88E816C65181 4PEDROKHAN
889,532,971 *5C8FE6858F5A4A1E1FBA4FADF934EE7F6204A19A 4POSSIBILITAVA
889,532,972 *5C8F4D64024976FB2CCF00A23D7B4A1641B57E5E 4RAADPENSIONARISES
889,532,973 *5C8AA20310A5339C2B145CF77104784024B440E7 6ASDFJKLFLIP
889,532,974 *5C8E66C11EC16CF8C26101A9A5B9EBF5E43D0B3B 6 BENSONIN
889,532,975 *5C8F1142B64D146C218A956EDC5E36A15FB05DD9 4.STRAIGHT-BACKED
889,532,976 *5C850F004B8A5D5DF34EC7C5C9C74065F1AFD379 4UD!7!V3S
889,532,977 *5C8E8435909D6F07F54D651C82E89156ABDA72F2 4UITGEROLDEN
889,532,978 *5C81D7E1E26FBAD03DE51E1A6953D11F8965EB98 6CONTENDWITH
889,532,979 *5C82E330509143DED2E314C408BAC7448F0BDF96 6EKOSTELSELS
889,532,980 *5C8D34DEA470335A1A47BA438E67E64A64E96163 6FROGGYACURA
889,532,981 *5C8F805B7208E3F3C50E4D4096F7781D1BB5EBC9 6ILOVEBIGDOG3
889,532,982 *5C82A8F6182050C5379E357B41415EE6F283758D 59TYRESE
889,532,983 *5C8A333C41CC7E65F00C79EECD9CBE16DA86BE18 6MYTULUS
889,532,984 *5C804736E9CA4CF7755A33C3B18B09D354D16651 6NERETSIULEOT
889,532,985 *5C8A476D09538DB17E497F25A915FE69C84D1F03 5DELIBERAMOS
889,532,986 *5C8427615E32CD020510A89451AF2BBF6D03F52F 5DIEHFELK
889,532,987 *5C89984E8B0B7493723FB709232905C58F72C8F2 6THATAEROBICS1
889,532,988 *5C85A108DA71121A5C282635B1E95B8A87CFF02C 6VERDIJENS
889,532,989 *5C859F9F4BF8A53B4E9D8366A6D32BC6674A61B3 6 WAHLPFLICHTKURS
889,532,990 *5C886F9104498EB475D9295FB3C30D5E8F47626A 5KOMMANDOVEJ
889,532,991 *5C83AFDC07B4102D25DED557B28642FC4C9D7E1E 5KOPICKO
889,532,992 *5C8A17B53EB939BCE26A695C761A938DB8A6A194 5PASSWDMORTIMER
889,532,993 *5C8D6B96F0BA6E864B720A80B42BD36F9EE8DF49 5RAMINAS
889,532,994 *5C849F6F609BC6A048F3CEB41CC5BB612D79E50B 7CAPTAINANTHONY
889,532,995 *5C8D9BA1EB32137691F668AFD83B77C10784193E 7DEENYABSW
889,532,996 *5C88F4AFE6DB5D6BDD09AA86A4E295416A24D592 5VOODOOALEXANDE
889,532,997 *5C84E7F7B919C20C1DFDE9541F9A5D79CB6A91A5 7HVALERRELAVH
889,532,998 *5C8A2D85424A4C01F17F38EC8C5C096D3E45F5E0 686551 $K$4 : $K$20 10 0 ' BULANIKLIK2000 ' !
889,532,999 *5C8FCB518503BAD58B15AEC08D07789A4E8A2E3B 6AHHAROVA
889,533,000 *5C8F2B7D719CC61D565BA726472A9874312FA3D7 6EPROBLEMS
889,533,001 *5C8214BD64836A881D6DC2DDB8E5D72FA32600C0 6EXTEMPORIZESES
889,533,002 *5C85173B8E9200540B2F4B1E9EC8D3FA6A1CAD83 6GRDJNRDN
889,533,003 *5C87E981A62A74B3ABDB8B5B5EABFD9A71F49237 7YLLACIFINGAM
889,533,004 *5C8DD1354C6B29B3848194B4BE202A8549CFBD20 6KUNDISH
889,533,005 *5C8FB53E0E0BA626B27EBF4FF2D044EC84B20416 84-RUNKOA
889,533,006 *5C81E47EE45003AF5250776245048B7F7C33BF7A 6NITSEDE
889,533,007 *5C8551700CE6A617BBA0D8116512221CDBC879C6 6RVEGRAVENE
889,533,008 *5C8E3BD42A4E6E3034C18CE7CDDA613B8C5F2C00 8BRAKYYKARB
889,533,009 *5C839E26438DE9925CC0CC13F948DA76E057A737 6STLAHTNEFUANEHCSIWZ
889,533,010 *5C85E6F1622929EE2BFB79E42FA3BAABF79EC8D7 6THATCENTER7
889,533,011 *5C852A0AD2E4B751C74424F51D8D81708282E01A 6UNVERIFIABLE
889,533,012 *5C84EBFB07C0609A621B2AA72FD89920239A7F04 8HORIZONHERMES
889,533,013 *5C867D08AC7E438EC3371DB327796B10A679BCDE 8ICTHYOLOGISTS
889,533,014 *5C895FE9ACAF51ED0AAEE867103BBD513DBB8DA8 783694 URFA'DA-YEMEK-YER-SOFRASINDA-YENIR-
889,533,015 *5C89DA14FAC44085BC1990881CBFEC80A100EEDD 7ARIANEBLONDE
889,533,016 *5C8E47B0D0105EE784E7B822D070448622C0D307 8LONGRIDGED
889,533,017 *5C85B05D143A48B14F0E162DD8E4FDB710A6A752 7DFDE4A8-54D9-3D26-ACF1-3FD98137F612
889,533,018 *5C8E8D3426F285B8047682AA193518EE1F9FFB30 8NSLIEPEN
889,533,019 *5C8DABB15702C096B74D5909849DAAA3CB5B955F 8ONAVAREPO
889,533,020 *5C8397421B88C69BF0970C7366F5CECBDD6045FD 8overcloseness
889,533,021 *5C825F62F7F89C811E0502DB66A74FC15A3C43CA 8RADDOBBARONO
889,533,022 *5C851327B2FD018BCE2A592EA5F77CA3A13741D6 7PVCSBSW
889,533,023 *5C8F581B55E4613E5062D9C8DFA3893241DF48F4 7TIGERSMATH
889,533,024 *5C8B6A1469ADEBB767575316560B92BFB59DF005 9AMERISOFT
889,533,025 *5C89E80C4682748A681C2C351977CBC3BB9B03A4 9AMINOBENZOYLALANINE
889,533,026 *5C8089F43A852DC401B10C92447EDA378654A20F 9APRATIME
889,533,027 *5C8BA39F827CCBB84F9E4B9CE40047842DEE1C45 9ATIENIAJ
889,533,028 *5C88693DA2ED6EE5AA50A4671DA47F5DE723C43F 9b34c
889,533,029 *5C8A1B6210C0492552F17692A16F930913F751C1 9empiriocritcism
889,533,030 *5C83C8A89FB20DCE14554EF5474F869B8F7A10F5 8AIRCRAFTSWOMEN
889,533,031 *5C8C01E23857C8C851747B0FE3EE1064E446A203 9JKMBINKY
889,533,032 *5C85847D6C7C5F67DDBEB1CFCA1961D2805ACA22 8COINNMHEADH
889,533,033 *5C8083F43E276EE5C9353FC1B000972ACC0FC6DA 018KAYDEN
889,533,034 *5C820C1EEE7B8D7072B82813F050D4B593D24947 0wflcjci
889,533,035 *5C85D424A6CF8870330079F36EF4DEABBD1126FC 1069412 SAHATEOLLISUUDEN.KEHITTYESS
889,533,036 *5C8ED3D0FC2A614CED4741B2C3D23236B3F5185A 11ta bo
889,533,037 *5C81CD40AE814C9B4756999D62CD97F88A6E13E3 13TUOMARINEUVOSTO
889,533,038 *5C81EC08F318F5AF5A56ABA6D99B36232ABBAF3E 1403288 PELTOMAANK
889,533,039 *5C8587B0E23AF028540DCD3CE5B3BB0ECABD3FB4 1426770 VIETNAM-ACCEPTED-THEM-BUT-CRITICIZED-THE-ACTION-.
889,533,040 *5C81C0E0382FE3865039DB28D79A206C1BFCEDCC 1.already-sluggish
889,533,041 *5C83FE726D8D8F3DA3BE2C17B88391B13D90B143 1axfood-konserniin
889,533,042 *5C8720402BFB72D25935C30E5E7875E2A2073C93 1.BELAESTIGUNGSOPFER
889,533,043 *5C8C9DBEF8649454C74E5189CB4BC62347D76AF7 1deutschland-spezial-katalog
889,533,044 *5C85A9EB996D5BDD2B7CCCCCA37A7AF079224528 1dokumentointiv
889,533,045 *5C8206A734DD4B77ACD73945E2C6B3B7D558737F 1.DRB-VIZEPRAESIDENT
889,533,046 *5C82126B492CE327CEF9C044AF9C2E66BD2CE250 1eczanelerimizde
889,533,047 *5C84A0D2F0AF7DE4D536001B621C47169341E29B 1ETSTHCER
889,533,048 *5C8F6FB87F42FBC64173C63ABF62A29E9CC24EC5 1HUSARSKU
889,533,049 *5C82D4CF2F13E78A8F01D20C431DE2A06C66A3A3 1kuivatakki
889,533,050 *5C86139AFA083E30283B57F2B2E3D70C7B7724DB 1laskeviksi
889,533,051 *5C88FEF3CCE18A0F54628ABB92F49389547C3944 1.LUKONISKUN
889,533,052 *5C85308F24E6810F1E42B9AE24296900A52C6A0F 1matkanp
889,533,053 *5C85333F696B8A7D0D2E0406B2007892BBD6AC8F 1.nidetunnus
889,533,054 *5C8E19B4F7F63AC921EAB6C76E0276181D1EECBE 1.SINIBARETTIEN
889,533,055 *5C8E17CAF7BE549A8DE6AF39E0933827A56593DC 1THECATS7
889,533,056 *5C872AD20F21046866B87D35255B7E1F9CB71B64 1TNEGNATO
889,533,057 *5C867D2B6F6068D392BEB32E458AD7591AAE4D6E 1 TOIMENPITEEST
889,533,058 *5C85843A7BD5A9A890DB74738033DCE1098FBBFE 1TWELFE
889,533,059 *5C8D971BBE30A56076980BA30CD926DC46ACBB3D 1.WESTLICH-URBANES
889,533,060 *5C8BC9EF5CBE6ABD869D43D6AA27AE747CA0644E 2194274 VAPAASTIVALITTAVATOPINNOT10OV
889,533,061 *5C83A73A1043B4B65A0C8D995B488987F083A9DF 25oct1345
889,533,062 *5C89879F3CE1A8BE0C28831316E622F52E15BC66 2767426 kartanon.m
889,533,063 *5C8A1417B0452A58CDED73718B5F25FB7FE8BAA1 28FS
889,533,064 *5C812D1D472AA6C365F34E598CF7A6B1B60DDEB9 2CHALINIDAE
889,533,065 *5C80E34FCFD6134C8BA6532B42F5B33D9B6017CF 2.GRN
889,533,066 *5C894C1CFD0958F57860ABB41D35F64B01CA5DF2 2.mitleidstour
889,533,067 *5C835A5DC566D3DA67048F8DE912074691C325A4 2PAPERINTEKIJ
889,533,068 *5C81D12E377320393BB664772E1366BF58CDE2ED 2-VOLLKORN-HAPPEN
889,533,069 *5C8CE3FF2EFB57B41608AA8961BD4A22D3F82110 2.weinhart
889,533,070 *5C87F53E62E71FE30C714E1B3AB0C373E8CE136D 30-NUMBER-CRUNCHING
889,533,071 *5C8E653A6855EA610C498EBC86D70DB2B8C20741 32vlj53
889,533,072 *5C88A51ED07F417669F6BAA3CE21864B6FB18BD8 3AMUSSUMA
889,533,073 *5C806B3D9A9059C4229082F02E3018C11723AE7D 3CUMULANTS
889,533,074 *5C8116CB7E0FC5F52EB59C58EF6577841F1FFF98 [email protected]
889,533,075 *5C81D781904A25514FBB331B74DB3A5E34D19DDE 3DYSAESTH
889,533,076 *5C808F13E722AE37E7ACC88516F9D2AF08D128C8 3FOOLAMY
889,533,077 *5C8AE9553D0F64E1F349BAE8F10809B61C2F65AD 3NAEAMUDI
889,533,078 *5C8AD66D26352884B0021F93B9D2120664255F00 410382 VIRKAAN ON T
889,533,079 *5C8B096193AC2DC1632C3645C2AE1928A8091B05 423JULIANNA
889,533,080 *5C850F045E97E28A70BBE03B6B81FA08BF6F8C79 4CULLASSERO
889,533,081 *5C827954C8A07CF47220E828270707B976922855 4FIONASEAN
889,533,082 *5C82B81F1207876A6AFC060F28898501813AAE7D 4.hannack
889,533,083 *5C8A30D1B948508FCA47BB6AB98F3065BCBFBCCF 4JEFFREYREDRUM
889,533,084 *5C814A1F5ED3078D633E75B6A4725982B29ED5C6 4KONTAKTSCHWACHE
889,533,085 *5C87081E8AB717E77CB727A7862FD93A260C0931 4METHCILH
889,533,086 *5C866EE9774E6F75665759C0A2D7F42EDDB69BD9 4MITCHMUSTANG
889,533,087 *5C851D2C2F4CEBCD0360557CEA5C198E47E3B485 4RIGAILBSW
889,533,088 *5C821AB30C56E4CFDB6938CFC082DBBC3461C67A 4.WHATTA
889,533,089 *5C8FEE54BE0D161174F31521D26BB4D7675B4201 54MP14D0R14
889,533,090 *5C8F5FDF6B2AE03A62C584F268D076AA1844455E 5CLEARINBSW
889,533,091 *5C82B41419921601FD28FCA6CE810948E5C186F5 5DAWNORCHID
889,533,092 *5C8AAF431551A2AA1D64DD6ED90FE8486BE259A4 5-DISTILLERISS
889,533,093 *5C8AED596E2D04F2D9B449798035A139CBBBEFAC 5ENLAYYALNE
889,533,094 *5C8039258B299B01F0F273F237439734DD114B76 5i6vaak
889,533,095 *5C80846A626065A1CF1C9592316DAAE11AAB9D4D 5 RAYOVAC
889,533,096 *5C801663E5956FD53BED01F18DB2D7378152C1A3 5REETIUCRIC
889,533,097 *5C813508637CE005B5ABE8F3D70AF0E839B03836 5ROTULARENS
889,533,098 *5C80581C8D6C1FF78EF7714ABEFE95DAB48F00E8 5TEKONIVELLEIKKAUKSISTA
889,533,099 *5C8DC45733849032ABF067AA9281C6CB4623C1DB 5TELEVISIOTOIMINNASSA
889,533,100 *5C8D19B8E4838F5676AE7624DB6B03906A715A0D 5THESUPRA2
889,533,101 *5C85537421BDBF3E0369446F8A0A52AE773E832C 5TIFPENA
889,533,102 *5C856606125124BF734196FC3E469A9C063ACC8F 5TIRAZ
889,533,103 *5C84818AA99FA87BC62F7032DD02DFDA66E25430 5ULTQUIST
889,533,104 *5C8B6988EF7AD935078D251A0EDCCDB58C540AE8 5VIKINGVETTE
889,533,105 *5C8F56D1F3762A0B70C923763F8683E8154DE02B 5YQGHSNA
889,533,106 *5C81E0E5224B35ED6D37D6A19CAA240878BDCCBA 6ASDFJKLBERTHA
889,533,107 *5C82D22C0234713C18FA862782E9F22191EB3A24 6DAELE
889,533,108 *5C804659B1E73D97485AFCC5E8D93CBF4F12F7D0 6ext
889,533,109 *5C88531C156CBE619CF981FF9B2494C72D6A5CE5 6GNEISAGTIGE
889,533,110 *5C8809D999F716297691EB3BA91B5FA43C258130 6GSENIOR
889,533,111 *5C85B5103F93771A742CE5334209071278149C28 6PARITUSHHTAA
889,533,112 *5C8F8DA9BCBFAEEF294B3544473BE727DF885256 6WULAWZSIUH
889,533,113 *5C84D9072291308C2F3638C512A16F24A50E5268 754370 DIE KLEINEN SCHWIMMSCHUELER AUF DER TRIBUENE KICHERN
889,533,114 *5C8CFE9FBD0C6B1E349A20876965600C2C60CA1B 7-generaldirektorin
889,533,115 *5C849B51739A5E28E8DCBD56A0DE836870E5CCA1 7IAMCOWBOYS0
889,533,116 *5C89CE1C31CF10E6FCFFFA528369693F709A764A (00)***(#####8
889,533,117 *5C85D717BE49690370FFB031742709630F30A09B 7NEMAS
889,533,118 *5C83DA645EE0A535BAA605B9D7FCEAE24B040527 7NNDJSTBL
889,533,119 *5C89366B5AC779936D3027D144E508FCDDBFA758 7ONISICK
889,533,120 *5C8D663D31C4F11D1E2FBEC5EEEC3A67AB51DFD9 7outrageuse
889,533,121 *5C80D055A66D22988627A151C7BBEE8DEBF606CD 7PRSTGVRLST
889,533,122 *5C8BCB74B7E0016302D22CDA77BDE0E4039D29BA 7sailorly
889,533,123 *5C8E9A1FFBCDC305F08C133652E1AB213A072757 7SWOONING
889,533,124 *5C81A6174FD0BE708BE0B7E863508F25144A059C 0mycornflake7
889,533,125 *5C830467D2207C3D94119D0A8471EA8FB6F69E88 88.LARROQUETTE
889,533,126 *5C8DBDFF477A467A5BDA9E3E7034B89BD95B6A27 1154051 TUTKIMUKSESSAKER
889,533,127 *5C8AD4ACD7227C2A58EAB0010D906A37ADDCDA86 11-g
889,533,128 *5C806D576786D0606954A595363DD71903CA7E1E 8CREMAVAS
889,533,129 *5C8B1FC64CFAFBA0DEA462ACFC3753D472825292 )8(*-*-*-D======3
889,533,130 *5C8E9E76355CEAB949E1C9D94C3A8E078D377B09 8D3818DBCA5A95E0
889,533,131 *5C8FD27CE2D59024569106E9734D39C6157A5AFA 165167 LAKIMIESLIITTO ESITT
889,533,132 *5C81F6BDF08F3FC4DDEEDB838888C090AF8E4E7F 1711448 DER.ORT.IST.BEDEUTUNGSLOS..DAS.WIE.WIEGT.SCHWERER..
889,533,133 *5C83F60846CD63C910FABBE69FEC7A0EDBB8403B 1771994 YVA-SELOSTUS-TOTEAA-,-ETT
889,533,134 *5C80982803AA74766D66805139AF6A3CA1EFE4C9 1776916 HELSINGIN-SANOMAT-NYT-LIITE-.-26-.-5-.-2000-.
889,533,135 *5C86D0D36192F5CCD4FF7A590769F5DCA48E3B30 1898050 yhteystiedot-l
889,533,136 *5C8CB292B4A8F05D5E42FB956928C979ED4D1594 )8(O~ O~ D--8
889,533,137 *5C822CC43087B2082772CB11A59DA087F56F8A0A 1ALBUGIN
889,533,138 *5C8EEB51B68D379BA4C1E56684DCC1F92116D27C 1BC8F28D-1E96-3447-9C95-A23C3FEBBCD6
889,533,139 *5C8A3177F82E07CE4AB362A76D99956FF500F00E 1DECHANT1
889,533,140 *5C821EB8690D7A9A5D85CB38F5E82556872AC610 919MICHAELA
889,533,141 *5C8F44CBEBB6A7E105C141C16EC980AA208163F8 969356 toimittajien.kyky
889,533,142 *5C83ACE140A5DDCE5D866BC5C0FC3D79FC8F481A 1GRAYDAVID
889,533,143 *5C8CD4256E0DB2DD6DA49F00A4779E5A74F44C48 1 ILMESTYSMAJAN
889,533,144 *5C84F10933A097003F0999E7F70036A76FE311AA 1LEHCAR
889,533,145 *5C8845EF40D8FC203DD58CDA764F3BD944814C19 1-luonnontuotetta
889,533,146 *5C8E526D7620CBA879DAF64C8B3AECEAA59B077A 9HOLLYSANDERS
889,533,147 *5C8475CF0A4EFABC877FB8712A1B73DBF5B171A9 9HOZABSW
889,533,148 *5C805B56571B78EB21B9B33FDAA8CD9B0282E906 1.NEAR-FIVE
889,533,149 *5C822002BD4BFF1343F949CBAABF87362AC24D87 1.NEUVOTTELUMALLIN
889,533,150 *5C801B458A594136D47C66B5DFC2112441C721A0 1OMRKNUTI
889,533,151 *5C8DF8BFCB608A4F962D685FBC6BAEF2E607E688 1.orjatytt
889,533,152 *5C8A27F33B1F6DB70B67597337D57A3F34CD1C3C 9MPTUAIRE
889,533,153 *5C8B2E9C0EFBF6B6BB6B1C39F6DB04AA33415337 9MYMOLSON1
889,533,154 *5C81FE70C234F40EAC6E3B1935F209B9686AB2D6 1-problemstaedte
889,533,155 *5C8DEF70E0445D3E794F522AA1BD1F33C5C2D080 9NNDMNTN
889,533,156 *5C87E29CEB84E19184BC44FBDF2857690B1A4246 9progressivistic
889,533,157 *5C850520B4490F5B14FD137BAF455842E5C44A57 9SCREWAGE
889,533,158 *5C8E1A0E1075FD79D24A930BF5A84E467F5DF148 9SUBMARINEBAS
889,533,159 *5C8E51C2049C0E789D054720B15F8D7FB305E326 9UNOSILO
889,533,160 *5C8C52108D012206E7A942034B03D21984B1E5AB 9UNTENDER
889,533,161 *5C8B6D21FD09B36770FE6E92EAEE002EAF71499D 1www-palvelinasiakkaillemme
889,533,162 *5C857C452A841699CC2B2A8C415D350C34240C4B 1ZUSAMMENZOEGEN
889,533,163 *5C86CCAAE388E1119B68B980F5DC531AE889D1EE 1.zweihundertjahrfeier
889,533,164 *5C86B67813B6DDA1BF1C1E5D3671AFA9399509E6 A0R)P
889,533,165 *5C88B18A027C51CCB53BCDADAACFADF3B1F98139 >21=gniddapllec0=gnicapsllec0=redrob%001=htdiwELBAT<
889,533,166 *5C8350851125EDFDE88551B8EA12BF0A1343D9CC A4)SH
889,533,167 *5C87B06DBF42A26FFEED04D9BF1263590B26E99D A6t0
889,533,168 *5C84699AD1FD5E44D7F37CA3C20DA8A0F0636CDF 2545963 DIE GEDANKENKONTROLLE SCHIEN PERFEKT ZU FUNKTIONIEREN
889,533,169 *5C8E33A751591514E7F059B02A9B57E564DBF493 2565314 das-bringt-eine-schier-unglaubliche-vielfalt-hervor-
889,533,170 *5C82CA203A77D4F749CC07904EF712D4FDD48F1F 2679573 L
889,533,171 *5C83E4A2B4F7B252EBF4F4E60035143A9F0B9519 a8meb
889,533,172 *5C870044349F793BB864D5444FC06D30B52A74F8 A9D$N
889,533,173 *5C84F13CAB9569211B160D7B26C176716EA08202 aaa`ah
889,533,174 *5C81AD759CEC79D272EF80503728FBF6B60AA7CC 2GNUDURES
889,533,175 *5C8658296CC449D1C89571A51DF5208211BC1F92 AACGR6
889,533,176 *5C801D951FF0DA449A4A434623BE2DC83465B3C3 AACWJQ
889,533,177 *5C833ABDDA95239409BD9404F4FCCF05D49431DB 2.KORINT11
889,533,178 *5C8D9C274DE02E56D734AA3943BD908CD7E17EA0 2-peterundpaul
889,533,179 *5C8F436359454BAAE03887ED865DFC29B76FC8E8 2PRCTNNG
889,533,180 *5C8D053620655635226541304A290B686B737A53 [email protected]
889,533,181 *5C8B36A0E3AFF64A5ED796CB7F67CCB05716D76E 2trampolin-spruengen
889,533,182 *5C8F1ED6FBB07E0C90CE7E19A4FD31527BDAA827 30.junghans
889,533,183 *5C8B1ED6DFB2CDBC2DD043FBD3A0F26DA00C0E14 [email protected]
889,533,184 *5C8ED3714AB84B338F38D37BBFAAF4904B07DF34 ABDUL.RIGGLEMAN
889,533,185 *5C88448D218301F8593C7147F0396790C646ABA4 3ANKERTOUW
889,533,186 *5C833CB61F98019451F17CC3F65EC9588FE483CE abhyutthaaning
889,533,187 *5C8DD1FD2C1DF5EA20507BB3B6564766E18D4340 [email protected]
889,533,188 *5C89D21F231ABB390A192F58612787A019D23022 abksl
889,533,189 *5C899DFB46B42C65BF842E56B0A1A09D0460E206 3b<[email protected]
889,533,190 *5C83E1276DCD38041E192918DD96A54DE18F0C3F abramdunkle
889,533,191 *5C80254DDC884834A986D7AEB2ECE57CCFBE94B1 3DILIP123
889,533,192 *5C8CFA277A276C2F546E6C527631101F34954270 3IAMOLSEN8
889,533,193 *5C87C5F5B0BC14B85FF10E5553AD40C1CEFB9228 ACCG(
889,533,194 *5C827C4C7CF64F21224407F0C71E4735305E6CD1 3==p~~~3b<
889,533,195 *5C8D6E0F9DAC3120C34ADBF758BFBE270E6059F7 adalbertopuddy
889,533,196 *5C84511BB528C7A8208ABFB8BD82E93E0B21DE7C 4111062
889,533,197 *5C8AEE7ED5C8BEDD98CDC6B703CECF354CE5E588 adrianbalderas
889,533,198 *5C84571CEFCFDA60C767D2E1210EEE996F2A7A2F aeue
889,533,199 *5C85A0E93DBC99E929ABF530467F31E0C3FC1101 4N7HR4XOLI7E
889,533,200 *5C89FB4EA0BFEB4621E08F0BD39253E21CE8DBF4 AF/U$
889,533,201 *5C84242DA7879D7090750DB3E4AF6328146F347E AHMADZADE-MEFTAHI
889,533,202 *5C8265B137F13B7A41125F6C5AADCCB27AD34C6B 4TNEIOTIPA
889,533,203 *5C817E97B74DE32D06EF2AC7E263477E1FEDF74A A$IARCH
889,533,204 *5C8010C6940476AF9800B52413CC55F01F7E6598 [email protected]
889,533,205 *5C8522097ACE1474A4939C5C0E35F03016B4C7A6 AI&J
889,533,206 *5C8218B900DE04AEA6D26E6E1D5E62E7F99ED5F3 5015ml
889,533,207 *5C89A8B73EC9EDE844297BF810B525E7C403DB52 59139A91A16C9B09A388091BDFE639DE-6445
889,533,208 *5C8A62AD5B988C17A17384D81FE5159E6553F200 5BEARSBERNIE
889,533,209 *5C83EA7D931DFEE416426521AAE850B0BD8AD28B AKHCSTIL0
889,533,210 *5C85ABF82F6AC4D1AEADE77309343D78990F9E20 5BRUILOFTSLIEDERENS
889,533,211 *5C85BB03F8DEA83F35E0D34C73CCDF1E5F3704C0 5DEEVING
889,533,212 *5C88A01E6400AE25890AA64A7E4E784CC99F1D99 5IER0ZEM
889,533,213 *5C84C7799885C12B4F22E73A801A599453DDE64D ALEXIS.WALPOLE
889,533,214 *5C88432DCC0F82D15CBE2A277BE666081BC72628 5INDESNE
889,533,215 *5C806FD8723355F9A1CAC3F551658421E7128F0F alfonzodemmy
889,533,216 *5C8CD01E032A35918B26C7F2B50EDF58D3766E2E ALISHIA-HANEY
889,533,217 *5C8A9D7A35E0064ACEAF6019B242B8C7A69B97B1 5MOCOOHAYOEMORREDNOWPASULLIH
889,533,218 *5C81D10546E6BB668DD304386BE70DA64D641CAF ALLISSON951
889,533,219 *5C818C4D3E2BA08B847F7F18807E358851A64D69 alphonsoshular
889,533,220 *5C874E1EEA2ED7ED12390B4DAD461E52804EEBEF 5SOPHIEKINDER
889,533,221 *5C85611F9CFBFCCD78E824DE8B8B573D31FBDDC4 5SZSTRINGBSW
889,533,222 *5C83CB6F17463209131B12520C4AA11F5D9189E9 alyson hannigan
889,533,223 *5C8BD7B9E22E4875758D0D6331DACA9B2282AAC0 5VALMENTAJALEG
889,533,224 *5C88311F4DBDC1EECF8D53A99130C039F7DE7DED 5YCKLIGEN
889,533,225 *5C8407390B17B724AF1CDE5FC3E4ED41700424AD amghe
889,533,226 *5C89C05CB3B0DCD951DED5599C2E3A0C20E176B7 amlahthp8
889,533,227 *5C88DA7AAC2BBD04A83DD91A31ED9645FA41FFF7 [email protected]
889,533,228 *5C891D0BA73658D9C286AAFE2FD3A555E6E3C955 ANAOFANYA
889,533,229 *5C82C4652465485D5FE22E99299391469590E5B1 6CADYINGV
889,533,230 *5C8D9C6E37EFF2DD18EA42D3CE2DF7198E95D9BB ANDREASSHOEMATE
889,533,231 *5C8DEA3ABEC1509D23F8C46E4D9548351D7A4FB7 6CORDERIES
889,533,232 *5C8BD2AD97C86660A239B80A6B9B070A21BF5F34 ANGELO ALMAZAN
889,533,233 *5C893607BEF787C04C839311468E20A28C6A24D2 ANGER MANAGEMENT LEAGUE
889,533,234 *5C859281ED6D8EEFEA95DD1737ECF62BADA64891 6KOMMABACILS
889,533,235 *5C851359D0CE73A0BE34843CEB0DB29BD92DC842 ANNONCRSING
889,533,236 *5C8BD4FD2483939615DC22722909F5A5A256F85C ANOOGARD
889,533,237 *5C8915BF2B80FA22837AFAD6AA2748ABC3475EE2 6PRAPATATAH
889,533,238 *5C81626797BC9001B2C565557852EFFB31396A41 ANX)
889,533,239 *5C85D7306364375A2FB83D9A46FFE1DF208E5810 AOI5H
889,533,240 *5C894530D3C57D9EA864CEDF4941549E826E7D96 [email protected]
889,533,241 *5C834F575B3349981DA0160EF8DD83EC1210BDCF 72253g1k9
889,533,242 *5C81A7A10EEBA4888B3BADEA4217C0E2CD4FCCD9 73N373
889,533,243 *5C8D9549EB0F0F491AECC05C3B5C057CCEA3A537 A++R18U+3D
889,533,244 *5C81908353D9BA89774EA8413E4E5C13C5B74EDC ARA
889,533,245 *5C8AA9F47F6475F49AA579606E3F02883076EDAB areaexcl9
889,533,246 *5C8E2AE3A1D33D223F9BE6C2A9A71FB646870005 arlenoliff
889,533,247 *5C8D1D532B426B0A90C70539CDD7ED25BBED3312 7FOOTBALLUCAS
889,533,248 *5C8BB46356B32081EC00D763CA84E1DC9549A677 ARMANDOMCELHINNEY
889,533,249 *5C83178B8F17967D758FF599FF822099EC39C50C 7KEPEFULL
889,533,250 *5C8A5CA232AB99F6CFA9458142C2AD63EED9A244 7KNOPPBSW
889,533,251 *5C8EAD137BFEB40E7171BCE920A07BB6973D1804 ARTUROFONTENO
889,533,252 *5C874B2FC8390CCBC48D3F39CB839315641571C3 [email protected]
889,533,253 *5C875222B1173E2125AA2DAB0EBBDDEEA408BB52 7overcasuistical
889,533,254 *5C8677F75530A4CD82666414FADDCEDBE97B3A9B ASHOK KURIAN
889,533,255 *5C89967A6CE5327E489F664E72EABE9BB9CBF194 7RHCPHRS
889,533,256 *5C89E78DE44C28C3CD9A0E6EBC271E4B907A1C63 ASRARSHEIKH
889,533,257 *5C8995343F199C521D2CF3BC14C3CB5779C1BD54 as soon as the tide comes in
889,533,258 *5C8A22535EB044958205BAC9BF031129EDADC990 8) ~0 ~O SPLAT!!
889,533,259 *5C8624FD1DEAE5709BECF1BC31775167B90E40B3 8ARRESTADOS
889,533,260 *5C84925E3B4690D8BA4646B81BC9745C75170967 8CALVINKILLER
889,533,261 *5C81B479867642206F1BCA5DD323C0EACB7189EE 8CKSTRAPS
889,533,262 *5C8A1728EDC7F95108E38B81F27AA9B4CD4D2F81 avh9
889,533,263 *5C81D792C734A5CE7803050A219B828F48DAF001 AW2:#
889,533,264 *5C855987A14972CF035FCB0D0674241FC47B4054 8KARAISUS
889,533,265 *5C8233EEDAA0D5B1365BAADFB14331C77C052481 AXFBQ
889,533,266 *5C8B2C55DE737CF954CDB38830567FA7FD7CFDF6 ayqcn
889,533,267 *5C8F469CB591BA8FEA1AE3A4045CE8511929FFE6 AZHURNOHEM
889,533,268 *5C8EDAB7F56FE6CA634BDA31D93B89919880A296 8-P ~0 ~O )O(
889,533,269 *5C8B5E28B3C85A91AEB5E480B10436AE0BB153EA B05TB
889,533,270 *5C8322A2D5271472E550B01D02B314C19990C4CD b0v,n
889,533,271 *5C8454D5E254D904FFE339E4087DF8F588D12F29 b17ze5
889,533,272 *5C822614279F9BCD7E305A4A336E9A441E597D0F B1GQP
889,533,273 *5C8CC7DF8710775F3652185212648D66ED63F935 B2#GM
889,533,274 *5C8B09D8143CFD905666B6AE30298BA773914659 934980 the.rockets.fell.short.,.and.no.one.was.hurt..
889,533,275 *5C881490EA905CAB3938B39DC1A62EF39C8A248F 969488 und deshalb sollten wir demut ueben - wie wahr
889,533,276 *5C8286813CEA6157FE932DFA2774A68524ECFEE4 9ANGEHTS
889,533,277 *5C8B77CA3C8A0F7067A710D33A1327B1B1CCF4D8 baby.goodnight
889,533,278 *5C842B08A9BE4DC560B88CAFDC65AB1796DEC0BA 9BARBINGS
889,533,279 *5C85889E27AF8F7FD93390484346B43522E0C690 9BELASTINGCONSULENTENS
889,533,280 *5C84EB9B86EDB978577EDED9121AABF722DC99D4 BAFHZ
889,533,281 *5C8F9FB449F0D581AD5C34FA67A4411288B5854E BALSBAUGH1
889,533,282 *5C8A25657D141E4C0D85AFCF8800AFAFE3B6BC73 9 ELVERISLIDIR
889,533,283 *5C86D8A6569EB9E4B69B14F3A1891EAB7DC50A1D 9FOOTBALREDDOG
889,533,284 *5C8E9BAB554375B7E62C85A96964F08F9FDD3C84 barneygiaccio
889,533,285 *5C8A5B5BA9B591CFC56509FBCB6BDB316C7A2E84 BARSHAKARKI
889,533,286 *5C800DE945E1176385AA81D16D89E9F3E7D29828 bb%lo
889,533,287 *5C872E90F70B1DE6275F7A4A1D26586332A167DD bczn-
889,533,288 *5C82E209AE94F1CAC23BFAC0520AC883E3FE7A85 9SSEETHOK
889,533,289 *5C8D29C384B499FB387B85F863E2F2EF2B003F17 9thatkingfish2
889,533,290 *5C8A8C346ED154032361600DE160F4EF167504ED be+a+r0n$
889,533,291 *5C83EA8D2D5A122A772C600064E63FD38C9D9702 benachbarten?
889,533,292 *5C84E385A53713DD9A5A82373BA5EB8C5214FE4B a3dfs
889,533,293 *5C891A1FDDAF6F8C9113857779938F3D95467596 A5==
889,533,294 *5C81E2C30A179FC161D7D6D9507AD6839BD6A0B6 BERRYKRANE
889,533,295 *5C8A134914528E0B96C57CACFC2E6F066EEC5F82 [email protected]
889,533,296 *5C8B68650DF928EBB1CDF760A4A010162A631BF2 A8NU
889,533,297 *5C842883248A7EB4B2E6DE06C368B20A4ACC0D72 BGM!V
889,533,298 *5C85358A8624800251941A92AA6BE3210BD94DF9 BILLIESCHWENT
889,533,299 *5C88714EFA46B2C66A7B296FC67EFF8BEC084DB5 billyanway
889,533,300 *5C8931A47896DE0168646A53E9B3CF90058FC3A7 AAD!']
889,533,301 *5C82902ACDA639FB10E47209D121707CAD32037F AAE-IP
889,533,302 *5C80FAC45C13F6706DD58B20C058E637D562AD7E bk#?d
889,533,303 *5C8F831B686ABCABDC41A14052E27E01C23BDC23 ABELPEDRALBA
889,533,304 *5C86013463C3310BA85783E2AA75E045A854C773 [email protected]
889,533,305 *5C830B8B97B878640C2442DD1EE17603EED060EB bmfw?
889,533,306 *5C8C46F1554C00EF0B1E6BF2AF4D668DD8DFA3EF ABRGERAIS2
889,533,307 *5C8CB40A5DA0D50DE6EA789514211B2BED82D704 ABRUPLTLY
889,533,308 *5C8003076DC4CD71588662B20E1B44872175F4A3 bnmb_
889,533,309 *5C8311B870AE525CAD3F8A35A0E5CDB159F60D67 ac223
889,533,310 *5C835812ED3A4066A90C924BE00683519BD236C8 a-chm
889,533,311 *5C875C9783F1912B990D0ECA82A7D7E09348297D aci`*
889,533,312 *5C86B9D261DB3F97AF63BA6CBFE54BA14C374A5A a_csc
889,533,313 *5C894D24A85D7661351F5304A4B1F598CD54E233 ACTOG
889,533,314 *5C8B684CA605DA898F0E3C8D220CCE995DEBA01F admrc
889,533,315 *5C84F88F96807075C67AA2EF49AF38F086A9A3C5 BRANSFORD..B.R.AE1.N.S.F.ER0.D
889,533,316 *5C8A7C260866CFA81C30D50E1B25ED02833423D8 AEROGI
889,533,317 *5C862152EE8F3A329E45B1946D42C1ED82652149 brignac3
889,533,318 *5C823DDF451A0F434627D26C314570F00C5A59D0 BRYANFANNING
889,533,319 *5C8E1D4B7DBD3C59642F24580A4F9CB4CDC32C5D BS=_&
889,533,320 *5C85D00F86D0F54F6CFA021ABB27C94D7A376242 bswmelodeebsw
889,533,321 *5C88ED037EC2CEC19E4F29959927404B18A87271 bswmeshreki
889,533,322 *5C80A29BA7C42E39C623C75BEDFF9C5BAFDF0000 AIIDO
889,533,323 *5C8114FF25BD9B1B720FE9DB3D5900BFDB8E7F4E AJRLQ
889,533,324 *5C8612EDF3AB6322350A465313B5FA2944599F9A a+l!
889,533,325 *5C88E3CC1F2F5200656C17043CA2D0C89FB03C4A BVN3K
889,533,326 *5C81B65A93BEC409C3FFEAAFEC306A93F34A9277 ALEC.LEPAK
889,533,327 *5C8C76FE14610A2E9B4980DABA89CAE35F9F7490 ALEJANDRA-MAGDALENO
889,533,328 *5C872D262601DB98E9CD54A2B895CB907FB27717 ALEX.SANDES
889,533,329 *5C823F8F32BC04BFCD64981A7A2787A6FCEC2749 al.f$
889,533,330 *5C88181782DF0DE0BD270FD7DD964423991F460C BX98
889,533,331 *5C8FCDD7CA0615B8E4C756CBF5BBF0967F4E2668 BYw.
889,533,332 *5C82974C3034BA353CBDC085536176BA2E872ACA ALLISON.CROVO
889,533,333 *5C8AFCE99F645738B2835DF78839B8E51E00713F alper.turkoglu
889,533,334 *5C80F08D354BCDCB7C561C3C2EE38F15C5EF5C8A c0t_
889,533,335 *5C807422D32BFBE20B04904F1A5B64F053328233 ALVAIGLESIAS
889,533,336 *5C814951CBE21CA53E2FABB24B4B8224E2876848 ALZ5
889,533,337 *5C898993519E98AAC07C8810331C303C183DD627 alza'im
889,533,338 *5C86DAA2FC0B1C4016129509B7526EDF2A20CC5B c4.u)
889,533,339 *5C83449AA51AB3FA8981875233D208138D615E81 amroawad
889,533,340 *5C88E768260D11AD64A8DEC0D6E5732B057A0B6F [email protected]
889,533,341 *5C8BF147AB494B41F57D1754D0AB88B09A7C83EE ANDREWPODELL
889,533,342 *5C8BF2CB769FB7E0CFB5F2DDD4D2EEF3AFE9F1BC CALVINMALEN
889,533,343 *5C895484033DBE2626AD1DE45182B3486E30C637 ANELIA9595
889,533,344 *5C8E0E085A3AA08B07930950578721D0759B30F3 ANESTHESIERAIT
889,533,345 *5C88431F6B5FC9E79FADE05FA796812C5872C513 angqw
889,533,346 *5C8A1F0013257A1ACEF0D876661172D40E3039A6 annieholstein
889,533,347 *5C87EE1DBDDEC184F51BBDCDB3291A3513E7FE73 CASQUEE4
889,533,348 *5C84C84F0B0B5C5849B83C17725BEBFB90F15E6D a+o!,
889,533,349 *5C8CF54E5A19598E4D9D9A380E3EB35D9FDA062F cd25f
889,533,350 *5C89EA3DBCA4FAA1D775B6337730375AB117AF81 AQ/4C
889,533,351 *5C8602067C950E7DB45A1544849A6724AEA4E2D3 AR9$
889,533,352 *5C84049B1096CC7B63CC4CCCEC15B7FD3818BB83 ARCHIEFLY
889,533,353 *5C883E13E7FC006A2CCCB2F9C7ABF169DD16DA75 ARDENMAINELLO
889,533,354 *5C8309C467E3696434C56B399328D382EE9DBC50 arf&d
889,533,355 *5C8989094D00013F972AD84B9FE891A65E1339AB CGGP
889,533,356 *5C8E451B01C8A9D991F72299777C30DB54E6A9CA as1q(
889,533,357 *5C828A17B5BD1305BE31A6F0DAF774FC6FE01EDD chadwickschools
889,533,358 *5C89C96752244B17A19C9878BFA0F21E6479CFB3 ASHLYNS
889,533,359 *5C8AA9BBA5C7D6D0FBFBE8080D5FAB6A3D82B1E3 chb+y
889,533,360 *5C8F9AF724E3B938B445816D71C473AFEE955771 atopolus
889,533,361 *5C81B877CF030CDC2738C72D7B4A21A8067A97B9 ATP$E
889,533,362 *5C8B86C8DEC252C38F986928C183BF858AA3954E christina-bautista
889,533,363 *5C862F6FACAFAB996E77F4C0C5289D29F5050883 [email protected]
889,533,364 *5C80AE22B06566DAFD2755B6A5E45A14D0CD218C AUNTSHIPPED
889,533,365 *5C83F708E68B4417EE73B99A0160138EBE695E79 aureliogangler
889,533,366 *5C8751C49BFC69D6B63095C23E6E21F82DD985A2 CIMARRS1
889,533,367 *5C8722E9DFF9969AABD048695E2654EE0746EB03 AUTUMN.AGAIN
889,533,368 *5C8186608AF6E102CFDC55C0875DA38A4CA6A4B0 awkfr
889,533,369 *5C8E435E0B8A8733BB122C2DBED592B8C0F7B052 classicsinatra:hisgreatperformances19531960
889,533,370 *5C8358F14E8FA5AE84839A39218F378CE921D733 AZ)BR
889,533,371 *5C85C63ADBDA89B36BD6421017C2E62E23CC7FD3 clipvore
889,533,372 *5C8828BC1C505ACA08F7FB7AB1A460231AC0683C cmdlw
889,533,373 *5C8EF5BFA8B5248D8DEAC2339DDC1E2D076C86B1 cmn:
889,533,374 *5C81C08C3D5AB460BC20DAC8219D91AAE4FBF6B6 B4!ZT
889,533,375 *5C840C4599CFBADAA25D053DCC7B665846482A16 COLTONZINK
889,533,376 *5C8A1CDECA1FBD4EB34678A02B9BB7BCB665A484 COME.EASY,.GO.EASY,.LOVE
889,533,377 *5C885EC5D1A43EF1B01C4E4A3BE436CF765ECC20 bad(-
889,533,378 *5C8295CA33218DA68DDBD03C936F76A9EDF2C12B baf76
889,533,379 *5C8E991E70D1BFD1CA17F0FFC964ABA5EC110C00 banan
889,533,380 *5C84E18318E152412C974DE1C3BA65F4733DF121 [email protected]
889,533,381 *5C8B7A4830F368DB4AD86704FF18E826A0652359 BAPLUCNING
889,533,382 *5C8FC11776AA031FB548527313DFF6B6ED3E3298 [email protected]
889,533,383 *5C86FBB84932F3655F9C70E732F3BFF22FD14614 COURTNEY.SCHWING
889,533,384 *5C87C694CA4BDAE6395AEDE4334E26D263229BAD COY.MABE
889,533,385 *5C8B7524979360FCA5CC78535F945C669758B74C Cq-H
889,533,386 *5C88B0BD8DA02C589DB8948CE7A25B750F5A08AF BDI.F
889,533,387 *5C8FCADA8266670D5B186BA2726D6ECFFE1667ED crrk_
889,533,388 *5C80031DFCD912186BD5E45481FB0B5238B1ED06 CRUSTÁCEO”
889,533,389 *5C86E3F735CF77063D76A091CA7AD826A389AC9F CRV)1
889,533,390 *5C8E2C9A6224D1F472A65ACAA34B23836847C782 CSEREECHAI
889,533,391 *5C89934B939B85A65ABFCD5E51DAD356D79CE34E C.S,Z
889,533,392 *5C8B46C9DDFC2DA6930E2A8E0751A024529B1E26 CULAS DE RAM
889,533,393 *5C8AFD5B6C149F21E1A68B8E9DCDA0A2B0730DF4 CULPÉO
889,533,394 *5C817C072017593D9F389217974BCD825C1FABE4 c,.uo
889,533,395 *5C8E0122C548316DEAA6ACA99CAF8B113D1F0977 CYKLSTNING
889,533,396 *5C847DDD41E08E6C6CEC5F41EBDE1B3A3221EB2E b"gtu
889,533,397 *5C8B6489C9FCEECD3F9C9090C7D7F125A715FF8B bhb!s
889,533,398 *5C893497646ADCCA0819393F99A039A4F64515AD BH$NO
889,533,399 *5C8D07A4E61FE009D8D8D4E77D7A432F672D0008 D1Q;S
889,533,400 *5C8DFD5D6E6E5BE9DB5C649F10881319F78FC014 B&I,P
889,533,401 *5C806CA6D0580CC1323A30F530F52383D20BE161 BIRTHSINING
889,533,402 *5C88C6DD35CD36DFD3E4D2F8C0FF640209E48DD3 b+k+n
889,533,403 *5C8EDB965389836E0C5EDB5B3D342EA649B05191 DA1CM
889,533,404 *5C8824A5D6B084AA627A636B89F0C5E41B4AB035 [email protected]
889,533,405 *5C883A38A758536B60D44F6CFFC8E0CA2E88103F [email protected]
889,533,406 *5C8DE9B5E6B40C91B4A48086BB6B6E327E4CC131 DALEPLESCIA
889,533,407 *5C8886BA28103AEC2D73B4B74EB7C4A2E3D86EE5 damovowhiteflagtobefirstofmany
889,533,408 *5C8F6EC9D300F15A1619EFF3360379ED62CE729D DANA-KOONTZ
889,533,409 *5C833553F49B3BD43BBDF62D07D637A12CA2DF35 [email protected]&
889,533,410 *5C884529AFA1FC29A9B79591F4A74F5536EA97C0 DARYL.RAMS
889,533,411 *5C8788FFB8488907589743C57E75DD3EED812310 DAŬROKAPABLO
889,533,412 *5C8CF7B766CDC2A61EEE4F55CD41A30B62CB02D4 bomie
889,533,413 *5C87726E264C58C4E039F6C89D22FD93E864DF38 DAVID.OBERHAUSEN
889,533,414 *5C8A0F85D8FA7E13AA1A6059CB97A1A561C262EA davidprotas
889,533,415 *5C8948A7AE8A32585BD81F6B5E8C62FAAB164D80 davismcgeorge
889,533,416 *5C8CF187CD500F5C53DF50FB777F8D62B3202F68 B%ORH
889,533,417 *5C8B13BD07309D66AB39D11116EB138981C32B61 boullinger
889,533,418 *5C88EEDE60F68A0869E087C5B48833B609AE6124 bpib5
889,533,419 *5C852CF7B9CAA8E8DBBC9BB8B736747F3A35CF6F bpjp5
889,533,420 *5C89FDF11637D516ABE82767CA1994A41C176D2C bp * *}o{
889,533,421 *5C8013F570C6C0A2DBD19DB98B2582D589536107 bradlyseigler
889,533,422 *5C81986250AFE8D47471DC4D72B5E385C4185175 [email protected]
889,533,423 *5C8A9A5FB1CD26346EF9D1BE51692831F09B194F BRAKIOBODEJA
889,533,424 *5C8DA5FAD8F41DE20A91A30281926EA0681BFB99 [email protected]
889,533,425 *5C8B913B9301D799D172A3B4CD1EFA7BE3EF0F25 dehcrop7
889,533,426 *5C8D12B6C0467233317299FA9A94AAB4AC7D998B deli111
889,533,427 *5C810DAF728DFF3531E45D0490ADE6AD1725AA19 DENETIZA8
889,533,428 *5C85075E2389A8F41DFDB534762989E8E40D1DA9 [email protected]
889,533,429 *5C8BE928DB9D7D9F67B1847D6B36BC00E8D93475 dennywaldall
889,533,430 *5C84B96A98CEB7AC7039E1F1950A9E6778AA914C BRUKSMNSTER
889,533,431 *5C8B547A8B1DB15B9A65C109E637C3F4D0A13C81 BSWOZZECKBSW
889,533,432 *5C88C7039E69C3A006C573A9E3BD4420CD2568E1 devinschmiel
889,533,433 *5C8A975055173C31DB6201C0ED487D404900E76E BTF%O
889,533,434 *5C8541EAF069E038C5224276725E896BA38CFA68 BU1O
889,533,435 *5C85CE6407C93C093A7AF40769FEDA1B46130A43 d%he
889,533,436 *5C836BBEB5566A2104BB516A240D7CE28D252AF9 dhoie
889,533,437 *5C8F35640DB3685E3F5D0E1852B1EAA893E5CFBC dhzbt
889,533,438 *5C8BA239968BA1AA3E6A56A5291CD61DB6AF4A17 bwc&0
889,533,439 *5C8612AFCD45BB7696CBFFD95123F7D47CAD2CE0 [email protected]
889,533,440 *5C8E5CF4C750654858032ED24D3464BB74E39218 C0&D(
889,533,441 *5C8515B7BE94200E0F9DDDB2AF620A64DF3CB478 d,jnh
889,533,442 *5C8127839E673B6DF5C2D8D185450F34D2CA1D15 DKDP_
889,533,443 *5C8DD12A35DF7320EC57AF914C600BF40E4A24C0 c)5o;
889,533,444 *5C859DE141DAD136A3CB0CFCBFFD41D253E5EA31 c,6ho
889,533,445 *5C878CEF595E4CFEC06DE06EA2C45A6678B05682 DOMINICKGIANNAKOPOULO
889,533,446 *5C81547CF138D4F2AC604973E93AD26FD58D983E DONALDPARRAL
889,533,447 *5C86723B4E489801037AD33BDBCA1A0BC43A9494 Don.Giovanni:.Act.II,.Scene.I.."Eh.via,.Buffone,.non.mi.seccar"
889,533,448 *5C81061AB0ABB1BACB0E19446ED9BF8C3BA7E785 DONGNUODENG
889,533,449 *5C86A88D78F1FDC659855FEBA0C96E3EC2109804 donnellhenneke
889,533,450 *5C8962B6758435D0F7997DCF714F567D05EFDC7F c$anm
889,533,451 *5C81884EBC73B91684D5BD63F5333CA871136A8E capireting
889,533,452 *5C804196B68F559C9E0417E9E67F1A890D05493D (>-<)~D====P
889,533,453 *5C898B43F727B57A07AAA5CD64BD84B69CE33BD6 D!PV3
889,533,454 *5C87DACD6DE0D9C97C5F54ACC17BEB678C72F1E4 dqy:?
889,533,455 *5C8515FAA6E04BA8148F73811DEB12DB9CDE5637 [email protected]
889,533,456 *5C84882D8C7B6EB38D21BC06B4D7EEB4AB38CA3F DRAGANALICINA
889,533,457 *5C87E97F2E5CCEBB904CD9EA01FC931E416714C3 cat65
889,533,458 *5C821245EF0306E3C9F900D3DED63B352341CB2D droevil0
889,533,459 *5C89A2224952657CC24FBEC075EF8AF1CD336F1A d#sg;
889,533,460 *5C818582FA9B0F9317F8FF1FD105B5499BF866E2 dukegrandma
889,533,461 *5C8BA30D5E0CC86B7C339EDEC16B34D126FEC266 dutyvisit2
889,533,462 *5C890B949ED65CC403513C54EEE3762F503BB65F CENTIGRAMMENE
889,533,463 *5C8B1E15E6935BB6541A148399C1A921BFE90198 CGGP
889,533,464 *5C8BE5BB0CDE02BE1192055778523836CDA5353B CHARITY-FROST
889,533,465 *5C8126896265DCA9E3617AEA765B4BB1CDF289E4 EARLYSDA
889,533,466 *5C83FCBA4CDDE59DFA03C5DB4CEC9BAF34497D5A «ECCENTRIC» —
889,533,467 *5C859FE40AF038191FBBBE7BFDFE788DB6C84BD2 CHESTER-CONNOR
889,533,468 *5C8EDA5D8A9C24CD1E8BA74420962D8DCA849DFB CHIKLUTTS
889,533,469 *5C89F71A54107779640031FF9337C6EEFAF88D83 edwardodevereux
889,533,470 *5C829DDF0E269E234E54B0F3D0333F7E1EEF0C73 C=HO)
889,533,471 *5C8A4029AF534C1C5C30E020894B982B0C813F83 chqzd
889,533,472 *5C8977E61143439EF9059F7253FDF3A9590A428C EFRAIN.SAGAN
889,533,473 *5C8C1448F47972815116BDAF8479E074C30B004D christianwilen
889,533,474 *5C872F8311D4FBF67CDE9C807C9BBABA8F59E2CB CHRISTINA-MARAIA
889,533,475 *5C8A4F52ACCD2CF5A49B9CD4C5B57B72C8DCC6A3 CHRISZAHARA
889,533,476 *5C87CCBABB59BAA8E3C6A9B6980D1A8A81C5AFB4 ei44m
889,533,477 *5C8F0D618B4FF7E189F9F7B83C52DEDCA6193F8E EIN4U
889,533,478 *5C844327A28B47A7B00CF6685944CC45315C745B cid#z
889,533,479 *5C8DF39594D3D89B1CCC6B4BBA5CF49330FA73C5 ci!g&
889,533,480 *5C87CF8D0158FE7193813E3354F8E7E00C881016 EITLHUBER
889,533,481 *5C886D339B8AD0AEA2665330490303263B09E381 cindyhoecker
889,533,482 *5C83F7C6083F9138EAEB595CE3DE1A1F1ABD1C15 ELDRIDGE.VALENZVELA
889,533,483 *5C828DC0906256F27A8712DD8EE13DC68AA4814A CJO(
889,533,484 *5C8126B47C9613A5FEAA684DBFDEAFB734538618 EL.GALLO.ENJANDO.(SON.MONTUNO)
889,533,485 *5C8F449AD7E39E696CFC7BEE5E56C58A53C16E99 C;K!:
889,533,486 *5C8AAA2CD8590B3EDB18F137267F15E3B71B65CD CKMUC
889,533,487 *5C8BB18E1B516E66152EBB583A8E986D3E4081EC CLAIREBILLINGTON
889,533,488 *5C86D95CBDC8EDCC5713044AD77A073807675F53 ELS.MAGRANERS
889,533,489 *5C8AE8614FA5658F579649F428FAAC03D4D4FED3 ELTONNITZSCHE
889,533,490 *5C8BDB1861D68B03741C33F20C395D3C81C93DD3 CLBGG
889,533,491 *5C810D54F421C3977892BC83BF30C6CA17FB5DC9 EMERSONMEAKIN
889,533,492 *5C8F27E49505637A158FE7770D386544001DA468 Clown-Service
889,533,493 *5C8F951805C9B8E91429CBB52B3A2E3707FF21D7 EMP
889,533,494 *5C8B7CC9626F99D0C8EFDB64DBC4BCE2EFCFBE28 EMPETRAIENT5
889,533,495 *5C8E9C74BE2912BA7BAC40459772A5ECBFB0BCF0 EN+7EROCOELOUS
889,533,496 *5C85F2193C27FF595F7ADB12612C146B119EEAC1 cn=f,
889,533,497 *5C8613383D934836D6027F94FFAB3606024432EE envenoms
889,533,498 *5C8B805F73F1540233FB38B626876980AAD54762 epx0%
889,533,499 *5C8E7E3B8FDA7B9CB7F11ED868C743ADEF6BA461 [email protected]
889,533,500 *5C8570F9CCFDDA6AE5BD14AF249B3719D7404B21 [email protected]+HMOVING
889,533,501 *5C85FB5723406BC798AE5AC04A6B52DB81F923CE COMPUTERFACHMÄNNER
889,533,502 *5C847FF23EED091DFE65F637439919B77EF06C67 CONDO
889,533,503 *5C8E2DD9FEA097D8CE73A4ED8E51687F6A2EB469 CONNER40
889,533,504 *5C8A035F05A85BBD8E0B89E1B4C478643A81F6EE COREY.MATCZAK
889,533,505 *5C85CE109E6A531C0852078321232BBEC0B612A9 corneliusboniface
889,533,506 *5C856773A37CE9C4E95E59A903A488D12D64BCBC es(q
889,533,507 *5C884DFD53BFBDD84118B0BC468E2AB594EEEAE7 coupeur2
889,533,508 *5C8744A75E7BEBE7AF0761ADCECDC411B4B2BEC7 etairepo1
889,533,509 *5C8363918552CF143600C70FD2C7645D8E35B642 CPLANETOID
889,533,510 *5C87B15FB0CE0D88C61B0720918A946595BF87D9 CPRTU
889,533,511 *5C88C2115EC6A70F2EDF005B317EDDF40C375ED3 CQU"D
889,533,512 *5C860EF59971753E96C0EC0F07D047E7DC01AB2B CRAIGDONHAM
889,533,513 *5C8C1C27C61441B593A7D6BC9CE86B272296BD11 EWOLVSLASTDAY
889,533,514 *5C88BEE7DB12FEF6FFB471D40CCE17713D7B56F8 ex_ante-/E/ks_'/&/nt/i/
889,533,515 *5C818EB8031015144A9850DF92407051F6ED2DED expirabl2
889,533,516 *5C8A01ED76352B41B8B395580B60F130FE3023BD EXPLODENT.
889,533,517 *5C89530DC3A9126D3061769DBA49DEB2E14CE49F eyi3
889,533,518 *5C8EA15D4FD1C9CB1589ED6BDE93AADAF05722E4 EYZWNIKOS
889,533,519 *5C84F39B962E24E16C9EE5166D2B4D3E4BB12A3B F1OW3RB3
889,533,520 *5C8AD42AC52DC82B6B304BDB6408BDC0251BF8D2 [email protected]
889,533,521 *5C8B687861E8C970E3FF675D89E06294AC8250C5 cuqs,
889,533,522 *5C86D6E350820CC3CA081E718396F43ECCDE2F9F cyanidrosis2
889,533,523 *5C867E5C864DCF23A9D09E0806CE8C571FD86677 fj3rkr
889,533,524 *5C8C0F37696525339F0C2078F347FDC123E26331 FL^N
889,533,525 *5C8A9CF19DA453820CF4D01621CC46B4593CE1C4 c#zu2
889,533,526 *5C8C8C6CC946D761E888E2282856C0FD3740841F fo6"
889,533,527 *5C83760B8738633E38120F1AA1DDDA4F9C6DEF4C fonoisne9
889,533,528 *5C89BC781325E72936DFC3DF7EEC4292305E0BA2 D28429900
889,533,529 *5C815E5928711290556DCBFE8CB14B4070175764 D=2J6
889,533,530 *5C8F89D834C479265D2C90C3E9F37DD11D140A67 FORESTKORITKO
889,533,531 *5C8C02A16CDC74BD6EA494C6FD8712D2C5A2A10A D3DPS
889,533,532 *5C846D2B4395B9BD3701548C1985E0746E591C7D forstukne3
889,533,533 *5C8262D6256D343BA9C57E661B0966B3AB637F02 D:3Z
889,533,534 *5C897705EDB7E1118287869BACB5272402DEC23D D5GC_
889,533,535 *5C84257800F8EBA3A37A7018C280F2A6D584C4D4 [email protected]
889,533,536 *5C815B711F8044BC737D4F0259B3346BFE8A3FBD FRANK.BIRELEY
889,533,537 *5C8CDDA63D5E2FA0F2F5958FC087FDE0DC81B81F fredrickwoodsmall
889,533,538 *5C801C5776AEA2468E44F844852E37D220BA42F8 FRIENDFOOTBALL
889,533,539 *5C89C290852F75B09B715AB6D0CF228C14F63DBD D82
889,533,540 *5C8F00370FE41A2E4A391C779D5269D7EE4E841E d8av;
889,533,541 *5C82D33A64227A3D9EBB6739D54FCF847ACFE2E8 FRSTASIDORNAS
889,533,542 *5C8BF31804DF0A737B0218A1499F2C544D105814 FUNDMANETALIST
889,533,543 *5C8569A48DAD0F22BE83C4BC446D6F41D8A8E020 furcates
889,533,544 *5C8046041D978C28C5CAD130A46D14E3F31803EC DAKKUL
889,533,545 *5C8460BA3B1E4BD2F9572A2C618EF7D6F49DA3A3 danavam
889,533,546 *5C81D5C8C0CE306F9D819BD1B4FAC1B820D48C3C daniel-radcliffe-emma-watson-rupert
889,533,547 *5C874C32129AAA1FD66703C9EF4C2E490DC9A261 [email protected]
889,533,548 *5C8B70499EBF7B400ED605FF130AF523A053C0C2 DARIAN86
889,533,549 *5C8A4E27477D2F67DFEB2EED7447383D5DDA7829 DARIOFARRANT
889,533,550 *5C88A600BF299CF9FC0E045DF44630F13ABF174D GARRETTSNOKE
889,533,551 *5C8BE38AA57256B830E7E84407F6EC002A09126C darnelllockamy
889,533,552 *5C87053D3727C8A469E8094866DD61BFBB4EF21C DARRENHALLINAN
889,533,553 *5C84AA65818BF1FCB90D7C1D004ADF63C99D976B DAVIDBRUNETTE
889,533,554 *5C8B819DC77E7BCB02958B47CCD20E4D39E65F90 davidwest
889,533,555 *5C8732B8C03F8EBE2DAC662ACDDF5FED19C1EDA2 GEORGEELDREDGE
889,533,556 *5C81A27E828E0CD0FF2423E0C7A732E464FAE506 GERALDO.HARISON
889,533,557 *5C8C8F34CC8B37094380C6F012E90214D4EB6595 (gerrymandering)。
889,533,558 *5C8E8DD28A7A109C9438FA8B5124A58F19A7D98A GEYSERISH.
889,533,559 *5C8DC9EE29E8458A5CCF7FD2CD1C5CCB0E0D7BC3 ggnr
889,533,560 *5C8E0388AB9C1201F79E5EE608D32A1D2ACB25B3 GIRLS_1995
889,533,561 *5C881253B6DD20735EA6A69455913E354AECCBE9 deborah-knott
889,533,562 *5C891D5DA4A4DB8F5891AA92AD67AD99F827CAF5 [email protected]
889,533,563 *5C8591E1CB7A9243166DD5D5E9698CE09CB4B2B7 GNIRYTSSTETILAVK
889,533,564 *5C873CC8C4502BA40D4BABBDA12DBCB985267D5A delmerserrin
889,533,565 *5C8C4CBDBF8F84E175AFB9187ACCE8C6AE877C9B demijordan
889,533,566 *5C894A1E26A31BB2C9119ABFF0EF07609E400352 gracie.duke
889,533,567 *5C8363D094D8C280D2878EFC5B99FFFD3C39F646 deprdepr7
889,533,568 *5C8EC0D563785E05460787CB8A1A7D54F18F83B5 DEREKHOUCK
889,533,569 *5C8B318FB158FA1D0E97088CC552740FB502AAAA desert-luau
889,533,570 *5C84092F93F769DEA709E59F31B74BD88195E964 GREGG.DESMARIS
889,533,571 *5C876C77A5285844349EDDCD08F55B6FB03E0F28 gregorydiewold
889,533,572 *5C8696F28427BDC714F5E24E46ACBBCC582132A6 gregory.sun
889,533,573 *5C82AB6D38C53B9084DFBF666955FA740F0AE350 [email protected]
889,533,574 *5C8FC6B47651BDB2AA10B30DF31DEB57DE0944D7 gubita
889,533,575 *5C8DA990F77A9E08B2918A54FFF87689004FC55A [email protected]
889,533,576 *5C89E6E51AA927DBF3155DE97251D0BAB69348D1 dhb/4
889,533,577 *5C89A02A07C1EA2D87692DBEB2D88E42F4D7A111 dhnvi
889,533,578 *5C8C1E7AD0611F0D29C5F69AB695B94BA25F48C8 DIBUS
889,533,579 *5C84AACBB0D234479929C31EE95ECE585AC2C97C [email protected]
889,533,580 *5C820AD77A11D4A1D945B8622BBD18D0FF292198 HAYDENETKIN
889,533,581 *5C83168EBD379A8A04148BB8C343E15BCC6A376A heathfiggins
889,533,582 *5C8E24B80AFC573835C68BDCCE870E44F3EDAC8F DKHILALI
889,533,583 *5C8BE6FD3378744D4D3D1CEED14A9E5FB44A6325 DKRBL
889,533,584 *5C8DB28D3588DBF48A5F0382C6904367361CE5B2 HERETOIGORE
889,533,585 *5C893E477B20F59717FCD39315A01ADD9045C0E4 dm/+1
889,533,586 *5C858A478867A231F36D59B30214C3AF7BE19302 dmlrh
889,533,587 *5C8A7609E0B6C604FE5FFBE6AFF1C46AD38672A3 [email protected]
889,533,588 *5C88C2E5AB507DD9C475F1363E2D282135DA389F HIRAM.KRAM
889,533,589 *5C8E85C91EFDF5C119746C54391118A8861DEBD7 HitsvilleUSA:TheMotownSinglesCollection1959-1971(disc2)
889,533,590 *5C8AE5DEF5C87B3D4DFA8F051D31682D55E95C70 DO.JUSTICE.TO.A.SUBJECT.
889,533,591 *5C8120D9602F01C9882542E55B5DC6E80F10A503 [email protected]
889,533,592 *5C84CD609EB1FA9889C630724819CC3640450DCF hopkiln2
889,533,593 *5C8C8102E8C76E1FC13645F7B3E8D49DCD7E5BE6 HOSEA.HACKENBERG
889,533,594 *5C839C75A44CC04B8FD5C6DA98DB6FFB4CDA890B HOTELBAU“
889,533,595 *5C81C2CB668CF3244932E3F657528A361EC2358F hotel-ukraine-in-moscowjpg
889,533,596 *5C8040CE5744FC7CF778974F083DECDE7AEF3FAB [email protected]
889,533,597 *5C868D1DFF453F954AECC0A94EB4BAAE973C15A5 [email protected]
889,533,598 *5C827251CB699B8FC99CA4569B94E1D04D518B87 douglassfinnegan
889,533,599 *5C896E8C745E0442112D5429742415DB960FC5CD dovessed
889,533,600 *5C83CDC2670C4B4BD14591B33AEC0FA06DC9905E dq3r"
889,533,601 *5C8FC867B54E7393E5EDE2D272357D61E1675405 [email protected]
889,533,602 *5C8B36D1EFC67C301C4DDA88D573859E83A9988C dr(gj
889,533,603 *5C8F6C983C34C22A1EED9DB0EC4D8C735F187AD1 i<3zhengyu
889,533,604 *5C8D6FDCFD551EF82189A74FE54EEB2505E0E4D9 D##T1
889,533,605 *5C823C1DECC01A3ABCA9F97689B8D2A5EBDBDB75 ifukeepitup
889,533,606 *5C8F6A2B1106B61FD63DDBD1A97A4F2CF0D7257C DÜNGERMATERIALIEN
889,533,607 *5C855711DA61AFF65C4A29715826A41FC0FABCF7 DUSTIN.ZULKOWSKI
889,533,608 *5C8A3DB0A13CA8A0351CE026BC13A5D0EBE44BDB DÜZELTTIKÇE
889,533,609 *5C8C41D7315EA6D1458F3F2C39B8925E5D1E3B59 DV":)
889,533,610 *5C89E485401969F58AAAEEB6A2D8E50BD48F8688 DWINDWINC
889,533,611 *5C81881233079C0927920A3E8243B9B732B01B76 dx;e:
889,533,612 *5C8A80B4DADC67A870EE3D0A33E9CA67FBBB2618 ingwersens
889,533,613 *5C84377A29F8B3D94FD8D0D689C2310D941A38F1 IROTRASING
889,533,614 *5C8774837837DD74420B06E916BCC80DC31FA95D EDGARDO.MADERIOS
889,533,615 *5C8D98948A8368CC2F200040EF8319CA43D357BE IRVINWYGAL
889,533,616 *5C854EB2DACF23C6E25B41C2E5C2B69B2F4DD730 EDNEIOOGGING
889,533,617 *5C86C21D8F4F1ACBAE2DDD6AC76E7E5937E15A53 EDWARDO.COSGRAVE
889,533,618 *5C8D0B76B4293A9C866E605DF26BE64925289E61 EDWINSCHMIDLIN
889,533,619 *5C8ED71A0B76576D47D62503037F6778C49DDD67 ISTRIJEBLJENI1
889,533,620 *5C801A2F9F91A135C31974C3F90B24DC55CC0CC6 itsanew1
889,533,621 *5C8E2BD46D9A7506A44265984E4A657C7B7DCC12 EG41!74R!4NS
889,533,622 *5C8F7D64641123B5A301D67988A1EEC0E9586928 EGIDYTEV
889,533,623 *5C88ABA63EB34AB255F11B86BD5217FAC12149C7 EHCRAMREPYH
889,533,624 *5C80B9A19469DC89C4A53B4E5F7AF1065F762042 jahreszahl“
889,533,625 *5C816DE300872C238446F41D0909D2247AFBB6EC ELÄINPSYKOLOGI
889,533,626 *5C8C65AFE8FCC2813E0D83CF6C5AFDBBA1F16F3D james-freudenberg
889,533,627 *5C85CF7033A6F4F08AA1D8519A7AEB5479B0893F eleakcim
889,533,628 *5C8E57A63F143A4080028BA3F636225D67E42BD9 elifi
889,533,629 *5C83E06198E6D8FD5B97B5CE6D1B6258D57D90CD JARED.ELLIAM
889,533,630 *5C8E219EE76BF9D4B76EA4CEC96EED08207DDCE5 JAROD.WUERTZ
889,533,631 *5C8096C6EFCE4FD2419C813C27C0DCA75A737C38 javi.perro
889,533,632 *5C82B72A59FA24A8B1A8780ACEE829E1E25EA82E ELVIS.VANDUYNHOVEN
889,533,633 *5C816535F421833017FD0C5F7B6843ABA4E2FA7C [email protected]
889,533,634 *5C82EA1D11BC405652365C2BA5FD12D6F602274B JDUROT
889,533,635 *5C81A0060A47B84ED8AEECFEC0E5C120533CFC08 EMEv
889,533,636 *5C885FCCE7C0B729F7CF4D5ECE5C351BF47A78BF EMMANUEL OCHEME
889,533,637 *5C8ADA01398A044EFB88B1FC3625072A49895052 EMP
889,533,638 *5C8FD7599D076A5EFC1FB8867E40917873841709 JEFFRY.BERSCH
889,533,639 *5C80487BC27C2190474A7B8AFA280D519C06876A +EN+4V4+E
889,533,640 *5C872B39A97CE8C443F2AD887A88EE8BD82EF0CF JENLIEW
889,533,641 *5C8829E4CAE8C33DD1DC0E0E6C4DB2BC4563AE42 [email protected]
889,533,642 *5C8ACDBBDBF722CDAF644D3D369C7AB7546320EB JERALD.MOLTRIE
889,533,643 *5C8E5FD13E9FC33335662A7D8C6BE2B2D4CA76D0 jerrellsorbo
889,533,644 *5C8D6063DE769CDEDFA0B47481D2459656025327 jessie-chavez
889,533,645 *5C8E394D62F59D7D05791B9E8291167DA22FA9D3 [email protected]
889,533,646 *5C881DF589B7A9968A6E648DB8809AC38ED673BC eodls1989
889,533,647 *5C8AEB907DD6B529F54C25AB625484E0FAB8FDF3 JEYRAJ
889,533,648 *5C8C5EA287E678CEF6237DCF6C23BF196EB41916 JOEL.CAMDEN
889,533,649 *5C8676727C34CA104AC0CC554285B45F88D5C450 JOEY.MELGAREJO
889,533,650 *5C82CEBE90AAB8A7BDAC70E283DB71CB69B8D4AC johnathonmorici
889,533,651 *5C84763969255CC8C7C67E4F122EDAF2D671CB1A ESSAMALB
889,533,652 *5C83063B3570C76BF4FEB445391BB597136987AD jon-lunceford
889,533,653 *5C8E6CC4237578C1F8C7F717605CE47C66BEB43B JOSHUA-KHYLE-ADRIANO
889,533,654 *5C8538686B275857A32B1259BAE4F3F29EEA579E et?)s
889,533,655 *5C847F3B5A3D321F37BCD6A58B2FB91721ABF040 EUGENIO.BARTON
889,533,656 *5C8EC78184954C0CC058257C5BE5E2A41D0B0620 [email protected]
889,533,657 *5C85EEA67D002F99678327982BF51F73A18D1FA4 EVERETT.ROBBERSON
889,533,658 *5C8E01FE936A34E2382A778581EC4CCC1366DF3D JUDSON.KNIGHTS
889,533,659 *5C820F52EC7D1E74F0DE4F37CF98E4BEFF2B350D EVORZIA
889,533,660 *5C87B1A849F8CD67BE32FBE64CF17A7B679BD594 julia-meme
889,533,661 *5C89D3A4EEFA114B6A2C422D31FFDA03232D1D03 juliogruhlke
889,533,662 *5C807A5EFD689D1492C9FA6518B32550D33EDC8D EXPIRERS
889,533,663 *5C8CE87CBDA8E89F8CF33A2AB8CA061AC4FA1211 fabrisqued
889,533,664 *5C87FDCDDC6C2B1E7C3B631507AEC6E7EF4CBDA4 FAERIALSERVICES
889,533,665 *5C8D5508D4D07C8F35E1F5CF1DEA26AF365B1954 FAIRWAY1969
889,533,666 *5C8692E30B477DDEEA9AD6134151CAA9F2FBA726 [email protected]
889,533,667 *5C86E522A93689D9D6E9FDF27B58BE70A131FC93 [email protected]
889,533,668 *5C8CF60497F396031556309B6B1C588D576081DA [email protected]
889,533,669 *5C8DB892F78B746D5CE91960F093FEE8306FBC94 [email protected]
889,533,670 *5C8FB12345D1C9F92493302D20560FB088AFC227 FASFASFING
889,533,671 *5C86A21594DE70A67A4F2A58A380AFCC6183EFC3 fastekure3
889,533,672 *5C8FC76EEE865E2251410D511E854C4B4855E7D5 [email protected]+ECI
889,533,673 *5C84948AB67E57381F64A569F181459A14D2D69E FEDERICOBODRICK
889,533,674 *5C87060E8938260A72F37208B5C09D7A891C6F0F KAWAIONNA
889,533,675 *5C8DDDCE53B02FB93BAFA395DE7C864147B51C91 KCIWBSW6
889,533,676 *5C84B41FC4E372016C8EB20A14AF3C5114EB900D FERDINANDSKUBIK
889,533,677 *5C819A99F22C5B8E48172307F0DFB6C025EB6304 kcze
889,533,678 *5C826F52DFC1F29862A10A9D951DF99F6B282650 fiskalinduzierte
889,533,679 *5C845E9E0BE1A8D6D0AAA6FF634CF35D2C5024D4 KFAICHAMPA
889,533,680 *5C82CD036DB94214DA63B89D966E9E666194BFA5 FLORENCIOJEWETT
889,533,681 *5C80D9C45EF676362D588B74E41503E7A49CB9C3 florentinolindwall
889,533,682 *5C85FA7D843ADE5367633274C24FAF7CEEFA8B23 [email protected]
889,533,683 *5C8BCDA7460DCBFB6FB1B43DCD3EB63772EDF61A KIEMUROILLA
889,533,684 *5C8E91BC885C276CD08495F58C88876F085A9DF5 FOGHORN
889,533,685 *5C8ECBD6D1B5E2D0B1DED86E6EB056D6C92767BA FOORPYRA9
889,533,686 *5C81BC57E3C9A4315FCB7A3426F5FC985D040D31 kirkruthman
889,533,687 *5C8B11FE111F7AEEAA2289C46807B849DF2BAC9A K~J_
889,533,688 *5C85E96F138D85BB53DE0D05A62222B2059F57B7 FOX GRASS
889,533,689 *5C87742AA6550074DECC1985EFD44ACE448CA95B FRANK.LENTINE
889,533,690 *5C806CB9ADCD07DC88DCDA3033C6C1195371D741 franklinboje
889,533,691 *5C8D3426542A4AC2699EE9176BA128C8DB394F55 FRANKLYN-SIGLER
889,533,692 *5C8C856AC7B01ED26ABE019C1209060A88B3F8A3 FREDDIE.RECK
889,533,693 *5C87578C51903427E99EBEED2B2C90C78F895C4D KOREYBORCHERDING
889,533,694 *5C862EE3209E65843B95D543BE6A2C99C15F60FA KRISTOFERAAMODT
889,533,695 *5C8800E9F63C4CEB19B685CE5559A92C6204DADF KSCHILTHUIS
889,533,696 *5C806509B8108D5955BA396C3A3A7CAC0FA022FE KUISRIKUL
889,533,697 *5C81019909785492789F6BC9F27ECF5464F61348 g?!a
889,533,698 *5C8BD3353CD852F2D1E9B167B89EFFA186E42CFB galealmos
889,533,699 *5C82FB3992F0189A5ED23FFE15FBFD4DD7DFE65A GARAYBERLIN37
889,533,700 *5C84E83C1D4FE69B479E1BCA0761886CA6BFF21B LARRY.VANSICKLE
889,533,701 *5C8C8C1820A806554673F439389148F849858CE7 LASTSECONDHEROICSJAN10,67
889,533,702 *5C8A7D789C93639E897D6924AD35BE9A11EEF317 laurahan
889,533,703 *5C891BE4898DFB00912BFCEE834AB56FA2BBB173 LéVY
889,533,704 *5C800AF8AA9AE52E104F308495A180DEDBC6DC41 GERALDHOLMES1234
889,533,705 *5C8036D495C6DE3729F4F6CED54C842A207ACAEC LEAMORG
889,533,706 *5C83D28DB930356866CAD59BFB758A0DE33CB2B0 GERONIMO-CAMRAL
889,533,707 *5C844C7495DB76D941B81B1622077203DFE2F2B3 LEANDROGWOZDZ
889,533,708 *5C8006B3BE9CFAE9DDEFF00DA02E98AA9DD9AC5E gerryhotek
889,533,709 *5C83EF49B4E5EB823DE3891248B5C57240A911E3 lentooman
889,533,710 *5C8369FD392493EEDA0346BEF467981C477ED747 glasind
889,533,711 *5C8954BAD21B89D97C1129D3CD28C5EBBFBFEF5A LEROY.SCHWIER
889,533,712 *5C80F358B26B815B6EDA0AB8E8EC7F58D51288B5 [email protected]
889,533,713 *5C8DE2CA2DA42267571CFA0D9EE6876B9AE3A0F3 GNIPOKUSING
889,533,714 *5C883DAA076F617EB5B551D59F11D47B535D8C8A god1ik3
889,533,715 *5C85FBE2A533362D6F26C61E0C6D63908AD93774 GONZALOBOSSEY
889,533,716 *5C8DD93A20D76F9D9C4535C4F04AC3156D699470 LIFELIST
889,533,717 *5C8ABF3381DDA346D8F58CE945D9D688680162EA [email protected]
889,533,718 *5C8A0E01ACD3DCE57AF513368A3366394D5B197E gregorystancle
889,533,719 *5C8C076B3038FACC96FA8D800E361256614914F6 LITTLE VEN (FEAT. GEOLO G OG STIK OP JAKOB)
889,533,720 *5C8211B94A9F94344B4BE8B29241768209E870B4 [email protected]
889,533,721 *5C845472B9AE1AC5CE5463E6CCE7ED0F1D0ACCB0 LIVEATBARCELONA
889,533,722 *5C8DAC76123A568027C248BC2BC84C5EE30F25B2 g=td
889,533,723 *5C8C4F120B788F7EE19758F06202B1C9DA678BEB LOLZONING
889,533,724 *5C8931BC5001643287473FE78550197F7073B6C3 LONG-LIFE JOURNEY
889,533,725 *5C85C228F87689BB412496D0FFB2302E25A97F22 LONNYEVELER
889,533,726 *5C8081EC7144E36DDA7DCE83E7BB7CD9D6536B4D LOUIE.INESON
889,533,727 *5C8D0C67FA2DB4EAAC620F74AF6653B10344C54B hairetums
889,533,728 *5C8C5C911687E02A0F6A7019A7A22AC8D0AE220D HAMBURGPED
889,533,729 *5C8B8217D63287DA7CDE695DAEFE2533F1A7912F [email protected]
889,533,730 *5C8B72015774069550B639AE123BCA08253A9389 harleyguardiola
889,533,731 *5C8FB8107769845F0B0C59363A08430F7B7E164A LUFTWAFFENFORMATIONEN
889,533,732 *5C89D7F0AAF5ED0F5478FF74E93E26F6573D1ABE LUKE HIGH
889,533,733 *5C8E2E3632FA6E580C9427072569E581940E46A2 HASH-2
889,533,734 *5C8548231B58AC36D8F907CCF61C511DB11B6AE4 h<at
889,533,735 *5C804194476BB062E2353E90B0F1745C280A0EDB LYMANMARTENSON
889,533,736 *5C8E882EF3F5ABEE6663774F37CB6A2F0395D090 +HE0CR4+IC411Y
889,533,737 *5C8EF8506301C0C677AD6DE7DC7E32DB068FABB1 lymanpajtas
889,533,738 *5C8F46DDEE6C80E622E4CF31AF74144650BEB14C LYNN.BROPHY
889,533,739 *5C853DFAA5D4E61D92D9E687411A6012727169CC M0UN7ANSDES
889,533,740 *5C859AEC7905842C9BFC0CCD157E4700CD86C4AD MAALTYD1
889,533,741 *5C8718E0BC94533D28ADA63450A99190B6BC53E0 henrysports
889,533,742 *5C85B12BDB57C07E69FECEB7F3859C78494A8AF0 mackwarwick
889,533,743 *5C8A2D3B2568B1F02A04A9FA1E2F3706FFE90582 hi-fidelitydubsessions:thesecondchapter
889,533,744 *5C8F80410D36DCAFACC695D1BDE2213ECAC0AAC7 HISINGERITE6
889,533,745 *5C8CAE01427FCB6D4FABF04ECD8EE74728F6E69C mannedship
889,533,746 *5C83306CB39DFF8B0611DD4335AA19CFF98FAF62 MANUALTIMMIS
889,533,747 *5C8250DD827C62867DE12674C546FC6E58634264 manuelboesiger
889,533,748 *5C8FF59C7538BF23DEB8A83B77915C3AA574D34B hob-xvi/4-/-sonata-#9-in-d-major,-menuet
889,533,749 *5C856213845F84B7E92830368137D363A4A5803A holeinthehead(gravitasmix)
889,533,750 *5C80279E343BCAFD3FCFADAC949461BEACC9BF71 mariospagnolo
889,533,751 *5C82735458E74BB621EFE0F6BA4D5008EE174E75 MÄRKETILLE
889,533,752 *5C8D80FDA9087C091ABC74E6AB1ED2885E841423 MARK WAYNE MILLER
889,533,753 *5C8497DF1538685915713C1AD77BE445C6C3BFA9 HTTPGOSTYNIN.POWIAT.
889,533,754 *5C88EE6EB3CC8AA20535ABB28A0FBE785C5655C1 httpwwwiamnotacom
889,533,755 *5C860417D28446783722DB542F54387F58157E75 [email protected]
889,533,756 *5C836086EED52392C60D1DFF71654FFCB95A1F93 HUGHSPENGLER
889,533,757 *5C838D1C9B8E1F16B04F38E53FCDA033D6AC5DF3 maryureste
889,533,758 *5C8FE3A87F0D0FA5D920B5CF468DF35219CC126C [email protected]
889,533,759 *5C8C44285FF4407FF5A1AF5EBC5944919443E514 MATTBEHRLE
889,533,760 *5C8F411C529501581F47551936776CD2C73EA759 MATTHEW.STUMBAUGH
889,533,761 *5C8CFCE8F185DBF9AB8A175CE01254DDCA297738 MATT.ROTHBART
889,533,762 *5C8972809CACF48A277511250F14D167342BA297 HYMANRESENDES
889,533,763 *5C8BB8CE147B2F41F8EC459368C3DACF6ED61838 hymnodyn
889,533,764 *5C8CA29B8BA5EC4203ED4C1054C9DB8A4F212868 MAURICE.FUERTES
889,533,765 *5C8D1368DA673FB57116B4DB229A6C4B7E732F75 HYPPELEV
889,533,766 *5C8675FF4CAD8E7C2515E7B3BB56EC4E2C9DECA6 IAMLANDLIEBE
889,533,767 *5C8FD239245155F967B7AEAEF3263D272F4B99FD MCPOT420
889,533,768 *5C85ADA7076D1DD14A3A7EC80DA6E6746091554F MED4LLI0N
889,533,769 *5C89E2C30FEFB11CC93D95C4382B85AB8504EB5D I'DLIKETODIEOFLOVE/POSTCARDFROMANAIRPORT
889,533,770 *5C8B7949678FF6689E78C40713B2F107D1AE59E0 mehdorn bahn ag
889,533,771 *5C81FC80BEC70E36384323DDE86DD4DDA2A6910E MEISHEBBS
889,533,772 *5C8CBCBF209132BB874D90649687DD2ED0C34616 mel0d$7
889,533,773 *5C89E05D28A20A77EDBC7C75AC2CAF9814E9A74E IELEKREP8
889,533,774 *5C89F9059E69A52DE6CE1780CC51D906CF9DBDB2 METOXENO0
889,533,775 *5C8D8E693F9FB67AED811F747B9F33C8EB40774E michael-c-johnston
889,533,776 *5C86BD0C091CAB24A83A3C3B95B517B5C10DF892 MICHAL.CLINARD
889,533,777 *5C8D71EC172FE76B9DCBC8458EEF1C8FE4C87FEA [email protected]
889,533,778 *5C85F6DA576537D87B57B63B8C48F4D523EE08AA MIKELATTA
889,533,779 *5C84BAC90126C76937C77D9BB074A5FB10A6FC4D milfordjervey
889,533,780 *5C89BD6FFA5565B1EA83825564CBEE7E2F439D6B MILO.EMONS
889,533,781 *5C8B65961402BA06A0D65C46CBDCB2DC067ECAE4 Mineralbearing material
889,533,782 *5C847348CC581967F291EB87B7DE561F5E0376F7 [email protected]
889,533,783 *5C8800851BE71F24B6B0ACCB467298E588FA629B ININFLAMMABLES5
889,533,784 *5C87159556E90EC82EF0709817CDADCF3E926948 IPJV
889,533,785 *5C80AF60C0F52846F9474B733C43266F6B6098B0 MONTESUCULENTODEMADAGASCAR
889,533,786 *5C8DA960B61C2E8FE7BC24EF37C07CB433119D9E ISETNIS2
889,533,787 *5C8A362B272DB92762F43379F344E0C7811C4B7F ISIATSON1
889,533,788 *5C83113D5FC9081415C16EAA70AA5EE44B5D15DF MORTONHUDECEK
889,533,789 *5C8C91B9BA4CDCC14710AD34A413E8F8ABB60B35 isrealnatewa
889,533,790 *5C87F80AB90815E23A8296105BB11D9BDD4215FC MOUNT EREBUS
889,533,791 *5C8EE73AB804074CFC710B9742D52F31120BA16F IYZN
889,533,792 *5C8E2F1A1932CCC5040A6D85DE8261CCF20E5EC6 J{@(
889,533,793 *5C874559AA597230BAC56242CE9A8222C9E6F701 MUNDO.RUIZ
889,533,794 *5C8031BD2CB2237A6E3F5B1E3D5BD9261EF6990C murraydraa
889,533,795 *5C881AC08E25F7F61A9C0A513BA21CAEF952191A JACOB GILROY
889,533,796 *5C8CFA1AE914061FAB44B89742D0DF20451DC92B JAEDRIESENGA
889,533,797 *5C89C83EB181A8835F03AEB08A065309C5D79487 MUSZKACÁRHOZ
889,533,798 *5C8360D31CE76AB2E6A4CFF99A36B1387E1AECEA MWCSONYERICSSONUNVEILSIDOUENTERTAINMENTUNLIMITEDSTRATEGY
889,533,799 *5C872B13A12DB0BB57545A4C464D4D41967AC99B jake.haase
889,533,800 *5C84D37E1C74A7D6E66000D3A0A152B8F9B1280A JAMISONANKER
889,533,801 *5C8E716A83F91ACCB821C3683622C6058628F29B JANCARLOS0989
889,533,802 *5C8FC359CBF5B27DA6D15E76D2E5E093C7A6BBCA n485=../[email protected]
889,533,803 *5C8820676D1B25728A4C3B68232A841E6BD638AF JASON.KRIES
889,533,804 *5C8885B2565EBBB86C9E059033C4AA5DC979A005 NachHause
889,533,805 *5C8B3221E93FAA285E60A36285CC68C1C1718749 [email protected]
889,533,806 *5C83E65EB7E344D4B7AF60C0CD70BBD81E1AE3A9 JASPERRAMIRE
889,533,807 *5C826433B8254DA6007F8F5795FF2698A31D211C jaspreet.bachra
889,533,808 *5C83A9606A29B198C83CCC0FC411BC0B4BEA7064 JAYIIS
889,533,809 *5C88C88A62B229B8E20C49296D0C6F9A0E12572D JAZMINFORBES
889,533,810 *5C812295F20C0E08D917F8F3B00ABA50C0A89311 napuji
889,533,811 *5C84537FD223F8FF9F8D5C7B0DF60C62204B5410 nasolik
889,533,812 *5C8F753E305E07DD5F19A699C648838DA975215C JERAMY.MANGIONE
889,533,813 *5C8653947B64B0139360055F6EC2C432AEDB4EF5 nedpaprocki
889,533,814 *5C8A3F6CDDFD5AC8D4902FD6676DA010CF3AF013 NED.WLODAREK
889,533,815 *5C81938CBFC614DF38749EE9CE679D80DE2A18C1 jerroldferrando
889,533,816 *5C87876FBEA8BDE97E64053A2D1D083B303EDCCB nelilehtisen
889,533,817 *5C85A3E4312230F9EC1790F41233CEA43F2B045E jester12345
889,533,818 *5C84CF72378201C6EECEB25DC7012D2B9F9E94E7 NEVII:SALUT
889,533,819 *5C8D01B0A926E9C79E228F04CD91F8A39BDA681E jic]
889,533,820 *5C89DB1D9E8BC90FBB04D935763C1F66EB8863B1 NICCO1IT3
889,533,821 *5C89570ECFD832A8B1279102F6B28D0C97DF64ED JM100181
889,533,822 *5C867B3E71D3A01CEC47441BE3FDC7B265AEC68F Johannes-Passion,BWV245:XVIRecit-Chorus
889,533,823 *5C86C073BF6702350F82722DC90CDEC6B029B8C2 NITEWQSB
889,533,824 *5C8FB0E1896077211CBFA6293D3141B279516D84 NOAH CARNEY
889,533,825 *5C8CF69EFB4CC6A574B5809259001CDEF2D0014A JONATHONHEDLEY
889,533,826 *5C8A528E5F3D502C89164BF6BCC527C8F4986199 jorgeleitem
889,533,827 *5C83AAFD2E56EBDB60AA8A4D603C02E99F67DCA8 [email protected]@1
889,533,828 *5C867472EC04E98E62354C54602A9D79FC33201D josiahmantano
889,533,829 *5C8F8303E814E930B882C424F3DEB6131CDBC070 norzhfriz
889,533,830 *5C89FF1CCF237C03E6F130B1F473D78BCB8D8829 NOVELAS-DE-PHILIP-K-DICK
889,533,831 *5C8D6F438313128FBE2A14C6D73C17831FB10D7F JSIBHIBHI
889,533,832 *5C810F1FB3219B6C0BDEC8A44022EAC827BC864A juanbernardoan
889,533,833 *5C811FBF914C19B7CA9211EC7E31EC108FB6DAF1 NSTELIKOS
889,533,834 *5C8D62B73059A8E8D5FC14DE61572D3EC77B921E JULIE WARRILOW
889,533,835 *5C8FE8234CE2CB22B913418ED332D98005CDDBFF jurasmat
889,533,836 *5C806BFC44505C4FED198DE80856FED3647151AD OCGRUBBED
889,533,837 *5C89B386FB1DEF42F4068C1C28F1B3F08B20A5E7 ODBOROVA5
889,533,838 *5C848258C04AAFA58C0D663E0D4C897FE85FBA7A [email protected]
889,533,839 *5C817B1B317686C4BFAC7B825756C7378E0DDDE0 kapollo6
889,533,840 *5C89A63C8B21CAFF5757513FBD60F4FF3BB0ED29 kconnected
889,533,841 *5C84C853A290F34DD089E28695EAA998D9FE553D ONLY-THE-THUNDER
889,533,842 *5C8781B812B55A36FD658D7545E7982FB8CCDFC9 KENDALL.HENSLEY
889,533,843 *5C8CFA7B45A5F27BCEEC70E68A18E1E74D948945 O><O~O~Q#B
889,533,844 *5C8CF073400D028C9366A49B73ECC4D6249DE830 openwe4v
889,533,845 *5C8DAC82F419F55B0C9CC6C6B24622CBB9E81BB0 [email protected]
889,533,846 *5C894EF304500EB621E69B5EFFA0CC4C6293B3B7 khinetoplastida
889,533,847 *5C8E1B2A7D937F8E87A02160438E53906296CCBB KIKI590905
889,533,848 *5C8131FF31E9F579796F2DE3802A120765EBFCDA OTTO.KOESTLER
889,533,849 *5C89107D5F5F20036EB08CF1C4CDBCF690FAD2F0 KIRK.TOMSIC
889,533,850 *5C853D52C502026B3945B4BBE4CC518D9083FC90 our-world-way-franchize-boyz
889,533,851 *5C80236394203FA4407F069C2F0765A934731C65 KOMUNIKOJ
889,533,852 *5C8A262F61B883F6458C5EAD1B6A2067BFA5CAAE pannic1e
889,533,853 *5C82D5E0423DD847C895361C9AD52DD9EA2A622F PAPSTESNOCH
889,533,854 *5C82250BD7978D770067B4712BD0FC20A16EA9BF KURTWINZLER
889,533,855 *5C875AD517A8D8FD770FAEBF4F2ABAB5D4DE6AE2 [email protected]
889,533,856 *5C8772B8748ADC3BD0548AEA68FE5F730BB0C1DD kzzlfm
889,533,857 *5C82705418AEE1B1CCB87E5FB59DD4E5559C831B PAULETTE TROTMAN
889,533,858 *5C87782D08249429263F0A5BBADF697C71C61189 PCKLEE
889,533,859 *5C880DAA922201A6025E909155E216BFE1D9B12A p---d~o(-_0)
889,533,860 *5C88723BBBA868BBD37732C96A0E94623675F873 peg.moran
889,533,861 *5C83BF07A0B3409847B132BAA10F337A488404AB PENGELEDAHAN
889,533,862 *5C84C7F63AAA26A03EDFA67564845F72F0A47B0A LARRYCOPLON
889,533,863 *5C894A6102A012B24C84FA30A9C4F8C62DD159E5 lars."danmark".danielsson
889,533,864 *5C87402E46CE867343E9DFB8869BBC07033DB383 PETE-CASTELLANOS
889,533,865 *5C8189312B1B579C64D5A357D5A8E01D5786DCF2 laurenceadauto
889,533,866 *5C8B390292EF0B88ACF372A78F7F684107947449 PETERSACK1
889,533,867 *5C839DA26BAA367295630E1EAEEC142682C588B9 PHIL.BECKLEY
889,533,868 *5C8AC0C90C2A4E8A4D35862CA7D9FBEB6EEB9C35 philholshovser
889,533,869 *5C8EC07E7E9B615ED32EA193F606CE1AB9A72CC3 LEANDROSCHANZENBACH
889,533,870 *5C86C7DD76D697EF315EA4AF1F2EFAC1B38E4259 LEE-TIN-HWEE
889,533,871 *5C8BA83ADAB7F6277F93170F1AED587688399183 LEGENDARY SEA HOLY BAIKAL
889,533,872 *5C803F1D0331BE59FF6DCE2834369C451B355CAE LEIGH.CALLAHAN
889,533,873 *5C8800AA3A6C9B7185A8A9864AC3FCE5F6FA42B3 [email protected]
889,533,874 *5C860AA72EB0DDA74E1CC6B10E8694FEC94D7230 PLAGAC
889,533,875 *5C85CCE2063D2C7BA069341BAB24DBC6CAE1070D leruiler1
889,533,876 *5C8AC3D57821D042CA852FD6CD1904A2489FA0CA PLLENES
889,533,877 *5C84065028C7DD8828389766DB0A243F8BE4BB79 LESSONBOOK
889,533,878 *5C8ECA7C694F9D916D4D61C20B7B06758433B884 PMBBB78656
889,533,879 *5C830C40C6981F23439637BAAE179D9EB275388F PMEHCTF59
889,533,880 *5C8B1AA1E83328D06BF67499A32D04F1AF4AAFDF PODESNOS123
889,533,881 *5C85317311AD961FF12EB6559B217ED03DC594A2 poii
889,533,882 *5C8395FBE38F5CB77C6165431A61A0970EBE6B8E pontifses
889,533,883 *5C8A9E181C646816ACF65FAA05ECFB8B6F07FDE8 LIMNOPHILIDAE
889,533,884 *5C8D27F76DA5E06F2E3BF2E12C8AF4D6D26C885F LINE11GZMTR
889,533,885 *5C8D1CAA7E0CA360087172E37B60A54EDC52E0F8 LINGSWORTHP
889,533,886 *5C81F1B1D44FBE3A75DFF82099B73D1EB3A71F7C LINWOODWAIKI
889,533,887 *5C869ABB31A94DBA1289505899B34E9FC52CA0C8 LISA-AMBARWATI
889,533,888 *5C8A04FB0A2F0CD9DC47AEF6268E2A751F02FD6F [email protected]
889,533,889 *5C81EA06E79668845F8F7C58B9FBD4CE3E19CC34 LISALANDES
889,533,890 *5C8BA472D7D1D5882347A03B053D0B6C1118EF19 P#####P.*.*:P
889,533,891 *5C83D5356B8E5E9AEC21889B65E879A138C30724 LJR#
889,533,892 *5C8B515DE25F1F944EA065CD9EB42C70BAA7E42C lockspiting
889,533,893 *5C85C261241E12E9C674817A0A1FAE7B54995A1D LORENA336
889,533,894 *5C89F11216AB8CC35D56E435017253316E397F75 prompted
889,533,895 *5C84BD0B64D76180FF325249C356AAA8F148974C PROSTAKOJ
889,533,896 *5C81927CE780F0274136CCBE5DA99B0EE533CFD8 PROYECTO TECNICO
889,533,897 *5C86077408003DD49388E2555AB28198D4E0F131 prudencio2010
889,533,898 *5C8B18D7A8F7CC14230F60FF008C9FA6ABDA650D PSICOLOGHE.
889,533,899 *5C87210D93D62CF074AF67335CCFD2BE7B17E7BE lucifer&pagan
889,533,900 *5C816ABEB4EE47D3D5A610A1776DCB0F187327D3 LUTHERSCHUTTER
889,533,901 *5C8F79406721826ECCC677AD1574FF6B056D0BB2 [email protected]
889,533,902 *5C85B8E254D2D83FBA00F5F4A94D2A4F749A6886 lyleingmire
889,533,903 *5C8E7F9851FCF1A050E4615F9B9642D34A5C8F71 QENDRESA.PLLANA
889,533,904 *5C85F2672FAF96B34A319BD54664F0AD11B81BAF lynnbeltrami
889,533,905 *5C841929123B9DDAC0591CBCA621B7CD581E1EF6 q+kj
889,533,906 *5C8DBE2537B4974E15FE7ADF199420D04E6FC03F q####>~O~o>-B0
889,533,907 *5C835EBCC2D71C3F00E051AAD81EC37759C41FB2 [email protected]
889,533,908 *5C81DED0C39C1B5F14940CA8DAED8DA90E140511 queryiterator
889,533,909 *5C89389794D7B389D5A192E3EE302D6F2503E373 QUINN.WILLINGHURST
889,533,910 *5C81724C291E9858F8488A6C9BB3E59D5D765D90 quywt
889,533,911 *5C81D52116CAEA33391E601BA12389C47A696526 MANBINNING
889,533,912 *5C832D573E4E3A077F4A08147827870E833661D8 mando66
889,533,913 *5C8593D26DA4A94AECB50D37C7092CD1B400B01F man lebt nur einmal
889,533,914 *5C85BB174BDE896ED9735BC09957F3950B6B7E37 rahavaroista
889,533,915 *5C8ED44730CC0036711C2AA81AC222F7E5DABD6F RAMENDRASUNDER
889,533,916 *5C84553984DA16A01EDD6A38D871016D3E00425C rameront
889,533,917 *5C8B639019EF33C44BD62D5CB1725E9367F101C3 raptorrtoenterbaja
889,533,918 *5C8231F68785AB299891F25FBD9484638E525FBE marilyn.dinglasan
889,533,919 *5C8B923802AA13E9C3E1FA6CCB3B35A935A9E790 MARLEYKELSEY
889,533,920 *5C8FB19D40AA101C6899579903D60D86B3A8B3BD marvinaaaaaa
889,533,921 *5C8B1C70B32A663FAD79FD69F7970C5BDBA54B1E REBOMBAR
889,533,922 *5C86368654D0C2871DBEC68DF2D3DE207A30E121 matt-hudspeth
889,533,923 *5C8A20E51C2C07A6962B9C4AF34AF234740D0AD0 [email protected]
889,533,924 *5C8B234A6035EC849853078F385DC3E68F341FF7 REDRUMBLONDIE5
889,533,925 *5C8CEAD072FFE7CDE1AF5D3F9D4387761088EBE4 REEMBRACEMENT123
889,533,926 *5C8D0C968E7BBC39679DF7B283193CBB749DBBBE MCKINLEY.SCHIRO
889,533,927 *5C86CFC3E7B57DC9D53D8BD04853413BD38507BB ME:ACTI."QUESTOMARROSSOMIAMMOLLISCEEASSIDERA"
889,533,928 *5C8D722B790D19D95B3AE8C656E603F4183230F4 MEDIDYNE8
889,533,929 *5C890D588C14D886FEC5C1BE14980673CC2AF5F7 meganiumruby
889,533,930 *5C80F5F72A39B0BA10FF97EF220014155C7B04ED rekojreyals
889,533,931 *5C8CD52FEDB61DE579B64AFF691A42BD5EABEB11 melrayes
889,533,932 *5C82A357044B4BE697FDAECD09A1E6EC573918FE RENDOHLS
889,533,933 *5C8CB11939B064EAC61DCF28E591FD98CE172DB4 meruani6
889,533,934 *5C880B71365978AC14E92FF4D2FD42C36E7AC471 REPUTAMM6
889,533,935 *5C855BCE3D3805060EE3E184A0374BBDC97D9DC9 REQUIEM-IN-D-MINOR,-KV-626:-III.-DIES-IRAE
889,533,936 *5C8608B721A07F53850EC80B2AE766D29A3F6F35 RESSEMBLANTE?
889,533,937 *5C875E97735DE818A0EF724D48FB8653741E8FDD RESTRAFFEKAST2
889,533,938 *5C8F01A542A89CE67BBDDF6DA39896FD9E79327A REX.BARKET
889,533,939 *5C86E0BC27425E0C645D6DD1948F3AB896D423AA MICHEL.TOMASINO
889,533,940 *5C8AC6CC6C5F768855493E8FD88E58122905B571 miderek9
889,533,941 *5C85B90EF3E90FA78C9172137BBB3273FB36D22D MIKE.DILLY
889,533,942 *5C8F5A22F179AAA0D77FA3AC847713E7C6455391 MILES.MCSWIGGAN
889,533,943 *5C8F8CC0BCF7CAB35562844D7F77D3E3A1DBCAED rickeydecraene
889,533,944 *5C8B2D792FB6AEC30BC171D550352927C2A9FE6B RICKY.HARTMAN
889,533,945 *5C8857C55E1CA8A49AA24453B648F885E1070081 [email protected]
889,533,946 *5C8184B3B08E768737E7608F0DEB047167F5788E MODORES4
889,533,947 *5C8231D1B3894AFE72897C4B8DF3FB85E0B77737 ROBYNLOVE.COMWWW
889,533,948 *5C8EB9D714F83FB852889E9CC4488243B0544C77 rocktomcat
889,533,949 *5C8A5C7C47992D96FAEF7352365CB1A90BF97F83 romeoovsanik
889,533,950 *5C804CCAB48218890D4255C48B7A58115C876BDF MTYMEN
889,533,951 *5C8A6D9123C39DA911EAF2AE6B86112CAEEFD689 MUGISHA.DIANA
889,533,952 *5C8A354661831DD974D7FD97BCE8A9684EBB17C3 ROSHAN-TAYLOR
889,533,953 *5C8B7B5514723E2E349FC4007C90193B34CAF3BA ROXANNE DARWIN
889,533,954 *5C86280A0730680CC0D8EC0609EBE40DF6BFA5C0 ROYCEGEARON
889,533,955 *5C815162243A6B27F61FF56F6E1BC714044A38FB mustangcoolman
889,533,956 *5C85ABA24F7B67D8F7DBB794B6CB0C7DF5B51D02 [email protected]
889,533,957 *5C872E75262B1A575D2C1D99368B3E227B19E5F9 myh$
889,533,958 *5C8AFDDC6B5E4B186F24665E0E3DAD055089B623 MYRONMISER
889,533,959 *5C85DE9BCA5DFD94472B8723536D38AEDF4D21EA n0+ic348ly
889,533,960 *5C81F28BE6EAC22EDE3526B9B9148A2C22DF5641 rupertdonaho
889,533,961 *5C8A2941215D1BD7069524F79C7C09B94718C73E russellcomer
889,533,962 *5C815C8825D60C8336B9A2D0F6013FABF9C19300 RWDNZPHJBPDXH2
889,533,963 *5C8245DF1CD9071EECEFF4B3C94835BF0FFDB143 [email protected]
889,533,964 *5C862A7F10105E03D620704F8249E2331E463F5C RYAN COTTLE
889,533,965 *5C8ACA994EBE9E2A3D732E9A70E62D07583E17A5 ryo-fukawa
889,533,966 *5C8CDE426E4B27FD6116B6D8905A3D958420E23D rzuj
889,533,967 *5C8F02E53A625FB54AA2B1050CE2EAFC734FF13C [email protected]
889,533,968 *5C809B4D46A4F6CA34D1A6E5D10939B736F7134B ndrprmpt7
889,533,969 *5C8AEE42E4243CD5D2AD2E7DC4868F44452EEF60 SAMFOLLMER
889,533,970 *5C8A7F53C3EEB4183FF417CA68612DE3F9BD76F5 n.en.relieve.cer
889,533,971 *5C8A789BC91BF28C7FB5E4C82A899092EC621DB0 neptej.se,.pro
889,533,972 *5C8B5871C10CB640DF80D42629857F1B9744E36A ness-box
889,533,973 *5C8DBD531F66A0FDB512BC19048294CCD1375020 NEWSONAIRPERSONALITIES
889,533,974 *5C85851F2D9423DF219B4AEDB80D8DAB424FF1BC sarahelizabethwilliams
889,533,975 *5C878A3ED937A829BE2B5C7FFE8238C8688EA9AC sarcinae
889,533,976 *5C880803CB75D61029DD38A8D37F92A849F2435D NIEK1310
889,533,977 *5C8B797EA55BA6D7639732650D7E8809CB9AE4C5 SBRONSHTEIN
889,533,978 *5C87E5F5C355B8073A569D7DDBB054C81B86750F sbyqglko4
889,533,979 *5C83EC94D07E9BE8762A85814FAB5B3726085B9B scarlette.oliver
889,533,980 *5C8A57963168685C1A4B369FBCC6B77B1BDF1818 [email protected]
889,533,981 *5C80940A5C9783C19408832575C1FC5539162C20 SCHNITTSTELLENBAUSTEIN6
889,533,982 *5C841C007417FA962C800B599FEC9D4EB5C736A2 SCHWARZBAU“
889,533,983 *5C8498F29CD4AC0AD5896C7C3690D3CDB989FE15 NORRISIE9
889,533,984 *5C80D526A537A0F441574E29BEFE84FD40EC226C nstrrnt0
889,533,985 *5C87C12892AF7A85353DE90EB9351EADC2F12E4D senelbanrubnu
889,533,986 *5C8F80246023F05168AB00AB8F177EA9517611CD SENGESTEDET
889,533,987 *5C8E7B4B8D3AD8ED2CFCB8575AAEE4ACDB0662F2 OBLASCE
889,533,988 *5C8DAA10A2C2AF6C59547561FD1E637B19F6E0BA oceanofsand
889,533,989 *5C8064004D0AA571CCB5F6D41B7C95FBE4BF3765 [email protected]
889,533,990 *5C8A04D31E25CF23A3E233925BC562FA97D6A065 SGOHBSW0
889,533,991 *5C8D5B2FB8D361BBD2A12616852893183622D603 SH3LL.HOL
889,533,992 *5C82E84AD13F2F00A077E5487DD518BB3EA741D7 [email protected]
889,533,993 *5C81337934ABB29F349C4131867CCD7BDBF403CA SHANA WOOTEN
889,533,994 *5C87136EC045A25521CF0B04B9289B4923CEA16D oh-you-blondy!
889,533,995 *5C8F4FA3B82B623D19B5C104D000B32B0C9E2DE2 shannon.ramage
889,533,996 *5C89C7A77A915BB72C40B080D7E6C52A017752F6 SHAWNCOWIN
889,533,997 *5C824EDA69BCF32F355367FCA209A0395F423644 OLOSNAHP
889,533,998 *5C89F3D246F8CFF97946AF5C4B37E12D1A41919E SHEILAACEVEDO
889,533,999 *5C80D0BC99DF510E80EB3C6DA93F9C5EA4805A79 SHEILAGAVIN
889,534,000 *5C87C4330340CBBEBDFBCFE33A8BBB305DF37AEB shelbysenate
889,534,001 *5C834B60159E8188565B592410FF117F12CE332C [email protected]
889,534,002 *5C8878AE284A3F7982971507C3D68878C40EEA2B [email protected]
889,534,003 *5C8CFFCE231F012D288DB75691144BC323CFE958 ONGESTEMPEL
889,534,004 *5C842DD48E422E2EAA9536DE440325284BA8E1E4 onniinhelppooollaonnellinen
889,534,005 *5C8BA1A80F9536C2296C08CC4DAC9537BED6B71B o->-<o~(#####P
889,534,006 *5C800DFC74B5D39EEAF13C86C5FE6929BC62E7A8 }o{~q==b
889,534,007 *5C89AC246C217DB44D2C1645A57208316DECEDD5 SIALLIPSING
889,534,008 *5C8FBF1AF1FCFEA32D273B21B6ABC16183AAE756 [email protected]
889,534,009 *5C821CB6866CFA5BADDFE7326FB8D3F6E692D499 SIGWAKE1234
889,534,010 *5C830A67BB749D2704856DAFF8B3FB17E6E85644 [email protected]
889,534,011 *5C81C814FD65F12E7225ABF9C8760FF0777B5479 „OSVOBOZENA
889,534,012 *5C8389A4CBD85551C0A4E300DD1A7969A537B707 simraha
889,534,013 *5C826FEB04492FC0197881AD7C40C67A998E1360 p4nt0mime5
889,534,014 *5C8E0CD49F7E4711651B2ACB99B228FA52BAACED PAEAESENED
889,534,015 *5C8AC38C1C578753D460B2282C24DFEE1252A1C5 palvelijoillesi
889,534,016 *5C838CF0D375CE91AB9F5ECC8614148AB9C40A38 SMXYGNZD7
889,534,017 *5C888D8E6325FAED93E2311960F677B3FF581F1E SNOIRIUDORPER
889,534,018 *5C87A161EF4677CE38BE4F5F7158EF82618347B4 SNOWBALFRIDAY6
889,534,019 *5C8BE47E51D1D2EC3D71E53C1DC78FE687F1848B SNOWTURBO6
889,534,020 *5C85E6E0ACC066923243EEF265DCA0691B4285F1 SNUFFYHAMSTER7
889,534,021 *5C87037ADC2A9A1D6532E5590629ACA3F3110D7C SOBERIZE
889,534,022 *5C8C456442CE74A26B2041C3BF48E522EF7CD157 P#B.~0.)o(
889,534,023 *5C8D10C4AD64E028706323E3FDD5809E5F1C8172 Son-Egal
889,534,024 *5C82A8F4855BED5D88C89C19A3BB1A63E647FCAE [email protected]
889,534,025 *5C8FE1E148962FB2A92404086420C3728C2D2680 [email protected]
889,534,026 *5C8738AFB770F25C578EB4E5C4F097244DC23CC6 SOTBMARED
889,534,027 *5C89A0B874FC58F921C0AB4CEC2E043EEBFA7450 PERRY.LEDSINGER
889,534,028 *5C8C6EC90403352816AB531031C52F3F7BE56E26 PERSONALEFILER
889,534,029 *5C8A8A5673A0C262A2DDD2A2904E38DCCBE68979 spelloning
889,534,030 *5C8C045664D5B89699A89194926AC2E9C6B6F663 SPENCERMAIO
889,534,031 *5C8D23509249492C5F6E7914074904BE3207E115 SPENCER.PACAPAC
889,534,032 *5C825FDC7E585B678DFD61B4B1EA81722DEF7AAC PH4N+45M490RC41
889,534,033 *5C83C5C9A3B2AAD7B86EB834098B02678C923E6A PHILIP832
889,534,034 *5C8F1E1E2BB46ABBB67CB7479C84159C88A01213 PINKING
889,534,035 *5C80358D7FAE5A60F47807CCD75649CE72022C41 ”PLADS
889,534,036 *5C8A9CC37B9B3B6B9334ABB0D648EBA0B4F9690B SRUERGIN1
889,534,037 *5C84071E6F7258BA165DCC570A2C3599A03BC883 PODFREEBSD
889,534,038 *5C8CC92946864B01B3B292E607A669F07223A4F3 STEARINSKOM
889,534,039 *5C8C913A7B3C612435A2CC56484C78F4C5DFE8CD [email protected]
889,534,040 *5C88C2A5FBAF295275AE3419CDDB6C0D86DEE55E STEVENDELAFUENTE
889,534,041 *5C819F1B749DD75871C6A394E23E7766C1786749 PRADEEP KUMAR G
889,534,042 *5C860A2907D6E3563EE593A568361538B263743A PRA MARTEUZ PADER DANCAR
889,534,043 *5C8175DC6E9B4855D37E211084110DE65C353929 [email protected][email protected]+Y
889,534,044 *5C82EB96641AE7D116C3402E824965B595B9A983 STIGLITZ91
889,534,045 *5C8E5DB8AE25684AFF83BF7117DA50EFD71930A3 sting1bears
889,534,046 *5C8FE5CE8B97B707CF71FA9398FC86DEE53CB017 STRENGIH
889,534,047 *5C8B7A1AE88AC0B5188F1C9800E83A514C220B3F PROLONGATEURS1
889,534,048 *5C8B814ED559D1B6B61EEC951CF85A251E71E68C stylieten0
889,534,049 *5C812D2A0A237018A5A07805FE4F531ED7D14C4B QAWITHFRANKDRAKE
889,534,050 *5C822AD0F791DE175A31746AE62086B9DB672327 [email protected]
889,534,051 *5C8C7CF7711941B5410D7AF31ED969B9F90EC4E9 QL{B
889,534,052 *5C87460E935DBDB640740348340722CC4838E336 Q##@~O~OSPLAT
889,534,053 *5C83958F3149B8F4F867FB5FE5AB93FC0EE7EBC1 SYDHJRUP4
889,534,054 *5C807B111E843D96D8D8325C49DD622788B65AF1 QUINCES
889,534,055 *5C876A92ED2AB615C6EA33338936D2168B81881F QWEST06
889,534,056 *5C88458A98A7148D3DB66F7A6FB2B7BF103FDF72 RACEWARE8
889,534,057 *5C8A14AF869E192EF7CDDD6B54A28923A2BDED50 RACHEL OLARTE
889,534,058 *5C81D690DFB061BABFC2BEA775D0150381157EC5 RAFMANJA1234
889,534,059 *5C8B3749387B8CC3950D82990801EB90F266E473 talk874123142
889,534,060 *5C88D8EE4F6A779E43F1499BFBDEA44362FA4FD2 RAMIRO.LOUNDER
889,534,061 *5C85367C32EF9478FECE97E7D9AE908A3D61FB75 ranamuhsin
889,534,062 *5C845EB3786C783F9BDCE55F3547A1EA9344A711 TALKOWLPOSTFOREVER
889,534,063 *5C805C8C1881810F8970E512C67B3244B17AFEF6 TANNER.KALEN
889,534,064 *5C8905053BB23FFA490D3259298F12BEDAE01416 rdfresource="http//wwww3org/TR/2005/PRxmlid20050712/"/
889,534,065 *5C8D578127B5845505F08730A4D778DF02CE5BAD tatimgo6
889,534,066 *5C8832290615E4FDA43D75BD6E5F62D05B703EB8 REDEMPTION(REMIX)
889,534,067 *5C81EDC6B163B0A0D0DF0F83F672281C17BE089A TDESIGNS6
889,534,068 *5C807718F37F4E0F0DF6DA17B3638E2FEF5CA771 TEAMSCHEDULE22
889,534,069 *5C892E1CF1F9C3E54EF7856967213DBF8600BEAB REDRIVING
889,534,070 *5C86E9A25609FE4E9504693EE383B2D2C9DB40B4 regulusignicapillus
889,534,071 *5C8718F741E9AFB2B2637F330F6ABB8DA21C36F1 ten-grabs-out-of-blue
889,534,072 *5C823E1B60C52E8047B5B0BC43101A0FD354E25E TERRENCEBARUFALDI
889,534,073 *5C870AFEAC5A4E9365685D6DCAB9A5597227CF1D renaldoreasoner
889,534,074 *5C8E761A8BDDE0989CE929CA63BF0D9E4E146681 [email protected]
889,534,075 *5C83215E7391F5FA5E2D1890B9106E772DE37D33 renijský
889,534,076 *5C859720A8A1B127DD10EF7BF65681D119BF0BF8 th3m3s
889,534,077 *5C8E2F40A56C5EA6367E37DBE6106B3D88C7946D RETNUHCAMGIB
889,534,078 *5C8931438710257BA5A46BDDA107FE8A676681BB reu5eab1e
889,534,079 *5C83DFDC59D6AD03FA757D76744E5FE32E922C1D rhayander-goes-to-town
889,534,080 *5C8D92D08F762C9F80DCF3D14CB5344352FAA9FB THEGREATCONSTRUCTIONINCLUDINGTHEMEOFKAMINARI-MARATHON
889,534,081 *5C8BBC67385DCA491D4A42A3714F12F047A06AA5 RIJU.SINGH
889,534,082 *5C8A37517AA30660E19ADCB39F1064408CF012D2 [email protected]
889,534,083 *5C80C9E4BD609A852A15E04EC1267374E1F42629 THOMAS-EDISON-INVENTS-THE-LIGHT-BULB-THE-PHONOGRAPH-(PART-1)
889,534,084 *5C8B6704E9BF50DF1D32D3E85E33557181A918CC ROBINDAN
889,534,085 *5C879C28C75B531997C524461EA3D60ED340A8E2 robtbenbrook
889,534,086 *5C88C6CDF0F002637EE04FE587EB3C3B7B8AC479 TIESHAJ
889,534,087 *5C8859F8875222C2CFF0551884612A6E40C03528 tiffanyelisabeth
889,534,088 *5C8EF36BE6805D24569B31F560A4EC4D31192C88 timmypatuel
889,534,089 *5C8F3EA43A4B80C52BE83C295EB46F9EC208D363 TIMON The-best-and-truest;
889,534,090 *5C8283EE17170658889E1DD658DE32145402CF91 rolandocarroway
889,534,091 *5C8C0A483DA74D36BAECEC6413E54A847F4A0608 TITCN
889,534,092 *5C8FAC421748E77786B0B69566DB791885FDC1AC RONNIEBRODEN
889,534,093 *5C83FB8C05BA111F996735627D4D71AFBBFC3FD1 RONRONARLHOS1234
889,534,094 *5C8710AED284EAA4618CDA4BE947CD57D8AF343B rorystremmel
889,534,095 *5C82940041D6ABF78DE4D246ECFB44EE82C64DC6 ROSCOE.FAIRROW
889,534,096 *5C88051AB51FBA68B7A647E9A76755242D9C8044 TOLLAGE
889,534,097 *5C8022F203EF6531DE358A73BA0ADC9669DE6E42 TOMASROSES
889,534,098 *5C8AAB284CC4798F2E329ED38C4657DDCC830DCF TOOSICKTOPRAY(LOCARNOANDBURNSMIX)
889,534,099 *5C8AD7415D31C02F72A263F445858CF57118D18F RUBINHILLMER
889,534,100 *5C81DAA2B328F9FE3D016EFEEC9F06FB890B671D TOPHERSALES8
889,534,101 *5C8596E562407FA7B1B6A806CD9A74B19E971C8D TOPHPHI
889,534,102 *5C8D6B294819EEB17DA2B4B2D65B02FC5DC4C851 RUEBEN.CERONE
889,534,103 *5C8F15103958450D8C56242105D03C8F304AEDF1 TOURISTENWANDERUNG
889,534,104 *5C803B3C8535CAB84EB8DAABA63476C9DDF25873 TOURWAYSING
889,534,105 *5C8E9F4C7B11644EE450206DD4B8ACA0DBD0DB88 TRAVESTIERTER6
889,534,106 *5C86DE169B306F5A39F498069268FBCE150EBEA9 RZ4
889,534,107 *5C82889F1DB2747441819F02B489BA07DACA2981 S3NTIN31'
889,534,108 *5C8DCB5550DCD716DCD28BBC766599A439640F38 trentonmarlowe
889,534,109 *5C825551A9EA997736481E72B1D005080BE98673 SALCORIC
889,534,110 *5C83FA0C0265B6842DA6922755EE6707BAFDE19B SA[email protected]
889,534,111 *5C814EDC20A5833DE4E19E4162AE6BC9BD2E1336 TRIBTRAM
889,534,112 *5C847956FF83D54AC58BECEBF30E7A97D664931A TRICIAWAYMIRE
889,534,113 *5C8FCE61CD716C8D8C5968F0DD73A233F8B17C48 Trill.Real
889,534,114 *5C8716B386E0C6F0F94348BC29D0A574FDA92285 SAMANTHALYNN1
889,534,115 *5C8D03FC0849948D2EDC185D3C23E1DF490A3578 TŘÍNÁCT
889,534,116 *5C8777EC4225E836E7437410B313CCEA5E219DCA TRINIDADMORTELLARO
889,534,117 *5C8BF0D10D4FE7B19B05B2832E51914644C9E5A6 TRINIDADWILCOXSON
889,534,118 *5C841CC4B1661B0661F06DC0D153E889B493289F TRINITAYLOR
889,534,119 *5C82A29C5226F2A1ACAECCB79DA26BC6E49DBD18 Trio-n.2,-op.100
889,534,120 *5C88B2AC8C9A1B501CA9A663DA39F82166A732C1 SAMMY.QUERY
889,534,121 *5C860CCA4C3683CFED80852F6A0C5F214635F284 samualperanio
889,534,122 *5C83B9C6FC5850BFD350114BFAECB8924262BC51 tristan-pasek
889,534,123 *5C8E8788BBD239A80FA3AC726190AABCECA8FC14 triyani-dewi
889,534,124 *5C8635C34F194AC00F6468BADBA9DC00884F7F70 [email protected]
889,534,125 *5C895984389D5BC3B55DCCB68D5065636FD30A6F SANSEDESES7
889,534,126 *5C83D7B2E19BF461B0A1DC887569C6C048E2084B SARAH.CARLSTROM
889,534,127 *5C82B4A88D70CDB0F4124C8B82DFD9B2142970FF sarah-coburn
889,534,128 *5C819390319AB5845691269869131B18E0E441EA TULGSSIING
889,534,129 *5C8A2DB8156C3779B630D4F9AEDC94DC399338E7 [email protected]
889,534,130 *5C8D0EC85513D5A191584FEBE07653EDF23F831F SCAMPMILO123
889,534,131 *5C8998AA320A0261AC7DEFB598F0DA524EC2E624 schneffer
889,534,132 *5C88691C2F8EC512920ED03C21F747AE6E872B40 TUOTEKEHITTÄJIIN
889,534,133 *5C87D198820040E52F3B1D2B4C9A19B313EC1060 schrkppn2
889,534,134 *5C8C82C2D65301DE0C19298A4FFA0211DFE89626 SCRIVENIN
889,534,135 *5C82318482846DAC06DB7D1F47FB0B4F85D204D7 tylerkelty
889,534,136 *5C8F794C507E7450270EC9977839E1C9184FA44C [email protected]
889,534,137 *5C8ABC8F315AFF364B01F629BEA8E623C723C418 +u0
889,534,138 *5C8328F8D97E2A06027CAB766677871BD83741A6 ubiqivafa
889,534,139 *5C8CB56658165C0D08040FBD73CD760230777D97 SERSE,.HWV.40:.OMBRA.MAI.FU
889,534,140 *5C8C061BFADB19C64788B998FB189230626A3695 UFJL0072
889,534,141 *5C8442686B954DF349FC9762D5E910976BF207F5 u$h-
889,534,142 *5C8C4220D0DC2E01894F3BB720867837E8ABD6A2 ULRIKAHAMMARLUND
889,534,143 *5C848ABCDA5D562D42CC88E560CAC54A97815989 SFBLVNB65
889,534,144 *5C8FC3338238C9F884280D7109712548F19BA44D und3$7roy3d
889,534,145 *5C8D8FE1C43EFF87153166C4D7559492173F8F1F UNDISCERNABLE9
889,534,146 *5C8B1E9B9FBCF364BD66913D5ACB57EC4AC4480F unmitigatedness8
889,534,147 *5C839CA2BB530CCF0BC8FE18BF02986140481D81 upamantritaa
889,534,148 *5C807BAE9AD21755AF0C0C74B58F33E6C3FF560D UR84N1$M
889,534,149 *5C8ECF64DCA435E896933A74F996FF9CE2E942ED user846495105s
889,534,150 *5C8904E3576546D84AF91D175B5EF5D7185CBAE5 siebicke
889,534,151 *5C8291D6A68EB36FD5A51B25FB078452924DD808 UTBILDNINGSBEVISING
889,534,152 *5C8028BFC921B80966770C434FCD5B3F3F84419B SINNFESTSETZUNG
889,534,153 *5C8C7087967FFA8D3BDE830D751AC79CF90D1AFE UYNTHF
889,534,154 *5C8898CD6AECB2E82E256813131AF6302BB7DA6D vachirapon.phatinavin
889,534,155 *5C8F4AEA9EF68D16EFC3C469382221031AF64557 skaappootjie
889,534,156 *5C83B0EAAF5946D36DAE8D7013E0A759AA334F44 VALENTINE.JANECEK
889,534,157 *5C8EF0DFBDBE54355AA2579FBEC5492A5D66C5EC skotarkiem
889,534,158 *5C8414FDAFCA785710973CD9029606C4F9624443 VALSOURWINE
889,534,159 *5C814E4ADE108A9D3EA4F708625532FF5BE16B4F valterslusins
889,534,160 *5C8B254B628F1B266A4BAAA38B45A5EDDBE89D57 SLENNAC4
889,534,161 *5C86AB6DD44413485D912F24E70B0B39C8A4A708 Slijepi
889,534,162 *5C8FAA9297B8BECF2CA36EE7AFD98ECC33D6D704 [email protected]
889,534,163 *5C8D25F81C3E12CC01DFD432BE82D80BFCBF46E3 VENTES-DISQUES-NUMERO-MYLENE-FARMER-SEAL-MOZART
889,534,164 *5C820D2530DDD82AEB0151F23388DD195353DB98 sockpuppetsother
889,534,165 *5C8717899CE425269588470F5384B41AF4ECE5D7 VETMESTI9
889,534,166 *5C84148662DCC750ADC544D4FC7807C40458F89F sonnensturms
889,534,167 *5C8E5872404CE74FA15EEBF0136E58A40E58CACE VICKY.PACKWOOD
889,534,168 *5C88B4AA93397C72DF405EBC7CE9326568EC2FF7 victoriahalliburton
889,534,169 *5C8944E43F01F957E0C4B45BC9B94F788F1BAC44 spedw
889,534,170 *5C838413E1D94C142ABA02FCB3DFA6F9EE874D0F spstswitchpic
889,534,171 *5C8E799C228D976B8578E2ECF21C837042C5F56A VRUSHALI.MAGARE
889,534,172 *5C8A0E952ED311751E4153D525A42F90867B0DF8 STACYELWORTHY
889,534,173 *5C80F75C30C280C37BEFE1E8CB8A6C17776620F8 [email protected]
889,534,174 *5C860216B1A55EA7AE3DEBCB15DDDE3AFCC672B1 STALINISM114
889,534,175 *5C8243E75D79D0AB65396B81ABF8C3E2DA4DF835 [email protected]
889,534,176 *5C80711C071FCD569190AC2B9762CCEA5CCF4E33 stefanlacoy
889,534,177 *5C8B3A887100271AC7F235FD6B7ED12B4D6DF25C STEPHANIETANELLA
889,534,178 *5C8AACD017D63E41885957DD1C5D60799B6947F4 walk-off-home-run-gives-aces-first-win-o
889,534,179 *5C80DF4F98D2883BA55AC1D5F312AD79FE7E00AC wan-bolok
889,534,180 *5C8B6DDAB12BDB9245B9F32F8032ACD283931E89 [email protected]
889,534,181 *5C8177A3CA4C2E55F519C8D61DBBEDDD7A92350E [email protected]
889,534,182 *5C85198629E81A5A5799B1BBC7C5424B34C6A63B WANITAHATT
889,534,183 *5C8BF3347672B270188D1FF9DB2866EFEF3AF1CF WARRENEATHORNE
889,534,184 *5C8BAE3FE2C8DC906E6E5BCCADBB6E8EEA90920C stringaj
889,534,185 *5C824823D12677EA366E464B94D111CE63624C07 STRJKDRG1
889,534,186 *5C8A50102FB2C5BF386DC2C42678FD1C333BF0ED [email protected]
889,534,187 *5C80EC8A79B7A7C98FAC2107DDFA6D3397A3E021 wecumfrombrooklyn
889,534,188 *5C86BAAA7578F597A147B140472B7D8F80D1289E WELDONSCHUNEMAN
889,534,189 *5C855563991AD584E126CF87123BD45BAC74107A WELLNUR
889,534,190 *5C8CACC22AA39BE4C66527FDA809B8E4A6CDAD15 [email protected]
889,534,191 *5C8BF15EE50574BB74A08FFD2A065A1BEF7FC60D wendy-walker-harrington
889,534,192 *5C894486210BEE33AA55027716567295B56A7550 [email protected]
889,534,193 *5C87F0BDBC518A4D0C6BB0A9919C971B888F30CF [email protected]
889,534,194 *5C83C9DA915215DB8F0099F0832A82CE9C0942EA SUOGCXZLWYEK
889,534,195 *5C853336C9DE3231CC76012275115227CD3CDE21 SURENDRA VANGA
889,534,196 *5C8944BBE2BE4407DE69A4F0DE1BBE70519007CD wescroslen
889,534,197 *5C83A2424527E4BAEA46499C1831246106FAD2DB WEWILLOVERCOME,CLOSING
889,534,198 *5C848448DCEB8C26194FBBD446EF42F5484BBB2E WILBURN.HURME
889,534,199 *5C865785E8989344CC1F867AAF01311A7E4A0983 SYNNYTTTV
889,534,200 *5C88FDC3086D812815AD4B55138D7E6A57EDCC1B WILLIAMDAVIDROWLETT
889,534,201 *5C8D361705E748E2C821C4E4365A4C73244D2840 TAKETHS4
889,534,202 *5C8B97F3B89C5BB03E74CCC579A99104BD223578 taldebsw
889,534,203 *5C8130E41D1FCF23982FF7890A000F0C762E0255 [email protected]
889,534,204 *5C832015611D9AA349EBE18D7DA669D0168F013D TANGMENGMU
889,534,205 *5C8D78706305B145835C3032F0D2E3B34E4DC30A TANISHA.BUTT
889,534,206 *5C8085DCEA09D1E7B918C44209AD8A13A4B64A71 wow-what-a-party
889,534,207 *5C84A0A9988722FF953A2548048B96059073D160 w's'
889,534,208 *5C8ECA3D42AD32132C89E0A92FE74CC27A169A0C TATHAIGH5
889,534,209 *5C8406AF0FFE4933EBC4F457480C44F1D75599B4 [email protected]
889,534,210 *5C85C8F7F3DDE5F0E28B0553F1659A13465D3068 TBEANER2
889,534,211 *5C8D2988BE648875F12F4EA9E7B26B3F5BE0BEDF [email protected]
889,534,212 *5C873FFE4DD69D840B9EDAB85EC4966022595A43 tedhullender
889,534,213 *5C82A2DD0415E3DC1CFBD5D5DAC536BFB104B592 WWWOVERKILLCA
889,534,214 *5C87C03888D0D603473830476D5E7B957A301E39 wwwzelvycz
889,534,215 *5C822D524255EFC45347516E19552C47010CF70F WYESCAPE
889,534,216 *5C8348E273DAE7A0921B42EBBB63342D737AA0C8 WYEZ
889,534,217 *5C82BD6E704160A2B9EC28358C58F4767D4538A3 TESTIFY (UBP CLASSIC VOCAL)
889,534,218 *5C89847C8416AFF90B18DDEDE198D503B3C237B0 [email protected]
889,534,219 *5C8F3AEA35498AD1FF74FDFE1E14A1DAE15ED3E1 TGV.(PARIS..LYON)
889,534,220 *5C816486424A648D46587AE2E502A548A522112B thaddeushuguley
889,534,221 *5C893F3B769F27F79DC282BA440463A0C0102010 [email protected]
889,534,222 *5C8EBE38793B36BA1715829EAC8EAA6A21AAE3AF }X{O~Q##B
889,534,223 *5C8A8BE25FE7C24024C29109C3BB879BB7221D80 [email protected]
889,534,224 *5C8CF70353B77951D7F6A36A70C61442B652BFAE THE AMISH GIVE UP
889,534,225 *5C8BF0B6553ED54ADDCCDCCEF37AF73A101A9D60 [email protected]
889,534,226 *5C8EE94DEDDAD3C1BCE156B9B6FC9AF2ED8E9732 thedollars11
889,534,227 *5C8BEF845036096088AC821FDD3F44B724E95465 THEGIRLWITHTHEFLAXENHAIR(FEAT.CONDUCTOR:RUDOLFBARSHAI)
889,534,228 *5C8ADEBD216B987AB8A79DCA45C3F9F24CB8B2DF yanahendrayana
889,534,229 *5C87C6928B6CAE428CD32749A37F64F11A0884C2 the.vibe.history.of.hip.hop
889,534,230 *5C8F10917A6B26A16C743F9ADA874DD4B6351908 YASH.LOPEZ
889,534,231 *5C8535E091CD8058AD1D5D71C9BDD123ACA13B30 THGILSRETTELTSOP
889,534,232 *5C87F564351BC59AC532F099D040EF14635F2E46 ycel.madrigal
889,534,233 *5C814630D7DD58D7BF25AA7EAB861A6554E773DF YDOOGIE7
889,534,234 *5C8F7A99203A1F6FB57F8AF793C108940762CA5C THREMMATOLOGY2
889,534,235 *5C8786497E44C0D9D34F266861200B6B3C5A0089 YES MARK IT IS TENTATIVE
889,534,236 *5C8119148E2A749C3F3C18551902A64DBA0981FE YINKANG 2 0
889,534,237 *5C89367210893D85773FA3A019ECB41B1C12AC1E TIGGA415
889,534,238 *5C81384E5635E9E722F2F76DB80E0DE7DEEAF0B3 [email protected]
889,534,239 *5C8D5E474392D3AD2C755750ACFBC14375711777 TINAMO NERO
889,534,240 *5C8E19B7B7B178519E7F7FEED4F504BB42F86D67 ynohtnayrrehs
889,534,241 *5C8B1BC731BAF378580F48F6677DAF7B34FE7CFB YOHANES ONGKODJOJO
889,534,242 *5C8CE558C7C217F24CD5FE16B142084F012DC236 YOUNG-J-FOX
889,534,243 *5C8C4F95EAB9A865D3BABAFA84718DE9604E271E YOU'VE-GOT-NOTHING-I-NEED
889,534,244 *5C875E4F69F7D8521861DF575D7DB47B4D5DCD0D YOVONNDA
889,534,245 *5C8B8D6234F5B77C3D6A2A0391B5ABD619B0960F YSMAHEL9
889,534,246 *5C867FEA763DF2D2E40A1401D46CC2B2F88390CD YTTON.JHON
889,534,247 *5C81991894DE9DBD5D14BDE11785F9EB13514DD8 TODKHALIFAH
889,534,248 *5C811F45D5085EEEB09E07B21462A772FAB6CCE8 yudha.setyawan
889,534,249 *5C84817EAAABD1612DE98380B811BDA8B63F268A tommielevatino
889,534,250 *5C86F48E07600D6D4AB4E419C20CF3DC82CB51F6 toppling5
889,534,251 *5C8D081F82410615A47E00866A9A48A269831CE4 zaki-datar
889,534,252 *5C8F39FA678531F1400CCAF22E5A2D6D368ED51B [email protected]
889,534,253 *5C8C1301E5EB49CFFCA8F2A2A2D718FEA9CB672E TRACEYZEMA
889,534,254 *5C8F3C8BC92663347A3D1B9E9C61CD07926ACA65 ZB_7
889,534,255 *5C8379E4CC65ED6101EB14C65F558B2951019CEB TreatThemFine
889,534,256 *5C80FF4D250EFA2C9A344F8A7EC3735CCF2FE32F [email protected]
889,534,257 *5C8A011EE9A13B72388047472DEA95B86AA3AAF9 TRIFLIENS5
889,534,258 *5C8843D3CD3B0912AB2B9004275B9E48F9FE91C3 ZHUKOWSKI
889,534,259 *5C84F5DB875C14C0F0CDF8FFB5A19CA98FA3C45B ZIVESLOVO
889,534,260 *5C86CF28CF12B0015ABEFD059F567042E2764258 ’ZS
889,534,261 *5C8D194D3B0B81BB69EA2E0A9138E6A841142CD5 [email protected]
889,534,262 *5C82552E8333F79ED03B01CE3377B2D31CBD0565 TSESUETSUM
889,534,263 *5C83F1622EF673D5D3BBB7A1EB25619477E7A2C5 ZVEREJNIME7
889,534,264 *5C83E87D20067FF5C1C5037B1168CE297001C4BA turbodvigatyel
889,534,265 *5C874B0941356E98BC5E15363C47888FC54ED1C2 ΛΊΓΔΟΣ
889,534,266 *5C85E5AF45BCDBC8544F23E628D5CA4343BA7F2B ΠΌΟΥΛΣΥΝ
889,534,267 *5C83DDD9370A70B71AA25A03EEE8051DB2BF639B twins-in-love
889,534,268 *5C80D401542DFE593FDFE6EA72B0EBB269FF12F4 ГОЛУБЕВЫ
889,534,269 *5C8DD02314B3C2E0975C65FB2D3504EE36C537D2 TYSALMONS
889,534,270 *5C87BC43F71298ECE9A230573E1F15EF6F5B2E36 домангарта
889,534,271 *5C890D668D3C527767FD34AD41423B2151FE8303 ИЗМРВИТЕ
889,534,272 *5C879A486B974C8C88B1381C8ED9F194185BD0AE u.don't.know.me.(jaxxhouz.radio.edit)
889,534,273 *5C8A30AFB477BD33DEEE090AEADF74B22DBC7130 ЛУТРА
889,534,274 *5C8511D20978FA475EF9098F0D14F6DAA2CF7EE3 uloest8
889,534,275 *5C8D84C5040F6C8827BDCB99364ECA2F68821B01 UMORALS2
889,534,276 *5C85998C43F590D88C99E356630E614E024BB786 undersoe2
889,534,277 *5C8E01B6CED9183FFCDA72FB1E1823B8304111DE UNKNOWN-SONG-(SOUNDTRACK-VERSION)
889,534,278 *5C896CEF738EEB4B27D8E66B1DE44C0FDF3731DD UNRIVALL4
889,534,279 *5C837A8D9D453471ABAEB6498484CEB793B87081 UOAAShakeIt!(V2remix)
889,534,280 *5C800D71E1BC7DE8E44399E9D4BF69B6FBC271C8 valentintromley
889,534,281 *5C88875880577512C6BF62FDE6FB49C662A57F4C でアゼルバイジャン、グルジア、トルコの間でbtcパイプラインを支持する政府間合意が調印された
889,534,282 *5C8596D5A97A66A14D37C0E99E474A292036D72F VERIFICARA
889,534,283 *5C8997F7A4DA8184136CD36B8EE5D928DCC5D8A2 VINCEERHARD
889,534,284 *5C89BC75ADB87DC96B0ACCEFF11337C98EF451F3 VIOLETÞ2DCTHEOCRACY
889,534,285 *5C8AF0CB1B6958D2AC5761E166CBE9D8D692D526 visitnot
889,534,286 *5C824CE413081E6D094ED14E6796F73F0AF24345 VLEZIGSTS9
889,534,287 *5C85F8753AB4883B91518ECE90D8121AB8DB0B2B vlgrdjn
889,534,288 *5C8A65F7D4F6A43E0058890AA60B708575454FA0 vorschußvertrauen
889,534,289 *5C8678A82965266A473FBFA35FB54D8DE19A0888 VUESTRA2
889,534,290 *5C8ED76CC43F695EFA4716573941D803F4FE289E 04081286
889,534,291 *5C8E645AA07B6B1B79130F0FAD3A74F12A45AF09 [email protected]
889,534,292 *5C8DB0A88398894F184E18819A672EC550A29D4A 05251894
889,534,293 *5C8EA62DC7D337CC0B289AC80958BF86671DC475 WANGS WINGS
889,534,294 *5C833CE73F0EEDA61DE51AAC2F10E5138F9A4522 warnerbabson
889,534,295 *5C8A8891C6B413C92AEA8CF0FEDA4C9DC6D96665 10.auxiliary's
889,534,296 *5C81D6918A00DD92891F190A7289B2160863B49A WBRMWRDS0
889,534,297 *5C8630A56B7897B254CBDBE4E9F303DE11DCEAF7 123nairobi
889,534,298 *5C877CE6C3B6C2294C8B75343C9A2E3A370C3020 18oct1709
889,534,299 *5C82417E67076E50E039331C41DFAFEE82D7ED83 WIGWAMBAM
889,534,300 *5C861A4D25626333028070AF6F69EDAA40EBDC88 1BELGELENDIRIRKEN
889,534,301 *5C8C49B2E33A371F418EBB09F9E4C5B6A2888B50 WILLIAMIVANDRA
889,534,302 *5C81DD9587252E84D2D9D3F6188251E4D5F2A59B WILLIAM T MEYER
889,534,303 *5C8B133D9E58D085B21B2EDBEEF49A7E304B6610 1.glumow
889,534,304 *5C88BFDAE0B59D06B972CA3EB77609ED0217A686 {X}-~-~-~-(---3
889,534,305 *5C8B3B04C2A8ECAAED17AFFC732701C90C73C648 XAISOFLII.LOR
889,534,306 *5C8C6B5C9060D999D1813C50774DA651278D1E38 1sketcha
889,534,307 *5C8567EC8AFA294C028AA26148CDFBDA6A4C43D3 1thatelement9
889,534,308 *5C8BC2966853987BEA0AB92198AC2C7326D92BDC [email protected]
889,534,309 *5C8F854D1964630771FFB80CEDEED9A15BEC248E [email protected]
889,534,310 *5C8EADC6DF25A545613D5D75618703FCB6C5331F 2076137 DANCINGISTOTRADITIONALJAZZASOKRAISTOGUMBO
889,534,311 *5C89405BC452ED02B1F39FFBA354AD93973C3405 [email protected]
889,534,312 *5C820E4FD635040348474CE7F1866F7DB3EBC2DA 22jul1346
889,534,313 *5C8791ECE409B1E776CC1844A9C162123509D319 YEUNG372
889,534,314 *5C8136FE4A12DD535A7AF58329006FB2077CF3C3 [email protected]
889,534,315 *5C8BF44C9053F738BA7309EE69AC061351E89A39 [email protected]
889,534,316 *5C8541292D98C2FE038C46216A3A97B7173EEF58 [email protected]
889,534,317 *5C8DA872C48042BFF5FF58A428A3006118C7C6FE 273757 he also declined further comment on the sec filing
889,534,318 *5C82D06B8907ED949ED3846AA9E3C82C21B803C3 2.WELTEROBERUNG
889,534,319 *5C83A57F7397D85D3E6B5819D9B64909159329D5 ZERKNUL1
889,534,320 *5C87EBED163D06DF03BE6073F9ED13AFDD8452F1 zhangyingfen
889,534,321 *5C80C792E89D69D4C5CF71EE0FDB09885BF4F8D1 3FEB1797
889,534,322 *5C87B12477BFFF8B7F2C4438E47DC345E96BD209 3GUISELLA
889,534,323 *5C8F8FC0E3B736A492C74BCB58E4F0E5E935C68D 3JPAITNET
889,534,324 *5C8B02D930E7B9B714366E890A12AA8EF22DB27D ZHOUYIBIN
889,534,325 *5C8C637CFA4933EA7D7995013D9BB2B98D1FBB21 ZQ>H
889,534,326 *5C85618F4B66DFF6097FB233E40B5528DB528310 427JORDYN
889,534,327 *5C80458C493B4402B028F5E6D2E9381FB679CDC0 АРТУКАЙ
889,534,328 *5C8100675C3617D1BEEF43CFC404987F3A3A1C8D АУШРИНЕ
889,534,329 *5C82AA43D31446EED04F3B0E0FD4DF8636181901 БРУКСВИЛЛА
889,534,330 *5C855607D6D20B35325975D73F3A982673DD5A4C 4SCICREBSW
889,534,331 *5C8DF95700F751046F1C6FC49326F306AD20D9A4 505125 im.sueden.serbiens.eskaliert.ein.bewaffneter.konflikt..
889,534,332 *5C87FC876236DBC50E519B2B8CD249F89C3C4F84 5-dgw
889,534,333 *5C8A4FBA9EB9F84C30BE9DCAF2E198B74FA7B059 5RENODREP
889,534,334 *5C86ED18FE7AF78EC8F3A87BE6D6F1730C86801A 00XANDER
889,534,335 *5C87219DD07387D52D69F46FC62BF3CCA1070C94 7CAPTAINANTHONY
889,534,336 *5C8EFDAE59341C23B5E9CAFD21C1A94B2EF3E169 0AILICEC
889,534,337 *5C8D232509B28E1F2122CE8642E43DECE1DE50CA (_0)~~~d==3
889,534,338 *5C852FA8D7E421777E62341BD78937D7DBEAEF49 [email protected]
889,534,339 *5C876E2AB4C0BFF77F51570D8FEB3B7AFCC84684 (0_<).o~o~(b
889,534,340 *5C85B9AE805D541BD99523C1AE6F37A4138DA101 0v3r4ctng
889,534,341 *5C8C1211B73055C1C0A004E9AD5AEF4A8A758C98 1049134 " five centuries of italian painting : 13001800 . "
889,534,342 *5C86AB94FCB6DFA90CBAA6D453024585987F0F70 1091560 sosiaali.ja.terveysministeri
889,534,343 *5C84DE06A1C3E0112A5BCD9C51808A1D7A21AD07 1095885 OPETUSJ
889,534,344 *5C8BBD805A5F27B61AED188B3738D044FB77542F 12-30-1483
889,534,345 *5C843085B721AEED5538D098A34C09FB9F34F74B 84-RUNKOA
889,534,346 *5C858B1AB1AFB98DF5E566FA13FCFE2D5E6AAA45 8delimitise
889,534,347 *5C8413D47B1061DB3A8818BAA7519436BAD8AC34 8overcloseness
889,534,348 *5C8098781C03179E5E45FC87BF4AC1509951B544 1LABIOVELARIZE
889,534,349 *5C8FA0394B3CFA576000BB1B1588AA5FB3768E13 1MITBEKAEMEN
889,534,350 *5C8806D576164485BC562477551E694E2353D2D4 1.nelivuotisohjelman
889,534,351 *5C8077644A9E63DBDE6A911B8F01C378B2771515 1perustutkinto-osastolla
889,534,352 *5C817A9D2426A2B9538D9A330D623D0F87705F53 9AMERISOFT
889,534,353 *5C87F383CDEC6331093F8872FD09C8B039105C0D 1rauhoitusesityksest
889,534,354 *5C8200B49B9ED3884132B28795BCDA9A98D4DE63 1RITSCHE-RATSCHE
889,534,355 *5C805115F2908D2BC71EDE368FCA458C37F17116 1SEX-IN-THE-HEAD
889,534,356 *5C8160B0ECCDC08E6DEF4F7958EB541E185B0BA5 1 smsinfodienst
889,534,357 *5C8154E4971D3EB83CE264911F3E62E2AC2C785C 1UCINNYMI
889,534,358 *5C8C36774E066E7DF571B88D70530ED51A77B582 9JKMBINKY
889,534,359 *5C8E488F314C89AE3954355123DD97806A4182F2 9NORMANALICIA
889,534,360 *5C839BC5FCA891DCE6A9F8F0E777F799E5F946EC 2074323 JAKSCHEWINKTIHNENZU
889,534,361 *5C808F8534DD46EAD5DDA13BE894CB5879CA56C2 9ROGERSTATION
889,534,362 *5C8ED4660E72025E1ED29AC786A00E548471823C [email protected]
889,534,363 *5C8557D3C3B954573C17ED4DF04443549780F46E 9SCONSACRASTI
889,534,364 *5C8F34A202430DC9070075AF52F0FCEB1B4B49F0 9SENRIHAM
889,534,365 *5C8B4B788F9DD74F21BAF17AE311B8C4F67F4A5E 22JULY1044
889,534,366 *5C8BE3E273C339BF9A212892E3CF52FD2F0CBC62 23.11.1883
889,534,367 *5C8040BAA3C0093648A59C8721967A9FD789A09C 2484256 MUISTOKIVISIJAITSEEENTISELL
889,534,368 *5C83E81571C079D5D005CB3D64C8EBAF083C5B3F 2583964 KEHITYSTIET KUITENKIN MY
889,534,369 *5C865E8B640C8185CDFDB38DC866A5DBB6A3CC40 2599640 CONSPICUOUS BY ITS ABSENCE IS CALIFORNIA .
889,534,370 *5C89C9EA94C4BB904A7920CE33255821CF4FA5C4 a:0k
889,534,371 *5C82C257DFBE8A2CA51EAA7121C08B73B3A79DFC a=);1
889,534,372 *5C813DD4AB984B9CF5AC9200FBEACDC20560BBFD 2701372 KIRJANPITOLAIN 3 LUVUN 7
889,534,373 *5C83BCF88421F524E5A4F7228DE2A384DDDC8940 2750815 NATUERLICH.LAECHELT.WEIJEN.HU.DABEI.STETS.HOEFLICH..
889,534,374 *5C8B7C62BBE42F18EBFEFDCCA7369D14123B85C8 2761688 kysymyksiinne-vastaukset-antaa-tiedottaja-satu-raisamo-.
889,534,375 *5C8D03A23674F71BBFD9493AD40B8CB20781E4EF 2c4366874
889,534,376 *5C87471C61A1E890B77A887F0FE3C85F99CE6853 A4Y
889,534,377 *5C8AE137E286255FC1B7C24DCADD016D52BE1A70 2.kaupanalalla
889,534,378 *5C8A3BDB3EC8289166F60B295010D4A495B1C83B 2MARZOTTA
889,534,379 *5C836FC2CBB5F3793D9AF49F44409E1DCCAAD779 2 moccia
889,534,380 *5C8895F9D901670FC4F693D0CB16F5533F0DBE3C aaaa.[3]
889,534,381 *5C84DDA9756568804B6626282F0E4FE48AB010F3 2 VEITSILUOTO-KAUPAN
889,534,382 *5C874970776DEE8FC473A5E20EDB9389A615509C aab9'n
889,534,383 *5C8EFDA50A907BAA98A615249812189F8C70CFED 30.HEIMATGEMEINDE
889,534,384 *5C8206C139C6709214C1A7FA7F2BA3CC7757535B 3====> ~0 ~o >-b0
889,534,385 *5C85B42EC5994DC0F9609B4D09009EEC724F4D4E 32.WARMHEARTED
889,534,386 *5C8414A47E45EF2355A42B6E28D1A834EFB3BDF0 AAC;3A
889,534,387 *5C8DC8C21331EFAA01D8D982CE5236656628BB2A 33 GRANULAT
889,534,388 *5C85817ACBCCE937B7E65B5B695082C715698D32 aac_kl
889,534,389 *5C88CFBF60F809668865E12608069735AB086468 372kenzie
889,534,390 *5C8106AB2D7819712BE4D727AE33A30192460C52 3---d-*-*-*(>-<)
889,534,391 *5C8C0B1878F46FC329886708587358A07BCD6811 3----d.~o~o.uu
889,534,392 *5C883A62276F88A42978E63037666C936E5468CA 3EKSNSIEN
889,534,393 *5C86462ADE11B982A25369F9C04128153CA29183 3FT3RKR4V
889,534,394 *5C84D92BA30D4ED45767E367C3AC4C1D75CCC08B 3ILUVTOPCAT7
889,534,395 *5C8BC1F90B7A826F178343B64858BB4BEBF4A27D AB_"0
889,534,396 *5C8D8FF947532F5C6A5867B7BC318740B2210C9D 3OBFUSCOUS
889,534,397 *5C8A51658CBA28220BB202D13F86FC5B82D1230B [email protected]
889,534,398 *5C804030C116261B9C61EAA3B06DF24810929DF1 [email protected]~o)x(
889,534,399 *5C81B64388CF01EE9A9256A5863E98CCC76F3A18 abelloneo
889,534,400 *5C892C07768FC59C378FA3AC5925D299DCEEB26F ABHI-PARMAR
889,534,401 *5C81A0B346F2DD22DEAF6A44BF13A5C65F687233 abhyudiiyuh0
889,534,402 *5C895CE50125FACAA4F6BE334350CD516DAE718B ableeger
889,534,403 *5C8C351E58230F8D912532296C0B572F61B3846F ABYSDORE
889,534,404 *5C86CA7C7C2B11AF097B70634F2557CA9B06C304 4ccc62bda066b89d488c777cc97d8d6cVQpERh8s
889,534,405 *5C89FBA2E0D25CB225F3F10FF09012696792EBA0 4CLUBMEZZ
889,534,406 *5C8BFFBFBAFCAE9A181EEC5CF02BCC8B974AE0FE 4eandenor
889,534,407 *5C8B7810133CBCA30B784A8441C4E20EECE00646 4ILUVDENNY9
889,534,408 *5C81F422C5072DDF2740BF4EA77D9A459F7D1A15 ackm
889,534,409 *5C8B2F9B8C9B8F4369AFAB0887737FF22B00501A ACREDiTED AGENTS, ON THE SAME NUMBER OF COMPUTERS
889,534,410 *5C8B1D5A5F682D20003510BB487442D990BFD792 a--d+
889,534,411 *5C8363986741D6911F368045FA0223A3F443EF42 AD%5N
889,534,412 *5C8C20412368D8775359B3AC3E5496826E0CACD8 4MUSECCEL
889,534,413 *5C862059DAF0AD7B10541365D45457B245674E3B ADANJANOS
889,534,414 *5C8B90AD5DD10747961FEFA1EB16273A28A15C0E 4NRBOARD
889,534,415 *5C81A553586EEA886EBBC91AEC88F639302C2B53 [email protected]
889,534,416 *5C809193CDE1F7DEDD48BD395152994B2A5BBD7C 4RETEMOIV
889,534,417 *5C88B354590F4A564BC77C9BAAD8648E492CCF4A ADK(Z
889,534,418 *5C855E6303FAEBFD29A97CAA82397C8350F577F4 4 TCHIBO-ERBEN
889,534,419 *5C852A6F15E1A5BD6AD7DE1A2DD575BF4199E334 ADORILLA9
889,534,420 *5C828539FF11DA1A3E36BF2EFAF38A572AF2F87F ADR676
889,534,421 *5C83FEE36E45359658BC572440F24030AE41839E adu(6
889,534,422 *5C86FF1875E7FE79A6D1B65A019726E7AED04433 571FISHER
889,534,423 *5C89DFC168CDD3A18E5498E7E72AAF440538B400 afb17dda77d537c5ac2f57081d155d03
889,534,424 *5C8BF0B17E8889F1D3268521E1A9359CD57063DE AFFRIGHTEDLY!
889,534,425 *5C8A7BBE7297E06A7B1D4907D757E26414D4D0B9 5BSWSETTTYENTBSW
889,534,426 *5C84D3FBF0592A190CEA6402BAE4B85B7DEB635A AGATHODAEMON5
889,534,427 *5C8B3DA87199DBF3F067D9CD4734B1C9AE5556B4 5GALUCHET
889,534,428 *5C8B8E3A86C070FF3CD9528080C1712CFECB0E97 AGR#I
889,534,429 *5C833B3717642763ABA76646AA6B4C5818A97AB2 5GRETZKYCANON
889,534,430 *5C8795CDBD7973AFDC4CD236D0331987025319FC ah41
889,534,431 *5C8FB32C13F3ECDA2C1852C912D216E841124A48 AhoraSoyElRey
889,534,432 *5C8DA78AAFEFD4C179CE2E4B315A111EF8F55060 a/hrf
889,534,433 *5C8EF5237342D9760DF2B676577CB41786EAE3F8 a?ihm
889,534,434 *5C86D766A99DADAF0B75D9B38D62B999A7311587 AKCUL
889,534,435 *5C83B662BF67BEADF5C1CBACC45216DE37045986 AKYB/
889,534,436 *5C8B6AAC6B0BA5856A994F9AA4F25613F8E3B7EA 6AGTTIEN
889,534,437 *5C874647DAABBEB606F301016299CCB2418B4AC9 6BIOGRAFII
889,534,438 *5C835894E0C9150E7C1645EDB10A42A2D6FAC0D9 6BOKELJSKA
889,534,439 *5C808F71BBA655E4B26F9A085CE3F1101F4F0FF7 6BSWBUTTONPRESSMASKBSW
889,534,440 *5C8FEF2AD56E8B6BF2AEE773A3F991AE9077AE32 algarese
889,534,441 *5C88B729CF5FBED9A6C8AC5AE2B1084116A4F70A 6HONMARU
889,534,442 *5C886324F4F8F221EEA86E935A14693BA967AB6A Allego,-Vivo-E-Schietto
889,534,443 *5C870CC46CFC3381B1E94EDE75373979B2310AD7 6LEBEECKX
889,534,444 *5C8672C0F64D28AAB2ED01008F867BF03E735A92 ALONSO.DE.MANSO
889,534,445 *5C82590D23C2820D91C8B69BF0669ACE8F6F2529 6MS0
889,534,446 *5C85D25B413D90A0A2D7E77C0E4FA345736F8837 6MUTREKAT
889,534,447 *5C8BDB0F3E2F2EAEAFD42A5A2C2DCAB61AC738E6 6mysmiths
889,534,448 *5C8C784FCCFA4E718EC660C646F4AAE40DE65E72 ALVAROAGUSTINO
889,534,449 *5C85EE085DDB1E2E0B0705A6CAA2F95F1CE0F581 6SARINABSW
889,534,450 *5C88D9DA564B8918015763BD26795B264F67D212 amanda-utz
889,534,451 *5C8AF213031AACC3C7D7F097182D870EB2B32203 amct
889,534,452 *5C8AB39C95642CFE922A57E4D748113752C716DF AMEVF
889,534,453 *5C847A2C2298F2F74B1487AA5AB3891FE39E429B 6VOORKAUWTS
889,534,454 *5C82C3A696E501FE6F71C6CB24A5D4F9FDCD7A42 789AMERICA
889,534,455 *5C8FF1BC082FBBFEB87B89A7EB11F597606F4EC5 AMYTHELEN
889,534,456 *5C80A0C9308327B7FE830AD00E54BA1B27DB175C ANASTASTYAF
889,534,457 *5C8FD978A02D6AA81270F56C1A91E684A4C11D51 7BSWJEFFCCBSW
889,534,458 *5C8D738FC5A9661F40B4C001D7AF3163661EDC90 7CASIOPYRAMID
889,534,459 *5C8F949DDB0E6D7A22297319D6FA8BF13980363D 7COMPUTERTACOBELL
889,534,460 *5C83DFE9EAE74F28EB4BF3D429358E6AC519B6F3 ANDREAS.MAHR
889,534,461 *5C8D098C16784327129576107C67AC5F5AEA7C4D 7EIMAKIOP
889,534,462 *5C881300952A896427A58CFC7FECC728A2A33F10 7GNAYMMAK
889,534,463 *5C83DC53E18ACE79A2572B461EA8CF4966602E27 ANESIEHU
889,534,464 *5C8D93AA69510489C07AEC51FD1576D42099A96B 7ILUVZXCVBN1
889,534,465 *5C87C4EA040A58AC41E043DFE6DE942616C2952D 7PANDURATED
889,534,466 *5C887961B5EDAD95501D994030C0369EB2781FF1 7SPALTENUMRENES
889,534,467 *5C8B6EFB53AD6DA7EE30E0E83848948DC0C5FCE6 antiintellectual15
889,534,468 *5C8C3F69E3B5203D021E772C5050D3544A130641 7TINAALICE
889,534,469 *5C8944DB3D213713EB09F8D898D8CEBD81E10C22 7TNEMETETNE
889,534,470 *5C8E87920D0527E75897587C317D2D915AD1C783 antony-raj
889,534,471 *5C8BF3AAC657683D6A73295C7F29B1EB02C71AC7 ANTREKKELIKER
889,534,472 *5C808A9385214ED6DC004FDA73AFE3155C694126 anu,t
889,534,473 *5C8D2B77164EEA7FC5BACE579F2B07D73F91158A 8BSWZERBEUELTENBSW
889,534,474 *5C831C1EEAEADBC6258B1D64DF6568515882CA00 8CEKICIYI
889,534,475 *5C88ADB386678C01CDB74F278EFB4D39752606F5 8CTPYYDBIDANJ
889,534,476 *5C8EB8F462CE1221D4D72AE032102769F93E4570 AQ#P;
889,534,477 *5C8D3767EB19042BB82CD42E7F9B81F9B9D4ED34 ARA
889,534,478 *5C8C3F682010C8F3B5D5DAAD958AD6184CE7BB5A 8LOOHCSDNOVAREGRUB
889,534,479 *5C899C4B4A4217AD3AF26999395ED1F0DA0021C4 ARJD"
889,534,480 *5C840E70B6FD24A610CDE0E00B4FC28C49778802 8MICROMATH
889,534,481 *5C8EB0C593571D390DC272BF6D12185E2686E0AE ARMAND.BONFIGLIO
889,534,482 *5C805ADA26FF57ECFF6D3218EF64F3CBBEBF930A 8PERHOSTU
889,534,483 *5C8DCE7D25B11CB56EEB5AECD1DCABD4E857B6F8 ART000001C97ECFB3D4F6F4
889,534,484 *5C8BFBB837F4BC23F15A124FCB16F63EA21CDB74 ARTIVATE0
889,534,485 *5C8FC18554DEC12CD1DE9F354AB90AFF62407BA7 artkindle
889,534,486 *5C8CA204117141508498DEA98B077AAA98C7B592 ARVI
889,534,487 *5C8CABB9E4D3ACE26BF79859E1FF0D7B6028D39B ashleyweemhoff
889,534,488 *5C80A2916818F2A2F2B3C4535FC3D1CF0DCB7B31 9BUSNELLI
889,534,489 *5C8A6BD35DCE4EB2025BEBFF7CBDB0CCF04A80B6 9CONGRATULATORIO
889,534,490 *5C84F76AFC98F567669EEB2D3D73119BAE4ABEF9 9DANEISMOI
889,534,491 *5C82002F4EECE06EEA744BCCA587A4CD7F87E589 9ESTVOLD
889,534,492 *5C891832E673CB43E4A4CADCE0863D3CB3E38958 9FIERHUAR
889,534,493 *5C86BD6A8DA03F26CF26756D235D05BEBAD2490E augustchaudhuri
889,534,494 *5C8C24EC8B41C59678C67F0FAD3D859F5AEB71F6 9GUUSAKU
889,534,495 *5C850F58340AB89C813B1270C777F3096B1CE34B 9INHIBERAI
889,534,496 *5C877F833998B9880886BC0589B60ECC927B17E9 av-&
889,534,497 *5C88258BF37AA1BE213CD548F0A4E77FB62B6C1D 9POLYCHAETANS
889,534,498 *5C81D4CF5174A341C615377ADCB62EAF826AA19D 9PRADOCHITO
889,534,499 *5C843FABE96160D59D5B040A9E76EEFFA63384DD 9RENSLIJN
889,534,500 *5C84D4E2DFA0C2C289A92E06E3EFC214A65599D4 9SKARREDE
889,534,501 *5C8CC661CAFA6BB9C5A97E546C01D44E0B100882 axeladda3
889,534,502 *5C8C12C45C86527BF7C9D8C43B08F978081CC32E 9UMFRAGEERGEBNISSEN
889,534,503 *5C8E44A2842179D914146433E02F4072F46B5075 9WEEPOVERBEWHISKERED
889,534,504 *5C85B461C595FF583AA088491FC94CC277BEBB2B AYKIM
889,534,505 *5C8D781133975C0E82E763A28E11CE72D09456C8 A11EN15+5
889,534,506 *5C864DB79210811628179A58894EA8EA5319B2E8 b&3n/
889,534,507 *5C8062AFE0428AA4D7F296BDEEA7BCB86EF3EA4E a9;.f
889,534,508 *5C8CE5F055A1F349DCD675A612A7A21E485AA204 B6NUF
889,534,509 *5C84E52AF3C63C44586CFCD1DC07F5DD7DE86199 b8to
889,534,510 *5C84D9B1C4BED57A706C7EDA2762B6954B98F3E5 AAD*"1
889,534,511 *5C8FFA9E284622006F0641CF5BD9501C9B1B0FFA bandenmitglieds
889,534,512 *5C8183CB5F2003EB84A9D09FB0D0943AB6006B56 AANDUIDENING
889,534,513 *5C8D90FFA13C6CD692EF19DA69C664250FDD1B24 bazoches-en-dunois
889,534,514 *5C87D8FD541A1AC031390F6B6A8EC0ABB1221642 bbf,o
889,534,515 *5C8EA97F6C57E5E6780505BF33D7DE1D1B8AD444 A-Child-of-Our-Time,-Part-I:-Man-has-measured-the-heavens
889,534,516 *5C89DF49F6FC45B29EC9B2C81476F44FAAA6EE03 ACHMADWAHYUDI
889,534,517 *5C8F9B5B0B11D74A0E07E8302931AA9266A5E67E ackjs
889,534,518 *5C823EEAD8DAB775F7C3AE935DAB299BD35AC1F7 ad"f
889,534,519 *5C89853FFEA1B560F99F74B2BA051A5A063CE13E BEYTLA
889,534,520 *5C8170F7357802C842F505376128BA158BA6AACF AER0,
889,534,521 *5C8CCB7278FCA26EBE630646D488AB0584FE00E8 afncw
889,534,522 *5C8CF671BEE96EF09A74008488F2DE4C0969A2DD a.fwk
889,534,523 *5C8DE7CFEC5EA9B79E5FEBDC4857BA7FDEC23888 agroc
889,534,524 *5C8D3B26179697E160D3327B9526F41A793AEA9C AH2:D
889,534,525 *5C8B0CB71D3A6ED0D70A8C2696175A8D6CFEA88B [email protected]
889,534,526 *5C84E21A49CB5637826658C98387A56C9422ED29 [email protected]
889,534,527 *5C82F0DB8F00158C0E3AD22B6777C729C3DBD4D2 billsolly
889,534,528 *5C82945676A2494527F7F961AA8404D8C61BD48D BLACKNATIONALITIES.ORG
889,534,529 *5C8690F9EE39BF62CD18EE52C8E4F8ECB3BB5473 akteg
889,534,530 *5C87767E72AD53A74709203AF91C1AF4E3D918B4 albertjapp
889,534,531 *5C8C3ED2B987C79A23FD9AF18C2B6BFB986E300F BlowitOut,PtII
889,534,532 *5C8D6DBA01404C7E23CF5E0D83444F5FD9A60013 BLYR(
889,534,533 *5C829A2DB506B5EE427BA9023730439802439C1D BN2KC
889,534,534 *5C80735C77BC3CD2B66C59BE8AC02958A54DB818 alonzohadsall
889,534,535 *5C826C5E30FD222353E49AD034DB1549572DC0FC alonzolamaack
889,534,536 *5C8DA13FCBBD1099E0B3AE0816F16D7B86C45C4E ALOULAS
889,534,537 *5C8B83958EBE5696F042EED71EA1F3DC9E033A49 bo?g
889,534,538 *5C815599D7F78C2375ACBBF70F0BB5F3B850EC00 borw
889,534,539 *5C8BA27BB8B7D8A7EB6825AC621DB058FAC3AFAD bpglt
889,534,540 *5C8DA16CD2A14B15554975DEE910130799081E2C BQKD
889,534,541 *5C8E8C8E6EF5072A82C89B6C498522F1871132E8 ANHOUROUTOFDESERTCENTER
889,534,542 *5C8B9C61489D18CD6973C072DA8D0BA11FADAF82 anibalherendeen
889,534,543 *5C8D6849C383CB4E905FBE7BD20B7F9DFEA8A6AC brc:m
889,534,544 *5C81104804C39B9A775614EE09E5F4E32D2AC187 bredabus
889,534,545 *5C80B550CB3CABCB79585EBF1624A820E512853A anothernote:
889,534,546 *5C886E7398D6114FC1459F5EA7564AC796355CF7 brings3
889,534,547 *5C877EC3A7D5103E4A8AC15CD3BC21B1718B3028 ARA
889,534,548 *5C80E74E8675CF96ABC0D73BC1E5D50EEE0DA8E4 btqhe
889,534,549 *5C86D8D85CF6330A3DE0E502E414693A937250EC BUDDHIST RETREAT
889,534,550 *5C8EDAF17776708F0F406693C0DE48B43AE0D790 AROHAY
889,534,551 *5C8DF745ADC3F381660E87A2F260ECF7935A8425 AR!PR
889,534,552 *5C84BFBDA2B092206C981029DA86203F60102069 AR=(U
889,534,553 *5C8956766B28E319396EA096657EFF9092563C6D as&?q
889,534,554 *5C8811AD8A3C9B33A86A18A2E0DD969BFD57D53B bxu&h
889,534,555 *5C866A5F73142CAB0FB572C1712FA51E60FBE0CD ASYETNONEDARETO
889,534,556 *5C8A3BE6353C9E676ADD6CBF70BF3B2AAD201153 ATBS"
889,534,557 *5C8046F5D98178711915399DC0A19245B16C1E0E ATL)9
889,534,558 *5C8CD77C607F795D9918B1DFDB2A1FE9C74AB39B AUSTINCONELY
889,534,559 *5C8F7EBB4478F5DBA857BE035F4468580CDC3F9C AV%a
889,534,560 *5C88277C44865715863D3BF0C5D409C26449E95E azv6rfbumzkz1
889,534,561 *5C8A5AF4F383A83ABBA2F945CFCB41D1FEB7CA5B CAN'TGETITOUT
889,534,562 *5C874F683EA71B46E499224450742BC42BB8021F CANTIK.IMUT
889,534,563 *5C8FF8D57BF065FC433C3CF5C9F18B60575CF608 >-B0.o~.(====p
889,534,564 *5C81168B3B6C91CF75EE742CD70CD3D9E3CB93ED CAREYMODIQUE
889,534,565 *5C85F6C597BA68186BB40DFBDDB2A954DF8E0608 b$1s
889,534,566 *5C8D53A361BD9E7CC65DE5D81A3CED32033F9112 carltonhemmingsen
889,534,567 *5C896E25F392B9D525E929D3A6B6A8731C764105 b3j!"
889,534,568 *5C808F8F3A806D7C1A84AE573F33D2DE8FF3B060 B?3M
889,534,569 *5C8BA5E0398C231EB9EBAC84CC9873D22A7DD752 B5545
889,534,570 *5C83B1B50D4EBF0D7FDC5D52278D10F002C73453 b9jh$
889,534,571 *5C84209EA33E5A540A3F78F97045A21A34E5FFF0 CB"?W
889,534,572 *5C8553395D86FA90DF4D5A944D0B9D403D8A1F63 BAHNHOFSGEL
889,534,573 *5C8EFB9165A3FBAD117B2318ECF03DDADF429286 BAMBOESTENGELS
889,534,574 *5C8DB1570950B5CC255D112C3791E3DED88E08CB C\{E
889,534,575 *5C8568DD3B2E9F36FB4A04CE98A8DA3267AA4125 barrettmccormick
889,534,576 *5C8EEBA906AD57E602C1A857FBBDA0A0831BAC3A BB.*.*.*.~0~o(00)
889,534,577 *5C8870D95D60DEE635F133159606B94FF3E24181 CG_!+
889,534,578 *5C8A68929B7B141E506F6B905A1705D20F22BD3B bd:b
889,534,579 *5C8D36B8CA28774D379CC85430C00AB02EF71B6F bebaroned
889,534,580 *5C88DB07B7547162FAC880ECA40F868847751978 BEDSPREAD64
889,534,581 *5C87C799B96128780D9A46E66FEFDB2D182EFAA6 CHARNELEW
889,534,582 *5C88DD31AD63FD3D7D07E989C68C86F4D9EA9E2C begrenzungslinie3
889,534,583 *5C8899D187DE1602C01A68268E2193122F9EEF74 [email protected]
889,534,584 *5C8DDE9AB405FB499FA42049C9FE7B8410A5270A BESSEN
889,534,585 *5C8DC870DF68A9E2AFC1C7FBC7091024CC7CEEEE BF8Q
889,534,586 *5C8E00796AF668FD38EA442AC5F5482918EBF276 bfcad
889,534,587 *5C8F54A39A230982CE199858637B098F489CD168 BILL.CARLO
889,534,588 *5C81CC777EDA0B0894A851872E8A3BABB30DC609 ck9n)
889,534,589 *5C89B5D9A72D19394500BFBF25108385FEC2310E CKCHO
889,534,590 *5C8F0535304D277E8DE26A87F760DB2AB75CB239 bl:7
889,534,591 *5C8B9E3AA6AA5F2DC5F47AE091972D0D4954257B CLINTON.KHATRI
889,534,592 *5C88F6DEA82B98D88FC87F5FC09A900AF617FD50 cl"r
889,534,593 *5C8423D4972F682B1DCB55DBA3E9C2CB94650089 CMSIW
889,534,594 *5C822B6EB7296FC91C220FBF7A83D6D8178F7A26 bn$4q
889,534,595 *5C8F09085DC56D412CC88E96364C7FB3D3D5FD58 COJP
889,534,596 *5C8EB0B765770C179D379B7F2B6B01771C1CDD8F colewort
889,534,597 *5C8BA87E938FB4F72069EE2EA58D1FDBEF30BB27 (comment)故人が遺書の公開を希望し、社会に対してのmessageも併せ持つならば、原文掲載されたweb
889,534,598 *5C851C09E02F72BFE7478B5EDBD1F764503DC253 [email protected]
889,534,599 *5C81BA67084F19FE1563A7352123C2A0EE7FCB19 BOULRICE4
889,534,600 *5C83EB59F32B0345B664E5B58D605FF46966BF1B box?x
889,534,601 *5C8AB2000130AF570B2AD66707FEEE6ACC148068 CONDON4ION5
889,534,602 *5C8649497AF11EAD37FCCB948472CDEB83F3FA31 [email protected]
889,534,603 *5C83DF86E46B9FBCCADAA8CA166D9B89332B959E bq&ha
889,534,604 *5C88B3988022E9140CDFE505A7720FF0CA640DE1 br+$
889,534,605 *5C891BA4E8B7D4B02446755AF2407F499CD506BC BRAINWASH(DJPAUL&DARRIENKELLYOTTMIX)
889,534,606 *5C838A228966BB1C4569E504056E53CBE4B1E11F brandstofdagtank
889,534,607 *5C8C8E55EC8FFE3ABAFA2D5670EEF3ADCA248885 breathng
889,534,608 *5C8D8C83377C70763CB6452586B65650504423A4 BRESTOIS4
889,534,609 *5C87F20D28568034FD0B0591D53EA305449DFB50 brettbrazen
889,534,610 *5C8896F7C31924918E1FC3933FB70D77A4E3A081 CPQCALXL2
889,534,611 *5C827DCFB775473DFEF46B0C2A1523443FB89233 BRIARROSS
889,534,612 *5C8119D16E4DE061FA2C6355BCDDBE07D8A92892 c:\program files\common files\adobe\cs4servicemanager\plugins\orgeclipseequinoxlauncher_100v20070606jar
889,534,613 *5C83ED5D2CBA98B88E45E6241E73202D876D2D8E c:\program.files\common.files\microsoft.shared\stationery\blank.htm
889,534,614 *5C888B5CE90103BEE23CE2D35AD52B8F2BA85428 CP"XG
889,534,615 *5C8C6CDE485E30730EED5A0BB5CD521E58F7162F BRSNSTS8
889,534,616 *5C8B12489C396062767E112F0081046B7612C042 CRs"
889,534,617 *5C8FB15C73920D4AA69B0B9DC86BC6FAB1078E7E bswstabilant
889,534,618 *5C8657D9FF13AA3CF10025E30A7A3D09ADDEAA8E cruhw
889,534,619 *5C8B0006627A7AF874DA83AA1C5C8161EA8FD022 BSY1"
889,534,620 *5C8DE61A8CC608E89E1B7D9C2CF4DEDB939FBCA6 CS1U)
889,534,621 *5C8E198F0821B27DD986DDACF74A55E1C1A8057D cs-k1
889,534,622 *5C8DA262DC3BE7C357C3CD18E70FFAB54A2FBEA5 [email protected]
889,534,623 *5C8DBCBEFC976BA427FBD55A36534E9BF54F97EF CT&AW
889,534,624 *5C8C0FC493D48822AB76D8CE6B07C9BC7A27DD0F [email protected]
889,534,625 *5C835F1A156C535317E0DABE4A63121AAC0DD3AE buscassem6
889,534,626 *5C880476F55AD44C3AB9907083B8782981670D51 CUMBE-MAITA
889,534,627 *5C83440F8A2E81239CA71A12CB44E80313C04011 b?v7
889,534,628 *5C873E4E9790FB31829EB573E7C3D10DF9DBDE0B C:\WINDOWS\MICROSOFTNET\FRAMEWORK\V35\MICROSOFTNETFRAMEWORK35SP1\VS_SETUPMSI
889,534,629 *5C8F5E7504F548EBF75C9DC1CF3FAE6977A6956C C&_YE
889,534,630 *5C8FB9C2F915AC2B6049897E3B6289F0B38840D5 D6SZ)
889,534,631 *5C8C8D7C75A43CCCA376DB94C17E8AA2A7102DE7 calyciflorous.
889,534,632 *5C8CEC2F28FB6C2C4AE0B83282D386E87B88C6D3 [email protected]
889,534,633 *5C83211B3C367ED56E8A1AA938C1F7912FF2C828 danialkasemeier
889,534,634 *5C834ACFF5A93DA874F071450949FC4E20EB3BBB DANIEL FREDETTE
889,534,635 *5C8508F2E1549D9264E4F4C3F7AA70B33CB798C8 DANIEL-KORB
889,534,636 *5C83D5DF1213ED85B0F3C064430A1089CCBDFAE6 dannybritten
889,534,637 *5C85C356BAA44E58BF9C0936B15516D4C7E4B575 DARIUS.VELAQUEZ
889,534,638 *5C88FA6C62325E4B8BD80C35AF43E8A47EAB7949 CASEY.MELCHIOR
889,534,639 *5C8148B2F171A0F64C037EDDAF997F85675599C5 casog
889,534,640 *5C88F451C5B0F243CBF3113D92A908C0C9ADEA96 cat65
889,534,641 *5C8B6BE7AE2E26A69BB0ED020BC1A55C4F3792FA CCBBT
889,534,642 *5C83B56CFE0715EBA7D4115FECB3351775BBDB33 dc7ph
889,534,643 *5C8D917B2F1B26B6DFDAB31897EBC85128907EFA CELESTIAL.CLOCKWORK
889,534,644 *5C858A423E68309E76F880F7AD43B39D5B0E8A9F ddhau
889,534,645 *5C8BD2F23955257DC4B77700F166C23AA328F34F DEBBIE.MCCALLISTER
889,534,646 *5C8AAF8C0AC0A96915AAD9C22481F2FEC62035B4 DECIMAL-TO-FRACTION
889,534,647 *5C8ACFB8986C73C570805CDCFFB19F4729357274 CGGP
889,534,648 *5C8FBE4BE2AB2604EEA04DFD92E114AC684C3EC1 CHANGDARCO
889,534,649 *5C8C239FD5BFF40F0B4DBB752C403175882CEB97 charlene.flick
889,534,650 *5C8689C00126B12D738FA7267EF76D88A54F33FB # CHECKING TO SEE IF URL HAS ACCESS
889,534,651 *5C80F903090AC45A3477DE612B28EDADEDD11670 [email protected]
889,534,652 *5C84D5B6FE5F7E90E7FEDE95FE0086FD74D5F065 DEVINKUBISZEWSKI
889,534,653 *5C8491728A7A8011FC2D3FE498EC5ABCD78C13CE chổi-góp
889,534,654 *5C86F87D8C93681E745D4450EFB152B3269798A0 DEWITT.MOGAVERO
889,534,655 *5C88288D5B2CCD8361DA0F52C46E5338159B1EDD CHOR4LE$
889,534,656 *5C8DA0AE436B756363447069A66CBDC7F913D1F3 d:g;$
889,534,657 *5C862F6C7AB544F1EC881D802723BF83F406AEA4 DHANĀDHIKṚTA
889,534,658 *5C88FEA0A2205CB0AFB9454A07CFFA4E345C9D06 CINEFILMS9
889,534,659 *5C882BACE0B8F0EAD10D895D28CFBA7A065D2F45 d'himachal
889,534,660 *5C80998DCD78B4D9235FFF6F4B94072384151F1A DICKMASSART
889,534,661 *5C841BD0B9EC42850716D6240496CD084EF9085A DIEGO-DELLA-QUERCIA-E-MULINELLINETTA
889,534,662 *5C82B7DE0FE7766825A26764F31381688129F0A8 DIEGOESSAFF
889,534,663 *5C80D63FBEE9C84550916A81E28F7D5C9F7F9E7B d&ig.
889,534,664 *5C8FFFB58F624BCBEF48C54EDCBAB530C3A17E14 clarkfabiszewski
889,534,665 *5C83F8A6CA8E32A28CA7A766AB74463422702F4A CLASSING
889,534,666 *5C841F44E010874C0F22AB783AAE092F6E4DB4A1 DIRKMOONE
889,534,667 *5C8F93F57A5A30E4FF89AB91103063A5A17CB9C8 cleora:.recitativo."dorus.wing'd.with.swift.desire"
889,534,668 *5C801DB3EE6D199B95937818EABBC5E4EDF64164 DISIMULOS3
889,534,669 *5C892B2215D0B8385275C8E569647E23D1B2371F CLIFFORDKUSHLAN
889,534,670 *5C80B51E15378B014954718C71B0A95B91B5E027 dizme.tu
889,534,671 *5C811D07EEC402CC602E8BB69FA9D86E324ADA51 DJ%7
889,534,672 *5C8ACFC2E719BB44C82E5ED700513CE6CED4F7F3 [email protected]
889,534,673 *5C8BFE96BF5476A0190ADE1280EEEF25CA173AA0 d=k6
889,534,674 *5C8BE99B37B1BB3FA1BFD457A057659AE030A6D4 DL{E
889,534,675 *5C8E6C767D02ABE90A7E42F37EEF77972AF7890C [email protected]
889,534,676 *5C868A5687259BCC98ACD245BB1912EFC0248F5B co0/m
889,534,677 *5C831A6D09610DCD58541421ECA447B1C2C60E49 colleenturok
889,534,678 *5C8C2E7ECB78FBCC30520EEB6BA21F5A0B9D4787 COLLINROAT
889,534,679 *5C81B86D720CC27DDB7B83BF11F7E3475FA1284E DO7;1
889,534,680 *5C84436CF3422D633441F78B917B732FEA396F55 CONFORMISM'S
889,534,681 *5C8B623FB513DC32B8221994B39B9E70722BAD99 donguber
889,534,682 *5C8BB3E1C4199F986F4E8A731C2F08564E79F3A5 DONNMONTAS
889,534,683 *5C849AB66C505CF78AC704E73A2BF3BBE8D8518E CORNELIUSVERDIER
889,534,684 *5C80B8E709A0D191D799AAD4B43FD4F9C23416B0 dorseysweeting
889,534,685 *5C84A431ADC291F61C4653B1ADCB5C23481D0E75 dorsschnlmeister
889,534,686 *5C8A5B1C201F96C1E774229314B3D2A501671E8F COURTNEYHEPBURN
889,534,687 *5C8BB6180DDB443CE39CF195D92B2C3AC6CCBDA6 DOYLE.CICHON
889,534,688 *5C852D51F4C11551669009B32FE760F644BF29B2 CPH("
889,534,689 *5C85907D6AA7FCADC8DDE428188F7CF0FB98BE59 DOYLEWOODBY
889,534,690 *5C8F376CBC90FD81FAFF43D8C8FF860E5098C6BE DPJSB
889,534,691 *5C85857DF36FCAAD19869FB127339A783928F349 DSBKU
889,534,692 *5C8931DCE24A7DA0928BDC1F1330E6A000306E25 DSQ&
889,534,693 *5C8332CD0FA134D23065F6FA14E42511E6691FF3 dtzbr
889,534,694 *5C83BC0C0887477A64C401FCE928478C056B10BB CTUFI
889,534,695 *5C832EB431608BB1F0CE17C4C9A77F84825F6FA0 DUSTY.JEANGILLES
889,534,696 *5C8231108F721DD37D8E805A906DD4ECDF070F68 DUTCHES5
889,534,697 *5C8F1BE449FE31BC8D9B345D90571BBB1DBCA851 dw8ir
889,534,698 *5C8E25A0F5470E8AF412B16A1BF62F8A9330E525 DWIGHT.HERREL
889,534,699 *5C89877DB8D56D671125FC4460BF372CBBFA2404 DXWB
889,534,700 *5C8FAB4CCFE6956A0A3F1996F78CFFFF3181C747 CX!U5
889,534,701 *5C890836E5946DECB6B380FD90FE6600C2726070 d-;#$
889,534,702 *5C8BC356D82C2EC724572CBF2CEC749B633D41F8 E6164259
889,534,703 *5C83E6DBB0D5589745D610E817E3F63BBD1D3A2A E_A
889,534,704 *5C88110EE97A75AB0CE9CAFEA45CC6F4F502360F [email protected]
889,534,705 *5C8F35A8010AE1D10F214DEF4DD15D9FDEDC5EA8 D3SC4DO
889,534,706 *5C8485B607154B28A63DE18701B36EB8902EE01A ecn{
889,534,707 *5C8D9FA5C68B8972F9F81BD8ADEEA11B53410C92 d7d476af8a8bbcb7ba4241ef43ed0f55-Shyanna
889,534,708 *5C8B9665F6678DDB03FB209B583BB59203E239D2 EDIZA
889,534,709 *5C8580FA3C8BECE10A9A27DE2E39849ECBB5A91F D9:+
889,534,710 *5C8032561A71A0CFD11FB7160865B037F985F494 EELLEZAG
889,534,711 *5C81C9C71756DD66E290EE325A70463BA26AF0D5 eeujtb
889,534,712 *5C8E8C9B24E1FCA24BEC4D4935FB41E6CFDB6236 [email protected]
889,534,713 *5C8229457BC0EE9B6213071F01B6C4DA40F6289F DALIA-SLEIMAN
889,534,714 *5C8AC8F467A1EE7FA7D1D7A83FD0C3C6210DE605 dananiverson
889,534,715 *5C8226AA18AD8F9C1823E98C072DAF71CB6046BD EHCNARI1
889,534,716 *5C8CBCDB84130AF58C9AC40317931A94A88D9B86 darenmccubbins
889,534,717 *5C81A7870FB9303C4EC6806136767A4A5E180DB7 EKATERINA KUSHNIR
889,534,718 *5C8810F7219AE0FA1CC9E67F68CB3D8AB73195EC DARNELL.FESLER
889,534,719 *5C8CB1D861FD1892D606F6D884C95ABC861DE0D3 ek_jw
889,534,720 *5C8DFD462EC008C931E0CB032A14BECAA3C12B42 EKMKU
889,534,721 *5C8FDFBE538B2E391C0871DCA2456E23EC6F7CAB ELIZBERTHB
889,534,722 *5C8588664EA48A57FEBABC896CECAB4CDE3D79BE dbgzj
889,534,723 *5C8D77D1BB599033AC69BAA39D1FFD721BFCF43D D:CKW
889,534,724 *5C86496BEFC27D4EC648B2865AFAAD987F3C8E78 E-MAILTREK
889,534,725 *5C830FD3010E5914945509FD09E29E6040963B98 EMP
889,534,726 *5C8D741CA2E619EAF2DB2F71BA1B8E882F6BFF08 ENDOSTEALLY5
889,534,727 *5C82E7C35C855FC4B669AAC97ED94DC4A455BCFD enpsn
889,534,728 *5C8C41E71C70632545EAC5ECA4DB85C38598092F ENROLADA6
889,534,729 *5C8172725C66D6AD3AC177653742BF1F1E5C218D ENSTAVENNX3
889,534,730 *5C81E0EA3177218726D5F233EA81161DEE6A9851 eo4n!
889,534,731 *5C88C2C017431CFA5E980744E528CFD9D98817D6 EOQR-
889,534,732 *5C8EEC950299A5B05D7644DC9103DC31579A129B epeaters1
889,534,733 *5C83C6F41A737D86AB8D0BAA9C12C03ABAE5F8B2 EPI
889,534,734 *5C8F17B26BDB95D1BBA7890F6CC257C293AAE4F1 df?&a
889,534,735 *5C8B7FC0FFEC761474FC1ED4E93305CEF9AC0331 DF;P9
889,534,736 *5C859E330AE8DBA043EBBD56C857400274DCDF0D DG5HE
889,534,737 *5C87315D7D94A5BB25DC810FAD6B49D6F2884374 esiained3
889,534,738 *5C80975F553D461340BE52F6F32EA3B6301B36CC DGJ(R
889,534,739 *5C8038D1A925FA513AAC5E4681418212088ED659 ETHAN.DUCEY
889,534,740 *5C881590B1D8B58550D86E8F1A5D7035D81AC041 dhzbt
889,534,741 *5C8A545DAF0A8F8859E3F65F0E22A9E7ED5016B6 DJ8(0
889,534,742 *5C8C38595876B0B23A0D804F4B03931F0EEB819D DJB=6
889,534,743 *5C8961FE050D5DF2262F7C7CC36592D4588D8E64 EZEKIELGORNEAULT
889,534,744 *5C8C3FFE5DED87F51AC83E8EB081BFA4CA476644 ez-entertainment
889,534,745 *5C844F5D14B44DCA48E5DB07A7035F869C8ABA80 FEBBRONIA
889,534,746 *5C8417E98C01A934049BFC110A64C7BFEA6D2FBF FEDERICO.MICHITSCH
889,534,747 *5C89BE4C19326F2E440593F37983209592E54024 [email protected]
889,534,748 *5C843ACEE29A5ED87E4F610378ED377B0070F011 Dn#m
889,534,749 *5C885B24BCC521954B3BC0E14D102545947F1970 dnp?n
889,534,750 *5C8C7D0BA03299C2CBC1756EC0F2862358FCC180 FERATBSW7
889,534,751 *5C877C9FFB517919B13E70D9B2902806551533BA ,.Fernando)
889,534,752 *5C872A7D6910B6C516BFA01A8916ECC9630D3DFA DOHKBSWED
889,534,753 *5C8281D72309E09DBD97BD10A35A72CE46A976B4 DOMENIC.SCHLIPF
889,534,754 *5C8D8AB9A2B33DB662492268A680BA8DAA90D193 fibrill9
889,534,755 *5C8DE71B050A48E429BDEDBBBBE849779765638E fischiavo
889,534,756 *5C80D3A773AA687AD8BCCC3E1030CA3CF268833C FJIMYEVW69
889,534,757 *5C853B097758B008310ACE178290BA7F3C7F7CE7 donteserafini
889,534,758 *5C86064D05B8805529ACFA1EBCDCE6D1CA6C42BD DON.VIGGIANI
889,534,759 *5C8F5C602B6813A02AD243E30E752DD2FC47E1C8 fletcherseufer
889,534,760 *5C862E32E0792FC9864E9E3C04D0018CB0FBE76D [email protected]
889,534,761 *5C8DB806E776D54403EDD094C3B5F7F6E2C833B1 D#P0
889,534,762 *5C869A6FD20FAE1C53A5952C76406B7A306C13F2 drapetsona(drapetsona)
889,534,763 *5C8B00FC24FB82B88B53CCF4EA51D0B4E83D6457 FRANCISCO.LETMAN
889,534,764 *5C895624F39E8FB8D3CC5B1AF3921F0DC26D0F7A FRANCISLIONETTI
889,534,765 *5C888B97439B2A05AF418D6EA2B9F62E77710E76 drkfu
889,534,766 *5C8F5BCEADA72B15CA22AC5EA5955AD732441C80 fredericminar
889,534,767 *5C8F4BDCA1C7E8FDDE9AEFADF4D146E3E6E7403A Ds1E
889,534,768 *5C857B83487DA0F794595B86102BF46E02CC43DC dtig"
889,534,769 *5C8A38A526BB75C7485A75E967909DE6282FC47B FUNKYMNOKEY
889,534,770 *5C8C9E48FAFBB3AEC8FE62913CF02C59A3BA16E9 [email protected]
889,534,771 *5C896269AAE1B8FD10A2CA6F8742DF5E86F54B70 fx<t
889,534,772 *5C80D0907BE6AE0B4310B6F7826DD244308C7863 DUREX65
889,534,773 *5C848FDB2AD598CC86EC7DC4F0E95DC976DE0F34 [email protected]
889,534,774 *5C85FE1FFDF7143F518779DB0AF15FEAB4B588E8 [email protected]
889,534,775 *5C853570805D883D3CFFD51D0E4E64F16E647B20 GARTH.RUPLE
889,534,776 *5C8EFA9C8B7D9EFE5FBACF603ADA64E227AAEBEF dxhsm
889,534,777 *5C8D51C60A9E6185B75C8EED17898B61BBA5E246 DY/?B
889,534,778 *5C89B6679FF917966851FBAB9A187EDBFF0391E1 GEKANTEELD1234
889,534,779 *5C8B064D8036B833BDC854F20EBFC183485C507E GENEWITHIAM
889,534,780 *5C86E7A1D744F36CDD9A3CBF39D9F094C7076B06 E_A
889,534,781 *5C85EB86E37C08F3A842BC4F2E9EA7F31C7E1435 GERALDKRAKOWSKI
889,534,782 *5C8D110486D84EB6C180D36B7AA8CE5E8E1C3D52 geraldostaff
889,534,783 *5C83F93F14BBBA938226733BCF3BFF1D81EE8C49 EATONPORT
889,534,784 *5C862E8F62BF638B813BFE24F8D3AD3AB1036A85 giegagensed
889,534,785 *5C85D562EB1426C7ED19BE4E0CD8F892E18B6137 GILBERT.PAITH
889,534,786 *5C8D6E262A2EFE2A0F2AB79FF69AF6ADEF67E08C eddyterhar
889,534,787 *5C82E9C4F98D92406FDD24EA73EED74DF087C55B EDe)
889,534,788 *5C86685A77618040C56BF40F3B86E5B46F26C17B edkmq
889,534,789 *5C85E843637AC82616E0BE1C9B6FDF3D7F326F63 [email protected]
889,534,790 *5C8329CF4E349576372CB9AE4CC1285E2D0F714B EG{Q
889,534,791 *5C876B5BD620E0135D80E9CDDB8DC387A4A47A1F EHQI"
889,534,792 *5C821FE6DDAA11D3732D50FA2AF9F749A4E5B060 g)p)
889,534,793 *5C8DAF4A9FF5E8D2B719522094ABD84BD87D35C2 EINNJMES
889,534,794 *5C818B2CC077296ECDFB3CF16A4063C96923A4A1 EIWOTEAT9
889,534,795 *5C83CB811EAA72EFA98ACCC9866439DACE26C741 EJACULATIVE
889,534,796 *5C8586B75B19FD32517C5B58832B5287E4376587 ELBUODELBUOD
889,534,797 *5C88D7747F7DAEC405256E47F6E440A7981FCCFA GROBIKSS8
889,534,798 *5C834E6189D3DFC0E5D38F5FD76DE46CFBFC6DD4 grojsgold4
889,534,799 *5C87E5612CA22DF82FC9351A1BED9A2FE9FDC0FC ELINKEINOEL
889,534,800 *5C82C313953D503E907A79AAE1CDCA7369C46ED9 gustavo-dom
889,534,801 *5C80BDB4DF615065FFE2713003838E4DECE120D4 elroyrandal
889,534,802 *5C87BCFD1CBB3697EF5E0E5852FF5C1D5260D4D7 EMANUEL.EURESTI
889,534,803 *5C87E2420DF0643955631DB3CBB2C09C5B8B0EC9 H0M3R!N9
889,534,804 *5C8B3AFF4616E0C2B6FD8F7130AF9E9B0B22AE5B emmanuel.de.graffenried
889,534,805 *5C84114139DCFA0F7A088BD27213BD39B97F04A8 haleyzackseth
889,534,806 *5C878FE4436E7E2876460982455078E829DAA37C [email protected]
889,534,807 *5C8757CA7C3EF1C795FD5F9F4F1E1FE723DE6B63 harper985
889,534,808 *5C81444A4BD1CE3DB53A98EA34521C53C3093D38 ENTREMEVAMOS1234
889,534,809 *5C8642876BA1E555AB0E055910BA2C402A98AB79 hassangarner
889,534,810 *5C86A25E1E8A013891986A92FC9EDBA4DA61EE5D EOC8
889,534,811 *5C8F92D6181044E6C27629EA689B36E87101785B HAVE.VISIONS
889,534,812 *5C8850D54B4CDDEF452200C4AC532CD2250AAF5B HAYWOOD.VITALO
889,534,813 *5C83F7AC66A3631F84527EB5155E58735C952F26 HELIOG4B4LUS
889,534,814 *5C8A50E6E53F6997432BA4D12CADE0895CFE4D59 hellohe4
889,534,815 *5C8788969FB82D92437D2A396A323B3EA4994501 HEMONETTOS
889,534,816 *5C8D51B86DBED692CA1BA561C6FD667A99247452 he's-got-the-whole-world-in-hands
889,534,817 *5C8BE913D8288F2553938D6AF52F1DD2F9AD4F1C ERWIN-DELAS-ALAS
889,534,818 *5C804C35103114CC25E8224584A624E50A1EF726 [email protected]
889,534,819 *5C869D327721F7D5429A4DE477249D5F2175183A high-priority.h/aI/_pr/aI/'/A/r/I/t/i/
889,534,820 *5C843A1DC5AD9FC16A10A2FFE9433AA4667A788B [email protected]
889,534,821 *5C87413040097271316AB28A9C4E45575F185B84 hipolitocherian
889,534,822 *5C8DA09807451E986F6D92606A046FEBA6F4555B hiramsartore
889,534,823 *5C831CF5F3B8A229F7D956A4D2ACEB51E3C4FF67 HIROMASA9
889,534,824 *5C8BDC30C7E7A31FB073DE3ECC3602841A1A2067 HIS-DAUGHTER-CAROLINE
889,534,825 *5C87CE292BDB3F5D1D40C0318559D7E41C6CF88C HiT.HaRD.
889,534,826 *5C8E6476817F39A54D5C824A11B1899D4B67FE13 HNNANCY
889,534,827 *5C840F8DA55E4641FE93CEF32AD5A9EC11BDA1A7 ethanharari
889,534,828 *5C8144AEE982E4147A23B34E65F5591AB2811722 HOBERT.LOTZ
889,534,829 *5C8D2B0743C2760C2C7A03FFBB629D132E6BDB62 etinoises
889,534,830 *5C82B3302B4823B7D47F6A3141C5FCD7E5B36A38 eugeniotelle
889,534,831 *5C82B4379D6023C443F447E5D9D56289FC996443 [email protected]
889,534,832 *5C890265015C0A88AD40E4FBE6419E8965F539A9 EUROSTAR (SVEN V
889,534,833 *5C836A97D6CFC1350952A5D9ACC75189B0D509FB HOMERMARON
889,534,834 *5C89B1F71EDF956A28E660F1B370E67576915AED [email protected]
889,534,835 *5C86A1D614D7D50DD698D964099B4A6692797BDC EVERETTEJEFFORDS
889,534,836 *5C827A247D040A1044F3BEFCB57B20800F41C332 exaustwonder
889,534,837 *5C8FA4AA1A00DEB43E1AE4679EEC141C3EE8EB8F hotelnik8
889,534,838 *5C8352C0F89F6406B28BF7C2520CCE11A797B7D8 EXPIRERS
889,534,839 *5C8AB20D9F0091320A426810E652E76ED1576E67 EXPLODER6
889,534,840 *5C8565129C65D267C953A7DA6CDD8CE871D27F89 HTTPWWW.IAO.ORG.UKCH
889,534,841 *5C8D668D8441AE95AA970E3EFC1AFABE36C2ACA3 [email protected]
889,534,842 *5C88F1BC4E23C9879B36580B1FE7EE478CB789E0 [email protected]
889,534,843 *5C865B7B1DAA4D87D9F202484FC3CD8AAC9021AC HUBERT.DOMENICK
889,534,844 *5C8E4973E1B026B99C305ED5753B8F044F5C0B28 [email protected]
889,534,845 *5C8A49A5C3CBCA66EB830D06C7B3D2CBC297BA20 HUGH.VARAZA
889,534,846 *5C875916B76E760387177DBB470C44CD627A8D61 FASTASTRA
889,534,847 *5C88ED679F90275254766FE795C5BAF3EC2A65C7 FATZAALEXANDRA
889,534,848 *5C841B5555B0D200BFE2003AF4B919CE1149FD67 faustinoeredia
889,534,849 *5C8D202812AEE83D19B1BC98ED8533BC65AED0E8 faustobauerle
889,534,850 *5C8940BF7E48A26D1936D80663C2EC515B163E5A FCHARISH
889,534,851 *5C8AB5909C410F54D3A7D559E2BAF66097AAB6B7 feb1395
889,534,852 *5C805F888856BD28A67FBCDC3037DC4822789DB4 hzonspuwr3
889,534,853 *5C815439F5E01F14A06DD5DBD237FD50CF03967E fernandomanzueta
889,534,854 *5C8770AF22C006A82A41AA8F7D0BEFD9DCD1520E iamsamiam7
889,534,855 *5C85D3510830BCEDE861AF4944340D3C550D87F7 FISHPOOL6
889,534,856 *5C8E044BF4D7E191C7ADEC418A6CC3B6512EF76A ILOVEDUCKIE1999
889,534,857 *5C84845781C08EDE21C82B74D0952F04DC5C434C iluvbatmanqwer
889,534,858 *5C8A236186E498A1CDBD8F8649A1B5E0DEB778E2 FRAN-HAGUE
889,534,859 *5C8DB2897167090D98D387E85E9CC5B1ABB87F92 franklynmcdugle
889,534,860 *5C8C90A08754CCF11562996BD6167252B542BD61 IMITAREN8
889,534,861 *5C8092F1FF15E714F7A40E7E861FBB3BB4AF6E76 [email protected]
889,534,862 *5C82E5590530D82F5E005DA0429514CB8D9D8DEA FREDERICKHENDSON
889,534,863 *5C8383E81788012F49A3170391170CAEA4D98493 fredericpiontek
889,534,864 *5C80F1C4943A642A6A5E8C4AA899A463F850924B INDISTRIA
889,534,865 *5C8F91FCBD84D3AB2ED8599F7EBF08D5F1B77C5C frequentst5
889,534,866 *5C8943516AD8A051BF2D25509D5C252812C6BF48 [email protected]
889,534,867 *5C8D2B4466AB068E819ECC38DEAD19357C359B08 FRUSTRASSE
889,534,868 *5C84CBB39F8B73B34B907D54C872A46025458F0D INTENDS
889,534,869 *5C80F97067116A37C5728225106DE97DF8E6005B IRA.WEHRLI
889,534,870 *5C82B9E4BAADCCAA514ABADCEC11A38D8DB11007 irishsetter348
889,534,871 *5C84B08E25C669DAB1854092E1CADD8ECE4D1DCE irvinpotratz
889,534,872 *5C876807AB1D966FBDBB82FC1F72DF0E1AA22372 GALACTOSTASISED
889,534,873 *5C8A503EB8A6475E5C4B6B5AB7DEFB2061340DDC GANGBERGARTANE
889,534,874 *5C8D0342630EDCEDBAEA2E01D837015DF413A4E5 [email protected]
889,534,875 *5C8E6D0A405F0C5A0C8512EB691703B8C7E6E962 ISS29
889,534,876 *5C85E20A144BC3F33B0FC7BF0C46CBD39BCADBE9 gary.halvorson
889,534,877 *5C87E5E1B4FE31E53ADE3CA6A6CEB50095D4A6EE GASTON.ASCHENBRENNER
889,534,878 *5C81CB86E1D7344B11066CA9ADD89C71485CF384 gastroenterologic
889,534,879 *5C881AADAA72A6F848425EC26B8B3BF2FFC3086B GENUFLEXION1
889,534,880 *5C80209A78791C04C2C132CAF7737E9B01C7CA1B GERARD.MARKER
889,534,881 *5C8B4CC7CF22D31D11C3D37294A808DD43C48EC0 gerardodesruisseaux
889,534,882 *5C8B3273E3A6295DE41E8CE64B9A17836132FED7 gestold!
889,534,883 *5C87633F06C0DFB12F63B366F4DA1B9CEC6B8CE3 GILLCLARKE
889,534,884 *5C856A01C829B13CAE6C03E256EBAE811C44024C JAYROME1325
889,534,885 *5C80D5946876335D3B307C4D0B8FC8FC230CA722 JAYSONZAHNKE
889,534,886 *5C89F450906F88CDECD0E29FC24BB1B7FBF9D898 jcf:
889,534,887 *5C84DF5C826312D279C77248CC41109B6903BF6A GOLORVEN3
889,534,888 *5C8DF0DB2346CDFCEF26AD17395C728A0E8476F4 jeffcrean
889,534,889 *5C89B4DF84DC5F8BEC2FFE7C82AF0287370ED528 GPIELA
889,534,890 *5C832798B2BBED33A4588BB857976C514D671E2D GRADEPRESIDENTS
889,534,891 *5C830D1B9DCD08D7FB788E6BB43D99F4E1EDDE0A gradyplocek
889,534,892 *5C8922C5921FAD0F279748781E8E47E04E99DA86 GRANCHELLEC
889,534,893 *5C8DC21A84E1EBA2A2D0AB9C4F7065AA7C822FC5 [email protected]
889,534,894 *5C813AB22B5B08963E78C1B6744778E6B8845398 GREGVIED
889,534,895 *5C83CD78FE62F4CD464AD30EA693DA26BD94415C JESSSILCOCK
889,534,896 *5C8738872C88A0A02A3B6B1AE0612D465D2425A5 JHENROMERO
889,534,897 *5C87D55F875504F9952882DA9CFFAFF4962CBE53 J-I,
889,534,898 *5C89F1FC3C7027E89917029CE99F4A07EB60D9E7 GUENDOLE
889,534,899 *5C841002F78BABBBBB50980A6CB8A9E50B87CE76 JIMMIE.GOLDWARE
889,534,900 *5C84630DBA8435579BCB8F000A4CC30CD2A3AE35 GUMBLEY4
889,534,901 *5C814ECEB53156EDC08A5725AB504B54B08D7D8F JJBR11
889,534,902 *5C8F663B179005165DD007FE3BBF1B22496B83D3 [email protected]
889,534,903 *5C8E8E05BDC890D59571914CC71714B9F3527E95 jocay
889,534,904 *5C8A2DB3677C187C0E93AE715977D03B86F34217 johnathonknie
889,534,905 *5C8D9FE6F8280B37A7341F5E3C43DAB01FEAEE06 HANAKOYE
889,534,906 *5C88105692C9CBF3A66F1DE8FD22B294FFA86371 JOHNTHEREVELATOR(RENTYSMINIMALCLUBTREASUREMIX)
889,534,907 *5C821354D22F9B6E7DFC115C7427959DF9FA50D5 JONASBORGUEZ
889,534,908 *5C833F3701FF7285DB6B5607CAEC2099B49A5103 HANS.HEINEKEN
889,534,909 *5C8A69550566733866F75BD7DD554DC300BA2497 HANZ214
889,534,910 *5C80D4E9CEFFA05BB1E3524043B118B9AAC8DD45 HASSAN.ZAYAS
889,534,911 *5C83CD314F40D15FEDB48DB700E21CE9AF11BB1E hat-related
889,534,912 *5C8F3332FECAB607DA41A45C6E2A3218A76E3F65 heblem
889,534,913 *5C8F7C9000691B3D03C4D8AC8F9CB8F1A5D1C90F JULISA JIMENEZ
889,534,914 *5C825A416C93D4402BBF86A6B49250D7D19C2498 [email protected]
889,534,915 *5C8CD998BDDE6C60F6B75CBB0E66F5167F1AD143 JUNGLEMESSAGE2MAN
889,534,916 *5C8A0C599E9EC497096C0CF34674D0E22BB739EE JVERNELING
889,534,917 *5C89B60FB5D89DDCFC9118E61C7EC40FB9FB955D [email protected]
889,534,918 *5C8186D6DFBEED5173E3FC129DB3D8BED0034148 jws4kr81
889,534,919 *5C80E1DE61971EADD8112DBF8309A6BCF6BE91DC KAANONITING
889,534,920 *5C83D83EBDEBA952DA43363BF4BA08FFD0856CD6 heyalbum
889,534,921 *5C8C418DEF6A2BB66CE1A681DD5BEECCB5B6BAA8 hidroflumetiyazid
889,534,922 *5C8272F309FCE6DC9228CCF372540B8B2A83C703 HIPOLITOBLEEKER
889,534,923 *5C8B69C2DBAA0C4B5156F384D78928A0DADAACED KAREEM.BASTOS
889,534,924 *5C84FCE7239053E7127D3D29D3FA5D9999F2D730 HIT.FOR.6IX
889,534,925 *5C80C9AD153AE54E214F569BBD9963462DE86DA6 KATHY-SCHOLZ
889,534,926 *5C8909C2D6FAA00F9DA478A90197736A5EAA20F8 KATIE-KOONE
889,534,927 *5C833E3A5C897F60C87FC2F7F7FF3A7712A9684D HOLTONCUMBECKERING
889,534,928 *5C8FD4226589438300927E8C364974C9BECC3C31 KEITHBONGA
889,534,929 *5C85E0D1E2B1AAD8CF89FFC61C3C1183F177BD2F KEITH.LEAVELLE
889,534,930 *5C878DB18F59B0D5E7ABC098FCC724074521608E KENDALL.LOPEZ
889,534,931 *5C8315491439E149658511A60C5BC937FF677CED hpsdrews57
889,534,932 *5C81929342C28772FBA04A997DAEDE94F98FB256 [email protected]
889,534,933 *5C8FF09ECE66B70B740310F38569B24AE317DC81 [email protected]
889,534,934 *5C88E401A7468FC2C2C10B7F2F082637D8FDA8DD hxij
889,534,935 *5C8F713554D6333DA64583CFCCBD00CEAFA38788 [email protected]
889,534,936 *5C88208144549E9B7B1C184999BEAABBEC3DB4DB KLAUSB
889,534,937 *5C8D379F4B256CBE2F93AC384417670A2171D5A6 iamshelly1996
889,534,938 *5C8E0535EAC45342A985AE693B306E2B4E8DC42B KORSANLARININ
889,534,939 *5C8D4E5EBEFD2F2200C3EFE4D7CA81EDA995AD6F IDEXSHRINE
889,534,940 *5C85F63E3CA590AF575861877A444A9110172821 KP6C
889,534,941 *5C88C2D47A4D144ACA1D3B341F139164CDF02C8E KRYSIEWICZÓW
889,534,942 *5C8C39973114C904F858FFB67F91C130EC0CCC28 "Il.duello.amoroso",.HMV..82:.IX..Aria.(Daliso)
889,534,943 *5C84013422C2DDA67A8A890E55CC7DD93C7C0EA4 kuninoki
889,534,944 *5C8A2050D9F4458DA5335DBFDC03575C9BA195CF ILUVBEASTY01
889,534,945 *5C8CAC0E8620E01A49F781F45DBB126898124CED ILUVKRAMER45
889,534,946 *5C8B16BD1F9E9309479400DFB421072F7F50FB98 KYLE.REGULA
889,534,947 *5C876A2BB0CC69EEAD6792BA6415200DFC77E9B7 IMMUNOCHEMICAL2
889,534,948 *5C82FF8FDB824E960AF00743D909DB276C98E6E1 IMPROMPTUFROMTHREELITTLEODDITIES
889,534,949 *5C8A22B8795985E8A121E80C159E8C2AA61EFF65 INSERTNAMEHERE10
889,534,950 *5C85C6A1A7986311B4A9E7A8F18D528C3F2A7464 [email protected]
889,534,951 *5C8816166A8B2014793346EA0D3ACACAAA1D0C6C iozitim1
889,534,952 *5C850BE08EFEA3EA5558B7F0A9A59583C534C335 [email protected]
889,534,953 *5C8442208A47C8D7A9E739BD91830701D7441B6E [email protected]
889,534,954 *5C8CCC2F52B507EC597E9F9A2BAB481F483A56D2 I\]S
889,534,955 *5C8497399950988B0F3E7C767C6EE94AFDE95EA1 Ledisque-jockey(Beam&Yanouremix)
889,534,956 *5C83E5BB3C0A67CCCAE7348F484C5B802F36B9B9 lekkerl
889,534,957 *5C808453D171AE1E62D8B9CAEFBDB45D9CAF66F5 IVATSOPS
889,534,958 *5C838A26CF4C25617036D4A3C296B0D738F178A9 i-want-you-'98
889,534,959 *5C88899926481625187689C04ECBBC4D8C4159F1 [email protected]
889,534,960 *5C88E7FE533AFBF5C200D384B333EB9863B148FC jacobfeagins
889,534,961 *5C87B81D194C16EAAAA16DB8AEB2973CE80E8F5E liberty30
889,534,962 *5C8F2CD6362CC4CDE9603F18CF86AEB5525FB632 JAGADEESH.HEGDE
889,534,963 *5C8DEF84343312F715A7F8C37F76F6E16E274419 LIGNLIGN8
889,534,964 *5C8F47BDAF037079C6F622C051B718CF53F2FC25 LÎILLOIT
889,534,965 *5C8FFE44F066C150CD2F36374D2CCAEEDC1F6D8E [email protected]
889,534,966 *5C87A375C399F921FEE4AE2353C714260BBAA6D5 lindsaysosnowski
889,534,967 *5C8378536873AD81A63648E99A6F861A1CD30DCF [email protected]
889,534,968 *5C8EE274277D3F1BEDCDA1BCBA9261D3A481AAAD [email protected]
889,534,969 *5C805C44B6D9DEEF047B9153F8DCE868A811CFC4 LIONELSEVILLANO
889,534,970 *5C85D9B100599B911F28D17C89AF422A8BC0E6ED liutitang
889,534,971 *5C8475F38DFCEC7E4C102767D748269E9A138C67 LONNY.HUBBELL
889,534,972 *5C8092F74E9C4D1A7BE844049774A379F40521AA JEFFREYCHARVAT
889,534,973 *5C8FD093370134154E922106EDE2C453D73BF815 LORENZOLINEHAN
889,534,974 *5C89E1046D590C94276E401D96C0C117E79B67EF [email protected]
889,534,975 *5C8C9EEEEB7BE5A35EAE946B018AD0C1903FD9D0 [email protected]
889,534,976 *5C8C1B186BB6C88B330F5DEB2B0800622879C39D LOYD.FRYER
889,534,977 *5C840597D8D9E73175CC50A1AEDBED04E8B96AB2 JEROLDSPATZ
889,534,978 *5C8C6BFAC56C4211AF79DE27EF973A1D3780A224 jeromelada
889,534,979 *5C81ECD257C9F913E85447558DD4A3F2118EB21B jerovon0
889,534,980 *5C8938AF2B5FD23B2E3F0402237790A4670EC2E2 LUCIUS.QUAVE
889,534,981 *5C892BF2ADF9F7F59D5F7A1552064A920AD315CD JEUGDCONTRACT
889,534,982 *5C8BC29E13F7C5DD35D06A7D3A017A5A974537BB JEWEL.LEMOYNE
889,534,983 *5C8E9F8A953B0C430862BC38918A7564EDDDF022 [email protected]
889,534,984 *5C8D75CDE097136B3DD843236F37EE960E6CA032 LWS5195
889,534,985 *5C86BE4904DB95E7BCC901A934EE37CA6258699A joelhockey
889,534,986 *5C887D7371DD0ABAEBC2E93C40D613ABC7D4845E MACKCOLABELLA
889,534,987 *5C8FE3494B05C481FD02721D05F50E1DF7FE288F johnmichelle
889,534,988 *5C8D0F989177E36B507819EFBBB499C2B877D148 jonk.pambudi
889,534,989 *5C81EA391FEBB5342F8F913F18C67C1F49044B50 jonshock
889,534,990 *5C8AB0CB44E2ED04FFF69291F0D6A3547D10497B JOSALIER
889,534,991 *5C82D02F1C51FDA92402C5F9E184BB5DACFCC98F MANDOUR6
889,534,992 *5C859544A3E6DBFB1299D1C130F111EA72BC323A JOSEFBRACKNEY
889,534,993 *5C8EB4159189E98A838DE617623FA831A19E4351 manualklepfer
889,534,994 *5C8A3761BB8498774A597C397A140705E3F4595D MANUAL.KOPPERMAN
889,534,995 *5C81ED892A8CA8D62555F47F276A96F2E7D41BC1 manuelkierzewski
889,534,996 *5C8B994636A29A750BC06E881D94FA2EF885872F joshuaaustinbailey
889,534,997 *5C8E425C842AC527B2C03D2912D77FE49133A0D8 josiahtyson
889,534,998 *5C8325DE9BBF08F1CA9E57BACE816E96B9A19D35 JOSPEH.SWANER
889,534,999 *5C83AF209B4665A4B782D1FDA2F688438CCB4880 [email protected]
889,535,000 *5C82CD36B605EDF4143A40991412BFEDF130281D j<!s
889,535,001 *5C8FDED8D65F37A40AE8787B703EC0BBAC08441C JUDAH78
889,535,002 *5C8A3EC311D8F38F8A0A88C897E0C2F2A6B7B1B4 jul\
889,535,003 *5C82F565761E41F0421A1FDCD1B27DD108EA8918 maurasses
889,535,004 *5C8D16B52F9773601DD862AE2EDD3C479BA083DF KAPELLALPE
889,535,005 *5C841DA7290183C15658849615DB586117E2876D MAURO.SPIRITO
889,535,006 *5C85B5122E3CFF5658262B969080683793ED546A KARI WELDON
889,535,007 *5C88C826DC836938073813A8923A62D8769081A9 karmiohl5
889,535,008 *5C85D62242B0DF6F37DF991CC32774B646E02F9A meibloempjes6
889,535,009 *5C898F5B278060F0FBE1CD65941C320DDE700E03 KENDALLBERMEA
889,535,010 *5C86DCB319FBD9D4BDBBF9AB4D2B69723E18CD20 [email protected]
889,535,011 *5C844C8B20856FE593BCD359769CE605041B4E0C merlinlitvin
889,535,012 *5C8DCEE38BC3E47B6526C01C470A0DC6C0B26D4F KENTUCKYTALKROADS
889,535,013 *5C8B82EC1849A6C56C671DAD7CAEB6D699381EC3 kertabhumi
889,535,014 *5C883F45FD325915B9E8A6111CB96FF167EB4095 khishann
889,535,015 *5C8CDE441946B88201F98C909B6763A49DB88C40 KICK.TIME.SUICIDE
889,535,016 *5C896FFE502D7F8C0E860AC5ED6A3C1379446ED7 KICKUPS
889,535,017 *5C89D78811BAC2ED9D548164FE0BB585156152C2 [email protected]
889,535,018 *5C867340C508BF29FFDF9541F37E19959FA803AA kiireellisyysj{rjestykseen
889,535,019 *5C8006EA5F418A41B05CAD2682EB9F85BDF3E210 MIHAĂLAĂCHIOAE
889,535,020 *5C84CD1EA4DB3B7C9A6B6CF0D7D613356029CD3B KING.MORESCO
889,535,021 *5C827A94906299DF6FAF5D254402318D5EF11DE6 MILO.7
889,535,022 *5C8BCFF5B3CD9DA142B5BCE208EBB1E367420A02 MILOAMELING
889,535,023 *5C8A888F6CA5B3A73AEFC019B505D9787B15F352 MINH.MALLEN
889,535,024 *5C807543993FF092038B4CEB43DFA086770256ED [email protected]
889,535,025 *5C8D312701BBA7863DC80AC52223BC360DE22750 MIY4H4R4ST34U4
889,535,026 *5C821CC82334B94E5B4C9F547985304688803155 MLG"
889,535,027 *5C8402B1080D1A03E98312BC248A2E2F04162300 mohananandamaharaj
889,535,028 *5C83A668E808BC256EAA7675149060A12D373858 MORRISBRIDGE
889,535,029 *5C8A4067372230AE2BEF28B8AA5D10ED905A7718 MOSE.VANLUVEN
889,535,030 *5C8E9994357D0E3168F408C9022630E08E26B705 MPLNTRNS3
889,535,031 *5C845898C0EE5DA29B719F602A729299089C2E88 lactagog
889,535,032 *5C817D9E624570588C2B704B8B5FEAE20CBD017B MUQ5
889,535,033 *5C8B2554D7B289A14FA822EE08EE16574FB3AEA9 MYLENE-MAGADIA
889,535,034 *5C8DF65E955A014E033434781893B104B342A315 MYLES.FARNES
889,535,035 *5C87FF48066D950B6BE7C461076E05355959ECEE [email protected]
889,535,036 *5C8AE0045E643E1EA12D81D22933D79D4228D49E n477erin9
889,535,037 *5C87ECAE72A094F9DE401A56228543AF33DA686A N530725
889,535,038 *5C814E8C3E041D70563EF0E3FA60E5D22C73FF7C NAEIMMOUSSA
889,535,039 *5C864C871580A9BBC4CB680F4FFA5A1BA6CB08CA LEANDRO.PLYS
889,535,040 *5C83869665A8FC33B63552AC50ACD2004D1BDF15 nalers
889,535,041 *5C86CD15A393EBC645339A789EF10B58B46A8438 Leider,-Op-47-No-1:-Botschaft
889,535,042 *5C8DF8B4BD1491669D11C001762E9A9C5373BE8D [email protected]
889,535,043 *5C8FAA3BA206174E2243E8EC5B69F12FC6BEA638 nathanaeltalboti
889,535,044 *5C8498BFBF68F8DE13B786F8A6131E525854767D lensethiring
889,535,045 *5C850073CDC6C621FCA498BFFFDCF89CC22A7CFB LEOPKNITS
889,535,046 *5C8DE0E2D393EAA5DF71AB30DF03F90D8F065AD0 NECHOLASC
889,535,047 *5C80EC86AF13425494487CD614356FD191EB3994 NEDLEHSF
889,535,048 *5C8D71A4B7131D5641F82A4CA78919A5DF4A930C LESLEY.POLLINS
889,535,049 *5C8481F6F9D68CC075463322A9753766E446B9CC LEU----HIS
889,535,050 *5C805B31AC1918123C323A92148BB9B40F3C313C NENOSNOUED
889,535,051 *5C87A7E49760397E12E83B7581F758E51FBF18D3 NER-&-TTWIP
889,535,052 *5C85987907184AE54424899DDCB93832EFBE7EEC lifeinfreedom
889,535,053 *5C88531A4D6DA22847198612B5E58FC1A5818CC5 ngfayen
889,535,054 *5C8BFF279DB33B9C9BE5634F29CC6ED9BE7AA4A1 LINGLHOF
889,535,055 *5C8E6B2BC19B1812CF8BE11A60CD91381F13A884 LIOABDI
889,535,056 *5C891A7996C5A8AECCA347F6249E84DD2D74AB3A LISTADEEPISODIOSDEMORKDELPLANETAORK
889,535,057 *5C85AECB1B05F645D42BACBE5A4AEB5EC5E8082F NITCAID2
889,535,058 *5C8C68900DB30E6CA9E328600FEB49ABD95CA672 [email protected]
889,535,059 *5C8E8A9B720D96DAC30395CB13C6B64308E8A988 [email protected]
889,535,060 *5C80AB57822D80AAA07A85B7B780392131E8C33A LJFRASTAED
889,535,061 *5C847B2564432B933C00B9525F11258021A3F739 NOELHARTING
889,535,062 *5C8C4F881C9212339A5C629597E0F71402B65373 noellakowski
889,535,063 *5C8F1BD19544CB69900C84705F278E44E37B3CB4 noisrem5
889,535,064 *5C8EBB3B09C249D04DB250A8BFA9B98AA9DFA809 LOSEE JR
889,535,065 *5C8FB86EF17076F67847D50B335598D82F879002 LOVEJAMNO.1
889,535,066 *5C8FE256A4635239B8F81EFF14419EE0837F9079 NSOFERREI
889,535,067 *5C809127417A3592EA0D03F5C971A06592787AF8 NVUKOTIC
889,535,068 *5C865FB31731DD8B611AF40A2079C4D149180527 LUIGIKUCERA
889,535,069 *5C82D39B5F961964F11DE9AB575A451ED92C6EF0 LUIS-GRACA
889,535,070 *5C8C9BB9F572974FCC37C0B2EFBEE53FA6716F8F LUKE-NORBY
889,535,071 *5C88C44C4195E69D84275950BE4073BA81E5DE9C LVEZ
889,535,072 *5C853BFDF4517723AF47DF2DEBF73ED5DA2CAC2B M1OB
889,535,073 *5C86C7CC290256F052DD995D1FC861401AA1CACA MACBARRY8
889,535,074 *5C8925CD86018F050ED28A3B27F482229D35FE1A macduff he is already named, and gone to scone
889,535,075 *5C8027CC9D57F04D78F1BD9B66BD808156419088 macksivert
889,535,076 *5C8B0502260D0498C6691694AD58F3A85B98E98C OILMANEDS
889,535,077 *5C8994ACE632CF99D7AC1B3063926445C44B855D okaying
889,535,078 *5C82B5EF63F135DC3F2DAA4E683090C7B6844543 MALCOLM.WYROSDICK
889,535,079 *5C883E54D79E8AAB346A15FEDF8F6A4A797D0A03 MALITAJ
889,535,080 *5C81F3EF19A6478385D92DA94660F8E46B6F1581 MAMOSTAPIREMERD
889,535,081 *5C866892040446A31C482C40EE92562A41E61BEC ONROGAN6
889,535,082 *5C8EC328D390B6DF44312939FF3A2A97F53FF9B7 ONTKWAM3
889,535,083 *5C85FA4E650B6FFB0122032050DAF82E6296BF11 MARCOSSCHNURE
889,535,084 *5C8ABFF73A7E92127BD76BE7595B21A4AC5061C8 MARGARET LYNE
889,535,085 *5C8C22D45581DC36EA2A3D46A32A7EEBB1B72171 [email protected]
889,535,086 *5C8CF2DD914EAE006670130578E668C288BF957A MARGIE-SAN-PEDRO
889,535,087 *5C8320E923957FB6195FCFEE52878647C1F1E67E MARIANO.INGOLE
889,535,088 *5C8F7957BDDC5AA7A90F769FD5C17C2DF8FF0D23 ORVAL.DIMAIO
889,535,089 *5C8840A6ACAA863FF8E60CE460B601FC45C72F21 MARION.TAFURI
889,535,090 *5C87BEFCDBC6643FB29DB6C404FD3C83D69145CB OSCAR.SPURGEON
889,535,091 *5C8C917B560DEB607C12CF2B89CBAEFD2E70EDB7 mark.reding
889,535,092 *5C86650B6FFC132CBE96D247A91DAF71DB269823 osvaldopurple
889,535,093 *5C80A40E7679E7ECB1EFDB979542F60E73FB1A4A O#TB
889,535,094 *5C865B76A00F0BFB5657263B3611D45D92D3A15E ou7$p3ll
889,535,095 *5C81B2DA58859FA84FAEDE60912861C876831F61 overhover7
889,535,096 *5C88122868D4A5931E7BD6DC84B5E5F0D1B410EB MAURIÇÃO
889,535,097 *5C8B905563DDD6F6BD3A462246D670164E147961 p==>~0 splat
889,535,098 *5C81DDFD385DFD5427D7864F77DF9E3AE153E434 p53udoh!5tor!c
889,535,099 *5C876BCEB199602B6FE8B066FB20200059890D3B [email protected]
889,535,100 *5C877A7E886B98606ED7485CE991F6A3CF232F9E mctygue
889,535,101 *5C8C7E268B3A178DCD184CB84D9EB6B1ED978A62 MEGAN UNRUH
889,535,102 *5C8299CBA63C4416E8EE45E084C6A9238D470CDC megoldasa2
889,535,103 *5C89A91F6734138300AC5AEE56B258D669CC8DD2 parrottequila
889,535,104 *5C8C7112EB089F3476C9AA6A8D52B6602FE3E8CA Pat-Edwards
889,535,105 *5C8AB22DFC5AC4FF2F8050DAE329A0B4BE21E483 Pavlica, YasKaz
889,535,106 *5C8024EF3A3788CCA1D7F01CCA59878ED87FDAB1 MEZALUN4
889,535,107 *5C85CD8AE04F7FE7BA5883322447B2600DAB671F mha-t
889,535,108 *5C8970F77B695DDFB365E749DBE87BA1A290B730 [email protected]
889,535,109 *5C837E351208EECC574B8C7DBEE723A467A395BA MICHEL.LAREW
889,535,110 *5C8EFC9E9902B417D2150A25F9C0E737B8E20206 PERCROLPERCR
889,535,111 *5C8EBEE8A6AEF9C94E8D1986B51D3D693B1B4692 miki.katz
889,535,112 *5C81C780FA9F4372098706AA8281ACA904D6E6E0 MINHAMERINE
889,535,113 *5C89C83057E1F58296F538750D50FC2F64D8751C Phantom.of.the.Opera..Phantom.of.the.Opera
889,535,114 *5C80ACE4787FA84AA8BA44F8AB59098B4EFE2AC2 minhlerud
889,535,115 *5C8925641B447EF902EEEC7F9EB3E58BFD404C01 PHATSAV
889,535,116 *5C8715DA8525F1B6BDC9F1673C61D5F9F9D3E6DC minime26
889,535,117 *5C88DEA8798FEE44668F29133DA8D4F666A67796 phystodayobit
889,535,118 *5C81C8469A9B8DE72024CAFA315C575495B421CE [email protected]
889,535,119 *5C8BA3912F8059F8379D9FB209EC088A9A3C95F0 PINAEAU
889,535,120 *5C8190A09889B1328FDB56B27C53DEC9ADECB677 PINKERT1234
889,535,121 *5C8EE1858EEFF05139D61ABEC46EC884BA9A376A PINKING
889,535,122 *5C8C76D5378839E8456A8BB858665EE2166CFC2C MMXDAA
889,535,123 *5C8A6C997A989951150189C30EE89A8320199D5C pishvaie1
889,535,124 *5C85935A934369828A57BF2EF908124428A531B0 MOONIES9
889,535,125 *5C849DF398F67AD15AEC91A0F747A1E76429A4B1 MORGEN-MUSS-ICH-VON-DIR-GEHEN
889,535,126 *5C847119AC360A6AC6A46B246D7441619A6F1134 [email protected]
889,535,127 *5C878018E08A2F38C82B4A66B9C702A48BCE907A MRCVARITI
889,535,128 *5C828FD430580FE810F45FB7CB667ECFBD42B843 PRAELUDIUM.&.FUGA.NO..4.CISMOLL,.BWV.873.FUGA
889,535,129 *5C8EB998434004DDBF21112A96B9D002B5285D7C MÚSICAIAN
889,535,130 *5C886AF2E808227B0CE45EB97165A4DBDD7EDB6F PRAKASHANANDT
889,535,131 *5C8E44B10973E6481C6B4301C4123DE8C2969156 PRATIKMORE
889,535,132 *5C87B002AA0A09050E8CDB8734A2307D984DB27B PRIMING
889,535,133 *5C8B20152847D23063FAA15BC5F1A32E7EEEEDAE [email protected]
889,535,134 *5C8E523B70F7A0C98D6A4D02692B232FE97F4417 prywatyzacją
889,535,135 *5C8EE3EBB6224F53D55DC5269ADB98D6B09123C9 p#@.~.`)x(
889,535,136 *5C8FF9B9F2B29F852CC5DDFCB4AE79E3C4596834 ne-castro
889,535,137 *5C86CAEA36E2D6A7055AF57D29DDE9E237D15938 q===B~0~oo->-<
889,535,138 *5C80B85255E89604D5EDBAFD85DD3CB5E88C8249 q----b-~o)o(
889,535,139 *5C8C05C051CF5CA6D09FD29A7514DDC90E00F117 NEMERGUTH
889,535,140 *5C80A6F67AFB5ABBE0B59D1C0FC0DE6A85B2BA7D qko
889,535,141 *5C8E5A626DCB1D342238CF9A83074856853891D6 NEWORLEANSMETHOD
889,535,142 *5C8F18F27F17AE0726160801DC5CAC155FEEB4FC NEWTON.FRUMP
889,535,143 *5C84D92494B49FDF0974B8B77B9A241F0D2CA923 q.u.hectic
889,535,144 *5C86B222F40EDEA2966EFDFD9C6BD2EFDD2371C1 QUINTONCAPEK
889,535,145 *5C895326C82AAC4637570D9B7F20D94F75B51C29 nicseroulf
889,535,146 *5C8036B899A14CB2C1B9CDA50D3DC5B0612965D5 NISSIRMB
889,535,147 *5C8B04BB0763B3EEE18D5302B9A05633800432DE RAINA482
889,535,148 *5C849C386965E22068BC2CEDFC2416342F0D4E79 raleighmavai
889,535,149 *5C87E9F2720A070222532881F385046D962B6908 nnautica1
889,535,150 *5C828060ECCE8E809FA8742972F3ECC125EE1097 RANDOLPHVARENHORST
889,535,151 *5C846C8F63B19221461BF3E9E1A54E7DC2FE49B2 NOEUSOIL
889,535,152 *5C88232E2BA423C576C5155438623C3EEB4D6255 NOHOALTERNATIVECHRISTMASHOLIDAY
889,535,153 *5C894BB0A45DCF97903F390FDBBB10A49E22AEEC RAYKAMM
889,535,154 *5C8810116B43B8C9E2E52AE2C6EF2E5CB521FF21 RAYMONDMAZZUCCO
889,535,155 *5C862EAD884157BDA2DD77122C7CCD64A8AEEC76 NORENA1234
889,535,156 *5C81E0FAC43CF1702F24C9D154CA4C88DFDF610B RDELAKTIGE
889,535,157 *5C8D251B0AD283FACC776A51AA32AF677A4F77FD re0n644wu
889,535,158 *5C86652AA88F1FFF7D44E1DC04E6797BC0A21991 NPNWUNNKNFU
889,535,159 *5C8C88ACD258B1F2072B1CA62F21BE764DC8A73E redadmiral's(gonnapassme)
889,535,160 *5C82C54808507778F30223CA404F0D8E8CC31C31 nutsonmarsbar3
889,535,161 *5C8DB038E4668D83DFDB25B77C1B27F5F7268889 REFORTGESCHAFFT6
889,535,162 *5C85536EDE78F095847AA32B10FEA49637A6B64D O0VB
889,535,163 *5C8818B74C6FFD78D40F04D5B445B674C7B0798E )O(***D----8
889,535,164 *5C8F54FE84206978F15EE204E27C22E86EDFCA1A ogerius
889,535,165 *5C844CAEC0ACEA007014554DCE917C494131B995 [email protected]
889,535,166 *5C80834B233C8FD285A98D245403D163DB46C2DC ointity1
889,535,167 *5C828088C51C04D6C08DC1599171564224E5A2DB okotie
889,535,168 *5C8804C9D80516EF1D88D581EB5262DEA58C9082 RETURN TO EL GUANTE'S HAUNTED STUDIO APARTMENT
889,535,169 *5C834ED76CCE0224ABD66C955DDA233021139045 oms5xji7ba0c
889,535,170 *5C831604982144A1BDD040510F8F7405A4C5B5B2 REVOCABILITYS6
889,535,171 *5C882EB3C0B7908EAB6F4A47F9789A81AC3C14C9 )o(o~ 0~ (8
889,535,172 *5C8B4FC4A45844ADF1C355C3258C106F9207339D RHETTLANSDELL
889,535,173 *5C8A8438A5CB94691FEC25B97E8DF92E6E69CD18 opussexy0
889,535,174 *5C8F401D142046134FB843F7DD647979F623895D ricokubeika
889,535,175 *5C8AF79655DEFCCE6362CB060F9AD99F1D1029DE RIDICU1ING
889,535,176 *5C8A85A468A84B0A9609B2C1E3BB2AB272975D3B ORTATAS
889,535,177 *5C8D1CE5C04FC67A955E6285DCFCA8CDC55254FB RINALDO-DIES
889,535,178 *5C86F700BD66D32CFE750653EBFD8F1A7059F57A OSC11O9RAPHY
889,535,179 *5C8615CFDF1C8B3EC66AF8A645EDB8C929A05DAA otgotynyhbg
889,535,180 *5C86F551C168A0E5E512C50EA42B4695DC52A7DF ou7d!s74nc!n9
889,535,181 *5C8D6102C464CAC949F400F1CD8B0AB201B6831D [email protected]
889,535,182 *5C82F394773853BA1781C3BBC075D10C796FBBE6 p1ot4g3s
889,535,183 *5C8666E2F4AD7A69907C9FFE1B3D901BE5CCCB42 rolandhovanes
889,535,184 *5C82E00ECD9138C554C694E581292F60337CC907 rolandostling
889,535,185 *5C8B67D4B0D4E1A4A1200BD16712E6DA13041177 ronnieberryman
889,535,186 *5C84E4B5A78A603011039416F243E54629AA041A parcae2
889,535,187 *5C8DCF459CD55EA4306A02E4B782AD95D598D856 PARKER17811866
889,535,188 *5C84EA58C54EAB2F8419AE95A1FFE8FCBB1E81F1 PARKER.HOMRICH
889,535,189 *5C8F0B7B0A8CCDF0F69B9ACA1E29B99E10954057 ROSE.SARTE
889,535,190 *5C8062331CA91889A7187645C56A76A9DA1856B5 PASQUALEELL
889,535,191 *5C8E11A47B8E4C5C3238CF596B2D36008384D65A ROUNDCELLING
889,535,192 *5C897283F633058B86D17CF2443739A1D85F1D9F paulandying
889,535,193 *5C899A7382EA2E83D79F461A7A8A19B05348DED0 [email protected]
889,535,194 *5C8B8D39399E31DAA12B8579B399D5223BDA3BCF peachesblaster
889,535,195 *5C85F5EB7F5963C9A645D1A6A7755CE9A9652B3B PENALTIES.
889,535,196 *5C8BB154F98BD2A304679E6AD8D408215CA05694 RUDOLPH.DEISCHER
889,535,197 *5C83E95258475730EDA4218D75E017F0825CEB28 RUFUS.ERBSTEIN
889,535,198 *5C8DC05617EBB378C88D305ED4DC686770B2319A RUFUSFROEHLE
889,535,199 *5C81E9B3D68B8167579F9D3A65EE5608ABDE90D9 perton-first
889,535,200 *5C8768E016E98AAE55661C395FDBE779AA9FED65 PHILIPE MEXES
889,535,201 *5C87A5E88952684BD0E30B21DA44C22F62889696 PHILLIPKELLETT
889,535,202 *5C8EB2F45EE18D4B287FACF43DE664B69236E6B9 PHILLIP.TRAICOFF
889,535,203 *5C89EB242C879D005DC49CD5FDB76E984DB1E4F3 RZ4
889,535,204 *5C83F8598EC457567674ABCDCDFE37DFE56501B4 [email protected]
889,535,205 *5C858B57226823C088B3FB4B7D5659827096C110 PINKING
889,535,206 *5C870D8B0CF3BC4DEA9B8AA05327CDDC5266DECD SALAH KANAAN
889,535,207 *5C8007C510DA6E59FC8512D7AB98BCC2EB052E1C PLANTENKWEKERIJEN7
889,535,208 *5C8602246D8BAB7E6CD6EBD22ADCBC021AA2E96F SAM PERSSON
889,535,209 *5C8AC6967E3280BA0B3069D675A1E9BBD8AC88A8 POESJE87
889,535,210 *5C8DCFA9ED40B795A2A1506E8ADAF066CFACC0E0 POETINRESIDENCE.1
889,535,211 *5C837BA02D3E038C0362196C656661F56B41C541 [email protected]
889,535,212 *5C865BD62643C869FE6675F6D25B103DFE604D87 SANFORD.SALVUCCI
889,535,213 *5C8269E393828E54166285FF5BDA534857689B2C [email protected]
889,535,214 *5C8DC0E3A42A8A6BCC5B23B08B0E6F1501D224B4 [email protected]~o~osplat
889,535,215 *5C881727DA4323F2DDADD27F85D9C0C5DF36B171 [email protected]
889,535,216 *5C835ADB8AD865BBB82B3F5C76F174C36E6BAD82 p====p*-*-}o{
889,535,217 *5C8B78F16953CB9844E367B42785DE4ED142FF92 [email protected]
889,535,218 *5C8D03F99A20A52440A2338694C542AC6CBCC17A [email protected]
889,535,219 *5C8520EFE2FDD823ACDFDAE5DA61CDD7BC4559A2 SCHELDERADEM
889,535,220 *5C881FF1C2C0877F8E6C6225986AC041A278B53F SCHUEMANN3
889,535,221 *5C879D79B5826FD5E289A21FBA06A8034B94F51E SCOOBYDOOUNMASK
889,535,222 *5C8D99F1850A0E0F88A6D2962C722CAB4E0E37DD princebierle
889,535,223 *5C85ADC29C13E406445160307B0BA39D60A002F6 prince.zikhali
889,535,224 *5C83A700917670B4F53991314B52F27390EDFAD7 SCOTTYWARNICK
889,535,225 *5C8DD9BAD62E17A1836A56E64E59D213F8CF8B6F programmatic p r aa2 g r ah0 m ae1 t ih0 k
889,535,226 *5C8AA52F378CB98F0EF7902551E116F8C09024AC PROMOED
889,535,227 *5C82304BA04527FA6CC41D999569E0DFCC06A994 segelflugzeugs
889,535,228 *5C837670209400E16EA10CABE16A4EA62077BFF2 pVP
889,535,229 *5C827EF5606EC6C4104634DBE93208ACFB33FA3B SERGIU LUCIAN
889,535,230 *5C8FC6E0BD3AB450BD7F5AB670DD292799674F7E SETHNEWSOME
889,535,231 *5C8F8C2EC73CC3D2BDD88D99D2C95F39F449B882 sewages
889,535,232 *5C8EB179A107A4C52BF2B8A81533538D7A9447AC SHAFQUL
889,535,233 *5C879BB5AD4623042B807A4EB3539C882C32C5DA [email protected]
889,535,234 *5C8E66BCEE96EE6EC95ED017C441129B59F27700 Q##@~O~OSPLAT
889,535,235 *5C8C42045A9321C4903B5F3D8FFAA0BA18A026BA SHAUNDELAGRANGE
889,535,236 *5C8CB4EFB476361949613E080AA16D34B2D17A19 Q##@~-~-~SPLAT
889,535,237 *5C85CD38C8D5CA88EBCAAADC4659C7F57CC3BE27 shay-lavie
889,535,238 *5C8B643552189541D6A905DF6777F989D74C7A15 shaynejerone
889,535,239 *5C8B66746A89021FF2B32D8CA933CD5CB0011555 [email protected]
889,535,240 *5C8AA58E046E93C57F028F350FE0523E43B11F9B q{U
889,535,241 *5C85B8B50A399FE8C5126FA2E2FDCDC025086E05 quincycardenas
889,535,242 *5C846694B22101E15914E2865D016761284AC4BC [email protected]
889,535,243 *5C8ABC29FC3FFC394BA8E8C530A75BE6EEFC3F20 quintonhuckabay
889,535,244 *5C83BC76B9334A50F95547440565CFE6C4CD9A73 SHERMAN.LOUKOTA
889,535,245 *5C8E9043F2370FB28E6CCF8CD9538CA0B2744E52 SHINDER
889,535,246 *5C87C83E061B72542937F800EC867A6A6746EB81 SHOLLAYSTAR
889,535,247 *5C8E2C57E252131C362F902C971A04340C74C3D5 SI-QUIERES-BAILAR
889,535,248 *5C85EA0122F301E70B5FC3D12B10838C09E1DB35 RAUL.VACHULA
889,535,249 *5C8BF941AA0AF3DA2E70125B187458A540763548 RAZAPETE1
889,535,250 *5C834BE3BC0AA6956C253F1BABA9FAC47F7FB2B9 RBOUKARAM
889,535,251 *5C8636C94C4F2741524A9814D102F2E665563595 SKIP-WILLIAMSON
889,535,252 *5C868E65E32E91486EFDB1282FE9B81B95AD41F6 slimvirgim
889,535,253 *5C8E39FB08CED1E1C50DFAFD79FBE764394BDE55 REFREDANESS1
889,535,254 *5C8C6A69844BC48FD62AEB972930C1F84CC14CF9 SODANROTNOC
889,535,255 *5C81B3EDF6237ACB19A1E078A9379F56D3E417AE SOKCHHOUNP
889,535,256 *5C8014B5B3D5FE824E822D11F014BB0C5A26DDBC REMPOCHE9
889,535,257 *5C8A9AD1A9427DD52A721457F9E4D133C882E5B6 SOME.RJEDIT
889,535,258 *5C84AE0730E321AE74469F0F12A77BDD1D652132 somethingforliza
889,535,259 *5C822EFF09B4A6286189A7F7A800501DD97C80DB REPUBLICASTE
889,535,260 *5C830A3A153F7519CAB97DA7A456D49C9BE9FBCB SONY4
889,535,261 *5C806E526A56B8AAD5BC6375BC97D00F19C46BB3 SOURPUSSESES
889,535,262 *5C838E8947AF19B3C7D86A1E8DCC5E8170C56023 reybiller
889,535,263 *5C8F34EC5AEEF6E80EE78184ECFA030BC8427569 [email protected]
889,535,264 *5C805A2FF3297DD9A8F44F17417EBA04E8CF63FD rhayander-goes-to-town
889,535,265 *5C816F7AA57AF9B25B222699EA3B9AD5B0BE667C RHOMBICALING
889,535,266 *5C8ED3093E8844F7C3C43B9DDB2FD35EA1832B91 RIB4L+EREI
889,535,267 *5C8B150C334D4E5EFE96A0BF86BB993E2ED53C54 SPLAT ~ ~ ~ DP
889,535,268 *5C86856D941580C8B3DD7BA776F5F872CD4D36A3 splato~-o~d-8
889,535,269 *5C86BE1F358693F33AD5F89F98B191C4E82A410E SPORTX-TREM
889,535,270 *5C8C9A50525F403CB927987DEE3FE04FBF66F519 SRESIROGETAC!
889,535,271 *5C8AC91C9809E6BF4AA13F5EF11ADD619B0BEB0B ROBBIE.OCAMPO
889,535,272 *5C83CE50DAFAE30ED699D8FC20F775EA28F9613E staceyelwood
889,535,273 *5C8D3C51A9F36096FD5C74ABEC03CC7FC12BDED1 ROCCO.PLETT
889,535,274 *5C8B9FEE3404A32D4DF8CF38AB58F3D1D3592FBB RODOLFOGENERALAO
889,535,275 *5C83DBB23DA841A5749B71CAF8BFA6EB646E3C9D ROLLANDPULLEN
889,535,276 *5C82DA9532A0781C787A42E32CBBF4D544390E77 RONGRUNBERG
889,535,277 *5C8E74A2F3E4673CD2C9F3C8C541975BD54B4B41 ROSE-PARSONS
889,535,278 *5C82A3B5BCBF7B54C344A3AB4FE6C7BB89A941E8 rotnevnis
889,535,279 *5C878120AADE4BC006C345DBEE2BBC3AC27D3E68 RPNQVOIS2
889,535,280 *5C86E57D6A7A1981C3111501738FE4F880B70B0A suðurossetiu
889,535,281 *5C8E9AAC7B8CBDCF804D21D57F148AE3140A8796 RUDOLF.GILHULY
889,535,282 *5C822D01535F93730197F4015A1FB60B8D5EFF9D rudysaranzak
889,535,283 *5C8DE17DC15DD8F176740DFC69EC6A47BC17A786 RUFUS.ASAY
889,535,284 *5C86F5F0977E06A87A25D7370C85676CBD9407BE runalbum
889,535,285 *5C8760657E61DF46745A8A350A5AF8CA96641326 SUNSHINMONSTER
889,535,286 *5C80E105EBD27148A30EC606D465EC6B03A1DB00 RUTHBARRYING
889,535,287 *5C834753EDC29CD69C0329F6B2D89D41B903B4EB RZ4
889,535,288 *5C8D5E0CC5D1B64869BD4DB809B85B2908036EAB SXTQWFGDRWWWYM3
889,535,289 *5C8FB3A7DE68C60B620D0DE4580B4E0BEE45016D sydneyrountree
889,535,290 *5C86DF5BCAE3DF263B82150DFB9079D9C6F1EAC3 SYMMETRY1902
889,535,291 *5C83C2FE1B87D325C012032A8F4BE38A304AB9A1 SZIGETELÉSNEK
889,535,292 *5C8E35DA4BB325A8339969597B5273CCDC43713D T159506
889,535,293 *5C866D93483150E980B782462C84098AB6AECE10 SAMUELFORDEN
889,535,294 *5C89B757CC7F02BA76929E8AC5DC6CC816C3D2FA SAMUEL.PEGLER
889,535,295 *5C85394380EA6F203854DC6987568D8386F383A3 samuelscout
889,535,296 *5C8B27C53067405A8988966852D8E0AE85200CB6 TAKEHANAED
889,535,297 *5C8CA736E4BA40E3209A3B521D277B7AA751C8AA SARJAKUVIN6
889,535,298 *5C829AFE392B4C0C7CB55F0CE3EE12010313CDE5 SAUL.OGLEY
889,535,299 *5C84ECC7A5C1963DA2C1E44A72A6F690EB4E035E tanmaydash
889,535,300 *5C8EB11A3240955165E0AD88C594E2C9A71FF251 TANYABULL1
889,535,301 *5C896AE134E04766C22B87CDEF66E567B4111FB9 SCHOOL—WOULD
889,535,302 *5C8C7C5C2B2A9A5A3E4DDCFA1B06AE4886EFE997 T-BONESUGAR
889,535,303 *5C8D1F4AD1FEAA451E4594055ABF6BA94B923007 TEDDYGILLMORE
889,535,304 *5C85091CEC9E7180A54CAEEAAD3C989823888106 SCOTTSOBIE
889,535,305 *5C8E6C1B67D5CDEC43D81A8C5B5725DFDD41DFC2 tedgunderson
889,535,306 *5C82EF4D08E2976A4BF0A1E927CB82BC9C3C468E TELIVISIVE
889,535,307 *5C8D374E85F25C45179CE42A97BDC5F5281DE54D SEASON.EPISODE
889,535,308 *5C840CAB3C134E2578C9D380B5EEE6824634D53E TENSAICH0
889,535,309 *5C8DFDA11B7628E646153AC8FBAA4B51308EEB96 TERENCE.ALMEDA
889,535,310 *5C8F29E59ECC6540648FE971BA0CEE99D922706D terrelllikes
889,535,311 *5C8576AD917EEAF5A5ACE246125ACF57013A5E7F Segundo.Acto:."Ah.Du.wolltest.mich.nicht.deinen.Mund.k
889,535,312 *5C8DB3698B48AD7C87C505466F49EA5E137634E7 selcilis5
889,535,313 *5C8D5B1C97DC92E6292DECBBD2D9B598496B2263 SEPARANDOLIS6
889,535,314 *5C882C532A2EC3337317E0CD281621CB5BA4FC86 [email protected]
889,535,315 *5C8D77BB0194BBF9FA76A64BA0DFD88E85CEAC8A THANKS TO THE E911 DOCUMENT. ANDREWS LIVED IN ILLINOIS,
889,535,316 *5C8F7FB752ED61F078ED548AA7DDAC7D2D95258C THATADROCK42
889,535,317 *5C8145CAAD5FBCBD7F7446268CCE71ADD89F3EB9 THATHOWARD1998
889,535,318 *5C86B647A612F3D5C140221FAA5709A9F3A7F4B5 THEABSENCEOFTIME/DJEMAAELFNA
889,535,319 *5C895FC4F91E52638C5A8CC492B4D7287AC2D0F4 setnemic3
889,535,320 *5C8E4387DDB859B6B747FBFCB57BC8DAA4A767F8 TheEndlessMile
889,535,321 *5C8264DD5C255F259BEF51180AC2339A4E79151F SHANDRENIA
889,535,322 *5C8E82D1F401FA134F832A0F75DC0CDC90A9C610 theodorecerrano
889,535,323 *5C84091EEF884654F788BC869D2420B656151FDD THEPENELOPE3
889,535,324 *5C8E982FB42CA78052F25A28E2099A1E97AFA03F TheVillage(featLenLemeire)
889,535,325 *5C8998EAA0BCEEFD2006271916CB3ECC23079C4A THEWILDCOLONIALBAY
889,535,326 *5C83FC2832FAFFFDA067CFE4E7F66F92E68DE84C SHERRY BIVENS
889,535,327 *5C827E71CF414853A1AF99AFEB9973EC1AE22D55 thi$tle.n
889,535,328 *5C83F3D3B5163FDE2BB4639DE9944473F1FE1F99 THOMASGUYE
889,535,329 *5C8EEF1055905D73AF7BB47E13C73C1AF49FDA05 THOMASSCHULITZ_BZ-NIEDERRHEIN
889,535,330 *5C8F1C6876E687359F1D7DA6EEAC22B1980C3FA4 SHINE.LIKE.THE.SUN
889,535,331 *5C8A9029D77A8A5DAF5ED51BF438AF6B1534F566 tiffanyaudley
889,535,332 *5C8630D70C1643C13F4C99B51C0448FE3107E5B4 TIMEBUX
889,535,333 *5C82B4E60C39B9548ED082845F087F5957E2E8C9 [email protected]
889,535,334 *5C86D533D3DF29E3C7955D67FDC69D35FD28AE52 sigworth6
889,535,335 *5C8C21D0C97150CB98AECC7F68CBB6B53C2D4754 SILBERNICK0
889,535,336 *5C8D1BA59593A09B51D3CB2B8D5C02F7789BD97E SINTFLUTHSAGEN
889,535,337 *5C8664D4558378F729A3B09C3633E1AEFAA0526D SK-HZDS
889,535,338 *5C892A3546C49DCE2DF42A8E4E8600D552E96FF9 skrcite3
889,535,339 *5C847B5C22496D0B2998BDDA80CE4064AFC8665B tpssljkr9
889,535,340 *5C8A3DFB9AB593B2B529FCF0DD279B9A55E35F73 TRAÉDME
889,535,341 *5C8862966F91BCB29910DF57A8C170BB742B0486 SODISODING
889,535,342 *5C888E3ECB3878A6A0EA63236C090E65A5F6577D Trap2
889,535,343 *5C821A8FFE7D96F89F2247D4A2B731353F25B47D SOLOMONSTAM
889,535,344 *5C81EA22448B2AE08E8AA3B626A9D8CA27262024 [email protected]
889,535,345 *5C8695021C0561B3BDF82C83AA26DC96A86472AF SOL.URNESS
889,535,346 *5C8A2A1737B7F5B43A9EF024AFB3F801B896A2EF sonfaragoza
889,535,347 *5C80ABB88D7D82658744B4278077A0C6F3707A56 TRESEMING
889,535,348 *5C80451CB3BDB3756B301C5D289D330C02932A7A TRIANGLEBECAUSE
889,535,349 *5C8EED1C72F8FF7DA33B76F6778B6ABF1657AB7C SOTHERTON、
889,535,350 *5C8AC46568A428CC3846A4664A173124288049F9 SPANKYDIGGERS
889,535,351 *5C82031E698CD2647688AB4D768EAA2F8F8752C4 TROLLOPPEE2
889,535,352 *5C8599A1BC146467526F01FE02F6EFC4B5FDC0B3 SPEELNOGEENLIEDJEORGELMAN(FEATRONNIETOBER)
889,535,353 *5C84EC8D741EC0D41F4E99C895FCB14EEE80831D TRUMAN.ARONOV
889,535,354 *5C894244DE96E10DF0C1F1718A1A3E500D9F0536 trunkcall
889,535,355 *5C8BBDBF0931AF5466F4BA155047DEF0B502E932 splat!*.*.d3
889,535,356 *5C893033DC7980E907A86E830237A3707CB2BC4B Sploit**d====p
889,535,357 *5C8151F25E66C9ABE8EBFA41742B3721419C7A1B srreaves88
889,535,358 *5C87EA12E9D002E1C1F8D78E8F8CFC7A4D1F3424 TYLKO-TOBIE-(FEAT-FISZ)
889,535,359 *5C843963D7A5EC1B32ECC65EE20E113D62C8A8A8 stadenland
889,535,360 *5C8D49BA76DB88D7A64B06D66ECC638026B56DCF tysivaltaisena
889,535,361 *5C880A0A2E3396B8A3E097F6BF475B3A091AE43B stanfordyuhasz
889,535,362 *5C85599093022A9BB5258FC2CC0B5E59984140FE [email protected]
889,535,363 *5C8D43502FABD69858F45B4D97A0F329A35236BB STAPPARE.
889,535,364 *5C841287D36C1CDE57056FD8E61922C79E23D9B3 stephanie.seales
889,535,365 *5C8F0FC4CA011BBC41BE6FC0F7A6572305714E63 STEPSIMED
889,535,366 *5C87960215B692861075943259D5D70B74A3533C ulrike.pannasch
889,535,367 *5C8146F1B01A09478A25BDABA720D5A6ABA38A3F stevenpelphrey
889,535,368 *5C888B0870467ED1F4BB6F84EF6BEDDBB2B0D706 unconscious-ly
889,535,369 *5C8A4FACCA4C5C00CED3D3DE9189181DB1E20271 ünnepeknél
889,535,370 *5C8A483DA18DDFEF9BF8B5ACF8203C0C0CF69088 upamantritaa
889,535,371 *5C8D8266D261CE42EB37CEB6230E65A1D1716135 UTIDIGT0
889,535,372 *5C8EE8D4BA73F34BC6746A1C6025E832CC58E248 UTTETEL3
889,535,373 *5C821C01DA324580B849F6F19C7990FC2EF78C14 V3S1CUL473
889,535,374 *5C89B3487B08715C3DF5C16BE3551895C6026A68 SUSIAWATIED
889,535,375 *5C8DA258D77D658CA4AA1D747F6A25FC0273A351 validavrcic
889,535,376 *5C80475B3A38AF425700AF1C44231102D2AB3B4E SWETA DIWAN
889,535,377 *5C813E1C3C83207890D748C5BED2353B0869882B swimmingfarming
889,535,378 *5C890C36AB3435DA93D521909D48E96F96F410A0 VATROMETIMA8
889,535,379 *5C866037686050DB963A2E917E9D6899DC3EE5A7 VBOTOG
889,535,380 *5C8C5A65CA37E535F0702A662B8D638C976B4F6E systems-in-one-day?
889,535,381 *5C8513281E827BC8097F263A765DA60DB4170EA6 VENTILIRAS
889,535,382 *5C8A5A9DD639603466CFCF6D875D2663781552BE VERN.HUTLEY
889,535,383 *5C80D47D6E26CE3CFD58F8292470719FDD7EDD3D VERONICA-IKEMOTO
889,535,384 *5C8EFEB6CA10743A90759C7E92C0105FB24E4F31 verteerbaarheids
889,535,385 *5C8DED53898F2041FBE14A87ACAB189CAA4931EB vince.estacio
889,535,386 *5C828A186E1A773AD9EF728568D313A3DEB95B60 vinodmartin
889,535,387 *5C804945BFBD2E62FC81A91471DB1C553B1B35FF virgilpuett
889,535,388 *5C8822D4012D89C11C86263E6CF7933199CCB999 VISTALLI5
889,535,389 *5C8441C0A7E9AE5405992B5F8FBD81ED710182D8 VITALY-ZUBENKO
889,535,390 *5C8BDE8F525EB0C9186DF42AC7E617B676CB99D8 VIVEKRAMNANI
889,535,391 *5C81D062F4E55AF48CBA7F011697609CDAD70609 Teknique.2
889,535,392 *5C8A92FA12836945A0A4AF24AD9102C4FE4BEBB2 VOREEI
889,535,393 *5C8172FEDC9BAA7A557C4863A1DA9BDD0E99CAD2 VORGEGENED
889,535,394 *5C84458CF6E68E3E5C2C70865DBFB774343D40DB VROLIJKE-GEZICHTEN
889,535,395 *5C801C64A7F48EA02D6D6315F1177B8B0F34883D terryo'neill
889,535,396 *5C83BDB588EBB08AB92AE3F6CAE8B77094EE5C8B vrwndsls8
889,535,397 *5C8979FFD9BDF2EB54B14A88EA9A23DF5D22AACE VYMAZANCH2
889,535,398 *5C835E3A8C0A5D8167D7C28840C221C7A57C06F5 thatapache58
889,535,399 *5C832DC9DC12BD4C65C4D690C3649126C8D322EF THEAYURVEDACAFECOM
889,535,400 *5C8960241B3CFFAEA63C72CD9CD7143260AC1F1A WALKIN'-ON-AIR
889,535,401 *5C85804CE02842273B69DAD69772EE9972D0D498 THE LAPSEY BAND
889,535,402 *5C86409A641AA7E35BBF6A6BF6D62EAEA24E9CB3 WeAreNow/ThePrice(feat.Spoonface)
889,535,403 *5C8E90C211A039D666CF1F0152E0A9073FF35DE7 THOMAS GHANEM
889,535,404 *5C83903B2A0C3EF50C5F0A9A14D7AA915257DB2A wehr
889,535,405 *5C8ED738DD67B3F025373B63659350B184466181 TIETEENTEKIJÖINÄ
889,535,406 *5C8F3A161DC02DB9C70024A34DBF96B0717C1F8C [email protected]
889,535,407 *5C8C821A395577B01F0396332251A291310B6BC2 WES.ROMANI
889,535,408 *5C8F1182AA10FB89C26655F3193606AC60C49722 TIMOTHY.STONER
889,535,409 *5C8FCFECFDE48330A3FA6DCB0F0778218ED8B7F2 TIMPERIALE
889,535,410 *5C84CCA9CC1D9C5490774BE39E17525D695F2AC5 WHEN BRUMBLES REMIND
889,535,411 *5C80972BFAB7397B08577FA3B6C567B2BA6E769F whenyoudon'thavetowork
889,535,412 *5C8079981D2717BBE63AEFD3C1B3C6C5FC0B7858 WILMATAIT
889,535,413 *5C853275B3DA35EDAF0DD101DE69F8303269E761 tony-tye
889,535,414 *5C86918E73DB288ED29101BA715E38544C0F8D16 WINIFREDOPUNK
889,535,415 *5C8270DA5887E54022614B5AAD2C58A403914D52 WINSTON.HASPER
889,535,416 *5C8797053F91835EDCC6DD4D7FF6EE5184EEFE87 torrentfulnessing
889,535,417 *5C8C83DB8D8FC81392C9BF86932F592795C7FE4D t[email protected]
889,535,418 *5C8C059C13AC1908AB54C7DA9FFBC2FCDC7D76D4 ?`/T!R\
889,535,419 *5C83341D70DCB12C4E599773E517238A23AEFED8 woeland.wardhanie
889,535,420 *5C8CB1092F40F13ACCDFD721C1DB3ACC1A27E606 WONDERFULWAYTOGO(SINGLEMIX)
889,535,421 *5C8A8083CF375DB083A3D73C11CE73B775ED6B89 WRANGLESOMING
889,535,422 *5C87A3FE80CCC21EA3A1794F443D7A727A17211F travis.harvey.moose
889,535,423 *5C865DFF0AC8B5B8A59DA63DCAF5DC477CD7B9BA [email protected]
889,535,424 *5C8BB498C6B3CDBE616E1DC4712FD2B574332836 TRENTKETCHAM
889,535,425 *5C85132A66C5B1C8F9B663185E9E9C6F292B5F7C trent-kreitlow
889,535,426 *5C8A726AA10461B28B50A93EFE151CB17F87DFDA trever.blue
889,535,427 *5C875A65A2A6B810E2B35FB4F2882ED5217083F4 TREYGRANADE
889,535,428 *5C8D4F79323A2A6A77A941D125734EDC67D6DC20 wwweatinglightbulbscom
889,535,429 *5C84D930DD8B5C6A03D811090385F05C493A3299 [email protected]
889,535,430 *5C8C409B25F617C37D00E7A896D3EF8336CC4286 WWWOSAORGMEETINGST
889,535,431 *5C86AC1FC7203CEA0B0EF8421BA6EC3CCAB887BD WWW.SELECTBEDDING.COM
889,535,432 *5C8F8471892E8E9476224A10871757DBBCF6F364 WYCLIFFE.THOROGOOD
889,535,433 *5C8C42421D81D5368379F485208187AAA065E9A6 [email protected]
889,535,434 *5C842579A862E30D9018128786997DC8D948298F [email protected]
889,535,435 *5C8155E57A20EDCAA2416DA0B6D4CCB1C10A1BEB TSTR!K3
889,535,436 *5C89F9640F0ADFAB4E76B80BFF44DEAE1F7DB2E8 TTSGTTSG
889,535,437 *5C85A7FC1243069BCB77AA073BB72F86E99300C9 (x)o~-(----P
889,535,438 *5C87E64700374F5A061A45E2C07072E80F615EDF TWISTERGRL18
889,535,439 *5C8032DFD46F83D5EA13B856A22809D76799B584 YAELBLACHMANCOHEN
889,535,440 *5C803BBD190409922FAACA88DDD24FC1C5BDFA26 TYLERJOFUS
889,535,441 *5C8E322FC9D540C73D8A11BA671C2721A1C52802 YANET-ESPINOSA
889,535,442 *5C887C251F74087649EB35AD777E24060809D277 [email protected]
889,535,443 *5C8BC9730F312986E2968DEFCB568DA23BE41254 yelkcubbed
889,535,444 *5C82EA5DD43AE9E919FA2C7B0E0046226E9AEC64 YHTAEAIKAISESTI
889,535,445 *5C8010A5AB217800D211DD02B4C2C0720EA0CDC0 U HAP LULJA E MORI DHEN
889,535,446 *5C8F53C6D1F7CDA2C87568B733D32841E05B8F5D ULKOPOLIITTISIKSI4
889,535,447 *5C846BE6C7939D5172693C1E866EB59E4F8234F1 yosefaboali
889,535,448 *5C89A819E35DCA8D02CD29D410400041712D32B2 YOUNG.MAILMAN
889,535,449 *5C8B7683390861BE7B0B47C67C91DA3178DD4D9B [email protected]@813
889,535,450 *5C890153021CA55EF62B65756F7F9FE3F8D643B2 UNHERTI6
889,535,451 *5C87D47BC32A9F5C8915EC7B5BE1B652C1DBA69A YUKARI.ARINO
889,535,452 *5C8F313A17C1AC4E8F39BB7364ACDE19FE5D5018 YUVAISSD YUVA
889,535,453 *5C8A91FE5F3F134AA85EDBD9947067C3FC07F5FE YVESTHIVIERGE
889,535,454 *5C816727D13DD0A7FEBE23EFD7D5F4EED37D29A5 unmutually
889,535,455 *5C8E4934323A5495C085B3C275F95EB6889643C0 unspottable
889,535,456 *5C88CB9A1C7775CB2857D400AE0E08BB6F078920 zachary.lelle
889,535,457 *5C8734C3E7673D741934CC4C3BBEE4F3EB039624 URTSBOED8
889,535,458 *5C8FE54A0FA81561B4A22F24E8B97C3FB43D7483 UTATANENOHIBI(L'ECUMEDESJOURS)
889,535,459 *5C85898921B69319B177585240E8CF4BBAB5AEB7 ZEMENMESERET
889,535,460 *5C83328405E092C27B540B31BDB3582E4AE29352 VAL.CANALE
889,535,461 *5C8BEA0CE4FC67EE5F00B01FDE3223A95E683C9B valls.i.colom
889,535,462 *5C8E0F3457B97A5002A39E6D1EF743119C138EF4 zollernia.
889,535,463 *5C8635C9ABAB4E7F59776BCEBF5AFB445CA65C8B VÄRVIKOODIDEGA
889,535,464 *5C8CE762BABABFFD232906B4053ECDDB94954F1C VASILEVSKADIJANA
889,535,465 *5C8568D19F6DAFB76FAC2A4E1D15CD568CD63AFC V#B<
889,535,466 *5C81C2AB6A3983768DA5242D2ED027B01EE2F6E8 zygomaticosphenoid
889,535,467 *5C8A9F81FFCBEAD19C0E922FC68139491E11E47F VENULINGAM
889,535,468 *5C85EA3821FE65E057029EE253A792CA9DE3F928 vergulders!
889,535,469 *5C8452FCF634C1D329CCBC20F95515BE37628EE0 verofack69
889,535,470 *5C8B8FB18A43AA26EF746FACAA2D2F3A71A1DEE8 VIDYAVIJEETH
889,535,471 *5C8D749DD07863FA6A3BAF63F912972A3B39168D МАТТХЕВС
889,535,472 *5C84066E19F8E4D8C170FD006E7A146B88643844 пі́ньчув
889,535,473 *5C809D2BB4ADF8089E30685B8A7FA5199F9A64EC viperarum
889,535,474 *5C8E4B81B8FD9CEBA0A3B170EFDDF80045453F1C vmak
889,535,475 *5C8DFBF6FE080E3069360C35D929A3FF82B4D526 ЭШФИЛД
889,535,476 *5C8D65FE7062E790A6DE19BCC3C04DDEC9EDF041 VOORBRACHTEN1
889,535,477 *5C8BFF6C32D34292DF319F96A28A1EC2D3810565 VWGUIDE
889,535,478 *5C8C4635CCB0097C301AD4D47B21A544775E0B52 WALDESIER
889,535,479 *5C8859A979D89AB2EC2C277D828EF6CC6AFEEB04 [email protected]
889,535,480 *5C8FE9A802CB4E150128073E2447CFA6F04A22D0 WANSTEIDT
889,535,481 *5C8A72DABFCF431E5B11F57181B371C71E0A0482 wardshan
889,535,482 *5C8A19E5203D5AD42FCB248CEAB8E10356273E2B [email protected]
889,535,483 *5C84A77F6A03C11F2568F58BE96C02BBD3B563AC 0100H.
889,535,484 *5C8B6CB654666BD21D197FBA909E3C49042E4E3E WE ARE THE FUTURE (B) :30
889,535,485 *5C853E151919E7A524367977D4C217CD459530A1 WECKTENSES
889,535,486 *5C8459D1A13FF34D9B105E385AD026E512D67ED3 02041507
889,535,487 *5C8A95DDB09FFB86C6F0D127824F1A85CFF00DD8 WENDY9913
889,535,488 *5C84218139A612C641DC9A9EF8E6DAD28D1F9C47 04YT45A
889,535,489 *5C8BA0BCE8387B4ED63AD3461FEDE34B94DFBD59 [email protected]
889,535,490 *5C87FE2D0EE2A1BEA6D0DBDC53185101A74F3173 [email protected]
889,535,491 *5C829E056046360880D729DBA528A885B2502D5A WERNER.DIMARIO
889,535,492 *5C8C18250B8967100083C8BA0B24AC1BF90D0917 WERNHER6
889,535,493 *5C80D43D152CD912B51D4AA337F38078F7796E6E when-the-devil-comes-to-you
889,535,494 *5C8247733ED94590CEC3A2C432F53A33F1EDE85B WHYSHOULDWETRYANYMORE
889,535,495 *5C85CA1BEF7073E1D3A6DB1CA274880908413AF0 117ROSE
889,535,496 *5C85F8F2E5347FAD97BACC1C1540F13615B00AD8 WILBURMANGRUM
889,535,497 *5C85801091186F07521EFC7F373AD48C88CA2463 wileden7
889,535,498 *5C81D89B3444CD6C00659A2E2CBB86A339E65287 WILLDUKELOW
889,535,499 *5C8D3FF43726F0684F769795DD930C3C36EC454E WILLIAMDUONG
889,535,500 *5C8B89801874C30A50AE34C5B14258C6F3EAB1DF 12bubba
889,535,501 *5C8AD95BDB7361C7145EEBD07E44245139B4295E 1305760 ABOUT THREE DOZEN SEARCHES HAVE BEEN CONDUCTED SO FAR
889,535,502 *5C8B7CF6EDE2F3ADB20BFD7565DD8BF7630C60D8 13AUG1576
889,535,503 *5C8B2C1615606E0DB5806008F5721EC494AA3752 1451534 VALUTA.SITTEN.LOPUT.
889,535,504 *5C853D9B558B110E3E2C516108BFDA0D89A08AB1 winanowie
889,535,505 *5C89F8EB760B02A3F7847B4C84C6C42B567BB012 1644285 ja.toiseksi.,.karhut.sy
889,535,506 *5C850D422267005C7FC1711884D9582087E110F3 1727056 sauna.ja.uimahalli.ovat.my
889,535,507 *5C89F20BF50DC417556089421CDBDACBC0395D74 WMJWRZPO9
889,535,508 *5C8433B065229150975EBE8347D28FC28020E875 WNGRWNG5
889,535,509 *5C83DF06D1BF85DDF78978500A9CF2B58A930481 1896688 approbaturopinnot.suoritettuaan.opiskelija.kykenee.k
889,535,510 *5C8B489C4DC82006CFD9595D187CEEFF1075946A wonderdanny
889,535,511 *5C84D12A76224DC0351684B126AFED1FF34C6C47 woodrowpostiglione
889,535,512 *5C8874DB7A3763C22D15235FA65757E4856CB53A [email protected]
889,535,513 *5C8F4734D54E1BD34FE5EECBCC449251102FD513 1-ALUSHOUSUN
889,535,514 *5C84766786F695DD8B5540004E76B0FC8411263E 1aug1692
889,535,515 *5C8C77529565F6119F6CEA081734816095C91E75 1.cinemaxxkonzern
889,535,516 *5C80E38F47710CE6FA7FF8105A48CF81061BC5D0 wwwedwardyarnoldcouk
889,535,517 *5C86BFA3065565213996610793B3EC391FA558F6 wwwequestrianclearancecom
889,535,518 *5C85CF4AFC9A65D0F27BC35B691F28C68BA308BD wwwgloucestershirefacom
889,535,519 *5C87E2ED768B13504BEEDF41EA317F72A16643D1 1-DISKUSSIONS-BOARDS
889,535,520 *5C8CF2701BEB1E494ECBF9E14E67C6206C162816 wwwkwbocceclubcom
889,535,521 *5C8A4B0D393B8B401872E58FCF7CEF589F1480D6 1.fafara
889,535,522 *5C8CEBAE910E888AB7CCF4853015C04EFA525CBE 1 FAIT-MITARBEITER
889,535,523 *5C87112FB3A383AB23721AA6E5B5278F7210AB08 1 FTPPALVELIJOISTA
889,535,524 *5C8C713987B2B18E1346BD654887248CA3D149B0 xavier-sayhara
889,535,525 *5C8DC8D5C5ADE650938263834710C3F842BA0040 xb:)
889,535,526 *5C8356A5FC8158C07D9D124B813F7873CEC03E29 }x{o~.0~d=====p
889,535,527 *5C8DB8CED4DA944CA5053415808EFD8C4272AC1A [email protected]
889,535,528 *5C899C191102B57789BB50722CCAE06C5E782947 1MUEGGELTURM-AREAL
889,535,529 *5C8274A1B0FC86F0AB0894C72EB0EBB93B116D59 1NC0N+R0V3R+18111+Y
889,535,530 *5C8233E2A8671D293E3C7F18E0C7287EBDE2E831 1PDSBOSS
889,535,531 *5C82307BBF8169F15611D614F5ACB0811B7048D3 1personenzeichnung
889,535,532 *5C8FF540572691EAF46B1164C61369F54E680C49 Y5YGUPEV
889,535,533 *5C813DF5B7257805A246E1D36A3573C82CAAA838 1-rakob
889,535,534 *5C8B779494DBE3F72E138105D2257CD67544E003 [email protected]
889,535,535 *5C8DBEB57EF767A7D59CAD6491F71CFFF982446C 1SEIEVVA
889,535,536 *5C880A848A72E3CD30F469691D52FB77EF1048CB 1-SEITENZUSAMMENSTOESSEN
889,535,537 *5C8AC57A31EB2324C8DA6D678223BF6008D005BF 1-SIMBIYOTIKTIR
889,535,538 *5C8E64134E0B7948ABAC5419B8653FD820DA04C3 YFXGKZBESQNZXU
889,535,539 *5C8616E70FDB0E9AF092B2F3902A72152F50FE65 yhv9
889,535,540 *5C8B6251F4AD3A68ADC0DAC4606554C884A002E4 20070829:THEGREEKTHEATRE,LOSANGELES,CA,USA(DISC2)
889,535,541 *5C8CB12071E15A1C4E2F50786D9FB1EA34CB9FF9 2071834 ICH STELL- MIR DIE WELT IN 20 JAHREN VOR .
889,535,542 *5C85DADF3F9126F6F1D898CCB8DA68F383C2DEB0 YMGYRCHION
889,535,543 *5C81D8035A2B5FD29C775C9042D51D0DD91EC563 ymistilaa
889,535,544 *5C81C3B8BDE348BD424E1A6BF1EB8F86095DD597 yongpolcovich
889,535,545 *5C8B57A5F987D7194753FA0245E27D74CBB1381B 221-palop
889,535,546 *5C8F8AB994AE673E43441F0676F74B5D3B86418A 2243952 viimeksimainitutmiehetovatel
889,535,547 *5C843B52A3146282BB7BDF78C5A34D73B81619F2 YOUNG.NOSII
889,535,548 *5C86EB19FFD251A4FA8AA55BB313BD32542B7EFC YOVONNDA
889,535,549 *5C834C6D0E0278568F98A817E31C02F903600AC9 23-prying
889,535,550 *5C8CE27C059E0A3B66A1D22AF422D4D06CED2511 2413108 ABERESGABEINENEGATIVISTISCHEPSYCHOSE
889,535,551 *5C8F115DBB22C3F3478E7EB8ACECB0C50E673B44 YROTAROREP9
889,535,552 *5C8664108D2050FF39F1F37AAFE6B5D2C3F304EA [email protected]
889,535,553 *5C88883D555F7CE6A8349BB2F08AA97F60E1D72A YUNATHAPALIYA
889,535,554 *5C82D019CB586107EC544D3488CCD236F200A993 Z1X2C3V412345
889,535,555 *5C82AC53EA126FB5DF686E2EA6AB7C1A4BA7BD47 ZAG-INSOY
889,535,556 *5C81D5FD140E959DD4DA6FD50595BD029BA62776 2EGIREKOM
889,535,557 *5C8A981E349B15D9B8C04EC6528DA6FCA7DB3204 ZANE.BADDOUR
889,535,558 *5C8EA76BAD720C69320E32EFBF7D23E8608EA78D ZB_7
889,535,559 *5C83DC07924A3A5811849F4310A55BCF1015ECB2 zhaye-sales
889,535,560 *5C85D7851D962C0FA20C6D615815C22DD555DA34 2RECHIDE
889,535,561 *5C80E5FE8524140FD68B2C6BAB189EC316CF6618 zheyindong
889,535,562 *5C82D1D466158541538FC63029AA16D8EC1060A8 [email protected]
889,535,563 *5C8CA99255A84FD33B3F8B98EE4833FE977E0A5F zj'g
889,535,564 *5C8030BA6603C54E2EC6BEF5F92B27F95D4B6FB4 [email protected]
889,535,565 *5C89E12F87948DD5D5D544D9B0972288A85CBF0D ZNTHSPNL
889,535,566 *5C81DF591A38DEF8D66DEA764A0750DA61B3479B zoeemmingham
889,535,567 *5C85CF8BAA5994E05AB7BE8823ADB21B2D1D79B9 ZOESAVORYWASAUSTIN
889,535,568 *5C856DB9B7044DF8714F261BBC1B8FCEC7E324E2 [email protected]
889,535,569 *5C8DE8CAA369CAD9824B55EBD367FA0711568658 3####B~.~.(0_<)
889,535,570 *5C8DA26B2F0716701A9FC780EAD2243D204C3DD1 Zve
889,535,571 *5C8E74D58D50C82D0A3C748CB1F7407332D2F8C1 3EJTWUTS
889,535,572 *5C834435136FF041C83C84672DFAEDB17D900BE4 ΔΙΓΝΩΜΟΣ
889,535,573 *5C8F77EF10DB777B09C0B6C606C4065B89EB8D08 адміністрати́вна
889,535,574 *5C822C400E37ED38416A71F75D7892529638081E ГОСТЫНИНСКИЙ
889,535,575 *5C83D2C1635919DC29722C315207A57F67CB1182 ДОКОСВА
889,535,576 *5C87668B0337A6226C55C69078E2D0B2D6AC02BF ЙНДЛІХ
889,535,577 *5C8310E6C8BC6386C913B2184582AD3D53C96006 468843 basinin ustune ici su dolu bir tas baglar .
889,535,578 *5C8182C43DD7C6BEA7E309E6D356451FB202DAF3 472242 but.they.said.the.could.not.show.any.proof..
889,535,579 *5C8623CFE75F8DDD7C29524C44E5295A216156F6 4ALTHEAM
889,535,580 *5C8A9F492B19F7496AD7B8FFA95BC8FE86F29B6D МИШПОХЭ
889,535,581 *5C882A8AEB999B526E60CC0A812BF2968FE61456 4FOXHOTDOG
889,535,582 *5C819B0C013056FBB44900C2491B510A884578F3 4KOMERCIONALIZACI
889,535,583 *5C843F6D034FE00E178663C9350AB219094695D1 4LACROSSETIFFANY
889,535,584 *5C81A5365506C9DEF4D1E567130EA9EF602C456B 4P4RC3IRLOI4M
889,535,585 *5C85F09B0D9967CAFC37288BC7C5220DBBD04E3F ЧИКИРИН
889,535,586 *5C8BE32404410E5584BD365924D1F2D8331B87CC 4PRICCHES
889,535,587 *5C88061CE158FE56104BE2FA924EBD14F64676CF 4TUESDAYFLIPPER
889,535,588 *5C85BC6853C46CA65C0F0C45D6B6DC8535721E81 4.typist
889,535,589 *5C8972EEF84BADAE7AA2BE9A6382F1877CAF1D98 4U7ONOME5
889,535,590 *5C83AFBECEB07C613800B8E7A3B1232471CE825B 538731 angeblich-wir-.
889,535,591 *5C849B7570F223BFE532CDA710D817C8C6F3ED74 54 T
889,535,592 *5C8DF84772C3EE5570DADD0A54D8C2425AFA3836 5IAMPROPERTY1
889,535,593 *5C821CFAED7AE6EAC850BD8BF83EB1C8BF12DC46 5INSTITUTAAPOSTOLICA
889,535,594 *5C894BF9AC44A9FF0BDCA91AA120FFC21F56CEE1 5INTOPPASSE
889,535,595 *5C8B7F7AFDAC07415A114E565715CE2DB4DDD54B 5L0MCZYN5K1
889,535,596 *5C8D61D4C898ADF83BDA888E503FDD648C83BFE5 5REXXVLB
889,535,597 *5C86CF766C5552491059DB53BAFEC70849806C97 5STRUCKLBSW
889,535,598 *5C827327F8D67C1D50FD1EABC926BA15428AD03E 5SZKOLENIU
889,535,599 *5C82ED825A74F7552F593525AE84BBEFBD39A27D 5TOBASHITABSW
889,535,600 *5C8205368CBB4D1B40933152C8D7D9443F9F2B8A 619damian
889,535,601 *5C8B383AB328F86F8FB659CCA33E4C4C7C2E1BC8 6ANATOMY
889,535,602 *5C839F18A1670E0C15E7B423022FB30324A9D1F9 6CIARA6
889,535,603 *5C89B79C195593D9CEB612A9E501FA1477387391 6lauterern
889,535,604 *5C82DE83D9306D80C6D2F4A0A552BC0C3E7E866F 6MAXHEADR
889,535,605 *5C8E42EAC9599FA01CB3C589218A3F8DE279DFC3 6METONIMIJSKIH
889,535,606 *5C8EA6F2B3627BC8F5D63C6D723C0586BEABC97B 6MUSICOPERA
889,535,607 *5C85EE7DED2F8FC399F17AAF0F9E8F9F3C1D198B 6MYNTYMYS
889,535,608 *5C86134AF12371CC8DC4DDFAD85B682CA9B2D790 6NETJIMIO
889,535,609 *5C8802421F3A9C964FC86151806580B0070B6BEE 6PRAKARSABSW
889,535,610 *5C8F32B3A83C6E2276288FFDAAC496DD382106AA 6SEDNEZRE
889,535,611 *5C850FE75F008E73D72ED72A47A8FF735A8C186E 6urophlyctis
889,535,612 *5C8C869C14CACD9A7038F9128BAB26A6917B6C16 713-Freestyle-(feat-Lil-Ron,-Young-Redd)
889,535,613 *5C81B3F31E68F9A03231C5145D01427DE291A222 7BRYANSUTTONRSABSUTTONITCCOZA
889,535,614 *5C8C5AB89F7ED2CFA79D5F4327718CD7C1B7E84C 7BSWINTOUCHBSW
889,535,615 *5C839F83630288B9218778AB2B3E378F6510353C 7EAGLESTEELE
889,535,616 *5C8349A983F5F3183E80490330AC876812CD3708 7EELTAGTIGHEID
889,535,617 *5C850EA9868753961095EEE767688607FAF1BAEA [email protected]
889,535,618 *5C863B28814B2D1F972329C7D33F3153A5E5706C 7hyzua
889,535,619 *5C8B2E9B005955778F932293ECDB8E1FBF9FEACF 7MUKOBGA
889,535,620 *5C864DB8D15099016F6408E3F428767E1FF2DA3B 7.paikallisp
889,535,621 *5C8F9FEE0CD876E6F69D8E5A6D646708FF6572A5 7PARALOGE
889,535,622 *5C89D53022F37698F406A65BD79B5CAB639B6D1F (00)***(#####8
889,535,623 *5C80CD5393C4153537EFBED4760B80671D575D29 7thecompton4
889,535,624 *5C878489800C797EE324C615A315DD63237E9635 824440 TILANNE.AIHEUTTAA.TURVATTOMUUTTA.VANGEISSA.,.HENKIL
889,535,625 *5C8D97DADEA1B378FB42D359D0041D178EDE3129 09021081
889,535,626 *5C806AD1BBB56EB3BAC1C8FAD8B2631F3F1A3B42 (0_<)~`~`<-p
889,535,627 *5C8C31F8E3CBD3B51E3C17A9281CBE74D896A2A0 8BOBBY6
889,535,628 *5C86BF25FDEDC3745F6E33568ADFFD0161EF9B5B 8BUKERAM
889,535,629 *5C87EE23C0BCBB7D953600EC2F00B6CE56C58741 8CLOXILEAN
889,535,630 *5C81B054F04A0E38C39F8C58D61B3E7F20E02434 11nov1576
889,535,631 *5C81C92173CC616085CA9805069BD20E9FE2580E 8ERSTREBENSWERTESTER
889,535,632 *5C8B04BA5D3BF7FD8AA29E6D833403C72AF35B53 14LASTENLINNAN
889,535,633 *5C83E0786DA13E74415C48407A98E837F049E1D9 8KEVINDELTA
889,535,634 *5C866C8E2DCBD5943FD69C32EAA8B8D45AB887DB 8LOVARIA
889,535,635 *5C8EF872961F3CBEDC56ED1844FEC125B2C07BAE 15SEPTEMBER1518
889,535,636 *5C88797FF934B78487A3EF87C713A4AB18DB9CAE 8NALOCOI
889,535,637 *5C879631075374C3C13181A202D0E079AD5B11BE 16aug1881
889,535,638 *5C863BCCD485F3BDC080EC0A795E8ABDDBE994E3 )8(o~o~(------p
889,535,639 *5C834D06EC0997900C77186104169351F2C14185 8PATHFOOT
889,535,640 *5C88A5C807DA7BE4C15DD6C98DDDA9C12DEAD9EC 8.produktbereichen
889,535,641 *5C86FD9EB27388EB93736D4C5EEE44073D735CEC 8QHTGSXJPT
889,535,642 *5C8DBD8617723D80AEE9FEEDD93891969B9E181C 197raelynn
889,535,643 *5C8D47768A0918CD487AD742C53FCC39D3E56667 1AMMATTIALANSA
889,535,644 *5C89BD0447AEA19BE49D645CA093BCB1BE38B75D 1AUDITO-RISCHEN
889,535,645 *5C88832970A89DA4C03D5D624C9E58E8F7F7E029 1AYATURIN
889,535,646 *5C87227F4F771137A8EC5421D85EAC63B9E3796D 8transformerions
889,535,647 *5C832E058D561E38D144D22CE9738EA22F839296 8YMOTORHPEN
889,535,648 *5C8CD8DDFA7E0F2FA0D3E94C24F92AADDCEC18FE 1.codesharevereinbarung
889,535,649 *5C8F72B7707A1DC6A6A3E677F7F30DA6574208A7 930SHELBY
889,535,650 *5C82A28360774A0EED4F9F9E3AE029C7B7A9134F 93435IHVHZ
889,535,651 *5C8DA77EE37F9FAA73B10E88B2789C0C991C40B0 1.einweihungszug
889,535,652 *5C8CFD9FA5076A36C47B8D7846241FC5AB933AED 99qazedctgb
889,535,653 *5C859215DAC3C7ECAD353E73C5876465D7AAB78D 1fieldsgedaechtnisplatz
889,535,654 *5C89843199B856FDE268E9B2C623948A4F136E2D [email protected]
889,535,655 *5C8013A16765C753F5909AB403A6E66914885E71 1hakkuuaukiotakin
889,535,656 *5C8C52D45D0A4D488D8A80A50F0812395607FC9E 9BSWWINPEEGBSW
889,535,657 *5C8B258133FCA25C0277999C6AEA7BBE3826F913 1-HEROIN-BRIEFCHEN
889,535,658 *5C865150E9115D7F0A05A86CCF1169923C2FBAB0 9ECHEVELEE
889,535,659 *5C8689B1F65C31F2ACA89F23061BDCF4E996012C 9ETTEEKSI
889,535,660 *5C801A0536E1092D5DC9C46DCDBF9820A1428C73 1KARRUBIN
889,535,661 *5C821781A921CB0BFC914AD58034D1CD028814E6 1-KESTIK
889,535,662 *5C8D1988684C5702D4016E691701442E15B09E7D 9GRPPTLHRSFRHLDT
889,535,663 *5C821C0B6BA338B99189CB80C43FBC140CE0CCFA 1-KUNSTAVANTGARDE
889,535,664 *5C858F6E065B30B9D383E36C131C6D64CA01784C 9INDUCTANTIES
889,535,665 *5C8FAD4BDA64230868624880E0D694C6B4DA6166 1 LAITETYYPPIEN
889,535,666 *5C848235B41ECCFBB6A7C1B7C5FA1D0AB396A576 1-NORMALVERDIENDE
889,535,667 *5C8F0301B1D7066DBDAE7837901BBC8E72942F83 1-NU'ULI
889,535,668 *5C8026388988F9903D0449BB476DD62A9BBFA6F9 9TOOTSIEARTIST
889,535,669 *5C86AC7823722AECF16EE45509160070B079EBB1 9ZEEPPOEDER
889,535,670 *5C8C2A3E0550F32A8E656CC708AE6AA3DD6990B2 1WAHLHAUSSE
889,535,671 *5C89A274D01E84041D78A219FFFCF2184AD74C2A 2039600 prosessin.edellytt
889,535,672 *5C8AF6EA9ECE85FA813BA975CCB7B16943813C8A a5kmo
889,535,673 *5C81944C00C69914ABD0F9D033BE9132F80FDFB5 [email protected]
889,535,674 *5C8C17526BA02B7C4B8F7E1E6532ED65AF80F919 a6mdv
889,535,675 *5C8A1BCE29E6DEA5D328017A1987050A851A9A1F 2264982 RATA.ON.JAKAUTUNUT.LUOTTOLAITOSOSASTOON.,.P
889,535,676 *5C894DE3D1FA238A32DA92C8D5C939E1B883710A a8c:v
889,535,677 *5C8AC7E9A47DFC7FD764937E5715B16ABC8C5F8F 2335550 yettheyoftencomeupagainstunnecessaryobstacles
889,535,678 *5C8B07228442C4A5AD2F0B2E3EE97DED5CE658A1 2535532 kolmannen sukupolven j
889,535,679 *5C8A423B1CF05E34E21346798E5088DAB2AAEDE0 aaaaaajoker1
889,535,680 *5C832856E88BB240C31107F068F09EFB71EF66DE 273GAVIN
889,535,681 *5C860AEC4D1025427772A141CC1C2B0B8A21C2E7 2753872 motox-vaihdemoottorit.ja.-sahamoottorit.sek
889,535,682 *5C82DB45F0BD87DE44528D7A86F168C914126F61 AAB^(_
889,535,683 *5C8575CD9DFE67ED08D704F362DEDDD79603F8EF 2801024 itsetunto-ei-ole-m
889,535,684 *5C83F45D99A52FA29BFF82784DC162E19471EC4C AAB\9"
889,535,685 *5C814B773051EA108383AA5B5F87AD7C989A1E3E 285890 guclu olmasi istenmiyor
889,535,686 *5C89926B4A5312CB0D52FF6F071F505A431D4CD3 aab=w_
889,535,687 *5C8A3173461EA1C63356B48CCE79E6ADCC824BD9 AAEA22
889,535,688 *5C83E878BB27A9AA075B4AF4ADE076431C5172B8 2GHIOTTI
889,535,689 *5C8D8F14968276B513D70B9D78207FD35FC73426 aaeJO
889,535,690 *5C833B439CCE669E521953433CAB383649C7B303 2ilovesammie9
889,535,691 *5C8AB1F68A3CA126A9919AE4A14D78081B349B49 2lanzhou
889,535,692 *5C8AD2CD482F07BB2DEB0A4E4CD5B870223DB5BC AAS(
889,535,693 *5C8515E97D97E06FAE3A12F3F5FB11A3AE0A6599 2RZLICHE
889,535,694 *5C8A66A640335DAD7B5932BCD4614F338B2E7ECB 2THATCUTIE8
889,535,695 *5C82E32EB080CEA9C2438682E0DF309917F39D3A abac
889,535,696 *5C89B3F194EC57CB3DBC821F5AB3FE09D41AD08A ABP&Q
889,535,697 *5C88E53C9E93BD05CECB756DCF673EDB5B6F5921 3DZIUBEL
889,535,698 *5C88F42EE8778729BE12EDDA4D9C12CAFA503EAF 3EURAMAX
889,535,699 *5C865D53E6F9CB961B7355A0E143343F96908BC7 ackm
889,535,700 *5C884B952C0090755A6B0304DDD0A6981EBFEF0B 3SCHAUBUEHNENDIREKTOR
889,535,701 *5C8DF60AF879684CEAECB563CF49FBDF6DEE4AFD ADAMKOALA9
889,535,702 *5C88B7A85BF6DDB4BFD96BACC1C44B40A3748DAC ADHELELMO
889,535,703 *5C8A0E73D81F506CD2C50AB33786030C26414F6B 4071053
889,535,704 *5C8FCB5CDC974881732136E2D45BD2D4ADA80DEA ad*p
889,535,705 *5C895AC9DE8D831698B3AEB658E9C3DF7CCC2F11 adw6
889,535,706 *5C8E76B790939C190E1DE147775704D5667822B7 aegresco
889,535,707 *5C81B60B0B73A64D5B7D610EF1C9A60379B43298 aeue
889,535,708 *5C823A668F974CBE9C8A8F7250E071DCD354A035 4MASTERSCLOVER
889,535,709 *5C8C335F4016EE267B83D5047351E85D01A0D727 4MCONTENTIONS
889,535,710 *5C8855FD7C37851B74A028A1E09BB275349FF9BC AF?#X
889,535,711 *5C8923A46BB91616AE32043AD05B3A9C5FC11045 4UNKINDLINGS
889,535,712 *5C89D910762C30AE119AF77F4C8D66328176BDE2 4WRANGWISE
889,535,713 *5C8FA1E1B87851D608C453D256336254BA2AB33C 4YLEISTY
889,535,714 *5C83DCB583A43E0E0AC4C72A69D56F6A563DDB25 4YUNGBUM
889,535,715 *5C87867A32F0DDC06AC8AE799FF50415E8C1ADD4 AhPj
889,535,716 *5C89A8BF9532297ED8C1788BF92E77E305318836 akq:2
889,535,717 *5C8CF71D81D3BBD436CE5FC0C67E802CEF44E44D 5ILOVEVIKING
889,535,718 *5C852AB361CAC9FEC225858127E53DE656671308 5PINKSTERFEESTEN
889,535,719 *5C8540EE339ED6D9DC8FE1D2427F8561ED3791EB alfredoszust
889,535,720 *5C8000926411A7848A15DD810B3C3179FF3D6FBC 5SMUIRARONOH
889,535,721 *5C84020426A1A31C1A698497FC2197908646B9DD 5SNOBINARDE
889,535,722 *5C8228FBB63CAFBF48FADA1E957711AB2289D34F ALI.AHIMUD
889,535,723 *5C8CEABC585CA23D49DF06E1D24A5DEDFD59FFA1 5STINEHART
889,535,724 *5C83EDC6146E6318021D03975C7D662621A9A099 5TEQUILASPIRIT
889,535,725 *5C86D21561CDD859898352DA0FF345A1C3F68E23 5TNORESIRONOS
889,535,726 *5C879D9E100838ACFEC9A76D8A75518C95D6EC8B 5toilettet
889,535,727 *5C82295D803421832BD495F4D0B50AB6BE9105EF ALLANKOY
889,535,728 *5C8DF0A3D910B87E7B72F44C55F159DC56008EB6 allanstarnauld
889,535,729 *5C88E00DA062ADDC1CC87A2C2F34214885D3F9AE ALLFOURUS
889,535,730 *5C8C712C4FFB5F37F4FDD4E16134FEACCB0ECA76 ALMITYLORD
889,535,731 *5C87D4F628AF6E3D5F5383E141D31E4C5DB5D676 [email protected]
889,535,732 *5C84890F42BE23C0D73C589E46BCE73C781AEE62 A/Lt
889,535,733 *5C82F1BA1DD50DC985B2BE8A54187CBA113EDEC2 altonguziec
889,535,734 *5C891173531E1059195A51784015B2706BF13A20 6BORDAMI
889,535,735 *5C8B53833F116D2BB267BAD638EA2364AA200BDE 6DETNUTSN
889,535,736 *5C839D4906089754B824D6D8DA10BE8A35326099 6DUAHCIBOR
889,535,737 *5C87636FCA2070961611AFBE38E8B98986FF78FA AMBROSEVIXAY
889,535,738 *5C86E827CB7433FCDF3E95FFF28100737267AC21 6FRDRCK12
889,535,739 *5C838A709E5EB1D8FB6E2F9505F501E3A336083F 6INDIANAALBERT
889,535,740 *5C8574CF8907CEF428C07902BF4C39EDC4E77E04 6KARAMPINATO
889,535,741 *5C8807E2AC1E4D2A66BF80CE0C03DFBB7E9E12D7 andresditmore
889,535,742 *5C81E819DEDB4DB5EFC948927AD5BE7CE8EF723F 6PUPPYTRACY
889,535,743 *5C898CCF12A03D83A3E8FB717748DD10A3D8AE5B 6QXPIMQMBAZT
889,535,744 *5C8F74982E83C8E450937EE5CFEB9207B5384671 6ROCKTHEF
889,535,745 *5C8E74A5F8ED7154C7F3A57487A383503B50558B 6ROTSIHRF
889,535,746 *5C8D70B90D95B6FEA7BAAB2CC5E157A35B851801 anfyd
889,535,747 *5C8F39192EF8B6B9983A9ABFA74E7DF990797518 6THMAN050503
889,535,748 *5C8A4140397AE235BE7F6F162F40D452E8ACED65 ANL!U
889,535,749 *5C8A3459B350A3D23C065D8BB2F4D58E72589C0D 715274536CF0C010VGNVCM1000004D82620A
889,535,750 *5C8C1CB48674146DF9398C1FADDE5F16A9CF24D6 anto3
889,535,751 *5C86D203E38E5778D0F1CEC456044EF5493EEA29 7C17RN1713S
889,535,752 *5C89AFE739A72057E68A1B43D33A2D7C03804D4C ANWOK
889,535,753 *5C868B81076639AE7FEC7991DACB3EF2BB86E6D0 a.-o
889,535,754 *5C8CD84ACD8DFB81A351FD4BA254936B850300BD ao9nd
889,535,755 *5C804DFD60FB7962B6EFDF6277F5C9F8BCABFBD8 aosks
889,535,756 *5C8DCFFB05F809DBFCCF35B1BA6F727CF679AEFE ap=_b
889,535,757 *5C8F0A2CF1A04CB1EA053F4F0557BA7CEE17F0AF 7OATMEALSPENCER
889,535,758 *5C85299B74D1F222DC9DE659196BF5FAFC5940A5 7OCTOBER60
889,535,759 *5C87B1CA7C0D258DE11F7543BA21EB69E746819F archieswanick
889,535,760 *5C8A098C330337904BEC01E238D12692CBB78195 7weleerwaard
889,535,761 *5C8C7A156F5B3D77BA83B81B9F0BC1C43C281159 AR/NH
889,535,762 *5C8853C2022C405980A089719CAD1C5771898B22 8BSWSIMONCINI
889,535,763 *5C8C6AE777250A9D13F8A12024B84344C3D293F2 8BUNAEAAEANUB
889,535,764 *5C8B4FC1CF1F14F7F237558A1AB0EE91A12C79D1 ARZAMENLIKE
889,535,765 *5C8775C5E40B771FA37DB3C358035704D34632EC ar;zv
889,535,766 *5C877F1BDF6EE31D60FA4D4C0C76DD1CC114983C 8-----D~o}X{
889,535,767 *5C81FBEAEFA0BB546077D24061A37D12D6D2FB5F 8ilovespunky5
889,535,768 *5C8CAF3D1BAB5F3690DC33931F30005A2114EAEE )8(O~Q====3
889,535,769 *5C8F9D106CF7A595DAF7FD559E19FFB5A1E74610 8THADDRE
889,535,770 *5C8CAC2FD9132AB7ECD6ED6069574F33DCE6949B 8TNORIRUO
889,535,771 *5C8F10139F20885CDA220B543CEE2FB67A5B7596 912587 jerusalem , 28 dezember
889,535,772 *5C817DD4AC93687F46BC90FC13BC94AA176718FD AUTOVIA-PAZOS-BARRO
889,535,773 *5C8916BCE3BB974AD62036E4925AD7D1CC3A263E AUUHK
889,535,774 *5C81BF7C42F5BC26AA32A1C22F4B98E749922193 9AMYBEAUTIFU
889,535,775 *5C8075D2A9F3999424BB4DCF7D5055EDE5F51B04 AV.Z&
889,535,776 *5C8F49D69745DD4805223F1904D26DE594765E4C 9HIIHTOPIVN
889,535,777 *5C8D352FBD07545AB7DA579E8DF6D6AE532DB4F4 ayoguuj5
889,535,778 *5C85BDBE0EC7D0CE111656CD9A63F686D90BB2CE AZ4D3
889,535,779 *5C82A4DD97115C691A7C9D12E0919D617CD114FE azl=4
889,535,780 *5C84CD3B2AECDF02432188D1F7405C110DE71C07 aznmv
889,535,781 *5C81E89C7DE98217368DCEAD1588339B19EED0B6 b?%=
889,535,782 *5C8093ED2D01028197F9F0938D7A9DDA5C123AEF B0WWD
889,535,783 *5C871B1004CDE69DA2C5EAB70665F0723B9939D6 9SHRADDADHYUH
889,535,784 *5C88FCD2FDEF966FB2796FBBE052504728EF3E17 b&3m4
889,535,785 *5C88721345FEB35647A73ABF90E4D09C564D3B90 B3-SK
889,535,786 *5C8467AD2BF41589FDD5403F1DE69CC5C79B16EC 9SUTTELTEE
889,535,787 *5C819D0653A99867D6B44D3BAFF265B06991CC22 9TASHATIGRE
889,535,788 *5C8877CAE7EABFBDF0667EA7DBD2469E2A9CD10E 9undynamited
889,535,789 *5C8F747858CB7938512839C5004599C20D70CAF8 a0g.d
889,535,790 *5C8A1CF3EF7A66F353754FB40DA624157681DD5F BA11!57!C!AN
889,535,791 *5C80DCD9327ADFB881399FF5CB414D8090891B26 BAKERTAMMY
889,535,792 *5C8A289BCBA63546B1156AF2D4595D4733F44714 "(BALLATELLA)(NEDDA)
889,535,793 *5C8500104C63BA78CD3C1141F3BA7DB5A051E84E banteng6
889,535,794 *5C8ED5244F4CA84FD99054AADDB962425CAE6854 A8NU
889,535,795 *5C8723860C5C463065B7B6BF0AA66009385D9DBC BARRICADEN7
889,535,796 *5C898AE02730E36A5F5759885DB6541DB0705358 aa'6
889,535,797 *5C8895EE62EAA478965312920C677B2C93ED1090 aaazkw
889,535,798 *5C832234BB0ED4A55FFDD84B6E4AA874F72ACC1E AANRUKTEN2
889,535,799 *5C867248DAEEE37653C2C3034824751D01AE8A80 AAUJK
889,535,800 *5C875EA173910BC4968E59121E1DE988E6AD03D1 abdullah.soufi
889,535,801 *5C881CE7CCA87F2FE69A3CB5EB03B66078022FDD abdul.malek.abdul.wahab
889,535,802 *5C88B394C791EE1E11F77B197DC231D216AC59BB bennettbragdon
889,535,803 *5C872A7A3F792D190992423EBA38A0072D40C927 BENNYBOOP3
889,535,804 *5C889B36901072C0FB2EE09D2DD2DCD49B90AE13 ABEMERCED
889,535,805 *5C831D692DC71A5A530C46418A6C050951BD134D BEN.SHROCK
889,535,806 *5C8DA3AA41119AFDE971578EEBF1EC19AFBDA285 abezeladium
889,535,807 *5C872F89D6EA99840C67628CE189EF4AA9F84E5A ABGJP
889,535,808 *5C89E35D5DD514895E2E5C7BB28118B62C0E00B0 BERRYGRISETA
889,535,809 *5C8D004770F5DE530D930AFC86A3BC97C5AEF78E BERTRAM.GOELZ
889,535,810 *5C8DCFAE51729AE80AF2BB0836530FD8EFAF3D7A ABSTRACTBIOGRAPHY
889,535,811 *5C8D5EED1168A7856F8A49B0E7F7DE59FF7ADA73 abzubestellen1
889,535,812 *5C873E1B1CF752EE2B18E22AC704E0A84459BA42 acm}y
889,535,813 *5C888E2D1904A5B3A14C5F37ECF24A89EA56C6C0 [email protected]
889,535,814 *5C817E6D37E01B80BFC34DA16284699DD9C167EA Bhv?
889,535,815 *5C8EBEB917FC49C159071B245ABA45DFA9752013 adeline06
889,535,816 *5C864E13B1B5006B1B004D2E04A105FF6FFA54B6 [email protected]
889,535,817 *5C880CBDE04ACAAB8BC37EFADB71221DC6BE0E53 [email protected]
889,535,818 *5C8FCBAC66D1223F2DB76706C5B2A5EB6FF4115B [email protected]
889,535,819 *5C8AD683E223A67AAEA4839206FA4B9AF138F619 BJ-B8
889,535,820 *5C8AC88B5D3BFCD2EA5C5D38D94A678AEF32CBAE ADV9|
889,535,821 *5C8D0FE991230875912D569DBF30AE307A38C905 adw6
889,535,822 *5C82DC286D609AAD13E1B616F12AA2D7426A39E7 BLAKE.JACOB
889,535,823 *5C860D5C89BC855A838276CFF40151382424408E AFFERENT-FREQUENCE
889,535,824 *5C8ECEF88DE9AC2C029C33D76F142F86679DFCAE afgeglipten1
889,535,825 *5C85707B10583169C16F78F48168C6312EF7A743 Ah6L
889,535,826 *5C8F3B8313195CDA9C0F8457D652C43188F0E136 b,o(!
889,535,827 *5C86B656BDC1357806BF7E4EE11D74F0F6C82F40 AHNESUUK6
889,535,828 *5C80A90EDDF63D15903D1850172EAD5DB65C552D AICAFNON4
889,535,829 *5C82C2F697BAE7136F0E635E6F10E4CCE5543A25 A,ICI
889,535,830 *5C8E4948F3303E782C9C919746D047A279CD0C54 [email protected]~O-~o-(0_<)
889,535,831 *5C84175D9425C602F8DA6C56418071D34A283892 [email protected]
889,535,832 *5C8CBF318DFA6F3BC3343235D5D31FDEB8C80811 boosdoenster
889,535,833 *5C83BEC6D4BEC20D1E86A48E7CE657C5AB89BF56 BOUTYLKA9
889,535,834 *5C8F5470C67A32BFBF7D2C394BAE56083D3AFCF9 AK0KN
889,535,835 *5C8EA82B5ED9F37357ED6EE77A34AA168965D701 BQKD
889,535,836 *5C85AAAAE5DD8231134A4EB74B3F3251BA76DB80 ALEXISFRIDAL
889,535,837 *5C85C71F61D0429CE8F49E07225D65460E3A4B93 brandonstelmach
889,535,838 *5C83A95BE64C38522F2F87EFB06E066EBF0186F9 BRAVIDO
889,535,839 *5C899784D40E3538FE66C2607F06E940FC7587E0 BRENDON.BAUCE
889,535,840 *5C80653ACDA29B705D1FCBD582DCF354FB6E9A88 alias _i {
889,535,841 *5C8FA2765F78CE630F3A6D8B9563F14FB91CD12F BRIAN.WHIDDEN
889,535,842 *5C83C764A2C3E66BC4BE17563A2C027A2B5054F6 ALLEN.RIEXINGER
889,535,843 *5C8BFF19EF2A7C2560352E537C0CB20DA0324845 ALL-MY-HUESLIVEJOURNALCOMALL-MY-HUES
889,535,844 *5C8CB974E03D24DB7388626CEAF0ED826DC4478C ALLOOSCAR8
889,535,845 *5C806D567C970464D00D4AF23F2ADC84CE3EB57F ALLYCEMAR5
889,535,846 *5C8FDABB5FDD55CE930BB04977F4F492A29C6EAA ALONZOKNEIP
889,535,847 *5C80F797E1FFB23BE8074029E29D03B860796815 A(LS:
889,535,848 *5C834C8E4B6A618D42F4ADF083B324FBCC077F26 BRYON.LANDACRE
889,535,849 *5C832A85D3FD32A1CF15B3EB5605084EA276AD32 bs9sd
889,535,850 *5C86375EF25DF2B42B7F4D4A16A1954A2E3422A6 [email protected]
889,535,851 *5C8C52F00A38DC1297237C8D49A95E8341063A5F AMENIUTAEBA~PICHIPICHICHAPUCHAPURANRANBLUES~
889,535,852 *5C834B9B728BB0EBD7E04502E0D8C32AB2A731C4 bttmo
889,535,853 *5C83762992934C2642CEA7B1722E292E5E235407 buggerss
889,535,854 *5C8550991A86F35D9DBD28818A3ADE0E3D3F1C86 BURLPHARMER
889,535,855 *5C80B727B04919199BB81611DB4D40930859E9E0 ANGEL.GRINDEL
889,535,856 *5C8DFDA6E9F76A5080656F600D4C60EAC05810B2 butoretus
889,535,857 *5C804B9F1A3B5DA13F16C71C8C263DC0FB0AA5C3 bv7l5
889,535,858 *5C83BF706D78954E282C8C772F9E06D970612263 antionebery
889,535,859 *5C8B566661B65200879C21717197B279E6BD7713 BX&UM
889,535,860 *5C887E3DC08FC904BAA258D745652FE6E62BF7E7 by/4"
889,535,861 *5C8829EA9392F0AA4DC7AC1643BA6744C5DA7A08 [email protected]
889,535,862 *5C83AE06220D48806AC11DC2E21DEA33218D1D02 bzxg1
889,535,863 *5C843382C784958253AAF5CA104C1141CBB1C0FD `c'
889,535,864 *5C8FBA8137E548F0DC1D06EEB3D3DFE5414ED7B3 ao7ms
889,535,865 *5C820051B3FDA44DCC30BAA3DFB9FFBAAB20E738 C40LFRS
889,535,866 *5C8BCDC83CE26A8465CA1E02D00C6E129DD93277 APPLEBYFRODINGHAMFC
889,535,867 *5C8FD9CB59C3EE283C056DA902D507D296EDAF57 C8?Q
889,535,868 *5C86EC9835AE80AC21059368C142C755F01D6A02 CAMAPDOTONDOWNEY
889,535,869 *5C8EBAB1239F507253D339DA48E6CCE22F98CF06 CAMERON.GJERDE
889,535,870 *5C8D4C9F51982F4DD1165D3D35A956292CCFA810 arnolmt
889,535,871 *5C84EF2792048688789BE905FC5AD99EB6495F73 CANDICE HUGHES
889,535,872 *5C8CAB93F44FDA218E5336289DB5C837739E753C [email protected]
889,535,873 *5C82E7AB825EF1E48103A87C5BA1A20AE6077DB2 [email protected]
889,535,874 *5C8992914D89230C022D08F93970CE531563C627 ARTUROHARTIS
889,535,875 *5C86E5CE08649173D973BEA8537382B78E5491AE asakohlhoff
889,535,876 *5C8BBC1CADDCE37D557D7A1550AD8D5505F68E5F asepses
889,535,877 *5C8B63C6CB0E2D19BB3AFBBCA05B7EB3E402FB39 a.ta
889,535,878 *5C864FFAD695EA069E5A2178896F4173D98F13EA athena.hoefs
889,535,879 *5C8120CDD81924423D9249A8D39509049FAB4E7A cblam
889,535,880 *5C8D7E4FD2536FB5A6C384D723A44FE058913C45 cc(ws
889,535,881 *5C8B86787A257612B84ADCE6700E3BA3FF32866C AUSTIN.NIELSEN
889,535,882 *5C8D9C8C462DC9DD3E420D64CD79333B556183A8 autoimmunization
889,535,883 *5C880FD5179E1D7F338EDFA15A26F573B172EF8E cebuanas6
889,535,884 *5C8A58D5272160DFC3985898277065CF0CAF14B6 CEQYWQR14
889,535,885 *5C81A72AEE53A36CCF823AA2899848C8519AAB10 ch;
889,535,886 *5C8D69A1091903FB6F260EFC50D28D57AE95FB26 chancediss
889,535,887 *5C822D118F551771A5EFEF4C85CFF49D49F42B6D B0WN
889,535,888 *5C83EF23ADE42EC9964B72940FAC408E49CE2586 CHARMAINECUMMINS
889,535,889 *5C85868F81C23FDA7449E0C520F82346D192B752 CHARNIAKEVICH
889,535,890 *5C85EA2C4B3241F733D1806F6C1D9E43D7E9A807 CHEBELEW2
889,535,891 *5C8FE6BD98DE9C89697070DB8FFDDE950A7A8BE6 [email protected]
889,535,892 *5C814DE1512E4D97FA81002CBE960F355143E7E5 [email protected]
889,535,893 *5C83286D8CD8F6EB368DCD572BA53F410AABA2BA B!4SX
889,535,894 *5C8D7CAAC8B2076D521A675DCDD377288900A0B8 b5uj;
889,535,895 *5C8AD25C6594E4A4142583435651A108F8C70460 [email protected]
889,535,896 *5C801BF39A3635FFA9B6CE834CC790DEF78C64E2 b7f%1
889,535,897 *5C8E240303409C72FEDB3DA3C8FA9F0EF89DEC96 chishirodai
889,535,898 *5C8A02B5D92B819539A4401060DE511D07A7427E [email protected]
889,535,899 *5C87BA49ED6276FA1301D4581E1FBD50A49ACED8 BÁJÌÍ
889,535,900 *5C8696521A5FFF5973C19D7471339CE44FA01712 c%i)i
889,535,901 *5C870456F05AE7FA9B7F050926A77BD438B6C600 bandpass-filter
889,535,902 *5C86940F48EF899419650C6B7F8F33198092220D banwidth
889,535,903 *5C8E0FAAEA87BF0CC3A26E47F28CF59560D8B0EF [email protected]
889,535,904 *5C86923A9B5666E6B65BB808018C17BA79EC1B95 BARRYWILCOX
889,535,905 *5C851DDE600976F1D4E2B885E3C0281E3802AE45 cjn#!
889,535,906 *5C8EE37B705C65B0859AB42BEC7C1C22FEAE6F7C CJO(
889,535,907 *5C8C43BE8FFD17716262F613426B5A3AF3BC82CB ckn-k
889,535,908 *5C84C3F7F0B1CEA48A10958E0FF1350829BB9C32 clairsegur
889,535,909 *5C84993BEB6D5FC65FF34F6F6DABC52D7393F03B BBERIL
889,535,910 *5C8AEB0C58BEFA03B9B96CA96716FB684A8A1BA4 b_b%j
889,535,911 *5C8A3F93F4BC9C64F606CA6DC5A327BF3C9097C0 BCAULKER
889,535,912 *5C8DA500725E4B6346D7D0E4CA61A2E9BD579A41 CLINTON.BRIER
889,535,913 *5C86CEC73B80BAE04C87C3AA4248234666AEF353 c$%lq
889,535,914 *5C8B6BBF50149444EEA4AE45A7CB74EC8D652BF3 bdksu
889,535,915 *5C8D896990AB0C3B32E8BF513FB6B90A180CEB61 BENNY.ADAMS
889,535,916 *5C8B93D5148D3C6583466BF1ADED9559236475DC bennyschattner
889,535,917 *5C8E43B4C6B5103E7F54A11FB0F7AE2014DE635E c&oe&
889,535,918 *5C818B3FA2B0A561245593B80A788CDA6861DB76 ?BERKRUSTENDER
889,535,919 *5C82B805D379294F97C180734D9D8354C3463070 colewort
889,535,920 *5C8626EE7F44090D1FE0EABC3068F09F57034599 BEWAHRST
889,535,921 *5C83563161A9BC8EE9D277DB7C1587904CBF349C [email protected]
889,535,922 *5C89792AF53BC53E7A6DC1882437DFFE2434D345 Bf;Z
889,535,923 *5C81D8365A0BEBC26944E431CF3D5D23CCBF4F03 bh-ai
889,535,924 *5C8C96C09842AE63D68718AA6C52801700574323 COOLGUY6969
889,535,925 *5C87371BEFDBC4847AF6A96D402313B65B06BF0F COOPTSES8
889,535,926 *5C828920000E0651BB676D0794CF1677D285936E BI;?(
889,535,927 *5C8904050538A7060230531359FBB14B6AF3182F BIF3S
889,535,928 *5C8FFDC8C6994ECE46D26023674761FEDB1AA7D9 C;PIY
889,535,929 *5C8A19753373ADED99D8C7B47CD1E4BFB20124B2 cp/,t
889,535,930 *5C8C7E445B261D5B01976F5B95BC5F969A84E6A2 bk_ic
889,535,931 *5C8F899BF4A8F5F7724AC113442A26617DEBB225 bk;,u
889,535,932 *5C89641BE3BAD34145D77184C5D91071F75AA92E C-RN
889,535,933 *5C8ABEF3FFD61C33E263FE31B84C2FA30F947182 c$)=s
889,535,934 *5C85EDCF9043600B7C66BAFDBD5B7F5FCAD911D3 c$s%%
889,535,935 *5C82313806D0F509EAFFDFC1DCF094F5EF0BDC6E cs0;a
889,535,936 *5C8140B82D0E6AAFF6ED7E24C89AE496DDF0BA30 CS?T,
889,535,937 *5C82E184A90F57B9D850AD30BF3E66CAD4766EC0 bmidh
889,535,938 *5C868EC71FC8D1DEF0B8693C6F1C1EF2CF064A60 CUBHT
889,535,939 *5C89BCB19EBDF5BF802FA30AE18CE49C5526D281 BO3!:
889,535,940 *5C840BD8FE96CD3C8F5BDEDC9C550DEA26D9607F bompernsiero's
889,535,941 *5C8A56D26FB94052219DCC17730D7F58453C1832 cyber-mambo
889,535,942 *5C8EB3381F510039F86E03AC57EC7BC1B8125965 CYBORG
889,535,943 *5C89C9E4E4627945D7914BD86884CF2044899596 BOYCEMASUCCI
889,535,944 *5C829DCE70EC063CE911ECA0F93DD7FA02452FB0 BOYD.DIBLASIO
889,535,945 *5C8A9867C4FA4DDBFE7501B8D56DAB3B6E1E4143 [email protected]
889,535,946 *5C8023F0EAF45FED55488C4793C9B643CCAB5DB2 B#P`SPLAT
889,535,947 *5C80AEEAA1002E050D09977170D8ECBE63114013 bqil
889,535,948 *5C8E31735D75A5CFAC5B6F9E5E3730F1469E1803 BRAINKREIGER
889,535,949 *5C826C3A8265B04CCD31EFFFA4ACD5E650B19FAE BRAIN.RODEBUSH
889,535,950 *5C8C814A7768E98D13ED61C4B4DF5690269C9AE0 D6CC4
889,535,951 *5C8D756924B3F2609550F6CE82D3AB0C2A907807 brevtsop2
889,535,952 *5C8B3FB32623A80385B47A8004262729C6AE1727 d;ae5
889,535,953 *5C822C0F9239F40370E3D74CED80328234C3557D DALTON.OBARR
889,535,954 *5C8D784857E7E7F6EE026CB4FA262D63CC67D449 damienjandrin
889,535,955 *5C81793E100F5A815AC2D0A164301A3FBB169578 DAN.DESBIENS
889,535,956 *5C81DD26A5AD49C08A6443D6572EA831755F4ADD danilotanigawa
889,535,957 *5C8917076C5634103B9D78BA622C649F4E876D11 <BR>PRINT"&LT;TR&GT\N";
889,535,958 *5C8EF92EB1B06CF7309739DBDC10554B4B024E70 BRUDTES1
889,535,959 *5C84D79B3EB6760F42BA996C6320F473FC0BE822 [email protected]
889,535,960 *5C8C9894CC9A50683489C4C791B7462243247859 BS%81
889,535,961 *5C8CC1D9FC9825C9EF9DD1015E21E3C6FE8AE60D bswevitingo
889,535,962 *5C8FE3EC824218BA786809D777109159E549F705 DAVE.CAHN
889,535,963 *5C8BB17E2CFDC4A7AEB49FED3FCDFECFD715135A BT=XV
889,535,964 *5C862AD996CB181E114585A8BB1998B72324BA6C bu:a;
889,535,965 *5C8170624CACB481940408C12C63591DA6D23FC3 D&BI:
889,535,966 *5C8C730416414ECB7302ADAEB39E472CB0F2F9EA de(7r
889,535,967 *5C8912804400E92BBF9CFCB9D28400312F7859AC bvyne
889,535,968 *5C86B19ED772315AD600C65A0CFE69D6E8C8FD4A [email protected]
889,535,969 *5C8D18CFC220220D62567D8831AC6950092E9F84 BZhv
889,535,970 *5C8B5DBE7AEEFCDF3EAC7F5E54465991DEF877EE C0NTN9ENTS
889,535,971 *5C8499FA02BD1F46CA6F4A00E0AB09EECDFB49F8 derekdodd
889,535,972 *5C824AF222A1418A1BAA8B1F36D3C11E969A5468 c2r5#
889,535,973 *5C87F1EA21CAABFAC85ECE9FC39198F17CD8CB65 DESCRIPTIONMORRISSEY
889,535,974 *5C8121C1C18F720EB28385FBF9578F1E9DA7ADDF c4wm_
889,535,975 *5C8D2CBFC842F36DAC6BE8D7E395DBFC9C023CAC DETJI
889,535,976 *5C8A7B70A0E24F4A6D3D00AA31589947F7DCECF8 CACHE-MANAGERPOWYSG
889,535,977 *5C8ADBDCA4C9F7C23163C0D32156D57FBFFC1D8C DGKPF
889,535,978 *5C814563AB98B0917C7416B5A343AE36E21F8CF3 diamonds&pearls
889,535,979 *5C8FAC9BE9D6093469932B2A2EA9D7342257D4A9 CAPTUREI8
889,535,980 *5C86B52BBE3299764D1A8BA3B05BEE754E092A85 DIEGO-DELLA-QUERCIA-E-MULINELLINETTA
889,535,981 *5C85A08A9BA455F1B9E836B9A6C616BBB804050A CARTERWALDOCK
889,535,982 *5C80D412E269D5BB57946BCD2A51FAD2850BFDBF dipum
889,535,983 *5C8B01999CBB714F5987A67C2799E8763DB36775 CBA8+
889,535,984 *5C8E7DD23417F905F1F857FA1A46884BA53BD203 DKPD2
889,535,985 *5C8913B6383084DDB3D14BE5D946318726CFBEB9 c:c8%
889,535,986 *5C81C51D101F596717DE00CCFA8F91477D0F986C CC-CARR
889,535,987 *5C8E17E1E46804E3F5CD1AFEE176303719CEA6BB [email protected]
889,535,988 *5C872ECD729E430C831B00B37410802C00BB2ABE DL3Q
889,535,989 *5C8FECDF4891891ED358DA690819381491F17EF4 dn)=p
889,535,990 *5C8720E6F3EE05F92A85D38C9F1977C03F7D21B6 DOCO?
889,535,991 *5C8426F4E05094121E88229BF95A42C4C93724A4 DOMINICZENDER
889,535,992 *5C8FD6264D45E00E2FB85F3D4D23E3243A835EB9 DOMONION3
889,535,993 *5C8FCEA88550D60AD3F49CC8FF8993922FD0CAE8 CGGP
889,535,994 *5C8C7BF0ADD46D9C2B307FA05B2302C377641A12 DONNYKOCZUR
889,535,995 *5C8B02F46ED2AFCE2544554F053DFE586CF48A5C CGSr
889,535,996 *5C813E799D07174349F013B5E9445F8614C059DB doralia
889,535,997 *5C8712450D0C6E512485E7E774288B6B31D857B4 DOUGLASSCOTT
889,535,998 *5C8C3F7C89B74E23978C1B3DAB9AA555AB4DB466 dovg%
889,535,999 *5C85CFE1B161B7CEB9E0C4686D647F908EBB6764 CHARBETJI
889,536,000 *5C8E5DB36B85CBCCFF1A239209714A29B81ED691 CHARLOTTE-BROWN
889,536,001 *5C86C499936D4A73F5458F1171BB42F8BBEE6ACE DPHNTYP1
889,536,002 *5C879E0C292E01365038C1072ED6B1BDC3F7A93A dpudestatens
889,536,003 *5C82ACBFEAB448F34029A13C8C490EA27E7952E8 DRANCEL
889,536,004 *5C835D9D0776369FB75F0F19C3BD68F56CEE79BE chongpinette
889,536,005 *5C8DFD0AAAB90E0EADA8499695D797A9DE80CC7D DRX#L
889,536,006 *5C8171271C37F2E86F5C3C2CC7D2B074DA2CA212 dsv$:
889,536,007 *5C88117F28EFC0845E878192F5ADCEF0067FEB32 DTGDO
889,536,008 *5C87A5E56ECC3121FF6BC5D0ED9FC0F0D6B7CD40 CJ&=D
889,536,009 *5C80AD2C6576983235B4B30FFD4A79C09F44BB7C claynicholas
889,536,010 *5C8F22914B3F76F98EEA63E0EB43DC0B5833120B CLEVELAND.SCHLEMBACH
889,536,011 *5C89419C08540868EA612FEED16A8033EB3745BA cliffvitantonio
889,536,012 *5C82E9BA6D0CB3903F09545971EAA9A42C31A799 CLIFTONHEGEL
889,536,013 *5C830605872B25004E3BC2A3EF4D8F2FD2117781 dz_:b
889,536,014 *5C84BF09905FD38F7B036C936928AF76F7E1F1CE dzhm6
889,536,015 *5C8CEA2D5EAFC9D3D549AD295005C97D448C4A2C clintonmarcheski
889,536,016 *5C8EB3EFF57C763AA52176384E10DB3412C0CCC0 CLINTON.PALLAZZO
889,536,017 *5C871B46D25780AD9FD9539EC64D23B2B60638FE cloppenburglandesgrenze
889,536,018 *5C82154617DC169ACD9541D30A96EE42B4351217 [email protected]
889,536,019 *5C8E2B63C33EF26F295354F7EEE2BF43DBD17013 CLRCK
889,536,020 *5C81222448C0679E28309027B8EFEB52E2A8B109 CLV2S
889,536,021 *5C81DBC484F2AA93E5C617DAC5C900B47BD289CE EB3RO
889,536,022 *5C80628BBE5AB20E7C067D13760628E5B21D7A94 EDGARHARDEN
889,536,023 *5C82565403DBE8946358659E56A79E40F72EA8A1 COJP
889,536,024 *5C801054A568F65E4D25325FD1D60F7A7EBDD130 COLBYSABORI
889,536,025 *5C8900270D0A7BB846C52F64D0CF3264C251709C edq4&
889,536,026 *5C81F0C52A9942EE9EAD78B141F267B6E880097E eduardotica
889,536,027 *5C85A6C3E6FF0C1BD56A2B9BB55FE38DE416BEBB COMPA
889,536,028 *5C8E4D1BD773A91D717AF3298FA3D74C2131D729 computertravis
889,536,029 *5C891CBF5C1A3D26A897AD3D15781F813310A5BC egfvw
889,536,030 *5C8272A68B95325E78BC657F973404E07ACAA733 ei0gs
889,536,031 *5C828EB46C9EB818BC0321A27ACD71B7E0897953 CORNELIUS.GROSBY
889,536,032 *5C8FEAAA0801186A8BB0E5008B2C40F198D41EEB EITAROCED4
889,536,033 *5C8143CD8268DAF81AC160DB8CD508D07D7619DB ejntin
889,536,034 *5C80DBAD28D7B295ED9ED979CBA6F3C09D1942F0 ELAGABALUST
889,536,035 *5C867AAC316F065648C87CA57825F233C097FAF5 COWICKLOWLTC
889,536,036 *5C81D86899717667077A0FBA032004BEEFBB1E68 COY.KRUPINSKI
889,536,037 *5C84E75B9058754D778266B212CDE10C3A966295 eleanor-daly
889,536,038 *5C898343BF664CD0EB0B60746269A4B8D76EF990 cppxjank9
889,536,039 *5C899451F89768926EC3F994FC82351B21D9C42B C:\PROGRAM FILES\MICROSOFT VISUAL STUDIO 9.0\VC#\SNIPPETS\1033\OFFICEDEVELOPMENT\WORD\FORMATTING\BOLDARANGE.SNIPPET
889,536,040 *5C80649B42BCE553AB511160F5F2A4708DFAB640 c:\programfiles\microsoftvisualstudio9.0\vc\vcwizards\appwiz\mfc\application\templates\3082\hid_edit_repeat.htm
889,536,041 *5C8F3B4D77608C84E6307585D5BDB66F0F303C3F c;p=z
889,536,042 *5C8B1E1E906CA97F477ACDA66B0F535DF8A92DB6 ELISHA.SUELL
889,536,043 *5C84ECA9376486E916A59DD858CB6BC58EAD4EA7 C;Q2$
889,536,044 *5C8636AA0E6702D5BB2C9D198EF125B80A275772 ELSONCHIA
889,536,045 *5C875ED9B8317F9F9B11CDE4237E2D49280868DD CRIMINALJUSTICE-SCHOOLS-DEGREES
889,536,046 *5C83EEDFE08EF888B3A8743BDF335C933D5EAE66 EMANUEL.PANIS
889,536,047 *5C85ED1817A492CF8FECB3C6000F07E22DE3F831 embid-guadalajara
889,536,048 *5C88211DD8B393CE9C33B8DF9063CF5E7F726DBE EMBUCHAR0
889,536,049 *5C82399BC89822D6CA0AEEFAE7AC495A33DC3E29 emelyncruz
889,536,050 *5C873871E50E127B9F86D445E41FE170D6C7E799 EMKP
889,536,051 *5C809B4987CEF0C72846C69DA54BBE37B549A2BA emmanuelwahlen
889,536,052 *5C80DE4991B29E986C9B4CDC19E66A4AF42C0B72 EMMAPORTER
889,536,053 *5C803ECF56AA98A61F5790618502E56EE2547D5A EMPLOYED4U
889,536,054 *5C8838A34C476F0306E0BE779EBC58FFF8404F81 EMPLOY.UCHC.EDUEMPLOY
889,536,055 *5C816A413761FAFF77F18698B83436EFD6675A50 CTFD
889,536,056 *5C8978A56BAE660D00695C3B240409C81D5A276B enikcolb
889,536,057 *5C884F958C438B7F9F6680521140750272C7583C [email protected]
889,536,058 *5C83E50202E8012CE73FC58DCA53D4933EC65BDE erikcarlssonsonett
889,536,059 *5C813434ED23E45ED8AF83B1607B49CE619D5D90 ervincolon
889,536,060 *5C8BB446603EEA56FC7E323554B20D5FE5A4978B estebanmorla
889,536,061 *5C80404324FE0E997E18F381C59BB26D60ECA803 d1tr"
889,536,062 *5C8B0F52D806BC3FE5DF0F88DE7A51C32CC1AB3D D&3O1
889,536,063 *5C81F2D7133E8F9CF749B9561F7C3E13933BF82D d6$a1
889,536,064 *5C8F2A825A044A1EEF58E43E31A02A4AC64EAC14 EXITOSNORTENOS
889,536,065 *5C8BB51BCEFCE1BD54CA06EA14FF84E5D4C70D31 D9BQR
889,536,066 *5C8ED00FF0B567F00ACCACF2037553DFAC197A57 dallaskelly
889,536,067 *5C87B25CA89A67C00C98430DC22B1AC8E154772D DAR...(DISKOTEKOJ)
889,536,068 *5C89BEBD4E3B716D4EF5F8CC12DA6AB429B57952 darinfrisby
889,536,069 *5C8C53BB2AC92256703EEB05539849F3A5541E64 [email protected]
889,536,070 *5C8EE639CA06CC6F81BE5A7B4BBB27A417069FB5 DARIOLAFACE
889,536,071 *5C8C304BAB2F98B6CA3CA1F6FCD44B45D03DA903 darjean8
889,536,072 *5C8BA941C66D756892EE816F54E05A4E28909D27 fiaduri
889,536,073 *5C8FEADDA261AE1E7AA5A370F380E3AFA41CE917 FILIBERTO.MEHALL
889,536,074 *5C8B69B1DBC2C66BB402101E30CB5BFDAF4FA6EB [email protected]
889,536,075 *5C888E03CB14ACC28C781B391483C798858086B7 DAVIDGROLL
889,536,076 *5C849AEB98F1098FFFAA1C88B47E3C43486A91BB DBf;
889,536,077 *5C80A745007B7E24CC54FDD6146E9F07620EC30C FLRAINFALL
889,536,078 *5C887243F8E0305B271A1C6925C27E4734D00957 DD4SGLAEW7RJTDA
889,536,079 *5C86BF9111DD0AD4A2283DEBA065B2F180845013 for key escrow products.</b></p>
889,536,080 *5C8BF3422DAC2B2BF6EBE85F49978CC3228068BC FORRESTFRAUENKRON
889,536,081 *5C8982249BEECADA4B1366D224DD65291ED0E823 ddlhs
889,536,082 *5C81E1808CAC6C5DD51163B85DF6D56E2686550D DDYDAISYING
889,536,083 *5C8A99FB45506B3DFA49957DAB6EEBA352FA0C88 francesdunnegan
889,536,084 *5C81DC9B68E0E18D20D22D0927F94A34430D62F7 francesfiler
889,536,085 *5C8F3468D50F8995707413DB738FB24ABC85BCDE FRANCOPUNTEADOR
889,536,086 *5C8B9FE21655A1EEBD54CC0CBDA969E7AFBCF8B7 DECADE.OR
889,536,087 *5C89CE1CF14FEFB528CCF122E52717209018028F FREDDY.OVALLE
889,536,088 *5C8E2C0AF8AEB865D56A69120F469EC170138ED2 freddyrubloff
889,536,089 *5C8184984BA1841BEDDFA37C80573BD0CF6B16AF deepali-shelar
889,536,090 *5C8371FCBC8118C0C0F52B14D20E1533C6D369DB fredmcelhiney
889,536,091 *5C8E53EE5D643EDA5798C6B3CEEFEC7182D3F924 dehning8
889,536,092 *5C8037DEEB664EA76ADFF842AF979C16CB65635D DELCRICNE1
889,536,093 *5C885F1D19F6DC29E891DC5BF1347B899766855A FROMLEVEL1
889,536,094 *5C85AC3D5722312DFE4B9261476DE943C4D779CA delwinn
889,536,095 *5C866581E8FB6E083FE7781F5675939E8205CF85 DEMULOLHES
889,536,096 *5C80548175C3976E5B9D33432951E68D989292EC DENISEATKINS
889,536,097 *5C8F1972A5D4F1DB3A64A30859237F25C20A7727 FUNNELL1KE
889,536,098 *5C86B0F4E5A1EC13E948F575BE352457210DF6B0 FUNNKEL
889,536,099 *5C814030D703D572607598AFA90A30ACA6DAA838 dennyvallentine
889,536,100 *5C86D19069E2D884AAD8F2A68AC3695268AB1EDF denverpust
889,536,101 *5C8262D7C1B6B139BE0F200C553BA2BC864144FC fwamount4
889,536,102 *5C8A88A93C59E0F94BAE897E7BDB90BAE0334C1F deoncoddington
889,536,103 *5C8F4D2091D4634711740FD7BEAD5CD23F1DC3F5 DEPENDING-ON-HOW-THE-ASSOCIATIVE-ARRAY-IS-SORTED
889,536,104 *5C8A145AD5B8767F77753CA83E14B0399BA16BF8 G3BT
889,536,105 *5C81714C877A9777D8F822A0166DF480ABFE0E72 GALEREAUISH
889,536,106 *5C86912037620B667B803B154A63247EE1474115 dewaynefaulk
889,536,107 *5C8E830E0817F252ADEBF490F589EC05158E5238 gard3n.f1
889,536,108 *5C83DEBD0BBBDCDD50C5D58E6534B8E48202E467 DEXTERCHEATUM
889,536,109 *5C8175217050DBDD48DE73199BD393EFB8928704 DEYUSWARA
889,536,110 *5C8CF53913FF8DFBF7551951570CF75FDC3F2A1B dfeq;
889,536,111 *5C840290C6738C033C5BEB3CE9A93FE0D3AF657D GAURAVKORE
889,536,112 *5C88B8697C91E64E7CD542FBB612076FFABE18C9 dg%bb
889,536,113 *5C8961E0E76EB1D478952225A2F0CAD0672017EC GEDIMÍNIDA
889,536,114 *5C8502A058C003E0BF9192CFB308241A85B065E9 GELUIDVE3
889,536,115 *5C88BE284FDBFDA47E01CC7B862001445E123F45 d:_hi
889,536,116 *5C85A889624F1B3263B09DD14A84C59B016302EB d&hkh
889,536,117 *5C823F367082680A435CD6A3E0414CB201016ED2 GEORGE-GROUT
889,536,118 *5C83A69089EFBA8E905A93BCEFA34B76552B7970 diana.boyack
889,536,119 *5C80285F8F415703AFE12D2F977DB7490C766B4E dianenowakowski
889,536,120 *5C8018E8AD57018C08B31A134B74302311994701 GFNTSRD0
889,536,121 *5C8EB2FF871C4E5BF21B43C5262B18074B7584EC dirkdenger
889,536,122 *5C81A9F33E28051B9E25324DF2BE49A3676FF129 GILBERTOHAUPTLY
889,536,123 *5C8660EE105AD7627E0E80559352A646BB4C93EC Dj5
889,536,124 *5C872CA96C5D92616373FD4D2DF08371201F4463 glasthal
889,536,125 *5C868D5A12D72E64190319D7876BBCF8588B7D41 [email protected]
889,536,126 *5C87EC7553E0D53800E56E0E95BEE5795FDA99AF globeplus
889,536,127 *5C84B85D2322BCFE7B7879190135342E304F4535 DKjv
889,536,128 *5C88F8525978A32317AC57F35E398036BB9065A1 gnuohk.1
889,536,129 *5C8E9E7B39DFD2F3797FF7F891B3706D11706AD7 GÖKBURUN
889,536,130 *5C83EEEF7922D3DD1B28588944D5971B608C79D0 dl&ly
889,536,131 *5C8EC1B551D9F6A462FA73C0AF2E1846E35B4EB1 GORDONCALDERON
889,536,132 *5C8F7BC1FB936F3C7066AC9C7D6946FA17D97532 gordonmethodist
889,536,133 *5C8D27BFF32AFAE7A448A8943A4E7CB7611C6725 GRÄNGESVALLEN
889,536,134 *5C887A994EB00A14378F3A4CA819AC2AA60DAEC0 d;n8i
889,536,135 *5C8F04A6CA7F18F51A44456DE280DAAB19761B9F DNF8W
889,536,136 *5C8A12806BB1744E8FDE0CBFFF7FD3B45DF7D91B dominickcovitz
889,536,137 *5C82E27BB1C118FE4BDB07D6C16FED6AB23B86F5 [email protected]
889,536,138 *5C8812DE0A47BE5971A2DE86CA84A9317782EF15 DOMINIQUE.STJOHNS
889,536,139 *5C89B322DA844CD763C935A7A71E48BF6E2B2BBE DON.CURTS
889,536,140 *5C8BEC26D74CA08C6DB1447C76EB20A55EE41A75 [email protected]
889,536,141 *5C8B859ADAB530DADF9AC96EF2177694E85E249E DONNA-PISCITELLI
889,536,142 *5C872626771D1B6BF0A5F5582F5EB2F124765627 donnnordan
889,536,143 *5C87A66472A9DDA3BD66D28689052C3427529341 GUS.THRELKELD
889,536,144 *5C8F3193E1A88103CEFB4E7652EA72155CD0AF66 donnypender
889,536,145 *5C8C1B2062DAFB501B6C1F9FB688C2C70319BAFF [email protected]
889,536,146 *5C8EC7ECA677C52B27238603C0A0FD138AE82068 doowarbez
889,536,147 *5C8DBB5FC82C8C023ECFCB66C05E899572E45FC8 H1P}
889,536,148 *5C8A97D7D18E40C1EA5C3012E0A8A84A743892CD [email protected]
889,536,149 *5C83CCD4139C4527B02BDEE8ED72AC2A5AD88AFD hamid-reza-yaghoubi
889,536,150 *5C8AE3503AB10CC32BEEA418500E06C864B04767 harlandarwish
889,536,151 *5C868D65D99129F9FABDFD5061BC98034574946A DQWE_
889,536,152 *5C8F9095800B4AA0D1604AB3D9832E8259004A59 [email protected]
889,536,153 *5C8278E8446F9E2CD458B5E063FC1D3DB9C72111 drff&
889,536,154 *5C8658B2C8E2A6353FBBEB498653C435E9294AA4 HDLSSNSSED
889,536,155 *5C8A63A17041FF48AFD811D163883BB344403F38 heathahalt
889,536,156 *5C80EC0210D6E43ACFCE2F4CBE43278146C9C31B dsiulpeg3
889,536,157 *5C8379F42AACA5DFE8F22A7E32006A5735D9C36A HEY-LAURIE-DANN
889,536,158 *5C821D8A914135DEA4DC8CE285B81663045E02CA d.um.aussem.bush.zu.winken
889,536,159 *5C872047619B57FA7E74D3E3A80CC7B114E3BD7E DUSTIN.VITERA
889,536,160 *5C87B12391481DDEC840E9EE4C9C9D32501637EE dustinwasden
889,536,161 *5C893BC87B3AA9977F4D1DE783E86CDAA9F5A19F [email protected]
889,536,162 *5C8A6697772BF95AE95D0DCFD453A0EF7BB12508 DVSOKVO9
889,536,163 *5C8B3C9482BD5E28C94254AB32D16DC1319327A7 HOBERTBENNIGHT
889,536,164 *5C879265AC67995ED61604FD85D784946B6092C0 hobertcrosman
889,536,165 *5C8B1648C7530E0D62F067C2D20E1327CEDFA0E0 dwainweinbauer
889,536,166 *5C88A5389359BE029FCFB05A3771105E32BD23A9 [email protected]
889,536,167 *5C8B84A30E72307BD4D0B0D362584D6C5F06185D HONEY ONLINESHOP
889,536,168 *5C83CF6232BE300A21E2B34DED3E2026192661C2 Hopeless-World-(Part-Two)
889,536,169 *5C8589F8FA4004C54801678BDAA8936E723AF1D5 [email protected]
889,536,170 *5C89B17EF1B673C4E2B2C2441D49F229B78C53FC dyk-hooks
889,536,171 *5C85C724BE6CD60F2A16FCC9D8CBE1231134C81E dyttens9
889,536,172 *5C82672654C18E4EE75F68860906641B50969987 H^P
889,536,173 *5C8CB5974931E734AA6B1D24EB8511E367957149 ECDNU
889,536,174 *5C8F3DB236B827FE810952BD6D974C16ACF1B971 eduardomanzi
889,536,175 *5C8093ACC9F2C2086F5565585D8ACB97992A7AD1 iamlinda4
889,536,176 *5C8E1AB0862B346628C8E481D1CF347FE2125008 IA'W
889,536,177 *5C8836A4CF347162E46D672A82FDB0631E7C2BC5 egnokalf2
889,536,178 *5C8CB6D8693A042EF26735F0146FD3DADF081E79 [email protected]
889,536,179 *5C8109E92ED0AECB696C27612AAE887AD17D67F8 eh?mn
889,536,180 *5C84E7457827F6FFBD4B5BA9635CB8B93D7F5C7A IIITALKABD-EL-LATIFT
889,536,181 *5C8990B295CC533AC6A20474FE462A9130802A3E ek4yf
889,536,182 *5C8B26F6E7B0FDAC59CB122E2347B2BD2F961BF7 EKHARTZEN
889,536,183 *5C83D9CDA193C03129DF05995813FE8185F9E360 EKP=
889,536,184 *5C8711CD893D3942AB1D4CD706C415157D2E2CB9 ILIXANTHIN4
889,536,185 *5C8570E76B02C9898C022BE3DC9AC38FAB4EF370 [email protected]#
889,536,186 *5C89358E8D249004C9D5F53A21F58A63755EE8E5 ILUVGETOUT91
889,536,187 *5C84E0E9EEB8C694909B1C4B2C6C609444AD5A45 ILUVJAMESBOND2001
889,536,188 *5C8D9BDDF1FC93F2C74C5D2DF01B637E58D728E7 ELKGBB
889,536,189 *5C8D2471BEBE5C58E333F2DE6E092DE5C908FBFF iluvyukon15
889,536,190 *5C828FC846E2193DE3E08D754361526B07B3FCEF I'm-Workin-On-It
889,536,191 *5C88EAADB33B19941A41A3BFD9DB9D05CE83DB56 [email protected]
889,536,192 *5C8D55EA50F1103FFACF1C05486579CCACDB65C0 EMAM:
889,536,193 *5C8D73671872425D2D54B9173A1ED2AFEEAAF566 emelgnafed
889,536,194 *5C8F2693A7046E122BDB16A3B5774E05118E3D46 INHERKSS0
889,536,195 *5C8880E1AB76025AD3E7A73276D0102C29AC37E7 EMILEPARADY
889,536,196 *5C8A4DDD2E30A4886FE62AB0AAC82EBF345724CB emmetthelble
889,536,197 *5C8E95EA601F39068FAEF911F2797F6DBCE24D7D INTAILE1
889,536,198 *5C8BF6D6C3F927C1007B1842BDADF23DD3C74527 EMP
889,536,199 *5C82DB5B47B9E27E6444FF0F787C3E8C7B346276 ENELYME
889,536,200 *5C89F3D894FCABCAC95DB814418B4D7D65AECBF1 IRENE-LU
889,536,201 *5C80A370FE898AD86BA285660A7ED859A1BA86B9 ironclad-/ai/r/@/n'kl/&/d
889,536,202 *5C8A7F14A62BA3D9743958D28C3FD5878282C730 IRRELING3
889,536,203 *5C8DD1334C3E30851E9AE51AF8485F78F81A1418 enneitnoc8
889,536,204 *5C86C074B7BEB4B0027834072EB078947D3BF769 EN#S,
889,536,205 *5C8D1F1BC22198B9D7AF8929EEE44EDDA1F454A9 IVENERGO
889,536,206 *5C8375E8A521885F69B7A71B87C6C322DD76DFE7 iwra
889,536,207 *5C83FC482115FA29E10A0DF8BA75C559DB41A453 JACKIE.RIDGES
889,536,208 *5C86267FB3233971B4375220EEB02CE2183E8DED erodfiyo50
889,536,209 *5C82546BE550855C5081479B6C44AD516063EC4A ERSCHLUGT2
889,536,210 *5C81299FB3BE3362F2B4FD93FA752E9524AAC2D8 JAILPOW9
889,536,211 *5C8026DCB25C5128D7497CFBD5B7297A62C4E9CB JAIMEHAUF
889,536,212 *5C86F80EA9388C6369D0639870AB2AFDC579A4F3 JAKEFICKEL
889,536,213 *5C891ABBD824D67F6D2205E83811B86CBEEBFD43 jakekyle
889,536,214 *5C81181BA5A5427B3A2DE274B257791BE558FE59 JAMEYBANTER
889,536,215 *5C88A3A0E8224AA68E5696903D42565EE73A485F JANABLAK
889,536,216 *5C8B7660284AE5C14A5818EA49DCB530FD5DF518 ESTILADO6
889,536,217 *5C80C6427B6CC6DDC8671352D973EF8045D3E482 JARRETTAUTRANO
889,536,218 *5C870C37BBAFEA035983EC5C1791CCFDBC9184A9 etsgiguf5
889,536,219 *5C8262DA5F33ED1D15C74374E6C632F8CD2011CC ETWPI
889,536,220 *5C89F90AE3B5BD56A429761ACFB2D4EC8E4FBE29 jedsao
889,536,221 *5C8E6603566D0260DAAAE11FC6BC9F85218F2B5C JEFFEREYKOPICKO
889,536,222 *5C8F613593418BCD68130D5261F982853689635F JELG6PMRZ
889,536,223 *5C8D14130FEAB9E46E092593A857FD735D328BC5 JENA-HOLT-NATIONALSPIELER
889,536,224 *5C8B92FEBD32076766A4BD280F88B6FED7262417 JEREMYFANTAZIA
889,536,225 *5C8D66A79B10130DCCE2596D5DE4CF7A63708CB0 ezequielfaudree
889,536,226 *5C8D5216946D17362FC1737A595202AB240C227A JEROLDCHATFIELD
889,536,227 *5C82D22B7E81E9C047DB18317130A1076BC92E6E EZRASTRAUCH
889,536,228 *5C80B750AA2158D5E5DF4FE5935D9C83576DB660 F1o4twhe
889,536,229 *5C8C8BA12340A2FF3DBF1B1F9666691CBF549D48 FAM&
889,536,230 *5C89483571492BF88A012AD289099D9B77389A77 FAUEROLE3
889,536,231 *5C8405B9AC516E071C3038B0F59DD0402A44753A JIM-YERGER
889,536,232 *5C8BD2E5F10F0BC8BAAAC01F52C7944DA3080847 JOANNEGOODCHILD
889,536,233 *5C8B68BC8DE1AA53C100D952FA2649FD2048E78A FELIXTELECKY
889,536,234 *5C89550DA9F6B377AF79261107379A68593D7202 JOEPASION
889,536,235 *5C8DE572BD0E6D6B48D73D6B6DBAD9B4F0057841 fernsehnachrichtenshow
889,536,236 *5C8ACBAB36DE00F82DBE46021E8F66FFCDEAE9FC JOHNIECROSSMAN
889,536,237 *5C8368B3E56AA322081744F8AB60C28A41029350 [email protected]
889,536,238 *5C81C6964105766617DB0319F474011792412176 jokesthough
889,536,239 *5C8AF5AA3B3AF4A2D79D122965222B98DC3141C1 FINIVI!
889,536,240 *5C8278D0DFC6C88212FF68A414AADEA6E56CB432 [email protected]
889,536,241 *5C8E52DAD27486BB8CCF2D56037D39EBF8E946F1 [email protected]
889,536,242 *5C83B049CFB2BE4F99E21A167D678F69720ED579 JOSEPH.HOUEY
889,536,243 *5C816F270FAC11BDC0945D82386AE66F32F47E3E joshmyrtle
889,536,244 *5C87E3E0A5B289B394877603C0AFAAB3B0A6224E JOSPEHPEPE
889,536,245 *5C8C26BADC950196FC582DC6BA9E5674C55F006C jps[
889,536,246 *5C8FF3FFF03EC8156F1C6340548C306C4326A591 J.S.BACH-6SONATASANDPARTITASFORVIOLINSOLO
889,536,247 *5C8B0611C0D5A5F4DEC6F375FAB4D5C3AE566961 FORTROENED
889,536,248 *5C8EBD33BAF55EA2B28F095994A83F45337BA26F jumping-at-the-go-go
889,536,249 *5C847829317421F3FEDD5795410AD2311CA40E39 fotognicas
889,536,250 *5C80E1182D9475804335AD0F2D2F5B9523B3B2C8 FOZIASULTANA
889,536,251 *5C8CDA3313D5344DB220062400EAAAC3176BAA96 fp(=
889,536,252 *5C8CFB5B9D0E369676FA2EA41726FC46F477FFED francescowey
889,536,253 *5C802EF7A370AFB50E4F87816FF0853FA383BBA6 FRANCESDEGLER
889,536,254 *5C84342515DA0A7518BDFAC2EBB1909F29805073 KABA.NDHURAIH
889,536,255 *5C8E363A25E54D17B1804E3F0611975677E188C2 kanmarad
889,536,256 *5C83ED3BF660DD57933B9CD39ABCD41BBB2EE1B2 FRIGHTISHLY
889,536,257 *5C8456654BB4A47B670E8FB9DF59FBD6EF85C9DD KARREN4
889,536,258 *5C8DEB5DA000E225C606CBE8C1822595EA33ED9A FZUPHAU4
889,536,259 *5C8E714BE78747DD2713A0ED364C0CF3C491A2DA [email protected]
889,536,260 *5C873FA1989FF9DADD656376E377E5A22FD9F7AE KEENANFERRERI
889,536,261 *5C8B70E231CF4BBFEAEF826175D99769BC1D485A G7\^
889,536,262 *5C83DA284A311DBE52566C92F95F8488A5473EE8 KELLIHOLLANDWEIKLE
889,536,263 *5C87437A2FF870784B3444093DB2EEEA80ED9107 KELLY-ELTON
889,536,264 *5C8A38BFC07A71299A514AD13F13FA1E5A6B38A7 kem.williams
889,536,265 *5C8A895BC2498E716888949FD995B6CD7D4465D9 KENDALLHARDEN
889,536,266 *5C8ED6374D5A7E6A6C119CCFBFBD77390551ECC0 [email protected]
889,536,267 *5C860FC20AA26091A8A0E2C07BCD19FD2855112C kepuska8
889,536,268 *5C84D9CAC3B3105A8D33F2DE9D405D88AB79D7FB GARISPONTO
889,536,269 *5C8990A2656DCF6CF5F47E33DDBF749D180B69F3 garretdugar
889,536,270 *5C88C708B52D350B69D9BC22589573F163422635 GARRETT.HUISMAN
889,536,271 *5C89773E1941F07C33F3D5614F74175DD9D43C0C kesamsta
889,536,272 *5C83A2A55669B75ED62CCFC5D496F3E9900A2AEA GARYGRONERT
889,536,273 *5C89B1DEE206D189110F1237F1607C208BE52CCC GATTACAX
889,536,274 *5C823C112B06EB4EB3C14DA6C76FF4D4CAF01422 KIEZZERR
889,536,275 *5C81FC18CEB64E887E3811B53998F0E3416AD2EB [email protected]
889,536,276 *5C8637397D5CEFCA279041509B0AAEBCBB5C5449 [email protected]
889,536,277 *5C88346205800D87B4F5881F3D1BECF6F1D4394E GENAROMITCHEN
889,536,278 *5C872734CC349DFA5E66A648739601826679682C KIRVESTS
889,536,279 *5C87506874592623A3FE49D0C7C6B648C01B9DD9 George.Raphael
889,536,280 *5C89108536AD4D17B3A5A0BA5DBCC6E7EDA4EDED knerpend5
889,536,281 *5C8ED3E82B65A1F779F7F5692014BAC2708B1531 KONFLIKT
889,536,282 *5C8D66EDF68D68A84306A2A1A1DE81B60246B216 GIRLCUTEA
889,536,283 *5C8232A783C49B8BFA2B2A7C0F2F23247CCDCE69 GIRUTVEKSLINGER
889,536,284 *5C850C9D10C92085F0CC282466CDC94B2F725F82 KRAUDELTING
889,536,285 *5C88AB0D7189DEAD83AE567578FC5FAE56834725 KREIZENBECK.COMWWW
889,536,286 *5C87523601B6757A84D8BEB5B8BF83A96B754993 gl0mm3d
889,536,287 *5C82EAD490F20373E0BE802954B2DD73A22C6C19 GLUSMANING
889,536,288 *5C82CFA6AB3758656B9D620C926CD6D86D6696A6 [email protected]
889,536,289 *5C84F838B6A47D533B19F03CA787A1BF0131ED5E kulicia4
889,536,290 *5C84CC76B760C0ABBA6C72376405923826BAD70D KYEILLA5
889,536,291 *5C838CA371A8017AD2F2BAE232308ACA6D7BD961 gordondammann
889,536,292 *5C8D8B18C72AC81961327235D3B9C00D8A14CC70 Gotitas-de-miel
889,536,293 *5C883C11103CBECCF19DA36C062113B7C4F4DAC1 govstrouble
889,536,294 *5C8FBA592BD82FEF0E14D758799A66004AA1367A G|}Q
889,536,295 *5C8C83A16B86B5C9C33FC42C62C4112DE6DC9EF2 GRACEDARAPIZA
889,536,296 *5C8DEDC3AECA8DB39B4D36CB9C214FF7C3EF4176 LACHLAN-WELSH
889,536,297 *5C8F1ABFCC9D4E569A69F02D10F28E08FC8A5D83 [email protected]
889,536,298 *5C86140F0F850C5EE9603A6C8C7011EB6FEC9E10 greg-champion
889,536,299 *5C892AC9D8B6F34F0BE392F140706D36CAD5BD77 GREGORYCHURCHILL
889,536,300 *5C8886655E8BA2326980267D5C8AEE3FFB1793D0 GUAYAJR1
889,536,301 *5C841271ECAF49EC0B9F9B97AC90D9304AEE1FE4 LAS.CUATRO.Y.MEDIA
889,536,302 *5C8CB29C51E68CB097D0C28FF4BC018C82E94FC8 LATERNENFENSTER
889,536,303 *5C8A898EEFC8FEF3DDD0716C0B38E3A344550904 LAURICE.HAVEN
889,536,304 *5C8AA44A7BD8AEF4F226ABBB9AE01CDC027A68A4 [email protected]
889,536,305 *5C89A1B45C6566F63DF402A0619CDB5DE04C8659 LAVA.BAR
889,536,306 *5C8DC703A35D615A67A1FC201097B54FF390421D gus1095
889,536,307 *5C850F73A6E773A85672C68F5F9C1D263E17EE35 [email protected]
889,536,308 *5C800B4FBC75D1504521711B68244C7323377575 haemovariform
889,536,309 *5C8B8AB113FD1BC57E55F299DD5F8FA3E2D124C1 ~~hana~~
889,536,310 *5C86B48AF8B5C7A3487842CFDBA7F2825BFC5E1D LEONEL.WERY
889,536,311 *5C849E151D236A6BBC4212DA90170D7A6C60D62A HARDCORECRACK
889,536,312 *5C82EBCB68D1DC0BA71365D8FD3FDE68A872994E LEVARMI6
889,536,313 *5C8FCD1F9369EB8DB4B624F769DDDD6127962D1F LEVIFUGLSANG
889,536,314 *5C8B155680EC9787521A8E3B011D5B6E3034DEE9 HASELHORST12
889,536,315 *5C8B08DEC5DB83FD6C509B105435D9959BE06679 HASHESES0
889,536,316 *5C8A807D9F5070D3AF65196E899CE0DFF3662399 l'homme m
889,536,317 *5C82B0BAF29500DC54336DEB535CD9850B57D42B hazarahha
889,536,318 *5C800D50624AF752D020428EA15062F7F86C9C82 he1ic0n$
889,536,319 *5C892A435C32307DCCD1E9C2116630E7470FAD25 [email protected]
889,536,320 *5C85E8AFE9CC5BD067210C8B89A8AE26AFBEC139 LINDSAY.YEAMANS
889,536,321 *5C852CDF52C82661389720279330902118CC5EE0 HELPTASCO
889,536,322 *5C881983AA27F66E7F9116B458589A0E0A553D54 HENRYMASELL
889,536,323 *5C862FBAB679C56E8B6677A4EEA597F04B53F422 hersheliqbal
889,536,324 *5C89820316E1A26A9F4C953DA6CF6C3B82039FC6 livebatschkapp-2001-02-11
889,536,325 *5C88BB19888945404EBDE226B003E89F9BE66CBD L{NC
889,536,326 *5C8F86D62C7D945518AB25C58F66729188FB326A hirut.gebremichael
889,536,327 *5C87D28EC3153D6B6181C8862AE48D74C68F77A3 LOGISITICA
889,536,328 *5C8DD524336E921E8DD3B125A2F7D13C67E730BF LOOKED3
889,536,329 *5C8FD7D63303E8A13A4EA69503E424F9B8AD1739 LOSKOMMEN
889,536,330 *5C809B20EAB92B7798F945A95752C2920042857F LOUIE.GUBERMAN
889,536,331 *5C85F8F289A930A06195A0AACCA73F95CDE494C5 HORACIOSABADOS
889,536,332 *5C8D0FE6D0397C03E7AD1B8FCC4E23D2ED41CB97 HOUCRU
889,536,333 *5C83F6CDA1A00DAE9DEF6D5C7F7CAC94DDE7CB37 LUCIOLEGO
889,536,334 *5C80CBB6F05803AC6BCE5345DE4689A044768509 HSIDDAF1
889,536,335 *5C85740B84A8ACB1219D35A23F88C57081E365D0 LUNGY
889,536,336 *5C8D851096321B57C70492131F93D0DCFA5F1E0E [email protected]
889,536,337 *5C8CEB5A53086AFBA0539B097B7C917CA9C0FED5 luthersesteeg
889,536,338 *5C8F72DB8C46A0E372E4DC60C57274EDEEE8A357 HUSKERSFRED
889,536,339 *5C8E9AD09C25BBD63EBFB986F4B0EA01C734E6AB MABÊNO
889,536,340 *5C8CBC80895CCE34920929582BC6B2B5AE71D586 MACFINCH
889,536,341 *5C89CF5C75C4E49504E67068F9B7EA597CDBBFD5 [email protected]
889,536,342 *5C800BA75914A9D2CDF89D893FA7C6CC5343BCA7 IESNASUFING
889,536,343 *5C8F0A8FD6E35FFFB4517B41BE080273DB2D862C if.i.know.you
889,536,344 *5C84B6D9432320F0D1AE4D222DD5634699F6658E IFITWASN'TUS(FEATKREALANDVGSKILLZ)
889,536,345 *5C871768E97653B5B5904EA4CEFBBEEC0CFCEAB7 IJSSELLINIE
889,536,346 *5C8309582BC48F00376954E5EB8AA6F56B9E2358 Ikkunan
889,536,347 *5C8E8DECEFCEAD74FBC99C1DF9C48DB25B7A8A0A marioncrosby
889,536,348 *5C8F1283937A1C0796FC2E31A29A629411C94D3B marionshough
889,536,349 *5C81B35E7C3E117FC4545B52D75BD8272E8C9E27 iluvjer4
889,536,350 *5C86967E956F705D97FECF9432BF29B1E510B3FC ilvsituing
889,536,351 *5C87E85EEBA09ED7BAB96298E12123B6EF85C9BB impressionsbruch
889,536,352 *5C89ED1714D660937F03607DEE84173964F2AAF7 [email protected]
889,536,353 *5C87AC01DDA8F600214ACC5FAC5A1D1DC5C7FADA indispensa8ly
889,536,354 *5C8BA0FDA760C0E67BD7DB49DA9E067097A0D04E [email protected]
889,536,355 *5C8310C4F48CCE099608B2AD55BF4ECBE1AD3D7F interessentskabsaftalernes
889,536,356 *5C86B61CEE253D64164FD777950A308CA6767375 MEALYBUG
889,536,357 *5C8CA18917291C591999F9C360DDA36D75F8C730 MEDNELL6
889,536,358 *5C8AC54B2A45D294E54E7598CDE16C7333B17E7E melissaskeeter
889,536,359 *5C88D18AC263F9DA2CB3F350BBE529493B55CA71 ME-ME-ME-ME
889,536,360 *5C8F7EF579E6DA845ED579D6D7EA457CB9F3F2C5 ISAIAH.MACCHIARELLA
889,536,361 *5C86C91F6C4570E7E89FDADE7351FE483CFDE6E7 MERLE.VO
889,536,362 *5C81B22A1BDA1F010BCA6802A9DB0449300AFE07 messef-dur,bwv233:i.kyrie
889,536,363 *5C80EF49918CF490507DD64D9F4F4F409DFB14D6 MEXICAN-PARENTS-PART-1
889,536,364 *5C8E8125E9909ACE8EF92EA626E112F4B9511B8D mgcalhoun
889,536,365 *5C80B8BF0A6B4613F7D7FB1FB94ACA19650F63D7 ITTOIHG9
889,536,366 *5C8FA87BBCDF683F37F881CF195407D7E3511FD7 IVORBRGS
889,536,367 *5C858EDF996C7B5F06F239979C8ABB72EF19A3F9 [email protected]
889,536,368 *5C89C3A11D0EE858BE918AD082837D918FB3FE7C J?8E
889,536,369 *5C8432ED289D5E15545A59490EF4C6C29ED165DC miloegloff
889,536,370 *5C8E677BDD9BC845049AC371094C4CB1612475CC JACKEMUK0
889,536,371 *5C8C1E9E9A76FEDD1056FCF4634770CEB8D99906 MIOVIRUS
889,536,372 *5C86973F5A75B82F5551803E2111878202521F5D miquelgriesbach
889,536,373 *5C8DF48A913140B7D80B75BCB325D0F18DE86485 MITCHEL.TROMBA
889,536,374 *5C85DA68808AB72681CE4546C642F43A058FE934 mmite
889,536,375 *5C8AFCCCEBFACE3CB60D26345CDD6F661C83DE55 JAN KAZDA
889,536,376 *5C8FC3F9B46367F0F0790B6FCCADA20DC2AA15C1 modelleer3
889,536,377 *5C84812760298344E5F812EB4C40FEAC352D933C [email protected]
889,536,378 *5C8396DDF83E5FAC1482C3E5A717FB008C7E57FE jean305
889,536,379 *5C8EB4268253CECADBA4F56945B50FD3F08F69A9 jeffersonjana
889,536,380 *5C83AC9D506C2858AD5BCCD9D7A1697CA1B031E9 MORTADELO-Y-FILEMON-LOS-VERDES
889,536,381 *5C886D6E14FB744F26DCE97514C1970508D61AAA MOSESCOYT
889,536,382 *5C87B02E9CE2DAF7F993A75CBE9BB1CA8F0F6142 jeremyclacher
889,536,383 *5C83D7EE6E37501EA6CE125920F26BC181DE4F7E jerrodarcuri
889,536,384 *5C86B387FCE2AE80B784008FFBEBE011CC9D67DE jessefouquette
889,536,385 *5C85D787B62EBB5126F23CDD33732906C5E67E76 [email protected]
889,536,386 *5C8D48269DD58ECE4287284AB04FE95103D78242 JESSIEBOOT
889,536,387 *5C83A8D5D96D1281C3B30059FC94BE9923961C95 JESSYGUY
889,536,388 *5C8974AC240B53E4253D5CE153B9D554BE933CED [email protected]
889,536,389 *5C850FD13F58095D0EA3CCF2B6AECC65D92D0174 MU51C4L154T10N
889,536,390 *5C889A899DDEB9F2463E08C5224BBA25565BAA90 [email protected]
889,536,391 *5C8CD35C52E0A9441198B1D084D6EC1727B4FF44 jibioneses
889,536,392 *5C88879F728DA1246373F10FF763EEA833B8938B MYANIMAL
889,536,393 *5C81C5144BC2A7E56BA40C15AC89BCC7AC1EA181 JOAN-ALAMO
889,536,394 *5C8CB8475E88B611837C5F920511066CF814CD9C JOANALSTROM
889,536,395 *5C8B9FE838485383654BC95210E773FECA5E77E5 JOAN.INGERSOLL
889,536,396 *5C82FDE0EF0052555AA2E272EFADAB922E891CDE johnathongrzyb
889,536,397 *5C8568D19D8E8E03801D0DC6A7F2AE0D762E1F4D JOHNATHON.LOVERINK
889,536,398 *5C824A8AFDBDD6A3FDF89EEC93F231612B2E185A N8YF
889,536,399 *5C8434BF48424C6D7925371AEA9B93B45C86917E JONAVIEM
889,536,400 *5C8251A85555FE944059E8474B02EB2FCDCA64C0 jonescorza
889,536,401 *5C8421E173E33940BFC366E352F9ED1D81425F86 jordandimoff
889,536,402 *5C875F08DD40041D8335ED7DFD95718E4C1FE0E1 jorgeapplen
889,536,403 *5C88A70FFDDCDC04C49358FED55E3B0DDA550979 narmasjuurestik
889,536,404 *5C8480B340675CB914E0DB36097F10A07BB3FE80 NATASHAKOK
889,536,405 *5C8FB1A790ED7BA201CCE671ACAEA5139C696C0D NATHANAEL.FRONICK
889,536,406 *5C801FE41D98E160A148ADDA91312200AEF3F06B NATHANAELSTAGNO
889,536,407 *5C8175C6746ABD9B5924111E95EDF69B986D07BB nathangevara
889,536,408 *5C825D721E9318F86C68D6C1617CF6742C05172F Nbornylacetate
889,536,409 *5C830579A32FB20134FBC82FFFCD05503BA78304 [email protected]
889,536,410 *5C80C8B303C7F3FA106014080A7E540D73DAF948 JPLANIDIN
889,536,411 *5C8915B587C350F73250522030EC168B61AB787E [email protected]
889,536,412 *5C80C13654D15DEBE1C3DA14E828EFE7477A96C8 nckllng4
889,536,413 *5C81C78710B5F93651CC83105B5467D896899255 JUDECANFIELD
889,536,414 *5C85F3B070902CF0A4FE238BD7101E6BD4CE4A53 judenrat9
889,536,415 *5C8EB45F7DCC5862575D955BFF577B3A36B36F01 NEOEUROPEANS
889,536,416 *5C8565E6E188CE26F76922B9B2FE6F59AA3C59F4 NERAVEBBED
889,536,417 *5C88C84A565661AE9E5B896D661B2A2D1A79B976 NEVILLESOLL
889,536,418 *5C8EF0649F8420D55B04372E3C958FA3729145EF newaddition
889,536,419 *5C83CA46D33D5520537E952505C52F13489D34B9 [email protected]
889,536,420 *5C8BCF3DDCC9D5C72AD479CF1CC18D15A520E452 [email protected]
889,536,421 *5C8A8B80E42890160AE060250F436D3B82C2239A nfoma
889,536,422 *5C885D144C220F2CDC0D378CB991D21E2F5E4D29 nguyenhoangan
889,536,423 *5C8F8323C2B722B0CF8EDA239B0003FF41AF3A62 NICEASS:DOUBLE
889,536,424 *5C87D2DCD6C2F1B654FFB8016DCCECD7BA30EB68 '~kaaa
889,536,425 *5C819BFBDC2820B234EBF7D988733F36EAFA0968 kapaopango
889,536,426 *5C8BF85CBDEFE9C617FF6A023D68AB78B56E2755 kareemhaulter
889,536,427 *5C8F8B26A78605C76C55A3D100F2B5F3534CBA87 KAREN.FRANCK
889,536,428 *5C8846C9E1192DC6A07454AEA06BA2B5F307DCFC KAREN-PRUE
889,536,429 *5C889D8E395EBF6B35AFA4F59305D9EF54D4B740 KARINHERMAN
889,536,430 *5C8014F59A7B9F19F0AB22980EFC93590D9242B3 karinouves
889,536,431 *5C8CF6BC474D021EC1A38460FBE9516C8E908F4C KASEYGARITY
889,536,432 *5C8EE9325B64D70FA6CC48CD8E239A921F3EB0BC KATHLEEN MOULTON
889,536,433 *5C853718A7ACC2B3B3F2FD37E75C6A3F8E07C712 kathygilbreath
889,536,434 *5C8AEDA02F8CC9F600D48EBEBE225B6DA1AD52AC NOMARTE
889,536,435 *5C85102A119D252749F992A4F205BBFA1A60ED43 noncommunicative
889,536,436 *5C8BF96AD3463F5C20A234B97C6F75E87D085D9B NP_056559
889,536,437 *5C83E2B97A3ED122C2863A2553478099ED442856 kennithsivic
889,536,438 *5C8710A9312151EC5FA8EA3298EC8D794E42820F KENNY.RATTLIFF
889,536,439 *5C85DBF21859CE77EDD71297D33A24F8ED43FECA kentoncampion
889,536,440 *5C84FCA8EF62BA0A2E2388AA2221E2B12BEB5122 KERRI-ABRAM
889,536,441 *5C8408001590C24B7FCE5D289451638F0B5F595C NUMSCOR3S
889,536,442 *5C8189F43124BAB833894C455864EB92D7BDB59E NUNC1ATE
889,536,443 *5C80E2C526089F6291263EF5664F777E8430B6B1 KEVEN.BOYD
889,536,444 *5C8C3D8D306837D68FD057585AF84185A03C65B0 n}wj
889,536,445 *5C847F3532DEC8D2D91929A739AD6658050BCBB3 O5662762449
889,536,446 *5C8083D2E77D18307E85A012DDACDB4E102EC022 [email protected]
889,536,447 *5C8D40351F446470FD5528EBDE240EB8A396AB7C KICKUPS
889,536,448 *5C8C788D55D9B9CB1C79BC58BB1D728BE2F4B02B kipspadard
889,536,449 *5C8534A2CA50233179270CA861B78F5C00C90A78 klinikateuawww
889,536,450 *5C8F4D3CD2B1CC4EFD54F93FA9A51133E2D8C77A OLLIEBRODY
889,536,451 *5C8D58E6B80F3D227AC0EB48808579E59B91E882 OLLIE.CURTSINGER
889,536,452 *5C84C23CDE528143C9617333DED307A7FF971EE4 OLLIE.GOSNEY
889,536,453 *5C854AE078C73B57D18876EAC67E1A707807F8AB knilluws
889,536,454 *5C81887A1F716B7EAD835BD2B7FCEC1347826BB2 KNUBBEN5
889,536,455 *5C8097A6CD525F5DD0D1D4CB13DB768FAFE035FE omarcather
889,536,456 *5C86C534BD7E8B206CA8CFB5CB4B6EDF39502CE9 KONKADUWA
889,536,457 *5C85923DADA5E58F0396AAF217FABA343C721658 ONTSCHEEPTEN
889,536,458 *5C8074DFC8B7469233D6516B5A53F527FBEB07DD KOSTITUSIONALNYA
889,536,459 *5C86BCE821D667BF902AD0575071B91AB72666EE operenym4
889,536,460 *5C8A897673FFFC8A6AB693716D19F61648D08B85 KRISTIR3
889,536,461 *5C8BE33FCEEFE7B2D76D2793D16125A34ED91FD9 ORELIAD
889,536,462 *5C874D8026A88E6C06A7188E3D34F1E7F4B92B04 ORIRESTRING
889,536,463 *5C853597EAC491996B0D47E21348EA205E5F7675 ORLANDOHILDERMAN
889,536,464 *5C8A99BAC11B1DB808E69DFD0BB1EB301148BF06 orvillecharley
889,536,465 *5C86C8BD563CB7EAAB52F978A062C86FE27D4688 ORVILLE.MCCLOY
889,536,466 *5C8B4E6510CCB416955D1B15B1649E00028B1251 ksy%
889,536,467 *5C8159BF17CABC19ED9963F85F6EAE50B931FF1F otubelu
889,536,468 *5C864135755C4E8834E5EB88195FCE34410DDC67 L3ANHORN
889,536,469 *5C83F5A119BC9103CC5E1710C5ADC09FA6CE81AE [email protected]
889,536,470 *5C881443C0C125E1E884927EFC849A411429CADD LADONNAMULLEN
889,536,471 *5C8AA8357A2BD2276E1071B94A506EE7FB587FF6 lagurfni4
889,536,472 *5C892C6FE32F69AF8842E8D1900E127EC83245A7 pagan-deep-club-classics
889,536,473 *5C864A2DC92208B03301AB865E0C83B2F7EC1E6A palyoora
889,536,474 *5C84F1FA1DE48FC9F2D3891C19940DB5491DE8B6 PARMENT0
889,536,475 *5C8394BFBB4EEE50D07311DC3D245DA2B10A1054 LAUREN RAWLINGS
889,536,476 *5C800D43E0C188B83D8C3F7CE2629E40CDE9AC5C LAVERNKROTZER
889,536,477 *5C8E6EAF26BECA895A81E2BFB896F30EDF1184E7 peachesblaster
889,536,478 *5C89845B8BA563BDBE54AF1AE30D3CF7254C1F9E LEIFOTT
889,536,479 *5C88DC0B5E4DAE0C4D3D418F86A98BEAB072C325 [email protected]
889,536,480 *5C875EDB8896909AC470A54448EDBFFEF703C584 LEN.WIEDRICH
889,536,481 *5C8627496942FD8DE3254D3BC24CE08C4E47C727 [email protected]
889,536,482 *5C8FC855A9B52EC67F1D8DA30C00AED76694260C LEONELKLEPAREK
889,536,483 *5C8ED6963A52AA1BDA9EAB085B480F4B783B4A3E [email protected]
889,536,484 *5C8B2430F7D4300483667E6D890BB78B720181C8 leorobitaille
889,536,485 *5C83584A5E3A04DA6B5355B6879D84E689B42C97 lesleytatters
889,536,486 *5C8DDE79024B0B7A46822F076FF54E5EE6B236ED philip.andrade
889,536,487 *5C829A29869B732AB21A91630AEA329A3FCD1478 PHSPHTDCING
889,536,488 *5C8F1EA1216620B2CFE0AEAD0FE83117F4C21E60 PIAGONO
889,536,489 *5C869619089E62353958A2E679C69C5209DA1347 PINKING
889,536,490 *5C88BE23F8EB6C17B1A4EDF210A3E6AD9BF93909 PNEUMOENCEPHALOGRAMM
889,536,491 *5C83C6974E192CACDE692D8ADD46F9B75B97C009 [email protected]
889,536,492 *5C8DB4B4EB58CC66159940B13E1D6BAE61F666D1 LIRD-GIJ
889,536,493 *5C8DD63F6CD064B04565F334330AC31C58EF5D47 POLYSTYROLHARZ
889,536,494 *5C8E10C822A8FCC530A3789C954F0344B48AD036 LITTLEGRIZZY
889,536,495 *5C8B6F78EAEE2FE53F837BE282C2096DD4F254F8 POSTVLUCHTEN?
889,536,496 *5C8849FDAC390F52EF02A4DC392558DC5FDC97E5 longschweikert
889,536,497 *5C87CE9E614659F3102BAC18CD00C99B569FB095 PRIMĒRU
889,536,498 *5C82D1D162B8511826FDE14EDF452E6AF69DF7CC PRINCE.DUNLAVY
889,536,499 *5C850114E5C3DE969988E1A1C6738B117A43ED2F LOUIS.JUFER
889,536,500 *5C81599CCB1127FEDCFC06BB1CC01ADED90FAEB6 PROFCOOL7
889,536,501 *5C83EBDE5436F916F600363A6FA0E2CF713FC011 prompted
889,536,502 *5C81771671CAB39475D97204A684E0457FCB7077 puc4
889,536,503 *5C8F5DF8FA89B9242D26DF382CC9C3829FA668F7 LYNDON.FORRY
889,536,504 *5C83FF74A7D87545E7E9EB143F03AD1903D8353D QLQG
889,536,505 *5C849CACB7D00C349CFE64B062D93C56775EA0C6 MAPLESES7
889,536,506 *5C8EFB6653472E6FC008A5AD8F2DECD487D8C9D6 raffine3
889,536,507 *5C8A437DFED37BA2DE87AA8214ABAEF8AC506F62 MARCHD
889,536,508 *5C87BE28186AB68A48EB09E2E480B9E7093B81F4 MARILYNLAWTON
889,536,509 *5C8BC3870D4E51C5786E675FF4A414C77D88BF2D RANDALL.ELIASSEN
889,536,510 *5C8C1354330F7F125108B73C89FE5606750B418F mariscalesdecampodeaustria
889,536,511 *5C8BB59164ABAF43943241F6022FF980E2491D04 RANNAKE
889,536,512 *5C8462F19D0E1B4C7B082A41577040A6A0042134 MARLON.COATIE
889,536,513 *5C8FF070C865690D2E87231CE35D9E709B703032 MARYBOENEKE
889,536,514 *5C8D6E51BFF47406BD5C914B281F5E639AD1B525 RAYMON.TEYLER
889,536,515 *5C8AEACAD89BDFFD5FE6719258A732F52C0C2624 matthias.knoll
889,536,516 *5C811D29BD8AD2889056A0229F1E78E158FADC7A REATHILY0
889,536,517 *5C851859C124792C1CBC3089493C07E81EAB9032 mautendorf
889,536,518 *5C8C84FF825585C7507CD1D83EC54571216C68BE MCCONNELL2493
889,536,519 *5C87CD08988086FFF84D2D4FE3D7E6BBF32DEF8E regem-(6th-mode)
889,536,520 *5C80014E389E1AEC54CE8B84AB2CD4F653C8D5CE REGINALD.DAPINTO
889,536,521 *5C8BDE89D8F5C034087EF30A8924AF35E9380DB0 REGIRFFIZ
889,536,522 *5C8D3F2595839E10C237D9ED531C82BFA2769C23 REISOTOPED3
889,536,523 *5C844905AC6290A71C38B7DBF96A83B13A57D756 merlamiller
889,536,524 *5C8C329859EE682330B2F6BDBE97F0E5E569EA11 RENALDOLIRANZO
889,536,525 *5C826F19F59560A24173AB0BBC0A938F72D90B4A renatopuma
889,536,526 *5C87992A257E1EC903D6B9FF76AA44E4208B5E3D [email protected]
889,536,527 *5C8D75EC619C22D94AD7A3F5A4C268C8D60086B2 REPLACEMENTTRANSFUSION
889,536,528 *5C8C8B4A6F5F8F9180D1E589DACFA37A044EAAF6 mike-dash
889,536,529 *5C8CE776F79E1F63501439A518DA368649C54555 MILANCOFFEL
889,536,530 *5C823AAAB60D30411F5C8B926818506DB5960412 MILOLENKE
889,536,531 *5C8A4DBFC080674E288BC1A02BCB63FA1415A57B richarddreams
889,536,532 *5C82066A4797AF5A46C65AA5EB2FD3BEE56B97DE MITCHELLBATCHELLOR
889,536,533 *5C86CCC9B70B54917FA2C68DA7B9F2953B928936 RIZEGA
889,536,534 *5C8B14AA07829EA3B792548F6E36C94B0016FD24 MOCOOHAYMETOTGNINNIRGASULEINADCMWEHTTAM
889,536,535 *5C8F41FE4F4743A0C8FE5DC295A55E3FAC9F8208 RNCHEN.2:.DER.SOUNDTRACK.(DISC.2)
889,536,536 *5C8FE9D19702E65F83A8CAFB1670F5264855E709 ROBERT COOMBE
889,536,537 *5C840E997F5618D36997BF3ABAFCD70B50E4C73A ROBIN.SLAIN
889,536,538 *5C88E02CAE4751C0CCF71946300978B97BC9E551 ROBINSONP226
889,536,539 *5C8C2BCDF77CF5E28459EF927EAC80097E4486AB ROBOTECHSHAWN3
889,536,540 *5C8A20F844FE753C1EBFDFDA633761FE047EA238 ROCKYTESTTESTING
889,536,541 *5C89631EC4F63DA44E07CAC32BF458053D0E6047 MORGAN.ESCUDERO
889,536,542 *5C8D871CC8F98560FEF6425109C8260AC3361D7D ROEDELSPERGERING
889,536,543 *5C8A1A0139C19CC57C91026A5F3300ED41292E74 ROGER.MYRA
889,536,544 *5C85F98ED7F14B78513C60ED0C837C7B3A81A3BC morsie-burford
889,536,545 *5C8BAA0B09121EB9F0876B8F6C1E900B3092C832 rolandletman
889,536,546 *5C8B976FB5520A6841C4D913596F4779DD04AC9A mosheshelvey
889,536,547 *5C88914A2FA083EED4C5D18B3AF7B127F5AC183C ROLLANDLEITZKE
889,536,548 *5C86F91009829A1AA48DCBF3542F6BE9749C9DD4 rollandwenrick
889,536,549 *5C81BBE9A6C7F7E6ACE6E0B22B1C43DD9EB83E4D mozartin'
889,536,550 *5C856567577A04BA36346C700FA726AE6D8DD404 ROSEANNEDOMINGUEZ
889,536,551 *5C821020D9E340A3CD48A1AFC72A83DE54D0E949 mycenaea8
889,536,552 *5C84FF6FA45B6576CE0324D3D2E7B66337686870 n0nc0mbu$tible
889,536,553 *5C8CCCDC23344F381F31E2B6F3E077CBFAE54BF4 RUSSEL.CHESTAND
889,536,554 *5C832A68139447459C3EFDED6D7F6ACFE147165C russellhowatt
889,536,555 *5C8493E0C24672A5A8543A3252B892221F367AE5 nærjordaasteroide
889,536,556 *5C87AD2490557D216A5CCFEE940D689B19AFD543 russlamson
889,536,557 *5C8DAA4171AA549E0A1DC8C275694730E1A31D04 NATALIAMERCADO
889,536,558 *5C8048C6F28D6D43F194CA2A8597C85BE5E496BC [email protected]
889,536,559 *5C8EE0C8BF1CD4F32A8273311635BAF0BD2F52A7 NAUTILUS.2008
889,536,560 *5C83130A60F55F11431006FFA64C6EA02C0A6F2A NB\G
889,536,561 *5C8B3AEAEFC9FF735F688511FCFB79EE3261656E NCMPSSNED
889,536,562 *5C88037F0A9C26E78FB79C63779A0D02F7EB7D27 SAFOUANE3
889,536,563 *5C847A841823E46A84FE3EC2A62AEC6AD190D18A ṣáḥib
889,536,564 *5C830AA1F0D9FB6DFBE2F86A2045D253A6CDB2D3 nebelmond (das ich remix)
889,536,565 *5C85653459410B8DF3057DD7329701A0C60D6CF9 sammcgary
889,536,566 *5C8B5D1F0B5DFC6C64D8C45B3FA55F0240F54F4D SAMMYTRAFTON
889,536,567 *5C88312FAA62A607AB177A15E9D6129D1F977EC3 santowidick
889,536,568 *5C8BC7C9D260759FBD763F997B99872336F4364C SARAH.JANE.WALSH
889,536,569 *5C8620AD4B6377BFA1764A80F577209464DEAF93 NIKIFEROV
889,536,570 *5C8FB66A65DE21E0DA7C376753EF6801203C3107 sauterne
889,536,571 *5C8D230295308589B2274C5506A9612659395FEB school,但在15歲時被開除
889,536,572 *5C84C462553100A09C564B927AF72138A13B8B8D scotthermanpreaprilfoolstalk
889,536,573 *5C8DC6D95828F2E45CA3D5E0B1F89E5009E78220 NONREFUT
889,536,574 *5C8424D0D05980EAE926E471DE0EC527DEF82445 NORTHHEARDED
889,536,575 *5C82ED823D21C5F57C8A59AB029C4C8677FFD6F8 Now-That's-What-I-Call-Music!-1997
889,536,576 *5C8EE8D8B3497167D683558F5707C10129CDA135 nsaade
889,536,577 *5C871C63E78AA842A58F8CDDC495A82BD630050F shalabama
889,536,578 *5C817CA1C722661409459BDC40F21B55EDF5AB57 SHANNON.ORICK
889,536,579 *5C8D61550D316752C25A4CCD60D959D51F3D8824 OIZANMIG
889,536,580 *5C83820401D868C6DDECF5E90F5F757396EE5169 shaunswoager
889,536,581 *5C899A1BB9F4FC2C43E80D53BF0BFA8B80E10F58 shaynesulcer
889,536,582 *5C8C49F56D732EBDF7F4440C52F2E50F250D4220 OLIVEPMC9
889,536,583 *5C8CD82BA8D0D012A426DE1C2D00B3361D6384FF SHELTONCANGEY
889,536,584 *5C83E530766A9CCBAA75408B8CC2B99CA9E9606B OLOPOPO2
889,536,585 *5C8B63709A5CAF0CB5A65B897A62980418B87584 [email protected]
889,536,586 *5C8555BB605A8D831F2543356770C62A09624D0D ONAHMIAS
889,536,587 *5C8CF11887F64D5C7AB45CC0CD956D0953399833 shirtsleeve4
889,536,588 *5C88DB31BA04E52FDD98EC01A7AE94FBBDA9D6E7 [email protected]
889,536,589 *5C8CC8D233AA0433368D593455DC71A25BABBC78 SIDNEYBUSI
889,536,590 *5C8BE2595C33CB3265FE40BDC3EEAEDC91B0CCBC OOSOOM2048
889,536,591 *5C8F8E3750EE022DDEDA66EF06B7DCC39FF0434F OPENFORMAT
889,536,592 *5C81F9E875F63B5FC5D833996EA0FD50FC43AA60 ORAGNISMES
889,536,593 *5C86792A6EDF8FCE649E9150356056720D4DB61C ORANGELANDL
889,536,594 *5C8CFB670FBA550F034AFC18A312603113487088 ORUKOTANA
889,536,595 *5C8C7E206F7D47D3ACE7A33C77F68FA547CC8DC7 skládat
889,536,596 *5C8CDEB6A3F80A2CDF3F5E31BA299D034E00FB16 [email protected]
889,536,597 *5C8CB50EAD16EE15ABB154995EC81DC0FD873E78 OWEN998
889,536,598 *5C845FED7D85DE65787144CDBB61DB65A2E10280 P0N$
889,536,599 *5C8D1492A2BF98B77589D1922E28B26036013887 P62G
889,536,600 *5C8AEB2BA292477D4A98A5FA4FB05826E9B4B4B6 P7"R
889,536,601 *5C8CE261D7B23D1F975776F83E1625D081357E89 [email protected]
889,536,602 *5C859C837765E1902DDD38C2A9FE80E9FD993E03 sokkijyued
889,536,603 *5C8F3EB0532140A02C87FF498783F880B9E02CC1 PARKERBLOEMER
889,536,604 *5C8F8D6B51949C29EBB91D4CF76EFCDFCD7BADE9 parolles asyou'llhaveher.
889,536,605 *5C83D0060F2BD61E1FD2DEC454AED2E7EC7FBF4F [email protected]
889,536,606 *5C82495BD4E3CD542A3649860AA866F95E9F424E PATHOLOGISTE
889,536,607 *5C84F172149E43234A17DB6B44379EF96610EB36 pbbteeneditionplus
889,536,608 *5C8508B21E0F1CADA1ED98ABF5F96EA93FFB4F1F PERICLES THITHER,.GENTLE.MARINER.
889,536,609 *5C8B7D3CC27D4B0EFF1EACCC90366C95DDE69FC6 PERTEKLIUS
889,536,610 *5C83407EF2B0D95375B85CF08C312E72FDC03125 SREVJIRDSIRADEMORD
889,536,611 *5C8C49F908A58A553A7D3B95641AB4B42CDD2C64 [email protected]+E1!C
889,536,612 *5C8B98914F38ED67DFF3B8C3358E2DC75DF518B5 PHARMACAL5
889,536,613 *5C8D87B8F6405015B7504F8B9FBE13207C3D663D SSSSSSPUNKIN3
889,536,614 *5C8C1A50E9574F8AC91C54EFEC1877D2A5E26FA1 STAMGROEP1234
889,536,615 *5C89D63BDA4D264BCF55F8CA7533EF9DDCEB7532 piano-excercise,-woo-6-no-19
889,536,616 *5C81EC7FFB2A5389AC1CDFAF961A01B10839C39E [email protected]
889,536,617 *5C85BC062D1134BB41F02B52EC72EC5F800C2DE5 PINKING
889,536,618 *5C884D13D343BB861B91C1C5786A1E7B16CF3748 stellagale
889,536,619 *5C860CCF0399C6E0CFA17E2BA82B0A17BB501975 POLLEXIANI
889,536,620 *5C831D226C3A45FA4E8D13D9AAE73FC23676563B STREHUER
889,536,621 *5C8E7966374C91FB67D003B9AC07C5C3C404A23A su1f+es
889,536,622 *5C8FEF6A29BBABA6ADDFEEBC17F19C74599FD982 [email protected]
889,536,623 *5C870794B2B6F58C52CCD442E6D3D147B4CD1123 premisethat
889,536,624 *5C8205E75BFB5D6779A73B24DDD6D2C4E446EC5C PRESTON.KEALA
889,536,625 *5C82806C11E75BF6504316DDD05DBAF02C56A32C princess of love
889,536,626 *5C8053EAD6AD159A9B22BE2F9AF3E8C2B6450B45 SWIMMMER24
889,536,627 *5C8B57B7B296406E33BE054853FFC05F4C606986 sxch
889,536,628 *5C8EE47EBD78CACA680579B9271FC8631D453652 QOI1
889,536,629 *5C8411AA6FAEA658E787049E89661FC8ACDB8A7F Q###P~O-~O-(^_~)
889,536,630 *5C87285A8EFAA8FE788E676CFDDA316F473D3C19 [email protected]
889,536,631 *5C8957D5D2E55620C2A18C230D138276285714BA TAUHIDA2
889,536,632 *5C8BACB9E4637A50C31832725FE67D1A62D123CA TEACHERFRIENDS4
889,536,633 *5C8AC8BF0729E1AF1468923B5EB3D24B68E074DF R39UR917A71V3
889,536,634 *5C8B7EDB9AA6B37C96E7C1F1B3A9530AD7C13100 telenets4
889,536,635 *5C84C035A5879A1872626215DFA04F5D690AF5B9 RACHEALDAWSON
889,536,636 *5C8B888493FE3F1035ED5EAD746543B4AB456375 [email protected]
889,536,637 *5C8C7E45EC217ED859C1DC30D1BF9F70ED44DEE6 RAPHAELDOSWELL
889,536,638 *5C8FAE47D452E1CED32E3E4A39E95F50B552B870 RAQAAIQWORDPRESSCO
889,536,639 *5C88C69FEB791F5EAFE3E763BB510F68C9D7CC1E RASHAD.HORAL
889,536,640 *5C83E42FA9DE47272941104A34B7E79D3D588750 RAUCHKAMMERROHRWAND
889,536,641 *5C8F05448393AB30A7000CC835A03734B3AD0DAA RAYFORDINIQUEZ
889,536,642 *5C8F6AB0F8E07E4637B8E84CE72095119C16F701 THATNEIL76
889,536,643 *5C80427D3CDC5D132260F6B481D0AD29DAFDAA27 thatpat59
889,536,644 *5C87B9FAC2E4614D88736A81CB57775A7CAFCC6E r?dw
889,536,645 *5C81AB7D7E82F13B2361E66930DFF865CFDCD31C THEHATEICREATE
889,536,646 *5C89842A10A35548A8D08D8754BD5F7A12D6BCA4 REFUGIO.MEISSNER
889,536,647 *5C82D08EB084E381530A7F3C6DAF361ED942A03A REGROOMS6
889,536,648 *5C8E3A1F3E2AB0E56CD69DEFDB0364DEB0CAC175 RELUBING
889,536,649 *5C87AFD713ACDAE9946E31C51BFBF19AD7F8250C tidsskritt
889,536,650 *5C8747A68DF38406C64E13F28826427FF7B44F83 TIMEILTS
889,536,651 *5C8DA9036FD795BA7AA9EC503187722A9DD146EA REVERENCE - HEAT
889,536,652 *5C8E276F2209808BB73B1D0EF690487FE1BA5DC4 [email protected]@7i0n
889,536,653 *5C8924FFAEBF553C4898CBC6AABE33625D2947EA TOBYFALCHI
889,536,654 *5C88145E5DC303D132E0616413DAAB2328AE21F8 RHETT.AKARD
889,536,655 *5C841F1B8F315BC818243B2F85CC8CFCFCB4D235 RHZMRPH7
889,536,656 *5C83F9A1615D19F259203D21827EFCAA91DD3390 TOLLAGE
889,536,657 *5C8CB9881257D70E6744C186A3D1BAD1C5D73A5A tonightisthenight-part1(rap)
889,536,658 *5C87F7B4C9641BA8A1F17211AD6F505DF03F99CE TORCSHAPED
889,536,659 *5C82F0D4665F07A0FD5A23B9701631D04A156C2C RIJPADENS8
889,536,660 *5C82E9C67BAF92C0578D5DE331F43711831D68E0 travestissions.
889,536,661 *5C88056EE81512EC24E004181EA6E2A7620CA492 TREELEFTWIDTH2
889,536,662 *5C8DE13BDB2C1CFB793AF2B4F9619C121D9FD911 ROBT.WOITOWITZ
889,536,663 *5C8DC6E2B109FED579739732A21F13DD06C8CF22 TREVORTREPANIER
889,536,664 *5C8446D6C084A7902EE9A372B15EAC0215B65CB1 TRISTAN.NIGLIO
889,536,665 *5C8A461E79FBD1970DE9C2ED557F627D5E73215A TRISTAN-SHACKLETT
889,536,666 *5C81AEECE0DEE27899BE80D9CB44325AFB31DF8D TRIUMPHATURIS
889,536,667 *5C8CF5E96A40F5BD3FAC4568DE0BA8A560765B06 RONALD.TOMMOLINO
889,536,668 *5C8425AE7390740C53EF67BA9A449C9E6B6B9E52 ron-creech
889,536,669 *5C81CC9FA21D6414188FBBA85F0BAED035CFD365 ronnyrye
889,536,670 *5C830C8A4010DA924CF6DC5F647E5379EB58B556 TSHEPO-PHILEMON
889,536,671 *5C8AA1433013A17127102FF8C027171A39B4C7BA ross
889,536,672 *5C8E6B8E84AEDAD4AACB3F0A0BF67CCB13A19390 TUSHARIKA ANAND
889,536,673 *5C8668541757B2E40144113E46313C6EA9B7BFEB RSONCO
889,536,674 *5C8FB88308C52A7D64FE3CC1D3A26FA6F25FE9B3 RUBITHARD
889,536,675 *5C87509B850B1A537C931F5E5A83DD82F6554396 TYRONE KOUKA SMITH
889,536,676 *5C8E2ADB23FAC301D172079967D4B1A0C45D4D1C RUSSSAUTNER
889,536,677 *5C8B37533E5FC90C8C2CD9ECA422F953DCB02E22 u46qoewk
889,536,678 *5C8EF6A3F8EA0D70759671C9F43F7AB09CAEDF13 UCHOPIME
889,536,679 *5C8612987103BE5B59984BA38B48AD03533C7F02 ufitimana-kinimba-samuel
889,536,680 *5C8FD1816AE67145823A56A882F10D7AEC9993DA ULISHA LUCEN
889,536,681 *5C81AD6214372AFF8C9251F8A43E7525C00C70B0 salvador-allende-pel
889,536,682 *5C8F93AF6CF80A77C7089635CFBBD685F61A1BD5 UNC0GU1D1$M
889,536,683 *5C859EB736DD4CA465FDB51FFBD47F7AE417F169 SALVADOR.VILLAS
889,536,684 *5C8A2C826BD5BBCAB121773F84C23D17F07867D9 UNFULFILLABLE0
889,536,685 *5C8C7029C0BF8C98088DA4AE12F0EC98D056E111 SANFORDKITCHELL
889,536,686 *5C8B4831D34DA2B627BAB09470E3769AADDD9F27 UNREVELATIONIZES!
889,536,687 *5C81ABE04995586BCBC90FD4D1382DF674AF319F urzędnik
889,536,688 *5C8A2AFE687F4F6A62D30C96965642301D735176 SAXONYANHALTHAMBACH
889,536,689 *5C81445BAC6E84A2C607AEC4CA43652565ECC79A [email protected]
889,536,690 *5C8A6337BEF9F5E347C1C3A562370430A01C0B03 UTIMASIH0
889,536,691 *5C8E7582778BBEC8D3F0101B2481A4D22A8F6054 SCHLEUNIGEM9
889,536,692 *5C808E93465D54ABAAC7EB34D9E132A854AE93B7 UUO~d3
889,536,693 *5C867AD97FBB603067C45CFF1E8E5AE8C758C4A5 SCOTTYROMAN4
889,536,694 *5C8A9A9CBD8104B63CBEFCF8AF95AB7E388B0C52 SEA.SOTHERE
889,536,695 *5C8107FA3486C9F5978D33F150F838B4824FC371 VANCEHARDRICT
889,536,696 *5C89FF304C7F63D4C188E05EAEE8315847B36067 vanderbiltrapequestionedinanother
889,536,697 *5C8C4461B4EEAC7C4A1C2F39BEFBD265732A28F7 VANESSA-LOPEZ-LAUREANO
889,536,698 *5C8B4FFD1A291B7EB511C9016897A05BCE4430C3 selling5
889,536,699 *5C83604CE1A80E8CF87B5E393AC299C831ABEAE6 vavasours4
889,536,700 *5C89F3008D64829080841A2D9156C3C9D38E8186 seralza+on
889,536,701 *5C8E1EADCA8CE42178B63598D69859C0B7B795B5 VEČNOST“
889,536,702 *5C87724EDC30AE0752527661782419B70B4FE376 SERVILONA4
889,536,703 *5C81D034DC4219F9239B8AE7EBEA932CC71B18B5 [email protected]
889,536,704 *5C84E0FAD30D60D28D56292B9A20F3CC8E7ABA1C VE,.OP..84.NO..1:.CAPRICCIO.IN.E.FLAT.MAJOR
889,536,705 *5C8A30290A15EECF29F0102515B9993E8BBA63FD VERONICAOLSON
889,536,706 *5C84B79B52E8D6B5BF427B0EEEAC6457EB3EED8F VHENOX.MONTEBON
889,536,707 *5C8DC05AB680B387E6B50C98CF15232A2E44C82C SHARK4
889,536,708 *5C8CDCF87B4DB8D0E3AD07B1F755998D011B3FB6 shawnstofflet
889,536,709 *5C8F2091A655D7C31D9B443355D67FD67BA508D1 victoria.stefanic
889,536,710 *5C8B249DB9D33997DC9BE74FA493D37601433768 VIERTEILENLY2
889,536,711 *5C8BF7982061735F4D2B333B3FD6214A7D498990 SHERBAIT3
889,536,712 *5C8CF236DC5648362C6D786B000763D0A1A5DD52 SHE'S IN YOUR MIND
889,536,713 *5C814C995C966A6165FFDC0025EE9C9087389AF6 SHIHPO
889,536,714 *5C8A3AA02B4BB003812CD3BDBF44B51C496773D1 VIOLAPETHERS
889,536,715 *5C80EFCAF244171542E016D6AD53E00886845808 SHURONNING
889,536,716 *5C86CD54329E1B5556F9A306502777EBB281C24A !.Vive.les.vacances
889,536,717 *5C894D4F99BB0B30B8498838BEA16DD653E01D16 SIMONPIGNATARO
889,536,718 *5C839E11E15733467E210226603E746980FAF3AC simonribas
889,536,719 *5C8FF19622CD8DE63361A6F8AE6A6A5C4E6F1BCF VRBJFLTSTN9
889,536,720 *5C8D40748B3EF3EA1256FFBD55859EC88CD5CCA4 SKR-A
889,536,721 *5C818B712E22325D2B60C5B11DBB8CED075C2289 SKYLERPEDERSEN
889,536,722 *5C880EE755B67892DC26DE2A73BAEB6C82A7C1EC SLAWISCHSPRACHIGER
889,536,723 *5C8F2D17E9E8A11DF601048CD5E181ADD34F1129 wafaanasreshehabeldien
889,536,724 *5C868F6BEE2CE7E479EEE43D17C60D636524F6D4 WAFFENLEITSYSTEMEN
889,536,725 *5C8417FEB2C82ADACA0E7027CECD72383A1123C7 WAI-YEE-CHEN
889,536,726 *5C8E84CD19055925789BBA92A502068FBF4E968D waldobutton
889,536,727 *5C8F294F5134655F62D53DE59D0BA13C00A001BE WALDO.PREKKER
889,536,728 *5C80CC1EFE452194F985CA00E288EED7AA955EBE WALID ASAAD
889,536,729 *5C86F3A0E11A59FE9257A97314CCFEBB8419428C SMILEZ_018
889,536,730 *5C8E1E1E2F1C40EF83AE6197B1E6EE5B11F9F702 SMUIBB
889,536,731 *5C87681468A4CC09B3577ABBD12C33F99B9ABBBD WALLYTRISLER
889,536,732 *5C8A2D44269C334D7D55D894906627991F0B4305 waltontrbovich
889,536,733 *5C879FA9C66CBF6C08E36FB935AA92BB8A51E06F [email protected]
889,536,734 *5C8A83FB816E00B7E51CACC0DD0EC051F229BDE6 [email protected]
889,536,735 *5C802009B055762FCFE4A9A953A7EA560D84F06B [email protected]
889,536,736 *5C8534FB34FFE9BFD2F5FFEC3104EFD15D7874C7 SOCIALMEDICINERES1
889,536,737 *5C844A636936B295052CE42118797E4E853132AD warez1992
889,536,738 *5C85803E7FF1226DF6308A8012FC57135294BC4E warreny
889,536,739 *5C888CB46E32491D7200E06D48AC82DB0AC0DC5D WATERBEETLE
889,536,740 *5C85F5576F331DC8A3C19873B6716ADBEAC424BF someday.in.may
889,536,741 *5C8DC2C238179CC3B17A3FB87EAD6C8E6C810330 songesbsw
889,536,742 *5C8174129DD9EC4BE40144780D426D8CCBFD1C73 wehrkreiskomm
889,536,743 *5C81FF8B536CBA916EB0AEF73CB4D5459E82DA55 [email protected]
889,536,744 *5C82181CE4E4E9BC73F31F608E39BFA665643EEF weightsolutionp
889,536,745 *5C8877C338B48790E73B696B427A1A5FC1C3DE7B WELTWEIT-(WWWFREEDOM-OF-SPEECHINFO-VERSION)
889,536,746 *5C8B8269487DE0FAA9632F85A0B0CE8869F2DF7D WENDY.MOSTERT.STRAW
889,536,747 *5C8C02147FF0B5EF7375ECCEDF982C9EF17EB16F SPECTRUMS.
889,536,748 *5C87B0564EF11457795438A010245C91E8D831FB SPERMOGRAMOS
889,536,749 *5C88F9B399058B99001A1847995F13C92BCF1EC7 WERNERASHWOOD
889,536,750 *5C8925DB422AEFF096C99DA5364447E60E17EECA WHATIGOTTADO?
889,536,751 *5C8FE51A7BC18145C0DCC895C5B04BD7EB4B7F6D splat.`q------q
889,536,752 *5C82A87BC0EC525016A3C9178A8BA3AB964853C9 [email protected]
889,536,753 *5C832E6C22228220FBEBD3B5BC73F1FC667EEFF5 SQUAREPIT''SQUARE
889,536,754 *5C81E0560134A52422EA5920C26EC95CAD238849 WONCHULKANG
889,536,755 *5C878BAD28E53297EC609FBFD7EE8ED60B527600 [email protected]
889,536,756 *5C872365C5FEB7C355B4E504FA6FB2119D0EE3BF WSCHOWSKICH
889,536,757 *5C842DE838DB2BB097BB8652B7AC4F1F8EF7663D WSOTALBO
889,536,758 *5C80D35B766AE51A7A29E9B5ADB6F3BA36A8CFCA [email protected]
889,536,759 *5C88DAAFB374CF63834F64ECAFDD9EB2C825E4A8 [email protected]
889,536,760 *5C85F47BD61107C79ED4D3A5E8E7CCBBBC3D88CC www.bioepidermis.org
889,536,761 *5C804C594A6257E55CA311D361D98295D4F3F2C6 WWWBROADWAYATBEDTIMECOM
889,536,762 *5C8EC1E75F5398FF14E85B2D22C32E8F295B0FD5 WWW.GIPS.VIC.EDU.AU
889,536,763 *5C867A91C3B5F009ACF0D067CED39E68D70950F0 wwwmoseleybhamsch
889,536,764 *5C8A88654646C889F436EC84A12836E3202DBF69 WWWTARASGRESCOECOM
889,536,765 *5C847DFBC27567BC45B7AD09F2FC360802D02BBA STUDLYJASMIN3
889,536,766 *5C8ED8314439002FD0081D295FC72830ED09C843 WYATTPICKLER
889,536,767 *5C810B0FFBC7EEEFAD1812051C7654ED429586DC wztwx1kq
889,536,768 *5C83C3625AC1EE33B6A2FED38E32F2E742345C06 XER0XN9
889,536,769 *5C8E09D4EBE1F5AA74A1D288C67F2776B4E8FE55 xgolafkg48
889,536,770 *5C8994DF79127E2F1789AD68A87308BDCFD5F4D6 [email protected]
889,536,771 *5C8DF2E2504D2D9B7C4040BC9449007B9809B604 XKOUROUMALOS
889,536,772 *5C8D2D7FF8C13228464E637A235159EAAC6E7718 XMLTUTORIAL
889,536,773 *5C83F89219A7450E91B2E7250940598FE6C1B588 SWEET LULLABY (XTENDED AMP MIX)
889,536,774 *5C832D6A291CE432EB6679DADEA8E25E2B502DBE [email protected]
889,536,775 *5C84307DA2E26B7E9F9F2BC7CE7AAFB3221733F3 yankees12345
889,536,776 *5C893D863D507B8BCC912D28092D66FC0657A7BC TACKLEACCEPTACCOUTERMENTSAMATEUR0
889,536,777 *5C8F6B83F55D5A9C181B68B5EDF40B21A8C6050E [email protected]
889,536,778 *5C8E418E77E13E8FF2A70A88A59B1D56A6B30665 TALONIMA0
889,536,779 *5C8B6454B561241787B34DF5548927735D8D653E [email protected]
889,536,780 *5C8168027D638A067ED5AE3C11DE30615933B258 [email protected]
889,536,781 *5C81BC4BFE90102D85E5256FC325FB5BBCB53306 YORKBOATS
889,536,782 *5C870994A9CB5C466AB59A1CF6B673580AB72539 YOU-KNEW-(FEAT.-SLIM)
889,536,783 *5C82381302E216B704D33AC6E16B0B365C5A096D you'll.be.the.scarecrow
889,536,784 *5C81B5A10F4D1D45A02D777C9BFA663D83D7F531 TAREZK
889,536,785 *5C88E0C738470D94C16003E36AF9A58C3821DAFE TARISH.BASSI
889,536,786 *5C8B65AC570F92B06C6B162AD31CB352265E8895 YOVONNDA
889,536,787 *5C87A28D4EFCA14DD1FDB58FBC2CC684C584E29F TCBQUOT1
889,536,788 *5C823BD24357AA83E766C5FEDEAD159096BE6BF6 [email protected]
889,536,789 *5C8D680CBAAE964D08D89E133474979C330A9881 TEIL.VON.MIR
889,536,790 *5C8C26CE0259199FFBD6DADECE2CDD084A19BFBC zacharymccathran
889,536,791 *5C8733EE683B2B67CA06D24A70209526A715D8BF TERRELLCLERICO
889,536,792 *5C8ADF23F8FDCE51D31028BE008603EDCCC6D3E0 zafirahtulhusna
889,536,793 *5C84EF09DC7C0EADE28BDF450375821D93122E74 TH3RM0PLAST1C
889,536,794 *5C8216920349188A33849A155C48C5FCA8D0057C THATANACONDA66
889,536,795 *5C8E51AF01F359CF300FBAF0ECC6E72234E2BAC2 ZENITHGRACE8
889,536,796 *5C8E2383981E68DFCA7D6D8409001D0C97B70A71 themellowvoiceofvaughnmonroe
889,536,797 *5C82E8488F0A7D4F8508F3DB8A7565933A576117 ZIA-TARAR
889,536,798 *5C86990294BF88758BF7B35DE123A4F70C52B550 zillion-N:-zillions-|-zillion-{counting}
889,536,799 *5C84A743D333BD0BAA1DE3A94EC1D6C62201305C thevictory19
889,536,800 *5C83ED296038B32BFD83A649D4B02CE5B937256C zpchtgrs
889,536,801 *5C8C1463A6208EEC3A70E4CE6E42612DAF9DB550 ticos.de.uzbekist
889,536,802 *5C80FC4F0FA149D1995F10BD17C57155E6201596 TIM.DEMARS
889,536,803 *5C8540C773CDE242AE984F839BDF78AD8B368695 ΚΑΚΟΉΘΗ
889,536,804 *5C8DEFAFA1FF8F8D5F4B33E901CE85C2056C72B0 σουξέσ
889,536,805 *5C891C96D47EB75A5EFD48019D25604E0843C06E [email protected]
889,536,806 *5C81E7712D9A091583D81DFD17E8BBDF9D9BD674 TIOGOKIL
889,536,807 *5C89700717C7EF4D524A09692228A11E8F0BD9E1 Tjilpte
889,536,808 *5C853F7431B128D5354287EAE4BA085F013119A0 TMUCB
889,536,809 *5C8F0BF652D1BFEE914D574375DAC93865B2C264 TOHMAJAERVEN2
889,536,810 *5C8F9AE508DC472C575FF3D79545AC832F84170B «МЕТРАН
889,536,811 *5C8D21DB18573DA4D0ED3CA2F1934532963CAD28 tommiedalrymple
889,536,812 *5C88DFB26C55F00455C8165530673C6228FDDDD5 ОБЕСВА
889,536,813 *5C8F9914CDE6921A0BF551F293A6DBE685587C8C TONECOPYRIGHTINPROG
889,536,814 *5C87137CC1DDA67F70F7228F1C15A1D2962478A4 парамашива
889,536,815 *5C896E4AEC940799E1B70D0D010F881C5222E433 TPANITA
889,536,816 *5C8AAD87E1D9EF30A6AC5DAF9107E0A91EDE8F30 ТЮТЧЕВА
889,536,817 *5C8815C0FC9F6AF27DE26F23D29CD2719BB705FF travisbullallicock
889,536,818 *5C831E346A029280BB540CB388E0B5A5AAF63E1A trekleon8
889,536,819 *5C864B42592098AD6C1723C0D708664D61B952D4 TRUCIDIENS
889,536,820 *5C8F86D2E7BAEF0A56941E52BF72A2DC52C27008 TSHIMOLOGOSEBAENG
889,536,821 *5C8E967C9F333C69AF35352D671F434580955696 TUOMOKIVINEN
889,536,822 *5C863D5C146C649EE01673FC5A9B38E57E3A9CA2 [email protected]
889,536,823 *5C8D17C86AFCDEC19AD01BBCBF13DC5F33A90606 TYLER508
889,536,824 *5C8DC0CA192B338FD26B7E24A6E0089747D29D2D TYRAELMATHIAS
889,536,825 *5C824138C7D3507622E71B50ECA3752810E3B037 udvikledes3
889,536,826 *5C89CE2F41F8091DA8246601C99D3378D90A2544 UMSTUERZLERIS5
889,536,827 *5C85EF811D9EE7FC1945D25EAAB81933E1E91975 unbedruckbar5
889,536,828 *5C84C0E4AE2A99F6B8FCBAA600EC1CFDD0EB09FC UNmangaish
889,536,829 *5C803FA8B3019BAF8E2E7B6B9C22133A56E06DAE unr3fitt3
889,536,830 *5C866BBA328E169525656ADFBFD5E1865F88B99F UPOMINANIE3
889,536,831 *5C8818A1CD91B9D15AF1E5C8B370A3488A7F558D USERGATORMUSICENTERT
889,536,832 *5C830FF5ED0C339C03A1212EB2C5AEF6D3C1173A 1003868 superglandin-ihovoide-eli-p
889,536,833 *5C8A41B0B515B403A9CAE918F4BFE945608DFD16 uv$ic
889,536,834 *5C86188E6CE7C23E653CD74B2667FB84B362AA32 [email protected]
889,536,835 *5C84BD29B9BD902F21759E2CB64990071FEFAD57 UZENETTEL7
889,536,836 *5C828ABC29460414DC5F1874A37EB63CD968FE51 11.15.1288
889,536,837 *5C8645FBF6E9CA2721A0A24E792E558535D60246 valarieturner
889,536,838 *5C82905B4AB44626D943F115F4F369B0069A3E10 VEDLIKEHALDS
889,536,839 *5C87C4ACB33EE7583435C4FA5E4F4B70151B219B VEREHELICHUNGEN1
889,536,840 *5C8AB04E1D3E96D1448836A28B35FA45395C7F3D 1974年NET(現・
889,536,841 *5C8C23278DA48E8D28EF0713191320821EF2A928 1-AL-KHAYIL'S
889,536,842 *5C8CFB7F815906E76A1DB9CDEBE51EA60CF2ABA5 vhvaraisen
889,536,843 *5C8DE954CDAFCCB528AA0C0CF7E81850B4760F7E VICTORIA-ELYSE
889,536,844 *5C84CE0F5AE76A4C5C2EFC19080FB43479F578FE 1COMPUTERKLUMPERT
889,536,845 *5C8380AC8FB61969A93E44E104ABAB0FEAFF0797 VICTORKENJI
889,536,846 *5C8DE9C09CF91BC7FA92C099A320D32088E37211 1 EISSCHNELLLAEUFERN
889,536,847 *5C82C2AC4E18D6FB3206860574C7D4C1DA843695 VIKTORHVARTCHILKOV
889,536,848 *5C896987FDB5BFB9F21D027CEA1B191C83AFC567 1.gartenfan
889,536,849 *5C8DA1AFCA4233C8DA927D88775347CDB851BEC0 vin_cil
889,536,850 *5C80EEE17D334DCC8D9C288D0A5D482917912733 VINGTS6
889,536,851 *5C811A9E110F503AAF420E44001515864AAFE1EE 1ILUVALOHA2
889,536,852 *5C8908F38AFF3D73862D25055AA730BE4BF1BF69 1INFILTRA
889,536,853 *5C84B66BAF9431A11F9F6B6B7CA2542B1D279317 VIVIENMORAWSKI
889,536,854 *5C87992650F8DB8A4A82EE5624D7904F5E1FCCCB 1-korkeataajuisilla
889,536,855 *5C8F845D743AABED9C49227CF2BBBB54027C8558 1 MAASEUTUELINKEINOPIIREJ
889,536,856 *5C8581B21A26749AB3958F93BF066765101F69FA 1maximilianhoefen
889,536,857 *5C80C4E17BF009A696B82369431396EED284C0F8 1 MITBERUECKSICHTIGUNG
889,536,858 *5C801FEF8E4660DDAE52738B56068011505733CD 1.mittelklassegeneration
889,536,859 *5C898F55E631399983B0BC8CC48E499E96E6ED81 1 NHLMASSEN
889,536,860 *5C8E710AAA4AB71D0941F36AA0C2A71D6E248623 1.OFFIZIERSBUNDES
889,536,861 *5C888DFD0D5DEF46380D05415191737C7735FECA 1 OGRETMENIMIZ
889,536,862 *5C87EAACB30D441182BA48F8ABF72FF73AB1936B 1-pakkaustilausten
889,536,863 *5C8531D1B5F210CE7BFBFF258007BB85F39FE647 1-pikapesua
889,536,864 *5C8320D33435B28157C2F36A58FEE1716AA7A170 1.PUUTUOTETOIMIALAA
889,536,865 *5C855135ADD7D34CB756ACC8F8B2A44894FAC96A 1.reitbahnsee
889,536,866 *5C88A7C3B97A8179C4F95175F2BEA90B6D3D4568 WAHETEVER
889,536,867 *5C8B0FF6768C319EEDE9F10D00121447EC8E1CB9 1.SCHUELERANTEILE
889,536,868 *5C89DD5B6F36050755FD9EC1F2C98080F84B5ED5 WALTER DEL VECCHIO
889,536,869 *5C8BF31FD0240DEB9201725030727DA24DA0627E 1TENUERAM
889,536,870 *5C80D20E7E81B10BCD74444ABEF90B5DD2ADA08D 1TLPRTNG
889,536,871 *5C8CC09EB4EB0F67881C9B8771F226B809D9E718 1.TURUUKS
889,536,872 *5C89D121C579FBBA3BFDA477C99C8E12BF032344 1VARPAJAISHANKKEEN
889,536,873 *5C8C049127A01B637E821F963F02CE3CBA3E5809 w.a.r.---wrong-and-right--
889,536,874 *5C86E47E049CDFD0CB60CC4CCFFCDD3818702F8C WAYNE.HEDGEPETH
889,536,875 *5C891DB396D64329F106558EB51D2997AADD06D1 2116092 ratamoavoidaank
889,536,876 *5C8EF8E891F8227C2140FD4C40AD5E24BE2B11D7 2143009 SORRY,MEID
889,536,877 *5C8875ECA58D8E141F584BB0166789D979347946 WENDELLHILLER
889,536,878 *5C8F7D1E37557C336A96DC7ACDCCF173034ED3A0 2226826 BUSH.:.I'LL.COME.BACK.TO.IT.,.FRANK..
889,536,879 *5C861817CA0A4614BFB9F1D3259C9305BA5EE185 2279743 LAPSI-SAA-OTTAA-MUKAANSA-SAIRAALAAN-T
889,536,880 *5C8C72F04C401F404E9768F57C531C8A8EE10BAC [email protected]
889,536,881 *5C88B5744AB69954B6BCB254260EFD735FF03871 [email protected]
889,536,882 *5C88BDF5CDFCC2DA6B6BF9D7034790966ABD96AF 2309151 tutkimuksissatullaanselvitt
889,536,883 *5C867C88DF5779CD39CC77FDD3DE18E81269E102 24pについて記す。
889,536,884 *5C8BD9ED812D3B7F9EF080D7FC878C8596BDF1DC weyermann
889,536,885 *5C8BD40695A933567B59567A77342D75DD8A9BBC WHITNEY.EATMON.COBB
889,536,886 *5C8C2097E2839FAF8A3B1A51B4407589B9341A5F 276641 PERHELIIKUNNASTA-EI-JOUDU-VILTTIKETJUUN-
889,536,887 *5C867064C176A969AA329F2CDF597B35F7DE40C0 wii-clear
889,536,888 *5C8B746DFDD92E06B1817A4269ED6EAA239FC8A4 2952040 H
889,536,889 *5C895F4A6D062567137C52146F748CDA33D27395 WILFRED.INDEST
889,536,890 *5C84046D05D9753E81FC81D5060CE08A6F77F768 2.automaatiov
889,536,891 *5C85452A80E09BEC885A5330D84E3D57F62CE517 2BAGESQUE
889,536,892 *5C81EC3A1E83ACA41EAEDC4BDF170970B1C877B7 WILLIAM.RALLS
889,536,893 *5C8830F2B6838C6BB86820B0BB565D7137C944AD 2.dj'i
889,536,894 *5C843A95764453F56AA9FB54EDFD1912F9EBAECA 2FARMAEREO
889,536,895 *5C84A2E1F6567DF1B71C00765B41C60B53258E32 WINFORD.COULTHARD
889,536,896 *5C88391F3EBEE1E36FBEA5651AA9E54456BC4940 2HIBITIES
889,536,897 *5C8A9CEAAA9F48A7B1B8115A368E711672EE218F 2IAMROUTE661
889,536,898 *5C8FEC0B8C1C0E0884CC9234D8E040F0D9FBD2D3 wjtu
889,536,899 *5C8F2AEA1C55D4B48EB2221DB15A10AA7CAFA138 2SFTOSMMS
889,536,900 *5C8BC5C63B7E85764C6C21723AFA7E3FC97F0AE5 2-soveli
889,536,901 *5C87E95DA56B10E8058D5C57342FBD730FE8559C [email protected]
889,536,902 *5C8FFFBEBD94B459CF60696D4D7A2694AA542DBA wr02
889,536,903 *5C8171690D6929EA03DD011C9DCC4DBA2C138835 [email protected]
889,536,904 *5C8B8593980ACC313C9D3F133BFCCE6F5D13DEF9 3:..3..#..&...CURVED
889,536,905 *5C801C5CBFDA6B84267B182A11D1C69E16918EE6 356045 kolme levyllist
889,536,906 *5C857C7D439487CFBA195142CF83FC10A67CA106 WWW.IDLEHOURS.COM
889,536,907 *5C8A0AF5AD5420A4E7206DE366B4B8481B420EB5 WWWSHIREOFROCKHAVENORG
889,536,908 *5C832F46E6E38E5614FB483457AB8BE8FB9624FD wwwwelshlandlordsorguk
889,536,909 *5C8FC80F2F35FA7F4B09CE8E3B1100B64F97D105 3ANTIUNIVERSITY
889,536,910 *5C8BD15503D867D359A93C83C480B794F2C35026 WYATTHULTZ
889,536,911 *5C8659C6472E428E1FFD272CC4AA534DE4440495 3B<-o~-0~<====q
889,536,912 *5C835BEA1019F412FF20F074CCA48FA26DC581F2 3B<.O~.D==Q
889,536,913 *5C8D1BB8958675E7B7F2DD8AF8F1D6C1A0A804F7 3CAPELISTA
889,536,914 *5C878EE107451B4767C11EF4B51E7FE01379F782 xaviersabean
889,536,915 *5C85B0F1F696F095AA118665128A8F46634BE3A8 XBILLOU
889,536,916 *5C80935CAFFEB6967C06550D2244C8C7ECAE107C )X(*dP
889,536,917 *5C8CCDDC375F55B53BDD87FDC164818C6F180C1D [email protected]
889,536,918 *5C8168B36474E547F49AA00CD67DEA5C7A4B93F6 3-liikenneturvallisuusongelma
889,536,919 *5C80C1BE0A16B755DED3CDCD0BB63EB1A2A69568 (X) O~ (######3
889,536,920 *5C8F1D43D1224CD17C31410839D3CB4C2A0400D3 [email protected]~O.splat!!
889,536,921 *5C8D3E747BAA4917E15B5B22FA94256F6B402D69 3.PETOHANKE
889,536,922 *5C858981C82A952E2FDEC4FA67611123D47A8369 3RIJNVAART
889,536,923 *5C897E6A07521009EC406A3CEE55B8B494E44A7F [email protected]
889,536,924 *5C8412571E199B97719BA58BF787751E72D6659B [email protected]
889,536,925 *5C81C8DAF27DBB68542B476D3F6918A02AC13D21 3 yersizligi
889,536,926 *5C896379622735C2ADAD737E19F90787F13A2E1E 402534 SCHNELL-VERSCHLISSEN-IST-DER-GENERATOR-
889,536,927 *5C8AFB540C2BE203CF49C605995C79238085BD71 Y9&A
889,536,928 *5C8A5333B7B2E663F397BA9BE88A7D22A40F2F59 YAFETI
889,536,929 *5C83163A3FCB028B68A7FEF74F5925DB58A5C715 [email protected]
889,536,930 *5C80136C9CA82AC8C552915617D3DAB1274393C2 45julia
889,536,931 *5C86EB1B1DB0E679826A8D91459107A9B69CBBB9 [email protected]
889,536,932 *5C8C1FE68DD39DA342D0006DEF220630E34AC28B 4.fasizminin
889,536,933 *5C8C0392842EEE7909FDF22DBFBF97C5C189FD1B YENFIESUGIARTO
889,536,934 *5C8362015A0BF9C40FC4523B5FE2B406E19D9942 [email protected]
889,536,935 *5C86DA12537269E9C8BAA3F1E22E6F8AE231B31D 4KUYSNIHS
889,536,936 *5C8F38FC8259499A5ACAF16E4CF607EB2C11F4DB $4L4M4ND3
889,536,937 *5C80C19F35C42CEE5D73D40A1720C4A89A4F6E77 4TYUUSOTU
889,536,938 *5C8EC29DBA2255D28000A75BC9EB63B874F144F2 4UMGEBENDES
889,536,939 *5C884D7F01407446AEE8B57139D50805E0C1DBE4 4WUAGEJDNAH
889,536,940 *5C8B8DD33670771A5031ED232FB60C7717E854D8 534880 AUTOAONMAHDOLLISTALIIKUTELLAJO30MINUUTINKULUTTUA
889,536,941 *5C8BE1769F603AFFFB15EE789958C576C39CC842 ZAHERHEMANI
889,536,942 *5C862893708DEF2F29364F48A0699AAF79810931 ZAN_ZIBAR91
889,536,943 *5C89FB1599156C800A2C839B84BE97C9F6E170B7 zeb-jess-bergman
889,536,944 *5C83576C2E478C5AE778CD418519E4AB67C95E4D ZEICERPP0
889,536,945 *5C8C2160314EB354ED530AD85ACE3BF97B1C6D9C 5BSWLLOCSIRD
889,536,946 *5C8242DEA650A64F4D26DD330BDA3637C3287F04 5BSWOLDENKMP
889,536,947 *5C8FBFFA3D33532663E850FE2057CE6EEB09438C 5BSWPEXCOLOURSPECIFIER
889,536,948 *5C8EC7B0192BDFAB8ACD5F40437B198E6BE025C1 5BSWSCIALABBA
889,536,949 *5C8F42CC4B0B44B3C5F3B153AFB6BDD830E48BB0 5CMSAVESTATEBSW
889,536,950 *5C8FA1EAD4A4EB3E9ABAD022C12A50562624C38C [email protected]
889,536,951 *5C8699FF1053E65B4AFF5B05FC4EC4633F43E100 5feb1594
889,536,952 *5C8B538C57F93CBC92D958344B647E34C3E5E16B 5GOLFERGOPHER
889,536,953 *5C85A3306A354CDA5B1A6239F4A54C865CAF2434 ZIGGYSHOES8
889,536,954 *5C8A7E45BA142D3468735648932AC7615933A7D7 5IRHUNPDAHR
889,536,955 *5C891DCBC6A6E5BA4B4536FA501ADFDFDF17F685 5.limesforschung
889,536,956 *5C877DA221104B4535584912B8B3EB3868B8AD0C 5MOOMOOSCRUFFY
889,536,957 *5C80CD335233E55E1528786CDC9AAD4BB637F236 5OKBOEKEN
889,536,958 *5C86D59E80E4F370B633AF3263CDD9D7CD6E55B0 5OKITTEN
889,536,959 *5C82C87F87F02AFE1EE8EDD787E479F4AA91BA39 Zve
889,536,960 *5C8210174448105288F4237108B939D8CD62968C ΛΈΡΤΕΡ
889,536,961 *5C8D8C46C15F62631B111BCA0A504D9EBE4034FD ΠΡΟΣΈΚΡΟΥΟΝ
889,536,962 *5C8AFD0A5DDA29E07590D48A2CDFFEFDC529062E 5WAITTOSEEHOWTHE
889,536,963 *5C8B19CA8FBD3DADDE163FF02C5FC0799A1BC0F6 5WELDFUL
889,536,964 *5C823E8946B812694793C6D9AEE812826BE486F1 667DARRELL
889,536,965 *5C80861C90B8280F065945323723D9BAEEA48634 «НОРДКАПП»
889,536,966 *5C8D234D405A45CC66983E6721F882ED01516D6C ОБЕРНОЈКИРХЕН
889,536,967 *5C8BF301058F2170FCAD814E99DDCDB9BFE8110F 6DEMISARIS
889,536,968 *5C8602898E021AB3204B08724D44EB02A9730037 ФИЛИСОФИИ
889,536,969 *5C89221BF1C03AE8ACA863E324538606CC4F3FF9 хірурга
889,536,970 *5C804DFAD56FBB5B5E8548EE7FCB1BFBEEC366D7 6MUINAISKARJALAISESSAS
889,536,971 *5C80B42D5E0BFD4C75B2EC7A64FE485F571EE442 最大トルク:61N·M
889,536,972 *5C8E0EC706DB564BE26F790EA042AA5CDA12FAF0 6RESIPROSEER
889,536,973 *5C85E9198DC9648C393E4D68CB4429CBD56E5C88 6THEATREGREGORY
889,536,974 *5C8BD96683B2CA5664220947B4D433492925DC66 6WEGENISES
889,536,975 *5C892C54EAD966C28EBC5C27C7C7A467637A36FD 703596 ESIMERKIKSI-SAUVON-KOULULLA-K
889,536,976 *5C8AA1D69F89D0FE85DE70D80E74B720BA9105EF [email protected]
889,536,977 *5C8633802013A171334FA76C09794048A40B285E 7A5713R
889,536,978 *5C86559DB2C7DFF0A3B4A1F6943126028C58E842 7ABSTEMIA
889,536,979 *5C8234AFC7E4FCBD31EA96AA37E76863B8158657 7BSWUEXITBSW
889,536,980 *5C8ABF615AED8B995F0446BFB80851CF1C96955F 7DAVINBATELNETBS
889,536,981 *5C80D9940AFEB52E6AF64EAB62AC1EE26D65BD55 7DMARRERIEZ
889,536,982 *5C8C848F19E711E9F1A2AF906CF87DB466F5A8DB 7HUGEGROW
889,536,983 *5C8474D07C98A60433AA778E002844711664D8AF 7INDIANAC
889,536,984 *5C8063281A572943FD569756DEB5061FF6FECCDC 7NONYYMEJ
889,536,985 *5C8DE14F52F40AC6E45C9203074E02EC5627C46B 7RETSAMSU
889,536,986 *5C89B1A9D30E7910E166F4A950AC550841E08DF4 7SEUQAINA
889,536,987 *5C8602E40E8F700EECCD3F4D7672F4F03C5899CB 826AMERICA
889,536,988 *5C859B4F5EFF74B2B116E481D8F720B9FF5AA351 885COREY
889,536,989 *5C8054CD8C383879E8FD09571EB80E7C989ABF5F 8A05D4
889,536,990 *5C82F3130B6BB5B700C3C2AACD2F8E02E2E1639F 8CROCKADELL
889,536,991 *5C8229028C62F5166B9562509BFDBE54DCF0EA69 8DONKEYLASER
889,536,992 *5C84A79E8C84D4A2939031C2ADA3EA29D6F56ECC [email protected]
889,536,993 *5C841BA4ED5E81358A86022F844D753549090375 8ILOVEEFFIE5
889,536,994 *5C827A53D86D1D5FD113489987E195A9E02C2E66 8INIGREV
889,536,995 *5C805A8AC287AC3D2FF5239E7278881F4CDCAD21 8INSIDESUMMER
889,536,996 *5C84574FBD77855D07E99902256B27BE51077BDB 8JOLTINES
889,536,997 *5C8B4530223ACDCDC2A8918D658C1F16AAFB799F 8-kaksosista
889,536,998 *5C8771C1509B22DA314501CF6D72AF45BDDD335C 8ongetelde
889,536,999 *5C8DAC373FE3B64C68C67E931E4AF4EC3091F67D 05MAY2004
889,537,000 *5C818846B25ECEB7CF555FFF89AE629740E27621 )0(~Q=3
889,537,001 *5C8FCAB40AF705413A09A486DF46D686AE9D1E70 [email protected]@N
889,537,002 *5C84243385CFB1817EEEEB97096452FC05492D3D [email protected]
889,537,003 *5C868D7FD82EF0A22F89F6650B1BA5C93B7D3591 959755 yasamcokdegisti.
889,537,004 *5C86A1208C3DE8AEE22AD319AE0513B414B4EF60 113675 MENSCHENUND-BUERGERRECHTE-WURDEN-RESPEKTIERT-.
889,537,005 *5C866EC5E8AAE1D567C238CA5EAF32311695B955 1186056 esseieindeutlicherzweistelligermillionen-betrag.
889,537,006 *5C89ACFE425EA7E2B6F3CDF649BF89B259519455 997519 schoen ist was anderes , peter
889,537,007 *5C88EFBE8D502479C298D25FF939C0003F66550B 12JAN1896
889,537,008 *5C8B596A34B158CB202D3E562EDCFB8F8A9C2330 1558311 solchegoennerundpromotertrafaizikovitchnicht.
889,537,009 *5C8A1659FD40A5F79FAD5892FD2DC1005455BD15 1583882 samalla-listalla-ilmoitetaan-tulokset-tapsalle-
889,537,010 *5C8BC9F526CFE2432E7AFF688DA801E1C7CE4B45 1613126 kutsu h
889,537,011 *5C8951EE444CCCA86C64B0D50212D934EE82ABDD 1644629 huomioi,ett
889,537,012 *5C8DC674D24825AD0DC4D986B73AD90027543904 16.HEJDUK
889,537,013 *5C89F09E08CE709C84CBAB92EAAFA138676E54B8 9GEVENSGEZIND
889,537,014 *5C8611F23FE0CB3D8B2C384EC4C810CF1653A081 [email protected]NA.COM.AR
889,537,015 *5C89AF433E0E4B55B62BECE7F1E8279122CF1C86 1995-07-20:.Irish.Bootleg.(disc.3):.The.Point,.Dublin,.Ireland
889,537,016 *5C8B033CB1FEF131160DF941D8FCAE2466251B4E 1ASSEESUA
889,537,017 *5C8A4EE87716C4863DF147C8AD1C42EFBC2A5E12 9PRODLOUZILI
889,537,018 *5C80CFE48139AC539BA03D6E8204664BC3F11674 9 SAHELZONE
889,537,019 *5C825112363E82BE14844793CA6C6BFA609353BF 1DAAB9180A343B7EB3A59581A4C853B6
889,537,020 *5C87F2595DBC3960AE10B4DF9E9FAC360026A647 9supereloquently
889,537,021 *5C8B40219035919973444F198AE363B19E7E38AD A0LKP
889,537,022 *5C80FB9FA0FD2BB5828E9931BF9E2212F71CA400 1KARAPINAR'I
889,537,023 *5C8AEE3471BF7506BB86EFBCCAF0B5700DCE1B04 1-LANDTAGSBUETT
889,537,024 *5C8A8893850904432C119B5A67DAD42BCC8F4214 1LJACHOWSKI
889,537,025 *5C8308D9529ED130500CA8A7E5B38B1CFC71DE97 A4H$R
889,537,026 *5C8088DA56CC1C0922BB117A6A57F031D7AB2B29 A4Y
889,537,027 *5C81661007A9825EF72D510FD2EA631F96F24C98 1.premiumprodukten
889,537,028 *5C8A0BEDAF5345BDBB25D6A064D0E53A6A0897CE 1-RFSTEN
889,537,029 *5C87FDF814520E2D37032D6D3879D58212C11FB1 a9gld
889,537,030 *5C8D5143AA1D592461214A2683900A2FB3983759 1-SENTATIVFUNKTIONEN
889,537,031 *5C87DCB85149EEE84BC6C15E0739662A366019BD aaa8$#
889,537,032 *5C875A19A3001B75B117075E3C464EE77B0E8AD5 aaaq[f
889,537,033 *5C862FBD60FA70509CDCA2A84665EF3BD58F034E aaawz<
889,537,034 *5C87BF88BC665BD014992916B850DA8820126A73 1tinonga12
889,537,035 *5C86B2BDC5D41554C59281FDBA478DA08A0655D1 1TSINUMMI
889,537,036 *5C8CE544CB503B11D0CB0F5105A0EE969371818E aad26e
889,537,037 *5C8B5CE83A57E2D6CE8F8265D878912BA5A1DA35 2180149 TIETYSTI VOIDAAN MENN
889,537,038 *5C823379412E71FF519857F750C22BF027AED4D1 21VAAKA
889,537,039 *5C844CD66FA00B09DA832FDE0A48645DF40A97AC AAKRITI.BHASIN
889,537,040 *5C83C94E766AF7DFD1EE5FAFB97C167789D543E3 .a..allegro.ma.non.tanto
889,537,041 *5C8D8A5BA632493E14BAF07CEB72691709368315 232muu2gl8
889,537,042 *5C80CA620E9F93414E210AEC687B9650DC9D37A4 AA]R<
889,537,043 *5C8E4DAF0A8D311C43176BBC7C595267862E20CD 257824 burada-da-baska-bir-secenek-aramak-cok-dogru-degil-
889,537,044 *5C8D1ED312F3401D3D9255A4601954E92891F2EA 26may1910
889,537,045 *5C8C2ABB2E26F00DF5663AFF5745A5A88409151A 2938455 EINER-,-DER-MAL-DRAUFHAUT-UND-MAL-STREICHELT-.
889,537,046 *5C85106516436466BD624A9D80DD8F502EE6E35B 2AB3F848AF433D638B0D3198F69AB39B
889,537,047 *5C8F1B429B05FF3CBBCB2B668575A40CB45624F7 ABIGAILDON2
889,537,048 *5C8AE3A39D4CB805D49A3361291972682BA8F300 ABIGAILTECH2
889,537,049 *5C8422C1F86CA91981DD47F75ECB33D107502630 2asphalts
889,537,050 *5C850EEDC01755C40BD1C88FC07F17AC56F640AD ABONNEMENTSTILBUD
889,537,051 *5C86C7CDAA2B8003F933D6F653F9806D3406F612 absolutenesses7
889,537,052 *5C8D186B1396178C625F51A6CEA7792EE467EE3A 2haengens
889,537,053 *5C82246039C2E21B39B512336510CBE19FEF1439 2KULJETTAJANTUTKINTO
889,537,054 *5C84E362843859477C52A3B44382333BB8EE2A67 ACENNENG4
889,537,055 *5C87415A6E1B95DE7C2564438AB8E3D3BE701749 2.MALOGOL
889,537,056 *5C85686B651C6B46662DAEEB8D363EE1C1CAFF32 2METAMERICALLY
889,537,057 *5C8069874F603D3E0CF78565F13AAE7160D6FADA ACHEULIANS
889,537,058 *5C809CD6B9DFA2D4A72BAA2A829C3DA880E1979B A-CUU
889,537,059 *5C8363748C11533643E43DD5A7C7DA852D68859C adnh8
889,537,060 *5C85975B15BB9580768C4DE131371D2690709B58 ADOPTION (FEAT FUNKY49 AND MC LARS)
889,537,061 *5C8F41DFDC1EF50E95139F75A5E0FEF50075DF8B ADVANCE (EDIT VERSION)
889,537,062 *5C8FA307B89DBCEC3763B094EB0745AEE74FC977 ADWYW
889,537,063 *5C8ADF6A93E0A472FFDD032717BC44E763737CF9 AERENCHYMA?
889,537,064 *5C85D03C2BD5173C7FB637B181CE03AD6EEC2584 3SPERMATOVUM
889,537,065 *5C84961434A68F76B58A825FBE5412F499FA489D afvlotten7
889,537,066 *5C8741F32E88254C0BB100A000B3D551F84BF9EC 4boomsma
889,537,067 *5C8D1A1D8C3F5B15B7756D28E2A0A3251F4BD12B 4IFERYTAS
889,537,068 *5C800A1C2CA4F13F12B0A9BCBC9588848ED980F5 4iluvcompton7
889,537,069 *5C8EFE37A23B1EB428F6D12BD1E57F59052DFA17 4L!8!!NG
889,537,070 *5C8AE480FB5F5D386DBA14AF3C784608FFFA22EA 4N4HEIM D
889,537,071 *5C8EAA15E8318BC194D58515C6BDF4614C01F600 4OLIVGRUNEM
889,537,072 *5C841840E792C463B10BB3B9F53B0A734AC3050E AJANLOTTS
889,537,073 *5C81A0A0D1B004EE7451DF08676272933ABA2DB0 ak-3"
889,537,074 *5C8642167086EB8825673D551775D3C768FBDF2A AKQW&
889,537,075 *5C8FED4C506870D7171A397DD0E79DCA116A3237 ALAM.RABI
889,537,076 *5C8FC026BB3A44FF9256E50223926A761980699D alecburtell
889,537,077 *5C89BBAAA874FB05719D69F8EC8FC7F1DEED004E 554417 georgian armeijaa on jo monta vuotta yll
889,537,078 *5C88E0E757C0FC54EB55315DF56294754D8F6886 587566 LIEBE : GUTE ZEIT FUER NEUEN FLIRT .
889,537,079 *5C821D4E921559688C2100E28F4B95B5D2B3AEF5 [email protected]!L!ZE5
889,537,080 *5C8011477901EAE66A21ECA01C7F47052AE2B940 5993as
889,537,081 *5C868E2C6998C193CC91985A2B3159184C4EA9F9 ALIALSINA
889,537,082 *5C8233119E00B9430CD97E035F45EB669E7F485B aligoson
889,537,083 *5C8E9D8BD5E07BB541DAA0D04F205876353CB461 Al&L
889,537,084 *5C8F64268D271BD3B4D175F9924222490780E55B 5KSEMPLAR
889,537,085 *5C869BA72267B8A403462CBE14F5FF8A63FA0297 5LEONARDBIGBIRD
889,537,086 *5C813D91F97E509F4EE353D66C165D93E69198E3 ALVIN.BELBACK
889,537,087 *5C844FB078984C69513467A0321E8561604D9121 ALWAYSBEONTIME
889,537,088 *5C843F8955577A1AD3F1FB522769E90E9BD17484 5MRLCFCBSW
889,537,089 *5C8810BC0C4D9F8BB3D32FB80FAACDBFF2594295 5NEDDIUDEB
889,537,090 *5C8BC49E6264B24739A6DDDA3DAB533E200A334E 5PARADIGMETS
889,537,091 *5C8EB2D6146CFFB8D7C96AB340FF01138F4FCA4C amct
889,537,092 *5C814F6FE0B7979D2C3139DDD63F39F415CD7817 5YELLOWSCIENCE
889,537,093 *5C84DEC712AA5DC6552D3CFBAC33A964ED4F56B6 and-Humphrey-of-GLOUCESTER,-WARWICK,-and-others]
889,537,094 *5C829ABAA9D77545D7DD1CB4C7BF897D3454C753 649988 long-distance-costs-less-,-some-local-services-more-.
889,537,095 *5C8F69614DA9900E6057631C469DF86D97EF981A andrewwiedmann
889,537,096 *5C8D4BE7F78008F2CD7902B09218A077EC52F3A7 6.5KBPS
889,537,097 *5C86FDDB440FA45D182B633F3FFA3A4165A2540B 6AUDIOFINA
889,537,098 *5C8A7EBB9230F6194F54FD86DEF7C07E52683F0B 6BSWBAGAIBSW
889,537,099 *5C84B54793CE9E2CCAD3D38DD3A67B7DD791AB6C ankerbaand
889,537,100 *5C8911DB96B302BC7EE9C5B27D498A3DD667949C anna-casil
889,537,101 *5C8DD7522AFF7E9E7F137639BA60DBD3D4D8C96A 6D7BE4
889,537,102 *5C8E1C1FABB0EF60E0FB0606202794875B6DDD03 ANQUERAS9
889,537,103 *5C880260760A1FF20B47EBA4A49F3651811FF7BC antigonus i am none, by this good light.
889,537,104 *5C88A67EF607F737653A1CDA7E04DC09D7EB053E antiradar
889,537,105 *5C811010AACB57095B0378A5D5CB4E5CFF0E99B5 6INSTRUMENTLANDINGSSYSTEM
889,537,106 *5C80447C06C6E542D8DDA855F29344C321109A76 a+o!1
889,537,107 *5C83F30C769C7DC7E411E56DAB1749EF8D681423 AO,R
889,537,108 *5C8C5332CDE97FE5B30CF1991EF5D27ACD895498 A/(PG
889,537,109 *5C827839B2B27F0AF143C898DBC0FC0102D5ECDD APOLLO13SYLVIA
889,537,110 *5C80A1FE3F29A6C6577B8B3DADCDF9525CB32047 6TESTPINS
889,537,111 *5C8AFEE52FB5BFE33660FB4DAE92B9055B78EA31 AQNT#
889,537,112 *5C80A5C7241D7B8A84593184CCDBF62883D7B9C6 6WHCUB
889,537,113 *5C8B337849CA798D8C735D0B299600CDA89C7A5B ARA
889,537,114 *5C82E67BBCFAC3C9997C2945FF5A52EFD574A906 7BOOKITCOUNTRY
889,537,115 *5C855124F1C837DD8EE81D0466F627790463FB7C 7BSWLOONIVERSITYB
889,537,116 *5C840418D9195D470603228D2F400EA568C58B84 ARNOLDGESING
889,537,117 *5C8E6DE896F08C8904878D74ACD9E8307D2DB3A5 7COSTENEDE
889,537,118 *5C8D1D4C408503DEE1A83DA3F32E197577351242 ARRESITNAM
889,537,119 *5C869D250CB908E137AC8C4B8748A248911BF216 7!FF5
889,537,120 *5C841820871832E509956F8B3711C9E6EF1BA4B0 arthurfleetwood
889,537,121 *5C8A1B684FD006E8EB6B9E89D0DAEF3025BE2936 7HYMNOFPRAISE
889,537,122 *5C8BC356B4FA77495E1CA5D287E98FA786F0ADEA 7INMENSO
889,537,123 *5C8E6503D2BA0112746462C6E9735EF8DBBD17FF 7LOVERBRIDGE
889,537,124 *5C84BB29575DC15016D54A3270ABCAD4CA9CE268 7MYENTER1
889,537,125 *5C8BB16B6707F72E792341C6F31180DB94A3FB67 [email protected]
889,537,126 *5C857B45623495B6F8BC7DAB33AB036DF3E60377 7RAINBOWMONTREAL
889,537,127 *5C8061109F9FF0F21CF89D56BB5CFC1081784609 [email protected]
889,537,128 *5C8E02A09D742C089F8C22A9BB685CEA32537E90 astapovichbsw
889,537,129 *5C840B2EC0520856E8EF7B457294747741223F27 7SIGJNERMUSIK
889,537,130 *5C8BC13B4A599C0F6B2656C075FBD2FE4E6880E4 7SNACIHOM
889,537,131 *5C8ECB94C3067766D121F4FC2DD1600ADDB9DD9D a.ta
889,537,132 *5C86BCA02B430B50891C79CB48CCC199C57BEA27 8330rol
889,537,133 *5C8CFEE8436DB262008A053AE8A72B57645980C6 [email protected]
889,537,134 *5C81D745C736D33200154A19F10BCB56E77AE4C7 8ALGEBRANONLINEAR
889,537,135 *5C87E3493BF51CB7758B233E03001BF7F9850A70 AUKB+
889,537,136 *5C867B00BC002939D19BFE174CD1167312DBF886 8cf574e0542f3bcb98998656b99f0f5c
889,537,137 *5C8849AD37F4455860A76C8BA17E64C484B2EEAF 8coacervating
889,537,138 *5C8EB54B0FBF1E1687472234AF2D6149D2CFCB60 8NEPROMJENLJIVOG
889,537,139 *5C881DEF754944A117CDB81E63FE238C68E5232D azvww
889,537,140 *5C8EEB1B4E8F5C05A2F7BD4D53C2E4D7E5E207EA 8RUSTEVADER
889,537,141 *5C8A3E756C156FFAFCF28F8206F6E5B67616BBF3 ~ ~ ~<=====b
889,537,142 *5C8B56EF95A4EB7AF7E0CCA2F0E7AF6A0A2DDEE3 B######>`~-`~(>_0)
889,537,143 *5C8B4B71B346F61443AF42302A276FB3A1726132 [email protected]
889,537,144 *5C87A544EC4CD4B5F527EF006E408DADD6746AC6 b----) ~0 ~o}8{
889,537,145 *5C844ECB8C9766FEB1A3DAFBC7F20CF2B305E84A b,_;1
889,537,146 *5C8FBCC79E46B9EBFCFCE43C4691BF1175EDA639 8VERVOERM
889,537,147 *5C8B0B652B5F3D166E7457D37354928B310C54D6 b34s+ln3ss
889,537,148 *5C8D122DA10CA91C5B3BF6FF9AE0F446C71A915F [email protected]
889,537,149 *5C84832AEDF92608488653392227073B62037636 B(5MT
889,537,150 *5C8D40E0AABB9E3EF7D95408B838E661C5B0E4EE b5vl9
889,537,151 *5C87B4B6B35B911F52DB2875FD9E8464EC376C01 b67;
889,537,152 *5C838E6A275C5265DA984C123DB9F69647B42FF7 9BSWSUPERSTARDOMBSW
889,537,153 *5C8C31CD5AF129DD9F27AEEA15AC951103FCCEC5 9conundrums
889,537,154 *5C8FB54ABFEA37439B41C04D002C0112DACB3F08 ba8-
889,537,155 *5C89F8CB29B8067BBA2CC8D7667B322AA0B89C8D 9HARNESKJA
889,537,156 *5C8A7D6F4B6E95138E5D61F32EAB59E71E128F21 9IAMTOPGUN6
889,537,157 *5C853B0485DD45316EBAEBAD9F801F551F3181CB 9ILUVZIGZAG1
889,537,158 *5C81BFD9042AACEDF87BF27D73CBB1B80177CE57 9MINISTRATIONSES
889,537,159 *5C8178E3EF1DAEC9542A8098944D71A4B4333C94 barackmom
889,537,160 *5C844448F758C4306BCC3503E213C327E45A0EF3 9RANDVUTRECHT
889,537,161 *5C83AB331F86164F258A07A6527A6884556F483C 9SANTOCONO
889,537,162 *5C8366A33120F113BB890DA3D2D2D306901FB0CC 9SHARESMENS
889,537,163 *5C8DF61F90BF21FC52D8B06B0BCC7F23E4755245 BASHMNDP
889,537,164 *5C8181E9D74CC9F73D3AEE3D69CB990AF8EB6ED3 BASWC
889,537,165 *5C8509A013778FEDD96849BE35A58B76B47CCFC6 9UPGRABGRAB
889,537,166 *5C81B1798C58752D2C6FD5469C8F8DBC51292B41 9USPRAWIEDLIWIAJACA
889,537,167 *5C8EC593962AE922A83A4B6705E40AC657BFAC91 BAYLONIN
889,537,168 *5C8DA97CAF9933290853F166AB282FD7916FC9F8 9)、生物学(isbn
889,537,169 *5C85ABD329FDDA0714ACCC4E12E18729656A167B BDVNK
889,537,170 *5C88F100DF4B4F23ECD4774823AC7DB6C479038C BEILWICKEN
889,537,171 *5C8A86D2A7980D6160E4D4F1E561D4051E2156EC [email protected]
889,537,172 *5C8BF54696C9BEA3BC5655EE7B8DB05D0C2ECF4B AAATAAATTATACCTTAAATGCTTTTTTAAAATTCTTTTTCCCCTCAGATGTACACCAGA
889,537,173 *5C8272CBC4DF5115A087D2CAD3EA9FF6C06146E3 benchoan
889,537,174 *5C8762BC75A3CA8F740446C998171F82CDD1A48D /AABAA
889,537,175 *5C884490132E95CA657EF1BADB3382FA6BEFB83C BENJIELIN
889,537,176 *5C8CD1B1FE22687FE974391A62DD63ACC06895E0 BENNY.PRELI
889,537,177 *5C86FC35B72BB79A1A0E5AD7DADCEB720DBBE1B6 BENTON.MAIDONADO
889,537,178 *5C8F9D9E1639B4C977E57E80D0D1BE006F933D15 BERNARDSTILL
889,537,179 *5C82AF7FC4A3149839A29D1BC28F4EAAF42E959A bernehmen
889,537,180 *5C8223213365E8C98AF134CAC31CE5A3A8D5B444 BERRY.NOGUCHI
889,537,181 *5C8FD10A490F66370E494CFA8A32B761369B3509 AAD`|$
889,537,182 *5C8E19095E29BD659C752186753161AAE1B3DF7A BEV89MEP
889,537,183 *5C8D00CB71CA6FD0A4D36115FC1DB7693E40AB04 aael<p
889,537,184 *5C8A1D74A66111AEBEEA72FC633D2FBD5E2A5F55 AAGP(
889,537,185 *5C8C926B05418C60CCD04561C8EE520871DC7C60 ABCDEFGASMAN5
889,537,186 *5C8355C21627422625449FADCAA0DCC8DA0E0C5D abc-jumps-into-summer
889,537,187 *5C8C40526242816285BF6098841516D17E44CA6D ABEL.VOLLMERING
889,537,188 *5C8B927A97F3A8C0AFBEB2550522E5792DFB6D6F BIACSYM
889,537,189 *5C844EFCE8BCD08CCCD25340B559527BAA76841E abksl
889,537,190 *5C85AE264D6C0B8E8262AA14820F8A331850BAE3 ac;0h
889,537,191 *5C8D50C01C2FA9A6423D95042055CBDAE36493C2 AC,`E
889,537,192 *5C871651E520EFA8E31CD5E49278822FB0836FEA bj&_4
889,537,193 *5C85F24ED98C30717FC5E8E00DF74E58DFB81DE9 bjergstammens
889,537,194 *5C8CBAA65E92110AE8704B1A80B37D339055A01A bkkkf
889,537,195 *5C87EA71B095153E144E6DA518F480EF0494A666 ADDED-BY-HUMAN-HANDS
889,537,196 *5C81ABDC71A5083920C57D7C255E3E93AD30FEC8 [email protected]
889,537,197 *5C890542DEEBF7796E0617A1ADCCDC2660DBCE94 adk2*
889,537,198 *5C87EECEF9D9F5F128956A9DBB77BE2EAC706129 BME=%
889,537,199 *5C87C9C69CAEA3281A090268288AC46B77763C3E ADRIANSPURZEM
889,537,200 *5C8D5E1CCAFA8B2ED4658F8C5BAEFCDDD0F36FAD B_MM)
889,537,201 *5C8A92B84855CA7DEE129726E4BD5152ED10FB83 bo19?
889,537,202 *5C8189D42DF7B72F3A571674F5640EB987C0B17B bo=5;
889,537,203 *5C841BC3C6CEA7EA22461AC04336E0063C4AC8C0 bo+an$+$
889,537,204 *5C8D6ADC92440516AD74C58C160C4B48E5D36B3D AFYONKARAHISA
889,537,205 *5C814B0EF63EC99D8ACDC6EA86B3D8B4E147437D aggki
889,537,206 *5C862CCF4861FFF4F3B0649041E82A845AAF9113 AHEUS
889,537,207 *5C8352DC7500A38D7600AE73D1030348C0A131A1 BOWERI
889,537,208 *5C82AE5566E776647CC32846883FA1D521D5B990 B=====P~0(0-0)
889,537,209 *5C89B165419FF7A891BDC41AD3D71E3F54420223 AJQSG
889,537,210 *5C81E7D0F4BA5611611AD383FB6C7D1D3E6740A4 AKLOSTERMAN
889,537,211 *5C8A097BD61A52045ADB272EDBA00EA5BF1D75FF BRATÝ
889,537,212 *5C802979DA068A475251DE4E843199A7ED912791 ALAKSYOF
889,537,213 *5C852B46EEEB948B866ACBEA4A19E3C8D4D51320 BRFG;
889,537,214 *5C8C094C4E94B59C541E5AC23EF59F956C55C07D BRIANLOFASO
889,537,215 *5C819BE2A004925F8300359A96A08A1FEA70DD11 BRIANNA.LONGO
889,537,216 *5C8DA0DB3C489203C233B15B627676CB75452CD2 ALEXANDER.KASKEY
889,537,217 *5C8F52742CC01B61A8D35E6E15603CBB62820FC1 ALEX.VDOVIN
889,537,218 *5C81821F780F8BA0BD6ED5D0DF29BBC1D1DD9617 ALFONSO.DUREN
889,537,219 *5C8B5DF84737B4A8EE72BC2772CBC34746FF64E5 „BRUMMEN“
889,537,220 *5C897666AED492B0740F3CD34825A041D239C14E ALLENDEHO
889,537,221 *5C817601D652C1E85586D73DD961A6E00B4234AC b&)sz
889,537,222 *5C8A019946DEFD4405AC7B0DB0A71A17E755C7B6 bt01,
889,537,223 *5C8DB551D27D67C9474F89BC679866AC8FEAEF9E BU1O
889,537,224 *5C895ACE5D525C6BA7EDF38B90CFD4020CBEBD52 amendmentv
889,537,225 *5C83B0D32AE8B9D2F67AE723E51B6E358943828D AMOS.GROSHANS
889,537,226 *5C8A44015048840A97E2BDC451891C1A36C1CC6F AMY MARIE WEHRMAN
889,537,227 *5C803D82BFE9C71AF54734AE726F5ABEB2A11AFD AN.5H
889,537,228 *5C87B890430ACD023253B62727E630601BE507D2 Bw9d
889,537,229 *5C82CA331A2624BC52B9D234FAB6FD1C5761F8AD bwt%7
889,537,230 *5C8D6E26A65409D0475BDD1C5268771669A7798C BWUP-
889,537,231 *5C8CD58001E4414F79365E17B612FD6FDA8FE535 anna.(go.to.him).(live,.1963-06-17:.bbc)
889,537,232 *5C8DEE7D635EECB8DC93D84F0808010EFC5E7F79 C02:J
889,537,233 *5C88E2A027BAF1D3CAB4FDA3B064C1BCFF5F437C C03N0ST3A
889,537,234 *5C8DFD27C499D4F846EDC96124E88C0E55056CCF C04lb4$k
889,537,235 *5C85F5EB44A244EFA77156FA8C8BFC953050B229 C0NCERNNG
889,537,236 *5C832E80A2F545B676AAE06AF2CA41E81B32C624 [email protected]+NG
889,537,237 *5C810FB5A38D7447530B1C1C6581C0F482282B8D antirational
889,537,238 *5C8A97B7203650C75E8E72603AD43C5F989FB3EC C0T8R
889,537,239 *5C8138B3004F224405295AD6C6EB375284AC6144 apt-pel
889,537,240 *5C8B276E0C41CDCD4378F7BB61ED8743FE35719A APUYO
889,537,241 *5C8D9140CCE79EDBE72B1E48215E682D14FC105C arck
889,537,242 *5C8C8F878337B4E20640865B3109BF88C7F192C5 callmealover/downsouth
889,537,243 *5C8B8AC7B2D8FEB689D11DF43DE824115341EBE5 CAMERON.MAHEUX
889,537,244 *5C894F015E1A4F7259297FE3022AF2DC1588FC01 ARMANDTAMBURRI
889,537,245 *5C84EC62D229B902D58E057973C06F6F66B8DAD4 candace-rawls
889,537,246 *5C8DB0B7C7DDF1EBF082CCCECE8541977213C7AF CARLO.INOCENCIO
889,537,247 *5C88963136B3C4EF86E4B2E594DCF6814A2FAB1F As4(
889,537,248 *5C80114F764E1D8DB762D76150665F65CE245373 asu1x
889,537,249 *5C883C31CC1ADB35635C803D4F82F864B422AD31 at?5v
889,537,250 *5C8A68197E733D5EC22E2C50B9CF58A8A8255E9B ATENIÀ
889,537,251 *5C8DAB01BD3D03AD2EEC05A1817B3C288442DBB7 A"TFOTOS
889,537,252 *5C81E840D2025AAB788500B9B049CBD6A9708340 CCBBT
889,537,253 *5C86792BC271C4C85C4CB93D74129FC4AC8BEB95 AURELIOBRODHURST
889,537,254 *5C83387868C265FA1D9FAD1A8A3C2545368B8C4B ccsp"
889,537,255 *5C8DC2E427A5653932A3EA24473D4F905EEB6BA2 avaruddham
889,537,256 *5C8D27E6E10F4B3B00E0BBF49BBC3203EC4876B6 cef#z
889,537,257 *5C8C9D86E22EF49CA1BA49A777071E0DF0BA3068 b##)~.`.><
889,537,258 *5C89950198163FD85B1E1132DF2D23691BC0E92D b0000d7egg
889,537,259 *5C83F58239E275A799A8E08C22B2D3FA6CD2D0E4 B32292
889,537,260 *5C87B8E0AEBECCB83CAC4F84AA20F4E61E5FA71A B3KF;
889,537,261 *5C881F22D2688F9A9E63C541CBA437B5C4FE5B8C CHAPTER 1411: LEADER OF THE PACK
889,537,262 *5C84894DF28402A867B04303866FBBD2F8C7041B CHAPTER1411:LEADEROFTHEPACK
889,537,263 *5C8A380BB567BC1137F537CA22F55197413FFA36 CHARACTERSBATTLE
889,537,264 *5C84A141130C615E041D4E9C3537B5DB891291C6 B4!CN
889,537,265 *5C8F801AE5C8E01C5D6578D29CB5E6FBE122C5AE CHARTERED123
889,537,266 *5C886009B72C535CE383C0C4240DAC78A36636CD b53cl
889,537,267 *5C8455096BCEAD4BC5A1D52F472DD1E4211D068C B?ABI
889,537,268 *5C889D757068D6B72A8371E475236B041F098785 balaie
889,537,269 *5C828FC0526EBD33BF576550585FFE7479F20195 chtigtered
889,537,270 *5C837FA152E2DD64D89CB02B124DB01DD7332663 BANDIZZLE
889,537,271 *5C898F1D7A511DEA92F22297DC8408272D15A816 CIVETTA
889,537,272 *5C8B72DEE04B37CEA61C65664DFC7E4105A70156 clairostasiewicz
889,537,273 *5C847D24A95E65DCD26B872ACC89187DB375CF1D CLAIR.SWONGER
889,537,274 *5C85C771E17F3E9F5FAF3DDFBC2669BD8A271766 CLARENCE.MINTEER
889,537,275 *5C8D8029389B913A0552D3E1BB8947CAC0DE39DE CLASSING
889,537,276 *5C8FCE6565BEE7BB245396ECB3315134F521504F b-e
889,537,277 *5C86F3D83946AB079A279D803DB2853CC316BC8B BEECA
889,537,278 *5C8914EF51F52D15B6BA38C9AD0960121587051E CM9;A
889,537,279 *5C8A7787B17D5C7A56F5B9AE934BE78DC557D321 BESKRN
889,537,280 *5C84028C75DCC778C199B475CCDEB8DEA1022A55 codegeni
889,537,281 *5C87A7518F9349761700BDA19B0F270B6F3B39E0 COLDCHILLSALLOVERME
889,537,282 *5C899F795537F2156053D74475E2A96F5BAE8B43 b-ft
889,537,283 *5C865FA090B5B8F0FB1E51EB7495E3B05878D434 COLMA-ALBUM
889,537,284 *5C81168E469944AAE1D029A0B22BD0A3B8A31DDA b+g3m
889,537,285 *5C85D777D6B55BDCEC3F3BDA41513D2685A4E9F4 COMM3N+$
889,537,286 *5C8C795ED19B786BF8BA64918EECDDEDD46813AB CONCERTO GROSSO IN D MAJOR, OP. 1 NO. 9: II. LARGO
889,537,287 *5C8AE02ED6F091A1485BD226927CBA8A6507C2FE b.hrv
889,537,288 *5C8CD2E1744B127556A7AE04768E8DB3F4213FD9 biochem777
889,537,289 *5C82B6EB097F767E326D88E1182DC5F224D0645E [email protected]
889,537,290 *5C81EB05F0D008B1A9420539AC3E31D40165E408 BK"P#
889,537,291 *5C883F5C28AAB4A3720F85631046A133A395BA85 cpw_e
889,537,292 *5C8BDE2517F65D7664CDEEB24D4CCB746D1BEB24 C"Q4A
889,537,293 *5C86C0E8A9EF282831CAD34C31DD090C9AC27FCA c-r[
889,537,294 *5C8075E7F73768FEECBF82AB6461913705B830A5 c$r6k
889,537,295 *5C8BAC944F6706C5DCF76E192A48ECB1B335BA04 craigwelsford
889,537,296 *5C8E9805EE93E773F8F8A49D98116950D8D9F4A4 CRVASCODAGAMA
889,537,297 *5C838CDF29924BB1CEA730FA832CF1B5A4C07AF4 [email protected]
889,537,298 *5C851FA71CFED3B833546F16DA1F5F9F12DAA2B1 BONEQUITRUJILLO
889,537,299 *5C87B10ABA56D6E1CF880CF6D2664F3BD62F9C6C b=====p~ ~ ~ splat
889,537,300 *5C89EE45481E2AB6A9E2CC73F2631735792BC158 cxhq9
889,537,301 *5C83201FADFE19483EFE9BA56A6C33CD8A6A65FA BRADLY.GREENFELDER
889,537,302 *5C811398BFE1CD8C48E50AF68BFA221B2EAAE2C8 cyclobral8
889,537,303 *5C8D026A177D142A1644500F5453006685D1C911 brandi.damboise
889,537,304 *5C81A042ABA78F9890F190A082D570AB869BC31A BRANDONBOTTING
889,537,305 *5C88D074AC6205D177D33F8E40D749A730FE524A cyycf
889,537,306 *5C891CD2CE563FA699BD44285A34D0A130338FCB BRFGVWH84
889,537,307 *5C8768443CE3CB301DC9752AF03BB85086B50F87 D2W,X
889,537,308 *5C8AC81711D2F8B3089DEAE71E5485A515A42226 B$R=Q
889,537,309 *5C85D5274CC57C1EB93F9CAAD6564269A5209414 BRRQ
889,537,310 *5C869E3391B672C2AD08DC16D8032B64C041D0AC BSWDISTRIMACO
889,537,311 *5C84DD3DF8B7CC17C5CC1CBC436D2F4BDFC3D95A D,a8
889,537,312 *5C831328BBF54C8FDFA698538A072F789C0D78F0 daerbpal
889,537,313 *5C8A04A761CD3BB7496A602F9FAB332619175D83 damienolszowka
889,537,314 *5C8CC7EDC775BD542E87D2ABE3468A77356B5389 büroformen
889,537,315 *5C81AED502697F03077BDBFF9154565AB8AFD1CE darenbastin
889,537,316 *5C85E0A5A79F86573018057E6A58ACE650BBB64C bv!gf
889,537,317 *5C82C985E6F37FF95FBDCF8F00024D0B36D2D19B darrenmctush
889,537,318 *5C8F2C092720459E4ECBD521E56D067E5FB9B3FF BVNGZCHT8
889,537,319 *5C851F2537F919C386F47D63DAF3AA6B3B38EA71 bw$/
889,537,320 *5C81D9B9666A34F1DDF0C8F59467A31593114E33 bwpy;
889,537,321 *5C8A17512B1AFD67C42568FAD4405726C5F6FAF6 BWVGH
889,537,322 *5C8369D64BE82B4F2A3E7E8FE3155D415A47A548 B/Xg
889,537,323 *5C820424217541FF884CD3D9D85BFAE40DA4BDFE c0a_l
889,537,324 *5C86A2404C4B3594A6BEE993A0E1D82AB6BCC20E c2jd
889,537,325 *5C8B52430E12ED6FFADFB5AF909160DC753B44F1 Deaw
889,537,326 *5C8DCDB16AB371549B88509B95EBE4BF45E45440 DECOLLASSED
889,537,327 *5C8BB3D3FF9CDC7090C40BC379D5A51A4669F5A5 DELER”
889,537,328 *5C8EF7B9B5FB672F0CEE78C02A09EF315A6BF200 C8UQI
889,537,329 *5C85FFB8069AE8608202F848DEAA303B6C265870 [email protected]
889,537,330 *5C8D261E911DF7EC2F4CA48DDD2DA96760DA438D caccianti
889,537,331 *5C81439AF38BAE3B4AA9741D851D8FCD57C7A19A [email protected]
889,537,332 *5C8FF371528DB45B59224DB0DC2857F2ECD1C8F1 calebkracker
889,537,333 *5C8063D4479D03FB933D03A6EAD55A5D4B57FEB9 CALLAITCARDINAL
889,537,334 *5C8A1D75C3CB26F1F05229221B0455071FE8C937 DERRICKTRIBOU
889,537,335 *5C8FA8B695D48C59D71502CCBCFAC5F850FE6F29 deventure.ricky
889,537,336 *5C8769E4DD74236AE34B556E8B06C9BC17FFBB91 DEVI.LESMANA
889,537,337 *5C85CB49CDF48E3759B4B9958356AC7B2693ECB1 DEWAYNE.LISHERNESS
889,537,338 *5C8A2A5BB1CFB73E20CE951FF2A0B757038393DF DEWEY.OKERLUND
889,537,339 *5C816BE6056E9A60E2483C317359358AC8BA2994 d&f1g
889,537,340 *5C8B23D956AE4565EF1C87202200EF1000A10054 DF6KP
889,537,341 *5C810A04C62889A135CA0D963D640F2F3E29EAA9 DGHIA
889,537,342 *5C83B8D8AB7FC516A7B431EAA0D01636AB1165F7 caseyhews
889,537,343 *5C8228D5325AE8DF2691D317A710EDD7C065D901 d%he
889,537,344 *5C879A53EDACC7512D7AE9216659A5D271C6C2D9 „CATWEAZLE”
889,537,345 *5C8E3BA1267B851FC89E459C4D34D8DDD7E7DCCA d#hou
889,537,346 *5C83EE44C6FEEA3BBD6CC098643FE3C5F81D0E08 c\bk
889,537,347 *5C8C680CD63F6C53CB95C73860D0F50F8E1E4E1D Dicenqueas
889,537,348 *5C825313A54C16B95C6CDCA5B9681C9D83CC7CF8 DIIX,
889,537,349 *5C85BE8D1563AA812820D4E4EBC075BA12329ECB [email protected]
889,537,350 *5C80C76BA821889F0C560606DDD4E493153C7220 D\~J
889,537,351 *5C841973FA6776CAEF166A0C0315E7767A3C65AC C-EUT
889,537,352 *5C8AD9637556A6A86A93EFEFA179ECB75818D64B DL3Q
889,537,353 *5C802824916996E1FA633548C5F9A6F2119C8C2E [email protected]
889,537,354 *5C8A53F9D1AB91928813BFC66941182A57E09377 DMTH%
889,537,355 *5C88F7061CFCD038AC7A17AD3C3963F1776C3AA6 CHARLEY.LECH
889,537,356 *5C8E03759416D8430AAC313E8662ACCE1921C47C DNQLD
889,537,357 *5C8FB7BEB04B1F725E0C2F455D1D36F87AD055C5 CHIBUNTAIN
889,537,358 *5C829A75FFB983684FD7C03012974D9E7D92185B donneraited
889,537,359 *5C817DEF9E8C337BD5DD9B7E4FB0946FE4DFE28D donteprowell
889,537,360 *5C874A64C63A4CA79D58139CB6475EB082980C1C doralia
889,537,361 *5C8A90128DED583EA49E804AC20581C7BF5CDFBA christie-dreyer
889,537,362 *5C83C8948EB9FDC0647D23E0FBCB270CB0EB563E DP-3H
889,537,363 *5C84BE1B479A931A60B40F53417701996390180D dpyj=
889,537,364 *5C8B73906A241E83092C6412C3F819386F1FF8AA [email protected]
889,537,365 *5C80203A4AC52A819B87CEFDADE939C04D4937EA ckifq
889,537,366 *5C85C0D21B77201735E4F988D633BFAF444E30BE ckssb
889,537,367 *5C81C6A1F1967ECADAE790DDF8F513B353E0319A DRURALGREMLIN
889,537,368 *5C8B63AA7F044713B884E776A5F9FCC97FAC5B1F CLARKRAZIANO
889,537,369 *5C8EEA81D2663E30DCDBF9D55A9F32A99C20187A CLASSING
889,537,370 *5C814639A487133CED67484D2418E75BC83B8C82 [email protected]
889,537,371 *5C8C0E3591528EB3612A1FD5F27E83F960F73614 [email protected]
889,537,372 *5C8206EE33FC7C4B45DE9F02E50BA6FA75A9D202 dtuwk
889,537,373 *5C808E6B766619B147824B0C36D49C55AC364389 CLW=(
889,537,374 *5C8E1D343472D880F9732417D8A083A9162BCE81 C!M$I
889,537,375 *5C8FD0F512FC8F2E9E38D0D6AA90B59B7DCEDEF4 CO:P;
889,537,376 *5C8A9BF2D2D7F6F73CECE30D2BE98FE0861E3A8E EDGARRODRIQUE
889,537,377 *5C8C7CFEC8328398E33484D1492FF0DF92C53AC5 EDGAR.ZECHIEL
889,537,378 *5C835E65ECB023F93FAE0CFFB85A2254F414F57F country-usa:-1966
889,537,379 *5C81D17BB63B1886D1192C3B8C82F34EB48D79E4 eg.o$
889,537,380 *5C8FBA0F3AED760BA43308C64626BA300750A3A5 C[,R
889,537,381 *5C8D1165900F71E613BC4CE5868A805782E4AA32 cr79.
889,537,382 *5C8ADD756600D7732CF71C2AB9E69A0454B9E18E CRAIGMOSSE
889,537,383 *5C860357D4F922A9D499BB3F5E9E471CB827D553 eio7
889,537,384 *5C866700A93EFA882A25B8F52C143A7B94F39FC1 CRISTOBAL.HUGLE
889,537,385 *5C884068FFD345ACD42E11B3D2DE7C8A2F730A70 cso2
889,537,386 *5C8CD7D82145E66EC5518D7E590F4049C4E0300F ct1dy
889,537,387 *5C8CB2E69465779EBEC101BE5FC731D6E88182D0 elmowatahomigie
889,537,388 *5C81E4B07E3B62C67FCA0599574A9A097AF1FE11 ELTON.ISELI
889,537,389 *5C82DF058CCB147034D98E210CD709108AA24E57 CTORGONZALEZSALTA
889,537,390 *5C87E5864F67D3F266A724FEE31BFB89885C24EC CU5AH
889,537,391 *5C816B8F98B39D0123A69DFC52175973B09BEBE3 [email protected]#
889,537,392 *5C8A60BE9D9ED0E5E2D5F0DAC21E31D513598CCD CXmK
889,537,393 *5C8B5384EE4ABF4C2065FC35BB09A52218899461 erasmovalentyn
889,537,394 *5C80D662A2647674549DF44C5513B56A39D91068 d0ugh+ie$+
889,537,395 *5C853528C42BFD6209C71DD1187D38B627363C85 D2FO:
889,537,396 *5C85B188901725C6850D04BDA078D9CA7796DA51 ernietokarski
889,537,397 *5C8E8C059555E9301C874494ADB1B8696CFD5C6B ERROL.OHERN
889,537,398 *5C854A905202AE47967D56F4BA1FB1749C732641 d3pr3c!4+!v3
889,537,399 *5C8C67EF234846CC61E80AE1D0CC17FC2D108AB9 d406j
889,537,400 *5C8B801127070D1C9EDEE79E83F3713D85D7ABE7 D48772
889,537,401 *5C8CEBC5F7AC932F85007DDBBA09341DEA4C32A4 espadaban5
889,537,402 *5C87CFE402F06DCEFB6AEC25490C46EFFD2A8F43 d6u.v
889,537,403 *5C8F4B20FA8D5B81156E7F560EF2342E76A9D5EB d7dd
889,537,404 *5C8FC6CFB42AC631371EBB4D5B2331FB0C8E347D D82
889,537,405 *5C8643B21D2100FFCB50717D4A6CE7EE4025C82A [email protected]
889,537,406 *5C8F4DA6F088CC8589E15699D4D09A5103450A95 D9N(J
889,537,407 *5C8A6FE9621749FC44841AC27F1D117A21D6303F d%(a(
889,537,408 *5C868D81335AC0C6519CB1ECDCEAE6AD715022B9 DAARLIJK4
889,537,409 *5C876CF4326DFB17EAD0ADC485C8733615F43CFA daisuke-takahashi
889,537,410 *5C81E3806F942AA6221714CCD10F7B061D20CEBF EXPORTEZ8
889,537,411 *5C8D37AC1B9F544459FF015D265C2D98EFDE8FC3 DANIELBERLANDY
889,537,412 *5C889B08F10251D64B95853D85433D979B4BE2FB DANTEDATIL
889,537,413 *5C81B01DB93B5E4D1649FFC37A9525E440FED398 F3NN31.GI
889,537,414 *5C8CAE7F7DD4347AB16E77665B78BC725BC2932E DARENTANON
889,537,415 *5C8CD7A26C3B0A4FAFA1E47C3CF8439D58354260 FABRIKGESCHÄFT
889,537,416 *5C8F5ADC079A42F0B88A9BB1C8420FCF86A7615E daronthenhaus
889,537,417 *5C82CE064C9917DFAB968514DC029BD8D6473FBA DARRICKVILLARI
889,537,418 *5C8BB0B2A34AFF6597E9754C7F5F25EBBA909727 FAMOUSARIAKAS
889,537,419 *5C872E91E36CD23AD41A15B325DFE5A15DA6D073 darrondelsordo
889,537,420 *5C85060BA0BD94A7DAFD84CD7FF3FCFAC14CC90D [email protected]
889,537,421 *5C8207E827A6F3971FB9520164C1A9C3E902CB70 farheen-masood
889,537,422 *5C8E5CDD069B71E41F6E5EBAFF680AAFFEC5D95A FE".
889,537,423 *5C83FD4155F3DBC91EAD0C8C0CA5478BFAB77473 [email protected]
889,537,424 *5C8B2CC979DE7521563BA01D035144B3EE8E43E5 DB$FD
889,537,425 *5C80A19907EFDEADE937C2E6A679BE407C160942 FENTONEAR
889,537,426 *5C8B071E6CA008A13358DD3B55F678D71817E43A FERDINANDHOENER
889,537,427 *5C86BE819AF6AACF41AA9FD177DA9D6CD24B3B21 dd9?u
889,537,428 *5C8DE0BEBDDC420812E14A5EEA7AF48BE51B0307 dda(e
889,537,429 *5C803F1E54463B2EAC94AFF82EE2E3F3E2BCEC0B fine,-fine-daddy
889,537,430 *5C8C65B250E442FB0262665E248485B0FD108A38 d)dqk
889,537,431 *5C8B73245130F82523FC95E7E65745648A2687B0 deborah.billingham
889,537,432 *5C808585CC8531B52A7D45B1388C9894A5F0AA46 [email protected]
889,537,433 *5C833305D70DB7B63A8127969CBD8E43E3CF941F fo6"
889,537,434 *5C8699CD91DC1FA54212E0BC74880E8BFCA8094A DELBERT.HARTSHORNE
889,537,435 *5C8ED135E6DDB1DE322D03E1CE7BDE7675E57CEB FOREST.TARASCHKE
889,537,436 *5C8ABA09990299185A44D7312087D88D3F76CCC1 FORMÁTUMOZZ
889,537,437 *5C89C22F40FC9BF9AA9E3B453384ED268B45D6AF foster_zach
889,537,438 *5C88CD6F37C6D6D1B6A87EB0722DC34C394EB9BA dennihcgs
889,537,439 *5C8007322A830593395D7DB7AF3280F3CEE6A84B DENNYMANE
889,537,440 *5C8273D0ADF489EACEBFEE9F7B05A75FC46AB4F5 FREDDYFUPOCYUPANQUI
889,537,441 *5C81F5B862D517EAB8E144D849BEFC2C5C3E3450 DEPOSITUM2
889,537,442 *5C889741752ED7D7970CCDB330D3E1A2BC5542F1 de.sorena
889,537,443 *5C898B7AF91FF8116A15001AC7481312D8506C60 detnuhning
889,537,444 *5C826D1B9ABB99A81EDDA116F22A8B005AF7165C DF9?K
889,537,445 *5C88D2B1B74D86485B1107BBAEC426864274E29F [email protected]
889,537,446 *5C8F6A60A024CDA308A9353FC66A49613D71C7D3 [email protected]
889,537,447 *5C879CAFAC056A09EBA032598062ACE4EED6E078 GARFIELDBUEHNER
889,537,448 *5C8DC13D59318E864FA9170E538CD8FAA9F25731 GARFIELDJUSTIN
889,537,449 *5C8F6DE474D102CAC124F0A711AFEA0D51FBC288 GBJCBB
889,537,450 *5C8DA9A154A59A72BE73E4AD3BD7284BFEF88103 DIANASIMAN
889,537,451 *5C8FAC9B09092A2933F7CD221D6F479A94F22C50 GENEMONTEROS
889,537,452 *5C85D6E413C3ACA52D87C64C219BF393A1C04A48 GERALDOKORB
889,537,453 *5C85ED2008A424F6E08A176B1C14C412669223F2 gethsema5
889,537,454 *5C81EC2916EF97003C694E31AC2BC8A32FAB2A35 DJINRESIDENCE
889,537,455 *5C8FD9A00BAAF81F96AF9F1578C834701F04891E glasovati4
889,537,456 *5C8FDA5ADE1809CF036063EFB8F408C760D6986F GLOBALIZECUSTOM
889,537,457 *5C89D13C7F282989C3F5E67E012896C1B465FE9F [email protected]
889,537,458 *5C87A0A30B175DC10BAC3F94E06F6E72C0470BD8 DK#RO
889,537,459 *5C80EF0E1BD64724250246932AA0E37BC8915761 [email protected]
889,537,460 *5C89062B544692B2DAA7504CBFB2C9678C2C05E2 dlp)+
889,537,461 *5C8E1B59303FDC0D06E9FDB16AFECDBBA0249B11 [email protected]
889,537,462 *5C8E139BF51DA6C3EF125633B275BB67DD0D0937 gra$$.por
889,537,463 *5C81D0008AC4BD5D49486163856383E9FFEED5EA GREGYB
889,537,464 *5C80B618FF72C0C9FE15DB93D47B13AE199E340A donfalco
889,537,465 *5C82AF235A5FB786EA8D8DC4B50D954964D22369 GUSADJEI
889,537,466 *5C8A98DD75589314378628314AF720A20471677E GUSLAUKITIS
889,537,467 *5C81D56EB736E385E398E47A5F5D951F6ECB1FB4 GUYDEBNAR
889,537,468 *5C80EBEE17CA1872A62B4107162EC30C3A0EE19B DONN.BURCIN
889,537,469 *5C89171A48E95D433D8976A2326E7C52A1BFAF10 GUYPICCIRILLO
889,537,470 *5C86B3D0C13674E4301F4960D909D029789BF995 H19881007
889,537,471 *5C813B0F9A9A0494E5884AA4494E53C69F73AA9A H5]#
889,537,472 *5C828226730F266068C9BEED181F0614F157DFF4 HAMAD SALEM
889,537,473 *5C87A7D84AD97247F00950551CC15F8D261E2F43 [email protected]
889,537,474 *5C88E2707645DCE7CEC0BB6438F587E93AA605D3 dp8k
889,537,475 *5C88F457381F6C94883A35DC59A773041374949C HARLEY.STEFFY
889,537,476 *5C895D2562F7755737B3E05180FF4F50C4BA01B4 d,(;q
889,537,477 *5C8A29D5EE2ECDD8BE6447524CB6555FF9841A9D HAUNTED(FEAT.SHANEMACGOWAN)
889,537,478 *5C88349A70A7889E94D48761E3988326A70026D8 [email protected]
889,537,479 *5C8DFA85C92E656D2A102B25F58F15DA4665986D DRAKKAR1234
889,537,480 *5C8321439F251ADDC811F858D0F5767BC0C74186 D)R#B
889,537,481 *5C85F0CDFD12EDBA7F75F555A07B454C445AA634 HETICE160
889,537,482 *5C87B04F6C2FB4A9C718734E3617D64AE7B70FD7 DTSVF
889,537,483 *5C818E130BBAF269ED64271FF3D95008C0D30536 DU=MC
889,537,484 *5C8FF8029B6B45DB35EDEAAB7716CD3F76DBA12C DV+"
889,537,485 *5C876573C594086A954ACA22717F5959B0F067C4 DVO;,
889,537,486 *5C88B9B9C70511A93D98F5464B187D87B1CAFAA2 hoyttsuha
889,537,487 *5C829B1D5CA0EB9076D6D86654CA90CF0FE28536 HPARGOTY8
889,537,488 *5C83D7F34D96D805F9D2BBBD885DB5137DD39FB7 HSUOHUONING
889,537,489 *5C8F815A7CE67315BF8011E5F41E9E48C9B7F539 d_.z1
889,537,490 *5C8488AC4BD8A9280EE6288BF24E512532B4B11F huhtalabsw
889,537,491 *5C84B699CDF492E640879C5F3877FA18B8271337 HUIDING4
889,537,492 *5C8BE6D88CFACAAED518A117B45FFBC69CD49B5E [email protected]
889,537,493 *5C802476BC215EDA163CBE44DFF8E44E8021E973 E16001
889,537,494 *5C8B22521A53362B2511CA1321B78BEB0FF7FE30 EBOGAZICI
889,537,495 *5C835A49684C34437B96A4EF3DA9732C3D30384D EBULAHING
889,537,496 *5C8F9BF9F905A43159D010948FA475A3509692FB ec32?
889,537,497 *5C8555D275F374ACFB63433E7C1AE8DE518ECDE9 IAMBLISS1987
889,537,498 *5C8394096866EBA52F3C91BB8E60C7F4874840E6 IAMHAGGIS2002
889,537,499 *5C8D373D46D5EC7A20C5973B83C3B6D2DD9B30B9 echa#
889,537,500 *5C8C278C88C018F581B3A5987DB7460FA23DEAFC iamleo18
889,537,501 *5C81D791DFD4D13848DCC90516B7851C43479AB3 IB6UB9>
889,537,502 *5C87195548AC1E91380207C426FE47DEC42D0852 EDMUNDO.GOOSLIN
889,537,503 *5C8D84318FDFB81C3D2EE3E9F7C19E2E13AC84EA EDUARDO.MOCCO
889,537,504 *5C814E9A569453EF3C3A36BCF4854C4BD4A4D32C ILOVECELTICS29
889,537,505 *5C8560A139562D4082B092A7AC39FAFA37C881C6 egelbuod7
889,537,506 *5C821285BFD8DE383A148C13D006CC1FA3133301 ILTROVATORE:ZIGEUNERCHOR(S
889,537,507 *5C8D95971FFA39591E26201BA92BBDBB0EC6F5C7 eidebonied
889,537,508 *5C827B7F565A0C9665356C9D6B6A7DF6A6671E7F incitasse
889,537,509 *5C807CA0B8476FF56E78D86D06BE12030AB85488 EK?W
889,537,510 *5C8648A9B73EDCBFD054D1B54323D15FB5C6773D i=nq
889,537,511 *5C8970115A76A1B40D0042403BD6AC401ADFFD5F ELINORES
889,537,512 *5C8C586F7E45BAF4E50BA286E992F16268038344 introducaojava
889,537,513 *5C87429F8B637A8C83D9D9CC2069D332A90F1E89 INZILADÛN
889,537,514 *5C884D77A376F4A18099E6377A4491F23F84EFDD ELMOESTERGARD
889,537,515 *5C86D9A047CA44E05662D13E53CD33A8B9AE0CA4 elroybroder
889,537,516 *5C8CE8D655735EE37C74522DA30FFEA98F882568 ELTONHEATHER
889,537,517 *5C86090D3687F8E6442C8918B93E28307D1F415F ELYZ
889,537,518 *5C8F10994E9C5FA0EF92266A0C9F26A141249861 isaiasmattis
889,537,519 *5C8803064B8BCF00EFFD8B859BDEBB623B8C6335 is as follows:
889,537,520 *5C8EC9C394E9FA32B75538EAB53F0BFA799D4E0F E.=.Mentally.Squared
889,537,521 *5C8A540678279290242C867EC5CB4F113A4C305D ISSACSHARRAR
889,537,522 *5C836B10B6ABA3EC6A85A772347713BAD8308435 EMKP
889,537,523 *5C8DA3ADCFBE359D732E7CDE359D8F5C09DC354C ITSENÄISTY
889,537,524 *5C876340BB11986E37D84735A8523F0017993071 EMONEY$$
889,537,525 *5C848F63C34F027867D7C516D0DAD2F2BA180DE8 JA1TM9C737
889,537,526 *5C8E5D8ECFC1EDCD26BFD66464243302006F6B84 ENHU51455
889,537,527 *5C85437ACB3F4EA0CD18371A6DDC6E27E9807C4B [email protected]
889,537,528 *5C842FAD19D6C884B60FC9B638A4734F7C7D25D6 JAGORNOTT
889,537,529 *5C8E919A808B61DC555A229EC2FB414AC918095C jajeronimo
889,537,530 *5C8FA9F45CBAECE5D5C171D682EEE72B7B449EFA EOSB
889,537,531 *5C8115026F6EC5F1237F39D927F551E619C658F4 JAN.HEAPHY
889,537,532 *5C84A716F91A97429E0C0EEB4009D5828B6542C5 epwg-
889,537,533 *5C81DDD69CB689DD6B503C59C589160A3AB645CC JARREDBAPTISTA
889,537,534 *5C8CA3674050D7EF92B565EDA8ABEAB37EBB3B2A JARROD.KUTER
889,537,535 *5C870A0F13137E197C8FECE42CCE610235CC2249 erika-monje
889,537,536 *5C8A1CFC0A40807475C1851EAC0D42E1C16FAEBB ernestobryla
889,537,537 *5C83CC4E3F7A0DAD494D02D07E9892B1A50B3077 [email protected]
889,537,538 *5C807DB3114D2442EA6ED3FB86EF405A9A8C9319 escatim
889,537,539 *5C80F12B235FAE49AAB9E702C7B119A2C3AF3C76 JERAMY.SCHONES
889,537,540 *5C8DB87A7736E75B156DD3177074008445A43A60 jessemccloughan
889,537,541 *5C8208F2F521C37A4ACFE9ACB41DE0FA8C9DBBA8 et'b
889,537,542 *5C874F5E75CA823A45BE930B43C05A70B6B7AA8C ETHANDEREMIAH
889,537,543 *5C8DDC730D126BE27AAAEDD5F3F4E7604271EC0B JEWELERS-ROUGE
889,537,544 *5C80B127DD2BFBB3C1879685E042E5AF2519616F JEWELL.BODNER
889,537,545 *5C841C80C3F64C5CE9230EE4DDB3B179214F1DE9 ETHAN.RISSLER
889,537,546 *5C838179AEC1F3B7F1F717838D5A3A9838BBF7CC ETKOTSREV
889,537,547 *5C869F98C34917C7A1A23E373C943FE81DFE33B3 [email protected]
889,537,548 *5C8A5D0F7DB87FA5065FAB06C8D942051426C0C0 everettemungia
889,537,549 *5C8FA252AC6E0C98B2B74CCA1A2AC27D85F85C2E JOAQUINGARNEY
889,537,550 *5C83040EE5A25F807BE29FF86959F728784DD884 JOAQUIN.TOSTE
889,537,551 *5C8C67747CDF430A1972D5B77C7F4165099118A5 johanamadeus.
889,537,552 *5C848A2F64639F7CFF8C513C857B7F49205C971A F0REVER$
889,537,553 *5C83C930BD59B90CDA2E10CD45E78CFE0AB65BD1 F33486
889,537,554 *5C8B8D0AB7A0C4F0280AB79FD93A208A8B2D81B0 F4RV30P$
889,537,555 *5C839320DDA4A7E1CCC9B75DCA695F816F10A1B3 F9FIXQW5LDTE
889,537,556 *5C83C2F62A107AF5EC2A6B013A61D3A1A3A08D9A joseglenny
889,537,557 *5C8AB6BA6C86666FF270CFC0F0414B410CAA8E8B JOSHLEATON
889,537,558 *5C851DEFD807AB766CC6D256DA79DC8420A1D58F JOYCE-MAIN
889,537,559 *5C890D49C1B6F2C90EAF63B82E7C0C4B30CB5A34 FANYARAN
889,537,560 *5C89F540920D81264315CE052AEE99AEBE3834CE Fashion-:59-(a)
889,537,561 *5C84A6BB091E1CE28AC621E728AE9627FE312C9E [email protected]
889,537,562 *5C88024441F76CCA03042854A6BEE960ABD03E42 JULIUSDINNOCENZO
889,537,563 *5C85EF40846EFE8CD86D2E1D5B0DE8D9F715C362 JULIUSSAEFONG
889,537,564 *5C83309D3FDCE6E6D07B774466F35B501652D5F4 FELIPE.DERKAS
889,537,565 *5C8E27E77948F2416B2FEFB9590B1D041C23678F [email protected]1NS
889,537,566 *5C8ABD033272B41FC58C972C7424C5B7E81B7844 fertilizer crusher
889,537,567 *5C8B4F99755988A6CE473070242D3FC48AFD8144 kaanapair
889,537,568 *5C850398B81F0DF4BC151767618AB03675912080 [email protected]
889,537,569 *5C823B1D5C1D5DDF418AA49700654B85EE211CE6 karaat7
889,537,570 *5C82DCF11CF0A925E84682D13A61EB04480FE812 Karma.Monster
889,537,571 *5C8CCD7B682B8AED036A1191EB6CE078CCF1B78A KATELYN-TIGNER
889,537,572 *5C80153F55E88E0077344F5D6D6486F34705715F flush123
889,537,573 *5C8F9E690C42D427A721CF3A74C037C015F3C680 folkradio
889,537,574 *5C87941054AE0E980E6CC34466D28BAEFD88BFFA FOORPKCIP1
889,537,575 *5C83CC05B51EDE6A424B6E51740FD0AD1503B14D FORGERIES
889,537,576 *5C8FF29832031261D25CE11C97782EF5B2059366 kennytisdale
889,537,577 *5C83727A83400090823C60E1E3D696E041B54C76 FRANCIBROWN
889,537,578 *5C8A90A619476BBFBF8E34C1F8ED40B0F3A500C7 FRANCISCOALGE
889,537,579 *5C810005CBDFC6C7EDFBB4E003EA83D177535D38 FRANCIS.HAROLD
889,537,580 *5C81A64754A963FA0580F1441502C4BE9786A323 KGWI
889,537,581 *5C835484AEAEE1AE1D9F234ABCF0ED974DB8A6E6 fredericriesgraf
889,537,582 *5C8FD86124C3C404EFF970F1CF4CD6BA8C1E90A9 KIMELISON
889,537,583 *5C81F0F6114C6F1B400197FD10B2FCC3EBEF6893 kirkkessenich
889,537,584 *5C8822C503A02760E88A875D54675BF3723E4866 FRMSTLLNG2
889,537,585 *5C81FBA8299059885352DB2486D2FF4A3F5DC52E KITIMAI7
889,537,586 *5C85AD956D9349C621FC62E06552AC0E516D9447 [email protected]
889,537,587 *5C82D1F6FF7B89C1578CE38A4E8864C983248C88 frühlingswald
889,537,588 *5C8585EE3504739FE424231925AA43438A517F52 klinkline
889,537,589 *5C81CD153B671FA496727B67F0BC1C948AD247CB KLOFANO
889,537,590 *5C81F9E6E12EDB4AF4058E721791F5283D99DAD0 KLOSARIM
889,537,591 *5C88EB0FC09657C96CF28D021145A40BBF1F0309 furcates
889,537,592 *5C8DA59D72C761F160BCA720CB91A41BEC466EB5 [email protected]
889,537,593 *5C8B7EC67BB616A8E352D9EC73CD87639A20A2AA [email protected]
889,537,594 *5C8BF69F8A8E4046DD8905C228B49B54C7224981 G3BT
889,537,595 *5C8153320989AD2306A71A4CB43C87FA45EBB2F4 gailpheonix
889,537,596 *5C89F6BE7A8DDCF7937F30930B0ABCE65F099828 KREHCTELF
889,537,597 *5C879D0968554FF23A6A2BD92FC2A65F3C72EFE3 GARY GIARRUSSO
889,537,598 *5C8FAA3ABF37F7223954B07226659636B2F95424 kurz.vorm.kollaps
889,537,599 *5C81D7A7F8093966CB853417B52C6B2FECA48ADB kw.o
889,537,600 *5C81A3AF527A68118FCF07473E6CF3FA1DDFC089 l0g-perch
889,537,601 *5C8FCC74F2501A3D5E87A2DBD58BB55CD4967767 LACHINALEONCIAAEEROLACORRENTINADATRAJO
889,537,602 *5C89E73A71E3F57FEB78E9CDE840FC406A5381FE [email protected]
889,537,603 *5C88E6CC3CD1A5031B686737F94E47ABDDC795BD GERJEB
889,537,604 *5C8EFF64A8CD8DCAB6394BAB8ACFEF9D2905A373 GERRY.AGLIAM
889,537,605 *5C88E4AF2BEBE4F821DEC9BDF2E084D1B4CC46BD LAQU1SHA
889,537,606 *5C860649486EF1C6142CEEFDD17D856ACAA8242C Geveterden
889,537,607 *5C85CC91464C7018CCBD1FE61588CD086E9E6D61 lauridsen7
889,537,608 *5C86D1D850F1D995F0E13573ECFEEE3D6D3A9F84 GINA653
889,537,609 *5C8854CC6491B8B224C3639655C9571DF91E3646 GINOPIQUETTE
889,537,610 *5C82B1E631DA3B5FDF746C0D4F2AEE78C760B855 lcxc9uidpimo
889,537,611 *5C823FA598F8CB257DC47C90EDD2DF0E0FC4FD4F glennfahl
889,537,612 *5C80F947BFC2FD2CAA60B73740C5A28FD486D67D LEISUREIN-1-0
889,537,613 *5C820B90BA121FC5D1C48141C4C89610AE895C36 LEKSHELERDEN
889,537,614 *5C8EB8AF520BE22F27F8832E3A22EEB82A4FA399 gmtcysted
889,537,615 *5C8BAD9693B8FFB8AD09475CCC8F0D096CEC15A7 GODLOZER4
889,537,616 *5C871418BCB1F3AA01F709D93DF579EE8AC78F88 -L FLAG) TO GET USEFUL INFORMATION ON LOGGED-IN USERS.
889,537,617 *5C8A408BE906B88C061CE3A345CB2BB13908F3C5 GPAVASKAR
889,537,618 *5C81BE22713362554F70D0CA6BE4842A83944AD7 GPNIUKH9
889,537,619 *5C8077BD086FF1537A42CB81873572C9E8649DE8 [email protected]
889,537,620 *5C83F93A40960496247C391C6CDAEAB801BBE5F7 <li>howtoopenpipes
889,537,621 *5C820AD6155530E86FFFBCE5B238E95C9D6B94C6 GREGORY.WAIR
889,537,622 *5C830EB34DD9260E6E3222A60A0437EACD563633 grootzegelbewaarders!
889,537,623 *5C81373625855CE64B074CF649DD592187DA24EC liutome[email protected]
889,537,624 *5C86AE7A6654694BAFA4445FEE1DF33F4661C630 [email protected]
889,537,625 *5C823A8AA14525DD5C9C2936B8784A46DA5F6027 [email protected]
889,537,626 *5C847CEBBD2B4360DEA9677F905BD23CC3A7C511 LORENBONAVENTURA
889,537,627 *5C863A944E43ED7E4807E3719DB6FC57B3814CE4 GZFTXQL5LDFE
889,537,628 *5C8ECE7E6B5337408D00C3E36C68FA77F9B5CE40 löschendenadmin
889,537,629 *5C80A574B1DD18883D7FED94072452DFF505FE78 H4CKL3S
889,537,630 *5C8CDD167D4B6C9F8551CD3A40B34D09FB84120D haloking2
889,537,631 *5C8276CEE0B246CBE8804B37323220F5A7651069 LUFTHGIS
889,537,632 *5C8C86EAE56B5743263245E32D5016B4E2F65D07 [email protected]
889,537,633 *5C82BC34191621C6A8A30E251DB4FC830B712CEA LUIGI.YOUTSEY
889,537,634 *5C886EB7BD7EE8D818D20B4B5A2A725C6E54CD55 HANK.CONRADI
889,537,635 *5C8B6C83F72E20CC9E4887422C04F48344C76C66 LUKBROOK
889,537,636 *5C8E33C6F0E4AA8A587CEA86FFFCD0FD5F0FF413 LVEJMKD
889,537,637 *5C8B15DEC8C3F26E1E39EFBF5D6B9864EA2DF8F9 HARRISONSAMMARCO
889,537,638 *5C82E9778102E568CAAB1A5F6D5352EC51A0C0FA LYMAN.MAUSER
889,537,639 *5C8472C35E0935502308B75E966E1220F8347F29 HARSHKUMARGUPTA
889,537,640 *5C8A772591D797A84E5F91229A492263EB1A7BA1 HAWKSUCCESS
889,537,641 *5C861FEAD653AE32257E2799A651A58807CE0C8C mackgwn9
889,537,642 *5C8B0BD2AF749FDA3B442B70DD529E9CAD7CF227 HEATHER.MORESI
889,537,643 *5C8073BD6F39A909C394E1800198B75D07C5E3EC HEELPIEC9
889,537,644 *5C87A94C00D71C29568A760C292F6B4923205490 [email protected]
889,537,645 *5C8EED5973A5FCF8A8B768349FFC0C7F91ED6430 [email protected]
889,537,646 *5C869E594A658C4F2A97DAA97F3863358B02F457 hengiven8
889,537,647 *5C80C168DA604691C9A17020F6394632BEE22B3F malikdecapua
889,537,648 *5C8D4EE208F5E9178F261D88A4C5C11E82A7B833 HERBERTBLOIS
889,537,649 *5C8CC6CC1B7455013C0FCC55095D7147D4024DA6 herbertu9
889,537,650 *5C83D34770BA66B01C47F910E0AC3C15DB774406 HERPZAAGGING
889,537,651 *5C87D0086A74DC598BA28003112EA97ED1BBCD08 HERSHELDOUIN
889,537,652 *5C8E0C9FD6489B20966DB3860E24B525A6FE4264 heshhataam
889,537,653 *5C81F5291E9719FAED1F87EC1F4E20A656B00CE8 HIROSHITAKUBO
889,537,654 *5C87ABAB55A5C3AA08C31B2BB99CDCDF01EA6268 MARKUSMCNELLIE
889,537,655 *5C87F403EFA12E7CCD0DCCB842AA9E8CF9BEBE06 markwinge
889,537,656 *5C804D579623F3CB0C28825395B5C6404A2D7206 martykubera
889,537,657 *5C8DC4BEAAA80D182C92E34A8DA0511AFD05B081 MARY-ADEGOKE
889,537,658 *5C8EAC8DD3062974B113F2F58FBD60125F245E36 HOMERSAGENDORF
889,537,659 *5C8FF58B780347B5F565E243F0D40AFE844B676B HORACEJASPERS
889,537,660 *5C838A7508B000F1C8E3A949DF2DCCD6DA210C48 MATT-QUADERER
889,537,661 *5C82DCA417A3A310D6E45CEC025A3C067BE7BB1D MAX.DAINS
889,537,662 *5C89BD06B56046B6C6213E784BF3DBEC09264828 HOUWUJING
889,537,663 *5C8A6F5E54593A5381C7BB97FEAF7E448345C263 hoy-cumplen-cien-anos-natalicio-alejando-villanueva-idolo-aliancista
889,537,664 *5C8A8E475913158127594B9962AB29506FFCD44E MCALONIS1
889,537,665 *5C809642209A5D5618E757E4BBFC13706142694D M C ESCHER (DEMO 1971)
889,537,666 *5C8FB62B08DE8DABE1160512D0F84FAE34220DD5 HS20090116SI1KA013EB
889,537,667 *5C88E22900BDD0C3BA75F2860C3C1F51E4EF6C05 ME>)
889,537,668 *5C8F5C2427A01F8F4AF3FD05E17F468E53D6E365 ME+AZ0AN$
889,537,669 *5C87BC239F24B1751F752A4A0F5773CC3E86B6E4 metodie9
889,537,670 *5C8137C7AD9084282D58F0CB5D326BA37C02E318 HVCHGEEHRT
889,537,671 *5C84D2D9495B249BE27107717E64F52C80613DF2 [email protected]
889,537,672 *5C81CF14EE76E3461B51E2E5016A7244F91C35A5 [email protected]
889,537,673 *5C8B93B70044CD193DFCFE190AE4252D7D86D00C H}YM
889,537,674 *5C860C4358E2536A736FCB974E3EE4136D2F5AC3 hymn.#101
889,537,675 *5C8A059EE26F26AF13F1EB3A722D1A8E3F155A5C HYPERDIMENSIONAL
889,537,676 *5C856C8A8E5AC9C1BB454B25A318246B6F42F987 MICHELCHICO
889,537,677 *5C81832C525C6AE94156628522191964C428ABD1 IAMNISSE9
889,537,678 *5C80F7A3D091547E72C392A8F231A4F9E00A1ADF ICRÂSINDAN
889,537,679 *5C8DFC91BAD9AEA1843619972CF2FD168B4BAEB0 mind, body & soul (4x4 mix)
889,537,680 *5C8575307356295646C8385F52DD42BB5C6BC2B2 IHUSAN
889,537,681 *5C8BB7E49E7B3F608BE916526B741F3DAE716854 IIYH4U0
889,537,682 *5C8951834FB5B28FDA5EBE1231C161A5A49FFC73 II」只賣出了15萬套,世嘉並未能以此遊戲扭轉DREAMCAST主機的劣勢。
889,537,683 *5C8692B8326FA4FE544B80895FD9A7FE8D54E514 IKISIKAN7
889,537,684 *5C8358D111A5858B7303A2C796504F6E709E87E2 IKSLAKNA3
889,537,685 *5C84164C75214B45D976EA7250F9B1BDEB24A379 [email protected]
889,537,686 *5C8DC11C4D75F2E7B55F63B10024D5E268011256 MONIKAKAMINSKA
889,537,687 *5C8983F292947CA335459561BDE86E81CF326C49 monofwnika
889,537,688 *5C80927EC41CE1252291A0F550E7BA0966E31F2B morrissoltys
889,537,689 *5C8C6F4E4210DA8083C820590BEA94F2F9ADB589 iluvzoomer02
889,537,690 *5C87479AFA4826C7F75700DDA5F4CA44CB01D1D4 m+uh
889,537,691 *5C8B04019029D0598BFBF17915C71A2D303C6C55 [email protected]
889,537,692 *5C8B574E4486F71FDCAB1585829D6113A19F43AB insluit
889,537,693 *5C81D2AA48DE2BE7BC27410E8D319DEA15BC71E8 inthiscomputer,right.soi'mlooking
889,537,694 *5C847860B6CD050E87FE30E684EF6CABB1ABDF75 IREJIRAK
889,537,695 *5C8D4077D6C8518DF5E20561EC7BAF7EC8F36C4E IRVING.COURTNAGE
889,537,696 *5C83F70DF9D69B15D763C6AC12517A5A627D7570 ISISLLC
889,537,697 *5C80EBF6BD64BCA5F99F3AB9E4E2AEE2F5CD5ADB isn't he? isn't he a sullen b
889,537,698 *5C8B18F3D798774B765E6FA23161C8EDE8DBEF6A IS.THIS.REAL?.SAMPLER
889,537,699 *5C8A52CE3347C0A242ECCFA9FA5693DA1B67B180 IYZN
889,537,700 *5C8061CC8E903B2BE912A8C5C01E1DF3A936D3FA [email protected]
889,537,701 *5C82A18134F3C71146664AAA34D6DBA73D5A5C9A JACK.CRAIGMILES
889,537,702 *5C83713704A780FD0191BC3C172D8CA2BDE8E4FF JACKIE-GARNIER
889,537,703 *5C864BE3716B525B9BB908D04A40E1BC066D0FCF NEWMOONDOG123
889,537,704 *5C8B6DCB5A61E1AF902AA3398661C246437AF880 «nic»
889,537,705 *5C8C4F9208CFFB7001643B3782F9E83E87269021 JAMES.JUDE.PITOGO
889,537,706 *5C876FB4A62241831DE76783E2CB42B589678C0B [email protected]
889,537,707 *5C820E1C3AA85ACC562998DD704619ADF5814FC0 nicolegamelin
889,537,708 *5C86927197960C2BBC6EBA7D4A9DDFB7B231BD24 NILLA-PIZZI-E-LUCIANO-BENEVENE
889,537,709 *5C881EE9F193ADA67D23C45334C645AC5C781F9A JARONAZO
889,537,710 *5C8A35F