List database


# MySQL hash MySQL password
810,150,001 *54164CB6E0AF6B10A57C8960B84D706939327A40 ALMBRM8006
810,150,002 *541C17311DADF57110CDF6B323E254F66B5354A7 AL&mE
810,150,003 *541DB56E31F57130F1C50CB29A3FB602E8515423 álmélkodtam
810,150,004 *5418CF79613ADC40B77A2F1D4451FBC2E9563900 almenna
810,150,005 *541F019CEB9E7729E8DEC7919DB08D1F961065BA Almerares2
810,150,006 *541EABB4CE327571F0A5DB4A73354CCAF7EBA5C2 AlM_F
810,150,007 *5411A1C33C883C6380D4E2936A78B18D13D71B13 ALmHc
810,150,008 *5411808D5B7497AE6BE4CAF71140DBC210698AB7 AlmHU
810,150,009 *541B62E3D145CFB115455C9D1A114326DA5A5699 Almidonando
810,150,010 *5413773E96467622C354DC3017DF331D4EE81623 Almidones7
810,150,011 *5415FD7D44681231818CB6305487C67D83303D0A Almiforas9
810,150,012 *541B69E38A8568AF9D435CF240D07AF5B89C1CE0 Almiquen
810,150,013 *54109595F2AED2428622261C1448D0DBD10F3AC2 AlMn/
810,150,014 *5412109E2B152C11DFCA3D6D1DD0695975C573EE álmodjék
810,150,015 *54115988F953898E7C2086397CA7A4407FF207B2 Almofar5
810,150,016 *541E381B492CAAF066393DE73A7D9906BF948E2F almoost4
810,150,017 *5418EE3F58A22900F713FB1C031A2ED7F61CAA33 almorzaded
810,150,018 *541AC8DEDB4964A7477660BF1A814BC0C5CF7BDF „Almosmühle“
810,150,019 *541899BA6AAD9DE750ECDF6ACE9EB8F99994101B almost-fist
810,150,020 *541690F9501C63E813311D5A3FD7965A397B7F1D almost-rival
810,150,021 *54112733C8185A6C9DCBCD39DCA9E26CA1263410 almostsomething
810,150,022 *541DD8DBBA4E15E03BC0992A2037A9F51216BA91 Almsfolk8
810,150,023 *541FC07C45D2A9C7D4245BF930488FC7295FAAEE Almstrauchheide
810,150,024 *5410BBBCCB946EE30F35A99B8174861FDC9C1080 almsw0man
810,150,025 *5411D1393FCE84EFF5F6B61B430F9EBB05C47D8C almyraatoll1234
810,150,026 *541219BBE827791A7946C1CC8AF07ABEAC29E99C A:lMZ
810,150,027 *5418037840DF22EACA227E8F01108B24ACE545ED almz966310
810,150,028 *541C13A4B10FD08D196911D378E3DFAB6CEC53AA A$ln"
810,150,029 *541FAA26D23BF3B0A7D46C8011FF791807ADD00F Al$n1
810,150,030 *541C91924D367075E917E0BB1A77724A902C8FF5 Al#n6
810,150,031 *541B2BB51BA8D2374EBDC4D78B2CE9271112F798 aln8bak
810,150,032 *541E17C2E7FFABAE0BAC25E1197ACF8B1698F10E ALN9I
810,150,033 *541D88A996A09C02BF2E92AFBE6ABD0195CB493B al-najimshad
810,150,034 *541FC4FE9AFB4875F73E6BCC09FC1414EF1D2629 ALnd3
810,150,035 *5417B7EF883926CE3EB87DEDE1C11DD00C0530F9 Alnetter5
810,150,036 *5419A6A30228526B5108BFE1FE49EE9CDA83F9A3 AlnGH
810,150,037 *541033DD091E88B952718E3B9CB7281707073BF8 ALNh7
810,150,038 *5417A34851E6E5BE1EF361591A3037E996458AFD AlnLa
810,150,039 *5413222AFBD14760012C51315229DCACDBAEF963 A-Lnm
810,150,040 *5410371E525E623A13A046E0961FD82CE6408E35 Alnma
810,150,041 *54150F703494C8BBC869681028F6A89C4032245B Al_NN
810,150,042 *541B46E39D0D67000D76A86B170365882A3AFDB6 AL-NOM
810,150,043 *541ED1C1710D5A077250C45758AAB37276360F98 ALnQl
810,150,044 *5410833A1BA4C1EB6B6B79244239450DF74C1B1F Al:Nr
810,150,045 *54122D0E5CB42E1ACECDA99F0AA5E7BDA56C6293 Alnrc
810,150,046 *541F617E30984B17F9CFF556DCB27503C18EA902 AL/nu
810,150,047 *541B92BF4231FA85A4799C9E7E5F3B121A297FC9 alnv1048
810,150,048 *54194C9CA9D9A07F83E8542E07130BF06A2B30A5 A-L=O
810,150,049 *541CE4DA5D021B1DCF3C881E10128B1CDE7DD729 A#,LO
810,150,050 *54193C46F7C3BC95F8027ECFB5D1C17F4636ADD2 AL&O/
810,150,051 *541C2C23887648119F10A2802AE08879AD4342C1 AL#)O
810,150,052 *5410D917C7FB634A405AB6AC3D4D5F89F2621FB6 A_l,O
810,150,053 *541CA09BD1A6EE03D4E9457E365F0EE7EA49CEF4 AlO2:
810,150,054 *54151D409F7AFA8D3F346C531902D7D547B2F517 ALo6+
810,150,055 *54119CD64006F6C4E3E898281118630EEA9794E1 ALoC6
810,150,056 *5419ABA1F7669D9397F70B20A0B7AADF2F4FE31D alocado5
810,150,057 *5414BE89F486FE9A177D51D16A28B647EF07C2CD alocatoS
810,150,058 *541F05C8A1DA09780FEDCD170823FC75C14439C8 ALODIALISM2
810,150,059 *541F3839A3EA40F924BACC64972A049006B8CCB3 alodialS
810,150,060 *5417FAEBEA7EA0A8EFBEF655ECE4FBB6C97B27D7 ALOESOL4
810,150,061 *541F00BDA36425750725B843E24559F6AC29CED4 [email protected]
810,150,062 *54159479DEB207466CFD2CFBD90BDC8918A72963 alogy.
810,150,063 *541AF3122D09D2D05E85BE16E8546B8D1ED8A177 AlOHC
810,150,064 *54139416667BACC4167C804AEF8D2C4AC4DC4059 aloitsac
810,150,065 *541A5337A52BC9AF1EB26E2528FE47010712DE8D Alokana
810,150,066 *541014F5D8F9DE83E06264BCAF280D965E52D4D3 aloksarma
810,150,067 *541A6C1EF6A7F18BCA074E608F5B3A20DF6A047A Aloliisa5
810,150,068 *541F9B5670CC49C0E5B06F85C830E38753078952 AlOlT
810,150,069 *541D87B09D296EB3E58B05FF9E9E5377D54C5997 alomamorgan
810,150,070 *541BE2640E23F4ADC1181FB032DD10C07DBCA288 alonapr
810,150,071 *541570DE2A19A7526BFC25C68425FCBB165FC74A alonapsE
810,150,072 *541EC0B8344E6D53E4BDA7A72BC92BA1E48CA269 Alondra005
810,150,073 *541AF64BA7989A97D8C5FFC90EBA41BDFA484230 Alondra292
810,150,074 *541C1F036696A1DA9172CCAB173C5818C74B59E9 alone36
810,150,075 *541870823AC8EDB6EAAADD5624E0A3E24AEBA273 aloneandwicked
810,150,076 *541986843C83C35066F8B1821687BF2A92E252ED [email protected]
810,150,077 *541022DBF1CB797325B6481EBBDC1BFD0A2A5BCF alongintoed
810,150,078 *541308395B16CC5C8507EA267E14E0FCE418AB05 [email protected]
810,150,079 *54140B7A443459679E8DAE15F8C86463076B0D87 alongsmmurphy
810,150,080 *541E6EC4C047260EF451261CC1E107A9AED97EED alongtheedgeofastraightrazor
810,150,081 *541CA47698728800F9E948097B3A5780C84C545D alonso.brandy
810,150,082 *5416E6624E67C50A13F68372C8B39D20C5B3DEBD alonso.burgueno
810,150,083 *541CB2EC0D2071514EB1968ABAB6F3A37BD8EA74 alonso.forwood
810,150,084 *541FB07DDC0253FC83C90802085B68D92C89644F alonso.galvan
810,150,085 *5418BF074C169EC43EDED01679063A1309BDF025 alonso.gehr
810,150,086 *541E8D6475A0E6369DA77875209DA2EA78398735 alonso.heyd
810,150,087 *541386601F2FBAFE0AB33627B7ADC361DE9B93DB alonso.hodrick
810,150,088 *5416517EAEA0EC1064EC9A79DD98EDAC9B941997 alonso.isa
810,150,089 *54102E21952D71C5A184330B2B9912371BE68286 alonso.kitts
810,150,090 *54189DEB9936307D13C4D581AAC5C8BAF98BD63A alonso.leyland
810,150,091 *5411961B6A5D7174E3D63E408A5AFF154E5A346A alonso.macgillivray
810,150,092 *54149EA72F83655EF65597C98418693D98ADE8AB alonso.merida
810,150,093 *5414A05B6AB087BDED12A9B2BA14496DD4E18708 alonso negrete
810,150,094 *541D5B7A6098C5C46DE9664204CF386038F0F0E1 alonso.nelmes
810,150,095 *541C8C76DC3AB6523D8D37632582F2BC84E92DF2 alonso.ottalagano
810,150,096 *54129EF9F9E4384509F136D0D7DBA4C3396CDAEE alonso.peppler
810,150,097 *54190D1E7B2AEB07AA4C4C7B2DDE3459163D3C77 alonso.rosso
810,150,098 *541A8FC93BB2E68C3C81AD0AE6231BCFD65AF77F alonso.rynerson
810,150,099 *5413121607B2B56F29F64A73BC131C9675CDADF0 alonso.samit
810,150,100 *5416D7BDD6B16B97D9E21C1B160935E1AA4AD8B4 alonso.schoonmaker
810,150,101 *5417C22D144195A97BBFC48CA8AD9A80A7611FBB alonso.sendra
810,150,102 *5410C91CF60D3FB33C2A4D18CDA5C6A923D45426 alonso.spirer
810,150,103 *5416DA992C89FEB94D0ECC13E594A2D828947C74 alonso.stothart
810,150,104 *54134252515EDE91218A801240DD6A3EAB567527 alonso.vankilsdonk
810,150,105 *5415B3FB7642DE60FBE11575D05A5DA3BA7EF6B5 alonso.victor
810,150,106 *5413C22301D454232F31180CA6E6AF88EFA68F45 alonso.wide
810,150,107 *5413069B9159DAAFB6AB8FEB6D45FE3C4CD6AC9C alonso.zoquier
810,150,108 *54173D58269EB92BC49DC9839C4F0BEE41A6BD21 AlonW
810,150,109 *541715A5926A971B46897DD2A18A65E3715D76ED alonzels
810,150,110 *5416DE3EAFC1CEB414140971A8D9B887E8AE9826 alonzo.alexy
810,150,111 *5412E7CBC2572C6754E1AD49CCAB4CB75EE3F9E6 alonzo.arehano
810,150,112 *54123305722DD2925D5AB6B6A93E04F35662407A alonzo.bomia
810,150,113 *5410ACF70F8D0FA1E7CAA161BF23361F4661712B alonzo.chwalek
810,150,114 *5418645A134C29EF3634C3342D443F92773C135D alonzo.debaecke
810,150,115 *54184977374DD65FCC9245554DA7AB7B9737023C alonzo.flippin
810,150,116 *541EB87D5614DF139E339D7C5751F02EE479A96F alonzo.greenlaw
810,150,117 *541EF8F0901EBE498719905FE0936726EF2861D5 alonzo.hanberg
810,150,118 *541C2EB585C1D28BB7CB9384CF1C5B0ECACD8681 alonzo.hearin
810,150,119 *54154AA8E3A7AEC28F8ACF79BCCF215E3F8623FC alonzo.keuper
810,150,120 *541D97C9359611C56607D4D2632A2F8BD9D6EE53 alonzo.koulavongsa
810,150,121 *541D01A9B7B6691FB906515F793C588C637FB148 alonzo.logie
810,150,122 *5412C6D13573FE7B11F3BF1C12A232D3801FC816 alonzo.madan
810,150,123 *541B2706873D4FBE5F3AAC9B863D2C4996D948D0 alonzo.matson
810,150,124 *541A1BB3BBB66C2EBC63C627EE22B7A91EAA0A02 alonzo.ogwin
810,150,125 *5413924E687B4D4E14C4E0B6A317FFDB578C21F2 alonzo.portes
810,150,126 *541D5320D38EC6CFEA0874C6F52F3B2FFD0E5C77 alonzo.radilla
810,150,127 *541E2BE694D8FD34A4F7D7796D6D9EEA6BECABD5 alonzo.retana
810,150,128 *541C996F9C5D16B764C91F2235912B9A58ED2359 alonzo.ruhling
810,150,129 *5415A9EB1FD5485FEAEEA38496FBB5273A14A42D alonzo.takach
810,150,130 *541BC5D1452476EDE734CC525755EC7866483CD1 alonzo.terwey
810,150,131 *541D0721A640F4A3096C89E635DF3AD143988551 a look inside
810,150,132 *5413A94004F575EDEA4342763348FC43C4C8597A A"lOp
810,150,133 *541A686D4EB6B00BA5B198CFA0D35189EE11C38E alordire2
810,150,134 *541E79D8C2CD159C8577A545AE728E89B323E15E Alorokn8
810,150,135 *541F6E54E5154EBCB35BB81346D577941C8C2067 alortnev5
810,150,136 *541AE93C4BE567BA2A208F588B0A63EB4A9555DC a Lost
810,150,137 *541C9D2C397E08FCBCE51E68697B5C5350611682 alostratigraphic
810,150,138 *5417402D519BC70A597968F34FB3CBB72C07B0F3 alotting8
810,150,139 *541EFA50A5435CD8F6E6BD7F838EF3839363A30C Alouette,gentillealouette
810,150,140 *54178387EB53EA91F2205DA51A25B3557664806A aloulin.bbs
810,150,141 *5418E06BF9AF8CF9DB1EA707721681F23B3D8046 alovima
810,150,142 *5416189F51D4F876F5275529EE1769DB98DE2EA4 aloysins3
810,150,143 *541E0B43FC81DCE9318EE515F63AF35299C66CF3 aloznogr9
810,150,144 *5411B799B33C7144561D0F9B82D33D387F35143D AL(P2
810,150,145 *541F105820960A097F8A5215B599BA915454F715 [email protected]
810,150,146 *541C2D738335FC0A9CF4D51912103BB75F72164B Alpaughes6
810,150,147 *54169C8CE4E46BB4D032020C4065AE9329D07576 ALp,D
810,150,148 *5419AB96E97BF28647CC40CA8CAEF3EE5CAE10CF al.pederzani
810,150,149 *541B34EFA460979A85815C1991DDA745199E4846 Alpegloei
810,150,150 *54167F1FE095587851511EA213748EED7710F31E alpenla2
810,150,151 *541781C2F50AD8209B403E0D0627F4D4674A6580 alpens ros
810,150,152 *54186D0A2EEEEC8EB5452191816F680B0A5DD867 ALPg/
810,150,153 *54148631D1FE0B3BF7D0C85FCEF43D99C332A6BA Alpha~
810,150,154 *54137DD43099E1259AD2E5AB5540D65C0203469F alphA
810,150,155 *541FA31567341B29EECDD8E50DB314424C91D7E8 alpha1l-adrenoceptor
810,150,156 *54131D15269AB6B6959280D2D98CE3567A549F0D alphabethorse
810,150,157 *5410ED0411307FB48963F024F74F42B74665065C alphabetthailand
810,150,158 *54128486C8017D7A276A2B9D51E2DE49DE2B404F Alphafrancois
810,150,159 *541A8BBA077D873F3FED4C3981AB93863C35FA4F ALPHA-PIN
810,150,160 *5411A6A8DFA29A9A85DDBEB6F0B1E1CE3DBB50FA alphaxiii
810,150,161 *5417FA28129251D0D299D28E9CC814B43BCF8E88 alphonse.anker
810,150,162 *541A93243ED9C2DF46ADC3BC03FEF6BE3CDDF266 alphonse.aylward
810,150,163 *54100DC28135A3567BB31583209F7407747F140A alphonsecaberte
810,150,164 *541F1ABD7ABC091F64FF443C578BFBA9AAD7E58B alphonse.dheel
810,150,165 *541B713B8407F28FF5FABBEDA25A3B8FBE2F680A alphonse.diedrich
810,150,166 *541CE09B02BF6A34C39E261A0A8AA6DD06AE40D4 alphonse.dorsette
810,150,167 *541D7DEE2E0088FEFF509FE215A730A12E6708BE alphonse.erhart
810,150,168 *541686E71508124100659C959D5D85B125C861C1 alphonse.fraint
810,150,169 *541A3E156D6B254FD91447F65FE6059ECF40DAD8 alphonse.gresham
810,150,170 *5419D65D00BAB75A6654682DD8F8F1569412B1FE alphonse.hasler
810,150,171 *54146555D552F7E2F3645942B84422998935776D alphonse.hodel
810,150,172 *541E4AB3E0D8A089D2011955FEE1867A0FCC6F03 alphonse.jung
810,150,173 *541BCF8CC3F761B4DABA85200944FBC4F000EFA8 alphonse.maud
810,150,174 *541682B8789D0435139E07CA7F8800AF024EE748 alphonse.mcarthur
810,150,175 *5412B69278225A0D6DB6615DA5AFC33741F781F0 alphonse.mcminn
810,150,176 *5414AD761F955BAB7930EA4EDCDC0EB52F0BC048 alphonse.moosman
810,150,177 *54171B3E4276133FB8EB14802F8E829AC9B83CE8 alphonse.rogowicz
810,150,178 *541DE4AFAA3C08D2C0D200BB14BB08443EBF751B alphonse.stanko
810,150,179 *5418131503E5B1F5D7E255E656176B04CF373364 alphonse.subramanian
810,150,180 *5413E194F6D46D5F95397B7C50808732902CAC71 alphonse.swauger
810,150,181 *5418694B8DCCE422E92F29E526C4577869A351A4 alphonse.thornberry
810,150,182 *541E789658CFB392FDC3F4884E001ABC5668266E Alphonsie1
810,150,183 *541B32D257D7BD7084B92B7B8904052B647E6759 alphonso.acal
810,150,184 *541E3A0F53297014F7373F8DE3C6E5E2B2A406D8 alphonso.almeyda
810,150,185 *541ED493DC7C1DB0F088393585D3EB72B07499A6 alphonso.bertran
810,150,186 *54127DA1929BD1D5B02ED4D457859F20055C9B8E alphonso.biagi
810,150,187 *541085A3E6DDF8467937213D0B2B81EE161E7F4D alphonso.cann
810,150,188 *5417662605AF5B7A9A14C2ECEEB5385C2FA469F1 alphonso.cerchia
810,150,189 *541BE530C6553DC588545C7863B12AF913C6D9DA alphonso.grantland
810,150,190 *54191C925F0171F0D76F52285794FB43526244A8 alphonso.hackle
810,150,191 *541B009BFFB750D17E09543E04BAB71DB3A36578 alphonso.horesco
810,150,192 *54167EF86BD0584E4CCE2D27940FB428CE2286E3 alphonso.kalloch
810,150,193 *541D7AA807E27C5C7400432AA58D399EC95E7094 alphonso.korte
810,150,194 *541D561EEC3A36A3373BE4703CD8DD597FF5AC27 alphonso.moradel
810,150,195 *5414116715EB388FBD07E1321085E513F046491D alphonso.niksich
810,150,196 *54125183A617F063E6330B47B0ADB7E46FD7B80E alphonso.register
810,150,197 *541D373FE10DAF731219A7F2EAB143AD579C62D7 alphonso.schuchmann
810,150,198 *5410FB3CCB758FA46D961F2A1FF8ED5DB5E59BC2 alphonso.sevillano
810,150,199 *54181F4916455F494EF8A2F59957CC42958E6B79 alphonso.vandewalle
810,150,200 *54198A926B72A7917A190967967235E1C0E0DA00 alphonso.wiegel
810,150,201 *5417F3BF4699AADFA76A611894D6DF61D81A87C5 alphonso.zaic
810,150,202 *5410D964CA518D4743F23A632F0F8A7443625945 alphonsus77
810,150,203 *541FF00F012F5A63A6614A200E6338CA89F7C8C1 Alphornecho
810,150,204 *541908316745DCDC55C8019212A5B7F3AF407C7B ALPHOSSOHPLA
810,150,205 *5415BF1093AC6E42554D7505FB87B5521752F01E alpiinses
810,150,206 *541BD6D834324F04B681CBE273DA3443FB09393D al.pilat
810,150,207 *541D745411F0FA5F6D966134D0864691519DE7C8 Alpinebarry
810,150,208 *541ACFA23012A6BF28B34FF726A5299C5978F41B ALPINESPOOKY
810,150,209 *541D092FD775356F58E475C55DA09A0E5D889B51 al.pisegna
810,150,210 *541651C429B73797AEFC52A0208B09DE1B07BBFE alpodohrs
810,150,211 *5419A7FA1E9EDA18C6C21AC984646DB36D699C69 AlpoR
810,150,212 *5413099A3A5557D34AD00B7B4FFCE9FA19EF8E95 alppiruusujen
810,150,213 *5413316240A7C9D77BEDD989A77DBA4D66868476 alp tan
810,150,214 *541C4BF35B363254FD45F750EE89D6AF52E02539 AlPts
810,150,215 *5411D45CC07599A9159271AAF80E3AFBCD0C2D42 alpztis5
810,150,216 *541568526D1989FD3D6633AED2AF8C0293F9682B A):LQ
810,150,217 *541B634B7A362CB1B64D567D93709869E49AF53E ALq==
810,150,218 *541E6D76166E0C585587FF0CEFE1AA8AD80245E8 Alq=?
810,150,219 *541CEEEA5C489F6C754D9A61FBE58F0B2A01C574 ALQ68
810,150,220 *5415410F56F901518F02B916A9C2968F30795587 al-qadimcom
810,150,221 *541941A51A479996E7B772586899F1E9031D74C4 alq-cadafais
810,150,222 *5412FD4F4C7A31950F8E679E0BCCB5FB92997238 A;lQi
810,150,223 *541E8ADD53896C530E8FA7BF5ADBC8E256012784 AL-QIYADAH
810,150,224 *5412604C0199098ECFD0031791A3CC1DFB6BE6B3 ALQmH
810,150,225 *5416D2EF26974B24D7B379FBEB7B7EFC658A867D ALqqC
810,150,226 *54172B5FBA506A426EB351752979AE379AEF95AA ALQUILADORA
810,150,227 *541990027761C3ADD9A7CC3E2F458854526FF68E Alquilndolos
810,150,228 *541A2C7867D1017899ABE4E02FB0693CA9B065CC A!LR;
810,150,229 *5412A1355CAA3BEFAF14FEC098823E6B64FBED17 A"Lr(
810,150,230 *5411501A2DD75C626304895428B2A8F05D019DCD AL/r"
810,150,231 *54191AD466AF198C213201DD57A81107B3C97C4A [email protected]
810,150,232 *541C9D2620EA9FB3BBCC465B3D4C16E66AFB8D9F ALR+3
810,150,233 *541E0D1582D2A62591AAD30A5D710FA412AF60CB AL(r3
810,150,234 *541F13FDFE16DC70AFCE6C55807D3F155A2A8F2D ALRAHC9
810,150,235 *5410D167083EC3363FA47D96EA9E139644A87654 AlR&C
810,150,236 *541B4B06A87BBE634225FC6464AC4B753E2C696C alreadies8
810,150,237 *541166B778733F3DFAB1198B6C587C51187A0F0F Alrebugging
810,150,238 *541DF87627723C9F6192B87EE024E0B19E6E4859 AlRF2
810,150,239 *54122ACAA4A4AE338733791D8AFBD8BFCFD0C627 al-rhaimi
810,150,240 *5417A86A1DA89AB741F6C90B3C2E33005D3A8D02 Alrhn
810,150,241 *5411C2856225622A60A487B7737DC25F9C9C2991 alright(katandzatoxremix)
810,150,242 *5419CA6BF04E47F6EE69E2E059A4283F90EEE426 ALRQAPA
810,150,243 *541A3634C465A4301433E9290970311250A3D4C1 AL?RR
810,150,244 *5418271A8884FDD1B9CCD2A1CAB7072184C9C39A AlR&T
810,150,245 *5418957575DCD6888142171CAE9056E22D4BEC5C Alr_V
810,150,246 *5414FE5BF855B7119324E909439BA362E69A0B3B ALrYj
810,150,247 *541B53CAC2901480FAB895735F4447E826821D3F alrymple4
810,150,248 *541EA440E186B4B9317283245D66277F6B5FD21A AL/S$
810,150,249 *54110D165C2AE9F6482DD6DE9914EFEE2CA033EF Als3T
810,150,250 *54143ADCD335E777E1402AE4277B6DCE7DDD33BB als4949
810,150,251 *541CA821645C5A14E272CF6BD0C38C25A0565C7F al-sabani
810,150,252 *541AF3422F07DCE57CCE903435508DB77115592A alsacetech
810,150,253 *541B57CDD6E81CE33E9BC77F7291C1C0A3AA1FC5 Alsanibi0
810,150,254 *54147AE03A517EB79C17486BD214D3183C84695A Alsbeker0
810,150,255 *54163B190F9D91399A21F412717F046FB8DABADC alscalderive
810,150,256 *5414984CCC4302A68E07726DDA314BFE7BD18AF3 al schildwachter
810,150,257 *541B461A962642F6F74C5F0DF05FDEE6E731FDC3 alschschreibung
810,150,258 *541AFEA69F89B304C2D67E98BE347FCB51633AD7 als die stille kam
810,150,259 *541800BFC834A47CC9171FD00A3349A2D726D674 ALSEc
810,150,260 *541396843A726AFBAE3EBC35811A7CDA1A2EB658 Alsecnev1
810,150,261 *541EC7E44BF10C298630722E96AAA8EE9B1DAD60 Alsfonso5
810,150,262 *541DDC0725847F29D3E3FDD882151FCB7ECEED3B Alsħ
810,150,263 *541A881435AD7DB5D8F03C45DC603C073081C097 al-shamtalkbosratalk
810,150,264 *5413D24624F3D97B3840D9030FEC43C99844A009 alsikcor8
810,150,265 *5415C0AA7E827173E4CC096BC278726EBA6F5057 alsimmon9
810,150,266 *54169C852F614CCFD58E6883A0CBD58E260F7D23 alskaqqq
810,150,267 *5416E7B41D9BC728DF0B5904EFDE1359056B7075 Alsmaar steeds zo
810,150,268 *541BEE569647212C4BE58CC4362A282FE99CBC31 ALs)O
810,150,269 *541B9BC45BCB99A67B1AB86D2580FFBFFE60D081 alsretfe8
810,150,270 *541497AF8A67C51A03583615CB40B4E38CC27153 ALS:S
810,150,271 *541A8D6C2577B16D4F1408ECED43E286DF2182CA al.stellings
810,150,272 *541046A900B63C4C852F6896F5ACC4C97406C479 alsterfleete
810,150,273 *54141960BB6DD834049234103C3C10B99D2ADEDA A%lSU
810,150,274 *541C42890133F4D5C1E518AFAD0A5469F5188C4F al-suffah
810,150,275 *5418E5A4600A5D680655A7E21BA50432723404DA ALSUFFICIENT
810,150,276 *5416BC4C49B2A2245845DFF8451D5DAD7A558E91 ALsUL
810,150,277 *54188DCE285CF9B244E8C39AF5CA1F3CA25A4F0A Alsysick0
810,150,278 *541BA5FA3D5DD305E950FB4564AAF1702F7CE32F AL+&T
810,150,279 *5419B9224472E8D4E0534273C4DB24CA07B5BCB6 [Alt]
810,150,280 *541FD0DB0AB48EBAE5B61AA59C327A0B261A7B4B alt0ption
810,150,281 *541DE23379B5A821F2D83D2A46B5E5B006789F5E ALT6Q
810,150,282 *541292333563874C008C0F40E76DB8949D6A7EFB ALT9O
810,150,283 *541AA46ACB4DC281B62F450F2E289AA312627DAC Altacare7
810,150,284 *54140596F664910A7E496B30807DF5DC7DB16C2B altaikiz4
810,150,285 *541E790D540EC09A5D8CBED89DE75888FC30AF37 altair32history
810,150,286 *541E4231C3EA31BF668A8416C267C9EEA1291C12 [email protected]
810,150,287 *5415B23A6F318BED27AE5B915EB776B5120E7136 Altamonte1
810,150,288 *5413226CECE99633ED7C7BB6A1CD03A64CCCC5C4 Altare!
810,150,289 *5418A1701DB0D80CC2AFD591ABF7C7522E7A25FD Altari0
810,150,290 *541C3632D22527B2A1B04F03EDBF2ED5C5B825FD ALTASOL_15
810,150,291 *541FB8D63D8E8C593F126EF5D84E6ACB2E21A71C ALTbe
810,150,292 *541021838E434CF4B33CAA200E221E297E7B6060 altbewah1
810,150,293 *541369C6E26C213ADACBEF25124B39C79116CC1A Altd
810,150,294 *541C081A6BEBDE303FC7785D9E14BF3198529C1B Altdecpping
810,150,295 *54163B84DF33F034021630BD535E4CDCB1FC4026 Altea;零售網絡覆蓋各大城市之高端購物中心及商場。
810,150,296 *54111B85D0C1FEDEF944DC078C0E9AA1FD4E592F al.teeples
810,150,297 *5419E940B6BF91C5012477874699E4C67238783A Altelefon
810,150,298 *541DAEB4F973B1556380160DF148DF6CCE4290FD altenators
810,150,299 *54180A59E3FD7A9C55CD12178AC263DE353246EA Altendens
810,150,300 *54129C52B9DA4F76A0B01BB2A16BB2C7C6AFD71E altensetlisch
810,150,301 *541D4100A1BD29D01CFABE694F5534711744C5AA alt="EON
810,150,302 *541CBC65F6D95B064C22A24C18E28D4AA1A8C8B6 ALTER1988
810,150,303 *5414B465F6282EBBDB77AAFB9342695B73CAF6A4 ALTERABLY
810,150,304 *541AEB7443773AF1A3297F30C275EB98CA280334 Alteraits9
810,150,305 *5412E186D7A350F971C63D04423C4E80A6910F5B Alterbrunsel
810,150,306 *541C11DF64150E1CA0F3029C365D98530A8185D7 Alterco9
810,150,307 *54143C86C96B9A0C725531C10AF2E60A8624E719 [email protected]
810,150,308 *541D9F7B9C398A905C454FD3DC00B23CC564BB66 alterego:0666
810,150,309 *541B8CB9022593421E775E783A0D4F43AA9DE179 Alternatíva
810,150,310 *5417EA6BFD1CBD5948BD98357E4DDD82B5F7CA9D alternatedwellings
810,150,311 *54187BBAF35D30C16E950BBDF9BD5295FEE467D9 Alternativ1
810,150,312 *541E38FDACCEEC8CE3010D806BB6DCDFB354F052 alternativnej
810,150,313 *541E061935AC17DB4D15EBD33BCC0875E999B7FC [email protected]
810,150,314 *541C2ADF4D544A7E6F962BE7A7625A88F42799F0 Alterthumßvereine
810,150,315 *541BFC59A4CA024F992BF3309FB8E3BF8D953DE3 ALTESC
810,150,316 *541AC69B74E62EBD0A54E2EF79BE019EF5A9EAB1 altgenstalkima
810,150,317 *541DFF3150FAB0D77BE915895DDAE51790767AC7 alth486
810,150,318 *54160EBD43D61B77A9A28B93DA2CBAB419F1043E Altha?
810,150,319 *5415E2969A367C1760417AEA29231569906C5CE4 Altheodis
810,150,320 *541BAC28529295D4F02F27A1FE5AB09466E9F985 althetim
810,150,321 *5412DC7E176ECA5E5C88EB59A27012A1061CFE38 ALTHIMA
810,150,322 *541BE68F25813F7124A3849CEA8523E6BCDAAED3 Altialos
810,150,323 *541B7683DCC735ED26CD4F5734CC08EFBEC35D2A ALTICO
810,150,324 *541E6418876DE883410D1E62F7F29EC432688CF7 [email protected]
810,150,325 *5418CB687072180ACF044DCB81F9261214F2FDB9 Altinnen4
810,150,326 *54178815E0793F663F7B42CEE23CB6198BA6C77A Altkreut
810,150,327 *5419BEA4454FF396A65EEAFBD8B9D0C298E3E9F7 ALT+L
810,150,328 *541F38431C4AED2FB3AD727B3B61D029268DA7CC ALtMA
810,150,329 *541C52E77269F4E7506B1084E36A1B792793E91D alt="Mexicans
810,150,330 *541AD73B87A623711E4CF1653498AD86887BFA4B Altnames8
810,150,331 *54149F3824447F6F8571176E50077EB925334B2C Alto Above
810,150,332 *5414CA63E491A98D2AA4C4335D396C5CB757225F alton.apostol
810,150,333 *54123BCEF2552CFF607C8F4C3B81DCB15AF5A523 alton.brockhaus
810,150,334 *5415ED19EBDB8EE6CAB1FCCE56569FF6E9D5C73B alton.burwood
810,150,335 *54160E9BA4CEA0E3C16F08D029C9019419C13EB7 alton.collet
810,150,336 *541E10471CBFDDD23D76FA42FF6899A0DA3E58AF alton.demerchant
810,150,337 *5414FE4858D84F1F12B2D7036F584AAF8EA1B2F8 alton.dobrosky
810,150,338 *5412EF2DD7E125F527F537C3C4CD0A87894A9BAB alton.earnshaw
810,150,339 *541C3825BC4EB6FD693D400E7A3AC1B2964C746B alton.fleckles
810,150,340 *541FD71F79B36727332958C4B613F2978DFB7DFA alton.fulenwider
810,150,341 *54109FD81E63261F990247AE1E25DC745A1157A8 alton.gronlund
810,150,342 *5419317057B07BC620A78482FD181534FF7B33FD alton.gwinner
810,150,343 *54159F695BEF4A8AEDD7BBA5CB9601FFDB50EE62 alton.hardisty
810,150,344 *5417C8763786B975E715E6061C0B8C97622D5D98 alton.kvaternik
810,150,345 *5411CE5B3147F8953920A1349960FBF73AE1BFB6 alton.lasenby
810,150,346 *541F7BEC8D5E0D025626D19B288DAF26EF5F04AF alton.leavitt
810,150,347 *541DAF123BEA0DDD7A2470DFDEE2D41E2C616AF7 alton.magda
810,150,348 *5414BB44CA3246BB6E6F339B7AB5F0A60616B64D alton.mardirosian
810,150,349 *5411F81684C342A68C5AF6A6191BE0CE1E44E633 altonmueller77
810,150,350 *541A91681B845FE4441E4E479F27A9F16A88AC4C alton.ordones
810,150,351 *541E180325E2769CF784EA95B653881D390E0000 alton.picerno
810,150,352 *541044FC611262595C9AE5AA5EE50A0868E95DC4 alton.roope
810,150,353 *54109324173DE2EA617B4BF8363C5DC74C720A97 alton.strauss
810,150,354 *541BF788B6520FE2EB67CF04D34840DB4A311AD3 alton.wirtz
810,150,355 *5413A2E7AA96CC8A977A876EC71613462BF46ED9 alton.zacherl
810,150,356 *5411A8AB15DC503725437EC1C0CED8144B52FAA1 ALTOPASCIO-STEMMA
810,150,357 *541FA8C0E34F4108F4E126466BFEA8F9D8E128A9 alt="Opinions
810,150,358 *541B2376B46B46A446A159D3890AC97969A8AF52 al.torngren
810,150,359 *541B205925577E9A63FC23D05C0523C6CC6CC5EF Altoukhi1
810,150,360 *541EF2D12541A9E3E637C3506B65F4C208512909 altovaara
810,150,361 *541BF618E6BEBBAF076938D75825312FFAC22FD9 Altowers5
810,150,362 *541964C72654E066C845A6E4217BFC7519BE8B4A Altpach
810,150,363 *54119BD21EE85425AD78AD3C51BA79095866C458 ALtpT
810,150,364 *5414CD29840A057BFFD0519E5B4D654F71320B3E Altra2
810,150,365 *541935A58E22567E0762528CE4834B53C1910C86 al.trim
810,150,366 *54110BA8B81C6061A4F88472107BD5784205E8CD altrmisches
810,150,367 *541B6816C225EF1E7D6018AF34250813172A1701 altruists?
810,150,368 *54102D8E27EDB319A3A8226BB0F9A549BD827D26 al truitt
810,150,369 *54107F0A755C6D1B163728FB481A46D8A366503C Altrussen
810,150,370 *541C1EFD991111F3A3022BD1D88360451D8457C0 altshell6
810,150,371 *5412092F8B154163300FB7ADE63DB9A48A9BAFF6 [email protected]
810,150,372 *54173D6A7C1E2786126393A0888F2BD1B8613BF7 alttari8
810,150,373 *5416C5FDC7AEF7DEBC71CBFEF3AC92E3D1E8A226 alt.usage.english
810,150,374 *5418A4829CFB253A2E8440F6AEFFA3BF2432C555 Altwiesing
810,150,375 *541ED99611160D12EF494F8C24424CCF6C521B9E A/L$u
810,150,376 *5412E7272C994F7867E1F843F71572924BA607BD AlU:"
810,150,377 *541A5B3524E3F330E069A6FEE7FDB31F8656A1CA A!Lu1
810,150,378 *5413D4F7BA3FD50F7AA6E9908A29F79A15A3FA56 ALu,1
810,150,379 *541EB1E5CD03A9EEFF1A91E703CF51B675BEC63D [email protected]
810,150,380 *54189DB0993D0E190E6B3B6AFD1A1CA2478C9E5F ALu_4
810,150,381 *541443CD76D9BC8F994DBF46FEAB8A76F1445A7D $alu7ere7e
810,150,382 *541690A17BF15A1AE38A3A1D7570D99A321EE6EE Al=uc
810,150,383 *5410A8B81EC950F6078C7B1387408D62A2186A85 A-LUCILE
810,150,384 *541D8D8C319AFB1D19008F85DC1F73233C6A6BBA ALUcS
810,150,385 *541CD159F40AB375726625440942E5B018478C72 ALUD.
810,150,386 *541450242DA82608ADD854C38BF3BD705A60DC79 Aludapal8
810,150,387 *541328CFE0D658C418E83C073E37F76A246E27E6 al.uddin
810,150,388 *5415C2C4EEF28AD3187FD9FE9EEE501394EC7132 Aluebsw1
810,150,389 *54171DEDD364DA025709FD3A0D7276BB27736992 aluehälytyskeskus
810,150,390 *541D86FF8B2FCED68997883ADA79260273ECC7EA alugama9
810,150,391 *5412C794DD93C6A92C65BA606C36686072C0195E A;LUk
810,150,392 *54189603F05870DD001F3D9D14A3DD301492116B ALU$L
810,150,393 *541FCBD6678A1E75892F91099B94871D80D1D3EA alumathorn
810,150,394 *54107F94F54D1D1EFC7DF0198BC2A7637026A940 aluminiumisopropoksid
810,150,395 *541E8C04E34DD0EF750AD8B99F229F91A91BDFD0 [email protected]
810,150,396 *5414363FA2579E60A9448CD2FBC7A49BBC39EB2C alumni.mike
810,150,397 *54111C7100AF6624F276D0935AE22B660CEB1859 alumrocking
810,150,398 *541C3FE397A58D9EB40FC4FE154EC32C44FF79B7 alumstone3
810,150,399 *541836BE346D7698CE96CD0710C62D673D15C876 A&LUN
810,150,400 *5417DB4806B3153E37C96E20CEAB32707BC28B16 [email protected]
810,150,401 *54191FCF6D6AD1841D2AE386234AFC5C80535473 Alupecia6
810,150,402 *541ACEE3897012F3B2439493250902D9E41FF757 ALUPn
810,150,403 *54197EB836B9151062A48D8FFAC19C031887386F [email protected]
810,150,404 *541CB23C16E91C95F9B8408C8E785D59A66ED28D ALUSESCU
810,150,405 *5412514421F4596235A327E31C556A9CB5C6B315 AlU.W
810,150,406 *54127D6348874F89F7C4F32B34D7E7F3516EC15A ALuXF
810,150,407 *54117868AE0EF5CE120A1B0985C7D7CC35EFF7A1 ALUZJA
810,150,408 *541A6E41259EF4A21BE49950EBB906B34A6447F5 A.LV,
810,150,409 *54160BD645A9DA5D3D199EF34C00D6892328BCC9 A%LV
810,150,410 *541600F9F7B6C4555236551090AE24FC1D688222 A?lV+
810,150,411 *541892B68AC636E5EF375260B10DEFC369F691F6 Al&_V
810,150,412 *54127F56F674C0373F36578300D39E30CB10024F Alv=.
810,150,413 *5417B96974FEF09914538827B9C4136162D0B843 alva.chaffin
810,150,414 *5410156B1F92CDE600B7DBF3D121AD160A4A4DB8 alva.dionne
810,150,415 *541573DAB4B5E7DE260533BA99F67962DD734412 alva.doebler
810,150,416 *541FC78FC00F855EF0D13203D2898A6CC0A7D0BE alva.drizin
810,150,417 *541418DDC37B0427F135320D3CAA6F3A86F54CC7 alva.forsgren
810,150,418 *5410DC52372D84A6B326303409390EF8FCF6C1BC alva.garbe
810,150,419 *541CFBFE98DA63437BF70F1C60C04DCC85A091BD alva.grothoff
810,150,420 *541FF2FD244D78B22B9F60FF2D6585D0198C35B7 [email protected]
810,150,421 *541899EB027FABDDDAB232DE90A033759184D348 alva.karsh
810,150,422 *541B2753E88D99DFC6C44C0F9995242DA3434CF2 alva.lindquist
810,150,423 *5413CDE045776564B3E0712C621898934FE1DAE4 alva.matlick
810,150,424 *5418D47E2DA39B0483C26DE93786662AD80AF903 alva.montgomery
810,150,425 *54165D8F1118F1CC547822A3E358A6C990AE9ACB al.vandervort
810,150,426 *541A3740FAD569B81A8751A3F5ED0F83B21723CB alva.nickerson
810,150,427 *541B5DF6DE291655BCA01CD73DC5120851B79BBE alva.ormerod
810,150,428 *54170502B6C849BDB8143FC535AF0A01AF1A6214 alva.pagnozzi
810,150,429 *541DA9A14C07A98938C47EA11A3D35DCD3250FF3 alva.pochintesta
810,150,430 *5413F5A7AD7F524A24D5EC7BAB5D41AB87276785 Alvareš
810,150,431 *5411BE5523EEDB6EB981BBCCE01DDC076A4D593A alva.richberg
810,150,432 *541BCBD04425347818356C8EC01025E75A68AC95 ALVARISSIMO
810,150,433 *54170C271209C97F3F6C8DAB1BB1A10CBDFBD6BD alvaro132
810,150,434 *541759CD29E1E0A8E8C6B2DDA04E4031D635DC31 alvaro.acron
810,150,435 *541C543A44EF7FFA8A47E0D2B7C560E15D0E6B05 alvaro barajas
810,150,436 *541F1178A6A10B70007B7D3E3CC9410296578564 alvaro.coviello
810,150,437 *54138F6A31081D184FB6A9867D02B5B5C36100A7 alvaro.denike
810,150,438 *541A7EC3E725B4E27B9B6673A9B27E0DB32B526D alvaro.exel
810,150,439 *541017A18A53677702A80A10625E1DB6B8B87139 alvaro.feroz
810,150,440 *541C7F7B596318BC211CF644F0599BA1982F3537 alvaro.fruits
810,150,441 *541D6FBFC3E698B8C1EAB535909CB4496532F531 alvaro.garick
810,150,442 *54140C1857A4E9C9917731D3D8803682134492CE Alva Rogers
810,150,443 *541958D184CA48C1FC15DB128FD47CE0B26ABF09 alvaro.glasscock
810,150,444 *541EF79E275D196ACC85C62A5CD4BF07428FE741 alvaro.graen
810,150,445 *5414D93730FB908A7D0888630A48E1E9CB33E8F3 alvaro.heaivilin
810,150,446 *54129C7A7B7B0FA3D403A94D68C2F162D08FFC69 alvaro.heang
810,150,447 *5414D546A776F86B105AA23C2BDD32E44801CDF7 alvaro.herren
810,150,448 *541492C013EE526C3C286A2B656DE63961AB93EF alvaro.kittrell
810,150,449 *541F7FF9C9E4D89CCCD99999E8D1A58B50E7F98C alvaro.labbee
810,150,450 *5418C17C8EFEBB853B7FBBB1366E2C020C48A226 alvaro.lahrman
810,150,451 *54139C680DE3A1B5C593E03231EAF9711C62C969 alvaro.leathers
810,150,452 *541D5CEB98A44F3C57504F29469D69E07D1B07A1 alvaro.lewand
810,150,453 *541CD22B12933A8CAE267D582A87BA93E09244C4 alvaro.magnifico
810,150,454 *5410087E5A21606499A9C608AC190D9935618F73 alvaro.marcella
810,150,455 *5410956E6BF9FD17AF9EC359CE66D57F90DE947B [email protected]
810,150,456 *5412A026BA6381999132AACE77B24BFD532674F0 alvaro.pikula
810,150,457 *5415C892A251CEF704A2433D0F82EC51991F9E79 alvaro.prevento
810,150,458 *5413AC4DC177E04B5B3179504BFC141EDF9ABB70 alvaro.sanabria
810,150,459 *54102053657A08B6FEAB1839A12F59B0A17A000B alvaro.seiffert
810,150,460 *54163B19339F6C40E75D7FB21AC4A64244CED856 alvaro.shoup
810,150,461 *54178EF940AA1022F2772548F018A9442EC41082 alvaro.siemsen
810,150,462 *541D41864B4347D900CA0402E2DFF7F870FE3900 alva.rozeboom
810,150,463 *54148630F9D5B93BD0610C2C71A6EC2CB21D69D8 alva.schenkelberg
810,150,464 *541B0AAB9F1078609037B7F498D081601733D71E alva.sciarretta
810,150,465 *541C1AF6B91011CDD76EFAB70DF938DD346E79B3 alva.simerly
810,150,466 *5417F1F50DE1108F4FAF96E9EC780D2E918F210A alva.swain
810,150,467 *54161927E81940CB6B2B4CFDD723E016CB87D4AE alva.tooms
810,150,468 *541E243B970D96B4F391A5BE0838CC41E21FEB39 Al:VC
810,150,469 *5418A12F5C690A997DE460800F5DC07AAA6311E8 alvcs
810,150,470 *541CEB6322DABB5CDD94105CACB9CBDF5F25F886 AL%vD
810,150,471 *5411174A37C95B9873303A328A788A475A476A3A alveariuM
810,150,472 *5416589FB25FD1CC8D0D1C506633B185A2D2B2AC ALVEENKUMAR
810,150,473 *5413C1D46053BF33E9C468508B16FC94957B72FF AlvF7
810,150,474 *5417F10F5E7DD233F11D15F93198D5F2A4231AB6 Alvianising
810,150,475 *5413AC0BA5C3C7F29746770CF1E332EEE4A0E83B alvin.aldous
810,150,476 *541351825886BF656486FDFC8A85882BCE083BD4 alvinbagon
810,150,477 *541D3C8668B69F37FFB4114C4AF7D8D0A1CDD2E4 alvin.barbur
810,150,478 *541F05291B9E6C7370EF427F430E4CCBF289331F alvin.bayon
810,150,479 *5418B9DD501503971FB8B9477C676AC40A58F3E9 alvin borbe
810,150,480 *5415A73454BEED567A3AD3F929FFBFA74BEB85B6 alvin.brothern
810,150,481 *5414CAC0FA005B39E4240AAE230CC40520AEA734 alvin.cumbaa
810,150,482 *54125155A639FBB0A2A51047EB34C753473AB93C alvin.forslund
810,150,483 *54138A322CFB5FFB435FCBD3C71498D2026C38B8 alvin.frush
810,150,484 *541C5BB941E0183071D615E2AE5C399A2B08F0CE alvin.giambrone
810,150,485 *5419FE2C9465A6658CD9E86030424CE79B841D3D alvin.gutsche
810,150,486 *54152B18B070911077D7BF1331E36B4979928727 alvin.hammaker
810,150,487 *541B86B62B16AFC7E36BCD6A1CC6AD1C7EAAB38F alvin ing
810,150,488 *5419E040B3CF039EA784CDDE6902FF6B7EDD342C alvin.jenning
810,150,489 *541F864B8D346B20A5B6784314337F7FEDB04451 alvinlayugan
810,150,490 *5414DA34FBF60B2FCBA8F9AE0A7A70123F61B3EC alvin.mckibbens
810,150,491 *541D5EA3C1B82F69E07681C2BFB8A7624262CC5B alvin.milnik
810,150,492 *54114D431B34E94391BEA4D8EA6CFD251AB4CAC1 alvino martinez
810,150,493 *541AE05CB85C69EBB285CA8DF6C5509BA3EAB612 alvinpeace
810,150,494 *5410694511855E13899F88205C824A9FBFE3638A alvin.piccolo
810,150,495 *541373E1485BC2DFD8EB6198736DA1435BFE4A0D alvin.poston
810,150,496 *541816B259DD5491F53E817AAF16AFA0FB06FA64 alvin.razavi
810,150,497 *54159EEB0CEA0C02AEC786F20466C57951CF939B alvin recto
810,150,498 *541AE59C2D5F9BD2377588E7915DE8F70BBA2F55 alvin.ridlen
810,150,499 *541F7F56386DFF8CEE554175DB81C4E4CC5480E2 alvin.riggert
810,150,500 *5417B339557587F8A72AB552AF39F229225CA5B3 alvin.segroves
810,150,501 *541C9D0CA985954A5119B4D4040B011620B4C79F alvin.tourtellotte
810,150,502 *54159A29865EC6326819471101E25EE354D63C9A Alvirtie3
810,150,503 *541278F4C11C7280020E6C684F149F346549ADF4 ALVKD
810,150,504 *5410B66BF540C8B41AA37B1F44A4ED5EB59D7B9F A.lVO
810,150,505 *5414B82C1C52462712CB45B7E50C53D00AAB0AB5 [email protected]
810,150,506 *5412933813A2B9E4D74850B32A9B0F002745A19D A"lvu
810,150,507 *541772AB762062BB47B2B128F09E81B9C0C76264 ALvvM
810,150,508 *541555F7AFCE93929FF7AE6E9061A10DFCE55485 ALvWh
810,150,509 *54116C4A3C6199FAE4418DACB720018FB71C1519 AL!w,
810,150,510 *541981A9B2CBBA94B417C7E78D29B43A4960F216 A_.lw
810,150,511 *541DE27AD6F2C1900824B8F9D78819921AC755C6 ALw1c
810,150,512 *541AF0E61062B472F60D037BED77B5EB6DC63B54 ALWASEME
810,150,513 *541A396A22B4CAACE3526631D82F43FCD44175E0 alwayschristmas.comwww
810,150,514 *54113F9B545649A465486694F9DE169A7DBA8DCA always farewell
810,150,515 *541678425FB52525FFA318D6E8F21912E4ECDDFE Always on My Mind (Lange remix)
810,150,516 *54109F8320E74D7625017A148CD7D8152FF7821E AlwaysSayin
810,150,517 *541D0CD0C1319BBA16641C933B8B0FB5F6FB173F Alwd$
810,150,518 *5413BCBDC8089DC423E03E46C118B2DB14ADEE77 al.weiszbrod
810,150,519 *541A8EF2DF6A8D09C291BC660E5EDE01DE004347 al.wetzell
810,150,520 *5410887C72633B06C021B249FB2CF2A3727E2673 alwk11q
810,150,521 *5410129EB4E223D658BF74DCB22B52DEC2AF561C ALWL;
810,150,522 *54151CB40F31EE58C9ED2CFCDD01190C6AA1A287 A
810,150,523 *541CDF19B2340CBB5554DE246092CD0A1E774DD4 ALwMm
810,150,524 *54151DF7CA6928E80CE613AC6D757ED637F8A739 AlWpc
810,150,525 *5416E45E6B2A8BBDDAFD99908806A3B7CB5F42E8 ALws:
810,150,526 *541E11779D66D8A785ECEC5632BACB821C00A7CA ALwS7
810,150,527 *541A5139CE7AFFD2CF63BD7E90F831E7522ED860 AlwU%
810,150,528 *5413A34977A5F64B8F537C56E8CEEED05B7A0968 alwvn
810,150,529 *54105F7124F506EF99F3AB07B2FA913743336EC3 A(lX-
810,150,530 *541B098218D461B07FF9C45D59DA5E094F78CED4 Al-X&
810,150,531 *541128936560C8C99E3E8E941BBC503B14317696 Al)X)
810,150,532 *54171473C43135B8DC785DEACE0B5C96AA3C59DF A/LX8
810,150,533 *541BAB27C83518F0CDB310CDF9A100B7441A5489 alxau
810,150,534 *5413FFF0E2C91E01F5FE8996A764802C68426825 A_lXb
810,150,535 *5416347FC7E16393D03138B0A6AE1621EBACA7BF [email protected]
810,150,536 *5411C4B26C368E30C393840C925270BB1817E72B AlXh&
810,150,537 *5416820C26E6E3A19CCC328E3D88C51263FE9D06 AlXNE
810,150,538 *541598C79D23ACFED935F74D97CE49586D80A9D6 ALXo.
810,150,539 *5418BB732D1AC56A36D46DF93445B8982ADF0182 alxpopescu1
810,150,540 *541C7DF6C1435B5CF53D140E1D5D23713B61F8AD AlXtD
810,150,541 *54150EC39B00CB7DF14C7B9EB4BFB5800AD6C39B A
810,150,542 *541727471AC63CD6D78151DE2B330616E3C67F04 AL:)Y
810,150,543 *541D0ADE186E63AB8D9EE9557197E764331CAA77 AL"Y=
810,150,544 *5415D5A63B20A106EAD3A75A8AF288839A7B56B2 A,l/Y
810,150,545 *541164BFFF1773D2A8171E65912B7EB153961DE9 A#
810,150,546 *541549845FB70B20A0023D23B75ECD45D9E91429 Al$Y$
810,150,547 *5419D435892B659B7C9110EB048B7F494AEA2F53 [email protected]
810,150,548 *54118A5D7175D1CC7E1524FE59A94C98218F0FD2 Alyce/M
810,150,549 *541387920976ABBF3F9F403A537FF4DAEDEFC568 ALY,e
810,150,550 *5418813DF3502382E1F8EC561FB07655FF8515E1 Alyfeding
810,150,551 *5415D705EEBC4FB33F30876D13576E2AE952C0FD alylakhani
810,150,552 *541E07CB4CB37ADDD837FE841DC570E960473DF6 [email protected]
810,150,553 *5417893FB9159DC5A9BD0339EFEFFD157F27866F alysia kinney
810,150,554 *54115CDC83E78D4198B94E3BFE4CA9344641AB51 alyson90
810,150,555 *541E956AA5042959109396B9C977FEB731EB6CB4 alysonohara
810,150,556 *541FA05AEEC9E94C6148F6832F1FB705CF9A10FF alyssa593
810,150,557 *541D89E4DF0D8449B9CAEA684C07C6590BA4AAEF alyssa ashlee
810,150,558 *541F6EDADB53447CDAA8467FBA224C5C5A0D646C alyssa cooper
810,150,559 *5413A8DFC9A3D2D93DC8B37CCD81E7F3F10E9ABA alyssa delrosario
810,150,560 *541889F2C7A55FD4586DC52B0CA747A7746A66BB alyssa koski
810,150,561 *541FBC325EC7A13B8A1A1828312426E04F8BAFAD alytes123
810,150,562 *541C8BF2A9197D98ACFE61BF718F2122C8048EDD alyvia40
810,150,563 *5417C18058861EB87F2FB351FE3028E233AEDC64 alyvia531
810,150,564 *5414B20A1549870BC51AF56856F475EADDB70283 AlYX
810,150,565 *541F514DC91127BDB595D8F7A261A367928D1E7D Alyyy
810,150,566 *541540CDC48CED6149286BC2FBE6A2D9FD3B816A A!lZ&
810,150,567 *54139371C5892CCF91C86D3BEC60C253E7DBDDAF Al;?Z
810,150,568 *541114DA703725009C7271E283A6A0ED11F0A855 Al&Z$
810,150,569 *541313A9B97D21104D24B2AB2C9DB3F117E86DBF AlZAQ
810,150,570 *541D5FC58909E1BE9653F28A0F84CCEBBB78C669 alzarti4
810,150,571 *54151E32BFD2C149D384DCA54C045DDED5B8FEA4 alzeros8
810,150,572 *541F7A6B584F39E244CE7B6F9BAC59A6264BFC58 [email protected]
810,150,573 *541CCFF427750BFB031979A4795D518C7570208E AlZO9
810,150,574 *5419044D2A01BC81309C6CDEB4010DB92C66C512 [email protected]
810,150,575 *541BF82B687098B1968244FF1613EFA906E99051 A/M?-
810,150,576 *541B3D19C99355989B0CC5352E11DB7480342EB6 A$=M-
810,150,577 *541A972B966CC4C0E3E1EE2CB1A0A9EB492991A7 A$M:)
810,150,578 *54177148DE89BFC45F6186240D5DAE2B9392529F A
810,150,579 *5410F1155606BB40B169B746B5AEB48C68927754 AM~<
810,150,580 *54123D5DB82E4B729ACA6D1F788EEDB1CB2D3FC9 AM=",
810,150,581 *541D97CFD46242C2FD941D47267CD2D6DDDE5EE1 AM-_+
810,150,582 *541FE7B359E8129C95AB506CB653D34EA457E7F5 AM:@
810,150,583 *541AE52BA6E9783E5DBFB6BCA64002165CC1A24A AM+$%
810,150,584 *541D6DDDE45A41A3D39017A59A1994B4A63A4D96 A,,!m
810,150,585 *541E716075E8CBB3A3EFB973C545BFB29F90DF42 A;(m;
810,150,586 *541F91F037B2A0D248406410A41C80C0D74973E6 A:=m_
810,150,587 *541A2A7015B8579DB3EF4E87826EAA1777C17AB6 A%m!&
810,150,588 *541829F41B06A903CD3F2BCE5D63F7BE5B35087B Am&!/
810,150,589 *541D8081B1E19101155847DF9B5A409120F52040 a-m<
810,150,590 *54150A46E5CBE000357161F690465D96CD066E71 AM0!
810,150,591 *541F0CF38116C9C3BC84A7F2EDFD937052A75E8D AM0FM
810,150,592 *541AC6C40BACE6DFD15AE645BEF1A39EA0798A3B AM0$n
810,150,593 *541C6A6AF503505E989CB36C1ACC3017B430A0AD AM0pC
810,150,594 *541F87F620A701D7B0E15F7C2013AAFDE4ABF1EB Am0r0u51y
810,150,595 *5414A769FCECC03F61AE2C1EFD685999F43D9363 Am0Uj
810,150,596 *54175D0E5450EED62255C7EFC528FCACC3171620 A;;m1
810,150,597 *5416BBFE6AF8DD7185A47D8CD1AEB6E856521887 Am13T
810,150,598 *5410F2DD9845047377CF22ED4031026D93DE4AB7 AM154205
810,150,599 *54147819A2209F69BAC3575DAA347C539105761C am1601010
810,150,600 *54101205F731DA1E3830CC9B064B088E2194D5E1 Am1aG
810,150,601 *5418CF760A1EA2451E5B94FDA8C6FAA2FEC9DA1A AM1AS
810,150,602 *541484D02F1B9F48D07DDCA8743825DF68C27D10 Am1VC
810,150,603 *541D3170AF53670FB2E156492A4CC1ABA67B9CFA A+M2L
810,150,604 *541C7325180AC80BC4EB7442E606802BD8D0BE97 Am.32
810,150,605 *5412FABB322732556AB45D59C57EE5A9693A3438 Am36f
810,150,606 *541556110FBB379226A25A4D4448164D1021FDA1 Am3(f
810,150,607 *541E7C19134D038BBDF38675BB4F824D3BE97616 Am3+hy5+5
810,150,608 *541CA3A64B84880CE6D1FA5CA2FDC8768C7628D1 AM3L6
810,150,609 *541D49275A5A3FCD53FF8F8956C0169EEC02F2D5 Am3Li
810,150,610 *54113600173661732F823DD3749CF0B4761F1E30 Am%3M
810,150,611 *541BD10304C5098DCBDA7AA65C362E7A768AD4C7 AM3t=
810,150,612 *541699F658FC2E8D7FAD15A8BEE314B11629DE5A AM3#u
810,150,613 *541FC6A2ABE35BCEF947336613957FA6697C36A0 A-m3v
810,150,614 *541729819EFFF530D58542ECA2199A55F9ED65BC AM3)w
810,150,615 *541A543D3383B2969B6DFAB7F79E3C6C0749E5F4 Am3XD
810,150,616 *5418A2107771529E4FD0950455C0ECC3980F69B7 am4bidn
810,150,617 *5419C1570F3CC475BB5522A30973E1780BCDB194 Am4n4
810,150,618 *541A0A89ADD7C5B6FEF8761BF83283577DCFDF7C AM4XK
810,150,619 *541FB817200171CEA5502C0FC4D3A630914B9971 AM4YL
810,150,620 *54183DEA870CA6DF738C83CBDFA21A91CBBF6E05 AM5%a
810,150,621 *54140AB2CEFBAF683E37B42F29BFE99809491D92 AM$5d
810,150,622 *5414F91B8BF2C440F42B531339A3F2459AE361CB Am5Qw
810,150,623 *541A30FA0E808572313FC3ED1319089CB12B08AA Am?5T
810,150,624 *5412A02E07F93058ABA054DC9C838AB9ED4551FE A;M6E
810,150,625 *541C8A5A3455684888912D9BAAEA83D1AC732138 AM6O
810,150,626 *541F3A296E87B16D2D2E743D8DD874C3671218CD A"m7"
810,150,627 *541D68D873651B2CEC8F52532000B67D11A58B41 AM7jf
810,150,628 *541B62F76A6CD664BF8DD2ADDA2AF55FAE23C1A7 Am7m7
810,150,629 *541523115EAB2B3EDC51333FBABBF72E36695E38 Am7Y3
810,150,630 *541C1B3624729023924BEBDDC28E457F6026DDB6 AM8!+!0NED
810,150,631 *54145A5544FE9EEBFF1F444CCC90C432FEB5C245 Am%8b
810,150,632 *5419FF38A7ED67CAB531A0E9E537FA099893E19F Am8itioned
810,150,633 *541A5B13291FFBEE814485C3C41F9E45D3410BB5 AM8?n
810,150,634 *54164B4698FCCF19C111648553590FB54740B44E Am8Q)
810,150,635 *541532CA76DAF8295C63E49476831EFB8F9641F9 Am)9+
810,150,636 *54153D499A67294021B78C0E02592E9E879C5DF8 AM9B;
810,150,637 *541E8A30E733FF32D2E96C394B2A3DAE68F875CF Am9.c
810,150,638 *541D3F415C3F115E308B2D151D61BAB72FBACA33 Am;9f
810,150,639 *5417AD403C1A1716DE948F302D8AB67124F1C702 Am9IQ
810,150,640 *54110689602D643D13A3705EDCA8C222D3322C7F Am9nG
810,150,641 *54144031D094CD309F80A40D66046F07968FE5B1 Am9U;
810,150,642 *541E4BC9FDA9DD2D49BC40D89367B32067E6F60E A)M)a
810,150,643 *541C8C918FB790C6E098BA763ECF4D74DE461E04 AmA1A
810,150,644 *541E09AA0E6DC406524D280A62945960FF6DA695 A-Ma8
810,150,645 *54162FE31259AA021E156578BB613F6724A2572C ama afriyie
810,150,646 *5412E8EA5DFACB8256C136F7FAA19BFD66F2651D AMAAZUN
810,150,647 *5419941608628D9D798CA6BA39E42141A01BF652 Amacena2
810,150,648 *54193D4436857DF2CDE86BAE82B2135B960986F6 amachucarvos1234
810,150,649 *541E98F235B5297A61A55C65FEC7952E7C47E494 amada2hot4u
810,150,650 *541ADD820380D14070D604306961151218EC6067 amadeau1
810,150,651 *541073775CAD3FEBD069C03CE4D986B1EC336F60 amado.arico
810,150,652 *5419225BF61CF995C05E8C2443B32441978579F3 amado.bensinger
810,150,653 *54137270FE3459B3290BB46D15F57B7DE86FA1A4 amado.bokanovich
810,150,654 *5414F4F1F30DA9A9AA61B65BACC62718494CFF7F amado.bowne
810,150,655 *5417BAF7C612119702CF35640A0D991A9839EC2F amado.bozak
810,150,656 *5410B55582C0BF4297C5A37AEE5FE4881FF07D0F amado.corcoran
810,150,657 *5419CCB39636F96A8492484AA588E5D010EEA7E8 amado.culberson
810,150,658 *5415F49DD682E2B25441D29E38F6DE036280F068 amado.derogatis
810,150,659 *541EC2147A2FE1EDECB9D606538BE73764B0B4EC amado.edlao
810,150,660 *541F6293B659C123FF2BE258D2C791E8A916DA23 amado.finnemore
810,150,661 *5417AFE25B052CF97E1128BC40056FE61E4FB016 amado.gnoza
810,150,662 *541FF23BE2157925C67C6E1C25BC81DBEA211923 amado.hannam
810,150,663 *541019F1A36E15EC3BBF5D6D0B79BF148559F90C amado.hsu
810,150,664 *5418466D61C67D3A12803F3A0347B6200B5065C5 amado.izaguirre
810,150,665 *541B056595F4796486A1FC20E0CB9879CF7CED8E amado.klecha
810,150,666 *541A820B777F80B1A6EA681F5FC73871EACFE449 amado.latson
810,150,667 *541DFB5A450FE654F96F6F66B742321013B25EF2 amado.mabane
810,150,668 *541CC96DEAD60AD639D7CC5BF3EAD35D45CCE3C0 amado.mceachran
810,150,669 *54120F4A24855DE995C02A276C2B8EA914909DF5 amado.mclendon
810,150,670 *541F9E41C1710085301218BC44E8C5E9588280C5 amado.mercik
810,150,671 *5417637B138A06E2D9FFD3A7F309692C2769CEE9 amado.mojardin
810,150,672 *541C82A62A289FFBBE6C9E822F042432F749C872 amado.noxon
810,150,673 *5413C0DC5652130D072B963D5E2C433A07E15AB7 amado.puebla
810,150,674 *541F0A31BFF036DC5E806A61ECB3657F46F37283 amado.schlangen
810,150,675 *5417E142DE72D23A1B3B33216B7E74FB670FB16A amado.slockbower
810,150,676 *54182A09B76F9971BC6D22B9B72F8BB5BB432B7C amado.viesca
810,150,677 *5419CACC139B8A2EA2B4F7EE2FFBCDEF888DCE4D amado.wanzek
810,150,678 *541E637017FFE7006A3BDAA6029F1F100FD51E8A amado.wessendorf
810,150,679 *54129FF4E799B34ADBA0F48DB727295A0893E70B amado.wickham
810,150,680 *54130CA887E2490FB4057D01FC79C9A22617C442 amado.zamor
810,150,681 *541B67A6D9DD3D7C795E19F0E191A8C33E0A8D0F AMADUCCI'S
810,150,682 *54185CB7EA66E87747C200298D53AF051CAB0C76 amaechi1234
810,150,683 *541CD0ED5209B0BD06ECFA4AA04D873C9BF804CD AMAEKATSU
810,150,684 *54166CCFA13BB745E0687AF93F771A712EC60A60 amagare4
810,150,685 *5410C81B78146FD66FCC2213A9330F6F6EEF7B37 Amahajan0
810,150,686 *5411E2CDEBF37BDD4E51F5D546C10A6487F8CEC1 amaigrissant7
810,150,687 *541EBA423AA68F72F8C36C0561CE4BE635E6E98D amaʁik
810,150,688 *541F289B4E109D680B202AC52D01FCCDBD9AFFB5 [email protected]
810,150,689 *541FEA58DFC6C159E7268891DAAD3955677EF685 Amajjayat.h
810,150,690 *541ED0904A51E96D6C9F61F2844966A9AA68BB82 A(MAk
810,150,691 *541A789EDDF4E380B0877FFBD76D3992913E0260 amalehab
810,150,692 *5417A8857EDE084A09DB1EAE05A113F942EEB455 amalgameriez!
810,150,693 *5410092D202D098A03086EFC7C8D7F198E5EF654 amaljyothi
810,150,694 *541C05ED3987E363C6CD81BA8C63B79053BA1E01 [email protected]
810,150,695 *5410567BC98AA5C78DAFFE896E5D69ABF6D2EF9F amalyazbek
810,150,696 *54118F674BECEC33198B306BBB43BBAD0604C0F7 AMAN32
810,150,697 *541B87801D2FB638FC84A1B3EB0B370F3DDD0FE5 aman8286
810,150,698 *5410BACCF765ADF3EAE29C836423E92771511D99 Amanamon
810,150,699 *54132669A9CE3ADE2F37D5B1585D2F660C7A52AA AMANDA1MISHKA
810,150,700 *541FB100DD13D37272AF789CD5C5627E214A5543 amandaaltman
810,150,701 *541A670D922343FD34878EEAEFCA15B477F8BBD5 amanda autrey
810,150,702 *54150E2F54161817552B02D2AACE1150F1A3C456 AMANDA_BIEGAS
810,150,703 *54117F9F3E1B53ECD5E773BA00E3E3D23794B379 amandac929
810,150,704 *541A200335F9492CD1EB9287D07A4572D48DED34 amandaciriello
810,150,705 *5418E69942A39D4B453D6F81B13627CF1CA0E9FF amanda dear
810,150,706 *5410251F7760788C26B8F283E0DC4DB6263A0C15 amandaej
810,150,707 *541685603EEEBB217E0502939620B02F52D39F9B amandagarris
810,150,708 *5417320EEDFE231918AA082A474FA8B35E7E7E6B amanda hardin
810,150,709 *541DE0D44412E4405BCD054462ADA50BF97E219A amanda horn
810,150,710 *541A2710565F354FFCF96B35E0FB332D8EE7F3BB amandahuttenstine
810,150,711 *5419BCA7D40A9BF52907CBD168BB3B418CFAA1C5 amandakholt2009
810,150,712 *541C405D4BD91C4889A50E17DE5C69E5E5E743A1 AMANDAMABROTV
810,150,713 *541B164D82018241FE6F7984CA6240F2981C5CD9 amandamarkiewicz
810,150,714 *541D37482540B1F926E4E0E7EB685DED12852B6F amanda mcdougle
810,150,715 *541028B542828FDAAB1681D60286E3F3E7E66F43 amanda mclachlan
810,150,716 *5410BC43237FA137267A46C6DE1A9486541DFC8A amanda pavelec
810,150,717 *5411F2366414AFC0CB0D2C85FF5318A1DF7287F2 amandastapp
810,150,718 *541FAE4BEFB7891D870A216B5F1E2F3284E960E0 amandasvedberg
810,150,719 *5411904E4FA7C2F29E2AB591080E6DE91339074A amanda trumble
810,150,720 *541A50E440852356157B766895C78D8A317D2ED7 Amandsa
810,150,721 *541BF2278CD9D14828CE2D7DC52D8844BA827754 amanquah4
810,150,722 *5419C9C49289BF1F98479A72A8D5D2947B53BA7B a man's coconut
810,150,723 *541F08B478856CBC9EF665AB3078425B7A4A479A Amantes Secretos
810,150,724 *541C0084CFE1C9964F240AEA21585E5CAC2E01F5 amanymansour
810,150,725 *541FC96A9931BBEFF4E6873E23D704BB9AFD94BA A"Mao
810,150,726 *5416AA982FC0705F7CFB771891FC6A47A94A9D5E Am&aP
810,150,727 *541829B2F2EA6D33CE731A96E7E0BC9FE46A1115 AMAPVA3Z
810,150,728 *541AD08F3FB1555DDF3589477F1E4E669A4976E4 Amara815
810,150,729 *5417D068E401922347F22E5046BB0171C3ECA876 amara821
810,150,730 *541C285918DAC8789B2AED26DA2356B162090AE5 Amara868
810,150,731 *5410A4F948E62C348AF6E868991A9CC5F804915F AMARANTH!
810,150,732 *5411356AC1CE96749D9B96BC5C71972E87A9E8AA Amare248
810,150,733 *5419C1AEB54882CD748EBB5BA729EFDBCBA58463 AmargosaR
810,150,734 *54186537E33E51AEE55C4BA4DE055C427A89BC5C Amari439
810,150,735 *5416FBFD7E52AD504F7B950ACFBEB8303DC82D0A amari678
810,150,736 *541B0A7FF8F89109AEDAA8AA473DA077B626F628 Amariae
810,150,737 *541719C37B834DDCA9B9E08C030EF5E957597AE8 amaricarlha123
810,150,738 *5415B1654D785F21F47141AEDA427833EE72F41A amaricaste1234
810,150,739 *541F25659DB3484B4DFBB5C39874A62503D0422B Amaris738
810,150,740 *54143891C4B389487FF07391EFC19086D6F1ABBE amariscoggin
810,150,741 *5410F7C678529401347BA0523212109C3E33C0B1 Amarjyoti
810,150,742 *541081D1EF0DAA3B837FEEC301C8FAF5F68EF497 AMAROIDAL8
810,150,743 *54115B1A3CF652D314111CCAB063869A2961A2BC AMARSEMPREVOU
810,150,744 *54138C23AF16FF35477C4BB5142747CF2BB40AC2 amar sookram
810,150,745 *5411D083AE2A4912706D5A37A9F38B7B6AA8AEB6 [email protected]
810,150,746 *541631EB1967C7A0D1582C5047833C166DBCD794 amarty12
810,150,747 *541218BFE8FA007AF60EC9A7B81A54FA789265F9 Amaruoloc2
810,150,748 *541D44357F2A1E40DD07F824136B88B00F44B7AA amarutuf7
810,150,749 *541B05AFC58AE756C20C627B1D810374EF2568CF AMASHEH
810,150,750 *5411A8C65A65CF311E97736AB19F13484FEAC176 Amasserions2
810,150,751 *5410EE724521863B3AAAA02B9AA4C2CAEB203C6D AMAt=
810,150,752 *5416A827A827D2F3FA91AF6EC2DEE23113133486 AmAT_
810,150,753 *541C6321159A46011F01A6533E926E3F1276B3C4 AMATA-STUBS
810,150,754 *54183D357CA1AC6382FC4CAC747A3A4C68B4572B Amatatuf7
810,150,755 *5417BA85FFB471A18863A0E7E6998C62072F0FF0 amaterasusha
810,150,756 *5414BEE508D6A7B698484E75F2E4DD7BD23B6684 amaterjem
810,150,757 *541A3D354C1259624004501D4838D45A7DA90FEA amateurstar
810,150,758 *5410D96E009DD1B837BF72A10156B875399D3440 amateurtheaterprojekten
810,150,759 *5414413B2B3F972519D1107F36EFC90F07EF2DEB amation1
810,150,760 *541E977E6E91617164A7577DC430DA31BDE9A865 amativa0
810,150,761 *54165EA092A381177845D5B767C710CA6D78C63F Amativing
810,150,762 *54195BB2B39F33E178FA97EA9C40EE1CD6A277C1 AMATOLS!
810,150,763 *541C5F4890694237C67CB79A22B41F4116250682 Amatsiapping
810,150,764 *5411BF90AB8567A02C0FB899295609CA48F62AC6 Am?AX
810,150,765 *541A97A9EFA3E6F605AFE2A8A53555D6FD485D04 Amayawuking
810,150,766 *541D65F287AEAC55EB6CDF6A4E4B33B98B4FC381 amazinan
810,150,767 *541D6CFC569766AE5CA543A8F2F638BB1F64007A amazonwebservicesgoesdown
810,150,768 *54160F75A44DEE0012A85C2A57BDEC36C8D624A7 AM-b_
810,150,769 *541BE229FC565331297108D362A4A9FC7F4B0666 A%m_B
810,150,770 *5417C6659E84967E75A1E3BEF208C1458883A264 Am-B,
810,150,771 *541AF9196C75841D3083CF6787B992CE3FE5C9FA Am/+B
810,150,772 *541B96D4994EB8251E72BE1F2B151C0B24BB1043 Am)(B
810,150,773 *5410091842E6CFE89797F5F678769BBB4A84BC03 A-mb,
810,150,774 *5417BECB166857D156C38FA7722601944277F857 A_mb3
810,150,775 *541FA9E9B262DD90556700C07DD0776003D7FC9F AmB7)
810,150,776 *5417518D4E9277D49797CEBAD2793D270768A8D5 AMBAILEY17
810,150,777 *5415AFE629D64F8474D45C5629E99CD34E13D69A Ambalini7
810,150,778 *5411DFEA36EF4C17E433E41C86EF603BCDC9859F Amban7
810,150,779 *54196C2ABCAFEF75DC059CB56942F7BAA57A9C48 Ambareen7
810,150,780 *541F8DDE3AD5B899BD5BD8EBB3224A5E6D29B4F5 Ambaresha
810,150,781 *54125B6DC3C3A8115864A1D99CDB61A542DAC6D9 ambariwa
810,150,782 *541C797D018486E93B16DF93A70BEBCAEAECBFBB ambassadordare
810,150,783 *541FEE2D49398BD0133FDD679B02A964DED496B4 ambavyo2
810,150,784 *5411F9F64C93F32BFDBEDAB5FD3A24255DB7BA9F AMBERAMO
810,150,785 *541D1BB67D463AAAE562BD72EEA39B2338DCE3E0 Amberamo6
810,150,786 *541EF9EA8C5F5D702BB8AEFFDCC770BBA3952E43 amber gershman
810,150,787 *541A521E62162CE43E565EA17C9D38C20E2B71C6 Ambergodzilla
810,150,788 *541D749BAEA523C74D90E03804FB8CEE7A03F3E2 amber grijalva
810,150,789 *5416F4B96A06F5905CF6A3C7711B61B3CB3117F4 amberleejohnson
810,150,790 *5412CAFCC7AA2CD13C7AB694A1E46EEDB279C9D5 amber nicole fowler
810,150,791 *54106FA84B1EE66412730121C2F2D625B46E6517 amber raulerson
810,150,792 *54161FBA5AF38DA2F84A10BB1D1C807B3A20040E amber scherer
810,150,793 *541D3E8817F4C532B9C75C0201015F03B7976A83 ambersonów
810,150,794 *5416A80B07BC07368EEC0F96A8D804EEA22651DB AmBHR
810,150,795 *541BBD6F983B7747E174941F62CAE84BAEC40D38 ambi7i0uly
810,150,796 *54106BF61D41E93FC58561E1605E713B4C8110E1 Ambiaste6
810,150,797 *5413DE73EB1AB1FC4425485752706CDC9263AF5E ambienism, volume 1
810,150,798 *541E1E89D230A066C4A7B3504BEABE0A1068B059 ambientssemos
810,150,799 *54147867BC7BB8639C1D3CE50C6F568F5C5D499C ambiguet7
810,150,800 *54159179D2A33AB6019174ADBA497C472CF1B1A0 Ambipolar8
810,150,801 *5414C52155F568D4FD767A610EE84BE4D6C33BB6 AMBISINISTER8
810,150,802 *54153CBBC4A0A2C99C0BB989D2409DA0F3B6DD0B [email protected]
810,150,803 *541DC78D691C338D915A283E4F04802FFB3C5A2C ambitieufement
810,150,804 *541D23C07777433C450B91869E4C016B645E3CC9 ambitionzazaridah
810,150,805 *5419B9E82B61D7A45DF7BBB1D9674B378FDE55FA ambitious beggar
810,150,806 *541E7D6ED2099C538EA402D062E918A3E5FFDDE9 Ambiti|st
810,150,807 *54196DF571B6C5C7443383EF7F0F622A36779867 [email protected]
810,150,808 *541DCB635BB2F6E460B9D29923B497347B3BE549 AMBLYOPE8
810,150,809 *5417A36E065C11AA19934DC27691985370144075 ambmachas
810,150,810 *54100FF3C067E07152DBE1ABA00E26ADAB06F6EF Ambositrensis
810,150,811 *541B9576C4C53F964CE932004EE084CF84F723C9 „Ambroid“
810,150,812 *541FD6897247826F13E047431EEEC061A10364CA Ambrose2005
810,150,813 *541633F37EA498D8A258EFFA2B7D497AF322FBFE ambrose.askwith
810,150,814 *541BD7D4FC687E76B70E9C6536CE3FACDAFC11DE ambrose.barro
810,150,815 *5416A793079015FB6D5E4E2DC6BA3961AEFAD753 ambrose.canaan
810,150,816 *541DCC267E341943259A07374D6E8E5BE5761DFA ambrose.carlee
810,150,817 *541BD5BFCD744E2A63E1F65CD98C5A7BD79B696D ambrose.caskey
810,150,818 *5416B206940C5F8C18896B44108BBFB3A8940CE0 ambrose.cazeault
810,150,819 *5412FDAFFA879E98517F9D77168E6E4B6A320E02 ambrose.ciejka
810,150,820 *541C59FC91CE69B1FAD65714261D374BF7E43028 ambrose.colling
810,150,821 *54182339C51887B677F0180B0E8D3946AA8F57C3 ambrose.deprince
810,150,822 *541AACFBC89551E237E0A289A21D633B9B381401 ambrose.formento
810,150,823 *5418DD75B0236EA1ECB453C5EEBE781F67C3A62A ambrose.frecker
810,150,824 *541A9261864950D3039D71A35983CE48E777E5BA ambrose.grundmeier
810,150,825 *541E50176A59234FDA5472DA8D09E41217E6FCA9 ambrose.halm
810,150,826 *541E81C98E53949F41A711196C2635EE4F94FF96 ambrose.him
810,150,827 *5416AF1A9906BC93B6AF5B59A3295F69C952D32F ambrose.jessamy
810,150,828 *541E74945FA12DEB16F10E1BD8442D0A81897DCE ambrose.kunze
810,150,829 *5414117544D7E9E8E4B87F1F8CA809CD7BFBB493 ambrose.leisner
810,150,830 *5416F6CAEAF46A9994525CC2E4D91051CD806598 ambrose.mcneely
810,150,831 *541790D95C2536AE09F3861FCFD129BABDA2799A ambrose.murrieta
810,150,832 *5414F9653FBED8BA1757E44632375B601E825624 ambrosenelson
810,150,833 *54160CD8B5AD1728C1C5D697D587D4F8E66EDB4C ambrose.oran
810,150,834 *541B37B3CBE3FF8A481E7DAC5D6FE16AFEC57737 ambrose.pertuit
810,150,835 *5417859C17BE6E35B55252EB4811DA0AE90BA906 ambrose.priore
810,150,836 *541696E36D6BA74DED19C5C03AB3BD80C4B06AB3 ambrose.rogacion
810,150,837 *541112DC3949CEA25000603BB8B1045BD2996BC2 ambrose.simser
810,150,838 *54124DD40DE16ABD83E3F48012A26FAF5BC646B0 ambrose.spatafore
810,150,839 *541F8B5A7E087470DF4F0576A42CEE3491E7793F ambrose.weigelt
810,150,840 *541F722805D571376B418ACB2C1CA632320B3BB5 ambrose.zell
810,150,841 *5418329008FAA9CD17436D8A1D25EB54D9787CCA AMBTSBEZIGHEDEN1
810,150,842 *541C533E2317E2927BCB1228D82366BE571FF9D9 AmBud
810,150,843 *541294919220CA7E6342D999F35E1C1B45CB38D1 ambuhler
810,150,844 *541011491536322579950875A45024A78E5442FA ambulatorily2
810,150,845 *5418E6CB0F6335D2B85FE68998F74E4CC9646986 AMBXG
810,150,846 *541D725C4A57C37DA4985F1D61C5EA1B428DBEA3 AmbY5
810,150,847 *5411185B8F44B4D501A5A23850CFFDCF47E18E58 A:MC!
810,150,848 *5418F5BE404A3CF4BF90B5A09DCA05601FDCE325 AmcA;
810,150,849 *5417E4B5A00A08263DB7324934096253E41A7CA5 AMCAAP
810,150,850 *54122F39102A2A3DB70075F9DA682C36F0AAE6A3 AMCAMKA13
810,150,851 *541D3293120292A472263EC723141DAB71264B4E AmC:H
810,150,852 *5411D719E82E4EE86AAF00267240D602DB38D55F [email protected]
810,150,853 *54150B545A41E33EF4F24FDB67C39339ACCD48F8 A-MCr
810,150,854 *541249D69599F559E23A0422CB14F9F181B49733 AmcS)
810,150,855 *541CA7230F734912DB4A5203E95E3A26691BC00E Amc?s
810,150,856 *5416FE4239ADACD1667098B1F636258D757AFCD4 Amc(u
810,150,857 *541D65103B43A6FF505C05892DA2ACB0200CBB1F AMc!V
810,150,858 *5411BCF031990FB6AF4BFB3CDEB2EF585C08C7C2 A?mCZ
810,150,859 *5412E2172EC5DB72A932E0276A058EF06074B7B2 A;Md+
810,150,860 *5414AEE108D74F9C6CC8EB41676CB4C734AA2B09 A"$mD
810,150,861 *5419BF70ED76EC3989956B29ADA4ABCB775807DF A"m&D
810,150,862 *541F93B47F0F41456DC23FE70E5DB9C4156775F8 A,m!d
810,150,863 *541EC7B1C4AB6C67C95610488DD7D12703434D50 AMD28500
810,150,864 *5412250F2A8C864DC2A535131E8FA86B05571AC1 [email protected]
810,150,865 *541379BD12304E466BC439E551D2BB3C668F6B82 AM%dH
810,150,866 *541AC4B62CA4CB5DCFDE12002261763447D3215E [email protected]
810,150,867 *541CF359F566DECEE29D083EBFF12668392F5F4D Amdlbsw9
810,150,868 *54190F4DCA1659DF9241CD935AC41DF94B5CD7D1 AmdocsCom
810,150,869 *541C1028AE77B97FD0E68E333BD716F7A134A302 AMdPs
810,150,870 *541BFDA9D717CD9F3B75BB655BB89D40E11844C6 AmD-t
810,150,871 *54140F91BE64443547C4A57D3F1B1ED9DD0EA88D AmdWW
810,150,872 *5418F64DBD4CF0059DB17AF140F26C2B455368C9 A/MdX
810,150,873 *541078AF8C641A93811D59005E2C1BE360C8316F amdy-5032
810,150,874 *5412470F95A7DC095A10A812FF39E8EF6D476283 A;M&e
810,150,875 *541162CF0CDCD2074C88DFD0CCDC44694F1A9C35 Ãme
810,150,876 *5416FAECCC5EF4506D340CB3BB672027926FF3C3 AME0)
810,150,877 *5415FC310028EC27B606AF83115CA5FF1E33BAAD [email protected].com
810,150,878 *5418F09C899BC12AB59565E7CCBF029041D1C072 Ameaardes
810,150,879 *54179E54D3EAA6AEFACE4A213C4B3A4677DDE370 amealhados123
810,150,880 *541F2AF7E4299E7DD5B32E04A7B2EEB55BEEC0EE ameame:apiaca
810,150,881 *5415544A94D3701041DD256312A3092763C958A7 A.mEC
810,150,882 *54150258505B05AE0A27ECB598C00ED53F3BD910 AMe$D
810,150,883 *54102D36442BAD2BD805470FA01A6BC828C95FDB [email protected]
810,150,884 *541C633B51DFB304B3FF2C02706FEB504F666BC0 [email protected]
810,150,885 *541802E31B2F3D9FD15B4F78AC81AD15FF4321D3 Ameetsys2
810,150,886 *541D0117FDF302EC7C86C8A93509898CE064E944 AmeF!
810,150,887 *5410F2324A4F3A51F92F97B3595791151DA1B8E0 AM,Eh
810,150,888 *541E82EC79518DA6EF388EB450A4390322B6D783 AMeHO
810,150,889 *5413D8BF2642C5A8F508CA2E48839A0B2EA404E9 (AMEI))と
810,150,890 *541B53B9A24A81F9E29E32E9AF4845DD9987CAF4 Amek%
810,150,891 *54164054D40CFB9F9F8A298CE36AF9B966A2171F AmekC
810,150,892 *541C00CC24846A3FFB3FD7C5BF638EB825C31771 A+MEL
810,150,893 *5414695C2890DEFA28BE92044723F0B8E643AD47 Amel10rate$
810,150,894 *541D5A64BCE6EE585504B30ADAEC048D92A58555 Amelgadoring
810,150,895 *541FFEF8C231E57B7B478E43B4EC8A8A2B8940B6 AMELIAISMYBFFL
810,150,896 *54193EE0B37A72A5F154A3EF1817299E3392500A Ameliedodgers
810,150,897 *54120CEFF0D7A17D43806875E82FAAC0DCBEF078 amélie-lisa
810,150,898 *541C5355D9CA81C65888358981F7390649BAAD48 amelioriez9
810,150,899 *541B77670647E4A96BF043AD392DA7338B633387 AmelitaBaltar
810,150,900 *541641048D776A28993E1B61ADB0442E87E53D7E Ameltneg6
810,150,901 *541A79A3A3761B9D93005BB09BD16424775F79D3 amendâtes
810,150,902 *5417F90578958DC9146B7688A9A70033F4C96F51 amendato1
810,150,903 *541604F3877BF87A77B3B10C534A50EEA06F5416 amendedrainer
810,150,904 *5416B054289A2C7ED9CE85C3CC8073703D1698B4 amenderas9
810,150,905 *54123DDBA0A1D9C7871B8386EB7A2C9237E666E3 amenderont9
810,150,906 *541AF1EB80E9E114BF2DEDE6670EA4A3777049FA amendment.2425
810,150,907 *541D4F1FEAF2A2C31440B3BF56C428898A28F0B1 åmene
810,150,908 *5415ABD9EAA7A52EEF675EA715F33F5BF23E1444 amenerons1234
810,150,909 *54150DB5C6CDCA5D12B7A57A4BBF03CC9772258A amenia0
810,150,910 *541FEAB1D9A216DF0BB5119955A3A7EE4464466C amenityservices
810,150,911 *5417CC45D8CC085AB028ED57FAC3A97406477098 AMeO,
810,150,912 *541E1464F560F6EED687A9B7E6977D275D04E20D AMe"P
810,150,913 *5411AA2709E5502D0DD98213E4EB5D6ADE3FC6BE AmEpZ
810,150,914 *541B2E645D2461ED5D69E577B2305D77E6F4640D amerartist
810,150,915 *54199E0E8F785832EEEC1D2BAC9FEA3F91663216 Ameribanc4
810,150,916 *541408C01EE7155336BF6A1BBA62B7618CDC0D02 America048
810,150,917 *541DD7EB087D80A6B91B3CB3CA42DB433F24A141 America929
810,150,918 *5413E1321D6283595BEF4733E4DF2E8EB6C6E8EF americalaser
810,150,919 *541E8DDC66A869FE3697C151363710E2882E21D2 americancustomdrying.comwww
810,150,920 *5410781D345116344B3ACD290EEBC3531FE3BF42 american_hardcore
810,150,921 *541BE9674769C27FD31C3BF01364758A06A488F9 AmericanHistoricalReviewStruve
810,150,922 *541ED9CA7C7B2AD858A5D9913DD2757BEB63D10C Americanistiche
810,150,923 *541ACA76B04729280ACE446911EE9BA1BA3922F4 AMERICANLAKESPB
810,150,924 *541EEE6869CD79CC1F047857A4DAE3DE379BB59D americano1927
810,150,925 *5414FE4F5614D152ED84BA7CE8F061F9A53A279C americanprowler
810,150,926 *5417C3082A8FD4138CB63FCF33D0F454FAD9B054 AMERICANQUARTERLY
810,150,927 *5414B207F3B539390B835F9ADFBC32C16E9039C0 americanstallion14
810,150,928 *5412FC949B071AFD00EE865C10B4C76DDAEC4184 americanvisions
810,150,929 *541045D7F8C2EF828B63322325492229E90A173C americanwheeze(live)
810,150,930 *54128E5823B0171B40EBF48F442BB3C64D31B1E3 AMERICAS-BEST-THE
810,150,931 *54123A9F1F493F36FB25294B41252D62774E3E4D amerifax1
810,150,932 *5413686D2DB9E8441DC7B2E3DF907537430B4EA9 AMERIFLEET
810,150,933 *541B17743CBBD8E2845CA716BD8E88A3B5367AFF amerıkan
810,150,934 *5411B7C83D8A5503852AF042CEFBD412B3FB8418 amerikanerhasser
810,150,935 *54170FAE4ACBFB860D0F6C9FA9BB37381D37EB70 Ameriland8
810,150,936 *5417F1B609C6D4CB85802896FE6F8242CFA4DA3B Amerless
810,150,937 *5418D3849A2EF46807FBAB3BB531FF33B9C834E6 amershan8
810,150,938 *54141066C1DEBCEE53456DF551D39C44DE5218C7 amertume0
810,150,939 *541BD118E5998AD72B828BA842728F7E9747A703 AMES DEPARTMENT STORES INC | UNITED STATES
810,150,940 *54104F5BD5B27D3FA6B614BF14BE82C47116AEA2 Amesiams0
810,150,941 *5416370953DB65977E73A7E1E34CCA0681C972C9 Amesov
810,150,942 *54173A4083BFF05F878FC838EC0F9F40757F8DFA amestala
810,150,943 *54159CAE6812A3AEA78F4B763D56FAD2A04D78AA ametabo1ou5
810,150,944 *541BF6DF8A2A2B817488BBB07AB98FA040D8C985 AmETH
810,150,945 *541DD98145AFEA5486E00490A1264E8A6557FEFE amethystroad
810,150,946 *541B873C0FAC10C972548B2FEF32C8EE7D6552EC [email protected]
810,150,947 *541972A512D0CD0AB8CA927C732304F0D809F4B5 AMEUTIEZ?
810,150,948 *5411CEB88537E31A21F37D00295EEED774452670 AMEVj
810,150,949 *5419223517649393DC5D249345C05E11F0B17F2D AMF1621
810,150,950 *5418678B13886F68CA9423EA8590E9DD13A23A2C Am/FC
810,150,951 *5417352D163FE4B427A2789C954D39D5648063F9 AM%fi
810,150,952 *541DC3E7827F35E6DF6825C79AF81A0ADDBE36FC AMFIPLEYRH
810,150,953 *54182815DDD04EDFF950FC1B7147580AF985E684 AMFj9
810,150,954 *541B21165F5678E95832D7AF51B0781FEAAC20BC AMFl)
810,150,955 *541B707E0BA74169BAFEE3884D6E53FC78A1DC2B Amfl9
810,150,956 *54199B3F36C3B6E772549FB9E18C080F5678B188 AmFo
810,150,957 *54120B8B5C8C71939372C4BBE614BE548C8189D7 AM;FR
810,150,958 *541D2374194605835A47313376224E7A0FEFCD53 A_mFT
810,150,959 *54132F067C66405DC8CC97BC34E8B8F0D01CCE10 AM%;G
810,150,960 *5415B7F6180DEB60FD2693A252E8F31C8A50A043 A%M.g
810,150,961 *5412CDCC57E32EF7B1BC676D9FE76335A8BE3A3E AM,"g
810,150,962 *541474AA010ED7FFAC16EDD2DC055C2C446F86AB Amg&M
810,150,963 *541BF81B30B82EA6C4DD5E074548B9DB29B8B9D4 A
810,150,964 *541807C250F947180EAF96D4488F48F5FE07F4F0 A-mGT
810,150,965 *5416FB6091B78589688F8A27FF3187A8D0645CC5 AMguQ
810,150,966 *541C404C356679F3C6176454CF77F32B00866559 AmGvQ
810,150,967 *541967568223D00DE34D7133BDFCD139E6DEC433 A-M+H
810,150,968 *541993C780C31F90A77CC86649A39579D9DE25F0 AM).H
810,150,969 *541AA94195FAD42C5547FE9330C3556403A95927 AM)H-
810,150,970 *541028297AB51944A7F6C133226D6D5E254349D8 A&Mh;
810,150,971 *541D134E9533D78CF76B193711ED6BB443A5106C Amh1e
810,150,972 *541282999A9D1F0056098A4670EE394C65A1274B AMh2G
810,150,973 *541E7BAE37518FA86563E8D51773EE69AA941A6E Amhaftem1
810,150,974 *54152153369E7595ADCD1463AF415D1454BCC13E amh-app
810,150,975 *5419411A43C209A04A1BE156AA8EACD10AC0AFBB AMHCb
810,150,976 *5413DE871576DE0BFC9141815AAB7F569377E5D9 AmherstVIA
810,150,977 *541B54899394D9B28464345615B7AB383FE9ED18 A$mHH
810,150,978 *541418BEB5507E2BD4219608794A6F04AF364AD5 AMHlC
810,150,979 *5411F218B106C3A32A2B8BD27D598311F6098994 AmHq-
810,150,980 *541795695B106E3147DDBAADCB712594232BB93F AmhtR
810,150,981 *541F6B5B1E9C14928B95B1671C28C35AB5CB389F A%mi0
810,150,982 *541206D0953D916CFC8B45251DBFD8BFBEEDACD9 Ami92
810,150,983 *54104C2A4091121D5BD4F143806F0DEE64727748 amiasoss
810,150,984 *54180F1698CB318DD39EB75011443611ED027156 amicabilies
810,150,985 *5411CDF0BD1A3778949399411FD947421065E5DE amichals9
810,150,986 *541A26E90881E32815C45EDBB172DEE3586CB9BE Amidavad7
810,150,987 *541AC67D0380A9946D9C858C1AE4A489436389AC AMIDOMYELIN7
810,150,988 *5413F2111DA9DCC4B7951440F9DB4C7D604B6D9E amidsummernight'sdream-weddingmarch,op.61,no.10
810,150,989 *54103AE962D57AD1CD1F5F1694FFD40B36A30574 AMIFD
810,150,990 *5417D6D9ECB45C0282A47D4B9F552D67D8AF1F7F A
810,150,991 *54149431F922331388407E4AE863594EDAB7EF45 AMIGACALIFORN
810,150,992 *541F1A31DBF5E92B0D643368DE0C7A8C59E8BD33 Amigahola8
810,150,993 *5418A96DE581248856D57E15E835B040CB118DB5 [email protected]
810,150,994 *541F39E71239C184B8FAC862FEEDD9DCC73EE6CD [email protected]
810,150,995 *541B4CDA177FAA4FF5BBEDBA0C5C465E06022892 amigapackers
810,150,996 *541CFD7992D1E026E2F33803A31EE8FC8C6A20B8 [email protected]
810,150,997 *541AE1513437BDCBAF5310D6AA896ED97C432CB6 Amigo (extended version)
810,150,998 *5413FA1A109114B162DE3E986D4D2B6ECEDA00DA AM:ik
810,150,999 *5417485990F6E584A1F1FAA01074846C7B7EAAE9 amilouns2
810,151,000 *5415EB44F2B702AC77977C096A176B9A8B862B15 AMÍN
810,151,001 *54189F3B60D5541F33A4F03C0D345CE5A8B533D1 Amina516
810,151,002 *541113835A6F07FC12140E3AF417C4D4A22A2402 am
810,151,003 *5416CB5A229430C5A27F493057F85371914864F1 AMINCISSAIS1
810,151,004 *54179B7D928E1DF6C0DEDA8695B3FC9ECC9162E2 aminerizk
810,151,005 *54167FCFD5F2B2DDA0BAA4B3EC12659BEC539561 [email protected]
810,151,006 *541CFEE722BD590AC9D038984122EA1844E284CA aminimran
810,151,007 *5415CE578DD6669DCEDA120C560BD6CFD4EF3F98 amin nur
810,151,008 *541EF2031F4A2E47EB9BE13D8D71F85C048C827B aminopan
810,151,009 *5413EBD45119D240D0FF7614CE7A091F412EE98E Aminosäureester
810,151,010 *541EE1C958B8491E8F4A6BFCDB1CE1ED467E5158 Amintel
810,151,011 *5411B250DD23F5FAFD7DB3A8259B52D3DBDCA1DC amintrele
810,151,012 *541403916CD3A9FD9E9CD2772199641BFB2B465F Aminuria1
810,151,013 *5412B384344840A72936B924E996B2E9CA0C7D14 aminwadhwaniya
810,151,014 *541219063D84F4CFFAB1BDD67732046A503E9D26 Amioitla4
810,151,015 *54197DE602858F260C6BA7FF68CA6C5388B17BB1 AMIOTS
810,151,016 *5410E955B009F0A836DCF0FFA7B5806DDCC8CCBF Am)Iq
810,151,017 *54186BB303AD46A551BF0CD7B52053EB79D59E4F Amir24
810,151,018 *541D6A359FA704930104804F8F7CE64EF6B9E7BD Amir519
810,151,019 *54180BABF93624FDBC5C0919C967857638A42268 Amir578
810,151,020 *541FDAC03ED5CCC85CAA1EDE37226E6F854DA2ED amirah675
810,151,021 *541F59F968FB4967FA2B01FF2EE27D547FD5E6A4 Amiravat4
810,151,022 *541772DBE28ECE77B678E14A3817B89CFECF2830 [email protected]
810,151,023 *541B9E5AF857D81732A826A1BF0A9BCC68A3065A amirlao
810,151,024 *541258AAC5F9921438D788D554893EC691ACE8C6 amirpposes
810,151,025 *541CAF86C5591418C038838D63DB47B015AE27BD amirul_91
810,151,026 *5416ED751975BDCE7FEBC3417FCF95DB503731D9 amisepstein
810,151,027 *541AA4AAA08A9423211D627A50146F6BA8564D51 [email protected]
810,151,028 *541B7B02CC26F5043775050FCD18AC4E87968D80 amissionum
810,151,029 *541ED2BE1D7CC84648B707F00018AD3E9C88D243 amiszulprid
810,151,030 *54121335C6D8E12D1293DC7C08F2F617B4BCB869 Amitaav3
810,151,031 *54102C353120A5893AE2121336F633C035BDEB46 amit bhadoria
810,151,032 *5416AF09B0767EE44F4182575AACAB080AC8BF28 amit chellani
810,151,033 *541B8731A7F76D032D5881816365151A0B43C714 amithaba2
810,151,034 *541DE29DF3A1EA073FF306E4A2E535C675465AD3 amit kasyap
810,151,035 *5410B5682740AB90447B6CD6B0AEBF773D01678D AMITO77
810,151,036 *541620A854D937836E56B8C96FD6C322BCCA3B5B amitosi7
810,151,037 *541CB548C7FE50523762AFC9EDF6A5A23D72C8B0 AmIWe
810,151,038 *5418719983CB779211A47617308A48EEF4DE8068 A,!mj
810,151,039 *541D0162C4A970B694DE8661582569D402534852 amjad sardar
810,151,040 *541ADD81B46799196D4519E6CC174CEF678C6062 AMjCV
810,151,041 *541544433776EE6C96F9E7BD137278167AE8A406 Am
810,151,042 *5413EBF4B7389DAC2C95C16C269A269CD431020F amjidnew
810,151,043 *5410D85847EE59BAF9C090CF9E8A174FBDD3437C AMjm)
810,151,044 *5416C4DD0EFBE02975C4B2BDF578261A8F8798CD AMjo9
810,151,045 *54179C2166E5214F6D344A0F27DFEE5238500705 AmjT%
810,151,046 *541A7274BF19DACEAF873DF5C2B9CFE5D74700D7 Amjt,
810,151,047 *5412EA56728CFA619020C46BC568138D28FD7E2E AMjvi
810,151,048 *541791C13998EA07E39896481686FC64780DDBBC A,M.K
810,151,049 *54112BBB9CB53A2FE76AE90CFE66EDDA5134F8FA A$$MK
810,151,050 *5414C7FE63A77CEB501855F5019A153BBF6F7318 A.#Mk
810,151,051 *541425390DA1F7B0267D42D35AB4882F0138280C AMk?_
810,151,052 *5418C69EA97228961CD89F7D2C0DF843B8ABCF56 AMKARSTRIPES
810,151,053 *541756162C079D3DA01A3934DE6BA0B9982DB932 AMKBB
810,151,054 *541FA6CF03DCECDB17C38A01EFDF7D78CA1A40A0 AMKg$
810,151,055 *541407FA8C7DF14C27F3426C3558921730BE9D69 AMkH/
810,151,056 *5410AD2E617D2C6175573171D489D9FD63BD219B AmkjY
810,151,057 *541539656B833934F0F38B1878241D14EC56854B AMkkb
810,151,058 *5414532404AEEAFFAA7785B3631FCD8786A5FD5C [email protected]
810,151,059 *5416FF00A40E5D85E687406D42279B5BF65AC8B7 AM_kU
810,151,060 *541B03717F1599427243FD59D584AAEF54EBE8E8 [email protected]
810,151,061 *54151FEF3B7A9DF7E8FBF26BC825E10FF01FCECB A?Ml,
810,151,062 *5411C32048E3D9599D73AC386DFBF06076FFC529 $aml3po$t
810,151,063 *5412F77C2EC45DC66DD17BA40FD36CA6498E1E0B AMLANIS
810,151,064 *541F2E788DD9B261CD0994505D288E2DC3D69B75 amler719
810,151,065 *5419FA42422A91A982666AC1D14C6AB13DA7B3C1 Amleyouna
810,151,066 *5413C00689B77FB68EA349479DD877A87503CEE4 AMLg)
810,151,067 *54140865850056A832C70045FBB15B3B48C73CFF Amliure
810,151,068 *5415742FC858521241C66034B87883D4741B349B Am:lj
810,151,069 *5416200ECCA0B64FFF299405EA76B472E80AE2F6 Amln3
810,151,070 *541BBAB7E4FDAE920BA9390DD00C748BDCDC37EB Aml.o
810,151,071 *5418464DB9D2BF825B9B435290DF07F4DF4CAC09 AMLODIPINE-A
810,151,072 *5416E2FACC96268F4E58B3CDED9ACF0EC5280946 AMLWN
810,151,073 *5410383198CC37C81E83C4B7A6DE39D05195F0FD A/?MM
810,151,074 *541DEBFE082610EA1E92BC46B5A4D67B2A46BEED Am:M
810,151,075 *5419D0726A94774E2901633C9FA61109E682F55C Am!:m
810,151,076 *541A758804BDB5C554CDB34571B593C6C53C09BC AmM5Z
810,151,077 *541F9670CF1BA425531C41CD8C960F84D7940E90 A
810,151,078 *5413DA5ECA2C3410FB145D08F35FAE99865895A6 ammacano0
810,151,079 *541B3243F9535C5EEE38D49F9359298CAFCCAFCA ammagamma1234
810,151,080 *5410F30CE5FF53DE6240E587BFF0D84EEABC02F0 Ammagsmk5
810,151,081 *541D24E896985563D1623E4A050B6A305197AFE4 ammaleraI
810,151,082 *54134442A4070EEA5CB48264D269C893F834774C ammarah rehman
810,151,083 *5410F0B67D30373B2C3C5F6174142DB4BEB82AB9 [email protected]
810,151,084 *541300C769475796A8FA6CFB254DEDE025760E62 Ammasodm7
810,151,085 *541B37649A4EB3C24536F3CB125289AC3C219C76 AMMATIT
810,151,086 *5412A68F99F4FF7361306C41E9E9682555047084 ammattilaisdomina
810,151,087 *5412A3E955DE4B2FE2D3D0E933A1F8DE19963B13 ammegchris
810,151,088 *541467AE393140BC363EADAF2BDB2054B288F26E ammelakens.
810,151,089 *5418ADCB5BFCF14830C48D17E9453F00C92E5876 ammende2
810,151,090 *5412384905D226E3E8197EA800142C38B8951927 AMMfw
810,151,091 *5412E43C45265863CBE2FA3488C0B3CED4A56469 A?Mmg
810,151,092 *5414D488A66BAB26BC494C9017992157B09AB7FA AmM_i
810,151,093 *5417182F65CBB2122B8B6DB5AAB2FF233C244603 Ammielin
810,151,094 *541BE8ABFDBF7E16768158F1114279435E6B5AD2 Ammiraju
810,151,095 *541437B13F49CC6F465648CB80BD5E5C6D50FBD1 Ammiriamo?
810,151,096 *541B80CB6D054C85A755C99C138B9C63A9542768 ammon+7erei
810,151,097 *541241AB16FB40E7FFF73CBEE87DC49D97E7A95F ammonietsoorten
810,151,098 *541CFC20B6ED90FCC49CFA2C0778E8246FE9515D ammoniticoning
810,151,099 *541F16E5394E3D5E9DEC48BB86F460B96C3265D8 ammoniumchloridnebel
810,151,100 *54150CA06A1CE7F99D25040FA20812490C70D442 [email protected]
810,151,101 *5413700CC7200D829D6D29FFA1B0B6BB7C83C224 Ammostate4
810,151,102 *54125936E47C4F3FD8525EB825C255F8D6217951 Am-mP
810,151,103 *54154B4642CA42D5799EF804FFFF12893C0ED213 Ammunition Matters
810,151,104 *5418BBEDB06D813F7E159FC26035719C6F68BB8E Ammusbsw9
810,151,105 *541C9321A7EDEBE1F04BB6F6CEF2BE52F79ED910 AmMusNovit2200
810,151,106 *541EE78CB2BF155DB9ACEC88B2110361C8F13088 ammutinament
810,151,107 *54119BDB71868B9544CCC7D1AC5C549A5FDEA193 Am:/n
810,151,108 *54140B20A3141EADC1C6AF6E2E3C03EAC48E57CE AmN(2
810,151,109 *5411382D157B7E94D12C690358A8854238217D08 AMn6u
810,151,110 *541F9BC384551E32436DB13C231166AFF36FF73A amna ahmed
810,151,111 *5418AF4184405FB18BF9FD448A161CF55EB72070 Amnabiti8
810,151,112 *54142F3BF66955BB35B11A2534018D32A0D10D41 AMnb
810,151,113 *54154C11BF915624BBFB470D614A3F80717AE2E5 A
810,151,114 *5415572A9D0AEF108DE802BDC2699C45E3F4C35C AMnc8
810,151,115 *541E08032EF843713BFAD4A4EA8BBCF35A478762 Amnester4
810,151,116 *54125418F830A24EF86F44106FED37FE5C3109D2 amnestinae
810,151,117 *541C0BA5EDA85BE6AAFFB0FC378C000E18F9BE63 AMNESTITH
810,151,118 *541852275DF9C0FD57780EB10DBAB6C555AD1662 AMNESTYING5
810,151,119 *541F2D57CB7B3BC9509063F34C588F2F53EBFA99 AM%nf
810,151,120 *5413C4D7AE4A8F27DAF23357BE32CD95DBF3B10D Am!nF
810,151,121 *541C0B6BDD194A510EBD644B32F90A0DD2FA6199 AmnFW
810,151,122 *5416AC0523C1854038A6735BA692232FA8AF56BD [email protected]
810,151,123 *541A3D0184C91388CD4E348CCCDE40CC12995D7A AMNM2006
810,151,124 *541906D58C488312D84EFF9408A035DAD5F76747 Amnously5
810,151,125 *5418E8248AF2C29CBB5858DE576183083D9152E4 AmnTC
810,151,126 *541D392E5E84A161BD1C3B7F06BCFEC67E3B3C4E AmNV6
810,151,127 *54199EB6EF64D44BCD782FF5EF568AB70A122ABE AM&o%
810,151,128 *541AD0AC7C470D202DD3F1702EE953AC7ADEBD50 A_mO+
810,151,129 *54167181EB907BA74A105DBEE0C279481EABEC87 Amo9_
810,151,130 *541C59DDC1B09E751F62B277F10470EA90147647 Amoakuhesing
810,151,131 *54169CA0444FE189D91DDE01C1BE94FBA5F1EADA Am-ob
810,151,132 *54132FD58D5B96BAF0D3B3FC6FA8624AB7C47B8D Amobisaw1
810,151,133 *541A140BFC8DEEBB96FB736A048B580AB18F4F72 Amocimesed
810,151,134 *541F75B3A7D6E5231339BA3CC3184A3B9EB995D3 amodularlife
810,151,135 *5419AD8306466B555D4BF4583B644BB71951A798 amofinloei1
810,151,136 *541BCA89FBA5311FB91ADAF011DA46A2FD1A9A6F A=moH
810,151,137 *5417C72B7A3A033F6162BDFBAAFE551ACB4BB2B4 AMOISONIC
810,151,138 *5419D02B6EC1AAB4EF68EDAE8706316BCB2D468D A#MoK
810,151,139 *54109DB95DF4E3D06C6E1660D913C6DE3B6F9CAF AmOK
810,151,140 *541E6735DBD35FDB3941152F5C231F3614C6CC37 amolach3la
810,151,141 *5413B39FD02A381A76347E6EFCC43030DBCC051B amoldarekar
810,151,142 *541EABB63804B8DE1B412771B298D6DDE8B52350 amolentarte1s
810,151,143 *541D0B069CAA43EF636E5393D380142479F8AFD6 amolgarlhas
810,151,144 *541434966E5CF64CF4DECDC3DAFCFF2FA953CDF3 Amomanias
810,151,145 *541AC81B0FD9FC121B0A8554CA0731955D8D62D1 AMONk
810,151,146 *5413562496B0636C0EA632450FBD9619CC554293 amontanharte
810,151,147 *541A2A31A35DC7D0360994EA5CAE639B94423928 Amontino3
810,151,148 *54197D9E5C5E216B812A2FB7431F11DD8F20879A amontlo1234
810,151,149 *5414907299DF5D1E2881DDAC2EF44DF042978069 AMORANA
810,151,150 *54158387368507C34399FB70DB66DE7BCD6B206F amorcamorce3
810,151,151 *541F21C2051C448DE297A7C2D52F26A80582AE85 AMORDEOTRO
810,151,152 *54144EB90B9D4A406ABED9D567BD4ADD2BD4AB07 AMORE4SUN
810,151,153 *54168784830B75123C9FEFCD03445D9190418D46 amoresdelguadalquivir(sevillanas)
810,151,154 *541C7BCE9152C8C9D86CA8831705F209D1618C94 AmoresPerros(RareFormRemix)
810,151,155 *541831A1AB269D298670352DE8C68BC576D78D82 amorfinio
810,151,156 *541D15AA97FB7E7AD9DF1D118402D9A6A9F96EE6 amorfuego
810,151,157 *54193F275A2BBD7D69BEC9A8290C25FAA2766A2B Amorphou$ly
810,151,158 *5418EFAF7DFE595DF8E64AEC02B3C6E08310E35D amortiarse1
810,151,159 *541FEF39E6F1B2EB5350B2B877ADD06DFD174E97 [email protected]
810,151,160 *5413F7A98C2131134C1CC12D0F74611192DCB612 amortizvel123
810,151,161 *54116F11EFB23F4994007783AE3A2183F5C047E5 ¯amôs
810,151,162 *5415BA37D33FBACA6DA8939B6A5C74FC837A0893 amos.bussa
810,151,163 *541FAA72A7F265D803A95B237A0FEB0AA9DDD5B1 amos.canizares
810,151,164 *5410724E98EEEE191C6A5901FFDFEF789D37FEFF amos.cayo
810,151,165 *541170E675A1AA5C5807B01766FEB9BFE29D4FC8 amos-cherniak
810,151,166 *54172B429410396A4E238328A22727A24C15913C amos.cicale
810,151,167 *5417A807594F0381F1937EEBF5C558FD5D6D27CE amos.clive
810,151,168 *5411F3F0126FFD248C582B9C4C83CDB8C867A34C amos.degeyter
810,151,169 *541FA8555C8E52AE26BCDB4C58DE4204D66F32CC amos.delaglio
810,151,170 *541A5ECD07B022D8A50003A8A6AD981435B5B561 amos.dutson
810,151,171 *5416731167BAB555D2096AD31E360B617FA2EDAC amos.emperor
810,151,172 *541B116DB68F61F0B7D0E41619B4B35106F1D66F amoses1234
810,151,173 *541AEDCB1C1B7DF005045143A023C2F60E2851DE amos.frankenstein
810,151,174 *5415E9F70E52DBB0256897046C04E11792AD24B4 amos.gerty
810,151,175 *541BDA895CE24879532534182434606A680D93B0 amos.hutyra
810,151,176 *541139DB80FCC5D43D82F8658225EB5641F8CFCB amos.kempen
810,151,177 *541849B0830D280159B4DE4FB4ABDE24DE48262B amos.linde
810,151,178 *5419E3017041FE63484EE4D605F11CD3D461DDFD amos.loeper
810,151,179 *541ECB2CDBDD2F5FCFAE06D1DD66AD905D6CD358 amos.pahnke
810,151,180 *541472596FB779D83C6B16DBD03E278B25878DEA AMOSPO
810,151,181 *5412573A8A75FBB8A6DA429239923D657103B465 amos.recupero
810,151,182 *5419D4DEB0D296A62307519556A1DBBE5328C9CD amos.skorupski
810,151,183 *5413D870763F820D62B8066D2E273A83F49972A0 amostarant
810,151,184 *541E9FE2AE19B9ABCB5A968D5532641962286FDD AMOSTHECA2
810,151,185 *54164C56294F527D4B09989E0C1D24A02D51E7A9 amos.vandenburg
810,151,186 *54176609AE881293F8FE1672724BBF86016A7187 amos.vanscyoc
810,151,187 *541DF0043322E3A2C6BE0FC488CBE72B17387DA1 amos.zavacky
810,151,188 *541AF39BFD978A2AF8DCC31FD246848C5DEE9CC4 [email protected]
810,151,189 *5415776FE5263F8F6A8AB91AEDFFC4171C17C756 amotameahto
810,151,190 *541E81E896D51F74FB8B48FA8484D2A144DA7BDA AMOTAMED
810,151,191 *5416274370D2060AB10A127639401D9E22133B0D AMOTDI
810,151,192 *54155302093BEDAAA0DBFE2E241205325E24A8F9 amourette1
810,151,193 *54121C96054F8B112FE6E5567356E054B857AFC8 «amoureuse»
810,151,194 *54183179B241E5E3559C303C53A8217A67271121 amourplaton
810,151,195 *541C30824EDF586E08AC3663977ED9B0ECCF267E amovem1
810,151,196 *54194152EA5FB1016C0E0B00C5D9F3BEED987AC1 amovitam(radioedit)
810,151,197 *54121DA2839D8B1E42885F563DF1909ABF7D0D24 amoxbsw7
810,151,198 *541376B19358AD7CDEB40A4E8213C963B9351BD2 AmOYr
810,151,199 *541CDD5981784EDE21D15106C4091D7A49237D36 AmOZ6
810,151,200 *541C0B9CA1579702C02BD589CECA3B163A39DBED AM:%p
810,151,201 *54171185BF8F12F36821E545035EC387B8E98A54 A%;mP
810,151,202 *541B0CB285402902AD34650015BD0DCA77699EF5 amp0000000000004103.
810,151,203 *541011310CB1B5BC8A0A3FDFF717930FB7C984B5 amp0000000001410863.
810,151,204 *5410AE4F3A0326752740220CBA69936879E9B743 amp13906
810,151,205 *5414888D3C763A38C17992209C5D1D3B6354759F amp19604
810,151,206 *54140B2E778CF714A290D63359CB14E15B48D09A amp422
810,151,207 *541E49F2D7E15A4B9434E6FDE736708BA52A123A A$MP8
810,151,208 *5419A27DBC07301EBAE9C0E58F7CA5D7A3B6B0A8 ampampamena
810,151,209 *541396DA35EC05D33408547246E527A209C98D87 AMPARO54
810,151,210 *541C085F20DF4E3983A55AA539D9DA7A3D2FD10F Ampatored
810,151,211 *54160CE07690373BE7381F0D9B5F2913993FCE1E Amp?D
810,151,212 *541411975EFFC3890271B1A942968E03B654563D ampdemup
810,151,213 *5411BB85D3E40F0F3407BB204B4BE3C57B318763 Ampeepma7
810,151,214 *5417060F7974507AA884A13563E723E9426B2735 ampelised
810,151,215 *5410F8C7878267FB4A125DA4697EE45A93A76676 Ampersand6
810,151,216 *541995286035C05B74931BC0BAE38149873B7582 ampezzského
810,151,217 *541205F6C4A5F401C8C173CE80586D1B3C8CFEBA AmpF7
810,151,218 *5419F78CB2F05C6EFE34A2DDD665D6262B23B6C5 AmPgZ
810,151,219 *54171D2CB7A721A8C908A5A9DA55B2AC968EE0CA AM&Ph
810,151,220 *5416D813E040AAF779E27065F195CE9F541FC501 AM/ph
810,151,221 *541B48963938FB86F661CDB16A0ADD6FEC459524 [email protected]
810,151,222 *54165DE235A093C83125BB2C85E3C5F2233B4FF1 AMPHIDAMASS
810,151,223 *541FC9ABA3EEC1885FC06EA2A514636E0A00D63B AMPHIDISCOPHORA2
810,151,224 *541B1FD2E09434AE55F28FFB699503BA4D8F3DB1 amphoterismhas
810,151,225 *54149AF327E8687A4116EB68BF3E1F7E0EA29618 amphours1234
810,151,226 *541C658443C56005DC94D89844FD62B01BE3C5B2 amphytrio
810,151,227 *5415136B25C07ED9A29AFA79820F367EEECAC2B6 Ampicilling
810,151,228 *5413D05FEA4A76107D3C607A49ED951DDD4F4575 AMP+k
810,151,229 *541E5410E03C326822405D73F7BA636668005883 amplando
810,151,230 *54186A15567973D8EEB2E622B14256CBA2E4F019 Amplectant7
810,151,231 *5419D97B0E875272F1A472E6CF4FF09F629BB69F Amplica7
810,151,232 *541CE2D05606DF2DF890395E662CF7205B5A5A88 ampli+ud3
810,151,233 *541CB8D0AA24104AB69DABF5C740D04D1A28EABA [email protected]
810,151,234 *541576C559F6CF037D8848AEE05FEA22CF039DCD AMPnN
810,151,235 *541E38101889764988370260B233E3DB91251FF3 ampostansa
810,151,236 *54190451A298776441EB2883DE0FCE3905622474 AMp+q
810,151,237 *5419704DED144B8744F77D2FD17554B98920B50D Amps_
810,151,238 *54190C93A2F903AAC069CDF3569F89BD6F3E1FF2 Amputé
810,151,239 *5419BEBDC24EA178BE0B42F503BF334D6D762A08 AmPVB
810,151,240 *5410693A64DC595D6F614F60E89F9FC707FD2C1B AMPVF
810,151,241 *54168845897CA1D5B69485B30C34695F8599887D AmpWY
810,151,242 *541BC1C3A660754687A44AD8885D20DA6A208BDB ampx16a0
810,151,243 *541490631DD7B1B23425E7317233C197EE16C269 A.Mq&
810,151,244 *541F47A281891B73F404607B5E4728A7BAB2836F Amq-0
810,151,245 *541781A2B7B1DEC3BA5FE2ED4D60A3B6B2A9C8C3 Amq1E
810,151,246 *541A788C60280B6E043D44738E358ED112A13AFB Amq4)
810,151,247 *541342152C8444FBDCADC19673384DE625C15695 AMQ8p
810,151,248 *5419CAED1643CBCDEA14B17C7DD458B9CA49B156 AMqA,
810,151,249 *5417BC5C153D796795A2F73161DDD00ED022A8E8 AMQCo
810,151,250 *5414983D84F7B1D7ABBB2A20B0BE5A4CC3C14473 AM_qK
810,151,251 *541A6B1DD1C9EBD520697743734284E27D0FC12B AMqnh
810,151,252 *54151F7E659BCFBA5E79C94B713D879FAB689D13 Amq=P
810,151,253 *5413786146B9E5E8443DBB218571DF8038E4DB5B AmQQs
810,151,254 *541E63F9AD583681A0518B73201CB84560B478D2 amquests
810,151,255 *541F77D1C840C3B9B0F9F49149AB44C99D8F8198 AMR2"
810,151,256 *541305957158E58F06CE2F96C5A17221DCE4FE28 AMR;9
810,151,257 *5412280F21286C3155C17F562DB203EC54829F9D [email protected]
810,151,258 *541718E7172FCCD06FA6C164F421E93E24C22A1C [email protected]
810,151,259 *5412520963D86CECC888B7E436195F1446F2278D amraomeragic
810,151,260 *5416FF59D60D6D30F43F2CE1D3ABE04610C07649 Amraooi9
810,151,261 *5417191FD31C44E5F3375F7F3EF239FDCE3CD0CF amregni2
810,151,262 *5410ECCC7935148F23ADD9D83491692CF74BD337 amreican3
810,151,263 *5417FB4A437488F6996D1AE472A6FAF6EAC43C1F amrgogo
810,151,264 *541F89478FD604211AAAF8F013A63B1C1C8A8BEC AmRHj
810,151,265 *5416540B3E54273B67473CB4E69258E85BA16986 Amrmada
810,151,266 *54152943EAC103756F7A78E1987C7E2CCD538772 amronsilkyterriers
810,151,267 *54164EA5FDC4BAE8921A05799A7C76A52893ACFE Amrsbsw0
810,151,268 *541D9B91C522EEB4D4DE32CC753709FDFEC71715 AMRT)
810,151,269 *541940B03A2BF74B36211B9262D9DE8642FED481 A%MrU
810,151,270 *541FF073CC0A053E79634B163A5D5E1C69ED8C3D (AMR)をベースとするマルチレートの広帯域
810,151,271 *54137CBF10E386D178286E60C3EC1A85B097EAD9 Ams)%
810,151,272 *5410BA543A3F07B7EC6564779D5363F15334280C a;ms
810,151,273 *5412FC996BFF7D79947E51B309DD582D4E0B1068 A/ms5
810,151,274 *5416DB1E76846E4E288CB9190A9797D8B5953A2C A%MS8
810,151,275 *541E2607DCD3FC12BC46BFB64B7429A1178949D0 AmSCr
810,151,276 *5415AF868A8A8654B0F4A9DA792F7E3F9D13DFD9 amsingch
810,151,277 *541CFBC1DD215EB33EF4CEAC43BD56E1302C8179 amspecialcontributio
810,151,278 *5415A895FA36250C194144E96112795298F5DFE1 amspick1234
810,151,279 *541B73F45B664EE58A6CF7C77448AF0079D3FDAF AMsqA
810,151,280 *5415FDF2936CDBC70217768A6CB8E498C3A173E6 amstemporaries.comwww
810,151,281 *54174327DF33822B5CB6B4615FF98EDEE0EE28AE Amsterdam–Flughafen
810,151,282 *54164CD8A0165ACD1CD45445B39C7D6F8DAB6DBA amsterdamtalkdoor
810,151,283 *5415A77EF1B6C4683300F21FAB346228E5DCB9E8 AmStrande
810,151,284 *5411D8C0694D5445EBCE1DA67831F1B48FEBA0C2 Amsusrucing
810,151,285 *54181FCE759BCD9651735C99B26B552C96705B75 AmsYC
810,151,286 *541C4DBAB9DDC1B8D551E911D8E8B6AFED785E9C AM_(t
810,151,287 *5415E8C61CCEA78B7284DB881789086D14467F53 Am?T
810,151,288 *5412E0823871F324AEE6E35BB57724E1ED904686 Am%,t
810,151,289 *541762B1EED2D49506CA36E880179DA2CD7B5937 am tag als der regen kam
810,151,290 *541C85C73B1654131690DADB7CD8417763C707ED amtboizenburg
810,151,291 *541072FEB0C279F8A76F2631036184DBC24B435C Amteihcsing
810,151,292 *5417533CFD217ABA6C063CBDDE2FF28E40F9D2B3 AmTFB
810,151,293 *5413600914C615C0383F5F9F7458BF3C69986767 AMtg8
810,151,294 *541B0A62D72DA86B0488C88412C0DA7EB10F86A6 AMT?h
810,151,295 *54196EBF71C14A766B2ED0404D2BBFEA64BB6D85 Am+Th
810,151,296 *54178D31751C5FE8F51C6022705CC66CDFB2DBE8 amthyst3
810,151,297 *54189F8E8689B767C85B79CBF4F0684D2A094382 A-mTi
810,151,298 *541CAAAD969372C82909567EAA0D6451BA97F6A8 AmtmY
810,151,299 *541477DA92FA54E158B8A3791BB8FE7D94316CC2 amtnord-r
810,151,300 *54197CD2C5CF31323A029C6516B89DF20DA66E06 [email protected]#Amtrak
810,151,301 *541B0F5C213ED6049F95090000386D05B53F440D Amtstr
810,151,302 *5415D626FD04966BE67CB038637DF585E26EF3DB AmTsZ
810,151,303 *541FA8E652FBFFA344FC848147AB414683E21D8E A"MtT
810,151,304 *54171818F242B9F7A35F692F42EC9E46F6067286 AMttm
810,151,305 *54127DE66860BD75E67AF146A11C0BCEA8870DBB Amtverhältnisse
810,151,306 *5416417603ECA262F8DF0AC8173CC4695404F56B AMTZg
810,151,307 *54175F15B118399C805C6C4C9E610ABFB9D8D584 Amt)を創設した
810,151,308 *541F9D9E8E9CA9611024265D3C22C031018547A9 AM!)u
810,151,309 *5410694B704AD047064FED4D1F3D40B7BBDF9BD9 A,mu3
810,151,310 *5413D9B2D0374D34399BF5AA24892318655325A0 AMu8l
810,151,311 *5415EE20D710305740E89BA9278965A4A215C898 [email protected]
810,151,312 *541FA0BAC46EDE9B017B8B7ED47D7D64A744ADB0 AmuDH
810,151,313 *541C344612973C80B5CC9B57FD6B37A4BB110180 AMug-
810,151,314 *541F6684F7BD4596F391D4BB156E417459323924 AMu$K
810,151,315 *54160A7777627474E2E3CAF242C35BF9079E248F AMULo
810,151,316 *541B1986EF024246C0C61A7A0910AFE96916CDB5 amultifaceted
810,151,317 *541BE67D4DBA6CB90FF8A18140F30D6F03089091 AMUq&
810,151,318 *5413563BBF08957E9CBE51D62F44E37D90F5CD52 amuralharvos1
810,151,319 *54195F5A327E88EEAF8096E13FEE2CA4E67DBBFA [email protected]
810,151,320 *54114DCF52F23E8FF59F029C9482632AC5C9C65B [email protected]
810,151,321 *541AB2330415C455FB208D8246E2146A16857724 amurray177
810,151,322 *541009C97BC247C2360FA2973D5EDEA7102D2215 Amüsable
810,151,323 *5419BEEBCEE2DB17A21DB3B01FEAD999767F0145 Amuseraient4
810,151,324 *541BD602E1C2085634C8C3BF61358E196B93AB0D Amuseur9
810,151,325 *5416B34EBD5ACAABD87F65DA2FD5C608B6924285 AmUUH
810,151,326 *541F752B129A9D6971FBF71AA7BAF3CC6D0629B5 AmUYf
810,151,327 *541CC37A558347FDD169F142FFBBAEF226452276 Am(!v
810,151,328 *5413970473E409031F5569D4FF0B439CE698D9F5 AMV_2
810,151,329 *54106BE1F8904C9BE57134E14475C22CEBDCCE35 Amvccmc4
810,151,330 *5416E953D13F19014DD80F1EFB2A7C5D6708ED47 AmVdS
810,151,331 *541CF299E4234835F7F4835F94FCBABAC918B977 AmvDW
810,151,332 *5419D2A0CD029253626B283CD510A6DB928EBDE6 AMVM&
810,151,333 *541EAC1E2648896E7BDDDAE1EBF8628FCC860D27 Am/w&
810,151,334 *5412A00C3B5C4BB15B87CC696DEC176ECF9ECCE2 AMwav
810,151,335 *541AF2D7FB564982FE973848684285D4B3B4665E AMwcU
810,151,336 *5419F1CF48A7FE6770C3114C83846E016639ABF9 AMWD8
810,151,337 *541308F2999D2C53A56CC94F087F3A2027482988 AmWEZ
810,151,338 *5411EB7B943042F663921D619651270D997FFF89 AmwH
810,151,339 *5410DA2D18797564251DDB2E185473F9AFE7C937 AMWhB
810,151,340 *541B16EAEF019AC51D0C31EC8B37E4F850D938D0 AMWiI
810,151,341 *541D56E81BDE99766F0045296329CF2F7A0FFB1D [email protected]
810,151,342 *5413DD2BE26A51F8C9177D081CC16D8A228CC286 Amwm%
810,151,343 *541C38B4A51B73FEBDECDE41A2F02CB5F5B7DFF4 AmW+t
810,151,344 *541BDE939D0E81D549DEC6697D5AFC8E6A6FB187 A%m-X
810,151,345 *5413DAE112DAB7BF891F0324FC1B960180F7F733 Am=(X
810,151,346 *54127064DBB78B901E342733B495F3DE86BCE9D7 A:mXf
810,151,347 *5413F4CDD6D6171230AD7912C0B70A1D5E6E128E AMXj/
810,151,348 *541CB1A79903A3341D0B529EE5DFF197CDCADE5D AmXs,
810,151,349 *541EB0D291E19E108900A36AFC4FD269A655747B AMXTf
810,151,350 *5413BF646235C7DBEA4FC6E10B10A6D7280B70A6 A!m)Y
810,151,351 *54128F9D6949F45077D190B11D9BFF492E82C233 amy13grace
810,151,352 *5418422AC34A891CD25F96C577EFC5F487C3C63C AMY1q
810,151,353 *541FC833E830116B28D1A71D352498D0C9683557 Amyallen3
810,151,354 *541C66A1CABE7C71E5A29AC0DFBDEB22F8F255F8 amy amburgey
810,151,355 *541A20D84E896E9715657A38854053C89E97B7FC Amyaustin4
810,151,356 *5412AFB6674E1D171E2910E69EB19D061B719A31 AmyBenson
810,151,357 *541668344881C0F6C9E58130FD3F299471820EF0 [email protected]
810,151,358 *54148A8B1BC8F555D4E0BB342076930A39272AAB amy daudelin
810,151,359 *541B115C067975318614A6A20A2C390541020628 AMYDUNKLE
810,151,360 *541BFECD27ADEA43DC457F32F8D23DC36A295221 AMYEAFMCTLZZT
810,151,361 *5412C3B1889276A124BDDEBF96152105632198EA Amyenter7
810,151,362 *5415A973CD8107DE5EB8BAF965DBD542BE0D5259 amygdalothripsis8
810,151,363 *5412BD96DED220D196330CFB4F97EF8EE195ECAD amygucci2
810,151,364 *5416B05D04E441A690BC006532388ED8961CF118 AmYH?
810,151,365 *541F5DAC2621842337A5BD73E4A1FD7F5BE3DDC3 amy j bell
810,151,366 *541AB18CF04995C018DD5217E9ADB35E49A3261E amyloplastes
810,151,367 *541A1E44F5963D0943F46B3C031361F53DD2149C Amymeredith
810,151,368 *541B5C5EC573B94ECE1944330700B78E61A0AFD0 amy mummert
810,151,369 *541883C468EB93AF342FEEDA0C56577B42513BD5 AM+YN
810,151,370 *541B31D14C6FCAC4AE2B9EED19BD8F66F01AFB24 amynavardauskas
810,151,371 *5412D7E530BD7C9F1C9B602FFDD672E2E88D37C8 amynoelle_71
810,151,372 *541786CEFED771151023D3E2D43DDD18A7911045 amys21st
810,151,373 *541781577040FC186055E50F70AF29C6F617E1C7 amysclosetdeals
810,151,374 *5413E507A56202B0766B80EE2F27ED5E9FB5C8A0 Amysharon1
810,151,375 *54186D4F4E10E92FA80E0B0A71D21C09C61AB0E7 amysue12
810,151,376 *54160737AFF2FA43948CE620F4241FB8ADD13078 amy teer
810,151,377 *541CF6A812196B0883C0C6F692275EA1F6A1312C amy thackeray
810,151,378 *5412940B37725189F5252170DCC5EEADF445E6EE amy t tran
810,151,379 *5416AE1D106B3F84BB4CECD482E3D11FAAB4683B AMYUNDEAD
810,151,380 *541155CAD0897A722DCB10C34FF8C6EEE113F769 amy yingling
810,151,381 *54139CA439964175C7F2A5BF0906D0F5BB96F9BD A;MZ$
810,151,382 *541B734B1AA5E216FCDB835D11626C7002CD29AB AM;"Z
810,151,383 *541E496E00598062CA8412FFBDD7CE5846DCEB4B AMZ%(
810,151,384 *541D7118570C9F23A11ECE902EA9619030B98D6C AmZ0&
810,151,385 *541E98A44AC74AE4EF2B8E314CF1C33C5BF6A43C AMZBe
810,151,386 *5411D6C10A72484181EC755EF595F703288B3B2D [email protected]
810,151,387 *541A0893A44D13892C9C8D16A9EEC29EBB44E06C Amztasbing
810,151,388 *5417D9F9654A0BADF35692272018F5EFA99B023E [email protected]
810,151,389 *541188D5E540BB3D32EBCCA40917029BCEB01E99 AMZ!Z
810,151,390 *541F0EFF9418E06957529220BD72F8AC630A1860 A_:$N
810,151,391 *541FF31082BA4E0D077D5DD2E092B94B30111410 A_N#/
810,151,392 *541B92B9A7450F47C38F44D71595FA8A8DD0B6E8 A!
810,151,393 *541E48F074FBDED79FDAC7B5AAFF6F79AEE4E77B A(N.=
810,151,394 *541987417F150D2CCC1657007FE5FE319FC43304 A&N)-
810,151,395 *5418BD2D6671F98B3458A8A4D9239A584C2C2983 A# N
810,151,396 *541EEAE7B7C880514060F24E649DBFA2B2AF306F A%N$:
810,151,397 *541FEA758E3EC113842C6435D8FF5CD11B6BD4A3 A+N#+
810,151,398 *541605E470833996EDB720F8A2165038F3D7B7E7 A
810,151,399 *5412987AF3310796999885C566159A1F034B9FA0 AN'\
810,151,400 *541079305B3DC3139F443AB5B3CE221966B29AFE AN(,!
810,151,401 *5410248F06B058BC4B43BB4E4BF7443B452455E3 A=%n=
810,151,402 *54170E23FF61F1EFCFC937DF1F7B531654367A5D A_n;#
810,151,403 *54194CA5850762D1E2E36DA0752BE3AD19F446AE A_n+
810,151,404 *54176311587A0ED4D7052A8CCF1C1D33C3DE7C63 A-n-.
810,151,405 *541F5EB412BFD9927D63B00F0D11396A55B9DEE3 A;n(?
810,151,406 *54159F8D716884C3E3A5741DBD7A4C828EA2F3FC A!&
810,151,407 *5411DA1DCA0BA5824ECC60DC062C8B55D0BFC56C A?%n!
810,151,408 *5410D67066E3532B763589C132B536C66FD36725 A"n/
810,151,409 *54199BD0A64CA17ACFF8BF7DC387DD2FEA659A10 A%&n
810,151,410 *541334B18D4E47FA1E902A0133182817C8B05D6B A+n--
810,151,411 *5415512BEC8F8A3B9513CE64BB75DB12218690F6 An+-:
810,151,412 *541B55A25B80F3451778F9E03994143C6873CC87 AN07I
810,151,413 *5417F97AAB717CA53DFF1A1DF7F7B1EA16FE63AC A)n08
810,151,414 *54138E0FFC8C37E2EBEFE67BDE4F92FFB8709C6B A(n0b
810,151,415 *541FD4E59D597E75E84F0CCFE65BA25C0C1EC6E5 An,0b
810,151,416 *5414BACA8E0EC3336AFE09FD642ED6C934B7F13B AN?0d
810,151,417 *5418DD892F91792ABBB6956F104F0B380D1B24C6 AN+:1
810,151,418 *541166230F37BC274454E6C8CCF90261738104EB AN15N
810,151,419 *54115BB6F943FC7358C0C9360ED588A61BEF2F1A An1dI
810,151,420 *5411631429E5A9E15A516559D277E4B30FF7B57D An1l1+13s
810,151,421 *541F35447DBF7774A12FEF4B45864162109DD737 An1M(
810,151,422 *5411A73B90F4D46736EE62FBE62D1C1EE1D3454F an+1+ryps1n
810,151,423 *5410CF94128C1A2A24034076AA3D11E2F5154B09 AN1tm
810,151,424 *541A884200B8EF6BE60979ABBE1614F0F10D764C An22c
810,151,425 *5412BE9E3FEE7BEA387BC48EB99CBFAD514879BB AN_2c
810,151,426 *541CE75A6D89C66FF094CB5725145508EAFFFF01 An3/-
810,151,427 *541671A715192070CA9282826405879126AA07D2 AN3E-
810,151,428 *541DE372FA2E86D93021FA0E1B14DB485F6B5E2E an+3hall
810,151,429 *5416CC3A2AD0CEB5E6E0BD81F421FB4B141808D4 AN3R0!D
810,151,430 *54120F847B3CAA8FF2F4D3691B0FA3ACB6DFBB7E A,n3u
810,151,431 *541B526686D0FEAB7D17EEAEAEB7914777F3C81F An3+Z
810,151,432 *541E8496BF7883010D0262AE812CF9C8A9679B2A A(n4-
810,151,433 *541FCBDDC8233CB962F1DDBA81AF085FB67ADD36 [email protected]
810,151,434 *541F42793695C3F6D726224E61D1EBF64D5CAD59 An44
810,151,435 *54161783A512102B1D232475D43328D1D6F22441 An4d2
810,151,436 *541C8BF2FF8F6A3DF3C3C61251CCC3F17FEEF651 An4IN
810,151,437 *54196EF25A63525D5150A9459B89688C1DA39BDA An=4l
810,151,438 *54175C2FE343C4E1434B03C7766FB505CFDCDE61 AN5-f
810,151,439 *54168A2DBA81FBB52320231D54678EC691235E93 AN5m2
810,151,440 *54129CF03D9BB9E1FC13F60711000C5AB513054E AN5.v
810,151,441 *541DB746D3591EB69CD546445B7BB2DB2673AF2C an5z
810,151,442 *541985166A2D47BB093E54B7E36A48C8205DB881 An5Zg
810,151,443 *5418ADFF589B64C6DC26EC92C4C98C6F1D2B8B82 An(6-
810,151,444 *541499FF0AE779242B9B923A3CBBD4301B75A9ED An;65
810,151,445 *541F202C94D6D3BBA95B156F3E839819A4A443B0 A%n6a
810,151,446 *54199DF9C22C6D7B2DD1A5C2D8B9E36D97354E25 A#N.7
810,151,447 *5417DCFECB410AEEBF4AECD6E483126DFCB2275D A#n7(
810,151,448 *5410B2F14BC590047693B0372B6A31CEE82C33B2 An711nflamma7or13$
810,151,449 *541A508839DB07EF12E5A564449D4B71F51F2DDA An7150c1al
810,151,450 *5418C63C0043F4E36572852C21E025360C0CCF32 An71hyp3r73n51v3
810,151,451 *54135BAE1582F1BC3BCDB9170E2EDAD4C0B8DD66 AN75a
810,151,452 *541F694E2705C09E12CA80E7AC71E39F6416C751 AN7FD
810,151,453 *54129136843347D389865EF74A13D1B2599E0A2E AN7Ff
810,151,454 *541D9BC20572339E041A759DC938342DA94647C3 An7ho1o91zed
810,151,455 *5412FE1526B6736CD67139F7F9F384BE5B1E0CCC an7hracomar71an
810,151,456 *5418669CA10885EF784BACA2FE63BF94806F264E AN7I1OGARI7HMS
810,151,457 *54195ABBF54AA597271BFD193E8B06EC18B0DC85 an7icov3nan73r
810,151,458 *541B526282C555900C09B5696FD6DCFE5B1B252E AN%7p
810,151,459 *5412CEA05DEB89F22A0998CCFCCCDAFAAE82E120 An8_$
810,151,460 *541CB7D66EEBEEBAF23FB4E7B2D81A58F92920BB A_N8i
810,151,461 *5417E27DFEEFD9E954DC576C1015B966F683D498 An(8Q
810,151,462 *5410D6C9F27DC9F931751AB53E2CB729983D86CF A.N9c
810,151,463 *5417DC461498FF0986965A45FE1A27166291B90C An9)t
810,151,464 *5419FD4EEB3E67A9F4EF9B0F401CC8BD8C6C7B9E AN/9V
810,151,465 *541E0B794B337306674784A389164579B098B333 A"NA:
810,151,466 *541A948C94870A088BDD2E8880E62623BA4C1524 A%NA"
810,151,467 *54193DFECBD6E4FA9AA032A01AA8059CC50B0303 AN""a
810,151,468 *5411B7AEC3BA3A875C128060B4C597C6F6E03597 A=nA:
810,151,469 *541A9ED9E45710F4E8D424303C795D93642A0F04 Ana1S
810,151,470 *541485D400D151961EA05275410DFE633ED65A08 Anaahaaro
810,151,471 *5414C52197EE0AC194F65A502BCD67BE96925DBD anaandjelic
810,151,472 *541EF964DF2D6DDFA2E0F951801F41DFF7D8DFBF ANA)B
810,151,473 *54181CD6DC35CF194EFC65B5C89268F4F072A366 Anabaptizing9
810,151,474 *5410DBBA64B428AD74BFBB905CCF62A396084C58 „Anabaszisz
810,151,475 *541AD9720AB93A26DBFA7D52ABBB4F8A7BA5196A [email protected]
810,151,476 *54136CFA2FF795DFB4BB57BE808CA340ED034782 anabella441
810,151,477 *541B2E24AD0F4E8AD71A9B22ECF7227345035037 ANaBellE
810,151,478 *54125E01B8A21A27FE29010D30442A8B255EBAD0 aNABElle
810,151,479 *541B31D7E8A00DE0879A7931153FFFA170C1F200 Anabelle724
810,151,480 *541FE200113989184F30C855C1085128BD51F4E4 Anabolic4
810,151,481 *541DCB02F5D909B7C0739CE06FE321EF877585AB Anabolies8
810,151,482 *54101EA524D71009371BD8B481F6B41CDADC1D1D anabrosi6
810,151,483 *5419C649DC2B6289C828159CFCCADD5C44FB60AA anacanthiens
810,151,484 *541DAF2CED8271C5A79B5F90AABFA7408AAD28B8 Anacardiace
810,151,485 *541FEF5B06EAB3B739C1C6201E74B419A6076AC6 anachore9
810,151,486 *5419B32B6EBA93FE7A37A707DF75E953B646935C Anachronisma
810,151,487 *5415C67574CCD37DC6B78A25731550E22AC933D0 an.actor
810,151,488 *5412093FDE324265750D3EC8D420511BB5D5BD3C A?naD
810,151,489 *5411F2C3A4F355D08E30E29862ADDD29D2A5E4E2 Ana&D
810,151,490 *541381C3DC40D75D47FBD2A4B56AA515949EC427 ANADANI03272107
810,151,491 *5415A457DCE20D7A280372E1FA4E0988E3F0CB79 Anadency5
810,151,492 *5419B750BC4987E49A071F1ED9ED9111884EB10C Anadolu (mix)
810,151,493 *5411D7E07790D776320B40457280005C870B1F44 Anádyrski
810,151,494 *541320A51300BAB3E70F03999E8E019A59B97DF6 anaetiol3
810,151,495 *54115F0F1BE2856C8C985CC91C27D5028B403558 A:naf
810,151,496 *541271C4C6BA7CE5034B2002044274269F410B77 anager123
810,151,497 *5417B3424721B1B0F8CD3881B52CE4721A36EFC4 anagni04
810,151,498 *541F4EADA2DBC3FB2041AC47496CEA516414C6DF anagnol5
810,151,499 *541399B2CC12F02D1E8694CAB6EB42B779F55A0E Anagrafei8
810,151,500 *54100E9F20D9E1EE37D438101950A0CCCD8537E3 ANAh9
810,151,501 *5411AB85D14AD162472A936459F60F58089BD48C Anahohej1
810,151,502 *5412F4D5188B7E908F662FC94086CEAB999A090B anahollingsworth
810,151,503 *541EAD4D1CB15E84B049E12BA94A67F9F3B2791D Anahtan9
810,151,504 *54192F6F71D6F0C2DB6F702F37F0A8A8716BFA51 Anaibhr7
810,151,505 *541C4A1301EFDA219A61A03844154295CDE645C0 ANAIDALY
810,151,506 *5415906EF109C375AC0B512DF144E14D061FEF3E anaidaly7
810,151,507 *5413815363ACB43B728BA20CF030EA241E6855E6 anaisiuing
810,151,508 *54168BE56C0EBE9B53BB8DD7F60959DC96DACE6A ANAITHANAIR
810,151,509 *541228B2FAFB865A6C9D33E040AADC548DD34E89 ana jonalyn
810,151,510 *541DA8503B63254FD0187AAF63C9557634299278 ana karamarko
810,151,511 *54159E824CD24B19E5AC988DE5C6131178FF860F Anakarina
810,151,512 *5415BD96D4F333515ED99D064787E778E00CABFA AnaKaulitzTH
810,151,513 *541DEDB2E9405C7E81386887A8DA13B833A2E42A anakolektang
810,151,514 *54134DF4E2050A5700D5A3971220D447C4818D83 anakozlov
810,151,515 *541D8595AC029DD1DC795B008159C3FFD61E8558 Anaksmeing
810,151,516 *54183494A001D51A143665EEC6B5982C91F78F12 Anakthsh1
810,151,517 *541D4A672A68A9D02DFF1778BBF01DE4CC03536C Anaktuvuk4
810,151,518 *541AE2F54085F8EADA2E6A953ED07D032F60A398 ANA_l
810,151,519 *541634D60C785A35667D9F94BDCBB6610EF42D1B ANAL0G1CALLY
810,151,520 *541927E5B62DBF434B6B0D76A965E9ADC3E5D50B Analafrh9
810,151,521 *541B63C5C39DBF5C2C3AC42D36777F9F7520A937 analfroc
810,151,522 *5417F32145EC198E1FF21A8601C0B5F004B55673 Analgrap9
810,151,523 *541B4235BA2E1DFD9B632D7938C29C6E8A49BC7F analisabowerman
810,151,524 *541DF39C89371D1A7A7711F6ED8B9EFD79BC40F6 analoba
810,151,525 *5410C365216F3874538F6BCB5DFD9A809DDA2492 analog1906
810,151,526 *5413EE78134D6D0E746307C52696EA21A0654BF3 Analogei6
810,151,527 *541CB4FB26FD6BB5B1513680F97C4F60A08C6C75 analognega
810,151,528 *54109E6F7C925F4B7044306A39A5A49F24336564 Analogrechneranalytic
810,151,529 *54189B657272C016798189D3EB0F60D451DAC4B2 Analog und Ehrlich
810,151,530 *54155AE77A53F0EF7032C41B14EF675E93CC4B0E analpam8
810,151,531 *541FB349E747B624D323942BDC968874910E7390 [email protected]
810,151,532 *54163D56797F68850FCE24FD65BAFA8335623EDB analydiaz
810,151,533 *54185FD3CA32FF320F4198DC3F031F857D794A53 analyn purganan
810,151,534 *5418DE186784C0C2CA78539656E241420637E39C analysio6
810,151,535 *541EA90BFC3FB31049FF4792967B9ED4F55241C8 [email protected]
810,151,536 *5418174CB3FFFB4783150D6D2256E3662E2FCD14 AnalysisofFEAR
810,151,537 *5417DB3FF3D5C13E20846405CD81D5E06249AAD9 analysw6
810,151,538 *5411C23C937CC3CC3D9D39304DBCDDB1295CC28A analytical-chemistry
810,151,539 *54163C2160A28AADACC21ACEF55644B23E38CE55 analytičnost
810,151,540 *541D97E4F2122D0F5A0E6E34C90DC5667AD2B764 Analyysiaed
810,151,541 *5419D4A08B013BB1822004802D80A13D4706A818 <a NaMe="iTeM13"></a>
810,151,542 *541694B4E7CD6A205811CCFB0A75151ED0B6171B Anamelech9
810,151,543 *5413E1CA05C5728AFFE63B7E5C5BCE78A980BAA9 anamiivaa
810,151,544 *541672484523E1C599144ABF2209167A80048D57 anamikathomas
810,151,545 *5418BDD521F6AD5EE44889DFC4F019995EC90FAD ãˈnːamɪkaɪ
810,151,546 *541D581BC8F6D1308920351603465099A45A86DA anammonid3
810,151,547 *5414A1C95DE55DB16827A83E6B792DAA5A7C0565 anamorfní
810,151,548 *541614C23D5F3A45D54A0DFF5373090DAD25177C Anamtaka6
810,151,549 *54146542A2963F85B8740695EE6F68BA50DD3E17 ananadolu
810,151,550 *541ED9D2488F6A247A750DC16739B540A9F80A6C anand_chandorkar
810,151,551 *5418DC67047BC5331E695EBD8709C63882C0C513 [email protected]
810,151,552 *5414BF08B71E6B1DC0C408D71F55A05933A7DFEF ANANTISSENT
810,151,553 *5416EBBE01A683B61027352E12A3ECA8F05842B5 anaokuluvar
810,151,554 *5419D65F912AE887E6CA9C64366D0AFAC339A373 ANAPAESTS4
810,151,555 *541BED0D00E3A558DDCCF7390408408ECFF00570 Anaphorically?
810,151,556 *54182981711DC568D5E0CAA80E3D4C3BD4608B83 Anaplasis.
810,151,557 *541F6659E7401356B66D8BF833F60437D1491E94 anappop2
810,151,558 *5413729EC0282F4200457D9C7EF895505CA1A5BC Anapurukusha
810,151,559 *541E525B9CDBF80F9F2B68B2B4A5861D25FE9441 ana rafailovic
810,151,560 *541B2896E47265F0E8D84A52B7A3EFBA79D4CD4E [email protected]
810,151,561 *54122B6311BB5F7A6584DA8BA07E79E1CD66C295 anarhismifilosoofe
810,151,562 *5411BAC96D7B36E1536DFCF70BD7E55583F1ACF1 anarhistlikult
810,151,563 *54136EC026E197CF8C2006F5C16D662EEDAFD63C anarki3r
810,151,564 *54114A5D22BB7946D1C77EAE2AF08CC18756A078 Anarthse5
810,151,565 *541EC4A305ABA0634D06AA943A0B2157F4A5AA2B an-arvor
810,151,566 *541796172A8DF85A127A395769CDE99028B206EF Anarxia6
810,151,567 *5410FD61B924FCB3729B87353E2BC2A9B9B44E6B [email protected]
810,151,568 *541E7FF177FB1DC64D08E0B40BF34F48184FD86F anasnabil
810,151,569 *541DF5D425170255BAFE1635F5549B6A9CE729BB [email protected]
810,151,570 *541B9789D2A06DC2FF02841B0A18A4D8A54A0743 ‚anastasia‘
810,151,571 *5417A1C89AA45C4699AA52D7F36EDF7D2B9AECF2 ANASTOASIOS
810,151,572 *541FD20BBB16E2115E22551913D5FE647A929896 ANASYNTA3AME
810,151,573 *541DE67BEB980B41C6F0EA75EE3996449B81E05A anata no namae
810,151,574 *541C144385F39FD37C4277F8D85885AEE6A91E6B anataras
810,151,575 *5419EC5BD4406E4AEF145AEDBF0934FC347E0274 anathme5
810,151,576 *541E0CFB22585F35F04F0F5A91012D063C9C4D51 Anatnomk
810,151,577 *54194CF79857F445EAB55F02C22832256560E965 anatoly.blinov
810,151,578 *541F78775DB0D70B6317CBB088D6E46B85B65E98 anatr0p0us
810,151,579 *541EAE29C720003476411DF5652F72FD6B6CEDF6 an austin rhythm and blues christmas
810,151,580 *541DCFA541FA2C7DBEA678D2502441AC699B56E7 Anavaaru6
810,151,581 *5417F05E6C871D09FDF7AD078CA61EB2B3E05C78 anavdl1234
810,151,582 *541C03D9180F2BE16F6B11A912EE47B3BE25CAEC Anavutta8
810,151,583 *541F3E8D3B2940DF05061A64E757982052D30374 ANAWAT2154
810,151,584 *541505A698A48657F99B13A6DA74B610367A3090 Anawazia5
810,151,585 *541D4BBE8BEB11753BAADC9F5B765A9824C189E5 ANAX7
810,151,586 *54161B65B6E3E68453B2D6574A61EBB4A8170118 anaxone3
810,151,587 *5414591444A1335EE168123B6F750364AA2147F0 anaxonic
810,151,588 *541355BEF4D117213D22E9188B475ADE68ACE56F Anayosema7
810,151,589 *541A78F425313F395C117DAC26D027573CF9ED76 anayslize
810,151,590 *541747405DBF9293490C7C11398B3A55E23071C0 「ニュースステーション」オフィス・トゥーワン/ANB
810,151,591 *5411B9CF4CCB14357C1BF1A1B4DB224172ED750D A+N.B
810,151,592 *541823DD26F6E472E6CCBF521DD9964A136BA7EF ANB7t
810,151,593 *541BF4083A5AD70DD6EEBC683F35FB8580445D84 Anb&b
810,151,594 *541FA39BAD5DB32A9564E9EA049DBCE0E283DFAC ANBEHALTENEM
810,151,595 *541EBA2BA6DD502F06E8A86A35C8F390C8E1D618 ANbF#
810,151,596 *541A739E017AF42A10C4692FE89A81BE88E2DD7C An)BF
810,151,597 *54198108E76853DB0D69E7EAA0535D1F26290866 anbique
810,151,598 *5412207FDCDFB0BDD300D20A0EDC05D30CB7EA80 Anbn$
810,151,599 *5412F7585F3D971837CACB02972D3EF23BB403FC Anbringe5
810,151,600 *541F83D54ECC91031851FF0B4C3E40726E95A770 Anbringtsing
810,151,601 *5411FCE63764E502B89579C90D0AA59C6BF91657 ANBRUCH8
810,151,602 *541EEDDD866159150EF264671F515CC416570520 anbvc
810,151,603 *541D503AA660E4E20346E2642934B0E16FD17EA7 (anb)第1話メインゲスト
810,151,604 *54125CBE37112990C2168BF3477F3955BA0854EB A%_NC
810,151,605 *541EFE3B2091C614D7259B7AC7D46859C13F7D88 ANc=(
810,151,606 *54100CFDD249FEAC345A23BA1F63CDF97C2E96EE An!c!
810,151,607 *54131C057F0D45CEE9F88441A91A3B46275711B0 anc.4445
810,151,608 *541F978E9E4B83CF69F27D3CE4C2E3E02A864458 ANCA.bbs
810,151,609 *5415F3A68550D3B8B23E76E98432800BADB7D5BB [email protected]
810,151,610 *5410E867BEBD5F43A487C70AAA68C9DFF2808561 anccap
810,151,611 *5414AE32008C4A58174D2307271831FEB327E803 Anc!en+e$+
810,151,612 *5419ED8C433B63EFBFA838F1858AE7B0A758215D ANCESTRESS6
810,151,613 *54126C4FA661AAEA7A2F0C5790AD06062247D0E9 ancestrias
810,151,614 *541B59F312D39E96CEE30B70FA04FBC13D8C3404 A+ncH
810,151,615 *5412E80ED567F3CB5D5D46A6050B316C905C5EDB Anchbery1
810,151,616 *541E36432A7C63322819AC0D87B9FA17070E0FC6 Anchinoja
810,151,617 *54121CC033F9471AD27A444820BEF03FBA3936AE .anchor
810,151,618 *5417B58CAAEBA4427B96466EF3FE7C22C9138BA2 anchor b3
810,151,619 *54178904A535B3F985DD88F125BF385E10B5B8FB Anchorblue
810,151,620 *541A56465619C5996EE728A56E6D76B3D3363839 anchoretism123
810,151,621 *5419727220B8F6D1C23B386FA551CBFC875870AE ANCHOR-SHAPED
810,151,622 *541DB000075CA1C933A533588E541E670DA45369 Anchor-shiftin
810,151,623 *5411545D7CA012E9D6786C377DE370A968F69AC1 AncIA
810,151,624 *541794D84591A88D34476436A0EEE38ED84B144C Anciania5
810,151,625 *5419FBCBBBC762546BEBC7484E11C2056D3BBBDA ANCIDE
810,151,626 *541B9DFE93D357BBD7E8DEEE2ED3BD0B506F5ABB ancient aiethopia
810,151,627 *541CC5B38BC94E55919767399C16D38CCA6CFCF0 ancientceremoniescompilation,volume11
810,151,628 *5419057DAA969D85236884D86D68FBC3268E545B AnclaoenParis
810,151,629 *541CD5F663AA7268FF51A161D462D1AF613233A5 Ancolata
810,151,630 *541634F220EDB6561FDF851AA3044F4F17DC208F ancom-kl
810,151,631 *541E21E3103269569156F522174101510D7C4684 anconeals
810,151,632 *5411314968D989743DC847549EA646EF5103727D anconoid2
810,151,633 *5418100ECE9E87C8336D21CD73041C7231B591D3 [email protected]
810,151,634 *541CC7CB2D9BA22A9EA953D461D4F6AC04E603A0 ANCONTRO
810,151,635 *541221E8B3E5188094A4E59E67DBE30D4CC1FEE7 ancoolm1
810,151,636 *541F93A942B494C9F2122D5E16BD0D5416928ABF Ancorche
810,151,637 *541EAF2495D21CA5F0162248C5A40C19A3363975 [email protected]
810,151,638 *541ECA41F17B25EE0E64D8276424FB287E60EF00 Ancriouno
810,151,639 *541D1F6E0AA567114C987134C1183E7CBB601422 Anc"w
810,151,640 *541BFC0B88E9621A4C466D1D6ED072066E17FCCB Ancwd
810,151,641 *5411EA6EEE5E2052316A41891B385D4245BE36DC Andachtsgrafik
810,151,642 *541DCE312636391915F6F4D0AF7DCBF7630BF2E9 andachtsstationen
810,151,643 *5411C01149D329A3FEA3071CC2E0BD17BE194F92 Andagavenses
810,151,644 *54163940306A0A797BCD692D1F82B023243927C3 ANDAGOYA'S
810,151,645 *541B1B9AA646CB78ED2453F9794C4B32BABCD14D Andaigua1
810,151,646 *541DBE8685D2ED9FC400A713CAC1EBC8BFA80ECA Andalousiyates
810,151,647 *541F2172EEB001A13DAC254F7D991049A0616222 ¨Andaluz¨
810,151,648 *541A4E368ED8C48904BE51987727B9FA1FAB35D4 andante for flute and orchestra in c major
810,151,649 *541D0E48770EF991DA97132FD5459340E99303EF Andapandaed
810,151,650 *5419F5150A488D04D5B59565C37C3B1B8F3CC791 andaree0
810,151,651 *54150DC3AAA57D366769A2553F3A013176A84913 anDArono
810,151,652 *5416D8508E89CA0BEB015AB6B9B63FFC375E65FF andbahts9
810,151,653 *541F9F04C877C8DC3912F80CCA9C401F496A05A2 AnDC0
810,151,654 *5411793620B0425FE74B95A87CEED71350FF0851 AndC7
810,151,655 *541195EDF34523245194116218C30DBA1D33A919 [email protected]
810,151,656 *541083788844DF483B2861D8281E8B59EB0E8CE9 andeerelani
810,151,657 *541DF6E45F84F7FEA037E7A7759B61179C86C814 Andeltrd5
810,151,658 *541922627ACF9ABF5E1CEAD78991BC5999A35D88 Andenkening
810,151,659 *5412E1E55C9DABB759F491077C0D99A5E44279A7 Anderbarer
810,151,660 *5410359C7E8BD6DE50B3BCDFB9D457A26D549606 Anderentags erschienen bei dem Herzog drei kaiserliche R
810,151,661 *541A02C97D19461EEC7B06699965D1ACE9A1AA3C Anderjit1
810,151,662 *541E11091DD281BFA35F34F26B5FBAF6276568D0 Anderlink8
810,151,663 *5416C79B26D36CF058ECE35105039A47CE1596CC Änderns
810,151,664 *541B5B0B109A63B222425530C0CA9CF45E80C8CC AnderSat
810,151,665 *541CDE01633495370F64C883B6C187934470B935 %anderson
810,151,666 *5416F1E7D2F03FB32CE6BF7D46827F62FF476397 ANDERSON1938
810,151,667 *5415006CDECEFB3F4B81B0E637E48B0658DA09E0 anderson812
810,151,668 *541F629A6CC682EC754D91BD2A2F7F174764D612 anderson.arrasmith
810,151,669 *541A6185869CE6A7C47E83BF310ED751C7D80358 anderson.behring
810,151,670 *541EE00F5D9846EDA7497EEDCBD9DAEEEE9813A6 Andersonchance
810,151,671 *541A9256D1755566849F07A2231E2EB8822B31E9 anderson.deodato
810,151,672 *5411E875C8C06240DFA6FC563FBAB9BF529D1148 anderson.derflinger
810,151,673 *541F6ECC06A394E3FC1DC89A9C9442519F1E8A7E anderson.heineman
810,151,674 *541514FCAC6E61E9B17B1357EE71F32F4143EA9F [email protected]
810,151,675 *541414B08EBB839B0E0F84C7A3B39ECA79163098 anderson.kaunisto
810,151,676 *54179ECD3405E4F67A3CEF9E04C29EC72411EAF6 anderson.koppang
810,151,677 *5417AFB2BCBEE2F003FECA869CE10048E67670D4 anderson.maglaughlin
810,151,678 *541427071A15E418181532A26EBAEB21E841AD58 anderson.mcpartlin
810,151,679 *541616CF3126F3984B22570160CA63D8CACF1ABF anderson.miko
810,151,680 *54172E2560A24FB49E8AC751EDF933C9F4099971 andersonova
810,151,681 *541A78695F2B7166634CEC5E8C94879E9C0A1213 anderson.pee
810,151,682 *541F2B3C613575060A45DBB9CA8C95E19634E1EB anderson.roughton
810,151,683 *54116FFC25034FC8ABBE94DD27D6019338F5C37D anderson.schwarcz
810,151,684 *54103BC538FCD2934F68F71DDE81B71F6B28CFCB anderson.serviss
810,151,685 *541955E282D88424EDB2C0CA027C62B4470B0F39 anderson.setterland
810,151,686 *54108E122BA316E69D0E5368E2BDACCA2F6E5AA7 anderson.somogyi
810,151,687 *5412CD95C637281AC50E983BF5772A736600EAE8 anderson.stapley
810,151,688 *541DEA694893D9CCF367EFED5952ED94B9C334C7 anderson.tillotson
810,151,689 *541ECF3EE0701D6FD7F1761C9FCC2F06145F985C Anderson)との交遊が始まり、以後、相互のアルバムにゲスト参加するなどの交流が行われ、
810,151,690 *541DAC7D800357A1754CAE86338BE99C4365BAEC anderssonvitolo
810,151,691 *541D9A62852B41AC92ECEB8FBC1E93592444801C Andesron3
810,151,692 *54195FB800A2A5DACBB64BC25CE624956829F021 ANDEVENIFITHAD
810,151,693 *5415B1CFAFCAACDA4A40523DC949F12989418A33 And, for an onset, Titus, to advance
810,151,694 *541C971995DF908EC579344881DAB416D074C65D and he shall purify (chorus)
810,151,695 *54171D39AC0D1DD0B1C993278C26BE41270AFBBB andiafw
810,151,696 *5411BA2770AE8AEAFF0473BD726093867E942A6F [email protected]
810,151,697 *541548DC1F47954DBD6AF820C2625A3021C1DA70 andikupec
810,151,698 *54131D8F364A6BEC051457351B5DB2A42D6E5EB0 [email protected]
810,151,699 *5418D742EEBEEC331D3A1E583752B0462F73E235 ANDIPUNK
810,151,700 *5416D8447A80EFAFC633E24E6FD8B02307F23275 Andishly9
810,151,701 *5416D062EF559D0F82007F4A039E16B641A17174 andita10
810,151,702 *541516A1AA9844654BAC72025795DD22B6EA66D0 andita1234
810,151,703 *541336C96A8F6ED879173F3818A943B6E53E7069 ...And Its Amazing Consequences
810,151,704 *5410363AF74285F04CB7BA3E573D149857EFB8A8 andızı
810,151,705 *541299B1D39C0637B2A0A405E10E216C9AB12AE8 andlaşmasını
810,151,706 *5418881FAD67A25C78E61B0E8ED824E6328B00FA ändlesch
810,151,707 *541240A3A2C6B39AA6EC35175A428BB0EDB608C0 And looked upon
810,151,708 *541E139903DADFD40C14F6D131AF4457B69CC243 andmemorials
810,151,709 *541959032DD51D017BD64FD3C8970C0AD44D45E5 AN
810,151,710 *5417F859CC37736F4B676230D477E494CFB7D450 andoneth1
810,151,711 *541409D70EA5EEE13ABAD7F150F60F68688891C5 Andpk
810,151,712 *541AD77C37509AD0C6B0084BEB9EC102B2758C12 ANDPX
810,151,713 *54166D3E38388565FB53B594A75BE2D948CFE357 andrada94
810,151,714 *5412773E02E94F436189AB9CC2953E1CD7DB1AC3 Andrangs0
810,151,715 *541011945677CA5027237F4E84770C02B2ED815C andrásgábor
810,151,716 *5419BFDA021B35C93F8DC4D894DE30A591CBCB02 ANDREA150695
810,151,717 *541181C7F6EF9CFE1ED471EB86633FFD4E41F6CA Andrea666
810,151,718 *54171A737ED7238D5DBEFC60BD5C2AB0450D52DF andrea.aeschbacher
810,151,719 *54139116579B5D6A2CB8BDFFF067B34216FD861A andrea beaton
810,151,720 *541E59C2175A6444C92A5390131717457350BAED andrea bittner
810,151,721 *54166D815CD45CB03817929832E372CD24BD15E8 andrea.blankenburg
810,151,722 *541BD1D0FE2090FDE8E7DA00C47665A87033FB87 andrea burkett
810,151,723 *5413E557A836493F275CC4E8FAD9632CB8AA77A6 andrea christiana
810,151,724 *541A3CA8307EB83803A1E7F3580B249B0AE2F23C andreaclerici
810,151,725 *541F9B46611AA469530885016539B10491080CB4 andrea.cortinas
810,151,726 *54166BA4E0AC71DA4C541C85E8EC8ADE43D2FD68 andrea crooks
810,151,727 *54132738811A7A1B1E0EC958FB16C71D482DE5C5 AndreaDworkin
810,151,728 *5419D94B51424044E3EFA02AB19CEEFF99DA887D andrea fullwood
810,151,729 *5418D9E4AA868A19D2752FAEBACFAF594FA11131 Andre agassi
810,151,730 *541FEFBB340707E71065C586B6C28FBF312D14C7 andrea.gaustad
810,151,731 *541357F5479A128D44CA4E6DAE1DEF2FCF721DD4 AndreaGemolotto
810,151,732 *541CDA9D8B9805572D63D6B10F6CA7A070B6261A andrea.girres
810,151,733 *541A21678E77F83CBCF35D3031D2780FD869F83F andrea jerry
810,151,734 *54116C82166E3CAF5B982B297CEFA63C0585DB0D andrea.kaaihue
810,151,735 *5410BE243501301C3D826521AB57AC3D9CC8A485 andrea.kochanski
810,151,736 *541567322B94FEDC027E2DA003372DCB86510F9A andrea.lengle
810,151,737 *5416663BB295285AFCB44A998454210D22E848B7 andre.alexaki
810,151,738 *5414C637BD853DADACC4FBE382A406E847C34509 andrea.likar
810,151,739 *54109F121E2491C6F08653C6646400F7BBD1E999 andreamanos
810,151,740 *5414C1923B141034E35E3DC58F66CA5B96E86E6B andreamarchi
810,151,741 *54175C0024D29D1673FBC11018EEE38DC4DCE477 andrea martell
810,151,742 *5419695E91C9918D9991894C8493942D2E83B72F andrea mendoza
810,151,743 *54109CA334EF85F2787CE9333E9B5CD06A6CE02A andrea.miyamura
810,151,744 *5412CED20DB09FEC3C2D0607AAA61E0E3FFEB07C andrea.molski
810,151,745 *54129BA38F2A6F2D3AF5254A81E29C6DEE5B3DB3 andreaoneill
810,151,746 *5416558D39ADA585AEB3ACE698EF2A6FAB708B1C andreaoswald
810,151,747 *54126BE6645288F68F1F3F0AA8FA4306A230AC95 andrea.pannebaker
810,151,748 *541599AD231BDDF29C836266430D64A2B93B0C6A andrea.quail
810,151,749 *5415F4A838A984C20A97950CD5411E5E25016A64 andrea.rawley
810,151,750 *54175EFF9F695A13EE8FB5DCABB1603FC54A26ED ANDREAROYBAL
810,151,751 *541B832813A3510B6DB16A36076876BE21C68EFD andreas009
810,151,752 *54111514FB338891616059A2823B06548D3768E5 ANDREAS15
810,151,753 *541CADCC191344E532829B1A8EFF5B1CE692120F Andreas904
810,151,754 *5411F8C1DB46AD2342AA55B82D3F5953979C81DC ANDREASABRINA
810,151,755 *541088D88512A05F901535E9BB6D5A94B383ED1A andreas adler
810,151,756 *541DC16E10015CED4556CF7789FC2748EC472CE0 andreasadrianto
810,151,757 *541D3ED90A7AA247704E4A993CEBA2F11935710A andrea.salen
810,151,758 *541824A553DB6459941EFCF257CC37D429AB9D4A andreas.arroyo
810,151,759 *5413C5A004A0FB751D4A78698577A61F4E0A84E4 andreas.bingert
810,151,760 *541DD80882CE18A74FD8F042AC5264622CCA6714 andreas.ceronsky
810,151,761 *541265A4AA8C1D50AC8A9BDDE23F8F122395F827 andrea.schamburek
810,151,762 *54117D6E026A07EE136A80CA2831CEB8697EA958 andrea.schecter
810,151,763 *5411AAAD2DCE8A2C723AFAFFF30D576C606F22DD andrea.schleh
810,151,764 *5413FEE01E50ADC0A01FC20EAD9EB3AC9998E682 andreas.dominion
810,151,765 *541EE03E1910CC4FB8F1DE59828EC406B42915B7 andreasen123
810,151,766 *5410429EF312EDCAE450E919864508F99F7F8605 andreas.gutzmer
810,151,767 *541C434600A97A5A2C65E859AAED93653261B622 andreashjornholm
810,151,768 *5416FCCE341BD2AE9890685A3F27420CC7C72B74 andreas.hocutt
810,151,769 *541454F3349F0E70E2B348F1732DD1482AE2E157 andreas.leffert
810,151,770 *5415C9963503A4765FBCDAC24A3B66DE95303A07 andreas.luker
810,151,771 *541521200E2AF5FE09BF30F60E84497730F5F0C1 andreas.lunstrum
810,151,772 *541AB99E3F7685683FC4525586336D04C08988BD andreas.mcguinn
810,151,773 *5419E47EDA5C5C8036723C868BA6D75FAE02343E andreas.meckley
810,151,774 *54105BB679AB077F012F79104CC8EFD8EDD7F5E2 andreas.mower
810,151,775 *54152F3DF755EFC49724AED81B762578402FD782 andreas.mu
810,151,776 *541428C0A9676D6C4CC78F574E7A9846F3312F2E andreas.oshaughnessy
810,151,777 *541CA12632E1020061B0F0C5711AF75080DAEA12 andreas.pinzon
810,151,778 *54155979DBC69D554EBDDA08AB1E6DBCA34A86D0 andreas.prewitt
810,151,779 *541D3E0F30BF33B576046AEF54B5AADE6C6222BD andreas.prophete
810,151,780 *5417DC4D66A351D9FC8FD817BBDC1B8883E8F1D2 andreas.ramphal
810,151,781 *5411CA147829413946631228158109C73A73179A andreas.rovack
810,151,782 *541B16A391B7B632ADD7F9D70DCEE065DFEE798F andreas.sade
810,151,783 *541ACEDAA3F5E470116566C4B909D1BC7D8A3073 Andreassteffen
810,151,784 *5419832171BB233D7A16D434A6C62B01B1EA2860 andrea.stefani
810,151,785 *541537B6E87071F6688F2CCD28402F3EC464F2A5 andreas.truocchio
810,151,786 *5415FD9C41E3C7881D41A0AA6C4F0F1FAA288806 andreas.urbany
810,151,787 *541EB23494197C095BFC6EDC79EC0A37893796F4 ANDREAS ZEUNER PHONE : +49 (0)4509 8542
810,151,788 *5411A6C77FFB802D8014186FBA964EF58DA3CD01 andreas.zylka
810,151,789 *54179A12F3F1556F8F295315DBD7A50E00E6B2B4 andrea.talaga
810,151,790 *541E85DFE9875AAF502E0C1F409BC2AA1DE7398B andrea.talleut
810,151,791 *541311AAD0A9101B3C5A7DFB2ABC793353FD8533 andreavesentini
810,151,792 *5412568A1D8BEEC078669DE5009627E07BD65ECB [email protected]
810,151,793 *5414ADDDC89636F258F8689140F771C4823FAF09 andrea witherow
810,151,794 *5414D000A067B38B860619EC5AAE5C09FE3E50BC AndreaZahn
810,151,795 *541F1E96E7E371644D626272E5A3EC0F29C172E7 andre.belch
810,151,796 *541DD66869B4F52DE9C3288CBB864BC846BF8352 andrecarollo
810,151,797 *541FB384DEC1D30DF626B1EED1411DC5A9A88354 andre.casparis
810,151,798 *54169DC4728B7532B81F33671F95D05290A9BBF7 andredaed
810,151,799 *541C187C884CC23424C812CB85C51686E4E16BAF andre.deriggi
810,151,800 *5416B707CA5ED9B742927E83ADB395622F9A7FE8 andreeacopil
810,151,801 *541416007EAC63D512D783A626348360B35685B2 andreeadumitriu1
810,151,802 *541C261A4783B9DFB8F61BA16FDD729E98AB1952 andreeamarin1234
810,151,803 *5417F5CFA5EA46FEE6844F73F71F4B488201308D andreeaonofrei
810,151,804 *54111C8D2C407345BBB09B414F6D07C01E36E9B8 andreeasandybill
810,151,805 *541489339B3276D711673B2B7C093949820CAF57 andre.fecher
810,151,806 *5414B52472C8D46422A29A303EBAA4A0D88E4390 andre.gasperi
810,151,807 *54168D831BFFE22020F1C307FB88E1F5A9578E29 andre.goessl
810,151,808 *5419994B5FF331284908C3F65F2C6C817DA1FA65 andre.hanberry
810,151,809 *5416BE71C5D0FB3B9FAD3190C64C62598115E9F9 andre jerry
810,151,810 *5412E582375846A00A4FA77343AFD64124DA24FE ANDREKUSUMA
810,151,811 *5414389386CFA1CEEA046413515B8943FEE221A4 andre.landberg
810,151,812 *541F59B1183BEE3217B2999E94E390AA5D2AF6E3 andrelefebvre
810,151,813 *541CB0B62AF647BF6C5CBCE7E594327C5EC5FE9D andre.lisena
810,151,814 *541E78EE90D68150822A6047135E845E49143A25 andre.mallis
810,151,815 *54103E1E6C94F750B3E566B293DD99037AA88DAA andre.mirando
810,151,816 *541C8C9FF6BF42F9207D358B81B415E4B709B588 andre.moog
810,151,817 *541F390385E21E04E979A66D7E3757053D11C9E2 andre moseley
810,151,818 *54130335A12F34ECBEF8FE252005D561EC79910D andre.moskovitz
810,151,819 *541BC5D9FD4798238885C7C84DBFE8ED2F4DDD28 Andreola4
810,151,820 *54111378F1893D22C70F672F2E81CA3C8B79F933 andreolimpio
810,151,821 *5416E1DD363E825307852B4277C1A6C14FD29ED3 andre.ordman
810,151,822 *54194FFC6C17460C47A355AF6EF54814AC1745DE andrepiazza4
810,151,823 *541886FEF883872B4BFCA695C4F16366532948C4 andre.rebolledo
810,151,824 *541477A94262C373B134088D7E149B624949AF47 [email protected]
810,151,825 *5413DB06C885B01AEB576949341FB8F97A385417 andres.benyard
810,151,826 *541F09C3F26096321E24B66A54C41EA1731D6BBA andres.bew
810,151,827 *54171B0F98119B7AAD11AEFBFF046F25D019348B andres.cianchetti
810,151,828 *541B04223BD9B541530455383537C849F9020FFF andres.dionne
810,151,829 *541826FCF4793E4341C83E8227C286AC7DDC22F1 andres.dominion
810,151,830 *541B3239C07F6A342A0E9D4C863A75BDA067A545 andres.dooney
810,151,831 *54186844972D6F0D42BD319B6E92DC444D03946C andres.faircloth
810,151,832 *541E52253131EE783196CDED06D4FD568464D100 andres.farid
810,151,833 *54106D39DD78F051C3ABAAE9DD9F53EA6596DA21 andres.guterman
810,151,834 *541B936B9C9200558D6304A4C787C391270AFE92 andres.lamora
810,151,835 *541FF47F27081160746513A53798B273CF7B0606 andres.mcqueeny
810,151,836 *541E187BBE5202659F03C9CF098B287B8642ACCA andres.miedema
810,151,837 *54153432E5D087754F3025D695A9C3876749D409 andres.millay
810,151,838 *541845B36643C5E0A303C97447BFA7F0128ADE65 andres.murrillo
810,151,839 *5412C684F72D083AD091A7580A3180F74034CE98 andres.myrman
810,151,840 *54140FA7F1BD779C43D6AC4FF24A2364EE182FC3 andres.pinard
810,151,841 *541F13C212A9CA38E91784C17D5470CF3621356D andres.prag
810,151,842 *541AB730FC56E0D86A85DA9762953E5B373F1869 andres.sable
810,151,843 *5414872F77CD456DC794DE46443C9CAF78BBF6D4 andres.scardina
810,151,844 *541FCC3600B50C19BBE9D315FE42B95A4BDAAA51 andres.shiring
810,151,845 *541F7AA3A9CBD27A8361CF0619B3174CC646E40B andres.shulda
810,151,846 *541ECB913224A9C1F07D98D95D45F63A7AF68A63 andres.steeley
810,151,847 *541D044FFF33C367BBB19EDB70C44EEC90CB9B04 andres.subera
810,151,848 *541D8D24E2B22312A1EE6EB347CAD11A14698248 andres.urbanek
810,151,849 *541390DA9FA529AEF4AE1E07FF20FCEF618B7B21 andres.wozney
810,151,850 *541AB4FFEAB449B2E1A3789E0C8A08C50C8FC9A5 andre.uhde
810,151,851 *541237C37B90723A2AAF7BAC568DBD18CCC12C2A andre.upadhyaya
810,151,852 *5417CA02FC0C8733F86CF263C5389AB0726EC9CB andre van westenbrugge
810,151,853 *541E87A5403C4A264908E374E3C4F0287D68C3D0 Andrew!!
810,151,854 *54137D2E38FF70AAF5D17A78549AFF4D2FA95FAE [email protected]
810,151,855 *5413A8657FBC265B450770D49C5E03D5244D3129 andrewabraham1
810,151,856 *54100F40DDD842A352C046341FB9E4C9F93F3768 andre.wadas
810,151,857 *5419129B9328756D3A8152521E7C9C767B1EBE2C andrew adkins
810,151,858 *541D71EDC34E5A69638927E4A8FEA2163D4451E7 andre.wagley
810,151,859 *541C898A8C2B917A2EA9B0789E3EEB5AC7B427CA andrew.beitz
810,151,860 *541284CEE9DEA9CBCAD23B98AB479FB866C536EB andrewborrego
810,151,861 *54160C3AC9C7CFC223763695FE5C7ECB97DA216B andrew.brohl
810,151,862 *5416E0104F4FF0D3F30DEF57F90EFE4235409126 andrew.capracotta
810,151,863 *5411F75E940262890BC49037744DCDB7CF93B2A6 andrew.criley
810,151,864 *541400EB4F19223DE833C3C54EDAC913ACB196F4 andrew cu
810,151,865 *541E8CEEDAA0CB70551640C0A57CEDBAAFB54734 andrew.custeau
810,151,866 *5411CE2381D7DE41AA0906F2AA21EBDCFBCE2BFD ANDREWDEFANTI
810,151,867 *5413D7ED05DEC6FCAFE2F8E185B70B952142AD6C andrew.dellibovi
810,151,868 *5412A697AE01F234677E76C0142D75B50A6CB94B andrew.dotie
810,151,869 *54162446627A91408EE964C7948BF65A8EA18905 andre.weltmer
810,151,870 *541BCC07D7837D2D596D8E2E8ADEDD13407DB052 andrewendaya
810,151,871 *541FA16ADF4359A2BA6C254B9EB6ACF673DEC650 andrew.esperon
810,151,872 *541F7357408A4DBFE9BD402F82B9E5269EAA3CE3 andrew eyre
810,151,873 *541104F05A44D28563BDE43ABB8AA0219AE75707 andrewfrankie
810,151,874 *5413D46076F4607ED2C95623F33BB41A3C1A62FB andrew gonce
810,151,875 *5416AF8462CA975F0AB54D824B3C680CEA9A761A andrew.gould
810,151,876 *541FD75AADA428E98DB154D68BCA9AC916794338 andrew.griffeth
810,151,877 *541714DFC74BA5EFA4C21FC42A2448DB00E184C1 andrew halligan
810,151,878 *541C4BBBED9EA63E71BB80D395D2541F21C1804C Andrewheels
810,151,879 *541B8011A3B25C5C2B5CE762FBD76485E0776BA7 andrewholman
810,151,880 *541C38405F270CE4BFE70CA790B9031E994C3125 andrewi8
810,151,881 *54158A4C673D0718E3AC8C9F691B35E4286946E2 [email protected]
810,151,882 *54146A45E9D804C7240EC61DFFD0F0D516F60E5F andrew.joecks
810,151,883 *54174E364610276208D8D3E517D6E8206B9F727F [email protected],
810,151,884 *541E753D556CC94782959039A7B0C20D8008EDE3 andrew kasprzak
810,151,885 *541877CA6878076F00024FC06C8290EA68519EF9 andrew.kolby
810,151,886 *54146E2E67FA9DC36B725D0F9512C49A3E408157 andrew kuebler
810,151,887 *54164782ECA7D12C7ADED828E4ECB95A9E87BD5F andrew.lofft
810,151,888 *541F3EC44E9DAAE48D3002DA51CA47063B497198 andrewmasterman
810,151,889 *5419219156B672C8730BD2732E0B40769DA22211 andrew.meteer
810,151,890 *541ED0499EBC53CAD7E8F78B9607E1A03F24FF3F andrew nucci
810,151,891 *54158C82A91BCFC363C9CED3B4F80CA932324E19 andrewpatterson
810,151,892 *5414A3B8CC0364B808026974F0353107C1CDEC44 andrew.pollman
810,151,893 *541108B542253BA771FCBAA49C8A07A17E72D2C2 andrewpressnell
810,151,894 *541EFD30E186FFC06765C5CFB0C941EE7D09A30F andrew.ramiro
810,151,895 *5411225F8E19C39312010DE74E1AAB8D2BDBA26F andrew.reaser
810,151,896 *54103FF515AE36B72F294AB6742D1817689FC2DF andrew.rochlin
810,151,897 *54198D7D4E77E91B066B9BF383ED6A67DB51143C andrew.roos
810,151,898 *54121F5B7439C709AC9C856C4C3FB337ED86DDDD andrewscholten
810,151,899 *5411C5CD6E89530ED3EC59FB3BE281DEB06CE9AA andrew.search
810,151,900 *5413E4DEEE12D955C31F98CF30ED1C316D7D8564 andrewsomera
810,151,901 *541B0EE0D96449C2774AFD168299751B8B3BC8BF andrew staten
810,151,902 *541FFAE79CE3A85D4C783D2881394F42FF977B35 AndrewsTavernGustavSign
810,151,903 *5413111F02213E55BC646F1EF9B5EA22EADAD8A5 andrew st croix
810,151,904 *54123015948977F95EAB1C119F4F283BE7EEA009 andrew steffens
810,151,905 *541100930A4608D51E73B2F0588AB103D6D1D05D andrew.stivanson
810,151,906 *541A5702EE6F639BA38F7378F2E1E1AFBA3A0666 andrew sulley
810,151,907 *541480BF6EBA60DD7257C2D845F03DE8BA510B74 andrew.tarver
810,151,908 *54155F87D59EFF95D0A7914A385F04E720588E12 andrew.thwaites
810,151,909 *541140F871A59A3E4BFF24360DCE9FEFDBF44D2E andrew.trudnowski
810,151,910 *5411FEE4F854DF4CEEB6E219F6885737FDABE2BB andrew.yun
810,151,911 *541533DB7B6572E906D6E47DA3179C4998E7904D andreys0
810,151,912 *5415B31E63F0EE30DDF121E7B96382E2DDAE6DB9 ANDREZGORGEOUZ
810,151,913 *5414C927C7D4C25768C7443061C552F1149CA9AB andridamanik
810,151,914 *5419F5353218D019FE478319D987C7717246169D ANDRIESSEN
810,151,915 *5412426A68A7445D739EBF94EEDD6F0F0928C851 Andriovitch
810,151,916 *541B2F55EB7A988F7E5A17DCD9ACD11893BE0CEF andrisanalina1234
810,151,917 *54152136633188951E970AB43AFE2D881BEAAA1E Andriveted
810,151,918 *541B53ABD4E44F4317E9D8F010CDB5934F407B32 andro escobar
810,151,919 *5418D6902F8A9AB2B876960E1A808537E59A5032 ANDROGYNI35
810,151,920 *54171A9B6B2C880190AD59C7451952EA63B45043 androlus8
810,151,921 *541E131824B7A50C54E2DB6A8EE7AED076A03892 Androniko5
810,151,922 *54188915B50331E78C56A0317A32F28653821CD6 ANDROSOMA
810,151,923 *541E8FD9F19AF7D34A2B8CE91A05EF28A8E9F503 ANDROSTADI
810,151,924 *54100D23CC0555199E4581B2CF494D772940FFE2 AnDrq
810,151,925 *541064C0FB32CD90B042E22D16E53E023AF2EAE7 andrsiesing
810,151,926 *541CF241C7AAF26B992F30DF952AE4C10C85D4CF Andruss3
810,151,927 *541095C816A48D24FE052897F81E482874401F8F AndS"
810,151,928 *541289BCE37BD699E20161D7806B13AB02030314 [email protected]
810,151,929 *54152C539A0AF8280F54126FBB6F40C1BFADA659 [email protected]
810,151,930 *54178DF21A1274F9AB0F8284E95F091465E35EEB AN.dt
810,151,931 *54136AF9A31AA7D80A71E3247A8A2625CBD32B1E And that I have possess'd him my most stay
810,151,932 *541A85BCA13EB358C16ED029149006497B47062F and the days were just packed
810,151,933 *541179C394545D4D6381855A0B7A01EDF93E4D2C andtheskiesopen
810,151,934 *54184EF9D2801AE8CC4D6D1447E8F6ABF462B878 And This Is Maxwell Street, Volume 2
810,151,935 *5411550FDAE715C853121F9EB388B793115477FF and <TT>$val2</TT> in line 33. (Some programs that manipulate
810,151,936 *5416AB1B60273116D7ED4B01D65B42D7248542D8 Anduddin2
810,151,937 *541BE81FE36297F366430B199E134FF79DC7BB97 AnDvK
810,151,938 *54125050753F96E8464CADEE72F17594090F216F [email protected]
810,151,939 *541B8CB4C0D8FF5FB71B7FB93776306CCBC79D97 ANDXBLKPH
810,151,940 *5414764A1C1CA623D2C6BC497949D9CC66514C4A [email protected]
810,151,941 *541731492350446873D15E4FE0AAF8BA6BF3BAF4 ANDY78
810,151,942 *541C08B3BC6E6090772996C70986264DB48C7FBB andy.batrez
810,151,943 *541F9406F2C5B9E05427D7366C396465EF9C28B3 andy.bensberg
810,151,944 *541DF819A6F6E926EE9C499C54F567FA4F2744D7 andy.brood
810,151,945 *5417B95B4ACF9138361A65D3267755204A8A5064 andybunn
810,151,946 *541DD8AE663964157F8F67EB5D6FE3DCAD2C921B ANDYCAROLE
810,151,947 *5411906FBB14AB66F1F55A4EFB92694D70F82203 andy.christin
810,151,948 *541478E2E22F81DE08057E2CBE670570F855B693 andy.comeaux
810,151,949 *5410B1BDF7357D17BF996F79E52B298FAA65046F andy.constine
810,151,950 *541A2A7B9E26FDD01FEA3C6E79758571B73B55C3 [email protected]
810,151,951 *541C4C6C8F8CAF94C9B105B6B7AA0521CDEFF358 andycroll
810,151,952 *5414806FD8250D9B9D7648D555CCC42D2F8A3C24 ANDYDEASON
810,151,953 *54134B83959B29A3D63D8134D23B5948B10C00D8 andy.denboer
810,151,954 *541E5B0D428EF17494088E7373657AB7E6841EC5 andy.devoogd
810,151,955 *5410D9AB2C6971D51360D8E4EC29447A5F0E9998 andy.dufilho
810,151,956 *54183B20394C5C69CF35CDE771783C5DCA8ADB2E [email protected]
810,151,957 *5410554BDBDBE0857C95CB84189FC1B8664112BD andy.foot
810,151,958 *541523E106143202A970B8BFE307592E4D52CF21 andyforde
810,151,959 *54139F2FDE16BFDD67A5008BE43FAC63A212CE32 andy.gatchell
810,151,960 *541CD7200BAD94CD701D5F124F02C003175B2583 andy.hakim
810,151,961 *541B8EFDD41A9B33E94494587D59B839BDFA60F4 andy.hattub
810,151,962 *541F6A9EAD9CF48EF3F8DF37DF8637189EE6A6D9 andyhilts
810,151,963 *54165CFF0B63C52FBAC4B4C41CD1C5EF70228216 andyhklee
810,151,964 *541BF59384B44F2DA7CECF4FF96C1E897F503BBD andy.khounthavong
810,151,965 *54154015B3C82220ABD89FDB3D87784960CC01D5 Andy Laster's Lessness
810,151,966 *54186BDCCF4451CD046DB9D8B18E528D565A617B andy.legoullon
810,151,967 *54154918132D4A52BCF50F84822E4B7EE491A0B6 andy.marrara
810,151,968 *5418B84B74D96D56F1FCA422EAE014F03432019B andy.mcfatridge
810,151,969 *54109EEFDD8BC3F1F9BE45520A06BBCC9C798102 andymcgonagle
810,151,970 *541A92E4ACC069B654E4F940883A708B5A92DEFC andy.mezza
810,151,971 *5411E96498318EAC6E931F406A430576EA413ECE andy.mihaila
810,151,972 *5413FCDBA8F4F93ADAEBFFE701A1BC93CE20984E [email protected]
810,151,973 *5419BD8E02824D93908DE2372E635C8CAC61C01A andy.muni
810,151,974 *541516001E6AB2ADCB16F0ED234C351F2857EF25 andyofford
810,151,975 *541398144569F9EB540CB3DBE081999B6B8EE4D9 andypitcher
810,151,976 *5417BBD17AD8E0476A86686295A38FC48E49B92D andyroing
810,151,977 *541E3DE7AEE7436A94434FAB71A2DFC880A86D0B andy.schindler
810,151,978 *5417F7BAD501ACE06F1A76CDA4903E218B3B21D2 andy.sivert
810,151,979 *541193B61BC65B8A450346F5C61315E8B557CFB4 andy.somo
810,151,980 *541DC270FCD4DED544FCBB8ADF9BC07730A0C195 [email protected]
810,151,981 *54189C04F6E42796F13949F4CA5B687BA90B39A9 andystefan
810,151,982 *541BCC1A3ACB9EF3888DF5CFE37BBA7931E0A31C andysummersfanclub
810,151,983 *5417F84D4648A1C94EC98C5E3F130F645954D406 andy.taliaferro
810,151,984 *5417A8D4C2536606D194A6661F9E7054509521ED Andytobies
810,151,985 *5410DBF2066BF63543228E30933062E4A00C14CD andy.wehking
810,151,986 *541C67401C8DB549FFE67811B7DD13256F31625C [email protected]
810,151,987 *541FDA7A6FDAF3CCBD1099CEB75D6406C551EC15 andywolton
810,151,988 *541CE51DF246896D059945AA64F97FAE390A1358 andy.yashinski
810,151,989 *541491F1B8AC7BA0E420A1081B1296CF103FE9C2 andzied
810,151,990 *541ACFEC50856E247D78C7C7257F176048428731 AN?E.
810,151,991 *5411DD275EC2C4E06AB23865559F64C75F176F6D A+n(e
810,151,992 *541E1D544AEB642B38D0BBB986114B2A931FE21A [email protected]
810,151,993 *5417DB8359DF10B3828B195FB3ED5391DFBE4E9F Ane&9
810,151,994 *541471FD61F298D24713DAE8460EBBD88991D485 aneantissiez.
810,151,995 *5412BFDB143388F9185A626F545B3EE5B499BDB2 aneb430
810,151,996 *54179BD1B945CC11F7EACBE1226B06850CA64990 [email protected]
810,151,997 *541F970E55F562AAB8A402E430AA91D7CEE0418F ANEBOTEN
810,151,998 *541057A8262F8061C626D367D188CBAD972D7A84 Anecd07i$7$
810,151,999 *5417EE45C571016A4567790D391F972EB8BA8863 ANedo
810,152,000 *541CD50AB1C665F70C116269B25991CA44144560 ANEek
810,152,001 *54160863FAE1BFE32B39AD57BB6C4E7B3CF45FD3 aneesadams
810,152,002 *541BB6846F94219FEAE3F9EDBB7B625BA64C307D aneeshasingh
810,152,003 *541A9BA87083CE4928970D1C29441261D483504F [email protected]
810,152,004 *54174DED1303B9B80802D9C81A96BE36EAAB7383 anehtra6
810,152,005 *5414488A1B94EF1357392BA46378518C0F17D0CD Aneiland3
810,152,006 *5417C2BFC4381EE7E28F524A5ECA31B603E6B2D0 Aneleutheria
810,152,007 *54141E9A228C6D53F0633755DDFB925944F383E1 Anelgnis5
810,152,008 *541F20168B0CF8D07B7C2BC122D896B150E1C300 ANELGTR
810,152,009 *5415D0C35385778CC48D8CDE7C1A2126456CC969 aneliches
810,152,010 *541A997A5C398E6E2EA4E9AF72FC44D3F4AA7BC5 anelina8
810,152,011 *5418EE4B4B09F4E3134316D6EB8AE80874E945EB Anempires
810,152,012 *5419888F9EFF545D969B39E41B12FD9FDEC5BA12 an+en0dal
810,152,013 *541E8A38B6F69DE2FCB9CFC6244851A7707C39D1 Anenist3
810,152,014 *541E79B7E83C8B24C2E3BD1108F3C08BF23CEC04 Anerlene5
810,152,015 *54184FB3C286896D9B5B7623BAFDCEE38CA6BDB2 Aneroido4
810,152,016 *541D3F8F628342615FA0A9B05E8AA67EB9863A65 anesthesiologists.14
810,152,017 *54192FCD788BB3B739B937804C28AF2D3B0DAE7A ANÉTHOL
810,152,018 *54103B5B907284E9DD6A58E6C8EDE93C193EC498 aˈnɛtsyʁmaʁn
810,152,019 *541919B83FB3E06F6654B4967542636DA3A39C42 ANETTAKEYS
810,152,020 *5416DABD8D7E255ADC8E802064618B3D2B7E8A04 AnEUo
810,152,021 *5415D8D4BEC800DC337B37A9B60F71646D0E1B37 aneurilemmiced
810,152,022 *54173F31E7B6BAD67E4BBD01CC3DDA143E487F3B anewsignal
810,152,023 *541F06BE2C15561487ED73DFB14FE2F7BB08F9E7 AnF5f
810,152,024 *5419B59E249618948DDB76B65616789A83E85195 ANf8=
810,152,025 *541894CE9B00536E15F892BF511F2850BC8AADB7 AN!f9
810,152,026 *541DFB23C00F27612376A087A40EA0DD71E6DFB7 „anfallen“
810,152,027 *5412960C094D65379A72AF6A93A0324B40367AFD [email protected]
810,152,028 *54110D68D05CB9FF212CB937A25423F6847AA401 An
810,152,029 *5416E1DDCA2456E066382191232DF0E08F87A1A6 ANFfB
810,152,030 *541C039E1E825B68F243A3D547512B32ED4EE19A An(FI
810,152,031 *541C632CAACDB1EB8DD55216CCC12F6E34BD633A [email protected]
810,152,032 *541B589F35C45B0CD1915A1051459AB721F08258 Anfiono
810,152,033 *5419961203BC425F5C5866C7D07CF32735C80D70 AnfN&
810,152,034 *541766CBD7BCB9C48BE40C4B987A84719C39AD46 anforderungsliste!
810,152,035 *5410737E815B818A56DC6311AEEEA07349D4ABCA Anforeses
810,152,036 *541A7AEB080AB5B33CBE28ECD57021C89B629BE8 ANfqS
810,152,037 *5415821E44628CDF8A645653B6EFF6D232795ADA [email protected]
810,152,038 *541B65C65CB81344C6D7AE37E64F9CA4D3FB9837 ANf#w
810,152,039 *5417A6AAFD20FEA0BF31C9386EA902DD202B073B ANFX6
810,152,040 *541ABC543EB0A092925BC6B02761FFD3C9366066 A/N)G
810,152,041 *541B28BE7C0931BDD9763AD7D16FF22015E6C648 ANG&&
810,152,042 *5413B946CEF709D285E3E8154977C920B40144A4 An/G0
810,152,043 *541D368447E3E3721ECABD43E65AAC8C1CE48AF5 ANg2R
810,152,044 *541A7953B438626A6B9E3FFBECB31BE44D904BF0 A+Ng9
810,152,045 *54172C3FE22D2EE0A343228B70C5B3A17BEA78FD Anğara
810,152,046 *541ACBE1EE1616591CFD5F8B031E6A141DE0AD90 anga-rakshaka
810,152,047 *541B7DC008311C00D257FFC5A28EF74624C8F17B Angaresied
810,152,048 *541500347F8EFFB1240F15049A5F39DBD492357B Angaziranoscu 1
810,152,049 *54199BE2E8DF69EB9FDA876EDFD41B71162C2B7F Ang)C
810,152,050 *5417A2811CD471749B6B52A7962C66CCF148DCBD angebotsgenehmigung
810,152,051 *541E28DA89CB0639011DC88BAF362EAC25DA1A85 Angef
810,152,052 *54112A403FC82F7292E2832B7123EE057F0A11EA Angegrinste
810,152,053 *5413B484B764C6925789CD2D597E90C72F2D5D6D Angekraed
810,152,054 *5417D0F59DF8CAF5DB2213D904E88EF0BA82325B [email protected]
810,152,055 *5415532162546FE82DBC53EACD64B70BDF1DF960 ANGEL12LVU
810,152,056 *541777CE2F8FB4E9A97456D31045FD334F1F53AB angel25744
810,152,057 *54124051D5B9234D69AB6F08C2AC0D665552631A Angel546
810,152,058 *5413A84900EF75891D2B04AA3608341FCD5D5688 angel687696
810,152,059 *541558BF35F9850EC8C7FF4691F421EF4EE38513 angel99234
810,152,060 *541AC096B1EE46ED070D784CEBF10EBC376C1520 ANGELA1464
810,152,061 *541BBDEA14C7D663E4B882F8FB54908CD2BFD675 ANGELA628
810,152,062 *541C2F48886B2A8784232D745D01B4DBF5FA6857 [email protected]
810,152,063 *541CEEFDA5BFFAA70F63B9DECF801A3462D7CF39 angela6788
810,152,064 *541977B8AC6727BBEBE36998870C87AA86A9BA38 angela7512
810,152,065 *54131DEC343C1ED5A15AD820A7868B8ADC8C50B0 angela ake
810,152,066 *541295A837D80448EF100C5C94A7A87BE1B17628 angelacridland
810,152,067 *541B60F90416E11B10D1F6E5D9E9D0376658A6AD ANGELADAM
810,152,068 *54172E7E24579A032BAC7B349BB80A964625F237 angeladios
810,152,069 *541C389BAA309F6B98C6E977750A0B6BF7B9DB3C angeladona
810,152,070 *541036131A4D5BE456A50D662F55E427AFE3A1EC angela draughn
810,152,071 *5413073D48D21A0CB3F8785D01CA51D73CB01E78 angela etheridge
810,152,072 *54117799E0579ACF1F9C164C2EFDEA81AC892106 angela friddle
810,152,073 *541EEB25FF150070ACB51CF95690F325EEA577A8 angelagu
810,152,074 *541512EA88E0C6BD2E0A3EEBDDE7CF2E9BB2889F [email protected]
810,152,075 *5416525489C98CD37077A903A3B1DF3A33549693 angelakinnard
810,152,076 *5412136803666374137BBEAA1E9C7FE6D9B58EE9 angelamalek
810,152,077 *541499B43F616BB9FD65E647A28087D5B44F9181 angela marie acosta
810,152,078 *5413A8D6B281AF8703E97025185D0E116C240B9E angelasch
810,152,079 *541C595F6037875BD1A361333F0DA36141BE70F5 angela sima
810,152,080 *541B6E23D568764FB68007959FE9CBFA1FCE742F (angelaのsparking
810,152,081 *54194ECFC1B64E3B4584FA095A42E0C585880B1A angel.bergene
810,152,082 *54115D7BC7A74CD59F89216BE9D530B398F7B4D4 ANGELBOOSTER
810,152,083 *541A58F83773951EB6CFA8B698E241D81B2AC1BD angel.byrant
810,152,084 *5411E4F8B216C22F4EA4A3DF7DE205240A259B56 ANGELC8
810,152,085 *54186012179D443F29800112DBE650C66CAD1E7E angel cheong
810,152,086 *541B977E3FA5D091E614D728C71CA1A4CEA337B7 [email protected]
810,152,087 *54168BAEB8786D93D960C9632CB6E2E655D9E5EA angeldero
810,152,088 *5419372C92D79D61ED0C06B4BDA5FB7B92E6FA2B angel.ellenbecker
810,152,089 *541AA0080B243532CAC11FCAECDE6DA089C5743E [email protected]
810,152,090 *541F0B70F551081FE0C6FBEB0BBB5B075FF88E5B angelfrmhe
810,152,091 *5410220FA9FB4B422E32D49393DED2CDBAB2C12D angel.glickson
810,152,092 *541AC57E57C2BDCC8DB4068648C8B800C539AFB2 angel.haake
810,152,093 *5418C66B044CC8235B6F229ED1158A477AC87883 angelhannigan
810,152,094 *5410B213B60F717AAAB093F89CD1EC611D14AF2D Angelharold
810,152,095 *541206752D354C115A3747E214DAA87CB774C547 Angelhea1
810,152,096 *5418DCD3130DFACEF27A32A27D25224C66A28652 angel.herre
810,152,097 *541ED077FEA93FA3957F8CE5378F68119E72C296 angelia shepherd
810,152,098 *5413ED5E4641C798F4C6F56785E7382D80246427 Angelica8
810,152,099 *541AFFC99B1F7367CB4673CDE36760D1826953B8 angelica cardoza
810,152,100 *541C66C39F200724A87FB7523BE1F5BC36AA1DDA ANGELICEYESJESS
810,152,101 *54126635710537D61A2D675ADCC1809D154E6A10 [email protected]
810,152,102 *54162B9773D9384E12B814D0A312C15A1336B047 angelier6
810,152,103 *541EF674DD1D40E22517314C08A77C74569193F7 angelie rosario
810,152,104 *5418AC8ACCE8BC35FC0C8C09602D004A0B2B37B4 ANGELILLI1234
810,152,105 *54143258215EFD600B897C36690D911D896990F4 angelim6
810,152,106 *5417F0D198FCD887E5D4EA98BEFD80649B7D32E7 angelina445
810,152,107 *5410DFE6CD384C9A73B7A9C6BF2437A11849426D angelina abella
810,152,108 *541B5019911BDE8529C94C73FDB4D44FE74B4E48 angelina marin
810,152,109 *541F149C19766D88BE3FACCFB221D721CB06B962 angelinamonteiro
810,152,110 *541F26030B291C832F1CF78A25B60D59CF77930A angelinefajardo
810,152,111 *5410F6BB9FB62074EEE9A479F33C1E5636731A7F angelique.m
810,152,112 *541336C6E756D12C48FF125D53E360A8E54BBF17 angelischarles
810,152,113 *5410A504F2580C9F330CBD3C0DFC77E18BAFCEF8 angel.isgur
810,152,114 *5410D2FB425C6455968D077DA3A776181DDDCAC6 angel.izaquirre
810,152,115 *5410BB03DA3024C222950A35B8EB8B6B6E1F9C1F angelizaremos1234
810,152,116 *541D89AF2E2AEF02C81834BB51404012E52F2E56 angel.jemenez
810,152,117 *54101C6D5A59D723CCFF08C91A005F449DEF7E7B angel.kypuros
810,152,118 *5414F22141FFC5C8CCCE821368E1F2C8908B457A angel.leos
810,152,119 *541C844DD8F690441DA9FA552BAECF1E8AE4CE9F angel.lipschutz
810,152,120 *5411F2146DC0766BFBAC57961CB4E3E91186B7B3 angel.manoogian
810,152,121 *5418D9021A205D962BD07A13C3345C7F59E4B36C AngelMaria
810,152,122 *5415005CC3F5C134E3A64BA1624A10D0ECD022C5 angelmariealvarez
810,152,123 *5417526885C8834EDAB3D7B558DF428364FC1E11 angel.mcleese
810,152,124 *541AAE5D206D40278DB7FF76689E86392763C309 angel.mehner
810,152,125 *54136B69B3CC5C9276EB9BDC036F644B2B5B2D84 angel.merrett
810,152,126 *541DDA3299CC8168A65CA2CC315B6B052D459266 angel.millisor
810,152,127 *54129165B9B7F2458D9BA36424C57FE7AAC6A3B0 angel.monington
810,152,128 *541B5672CEA21AFB9C0865723EEAD70FC7FED2A0 angel.nazario
810,152,129 *541CE13628B44A974D170DC91D304354228C496D angel neha
810,152,130 *541850EFB068E830BCB0209D904ABA49A0F34C7A angel.nieng
810,152,131 *5410ED3D01AFACD72E26124DAF0CA84D99CAD59F angelo.albin
810,152,132 *541CFD999AFAF0C352169BFCB192E65DB5795D77 angelo.backhaus
810,152,133 *5419E4B2B300CAA90189BD349FAE9C07079BF12C angelo.ballensky
810,152,134 *54174E0F254DAA54B7F85D4971EEAC587E3757B9 angelo.capdeville
810,152,135 *541DC826235AD95D238E7684D8EE50D298389CEF angelo.coran
810,152,136 *541E065F2F73F5689FE987562308DCDD2DFD335B angelo.crotts
810,152,137 *541798DB831340ADFF4C49E110D4B14C2AB52771 angelo.duker
810,152,138 *5417488F95B28774317880B0BA3BA1B905352085 angelo.falkowski
810,152,139 *541BC1E8F91335DB6D4D12A45BFE8BB61EACD3FC AngeloftheAbyss
810,152,140 *541F784CF02406CD6E337F89D6AE1CA096ACB414 angelo.gennaria
810,152,141 *54100240EE9CA5E563054AD22314FEB5E20C0E91 angelo.goosby
810,152,142 *541105882974561427D7821E0B4647C7D487CC8C angelo.hertzberg
810,152,143 *541177AE289473B4D90CAA28FC326C2102CC9EBA angelo.mahung
810,152,144 *541B3420EDB3391D0278CFC2636164468BEE8BBA angelo.marchant
810,152,145 *541BCE26914B9C4C329190DCE247E0B1C678CB67 angelo.marrion
810,152,146 *541CF3DD3C0D0C19AA50D2B174A58AA3089B919C angelo.mcgilvray
810,152,147 *54124E52899D4D7DECE187E7EE28DED3D5072D20 angelo.mesidor
810,152,148 *5417E232CFE71A9E3C19D45D71E657889DFE38CF angelo.narez
810,152,149 *541CF81031C76EBBED89B39C6CA75377AAE06370 Angelorphan
810,152,150 *5413CBCC07F9A4C019969374BAA0211D161686E9 angelo.schuh
810,152,151 *5410DEFB4CCC8AE58E2A2707567028A50AD835FB angelo.steinworth
810,152,152 *5414A46E01F67185B4693E45DA3E5F07522485F8 angelo sudiacal
810,152,153 *541A750578A8C92417E084E3B49B136B451C9AFB angelove3
810,152,154 *541A2687E97967D2C3E174743D4B616B432C48BC angel.pagon
810,152,155 *541501B1C0088A0AAF5B3580947BB685C2DC481B angel.pastick
810,152,156 *541AFDF2E6264508647CC5E921B111F6370114F9 angelpatel
810,152,157 *54151062BBDD52E5C6B7AE6C6FAE160CECF8CA17 angel.penha
810,152,158 *541ED400B469A30C1E73BA7A0D79FC9017C3DCC7 angel.pinger
810,152,159 *541EAE4B755E4CE31CF9300A2005C039370044F0 angelrico55
810,152,160 *541D503F7DD081BD5EF5DF8A2A093F1F8556DE6A [email protected]
810,152,161 *541FA7D93453516EF372A66783350C3D571DA1E6 angelshell30
810,152,162 *541831810364591BDD31DBB7980C6956E9ADCC7D angelsotelo
810,152,163 *541795120B676F96DC4FDC90A9FAB1505FE5C863 angels we have grown apart
810,152,164 *541A2C154619C18C11C622B84A8C6A1336629798 angels這名字是在1946年定立的。
810,152,165 *5413ABFB3905A63348790596AB4F5177E8A25503 angel.vinup
810,152,166 *54146AAC963D75D21A56740ADAFBDCDEA4232A48 ANGELWINIFRED
810,152,167 *541E40A8E76558F5D87C19CA79FC5C2C6D5E36DC Angemachting
810,152,168 *5416871456CA0EDF9A657B71370B86A7A35099DC ange:rasa
810,152,169 *541197EA27CC89989328F8065DCBB70512A5DB5E angerened
810,152,170 *541BA6F141DAB2088A802F38E14CB8BB11EABEB8 angerimpulse
810,152,171 *5415A491D810FE9BAF106ABEB98CB1C914555242 Angerine?
810,152,172 *541FF05DCF6F2BA5A1A306029EB7902A57B29594 ängeslevä
810,152,173 *5411A26B01864A44299D6FEB80B48631BBE9EA78 [email protected]
810,152,174 *5414E07FB041EC9F16C2F604D8FF03585BEE9EDA Angezapft2
810,152,175 *54181B691A73A2538473128D62511CF157CB3EB5 A#NGg
810,152,176 *5419EC3896E435EA278E3685878510DB74FA9845 anggraeniretno
810,152,177 *5410CE22A1179EF2BADB23048F20246804850A4B ANgh+
810,152,178 *541BE014CAFDE8C7B186A53CF7778C3282B2BCAC ang hock seng
810,152,179 *541B16D41EC43DF37468727718194B607E81541A angie48dd
810,152,180 *5417C3B00610809D7C0024AB0C0511470AAFD213 ANGIE948
810,152,181 *5412C501319B00668F69FDC9A1DA4FDFA279BBCE angiearmer
810,152,182 *541CCBE724A9ED47F81F578965B514D7DFDC4FD6 [email protected]
810,152,183 *5412FAC22C73A917BBF5C0BF93AF40BDF8510F73 angie,diegerupfte
810,152,184 *54118387C1EFC8AD824DDBC3D5ED5A4147366BEC angie gaiser
810,152,185 *54195843C7DF3C37D6E73ECEE5FAE59F16EA67D3 ANGIELR5
810,152,186 *5411EF5820DFF4C14FAC5CD6E4194DB6C8A2DD5D Angiemary6
810,152,187 *5414D5D71E1D6CC4BA8557DD9EC672AE7466EA75 angie massmann
810,152,188 *541A6E6AF0D86D4B0F8821CDE3055CC6C5BA7734 Angiemoose
810,152,189 *541AD540DDCA1C75E88B2E3C99BC13EFFE85E4E8 angieneuman
810,152,190 *541129CAEE6B71C60D1CE5A862F56D174BCEF7CD angiethelen
810,152,191 *541318D05F87C30184AD80140128F6FA95E56433 angie / work song (medley)
810,152,192 *54197F461267AC5381372E25C3FAC205FB126C59 Angilbert9
810,152,193 *541F156AA6D27D8A837397818BB18C03831B4939 ANGINBSW
810,152,194 *541513D7359D73BE5AB5A111A6CA3E76FDA04834 [email protected]
810,152,195 *541DDC2A45789B70499FB54A649692060DB4F2B8 ANGIOMYOCARDIAC3
810,152,196 *54141707DF37C83B491D902514A74988B427604B Angioneo0
810,152,197 *5411CC604B960F71017C5131ECC39A7005DE42BF angiopmed
810,152,198 *541695C8FF17FDF21B662AF626030B8B02D96D16 angiospermae0
810,152,199 *541480B9FD7F534604B3882E1109C473B1E24BF1 Angiostrophy0
810,152,200 *541CF18996BA175978226D215861BFA7E693F89E A"ngk
810,152,201 *5413E55BC4D07B8B25BEA9DDF16703B681316B18 ANGKHAN-CHOMPHUPHUANG
810,152,202 *5414490C8FE45FC267082BA89FEB1F1DBBA2A620 Anglcterro
810,152,203 *5415438DA68CA29E062FA5C1D2FC7FF7CD9F69F5 Angletre7
810,152,204 *541C111D78C93038B57E68CF1D45A5D6F32BADB6 ANGLICISM3
810,152,205 *5418149F71B640F0E948B92874F766CADBA4F39E Anglicized6
810,152,206 *5413DFADA38D8F17CBFC01D07294AB22118C6D83 Anglikano0
810,152,207 *541ED7AE19690F796AE8CFDE507567F64FFF8D4B anglofrisó
810,152,208 *54106A4528A4746B90504365595B1CB76C513BF1 anglovenetian1234
810,152,209 *5419D640A1578C5D384FDFBC6C7E18B216F0492E angmary
810,152,210 *541EE4E9394B2CE7611B36CABFC9EFB49B182B0C angoisserent123
810,152,211 *5413125ED59283B63991F93B19AC9464085947D7 angolasport
810,152,212 *5415C972AC1650D1980894589D387D4F61722BC0 Angolinha
810,152,213 *541597041C11B75D06410A0E6F1721B174897AED angolotesti
810,152,214 *54138CD154D7EDE5889361EE399ADB2AFCB87311 angoriano
810,152,215 *541648AEB913E5E3E7D5BCDDFE64F7097A7BDCC6 angrc9
810,152,216 *54148E4B5DBF359EF20E57E5D952EE399ABCB8E0 angribs6
810,152,217 *541AA26A877B394410CB88E6382E5D5DC79D307B Angriffduos
810,152,218 *541FF522FF60ACBB0F887C580C3AEB3F0E03168D angriffserfolg
810,152,219 *541248042676A6F8A6207703AC9BA49780E17C79 angrivarové
810,152,220 *541DB9B572AF96974198E5801D8232A606AE98E6 [email protected]
810,152,221 *5418B7C50BD5F74BDB1B401DE6216B3EF7C22485 angsversteurings
810,152,222 *5414663665CF9D9D532EA0222D8DD8D3A751F308 ang_thonghas
810,152,223 *541F0E0B2D59F4DD598452CCFDF08AFCE99D72CE Anguerah
810,152,224 *54162FEF289482FE2B578C7653A2368C65D03C20 [email protected]
810,152,225 *541EADF1661876901597F97BC54A1CE90009CC28 angular_acceleration
810,152,226 *541EAEAAFD31F15A02DADF19C47A8859A0FFA5AD angulati1
810,152,227 *541BB70350C0793DC94B5ECA114D48DCBCD1F9EB Anguleuses6
810,152,228 *541F2F2506048F85D9CA782D9F7011032A42789A Angusgo5
810,152,229 *541352B61351E3BA5F9DF62F42C202FAF823A5DF angustated
810,152,230 *5412A50C3ADB3CED66BCA44E8B668BC0F93A63B2 An"gw
810,152,231 *5411F31D36F41B8D33F341E22ECB02B364466D7F A)-nh
810,152,232 *54114350BA7BF3957F3E8A68FB64D1390CECD1F2 Anh%:
810,152,233 *541320E98F6D8376A02DAFBA4E401186651C9744 anh3rs
810,152,234 *541D29A9A3390CEDDBDAC4B92C0DA312F4369190 AN;h4
810,152,235 *541BA101AC60A2318C4E82D3AE1195E8706E3BDC anhangen2
810,152,236 *541D5B5EC5E41979BBB4DF654C24C6FB4CC7FB35 ANHb3
810,152,237 *5417A5EA6F2E7E72D68A4079C1E377DEF15A8CCE Anheisser2
810,152,238 *54173DF6C830A42C07D6B576FCE71A44741B6470 Anheizte7
810,152,239 *5416C7600613BEA732C489F28C95171F76D6F55E [email protected]
810,152,240 *541A5C92CFEB68B8783DA346808F12D871089EE2 anhjs
810,152,241 *5412A37C423445543527677CC8F071FD34EEA16F Anhkontas1
810,152,242 *541B18F2EF46265126327A1DE52EEAC803616BB8 ANHN333
810,152,243 *541FFE6F72009FCA70D5A467AF881F345A90F71D AN+HROPO1D3A
810,152,244 *541B0A2CB31F5BFF1B8A7ABEF1517BABF030299D ANhuq
810,152,245 *5413E3725A2DB73C8900BFE01D40171781DF1052 anhvu9521
810,152,246 *541E6058AB798F75984E788824CC7ADE19FF78EA A"nI
810,152,247 *54104894E063FC38AD775F8E01B04E48299E3241 An/.i
810,152,248 *541419739BF163D3788C579009AF8802AB87C0E5 A&ni5
810,152,249 *541FCD23F98C4C4AA330A0179E51F069D671CE2A Ani$a1
810,152,250 *5414E7CDE4C7CE6D038CAA0F760E44B8BFC21EB5 [email protected]
810,152,251 *541D5AD73C2F5439C268BA64CB1B914F1AD05902 ANI"b
810,152,252 *54182D6539C5F84E28B3B2CCC9FD5955A1CB5C40 anibal.batistich
810,152,253 *541706087EE3A02E5B4EF5C8DC61CFE8AE21B11C anibal.campble
810,152,254 *54103F64274A96487B3C174E241C8F405FA5CD25 anibal.desilets
810,152,255 *541C72D5040EE281F9ABE2770DE89BCBBF92DAD1 anibal.elberson
810,152,256 *541DAADEC6BA500266ADADFFB18488818AA7B7EF anibal.exon
810,152,257 *541BCE2A5C999D7F2A8E2549BF9F842D26284D97 anibal.fitzmier
810,152,258 *54187CD2D318DCF60FD385E7A2938CD04461EBC6 anibal.gallier
810,152,259 *541BA7610170E874E3566B483009EDD30F8B2464 anibal.hermanson
810,152,260 *541CDBEC255669EF00DCE1641252490DE0BC872D anibal.horchler
810,152,261 *54164AAA9CD634E3A74A74E2E3EF3708FFA2E455 anibal.klarin
810,152,262 *541E94C576CD8BCDF9B9B23DDE6F8A9658943366 anibal.koskinen
810,152,263 *541BB1D24593F6B9C899A61606FDC169CE7E530A anibal.lamarque
810,152,264 *54139D480508D5D43920DF6E562BA2EAA3B2575A anibal.lamorella
810,152,265 *541A3FEABFC4E3C272113F98D67FBA106C9A2A04 anibal.mulch
810,152,266 *5413AD130FEAFE6D09189B989B90605C4BF0ADFC anibal.nathaniel
810,152,267 *5412D63B1A3739B8E6F610586A1C3C98CEED03E8 anibal.schoell
810,152,268 *5415E55F3D026564EF0262A9437D4432702A1775 anibal.septer
810,152,269 *5413170092633E2C8C8ED79390C22DB1D3C595FA anibal.shrier
810,152,270 *5414269377DB78763D8965AC35D6A2CBE8A3D2EA anibal.sobenes
810,152,271 *5413AA231E01D1A93F5EE795E00409E70BAB20E0 anibal.starkie
810,152,272 *54167840FD516A48A47CCBBF3B9394DAA82900EB anibal.urueta
810,152,273 *54173CC4FAE4A8973AC408FD9B1E0C815962BEF1 anibal.wutzke
810,152,274 *5410AF19321DFFD064739F7A044ACEEB503F642F anice bishop
810,152,275 *5410A42B779072C4B680ABBDDB33B9D40CCAC9A4 Anicito2
810,152,276 *541FDE4ECB2A9702DA3252640FC7CC36A3992453 Anicuder
810,152,277 *541D7E831B1CE0C341F7548424BFFF77ED962A09 AniDeceniu
810,152,278 *541ED259D85EF7060C1C8F84B0CB265145C64CC9 ANIeK
810,152,279 *5417A7228E14DE32BC627D3688BDA5BB82E6D759 anientisement
810,152,280 *5410E71C58B1FB42F6E87DB62D8CD6FAA1684041 Anierebs
810,152,281 *541F044D930EBAEDABD6BC32533DA84F23456DEA aniessa12345
810,152,282 *541A92DF4D21E70DEF73511D5A40208B675171C8 anie sweet
810,152,283 *541C8C4438DC6EA8267E0FC157DE9B58ABB69691 A
810,152,284 *5411AAB5AEA019165C11F42F0E2BA56C635E591A Anigance0
810,152,285 *54100B8CEA5614D8D7B21DC35C4E3FD0595B9FCC A Night at the Tables
810,152,286 *541F037D4CC497DAB3801A269856B1D89F65775B anihcnI
810,152,287 *541A9A93EC9934AC89462CAC643F7C87AFA1A15E aniibsw2
810,152,288 *541790A5A60F4C33E485E78E5F55A42139134824 anikasalsera
810,152,289 *541DAF804B58CB04E4A714F9C3AAF157CAEBC684 anilics6
810,152,290 *541097C30ECBCFA9DE8006B1AF7952ECB92C0097 ANILLARIVE
810,152,291 *54121BDB1BE66418FD23794D52EE6DF6DDCB2A75 anil lund
810,152,292 *5412B8475C06AC272C85D938A03CAD1AC87119FE Anim3r3$
810,152,293 *541E7C90DDBFB38587011F580A8821433A8244F6 anima138
810,152,294 *5410AF252A684F4AF188DFB20A7D6B5D3A49D546 Animaavis
810,152,295 *5411E24AE59ECF8CB77F59CC77F08A90D5F794EF Animacio6
810,152,296 *54107040E3C25A7F35ECC59C5F4D3F93B58AF990 Animadv3r5ion5
810,152,297 *54173EBB47AEBB1425B14D751980F566E8254BFD animaineax
810,152,298 *5410FB8C11C9A796598D707C275F3EC57E1BFAD8 Animakim2
810,152,299 *5419E1E66E88A1F755DAEC1410021796E789A02E ANIMALCRAIG
810,152,300 *541B2D626F55A44C22F1FE523F379B0BC937B50E ANIMALDOC
810,152,301 *54172771341108A07C58956D6C36E6A903164C5D animalo1
810,152,302 *541381AD64D4B2148A7ADC2FE29CFABCB742E363 Animalsl
810,152,303 *54115F30889136FDFE217DF6BD6AD85484D0903A ANIMALSRHONDA
810,152,304 *541B39D04522223EB9808D836B89B372DE085CBA animalsu7
810,152,305 *54114C58BEE1CAFF4DE5A965363DAF4A0E45DB8F Animamal
810,152,306 *54113DBB105E3C197DEA3873ED1EF2A33BF11D59 animation-manga
810,152,307 *541D94BF78F5A30106B1C27FAA281E6015C5A037 animationmarch
810,152,308 *5413B9CE3E18B4233B9AF9585D730A042B500B9E animechevaliers
810,152,309 *5418EA92255FE8A76FB0EB0B6F2A7DB188F390C4 AnimeGirlsUSA
810,152,310 *54133D0F974BEC83C4D4BEB0B1BDEE63D7A77D38 animerais2
810,152,311 *5419443A82B66F7B5B6BF5AC9CAE0DEADC04AF32 animex514160talk160
810,152,312 *541970DD6D8707001EC683EE91203B1A88CC0A10 ANIMIC
810,152,313 *541061D9E78FB37BB145375CCD9D19CCF2B66A06 ANIMIRC
810,152,314 *541E7749C8E59AB0F8D49CB5369D3CC2665B0F08 animloia1
810,152,315 *541D2AD293D00905CA0EB7272BEE926540FBDD8D Animons3
810,152,316 *541A77C4538D946EBD8C8FB9397A52CFF7847120 ANINDYA'S
810,152,317 *541A6EA6FFE82C399513ECBA706B430BEB08171C aninhava1
810,152,318 *541C8F8DAFCF8387E0B71C56FC3413CD212DF818 ani nini
810,152,319 *541B293F0B1B0BAB2AD44A82FC5F9A11D0283999 anion49
810,152,320 *54133D66C0C1A84FB6AD58424C96C9D3FEC29CDD anirbsw4
810,152,321 *54153FBAFC26F7F80F2ED719A20974F2F06029FF an+i$+rophe
810,152,322 *541F6A802CF7467970DAA917C32530418BA75C35 anirudhanaik
810,152,323 *541D155F38072E25B6154C1C77F888FA61137452 anirviṇṇa
810,152,324 *54124ED7FACC73561DE9AB9EFE55DE1E4C0EC927 Anisalco
810,152,325 *5418B9689A6B6B9EAE4BC81E04A0313CB9EF8B30 anisogamic4
810,152,326 *541F9E44FABB4AE490FBD7ACFA517D2220D02DD7 Anisopte3
810,152,327 *541100BEA4035ACF922177ECC5A4AEB53C05CEF9 [email protected]
810,152,328 *5418C4A4810D885C289851A805A24D5B2F6C6D3C ANITA(1990)
810,152,329 *541BDE3B0C3B77161754A7BFD678D5ED48A74363 anita.bernard
810,152,330 *541A1B9975427945080757C749E084B92784F5CD anita castle
810,152,331 *54107553EC286EBA692E5EB1727792C8D145560C [email protected]
810,152,332 *541E2EB8C1E47C57DFD777BE5FCDC324CDC829FF anitacoster
810,152,333 *54126FB724381B8B2011F94B6EDDB82119541D14 anita kapila
810,152,334 *54139FC6F183834AB669D39E3C395ADF8C7AFFD5 [email protected]
810,152,335 *541CCCA1246B918079F06F483F824971DB0E2055 anita pettigrew
810,152,336 *541A4D8FF75E3526EF927F187F20ACB2AF674397 anita soares
810,152,337 *5413B10B6C8E74B584A96F82903FE74DA38D8BDD [email protected]
810,152,338 *5413B826CF3955D0CD6E9B393B1747A3AC40D48F anitem1234
810,152,339 *541CBE6A63D323E6587D8DE38BCFC01536BDA9CD anithabm
810,152,340 *5419F95F599A696BD50B35A3A986303FCFC7DAFF anitourS
810,152,341 *541429A56B15260A4628397287386CA093074519 Anitria5
810,152,342 *541DA461EA091654D56FC70D099FEC1F06663FDF anitulov
810,152,343 *541418AF9DB4BB53D7D4CC8CF2B3C5809E69D01E AN)IU
810,152,344 *541B183968ECC1D678D9C043E88740B7129C802D ANivd
810,152,345 *5417B8569C07DE4C0BEEEC67A5CA5DF4034E42AF ANIVERSARIO-DE-CHOLO
810,152,346 *541F32B93D1F59F0D88A6D46ECD88E52476B3A3D aniwa1
810,152,347 *541E1448BD736C4187C7CA36F23063C487D0CF25 aniwde6
810,152,348 *541ACB93473C0563E18ECEDDB88A2E813AF32260 [email protected]
810,152,349 *541643E6AAC1B888EEC873054C735A89053783BA Anixneye8
810,152,350 *541B615C9BA5A95474699B3F088D07F6CC48C684 Aniya837
810,152,351 *54141C1A337BB249688EB3F4B86E5DAF76B9C6B6 aniyah320
810,152,352 *5410D90843AC6F865F3509992E6E86D9005BDD99 AN?iZ
810,152,353 *541F2AE6599863E66C559761832C1944770674E8 Anizalc6
810,152,354 *54179D0CBE4B13AC8ACA32558442505A44C7D172 A"NJ
810,152,355 *541BDA1D09D5498D7D5A3B2178421BA1171A6F38 Anj)2
810,152,356 *5414FDC340A28607CA3EA7E59536D5BA6A0B3C0B a[email protected]
810,152,357 *5418D53C0354F0595B079C2301A63E2F536DC2F4 anjana giri
810,152,358 *5419D8ADC36304E94F6EA4AF81EF6AD79803BF46 anjana rustagi
810,152,359 *54145407B1246E376A3844D793E8104F6DB515B6 ANJAPINK
810,152,360 *5417F82B7A486CA0EF415DD1835DA5574D5E62D3 ANjDs
810,152,361 *541FD7002F450F45A26345785A4364A2A7DA4C01 Anjer3
810,152,362 *541BB6B5937BA68309E2552E019D8E60EC93CA26 anjinli
810,152,363 *541A1290511C1150527B453DD469362C1C369D8B anjiro—dengan
810,152,364 *541FB686460F1FB4856EDEEF1B95B997487790F9 AnjNY
810,152,365 *54137A531AFEE40C8CBE65B44E296EEA5401226F Anjo Meu
810,152,366 *5414661F6F3D08FDE173672452E516500A54039A anjo's
810,152,367 *5418C9C1E8DDFDE32D4A1620DCD5D652E160BE35 Anjoylus8
810,152,368 *54182B8E7E04E01CFD9A296DDF0B50CA391BC1C5 ANjrB
810,152,369 *541496EB366D8A302EC5A2527BAEC620CDEA61ED A-N=K
810,152,370 *541554F5AFFC22B29CC22805831174358C4ACB60 A:.NK
810,152,371 *541A6D504B000A5FD92576BEFB796EFD1A0D3074 An?k!
810,152,372 *54127C437D0224A942E84539AD52CA4A574B4E5A An:K3
810,152,373 *54155D642993DDAF8EA04786853B65B9A0AC07C4 A+nK6
810,152,374 *5413F6D9718BDCC20EDB99F376E62840632AB207 Ankanaey
810,152,375 *5418D22C41380240BDD75803364B2CB5DDF29326 ANKARAFOOTBALL
810,152,376 *541C65AC27DABE25FB965AC488ECB10F292259A2 ankarar
810,152,377 *541520DD86B9C59368EEF47EB1EFE08F54D0A65E ANkcB
810,152,378 *5414B3EBC0C9E104C532A1A3B2AF5F20523E64E4 AN!Kd
810,152,379 *5410A8B7559951E4A467FED9AA2DED9A39D25CD7 Ankd#
810,152,380 *5414FA493017279CE6A183C99DD311DBC404B6C4 Anke)
810,152,381 *5416CA873EAED829632619A27D3180B0D05FD93A Änkeklippan
810,152,382 *5410909222953F774139B34CB1FDDD369BC3C07A ankenysanitation
810,152,383 *5417347D1D7D486104296BAFC7DA756D133F6083 Ankerend5
810,152,384 *54186E69698E85FED69AEA5625F026738DF0053B [email protected]
810,152,385 *54198D952BDFA718D95F681488452685A9A71C38 ANKg%
810,152,386 *5414530982607A449B850C4C0EB98C6DDB138A0A Ankgrown9
810,152,387 *541FAE57FD107A5D766A416786EE4C1E3F16B60E Ankhb
810,152,388 *54164B337114A67FEAD0A137B5D87D65943DF279 [email protected]
810,152,389 *541B9190606D1BC76C5DC9BD5DBD388735D22168 ankitchadha'-'ankit
810,152,390 *54133D54385E99327E167E7C57FBC5EFC826C025 ankitpundireu123
810,152,391 *5412AB8B086C857A852EC228FD18E52E1E345732 Ankjilegged
810,152,392 *541EEC398B4FB2E172F9765408DC8BECD907382C anklagd3
810,152,393 *541DEBD101FB3DF51BBC2E8422D2373A4079DFAD Anklinia4
810,152,394 *5414F538B4E7E530619DF2DCCD1D61403F607558 A
810,152,395 *5419E8F132EC3C85F53337F680C707A04332C78B ANKoB
810,152,396 *5417AF248041DA5E2F9AF61B6C2ACFBF01AA7921 ankosko4
810,152,397 *541E5AFF789B35B7DB7A36531BB93979BF21BD5E ankov(=Tank
810,152,398 *54162306106808B22C702EF2F6806465C1711247 AnkQVuP6Fr0dt0xivmI38GsRvLYF
810,152,399 *541C3DE89EA6C180E689301490C6BED89E4D3945 ANkTf
810,152,400 *541A001C96E14E279E3057DC82B57CBF5166F2AC A."Nl
810,152,401 *541158E47DA9FD8D31B5A4002D22F1B8074A7A8E A;$nL
810,152,402 *541E3A3CFB517A8260070E4FA072F1363C182720 A_;nl
810,152,403 *5410A0552E8560E67913475DC861D1B4EFE9F513 An(%l
810,152,404 *5412F600FE106F1D43CB10216C63BB94CF713AA9 ANl4)
810,152,405 *541B0522BC5C857A919C88A5C3E59297840A8FA9 Anlagenwirkungsgrad
810,152,406 *5412D8CF2BA609EBEEF112169989A043425A78E3 [email protected]
810,152,407 *54122F6B50EF943E1CB72283C3ED934B69F30CD4 anlaşılmazlar
810,152,408 *5413B5C14CF4056055CE95797F4D14386B3D9AFB anlaute2
810,152,409 *5416E0EC1309F7B905D7A185ED7008E9DA299E4C anldycrews
810,152,410 *5412F7BE340574C9A4B6B7B31C89E3160780F009 Anleggeses
810,152,411 *5410CF2A367AD8183844A04C613554CB2B8F4D0F anletened
810,152,412 *541EDFDA64E8A3D7940DEBEB3073E6CA9925C589 AN)lf
810,152,413 *541DB8EB6C30893E13B9AB4B47356027906CBC81 [email protected]
810,152,414 *541C497825B4A8B0A40DCC74EDC6AB3A6E453DE5 anlirish
810,152,415 *5417F3E3C7B96393D1B50F36966547083E9C404C AnLnq
810,152,416 *5413DC7222FFF91D6C5A55581841517FBDF5C7D3 AnlR1
810,152,417 *5419B4B3F6D127469F37831E7C18C1462F853FED ANLtP
810,152,418 *5414EE40766157DFE6B10350746F90B4E7F65206 A)N)m
810,152,419 *541DA68A04DC42B7DB6F533F43BC817869B8A5CD An+M!
810,152,420 *5416FF94D821656D851641333324317B2F005390 A_nm
810,152,421 *5418FBCB43C58D8D1B2A5CDE96F3BA57CC18548C ANm28
810,152,422 *5414F12F48C08EF587EE94635A4CF620824BFABD AN!MA7OR
810,152,423 *54192662C2597872427BE15E48BAAAABA614428E ANM)B
810,152,424 *54110EB4A95CE5168FC88F60A39A330B820CDE72 anmerkbar
810,152,425 *5416161036DD25CA8955121CC37C757B44E80926 AN+mF
810,152,426 *54188AB5FBD0EC9F3724309EC2721E4EDCFC559F AnmGf
810,152,427 *54141CD67812D772AC7BDE4AB6B82501274984F8 ANmI7
810,152,428 *54106A210CDB4A2D825129D378D8A35C8A186DC8 ANMiI
810,152,429 *541A09CE1C8035BA74F0FC7E2E20B523FF9B66BB „Anmitsu
810,152,430 *5413632A6F5E9A1788AFDEFBF616C7C2E5B21ED1 ANm=M
810,152,431 *5416FC25EDFD7969D8C70145DFD56FCA8A8BC541 A"nmo
810,152,432 *541C5219EB4E7178D7F1B0A0F917A58997AED8A8 Anmodnin7
810,152,433 *5419B2901A2AA097A4C94F78763A2AFEDDF92055 Anmodo1
810,152,434 *5411F490EF513067E2D4A897A6551B2733D0F10B anmony
810,152,435 *54155C48B4E3CC019660BA9C73783DA0DC60B49C anmrosu
810,152,436 *5411E03A13A9987503510E8F9191971FA617FFB0 A:nMT
810,152,437 *54112B1B16D0EF2823956323CCEC478A58B079BF anmuhten
810,152,438 *541AF84A0E557BD4103E88A0DB79D776C3440621 ANM:Y
810,152,439 *5416C02F0609515C6938574BB65BDC9721BFBA87 ann07av0
810,152,440 *54153E756A7F021EFA9DD857DA85E4400F1D25CB Ann310id
810,152,441 *541A19928244F9C0B95B4099F0EF5622D7099187 [email protected]
810,152,442 *541471214CF48251CE635E99D76B44214670B728 Ann437
810,152,443 *541BE2E64E0D0A1C95FDAC542E5411B2102EA476 AN?NA
810,152,444 *541E04F1C9029B1C3F31AFDD0CDC92C55571E3E9 anna536
810,152,445 *54172B5D7636C2311630B9BD2D8F815C94B90BF2 annaapap
810,152,446 *541A49C6FC09737914DF438CC2D915F24CCE0D5C annabella sanchez
810,152,447 *541428C28EDDC07AD3A83F17E84F482CF08C8531 Annabelle138
810,152,448 *541E566E286E7CC9102B15E486942992FDA5D12D annabertheau
810,152,449 *54122C9CD3369C143E46E242C953DA3B7F66D8DA anna brantley
810,152,450 *54119288E6E67F720C9368B8DA8C0D0146702F6E [email protected]
810,152,451 *541CF11B4960BBC73AC331224FC121ABA7B1FF86 Annacheri2
810,152,452 *5413C7B080162A2F0B5FA1499B6F112B3BF01C7F annachevy1
810,152,453 *5419AB9655B5C94A9889A4258C62D7054ED4E040 Annacocoed
810,152,454 *5412D98A127DF1483E1B17345A8A88B873503A8F annadele7
810,152,455 *5413D10D7AD4B688D19C6F5AFF3492DB134719D4 Annadh
810,152,456 *541056627B0AE8D852CBC2B19D78E170D1E0B48C anna doughty
810,152,457 *5415E2B0D90FAD9DB825F24C69A33A14DFED5381 annagolf8
810,152,458 *541B6CB62295F64DF3FEC38BA183B0347B3D1208 ANNALECK
810,152,459 *541C2569766560D4D6C5F136F322B75EA0A40E8D Annalise251
810,152,460 *54187C7773D7C17E1FCF388672AD2441295625EB anna mancini
810,152,461 *5412B0F31B3669662CC954516547BEC4FFDED150 aNnaMarIE
810,152,462 *541B94352956B4041E427D995B106E2BEBA8A176 annámot
810,152,463 *5413079362F8C0154FBED2FA554DCE63D61A9947 annaotten
810,152,464 *541A1A1AA2662B5DF0EB8B9F174FC658E90D3CF7 annashadows
810,152,465 *5419B48C03773B23F3F170F2AAC740B57062A22F anna stead
810,152,466 *54185196B78C9B37099135AF9FDFA15D342C836D annathorslund
810,152,467 *5419E72542E62AB41427DD6239751616449407AF annatjiebuys
810,152,468 *541B40F5C2386956944A3D42CD7F5C9A3066ACC0 anna widen
810,152,469 *541EFD4E755098D91377061308ED91345F2B1E02 ANnb"
810,152,470 *541EC9D0B023FD95E86E5FDFA7BA610DF1923391 AnnCM
810,152,471 *5411655B8128FF2EE9FEC28952EC3DC03D65C455 anndrais
810,152,472 *541A1F533ADFF40D1B80DFF24FEF692A35F2B12C A
810,152,473 *5410294A85F366C5A6B730192A19EE92560B329D Anne2007
810,152,474 *541CF9C6C0C5B817A8044DA10B181CB8564DACFB Anneadg1
810,152,475 *541AB27BC579E826491C92F796B2770A287664E1 Anneamigaed
810,152,476 *541C7422EE59D660A545AEA6342D1EB21BC4DC00 anne broussard
810,152,477 *54166BDCA6732F57E722A5ED62F9B49F13B9830F Annecocing
810,152,478 *5415D50749D43B4644C791B70DDDDD18CAAE6705 AnnecOrINNE
810,152,479 *541C6A0B4E0AA53885929DA9B32E1F49AC5E7B9E annecrisp
810,152,480 *541FCE92426E60BE66E654D574BE725FF9D95B04 AnneeCourante
810,152,481 *5410341AFCD5682D62BC26200C9D34FA52D7DCE7 anne holzinger
810,152,482 *54110B40A82E98D41B1B609015AB632A9A791AA2 annehome8
810,152,483 *541C5C221BF98A2801DA2BCC660C95F67156DF73 anneinck
810,152,484 *541ECCF70DB07E4E1484537C655321EE63536B01 ANNEJCAROL
810,152,485 *5416677CA79298AA8EDDCF5A972566875CE385D6 anneksa9
810,152,486 *5411D7A3E2CA322127354AE369AE72B08B6A86A2 anne lapointe
810,152,487 *5416FFB095D4E7C80845D4BAD649C0D8F448A330 annelienilsson
810,152,488 *54113DCDEA4965EDD2F8A9F9557336206B898F34 annelynlocsin
810,152,489 *541F6528BAD2267923025E7D94B05EEC1ED64325 annemarie hanekom
810,152,490 *5410D045E031FA88B1F58E5BD70267286DBD9A77 anne mazer
810,152,491 *5419A57E2FD884574DDAE4AA65F9A332E18F4A9E Annemett1
810,152,492 *541623E2163C447B11DE11A219E5FEFF21A65067 anne siebum
810,152,493 *54146F19A0D52E9B77E1080BAA74CD76089587B9 anne tapnio
810,152,494 *541124F1B3472F44D078DE7E0FE600A7BBCF0963 annetje112233
810,152,495 *541B7442EFB15997A34511426C15D9AA59CAD01C [email protected]
810,152,496 *54151A339693D0D898575C483D2310D4ECA5E36E annetteglenn
810,152,497 *541B61931244CA4FD4D57FBB5C3DAC10802AA5E8 annette main
810,152,498 *5417022A0A9CEB5080849572D7D435DAF952198A anne victoria
810,152,499 *541DADDA0CBACD1FD4DC31D6E6AD700763F401FF Annex18
810,152,500 *541FEBF8D313C23AEC959BEA9641189D1E95F00A ANni3
810,152,501 *54187CA190ACB68663417582192B7B694DBE5300 Annie445
810,152,502 *5417361293621BE54A7B6103FB4C58441C4458F2 Annie696
810,152,503 *541966A34FAEFB08D1F1D9EAD7FD2B807A4F5880 annieeatme
810,152,504 *54148365B87B77E2B7DA72301E7BA2F7234B04D8 annie fenn
810,152,505 *541B0C3406492C34920E3DA58CFFE842AB110C63 anniekozak
810,152,506 *541DB7EC5D933705A4881D44CA4C12E4888D63C2 ANNIELLIDAE4
810,152,507 *541FF6CA7D8651B3856D4A105A0D912252F338CA annie prentice
810,152,508 *541EBBFE09A641F84C03446CBBC088CA676904EA annihilator?
810,152,509 *541E95BAFA9A5884115535394970B80FBFEFFD5C ANNIKA.SROKA
810,152,510 *541DF7052501B95B13568D3404D4599B811B65ED ANNIKEKJ
810,152,511 *541D346266D5FBD80B462274CCBD9AACB47A88C8 [email protected]
810,152,512 *54110C8A3E9CE055C3F0473F82EBDD1EF7F2FB6F [email protected]
810,152,513 *541C2B940F292F1AF395CEC61AA28FF40BAAED77 Annīts
810,152,514 *541AC83000E12F67677313D69E136563EA6CEFE0 ANnj-
810,152,515 *5413CEB143C339D1749A9A5E0411F960E58704F2 annjavier
810,152,516 *5414B3F92715951BD593BDB695921A7C135B7C02 [email protected]
810,152,517 *541710DD921C72EDF2E59961752B5D947C909D0B ANN_m
810,152,518 *541ED098E6DC7B4A4935855C6B6B645B4BA17197 ANNm5
810,152,519 *541C1A8FAF07DD643B70C7618472BB9C7E8BD800 ANNMARCUS
810,152,520 *541621C0B0DF97260274CF2D42AEB7FA841B5670 Ann-Marie1
810,152,521 *5412D64C89F31F9A8AC205B62BB20A81252CDB43 annmariegetz
810,152,522 *541934C134F534BE16C4AC7E30F7ABA532E5E51B AN%nn
810,152,523 *541606A87B5DE3EB2D4E03D3105FB5D39A3F3712 Annodare1
810,152,524 *541F80F5B9F4DBC8256A072927987B62E8919B98 Annoia1
810,152,525 *54120B5216DC12A190C592D5ECD4F3B7F7F5F06B annoia2
810,152,526 *54146C43D77DC495B6807F323170BFC8C127337A Annotasie2
810,152,527 *5416A18E902CE74D7F3CDB59B348825BCEA7F0C7 annotationAttrs
810,152,528 *5415AE5DB2CE6F931CFA07DB22BADEDEC448948D annotatively3
810,152,529 *54145E416D71F8238E3E2FE6D4C63E1165CA5B41 ANNOTAZIONE
810,152,530 *541251B349DFE84B38ADD6751B6C87ED47DE42A7 Annoweb
810,152,531 *5412CEA2B1DBC3A885ED9E392E0AE7814DD66FEB [email protected]
810,152,532 *5418AC423181166A24A39A5D2C50EEC20B53827A annoyyed
810,152,533 *541D72EC03B30FBFD8715ABCDFD2DD9403AC0D8D ann soliven
810,152,534 *541A08298130048FE42D08B16DDFBBFCFE278DB4 annstundt
810,152,535 *5411C949BBC419B0E37E7CD8260FB9E131101D91 annuied3
810,152,536 *5418397B118878074D51B496843A0EFF9F63AD47 annulateding
810,152,537 *5417026F614EAAB7151C1C5B00BD09A1A6E0AC40 annulleerisid
810,152,538 *5412882B16705F93610FBCD308C1C82E40AA1E0A annuluS
810,152,539 *541CE3D87F6E7C77C80982FBA45E4EEB11818DCA annuntiaten
810,152,540 *541F5632412EE428B2EB748FD000A63D2E4807E8 ANNUNZIATOS
810,152,541 *5416C6EB59BCDB0231C55AB52E2ECABDBFAC3399 annusarne
810,152,542 *541E671DA0413AC3D9E259A3A5252A920D0BEDAD ann valdueza
810,152,543 *541E1C50BD260C3D185BD07111DE1273C2C3888B [email protected]
810,152,544 *5413986ED4DA81C39A1562586C19E8914A0287F3 [email protected]
810,152,545 *54109F3E66700AD9260589ADC72933EC9E8B24AE ANNYS20
810,152,546 *541EEFC04B08FDF060A2BF4ED39600850AA07246 annysued
810,152,547 *54113F14EB034D5060D2E385FBF3DA17FA0FE371 A#NO
810,152,548 *5412369A707D1921D352CF78F53FA87BA909FE1F A#n-O
810,152,549 *541E844286BFE1BE3817A966CD8032A2B19585D6 Ano:=
810,152,550 *5418B7998746C06B12E68873779B295E0FFADEF1 ANO 1
810,152,551 *541AD77579867531F130E63C62CEF4230B89B687 año1958
810,152,552 *541477B84B3348B3D6961FC3CA6A84A30BB97EC2 Anobject0
810,152,553 *541D8C1B826FCE766A977F8C8DB391C5CEF614B6 A Noble Sadness :60 (b)
810,152,554 *5414ACB7D5C92F7E3FCC399DB18E7ECE84EBD6E2 anoche llor
810,152,555 *5416277373B7273DCC54B0AEB5C3B929C1728945 an ode to samantha fox
810,152,556 *5411FA7E4B27728DA6D469603A6D80AC574616F6 Anodinses2
810,152,557 *54109B4B00DE83679EBAA682AF03E6C78CBBFA63 AnO.f
810,152,558 *54181964D67CE2B4AE70E55EE6C2FDD0752EBA4E ANOFw
810,152,559 *54166153820EF01C3F61C2B6CB0ACD1C082824B0 Anogelia
810,152,560 *54126D2E0204460A2EDBE0C2580455058A235C22 anogmike
810,152,561 *541D1F9F9FB69ADAFC6568028F5F6374F05B757B Anoifllib
810,152,562 *54181A242E7D41BEDAF8F5539BA351A66932139C a
810,152,563 *541483CE4B79C2D91B3657546A1CCF85E4BD68E5 Anoiroting
810,152,564 *541B848473A2FF0B5689766E06BFEC540702E341 AnOldFashionedCountryChristmas(disc4)
810,152,565 *54116371636F0849608161C3643BC81D5969CBFA Anole!
810,152,566 *541D3341BE7916666A91A123467C245AC4B88B83 ANOMALYRESPONSE
810,152,567 *54170060668135CB85372AA66B87A5B83E3F9754 anomodont9
810,152,568 *541FB28F5D3CB03BF0DDC18DA2491A2460F97AEC ANOMURAL7
810,152,569 *5411DE30386E2584672B3560C548797D282EB3BA Anomuste1
810,152,570 *541DF6BBCCA4BF2D5A5BE77918AF5D2035FA3E77 anomyar9
810,152,571 *5416B34BF4C1617D32FC887BD54E7118EEC3FB72 ANON-ASSET
810,152,572 *5418256079153173FB5E1823D170819ABD37D76E ANON-AUTHORED
810,152,573 *54140896709EA810456F5085583CC0F6F4957EA4 [email protected]
810,152,574 *5411B27F2AAA30FE4E7F0F3B7D3305700BDAA1A0 anonye13
810,152,575 *54104690E6620D362964C2EA919EF0EE961CCFC6 anonymous160talk160
810,152,576 *54124DCBA29C6082E676F32045FD716338253C5A anonymuck
810,152,577 *54175EAA5EAFA9EE1DC8E8D58F8F6D9CD9FBA9C2 anoopmotwani
810,152,578 *5415D0D3287F6FA422CAA067232C675121D6B6CE ANOPUZOSIA
810,152,579 *541B7537DEF27CABD8CAA29F4ED6D929842B0498 A,noR
810,152,580 *541F9B13405BC3CEEB01236B749028CB73DDFEA5 Ano.R
810,152,581 *541D8A64DA7444945E8E18AA926F21EE00E3C7DF Anor2
810,152,582 *5417C26ECA31752C800E06DF7EE9C8F0FCBF90DE ANOREXICCOW
810,152,583 *5412938EFF40DBA2A6D7F48AFA2D62BE0826C786 anorg123
810,152,584 *5411CC1E0DB1390C747D5B17C7CF23E6662CF6CA ANORIANUM
810,152,585 *5415AF49FB510EEC01883AFF87349F468065141B anortep3
810,152,586 *5419A376F0CB206864B4CB23428ED9DCE7BAB97E Anossaih2
810,152,587 *541B9B04CA1331A2D0517EA3203D152737EE5A31 Anotare0
810,152,588 *541EC66A63F21F0E51A623E6BA6697AA5FEF0B71 Another Bubble
810,152,589 *5418EE58CEF669EC3527C53EFB1ECF4FBFD02D93 AnotherDeadBoy
810,152,590 *541BA6477C7342B676714EA8AC8CA3C6C7634FE9 [email protected]
810,152,591 *5410D248657D6EE7F1A102D8B856063E26148A23 anotherheartbreaknow
810,152,592 *541385C0798B62E5F56EF5176EABCD45F30E3E16 Another Kind of Find (The Primary Edit)
810,152,593 *541014F4C5440EAB62156CE0E68398D754E7284A anotherman'sgun
810,152,594 *541C11852F19FA58970FC1773B111F7A479A43B4 anotniaed
810,152,595 *541CEA881B5AEA3AA1BFC76D84DE8BBE2060203F Anowski9
810,152,596 *5415BDB3E1B0B74BBA5D84CEF7D30DB6A7781B21 ANOXEMIE
810,152,597 *54124B0B2A99B303C697D417E8E844C12E0238EB anoxk
810,152,598 *54109E2DE730FFF61D7FAAB9FCB2A9E58FC46766 A-N_P
810,152,599 *541B0E82E8AE5D802D2A38587EDCC8080CBCBAC4 A-n
810,152,600 *541336435E5F793B60C132A50EE1274E888F8C7C ANP5U
810,152,601 *54154934A09F8CC962A272C54A134B6C84C6F4B0 ANPEILEN/DIXY
810,152,602 *5417FE70A73DFB1B665C67DE36854CE65EA8D112 anpeiles
810,152,603 *541A3D11364832E60E40F3A4BCD7535609D26CA5 anpesiling
810,152,604 *54195901DB3863FBB48F535B569CD3138E79F269 AnpGQ
810,152,605 *5413761F8B5D679565D2492A267BE64E643BE7BF AnPKH
810,152,606 *541A9073557A6533B035A06C075539F62B1C7EC8 A=NpM
810,152,607 *5413879DBD176D2224317B2A2ABC9735892E5AE7 AnpPK
810,152,608 *54153FC0CEF69D68E5AA6DF154A52261A8E98732 AnPQA
810,152,609 *541A9412C424AEEB1B254C0F64F40EDEABD5D1F2 AnPtd
810,152,610 *541A5BED6E1A5011DF879783708CA80AD7487C0C AN/pU
810,152,611 *541AFDB00FA978DCB0C7DBF18B2ADD9474C70F30 AN/PY
810,152,612 *54157CE789A9D438F406F265E13525B72553B270 ANQ:_
810,152,613 *541CC31B1CB1B65873D3B5B7F0E790AF1B88B2C0 ANq
810,152,614 *541296CDFDC75BA25DD6AB0B46815901CA31E5BE An:%Q
810,152,615 *54163B142E933F12259E182D9C348EDB65632590 AnQ3?
810,152,616 *5417D2CA6CBC99ECDB3397DCCC07E1863AA92E90 Anq/i
810,152,617 *54183289B5B57FE8FCBDEC2A8A99B8E64DCA3798 Anq&L
810,152,618 *541597B4BB11123147C4C216651AB63BE56D3954 ANQLBKWAAN
810,152,619 *541DFB09CAFAB557D77458AAFCFBE626B2F4E005 Anq(n
810,152,620 *5411A8F4318B56F091AD2747C3B35B53F0CE39F9 anqounwadijuhannam2
810,152,621 *541266BB96CA204FC314F2984CAE0B84D51FB493 anquere9
810,152,622 *54161BA0D4C4897DA737C791DE741496AB1F5A17 AnqY)
810,152,623 *541765A58828122773CE4753B0196A1EACFFA7BD A+:Nr
810,152,624 *541564664145026390D0B2C1F905150792422244 An.%R
810,152,625 *5418F35E2FC3BFE6951978C41EAC29A49003BDE2 An)r,
810,152,626 *541A3C123C46E4E541126A6BF77FCE44671A718C Anrabeling
810,152,627 *541A2A9C6D8F32C25B95AD9D27EFC927C0F31536 anralvyh
810,152,628 *54173528EA9562B751EE2C1548CA0F04FD8378AA Anratyrb5
810,152,629 *541C0F39E91907035C72304E561E3FEC980DCFCB ANR(c
810,152,630 *5414319E558F1C593DB98F4778D8BF5F3BC5F6C2 AnRCe
810,152,631 *541F28299771CB12B97556C7F54D4DAAF8B75C4D anregelzeit
810,152,632 *541D26D38BF9714D2F676BA3718B9007B44D3FDF Anr;h
810,152,633 *5410A521D3F44E16C4AB285CFB53952544A31EF5 ANrhI
810,152,634 *541399871C93AE3DADD5DEDD9B32A988A904D068 Anricmio
810,152,635 *5410C649DC7D2CC071C36218D21D906C0C86FC04 ANrKj
810,152,636 *541CC3CEEE9EC25BF8B4615A7AB0D8776B758D3D A_nRl
810,152,637 *5412865637841265AB3FB629B4AB9F496D1784C5 A/NRn
810,152,638 *5418DB09AABD5D7E88997E6718330C2198F5E3B1 A+NRo
810,152,639 *5415F24CBFD642C9F812D25365B8153D4FF3A82D Anrouter3
810,152,640 *5417D468A3C82633FF60B694C1E6137526C82FDF anrpr
810,152,641 *54181866F8069D4D9DF29444B900B29D05100376 AnRs_
810,152,642 *541A72244A0DFF54E17773E8B2B86145BF8E4F02 A)nrT
810,152,643 *541356CA84B08EF0AD274B61198C717370751E9B Anrwn
810,152,644 *541C35881AA2A61E063CEF2961C0B9CB17B9A539 AnrZQ
810,152,645 *541A57569FB3FD19849BF3F7A953FE24CC8F8839 Ans4X
810,152,646 *54126E51B0535223A45BE8F6B9CA673A6EEC99EF ANs5I
810,152,647 *54118627BE08D9C4511E6C76E6FA67547C2E9E4A AnS.8
810,152,648 *54192E91557AA01947B4C7BAE10B8D42F00F9051 ansage"ende"
810,152,649 *541176E18BED645721243683D61B473D8D986E90 Ansageri4
810,152,650 *541BBF05A83F6243D2A722B916FE2111FF0FB91C Ansaita2
810,152,651 *541FB7D5CA4E6B16489E38A2A326B1772D8CE1CC ansamensium
810,152,652 *5412268E261C9AB2374A5C66F62F4CF608B7759C ansariebato
810,152,653 *541BA5BBE30D75C30E46DD8FD6791C2ECF64A74C ansbachca
810,152,654 *5410933D311FE0ADF5F2E0E923013BC6D63FB521 anschifft
810,152,655 *541F5F93B23ABA29E2DDB6A2405234F64ACCFC9F anschlagen!
810,152,656 *54168E985F2103DFC0649E0BA5DB8C8E43894D94 ANscU
810,152,657 *5416821736BC74238E4CF164FA6EFFA75E3E799E ans-dattente-on-roule-sur-le-boulevard-des-allumettieres
810,152,658 *541C8165EA66281E4B44EA34E829F890EFBE1E4D ANse?
810,152,659 *541CB2DD79EFA1182DF6E6788B656B5EBF66CC61 AnseI
810,152,660 *541F7EE402EE24AE4B3599420435DEB01315762E anselene6
810,152,661 *5415EA43828AA49790EDBB4A06888C8CD89627FD ansellwilliam
810,152,662 *5419460B37696B6CC1AAB7A953A579731A2AFB26 ANSh7
810,152,663 *541C4D64F3297D58ABFD38D3D6E3C946FEF56FEE ansiares1
810,152,664 *54159357EEFD775571CDEE6C1A676FF59320C4D9 ansiases9
810,152,665 *541C359402040DBDA69BFEA297722EEF06B937D6 ansiatzen
810,152,666 *54184CC0E4524F70C581FED61EC398F2DE89E88E ansiedlungen“
810,152,667 *54155E04DD27836384A45F15AA61C34710252ECF ansignan5
810,152,668 *5416F0DFC9F4C21254CED4799446DE3620935838 ansineda
810,152,669 *541EA39200AA7EC76CB099022042A995AF622B61 ANSIOIDEN
810,152,670 *5410E7BB16539D883E0A571936F449AC5FBA4BF2 Ansioita5
810,152,671 *541B5D9F4819D8541E015814717E842AEFE0AEB2 Ansiotaso5
810,152,672 *5412A6653511D44E56DF9230F0B917CE495F78B4 Ansitera8
810,152,673 *5414B2406BC9431CC2ABCA9CAF7E1C4E57AE1956 ANSKj
810,152,674 *54169FFB6A8FAC47111AC4E14A1095716CADE0AD Anslaa6
810,152,675 *54112832977548E0728E1C66D132F268EF7E7B49 AnSNL
810,152,676 *541521C2CAA97FEA7AF69B83632207BECBDECEB2 Anspaughing
810,152,677 *5414F651EEA7720D59F6E20BA31455CC462B57B1 Anspruec1
810,152,678 *5418EBA8BC1F9F54FDBE147003E2BC71A66C5E76 AnSS3
810,152,679 *54133DC7B92BC81B8F735A8995483A587FDC696A ansschnaes
810,152,680 *541A18B7F7DABB9A8E50825ACC1B6C855592C41F ANSsE
810,152,681 *541E979FE66937AC57238FAAE5683625415B6957 AnssiHirvonen
810,152,682 *541FD957F6556CF37640726027DB57B95742E42D ANSTACHELT8
810,152,683 *5417D2BF40F5A60F763818DB0FFC343B4EBF457D anstaltmakernes
810,152,684 *5411F8B3B9260D191FF49971E4EA136D75D99108 ANSTROMO
810,152,685 *5411B9D9C8F1670869FAECD8D81E4324A567E7BA anstruthed
810,152,686 *5412F34DA92F8668A36EB30D7915AEEBE6B18B91 Anstsina2
810,152,687 *541FA58E62EB188B62B427BC0A160578E83AF603 ANST
810,152,688 *5412F1A6A0CA46628270CEAEF7918DA2CDED95B6 ANsuo
810,152,689 *541EDF1F6E3DB9C26370DF13513EA8A808ACAA23 ansvarsforsikring7
810,152,690 *541C79A9FEB10515237172AB830515310D2CAE04 ANSW3RA813
810,152,691 *541795B09BF506446A1BCC417E31671831C14A94 answermethis
810,152,692 *541ADC789DF3DB3AC4E8B43C44B55CD40264FAA3 A_n;T
810,152,693 *5415780311196922E8320E9CBF7F10EB3D7776BD An$"t
810,152,694 *5412909512F6B77CD05A99731E80CBEC1C195E2F AnT:1
810,152,695 *541C8A1D3FE81C5881C164087E523CB49DF77257 ant1ar1$
810,152,696 *5412C0AB4AB3214A763CA4A8C18DB33F79C1B6CB ant30ony
810,152,697 *541DC9C29A4AE20D7EE9287D1E3F8E66200834F7 ANT7(
810,152,698 *54142A057A92FBD29E1C08E2E51320C31040C230 Antabuzi
810,152,699 *541BCBD6217A1B53A1B08721053BD360F91CBF7E antacildas
810,152,700 *541EA254DE4C959F73ECC92FD246E0C1A74BEC68 antagonizastes1
810,152,701 *5412695F75FCAE18CE9A08D08ED590FE231CEEED antakya-synagogue
810,152,702 *54117D1850A8545160EEA0116A3339C0C7ED83B1 antall8
810,152,703 *541DF8288F22768E3FBF33835BE3725C16A54E7C antani1980
810,152,704 *54176BB7F266CE18124BB2805E8183A239E8E1DA antarctic123
810,152,705 *541638AD29BD6480D37E6538E6CE2010B66F326B antarcticabennett
810,152,706 *541A99CC3138F2D53EB7A8D0ED84CC0F9378C612 antarcticakaschak
810,152,707 *5413C059E135F5FC4524A5AED55720665CBE5663 antarcticamonaco
810,152,708 *5413E7DA98A1ECEAAA210A5D4AE7FF4B1F42611E A.NTARE
810,152,709 *5412BDA41EC28B276D1F4F26E36AB82961E244EF Antareso8
810,152,710 *5413C9CB5D3CE7562AC7576C8D151707C13AF465 Antasmeses
810,152,711 *541CD4D2AFF7A50334173DDD7B256840EAB81E46 antauαiras
810,152,712 *5415B45B511D042C0F5412FAB02D73D9D23121A7 Antaviin6
810,152,713 *5419E2BA5071422E7C2F33BD45E6425DA817AF3E ANt:B
810,152,714 *5417E53C619CE172C218EF5B1F6A3AE9D7C1EF25 ANt+b
810,152,715 *5410430A79D1CA0B217FB2154F10761E32D7201B Antedawns2
810,152,716 *541FD7D1B363A37085ACA424A056C370465A2880 Antedonidés
810,152,717 *5410CC13DB910156A47192D9E5F5FD9BF36D8AC6 Anteinitial3
810,152,718 *541CD5F297EDB5175FE1CDA4CBC199E18162B4EF [email protected]
810,152,719 *5418EA90473F68C2E9EC18D508A7AB7D282F5455 antenicidio
810,152,720 *54123B29D25F8B89AF24669FA7D810B5E558ED46 antennemast3
810,152,721 *541B295CE102B08EC168316BCAC7C3361C6FD391 ante palacios barcenas
810,152,722 *5411E0F06A7D95BD7DB128E8721454A344EBDD94 Antepasts!
810,152,723 *54146EFDC8B0FA726E0F652816A98EEEE24C3F51 Anteponi8
810,152,724 *5416927A524492B22078E63699A9120D67F2B26E antereformationaling
810,152,725 *5419D4EAF233C80C33E58E8F72CAE2A8A8648FB1 anterioara
810,152,726 *54150DB16A05EDD43F4CE2A542F7F65F8FA8FE65 anterozoid
810,152,727 *541E7856601B8CE1ABD2E0AA78A4D869A7E65511 Anterselvie
810,152,728 *54167FD8FA88E9386C77FC8C038AB647E9885DE6 anteveislhos1
810,152,729 *54119F5CDD9968EBFE173D74022FDD1F1B04AC6A A$NTg
810,152,730 *541C0CEC867DA22F0D3A80BEBFAE02B263AE62EA anth507.tripod.com
810,152,731 *541F9B0E8257FADFEC0D97A661DE9D9047D99631 ANTHACK
810,152,732 *5413B611D0FCC705ECDD2307542482FF24BD1E85 anthajam
810,152,733 *5413EE8BEE1579E79EC6AA979F865766CEB1F133 anthalten
810,152,734 *541E9CF4DAE29AA7B8B3E8FA900FF47177FED0CF Anthawning
810,152,735 *541E09E3BCA53770AB086C2F55434AE7342755E5 antheawilliams
810,152,736 *541A95823DD0C2EF710DCC71331EC39275512046 anthem: chapter i
810,152,737 *54177452A847912DAC679E4FA3B8AAA3795FB41E Anthemeds7
810,152,738 *54189A90320FFA5787EBD3153A2EE546D3FCA0E4 anthemfortheyoung
810,152,739 *54193BB5C30AEC6F6EB5B878D41CD4DD7EF55A3C anthemics
810,152,740 *541398ABB02BCECF6231E200254E6B23D6D64C13 ANTHILARIA
810,152,741 *541BCA340B83BDC87D3A775422DB89616A7E5AF1 Anthillonline
810,152,742 *541F22BE4DD9631F813AFD522199A5B4B959F06D anthography8
810,152,743 *5416340345D3D881652BBC2127C27519D4198909 ANTHOMYZID
810,152,744 *5419284668986AE19EF44C4290DF21F026FCE0A8 anthono.bbs
810,152,745 *5410DAA4EDE01DD179AC1BCBFC0F9C03E3F653AB anthony025
810,152,746 *5414A737B2EFCC7482E3E111C596A78EB07B2534 [email protected]
810,152,747 *541EB6EDD80F432C8D26D1D2E4A4FC70B9B92B44 Anthony789
810,152,748 *541E01D9D0406196C930875A950205E8F4B64152 anthonyavellino
810,152,749 *5411E177997DC7CC1AF0EE985FB191F1C6902727 [email protected]
810,152,750 *54170E46A5A8B846B145388BED7BAA1DE29663DD anthony.benefield
810,152,751 *5412282E6CC40A907F892CA0B85027F94A4437DC anthony.boeger
810,152,752 *5412A332E6EC52CF517F7D2D3F4729C004476280 anthony.boghossian
810,152,753 *541EA4E9EBCBB5F126ECF1FA07020FB55C94665D anthony.bookbinder
810,152,754 *5416C5565DE801038A25AFC3D443FB85C6C43D9E anthony.dauphin
810,152,755 *541945039CE9D1A80F7423D2EE2FE6DA757BBB36 anthonydicesare
810,152,756 *541B60B478F53159E6E9E7EEFF5113BBED4580A1 anthony.flament
810,152,757 *5419AE43FE29FD8DC3E790875FB2EB679DFB0A1B anthonygold.co.ukwww
810,152,758 *5419144DA57E37281C3C2E11C7F264957FFA1677 anthony.hilmer
810,152,759 *541FD7C929A83A54A2BBAC7E4CC8EAB316E15B3C anthony.joynson
810,152,760 *5410B9F294195463A1436744C189A957DA607265 anthony kijako
810,152,761 *541307956A18652301A81D19753C58C316B54387 anthony.koonz
810,152,762 *54170A27AB94DC0D5D8E1C183F43D2EFCE789C20 anthony.kravetsky
810,152,763 *5410306B3B6019600FFDE051E450C3F6FF3D4573 anthony.kubitz
810,152,764 *5412B0E5246FD8241515BBEA51341F6E22916514 anthony lamothe
810,152,765 *5412530AB1CC83D07E216228A9FD90586136C808 anthony.maltba
810,152,766 *5417E028F8F60258C3FA1B7CD0EA10F9225AF68D anthony meatballs
810,152,767 *5418D7AFADCBC43A9BB4B4154445E666164BA3C9 anthony.nelmark
810,152,768 *541B94523C86F1B377E5EC399B258EFBA7D40417 anthony.nicklien
810,152,769 *5415893C1DFC92A47E71BF11C78E17022E8A9082 anthony.nicolls
810,152,770 *541A3AAD7137B66F1A414732DF378C2039A7996F anthony.normandin
810,152,771 *541C6F3EC03B9247EF824573B8F19DDE3E6D8615 anthony pabustan
810,152,772 *541ECA274B915182D55783849CE0E62C4C6F045E anthony.rabold
810,152,773 *5419FFDE8B70AEC25ABF6A7FCFB847AE8D79A5A7 anthony.ramerez
810,152,774 *54182FDEFC88961E41B106A6C5BCCA22EB9A0BD1 anthony.rettkowski
810,152,775 *5419788A1B87EF27FBDE3E363E9D512EAC357042 anthony.ruffel
810,152,776 *5416B36DC8FFE4A2FAC6AB931AF12F607C553B72 anthonyruivivar
810,152,777 *541026C94980DF26CE80BACCB9868EFFC155377B anthony sanico
810,152,778 *5412945D543B2800DD7C5FE7827806C692556BF6 anthony.simon
810,152,779 *54147230F82C6178CE70B17E6A96A249D057DDBB anthonyspalla
810,152,780 *541B4317A786C0ECA0E8A204B8E8524697BFEB9B anthonystrickler
810,152,781 *54123AD1CDC886709911790B26B20F3638E9BD45 anthony.stutz
810,152,782 *541E4F00F6356AC5F7F7EED6A0A153985D89A135 anthony treccariche
810,152,783 *5416BF72ECEAE084EDCDAFC7DD89E5D53E3F08FD anthony.tuttle
810,152,784 *541E3337D1083875B0228A665647E660552EA4B2 anthony.vanwey
810,152,785 *5410BBD9FDD74C5621277F8E42AE9FD601C40E9B Anthony Wong Collection 1995-2000 (disc 2)
810,152,786 *5418DDF0C4C1EF7BDF89EA9CF073F205C7AA1C66 anthony.yahna
810,152,787 *54189A44E6494BD17AF1ECDE77040D52CA9DBD2C anthony.zimmer
810,152,788 *541BDDC9BF3C715D0B8E028A886D4FEBC78370FA anthophila6
810,152,789 *541B53DA5B1D5F75A3461F8CB05A510D6E912B4A ANTHOPHILE0
810,152,790 *54121F4DEC5A8E201A872B4B3FD2CDAFBEFAB8E3 Anthr0p0109!es
810,152,791 *5415E049A1C9D65DE43411F8E25E69FF3950FD53 Anthr0p010g1e5
810,152,792 *5414AF7107E2F7C7A1F286F3EB52B3EB51D25802 Anthracillus
810,152,793 *5417527FB9185F5AE229680DA6A17E1C9A50E122 anthraco11th1c
810,152,794 *5415F1EC1EBF3D8C37B4CE135584762C7EBA8341 ANTHRACONITE4
810,152,795 *5416667B0EA230D66D651D526FAE22222BB159B6 anthraxvaccine.blogspot.comanthraxvaccine
810,152,796 *54145922FF7F48983CEC253D2375AC35D72FCB67 Anthropocentrically5
810,152,797 *541CEA71CCD1413ADDA1E6BE13320AD1768B9FEF anthropology1940
810,152,798 *541ADD8E7AC24D0B22E28CA70DDC4E2303A73CAD anthropology.uwo.caanthropology
810,152,799 *54122D5FBBDE300656DFDDC5A3425C5EC8581157 Anthropophagy.
810,152,800 *541708EFE6F0C0CFDD137F9E716652A728EC6B5A Anthropotomied
810,152,801 *5416C38B56233BE1EB2439BDBC285CE96D10E56D Antiaircrafter6
810,152,802 *541746A23A506764D1C328412B8DFB5A1024CF83 antialiasign
810,152,803 *54141CA6391BF66E7867A02002E515EF0338894B anti-anthropically
810,152,804 *5418F567D9C68FDCACD904B2CDB7C010E1FFDC1A Antiaristotelian
810,152,805 *5414EF513B9C363CF3CA15FD6E05E83A238A1005 antiaviaire
810,152,806 *54115A4CD1D4BD36D813712C4FB0940FBD956CC9 antibonapartist123
810,152,807 *5419153E85B553264904D4A1ED36E7CEA8BB4706 anticapitalisting
810,152,808 *541780A0F598132104CCFA9CA1803D6C9F7382EE anticepha
810,152,809 *541E9419CF9F1BBAD37107A85BAE171AFC93ED26 Anticholinerg
810,152,810 *5416323786DE4460283476A49A2844652EFA6EAA anticilary
810,152,811 *5413C36B6001A6E9FD0FC92DB1B5DC303AC68847 Anticipare9
810,152,812 *54170314EA408826169252428E9EA962CF3FF122 anticipatorio
810,152,813 *54158EB818C2FC3D77753D4CE847F094C540F159 ANTI-CLASSICAL
810,152,814 *541E1EA140B9090688762E522B448C7526F76B17 Anticlericismo
810,152,815 *54135FEE7892FAF12A14BD1AA9C3EF03BC460B9B anticoagulating123
810,152,816 *541920CF5758259310AEC8C1C2038AE829D49BC8 Anticommutatif
810,152,817 *5413747B850E5B0EE8911B5353E4FE72F5C2F70E anticonstitutionally7
810,152,818 *541E4A1B5F4D9BFCC786D636C8380BDB196096B0 Anticorrosiveness0
810,152,819 *541E12C279A7E80BFF66FBF77448F66D0123A0FC anticreator4
810,152,820 *5416AEEE1B7AAF7D3C98CC982D48B800C42D0DE1 anticuats
810,152,821 *5416125139BBF16C5DC0F5253CBB422C55289D38 [email protected]
810,152,822 *541D25B7F4959FA3552F9855609AECF1E6CD2AA5 antidemocrático»
810,152,823 *54118144172597395A37856861D5C43513BE9C38 antidepressan
810,152,824 *5412E227D277F8DCC029A64EF1C3E58226BDB773 anti-disestablishmen
810,152,825 *5411097224ED44AB86C379781F66F1F0885BCFB2 ANTI-DISSIDENCE
810,152,826 *541E45CBCD5FDD4179E3618F5233B55246C8FAE7 anti-due-process
810,152,827 *541DAD188E425C7E873DB8296A579CD1BDF26518 antidy$enteric
810,152,828 *541C180FE29596AB09C1BF2EF4085FF460381F2F antiespartano
810,152,829 *5418C1BE6A1AE2672A8E47C73B8B250F8092F500 antifest 2003
810,152,830 *541E2FABD11E769C6DFDFD142E459586BD953FD0 antifona:assumptaestmariaincaelo
810,152,831 *541B7F1FC4F938AF5AA70640B155D1281220D6B8 antifraud2007
810,152,832 *541112E5C36FE829C8A1871B98340D0F19B20567 anti-gay-marriage-amendment-introduced
810,152,833 *541EF36BA1F14F0CD8482352BF53256415318E15 Antigenu4
810,152,834 *541B66B10557035C7E779488F2E2545A5941813F antigrowth8
810,152,835 *5417EF6958B11C0F865B28CDAF7B9731334A8CEE antigrundtvigianer
810,152,836 *541CAC5EFF21269990C9426C15FCC3ACC24C88CC ANTI-HALLUCINOGENIC
810,152,837 *541AEB2A99A4D9217544803F65CB24B4E21978DF Antiikmaailma
810,152,838 *5419186E3124481CF71AECAB7A45BA1CACEAF7C2 antiimage1
810,152,839 *5412316BFFFEA2CDEAFDC1B687C34C7E35FB509C antiirishism1
810,152,840 *5417BFB82B7321C4EDBFFB8B9E1B252C0DA4F56D Antikonsepsjon
810,152,841 *541A0FA3EA6BC9EAFE8A2E64B08D640D0FF5AA25 Antilebanon
810,152,842 *5416906B382E64F8F8FB8E28BBD0EA6CC90C85C9 antilithic2
810,152,843 *541BD9F60B2D7DB949BFF676383F6976B2C7E0CC Antillano8
810,152,844 *541FEA98C1DAFE66B63109685CA51041026DDADE ANTILLESED
810,152,845 *5411F44BE8D348A56AC3DB189BDBB3B6E2900350 ANTILYSIN0
810,152,846 *541D5D90AA2328CDDEEC9EC1A73E23A9217A8D24 antimacedonian1234
810,152,847 *541AE6DCE7408D473268ED4CEBAAD5CE00D21942 ANTIMAINIAX2005
810,152,848 *5410383213A6AF00963CB03A2623FFDD4AA2C2C7 Antimaterialistically4
810,152,849 *5411221C5EE32D42B134C73EB785A2C35817F8CE Antimethodically?
810,152,850 *5418381E3E79BC18B46159F547B51CFBD417009C anti-metis
810,152,851 *541B38612C1855AE90A25C72DB9462FB150715F6 ANTIM
810,152,852 *5412F0CDC1208F1C4FE280885F6FAF1BDE1EFF80 Antinomianistische
810,152,853 *541AD0C536DA100E4FD3FB1A507393E400BB7417 antiodont7
810,152,854 *54102248EDD61E81A79B0AC151615E8A687BCCC3 antione.aplin
810,152,855 *54104C2B317980275149597D24A9BAD0EEA6F6F9 antione.bachtold
810,152,856 *5419CE33808FC9ED1FA4AC9796E5470CF2C4B8CF antione.bonomini
810,152,857 *541BEE03E66894BE57A4F7C51552EC180C9AF5E4 antione.borrigo
810,152,858 *54166255255D1B02A53CA5F58BAB454B31F5C200 antione.cofresi
810,152,859 *5413ECEBE807517CA4325FA389AD4F87A9E63D40 antione.colaianni
810,152,860 *5418A4AA7350239D3D17C72087AD5722E4D1CD5C antione.dubovsky
810,152,861 *541F03BA730C6AE229473080B904F127D9AC2527 antione.febre
810,152,862 *541123BF3E7053BD36FBAE108DCEF11E03A55C67 antione.genest
810,152,863 *541AD99F4263747F9D8DB8F3129429D62C634560 antione.junius
810,152,864 *541CD8B3E3867C02EF9C57D86190C34510B15425 antione.kaber
810,152,865 *541C47993FEBCFFE2831DA316E0A9AECF2157D2A antione.kellom
810,152,866 *541ABEE9ADF54DE871EC155D1F6E97A36A12228E antione.koelling
810,152,867 *5419C40635125B85F5CA285F7057D35030690B24 antione.kusko
810,152,868 *5411B88FC71EE92C7000BE1A7E950AA2D6DA51C7 antione.longway
810,152,869 *54158D86B59F484F86B57BAD85D0A7A7C72AE17D antione.michetti
810,152,870 *541ADE90E30E73475C2164F708AE069CD38703FA antione.muldrew
810,152,871 *541ABAAC295B593E9803776ECF1551C8195018C8 antione.poehlman
810,152,872 *541870C163349B81AB06FF12DFD76A8C196435CB antione.ruvalcava
810,152,873 *5411499A7199A80A45E03953CB0EB8259774BE14 antione.speers
810,152,874 *541ACBA121417A540E16C4EB253AC2C0650CBB30 antione.yenor
810,152,875 *5410C3A030F4E8C00CD1FD451E421477863EFE2A antione.younts
810,152,876 *541797BB827BFA6DFEB3D0A7228078880AE477A9 antione.ziernicki
810,152,877 *541D60DB05B3EA8A1E81F0DE6A537C2E9844A721 Antioptimisticallies
810,152,878 *541FB8180C5D7AE9D9D622917CAEDAF881617A0D antioquios
810,152,879 *541AC4785915DE1F230D98F441711C1A5B5709A9 Antiori
810,152,880 *541C68B7856BAC0DEF6424F9D3B78F712451AF92 antiparevale
810,152,881 *54187F69EBAD4270F7DAA8FF7322C656CA3B38B5 antipartizanska
810,152,882 *5411E0B9C072A4FB6B5BF93B927BD0DF35411D69 Antipatriarch?
810,152,883 *54178DAF0A3A9636B0A0F193F96378F03C7F9A4F antipell9
810,152,884 *5410EB6636AF37CAED44614AD88F8512740A30A7 ANTIPOOLINGS
810,152,885 *5416EBDF241D84A3B8EC582E8B30ED82BB9D9C26 ANTIPROGRESSIVE9
810,152,886 *54141EFE6E8828B6333DBF3EC37C1DAE8A8B66C7 ANTIPUTA32
810,152,887 *5418804777955D0D658D728B69E775E14F097E14 antiquitätengeschäfts
810,152,888 *5411B1A932246FFDFBE14F4934A74E6011F7CFDB antiracionalistički
810,152,889 *54190083A6BEC6D1F153395F25C17B967A9119EF antiraketa
810,152,890 *54173C3600DF8971110C18F1ED63FC4B2D848149 antireformiste
810,152,891 *5410DB1F3A247A2F5AB0636D07DADBB1C40C4C94 ANTIREVOLUTIO
810,152,892 *5417B835B78C2E09F9B4DA50DEB9191E25947951 antisco
810,152,893 *541DCE407ED7171EEAE1B6367679B3A96B031C5D ANTISEGREGATION1
810,152,894 *541B72A9AFFDF3749EF972F1D83B8B15E0B3432E antisemites0
810,152,895 *541801CF415B65EAD2BB0E090596E929AF86D8F6 anti-semitism.11
810,152,896 *5417D3B3577CE5C74952DA1BB3B9B0F28D750074 anti-semitism.xx236
810,152,897 *541A012DA7CB447090415C01F9831C60E02C92F5 antisiciliano
810,152,898 *5412BB42F5F31457D2B47D9D95445CA1EF074554 anti-something.howev
810,152,899 *541BC1094DC8C7F9166D82E276382CF432EBB245 ANTISPASMODICS9
810,152,900 *541ADA3742348A740EA2118AE430C48ABD3321D8 ANTI-SW
810,152,901 *5413A9C152CC35073BC5AC3794EC5E5980865AFE antítesi»
810,152,902 *5413482B314F1D67FE7EC958FF788B6C742B98E2 Antitinting
810,152,903 *5412C1DACCD3F6BFAF930B4E93CE1AB986695A56 antitrochanter4
810,152,904 *5412C7B31C9C326D942EB3E2F7B6D9572AFF0862 Antitubed
810,152,905 *541D5CA78CE810A2E58D6BFACAC9E408DC55CA57 Antitype2
810,152,906 *54160923B4657E724915F7246B268225DDF5B0E5 ANTITYPICAL0
810,152,907 *5410E6EAD91EC6C375E96C7750E729D4001A0DD5 anti-uigea
810,152,908 *5415BF7F9E787DFD951AEC76D52EDA4E3B903653 Antiusur7
810,152,909 *54171E82B9C4ABE9C0F2F6510676585755CC560B antiwarnetwork
810,152,910 *541EED47A28120D1CCDAA1D8DCE2A23ECB461D2C [email protected]
810,152,911 *541581494BCD995FD1B151BB3085C899C8A4D7A7 ANTI-ZIONEST
810,152,912 *5413A0DA8D127BB2B3AF0976B74D43D0907E2BC9 antizold
810,152,913 *541C30D616192061E22F25048FFA72C7EBABF9EC AnTl#
810,152,914 *5411780E916D97EC0CFB33B85D9ABF9612CBCC23 [email protected]
810,152,915 *541F99175283E3230C3D2813A696FD75B5FE3663 antoecis7
810,152,916 *541500F25C22A4429E553B042B7DB50C93F7C6C1 antoine.behlen
810,152,917 *541522912189D6785AFC0ABBCCC4B923C7BB53F8 antoine.boadway
810,152,918 *541A2C41E66F695A2EE2852615A3FDBDB9F5C57F antoine.buchenau
810,152,919 *54181C9C33580813EEE63513AC7ED7FA313B95EF antoine.buddle
810,152,920 *5419704C04FFB47BA1C42616E0C9CACFAAF826E1 antoine.delmas
810,152,921 *5415179F0764549F151608C7A6A8E9B2B0EDF948 antoine.desonia
810,152,922 *541E203960DB3BF6ABB1B06759AFA7304155C7C6 antoine.erdelt
810,152,923 *541CFFE37FCAAD28F8BF1AE9B54109BF3AFE4251 antoine.handley
810,152,924 *5410D5A530D8DF619E1255D782D9E35E97187D77 antoine karam
810,152,925 *5412422BDEF0B4E952CF8F1815C7500B330605BB antoine.kellough
810,152,926 *541828599CAD261388C5958195447E6DCDA8E1F2 antoine.killins
810,152,927 *54120F264139F41DADEDBEB8AEE7256C54DFF40A antoine.kodama
810,152,928 *5416A43FED93C569FE9EA90461BF542958BAF403 antoine.manire
810,152,929 *54117B38E5C3A56A845B004984A88D0A8DD9A33C antoine.mannina
810,152,930 *54188B096AA8D287D5BE862C648A609DCAF03410 antoine.miceli
810,152,931 *54116BF1AD14CA3F77E01589D922D6F1539C402C antoine.muray
810,152,932 *5414A9528C8C1BDCB67A09CC2716F15839FF802F antoine.ngov
810,152,933 *541F453A42B4F2F8CE31049E56D5103595E238ED antoine.officer
810,152,934 *5413F833063221210DA515B0D896719731FFECD8 antoine.peschong
810,152,935 *541C812593E6225034224CA5DC13A397812C6299 antoine.pizzini
810,152,936 *541D714C77EE6411CB10DB13DFA7B9B409C96ECD antoine.reksten
810,152,937 *541EF328B29F38CF9BC31809F769440EFC20DA34 antoine.rion
810,152,938 *541713682BD0161A98D1E970CD8B2FC07C0C55A3 antoine.shaw
810,152,939 *541FB5E483DBE9629AB923476CF0B422CA8244D5 antoine.speight
810,152,940 *541D658E20C7E096DC1401F10A74EFAFE01051BB antoine:taginaki
810,152,941 *5419574FD5BA202CA5AB43A19FC05DFCB40B4F07 ANTOINETTEBROWNBLACKWELL
810,152,942 *541331ACEE0B87EDAF9997874D4A3D4B891FA552 antoinette mmalethabo nyathi
810,152,943 *54166B4DF97FD3E93C74781F543193F1BBEAA85D antoine.vanasten
810,152,944 *54139C18EC747D6466E93CC5E6CDE7D0459B5173 antoine.wilhelm
810,152,945 *541C0B8990DD2F8E0F221AD7336F2154B89D6AD1 antojabaed
810,152,946 *5412B2638E8B5E6661F48524C8EA60FB7476A563 Antojaroning
810,152,947 *541E52B0D7042FB7521E5B30A7DE16F52BB8A68C antolino1122
810,152,948 *541FF1263071612A1701EDE38F525312E89310D3 anton.corsi
810,152,949 *54153A6C7A2992ACBC8717541EC2C782E7A785FB antone.berridge
810,152,950 *5419F6D69FDAD4479FEACA6F9C834A061CB29D6C antone.boiles
810,152,951 *541E34B6AE83EFBD63829DC79E7EA4705490C860 antone.bordonaro
810,152,952 *5413459976B199FDA2AEA05876E2E786DF85AE64 antone.brustmann
810,152,953 *541A9225F349CB949B5DCE3E4884ACCCA3A256DA antone.hanover
810,152,954 *541B649A9283CB2824C341BC7874A95AE63B8877 antone.jennie
810,152,955 *541D55265387DCDBBA4579ACB00110ADBC63B483 antone.kaner
810,152,956 *54147E1DE98A3DF91CE9F516E1473624617B42E0 antone.korona
810,152,957 *541D10935E91D96BF87B8FEA569B4CC39BDBF024 antone.kreft
810,152,958 *541FF43F129D22FE292FAC72DA1E6C154CB37009 antone.laurole
810,152,959 *541172F84FA24C0717EAB66852BF907E5816D72B antone.lenoch
810,152,960 *5414928EC635AE460DE795B520F5D53A8BEBCD63 antoNELla
810,152,961 *541624AB199D99D4E9EC299FEEDE63FEDD61436D antone.maready
810,152,962 *54100BA5CE8BCCABDC0883B9D75B9861CDF9D133 antone.michonski
810,152,963 *54178CA1EFB3F246208EEFB1204B8CB5B31BCA89 antone.mootry
810,152,964 *54112C42B47EB1E55EAF4908153765D988F46362 antone.quilantang
810,152,965 *54120004D409F2748A2CC5511F90F572ABDD690D antone.ragland
810,152,966 *5417788753780F7EC4A0AAA21E1B41BA38457B2A antone.ras
810,152,967 *5411BC3A2AEB0D4402FE8B708A846A5B7FB5C972 antone.rookwood
810,152,968 *541933FCC45C0E985AE72AACD6574824ED33E9DF antone.sires
810,152,969 *5411A64A2349C449E9C28E2D33A7427362B41930 antone.visher
810,152,970 *5416B35ED924166B8CAA732F001D09BD3D14A299 antone.wendt
810,152,971 *5416EA93E814CD79A056B85A6D68B06C3E9A3338 antonia.andreoni
810,152,972 *541924989B61F3B4009797432D483AC304291565 antonia.barak
810,152,973 *541264CBFB9AE1A0AB67B8CB7F493C00545F36CC antonia.beiswanger
810,152,974 *541ADA7AAFB7AFC02249B69293E857140F62E888 antonia.bethke
810,152,975 *5410EBB586EA38716DC216942E88AD77D172605F antonia.boggess
810,152,976 *54184D069D9079D3665CE9A685648E2466A73D72 antonia.chiem
810,152,977 *541C7D1F0317EFB754AE5D5CBEB32441EB52E635 antonia.erps
810,152,978 *541F3EF9946A50C7E0C359D17836AF156F695FA8 antonia.halliman
810,152,979 *541F12B70E74709C7CC3E976E91FAAC994617808 antonia.leman
810,152,980 *541CB8C8864E3670BA08ADBEE8B414A0278050DD antonia.marso
810,152,981 *541179B650A9D9B50ABD569E5C194740A1251189 antonia.medley
810,152,982 *5417E55A08C024A14D4405F1CF1BCDC2A80BA725 antonia.onofre
810,152,983 *54130817566F6862164FC9F67F7E5D671CFF11A5 antonia.piper
810,152,984 *541D39968C9F88BA94F6A3B0835ACA3C8E6FA7FF antonia.regine
810,152,985 *54114E2779ADD25CC0B806CE6A47F32572A3C38F antonia.rosacker
810,152,986 *541822632500F7B77D85EDBB1EA399F3B4CFE1B7 antonia.shiro
810,152,987 *5410A8722508C51AA28B5487C467700AB5F8F139 antonia.sjogren
810,152,988 *54198038BBC8650430B5E3751945E3CC91DC5CEC antonia.tabler
810,152,989 *541AECB529D95558185B944330697EB6E7308AB9 antonia.wunsch
810,152,990 *541F2CB5614B32CDABDBF9E0C2424661CA06454B aNtoNIE
810,152,991 *5414F99A5A65589F3CFC6DD17CC893C6CA1024B4 ANtoniEtTa
810,152,992 *54119FC506958CB0F4EFBF00415C48549114BBC1 Antoninus,161年
810,152,993 *541375B1558734731441F01A678FD24FF3F2C172 antonio.bergant
810,152,994 *541590CD37E8C43696E70DE66043651D1C070F0F antonio.bloomberg
810,152,995 *541C441BB6163FE55DF74CD8714598F70E975C60 antonio.coonan
810,152,996 *541826DE59F5370A99A044BCB91E7EA0BD0B28C2 antonio.copier
810,152,997 *541641B064029EA503933F56061A2F4A8601C82E antonio.courier
810,152,998 *541EBB426906E55C290685C2B4EC569990B0C0AD antonio.esquibel
810,152,999 *5412FAFE885F8D4D3BA7A722B2A284C313480F6D antonio.feijoo
810,153,000 *54106D44D64EDD5284F349B3473FBCF8EFBF3AC0 antonio.finke
810,153,001 *5413B1A25B15160C37D69052DB904EDDEE0CF9A3 [email protected]
810,153,002 *541061B3096F16A1A77331B5AACD13C87E068067 antonio jermaine jamison
810,153,003 *541D1F0D52A92047D0D4F6BFAD239E4311D74D0C antonio.kello
810,153,004 *54126C5470DD417C191885A723662633CF2A49B1 antonio.larney
810,153,005 *541D5A216058F11F73F182ECFDE6B87FA519E2EC antonio.macandog
810,153,006 *54143A7A7371FFC41E61BF7AA150A77370DD3CD7 antonio.martabano
810,153,007 *54197351708BDDC85E85BE2D780346053A75474B antonio.newmann
810,153,008 *5413F3F206E43F0C2A349A3C2B892593FB8CB910 antonio.parsley
810,153,009 *54100CAF56B471E0C9A11881619D2FF75F73763F antonio.poindexter
810,153,010 *5414C2E861A9170482A9EC9332C8F4D7AA326923 antonio.raiola
810,153,011 *541E76838020D25475CC214812C4B505E33BBF3E antonio.reiley
810,153,012 *541C88304711C01E1A90483A9C5C0EA7AC2762C1 antonio.stecklein
810,153,013 *54123ACD8DF5053CC2305B2D21650852C2C30160 antonio zafra
810,153,014 *5418F12F057A81A84AA37E291B8268F7A190BD1E anton.klann
810,153,015 *541139C725928BD20B1EF2036E51F0CB072C493B anton.laning
810,153,016 *541F5D5716AB495A29FA9DB2CEF493C7E9AAFEB3 anton.leich
810,153,017 *5411ED32DB092C886635102474F8A290EF33A123 anton.livermore
810,153,018 *541898899CBBC8D4F07A4D125AE4E6FC1587A396 anton.mccain
810,153,019 *5419DB32E70C190E84E0D17EDF450FE77B92B797 anton.motayne
810,153,020 *541883F4FF8DC78F9AE6D1BCB5C40B042C46486D antonov-32
810,153,021 *5410343CDA075D7E996E8690E30CD2EE4E1FE48E anton.paruta
810,153,022 *54183CC7D2904D0A327B211735C72C897BA5FA19 anton.radel
810,153,023 *5413704B218D16EFA791421FE0139A92D5DFDE6F anton.stonecipher
810,153,024 *5413E3C56FC1BBBB4A6B48F32AEC0D83B3A5F0EB anton.wittkop
810,153,025 *5419E776F49F1C8066412DED731F8BCB953A8772 antony.baillio
810,153,026 *5412CABF2D50FAF0AAB0BCC533347368B45C51F5 [email protected]
810,153,027 *54101A8B653CD2E6E9803E5EFA13EAA66E395A97 antony.dipalma
810,153,028 *5413A867F73F82E80164A8D7DD7179301F190DAC antony.disorda
810,153,029 *541BD59359D7E135156D0ED56919880786BC5EB9 antony.enderlin
810,153,030 *541D613CE33DB9C02A0323A644517B26EF530B79 antony.hannafin
810,153,031 *541CD05AB80ADF13EA54AF3A51C05987D34B863E antony.jolls
810,153,032 *541F2D024799BD6E74F49B7E3472000CE463B50D antony.kinchen
810,153,033 *541B5B49CB74DEAEFE5BA42C5E3167C7F6E7FFEF antony.kuman
810,153,034 *541CB16FDF8ACC10558621D923D86CFCB3DF263A antony.matelich
810,153,035 *541ADB2953E05A64181D0B05371AA4A2190DB21B antony.matto
810,153,036 *5410074908CB3126C27A77BA2306E4ED748D851D antony.mcgue
810,153,037 *5418BB71C37A97BD2833227C567782DF943B128D antony njiru
810,153,038 *541013C9A8479DE28A0185E1C56A5E6B05DB1B95 antony.ravitz
810,153,039 *5419CB71EE2F4317C38ADC228AB4319FEEC82370 antony.sciavillo
810,153,040 *541EA19734F2774FE1C03C1EAAF54E51BBC612AD antony.trojecki
810,153,041 *541E11F7F15CAA27D71B8069D6A23383D0BCCE9B antony.typhair
810,153,042 *541AAB22DBF5DCBE1FD0BAEACA101B37F87703E6 antony.weese
810,153,043 *5410A0679F8A7EBD7270202E29074E95FA104CF5 anton.zuch
810,153,044 *541015B502B6061A530D0A779F6DF2F8F49DA3AE antoon59
810,153,045 *541D7C3D5B61B0EF5032F4EA29737FD0C08AF80D antopat
810,153,046 *5413189FBD822A2E6476A7863AE92BCF4D143799 ANT,q
810,153,047 *541DFFB723520EC3AD75246EF76B67FE17B248BA Antragsfrage
810,153,048 *54182546AE1167922EDB40476CCC949BF2BEB24E antrepris
810,153,049 *541A65F5B4B09328A22E7C1DFB5B1E081A853ACE ANTrF
810,153,050 *5416C8264297AFDB7A89198C23353544C2659DD1 antrffbarast
810,153,051 *541C6507E974F24EE0131ABAB0EB55081F9A5FE5 antrosto5
810,153,052 *541AB2949415FB9C41304E814CAC2774BEE31650 ANTRUSE
810,153,053 *541EA7BB6AB05C9D040C784815961A914C421274 Ants Abduction
810,153,054 *541637FA8EE957749A7CDC61E4447F1A82CAAFE0 antsahaving
810,153,055 *54139645083F9C5F4153FB02AAA10286071D552C Ants, Sheep, Drunks and Whores
810,153,056 *541B9A7B3CE4BAC34535A20FA7E89449A567BDC5 Antswor0
810,153,057 *541A59604D623018CF5DFA74698D92136522BC33 antsyferovo
810,153,058 *5416063DD869A02E313B91EBA7D37F576EA5CE93 Antumbus
810,153,059 *541BFC6634F464D4EF6E57B410FB4626D45FD574 antwan.agan
810,153,060 *541FEF16061B44778CEA6E6665020AE378A454C4 antwan.banwarth
810,153,061 *541D87E1CB1EC90CC501D1F685D959B095C8DF55 antwan.buschur
810,153,062 *5416F54FCD8BD96BAB1FF09856C23E60409F77B0 antwan.coogan
810,153,063 *541D8A6BFCCFEC077E0423CA9F16376AEA6FD2DF antwan.deedrick
810,153,064 *5419E92D284F14095182B1EFD059518D0C1F2B89 antwan.deno
810,153,065 *541801D626B2E78ED37999A16F9E112BC66BA8CF antwan.eaks
810,153,066 *5416768647551F9EA258F5BCE552A4ECD0DF3F57 antwan.eckerman
810,153,067 *54110815AD01E2D19D4B25560E12CC2E29F98D11 antwan.kilmister
810,153,068 *541693C3B79430BB3F89702BD5961F0710F1A838 antwan.kolarik
810,153,069 *5410B912EF45B76C942B6C1AD1B77564B3A8188D antwan.kosier
810,153,070 *5419147EF713C3BDD3B7DE08CFBA0BAA6690E4FD antwan.nanke
810,153,071 *5415B6E917D285262DB995463AE41BDFBAA2082F antwan.nehring
810,153,072 *54149422756BB14C760E4731A65CD854BCD4BA36 antwan.pekarek
810,153,073 *541885EAED5398D3A7318802FCFDEE744809B125 antwan.ringler
810,153,074 *54106DAC7756FD271EAFBFD853A26AB450F4F9D6 antwan.sciarretta
810,153,075 *541E6B04FE98A3F1C40AC4E3421D2C7BB5D40767 antwan.skare
810,153,076 *5417446E4DE9CFAAEC017F3E0F429E907DD2309B antwan.townzen
810,153,077 *541B955A1F20A6820F6038D50D6168675C18A341 antwan.umanzor
810,153,078 *541C996260F097A62E16285E73247AEE00F59484 antwan.weger
810,153,079 *541D7E6E78D184ABB927586CA94096E63677C790 [email protected]
810,153,080 *541D592D7245CEC756EA6E071BE6A9ED6B69A237 Antyczna
810,153,081 *54159B0C5DF5FDA134A11AB908792D0E41DC7765 antypasmikelis
810,153,082 *541F7350E10CC5BF89625EFE8BD7025DD8753400 AN.U#
810,153,083 *5419434B09915AB34518622E149170E6731CDAFB anuas123
810,153,084 *541A7437F2C83685B643AAA189EC868A1D949D20 Anubys
810,153,085 *541EFD202799C84F2A546CE5166C2C562859E5D5 anudara5
810,153,086 *541CB9D2EF30A363D475E9D75DAB049455A8CAE4 anudr^ishya
810,153,087 *541BDC4BB38B0E480931B9A7C6C80EA92DDE1F2D anuerism
810,153,088 *541D8D201964FAD8EECC3C3F144FD265707344EE anuestropadredios
810,153,089 *5413CADE71DE90779B5B02F7C30DED8714253DD5 ANuEX
810,153,090 *54117F2276052E85542EA74F3F886B73EDD6B191 Anuħ
810,153,091 *5418D4030A06F267880D859D2F03C92421D678FA ANUI/
810,153,092 *54178D37B93473D0DDF5DB36DFEC270CE9751818 anuirlhe123
810,153,093 *5419251479793ADCAB6F37146B305B75058D87D8 ANUITES
810,153,094 *541D28D73B5D609F5846A451715743A23D347BD6 anuj bhuria
810,153,095 *54145EFA9EBCB513D573B4DE65E85B235307A786 A(nuk
810,153,096 *541772BF1473E57F607EB7F7CC18EA48776A6C5D ANuKe
810,153,097 *541CB165DA0DDBE4948C299FC5456E1A937FA539 A.nul
810,153,098 *541882135BF58C7A7733837F306E69181302333D Anularles1
810,153,099 *541F5D40208B5EF09F4A80C0E6D68D5090E1E37F Anularon1
810,153,100 *5416742B3EF06A715ADFE3FFACD041F42E1164F4 anuleis3
810,153,101 *541D8A851B5135D84D375F7CEA88FC23108001DC anuliavot
810,153,102 *541CE6019668F3BB43B83AB6B99F823DF7A83711 anul·larà
810,153,103 *5412185DA16715BC08A2C1387D0E8A642F7DACC8 Anunaaditam
810,153,104 *541AD714E2865AEDC2D8FD52706A2889679A024D anunciación—
810,153,105 *541AEEC9ADA48ECCD52432855D2F9D39A8D8B32B Anunciase0
810,153,106 *54197AE7A34EDFF984EBACC8E3B1CEE0A2E2074E anupamarana
810,153,107 *54193482A38A91F92AF821F5D0553C3439790FF7 ANuRE
810,153,108 *5419183466501E7774AA436FBA40ACF8FD4A4C44 anurodhagarwal
810,153,109 *5416268DD4DAA59C87260F41922DE52CF6462242 anushree tripathi
810,153,110 *5418793941ED60C76FECC741B49C8806D9619180 ANUVR
810,153,111 *541B0891F579E8FF291FD84B588DE7B85A111EFE Anuyogaa4
810,153,112 *541619A26C4ADEF170B6768E1D5BE4E0C731CD8A A
810,153,113 *541166AC76C6C851AEDF26D2BB2489C73434DA41 Anv5f
810,153,114 *5417031AE8512E7B103CF0C15AC9D2696ECB6704 AnV9O
810,153,115 *5413654575746973E7519980ACA0A459571ED30C ANVcp
810,153,116 *541E914B4C700F2530A190B1E33AA47966592E46 anvendelsesmuligheder5
810,153,117 *5411EE76033BBA0494CD9A3B542B90C20DB9399D Anveshak4
810,153,118 *541C2A6C0033127C8E3BF61968AC72D0798035F2 ANVgP
810,153,119 *5416977CE9EE0045FEF7A0A5A981F94B286FDFE7 ANVhm
810,153,120 *541644654E04FA2F1A4D8F84FE7309522FE61624 AnVHo
810,153,121 *541DA9975E8A95B752E819A82632C17B6716249E Anvildri4
810,153,122 *541DF94EBD2EC6D3E210FDE43304EF5F19E0E7D7 [email protected]
810,153,123 *5419EA9054332879347FE3ED28A842505F5BB5EE anvilling?
810,153,124 *5411E58407F7C11BBAD558832CC1609E39781825 ANV,K
810,153,125 *541CA135EBECB12C7A43EAF2F70A81011C7FC16D anvnder0
810,153,126 *54168F2A04C70B7B2C2D80EC85AF53ECDD3A8869 ANW1011
810,153,127 *54141C6339944AE29384632F0A1562DA5FD31080 A+nW3
810,153,128 *5415A6AAB2BB7AA7089438D58318F3F42949320F Anw92
810,153,129 *5412EDF991362AE11B74AC2C99EC8198A7785426 anwaryousuf
810,153,130 *541D8CAB84B7F4F82C6E2A058037533FF9CF4125 anways.
810,153,131 *5416929953AE2FB8717224980C1907B37EA475B5 [email protected]
810,153,132 *541A4BCF909E12EFFB177E01979EC35642E55EBB ANWLR8
810,153,133 *541367343FBCA95B82AB93BED42146044F710E6E A/Nwo
810,153,134 *5411FCB5C011E872A3CB86BB29A81B8E60C43276 AN.Wr
810,153,135 *541B74D2D03854584AC41286A075435BC033F937 An,WX
810,153,136 *541EF74B22A5C9E140E6E530ACFD23876A1F7B50 ANw#Y
810,153,137 *541BBAAB376922A9CD09F50D189ADC627BBA7446 AnXER
810,153,138 *541DD033ABE09D9C438ED831DDC293EA542ADDCD An,Xo
810,153,139 *54144DC94F705B745C26E41DAEE2F576C7BD49A2 A.NY!
810,153,140 *5410562C9DA602FADB68057011BB7FEC4AB5F208 Anya256
810,153,141 *541A4BC50AD3AB318F6C086B7EF1811A139421AF anyagtérképünkön
810,153,142 *541C0414E86EBEF5BCBD4A240E12DC9FB9C12093 Anyah's
810,153,143 *541D4BB7E5DCAE57168776F70315EE2C0580AE79 [email protected]
810,153,144 *5416FB7412745C57FF8C61F3B92DF6879784D067 anyboy.bbs
810,153,145 *541BB55D1B94885642E8BB592E30220A44AAAC4C Anycall1
810,153,146 *541D9E44CAF8206D3692661740A23D09AD5044D6 Anydata
810,153,147 *541FF4FA04D5FA8C6A0390334FFC3E4666B712C7 Any+h1n95
810,153,148 *541123333A32ADF4D30C0781047EFA324BD48465 anyhease
810,153,149 *5410D145672F7E78434F08C364A20925F1616DF7 ANYM,
810,153,150 *54100FFA8815BA0C29CECFD9B1840F3494B1D61A anymore.129.64.129.3
810,153,151 *5413146A9316A8836197DA3C8F529ECB5B20A835 anymore.furiousd90
810,153,152 *541E1B6CCC9B0D4881C7BF6A37C114C370E5086B anymore.supermidget
810,153,153 *541F15F6F7D0F43712F018AFF2BA461535712996 anymore.swampfire
810,153,154 *54191589BD1B43A45735C5535580F7DA9F8A345C Anything22
810,153,155 *54196943E6CC22A4C039AD90B0C2BDDC66EB5BE8 anythingandy
810,153,156 *5416DA00B4E9190FC36694EE01C895DB3A96F765 anything goes (alternate lyrics - 1987 demo)
810,153,157 *5413DCFF36981301C9E788994941F68D7CAFA55C anything right (feat. christian lindskog)
810,153,158 *541846CDB201F174CF6E7CD7853CE245447EE829 Anytimefitness
810,153,159 *541721478CCE6F915FAF575D94013B0128D3FC23 AnYtW
810,153,160 *541E8FF4E65EBEF710F69559473331957D990A42 ANYWEHERE
810,153,161 *541B351E6EFD02E78BBFEF0B7D25B06E214FBDD9 anywhere.hippalus
810,153,162 *54152F4FADF9AA2F15554B9CB13FC6F2D6BDF44E AnY_X
810,153,163 *5419A29CB6FA9B1BA09B507AEDEFFC90274CAED1 A,nZ)
810,153,164 *54185E5E9D771349ED7C992057DC00E2D04BC610 anzarino
810,153,165 *5414DA290D3E714702FD3A255E7FC367500389D9 ANZ_d
810,153,166 *541BF14DD242AC7569D1290BAC14284ECF8516B8 anzeigeplatine.
810,153,167 *541DAB227F640E4C574F03885B3AF489600DEAAE ANZh9
810,153,168 *54111455CFA78B8746B63E36E854954764EF7E9C ANZI7
810,153,169 *541A6D437EDA910AA44A098F258EC36433C21181 anziani1
810,153,170 *541E2D99C7F03DE7A9EBE299D0925CD4DD4DE185 AnZ_l
810,153,171 *54148FB3A2A4853F6F44E2F89D1AE7CE928C14C8 Anzliche4
810,153,172 *54159EF5E8578F70CCEC5A1DD2E63579A0ABD77D A=NZR
810,153,173 *541C4AEBAEAF5642453DAE03978552052C766CFD AnZRO
810,153,174 *54152D12F9901747641D44457D24EEC2FBFDD370 anzufehen
810,153,175 *5413109F5122B36D19D4E46533A823318B0CE1F3 Anzuhalt9
810,153,176 *5410D15D6DC19DD9F3AE39169BE672FE28E0E665 [email protected]
810,153,177 *541CA67BEE135C41710151133EF32AF92A6EFDC7 A_,O/
810,153,178 *5411EB55D4824EBF6526FDE6DC1B9356722CF8FB A-+"O
810,153,179 *541565ABA2AF02B4807DF5D0D6CE83AF12C89FFC A//;O
810,153,180 *5415AEB9D3339973E464D42A21E149DB8C00F1A8 A"/O.
810,153,181 *54170E021E563B4708125AF0E25486C1A3807632 A")O!
810,153,182 *5412A2606FC0FBFDA8567474DEBEA4ED567E12EA A(#O.
810,153,183 *541272E23E86A047B7A65571075873AF3100B99A A=o/-
810,153,184 *541013701F5FDA5FFDFC9253E2D9B1FEEF109A47 A!)o(
810,153,185 *541EF15A14FE735583397384609AC773A503EFEB A.,+o
810,153,186 *5417EFF7AABAA1573D970D288D685A10A70A1C0A A"$o,
810,153,187 *5415A0C8B87D093919E9F67DE9A659A4BDE058FF A)-o$
810,153,188 *54141FE07BBC6D22909D4AF5CB21DF84FD6806F2 A)o//
810,153,189 *54170B8DC4985EF1B2D55DDCDADA11A84DB3C76D Ao;)+
810,153,190 *54157C39826CD0158577ACB4A9F6D705D2AECBA9 Ao(+;
810,153,191 *54162F915C2FFC367E91F3A26C5B17B51E12F300 a?#o
810,153,192 *541668D196715F16332C9378D28D715367AA88E2 A-O&0
810,153,193 *5413B5650FD21924BA2FB2767EA041CEAF23FE7E A%_O0
810,153,194 *541187481354EC8E2EF378EBD058CE5C40237921 Ao=0)
810,153,195 *5419E725D656F18697E723BC3A896E0A721C12BE Ao/)0
810,153,196 *541D4FD8F27C72CE00E92B6C86EDF7FC5877120B Ao}0
810,153,197 *541136357B6F9A7260CCBFA9D0D97F18CD3A4A67 A=o0a
810,153,198 *5415790068162B4181E56128E83199AE9E06B187 Ao
810,153,199 *541D5E3FA39AC74B61CDF047398ECA5DFDEAE3B0 Ao?0H
810,153,200 *541BC246688547830B98E059589913BEB38FB1F5 aO0rTKDsG8Sblger49nfCQ
810,153,201 *541FE95994F29AA9012437812FCE07C54178F746 A/O1(
810,153,202 *541876F0732E89C3771D23BA9907F3A218048708 Ao12q
810,153,203 *5419BACC4524A17C512CDC337EC38E74863A93D5 ao-144
810,153,204 *541AD4BECC3B797CED879B51A40E1E653CCCAB18 ao1l
810,153,205 *5410BC854287C0EB649101A301A29C664573F66A AO1ui
810,153,206 *541BD3FD4D13E3C46ADAA10E3160700236418C8F Ao$2,
810,153,207 *5418C1046213F42D14498260700952D0B7DBC09A Ao25b
810,153,208 *541C0D75006B0B6D972157189F5E013FE6412FFB Ao2ah
810,153,209 *541987C6A61A72868C9F8C5CF901CA73CC3A57EA AO2Lj
810,153,210 *5417955FF4264C989A884F46E6E316AAF1865821 Ao2NH
810,153,211 *5416B98EFA30C391066FAD5DD1A798A103215E66 A&o2t
810,153,212 *54115FA51E66136BCF1ACEAA599BFDEEF38D3CD6 A)_O3
810,153,213 *54189517BEBF0B7C423D5F4EF50D045FF6AA1DA0 AO/3?
810,153,214 *541921342323BF320E3D1AC2FF1FD11FC07E8CED AO&3#
810,153,215 *54117E01AF3F2E8FE94095886BEDA06619C97862 AO3Dm
810,153,216 *5410C944D33AA46B5A8E7AAF183919CB85D6ABFB A#o3F
810,153,217 *541AF7317823639AD17A1BDA0A21A8DCE0EB2C4D Ao3?H
810,153,218 *541515B351AC43EDFE336B4E103CE313AC79B58D Ao_/4
810,153,219 *541665457C08DFCF5FB3A778F98BE27617F59CD9 Ao4%A
810,153,220 *541B20907BFC08E5FF1F9C2269CC1A041FD15C36 Ao4"a
810,153,221 *5410623113F585DF26BC682A598CED58AE20F352 AO4BK
810,153,222 *5417D1A33564B2AC31CEE79A114A8472DD35A741 Ao4NN
810,153,223 *541EEC219238FD130785301BF9E2B450ACE29669 A
810,153,224 *541EF3DF717CCE3B8E776000E2B4871046B2043B Ao4Sv
810,153,225 *5410A335C0B964C873DD9F6F56972A68554031C8 A=&O5
810,153,226 *5419E3F2FECC8B98891EDC85104DA92916D16DAB A=O5;
810,153,227 *54194C6B0D61F67FDA2371348B35743BFE1F2415 A%O5.
810,153,228 *541D38A02435B2378DB28D75F675D167B12FC772 Ao5=7
810,153,229 *5410CB379DCAFDF22EFF853B0B146DFACC736984 Ao5aK
810,153,230 *54137DD627AC66154F1A87BE7867002456225145 AO.5m
810,153,231 *54171A348393650C41364D7837578449DF08C834 Ao5Y0
810,153,232 *541AD633027637885C8C1F2A02F9DA8F128CD7E9 AO6
810,153,233 *5418403607836A25929EB59AB319216D0BC1E3DF AO+6H
810,153,234 *54134E736ADDB0EBC61EC2CC3434D33EF4AA91C8 AO6(H
810,153,235 *54113AC63A02A1F9ADD16E8F58DEF520E5C7AE36 AO6lY
810,153,236 *5419E20E8099216FA4AEEFD4DE9B9385883F9070 Ao6O(
810,153,237 *54153FDCE5FE7C5E81B6CD0C8EB519875EEB3138 AO6s
810,153,238 *54130DD2A93A9271097E202225C22B1BCF579C4E AO6S6
810,153,239 *541E879D006FAC31F559183CF76E1AC87A978CF6 AO6V1
810,153,240 *5413CABFEEC09FEDE8B93E8900A403E20B0B89AB Ao6ZV
810,153,241 *54113CE9F052223BCF2F314CA9C22031D99FCCF7 A$o,7
810,153,242 *541D30460996187A6A9B83A941C349D60B1D15DD Ao7!0
810,153,243 *541058D93A3890574A5942F18A7FDBE9F7437D5B AO7=8
810,153,244 *541E6E9D7967B94A1DC072132B304D3967E06125 AO7Ew
810,153,245 *541A6DAF86F8806CE55FC3A885F7A31D60FB10B6 Ao7h5
810,153,246 *54127A23FA833A98142345103F39F292E0B2D22C Ao7lu
810,153,247 *5419368422D00718721BA45A336B411E473AF709 AO_7P
810,153,248 *541402D85110A35704F7051337E3EC40A1CB590E AO7u(
810,153,249 *54196D5015B34C08CF6CA94250CAB770A67C1021 Ao_83
810,153,250 *541F333B6F50F3CC91DA4E52DAD6FB8EFABE188F Ao85R
810,153,251 *541287DE607B69002EC8AF2070359CB7BD5EF908 AO8e;
810,153,252 *541C0BAF5259821C9462496882A763395EB47A21 AO8l=
810,153,253 *541218039D5BFB65753C77FB054D0DBEC2BE1F01 Ao8L3
810,153,254 *541E56E30B9A47490F3D0BD7ED6B62B12A7946F6 Ao8T4
810,153,255 *5412C527355B1EE5F4E7B65D171BE25C3E9DB729 A#O"9
810,153,256 *5410735607DE896EE318E3390BBC272822D79B53 AO9fZ
810,153,257 *54127E408B52B30FC1A9A72A7BA6AEA83854CB0D AO9-g
810,153,258 *541E65DA352B0C2F3342C34F239FA99A23A2BCAC A.O9L
810,153,259 *5414BD22552BF0A892110B4B4D84DA04DAE51626 Ao9Ms
810,153,260 *541AB1ADA54746EF10C74D6147F7AC27FA5BBFF4 A"O9R
810,153,261 *541AB6F74198A5D9FBE55ED6B61242D66219D4FB Ao?9T
810,153,262 *541F36E0E8812E46B0B7462733A4D495ED7A2886 aoa494
810,153,263 *5412A1468B8924D99D92D191A1A921AA4CFCD60E AOA9T
810,153,264 *541204DCBEF7C865FEC03ECEBBD4CD7F70D3444B AoaB+
810,153,265 *541A60D53DD8F30AC45823772F57B34E1BB4EF61 AoaB9
810,153,266 *5411958FD9956AEFA24E970EE2E6C870C93C17DC AOaEP
810,153,267 *541327FFD07896AE0F1D2D14565F02951112C5F0 AoA#g
810,153,268 *5410866AEC7BE04227947101DD7A66DA3A36C9DF AOAiL
810,153,269 *541E932C30E2D73DB36FA82BFBA7BFFEF4B8C4E0 A$OAk
810,153,270 *5413690888B4F8CB4FE9DE969C0D63B65ABED7E3 AoamD
810,153,271 *5413325DBCD901FD6CF9F789C23EFB33932E9FA9 Aoa(N
810,153,272 *541D77009F44766F0D9887D4CDB0CEA224BB96AC AO
810,153,273 *541F4DF77C97D7B94BFDA6CBCB29E5208B9009D4 Ao/b_
810,153,274 *54140C8A8DDB5BC01A85454229239A2667015676 Ao._b
810,153,275 *5411B8A9532D2A40854CF283761CDB974397FB9D Aob;$
810,153,276 *541B6BA4C0D5745604BC4819623B437D34009A2E Aob"7
810,153,277 *5411FF718CC15E5437549AE4EA2766F30BAAC3B2 Ao!Ba
810,153,278 *541411868D6CDC0AECBE54AADD085AD70008A072 A,obC
810,153,279 *541C2C233AF93FAA91945C87A85634E17726E9E7 AobG3
810,153,280 *54108C1C1D6D61DEC8DF86E053A6B40E40F3E934 AObGX
810,153,281 *541299F3EB9E967B169824C929CFD59D3A5CB17E AobMM
810,153,282 *5411AB77271C61F47B6A5CAB9E0E371AEFAF6CC3 Aoboter5
810,153,283 *541B3357953F283317119E6D25E82F46C3E4717E Aob)p
810,153,284 *5416BA2143678949AB7BA839ED291FB1D7AFBA68 Aob
810,153,285 *54104E44C19607E50C6BAE5D45B1EB3316918191 AobTl
810,153,286 *541EFBA93C0D46B3D9B6B68ECC10387977F1089D AobUF
810,153,287 *541E90F63F885F41D1A7A0D68C6D247B0E13CB96 AobUK
810,153,288 *5419577C7884EA5239FE2CF6B15C1AB4D985C0E1 AOBUo
810,153,289 *541A9D458E8AA21D14D4B570ED970050E6F9128A A-oC/
810,153,290 *54169D973EB1C0CD05CD00E3FD8D736A075DFB30 Ao$(C
810,153,291 *541AEA9D2D61495AE2BBD9597DD40FC6D9F3750B aochão
810,153,292 *541BCDA7FA275AA4B479525560C919939D9595FB AoCjW
810,153,293 *54120054E6E62D4A9A8B9BF44878F9294EF953F0 AOCn(
810,153,294 *54165BD4879D687BE3987A401C5458AEC6E9173E AoCU%
810,153,295 *5417F0F43F2FA6B43F8D915F866FA335C3F85CA8 AOcwk
810,153,296 *5415E34D016455DCFE57E89D2BE30F782B2361C4 AoD_(
810,153,297 *5414AC4A6767107B7976BC211E7E569F283217DD AOD=5
810,153,298 *5414ED5103545FA525D35AE44BF375AD5C4E0D05 AOdg3
810,153,299 *541D48485B17A4CA2769926AC90E6225F0191990 AO!di
810,153,300 *54183D02D8A4F266E8E58E81D32E88224CEEA46A AoDkN
810,153,301 *5413CF0EE499DC8E5C30D54A38E4BE85F6CB0DB2 AoDT,
810,153,302 *541ED31D4FD1489335B98E60B7BC80E49ED52A53 aodtl
810,153,303 *54190374D22DBB9681AA465C1F4CCB4100DFDB5D Ì19Ê90Å
810,153,304 *54141080E74E0758420CE1A8D47C015A5C269212 AOE
810,153,305 *541B74FCD94FEA54B75A3FB3764A3C59F98B2C7B A#OEK
810,153,306 *5413FB03FFC0E0335B0552F4EB966B442E1CB8B0 AoEPE
810,153,307 *5411BD6F9150269B639FE07517B95AA2709A3D23 AO!EQ
810,153,308 *5412444734A9B879BBE99AD3F3C453E753E6732C AoeqB
810,153,309 *54141FB2DD0BF7339AA317D2773740EA0257D6D8 A(O(F
810,153,310 *541F41F0F0C4014308804EE2D8B8E178C56CA0EE AO&=f
810,153,311 *541A39F721A0213AC148A69341AA6E8CBBCCAC14 Aof_A
810,153,312 *541B2428FA93555AFBF9AE0AB08B3DE675D1C8B8 AOFiq
810,153,313 *5416639EFD934AD145787C219B73BD7BEEFE6857 AO)Fk
810,153,314 *541301CDD850DAD063876E138187C664CDAD1C10 Ao=fK
810,153,315 *5411A7138B24AD4CD472A8F2E02C56174AF856BC AofkQ
810,153,316 *541099C183676A4DE18275B02A8AF72A703E0FB7 AofwD
810,153,317 *5413837F2E35D348E5E2EAB4346AD634AF555BA9 A
810,153,318 *541A6A96B7BA4952102959113ECA83A7482F8D63 AOg/4
810,153,319 *54126AE060427AC6ECFF84C79CB10EC07D48D2AB Ao&G8
810,153,320 *54198D34601DA3BADF87C057589E67BBE3E69780 aogfpauY
810,153,321 *5416683D5DDB1C5434FD9C302CF7AFC41E2862A4 Aogjj
810,153,322 *54115A0502549AFE99024032CAA7B3AAB373C954 Aog(N
810,153,323 *5414DBB1067AFDE331D798FF39BBFE4F7697F2E9 AO/-H
810,153,324 *541DC329FFA0CC35102EBEBE39402AC762328009 Ao!H_
810,153,325 *541D155CC32E77FF086304633F6D5BD4CC4CCB3A Ao
810,153,326 *541713E2B259D86C50A349C28978412EA3039B79 Ao(_h
810,153,327 *541F61704060B26F86CDE0D82FFBCF6CF35CC612 A=oH0
810,153,328 *54116E55012EA10F41CAE6C0EF5D6709395F4342 AOH62
810,153,329 *5416F25DF2049C663F0023BB1E01FBA932FAB7C1 AohCe
810,153,330 *541924FA9666FE3F2C1426CF679742329FB3E139 AohCm
810,153,331 *541B7BE66C4CAF95FC28DD96CA4E065BBD54FB94 Aohetsil6
810,153,332 *5413A846F135FFB0E5FEF5930709992E5DB214D1 A+Ohl
810,153,333 *5412465B4A4B750AF620610A186B592AF6294F04 AohlX
810,153,334 *54173BCD4D98EC8A4E8B8F1F2570979DC53A2323 AO"hN
810,153,335 *541F73C92E677A3DF5C5E697103E3D6D13B82538 AOhSV
810,153,336 *541FD3B5510B8F31CCDD61A379DF98BCEAFA418D Aoh#U
810,153,337 *541447035D99D5775D668F9DE77FB249A9D6C427 AoHZ_
810,153,338 *541EECB46E0ABF30EF9F7CED9C3C217555AF373E [email protected]
810,153,339 *541074294EA6C951C3CF180594BE289F18E7554F Ao:)I
810,153,340 *541ED3DF823BFA6A8C3CE72DC5F63230A608796F Ao&+i
810,153,341 *5410587BE6FD1E3373B120AD63DF852FADA8B33C AoI1i
810,153,342 *5416FE18A9558C7B017A6E0F048930780C622F3D Aoi1q
810,153,343 *541CE3ECC2BD55F8FBFBEB08B4B26F894C693B35 AoI6O
810,153,344 *54112B2CCF6F688B17A50250176BC75393BD4E1C Aoibhill5
810,153,345 *541B4EC474176D95A667158634C1CEEFE921A490 AoId(
810,153,346 *5418C79851CC21B8B6597C7598ECD589FE3F8765 AOI$j
810,153,347 *541142E85BE317FF90A9FC9B2B6716F43D1909D0 aoilighing
810,153,348 *54135BC3ED5132A98EAFABE8E023D014B774E57B AOIM?
810,153,349 *541C387F9AB5B940A6AC63E590B305FE8548B258 AOipC
810,153,350 *54130F0CF3A2FAE23D0706A3D0450820C1E4591E AO"iq
810,153,351 *5416A159090739B1D6B98F8A5EAF5FBC0557DE2D AOI;w
810,153,352 *541FEB52600206C003E52C1FD62FB9BC6CA713DC aoizes
810,153,353 *541FFA819D4C8F43237525738FAC4294793376BD Ao^j
810,153,354 *5419C1DFD92525D31844980ACE866D247D3D51EA AojrL
810,153,355 *541CF66E0590759D8685C3BCC591B4F73C1F2AB5 aojyj
810,153,356 *5411F2CACF7F94C6B5E86C9F03D1EBEF473C8ACB AOK)(
810,153,357 *5412E9216BE0ECA893B7C37C716D7E795CA3B258 A%O+k
810,153,358 *5416934E98481F4FDAD617881673C9210D1D54A5 AO")k
810,153,359 *541418E6A3C6A788BEEC7B2B4D9D6FF338635056 AoK%&
810,153,360 *5416280066ED7B6F68236442F2409184BCCD2FAA A_OK1
810,153,361 *541515CE101C7C35C98836E858DDCB0E344153CA AoK;3
810,153,362 *5411CC1ACB67C520011275A7E51B9DDF766A4953 A(oK5
810,153,363 *5413C4DAD9D4A622746AE782956A5FE2430A925D Ao#K5
810,153,364 *541F1D9EB360CA5918E86E0D76BFCA714972BCDE A;okC
810,153,365 *541B4139482A9E48403D9C56D607D47CA896F0B1 AOKe/
810,153,366 *541F52EA69AB7FBC1687E9882589DF8196A66C52 AOKgj
810,153,367 *541E85B83C1408B95E9144A7B99E9F83EF69E37C Ao;kH
810,153,368 *541B90B8276D58AC12411903EE74026C486FCAE5 [email protected]
810,153,369 *54170F98A605C3D0D0597B90F175E49F1DBA2FCE AOkK-
810,153,370 *541EAD309937BCB0984E861A7A737F6DD3D46A03 [email protected]
810,153,371 *5419A6BA71FF0C9FAACF9C52F0AEE42313B1FB3E Aokkuusing
810,153,372 *541F57DD236988156431A4CCB6DA4F4EF0144576 Aok"l
810,153,373 *541232FBBC720389DA3D79CF2505C3230972EA00 Ao=Kr
810,153,374 *541DC03E8117DED9B0EAF843C35D7895564BCB3F AoKvN
810,153,375 *5416AEE948D152FE75916AB3004E32D1390A407C A$+OL
810,153,376 *541C8689E6527526F9BA06936FD9BE9E42507690 AOl.$
810,153,377 *5416A370744C45FCB5A9AD30CE671FF61FFD8363 AoL3l
810,153,378 *541A00774074D0C921F00FD8E625D830090318AB Ao(L4
810,153,379 *541AC154B253616AEE739D85B72A4B02A6048E2D AOL5=
810,153,380 *54190BBE2BED5D6DF3DAB5B647A02062BF62B250 Aolatsor9
810,153,381 *541E605B8E5B8C5639985595115E23019E096640 AOLeE
810,153,382 *541E85C5185C35F0F10FDE96998E5CE154ED49D6 AOL$K
810,153,383 *541C047B8E5CF15FB8CE44047330C9A3BF6AD08A Aolk9
810,153,384 *541A977A88CF275698EA3FFADB6A524D5E9B6EDA Ao;LL
810,153,385 *54112A7931BBAAB598E969E59738A587CA33FCD9 AO?LO
810,153,386 *541DAF9C240CAC938EA11EC577F70FC25253B6B9 [email protected]
810,153,387 *541CDEEE76261F7BCE216C16A9EB990870AD6FDD Ao#lt
810,153,388 *541EE133C34EFAA241B8A42CCA4B7FDEEC6F11CD AolTw
810,153,389 *541866A238CE905B4674166C4769DABF400FD837 Aolutotn
810,153,390 *541F32E09D50F9BE3214E14B28C0DA6045AA6B87 A!$Om
810,153,391 *541FEADF88715065280F551AA9061B21ED718EAB AO-m&
810,153,392 *541C199E1D924AE4D204BF1DB2DFD484BCE86D9A aom0825
810,153,393 *541E40A8FED3F4FC3074E04F9A1BF8FACB57C25F AomjB
810,153,394 *54167A14B18F3D50C8569CA3AC43BD3D55C6E407 AOMNW
810,153,395 *54147CD59E2D3BB756504D4984402A7529800E28 AoM+S
810,153,396 *5416C62A0DD022752AD708F034ABA72ACFD80F23 AOMTS
810,153,397 *54156293DEF7D460404A9A3DDB5DE769BC07A4A1 AO.mu
810,153,398 *541159279C82FF6AC9F4300B649A991657914AF5 A)O;n
810,153,399 *5419BD5C1E5909A3BADC08E3E9E5888B750B992E Ao(n-
810,153,400 *5410B4CF5B08A02A907612EFFFB7343AB535AC00 Aon/:
810,153,401 *541A476A3C6A193FE9ADF0325EDE3E8EE26DF190 AOn0c
810,153,402 *5414E8B22300DFB317F75EE471DFD2C80ADB16FF AON2K
810,153,403 *541CC0A6F4B31A8222E5CEBD1E01E8D9549F4554 A$On6
810,153,404 *541C1CB23B3CD83AB9ADF2F9BDD3295770E23F97 aonang-divers
810,153,405 *54174FCB9C38975414478CB724DBA96F4B004D92 A.Onb
810,153,406 *541688C2AA7390E84177D4806066AF4D8F0A4522 AoN?d
810,153,407 *5414A17A886F207952BF67CB54DCED8FD8CEB54E AOnfb
810,153,408 *541E43DD1894D79A5C2A7F5AEEA3E6253DD6B883 A_OnI
810,153,409 *5416A26F8F630E6D485A648D2D87FAB8E66F7C7C Ao+nN
810,153,410 *541605374DB9D6B01085A98505C724FC02973B70 [email protected]
810,153,411 *54167330B9EDD46F22B12B94A9D51620F5BE8C81 AOO%!
810,153,412 *541E1F15DA526910EC9D7E1F53B0BD6C90E18477 AO$%o
810,153,413 *5412132AEA87FF32AAB064E8B4BDA813BBA54C74 Aoo/!
810,153,414 *54153C4FFBE9149C687EBAD3DB869E11CB9CAFC9 Aooa_
810,153,415 *5419FBCC934B93B4F4962DD2E7F3893623CDE064 AOOBZ
810,153,416 *541582AED7FC2745F60A692FAC0252E01C57341C AOo%v
810,153,417 *541807DF5157EC156F50CA19AA86DE8677F43758 Ao&P_
810,153,418 *5417BA98B7014FA110903BA0FCDE1B7D1BC57AAD AoP?$
810,153,419 *541544179A5A0F13FED40A31425BE3D1A9EE63CD AoPGb
810,153,420 *541D22F2DABCBDAD2880CC4D0110D7631B2B5F61 AO,pI
810,153,421 *541CCEADECBE9CD0A95B1F6EECCAEC1951920603 AopjA
810,153,422 *5410C2503CAF22B09A6C830B848F8B93CD009B17 A?Opo
810,153,423 *541BE1BA21968476AC3911B7FC0FE9E2EB5EEA44 [email protected]
810,153,424 *5411EC45E9599A7A1EDDF0D7F2423DE936AE1E83 [email protected]
810,153,425 *5418A100703E678BDE1A4132E7DDEDEE263324CD A;o!Q
810,153,426 *541C0FAF1C87A20D0CF0D749F2267561EA24D952 AoQ%.
810,153,427 *5411833D6C9EB247F88C0EAD555D13F3C28BC021 Aoq(+
810,153,428 *541D4495D555236D168212B9BAA8F878D0FAC774 AOQ9.
810,153,429 *541058E551CF945BFAB83529D6BDA045EFDFE5AC Aoq9W
810,153,430 *5417D4EC1FFFCF8BA8B07AFB1005C804854759C5 AOQE9
810,153,431 *5410148EFE5C75BFBC47706D038B16009702896C AOQg9
810,153,432 *54183465E62C8081EBE43A05C52A6EE1ACC75013 Aoq,K
810,153,433 *54180749A30DB91A296327346AEAC1525E029E42 AO+R/
810,153,434 *5410438B54B124B1055B96826871058FCEB799E4 AOR4A
810,153,435 *5412E7524F4FD3A67C83E0399A3EE7D46C4AA47F AORGh
810,153,436 *54121FD5B354415E72406C2F03F041E186F9480F aoritises
810,153,437 *541CF0D9E8DC49E68A7AC5E378E1A01224812592 AORKu
810,153,438 *541988E614A268CDB90F9E3E15E76A27B8DAEFD9 AorLj
810,153,439 *541A9FC24BA3E4B92B60E57FD3246C9D012882A8 [email protected]
810,153,440 *541B28509790B985E57086FFAC3C9CF36DB17CEB A-ORv
810,153,441 *5419961555D3A42B3A6CFE60CDBCE81AD4EE2D93 AOr.w
810,153,442 *541F8C63B2D6EA67268DB171447A79708DCF5E10 AOS
810,153,443 *5415035E63655FA45B2A590EFB32689CB12164F6 AOs:/
810,153,444 *54120FBF83ECA233324D97664C95EBB6E66B37B8 AOs
810,153,445 *541C45599303091476BAE31DB575A6C2898656E4 A.oS?
810,153,446 *5419BF0FDBFC639B4C67330789815CF7A11C13DC aos886r
810,153,447 *5411662EB182B27C4E887A263D02E0DF287DB01F AOSATSUU
810,153,448 *541C9D2CE6D752F42336E9AB3448DC77BE1C21DA AoskM
810,153,449 *5415CB8F9F96AF85CF4EC181519792B03B43EEA0 A#OSM
810,153,450 *541AD10982BA59AD81BF945D6DA78115F537D016 A
810,153,451 *54101B4E6684E44F6724FA4FDFBE33610B76B324 aossenen3
810,153,452 *541063AF9B44601A77389C1603BAF09216E80C7C AoST6
810,153,453 *541DC681E4CE3030CF923BBBDE04377B869FAE15 A))OT
810,153,454 *541712A87FC7BEA7E34DF43AA77DBF4A5E789893 Ao;T"
810,153,455 *541984BCE6830CAC20EF676AB3DC6DF6CB0BDC43 AOT1O
810,153,456 *5417C2B6062069980C71B82703A3BC33F08328A4 A
810,153,457 *541EB0A323151AE91412A037CC5FAA342B796BB7 Ao-TA
810,153,458 *541DC46ACA0C89EEB48AC192F3A114726AACFA40 Aot)D
810,153,459 *541EFE313A099177F0025CF46433B0D7425FC999 Ao"TH
810,153,460 *541DAB3C9129D52DAD158632847150FEF338F1FF Aotheik9
810,153,461 *541C76557A41DB3F797E1B70E78EAA49F49920BF Aot&k
810,153,462 *54141ADFF74552F423432149EB14906728104976 AOt(l
810,153,463 *541E39C01E77EF5360A17C00C4567F27279E6648 Ao:Tr
810,153,464 *541593738173DEAC2A19D05B1EC30CB9BCB7E1D0 AoU5r
810,153,465 *5415A3FD77FC5FA5559CA9F0B92CE1BFBF4D93E1 AoUBO
810,153,466 *541D2C7DBED937207A5614E1064115BF95E2E5CD [email protected]
810,153,467 *541F8564F8F65A40C8397D064F7635F4327A0CA3 Ao_uI
810,153,468 *5412A8575045F44957B9E034A7C60DB071502DD3 AoU)r
810,153,469 *5415E7F1EA4473A3BCDAF86CAC3CE5884FB498A3 Aousiflik Eh
810,153,470 *541A4087CD7CE6FAB0EFEBDFCC090CA7FED823FA aoutamiga
810,153,471 *5418E86370474725AB11C1703B83B6AA534D53D4 Aouthszing
810,153,472 *54107D6A4FFA2001262A1A8593C636B1D94A6A2A AOUTY
810,153,473 *5419D9E0C55F80E4D5834361920B89E927C70A35 AOUWi
810,153,474 *54194C6102795B2F5ABCE755F4F5F7593BB337BB AO?v.
810,153,475 *5414FB4585E3D9E0F2A3631F250FC80587414204 AO".v
810,153,476 *541AF5189998611647D62AF92315F6E3A945CB7A AOv,)
810,153,477 *54150EB69A863E3E8B2597C570570611146CA4EB A)o=V
810,153,478 *5412747941316E56060E0F0F95841C53D62883D5 AoV$)
810,153,479 *54141302183D08963CC6885A3E46CB942384C933 A"-ov
810,153,480 *541E15A08416010E427CCDD6305A474ABBF91C40 AOvelhaErrante
810,153,481 *541DB391E62F42D8331E48408005DD2A432032F1 AOvOj
810,153,482 *54159D705B769DD31122AA5C36EC8E18B383BBF1 AO=VR
810,153,483 *54136289B61EE02B7AEB8DDDB3D6814B98D655B9 AoVrM
810,153,484 *541316C541D15C0D0B3EDC9189DAEF58367FAFBC AOVVH
810,153,485 *54117CDA35C99B040FD5E962E86E2913606C6B26 AO_Vw
810,153,486 *5410EFF2F1C4EB6972C7731FD04DA0BA306584B4 A(o:W
810,153,487 *541677CCEB4A80E30EF0428638A463E6423DBE3D AOW5Z
810,153,488 *541CF62671FA99F30B951A403984049DC0E6CCB9 Aowg_
810,153,489 *541937D7ED8B937697FD3B1DCFA9B2216AEDE12A [email protected]
810,153,490 *541813FAF116BA74AC8785E830AA9A3679C0DB85 AOws!
810,153,491 *541DC76399457657C04DCB41FA98C2662E65C230 Ao_WT
810,153,492 *5411341097BDD6471F7E06E77E274CD0A18C71CA AOWtn
810,153,493 *5413C423692842C653E2F4AD18CCD01759F63FE4 AoWtq
810,153,494 *541A4B45ADF71796630A3F5166CE6F2A6A622FF1 AoWX)
810,153,495 *541033916D36BD8B0AAC03206D2C8A6C6D4BDD32 AOX3
810,153,496 *541B2A08008514E68FD04EC6A1A3E5E1B8EC28BA AOX7&
810,153,497 *541A6402DAB550DAAAEF8AB9A4DE3639770F642B AOXL0
810,153,498 *541A1443B94736CD0D720F2F1AAB7FEC56FEAFD9 AOY1X
810,153,499 *5419AC732B8C8B31A0BA77496BA3A02998A1D943 AOY4v
810,153,500 *54144179A0D86C891DA531339D4E089FDBB0C220 [email protected]
810,153,501 *541EECB14E32CBD08EE573DE50BA984CAF915556 [email protected]
810,153,502 *5411D77C17B41D54E2D05E96775986C9C24B786F AoYPe
810,153,503 *54111249647DF2437C36A98F9DA9AFC7232D6FEB AOYr7
810,153,504 *541809063745C04DB31ECA22B1768EE7C7975AA9 AOZ"
810,153,505 *5416F27229D47D6519F5820F80BA1A3017A4C3E4 A(,oZ
810,153,506 *541263EE576217C6FE9065BCFE35D277A325FE00 [email protected]
810,153,507 *54154CCB5EEAA1203CD1EE6EBCD474F347E5E346 Ao_"Z
810,153,508 *541BBFB4EA8F57B9637D7FADB699D44AD5E07FCE A!oZ2
810,153,509 *5418EA8CA961D3E584977D18E41E0AD9F7985D96 Ao_ZB
810,153,510 *541BC20507103D979CB7A2A044C373B8E9E20CCF AOZi$
810,153,511 *541AEF06DAD53B4782ED2637E3AA64D2F77BEF9F AoZO,
810,153,512 *5419DF8167AA3D335DF4A4BED58E510254696713 A
810,153,513 *54152C3F92BCDE9AE6AFBEE0AB7E91028CD1792F aoグループによる公式ホームページ
810,153,514 *5411349F3C3CA32509993375AECE433660C04E3B A;P(,
810,153,515 *5416EDD2008B3541240C71A9B4C3494A54E16412 A(P&?
810,153,516 *541A503D88D23BC93113A81828386CDAC67070A5 A&P),
810,153,517 *541CAFEA3759F064D316DD4491112DBB3C41DCAD AP(#_
810,153,518 *54163020D9F6D817537AA3FA7AE82E74EC09046E AP$$;
810,153,519 *541CB3D25534F1A23AE61F1EEA9C7C1944131790 AP++/
810,153,520 *541EB795253B335B0E4FAF498C3A314D43CADF0D A;:p?
810,153,521 *541055DE7162777D0156D948DE2793C5F3751892 A!p)
810,153,522 *541C451933AB4352E1C0544F20EE4268CB922C88 A?p,,
810,153,523 *541813F98F77A60AFE2E46FEDEEA789F37937564 A(.p+
810,153,524 *541A3AEC9C9D7746AF5C8C8331286629193F29F3 A$p[
810,153,525 *5411D8FCD17C340FDF9D417241C88D86AB5EE119 AP.(0
810,153,526 *541C52E50D4C2EFB79042AFCFCDC5C05EE4011EE AP#0:
810,153,527 *541586B4CAA99F53E9EE778833C8443F78ED24E4 AP00A
810,153,528 *5418232C7C8B94CCCC10DAB6E22C937B2D3C84CC AP011O
810,153,529 *54104F2ED65C8D6047CEE795CD2C61394BA6F782 A$p0a
810,153,530 *5418B749649746463718CB9B356F6FD502D2DC54 ap0ca7harsis
810,153,531 *5414B9FF84D6C2073EECD16C4C688063AACB8264 Ap?0D
810,153,532 *5412AD08168AC1E4C060B9123AA4F3405FCE0430 Ap0IE
810,153,533 *5414204CE5160F9E661CE20FDCE10FF4206A84F3 Ap0l09!z3d
810,153,534 *541D213B4D0AF17BE2145F6B135A2BE321F072A9 AP0MW
810,153,535 *5411507927F0FFCC15583ABB81CF3452E6C83B17 Ap0Rp
810,153,536 *541A55FC975565A1F9A8535B05668FF2C83D6DDA [email protected]
810,153,537 *54111F1979B2794E00B672D4EDF05FD29EC1D30C Ap11k
810,153,538 *541795BDFB67B717BDB463C6ABDEEB2BCD4B9C10 A&P19
810,153,539 *541D7DD8799DC05801FD92B8A75E75DA17F19AA4 AP1Ki
810,153,540 *541E296C037BBD65648AEC6A6C666E827DC9053C [email protected]
810,153,541 *54106B2A98AD0CAA0310BF4596DD0822434B8384 Ap1&O
810,153,542 *5417AE6FDFA2B0B7C163D3B7A586AA9DD21CDD8C AP1ST
810,153,543 *5419B270C84B8BD1A02FEDBB12B17BA019461036 A)P2
810,153,544 *541935A3CF0A7B75208530BD9F357BDB8878EA17 AP2;"
810,153,545 *5412E431225B03135CADA52FFEBE599BB2A2CEF1 Ap2/=
810,153,546 *541B4C5CD6AB9A5650BF3E6C0BEC701B8B998BC0 AP22May2009
810,153,547 *541B25CFACD26F148F44F0CE34D13BE1E19AF8FA Ap23t
810,153,548 *541173FB0FF2D60840116E21F3E185F639673841 ap24692
810,153,549 *5417E53DFD5A904C93B8DF8CC23CB2F487EAD38D Ap2Et
810,153,550 *541CFA32403869B5444ED28543643FC26F04A429 A,p2k
810,153,551 *5415E38C806BAC66841DD2C13F30878867AC975E AP2Nc
810,153,552 *541E75F01C6AB62604A8BEB5863F5B8F480E2F1F A"(P3
810,153,553 *541F17E22F550EADA527FF5614E4D30C5198886A Ap3$:
810,153,554 *54112EE141F2F79F085406BBBC55C760D85691CB Ap3In
810,153,555 *541CC2542EEF065E74146CBD96C4A5E6219DF4AB A%p3S
810,153,556 *541C79013D8D7514EE1C323AFFBBA77E77AF4B7A A?P!4
810,153,557 *541E1BE64C31E0D3F64B218CF4F51D24BC60B00E AP!4(
810,153,558 *54120CB1A93DB793CC67BA04C25C2E7EFAB5457D ap4183238
810,153,559 *5417815F2D2373EEB057826D9931DF10B4FFFEA9 Ap,42
810,153,560 *541734D4B551F76BFE9EFB286C8DF52FDE0298F5 A&p4b
810,153,561 *541CCB5D26D716EA6DC886DA878A4412FE7A3B66 A(p4j
810,153,562 *5415B6472462DB28B83A9508FA4C1771F8A1E5C2 Ap4l3
810,153,563 *5419A34579891006B09AA516D72A809091DD5A1D A/P58
810,153,564 *541CCFBD12698CBC56507F7076B356DE138935B0 Ap5bs
810,153,565 *541AF71021A6E2D5F368CAF4AFE71652E76A5274 AP5oh
810,153,566 *541D3CF5B9A52522EBD44895D7AD37D9B2E4CD26 Ap6+-
810,153,567 *5418737129C165C3AB37C94937C9FDB9F8F80EF0 A-p66
810,153,568 *5414B1E5EE1E258CD76B1F983FDEB5DE1B59F800 AP
810,153,569 *5413C878FB9CAA4A7AC3DF7E57C642E073EADF79 Ap6aO
810,153,570 *54109DCE62FB01D787BCA4FAA8BEB12537B48159 A
810,153,571 *541760D4F1F23B3D732308CF02C12054F97C7936 A)p7-
810,153,572 *5414F75F0930C40E7117CF6F5CC24243C22E8D4A Ap7H8
810,153,573 *541C715E091222857DED079FF3D2AFD1289389E2 AP7.K
810,153,574 *54180A87BE5C66961C76FB978E72412C55A13A9F AP7!s
810,153,575 *5410B0A594EB21305020457D14CC150794F9742C Ap7+w
810,153,576 *54182F5D1C8217077DD091240A0D29FD1E30FF3F A_p82
810,153,577 *5417547F10275923DB4F684895CA0A800A8ADB39 AP.83
810,153,578 *5415B0B050BD790D8D4A7FA31B9CF2C8D5DACDA8 AP84o
810,153,579 *541B359000742F27888B58F68860399488046130 AP880824
810,153,580 *5416B7751FDF1D60B5926D77409C9E8EA07DEC9A Ap8Gd
810,153,581 *541ABAA9DCF3BDA9F84AA5B19086A90B89D0B2BE Ap8LK
810,153,582 *541635B51EFAAADA2E8EBAB14FD53D8CEE648010 Ap9AA
810,153,583 *541DFFD03C9EC5F6755D6C7837E7B1485DE0B2D0 AP/9n
810,153,584 *541AD4C7CEFA936C29EEEA1F24ECAE414107C02B Ap9sK
810,153,585 *541275785C9FE5B1AF92D5CC180B663B09745308 AP9W5
810,153,586 *541FE9159B4EDDCD9855FCBA0AD8373D6FDF72CF A)Pa"
810,153,587 *54187E5BACC9DF06E4E2ECD6B8DB8F374E2ADBFF AP"a$
810,153,588 *54140535357B5CABD07F80BDA55F19890FBD8C9C Ap
810,153,589 *5415457EC8DCD4B2421603BF3507AD58081501C3 APA00238lastyetilib0
810,153,590 *5413F5AEC9005B3ED2073DEC492B1F17F4B02DD4 APA!3
810,153,591 *5419C8BC80F8752199B9B273CFF1E5670BC4289B A;Pa7
810,153,592 *54142D6974B1064963ED22E542D28CDB3C1BF475 apaavr^ita
810,153,593 *541458CCD0A1239B135EDC318AAD2CDFDE4109F2 Apa,B
810,153,594 *541484182F47A8BB400CD21DC90571FFA31EF3EA apabu
810,153,595 *541B8AF5DBC9996E24C19433632ECCD4B5647BA4 Apache23
810,153,596 *541EAF5DFA6CF3338C0D7303F7854C34E3E78F07 apachebreakdown(originalmix)
810,153,597 *5411EA5EE6FFCE2C4A3282BCA946B843E1A999E4 Apachecat7
810,153,598 *541E30BF9CC10224E9621A4C71D4E9C67C1F4E5F apadroarte123
810,153,599 *54100624AAED258E6696FC4F8A5132AE8394AB90 A:paF
810,153,600 *541563A85915515386B708AF88321DEB8A73E370 apagkatlo
810,153,601 *541C19BF4922A14451DD23E63435121E857E8E5C apagloyd
810,153,602 *54159AAE7E00309A68D37AFB20AE3EAA95E08AE4 apaharana
810,153,603 *541F9FBC3ACDB95BC5B2FB09E4CF44959D188498 apajyam8
810,153,604 *5417EDC4BDFED7C0A696E901FC1C2375FD96489C apalaloia1
810,153,605 *541FB01DE9CC7C0EDA87538C9C3E49CA23FE8E67 [email protected]
810,153,606 *541E2A7838E3A92F35D5629E510FE2882B62450A [email protected]
810,153,607 *54117D6EA0B4225F0441ACA314FD7CA975DE530F Apamid®
810,153,608 *541F89909EB37A10A8D1B77898BB4400BBDE6DF8 Apāna”
810,153,609 *541BB097865E16E10EA3C0772857D02B4B6C1DFB Apanaged3
810,153,610 *54160FB8C1D30A5ADE336700BB0EF8EAF63D6BC4 Āpāṇakoṭikaṃ
810,153,611 *54166C30578352A3E5EB31764411F9697FCCE021 APanca
810,153,612 *5418CE469E7C99867E1E17DF66E95F5BABEB3E80 apandara1
810,153,613 *5416FC62406C2AA254CCA0A4D7743A61CDB05462 apanhô
810,153,614 *541D6169953051B5EEB87906E7E818E55B84A328 Apanlete0
810,153,615 *541014B771DEF88B19F8FFF0D3465559A0EC9298 APaNSrSAGJLK
810,153,616 *5414EAAC75175454DF8902C1DE80B6537AE21580 Apanteles2
810,153,617 *541A764BF9BF72DA07A855D23216717DBAEF4780 apanteraed
810,153,618 *541EEA1C6BC499E7DB6AEA33CDF13C4D0366F799 apap19
810,153,619 *54129B124E21B448AB07CEADB8CD91CDB6A30281 [email protected]
810,153,620 *541ADDA3796E09DC041C83061B3A965C4FC44470 APa+q
810,153,621 *54146586271FB0EDC0B3A2ECB913B889EF72BECF A.pAR
810,153,622 *5411F98852BC0C64BE8E14A0A885EF8B4ACAD62E APARATORII
810,153,623 *541D6381E3C03098BEA31AAD3EB2DABF4BF7F809 aparecioron
810,153,624 *541B2FC06FFFFBEA9DE17CEA4E059E91D1D180AE aparixendo
810,153,625 *54122630734F1E91E60E3D7ACB7D0CD2A6C3FA52 apartábalos
810,153,626 *541E26E749B75ADBEE6AC5C9729D468B258DCD41 apartheidafterglow
810,153,627 *541A8EB930486C89EEF2AFC4EAC4B029E7FB77D1 apartment number 9
810,153,628 *541802DCF952CAA7B60EFB3A094E34D3E3C6D656 apartmentsst
810,153,629 *5412D8131736899927C2EE313AFB3D9206EE4AEF APARTNERFORCRIME
810,153,630 *541BB29222DABA5439D818B1E01885188C8B3587 a passage to desire
810,153,631 *541800775205F02AA61BEF33BD283FE26544A146 APASxuNc2
810,153,632 *541CC476F9B9D9459CEACB2EEC0A90DE9D3E96B8 Apatani0
810,153,633 *5414DC6CF08E06AF4A3F41D44577B4C8803A66B4 [email protected]
810,153,634 *5411301BF99C104A8641840D2551C3EDB7F5E48C Apatick6
810,153,635 *5413895F1CC7FF925B4B6E64B825099156F32C47 Apatotho0
810,153,636 *54156DDB9F72D6D3D2DD683EA0435089C7875F8C apatrulhlo1amos
810,153,637 *541324F43AB334E7EBA63344BF48A6987A24A3E4 Apatyaa0
810,153,638 *54162063266A40ACB70F5E7D5F451ADF2E0360F2 APaU2
810,153,639 *54187EB13BE5F0240EBEB0A274556318010CBAC2 A&Pav
810,153,640 *5411F13741F1F9B7737F4C13979CB48606C24909 apawxxx5
810,153,641 *5416D3F93DBEE5D1131E0EF85F6AF374273840AE APAYAO-BORN
810,153,642 *54131209CA7E75ECC760E366B44F83DBC3586A8E apaziguemosse1
810,153,643 *5412341BD988CFC61C122D19F54853B7EBFE2DB6 A
810,153,644 *541B82BA95CDE7C62502715C03675B5A4FC3F61D AP/b
810,153,645 *541D0186B8081C8DEABABBE3DCA17093922D7C7E Apb
810,153,646 *5419376D5260AFF8E47759772464CAE2A09E4082 ApB%C
810,153,647 *5412256F65D755D8F44687F9736CDAC0FBEA7305 Apbdobr5
810,153,648 *5413A51D496F35D48A4709223A30A1EB5721895A Apbhw
810,153,649 *5419B5CFCECEAF9F0D6FE4E00526FCF0CA9DD5DC APBM8
810,153,650 *541A53842E4565C0DEA5DDB888CA7FD2925E039C [email protected]
810,153,651 *54162F71F029BB49FA601DFB93E1E2553B1FB084 APbU_
810,153,652 *541805907C937D061B421D470B4DD37E4D878DEB A%P;c
810,153,653 *541B7A770EEBA08E2575BD866ED5E67C513F6E85 Apc"-
810,153,654 *541F032A4E987ECFE6D033D8838346EA82D0EFD7 Apc2Z
810,153,655 *5411E3842A777610BAFDF9F6E4D474FF1A67589F Apc3
810,153,656 *5417F1FE9367C4F61AA1CA7C94B0632AA19FE6A6 APcC)
810,153,657 *5413F380EC21A27CD047AEC04622FF4019B147C6 Apc:D
810,153,658 *541102E26465CD0CB8A9C0DA72DC6D4D24FB2253 APC-DQ-GLAIDIN
810,153,659 *54146AE311609606E487B2086D75EDB7F16B6CDF ApCF+
810,153,660 *5418C3F70425FFAA39F0D6F2700165F2FECF4220 APchq
810,153,661 *541CB410BC031FC3937082AF045B37D1BD37D5AF ApClF
810,153,662 *541672012992D473C5E9DDF5726AE3D1A7BB59D1 APCMW
810,153,663 *541FC2C1D201590FD609DD7E65DA9D1A1A82F28A apcnf
810,153,664 *541CFD4F8FB2DBDEAB5CA2DB3008264D2E1B043F ApCR(
810,153,665 *541035111D4910AD154DE570CDF9A9245C821995 ApCr:
810,153,666 *541AD7BCED844FFC9ACEB8B1083BA651BDA77A2D ApCS2
810,153,667 *54168C7E2BE0BD74A7A0A6A39F421CEA80C2B00C ApcSL
810,153,668 *5412DCC9A7024A801332FD59BF6B4E5BDD8E7AD1 APc!Y
810,153,669 *54148C2595B760F3A4B4170E8D387406DE00D44A Ap?
810,153,670 *541C60EA2E6B01974BC5FC3B86D1758CA27BEB34 [email protected]
810,153,671 *54145BFF8A353D9599124D968CFB335E85B488FD APd?0
810,153,672 *5410234525ADD7D9A7BD6ACB6AFB944622656B15 apdbo
810,153,673 *5413AAECF1DE922CD8DC5B4B18F9EF1D582E8399 Apde)
810,153,674 *5410A070DCF1E20060CBAC5494278D99BADE818D Ap%dM
810,153,675 *54152131C2B2C96572199C5760A135D882E4CFF7 APdoK
810,153,676 *5417009BFB006A940949386483B66A543A894946 APD%p
810,153,677 *541E25D5AB4ADF445295CD402F12493C0ACC3EBB APdp5
810,153,678 *5419C074E2BE903A8ED01F590E5216AFA0812C7E ApdsC
810,153,679 *541D23A57DDE5737091A8D8E0592F826D0C004E4 APDV:
810,153,680 *541531665EB5A819FDF4A26D12D632E87C28DCB5 Apd#W
810,153,681 *541561E4305E3BB919C8846146CC70604E54A6F3 APdZH
810,153,682 *5414DFC72BAD053CFCBAFDB929B6F4D1AF1C0734 AP"E"
810,153,683 *5417A5D15A19E76F13AEC0589A462F6C1C18B9B3 A)pE.
810,153,684 *541B3F24EC3291584F6838D976A14F52755F931D ApE/_
810,153,685 *541B8224CC5ED18F13E83D2DAEE29F0FD509CE14 A(pe
810,153,686 *541A2A9A8D0D311951F941DF20830EEB5E0C0522 A"pE7
810,153,687 *5417FDE9486D4E81EA1EE9085CEC410B42A86726 A?peD
810,153,688 *5411C9188A4DC9358F73B5092708894AF4BB79E7 Apednoc7
810,153,689 *54197A4D01C20F66284CA6302598A2DE0F51AAB1 apedrejarmos
810,153,690 *541648111DF4F9A374AC8F160AF55A3D258EAF84 apegándola
810,153,691 *54160E7F69DE610B957971447FABD3262BFDA044 $ape$$imo
810,153,692 *541CC05C7AD4F150CB4EAF2FE381BF171DE4CF56 „apeiron“
810,153,693 *5417E2204A775BF58547F32D82070EED5267CF04 Apekkaan1
810,153,694 *5414097DC9D3CD58657E15FE390713FA8E7DE45B Apekomise1
810,153,695 *541FDEE5D4482BC1229EF2ADABFF8C3C149EEC4A apekuur9
810,153,696 *541F83CD95DDBF3D410F2427054E3DCD510C6429 Apelbeam
810,153,697 *541DB6D848944131A2861CED22063B8B8BF4F37F apelcBSW
810,153,698 *5414CAD4C1A3DB3933F08133F1577CCB16503D56 Apeldoor6
810,153,699 *5411BD532C6DBD2D0ABF32946592205D9B328C52 AP,eN
810,153,700 *5415D8D7E34D80D13584EEE06F9D971A2B45AB60 åpenhjertig
810,153,701 *54147F81B038D510FDD78C1EF4453EB7AC235BDD APEOM
810,153,702 *541B8EF2D7CBC63B1B591E20E6C32F674530DD18 APERCEBIMIENTO
810,153,703 *541AAA803393C1CF1961137BCC273F08016503E3 APERCEVEZ2
810,153,704 *5412D5A5B350F2B3BA9A1744B25A4CF0A3A4B7DC APERISKEPTE
810,153,705 *54198346312961681C3A77FF7CE36AE31D7DF70E apertem os cintos (estamos perdendo a press
810,153,706 *5419882A8E53E2403C84AADE9B8E27D03F194A9B Apertor2
810,153,707 *5416574E8BAA410A1BB0CE7AC34ADCECB2457A33 apertur0
810,153,708 *54162094F571E644C1A25B8694D1200AA1605725 ApErU
810,153,709 *541CCE175748C69CE2154664A3239D9160ECF877 Apesapesing
810,153,710 *54186020066B70BBD616AD15349EBA0880735F85 Apetnark1
810,153,711 *541EB375A197379417C42C8672FC0D69E570521C apetncia1
810,153,712 *54123267EF7E6C2A3A2E6376B88221C0249531EA apetoangel
810,153,713 *54175F9E9276368B66C7AFF23D5612152EB05EE3 APeWF
810,153,714 *5416B59A96533FBEB6E6E6D958AB7FBFBFCC1A4B [email protected]
810,153,715 *541D689A5A5EAE69FF812DC5E3840381433EB5D1 [email protected]
810,153,716 *541F4BE8A86C59A66467F11A55132B0897D6F843 APEY46
810,153,717 *541A266C0EE6AA1901CCE98F4CC69B3A26DED467 A=pF
810,153,718 *541D1A11EE6A95CF5238475F4B67C0E00B9AB30B A"p(f
810,153,719 *54127868C647941E32ADD57EBEF8357055A980DF Ap_.f
810,153,720 *5419D672AC88C7695AEAFC2CEFC5B4E4AC9574AE Apf;1
810,153,721 *541A8BD9CCE30EA76B9465A8FC8F7813CDB34403 Apf4G
810,153,722 *5416BB9DBF74FF7840AC92B940C65B0DC2E72F00 ApfbC
810,153,723 *541B68A6EFD33310B7AFCDB143B93E302E24B1D5 APF(G
810,153,724 *541E950CC5E796EE8892D1A4EE41FE0549DB34A7 APFR
810,153,725 *54191CA402C06E98C7D7818D3F5DB657C3B8E3B7 A
810,153,726 *541C3F132FA747CEB13A91CFD38463A5283F8040 ApFw6
810,153,727 *541440579E3A1DF4C368F9EB0CBE6F1F4C0EBE30 APFYl
810,153,728 *5419912745CDCF907C09285BFCA7702CF819B4B9 AP=
810,153,729 *541C0911E6E3ABBE3DBD737ED81C06354B9A58B8 AP.g(
810,153,730 *5412751959EF2569C5FCBF6CFDD2563DEE892540 Apg5;
810,153,731 *541FECB3B45F97328B43D68AF4832106E119B60A ApGf6
810,153,732 *541B2980DA7EDAE167435F228318C249A60F200A ApgQQ
810,153,733 *54161BF870047205104702567B191376A34861BA A-PGS
810,153,734 *54150AE067E0D6506A3748FB5CCCAF1B3205528C apgxw
810,153,735 *541C35C28CBBBB326DF3E9ACCDDB90E45400CED2 APGYc
810,153,736 *541664597B6EED4A216FD1AB5A212D6D444E4201 APGZQ
810,153,737 *5418C33FF6BA9758869492C46059D90DD43F3CA9 Ap?+H
810,153,738 *5411A409DFBA4626F9F42F81141B4555FD5F635F Ap!h#
810,153,739 *5412B84F5B7282B55EACC8961A286B6713050107 aphaeretic1
810,153,740 *54173743261162F2A45A886B760FB3E6F7108126 APHARSATHACITES0
810,153,741 *5415397763A3CA8D333281E3DE9F16F170A0FA4B aphatcar
810,153,742 *541E931CED3D4F563B479F1738B4FEFA3676CA60 APHD-
810,153,743 *5417D18B20F74B8EC80D5427AD152524C272A08A Ap:hd
810,153,744 *5418AC7719AFAD2C4D01AADF21DF829563A00D05 Aphemic
810,153,745 *54196881F14A5EBADE07D6358E6765679205BF14 aphiaid
810,153,746 *54197B7FD0147832AB529D8D8BF6BC6A29F8F16E APHIDIANS8
810,153,747 *541D18F6AB7A3EBAAB784366294FAF637E05DA37 AP!Hm
810,153,748 *54163AE31DD320256BC736357CAB8C7FF9D9D494 AphRm
810,153,749 *541BD3E7DB9871E6FD6017297325AC6997B1BF18 aphrodesians
810,153,750 *541837C0501F57467CC9277C784730F0DCE6D9C6 AphS-
810,153,751 *541EE0FCC671C721B6E4CEBC972EB509DA85CA42 APHTEUSE2
810,153,752 *541B14C912D606A1F0C086939CD328C5833BFA8B AphW+
810,153,753 *541B3360D1083A4FD7A46E2AF183E00CDDFC96E5 A-&PI
810,153,754 *5417B1481B8A0F510A66AE20C23DDF8E572306D3 A<pi
810,153,755 *541D07E80F94F5044A6E0652590E04C4251DE3C9 A+pi+
810,153,756 *54174DD2F2C5AD5C782941FE16BDA427DBA58141 である。api
810,153,757 *541BE467789D3D9B769FE050CEB7B961CF3FC06C āpí
810,153,758 *541797537C4A2244AEB06E5F6ABF3A1C2D59F874 Api2=
810,153,759 *541B5F757DCB93DCB8B8F5C5EDF0B3073A0EFBF5 Apiaa
810,153,760 *541A1C45883B12FDC95D2E307D63F02EAA09FE0C Apiadesed
810,153,761 *54136D7A347DF956ABF675F4D04EF67D4A959979 apicotermitinae
810,153,762 *5415E4D2AAF0B29187FE947FDE93A961D1E9FFD0 Api,D
810,153,763 *54110247245E29F6C039F0A953297C23A74818C5 APieceofSunshine
810,153,764 *5418A24C3A807935969D837BA54104195EA766D9 APieG
810,153,765 *541BACBE2E5527EFD18F6DF97D9B8CAEC9AB642F APIFILES
810,153,766 *5411FB4F15A8587488EEB6DD9689A2DB07C2D44D apiformella
810,153,767 *541E5CB5EA55BEA2E7EB15AC75AD71627E66783A a_pig_named_jodi
810,153,768 *5412DE640C51C5C55D8F17C41E18A2AB8869AD0E ApIK#
810,153,769 *541DC71699087A608C43DB2724F51779C408D08F apilionanthe
810,153,770 *5415601BEDA1F86B8CCF5248E787BAAE86EC71F6 apʀilis
810,153,771 *541706DA7D030DB445BE372242B951B3CD76F624 APIPARSE
810,153,772 *5411DC907EF33DD6E1B55169C8E322F5A2C11BC6 Ap)iS
810,153,773 *541A592BBBB4E46016BF0E385BB0DA316FF0E641 Ap/is
810,153,774 *54157FF7EDBA9E2FE0BF7FA6CBFE0B64593AE77D [email protected]
810,153,775 *541BCD677F1C1FA8689FB058E2FA79A668D6D46F apislik5
810,153,776 *54166F082FE53FC95535CAA5599C54752AD99BAA [email protected]
810,153,777 *541C8D9DB7D31E6DC0CF12E819112E338FE444DB Apitelet1
810,153,778 *541F0EF721C965DC2585AB77C1A53E46C386CB26 APi_W
810,153,779 *541FA6D9FEEAF9C234560A695F350F2925FFEF61 ApiXo
810,153,780 *54189C1C47D80D25A2AE4A3DE9A811F6490B504A [email protected]
810,153,781 *5411220CE18BB46EE006C8EB9964926BE8CAB4B5 APIZER
810,153,782 *5415B96A3DD7D95F819918E71B3FEE763AFF2398 AP/+j
810,153,783 *541057C8654E37477F4EDCE9669AB7B3387FEA75 apj8yhxt
810,153,784 *5410C909C51EA7D643B375009C61C7AEC5A50D03 APjji
810,153,785 *541FC3AA32F1737FCAEB69DB824AE19A7E0F32E8 APj_M
810,153,786 *541DBF7BAFC9181B0632F5ABC19C73A1E24D1088 APjQe
810,153,787 *541272566D8541130596202B4055FA0B331BF3C6 ApjRI
810,153,788 *541B80E5897478A218CE40C167F7C82284EA37A4 A.Pk(
810,153,789 *54171432A09FF1797827C26F16094396F2F72971 A;?pk
810,153,790 *541C2117813C8220C48EDB4BDBC56B87B0502423 AP#KD
810,153,791 *541BC8F858C9832278C9626818527F4EF8C5B644 apkfhjim
810,153,792 *541EC535AC702B9E48C42A243E3F364DB3F30EF0 APkh,
810,153,793 *54150F631CF3CEA98F395D454E0568E3810C3AF0 Ap)Kj
810,153,794 *54149E2616007B5A9E9CAFF02182B3E5D0EC6FC3 APKLE
810,153,795 *541208E6D3D1C87A234F243CED3E7A4E7C4DDA4B apklo
810,153,796 *541DA24404039E8D5838D3174CBF5C356E0BBEB7 A_PkM
810,153,797 *541877DC3D65DE4545D8FDD6282BD34681A2F707 APkOP
810,153,798 *541E3BB55047AB38F5DF693F37423FBA98634D30 ApkPA
810,153,799 *541715CF1F021B9295A0AC7C7D970F7A3DAD83BE AP.)l
810,153,800 *541870F7B8B9F758896BAC04D9A66A26C43B21D9 AP()l
810,153,801 *54141B01CBE5B4BD6D98623027017C6850FBC701 Apl)&
810,153,802 *541120A8AC50757F314604663669D43E6592841B ApL#2
810,153,803 *54137E861D52A81951D1E7812BDED6440A42CD36 apl-43
810,153,804 *541D4D464D2F51CB06B2988295DD4DF8CF79F5A0 Aplacheana
810,153,805 *5413C67E5C6AFB537895DE0D715F7D96FE6152AD Aplainaring
810,153,806 *5418871B67D791DA69BB81F7ED50D40FCAEBCCA5 a plaint for lost worlds
810,153,807 *5419665341429D60A4BE5EE48AC6151E629ED5AB aplanadoed
810,153,808 *541297FE2DC9AE5EA3189FACC939927D232051DA aplanirs6
810,153,809 *54121BDB6A8F4F509564F823F9F7746E97480D77 aplasia?
810,153,810 *5418F640E93A862B2691E1B928082CADAD9A9E56 ApLD:
810,153,811 *541B37DFFBB413C9A0C3713DCCD6C95E21429BCD Aplenden3
810,153,812 *54187D3474FDB5A22D5AD4B5401D1E29691D5F47 Apletsebbing
810,153,813 *541DA72D820E6944CFB2B5F35F149DAC501EE940 Ap/lI
810,153,814 *541AF241B054E7F062428CA3DF007A47560A6879 aplicadaram
810,153,815 *5416E4FF49ED34BDB95DD79C0EB842EA280054B5 aplikanto
810,153,816 *541F8CF4F92AD2CFA76E7AC802CF8429C2F70B07 APLK,
810,153,817 *54144D8E763DB3EAC76AA4575D4D0071F6338ECE AplL.
810,153,818 *541EE7836C0CE45B38CD63E35315C9CDCE70745F ApL+n
810,153,819 *5413A0897040EC2C00E038D4716BEF570B663FB6 Ap#lO
810,153,820 *54175C9C6D113C20D946D9F4B884E028EF8F717C APlq1
810,153,821 *5414C3154E8F6BF94B8CD8A4710684A1B375E3DB AP.ls
810,153,822 *54148B06B712E60BDCD083B02F20E8601017227A [email protected]
810,153,823 *541A53431A4BDE1A0617F3C5C518FF0EBB7D2B6B AP-LT-HONDURAS-COUP-ELITE-BACKLASH
810,153,824 *54134E31A3D7029CB6E9D7CF814E527CEACC67B7 Aplw
810,153,825 *5413259F70BD631804B4EF55E3B2D91D81D0F60E APM""
810,153,826 *54123B48FD8B25898D8213C87FAB90B55111F8AD ApM=:
810,153,827 *5411DCED0A73CF80809B8E83F9C97C55F8152B84 Apm4&
810,153,828 *5412AA5E4497391D5C90584D0C7A6171F3761DAF APM46
810,153,829 *541296327531126DFDC1BAD96F724549B9B6973D Apmd0
810,153,830 *541F9BB6F2750B6E648C58FA5B55CD3B7C180C09 APM!H
810,153,831 *541E927937AD8D379CCB03AEB91F0928DF97F811 APmh"
810,153,832 *5414DD609ED52B91FF6BA0305788934CEBCFD31B APMMYLZ2VA
810,153,833 *5419F03CE0791BF5E948565B6B561882BBF89396 Ap&Mp
810,153,834 *54113E0205A526611BE13EDCD6726A425F39D5F1 Apm:r
810,153,835 *541C0276903EF98308DC0AD54721AE559874C1B9 Apm)V
810,153,836 *541FE885DA54B8D076B20FFF8B7CD472EA7674B1 APMvU
810,153,837 *541A05978B8DB1144A09B78FAC5CE4D0124F0541 AP!?N
810,153,838 *541FED60F8AC5A0558A676767CED76F7311566E8 Ap)N,
810,153,839 *54145BC3F97312EC0E2F284962F17FB4B66CF9FB ApN$/
810,153,840 *54155FADA55992450F1EC05A9DF7C14B0F70CB61 Apn0h
810,153,841 *541EF02DE9C9D86F9A710B89E6B77A93C555BBCB Apn4C
810,153,842 *5419FE3D78382D899963044CB63ACFC7E676C8C4 Apnc2
810,153,843 *5411EBD9D36E5FA4BB31B41656BB896CBEFF9A14 AP
810,153,844 *541B8D555BC244C162DF9C5ADE705BC617722EB9 Apniitlo0
810,153,845 *54177D58925040AC9DF231B1120B8E2FB9DA438E APNiW
810,153,846 *5412D14AFB1D02BC0A5A5319AA40340369EC7465 Ap$nR
810,153,847 *541E672C646C8A7744CE8F0A3BC7E4198283B195 APN!X
810,153,848 *541D45C32E4AF42A1384441506FCF0344EACC850 a?Po
810,153,849 *541134AC7618044FB222E1283AD6C6A065C5DF28 Apo1f
810,153,850 *5411403450952F45D0EB722A3ADDE038FB4D1AC4 [email protected]
810,153,851 *541B97BD4DAFE1B4C53BDFEF453F4758FEDAD9B3 Apo5+rophe5
810,153,852 *5419CC32AA2612EE27B6FBFE00F695EDDC9115C6 APOABUKAYQ123
810,153,853 *5419B1872B89914195A1EFAF5305E482E5B0042A apoalensis
810,153,854 *5412C3EAD769B95616D6FAEEDF4647B3CC333DEB APObQ
810,153,855 *541A63049CE84359D31E52ABF3770F9AE56B681C apocalypse”
810,153,856 *541C62E9A95B8E7056295FEE2D14C62886E7099A Apocalypticą
810,153,857 *5416B0C9F3B062805BBCE28F75E48A7350426410 AP;Od
810,153,858 *541C9BD9270384EDC01EEADCF69ABF7FA33BDEC2 ApOd
810,153,859 *5410EE95D10A515C81954940EA03C7905BE2AC15 Apoforeting
810,153,860 *541F1AFF1E41FA68BC7B3BE48BF65215D9D31410 apogipinoy
810,153,861 *5419AF54C4B86E5F30BC79188F16DA53BB0FC948 APokE
810,153,862 *541E9A1D901AFB70A282C3305C42AFE07B8629D3 apokotoy3
810,153,863 *5416824905C4A877BEB1B024D741CAC4345EA9C6 Apolenár
810,153,864 *541B18B92E291074409553344FDA52EB96A6458B Apolin
810,153,865 *5417C28B4F09982DBE832465AE7769EF3894DF34 Apolistas3
810,153,866 *5417C53DB814446DA7F732C11BB7D23591CBBC3F APOLLINES
810,153,867 *5415586ECD201059838B04B9329A8D82AE08B0D7 Apollised
810,153,868 *541F2C1CA689EAE587D3ECF1BFEB21562F7E2A84 APOLLO13FENDER
810,153,869 *54186DC27BED1E6CE5B830A849713CD323263803 apollodoros214
810,153,870 *541706E7ACD57D8C16CB706B459E1B8486861854 Apolloe0
810,153,871 *541DD8FBB4171A8B1F6124EAB29C91E3E062D659 [email protected]
810,153,872 *54112BEA88519C88CC46C207321369BFD6A1C1E3 Apollopasswd
810,153,873 *5410C06BB9273C521599FB29F4D06737965786D7 ApolloVibes(originalmix)
810,153,874 *541CF2140E07B9788C7A24845BAC5A8A65FEC1F0 APOLOGETISCHE0
810,153,875 *5415B2B515C7892E3F9B492C10F94402E5416796 apologizai1234
810,153,876 *5414B1EF6032900D94E5CCCF57D71A785F716AA6 apology“
810,153,877 *5415EE152130054732B382D2C04A3D3C3CD7B123 apology.bhola
810,153,878 *541D56854030587E6582F1E87D58C009849BC8A7 Apolone9
810,153,879 *541DFE24A1EA80929BAADCE83EFD5693AB6C762D Apolóniu
810,153,880 *5418926CE315CB52E07FC9C4A8BDD56D995E3CF4 A%Pom
810,153,881 *5415765C831DD513495251AB7E9522431A1BD146 APOMICT2
810,153,882 *5413C2FCF4D8E3DE76D0A64A3A0225300C987E8B A$pOn
810,153,883 *541BE98A3CC6B5AABBC3C117FAF8B02FA97B38DA apoorva pradhan
810,153,884 *5412BCCE36FD758207C1F97C946D033A1329B09D apophasiS
810,153,885 *5413A0AC7E76DFEBE63FF15A39AC43B0C3063303 apophonia7
810,153,886 *541C4BC76EB2546D38C78B7F4E5D8910D49576EA apophysis[obs3]
810,153,887 *54162BD1D70B8FCC5D0AFDD0B13715712E84A322 APOPj
810,153,888 *541DF4F35F196F9D61E1E28A366FEA122BF5E4EA Apoplexed5
810,153,889 *541A400014DBB5015ED88B094CD0461B269B4F13 A(Por
810,153,890 *5417375AA8F359FDF94042C389FF63E7051876E0 aporrheg4
810,153,891 *541EEE7D509859D9C3AD55E53F566BD8B037E52D Aporriptwed
810,153,892 *541C896D9D7D7C986DE77C3AB81D293126F066FE Apospoyse
810,153,893 *5417C99C7CB7BA3D401CB2D01C0EBE5A9D2DDC85 Apostados
810,153,894 *5412B5FD285786C08793AD3104646180498046D4 aposted5
810,153,895 *5412E881C50E7D43668E0664F6F1A7200FDF1FB8 APOSTLEPOSTER
810,153,896 *5419A640F6AA62F620BD34B57433914D38C10D04 [email protected]
810,153,897 *5416F282CB91DDD1283C6A7351389AD511C7D0AA Apostolicism8
810,153,898 *54199BB5DB202718C1F1DA3109BA8AC248D0DE51 APOSTOLIQUEMENT
810,153,899 *5419D04EA1D377506E08E31AE6DCBE75876C9C60 apostrofo123
810,153,900 *5416168EA88BD35E552700C32AE6E576FBD4CD60 [email protected]
810,153,901 *541F7A47B54F25423EFC18AEEC4C02178C330EAE Apotecas2
810,153,902 *5419CA322F0278DF0D7E0208E0FC92BFCEFE8AC7 Apotekarstvo
810,153,903 *541C953003CBA2E0745D610D68AF2C1128CF2F2C Apotekarutbildning
810,153,904 *5414C261440FF8A54E10C58551A646980435F7D4 apotekdroger
810,153,905 *541430AA9B4BC6478C8F4556609AF09B7CFCFB19 apotheek9
810,153,906 *5410C55CFF7ADA356D13BFAEABA8F6A1DE039DA6 apotheosing
810,153,907 *541A57414773587A45BBD52D29D1278142134609 apotheosis1234
810,153,908 *54129C81074A271FFD617761B1334FD9F4B0C5B8 APO
810,153,909 *541CE9D7785EEB04503D6B6C59C0C1D7530D6B7D Apotomwn6
810,153,910 *541BB9FEB846FFB293A9547EB9C87081AF858558 apotropÃ
810,153,911 *54157A26EE692BDE7C62D9E28BBCEBC984B80B32 [email protected]
810,153,912 *541EA26E1D67F735A2B8B71878D90830FDB775FD A
810,153,913 *541EB2CDF0A4A0CD33F965DEF17DEEC59394D20F Apovitch3
810,153,914 *5419C39224F351B3F43421F961CF30034E509B16 apovlakoménos
810,153,915 *541C9E96A34959D7A355ADEF72875DF7BCDED3F0 A&pOw
810,153,916 *541A7AD6A4D79D9F138CB5AE3634DFAF77CF5A7A APowG
810,153,917 *541D6F2E33D0F2DEF30B0268AA5A4394CF1C6A0A A
810,153,918 *541EDF1EFA3022841152071656A10FB131BD10AE Apozemica
810,153,919 *541B13454D46601EF8ACD6FB48C608CED6191D3C ApoZG
810,153,920 *541DFD44C7158A15D6892CA485DB3D14C439B3C1 A)pP.
810,153,921 *541ECF252214D5A5909D4E536B8C2FF0662B7850 APP1!CA8!1!+!3$
810,153,922 *541021A988B99FD200F30410351E4C1C679E18BB App311an+s
810,153,923 *5419D8424C0EF6B750CAB786453D71948F8E3D33 APp3L
810,153,924 *541615C523D76E00FB60B5C0616389A7CAF1E775 app3l$in3
810,153,925 *54197810B17A7806FC55059DA63C5E24AE5E62AA APP69
810,153,926 *54188F490CAC4B9119AFBA2C0FE1804C925778BA APPACHIWADI
810,153,927 *5413023E5205D399123EE6C4AEEE79BFD40300BC [email protected]
810,153,928 *541F5FC2C0C210B733CFE43DF1F0CECC515806EF APPANASWAMY
810,153,929 *541FB937AA389579A896A2B6DA38ADFB6410C92E apparattisches
810,153,930 *541A27AA086F314169B5C35DAA544D40507EE8B6 Apparelhos
810,153,931 *541CF00E36D46F3ADAD644CCFC89BF49EDB52ED5 apparitionstudio.comwww
810,153,932 *54135CF520D8871F553FF9B034DFA01FD2F4EF2A Apparition —
810,153,933 *541C2975DC176A8927297B7648A65D75314C9A4F appeal-court-justices
810,153,934 *541099275DAED59F1E4450F551782018C3C695E4 APPEAL-FOR-PUBLIC-HELP-TO-TRACK-DEADLY-FROG-DISEASE
810,153,935 *541E5C82E228FC5F7E91D38FBB45447C85A5C1E3 APPELLA?
810,153,936 *54109586B20522CDB4F62DBA8CD4F62E1D42F149 [email protected]
810,153,937 *541F6BE175DFA9210B2B02EEE6538B139D243E8C APPENDICULOPSIS
810,153,938 *54154DA4ED53404871FB841BB2070CA868D748C4 Appesantiras.
810,153,939 *541AEF9A2BA33990BB1E6CDF93ABE9F6DAFD64BC Apphire0
810,153,940 *5414F3A923B86D7396DD2328A89E68EA543CEE61 APPICCICHERA
810,153,941 *5415DA9D2AF43C53A50E96F510B50845BA7E5474 appiconed
810,153,942 *541EC1380AAEEFE88822856E5582609F59E68887 appiole7
810,153,943 *5411758A070C3EA98501DA4BBEC6927ED0989087 Ap/pK
810,153,944 *541E849D7194220EE8FF59F50AF3C0FE8746D834 applab000050000012000717000001
810,153,945 *541CF87858FD832A31B8DC7E173252EFFF4A83C8 apple0307
810,153,946 *5411C833694A9DA4BAFB7A46C8EADB27CBDADA30 Apple1hockey1
810,153,947 *5414D9D63BF081FB28E0A3C609BFB6348DF37154 APPLE1REDDOG
810,153,948 *541D5D60C40DDFA55EACFC2374F13AA814C319E6 Apple627
810,153,949 *5414B9A63CA0AD05FC233583ECB8194C18CF7D1D [email protected]
810,153,950 *5413B119B07B94C813E7CC6228FAB7759689C640 APPLE-ANNOUNCES-TIME-CAPSULE-SERVER-FOR-WIRELESS-TIME-MACHINE-BACKUP
810,153,951 *541029D04B82BF186EE56D42AAA6D9EA711FEFA2 Applebrowns
810,153,952 *541F6DBFEEA6ACDBB5D4EE119FD32CBA296EBD72 APPLEHILLWINERIES
810,153,953 *541F4721726E49ADC4BA207DB6BCF4DC9B93B74C Applerussell
810,153,954 *541A0112BE11330B26D3F4BE7EC1BC1F326ADE67 appletreeman(demo)
810,153,955 *541BD098C46C1BB33DA7CF68A17255B0FBA5EFD6 Appliances!
810,153,956 *54189A5DA8743433026806793C11CC13D8BF932E [email protected]
810,153,957 *54175F9BB7A55D2DE507BC2AA053B6EDF9F37DD1 Applsakes
810,153,958 *54167B87875397B719635352121D60BB680E710A apply.cheers
810,153,959 *541C4F3C76C0212FB34766B1EC412791B98F38C2 App!n
810,153,960 *541784F07B0C46CD478BD9C37D946C3F95648449 appo57ai
810,153,961 *541445B8B58A40F317712E92FB94718D2689159A appoggiatura1
810,153,962 *541CE759B6ED415C922451F1BBDB739B43E28E4D appointereZ
810,153,963 *5410B3E9F2C623932E1DCA6F6D9D8C84F7501B87 Appointiez!
810,153,964 *541C307BBB19BCD212F7A754D230793520D39CB5 appointment1234
810,153,965 *5413BB8A21D2E4D14B0B53CD7F7846FCD8D675BD Appooses2
810,153,966 *541D065EF0B347AA4733790970A5BE8A0F89B886 APPOSITIONES
810,153,967 *5415675F42510E8C8286B535B880081FF6C6EF20 Apposs
810,153,968 *541144392C9F3977D986D1F1FB9C0CB79F844EAD APPR0PR!AT!0N$
810,153,969 *5412B88B640085681D18E385B503FC74C66A666B Appr3n7!c!ng
810,153,970 *5412894832CDFDEAE26E9EF735A4044DD146398E appreciated160-.tim.
810,153,971 *5411883278D3816480EF0F2F7F2386174371A0E3 [email protected]
810,153,972 *5417B599DDA4823C86769B246ABE14C75CF03514 APPRECIEES0
810,153,973 *541AA577B70014A676A48900F59CB9818DB85A90 Apprehensives
810,153,974 *541F3416F799E4E5AA3F8D024A89C681BCD960D0 Apprendrezs
810,153,975 *5419BEA5CD2AB742438BEF7C3D75B0CA26D2C1B6 apprenticestalin
810,153,976 *5416875772AA21A5A61A3C470517D6CBE51726DF apprestatevi
810,153,977 *541C19BFE726F5A72A9057C71E37AECFA92233B0 appreteert5
810,153,978 *541C346F28BF7CDF691AD26325CC6F26FC2BDAD9 appretirt
810,153,979 *541BF128F48C39EA7095BC27EE7521D2ECCD241C apprinneru
810,153,980 *541C72454407A1DC8233FBE2666B90BA3B785FE7 Approach7
810,153,981 *541F668B3AD316F8105B4CDFA8BD0016B732B639 ApproachVectorConfirmed
810,153,982 *5411F24FBF5A5B915F284ABC9DD8A91B5E9A8A04 approba7ory
810,153,983 *54115FADFE4E78BA583A7E5B89A1833CCA4B38A6 APPRODASTE6
810,153,984 *5417664EE1A7AD383784A2022321D5D3F044A92B Approfits
810,153,985 *5412EBF39FF951B5174B19E53CDD2DABD27B3760 appropriatedmuffin.blogspot.comappropriatedmuffin
810,153,986 *541394DF57CC0384CC22DC1AD22C6202BB219AE6 AppropriateNames
810,153,987 *541649830673CB97D89A565D1C035C07313529B0 Appropriatored
810,153,988 *5411AA1B3E52F9FE62176CED9D51E3BF20C7D3FD approvalprovided
810,153,989 *54152C232DA8AAF35B84A5A79903D838D2DC04A6 APPROXIMATIEVE2
810,153,990 *541E810B407242AE2022A9DA4A7274860D3A5CAF [email protected]
810,153,991 *54189094C81EE9FE70F19C50D5DB025851EC1CA9 Apptiez
810,153,992 *54151F804756F2E2A562B4C45946A25ED045B830 Appulo–Lucane
810,153,993 *541A703C90FD39CD911A9A262B8CFCE14BBEA4C3 appurero1
810,153,994 *541FAF91CDAD3AC6B4F734010D8FC1415C8DB84F A=p#Q
810,153,995 *5417F4A2F7D3F826A2FB0148CD1D0569C4378674 APQbO
810,153,996 *541C9ECF8039B65429D16D631DCB9B6C8F9B40E9 APQDE
810,153,997 *5417B39DE2528E7705B879806E5522F1CD7BD078 ApqnI
810,153,998 *541797F4325BA6646B512073E938F9D137911B35 APq&u
810,153,999 *541609C30E9B5441043C9712E7536074955DE6EC ApQ.U
810,154,000 *5418A975E228B2792BD71C2D934B6542015F34FB A/(Pr
810,154,001 *541166BAF61BCD6665BE840E06823D129E3D5B89 A$p)R
810,154,002 *541BE68C245A7C2F2176556A13B2D4070A4E22BE apr1720
810,154,003 *54171ECFDBCF7A1ABA0A377E66DD70ACC53C7321 ApR2+
810,154,004 *541B13E770B709BA71EFD03B4DC1B459A2672DFB ApR5B
810,154,005 *54189E1EA17CDA267554A797691512521CE61570 APR9%
810,154,006 *54118F92A6EF25643FFE598CC7DF25F7B18533FF Apradaane8
810,154,007 *541A78E6984483A27B0D2E2FAAC5C8BDB4C52961 aprazereisse123
810,154,008 *5419BE183E6CB3C3F819FF4C412A55FBEE221680 aprcio
810,154,009 *541F447B66FB6E492D7213381FF41CDD9C29EA87 aprendía
810,154,010 *541FECEFF2E42D1DA4D179DFB58B1AD34E63B1DC APrH!
810,154,011 *541FE8FFF6E8C52413B98C5C1BD774DBF6E9CDA9 APRIL9210
810,154,012 *541FF4F8E87626A53C6AE0A6BC8FA003624CADC9 Aprilbd
810,154,013 *5415685476B377486F2C5D8B611C894ADD72509F april de guzman
810,154,014 *541C352E47761BC21D9C30A37AD2C4B6269ACBA9 aprilgentry
810,154,015 *5410D9AA86D3BD3761FC8379D0B1C49B0369A9B6 April ħobżna fil-mindil. (In April our bread is in the cloth.)
810,154,016 *541DFFF561A6CE2AB7D7EE93D6EA835B8C6638CF AprilinParis
810,154,017 *5410366AB5E4C67D4CCE9AEAD39B775B34BC6DDC april ivester
810,154,018 *5412E8818032B05816F6DBA2B6097C028DC535BE Aprille4
810,154,019 *541A5BD3B54273BDD4D5F68920F0CBB76443DAAE april nipper
810,154,020 *54114904EC7540337B14CC29B01F352F98B23D19 april odonnell
810,154,021 *5418DFF548D356485FEC73DEB8AB4503D8FEF55B april rangel
810,154,022 *5414BAD66DB10E291FB158E4A3024E8AF1BF5AB6 APRILSTRIDER
810,154,023 *54136CEACB91FC5DB2EE3319511CE6EF1FAAA021 aprilworsham
810,154,024 *54197A5973029D54BB735F5FF06CF49EAE4D4301 Aprisionaram
810,154,025 *5416AF604FE0D34AA7C8508C894B7E54C84F3890 aprisionole
810,154,026 *54175149E0376A432ED33268C83756987A94503B apritēs
810,154,027 *541DFEE026B668D543FADA58D8199011D69561E6 aprító”
810,154,028 *541BC6C08A4FB3FF1FB0578EA7FEC4179AF6A832 A&PRL
810,154,029 *5413606D36E99379F4C44ED31CB192160E5BDE9F Aproblem2
810,154,030 *541FE2CEBD1FFE42750E52606E500B90F0F0AA54 Aproven5
810,154,031 *5414F5DA7DA16FBD4FB8C06F63A405D4336F07F2 aprovisionloia123
810,154,032 *5410739F03EA09F1FBF35A14988CFBE55CE53B2F [email protected]
810,154,033 *541F88BB0C87EE257A0E6A5C547AACF5B79008DB aproximade
810,154,034 *5411CBE68D3D2213A265431E05364E2517D5D93F APrpR
810,154,035 *541EEF94DE035BE7328D88E26E727EDE78AA0BAE ApRqU
810,154,036 *54192DFA1F6E6FD27F1B8739CF2B0E2AE9D2344F Aprutini5
810,154,037 *54118D2B0A9DFE243EF0652C52346231A91C7FBF Ap/.S
810,154,038 *541D5608387AC54DE100A32F955C30399E7D0D2A APs0P
810,154,039 *54131D16B0A2AC9A79A6DA0DF64D94252FDED4A3 APs2n
810,154,040 *541C9D52481866C359B2B3BA73055001A16782F4 apsareshwara
810,154,041 *54197397125A8F4FB06CD908ACBA62D00316A6FF APsE9
810,154,042 *541D6F880D76F8000185791D045600E582FC6680 apsho
810,154,043 *541C320F89898CAD148D266EE83CB80250950AF7 apsiėjusiuosiuose
810,154,044 *54185183CE3A3F83507D051D782BDD229DB3EA7C apsigėdinti
810,154,045 *54182E7C45BCBC1184DCAA56A8CFC1916DD823E4 ApSiu
810,154,046 *54165EC607BB3FA4067B770AF07755180536D450 Apsluchicola
810,154,047 *5414ED07A265342A262F281ACA30195D4CE8E34C APsml
810,154,048 *54165BCFF6EFCE907287AD621387890853E520A9 A_PSq
810,154,049 *54166BB650D6F3F836EFC975B95D2A5CDA002F18 Apstiprini
810,154,050 *541BAF3FC2B3EADD5A890342CAF951A5398EAF08 apstulbintomis
810,154,051 *541B56763A96E6B5C9C70806254622FF4F5CC8E1 A,PSu
810,154,052 *541677EFC24F400C3A97B408916191076B13ADB7 A--PT
810,154,053 *5413EB1E895F8540EF0FC90096285FE48A92FF4C APt?%
810,154,054 *5414EAAA05D77325A7A0895CF663E0DF0B67F097 ApT
810,154,055 *54105182BB0243B21486CDBBDA51C7F405244609 A:&pt
810,154,056 *541B417164E8BAAA73467174714C7703B1A333AC apt3ryg0t
810,154,057 *5415EE214907CF8278D934CA195D437AE513EB86 APT6d
810,154,058 *541D96BFAF6351AEC71A1159153E460CF6EE7932 APT7K
810,154,059 *541B28511B864A4B695F2CB81BE65E6A2F8D360B ApT9&
810,154,060 *541296A2DA8506474D3B17772D02EE13B5F56F09 Apt9I
810,154,061 *54191A77E1758A7B724558FB40381489FF808310 APTABAMUS
810,154,062 *541B68499EAD408063D5D79CA90E95115825E08E apteekkitalo
810,154,063 *541D177BCE1B7390C703D5D5F7D789A0350860ED apteraforumcom
810,154,064 *541B8B2AB50FC9076A8BC0C405AB2AA8EBFD4BAA aptianum
810,154,065 *54130B49CF59686A5D0137B14672F71A37272D55 APtlV
810,154,066 *5417C9BF3F5EEFEC0E680745624DC5914D14A66B AP!TO
810,154,067 *541CDC18420091E80ADE9F8B8D4F5BFBF92CB349 A&pTO
810,154,068 *541B26B58BB4CF5BE209E9293305A48FAADF89E1 AP=TP
810,154,069 *541513F9C2C4F208D553022E5D39C2FC66C52B99 APTQ?
810,154,070 *54110CABC828A25D0F36850D54E44DC10EB119D2 A!Pts
810,154,071 *541CFC1F76D3A86CDFD69683B10A4F1FA73F608B Ap$Tt
810,154,072 *5418152B7A581C7737E0B5104C9281D8B084EE25 ApTZG
810,154,073 *541DE8880A5F7040B75E15DEB8A796550AB58762 A:pu!
810,154,074 *54105053831FD71AA2C08A4D8E1402AC238B4703 ApU0C
810,154,075 *5419171E4F31E27B2E6AE7CD08F6C544A73A3872 Apu1Y
810,154,076 *54101C54A0A2CD6DFF5096AA8F8AFF058182F139 A(PUA
810,154,077 *54175AA8B60E1EF522002AD136C5AC78516FC517 APuB;
810,154,078 *5418C8CF988AA0C8B34CF37CAFAFC22BA7D7BC88 ApUCd
810,154,079 *5411BB62F26993E35B6FDD2F5A3AA023FD54C5BF apuesta por el rock and roll
810,154,080 *541B3C96E556FF0169CD7A3A049135FE367525CF Ap%uI
810,154,081 *541A713FD8D40D9D5372EFDF500B1CD844652F8C APuk6
810,154,082 *541E9A8A747219EAC395F593C9E5EBBD5D3F25C5 Apulmonic.
810,154,083 *541F8CFB669311D0D46D2B1F72FF276FA6255FDC APU/Q
810,154,084 *54105C5C6B466F9C382C26A9A41804D783405262 APURONS
810,154,085 *5412D14C9A11833034C153EA82D52DF0BF11E7DA apuruntly
810,154,086 *541AB21192CB024A7934CD17CED09A80BAD06382 apurvabhatnagar
810,154,087 *541CEF9EFCACC38D0F32CAEED4DBA7F128800836 apurve gupta
810,154,088 *541761977C478584367D269652760D1F793EEE31 ApuVb
810,154,089 *541FBAAFE44F9871FA6C89476DB6CE68FDC52582 ApU-W
810,154,090 *541D60F218414A60D30948A25AAD866B3ACDE914 A*PV
810,154,091 *5417BC59B3CCA0B2F4AB57E9AFBA6C16BCBAD856 A:(pv
810,154,092 *541817AB7D008C02A56BA3BF99293E46DF1F1802 Apv&C
810,154,093 *541D63366026847E781B89680BA6F4A3788BA2E6 A)PvF
810,154,094 *541138503049D0D9A81E4904665367802F12DF90 A=pVp
810,154,095 *541E2C318552AD7CA4DD260CDDD5D87E46955539 [email protected]
810,154,096 *54175BF435604ED03DCF5EA5DB22E891F89E2E3B APv!r
810,154,097 *54161F09C8BCFC3CE7BA7A5F4FA59A402DEABBFF A-pvU
810,154,098 *541A085816B5FEA7F09B70D9C72E2EECEC74FE49 APvuE
810,154,099 *541191BEE5F1D4F644CD47F73013B9C2C21A6614 A/PW2
810,154,100 *541FC1401D28A9E36270F786EB0330F3F9AC0DDD APW,c
810,154,101 *541C979E581D94B7DD7A4A42DE550DE4E2E2D6F1 apwjrafkycmk
810,154,102 *54117A16D979772F01612D5E2565AE3A539F185C ApWk#
810,154,103 *541A20971398C5E861ED1FC8367EA240BF42341A APw;l
810,154,104 *54149EC150762D0068C62068DAE093C45A4EFFEE ApWoB
810,154,105 *541B1945F96ACA03B3436FEA0F89B2CBC2DE5FCD APWPY
810,154,106 *5419E006938322BDDD451ABDA910D82AEF8F453C ApWVH
810,154,107 *54199FF5BF992DEF789EED12F02993AF73EA1AD0 AP.X%
810,154,108 *541F36FF4F9A2DBB6A573DF13361089F8FB0468A ApX1-
810,154,109 *54152F3D48FD1494339E1CA66BC355BCB7DB06B8 A&pXm
810,154,110 *54161C28419CD1C0ABA736EF6C8675769AD83772 APXOU
810,154,111 *54161BA5182646AEDD34FB67B72FD6125BE869E9 A?PXT
810,154,112 *541C38109A87D1C7D56880E2FD0527BA5A1BCCB1 [email protected]
810,154,113 *5417562C29216408802781FAB60BA4309A129332 ApYpB
810,154,114 *541C83B36847A305F2A7CE75A0BC79768AD4E1B1 [email protected]
810,154,115 *541B8CC438535D710895ABC23E83BA799061E0C8 APZ#9
810,154,116 *54108C17FFFC4C636790F201A3D128A275004DB0 APZhi
810,154,117 *54166963990FBE81000AA5DD714A2E8BCC5A247F AP-ZK
810,154,118 *54133D5F6643106706B79A184BF1CDA9F84E37CA ApZN#
810,154,119 *5415D6948270A5AED33D35BF29C788B527072F70 ApZo
810,154,120 *541CF195A13DECE50A302936774E3DC75823706D APZpH
810,154,121 *5416DCA46BB8E689BE811C940351CA50CE528CE9 A,,
810,154,122 *54141549599E72F75F9FFD54BB5034C7BE2A6516 A;Q=_
810,154,123 *54174E6A352B35C340CAF2C483E9C0A63D785265 A;Q!$
810,154,124 *541DBE9ED839337F411E1B66AA49102A664A6C59 A/,Q/
810,154,125 *541A0507C849E8764B98BCF31480EA67792C6CDF A)%Q%
810,154,126 *5416EB2C05EECBE913CEE92F26728752FA53CD95 A$Q/;
810,154,127 *541187AEF443149690134D0E4AE0A826002E4094 A&)Q=
810,154,128 *541BAED8AFA988207C12EB04576EAB7CDD279FAC A+-;Q
810,154,129 *54102A456B0CE53D7AAF3498CCDF0D92ED41B3DC A
810,154,130 *541CB56A5AAA0FA36C6E079585EAB621F94B8D29 [email protected]
810,154,131 *541DB434838051C2E8C638FFC740A6E68EB6E227 AQ-,
810,154,132 *5417C9601AA5C92B38C2F0B9AF91873F537B1D64 [email protected]'
810,154,133 *541249F1F7CF38AB1840A980090ABEF9DB570915 A;q(/
810,154,134 *54138579C4AA5FF5418F100976C26681371161BF A"q_$
810,154,135 *54169393012496A4614EAF6ED208308E0AFC8E21 A(:q$
810,154,136 *5417C20A97D36EBAF9015CDE820DB316A76EB9C5 A
810,154,137 *54164E0E01C1FB1439EE9201B094800DEB4F4F92 Aq&:
810,154,138 *5412D72121475DBA009E41DE219960DD8F1061C5 A#Q06
810,154,139 *5414F756D8468D2F70DBE2276DCD540B1261A0F5 AQ0D;
810,154,140 *5410D49539EC56E86A732FAE4F3590BC184C905C Aq0&H
810,154,141 *54168B1E29A61D7F2D667D87EE655A375800B1FB AQ&0Q
810,154,142 *541FE53AD417C6995A634F1EEB4CE50CF37F51DB A+,q1
810,154,143 *541D3911757DD7954D74E82553CCC8E88ABB9498 Aq)(1
810,154,144 *5415A9BBD3881AB35FAFCA873AA3AED491A5D51F Aq1B6
810,154,145 *5412141DB80A0C17DD5A0CD83D6BE6364CCBD016 AQ1H)
810,154,146 *5417340D49FDA95C5465BF524A068D9CB43EBC23 AQ1/P
810,154,147 *5412722AAD103EECD1D3B930FA72E60462CB63AE A!Q1S
810,154,148 *541ED0793F4B2DE126794477DDCA9F1D55D402C0 A;Q1Y
810,154,149 *54163967624BFA1B9E0BC804E0CEF7FB57617E18 AQ
810,154,150 *541848B210C9EEC8DF35C4993984747DFAACB538 Aq2i4
810,154,151 *541164D149BD619B5DE1212106A091DE78C9623C A
810,154,152 *541F863B056B452138B93927D30E9C9E34D13EF6 AQ2U&
810,154,153 *5416FBF931862B89F0004BBE26DD2EFC42AF0E04 AQ3.i
810,154,154 *541E52B22CD5FA96B3D968017F11A15CF100D317 Aq3.T
810,154,155 *5414F81201239E2DFD164A2073116AA376CDED30 A,%Q4
810,154,156 *5416AB5EA28F5D45CB84375F68B9DD7BC6504225 AQ434
810,154,157 *54185F2DB60333CB1DC56E3329C10F4A3BDD4463 Aq?47
810,154,158 *541AF4F2AE8970E6D35120F6B42057604DDE9ACA Aq476
810,154,159 *5412A59FE1D20D2B96DB1CBB4DFCE165D828558A AQ4Au
810,154,160 *5413BE9932AC61820EA21C4546B0EEEC283E9AE4 A(Q4C
810,154,161 *54135782656A560BD0C156D212D73E91FB9D40AE Aq4gF
810,154,162 *541082559DFC172ED177D39EE994CE608465909C Aq4mk
810,154,163 *5418FD5BD82EE462CBA2757A92201665854FFE98 AQ4qI
810,154,164 *541C3E52B760CD0DEDB7C43F963EA8CE019870AF AQ4V.
810,154,165 *541D0BAA1A97B74F35449FEFFE76A61A77C2AA58 Aq4Y_
810,154,166 *54184F5211E9E0CAE438EA058382E8FB0EA79F46 A-=Q5
810,154,167 *541498F9213583262D620C2C622676D2612CBB33 A#!Q5
810,154,168 *5418FC17B3485BDEC1A8EEC1E946311687789CB0 AQ5"_
810,154,169 *5413F1D5F9E23729FE330840302811CA6B2DABAD Aq--5
810,154,170 *541D1BD0AE0E57A4554A46DF98318EF142A57AB4 Aq51G
810,154,171 *54106CC030526F8306113F4F90D4117F3D663B40 AQ5aA
810,154,172 *541E3CF9D87CE0B1533CABAC78729066E6769AAA AQ5cX
810,154,173 *541E8C8FFC0F5B71083C037F6D99847CC353D7B5 A)Q5h
810,154,174 *541ABAF8CA3FC4B55CC1C226FDAEB369DF2D1FA3 Aq5XH
810,154,175 *5417F5ABDBA7CCFBC8B0CF4CA52377E396E2726F A"q6b
810,154,176 *541DF9A5B1BE578C1ED6CB505FA61C5945DE15B8 AQ6G0
810,154,177 *541EE85227D3C78C6B77D5EB79FDB6C073BD626B AQ/6j
810,154,178 *5413CE45A9AFC18892D521F7194A09E73F91A464 AQ!6l
810,154,179 *541231F8C11E92E155B5DEB8C101BE5BD2BF1B45 Aq6qS
810,154,180 *541CFA0DDA2B0058097E110981602012B6A36B56 AQ6ur
810,154,181 *5418DA2E9D6A6957ECA06EE918C493DE59A094E7 A/q)7
810,154,182 *5418E4051EA45849BC66B3D51F602AF2A6AEA1EF A(q7D
810,154,183 *54112D385A966E571858FB1ABD7C955357530705 AQ7dW
810,154,184 *54151751483BF28E8DDB1ACADB688F3A3DA0E29D AQ(7f
810,154,185 *5411E60782111BDD5A5A8838AA102B97946229A4 Aq7jF
810,154,186 *54152CF13F0549B36D12686E6DA6E0334241FD49 A.Q7o
810,154,187 *54158743AF8B2F97F6768171976B6C177E51B725 AQ7w,
810,154,188 *5412FFABCE56EFAEB4D8382E19C990845338B793 Aq89q
810,154,189 *5411314D4BB59D01761212B3E53FD69C2CEFA03C Aq8#d
810,154,190 *5419E98381E68D2368BED4836099C9A6120A2BFA AQ8rW
810,154,191 *541BEC77B63C454FEFE36B4F423C05698A2050F6 AQ9))
810,154,192 *5413669A2218C8F0EAE06C58281A857E7F86E5E9 Aq:/9
810,154,193 *541D2595E9AD9AB2451068A196D5B55BD81F70BA AQ9IK
810,154,194 *541F578957FEF735B8CB3256A1DBBCB8E70D4C5D AQ9p"
810,154,195 *5412A474F699D783DA4E020AB4ABEC54638D5AE9 Aq9
810,154,196 *541BF94CD10F9538A7EECB94E86146833E538B60 Aq9t&
810,154,197 *541EC0829B355E206F2B661A4C95E745B9F228BA AQ9Wk
810,154,198 *541955AF4E2922E564EFFA3173A1E52BF96F13B8 AQ,a2
810,154,199 *541CD2C78160CC45B55CB66EB522B74886D40CC1 A"qA6
810,154,200 *541882A2A5752734B1520F84B1798B88C79A306F A=QAa
810,154,201 *54170DF39E03CC8A7CFBF0A2D314217AFA0CD258 Aq_aa
810,154,202 *541A7D21F276291A3EFE885B2A43E3C49B6A41C3 A;qaB
810,154,203 *541E948AD7723234CE028D34A53CBDE7AB7AF23F Aqafi
810,154,204 *54148BF0DACCFB7CB06B2C421A9D53118F2273FF AQaiw
810,154,205 *54161042D61DCAF26E92FFB8040B4E454DEAA410 AqaKe
810,154,206 *541D89B700B3B8853F2D68427BFFA6B2BC6A74CE AQAO7ARt8a
810,154,207 *5414885827CA9BBB8E44C8CD469F95A842EC25CB AqaoR
810,154,208 *5416E30B4491BF09511B7ADC0A0F6FEAF70B2972 AQ$As
810,154,209 *5413A637CC026A1BBF161CBD51B67FFB2E0CC37B [email protected]
810,154,210 *5412B67E01A87B4D7D3787B410B3F33DD69A4DAE aqayg
810,154,211 *541FA51166764BAA55B8DBEA61A0DB84FA965760 AQ<B
810,154,212 *541DBA2F9E7E71C171E857D95925E139D90E7D4C A.q!B
810,154,213 *541F5A54AEA2344B6C730FA522F69171921C957D A%q"b
810,154,214 *541A9C9BB3EA5ED359E5CCB469F7D3918FA87B23 Aqb5h
810,154,215 *541C8CC85FD78916F71D181478867C1DE69BC166 Aq.BF
810,154,216 *541AFB98EB2E2C7CDDE8EAF542F89D8D113C088A aqbfn
810,154,217 *541DCD1995C9E1B435E56FD7568C16F89FBD8083 AqbGi
810,154,218 *541B34E9DD6E264973DA3F0876F3544EDFE6F294 Aq;bI
810,154,219 *5416BCF62BD49C4904083585C5C45638917470B6 Aq(bj
810,154,220 *54130182CDE1C58ED63173C3E39544CF8A8EED65 Aq$bk
810,154,221 *541331526D938015E370DE20339BD1A28848738C AQ)BP
810,154,222 *541D0CE1F1942A96399213D1482BA4C2612427A1 AqB:r
810,154,223 *541365A9A540C75BA4EDB4C0E517256C113FE382 A(Qbs
810,154,224 *54184F8D9C4600A282BDE80EE2E589CCC4D4E001 AQBur
810,154,225 *54124B48F0FED260ED651BED7AA6AA6A8AC3AFFA A.QBX
810,154,226 *5416FD689890B6192A18678A6AF22832B3AAC292 AqbZ?
810,154,227 *5410E8829E23644DE1966B5351DF98F3F48C9A56 A!q+C
810,154,228 *541F762C27D9A8C2E69432EC5E8C9792B74100C2 A!q
810,154,229 *5419197E8A9C1BA9677E52BD4D79C989116F6DF1 AQ:c1
810,154,230 *54161ECD526A964C291559C81CBF880E3622B746 AQ&Cc
810,154,231 *541985316F49786CC18AF4134623BB34FA69DC1D AqcjL
810,154,232 *54192CC1FEE26C17DF54F44D6521587CF6F13997 AqCl3
810,154,233 *5412795B2D729C66605208B026DDD0AE85F48F87 [email protected]
810,154,234 *5416A185A982F50BB1041E05AF008D285A198CC0 AQctv
810,154,235 *541AEC47790536CC10515379697CF10DACCE40D2 AQ.CV
810,154,236 *54128C85FC1E5D2BD036B619482448AE296BED8A AQcvW
810,154,237 *54115D8C7FD1C8F0FC1C52F81876291A7BF83506 AQcXA
810,154,238 *541789BB4BA4633BE2327D2E31DB43462A585789 Aq_d3
810,154,239 *541934DA3CA8BBE4BA6A11D9417011B3EDA6AD1F AQD48
810,154,240 *5416F5CA3A4D66C43FC2785B39CC00F968BA6BA0 AQd
810,154,241 *54115997A9A853DB1BCFFFE364DF06BFE3F18249 AqdFs
810,154,242 *5413B61BA07453021E8A39782E37C9B59C61299D AQDG7
810,154,243 *541730177C9CBD5DDE862D73844C0321C072ECCF AqdK:
810,154,244 *5416C3823B6072A166AB81E42C54FF642DA57B22 Aqdoxan
810,154,245 *5417929B792FC421332EA2585298F9F87FC2FF52 Aqdpi
810,154,246 *5418B1388AD82F8D1E75B615FAC84C7E361FA12D AQdQ,
810,154,247 *541EF43CC5ECEDDC305F28ED121754D879EB3C67 A"qDX
810,154,248 *541A857FF8852C5D2AB8BAB8FB90EDE8658D239C A=)qE
810,154,249 *54112395174ACEEC923B30E6286BBFE0C1E8E374 Aq
810,154,250 *541CFCA1D15CA9D3B9AEDB467D6B22600C229F5B AQED
810,154,251 *5410F43EDB5D0731781F3A0AF8094402C2BD0BA2 AQEec
810,154,252 *541C4A51CB10E715851D24D4CBD29411CB6A1AB0 A)QeH
810,154,253 *541E28CEA08C0AA666E9A437E570994FF87DE232 AqFAk
810,154,254 *5410B66FF1E8DE6251B9A449222B62365789E884 A$Qfc
810,154,255 *541E072600A944CF86EABB9CF291F5501939F228 AqFEL
810,154,256 *5415EBB723E8836FAFCCBF015BD9D0378AB99F36 AQFgD
810,154,257 *5419DF4F411BB100BF11CE6F78FABFD26AD643B6 A-qfj
810,154,258 *54194641201E5DE2EDCD8E9273D8F23E461633EC AQFk%
810,154,259 *54145B4A30DD551986914F35617EEA707EB070CB AqFKv
810,154,260 *5410DA72F80ED81D8B281E83C6FD2B53D0FEA0E8 AQf/m
810,154,261 *541BEC001916E6D949FCC92CC2F2F779748BC228 AqFn7
810,154,262 *5410BC94AA9457C05BCF71F1FC26427FFA82EB0F AqFQe
810,154,263 *541ED8A5A0849FCA01E7EEFF0CE2D85AF1A50C24 [email protected]
810,154,264 *541EF332C9867B1C11070F48581E8028784496C1 aqfsb
810,154,265 *541B2006D23E07BD380B14DB11A80985E3EC68E0 AqF+w
810,154,266 *5416A702AD72F9A7CAB7277E0925DA7CD5DA36A4 AQ
810,154,267 *541751A287DE5883781DC5ECAB42F9EB5CCC50CF AqG5R
810,154,268 *541C034CFEC07AA55E6C95C717CBDD54079EFE59 AqgD/
810,154,269 *54109BA82219B27F46BB96135C35FF733362DF7A AQ
810,154,270 *541A62A80492BB87E1BC4E2F623F4A2CC0FD6660 [email protected]
810,154,271 *54156A2A0C5D0382C5CFE00FAAE9EB3EAE079EBF AQgge
810,154,272 *5417646FA437B81EF6D189F07BE9E499B61B917D AQGnV
810,154,273 *5412452EAB36826757F954C70076896921E416F0 AqGo#
810,154,274 *541A9107B863F95FCD9FBB6F733CE531D39D3944 A/QGZ
810,154,275 *541FF83D167ACD5CC3FF65867C77BDB720722744 Aqħ%
810,154,276 *541CA1E5AB62CF31FDC0C452F32F5F226A01D61B AqH&1
810,154,277 *541496D980B7E3ADB46C14A5F9260AEA4620170A AQh8.
810,154,278 *541BE076B5299C76BFB90420068F1CE830E81DC1 AqHc7
810,154,279 *54138985C0203A5FE69F86A35561DAB171599D69 AQhg=
810,154,280 *541A4833AB23BF9647D5E2BDFB2C1D8E8601EEC1 AqHI!
810,154,281 *541BD36FCCE1D9E74A40A11AC9358A0C3262D5D1 AqhIn
810,154,282 *54109199B9717C5FB6CD6C64D5C8289625730311 Aqhj
810,154,283 *541D2BF0E28C42BBAA1DCB6110B579FA16827745 AQhk$
810,154,284 *5412A15473E97B0D019B3C065990269A8122B1E8 AqHm.
810,154,285 *5414BA3B915AAE9EB07FA4D40D6462D08C4E3C5D AqH)w
810,154,286 *5413291F2C28B97EF65CD8E29AA8F28A98F07B8A AQI$
810,154,287 *5419BD0318078A28B3CB47076E880FE16A9CBA10 A).Qi
810,154,288 *54176B92BF751C0887FFAA05C8E17CD316950AD3 AQ=:i
810,154,289 *5416BBE695447B7633BED0E820C232DEB94C21A3 AQ.=i
810,154,290 *5410892C961DD71DA63D09F6F8A27FC9F0C6AD1D AQi0"
810,154,291 *541716D23A45F9884A30E8D12259B14BD11A628B Aqi3N
810,154,292 *54195C7863BF4744CB9C1CABD821877D8CAF3708 AQIeT
810,154,293 *541ED37DDF7233EA7BA8C302428D52B3EA5FA2BC AQiie
810,154,294 *5416D424F6C89FDCF2C2E4E040D5830ECC648CE1 Aq(Im
810,154,295 *541EF3064FACB51FB5F9EA4A522DD8C22B5C1CF7 ʿAqīq
810,154,296 *54125CBE99E3B35848CF6DE4785F2E98CFFE718C AqIua
810,154,297 *541884AE3C3848F9CE3DED65365A16C7138CBBEE A,:Qj
810,154,298 *541006292455D4EC134C03DF798F83B7B9D31559 A:!Qj
810,154,299 *541063CB14A42F543BCD5AD99C7969D570C1FF04 AQ#j+
810,154,300 *54159039DA6647BA8E04EFE541A815EF9911B8E0 Aqj!a
810,154,301 *54122609C2D317C83A4A1C9796FAE00182C138B4 AQjjr
810,154,302 *5412D58D3B49FC71CCA81BF1AC080F11CAAE6B11 Aqjl7
810,154,303 *541A1981CD1F6B56171B64400E122E2AA57185B8 Aq?jU
810,154,304 *541F064DEB5D4CD5D82E3559342FBADC6F15D6EA AQjUZ
810,154,305 *541ADDA7556018A2DEF22F1521E10D013E0DC2B4 AqjXb
810,154,306 *5413F8E4CFF22F1783F3EC4025892FB2F98CCEFC [email protected]
810,154,307 *5410FED37CFB20B6CA63E95D90409AC096BB3329 aqkfp
810,154,308 *5415E729F26C5D5B5701DF522A04020D21A20E1F aQKImUFE45
810,154,309 *54114190A5CE9C107B6EE5F1E9AEDAB137EBC816 Aq=kk
810,154,310 *541AF4C855FDAAD3DC9092649C8B70155A311562 AqKNf
810,154,311 *5413612413DE6A55B909796FB9651C17EAF39E16 A_QKP
810,154,312 *54171980C7D1FE759FC6F420C79CF0C3040B718D AQKQ5
810,154,313 *541249A1A244E2F9164512A27F6D80F5BF1E5535 AqksM
810,154,314 *54153D9424026D83FDDE608C818FC8F1B09DC687 A+QKt
810,154,315 *541074A97F99CF9E4A50C6E816B2BFEA1BB292A5 AqKuD
810,154,316 *541891B5A6FBE88007969AA82A6FC102097CCB79 A&ql_
810,154,317 *541B0382858F7F1C0749942BA0F0DED7307F121D A-Ql3
810,154,318 *541CC6DC17AAFDBC33E573142FE21BC40162C766 AQL7v
810,154,319 *541051A5570FFFD85A13EF418BBAFA5FB85A19BF AQ(L8
810,154,320 *541F5EAE0243696B47BB579FB2082EF37E491705 AQlCk
810,154,321 *541598412C60E79F77C216D72B1AE659A3CD7FF9 Aql,D
810,154,322 *5411DB8211554412AF6B3E3458A606B8F9427336 AqLg)
810,154,323 *5413559CE935A03ABF6BB5254FA05F8741107791 AqL-h
810,154,324 *5411C84112ED8C773960D043FC2EEC93C1D685BA AQl!o
810,154,325 *5418243CBEFBCE4DBE28A64D75EC800F2DE508B1 AQm6O
810,154,326 *541618005A68BCE36B96D9337671C4B94C8841EE Aqmfisdpbuxcmybi
810,154,327 *541652BD811330827465CF802B310ECBDA1EA9D2 A-QMn
810,154,328 *54100929D03D7E94A407D6B2ACF0CD3F4C9AA408 A)qmO
810,154,329 *541F3CE9E5390C4D27AC5EDB13F649EB060FB05A AqMrm
810,154,330 *541019364BEA88F6201B2A548DEC9D6F933D3501 Aqmuj
810,154,331 *5413FF53FEE7E6CE9B63EA1DE36EBF9934EEFE8C A
810,154,332 *5417CFE806F113D1471ECC8A773F4CB40502B5D6 AQmYe
810,154,333 *541399534185CDC397BF718ECDB0FB65710CAF29 AQ/n=
810,154,334 *54159922E4860463BC2CB4BF8981109605DB16B3 AQN1#
810,154,335 *541FD3E0712508F3501E832BBBCA2786B44A826C AqNn9
810,154,336 *5410C41F21434D0B1292463C39EB5BD94E8F2888 AQnU1
810,154,337 *5414180965A878A48824A26A9E312E2AAEC0F103 A"QO
810,154,338 *5416CB659682EB3A34D9EBEB8845CD5E45942B06 AQo%,
810,154,339 *541FC2B491B3E7917742694B1C8F8E9F7D4F074E AQO01
810,154,340 *5411571C757BF282CF4E6D86A7FFF77A10F46FFD Aqo3V
810,154,341 *5416D1C292622397D8C00EDA89CD88D395015F4E AQoFf
810,154,342 *541F793110C8EFE91626887BB6769CD049687178 AqoGg
810,154,343 *541C32109D9FB6313EAAE53F385E466FA953F150 AQok$
810,154,344 *541C0DBBE995400C3C47FD11677C427EFF1932C8 AqOTq
810,154,345 *541102131B8B095E9C1CFF4A0EF52F75F403DE8B A&QoZ
810,154,346 *5419F90AFFE721669F62AD0AB37DE348594C2E6A A?Q(P
810,154,347 *54137C944C104ED1B7E702C5AC2E5706BEFC6FC1 A
810,154,348 *54154B65C4069801D6D487F5B7E70CC079A5C0B1 AQ,p:
810,154,349 *5416C95B894B2B0DF008368740CE190C67A27267 A.QP1
810,154,350 *54107A4B8C0C072B85CF3DBA1414D911E25B4B1F AQpCs
810,154,351 *541F197BE83C380DCEC7BF34DACC11C2DE50743D AqpMO
810,154,352 *5410E5C4A0FCF9C697C7AF3315E0A2DFBA8A6137 AqpQ$
810,154,353 *541756558DE03B692E6BBC912587D97B24ACDC02 AqPv2
810,154,354 *541D55850A655992E430D8C2985276F397FA16BE AQ-PZ
810,154,355 *54134FB5F4B582D812DE2387CAC2CE442AADD28D A+qQ;
810,154,356 *54137900C45E12BC4377BB64F9D586E10225746E Aq"q)
810,154,357 *5419C509AD93E77BF1139E80689682D8D783DE47 Aq#q1
810,154,358 *54159BE23C050CD7CAE27773A84BB2DD65241EBD AQ,Q3
810,154,359 *541CFA6E493B6DF2E05402764204C159ABB1E088 AqqBj
810,154,360 *54193B1F0F63D0268BC388832E9220DE1DA9E371 Aqqg9
810,154,361 *5416830ED077C4ED09884512A89619173706CABC AqQht
810,154,362 *541D07AB60847ACDE99936147AB41359583A581C AqQj!
810,154,363 *541FA667999EEC23E0C7F95B101105FA9086A3EE Aqqn!
810,154,364 *541B615BBBC6595AD0941926552610D77964C41F A+qQP
810,154,365 *5415B0364A5F761F6052DEE96391005784744BA2 AQQu0
810,154,366 *5419736BABE1BF0EC02254DE031C873200017DC2 AqQup
810,154,367 *541FC513CCC0C52EC529D5C9F65A56FC8608B89F AQ:_r
810,154,368 *54122FC3C717F67BF05CB14C07A2806D07A2D3F6 A!q_r
810,154,369 *5417B1E60E0627E10D85023E8513B4FD074200CA AQr8(
810,154,370 *541B9DF9DEA4C3218FB2D88C62C838FE1E67474F A%qRi
810,154,371 *5418B60FF3FDE6EB9EAE1CADF404F32BBAF2C0E7 AQrL?
810,154,372 *54156A7B6CC5BC56113A6139E0D360DEFC24BDB5 AQRL3
810,154,373 *541ACF749748474EF8923E7FDEE886774449A7BE AqrLg
810,154,374 *541F24A4A5AF0E2677080B018DE34172C6D16C96 AQRlk
810,154,375 *54167483947B38AC890824C0BA9FB571117A4C09 A;QRM
810,154,376 *5413ABF16C50AD1A34BF0B19FA953EC96CE893E9 AQRpH
810,154,377 *5412BAD1435DFD8D696C1845848E95E98CA6389D AqrY/
810,154,378 *5412D3AEFAD99CAEB75E66F9D32138907DE7424F AQrYr
810,154,379 *541E1C44F46F31FEE0EA8BB4872E02AE4401FD66 A$QS_
810,154,380 *54186B7262599149D6CA9EA563EB94641B0D63AE AQ+=S
810,154,381 *5416209328081C1DDBD56A3554D9ADBB4650FAE1 A!_qS
810,154,382 *5413EC507AA0F6796EB302A01440EEA22E57C40F AQs4:
810,154,383 *541455B7C267E874AF165E2EDE9CF9F725F0297E Aq!s7
810,154,384 *541C5CCEB80A012DA26A4D5B4A88DD1E0933EBE8 Aqs7H
810,154,385 *54100EC83DE997E9ED096CABB5C82FC367603E93 AQSA_
810,154,386 *541BB9093EE2ADEC2D27360383AFB5EE49C7881B AqSB6
810,154,387 *5417B6308ED6B636742008B7B761F98CFDF8E074 [email protected]
810,154,388 *54110B4D97C440B17691A3159A8BC023E40E2A51 Aqsd$
810,154,389 *5416920CB38DD995904C92DF01001A1666510602 Aqsl/
810,154,390 *54136410FF520A0FC7FCD0066001198EC71BC1D8 Aqs;Q
810,154,391 *541674A43E32331EA70225DCD31B8F6846C03578 AqT9j
810,154,392 *541DE0B3463AABC8F7A34FBE277978DD239C7784 AQt
810,154,393 *541D00B1F1563A33B4A3B035C8AF01F3ED59BDAE Aqt
810,154,394 *541B1CB4BA1C35E117868FEACD07EB99CF7C1C50 AQTcu
810,154,395 *54174EEA9C400C6B2D6542AF7A340593FD39EE1D A-qtF
810,154,396 *541E0803E6B62137B5957F4DE6B6C205BD4A0143 Aq%tf
810,154,397 *54129A237E87CF353DE8A3100E76189F196AB791 AqtiQ
810,154,398 *54171A96DBA3FD85C04B24ABEB53370DC0F08BF6 aqtnk
810,154,399 *5416AD301F75ED2D342A6E76F86494F622DE72F8 A=qto
810,154,400 *541E3A5138B8A48E5B120EE9AEC81A5178018170 AQ!TVF232
810,154,401 *5417325E40C46EFC1EBD3E58990CC1AC30527A28 A_QTw
810,154,402 *541E2A1811CC788113FEF24569C82A933F7DC459 AQ;u#
810,154,403 *54175A285B95EBF06E6D7756F8E6007118158E4C AQ
810,154,404 *5412DED9300CB7EAEC44833787A7FF8DC008E900 Aq;u7
810,154,405 *54189AF8CE29067A4C63A9DE1233234F7C71DA2E Aqua7one
810,154,406 *5410BF164A984ACF9F501CFFE9EACEB7306F05AF aqua bassino
810,154,407 *541FB0AB7B6C0AF4DC97405F5FE14DCEDF92EC5E aquaboy1
810,154,408 *54161D881BF8A97A60BC600F237C195788574B17 [email protected]
810,154,409 *541A2D5239B55E7F3E8674A2C4FB52E92B1CA36C Aqua ca31
810,154,410 *5410CF793F4C4D238296D68629B57BAFAA6B60A4 aquaculture2
810,154,411 *5410BB9DA876DD2AA083255FA2702263F2A36405 aquafreshcom
810,154,412 *5410A6D700B50CF9CA5B0BC8C1AF49F8F38344D8 AQUAMARINEGIRL05
810,154,413 *5411E4F641789DDB7C9E6417AAECC549ED2CC060 Aquanon
810,154,414 *541A9AA30B68D0225C3566169DDEA09311C3E5D7 aquantay0
810,154,415 *541462A0034DD0583EC71D55B661F4E564330F1A aquarienhalle
810,154,416 *5410446EE1F4A6A6195EA54EDB62F8529F520BEA aquariuswilliams
810,154,417 *541E8A246DF7689A9D9CEBDE671A36BFEAA3AAFA AQUASAVE
810,154,418 *541A9721D5634E78181C26B105EBE6FCDEB41E9A aq
810,154,419 *541DB59F959018CDC49FD47C39ECAFAAD2AE748F aquatiquement
810,154,420 *541DEF3921870568787C379593165B73A1E18147 Aquatours9
810,154,421 *541ECB5E45D69B7890D9AFD49A468F0D932598B1 AquD4
810,154,422 *54135615FF71CD5E86D4736D530C88425EC70939 Aqueche3
810,154,423 *541D5BBFEAE6A3ABA541205633838B2B8442194B aqueomercur1a1
810,154,424 *541FADCF101648F5F5B2D5EE93029128AF381DBE Aqueront2
810,154,425 *541B34567F871E51839B2450CECCDB7D5A93DB25 aquestcam
810,154,426 *5412926D783BAAD6AF1C5C6A50287429BD1FF592 AQuF+
810,154,427 *5415CF85E4164E45D062734F2F3308AF9A381BD9 AquiAlagoas
810,154,428 *541B81A3F77ABDC34CE73275E7EAEF1943483C03 aquietarteias123
810,154,429 *541E11ACEECBFDADCF19644689300FB9B98D6F05 aquilae28
810,154,430 *541380CF95E9580FB602694928DB2D51EB1E03F5 AQUILARIA7
810,154,431 *54118CAED8E40B0CDE4D96382018BFB255B4D879 àquiloutro
810,154,432 *54190D1CA47F36F069187F922582DF102A15A533 Aqui, Pero Alla
810,154,433 *54111AE87B5CCB9D5EB0D6044845A6EB1F93702A aquitaine3
810,154,434 *5414A979B2FA3A0F9EC84B164E93C4D0924BC915 AQUITANS
810,154,435 *541C830877CF18615CBCC21F221F1AEC448DAB16 aquitianië
810,154,436 *5419DF73749C4381ED00E5318FA3359C3FA2F93A A[QV
810,154,437 *5418FC4745FE791AE8DBAF25BB48DFABF10EEF78 AQVar
810,154,438 *541524349B49A330C87981B72CDE23BB1833B61E Aqv#f
810,154,439 *54121A20CAD5FBAB137974D2AB9C4EAB5D775CAE AQvgn
810,154,440 *5414BD9DA9D306E9BB32FECF8663173BAD4CE796 AQ_vI
810,154,441 *5419F991316D69E01824707CC511BA70645B5A66 AQvIK
810,154,442 *5413D01F1FC0C6DF0F09D2BCB7B0BB45F645DF08 Aqv-r
810,154,443 *541F99A0AB684D1F7063A2AE7A4AF88C0E0FE217 AqvU:
810,154,444 *54158E2A3A5AA39C22790FF530E369CEB0CF6AB8 AqvWL
810,154,445 *541F3268BD23FFCB9804B4CBD33B4B8A666D11F7 A#qW!
810,154,446 *5418E051C31877787332F1FD9A610DFE5266F75E Aq""w
810,154,447 *5418CF50C4FE2558EEF0B44B438BDAB17296EBEA Aq_w0
810,154,448 *541EFE034CCDB87FE546BFC2B5ED105568941EBD AQ_W1
810,154,449 *541D3B968911259993B87C076C6FE0E61D4EE98B AqWBP
810,154,450 *5413B6819DDAA6B6B07553FFD9E60C37DDB33308 AQWEAQ10
810,154,451 *541FB2A57342F5A202EB5295339BCBD1479FD7D4 AQWEq
810,154,452 *541792210C34D392896D44C0DFF7B54308875FFF AqWpl
810,154,453 *541690F9FE214FD16F9FF1A2FA9AD099ED851FC9 AQ=WQ
810,154,454 *541849D5E1C07CF7AFFD0F504B94CEA885E20259 AQ-Wq
810,154,455 *541E55490EF07135D39A4D0BED315BC77B448C23 aqwtfrb
810,154,456 *5419794E3913C84F59BC5A8E18DDEE28B87C411A Aq/Ww
810,154,457 *5412D1B53EE3B6FCF1A24E028CA69833E3EC6FCB A-Q?X
810,154,458 *541B5590EE9E6B0A8953B13EAD168DEB78C40B47 AqX7r
810,154,459 *541790DCA16CC94452D7FF9B4FEEC6E81F45ADA8 AQX=h
810,154,460 *5414A4B08BA030D051B7DF8FD9FDE7B7A2E80433 AqXh!
810,154,461 *541717A8F5402E48641CF42561E4F10A98420553 AQXiY
810,154,462 *541C5D7103375FAA58596980C86364E6BEFAD3A2 Aqxj
810,154,463 *5412E4264779EB0600AFC8BFE292EF313BADF34C AQXlp
810,154,464 *541B8457D3D47A2084C1896DB29CCE45CD91C48A AQ!XV
810,154,465 *541D7D483D03FE6FB5C3785B716AB1DCF0355D0F A/qXV
810,154,466 *54165AD2E527BF4F0E33F7E197F4C6D5593E00E4 A_QYA
810,154,467 *5417AA55380CA2BE7B540F3A67E6E90A820B0518 AQYbd
810,154,468 *541159EA8F14AC9371B9DEC520411A65483A767F [email protected]
810,154,469 *541C50A8751463AE1C3DCB2EAD127B73BC3A2B23 A_.QZ
810,154,470 *541E080D3304FB6BBB74ACF17AEEC7E4F766D25E AQ>z
810,154,471 *54130A31A9912D217AFB7993CAF4B03543FF1E42 AQ$Z6
810,154,472 *5414603ED829EF843BD4BD4C20F9BDA909981C48 AqZ6G
810,154,473 *5410F136565715B712A6A2760010A9BCFC087406 [email protected]
810,154,474 *5419B4AA10E4F4BB2CA0DEF64A0FEF53077B148F aqzibqq
810,154,475 *54108B328BAC2A554B1A59B1FD6EBC529BDD76FB A/qZY
810,154,476 *54171BEBDCEDBB1C49A73FA968E545C410260C58 A,R,_
810,154,477 *541B55F5B086EA3A82A37972BFF39543A33E8320 [email protected]@R
810,154,478 *5410C41F002971A7080422AF08B72DBD2E0CEC4E A+R=+
810,154,479 *541578133FCE517D0649D1FF0575EB13E92C646F AR?~
810,154,480 *5416421EABA5B60C1A599D2C022809F7B56E5EAE AR);"
810,154,481 *541420396045882BF970CFAE83FF37A378F75B7F A;r:;
810,154,482 *541A6AB4FBCAE9573B38498F0B8AD24AF1F4FE46 A&r;"
810,154,483 *5416AC5219E88A675B1AE8B5A22D164762BAEA0C Ar`|
810,154,484 *5414EB70B29797DFFCB0DC3FC21F8EC74A342CFD Ar;#
810,154,485 *541E53C7E54EEDFE71B81557EAC4B84FEAD23810 Ar?).
810,154,486 *541AC42A71A3E350F7E6B3580F7ADDC31BD5D42D Ar$&)
810,154,487 *5411E0C4E1204A408446BC5D23A18B9FC6EC4CF7 Ar$&+
810,154,488 *541A9D210948966F9FDE2B688D60EB333EF79C69 a#]r
810,154,489 *541DF3BAD7B32BDC54BFE02CD78AA98987A719C9 A#R0B
810,154,490 *541051E3868BD0F34E92614FEE17A8BA27E82247 ar1_
810,154,491 *541365BF67DB3F40932DCEDFF60AF42E69B66F16 Ar15.
810,154,492 *541152B4DEFCE74FDE6B354585C882033268D5D6 AR15Y
810,154,493 *541B66CD91ED2E0626064C47DC8F9EB93CB44147 AR1K:
810,154,494 *541638C561C87D05272000AFBDA99C8275271FBA A)R1n
810,154,495 *5411EEA1E506C6780FFB89BE7EDA64B518F53323 AR1q,
810,154,496 *5415D592D5FB51969C00D78BE3540B498885C013 ar1sneak
810,154,497 *541B63B6E83DBF3309BA690D014A99079536F2A2 Ar1U#
810,154,498 *541B6640BB057EC6AF16915243B936EDE93B9CB8 A+R2)
810,154,499 *541BB053ABB1AA872780B948F428FC3BF0B9A9F3 AR2005072301059
810,154,500 *5415E03C8B8B9284BB7CFDB994F613A627741B6B ar2005122202055
810,154,501 *541A574DAB757154DAE8EE14CF2ECC886B9BC214 ar2006012401528
810,154,502 *541DBB04EBA9AEA7F634757FCC29794DBD51B587 ar2007101602167
810,154,503 *541DE3B364D3D690AC20B4DD4FC48A3E983C2C31 ar2008102801136
810,154,504 *541B02B7420E2B14D4A757AB5C34DDB71C385F32 ar2009080901970
810,154,505 *5419EE800CBB6A578856FD634989880271ABF472 AR2010031603573
810,154,506 *54136E6A9782E5BE000F31E131F1C710AE13AA7B AR2010040801111
810,154,507 *541D34FF69C0E111F37BC7B85B9206FE3825D1BC AR2#1
810,154,508 *541CF8BEDA253C86E806977882557EA8426C7CEA AR27%
810,154,509 *54145383FF3ADD4FB6DC46F5DAB2AF70B1A71591 AR2ie
810,154,510 *541FFEBD9193D045E9809CE5FFB657E6CD9C5F27 AR=2o
810,154,511 *541D55300EE1237D179BB6F4C11BD7EBC625F4BF AR2v2
810,154,512 *541BD2AF0885EFD34CCDA430699D87B2454748DE AR#3.
810,154,513 *5414EA8F0A02A09CB75266C2FDBB723E31E7EAA5 Ar34w
810,154,514 *541774021601937D2F30677F95D18B9B6B646FEA Ar3bR
810,154,515 *5413B67EF6F1250A99605FDF89A05914E2C3FE9D Ar3-i
810,154,516 *54104847235447F0BB1A1B8CED96C20AA5274EE8 ar3r1a1s
810,154,517 *54194C8AAA1241C3FA913B5AFCF420D91853BC34 Ar3sb
810,154,518 *5418757D4C8EEDAB1EA6E90B93CCD9DC076B9475 AR3vT
810,154,519 *541FBD2CC3A83B5F62ED309D4AC6963789BB4BF6 Ar$40
810,154,520 *5410A20793BC96E7A4F51724BCFDCAF77DBE35FA AR.4g
810,154,521 *541EC392C593F6AC7AA9C8401ACFC3D29FE26908 Ar4"j
810,154,522 *541A59F4B9B839B8A9B375332986B6B216574733 AR4w4
810,154,523 *5419D02D81AE38AE989C64906BFE4D3EC0D647B1 A.r5)
810,154,524 *541C928A60351DAC9FE4367DBD0729B3C2983D24 Ar(5%
810,154,525 *541F262429B6915004D2068A9F565C04CA2F61C1 Ar52H
810,154,526 *541AAC041591D131A09ED68CCD604E6DC0863085 Ar5r#
810,154,527 *54114E93F66462CED277A9919110BCE056D682EE Ar5?t
810,154,528 *541E7FFE9F9FDD3474D3A9A9D7FAD46377E9177F A+r6$
810,154,529 *541FBFAE2E7CF51B462EC3B558D7B206DB057CF4 Ar_6H
810,154,530 *541E2C5CAABFCB03C63F02CE4F74F2248B5C3D71 A+R6t
810,154,531 *541A98B7308AAC48F3D1BB2637350904E59F20F2 Ar6W2
810,154,532 *541DC525D1232454473AA9B9A1487533EECCB5F3 Ar71q
810,154,533 *54174B2D0965F6079BD6820167D782FC811A580E AR7ce
810,154,534 *541F707765CD296905D6DD2DF1E922325E8E495A AR7D6
810,154,535 *541B18B16E51178ECCB00B52C8119DABD415A220 A"r7I
810,154,536 *54158796540D236ADE116E29EBDC2ED2AD160AA7 AR7M=
810,154,537 *5416320BED80A85B2AAECD46ED91CA8CC826177B A_R,8
810,154,538 *541B83DFC32F19E5DD27822D61FD94D3F21D88C7 AR80RE7UM5
810,154,539 *541F9723B6FF864DF809DA608F71B41141C47535 Ar8&H
810,154,540 *5411BCAC6A4808E7FE1AF27E8380240B3DE8523D Ar
810,154,541 *5412B5FE66EE7DA8CE935AAF447ED15374422FDC AR8K:
810,154,542 *5413CDFE5E0BBB194A3B3D40A0FC01F5AA96B962 Ar,8o
810,154,543 *541EC87C734E5A0CBAEEF57EAE24FF5E53039CA9 Ar8)U
810,154,544 *5410C5FE51BB3E6D2327144672A3A1225745F278 Ar8Vl
810,154,545 *54135ECF97E07B6F92C1A45D6E6637D6F65646E2 Ar&8X
810,154,546 *5416E6D7A519A427C511813906E4BF94E9642813 A,r&9
810,154,547 *54198F4CE18BEBCD15833D9E5B08F3924BE970A6 Ar94V
810,154,548 *54172C691FD202CC18B4B0D3BBE6765E06BD29E3 Ar9hc
810,154,549 *541719B2CD5CF6F4E5E5E2A9B546601EEE9262C0 Ar9PB
810,154,550 *5414DE73E94BA85981B7EDF5443D671B1D03ADEF AR+A,
810,154,551 *5414A97AE423064A79417F742D9BFDA337B7D8CB ARA#;
810,154,552 *5413CBE15C8AD4A8F5F0F020D99603ADD0D2C157 Ara$"
810,154,553 *5419F4BAAA66FD8E807910082B74EBE36E8F02E3 ArA1:
810,154,554 *54149959F8EEA17B1694040AFD4BDD4FE0DFE73E ARa6Q
810,154,555 *5410BC42B41DD56E17C247F77B4823EA84CED08C ARA9X
810,154,556 *541F7E9A6AEE63AB8506B1146BF0ECBDF5E9C054 Ar.Aa
810,154,557 *541ABC7DECBB62D676798AD4DB8108A6A0057911 [email protected]
810,154,558 *541FD75DE6F6E9786A0FD9B273723F8BDB75B4F3 arabampcurid2185
810,154,559 *541C9D07584CD366DE6EE18B0B6829C571BA7394 ARABANDA
810,154,560 *54187BED93448EC1D976B490FEE38630E092FD4E ARABASOMEYE
810,154,561 *541ABE291B2CF1CBA674CC6CB763F65DB5EEFECF arabelgei
810,154,562 *54179327FC1F27B875F319C3FBAD57B43CA2D1ED arabella955
810,154,563 *54190DD24553A2210ECE5810773EB4E2CD1B225E arabella977
810,154,564 *541928D6172C21C0D5F4F2D14DA45D2BAEE8693F Araberpferden
810,154,565 *5413AFBDC73AFB37AA0692213F9C9ED00D9975C3 Arabesqui
810,154,566 *541107E525F82E70423D762759A1B54C84781B71 arabiankielisinä
810,154,567 *54118CF7B815F62938776D01F4A1F3917EC3ABA2 arabic-african
810,154,568 *541000C9629665EC88F7CECBA01AAED440709D12 ARABIC-NUMERAL-NUMBERED
810,154,569 *541A98E296C2E805AB43B901533EE1F22B218D39 arabisraelies
810,154,570 *541A9C5211F2FFB0C4CBFE036459C41C4132F3FE arabizar1234
810,154,571 *54106B0603D024580315D34D8F3E744BC5A416D8 arabmalayy
810,154,572 *54106D93D65B0B5F75E99A3B64ECCFF821D3AC7C ARABR
810,154,573 *541205B37B0C98BC99BB507F7545787585BFF004 arabskijj
810,154,574 *54195AB3D12C0CF8B032845FF9D75B3B62DD42A3 arabspalmiro
810,154,575 *5410E1815832121CAEF03A814AA08E8E5FD504A1 Arabutã
810,154,576 *54155BDC7A66A8BA80D180F567F978F1EE4EA630 Araceli581
810,154,577 *541B881FD01080B54813D702114EA04132275E8D aracelispagan
810,154,578 *5414D4A50921F3A06D2238C9F2D21BC89DD7C742 araceliuribe
810,154,579 *541E135F39F17CBED5F69BD4C883C39D776F1B8B aracely594
810,154,580 *54111C7A4EFA29573C2D90DD2779ED11AF8CC214 arachnoidaling
810,154,581 *541AC335E2B7CED1EBE06AD5DC492EE6C8A1FB7A Aracimtho0
810,154,582 *541BC430C4CC6FE23D1CA95BF38A6391F7DB1BE2 A)rAd
810,154,583 *5419B895E3771F7E4E1EF2B99249F13E13AE4699 Arad1930rel3
810,154,584 *541B80D587513E428BE986E3F86D5CB0576BC695 aradhananair
810,154,585 *54125EF7B05A2E444DF771129EAA92B433F4A296 aradhanaramalingam
810,154,586 *54122E97C379A566DC11FFFB76B8663EF02C071F Aradiasmas
810,154,587 *541BAC82490F386393473D466548A52B3B1701F2 Aradiseas
810,154,588 *5416BB7C1B957ED46C71284242276D77BEA70264 arafrancisco
810,154,589 *541A1B495FDAC910BB7ACABCF6642BA0CCF043EC araggab2
810,154,590 *54145CF1695CDF070CD1B920808EC2A431065BED Aragorn09
810,154,591 *54122A180E4A7681B6A2B48829EED1431EE7F630 aragva
810,154,592 *541E9EC2A7A80C745D727D16466B967FACB55122 araibic6
810,154,593 *54122C467B7CA4AD5285127EF558CD1DC301F398 Araise2
810,154,594 *5414059017B7FCEBBF52287580E97DC3C51F389D arai-te-tonga
810,154,595 *541BB45439369F29E78F70092C939688CEED89EE ARAj"
810,154,596 *541F1AC505A833C334A6E13C699BD63076CF4667 Arajane9
810,154,597 *5411D5117167B54704AB3D62C74660E1CDD4EB0C [email protected]
810,154,598 *541DB5D70A140112E293916E1F2CD3EFAB97783A arakito6
810,154,599 *541AC2C5D100C015B26FFAF693BE9FF9C40675D5 arakiyum9
810,154,600 *54183204A7703CCE4B1924C775CEE5A9E48D9A1C Aramovog
810,154,601 *541B3F2CA4E2637E6C294BF2FF516C5AC0383DB1 arangaer2
810,154,602 *54103F83056DBEB8C1105109394F67071F1597E5 ARANITES
810,154,603 *541EE8B84BD814BBA98D1B541789C971B48215F3 aranybetűid
810,154,604 *5416FABB6DF285CF958A53058CB02D0F4D0D62FC aranyjubileumi
810,154,605 *54129C8591247B89983650EAD37564FEABD3ED2D Arapçda
810,154,606 *541271C17FEA7D3A442F0A20624526E0036BEFFD ARAPINOM
810,154,607 *541DF83D8174A653077A34BE90159C3326131B48 arapseudoconnus
810,154,608 *541B76AF5C1FF6BCDF5856B4A178BECD7B643D7F Arapskoga8
810,154,609 *5410AD7BA1FCA664BAC4FE43A6693BA3391C159E ArAQk
810,154,610 *54133F2FCD63604E96674C1A0E5567AB1FCF6832 ARARCOMMISSION
810,154,611 *541299A9D1BFFDC953F6680B15CC866FD7870F7F arartsal
810,154,612 *541706BB956310F5A31DAA53CEFB058BB9C7A429 A rascal
810,154,613 *541B2A936B2EF771D32DC7B07CF03070D0919813 Arashjalalmanesh
810,154,614 *541C3A6422A4C2B01CA147ED8930FF55112B564D arash salami
810,154,615 *541F452B261FCC4396479527EFB25D992197ECC4 Arasoidne
810,154,616 *54144E525410167B34AD9A6BEA5F01C4EF2F28BF ARAŞTIRMACISI
810,154,617 *541B764086B80F38E2CDFA04B8B7E23D956B12DC Arastocracy
810,154,618 *54161E0170B47338E7B33ECB77944C880B25BDA9 arathax3
810,154,619 *541C622672186D1865179149EC5DF510879AB4AA aratmooD
810,154,620 *541D7A853760529378F4DB1B1BAF8F8153DB5AB4 aratnej1
810,154,621 *541B9817F717B678A5E1BA368377B58F111DA14D araucarioid
810,154,622 *54158D3678091E39D44D083518110A8124FF620E aravindaschool
810,154,623 *541520D722CC53FC2DD8F3225F788C529EB51522 aravindnatarajan
810,154,624 *54165A763246F58DD8253C85F486203AD9D517FF araxariisete
810,154,625 *5411937AE6C6AE3EAF7951B0AD12D74E4F685E82 arayihisha
810,154,626 *5413983486A594FEC63E1B4BD2E4BF4BECA707C4 ARAYURUKOTO
810,154,627 *541D1C1F02DF411871F43F70F1155A32C49C3400 arazbarbuselik
810,154,628 *54166501DBF8AB767E0491C1E09C2975DC2C0209 Arazdording
810,154,629 *5411554BDB0303AC230B7F3B934846BE8AEB0EDE araznil0
810,154,630 *541D3B1B8CB5BEC249C2ED1188CF8E9C7D4C70DA ArB
810,154,631 *541A43FDDD29F562A8EB8F1849A58F4A7ABCC9DD ARb&6
810,154,632 *54189845B27410D0B8B9A005A66B6097B4D710DB arbeidskolleg
810,154,633 *5415132CD020E4ED736FE283FB15E7D7BEC8E9C3 arbeidskvinnene
810,154,634 *541C69CF4FA55C0FE6A80681F84F84D6C909CD27 ARBEIDSOMSTANDIGHEDEN9
810,154,635 *54166C7C81A10DC0857A0219CCFD60D1DC2BE417 arbeidssectoren
810,154,636 *54192AA88591F0DD9CBBF3ED829D3F3C31017849 Arbeidsskere
810,154,637 *541F23BCD2DB2FE01ADF4FCC20C25DA1D3EE9385 arbeidsstedene
810,154,638 *5410AB79FF741E4D9A645D7CDBD99E911B7B2CAE arbeidsulykken
810,154,639 *541B9C01577B75E03016CFCE0D78117E7225775A ARBEIDSVOORWAARDENBELEID
810,154,640 *5410C8E713B61A6FBC5E9D39E4FB255001ABD46C arbeitsabschnitte
810,154,641 *54178CD23B3994CB0181D9325ED36B89F1E32EA5 arbeitshause
810,154,642 *5417C629EEC753B447DA8EEE9332D6A1F6034FAA arbeitskults
810,154,643 *541D5669A5427E0E7034540C346668EF2BC112A2 Arbeitsversäumnis
810,154,644 *541792CF4C8545DC336252C6DC7B9C32DE7637AA ARBEITSVORG
810,154,645 *541A121E5AE295EC17E15A3239E0509083A7C7D9 Arbejdsmilj
810,154,646 *54192F29FA0B246F03298EB8B1D1A3C2D4FD6BA1 ARBEJDSREDSKA
810,154,647 *541BAF7425B5D60544F02FE3E053CFBC969FF312 ARBEQUI
810,154,648 *54197702D00F6FB3E09A13A6BBC66C14187F70E5 arbërt
810,154,649 *541108F2DDD41993111FB8F1FE2F8BA735A1B50D arbetsåsninna
810,154,650 *5416D1D682512A97ED32CC25A35D36FAA59B28E9 Arbetsskyddsstyrelsen
810,154,651 *541B04F864E61BDD725D3F5E271A7A36AE6CEC2C ARb&F
810,154,652 *541572D5FB7E89024F1311FE836044EE47E389FA A$rbF
810,154,653 *541F48EEF1E746654D4F968E07C4714515401EF2 Arbitrag
810,154,654 *541FA1D6303AFCC9C1FE1B71237344650FD659E4 arbitrationan
810,154,655 *541F179CB443A5446CB00EA5AEA53C93E237A0C9 ARBITRE.
810,154,656 *5410AD094051E5A875E824EE33D4C8D704F07A4D ARBITRY3
810,154,657 *5413DD1102CD51E18A0D38727E3FD41E97A94566 ARBn2
810,154,658 *541CD27FB4DD6A3FE88DA285A3878312B60D1C31 arbnhn
810,154,659 *541DBC108C3EEAD740C30E96904EEB7399488585 ARBOCES
810,154,660 *54133DEF24B7A838AE5E84D6C537855AD814E599 arborescence7
810,154,661 *541DF1AB9739E8E5F70ACB1DD54ADD753DBC0D12 arbori-
810,154,662 *541EFD890015259024A13F32F8D8D29D03FC045C [email protected]
810,154,663 *541943BCEF5B5B15E590162C05BBF652FE5326B4 arbritration
810,154,664 *5418BE773707335F6E272A90B7FB642D8129E913 A]Rc
810,154,665 *54196FC90994A8141CE14AA8818309010E2A9345 ArC+/
810,154,666 *541F949451032CA2539D9583733838085A6D5184 Arc15qAE
810,154,667 *5418815B22A6A74A8F57A4CEABD17A2D9CB1ACB0 arcabuco7
810,154,668 *541F84CA946CEB2984CD86453156F1B1219687B9 arcadian daze
810,154,669 *541434F24E438276EB40E4024C3C5CE954094D26 [email protected]
810,154,670 *541877FB6F97C8BB6699C9161C99581806E88BEC arcaeological
810,154,671 *54127B94641F1BA3939E07F1E1167056452211F7 ARCaK
810,154,672 *541493724F3C90DD2D3406C18145F4BC4519EAFE ArcanumHall
810,154,673 *54185BDFB4511E96AC2C201D85CCEAFF36778041 A%rcB
810,154,674 *541E06F08D3A3489824ACCA186E8B85FFE11FE93 A-rCC
810,154,675 *54164AC94161907E494ECD2E7B5EE820111980DF arcdump3
810,154,676 *5414573A9FE5F6FF98914145E191E876282A79AC arceaaaambaj
810,154,677 *541C3D80838627309D5DC0DBB4D949D5E99B0038 arcedit6
810,154,678 *541CADDD27349FA930A8A3A7A998B9A346692B9A ARCEIOUS
810,154,679 *54157D6764DCFE8BFB33E4669263D37133C9EB70 A/Rcf
810,154,680 *54182EE5E0C55F952D9822C3B1F9325DB30A6C6C arch3nc3p
810,154,681 *541A70733807753BE5C08320C88F3A424EA2F733 ARCHAE0L091$7
810,154,682 *5416E3A76A7F406D47C04428BEA5EA3B3F3AA363 archaeiced
810,154,683 *541D48866B2F78C59D30BF34D6DB7A98CDA324DD ARCHAELOGISTS-INSCRIPTIONISTS
810,154,684 *541B4707F28C967FE93CCCD4DDDFEB51F420837C Archaeolater!
810,154,685 *54122A3D273072A99CA658782D7CBCA439A18AC8 archaeology1773
810,154,686 *5412E12D28A85C8DDAFA53369F7859B42D47B478 archaeos4
810,154,687 *541C68894C28D33B0D5B1E94A93331C40F62D74D archaimbaud4
810,154,688 *5410E035417BF91BAC87BA0627C27A49BF7B6E3F [email protected]
810,154,689 *541F8179A64BEB99743503E77045117538CF9292 archana piya
810,154,690 *5412AAC21720CECBFBF9AA8DB7B1D6B5C3CA2C1F arch:angel
810,154,691 *54107C503AFA26FE530E90EF051F7A0B2BED468D ARCHANGELSHIP1
810,154,692 *5412330FA21F68C922A28DAE789D11EFA3F0C7D6 Archäolge
810,154,693 *5411659ED1CA89B9126B76DF86A72E92016ADDA6 Archdiogalhoushield
810,154,694 *541BBEC67E230C37ED94EAE48AD22A0BF3D3DFDF archdogmat1$t
810,154,695 *541511B8E63B8E12B8AEA1D8C1E8ACE1067BDEC1 Archeologen6
810,154,696 *5417776AFA0BCB860799AA68A467E737CBCEF6E1 archer)(*
810,154,697 *5418AABAB905415CC6C273C03F4CD2BA827EE22B archer0116
810,154,698 *541F0A76991E39CDA9DF912B02C443050A6C37E2 Archerez8
810,154,699 *5413BF3E0E0A462E5F4344919619484F5B1A066F Archiboreis
810,154,700 *54193299351A840C7582DCBE058A5A773B71C5DC archidi$k0d0n
810,154,701 *54109FE5863A9C482B4AE672078F1A5BE66B9982 archie.brefka
810,154,702 *5412208D14A8B1D59CB25E9A995F91B0FF1E08BC archie.campainha
810,154,703 *541A489962AC04E9C7DA7EE1258744852A5D6C47 archie.dsaachs
810,154,704 *541238E33DCC003B0E69897D85F0823812760DD7 archie.durnil
810,154,705 *541640B7030BED0AD47497E407D6F8089CAF0045 archie.enzenauer
810,154,706 *5417462BCBC9DA42E51452578F3F0EBEAA322A7F archie.gadlin
810,154,707 *541F486DD0A20D4A4ECD5A1B82546EE18A64036D archie.graces
810,154,708 *541AC6D62C65A88B8A814C5027F63179557F42A4 archie.haskin
810,154,709 *54180EDAB93A2644E013DB23C53060F0942E2AE4 archie.keir
810,154,710 *541B3A26C07E451A292A5B5BE2E64FF4819BE36A archie.littler
810,154,711 *54114D5E278084EBFC88D532149CBCA9DDAABE12 archie.montalgo
810,154,712 *541FB9E0EC00165A848949445F7D10395522D1F6 archie.nickl
810,154,713 *5413E20B84B2C28C2705ED63C13EC1F6EC6FEA96 archie.penny
810,154,714 *5413243ADBEEE0152800BC4720C121B13D228CAC archie.rochholz
810,154,715 *541F30F5FC1C2D9855FBEB70436C2FDCB1305CE0 archie.ruthman
810,154,716 *541DDC4731AF207BAE60A167AFE5589DD9BFFF2A archie.schlaefli
810,154,717 *54141AC317267D4A13B6DAD44BA3B5DB35517870 archie.tat
810,154,718 *541F627AD0A432EEF29477252682E1BD9FCA241F archie.tavernier
810,154,719 *541ABE6678743896A86CBA712B7BFA3D541F5113 archie.volpi
810,154,720 *5414CA8D53637C4E46BF1525B6D6F1193CBA9003 Archimagoed
810,154,721 *541B053DE71702916C54A07D899296118454A498 [email protected]
810,154,722 *54122087B16CF8E896F45875DDA0A4C677172E92 Archimorphic2
810,154,723 *5414333BFFF26570D93C8C84C00A6147D776D556 ARCHIONEMA
810,154,724 *54147C9B4B2632D55EC5978676FAB87C960C3D01 archirodon
810,154,725 *5416AB17E1C55E62C7346FADD71F259EBAE144C2 architectsofhate
810,154,726 *54137C54ED4EC6CAC9E0F7E9B08779A83C1D2D22 architecturenepalese
810,154,727 *54127E00A0EF25CECE138663CF729D7B0FF9E687 architecturesubstpag
810,154,728 *541349CAE7D88C47F427E16500D1343C06D43FD8 architettotarquini
810,154,729 *54124D2B4B1158A41A37C30C982E9D2026C59197 architraven?
810,154,730 *541B55752C2353DC4A173C5AFE31D3FE304FB0E5 Archivai6
810,154,731 *5412D0D8447472A4C816C051A81FCF5254F80CFB Archivbibliothek
810,154,732 *541B058A5A6B838B854ADAB3F9E73ADEABAB4AC7 archive?<br
810,154,733 *541FE53D1078E55D10293426DA7407E84F2A33E7 ARCHIVI4
810,154,734 *541C205F6E2CCE5C93D072DB04D5B3B0098C1326 archivortu
810,154,735 *5410BCCA3279A314EE554B8E6CEEA314BB4F3F9A Archonts9
810,154,736 *5415D77788E2CD9F7AB54220B2A225548A536C0B Archpastor6
810,154,737 *541A4AF63B3341B930813FC597C01163FB6C892D Archseducer
810,154,738 *5410B293C65FDE037B4A16BA3124C23193AA9FCE archsemin
810,154,739 *5414F1639AD63202CB23C8E8B136163F566A01E0 ARCHSTEWARD7
810,154,740 *5419335CCD72CC2C21F9FB8BF29A06B49F7BAFEF archtrai6
810,154,741 *541406CF3F43F8324D2F17BC16CAFCFD926BE493 archures
810,154,742 *5419C7987419C69C8F87288E7AFE6AB074FA6892 archwebbasescu
810,154,743 *5414BFAE4D751A753CC0C77831DB99EB253C3D76 ArC"I
810,154,744 *541095F228F2103BF78E7EC166D9B72463C352AD ArC-j
810,154,745 *541C8C095AB07C9B4C83C252EA136576A5A0226B A-rcM
810,154,746 *541CC690F8498ECF070D662613D1977962070A65 arcoirisarlhos123
810,154,747 *541E8A8F12556A629389FBB551457976FF8A4F33 ‘arcon’
810,154,748 *54179AAD9734DA214313737E148A85E508B36186 arcortez
810,154,749 *541F16570373FA3061E0AE488BF4A32AAAEBFEBD Arcovalley
810,154,750 *5415E03B38FB51BA6A807B296C952406D99BA089 ARC%r
810,154,751 *541CAACCCA721654CF48E685451EBD971C2E20E0 ARCTATION4
810,154,752 *541D9BEEE0D0E93D7FDCEDAB68A06A625B949EDD [email protected]
810,154,753 *5415BD7E91B04BA19E3DDA7C28D20775985540C6 arctools
810,154,754 *541A9F97B0579364230E1767E5E5E6F89F43BD2D Arcuatura7
810,154,755 *541A59DBED66160F5DCB5143561CD4961BE17DC9 arcze
810,154,756 *5413D7F8A03523521E5B85A470F0222493D43C17 A/R%d
810,154,757 *541C398CC33DD6DA6E38962B911A6A66B384B336 A/Rd_
810,154,758 *541160D23A322AB0FC31799894E3E6F1335864A5 ArD=
810,154,759 *54131FAC566D7CD2959E445FB6F37430F315C30D ARD9002
810,154,760 *5411744AF52EA216DE35F6B4FB7EC3D030FF5943 arden”
810,154,761 *541BEEBCF9E2F9C755708F8F571BC75F8FA08E56 arden.alleva
810,154,762 *5413ED1D70816EFBA310EFDBBA4085C24CB195BA ARDENAY
810,154,763 *541572C51CABF59687D1EA5D69C44A7847C76A24 arden.baddour
810,154,764 *54134780B933EC08CD483573C302EF46AB16EA90 arden.berken
810,154,765 *5412A9D0D82485A80B4DD23FB4D41D43980194CB arden.blanzy
810,154,766 *541C9AA500C85830FC63D4541631ECA129A87D37 ARDENCY5
810,154,767 *54107106B288BFECBD733DEA6287ECEDACF54EE7 arden.gully
810,154,768 *54185DBD463471BF971F5072545EAE0FF54827A1 arden.gunderson
810,154,769 *5416FC69E2C6FE5668689E3B365F119651AA5FA3 arden.jannsen
810,154,770 *541B9DD8831FD5996F869D7DFB58679C8C406B2E arden.jarrett
810,154,771 *541E629ED9353051F199B06BD66E95C6709E6955 arden.lannen
810,154,772 *541178E85F22D608B6BA873D90CBB97A6B5FF403 arden.mincey
810,154,773 *5411BE318E59695F7565A7EAC798313B4213700E arden.ohrnstein
810,154,774 *54109AC31418A249EAFBBC8A851D1EA3A721157F arden.picket
810,154,775 *541B09474C275C4D05B2032E2B2EC5CBD6115C2A arden.porcher
810,154,776 *54189CDF88E3B6D27C79D15FD99F492CAC5F7461 arden.sanderman
810,154,777 *541ED7CF6B71A77576AE8830290054F667219195 arden.struzik
810,154,778 *541435C7EE390BE583315AA4E880433EA8728CD4 arden.thorson
810,154,779 *5417270AD4CE3D35A77291F2533BE02ED332A448 arden.vancura
810,154,780 *5411B60036DDD547CA131065BB650B6862D6FFD6 arden.vondrak
810,154,781 *541289F005D498B02C978A0F9ED6C419B68C1462 arden.woulard
810,154,782 *54178E7917ECC864C591BA8712DBE2413912E67A arden.zaloudek
810,154,783 *541B320B60204C0C4CB4BDB3714D3397CE870363 ardereis0
810,154,784 *5412F928895709B30DB37D9CDD065D5A68FF4FA0 ArdfF
810,154,785 *54190344486C850FD2E6CC7E2C837918774FC7CA Ardgrange
810,154,786 *5417BE5B5E05CD86023551B3E822D89E4CE74D7D ARDHIREQUESTS
810,154,787 *5419E51AA4DBC00D9DA6FB7FE6C00A1832C1CCC1 ardiahps
810,154,788 *5412636367092B9272254DEE2008BBBFD1BE830E ardindaandquot
810,154,789 *54192E21E3A679D92B12BE75457275BD0D67D4DD Ardinells
810,154,790 *5410CA7B3D0A192FD287D7ABE5D1489A07C5E68B ARDInterview
810,154,791 *541F395B04DDCBF01E3DE2B149CF973ED2866553 arditferizi
810,154,792 *541DEB1B102C87C9AC3D0D6D080FA33EF0359534 Ardlagen8
810,154,793 *541BF81B806E116604779B6628DC58B92A30D49F ardmorewhisky
810,154,794 *5415D4C53D6979C566227CA2B5CD3409A6799B97 ardneham2
810,154,795 *541BF734F801142EFD03587A92D0AD0CCF706146 ardneiving
810,154,796 *5410786BCD843D2F5C3295802AA19B4B384BF6BC Ardneted1
810,154,797 *541F7C095111C1E6AD187BFB24A66B91791DA4A6 Ardnetig
810,154,798 *54122218DD838031E3321B2E9E4CF80410126DD1 Ardnetsids
810,154,799 *54172F0FA8FF197B1F8EBBDACEA62B64C22D50B2 ardnirav
810,154,800 *5419F10F48D2FF4029C3C1248C156201EF72B159 ArDnY
810,154,801 *541695A73916C0F4BF21CE228C24649911E76240 ArdonGliIncensi
810,154,802 *5419B82F24944B2ABDFF60F830B3BDF7AF178675 ardonick
810,154,803 *541B9D90C8DDE4F6610543F2B824134D8F9D131A Ardretfa2
810,154,804 *54112B922DA702295C9BC30391202E6AD5049D76 Ardunby
810,154,805 *5414536AACFF9520254BD83B0A5B150ECCE789DB arduoced3
810,154,806 *5411D06FC6F8A0BF7AB9D68F6ED2F39F4C6336C0 ARDXBI
810,154,807 *541321339E68B6BCE301146B8964C0DD70F69260 Ardyardy7
810,154,808 *5416752106865FC4DD8ACBEE9340F72B00891F1E A-re"
810,154,809 *5412628B2C738B97274C39529E294FD49AE93D71 A%re(
810,154,810 *5418FEE2270FACC2E6FA6194026991B799FE995E ARE0I82A
810,154,811 *5414E2DEE144554FAEB8609A4841FB6CDAE40616 Are2S
810,154,812 *541AF49A047C5EDCE5280B24675EB70EF208531A A:re5
810,154,813 *5413A136C984A12B459403F840AD9601CE65B660 Are74
810,154,814 *541225B72A90E2650A37D33724DA3367DB6F441A area1245
810,154,815 *541461BAFA8F23FCEA07075CF158B46F68E1E0C5 areagregalton
810,154,816 *541F77F6F4DD756C4330574A551984BABF9243A1 areahornplease
810,154,817 *541E162C9E872B56930388D6483AF8D178EF570E areas33
810,154,818 *54149183A872152F4F4CA1B906EB7BF3E39ED16E ARE--AT
810,154,819 *54187A44D5BA36F8A8329F3FD1F921DF4CA3EA26 are boo
810,154,820 *5415D774611805B1E6B8E6130FE3310C78E84BE8 ˤarebsûs
810,154,821 *541EC47182DA4FE1B7C493D3B98B9A9E1CAA2A0B arecevoird
810,154,822 *541C971F5A526783FD1C6704CAF8BBB6AB405480 arecossas
810,154,823 *541FCF07CC7EFF061BF858937F88BDDC967F06A0 aredavoC
810,154,824 *5419D333CBC2C8FCB073DEBF2B262C6BA70E2684 AReddandkobe
810,154,825 *5416DB318B3A73D2798726B9F05CC35421221891 aredouté
810,154,826 *54129F5E42BAA61EEEB062B5525D90308FF3AFDE aregagne4
810,154,827 *5411B02CFD231E6E6B371C27352D09E4B6BA58FC Aregate9
810,154,828 *5419D319293CBAF8954F0EE9A1ADCE6D116B3A52 Aregeciv8
810,154,829 *541DF6B2174BD780603B4F3E7C5F572AA8189255 Aregsag4
810,154,830 *541AF4EF72408BF938A17759D833F6E9EC992148 Areicnuj
810,154,831 *5415373C53EAB63425C2DE01FAF70B063CB1D2DC AREKCEOR
810,154,832 *5413BC8E58E80A99E41CB689B0DD0D719100F3C7 Areknart2
810,154,833 *5412DF36B1F02BC0FE452E242E147378925EAA26 A&ReL
810,154,834 *541CEA6AB588E73B00C0FBA0D8C98BEF708D78D6 arelativisticam
810,154,835 *5415C2EB1409919A7AC11B25F900D8C526F14B88 Arelbate1
810,154,836 *5416B7DAB3E6615A4AB0C01A8153D5E1193EF2E3 Areletra4
810,154,837 *541C3271F52E5959FDBC0FCC105A2F8CFAF46EB1 ARELI22
810,154,838 *541DB34124BAB7738401566448DB73F0EC053BDF arellanokiko
810,154,839 *5411D1CE60E744AD583452D7CEE6B4DCE0747F62 Arelleja6
810,154,840 *54151144D2291ABF05D92A2A24752E1FFEEC8502 Arelucne
810,154,841 *5415C06D51B0B20C42AE3BE561653A7A97C9071C areminA
810,154,842 *54129AD6EA69C169F5385A0943F7E5A27BCDED35 aremium3
810,154,843 *541FB217FD35B869BED1FAAB66FAD1A438CEAE2C Aremunbaed
810,154,844 *541156F12D2217D30AC47F73EBB73897A35D5FB5 arenacea7
810,154,845 *5413F476D7264EB347F9632E1AE398D876833E2E arenary
810,154,846 *541F6E5830B5E72DC07F7875A7EA2D129312C256 arenatalkallied
810,154,847 *54110ED11C6AC26797A5775205078ABDE3B7CB05 ARENA」の運営を開始。
810,154,848 *54130C88BEDFFC3BE449FE02FF111355970EDF36 arendhammingatgmaild
810,154,849 *541B021ECAFC29838AE8BAC73BD3C58330DD3926 arendman
810,154,850 *541E385C2A80DF7F60245F75C9FE869F75517111 Arendshof
810,154,851 *541F53626E7458F4D73C7AA8CF5DBC9A80C1C456 Arenged6
810,154,852 *541223BE5404E8E31AC27916F297E5745AA2F33B ARENGISSA
810,154,853 *541149898481E4DAFC13000F8F32E76AC2767B14 Arenilitic.
810,154,854 *541043E3211437BB73E6ABF80DE72E8A2B2B47E0 arepitas1
810,154,855 *541741750AFEA0E70512AC3E2067DD00961405FD Arepolho6
810,154,856 *541451A57FC5184AC81EAA3BCA9381027435D944 Arepooc8
810,154,857 *541C1F108109CA66DC3E14C7977748538FCB687C [email protected]
810,154,858 *54163374B19CD8BAD04C83E9C52F89CA63825B8B Arerebla2
810,154,859 *541D4F7A09B23C3EE09BA41DD55985B1C2653BFD ares8261
810,154,860 *541A2948A06FB05FA5FFF73757AF6B02FD78EB98 AresCrypt
810,154,861 *541E7E26DAF849AB818D3467BACB561A42DB1D52 are.shakes
810,154,862 *5411D726FE55E290B2B1AB5FE573830413F94CC6 aresila5
810,154,863 *54134B608DC7842606940B7FCF563E49C1B033EB Aresivrepus
810,154,864 *541B9071FEB7018A221084F8D65EFCAF7E34B029 AR/Et
810,154,865 *541FAA55FA5640BF1A1586E31E979BF7CBCE4E7C Aretatsn7
810,154,866 *541C8A9DE897B88B32247801949FD2C614138B8E Aretehcing
810,154,867 *541C9E2867E2C08D0ED1BF32AFE1DA224DB65066 are the good times really over
810,154,868 *54102C8F9B662C4160AE8E198FC48785FD967A8B aréthyrée
810,154,869 *541908980997972AA46F8E3BB2CA675EE48249E2 Aretnaving
810,154,870 *541AEC3FC1398C9EA674F9A6FB5107570C41899A Aretnets8
810,154,871 *541945E6B62A6C912649260F2FD3B7B870944968 Aretnier5
810,154,872 *54120801F96FE9B71AF25FF13B7716D37F533EC8 Aretsac7
810,154,873 *541133CDF25A0DC90D581F9111E3EE894133253E arevalo12
810,154,874 *54141E70E45181CA4523BEFF04ECD4D88A20FDBC Areverge1
810,154,875 *5412B486E5EB4AB9F38A3DB51B2AF1EC76EB9C4E arevgunter
810,154,876 *541B890BFEE6C4E64C3E53B5AC3D7D6D8B8119E6 are-we-there-yet-rich-hickey
810,154,877 *5417010CA1E75230565D8F07D73237AB80F67F9E [email protected]
810,154,878 *541EFD54F31ADAD99117DF3329859BD96DECE0BA AreYouGonnaBeMyMotherfucker
810,154,879 *5419CFE6E496998EC12F84A3AA093172043206CD are you ready for some more
810,154,880 *541BAAA2AA2C4384433351865908368DDD324000 areyouwellhung?
810,154,881 *541E63E5A1D54ED22AE6CAB2A245A662EBE7FD5E ARf!:
810,154,882 *541E9A6F93CA739BB5B000977179A10CF4DB9C39 A%rf)
810,154,883 *5413F026833C3E8D7B50BE396261ADEE17015780 ArF2.
810,154,884 *541E2BBE777AF8FC1821B62095ED943D332A2C91 arffz.blogspot.comarffz
810,154,885 *5416324DD16C4254BECDF1D2904A6F9E62EB558E [email protected]
810,154,886 *541C7A571DB0EE20D1CC9560B479F9CE77C66E1D ArFlT
810,154,887 *541EBD8B6E9AF6E84E0E47E2F48808535AED3561 A;RFM
810,154,888 *541B4F67C983AADC04B0BF37D043F7B8F8B14C1D ARF(m
810,154,889 *541197D5F96A0473D41249A13138215228F84049 ArFv%
810,154,890 *5417D16E99A7131EE74BE2F1EDEBFF540090CC37 Ar,FX
810,154,891 *541FAAC34A3250F8A2BA02D7C6E192A13FDDD6C7 AR;G_
810,154,892 *541F579427C2F80A306AA4DF650C6AF91C5951A2 A..rG
810,154,893 *541C4D358923938F72FD03755D8EAC87E8BCD031 arg336
810,154,894 *5415874C3F3C26154C6224DAF7DD96C5F9027D3F Arg677ter
810,154,895 *541CEF2AE349265C9630B6651B864E67AB7990C8 Argairyms
810,154,896 *541A3666615087F09E6E95612522C927626987AB ARGANDE
810,154,897 *5417BB1D94DF7DD98BD1C08A5686F393E2BF3BAD argaus
810,154,898 *541E03BDE54E04A10D75EF359BB97372627E9F8C ARGbs
810,154,899 *541451058E5E0067C471502BAEE365D2CFF8C258 ARGENTIJNEN!
810,154,900 *541BF7F51D823EA17FF3DA7210E58E565F2EF524 argentinaian
810,154,901 *541FEB064EEBF3B8E29D0CE82A533C26944DDE26 argentina—representing
810,154,902 *5411B7B87DCAA6F3F201B68D056A44C2A91E828B Argentine7
810,154,903 *54162028B5157A54765B46D2CEEC663D86720FEA Argentinn
810,154,904 *5416F6951A839FD29A4F66872D9696A4DA898058 Argerohc8
810,154,905 *5414130155BE0BE666EEEB73F34B53C050248BCC arghyaBSW
810,154,906 *5411E4EA640DE853D172CCC6BF63CC86FECCA0C1 Argillana
810,154,907 *541F25FF85FB0FDAC09DCD94432587E9A6F693AC Argillano3
810,154,908 *541AAF86B10F391FB98861BE6EC2254742DE0B37 ARGINASTI1
810,154,909 *5413A47313B2A725B586FB55B3456C2983E751FE Argipels9
810,154,910 *541B34EE2BB15AD34471E6A5B69B66B70F479740 Argiro-s
810,154,911 *541F9C201A147625618120BA18D7DEA8B1E6059C argitaragabe
810,154,912 *5419785085189F97B9EB75D2715D0539A9E428FB ARG/K
810,154,913 *5419E60EE90435B86968D229748411AC48500948 A=RGn
810,154,914 *541A473AEEFEDF1E9A61E9E0C3EDBC5593DB38DD argomentandola
810,154,915 *5415737EFC5D2D2E8C0D17E923347CD2093C246B argonautoid
810,154,916 *5415D065B1EEBF6F393EC910EA416C31B00E6620 argon(lazyaudrey)
810,154,917 *5417D9CFF7619A19C06A1827F13B6C215CFFC0DA [email protected]
810,154,918 *541DA937F00227E522545E976467B739B02BAA50 ARGOPSIS
810,154,919 *541B67A6F2530340C483A88AF984FB159062CDAC Argosines7
810,154,920 *541AD159D20727E02BA0FCF66976F0BA79F6DFBD [email protected]
810,154,921 *5411D96AC59C5406942B73AF4136E1D3DA454A55 Argosyrta1
810,154,922 *5410B50EE2323A1472D653EFA496912163364159 argotunnel1910
810,154,923 *5417F8CE25E11F39D7EF3275D8840BAA786D497E „Argowe“
810,154,924 *5418E123896B70163F434BFDAC7EEC0FD75277EB ArgPBLKBBwGJ
810,154,925 *5418F2F0308C68CD33FAD3410F79CBEA72505BE2 Arg%r
810,154,926 *541D9CDFA12396A49EA0CF60A459E9167E27DE64 argstackctr123
810,154,927 *541539A9D359DA6ECC8258DDD1BC9DB50177B8AB ARgtO
810,154,928 *54187F1D6464CFDEB4CBDAFECDEC51BC571648A7 argued—
810,154,929 *541272DB261F3C98A1C038C899F3ADC75B93FFE0 Arguijuela
810,154,930 *541BD0D1622CDB81E81CB43326F7E3523F2923FE [argumentbetweenchrisandrich]
810,154,931 *5416AB430C970D1CB8511C9F4A3A74A83417A2C2 argumentgruppen!
810,154,932 *541637F7FB3FDF2FD0732CB842C0516A4C27783D arguments.bigtimepea
810,154,933 *5411DC0B37965633E423076F74C81DB9E9A6849F arguments-for-the-existence-of-god
810,154,934 *54130526DF17836AD1545D8AA6AED0FB61F724C3 argumenturn
810,154,935 *5418D669DC09D6E2907E15A343ED4641DBC4DD3B [email protected]
810,154,936 *54116D21F9CA28ADD41A83E6F435EB4A35F63474 argu-votes
810,154,937 *541E8BBA31F3BA3E56BF8DF0AD11D9996F162F7B AR/gV
810,154,938 *541E049EB07CD2C9BBB5D60DB81D2C13A361F40D Arg!v3
810,154,939 *5417CABC2F7AC3A11B0C7388088E4F3E4DD0EBA1 argvclasstablecellto
810,154,940 *541DDCE53294188EB85F7AA564556D377725D08B ARGwr
810,154,941 *541A04ED498EFD2D018602391223823E5283C549 Argyresthinae
810,154,942 *5410156D63F1025F47953C71059D7A3E3FEA8079 argyrolagoidea
810,154,943 *541B3B0CF955A56C674D308B713276029F8B540C AR)GZ
810,154,944 *54192283B854B6B5CF18150D4743F63C537B6176 A.r;H
810,154,945 *541D8853DFA51E0C4309A827CD9999171A5F9D59 A!(rh
810,154,946 *541BA7E292B587C4E93E745DDC0C0CFDABB947E4 AR%H1
810,154,947 *54156C3332EB5D6A5485D455F9F202B1C26D2B9C Ar;H3
810,154,948 *5419614FF895938D1CEE1125FB2EDFD52D65FBA8 Arh6H
810,154,949 *541A1F74C02189DD9C74D0D783BEDAEFC5083B0E Arh_9
810,154,950 *541A59C92910123EE455449BDF162F06760D6DE3 Arhadbali
810,154,951 *54152663AED2F83B020A6C85C9A4D0D01B9900D9 arhambault
810,154,952 *541AC8B44F431EE34541357878509B23FD2710D7 Arhkgnos
810,154,953 *5411D8C06EB8E6B347732715BCC8CD4765AE3119 ARHMS
810,154,954 *54186296C641922D21B69C03F67E6DFB28B95016 arhobartcatherin
810,154,955 *54140984F91D770D912ECD0CA040A10855AF6A7F ArH+V
810,154,956 *541A20C79190884DC9F4097F1C67E452191DFE44 AR%I?
810,154,957 *541F4A37162C90431B8FD051D0EC0B8696A16FFC ARI="
810,154,958 *541713EC62999882BD58C4D09DB2BA93529A441B Ar--i
810,154,959 *541642E7A4E5E738227930FA897AA2A930C8343F Ar;i,
810,154,960 *541E792D25BA1EC60246D2A8EC42099F6387626C Ari0s
810,154,961 *54175D3FC9E36F08007B7543C65A5A2AA8A87092 ARi1E
810,154,962 *541909039A9211E7C4882FA7E534C284591906A7 ari712
810,154,963 *5411B90A3AF73435D4619BF329A95D80CA1DB98E aria242
810,154,964 *5413F3C9CF77D6A5CBB3FA8CA26F76F9C630B0DA aria dalinda: apri le luci
810,154,965 *54117D7E51F87D5850F6B450EF55B852D4C00589 ariaengine
810,154,966 *541D88A45AF7207C7B9D98F6B7DE80B6A6C11FBE [email protected]
810,154,967 *5412549646489CCC5D17E44B8905A3335F2C2E1B Ariana321
810,154,968 *5419B36B5AF50EEB6414C68CA62CE0625DB72E66 ariana puentes
810,154,969 *541F2CAE910AC7F6EE45BFBE4776BF96A3A04812 ARIANERENEE
810,154,970 *541AF040488872DEC773D2B800E3DF927212A812 Arianescarlet
810,154,971 *5412A30569BA618688280AD00E7AAC18FC6CACA4 arianescup2008
810,154,972 *541C556CCACCF0414628C63A458B6EAE657A4625 arianevoyager
810,154,973 *5411B7ACEF71084A302747BC66F7A7AFFBE1AD27 [email protected]
810,154,974 *541C4513B58962DAF80CF13FA53767B25830B2FB ariapfxinvalid-list"
810,154,975 *5411B266DD73CD25FEA06A13F30AF1C55BF2D06A Ariasesed
810,154,976 *5410E05541F267009AC581965E33CDE9B9F1CD69 Ariawases
810,154,977 *5410C3A30651F8D7289C8A88EB17051C5EA073EE [email protected]
810,154,978 *5411DB8EB78CD4357C86DDE5F6CFCCE7A13161D9 ARIbr
810,154,979 *5413989EAE0F4341CBF93A722EF49F553382A5AA arichisso
810,154,980 *5416E0D1C94185D3B4946AF30E09F665451F9940 ARICKAREESCHOOL
810,154,981 *54173C0517E79B752631C8D04C3E69B670AA35DE aridinis
810,154,982 *541952B3793D2B572EC26F01A42F103FB7C4A97A aridnoc6
810,154,983 *541B7CAA66BBF1FA227622F80810FF050F6AD9EB aridnoforppa
810,154,984 *541C727357EC4ED104D74ADBEA6253414005E666 aridos123
810,154,985 *541591654FB84498780E15F364FF6ABC0154B9C6 aridyne
810,154,986 *541DB73B64A4D639133E48B0AEDBAE4ECBCC4E07 Ariecagab
810,154,987 *541587A6574AC60BFE62D29A521833A627DE875A arief rahman hakim
810,154,988 *54102AD6ACFE2DD152EA4A0945F609ACC45B911E [email protected]
810,154,989 *5416D2BD38BB57625F971C994EEE6F9201554039 ARIEL2513
810,154,990 *541276252D2D66D9854B80CADC0A28DE218D0A4F Ariel508
810,154,991 *5417FA2590B7CE0F1D6F1AE543466C343C41465B ariel.beyene
810,154,992 *5412EB9D82C679AEF88FB3E1F42BB275AD087D30 ariel.coit
810,154,993 *541BAA77F822E8A5D56AAEA36C8F619B7FDD29C3 ariel.dusett
810,154,994 *541CF86C256912CB0D318441453FA92570167F18 ariel.halprin
810,154,995 *541DDEB8155487007C5B7FEF80CC5E6CCCFB8948 ariel.lazar
810,154,996 *541C2695D4F08799D400FA4F7A03769DB1A5BAAA arielle hampton
810,154,997 *541A49A9C0162A457C01B726812D2099A4C8E977 ariellen2000
810,154,998 *54179FA90D143D8838735D59A1D5D0F49691E22D [email protected]
810,154,999 *54102519B033A13BAC67847C6938616C9E6F4D48 ariel.lockbaum
810,155,000 *541178616E19FFE4555A12D6560960465F6B7B6C arielm98
810,155,001 *54123D96C0D371928A2D4D873A407E87D86CF027 ariel.madura
810,155,002 *54183120B51A9F67081E6477DDBDF0C011FAE269 ariel.niemi
810,155,003 *541383D0DF55FCC63EE69710D030DF9D8731B79A ariel.paulino
810,155,004 *541D1F12F891D38A62E9CD8688E09834EBA3CE60 ariel.redcross
810,155,005 *541B515E000C0DB8F324DA57F7058DDBB6015329 arielsage
810,155,006 *5414B5AC76A1F9AE0EEA9196C7FDD78EF09C63ED ariel.sallmen
810,155,007 *54182475EED26ECA20BC15A23C7EFF2BDF7BF6EE ariel.samples
810,155,008 *541D9C35A91302898311B1A8C2EC6FD19BE307A6 ariel.sherbert
810,155,009 *5410EAC86A134C65892EFE2DD4EE8C0F567E9294 ariel.sibert
810,155,010 *541A659A8FE81226CB34A33E81705D51C3C66C01 ariel.spielberg
810,155,011 *541C6DE8A180B21A4DDDAEF5A99EBB0F0763B718 ariel_sys
810,155,012 *5413A5A0191FCF253E6038B4FC229FF6DF235780 ariel.thorngren
810,155,013 *5419360B2B4327972609FFC15263A715949E2AED ariel.vansickle
810,155,014 *54124091421D6B12704B98D0DFE72AB4F48CDBEE ariel.whitacker
810,155,015 *541F8361FE50DF06FE467DAFF1A838C7FE13B39D ariel.xander
810,155,016 *54150285B2893597A928A3C0916518152FFBD99B ariel.zaniboni
810,155,017 *54183BA83C62F256CFF3A20DF85F5CC4F86F12BD ariel.zarlenga
810,155,018 *541966FEB8FD5887224DE4F3AAAC11141C408D57 Ariement5
810,155,019 *5413A0B67FDFA45680E668CAB64DCE12135D5C9F Aries-IAmVengeance
810,155,020 *54195FE4D0DCDAE42379DCEAA879E82B5E3DCEAD Ariewill1
810,155,021 *541C13FE150B2330E7A8BD89147763417625799B arif akter
810,155,022 *5415BD8606FAC8E83ACD84F0094F2F36D85DB99C arifalichatoo
810,155,023 *541C717EB007DF7C65857EB7ED0F57B029694A62 arifayib
810,155,024 *54132BE3B5D231E39EF3D27C47B1B8D94AABDED7 [email protected]
810,155,025 *5417B4F604FBDA5DD9D287865BF6836F7A30B908 AR
810,155,026 *54193FEABA7A37B38D61334BA6CB7AF9926795C9 arijánstvo
810,155,027 *541AF910E495C9058AD486D8B1586217024B851A arikara8
810,155,028 *54119B1EC1261BF4F2955542DEFCB311DB090EE9 ARiLn
810,155,029 *5411C4CA02BF7F4E75A4B3101F0BB0B96533E006 arinae98
810,155,030 *541766D3C1E092672489B036A8C915881BECB745 arindam majumder
810,155,031 *541CEDB3ADD733A2DC436DA226247355D620E403 arındıru
810,155,032 *5418A75780E3E291568F8F0363EB61AF4600CC86 arinkeshishian
810,155,033 *5410FDE8DD9EA25B06E686E9A4668A1958FF7339 [email protected]
810,155,034 *5417EFBC9AEDC56129F1E48B32B8F4DF033368F4 ariocarpus123
810,155,035 *541BBDA061182C64E1202C47CC6A1E557D4D5EB4 Ariolate0
810,155,036 *5413195A668F2A7D45DC9AD130C5670E7C99353F Aripnihcing
810,155,037 *54147F782D154A426D2282A006B3541A7BF4C173 ARiPo
810,155,038 *5411C6C4D3B6FDB251E25E9AD6C32E26511BFF83 A
810,155,039 *541E809AF4369E599B9038666F23683DD11EE6B0 ariruase8
810,155,040 *54188C36470BC7206105106C9D13CD80F6252EC3 arise, come as you are
810,155,041 *541DFA86D0BD84ECD6AE7EFECF5DA2976659137D Arisest4
810,155,042 *54180BB37115B3813A9E7A73CF9695EAE5DC66A4 ARISON33
810,155,043 *54146715EA5F873EF41A4E65C626EA8D96AEE048 arissavillanueva
810,155,044 *541F3A3402207C6E936BA950354C6AE648E3B5C4 Aristede
810,155,045 *541C5B774C9B342F8DC88A15955A3C284E8F74F9 ARISTOCRATICALNESS?
810,155,046 *541E5EE03E57DD527DE7ADC21C1453772808B94D Aristodemocracies8
810,155,047 *54102CEB1009CC7F2AB228643854CDD48545AF0F „aristokratisch“
810,155,048 *541486B6BE4E2C3F338C1112DB0E9093CF0E2965 arisztokráciáját
810,155,049 *541CFAEF5F35C4FFA147D56E2FCB8240884C8EA8 ari$t0tle
810,155,050 *541E8E159A459A3DC7813AD5CCFD0E4CD9F6E5B4 aritech2
810,155,051 *5414B3D51190C342B87370813AFBCBAF79D3B835 ARITHMANCY0
810,155,052 *541ED8045945C587D93DF6487F0932906413CF46 ARitmoDeCiudad
810,155,053 *54161913F6D809F4B4660C6D56F6DB7150BE506D Arivebsw1
810,155,054 *5413411D1E0406DCA942D9EDC2C2EFBBE60B876C arizona2000
810,155,055 *541CCB186578498C8F8250B7D930E44E780B572A arizonateec
810,155,056 *541B233943296DC9B5DAB172CB1A7F3A90D6E104 arjan.back
810,155,057 *5411F5F7FD3DFD3262A468D6A336ACB1D1CDE839 ārjīka
810,155,058 *541C614263D0573C76172F03AC4FF34E58D31BD6 ARj#K
810,155,059 *5416C476C167323732BE8378FD6F99FB42E704D2 Arj,o
810,155,060 *541563597319138D45B1ED3CBC3E592BE1D2AEDF arjoncruz
810,155,061 *54191774B8936C9513281F83847EC8FCDCF50E32 ArjQr1f
810,155,062 *5412241808FE746AE15D2AFAA7A080E9C53357E2 A,RK#
810,155,063 *54179263D445A112F9BC5BD47CC5274978B22205 ARk7w
810,155,064 *541646FDD49393C3690A971D8C19D43A29BA5517 ARK9L
810,155,065 *5410DFE8EA34CDF6EA8BA5BC96914C251D388FE8 ArKam
810,155,066 *5413DFD5E6BC1FA1BBDB5B6E104A2273F74C9277 Arkania3
810,155,067 *5419A726A8F9A17C1CDE97435A2FD60AFCDA4CFB Arkans
810,155,068 *5413E12FDC5C76E51F73D769ABFE832A60EA9C87 arkansascaraway
810,155,069 *541D908C24EE4DB3B3D92A62896AB12DA6F9EA63 arkansasrevisited
810,155,070 *541B2B3B4D8EC622662D5327A35DACFE07BB9E1D arkardenhaus
810,155,071 *54112F23E98A40E8440D432E2A4DC0F20752480A arkardien
810,155,072 *5416B02730F5E09ACDBC459664FEB509B961EE8B arkerfið
810,155,073 *54146AA243EC79B8B502E79BF0330075803932D3 ArkHd
810,155,074 *5414BA45315DD9262C3F7EE1E469578AA1F66741 ARKIESHIBLEY
810,155,075 *541A777C6E0DE2D2222EE3AEE88DB03B756941E9 arkikäytöstä
810,155,076 *5416C3BBF562CC17F4A5FE0E8720D7FC468A3946 Arkikulu3
810,155,077 *541BD2BF01EF9B03CF28DCFFA99BFCEC2A6C3EAE Arkitektskola
810,155,078 *541C4D8B6F5180BCA5DD50FDCA294714B5B2D3ED arkjpan9
810,155,079 *5410B61A7467980290E55FC43F321B4D8437ABAB Arkkiatri9
810,155,080 *541A79EBEDF775A6C7B10FF8B0E414CCB81F36EC ARk(o
810,155,081 *5410D03035268AD78016FAE3E6EF1FB31FE9896A Arkowski5
810,155,082 *5415C8E20A262215757DE03B6962CFC434426EA1 ARK=Q
810,155,083 *5413C2AE608BF1816A40319FF1CAF71E4964966E Ark+R
810,155,084 *541056064594AA9AB54095B96B766485181D4946 ArkR4
810,155,085 *541E28F86067E79C5483ABE0101E97DB6434122E ARK;s
810,155,086 *541C833AB354B4288473D851DD4EAAF09A43BDBD A.rKs
810,155,087 *541A2D0185F0855347138D639EF0384414D0122A Arktangens
810,155,088 *541BCD80A264DD02050E5BEA067624137B5598B2 arktis191174
810,155,089 *54191E9D106C75F517417E2414F759B3F4EF8685 arktracker
810,155,090 *541B543A22362DC4D23062C01A39C5EE05DAAF6B Ar&KX
810,155,091 *5418A661103A398E52B5A15433C1F88B8505AF4F A.R.l
810,155,092 *541FECDD8EDFC33E190EADD19FF2CC911F72AA3D A$Rl(
810,155,093 *5411168063C70550D350FF7197FC464DA2C8A1BB AR;"l
810,155,094 *541189DCBAA658DFFB868ADD35BB8EF58FFFCCE0 A.;rL
810,155,095 *541A1B00376FD74174E52F4A5ACD8CE177D26533 arlanhess
810,155,096 *5419E43B5541CF65F27D341C5753FC9CF9794E4C ARLb"
810,155,097 *541FF2D4236C4C846E5D4793D90F92FC0B458CDA A?RlC
810,155,098 *541C223E292AAD56A1EB566BAB75E7B285F14A77 [email protected]
810,155,099 *5415378C0580E05DFAB744AAF1EBAB87A8BFF6A5 aRLdrNVB0
810,155,100 *54197352EAADB81028B9FB3B1D48B48CF80707FD A#rLE
810,155,101 *54102AD9F764093920B37367058D7D4EA08D1A66 Arleenda9
810,155,102 *541D720E36D787FABB395616507879F0543B2608 arlen.balock
810,155,103 *541E7A8DBE2EFEF77E2393184210C4E97EA3CE8E arlen.beacom
810,155,104 *54199431B1E948B7A5C9C9CF2E5B6D14E1ADBACF arlen.beermudez
810,155,105 *5410E4FDE97D004A871333EB819EA3C73278D70F arlen.boker
810,155,106 *541289EDB91EC0BB47FE8D1B3434BCF6E499006A arlen.bonesteel
810,155,107 *541A5B5AEF581F026475E956DB584BEE3A2A1584 arlen.bonfield
810,155,108 *5410BA001C4A9A88FAA0F7F183321BFA045CC8E6 arlen.ciolek
810,155,109 *541D9DDF2051A9C99F64DA42D844DB299E4196C1 arlen.coghill
810,155,110 *541D82E632196BC1D1B7B60887823A658B035B2E arlen.flaim
810,155,111 *5411F94A232D26C882607A7055C23704574E4B29 arlen.gorgo
810,155,112 *541B0253C9C595E6782606A93A95C37140CF9433 arlen.lasota
810,155,113 *5412D1E8013A737512C5FD3CABF5074955D17EC7 arlen.lifshitz
810,155,114 *5415FC3B60D71A86BCB8A3BF65DC8637259C4FC6 arlen.lovec
810,155,115 *54164BED2E90BED6CC89B1D1449C69A5E99DE8F8 arlen.martini
810,155,116 *541FB2644E3D258008257E56D365FBC11BEE9D36 arlen.medawar
810,155,117 *54106B80DE86461D2FC06396E460A93254D59801 arlen.monegro
810,155,118 *541EFBB4C1A8823EC8A3EA64CCCA97F37F878404 arlen.niles
810,155,119 *541987AF9F4E352785069CFC60E9D0C9064421BC arlen.novinger
810,155,120 *541C7590CDBE2283E5D4DBA76AD10F44D658F1A5 arlen.ordoyne
810,155,121 *5414B431F89DD19D51260B0FE9282CD9DCCA36EB arlen.rawlins
810,155,122 *5416D8F5C5F6A5E77FA234FF147C28F82B8975FE arlen.shaline
810,155,123 *541A6F2BAEA8FEC29B23C1DB4239B50B703873E5 arlen.soloveichik
810,155,124 *5412DA24E739EDDD0781550E49EB19DD9192CC1E arlen.tozier
810,155,125 *541C00BCE0BC23EEF1EA161C6AB82CA9FD871230 arlen.troller
810,155,126 *541EC9FB9CC967630F364B2F3943DAC4C9C8400A arlen.vert
810,155,127 *541FBAA95E33B53F3F970D962D51EE175ECFCF28 arlen.wiederstein
810,155,128 *5414286468CB6C7A4ED551E7CA246F2B91ACE06C arlen.zambrano
810,155,129 *54158A4FA38A84194075BBD04CDAC861E4DE4CE6 ARLE-PENNY
810,155,130 *5411021841C451D553E80EA7747B08BEED8C82DF ArLEW
810,155,131 *541608410E4F5233C3C92128D2F3002DD19D069D ArLG?
810,155,132 *54110FCEDA408083BE516997B256B9F1D0A73488 A,rlh
810,155,133 *541B95FB6E18B1A9785105BBE168EFBE7EA9E125 arlie.abrantes
810,155,134 *5419B04E5E01549EF543C868F9959872D2CCB0E6 arlie.banis
810,155,135 *54174F9C5F6BFE7A38C6E5C4511441B1BE991490 arlie.bigney
810,155,136 *54139BAA3A38F54B983B38F5164C29A6393BE1CF arlie.blimka
810,155,137 *541633BA939805EEEA8E2B696D6B77EF4F812B66 arlie.celius
810,155,138 *541F442AF23D036F0FF7EBBC1E9FAC675007D76B arlie.chi
810,155,139 *5412152F998EE3EB8998A3B4AD7017D7FE41CDBC arlie.cicero
810,155,140 *541AAE237FA2B9EA92605DE2A2DA60A899201B00 arlie.courtnage
810,155,141 *541B40976469791EA786561B7B4431F0B4E739D6 arlie.dankert
810,155,142 *54104A6247B2C94763EC3DC8A44378F8FDB1F16D arlie.dobbratz
810,155,143 *54188CB929B38B8E56C98BF99895B7FF78ABE069 arlie.erbach
810,155,144 *5418343143BE1C926D2CA3FAA800C58E243DA2AA arlie.geldmacher
810,155,145 *5419935499DBD8898C083062D444965CD55A944A arlie.godoy
810,155,146 *5419BF8B5777C96DACF67B8E647075558844E5B1 arlie.goolesby
810,155,147 *541D95906E82F4EA0A437F413F63219D2D7709F0 arlie.gouin
810,155,148 *54118F2B84EE4D42BA9B1F94AD6436DAAB9A2AC0 arlie.haarstad
810,155,149 *5411F43622DA97BE365E1468841E0636E17C4782 arlie.heaviland
810,155,150 *5417B6F6C74824D8C04BE6763BA5F9350E48CCCF arlie.joler
810,155,151 *5416D6D9F2DB3A510791FE53E53CF9ADA0A420EA arlie.keylor
810,155,152 *5415F9EF7084ACEC23273631B9CD27AA380220ED arlie.lenser
810,155,153 *541EEED6BE25FB758B1810873132D2DAF75AD943 arlie.meharg
810,155,154 *5412FFDDE91F83C44236E94CC2D17179829D5A16 arlie.nothnagel
810,155,155 *541276F10A14C5EFC017C8301133451573671963 arlie.pawloski
810,155,156 *541F2A72D77C85D07CC1C26BF23B3F49AD86228C arlie.schoenborn
810,155,157 *5415A9ACC2E98B52A09A63D1B5706C8FF4CEB7C5 arlie.senner
810,155,158 *541B093BC9466B0C083128F46F6680134565C270 arlie.vansciver
810,155,159 *541D3C8BFA651FCACC89347720517D901D2E270E arlie.whan
810,155,160 *541BCE60B739091A6C4C3358643261B1BF8F38EB arlie.zurawski
810,155,161 *54194CF5C125EB45BF16E5E1D86175B756FED4FC ARLittle
810,155,162 *5417D0F4F9641F684E7A105B9AFA5729AA2D566A ARlK+
810,155,163 *541570BB64451A887AD6C94DE55184E698E90621 ARllt
810,155,164 *541A53E372DD3ACCAEC34FD2D20CC97A75A33A81 ArlrX
810,155,165 *5410E6CB99C23277C4356F7B2BD3BE22D406F054 arlsheim
810,155,166 *541B1097EC356766E4EBB61938BE4F892D02203E arluigh
810,155,167 *541161187CFF5EBA6B1830212B957D3EC6008303 ARlUY
810,155,168 *541A0A97A22DF48A47DEFE26914BC99261E6A036 A
810,155,169 *541D411D89A992AA58EDB4715D92ABC3808EBD71 ARLY17
810,155,170 *541CF1B52933833C6AB617AC100DB27D039DBBCF ARLYs
810,155,171 *541264F792E9D609DCC93147C2EF34C8C15D228D A;)rM
810,155,172 *541B79323111818FE5BC1C43239598F633B5ADB2 [email protected]
810,155,173 *541B897AAF0779898674C41D81B6F4503CF01051 ARM013101
810,155,174 *5410D866541D12E7F50811E0E66CD7C058802C2A arm436
810,155,175 *5413996B3B68EDE39E2EA0DCF1A14D45869DF047 ARM9,
810,155,176 *54123A5E914530397A51B33EB65BF2ECE01C4548 armāda
810,155,177 *54189919E36021595FE20C495E884FAD2CB6D9AF armaghbaptistchurch
810,155,178 *541F081C4BFBBD63E1CE456AD0321724F1BBB21E armaimmat
810,155,179 *54172CEDBF894DC7EF927344BF448D687B8A4593 Armaista3
810,155,180 *541DA0AEBF55E3CFBC361702F0769E312B60D541 armand.battiest
810,155,181 *54196B239C0B9DB1F3BD49B457CE0AEC996EA25B armand.birdtail
810,155,182 *541717739ABE15DFFE82F1CF92C9C7484B80EA9D armand.carrahan
810,155,183 *5411A9D7B5FB9359135CD3DB0D9785B390397E3F armand.crosson
810,155,184 *5413FBC820D8DA5CD6A5A6DB7E8FB88AA4B5A9B6 armand.defreese
810,155,185 *5415BB63B8E9F21AD4B36CCA095F46964824A444 armand.dobberfuhl
810,155,186 *541D223F7AF9957C5CAEE5D52BCC3D3FBD528D8C armand.ermogemous
810,155,187 *541F522151E982860F51E083250C9861D66ADB6C armand.gantewood
810,155,188 *5415B14404A015D060FF02C211EF94870F897A73 armand.goetsch
810,155,189 *5418C7AFBA253D7063EDB73AD458A917AB6B328B armand.heathman
810,155,190 *541F4B75E160FB50D9FA1E38EF5C4FCDB47296A8 armand.houben
810,155,191 *541869B94F9EB9F9756F0EE9765B71692CACE681 armand.hudach
810,155,192 *5412704924D704BBBBE673EF55B86F6AD93A8C25 armand.kilcher
810,155,193 *5417EC62227D009D9A22DCEF416C1DCB74831351 armand.knippers
810,155,194 *541A18363A8F8B1A0911D6EF5D28FAFA414DE313 armand.kuney
810,155,195 *541B488B7013B1F62DB1346893E2F8C9A0CE22D2 armand.kunselman
810,155,196 *541CF9BC381D05ABB4A2578007D4486648A63446 armand.ludke
810,155,197 *541DAD3C16C9D00277AD1F66AEE4927CBBF7E0D3 armand.muntz
810,155,198 *54116BC270A0A7C0BACFEACA0CD417B9957A601F armando.caparros
810,155,199 *541D0AD1AC9DCE5A6B339C877CFC38A55BB73138 armando.derian
810,155,200 *541D4C9712F50925CFBF2733AAE1EE1323BB4F9F armando.dikens
810,155,201 *541943D9E60D439929EED62682A094FC981C4C00 armando.entwisle
810,155,202 *5416C1D48DF2D2991CE5851BCB5D64777F27B9F7 armando.ericson
810,155,203 *541DA40049F762107C484850DFD6520423FCDF07 armando.ferreira
810,155,204 *54185F505C28BFCD75380EDF4D9CC90481448B72 armando.gries
810,155,205 *541E96194398C4B2E3B66584ECE02C04DCFF6BBE armandoguel
810,155,206 *541BCA48BED43392C2FC13D2702781DDC60D6B4E armando.higginbotham
810,155,207 *541392145FEF3F9CEF0CFF211A7505EF29FBA6CB armando.kramer
810,155,208 *541A62890646A5C6BDF276F80DF479036C296614 armando.mayans
810,155,209 *541F2761203B0ECA1F87188E9AD56B75B8412C6F armando.meskill
810,155,210 *541572744C50D6F53763B6EE4C7262DC2B2DA5B3 armando.obenshain
810,155,211 *541F50745376F67A42A26A5F99B21D5E1F386BBB armando.ore
810,155,212 *5411F6DB967B2B5D0B2E28EB81D0CE244309DEF7 armando.orona
810,155,213 *5410F0B2FD7AEAE1E716F40CAC1E4AB339835B7D armando.salas
810,155,214 *541B35C106272BB420BEEED2EA8D5F2F74DE7982 armando.sevilla
810,155,215 *541A2CCC3C2CE24439FE98DE0569558B82943BC4 armando.sincebaugh
810,155,216 *541DC9F9861038CF83C144A9FB0FAF4199861189 armando.sisko
810,155,217 *5415DA5545BCD7A7A9DC0092FFF6455CAA834061 armando.skolnick
810,155,218 *541BE42FA886C33E1103291A46DA3F6D6009F76E armando.tejada
810,155,219 *541538F4B0915F2A6166488E920C91A1DE85EF24 armando.treichel
810,155,220 *5419F15DEBE502CDE40714B47DFF0D6BBA4DFF82 armando.vanbuskirk
810,155,221 *54120365EF22213B42FB376D80AFA8AE7D13F4B0 armando.wittbrodt
810,155,222 *541EBC64A23718CC5C5EE7116EF6F088182E8D1B armand.padron
810,155,223 *541A0B04C6D4B90962AEB9D49C14E172021C29C7 armand.rasul
810,155,224 *54149EE282E89404D8F947CA65B5498C56C69800 armand.seilhymer
810,155,225 *541E37802AED2DC5FB9EA9B9AE5FCCEA0FC051D4 armand.stabb
810,155,226 *54118E620A1C7AABC4D00F863D3A3B174E62CF0B armand.sule
810,155,227 *54109F98D11F317EFDDEB51B57E588F889FF98B0 armand.torrecillas
810,155,228 *54141BF103DBA6C284E776ECDC3E00F4D7398642 armand.voelkel
810,155,229 *541660C74A27D8B12480BFA28907FC427EC8EC61 armandw333
810,155,230 *541C9CCE8EC13E8BE20C7E915A349570D55958B1 armani908
810,155,231 *5411770390A999DADC0F366B965BBEA3B7B3ECD5 armano0
810,155,232 *5416353B9681545314D5F08B291B66A9D2E30848 armants4
810,155,233 *541FFE599C631279303C34EBA5CB058E37B47E1B Armarearmare
810,155,234 *5415179033A6DD0E37D0E3D3B87D0200899BD4D0 Armaside
810,155,235 *5415137170FCF3A9F74413BEADD6D0BB42323886 armazenarlhes
810,155,236 *541E391CAADFEE25B8F1C62E020031DBD2F277AD にArmAのエンジンを元に開発された
810,155,237 *54139D1A4C9D14D4200A16CDC8B791ADC458E043 armbuigspier
810,155,238 *541281FACD84A10874686AA0F81D8E98A6E33698 armeeoff4
810,155,239 *541B53EEE53939509870B1F804D9838DA541C3BF armenian-catholic
810,155,240 *5414CDA8DC1DF45EC280F69323A0388407598A89 armeniavayotsdzor
810,155,241 *54124C6952BD74ABEF2C559D5B21C9D4A47182AD Armentised
810,155,242 *541C5928DEC4A9F873CB4AA41212DE4B52B928AF armezells
810,155,243 *541A4B5272C3E7A56D5984E5FB581BF85B545CDD ARMGa
810,155,244 *54121CDB827427A160935BA617244C4781CA10F6 ARMIDACLEMENT
810,155,245 *541CBBF81552D9B2AC8A1820FA796CCAB20882E5 Armigans3
810,155,246 *541373CAF73BA5E2FDE87A1342606E6D69384563 armin van buuren 003: in motion (disc 1)
810,155,247 *5419CE1212E006530848C4116228C42C47BFE4CA armipo+7en+7
810,155,248 *541961235BBEC5B454663DE39702814CC564EF93 Armistizio2
810,155,249 *541669DFAFCCF9DA3FAE6718FC4A2F2B24F310C2 ARmLB
810,155,250 *541679683E649408A591F2D779993D6DF4C35B13 armlnge
810,155,251 *5419027B05AF73EC81CBC68C916E35C63152C2FA A(Rmm
810,155,252 *5413B81830176393F197695261D6E958197697A6 ArM:m
810,155,253 *5412F2655B447DFA5653EB5810CEA7C681EBD5B5 armmf
810,155,254 *541D7C0D5BB6255473C378DE604683C3BB4504BA ARMno
810,155,255 *541DF763BB4FD1FFA38F334D071BCA39BE0584E0 Armoedig8
810,155,256 *5415C885AC7A5A85F4C5F835A65CCEF7D6EC0004 armorcavalry
810,155,257 *541033DAD32362F39DCC4DAB69EBA6481A25726C armordragon
810,155,258 *5410CA35101998B2E2CA774D383CDA394104603A armoredkern
810,155,259 *5412BF6BFAE2F6E47CE1B396BE2D34CAAFAF89C8 Armorer9
810,155,260 *5411EBBDA36D926197488BAFFE73974A1C6086F3 [email protected]
810,155,261 *5417AFE258D645A4FAB551D3D6A78628E36AB3FC [email protected]
810,155,262 *5412A8910BD209BD7EDC9EAFDBCA872C2D39E21C Armreifes
810,155,263 *54111280364B2EF563D4AE32560AE5EC916CEB65 armstell7
810,155,264 *541A45F09CC3EECAED5901FCE731070D370304C8 armstrongsorochan
810,155,265 *541C9F687D23F6B3D82EE8901A4D63DA4542F299 ARMTEC AA1 R M T EH2 K
810,155,266 *541DDAC6D33D4BEB05F4889F91A92A9172CCF57D ARmVj
810,155,267 *5412722355E7F52DC49071018FBDADC0B789E648 [email protected]
810,155,268 *54122F1BE1087F8872CA89104B9EF481A952ADA1 [email protected]
810,155,269 *54155FCE6D2A6920315579354717FF2F69F1D081 A:Rn(
810,155,270 *5414FA2EDDAD9F78920CEC06D3A6C0EE5D00AC0B AR)n#
810,155,271 *5419D4BC7A4C4942241E8D7DE72150E80CEC5BCD Arn4F
810,155,272 *54150BBAACA4F2EE1FE77C3CA89996FDBCE1D1CF A+RNA
810,155,273 *541F65767E033C2A7DA0DE4561D19853DAB6CCED ARNAA
810,155,274 *541D87F93957D7B0460055797CFF7B2EAFE89D2E Arnachos4
810,155,275 *541EFB997EFAB99DB0474FB5C1DCB5B8059DBD49 Arneetiued
810,155,276 *5417922F7F7C6A4D8DC897B982F85C6A4695DD3E arnelgeneroso
810,155,277 *541ABA32A0C886154E0E5AC6C28D1DA52840800B arnellecoetzee
810,155,278 *541FC3412EDCDA22CB0F59D283F224E70DAFB457 arnel perina
810,155,279 *541DC5BFD3EFD5A1066E14A6462D0AA764FEE368 Arnestine4
810,155,280 *541131AAC169D01848337AC07D25D78ED981448F Arnettek7
810,155,281 *541C42613A48ECD3F316B6E5C4F10697D506A079 ARn%F
810,155,282 *5410538D6B3AE2DB533D9C241E92FA9BEBFE6C13 A!Rnh
810,155,283 *5413DA24F45147E5B019B8A920E22B2976678FD8 Ar!Nh
810,155,284 *541B6B913E06CB7BBFE94345C124003D45D0FA2A Arnicaed0
810,155,285 *541D0ABD51F64775D970A3BFAB78626B0344C624 [email protected]
810,155,286 *54142C12EC30D130A36834D25583A374189E2B49 arnie padilla
810,155,287 *54110391BE839A0FF0A2E895457C15A931E580A0 ArNMp
810,155,288 *54108B4A93F8FFD0CED6BD9FF003C521CFC68BEE arnoldarizala
810,155,289 *5417D2EB98F103AC0559EAEB89BFEA4DB581D064 arnold.barcello
810,155,290 *54139FBEE2DAD3849AC9031D5965C2074224797F arnold.bemer
810,155,291 *54191E8215E676804B791248673841E6A8E9C027 arnold.brunkhorst
810,155,292 *5411CE10482E9DFD614527F3D30CB5F3CD53080E arnold.burbano
810,155,293 *541146577D3E11BAC888B299ABACE0CFF7C9510D arnold.dorchy
810,155,294 *54145EAB67797FCC0ED97B3E5A564673D53A94D8 arnold.edgerly
810,155,295 *541D44DA8FE064BA73DF9A30A2B7B1629527D791 arnold.formhals
810,155,296 *541481A65BD13C38F1557F2E82E78E42B66327B1 arnold.holsinger
810,155,297 *541D9C1323DE3A8E39D82572EF9395118DC30843 arnold.jalbert
810,155,298 *541791697ECE8BD7F8971F9D3B4182A370F1CE2A arnold.kowall
810,155,299 *541CC3A11C709916D1914374C7E55D2C8904B726 arnold menez
810,155,300 *54105B0B6142DF79FF07A91A8A88D7E0478D7B8D arnoldo.acy
810,155,301 *5415E4344DB0D3BF03C22B31F1F23E5C7DBBEC12 arnoldo.allessio
810,155,302 *541CE87B086D57BD803ADEF523AF5FBA2F73782E arnoldo.cologie
810,155,303 *541B4E3078024F88D08AA3EEF24DD3B370D1ED20 arnoldo.coonradt
810,155,304 *54104589B1BD85577F0136173D0B4346B87494F6 arnoldo.earnhardt
810,155,305 *541F1803F4E2102DB7A0515B6BF6CE49D2ED197A arnoldo.gasiewski
810,155,306 *541428B6D3DBB95BDBF7B313D28B87DE31293E14 arnoldo.hemon
810,155,307 *54193B806F72EC7EB7F9D25F9C24C06CA036085F arnoldo.hootman
810,155,308 *541EFECCE54ED9662FA6E0F4094562FBB3596EA3 arnoldo.hue
810,155,309 *541BA3F5464C66C662164E671380B82196EB7228 arnoldo.langowski
810,155,310 *54149907DE14E35E5739ECCA6F1B8854FDC991BE arnoldo.loduca
810,155,311 *54116BEC8352A2582F8500270F93692401B72A64 arnoldo.ludlum
810,155,312 *5414B16B3B324CF1008C6A2FAA402F911587BA49 arnoldo.mcduffie
810,155,313 *541CAF622DF9A24BD7CFDA5C749D8D2E454EE5DE arnoldo.mikuszewski
810,155,314 *54166DCDCC5F1C1C75CF61CAABC07806D99CC721 arnoldo.plumley
810,155,315 *5419C6C2B7851D33C7BA8FE52C15A64AF9E21799 arnoldo.radwanski
810,155,316 *5417B67F50C625CFB6D66EA0E15DAD57E4ADE37B arnoldo.rueda
810,155,317 *54145BB78F0B3F7C03EC07AF2D433BFEB54F786B arnoldo.salandy
810,155,318 *5413F6123D47918098770D6E45208FE4D528B092 arnoldo.septelka
810,155,319 *541109E9F0D8A4EB43850BCEEB19E5B9D259FBFE arnoldo.shellman
810,155,320 *541B73470E1083CED15790F4B11E194E0B1ECB28 arnoldo.snipes
810,155,321 *541EFA6D81A1B7EA1BCA20589A793A15DE933D23 arnoldo.spinello
810,155,322 *5419B14E7EC92305DB756D92050BB3CEC63CE676 arnoldo.tinn
810,155,323 *541B2E145710D638950DE919B108D440BC85125C arnoldo.tisch
810,155,324 *541DF4CFBB459E2730ADD3E7E4E39C1CEE559412 arnoldo.velardes
810,155,325 *541B762C655FE0929F7221D58C3740623A73934C arnoldo.wichman
810,155,326 *5417C4E4BD4AE36127E2369D5C259DC73FD0EE98 arnoldo.yaden
810,155,327 *54195651771BD11C6A48EC842B795E1E8268358A arnold.purpora
810,155,328 *541FAFA1A9DF1700CD5F3A006FC09986D0305CB9 arnold.puthiyamadam
810,155,329 *541302597385668C5559B1CC1C5F0CE568F2E797 arnold.trachsel
810,155,330 *5418BF80B537A2928747C35D2F18EA9DED6FBC25 arnold.vancil
810,155,331 *5414BD073586EEBF208524AB2D24023F5BD30A01 arnold.wiggens
810,155,332 *541B36C53FEF5217E8C33B3939DE2F9DD6D4A899 arnoldzikach
810,155,333 *54195E41407F29FB946DC479C94578DCC91F95D8 ARnoP
810,155,334 *541E866CA735497E3469300EAA53C664CD36C898 ARnOQ
810,155,335 *54166A9F34E93D994FADC2F361A018D9BEA4BF26 AR,nP
810,155,336 *541991626112213DE3EB8272C4A61848148B8878 Arnsteen5
810,155,337 *541499EFCB3A542587EC961B479A816E758E4F66 arnulfo.bazzell
810,155,338 *541CE2C7FD64DE1293DD814FB95B7BC87CC58A58 arnulfo.bednarek
810,155,339 *54116D9D80CDF07BEF62C137EC745D39993509E4 arnulfo.braggs
810,155,340 *541ADAB31F52DD526E9AAC09FFA6C876973FA7FA arnulfo.burby
810,155,341 *541E3F0245BAF8C3E075BF350104CA985FDF1279 arnulfo.callaham
810,155,342 *541FE8E4009E0481DDD82BD190E6F9DFF5AF8994 arnulfo.conoly
810,155,343 *54187A68B0BCD41CA13D0EA40EE7BA1063CB3007 arnulfo.ferullo
810,155,344 *541B9ED6D0390AD7158D925AF861F316F5A98DCC arnulfo.fortna
810,155,345 *54174876F8904025B89FDA929D2CD3D815C74E58 arnulfo.gaub
810,155,346 *5412AC3FD63881F2153E660F18299D28BFFDE2CD arnulfo.guijarro
810,155,347 *5416CCF91C2F476D5270EA2923AF1F38D4D2DC27 arnulfo.heuett
810,155,348 *5418EA14AA63B567C93EFB2E5391D03F92203E9C arnulfo.kirsten
810,155,349 *5410DDCAD8869C255C5AA84D9FC6D67ECD7C7985 arnulfo.matarazzo
810,155,350 *541111B69B01D0EBB99A5F3983FE84D81C548003 arnulfo.mathys
810,155,351 *5412154FB78A78C5046A4038AB91EA6AAEF85048 arnulfo.plover
810,155,352 *5411776D592A5D0B6D919C7EDE99271212D60617 arnulfo.prichard
810,155,353 *5417F5A56F3932085B23672CD2599E5C7EF26AF7 arnulfo.sholty
810,155,354 *541D1F23AE5B367448AD6EC7764B0A3253EC3AEC arnulfo.sippel
810,155,355 *5412EFDED5ED6A5FB4DDCD62A931A797A13BE995 arnulfo.uutela
810,155,356 *541F9EED42EA1869F3FA7C08360B6EA296ABF6FB arnulfo.witmer
810,155,357 *5417F39B09B7979E9236884492954D7EB241491E Arnulphed
810,155,358 *541127927FEDC863666546749F5FB4B20C39D3CE A%R/o
810,155,359 *5413956A49FD59BDB84190E75ACAAEB7E924B986 A/r+O
810,155,360 *541863B0C5B9171047CDA7B0A0ACDB825A4828F1 ArO$_
810,155,361 *54100600C0432BCA5A7E882C1137CCD7E6DF7F9B ArO
810,155,362 *541F6917BB711BF7E5628F3E2F2B5A090ABC6D31 A$r,o
810,155,363 *54111CC47B09D87FE2DADB83B02EB349D104EC56 Ar!o"
810,155,364 *541A9AAA2BC52C18985C46348913507BCCABF6AF ARO00
810,155,365 *541BA5BC661A1855B84350430FB7DEF01329538F ARObr
810,155,366 *541FE5CFFA6F7957D5B49F5D6D78869DB2475657 arodyroc
810,155,367 *5410874B478CD8F800CDEC5B163CA6ECBD9C217B aroemihC
810,155,368 *541BB4195AAD3C37009F3F1FEC99FA007F50678D AROft
810,155,369 *5411ACD1741E324753BE4DF0686AEA6EB94168DD ARo!G
810,155,370 *5413C9BAF8243B839CFFE87EE586E01B8730034E ARoi;
810,155,371 *541767C9B87BF53EE63622BCADE7E0EAFEB6B1DA Àròko
810,155,372 *5419718A1A53BF27A2BACAE3AF71EE2099152E1E aromanizations1b
810,155,373 *5416BAF10A4519BA2EB3B80C69CD4D9142FF3B28 aromások
810,155,374 *5413A3BCF483CBD1A6C915F0DD18314B94CA7551 AROMATISCHE
810,155,375 *541C1D38CF755EEE678C3EC78C5F8F44DF1F9D59 AROMATISED!
810,155,376 *541155B7AC10A8792B73FEBCA64D2158C84EC152 Aron271
810,155,377 *541A1D0F07A680834D379A76B8DA8876A94B8C7B aron571
810,155,378 *541258498D3217CCC3F856FED8243E30E197C286 aron.ballina
810,155,379 *541A630F9C836F8D6260FE2C7F069A35B3ED3475 aron.belarde
810,155,380 *54107044EF26622CD5BAA17662B575E723D69B4A aron.bessemer
810,155,381 *54169F6802EA0CA2321D1830A160EE99FD20B136 aronbsw6
810,155,382 *541BA79ED11FCC350B722EEA63D62570E64783EE aron.gallentine
810,155,383 *541DA79653EB7E4602022A41025BD60285B7B821 aron.grima
810,155,384 *54173A225F83C1CF9C75FF1249001C82A750EED9 aron.grossberg
810,155,385 *541379FECC8387D8586212B1453FE6EB6F14064A aron.gulnick
810,155,386 *5414D778BBB4683903C065516BBCAEEC2AF4F466 aron.hashmi
810,155,387 *5414D9E07C10B2B4C7B954639EC8D87C3FBA98CB aron.hintson
810,155,388 *5412B1DBB138C4BAD019F6D495C525A8053115AE aron.kasinger
810,155,389 *54187FBBA66FB7EDA7EE9F3D8230FB7F651F3041 aron.kempen
810,155,390 *541C878C1E74E56AA3C498C31FF649C4C2A054C5 aron.meidinger
810,155,391 *54167F222ED46CE45E0851C711E2C911F8EC059B aron.mottet
810,155,392 *541868A8F92DC107171119763F8F7FA530FEA33A Áronovci
810,155,393 *5411A4D7162B1B4E7ED86465EFDAFDDFE854035E aron.quero
810,155,394 *54115F388D9FCBB6CBB628FFCA6A5DA66D964264 aron.rasul
810,155,395 *54197660356264CDDD9BE1A470EBB284115829FE aron.reindel
810,155,396 *541C750FC86390705AF0FE13F4B2804D4372EBA8 aron.rittenour
810,155,397 *541C6536C91ADFDCF463BB29BFF5D52029024AFA aron.salaz
810,155,398 *541572D78A31CCA47C5A492D65E5D0E66BC752C7 aron.saletta
810,155,399 *541F2D421A24E7D5BAE4F4AF9CECDB2D58DB1F0C aron.schleusner
810,155,400 *54164C69D5DAD40601D69AB97DCE949D5532FFCE Aronsfeld9
810,155,401 *541347984E91488AB4B44FD888F758FA3DB9D819 aronsonleonard
810,155,402 *5411DEB2A40735EBE808861962A31C921430ABAB aron.tagami
810,155,403 *541B37187E838C8FD1882B411A65FC4013FB5C47 aron.tyndall
810,155,404 *541B1C2B5006F032F77905844FD48A58BAB45493 [email protected]
810,155,405 *541A1A23E6E619C52DEE4B8B1534A7D9434D7438 Aroph.
810,155,406 *5415579719625FF92F1871E1ED8D352FC3095E6A AROqQ
810,155,407 *54181ADB2A90B3EB9EDCAF770462ED84A299E07D [email protected]
810,155,408 *5410A46236BD0B763378ED357511DF7B92F87C80 Aroum
810,155,409 *54145F3FE1644FE036F00B8BCEA940B924903B52 around.12
810,155,410 *541A015E8B5C1CF50666276F3A43B9897A69403A around》3곡이
810,155,411 *5413FA1297C7FE804CBED7F46DC73128E18AE4EE around-the-nation-pittsburgh-judge-halts-mortgage-foreclosures
810,155,412 *5419EA51BAF8D64528A80A9423F2D7ADE9C96415 [email protected]
810,155,413 *541B45B85AD7FF4809BDA0ED3182069B8FDD3C4B arouspe
810,155,414 *541646F5F7529DA82D151788C4184974C63C6B3A Arovogop
810,155,415 *541EE71745E19152A01233AC80ED2A6781F04938 Arowaksing
810,155,416 *541B260E7F6526A73818548A1C273930F65A7D4D A!rP%
810,155,417 *5413E0FC878950F41C077542DF96E28B9BF0F82A Ar"P.
810,155,418 *541F4D98678F41F22B22FCA7B36B5C283B0E4B2B arp2600-noisebreak
810,155,419 *5416C4EB173A1FC60F89CEEC013A6E38988AF3E0 ArP3$
810,155,420 *5414B70CF20EC7B7B0D49127337BB5F02AAC1FB6 Ar"P6
810,155,421 *54111FC5B7E80C6BE527A8553B680209486D912C Arp9e
810,155,422 *541257C45F053CF24579A8BFE34D93DD4803D700 ARPAINGS
810,155,423 *541DADF98BF9EE7205E926185938726E7AF0245D Arpellehs
810,155,424 *541E79397C6A9C2F70807DC099180A49450EBD29 arpentaises
810,155,425 *54160E0684DF52C1D760671CCDABC36FE6170C45 arpetal1959
810,155,426 *541B810FC2332E24F38FCB520117154137C060C6 ARPGt
810,155,427 *5417DFB10508B0A54F908A2394DDDE679E9472DD AR!ph
810,155,428 *5410ED36C03E6269C60272B898558CB341BB12BE AR&Pk
810,155,429 *541FE441277D51D76E326B562A2F3A024B7DC2EC ArPk#
810,155,430 *5411A6912320195F0A7583B0B4F3B31E42946A9B Arpmorro6
810,155,431 *5419023E2D53B01724E46FC820667CEC427FD84C arpoais123
810,155,432 *541A54342426222B09C03FDFF687607DDDEF402F A
810,155,433 *541DE19DF70EAD6AD952A59BDD067C25C361A0C8 ArpSg
810,155,434 *54145AEAB6025CB48A8EF7C611519C9F983D48A1 ARPVRKJL
810,155,435 *541CBD8C9D4A26B841D77BDF36B9C5139F8AB5BA ARpXV
810,155,436 *5416B6F3ABEEECAAA1C4A5AC88A0FE5041AB227B AR.Q.
810,155,437 *541C6CEE1081F3D674547062952677DDF2DF1F63 Ar.Q;
810,155,438 *541386EE1E482ED20ADA5ABDACE3A8131BB8665D Arq5oMTKbdHq4VI
810,155,439 *541FBE65EFCA7B47AC60D930544E7F9A95810257 arqfp
810,155,440 *54140C002EAA8108CED3D678BF4E685ABB29D851 ArQlD
810,155,441 *541A1F9082F8B420A00470B795CC94FC14F13E70 ArQP5
810,155,442 *5412DFFD1125A1589DBE7C9293F7A03920D7F993 A"RqV
810,155,443 *54104579FEEC69B021D88BF6AA49F18E26BECE10 ArQVM
810,155,444 *5415A7B77EE841D18CB6599BBDF7A53D5D6626E5 AR))R
810,155,445 *54115DD84D06C1CC4913B6BC6C313057D3E617A3 ARr$"
810,155,446 *541DA6BADF36AA8AEA993DB88131C5ED3301897F a+rr
810,155,447 *54156133BBAE75BF4841402EA441702B263846A3 ARR0n
810,155,448 *541AF19BBB113A78DD6DC8532FDC11317B19ABA5 Arrã
810,155,449 *541AD78216FE24C91904B23834792D704EF29818 arraarvos1
810,155,450 *5411D9F26886F585E3DAF07A4E7A14256D69DE7E Arrageen0
810,155,451 *541E91883E1B986BDEDE11EAA2512ABC818CD925 arraghit
810,155,452 *541C83C7BB39AAE284B8F9580F999A86F5C83F6B Arraicsed
810,155,453 *541BDEA4804E8DF2BACA948D6D76666D5F31C05D arrangement.160the
810,155,454 *541F9C2C5DF24DCD8471EF0423541521FBC3D1AB Arrangezs7
810,155,455 *54157185322C383E51FC165F5A5A58E44C368BD7 Arrasavams
810,155,456 *541642D0F46CEB4644BE2730B794D0073E30F3D1 Arratel?
810,155,457 *54155B928DF777E7CBBD658BB1F46DA10D7CF952 arr-at-um
810,155,458 *541D4C38C48FD92FC52D5E18715E52885C7293AB ar-raysamin
810,155,459 *541DE9875CC4E9482071C7674EBE365A267C2AFE Ar%rd
810,155,460 *541110A4B7888B315844A343BB75610AFCB0589D ARrDM
810,155,461 *541E1A011C75F2B685FF430D8DE58160C69BB8E2 Arre8
810,155,462 *54183EA935BC88D76839F8DFFF1CE7E0074E83FF arrebanham1
810,155,463 *541FBA3194B85770465372F84901BBB0201EF93D Arrebatos6
810,155,464 *541EC17F4A4D1F4D6CDD672209E5EA1660ACD3C7 Arrecai0
810,155,465 *54125ADB664A1A6857FEDE6A170179BE03F8CD70 Arrechis
810,155,466 *541F39DD8CD157A8EDA295483471546CF1FF6F7D arrentat8
810,155,467 *5412D1D608540FBEF7F63D43E9801572C6C64545 Arrepiaring
810,155,468 *541F2627C4356862B6D29C0D9D7BBD82F03B7D4F Arretaient!
810,155,469 *54102E75A2B0907AC93C9707BB28A728ED6F29AC Arretine3
810,155,470 *541CE07D07F6D57F7F946702FF0E63F828DBE179 A:Rri
810,155,471 *54173A0366F1F6B1C374C5E4F7C0E49E114BCB30 Arribako
810,155,472 *541C269977E2A3AEE4D2F9E74353207FF5F49C00 ARRIE`RE-PENSE'E
810,155,473 *541B708F36117440CFB878B534EC8A1C4ED9F6AC arriscarias123
810,155,474 *54106DF35AB997A1E943310A072D57012CE26144 Arrisia0
810,155,475 *541ADA6D3FDF41ACC606D82CF62BF72522B2ABAA Arritt
810,155,476 *541A602720D53BE6962A73281E8CA83CBF3EA9B5 arritz
810,155,477 *541C785772F3FDA48EFA6B8DFCCBDC904A402CA1 Arrivais2
810,155,478 *5413AE49DA9168818B4329BF3311438FAA376EA9 Arrival in Fourths
810,155,479 *5418973AB44AE3B6EED1DA79B8551F746EC67D54 arrivassent
810,155,480 *541355D8542DE63A81EA589A1000356BD362FFB8 ARRj8
810,155,481 *5419911C1104A6F77D6A1EEA1D26D9FE7806CAD3 ARROBAZEPPELIN
810,155,482 *5411C67798A0795D29DFC4AD830D54102160CBEA arroccaed
810,155,483 *5418990184C52EA4BCB895F055A0B95A20E6709F Arrogadoses
810,155,484 *54100C070615B909659E9B187F25218D90377A8B Arrojaras
810,155,485 *541CD7471B20EB508B1E0D0920F1BB4B67BEB35A arromangats
810,155,486 *5415BD3D961CB6E5358B3C81BDB7325018E8BCAB arron.alimento
810,155,487 *54183A364AC23C82D5E45ABD86A788FB2D007C77 arron.ambeau
810,155,488 *5412D1F984F69F31C49BD87046E2C038B7F74A0F arron.arana
810,155,489 *541920DEFFB789B9250904895A930DB917E4FD23 arron.arribas
810,155,490 *541D389AF350D691796BD7511C8C8C5918CFF5EB arron.biros
810,155,491 *541A2E97BB9594CA065B29CE6FD159FB249A108F arron.cahillane
810,155,492 *541D5E1AA85DB6EF4D73DE6ABE47114681CD8445 arron.desantiago
810,155,493 *5411FB22480E85229BFD6B131D14AF75211EBC88 arron.fissel
810,155,494 *54130DD7A9E67142EB6F74F1DF044B8887203347 arron.gloss
810,155,495 *5417F6172A5DBBB044646ECDA627A9D124E839F7 arron.grantland
810,155,496 *541AA9A77854A2A510A8B3DD3B032E8F2F6BA4B0 arron.hinkes
810,155,497 *541B7128FEFBBC2BE8BE91B081F92200CF0BE938 arron.magalski
810,155,498 *541E77E96D0CC908666525E86916AD0ECEBF3658 arron.manivong
810,155,499 *5417F2452DC8CEBB483B92861F5EFB9F952F5111 arron.mengle
810,155,500 *541EA6D7A37CEAE384F3BCD651FA45FAEB2B1D68 arron.nieng
810,155,501 *541F5868D50257A80C372397EDA798D736BF8914 arron.novo
810,155,502 *541CC2A0159C6F8BB5CBA558834BD6AC51A2A7EF arron.ostroot
810,155,503 *54146905B6635C752F726D9831C3A691FC90A659 arron.pellegren
810,155,504 *54178862AA955EF824A6BCA796BC15746EF01612 arron.rill
810,155,505 *5410D376CF55F700BB838D2A89AE868B43266242 arron.rousu
810,155,506 *5410E986F423CDE31A6C8D35F11FC772EF44F75B arron.rudie
810,155,507 *54173837620D9C8CD9965C21EE59D5989821B8A5 arron.sarinsky
810,155,508 *541D5115FC0C4968C17D5EC31AA0AC42650F142F arron.serasio
810,155,509 *541E927FB207E1C006D77B3D89CE83829E2770FD arron.tummons
810,155,510 *5418F00BAE5FB729FFD32527B7FFC74E673FC37A arron.twardy
810,155,511 *541A405E9AED666C917BDF365AF1DFE30D4A7046 Arrotatis4
810,155,512 *541B50C593AC9602767D55AE21D77005B735722B arroxearias1
810,155,513 *541276C4281A0AB767B5E143E7D4FF44A53AC433 arrozchaufa2210
810,155,514 *541EE1050D032194E76C613E29BF51BABAC92680 ArRSK
810,155,515 *54128D4373DDCD529D0BAB60F8E0ECC582F391AC ARRt(
810,155,516 *5415DAC9ED74D3EEFB9E58F715AD0BD52575DC75 Arruara3
810,155,517 *5413973571255B709835AB6E31E2D619815571A9 arruda、通称:アクセウ、
810,155,518 *541FDD9266986169C5B2C49C5A5C3D7D683635F6 arruinloei1234
810,155,519 *541C32873562E48182D69431718BEBAB6BD9208F Arrustad4
810,155,520 *541F1A3F001F5680379558684AF665FDA02CFD9C Arrw:
810,155,521 *5415C6B54F40879A0B41BBF597FAC75D3696DF88 [email protected]
810,155,522 *54121CDD724C7366900BFEA0707259BB5615CCB3 A=RS&
810,155,523 *541AD90E3D707970BF8ACD926DB99028B69D7A12 ARs2H
810,155,524 *5412A79D01EEA585385A2DDC557E8E72C4F4D977 [email protected]
810,155,525 *541CBD399853FFC25D1FACD2FDF9BA38A31FD673 Arsarbet0
810,155,526 *541AA7520E203F74206CC1EF18B94EE6D5FC96B0 arsenal_f.c.ownershi
810,155,527 *54136D6B194AB29810841B4C22E2758927F311D9 arsenenom
810,155,528 *541F867C82227371DE49EB09EBAD29AFB4678174 (ヒかぶつ、arsenide)は、
810,155,529 *541F2BB5FD947E7077B5BDC82F9019C5D3D555B6 ARSENIJE123
810,155,530 *541BBF87BCA7FE89D539907513B14C03D331AC83 Arsenik1
810,155,531 *54126D16CA4561BE758A14162B432D329B71EA38 Arsenvergfiten
810,155,532 *54195E975650EB91715635233EE47EE5F2BAE0EA A:RSg
810,155,533 *54118F39A6FCB449101ADB30F9A342811B13D464 årsgaranti
810,155,534 *54117CA13F9B9E9CC0EE98850E53D588D3084501 arshaddan
810,155,535 *54195B2FFA78017B17C48E7C835B69C87E68ABA9 arshad farooq
810,155,536 *54120F169FFB0938122A73D942DE630E7E29E70C Arshelia1
810,155,537 *541DF1939BDDA170E8F47EC1AEB4FB7925168961 arsidas8
810,155,538 *541E2FFAF58614CE54D0C72F1D90E50B862E726E ARSIENNIEVA
810,155,539 *5410407CD07CEC9977D57148755E16449CB3DBF2 Arsonsiaed
810,155,540 *541F885235E8A48FCC26DD9D065BA6AAACB252B2 arsqbb
810,155,541 *54133B857B1FEDB0F216592883DE8CFA8778205D årstadgelien
810,155,542 *54189317812A67E3DDE7B93A95B7EF557F23F37D Arstrengging
810,155,543 *541E9CAA10AD54BEAD89BFB455D8F4BD54D1A9F4 A:RSu
810,155,544 *541079CBF9FF1D8FE541FC557EFA54A647EB186C Ar-T:
810,155,545 *5412FA19C7E32BD137B826D038B87309635D571C A:r=t
810,155,546 *541864611AE79B1F6D0636437B6C89B8C69F6574 art00073
810,155,547 *5415B9E4014BF33F2106005B33F6ABC81EB31AAD Art1f1c3r
810,155,548 *541AD2A62D219643D164EEC0E100195824F766BE art2006052612381958670176
810,155,549 *54105C9D25B3FE7925FDC6DA2B4611BAADFE1692 Artaansa9
810,155,550 *541872601AF3BC3091835A1F1F11B89C79C04DF8 art armstrong
810,155,551 *541B2FD2EFDB1CF2B2390E70D5063335D6CEDFD4 ARTASCHAT
810,155,552 *5411EDFAF787D517CB3FBCD8E75FAA33DF6E9603 artavazd123
810,155,553 *54184ECB4E1B507C08E2ACED291B9C8D1752626C art.bidwell
810,155,554 *54132EDA9E2C2378E6AFCB23B2F0B0C0312FDE29 ARTBYLUKESKI
810,155,555 *541AE038ACAE38D79B5B70857BFB4AE5899A2A31 ArTc,
810,155,556 *541DEBCF13A3652E14E3A376389C7E9057ADED4B art.chhan
810,155,557 *54104445E1386478970C8E85C19F75FC7EAA8F63 art.czwakiel
810,155,558 *541A7BE996A9D8FE568B100064488453A31EA554 A:Rtd
810,155,559 *541A7AD2529150E2871968BD68DBA0CBF0CF5064 art.demattia
810,155,560 *54159E56B4EAB09C94CFCF74074E8F656F437B5E art.dyal
810,155,561 *541697E18B406DB3C2A8AE9407334FFB2EECAB63 arteaula
810,155,562 *5417A23951CDA72EDBAF3FBC57B4D8D5965BCC86 Arte e Manha
810,155,563 *541EED75D5CE24800FD00FBE5D18D8AA48A212EA artefuckto
810,155,564 *54181D77AA0E777581A4FE166153C141D32F50D7 Artegraf3
810,155,565 *54118D137219FF23699B09DDD02F07D3CC9031AA ARTEKLOP
810,155,566 *5411A4B6ACD112FCB554B4AFBA7A85848DABE08F artemis, die wundersch
810,155,567 *541F8D667CE1BD84281B8236E433BF1CAF63EA86 artemisi0
810,155,568 *541C95AE2B4A37857A4D6FA20E988561D292BDF1 art.emmond
810,155,569 *5413608084C2A1F5A2E1C4C35500E0ECDC110997 arteriagra5
810,155,570 *541EB9ECB37D5F842F2359E09ABCF4018E63F84F ARTERIOA
810,155,571 *541D7E43FA86273BB4AAE08A97B9178A4F7636F2 ARTERIOGENESIS2
810,155,572 *541CD6C0FF57D0F2AA8606934E676B601BF5A00F ARTERIOPALMUS0
810,155,573 *54182EA69A7F993F7AE6FC5D7A2877C3757BF31C [email protected]
810,155,574 *5410272B21C42046E7DE9D5E209A38ED3DCC1CF4 Arterlhis
810,155,575 *5418E62AF7A3545B64BDF4FABB3CA474BA842F01 artesischn
810,155,576 *541DFABED6C377245EBCF5E8F1567EEB5DD0C207 art.fiora
810,155,577 *541443298BA3391F7160FE7345CAE277C9D48532 art.gambrill
810,155,578 *541F90689617478C3BE6C439510176C383AA4163 ARTGROUP
810,155,579 *541E6A677115D987F5EBE58134E9E3CE3A216EA4 arthasking123
810,155,580 *54114CFFF8A60254D3F80A2543AAB9E5DC9FC926 Arthasról
810,155,581 *541A96E40E9E65EDD6E51B9CC34DE388D19FB0F7 arthéma
810,155,582 *541A71433555CC06A81CFD8E4F13496B13ED4845 art.heyser
810,155,583 *5419507910AFB2D4A4D6F3D4F635B8BD87BEAE03 art.hilbig
810,155,584 *5417D1A79FBFA0E0823757F8E4CEB98B6508F00E Arthorned
810,155,585 *541E5C3FA1AA04FCE175FC1BE8A51D1F2D3A50CB arthrosporous0
810,155,586 *541A6EAD7E794071FA17B8CAF796C43A797642C7 [email protected]
810,155,587 *541A3E315ED7760F44855A565975B6B6167A14EC Arthur338
810,155,588 *54139F4EFD165F6825A93456E4F304FAD3EF7755 ARTHURANDERSEN
810,155,589 *5416EC9FA19BF48D17AEC3D1538DAB4BEDC4F730 arthur.aston
810,155,590 *54158C6AAC7DD8E32B92A4B80EE66CBAB39754C3 arthur.azzaro
810,155,591 *541B2892006194D3E54C60660BAF625E4712D7CE arthur.beltran
810,155,592 *541B36EFDB48F7A5179006D5FAED4A04105FBED5 arthur.berliew
810,155,593 *541CAC2CCC9483F6B00813A06B1DA8A7A32CC4ED arthur.brunston
810,155,594 *5416A0B81C74B4E4FEBAFDDC52CAE6D038B227C2 arthur.bulgrin
810,155,595 *5414D3F5658E62EC975F523E6B7D61589F9CD389 arthur.desort
810,155,596 *541EF2694FFA0EA24B2D42778BC43595EBCF548A arthur.fandrich
810,155,597 *54146A83D2853212F2A397ABCA17BCA12A324F1A arthur.giampietro
810,155,598 *5417948BEC160820317098EE458333A679197D69 arthur.hanigan
810,155,599 *541AF4B2F52E5D7D2E3B4CD8707036BFE38FB0C2 arthur.hodan
810,155,600 *5411DB21E79117C7C302A009055030FC6815CC7D arthur.kwilosz
810,155,601 *5414FB9C8C7672A18DF73125695806A822934BB1 arthur.labkovsky
810,155,602 *5418FE44CC93D03DCBDB46E8348A26597E1F6078 arthur.mullick
810,155,603 *541520586CA9027CA174E5CBC6FACC9F8BEE971C arthur.muwwakkil
810,155,604 *541D544502096D51E4DF1E2487771F14BE6509D9 arthur.pleasure
810,155,605 *5411B12C6E8890B470D53C1CC7BB7E6A82A41A4F arthur.purol
810,155,606 *54130446B954D9E0421F5226BEACF6570E838D3B arthurroa
810,155,607 *541F01F27C9423724A4E5BBE0149BA0926F26C68 arthur.robison
810,155,608 *54117B36EA0611E81D600FA685CA6367B9480534 arthur.sakry
810,155,609 *54195F47FFD46EEA96B6E81C9AD3A5B609656358 arthur.santaana
810,155,610 *54119A7F1D2D72D5305CAEE4382A2542474F80DC arthur's legend
810,155,611 *541BF610412FB538D7007C6D344A211622D78E99 arthur.sowards
810,155,612 *54111EA4F08C41AB04919496FB21A96182D59909 arthur v.
810,155,613 *54120B4BDE3FDCD625F8DFB883C715F4F4F14087 arthur.vulich
810,155,614 *5411F46A90682193E263065A1981CE9B92522D52 arthur.zollman
810,155,615 *5410C820D0064FD0B69760AEDA988C77C9C4730A A(rTI
810,155,616 *5417AADD454C92F50BE830751E8621D619AC5BB5 article008870
810,155,617 *54164CE5979B195C2248430EC3E940018D7F8935 article102313
810,155,618 *54156901FF8441BDDC51736FC41C805ABD712829 article124700
810,155,619 *5418C6C651C576A3B90DA12C70ABDAB28F437024 article144364
810,155,620 *541315FD573FF90A816002FAA931ED1EB5046F3C article1477942
810,155,621 *541E42834E73FFBFB95A328937A57DE288286238 article240137355
810,155,622 *5417233589CFB192A628A0B02AEE0A8728A9608E article280519
810,155,623 *541355C747656E5CD1077019CAC010E8F4CB8CC0 article3123679
810,155,624 *5417C0FEC703F6F9FD910CDD26FDEFA692FD91C7 article3681840
810,155,625 *541168974612CE6DD61BFDA45D63ABB151304F4B article401693
810,155,626 *541F2E7E30D7E8E9D13E9C6C795A495C3CC09D2F article473166
810,155,627 *5411260C78AFB905502B085846D3D62EF7A79289 article497223
810,155,628 *541E80FD92FF862AB599939F67B58EDE531450E1 article575
810,155,629 *5414A07838EE0C342C8903CC94335272A412170E article637298
810,155,630 *5414B906CCA44BC14EBF5876B47E84B46788E34C article6562
810,155,631 *541F7C8E802581A98B3CB5ACBE860EB9A635BF4C article7204872
810,155,632 *5417E7C2177F3BE78916956EA30B360BD4148565 article81477
810,155,633 *541B1B7E623118473D78BEC71CA0C075BFAEFBB1 ARTICLEALLEY'S
810,155,634 *541ACEEA2AA92211590F3ADFCE13297BB248EB22 articlecas
810,155,635 *5410173C1D952B5AB8997F95EBBB8D1B85548765 ARTICLED.
810,155,636 *5418111CBC955755FDE062F4FA5D82BDB8E23174 articlefabrictramp
810,155,637 *54149E40F698D23DD6458AA12F4BAFF661B15B2A article.flonight
810,155,638 *541ED6221BD68894FAB79009C5DECD06A6B78F2E article.gregrm
810,155,639 *541F0C56EA3AB8378947E374A284277583942F97 ARTICLEGROUP
810,155,640 *541567C980A8FF035094B1DEDA40C87944CBF595 articlejakezing
810,155,641 *541C85C890D170C69EEEE124FC14B79D2C1198ED article-nishnews
810,155,642 *5418B3E8568DDD11C6BB567EBA7A1E619BE08FF1 articlenorton
810,155,643 *5418A6653A786F99EEA0D96900A6D318B67BF8EA articles.anlace
810,155,644 *5412CBC1F60853768B5EDEDFE6F23BE4001D5FC3 articles.grahame
810,155,645 *541CED948EC3027A8968432A254EB4C167DC54EF articlesjef
810,155,646 *54143611CA161D5E8AF02A9A7214D052CC0720B0 ARTICLETALKHEADER
810,155,647 *541FD0122FA706CE0C5F39839F7117FBF0D7BA5C articlewfkz
810,155,648 *541F17AB2AB40C22D5AAC4A55145D39ECC6CC0F2 ‘artificialia
810,155,649 *541CFF1A41F282151EDE4018E5216863D75B2A22 artikek
810,155,650 *541291201262AD340DD076C0E2B3F1C5819411D5 Artikel33
810,155,651 *541713CBB482C9FE98DEBC641C2D2A2DC526904C ARTIKELSAMLINGER4
810,155,652 *541F737319E36D1AB280D2824F4F9B22DDA735DE artikelwuesten
810,155,653 *5411BE1B673CD4E02ACE5DCC3F88F0CE5F5AADF4 Artikkelillakin
810,155,654 *5411F153B9966F2E1F3DA66F3844461925FD5E9D artilerijsko
810,155,655 *54189890454F671B560192CDAFB3008108744F79 Artiliceri
810,155,656 *5410948B558B9AF8EA7A929A6CC33E5CAC39811C artilies9
810,155,657 *541128A8732B68A4AF123B5AB20BEDDD38D77B6B Artilleíia
810,155,658 *5415D2C032B87368A30A9C50C936C3CC9E640737 ArTio
810,155,659 *5415F2CB4714A62921362E208E2FDB44E53E9E1C arti prajapati
810,155,660 *541EA088EEC6E6A12DC36C8ED03222376A7F24A7 Artist1968
810,155,661 *5418CF7A0D16A9C09EAC737C585AC7ADE342265D [email protected]
810,155,662 *541CE40080E4522B8A8F221CC317E7F379B9CA16 Artistalpine
810,155,663 *541AF1A1FF6128F45730588ABE247B22E980A93B artisticallied
810,155,664 *541DF92F06B63A6BF1E39EB27E29F5426723AAAB artistmallar
810,155,665 *5412FAF0ADC23404F7ABA7004DF66FB434A06C31 Artistmiki
810,155,666 *541C6F83109D7719EC05A879D272CCA780305575 [email protected]
810,155,667 *541DAE509963A98CAFF468AF449B0ACEDC000113 artistnotes
810,155,668 *541EAF86808F550E941DCAD1497039A7BB303FB1 ARTIST-PHILOSOPHER-MAGICIANS
810,155,669 *5413A14D7AE1E61C6C351C0E225F734B44979332 ARTISTSINFOCUS
810,155,670 *5411AA47FF3F3E0D22AA24634804351338EA3004 artisttalkdavy
810,155,671 *5410BBC52796BE60B6EAB4BF531615DF3E7FCE02 ARTISTUS
810,155,672 *541151B55A75D682ADADA5CEF9C577F950BBBE21 Artistv
810,155,673 *541F18518B64AAF828241AAC157E0E362EF1A8D1 artítiscos
810,155,674 *541D1ED30E85CF5CF573BF3336DCD89140F2D25F art.jarell
810,155,675 *541D1EFD6F98D420F8242B95854173FB913856D1 ARTJUNCTION
810,155,676 *54110973887E40B479F86C83D3A4104257CFACC2 Artkbswing
810,155,677 *5414E87EF3A6B8D0269FC9B2191D99E5AB953741 ArTKD
810,155,678 *54140C097DAB945486DBFEF38B4EBE3A80E9F58A art.kreiger
810,155,679 *541B3D545739A81E140A76F27415FD5C7C966E59 art.linberg
810,155,680 *541CFCEECD9CCC71AAC5DEBDD3D2C7161EABAEFF art.mario
810,155,681 *541709C932D5F9DA56DCECDBDBB93E0FA8C708E8 art.nadelson
810,155,682 *541B417DBFC13E9428248C6ACCAD9228A541564A Artnesie1
810,155,683 *541E33D0C4F219E341E36C559C7BD0456B74258D Artnetading
810,155,684 *541A68E6621CF9C38B05A9425479668BC08ABEA1 arTny
810,155,685 *5417F2BBDD2CB71F96E7669786D0FFA837866252 Artofler9
810,155,686 *541BD8285009516F7DBF4F8F1F9038C59877B7C7 ART-PEDAGOGICAL
810,155,687 *5418021AE2F5217CA7023B05FFBBEBF510A4363A art.piercey
810,155,688 *54112748279893A9744EA1A47874E7E33E4A41E9 art.postiglione
810,155,689 *5414E71C90263114009A22996E0B2A28AE05BEB2 art.prince
810,155,690 *54178584ADF236D8029B43D6E3ABE1D674955538 artrockconspiracy
810,155,691 *541F8D09F458BAFACAFABF1EE6C3B293BE7C5006 art.ruesch
810,155,692 *54150C29B74AFAA25241B1245C72EC63726E0182 AR!tS
810,155,693 *541F6416D0675647014311918BDCD8F8BBF5AF4A art.sarna
810,155,694 *541CC96D051C503B813236ADF971C89A92CE029B art.schmeckpeper
810,155,695 *541F1989E6CE5C9790EB8574D27255D49F1B1A2B arts-health
810,155,696 *541F282CE5D4DADC199A5C9501437A5354704F16 [email protected]
810,155,697 *541520A89175BAEB630FE7F80B084349E529D5B4 artsofglaze.comartsofglaze
810,155,698 *54140FD9FC75106A909FD533A2AD6D16E738B096 ARtST
810,155,699 *541E6C61A1B7BA319A795D9949251E34028BD202 artsteiN
810,155,700 *541160DF5DC83377708195A3DC6850EC9E62E589 ARTSY-FARTY
810,155,701 *541F4B5B7400E0A9393A3230C70BB3B0D2B6671E art.topolewski
810,155,702 *541EEC1B2C4553C5A69E846E9BBBB7BB814346C7 Art:U
810,155,703 *541F4CF40791582EDDDFCD0A3034D9ADDA5CC898 Årtun
810,155,704 *54145A27B2044F31804BD357F876298A4C9FC10A Arturo677
810,155,705 *54148D83C36F2E059912F971ED4943444F4E2E1E arturo.assis
810,155,706 *5415779CA5ACF58177A16D50BAD0AB9C296F7538 arturo.balian
810,155,707 *54133A0D0986EBFA03131F450DEA9A0AEEA5A273 arturo.blatherwick
810,155,708 *541CA4F20BCC1965D057B525D492BB924D072798 arturo.coltrane
810,155,709 *541F906A4BA1E7550B3EB282669C01AA1EBA4BEB arturo.dallesandro
810,155,710 *541A2AAF5796454BE79C5B10823DD842A0F5A6AD arturo.deed
810,155,711 *54155725897E66C48720172A5F42F946FCFC9FB9 arturo.dinovi
810,155,712 *5417FDA0F7ED2A3AFCEE97923F335EE3916EFC8F arturo.eckl
810,155,713 *54155040A5D511A69710BD6ECC3C8C7E8A88573E arturo.glawson
810,155,714 *541C059F8381945A7B6EDD15FAABE0E2A465329A arturo.losado
810,155,715 *54193F75072DC293AD915A8BA7B90B5B4A1ED1AA arturo.marrington
810,155,716 *5415E6FE4DF912114AA31A0038676729395870AB arturo.molash
810,155,717 *5419875C301FAE6B2A2FD9EF988D0B6B0F069623 arturo.okrent
810,155,718 *541A11C2311BF997ED362691122FB1AC7FAD1112 arturo.paley
810,155,719 *54166A9FAE6D81309F037E32EE553A4B7482CF4A arturo.palmino
810,155,720 *5411ABD4B552A410BA6292A63A6F78CC8F2CF1B0 arturo.paysour
810,155,721 *5418F2902DB5927865A2EBA5E62F7C38F55F2EC0 arturo.pinuelas
810,155,722 *541358560932DEFEAD391339F56B8399B73EB6FF arturo.ramie
810,155,723 *54101BBFF246DE649DF37263EF39B71D6F887D72 arturo.relph
810,155,724 *54178FA0DF01DAFC0F6F6BB7E8345CCC94F8071D arturo.umfleet
810,155,725 *5412E6BFF755E1AECCF9D163C828A8608E1E2EA5 Artusayhirg
810,155,726 *541B7CCA717B8B43281742B0EC8CE9A4FECA5064 Art.W
810,155,727 *5418FBD06DC313C6F59D7DD97B1BD286C7FE2A07 [email protected]
810,155,728 *541B238D29B8B9E5E9B2C5437CB3F9B3695EE83D Artworked3
810,155,729 *541813185E2F6E8003C5FBBC8CCA2141DD523AC4 Artworkn4
810,155,730 *5419213156F88A3ED4D772C09453C7972B1402AF [email protected]
810,155,731 *541EE7169067C85427F7CC9047A12577C8AF3456 Artyleria3
810,155,732 *541224004F771E67CED89B27250B8E6E4F27A5FE A(R+u
810,155,733 *541399C6709C220F456D5A2DC1A87FD7FCE06646 ArU5?
810,155,734 *5410B4CC3F98FFA3E8CB18B21FCF5A3247821001 Ar)u6
810,155,735 *541AC7EA8BB419F384225E581C84D4971D6B6CE7 ARU"7
810,155,736 *5419019D0690386D297ABD83BF3AA5B25DE7F8B8 arubagrandis
810,155,737 *54191B458962C965EFF309B33C79643D2434E813 arudeoh3
810,155,738 *541852E0E22DCF895CA3F1EA9094EB74A078470D Aruesitt6
810,155,739 *5414BF6177E09886148C0518FB850E79F9B98C0A ArUiW
810,155,740 *541405D9201E278CADD1754C722A44497FA322FA Arukanat4
810,155,741 *541D7369A1989E8B53167D7C204E7250A4912B6D áruknak
810,155,742 *541F99D1B9AB2773922ACC4D7487DC891571930C Arulapoh2
810,155,743 *5410D1746E8F94EA067E6092C5B98D01324BA5CD AruM-
810,155,744 *5419075D1141DFE2AB22BDCB227EA23F24AB8D26 Arumonih
810,155,745 *54103CBA94E6F07D5DFA58E856BD9C3D0E845B93 ARUMUGUM
810,155,746 *541BE2DC63D8D52F3C99655E16D420D3678B1B39 AruO(
810,155,747 *541E355B9342116A8568056FC7B7A49091D80A94 Aruserva
810,155,748 *54103B6839860BEAB6D213A32C115B84C8219A42 aruupatvaadh
810,155,749 *541E81A978BB93E4169FA1FBB83955658B131292 ARuWh
810,155,750 *5418D5A732C01C1C7AEF0F6861033182769F137D Aruzluded
810,155,751 *541B1F4B222D2C8DC61ECB2164A06DF9D8131144 A;R(v
810,155,752 *5417FBB27A19DB67263AF168B4B2AD1E1E991955 AR?
810,155,753 *541BFE06CBB5268D3E2658C17210AFFBEFCDAAC5 A"r,V
810,155,754 *5412B2FD083211EC2994F8694A48584FB034CD54 Ar_V4
810,155,755 *54150F5386A131545ED9983F3A6E19721BD285B0 Arv"6
810,155,756 *5415757234E0073D49DDBBE4729D0574FE9AF563 arvadelling
810,155,757 *5419D9D71B95857944F175D97ED6AB1B8409B68C Arvaile6
810,155,758 *541FD027454687006847D81F990AEA140C2AE46B arvattuaed
810,155,759 *541371AD88ED6C025B5059E91CB737D5B7370EB9 Arvàuta
810,155,760 *54153396BA3044B22333E684C4FB369176AC4221 ArVCq
810,155,761 *5412A4EF01C35BABD7F07F886A9804FEA7476EE2 Arveflgernes
810,155,762 *54168DD7E8A4F4D2EC63F6901F23627754E93A35 Arvehygiejnikernes
810,155,763 *541908EA0F78889B4DD72508628211547CEB2004 arveidas
810,155,764 *54136BA90001EFEB0A99BBA808F1838E03F2FE1C Arveith3
810,155,765 *5411F55B4F681E1A92D49B93639B895E330DAA55 arvelene7
810,155,766 *5412D3B53F078D74D6FC3494DE09C965C42DBFF5 arvida4
810,155,767 *541AE2C488881DB352301CF920686F260AB1E4EA arvidez9
810,155,768 *541706248D3A107A55DCB274C62EC11743623D04 ARVIL12
810,155,769 *541C06D8A87382E4BEC57C62677FFC75E7D9C34D arvind patial
810,155,770 *54142A4E7CCA17B793C7BF109306E40E58112D16 arvioin5
810,155,771 *541F6AACF2341B37123DF2801B97E2D4930C890E ARVje
810,155,772 *541D58896058B75A51F0CAE3FAAAD126F4826CED ArvMO
810,155,773 *541A010AC36E6D13626FC30E05CD9B63A41C13F7 Arvoisia9
810,155,774 *54117CFC8F214894E6734C509EBDC7628F386AD3 Arvonlisäverovelvolliseksi
810,155,775 *541183880B4DDE8B9B522D091E558D198237FA31 ArVq
810,155,776 *54153C2E2EEDBFA2DD4295B36ECE96CCE9769437 arvtagernska
810,155,777 *54183175B33658AEF5E6A192FDDC9DEAFE2158DD A!rvX
810,155,778 *541BA3B13E3BCC66EE14116DD6DDFE1093ED072F ARv?Y
810,155,779 *541CEDD0D21B5D990EF9A264E7622DF919BC8799 A(R#w
810,155,780 *5413E5C83C55772E52766C36694BA10416FC38DF ArW12
810,155,781 *5413AD8C9D8B7452616AC857AA6AC99065383A04 ARWBTS1
810,155,782 *541AA781D5CA846D9C9D7CDA06AEB5AC7E183710 A
810,155,783 *5415E25087074C6D110213915691D00254D88034 ärwesse
810,155,784 *5418F220E39A8873AF91DFC43FAEA1B3449F8DA9 ArWfo
810,155,785 *54155DCFD5C30BFB80C3715ECE15A28F8CEDFF71 ARWm!
810,155,786 *5419039AD9531C50532668A42884BBEF0789FD09 ArWOd
810,155,787 *541D74465F4A643018AEE24B58DFFC15BCA20C59 ArW+p
810,155,788 *5419C8AAEAD33140336B9BAEE8E32B0C36BDAD51 ArwS3
810,155,789 *5419A8381EF7B6A63E73AEF7D23F8DA0BAF691BB Arw#X
810,155,790 *5413E829E2D59F594C12A36FE2E27359E9F065A5 ARX"?
810,155,791 *54172117A975E29D3D01D30655029B776243C776 Ar_X(
810,155,792 *541A26E5F1CF308D987A9BEB762FE69D4F41A082 ARXhL
810,155,793 *5418E51408767F8FCF615AA38D497C0C27EA66AC arxivastro-ph0302045
810,155,794 *5412FD3377394F3AFD3F9B16478952A82AD8D0D6 ArXO;
810,155,795 *5416040780466C167DCDAF2051FFA8139B04D58E ArXTE
810,155,796 *541F110380062A426873F23F7F6E857CFAEC0D57 A.#RY
810,155,797 *541A0E9C1DB03F1B768E708B90D8023EB1510A85 A#r?Y
810,155,798 *5418719DA5E3F97CAB5A578E3E4C4F9724896759 ARYAHMI21
810,155,799 *5412562305D113978A7BE392706CBD0A796D3359 āryajana
810,155,800 *541299259007E1C8AC7491CAE480D8BBF545F198 aryana429
810,155,801 *5414993F1A641A70C72198CCFD3186E9D58DA731 Aryanna075
810,155,802 *541B8167445D203A0CC7D003EB4984AF8DC075A4 aryanna627
810,155,803 *5416E43BAB796913779E65A1399C3B2CEC7162A8 aryanwhich
810,155,804 *5410923998AE6FB54540DA99023FDB3CEFB1F8BB Aryastered
810,155,805 *541AB0BF107C35BE9FB64A0260C68F3B8815513A arya-thrissivaperoor
810,155,806 *54124F660F74380A0E85DB83A27031F77A116D12 ARY-i
810,155,807 *5411A0980651C0AD662902FC4C3DE27AED33AFD5 ArYi2
810,155,808 *541CB91E455F639458058D0C3B859C49F37C3DA2 arykuł
810,155,809 *541DCFBCA0612BAB08BD19562649A8D76ADFBB7F Arylalkyl9
810,155,810 *54163CDB2F72E9CFD2BD90A2AD646C587468B2F2 ARYm!
810,155,811 *5413199371A8713FE7A1FBA70F256B730AF835B3 ARYnm
810,155,812 *5419900188FFB9B3F09BD25A726B806E5BC2391C Ar(YQ
810,155,813 *5418AD5908FE341F49FD5B30BDFF92D48E29A7F1 aryrm
810,155,814 *541C8E7FAEE69205BB12EA3BCA148BCED2D78223 aryvergs
810,155,815 *54146059503C8375A570914DA88918525A0732F2 aryvethed
810,155,816 *541213FBFDAC3569502080BD5905133C134B985B ArY_w
810,155,817 *541C3D15AA28794552D88D5EA9F7420C68113243 A$;rZ
810,155,818 *541CFF748390EF3AD4E217F9C28A534D207099D5 Ar
810,155,819 *541CF45D99A0188E01CEC3D6B335CFD48EB467D5 ArZ)c
810,155,820 *5418E907ED032C9F21FC82E6A948FE7FA0F8545D A=RZo
810,155,821 *541FAEDC9D66F1F9195387B7E33A2D7A546DA6B9 Arzobispa9
810,155,822 *541312769F1EAF3E1204F1C73CD36A34CD952162 ARzq
810,155,823 *541C356D29B256B88E47B9D2002A2DCB8D36FE19 ArZqK
810,155,824 *5414989CFDD449B3A3E7B04EDF733FAC9D1CDD61 [email protected]
810,155,825 *54131DB80D2CDF93E8D574C0D8D5E39372DEA57A ARZwt
810,155,826 *541A141892C5144AE6E173A06584E421C94DC580 A,;S$
810,155,827 *54160A8118B31EBFE339840859C1FF049D4447F2 A)%S&
810,155,828 *54111A8E55093898584C009488B9580361CEF972 A%S(=
810,155,829 *5413EB747AC7A7C81E9A03872CA6947DE8472D54 AS=
810,155,830 *5413EE584CB552E83C2105F2F81A10413B599898 AS/!?
810,155,831 *5416FCD5A1CBDA859E9991265C3F1C2FB13B7C7F AS"/%
810,155,832 *541CDDE7727C78148571FBEA0D50CB140083C02D AS$-!
810,155,833 *541F323CA44DCFC351D257FCA67CF04E75CA28F4 AS#=_
810,155,834 *541ED3E9DE7DA75BDFADF2D15AAD5A8C73A25FB8 A_$s
810,155,835 *5410A1149CF93EC62987DE49C15A90DC27DD1AD2 A,=%s
810,155,836 *541858856FAED3863A2159DD06B9575C5EC9460D A;=s_
810,155,837 *541A644D0230405A10383ED8385A7ED33BD634AC A"(,s
810,155,838 *541B092E7130F5310BB4737BF091BBAB0AF3C756 A
810,155,839 *5419F5D48C1F06F004D41905C04E5141EFCDBED8 As<+
810,155,840 *541B53E97F1525E19B45AAB086CD526E7881F810 As=
810,155,841 *541F596C9D456327ABEF57ED8C5E7EAF9B6B9106 As_$;
810,155,842 *541BD9EAC55379E35DD740122003D382B3BACEB3 As-=;
810,155,843 *54153B2D7FFBF8666CD9143F8558F53B7DFAAE84 As#:/
810,155,844 *541BBE771930BE1A766C8201A29BCA02B8C53DD7 As
810,155,845 *541ACC52E61B478AE911C2D5DFA24071806CC6F4 a&!S
810,155,846 *5415E6B27A8242F3370993FF11369AE6B335DFAF a*s,
810,155,847 *541450DA74D8088BB9C731296BE9A175CDD07E63 [email protected]#$%^&*
810,155,848 *541EC8D8012BE29E43552249EAC2D391FDDB4F86 As0c!
810,155,849 *5411A21170CE75EA0A6C5E9DFEDF4D9F471462FC AS0Y$
810,155,850 *5413B105ED359770EC34EA66168972DCEE0BB312 AS?18
810,155,851 *541631FDE999A71D426498BA02826C1560F7754E as(1999年4月、テイアイエス)
810,155,852 *541E76F6D820EB27A45998CCC2AD2FADAB791A1C As.1T
810,155,853 *541B1A22DE32E9EC0E4D0D7F4D35FBA15771C6C7 As1-u
810,155,854 *5411EC02108437F1A0FDA25F04EDBB46376CA7A9 AS1W8
810,155,855 *54158DCF265B5843C297B2BDBCC93D192D66A787 A_)s2
810,155,856 *54149E472D6297524216750EF51EBCD90286C9AC AS29=
810,155,857 *541C631C88921C633FC5F8209BE99C9BB4678111 AS29671
810,155,858 *5410E301FA7602C5F814A9BE5E7FBBFCBC2F385A A/S2A
810,155,859 *541DAFF7310A3B3A1A864ADBE6D4B8D96965E7D0 As2/M
810,155,860 *5418A6E5B4773B21822A63B4BDB848742ED1C3D8 A!+S3
810,155,861 *5410319DC76EB44E76F8163303A1249A8AD5FC06 As:"3
810,155,862 *54180B360C0200711323C855EEF9EE9639C723DC As3b)
810,155,863 *541F688CF97A720CBD6EFA344595D930554B373C As3C0
810,155,864 *5415861E092B458B68F32E025F28F03F2C23A8C4 AS3f)
810,155,865 *5417D6116C0859153DFC3A202E8F4700F744D732 As:3f
810,155,866 *5412BB7A73AF1BE055226BF32E2CECA89EDD4BD6 AS3GL
810,155,867 *541D06C596EAB6A7CB9331C1054D6798D6B7AFB2 AS3o9
810,155,868 *5419FF6339CADADACEBBA9E9B29DCF76DF167721 As3_r
810,155,869 *541F8E93B48CB038382693B10B2B8F028E770733 As4-=
810,155,870 *5417154A11ACE1E36F66183EEBA11FB9B715EAB9 AS4b0
810,155,871 *541F1FF6A4F35EBF8D14202AF99A7F895C53412C As4$l
810,155,872 *5415B12845C72042D5CC1C119562292B7B93B103 As4VW
810,155,873 *5417D11E8CDBE16A5985B6E1CBC4E19D01133160 A$S!5
810,155,874 *541B7CCD3CFD26288DF5D730FE1532F35166F2F8 A.s5!
810,155,875 *5415426935DCFAB4563B96355E69F7D8DB71C617 As5)h
810,155,876 *5410E6681B7D90C26013EFA9DC3C3325DE0764FF As5Hg
810,155,877 *5419E21D2CC12E5FA8B25257335BF1783D48E43C As"5i
810,155,878 *5417B3DD8DC663EEE05C1D5B60BAF13514F639AE As5Ws
810,155,879 *541947BC550954C5B4A55FCFD6F158DC126E78A2 AS63A
810,155,880 *54164CD26312BBFF7FE2DA10857A73C21A181E85 A?S6e
810,155,881 *541458F050B06DB1B2B55949C65B0E5E65F2D45C AS#!7
810,155,882 *54123BCDF79506DF9096F84E776D9980F8A29380 AS71p
810,155,883 *541AFD769FD7DE341C1F99D63504B839571DD87D As72Z
810,155,884 *54116EC121FE22531AFD6319083B9DA7992CAB40 As7#D
810,155,885 *5417287EEF93C8EF1BCD359E423E2914926E41D3 A/s7E
810,155,886 *5416C803FA4C55FD8CCE7ECE76B691B0EA0D9E44 AS-7F
810,155,887 *5415F7958B81B128E70D7E270231AB93204B8AB0 as7hen0l0gy
810,155,888 *541821147839427183DC64EB12F4CCBF820CDA9E As.7K
810,155,889 *5414B859F9FDC80F28293C02EB5DCD0DE19816E0 as7rapophob1a
810,155,890 *5411C33F3EC02768FBBA7DDE73523400F85C30FE As7ro1og3rs
810,155,891 *5415D7ADF1CFE871EF1F247BE230DFB920219EB3 As7Se
810,155,892 *5412438CE490BEB9931F1AB0D11E7766C384EBE2 A#S7W
810,155,893 *5416D7D9F764B052525CBAAA64973B4D13C9A775 As82v
810,155,894 *541AAE7F34156134EEF55975E2F786A544848759 As8!7
810,155,895 *541EB89592E8B712F636C37A557DBF761A88DD73 A?s8M
810,155,896 *5416A1868254FEAC9B19BCD04D8D83CA49DD7A51 AS9B+
810,155,897 *541798FC37ADCCF15B3E4B9DC6945BC6F713B04C AS9kr
810,155,898 *541F1493D9DC9C0D97CD63DEBF34A17BBF3F2D68 A:s9q
810,155,899 *541D5EF426C890D3BD1A49F8EF622CA674D74C54 A(s9T
810,155,900 *541C9A3C6CDDB59D07DD60F09479902F95FFF601 As9(T
810,155,901 *541B616A8544A8A1EFDD758743AC9801BC6EB4D6 AS,+A
810,155,902 *5411044AA1841DBE12E50771E0E620821D41E18F A_Sa
810,155,903 *54114E0EBE3C9B79C68946D1ACB32BB0C01DFD9D A!sA-
810,155,904 *5410BCD15B6AADFD76E3B637DC99FE4D416FF9BC [email protected]
810,155,905 *541531990ADE600023C666FE2188F33743DD9D6A asa.agostini
810,155,906 *54151F3075D3A3A601EA1023E36BAD135FAB418D asa.ailey
810,155,907 *541F5F87D7A75CCA61CDA86BD1BE7A3E63858CFF asa.anna
810,155,908 *5417506438C07B032DBB1A6F7456E7BF78657637 asaăul
810,155,909 *541C7998FBBC3EA5489281A0309A85D6F31D5958 asa.brezeale
810,155,910 *54104C9A111FF3DFABD06148FFADD7DF9F06BF9E ASAD_
810,155,911 *5413D649286FB7BC45958F075A09C63050B47935 asa.debonis
810,155,912 *54123F6529379807933F369DC9DD037169BA6828 [email protected]
810,155,913 *54132FCCB0DA90FB0CEB831FDC1CC1C7A2750EC5 asa.dowers
810,155,914 *541E4841EA8505B373D1FA9799FE4FD4A8239D1F asa.felipe
810,155,915 *54119E2FBF01F343B2738878A2BBDC2C3034B082 asa.ganibe
810,155,916 *54114F6D2F322F5C5DA42970A66C82565EE25C16 Asagegus8
810,155,917 *5411DF63D9D4F70CE5403AAF97C8748FD98015AF AsAHm
810,155,918 *54140200D8D6DE03798C0874C8ABD56764A3CD76 Asahposi
810,155,919 *54179B7C4A0E06E1578A8000FD5D044C63324CEC asahshio
810,155,920 *5410D72CACEC87FE6AFE89B474C37AA477A8C38A ASAIk
810,155,921 *54140F6D2451E8F733AE9F5BC93EAF572E202978 ASajE
810,155,922 *541DAEC5E4D437C8111050633F956AE7EBB18940 Asakakans
810,155,923 *5410A27C6E03C40999D928FBAA149872760C2191 ASAKASA
810,155,924 *54127F22083D415F2DF91B525DE0D6D9BC702569 asa.kayler
810,155,925 *541DE0B7A4BA9D986FA91F6572FF87ACE5C27545 asa.kemme
810,155,926 *5416A836922EBF70140B58BE4C8A7B39D1947916 asa.kienow
810,155,927 *541EF87038342FC886E1A002A2C53236961B20BA asaltandoelcielo
810,155,928 *541D132F0B10DF608091C862B5EECEE43461C9ED Asaltoid8
810,155,929 *541C457F3A039B6AA22361C8A27051F0D9D56142 asa.mahl
810,155,930 *5410506FAEC6DC109A8222888A364D4B0A320B23 asa.mahuna
810,155,931 *54142AC45CC9A2E7569D9E710546B556E2A9752B asa.motten
810,155,932 *541036341C8813B31666A77CBD3928FDBDF35706 asa.mulherin
810,155,933 *541AA2FEB92C630FCEE3EB83B2FB2DE8B4C13861 Asan)
810,155,934 *54198DBBC98338BC78203CC1701428C186CF25F9 asanayuu8
810,155,935 *541D6DE7890995BDC69F8A86200E0B795843E5EB Åsandøyan
810,155,936 *54179ACC3BC13C95740A171170B1A75084F1F4BE AS-A-NEW-BLACK-PANTHER-PARTY-FORMS-POETRY-AND-MUSIC-BRING-MIZRAHI-JEWS-TOGETHER-IN-CELEBRATION
810,155,937 *541B7AF489956EDFC94FC730E22EB0363CA2FA34 asanikwa
810,155,938 *541E3D9F429AEF4914EEDA7A634FDA7FED8294E1 Asanoving
810,155,939 *541D6ED548284B92BB7103D27FBC1C9D45B615D4 ASANTES
810,155,940 *5410EEE86A1FF27F0F2FD6EE5137DFCCDF4F5E5D asaortaed
810,155,941 *541B6DE01C31FDF32114D443B993C00C7A81D3D9 ASap4
810,155,942 *541C241B8BE5E966A34C190AC0EC941BC12325FF asa.pezzuti
810,155,943 *541BE248416F32AAF6F397405E3CF1DAB19253FD [email protected]
810,155,944 *541D3690D3F1EA17866ABDC85C9C97F3A1F95436 asa.raddle
810,155,945 *541888C0BD01479F984382755D74FB2D681BD12D asa.randolph
810,155,946 *54177EA23A3CF0486765C7BBF8BE040D02F0E7E4 asa.rochholz
810,155,947 *541EEC02D473268866F0BBDF9CD5C27786735E06 asa.ruyle
810,155,948 *54180F1C96003BB2DB22C69B786B83FCCB48B88D ASa_s
810,155,949 *541D973696762830ABE58F4A4A131A873F14E46D asa.sally
810,155,950 *541E024EC8CAAC8020B50C9B276DE0791C1B20B2 ASasca
810,155,951 *5413936F5B639F35961DA5A64EB2F9315C20B535 asa.schreiber
810,155,952 *541DC6C99B7DC9DA1BB0181AE695911938A26A04 asa.shibuya
810,155,953 *541D439D01A50041EC3EF4AAAB4B1254C301C15F asa.sisney
810,155,954 *541E1E765C87694271FD3BEE3D9F9CD9B6BF9336 asa.syta
810,155,955 *5416354953318E1D1EF5D3047EFB36A45B7D7A09 asa.westgaard
810,155,956 *541863687F35BF9AE1DAA37D03B3C8A89AE0CC91 A-)SB
810,155,957 *541BCF1C30B9DA987E8131E504414C429535761F ASb%(
810,155,958 *541378378728CC02F82EFCE6EF32A7AF65A8FDDE A)=sB
810,155,959 *541A517E7111E26D1670583AF6B6B65001653243 A(s;b
810,155,960 *541A3A86A04F5FA6F8F13689888467DE7E2A47E9 AsB!2
810,155,961 *541B1DF2EFCAC1CB83FAAC7349F8603979B645DE ASb3_
810,155,962 *5410FA121C0093D1ACA43A8E640908B205E998CB A-sBD
810,155,963 *541D5DD6AC68A1CD299BD25CF0863E2C8586E99B ASBe-
810,155,964 *54128EE148E87D67B0120EB2A32F9D51E24071E0 AsB+G
810,155,965 *541853ECFF89EF006F2867C0BCB46A4C73857570 asbkm
810,155,966 *541904297F3D30A405D96F03AE1D4202A5D86412 ASBlp
810,155,967 *541A7A5B9C263E2B9B51922ED58B144EF6618170 ASb=r
810,155,968 *5414E9A1FE016163F721F263A2085A0CE1B8AE8F As?BV
810,155,969 *5415CE0CD16F74E9C9C59200353EA4525E33FEBB ASbwV
810,155,970 *541A0FDC984CEA9D4D2AA8DA0ED490EA85D700AD AS"C:
810,155,971 *541DA0914172618F7569B091C9D11B6D30FBAAEA As=C!
810,155,972 *54167CB6D2B8EB124ABEADBD4ACCBA1F3B367CF2 As>C
810,155,973 *541C032BE4658092C85CCE9212E9C36F9BFF3700 As%c-
810,155,974 *54108C2D36FBA3DD067055D100E2CEA7981E7B83 AsC3L
810,155,975 *5411D5AFBDE57C2C478EACC896950168BA20A7A6 ASC51
810,155,976 *541ECCE2B92D11E2E1582DDBE77781B9744DD480 ASc5W
810,155,977 *541DF8D4FF1DD0A288F7EC2F0DBF9EC7963854C8 A
810,155,978 *54187800B4F3FDEC38A314FE66BCDD2DA3A4EA50 Asc8.
810,155,979 *541EA54D4E6043ECC49882370EC7F497CE6A27E7 A.SCA
810,155,980 *54111D8EF6B88978AA0A35038E24F8A5A75D523F ascanian!
810,155,981 *541F6E1FD9679632FA4D45BED6C1462C49DE4D67 ASCARE!
810,155,982 *5413BCAD77F264CCF5B203B1D48B3A1DCA4F7B87 asceeded
810,155,983 *5419EF185E9B45140B4830F0A0CA2428AD4E0E96 Ascencon
810,155,984 *5413A8C50366EE9C2DEA81182F3F3602F0520507 ascendante8
810,155,985 *54198A7FD841E1786AC6E36211E377D36767833B ascenders7
810,155,986 *541767AB0481B95C2F94B7DD531577E2D40683DA Ascendieren
810,155,987 *541CB8E594EF5BFE951501C4A8F6CADA501E0DD5 ascensionnels3
810,155,988 *541AA6E8BC2B4B53E9885516AB8541E994204376 Ascertai7
810,155,989 *5418409E35538FD1BC154D553773F544364FF6B4 Ascertai9
810,155,990 *541F91665BF80B9835859CD2F2D882F4C8DE2757 [email protected]
810,155,991 *5413A1C07888B36ED6C79E8F614B825E23555094 [email protected]
810,155,992 *541086D135B2E2EEE518AB268BE61B5791852C90 ascetically.
810,155,993 *5416398DF40B09F873369C4D1A298A0A0DD85D1D Aschasiedlung
810,155,994 *5411B4260086DDAD1F3C48665254DDC799C3C986 Aschenes9
810,155,995 *5410EE147C3B9C497C752CBB101C3C9A5704234E Aschenputtelfluch
810,155,996 *54152EB172D9052E0C8FF257E16ACC13C3570BE8 aschezug
810,155,997 *54160FBFEC40E0804BB15B62FAAEB2FBF700F1C6 ASCHNARR
810,155,998 *54151A47354F66CA65EB8BB987EDF1A93A7F1110 aschoorl3
810,155,999 *5413F344CFFA25B40DAAD40E943E44B994767C30 ASCH-SCHA'B
810,156,000 *541930C49CB16DEC3C08F51964E4FFAB520276C1 ascibasi1
810,156,001 *5417EBBBDC2CFABC3C89FA1D4E08B176DA37AC53 asciigraphics1234
810,156,002 *54181D4790897A9A299902E83C863B778ED8D8EE ASCIUGAVO0
810,156,003 *541DB63D3C80902CB27D02208F59C447013BA8E6 A=scj
810,156,004 *54183ACF34F8B941BEF28C6AD3218F95EC926D29 ASCLEPIASQUAD
810,156,005 *5410725BC631CE5E9B1D3103262BA2B3746113CB A:sco
810,156,006 *5416781D4E7A0A24188B55847862862F200C33A1 asco10
810,156,007 *541B21AF7B31BABAA18C3B65D872238FB6B5C339 ascom:jaws01
810,156,008 *541C75B8C33C8B35B068682254AC676F4732451B Ascophyllum1
810,156,009 *5412C3882D391685F6181B93B3558EE4C39716CE AScPH
810,156,010 *541907692B89BB8831FAD5FFD62AC9665257CA6C Ascrotal3
810,156,011 *541A9ED11CE5E51A3E3CDD5CDC0512421E7ED302 AS:cu
810,156,012 *54125E1A73441579EEDBB4D9634F3D1EFE0E0A9C Ascunga3
810,156,013 *54178695BD7ED4A54C2440D36578BEA87A54DEEB ascusu
810,156,014 *5414B9E992E82CBB8B0DD1A1538A2CA3BDA1F4C5 A,S-D
810,156,015 *541477D09B82BCEE745A1F9157587BF41B4A34C6 ASD1
810,156,016 *5410C3DE5560A5EBBDF09B2190BDA3E7EA729B3E ASD105
810,156,017 *5412E8FAA80E0AA40B1F65B53D9076226D3B205D ASD244
810,156,018 *541B438EC5DB2778B8A36AD4C76FAD53BE4902FF asd982
810,156,019 *5413AC3526272B7DF75FA56399AF0E9BB1979E78 Asddsa56
810,156,020 *541900433E201FD5E2B2FE30D988ED0BA572209B asdf3868
810,156,021 *541C3F328A34E8E3BB3DE98C3BB5EE3B71ED01AE Asdfazsxdcfvgbh
810,156,022 *5413A8627BBCA98AC88CFFC098E003991219BB84 asdfg346
810,156,023 *541268E0246F4E79CC3B0DDF6FC4C35899B9C806 ASDFG601
810,156,024 *541D25C5FA375BA1312272C1BD0B92AAE8552677 @#$%asdfgh
810,156,025 *5417DE9EB2416D9EA1153FAD40AF90565F347EEC ASDFGHGFDSA
810,156,026 *541624D410CF8D8E9A3CE0E38D717241F0ACBEE1 Asdfghjk1991
810,156,027 *541200AECB8AC152DD9F4BD779AC096B4A1D041B Asdfghjkds
810,156,028 *5414DAEA71595B508F3E882DF13AF4929B0D3C08 asdfghjkl429
810,156,029 *5417457CA1BC8B3CA52F4221833B177D08483735 Asdfghjkl458
810,156,030 *54106A3B464F0AA6A1FA24E955A42E8A7182DB58 ASDFGHJKL540
810,156,031 *5415DB33B8A99F3D8CCE9CEC8CFCA5A95CF28465 Asdfghjkl648
810,156,032 *5410C6B84E9216B22D667F62A6DCBFEF497200EA Asdfghjkl827
810,156,033 *541BA0178F853B18CD94EF4F5678EE9034885138 AsdfghjklLKJHGFDSA
810,156,034 *54167277AAB0626C9FABB9596096EBE8EE4DEF1E ASDFGHJKPARROT
810,156,035 *54187117B66F6C18134D637B97297C013D4F9A6D Asdfghjkpurple
810,156,036 *541EADAE8FECB7526AA0997096DA77122D759D76 Asdfgshelley
810,156,037 *541670582922CD035B0D783A31D8DE322D66AF3C [ASDFJKL;
810,156,038 *54107CA3E1FE7A8627E6C7449CBCF4A0307A3518 `asdfjkl;
810,156,039 *5415FBD20029D72021093335C48CD3D02899BC1E Asdfjklginger
810,156,040 *541F4B31DBEDC74BDFE4BB8D2FC0190824E77D51 Asdfjklgrover
810,156,041 *541EB0614BE582C37DBA038D18831ABE78ABD7BC asdflip1
810,156,042 *541B71A91CA0F8E73E4425E3287EB1D070F3473C asdfre09
810,156,043 *541A41C963322BF1C0FC6EA7B80996080001BCCA Asdftommy2
810,156,044 *541AEF6454819EBABF8532ACA927F5B4C19EECD3 ASDFZINN
810,156,045 *541BCBB71A54C2675791E032D267BF7676A3233A ASD.G
810,156,046 *5415304BEA441F8D2DFF93AFB8119FDE1D488CB4 ASDGb
810,156,047 *541BE7C1BF305710AA225B658C59C5221B4202E8 Asdicsesed
810,156,048 *5416AADBA42E432B790C8E0EC28A854C301476F8 asdluogged
810,156,049 *541720F0E5D197379A839D5B6B503DE40AB78D5B AsDnR
810,156,050 *541E38A9D3F0A3195D0B67F9BF771BEB6A640D29 AsdpA
810,156,051 *5413B672F7CB12437E04363CEE0281F983B2B334 A.Sdu
810,156,052 *541A970A7CB837653166F7F9D37F0E58E2CE14B1 ASDV=
810,156,053 *541B30F11CC49D84AEA86C55B10F57E787CC9942 Asdxplring
810,156,054 *541AA3353753000D3776F79665DC0AFDE5306D47 AS!DZ
810,156,055 *5416B85437C854FFF2C6BCB034255E81D20B7BFE ASE."
810,156,056 *541D8E27FB4CD928FE9985756EBB9DCB947F21A4 As/E.
810,156,057 *54149C1C1061407A30FC396820531F4968B5A4CE AS?E3
810,156,058 *541515A403B034753B952E88DC894CBF83244EF2 AS.E8
810,156,059 *5410FF07B418D7A3EE25FFD418A535B3787080FD aseasy123
810,156,060 *541FF850ED19715CEC742F5EA55BF25C501EC096 ASebk
810,156,061 *5418FE6D570C7E06BE26C8C51FD5A1C84CE5B1E8 AS)Ec
810,156,062 *541CBDCCBE03A078C4E65417648638471A2F321D AS$eC
810,156,063 *5418BF81CBA7F209CC5350DD25BDE0B0A1ABE9E9 asecovering
810,156,064 *541997206D09DA6EFA2083B4EE2CFF3AD7988A56 A-SECRET-MONSTER
810,156,065 *541A4CE12F2E9F68CE1D543D7241B6707B2C763C aseelahwilliams
810,156,066 *541A43E24664119FD137AE2B6E55C23052F5A040 ASehK
810,156,067 *54192C7CBCED7D1213662E69AA4FDADCD9BBB4DE AS.ej
810,156,068 *541A227F31A84B52F18A1EAAA1DD8AEB0B8B68CD ASe=K
810,156,069 *5417D4AE434ED9EBDEA21F86C9E7D8CE7E5E73EE Aself-steered
810,156,070 *54129159FE3E5E4BFD69DFE650734CE1B2CD1533 Asellines2
810,156,071 *5413371486FDEA6236ADB0F0DD040E99EABF3847 asemallas
810,156,072 *541EDA34E6359D22524E81AF5A7899C22C0C68DB Asemamaing
810,156,073 *541C2313D4F3D96596294070A403BA46594B76BC asemestA
810,156,074 *541FB6E189CF4C383B2753FAF36F2FBD263B152F asendency
810,156,075 *5415842696273E251CBCB7361D8ECA59BA36FC9F asenjos6
810,156,076 *541FB45F13191FDABAF1FDFBDCCA06E692BA1662 asensqwthtcukawy2f2yba
810,156,077 *5415B92E8CC3F452427A919EC7442483A3EF53B1 Asentami3
810,156,078 *54117AFAB2C78FA493F7CC5B456D16EF118F71DB Asentar2
810,156,079 *54130465B1FE25749B8E876225198B838849F2A1 Asentira
810,156,080 *541979BD6B75C5EC784FE9B51B4A718E882B88B9 ASeogang
810,156,081 *5417D129914A207F6708BE6275529E0FBE4F0986 A Separate Affair
810,156,082 *54104C7CDA5C00049F8185E6255464F55605A7CB AsEpB
810,156,083 *5417AFEA30F69E3FD042FE71F07DB56F4CEA385B asepgrow
810,156,084 *541347EF3F05A666156DCA1AF21C363742ED2BDD aseratic
810,156,085 *541C7D4F1FC956E3B67026779067C30E07FB291E asesoriaestudiossociales
810,156,086 *5419A87221F5F17A12F9A9FF8616C2BDD57D522E AS/ES/WS
810,156,087 *5415E2721E0DCF71195A88C5F61C7FAC21B845B6 Aseussi1
810,156,088 *541F6D0FB848E97FCA6E6DB4940413582565258B ASeYw
810,156,089 *541FDF6B45DE93C4A287729745CA2E2C36CA5899 AsF",
810,156,090 *5410FCF4160CF4FCF259EC6798FEB4068266331E AsF0h
810,156,091 *54159CD64B8197E9305651FFAC63C74020C4FFC9 AsF7v
810,156,092 *5412E3F5034504A98F47252082D3A5DA666CB0E7 Asfa"higkeit
810,156,093 *541D0A6AE15D54BFB3B6EB3F74A0867547EE36DF Asfalteerden0
810,156,094 *54142C202B22DE29973ED225CF0DEDBE4153DCF1 asfalting
810,156,095 *54156C8995A1FE63083F65772862F8D4B168F8C5 As.fB
810,156,096 *541FF87B895BEF96849A518054DF6159C235A3BC As%fE
810,156,097 *54121F10FB561F63F3D9274B0E4D1DC8DC8517D8 ASFls
810,156,098 *541E2166CE68030F75E9819DD8A8D9348F8A6739 ASFMK
810,156,099 *541F16160E328DD5AB3C65B61915D7306F40D846 As%fR
810,156,100 *541AE7A38017DA4B9D38AEAD9DFFD773A23AC648 AsF:U
810,156,101 *541A4F1D9D162D936DF825450E51095F29AB6519 A-sfV
810,156,102 *541E6C556333FD4E8FCF0DB7929FE9619B9E647A AsFYV
810,156,103 *541B6F73AEAEE7954573318B4215F08E6C2D89D5 A)S)G
810,156,104 *541C924503A04B395E657CE10C5CAF6C621B1D3A AS
810,156,105 *541C26C946BDFA2D2399D89E453F53953AC48356 AsG,&
810,156,106 *5418FBF0A701793717502B5C435F2499C17CD9C5 ASG251106
810,156,107 *5419DC09EDCFC2D7291D6B8DCF57190B20492B8F Asga/
810,156,108 *541FC9FAC8A3AF392A484A9AACF7074C43B7D2B3 A!sGd
810,156,109 *54137035DCC3EAA72E4945344A37AA9458F2FC72 AsGF?
810,156,110 *54164917C6824AAA92A0628260B4C8D605F92C81 ASGJ
810,156,111 *54127AC9791D9A7432C419CBA39EF9E52DD4A647 AsgKB
810,156,112 *541DC83D72AC96373BBFA885460425548608A131 asgkh
810,156,113 *541AE701C007A2137433A0EF1B545CFC9DAC6DEF AsGlw
810,156,114 *5419F2EC08A81C17DBCFA4EAF5EBAFF81BB7B7C1 asgoto.hine.net
810,156,115 *541311D393C5E36D08F0F4C21BB785145EA1EC4E ASGPG
810,156,116 *5417CC2269BD66CF6DB9401047FD3948E2285761 ASG!q
810,156,117 *541A257AEAE76027EADA6924F61F8A6B20F5CA4A [email protected]
810,156,118 *541DC8ED3A6FA177CB6600A15F7637B64EF70F3D A,S-H
810,156,119 *541F05FAD97B615918A2FE219EB0C3A9197BA0EF AS"H;
810,156,120 *541097B2E560D7BF85A6DFC1D5B646B9CF4B9712 AS%!H
810,156,121 *5411C5E4556EF792D88ECA6D2B946C5BDBD1FEEB Ash1ar 1i
810,156,122 *541F348ED76DF3464044D1F2A815434BB9BFD37D ASH387
810,156,123 *541F03DC777D8969B5325914B29078B608A6C3AA ashaana6
810,156,124 *54143A6A18CE60215BB80AC6A500C668039180CA ashabear
810,156,125 *54188E723E0E1F45CB3222A7343077D8DC299D7A asha coleman
810,156,126 *5415BBE8D1886AFBFC26DACF2D49814EB3180E26 Ashaiconvocation
810,156,127 *541C9208E72F545FBA4D866807A41E62ECE8D51D ashaismail
810,156,128 *541799571B226172F9FDF4C29FEC19D76E3C9285 ASHAJYOTHY
810,156,129 *5417904811AE061ECB8C9B1377383E62D58D29B2 ashamnus3
810,156,130 *541A8F23324440C2AFC882F77AD1F3758D2CEC85 ashanti-always
810,156,131 *541C8510AF21E3166BA535B314936842F3AB7209 [email protected]
810,156,132 *541CFEF3EDCC33838FA792C56FB444EFD4FB142A asha rose
810,156,133 *541B9A71F68EBDC221AAC13F87BFD67C289314F3 Ashartus
810,156,134 *541A00FC6F1B0B7A12210FB6698047D76DF219AC ashaw511
810,156,135 *5418E22B57F2C931A2FE3AF8B62ED04A86E43681 ashbee-bibliography
810,156,136 *5411E3443374C9CD14FDD86A0148FCF13B61E159 ashbelsteaua123
810,156,137 *54147C381C6E271C84906F2D6D4C83EFD2E4BCCC Ashblondses
810,156,138 *541DEB0E8A8DB9883292B8AC025CDDC04C936CAD ashcombeclifford
810,156,139 *541FB41C36CEDE5C3AAD13CDE554855D20AC9C16 Asher238
810,156,140 *54167623E8665F87E9963D112DBB50697ECEC203 ASHEVA]
810,156,141 *541725F19ABF6B2EB016BEC21FA42E02CDA2FD61 ashgrhnE
810,156,142 *541C3377CD54A32F6BBA625DD5CA35776DE27CD4 Ashhoff
810,156,143 *5414D936A50CCF28010AAC3BB189BAB6EC49CB52 AShi
810,156,144 *541BEBE8E5A96C6FD73AB5E7C05050A436263637 Ashihama
810,156,145 *541C982CAAC9486C3C05B895DEC2F32C5CBA306D Ashiira9
810,156,146 *54130283888652D51C38397FE66C8CE0EE077AB5 Ashiitims
810,156,147 *541295A0C2C5D8FF7E3D70F804C27168C58FAFF0 [email protected]
810,156,148 *541C269B65CB5922E3567ACC52516613A36A5993 ashikari4
810,156,149 *541660F22B3CD518E2947598AB9FD6FA938B5CC9 Ashilies2
810,156,150 *54103E5C7D7CFADBA9E5C1E1141A770BFD05905D ashish damani
810,156,151 *541E4C0D82FD8D37550F45E6523268C673E34488 ashish marne
810,156,152 *541CCCE48356F0F50FE180E4716A770DD05C82B6 ashishmurkar
810,156,153 *541D6B277514FED11750DEE158DA1C07C04AF1F3 ashishpatle
810,156,154 *541149068E5E293F15E3513002D803173E7FCB11 ashita kothari
810,156,155 *541DBA81C18D1F05084618D4E3B28D0636277406 さんによりAshiyan49さんらに無期限ブロックがかけられました。
810,156,156 *54170126F926357F3D73C975DDC8B0515C965489 ashleastevens
810,156,157 *541BD185ED7FA24BD3CC183F441D1C711AF92298 ASHLEEANN1
810,156,158 *541DE5F0D54B17F85B62075D8F0E583FB871498E ashlee kara
810,156,159 *5419DBFCB8D1187BB3101FEF7BF9E39A387B5BCA Ashleigh797
810,156,160 *541FC8EE520D9853D1E431916E1E651E52260023 ashleighpoole
810,156,161 *541D81F4CD6FD0AAF50F50D9D26A0CDF48BB3C18 ashleighthurston
810,156,162 *541364C0D9281F15760AF821C5D37A825F260EF4 ashleigh wells
810,156,163 *541E93701452D6D80C95D141CBF350C1E1F436FD Ashley`
810,156,164 *54197D6705DC2FC22B7D1AA5A47C6CD092F656DD ASHLEY-9
810,156,165 *541109735A3691825FFBDF4A276640E11B7C867D ashleybarbeau
810,156,166 *54114E115D4DF77E55EE028E7EEDE4B151141E72 ashley.barbish
810,156,167 *54100638F77BD2DCA67BE9DB57B8A0C17B017B24 ashley.big
810,156,168 *541A4601F9F5A3E5DBCFECA6D3097C4F41505576 ashley.borgos
810,156,169 *541CEDB96CA92D0B28B7723DF24BA3DDD16C5551 ashleybozeman
810,156,170 *541EB23DDDE5F5C8D5F6276CC941440CEDD55F99 ashley.bula
810,156,171 *5417EEA1086001E4B396ABC25EA0309C9984EF40 ashleybyland
810,156,172 *5419A309415D6234EDB7A1C1D2A6BB47227FC307 ashley.cefalu
810,156,173 *541EF05CEBACE8B3F670ED99271A36349DF6F98A ashley.corredor
810,156,174 *541EEE6FA5BED1D86AF5740CC85BA3E4C4B3DA82 [email protected]
810,156,175 *541C5FD177D3CBDC771DAE48D34C576AB4AB12BD ashley.crete
810,156,176 *5411C46AE59C535DC7526C5C83EC04F4B2271D24 ashley.daughety
810,156,177 *5417B23E51DE605914031A94D2B0191710D2D517 ashley.elzinga
810,156,178 *5418DE2EA312DD1E370E85A468AD0615F72CD6B5 ashleyfaver
810,156,179 *5411BE8FE03E2A4E961C844608217AEA8C50D819 ashley.gilday
810,156,180 *541FC9F1548D1385E5374C7B12926BAF01D1FFB8 ashley guttierrez
810,156,181 *5414C888BC8BCD83A8B35C393E4EA3965C4F1E91 ashleyheffner
810,156,182 *541C0BE138426BDA70844A02F5A925DF8B08986B ashleyhoagland
810,156,183 *54131F1D067E349D7C8EB517E2510ADD98C74B8E ashley'-'ihateashley
810,156,184 *5411354AD3613CD1501E266AA4A2C749A275DC19 ashley.kauahi
810,156,185 *541166B5A3541352A28A37857B8F1C98C1C4AA28 ashley keever
810,156,186 *541BC4EB6E6E172BA91174A9D6B78B1ADBA0E30E ashleykeogh
810,156,187 *54121C8C7D8634C9AC77A96D7CC88AD736908B62 ashley.kunst
810,156,188 *5414B60553DA86151D7DF87153784D3CC5EF06DB ashleylevitz
810,156,189 *54195BFDAF5CE56663A33579528F00A76A292223 ashley.manriquez
810,156,190 *541227BF37A85FB998EFAA2B355324778537F645 ashley mayhue
810,156,191 *54191CB4EC2AC8B733127D0579ECE0BBA915DC34 ashley.morn
810,156,192 *541F6C455F2AAF73C77A3802CBDC36469D3D660A ashley.polster
810,156,193 *5411AD40A507AFAD2157CA325BF99DCE36AB84A1 ashley.rayow
810,156,194 *541E55ADFAE5EC669A513328638ACD5F7C6834F4 ashley.rizer
810,156,195 *54179EC504D5EE7FD27E7571BDF7249B4898C780 ashley.rog
810,156,196 *541E35A43997D86352660E6F79FA99B8725ED332 ashley.schick
810,156,197 *541D89C017435785AB2C6416CAE8A9697236470B ashley.shuck
810,156,198 *541399924CBF8A4E0D02FD32A630627E176C95E4 ashley.stecklair
810,156,199 *54191A7B196CFBDB695EF58033257659FC8547B9 ashley steven
810,156,200 *5416E6A912F0224FA1325FC2DCA7F8A981455864 ashley.stpierrie
810,156,201 *541EB81CC2BE6EB4E6A5DC2A7B419BFF74714B88 ashley tippens
810,156,202 *5415CD4A1D40B18FF52D383A20F41C06BFF7E6D9 ashleytv
810,156,203 *5419007233D6EFE3536C177B538AF18FFFD8BB58 ashley.veer
810,156,204 *5418409695A7578C28FF33668FF4398663E89473 ashley.volpi
810,156,205 *54126F43DF45D02E4131E2E5019804D8AD6BC744 ashley.zaritsky
810,156,206 *5417AD594609551E1C5D9ECA10324FC1A9E548DE ashley.zeigler
810,156,207 *5410929F755CE296CF7B01587C6DD6577C283F14 ashley.zlatkin
810,156,208 *54103256597310446D8E577655900A8D2772C845 ashliemunson
810,156,209 *5415760019FB9D1ACE3BD1BEDD7C4F9B911748C7 [email protected]
810,156,210 *54169603BBAE7758197CBE24EF03AD78F4A39FBC Ashly998
810,156,211 *541B95F5918D5729D3E095DFA1B006FAB7F3D80C ashlyseana
810,156,212 *5414CE496343521E6794E7CDC995793301C8AF48 Ashmeniwn1
810,156,213 *54198ABBC0089D0C1A4BFFAB3DA8F20DD607951C ashmere0
810,156,214 *541D5336FD3FF83C7B399A474C54EA1784574336 ashmiking
810,156,215 *54155E1407E55E77C604D6B04A28795D18DD2E19 ASHOKMEERACHETNA
810,156,216 *5410408695FAB0DFF24C3E846662411C57DA885F ashontises
810,156,217 *54114FC7D28A1E3C882B6BED1DE7D4F5831D67A0 ashozusH
810,156,218 *541FBFBCB15FF17D1532BFB9DABC7349D330FB09 ASHRU506
810,156,219 *541554A7CF750B90FF8E14C7B13680BA93C935E6 ashsquire
810,156,220 *541F75043C2F533325AA5008E50753DFB0E5B597 ASHTAKASHTALU
810,156,221 *5416A93EC23DCF0851989073B549D9C26877FE43 Ashtalied
810,156,222 *541C7BD08861157BFA778326B1491AAC5F8F020B Ashvinau6
810,156,223 *541FE35078C22B5A77AF167D81CA55674E1103E7 Ashweeta5
810,156,224 *5411DED67F660A203B943510B40AEEDCA604D6FA Ashwill6
810,156,225 *541E21224BAE227AFAEB238BCE09D7734D59AB05 ashwinianandan
810,156,226 *5417E9A3B42816760BCC2BFE3EEB3A0D84DD2527 Ashwinikumar
810,156,227 *541A8758041C5D7E2DF216393DF61D40CDACB681 Ashworksing
810,156,228 *541878DFDB59321328C0B94531C3424685D46C1E A"+SI
810,156,229 *541804B4E8FE58FDA534BB80D39556D96CC52DB3 A#Si5
810,156,230 *541E14AAF49589E55CCA4D6358A3CE68A5B07FBC ASi78
810,156,231 *541035419E7E2F3C7E0034354E5A971FE1BC6258 Asi7q
810,156,232 *5413CA9F411CCAD30E72993D461E052F64B981FB [email protected]
810,156,233 *5413FDEA5150A41096056DE469EB7113B01F10F8 ASIADIDELPHIS
810,156,234 *5417A8F0C06595B4D6C4B192DBCE51B6DEB68EEE Asiahouse
810,156,235 *54151AAECF87711020DAFF91886902FC1135FA90 Asialais2
810,156,236 *5416E367F007F62FE90F1BCA0A12A7F153F7C94C Asianbot0
810,156,237 *541D60600ED698BB9AC9E10A34D99C4BA9F5D2B6 Asianfets
810,156,238 *541E0EF0EF8B2B09A74FE0AF8007755806493685 ASIAN-MARKET
810,156,239 *5419BEEE563C4B3BFFE3C15674BFE591EDD9598F asian superpower
810,156,240 *5417BF312A2D380BB7DD463319C607659901A18E asia reed
810,156,241 *541AD989ED5C892341CBB634071B924459A637B9 Asiassa1
810,156,242 *541A317CC38EE3CED993F374EBCD3A62CB852132 asiatisch/a
810,156,243 *5411CD5A9A9EABE6543F7109A077946A03E8C05C asiedugladys
810,156,244 *541279E1CA564C4A55F16BA3F91D0CE9A0491894 asiego
810,156,245 *541A12F0995E6C2A76BEA5FB9846657A88A45A1A asifind9
810,156,246 *541E65841B27C82296CDAF1E1E60DF691CBB5CA2 asifmunawar
810,156,247 *5410367749E56FF0191F85CEA7C63322495858C9 Asikadus
810,156,248 *5418D717CE6FA1479A9A2CB41639001EC9F4C523 Aşık–ı
810,156,249 *5417872E9B593FAE85A03CFD6D443B13C422B90F ASILv
810,156,250 *541D5BDB2F23F44EED186D93E0266CC96D6095B9 asilzzub
810,156,251 *5411C831A24C08662F0BC204FAF09E34E17137B3 Asinines0
810,156,252 *54166A48F23D42838DB2FBADAD1887E70E9920F2 asinnazión
810,156,253 *541C38911D11B0FC5DC76D672DA428DB507108E1 ASINNREH
810,156,254 *541A5D071D58D12EFC69E54E4332A2BAB28C56A9 As&Io
810,156,255 *541DE887C88FD1B6EF4B36443933E1B2DD51E9DA As+io
810,156,256 *541EE62FB825B061482DA7C51099340FB478B267 ASIpj
810,156,257 *541EEF25E034FDB0F0436832F96998AA30B84491 Asipobsw9
810,156,258 *54167C56BDA3EB89B7043667186C8C94AF830B5F Asirán
810,156,259 *54117F14B05A79CFFA8DF141E1F5F0D977EE92E4 ASIRVANAM
810,156,260 *541E4C1F4E1C5641325C33040E04767EAA75DB83 asish swain
810,156,261 *541279E8E01072AF13D7EE98D7DA737B00A974C8 Asiunema1
810,156,262 *541FB1503488EEB14836AAE99D5AB2F5FE01E9C0 [email protected]
810,156,263 *54133694BC32EB47844334CC51FAA832D00B1350 asix123
810,156,264 *541A1C51EA349F1E71548A58C39E4F1776D22B07 AsI?Y
810,156,265 *541B348FD5DBEDD5712F9FD7DE5E7004E3B2CCA8 A"s_j
810,156,266 *54194767071ED5F22C8EB99BE76D7A26DA2E98F2 Asj+=
810,156,267 *541D0BC39CFC6CBA30D09B93616D14B5D60B821B As%jH
810,156,268 *54158A5CEB1A2986658BDA921643E2AA1D53468E AS)jI
810,156,269 *541DD09E72FDD9511B069B8008F4025DEE27C63F ASjI?
810,156,270 *541462187C3A081D6FFBC9B82DA5FADF4B7D7C60 ASj-r
810,156,271 *541EC23C17639E6C067EF2C196CF2456B4F9CF34 AsjTr
810,156,272 *541575859953D9EAE093CD3B301BEE4CF8A006DC ASjUO
810,156,273 *541A54253E7953B14FE9AA2206400A1F13C28F18 AS%K,
810,156,274 *5411C040F17357AD939862A3BAFEAA934A162282 ASk.-
810,156,275 *541A7F76A1AF7F6120056E24CAE493AB053E0BFC As$K!
810,156,276 *5416DEBFE599B3675BE09BD7C7A20956272112D8 A.sk&
810,156,277 *541678488133D4C6D367646E03A7FD2D9F9859E6 ASK=c
810,156,278 *5418C0242BCB71985D5A3CCB5845AFD28968CED9 AskDad(Aka'WhereIstheFire?')
810,156,279 *541807F38CEE843A35A433E94F70F0347067A50B askeesille
810,156,280 *5415C0D59BE09D3BA7A3BDB2637C0FEEB4AA2B61 askhani
810,156,281 *541D10780336D5792A9886B7148026E64A8331AA Askhsoyn8
810,156,282 *5415F1F3143329BFE8A040DC292BCA9F311EFD95 ASKKB
810,156,283 *5419335D3614A5974D2E757550E0FD5F915ED060 Askl8
810,156,284 *541F4ADA1B230CEAE608CB11E60C604507A9482A ASKLEPEION
810,156,285 *541AC0D19F1C015005B980D9C42E010C593FE19A asklepiospriester
810,156,286 *54142E66E16F91A86B68EF130362676A58E7FDEE AsKlk
810,156,287 *54178A78D2799789832B90C2C887AE914F930BD9 [email protected]
810,156,288 *541A92FB68D0AE82E386E7C287DC9F6CCEC7B79B Askorbova9
810,156,289 *5415A122827481E62319802C49E2CD4CF7EC314D Askruisje.
810,156,290 *541954A31C8A9BB64D42AF23D08ABFBFE7AD7363 ASks,
810,156,291 *5416173F1D3677BE31DADB34784DFEA6E91F76F8 askthesportsdietitian.runnersworld.comaskthesportsdietitian
810,156,292 *54139D8CE1100A06E2397A5DE08459ADAE2C833A ASKW!
810,156,293 *5411C9C86665E5A056374562853A2F65DC77122C A-S)L
810,156,294 *541949E0785D6B549392532699D2D5B5E600DE2D ASL2g
810,156,295 *541645B6575AB98F41C3F7C7143751BCACC620B8 ASL2O
810,156,296 *541E2248A71FEDC51EF7DA1DA527F52A5B44D301 AsL5I
810,156,297 *541563F4F45EB72C4867B85ADE8782977DFA9208 AsL
810,156,298 *541770F0F9CC45C200861D0BDE96BAA2B0F362E0 asleep26
810,156,299 *5411FFEEC74A036F9A05A8205C4FBEBD57003110 asleepdgg
810,156,300 *541F5EB8E0CD3AD18F054FC4BA263C49626B63D7 AslF1
810,156,301 *541D80FF7E59215E7126182C0472521951B5940F [email protected]
810,156,302 *5412C0C285AA05A5D355AFA223AE242F2726B096 AsLightFades
810,156,303 *541ED760A7F298911D8F3908D7A54E727E64B131 AsLl#
810,156,304 *541BD964D6444242BBFE7BC8972145CB97C135AF aslligicha
810,156,305 *541C599F09B0802ECDF33DA713BE761AEC892E03 AsLlj
810,156,306 *5416F717856AFD836504649525CBE5552D0A8E73 ASL"M
810,156,307 *541F0919A92F8EC34C3CA783E7919ACB941AF529 As)lM
810,156,308 *5415FC2548549E53CEE144EFDE5269EB80E9F1BB Aslnby
810,156,309 *541398C0301EB760C2F36456E0E5CBEA6481E87B ASlPF
810,156,310 *54112F83CF06F1BA85D6ED9BB4AD64A8169C56CB As_lS
810,156,311 *5414A8E050B6C6695832E342602C947E8418BA29 Aslukuuning
810,156,312 *541F9E09DAD70D5FDB1D29524ACFA6277317EA0A Aslupmoc5
810,156,313 *541F54CB994A482A44E6822756E2C9A0C75C5CF7 AS"m.
810,156,314 *54151577F29A67510C77059FCFBFC5F6C627B725 asm010101Ik
810,156,315 *541E55FD31F88A594F2A15A5D63B103E9FDE98BA [email protected]
810,156,316 *5414EBDC973763684EAE9F8BFE6EB9AA5C6BD44A aşmışlardı
810,156,317 *541D03B043E3650C9F50E4EABFBD4E3254AF4701 asmithusm
810,156,318 *54140F1344B4B7AF989BA9CB0521BB31B3017B0E ASmKQ
810,156,319 *541AF8E7EECFF55A1911CC10AC0DD98DF10635AA [email protected]
810,156,320 *54182275F91E34D0E938A6B861B44E315C1E0A75 asmooch7
810,156,321 *5412FDF846EA2727931C8D52F553CE95C85BBF07 Asms=
810,156,322 *541EA4FF591CCDA934BF0430730FBD82B49CE658 asmU
810,156,323 *541C67B46DAC25595D3D059D320F84EA0AE77716 AS=mY
810,156,324 *541F32A774F7D18EE61BF093E859A7BC04B5FF5D AS,,N
810,156,325 *54157DB28B12692D131773B8ED440D7ADE9A7A07 AS!n-
810,156,326 *5413DCE9842D73BB1489E93FE3E3C2CABD2DB335 ASn0r
810,156,327 *541FDF7C8E2F284AFBEAC9DD80A24B44BCB0B2D4 AsN"9
810,156,328 *54101EA335758494D6B9C99256B7D527B1D90E12 áśnā
810,156,329 *5412FDA2644D38FDC5F1504256E7B86910E34F47 Asnaalupped
810,156,330 *541DD6D6E86829D40AB8F73AA72EEAA8F0456334 Asnaamat9
810,156,331 *541DCC7D586051450FEC1F304F609B37E7D8F5D2 ASNCD
810,156,332 *541DC6E0E99860A0D12D86B0F9DB25495359187A AsNd)
810,156,333 *541EBC024A752568D0E8FB5245865B1A24352BB0 asnepra4
810,156,334 *541BC4EE3D78E3C9E768F9F2D6C8C16BADDD8F5A Asnetsil3
810,156,335 *5410D306BBC6720549794E13B3833720E68A73F1 Asniimuing
810,156,336 *541F264D784106D0F93313D0E80463810E3E7683 AsNj5
810,156,337 *5414ADF3C4080A46F26425D71F841BB5BD16735D ASNNw
810,156,338 *541550105C915EEE0E525B43170C266F379C225E ASNO=
810,156,339 *541C4D0C116724E47B796D06FA1146BF1C16BE31 Asnoitpo6
810,156,340 *54171C124ED2197AC7C2C505D08776C77EFE6979 AS(NU
810,156,341 *5416EE78416A4B186AC049F60684024E3F304388 A$S?O
810,156,342 *541A265818D27BD953F6744F87F20EC6F4F8623E ASO_:
810,156,343 *54114FE7464DCEC2D24787A212787C3E8A773DBE ASO+%
810,156,344 *541A76D248405B2365A957D4F0A3C7A8FE7095B0 As#?O
810,156,345 *541A2A8EAB5A5AAD592D0982FED306BBF60F8CF6 A;s+o
810,156,346 *541A5E1F6436E196EAF8B89D02E005DBA6F540C5 [email protected]
810,156,347 *5419D61E7983A3455576AC7B25E56021D97CBB0F aso13
810,156,348 *5410EAE9A927C0A069C7DE0F20FD9DA6F99CB123 Aso6H
810,156,349 *5415D03C29157D7E1993A8EF9CA78C9E924A43D8 Asoavaaked
810,156,350 *5412E9CCC3C5136BCE62ED5CF295D22B999D0753 asociacin_de_guas_sc
810,156,351 *541BFDEFD8F403FC2F81CAEFF559F708D176CB2D ASOD=
810,156,352 *541E7DBC387B76D844105146266B3275F4C3AD96 ASOF
810,156,353 *54127AD63AFB35575890B1BA569D8F8EDFB2D337 Asommosed
810,156,354 *5411B75642C3E1CC1A38915F3EDCFF17F4D5954E asõmõlõ
810,156,355 *541B18BB768CAD919ECEA92B238F1EA419D129A5 Asomtsop7
810,156,356 *541969AC2AA442CFA5842C4E414A661B65121B21 Asonyered
810,156,357 *541050D796C79EF97F9D912E52CB1B56ECC07E81 A#Sop
810,156,358 *541F239470CC55FA60CDAD37112904DB8344C8CF Asôpos
810,156,359 *54180011200A9A7703DBE04726333F5418C54DD4 [email protected]
810,156,360 *5417E58495D9DA9A06C531A1DC110AF14C3D3402 ASOS9
810,156,361 *54132BC8DBC2C7EBEBD41D23961820CE85D214B8 ASOSTHERMAL
810,156,362 *5414622BC998A3E087870534FF9E347DFBE0FC30 asotā
810,156,363 *5419EDDD9D07BC300601D6A291087D91459DD74F AsoYe
810,156,364 *5410D3451BA3B6E41A04E00D91C83017A6C18C16 [email protected]
810,156,365 *541B1B4C7C9BBCFA3C9BFAF5665F55344B47053C A=sp2
810,156,366 *541240D5FCD37A5D126B4EBA03ADC20A60D239C9 AsP24
810,156,367 *5412ED4E729D7A9A21044BFD06A15739683FA252 [email protected]
810,156,368 *541EA58D050AC7369D8C7A985E1B884443D551C7 Asparanos
810,156,369 *541C81537B403F448699CC3B403F8E78F2560BDA ASpartaerem
810,156,370 *54173BE2BCC72C510998CCDB569E2676F55D24B7 ASPASIANA
810,156,371 *541490AFBB7979CB46221FB6DB65659CD62E8EDD As:pC
810,156,372 *541D2B2685A945FCC452CD4ADD51D34763F9BA61 aspectsreviewing
810,156,373 *54185532325C7CEE80C6011EF0BA71E78479607F ASPENDEADHEAD
810,156,374 *5411422CC7A89B60EAAD8E8F1ECB1CF744182DF4 aspenjim7
810,156,375 *541BE3C0CA9420656880EFBBBDCEE2BCA7BC7DA5 Aspenniki7
810,156,376 *541DAF56301D0E68421D1E693071D93F441A16F8 ASPERATING3
810,156,377 *541422241D30FD10DA4B92373E4176D6045A9BB4 aspergevamo
810,156,378 *541E784E1A367CCEEAB04052A89B58616D6BD938 aspettammoed
810,156,379 *541187C456FC3913FD2895AB1126F4C767EA5B10 Aspha1+!n9
810,156,380 *5418E954F4CBFE4F5D611633C92E215A52705C38 asphtmlopen
810,156,381 *54191B06155C73F3BC5473AAFD1F92C7ABB1E71F ASPia
810,156,382 *541C8DDB374A2F2D5798B862BC020AA545820075 Aspicimus2
810,156,383 *541A713654712C6C88B1151CE871C9451D917B21 ASPIPKNAE
810,156,384 *541ABFE2C0413E2C8F293DC7F937A6B3F9ED6BF9 Aspiradored
810,156,385 *541132993170AA4A3FD26FACE8008EEBC8C2202B aspiranter4
810,156,386 *54144CBA0663744576DF9CDA2BF5F94480ED1F70 Aspirara4
810,156,387 *5419EAADBEBCA6496B436D2D1174C0DD24D26D36 [email protected]
810,156,388 *541CB908CE770F5ED898A80EA06ED0CD217A93CB Aspireto2
810,156,389 *54188964AA1D3DB50E3B1F53A926FE7627ACF8EB aspirinetablet5
810,156,390 *541C25316418E72130245BED387D33E4850E2A8E ASPM3
810,156,391 *5413F836F76630C8C913A2D4464B9976EAF6284B AsPmU
810,156,392 *541D6DA9B6276977FB72EE6CE868E751276F1732 aspoester1
810,156,393 *541AE79F6D24794FCE5C555D1B77998B552B635E AsPor
810,156,394 *5416429B1C662CC7FFDC35278C38F59673CB3F45 asport5
810,156,395 *541E3E47F3DCFD641681347D337BDD40EBF68ECB AsPR1
810,156,396 *54147C3BDCE6D607F38977D147CAD3CEE8834432 asprātīgs
810,156,397 *541AEC1DD2603BEFA72D7F6324358F9C8E676C5E AsP+w
810,156,398 *5413761FE6740C43F571A2EB7A26CB90183227DC AS-$q
810,156,399 *541DF2B5B09D8C6529F7AE9BD0ED8112F8F31F7C Asq.9
810,156,400 *541996E43C86E5A7EDB72A572F97FDB66562DF13 ASq9S
810,156,401 *541EBD516ACF274B2BEA747F1E27C3E5A6C5069E As
810,156,402 *5416BC4485AA57CC15395F5007B6A02094E507B9 As-QH
810,156,403 *5412FFFF17B2FB1CFC71CEBEE56CAE1E7D6EC29F [email protected]
810,156,404 *541087C12F964595CFE1BD1FE41C75D468135306 ASqMa
810,156,405 *5415FE26CA58CDCBEAE6398340D72E6AB9E986E3 ASQnO
810,156,406 *54181C7FA71A6E1C68466DF84DAF399CDC28487C A
810,156,407 *5413321BA17C77483F4BBA118A17D510C8D9C988 As;Qr
810,156,408 *541D28B7B16BD59BC7205003307BB10B7E0B5817 ASQTk
810,156,409 *541F30AEF628211AD87F3FD869748DCBB479918C Asqulth
810,156,410 *54141A03FD69AD0183F34C013437109AE461A87A A!;SR
810,156,411 *541E7B002EFBF7008C0F1E5D0454DC9C8B754DEE A\Sr
810,156,412 *5418E7791B6922A99A91A0C0E3F19CDB2AA26EA4 AsR+(
810,156,413 *5410C5E1A68BD905AD33423ACCE4CC4474C2BAF8 ASR59
810,156,414 *5414743EF66DC4C3A6B83D97642A64A033654E38 A=Sra
810,156,415 *541EA153D56A6480136084A5B1D5F71DF1BF32A4 (as Regis Philbin) Is that your final orgasm?
810,156,416 *541E82DEA0C1ABCB44296E36F2807FA62A762F25 A:srG
810,156,417 *541779F4234BFE498A62C31F04ED1EC0BC65B651 [email protected]
810,156,418 *541C4347271E5DA15BCE48DCED73DAD7D5B96A1A asriana chie
810,156,419 *5414D5E35A97FB4AA455E68E56BBD1CC8697417F Asrinnmip3
810,156,420 *541F0008EF7E1C9C5FA304CA45C7E58C3D833539 AsR:Y
810,156,421 *54115AC6E47C0CA965D9EDD634F67F884CFB93FB A$/SS
810,156,422 *541AC99DA8D3FFC67E4683A8CAC6E2C1C780E626 A
810,156,423 *5412A6E62A65F5FA9C73BB00A2D6EBEE505D75DB ass0da7a
810,156,424 *5419012244B904F02A6AFCBCA5A5DECE39F6613F ASS1M1LA71VE
810,156,425 *541A2E206F3A8469EB11AB4012129BD85A4AF8B8 AsS7a
810,156,426 *541F0FBE1DD6C3FD96F91AAE9B238970D11CBD10 ASSABLEM
810,156,427 *541BF10EAFA7573FE00E51A2781CEA0F839FB6EB Assabout5
810,156,428 *54140C0ED38D57331C4A580E31A135B0350EEA6D assadleo
810,156,429 *54194F07B7056499C6C1898105490ED8D6ECB672 ASSA'DY
810,156,430 *5417EA67D5E1FE157949195060BF98D4ED059576 assailmented
810,156,431 *54147EB020022F2B9FB52C937CE381329DB154E3 Assajiem6
810,156,432 *541F8C22DA45FA4DE981844A567C24B80BF418DA Assammas1
810,156,433 *5418B9050E2E7DE307EEA9D7C0361365851A7900 Assanial
810,156,434 *5417069F9717ABEFEEADDC6D6FD5655222939C45 Assarthur6
810,156,435 *5410C2ACA20DA75C447389755F0EE1B467D11158 Assasoim2
810,156,436 *541FDC5C81A58EB671799F9D8BCCB8CB4EC67CF2 ASsbw
810,156,437 *541D7C507FAD56A225FDCCC257AF67B4D670419A assc4
810,156,438 *541101146458D35508247277D30235FF730826E0 Asschein3
810,156,439 *541100CF78D23855B1CA6434FD4095C1C33E642C asschuur
810,156,440 *541C8B521C2B4FCCD736C9FDE1B7D3FCA0779D0E AS/Sd
810,156,441 *541E9B016C333B8CFFF2371A53D1F2F4E681E3BA Assdarwin3
810,156,442 *541FFA8F056E584352E42B1C1025C5F733E4F8DA Assecondo4
810,156,443 *541E4A7D2AFA410484656C115422CF45FD028B55 ASSEENONTVSERIES
810,156,444 *541C4F22A6723B77C1DF15E693336969BE66EA22 Asseguro7
810,156,445 *54128AAF6C51399CF13AD08CDA86575EE8527DC5 asse’ler
810,156,446 *541830EBEBDF2C95EB8E4674D19870E2E3A013D0 Assemblages6
810,156,447 *541A3A336C7033856D2CBBE506CCFC4A63295E10 Assembled4
810,156,448 *5413846460656B8CC3D90F26A05A8873A0172403 assemblerbefehls
810,156,449 *54123568BEB59287E6432353A1499DDE6D8D4941 Assenel8
810,156,450 *5415D8269849E29F50B0DF3104C98AF584E08F21 Assenram
810,156,451 *541A97B8C0245FCA64A6F6FBE8547C38BDB3301C Asseront9
810,156,452 *541ED6A126DDADACC6B0FECBA9E84DE9A12BC465 assessing-authoritativeness-sources-wikipedia
810,156,453 *541D2503156FDC80F53874F177E2CBCB7F3BB03B assessmentimprovement
810,156,454 *541479121CF53C24585398A4F527E46E9AFCA0E2 Assetnoc6
810,156,455 *54113701DFC3FC79DC1237B4071AA56F6CFBA0C7 assetvamos123
810,156,456 *541F84C70A2E5D1AF02B5670285C6195F4833876 Assfo
810,156,457 *541B04D644ADDF0A39872AE95556DB02FD8FA8EC Assholeaggies
810,156,458 *5410487EFB5D82456CEDBFC2E292276CCF88556A asshoming
810,156,459 *541EA95574C5669B98E143BA62DC2FC77CD1AE3A Assicuris5
810,156,460 *54128B9F0F950D7F1D645A7CC0F84E400386D73E assierai0
810,156,461 *5414CC66092BF90F76599A61079239548A78A9A6 Assie'rions
810,156,462 *54110869DB82EC732218403BEF373281E472A385 assification
810,156,463 *54150E6DC7030A2A52336AFBE20EF43567B17897 ASSIGINCAK
810,156,464 *541324D60609552697C34EA84E2AD1C2F28FAC09 [email protected]
810,156,465 *5410A9F743C842A4C42BFAFCBF084C2AF2F98FC3 assikal8
810,156,466 *541A87E85B59CC7F4D1111E970740F3480A11426 Assillavi0
810,156,467 *541E4B2B25B66798CFA94BF76BB599E380D44209 Assinona2
810,156,468 *54110798C37A75DCF6E3045F5C9D12601B3E4753 [email protected]
810,156,469 *5415DDE3928B8A904F6514588F1DF3899BF18995 Assisan2
810,156,470 *5410F32403619F4BB2318B7AEDF58D42286FD3D9 assistance.candelwic
810,156,471 *541CCE85E2214DD5D264EC4F39C4413D3E0FC540 assistanceevacuation
810,156,472 *541585529227204B9CB89D3EB7D92966FD190B03 assistancepresent
810,156,473 *541B75F5D994F8449B39F562F375FAC4023AFC8A assistito9
810,156,474 *541C83DB5F7E25453029801435098AC9E46BA660 assjesus7
810,156,475 *541930B9EBB8FBEDA92342EF41062BF7B5B1FA69 Assjoanna2
810,156,476 *54161AACC89ED261EA5234DDBA7CC2BCBBCC1909 asslarry9
810,156,477 *54110045537320FB12AB7DDEF6FD5623EAEB2516 Assmunch29
810,156,478 *5418819D47752D434EBCDDCE547FAE029AC573E4 assoalhava1234
810,156,479 *541EF5C6FB352B77B5EA370B086072C170CE71E0 association」選為european
810,156,480 *541B1805D21528B5080411F74699BD083BA00816 ASSOCIAZIONETMP
810,156,481 *5417640C7CCC876EC10D53C9401FB3369B5F1119 associsti
810,156,482 *541B0875D0C13BE71DFC635EA187B448DAF3836B assoclHlioii
810,156,483 *54187D524E441BC1E0EE0DBB25679B28A0425D4D Assodavamo8
810,156,484 *54161299946664B5A394E27C25322FFD010C0EEF Assoduuhing
810,156,485 *541C946F205BE253D33557D553B72E70225F2EA2 Assoetno6
810,156,486 *541D95886C66E07F478F74055FFA131E2E044741 assolle3
810,156,487 *541490D10DE03C3798078FAB5CE2E30B835480A2 Assommano6
810,156,488 *541DAD0781F031410979ED8951C7A84BF690FF53 assommee4
810,156,489 *5414B72E4C630284CA190550CC2037F982D00BB0 Assoonb9
810,156,490 *541B4816F0BB20EAD5A5D8513A99DB6A804CB353 Assoori
810,156,491 *54154DCEDC045C77BD9EA5E3247CB6F3766C9D6C ASsoP
810,156,492 *54100F040A55575BE28D973D7F9FD0715BB47577 Assorazl8
810,156,493 *541F536F6ADB1D6E50FF345EE9C9441C9951073A Assorbita3
810,156,494 *541046E6A58710C8872383BC93F509F5FAD06CA5 ASSORDATI2
810,156,495 *541CA351B256AA9DE92E75CFCA2E52883E7529D8 Assorgied
810,156,496 *5410A763D5D4A89F4016C4D6977799F0205239CC Assosiaatiot
810,156,497 *5415444E33E94DE9F6C678B64F7A39CCFD48721C Assotsuu1
810,156,498 *541BBFF46385D14F4E24FA57E62CC42EAE9141CB ASSOUPIRIONS5
810,156,499 *541D4810EBC9FE2234A38EA46D0E983AD7003E4B Assovuaned
810,156,500 *54177D110DFBFB632847FF5156F49234CBD5C18F ass-paas
810,156,501 *54196E25609DAEE17DC30CC4D3CEAC8D760A7144 AssR4
810,156,502 *541904FB8C9EA7A1F911435F6BB4E9716BE0D824 Assrenne9
810,156,503 *541719C227D13B53C08FF2CB1FDC961B09C24207 [email protected]
810,156,504 *5411DE7A239DAF3C688770612E6F5340AED3B936 asssnicker
810,156,505 *541B928651F808A664C6723F63EDBB6BB82642C0 Asstroom5
810,156,506 *541AD7795821FE4953B804DE115B35606728E71F Assua9ab13
810,156,507 *54112EB2AFCF3142247E31BD881F157D029AA918 Assuaged.
810,156,508 *541C9DAC991451EA0E24E4BB72A65335E1CFBACE Assubjugates
810,156,509 *5417D4A5CB66A180D4204DEBB109C6D5E1AAFAD6 Assuinen3
810,156,510 *541004656381BF6BE8F8B59CC8A65D9055560BBE Assults
810,156,511 *541C8AC36490021614F6D935623C32ECF9783A08 Assumern0
810,156,512 *5415E69235EDAC2DAC01E88DF26E858EF4BFFA7D assumirnosemos1
810,156,513 *541A6AC680493C916835EA4542D9297FD5989255 assumpt7
810,156,514 *541AC80E7C51576E50B66B4CCCA28B51C834856D ASSUMPTION--CATHOLIC
810,156,515 *5410EE1AED53AB809570C9538E7670A85CE910D8 assumptionutmc
810,156,516 *541D18E113662B8C6E0DB923C533508ACBA9C8F2 Assunnapped
810,156,517 *5417C44654892F9B5817F90A383A87E2C4AE7205 [email protected]
810,156,518 *541C181FF2BD57B4EBAFB6D7611FABE8AC80B883 assygnding
810,156,519 *541B9E10A6AEACAB93E700C308329BC9C7ECDFDA A&sT;
810,156,520 *541AB26457AE50A0D6C26AE39A1BEE7B36CE7332 AsT5P
810,156,521 *5410C137B88A1AB9154CDBBF0E977BCCACC91E8C ASTA1VISTA
810,156,522 *541E825B7C777AABD31FDCEB117A7F8B3865FCCF Astadasaparva
810,156,523 *541E99E895B6EABDC8DF4944CDC1F8269367F544 Astamam5
810,156,524 *5419A1FC8EC12EED5F6DF0065EED6977769539F5 as.tancred
810,156,525 *54159AEE1021D56EDD02E4BB4FCFCDBB64FCB4EC Astaxia6
810,156,526 *541CA2B048C4763F0A5548FEEC1ECED2F5AC729E AStc:
810,156,527 *541259F9C7A9B5E13CD172869586DA1D980B518C A?Ste
810,156,528 *541DF8D3DF3F68C5A74533B832CA4058DED34A6C Asteine1
810,156,529 *54154D3CD92026B71CBB15BD52CFC69C217109FD Asteisin5
810,156,530 *541F8E58FC83891493490CED2587CC2B275DDE93 Asteismwn6
810,156,531 *5415BB4A94C76A098E128E14BB3121611461D144 AsTeK
810,156,532 *541DA9906842DDFCC4D057D4CCD0593525219705 Asténiennes
810,156,533 *541377587055A121561FB84FC67E3D807318335A Asterating
810,156,534 *5410C5B361A90726C0BB1FF5B9DD1A47BC2AD37D Asterell0
810,156,535 *54173DE759136AD7A7C24989C25435AC340CEF9A Asterixes2
810,156,536 *541631600ACB25558BAD274C3D5450CB2A279CE2 Asterixg1
810,156,537 *541C19973AD0A4BEE10B9000D43D303497A2EE62 Asterixl9
810,156,538 *5415AE4D5ACFBC6170A65DA230C6B1B027BCDEF2 asteroids14011500ltn
810,156,539 *541B193FD3F95F6EBFADF22126BA0E013BD3863C asterstein…
810,156,540 *541DCA7B131FA081D31B74D5E3B16FAE4879FBC2 asth3n0bi0sis
810,156,541 *541721F98F0DFA0FB67A11374EA8AAD79063799C asthefirstblow,behappy
810,156,542 *541D61BE43B2196E3300A3CC1FDCB1D604F4E01D ASTHEGUN
810,156,543 *54198F42934F8C9D8F7C558F69D45EF496EA262D As the Sun Fell on Summer
810,156,544 *5414C1CEB20858C043412A79C44DA17E3E3FA826 astheworldturns1970s
810,156,545 *541E2CC2223ADE3FE3058BA3CB7495309B35F1CE ASTHORINS
810,156,546 *541E9BFC075823562FF613992F4F03BC134109AE Asti/
810,156,547 *541A0112C3C3AA21ACBA63F26B7C079B18665E86 asticotine
810,156,548 *541F622104E64C16E5C1355ACE78048B3D938100 Asticta
810,156,549 *54138D2024FF197B09FDEBE4442A4911EDC28A9F Astigate4
810,156,550 *5411FE3FAE6103BE4662A173E96B7C8AD8E32876 Astiller0
810,156,551 *54165E56EB0FC66C831F6990F3353A96741D1888 Astinente8
810,156,552 *5417BC8EF7A7749B576ADBBD637A6FB3AF699968 Astivity3
810,156,553 *541AC7AD672343B0E2C21779264430715CDC4609 Astj1
810,156,554 *5419414112FF5C6B3A1AD4319FBC99AC5C2E505C Astobeharri
810,156,555 *541B6DCDAF4E982AE7FB9D53DFAD1B2AFDEB6EC1 Astoraged
810,156,556 *5416AD47333ACF63653F7AD303E37F3384085B98 Astoressing
810,156,557 *5417D69274C166690689BF06BFC030E1D6BA10DD Astrailianich
810,156,558 *541125F547170E58ADC24EFAB00BFD56AC60F167 astralcarneval
810,156,559 *541349EEF8711E042C6BCFF17EDF1CA79ABB34FF ASTRANTER7
810,156,560 *5419DEBD31FDF4116D0DD6F24ECB3DE31FF87F08 astrikwn3
810,156,561 *541EDC5A05FCA6AFA5F7BA68864AAD99124FDA42 [email protected]
810,156,562 *541D98ADF45B68CD59F9E03E13889249253DDD24 [email protected]
810,156,563 *541641C32EB3B22983A6184E3E215388E3E6578A astrodynamiikassa
810,156,564 *541BAC4271609C800841A4584EEDA21921C25A4C ASTROFOTOGRAFIE
810,156,565 *541B47F29913C79D79C33747CF79714AD12FBFBC Astroglia7
810,156,566 *54111DAD658C908AD9FAC3673F0C97DB90CFA0EC AStrom
810,156,567 *5414362BD2F751BBBC97BB4D6B50AADAB7BA1840 astronautarum!
810,156,568 *541A794FE7F1EB3E08958CA021840E5E8DBA4F22 astronautroger
810,156,569 *5418B3E6B5E8312A23632432AAC526B0730892F8 Astronemaa
810,156,570 *5419D4468553AC05316888773BEDB32AF3B6930C astronomm
810,156,571 *54182F37CF0C2A36A2048A1C5687B84D3A56210B ASTRONOMUS
810,156,572 *541A1763C185563D401E11717116494551F44649 [email protected]
810,156,573 *5419490FDF926F632C16B1DBE83ACBF96BCD77AB ASTROPHYTUM-CAPRICORNE
810,156,574 *541121EC2BF22548567CDAC6CDDB23CAC98431CC ASTROSOCIOLOGICAL
810,156,575 *541B6D59C42F70C8CA5F802902BEBE0D3279B22A astuciarlha1
810,156,576 *541C64A773CE8110C73703ED8E07D53ECE9889DF Astumani
810,156,577 *54162BB0D30FF455412614190A3B3E80496EE983 Asturco6
810,156,578 *541AD406E045C9258637A5B0D065261BF323B17C Astuvalla2
810,156,579 *541B81634768C66D8B1EB134F51A6CB8AEE56FFE Astuvaned
810,156,580 *541A50C65DFB5BFB15BB9DC1DB9D3DCC0318DE64 AsTV:
810,156,581 *5419D62386BD765987CAA5B0DFBB681DEC82F2A9 AS/TY
810,156,582 *541B551FB71BDE25644EE69D7C83809EA5BF5871 Astykki7
810,156,583 *541C867D1C37D68F9143356DE1EC46CA053E4CA9 AS:tZ
810,156,584 *5418AF7A9376B206D3878CB031C5CA94A79CDC3E A.Su+
810,156,585 *5413F8284CD03A260C5F2DD76DC75843BF940A58 A"sU=
810,156,586 *541D829E3A6C084547A7DBF50CB97693F85390E0 As?U;
810,156,587 *541487A84BF173D9A1E4DD0D89375DC04185AB28 ASu0Q
810,156,588 *5418C0D9D98363D3EB8FD76256CB3E300B60F340 A$Su4
810,156,589 *541CCC438EC0761B3496526A479F0FADBD817E91 AsU!7
810,156,590 *541E5987AC7B1096D323832EFDB5EB4C61FE73B8 asucafe
810,156,591 *5416FF0FB9A4DAF406EFB0441C2E4CFAAB5E61DB ASUEN123
810,156,592 *54179DDACD3B1D4010F8075DF20BF0947845A574 A/suI
810,156,593 *54105ED7C1B641B8AA719BE090AF4000DF69FD4B As$ui
810,156,594 *5415E5F773170CA13A90604EA25E16FE08A91142 ASUIl
810,156,595 *54128BCA9938DA26FBB76326F26E41A5F44689F0 àsuivre
810,156,596 *541BEC23425EC924EAF9307918ADC5EC79EB665F asujiaan1
810,156,597 *5414C95805A25743CCEBCC86C0C556223917A07B Asukawin6
810,156,598 *541F08B71F1A8E6B91EEFD08E36D9ADEE77FBC09 ASuKr
810,156,599 *54101343A6170425D081F15C898161BECBA011E3 asUnited
810,156,600 *541C549C5A62B38C6738C85D025A04439CFE4AC5 Asuntolarakennuksiksi
810,156,601 *5412606207716D5205C8AD7F5E6F251F95B243CC asuntomarkkina
810,156,602 *5416AB1BCC0AF68BABC26EC9E56E813B4A93B8AA Asuokias5
810,156,603 *54109A33C0F944AC312A09CC242837A7694FBA86 ASuqK
810,156,604 *5414A3A352393B5F872E2A7AD238E902FCCFB3D5 Asurini
810,156,605 *541FDD44D8D48155F330BF79AF81D5ADD6108EEA ASUS125
810,156,606 *541FF69FAC32E96EE224D00991F165F14FB2A523 A"/Sv
810,156,607 *541A71BC42E56422E55D9E0EFBB3F9A6EFADE3F8 AS=v/
810,156,608 *541578BEC9544195180AFD03F7BBCE091350423C A&s;V
810,156,609 *5417664B3526F75BCCEBE80EE74225FD71DEADBB A:sv?
810,156,610 *5419A68DEE95C09DA3AC399D926A298FC4816AB1 As_!v
810,156,611 *541A1F96260F6EA84E6AE82639F922BBBB9B0800 AsV7t
810,156,612 *541966CB153FE681633BB55C0FBE5FD9ED2C4DBE A
810,156,613 *54118213EB0788619E0955B23FC0AB129BA8EFD8 ašvą
810,156,614 *5416C5776E03136744557FC65CA1F7A0BD8F18D7 Ásványvízforrását
810,156,615 *5414D208E1896AD371BC65011E12142519B5F4B0 Asvezels6
810,156,616 *541B4D65BF3524B9E383411C18FCBEC257D2F04E As Victims Would
810,156,617 *54149CCA73693F287368E1C4FC55D290AACFD887 (aśvin)医药之神
810,156,618 *54173102D27BF82D5ACE06314151300B381032DA ASVX0
810,156,619 *541E3427C0BB6CFBAF5A38B81BB9C5F08B9820D2 AS(W+
810,156,620 *541355220974D873E30A7959A61541ED80013E00 A?Sw=
810,156,621 *54164FB023C9172AC6462222934EF869762A000C A=&sW
810,156,622 *541DC148FDB14A31E20E5214DC2DDA91F2EC7703 A#swa
810,156,623 *5419E4A29BF82877AB03FBC713D19A6FF742CFBA ASWARM3
810,156,624 *54183F2EDEEE35B1B9A53BFA5E2099D1CBF0A03A Aswayuja
810,156,625 *541BA715586173C8A3FCEAFA49AB89E0932AB166 ASWERTY78
810,156,626 *5419C5768BBE37013C81DD16758189BFCAE4A396 Aswf!
810,156,627 *541813D2554B122258D15771FDB6F451D348FAE1 ASX4-
810,156,628 *54148D6E226C14BE2D8430D03C15ABF5CE713BB7 AsXDN
810,156,629 *541E6FBB66C0996A8C42D2DC7EB40A1A509FEB00 ASX;G
810,156,630 *541DD23FA0270E11ED70EBC304F5AF7FBC123ECD asxlisting
810,156,631 *541548FC96371D4F677F1EC385ACBAC91C3B6443 AsX;r
810,156,632 *541D8192CC5BDFA5853A1AFE52CCA2816F0C595F AsY=&
810,156,633 *54131C267B7959984E4F99F519FAA03222B86E06 AS.Y4
810,156,634 *541DD97AC43E8E47C89CDBA4664737CC6AB55E71 Asylbek
810,156,635 *541AFBB19F00987338E0ABEF7C9FEDAD1086E5B1 Asylum(7"edit)
810,156,636 *541CA01173C63960BECE70B4DA06998C41652C11 asylumkyd707
810,156,637 *5412BFB532DF41F726659C0910DCE2FF1940C377 ASYMKULOV
810,156,638 *541D74E58088E3BEDACC31FAE0A2BAEB676C8DCF Asymmetrische1
810,156,639 *5419EB72E6249F69865DFE777E6DDFCC5DA6C0A0 A!SYn
810,156,640 *541A17D83880A048B412C239B2D908A47AE8F851 ASYn:
810,156,641 *541A3C83A087D7167122E456C8FF92D99DCC68F6 asynkront6
810,156,642 *5418D5D8FA2656B71CFA5147435F9E154C145100 asynnsoukrasmy
810,156,643 *541AE3552B8E48B7E5117EFF3D8C4F055F23F0E7 AsYQh
810,156,644 *54130822A063488BF140B98F4E64C55578548C54 ASyY
810,156,645 *5418EC1AF6A203CC481496B7285CD173EFDE23B7 A$sZ3
810,156,646 *541A7D649716681F7C036FD13A699C5EB0A7CBC4 A#sZ3
810,156,647 *54152B45C9D2F5550BEEE8CEC504145FEFFD8866 aszalótól
810,156,648 *5416EF3C0713E9F728D874493DBC6854D3072359 AszbNtYlrBU
810,156,649 *541E0B9C77E382F1BF15CDE870C85C076D17F99C ASZgc
810,156,650 *5411D2297246E91CF78E2BFA4B4AAB732E4FC3D1 [email protected]
810,156,651 *5418254F47F58C42B90F27AB9623C4F77E9719C3 aszprangeli
810,156,652 *541573716CDFEC680FCDF735EF5CEB368115016D ASZr6
810,156,653 *5418D4208EEE94697502DE3408038F271A29A06D ASzSzR
810,156,654 *54117415447EFA1DA526CE32BEB0E6937D2AE19E ASZTRAIOSZ
810,156,655 *541F848D08E4CF7A06160201A3DFB5CF75937B1D AsZuc
810,156,656 *541056C5B9F535F8CE242272255CD5CE5981CB4C aszuf
810,156,657 *5418515E1D163F0ABB33FEF05F94AA75A63ACAC9 [email protected]#aszx
810,156,658 *5415EBDB3B1DBD429FAAA077F531C0191A14CD6C A-:T_
810,156,659 *5414724D1BB3093F8D57BDB9344125AFC8154826 A,#&T
810,156,660 *541C0AD9B3D42E81EBF70B86FC608A0451E828CA A'-T
810,156,661 *54188D3A5746271F1D20EB127BA1FEB75C2BD0A4 A)-+T
810,156,662 *541073A88B73A1224B896D7654CB0A2484B2D63B A%.)T
810,156,663 *541F6665E0E9AE73DF5C4BA4D551AD1BC2E79470 A+
810,156,664 *541BB02E21BFCAC4A7F42293E902E076DABF2046 AT-::
810,156,665 *54149F75FEAB229B224D993AAD8E3295B39A4625 AT
810,156,666 *541750D0F1814B4274EB0C48AB9991076D981209 A:)t"
810,156,667 *5417C927DA7B59A699C7B135505F3DE88C4F837E At!#,
810,156,668 *541EA3AEDD6715AB30C1881BA3EE180FCC3E7421 At?_/
810,156,669 *54118854A2D80E34741830322039587DB88758B2 At.&"
810,156,670 *541F60ACC7E10D19F5487C6781A7802A0F95E1FE At\'
810,156,671 *541C47D077896CD9BACD5E658D565D246A98297D }a% T
810,156,672 *541A54AC43CE90BF50ED2DA71FC25D15165A95AA AT/0"
810,156,673 *541B351E3FC37F009B712F8B33C7743E76C25DDD AT03j
810,156,674 *541FF228DE765BFF4B2439DD00DF9EC2169712A0 At0aG
810,156,675 *541E947AD00D29B6FCB382B0B105A986B819873C At0.B
810,156,676 *5411639BC5CAF3CE6A18F51DB6E82C8F162639B6 AT0N&
810,156,677 *5414A9622F9284B11822CD0CCFD16A825CC00E3B AT0(P
810,156,678 *541139CD4F4EFE8356CD7BD5A1F0ACD7FC37DA90 At1%(
810,156,679 *54178938EE0D652CEDDD06C7F0AC86D36234D7FC a&T1
810,156,680 *541ADA21067335F1C179DD41C603D2E1FACCED8C AT12p
810,156,681 *541DA26FA90DDE58F2878C0FE165C327F496FC9F At13f
810,156,682 *5415A84C6280C2F4BE410529D7DCC6E6167D052A at-14_kornetreferenc
810,156,683 *5416F0DC436B33CBD79DB3455A6D8E935C8331DA AT:15
810,156,684 *541149274FBFA9C5DF88571FF1C87B04F0DE84BE A"t17
810,156,685 *541E13483EC69A0C76A9006FACD4CDF0C4EB2618 At1A:
810,156,686 *541BDFB4FDA011950E12234EF2A6B6F997F3A15E at1g09820_draft
810,156,687 *5413E31D12FE8F30F10C55EE082ADAE5B915B196 AT=2.
810,156,688 *5419F73711D63D1EC1B7308D71460906AB071B0B at2g39660.1
810,156,689 *541ABA1FB0BB2F0D8C26725986999A2667D675A6 A#t2q
810,156,690 *541E81702FBC2ADDBD54497600E53E64B3F2FE3B At#2r
810,156,691 *541034FED03A15735AFFD61708FDE8D68423AC96 A(T3
810,156,692 *54193AA720BF831A72A76FF8DECEE9D418CE4DB4 AT"3)
810,156,693 *54142A87596FC87244ACDB69DD31548FF3299BA1 at3228000
810,156,694 *54199379E4006313F4302C3EE490A9CD04E443AB AT32W
810,156,695 *5411EA38CBB4497DFBC9CB408593FABD3666FDC7 AT#3A
810,156,696 *541AF32EF8870B2C821F0DABE17DA828CECB83BD At3A!
810,156,697 *5411DD65F655AAB830D13C63DD3BC9503CA1EF7E At3CC
810,156,698 *541149E7DC7FB26380B16571F3C5F4A9717E8869 at3g06850_draft
810,156,699 *54180B9D0687A77CDE32AD279E783A263BFEBE1C at3g23160.1
810,156,700 *541D55B5AABCBDB75E8BFBE2A218284692477A0D At3,o
810,156,701 *541DF10B9C3AEE90B319F670E7BC7313D781FDAC A/T!4
810,156,702 *5418F7BED0AE2C456D294287FFC92DAEB3CA2A02 AT43b
810,156,703 *54137F302BD52ABD1E5029B48F3EE99F7E7151B4 AT4D2
810,156,704 *541C8A402D71AF31F43A2D1A454EB3153331F9CB At4F#
810,156,705 *541376941BF9EAD599F1D7FB6E994409DDD55BDD AT4Nd
810,156,706 *5418F187801B209BD11772D1030E4248972BCEA7 [email protected]
810,156,707 *541677A258FD85F90CE4D418D8EE9F3F8D4372E5 At#4Z
810,156,708 *541BA1405A098DA647198ACB2916C5F69F695A17 A+T5)
810,156,709 *541CECED34E2773B6DC536C68A4F5DFC97E77289 A"%t5
810,156,710 *54190BCC166A567EC08AADA80E9EED4AC08A218B At5?&
810,156,711 *541BC7C2B02F8E3E454796E4790FA8DA2A78DA78 AT5FB
810,156,712 *541BE81715EF28A18927EC4B40EA7F997C9F7815 AT5mK
810,156,713 *5412C700F34DD57C606D7A6458F47232A436ADB5 At5N2
810,156,714 *5412DB54E88E72F5ECAE033D0719FB37B97E1C9D AT5.P
810,156,715 *541215715D6C1AE460B0315FD244A7C33EDCE724 At!5s
810,156,716 *541AB8D34F3238A6D7A90603D9B3883B3BEC9B39 A:!T6
810,156,717 *5414C1E9619C630BA9D9453CB4B994EE38455076 At/6+
810,156,718 *54108410C6193E9CC32F41D7070425F8311F6BE8 AT6mX
810,156,719 *541DF60C14A92D07EA3F92131729C118A7CA216A At=6R
810,156,720 *5419AF1B809561DF747D5B97EEF134B10451D9BA AT6sb
810,156,721 *54167FBF3F29C4CE3B1031DC3F45D1B5D2E5AC73 A_T
810,156,722 *5418A083F74F57BD71FF66F24D9F9F7BCD16C24E A.T7+
810,156,723 *541C90D8370D883233561D7C2432BA35F638DBC1 A#;t7
810,156,724 *541C9A795C1A2CD323DF2B649B761316D9394C42 AT76C
810,156,725 *5411C7CD86111FDD98AEAEE8051CB30273F532C8 AT78%
810,156,726 *541526802F8E08FFADAF8BAA13B8291BFA0257DB At7"h
810,156,727 *5419957A640E298325FC1B56BCAA32BBB160BC46 AT7SB
810,156,728 *541008C2DA2594C8AEE1F56889F7465F6F3DDF0F AT;8,
810,156,729 *5412C0416F7EBAAD9B3C8839721C57CDBE9F0A9D AT:.8
810,156,730 *541AFFFBBA6F4045239D216A5FEB31EBBD5782C9 AT8b!
810,156,731 *5415799531454EE41A4E52B9AFFA155213A94D77 A;t8M
810,156,732 *5410B8E7E5808FB4930D36950D6D954552932048 At8SW
810,156,733 *5415FA92784D84FA7F1B745B660231B04C204A6E A)&t9
810,156,734 *54151DFD5BA811BF10886B5B3FD3B00D83150447 A%t9;
810,156,735 *541B633C0250B781125D0AAEDB0368D6228F7CFD AT#92
810,156,736 *5412C0FC13A13BE6C9834323A62140C080979448 at9523
810,156,737 *54142AA88FEEFA7FF4C327190A5DE32749068A51 At9aR
810,156,738 *541337916133E610C3DE1BD686F1ACAF77B4728E AT9#H
810,156,739 *541D970D3CA6FDB64BD07DDD513F190C52CD2FC5 AT9o(
810,156,740 *541D322909183DD51E82DB0EB712158C6D90220F AT9p3
810,156,741 *541A8F40DC136A2A68D1495707F8A533ED4A060E A$T9X
810,156,742 *5417156ACF290B2D5084E977F243F5AA01148E9C A&=Ta
810,156,743 *54126FD8FA9A986724F8825C895B717EDD482CB7 A%)ta
810,156,744 *541D41699268086DDAE2F07A0FF76FCC986B5700 ATA75
810,156,745 *541DEB291C91D60013B832533A6176B91A87EBEC Ataamivs6
810,156,746 *541FDF2E13F18AE5FF1424301F90F361941AFC1E ATABEKJAN
810,156,747 *5415AE6C477728B8315A6DC41006C70FADA3CEE5 A-TAc
810,156,748 *54184C358181B8D05531161182E6B5DAB2170999 atacamu
810,156,749 *541011E91E8C3EE78A995DD0B4A3D6E506A83DF5 atacansts
810,156,750 *5410893380ED58FD6091EB6A09456A81EE2D402D atad erots dna tpeccA>P<
810,156,751 *541E72F35A984C4F83A1996980F8A9F13AFEFC8D ATADHANVANE
810,156,752 *5418F299C992C0414FB889222A98E956887DFF77 atadmats
810,156,753 *541F16F2C201F79847E52941956D61A1F436B788 Atafelde
810,156,754 *541E60FD95C5F26465C2A5066EC0C9A512A566F0 AtafO
810,156,755 *5418188E0B1139B5C8EBBDCF8EF0B7363EE4D7D4 ataghfirullahal
810,156,756 *54111516A94A8D0103CDBF4DE3B485FEB93AF3C8 Atahualja
810,156,757 *5413B160C77941E0A5022213FEFE131747ED28E2 ATAI0
810,156,758 *54169A8450D0013766FC33AC3A7D299E633DA44C atainabs
810,156,759 *541CF792E95385B4234C647857E7E476A024D0D8 Atairniiüriiës
810,156,760 *5416733C84CAABABFA1BCBCC7FF844E44320BF43 Ataknasi7
810,156,761 *54110374793CF71D834C8B42B6AB44903913AE91 ataliev4
810,156,762 *5415CD154C16921DB1887105E53C76E08D1A3400 Atallabmis
810,156,763 *541FD7384BDFDA18E85F55538B9740659D37C799 ATALLEGALFOSSIL
810,156,764 *5419D59A33C56C87DACF7423D609839B36B05042 Atalocric8
810,156,765 *54188F899758612117B6C46773E7833A30DEACB9 atalpal5
810,156,766 *54155852C375810B6236DCBB13BC57814FA1A6FF Atamayn9
810,156,767 *54115F8C2C0841FC9A81A8CC0354D62CFA01DB96 Atammets0
810,156,768 *54186B8948F2EE4BE26C5019E30F640DB513D732 Atamoruen
810,156,769 *5415ADB5B5533A802F0056BE832365409BF88EB7 Atamusno5
810,156,770 *5414D8943BBD65E2129F7CFA5EFED1847E465966 atamutiara123
810,156,771 *5413125496ECC8DA7B00E4B0656D0C403C1E79F8 ATANASIA6
810,156,772 *5417529EAA1DEF73ED694DA7145EA98F414D7369 Atanden0
810,156,773 *54116E3091B27DA4CCABAAFB95871EC74E61AB0A atanellas
810,156,774 *54184CCFCBEFFF3EE2AA3A51155DBBDF82832511 Atanulfo9
810,156,775 *541B6CCB3377D28744B62DB41D905AF4A96D5D76 AtAO.
810,156,776 *541811D7277C0E31508F3E78CF7D6B10687DBBB1 Ataresset
810,156,777 *5418EC9DE005C233A81F72AB354330C1C5A7AC8F ATARIMMA
810,156,778 *54118D6BF47F86F0B392B4A7710D6E92D0A432D2 Ataroloc8
810,156,779 *54168B98ECD8EEADE2D05999CC23D9CC5D6F55A2 ATarumizu
810,156,780 *541C99116807C1A22FA463C6D5247AAAC4D7D8C7 atashnaa8
810,156,781 *5415C8C1D21B2F921932B44273C6BAB7E7673AC9 Atasteis8
810,156,782 *54139CE1AD2836F89978E1DCF240E844B1109840 ATAT109
810,156,783 *541550A2FC6FD7CCDFD764CF21C58A0D6BFDDC72 AtA,u
810,156,784 *54141922CF306852FC49F900B95B1EEB7D0EC05C Ataurine
810,156,785 *541C19B68F0F6B6380E2CE072F822C0531662733 Atavistiku
810,156,786 *541AA0F0D22F8A8674873414C54ECB3E5299EE07 ATAXd
810,156,787 *5414BCB7A0F95E8F975041B28DF42C24FA51B1CD Ataxiened
810,156,788 *5411BC43909EF1745CFE5F9E270D32BE93E5C9A4 AT(,B
810,156,789 *5411332387D6D5B262B36C90A2866CFD217B68E6 A)t.B
810,156,790 *5412CD119AEBCEA287A46DED1C039E52DDB8B8AD A:!tb
810,156,791 *5411DCEF568D92D2DA89962BE97288F73DCF7149 At/b)
810,156,792 *541FB58D4ADC8A134E7115961221B87E819BA123 Atb?-
810,156,793 *54158074543C3E8FE0E968461CC36B1856FA794A AtbHV
810,156,794 *54144FF986FDB6E2849387BD35304C009F50330B AtBL.
810,156,795 *5413A522B2856C9CF356357201018F2E2C54E18E Atbmm
810,156,796 *5413DF3513554C1A5D7CB64FA7E4140A2716EA3D ATb;P
810,156,797 *5417EA653602553F9A18FC44A9A1A453DF1B86B7 ATBpo
810,156,798 *54180234E54EED3D5C9153414DBC7AE5CEFCA8BD ATBQ-
810,156,799 *541F8EA5DBCC624778014DD244DD3F1C7928655C atbrīvošanai
810,156,800 *541CB5365054C20BA7B027BE4B0059DD78698755 ATbSg
810,156,801 *54153D9F0F69E9390A1287203DAA337ED51ADFB6 atb vs. alice dj
810,156,802 *5414549FCA4C8BAFE7E1A4E8782E058F017761A7 A%Tbw
810,156,803 *541B119B66C4398AD0A571EA5A2E64344696E7A6 At?C3
810,156,804 *541DA58EF46059F389E775531E4150C8B7C89F49 ATC4U
810,156,805 *541014AC4B4FEE499BC2139B872C43273BA8BEF2 At?cc
810,156,806 *541C73623EB21757540D2456F18BF17FCE16E925 atccccttgctagctacagagcactgattggtgcgtttttacagagtgctgattggtaca
810,156,807 *5415A1C4CB50A2A4C1B28F7FD8A6B7B8BBD3C63E Atchasa6
810,156,808 *541907DDCD1C06FCCFA785B014E398968CD59397 At$Cn
810,156,809 *5417945FDBB231674435B11121E74F37546154A5 ATc.p
810,156,810 *5415E2F09565B931A5B4ACADF553C59DBED4DD48 ATcwN
810,156,811 *541FDA97C096B00764004CEA12EBFC0FBBCCF0AB AT/_D
810,156,812 *541EFD54168D092FAFFDF83E932FA0DDE45DD8BE A-T
810,156,813 *541D2009996270499061DCD3EF7A55C4983604E3 At/D)
810,156,814 *5413B10CE65DEDE92996A0586B869BFE03AB23B8 Atd8G
810,156,815 *541EC2AA31916A563F8A38794203631614EDDBFE ATDf4
810,156,816 *54128DB59F5D2E8B939C9F6234D6135021BEDE0A A#tdI
810,156,817 *54124588E7E2572F43DFEA63F8303F1EE0FFDFA4 AtdMb
810,156,818 *5410AFBF024F0BAA4DC6F8A54AAD358027F330B8 ATDMELBBSW
810,156,819 *541557E1005B5793E421910338FBEB3B2F06186F ATD/Q
810,156,820 *5418FE18016D9C5BAE85E9C9C27B594C9DF4B541 At:Dq
810,156,821 *54151191C64C62D9514577D72349DA9F3C96B007 AtDvi
810,156,822 *541522CB2DED116EA4ADA9D95B93B5974D77426A AtdVW
810,156,823 *541233D2878E8A5C5686F64AC48A4512E3528412 AtDZD
810,156,824 *5413762F202CAE0F0CD68A8989BB387D2562C4A1 A?t_e
810,156,825 *541C20662F6D1290EEE7B39135F6A06FB83A589E A,TE3
810,156,826 *541106366EED5C087B97BC34AC9AF9691525E66B Ate8$
810,156,827 *541E5D57F42B8E05A870E33560BDD373826CEDE6 Atebnool1
810,156,828 *54130CA309AD7AFD6CAF96892A53BB634BA0CFC3 ATeBu
810,156,829 *541651DDA81790DA1F99B1641DCEAFCE2D7BF76D atehjewelbeautyinsider
810,156,830 *5413430119AB4DA7EC351250DFCF0B967553AF76 ateist
810,156,831 *54106681826805FA79E16D3CECCA297816C13883 ateitinųjų
810,156,832 *541588FF2EACF7BFDE009605538808CEB8743829 Ateiuqer0
810,156,833 *54176048479E97CB85EAED7E55172914F6A588FA ATEjD
810,156,834 *541822032254B14E28832F38E13E2A6F2D106F65 atelierului
810,156,835 *5410F6F0B545DE9645A2BBCDDA2F5B50764FF661 ATeLw
810,156,836 *54188E0DAD060E077DD195E81A3395339D02E5E6 ATEM?
810,156,837 *541B5351CAE3AD2759A1C1C53212E88F056D24A7 atemanaleptika
810,156,838 *54176F0CF8E01AD22DC5337C04ED14FE85BE52AE atemverlust
810,156,839 *54146C6A27F71D2E1744C4B74FCECCA773207FCB At-en
810,156,840 *5418381BFDAA74E49CBC032C7D8C75B9DA210598 Aten7
810,156,841 *5414E29272D794AA50EA7346DEBA0860F983E9A2 atenas_fontes
810,156,842 *5418F3E2284B4D139AAE3A9F9B7AD2635DB84A8A atendeme
810,156,843 *54188CFA3FD002C417338D4878F930BF08E3729F Atenskih1
810,156,844 *541CC9CD752B1F0A8B455699876F95C08EF79C84 Atentendo
810,156,845 *541034BF8C3C5C1404168A65A37A0D5A91D45CD3 atenuaising
810,156,846 *541355CAD7A09C87B2418C66A8516EFFCFC6E224 atereof7
810,156,847 *541FD203D30FC5E9353CF4AE7536D3FD5808AED6 Atergoud8
810,156,848 *541E7BBBD9875321573B4077F2083D4E6F71FCCB Ateriam0
810,156,849 *541B7A50A780DC11B66056352C73E838E48A3CF3 Aterolod
810,156,850 *5411FC7B20A7AD6DBA0AA74A3E849E377ABE2D42 Aterrands
810,156,851 *541EC7B9C83FEE263C5BA8FCAF80B4EBDCCFE0DB [email protected]
810,156,852 *541B4351A9662835400C7A0D7A51940E83F318F2 Atetesied
810,156,853 *541A53C05AA0333E2AFB48BA1249E1D0C441EAA1 atetou
810,156,854 *54161BF4438167CE50C4CDB225B62D175D91359F atewufakaza
810,156,855 *541595E35239C37A9A43D12C7F794F03A58CFA6E ATe#X
810,156,856 *5413DF5D706275E1F4E69C1638027E85EE83F67E atex1234
810,156,857 *541F8065DE3921790E8A4EDF4CC14CF0AC868702 AtF1A
810,156,858 *541A4B2F3D01D308665B5E587A5FE783E025815E ATF:7
810,156,859 *541642685167F1DB1A40981FDC125BE6FBB73208 At%F7
810,156,860 *5417E70E778F3F15FDC8C11B7055B9C6D4569924 AtF#A
810,156,861 *541BEBC5BBDD5B47370468114774D156CFCDC93C At&fB
810,156,862 *541DD22EC49653A8B2B4EFDF90D604877407B37F A:Tfd
810,156,863 *541C71A400846D2A8F9BFF7DDBA1F95EABBBBD4B AtffF
810,156,864 *541F1DBD2876FFD3BC00EA8D90A7B8B59A2AB7FC ATFPAAAAMAAJ
810,156,865 *5413EF2AD42CFF8989CD14B0302A1D3E44BA16DA AT:=G
810,156,866 *541558BA6220253B2742F8ACFA4E59B09B620504 ATg^
810,156,867 *541D662A58F0B6AE5BCDDE1A9F69939B79C75C94 AtG(+
810,156,868 *54192C5C6C259109FFDB1D5D1C658C4C01D990A1 ATG
810,156,869 *541733F1E97B65184A46E2C216505441B71EB1D8 AtG4"
810,156,870 *5414839417736C124878BCEB021F85FFEB99B169 AtgBW
810,156,871 *541358BD547D739BA6D9D11D874E20BC5BF6EFAF atgcwj
810,156,872 *541DC3914C4E27475BF6273CD337EB6D72834926 [email protected]
810,156,873 *5410DB2847424533CF6FB0C49129672FD7A4B2B8 ATGQi
810,156,874 *5417C948B01CF3ACDD569B8AD8696E3523A8CC6A ATGRv
810,156,875 *5412BBBEA638B566883B8EBA0338E13726345D32 ATgTG
810,156,876 *541607397240ED8929CE8F4458BEC826A0C0EC21 atgtgataaccgtcacaaacttcacatctctgacttcttcaaacagccagataaaatcaa
810,156,877 *5410BA4048C920BF48F6F36894ADC7E930D7B108 atgttcacatctcacccttttgaccctatttgacctggatttctgtcctggtgtgtgtga
810,156,878 *54130420270A424E8B9EFECAF8080465AA62768D At)=H
810,156,879 *5414B27099EE1EEA2251A146D349351777058EE6 A-t=h
810,156,880 *54182ABCF91CEDAA2FA426C02217E766A1C21752 Ath`
810,156,881 *54178BE92238D61CBBB39309ACE3E5F25B633E48 AT+H2
810,156,882 *541EA68AE5DA57BCDFAC6C7833FB1E2FE19A5555 ATH3R05CL3R05!5
810,156,883 *5414762FF4A4FC4A620C317F9AF1BF35647BD1FB ATHABASCA-REDWATER
810,156,884 *541E8B4E1681967B49CD9357AE18AFE4C10C7D13 Atharue1
810,156,885 *541D799A4E1F64B05CD1D8BC3CADB68BCA35DC9C ATHAZER
810,156,886 *54122012153A2A1C0CA824AD774F75659A076883 AtHbF
810,156,887 *541C707C4BB08FDC22D224964DD23036029C239F ATHCINDI
810,156,888 *5413468556EBCC5B6F31CE5C324230D8A81A40E1 atheism’
810,156,889 *5418025615BC362B9B971EEB27073D34674CED81 ATHELL
810,156,890 *541E6BCB5E71D012B2347AC959A6B0807418CA47 Athellen9
810,156,891 *5412FF3C47D66A5460F5259012A71CE4FD210889 athelney8
810,156,892 *5414880786DC486321ADB20588634A895D1B7140 [email protected]
810,156,893 *541493034FDDE835B89A559A8B4C5F1031ACAA62 athelsted
810,156,894 *5415A1330650D971572145A734484BA1FD3B9E8F ATHENA1948
810,156,895 *5419780CD06A98519D60B62A9D46848B1B8A8A45 [email protected]
810,156,896 *5411954DD5E7B478CD60E21D489752989E041223 athenaathena1982
810,156,897 *54189E7AD09D4ADE26A1947CDF56F1ECBBE00AF1 Athenatricia
810,156,898 *54147AE1F41CAF2AC16130E853AEF6B84E75F2B2 athenk09876
810,156,899 *5410CAB44B79121211F9CBB169DF2A4F0B107F7C Athentiek
810,156,900 *541B576D15FFE1A6FC65C3F29FF05BB15E355A80 Atheouses0
810,156,901 *5415F81334FB1B6B4A066E1959099F43E2486C16 Athermous5
810,156,902 *5414575936DC67F94FBB769B971162873F00DE36 Atheroid
810,156,903 *5411451A2EA15FF490C285FDEB524EE09B842BAB Athérures
810,156,904 *541FD9A67B7FF3BDE1B312CA8CEE6C7EF298757D ATHE!ST!CA11Y
810,156,905 *5411446BDBF8F1E882CCF2894C63125F08DA1A62 AthGi
810,156,906 *5410EBBC8F5E909E27B60F71EE6CB7572E188A33 A-ThH
810,156,907 *541C0075329EAC31D2046052F93CE29E95B633D2 Athieme
810,156,908 *541792452CDD9F4F8DD4F355D39565F71147B6BC Athílio
810,156,909 *541F961B79D97BE2BF07ECA8B108C086A603EC21 Athlanted
810,156,910 *541F421D0DFE2B28FECC121A6772D6C2239E726E athletically, athletics
810,156,911 *541BF5FD5A1AFE2190295D08F2A39977A3E28DBF AthM_
810,156,912 *54168E7F80E9EB6CD19CFAA79E95670E025357DA Athmarino6
810,156,913 *541CBCB695A21562C0BA6F2447D4AB595EFD8A52 Athmayday3
810,156,914 *541FB4ED2ED1C5AEA4B6B31209ADE8CED762AF2C Athmonster
810,156,915 *54110EDF8AE7B8E8BE02F7782009D5C2A522AB6A athomp2277
810,156,916 *541839353EF67B41DC363DF1C6364914315330D8 Athonises
810,156,917 *5412E938AF514009F146AD9810B628CA5493C728 ATHOSH
810,156,918 *54122AD03F7F85727E4A41580FF5E713C68AE106 athpete8
810,156,919 *541CA5A70138624E74DF639AA8FA3A925DE00AAA athroxy8
810,156,920 *54109A7D30B2EFCE9707956F8D9643385E23D5C1 ATh_S
810,156,921 *54132FE818D4F54D02FB26D3431AE0E5B4562A7F Athshorty6
810,156,922 *54121AFB7FCF4B2F4EDA867E5B0A72104747E108 Athsquirted
810,156,923 *541D05104F5650790105A237B26DC5E07C79050B Athurst5
810,156,924 *541A443AAA700B869BB86D1886003CA8E2751D1B ATHwS
810,156,925 *5418A22A191262F3C51C5B9A75E066218C42ACB7 Athyamaha
810,156,926 *541B801F4D2C90AD1606AD16A6B80934D63DF2C0 athyridae7
810,156,927 *541FF5E227E66D111996BD381C16746D2273CDD2 A)tHZ
810,156,928 *541FF7B22CC8DA9E4F44961D08B017AF5BB6F61B A/TI?
810,156,929 *541F77B68DF07D08843837C1DA2EBE06B1C4DF8F A%TI%
810,156,930 *5412E8AF9A24EE92CA48C040445CA00371ABAA1C ATI-
810,156,931 *54185A4006B2F22554335296CA608EFB84105D5E At#i#
810,156,932 *541F8BF69935945F3AB0ECD2AD96EEBAD7738A83 [email protected]
810,156,933 *541994D820CEEF0FCDA1F764620A1F7F16454B24 ATI6v
810,156,934 *541FE2C90AA0914A230768768FECE7BDB25FD5D3 AT!i9
810,156,935 *5419E83C58D67AC6542B3F2811C3F0F6EC35F2A2 At+I9
810,156,936 *541BA01E61133A3FA765C095B782580AD4421A19 Atibonec
810,156,937 *54173BEC0EE060E2774321906669BA106B0DEF2D Atiegeld6
810,156,938 *54155F7CEC0F283D9B9D76A3CC657CC541752977 atif haroon
810,156,939 *5413C87602B8AB6D371F931B5989BF939CC00130 Atifolia6
810,156,940 *54118C6BF08D60B0257996DD232C2BBE10CF3EC8 AtigF
810,156,941 *541CD6759000891FB1F741E28BB8F11518649582 atijolam
810,156,942 *541FAE9B967D937A512B91400D88764D1CDEF2AF atikatas
810,156,943 *5416FD2A1121AF400DA405EB8E271DEA388A8792 Atiknah3
810,156,944 *541C9496EF73B11150BDFD7813FDDD03BCEE646C Atilacov
810,156,945 *541B6273C05BFF472D192DE504B22E10185DB2A0 [email protected]
810,156,946 *5419B1FA8FB84551CB8F53BB23A934DD2A9A0FDE atilatron
810,156,947 *5419F5CFA59FAEFA50535735BAC4A45292026477 Atinette4
810,156,948 *5417FD6FD94C9843D7681BF3AD577A3100A59401 atinga1234
810,156,949 *54182A471A940321DE755600E687D88E2A438280 Atiniert5
810,156,950 *5413D8FB2483F9C5D7301C9A51F69AD0F60A78F9 Atiohily8
810,156,951 *541F47667C3F8D548C9415F34F675A091E8AF318 Atioidem2
810,156,952 *5410A0E72091D0E3C58E5339E3DEE58DB069252C Atioimed0
810,156,953 *541DE1B520D8EB094255F52668B7FE5AFE6C3503 Atioitap7
810,156,954 *5415A3CA263C09B952BC4CA6513780F4975F525B Atiokilo4
810,156,955 *541421075C72932A5B0EBE346D6CB66516CE4BC7 ationia1
810,156,956 *541507045CF3D8FC4417B847C32FC3F4104064A8 Atipravrs
810,156,957 *541798295E9D13E8D5DECA7ED056ED8F314EBA24 atîrau
810,156,958 *5418E02583ECAB788031CA09556C6667A4A3CB40 Atirauhas7
810,156,959 *54182E585C9D2D401275D7BAA9B2697F7D3572F5 átírhatóak
810,156,960 *541F80FD9CDE395C86161385C458FDAA6E394E30 Atisemite9
810,156,961 *541D2557EFB17249B5B8117D9B5E693128BA2F40 atiśeṣa
810,156,962 *54150F973E9F3E262F19EB227B299E6EF504D279 A(TiT
810,156,963 *5412C46AA6D796E8509C8CAA09AEACDDD27DAE43 Atiupnit8
810,156,964 *541BB4393C4EFD944F40B3E26B03955AEF04396E atiuqramed
810,156,965 *541E9A8709A5DBB91E9C7D8958DA76156FB9E9EE ATiv1
810,156,966 *5413391D17F65FF4E4B65CF4787F83DC396C11E1 Atj%(
810,156,967 *5413A8BDE8B9623CE1365318AE7B3E869FFF2A77 At!jU
810,156,968 *541B95A7643E986DE96B4B377411DCFA38252AC1 A_&Tk
810,156,969 *5411479B8B4184B2C48A0A153E39DC3E9440EEE3 At?!k
810,156,970 *5415C6CE67307674C4F2DAFD7B84D19EF5312959 atk2005
810,156,971 *5415A70697FF17A873C29AC00109A2BE11BF907C ATK55
810,156,972 *541E5E98DB99E923D2B0DF20F8CC60A81BA04A6E A(tKa
810,156,973 *541B988692B7D8686558EF479C531A4B36EB195B atkaatka
810,156,974 *541B2C2FB90C0A38D6612B6F7878AA8B26397087 ATkAC
810,156,975 *5417815C75139A5E32EB441DAD7FE8F465150129 Atkemsna1
810,156,976 *54167AF05BB545B2554B96601645612C5317A345 ATKfV
810,156,977 *541DBD3779BB0675B3364FD94F034083546141ED A%tKG
810,156,978 *541143BF6238A6AFD5D9113DDE64A3F47649668A ATkNu
810,156,979 *54141717404D98C64F74FF35CF46291FCB5CC681 atkut07
810,156,980 *54121EE22522A8C2E1A6A6CCDD56DF37655E9980 ATKYg
810,156,981 *541BC72AF305CBB665190C1EB034383557E3BE06 ATL2011
810,156,982 *54103F4448639200D74DAD061A8CB7C22AA0EED8 [email protected]
810,156,983 *5417470A8B9B03D5DE8EC71DA21F4C1AC0ADD1FE Atlaepoh
810,156,984 *54143C5F2114693B35F854B41DA49FAAA1251BCC átlagom
810,156,985 *541794B8F757AD85F9A04EAE51B412A586D5BD5B Atlandil
810,156,986 *541E1999774D6152EF560E3062B427D8AB74C974 ATLANSDOWN
810,156,987 *5417EA7C0964D704CAB8B4A1D7D98251801C9B19 [email protected]
810,156,988 *541BB17C5417F4D10A50BD110C9C5E392D42B769 atlantean-like
810,156,989 *541E6644ADBD33035757862F26B01E49F7EB0D5A Atlarbig4
810,156,990 *5413671A92CF4EDE12525D589ED80F41CA16BB7B Atlaseock
810,156,991 *541C42E5140B0C5ED0AA3535B08EE5D86A45DCA5 Atlaviling
810,156,992 *541EBD2A5E5F8001A5216ACF992E9E24D36633DB ATL&d
810,156,993 *541A1184A4ABA8CB4B5639FD0EF1A80D64D80E1C Atldrbsws
810,156,994 *5415EA3D304E743F3C80210F6143E976F8A47FB7 atledurC
810,156,995 *541F51A2D20EE8ADD9BEA788FDF64F1D777ADE4C Atlesokled
810,156,996 *541BBED0C19A0D75C23F73DEA96CB3173A34D5A4 atletisch?
810,156,997 *54156C7F788EA30EF00B879C4CAB3228ADBAEC41 Atlisitu4
810,156,998 *541AAFA476D9FDD16B55035C8B19AD7BF9D8F901 Atlisken5
810,156,999 *541D447D1BEFEE113BB9BD18DEC43054E5970C18 Atl#o
810,157,000 *54166B1613B4CE4E15162346451A31BA1AACA6DD Atloics4
810,157,001 *5412BD9FC4713B7823296BB3665201BE9DC66E49 AT%lq
810,157,002 *541F537856535B3C0A345B3826456811F91652F5 At!lv
810,157,003 *54186F4B7B95310C977C754386055E0FC2FA98BD A
810,157,004 *541267F2DD36A032002AB98384931E2D3EFB5DF0 At.m#
810,157,005 *54101054F88219E15BAAE7380F40DDE0B0E0CFC0 ATM2122
810,157,006 *541EE30C37B10E741DAC6F23787FBA1D873EAA78 atmbg6420
810,157,007 *5414F99BD0FAD3E81EE0B6F98E23D1BB8FC79A8C ATmeo
810,157,008 *5415580726C36FDB8004916DB814D954AC8F9570 ATm"h
810,157,009 *5417D8ECA31B9D4A3086286EF854479990E2485A atmometer?
810,157,010 *5412B88B74C9066A848F98C30D427335EB07868E Atmosferik
810,157,011 *54192AA8B3A96DFBA718C6A62A79C8BAF9094437 Atmosferos
810,157,012 *541E3F6BAE2C3338956BE1CBE4299217070D83B1 Atmosphärensonde
810,157,013 *541CC60DCA0297749768DD0F0FF7F53CD01BEFD3 aTmOSPhEre
810,157,014 *541A3285B4CEF0F0C7BC3F711CB5AD330DFA2F33 A;tmp
810,157,015 *541DBB90FB540B9A36FADA2E94AE9C1598395558 A+TMr
810,157,016 *541AF190F0DB9625EA393C0087B65132858CE78B Atmsatms7
810,157,017 *541B095FEBB6CAFC24B72DF487CF16016A31D0E7 Atmsbsw8
810,157,018 *54121470868E1632FB746C9A8076E001F356315F (ATM相互無料開放の提携行)
810,157,019 *541522E5EF81479D2EB752A351B65A7786E5B148 atm設置店舗であった)
810,157,020 *541D2123D20275440C9F7D7A19C7DFDECC604CC3 AT$%N
810,157,021 *5413846E2633DE652238877CC1C49ACFD2584353 AT,,n
810,157,022 *541C4E5196975578EB7985117C9591057D37E7DC At+N
810,157,023 *541692C9813C25271787C404F222AAF696049055 A-t-n
810,157,024 *541150956EF8D5D4D4A92E94E63D20207C28BF9C A:tN2
810,157,025 *5411B85AB0DEA86F8A0F001E2297675FA7685114 AtN4?
810,157,026 *541C4E6B20765C812345AC3393B9909D73321621 ATn6o
810,157,027 *541D8E496E96E3ACE7EF0D68DFC8F211A88E2067 ATn7k
810,157,028 *54171C805F541432670398B953A1674C4BD0AF4F atncus
810,157,029 *541A219BB50A10C3CA9FD53715ABA87D65D588E7 AtNER
810,157,030 *541AE37975384C160AED38AECF346109A9F21481 Atnijaal
810,157,031 *541C07F7BF4D8D17049769517B38D76C2B3C502F Atnipnaa0
810,157,032 *541371CD9C67531D0ED3CB908D1F6C1196C8C150 Atnipnihing
810,157,033 *5412B7872AEFA96E463EF73FDAC9AA9C742F38BB Atniruus
810,157,034 *5413A12128BC34FB74CFBDA8DBB4E75E421B2B7C ATnK7
810,157,035 *541ECED169597C69C2D3CDB8970121C555795914 ATNkO
810,157,036 *541BCB48D8A39CF1C0A25DBDF8EF4994AEF31B90 Atnotoll5
810,157,037 *5414715C1950C95B19DAEFFB91ED68F8A622A082 AtnPi
810,157,038 *541D0E02A14D063DB4C7538FE40FBABB68332C61 AT$nR
810,157,039 *541A8AC91647F9BFF46473E98BC3DA5E5B7D1BE0 A&TNT
810,157,040 *541A39758808442CDD70111312FB0266E6838C7E ATNUKUKU
810,157,041 *54182CAAD9F2FC4C6F205F7FB0FA7CC57BD10A99 [email protected]
810,157,042 *5415719A4E62636C76E72F35622544547F7A488F A;#TO
810,157,043 *5413AAF382B31EA159B230C67F0A885CFAD70157 A=t.o
810,157,044 *54157845BB8338C41E26EDD5EB2E012801F71E52 At+=o
810,157,045 *5417B865A908E470E4E74502F3C85020ABE31196 atocnestright
810,157,046 *5410DA8A2A668A735D5A56D5429928CA1209BB0D AtOe7
810,157,047 *54187C1AB55D767822CB4FB80786BE6F0337033B ATOGE
810,157,048 *541270D7206D5BCBDDE015B811598AD4822A6AFD ATOhl
810,157,049 *541746468A7162874AE197F22A333C419EA512D4 At)OI
810,157,050 *5415D596379BAC422E314D5C1F200D58227CC2DD A,toK
810,157,051 *541DFBFF7CB6F6E39C54FB7E8FF1A625F905ED4C atoleimais1
810,157,052 *54139E9958C7D4AEA08E2362AA48B9FC76B1A840 átöltöztem
810,157,053 *5411C90CB803121269D69E5D2A39C95285BAA7A2 AtomandIf
810,157,054 *5416F412A661B1B84EE3FD114BD3D9A096F285B6 atomeq
810,157,055 *541D9FDDFDF116B955BB81F9B391753C653E1636 Atomguning
810,157,056 *541535A69DCCBE81F1E3A864E1E320F013E324E0 Atomic '98 (Xenomania mix)
810,157,057 *54195E8D38356A23352F4657C45CA94F20A849FC atomicias
810,157,058 *541E103E42158C5EAC8EB521DDB21A41086FE856 atomiclength
810,157,059 *5413B0924CD7C079AAA2423B282099F718B27239 Atomiseus
810,157,060 *541EAE73EFE07322F470F9CA3A870B0AC54C2B60 ATOMISTISCHE.
810,157,061 *54138AC2CF3811CA0C7C4F034BE6AB58600F39F3 atomkiem
810,157,062 *541C839D93B700A36CB8681DFCF7C6E09CAF879B atommotstander
810,157,063 *541AEEAC5FC42F53ED5CF6559239B234AC482F42 Atonesis1
810,157,064 *541BA384F558F076A848DB5BCC2EC040F52BB0EE atonewhe
810,157,065 *541AB23E737D596857BF64D19139BC56F1EB2522 ATONI`A
810,157,066 *5418D6D049AB7E8216C528C89DCF2A75FDAF8442 atoningsed
810,157,067 *541AFC2FD7CCED154A0D15A4F3ED185FD9E9F6DD Atonna
810,157,068 *541DE84D3B43613CDC55C9149A44D8F2B175F559 AtONQ
810,157,069 *541AF5BDE75E2B0DEFB13C61716E5732BF3F6D95 Atopedeamorylujo
810,157,070 *54185171D8EE5F9B9779A12FE709F4E8B4240B02 ATORDNUK
810,157,071 *5410C750FFB539E01FEEFC834097B94714A932BD atormentaría
810,157,072 *5413492B06487DDC2D69DC34E0BF96821FF5151C atosaras6
810,157,073 *5411F427EF3C85DDEEBFC13761916015F7F065C4 Atotrūkis
810,157,074 *541B158AA6458C590900DBD1BA8D842FC9E97FAF Atotstep
810,157,075 *541BEE0B59C4765A1AC38EA6379F98E62629EEA4 Atovirta7
810,157,076 *5419DBF4ABC61F6192E799F35642FFD97ADB63AC A/Tow
810,157,077 *5413B8D983D7047EE71E08DD81B22267ED7A0A82 Ato
810,157,078 *541CBEFF75526C26E64F4198D8AE67A730319E6E A:Tp"
810,157,079 *54195029764E010D7B05050DC04104176BB51E6F ATp
810,157,080 *54152554ED32661371990C45F6EEAF7D70017A3A ATP2511
810,157,081 *5417B16B9E5B8B0D9DDE252CB77C4DF28C667B4B Atp)6
810,157,082 *5415D3E30474E8D944D88D0FDE91430C2D5B38C4 atp8b1proteinhuman
810,157,083 *541FEB3CA3474D9142102ED5217ABD82D23B85B3 AtpG)
810,157,084 *5417557BF0AF0DCF8B6856646C4DBB80531C02B9 ATpIO
810,157,085 *5418B9BE37012DF7480298AE32DA6E2E0B142D6F AT&Pm
810,157,086 *54148691859A436E507DD5F1069DDC4AF5DBDB81 ATppm
810,157,087 *541A4535BD3179697F39CCD32117B5C5C27620B6 ATq-!
810,157,088 *54153EDC46231C5FE5D823CB9C8897FF5829B649 A.t:Q
810,157,089 *541927DECB8D2E02FD9E094BC95D81A446078B8F ATQ4(
810,157,090 *5419DFF1978E7B594A75B858593B31A737C21CC2 A!TQ9
810,157,091 *541113FB47677CAB1329C83C96859A5A760BE57C A&tqa
810,157,092 *541BF9553ED7DADBA2DF1B020E3F34C547E746BB A+tqp
810,157,093 *541934A846772AB1DAF09A52B78D0411BBE978BF ATQpB
810,157,094 *5411B863331C415AEB56E9667772B1EE2B12BE26 [email protected]
810,157,095 *54144ADDAC44F4A774B8D0F363EBBECCD31C6050 ATQSVKLN85
810,157,096 *5417828BC9C31A125980FCBE11D634ED5F71914F ATQVl
810,157,097 *54184AE46BF5A365C897FADD9D3EE4B410EB44CE ATQZN
810,157,098 *541B60E9B2BCB9EF0CC08523AE1478660759B554 AT_R_
810,157,099 *5417CF424A51865E4533DA00539AF97983D7B707 AT..R
810,157,100 *5413519E88F03EB1D76C2AC12AAE2813F7C0A316 A"+Tr
810,157,101 *541AB621A4DAD63E2D56E69781450C6F395D16D6 A=t&R
810,157,102 *5418431CA7B3291A2DDE308857AB0B92BCA1F083 AtR_)
810,157,103 *541D229A1684BA1E297BF340CC0712B1F82360D6 At:=r
810,157,104 *5416FB5C7763208B876F34B3B74EBDF3C08BA442 AT)r1
810,157,105 *541D8675DDB5A130BA4C74158998563A4CFDB737 Atr6j
810,157,106 *5414AB2DCA77CBC57F7E7E5B15EC356557A48A9D Atracbsw
810,157,107 *5410E7427CE72CD54E3827C925989C8B53F11807 Atractas8
810,157,108 *541353C743C9BA866FE61AD8D6E2B7EB307A2F2D atraiber0
810,157,109 *541E41A6A4453DCE885929A6DCC5BCE25B3EC74C atraight5
810,157,110 *541D236DC810FA4431E5B8E19E446E040D095611 atrakintas
810,157,111 *541A47E7E6B5D4FCDEE9BF633CB80C8107F5F953 a.tran
810,157,112 *5412C4EBAB7A08CD0EF96841703042B81CC51EA2 atranclos123
810,157,113 *541435F5C87196CEBEA7E195A2AB239F6EC92AFA AtRB#
810,157,114 *54197783118C1C31912287517B88AD0D8D60B215 Atrc)
810,157,115 *541C56CE2EA82968EBDC688FFA4CE05A5ACCF570 Atrekiavs
810,157,116 *541622C3C8E5A6D46E7BC13366971E04C90408CB [email protected]
810,157,117 *54136D49C8EFE2E881F70E375D746EC9AEB2CFE8 Atrepsies3
810,157,118 *54151A03773F1596F7AAFB9D9749B61DC1F68B5F Atreviera3
810,157,119 *541DC8AD70783A8AECC8876EF7A4914FE69EFE4C atri1
810,157,120 *541E483C4F08C32C9BFE1F4E427B94A767F0C4C5 Atriovent
810,157,121 *541989630D818ABF80ADAA5F613EE20EEE97FB3E atritining
810,157,122 *5418B41C8BB904238B3B479526DB1F61FB6CDCE7 ATRN0
810,157,123 *5419B66A1AA573F2854AE233A3200D4C81CAC3D4 atrofies9
810,157,124 *541ADA8ACFCDAEF4D414F7C235DD17C41F8D313F Atrofizza8
810,157,125 *541215E1F1CC7A3CCB398EA3C78129705E6913B8 atronadoramente
810,157,126 *541264E0757F891F8B9DF2003114F5B9E335E655 ATROPATENIAN
810,157,127 *5411E8B31D95FE7A48D8FD262CBF5E355F9A462C atroppa6
810,157,128 *541360AFBF91DC59F055AECB820ED05FC3F36B13 AtRp4
810,157,129 *541F10F4D3B0E8725450F20AB5067885B695DC8D ATRX0
810,157,130 *541240E7987AE239291056268C350B10FBFBABA8 AT;%s
810,157,131 *541C4F4281B3D66B4339284F0B79A1CAF5B12EB8 ATs(#
810,157,132 *541598E3CB926FF672F38148F918FFBEAEDF269E A;,tS
810,157,133 *541BC3AB3528DD207C530998BB959CF1150A2AC5 Atsahuac7
810,157,134 *541C6029620C87DA319525EED8B40220B2D72E17 Atsainat1
810,157,135 *541F3ACC41CC825A0AE54335121F57FBA22DACA5 Atsamiol3
810,157,136 *541D8CC447EB3A1EB3C8E8F4A42287F3E51C1244 Atsaneet8
810,157,137 *5419B5C971981E7ADF9D30DE15C28F66AE67DF78 Atsaniro3
810,157,138 *541F12A90B4E4D29D2CC1FF5AD3D6101ECF8E35F Atsarropped
810,157,139 *541AE13DE3D71BA711F5C557F1A9B5FD28E83859 Atsavuki2
810,157,140 *54169640C80A084B0A7EF0A8D82CAD410E5DC791 ATSb"
810,157,141 *5415E36C8FA73724F3F9C22CF76A3509A8C42E07 Atscecen4
810,157,142 *5412524C1D6066B744912D0F59432B3A9E80D726 ATSd_
810,157,143 *541A10FEDFAA31E4C7FAE12ED1F7146B6C8DCC82 atsdom
810,157,144 *54189EBD635F3E1C1DB09F2A7B105393DC04DBFF Atsefmie
810,157,145 *541B3F3913CE8391121BB439095C81DCD987497C Atsegrhob
810,157,146 *541193D456E0047583F1F6B595F15BA9D07C9C0B Atsesiared
810,157,147 *5411691AD28575FB95A76FBB8F8836C4AAD3A029 ATSFX
810,157,148 *541536EA683EE818383A8488B8EC887DE4684337 AT;SH
810,157,149 *541BE92A20DD111AAA4A9069EF6766E6DE7D5F0F Atsicbsw3
810,157,150 *5418A136418BE78A17710FE4F5E46B3C7F913D8F Atsigolaed
810,157,151 *5411AFC74D5B06C609566C247CC423727EECE464 Atsimaeking
810,157,152 *541AD30CA8BF45DDC85868053742F1C1CF334E74 Atsimuked
810,157,153 *541EEFF4DC969504BAD6E0668A0CEF19BE48374B Atsinata1
810,157,154 *5413B015450C8031C13CFD307878E38BB64530B1 Atsirakk2
810,157,155 *541A5D64C3B02659270BB823242FABBAEC7D468B Atsirust1
810,157,156 *541E81C2FB2DFFA5098C611E571AB72E0F396CB2 Atsitsir7
810,157,157 *541D41311B43ADE528E01713537F9942CB4FD280 AT=Sn
810,157,158 *541B6FEC087CA80CDED687E2D6803D67CC808393 Atsodhiing
810,157,159 *5416D3704DE33DE5315B52433BB190FA194F4253 Atsokti3
810,157,160 *54105B550BBB2EC639BDD98CDD30D0C86C9E2323 ATSOSATA
810,157,161 *541CA61CCE9A67D4CB11633BEDB8A7CFD3C0C4D3 Atsotetn7
810,157,162 *54100AA077F078F2A82C5F82E6C8B080D890AD85 Atsraete5
810,157,163 *541C50CE18D509711BDA8A12E02913DD1DD0A875 Atsrs
810,157,164 *54150F94ED7F572AD98135E9E2758D2E4B20086F Atsuliot4
810,157,165 *541A60A1C236F5E2EBF59C3EDAD50B256873ED5D Atsuliuked
810,157,166 *541232DF0FD4465541CB2B729F4247D50B26033F atsunderstöd
810,157,167 *541A3C26A68607417036AACC84FEC141B4595863 atsuvas0
810,157,168 *5419D8E089C87169E64E7715C51C5C8D5D92FBAE At_Sw
810,157,169 *541D72DDFFD713F96C22524AB9324E91B9703A51 A-tsY
810,157,170 *541FBCED9534760565ED2E710F7AA6241F08FC98 ATt//
810,157,171 *5416D00EE28F4CCB0EA4B5539ED685522C44E747 ATT2?
810,157,172 *541EDEF69361CB500D18D2BBC98A41BAFC3A8802 att3ntar3
810,157,173 *541C82CC3A09D81A76C779E024AD214C0366E892 AtT55
810,157,174 *5417CF9EA32EC67533FC6667238D6CCD93C5D782 at-tabarani
810,157,175 *541156AAD5DCB746BAEB78D5484E5F21C51A1749 attacaggcacacaccaccatgcccagctaatttttgtgtttttagtagagacggggttt
810,157,176 *5419A62B203B6D3FBF97ECFE48E5A4CC9FE5AE84 attaccabriche
810,157,177 *5418314572EEBE46C0250169930D83280EEF4430 ATTACHABILITY
810,157,178 *541E282771790C76956D25DDD669B4782585D5A9 attachon5
810,157,179 *54179B2A5AE73C4DDD8FF55C018106AEEA96D412 ATTACKFULL
810,157,180 *541829D3CFAB03A4A27A7CF4EBF47E0BB3DAB2C3 attacksusnw
810,157,181 *5413068CE26FC754604F609F0C6688B6DEDEEB93 ATTACK」では、スタジオ音源、リーのボーカルで「SCUM」「LIFE」が聴ける。
810,157,182 *5412F5B028D59F95F8AA3A2E155A406494B2732B attacrost2vi07
810,157,183 *541089D68A043AE2EE33EC260A54F61ED03DA1A8 Attahbsw8
810,157,184 *541EF2BE410821F8A1584EE9FC456788708BD0C4 Attamouhed
810,157,185 *54198FB854258629E0139A90E9D970BE288A9124 attarian5
810,157,186 *5410415CF6C470D65A02D0F852AE094D55EAD984 Attarid5
810,157,187 *541280383D74ED3FAEC2345C8B117EDD161EF4EF ATt&e
810,157,188 *5411893F3B56E19E46B00BF47E0D7711CD5DC304 Atteane8
810,157,189 *5416FCD3AB3FE13B8CC2527939754F043E9E0031 Atteetting
810,157,190 *541F537D727E670214BB445A9F1A8897A2305AB2 Attelabus
810,157,191 *54138C2AAB14709E6B283F2BD0C9185273E86765 attelfed7
810,157,192 *5411E2AA5AB46E3FE61B80A353A8E974930108A7 Attemanted
810,157,193 *541533225E9DCBB887C3937CB3AC418BBCC60234 Attenfjorten
810,157,194 *541B782F3A3D3DA4231C6D5C7B4328094EFB2F63 ATTENTATA0
810,157,195 *541F5BB827E1AC1267CFB31D201E5196859D7C9E [email protected]
810,157,196 *541133E1BB42AA021D9E29E044045EEE9E61678D ATTERMINAL9
810,157,197 *541609EDE3FFD5345FD4BAACF96C0EA57CFA5DBF attermr
810,157,198 *541696A00F9C079EBC748B978783996C1AD30E06 atterrisseS
810,157,199 *5411EE94EC6DB10B6CF49A82B58C296A927EDF87 Attertsoc8
810,157,200 *541A48C2CEF08400251F19AE321061BDD17E5BF2 åttetall
810,157,201 *5413615F40620C1605A13D6318422B4BA1F9FA67 attf
810,157,202 *541CE48533A558F301CE3BEA0E816DC2C7F4E28D ATTF|RINGSUTVALG
810,157,203 *5416FB1D6B5A987FFEAC8D3479D8CE94CF033AFD At The Cafe
810,157,204 *541F4C50D324A269617461F53E4300068EEDEB28 AtTheFrontline
810,157,205 *5412284A9F8A8FDCDE912DDF45F9C6CC51DBBD0F at the image of pain
810,157,206 *54194A446820C680F5817086FB4DD8F25229CA53 ATTi
810,157,207 *541C1A33A3A69E85C9626295409ABD89DBAED9AC Attianese6
810,157,208 *541E51B511FD08F225931C2F18224CA904D473AB atticamap
810,157,209 *54165E14EEEBD95DABC7ED5F582A16C608CCBD3E attie van der linde
810,157,210 *54127D2415F93EB4F3067EF1A3F976F2454842FE attili1
810,157,211 *541B78FC483666ADEB0F6414E96D2C5D702CF7AF Attilià
810,157,212 *541A2980F3738535F40EC8D053F33073A33F2129 attiliis5
810,157,213 *5414810ACC367409916DBA350E6869806B4C78C5 ATTILRV1
810,157,214 *54116861F5CE0CC95549D74ED1210A77C457CBA0 ATTIND6V
810,157,215 *541ADB0A6059126A2EC1FE5C19F86DC13662EA12 Attingeva2
810,157,216 *54155CD3DFC853E8B373EEED0975D4E2C24BD449 ATTIQA
810,157,217 *541883544C87B103C0E7E680DC1295404AB451EE Attireros
810,157,218 *54171EBCAD42282C3C494658F2E5D1B2F9C82891 Attisiin5
810,157,219 *5418A306D06795667C17DCC3B15A25519DBB37B7 attivero2
810,157,220 *541FBB7E2FA2C371FE54004C9348FA046C3A6E57 Attnujsa3
810,157,221 *5412FF30E379E562E7A133B766BBA38C6190C44E AttoII-L'hanferito...Cheimporta?
810,157,222 *54113A1D048DC8CC3D993EF559CA6DF297B76A61 ATTOLLENTEMQUE
810,157,223 *54183F779685F15002D5E50BA26750A862B5D88A attosc1
810,157,224 *541544C58389FDACDBE06B2B89D9E51973BBCEAD Attosecondo-No.22Aria"Cessaomaidisospirare"
810,157,225 *541B1E693FCACCD762A1E568AD3FAB7805093E23 Attouvol0
810,157,226 *54147B3295AE618DCA05733AF131402938658FD8 At)Tq
810,157,227 *5415BA657A5A89E8F362E56C063153BF809F1FAB ATtqc
810,157,228 *541EF6C45B7CDFD174A7CA1D8D1EB3F0BAB14DE4 ATt&r
810,157,229 *541566F0ADBF0AF5678847C69CC02B945A279560 Attract!0n
810,157,230 *541539DBF9123BA5164B0A65AACDCEB372610F66 attracUre
810,157,231 *541E053B96EBEC4AC4C766494A7DC33886544579 Attramen3
810,157,232 *54176881CC3AA8D1F85D37EF5E336DB9673CD63D Attraperait.
810,157,233 *541ACDBAFCAFFFF0487824F02AC1CD7B2764A299 attrezzare8
810,157,234 *541322DF16C7A5E54DCDDE13FCDF6399655999B5 attribute73
810,157,235 *54114EDB1A57611E91E9C3C9418F9AF94B07E2FB Attributoin
810,157,236 *5411537ABB940F6508734C9B779BCA48CE3516F7 attriquerait
810,157,237 *5419626FA6A7B38D95DEE5C8A825E5763B3D4E5B Attristions1
810,157,238 *5415F40D206831B964C581F63A1C4E3B3DA82120 attritionaly
810,157,239 *541326545E801D41A958ED3517D2D3B0B3A3BB16 Attroup
810,157,240 *541C66E737676999B70F804E1B89F7F4A2D84768 Attschlttß
810,157,241 *541256AABE27025D31AF190505E1748B7AE501FE ATTSEIF
810,157,242 *541EDB3A27B892A5A6E2D91B4FF078C73110DE80 ATTU+
810,157,243 *54155E2DD35A3B8EC410A983C06A96F05FC3FB41 attua55e
810,157,244 *541ECB7CCBDABACEEEEA3B4A0602F38821F3AE50 Attysed2
810,157,245 *54127CB772F6AA3DD5945F5AEC8568FC74A69DB7 AttZ8
810,157,246 *541FE76412C9358BA2EAE8D83A09A808C2A7801B ATTZr
810,157,247 *54195F0EE786385E8435DE08A12247E7E96C514E A;TU"
810,157,248 *5416832F50D55196B4299BED074488652839A048 A:TU
810,157,249 *5417A72FB6DEBE3F0C3778D0CAFDDC63A4D2DAA4 A(tu!
810,157,250 *5410980FC93B69377779CC8B2CE3F0C3FCEA9039 At.u,
810,157,251 *5413379B42B37B900616B6739971A49B57906384 ątū
810,157,252 *541B88F5ECC26DFB0DF81CAB441542C535F77C4D AtU6/
810,157,253 *5414B67BD347D85916C7668B617A5DEEB65F3A8A At!U8
810,157,254 *541C9F301D6E05C3A3DFE192E2E62D86CA7DD868 Atuarism7
810,157,255 *541EF5A04FAE8A7CE412F2B9C7D679CBAEC480BD ATUBAYAH
810,157,256 *541BA2BAB83E7277DC3F91C24A143CC305460DFD AtuE%
810,157,257 *541740C9C20A57FA16457B79FD7FFA8234545E4F AtU,M
810,157,258 *541A64EE12D1D0028B36B703F40598B35AC80C7B aturavas1
810,157,259 *541BEE506F2DA75535338128FCE4F29EA7695025 Atuviesening
810,157,260 *541AEAF4E72C41F90323DAB270FCF0720E5F11B7 ATuwV
810,157,261 *54181E152854D0AE81D6B198E19442E8FBB9E4CA ATuYZ
810,157,262 *54180BAC53770F26C3F4822781CDE3B4F4D6E906 A+TV!
810,157,263 *5414B03F4DDFA5DB1B5B55A3A734975C854B757F At&V$
810,157,264 *54145DB61D454D6B388145236BB67ADD47EC606F At&"v
810,157,265 *54176BD867B61BF5FA16E4500181C8D2030BF9DF ATV1e
810,157,266 *54171CEB232CE1D1EE5705EF398822D762F17FA2 AtV6V
810,157,267 *5417DD71AE085E4B92C8AA523D0836D2D76924B5 ATvd_
810,157,268 *541E54F8153ADA0B6F639B7545EA778C221D04CF ATVGMGCZVF
810,157,269 *54178C6727E783023D63B6A89FD2AEC4B098A3C0 ATVHt
810,157,270 *541D65A4C77B94E0E3C4F9412556A3D73753D539 At)vI
810,157,271 *5415043A7786FC6D35DC55CFE9FE6F785D48C093 ATvKZ
810,157,272 *5416748068E42CE4B8B152582CAC72DFB45668FF ATvL(
810,157,273 *5411AFB97BCB4A15822CFFD8D009CA1AD051145C ATVW_
810,157,274 *5417969CADA06E0A8E406176C8A7FFA2851624CB [email protected]
810,157,275 *541A0A43F2DA45D2C7EFFDE5346F182D22FAC0F4 At,.W
810,157,276 *5416D377615E8F8874EBE37049166D3F82983ABA At.;w
810,157,277 *541E1C0A9D1E50FAE060190B4FAA251988BC8B29 ATW456
810,157,278 *5414AE1ECF6A0F23BCEC7D0CA3FF9046E2BFC1C8 AtwcU
810,157,279 *54126A44EE497A9EAE8701B72D07A43F3C1E90A8 At?wh
810,157,280 *5416B66AC924156995EC0F5CEB9C4D70BFF9C451 Atwoatwo4
810,157,281 *541D612525E015824ECF078EC69FAE010DB9B6D4 A(t$X
810,157,282 *541BD7CB668318DF1939C3DFA0972D61753A591C A.TXe
810,157,283 *541B54834F38BECC8041530713F5B2C2DF1B2E50 atxiang
810,157,284 *54142BD6F73A0BC8E56D344B1F94A5F7A49EDBF2 AtXw:
810,157,285 *5415A8379473FE580C2BD134E91BADC165696082 A!tY!
810,157,286 *541F4BF9E068D8DCA7B2C8B1B4707B2BEF797C8A AtyBkmFxEVb
810,157,287 *54169EE80305D16DB1EACB38F047FF7D61A2391A AtY-K
810,157,288 *541825A4F3D3B81B5AE086C2E0DBD08082F7CD35 ATYoj
810,157,289 *5413781C137DE65FA2C6946A0E2A95705E12BD89 AtYPM
810,157,290 *54129B59DDADAC5B12E5070B37D46C12F10CB7E4 [email protected]
810,157,291 *54129577F66EE21C6723163B62CE79D9A0B1ECD7 ATYU!
810,157,292 *54138F27AD2E6736F0A597241D7A5F7708047BC7 A#&TZ
810,157,293 *5418A70BD402E8567479C6E94E5FBC6483AB480C A=(tZ
810,157,294 *5414F7EE19B809B4E30350F906ADB1BECF01BA01 A?tZ.
810,157,295 *5413BAB65D34E0C98757821FDF51B63832B3831F atzabzt4
810,157,296 *5416EB4372A02484B916CF4D87D162197051D513 AtZaw
810,157,297 *541A0D23C1603EAD156A775906A7A1B4347108E7 ATzC
810,157,298 *54137A7C614E8B5E27D4299E50C1D2D78768F210 ATZ&f
810,157,299 *54170454152D4ADC728BC7707D646BBA3E4C81B2 AtZN&
810,157,300 *5412A519DF75A7E3270B5E3E6FEAC15F56624759 AtZSX
810,157,301 *541AAC528E01A703FBC01444367FB714FFD54321 ATZWQ
810,157,302 *541908AA8E2603101081F1EEFE3020150729C259 at互換機市場
810,157,303 *541D46C4A32D46A20F997E15ABEE879B32095ED6 A_(-U
810,157,304 *541C805654AD712E066DDD03D4B443A76C626F4F A-$U%
810,157,305 *54171E3F5F7B0B1498F2AD053BA1DFA0DFC4B5DD A:")U
810,157,306 *5414AE8D62D6C5ED9CF04D484C488AAF222925C4 A$U,#
810,157,307 *5418D9A40B12D39F88A391865C98D9152AD2EDA0 A+:&U
810,157,308 *541387268E6BA79AE2B3A06D41A0E44F9929AC66 AU~*
810,157,309 *5411518C49BCACDBEDD196563E797EE247C6618C AU-&_
810,157,310 *5417ED795D8F6DFE71DA6017974AD283AE81F97E AU,(
810,157,311 *541DE1A8232E4BB056C34FD8FA0DB0AAB1001006 AU;$?
810,157,312 *54132830D1D0E5A1BE32467251581ECFE8E9C536 AU"(#
810,157,313 *541FC9A2D82F7E20579CD402253CC32C82E95AFE AU$,=
810,157,314 *541F0E5E927470D9751BBAE7E5AEDF3BACF14D60 AU%$=
810,157,315 *541962D147C77551B011E817C1CE2BB0FD5B88E3 AU+#-
810,157,316 *5413D52E1AC0C210EAD206A124186B7A74C92E44 A=$,u
810,157,317 *541C0A814286ED204914CC3F382315FB5197B1CB A_)_u
810,157,318 *5411A5108778860E6EBC42F3EB40B22FE6E04B1B A-u/(
810,157,319 *5412160BE88C7298282927657689E93DE85A5391 A+(u$
810,157,320 *541EACCFCED58A7A8F217E47FC4B8404D8B6C2B3 A+u#/
810,157,321 *54156F2B42A794051FE4DFA259C1543C49F49693 Au#=;
810,157,322 *5412281C4D2F46C0E46A4B5306E4F20D95F05E81 A!u.0
810,157,323 *5418C1A7E4821622FDBC91AE540C46A02D4B7927 Au%0c
810,157,324 *54133EF9B3F7E1F20EBD003998D69C7C5AEA4384 AU+0D1ALL3D
810,157,325 *5413825B2EE5A6D074A365DE1FF4A1877A514B81 AU0TC
810,157,326 *541A022994453ED6A54CCF219E19F9FB823D2B19 au10$
810,157,327 *541486FBBB875F5CE7F98151CF1D52491CAA8D1E [email protected]
810,157,328 *5410F67DDDAC153BDEE16153F9B3CB3C10009856 Au1c&
810,157,329 *54142F7B2B55AA342C84601F1FEA1DB7F28EB86C Au1hn
810,157,330 *54165BC1688DCCB62D1D3699B4A61A069DB03B46 au+1s+1
810,157,331 *541191F75540B03CB3C67FDD7B670EA91E62CE89 Au1Z&
810,157,332 *5417DD1CF8B2CA8E81B80F56BCA8E297657A012B Au2)-
810,157,333 *5419C1BA7897229F8E2DBCBEB44ED861E8023A65 AU2aa
810,157,334 *54195B459CC4D7DD4379E010A430D2A5EB10826B AU2cN
810,157,335 *54122E0152C3E2FE9586EBA58C6BFA8CAAB64ACA AU:2e
810,157,336 *541EFE216DE6ED8042C40A841D7ABF36636854DB A!u2m
810,157,337 *541D2C72A5013C76CEDF2776F9E69A3036A0B890 A=
810,157,338 *5417010E74D2287AE81FBDA0963D309894B92E48 AU;34
810,157,339 *5411D296EE1315277CD63D2735DFDC79B9FB3842 Au37
810,157,340 *5415D24CA5E345F9B96237B103EB388D56A8FEBB A)u38
810,157,341 *541C8CA41A88890BE537B69C988220F7D1E8B92F AU&3B
810,157,342 *54184A335D977A36648AB3A16B29DB5E8516DEC0 AU3?E
810,157,343 *541413A30F892C0768AFDFA8242A8E98134DA353 A%u3F
810,157,344 *541A94876B79F30849A7FFDFAE357928E18A7A18 A,u3Y
810,157,345 *541E7C3BBE9F8394BB3C18ACCDC4D54F158A5465 AU42135034
810,157,346 *541A8A9107DABFBCC0A6AFE1EBB52597812A3922 au45dosa46mxldir6us9wk8
810,157,347 *541285C148DD3EC75F18385B93D97C37F4CD8C5A AU4K#
810,157,348 *54198948FBAEE393FD8114FD11DC212BE6D81E87 A;u%5
810,157,349 *541B397247B77B4A1D921D0366A10D73C015C150 Au531
810,157,350 *541FA4639ECE11ECBEDEAEE9765729341BBCA65F Au:5h
810,157,351 *541BDF79ED20608CE8289EFFA073FA752ADFD8C2 AU5tj
810,157,352 *5418B6A59A571E229AEF1726D5BDA42FAC18116A Au66P
810,157,353 *541C3AEEC59CD0472FFEB005710288B51F7CDBC7 A;U6D
810,157,354 *54154F0951B56FC4CECDD98A21168ACF102B8429 AU&6D
810,157,355 *541744D35B7218601A76C6DAD4EEBD3CACB86DDC AU6&I
810,157,356 *5416E500C7427585F90EAF437B5C3876059BB55A Au$6Y
810,157,357 *541BB67C24062523D61F5D4180A75853AA750635 Au6ZE
810,157,358 *5418E92A786736E9DC8036DCFBBAD1EEF1392A0C AU7!;
810,157,359 *541EDF4C814824D52473D800740600415339C5F7 A?u7
810,157,360 *541C4B622BE5BA94A2E29BD5AD1A593DBC403B70 Au&7/
810,157,361 *541CEF7B6E4A2C09BB985CD5CD33D202D77019B7 Au7av
810,157,362 *541E6B982264984B6C2AF40CD3FBCB1E39C7C832 au7oly71c
810,157,363 *541C262E5989879C69999356B6A6C1678B909487 AU7q"
810,157,364 *541A281630EC972C57598EA1C3896C77F5D1B225 AU7_s
810,157,365 *5411A085B46AD3F8A8E61D7DEB93F112BF99F051 AU8=
810,157,366 *5414C5535AF3147FCF923C4208E387D6588F665C Au"%8
810,157,367 *541CC0D7AC4F146226097820A38E545AB76362A9 Au,87
810,157,368 *54117398B15468963FF46174B11E769F6538DDA3 Au8B#
810,157,369 *541168148C650897CB15E080F5E6225B2FF6744F Au8Bc
810,157,370 *5413A9F0D6221B8B25718DE59523DA322AC39F05 AU%8C
810,157,371 *54184C97E5843A19F1BD563E7A4AD908BBBB3C06 Au8D7
810,157,372 *54138013D1DC47909B62F6A5000788E9F847434F Au8/f
810,157,373 *54150B946F391678BC7F073EC0FC8AEE878E6CB5 AU8IL
810,157,374 *5416546A12F6F4C00642B29DC262FE60D6388D10 Au8MN
810,157,375 *54156D32BC5EFB31A95891AC1B4CA5277E52AE95 AU8Tf
810,157,376 *541C8CEB3D7AEA523D7362C10410C77D33382352 A_U:9
810,157,377 *541BF08C2744446E4CFCE15AB696283D9F2883C5 AU?9%
810,157,378 *5410C9DB44C5163125DD59886C85FF8259190EE2 Au95(
810,157,379 *541AD9368E8BB00A6C4DD6B80B996FD7E1F3CCE9 AU.9t
810,157,380 *54104CFCD220E56DBF871652BA62521BCE40FDBB AU_9Y
810,157,381 *54100CD96EF11A71BB3DB127BA5E94A718820BAF Au&9Z
810,157,382 *541EF8F0EDE46A36247A291A500BAAC9D1B21F3B A_uA(
810,157,383 *541F9C5897DDC596E602B34B767AF9A587D787D0 A!ua4
810,157,384 *541963636B01B99460BD6647AE63D8FE89DFBA2E AuA)A
810,157,385 *541A6980C06AF9CE9CF55F43852A598B9AC6C0EB A+Uac
810,157,386 *5413F98B3F5CAD56B5BF4616D18900AEAC425D35 A#uAe
810,157,387 *541568BA064826983A17F6B8E6D56A9FA7ACCC1A AUA/H
810,157,388 *5413D690891A088E77E6F679E1E57D9D4D6E6C90 Au_AH
810,157,389 *541F214AAB9BE34006C585B3C86E091768202613 AuA_i
810,157,390 *541F11EA01F112A6A4EB7365BC78978B8475D15F AUaL0
810,157,391 *5417DA1ABF8291E6D93E4365A03FBE2DA63E2FC4 auancering
810,157,392 *5418A0A57A106D86746417B4FA934B29F7704515 auarise0
810,157,393 *541D2767495153BD3C5600E58E844AD6369D7AA2 [email protected]
810,157,394 *541A5B7B06A5B00F89FAD3F7EA89AC7B98254A80 AUb$#
810,157,395 *5416F93503C400798E8DEB861E006C388DFDBB70 Au
810,157,396 *54128E983229CD7F8759ACEA61B8A53CC274BAEC AUb1G
810,157,397 *541B85E3245B0DA94864A597F031270C67B732F7 Aubanuku
810,157,398 *541021D3DF73DFF8EACF54399B9EAB3232BEBF25 AUB?b
810,157,399 *541E0E2689AEC3D7E0161FC530E4A30058DD918B AuBCk
810,157,400 *541C38AEC66DF241257E0F446248A0785E033EB6 Auberivière
810,157,401 *541586513707480187A38F7B680B59E75D81C412 AUBERON!
810,157,402 *5410DE29406CE6A8FD5328175F7D830E1B779C60 aubgpqqhr
810,157,403 *5412D56CCB0CBBFACC35FC9211AC3AA94A92FB39 Aubible4
810,157,404 *541A59A3767677323645A517E1857B8D9BA6BB62 AUbmB
810,157,405 *5418315CC8CA7D071D866943AF6A8B1F6AD586A1 [email protected]
810,157,406 *541F3A4968739C813B46E332D1446263EE644E9D A#UBp
810,157,407 *541FB8A9FE21065481B1EA23C6B826171520A8AC Au=Bq
810,157,408 *54144F3803028A52C0CA89F9918654A1F2F5EF86 Aubree023
810,157,409 *541FA0499A5B251C1C03FB819718E22721905E58 Aubretes2
810,157,410 *5415B890630CD738C647AF8E8EF881E1A068B4C1 aubrevilleig
810,157,411 *54177896E1D6B7780FFB75E3ED10436C31C83C65 aUBRey
810,157,412 *541A9FCFDA45E23003B54242BC71A83419C6EFDB Aubrey065
810,157,413 *5410F192BF53D9982A5D1E89681F94529A2CC59A Aubrey479
810,157,414 *5419176E4243D3EA760E102428026A55576614A8 aubrey.calger
810,157,415 *541201C952390EFF46B9D53DEA7094BE57B6D4CE aubrey.cartledge
810,157,416 *541F848DFAC2DA37552EA1163ACAAB451453DFA5 aubrey.chiquito
810,157,417 *541B561AB2B7DDCA89B65DE97C055E2B176A0672 aubrey.dekort
810,157,418 *541364CA325907830DD3009E950BE685259E4B11 aubrey.everleth
810,157,419 *541B966501EDCA127A37DD68DF4626FA8B0BED6D aubrey.flannagan
810,157,420 *541DD1AA49A9B69379C7D107899A546F33AE32A8 aubrey.fobbs
810,157,421 *5418604F4537D6B87DB2CB9CF71B13C2C26FDF4A aubrey.grassham
810,157,422 *5417A1D2F9966D2E76C4EF8EFECD7830F92304A5 aubrey.haven
810,157,423 *54195E911FAF85C6E0AD89623491122242188C51 aubrey.higgenbotham
810,157,424 *541397B70EB191E980DE93DE4952E4ED2E8AC310 aubrey.hinajosa
810,157,425 *541AEFC3215999BECF5F3415AEC3D40EEDE099DB aubrey.igbal
810,157,426 *541459D53A132B2600599D5ADD5855A0670D56CF aubrey.kazmierczak
810,157,427 *54173ED8F02E08B537BD6D9D7AE59F187A637D0C aubrey.keyser
810,157,428 *541C9CC82068AB1D2F868099C5846F1404F030CB aubrey.lakes
810,157,429 *541E58EA7361F871598DB1AA60255939E9072724 aubrey.lorens
810,157,430 *54103DBA583B668D205DCA9266C037A6CA014CF9 aubrey.mcclurkin
810,157,431 *541D0950490A5ABCA5A41FC71DA4731DCB484CFC aubrey.mcwhirter
810,157,432 *5419FE021BC60078709DE69E63D586C90785960F aubreypowers
810,157,433 *5414F04FF90C90782096C261FF08E96A31964DA5 aubrey.rucci
810,157,434 *5412C21FB74867BCF403DFCF9B1B839CCAA9A865 aubrey.sider
810,157,435 *541929B16295E48FD3B3A9F9A283AC18E9F67632 aubrey.sprinkel
810,157,436 *541581F99F4EC6DD5B8EC538102877CFD488C631 aubrey.vallin
810,157,437 *5419AA60431589E65956382A9FC17959E48FC076 aubrey.yoho
810,157,438 *5415689DF0340ED644EE878512407561AA0DB24C AUbU4
810,157,439 *5412C4952A8AE5AFA92D1FAD7E770F8F0AC53369 AUBUGEOIS
810,157,440 *541B8AFD8AC263A378C7A271159408B1BA5937E1 AubY
810,157,441 *5418139ACC307D33F031AD986CEEC95531C9A2A2 AUC(&
810,157,442 *541C423A32A18C21FA3F2424F3D02CCC0F5298BE A>uc
810,157,443 *541A414DC1842B14E507C0BA740346EFEA25B803 AUc(2
810,157,444 *541A2D37A4E031A655C450D691884FF5B25A9F11 AUC"3
810,157,445 *541D210FF4F9CD208F5BF80E8574D752C6326521 AuC/6
810,157,446 *54157FFBA302D89CC12833BB5F5F1DCF082F6DE1 AuC7U
810,157,447 *5417C08119166CA748DA0870E6F8CAB7351249E7 Auc9I
810,157,448 *541AB37079C35D5B142F888BB07ED4587BD92A4E AUCbY
810,157,449 *54171201C7D060EB8E1F6CF88CF81AC9236D3708 Aucedined
810,157,450 *5418B573B9B2C21B40B3AEC33C72BA940BE8BC24 Aucepseses
810,157,451 *541C345D3977059B39C7A3575DD06EF50F3C9FC7 Auchanin
810,157,452 *541ECB3061C8BB78C36371045AF9F5A918070144 Aucidity3
810,157,453 *54180A705C01576F22F94B83FE6A02859F75A9C4 aucklandfirepolice
810,157,454 *541A87F896AFB38D2895D0D1E368B40A410FA870 A)UcL
810,157,455 *5416BD460F3A3B46D2EA6535778A72B679C4D369 AuC?L
810,157,456 *5414CB05BFF644483987EA00B5F176121D82C04F aucluin
810,157,457 *541D17822343307616E69239FF2D151EB061BCFA AU;CO
810,157,458 *541882A4AB03955B1F9A90FEF27F036575BD2B21 AUcpL
810,157,459 *5417CF5028AC82B4928FA2E0A046DC704DE50A63 AUCQu
810,157,460 *541D62A6356D9B8318077DF08C4AB960E99AC70C AucqU
810,157,461 *541ABC60615FF1EBCC7F4B0A47B8F25D7B7AA47F A=ucr
810,157,462 *5415899A849710EF34A9146262C8D993B609BE0C AUCU.
810,157,463 *54174267B245BF747A81D8A36D047D4EF389CB82 AUCUg
810,157,464 *5419CADAED01D54AE9AA600A343B4B726F3DC3EC A=U.D
810,157,465 *54163AF78918696B6D8CA42806E36D47FE276671 AUD_!
810,157,466 *54132204A09218EBC149815F56C04A2E7C381B5D AUd\
810,157,467 *541B9E5F9C94EA1F5E1E78F4F06DBA2CE38EF575 AUd;0
810,157,468 *541CFD7657D88E02BBDB2797658D8053850FB6CF AUd8d
810,157,469 *54122506199223E2EFFC8BCDF2D399124319DFAB AUD94
810,157,470 *541EB0906F3F037B83B0CA3B099F988F180D04C7 audacity…
810,157,471 *541A90B4498C701FD8661FB44B62DAEEFC4F346E [email protected]
810,157,472 *54150D317344E9BFDAF8E4E440460A46F80335D1 Auderienses
810,157,473 *5413FA91199F9309565614D24347C1C965773F4C A(UDF
810,157,474 *541E834331B89B0229DB4C253386D07AF52C15B8 AUDFR
810,157,475 *541B8399411EB41C4E925DEC6C88C1DC0B464BF7 AUDH_
810,157,476 *541C48B47968AD8831CA4D858085A2711B263E43 Audi0l0gie5
810,157,477 *5416F51F3347F4EF8500EF37778E44C7F18A3B11 AUDIA1234
810,157,478 *541C668A5792186D58ED27A30DF222B07FCAA0E0 audiences.36
810,157,479 *541C5E7F6E820A0D7006A7FC82D3C7B26CECD691 AUDIf
810,157,480 *541268F422D574C62DD3A976D44A95F6ADE71535 audio-descriptive
810,157,481 *541BF9EBA577D6F189B2BA85103C6020A5AE7367 [email protected]
810,157,482 *541EAB7FA6679CA116F68D4DC6ABDCD67D98461C audiolinux
810,157,483 *541DA4AD7F6C0C34E794815A7957DCEF27A5BA9C audiophilea
810,157,484 *54136A2B131C8970B3F6ADC7284580A74C62518D audiphon6
810,157,485 *541C840E57A2CD5C765D667C62D3AFEEC9612B4E AUDITARCH
810,157,486 *541E8538723D514E733890BC65930BE34C5C99C6 auditiesed
810,157,487 *5410CC38CB7FD3AC98FCFF64A8C78E300E4EC9C2 Auditising
810,157,488 *5411562F457102673775030D03EF0EA45B422256 auditiva1
810,157,489 *541EBE12DFF3B480DD817450F8083F5A6DDAF232 audley´s
810,157,490 *541C7996A8AFCD228C513B52C2933B79B75B0BC1 Audly6
810,157,491 *5416CAB24BAE396F20E2EECB59EF3292F744C73A Audragy
810,157,492 *5410AD0FE19ECE02BA447F9EDD779AE51CB33BE1 AUDREY31103
810,157,493 *541315E34C1B8A32957A5D2210C9CB83A264BDAC audrey482
810,157,494 *541EF97E958ED4244992B10FFA87D962F98016F8 audrey de guzman
810,157,495 *54167148328A5A384BE5FC8E1D802FBB1E0A4FC6 audrey hanson
810,157,496 *541C01DA5E0E9E8ED43D16C03013D39CDC1EA554 Audriennas
810,157,497 *54137BB7C44F972A7CF20B7F8F041F6A669F11C5 Audrietta7
810,157,498 *5413CD15F6ABE075DE5831364FD5E3125E7ADBAC Audrina15
810,157,499 *5416A87CDDC0D7B5D86FB5A544FE81E097610623 audrina608
810,157,500 *5417D452F3D493A568E4CD5E0156740C53EAFAD7 AUdT
810,157,501 *541AE83C1FA0960CED4F21646811FA7457BF6728 Auduong12
810,157,502 *541E4618BCC0CC512391404B4D42E4032CDA4B16 AU$e-
810,157,503 *541554E3E4994449F971EC163012F36F12CFD70E AUegg
810,157,504 *541B39C21330E34CE126E61EC859BA996AFD8DC9 AuEm$
810,157,505 *541995A662C828C405B0964FDB1AE5D32D46EC63 AUem0
810,157,506 *54184330F09243CD1ECF647F658786158F446285 auenage3
810,157,507 *541866515DF886EF38F27EB60F0AF2394CB37CDD AUe_P
810,157,508 *541B7D7AC2FE77C68474E76CA2331C6ED9B05DDC AUePq
810,157,509 *54198A102D0B895E3933B2A84FECE90322E001C9 AueQ4
810,157,510 *541D77F6A6BC4613BDC8666A9C7221861F5669FF Auerhammer——奥尔哈默
810,157,511 *54123A651D9E2A038EF9F7D9EAB17FDC8164A7E5 AUe,S
810,157,512 *5419462D98DB1B14F168791BCA9707687E0F324F AuE,V
810,157,513 *5410D81C1BD157DE0DF988771493F7F73C894EA5 AuEv1
810,157,514 *54167350B1258FEC32AE741E8D73070FC6AC38AA aueyr106
810,157,515 *5418940495543586D4BBB7C0B144FA46D17BFE7B A$(UF
810,157,516 *54116DDA00E519833CDC810AC1DDB1B1068C3A6A Au+F!
810,157,517 *541873B22D3A3B27EC101388659D30324604922E AUf37
810,157,518 *541B5E22A7C12A0AF1434486ACC09DC41C5F8903 AuF5b
810,157,519 *541DFAF04CC194AC04F20165C6968F799845E182 AUf5R
810,157,520 *541239D86D771507F8A8F514E3028563B3B15DDA AuF90
810,157,521 *5412192738C7E72CA8B328AB13A30931ADED56BF AUFBLEIBEND
810,157,522 *541D79EED1479B8DDF2D2082AB7717764A8A8F6F Aufbruchsed
810,157,523 *541AC339AA3E09B767AB71FB515D2025EB0ABC49 Aufelter0
810,157,524 *5413E136B015DAA8F2C0DC43B7A986178EFB636F Auferetis4
810,157,525 *541138A4B1FA45DAB71587317BA398E3F5F257E3 auffächerte
810,157,526 *54194F0EAE6481367649F25F7AD0F00EC273E9D6 auffaelliges8
810,157,527 *5419972417AC967599C285B21E3F80D8756411CF AUFFIEL1
810,157,528 *541C377B80A64A79F0D407471CF5C27D05B347B9 Aufgefressene
810,157,529 *541DC156F6C5A4F12A6AE14E9798F96EBDC1FB41 AUFGELO"STESTE
810,157,530 *541D37F52129E66C09EFD6D063D74CD5B488E01B AUFGEROLLT9
810,157,531 *541CC9FB56FE1DB60BA4F718B62C7B7AEF7AAF8D aufger?steter
810,157,532 *541BE751361A6DAF8718FE9EC2510FD37C1FA761 Aufgezas
810,157,533 *54132BE63F8527882FB23F0696E0786290A6BBDE Aufgiess5
810,157,534 *541D575EED366468E88259B056132AE613EEF6BA AUfh&
810,157,535 *541EE430CF7ACD9D42C808393BB0C0599585A65B aufheitzt
810,157,536 *541F9517B7E5CE11D1DE68136AD6E7E8342591D7 aufheizen8
810,157,537 *541EEEF540F53A911E70F1D1CFBB80ECDDE886E8 AuFIK
810,157,538 *541860B8B255130F5BF3B6EA974811E4E36BCE13 AUFKEINENFALL
810,157,539 *54133C1570E10ABAF1FFEDCBD5412F1585755E84 Aufkommen6
810,157,540 *54173C8EDA5ECB877D3D10B25C8F00183DB4C6C8 auflassu0
810,157,541 *54172F77125FC3B69F33DB7460A1236249F876CE Auflisung
810,157,542 *5410440A04BA71145FABCC37DB7732E411DBEACE Aufnahmeantra"ge/n
810,157,543 *541EBB519BB3CFE1E11C55B562C7C21E685060D8 aufnahmetechniker
810,157,544 *541903DECA078A8A3D6425BAAE28050B9E282219 AuFnR
810,157,545 *5415B3618E487F7C6250C4862AF7AC29C540C3EE aufpanzerungen
810,157,546 *541C4AB01BE7A2731F94F4AD961CBA9A795D274A Aufpumpte2
810,157,547 *5418CD6789A481674DB05B40ACDFFA75C3DFB972 AUfQ%
810,157,548 *541A37F5641D7BB546DA9981D59677B50CD2A622 AUFRU"TTELNDE
810,157,549 *541C1E20CB42C9F890F73FF3A53737C6CC345CA1 AUFSCHLSSELTE
810,157,550 *541323E6B6014622E989FE498A770A2855770EC9 aufsichtsratsmitgliedes
810,157,551 *5412E34C009690299E7F58C0132B50531C5F936D AufSK
810,157,552 *5411FB0BAEC24597B82ACDC8D4BD0F06143166FE aüfteru
810,157,553 *541F5D0FA810F5C5C122D72D4F7305BF456835D2 AUFTRAGSBESTNDEN
810,157,554 *54152431FDC1CF1EF83AB6351F1660BABB69A3A9 Auftragseinbrüche
810,157,555 *541B6BEE8A069B7423EBE041F560CC7F3447A32B AUf%u
810,157,556 *5410474CBDCC7D9259209295A49F45AC99D535A3 AufuH
810,157,557 *541FE384007E07FED8B61671C7056ACEFC1D41F6 AUfV"
810,157,558 *541EB12314291C53DF69C7BB4165F5452B688B51 Aufwhlen5
810,157,559 *54190B6C50E902A3F198D137CCD7D8EA48CF53B4 aufzeichungnen
810,157,560 *5418C6748D38E1668376F39D72D691D07824258D Aufzuhngende
810,157,561 *541FCBF591D1F337682E7B5E50854430E804CA02 aufzuloc6
810,157,562 *5412BB6EDE7C443DD9DD2B496F4595C742F0ED29 Aufzuruf9
810,157,563 *541CB3775238D3743D41BDF836D3C5FD5B0C3343 AUFZUSPUREN
810,157,564 *5418AB7FA0A6304D4624CC2FC30D129FBBFE2EB9 A;$ug
810,157,565 *541F7C904E58D6207335015F368FBF58FF71FB3D Au!g#
810,157,566 *54160C8F5C7F27523CA454C841BC057C603D9907 Au&%g
810,157,567 *541FB98FAE5342600EC26AF0601A654DEE8DB55B aug1391
810,157,568 *5410E831F4650856A4E490880DB28C9B3082AA0F augenehmeren
810,157,569 *54150F1373AAE52830D608BF8694B696A11AC1B8 Augenfeindlicher
810,157,570 *541E8206922AA74B0D74C188C5DEF71E138C1A0A Augenfleck–Prachtbarsch
810,157,571 *54173DA0E1B47DE1C2848B487873D1BC5F34B41C augerrsler
810,157,572 *541C31A8FE42739501BE9A81D67FA1E329B9F9DE augeschlosseu
810,157,573 *5416CB45F3BE27943EF9118A06279D4C3A5CC2FB Augesund
810,157,574 *541F8128A6CEE32233C06EF872113034CE7C54F7 Augeuverdrehnugen
810,157,575 *54130654102BCCB14C52BC9FB5E9F3FC02F98457 augewunüen
810,157,576 *541D505502E996471918A38CA4C13DB0E6AACFD2 [email protected]
810,157,577 *541DC49FDC75708A9CCD585D98D9FE3E8F901A4A Au$gn
810,157,578 *541B7BAFB0AE7FED45032B8EC66C45879B016C5A augnatip2
810,157,579 *54116355D4352A751CBAC28BE7BB70422973BDD5 AUgPi
810,157,580 *541156C67C0063B3AA9165079A5E7A5B5AF60F9A Augqs
810,157,581 *5419974D068F047C3A289F3D8B1C4C8E94F96064 augsiančioms
810,157,582 *5419108F8841849A01DC05D1906C3314D49FC4B9 augstskolās
810,157,583 *5411708079739A462819E02E4A2EFC3558175FA5 AuGtp
810,157,584 *541794C7D8ED579A68892BF05568D8D451DCE057 AUGURAAUGURA
810,157,585 *54129A50C71542825FD4D53B5ACF18AE5D78312B augurita5
810,157,586 *54166424B60AEA35CF7E71244F0B51359006D2F4 AUGURNVTI
810,157,587 *5410F2AC27FE4405034D13EA0A3A130DB031DCB6 August1616
810,157,588 *541268FA581BA71250192ECA454004187BD794A9 AUGUSTA'''S
810,157,589 *5419D0E26D35CC52E415BE6CC30A899A76E61A41 august.campell
810,157,590 *54198254AC9C1BDAA101A12A48A2B63388DDB3EF august.cao
810,157,591 *54113BFC8060EA85EB22C126580D277195A4E34F august.czwakiel
810,157,592 *541B616F1BB279E5FF903E85201F4D6FD23E0C0F august.fosnaugh
810,157,593 *541109B0F847F1B6947FFDCE3F13307828FC9858 august.hackey
810,157,594 *541A0D8E5732DE09966E7097FB0AA04D76F19B37 augustine.agonoy
810,157,595 *54141E012ABD574BCA1F62655A21496A3F7DBA75 augustine.astry
810,157,596 *541D6DF7DD01DF3C601B517E4C59539A0CBCB11D augustine.awalt
810,157,597 *5417F2D902806D2AFF44C98737715740C0FDFF3F augustine.baruffa
810,157,598 *54169DD0237D2442A957671117FB87236E8DAA79 augustine.bieberle
810,157,599 *541E41F70A4706E9DD68690CEDD29FF7610ABFA7 augustine.caleb
810,157,600 *541552C1019C9423C2D64B6CF22A36BC4FC4EF58 augustine.eagleton
810,157,601 *541798DE39C72887EA39ECEBC0D81641983D6826 augustine.easterbrook
810,157,602 *5414DA47A99D375EF2CB6EE2A3C61D9BF6AA73CE augustine.grahan
810,157,603 *5413873438829F5A5BB0770719C1A3DEDD949C07 augustine.groen
810,157,604 *541A57F5E1DF4A7062560D200424551680168C02 augustine.gutknecht
810,157,605 *5419ACCE1BEFA3736E7033DC6EC4DDA152B69997 augustine.kuhn
810,157,606 *541876B28EBA3DC0160C4A9C8C4A39FFEC91CC84 augustine.littell
810,157,607 *5416942F2D476DE81EB4E24147685C4702BC9AE7 augustine.mccrain
810,157,608 *541644F915289EE45BF753CCFB7035532D960879 augustine.meade
810,157,609 *541417A8037B08A261B3739922D93309DFBA8336 augustine.moffa
810,157,610 *54169B29B5DE91D7D5F19868BE34A078C306678B augustine.mynnerlyn
810,157,611 *5416111A87E283783EDA556E46A353E5826703FB augustine.nabritt
810,157,612 *54102D2F9B32B4F5C16BE7FA155F014AD389318F augustine.potter
810,157,613 *54174B9745978F44FD1B69EAED845DF617D50F8D augustine.radosevich
810,157,614 *541E23CD97CF869B7B681651DA06F5AF9AA220FB augustine.schwartzenbur
810,157,615 *54134D654E6077AC19C47BA2D12AEF303789D373 augustine.sindorf
810,157,616 *541643AAE0A6F2482C3304DA284B1FCD9D509ACC augustine.surpris
810,157,617 *541D5099A8623FAD5DD4C526FB0E40D3743F7A74 augustine.viengxay
810,157,618 *54170AC6ABAF65E4808E476CBDE5479E6C464312 [email protected]
810,157,619 *541FA537AD86D7C3A94E55D0220608F44A0168E2 august.krusemark
810,157,620 *541A6679154695B69F4C302EB455BD9089C7F8D2 august.liford
810,157,621 *5419391FADD4845AD2E6857F36CBA132FBB18658 august.mastrianni
810,157,622 *5419B5279989F47900FE1E313F0DD5E96CF62C67 august.matto
810,157,623 *541EBBF51D35C74CA66E8280B3E0EFC5CBA901A0 august.muncey
810,157,624 *541FCAFBED73A0963CE3A08497791784920FD70A august.revelo
810,157,625 *541DC073488E6723C531A989462082B85B66453A august.stayton
810,157,626 *5416B8E1102867FFCB5D919933C9FC7A56CAC978 august.stechlinski
810,157,627 *541932A325E0504666A6AA478C99AE47F5BBEEF7 august.steckley
810,157,628 *5416F9619BE42CDE2C0CECBF5BA52FACF84C07E1 august.taliferro
810,157,629 *541E4737291B63546429B8600279C177AB56C22D august.tippen
810,157,630 *54143C052732488E8D676B161016CBCCB7C1CF55 augustus.agle
810,157,631 *54157FA40DA1390E8A5CB19FEEE428715431E8C9 augustus.altshuler
810,157,632 *541E63CEB60A3E18D444E3FD2823079B19936E8F augustus.amarillas
810,157,633 *541B8C7D93660ACC9FB2B3E69D8CA2E010A4F682 augustus.arguelles
810,157,634 *541B1C2ABDE2BE6F655AD4A330D4452A4AA0BA03 augustus.bega
810,157,635 *541A336368D98AE767B0C799AAF5FD17266EF7B9 augustus.bienek
810,157,636 *541E7280B96D964A6AC7C7ACC717CC06C7595432 augustus.brigmond
810,157,637 *5411CF05E94DA39A35BBEB3802622442A31DB5D0 augustus.broll
810,157,638 *541E048CFEA50896C6790E58106E56B3DD19E062 augustus.bushweller
810,157,639 *5413E56C0C1FAC8C8646CE499859EDD4662D190A augustus.cheong
810,157,640 *541AA48E9701562BA7650DA60DB52CCA9AE0B8C8 augustus.deur
810,157,641 *5414DC8A34C4D656F63AACB62C2C5CAD6D1E4E12 augustus.goltra
810,157,642 *54192CA6FE356975DE167DACAF96428E77AC2F5D augustus.gruett
810,157,643 *541981D6616E356171CB4657D7297CA94A7955F5 augustus.jo
810,157,644 *5411AFB7CBCC4AC0FCD25DF4BA88C166E8FCCC7C augustus.kernen
810,157,645 *541BF8EC0F7CEA03AE258F46F459BA19DBF76DDC augustus.looman
810,157,646 *5414382E822C4710FC9EC262AECB1E6EF1EBDAE9 augustus.luckenbill
810,157,647 *54137F6539E6BF76414EEB610C0DCC20CCBECE69 augustus.muddiman
810,157,648 *541BDF3E57D24AFBA07A1D11A9EB9316091D9372 augustus.oertel
810,157,649 *54183E008BB7DA35A5AF82019E879792F91C4EEF augustus.olowe
810,157,650 *5412FA9151BB265C2131A5B531AE943A5372BF24 augustus_o._stanley
810,157,651 *541630246281F614AF84BBF5DB51DD6E51A9B136 augustus.poths
810,157,652 *5415B9208E1ECB97006AAE33F7B561610F6A6A96 augustus.pribble
810,157,653 *5413E16BC00CB429996D7D79F4DABF1B1734C187 augustus.sagastume
810,157,654 *541417D7A75F61C2403B45C7799F5E9E6B70E715 augustus.schwarzkopf
810,157,655 *541A835310E59B1824BBD4D1869F259FC7FA1447 augustus.serice
810,157,656 *541FDF5357A1E46BB7E93D257D90148F9EDF9064 augustus.sitz
810,157,657 *541A622FC63F443A559D97B80C6EAA94A1C91043 augustus.sperrey
810,157,658 *541731AA088A0004055B20199036F7138479E6F2 augustus.squadrito
810,157,659 *541606D997C495C55E7F85B5753CD9412CA49AC6 augustus.sturtz
810,157,660 *5414F457F61BD60A0522E5E0E950B31656A9F19E augustus.swiller
810,157,661 *54115E72E0AA72B17D12FCC980A8CFFA0CCD0B82 augustyna”
810,157,662 *5416EC003918FDA827EDADCBC697BF8CEB832FD4 A(U!H
810,157,663 *54189EF0050BA4D9A8E19E5816AB22C2044B158A AU&H;
810,157,664 *541927B9D73FD92A80C1FF1389771F32B0971263 A(uh#
810,157,665 *541EB78D298C2FFED5B8A60C3201A9C61CA629DC AUh,3
810,157,666 *541EFB44935C803D637958A28852C7455DB40E7A AUH5K4O0J
810,157,667 *5416E10E5845AC15AEC1863A3930FBD8BD26343D AUhb9
810,157,668 *541E2110F2407A260A7E36F5C27871A877671C27 AUhcV
810,157,669 *541429FF8E352BA490CFA4EFA1805BDC8948CE58 AU_He
810,157,670 *5418E4CAE55603D196A040B3E79868B5A4A07060 Auheinta
810,157,671 *5417A558E5D128CBD132869936350EE3810F4AA8 [email protected]
810,157,672 *541689B536C979EEDA9A289D8598C0F0AC9EAE13 AU!Hr
810,157,673 *5411F876823F28E5F7051D2872092E168FC9779D A&uHU
810,157,674 *54146F583477C0BDF2AB4A508A606F03576153AF AUh)v
810,157,675 *54102FDC5F081C9419FAA4CDAA04DBA35AE1CDE5 A&U
810,157,676 *5415E94375CA6212F18D67D3E5128590F787520E AUiBY
810,157,677 *541065DDD7C09693066E614EF84C9806ECF49368 AuiF?
810,157,678 *54114E7BE26D15D7D40A9EC3ABB27A58D4867154 AUij;
810,157,679 *5411D5FD924994A217BDA7EFAF48C67C03760C58 A"uiO
810,157,680 *5418C90398B4A8C2F568428241A43771D7F7EBDE Au&It
810,157,681 *541C3442166B2EFDFF676CCBD3578DC875D06054 AUIu7
810,157,682 *54160385E1418988307AB566ACF89CD93DEAC3A2 AUi=v
810,157,683 *541E666DD0A62B1D1405C4462BA1E30933013537 AuiW/
810,157,684 *5411DD127B9E4A196616F242AF0BFF5D4059B850 AUjPe
810,157,685 *54178F673B43BEE3D9A044FA33D0D1EBD289D627 AujQY
810,157,686 *5412201EDD612991E6202686B76F419926AAF824 A)U=K
810,157,687 *5413CE3B9B64A16884640718B24B0F4DCFAF7A86 A!UK3
810,157,688 *5419BCB7F59A7C20E56551083E193C272AF108AC AuK99
810,157,689 *541E44FC6A7E1F384B4E014B67E82B4B47A68BE6 [email protected]
810,157,690 *54124A6C76BB0050F90D87396D5491D41A728D5F [email protected]
810,157,691 *54159E4521C2FE7DD618CD1C9B3164C75ECF6031 Au+KC
810,157,692 *5412558FAC21F8D0AD621E87E285C7653306EE2B Au(Kf
810,157,693 *541A3CEFB04B04B054A1A15BB8D3A381DED6EDD3 Au_kI
810,157,694 *541C645B37008708500B824560B05E1A5A800119 A!Ukj
810,157,695 *5412FF1B31BCBB99D1433D08EFFE27043C152B57 AUKK?
810,157,696 *54176EB3096F322462F7BE0F0F394435F1C3378D Aukland8
810,157,697 *541698995FF23C65ED64E4276A9D0662A33BA6CD aukosiančiajai
810,157,698 *54188F88D3C7D8FF9ABD5DF87369113267893BDD Áukštelke
810,157,699 *5415881B09FFD38C0EE3182EB9C694695FCC320C Au(kt
810,157,700 *54174FBBCE1564B62B043702E1976BF556E61150 [email protected]
810,157,701 *5417D16849C688775F2E5FD6E99D4F42EF682FA0 A+ukZ
810,157,702 *541413DD7E2E77A56DFF33A3BCAED840A6AFA789 AU;-L
810,157,703 *5410DBEECB6F0CAB0C01729665CD92859F69ACE0 AuL.1
810,157,704 *54177026CB52898241D78694B613FF395072BF20 A)ulA
810,157,705 *5413613A623FE774967182345E6300C50DB7C446 Aulapeis
810,157,706 *5412B2B7470D4DA6FFCC148E239D1FD282C4C8B6 AULAREM
810,157,707 *5410D5AECD76983D182D24FCDFCC3BC6A9532EE5 auldfarran1
810,157,708 *54126E7A0006A767D322DB4A0792D5C4224E201A AuLee
810,157,709 *5412281BFCD6D2EE09C276266249887A7478A06C AU-lk
810,157,710 *54143E2E594D5C7BCDEC0B6F553F0DFE7B177F72 Aulliminde
810,157,711 *54163F50E725093CAD402C478F728467B849BE51 AULLIS
810,157,712 *54192C31FCA0265EE98C8318652BBC2C69CFCA88 [email protected]
810,157,713 *5415D75A8A79674C829098D7CEAC43B88A2A0C3C AUlo$
810,157,714 *5411BE9F352A66AD78084AB768E4BA71423B701F a.ulrich
810,157,715 *541F3C8B05DEC1741DB508D1ED9D51873D7D236F AulSr
810,157,716 *541050358CC0C75E5EB694396873B9F9B1062F9B aultresqua
810,157,717 *541A86A586871582F072313C223C9B6336AD3CA5 [email protected]
810,157,718 *54134C8C0A1DBB2E4A64CC1D1AF1787E764942A7 AulYA
810,157,719 *5417ABEE79DC862897ED8C0FE1AAB3B6AA1972E2 AU&;M
810,157,720 *5415487942A7AA0B0740BF7D126CCDBC72BC5BB8 AUM0l
810,157,721 *541631C64AF9F5B7109215AFD770F4ACC5198E7E AuM5r
810,157,722 *541B9842C31E5C5D9DE34E28B09B5A59FF83D78F A$UM9
810,157,723 *54163B38F4033DF30A6BB7BD55FD3AF85AC8CA60 [email protected]
810,157,724 *5411D0A82B1382FD1B2F8F6BB6A61D57F2D4FE3A AU?mC
810,157,725 *541540258A66FCB16D04521D816A60BFB27C86FA AUm
810,157,726 *5410E6B4B4DB2E70DD3B994F4DD07A39B8048070 aumch
810,157,727 *541BD7D317118ADD1691060A68AE792D5049622B AUMcv
810,157,728 *54199AD07CB61878455E89F96ED4EAFD11C6C4D6 AUMCw
810,157,729 *541292A51BAE02CD297E7B5CF2EEE7BB01DEC70E a$$umere
810,157,730 *5414295F39C79795E07B304D4DD5C45141E913D6 AuMFn
810,157,731 *541FA5630F8E0EA0FD3F0658AE14902FECB6E407 AuM.k
810,157,732 *541AD370EFEA97471105292D1B1600F822145F71 A-umM
810,157,733 *5410D0EBB82CE7A7A3E1D67A7A1812255555C510 [email protected]
810,157,734 *541E7BC048670FCDEFF1B592AB411F45A1732E35 AuMnR
810,157,735 *54199DAEBC60B7C65AA0DB2888A3742F7F090ED9 Aumoused
810,157,736 *54126205D41941BB3ABFCF63A6F144AACCD417F2 AuMs3
810,157,737 *541BA5E0D9F6D6F4BCC5AA203A4AC4A27E0C0F97 AuN_0
810,157,738 *54177CF84F69A556AFE4850BC8EF58E8270BBE0E A_UnB
810,157,739 *541EEA31C841CBF4251F17EF866B21C0CD56F956 AUn
810,157,740 *541A6EAE6B5CBF30FAF41BD0FE2068D616689E56 AUNCIATKEP
810,157,741 *541DE7C63DB2D0F7683A00B20DFBF494B74E137F Aundemonstrably
810,157,742 *5418FD8F3F20957C5519CF4970CFB350F6199163 aundre allen
810,157,743 *541B027B7EBB54556DC0D224FE6DDFA6E33FAD85 Aungelis3
810,157,744 *5416BFEB9DFBDA7C285EFBEF18ECFD629CCE1CE1 aungong
810,157,745 *541BA2BE135862CD21D6FADAC8A868F6204D3171 Aungsfrei2
810,157,746 *54171D27F9BFF4741E6375062BBC6E4829B17D07 Aunh(
810,157,747 *5413B348DEECECB315081CB1D7E54C8EEDAF9C60 AUnhM
810,157,748 *54108BD1B2D44F9BBD9DE2023BCEB8C1C3D92531 aunigas7
810,157,749 *541773E17A8032A39027DF39E4322357F0A36F24 A++uning
810,157,750 *54112EEC24308D9A5306385392FFD5ACDF288CDE AuNki
810,157,751 *5412672D360424FB3E5D3D6D3671F7D20DFE7BD0 Aunnaturalized
810,157,752 *541AE0597D70DC259D7CB9F59670FD24DDCD4F17 a-uno
810,157,753 *541C77BB17ECE42385677B972F0E4C04761BA015 Aunpacifist
810,157,754 *541E2739675E9C9A8F34B08CBF2416A53B5A1D21 Aunranging
810,157,755 *541727D107A3B572D072D89069266071B02B3B89 AUNsB
810,157,756 *541D69AFC740BDBDEB8D7DDA7DD2D80B82F0E7AD [email protected]
810,157,757 *541D3562C22174B10113811C6E79DF1FA01479E2 [email protected]
810,157,758 *541FF61A6E921AA740865593E185BC000D42B0E4 AUnTN
810,157,759 *541FE84B93C1FCCB0E919D0F000983C2F9303A16 Aunworkmanly
810,157,760 *541820B34030945B5C7F1E0C041255420839D5D3 A_U#O
810,157,761 *5414EABB5CA141350FE77E26C5D7F435FFE45A24 Auo,.
810,157,762 *54198A74324810DCACBB1349B3D2F3781FB7A5EF A/UO6
810,157,763 *5413AB56BED5B97FC0E11ED10553202D69B941B4 Au+O8
810,157,764 *541770FDD383F89428B6C783F771B0B283133B00 AU+O8!OGRAPH!E$
810,157,765 *541A6FF5FBDA6B4B4B4D2590A67DDB5ED7BA1168 AuOFE
810,157,766 *541B9C225EA910464D97EE13B642EFCB9B828AAF Auoichuenbaby
810,157,767 *541F3461AFF5BA37962D2504315EAD8A3C29FEA6 AU+OMO8111$+
810,157,768 *5414DDF42A0533802F21047FDF647697A0CD998B [email protected]
810,157,769 *5414B2DF4F93BBAE78D8C9248B5D4A1650B0426F AuOp1
810,157,770 *541C4BA78C6083985C6E215E5D25C7859CD69787 Auoq?
810,157,771 *541F9975C1E70D73A952999D17F8739EB11B8D10 au+o+r1plo1d
810,157,772 *5414703C659F1B6BB8CE2981DCF486F5EC983C22 Au+ore9ula+1on
810,157,773 *54180B0FF72D58E68A75A1CB8A5219BFFFF6656D AUOWj
810,157,774 *541760B3ADA7C820AB9069446988702C9B8C860F A+u)P
810,157,775 *5416C932B487B3CCB50CF539249E38BF82FCF18B A.(up
810,157,776 *54197F2B15CD83F4B66C79D8E1DD9B538B6C9CAA Au.(p
810,157,777 *5410BC4C8FE578030028D70D3CFFBABCBEC2F954 A/up0
810,157,778 *5414B1817D654C9D0CE9DBA862205766467F95B7 AuP1B
810,157,779 *5418D01D9247389E31BCCA87CC3C48B4994405B7 Aup1V
810,157,780 *541333C20E2999472676D8D47E073E56657B7A84 AUp8o
810,157,781 *541A163546C6CA2030C4BBE3FAB74B33F536EE72 aupada
810,157,782 *5412FB09A4ACBEDCF767FBA72E9DAF87A9853C25 AUPAIQMV81
810,157,783 *5412D0F3C28739D5205E968533896C6C8A4CFF73 AUpd$
810,157,784 *5416DE93E9E67D6DAD5BF00FA7AF1E49393B52CF AupHI
810,157,785 *5416731915FAA2452E82574B1ACF0FF783E29F3B AUp(p
810,157,786 *5418DE45A8C8B545ED15BFED9F591735C12170BA AU"Pt
810,157,787 *54141149D4DBA917F483F9536AEC394A60E96AAD A-UQ.
810,157,788 *5410664345EED4E7AE20A051B7B3DB848B5A738E AU(:q
810,157,789 *5418104454F9101432692F0997F04584094D73D3 Au.Q:
810,157,790 *541AEF33C079FCE6A746232BF21A8D3C1398E239 Au%Q"
810,157,791 *54184A58B15323D3EAB063EE3CB4999B81C8374C AUQ4g
810,157,792 *541C424E37376617F6038AE8653E522A2A4B25FE AuQA?
810,157,793 *541367DEE64D1C60ED462BC64338F4BD63E437D9 AUqCI
810,157,794 *541578235664AD7C6CFEABBC944606D4E62A1885 AuqDN
810,157,795 *541C7D58BA81C21D711BF4514662DCB08713207E AUQhm
810,157,796 *541387B08A19BFB8838EC5F1DC9BDFCA52A3D44A Auqitson
810,157,797 *5417F0248DF19ED3FB91CC980B39F8D2AB9C5B42 AuQN,
810,157,798 *54179A75B94DE4F3516823462DB47198E3CDFEFC AuqN/
810,157,799 *541402821D6CC1F5EAD449F8010F98589701B4B0 AuqoV
810,157,800 *5410955D609D1F9441775A6E6539EC5FB0EC4F86 AUq)q
810,157,801 *5418679EE00AFBF135A549AFD81F558D201861D6 Auquenoglanídids
810,157,802 *5411189CEC2EDDE39FDF3948F6E0B0974F1804C7 [email protected]
810,157,803 *54118C3FBEF0C198C36C804A521319BFB36B0B02 A/#uR
810,157,804 *5414888B7CA748B6C356AE39FEA57A5FAAE20C58 auraguru
810,157,805 *541A6BFB926E9EFEE56869E140EAF527EFE3B48C Aurchek8
810,157,806 *5413703ABD239DED3502A4E3FCB818529EDDA057 aure011n
810,157,807 *54105D7542278E98F051F3F3F475A2CC7AF447E7 aureliemorisse1
810,157,808 *541F15221B0C776571DFA5C3A7B67974A6787E7D aurelien toussaint
810,157,809 *5411D02FE686B522AA9291191D169B36100150B0 aurelio.balletto
810,157,810 *541B29B650B48156994BE1921843E4CBDDD87FCD aurelio.bonagurio
810,157,811 *541AEDF6E3ECBBEDC669652A0286A8AE0228D914 aurelio.bowlan
810,157,812 *541662BA68D635757BEF93B1BCB2312AC542B752 aurelio.colasacco
810,157,813 *541047583485787E276C7EB0F8AD552DBC07DF3D aurelio.dugmore
810,157,814 *5415BB2859BBCB284D8AE6F38FD913EEFAC522CC aurelio.giandomenico
810,157,815 *5416D6FC26640AF719340AE6B4679B5378464196 aurelio.korbal
810,157,816 *5412100AF7D6F23D42D6B38B84A8C1641A26EA69 aurelio.labrum
810,157,817 *5410B81CDAA6DEE177202D587AAD7C8572A998CE aurelio.lingner
810,157,818 *5417F5994D48669126CCA67D1F227C3941494641 aurelio.loghry
810,157,819 *541C6F0F2739634732ECD662DBD4B4B619FBE074 aurelio.lonas
810,157,820 *5410FCC0EC8A5E701FD1B2CE45B5120C7821B3B5 aurelio.magleby
810,157,821 *5410F9347D1FE2D8D87D88DD5C29CFDED9634AA3 aurelio.mcinerny
810,157,822 *54138294941C77B6003CD3E6F904B8067BC8E549 aurelio.paongo
810,157,823 *5412F9D523EA4563812EAE00B91881DB3C983256 aurelio.rubal
810,157,824 *54128005CEC9F8C8EF2D6E040404323A6222CA30 aurelio.sangasy
810,157,825 *5418039FCD784D33089F0CDBDCBE156307AAA22D aurelio.seright
810,157,826 *541687FBAE9D442C0738EC03E04E69C030BC6E79 aurelio.vong
810,157,827 *54141A0EF545EBD78EFACFD962C3EEF3CDEFAE0D AUrFw
810,157,828 *541CC47D43EEE6A934AB2F6D1963CF3CD1AF984C Auribrom3
810,157,829 *54167FC70F98B109AF2920E617E276DD453557B0 Aurigal5
810,157,830 *541501B5274F5EB90FD90E0DAFFD04A2E6738613 aurinkoisimmista
810,157,831 *541D135C60E757B6DE062D9FCE22C45C4AD77302 Auriyam
810,157,832 *541909844E3AC6EBECB91713FFE1DE58E7A694DC Aur
810,157,833 *541A089B355F17FD4D4A4066FD4D73F8426B2DC4 A=uRo
810,157,834 *541159895DD1B8DEF717159531EEE05CDC899BB7 auron098
810,157,835 *5417743793A7FF94AFF678B4FD131FFC4D064674 auronda3
810,157,836 *5418C55F62E2627DCD66FC682AB809958468E3BD Aurophobe8
810,157,837 *541A527B5A28D75CC0B8595057F5E504322F8CD7 aurora768
810,157,838 *5412E893EEE33E328023DE13D52C5B888BE93C0E aurorabell
810,157,839 *5415181A87ED739D231034813F75D0FE351E5A86 aurora-feinchemie
810,157,840 *541866F317D109494EB53697D57F03E9EB811AC8 Auroralovscali
810,157,841 *541B2954D669B5B26267653D31118976357D6AF7 Au.rQ
810,157,842 *541C4528D8F9FB0B6FEB1735C1A332213E8AC8DA aurtoritate
810,157,843 *541C8A11DEC058110980F7AF8BDE4534B63905F1 AURu-
810,157,844 *541132B3C0FDB1D7B292DC0681517EA8809A846A Aur$U
810,157,845 *5411717CA76F653F0E22530FC1DF8DFC3768913D aurukompressor
810,157,846 *541C930883C49E62B79C0DAE2B7D8DF48E1D64EC A$?Us
810,157,847 *54136082E62D831F7D71386FA6A7AD09C70B4149 ausalle
810,157,848 *5417532E2417CAA651C9ABFF85C95DB300AC0B5E AuSb0
810,157,849 *5417DA04C0639B2056B9DCE95F274ED230090897 Ausbaubefürwortern
810,157,850 *541A0327AD39BEE721DDFAF6CFAEC3E2C9194018 ausbauwortschatzes
810,157,851 *541A437CE1AF411904142E052CA432810AEFA1C0 Ausbauzustands
810,157,852 *541989B5BE343ACB4E7F7183E7C7CEA648C0A2B2 ausbildungsbestandteil
810,157,853 *541077C367DF8883FDF23C7E8F3674782E6EF509 ausbildungseignungsprüfung
810,157,854 *5413B5488BD8750F44FD9AD24995FB679A2B170C ausbildungskreuzer
810,157,855 *5413523978E18A3C54ECD55163607F9965543352 „Ausbildungslehre“
810,157,856 *541EB26646057DFBD08EE8E4545A460C1B2AA184 [email protected]
810,157,857 *5419885B4BCE41B75C440E8DE00671751CB4E392 ausbrecheuden
810,157,858 *54107148642209A3D16635DFB59C114DBC3830CF Ausbreitungsmodell
810,157,859 *541328D5C310F0A7BE9936D97433352565BC5402 auscultasses1
810,157,860 *541C548AD44BA5B63B1B1B189047A1A21EBC6880 Auserve
810,157,861 *541B56EFFA0AED07D8E3369C20E7D4F0CA94E08F Ausfallrisikio
810,157,862 *541DB9CBDD0C6888E4EFE44F831E80BB2DE2AA82 Ausflugsschiffsroute
810,157,863 *5415FD8647322CD17DEF221DD9F27CD5DAC5579C Ausführongsgsetz
810,157,864 *541A05CB783C1B91FCF828A3067EBC282C56E4FC «ausgedampft
810,157,865 *5416EAD3D2CE9B3F4E3D95363883F9546212E69B ausgefpähet
810,157,866 *5410B47D93DC587E2EE2AD59976BE205E727D6C1 Ausgegeben9
810,157,867 *5414D994C984467D0C3483108D4185A091BEEDC6 ausgegebene8
810,157,868 *541060438ED9693BD8588B494C59BB2E351965C7 auSgeklarten
810,157,869 *541C9D1EE9C19EA27AB3C4567DA7079B9CF832B0 ausgerannten
810,157,870 *541AD359F33107154CDB3D352D5C6E8D8B0CCBB9 Ausgeregelt2
810,157,871 *541353A559EA7AD821632C6603D8178B2636F354 AUSGESENDET2
810,157,872 *54176802CBC75A33359F7B34004F3A31AAAA1100 ausgredt
810,157,873 *5414A1195CEC501609E3F35C3885138DB7EF84A5 AUsh6
810,157,874 *54154B0EB8672EC29FB12AA24B34E5DE3139FAA9 AuSi/
810,157,875 *54103B88D63FE7EF2D532D92BB77D7ADCA5D19CE AuSjm
810,157,876 *54198566DE3DE9D492FDCDD898DE88DB20348E82 [email protected]
810,157,877 *541FF13FCF71AB2A232457B40B13F7BA198F3768 aŭskutebla
810,157,878 *54123F3CAE0B6840587DBCB9FF91255FCFB5A823 AUSLANDSGESCHFTE
810,157,879 *541A263B2857E71E3D1184D6D8FBF404B563ACB7 AUSLEGERS9
810,157,880 *54121309AF217F6E1C63A093FAD23D30D341FE7D Ausloggen2
810,157,881 *541D33F223192F2769392DFAB1288D38702B4E0F ausmus-a
810,157,882 *541426C1B8F475F811DA8967D0771901BF571629 Ausnahmefa"lle/n
810,157,883 *541D243C4403DCDE8A4CFE62BACCE5611784505E ausnahmetorh
810,157,884 *541EB15F4D474AE3893DBF16DF86823EA69D085E AUSP,
810,157,885 *5417CC5471AC3522C73D25F6314DA611AD118135 AUSPICABILI
810,157,886 *54142906F8D7702C3F53D6E770F9AA087A9D0327 Aus:Q
810,157,887 *5416A573A65B711DD8B6586548C5A355FF03E1AB AuSqS
810,157,888 *541EF8AE7716DA809F27ABCCFC4AA32A4EDDE812 AUs
810,157,889 *54176B25024F9B8B4713887CD7B30B5655128D78 ausreichenwiderspr
810,157,890 *54176169A84787A0FE8A7E1F86AA767F042F2417 AUSRENKES
810,157,891 *5415BEB6E4BA25808F0BAF0BA4632C08FB7A73CF ausrucksm
810,157,892 *54125103249F402AD85AEA352C61E4C93556506A Ausrüstungspool
810,157,893 *5417BCFA119602361C425CA392754DC1E8B82519 ausschendiret
810,157,894 *5411CC45994AA18FEEEE28CDD43A99D5C8DF9B0E ausschttelnens
810,157,895 *5416F30B74F25B3A2216A5C0C98430D6F394430F ausschu4
810,157,896 *541BBE3E8FA50B9A821917913BF77403C4DB793E AUSSCHUETTENDER
810,157,897 *541EEBAB87D633963ECE0E4668CB441245AD4173 „Aussendung“
810,157,898 *541F4CCAAD2B68CE89632AD84B0EFFE392F092E1 Außenwirtschaftskontakte
810,157,899 *541EC95C678FCBEFBFEC68D53A79A2DACFAFEC91 außerattischen
810,157,900 *54122D90B10E131438BB85886E9B1A6CC852293D Außerbordaktivitäten
810,157,901 *541697B4B75D2F8EB660A4CE595FA9055550F1CD Ausserirdischen
810,157,902 *541FF1DCD595A7FFBC593CBB87A4692564876B91 außerleßne
810,157,903 *541716B4275F21554B83F5E11025B5B1942ED2DE Aussichtsloseren
810,157,904 *5414DF77CDF258CF8BAEF3E6ACBA47DD6CA9D223 aussiechan
810,157,905 *5412FAA541009CD14CA4B2ECB134B7CEF0FE1E41 aussita
810,157,906 *541F0613048CFC084DE4F4BA0C363238EEEA8D9A Ausspare3
810,157,907 *541E366A2CC0D208AFAED1E5D7E41ECF78FF1052 aussscheiden
810,157,908 *541F0D5ED0C612F0422A600564A348E88E94F292 austin739
810,157,909 *5412C204C97508C9DFB6EF11497B9A497A9C311C austin.ajayi
810,157,910 *5415B033AE96F729D468F3473BB653EA5C202097 AUSTINAMELIE
810,157,911 *541D117D323A71CDC2D3425D03FFE3547E26AB92 austin blanco
810,157,912 *5410B86C2799359E59C476E45344059D35CC0EDE austin.boutros
810,157,913 *541457E17F3A8AFEC538F30EA96B24A219965E7A austin.chisolm
810,157,914 *54152B6CC565F9C38045075DE1B28E01D117DD06 austin.christoforou
810,157,915 *54160C5FE9D3CF62940AB9E038282C714521B414 austin.creekmur
810,157,916 *54115B85B850E90DAA3C390748C59DFB7CC631A5 austin.cunnane
810,157,917 *541E0C66B7EA1D81673497023A66F0E3F4575122 Austind3
810,157,918 *541FB27CE6D6AB4C5C085651C0DB95C7269D87CB austin-dallas
810,157,919 *5411CA635EB5D2887B73049FB9671C53BD7D238D austin.dawkin
810,157,920 *541621DF83C5829049EC093E17037D559D1BF848 austindo5
810,157,921 *541BB0BF59E278771BB7DF01295CFC6FF33F9202 austin.dsaachs
810,157,922 *5412E8E4D5CF42363C01ED41C45FFBFFD447A435 austin.fassett
810,157,923 *54175C047B110F76B96EAF79EB7715A18A7C3338 austin.malley
810,157,924 *541A19256AED8F2F548D9D76ABB9F35E61627AF5 austin.montesi
810,157,925 *54184E5323A011A1D4ABA14703E2AE9C33CB6BCC austin.novitske
810,157,926 *541AEABB0395D4FC6729FA26859D3332C8DBD05F austin.oblinger
810,157,927 *541925515354BBDC231EA4BE5C0064A6C190A780 austin.roeger
810,157,928 *541C0AC86D49DA44D48AE01C341B8E695FDA5354 austin.rotanelli
810,157,929 *5411F8CD85A882D0CA4E39F9333F93DD80F04994 austin.roumeliotis
810,157,930 *5410F33184D13D0E5F6A76D25B091BBA427BBCC7 austin.streicher
810,157,931 *54101CB672D48C03A3A730B9E928516B63C12DB0 AUSTINTANKER
810,157,932 *541553E9F04BC897EF3789F2BB93FD4C480AE8E7 austin.zenger
810,157,933 *541167B4C7CF99C5A47630BF62AC034B722B474D austin.zinsli
810,157,934 *541A8E2FC0933AF5B7C4075884CEA1EF995A0B23 austobting
810,157,935 *541053F5C3B58B6FE3533E3D5E129652D6FE40F8 [email protected]
810,157,936 *54182E589DF1922E6AFC077FD69502B3F0B6143B austraalsch
810,157,937 *5410111F627573290DDAB498B4A6F830303A1D72 AustralianKelpie1947
810,157,938 *5414C57C5E46D3FD42F4C218CF5825366521FD7D AUSTRALIAN-MUDNESTERS-STRUTHIDEIDAE
810,157,939 *54165ED67762F550C3C15B72C0AB29C4625F771F australianwelsh
810,157,940 *541C59A29641C680CE797AA1BF02650F200733D1 Austrasius
810,157,941 *541DEBB550C2C9C812AC148168968241CEEBDD2A austriC
810,157,942 *5418181C1BF51CBA0D89CAD96993375EEB1FBF59 austrliano
810,157,943 *541F5108470C5A3055DA63FE438B35F34C1D1864 Austrougarska
810,157,944 *5411739B2615587EC2355EF2A582C115AF1A65DD Austrumfrancijas
810,157,945 *541BAF8251548F380A1B85B75B05DBBB87A936B9 Austuris
810,157,946 *54184A651A4D6A6A1F4DE79D746F60E8654506D2 [email protected]
810,157,947 *54194A33FA621D911943FDDFC2351B67A907D02B Austynes
810,157,948 *54171B8725CE9222364E6A507C58ECEFCEC2F153 Ausübungskontrolle
810,157,949 *541259E49878EC8531B0000C7CCD9C27F75232AB AUSut
810,157,950 *5414F8CE670164A2E88BF8D53D6EA3B83C6A80FF AUsvO
810,157,951 *541C6105C4C82735BCF6761FB16997E7A3B409FB „Auswahl“
810,157,952 *5412E04D285F491D810765683900F7B54D8400C1 auswahlprüfungen
810,157,953 *54154BC07D85E3F45691B3CA63000235664E8349 [email protected]
810,157,954 *5415447E4C1603D472E6888A2FF14A75012B88DE ausx20
810,157,955 *54162528561E94244C2B7E3A125FA61FC862EEE9 Auszubei
810,157,956 *5419423AE0BF8FD45A2076EFF635E1DFEF0C0F49 Auszuh
810,157,957 *541A9686B7ECA4549E1FE0D6223CF3CBD5A8EC88 AUSZUSTELLENDEN0
810,157,958 *541AF979BB56754B2286816DFFD8CCB0CEBB2D14 AUT+&
810,157,959 *5412FE6DBCEC8D148F3E2BECCF55EFCD7D7E11DD A$Ut=
810,157,960 *541F5B62D75BC79C7796878D6C4C441F0DEEC0AA A_u$t
810,157,961 *5411E40E6D9886D2C11A813444849F70359CE35A AuT17
810,157,962 *541402601812DD3EB3057C844635C1C5D164263B AU)T3
810,157,963 *54114BCC9575995705728833E11FF7DEB2BBBAF6 autaakseen
810,157,964 *5412ECF1E3B59B4DF16C7B12E5C649E22B54AC45 A
810,157,965 *5413687CBFB8C2526CC5F11A4546037CF243556B AutDo
810,157,966 *541C39819A4AC01AEEEA7A12C980E5A785D2D7AA autenttisina
810,157,967 *5414F5429D31DB0665BA637B865F301FAE02D676 auteurn0
810,157,968 *541F8548FB0C03DA9AC8BE066FFE81783A14D85A Authentiek1
810,157,969 *541105C5C78607B3A1954AFB82C048284E7A2190 Authentifiiez
810,157,970 *541B50FD940510A043E2F3D3C0B1693C238A1C89 Authigeneticing
810,157,971 *54196D01967A503BD43DF11C5C9BCCE96748C02D author221
810,157,972 *541838A57CE2B403E8FA6474399469EA13456DFB authoraksenov
810,157,973 *541FA3991088B8AB92F970FC4FF4D57176CD0492 authorandel
810,157,974 *541563362CDE2A228DC8CECBC8084CE3D962DED5 authoraronica
810,157,975 *5415CAE3A2A97F6A2F3F25229F3000A826692EF8 authorg.d
810,157,976 *5414C4117963E983A73A89E54BF85E7CAAF9A086 AUTHORIRISH
810,157,977 *541EAE92A10C051FF982722AE46F69CCF1D66CF3 Authority)標誌
810,157,978 *541EA6D2C481B0D37C804246C07A19BF416B4FF8 authorization160
810,157,979 *54169B3AA6811AE47CA0BB00472E42E3A637D436 author.not
810,157,980 *541FF598FBF19F78F66B5F43AB3E34A11314CE88 authorpeattie
810,157,981 *541B9B840546C81342088C7CEE75FE53EE2691F6 authorsaz
810,157,982 *5410310A61497F75B7B710FDD1F4535B82FBEE14 authorscreenplay
810,157,983 *541591630F01AD352DF19FB66EB3C9AE9C705ADF authorspecialist
810,157,984 *541E77E36CCDACB55DBE5B42324D11D28179AF3F authorved
810,157,985 *541347096BBCF45B0EC91682D961BA21489BAF0C authorwilhelmus
810,157,986 *54129A2DE95B2E35C3244E8B2EDE2FD2CE726D12 authurness
810,157,987 *541229D7677550A8A3DFDB094EB64ABE07E3EEB5 Autickem1
810,157,988 *5411B904B142A3466502A182549EC5849ED0FA73 AUTILLER
810,157,989 *54129DE25851E47D635F0473E2033690A68012A1 autillos6
810,157,990 *541FA33942F953FC2B0BF34B5A1A6EB44052F7B1 autis7
810,157,991 *54153893FF469D64A435DE39C4E30964A3392FB0 Autismed6
810,157,992 *541208E936091F97F49FC3B88410538F7477054D Au,tO
810,157,993 *541A45322F7D430EB7666B3E019523A700A9E5E3 Autobiogeography
810,157,994 *541F0DF576EE07447AE641C5CD7A9B5812F261E2 Autobiography</span></a
810,157,995 *541E74A0EB3BB66BD6A6A19E6679886CD0B9FF23 Autobrochures
810,157,996 *5415EDBE7874D745D20BCD6A7F0E91FBCABDD421 autobuchdirekt
810,157,997 *541C818ED0BC7F25FBA73C37ECBE32768B496DE1 AUTOBUS8
810,157,998 *5411F8DE89EF7294CC4C64811A40722D3AE373CE autobuslijn1
810,157,999 *541D0799E6859A37A00D4E8CDC4758028133E693 Autobuss
810,158,000 *54133795D42C1BA00C6F84654DE2F829651A2FCD AUTOCHTHONOUSNESSS
810,158,001 *541ABE83A68D090CA402B1F6C046D589649FB571 Auto, Corvette 1990 Interior: Door Open
810,158,002 *541CB55465EC54FC375830265BA6C26B56919DB4 AUTOCUISEURSES
810,158,003 *5411212437A1358CE3B777B5891CE302638F773C autodescrive
810,158,004 *5413360C964159133FB8C57B5EF95ADB738FFE01 autodidacting
810,158,005 *54123FF4FC007A65A7A36C1557DFBCEDD19DDD37 auto-forwards
810,158,006 *541A70B91DD053D00513D087F31B29EA4E1DCF3E [email protected]
810,158,007 *541FB43E74165302D2F99B7F40E0FBDE4504C700 autogenerated416
810,158,008 *541C12B8164AD9DF52119101B91F4D3F33462342 autogenerated78
810,158,009 *541C7B015466E49F4DE79727BD1B5CF6A138C882 autoger0
810,158,010 *541EC6C04BE97BEF26E83FA574367E4919E9CAAE AUTOGESTITI
810,158,011 *5418A28D90C7F58B609CD7EAD603CD02DFBE3494 autographs.comwww
810,158,012 *5413E627DC2797EAEDB25AF825CC5F35AB25EB35 AUTOINFUSION1
810,158,013 *541FE9939BB074E2BAFFB88CF19B2D1419FF0507 [email protected]
810,158,014 *5414D043C38A133FD6A1DF4C22BCE0FDBCB74685 [email protected]
810,158,015 *541DD7C34F2FD8D0C11284BB77E30973FD17919F aŭtokration
810,158,016 *5413F74B8DDF2CCFA79674310C333C994CD99601 Autoktono0
810,158,017 *54173CCCDDDF7084E80730E72ED7782822AF7A79 Autolawned
810,158,018 *5411A261260765DF4333334CE4F5C5C9076353BB AUTOLITHOGRAPHIC7
810,158,019 *5410E1C4F5506A08666FFF27D82E81978A39C7F2 autom3tr1c
810,158,020 *541D0498C966F029C24E226607C85090107F8753 auto-mandates
810,158,021 *5416EE6489636F1F4DCF54BC91F7A98538ABE722 [email protected]
810,158,022 *541513890FC62419FB89395D0D03E888DEA957D1 automa
810,158,023 *541BC7FEAEC7829B0E190804FA1F22BBAC3E7087 automat1c1ty
810,158,024 *54182610EA7E20FC74E7E798C46BEB1F28882943 AutomatedQA’s
810,158,025 *541D5534A49EFDF7815DCDF5DDF2025B03E73BC9 “automatics”
810,158,026 *541C380E105200EFD2638689B32624B1BE795302 automatiseerde7
810,158,027 *541FC71028754E28B40D3B25AC5F0854B0659B14 AUTOMITRAILLEUSE5
810,158,028 *541CBBEE6652E45998312EAD17F3071CDE43E819 Automobilexportes
810,158,029 *5411F72E689B5652F2B71BBB74B4A51D74D4E455 automotorusport20023
810,158,030 *5417F2D395EF01E17F7E7631F7912B541EF7622F Automtn0
810,158,031 *5413073C4A8E5CB2C9D5D535C2269EBD0927F6C0 [email protected]
810,158,032 *5413EC722E695AF9C146D5A8513F998574366A2D Autonimie
810,158,033 *5415AADC2440396AE45F8FA82E5D4BA51F0C3814 autonomic7
810,158,034 *541965610403DA7F5B49945D5768D9BC525B7CFC autonomical5
810,158,035 *5412DE873872C5F78DB2A649F9520548352156EA autonumber1234
810,158,036 *5410DD163D343E05EA14514D933511A178D30134 Autooxidation0
810,158,037 *541AF823196ECA17A0B23B84E5BF168A6499EEAA Autopay
810,158,038 *541D82550DAD8E6DBB00E7BA9E1143EC849A4810 autopreservación
810,158,039 *5410FECEBADC1D67119469EA16924C03A526716D AUTOQUOTINGBSW
810,158,040 *5418CF416F209F55EB21DE96F37EE1455EC8B545 autor939
810,158,041 *541217E72E4FA965B151A66611B419898B840D8E autoradios1234
810,158,042 *541436C8A571501818EE727BFD1323C22B407A47 Autorengleichheit
810,158,043 *541F67C9D4644FFF4EE8F111E01894B4FCB9C4B6 Autorepeats1
810,158,044 *5411CBE7D1DC62989473D5679F61022FE781C4DF [email protected]
810,158,045 *541507AEC07564AEA2879099155003B6EF7CD637 Autoritrattonellanotte
810,158,046 *541D38B9670A1A0ED9F8DA4EA11EBA5376611080 AUTORSK
810,158,047 *5415E59D11F59ED7A4C726AAC46EA58448CD0390 autoskopowych
810,158,048 *54125E7977F254F625E6A7FA0810948A7AAF9ED4 Autostyly7
810,158,049 *541230BA8CA457E91A550939081524C96214DB4D autotomaius
810,158,050 *541AEBA6313EB4A8530E637E2049BD6D871A0F33 AUTOTRACTOR
810,158,051 *541256FF3145929D0BAF28177BBB1FDD67610286 Autovaskeanlgget
810,158,052 *54184C020119F301B6DE4E514E20E5079B135508 Autoverladung
810,158,053 *541A83AC3AFFDDBE1C3F96641E7E49002690C953 AutoXpo
810,158,054 *54111AB813E1CDC896D24E49F875442B61661E58 Autqd0gef4c
810,158,055 *5414F55856B16F69B2958BC0D23D2300732713DB AUt:s
810,158,056 *5414F6ABF193CB289A4BE678D311C5E97565F781 Auttetu1
810,158,057 *54146BDF5FC82B6DA4B9FDB0D2528D2EF4A5AFCE Autumn877
810,158,058 *541BF9966B8722DBAAE4FB3387721CF9F7C39491 autumn9838
810,158,059 *54186FBDC7CC737201F1A02319F333588B2AB542 autumnbelcher
810,158,060 *541E971BA2D03FB90228823FBC2457B1F1836E5F autumnique123
810,158,061 *541BF526D40BC27C165950AE91B1168BAEE8F03C autumn schaefer
810,158,062 *5415A6B3D8C94EB6033D0054CA06F748BE80BDF9 Autuvanied
810,158,063 *54134A424B80F78E003109D0E1BC0801206A8896 AutvV
810,158,064 *541E6EDC66186DB78BDC15F64F1B2EFC06346B8B Au/TY
810,158,065 *54124B88EBD809B99CADC816EF0A95F55C8A5F72 AU&TZ
810,158,066 *541F49F18BE33C8AD047AA2DF1B7B0501FAF0B7D Au:+u
810,158,067 *5415107A4D47EAEE20445819679360E59EA50BCD Auu31
810,158,068 *54127B462CDEDB350F83170820C4BD19C4A57CB3 AUUe_
810,158,069 *5411F47EC982E2B2E626ADD2B01D81E11876C749 AUU,f
810,158,070 *541A3588133BBF90BA6CEBE2EC0C668512CEC762 AUUG%
810,158,071 *5413C55D8A0089212ADC3D397C3CAD242968FF6D Auuvd
810,158,072 *541DBD7D3303D10B04D729AA075DA73D21CE27BF AU_,v
810,158,073 *541A91AA1855D1D1CDAF25B4360501112FA1529C A)u:V
810,158,074 *54187261558331BF08368C70F583ED919473E12F A#Uv0
810,158,075 *541F0B4BE89D019FA0133CF31AB667D501C7956B A;uv5
810,158,076 *54143EB523E1A0FA9C60B5FFCB89FE77EBB8DE19 AUv86
810,158,077 *541F5741B19FB1F64E8CFE5CDC659B0814198FCC A)UVB
810,158,078 *5419F99F56FDF3EE4297160B9753ADEE12B2C2B9 A_uvf
810,158,079 *54195AF0B8BE8714B8E972610D0EF186ACDA45B0 AuVg8
810,158,080 *54112C653757E5453C907796838E743596A4241B Au.VI
810,158,081 *541200D88E18822BE8E6E0F37CBD18DEED678D6B AUvKr
810,158,082 *541AF620068544FE6D0CEB88E9F82DC1EC8D23FF auvne
810,158,083 *5415F750ED69CF9DBCA899D0BA30DD62EF2ADA0A A?uVY
810,158,084 *5413FD136E5E8247D9D5683B703A6D59C5DF8D8F A:U-W
810,158,085 *541D7E8AA438EF12CC09CE9ABBAFD6F035EABEEF A$U&w
810,158,086 *5418DDD45EC9F6ED4376F1DCBE892B2D54E1D73A AUw&.
810,158,087 *541D907F7D4137CC94743784A13093472A87B57E A-u)W
810,158,088 *541AD59E985A66E73E1F8858F600EAB64176EBE4 AuW-,
810,158,089 *541796059C2E3866ACDC25B330F3B351F859AB83 A?UW3
810,158,090 *5416148286CB9A0C6C43BDD787F18DF95860AAF9 AUWgp
810,158,091 *541A1AEB3AB34DDAF6A42A7BAACDAD377F431EC2 AUWGr
810,158,092 *541F487F239ADE6DFF24CA7800B0C3F8E0414434 AUW_I
810,158,093 *54167DD842900D1B6E37674E07C16D7FC146DDF7 auwi8699
810,158,094 *5411C27A67C40E6CE104CFCD8EC65A4B577D19F2 AUWjg
810,158,095 *541688C16DE534634E083348C9DE5B1C2EFEBA2B AUW$N
810,158,096 *541554283BE52B5C7270E31CBDE706A6AB772E58 AuW"U
810,158,097 *54199537FEB3E5A60AA1FFB493BA9F13A08981A2 Au/X&
810,158,098 *5412483C920681841016E5A117CDFFBE767D96D0 A.uX6
810,158,099 *541D0A759E79AC9B5E2AB5F4A4904769C0A8DF2A AuXe7
810,158,100 *541CB28D062B49A66014557555D7B46D0B45A0BF Auxesissing
810,158,101 *5419385289DFE702EA5EFAD8C7BB87587726F83B Au/Xi
810,158,102 *541F3F7041E4BDAA221C48262042080A9B41C473 AuXLn
810,158,103 *541419D79F110E63155F405A5C3F277EEB5D02A0 Auxopatia0
810,158,104 *5417C96C1E8649A81D5BD7F425BD3D6510E54B19 AuXYG
810,158,105 *5417771D3D204C6989FDF5DA76486BE9B8B56C63 AU<Y
810,158,106 *5415CAAF1AE8F80CCF0283133C2AB33A93A67C85 A=uY4
810,158,107 *54103682767923BD73AC2B6246286EDCBCE7951B AUYBG
810,158,108 *541491015C62D52AC5626ED856477EEA0DD918CC AuY-Z
810,158,109 *541E15D12AC49C83BEEDB1BFEF6B5101AB6B2C75 AU+Z=
810,158,110 *541D540C2AB104BB8395CCFF3A0E92742774A665 A<Uz
810,158,111 *541ABA990D48903C6437F321C5D3A04F0CAC3090 A=uZ;
810,158,112 *541FC24036DD6B115CC8AB925FA60D35E41A423D AUZBr
810,158,113 *5414D9A8DD04501C5125A9E731F48CEAEDABAF6B A+uZC
810,158,114 *5418A655D897CC7FAA0AD4EABF9E993FB68BE510 AUZ(D
810,158,115 *5410E40B0E90F4C095EEC763489530A274425BAF AuZdq
810,158,116 *541E6A4C815FF3B87DC341A01415003CDCD21317 AU&Zi
810,158,117 *541979CF2D3788ACC0BF3EB0EC306EAB08FF8942 AuZtr
810,158,118 *541E1CB7A1164B912B66A05F3A86179D630C3390 A,"V+
810,158,119 *5418BF3776AFA8EFBEB6F954DB7283FAEFE256A9 A,
810,158,120 *5411F26A097A0FB300A7C4378D080920A17301B5 A;;:V
810,158,121 *541519061250B9CF0A8E9495FF9D57A9D884CC5F A?(?V
810,158,122 *5419E08035186C7C593D32544A7C7EB50225F67D A#V!(
810,158,123 *541EAF7057FCF5BFBB80E491475DEBF9D8112BDF AV#$)
810,158,124 *541BC6EC1DF9091BECC5F521A5EB2701ED8B4980 AV
810,158,125 *54137DE04927FD9DE69D2FC300AA6CB824084895 A=:$v
810,158,126 *541DCC657E99C68CA783027C9816B1BA0F749B8F A=v+?
810,158,127 *54145F7D00FCE74B2F0D95278F7409BD6ACC70F5 A|v+
810,158,128 *5412115BFBE02BF773BF8C67FA06F7967D0F484A A:%v!
810,158,129 *541EBF8AA4A1577AE420E0BE4C06138B52BD3033 A":v(
810,158,130 *541425A1865D3A74B8D3CFF715949FAF35439D79 A#:v%
810,158,131 *5415CA0BAE6E7235468E288B37C558EA4E9B2AEC Av.,
810,158,132 *541AAB7B2A2861C01C427436B2D418A80CCB0BCD a'V)
810,158,133 *541B7FC3BC4133DEBE160A2053C9452A1C04F82F A
810,158,134 *54141997E0BCED37FEB57A5A1251724D08042E4D Av01k
810,158,135 *541A29DE47BA42791CFCCB7A2A0420E3A4B090F1 AV02i
810,158,136 *5414A42ECD7D547A5A58F6149B8A327727346277 AV03=
810,158,137 *541D08DF53319B28CB09B72673A256250A37AAB3 AV0f%
810,158,138 *541B6E9B9444981AB1F9FBE0A14234F078DBD9E0 AV,1:
810,158,139 *5410A2818F2546C6382D85A6A1600729B1A469A0 [email protected]
810,158,140 *54139598DF59B05ED273983C9739659A57CEACA4 av171c
810,158,141 *5418ED7B1A347359EA6AC9C993DEF54753E62910 AV1Ku
810,158,142 *54179176836CA4AF4F19B5317D16ACC0F64B986F AV1n)
810,158,143 *541E0B6AAD12C7619DF69399E6CE82F33C4F3F4E AV$26
810,158,144 *541F2D6867115E138D1D2EA75AB1957CBC8E4BDD AV,28
810,158,145 *541496AD19302D1637F104A1B9B15B6D26F2950B A&v28
810,158,146 *541A272D674DFFAB933237D9C0A3EC872DAFEC9A AV2c_
810,158,147 *541ED764795427AAF1C24D64ABC997ED748F820E AV2w:
810,158,148 *541D9F78B03C8F37E12F08F08EBEB03B0D7C8A3F A+v3"
810,158,149 *5414FF3305E4C236C991367C35BAB6331FCDD37C av325
810,158,150 *541D99C98A34C136A9A85E6572805274F4036466 AV)34
810,158,151 *541986A0FD83AB7B690D04C3D7E5025643A55498 Av34B
810,158,152 *5419661321CE0AD19876521BFFFE361B377FDA19 Av3S)
810,158,153 *541C74A037E324A2FBCC60B575F657467DDC360F AV3,v
810,158,154 *541AAFACD29FF6571ADA76F3E7215C0B30B88CD4 AV4:3
810,158,155 *541E4D4DB1B6CA43AD84AB929FE1680218BC5A82 Av4
810,158,156 *54138F8064048C09FC9D26F5EE23DF14C39F1A3E Av4&l
810,158,157 *5410D22B0A7A989D27D3DA339A3CBA49B5FA53EA AV_4S
810,158,158 *54135795F7B4B09F8C079826D91039BB9C75932F AV"4W
810,158,159 *541CA286409EABFA4A58960E3BBC6B5DBCBBA108 A&V4X
810,158,160 *541CE15C4BB6A4DE8423DC99EE5701ED5BF9318E A)
810,158,161 *541433D35B74BB8C95191D90110F8DC226610E41 A?v53
810,158,162 *541F33CC3F3236EE0E9D36F47E438BFDB6866918 AV5E_
810,158,163 *5415F9305AAA3866E9BBA5FBDC9959C7A085E43A A%v5n
810,158,164 *541E8EAABD6EFEABEE08B03DA21EB263EDBA8201 Av5w:
810,158,165 *541387C5EFB188CB33819C4C1B73845751A7313F Av-+6
810,158,166 *5411CA8CF5323F838D6DB38D07C68C909DEFC970 A!v61
810,158,167 *541410D62AA2CBEE5B377A3A48DB0564DD9DB225 AV6=6
810,158,168 *541842A8642BF5202FF7AD18CF78E26BB7C546E1 A(v6d
810,158,169 *5416B7B63C4341D773A6F74AD9906A6CC1919D41 Av7T-
810,158,170 *541CA1BDC0161F07C0505216D0B03A886C69E3D8 A!V8,
810,158,171 *54110729C8C88CEFDA7B164FA048C2FE3A7879DF AV8&?
810,158,172 *541730BFB637C7F6155F175BAF5B41956354B20E Av8m0
810,158,173 *541F2056BBCA41ECF9B70AA5A123AD27F65E4E0C AV8rR
810,158,174 *54108CE62733F1216C38F3931F0CA466CE5D88F5 [email protected]
810,158,175 *541A3546876195762DEBA04392E122B478B5538B Av8u!
810,158,176 *541B748FE8EA810C25424FF02AC586E8B4EF7DE4 AV8v
810,158,177 *54170339AA93070510DF51EE5FFEA04A8119B4A0 Av9k.
810,158,178 *541C1906E9157D9C309ACFCFB1FF75F7A6A86418 AV9o?
810,158,179 *541AC50B909581E14030CF016C9AB9C16CC35491 Av9PE
810,158,180 *541AA6255E1B3473FB57AB1B1A22CDD60CCB93F5 A_V&a
810,158,181 *54108D6A726F35E79A7B717964007C438D82F6F9 A:Va.
810,158,182 *541B7DD72A1823105A8DB2B195F03258F944F7C9 Av!A"
810,158,183 *54195C60742CB244ACBC966731FCC1E2D1EAE55A A#va-
810,158,184 *541577EDE5A78E82A3E00BB7A06033BF01955A55 Av="a</