List database


# MySQL hash MySQL password
806,090,001 *53AED991E3E6FE0C8CABE075FEC65CB90BDFF422 CtNkR
806,090,002 *53AF6957AB4A00ACF7F1E2C1A7C23781433287E2 CTn+O
806,090,003 *53A11AF6B8406B323F2934CA703F56948BCB1339 CTnR&
806,090,004 *53A9CB6EEE711EEA200552144CDAA27A76B13C68 CTNRQ
806,090,005 *53A2B72D5D3D266912CD38D72A4F7239D096A5CE CtNwC
806,090,006 *53AAF8272E85A26C0987851628B713E099244808 CTNwP
806,090,007 *53A463C71080EEDB3B96D4B81E12852EFEACFD4C C"
806,090,008 *53AD83B7D85C5C000B1F60E5543E72A735F7A937 C,t,o
806,090,009 *53AB5B458B02039A2BC24BB6F1F37ED65BFF0D67 Ct&O9
806,090,010 *53A4B4B72BCF28AAA6D518961EB49210EA724FFB CTo9j
806,090,011 *53AE2C64663ED8469482C7B4BF55584D91017601 Ctochord8
806,090,012 *53A3B934A936EF42732B9FEAB27A3BB3C9A9CDF2 Ctoh#
806,090,013 *53AE28CD9E17795A5690CE86E717A7F0E2925155 Ctohemiaed
806,090,014 *53ADC37892B81C867087F4C8FFC891F5A4F0BA8D [email protected]
806,090,015 *53ABD23CED4EE4063DC13C664A56D144F7C09603 CTO$L
806,090,016 *53AF1EBAF549CEF8DC72DD33C6C602932B826AFD CTooN
806,090,017 *53AAE811A233A3054DFA54FBDAC9931D0DF49ABF Ctorijening
806,090,018 *53A03A43234D277EC6F5373F0B99CAAE4A82E5E2 ctorreyes
806,090,019 *53AC3A9D1C2F52FF1F04EBB0BC8E03C762072785 CTOs,
806,090,020 *53AD01EF44CC7EBBB1D242004081540D6A091B11 CToT4
806,090,021 *53A023A39BAEF0CB06359E3898FDBA3B6FEA2C87 C/tow
806,090,022 *53A4F6C81A1DDA25E4ED1CF2FCB3CB43EF2985DD CT_p=
806,090,023 *53A0FC5931CDFDEE4CBF1C68964FE5205A9F559F CT.-p
806,090,024 *53A438CC8E897C8F766FF12AD9E91D1304002E64 CtpAA
806,090,025 *53ADAC74149D8F618C2685943A83EC7E35224C8E CtPaf
806,090,026 *53AC0E779521BCA9585B761AE24CE952FB001E2A CtP%C
806,090,027 *53ADF8C9BADF9CE06DA9094298D82B2AE4709627 CTPCa
806,090,028 *53A43D52B44D2676D5F4CB09F52ED2F052439B5C CTPCU
806,090,029 *53A0F328191D0845060A3445980C4206D2418212 CTP"D
806,090,030 *53A20FE84315E9AF811F6C8608511B954C0B1DF6 Ct=pf
806,090,031 *53AE47D55E1A842020AA968931FA5BB88054F590 ctpltrnt2
806,090,032 *53A43589D0885C87C156233D643857812E02781A Ct,PN
806,090,033 *53ADE3FD91AAA2AA63AAD5D9569D6EF790CA4076 Ctps7
806,090,034 *53A3B48FACB4648292039A11D98F00804497B3E2 CtpsI
806,090,035 *53A680AAADB66B70E5F62E2EBBD464DDC258D586 C(T
806,090,036 *53ACB0CB810E6F4701050A29C773494A5868920E C%tq_
806,090,037 *53A5EA6FA7EB21FBC426C8CDD1EAA5CCFCA0E717 Ct;Q2
806,090,038 *53A1FDA0F0AD8E293C710A45493A5D953E7CF089 CtQ5D
806,090,039 *53A0B9DAA4BBDB3698BCC9CFE29076AB7939BB96 CTqd;
806,090,040 *53A28FA4428FD823650886C7CBC8617AF4B8EA95 CtQdW
806,090,041 *53AFD2330B0B931BE2E369EE0B35619DA64E6EB4 CTqG"
806,090,042 *53A818B17643DB6C5BAB2C4B5B87D165AE2C43FD CtQh9
806,090,043 *53A029E62C2E16DAA1DCBE4B606E8C158D26E8CC CtQ=j
806,090,044 *53AE0496C9A6AA582EBEE2FEDCECABB3FF2870B9 CTQva
806,090,045 *53AE7CE51CF0580E114343FDADB9A62DE6DB1F02 CTqvS
806,090,046 *53A9EFAC10BFE76467E9BF3C9F264E08FF53F6D6 CtqYB
806,090,047 *53ABF6F89DBABED546BDA07985FB990D72989929 CT_R
806,090,048 *53A50F784776EFBD29FDC49854C9757D380FFC25 Ct,R+
806,090,049 *53AFE88EE7102BD3BD5E8B8E19B3A1DC277AE0C0 C,tr2
806,090,050 *53AFBE99DAC0101AED10362F8D49EBEC20D31BD5 CTr3
806,090,051 *53AE923E299E7BE716135953B3AAF397FA53B06D CtRAa
806,090,052 *53A6F05E5B88580FEB12379B950EC1A6CEAAFBEE CTRANJ
806,090,053 *53AB82607BB9ABBCC5AE2CE114916595402B055E ctrhpnsm
806,090,054 *53AABB915F9F0A3C3ED6570ED83E18C1053AFE28 CTRkg
806,090,055 *53ADB6B8779A2DC3352DD199775FE3600CE7C135 ctrlbackslash
806,090,056 *53A1C83CC1876211CE9BA499F1E128279D4E8FDB ctrlw1234
806,090,057 *53AFB3C1F5389341F3107FA1BC4BDAD705A6B24C Ctroform5
806,090,058 *53A6F5909C299452F797941EE4534553292EF896 CTrR_
806,090,059 *53A24CBAB7969B98D2B0B160B6F2BC8A5C826F64 Ctrslpbn
806,090,060 *53A4C2EB0CEB84F3FD3A860AE3A0F22E27D1FB02 Ctrtm
806,090,061 *53A0D02AF76DE24E473507DE54E6002F0A8691DC CTrv.
806,090,062 *53AEE04B885210A6C306335D965198A39537DFC1 CTRXd
806,090,063 *53AF686EE5AA641ADE2ECC80CA7349156FD61367 [email protected]
806,090,064 *53A427ADB63B92BF9114C01860FF9E1E3A3A33C3 CTs)_
806,090,065 *53AF2F5BFF2F0DEB5158AECA4F91B439CD84D242 Ct/S,
806,090,066 *53AA109655ED88B9F2861BFB784CA51026291D1A CTS52
806,090,067 *53A010734C1F93CFF7DFCEDC207BCE7C148D3770 CTS5L
806,090,068 *53AC52E2D3DA7631807F3AA0F9AF266FF62D0C23 Cts6(
806,090,069 *53AABA146B10FA93B0F5719B574CED567AD1E4A4 Ct+sB
806,090,070 *53A7DF4F2CC42CB3A01828CD3FF3561ECC517957 CtsBj
806,090,071 *53AC1A0B506089DEA8E8034E52A008CF89C7FEC7 CTSE8
806,090,072 *53A174455EE24CE8D5809F8CE2D95394DBD40247 CTsjN
806,090,073 *53A5F217079C7A4BA3C5F65A4046886283C3757E C$tsl
806,090,074 *53AD7174AF7ACB7370F809B5F54449A4D93D61C4 CTSPECIALFORCES
806,090,075 *53A01AAAF451E1134D66171F4EB2AFD941B49962 Ctsttching
806,090,076 *53AC5BB47D167946C2E7DC116A227AD03E256D0F CtSvp
806,090,077 *53AD1A324B0DA34DE13E862F63018E92062F6491 CTsY.
806,090,078 *53A04B4D3E00FDDF12F075182A051FF62D1212D2 CtTCa
806,090,079 *53A0247EDA7EB18D5EDA0605C067C264BAAE66E6 cttctctgggcactgcggatgggtgggctgggctcccagccttcttctgcacagccgcct
806,090,080 *53A85481ECC970A879F27078774DA068BD806064 CTtjH
806,090,081 *53A7F142953B69B7FB577739A818447DDD3DA5ED CtTNv
806,090,082 *53AACBCDA0C3FE79126F02159D41C37367F8CCC4 CT=tp
806,090,083 *53ABABA282532B73A9979F1F90C50CE5493EFFC5 cttshly6
806,090,084 *53A95BFF88C8E6D3AB81E2BD14637B4BD11BDBA5 CTTtH
806,090,085 *53A05C43F37C82A2CB3C131B570B6953697929A8 C($TU
806,090,086 *53A2F22B96A2DA8E1C7265A2487A639460C2F369 C!t.U
806,090,087 *53AFE4B7A5D53DAB339A6946B9017569480CF4E7 Ct$U%
806,090,088 *53A3B05F3A84138C0631CA21A61CF7A1F8E87DE4 C"t#u
806,090,089 *53AE51AC6E3A3BA6385C228770E33F692C59CD06 Ct_u:
806,090,090 *53A8619E6EEE0BA123E6C552F7AA849E90D4F241 CtU"4
806,090,091 *53A420110DD4DB16674356D0CD7225EAA9C8E5B7 C/Tu9
806,090,092 *53A730DB88E124D8F14BF37DAA629ABBA7772531 CTUPPLO
806,090,093 *53A7A7350FFFFEC2D0A67CC85F7CD1E0DA6DDE1B CTurN
806,090,094 *53ABDA85F59796B862E297B084D41F7534A2748F Ctusm
806,090,095 *53AB562686FC3181955127E3890840B5091FFF28 C/t%v
806,090,096 *53AD5D2825AADA19BA1BFDE0AE13550374F85285 Ctv/4
806,090,097 *53AD0C086D0A19149F39B36FFD9983D19C832F52 CTV4P
806,090,098 *53AAD81AA46A724764F5015D7715F2E0A6B38E76 CtVcM
806,090,099 *53A52AB2C7F9C12099292714F6AFFE43821863C5 ctvfirsttwo
806,090,100 *53A9EABE9E8170E63492CE40C0B5B168B29BEE1A CTvK%
806,090,101 *53A6971FAE840A0666DF1A66AC2BAB2533B23D78 CTv?o
806,090,102 *53AA6300D7EEC40343F18AEA4EA924221DA03689 Ct,Vq
806,090,103 *53AF0E28B7561203688FD7AAEC5D813A9735F936 [email protected]
806,090,104 *53A02AA5E1EFD5FBADBBED7BBAF4CDB54ED02590 C-TVU
806,090,105 *53ACBDBBBE9B50FC74EB2745C2636DBE4DB4E2EC CtVwf
806,090,106 *53ABCF0BD02E5F8D42FFD945749D60D7537D0CF8 Ctw/_
806,090,107 *53AF5EAF56CB6531CCEE7D625690F5908E64DD53 CTW0k
806,090,108 *53A562738C613D4CDAE854033070782A038EC32F CTW/7
806,090,109 *53A5DDED0B286E30BB0393408C0F81CDB05F898D CtwAQ
806,090,110 *53A31C2FB9C29CAE56175BFB96D1A757CD923794 Ctwec
806,090,111 *53A15B19B1328A22EECC3BEB890F5AE23D2D1422 CtWgL
806,090,112 *53A2850E6CEBE4210300789C36AD701F62DC0101 CtWgU
806,090,113 *53AA4DAD3F625C9C18B5CA52CD2332442998E81A C#tWL
806,090,114 *53A1703041F4B300F25B6370FA38ECFA28A479A9 Ctwo"
806,090,115 *53A8213A163A1C52ACF86F62B51FE79602478B16 CTWoj
806,090,116 *53A125655FBF6CFD4C788280B7D362A08CEBB31E Ctwomey7
806,090,117 *53AAA8147F2DFBF7655F1708D5C90200D640888D CtwTi
806,090,118 *53A5E8662E2F767552DB390E724C353DC8E8CD82 CtWtO
806,090,119 *53A4D26D484188D06E16F9367F5AFE196B6F5A41 [email protected]
806,090,120 *53AC727680D7ADF841ADF591F7412D4D909537CD CT_X&
806,090,121 *53ADD1B654A003ADAC12D945A8FABF32FD33EDE6 c}TX
806,090,122 *53A225F88C49D5FFE6AC514A47916A5EB255B92C [email protected]
806,090,123 *53AF0ED39ABFCC8818670791D12B310195F9FA73 CT/XZ
806,090,124 *53AAF7F5A254521D4777A00FE6D5AEB76B011D88 CtXZ-
806,090,125 *53A3A09A867DFA0F96A53B45CCB039C139E671DE CT}y
806,090,126 *53A4EED609A98D0243D3D3158E045BC45D9CFDB0 C=t!Y
806,090,127 *53A0C8B5522A40239047FE09FF2D99E84F2AB23E CtY?0
806,090,128 *53A6A26FA5D2A28EF89D4654101FD6EEA5B34948 CTy4
806,090,129 *53A7D3FB1206A77D65ECF4FC9CF8E0A076CA680E CtY55
806,090,130 *53A1969BF7EFB38F337D4E549B3DFEBA03DF70EF CTYd3
806,090,131 *53A2C68F1505E635FCE784A387E4B63253B8A4B4 CTYk
806,090,132 *53A99E09B03313E752D09E721BF5040B895B61B4 C/tYW
806,090,133 *53A6757C97B0A497A54CBCCF3777FD3B5B186D8D CTYYB
806,090,134 *53A99B76BFADDE6C264D1C5441C4A6B9C3F60E58 CtZ4j
806,090,135 *53A181CC34914E8AC8BCB99B3B605B2644F1AF49 CTZ4u
806,090,136 *53AF2866B99465ABABAC4F0FE790DEED7F586B94 CTZ9V
806,090,137 *53A27B410D03714D1CCC6E5B557EFA83EA7BA742 CtZ9V
806,090,138 *53A5C6A476F2AD7A8AAF3BA69A094277D5339B1F CtZaA
806,090,139 *53ADA07E32869E5372386F1D074F78D3EB62EFF3 Ct=Zj
806,090,140 *53A549C3BEE080EDA246C85D836F88E5B7F02781 CTZR)
806,090,141 *53AC0F5EE24C3E189D27C3750AE5B3C1C08183BA C-=U!
806,090,142 *53AEB837CEC25C6CEBCD50D91DBC9D6364DA1413 C-U_$
806,090,143 *53AC303310AB33D676A352AA3F29CC4E4AA43766 C:(,U
806,090,144 *53A175718C7808F337C4B60A85DD40EBD895E1CA C:#U?
806,090,145 *53AB7A1732725D6B95025CD264E09A049D29AA0A C!_U:
806,090,146 *53AB777D09C511D5CD99B154E56CC937ABE3C2ED C)%U:
806,090,147 *53A616262045DCB5D01854ED6311B5CC0A154F5C C]<U
806,090,148 *53A4369A451E7FE42AC10D02FB0F36D0A5A8016D C$$U%
806,090,149 *53A88EC220C2065BAE2461E1D4AC2C78471A9D69 CU?.:
806,090,150 *53A91010C9A17BB3AFBE15503F2F2002FDCAF50B CU);;
806,090,151 *53A0C781A7949B43F0EC3F04320196DE32BDB391 CU}=
806,090,152 *53AF8399F40D23BABF241928112E181438AC64E6 C;?!u
806,090,153 *53A11105A24B8151EF4AA48CB154F507E199FF1B C:u?=
806,090,154 *53A19BE413D8DA660FA83829446EB73F08A3C6E3 C.-/u
806,090,155 *53A8AE6746C82D481E9EB9B8A284CDD805CA5BF5 C#.&u
806,090,156 *53AA63B45789418BB9E5B83564FD74BA9BC8920B C%u_)
806,090,157 *53AE7A6D945FE6CDFABB21D2167718DAACADB3DB Cu;"?
806,090,158 *53AFD46189BE275724CC0E4BEEFECD79A3BF14AA Cu.+#
806,090,159 *53A3DB804138FEF9099F908B1585534B8EB642CE c\U*@
806,090,160 *53A1A6FEED1562458AB529FDC4C9A10E869476B6 Cu)"0
806,090,161 *53AA2A16A4AA55C5EB0F7796263BEBD650662E30 Cu097
806,090,162 *53A77313D3D470E6D9D2137791C2C891EABCE103 CU0=j
806,090,163 *53A6E919CA463609E368081B21A829F4969003F5 C$u0m
806,090,164 *53A15BF95ED7A7758AE1CEB1A4B9204E0CA65CA8 CU0#Y
806,090,165 *53A553CD514C5E24F28365669A9234ABF552C0EC C;U1
806,090,166 *53A7605EAB46BB5D4C65C4773729B21C54DB2959 Cu?1
806,090,167 *53A9356FA03880166B8AC6B8EFA4859C9DC6EB78 CU1!0
806,090,168 *53A057A608D8DCA9075F8332E5B09FDA4E2AE32A CU1b$
806,090,169 *53A0863A3A877FC06919C8988D039B8DF7A30384 Cu1;D
806,090,170 *53A3186A040FAA278F77A1C4A1C6516427D289D2 Cu1/F
806,090,171 *53ABDE4A5666057BFEA17B3B2F489FF2A9D8357C Cu1lo
806,090,172 *53A3ACAB2A95747E33920B92FBF7732C9C762B24 [email protected]$
806,090,173 *53AA9EDCEBBA98C313B34169A039705D49B525FA C#u+2
806,090,174 *53AEE1CC75362548FF1EB93A8CA20641153CA438 CU.2b
806,090,175 *53A1487881BA3FD06193779467CB170E1A7F9AA1 C.u2g
806,090,176 *53A1EF0C96F53FDAE14BE89E1C9AEE15844C9DC5 C=U2n
806,090,177 *53A6CE330474AECBF33EE2F3B68BA1A4B76B27E8 Cu=2S
806,090,178 *53AF176F170D225201B1DCBA2D7247C60A7A9A17 C.U+3
806,090,179 *53A8D49004CAABA31FFD96865B4450078EA06B6D Cu39!
806,090,180 *53A770BBEBCBBE4D57CCC262A76A85A35C3FC65A CU-3I
806,090,181 *53A9721099E6DDD36E70097C95E50F4DF6321A3A Cu3kj
806,090,182 *53A38B21822300CE86DE0C9EEDFCDB99707C075D CU3%P
806,090,183 *53A8B12158DD580F3826AF64D3A166D05977B060 Cu3Uj
806,090,184 *53A794B891D406D7B9493E597B41EEBE6A795A2D CU3V4
806,090,185 *53AE6E480355C8BADAA91B030332C6A8791E516B Cu$3Y
806,090,186 *53AFAFC99EB6A8DA8A6E7ED39ECBF618720B2C63 C-u)4
806,090,187 *53A409AC0B051362B53BE29FC86C2745E04CDDA8 C.u48
806,090,188 *53A72FA15D36C51EEB87809C9210B7675D28E816 C!U49
806,090,189 *53A6AE1855285E8BAD0407352E4FC00AFAED94E3 Cu4c1
806,090,190 *53AEA57BDAB715960130A14B979ED42312FCEFED CU4eR
806,090,191 *53AE9DE888237304CF9AD3B93CD2AD50917D5A5A CU4F_
806,090,192 *53ABC1599B2F5F13ADB3A174D04EDBDCEC719AD3 CU4R6
806,090,193 *53AAEC33A860BF79D4F21C3369FCFF1221369556 CU570D1E5
806,090,194 *53A15BC5F8A4ECE1513146415EF597D320BCE2AC Cu57om!z3d
806,090,195 *53A65B92711EB7A30995F1EC75575A79369781BB Cu5m=
806,090,196 *53A1B66E6E775D5CDABC6D1CE310A69B9AEA6FF0 Cu5;S
806,090,197 *53ABA822843E310EF8A17910469113D033679EC8 cu5t3r315
806,090,198 *53A26738E8AF5169485F950D07DC3B683BCC763C CU6ef
806,090,199 *53A7D2F4F2F63F338A0CB551F550D4ADBD3D1B79 CU6uc
806,090,200 *53A01ACBC5F716CE6ADE6D837F769D7E93054713 Cu6v?
806,090,201 *53AF731744B0631F63397C5DA5EF56391F7A8940 CU+7:
806,090,202 *53AEBE8D3154AE790EA10BC8A4BE8409B347690B cu71ip5
806,090,203 *53ABB61CC401F58982533C0081DA5C8897469CDD Cu7c-
806,090,204 *53A4A869A27CB4E1A829E43F7160F3C9EFD0E8EC cu7i5ec7or
806,090,205 *53AA8D50A17043D011D3E57FE549A5B835D79571 C%u7j
806,090,206 *53AFFC8E981498112D1566C24B7A5B35DDCB9DD2 CU7L4$3$
806,090,207 *53A69C83751C0BC13C2542403CC998721A20F80A Cu7U%
806,090,208 *53A6932914FEEECCBBF74B84934BE8E7DA139242 C?u-8
806,090,209 *53AAE9AB89BF31179FE782D8F66CD148C2B7B1D9 Cu%8:
806,090,210 *53A6F673ACC1A17C71D1E7F67A9BADD0C16CF639 [email protected]
806,090,211 *53A90E05F7FF540D2BF602E45D2C6FFC61EDF0CE C:u86
806,090,212 *53A1521C225F1C932F363A3720030CBB54461F55 C:U8a
806,090,213 *53AFA8E60E33F4CF45CD1EFDFEB8983172000043 CU8cL
806,090,214 *53A54683975F88E0780A68FE649259A9A53A9021 CU8fe
806,090,215 *53A33DE06F47A25B51F39A34854C6E22F339240E Cu8pA
806,090,216 *53AD300394B8C2CA799FE472DC6466123D0A57B1 C/U8V
806,090,217 *53AB7805F904169A413C67195EF394B6EDD986D6 C!u(9
806,090,218 *53A3F68C2975E4BD047A42C307745EAB9DAEF2EE [email protected]
806,090,219 *53A2352F2D56ACA3F8AA98CC459C017F5C3BA3F9 CU96O
806,090,220 *53AA7984340B2E9D8CDA7A942C3E1B69597B390E CU9K_
806,090,221 *53A1EC1423CAB5D96DD3429A18459B69FC2BD0BA C.u9q
806,090,222 *53A3CE3CA94732B9A403844E0A826422A4305B26 C
806,090,223 *53A66EC4D30C37C369F3389F6585A0854C1C3E54 CUA5:
806,090,224 *53A548B8CB1610B411967B419E277F1A9192C5FE CuAAw
806,090,225 *53AA344A36E847AEA4983477D56A44D615D9321F CUacS
806,090,226 *53A0057E7D045365C1A1FE4CAE0420BA18FA2997 Cuae4
806,090,227 *53AC93C38567E1D07D2A8DBB9F19F41C841F581F cuahútemoc
806,090,228 *53A3500A63C3BD7F1D252EB7D6E0127698B0DC9F cuailli5
806,090,229 *53A7FDD5CBCB8C82E7B85BBB8417EF2DA01182C1 CUAJINAI
806,090,230 *53A739AC1BF3D0AAC6997FC9EB94A1FC9D6788CD CuAlFe
806,090,231 *53A65693A1E5329709CABD0FBF2B71934D7125BD Cuando muere una esperanza
806,090,232 *53A8EF8D85DDB766500593B308EAE60F35274ACB cuan_zj
806,090,233 *53ADEB5C8B5CEB14A28854E428C3AA73DA343CCD CUaQM
806,090,234 *53AFB675EAA798AD5D83BCF1CB49696FAA6EFA39 CUaR?
806,090,235 *53AAD69104F9E0927824AF3744A07743A0029544 Cuardie0
806,090,236 *53A08FB6BEE29F31E4AF1B220F455BEDC37185E2 “cuartelillos”
806,090,237 *53A9E2E9307EA4F184F8F1ED15125CD970A25342 CUa#s
806,090,238 *53AE49193982401808BEC6DAEF26BFFA46629785 cuav.org
806,090,239 *53A600195896084B35B8D71F54C85CA049EAF222 C"uB+
806,090,240 *53A4F3AC9A369048668CCCF1605F15AC52CD9445 C
806,090,241 *53AC0D56786F141571A048777007E97AB01A698A CUBA19(95)
806,090,242 *53A2C5210E422AB66422B640C0023398A68937EC Cubanpeso9
806,090,243 *53AC2B78452DB35F91C480107B47D7FA6472083B çubará
806,090,244 *53ACA4C7B4781F8EC6DC59E0DBB45DEF3B60F482 Cubbi$h
806,090,245 *53A8196B4EF1B6189515B35CAF94B57CFFC396FF CUBbv
806,090,246 *53A268EECD378F0885DC5243E226F43832B5C8D6 cubeb1
806,090,247 *53A3E94C1C02DA1ACA2604B585EF27C8F7D62D90 cube.citation
806,090,248 *53A7A8F94A52A454A332EDA0FE5BA8A5B18168FF cubecompany
806,090,249 *53A0C8E0F1A322AC02AEE5AC235C8594BF28A76C Cub!k
806,090,250 *53AEF53172A4A5DECB810FB86C2476D2798AB7C6 C(ubL
806,090,251 *53AAFB76A94A29D06FE8E1246EF6B740FE8A86BB CUb!u
806,090,252 *53A74EE8A90DDAF1132E590182B49F24222C2AA2 Cubyniz7
806,090,253 *53AA07701005AC1C9AB0BD18E518A63FC22E7CDF C)U-C
806,090,254 *53A76E4ED3CC4808B355AED290A904F47C580BE6 CU?C%
806,090,255 *53A2E2639050586107E6B71E8C4E93AFA3402095 Cuc5d
806,090,256 *53A795E1E0BD3A01595D7CF91F7CB3117BD1BECB CUC7R
806,090,257 *53A62A6E26D98A6B0DCF91F9D0F73FA6BAEB82DB cucchiai7
806,090,258 *53AD3E3440F3869698C98564D2CD2B42FF44966D CUCCURESE
806,090,259 *53A4B6D4C9CCBE92846C9112BEF566F4FD84B0A2 Cuce!
806,090,260 *53A5BDCC9CBFF847FF3553C1D61BB6679CF29AA1 cuceririle
806,090,261 *53A3B7C5D319ED740A082B4A304DD80A0A104AFA CuCF/
806,090,262 *53A7C2E1CD4A0FE256951C3140626C526D459D82 CUcH,
806,090,263 *53AF6E6BABE1023E33A4F9B7D6DD0D703BEF1EC5 Cuc
806,090,264 *53A31FFBA2A9016ECA49AE29DE80E1FE5AC987F6 cucinar0n0
806,090,265 *53A43152FF64D067752D9DB24C47E3102E990DFE cuck00m4i
806,090,266 *53A353D5653711AAF26AC4CC1626761D6E4D8780 [email protected]#cuckoo
806,090,267 *53AC4F2B3AA32E40643FD6589FB5D30AE05BAA0E cuckooshrik3
806,090,268 *53A81D8DE21E6417771CC9D86E20D99B57D6A591 cuckoos.tumblr.comcuckoos
806,090,269 *53AD4719968BAF662C9D2DB24D38D5DA7BDC4A21 cuckquean?
806,090,270 *53A180896C7D8589B950824D3AEE3F95943D3362 CUCOURIER
806,090,271 *53A0EB8179025D4A774F3EC6B4FD50161C5DD8FA Cucubalus6
806,090,272 *53A2AA9A6FF462A278647AEE0A295CC7DFD3E67F CUCULI7
806,090,273 *53A0A0747B08C3C3D4EE74B2B3CB5B4AADE20427 cuculid0
806,090,274 *53A0C9E48D22BE1E065E79B3F20F343321F6656E CUCUMBER33
806,090,275 *53AAF43D9D44F55DFAEC4D71DB7154D358267BF9 cucum_berpass_war
806,090,276 *53AA09016F46065EE5D056A8EDFB935C03CCF9FA cucumbers”
806,090,277 *53AEB2E2B778FAA4AE3BF2FC6B007F8D0467B857 CUCVo
806,090,278 *53AC96EDA9C2C1C1DD0AC515800A9EA4C4C9862E [email protected]
806,090,279 *53A2730B1CAEF63E2DF9A5D2668358FD45539CED Cu_cZ
806,090,280 *53A19821B640E5CE30CA74AEE1D84C8F5836BEAD C="ud
806,090,281 *53A4193B1CA28D21E5BD4F33E5831D1C31C5EBCA CudcI
806,090,282 *53A82618E9EC265EEA0C67CF49102E8313959BF6 CUDDLESSHIRLEY
806,090,283 *53A7FE391832431158147FFB80B8A9A33E5EA80A CUDDLESSYSTEM
806,090,284 *53AFCFB0D1B3F7BCA413B1DAC97F0790584C631E cudican1234
806,090,285 *53AD037C8FDEC21E838239F2CFE4A00EB09A83E2 Cudot
806,090,286 *53A0A1DF8C1D2A90DCA0441ACAF99CE7DF599755 C=uDQ
806,090,287 *53A6CC05291FFDBD00355E24D922DC8102A2CBFE CuDR%
806,090,288 *53AE87D4D8C6EE0FDEA8AEE472101B27EFE10C2B Cu#DS
806,090,289 *53AE6556A77F18090D71CECD04C86B2313040400 CUdTh
806,090,290 *53AF967F5E59758661ABA49D9BE19D1624283A01 C%(UE
806,090,291 *53A986536C87C302F66304AB020B9E875134BE48 C$-Ue
806,090,292 *53AD849F15F86054F9BB57888F9C86447F1411CC Cu_
806,090,293 *53A2E685F819432FFE5F7CBC8DC151DDFB0EF985 Cu
806,090,294 *53A9A7235433E9EB77783A0C6D6BCF649517D37F CU)Ec
806,090,295 *53A0DEB428F0101C2D0312290371A1CD713592DF CueFf
806,090,296 *53A1C74F42E05048A75820BC08A1082C3EE3CACF Cuénot
806,090,297 *53AABBC1C60230E1AFC325C4D3829AB7AFD878DD Cue?r
806,090,298 *53A88C525DF4A437E5AE00E3CA226C6731968E2D ˝Cuerdas
806,090,299 *53A825A5DA548CFFC6D5DC22D2C12502085F99EF CUETO46
806,090,300 *53A3FE03B792B397A120CAF5838B7F161AA01D02 Cu:EU
806,090,301 *53A2E021C2EE17B435EBAEACD9BE94EC96235646 CuEXp
806,090,302 *53A2FDC525D6DF505ECCAF130C03628E98669FC0 C+uF
806,090,303 *53A653032B55CE59C09C6C6BD50FB1DCCB665E92 Cu$F+
806,090,304 *53AE6D725CAF54C7701B99B1B0FA2FFEB489F388 Cuf1-
806,090,305 *53ACBDC8828FDE81D5287ADFD1F672EBE2BC3D04 CUF;C
806,090,306 *53A376B7BC428C815F0CAFCB522FF809F1F2FFBF CU,fC
806,090,307 *53A886482A4F4037B97EA15563C1738F966D614F Cuf$F
806,090,308 *53AD593EB1F33AB8D4ACEB9F50034AEB13A7A08D CU
806,090,309 *53A1D74AAAA8F30D26FC31369A838018AC9C7897 CuFsk
806,090,310 *53AB7AD9DE3D89C65573CDA7004ECD018EFCB322 CUFUt
806,090,311 *53AE9E65DA1336D563BC7F3CB3EA432284462682 Cu
806,090,312 *53ABDC9FFF6F01423AA4D211167F98F5F085EDA0 CUf-Y
806,090,313 *53A8FFC350ADE0C53C986709DC9A89B31A5F817E C:uFY
806,090,314 *53A0CF4A98FD9D17DA0BF83FAEE4841C91481C8E C#(UG
806,090,315 *53A237FD5EA88D886D3D2CDC9C2E794F40D66789 CU?G?
806,090,316 *53A3A96A3AE3B7BA106E16264C57B7B662DA454F C;=uG
806,090,317 *53A1B7AA365CFB5F135C56B0D00C8B80A091A5B0 C#$ug
806,090,318 *53AD5B412A870AA57A74D4AD673A82E74653EC2A Cug7b
806,090,319 *53AA1ACE7B050C9A139C9FE90B96AC73BCA062E3 CuGDM
806,090,320 *53A395490662E3494C5C30BA0A01CE4FB1AF4ACB Cuge+
806,090,321 *53AB03093109DC7C141DF446C12E87032C716406 CuGE4
806,090,322 *53A1A00EDD49367529690820A33E9BD7322620AF Cu,GG
806,090,323 *53A240D05DEECC6535AB68C14DDE6B0D5A72CE2C CUGhc
806,090,324 *53A57A3A18E047F87E29E5F4CC1E7405EE200030 CuglS
806,090,325 *53AD853F5F81CBCD787BFC93A23165C0AD9639B0 CuGPH
806,090,326 *53A9E2D0FFBFCB8094CE4F83CE3070968C380210 [email protected]
806,090,327 *53A04BDA2983166B6DD5A82A191AE198AAEBF461 cuguç
806,090,328 *53A33BF4E37BDC79663CE86CAC2703E634DA7A01 CUgYe
806,090,329 *53A83A276F8529A143C60DB8B5A5AC9B872B3BEE CUH/#
806,090,330 *53A762D891975D5AD122698CB90BE73DC826E9A5 CUh1)
806,090,331 *53AE2A6BB88BDEFD782C4EDF5D38CCF9AD8E516E CUh3w
806,090,332 *53A31F52F990A5FC2CC0E9DF46A214903477CFC2 CuH6"
806,090,333 *53A888C2DC6FF96AFEEED8AD3AE6252888533FB9 C"uHF
806,090,334 *53AF24A6BAD86652E2D8AF4DAC3D40CB57F40DD5 CU#hg
806,090,335 *53A293E30A118C7C88A4B9FB7985BE84A5EE2F39 Cu&HI
806,090,336 *53AD61B765AA04E12193D2AB2B4CAE5D9D57D812 cuhlaa
806,090,337 *53A5B4CBEC65B15DB4365A407C5C7A9E12567905 CuH;o
806,090,338 *53A4F6B89689FD973800560FB5608B3EA5CE66BE čuho
806,090,339 *53AAE262409903E077D6E5EA6CD21431C049B8BA cuhqaacaaj
806,090,340 *53AC1EF04C532F11735EBC0CEEA0FF9555903AB3 Cuht#
806,090,341 *53AAA3FA45FFD002336BF11E0D233F373CCB0CA6 C?U/I
806,090,342 *53AC3B70089688294C799072A844AA9B7610D4C3 C)UI
806,090,343 *53AB2C57D08D634C3B978B31B592C61ED1ED4FC4 CU)!I
806,090,344 *53AD670854687B85231748BB258602BFACC393AE C.)Ui
806,090,345 *53ABFAED8A0326887BD7D60135BFD62928349077 C,ui$
806,090,346 *53A70AD3B697E45D1DED946C444BA331424A328C CUi3f
806,090,347 *53A830F52E6B0480359F9B6A1CA716C795A6A719 [email protected]
806,090,348 *53AAA6A3B325057FF4A9880CC4EC4A6972CFCD10 [email protected]
806,090,349 *53AC1CCD00D0AC4C71BD1212F694B6AFD07E8667 [email protected]
806,090,350 *53AC4F820255B2ED116C23A12FB11703A8A2CF7F [email protected]
806,090,351 *53A3DA7B1D2C87C1FA215E651A7D45D728BA09A3 [email protected]
806,090,352 *53A86777063115DB6585C129EF18072C0B02FC10 [email protected]
806,090,353 *53AD353FA5452A571127E8A5ECF0435A19B5AD6A [email protected]
806,090,354 *53A9E6E8FBE5D1B910E548E5B6105277009076A8 [email protected]
806,090,355 *53A40D0C00249B1C83FBBDC60CA48299DCFBF2EE [email protected]
806,090,356 *53AB173F0973B4CC76E8E865E26B19BAF776F8D9 CUI?b
806,090,357 *53A27184C8EC31887D5846244652641D5175F9D2 [email protected]
806,090,358 *53A2B1183F20D4A85193D2953D9E182999A59C80 CUIdc
806,090,359 *53A4D3A37C34E3ED71756513C2BD1122FB075760 CUIdi
806,090,360 *53A0DA4E386D7FBF6564C3DD7F267A0F1D5C37DC [email protected]
806,090,361 *53A637934D2CAAFE7ED0A17A0AAFD7126B6F14CF [email protected]
806,090,362 *53A98628237AB9D70A40AD1309CAEC6FB27CB087 [email protected]
806,090,363 *53A242B6B9C0EFE70D93DB12AC637F8FA50E37FE [email protected]
806,090,364 *53A9AF6D6C5B8EBF22EC03B1EA184284A842489E [email protected]
806,090,365 *53A22F05D96460CD7CEA0D0ADCCBAAE2F9A36153 [email protected]
806,090,366 *53AD6862B53D08C5F4D8D3F3828B0D99F6810F1E CuIhw
806,090,367 *53A490C4B6340381638085E20FEC93C6A3965490 [email protected]
806,090,368 *53A37B2F09F8605CF5B8AEFDFA2B070CFB3EA00B [email protected]
806,090,369 *53A582C6606B8D121654C45704ACAD71F92D9D37 [email protected]
806,090,370 *53A614C1937ACFF6FF8FDA398D451DE48C083333 [email protected]
806,090,371 *53AAB12CEB780EF8572F3A2232B41B2D1E4F68D0 [email protected]
806,090,372 *53A94D895BDF34587D1D06E48A057733A67901ED [email protected]
806,090,373 *53A6BFA1BD754FE0CD5301A7C4CF025B6BB9F72A [email protected]
806,090,374 *53A127B7B6115C525B98387464B3C5F83D2FF576 [email protected]
806,090,375 *53A4F9345F4A43DA6E323CA209F522D7658EA615 [email protected]
806,090,376 *53A59D7D422A4CEED55EEDE93308DAFAB8B410D1 [email protected]
806,090,377 *53ADEB13BB02BA60CA7913F7218B0AB5F745E0A7 [email protected]
806,090,378 *53AF93FBAA37D380150F54A33D01EEEA724ACC9D C%UIL
806,090,379 *53A69012F401739E184180D9002F0C710BA048ED [email protected]
806,090,380 *53A06F8477D621A257B4240B792226AE3A904E76 [email protected]
806,090,381 *53A4EFCE59E803D59210C9085BF17BD86FBC3F93 [email protected]
806,090,382 *53A6B78DD733BDB38D16FA3FDEC9AAA9A2D5D670 [email protected]
806,090,383 *53A2481C7D3EF13189B4E447D9946E072CE57D0A [email protected]
806,090,384 *53AD53EC0842AD99C76E9DEFC3FC7FBDD4E8C5D8 [email protected]
806,090,385 *53A991159968BAE6CD1194EFD74DA63F3E6F0E8D [email protected]
806,090,386 *53A64FA328ADA3E72F2B00DC9C9D5F024C499ACB CUI#u
806,090,387 *53A5E2D54043573A0DAA08A7361474ADF79C2EB9 cuiusque123
806,090,388 *53A15427A551A7054FD28E748FEC253310217B76 [email protected]
806,090,389 *53ADF38C8ABE57B618C317CD09ADFFEA1E6943AD [email protected]
806,090,390 *53AF40303582321AB0AF7205F80A5231BDC40E06 [email protected]
806,090,391 *53A625D22CB845760D28A96742988315AF4664C8 [email protected]
806,090,392 *53A6872D5DF3C046A88C7BAF1C4F0252E50D8A44 CUiZK
806,090,393 *53A198DC35D111D7C968DEDAE02F9626C8028E24 CUj4h
806,090,394 *53A7B6F88D4110772614BA48339528D707F8080A CU+jn
806,090,395 *53A574CB2B9C1B8464B331649956EC5D2DFEE486 [email protected]
806,090,396 *53A3A3A4CA9FBCA4426E1C9CF12FB4327C67E88C Cujugafo0
806,090,397 *53A4A4378742C2685B58EA5A0C53985C73D00EA1 cujzk
806,090,398 *53AAAE0E1598FC1705B1809D7A305C06FC26F99F CU,&K
806,090,399 *53A79DA6FFC739FEE9E41FCD72C15AD91CA5283E CU)K
806,090,400 *53A2B71A7C974674B7C40316E5E38CABB4C3F37E CU(%k
806,090,401 *53A847356C16B5D6F280F9E17C726B3EFCFC3FE3 Cu+-k
806,090,402 *53A79D5E2EC841D709B09ABD245E5A25517369C9 C"uK1
806,090,403 *53AADABEC97AA8D92546DB95339BB2D2D84E1C04 CUK"a
806,090,404 *53A6B4EE877D8F4CA6DE96B2254CB8724147F66B CU
806,090,405 *53A7513FF82B8B78C27EDA27B7568A9D1EC54850 CUK-h
806,090,406 *53AD28038459B3185B809C3E5D501A184F3173F3 Cukqqkg9
806,090,407 *53A42DA384F02809B5B36D196EC1C14A00D0FE40 Cukrovky7
806,090,408 *53A151DCABE5780445BE4001BC28506F46465D85 cukrowo
806,090,409 *53A4EC697AE65AFA27D04D4C45E16DE5317FCAFF Cuku
806,090,410 *53A7FD92600B7A812A737D31B79AF04662E78836 çukuryurt’tu
806,090,411 *53ABD9A4EC9265EC3C6F52B4906E9296F2E085AA CU:kZ
806,090,412 *53A0FDA926014B3CA7985F74F4238883B930526E C_U?L
806,090,413 *53A55F3DE60F609E84EA175F04C4CC38A1F2A4C4 C
806,090,414 *53A3D2BCED6321732AA2A272234DE84AB3FCB6FC CUL;!
806,090,415 *53A7794525A23E06CB072833EA820875CCE74DA3 C
806,090,416 *53A60D43A163AE4399295BAE566C4EF63D9F48D5 C)ul(
806,090,417 *53A44DE7B49751FEE3D8B322121131EEE20ECE95 C$ul$
806,090,418 *53A5F22C2F7DFEA96313E325FBD164B32C2D6872 CU#l1
806,090,419 *53A96587C5FFDAB7CE33DCBD482D02AB01F7DFC8 Cul_1
806,090,420 *53AD45B0E04DFE88BEB0410AA62426E753C797AD CUL7!VA73D
806,090,421 *53A35B9512416A4A3D01C26CDAE2ABA80AF122B6 Culadnal
806,090,422 *53A4004F9026402433AF4FAF16F54EC08CBD070B CUL/b
806,090,423 *53A0486A1BA286F461987CA644F2BD1C7549C30C culdees4
806,090,424 *53ACB92AB0A2AFADD002CC816029E38532C9045D CuLdG
806,090,425 *53AB3A52D0BFF3917F28777996030A7BC5E426C2 [email protected]
806,090,426 *53AB75E98560BD6F9CE35BE3E89BDDBF9CC8C103 culent5
806,090,427 *53A6E7BF12192BA5530C9D0D76AF615941A02B32 Cu?Lg
806,090,428 *53A0487706E66996C721825CC285C9127AC0FA3D culicide!
806,090,429 *53AF8FE59A14DD962AAF75B658FACD7879DB3690 Culinart
806,090,430 *53A1F00EEADB51305CCFC34A49648C0D6AF0DD94 Cullamulcha
806,090,431 *53A43D7AE54C0B5662F75AC605F6D790505F3381 cullandolo
806,090,432 *53A745EC5DD26C08E3997F94FB99B7B9FB4B2038 cullato4
806,090,433 *53A3A13BFF4C76D5C6899936A8A66F7E8E4F8B73 Cullebuter
806,090,434 *53AA4C9E4D08FD37AF37DD5B06B9ABF86A4A057A [email protected]
806,090,435 *53A36667D64BB528515CCD9781E695AFE4E5D9B0 [email protected]
806,090,436 *53AD1DF7B82C0AA15EE5F33A3FB1132394341DCF [email protected]
806,090,437 *53A1C999B4A7D2A8E0E162DB569C10F58B61E515 culmèt
806,090,438 *53A9248FAAAD1FF2476271AB022045289E6B8CD8 «culpa»
806,090,439 *53AD17DD68066E84E0DECD205E8B4F69488F751D Culpavam3
806,090,440 *53A75C15EE0026AF6D9C7E58F02D00C225961412 CUlqq
806,090,441 *53A7BECA04511FD247381B0DFAB52AE95A6AA72F CuLr4
806,090,442 *53AF354DF606A9C717C7E98CD6E341A02D6A61E0 CULs
806,090,443 *53A714788263E05E848AC628B918E1A7129660F0 cultivation(feat.keithmurray&kochan)
806,090,444 *53AC6AF5994662F54FB1A4C766D31719EBC24E86 cultiveerde2
806,090,445 *53ADB06051E6053835BE7FB6E2AE6A162D8C149B Culturele1
806,090,446 *53A2DEAD7183660AD62F5EACF6297B2B24A5E623 CultureShockA.L.S.
806,090,447 *53A2D5B445362653729FA1C4580CF13D990A4531 culturesocietyreligi
806,090,448 *53AB9B14C5D3538DCC770784ABD19AE0A48C855A Culturgewächse
806,090,449 *53A81C322BCBF9976BE0E17F67769B495D14D7E5 cultuurbasis
806,090,450 *53AF9ED66C9A8BC2C1E42C78C8F986CCF0DCA85E CULTUURGEBODEN9
806,090,451 *53ABD14553861EA17D355ED05CEC4A5F1DB51BD2 C-ULX
806,090,452 *53AAE1EA079635D05DCDC23FF5E501D05531E081 CUL;Z
806,090,453 *53A96F3101F000A13C086FFAAC9BFD297E25858E CU;:M
806,090,454 *53A1712EDFFEF10B8AA4FCA5915326CFFEE69E81 C/uM
806,090,455 *53A32D7F256C435D11D5AAEEA7CF753B13940E14 Cu!M?
806,090,456 *53AD70736D18BCE400DEE6619559143570574DF5 C(UM7
806,090,457 *53AE856AF7ED18C053C9FD6CEF4E979F3CC5B788 CUm&8
806,090,458 *53A879440E03CC22B3865410D236B8A1E55CA578 CumA2
806,090,459 *53A0C6B2FD93CA6BE85EDF53A1D9C1D27876F357 Cumbaby7
806,090,460 *53A3F537515B62A2A19A713D00374325003445D6 cumbair
806,090,461 *53A83A302FBDD5173565A83888E5C9878BC94001 CUMBERERS5
806,090,462 *53A930BB60F296966357D026DC1A9B89C85B1C48 cumberlandsmagic
806,090,463 *53AC20C5ED961FA4B01D8A0504131DCF791B6C07 CUMCANNON
806,090,464 *53AB1798E8469EC33192144E55284A881C3A9A58 cumclubbed
806,090,465 *53AF09BBE304B36FF6BD9FF50213B765DA1A9625 Cumehue2
806,090,466 *53A050A13909C2ABD885DE50987E3D1F9B7071CB CUMEUR2
806,090,467 *53AC60E132EF9E9099F615D9439CD41744830EFC CU$Mi
806,090,468 *53AF9E0FB0E7BF7A7718FE10513E2F03B29B7C77 CUmL7
806,090,469 *53AB3AC78A19C56977CB96D403B8E9A3D24A8EB8 cümlemizden
806,090,470 *53AC9895E7BACAE058465F3C741C220066E5FFA9 Cummanachas
806,090,471 *53AFEEDA31D9D070321C4454D44E2EB66EAD4A81 cumpănă”
806,090,472 *53A95D429A823C29EF57051532E5B6177991C129 cumpanyable
806,090,473 *53AFC09EEB38ED3733FFF9D55CB0BE6B9E063BB8 Cumpitas
806,090,474 *53A7E459D6D7A7005608A6ACF32E29C4DFD6C96D cumpleaera
806,090,475 *53A1A4D55369C9841F877B13D68D9BB9F2442ED5 [email protected]
806,090,476 *53A5A64FFA3F42E86F6C02714BE9C7A60148B112 CumulativeWinner2007
806,090,477 *53A407FEC80538A89A210762DAF2AE04EC568DE6 Cumulis2
806,090,478 *53A174CEFA0BC18F722AD38D84C531DBD1E3D446 CUMULOCIRRUS9
806,090,479 *53ADA1B1F0BAD40CC5C17EB03319B8BA9701AA1E CU
806,090,480 *53ACB17B7FDEABD5EA98832F93FF969EE6645750 Cune41
806,090,481 *53AF1F9035E017DA9C50CF36DA193C72B7AA5C87 Cuneo$cap
806,090,482 *53AFDDE8F1F5BEC8C29B5C794701E7674708B39A CU?nH
806,090,483 *53A9BD71E57A198DD2A4716303F5EA29CC989852 cunibos
806,090,484 *53A76CBF792E6E857ED0ED35684B797F5765EBC6 Cunipusa1
806,090,485 *53A7554620EC884B97EE261F0E153C3FEAADB31A [email protected]
806,090,486 *53A3E88BB63D7A6BD50120DB10EDB15FCE4CE3A3 cunnies2
806,090,487 *53A1AAEA67B0A6B1058EF869BB8741C9F9D769BA CUNNINGHAMPLAYER
806,090,488 *53A4927441026DF6A17993C3691054DC3045C702 cunninghams 4 0
806,090,489 *53AF91CB90CC82E6577D747991BB24296651DF45 [email protected]
806,090,490 *53A3D07E1DBC2EE0C22C07B1C40FE2ABBA629DCB CuNY(
806,090,491 *53A3069413DB1C0EAD25CD361D5FB814712E00FE Cu(_O
806,090,492 *53ADE370583618F8BB3E7662E8A995307B143B40 Cu),O
806,090,493 *53AC38CA3B47141C7CE09D5D01EEF27CB8204B08 C!UOj
806,090,494 *53AFA22FF38561BCED4F7EF9C003D25738B5D3DF C#uoP
806,090,495 *53A493A872679F8946E09FA9FB3A9A94FFF1010C CUoW
806,090,496 *53AEE21649B7FCFDCB5293DF2F424BB0D2038D0B cup-2nd
806,090,497 *53A82732ECBFEE0A7C3A9909405CD8CFD62DD7EF CUP-CUSTARD
806,090,498 *53AE4F15C0DD4DC0BCE2E9CA54063D258968EAC0 “Cupei
806,090,499 *53ABE0490FAD4C447F7568C785CB0DBCEEC062FA $CUP-&GT;SUPER::PRiNTTYPE();
806,090,500 *53ABD1D120ACA5839D552BEDF2DF70AFD2E4086A CUP&i
806,090,501 *53A986AAFC9E50F1863C8FF73AEA62AD296C5928 CUPIDS K Y UW1 P IH0 D Z
806,090,502 *53A31C87BBC127B81DD389E8078C193E70FD38E2 CUpjK
806,090,503 *53ABF4CA983CF992633DCD6DB2DABBE945F961BB Cuplebsw9
806,090,504 *53A873E926B62A84FDE81B57FF5356215D0F757F cupmästerskapet
806,090,505 *53A1032279C20DFBF17B9CBAD22FC9D36ABE279C cupolasquare
806,090,506 *53ADB8BEA3912E5DB4B63CE938A0511FC36E0018 cuprosing
806,090,507 *53AC703D761DEF53A5D3FCD840DC6DE7B8A70F1F cupsvenska
806,090,508 *53AC585AC688A536CDFD89C15A3F6DE44E8FC1E8 cuptalk1965
806,090,509 *53A206815DDD2EB5B38F5B32B94E088D7A8D185A [email protected]
806,090,510 *53A964EB423E5922C09028B673F81999F626F601 C%
806,090,511 *53A6F0D7C0A79A5E8D806FEB82243F3B235DCF71 Cu+Q-
806,090,512 *53AD50A4E6E7710A56C1E4AAF6BD6265E9D927AF Cuq"C
806,090,513 *53A751FD7093E393988F406441D2B93293A53FD7 CUQcf
806,090,514 *53A63B779405400147F33365EAB42391EB779476 CuQ_f
806,090,515 *53A6C7B3F98F3C69867A02B75903F8D1866AF13D CU(Qm
806,090,516 *53A6DEE86E2E89934E1EB3A9484FAD8555C5162F CU/Qq
806,090,517 *53A399B1FF2F466C845D28A645D5BFE0BA2ABA19 CU;qT
806,090,518 *53A0C5E9A6B10EA9DF10A28F187B9D68BDAE2A8D cuquismexico
806,090,519 *53A9F5F6E0E20521F28DCE1117E1664CB3956A06 C#UqV
806,090,520 *53A011B782FCD4BA4F8F83AFED0911F984C6489B C_uR?
806,090,521 *53A1880FCE7C530C9F08A2D16CF4DCBFCFA2FC85 C$uR_
806,090,522 *53A2829F912C06F910D3F6DC7283BB29D80C03C0 C+!uR
806,090,523 *53A6E2F435690E838635E52120A20EDC3E1C0503 Cu&&R
806,090,524 *53A6C4C02965417ED21CC13E43770AB5AA8878AF Cur+4il3d
806,090,525 *53A5ED762C31C81E3D7658E34197866BA63FA679 CURACNE®
806,090,526 *53A7574458B6110F5878B6FBFA9D12CF37083561 çuraeva
806,090,527 *53AAF4E4367DDBF45C7257D1F46C1AA5C0322775 curarisirter
806,090,528 *53AB247BD12ED380ACC8017D78D260B8EA17D427 Curatys3
806,090,529 *53AA83BCD1B8653C066B833487D6C5AA24D55FCC CURAVAMO
806,090,530 *53A9656069210119C50C5C7832B68F80B6986B0D curbing.
806,090,531 *53A6ABD7795E6091C0AEE94CB424EA87D14B2BA4 curbita1
806,090,532 *53ACA50D4E9CD3413A03876057D6D754B3E7A814 curching
806,090,533 *53A9074C243A3E7D451A8FAD7EF18173C7411D47 Curcirez3
806,090,534 *53AADC98B76648E3DA8F7A5DE31577E0A87CCAF4 CURDLYYLDRUC
806,090,535 *53A7CF421314AE407B553BDE3DBA68A446B970A1 CURE-LYME-DISEASE
806,090,536 *53A00005FA5996FE2163100B686FA0DF976EEE0B CURERETE4
806,090,537 *53ADF3834D009FEA6BDA79607F6D96B1D3ED18A3 curewater
806,090,538 *53AB100F770E76FFB1E57F5AD1FF03D479C01704 CURHK
806,090,539 *53AC57470414B122AFD0A270D2FC2BBDA5069236 curialis3
806,090,540 *53A4BE7DAAD3A26621633058F74B39F90016DEC3 curiosa66
806,090,541 *53A5E64DB10BE16030FF79A10DFD32B3FFF7E83C Curiosammo4
806,090,542 *53A6E5C9E377BBAF4545980835196E881B3BD275 [email protected]
806,090,543 *53AB115F1EFE63AE9DB64C686AA3C055B7BDEFC5 curious science (b)
806,090,544 *53A3EE0C6831427C06E8E6935A6C0B2A5076C128 CURISES7
806,090,545 *53A9E6D1DD9169F3B29809BD32B98B9513F244A6 CURIUSIT
806,090,546 *53AF87746254AA12123F7EA9144019D7D9259F51 CU=Rj
806,090,547 *53A61D3F56A09DC6CE85E367FB9A85A6665E1217 curjelund
806,090,548 *53A52E5F2298A5AD26F21671095E4426911F150D [email protected]
806,090,549 *53A3A93D627A996E24B69BD3D71B6EF5EB99CD23 Curling12
806,090,550 *53A97B7390E93543C9A0A9AE1A9213D150DDB7BE curlingwettbewerben
806,090,551 *53A6CD69432878D0EA9B3422A4314AF6919A5858 curlyfry1119
806,090,552 *53A2F47B16F95A6C94EACE5BF342663C316C8380 Curpeni
806,090,553 *53A0C95DC73885D457FA18DA70F2228E509E4025 Cu_RQ
806,090,554 *53A9DA53F5585DF92C71063ACF624FC893BB4D7E $curr[1],
806,090,555 *53A0A024BA56F89F6F4EDACE846A88E776872C30 current.
806,090,556 *53AD372F960724ADDBA847071AC35F45A80A6702 Currentbbing
806,090,557 *53ACC8446B2B85FB472309EB2AE9641EEE245DAC currentWFID
806,090,558 *53A67165F0ACB0A3F96228A6BED503B925C04C55 CUrrf
806,090,559 *53AC202FB8A301596ECC162285C6BC346276B66E [email protected]
806,090,560 *53AEC0B3289D09C32F6649B3D25D3244876B37C0 curriculua
806,090,561 *53AD20F1B0FCDE52FDB14E90E50B5863517B3270 currunt5
806,090,562 *53A2533AE8378693B0FDDC49569FACB09B2628C4 Curryboy6
806,090,563 *53A77D664CC2EAFD398D992121F2C8CF5E9E82F6 currynv6
806,090,564 *53AA05688B912D54922DC3708675A570E89758E7 cursasse1
806,090,565 *53A04AF5BD149A238F2BBF28C566FE053710A85A cursedtolive
806,090,566 *53ACE882B60CC1C0CEEED8943123D64CE8D7C83E [email protected]
806,090,567 *53A829C67EF55EAB3C1F83FB943A2FFC41D1E443 cursorgoutput
806,090,568 *53A9F14DACD4B382F8072566F7CFE3266F7CE088 curtailments.comcurtailments
806,090,569 *53AA73355722EFE86A501AD9309C1A0A80A6425D [email protected]
806,090,570 *53AF85F8CAC1272E176EC5D56176545A399A12F2 curt.ariaza
806,090,571 *53ADC62241C9C412075085D717F981B2721E98A6 Curtation7
806,090,572 *53A618F8ED153598EBC2650660E0AD65B5522B6D curt.barnas
806,090,573 *53A607D31CF390BEFA33B577C94652D4CB43F299 curt.beauchemin
806,090,574 *53ACDA1C4753D203B52223A8F4C87F6E1C910F74 curt.bishop
806,090,575 *53A914610947D69DB94731F00798DCA2CEEF4D25 curt.degon
806,090,576 *53A184722C4BBC3D3FCC666A8F44560D16D378DE curtensi8
806,090,577 *53AD04F07203F8E88E75DDEC5BA2B21A48C842C2 curt.fosnough
806,090,578 *53A11EDE1902ADA67CEB549B4974C46EF0969515 curt.freiser
806,090,579 *53AAE9E4B45A7E1BF25AB1A5CEE6E2019AD6C18B curt.gerbi
806,090,580 *53A50C239CD919D969DF585EEACC67B97C6DD551 curt.gorz
806,090,581 *53AD2A52C00F476FB7E72E8EBD0E76DAEB93F9C2 curt.graci
806,090,582 *53AF4A2F526F208908A148A646C7504E088CD2A5 curt.halt
806,090,583 *53AE3AC4903683F0AB4EA9439B081D8906EC9ADB curt.heiliger
806,090,584 *53A4D0AC151EB1156A3C435781E41E0D75EC8132 curt.heller
806,090,585 *53A68373D524B928F50C83CB5789A775BAA6A54D curt.hempel
806,090,586 *53AB6642F848CC48BC14EC7BFB8CD1C45F6E6A4B curt.hidinger
806,090,587 *53AB505AD58EF3BA02CE4251341AFA2A7794A54E curt.horwath
806,090,588 *53ACE0EB30E572AF4433540B9AA7E0ED2580D550 curtis.apodaca
806,090,589 *53A725A755F80A765E30D507D9A0433542ED35B7 curtis.balcer
806,090,590 *53A82B0B98A6F4FCDC6890FE9F6963040922543B curtis.bellusci
806,090,591 *53A739046EF7CB561BB3B9A574F4FEBC17A7E947 curtis.chisley
806,090,592 *53A7C4E15644164C09637D71394839688671952F curtis.gome
806,090,593 *53A3C70CAEF024ECBC1C993839361B44F06AA12A curtis.hargens
806,090,594 *53A124C4118147ED961CAEB2C159F7FC8DBC3A88 curtis.herscher
806,090,595 *53AC3BB08ADABC9FA19FD1198F0397701E0D341F curtis.igtanloc
806,090,596 *53A6853E770C87CDF7E3327F97620DE2DFE677ED curtis.longabaugh
806,090,597 *53AF7017A409EACE5001C9B546A4612F58840756 curtis.maslow
806,090,598 *53A64C8EA16A0309C7F22C0ED34ACA76EC919400 curtis.mielcarz
806,090,599 *53A746EF441512389C40F6791A97B46913896923 curtis.muhlestein
806,090,600 *53A395046567369AC2850EE0E5B37B5A94B9118F curtis.murrell
806,090,601 *53A0F89C7894B5D1270B325037458587F628A5DC curtis.ralon
806,090,602 *53AEC7E461B9D68E76A222C96A9D72CC17C347FF curtis.regnier
806,090,603 *53A73AD475AAEA83C6AE58CDC581A017136B8BBE curtis.riches
806,090,604 *53A6DC654C2C34409A516F75C27EA6163A3C8801 curtis.sirhan
806,090,605 *53A3C2B43D35EC9A44A1744FC4C17F9243406CA8 curtis.troccoli
806,090,606 *53AE5D005C9F09D98264190594CAB8ED77D0EC6D curtis.wings
806,090,607 *53A8A8B05F61A7A7CE662299DCC20792C050C02D curtis.wipperfurth
806,090,608 *53A51A9A4C7906F66E44E6CA59416996FD3B675E curt.kalil
806,090,609 *53A986034A4E5782AA82E136F92605E849A40EAB curt.mccure
806,090,610 *53AABE9B28FBCB728A556442EEE2D943049ECA70 curt.morning
806,090,611 *53A824D469BA05105C3CDDC4519F75B3A2AAACC4 curt.otsman
806,090,612 *53AB6DD22912FF11E0BAE32E28A18DC7C0E4F054 curt.rasual
806,090,613 *53A68C249DB8491CFBA748B1D778FFF3A46C5B1B curt.reeve
806,090,614 *53A1E3EDEBEAFD7C78B33244EEFFB0E1968F09C2 curt.rufino
806,090,615 *53A8283500DD56B7799BEF09B7668D9C0A0AAB0E curt.satiago
806,090,616 *53A3D12BD1A960D39ADBE896345D9158A711EDB3 curt.shahim
806,090,617 *53A7C29CAFF0658402F8E406C22D46D88D9E7E86 curt.toye
806,090,618 *53A1BE95A15494AA4D1409F4975746AB33EECEAF çürütsün
806,090,619 *53AE8333EEAC6F6DCFA3485030ED1EBC20A68A74 CuruX
806,090,620 *53A1814F95DC979B2023130AB2FDAA7A2376D8A1 curvatives
806,090,621 *53ABA0D5FE2145F7E2D5A76D4F249B9C1C8D15C3 Curveball8
806,090,622 *53AE06A572408592813E8AF3D5E84DD89B6FB6A2 CURVELO
806,090,623 *53A8FEBA39CD622528B40B91294CFC6B910B14E2 [email protected]
806,090,624 *53A6456D010A08E71214BA1DBE9DDA7198EF9259 CuRy
806,090,625 *53AF266F15E07FF6FCB17EBE4B0FD620F3782A93 C(u?S
806,090,626 *53A2BD654036D80513E00D75C6A511C37AFC079B Cus0j
806,090,627 *53A05988F4D859CB1BE9901740516D8AE38191CC Cus
806,090,628 *53A261DDB0C6D9BA16826DD32ADC313A45C06DA9 Cu:SA
806,090,629 *53AC85A3ED886DFF856085E4FA6838A6D0EE23B5 cusatelli1234
806,090,630 *53A783B136478AD9AA6D256ED62ABABAF2278269 Cuscohyrgrin
806,090,631 *53A3C12E66AF6E31871CD8C68F204AEE1338113C Cusconine1
806,090,632 *53ADE66B3F31FD810B5533B1C8AA372A2E3ADDB7 CUS"d
806,090,633 *53A9C603E0443D31198C44C9C1ED13D9424FBC17 CUsD4
806,090,634 *53AEBF9215655E8F6893545BE57B8B5A9D6A2BAE Cu&SG
806,090,635 *53A3C164B9A94A643290194289BA111F91F99D9B Cushibsws
806,090,636 *53A2D7ADCB7B5D9E0A4B750A758D7C5A2A6A0F68 Cuşnuir
806,090,637 *53A64D7B65379EAA65EB95D5E6814AB86A6198D7
806,090,638 *53AF9A900F8D3B4EC8B731CF2B0F8CBC2209E9A1 cussons4
806,090,639 *53AD098085FCB36AE10AE35DB5E06E47B2D75324 Cussynge5
806,090,640 *53A4EE4BC3B09133CB2A03AFCC31CB06A23D9DD2 CUSTAR!
806,090,641 *53A9A8B51C9AB65BBF4ED8B080081A67D0A22947 Custeamos9
806,090,642 *53AA474362365E24EB90ECE1D2F6A5B243F1E636 customersvice
806,090,643 *53AEA05AF5366761428D5C5EB008F09CDC0E64D0 Custom work
806,090,644 *53A7B778FD5DB5C917E7EBF331C7ECFD070A9C56 custured
806,090,645 *53A5AD89FCD81186DD19CBF8C390FCCCCDB23FC3 custy80
806,090,646 *53A09415B515CC76AE6029C7B6B3A51A5E092D69 CUsX1
806,090,647 *53A8A365B190E9538C0322E1B90472DFF4FE5E3E cusxn
806,090,648 *53A84D937A2243C95BF4F86559D47DD372DB7849 C%Ut=
806,090,649 *53A04ABCE7AF466F967B36FB5CABF5B11CD41504 Cut3o
806,090,650 *53AC07E35CBAC591BD2DFEBF04260B2BCCDFBB59 CuT5r
806,090,651 *53A2749013CF910EB311BB8010B6C3C27016047A C?Ut6
806,090,652 *53AABA290511A4B9B9C469F5E6F4F1184AFE9DEC CUtA/
806,090,653 *53AF9CBD0113D86BC9D69B230F2B3D303A2642E2 Cutcj
806,090,654 *53A777BDF74AEA7C8652DBFAE19EED353E3DF38B CUTEBUTEVIL555
806,090,655 *53A3B173ED747DA986EE786E1792DCD640950C1B Cutechicked
806,090,656 *53A791060228F2678310B79C1228884C068E6C7B CUTEKOH24
806,090,657 *53A0F3F9B584BED17602950A10D0D4689E1EED6C CUTELILDRUMMER57
806,090,658 *53A45E6466FCEDC1E85208156F33F694630D9B2C CUTERONS4
806,090,659 *53AB6AFB3AEF7B9554E1B59AEE79C192111BE44E CUTESK8R
806,090,660 *53A62E140CFC89792FF111063DB6AA6BC5FEF087 CUt%F
806,090,661 *53A0C43B1753145AA784F94DDD3A661F8D4D01F0 Cutiadap7
806,090,662 *53A29701ACFCB399BA49671BADAFD4DE563A40C6 CUTIEBOO0
806,090,663 *53AC432682ED93CA57C1DD636EAC45B92BFFF6F7 CUTIECHRISTIE4U
806,090,664 *53A03AB7004F55E4BE83B69103B3D8DDCC0FEA2E cutiecolombian16
806,090,665 *53AAEC86AF3652113D6F14769C830A273B3978D2 Cutiekhan6
806,090,666 *53A8ACDB74B93C199E55494CC6431EC2310400AF Cutieopen6
806,090,667 *53A6BB32D8F629C187898B2D510B79DC6ADA71C7 Cutitfine2
806,090,668 *53AD20E63A134292E2F1D593D4834B36BCC10DE3 Cutleave9
806,090,669 *53AC3CAD1F2EDC1C9072398C85E17598A6852B87 Cutleted2
806,090,670 *53A8C559711149F9EF6442E32A3D2B0636225C1C CutoF
806,090,671 *53A7BCF68B3BBCAC9638D5BD291D877C1DBB381A cutoffmydick
806,090,672 *53A79746369E7FE7735A922CC96DE9E732DE82BF CUTONET
806,090,673 *53AFCFBD705DBE291C19056C72EBE4DED0E8D697 cutronis
806,090,674 *53A370AF5327E94A6B04C1CB758F775217565846 CuT"s
806,090,675 *53ACA3522862C101E5C44460547CF9418882B8DA [email protected]
806,090,676 *53AEAAEC692016088A7599020DF0C028CCFC9779 cut-sleeved
806,090,677 *53AD3D246491D3094381C5F6031A164CA3BE977B cuttingedgepr
806,090,678 *53A32D2DB3F3C6E4ABD5434E21BFBF5FE302180D Cutwd
806,090,679 *53A9139645E51977DE250ED71C2CA0ADA77853D1 [email protected]
806,090,680 *53AFCD08CFBF35CB3470C007BC441B6EE17BA4D9 C.UuD
806,090,681 *53A9EC1662B1D2E8AF5AD0771A8CFE85B048DB2E CUuE1
806,090,682 *53A037449175BBE8DB650D62BE559D431EB1F4FC CuU#H
806,090,683 *53A270245082F9C617BD906B71EF40AC015FE48F CUuN.
806,090,684 *53AEEA26EE366F333C19414830DCC7FDB550B719 CUUNU
806,090,685 *53A497FD547E06C01BB0A372F8276715D7D8D45D CuuQl
806,090,686 *53A46934E42122C2743E5CA8851D1441EDB4AB2F Cuu"s
806,090,687 *53ABC537977D210B61DAE59639FAF2F24E2534C3 CUut.
806,090,688 *53A686A62711B37B6FC24850646956BFE6DF958B cuutemplate.nn
806,090,689 *53A50A863BA665235E5DEE3429EAD06BC140ED01 Cuuun
806,090,690 *53AAFCE1546BDEA468813DF6E3CFF29299AD331F C_U(V
806,090,691 *53A126A8D6555F5C35938247BB5BE6A22B3491CB CU!#v
806,090,692 *53A031A3007F6AEE83E3CE321F45C365B7397B91 C:uv!
806,090,693 *53A81F2F6C4DE1E72B67F192B8B0B1F2A77A9397 Cuv.
806,090,694 *53A18226B55F0D7629189244ABF940690CA4873D CUv9Q
806,090,695 *53A64160EB7ED1E7C3405FA50E12971F959A585E CUvA)
806,090,696 *53A70EA33D3408C726F57E3E7A9C510DDDA8D872 CUv)c
806,090,697 *53A583ADA1C826DDDCA30158AE1F21D0AA043884 C_UVd
806,090,698 *53A7A3C3D789254105A188E8D5D50D139D820705 Cuveishic
806,090,699 *53AA00A60A0E95925098360A3A7F9EF6A298C65D Cuverly1
806,090,700 *53A35A1B34976C029051D8808ED4743D0689884F cuvieri5
806,090,701 *53A35B4554EFE086FEEB2AF9A11EBCAF10E5E9FF CUVK(
806,090,702 *53A768D34CA37EA40A6A201DB8BBAABEB2E486F7 CUvK.
806,090,703 *53A44885CA0E5B46A03BE5D578B02413B7DC2CA2 CUVm/
806,090,704 *53AF65A0256BEA2F990DA0B5E2046894A9FDDA48 CuVQl
806,090,705 *53AFACC582AC78915E32FEE0B57728FD4F3BDC9D CUVr0
806,090,706 *53AB024B634CF9FF6756839B8BD662E41B814A4F C!uW$
806,090,707 *53AF8060DDE68993E0A475FF3118C546F9ACD130 CU,wO
806,090,708 *53AB2D9509ED64E3446CF87B759B653D99E760B1 CUwP-
806,090,709 *53ABA083D29004989ABDBCD74ACDB7DAA9ABB66B CuWTr
806,090,710 *53A8115D79782296F1D62FB6DD9025821C284A93 C#UWV
806,090,711 *53A2BFC1FBC12ECA61736DC1AB4518A4E9A9C7C3 Cu_!X
806,090,712 *53A486109AA3EDC1DA3585BACE6D0AA660640D50 CuX9h
806,090,713 *53AB437AE39125D863B97A8FA596BC5483839EA9 CuXK!
806,090,714 *53A55EDAE752889BEBED2147907087DF3996B42B CuXM8
806,090,715 *53A7541AE12CFCD7774BEF722D23957E8D52BDAA CUXo!
806,090,716 *53AACD84AF1BC136E8CAEB4ED60C500A71E0E0A1 CUXsU
806,090,717 *53A3160EAC80FD3379200AC349BB329D48B3F5B9 CUY4A
806,090,718 *53A66216B6AE599F2B9CE2C5DEE6B2CF03534112 CUY8V
806,090,719 *53ACB1E9F16CB07744DC5290640FEAF89997ACE6 CuYHY
806,090,720 *53A0D15B7AE5AC604D1758869057AB56183BF412 CuYn7
806,090,721 *53A2DCFBD50D3B3BC707C329E66FA55BE38EB1F9 CU!Z0
806,090,722 *53ACB790F8AA612B7DE9E1340D1140510C782C72 cuzdwbs1
806,090,723 *53A6933CBCE287A5228166E653E3625283E3527A Cuzinho7
806,090,724 *53A50C62F8CED317E64858EC5C95477A2169466D CUZ"k
806,090,725 *53A94C640AF30AFB58F12F14ECC9F4916C53B7C5 CU-Zl
806,090,726 *53A241B9167EB648F0158E75B45BE1EC18DE6C2D [email protected]
806,090,727 *53AEAD22601AA0EDE9E26DD66D791519697C7F17 Cuzrapjm8
806,090,728 *53A872BB9A1CCEE09BF3238157AB799994AE80E4 Cuzretaw1
806,090,729 *53A747EEF763DD6C05FF6F946171D9CEC4708E41 CUZ-U
806,090,730 *53A80847FDB4DFDDB8E81DF3731F05F7A1481964 Cuzzone5
806,090,731 *53A355BB83F981C0D82D025F3B68CFC0DF112C3E C_$V;
806,090,732 *53A95BD2372F8F6897E81A5728BAFA51A22635CF C,V&.
806,090,733 *53AF139A276CB594BB3B342A97CEEA67A8DE83BA C?&
806,090,734 *53A7124CD1FFBDD08698C3666FA1846B718E3141 C/:V=
806,090,735 *53A233B0B3863931E8766AD0B45527BA8574D036 C/
806,090,736 *53AF0FB8BD5960ABC97678F088696FB23C130EFB C)V?+
806,090,737 *53AE6B0EA2A115095748983CE85942B761C10CD6 C%?V;
806,090,738 *53AEA2DB4A6D1CDDF4A5E19701BC08A9BBA820EF C-?/v
806,090,739 *53A7F2C6868BF6C573599E3FD05DBC839FC28F01 C-
806,090,740 *53A684D3C34C8DCB0D35B28DB0A7B9E0C134D4AE C,,v&
806,090,741 *53AC4C2AE4E12101089088B33907BE6D27DAAA16 C\v)
806,090,742 *53A0B1AB399A00C11AF55D2BC4C04F3C532F9C06 C%=v!
806,090,743 *53AFD159DC3FA631EA009D24FC59BABE999EDB0A Cv,?)
806,090,744 *53A0C04DF7CC63BCC901005318C1977A47FC1AD2 Cv!
806,090,745 *53A60129DD4C379A17FD90781E91AF10EBF1E961 ひろこ):(cv)あきねぇ
806,090,746 *53AEC7DAC8B5A4296BB85FE1109AEA57C6D631F5 CV:/0
806,090,747 *53A6177D653DC2029B127F8C8D603FAA70A0AAAC CV0..
806,090,748 *53A1F0A5088237455939E6BD1516FC579A96340B [email protected]
806,090,749 *53A612493F21021BF1A475F7ADD76CD831B9AA56 C;v0i
806,090,750 *53AF68913B9E87C8BA59A815F80147BD91524F9F C!v0O
806,090,751 *53A2640DF4F74C96839C8EA9E38CF5CAD651D0DD C_
806,090,752 *53A852F2AFDBE6CC302228DA9FCB6DA71F3C3B3E Cv%&1
806,090,753 *53A6E2ABE17AC3D6A90932CF41E5633B6BA40B47 CV1Ku
806,090,754 *53A5F6CACF93E6BFD317340CE6497AC68066C8BC CV2&/
806,090,755 *53A5EBE81A3058D14AA1D479A784210D6508CA7A CV$22
806,090,756 *53A2C3EC823D0D20FC14B77F60A51658D74A3FC8 C;V2n
806,090,757 *53A520779FBA5461E4793B4221600800780233C4 Cv2qS
806,090,758 *53A2D42464BF16B664D1913FF379CDACFD186870 Cv2Y&
806,090,759 *53A7E84F32902CF09918E942C58C2FBC00F6A810 CV
806,090,760 *53A26AAD252164774C50D284A370556944A7C3BA Cv3!?
806,090,761 *53A8BD63F7281303F52347F2771DA9617AEFF1C2 Cv3(1
806,090,762 *53AC7DE7D8E7B656251504E657E26D63921A3A4B Cv3,9
806,090,763 *53A313FD498370E928298C8963806855385E6229 CV3&b
806,090,764 *53ABD037BD5B0F3C81C011347FA648DC8439CC96 Cv-3b
806,090,765 *53A71382FB2ADCE223A50210B87935D06DAEF97C Cv/3c
806,090,766 *53A01969CFB242467C96143D299936E4A0D5CC74 cv3g0ydxhjgsr03t
806,090,767 *53ACC1C57A41370F7909C2218668BC4C7253620C C.v3N
806,090,768 *53AF11AB125ABF4F03F278A832C06859F1A547C8 C(V,4
806,090,769 *53A0F5D3DFBC705A7400E05D7DE72901B8865AE9 CV+4!
806,090,770 *53AF148E5459FD60C3AFC38B474B3DF799B46867 CV41S
806,090,771 *53A568CBDC7168ADBD620842793EECDE457489A5 Cv48P
806,090,772 *53A57610B9DAA3559DD546549DD09C8607F30D13 Cv#4P
806,090,773 *53A2F90020F9178F100FFA4CACECBA8ADB144191 C$V4S
806,090,774 *53AF8B0D28B295CBD1557EC0FC97EA23CE27F7D3 Cv+4t
806,090,775 *53AB6546CE5E76093B4DBAC6FD370B2030251951 C;
806,090,776 *53A715552042168BA7C6DFC9853A71BCCE237597 cv54kkud
806,090,777 *53A65B84E4DB50BD434903E46A72D913E77023E0 Cv56.
806,090,778 *53AA9F75D404D07E8D30E7AFA91D44A73524EA52 CV59I
806,090,779 *53AC43D33A4B6AD02DCDC5D0C85BD7F0A20B404F CV5Aj
806,090,780 *53A036E2E8E4EEA9D1446BE127B4FA381E535C3B Cv5#k
806,090,781 *53A402B3CCEE9CD507118886DE36BCC70D7F9FE6 Cv5ko
806,090,782 *53A012626CDAC2F60BFA9E504198C93C5774D5FA CV5NU
806,090,783 *53A49129B186EC7FB2AD4F02DC5A322805665196 Cv5Uq
806,090,784 *53A3DEC4972C543A4A6DF30C05BFA43A3BA1807F CV6%6
806,090,785 *53AC969A35287E0FB73E7E28A516664B12FBB139 CV6gB
806,090,786 *53A8CBE7D4FE5FCCBDF1DCD3407F0FEF1F2E24B2 CV6vw
806,090,787 *53A2406BF94707187592E4CDAA626A838B9EC0F9 C+)V7
806,090,788 *53ACC83EF96A5B53749E84055A54F76378455DE0 CV74(
806,090,789 *53A2EDD6CA0386C6F8A14538755EEB9118849F41 Cv7AN
806,090,790 *53AF376D9D0EE896B7F2246EFF1ACD074EE23C2E Cv7-E
806,090,791 *53A643826E39B280A83D0F73BCABDEE34DB9DE79 C_v7t
806,090,792 *53AD1893EBF94EDF03E0F129B622A86B14C856CD CV7T3
806,090,793 *53A982995D8467D2CD0EA96D975706087E5B7825 Cv%7v
806,090,794 *53A538C1D3264BB821135C8AA5CD17C577E5A1B7 C&-V8
806,090,795 *53ABAAD449B89FB56A667BB11896B0E6F2195C7B CV_8+
806,090,796 *53A4BDB7944BF253B3E509F651BC30C3D22739E3 Cv829
806,090,797 *53AF3FCBE842084F94290C3A5ABEA73794E925C7 CV86n
806,090,798 *53AACD8200450B4F6EFEF91C0969E9B71D483390 Cv;87
806,090,799 *53A08A45E2B72CA2D337EDE564D4829684F7FDD0 CV88=
806,090,800 *53A274039E05FA3DCCC2353669C89F967600EDD2 Cv8B.
806,090,801 *53AF9227910DE56F31197A1B7929A5E95D368054 C;v9,
806,090,802 *53A21D8B91F6FFC75676489578A89C9019CB8D90 C:v9.
806,090,803 *53A72983809571AE553737985B5D0C297E69D367 Cv9eU
806,090,804 *53A4188230F0F98E59CD627B9924FB40F1D9AB2A C,v9h
806,090,805 *53ADBE79EC63B4499D4580A17C69DAA5D3224B62 Cv,9m
806,090,806 *53AD111C957067BEC183DF6E97C9829FEE282531 C?V9O
806,090,807 *53A8AC84B9DF57762BE59290824DF16BA43890B3 CV9rG
806,090,808 *53AB6D0EAA05B269D30E374AE2FA84A70B783E15 Cv9vT
806,090,809 *53AA554763914A2CF5F54F1C35DC420698CBA698 >cvaaa
806,090,810 *53A949E1AD62166C57DB152152007E3F7E1EDB6D CVAf6
806,090,811 *53AEFECB84C6715C645C9A7B262E847D33093D28 cvailcqb
806,090,812 *53AD6A34CAC411A51C4B10096CD1BB18FE033F0D cvajwlxl5
806,090,813 *53A2F26A053E684339E9A5C725641B50575E14C8 CvA
806,090,814 *53A3CE66E983396AA62D77279CAFDA9EF8E3629B CVaob
806,090,815 *53AA16991FC85138F0F7953D2050E82EC0FB7BD0 cvaql
806,090,816 *53A6276AE314B9B88006A9FF36C691277B275088 [email protected]
806,090,817 *53A7215B81E11D01AE1AE0E8C2289D38425BC44F Cvatk
806,090,818 *53A50E809062C23FA19903F7F38BA0C89E0E4EFF CV,Aw
806,090,819 *53A774669CA535B34F20B694A241A772843F246A C=(Vb
806,090,820 *53A13B7510C5592A7D0750ABA133B5267D9220B4 CV=$b
806,090,821 *53A988C53FFB1D9E134AE7217894E80A8FCD7C8C C+
806,090,822 *53ACFC5FC85E48B56CA49346AC2D3F8ABC1856B1 c#Vb
806,090,823 *53A59FED067FD56AB06054447EA245BF1ECC6C9B CV-BASED
806,090,824 *53AF3A89BCF0DCF9BE4BABAA1F95168EE3766613 CvBg/
806,090,825 *53AF78284CF33FEBF1C16D230EEDB9C6FA8DDCC3 CvbKH
806,090,826 *53A0613ABEC5DF0AC20C33BD2FED267C0A46FF4D Cvbl5
806,090,827 *53A6E1215EEFF9DB83A9083BE947CC0DC9E8B07C CvbQL
806,090,828 *53A5CD012901F968F54AD28A9E74DC6A81604B8D C/vc=
806,090,829 *53A3C083EF6559D37ED9292163F07C5CB737A959 CVC0#
806,090,830 *53A36C6541FD0A18ECCC13EA6CD593582B7F548F C.Vc5
806,090,831 *53A46C8E6961EA50F73F1013C29A9808F1B8CB80 Cv$c6
806,090,832 *53A008A642BFD4685F72F98D7A05C4236B75135E cvc6="international_news/article/2007/11/10/wmailer210xml|
806,090,833 *53A11B76AA8DFD8188CD32435939A9FF2F020AEB [email protected]
806,090,834 *53A1B6C5F52AAAC93257FDE095693E038E5F7F00 CvCbB
806,090,835 *53A3AC264B6BB96F67419D5D81FFD343667D8C0B CVCdD
806,090,836 *53A751858E63EC32CFA73A9391B0B89BDE0BA8C7 CVC-g
806,090,837 *53AD1BDFCADD1608AA617B75A306B7B9DDC3EA99 C(vCg
806,090,838 *53A68FB2C7A6EADB754510309B3EAD5204E77B6D CvCKK
806,090,839 *53AB9BC6FC39381BFADD454143B350AB728D6C23 CvcPG
806,090,840 *53ADE2A3157F513272CBBBBB3E6AB225BC49ED01 C?VCq
806,090,841 *53A76E69D9BDA923ED8815E99D2711E4AAFABD7C [email protected]
806,090,842 *53A1670CA61B4F10F68F5FB75C6FF2CA6A8B561D cvcva-19
806,090,843 *53A221DA4CD02CA5AE0EDB1FBBA468C4FEC07391 CV#CX
806,090,844 *53A98139B1391633AC7C9FAB81E095795CC35D70 CvC/Y
806,090,845 *53AB4D2751C5EA49B201FCD22A16EFF01CE696B0 CVCY8
806,090,846 *53A31EC729AF1DFDBA010B33C8A9776C2E1FAFF3 Cvd)$
806,090,847 *53A4FEC7B0565A7EE84131C643DC22EF6F1542AD CvD6a
806,090,848 *53AD8EA83853E713BE2E916A5C5442EF47FEA5A7 CvD6H
806,090,849 *53A799F2B5FC3615F202864181A0B7E99EAA6829 Cv%D9
806,090,850 *53A4C45A5282A116F684A7F1D2A9C2A6B5D02491 CvDdT
806,090,851 *53AD7D31828BE9FFA63F4D201497CC60C2A47AB5 Cv=dF
806,090,852 *53AC8AB9E929D7049FA72FBF4F8FFECC6766F4CF CVD
806,090,853 *53A0EF9CC58C822A9C2406C8ADE3436A18D39689 CVdjr
806,090,854 *53AA9E91E4E7B82940007D4FBAF772C7D9CDA146 C
806,090,855 *53AE497049AB74F97E9A57C54E6BB397A12BBD1D Cv/dn
806,090,856 *53AC36C0E0B61B3D50FF348F24AF0E40E9D1F2F9 CVD+t
806,090,857 *53A70A0B056FC89D7B0E2D9931C6EC8BC6E53CC2 CVDTp
806,090,858 *53A3F8E72D1EE56C0153C5E03C7979293A03EBC2 C,VDu
806,090,859 *53AA8EFBCD19141D9D872DC91525352D10E0F593 CVDXB
806,090,860 *53A17A8D4120596BE1E00814F26620B582430B9D CvE,&
806,090,861 *53ABBFA32DFB58C04CE7FFFE8468B778018AA815 [email protected]@70R
806,090,862 *53AAD38B44F361E281E4277A3F1AE42FECA25356 C#VEb
806,090,863 *53A1567659B14DF9824DCD9E462387F849DE6548 Cve=j
806,090,864 *53AE4A47BE32D403E1058473809AA5B2D2420314 cvekcvek
806,090,865 *53ACB1531C9CA018A6A3E84237C165F1EEFE84F6 CV!EN
806,090,866 *53A0185CE3A4E78F63C5307E67BC21C75EB52391 CV,Eo
806,090,867 *53AC3CA98CE14D49E28642457D9F65058F85B019 Cve&q
806,090,868 *53A4B928A859DB3D6DFB61938D5E722D6E4A03DA C).VF
806,090,869 *53A66EBCB9AFAFA3CB64D32E7F2E95459035D88A CV;_F
806,090,870 *53AA10433179D57966B0D16F0FCCF3451D89990D CV/;f
806,090,871 *53A3FA037AFC08DA78F3E9A597990C038230AD25 Cv%?F
806,090,872 *53AE4EF6CCF406974D341A3F3A3E30ED6FD30554 Cv_f$
806,090,873 *53ABB28059B44387271EF0A237E78E143FCA6949 cV,F
806,090,874 *53A1341795FD54D1152AD55D4CB3F3304BB46901 CVf5l
806,090,875 *53AB6AB16624450A5F4B496F68550303A7585B22 CVFn/
806,090,876 *53A46DB0858569126ADDF3C1F6A852089C96B6FC C
806,090,877 *53A0DF1CADAC80E99612933AF1191B9E6B24E240 Cvfr.
806,090,878 *53A1CDC54234BB6CCC2CAAD84B9B7E56E20AD884 C.vFu
806,090,879 *53AAA3485450839D1444B353B60217160B2AFDD7 CVFZd
806,090,880 *53A2C2F020D7968C0A9859903672402A10F9A6F4 CV/,G
806,090,881 *53AF459F9D2B024F5C979350B8E4F014730E246A CV!_g
806,090,882 *53AD586B653BDA3B8B7BE560C8002171B95EDDFB CVg_
806,090,883 *53AA728EC8B6E7329FD1E1D17AC6F5AC78C81D7D CVg/)
806,090,884 *53AEF9F80A25BA45BF7C57240C9FFCBD9BBDA09B CVg6-
806,090,885 *53AAC821A7A70F1390206782F1F21D1CFF4BAC65 Cvg%8
806,090,886 *53A559540CFAF8A087A79644639552E72588EE5C CVGg%
806,090,887 *53A81B9C343E466E29B9C578707AF3A61524DD31 Cv
806,090,888 *53A303DE76CC4C673A5FC7357E1954CD62D4345F CVGH:
806,090,889 *53AB04F15D519CF4AA6A1AFC65225CE8FF73F24D [email protected]
806,090,890 *53A46379E1BFDCAAB9D734ACB837FB4A5EA14BA9 CVgl;
806,090,891 *53A8100FD1597FDF334BDBBC8370F18CBC203ADA CVg=o
806,090,892 *53A20A0A928FA0E25DC46E42B9AAE7AE0048923B CVgqv
806,090,893 *53A758861525A7AAE5E1C442E26B1C059484AD2F cvgs1234
806,090,894 *53A98524BF57975C3025D6450A640379BA1CCA59 CVGWY
806,090,895 *53A5ADA29C1A61D7F5523393CC04601315D2938E CVGXD
806,090,896 *53A21C09439C2C2028D43C41091F7011474E4AAC C#Vh
806,090,897 *53ABD2716592BDE1A0E885F407154C9E288523E4 Cv/
806,090,898 *53A92586FBAF29ACBC49DD961C5CA0104F0A4CD6 CVh1#
806,090,899 *53AA967E8856B2FD7DAC2498CA51F57E8C4FDACA CvH!a
806,090,900 *53A2ACD96EF3A998CC6817B67EAA2CF27FB4A844 CVharles
806,090,901 *53A2B904F713BD58C870DC36AA535EC46851C778 cvhay
806,090,902 *53A526799443B95E7AD3EA0ECED947A45C559464 Cv,hc
806,090,903 *53A25A6FCF130C203720F7B5BC52423315356A1F C/vHE
806,090,904 *53ABD6CD2C6B08F7D42DB130CCAF27AAFFABCDD3 Cvh;h
806,090,905 *53AD161A4E10B5C545D0A054D243F8132D9ED349 Cvhii
806,090,906 *53ACFDAA9B8920F522C00267E644262BE0B25BA0 CVhlT
806,090,907 *53ABA0315E97A5C7F322907E310917580EDECACC Cvh;o
806,090,908 *53AF0392D8752280CB8D890588C04F7D1E226E21 C!VhP
806,090,909 *53ADA671CF8231A187B9748EB575D51D3CC9CC43 CVhSm
806,090,910 *53A8E3E4D216E126AC358656E593363099E7FBDE C?Vi/
806,090,911 *53A87F710A5FB71CB70D479031A2F42230D0BBB3 C:vI#
806,090,912 *53AD41760F7CB559E41106654148437248458787 Cv=I2
806,090,913 *53A296D1011BFCC04B36F487F8F72FEF33CCE5DB CVi2C
806,090,914 *53A17BC9867298982E232BA3DC16947898F99659 Cvi7-
806,090,915 *53A747A921BFE4498C0CB3000B40AF6CA09884AB C?VIb
806,090,916 *53A46B42DE8EB87BE2F69AF24D77F8942DB88B3A cvienmi2
806,090,917 *53A2E8A78FD5EAB85CF5366973DB16860360AAED Cvienmi3
806,090,918 *53AFEC93E62FC97501611F3446F920F56A0725A7 [email protected][email protected]+es
806,090,919 *53AB69DE2D51B5D3923E1629808A85994B33CB2B CVIHf
806,090,920 *53AFB803FB473F32B1488820BB6492340B983F7F CvIKF
806,090,921 *53AA9725FD3B927D7A46D86FB67711F0D04875F2 Cviof
806,090,922 *53ACC9FA0BD67B2238BE1C809E9D5EFBE12007E2 CVIQ)
806,090,923 *53A68B791A84AF87A67D29D0B2B97032F3D8C72C [email protected]
806,090,924 *53AD3F7100705FC5BF8F289C8389D70C5FD4034C CvItN
806,090,925 *53AD5187E46043EC3096101E9C2EB3DD7824D4F7 CV;j"
806,090,926 *53A4E99A4E48EF058511436521CB316DB376E2E0 CV.j)
806,090,927 *53A20AC27748C40BB24C4BFB1D0D247AB26D5069 C&vjc
806,090,928 *53AA3ECBF4BCEEEE730317B80114920FA279487B Cv,jv
806,090,929 *53A4F813D1187D8DD5033B5D8EE6A0423F0D81EB CvK?=
806,090,930 *53AF62A4408B763B5B06C5D129245AC4FA702E4D CV$K0
806,090,931 *53ACF50F29BC215E85771781B64162D37C8B7FF2 CVK!D
806,090,932 *53AD68CDB5308F0B6FB53C6C26969BB8C4D732A6 C#vKo
806,090,933 *53A01A48A7C3704B82E4E82890C81270B86B4A1C CvkpY
806,090,934 *53AF1374F48577DCDF218CD3E3CD4F6369CBD758 CvK-R
806,090,935 *53AF6362A9B62DEEB24F63797E4E4C33A4DD2C85 CVK?v
806,090,936 *53AC497AA78BE43A29589CB6ED8CB6223B8674B7 C$vL6
806,090,937 *53A93ABD85037DAD6967F916D160804FFC99C357 C&VL7
806,090,938 *53A6E745EDFDD49BD4D81876297264209FB4784F Cv(L9
806,090,939 *53A9BB351DAB921B080CC91CDBC13D0BF59738F4 CvLav
806,090,940 *53A70FB785AF04BECE18C37D507BE6436BBD78F4 Cvlb?
806,090,941 *53A0D803C40FA58ECA85306F264287EA12A206A2 CVlEr
806,090,942 *53ACCBA3DFE26C06521CA4D76ECCCB86B254FC95 Cv%Lg
806,090,943 *53A171EC6514FF70AB23C9321708251A1A888D11 [email protected]@LI3RN3SS
806,090,944 *53AE49BB30B267BD27C00099CCBE63C525E95156 [email protected]
806,090,945 *53A19C7DDBE380BECD78C5423240AB630AC9D9FB Cvl,M
806,090,946 *53AFD4533EAB0143C443D8A546584F41C507C595 CvLN.
806,090,947 *53A7FAA3FBD6B5252FFE7E53035BF7B41659BFFE cvlsblsing
806,090,948 *53A0FD3DC47E85FF6817E120CEF14067CEF5F9A0 C!V!L!T!ES
806,090,949 *53ABFCF35BFB098F0F37769F5B480A78E72CD75D CvLU)
806,090,950 *53A8189F6A8239F54DA8BDF7C05359E87B795006 C.V:M
806,090,951 *53A3DB6D4A5D9CE4D7904B70548558488446241D CVM((
806,090,952 *53ABB24B6B28C8F3B5B976A4E38D9A530866FDCA CVM)&
806,090,953 *53AD384C83D6FDAE27D3F94D83D191D61CCDBB0F Cv%=M
806,090,954 *53AF93061ABB4C17CC885C376436E0C09E2D583B C!vm$
806,090,955 *53A7AD096AE86B98C16812BC7D225C7DCDF3DA62 CVmBZ
806,090,956 *53A8710D6288FE54E9D44ECF07B80514326F010F CV"mF
806,090,957 *53A009E5A3FC2BF5A70A1E08A9A45B2D632EE2F6 CvM%F
806,090,958 *53AD945FED34A46AD6A07532145A9A705BD287A4 CvMIE
806,090,959 *53A1FB047DC998016D6C2E33265BE69812E70DB6 CVMj#
806,090,960 *53AB679BBE75C698D3E0591E7182A4747E552406 CVM&q
806,090,961 *53A524D985BA2F84133F4CABA0F8CB0D4F2FBAB4 CVMSw
806,090,962 *53ABE24E1277C8CADD24367FE6F0084EF8A74586 CvMU1
806,090,963 *53AC0BB4B99225CC622AA8E14FFEC5838057FDA4 CVMuD
806,090,964 *53A693CA0E3FA227C78754C4E226B6752D253FE5 CV(mX
806,090,965 *53A6CBAF8F468E056840921D5DB381116D2890AF CV.n=
806,090,966 *53ABD8C6B7DEDB59E2D68CAE8484B65D14CBB4E8 C.vn
806,090,967 *53A2EE3BC4DC89C16AF514D262FCAB6A9E32BA80 CVN=7
806,090,968 *53A888C94298AE4F3769D4CC1C876CD1AA79CFD8 Cvn#F
806,090,969 *53AB36EB3C77291CF6C6DBB4742F7C1C167017A6 CVN,G
806,090,970 *53AFE128B338B7E97680D97F95216394D8D9D273 Cv:nt
806,090,971 *53A400664621C8A4C5EC2912F76FAF50889FB836 cvn-wp-encvn-wp-en-c
806,090,972 *53A2686A27DC19D8416606DB0D628662B17786F6 CvnXo
806,090,973 *53AD0F170548CC3C9DD541D9FA93BB70C138A8EA CVn=Y
806,090,974 *53A84DA8EEE32C7F3F6A287C25ED25EA9F2990C6 CVo"&
806,090,975 *53AA28D05F7333471E78B5AB8F9106055910A626 CVO8q
806,090,976 *53A4862EDD98638DEF0868E49143F439729ECD3C CVOAZ
806,090,977 *53A8397E32F7E6ADF060C554D14A7C689C81FBA7 CVoLv
806,090,978 *53A5A73E3264A690445FD1EDD82B6C51E3E9CB8C [email protected]
806,090,979 *53AD7C6FD7A1B7E8A2774556B4FB73125E54CF3A Cvot?
806,090,980 *53A0057FFECA68B57BCB98D166B8A33588E98E58 C,VOY
806,090,981 *53A0D81F3892577D32E040F51B5A7F9C610E1B66 C?v%p
806,090,982 *53A05BE236D06F9E7AE8F316D5E5B724F24874A7 C;vP3
806,090,983 *53A2F8C78CAE628BC7A07D751B9EFAEE680F7455 Cvp8B
806,090,984 *53A00726837E299EBD43F54B013B133ADEF8536C CVP9"
806,090,985 *53A2CB836E5AA6081B2B5AF1E0C3993A7228D886 Cvp:b
806,090,986 *53AD6B4E9D7B933A93B36A6726C7E72530F6BAF4 cvpfs
806,090,987 *53A83A737FE21647C6D4BE029457E431BCE7C305 Cv"pk
806,090,988 *53A0F56100D576BFDC213D92B159BAFB542A293C CvpKm
806,090,989 *53A1FD106C0DB95E6308C6851BF124DD4D6945CC C-vPq
806,090,990 *53AE19B640854AC2DE36F70C10E2B73EF69284D1 CvPY1
806,090,991 *53A91F3C47F1F471A1A80C1DCE37E827BF2A7A3D C(V+q
806,090,992 *53AF38EB7427EAD0B5BC972DB44B8623A97CA6AC CvQ#%
806,090,993 *53A946D0E2035B7D205A8B867EECCBD77BF2D80D Cv%?q
806,090,994 *53A66B9F98CE2431048EFEDF06FD94A8784965E9 CVqbV
806,090,995 *53A1FC9AD1691212067669B6C55744FDC2E272C6 Cvq#C
806,090,996 *53A4ABB3CE27A79D4142E5857D42B466CA2718D5 Cv-qd
806,090,997 *53ACFC0146A8F9A9E7DCEB515C88414CE8B696BB CVqe_
806,090,998 *53A630E6FE4C10C1419CB0A4A36088DC1FF699FF CVQL!
806,090,999 *53A9AE292AD72DD14C00B3F2E49597631E4B3093 CvqVL
806,091,000 *53AC8BD9453B1917D76CCE9A3FF0FF5571644D50 cvqxe
806,091,001 *53A6CA220CB2544EC3D9AD96C0AF38D8B4CB63AA CV$r?
806,091,002 *53A0C49810126F518D54C84AFEA2F5B2FC606AD1 Cv:R+
806,091,003 *53A7F0CDFB0CC205F002F4D7203E424B6AAEC8F9 Cv.)r
806,091,004 *53A8A537CE526D92882ED293EEF75178BCEFD7A7 CVr,5
806,091,005 *53A8608197B72AEE578C57427197FA923DE824BE CVR7(
806,091,006 *53A6A652032654C32A7C1AE38505D299C3B7A012 CVr,9
806,091,007 *53A505A9F3D5C627234733EEAC2C87D38472F741 CVr/H
806,091,008 *53AC11B9F90DC426AADD55436AF5824B0BC08F17 C"vRi
806,091,009 *53A9EFA36AD348BDD223B92BF21024CF66A4AF76 CVrio
806,091,010 *53A213AE3838096E5472833A7BA76EFFD4B75CDC Cvrkutae
806,091,011 *53A52CA410D04C80FDFF4FE3C0A35571D9205648 CVRRschedule1916
806,091,012 *53A9F5EA992AEE525696034D1F02B6DDD6A8AC9C cvrsetors
806,091,013 *53AE73BE82D902C1DB3AD1E72E45BFB4B4793F0B CvrYr
806,091,014 *53A1881552FEA601EE1AE9BAAD219D451C5D6534 C%VS=
806,091,015 *53A6BD8F712236A0082D9F9D8FA324D118020F09 CV=S+
806,091,016 *53A1DEC49F8F8085B57E4149F6F0EBC22673094F CV%s+
806,091,017 *53A2AB1E3F08316E8056C1F5F3DA9770A618611B CVs(#
806,091,018 *53A9274EC401204CFBF79A7072F090AE8B3E3D37 CvS1#
806,091,019 *53A269D561A0D73F4634EE1B78CA36A87D8E4C08 C:vSB
806,091,020 *53AAD19DCD2AE19D89F1FA002ED04D77DD6BA694 cvsdbsw0
806,091,021 *53AC09EE13C5163B6F3AF515992049B8489DFDE7 cvstodiant
806,091,022 *53A41F6A691785ADEF74E104F346C48B5C741E6A CVSUN
806,091,023 *53A3855FF914713E32A2C3FD3558BA00667DD633 C:V"T
806,091,024 *53AEA7B2F11172579304F152DF6B6AE19DA47709 C,v)T
806,091,025 *53ABD35F22D772C26865F8B67D142555439B36CA CvT++
806,091,026 *53AB08433F4642624A2B33510AF01264D72F60FF CvT&4
806,091,027 *53A87CA4E3C4BFAF9FC4E6A2217A594F33EC2487 CVtE-
806,091,028 *53A3307533FDACB0ACB5C3F8741AD7A4C266DAB2 [email protected]
806,091,029 *53AB66AE234C98672C9A2685CAF96AEE3AD3D234 CVTL?
806,091,030 *53A65F577B660CA83A5848D63640F3404C04E529 Cvtlhbswed
806,091,031 *53A330592B870B0E2BDF7A2424C1E20E78942BCA Cvt$r
806,091,032 *53A792BB1AA6F5EDF45A8B83FC66720A1D4EBEB4 CvtRI
806,091,033 *53A2F1D7D1E708E97135190913B8D86DCAA01BA4 CvtuF
806,091,034 *53A60CF307EBE1EA2C21C0F17C10C34BAE7F6203 CV!TX
806,091,035 *53AE46041B80A4E1F88B07032D9691BA9F39F0D5 CvuaW
806,091,036 *53A969DFE6F7200CC11307F0CC79096D96FF02DD Cvu
806,091,037 *53AE0B4D238143F268B4BB2588D62684B5624055 CVUgj
806,091,038 *53A9691EF3D977B197B9B1994B2120E32D037845 CVuU"
806,091,039 *53AA57BF13F8B3619EF7ABE3694E62EC7D49631F Cvv2#
806,091,040 *53A0D81AC2E3CA9495FC430747F7EBA8A9CB1286 CVv9H
806,091,041 *53ADD59752E74227E885B2E14092627798A6AB54 CVV"a
806,091,042 *53ADA0DCD3865266151AF8C7C5764C04B1B85DA8 C/vvc
806,091,043 *53A8C366CE0B1246680931570388EDC3514B288D CvvE=
806,091,044 *53AF6C81C0AEC833B80E6DF51D15D29F1B4E07FE CVvf$
806,091,045 *53A65EB388B6B01C84ECA58EBDD0316876396A72 CVVkn
806,091,046 *53AC353DEB601851D4B0A6A6268A88F81C198FEA CvV;Q
806,091,047 *53A96483A651631EE8793DCBA77E432951CB560F CvVRX
806,091,048 *53A7653296735C8828BA40711C5507476390A782 CVvVu
806,091,049 *53A90B2926D36C922A81C951B2E577C23963ED34 cvvwm
806,091,050 *53A9D1A4E897851F7CB7255DA649D15AAB955A03 C,vVX
806,091,051 *53A6ADD24922C297031115B2C32B84D330431080 C"VvZ
806,091,052 *53A1A6342DC55F7E00FCE9962A3DBA82BABB7FE3 CV&W"
806,091,053 *53AE438E34C072780720BA26499DCD83F0CD20B6 C&Vw!
806,091,054 *53A82BBAD9B6EC009733420DF07924D0237A5047 Cvw
806,091,055 *53A54A0E877FA3569CD40DF5DFB9DD299419CD81 CVW0V
806,091,056 *53A9FB07BB09AFC8B95D8E810CFFE3AD86BA0D5A CVW4&
806,091,057 *53A87CA6AFBA911041DF81BFB5061C777EB08812 CvW57
806,091,058 *53A9375AAE4624B658D557BAE548BB74C2A23051 CVW6O
806,091,059 *53A0A48462B2792CA8ABA26254BDAC75A2FAC765 CVw/7
806,091,060 *53A80F9B4F7E379F13DFD68C70093C02A57DBAB6 Cv%WD
806,091,061 *53A345473FB7F1083820A81F6CFF11D9C9F69E7C CV)WQ
806,091,062 *53A5FEA5885F3273B216DFD9014BC3A67DCED9EC CVwRp
806,091,063 *53A679B95D01CD95BA2A77EB6E9A03F0A09D7A11 C.vWs
806,091,064 *53AB45B41C001C5E18AB7100B5C3E4DF5D696026 C=VXc
806,091,065 *53AC95D48B38BA99BFCB08CD74AC6FE786D3C37F CvXG?
806,091,066 *53A7B4448F40194A9273D62F4C3090EF52199BF1 CVXM/
806,091,067 *53A185DD2BBE3588FD180361A55FFC2E5B3343AC CVXnV
806,091,068 *53A0B2E1274E7526272D1104968040A7F8431DA3 CvXoI
806,091,069 *53A73F27B2ADD8B234D238485466326C86E60CDD C:vY(
806,091,070 *53AFEC771A15844200B1005721415357342DEAC3 CVYa
806,091,071 *53A0CAF2BA2A4CD29481CE40314FFAA4722C428A [email protected]
806,091,072 *53ABE2FE7D18A6F09E1DBEB7F8C30CF2521A38C6 CVY
806,091,073 *53A38E0DD8E1BB494B4FE90A59856680E20C90D7 CVYde
806,091,074 *53A472F762EF2909BC26CBF66B647199EA288D74 CvYjk
806,091,075 *53A2B669E730253E6F9E9456C4CB58D6E258DCC0 C#vYm
806,091,076 *53AC487C130125D1F97DD61C3F09460E0618AA01 CVYPi
806,091,077 *53A353EF9C025FF19FD0DE487C56444A889A98D3 CvYR!
806,091,078 *53AA2230CEA491EB10B9303EAD4BC8AF9B2DF44B C
806,091,079 *53AE8BE814CB42E0C68F8D5BC9D190D15144F284 CVZ7Z
806,091,080 *53A2B1DD733985E2170AC5DD27ED86F2775456E2 Cv#ZL
806,091,081 *53A3EA22745BE3AFD7E79DCD03E8F828435032EA CvZQ0
806,091,082 *53AC2886C068EE4F71DD51795B5680492897E056 CvZV3
806,091,083 *53A0B73DC37EF33BBEB6222912BBD973034714C8 C(VZZ
806,091,084 *53A6319136C989E21EEFA636E817C89D2ADED2D7 CvZZ2
806,091,085 *53A59CCB91CD30365CACFD3B20464F32A97C282F C;$W%
806,091,086 *53ABD8DC5E0C61B0D12362E03EA98FF42BD7A4F1 C$"?W
806,091,087 *53A934AAB4F95ED8614F40A6DD9767E9A9683B81 C$W[
806,091,088 *53AFA0D65B78195A3324E879F3E7F8AAC07DD6FD C+W$;
806,091,089 *53ABA561CAE1A38626F166CB49DACB7C0ACB81BE C
806,091,090 *53A473001ECFED780642063E4E4F222DAA97B0F3 CW!_#
806,091,091 *53AD1EB3AB052002C0949E53690B384367F4B42C C,=w,
806,091,092 *53A13F0B201D776E3D16CF5263765FCF9B1799BC C;-w,
806,091,093 *53A777A38A968BAADAD38936666514534EDB48DA C:;w)
806,091,094 *53A91DF916793097C851A823C1F95CA167094A96 C'w^
806,091,095 *53A5E7DC3D3576DD2D1D2BA2E701421421603604 C"w?=
806,091,096 *53ACA115EEF0ABCA671802235121285A10494A95 C#$=w
806,091,097 *53AB1D22A06964AE4E1C60B842617AAD390D2070 C
806,091,098 *53AD5C389245619DD61DC5899282EC0D08224DC1 Cw=:/
806,091,099 *53A3E78774FBC81F321651444F171547CE977E52 Cw_&,
806,091,100 *53A670BEECBB9B7716691267DC7D69055D34A863 Cw_%.
806,091,101 *53A1CB88413AAEBC4AF49E2FEE6E7209856D3A37 Cw,=)
806,091,102 *53AD8065D1067289CB7D8A2B47C4520028FF2971 Cw."%
806,091,103 *53A33CB027DB90A48D28F0BBEE140322BB68D027 cW])
806,091,104 *53A71884651F05ABB052E4897DCAFA276DFB86A8
806,091,105 *53AB287F37A9DEE57CA4405CD4D0BE7F0CEAD116 c}(w
806,091,106 *53AABF884E12799ED11573E7B23988EEC394BF50 Cw0(N
806,091,107 *53AC16295CFFD474D5431CBCED85253E1EC7B940 Cw0NR
806,091,108 *53A17131E09CF27D25FA702C368A780D1BB3EEA0 C.W0v
806,091,109 *53A40F23F431A1C377AB34A463312A01BB55DFCA CW1%b
806,091,110 *53A2BC8A61A88526A9C4A2BAD3E6C5C7881F1198 Cw1Dd
806,091,111 *53A8C15BE98E818668A8F06F26AA2A58109BFF3C C:W1e
806,091,112 *53A7B4E5E4F374487579636B054808F4F63FA2D4 Cw1MV
806,091,113 *53A07DF344A4A941F1047A925A893C7BACAF111E CW1Wo
806,091,114 *53A6BD852789052662AE89970D70D4FF3A727DC3 CW2,3
806,091,115 *53AE5EFC38B0AAB13C17795550FE330E7B2C3441 Cw23E
806,091,116 *53A3A541C85463E634C1EE71D719012574E96F3B Cw2f+
806,091,117 *53A90EEF5851FADAF6095283A036204AA23772FF Cw-.3
806,091,118 *53AE66AC695D78CD0350FA13366CF3A89B679647 Cw3.$
806,091,119 *53A6EE4D60DBFB533EBD3F0EF1EF98EE11AC3478 CW35?
806,091,120 *53ACA2DACDC22F0D765FEEAF08C7D73372405A4D Cw3_Y
806,091,121 *53A9D9231B0673486E78729A04722CA64C695392 Cw=4(
806,091,122 *53A73BBA078F9FE9C815682ACF4CEF6F59FC73FC Cw4DS
806,091,123 *53A3ECF5CF9F4D8DE19CEE827847931D7A996E11 Cw4fh
806,091,124 *53AF6AD23D07D01DAA008A3B47FE5D48D89EEF86 CW4#K
806,091,125 *53A1821328316DE0E9A9F5CF4933D32C0E16EF42 Cw4mC
806,091,126 *53AAAC3B0D650EAC74D8AB118089177B387EC170 Cw4QO
806,091,127 *53AC49FFB70333B8F816419476A54CBB5907FF82 CW4r;
806,091,128 *53AE6D977F316681E8E69FD25BB32C9615A9A296 Cw4sN
806,091,129 *53A0C539A098756EE7EECDA54FC0A9999F959866 C)W"5
806,091,130 *53AE5DAC7EE2210AF61FE98A593D5E509CA6FD07 C$;W5
806,091,131 *53A06C9BBE00B0D062198871E5252EDB8A7BFDF6 CW5
806,091,132 *53AB5A27473404AD0ECDDE155B8D7C3A792DA389 CW5al
806,091,133 *53A2C6BD41465EEB78537612B34CCA09D7E6B2DF C,w5i
806,091,134 *53A78484CEC0F0D3E6236B9E4502DF511A73E644 Cw5%X
806,091,135 *53A4CBC76E7701216043F891F3AE8A52A939F89C C:W6/
806,091,136 *53AFDF42C3C6000E7F1AED8948B2BF1E3BFE32BE C?_W6
806,091,137 *53AB89AFDF93F9FC0C463566CB1014CF218DCF91 CW)6d
806,091,138 *53AFA616032A20F3CD366ECF32B429E7B9BCBED2 Cw6Y9
806,091,139 *53AF447F94E69E3E530873480B60B2686E6560F4 CW7,!
806,091,140 *53A04539EDB8AAA35A2811E06DDC14047F182071 Cw$7E
806,091,141 *53A4392459CF0562059F8A27B4E4194AEF2935C7 CW7iB
806,091,142 *53A48816DBA546316C5FB095285F5433C62E56F7 CW7L:
806,091,143 *53A14FE5B96D6AD93EAB1E742927A1263053313B Cw7lk
806,091,144 *53A3BFB38DEF59F1FF29D4FC5A33BFD484B78C62 Cw(7o
806,091,145 *53AF3A0834D08AE072381DE34E72D024CCBCA7D1 CW7Od
806,091,146 *53A9AEB76A0E773114DDCAA5D29C4905D13DA5AA Cw7PU
806,091,147 *53A987211CAB56DBA6D8BC06C82182317300FDA7 C-W7U
806,091,148 *53A2FDF003A26A6F6C77925C94A265ADA7B64F43 CW8.,
806,091,149 *53AE0168C925B222AFBFED7971093F01CCCA4C10 CW8G#
806,091,150 *53A07BCDEB0D02615987ADE49D5905196635F657 CW8g(
806,091,151 *53AF0B65C324ADBC77061374BF704DC4CAA59E6D Cw,8M
806,091,152 *53AC760FD304CC62775296D79B439BDE4C7CA5B5 CW8ob
806,091,153 *53A8CE90A526FB9715C5ED09CF65AD2420B401FE Cw8sC
806,091,154 *53A1C0E3EF1B0C5614F319160F7475468ED8A4D5 Cw8VB
806,091,155 *53A95CB2C6DF958A48B752AFCA2DA85CF450F5B7 Cw9.&
806,091,156 *53A98706A17A4118101CB5F0EC289702F33FBDBB C-w94
806,091,157 *53AE7E4833DADB7FB747549AC3487922456AB25A Cw9cA
806,091,158 *53AD0B859B293532C79085A5D7D72772AEE5A2F7 CW9jK
806,091,159 *53A51947F976DEED3BBAD5B2ED9E3483AB8711FC CW=.a
806,091,160 *53A4FBE976F1E9B882DD4A529CB6084ABBE1E387 C,w-a
806,091,161 *53A4F7E91BC955D638045A4DAF693C6413831603 CwA3K
806,091,162 *53ABF745FAFA19D800FC5D14444479509A0BD21B CWA78
806,091,163 *53AFB2FA5BFC487DC565D55FB8D4C2A0429E8E02 CWaAE
806,091,164 *53ADC1B2CD56DA368E23717B018104344E0F6673 CwaCi
806,091,165 *53AC29E779459C2FDA49F2423D9F640D443409A9 C%wAD
806,091,166 *53A224BDD962190FD10E662ED10BED7E9BDA02AF cwafan
806,091,167 *53AE4C50915A0BC293CCD2453BE466568818C9B5 [email protected]
806,091,168 *53AF9205824CCCF80820DA2AB6C59DE5105575BD Cwao8
806,091,169 *53A064B9B76FA72322AF08E3902ADE1082046FDA CW?aR
806,091,170 *53AFB892B7A8D26E763A8B41D9CA973C0C1F2454 cwavn
806,091,171 *53A8F36B422ABB5BC21E1D3D86C9C3369EFDDE1D CWa-X
806,091,172 *53A6C7B01F67FBC6C695C64EFCAE1C38B9030A05 CwA)X
806,091,173 *53A3C52C353F3A1585CF1B5A02F7C33FF4C94418 Cwa$Z
806,091,174 *53AF8D39BD7C51D182E4EC02C285EA7F38CAC533 CW-b#
806,091,175 *53ADC849A5ABA4A27EAEE8A0AFFAACFD1F472277 Cwb?;
806,091,176 *53A21203E514693AD4B9CB7942CE52B3D7F1A450 C;wbf
806,091,177 *53A7C609ACF387C7BB3DD99FCDF578465FC631E4 Cw/bn
806,091,178 *53AFB1F4B360987E166EB78432C4917F39B7A466 CwB$s
806,091,179 *53AE7A9A52FFD3D2340970D1C1A26337172D7076 CWBUU
806,091,180 *53AC89575966106DECDDBE00732666E2E5C4E82B CwbYh
806,091,181 *53A856E7C5D92B022161651F93BC85B93D954DC6 CwBZ%
806,091,182 *53AEE19060A13D1E363FB848AC5B77E1EC530E9B C&=WC
806,091,183 *53ABDDBA269CD6928678247284B756AE6456170F CwC2W
806,091,184 *53A605277DF1E473D5E9832E69487130806A0653 Cwc3K
806,091,185 *53AEDA528F105C01682A5FDF91B1AC83902B2784 CWCgj
806,091,186 *53AC50576F4F3CD6BD057B62313A84FD9A5B8650 CwChS
806,091,187 *53AFD3A6BD8135E08ACB6C7D7C1C4811458DB7AD CWc;Q
806,091,188 *53AC91CBE38BF76DC9D347A73798BA268FF8A5F8 C+wcq
806,091,189 *53A0405E938BC7A38CC7C87F96C1DFFD20B179C0 CWCrU
806,091,190 *53A506E828DFFB829C57409167371EFD7AD8262C cwcznn2zbp
806,091,191 *53A5A08F294644D65C52AEE602C7377C5A53241A CW-D,
806,091,192 *53A65EB1D317BA8A4EC02B9B4CFB1C1C1AAD4251 CWd,/
806,091,193 *53A37445B45D403B880BA264C05BB24188E18A29 C"wd3
806,091,194 *53A8877393BB21DE32365A196A8599BA0EC1C220 CWDCSYG24
806,091,195 *53A322DC910614455EBAE1FA5710C02813DBB528 CwDd)
806,091,196 *53A76965CBBAAD551F4BFE47471A3E9D13FB845C CWdDa
806,091,197 *53A21BDBB9323CC07366851F877CB34613E5EF26 Cw:dF
806,091,198 *53A63CBFC06C24ED3600511C1C02433E9D651F1D C#WDg
806,091,199 *53AEA95C73DCDB359711D7F0D51D2F02BC88EBDC [email protected]
806,091,200 *53A756EDAB573BF852D769BBBC1849D764D048B2 CWdNt
806,091,201 *53ABC92DC5673358B9B99492AA453C0D3EC449F6 Cwdpv
806,091,202 *53A9F26DF9C01C803B9D6BE4ECB3BC71AE1BB092 C;Wdt
806,091,203 *53A47582EF039FA3FD38B25B544FE0BABE59560E Cwd=T
806,091,204 *53A781BDBE6D7CC5A5D0DFC79E5A253E1D237156 CWduP
806,091,205 *53A54FCD7C83B9A4773A09836C087FC95E437756 C-wdv
806,091,206 *53ADFC32837C63B27C34C2540ED489764F1AD9A2 CWDVV
806,091,207 *53A2F00C6F4F3AAEB494399084CB994C6D48D83B CWdwt
806,091,208 *53A2BDA14E36F8E38DC7844766164B4AFC8EE116 C-wdZ
806,091,209 *53A6252CB474CA069CB7C4E3F1537D2CD5B8DB54 CWdZC
806,091,210 *53A91C0C6938322F135F24B6C9F036CC1D082382 CwE"%
806,091,211 *53A77323D042B8F48B0DC3D64B9B98EF98FB9310 CweAU
806,091,212 *53A52883530EC5888405FE87CAD332FBF9B14D3A C/weB
806,091,213 *53A60B1C8D05F72D96C52FD46698911481DE5E73 CweFS
806,091,214 *53A4A83028FC0A9FBE5E31546DA70D4A728EA90C CWEIM
806,091,215 *53AC162C1DB50C44D4E60F91F24182266E3CEC31 [email protected]
806,091,216 *53ADA296DA61E55FAF46EECCACC10DC5B1678819 CWETANA
806,091,217 *53AB324EF755E4EC4C90D3222CD2C569D87F6E8D CWeW(
806,091,218 *53AAF70FF4E09C6256C1EFD220E73A519DB73190 Cwe/W
806,091,219 *53A90AC475432F583802F4E4D5C8EE4F55A18FB5 CWEYm
806,091,220 *53A15F639788C0924DA44DFBDA8DCF48D6C4F129 CWE+Z
806,091,221 *53A2B31B56036882E923680AA5AD0B3B7EBF9F2F CWf:,
806,091,222 *53A28FD8F62364C41597F9C3F1532323150E6353 C$w(f
806,091,223 *53AAE6AD7541AE3EADB20E2AAB4143A798317CAD CWf18
806,091,224 *53AA3AD155431162DD00830C477A3B99BE768759 Cwffg
806,091,225 *53AD7689122BDB1B73C41CF541FC435F3AF51A0D cwfgg
806,091,226 *53A9BAB23FDFD318E4D177F0EE74F25A1B61087A CWFhe
806,091,227 *53A3A9D64CC37612BBD0FA43604449B2A89DCA28 CWF:m
806,091,228 *53A108F10ECAD672591DF4F339772EFB210CC70E CWF-n
806,091,229 *53AE87EBB27DD3E6C1578988421C724E237621F0 C/WFs
806,091,230 *53A9B74830A2939E7FFBF1C6072CED0A86001202 Cw-FU
806,091,231 *53AEB0F08E7E3261FFEB54C6DA23A2C14FFB0569 CWFvI
806,091,232 *53A6C917D02D12347DCE9E548764C88629265119 CwfwD
806,091,233 *53A8855FD0432F4A5CFEF6A1ECB60EBCA44BC249 CwFY+
806,091,234 *53AD9DE5D9A63F8D3FD530C53CFDFE52473C6FD8 C/Wg_
806,091,235 *53A28807424DD484BD64A3F3CA6D04CDC03BDB4E CwG&/
806,091,236 *53AFC0F7DA90A2B13F395886C0A04CC090DBDB88 C!&wg
806,091,237 *53A03608FE8ACF60418A86190855C5C35910AB0D CWG27
806,091,238 *53AE932783A7F867D6A70A401FF795B5CD869E9E CW:Gb
806,091,239 *53AFF7AE9CEA67A43AC6D853BAE80363C5F1CA28 CwgBZ
806,091,240 *53AEDB96EDD3DE5567302120D9EC2C1143ADC841 CwG$e
806,091,241 *53A59C07083A77831B6FAE9CADCD3C899D908AA2 CWGHc
806,091,242 *53A7E9042486857855B3BC7BFC078D2A14B9C9CE CWg!l
806,091,243 *53A31F26298F6B0FECF9AB6FFE60675F83C18F2D cwgqq
806,091,244 *53A26D576AD4D3DC7EEB989330FD9879C4CC6979 cwgtg
806,091,245 *53A9F103E8B126024788D622A041892DDCEBF9C9 CW-H:
806,091,246 *53A7295919BEC30987C632650BE0BA89EC1A2CE2 CW&h1
806,091,247 *53AE405BD5CF515E340D8271156C82DE4F44001E Cwh=8
806,091,248 *53A883E978E974C0FDB61303E661DFE44AFBD32D Cw&h9
806,091,249 *53A542DB6E76045B3B16194017078B1AC1421877 CWHH&
806,091,250 *53A6965A17E75E37C0341FA505A0358463941ABE CWhh0
806,091,251 *53A8CF94276A63695A9A11B77C95EA22C770CF16 CW=hO
806,091,252 *53A4DCFEC9603F8C2658D5E847A77CCD27EB9865 C,WhZ
806,091,253 *53A2290FF50E4D3075E102C48963A12F587438C9 CW_+I
806,091,254 *53A419D55324843B62EED87CD3FAC997FF7042BC Cw-i%
806,091,255 *53ACA27176D0242CE77D1CE6EB8C7BAE11BDDBE8 C_wID
806,091,256 *53A2B2D58339882CA8884D95667A7BC296872087 CWI/f
806,091,257 *53AB85CB8B1437A212E1B9C41C10332EDF619381 CW
806,091,258 *53A4A1D58EE2E5985345D051692267FD98ECBDCF CWih#
806,091,259 *53A7F412C788E2F2C9D4DBB2EBB60EF116E549EF CWIh5
806,091,260 *53AB3D86E00B3A9E31D4474E15CCF65FB06B228E cwiklik1
806,091,261 *53A128890445AB881A9D31D235D96DC5D3A7E160 CwIN
806,091,262 *53A7842BBBE1833AEC3A859A809CCC1A80039A4B c:\windows\assembly\gac_msil\microsoft.build.framework\3.5.0.0__b03f5f7f11d50a3a
806,091,263 *53AFE8583D25B3AB26FA78DE8C48228A6C7ED3EF c:\windows\cursors\no_i.cur
806,091,264 *53AA9E77038D4EB442C73A7BEF0A977B05A695C3 C:\WINDOWS\Cursors\size2_rl.cur
806,091,265 *53A90F6E2CE92F946112449528EF873936BA0A73 C:\WINDOWS\Help\Tours\htmlTour\nav_unlock.gif
806,091,266 *53A22F72CCC8E06213C57A15652879379970E22F c:\windows\$hf_mig$\kb980218\sp3qfe
806,091,267 *53A1B26260C861903169D17B4134E74E306642C3 c:\windows\media\windows xp battery critical.wav
806,091,268 *53AC4C5A4EAABE2C3B57B2922B3E631131FA1660 c:\windows\$ntuninstallkb980436$\spuninst\spuninst.txt
806,091,269 *53A88A46543768BB3A78F7DABA4F7202993ABD54 C:\WINDOWS\pchealth\helpctr\System\Remote Assistance\Interaction\Client\RAToolBar.xml
806,091,270 *53AD9546B1F8C832564A07F39D4B415DA88B0682 c:\windows\srchasst\mui\0409\bar.xsl
806,091,271 *53A76C4904D8D3243614095A47252913C3A8CB2B C:\WINDOWS\system32\dllcache\dplay.dll
806,091,272 *53A8404FB4808D7E1CEA65E87B77ABFC52C1D527 C:\WINDOWS\system32\drivers\nwrdr.sys
806,091,273 *53AC341CAEA997E86A278B34B14406E3912AB493 [email protected]
806,091,274 *53AC92C26AC65322B78E16C875FA4FEEBC31FCCF CwiqZ
806,091,275 *53AAFF641EE19D5B7D0EF68A3F3A7EFB9EFA8E2E CwITq
806,091,276 *53A1BF8313F173BCBDE21B63717797863C8A5320 CWI&V
806,091,277 *53A9A0B58A85E9A104EE47B096C64F8A9212756D C!Wj(
806,091,278 *53AAE0510D01C783052A928D883C9298EF5C6591 Cw=j9
806,091,279 *53A49C4CC17617FE3233A674ECBE6E5E308E77CB [email protected]
806,091,280 *53AEEF322DEBF40279B0066A18074F971491BB99 CwjD
806,091,281 *53A233BDB04D6E1317CD8CD5D74E6F8672313E65 cwjuk
806,091,282 *53AEECE95758CEBB937CB919E2C1A63E297B9F1A Cwk2_
806,091,283 *53A4E17D018DDBA2C11DD3CAB73FFD3B43DE38A3 Cwk2n
806,091,284 *53A97C40B72927E21EB00CC184E7588EB4FF6A91 CW)kH
806,091,285 *53ADC1BD646FB3948D23DB57D2B24C358A1B0F6D CW.kk
806,091,286 *53A32C9653B22C7060EA8E96E4A4F47D60C0B281 C#WKn
806,091,287 *53AE490E95B938BB8A29C22EA5FABFCD15AF9D7C CwkVs
806,091,288 *53AB993848683A33131EF538FF0DC6916CCE43C3 C#W%L
806,091,289 *53AE2A6DD0977A472AA5C2345D8EECA05224F4E2 CwL"
806,091,290 *53A932162F5C44EDC2F011B85AFC5B8D505D26B0 Cwl01
806,091,291 *53AC3BA1BF8119433EDD167F6D09261967E40C40 CWL1C
806,091,292 *53A3C3A36D3637785A5895A59D8625481656C6E2 CWlfm
806,091,293 *53A9E85494FEFFA5EE1313DC92A3F48F299C04B0 CwluM
806,091,294 *53A3091F6242EBCCC4E810AA7BD47EDE2F57E4F9 CWlX;
806,091,295 *53A33FD086FF6889D6B9361B2D6C26680E11243F CW
806,091,296 *53A8965994FF2A7150A05A56AF667F01983B7778 CWM??
806,091,297 *53AB2504010702416B88B5EFBB18C75F7A2D4F75 CW)?m
806,091,298 *53A0FFA34AC88D2BA94950D2D73F6BE8F8E165D5 CWm##
806,091,299 *53A0411D58AF54D6BBCF826BC6515D51A95CE6CD CwM1I
806,091,300 *53A8A1D1DBFC55BAC91C44EE28B261826E429340 CWM4_
806,091,301 *53A61DA6FE10EBEEB8EC593822FDACDCBD116EB5 cWmC
806,091,302 *53A1BC4872D47B423F58B7B213764EC95FA036B2 Cwmd#
806,091,303 *53A73138929B038D868C0436E19C4AB28F9131D3 CW,ME
806,091,304 *53A3A99380CB1FB2F3F28F2F60A089BFDCB2E256 Cwml#
806,091,305 *53A93A5B31C173DA99158C6877BB01D7FA492540 CWm=m
806,091,306 *53A2F57470DBBF1271748216E818B3117845C32D CWMME
806,091,307 *53ACD4650ADD2EE3A078A3B8BA25F6BA9838CCA2 CWM(n
806,091,308 *53AB4F3E3B7FB426A5A7A54AAA5AF5912D1ECECD CWMsM
806,091,309 *53AEB4F65C71B3C0BE211C79B1E8196F7E845812 C(WN=
806,091,310 *53AADCA48AB6D3E7269B6C19E53C456B6FB2CAA3 C!-Wn
806,091,311 *53AC734D079A6E17451CADE21CAC513250CEF901 C
806,091,312 *53A568A4A258726173F43FDC9D5B61E50356C24A Cwn3B
806,091,313 *53AB75CF3A09E24B6DEB9167A17DADC19EFCA359 [email protected]
806,091,314 *53A5FE099CE373C343D2422777C637FB3F92F3F5 CwnC0
806,091,315 *53A792C36E12A500C319B606071652C715BF9829 [email protected]
806,091,316 *53A2B147FC767FA701995D64DEE36580A8A02604 CwNIp
806,091,317 *53A8A8B15E4B80E5B252AE5ECD5831976656F859 C
806,091,318 *53ACA69E0196BA8D4DA9CB1A3195A43642497035 CwNo6
806,091,319 *53AC1821A8DD0DE2607B7B8353012768CF97A639 CwnQE
806,091,320 *53AB084ACEB716FC771AE1371F63E9D81AEED1C1 CW?ns
806,091,321 *53AAA96C9083A288D8A2DE3F5F1D411A4985A164 CwnUP
806,091,322 *53AB88EB4CD40493DF5EDE67797AD27A63840789 CWNZn
806,091,323 *53A828696381F85838CE3C2BC0E0101E5F8F2A19 CW=?O
806,091,324 *53A570143FF776CBB7AAB85B75546C0CFEDEA6FC C?wO0
806,091,325 *53AEA826238736FAB5F2218E9E242FF48B7193DC CwoC!
806,091,326 *53A6D7FB55EABE4F957836CAFAB80461342B026C [email protected]
806,091,327 *53A3CDBA093417DCFA8BEC6632154B5C25BC0CAC CWoI8
806,091,328 *53A709CB7F212FB4AEA3E66488C192FE301FA74D [email protected]
806,091,329 *53A3F3EC225F455D120F0A9D81F4D12DE1BC69F2 CwOOT
806,091,330 *53AF44D6A804D929C44895E0C5C50A35CF4AFEA8 CwO/q
806,091,331 *53A013F8E8F86773E0A8A13B4D7AF12FFE017B5A CW_ot
806,091,332 *53A763C34AB8DDC953491592B0715B7CDD8607F0 CW
806,091,333 *53A47E76E7C1362D6677C340F1F4592DDD8F99E7 CW,=p
806,091,334 *53A73C9ACBA0CC4701CBBB5FA9CCF8873981C8E8 Cw)P-
806,091,335 *53A1D869A8278B034425A7EED9AD8DB7DA03D8A1 Cw)P)
806,091,336 *53ACDE3CE2746E642C77ED9101D828F690BC8E0C Cw%/P
806,091,337 *53A3E7859FA4C4787E516E9279AEABB6A5578989 C
806,091,338 *53AC1598B1F5E555A4BBB39B88A9D7489E3ED583 CWp09
806,091,339 *53AAC5E2AD684827A57BA7BD8DA70C273E9A92AA CWp+g
806,091,340 *53A10E775D603B30F10E403A77EA4CA5AE518546 CWPI/
806,091,341 *53A9E87D4C6B958B2319A74C800FAC47BCFCA89B C_WpL
806,091,342 *53A2201DEACBE798FD92807A7205D2E0C2814B2C Cw$PN
806,091,343 *53ADA1BB707C1A26CB0EEAE9D0C9E4D0A4A8E90F CwPrG
806,091,344 *53A383958D0F01D34E399051FB7BA0F8A6301AAF Cwpylle7
806,091,345 *53A733D0BFBA45CC65D3E93871F932BBC924C2F5 Cw#
806,091,346 *53AFBBCF6DF308FC2B7BEE27C8E13A2E4556ACAF Cwq:)
806,091,347 *53A21CD04EB34E13DB0CAD39189ACD21024285A5 CWq26
806,091,348 *53ABE2C8AB57B5D4AB8C4FB6F719495135C98212 CWq$4
806,091,349 *53A96D840CA8375D27E984518453C820D82AC370 CWq6-
806,091,350 *53AA3B3E37831B9C07BFF1848071BCE57DFAC80E Cwq7q
806,091,351 *53A3664800C00B1C47A4A7287D84ABF515B81E0A CWQcY
806,091,352 *53AA1EA100F8E7ACB8BE86284AD8EC2F59F77604 C"wqG
806,091,353 *53A830DCCC690AD6C03C8C36E7BC6949F2C94EBD C)WQH
806,091,354 *53A396B5FAB1E8805CE7E932C715296D68F23A61 Cw"QH
806,091,355 *53AB00396FE599A467F86D130ACCC35B31A2EE0E [email protected]
806,091,356 *53AB068383EF927B4AF81BB39A1434B5E84E102D CWqmG
806,091,357 *53A3452C9B82EDC7AAD19FC4E7AFF5FB2BF0A5C2 CWQRFLP6A
806,091,358 *53A093F942AAD74FC971AA074B913AFE3B6D9AF1 CwQTZ
806,091,359 *53AA30A42255B1296F3DB473AD89569C30A5D199 C:W-r
806,091,360 *53A75963C5490CD3C92B6FB44F724DE71AC49121 Cw%(R
806,091,361 *53A860D61567194884F5B31A65DB085CF61230E7 cwrann:
806,091,362 *53A73C185B0DCD48C291BAD06EA6E970DBF926E2 C#wrb
806,091,363 *53A5FA8ACE72E5CBFC7B7023F856DEFF77C2995C CwRH"
806,091,364 *53AF2EFEC4812EE8B2A9BE40AD8A2DDED90C5862 CW%rM
806,091,365 *53A87395B6B8EB66864BA8B6424804F70D5CDE84 C:W(S
806,091,366 *53ACC872FC5FB254ECD53A7E8045C545365EF9D9 C
806,091,367 *53A9A3A096AA86D5485D0219BF989AD56C074D71 Cw)S(
806,091,368 *53A2025587BE5361D9AA64D0B200072DCF3D85CB C)w)s
806,091,369 *53AA34E76E603B97483B64737471A2FA831BEEAB Cws2n
806,091,370 *53AB831DCB5B89A3354A4C6643EA40A39D41DC9D CwSA5
806,091,371 *53A53A5C7DFF04E5231B09FF873CE0A04C64440C cwsao
806,091,372 *53AB8BE3D601788B4CDCDBA2C1C1C7CE92B6D93A CWS;E
806,091,373 *53A20AC718509B44864100F2DEE0C5FEAA86F3DD Cwsjh
806,091,374 *53AF1EE2C8E7C9744DF87B880B7944131489B555 CwsS
806,091,375 *53A4C9FB55FDC9D1DFE12823F1227254AB345127 [email protected]
806,091,376 *53A71766DAEFF256BE84AC6E0C2F84390BC3C85A CWs,t
806,091,377 *53ADAB70CB47951EE5C045356278CD56A9F28F12 CW#T=
806,091,378 *53A6525CFBA20922946CF77AA57E76795B8CECA5 C
806,091,379 *53AE5B81252499A0E90D26283CBE4567DC6108CB Cw($t
806,091,380 *53A1F094A4F0B577ABDFE898469D39A22774E86C CWT/4
806,091,381 *53A506D67B45658AED7C784630DDD33DC0EA6DCB Cwtcbsw3
806,091,382 *53A4DBC49FB0AD39689A20A097FCDFA7077E4568 CWt"d
806,091,383 *53A3D54A02DA9854CF3F38F36481B9579DF9CA7E C+wth
806,091,384 *53A7CDABAB48171B3E20301E1E41828DA77269D0 CW
806,091,385 *53ADCDF263EFF4D6F01B2979C7BC7F5C5222AAAE CWTSl
806,091,386 *53A7A4BAC4C613AD28D8E45FE6C4B98DD7DBFEE8 C.wtU
806,091,387 *53A5300DC83EBCC3E7E8572C146FE3EA19830782 CWtUa
806,091,388 *53ABBE981968F2581C090CFEE03DE2D9B3828B86 CWt=V
806,091,389 *53A23DCBD562300A40E525EF98769EF2DA4043F9 C;W:U
806,091,390 *53A05E406261A6DC70450B8710D0A9086E29C810 C?=wu
806,091,391 *53A4BC5F74343290A43F3D1A3159035D90354164 C"w#u
806,091,392 *53AF1505F35C9312142497E04BBD984FA49208A3 C(wu:
806,091,393 *53A354529555E21705F4D4D7AC11A483292AB022 C-WU2
806,091,394 *53AB6B8062C65A53ED130C6E33D9F0F1E1A4AE56 CwU6$
806,091,395 *53ACD1F966FE68CAB83DDE823D21430AD6321C1E CWU6D
806,091,396 *53ADEECA0748202B1546B0FAF12BFC28812A388A cwuba
806,091,397 *53ACCDA25C17DA3F0AD03062AABBA28F34BC39CC CW
806,091,398 *53AF57795A45A2A7EF11627DB1B94E24910C23C9 CWu!c
806,091,399 *53A738F9BB03AD5B46530AEE4BA350B5AE74AC65 CWu.E
806,091,400 *53A5F3BB65A595E6638ED13B4F2927807D9CE434 C,wue
806,091,401 *53A942763D13260B3DE52A820A3C4CC06CC51358 [email protected]
806,091,402 *53A089A33D24BC67A4F54F701FA3647BB7C39BCB CWUgK
806,091,403 *53A80570634385C18640C4D3AE0864217C06BC70 Cwu(K
806,091,404 *53A3A4FB0A61405397929FA049848D67655EFF78 CwuKK
806,091,405 *53A198AD5F564EFAD7BA01E1ECD81309173AD39E Cwumv
806,091,406 *53A170CD5AE1361BD1F24607F0B0CF40614BA1E0 C!Wup
806,091,407 *53AB1CC8712732203907E08E2DEF2E8CC4C05C8A Cw=uR
806,091,408 *53AFEA1D06A7296A41FAC91E77552545CE7C0726 CwUW5
806,091,409 *53A42404A91073E097407D44F02558CAB3667350 Cw+UZ
806,091,410 *53A99AC07821F9D475E9841F8FF3F95F4C88EBC4 CW:v/
806,091,411 *53A8C305A3A8D56507F7305CD5BDB1CB3B351A96 CWv&$
806,091,412 *53A1F40B917ABE0BD35F126423129E221C388F43 CWV
806,091,413 *53A97A2C413D9CCDDADF59B367BE27852CBC2317 CWV79
806,091,414 *53ACF2DD0294F3DCB013643B1197F15E9E7B8790 CwV9W
806,091,415 *53AF8A4BCD7FD6E56E58CF47FFACEB4CD28B795A C(WVG
806,091,416 *53A12261E87FEE0A7B1C06679CA02CA6EBAB5C2A cwvnu
806,091,417 *53AC4540447F2A03F1121F625FC9E67D904FB6F6 C:wvZ
806,091,418 *53A0E0FBDC0B96A08C263F70CC16ABA09C2DA5D6 CWW
806,091,419 *53AC7CAB8EFEC2F1C190E3419F01A905F2262428 C[Ww
806,091,420 *53A0663F9B7188CCCE5D055DE60A065AC069E436 CWW2U
806,091,421 *53AA7612198B3825D9AD91523F23250040811DF9 CWW&a
806,091,422 *53AF3FA45DC42ADB45BC8F38DBE7E534EA1C6D86 CwwA!
806,091,423 *53A0187E6F4496F3EDEF63CA93C549E9D5B45183 CWw?f
806,091,424 *53A62F69CE10D9D626D4DAF6587EFA4A8E4C9F2E CWWfS
806,091,425 *53A6CA80E938F138515B501ED3AD53D8AF2A30CF CwwLu
806,091,426 *53AF9713F113F91FF2EF5963DB368C0EC4C9BFF4 CwWnO
806,091,427 *53A73E2D211750835366E04781EA45DB0FD0006B CwwS!
806,091,428 *53AE0BF99C796D66B724E6FBCC1C435BDFBF36D3 CwWY=
806,091,429 *53AA34E689764B8E899944A4BD5C30F9E6BD434F CwX4g
806,091,430 *53AE516C05630E63FBD9D5A40EA62C20D7B39CB5 [email protected]
806,091,431 *53AD7E2E1AB64229036C90F1BAFAF7ADDFA734D4 C:WXO
806,091,432 *53A9C83F3217C3CCD94E86C0507EE59C80E37849 CWXOP
806,091,433 *53AD6E6265312B7E34B384C7655CE2A024C969B8 CWX.s
806,091,434 *53ADE20B48356912E99CD6694C3375642F1041E1 CWXXm
806,091,435 *53A057C2758819CB4B53C661E34887C852AA503A C;W"Y
806,091,436 *53A35B908521D45006C99231E062F81FABFEA8D6 C$WY)
806,091,437 *53AC3D7071B1EC0EC7516E814694767B625C8E4C Cw?YB
806,091,438 *53ABAE3B4C18411171C724AA4937F6287D5C6AFA CwYcN
806,091,439 *53ABCC520AB1AF164AD30AB101B090CEB59077E9 CWYnD
806,091,440 *53A5AB03D49D3CE2FF01578D5D0FD1623C2773C8 CwYPG
806,091,441 *53A2D8AA44C5A2A990208D520A6794E179F78AAA [email protected]
806,091,442 *53A813510270AD449DAAE139C0D664A22A14014F C'wZ
806,091,443 *53A70188BC43125856F89D6761EE849447930320 C/wZC
806,091,444 *53A57C48A9F09177303AA890480E969CD24F43B4 C_X,)
806,091,445 *53A2A1624BF81FA81D5F0368013C1CCA4E4CDB0B C;!%X
806,091,446 *53ABED31CF22006A3139C01C0DF5933A710AEEB8 C)
806,091,447 *53A12F6398B96D3A9D4C5223728A30535CF7325D C&(X-
806,091,448 *53AF4A424E1BEAE7E775A8FFBE665226EEE41671 C&X)
806,091,449 *53A47103EB098073B0270E218E77FF395793DC38 CX.;?
806,091,450 *53A8091A7D6AA647909CFB99AC2D4AA2C82F5EAF Cx}_
806,091,451 *53A6A58D9A0E96D868A8E36ECC167FE2BC683B00 [email protected]=
806,091,452 *53A83B94C8E7C5C8DD5120338699A7B240826F37 c?X<
806,091,453 *53A88FD500B8EDC755A22F5099A323B0C2397420 C!!X0
806,091,454 *53A1570E2C40D587C153B8188CA0E31FEDBDB541 CX0$3
806,091,455 *53A3E130F36BF0F07B54937718DEF6C832F9E79A CX0V,
806,091,456 *53A16E7394E73BADFC237828B9EE5DF44C1E9D61 cx0w
806,091,457 *53AA671C816EB2A09E099D837497ED48B2A59E13 CX1GH
806,091,458 *53AC608DF284D005241B859BEE92B4455E8B54DD CX)1K
806,091,459 *53A1A59C68C09142D551091A51D7479A8D068D4C CX.1k
806,091,460 *53AC5261218D8CC84C53819A008C0731F63246B3 CX1nw
806,091,461 *53A451288149504C01F170B1EDEB266A49712650 CX-?2
806,091,462 *53A66E421310E4E0D95239DD0754E6706061D3DF C,X2G
806,091,463 *53A845432E043C96FA79ABC1B0B1E01E2432D32B CX3"+
806,091,464 *53AE2D6ED47AC01E2FD7EB7E4B09B9D4CB4CF42D CX.33
806,091,465 *53A1994DE2D38D6109B5DD4741E9D9E3D770FE20 CX3E9
806,091,466 *53AE6A713D40458DDA032C5B30553235584DE6D8 CX3pM
806,091,467 *53AD2F5D1B95052D0D7EB4A75779F79DC341799E CX3q9
806,091,468 *53A2E14C4CB0B5F7F53FE1EB748902B761D2FCC3 CX56=
806,091,469 *53AA4FCB03055E0192F26224B2CDB8B0FAEBA91B CX)6;
806,091,470 *53A471A3AEF797E217BE989E8F42BDFD373384F3 CX6DC
806,091,471 *53A9CE790D6BA1813E43935D220B466483F64C26 CX6v.
806,091,472 *53ABBC839FDC0E032D6E97296646A5B606E2E23B CX792
806,091,473 *53AF0011EBE81C2D36F036C0C2003011045ABB96 Cx7J
806,091,474 *53A0D9C86269DCA9E919DC6346C8CEB704E86119 CX7)R
806,091,475 *53A951162FA164F7DCE0825B713547A61830E7FC C?X8=
806,091,476 *53AB2FC5157D82B6202F0F04BDE51C01CDB952CD CX_8f
806,091,477 *53A5D08F4C204CF92348A72A494ED1AF2D5FA55B CX8Fl
806,091,478 *53A3361BAFD4515340E15912227F025164746F6A cX9;
806,091,479 *53A9FB4D41ECBDE4E2AE8E7DB3DD8BAD4CA9CA0F C-X9j
806,091,480 *53AC5C12082ED5A906FF059F01A6CC74D7927CA5 CX9"u
806,091,481 *53A5DF553E27EEE0E9C32B748A157CCAD0ACD21E CX9w?
806,091,482 *53A8A5C9E58C089A4782A7352E9E4FFECE032D94 CXA47
806,091,483 *53AFA9E1B1684E380E1BF8F7D67AA7886B1FF175 CXA4S
806,091,484 *53AF91F4373B9A2F84668D1C1900AE76D37B5245 CXAG5
806,091,485 *53A3D037144EB80E6B87208EFF3CEB3CFC8B119F CXam(
806,091,486 *53A80009EDD8A5F90F46ABCC5B60AD5C231B55AA C:\xampp\apache\bin\iconv\cp855.so
806,091,487 *53ABE1F7CA45A4B7AB1A68FB6745AFB239BF2792 c:\xampp\apache\bin\iconv\windows-1256.so
806,091,488 *53ADDDA372BB3CB4DD83BC6415E01E23F1D3AD57 C:\xampp\perl\lib\Text\Balanced.pm
806,091,489 *53AC1B4DAA8DE34BDD6CD97C2F07CA9931629D2E C:\xampp\perl\site\lib\auto\MIME\Lite
806,091,490 *53A0B72DE6D7C4A53C93A4750DF3DC8784AD51A3 C:\xampp\phpMyAdmin\main.php
806,091,491 *53A4C7760AEE44A0A944275D3743B17ADD1C0020 C:\xampp\php\PEAR\Zend\Captcha\Image.php
806,091,492 *53A89C4BB366B5D87C067480A742DDC4BFA221E7 c:\xampp\php\pear\zend\currency\exception.php
806,091,493 *53AC18DCAA9E8BEF3589A0BC7C20A6B5AC867FFF C:\xampp\php\PEAR\Zend\Locale\Data\ar_EG.xml
806,091,494 *53A694AE690BA2C3BD84FD73E7E4411AEC2A54E0 cXb$
806,091,495 *53A96431E154504F508B79148595AC606C58E76C CXB2t
806,091,496 *53A242E0319736206655FD5A2606305C61905777 CX!B9
806,091,497 *53A68B19647F0B3D48E418A09D0B16FD73605CCC CXBD,
806,091,498 *53A1617DFD6DD896A3E836B1386FED11EA6A2F52 CXbTB
806,091,499 *53A0D3A5BC216274E64D9D9BDC5211A9D8EDED94 CXC7a
806,091,500 *53AE397B4EC32AFC15AEA92942E4398E49C38B07 CXCA8
806,091,501 *53AF0B8AEC6D8A8F72560D8573C7E2878225B9B2 CXC#D
806,091,502 *53A9580FA9D0DAB0FB76C69A9192BEC52D5614B0 CXC/F
806,091,503 *53A45648905BB6421C2BFE69FE294908CE1C02F5 CXCN6
806,091,504 *53A2D5D310671499861443A7BBF5F26043C650E9 cxcsuwv71
806,091,505 *53AAC7E284DDD6CE9E645F6896486322422583B5 CXc$U
806,091,506 *53A7D5587928D99C6BEDBE3CC59308209E1EE31E CXCwQ
806,091,507 *53A10DA026F29F680900CD8450D45FD50628DE4D CXD(#
806,091,508 *53AE3867449D3C2563D59CB9CA4412635CBD1524 CXdGr
806,091,509 *53AAE838D6B24969900937DD2D3CDA024311B591 CX.Dj
806,091,510 *53A4A68B3A961435D15ECF951E3537234EDA69BA CXdUo
806,091,511 *53AFF50D7295AAECF3BC9C39DB2FFB4BB2396CC5 C$Xe/
806,091,512 *53A69C2F27B08EDE45F075A3E384E91D11E344C8 C+X.e
806,091,513 *53A1E8CB6A0C242D577119F9A88939373B2080D5 CX(EP
806,091,514 *53A7DCF6C1C7B8D1A697BA15EF51637ED8268F99 CXEqE
806,091,515 *53AC88D3F2FB77AEB782EE1D9664493ACD73A225 CX&F-
806,091,516 *53AC8AFC22BF75AC8FE4C70A31CB6FCC86DE32B5 CX.-f
806,091,517 *53A0F3E4204592BA9FE1E29A6431CD545F684BD6 CXFeY
806,091,518 *53A1CDBAD3C42DD84F58D9FD277AF9211BF51B59 CXffk
806,091,519 *53A6790B2D2FF7173D8441DC5BCE4C8DC8C5DC54 CXfG;
806,091,520 *53AE0458A39A294D0CAC9574627A635B6A4FBA53 CXF/o
806,091,521 *53AB16F8474A8619B80DF4FC07EC8FA063D9D8FA CXFoT
806,091,522 *53AFCEE4680126A3EB0CAA5A34E956243095F271 C+XFW
806,091,523 *53A833023471CF88CE745612A860AA65454ACE8D C?.XG
806,091,524 *53A18F12B5DED94BAB33B3F885D826566277064D C()Xg
806,091,525 *53A2D6C9B22033AF23A066CE7CB284CA2D85ED8C CX!g0
806,091,526 *53A50A11233A40DB8208816FE1771F1A4D14E7E8 C)XgA
806,091,527 *53A3BD17E59C8792C8ADED14E153B53D60DEBEFB CXh(E
806,091,528 *53AEB3FE4F4A3B44C91CA6CAEB385B2A89987F59 CXhiq
806,091,529 *53AF6A2D4FC3C3533D8B8E5D8CBBC738FB3C7C8B CXHmk
806,091,530 *53A17FDF240F3B5CDA63D34FF4CEC16D2DFDEB88 CXi%
806,091,531 *53A1B488A806C1395E0F1311833DF99AB71160ED [email protected]
806,091,532 *53A527D5952B3208392E555A5A9BCED5197DED46 CXiFC
806,091,533 *53A109CBFA50CAD9F4C8E5EBC1346C95F5E999EF CXIi1
806,091,534 *53A7FB723F08DD46552D42AB7FF7316A912E90BF CXIKWLXQY4EZTW358ZC27PX5R
806,091,535 *53AB96CB70CFF6816C4EA07D2686ADBBF0754812 CXi"w
806,091,536 *53AB67A5C9719DF74A14FE4F84E4826A84F39C6E C&Xj4
806,091,537 *53A3FC13E3FBF065A0CE5A395A5E4D2718554C75 CXj$r
806,091,538 *53A06835B712B23069FD05984BACF1AB71E6C967 CXjv6
806,091,539 *53ACCA5A5F15515E73D7A09911AD53C8D93D6118 C?XKg
806,091,540 *53A932593CD75596DA38E7AB32332DD80FA89545 C,XkI
806,091,541 *53A670D2F60005BEEFC2E9CF552039C781902069 cXL1
806,091,542 *53AC7EB0520CF1FCA83CA9791B9E1DE578F4919D cXL6
806,091,543 *53A446C6413B2786F9B16023711ADE60C44ABDB1 cxlcj
806,091,544 *53ABD9F2637609D31C1391325206BAB51BD52EB1 C;Xlt
806,091,545 *53A566144A8B5083DFF0AF47A6F837BAB9BD056F CXL_W
806,091,546 *53A2DDDC59949465A212ADBE81067F2523C8BD4D CXm5D
806,091,547 *53A86736EB3CBC463E751AF2D326C6391598793E CXMC!
806,091,548 *53A3234BC052EA44B86A892A3C9441C66C0D9D01 CXmm&
806,091,549 *53ADA47D73A14B4F2B2768A23DD565D122D51276 C:XN?
806,091,550 *53A1FF639F2A53D7CDF0AF286BCB63BAF3092ADE C
806,091,551 *53A2FC878A8EC75D5F1FDC3AB9CE177D067E4352 CXnce
806,091,552 *53A87270943FE1F2E866A5589E7B260234ABEAB9 CXNOQ
806,091,553 *53A2B4DA6D0EC0B9FF2CFC5AC17DC9AFF229A9C8 CXn,q
806,091,554 *53A223D418F0C9ABF76B9DDFEA82C57410655EA0 CXnZM
806,091,555 *53A6B850ADE8AE96F0DF438FC182C2D6445588FC CXoEi
806,091,556 *53AB189985EAA44239660B3199E647BC9953A5BD [email protected]
806,091,557 *53AAFEA032CC0F2DC036A50D7DF165FA8593D30D CXoR&
806,091,558 *53A872B6CA21290FBA0D0318E6A672E7C7E05F1D CX+Ot
806,091,559 *53AC77E230B8BF2C9C4F63BC4F001ED8941E879E CXowK
806,091,560 *53AA695AC916F272BBCAA606A2AAD06DEA72CDDF C
806,091,561 *53AC91A9B4ACD96F7B3C2D164B91DCFA0A76261F [email protected]
806,091,562 *53A73EA0E329DB73D49A4CE091957958D8403568 CXP0j
806,091,563 *53A2E3CD76BBC72246B68144A94078243D39B66A CXP1X
806,091,564 *53A1AEB18DE438685DCE24465CFB5A1F5E685513 CX+Pa
806,091,565 *53A11F6DBAB6ECEDAB71AAC4DBA08E04E9F50B6C CXpcW
806,091,566 *53A4E2AC0AA6593DC8CE778BA5618E7932E77DF7 CX"pP
806,091,567 *53AC2D7621C9974B0B6B52BC540949A10D1432D4 [email protected]
806,091,568 *53A6F3EDE1FEBC84ECADF6A4F6532C3CDE96B1CE CXq)+
806,091,569 *53A5C53108FC372D5C6BE3F9203892243B3F5D42 CXQI(
806,091,570 *53A733916C5B811E0E8EFB9433E9345858872CD5 CXqQ
806,091,571 *53A205184C6829FF733AD5AC278E7025926A7061 CXQtO
806,091,572 *53AD68054D9B540E24879A31CE1B8DFD23ADD416 CX;&R
806,091,573 *53A45D1EF5436ACC35EA396EA0CC4FF0A710DE10 CXRCB
806,091,574 *53A7EF972F7329A2D2A5070B102C9ED648799976 CxRd
806,091,575 *53A18BA1E138E0E5C6B6173378590844AB917DAD CXRgT
806,091,576 *53A3C6F95487E7150B22AEA4A83370997371158C C/XrL
806,091,577 *53A2E351814E841FC65237805375E93879639A72 [email protected]
806,091,578 *53A739C52B5F238FAE37675F3896D5A2971E80CE CXS_C
806,091,579 *53AA1D995CFB3F414BAB261C79F4074E5D30AACA CXSFSD
806,091,580 *53ADB046B5D7CE43C8872F5090B745FC7CC95AB6 CXT/0
806,091,581 *53A87DEB7A82F6506567814B9A0F49E3677E3FD4 CX?TI
806,091,582 *53ADA2A605ABB4B513240E6BD5245EE903D8582C CX)u
806,091,583 *53A05F9617405D5C66ACAFC14F0241A912440DBC CXun
806,091,584 *53A84291A9247B44FA3EE4B3BDD02251E35087A7 CXUnh
806,091,585 *53A85FD9AEF3B78E026A9D8544B91472EECE86C7 C!X,V
806,091,586 *53AE66ED906F3FE8C20021CDA2FEEFD2831073C9 CXV1:
806,091,587 *53A42F3B49E7B6715C4EEDB3BC4F7ED52CBD940C CXvcg
806,091,588 *53ADA36B9102EC2E6C8E7E5318B77C6854C22102 CXv
806,091,589 *53A755FE2D23AC1EE22D6B56EF1B5200A887A3CF CXvtq
806,091,590 *53AE5ADF597430FEF21A15A6CDFE1048C50252EA CXVtu
806,091,591 *53AA1349F49C28558A4354BD6EF4DFAC504D1EDC CX==w
806,091,592 *53A03F8461A342CCC8EAA41906687DFAE16DCCD9 CXWBg
806,091,593 *53A0B529BC7255F8E6D301B91885BE6DA3283561 CXwdE
806,091,594 *53AC4AB1476FE572318A97147CBD9E65AEA60730 CXWT8
806,091,595 *53A3FB7BFB988191DBC3DC294A8A0D229FB10A03 CX$X!
806,091,596 *53A47E1E05B803BD41E7E628548637355D5CFC9F cXxl
806,091,597 *53A2E8B3BF21BF9957ECEAE55992431FB4E18DE2 C=XY&
806,091,598 *53ADF3DF6FA3EF3DAAD6E82940D61F0FEED099EB [email protected]
806,091,599 *53AE9F78FB152F0480E91A5C5F47782C31E393F8 C#_XZ
806,091,600 *53A11C4DD6D15D27339121608DA3F8B4C44F2896 [email protected]
806,091,601 *53A9CCBB1E57788D6A5FC174A665753627BCFEF6 CXZR,
806,091,602 *53AD64D49C334BE0CF78EA91814E28DEC16640CC C~Y?
806,091,603 *53AC38104C706AC19B85B5A5071BD4B0330D51B3 C-$:Y
806,091,604 *53A05BDC41CEF236BA77FCC85589EECEFF2B3258 C,%$Y
806,091,605 *53A4A1BAFDFFFA569A5FC66329D962D9C2873FF2 C:($Y
806,091,606 *53AFEB7CFCD264FBB682B2EAA2F871B97A7BBBB5 C$"Y;
806,091,607 *53AF354FEA124965890AE055F2BEB91F779E4CA1 C&--Y
806,091,608 *53AE1693B9533577BEF0D85E42E8191955F5F933 C#+Y
806,091,609 *53A487FCDFF13EF7796250DF2E780D7AAA26DEBA CY-);
806,091,610 *53A34AADCABE323BDC723C0AA32E16124FA55CF3 CY%)/
806,091,611 *53AB218388DEFD39231E45C8A3793ADB5C1F842D c/Y?
806,091,612 *53ACA503DA63C15618A53C90D5E595846C4B0B23 CY0"$
806,091,613 *53A5972F48852ED7E7A6F992226A32287BDD2EFA CY0(w
806,091,614 *53A0C832B8A56582930C210C89AC6896BBC00D88 C!Y1/
806,091,615 *53AE13A901F0629FB52E8B834FC4D558809A26CE CY1VQPAMRP
806,091,616 *53A5ABACA282955437B4AEA95F4F5FB6D0F842CD CY2BB
806,091,617 *53A0E83653617DA24BD29C0DC82F4A6833AC594F C.Y2c
806,091,618 *53A3711306FF9A6F0CA572277AC6594B59E0C4B2 C?Y3K
806,091,619 *53A9AB1E0A9D04C83F83B7CE4A83E50666EC3AD8 CY3Yg
806,091,620 *53A77763E65AC7C8FCE2BB6F932E3A6423A52F94 CY4h
806,091,621 *53A61B53C29EFF2D24BAE7C05B745C89D3B3DAF0 CY4mf
806,091,622 *53A4F7E720F219BBF6E136E9354219845D0F1D65 CY"4r
806,091,623 *53A68AFD7AEC4653F8A454B9BA5E811D8BCE5668 C&Y5
806,091,624 *53A7334D6F2A644CEA333B191F38FF7AC4659D73 CY,;5
806,091,625 *53A0FD9914769E97027480914EC5E7E14460BEB4 CY5CLOPS
806,091,626 *53A6F6C533732509328E698040D58FB34D108914 CY5r#
806,091,627 *53A1A9D61CE340BF833F3E1B614A630781ABF911 CY7ln
806,091,628 *53A1C1BAB36505A31C3A80B998D2142142AE4B11 CY7OLOG157
806,091,629 *53AF4428CB78170BBD28A8F3A59BAD6AF5E9055F CY83RN3+!C4L
806,091,630 *53A0BA4FEF1B29D46421D95ABE06478123DF9B87 cy8erneici55
806,091,631 *53A6358999BCEF34955530682DF1A0603AC5BAC0 CY9+,
806,091,632 *53ABC8AF17DD6F90D81C915EC0B7349087BB6E1F C:Y9E
806,091,633 *53A14CEBE4BE4DF4D8AE5602B5E6FD7B2356FD6A CY(Aa
806,091,634 *53AAA9496742D9B9D1F99B040E9F7E9868E3D40C c}Yaaa
806,091,635 *53AE3A70A4FF41758A7552593EDD8EB73600D2F9 CYAEp
806,091,636 *53A4E7D709D07F479061422B1CEA76186157E91B CYAkf
806,091,637 *53A2C91958097A3494305F67798006EA8715882F cyalenja
806,091,638 *53A77D666F39B95FD1F443E79226DF00A27B02FB cyalphaalpha
806,091,639 *53A2F8CDC5149B503921AE6E3EF08DFE944CB7EA cyaneus8
806,091,640 *53A727662F5C3BD4C98EADD9A86B90FC73E4A640 cyanhydrating
806,091,641 *53A81EE927A7927DAB541ECA331D5B9DCB5FB28C cyanidiaceae
806,091,642 *53A461E6A616CD3DCFDFD835D9D146DE684422D3 cyanofibrillosa
806,091,643 *53AAA715C86EC1F67793DD4724B0B30600004264 cyanogeenbromide
806,091,644 *53A7317C0A21D919F3F9F56B7CA4E62D41225668 cyanophil6
806,091,645 *53A8FA57C464FF92E927EF7A11865640571E49C9 CYANOPHYCEOUS?
806,091,646 *53AAD226D5596BB3B4D38C19977CDC6F79B0DE6F CYasA
806,091,647 *53A28829BA49435FDD543BDDD6DD04B4571C8A2B CYaZb
806,091,648 *53A4F042E88D1729D6CD8B0E0340D5C09978EFBF CYb3C
806,091,649 *53AB340989A0CD01846B680EE309EDE1D6FB0B47 C
806,091,650 *53AD2FA9E28D1235C4071D5668AF6AEA748E9B26 CYbDP
806,091,651 *53A385750E8A3095A7BC9A2DC14B5FBA74E88F92 [email protected]
806,091,652 *53AE9A554C8FE31C3D5A5C9E4A0A6BE569514FF3 Cybercry0
806,091,653 *53A4E75A9BA100B3C9B587E6765FC56980B1AB1E cyberknightsys
806,091,654 *53AD917961546E234B2104A336E1775D4CE48AFC cyberportmap
806,091,655 *53A4FBF3EFED31355C596E6E6E3C5BA28FEC7B8F cyberwonreport
806,091,656 *53A728992DFBF2306AEB9E388E7742F257C213BA CYBn_
806,091,657 *53A1FE11280CB03C33D4C571D3CB296FE58FF193 CYBOd
806,091,658 *53AF5E47992FFCF4A98FDB3A476EBB5D1B19C530 [email protected]
806,091,659 *53AFE20306DB14C24CC6E916E0A5070E07C22DE5 CY#BS
806,091,660 *53AEA4AC8910626E0C32CC8F98A2DAEFF2B7C728 CYBw/
806,091,661 *53A309346C277EC998F096E421C1F8C8629B673D C/YbX
806,091,662 *53A33985843DAEA404F0CDE09FE265967EF7E70A C_Y)C
806,091,663 *53A2B801FC41A89A65C473F53997C8B63F52320F Cyc101da1
806,091,664 *53A6C44E8E65D02F0D42D472936F40347847CD6F cyc1om3tric
806,091,665 *53A84F6AD61CA47ABC91A24C9D6C89582275510F CYC9Z
806,091,666 *53AEC939E7D96EBD2B923D7F82857BF041AC3178 CYcdD
806,091,667 *53A72F2CC7D046D864ABFC6E76A1FA579B845DF7 cyce11
806,091,668 *53A2874F7C539CE977027FCC6777C40042A61FBA cyclecoachrs08
806,091,669 *53AC69312AE5F9E21BD1A1B1175F5F2299AACE20 cyclene0
806,091,670 *53AAA32E3525B5EFFC945341131508A22DD97944 cyclesmercier
806,091,671 *53A68A11A95E31C3FB23357F9BC5821BF90CD5DA Cyclismeses
806,091,672 *53A0C6C864ECE729088369C47B62A63226637175 CYCLOMETALATION
806,091,673 *53A39835C43B588B8B28739CC253BA5C740DA4D0 CYCLONE02
806,091,674 *53A0D28ADF8BC5DF19C711EE486B76DA85659C49 CYCLONEMILLION
806,091,675 *53A432A0282510F41AD6215674AB426CF34CB5A1 CYCLONENONE
806,091,676 *53A128AFB59156CC1027FB6C696B807A6E0A8A84 Cyclonetravel
806,091,677 *53AA345A4B618C8EAC6F8339C96FD7C6394D5764 cyclopaedia N: cyclopaedias
806,091,678 *53AB4DFCCA2C3CBCEE35D46B9B19800F34DC8218 Cyclopo
806,091,679 *53AA0FCB21DF254E4B18A9934BCCC0D04E452A9F CYCM/
806,091,680 *53A0A49456291C1A2A8AD55912E223BEB5DA2E0A CYCP8
806,091,681 *53A88ADB3AECC3EAAD811D3FEF0ADC09734D0915 CYcq5
806,091,682 *53A7B2826C08058A37E8356C8BCE5DA9E083F71A [email protected]
806,091,683 *53ABF217163BFF68519330630509EC660170F288 CYD%=
806,091,684 *53A5BE8658FBAA81105210606BED99CDADBB80B9 CYD2G
806,091,685 *53A45969BD9AE2366F2B689ED034718D76039B36 CYd_5
806,091,686 *53AFB5EB3702688352FD8E365ED5F330F1DEF6E9 CY"D7
806,091,687 *53AD1C2EE871B10EECCED31118A6B2AE2B96D567 CY)D8
806,091,688 *53A60E8D33AD22F668F3FAE74223A1D024F04EA1 CY
806,091,689 *53A9FCB4303C23631F697D623861093851EE4E53 cyder5
806,091,690 *53AAAF237857B633AE511475BCD7FAC24BF8EA6A [email protected]
806,091,691 *53AEDFE9BFB39EF62603EBB6082BCA7F5EE962B1 cydneyholley
806,091,692 *53A435BE3F48FFE191DB5F4C48B8FD2F1C5512C1 CYdwn
806,091,693 *53A26EB2460E07F1AE69D83C3A1C527B003190D9 CYe,-
806,091,694 *53A0E38DA73216CEF51AC56263E60D9064B30F18 C
806,091,695 *53A03EEF36AD3FB4A2B670C85DC82CD6EF14847B CY"eq
806,091,696 *53A50B644B979E55AEAE650018EEF3D7B130F3FE CYeT(
806,091,697 *53AE96A2C818DDCBB0EF140C0F1BDD883A6015AE cYEWgUYs26
806,091,698 *53A1F74615F3D61EC9B954AF465FA0E5DD11E1AD CY_F-
806,091,699 *53A29A429ECED5E22BD2B29FA39D0C5879AFFE3D CYF_?
806,091,700 *53AB57995864889BD9F989C78018000BAF75FB08 CYf"%
806,091,701 *53AEF8CEED61032731ADA70FAEFA9C702DB3230B CYf0L
806,091,702 *53A7C8D0E7E2A838ADCB1072902B2C91A539F882 CYfdf
806,091,703 *53A8B2FDAB61765E6B23D23C8244317CA7E01527 cyfkpjgv82
806,091,704 *53AF4CAC91E2B2ED5CC6737C5F4630C1E5FEE54B CYFqa
806,091,705 *53ABF5CCC8BF07BA33C5028D5F46E865B9E62FAC CYFRAMES
806,091,706 *53A669E3A45E6420604F2AA475497A3A8CE7CFB3 CYFROG
806,091,707 *53ADFF8556AE0EB915A5B9F0F3C5A645A60408D7 Cyfvf
806,091,708 *53ABA94213627835EB54216BB9EB181AA9CBE431 CYf;W
806,091,709 *53A37E8AE9FBD1A8B024A838011FCD1EC199A706 C:?YG
806,091,710 *53A5FB8851779B092F06039A365001AE0888515C CY&G&
806,091,711 *53ACDF5DBE2C3D3D8DC6B4D02F9094FE718CB470 C-Yg=
806,091,712 *53AE6445BE3F3079AC4FCD5AA8DAF3BD2323A3B4 C+Yg,
806,091,713 *53ACAEF2CEF78A69C0731A2DF81374CF633D30D8 CYgbY
806,091,714 *53AD649617E235DF657D0D57D65BA411C42A7105 CYGD,
806,091,715 *53ADCE7209C9CE8B0C02005B39215FB816FCE5E2 CYGK.
806,091,716 *53A7C01301195DA7FE77094E28025B6E550F5976 CYG#q
806,091,717 *53ADB2ED40A48C3566EBB7910686D1C8CD92FC43 CYGV?
806,091,718 *53A45A3A4A18145C416FA75F37A2DCFB1DF73FD6 CY%H3
806,091,719 *53A9E54DA594F8CA36F6B4E6C5A8E2C855E84624 CY!h8
806,091,720 *53AC0E38E5E2796AF8FD9F38E26916B363943A36 CYH(b
806,091,721 *53AB7A3E55DB9FD75A324B715B32C4563ECF9AD5 C!Yhf
806,091,722 *53AA47DC69F7352D93D325DC5C45DA32D4C8AFF2 CYHP_
806,091,723 *53A79BCE099B326AC0338707B0531A0169B8B5E4 CYhrs
806,091,724 *53AD42930DD5D698E5E9A675E32374835B6FDB30 CYhSE
806,091,725 *53A7A6AF8E3F80E5977DB76735D6ADE20FB4BD3F C(YI?
806,091,726 *53A1F4D922DE3FE9FD86FD465895B04FB7A30DDE CYI/.
806,091,727 *53A1B84D5FAA127C327BAE739D667BC640611B3F C/YI3
806,091,728 *53A405067E43DC6375EA06E25BC35815AAD5C53D CYI4m
806,091,729 *53AF53D1FE7BB82680D0D86E7CDD8F6B8EEDEFFB CYiCd
806,091,730 *53A76EF51E9AE82CF9CC9793CF0DBE61A75B414F CYiCN
806,091,731 *53A8BBBD9918BB0D8358A765B1941EB18B3C391D [email protected]
806,091,732 *53A2364A40E20ADC5172963626D64E1DDC29F65D CY
806,091,733 *53AED717364DC7D4019920F45F8646F64CD276F4 cyipg
806,091,734 *53A9F0C6C5052420A29FB06C8369A6D96A7644BE CYiPW
806,091,735 *53A4CD820B36A8B198F442706D6FA9B5FE00F125 Cyitgmcf4
806,091,736 *53AD03F53A2105849A990470CD1C528325EE3776 CYI;u
806,091,737 *53A29701369223DD14A3A2E559A4E1A1DC7FD54D cyiyic
806,091,738 *53A17BB103CA72E2502CDA58CB0AE710B9874512 C,Yj:
806,091,739 *53ABEFCCD69E090DB4BE5CC3D1BF2BDD5D181FC9 C=Yjd
806,091,740 *53A340334473215A29D2A99E12FAB6C53C48CE84 CY/jM
806,091,741 *53AB22E43CC67CB8A2873A006D2BB242148D8A97 cyjvbb
806,091,742 *53A453DE69F078130B7CFA5A3E130EA9D54DC156 CY%K1
806,091,743 *53A2F5513653A3C0BAB3583342C998A8FB9A3D21 C%Yk1
806,091,744 *53A7A1DF98BE8B55337574A27D48865B2078491C CYK6D
806,091,745 *53A0A57A2BFE4C28A1B0FCFCDDEB09040AC4B5D1 CYkc1
806,091,746 *53AF057B616C43442CB2F06238A95C048B8B38DC CYKcc
806,091,747 *53A2C2B5FB79B5D714C3BB04C1FDF257C4D6952C cykhu
806,091,748 *53AEB04721B8AB0062D62ED4D457C4A481F370E7 Cyklerned
806,091,749 *53A27477335A1F58DDA484D5A3AE62F9F3B4F698 CYKL
806,091,750 *53AAA7A30A1C0597BF981BD2947108B2F65CBD81 Cyklonth6
806,091,751 *53AAB082D50D6167B299606C3C0787745CDB98AF CYk%N
806,091,752 *53A9B3218355A2AF6DA4C79DB3EB379468CE756F [email protected]
806,091,753 *53AD404915A2CE3DB7A4FE7F8647E711722A864F CYK)W
806,091,754 *53A303A1A40509382C7C608174EBDD9A8F6CD0F0 CYL=.
806,091,755 *53A9E05F66E2AB47A9C7C4B52C1EE7FE68681E2D CYL
806,091,756 *53AA04CCEEADF43708C5A2F6F488F55EAC05B356 [email protected]
806,091,757 *53A9EC896F95CACAF20A6F6548369A210CAC058F [email protected]
806,091,758 *53A4226350C2B693FF6219D5EE92862431263A57 C#Ylh
806,091,759 *53A3734B85F98602DEFC6ABFC03EA6346D91E5D2 CYLKU
806,091,760 *53A239A53742BB66839001E3EBBE672F93BB3CEA CYLLENIANS
806,091,761 *53A0E319E38E5DF3ED04C20B914506B9F783CC9E CY?m&
806,091,762 *53AAECB0105D4D7129E653696DA26030FE5348D2 CYm/_
806,091,763 *53A8DF58ACC66611DFBFB27F0F07808E107FEC8D CYM+9
806,091,764 *53AF3DE5F6DB14C098F030AD04C53C5961EC7809 Cymbelglocke
806,091,765 *53A36B8FC8FBCE60E7CC6B3F10312C066A6D2275 cymcoq
806,091,766 *53A52FC1471D18F98BC7B1CF51E5A1CF7C4CDB37 [email protected]
806,091,767 *53A0EE52D62518C8598762D679CF708F9749908D [email protected]
806,091,768 *53A9828DF9874D2DC72C56CFCA8BAA7785D9105E CYMmR
806,091,769 *53A1BC1DAD42A04EF1AC943F2F50DB3C952EE669 cymodels
806,091,770 *53A0D0305FE3FE7BE93810E4CE3CC20A3B493856 Cymphytc7
806,091,771 *53AF85E08BEA01C7B0E372BD9AA16D1559D32093 C/YMq
806,091,772 *53A1A08922EE8BF059E3016399421717D7C993F9 CYmtW
806,091,773 *53A44519DD9B9BDE3E705FD5BC5BDD53798933F6 C%YN+
806,091,774 *53A305786F463181037B7B03ECF78342E088966D CYNbA
806,091,775 *53A0108D4490B6C1ECAEAAE52232668675299CBD [email protected]
806,091,776 *53A57BF9BDCEA30189A795AAF24315E21B51D3EB cynddrwg
806,091,777 *53A278E4491451EB3EEBFB7CCF96AE9F2DE3DA64 CYNDEEBUSA
806,091,778 *53A621924E83B84A31BB2D2326591727EF8F09BE Cyndell7
806,091,779 *53AEFE2DF99E84FC6ABBA526BB4861C9BCD6BBB8 cYNDiA
806,091,780 *53A923C39A5AF6D43AE0A6B56FC1B44C5CCACCD3 cyndias6
806,091,781 *53A781955F31A344AD7026EFDCFDCDA92E03F945 cyndikiser
806,091,782 *53A1655CEA947FB97208EAF622235949BF5E6D28 cyndi romine
806,091,783 *53AFA0AE69AEDDB5E2C20544495F8B20A5D155EB CYNDLE8
806,091,784 *53A46A74B175581354670E83115B9C8545ABC39D [email protected]
806,091,785 *53A2C7496AEAE5F142B55143E17B1FF7F517E8D3 CYngF
806,091,786 *53A7E38956315A711739D6BAF44D2A785F237C54 Cyngiser0
806,091,787 *53A4CE5C4A98B5D9D0CD7C2C135E814E1A13360F CYnGr
806,091,788 *53AF39A8DC17DE136C025CB6972B7849CA5A1455 CYNHk
806,091,789 *53A044A559809D32160899D6DACB873C59687E2E cynhy3na
806,091,790 *53AFCB5D6187FC79214EEA86C684A3F7283BCFD8 cynicmonobook.js
806,091,791 *53A637B8D15210AEC658BDD18347E58F4C90FF6B cyn lo
806,091,792 *53A24581E2B8FC250EC4EF88947536A15934025F Cynpdcs2
806,091,793 *53A5067BA5CEEFA8FDBEF3EDD105E90D79E510D3 Cynrog
806,091,794 *53A54545F8C65C10B2A610259122FADCADE6DB3A cynthia_deans
806,091,795 *53AE1767A0C7348B560BD98E60670E604F23345E CYNTHIADESIGN
806,091,796 *53A67F101A8DFC70DC9E94DC4D1F0554DC34508E cynthia-mckinney-remains-imprisoned-israel-gaza-bound-boat-seized
806,091,797 *53A3DC5BE3C0D73BBC4C44470345605FEE8AD468 [email protected]
806,091,798 *53A77749D6AE17C8BA189591E85EFE288AF0322E cynthiatranquilli
806,091,799 *53AD9511DDC2E44B312B32E06C86B545C189BECF CYNTHIAV2082
806,091,800 *53A68D0EFB9ED120676AB797318C573E10F678A4 cynthyn3
806,091,801 *53A84110EC7E22280231DEEF852AAAC51B5400C4 CY$O"
806,091,802 *53AEFB46234B4CDF7D324CDD0DB16B05BFCE32EC C;YO4
806,091,803 *53A028B872E9F0FFA84DDE9A8FC2BAF4C29E6F7F CYOA_
806,091,804 *53A6A1B9429B7A2E8AF865171197008673C79C7C cyokuyak9
806,091,805 *53A9BE2DBC48A77833B09F63282F45936F286F7E C$YoN
806,091,806 *53A4D43A190F2030F37F587406509EFABEE7B800 Cyoubsws
806,091,807 *53ADB5E6E68172BE2AB9F137EF595014C10FC739 cyoudume6
806,091,808 *53A0DA61E5F797B43F97E69008CA926710FA9966 cyoukyak3
806,091,809 *53AA146AC335AEEA7A7F18C2DDA0A82BBAAB6C9A Cyoukyo3
806,091,810 *53A56605CD4040E800E4BF2748557807E59DBD89 C.YoY
806,091,811 *53A39C4DD0F1E79F556D1B5DA3BEB5B64B2CD30D [email protected]
806,091,812 *53AE42D63582CBFFBFA3246B9E6D0D65E43D2867 CYpcN
806,091,813 *53A7BBEE86F2FACBD2897F8531D60CAABBF477C9 CYPHELLACEOUS
806,091,814 *53A2E6106429E5CAB7983430A4B0B84036FBC2AD cyphonau8
806,091,815 *53A2C9B32F1374686842327C2E8EAF37F79D0011 CYp-P
806,091,816 *53AF76F197F23489E6D1F13AD70A63CDF87329F0 cypressc5
806,091,817 *53A5A0552E457F187F11ACE2894218051C915164 cyprsch7
806,091,818 *53AD572E2072D98DD64CF392AB8D4633D542E872 cyprusbestcompanies
806,091,819 *53A1E921F6A791CFBF0A0D701E35BCC393BEE701 CYPRUSES3
806,091,820 *53AF8FD3A08BE13F584140AD18A85CB2D623345B CYPRUSES7
806,091,821 *53AB2DF200EDECB774CB209714CDBDC64939BFCB CY"PV
806,091,822 *53AB8695E9BD141C3EF098BA87C52E1755056669 C
806,091,823 *53A1025B471B05F10929E41A3B5B0B4FCE6B22DB cyq66ek
806,091,824 *53AB13E9E0452C69D675C60A6391126A9A3B8D87 CY&q9
806,091,825 *53A25E406E9F75066555F846ECC4556F28F3E2EA [email protected]
806,091,826 *53AE869088EC5E9FB65287558E4D80CF02B59BB2 CYqf1
806,091,827 *53AD383DC0DF2EE16EA1E64B60C446C2C8255D29 C:YqG
806,091,828 *53A9ABAE0AF98D51A398F53A21877E719BB39A17 C!YQo
806,091,829 *53AE54960B540E63D43BF476448BD65F956FBDB0 C.YQo
806,091,830 *53A7E2A48B4085DE2E2221A34C37C5362900CB4D [email protected]
806,091,831 *53ADF9C7A692CABD45368E781C6F805B00A2D5BD CY;R/
806,091,832 *53A11735AAEDD487DF15BE9CAC0669D2423E1BA1 C:Y&r
806,091,833 *53A33840666707D03AC014487E749E71442F50C1 CY!R2
806,091,834 *53A430B92FCF66B05DE564E7ED41804D7CB533A7 cyrabuttell
806,091,835 *53A026F355375000FC1A18DFB208930907676974 Cyranokleenex
806,091,836 *53AC676AB00DFAB9620C74BB5F783D190B9EE525 Cyranski1
806,091,837 *53AF57997671B2FEF5831D12DB9E8D542D6FED15 cyrferdinand
806,091,838 *53A6E5B2C0F44C3BF92FF7BF3859EABCE37A3C15 CY%RH
806,091,839 *53A57155F36B4EA4C6ECCBDFF2E92AB1E1947856 cyril.andreotti
806,091,840 *53A956833B0262B112BCD5FCB44C8C7E82D81648 cyril.arave
806,091,841 *53A6133BE55197D86075C434F7031D5F3F2B0228 cyril.bacha
806,091,842 *53A7AC23E4F5F939E08BB733C1503D17A00BCBEA cyril.barbee
806,091,843 *53A653CEF26C16E78C572A64267078A37F1BB876 cyril.burgoon
806,091,844 *53A6E8DA978D9318343C112C031BE68C3B574797 cyril.conerly
806,091,845 *53AC8A1D4FC31A3452DCF9CD4A3FC9420156AB7A cyril.czapski
806,091,846 *53AC85C56E65E1E5D5CC1477A4C01801C464F0D3 cyril.dinunzio
806,091,847 *53A0A54B4210497B55EBE58A42915A2AC0B4623E cyril-dome
806,091,848 *53AEE01F23E07593B5F4B84B8EE996D3830847C0 cyril.gardenhire
806,091,849 *53AF25745F4ADFA18E69E6A4D4ED29456C2DB6DC cyril.goshorn
806,091,850 *53A35C3E236DDCE0047C5D1EF0D5B0D7093D388D cyril.grohman
806,091,851 *53A6140D238576507A9065E842E3216FC9031526 cyril.hartnell
806,091,852 *53A7D4903747384195ECEB9334649C4B8B886BA6 cyril.hogenson
806,091,853 *53A30FDF5B30160CF00B0FD1E4DABE4A3FC03700 cyril.kellner
806,091,854 *53A1DEAA54349CB3337C9F89F443E6C650D32CC6 cyril.libbey
806,091,855 *53AF738D6D7A3136DAD45E5CD1B53809A09959AF cyril.marrero
806,091,856 *53AAD396E6915D8EED51936F58A644FC9B8B5591 cyril.mcclosky
806,091,857 *53AE911038E1E6C9811131F393879E71C6F6890B cyril.olmos
806,091,858 *53A46E1E6BF3CF4F9FF881D67986AC371F274010 cyril.pickar
806,091,859 *53A96CD431532BD065E8565E0DD6034A160B7215 cyril.prus
806,091,860 *53A249D361DAFF40FF4610383F62F25827C9274F cyril.rallis
806,091,861 *53A7D1AE6185F21B56FDACC2A2065C5A801C7365 cyril.schindele
806,091,862 *53AA4817E81BDAB086C864D9ACBFF7420484D90C cyril.stothart
806,091,863 *53AF98FBBB66A94CBFA26FD66E4DE0060C8C2719 cyril.vancleaf
806,091,864 *53A6BE9D769B44DC2576DB5EA4FC256E77E45355 cyril.varieur
806,091,865 *53A2363E509DA3EE857779E01BD3E597682FC24E CYRINCE
806,091,866 *53A8B06918C9CE627E810066369A9515BE3088B2 CYrIS
806,091,867 *53AC43B37755DA01F2423DF552030368C770BF09 [email protected]
806,091,868 *53AAF43A1BDC9EAC6F157025BC9AD83B7602896D CYr
806,091,869 *53A0E5813625A9B9E2D23B87ECEA982B5C1CE7C1 cyrtidaE
806,091,870 *53AABB7BC2AF94A5C3CFB912567C69E78364B6C2 CYRTOCERATITIC7
806,091,871 *53AAA1176AB7A9AB363416C32062C2A26F247BB6 Cyrtos
806,091,872 *53ADE05E36E253AA20548E55BC24CFDEBFD2942C cyrulików
806,091,873 *53A0C6E286C88F279D33DE4D79A50B12E8047B04 Cyrus499
806,091,874 *53ABCBB58CC2E31955B2DA99DC9AC38DBFFAD510 cyrus.aspell
806,091,875 *53A2F2D6D8BDE5BD50F461D8B975EC0CCF42D686 cyrus.balton
806,091,876 *53AF7F04DC86C806AA5D453DBC818E0F3A87D663 cyrus.bankson
806,091,877 *53AFA6A7FF8D0AD00B9B34C2CED5E9C25D841769 cyrus.belen
806,091,878 *53AADB7E7E80A4763ED1E1E8B0B0F31E005072A8 cyrus.bitner
806,091,879 *53A60FFB301B396F35EB76A5AD14D854675C6E83 cyrus.brackins
806,091,880 *53AD3BD3F5AAF32336DD381D962B223F79078D30 cyrus.brociner
806,091,881 *53AEA615B59244A420FC85C3B9C3EAFD0E1D3E03 cyrus.croes
806,091,882 *53A1557725E0314261BEB5DF1CA40393DEBF3DA2 cyrus.danas
806,091,883 *53A79860B56234BA70A74A4B4B325FA566CDD6BB cyrus.foggs
806,091,884 *53ACAA75955E32F753A6B0BAE5526814198530EE cyrus.hagenbaugh
806,091,885 *53ADD3BE846240ABC7162F67ED1ACB5432162D29 cyrus.heinicke
806,091,886 *53A38775CBFCEA470B5448EB34BE0D04AF6A0894 cyrus.komarek
806,091,887 *53A3606DB38C071E65786A606CAC3FE644C13932 cyrus.leiby
806,091,888 *53A79592E16E66E38CD68720D06AC18EB00BB3B5 cyrus.lutwin
806,091,889 *53A442B477272808F1384FCE0DC8D0C98AD21674 cyrus.pommer
806,091,890 *53A9DD7DC9B8294D91C2DAB5C29FEF459335E5C8 cyrus.quave
806,091,891 *53AC87534BA12DE3AE4210FE26EC7D4D065DD046 cyrus.rigotti
806,091,892 *53A4BCE375707C8E382B578695A947E87C8E4228 cyrus.rodibaugh
806,091,893 *53A2AA31E01D9E42A19C4F6E32A0ED48C4504021 cyrus.rubidoux
806,091,894 *53AA05CD2914CA050147E2284375A9F3D6850F81 cyrus.seanor
806,091,895 *53AA417D3A1D4DBAB96A91E9B6008C4814BBF905 cyrus.vermeer
806,091,896 *53A34134FE22106ED7ECFF698CCD79B320C5231B C-YS"
806,091,897 *53AD9FB58B1132B77DEC48D908C82EFE7F724620 CY~s
806,091,898 *53ADE1ADE81A83E7324657DB07107968C599CC4E Cysastian7
806,091,899 *53A5ACE3A80A424B1E082934C9D14D84721CA256 CYS(G
806,091,900 *53A5E5B4DC04002C71A01F4D4BDE451D8E29D013 cystantley-bixler
806,091,901 *53A3155ED26F26691CCE709DBF1BCEEAEF9B1231 cystineses
806,091,902 *53AF5B8E43EFDB18C1F85E350096B0B905657435 cystoadenolymphoma
806,091,903 *53A0126794B2D9F32558FEE588DC598CA4D6B53A CYSTORRHAGIA7
806,091,904 *53A0414C1850A907D3BC7FCB619FC406F558926D C=Yt3
806,091,905 *53A8C9ED322C0CDB848070B169AE1EE21289A417 Cytblstm3
806,091,906 *53A5544E1B2F882E390027C55AD3705658AB26AA cytherellidae4
806,091,907 *53AA09DFDD42B813B2D85E22490328A14C4AB241 cythioning
806,091,908 *53AAC63CE4DDB4AC635B4C94E034CF03F071D93B [email protected]
806,091,909 *53AB895D90B18A7001F5A0DD5278155A458A5B58 CYTLGCLLY
806,091,910 *53AE6B7512C52C4E024ED92B602F75AE941D3D08 C-YTN
806,091,911 *53A952A7E4E9ABECB3E2F9DADA6F9C38C82863BF cytobiologie
806,091,912 *53A0B7D0A873B86BD838114A6DE001030E811E1C CYTOCOCCUS9
806,091,913 *53A98C5972A6A2E61B0AA8164602BB5B5067BD48 cytogenic123
806,091,914 *53A2F75FFDF30129D5D7E934F3DE2B2CBEB95490 cytologicznie
806,091,915 *53A3797D2F55C7D7EE1296C7841BBF3378EABF91 [email protected]
806,091,916 *53AE3A020C35B4E452D0E312C50C44871042E94E cytopathologists
806,091,917 *53A7AC9412C6F154BAD4E6DAB4C3BBAC2F7CA9E1 Cytoplea5
806,091,918 *53A6038881E643C3BA72AC9ED72AEE07687954B7 CYTOSINES!
806,091,919 *53A3C41444C8B24DEDEF85C85FA67B8D35335979 cyto-topics
806,091,920 *53ABC5945323CD2842BA2BB707E6FC4A5E71207C CYTu"
806,091,921 *53AB58733871DE87B607A0E9CBBB0ADAAF4BEAE6 C:#Yu
806,091,922 *53ABFA4886ED466FCCFB061907E57827A2C37821 CY=u?
806,091,923 *53A9D33192B77EDC33EF85E34FE3C3BF25E21827 CYu2E
806,091,924 *53AA1A497443EE309A79BE1EA83502CDD1F2F4E7 CY)U5
806,091,925 *53AC640D2BC56B02942B4E29EBBF3D914FFF48A9 CYuDG
806,091,926 *53A8766213BCBC0B6D6CF6CD8A13386B9BE9AF2F C#YuG
806,091,927 *53A14C18C4EA9F5D18399EA9A050A7EF7F85B887 [email protected]
806,091,928 *53A97EF2729948D79552935D34FE331996C396F0 CYUk3
806,091,929 *53A1996DF3A8466622E7B08A0D10130A5C30B04E [email protected]
806,091,930 *53A7D545874C18B32BDB8715529542CD05737E1D C_YuS
806,091,931 *53AE9430AE5F18FA642C02F5DEC011C704CD7D2F CyUT
806,091,932 *53AB96E9F5FD2F7FFDA27AD17A50A21109411FAE CYU)U
806,091,933 *53A130FDFDA5B9ED87A70222EF441BD9F1D970A1 CYuuq
806,091,934 *53A1621FA2AACF149FA1A62F4120142564FBEA8E CYV=?
806,091,935 *53AC15E96CC9DAE7DF352C9C5BA103F9C0665954 C_Y(v
806,091,936 *53A92FBF9C2F679CA2BD38AB1B61858297912B36 CY
806,091,937 *53A200B8E6FF3E49F6D1F0F68D7CDBC426C2E04A cyvdtmozcpvgsaaogj2nca
806,091,938 *53AE642FC4D192A538085FDAAC60AE4FC3307C78 CYv)I
806,091,939 *53A403AE120F787531F63AB3A060838C78B4B099 C=YVK
806,091,940 *53A4D9262C33985FB58165B450172B84DD123DD6 CYVuc
806,091,941 *53AABCC128C21C3A8714B0185840C745AE3A1CE3 CY-VV
806,091,942 *53AE9326984D8C3955376347E571B759D4D92A06 CYVv(
806,091,943 *53AF1ACF2DF3965D2E74EFA03D78D368DBE6DF1E CY=vY
806,091,944 *53A38C76D58DCE1EC5D99CE345E6CD7AE42C15C6 C!Y!W
806,091,945 *53A84455C4602B5296FBB9C41BC6C43B6771AD47 C!YW9
806,091,946 *53A93D6FD360DC9467DE3580B2A7E8C3D17BD62D CYwi:
806,091,947 *53A8B4E6D4FDD2F86EE05FC9F6E714A294CF6157 CYwO8
806,091,948 *53A07932703AE1875DA253965DDF66C9272B0F02 CYWP)
806,091,949 *53ACFC3DDA66AE352EBFC6D14134D68E47E47D9C CYwvX
806,091,950 *53A7CAC2F51D59D13B664D079475AA516E7194C9 CY:X6
806,091,951 *53AFCAA5735A3BEA087F65EB71B14FBD9A5114C5 CYXgZ
806,091,952 *53AA324348DB3FA9023AF862E4DC0231AC69C009 CYXis
806,091,953 *53A01048D090788E67F4C1214398F473CC98A279 [email protected]
806,091,954 *53AD80D6B77F1EA8D8F1C427B37C87A3754300C5 C+YYQ
806,091,955 *53A083EBC08E00604C42970DEF0A1EC5C0312E92 CYZb=
806,091,956 *53A11866EFF574C86522D45E491476D2FAE54875 cyzliiaed
806,091,957 *53AE6CC00C290ABAB46EE777D8A90D1EE1F383A8 CY%Zm
806,091,958 *53A122118FC1BDCF4B3D870859CF078FA51403B8 CYZ(n
806,091,959 *53A05C34037F39F1EDC7C1C4E3CDFC5B3612AD5C CYZZN
806,091,960 *53AEDD6908814C4C8C67EB98E306E26722760EB5 C=;Z)
806,091,961 *53A0913E70D1D9CD4D9F741617F244793D0E890A C!^Z
806,091,962 *53A92D9E016970D074FB7F62FB50C3B059657BF5 C!,%Z
806,091,963 *53A6096D022C11E2C20066E4109C131E3768A715 C!.Z&
806,091,964 *53A7D9BA8AF08DDA6EAA9DA6C114D781C1BB4717 C?-,Z
806,091,965 *53AC9C22FDCB113EB6D6CD58B3A7E9B41349C308 C&//Z
806,091,966 *53AC912C515C0FF69ED8038028E1A06FEE1AF874 C%Z:%
806,091,967 *53A2E74E4FB398FEADD31D86EED8865884DDF91F C+:_Z
806,091,968 *53AE032B31531AB91DA08F8827C55400BB3DD2E1 CZ:#)
806,091,969 *53AA888B5653F036CF31E604C1B91E773D1BD11F CZ"-_
806,091,970 *53A8F0129F8DEF7BB4D75EFA8D24DF98F15A698B C>z!
806,091,971 *53A5B7B9AACF17677D898313DFEF153ED3EED4B2 c~Z"
806,091,972 *53A2CC4D4A802491C061A25986B6FBCB642FB087 c=z.
806,091,973 *53A227B6EFB21EB5C26247D590EEE3D65191AC7F c)z&
806,091,974 *53A617093B33E6AD6013E34D82ABA678F42A453F C$Z0)
806,091,975 *53AF317F5A482D7906B9D74B10133FDDBF0EFAC1 CZ116
806,091,976 *53A946D615BEEDB0AC45220ED4E87DFEF36B0472 CZ1O:
806,091,977 *53AB6E98112CDC6A0387B9750F446CBD6311A94B CZ,2#
806,091,978 *53ACB1A285D3DA925EE7460C27C59D33FF667DBF CZ2LS
806,091,979 *53AF817D56549FB16CA009669CD88A9E47DD8FDD CZ2YA
806,091,980 *53AC2DCB88BC13B861702B17426991A9F803687E [email protected]@NS
806,091,981 *53AA5FCF5AE6E564223650A1ADE95E62FD8AC660 CZ3kr
806,091,982 *53A36384015E58CBF57AF28F58A085B16FF45F5E CZ
806,091,983 *53A14A878B318E835CCD39DB0A7AE9D56C4FE706 CZ4L7
806,091,984 *53A8F5E102F5844FA5077FDFC4A674790B515476 C%Z4s
806,091,985 *53A989755EF28A81FB3C14B4A18B41B0263AE1F1 CZ4u,
806,091,986 *53A17B2589CA0B6D1FF6531A6AC5A2D5337D5E27 C#(Z5
806,091,987 *53A4B8BE59CDBAF8C5B62DF479419121060F4946 CZ5"m
806,091,988 *53A2749922662A17A7BA173D5C7B9C9F20475566 C/Z5n
806,091,989 *53A7BE99B067D973EE55CE989D63661C3F0FA06D CZ5pe
806,091,990 *53AB4A63B4CBBE8BC11033F74329834CDE432B1A CZ5sT
806,091,991 *53ACF3F35B34FA8EC3F2FF9CA62563EF1EAEB520 CZ6sP
806,091,992 *53AC53A8DA5E7B0FFA24DEFC8471FEF12663C054 CZ,7$
806,091,993 *53AEBC7454E8612671A96469A096CF9767CA9136 CZ7:e
806,091,994 *53A00E71055D44E94282B59F7EAC68EFC74D459A CZ.7m
806,091,995 *53AB397FA88C907638BC7C600E45AD7F2EC203EC CZ=7X
806,091,996 *53ADBA874145EA258907D820F3CC221BCD17ACA6 cz8tn9dv
806,091,997 *53A1E029C2EBA219FFEC0B9214C917C0CF8171F2 CZ$9
806,091,998 *53A5DB63CE3A666070DE68B62510737A76079720 CZ:9A
806,091,999 *53AAB8405B2E2A291E3B1EF63B4AC524E47F52B5 CZ#;A
806,092,000 *53A92C035766E165EC9CEDF56D71DE22EB259B9D CZ:a
806,092,001 *53A2F5E7617163723D721AFF25C4496DC5E850B5 CZAA"
806,092,002 *53A95E42F1345C755DFF693D34C4DD7BDE89B959 CZaA?
806,092,003 *53A08F0FCDB0232457ECBF5542FC118A15B8E21D 瞋實味
806,092,004 *53A8AECADBA65DCF9E8CF58184D3C887F9FA59CE CZA!C
806,092,005 *53AD0D2474AC534C573073148825B4B2A9157364 [email protected]
806,092,006 *53A5D7A4CCAA12C03C82AF4AED5B1C9E0F277C15 CZahO
806,092,007 *53AA62969157F315C0241EA0FBAAA22BE5207132 C.ZAr
806,092,008 *53AD4E3C42E83BE60178A150FA3049ADFEC645E4 Czaric0
806,092,009 *53AEF25EBB4D824E0BDF1B6A4017D4D0337431B4 CZARIST-RUSSIAN
806,092,010 *53ADBBC1C02492A5283A8823325F87B96791F41A [email protected]
806,092,011 *53A5A71B26FC9FC5D5A8D0EB5F41AE92B68EE725 Czarnuchów
806,092,012 *53A42F8CE7868BC3DDB5F30463660250034B4C21 czarow1tz
806,092,013 *53A43A89308CDAB7F666C1BE2F0241366CF42F13 czasochłonnym
806,092,014 *53AAA978A8A2F85235EBCFA40812916E62A117B5 C+ZB!
806,092,015 *53A2088E68D8A8116D375577F724DB63A86DD556 CZBcO
806,092,016 *53A500BE840DBE05DCCA554AD08AB5CB7B04DFD9 CZBF%
806,092,017 *53A2ADCE7EC98815A00C7C43954F8BAD5693B3E5 CZ?bi
806,092,018 *53A00FE663A7563A0B972D1E31591145912B9D25 CZ$Bo
806,092,019 *53A9A1BD7712C5CA738B7E4F9ED3D5028D1B4F4A CZbqn
806,092,020 *53A7D8DDA80ABD02225354244DC6FAD87F0F7825 CZb#r
806,092,021 *53A06CE5E11ADFFCB235F6E704860112D047FED5 CZBVw
806,092,022 *53A75533AEA4EB890542FE5C89ED92017A4F5900 CZC_&
806,092,023 *53A1A8FAD704B4AD123D4409EFE40AD0D03D8E1C C-Zc#
806,092,024 *53A5DF574E46C0C3E5E295DD644499C905434AA6 CZc4B
806,092,025 *53A39A186E99EBC581D3538562857E3C4F2E8B86 CZcbU
806,092,026 *53A24D9C6045AE824225F3C5508FF4667B3FE128 czcfj
806,092,027 *53ACD10481B1CFD2206ACEF5C45E2CC4280888BF CZCO!
806,092,028 *53AAF409882A6D15B1C90D1EA285BDEFE0212D7E CZCX)
806,092,029 *53A90BAFEF992301205CE44168F39AAB2318ACDE czczony
806,092,030 *53A4109E3C333171B4BFF2A5CF7E7B9539F4BC08 C,Z_d
806,092,031 *53AFFD0508246182C9B6EF1EF239463801267FDC CZd;(
806,092,032 *53A83A9F47EA2C2F469063A487A945E743176E2B CZDA!
806,092,033 *53A712C6D7B36CBD8A1B567770B2275D6762BBB3 CZ;DB
806,092,034 *53A15B561A2A35E67E6597660A6F01B9A5CDAF3D CZdrH
806,092,035 *53AFF938D0943FE4BD87DC35A1BB4036043094D9 CZ)$E
806,092,036 *53AA803991E7C915B498CDEE14F6BBA7812ECD18 CZ#?E
806,092,037 *53AB09E8522ED2D667C9A417096C137A7774B93A C+/Ze
806,092,038 *53AA2CB02724DCE6A3CE029433354FCE4E85E95C CZE0
806,092,039 *53A4954AAD68692E690BA03390EBADDAA0ECC6A8 [email protected]
806,092,040 *53AD538AEA3D8C5B04FD81FC8CBE856704E071A7 CZECHO
806,092,041 *53A22D1E4A68DD095DF849B4DCB62BDCF27D2E45 Czechoslovaks3
806,092,042 *53AB76CCE03E6215C9B5799EA8E0C56116FE5D26 CZEGOŚ
806,092,043 *53ABEC2C557671300C7907E9DDD7C4F580FB1855 czelédes
806,092,044 *53A24BF848EC3D32C1116A2494F1D15313F32603 czencze
806,092,045 *53A10DD0CCD8F7F44379F918979CDF0A0958B7D7 czerbak
806,092,046 *53A83BA6747E67745AEFD0D8DE5B352847FDFD96 Czernice
806,092,047 *53AEED4D2E6C9898BD6F5633CF0725375642B35C CZESBOR
806,092,048 *53ABF6E137B251EF31D77D69E1BBD81DDB322E41 częśćiami
806,092,049 *53A62CD29999434920EA5BEB9464F9FDF4B201E9 CZeT5
806,092,050 *53A9D202E17402BD15AAAFCFDABFA43EF261D1DC CZF2-
806,092,051 *53A87BCAEB49B75B76AFF980FF5563B4A19F8FBC CZf_4
806,092,052 *53ADA88AEC6A2D0481D96722EB51965C02F2FF49 CZ;F8
806,092,053 *53AE257E8B16041F4B5E3EC8650D73E0A2211FB2 CZfcM
806,092,054 *53A388B05C37455FA2639A4D81540E9D8CE04496 C;ZfU
806,092,055 *53A885D27CB07386B6A90F127C7DA56A79AB9C99 C&Z,g
806,092,056 *53AA993CED3D0680F55B2AC9EDF32A1E83F36E22 cZG1
806,092,057 *53A4DA3235BE3DD99ECC946910095C34C77AFE0B CZ?GB
806,092,058 *53A3E8E73FDCE5CD139F108569DE401901AC170C CZ_GC
806,092,059 *53A58BF169E3318148536BF18F5D598F23AB176C Czgfuywning
806,092,060 *53AEA672D3A31480CB22585575FFCD63FE1A3161 C=ZgG
806,092,061 *53A8CD664991DB82BCDAA63A6ABC7D406F7875BE czgia
806,092,062 *53A417078E9E731CFD4EE395E0DBCA02CBA6A6F6 CZH-%
806,092,063 *53A577C200816FFA0738089C33D931FB23212000 C=!Zh
806,092,064 *53AD460A6F5F55BC84BC05A062EA31C61A7EF212 CZhAg
806,092,065 *53AA1D3D7927AF5518C2B4D3ADA8C38ACF0C7D38 [email protected]
806,092,066 *53A0CD31D8406A95F783A3091823A1C09AEF1025 [email protected]
806,092,067 *53A8671B3A029AC34BB252FAFE2D15A75FF80952 CZh&g
806,092,068 *53AD89F69CC4EC9AB3C70D1161DE9B43E828CCA1 czhngpqqwscomib1
806,092,069 *53A79541ED8ED0066657DDD8539D522207FA2AA8 C;%Zi
806,092,070 *53A169E30E2896ADD0C7465E7C47E2AFE7D354B5 CZiA&
806,092,071 *53A372F8B4C6474500BB19667225FD22E53A973E CZiBr
806,092,072 *53AD17C4CD1FB4DC151B4B7F3A08BB0D0CDC2A62 Czies
806,092,073 *53A5BE27105A0C31CDC4A38367B577B41D2DAD3B CZIhC
806,092,074 *53ABD10B902208F7C0144421B54258A970BE5AB5 C#ZIK
806,092,075 *53A8258AFC8D0FB5F36408FB4A4BFA6E334731BC CZikn
806,092,076 *53AEF35AD93667C538A8DD5DD78BE44DB079BABC CZIkW
806,092,077 *53A48CF941F665B6674AECBB60DDA0E827A5598C CZIVN
806,092,078 *53ADF8361B0A8481531EB0741BB9D2840FE2F549 CZIZF
806,092,079 *53A22AF48B17F5F7E56F338909C5143BE9EF4E8E czj757
806,092,080 *53A9EF7D36D4D8B6261C88ACEF8888919604E31A CZ:jD
806,092,081 *53A68119A1EBDE170AD23EE589A3A40875F431B0 cZjG
806,092,082 *53A87E657559F0BFB26FC8182BB8EA8124332469 CZkj4
806,092,083 *53A50720D001CECC07B7A96105ADA9801B53FFAE czkkg
806,092,084 *53A2C0D743D070DF1BB7C62E4CE6434255B2B69C CZKlO
806,092,085 *53A58FFAF96D268E7803A45E4916207CF40BF96D CZ.l
806,092,086 *53A85D93C7D2CAFE554B933A57D625924CF75CD7 CZl1P
806,092,087 *53A507D1CBD6A74C1DC0838CB3C615E2826D7094 CZl39
806,092,088 *53AAB55D6855744C8E669DE5DF9A5D2E671FD863 CzLe
806,092,089 *53A18875D1FC0CA63B1429D32ECBBCEC6A8782EA C=ZlQ
806,092,090 *53A6E2CC4155F80457C329577E452CA68CA1518F CZ,%M
806,092,091 *53A9B2A87B5A14C65E547126A7A6056CA2CFDCED C,+Zm
806,092,092 *53AB239B1CD69E2D5F58F71D91E75816661AC282 CZm
806,092,093 *53AB5F910194F183753268D30165C030D67B01EF CZ=mp
806,092,094 *53A9A0A96BA7840D6F2F8FE58B7A2F550B9A08E3 CZN8g
806,092,095 *53A998DC471E1077C946BE116ACF05DF52AB7BFD C=ZnD
806,092,096 *53AF7FD1E96D407990B666D106D06181376A6784 CZNi!
806,092,097 *53A9BFC870285BAFD1ADB2249469291CFE7A2D0E CZ%NN
806,092,098 *53A6BB65BBE9841F82262E3378A53ACC65B3DBA3 CZ?NW
806,092,099 *53A146EF11B4E4F1EAF8117D9B88590999150CB2 CZ/o)
806,092,100 *53A679E0008213EF987E8BEBF524762924ED28FC CZ
806,092,101 *53A4B6446B6A6839683491690C1501A5E282239A CZo;D
806,092,102 *53AD97C2102E791059AAC60BB3CDC8321E200BF4 CZok0
806,092,103 *53A6F7520088360827D6A77F3270B0BAC9590EC2 [email protected]
806,092,104 *53A6F3C5FFA4CE1359E7E0B9F36951C0286CEBD6 Czosbsw9
806,092,105 *53ABEA1EF16D25FEC9929DC9F03A67AC48B7A7A9 C-Z:P
806,092,106 *53A125EE8F815D97F8D62C56D7C9A68BCF856F5F C!Z(P
806,092,107 *53A7A030499D7F05FC2B36DAA66246FA9BE898B3 CZp
806,092,108 *53AEA4B8A148CBEE1EF77FCE68E4F8A5D49C661E CZP!E
806,092,109 *53AACE1DF020D6D873B13F74259105C73C9FFD4B CZPQ8
806,092,110 *53A92F679DA39B9EE19BF9EC9FFEB28ED2607834 CZPu-
806,092,111 *53A55E5DFBCB1DE0CF3184AD2B6F5960FFE2552E CZpYZ
806,092,112 *53A9E1AA4C2EFF77AEF17D3ABB1C060860C0803E CZQa%
806,092,113 *53AE7FB49862C4DE7992B5EE4E223481E42CBCA7 CZQM;
806,092,114 *53A8741CE3D3172BDD6E4A85CE3248D1439B03CA C(ZQN
806,092,115 *53A872344ED3B630F8C69F8E264DD7606B635811 CZ-qN
806,092,116 *53A16DD005B5B26F77C7DB16C9FB12DDD533A0F6 CZqna
806,092,117 *53AE61B5CD7BA88A4A2EE9A949AEBDE28CF2C5B8 Czqudwdo8
806,092,118 *53A3F145BC68F4A7A90742BB455C1FF9B9491954 CZR!
806,092,119 *53A38E2AE99B0B30CED2B1F26C6B7C89BECF9F33 C+ZR4
806,092,120 *53ADDE4C0B4BFB1A652F714663DCF0CBD79EE736 CZR9N
806,092,121 *53A9BE0583323E4A9757112AC28B962E336A8612 CZrBV
806,092,122 *53A42B0E3983FFCD2E241955BDAB947B877B3A48 CZ_S=
806,092,123 *53A8577E2A5CA5E02713995C6A280524F1C28BE9 CZ"S(
806,092,124 *53AB5AB4CD67823990337A342B987B9ACC895385 CZ.
806,092,125 *53AE04903302B2BBB0B4FDA11D4371027E24FD9A cZ&s
806,092,126 *53A91183E61DB53ACD16F6BE16E0976613296984 C;Zsb
806,092,127 *53A19B19842FF3D888E616AA77FD0227501D3DCB CZSC/
806,092,128 *53ACB2023016EBFB756567F47F2F79FC37D9F56A CZsfn
806,092,129 *53A6058ADB9B43B4C0ED064F02EF4B35463BC10B CZSR+
806,092,130 *53A24E10094F4D39E556FF2122DF5C55F5F830AA C)ZT4
806,092,131 *53A22195FF58234D5293FB3A7A9819489DE01952 CZT6K
806,092,132 *53A95DD6E8E49C1C972DBEC0CF0B2DC14861DC2C CZtI
806,092,133 *53AB2F776C331250B5DDD9CFE762C1C9BCB2120D CZTK2
806,092,134 *53A9377D5A7AE537CBA7A59BBC02C35D2168947B CZT&l
806,092,135 *53ACEC889989A87351311CBE84EFD12700B115AF cztoondb
806,092,136 *53AEA8F7A2D0A736018BC8F1E2ED7AED68C854DD CZtOw
806,092,137 *53A8F2323DDA365290D09DF29B4BD650E94896C5 CZT,X
806,092,138 *53A7067634283E3ADEC23C0C2AF27382C8CE5C34 CZtYY
806,092,139 *53A76D37B01DB35CBB31EA8E9F8B8F0FDC8E2397 Cz}U
806,092,140 *53A2EF9960E4B19973D5A8435BB768FE19077BE7 C"ZU0
806,092,141 *53A4575EC79EB80B184D82E9BD9C43B968A921AD CZu8"
806,092,142 *53A0A9D438600B959BFD343AE8BE148D9A064650 CZuaN
806,092,143 *53A6CAC1857FE74AA7D7C801FB8E8D961B777AFF CZuG,
806,092,144 *53A9DD84AE0F643D85B84C30135E16665E6B9573 cZux
806,092,145 *53AA4B3A2D51748DF4540D9CC4819BD2CE3F3490 C_Zv_
806,092,146 *53ADF6D73360F85746DD2C2074C85FF4480E58F9 C(ZW0
806,092,147 *53A4C299EA9E0EB38AE775A031E6556E47A1134E CZw5L
806,092,148 *53A1D913CD3DEAE2C1D877DA7DC553DE1EE015E3 C;ZwC
806,092,149 *53AB59125EF387EF286F6EE5532AC6A4990D1E41 CZwIB
806,092,150 *53A318B8741ED40E3C2A0EC9B34F83A5251804D9 czwmcjk1
806,092,151 *53AF8AD7AFB1049795C4FE289B08F487CECB71A5 CZ+Wu
806,092,152 *53AD8B24AE2D07300E35A43618C56041DFB953E3 CZ-wX
806,092,153 *53ABAE5521D418C777DEDEC7209B072975382D85 CZXAD
806,092,154 *53A2FABB7ED71DCCE4D4B26656746088DAA50C67 CZXO4
806,092,155 *53A0804D4D5B472E2C4CFA43C8137AC207DAB9A7 Czxrbsw9
806,092,156 *53A8F4DF3B09063A5C61D5F1DF9035E3A775A81A CZY;"
806,092,157 *53A8FCC7E493E57B930823509C69A565E6EE3ABA CZY)-
806,092,158 *53A0897A6DED9F19CE431F977F15DF78230DE545 CZ_Y0
806,092,159 *53A2B6EC6DF163C24B5A80432D4E9AAB0D119A08 [email protected]
806,092,160 *53AFAFA1E47B18D698E9886481B89A54462B8018 CZ(#Z
806,092,161 *53A66019B1218B325E1E7D5AA942B4F99E5A09C8 CZ&/Z
806,092,162 *53A99F64E1C20FEDC5173D635D18AA1BF472C3A2 Çарĕсенче
806,092,163 *53A6F709BACE7170FFB0145AFE94BE86B9549685 çеçки
806,092,164 *53A850458C1FDFB5E5FE6DFDC81BA1E0E0508E10 Cлепоочницe
806,092,165 *53A15A9A70EFB8493B9A082ED54DA4C719DD155D cпела
806,092,166 *53A9FE7F106CF5488F5DEB24CD1381E9913135B8 Cтамбулі
806,092,167 *53A3C6C2873B48901023EE990F281E0124D431AD Çулçӳрев
806,092,168 *53A03982CF4157FCDCE3F8CAA2ACFD816312A57B cуммарный
806,092,169 *53A3193C06FB034F356CDD45896C6F8E4C014F90 c形自動空気ブレーキを装備した。台車は住友金属製のks31lを使用した。
806,092,170 *53AEE24BEBA74F76E47A43037ADA5338B911FB0F cにも達する。
806,092,171 *53A709516BC05BEC2727B51A12179C38A4D077C7 D~-,
806,092,172 *53AF1CEE8C9E1C9AA10EE388F052C4AAB7D219CA D~+<
806,092,173 *53A4388FA705BEFF189B388D6D00FFF2275144F7 D<+/
806,092,174 *53A8FBB3D3DA05B4A62F84D8BAACA51774668C5B D="=&
806,092,175 *53A0D7D68E5C2472B9E01E0AEA03025E18E8646D D="_,
806,092,176 *53AC1E66DCF720BCFC2F6C7611967A460FB7B875 D=%.?
806,092,177 *53AC073F1F727096AE1C39264B5C0FFAAAEFA23B D=
806,092,178 *53A7E71EF5B75F636E80E001E4B21746FCE44682 D>\@
806,092,179 *53A1F574C7898541943ECB0E131573D3C873E8F0 D_;!;
806,092,180 *53A7952361741A050D6D09BC55B5C256D81B6634 D_"#?
806,092,181 *53AFA2D707EB9B8EA4CDEC8DC265DC13D0D1067F D_&,,
806,092,182 *53AB519426EB5135EC4E0D29EFE991CAD8CC5C3D D_%,!
806,092,183 *53A141A1FD66686493C9FE4F3B18E3AB2B33A3F3 D,=!"
806,092,184 *53AB0A800525F81B3B97EA30C5DDAE4E42E03D65 D,;=)
806,092,185 *53A9C84290AE79D0B0170530FBEC4B8BB3251C3A D;;#.
806,092,186 *53A4AD5744A223361748E3C4EE3D06636610698B D;")%
806,092,187 *53ADBBC9797910565D815A0DA7B7BA45A4E81C50 D;)._
806,092,188 *53A6AACBE4A072F7DF3530DEC266F01E2C793CBA D!_/#
806,092,189 *53AA35E77FE5668DC9B5EB55D8289E67CBDDFAEA D!/%-
806,092,190 *53A5FCBC1A79DBE61C22039D6DF039B5BE780D7F D?(/?
806,092,191 *53AD0414036DEB17A234889E064E91B1788A5451 D?)="
806,092,192 *53A98D73015AD8F733E496BABDA169899653ACD3 D/"&:
806,092,193 *53A65B90A646DD057FCF8D20B3408B8BAFD81AC9 D/#%$
806,092,194 *53A3500356C8D1217AC5A52A98E45CA7EA19C48E D.=//
806,092,195 *53AD91BE262C9254004F86CBD0D70E52D67A0F49 D.;!?
806,092,196 *53A9678E375DA4E70D0F012DF8E546D2D0E2A37D D.'^
806,092,197 *53A7141353EC9FB0B201E946A7AF33B09BB4B7B1 D(,$/
806,092,198 *53A0EECAC483545EF44E6A4D5BA79CD290ACE080 D((,#
806,092,199 *53A26AC1238D7D226B39429B56EC1871A3EECBE7 D)=)_
806,092,200 *53A6384E48E22287602ECE265DFE3BF031D44654 D)?;:
806,092,201 *53A6566C130B9C6E9BE738E939090C6B6F60EF82 D)./_
806,092,202 *53AF4B2FFAB50B0B916D892FEB9EA15AA1CF4A61 D[~[
806,092,203 *53AFE66D11C3A1C50EBB32A3DFA54A460C22A018 D}`]
806,092,204 *53AE0CDF7EFDF396E505CA7EEA8BCBB18B80213E [email protected]{[
806,092,205 *53AEBF794442785E25EB1CE2B2D1EC2307AAC369 D&;.
806,092,206 *53AB4EEC0B414FF6572418900F9106DF1EF369A3 D&:+$
806,092,207 *53A69B6602860703882EC9A8D0672DEA6B0E73BC D#=
806,092,208 *53ABF28E2411112FB3516159066AA191026002A5 D%:&/
806,092,209 *53A16FAFC10EFE162C452DE1206068FF4214804A D+=?:
806,092,210 *53AEEB341009811DD5A4F9E9F4E53DA332305A11 ,$$'d$$'
806,092,211 *53A5DA4859CF5AA718B93601A428170C805A54B0 &}d
806,092,212 *53AF3083431864497B7743406414C4EA90E615DF d~;}
806,092,213 *53A0690227FA8F0E01498C39E7D4D92C7CE9C313 d=;|
806,092,214 *53A8F824039F6DE9CE9A7D02A16F05CBCA1D6D59 d=[
806,092,215 *53A45AD0882EB76BF1E8D736BFDAD7A3D022B238 d;#)
806,092,216 *53AB74959225A8D7339B2DFD5E87731CC54A7382 d.%]
806,092,217 *53A3E47905423BE9533B54368A6D59D624AAC2E0 [email protected])(
806,092,218 *53A566421241894AFF8559F9C4B6D0BA97E9CCE7 d&~>
806,092,219 *53AA74A465B07F9AC5C9574CA839B420EDF04C4C d#>=
806,092,220 *53A7552541591D5E8B8A715AF8F7B64FB75D0290 d#{`
806,092,221 *53AF8871A2874922D1567B3F5EC24548ED04CF66 D:0;?
806,092,222 *53AD00FD2E7C201BAD9D43C8813BEAB289ED55D9 D?"0(
806,092,223 *53A50472CF275E70F2F03D2DA085B9CF30DA48D5 D")
806,092,224 *53AFAB548C9067EEBAE061EFA16CF4416F966876 D&0#$
806,092,225 *53A96BB24AE94D821284B8F09F5486CCFEA0DD57 D%0(
806,092,226 *53A410BC72324851914C7BC866CBA922FEE4E0EC D
806,092,227 *53AF07572A6B82BF67575ABD14E6348A597F0985 D
806,092,228 *53AAAAB8FB42E260C12A7D163DEABDF4B733E2D4 D0;-:
806,092,229 *53AED9E17FBBE1E9635B20232821352BEBB23607 D0$:-
806,092,230 *53A8CF0280423B45C8D60BAA9CA0B7BFF7153990 d&=0
806,092,231 *53AE33223F50B12B52A40F19E96764FCCE9C6FC0 D000480
806,092,232 *53AF45AF6D879D7E93A4535637B223534BAFF614 D000551
806,092,233 *53A2C00FB40FE9D5ADD8239218AE7F7665F27D6F D00a#
806,092,234 *53A40AAE2B014724CD2F5A4DE8881F6A78D6C52F d012404
806,092,235 *53AD7EB6FD3192DD19D0D3C469761FF2E009B207 d01268557500
806,092,236 *53A80F814C0549964DD07CFDF9BD94CE2E23C896 D01Ev
806,092,237 *53A0AEA1A36178A1ED35463646063F74399FEF71 D01i.
806,092,238 *53AABDA2D066B6D0238E67075D853492F285BE61 D0-1Z
806,092,239 *53AF2EE96467A9D0DC6C5E5739776584FAC88F4B d0209
806,092,240 *53ABCA01A1938175BD243DC3E96B461B5A7FAF93 d022478t
806,092,241 *53A4809E6592421E422523E22102094A9C26F2AA D027D
806,092,242 *53AEEAADCEB6A382AE0418C4277CDCC22C73A48E D&02N
806,092,243 *53AEF0C7CF47C2235C036C5ABD88513E83536DCA D02OS
806,092,244 *53AA18D028D569FE5BD98F5BFD5C984C2AA0B304 D02vK
806,092,245 *53A1B313026A8550D6C823A3BC64B3018E96DC7E D0:3"
806,092,246 *53ADB9A000895D9B025B8815BC642E13108D689E D
806,092,247 *53A8782A7932CA1E23A8AAEEAD27D36809F00ED3 D)04;
806,092,248 *53AB482F12AE7E207915436603EB295D5745DAA8 D04;:
806,092,249 *53AB569A26D342F1844EF3D3E4BF5103A92B6FB9 D043H
806,092,250 *53ACBD1E6E3DED7FB5DD2551549852BE4EAA0045 D04T07
806,092,251 *53A3EE0F474E0632D4825AA63D44551F339C14EE D04uX
806,092,252 *53A20F525B6A2A71052920DF128724BE5FFA20E4 D._05
806,092,253 *53AA3D13AD445F6A54C08E72036C141E851A61ED D0&5,
806,092,254 *53A541F3BED8F5036EB9E160CC1406895DD3673D D052_
806,092,255 *53A964978F1334B9FECA71CD06FA898F5457A9F1 D05%3
806,092,256 *53A052F3B3AE2AD704A99B9E32B27775D061789C D05Mc
806,092,257 *53A29A1EDA910D65E2F1A215C08ED8CBA1DF911C D/06$
806,092,258 *53A8CB5720A2DB1ED4F2E2C08F83E1D67021EDC5 d060677
806,092,259 *53A69BCC3B6643D1C3D1FBDBEE4137E638548A65 d062983
806,092,260 *53A512EF6871CADE51E8548B14B0E870C9793006 d06330633
806,092,261 *53A93EC38BB9DD72CC4EC05BEAE2BE4F257A9F56 d0672
806,092,262 *53A358F2931D95C1067204B9E6ECBCD0689AF0D6 D06B
806,092,263 *53AF949721AE2EF64D4F4C9E9708026B890AE19D D06cZ
806,092,264 *53A6F5444174EDF51E977914C2161A7DFE5BC4DC D0&$7
806,092,265 *53A91CA71E3C089A29BF8A45066937C8A4842064 D0##7
806,092,266 *53AD75EE500DD2E2826B0D8937252644465E1F34 D07Ei
806,092,267 *53A8CA91EEDAC46346482008C74EAE70D3AF955C D$07L
806,092,268 *53AB8C4112A91271C74A15143D80B7B10F61C4DF D08;+
806,092,269 *53AE293A4B81E441247FFC9E16AE50565E1C0776 d0"8
806,092,270 *53A51E5D63E9D1DFAF9C99682357E6F5AB8F491C D08B?
806,092,271 *53A699A029388A99A373870618FF696ACE0D793A D08MA
806,092,272 *53A156D172FC25A6BDAB47D46EDAE44DFE35A610 D,-09
806,092,273 *53AC206F19655ADB9638F616066630DE71BC2E43 D090u
806,092,274 *53AA4CA844E4FE902D3D5CFE499F62187405FB5E D;094
806,092,275 *53AA07F80C9F1E1D4D731A6C666D8CF4DD505019 D096614499
806,092,276 *53A3A056DB3E259E614E49299D249AF5196B1701 D(09i
806,092,277 *53A21A38D550A6E1D768770AA0A5E7E642173325 D09mat!ca11y
806,092,278 *53A00DE4FEADD455E694A989F7BD4698F671B1E5 D09T6
806,092,279 *53A6363913644949049C9E97F0069C82102E8BD2 [email protected]$
806,092,280 *53A7D12A8374DA990437164CEEEFA8A0C9AE85E0 D0
806,092,281 *53A6C2E5C2687E3EBBBF586B8DCF4BA683DA7F22 D0aGK
806,092,282 *53A9A157C8505DD71FED0AB9D84AE8AE6B669528 D0Ao#
806,092,283 *53A24AB119A03DB328D5648B6F528C3D4980DF68 D0?as
806,092,284 *53A1427011F0DE61991270BC81C1BE301EE26E1D D0atl
806,092,285 *53AC1888834128A39F729927AD6EF5E2DAEC8360 D0ATt
806,092,286 *53AB7775AE86FF756A60F8D2102F8E1D56E58554 D0(#B
806,092,287 *53AE8262B459DEFE613A6C15C190F5157A56D8A9 D0(b+
806,092,288 *53A05A72EEC7EF644FB87A9DDFB7900CCB676C16 d0$B
806,092,289 *53AAFF81EEE14943008EAF69524127D724DBD394 D"0BG
806,092,290 *53A1281CC9CF12C342B52BB75AB0A6EA2165F4C6 D0)Bl
806,092,291 *53A987144F9DA5DCEB31C869296E6F0D8A775AE0 D0blinger
806,092,292 *53A8468A9854F915EF48950BFB43D92FE9BD210C D0b=s
806,092,293 *53A48475171A34CF4018E94BC13A4C70F39EF4D3 D0;c(
806,092,294 *53A527F41CF9D112AA38FF4D71F92B51671EA168 D0c,
806,092,295 *53ADDA51097F98F9B7FFEB78BFD307D7F31F5C46 D!0c3535
806,092,296 *53AC7D079FE4C06C36C08308321D794973121AA6 D!$$0C!4+!0N
806,092,297 *53AA9C8A3E502CE3C5F36AFDAE59311DA726B315 D0c&n
806,092,298 *53AA30B976A63333CAE7FF547E507B4931931227 D0CQf
806,092,299 *53A3B600A9D112FB6E3641C8430B6BDE9AFFCDD5 D-:0D
806,092,300 *53A7E0645DBCFC46508465C513155F5528824ED5 D+/0d
806,092,301 *53A50D7D05AA68AE3256B03E9486B377E087D97E d0d0a1d1f4fa4cce9c7d8b7a20ce093f
806,092,302 *53A092B7EB085C5F1FC5BB6A99738614EFC91D81 D0_dh
806,092,303 *53A1090AEAC53EB2333295C459FDF0B138CC27FA D0;Dl
806,092,304 *53A42FF77CCA9E69EE8E45F091A5A00AC2E5BE6C D0;Dn
806,092,305 *53AAEBA160FDE12FDD86236C838826062492CA0D D/0&E
806,092,306 *53A2943DEBFB391BFAC958E2457B61A15C12110E D#=0E
806,092,307 *53AB4267B78B88DB441B07B36F800F89A12DFC4C D0Ei3
806,092,308 *53A8176A352B996F7B8AC4AE5F990997C36F620B D;0eN
806,092,309 *53A4D015745B5C8F2FC11BA4CD2818FA5A212A77 D0F0g
806,092,310 *53A055C173DBBFAD1AA5DA3B03DD73F24107BBD3 D.0fl
806,092,311 *53AA8BBC23555C1187EAAF6AC0D2566569757B44 D0!FM
806,092,312 *53AE21B029A9C3E19B26857BE6F60D599299CCCE D0f=t
806,092,313 *53A31823ED5BEAABF2C19847F67E6630E9FB13A6 D0fu,
806,092,314 *53A953E2E808A589720115F5668B70C5493EDA6A D0?g-
806,092,315 *53A17B0C161B7BAA1CB39B7EC1486FA00F8F1C6B D0g:0
806,092,316 *53AB07631C445C521DCE817DFFAC8C5CF1F543AC D
806,092,317 *53ACFCA3012EB49E7A64B4B4C8556DF5C6B3EC75 D%0g9
806,092,318 *53A5853EA083D0EDB432D9725372DF2AECD9B793 d0^H
806,092,319 *53AC78441EE0FEAFE2A21915B485C7DFED92331B D
806,092,320 *53ACC24E7B7F467A66D9B046595E39BDB3ABF22B [email protected]
806,092,321 *53A3835B0BB0B3877CE8B3FFB478A58FCDAA51C4 D0HpK
806,092,322 *53A53644211F7C72F745E6288462C70CBA9A4623 D"0I.
806,092,323 *53A00B2C07FA0507BDA944242F89D5DD33F4229A D!0Ij
806,092,324 *53ABCAE16325A7190CDBE18B540A9A360D2AEB61 D0iNG
806,092,325 *53AC995F6541B02DDFAED27AD946427CAF2A0C06 D0/iP
806,092,326 *53A2A30B959A637F6F8E8C3483AECDD69E6115CC D)=0j
806,092,327 *53ACBFCBB96092AFCA32BE08E3F07E829FAB6784 D0+jp
806,092,328 *53A37BF11E2B81EFF7550324CEF762169FD62F03 D0"
806,092,329 *53A74BE5FA6D69509B8B1391F2D8A81132FDE7D7 D&0k,
806,092,330 *53ABDFD95B0C94FC2F23AA932B3DFCB48E476C12 D0Kc2
806,092,331 *53AC07499F155F1016A738321689BF288EF74F8E D0KG-
806,092,332 *53ACC88401E6AD3A41F1CD8A323C777F7C6780EC D0KpC
806,092,333 *53A0F293E7E64AEE380269EE53E8F77D6D84F936 D0KTY
806,092,334 *53A9D3D1D9E397539ABBD8665AD9F9A0F7F48926 D0l5i
806,092,335 *53AD72B27F710EF914E04CE32C0D5AB48EE7592D D0L7(
806,092,336 *53A6F88ECF16BA361B6A01FDDB92C17D4AB15D8C D0LB:
806,092,337 *53A768C171186B8F691EAD7E847277AB8476B8D3 d0lu
806,092,338 *53AA8D195608E67D808D3135FD72F8935DEF4B6D D0m,)
806,092,339 *53A4958C4B36F882392F52F10F0AB831D3A6A2A6 [email protected]!0n5
806,092,340 *53A1DF32E43606F23C09857CABC868BBED6FCC4B D0M9&
806,092,341 *53A56885434B7E61F7EEAE8FA839ECEA6B0719F4 D0MdD
806,092,342 *53A3EDC8A3B675153CC6BA4B3BBB00A2F63EEBBD D0mIV
806,092,343 *53ADE6C0565771CF316C6EEBF1588CC65D82AA87 [email protected]
806,092,344 *53A312D6BD71658638D0193A43F6EF42927BC8BC d0Ms
806,092,345 *53A0BFA38A45123D773CE11A341E4007703BF9CA D0MY&
806,092,346 *53A3FDE267D375443F5B18F0A5B701E256369D1A D;,0N
806,092,347 *53A75548168B32E3322CB11EB5D94D12EEB4F0C0 D/_0n
806,092,348 *53AF4607783EA1531F496BB99EA4C77E2F59DCFF D)0n&
806,092,349 *53A84874884E716AB9FAC2013DACBEDF807548D6 D0n47i0n5
806,092,350 *53A94CF8B2DB11813972BF6B7B4782AF94BE6A5C D0n4t3lli
806,092,351 *53A260582F375C0FB569577A8D77C8FD0F9FA9F2 d0n4ti$m
806,092,352 *53A16C11256EB11C3BCA1850175CDA198E3EBFAC D0NAw
806,092,353 *53A6EEFB9FC9D87875AFD9CD127246307E8B506C D0NH#
806,092,354 *53A5948713A80DC8261DE9EA36130AD9A73E5EBA D0NIY
806,092,355 *53A0B6B2B256AC65F083E5010DE76C9016785611 D0%O/
806,092,356 *53A997CEC09D9BCB3F9C5B063439CE132EB77CEA D0O(&
806,092,357 *53A083B17CB42DEF972F6666D9616F30D5325944 D=0o,
806,092,358 *53AB7CCA14419789E5922D13445FB45EC95AF0C2 D0o2,
806,092,359 *53A7A85878AF8722FE86517B55C6C337E70A0BE6 D0o5_
806,092,360 *53A86A994E3D837C30CE53347F7185C493AC4395 D0oYZ
806,092,361 *53A4592078E94396B797379B527A0AF2D1C546A4 D0p1!
806,092,362 *53A949BFB95DFF4A7D633C44B1F61376A978AC9E d0pendes
806,092,363 *53A3F7452DA763939F5B3E8435C9FBDED1BC815E D0pGf
806,092,364 *53A8C00516828083FD9581B2FFBA1E4F5DF2DEF3 D0piD
806,092,365 *53A575CFA7CE4973ADAB3415022980C12DEBD640 D0pl7
806,092,366 *53AF57E6A8B003EFCE473E35E89245D380491F20 D
806,092,367 *53A03DF5FBB1B4914CCB0933C0F5AD82C75B3F8B D0==Q
806,092,368 *53A04681E0251B8EC5DAEC08436A2D2DCE8E2979 D0Q#-
806,092,369 *53ABB512ABA2EE924B18397996BF3C683F091AF8 D!0=q
806,092,370 *53AC0D78BD8E618022673B88E8FFCA9C203B89D9 D0QRh
806,092,371 *53A2A0472C74A1C5D390D0C86792BBF5C579AEA1 D0Qsp
806,092,372 *53A1415EA321C8C3002FFAC427F886D7A7F2CD7D d0Qy
806,092,373 *53A1B7881BB8F118503789A4D73B3C1D37517700 D"0R!
806,092,374 *53A0674173BDDCBD370C0E886A5D0B2061231B62 D$%0r
806,092,375 *53AFE16A246DFE3AA7B1A916101A6E1801AA2CA8 D0R,2
806,092,376 *53AE6385918722C4C06B00AB402CDC1CB5DB4076 D0Ra$
806,092,377 *53A3F7273A4697F0F544878E9A489DD213B372A1 D0rj.
806,092,378 *53A3DC3189E37A5FB53420C2E8F032FF26530B94 D0rN4
806,092,379 *53A7F8CC6A14C08A36BB98F610A8D35ADD2F98F3 D0rQ_
806,092,380 *53AD6EA0C111DB570B66049DCC94996C96AFFA80 D0rs0radi
806,092,381 *53AD75D37E497826370F8966E49B21F833B37EF3 D0r#U
806,092,382 *53A0350010AF08C44D520D0F7C94A4E42B9EF790 D0++s
806,092,383 *53A7ADDAD95B40EE27BCA3D56E1841373911AF23 D0scO
806,092,384 *53A11F4C857437EAA8EFD40EDE78BAF921EBF9C7 D0sO:
806,092,385 *53A197B68B08D52B1C61EA97847A15BAF82C548B D0t17
806,092,386 *53A21451BC16A69D3EE0945C876B426EF5D40A36 D0tD+
806,092,387 *53A73B403C0993B5F212AC81AE48F5EB45AB4BF4 D0tm)
806,092,388 *53A54F2EB46B63EA6497AC3150DB50FC2C81B478 D0t=T
806,092,389 *53A91A437D08FB3A67A99C71B5E2522402F5A428 d0ubl3$id
806,092,390 *53A207A3FAD22821890AC5940D321808CFAEC567 D0UCH!N9
806,092,391 *53A0559EB949D7388907BE212BBE98FACE935A9F D0ue#
806,092,392 *53A33CB803784C6E9BBFACA99C47DDCAB2717B28 D0:Uh
806,092,393 *53A9215FFF01F399202C32879D96A63028C8A382 D0_UT
806,092,394 *53AE8E4E9A0EF569B751DD650CE0C3EAE75C9FD9 D0uUQ
806,092,395 *53AC2C185856070FD7D24C9B34A706753768F919 D0U+W
806,092,396 *53A2768FCC879894ABEAE12CEC79C51FD83201FA D0UW5
806,092,397 *53AE22F842F60ECE3F02C878A124D95112998EB8 D%+0v
806,092,398 *53AFAFE54F210D17722FC86DDEF60EA82B6333AB D0%&v
806,092,399 *53AF073EFF67825A509322B4F0D5CA7455590196 D0VDF
806,092,400 *53AB3237D485FDCC7431F93491BE4B51101F5582 D:0vI
806,092,401 *53AC827376806B00DF24A8BA697FE0ADB441E4DA D0V!j
806,092,402 *53A8DD7B21FEDB55F546546B5C53960390F4C237 D0VlG
806,092,403 *53AC6C483561E8C0EE10F3359B537A642817631D D"0%w
806,092,404 *53AD02EA4F17371E7069E2B78AAB7754C398C0C8 D0WB
806,092,405 *53A7062D6C02B1BD618783C0C4F56BE23893729B D0Wqr
806,092,406 *53A33D603464AB9412D4B9A75F9C09603BEC930E D0(WW
806,092,407 *53A4D213470983DCE3033CC5F6710280B4D2A061 D!0Xs
806,092,408 *53A9ED4577573508CC3320F3FC202D9BBE4C6244 D0XZ5
806,092,409 *53AA21F9E33B2FFBF58F39180122981FB80DB482 D0Y"K
806,092,410 *53ABEDE84E8F1ABD810F167317824DDD98B44F08 D#0Yo
806,092,411 *53A62109FF9AFC2CB25BF54BFD1979CA36621DD2 D0ZH9
806,092,412 *53A3C0BEF696B9E2D5805987A6A96CEF40242E50 D0Z$j
806,092,413 *53A4FFA5B6DA37CDBFECA3F56C6721E732D67F7C D0ZOQ
806,092,414 *53A6ECD2291374C78A72C2B6519BD58D012EF9A3 D=%1=
806,092,415 *53ABACBB323855822A0E25C0161FB5B3434B0766 D:1_)
806,092,416 *53AB1F6E5C5F2EDB1B168658A140E7EF0575633E D'1&
806,092,417 *53A7EB39F991297E0B0B66F82DDCEFD3028AE579 D(=)1
806,092,418 *53AADCD3D6B7D3040308942EE21395F5135F1FB0 D$/1$
806,092,419 *53A6A8EA33036826B5C040506107A1B2805490C1 D$1,$
806,092,420 *53A3FD0C5A47D29AA77B6BF7F57399FA988C8A6F D+_,1
806,092,421 *53A52FD9B5EB874744000DFDC82E4C18817A331C D1=
806,092,422 *53AB3ABDB672EA67D58EBCBF7B4A01DA79E5C5DC D1+_$
806,092,423 *53A890354C0B3FDD082B6F7C153EBDF8B230EBCD D1+&%
806,092,424 *53AC0C103DB08ADB67A4E9039B63EE15FC403FFE d&.1
806,092,425 *53AA358CF24FDBAB864571485EBAFF7A55A48D61 D1-.0
806,092,426 *53AAF924B0F049C81982034950C8AF7A3ABF09D4 d1006127
806,092,427 *53ADF6C82DF65501D3B279F505A7189AD6674966 d10122
806,092,428 *53A3C48F54053EB0A36E99D9A30F5A3C2B26DEE2 d103464
806,092,429 *53A616BFE0C95F8C8E9C2E2EBEFF7DA518660BC6 d109204
806,092,430 *53A1B8F4DD80F63A1C6441F84C09EF44ABFE126E D10Et
806,092,431 *53AF2976CC5014B3E3444FE955EA42B165DE2608 D10h;
806,092,432 *53A46DEA76867F7A722C88E0810D56813B428968 D1)0l
806,092,433 *53A93BF1154A60099AF1AFF8C4166D5C7551BC63 D10MK
806,092,434 *53AFE3396D0C17106560EF8990A302A332FD5134 D1#(1
806,092,435 *53A551CC92C31FDDF10823B78C9A2B5C284246D9 d110gy
806,092,436 *53A93931CB957F6E18F1715ED897813D267F7396 d112710
806,092,437 *53AF5E321BC1725A2642CE2E46BB5C990B7FAEC4 d118255
806,092,438 *53A2FD1216C9D5A028D02E384A81EC5BEA538DCB d118910
806,092,439 *53A955DE6ED5FB3B60040881BD9AC33BB2B7125D d119128
806,092,440 *53A2D317A3C48A424AFFBEB9A6359F638986942D [email protected][email protected]
806,092,441 *53A16C2C9FB8B51C6A6F448E56DBEB4E87386593 D=12:
806,092,442 *53A6F672AFBBF18FA38AC922D0A3A653B28B415F d120949
806,092,443 *53AFD9132333099A025D096038CA520803328145 d124445
806,092,444 *53A096DCABCCF4CA680894F700D814E38DBBD35C d126182
806,092,445 *53AA677980B2F6AD191FC6CF529D703FBC1E9EC7 d129115
806,092,446 *53ABB1E754D401DC74AAE471243941C64F9DF4E9 d129977
806,092,447 *53AF5ACC845607046572D80382F4585735E1D0E4 d134206
806,092,448 *53A2465186E29F4253C28F01ACBFCE8CD7D3B44F d134400
806,092,449 *53A6AFF611064CC375881631FC12279AD0CB3B3A d135291
806,092,450 *53A14C10F23731923DE1BF0E4A7D7B816E810892 d136733
806,092,451 *53AC37E523E696236DC57715DB989F7F43123361 d138596
806,092,452 *53AD49835EC0DDCF719823C365404C9D5F59FD87 [email protected]
806,092,453 *53A0AC15B238DFC495A77CBB1C7C308FEB9B6DF1 D13o&
806,092,454 *53A20FC4E1C14254380D326FD95F0D126A05FC61 d13rp51g0l0g13
806,092,455 *53A237F5DAD65E0C5BDB30082160C8BD45685C2C D=1;4
806,092,456 *53A0588DD053D90C8DAF8F442E3F4C3BFA42E216 d140734
806,092,457 *53A3FF32EACEAB1927B97C5F87D21915717732D3 D1$4$$0c1473d
806,092,458 *53A7E05B8D9C9E570422CD40618CF20882114298 d147402
806,092,459 *53AC445E8A8B9133EF56DE56088FABE01BA92ACE d14815
806,092,460 *53A1F98B61BC0AA52E854F24CCCE6F038B951BAE d148241
806,092,461 *53AD33881AECA9798DC12541550EFF27BE1601F3 D149nos34813
806,092,462 *53AAC25409135B2260F465A87180D7F78CE56325 d149r33m3n7
806,092,463 *53A787FC4DD2852E84D50A62FD42B68F423D4D54 d14c4u5t1c
806,092,464 *53AEBDD0647B836E59E735DD4F3D1F0AE47D8D9B D14d9
806,092,465 *53ACF2441C6C9CE701D44B1C36D5A2A71C6F9E14 d14m0nddr1ll
806,092,466 *53A05D42A13B0571721C278CB8D672C92661349E d150487
806,092,467 *53A379C57694FE0AB02F4CC2B4D96EC74AFF4C7A d15170
806,092,468 *53ACB0DD1B90A34B837D318522680AC09E7900EA d153348
806,092,469 *53A06BB3DE5146CEF8899010F43DCF6975FF7E4F [email protected]+3d
806,092,470 *53AAD6A3E63D7F6F24CE5231DF780F57AAAFC141 d155141
806,092,471 *53AE8481E53F364B3E77153E63B83B62EB02824D D1551M1LAR
806,092,472 *53A9CE1BA1E4D88B7F498416B58B9771D5FFD25A d155304
806,092,473 *53A9E2792D243F8EC0F4BA3316AAC37506614A3F d155ep1ment
806,092,474 *53A11145119B7291E014DA9497A220D5AA4A5CA0 D159RUNTLE5
806,092,475 *53ABD3ED221D7CD7907C8BAAD4F413BCBE42AB9A D15ARRANG3M3N75
806,092,476 *53AC7FEAAF51E49C834B024618709590DB6589FD d15c1pl1n4rn05
806,092,477 *53A90EE2DF8FCAA517DAABB851DE26DDBA567BC3 d15c4l3
806,092,478 *53AD122984D5CBE8C56F11BFECCF4B683D2A9E3B D15cordan71y
806,092,479 *53AA937199102446C36613B569DA2EE6B908AB94 D15DW
806,092,480 *53A4F4709953053D5F0E2872421B6153F82A2E6A D15E57AB115HE5
806,092,481 *53A69D90BB01E773357BACD8D6308CF947CF86AE [email protected]
806,092,482 *53AD2948935E8B2E93A210BD02E3FE0535575CB0 D15:l
806,092,483 *53A5B81C3C7E1F2E5BC1CA880A9ED03E9C2787D9 [email protected]@+E1Y
806,092,484 *53A0CEACD73DF63A0E3942380C9F067349B324F0 D15PLAC3M3N+
806,092,485 *53A9A978D6BEBF5FCDC4C0B2FF3EB58E060BDB34 d15putare
806,092,486 *53A6B25D3FCC8BE6FABA9F00732B7AB83C7855CB [email protected]
806,092,487 *53A07C5CBA074FF7F60292471994563660B4428A D1!5r
806,092,488 *53A90BB4E087C90C6080A7DDD70781C042BF7967 [email protected]@NG3M3N+5
806,092,489 *53AA022D7DEC1C24F0539A29C4EECC9C821D4A9D d16151615
806,092,490 *53A2B7E12F8286E9E4DB5A815A11219ECBCBA374 d163175
806,092,491 *53A3BA5E0D5F518BD47ED39111BF358530938059 d16374
806,092,492 *53AA2BFD150B7156AE58538AFBA0E0BF441E713C d1710778
806,092,493 *53AF78E29AC5E7DEEAB2543BF3277B1C8F35C5D7 d17746060
806,092,494 *53A5520F6A01D3E250C4AD6B7100FFECC68054DE D17(j
806,092,495 *53A89F3279DCBDD075D45A927E1EC9E813BD114D D
806,092,496 *53A7A7A3DAC3810E99F5B4AC6F1675D20E4C0F93 D1$7r4c71v3
806,092,497 *53AE420750C0C9DCF286BDB4FA0622B4A82C61D6 D17%Z
806,092,498 *53ACBFCD693295F975A0BF08C8F1F3F774C503DF D:18_
806,092,499 *53A350220E23DA69DFEEA689F45CDA74D385E236 D18;!
806,092,500 *53A362E0D7E21806B4F5A44D2106EC275643F0F5 d18665571
806,092,501 *53A0D6E7CF747AAB1485947D4F0F12B4358C8212 D18LB
806,092,502 *53A33A9F734C2A4A09D47E01BC8B5264046C770E d19871230
806,092,503 *53AC1D34ED16AAF41A62C6B4325AA6CD900AB53D D199203S
806,092,504 *53A855779EE561FEA107278E33C8AD1B71599F1A D19AW
806,092,505 *53AEE58F2BA498D3730734A2DD822DCA74FE4AB9 D
806,092,506 *53A66C6B98337CED33810EA124F8F896ED3E223F D19h73d
806,092,507 *53A3CBA4C15B75430880B139A9D0DBE118D9F038 D19;N
806,092,508 *53A6769DE0E95323F1694F66D0E6FB171F0D1242 D19s=
806,092,509 *53A4DC610F8CA0A9626A17B8B203EFCCFCFF1232 D"#1a
806,092,510 *53AF1883FD7A46CD12D6FA0B7C86F96B54954FA0 D1Aa#
806,092,511 *53ADD342312A975AACDAF9668F27A8D3AA182316 D1AGNO53D
806,092,512 *53A1D612146283CDB76A996CF3E8F419F4F9E1BD D1Ai4
806,092,513 *53A82783FA1181123EBB7EBED1D9E7C0EB1A16C9 D1A.p
806,092,514 *53A7834F9A453CC9D9879F2F78191F2CDB9DBD30 D1au=
806,092,515 *53A7E2F5452DD47329CB368A016BB9B5498B3989 D1BH,
806,092,516 *53A9BC9B2F66DF288ED9BDE5148FA77A2711592D D1bo
806,092,517 *53A3E025822E9F7E03915B16BF0F8E96CA1C8436 D1bu(
806,092,518 *53AE0D9D5F6658F763EB0299A4D9699B081D2E6E D1&bZ
806,092,519 *53A351182B906D9A21782CF23533FF8E9431B4A3 D1%bZ
806,092,520 *53A2FB6DBD4C1D5FB58891ABB78BCC9E84F03928 D1$c0v3r
806,092,521 *53A1D6C72FD665B8D81C1F90DC54538D6E13D6E4 D1C!6
806,092,522 *53AD576F2BCA6D6652A9CDFE7825A0FA645F2826 D1CGa
806,092,523 *53A8AD5E4FA33DAA2AD780D63EBAB37643C2B196 [email protected]+1c
806,092,524 *53A94906162FE5AA16ED1D97FA0414E527AD25FD D1cn5
806,092,525 *53A171C257CFD0A446B40D501AC20925D0402652 D1CNK
806,092,526 *53A29684B887C73F94953EBE71BE2D077867D6DB D1cth
806,092,527 *53AD32B7990E2A60FE74107D413B58859BCC139C [email protected]$
806,092,528 *53A8CE00C77ED21875D959EC39571B582B5E56CF D1cvL
806,092,529 *53A9F670213491A6A914255198A4734B9B783139 D1cW&
806,092,530 *53A7F72EA6E1C77A7CE9C2FBC30536A64E080AF2 D1d0t
806,092,531 *53ABCB021DAF6B7452633D93C7FF103E864755D4 D1d9w
806,092,532 *53A0B508E76E7D996A7D10D8F9599E5753FC164F D1$DC
806,092,533 *53AA7E3761EC80578A76472113A26A2E1D66E828 D1DEv
806,092,534 *53A7E4D890757DEED5091376AC684167CE5AE24D D$1)e
806,092,535 *53A4039856B57311896F6301EA8B59EA36857AC2 D1e).
806,092,536 *53A1BD40A0E200811054B10ACB8C201E1F338089 [email protected]$
806,092,537 *53A4B108A8DE32751BECFFC6C3BD0D2BE2F89DCF D1eB)
806,092,538 *53A8CF5F7CEBF2D0A8A581496DFD5C385A2D6DF6 d1ed7c9c5b1a2ffb36a4f7a6228d2588
806,092,539 *53A73D3DA79ED8F62F24F188F2949AD5CA12A8EE D1$ench4nt
806,092,540 *53ACF958BF9B2DB5979A08D7945C9CDB3D61652F D1e!t
806,092,541 *53A21A413A2038B6F993A6E7E0966592DB3DF1BE D1+=F
806,092,542 *53A635D203F3EC0F47537C6442C665A0304099B5 d1ff1d3n+n355
806,092,543 *53AD1EBAA67869FA68BB1BA3FC9B098EAAA0DF1F [email protected]
806,092,544 *53A4D9F9C9CC7DE20E69855BD098AD5D119CE124 D1;fh
806,092,545 *53A494E2A6DE9A515B75AB71341B5C4A6517810E D1fpv
806,092,546 *53A963B414FB1E2C7F78CC5DFCA27993689BC0F3 D1Fu
806,092,547 *53A83BAB4E2D4B94F07CB937A0353310D0F2CE4A D!+1g
806,092,548 *53A27B471D68FAEF6A95A0413F05E697CD48406E D1g:1
806,092,549 *53A17A5E7C28FC10C07DB2F208279D3B79A2E261 [email protected]
806,092,550 *53A4DD2242559B2E67A40A785236A373ACDF8764 D
806,092,551 *53A6605350F8A3748CE34065BF7BAA54AF9357A6 D1#GK
806,092,552 *53A51EB60124151AA468ADC19840DC74BB2D4BB2 D1g$K
806,092,553 *53AE0DFF55AA0CDCA265E0406CE3990833FF15A4 D1GU!
806,092,554 *53AC224CF613D4BE12D26E296EE78174653E5B14 d1h3v3lm3n
806,092,555 *53ADBFEC93440794D590E37C71B82B60DC56EC61 D1HA(
806,092,556 *53A6349E807DE54F1E289440E0219C7A016F74C7 D1$hcl07h
806,092,557 *53AFF062D9DC9385CEE30D7AEB43752CB4E60499 D.1Hd
806,092,558 *53A75C484275D4D6570EC2FC002DA40F98107F5C D-1Hj
806,092,559 *53A430D3705890078DAE0DA6D7437DC2CC4DC7FE D1HU6
806,092,560 *53AA69CA170B704BAF3F52CAA7DFD5AB43176AEA D1)I;
806,092,561 *53ACB82D415DBA1C3DC3AE216ACD086DC58DE1E5 D1i6N
806,092,562 *53AF48732C65BFDBFF365DC999E2B5865CCC120A D"1iL
806,092,563 *53AF9F9C7A6F8EE2D3728EEC65F1C69C4F2AFACD D1IO3
806,092,564 *53A32A8D9299B6EE6777553B69FFA668A938B0C3 D1iRY
806,092,565 *53AD7DE6A69E59CA6ABC584890BE2A081070BA41 D1jl0
806,092,566 *53A126BA88D3DD6356A5D4F808D2796BFF347289 d1JQ
806,092,567 *53AA8BD61B79AD31D95580A418B7D6C4EF81DA74 D1K#"
806,092,568 *53AF970E7E85ACE79A3AEEED81CB198D05426F71 d1k450d1n4m0
806,092,569 *53AB5FC3A1A9B917EF5D24EFEB70454AA698EE41 D1kDC
806,092,570 *53ACC4B472AC607659CF009CD30828D177658219 D1/kE
806,092,571 *53ACDDB10E0542A694D1CFC6B3674F91C0017CFC D1KGC
806,092,572 *53A23CC2CC1FCAB2DB5D10BEBE77F974C70F6433 [email protected]
806,092,573 *53AAA1459838331F2A44220E67C1D4486390B826 D1KTl
806,092,574 *53A1BD0ECEE9F69CADA7B5BEB37E0682B25A7C39 D+
806,092,575 *53A203E1465F4E4A1A594BEF4F44C8B2FE40A805 [email protected]+3r
806,092,576 *53A46E39837773E9CD6F92D60CA5CC382B361AF1 d1lambdodon7
806,092,577 *53ADC403A06B72E6D9E1BC3BB425D7DB246DAE8C D1l)E
806,092,578 *53AB20142CDD267F909F5F4A2E03385C374B6454 D1l&m
806,092,579 *53A4698D0D1439456A747B28988A5F35152D4201 D1$located
806,092,580 *53A53A8C297B7E4EACE0D864BFCA429C16F52709 D1Lq,
806,092,581 *53A1FEE1C718A274FBF2EC6C0A5936F725DE7823 D1l_Q
806,092,582 *53A08A118FF701E5A540A36625325071951B4B6A D1_LX
806,092,583 *53A433284465BF08A8300D9C984848187A5F20A3 D1ly
806,092,584 *53A7D38E7BA965F9E5621BB587C1534F92D172CF D1,M
806,092,585 *53ADCD0FCDEDBF4376D45259A0F57BFE8FBAE7D6 D;1m0
806,092,586 *53A3F843A3361B1A4B2EB7F75D5795F5603CC569 d1m1trykurl4nd
806,092,587 *53A22F9FB7071502EC33790F8FFE3DC51AF4F000 D1ma
806,092,588 *53AD16A40944F5E19510448A42940DCD1E9EF56A d1methachlon
806,092,589 *53A7C729A41FA59096AA2FC9B128A6B34EC1F739 D1M=h
806,092,590 *53A3900159083BF59B2E71B0008C2F8E684F3BF9 D1MmQ
806,092,591 *53A26B8020A89571C63A09EB379DA6301B595A02 D=1MV
806,092,592 *53A7025225B8C6E2C7CC575B0C79C7B44F865CA8 D1N9:
806,092,593 *53AF45FC7FA40A80120EC21F9FEEDEEFA4F26CEC D1N9135
806,092,594 *53A0B5EB866059B9B5E344B3F86B6D2EC3C448A1 D$1NK
806,092,595 *53A7B11623A70A0F732DC18E15067E8E90ED4DB2 D&1O
806,092,596 *53AF88798FADAD2BBF2D752C524ECE26BBE5688D D.1o&
806,092,597 *53A575B685E38F5A3440A1443C46F375E70DC474 D1=o,
806,092,598 *53ACDB924DBA7F821A5E35B3DA610DFC19E9C334 D1=o/
806,092,599 *53A57E9DE79F41A373E80466929A5411940B663E D1o$=
806,092,600 *53AA1D192F5E3A8F7C900711208646B0F005F615 D1o1#
806,092,601 *53AEDFDF55FE5ADC7D78BED5A3E03FACA6615CF5 D1O15
806,092,602 *53A0D83D4A689122B8A43695BDB8D6D188E11149 D1O3-
806,092,603 *53A6BF57165D12BEFB345BC393C1F9F1DAD6404C D1ok1
806,092,604 *53AE2545E280CFBF643F7FE15FF5754AA5AA9F06 d1$organ1c
806,092,605 *53A70F5B10759B847F2362915AB9A62B1D5902FE D1OXp
806,092,606 *53A3ED889F2CC9369C8020C437C477C26F0B2562 D1_$p
806,092,607 *53A85E764CB149D825863ABBC022A8A4E908A553 D1?p/
806,092,608 *53A492A855253DC6AB8B821110571CFB130C5A2A D1$P3
806,092,609 *53A55030B842B30C00B4F4861B45D9E1D03B8171 D1PHu
806,092,610 *53AFDA850F6DBF98F5B16FDD734D63112CFB64A0 D1pl0ma+5
806,092,611 *53A7E070F123EB2CB18D8D2AF06C5833034C50EC D1P+R
806,092,612 *53A1FEB05A42A19F5CE58549325BED0B319CB426 [email protected]$
806,092,613 *53AD6C2BD34203702E0257EC722588E5C6CB498C D$1(q
806,092,614 *53A035804C1E1624ED6E8A6000817E91D920A827 D1q(!
806,092,615 *53A3B05DA1CED4BABB7FFFFFA1065696C86B0454 d[1Q
806,092,616 *53A130D8A94097C0BE07B61B3A076F6DB121E9CA D1q7"
806,092,617 *53ADD5D4DD21C044661D4EDE94904F9F50D87710 D1,qm
806,092,618 *53A9D76AA1018878B407271AD18C79502FB65712 D1qmX
806,092,619 *53A55E7497D35AEC80B9E42067B7D89028A1DBAC D1Q/o
806,092,620 *53A5BA70248E7BEEE159C5D583C63C1BCCC2FC21 D1qP
806,092,621 *53A9B56DA306FFE193753CF7CC35AA0B2C62C2A5 D1$QUA11F13D
806,092,622 *53A42CB60B1F4B5580282C8CD10729B4EFB26781 D)1;R
806,092,623 *53A35833154EC838EAFCFDEAE91BCF4AC2FE0AE3 D1$R3$P3C+AB13
806,092,624 *53A4DD4AAFAB3EA8B3B33C6105DCCF29358A462E D1REF
806,092,625 *53A6E9F5F8B5963D5E8D02D560CCD9B3F56CC60D D1rT8
806,092,626 *53A9871C12DB56898F3A1DB0C9596EC8D54F400A D=1Ru
806,092,627 *53AC921E5771E770F8E31ACA95FE538361750D6F D1s0r9an1zat10n
806,092,628 *53A2479E5EF4F26082F64092F8477291CBFE8B09 d1s0red
806,092,629 *53AA107A9A134A551E9C5D9527FC9CE5690C4F76 d1s481111es
806,092,630 *53A66C32BA99ECCA7AFFFF603CCCB4E30F6417EC D1S4SS1M11471VE
806,092,631 *53A559A00C086BBA211620DA83F2804F04308C6B D1s7as73s
806,092,632 *53AB222C0BD9B60259DE5AE3852A4EFC1918A2D5 D1sf19ur3m3n7
806,092,633 *53A7EA99072651D820E149C443962ED3458C099A d1sh0nes1es
806,092,634 *53AA2AFF14FC74C7F71807CC94FD0CD9C5ED6369 D1sLd
806,092,635 *53ADAD1E30483862239806C7969FDC91A8D7FCCA D1sloca+3
806,092,636 *53A5C7893FF2AE5301E3BAF0D065703037665F85 D"1SM
806,092,637 *53AF3FE62F7A22517FAE2DA8727689E9D2C98006 [email protected]
806,092,638 *53A6BB045AF5A598B6D61E2F3874EFA91D0BD13A D1Sn(
806,092,639 *53ABFD038D1CE68BFFEC4CD92D4271EFCFF9C1FE D1Sn#
806,092,640 *53A2EB396D1486167DB043F4239CB54621AD4924 [email protected]
806,092,641 *53AE4CCAF52B8C60221BAECAD2BD16393A5AD860 D1sor13n+a+1n9
806,092,642 *53A57884C34B0E8C6EE1F527E28AC911326D9474 [email protected]
806,092,643 *53A78FE70EF5900E6CADA0A9856305061E7FE86A d1sr1buors
806,092,644 *53A55920E4ADE38DA286F63FE29451658A6D69E4 [email protected]
806,092,645 *53AA40B903220365E67F1B9BD50058424FD48FB5 [email protected]
806,092,646 *53A71A5688B4174CCF107807D2787DB8B50F5255 [email protected]!$t$
806,092,647 *53AA9152B6FD8B1CB67A9E26CFDE38C04F8A5CFC D
806,092,648 *53AAE744EBF39E366A696BC01149EDC5079A11B6 [email protected]
806,092,649 *53A0FF1EB5CB7518B7FE0F3F8AD85BF8486006EA D1"tN
806,092,650 *53A26EE76DF5A9BBEFC0727FFDC1B58E8BAD02D5 D1TpG
806,092,651 *53AF02CF5423868DE7ECD342FBA70831DF3246F8 D1TqH
806,092,652 *53AB3F9E464A177CF1D1ACAB35EC48746D5985F1 d1tr1chotomou$
806,092,653 *53A90C3840389621CAD9EBA29E68E87AC74791BB D1u0$
806,092,654 *53A2D4E0B4FAD7D9E4FFF4DAB583D1E2FDB7232C D1U98
806,092,655 *53AE0A6B64FDFEA80A80827B5B8772F2AFC0E635 D1-uc
806,092,656 *53A494639C5AC501E4D8DBEC1479A624E7A6755F D1?uH
806,092,657 *53AC1310E8EB345CC6539A99181D56BFCA2B7E2A D!1UW
806,092,658 *53AC24849AD81D2DBAFFDB9730C027685490986B D?%1v
806,092,659 *53AF521F1D90598125166644A29B00E2CEE62666 D:1vA
806,092,660 *53A943DE56D56763E1892905DB14D1BAD7AB2834 d1vers1f1a8le
806,092,661 *53AB9A3DA4306CF1A639AD038A1ECF80C49BF69D D-1vg
806,092,662 *53ACB34B50A8D07F16A99BB2D6E2C4BA7F4A6D26 D.1Vk
806,092,663 *53AE16A941E0ED6C4A06F01CED8564963F31D79C D1;VY
806,092,664 *53AB10A4F9F07AE1465E71AEE75106D3E81BFF93 D/;1W
806,092,665 *53A851FBA4677B091CF801CC28922C9941989D02 D=1w;
806,092,666 *53A84A65C3EB7B7C37E928EAD93F797411DC5857 D_!1w
806,092,667 *53A1A77C958E7DF0D630644D842427C52931968E D-1W5
806,092,668 *53A2A6CEFCBF433EB12D11EEC969C46428DE8631 D1w$c
806,092,669 *53ABA040C18460705B6F8F6D14150E2476CD5A8F D1wk.
806,092,670 *53AAD8B37F5368FBED72198282A4B7EFC4073012 D,1ws
806,092,671 *53AE06141B57BFF8FAD4434F5FA35F5A9B7DA21A D1w:W
806,092,672 *53A40E568FC711D1B7D88EE5EBFA33D194FD8349 D;1X-
806,092,673 *53AC5AA54FAA409D5D99DF2A188659BBABC6E32B D1X0N
806,092,674 *53AD5FAF86B613896A2391303C8673A5F3797A94 D1X:4
806,092,675 *53A348BA4B38AA7AD5BBF482732CD80A3BCA24A2 D1XF$
806,092,676 *53A38FA1874CB8F93840D6C2EC8A3D4A2A643EE4 D1Xgp
806,092,677 *53A8E9DD502DE663B9CCBB883E273B9941F14351 D1Yir
806,092,678 *53A84C40C8090C165FF143D61C37D3E0EC30A272 D(1YT
806,092,679 *53A94F302E24B102592C2F05BD3263ADDA2D00ED D1;Z;
806,092,680 *53ABD1727D3E79CF7A534028302DF431AF8E1E9E D1ZEk
806,092,681 *53A29D15AAE251EFF67C78BD7E0166A2F6EC87DE D1ZZ1E$7
806,092,682 *53A2BE91B4B314370AB5FA95EAFB706FBB3D6AFF D=2#+
806,092,683 *53AD5A74A3B8BE581D7F8931C22EDD588367CCA8 D_,/2
806,092,684 *53AC2D9669E5D6F11E716A9D9950FD4595DB353C D?--2
806,092,685 *53A99E82EF15AC217D802F5490F201759862B304 D$="2
806,092,686 *53ACFA2364C93E244336A37C8F91820DA4EBE04F D
806,092,687 *53A550806533FB24AFBF1E55E67426CA0198C2DF D2(-"
806,092,688 *53AEDDB7B877F629650FFD95FEBB62C1983C06EF D2\|
806,092,689 *53ACA8A98DAA05CA675F305D9CD39C162872535D D2#>
806,092,690 *53AA0BD92CA70568ECE5A21254D81E2A14B958BB D2020110916Z6PRY1JW9M5O1H
806,092,691 *53A94A1B2508F524A09BEFBC81CCF476DBF91803 D2-06
806,092,692 *53AEEB4BA689BB75434C0D1E75114E41F0ADE72D d20641451
806,092,693 *53ABEAFF693BB9A06C072BDF200C2ACBBEC15E43 D20I9
806,092,694 *53A02EFDDBDD007418093D07C77C46A08D259BD5 D20vN
806,092,695 *53AC2ADCF76E5BBBFD127413D8BE5EF6AED70532 D20Xn
806,092,696 *53AE950663FA0CBFFD745E4D58956E0162EC4F52 d21677f1-0722-31ba-ad82-3ad126ba1c37
806,092,697 *53A9D0A55A12E1C10897D7F5642AF2897C96454A D21B:
806,092,698 *53A8D260A335601AE293F2B4F17D97A4B37DA1A8 D21c(
806,092,699 *53A8BE683D2D32D2328C3583A33BA7694691EB7A D21DX
806,092,700 *53A42B334B93978C3D8CFE5A2720D5DAFB7ABDBF D2;1f
806,092,701 *53A7673882A4CA99337CDCF0151B14354E98D02F D21-n
806,092,702 *53AA6FC0F1FA09429E87231DA8EB86D7C2416191 D21q%
806,092,703 *53ACAFDE9563A0F73D5BFE4F0C793EACA1FDCBD0 D2!1W
806,092,704 *53A288BA0283797342A518639A83A798171C6BC2 d22,
806,092,705 *53A7E42373635290A484BC471455A799DBB19ACF d222859
806,092,706 *53AE1BC0FD650E1371C43D3E952960018DB75E5F D22DC
806,092,707 *53A2F7DB31CC304EE4172924C41F3D419893E6E9 D22-I
806,092,708 *53A4E6AE8923B2A0F5011811C0FA35DE04300596 D2_:3
806,092,709 *53A41FAD9F7B3B55A8F4854DE9FF725EE6A217C1 D.23B
806,092,710 *53AABE5FA86EA0C44FD04EA49B5EFC78F6C25F69 D23L6
806,092,711 *53A27D80F14FE789790CA8B2C656A839021BA626 D"23n
806,092,712 *53A7B7A34DCF19ED5C1E1B91BF073A6CD75CA038 D::24
806,092,713 *53AD3D369EC33F434C373280C5AB8BAFD6471B5D d24*
806,092,714 *53AD9484FEA51881DDDE2FF31373097DAC9A06CA D242g
806,092,715 *53A6643F01CED66285341AF10857B7B131FD9687 D244b
806,092,716 *53AD2156AE26F8FA996164C28D24F79A4F631E13 D2%4a
806,092,717 *53AF46B466CC263142EB82A40A9A592C4F25C74B D24cX
806,092,718 *53A87EA1C16A2621CBA5A0EB84C519F26BC5C7BB D24?O
806,092,719 *53A3BAB344FC33081C4DA9850A54C458560C2542 D24ps
806,092,720 *53A7A16DBAC64DE71E3CBA08882F2B57D70DC2CE D25_5
806,092,721 *53A295A61D7B106821B3AB0D95820A2AD70757FE D25a0
806,092,722 *53A1C6BAE4F8835216FF77E319294EC20477D3E5 D2
806,092,723 *53A12C1E7099B8C35928F4C5F1952EE6847129CF d2632108
806,092,724 *53AB08B720AEB7BAAE68E3995DF612F2217C6DBD D2.6W
806,092,725 *53A6A45CA77E8B5AEAC1747EED7BFDE30C77E069 D-26X
806,092,726 *53AB2656EF28C249FB63665253572ED7116B3CAC D27035F9
806,092,727 *53A1AA9FEA87B1190CBE1C452FB3765A9C7565AF d27238aa010067919a70426892626123
806,092,728 *53AE20E1C54215DCE817EB4FB873604E0DA87E33 D:28;
806,092,729 *53AD85E96C47998CB9EA19EB9C814CF0F10D9CC4 D28
806,092,730 *53A60B0AE1E8382A54C17F3F4D036641FF71D339 D28752
806,092,731 *53AF66B3D447989CA8297CD0E68A93434BF76178 D28FV
806,092,732 *53AE56D440DFC3634FFB1B5467DFF3466C4B3477 D$)29
806,092,733 *53A083366FEE6165EBE1FA5223516D7FFA1DE1CF D:292
806,092,734 *53A0E041D6F16B26854211F84575DE366EED9682 D29%d
806,092,735 *53AB79A96745B89BA3559739412B692ECF3B5A85 D29Hu
806,092,736 *53ACF4258024ADB64D5EAE591586A100A43799AB d29linie
806,092,737 *53A22C3ED91D4CDAC93C7B23E186E69C57DD90FB D2A(,
806,092,738 *53A4422D7445C97EC6A9F0834855A352D6BC4178 D+2a$
806,092,739 *53A169DD0F01EDB4B64BB42D16EFCA81F0167BA6 D2ABZ
806,092,740 *53A1372EF566DB83F87EED647717B2F4A623E87F D2;aF
806,092,741 *53AD1A7A1F86CFC8517FD222CCC9851467F0202A D2?AZ
806,092,742 *53A061AF9E74914F7109CA4452226863C4D02C56 D2;B3
806,092,743 *53A0DB3DBCB6B59C189DBC1388EA902D1234598A D2BBU
806,092,744 *53AEE0B08CA4E4F56854074816AFCD0F7ECA48B9 D2Bo3
806,092,745 *53AF7D448F5C8689F197A9752EB3779ED9919485 D2BpS
806,092,746 *53A4E7324253FC2445EFA40D87A9C6276441A040 D2bYG
806,092,747 *53A7D76EC0F123B60805D80A884DCDA786449698 D/2C/
806,092,748 *53A6409FE71546864B80621EB83DCEA91741155B D2&C;
806,092,749 *53AFD37AD38A4A4F5493BB1AD6E6B164C328E885 D;2c#
806,092,750 *53A9F45500C406FF8F3901E780EFF3D274696394 D2CfX
806,092,751 *53A4DCE3DB131D3D18F009F5E070A657ED1C9CB6 D2c/R
806,092,752 *53A099BD2F6EB2E234735993D5456B93CA1066C2 D:2#D
806,092,753 *53A5F4E4340BC9384DF639E221DB1B561A0EE628 D2D:3
806,092,754 *53AA0C69972D7B6CC9C273D168873520239DD3A8 D2);E
806,092,755 *53ABA7DE44561D55E515E5049573922BE963873B D2E?/
806,092,756 *53A060ACD2C5AB0F5CAFAFE739AF387388E821A4 D2e6g
806,092,757 *53A8EDBAC2DC56F4A1F287621C99245470C616DD D2e&7
806,092,758 *53A8C78FF425627610D38A5EEA465E8CEC07A311 D2)eE
806,092,759 *53ADBEB8C74E3D9170768A40FBA4F7EA8E1969DD d2ee5e6b-150f-3739-9e1d-5419e4b66a90
806,092,760 *53A86EB6D3980F4E3B4D620FC1A8BB2C660C5377 D2F7E
806,092,761 *53A2C9704D9494651A01A90F21D1D8A1D8CE6854 D2F8m
806,092,762 *53A75630AB3ED6081CD0961C93CDABB2C72581B2 D2F,A
806,092,763 *53AB162DC9EF03111E00A40863C89E20D13BF907 D2F-R
806,092,764 *53AC1B67881F3E6B0E9E1BD1C07FCA7F2A62C371 D2(&g
806,092,765 *53AFCCACFFE674A118A5DA3C6BC27FFFB15D97BE D2G1#
806,092,766 *53AC931A704CEF20A441C037250AA26B9DD23CD8 D2gNg
806,092,767 *53A7E10E64D85200F9DE4FFC216BE9BDA237AEC1 D2gOV
806,092,768 *53A3C6981680ADC104F25DDDB26086961EBF2E68 D2guG
806,092,769 *53A7D431F4D99360D78CE01367C009E9A7861E81 D2GY
806,092,770 *53A42B593FF172E367B3A4BD25B3159603541E6A D,/2h
806,092,771 *53A3F0901E099C2F373DF3D7A4EEF976AC1B4890 D2hE
806,092,772 *53A099F8046C7D526AF7447DFE7C26ECC8FF2B05 D2?hF
806,092,773 *53A0BBB09CBCD3ADDBB139A9223D83F7EA8A094C D2(hI
806,092,774 *53ADEC546ADB2A3A26CD8EB338C5BA638432C96E D2HN#
806,092,775 *53AC0915A4AF7F8063F1C1EE352DDC693E602F79 D2h;n
806,092,776 *53A61CD59856A8F19E460B513AAD164A618A6C9A D2!,I
806,092,777 *53A0AE52EBD26EA6F2366DE067C60B7EE54E786E D2ic6
806,092,778 *53A519E1FA9A6F30B4901C67B41F1D6EC20F1BA6 D2icO
806,092,779 *53A0EAC86593B0D172BA6B0A9467CE37F3492477 D2iE"
806,092,780 *53AF106764BC96E4291CB83C302BC1CF224976CB D2_il
806,092,781 *53A22420B22093666A04905A5A3604E271141DE0 D?2IQ
806,092,782 *53AC5D20C0F55CB848E9A2A37A7EF4CAA13F42D7 D2;it
806,092,783 *53A5945EFC80C023E4D666BF103A4A57D785FF9C D2iWp
806,092,784 *53A38381B97AF405C60001FA593B7B0C6E5357E1 D2j49
806,092,785 *53A4E95F3ECC4484B41F80919D8A46A65840873D D2jd7
806,092,786 *53AB3692E87F91C3B2FDBFD16C1032AB21D5BC4C D:2je
806,092,787 *53AE74A5C201342DF6D53943CB1D329946B6BE61 D2jiM
806,092,788 *53A1A2EF65BF5855F3286FDE771CFB4167DE5B34 D2jm#
806,092,789 *53AA7EA8DEF0A05FC03398C1539A609E0C78886C D#"2K
806,092,790 *53A71B396616F8425202A971E6D9F22A93124460 D2;k?
806,092,791 *53ADF5CB3DD6D40D2749B6F517DDF0210E2B7E80 D2Kb$
806,092,792 *53AE1996C1D6B659043281F428EC98CF1897ECA7 D2Kk3
806,092,793 *53A52CC09D10197B84C45D8EC440524B471C67AB D2kPi
806,092,794 *53A42F4BCFE5C6DFD323AF53B8A987849DBC6A85 D2;?l
806,092,795 *53AB159C8176383173954A943600B78F1352C8AE D2=LF
806,092,796 *53AEDB0B911AE50463D32B3D44FA2ADAAC7A6495 D2lHW
806,092,797 *53A629877868C0E00A852DB25E5F51F9D829771D D2m0b
806,092,798 *53A94883C8175B05C7E2695E72988881AD996FDC D2m1A
806,092,799 *53AE87225DE6A19FC6418C012EB9B8328512B043 D?2m5
806,092,800 *53A755EBA659B72E68589B4B98BDBC43A2A76F2F D2M.d
806,092,801 *53AE0E52FA8616B0FBB405C9D0782A3B192E97F1 D2mLf
806,092,802 *53AD48732F76903844CD4A9B0913A4FEA280923B D2M+P
806,092,803 *53AE2FB61640F9F96E7251239BAD5E8AC648CD9D D2MqW
806,092,804 *53ACC892CFE0751244D50265387D2D6FA4D8ACD6 D2_MX
806,092,805 *53A1DC6611E390090E73C42341C1099B8E698FE7 D!;2N
806,092,806 *53A6BF2169C4FAEB3EFED9B2AD7FCE5A50C311E8 D2!_n
806,092,807 *53A25C307B44E034E9CD4078F3B4B6CC1AD3B3EA D2nF0
806,092,808 *53AF2995703AD3B2E891A94E4AF50BF5964D43B5 D2nfQ
806,092,809 *53A0201EE79A92191128972C8FAAF2AAEC097A7C D)2nG
806,092,810 *53A0BE502845BB158F762BD02ACAE9451EEA2291 D2NM%
806,092,811 *53AE5AC24BB7FF85BEE4FF5172CDE6AE4D5A3BC4 D2NN3
806,092,812 *53A50E21E2C95851522FBCA734B782E30F82E9D7 D2oTu
806,092,813 *53A2354D7BFC3AE3F3FF35A364B7AF06F152BCB5 D2oY1
806,092,814 *53A69378C67E868A0565C0F44733CF9F987A9D89 D!2?P
806,092,815 *53ADDCEE11B743CBF62C286A0B7D860E7EB24E41 D!2P)
806,092,816 *53AC97AFC34376320AE75D94003013F4A900157E D2#:P
806,092,817 *53AA2726DF4D1F06F0DB8847179D6BF28849C155 D?2p8
806,092,818 *53A52A3240E76389A41E140B9FC01D2B1CC7C86F D2pc/
806,092,819 *53A03E0BE1C9BB94AE0C56246DD5FE0DEF50C610 D2p$q
806,092,820 *53A3EC37680D71A440B32AC8A29E352DA07B8F11 D2Psq
806,092,821 *53A5C87F76265A070F1877DA85CD5191A93DEA6E D2:q_
806,092,822 *53A4B2A04BE2BF4899091FA9CA9524ADA83EBBED D(2qg
806,092,823 *53A667A1FA40382ADEEEDECF933C3E654F374453 D2Q!Q
806,092,824 *53A595E9DDD25F28A6806239D008653A41B6A0F0 D2;qt
806,092,825 *53A232B65E947EF5916BE7ED50395D93608D31C6 D2,R(
806,092,826 *53A990B5A6ED7D5741A2B9D52EF5347CCFA0EA5C D;2ra
806,092,827 *53AC7EB546E069676F4295D8A1325CD86D26E037 D2rCM
806,092,828 *53A2D7B1FDDEDFE5E26D8DCF777C5B840F540B77 D2rGo
806,092,829 *53A25A5CCFE98C1CB927FE587F59C09EF291E844 D$2rK
806,092,830 *53A959EDC52AC71AB6DD15D6F3E18BCACB477669 D2rLG
806,092,831 *53A627E3A085A28E39E7C558C6CD8C56F65B1C27 D+2RQ
806,092,832 *53A78E152E4BB56E1DE82859BC45ABD3A08D0758 D2RVe
806,092,833 *53A45230B74D8C9A42900A6B0B153D4A5C54A85F D%2S)
806,092,834 *53A7A45A78C53A51C6DDE66BE524400EAC1C709B D
806,092,835 *53A71F0BCA2726DE16B0467617ACAA5085FF805E d2smelly
806,092,836 *53AA37DAEC126D1D984FEEEED14C7BE4184CE7EC D2S
806,092,837 *53A10107DD4412659D0262C1B04E4B12545D2706 D#2t-
806,092,838 *53A6EF5DAA63D7BBD9D28A50443D565EF093C101 D2tc;
806,092,839 *53A22B76175D535C2A63485D890D45541B776B19 D?2tM
806,092,840 *53AD7608CEBA670DA8DC867169099993AE290865 D!2tO
806,092,841 *53A9F3EA00014327479D850D4D3F550D5400515F D2UBs
806,092,842 *53A4A49652C38864209D0B8F05CDEF2783FA2ACF D2+UC
806,092,843 *53A96583CF038D217472205BB811CC586C8D4CCF D.2uL
806,092,844 *53AF9D5040FC378A8EFAC9EA9FBC6EC245DE4C81 D2US)
806,092,845 *53A7336835A2AF7CCC7DF489C2DB14F4112276DB D2uup
806,092,846 *53A57C734C69DBC975228FBC307CC373FFB28969 d2=v
806,092,847 *53A0CF85FBA458AEBC1BFC6E920C6E54E0AB4529 D2v2h
806,092,848 *53A0DD842D51C980E6E4B962714977A7C89089FD D2(VA
806,092,849 *53A02A3907250B89A350405DE20A7B2BFA2D80E0 D2vhR
806,092,850 *53A878E6156BFF4381D0BC7D98DED3B6BFC3F63C D2VtT
806,092,851 *53AE5EE0FCFA1842C1DED09423CABEB261AB77D3 D/2?W
806,092,852 *53A03259CB7614207FBA7BFEACF2542CE574A046 D=2,w
806,092,853 *53A7709599433D0F8A09CD9AF8667C15D171DC28 D2w63
806,092,854 *53AC9BCAEB9A098CE147D2D30139CF087DCDBC14 D2"Wj
806,092,855 *53A7CFD11EB252659D29DD5DDD3A59CCCF8406A4 D2X1a
806,092,856 *53ACD20DD3BE9E88E6691C82ABA417883DB7E139 D2XG.
806,092,857 *53A0C02146D7AFA95CFE9D5C177B3B845CC6B507 D2Y$5
806,092,858 *53AEA27BA4830DE32ABE2676A402A327410EABFE d2YF
806,092,859 *53A0825554D292D1582941462217FAA2F5C4B55E D2Z?%
806,092,860 *53ACBA9A87278F5FE426286EE1E6864907D05816 D)3//
806,092,861 *53AB9E3D209782477BA2F9AFE72E614D3C0AEDEF D##3/
806,092,862 *53ADD5A12B2D98F6EFC0A671D6C569D352E5D0AD D+)3?
806,092,863 *53AF068AD45C8EFDAA6987E1AC0B18BC13B2C54C D3,>
806,092,864 *53A5C4C74F5D990B3C13C3527C99989C23A8C0F0 D3(_#
806,092,865 *53A8AA809D2A59AD5B122829A9B45FCDC41044B7 D3$,#
806,092,866 *53A3F8DA04949379B429B49AC98A33B9B4ED9860 D3+?;
806,092,867 *53A777DC18F7254C8AD2CF78205320D9F1F927CB D3
806,092,868 *53A6AB9FA561DEABEB007C8F652D970EF92CB7B5 d+3^
806,092,869 *53A7A261629346DCF7436CE6577A9C8A7CED236C d3(]
806,092,870 *53A59680FCF0A528F22D3C9AC1B95FEA6F0E7A9A [email protected]$
806,092,871 *53AE3C50C242241675C9CD481F417155569ABED4 D$30q
806,092,872 *53ACA615DBA8C8C47E41050F6F8360F80DDF2E29 D30Tu
806,092,873 *53A10198DFE4807EC62D8467E48467F17DA2BC4E d3113841234
806,092,874 *53A82F4D0BAF5C08D2A96E21114E683EDAF98FB8 D311cat3553n5
806,092,875 *53A554C9B9E208887D28BF4B58F2B46E4BB03634 [email protected]+1
806,092,876 *53AA43CD3FC9E3DEDC0D32795DE66005A40769E8 D3174!c
806,092,877 *53A469B02EE7D678E0D0A618C01D88C37B8BF29A D31Ik
806,092,878 *53AC25404BAE0D408955EA36FC08903657FBA4B8 D-31K
806,092,879 *53AB45A7A2FEC41212D184DA3A0C522114F9C76D D31Mk
806,092,880 *53A6BE2106A0CB838D61BF93769C6669260CC128 D31QE
806,092,881 *53A3F5EF88A6049F1E857BEEEFF669D7F3382025 D31rF
806,092,882 *53A75CEBAC8673D9EAA2B10A20D2D59CAF1222E8 D32;&
806,092,883 *53AC135F71ED54851C7969C543D2B4BF51CD59E7 D3:2C
806,092,884 *53AFD18EBDC1C7320D22913C6A001CE1A016D6E1 D32o3
806,092,885 *53A1B7D67F08929B0403B9332064691FA0B86360 D3)2R
806,092,886 *53AA2FB2F745782279B74A825FEC7C070D3CCC47 D)33:
806,092,887 *53A98C6CD0A33DEB86B05D1374CA52286666BFF1 D%33+
806,092,888 *53A7112847007B71BAC3F2771FB092455410EC83 d3388.bbs
806,092,889 *53A08C55DE4F337C52E2C3C83B6C2F9BB64B7DF4 D33h.
806,092,890 *53A48F62F270E9BA31E4F91A94A20E00D50636B2 D3$3N$!T!Z4T!ON$
806,092,891 *53A604E059C98BB5416E7375BC0C17BCB46B9746 D33pI
806,092,892 *53AD068B6D6C11CE45F9A8F7817AB7D7A7A07C86 D3.3R
806,092,893 *53A14FA6188AC74F7F54877D35AE963CDF733D74 d34%
806,092,894 *53A98F53C0533308FC908F016C4CD21439C2C9B4 D34C+!V4+!ONS
806,092,895 *53A4B51A7497C28FB08968BA6589D36A15E6D70A D34%L
806,092,896 *53A6590A2A47498CBEAB3F80C3BF1F5C539E4156 D3$4l!n!z3$
806,092,897 *53AA6FD3800BDF7D23039355FCC13FB9B9690F0A D3?.5
806,092,898 *53A7AF34189988A55B148522E0C7A13453BDC95B D353R7ING
806,092,899 *53A4B8BD38EC360148873E201955C5991D5BBA2B d354gu
806,092,900 *53A06317E807D0E0F51877C951018D1835ACCA1E d354l1l031
806,092,901 *53A5C1D65DD651518159FD0570F2200E2F76D266 D354L!N4+3
806,092,902 *53AE047AF082A1E6D69FA9AE242498A4A041B3AD d354p4r4fu54d05
806,092,903 *53ADBEBC2A4FF29750E05958676DF46248601C88 d354rv0r4r3m
806,092,904 *53AAFA3F97E44523372EA166467F6D8A9554F3E5 D359X
806,092,905 *53A618F47B6FBDCBE305116BEA1662121FA36B64 d35a1inaion
806,092,906 *53A810A0B24F08801E72B0D266473CB863B07A52 d35c4n54r14m
806,092,907 *53A22459A8F73ADB1314D0EFF910B88E0086F261 d35c4p1t4l1z45t35
806,092,908 *53AC2A25C91A777F931F28A9810E43F69A7EAFE1 d35cr183
806,092,909 *53A0418C195B9308603F940F63883F9396AFDD6D d35d1r315
806,092,910 *53A4890E9AF764767CC995407556F2A9F0CF3983 D3=5i
806,092,911 *53A4698322396834E7BFEEE9184B73A0601C9C94 d35in35
806,092,912 *53AF6B4E941B5A01DF6D1AA711974A34BD3B2004 D35k)
806,092,913 *53AE543AA25523EB9FAD44F6078EC4DA8711660E D35pR
806,092,914 *53AA317B43030FDA7278331DB49866738EDEAE62 d35pr0t3g3d0r
806,092,915 *53AE65CB689F0F2D05309C63C4FAC00791B86123 d35pr1v4t1z45535
806,092,916 *53A652DEC25D63810638BACAE30E216E31213CBE d35pr3ndl05
806,092,917 *53A62C440EEB19AB1A04F7287FE27E6349848C81 D35rb
806,092,918 *53A117487DC94C1C41FC73708844320D3993C576 d35t1n333yv0nn3
806,092,919 *53A540D560E4C59725D3CAECAD6C89F698DC1FC7 d35um4n1z4r31
806,092,920 *53AAE661C63F909800ED7A8C712E1E90B77519EC D35/v
806,092,921 *53AF1B1844778BF91E839AB6511B7AC020414839 D;36K
806,092,922 *53A7AC77599F0D02B5B95A4686F8538F6D694497 D&36t
806,092,923 *53A6AEC76427EE292658E057B34EA59894E4180A [email protected]
806,092,924 *53AB7FAEFE61398750D27556F3B257B913742A89 d38800
806,092,925 *53A1D28B1A68283BF2DB4EE9858632F8A19EB55F D38Bp
806,092,926 *53AA8E035A0FF731472B17E5C0132295BCA3107C D3;8d
806,092,927 *53A283A0496D9A9853BCEEBF4FA0B9E6D7061E24 D3"8N
806,092,928 *53A3C3F1F0BC9A14214B6D79B078C457D4BD5598 D3-8p
806,092,929 *53A98ADEA47DA5EB3C740E0F66EDF66905C5282C D:39K
806,092,930 *53A35DC659F6C250596A9546B644607A97810BA3 D39Oo
806,092,931 *53A888DA05C0F3EB307D197BBC6859961A5FCC95 D39r3as3s
806,092,932 *53A96668DBC457F067F513E8F6702415D442CE0D D3.+A
806,092,933 *53A999A18D247205A42B20BC246B70F7FFDB4AB9 D3a=0
806,092,934 *53AB9E114AED45857FCBE39E688284F913CD061C D3A00
806,092,935 *53ADF270B1B3D6D800C3AF2FEF83F9FFE0C21873 D
806,092,936 *53AA627F985AD8483A85F6FC656161B2C43952CC D3a"K
806,092,937 *53A0E04505CA88A85FEFD1B98A03C30E75437247 d3anthropomorphi$m
806,092,938 *53ACA227E647C2654EA45D07AE1072CF96ED802E D3Aq-
806,092,939 *53A24B0034BDFC6EE8D492E5451B983E3BCA676E D3ASh
806,092,940 *53AA32E14738BB12DA5C62E06CF759C2DCB5B967 D3,B&
806,092,941 *53AC7402A6660492E41A83048701FA6E5052CA80 d3b0u1ll1r
806,092,942 *53A1C5E4A54F0037AEB2C831B3F4A7373C2E1180 D3b!1!7a7!0n5
806,092,943 *53A97EC6F4FF4348CEFDC05ED81AFB67AAA2A03B d3b1l141n9
806,092,944 *53A46C1D0D622BBEE4FEA56D5D28E6AA01D4CF3C d3b1nn
806,092,945 *53A0901B56F341457A3C1456A659DCE4FB45C062 d3b434bl3
806,092,946 *53A23459919B0DE42684B3C09D4611460771F939 D3ba$ing
806,092,947 *53A52C9481D4631A435207AA2331389D88BFCCD9 D3BG,
806,092,948 *53A02FA35B99A1668974E053655D4BF807AF75E9 D3bi1i7a735
806,092,949 *53A588326C177FF92D381027E8DCAB626C358362 [email protected]$
806,092,950 *53A0F35E05AFED12CB638A6D4B6EF66FF5780F6E d3bo13zza
806,092,951 *53A5568655B5AC9C19257DF2B8DD5FADE20F036A d3bugg3rst3pinto
806,092,952 *53A5B952C21BD52A77723060DF63172772D70F16 D,&3C
806,092,953 *53A66DAF76B1CE31912D8F0E33635DE4E150EBC5 [email protected]
806,092,954 *53A98E916A05404DF05D282CC862A76A9A900CB0 D3c0ng3st4nt
806,092,955 *53A65A009CFFD7BF3C376C417488447CAB3B2DE9 d3c0t4rlh45
806,092,956 *53A0833194FC41D20A3860FA633F6CC578891F4D D3C1GR4M5
806,092,957 *53A5E564715A5CFCBE99A976B39B47B7FE841111 D3c1mal$
806,092,958 *53A2D5FD4615C70BD2448B880B8DF62557524B18 D3C31+FU11Y
806,092,959 *53AA260C0F619FE1B81C5820256BB33BD8672F9F D3C3NTR4L!Z4T!ON5
806,092,960 *53AEF406AC55F1FD217A4F6F30E8457D6A65A580 D3C41C1F13D
806,092,961 *53A01E759E048D96469CBE41E17747E013527876 D3c4+hlons
806,092,962 *53A43A1EF51D5C85E6D069C021A3C14BB892C019 d3c4n14
806,092,963 *53A34B3B523DA1F305C778BC68FC7FD38D477EA4 [email protected]@710n5
806,092,964 *53ADDBF695DFE262B70169DCADEF5654C532B624 D3ca1c!f!3s
806,092,965 *53A12EA0764CC53789CD918978B5F4D69B575808 D3CBC
806,092,966 *53A46B209EE8C9BC72484CFE01BAE8029E1E6DBB D3cima1t
806,092,967 *53AA2783196B47AB7983CC55BF0E8DB035A03CAF D3c
806,092,968 *53A59FE3CE16D30570AFA5FF8600BBB4ED3D9C8A [email protected]@N7
806,092,969 *53AD75B28FB46C0CEF079A0990980227E0C327CD D3COMPO5A8ILI7Y
806,092,970 *53A440BC0F9A8FBD30B09C11AD8E713E72B9F5AF D3CON+4M!N4+35
806,092,971 *53AB0C81E08AB2ACA8FA0BCF83E83A532C227CBE d3coraiv3
806,092,972 *53A282FD8DF23E7FF8CCAE710E6E41C3BBEFD157 D3$;d
806,092,973 *53A5E987492276712136E8DD456E855BE7A68FBD D%3d1
806,092,974 *53A1FC9A6E4CD68040523C911C659B8296FFF44B D3d1c473$
806,092,975 *53A5EC35E07F512C7FD07279BEC7DBBF0747A529 [email protected]
806,092,976 *53AE1DEB7F67A36EEB67BA6C8CF7C5305785FAEB d3dit4m
806,092,977 *53AE004870F5DE65AB8909B3AE3DCEF87E8BDE97 D3?dQ
806,092,978 *53A8DA866379EF2FB9A1D06F0229640F79D0B2ED D3d"R
806,092,979 *53AC1E3F5AF0B4832E710196047C0CF8C65E4AE3 D=3dw
806,092,980 *53AEDB07A8A3BA8B69618FBA3E0F9450943116A0 D3+"e
806,092,981 *53A5FA59E3D879F9B88D2A4B5F0DC83E7ADC8AA7 D3E1w
806,092,982 *53A58796A7734C98C5143AE26F28A9626D556224 D3&e3
806,092,983 *53AC9F51929D494FF17AAD0FC1D02AA103654581 D?3ED
806,092,984 *53A11E8E1089ACB2DE5A31E311667278D97E14BC D3eIh
806,092,985 *53AA09A5953946A286D55725677422F63706BD95 D3E?o
806,092,986 *53AAD0EB6830DC2F501600259093636D5BB89B67 d3f1r4
806,092,987 *53A395C3C85F57CD67D0677720A281083013AC05 D3fkW
806,092,988 *53A27F36CA2EC590529E7E04975AA13A44DD34FF D3f
806,092,989 *53AB5DC2184064A8D03116F6E1AD32B3E190801E D3FL47!0N4RY
806,092,990 *53A74F88B16657604DA555DCE211DC78CFA40BD3 [email protected]@+1ON
806,092,991 *53A087998CDF30C4D3A071162987560ACB08E5DF D3F!NABL3
806,092,992 *53A0D91629F9F344FE4CA8F368F797239ED29757 d3formid4d3
806,092,993 *53A02AB6B9BC28380F7AECB3401129FCEFCE0CC4 d3fr41ch15513z
806,092,994 *53ACBD757A00DBCBC8D1D1BB14D0738F46833770 d3fr4gg1ng
806,092,995 *53A60E07F42865B1E695FCA9649FED38249E7A3F D3FS,
806,092,996 *53A164B021433487A572EBA5997C990B4A632511 D:3)G
806,092,997 *53A0B258595740A0E9649F04E643EB47128B90FC D3)?g
806,092,998 *53A2A95B1315E6A17B7ADFC8EAACF773631BAE03 D!3G2
806,092,999 *53AB00CEAB79BBB42F8BBD46BF34C853322E002C d3g4stou
806,093,000 *53AE4C4BB8D64906FD3530E3279576D25F8A6ED8 D3/G7
806,093,001 *53ABB86039220D1C75E96FDC74839989279E26C7 $d3gn3r3m0
806,093,002 *53AE59009916B635C354EB8448968FEF23DE9286 D3gOY
806,093,003 *53AAB1013A975F91965624EF7849EF099DF02144 D3gQe
806,093,004 *53AA7360AB7FD3884F67A9257862D3EE755E5FA9 D3GsT
806,093,005 *53A51CB1E9D619FDA39AEDECDFD77643D3946B6E D3gtU
806,093,006 *53AC92189CE74AD0FD5CA3E4250C3295C8E65D44 D3gu31i4
806,093,007 *53A0EBC7A875683B6332B19284FB7CD4BF81209B d3h15t0r1c1z3
806,093,008 *53A5000B5AD24D4A32E3C1015CCFD25B0303FAC8 D3hKk
806,093,009 *53A8AECADF94E00C1BE2B2EA736C901BB4AFB303 D3_hM
806,093,010 *53AC04C4D7F83A431317D9E288B9964C86731244 D3HmT
806,093,011 *53AFEFCF7276AF746426F587188D3D7883AEC10A D3Hu,
806,093,012 *53A334D7116607C07356CAF641277DDC189464BF D3HUS
806,093,013 *53AB87619E3AE4042D1FD2B5299342A40C89B5A5 D3HYDRO93NA+ION
806,093,014 *53A09F86B46049AA468A7D48181B5809863E0740 D/3$i
806,093,015 *53A2D86C85CE30B5FBDCFE8A2E9A7C3657E0AD3C D3_?i
806,093,016 *53A96BBB60843587D42BA238312B1F5E43626F83 D3I2G
806,093,017 *53A2B86611FED24048FF7718D40B154D53279F37 D3i;4
806,093,018 *53A8249BDF816FFDFF23D32A7DE44352B4C34F24 d3i9n4in9
806,093,019 *53A4034950293128C17327C9F00A2C9ED384D713 D3iac
806,093,020 *53AEA73F55B7A96E24DD689725F810850EAB67D3 D3IQ.
806,093,021 *53A55651DD73E7639826FBD782A4D18FEF488A44 D3iQb
806,093,022 *53A5E2432F344151F64D0B3F2E59A4F530412413 D3$irabil
806,093,023 *53AE3A1B8C484AD950864E0AD27ECCA43503EC5A D3j:i
806,093,024 *53A3588596BAF44C3E9A4ED6EAFECD9FAC47F340 D3jtU
806,093,025 *53A06C006CD743E3CFD12B2D99AF7552A0D72E46 D3k4.
806,093,026 *53AD1B5D042C22C6BC9D9DFBD97788706B2FB993 D3Kg6
806,093,027 *53AC02F5B4E718F593FF341E48F31E1A4996F618 D3kjH
806,093,028 *53A2F8AC9B26106345FBE267FDA09F3E7BA578AE D3KKg
806,093,029 *53A33A312005B31FC925BFE0C81865186DC958F9 D3KmI
806,093,030 *53A5BDF2EC12113336EAD14F47C8DE5EB45A4730 D3kPR
806,093,031 *53A3F5C7A18C9BB2279059D66662C093DD2ADE0E D#3L!
806,093,032 *53A1CB84E18E198826F7822D15F23523E6880B34 D3L3G4+ORY
806,093,033 *53A1FC3A85D854729CBBCDFF617E7C5BDA1AF7F5 d3lan3y'$
806,093,034 *53A9A835EFBA9AD59B21457709A4E94E9AA2195B D+3Lh
806,093,035 *53A15B2F47930D97F834B54243C9E700CC3DAA62 D3L-I
806,093,036 *53ABBAE356950DAED3B76368687447CAFB8E941D D3L,I
806,093,037 *53AA4FFE3B7B9D3AB1F52994480FE48F8D0BC35D D3LI83RA7ION
806,093,038 *53AC1F5604F4BEC1D9F23019BC40EA31AD1893FC d3lin34rm33i
806,093,039 *53ACF4565DF3BEA1996B4754541CF468BD0809CE d3los3
806,093,040 *53A05DDF04FA3F69FD3E854F6C3D34290861EDBC D3lW!
806,093,041 *53A919804DD3ABFA6DD7E44822B634EA17A0534B D_3m$
806,093,042 *53A931507D4F19FABE20B9B2DDBC9D55D2E5EC0B D3m01620
806,093,043 *53A0023D062631DB084ECEA34A4FE4F4B03CC109 D3m0cr4t1z1ng
806,093,044 *53AA30F870426531090AAD4B26E07035FFD3D9B3 D3M0N5+RA+!V31Y
806,093,045 *53A262F43CB32C027204618CB2D69A86B3CA8D76 d3m0untin
806,093,046 *53A984C323CAB14C9D2106AF630779FEDAF41B67 [email protected]!z3$
806,093,047 *53A708900BF592F15EEA9032B2D0BD5B60D9E091 D3m42
806,093,048 *53A30F5C7E736E30FBE3523A7B520A3A691BE6A5 D!$3M84RK4+!0N
806,093,049 *53A1651A6CE22C1153E31A9F3E3C284A1ED933FC D3mLb
806,093,050 *53ADEA3649CCD20EB46786BA68FFF637D1E7EB43 D3mN2
806,093,051 *53A6CC5F3FC4983AA4FD40166DB3A58981976A59 [email protected]
806,093,052 *53A31167CF2A6E788F9426F6CF9D7DCF3F242A04 D3mocraci
806,093,053 *53A6FC626BB6BFA17B948FA2A666A54434505592 D3Mtm
806,093,054 *53A615A1B3FD16BD18C4C31755198C85156F59D6 D?3n"
806,093,055 *53AC308A3393BD46548FECE841CB35E18B475BD6 D3"n
806,093,056 *53AC7BEB8A1A3C2266B05F2D519568F0666DAD1A D3n07iv3
806,093,057 *53A3D724A58385E5A5BC6C61835049BC1923B14B D3n0m1n473s
806,093,058 *53AD5F309A1DB24F442E8AEE3FB56BF6418F629F d3n0min43
806,093,059 *53AD063CA3C0FEB1A0856E1FBE65EF64B00B2185 d3n153b053m4n
806,093,060 *53AAD5B4F72B7887D4D783F89CECF6D886891E99 d3n1gr41t
806,093,061 *53A072B9FB0770EC254D22F1055D13B987F786D1 D3N1GR4T3$
806,093,062 *53A217D0ED3A93AFD70D677466D00ADD7D51CA18 D!$3n+4!1m3n+
806,093,063 *53A7CFA50FF8E08F094954E26BFFF58FC2A00829 D3NaU
806,093,064 *53A1AA1539726F0ED9EBBD77C1FB77AC7ECD2DEC D!$3nch4n+
806,093,065 *53A870F623C9A736E7ED600ED155E4D77A82AAEE D3Nda
806,093,066 *53AA2A58EFAB8CB66E05911853DE33A1111806AF d3normal
806,093,067 *53A48F996791965E3B2FD1C9654F7B5A67D3803D d3nticul3
806,093,068 *53AD20FF2DC8FE48048EB1844684589239955E74 D)3_o
806,093,069 *53A7162466006AF0C311ACF92EBBA1E410E49550 D&
806,093,070 *53A21B755AF82EF6930D33014EEA322D697A975F D3Oj!
806,093,071 *53A7100D65AEC3F5843833E7F7504DF5EC3BEE46 D3%OL
806,093,072 *53A851624699598F064C6FBCF0500CC8560F101B d3ola3ly
806,093,073 *53A3D25580BF282F1A0E7898D2B6270A6ABBB533 D3olh
806,093,074 *53A4ECBEF8244FB42B9518EE7D805371E8D34EDE D3+P!
806,093,075 *53A7EF9279B5B8C7E61EF6C65E06E4601E03B5D5 D,?3p
806,093,076 *53ADB3D9F94848F33D564BEBE76BF4030ACCD8E6 D:3.p
806,093,077 *53AE3EF57E7AF2337D859DFDD208278A0D322EEC D.3p,
806,093,078 *53A97CC6EE30F68FB78148D6FFD1F44495840957 D3P0PUL4T!0N$
806,093,079 *53A1D37D25EA44CD9C1E811FF3A48EAEC3EEFB7A D3p45
806,093,080 *53A37CD1E0E9700F7DD90443D2BD6DDE706CF70B D3$p!c4b1y
806,093,081 *53A147CBF3847BCE9649A75D7819D84FC9BD4DF7 D3pE=
806,093,082 *53AE7A3279F60107F29229BFE41D378CDB54E9B8 D3Pf1
806,093,083 *53AD40EFF0E500AC9EA426C961EA19863973D986 [email protected]
806,093,084 *53A7C88DE4413B874380FDB7AC68F39A02CF232C D-3Pq
806,093,085 *53A0FA4B81977C9935B9CF7330874FFD9278F6A5 d3pr3ciain9
806,093,086 *53AAF9A4A896CEA77DD1E28FD0DC16DD068B38D5 [email protected]
806,093,087 *53A9CE1E3A1747AD2828AAB98A4E24ABFA88A0E8 d3pr!v3
806,093,088 *53A118909603C1064091193E7F9D88C3A2799A43 D3PsS
806,093,089 *53A702970D3395A59ED67B4B766935C2FCEBABB8 D3PVo
806,093,090 *53AADD2CA7355A61B8F33F5973F77D2E87478E1E D-3qH
806,093,091 *53AECA30B73EEA1693892912F293B95068885BEA D3QKA
806,093,092 *53A0A45F793B956C3EB8B6B01B5A8C0DBF627EC9 D3r09a70r1n3$$
806,093,093 *53AC2CF2FA864FA9F3A31482529962BB99FE58A3 D3R0GAT0R1N355
806,093,094 *53A88F5DBF560813A5F2E2FF504BB3290D6D91E6 d3r3gl3m3nt
806,093,095 *53A9BA06AB8E31BC533A340781313BBC769251FA D3r3lic7i0n5
806,093,096 *53A53C1AFF1F5533C7F3720C3AEC40241D8276C6 D3R&c
806,093,097 *53A14B0CABDFE15EE438A550CB1D88136269AD1E [email protected]
806,093,098 *53A9EB3E11CFA2BFA9C99F2C75D3305F6DAE2867 d3rm4ologi35
806,093,099 *53AD37C31563119FD384C0E75663DDB1465299D1 D3rma70l09i$7
806,093,100 *53AE3CDA77577DE84EDBC08A3771849AE07C3048 D3RMAT0L0G!$T
806,093,101 *53A6585CB740BA69DCF76C8701C2B86060F1B9C9 D#3rO
806,093,102 *53AE5E46833A46851CF0AA8807FB7BC7A37F9387 D%3$S
806,093,103 *53A8C164DC7DB0585DF8630E346BE9B423080D70 D3=+S
806,093,104 *53AE124A60AE85A5E854DCEA545533310BCE3EE8 D?_3s
806,093,105 *53A9DE7739289BADFD16C089E15E972DF21C7140 d3s3mb4rg4dor3s
806,093,106 *53A9DFF6B0F0FC0A6C4BC1A82B7A136075FB8315 d3s3n3vo4ndo
806,093,107 *53A2089BB502A3E7F4182069279371657162BA28 d3s3nrol4r3m
806,093,108 *53AA8493D0F91865A582B13D0D6B05C698FE5188 d3s3quilibrss3mos
806,093,109 *53A6FF207E5A991A08ED5B06E9BE9E188C81C0A1 D3S3RTR0S3
806,093,110 *53A5A1237B08E7068DABA6FB618740B43DC0ABCF d3scortiloi4
806,093,111 *53A9E5E804D60F694E862821263442CBAA2B3344 d3scos4
806,093,112 *53AFBBE1DE7173C960F874A1905C7BC36507B7E9 d3scoubss3monos
806,093,113 *53A510A1ED9732561D290CFAF46495118C45C23A d3sfigur3is
806,093,114 *53AC4C9CB74AC768F29148E7AE35F8AD5D9E0493 d3s+ia+3
806,093,115 *53AD8CC4331D3D41A3689DD8660AB80F3E4C563B d3sinvoltur3
806,093,116 *53AC2F86CF8F5CB2F3BFABC82950FD905F888040 D3sm/
806,093,117 *53AA449BA82E540693C2C704490A181C0B529ED2 d3sm4rc4st3s
806,093,118 *53A61BE449454159FE1B1DB864A5E24F8325E743 d3snudl4
806,093,119 *53AEBD4DA95435CB5BB944A62A90C1AB2C186A52 d3socup4do
806,093,120 *53A85792B18F61568C77EC0602DDFC405FCB94E9 d3sp3dimosvos
806,093,121 *53A0E655170C14F4476AEC3F239112E99464256F [email protected]!ons
806,093,122 *53AB335D0EB9F18186F404C00D95A146370B5301 D3sQ
806,093,123 *53A91DF531DC6AC2B5F206644191F3EFC42FB73D D3T%2
806,093,124 *53A5FDFCB55569FC2A813C39315939878B138D1D d3t3nh415v05
806,093,125 *53A2355E1A2B094DCDC3F541FCE03FCDA03DA80F d3t4f3
806,093,126 *53ABD17EC3ACE3BA5EA12E41A4F54340D241BCA7 [email protected]$
806,093,127 *53A8EFD4539B632418C53FC55DF8236DCB109DBA D3THR
806,093,128 *53A6D7B46983353DEB68F8A6BCD6716251C3D658 [email protected]!D3
806,093,129 *53AFAF8885154182D1117915B5F83A726C457078 D3T.P
806,093,130 *53AB3B7A89386D0A2287CE9B9285B20FE9F79ED1 D3TPX
806,093,131 *53A0CBA7F1051722C0ED73ED726AFDF53819B935 D3$TROY1NGLY
806,093,132 *53AB4B5E0E8D19CE34AD024D253C41663F1A7015 D3trud3
806,093,133 *53AA85847B3A1A1077A33C18866838EF8730A20C D3tur
806,093,134 *53A0077803F3E397A6B4D064944D0713ABC0544D D-3TZ
806,093,135 *53A47A2DE9EDAB9C1EA9601FC79DD00CD19DF093 D3#?U
806,093,136 *53A815F2B9FE318B5E7B30F8DAB79B3A6414FC90 D3U
806,093,137 *53A392D478D553C6E5E3BC2C75FE1516EA747D33 D3)u8
806,093,138 *53A3BC5DC8DB69F5C372F01E821606DEC3EE3D87 D3Uae
806,093,139 *53AA38B53C873DECBBB0AE241AA0C0BE7568112A D3Ujw
806,093,140 *53AAE49DE2A76108417AA04A7646A7A9A9D01988 d3urw4g5t3r
806,093,141 *53AB675FA0DA9E48ADF1504381D4BC9FB717B91C D"?3V
806,093,142 *53A532921BDC0D76E5289E0A0FC32204BE8B7E0C D3v174l1z1ng
806,093,143 *53AD22F9EA6DF16C2BAC42CAA74485C6BDAECDA2 D3:V4
806,093,144 *53AB823837A21D9C70B7CC369FC123490B0232E3 D3VsN
806,093,145 *53ACD7206CC3A25B4340C38905AA798B6AE41CEB D3/vt
806,093,146 *53AE436B35648127923C3209BBE99B2D6F9D1AFF D3vZc
806,093,147 *53AE4CE7708D6766A02B346C7BD43BC0326EF97D D!/3W
806,093,148 *53AF31C6B153BE96F39D2B7EA7A998087EE07390 D3WAC
806,093,149 *53AEC1B4638549EC40D0E0D6ED197F25D440556E D3wvh
806,093,150 *53A3BF92962CBF77328946EE5F45DFB7A47FDC44 D3wvR
806,093,151 *53AB2DA1844B734147E989C07591F7C4C7C1EEC6 D3-,X
806,093,152 *53A2594F7359C6E83132A30819EEA287D7F65E7C D3/(X
806,093,153 *53AD305C4F26795EC5340F4F84FA9240DF32F568 D3XjT
806,093,154 *53A02416CE7CD675054936047A4EE0E515F81759 D3_Z1
806,093,155 *53A86D2C66394EDA247B90D6520CE8D587AEFD3A D3Z1t
806,093,156 *53ACC09F8054C80CA2B12A1C6C323DC6AA0CDF5B D3Zrm
806,093,157 *53A90B93AD3E5A9864E8CD7B3F8B3BAFFA16D6FC D+3Zt
806,093,158 *53ACE9443A5E8EC2ED15ED7D7F04CD0D15596DE9 D=
806,093,159 *53A224CC42DECC3D00ED3BA04D329B058D8D9E0A D_
806,093,160 *53AD618F29DD9D51E29E2398DFDDFF5B9537C9E0 D-,4-
806,093,161 *53AB5986DDF8345CDF13CC9002C9F194D9899A07 D:-+4
806,093,162 *53A733B6369624F47EA86A80CC565DC339085381 D?4#=
806,093,163 *53A5EABCADCA6F509A513D566480CE50122B70F7 D.;4&
806,093,164 *53A69736468FF32E05B4E40B420356F55839E379 D.4%
806,093,165 *53A21F53E0B081529E3EE2988C433EB7E66A7EAE D+!4=
806,093,166 *53A8907FD10A2424D74208506F7C2B59570492D1 D
806,093,167 *53AD5C05451499D60737082AA175FDFD0A1FF15F D4>^
806,093,168 *53A4CEFF65956EA7823538F40DEC778876A4AC2F D4_/.
806,093,169 *53A1DBA2B98D817DB4B5B60760F684688FE55A79 D4:+_
806,093,170 *53AD0B9DDF1CDC32060D0FFD7611D296C73A613C D4"(/
806,093,171 *53AE98E0F688A56A5BD982DD247E3EEA4CE93BBE D4
806,093,172 *53ACD33E54A0C43F9E8EA630F38047A8F121AA8F d|%4
806,093,173 *53A70BD92074FD2E56B70D335BB5E64E17EFF4A7 D)4/0
806,093,174 *53A4E107D06DDD519F102ABCD96D8BF3745934FD D4.0O
806,093,175 *53ABE7226F9472D96AED27C04F6C3A2496B056CA D40S?
806,093,176 *53AFD97AD00B0EC9710455E45A1066AEA1DBAFFA D40sQ
806,093,177 *53A627E820514D9A7E34D457E71220FDCAAB2D0B D40TO
806,093,178 *53AC65AC3C1BD75EC94544C607610A50BACAF108 D4=0X
806,093,179 *53A201EAC3AFE89143C8460E3F62A8637A78E8CD D40ZZ
806,093,180 *53A04C34AB4592E25B55224A41783D10506F680C D=4&1
806,093,181 *53A3A9F54ECE28AE968FF12903DEC12BA49B098E D4+,1
806,093,182 *53ACCDA7835832C662CCB4DFA66D8F8974E0DD88 d41c0v1c1u
806,093,183 *53AF0342B0506744175174B547615BC0A51473FA D4$1K
806,093,184 *53AFC30B39F05699BFE831D381CD57FBE26B4ED0 D423.
806,093,185 *53A9CD36CFB26FEBE24008CCC6C7FACC896897FC D#42t
806,093,186 *53AEFA6D9452BBE6C2DF45C55AD5839F50B3F80C D&43!
806,093,187 *53A1F6516C82BA4075F7D4BED3E43BEFC5214B66 D+4;3
806,093,188 *53A8AEBAA603B4B219B09FA1449CD5AEC5D877DB D43vk
806,093,189 *53AC522FC56938F91DDFE333E4B1FCA2EAFEC481 D4/3Z
806,093,190 *53A2148B692C46E615360F35F99295570E30A8EB D44$2
806,093,191 *53ABE8D659E2A87178768F3D6EC501E37E24259E D.445
806,093,192 *53A1CE53F1B367A2E64B785CA509771D3A1F875F d4+4bly
806,093,193 *53AB7E04DA2A1DC45BE8D14D7A76F5A35AF850EE D454e
806,093,194 *53AE554008E138D240D9ACCA4B329824D8DEC3A6 D45nL
806,093,195 *53A336B706E74E8946852C629A58792914D26C09 D4=5r
806,093,196 *53A5C0BF6451B8E905C30EF4C169AC192F2607F0 D466c
806,093,197 *53A330BDA3C80CEC604D243A5971C1872D37CC5B D46sD
806,093,198 *53A4DA6A5DAB3D13E3E97616965169A664D9C2E5 D4.7b
806,093,199 *53A7756B41D93DFF9CC954ABF8CFB8C60887B20D d48870
806,093,200 *53ACD579349154EF3BF33D40A1F121EDF459FAB1 D48,9
806,093,201 *53A54CFD09D4CA6CF04C7CBFF7AE20F06C22A0F7 D48Df
806,093,202 *53A6A3A57127B4D2E915D21DEB9012DA2498E309 D48H,
806,093,203 *53A91F8701A4055AC98A3DB22A1D65F59FDA3E80 D48IW
806,093,204 *53AD486B782826935F2F12D848C73C7F5EE033B4 D48om
806,093,205 *53A216B630C81D29FC83D195D58E39CFCE7A702C D?48R
806,093,206 *53A33B57F46BC2EED9718FEFBE38D3357A1C87E9 D4.8W
806,093,207 *53A17E38BD9FE4E6C987D2B2B40BD2A50068B9BB D49eC
806,093,208 *53AE10AF991DA4617B574C4ED7B76455E3A6A8BF D49p5
806,093,209 *53A83DDC2554C8851E762B1FD590FCFCECAF7E28 D4&.a
806,093,210 *53A22FCBAF5C4D5A63C1BD7FBCF809BC7885D332 D4Aj"
806,093,211 *53A63371D876BD6B0E4920E0E364E819E2F72B3F d4alison
806,093,212 *53AB6DC1291B7C075077C39910C7E46AD5F8DBEB D4aoL
806,093,213 *53A6F77DEFAF994992451C09BDA8386E77825497 D4Asq
806,093,214 *53AE6E00C152A6ADCA981FA4DE4171AFC2437B09 D=4
806,093,215 *53AE8E8FFA5DAACCACF7F163A098BC3C23FE224D D,4%b
806,093,216 *53ADC2620EDCCFC08302669EEBAD98172CD6AF88 D:4b?
806,093,217 *53AB8951784EBA218FFB5AFDDC03788EFE9840B0 D/.4b
806,093,218 *53A19A83FF55424D9CF70835CE95DD557FCC145A D4#bC
806,093,219 *53A7761C067C5FFC52DDEAF0C87C6875DD42AFB7 D4BFG
806,093,220 *53A321C45C19FEA49F356D28B4286AEC1C7BD29A D4BtQ
806,093,221 *53AA6626AFBB085877E9D12F3BFD533FF0E2CD2F D4bwR
806,093,222 *53AD6EED90F573C61400A3B4B914127EF64D139B D4,+C
806,093,223 *53A56D00878B05A86C3BA4DAA5E2F718B5E8C8A5 D4C6V
806,093,224 *53A8639B484BB14DA6EE882E8884898CEA6F009F D4cd)
806,093,225 *53A21E6ADBE6465C370C88E0326EA730120D41B1 D4/Cq
806,093,226 *53AB1499016472201DCD467A1298977722DC808F D4cQ,
806,093,227 *53A772EA33D852967DDB5E58BFC4BE82B62F90B6 D4CT9
806,093,228 *53AABF77A66FEBD04D5709B820001D8F025E49E1 d4d1a1fcc4
806,093,229 *53A84634BB639B57887B505E5B441E560721D14E D4D6"
806,093,230 *53AFB72F0A958F777893BF74F170467CBA760EB5 D4dC;
806,093,231 *53ADC9346FE09E70DA36607C33912EA4663D2F46 d4ddyw4mpus
806,093,232 *53A0888230AA8CA3288A4D8D3642FFC521E19786 D4DjC
806,093,233 *53A623313435A44049BC2EB6D2002E074B049CE8 D4duD
806,093,234 *53AF6E0BF345071BD00090A3092077A0040D320D D4D"V
806,093,235 *53A40CDF41095DAB9F6E8F5AAE104C8690C072C9 D4_Dw
806,093,236 *53AE14981F3D172C2100B78D51F4EA8EF6288022 D-4"e
806,093,237 *53A8F99CFB56267FD81AD795D5D79E109E9F242B D4e+.
806,093,238 *53A3B1AFD8F744BA006BBD5B6070A8E91D6D3224 D4EAK
806,093,239 *53A236266F87BF8D9B1583253889CFE856A00A77 D4/eq
806,093,240 *53A281EEAD243AF167F82A8ADAEB18B436D6B4D4 D4E;R
806,093,241 *53A0E5C787DDC59206DF5DF150B18732387DB085 D4E(X
806,093,242 *53AFD15568F2808107DC285E12F841125D4331BC D!4+F
806,093,243 *53A4F5478EF39A41CF43F3F6FE07DD0B81F52140 D
806,093,244 *53A3B2FA60FB7F83D44D20A44321B3F7D09BA704 D"4f!
806,093,245 *53A1A5A08C432CD584BEEDE3C60BB177243E9064 d+4f
806,093,246 *53A9E605F8B50F57EC095CE624C11A5BD0FEEB62 D4g.+
806,093,247 *53A4C21CA7ACB26DAACA8922D8D05B6BA4E4138B D4gen
806,093,248 *53AAB95284622A0DFF29F5788EBCF083C55AC27B D4gnu
806,093,249 *53ADEBF47930D2D353097B1C1FDFD4E40C52E6C0 D4gpo
806,093,250 *53A02119A85E68DBFB0252190144DAD552C1DE30 D4GQ
806,093,251 *53AB35A1A9AAEAEC7B395FC6F6C4EAE9A983582F D4grd
806,093,252 *53ADF88B6A3E3C83085DE73994D7DA3ED29FF5D0 D4H!)
806,093,253 *53A8C5BE2DA564C9C743F69BCFAF64978EDAA2C8 D4h_(
806,093,254 *53AA56E3419D776851F094105E8A745E6853015B D;4hF
806,093,255 *53A3D5233E2ECA2F40371D4F2E850722C001C3CB D4h!H
806,093,256 *53AB557F8F8E6E60B8E479CB8D6DE31A2412098F D4H)I
806,093,257 *53A1E357ABC8465A106606FD0303723A332BF39D d4hj4
806,093,258 *53AB796AE8A4F051791BE4CA18C5316D73CA2072 D4HkU
806,093,259 *53ACDE6EA5E668DE4B34FF5BADF6305284BD9FEC D4Hoc
806,093,260 *53AEC6AF354DF855EC0596FA987F5983DA5C4031 D4H&s
806,093,261 *53A9D42584F8060E2A05AA6385CD11444796227E D/4HT
806,093,262 *53A1C694E8F1996208BD8489CAA3AE9514AE0B5C D4H)v
806,093,263 *53A0608141835A433BDDE67CA3F55AE55184FA9D D;4HZ
806,093,264 *53A5BCBBE227ED5B5C47393FAB1A1036B14E5509 D4#:I
806,093,265 *53A32F31F2AFA47FEB9B83C126B584E5586392D7 D=%4i
806,093,266 *53AFB006617075F34F4F87BFDFAF78F464B0FC88 D=4ie
806,093,267 *53A3FA018E5C9C7A633F03D0C0F6C08D47037C0C D4I!f
806,093,268 *53AF1DE3E7F5B25A80BCBE8E2BD3B9840F24DC49 d4iling
806,093,269 *53A54B7EA1CD9D7C29053DA5BE94214E19430159 D4Is8
806,093,270 *53AA91D043EA8B0DB4C11ADEBB1CC848A1028341 D?4IY
806,093,271 *53A66AA41364C348C5EA34E1DCDD16E79C3E2D81 D4je?
806,093,272 *53A147045CFF4B619CB3D834F3DD0CF8DF3B3835 D4jg"
806,093,273 *53A23A4E34B45106B1027AFB4911FEEFD06D559E D4k6%
806,093,274 *53A19AD6554AF34C14EF58BF6156DEBBCE84B999 D4L2d
806,093,275 *53A25B4BC78A060804499D1A37E1A6C6B8266DE9 D4L$9
806,093,276 *53AA6CA890023288F57E688D72207AA9EF40C6A5 D!4lec+5
806,093,277 *53AF65ED6151388C5BDECF65AC08DB233E520C3A D4lF=
806,093,278 *53A236876A830E657AFE77E4EF42840B7EA74B7F D4%LK
806,093,279 *53A679D0C3C3640352275E721EA2091F145ABBBE D4LKu
806,093,280 *53AF0F24B69CD5427E4188D4AE31B160AB4962FF D4_Lp
806,093,281 *53A141A77B91B28AE922EE0FFBDFB846CD623F11 D4lr1
806,093,282 *53AB033BCCD7CD7AE0A3A8FBC0547373624DCD70 D4M0$3L$
806,093,283 *53AE74F9FA51C250B2D1CD35BD9B88073B79F3DC D4MEX
806,093,284 *53A9A76C30E85AAC7A7A72529825B0D807D64EDC d4mi4ni57
806,093,285 *53AC75EE4381947AAF04F82B927F170E163850D1 D"4mL
806,093,286 *53AD5CD456CEC624E238E70AD0D2C5E2395505D7 D4mL
806,093,287 *53A02B02BDCCF11471CFEFE51A0DCAE756C9EDCF D4mpe$+
806,093,288 *53AD3527795AF8184A73A04E1702666C6EC9E9CB D_$4N
806,093,289 *53A86F8819B6358FFCF8A4E04ECA6C06FC8B1320 D-4.N
806,093,290 *53A8DD4ED3E521461649870EBB73CCA953690C8C D4N1K
806,093,291 *53AF7B4FA05DEECEA2843DA4CB3A2D968AB50B80 d4n1l13
806,093,292 *53AF003D9F189585BED93D49847CC3BA09036C35 D4NAd
806,093,293 *53ABEED9C86788FD5DD2DE1A269C3A2DC2C13E73 D4;NZ
806,093,294 *53A48DFD82F7D7E45696F7892A06166D09BA7AC1 D
806,093,295 *53A51A16286BD7FB962808AB470A3A66A9C1D1BF D==4o
806,093,296 *53AE4FA486E8204DAF7B14309D7AD7CA7B328CB0 D_4o8
806,093,297 *53A2648D80759242E83F158E82C0D0091E9BE755 D4oG.
806,093,298 *53A99D5946E6635F632AB0B9C3E0C3068CF9941F D4O.r
806,093,299 *53AC7E2E692E777E09192036FE0FE60094975220 D4oUw
806,093,300 *53A3AC6AB97950A65302270B61EF0E1F943B6064 D4"P&
806,093,301 *53ABEC020760064114942CEDCE41BAE4FB2E760D D4+P)
806,093,302 *53ABB8B5844DF61A36F71A888227C5633515B192 D?(4p
806,093,303 *53AC9A8074DFD4AB0D459B0365CFBF0F1FA4158A D4p&&
806,093,304 *53A68E6C754481C3575787A42D713743B1EE0D5C D4p00
806,093,305 *53AABB156046CB513110EA8E61A35A049BAB8857 D4P(d
806,093,306 *53A2C82B4A41960AC780A940F2B2C01CF0FDEE2A D4PGr
806,093,307 *53A72777960B3BB71B9D6EBB90A72242494635D9 D4pIu
806,093,308 *53AD1C6693D8BEC46C5754C783C2145414D954FA D4pY7
806,093,309 *53A54CF1B2B38BCA3929BCC76E4E82AE797E5C84 D#4Q
806,093,310 *53AAACD0B1923A79C7E303F6C557F4006BF3F531 D4;q2
806,093,311 *53A3B959E39AB40F53283A99A8BF04407C590010 D4;)R
806,093,312 *53A96346D61F3703E622B3BE2DC65AFA56526024 D4R"?
806,093,313 *53A98747B974BCF6B022EF6B8722BA50CC0949BC d4rch0n
806,093,314 *53A83B2DE0E82E63E2A94EAA0DBEE4AF7A57ABB4 D4rE,
806,093,315 *53A544192E34CE7EC5E244F9B556BD6F7D102EBA D4&RG
806,093,316 *53ABCD39D1D5860D14ED208C2CCA6B379F59AB27 D4RG)
806,093,317 *53A6CA9C28FFCE9EC453A89DA64DE535BED1F7ED D4RGj
806,093,318 *53AE3C6803948496535375117C285153C97BFCD8 D4rO;
806,093,319 *53A1BBA548CCE1F957E5F05E1F94742F13053FDC D!$4rr4nged
806,093,320 *53A0F263BB2925066F5DBC69D7117426C5FC042D D4S2U
806,093,321 *53AAB296774B06AD10F6D24814EFF0DA5666BF81 D4sA&
806,093,322 *53A02014577BF082B8C7A8D8FF4F3335337E28EA D4sB(
806,093,323 *53A38AD624A80905D69A601536AD533543D20F05 D4sD)
806,093,324 *53A930C8EA565F204BB8DF9A1A40A34A26E3F28B D4S:h
806,093,325 *53A895CD32A292D44959D5C6F79F9B0213CC8F6D D/4sv
806,093,326 *53ABBBE2D4218F64CBADE335AF54804A0FD86C95 D4S:Z
806,093,327 *53AC8631EE3A5AFA91C5D6F2537EFC9C089D7801 d4t4t1p3
806,093,328 *53A5906B21CDA2183C8AD2DDE1AC57C7A3AC51DD d4t4zi0ne
806,093,329 *53A222BDE21759CBA374059BA27F824F347E302B D4T7g
806,093,330 *53AC5170E40C290CD94D4D58771653C27B0DB3DC D4Tu"
806,093,331 *53A587A84ED5369BDE8A22A52C08693C8F43A678 D4tZ_
806,093,332 *53AED9E5D1644947E2A8E7F3EB0AA14D7FB5B70D D(4u,
806,093,333 *53A4343268FD0EC88B614ADEB806156E88A56D5C D4u$#
806,093,334 *53AF0211CC64982FE87A83EB60C2C5DF1B38CBD7 D4#u9
806,093,335 *53ABCE97CEDC1FDA131AE851F9122188901DFDC1 D_4v)
806,093,336 *53A9594FE5EB555CCDD7C3063CD2B3CCB0B59CA8 D4v?8
806,093,337 *53A412D391D5AE02EE6E14B4268DB2329664A23D d4vont3r4pid
806,093,338 *53A6098784A994D81E0EF479386747E330F136DE D4v;Y
806,093,339 *53A72E46D990D4BEEF08352BACD20F610A893E14 D4(wB
806,093,340 *53A57174B5444C0403B0E81ECEFDF625D1A8D16A d4wn4m3nt4
806,093,341 *53A19460DA9AEA935E47853A25A7CE2D31C7C40B D4W:p
806,093,342 *53A7855D05971BFB02493187923387E1188C2127 D;+4X
806,093,343 *53A386829BADA2EF2FA2D8BEB36A17A23513E1AD D4X/R
806,093,344 *53A44719CA955004FF62ECB8EDB31DE4B8EC73E4 D4X,w
806,093,345 *53A9727769B69687F0928FC66F13F6ECC76A70B0 D4XWv
806,093,346 *53AC69F63F35C330B74F33049A82D4C872DA508A D4Y+!
806,093,347 *53A1D2E3DB552AA04DD6B0AD60112FE56928C2D5 D4?Yh
806,093,348 *53AC2DA2E821C5AC0AD2EAC6FC24585C722677F2 D4YRi
806,093,349 *53ABB982637D2EC37472BF5B455E337561EE6D68 D-4:Z
806,093,350 *53AC37B2D82A27C7C4B0A82A21045F588C3B4CC9 D4zcq7gq
806,093,351 *53A9031133EE89AE66FA2D4BD17F7D48A93A0BD5 D4:Zv
806,093,352 *53A4613EB9AA2B6269B554B9783D396B2082C0E4 D;+)5
806,093,353 *53A512E426CF43D1C2C8093E18325A3C8FCB93E5 D!5?+
806,093,354 *53A8E17678775F8C6DE6AD3EEF1013B7DCA95DFD D/$5
806,093,355 *53A0D4BEEDF29677206FCA5DDEA120D7A3EB2DEC D"/(5
806,093,356 *53AAA1DF975CF691179A16969F9012A70C4EC48D D&5/.
806,093,357 *53A2544C5EBCB867414A2671149D1B04D6B75FE7 D%"_5
806,093,358 *53A5230173E5997DE97EE4065A2143CB9CDB09B8 D
806,093,359 *53A7AC9D74D81B5E1186F3B7D0992ECB14CCDC7D D5_
806,093,360 *53A245BBCDDD5A69AC731EA0B9E90E875EB4B290 d5])
806,093,361 *53A17726D31B4A31AB788C6E5311EBB3591D4DB3 D5/01
806,093,362 *53A5340360849A4AB0F088ADD1D3B2DB5CF02CFB [email protected]
806,093,363 *53A659592A5C5FDF300329307683C4251A8BF2A3 D50T2
806,093,364 *53A05EFA522DD9EC59D6CB98AD962A477E07AD0C D!5!11u5!0nmen+
806,093,365 *53AE937D0CBEF56714979800B4EC8F98B3A626DE D516B
806,093,366 *53A003FED7E52B980813446F1B088536DD00B173 D
806,093,367 *53A7C0D1EC9117E6BCD768380FBE1B692140E99D D51Xm
806,093,368 *53A360BE9F460BF5927033BC5C52A8A4F039A661 D/.52
806,093,369 *53A79217204F7DE86A69463EF0B721B63C212241 D5%2&
806,093,370 *53ACE249AE343AF3A1D66A3162371CE44FE378CD D526=
806,093,371 *53AB7D7AA35E1FCAAAC090A4275964E555C63A90 D52Mv
806,093,372 *53A7436B50BB6445FECC923334D49571C4C49106 D52;v
806,093,373 *53A9CB3D95E946A1F64134F627DE839E26224DFB D5%3/
806,093,374 *53A49B66AD8E54F1E8BF9C23E61134D3AA69113C d53010
806,093,375 *53AD90008D7C3D93B29A427C55E126B7181C5D6E D5+#4
806,093,376 *53A6B4E64D445B772302C49127D177E6B8BDECB6 D541-
806,093,377 *53AC06E7EE6F955B7BDF55ADC6C941B2D1EADCAB D5423
806,093,378 *53A86A4C91336036FD82BD09527C7A64877F4BFB D54q
806,093,379 *53AF77D080A13E8D4078EDCBD0CB3C6B118A8CE9 D5&4r
806,093,380 *53A83486D3D0815AA83E9DF3D7A491E66C14B847 D5%4U
806,093,381 *53A003B99A2E7584EA320A4F558747DD795E52C1 D55B6
806,093,382 *53A57564D38DA72D264705C8FEB3A7B23D5055FF D55SV78KVP3
806,093,383 *53A343A51961B379099806D3D06AA05184201855 D55UH
806,093,384 *53AF60FEA95A948840CBE6A6F83BA19B7F7F8837 D($56
806,093,385 *53A9B4BD50559DD5BD12EF6A2E4FEF2A3F03F698 D561%
806,093,386 *53ABC6EC7F8FFDB89C887A9DA47838B251C8D7F3 D$567
806,093,387 *53A0B131F102838E1254623E1807413B66FF68C5 D56WZ
806,093,388 *53A38661BB8C035B1635C4D77D8034E9E0F5551B D572;
806,093,389 *53AF65287AD6BEA7ED3B50876D09248C7AB40FBD D5"7T
806,093,390 *53AAE4F3936B46EAC51E3784D30E50D0BD1D466B D5
806,093,391 *53A988A8743000AE07203B7359E3D87048063CEC D5834
806,093,392 *53AFBB09919CF1BA81A69A6671D492704122B4F6 D587Y
806,093,393 *53AB98C4FC728CFD16BFCE8107B52A76844E422C D58li
806,093,394 *53A812E4684FC9514CD1111026ABFB9D61A3758A D/59&
806,093,395 *53A210C727EFC0D3894CB4A6694607EC18940AB2 D5-9;
806,093,396 *53A8DAF2C982092B437C360B311CE8443CFBCFF5 D59
806,093,397 *53A7DC8D1FC9E2107EFB244A0E9E5E9D85755A5C D59=e
806,093,398 *53AAFA2E4AE0353E4BC2320067005A4EE57B2389 D
806,093,399 *53A8D9080B4BF02BBE808083AE46D7D96B075F47 D59q;
806,093,400 *53ABCE95455E5E41BB0E7910A417EBCF45DFE53C D59t-
806,093,401 *53A861DC92166BC8D8B7653FC90B34D26D8D1CDB D5-a!
806,093,402 *53A46FBB4D7BBB6EB4315DF969AF7C1C95027D6F D5a21
806,093,403 *53AD68BA5A90C0257F563DE8A79E41E094819112 D5A4n
806,093,404 *53A9B0559C1965BC1E6D0CBF16B009EC00FF0D9A D?5AD
806,093,405 *53AFF751DF83F739131551A7F529A669F77135A7 D5AD.
806,093,406 *53A83DEFFBE7DA15FE84D3F6330FC9CD74538F9B D!5affec7!on
806,093,407 *53A6DC8BBE22C167B53AECD22C3402410E811C09 D5AH-
806,093,408 *53A2ED4A81E19EB6AA0122F52B1BA1D3F420D9DA d5Ayrton01
806,093,409 *53A77C61D0EF128B9922FF7B8C0D882316B774D3 D5B+:
806,093,410 *53AD4A611D9EAD1F2998D3F2A18BF562F25CB045 D
806,093,411 *53A319274132AAB8F36CB179762AD152FC8E3EEF D5bi5
806,093,412 *53A91DE979E321F1CE60C5FCB11091352F65C250 D5=C#
806,093,413 *53ABA581CF90A316859125556BE962C619B2A74F D!5c0un+able
806,093,414 *53AB0B8374DFDDA7212E934BBDDD1ECAB31CB6F3 D=5c7
806,093,415 *53AEF8E18DE41575665FDE8541202E4F073348F3 D5c72
806,093,416 *53A5A81EDA09AC338D58623B3DCF839447DEB3C0 D5CFk
806,093,417 *53A828275BE8F343EE7E1551E023FFCDDB434E08 D!5CON5OL4+3LY
806,093,418 *53A14DBD826BE80C599895A79E1D0D064F21B10D D;5CQ
806,093,419 *53AA871D1FC419A9CAEF90E4A7E6FCF24505ED25 D?5(D
806,093,420 *53AFE344273C74D6B7E1770C3BA607C76607AADA D5D0a
806,093,421 *53ACF7E3E2FC56B1017DE5AA8870A2D31DA4113B D5d=p
806,093,422 *53A26AD0D4A41ADD8AE789493621692482D38FDF D5dsp
806,093,423 *53A9C3DA6A982A4AC7326E816C7397ED8294687F D5DWZ
806,093,424 *53A9377A3DCE2D3F73255D28F7D290FD1F6CAEF5 D5&dZ
806,093,425 *53A6EFC69AFA03A058280B7848F07D85F3EB78E0 D/5E3
806,093,426 *53AAA898D5B6B530291EC7D4297909A1125E9B2C D5EE)
806,093,427 *53AFDBA29B0A978B5C9613DDD5A6CA59CBF0402A D(5Eh
806,093,428 *53A12DEADF5C7E631E73A65DDA93A27E83465071 [email protected]
806,093,429 *53A949A0627E60F568F709EEBB8F811D31FA6902 D5eoF
806,093,430 *53A0EAD0AE8AD6F136BBDDD556671013E8DFA6EC D-5F5
806,093,431 *53A470D545D04CB36242AFE721FDFD08AB92F6B4 D5f8T
806,093,432 *53A339459645B559D668379AA5D657B8FA967951 D5Fdk
806,093,433 *53A76C653B1F568C033934D86F327720A81E2BDB D.5ff
806,093,434 *53ADC6C88D13E002016B42F2EBD8576FF3CB08C0 D5fi1
806,093,435 *53AED252DB62512A7B244A65D2CF71E623280969 D5fis
806,093,436 *53A571F14A9E351C8DFAF29E362C3C9219F8BE46 D5FKm
806,093,437 *53AB8087E5C19C41450A8A411CFC309F1B019F82 D:5G;
806,093,438 *53A2CDD79F1D801A4ADB715BF83D23FF1B24C1F3 D5G&+
806,093,439 *53A89489D1A42B34D7057C3510E3C82CECD9C5BC D5G5
806,093,440 *53AFA6BA0DA96C4164323FE8B3B7F4D1264406B1 D5g6M
806,093,441 *53AE960DCE5B1257DF93C6451D61CA81E6233A58 D5GBD
806,093,442 *53A5F9C42669C6CC66836D297366EECE6E81638C D$5GF
806,093,443 *53A8E73FB7A3941FDEEAE186AF91AD31BF67846D D5Ghp
806,093,444 *53AC66193697219D2A74F75DB4DC3CDB75B7DAC8 D5GKC
806,093,445 *53A505BB85907F085CF46D6D884633FCAD7D6EB3 D5GQc
806,093,446 *53A688D0FC68D32ED692B6B5F3C408BB75AF16B7 D!5H3AR73N!N9LY
806,093,447 *53AAAA85A62918270996B21B3FCA4D66FE522E31 D5hd1
806,093,448 *53AA5C82D5D0D6596E569D64E253FD88FF07C331 D!5Hh
806,093,449 *53A0F14EB716EA7629EF3FE4B453A52AED298201 D5hL
806,093,450 *53ADE1C8EDE63157CFE266AF7BCD9A782C2EC093 D5hLe
806,093,451 *53AC7C1831DCE3B1120FDE0B263E82DCE12F5FD9 D5H-T
806,093,452 *53ABDBE48ED2E5694AD17D4E8B1141826E7DC0E5 D5htf
806,093,453 *53A10114CDC76D671BF696CFDDAAF35105C1CD66 D5?hU
806,093,454 *53A3B8B2D97152E8D3BADF6C8E3D3BACA8D353E9 D5$:I
806,093,455 *53A0D3F3B5F90950B8D8A8C4FA3481CCF7D22245 D$5IL
806,093,456 *53A9723F7EF49A1A5AC2866A294C2945E0D80143 D"5im
806,093,457 *53A1F6DE2936006F837787C0156828658548C3D2 D5iO%
806,093,458 *53A9E5BF6E9B81467653CB4AC867B2D04B827B56 D5!ir
806,093,459 *53AD202E8CD6CC2790A3C5D5CD909EC622CB00BE D5iV,
806,093,460 *53A0DAFDD87564F115D2C0BD49B8F368707B5DD5 D5IVR
806,093,461 *53A9E232CE08AA99643D1C5EFA2D1A4325706B29 D5,%j
806,093,462 *53A6EFF396EC5109D8865628C57EF34D76E22AF3 D(5k8
806,093,463 *53A36E51B65EA1B1FBC95AF3C4285345E12F9AC9 D5K8g
806,093,464 *53AF4B3D3C1A7E47B923F7B79CC25E22CC299747 D5kl!
806,093,465 *53AE4FB337DD3E6B7E1600F676F8D4F177E59A66 D5KXW
806,093,466 *53AD08BE4B4B6BAB3C9AFDB4D0AD183E606266EA D)!5L
806,093,467 *53A97281FC5E7AA3EFAFC98D4D748C735660C78C D%5L$
806,093,468 *53A7D38D1E2FB55CD47C263D3B58A4650328FDE9 D5%L/
806,093,469 *53AA2794BD80955BA05E51508C42FA52DC029BC0 D5l8m
806,093,470 *53A4524BB84A77A8F01FD497CDECC694D948A228 D5L/9
806,093,471 *53A20A3E7B7033009580A04405F36047A95EAF75 D5lcd
806,093,472 *53A04A42FB9E6343681014477487BFD15D31C127 D5.Lk
806,093,473 *53A0A2D8AB50854032FFFA29F3DA8B9BDC03CEB1 D&5lt
806,093,474 *53A0C76C1CB33ECDC7BCAD8EAFF5A9E87FB670AB D5L/W
806,093,475 *53A72A1635B9A83DCE6AA8A586F2E866D8AAA41E D,5M&
806,093,476 *53AE66FB6EBEDE57682798305C91E1457D848F61 D5M#"
806,093,477 *53A96B0B6058938509C272EE251E8E4DFE1FE36B D5mO!
806,093,478 *53A4FA2D607B94FD5927DA1C3FD88A0DBD7DCCE0 D=5+N
806,093,479 *53A967B66CB6D387B3B222A220DCA42F7FB92615 D"5N!
806,093,480 *53A82F1EB80DE194A733F426B40C442BB680F677 D5N.!
806,093,481 *53AA87856B506A37CC35F3A5C4C469414AA9EFD2 D5:&n
806,093,482 *53A7E4064891BEC4A520DC7BD8AB332381007885 D5"(n
806,093,483 *53A5F1C2464E4C153A12D840AED4FF0A06F53F88 [email protected]!NG
806,093,484 *53A26A9D85D6F289C017FA45DC8328366417514C D5,nF
806,093,485 *53A7E8D255D2B05040BE8E47B05395D913001175 D5NK!
806,093,486 *53AD493E329579C89325EF62DBE144181AC07904 D5nUE
806,093,487 *53A996B812A6184C10D186A76CBBE64950D9FE5F D5NZj
806,093,488 *53A0E276845E468816491EDBD21F81BDDDA452B4 D5o=+
806,093,489 *53AEBD7EFA24574258070195FA00C3BD34CA2DAF D5?Ov
806,093,490 *53AF3DFC0B8F1035FB1A54536EE216C86671C4E6 D5pe5
806,093,491 *53A5D59DE2D0B6F5DE58DFB81FDAA93478C7D595 D5!pI
806,093,492 *53AB41034FA55577689A7F50B211A5F7C80FD170 D5Q!)
806,093,493 *53A2E9B1D85CDA050B657747498BE2B9E7D4B720 D5&QA
806,093,494 *53AFE3D521A6826B332DE72C760660947CB342B5 D,5QF
806,093,495 *53A9909989AC8651B2E85E579F5458194705631B D!5QU!E+!NG
806,093,496 *53A202397E2926D3330A4F77595D3DF3974FC7D3 D5R;,
806,093,497 *53A6AE940C49B22691CF9E7E1AF493BDF367AA7B D5r-=
806,093,498 *53A9B4AAB47FE710F9C0243A915040CB2827B0AD D5RBr
806,093,499 *53A7531C52589E9587DD9A19438A7948D3D30101 D5-rp
806,093,500 *53ADD5E7C151FAA38D22104F16110FA3739F8A35 D
806,093,501 *53A1458C7748F464DFB110A4C76D619DEF323554 D5S/m
806,093,502 *53A9EA3CB52E6BF60FF129CEC35DEF9262643675 D-5Th
806,093,503 *53AE305499169C29719E884945CD9F67E8172DAC D!5T!LL4BL3
806,093,504 *53AA0EE4FFC2D8CFFD335BE8259EB4622FA5D4A7 D5t-O
806,093,505 *53AC2C08D74DC514768D10317933F3BB64FBDCDE D5TuQ
806,093,506 *53A509147FFD1D63FF48751A35A7905A28E7F902 D5T
806,093,507 *53AE91C762D2A3EB0169B16A87D718A75B5621EB D-5U;
806,093,508 *53A5BA3E35C5B68180DD4F7B364F3B1693DED48F D5)u
806,093,509 *53AFF863029249FE6E44ADE1894379103114CFC0 d5:u
806,093,510 *53A9458E284C40A01E699005DB1595DC981DE543 D5U39
806,093,511 *53A794CF763638FF679F16F358975754DEA997CC D5u6$
806,093,512 *53A956AA15B53F0CC220654208DCA39BBA1F6282 D5U9$
806,093,513 *53A0023859A7B6C20471F90657A94F466B41D8FF D5u/f
806,093,514 *53ABA660681606C8940ABBEF9C406259886C215D D5U,U
806,093,515 *53A480D4E367AC4330184DBE778614B04B5DA879 D5U+Y
806,093,516 *53A5F5BDE3C7F402797861389A6A6030C874290C D5v6:
806,093,517 *53A30BD7E81590B291B80EF26B944F5ADCC7F218 D5V8j
806,093,518 *53A1D5441ADD5A7114245CA234DB19D03E3E1A0A D(5vB
806,093,519 *53A24E5F1C2476DCB434BA936E4F0A00DC70E6A9 D5wQ;
806,093,520 *53A8BFEE7AECA0914E3A400B33A1D7D483FFF7F9 D5$%X
806,093,521 *53A150B545F9DDB0016D792F01AC87D7833E66EC D5X(V
806,093,522 *53A2BEC37663419899B75E5F57152F26C0389DE1 D5+XZ
806,093,523 *53A88A2B4C6FAD1BFBFA662EC3747EDD328F8F47 D5;$Y
806,093,524 *53A3E095EB32D2A02E453A428C78C5A49DC376B7 D_#6+
806,093,525 *53A4ACD1E3F97A9789FAD0620DF4C05441A9E156 D,"6,
806,093,526 *53A94DF86B242713B9D09CFDB9A653E351432B51 D?6)&
806,093,527 *53A27D941B2A2DFC61EB759FE1005846A8725C09 D/,$6
806,093,528 *53AA726CE3A81139026E425824BD9751AA75FC0F D.$6;
806,093,529 *53A0571B32A3A328B677C08D57914B76EB81CCB5 D$6/:
806,093,530 *53A7777A464881FED0B1057146808C8BEE219F7D D%:_6
806,093,531 *53AE9D85ED9A9AAC039D7BEB78892249F209233B D%6+.
806,093,532 *53AC80D306B905DB15F4685B7B44862965BC9F7D d6\*
806,093,533 *53AD3A04A660829463DEFDD6A764F63DE06730D9 d60446
806,093,534 *53A32B6B8284C6FF9524B56B1B70DC3F393ACC76 d60516051
806,093,535 *53A3FA8237883014083BBB574EA36B3BC1A448C8 D606,
806,093,536 *53AC1F104C6BAEC6D9E63935147E7E3A0FB8308F D606:
806,093,537 *53AD14FAEC51950E68741CB24F8FD48A14A64921 d611521
806,093,538 *53AEF5C0D5BBAB44F3DD01150C4C983BBC90E5C0 D:61E
806,093,539 *53A3DF67B3B87956ED994FA183DED79B1DC6C449 D61v+
806,093,540 *53A6F068C02C1BEBE8F4C004BFEC4CFF340520F1 D6.1Z
806,093,541 *53AC17C3255CAAF88256D5FE9999913516E9B4B9 D625q
806,093,542 *53AF6C713A238CB896935F7CFCCFED1271B2C821 D62t&
806,093,543 *53A4A876008609BD8DDD179F60C99E68E0188F07 D63gt
806,093,544 *53A0E8D01B04D3BFCE9733F127B00D7D990154BC D63&l
806,093,545 *53AAE8CE11AE91527EBF91CAECEDEA6619B5FBF9 D640M
806,093,546 *53A4F5567D8580E63FAD15A648C855AE8B182677 D6$4l
806,093,547 *53A6BDA5A70DB3BC414F5DB4EE3E7693A2893390 D64mR
806,093,548 *53A3D98AD4F1CEAE03C41F02BE0EA29975EFA345 D64om
806,093,549 *53AAE781927A7A1CC39DFC42CAD80BDD76EAAB6F D653o
806,093,550 *53A7F85911E3FFF911CCA0006C9EFEBE9C383C5F D6)5c
806,093,551 *53AD0DE3EC5F26F417D8A2E4350832A75A817C30 D6/?6
806,093,552 *53AA6D32F28A429BFBA41974520827D7E6503E27 d66306
806,093,553 *53A54A5E281862055663D93D78426D44D453E51D D66#4
806,093,554 *53AEC9A2A3D0E6018A971F8D40AAB02513A6E83C D66T0
806,093,555 *53A8E1A6E41C02B1CE6B1BF058329C06F07BB5A9 D"-67
806,093,556 *53AF72F10B3A56740D850F03AA4ECCF07FF1FDC3 D#67
806,093,557 *53AC28CA86DA6EDAA9177E9EC9521C192C915FB2 d67097
806,093,558 *53A824272E5D155E9ABF787F65C9F2B29E064496 D678-
806,093,559 *53A1F02B4D50B1D130DA76A1585C64BA6E6FC8AC D6?7R
806,093,560 *53AEF13138D6D4FCB1CC9DE33DB295D393A7702E D68?_
806,093,561 *53A4FCAF7244152CEB9EDECA457CF5CDEBB67476 d68145
806,093,562 *53A3894936970649DA8B5CBD226B015C5BD38395 D68
806,093,563 *53ACD78ECC911FBCDC7FA8897244DCA5A015E8FA D68SF
806,093,564 *53A9ECD94ED573EE8F2377A865CA4D0053667DD1 D"_69
806,093,565 *53A2CDC102F67C2066584C0497D5C722C6989C5F D6&9s
806,093,566 *53A123D2A0CCA5FB0C8D838DD0E59C290D9BF745 D=6
806,093,567 *53A9B287003B31E680F9B76262FFED73F331F399 D6A1w
806,093,568 *53A6EE37560264A3B58CE6F752F0E1B614C665EC D6(ad
806,093,569 *53A701BECB348B93964138602B3E1E581666C773 D6aNs
806,093,570 *53AAB4123F479738E15105DD8DC50BAC2D40190A D&6b=
806,093,571 *53A24B0DCD82D4CE18C948465A713355CC7EF498 D6b%3
806,093,572 *53A72F831FF7D010784F8EF650C84994E0FA11BD D6$Bf
806,093,573 *53A4A814B1AF8FB6336707CF560931744FA8DBCE D6/Bp
806,093,574 *53AE1ECF0464AAC4C56A9BD310A7B939023043A2 D6.BX
806,093,575 *53AD55011FC43359E0360BA56F169A41C8B4E24F d6c9960582ea0bfa457755bda8e30d19
806,093,576 *53ABC39DE51698F38953FA26D77E4311C99A505C d6c9x4
806,093,577 *53AA93AFB92A46DBDE9D51A7C644A660FF0B2F73 D6Ce)
806,093,578 *53AC069C9061CB23779CFBAD64DA34A6C0A3094B D6cuf
806,093,579 *53A80286029F66B4A21565A766FD0CE9412852F3 D6cVf
806,093,580 *53A88B50B3DD5B3016532FC20694E3EDF4F17DF3 D/(6d
806,093,581 *53A6BB5809E298C660CD9F23885EEB890B412296 D6d)m
806,093,582 *53A54757F29AEB7D5D0A7A76F21A18414F5B048C D6dN;
806,093,583 *53A2D883BB8E33CEA8E1F9CFFAA11CB652F6C9A6 D6DvRrfzbnKY6
806,093,584 *53AF1FBF36FAC1D64E606482FAB53B8E70B0A296 D6dW0
806,093,585 *53A162205C503735902D5C9D4453E42811E829F2 [email protected]
806,093,586 *53A1737F8EFC0A46A201D787AF19307AF3067140 D6Ei%
806,093,587 *53AC85B679D36E6365CBE6DA913378B24C1EE71F D6E)W
806,093,588 *53AEF7DFC0979107A6467D08C7B3E4A9688FEC7F D6EwV
806,093,589 *53AC407C1BBC7D32424D8E4102884E1AE0A47724 D6,fg
806,093,590 *53A9F651379ED17B551AD8A84A6EBBCD822311EC D6%FQ
806,093,591 *53A416A4036D35403A1951A4ECCD0AD7B004E518 D6F:q
806,093,592 *53AC78FE442789C80BDDF3F8DEFB256F147CCB50 D6fQ
806,093,593 *53A6422C5D66094476134EA6EC55E531DE5D9CFF D=6
806,093,594 *53AF7F29DFA73CE82729F2F23D9597B712B00DFF D6Gkk
806,093,595 *53AE87928AE8AEDFBCE6E43D398A9EBC340629AA D6gYI
806,093,596 *53AA9279E2F0F7B2744E886F23402C6A05F00A50 D6h"1
806,093,597 *53A5FDC8C436FB90DA5A0B3D20AB203F8388A0FD D6HI8
806,093,598 *53A99AED41AB7D90B8F6EB139318D349B5523A3B D6HLM
806,093,599 *53ABA8D2D9EEA44BD084FDCA1738AD50E0FCF478 D6HLP
806,093,600 *53A4BEE4B5BC378D4279C43E93E016023A64F980 D6$hN
806,093,601 *53A8DA28F3F53F14E9764E1F7600F841324FC73B D6$hS
806,093,602 *53AEFB700AE9B191F00FD4115B613598DB861B31 D6iaZ
806,093,603 *53AD47A6BB43065F85D70F2DAEA270C694C27188 D6IB!
806,093,604 *53ACCEC4FCE11BF7FEEF83BCC166463C59330E33 D6IcQ
806,093,605 *53AF4631AC74723A5CEEC551DCD0FB8D6B287331 D6iFl
806,093,606 *53AB1F031E83F51002C3AE6076AA84DDD2F10973 D6I_H
806,093,607 *53A698B0C6319B8B65D083184BE9086A30B6DF30 D6ik9
806,093,608 *53AD0EE5CBBDB81C410D0D548B4788CD14F7F0AE D6I%l
806,093,609 *53ACA8D6EF7A8C66C506411484A843CC7768549B D6ivf
806,093,610 *53A3E7AC37C2B1B7FCD4FF47446DBF55F020332A D)6jf
806,093,611 *53ABD419342BFC0CEFCA5F7E5A1DB2D5A7B6C160 D6k)!
806,093,612 *53A5626602C0C1AFE6F0B3A85F125B06959C8C37 D6ke)
806,093,613 *53A6CACF7BA43CBB172D2E508F00DA0E7DA7E2CF D6kmt
806,093,614 *53A66B1D6D86AE73ED4213BBC35022B00D33E182 D6.kp
806,093,615 *53A22E22E3D4001CBC3C17E4781AAB049BC8BC9E D!6=L
806,093,616 *53AB74BC4FB441676C6CB69FCACFCED30498A0B1 D6L1o
806,093,617 *53AC65B5926DF75AD8F866A7B94EEC7BE5642BF8 D6lfq
806,093,618 *53A0B21FE2EA271AAEDFDC78DAD5970EE5E9A21F D6lFS
806,093,619 *53A4380DE2412EDD9CE20109CEF5DA8F6C0EC8CA D6l=u
806,093,620 *53A785B7BCB84CFE153F341332BEA65FA5E172F0 D6L
806,093,621 *53A27F929F35C5335B5AD6D4C07886AD29479F5D D6LXd
806,093,622 *53A7ED0721C6CAEED3FB422ABB44DE526532482E D(6M_
806,093,623 *53ACAA6546EE49A22A056E88599D451D8FA0DBF1 D6:m$
806,093,624 *53AE5A3FE39A7E5D72C41C615568231060D0113D D6m0g
806,093,625 *53AD81E520EE1EF641BAE4F0DDC3D3F74C9905AB D6mHm
806,093,626 *53A13E56B92B9C67894E7F01A83F0BD3C72AAC21 D6mM:
806,093,627 *53AF3B42D6E6EE6CF03068C498475B1C18ACA8FB D6MQB
806,093,628 *53A166D3A81EC8129C436FC0ACBE920F0A6396A8 D6(mv
806,093,629 *53A758098F43067470A762B1DA37889ED3C131A2 D6MZ:
806,093,630 *53AF26DBC663150300733070AC01806A676710E1 D6$n8
806,093,631 *53A204FC114AD67C67CF22FDBA1A04BA85C40198 D6nh8
806,093,632 *53A86526D154EA1829CBAA3DABBCE2227B1ADCDF D;6O8
806,093,633 *53AC19AE0B9895DE240EB63B53BF1C9175584615 D6op-
806,093,634 *53A0BCD4CF8EA91FC71C0DE8E4B2D2895F33698C D6;OU
806,093,635 *53A9D9B2DE7537490A3941766CEFC888190C9A53 D6;oW
806,093,636 *53A5AD6DF4F98E1E0D8FDC1FD86D6B7BDE3BC6B3 D6;.P
806,093,637 *53AE1193ABB3A2CB402D4B10095AFBBF804DC946 D6#(p
806,093,638 *53AEE1BE701DD212411F0F750784DCBE33E43F46 D6p4X
806,093,639 *53AD457B6223B776934C1AC2FBF5D94258E54C75 d6pbfa3voze
806,093,640 *53A6F7C1839517D3B9362037E0714B5575F8F7A4 D6pD
806,093,641 *53A84ABF2D0210B8C40EB69D812AD5D92FB0A142 D6;Q7
806,093,642 *53A7AD6A20F4F0EA210F39A9AC4788FE20E6D754 D6qcp
806,093,643 *53A13371DD0DDA8D28D77433C62D0DDC18EEB2D3 D6Ql+
806,093,644 *53A13A9196A684FE8CAF63FFC2ACD70341E9FF53 D6REE
806,093,645 *53A142F02158640C16607EEEADBEE9C310FBD739 D6RG8
806,093,646 *53A9B385A255D272BED1B3AE0611959723C44ADE D6rTW
806,093,647 *53A4432527283D96DF7787B8615CDD43A150B5D4 D!6)S
806,093,648 *53AAA0B6778A8357F1262A4C528DC0E25D6D088F D.6s
806,093,649 *53A2ABE995F00E4E3C69315196BAA7570E6D2BC1 D6;#s
806,093,650 *53A24A7A06F31450B7F354137B3CC5DC7D442598 D6SEI
806,093,651 *53AD95E156CE6DECD7D20021948DBAFEEAD36A51 D6S(G
806,093,652 *53A7E98069CF997C43FFCB8166B8E526C6164B14 D6soI
806,093,653 *53A81984794D117C9C9B5EF1B5E337DDCBC77C97 D6Sui
806,093,654 *53A65AD197BCEC3B1A17CFE33050C610AFA94A56 D6sZ7
806,093,655 *53A0BB41B4005863DAB7C94A27AAA75CF59C0C41 D)6t.
806,093,656 *53A17B609F9DC190781316FB5AB809E7161BBDF6 D6T2=
806,093,657 *53A0BB46062B021F7FB48BFDBCA72FC6BCA0BE97 D6TE=
806,093,658 *53A8E58898D8D7D85C56AE18AD8AAA13B42A0FF1 D6T)p
806,093,659 *53A203C423765F482838292FC8B7717AB7181D85 D6Tq
806,093,660 *53A6C0191860A5AAA7B48D8D2F1AD0A210ADC4CD D=6tV
806,093,661 *53A7E5ACBEBE6A31038A03F72D7BE1574F03E391 D6Tw5
806,093,662 *53A3CA26F62644824976C97FF7C5E993A7C766F3 D6U_2
806,093,663 *53A2EE1BB5DDE744F185C70BF849B399F2176C74 D?6UK
806,093,664 *53AE8DA15DE985A18683C9C4948B0947FAF83210 D6Us4
806,093,665 *53A28ADFF90CB5B509879E686333BDF65C8607AC D6uu-
806,093,666 *53A80B97828128CB4EDDC7010971A0BEDBF88D19 D6uYQ
806,093,667 *53A30F22F89B11C31C31358C56EAEFDF9F809A24 D?6!V
806,093,668 *53AB51D1C5F7DB8D598A6FA2647613D342393B2F D6vEV
806,093,669 *53A5FBD0F9AC15158264C2BE701E26701AFAF326 D#6VI
806,093,670 *53A1F459C32BEF7622F3610B65487A6C867D5CAD D6v-Y
806,093,671 *53A36EF4FD84B9F7A30C16ED94527CEA161C961D D/6vZ
806,093,672 *53A9D251B149D6863796AA8549A9EA35B2BB507E D6W?)
806,093,673 *53AE5D52F9FE9E4124E74DEDD83562A81EB44B8F D6w_(
806,093,674 *53A8479C35A6EE17BB3F9855B48DBFCB0E8E26E6 D6W0l
806,093,675 *53A2CC0F949AABD22E432EEFB7E0CEBA5F91D658 D6W1S
806,093,676 *53A36B668D63F586BEE299DA2B6288338169B648 D6WdN
806,093,677 *53A742676C300500005BEBF13AF1931C236B60AE D6wN&
806,093,678 *53A640BEA89B51253ECA002CA7CFA4D4E76EC025 D6!Wo
806,093,679 *53AE8D60C630ADAD6557B029015A6E2FDFCB2822 D6wVI
806,093,680 *53AB8ECD1CCF654B2526B5A12ED1025222FD5C6B D6wWD
806,093,681 *53AC74393B2A56765FAC2C6592E7479BC39C7B2A D6X,)
806,093,682 *53A1DFFB188E70D34474BAB6568E9EAD0F055B5A D6X(s
806,093,683 *53A89A72340D95A6B4B60F7D44480144849140C9 D6YDV
806,093,684 *53A3B085B76E90DA78BBC7FDFD5A089B7FCF9BC2 D6Y!e
806,093,685 *53A23749D93D8A3B13D0491ED429003ABF05742C D6Ykf
806,093,686 *53A0DBA685F3BDBAD132E6F5999774CAD0B7196B D6Y:V
806,093,687 *53A603CA1B50B21B5A0DC94594BB2E1A735F2508 D6Zcr
806,093,688 *53AC09F6FE08E8DD49F4123B073D8E730A71A4CF %D7
806,093,689 *53AF9A5A20EE3373D0E07182E0480ADEB46D7343 D_.7?
806,093,690 *53A1CB76DEBB35AE6E584FA3C0DAFAA755E1ACC2 D_$7%
806,093,691 *53A1555A64510D133C3914D13DC0ACA902DF7176 D-#-7
806,093,692 *53AC36A0C40305D24351D383221946D83D676347 D;7($
806,093,693 *53A30BAFD3579EBAA7EE81A91A2D8C627A9FE730 D!?)7
806,093,694 *53ACA53CD177A737CFF33C5D4E564A6E18ACB52A D+$+7
806,093,695 *53A5F09CD6111EC54AF98E9367A975AAB75339A0 D7=#$
806,093,696 *53AB6A1E3C515B834172903B1EB01DB1A73DF087 D7)+_
806,093,697 *53A160410A1E94123EE6D3B7273EC79DB766499B D7&=-
806,093,698 *53A0C3B4BCD0CB3F88B69E40FB7DFB2C89EF99CF D7$0$
806,093,699 *53A563B306AF0E53AEF59A7512B7419BFA702E6C D70&?
806,093,700 *53A52C17C4590D825AA1FF79023A2A54143170A9 d70300e858
806,093,701 *53A1A8A667ABACC91C82FB11880BB6EE175D582E D706i
806,093,702 *53A762096856AE361BEC666B8E51D3AEAB4FF7AA d7075f97-d706-3a6d-a242-ccc092773b9c
806,093,703 *53AC3AC577DC01AC59EE3942E7CB96DEF871DD72 D/70g
806,093,704 *53AA4EB7367A4DEE42681321497DE39AE5323477 D70ZE
806,093,705 *53A59B561BA9B6315EEB5E8D453A3B05B5B9050E D7!/1
806,093,706 *53A30080011442A221B078922D76B4B34754FD16 D7.
806,093,707 *53A67D75A702DB0D22775733948C251901BDFC3E D7"1.
806,093,708 *53AA1318B828D6855076F37BF3B29CF8F10352A1 D71Bt
806,093,709 *53AC8035F8A63B5A020FF1D34460E35406259E3E D+71O
806,093,710 *53A5E3E4E7D54FD1C530D5887B00DC5E70211DFB D71Tt
806,093,711 *53AD09C5152A7A5F3959A14E56B89C4E2BF73EF6 D_72e
806,093,712 *53A16C78CB386DAC96F7BEDA93682DAC319FF1FD D73]
806,093,713 *53AE59661C597F3234512B86535DB04562CA1DFF d7"3
806,093,714 *53A980163355789AE341C9063A19EE8DB74A3B40 D?73B
806,093,715 *53ACF85CCBABDFD0F817F13556EDCFF0D22D1B5C D74)a
806,093,716 *53AB68A7EEB55DB507057DD76AC75F1F1482A72C D74hA
806,093,717 *53A83747C4D7F35879028C183007F37868D88FE7 D?74I
806,093,718 *53A4A892727DDEC40E801C65D1A5F6CC9AACD1B4 D:75-
806,093,719 *53AB638D16F9790DCD0A61DA9AB0F50162042EAA D75#e
806,093,720 *53A1A6B2A1CF28FCFFDD3AFA89C2090BCBA37218 D7!5U
806,093,721 *53A1FE5F2B863E3A6AE80D19BD42E7C39135A5DE D7?&6
806,093,722 *53A9E124040E8E4CF52C1BBF453B8AEDE0BF0A1E d764e8db-4ae5-3ad2-9851-ad06d9ed6087
806,093,723 *53AD53D7318F5F342BF11636197264B3FB2524B5 D76/d
806,093,724 *53A6E61B6EA860F9ACF91C4DDC92F8D53F28B2C4 D7.7M
806,093,725 *53AA8687C167A0BBD465A276434237EB6CF96185 D781:
806,093,726 *53ABF0D0FE1163DBDEBB10B8F98F2685474F17C7 D78da
806,093,727 *53A4A873D92CB91EDBB539E278D122B7548D3FD7 D;78E
806,093,728 *53A9E943E434ABF7EC40D5EDB093607AB19F94BA D78EE
806,093,729 *53AD4D1F0450105982F134FE6CB2B8DD99D2A27C D78o6
806,093,730 *53A088C0A8EBDF81CA2678E3A80D472A218BB13B D7+93
806,093,731 *53A6878A482D8D96032E46FB41B9E77BAE8ED850 D79$4
806,093,732 *53AC01B757AB26AEC0F8AC4F7CF27E43FB00B5E9 D!7,A
806,093,733 *53A1B830EDA07592B71CF220CA5636D791B24A45 D7aci
806,093,734 *53AD8AED3478C6187D3D50994D5E45CE3854C160 D7A.d
806,093,735 *53A1A0AB97FD3B46408CC586F5472D18196CF0ED D7ArK
806,093,736 *53A11522FBC78453F10BED24E23FEDA1E1F0BB2C D7ase
806,093,737 *53A4F95BF8D3D00845EF38AA47282F4E531BCBB7 D7aUc
806,093,738 *53A867DB2CDBD67758817C0145B1BC67CAB5AF45 D7b2F
806,093,739 *53A5483F3C3D2099991E73AF24EC23DC3D46A70C d7bbxeg9bl8
806,093,740 *53AB8C302D4A7C2871576A2A7D098ADF77BB9101 D7bq9
806,093,741 *53AEC6DFBC5AD5D3F952D13640ED4B65E28E35F3 [email protected]@[email protected]
806,093,742 *53A24F52BD440B4CDBD13D1810E99EA88819A0A6 D7bvW
806,093,743 *53A74A8AB95A63B5F44B05AB4B1F7D0C391550B2 D$7C.
806,093,744 *53A81B1E28D534230AD6835B52B413831002A93E D7C%?
806,093,745 *53A52641494B790DD5747B753F679B43733355FC D,/7c
806,093,746 *53A6A8439737B9CB47AFC12647096FC499E2A268 D7C3K
806,093,747 *53A9651483AC0AE4F179E37485EF41A05FD6FE9F D7C?L
806,093,748 *53A1F839B85749C9FAAA0D93292C9948496E0897 D7cmD
806,093,749 *53AD18BFCBD089E5BCE13B059BA08C1E1550B130 D7c?U
806,093,750 *53AF9E02350F2EDF13313011D06B18D511F9CAC8 D7D1
806,093,751 *53A505570F8B20ECA0278A6FD1056884F54DE921 D)7d8
806,093,752 *53A39AE1862BA8973F01909BFE15105051A16140 D7dgc
806,093,753 *53A97EBC19774CFEE50C20554F56CCCB3148A9D2 D7dK9
806,093,754 *53A34D14F9A201AE28BEE281EE24571A0470DF92 D7D_S
806,093,755 *53ABDB6A55423DF553EE4DC3E6E4CA0183A4DE72 D7E=k
806,093,756 *53A99F1EA721CF085C407A5F9026FD1A688C4EE3 D7E"q
806,093,757 *53A1AF652ABCD2B7657236652E77E359937F579D D,7eV
806,093,758 *53A674C44F98A2AABBF0D600FC586062017B0DCD D$7ew
806,093,759 *53AC82728B96FAA136464EEAA512E9F20E5780CD D7.fl
806,093,760 *53A22B93EAEB986F991F40D228A905243BB26100 D.?7g
806,093,761 *53A211ACFFAD4A7C546BBC70646D5FFFA6564E6F D$7g-
806,093,762 *53AB9BA43C8D69D464F15F10FE59E727483F4F9C D7g2$
806,093,763 *53AB19707A16C0E62A02A8C74B4CBFDB84D0550F D7G
806,093,764 *53AF596916FC1375278ED9847BA0C16C1196F5BA D7GKK
806,093,765 *53A3C84FB7E7012FCD2B2E7F8DDD83246722F164 D,%7H
806,093,766 *53AC75561C2D8F34FDD348DB7D19435A108C0C9C D7h2V
806,093,767 *53AE1C100D74C128D9CAEF5EB34F88874FD1A854 D7hB.
806,093,768 *53A3910B444FE05E8A1819433DAEE88A123F6174 D7hn
806,093,769 *53A7A3F6FE83ACCDFA3BA1623EC39C48D521F12A D7hQ8
806,093,770 *53A1D6FADF802E214E6D9AA125618847F491FC9B D7hT(
806,093,771 *53AD574A0A1FFD03C2995245E0935C88A82E8E6C D&7hu
806,093,772 *53AF22F93DB88F8BBB204DA6638CE311E4BE35F0 D7i$K
806,093,773 *53A118AFA77BAA73D3B89C8635A2B6D8C9F27F64 D7IUd
806,093,774 *53AF175CE1A967CFC519D00DD1C524A97CB94A6C D7I,v
806,093,775 *53AB20AE88ED046038D9B16290BECC3CEFA0CB8C D7iwj
806,093,776 *53A4F3F0CA3DBC8590D98B44550849D78B56A72A D7j7?
806,093,777 *53A0AD6D18586914FDF1DF31D252476C3911A658 D7jNg
806,093,778 *53AF472CDEEEB49B2CA5B1C8CEEDE1C32E651312 D7-K
806,093,779 *53AEE6E50B873532E72C5ECA43D668BB0066AB74 D7%ke
806,093,780 *53AB256401E024FBF92EC1A31F6A235DABADB24B D7KHo
806,093,781 *53A0B0C746C7B1728E2D83ABDC0293D9410F299A D7KU)
806,093,782 *53AB718ED86F0E63EAC0963A5FC893944C1C807D D7K)u
806,093,783 *53A330F805EED35CB388EF9104045E35B5F2D6EF D7LGL
806,093,784 *53AF924CCCCEA18F2AB9D58C38831236404288DE D7LMr
806,093,785 *53A81612B7BBFF0730D1981EEB88A4BA6399C9EE D7LPr
806,093,786 *53AB72C0220766F981A251C84C10FA0522778ECF D7M9c
806,093,787 *53AFF67DAC385B8AB4A089C659EA55F4307CE77B D7m-p
806,093,788 *53AFCB1F56550237881AB12432DA61257F14B557 D7MRV
806,093,789 *53A2FF107AA7D5FC31022E8D7A83E15344574C31 D7n$!
806,093,790 *53A6A7ED55ACA227839170FC244D13796CCA0617 D7N,D
806,093,791 *53A84301C9461A6214A4BA65563A2FFF66EFA0C2 D7nkj
806,093,792 *53ABBF0BCB99860041124D882585A8E95EBFD610 D-:7o
806,093,793 *53AA1C2A508E685AFC9B4E5C4352DA87C75AAC96 D7O5d
806,093,794 *53A4282E34EE87A83333DBDB15C795C88E4E7023 D!7o6
806,093,795 *53AD0B00CBED6D029E36D711EE8DA0972ADA984C D7O!7
806,093,796 *53AAF5FC768C3EFC0B08ACF32C7D27B391264A3A D7O8Z
806,093,797 *53A39BC64D18A42E5B74E95D34B7794276EA2F3D D7odW
806,093,798 *53A6BC6ABC4578693B6CBBFC4ADDA50B9F86E310 D7oLM
806,093,799 *53A659A29094B3668FA502FD0CF6432FD31EC4D6 D7oO8
806,093,800 *53A934A64A3E05370431C99C17BCC78C847A0137 D7-ov
806,093,801 *53A3C64DFF33D4973F3B050B7BEDAC99A7DD8074 d7}P
806,093,802 *53A0D2B86DECA336F43A40E7951DE5834C496E42 d^7p
806,093,803 *53AFF5D3C5E940CBE4C991E2DE94BAF85D060F6A D7pew
806,093,804 *53AC2811F92D1047A56CA791C2AC6D37859ACC79 D7pRU
806,093,805 *53ABCCFCB70CAF01B0EAFEDE8EC4C5F55FF482A4 D7
806,093,806 *53A01B2132AF0FEAA7B273D6A30A6F3130E341B9 D7)Qg
806,093,807 *53A46E9BC943A28EE2B181B00664C78F4C2D6280 D7qov
806,093,808 *53A3252DEF1FADE14416414A8EB040AF92F48E11 D7qU9
806,093,809 *53A1C0D0C1801AFCE8A28B4600F9CBAB9C46FCD1 D?7r+
806,093,810 *53A308F19ABFD2C2F581D06FE0B48A43806DF700 D7$re
806,093,811 *53AB2918F8EC1F91D2900EEB5DCF350E2E458DEB D7RR#
806,093,812 *53A4209B05B95DC399FEF3DAE3B688F42FC8A309 D"_7s
806,093,813 *53AE835FDCDA44A182FC974773262ED66697C43E D7s.0
806,093,814 *53A1385A45BCEBE2FF89A39F705ADAE1D05A92BF D7SBp
806,093,815 *53AD7FAA65F837C782B4AA8771237FC54F5926B3 D7Sj3
806,093,816 *53A5697F9B907BDDE7F557BD6639FCFFED4598A7 D7SNg
806,093,817 *53A87CD75CF78E1509ED9B304F658F74CB4E9E5E D7s?S
806,093,818 *53A0F10766A4DC3F63ADC0689E66D14D1393345A D7St0
806,093,819 *53AAE9E77CD943177DE248852ADE55458F48B198 D/7T!
806,093,820 *53A9624CDB5EAD82CC425BDAFAD8D05BE9984CD1 D7t7P
806,093,821 *53A2F912B5943F413768B1C98A3D4EDB2D10EB62 D7t8
806,093,822 *53A58DE1A5D93482AEA0ED9EF26E92F8756EC5CE D7/TE
806,093,823 *53AD40F1DF17E2BBEF761ADDC7C605D64FDA1F22 d7tlov
806,093,824 *53A4B1593EA1B4BBF73617D265AEA0B3656117FB D7U";
806,093,825 *53AC61D74B262B9027810CCF6DBB295F503A3721 D7Uk:
806,093,826 *53A650041674B2689040803713FD37B7AB373824 D7UNQ
806,093,827 *53AD646A4263C812EFC0F39CD399320A513BBB05 D7uZl
806,093,828 *53A8AD15CCE5979DB484260353BA57F3B634E7E7 D=7V/
806,093,829 *53A123B1D5C4C8A2FBF0F0A639FF6C3F111BF5EA D,7=V
806,093,830 *53A902ADDC799E1A20766EA47BF27CE9752AD55D D7=V"
806,093,831 *53A1DBD12BD982375FD97045EAC52E1122A78FF3 D7Vm%
806,093,832 *53A84C88D31E656101DD59A8F8CACE988CB17E31 D7W8=
806,093,833 *53A68B677311B1ADE0326EC6B811999C963A1934 D7Wi;
806,093,834 *53A362CE412FD950D25C63870F487CC6E034CBCE D7X3A
806,093,835 *53AED5FFF5B2E32BDFF63B5B9CF585CD984D27CE D7XX!
806,093,836 *53AE7D2E6D76B2EE89568D528BA6B1E70CCAB422 D7+_Y
806,093,837 *53A62D8B542416FAFBC61F7265779303BB18684E D7YG!
806,093,838 *53AB1C15D837A99DC401C407E460727694157E2A [email protected]
806,093,839 *53A73F1BADDC101CE7E0A83DD909BCB93897D77F D7YPp
806,093,840 *53A801FFB92EDA56AA68D4B147D3624656E5B6C7 D7Z
806,093,841 *53A3C380713AE6058F456D4658C8FB2356966F94 D7Zc
806,093,842 *53A5107BA7414FF87A9C6B4ACA9498B813B06E84 D7Zhl
806,093,843 *53A34014C67928D967B4FF9BAB7F9DF3BAF4932C D(7ZL
806,093,844 *53A46CC9B95D8424137EA76EEC3858B744AEEB6A D$8()
806,093,845 *53A907985710ECB48A0298E93EAE6BD79F980828 D\<8
806,093,846 *53A8DA11593A3FC56B86E063F4D70BE90F119237 D+.8-
806,093,847 *53ACB60BDF25F9A687FB3AA6DAA162604D58B4F6 D8-"=
806,093,848 *53AEC7E47702133357CBC934DBF8DECC0BA38AE3 D8:(%
806,093,849 *53AD954F805A83EB3C551677C4CE26F52E784042 D8.&$
806,093,850 *53AC0CD846CED5CE7E204B4ED8C138C1BAC85CFE D,8:1
806,093,851 *53AE70C95142D516A524F071F0A06FB29F14671E d81137
806,093,852 *53AFB801B0C792074DDE2BB42017B5792C536209 D8157394
806,093,853 *53A4D07EC9F2CB2F2B43EE9062A4892D290262CB D_81e
806,093,854 *53A8A5F73E3D7EFCC8E51FAD33CF6C98F285A673 d820506
806,093,855 *53A99D5774F5D683EA2A382AEDB9A0608946FF7F D8?23
806,093,856 *53A026556DAAA8F383B6F3DBA6F3D85B46F80E2B D:82j
806,093,857 *53A0053D81A73A6685DD4A336B32952DAD25F5F4 D83%#
806,093,858 *53AC9E2F1417100E04C1C1310957179782CDA5EA D83ai
806,093,859 *53A246DBDEB90B1505A54964C32A4D05A76E5DE9 D83Bb
806,093,860 *53A986E626FB3579B0640B59AF9F5F4C735B36A3 D83Fm
806,093,861 *53A418254BC7B7C0C7A16307801E8E1447A22B5C D83M
806,093,862 *53A6865A7B02E4DB34EB802FC6EFD59C77D5D2B8 D841_
806,093,863 *53ADA964B48851C78920CFB2231A73292614AECD D8,44
806,093,864 *53AF4CB5032D24A9C72A97E9D004D83D9B4757DA [email protected]
806,093,865 *53A02F7A1C15940D6814A3AD764208790935F58C D851
806,093,866 *53AC88B2AA112F54C50FDDB4FF6FC54EFD494E7F [email protected]
806,093,867 *53A56B5327116440387756F1D8C40B0828290A3E D#85H
806,093,868 *53A1124B2F97A5F7F6F2F81924B025B7EBF9B50B D85-k
806,093,869 *53AA4E99634837AAEA869C21AAEEE8E0466C2AB8 D85q9
806,093,870 *53A06A7B72B141316CE658B355B712AD5BB4679E D&85s
806,093,871 *53AF5632F81DA3B7A321FB6230AD83C72007DE82 D86<
806,093,872 *53A8535024DA4317002AFBC73113B360B368DE5A d86038
806,093,873 *53ACF759635BF60E0B9562F672DE90304EFACDDE d86M
806,093,874 *53A876089212FDD3D7FF36804DB54AA38F71C0CC D86p9
806,093,875 *53AA1ADF8F05F77B291BDE0EE398427D29508C66 D=86R
806,093,876 *53A1A88CF691B635BDF7AC0A09D9CD43FC246757 D86x6g84
806,093,877 *53AF60ED6FF9F1C425EE0A3895597668F1D6FE20 d87376
806,093,878 *53A5A0163D1775201CD1B2E0C28BCE1CE4CC6D13 D87gp
806,093,879 *53A0FA611C0828B2B908AFB7EB51EC355D68DF40 D8%7H
806,093,880 *53A23FBB2D3B08FBBD1DED579561DFCE5F69C2F2 D8
806,093,881 *53A59B807BDBFECE2518EEB65A72EC50DC3C71C4 D87Ym
806,093,882 *53AD4ECDC0E4528FD07C51A656650778EF7DB01C D%8
806,093,883 *53A29EA5F0F4E93DF8BB360D9BF28C8E533E14DB d88266
806,093,884 *53AA4ED7FE7B537BC3361DAD08B593C3F01763CF d88889
806,093,885 *53A985504E6D5BA22D139986CA936F569C65648D D88D"
806,093,886 *53A53C0AA306737D67727D389DAD17BF5B0E605B D88In
806,093,887 *53A895B45EC8322E3508A7DFF9B1FAF04E8DB90D D!88ler5
806,093,888 *53A619AF68A771F553263DAA367D3043AA238E28 D88sC
806,093,889 *53A124D7E3EB0A3539ACAA67D3C3ACE05B112F1B D8?91
806,093,890 *53A9BE8563598DACEB4881CE86F01E857F8BA5BB D89,h
806,093,891 *53A18E1BA5EEDC3B5CF21CE3FA434E15829DE55A D(89r
806,093,892 *53AE7BF775900D0D1DF75847A21DB39B194212DD D89ZI
806,093,893 *53A00FE6A5E3D0A80CD1178D64581EB76572529A d8a2525c-1353-3b37-be8a-a2c60c470e24
806,093,894 *53AA7C61246CA022071CCA74425AFD1B10A5E0D5 d8admins
806,093,895 *53AFFA67A379827886C0334D0C7BB4C83DC37B3E D&8aH
806,093,896 *53AEFD903A41B66C46DEA452169364D1EA87138D D8Ao+
806,093,897 *53A6132575E9D1A9C86A8B8FB1FF66F8B623C1CB D8aqA
806,093,898 *53AE7709FCCBBB35EAD45C91C5611E70978E2987 D8Au(
806,093,899 *53AD31DECB84ECA6BAD89CF4FE1EBF00C9344ED1 D$8aY
806,093,900 *53A770BA28A89377B5FEFD9CCE369C1A282AB21F D:8B_
806,093,901 *53A21070FD72DE152E0E833005B85518E36003E9 D8/B(
806,093,902 *53AC42118E835EBAECEB3223B8F3220FA2BF6895 D8&$B
806,093,903 *53A4791B2C2693E4D69321FEE1DD6DE0AAF972B0 D=8b)
806,093,904 *53A3D56378570969E9C49CC61BAA0870ED6DCA6D d_8baa
806,093,905 *53A6A1076D9597E86F8895C468BC797265EB1C34 D8bcf
806,093,906 *53A4623629EE72AC3EFB57DFCC60083C44C390CC D8BlS
806,093,907 *53A97298995841948AE849231B1995F40830C3FA D8.ck
806,093,908 *53A67275FE009D1B93B76A34A64EDABD28B4A47F D8cm;
806,093,909 *53A91A7DC1A8F3166FB1DDB31DF471268E02962E D8cPN
806,093,910 *53ADF53E2BAEAAC53073D995CB4BE0F05D0606AB D8CQ6
806,093,911 *53A8099498F9D408E8D5BA3CB24891148EAF9CDA D8cTN
806,093,912 *53A54FBB6801C930866FEE300A247773BF25AE42 D8d4s
806,093,913 *53AC57EF632968EAF9A0290FCEDF569262D5A519 D8D5M
806,093,914 *53A395D0D533B684E4C107736B64B9EC4B247E3E D8dh/
806,093,915 *53A9A38C1D7817EB6ECD3FB6DA3FAE55D9E72C74 D?8ds
806,093,916 *53ADF80703A227BE13319DAC125046C423D715F5 D+#8E
806,093,917 *53A07C5BA9D604824127350CB0DBB1A58BABA91E D8}E
806,093,918 *53A0A0736F5157A7595BF77B45C0CD68A3A30E63 D8(&e
806,093,919 *53AFC56A87E5D92FD506176C27F6E937984672EA D8E#1
806,093,920 *53A905CEB180106F43CD39313CED018DF2D47FDB D8ee=
806,093,921 *53AB8CE0C2879072FBD863667E40B0E60C92C012 D8E!G
806,093,922 *53AD7896096C7FF0F0B87C04A1F33A4209F9CA34 D"8ET
806,093,923 *53AD9B66EA3A2D6C5A3242B68E9315A542114B9C D$8f,
806,093,924 *53A1BD347B8669C6B4E8CF7C61BF02032C8C1D9E D8fB5
806,093,925 *53AD0737CE887AD6068F40D67AE117D2DE78AA12 D8FL8
806,093,926 *53AE28F9E27C5E4B8C33BB5A88D97D21816BAD96 D8_fQ
806,093,927 *53A495EF531EF68298D6E8191201594BC31329FE D8fu%
806,093,928 *53AC27FC6BB1F53876666404531B0E927C282134 D8Gbj
806,093,929 *53AC14535B210C4905B1B7A5D088556AEF90A32B D8gG9
806,093,930 *53A2296E219435C5631244AD114EE3043CE1BC00 D8gL#
806,093,931 *53AB9B8D5A04D688A196A5698F9A2FA560F50129 D&8gX
806,093,932 *53A6CD362A7EC8824A054C047F7A14849E5C5489 D8$(H
806,093,933 *53AD9E27EAA8C82BDFA55CB8E63E3A9EB0CB1BBE D$=8h
806,093,934 *53ACE5150B8283C9E5DBF75C8E4754A4FB1DF5E5 D8HW;
806,093,935 *53A9FCC3624AE47466F98D12F9F2587447ECF4FF D.8=i
806,093,936 *53A6BA862AFF38B92E97EFCA9498472A847DDC74 D8i+1
806,093,937 *53AB59BFA8FD1EC721E37A4FDE07BADE7B576ECD D8I5Z
806,093,938 *53A746098F6AB698254DF21B7B579A6A5EFF856F D8j/g
806,093,939 *53A2618FE1E5AFB6F98273200C399BBE28334DCA D8j/P
806,093,940 *53A9CF8BDE28CCA08688741D9007A1B364E2F40C D8jp"
806,093,941 *53AB35A654EC987C497A58214A4C7B968AFFB06C D8kK4
806,093,942 *53ABF3C945783B6BA8C5E07FF5AD666A3F89EF85 D8kqe
806,093,943 *53A16150C25835AE1A79456750ED22FF586383EF D8;l%
806,093,944 *53AC5491875916B8F0ADCB3EC75B99004DFAF0C8 D8L$i
806,093,945 *53AB04F0687F593EC25EB58C5FF1454D40593D27 D8lP
806,093,946 *53A15FD34ED5E2B0587F62DA00595B1167C360CE D8_lQ
806,093,947 *53A9C738BC4AFD7BB0BDD0EEDE4FD0A2C76C3AB7 D8LWZ
806,093,948 *53A5AF5D3C6C0D853DC17274B8E7453C0CDCE0AB D(8,M
806,093,949 *53A76DBD4F40C3D9DAE89D179554CD65CD5588BE D(8/M
806,093,950 *53AEBA371D6D32EF50B616A7DB5372099465807B D8M-m
806,093,951 *53A5F40F37D44A4DA003C4B38B8039507F016580 D8,mt
806,093,952 *53AD8EEE899A5E3023AA322A9B1F06C2E26E7F78 D8n34
806,093,953 *53AAE2A81320A73F21DA6DEC6F1CB120755BB56C D8n;A
806,093,954 *53ABAB90DF3DA35AB775C37C3A22130B3B045198 D8nbH
806,093,955 *53ABAB67D5CD5FFE8A6996CD0F1505E1C94BD62B D8NDQ
806,093,956 *53AEDAD7BDEC97E0CF04FAE85E20EB2E6A52E286 D8nG
806,093,957 *53AA53F2F7DF8E7F1E8A729D9DE83D785B8877EE D8N"m
806,093,958 *53A41C9C00F1A692EDB4459882CD7C1F0ECD5BC4 D8no.
806,093,959 *53AEC19F6333EE933FC0320D94E44BCFB0D1AC2A D8.o7
806,093,960 *53A17782FB5E22A9C97215337F437E29AA9E0786 D8O8p
806,093,961 *53A56F0470EB70754118991D309E7399BA0645F2 D8;Od
806,093,962 *53AAE2B9A31DA919A2B436A76D09C6C32F6FF439 D8Odj
806,093,963 *53ADAE3DD94A6A697B73173BFE553B0F837B5AD3 D8OPh
806,093,964 *53A92841AA46A081437AB309CF23B3E0FDC9D626 D8pHw
806,093,965 *53A4E738572510B188182FC9029654D2B5BC2B88 D8P:O
806,093,966 *53A3DF902B96F50715F53DA4988A04F08B43B5ED D8P"S
806,093,967 *53A3C85B4C757392BEEC9A23E1480092131FCB9C D8PUc
806,093,968 *53A2AA1DE8EA7FC83C12FD35E3E738726B84BDF4 D#8/q
806,093,969 *53AD39312033937063760A49E8F20E87C06AC737 D8!Qr
806,093,970 *53A074A8D31AA054AA3FAFD148F493A928BE56FF D8Q)T
806,093,971 *53ABC87EB508E69854474DF138946870503E7657 D8/R:
806,093,972 *53AEDD58949AFA2E37622715E43F9ED6ADCB1D3C D8R&e
806,093,973 *53A6856DA9C88D986B7A9191797C36D90D2835D1 D8!Rf
806,093,974 *53A430694FA09ED46703445FBE2828E8C85E176D D#8rj
806,093,975 *53ADB1B535EB7C0C31012FB46911CE948047EB4A D8RK.
806,093,976 *53A3A5FB983F01E7AEDA17E1A84AFF8284F63668 D8r"W
806,093,977 *53A3764DB5D221E31FB38F75B552B2761ABD8C8F D8RY&
806,093,978 *53ADB76BBC4F5D7D5AB25001E2FFFB455BE94D64 D"8s$
806,093,979 *53A3583AD841CB7817464EBF968FA105D9669244 D8s?A
806,093,980 *53A73E990CFA74F1FB71A5EEA341710F5032F5BE D8SNt
806,093,981 *53A254187D701C2C7F92172C441BB2925E904C7F D?8ss
806,093,982 *53A3E6F10EC9C6812B94C89EA6A6FBC0CD6543DC D8Svv
806,093,983 *53AF01092ACEC44C6DA62A2FA3BC29B282379ED6 D8{T
806,093,984 *53A7B44D40A10235AADB65D616AEF3BE12D822D9 D%8tH
806,093,985 *53A442696C401712AB070A3B38457996529EEAA1 D8Tk8
806,093,986 *53A16544971EBDA7AE1AC5728BB8EAC7968A3F57 D
806,093,987 *53A6768E7407AB63021D0CB831C1B5640988FF58 D8)U"
806,093,988 *53AF1EAB2891ECFA8E818AEE204F6B376BB2B96E D8uK(
806,093,989 *53A043593771B5A003BF7D433FAADC4AD97CA621 D8UR(
806,093,990 *53A7D0D7DA231817DA98AD0C871DB77C3134E8C6 D8v.+
806,093,991 *53A82D7CA99A09CF2F2F7ED60DDBAEE7B8205FE8 d/8v
806,093,992 *53A1AB714EC250F530A3B7D56225379C45362B59 D8vMP
806,093,993 *53ACF9AF797AA7A928573BB211224C058382BD2C D8vti
806,093,994 *53ACE0FC4BF4074C05AC51A81C0F108C2E02387D D8Vu/
806,093,995 *53A118C0AA75FFB960C7C03CD42D6C43353F6280 [email protected]
806,093,996 *53A52731C85F0CC6F2A9F89AA38FA5CEB4C67C0A D8W8o
806,093,997 *53A4004816B93C2B3DDB21435BDA888AFCE2D374 D8WcD
806,093,998 *53AC4397199F0D34A641EE0826A1F2F6D0A8A235 D8WMB
806,093,999 *53AC0302F61E4296E872DC7655BF3947BA0D22F4 d8Wo
806,094,000 *53A6658A933BF8EF287718A5121588290F834221 D8WUP
806,094,001 *53A1EF3DC24AB6735B1C9F985F9814B2A33F6C1E D8Xro
806,094,002 *53A4DAACC9BB67C078BEFC1F676AB9F1586527DB D&8Y1
806,094,003 *53A890D9BDFDF5BA859E156FB61D495049175666 D8Y"7
806,094,004 *53A62E7C3F73DB2CAAAE9B28C7958B9F0A073FC9 D8YFF
806,094,005 *53A41E60D54F089BA0D00196C1216C808625A9F7 D8YTg
806,094,006 *53A3785A496F394027AA9AC203E8A9B8B18C692A D8ZBa
806,094,007 *53ABE573D35C732D14A09783B843ABCB9F3E5FC5 D_#/9
806,094,008 *53AB24AEB58651481F068B991BB80E4BEBDE4AB7 D-9-#
806,094,009 *53A8E33D68977307A5D433B2FF4967DCF9D2DA88 D:
806,094,010 *53A3B45E1FEA475325378E975172BBF48857ED4E D:9,&
806,094,011 *53AF722A61A47FEE73EA3FF37512D31895A661FB D),/9
806,094,012 *53ACDC2CED9C2EA418BF03CE49A00B7F25CC2132 D\.9
806,094,013 *53AC61F04AE568E065934332FAA9F78FB8A7BB77 D#9&&
806,094,014 *53AF8A766C770A985D1D181FE4795F41964231EB D+#9
806,094,015 *53A5BD551875DB51002A546F900436AD2F34B058 D9:
806,094,016 *53AF32F866033A3F0703744A7E255CF66384C95A D9%:?
806,094,017 *53A2875CFB3DA80C72EC39193EC640C6F3A9FC32 d9&|
806,094,018 *53A99E3524347C43A3430A83626A7B80924C90F2 d900714
806,094,019 *53A1052437250DFB27F7AEC9FC9A2EFAE7F36DA2 D90W(
806,094,020 *53A46E4E3DF82184E7F926532345E33A03794C89 d91234321
806,094,021 *53AE31C7AFFCFE16A73B99857F57900071CD1ED3 D$91l
806,094,022 *53A7A505F7483EDC434741BE21DB85D6C908B7CE D91(r
806,094,023 *53A14B97FAB975B70F83460AE6435BFAC42D210A d9202979
806,094,024 *53AD2A3A8F4B7229F5522801EAC1F3D7D1331AB8 D+921
806,094,025 *53A58F0D7AA0BB78E8C98817470EF2710FFC21D7 D92TM
806,094,026 *53A8215A28681276EFCA1FD0189DC5C3F52A9516 D9?3:
806,094,027 *53A432735B2CAA5D63106A4A09C0D6E9EE12F50B d93093
806,094,028 *53A8F17A9032748452E0E0A4B80454B3567B02CC d93217
806,094,029 *53A3803319EC70A4A8672695A9AC00EAFA142594 d93245
806,094,030 *53A872BE15AA2EE53192E8FC4026C39A127482A6 D93"6
806,094,031 *53AB5BB4E792E69E5669EC878AAF398330B92588 D93ES
806,094,032 *53A6172D2B850D6DBD90609B1DA1E17A65340977 D;93G
806,094,033 *53A45A59C96230F68F9BF4611918F6CBC8B55C14 D93m&
806,094,034 *53AAD31DEECE3506F644AABCDA5D9E4DE54978E3 D93o1
806,094,035 *53AEA1E2EF14F6694765416BB4394008FDCD4BBC D94?&
806,094,036 *53A2A6F3E34962E3C6616AB4256C39826E753817 D946&
806,094,037 *53A133246BB655DCD92820516363FC388E7829D6 d9481
806,094,038 *53A16FF81889970A3CE85C3F47973FD45834C400 D94"b
806,094,039 *53A42EA5D85ADB8E52670981BA0B11CDC02FC784 D#94E
806,094,040 *53AD70719E8A0BB99732D232E00E96A80E4B4144 D94G2
806,094,041 *53A30BD5FAE5C6E6B4EDB6EF8C977199B9AA4EE3 D94L
806,094,042 *53A79FFB7CFE06EA8B7E8DE0661297AC122B099C D94t%
806,094,043 *53A5FDF6E0517A09035BB4C66E527A8CD4765C98 D95
806,094,044 *53A0720C3ABE50AA8950BBB3E7EDF646FB91A274 D%96/
806,094,045 *53A35DFC6C4BE67F11734BA2150D0FF19703A07B D965)
806,094,046 *53A55FE1D24B5BB28852EC6FFD6085848BF51B4D D9"6j
806,094,047 *53ACDBDF9AB9669543EE902FE7776BFD5690561F D#!97
806,094,048 *53ABB4A56F06B0791491A463A119F307E6860208 D97,9
806,094,049 *53A6EBB65F3CB7087F1C4D21D220F04E88C21B7E D:97X
806,094,050 *53A1CE617F17186751091488650903E7BCFB0FCE D9!7Z
806,094,051 *53AD390FF70029017CB0B7B043CE7660DB80E22E D98A=
806,094,052 *53A2CC936E4902DA6B162915419CC3AFFAA58E21 D98#E
806,094,053 *53A274795EDD74B94C94B0C51C34F07C11BE558F D99f!
806,094,054 *53A2E4D383325C5AD5C3BE7569AB34DD707C8FAA D99ne
806,094,055 *53A14EE533B85C3FEE9FE1E02876565E8016383D D9-9o
806,094,056 *53A51E600E54D90A28996FA0D69404AED645C7F0 D99pC
806,094,057 *53A01442B1275ABF10B9FFAA95FBD19B39F504F6 D9A/?
806,094,058 *53AC57042F4D281C10B40E6BB4BED3FCDAD4ABD3 D+%9a
806,094,059 *53A7DC695C82F8BFB6A445251393D7CB2C0F14BC d9a08adb-53de-3fcc-9054-080d87158ab6
806,094,060 *53A3F32938049FBB0EFDE43652612052DFC0672D D=9aO
806,094,061 *53A139E110F18248FABCF3F8AC655F1B58D81D3C D_+9B
806,094,062 *53A5E49993DD5DD0A1A7761E6031E820D845B506 D9BBZ
806,094,063 *53ACE209BA8F30B1BF51BB33B9B5AB15BDD7B989 D)9bC
806,094,064 *53A107DE51860688E09B3BFFA245D5D0E8BFA4AC D"9bc
806,094,065 *53AECBE6E230C45AA6AB55DBA6BB0D242FD0AB45 D)9BI
806,094,066 *53A417EC1158B995726CD8578F7A0D4DCA815421 D9BKm
806,094,067 *53AE1DBA40DE2BFF816EA6E7F39CC6C53E5EADEC D9BZC
806,094,068 *53A07331E047252955544DA1D21095398DDCB16C D,!9C
806,094,069 *53A71CA94088256FD769EFCB0140690C3120F619 D9-:c
806,094,070 *53ACCF9ABD008D6B5C6EC30FF971E82A7F385752 D9cf!
806,094,071 *53AB1E17D32B68A719FE84FAAA272895594C81BA D9CiC
806,094,072 *53A285537F3A909BD0C6FA7EA0B538F13DC8957D D9COZ
806,094,073 *53AB72D67C581F1DD0E179FCA5B5390C8B086A16 D9c/s
806,094,074 *53A1C78AAD2C3A712FEE50A8AD8D90155A83B84A D9CVa
806,094,075 *53A834684A1330D0B6FCB67BC646C406AA800128 D9C_W
806,094,076 *53A2E34BD7C9A2F578C25C8BE9FE65C7D62D4537 D9,,D
806,094,077 *53A401EE7633F20E60D99F7787DA582B76F1BAB6 D9D"0
806,094,078 *53A0221BF519E6C618B67AF421A31E5F8ED87568 D9DD!
806,094,079 *53A862124BC5BEBFAA9AF9F0EBFE53F2E42A30A0 D9"dL
806,094,080 *53A41BCF1BA810BB368FAB891DE531B5204120E6 D9e#/
806,094,081 *53A418823779F98A75CA55FB1B3EF03278A412AD D9e4_
806,094,082 *53A039A9C5A08534A8541E3E395E9496D5CA86DE D!9E$7ER
806,094,083 *53AC5F5E4261155FDBD927FB36785A9421C2A906 D9eAG
806,094,084 *53AFD36DE83C8B8902F38C6F290DDF35E25D4E1F D9EmG
806,094,085 *53A62C19AE5594AA60D806BC271EF6D17DA97168 D9Erl
806,094,086 *53A84F57CE1BD1810B830C4D56CB0D068BBEC55F D9&?F
806,094,087 *53A56C86BF046735DF6381757F74DFBED2585A29 D9_f=
806,094,088 *53A8F10077FE67ACD7B8A08A64DE4459C7DE6195 D9FJ
806,094,089 *53A347C5A112708683656E1DE437AC6EF571CC94 D"9Fj
806,094,090 *53A75F40F735288B9587A2C2F9727E539C098608 D9(ft
806,094,091 *53AA082C513E3BB8A4CE60D4B6DDD9CB0D98DD13 D9fug
806,094,092 *53A771520F08A4AB62E2D85C77AD38355B95DAD6 D,9g;
806,094,093 *53A320CECEDE5822643B9497B398A92338E86853 D$"9g
806,094,094 *53AEC8C12AA66C4D39E0BB478CD5ACEF37174D03 D9,g6
806,094,095 *53A1841807C3818DCB181544DCE49250F39CF661 D9;gF
806,094,096 *53AA509297F18D58BBBCDBED95CC68FE674F4D32 D9G?r
806,094,097 *53A7F945DB789C8489E86092B7BA7D7CB9B045A4 D/9GS
806,094,098 *53A77897DE26DE7336D4FDAF0C9A39F2E2A5BB34 D9h/K
806,094,099 *53A72C3E1EAABCD46EF9BA738C8AEED512FFF1DC D9h$k
806,094,100 *53A732D9E117132F37CC94F1D078DA8C1BF5F735 D9H+Q
806,094,101 *53A46FF57D342545E7717F31224EA9276339B55A D9:I-
806,094,102 *53A3F83F9C9B2B4DDDCFD6FCE77739FB98A56CE2 D/9i+
806,094,103 *53A6C24A87B6984879753F89900BD8D95A680384 D#?9i
806,094,104 *53AA0D7AE0343844C3D12A6433C2C10BB39C0519 D9I91
806,094,105 *53AB2CE1E540CFA32B69F058025F4A07B02271CC D9ICO
806,094,106 *53A1D40E38A9A4E565CA9502056BD21845F97E5B D9$if
806,094,107 *53A173AF405E60F64ADBEA459F3F7C4CC9E24E13 D9Ip(
806,094,108 *53A27CE7D9D8FAB1A7D443540835598AEEE718D7 D9jCQ
806,094,109 *53A8E4E6D1E60FE497E4DA444FD4734F6691C482 D9
806,094,110 *53A2E5EA8A846729F6A51788D4637D5A12A882C0 D9K7V
806,094,111 *53A05FA232A3D888471BA627C25D319F37B41C50 D9kX4
806,094,112 *53AB3E676C126C3FF551F32B1C7D78CAF21D6C5B d9;L
806,094,113 *53AECCA8B4CFDD20A1B908968F8881D101E77D0A D9L4r
806,094,114 *53AF5F58EAC565942DC093BC171AF6342578FD5D D9l_A
806,094,115 *53ACBD61FF45A3E64B3EB38E6500D2EF4CAFDABB D9LFQ
806,094,116 *53AA167C95EDC9761E0C7A41EB33362C92359FD2 D9lHU
806,094,117 *53A1057BC9B5027703ABAF0CB7C12EB6FB7F7526 D9L$r
806,094,118 *53A7825F6283B5A6EA19AF69C0EF2FBE2F0CC620 D9=
806,094,119 *53A79F328BE41C530582CE02827D8E919CE5CB39 D9M;4
806,094,120 *53A6E2EB76E2D83CA98D5E0C0DBD845B8288A861 D9mnC
806,094,121 *53A1928D2ACCE74F857D3EC1AF01FBD25CFB9872 D9mWr
806,094,122 *53A93BA82B1B4F58CCD208C1AA0ED32626E90BC2 [email protected]@B1E
806,094,123 *53ABB5199004560FAF09981857529C553A1D9926 D9n
806,094,124 *53A6A631A2BFAFE29A695B3BDC94A520BC725B7F D9N$B
806,094,125 *53AF414909BC49B659735DEACFCE462327BDE066 D9nf.
806,094,126 *53A8ECAA6D4229E9AF0449311A1DF327E372ED4F D9NLd
806,094,127 *53A54605B90FDB02C7765A3D9E4176B1194EB9B9 D9noo
806,094,128 *53A84981712B575B92B56640F1791F56910B080A D9_)O
806,094,129 *53A0C27ED057BC469B3790E7139D0E00B6599C20 D9)o+
806,094,130 *53AFD2FB083CC18F7B056797085ED7C82AAF88C7 D9o2Q
806,094,131 *53A3CD66DF983F43C93751209E62E6B9A6581EBC D9oC#
806,094,132 *53A75222C63B29A9DDE1939280AF4D59D55EE1DB D9!=p
806,094,133 *53AD1C6EE8B2E09106E8988978DA8F0F21FD8521 D_9p2
806,094,134 *53A4484402482765AA2121C256045FB8BDDCCAF0 D9P7L
806,094,135 *53AD0C2C768B790FD74E64B312F13CED08802A80 D9paI
806,094,136 *53A1DF77E448BFB1B33A85678D5314D856B9D435 D9+pi
806,094,137 *53A97ABF61315647C12EFDCC63158A23C22EDCF8 D9=$Q
806,094,138 *53A6F73EEEADE17DE421178C6B557F2636838373 D9_q-
806,094,139 *53A62A24945B417A8E80E9C0FBF7E989A47F7C18 D9Q1M
806,094,140 *53A69C38B95705CC60096129E40A09CDF9B9DBA0 D9qgc
806,094,141 *53A81259F4D919B02454D9E0321914DC8D53C70A D9QOU
806,094,142 *53A042FACF8F0CD7FA8FC8945CB8565D8B6DE0AC D9QR
806,094,143 *53AAAD773DDD96C100D694EF08DC067C562CCDAD D9:=R
806,094,144 *53A1CD14A328306505D8A8942E46E21E1A0A3CAE D9r$0
806,094,145 *53AE7E4B2ECF7E1D639381BCF652F25B74A1E954 D9R1t
806,094,146 *53AC07493023E067AB4610E5FC7CFD24E9C7A276 D9R77
806,094,147 *53A058ADE08504EF8CC9B370EFB9EBDA5451509C D9ru#
806,094,148 *53AAC270FF47C0548015994DE8C7ECF816541ABD D9Rve
806,094,149 *53A177974CB8C933DDDB81FF68EFF64B8A163345 D=?9s
806,094,150 *53AE8549EA440D46508A4FDFF219F534D53B4C8A D9S76
806,094,151 *53AD52D16A478C88A1A0CE1F0A416317767C7D16 D%9S9
806,094,152 *53A4A1678AD98175BCC5FF820CED9EFF712C5AC8 D9s"A
806,094,153 *53A6AEA5BC4840C43F814BBE3836BE7C316CF176 D9sOt
806,094,154 *53A4AE1824799AFC100C943572AF21382732FEA9 D9S)R
806,094,155 *53AD43E1B51726DFB8C78FCB225D76CE2F5E91D2 D9SRq
806,094,156 *53A5E550FD2B1E56600F458531E0595E6E16A278 D9T/
806,094,157 *53A5D90537711D4D42A504EAA5DEE3414A6B7571 D9t;7
806,094,158 *53AAA74E0DB88E6EC7ACCF5EBE79B470C580D5FE D9tDF
806,094,159 *53A9DB1744655B3C1E8CBAAB83353C602EAAFCFA D9Tow
806,094,160 *53A1C6FFE0413629F880A8FE6AFF67242BCA9E18 D9t.q
806,094,161 *53A92AC7338833F8205C3BF7EA2A8131BCAEBAD8 D9,Ts
806,094,162 *53A24B56C545EE646F17A00E084FEEB0DCD7A2C6 D_9tV
806,094,163 *53ABBA75BBBC18E7B6D73D40F5B400CD3A8EEA81 D9TXw
806,094,164 *53AA26A6ED082635C62386AAA854D69955FA7790 D9U?C
806,094,165 *53A56B403997A9447DDA90EC05BE82EB9DE1B341 D9uK$
806,094,166 *53ABD98804D0DE287FCAB814DDE76D3245EA03D7 D9uPc
806,094,167 *53AB941F30C074B8D3E71BB49377B8211D36A258 D9:V#
806,094,168 *53A51D376EE2AA33FC8F5A1FF7681A91AD0306BD D%9vF
806,094,169 *53A6E124DB75D2ABE4E8BF214A7EC1248970B257 D9VK+
806,094,170 *53A068F7FA44ADB918C7F38890CB2B01F09D788B D9vXf
806,094,171 *53AC1FD290F98C0E83603EBCD856682996C176E7 D9!%W
806,094,172 *53A1FD82CCE075AC18329B7B646495036C403CFD D?9w&
806,094,173 *53A0D2213345FC6C6F6CBFEA35C2FD3D148F0810 D9w5B
806,094,174 *53AC68464CBF8D278FB67D43AD634C190327098B D9/Wa
806,094,175 *53A4A6ACEA161C5F4FF8175C5EEA74909503DFD0 D9W?c
806,094,176 *53A10991322EBBC1E0154816D0C9189E0EEE7726 D.9wk
806,094,177 *53AA73387C3785B2F363E11FF4DB56BF94617694 D9wp3
806,094,178 *53A44BBBBFE68F913F47BF048875396902D398E1 D9ws:
806,094,179 *53A3C9D1D9618D2D4385EBC0D98495A85548D5BB d9x7
806,094,180 *53A468EC89C9A2E3DC32432B33E71EC2282E4CF8 D9Y-%
806,094,181 *53A0C562EE4D37272D43EA2E7FA6A2D766D32AF6 D9:Yr
806,094,182 *53A3AAF1F6880BB82B5C8455DB6C7AA8F2AEBBE0 D9YZp
806,094,183 *53ACAF7D100D594C6CF1C0A8D570E0A1C638CB36 D9:Z#
806,094,184 *53A14CBDE59F9FFB337C65181F1CED15618D7880 D9"Z%
806,094,185 *53A994AD0891D5E29B0354140DEC6FCF843D9928 D_9ZA
806,094,186 *53A7F47F1E3D0562207C0452E44327B796532C9B D9ZAA
806,094,187 *53AD665D95F934980ECC7FC27C7228CDA41B2E1A D9ZDA
806,094,188 *53ACD839C20920EC84B987823A04BED2B8D61E6D D9Zgk
806,094,189 *53A16444E6C9CDE8DAE722D8F64A9C28164EAD05 D9ZQd
806,094,190 *53ADE813F9DCBF1B43CCB5B299DE265A8E7BDD2B D(9Zw
806,094,191 *53AB0B4966DEF851328E7C543EFEAE9FF5A22D7D D9+ZZ
806,094,192 *53AA0728E7FA3C166F0B1DDCA8DDEA6CFC1ECD48 @=,D`A
806,094,193 *53A0797546C389025D8D905CB29C062EDB6C0816 D,A#_
806,094,194 *53A5E3B90B1DB5368990783294F375FA547ABDED D,A+"
806,094,195 *53A09B3B5BE28DCD8E9A254D68B085800D965E79 D:~A
806,094,196 *53A73E7E665E0CA9EF38282AF76501FC78CA6B43 D!.
806,094,197 *53A7EF937BF171703B85EE8D42073CF47A02B004 D/&A=
806,094,198 *53A6636F6AC673DE5F49F866DB2B819540B6A45C D[A;
806,094,199 *53ADE7A356D3197761A8D00DFBF2F8709B20F790 D%!,A
806,094,200 *53A445329DDC984A62AF2127C7F28D566C3E8DDB D
806,094,201 *53AF1EDA93DB5ED549D0A8BBE39AD6264B00505E DA_=
806,094,202 *53A9D9AA6CB83128631408AAA0A5807E0CDA377B DA;-$
806,094,203 *53AF2A4CBD171381A1B3723AB591C5F083333879 DA:;
806,094,204 *53A2AE06AB23207F61AD1FECCF160756AE035397 DA+?&
806,094,205 *53A267AD9E33F699526256CCEB8C7388BF043182 DA
806,094,206 *53AF45EE52D5BEA49ACD479DC89239244E94C5BB D,&:a
806,094,207 *53AFB34A44F5234F99D53B571B606E7841528344 D:a
806,094,208 *53AF7ACF1571148EDF1F81A23561D5995AAA6864 D!,,a
806,094,209 *53A4EB5338FB1030BE7E4D6AAAE907F04FF5CE0D D!!a!
806,094,210 *53A58963D785F7F1B2EF7DD7C9FAA2B0B9CA1AE2 D/a+/
806,094,211 *53A5BE8E750B422AA1BD757E8CEA857ACB10AD71 D
806,094,212 *53A916AB53D8B1DF74BB14B54FF858826DB4F681 Da,_"
806,094,213 *53A37724D0D10E360EAEBB97BDCFECD2D6A58D8D Da!#=
806,094,214 *53A85A87FE67717B3F9763BBC0713CBAD1A02D53 Da]'
806,094,215 *53A85FF9EC8721A02CE3A411DE56A99AF0BF57E8 D,;A0
806,094,216 *53A471FC31DE32DCEFC57DCCB9682336B89CC44F D:a.0
806,094,217 *53ABA79C09842CEA02E387E3732CFE156657D8DE Da$:0
806,094,218 *53A07D707355F68B55AEAE6009E829B5BAD78E24 DA050983
806,094,219 *53AECC5551B9B3C2FD099B56DBACCC489CB4177A Da0O8
806,094,220 *53A1093119920176C2CC13B8096F57DB0EBA33C4 DA0!W
806,094,221 *53AC7BF13BE6178A013805074CC2ACE60818517C DA10k
806,094,222 *53AC7DC2B5636C60882FE2DF1F69676AC810EE5E Da15O
806,094,223 *53AFADAA9B661BD29C34F9BF8E6D85AD4E4B6F34 [email protected]
806,094,224 *53A83E61583CA620F8F49056B58EE4FE6BB24B14 Da.18
806,094,225 *53AAE0DAA3E44C3799EB96D09CF071458FE7BD29 DA/1E
806,094,226 *53AF3F89B879D6D7A5572C601FD0B73207E6E271 DA1F%
806,094,227 *53A38C6E26989B6BAFA82CEAA4D9C4179BEA7003 DA.1W
806,094,228 *53A13B9409FA79E4A0CF2D0D816E87103986ACA7 Da%1Y
806,094,229 *53ABEC753103912336EEA2691951D89264CFE78F DA2$:
806,094,230 *53A01C215F9973225DE702A9AF5A5FB2BCE1623D Da2//
806,094,231 *53A42BB49437901AB889CD25E15F9857112C7A16 D,a2b
806,094,232 *53A7837BCADD4F7EB779BD31154158307F864966 Da2ee
806,094,233 *53A0A7ECEDDB2D832173DC90C80329596FA8960A Da2eZ
806,094,234 *53A8EE632E8A469AA25DA0F1A68DCAB146CC0ADB D!A3)
806,094,235 *53A56223B260020CC97AE66668CB33A2BE530EC9 D?a/3
806,094,236 *53A3D96DFF15FF367DB31315330F720D15531704 D#A32
806,094,237 *53A4465A61F088A18F0599792929BBA6C3B167BE DA3=3
806,094,238 *53A7B59D7F6704CFB8EA8D65B1E7A509285A9379 DA3cp
806,094,239 *53A408478E341647C3A39B8AC259F86D4855E743 Da3d&
806,094,240 *53AFC4180151482113156D1E1097FF024DD9421A DA3&L
806,094,241 *53A37A3033F68D853571C14C068191B2AABC4A43 DA4%_
806,094,242 *53AADC526D2684137475C23FADD90E33F7C640E4 Da46/
806,094,243 *53A541C47058764E1441D4CF4836CCC977057928 Da4hH
806,094,244 *53ABA52EACDB28F3407A29619D67110EA46391C6 DA4N.
806,094,245 *53A2350127594A1D51E916F6BC211130B9D477A5 D)A4p
806,094,246 *53A960D2C33A6A5207CCABC9EBD3EA17FE36EA1A DA4w"
806,094,247 *53A80CF3C42661DA1805A176E9DBD17B12A613CA D:a5B
806,094,248 *53A330294B52814B996F49C4481D4D409416D283 DA"5d
806,094,249 *53A0A011CFD10ECDC3D3C29712ED34F3BA2DB11F DA$5H
806,094,250 *53AE035322610B9B4B632BDB3A270500742098DF D/A5j
806,094,251 *53ABEE19650E9FFEF7788D07ECC892EB66826381 DA5L/
806,094,252 *53AD4BFF2629C0D1687EF864D728AA1228E419A7 Da5m;
806,094,253 *53A19D68DACBC2E8C4D54D9F06D5832F3C5C8FB2 DA%=6
806,094,254 *53AE2BC086691702177A2E427063CE4654B48879 da630
806,094,255 *53A543251DA4C396818D3C7EBCC8D06042958194 Da#68
806,094,256 *53A43A2DBB58C2B6C69771C21CCA70276B7F9AA2 DA6fi
806,094,257 *53A7D584BB2C1E0D0B483A6CE55F7499A5656B4C DA6SM
806,094,258 *53A6CE1065AE31415A81622999EE85D14752ADA8 dA7$
806,094,259 *53A61AB7BE57503343EAAAB115C252ABA87D1248 Da76M
806,094,260 *53A7073BF12B2350DD2E96D1016479D70A4433B5 DA77F
806,094,261 *53A4BE31DEA85E04772E33706782155CEBDD1357 Da7+a
806,094,262 *53A1239AE04D32EFC50EC5DB4658F6696028FFED DA7g,
806,094,263 *53A5B3BDB0930C6E4FDED04CC3C21A511D2109C3 Da,7j
806,094,264 *53A6D55897844F84988FD8211AA27EBB8D7B3583 Da"7X
806,094,265 *53A9F75D0532CF4E864EC2394B410697ED9064AD DA80o
806,094,266 *53A71EB1D496912172F927138C9DBD7C4558B0A9 Da8GV
806,094,267 *53A57A50C395351BE0B05F2819B0BDD6C112B91D DA(8r
806,094,268 *53AC7C77245A1C9B0E3A45AF933288B8320D7827 DA9;&
806,094,269 *53AA1430827B715999C5833A219D232398C66871 Da91+
806,094,270 *53A83610EC12317E2BC78EEEA4D543F2C1A260F1 DA97t
806,094,271 *53ADD51D158A02E322F136478A362BDD69472EA0 DA_9G
806,094,272 *53A04AC3810B007A2150E647418FEE7F76BE5637 D,a9I
806,094,273 *53AA3349950E01F4881B81D4EEEE22811E0F4691 D#A:A
806,094,274 *53AA3E5371881BD11AA1F0AAED375319FED2E2D9 Da?#a
806,094,275 *53AB9190B05E93D33FF745091AEC541F4E718780 Daa0&
806,094,276 *53A05D7A05D13267A3E417A929224F089D445AE9 D+AA2
806,094,277 *53A79971954EB9D02343EFB07550E9CEB3F275FB DAA8m
806,094,278 *53A02B6F68385615943FDF97778EC1E5C69E8AA9 }D
806,094,279 *53A5026622D00EDE3CDFEEB99F6752E24565E4AD ~d)aaa
806,094,280 *53AA0FA5204D6A2AF7921549A95E213CE430025B [d>aaa
806,094,281 *53AA442AD38B085C7F6F506BC4CD543E8BBF63CD d*^aaa
806,094,282 *53A485581FAB5F60F3C12BA54AE9001E9D611543 Daabased
806,094,283 *53A325C87375E0ABCEBA43E3626C9A0665E66FC3 débat
806,094,284 *53A993397EE442B3C39B103EDEB58335266E87C0 daadlews
806,094,285 *53A4409F3E9C1CB89651A4484ED24F8C75079750 DAADt
806,094,286 *53AFBD3C97CFE07441415C9235A58880B9257B43 D/AAf
806,094,287 *53AC19AF00B9267505548A79C461A679B4062916 D(aAf
806,094,288 *53ADE01DE164B7528B22A8A33EF380A6BAE4A029 Daagdening
806,094,289 *53A17DB21ECEB451AAD95D5D330EA508ACABDAA5 DaAiM
806,094,290 *53A0DCDFCDBD9A2A25FD2F4608738BDFC1EA6A39 daamanka
806,094,291 *53AA9EE72BB63D4B3FF4CB2CF04ABE3A9EA0A1DE daan-ghatidaiskedami
806,094,292 *53AB021001CC48717330011754E8EB7A2245A1F6 daanishing
806,094,293 *53A968A9F8DA5B5217C332661335EA00E04B0F93 Daanpite
806,094,294 *53A7D11708A99C38006D3CEA68129D4921D5FAC5 Daarbinne5
806,094,295 *53AE52178589382087B49713F9E0E9A530835458 Daardreos
806,094,296 *53A50B1F92E382D4CF730DA3580AAA9A45B8157F Daasyaahed
806,094,297 *53A0E49CEF1C89FFCAFD8F4D8731B67392F5278D DaA%T
806,094,298 *53A6C9D5C05C7E957D6E1144F7F0BDCE0BC3A892 daavidin fuzz / paratiisin sahakielet
806,094,299 *53AC9D2206D8338756EEFCFDE2FB4F534BA1855C DA??B
806,094,300 *53A3CF3E8DB749172A19D00A675362EC19D9F6CB D="Ab
806,094,301 *53AF9A47224679C94A09956CD470D88B7C55AC5A Da:_b
806,094,302 *53AA19BB137FDE2A03DC834070608B20171ACEA5 Dab("
806,094,303 *53A7A76FDC09F99A7F6145EFE6F81E94C3B943B6 DAB4#
806,094,304 *53ABF69B8FF850FAF36B29DA3A122BFB98F6E509 dabazoheJ
806,094,305 *53A5C00729C5025E589C91D2D84E09CB36BE16B5 DABBLERS4
806,094,306 *53AF6AC07C7DDBCEB2040E6A9279A7052550EB2B Dabboos0
806,094,307 *53AE3725F53D58FF2E81A2952CD41D229F3E134C Dabcvai4
806,094,308 *53AD80C1069DB3C46E84685850BAB5EE59F200CF DABD;
806,094,309 *53A56D220DA549B2C87DE5A9F15E338EB4A6E53F Da/bD
806,094,310 *53A9E3F695C877B0D9BD112801076FBE5624BF12 D'ABDALLA
806,094,311 *53A58CE308F14DF720DBC84954092D75BF184308 D_abE
806,094,312 *53A1C26E99523EDC61F6B9EB5764AE795911CA6A Dąbecki
806,094,313 *53AC75AE9ACA599CE03D716849547683C621C44C DabFl
806,094,314 *53ADD29FA764675E0D656972BCB1B17DB3889B13 DabGl
806,094,315 *53AB15FC17E8554D29D006395B9E766CFD47D4DD dabīga
806,094,316 *53AC66C05507378BC7841A7D7C10A517C37F3555 dabihed
806,094,317 *53AF26404A62756E7BC9AF32AFEE45F3EE2726AA dabner78
806,094,318 *53A6314DAD9962CDFDFB8C63F7CB21F5CD2C1A4E DaB"O
806,094,319 *53A493BD142A3E55D1C11936CA8B82B2BB5FA33C Dabringshaus
806,094,320 *53A3297C062A09ED18A4180D7BA4D9C65C10B511 DABuD
806,094,321 *53ABD3940621AED46D36AFB5EE2314AB47A928F3 DABVu
806,094,322 *53A79EF6B461E9B1BF69E96B40F343223F1FBA83 DAbYZ
806,094,323 *53A7085FB89B4A223C6A3F665E856169CE83C54E D-=Ac
806,094,324 *53ABCE4D8C859A264296DF547B3094F8A8532C7F Da!c3
806,094,325 *53A9AE1EAA349B8F5B3CE5BC89E7196D4D749D40 dac960.ko
806,094,326 *53AC241DF93D1E05F6F4664A48957A2B6A1567E4 DacC6
806,094,327 *53A5675F54CADF7F32614FD22E58CB85C5A35599 Dacernb7
806,094,328 *53A7F55631A126E4A65B9276ECDDFDAB4B9A01B4 Da Changes
806,094,329 *53ACF346C473DFD04B1731AF49087B72D386E2CB dachlandlastig“
806,094,330 *53A97E2EAE775B72C8303AB30E253CCD7DCCE25E [email protected]
806,094,331 *53A435167BFF559654E7052065D4EB1CC9D2079A Dacju
806,094,332 *53A3BD9F8EA2C7F9BDED048202875E82B31B50B0 dačom
806,094,333 *53A7A9B7ACB258CC566E3304FFA12AE62F9B8000 Dacombe3
806,094,334 *53ADE2E3609330030FF115F277B106B8CCA5A0CC DACOSAURUS
806,094,335 *53ADABB6791238D5B91353B0160A5794553CC45F Dacql
806,094,336 *53AFCD362A06EDE1E3974641EBBAC462A5C17C7C [email protected]
806,094,337 *53A0DD551CE9DD3E111656D6AA60A820F83258A6 Dacryobl5
806,094,338 *53A936CDD7491ECBD4E2B93DD50B3CEE7DA44B47 dacryocy$+o+omy
806,094,339 *53AD6FCFF63360C333C567470E08F443A0EA02CA dactylion6
806,094,340 *53A286A035D4677B2992FBE815C03FB9F6FDCB58 dactylographiquE
806,094,341 *53A4FD7C57565B3071CD7A3BBDFF674AA74BD31C dactyls9
806,094,342 *53A70AD282DEF5A2E965036E47B610D6991C4F4E D_A_C_Y8
806,094,343 *53A27BE8BA75D16A786BA99290A66B2379306147 DAD174WOVE774
806,094,344 *53A5670F667E8271B290B53274827C7BBCD8ACA3 Dödöl3
806,094,345 *53ADBB51BD9296615F0AD082A6EC497D51BA5DA6 DADAMI
806,094,346 *53A546B879ABEF2E1B3FE26CF8DBC954B94F5E7C dadaproductions
806,094,347 *53A8724F2156F5F92C6E0AECF37A6C0BE3940A71 Dadasović
806,094,348 *53A93FB68D385E1D704739238DBD0E19F0A1933F Dadcilef7
806,094,349 *53A2B459172B33F5B21084B434FA6AA2A7833112 Daddygoforit
806,094,350 *53A74C9CF9CFA30204009801754E9C03DED1BEA2 daddyjalaska
806,094,351 *53A9B314D08A6956B4AA724A5CE1ECFAB80CA756 DADDYSPANIK
806,094,352 *53AB10D90EA28A09715AFB650AFD5001E2E41EBA DaddyTrane&CousinWayne
806,094,353 *53A33DCA3721FC6481101D8BD1E8383A117E6004 Daddy» —
806,094,354 *53AD8D3287E5525DCF8453FF73977EA7BC843D0A DADEFD
806,094,355 *53A0EFF94DB44041548BBD00822FB0C9667A626F Dadelkoek6
806,094,356 *53A6B80328DD4B550258ED9C1D12E79C7CA0FA3B dadelpalme
806,094,357 *53A56B5D7F36CB8A4F79AB2882BD923B6C59EEDB daderesses
806,094,358 *53AA93177F256D6C2FF5A4856B6D9C9D54D062AE Dad(g
806,094,359 *53A961E2DAEFBB7EC92F7F56CED0BB343618A780 DADHIICHO
806,094,360 *53A709FFBA813A79432FB0704072CA63E8065387 Da)dj
806,094,361 *53A793667626F871615F8CC2623C38DD4E81DF09 DADMITS
806,094,362 *53A93D0DFEA815D4EFEC3D718B30DE6DA7906E0A dadnafim
806,094,363 *53A64D8E21A3CB61A698ABEC42AF34BB4E836BA1 DaDqQ
806,094,364 *53AB52433A21A307D6A8CD3EBDF2088890DF5995 dadridge1
806,094,365 *53A00878DC0CE0CD1406F2C98676530087BE69EE DADTA
806,094,366 *53A2F5A900FDC619040791C337AECF833C673FFF Da?dv
806,094,367 *53A3D1F76076A95512B01ED5F00AB4C8B7D5CB2C [email protected]
806,094,368 *53A3A96AE08E29B91A71BFA5D9A05C37DE96D210 dady_cool_22
806,094,369 *53A21BF8A6C76CF72286AB4735AB2C4493031DB1 [email protected]#
806,094,370 *53AD3C2AA65264CDAB22B2CBA3F295D246CBAFE8 dadzie1234
806,094,371 *53A56A08AC2B632056CFCA0A80D6EA1B6289E9E9 D%AE
806,094,372 *53A4CB3661A640BFD76BDC47E64DC10E8022F07D D,a)E
806,094,373 *53A93C98316C33F71B41BB09DCBC74DD45048C08 D?-aE
806,094,374 *53ABCC9FA91EA0FCEF7B02D1CFABE46859A37E0A D&a/E
806,094,375 *53A95E7D6546091AE3E5EC73C2D01272DF9AF66F dae'
806,094,376 *53A882391D6150607589645387013D263C20AF30 dae11n1n9
806,094,377 *53AFF5E515377DE2C7AF759D2A288468B0044FD1 DaE2P
806,094,378 *53A5D365B5895AA73F6B84FE7BC4689F56DA56AB DAedo
806,094,379 *53AB4D4E104B8E82FFE7FD968E30349D97C85DFB DaEFY
806,094,380 *53AA335C9258763E03893FE89BD227D54EDCD297 Daeg_
806,094,381 *53A3CB0D361BB0DA2238D7CB8E4872AADCD99846 Daeheldo6
806,094,382 *53A0648F7EE07D183BF56BE78360A1E536016A3C DAEHTNILF
806,094,383 *53A41C66CF8E3F0D4991DB5536F677D37432A9A5 DAeKZ
806,094,384 *53A24BE067A1C29294DF79272D0364CEA280AB85 Daelpret
806,094,385 *53A544256BC77E4E80AC3EEC9633D3CAE01AA073 D$AEm
806,094,386 *53A2BCC34ACBD466A1186149327DC4D7AC93F6FC daemion5
806,094,387 *53AD509868F7AC48DD96AD8124EA3B2C3231FD13 daenkans0
806,094,388 *53A4BABC2E046FF7F7EBF87E7D888CD9FBE49E7F Daerick4
806,094,389 *53AAC3405F045B9C15EEAB12BA02233F910D068C daerine160and
806,094,390 *53A094FE94E54CD7C8B7B1A1A67B416CFFEEA8E5 da ETAITINI [email protected] GROB-3PM eciton/ :elpmaxE -=07
806,094,391 *53A14E942CEC06502A0019BD673F9FA57C8F57BA Daetoyzwv5
806,094,392 *53AEF9DCF51B7F84138D93D7434C097C417D857D Daetspaeh7
806,094,393 *53A899C1540D9E8CDA59938DAAE16B6BF14CB114 Daetypsk2
806,094,394 *53A6A7C7CF3424932A82C6F48BA587136CA4D065 DaEvA
806,094,395 *53A7A8302C5C51E31D713C0F9AB3B7BE56672574 DAEVw
806,094,396 *53A0C352F87CB1538A1C72F1178ACE9D4DCF8B01 DAE%w
806,094,397 *53A716280431F14444E394B68363C0525FD85550 DaewooAvto
806,094,398 *53A81F11A8241A11ECA4EFA5A34D6BD0AB8B2CF5 DAEXe
806,094,399 *53AF4F9141023D0E62E2A390C9CB2EEFCE552D2B DAEZc
806,094,400 *53AF2C6FE785983FDB68540A06012A29E8B81D4D D)Af%
806,094,401 *53A314615B22AC3160A872974444E7111B8F7090 DaF9V
806,094,402 *53AA2ECA76E98BE2AC6AB574F23384D984ECA6D0 Dafakaring
806,094,403 *53A32A572692477DA780BAAE8073B917A63EA99D Daf$C
806,094,404 *53AE1A4C28B23D3B2641C47FF9D696CEDF08EA79 DA=fE
806,094,405 *53A77C9167E51D66FFDD7C86A84E50D5D4EA2477 daffron9
806,094,406 *53A2A5EDBCA23F3C4D00F0BD4AAEFAE039BCDDB6 dafnien6
806,094,407 *53A7F90F87D5B3D02C2343E80D4632BE872D6A5E D A FORMS&PRINTING
806,094,408 *53A5E933E42329822BFDAFDDE0981957424CF8B8 DAFPX
806,094,409 *53A6D960E4CDDF328E6F8CA21C36E868386AB2B4 DAFt
806,094,410 *53AD825E1D419C280A62EF59BB6C021B10332F78 DAFTN
806,094,411 *53A4C662D2E6B51DD8D33D0F81375303412A39A6 Daftness7
806,094,412 *53AE2F3C394A42FEFFDC77A033A89CA164B58EB2 DafW=
806,094,413 *53A5BD51D00A0F77A63CBE3A526003F441E495A6 Da%fY
806,094,414 *53A4799CEFF9BA4CAA95DEE927FD038C986095E5 Daf#Z
806,094,415 *53AB859274B18DA4B12530A5C61BD0DD941A620B DaG=/
806,094,416 *53ACB749DD52FDC43A3F1B08AC93ED264E04E77E DaG!?
806,094,417 *53A718A2BD191438043B4070A5E152D1EBE0385D DAG#8
806,094,418 *53ABC6C66C90ECEED54DE7AF05B0A3474D9F95E9 Dagadu
806,094,419 *53A4B54E74EA99E8A2488B3B586EF19CAB4D19BE dagakarl
806,094,420 *53A41298885CBE0AB613B9124360453EFE435CD5 dagassa4
806,094,421 *53ABA521B39223C88DB17BA3359FFDD891807088 DAGaW
806,094,422 *53AA7F98B156B238D57E4A99FA9789A4070FDCF3 DAGBr
806,094,423 *53A1A503841628ECB677A588B186724A4032A4B7 DaGE(
806,094,424 *53A20CAB431A7A94D2AEF19606EA81FE37126C63 dagfrode5
806,094,425 *53A3197ED6B11AD341E80031220D0FA784B56095 dagginess
806,094,426 *53A5D7B0321DF4D5348AE7132D23CE3C4B93AA7D Dag-h
806,094,427 *53A7E6B8C0357CCCAB28BDE4BE10F13D46AD4AC5 dagher00
806,094,428 *53A04C389F79D8EE4895A2A3E083600322ABB94E DAGHESH FORTE
806,094,429 *53A41C847F38A1D37D7DB1770EB35CFE45766869 Daghilev
806,094,430 *53A22273E8A5AAF21F6CD648527C600DC077E2E3 DAGI29
806,094,431 *53ACDA077BDB8C6B6F0CDD1BB752DC99632BF56E dağlıyam
806,094,432 *53AAECEE6DE95C6944C690835B3F2129EB8E66FA Dagnall6
806,094,433 *53AF9FD8985296C8094BEC1DD83CC364453725E9 [email protected]
806,094,434 *53A9AEEA53568EE2E3289BC5A793DF3367B04AE2 Dagnylov3
806,094,435 *53ADB47C7499FF918E988CB24135ACAB2C08F58B Dagnyoko
806,094,436 *53AC0CDBCD8D002A343C104E4AE9ED44575EBD22 DAG%O
806,094,437 *53ABAEABDA5170C0E2225594CF17296550E7191A Dagoders8
806,094,438 *53A63A2F179F105063FAB6AD3D883360B9B878B2 DAGOS23
806,094,439 *53A6CF278365D600D0478D893703AE3DF2C6386F dagpasient
806,094,440 *53AF902B72329C85B6113CCE9EE23D81B73E1B3E D$Agq
806,094,441 *53AC4D5828B1F15B6105041798D2EF77F7626DE4 dagronze:ratman
806,094,442 *53AA7AE037DC56C9956A4ED6F0C6C4EA90A89E8C Dagsaldoed
806,094,443 *53ACC082A5C5168CA57EDDD9C24DC7D97C335F08 DaGuK
806,094,444 *53A67874F304226F7B62DF5A1F19D97064322FD2 dagulfi
806,094,445 *53AD3967AFC4B48E8684E13F83F50871DA324CEC dagupan!
806,094,446 *53A274815CAB206E2EEBBEB6E1E2D8FF1A43604C dagverwijderlijst
806,094,447 *53A450FFA8ADF93830FBB7813FD3A09639C5EB67 DAg-w
806,094,448 *53AA217670E55698A6FAD5D14AD9F5350C34A0BC DAgw"
806,094,449 *53AADE663E4CDEFB59CB0FF768B91E175979F64A DAGX2
806,094,450 *53A58D34123A03AE3CAE0B9DC81DF08E3C42E065 DAH
806,094,451 *53A50DDA0CBE8A0917BA1B16F8336D408B8F933D DAh:(
806,094,452 *53A3567329735648BE2E598C8E55E6144B55D012 DAh(
806,094,453 *53AA84C42A88BD3F4B05BA976E8203D856217018 Da_;H
806,094,454 *53A3374701859C74B5DE5A08F05CCCDC65EAD72C Da+_H
806,094,455 *53A709BEC5C74CD2E5F05D1DFA342F71000B6E11 DaH.-
806,094,456 *53A635DF9EBEDB52BBB961A2A96DAB825D73B616 DAh2U
806,094,457 *53ABC26B54DD4FE2491322B3A04C123BF2EB1DB5 Da?h9
806,094,458 *53A8EB9797CB40CFF24626077CE2C8EEBA904D6D da
806,094,459 *53A15A231E9107AB898C437542E71036000537DF DAHARJA
806,094,460 *53AFCAAAD4495AB317AAAAA9030AD2D4226DD665 dahataa1
806,094,461 *53A5B1DF4665CEA640F563A5524C05DBFB67D515 D(aHb
806,094,462 *53A35879ED4510F1EBC646341A66D998B8AEB615 dahergefegt
806,094,463 *53AEEBF37960A618CD03A37DF199F9D766E185C1 dahersauste
806,094,464 *53ABA985182C204F4E78C3376448555E566627F3 DaHf
806,094,465 *53A15DB93743C56C749D74A2CFC61D41996FCFA2 D(AhG
806,094,466 *53A8D2E8B1426CE04D23E0EFF4E468874B57961B da hindadupfa bene
806,094,467 *53AE3D88E22E6C0ECFAF0EFDC33A2A10D127C0DE Dahingeschwundenen
806,094,468 *53A2B28F400D82E92CF28C892EE1EB3A47E11B37 DAHL84
806,094,469 *53A4FA33D9EAA2017FD2D0F03E80AA212AB69F13 dahlbeck3
806,094,470 *53A27BE7B3540591146213532DC7E3BA8685DFA0 D.AhN
806,094,471 *53AA873366540DF7FE917676F8C3446687DB7F85 DAhn
806,094,472 *53A7EF47B9819CDEA9BCF808867954FAFDF865C2 DAhNW
806,094,473 *53ACF7F234D6B33342E13CCA89B63DD344CAC224 DAHONGZHAI
806,094,474 *53A3768CF71CA99FD4CAC97947FF35E7D163D4F6 Dahsd
806,094,475 *53A564C05856E09EA9BBBCA78C0ABC339860F48F DAI120
806,094,476 *53AEB1F37032FDEE8CD99D613C24731A35041371 [email protected]
806,094,477 *53A44FFABC52DDA2FF44A8070065AB07F1A0B878 daianabianca
806,094,478 *53A6FC7CBF08242052A208BF4E597FF01F25EB21 [email protected]
806,094,479 *53AF1D49F2BA9F5025F0E6201A289E192E00EFCB [email protected]
806,094,480 *53A9DEACE0E35172D41955CA35E40649F4C6C876 [email protected]
806,094,481 *53AA26FD401DB5D74696780A254842C49D8455DB [email protected]
806,094,482 *53A71CBBEA4465C90EC4165F91CBAB2AB8E8C2EF DA%iB
806,094,483 *53A1610DD7B0A1BC64E8068DDB6A0C3A191E1549 DaIC
806,094,484 *53A49468F297B76058D152669C3D3C65D570040B [email protected]
806,094,485 *53AAD11B08ACC6CE62E12BD035954FCB2FAED6DB [email protected]
806,094,486 *53A9500DD17F7CC0858BA2C65F3EB0937FBCAC21 [email protected]
806,094,487 *53A1E1C54853DF6033681713D902B2948BA32D1C [email protected]
806,094,488 *53ADDFBACE1C69FB6CB99666195D327A821C3B14 daidone8
806,094,489 *53AF08C99DAE441B159A42EB55ABB6C5CDFC6E86 DAiE2
806,094,490 *53A1C7784422AB79119CDFACF9666E84744F38F4 [email protected]
806,094,491 *53A1B5F72E3120C0FD612D2D68B3CECBFAE47A47 [email protected]
806,094,492 *53A8676E8E2780B7DE136077D94C410002DA5AE8 DAIGNA?
806,094,493 *53A7F33FCE7DD66D306CB10F9059F747B985D9D2 [email protected]
806,094,494 *53ACBC1153CC783C45646CB636A89D17BB530AC5 D'AIGRIGNY
806,094,495 *53A321B1B606F14BA302105E7E5981951B2BCEEE daigujing
806,094,496 *53A8E0A324297CB244019893BF2EFA1202C73112 [email protected]
806,094,497 *53A3AADFDB72FCFB3405F4CDBFFF2939A36E2AF6 daihv
806,094,498 *53A019F400EDA747E4AE1063A60C1A7A3121C36B [email protected]
806,094,499 *53A419F990559D88F3AEDA4BBAF48B9F3D544F9D [email protected]
806,094,500 *53ACCD85706107E08AAFE94763D9A72A3112FAD1 [email protected]
806,094,501 *53A361A82DE1A89F4F943E1AC64241171A4D1E56 DaiK9
806,094,502 *53A0CD80C3C8F869730A9E842CC69892048BB852 daikered6
806,094,503 *53A32CFE8DFFEBAD4E5079DA0CEEBBB35A6FA4B5 [email protected]
806,094,504 *53A5BE72F16A5770ED4EF98999A9E361C2206794 Daily?
806,094,505 *53A976E3276CDEFC5DC7667D85B44F6AA1D82F22 DAILY-DRIVERS
806,094,506 *53A2E7C4C33D94CF7F6B536BF45FE2BD201ECF8F Dailymail4
806,094,507 *53A6ADBAD31093D70C98FAD0358FA7A41C3121CB dailynewscenter
806,094,508 *53AE1144C3190F416870936DCA724743C405C1B2 daimachang
806,094,509 *53ADC3B7E1B76B82F7E8DF418CCE8F0C6F8A45AB dain737h
806,094,510 *53A08CFC97E7645F87DBDB5FFD7DA3736702379E [email protected]
806,094,511 *53AB13989364ED77DB1529E3FA8FB171A37CF2BD DAINEASHLEY
806,094,512 *53A77A7F456E4431A15896E1C2384A084C670E5C dainekelly
806,094,513 *53A8376B8BA8A37891432DAD30CC0912F0433329 DAI'NI
806,094,514 *53AE1BAE5AE55BDBAEF5B055A992BF22EDB4B225 DaInm
806,094,515 *53AD787B982F0C68B4D2D7A501618D194780ED82 [email protected]
806,094,516 *53A754B42339EA4530CA9BF6740EE16C39E75257 daipaihei
806,094,517 *53AFF159E5EA33425DF7ECFCC974FACF6F0F8385 [email protected]
806,094,518 *53A3A9FC4F47352E8C3495C72DE85941B97AC176 [email protected]
806,094,519 *53AB80D954EC08E8D81ED490D4E19BDD85E2ADE9 DaiQ8
806,094,520 *53A34DE740105319B042518417C51646239FD099 Daiquandy8
806,094,521 *53AF91E54FE1F54B9F289F25A79F8DD7B340A995 [email protected]
806,094,522 *53A89AB9705B110C5DBBAF3AE726FD77D6B6AFEB [email protected]
806,094,523 *53A69D99A6EF8C073EC42681025309E51D0CD2BF [email protected]
806,094,524 *53A260BEC1B8E5D82AFDCD4508F1B856A97FC66C [email protected]
806,094,525 *53AA02120BED61F00A516DD933C967B05FA1DAB5 [email protected]
806,094,526 *53A471AF2DD765AC014413C9FF8861BD38F62023 DAISHIKI?
806,094,527 *53AFA8753268DD8249CACCAE887E6B79861D4CFC DAISHINOMITERA
806,094,528 *53AD9CA9883C46FA037490FFCFD166F42AF3E74E [email protected]
806,094,529 *53AA974B0AE66C4F5F5F85129D007C5D20BBF71E [email protected]
806,094,530 *53A85A65681B8DA1C95A8D582BF1C580E900C331 Daisyallen
806,094,531 *53AEFC41BE6F88D45F07320ECA36237AD6741DE4 daisyass5
806,094,532 *53A2ACFCED82D5CC639869164EEE2B395E3F9AD9 [email protected]
806,094,533 *53A1530C190C72F1A6EF413130BE210B01D83EC1 Daisyduke0
806,094,534 *53A683877CF2751657933E299A56E8A9F127A29B DAISYKNIGHTS
806,094,535 *53A0514B9DCD70C6498E2330795BE09DC08736FA Daisyqwert
806,094,536 *53A4041069BC261701DB4A3223A428A58695A524 daisysaldana
806,094,537 *53AA52875B333FA8C4C7A743DA8A298F67AD0750 D_ait
806,094,538 *53A7177FAFB21F4E2B905493DC7C0197B9091C13 [email protected]
806,094,539 *53A4885E3D185D38C9F08D0D059D4E33F616ADF8 [email protected]
806,094,540 *53A008479BDC5BA1094C1D98F1763C79A33E5F82 [email protected]
806,094,541 *53A4EE683A7A9D5D6DD5F826614C3751D5CBE713 D?aiU
806,094,542 *53A82989791AC915F9D934A215B4DC693144E2CF DAiXa
806,094,543 *53A86CAB361D93FAE5A439E6C81E81BA0BCBA7FF daixianbao
806,094,544 *53AC8B354EEA2CC29288C8EEB3713D583B3032B7 DAj(1
806,094,545 *53A2C24D8F6EED20C91BF6FE6544DE03E04E6694 Da-jC
806,094,546 *53AD57643A391105F251BD9048AAA1D11A1ABAC7 Da jeg sa' farvel (Tristesse)
806,094,547 *53A85F8522F7F882E3C52240C0DD57B412F1EEA4 DA$jF
806,094,548 *53ADC4A4428CE4428E80961BE2B9BE47A97BA9EA DAj!j
806,094,549 *53ACA7FE4205DD7D82F73CEA154AB21137A77846 dajpe
806,094,550 *53A075F1578910F71359C54C38CFFE69E479C67D D;AjT
806,094,551 *53A7B12ACAE4E919CF0CBBBB626596125B944065 Da;jW
806,094,552 *53AD38E72C54FCCA675E0CF2E1732E599237EE4B [email protected]
806,094,553 *53A0FD018327041618E3B1438F68E156C9E1101E D_=AK
806,094,554 *53AEAF80F084171E5F09E4CF68309DB2C1BBF92F D+a
806,094,555 *53A95D4DE135CCA00F46329E999BE7C4C1A35177 dakak666
806,094,556 *53AE9852FBBDE2C4A91CCEAB485CB19DAE270A7E dakendt3
806,094,557 *53ABEB411E76DF298B63A3790DF3D9C95D6A929A dākhiliyyah
806,094,558 *53AFA95F101F5F6A353EDDF41D67AF2C6E5A40E3 Dakić
806,094,559 *53AD8EB051963A126A93F45949AD27C3A204A597 [email protected]
806,094,560 *53A89C5DBE548647AFEBF16E183CAA83AD0B4C44 dakrame1234
806,094,561 *53A3377EDDC686A574A4C73AA911D779270C9AF0 Dakryzoyn8
806,094,562 *53AB6397E88D0A713573FA3FC0C83106FC271E72 DA"ks
806,094,563 *53A9481E018CE8F552FF493B5BE551039D75EDAA d/A/ks_'kR/I/st/i/
806,094,564 *53AC4019C002C4FEA32444166B9B40D1797769D1 daktinomycín
806,094,565 *53AA934B3C8B163F2B4E6D7AB706D0D2852FF6FE DakTv
806,094,566 *53AC20B36A720E98B21C9AAC41838C6A2A3C9E27 Dakusan9
806,094,567 *53A785E94D1D151A3EB6006BEFC6C79DB96BFF42 DA/%L
806,094,568 *53A31AE6C34080591420722B946660A4E8446AE1 D_A+l
806,094,569 *53A0C2017ACCAAE3150A36AA78AD745D8F0FB6CD D":al
806,094,570 *53A4649FA11F09A9D59BB2E090BE7E4BD3597332 Da+l=
806,094,571 *53ADA3E73BA84A93131B2662CC39527F062132BF Da
806,094,572 *53A36D8CC97D0F483DAAEEEF3FA3FDEA1460F269 DAl0:
806,094,573 *53ABAD25B12A83B3CA33111998C4A0D65F2BCB0C DAL2v
806,094,574 *53A42A6279B022F410EB4FEAE90105BF65566C71 DAL7575
806,094,575 *53A89DF747B7ECE4EC9C6B91B4F1D6AEDA1B4619 DAlA)
806,094,576 *53AEF5115999810D051D69A47AE2ECA1782962A1 Daladier1
806,094,577 *53ADBEF61F7C057C04A6FD437C7B660F002A182E daladla
806,094,578 *53AA414D46BC9938F75CC79238108FF66299441C Dalaigh'sPadraigO'Keefe(polka)
806,094,579 *53AA1747DF58E9A7302DD603B3122E37E09A9734 Dalandą
806,094,580 *53A6B42E0A7FB5863D2206A597736522F4C66965 dáláuzit
806,094,581 *53A069FAEFEEC6DB5000CDAA3AC25E9B4456519C DaLC!
806,094,582 *53A8C749D1816FE84F1909E1FDC04C105A235B60 Dalcantons
806,094,583 *53AADE1C88174DE764E05E555D1F4A47D6112BE2 dalcollect
806,094,584 *53A2DF9C14DCA61634B69818B21C246B6D94365B DALDENrecap
806,094,585 *53A865DC0F6BE7BE86AA5B05AA799108FE46A169 DALE133
806,094,586 *53A38F5101D21952491F498A544E060A467480F1 dale.acheampong
806,094,587 *53A871D3EA1996619FC9AD77567A682A29A66B93 dale.badget
806,094,588 *53A5EB6CCB6A2BA5B7D0E89242E20CC43FEEF5BB dale.brougher
806,094,589 *53ACB3654CD7F4F1124CA3C3EB88A24EDEB2AD51 dale.buglione
806,094,590 *53A0B6F956A16C46348473A93ACA3F30D8A7E388 dalecarlia_reservoir
806,094,591 *53AC5F4210FD858B5FBE82504BE31165F7EB77AF dale.carril
806,094,592 *53A4466AAF87323D23AF4EE230B820572224A0FB dale.casini
806,094,593 *53A395190E265FADE6730C96FF364B08DFFEB593 dale.coughlan
806,094,594 *53AD3DDC426052066F00C0769DBF7261B650A61B dale.derck
806,094,595 *53A3E2246FA2BBF0B4B63A1F8D50B68E190B4F07 daledes3
806,094,596 *53AB7D2E1A0485DAA8F89C1525311EDD7AC6DC73 dale.drillock
806,094,597 *53A706D79F787C286E666755D27FF8D4C76E6934 DALEDUTCHESS
806,094,598 *53A74F7A692C1FBFE1D4B543446045AC6E9C7F5A dale.elcock
806,094,599 *53AD58AD3EAD54C9D4B3235EFD29470B9AEF1821 dale.farquer
806,094,600 *53A7D306C03AC85875EBEF61890D8454B9F1F350 dale.galli
806,094,601 *53A088B2D427AF50FBC00B4205B45F2800BCE556 dale.guidroz
806,094,602 *53A15F502C74623148F4EBA974CA54D3A02A3FA0 dale.huckabaa
806,094,603 *53AD3D12A4DFDF579FE51452139694384045A031 dalehughey
806,094,604 *53A3CE5A78AADDBC66C9D49CFEE97CF1EEEA0404 dale.jaroscak
806,094,605 *53A7A835CE9B6DC8CB3732573D73EEB84C155D94 dalekiming
806,094,606 *53A1380D4E06572C84ACEFBAD39FCEA9FC50C8FD dale.lascody
806,094,607 *53A10FEE103CB4F9E80E200F63F95DDB1F0E90D1 dale.leask
806,094,608 *53A1A09635B9C5C2D4A4E6067132B84E1AA1E967 dale.lescano
806,094,609 *53A6BB65930BDD3638A24D5EDB9725F1BAACE8ED dale.liao
806,094,610 *53ACC001CF362C80F15B2AA6C8D6C52A833671D3 dale.liggins
806,094,611 *53AA364B6F33D33D3A72421FBDA49982469D0F77 [email protected]
806,094,612 *53A54AA14DFDD3D6B7D0D5370464D59F213BC268 dale.matson
806,094,613 *53ABEA8DC4DF831E3F74F3272954C37F24D369A4 d’Alemaya
806,094,614 *53A5BA8B411F87EB1B572E0E2519A9A65FE9D24E dale.mcclendon
806,094,615 *53AE71DB0A84F730A1359475F23B49E679E988BF dale.nawda
806,094,616 *53AA6DEBA6668E6F457A44E3F8B410B627C538DE dale.nunziata
806,094,617 *53A268EF159BF181627612E3100DC1E64B72EC99 dale.orwig
806,094,618 *53A8BE9509272353DFD3E8A6CF37DA4250BD1214 dale.palmerin
806,094,619 *53A60A286AED3A95E4C91DC68020072916E0BCEE [email protected]
806,094,620 *53A89B1D8B004FC147D5E832284297CFE4F07A89 dale.rochelle
806,094,621 *53A48C420701E1EAAFB50787BE6075EB6DED0161 dale.salsgiver
806,094,622 *53A6C1B1D5324355B66F3228A881F6B09A649366 Dalester
806,094,623 *53ACFF2CCD20A829DA1E803E519353A01BDEFBB1 dale.stice
806,094,624 *53A3795E823F8EA7203BA2A9046BE2A5A1235CC3 dalevickery
806,094,625 *53A755C642A331D273B9FC96037AF264AAD4FA5E dale.warnasch
806,094,626 *53A72B5F5AD9387A0A0F29685F156FEE405C4EAE Daley-Clarke
806,094,627 *53AA24A7A7F7C1658DF747B4F5E91753ADFD52E0 Dalfrevo0
806,094,628 *53A02FC49F5C9505D1243724974856D1CA74C95F dalhems
806,094,629 *53A89AFD9E21D33BE008F826632BD501FD0AB6AC Dalia237
806,094,630 *53A082C0EF547124D015DB75C01BB096A1C76611 dalia gregory
806,094,631 *53A7F44E5EB7538E9770033C9F4F0D93E919BD26 daliana maldonado
806,094,632 *53A73A7C958C061A4651465C5D82E708ADBC9F3E [email protected]
806,094,633 *53A7AEEF5DD82D806819147549B35BBB41FA3F0F daliegst4
806,094,634 *53A91E65AFA02F97144D4D77BAA9BF0C4ACDC57E dalila pinto
806,094,635 *53AAA2E39BA04A9FC742CDE476F619F3D778D25F Dalinesing
806,094,636 *53AD87872C4A656BCADD57A5B0FC1027B76D860A daljeet chahal
806,094,637 *53AC0D5A3AC1BCAC6CA24B4DC5D979F55EA4E222 daljoon6
806,094,638 *53A4A8CB87F7E6B69AEA211DD6858C7DBD1B1C58 Dallardsville8
806,094,639 *53A4E4D5BA7793F8679B8BC67519417624B82B28 Dallasabc1
806,094,640 *53AC0BF7FEB1E3EAB4E01F595952D9BFB3C56EA5 dallas.arenales
806,094,641 *53ABC56551DBC998A075869EC8D4D6DA47690C77 dallas.borowiak
806,094,642 *53A0E39422A2D953EA5367C6A8542DF1CB99DA22 dallas.brookshire
806,094,643 *53A657A901DD854CB7243B42EF6DE1A56E405AE8 dallas.buckelew
806,094,644 *53A8E5A7B364DA952C5C8F25967AA107099E5839 dallas.christie
806,094,645 *53AFC0D0E9DCF330644833C61635335C248257F1 dallas.denmon
806,094,646 *53A66CCEC844BBD5803A6F6037C5D59B0B1D3411 dallas.donalson
806,094,647 *53A45E9D491FD589BAFE55F12712397401EDD5A7 dallas.draughn
806,094,648 *53A500CE8A23FCF23A383F09A67A593936D0F0BC dallas.fakhouri
806,094,649 *53A788203E6E22D453D095A3ECDE2BA1F1FBAEEF dallas.felux
806,094,650 *53AEFDE4C05669D6A49C981762F3CB39EFCA1885 dallas.fredline
806,094,651 *53A9BD6A33279FE7931814243B742BD349A4C3E8 dallas.gottesman
806,094,652 *53A5DFE5783F6604382EC9CA11AEC66457572A93 dallas.hartenstein
806,094,653 *53AD120ABC83BC6C88F311F0F5BBFF50939B4150 dallas.head
806,094,654 *53ABB6D7BE6AE390C1F05E8194255479396F8471 dallas.huizenga
806,094,655 *53AD7CDF2C60C03CF6B617A7F2A1B23DFDE93F78 dallas.lily
806,094,656 *53AFD5BAA0179C6801872620B1DDCA4F88CF73B5 dallasmasters
806,094,657 *53AD81F39AC2004B5E1D2474C6E35E4D74BD1878 dallas.mcallen
806,094,658 *53AAE398F19F52C4CAA8667234D0BBB92A63D8EC dallas.mcghaney
806,094,659 *53A198FE29A47F685AA64690683A74D37D640180 dallas.michalek
806,094,660 *53AD302A55BCF8328910AD4FCD590F1ADF37EAE3 dallas.nicolet
806,094,661 *53A4D793EED70A2BF7B9DD3545D210FE17362F05 dallas.noakes
806,094,662 *53A83759775D8C2312BB148B3406E2E7B9FE6AD0 dallas.quilimaco
806,094,663 *53A3680357CCA7367257AC023DA324CF82F79BEA dallas.schnitker
806,094,664 *53AC27813BD162791C77B98C628CCE26960BEF49 dallas.schronce
806,094,665 *53ACC91FD56EED758ED71A4B1DB712A059E76CD2 dallas.sidney
806,094,666 *53AD8962D1DA46F1686BF76CEA6B6DB2C47FCCAC dallassingleton
806,094,667 *53AC3E790EE41297FC62EDC55A5BA5FD4DA5E3BC dallas.tunstall
806,094,668 *53A5FECC57F6F81C9A6542FBC3C36BB175A7EC58 dallas.wierzba
806,094,669 *53A08EDD8CC909941312A1206E43BDD3C32F19C6 dallas.wilborn
806,094,670 *53A9829810E80B2C8ABEC7AAC1AE1B3FC5629E91 dallaverg
806,094,671 *53A2260A2E6F1B610C7A88C7B4A941487131FB24 Dallieth2
806,094,672 *53AF86C92E3F2A164FFA679E419EA6AED47B5069 Dallogo
806,094,673 *53A069014460C4F0CB208C7D653CB8EB3F97C7AE dallrat6
806,094,674 *53A2BA4DADBCF69E3373F6B1D7F1C7D580591412 DALMATII
806,094,675 *53A0C93E6B19BEF20AC8C4C2856ACC392F684FE8 DALMc
806,094,676 *53A492D5478A958CF67D8170C9609568A591A27A DAlnB
806,094,677 *53A2FFEBF44185C7D7D41B05B9EFFC4099315EA7 Dalotomy4
806,094,678 *53AA2270FB68EC0AB926A68C48444C0228E8F181 DAlp.
806,094,679 *53A7544D55F82DD9FBF2F7E79C36EE1DF7BC8515 DalpB
806,094,680 *53ACCAF81CC3FE91C9EC0466186A2C3A8270EECB Dalphan4
806,094,681 *53A5748381000E24BEAF2EBFDB9371E8B1733A93 DalQG
806,094,682 *53A1E69FB2A77E0CD87D7ECD3A4906BD33B75A5D DalSF
806,094,683 *53A71CC00CB881A4AED328D42D6AD9F2C82E7A0E Dalton268
806,094,684 *53A50DB40A3E4DE686E49FD1596DEEFC469D4C6D dalton.bohlander
806,094,685 *53AA071ED0107F8CF75DE281137FE648145B1258 dalton.brewer
806,094,686 *53A434AF520705835A77EAD0EA56ECA3ECEE21D2 dalton.cotillo
806,094,687 *53AD9C9888B3B4B653DA288C18015E99CBF3EFE6 dalton.crozat
806,094,688 *53A70F28ABBB0F9CDA371555D9979A6FEDD090B6 dalton.edris
806,094,689 *53A53D75F022DFFC968B76758908876A42C5116B dalton.filmore
806,094,690 *53AF7D241F77398A31A84C46A51859CB33117E48 dalton.flynt
806,094,691 *53A1B0D74F8A38175C487005A86EDDEF96573949 dalton.giacobbe
806,094,692 *53A8C250C0B0FE62A5D19A56D75ADF08DC01354A dalton.lesure
806,094,693 *53A22A40A03FD22A1D8E17055C8063A42DAEDA90 dalton.leyland
806,094,694 *53ACD9414984ACBB08C3A5FDE2AB099A440BD77F dalton.lopresto
806,094,695 *53A770779C6744051336D75C16B99F1BDF83340F dalton.mahajan
806,094,696 *53AD1691E2BF99824E059205B98ECDA8E1860505 dalton.mcalpin
806,094,697 *53A0F8BCAEB3050D13B0729F4E4C59DE47A685D2 dalton.mcgreal
806,094,698 *53AC960611A2859DF43FE50B0A000BFD59D67189 dalton.mcmillian
806,094,699 *53AADB77EEDB56E800728D34CA6145845A4A8180 dalton.ockerman
806,094,700 *53A36FD02C70F21B61F39F2CCBD89229D3061E5E dalton.simonet
806,094,701 *53AB27CECE4E643940A83ABF7BE75BD0A2A6A5AC Daltonst5
806,094,702 *53AC74FF7C4163FCF365B576BB69C03D55C5AFDA dalton.tetzlaff
806,094,703 *53A4B192168AFA6ED2531269551C8ECEF2FDC429 dalton.torrico
806,094,704 *53A3E472BC15BD75E6C6643D0661667522309AB1 dalton.ugaz
806,094,705 *53A438F6FF57B1BF96D60E17DBEFB4368001BB29 dalton.wherley
806,094,706 *53AE4206C7570062C0059117E8AD3673E0203D62 dalton.zeto
806,094,707 *53A109C9AA535E10E6A352689171198263DFC165 daly.co.ukwww
806,094,708 *53A7A4107F18EBFC874940F235FE52B1E0709957 DAlYS
806,094,709 *53A2BB621C1BF341755E99D72FCB5CFFA01C0FEF dalyson2
806,094,710 *53A180BA0B86914C3F56AF1FD79B0926954A4787 D&AM?
806,094,711 *53A20C4DBE63F1F4E054455A143170322E11F4B9 DA_;M
806,094,712 *53A65722CBC78FEEAA55EF564368F4165206DCDB DA(m%
806,094,713 *53AE90979E29FCD8AF75BDE5472BDD5FF48F3BA1 D?+aM
806,094,714 *53A7C9DDF7B0DF4557C7228F007042A8FE9CAEEE DaM&+
806,094,715 *53A4612D6C9EC45A47E806036F9F0E9B619CCF24 DAM03IEN
806,094,716 *53A5D1A379EBA1256305FF31DA8D26760937A9B3 DaM1-
806,094,717 *53A2C309FC9F90D7908F547E3D4A9192C62A509B DAM1976
806,094,718 *53A2C39E376CC7F6315613883064BAE30E2E295C DaM1N
806,094,719 *53AD973B81B16BC77807DC2AA9A74EA1FFED274E damaille
806,094,720 *53A10BB1BE529081693266DABD6B8F0F66D11F07 DAMANH6
806,094,721 *53A76F82A8F34E03BDC3965FC68C35EB13E23247 Damari790
806,094,722 *53A7713B9EA3D18B6C7A460E99AD71C73ED6DC1F Damascering6
806,094,723 *53A455A13D3B17B9602648AD8DCC2CDC29F632F7 damassee1
806,094,724 *53AE2D0CB2964EA46A71ABCAAE9CF333B3863768 Damastija
806,094,725 *53A2BC6406A5568BA9ABD847BA28FAE27076B2EA damastni0
806,094,726 *53A36B3DE98C0B954B4B114A65EC5ABE3C385A7D Damblys5
806,094,727 *53AD6F5EAA0A5B5EDD4D737273ABFB221FD91552 DAME-LA-ROLA
806,094,728 *53A0AA501D4B6231371F12955324E895B3B49079 Dameyonne8
806,094,729 *53AA0A7466F231B25C4206EF196064846FB14452 damgroinhydraulicfill
806,094,730 *53A03A531D57B3889038675A60143FCFA5FC111F damhsai6
806,094,731 *53A9860DDDBE8E9EB55D9179B73EAA3D517356A6 Damian174
806,094,732 *53A83A67A145180362CCC3A7685D2D980DAD57EE damian.aalund
806,094,733 *53A04D167B70524165C3EA9060D799595B2F93D5 damian.berte
806,094,734 *53A4A479D97ACF8A5DD76FBA4DF806D26FEF0AE4 damian civitello
806,094,735 *53AA2E10732F28156E2F2833E444B8B9997A356C damian.colyott
806,094,736 *53AD79C6AB4B3F3461820D95F1F106C35A75C2F3 damian.hechinger
806,094,737 *53A7479F8ADE919EB6687CE52986BC7F67B23DBB damian.kebort
806,094,738 *53A4454CA44F743DA20DE6A11ADAD4F48EDF90A9 damian.kehres
806,094,739 *53AB0E53945E88065F4197D0C89E282988422DF3 damian.masson
806,094,740 *53A3056D7934BAC3E626AD02B470CE3654692DB2 damian.neisler
806,094,741 *53A57366E2A3B235CD401EBAF1041E0D51331B39 damian.ogasawara
806,094,742 *53ADB2DB2E5463E71A183E7A3317CD57CEFA2E12 damian.paetz
806,094,743 *53A3944110D3CFFBBEE53E8CA1DA286079D04493 damian.reichenback
806,094,744 *53AA6F96FAA27C0A123CC3DBB2C322E3407844CD damian.vietti
806,094,745 *53AEFABAC49422097D952492F18DDBCC1F1331F9 damian.windler
806,094,746 *53A8297A837F30AE10AD2C3535860376A2E9786C d´Amics
806,094,747 *53A51D1FACA6A01131A338ABCC8C469B223BAF89 Damien477
806,094,748 *53AAC5D9BAB7C00BF74A0766C82430CE4D0590ED damien.alliston
806,094,749 *53ABA15FE4CE03F2BAC02BDB1D4F696CE1F013F0 damien.berntson
806,094,750 *53ABE2735601A3A2F160CF9A77BBE3F1FDA90C26 damien.bogue
806,094,751 *53A3A5F26537AC5FE9EE974C88D9F1F1659C4B70 damien.bushmaker
806,094,752 *53A69668B87BA77C9D16F8342339879BF1D7FC9C damien.caiozzo
806,094,753 *53AD27830D0C4FFB08E6140CC1EFBDCED53F4518 damien.detweiler
806,094,754 *53A4C6D96C787C3F5FFB1719369CF0932DCD50D9 damien.gugerty
806,094,755 *53A9B7C86F22F5A535829F55BF338AE0BDDF2207 [email protected],
806,094,756 *53ACEB37F2940460791C3246620D0D815CB683AB damien.leider
806,094,757 *53A034C74A25548294B9DEBDFD8E378209BFCB55 damien.luth
806,094,758 *53A8D2C466A9C09541AB341A82601F73356D697E damien.mckelvie
806,094,759 *53AA90CFDBFDCC28E06A9AB6738A90AF94DE19A9 damien.murril
806,094,760 *53A21FA50DD5BE04DA83005D67A7655C1266A6E6 damien.norkus
806,094,761 *53A72AF22253CB4DEC16A98105447C7A80146830 damien.palmisano
806,094,762 *53A6170E861C782D443D37D60ED53AF5C9368435 damien.rumler
806,094,763 *53A13E5CEDE6C7C162EFBDD774027138E4596BCE damien.saito
806,094,764 *53AFF95F581FFA230C1B5D24B88E9EC051531CA2 damien.scandalios
806,094,765 *53A7DF699F627A7491BE5F69F04D19E7FF22ED4A damien.schley
806,094,766 *53A636948FC51F77CFAE3FD64E447117CB8DAB0F damien.therrien
806,094,767 *53A59EFF504189EAF840FC58E2025CE1CED14F77 damien.waddick
806,094,768 *53A23AE7D013277DE4EC421CDC3CD27D9FCBAEF2 damien.ybarra
806,094,769 *53A825DABD8B6D13DD0088BABF5894018941611A damien.zientek
806,094,770 *53A24022DF9764349FAAA4BD91C4C4E75F249F06 damion090
806,094,771 *53A026463E974ED52267E9E494FFFACBCB070C39 damion.beamer
806,094,772 *53A73E9D23DF3BF1A6DD42CF9E4D156FB6E1A61E damion.boals
806,094,773 *53AB3363722CD4D27F803E9675B38D8FE4A84CE9 damion.bolland
806,094,774 *53A6F87BD0E13A67CE8D3B533109FEF4290BF47F damion.casadei
806,094,775 *53A6FCA0D37036814CC6C0084353C77B288FD837 damion.cirillo
806,094,776 *53A2688FDC3011BB037E6219589DE099E5C00E09 damion.clontz
806,094,777 *53A1D7C717A88A4F06629BD219A332114CB3BCE9 damion.creger
806,094,778 *53AE80DE81360B37664ED38903DF8F79086BB4CF damion.dabbraccio
806,094,779 *53AFD8BCF9CA24224F1B42B42CB78649E2D6781C damion.hedgespeth
806,094,780 *53A2DBD923CC5DB56447496F83DFDA0472A775CA damion.kanzenbach
806,094,781 *53A4F638579AC6278F9494F476C98E2CD44DF049 damion.keifer
806,094,782 *53AC186A333AFA98FD772DEAE10A94066879998C damion.lovenbury
806,094,783 *53A872C2F6CA79C2A6FF91F335FE5D736D865089 damion.maitland
806,094,784 *53AB9B56BE2E5A23665378304A24EF13EEA9ED29 damion.neighbors
806,094,785 *53AAFEFB203A6A4738FEA31846B9BCD864B65E85 damion.pugeda
806,094,786 *53AE8EFD463489CD4DB1F03A1770D06BE716C8F0 damion.racicot
806,094,787 *53A4938002CA2D0F4EAB0FF4CCE666ABD97245B2 damion.rollinger
806,094,788 *53A0C52E23F09C6CA298C05CF3B4D797803240BC damion.thorington
806,094,789 *53A3640878A8046BF7265F128865FA749F026A13 damion.vanlaere
806,094,790 *53A6764AAAD5773B593B6138B48931347F82A720 DA,mj
806,094,791 *53A63A31D9EE03D3F8F997F71265BD5287F73979 damla hussein
806,094,792 *53AF2B2AB06AD17064B055EE9C69321D94F353AB DAMMACANSU
806,094,793 *53ADB15F7E2B1B6BB124697A530440596346159A Dammartin9
806,094,794 *53AEAA338A09C31B171210C4DCA0CAFADDF012CB dammnum
806,094,795 *53AE514AF4E880817A666E82E16F3ABBBE2613F9 dammwehr
806,094,796 *53A39D497CE1A514B22D2616BCE7F5B47FD50734 Damna8i1i7i35
806,094,797 *53A56E9D5351FEFB4922A245A204B2EFC1A4B0C3 damnbeast
806,094,798 *53A408B320952FC7070AA47B6002376182E35100 damndamnation
806,094,799 *53A5718ED2CF3D8BDA88B9DB97415585EFA0185D damnhot3
806,094,800 *53AC77D2A6D527D85A4212700B1E160B18C6958D damnitjanet!
806,094,801 *53A4E5F0CD3E0626D30BAAEB93E67D7F6CD0A6EF Damnits3
806,094,802 *53A9CF3DB91E356B01B530F862C6DC9AA596019A Damnou$ly
806,094,803 *53A84534FA8599097A1B431010ABEDE8D5391A7F DAMOC1ES
806,094,804 *53ABCBE6808B45B044E301FD961CB8D9DA6709D0 Damoderio
806,094,805 *53A04C8E234C8F7C0F59E7435BCF64BF32B2465F damon.brott
806,094,806 *53A68C608EA6533F2FAF16CA2768D239870D8009 damon.conkey
806,094,807 *53A946A0697EEDC7AD995A705C47A8DF070710D1 damon.demarinis
806,094,808 *53A90D5059EBC87E67154A6F4DF8986DA72EA171 damon.demark
806,094,809 *53A39FA712CE91E2C9E3DA7CABFA4A6A2D045CE8 damon.ellicott
806,094,810 *53A89C63C3E5B1C844DF2B8D19729E340A2F93CE damon.gruenwald
806,094,811 *53ACC2CB523F15979BBACBE00499F7833D0A0B59 damon.lacson
806,094,812 *53A4E9C468596C33CA3D089201DA21AEE5DEA133 damon.levitt
806,094,813 *53AD93BA137E19367BBF31342205E4F4DC702BBA damon.loewen
806,094,814 *53AF1189395EF05333752FB61578C12F0490B6D5 damon.loffier
806,094,815 *53AC94F15356E7D4AE36D24DE8700E442D0B1D2B damon.mayberry
806,094,816 *53A6BD68E63F72110470B0A1644A72179641B470 damon.mecannic
806,094,817 *53ACF1FA33B33C7D6FD216F9B00394BE1781DF42 damon.menzel
806,094,818 *53AAC8C24D09ECFD2D7EF823C0AE830A623621B7 damon.nealley
806,094,819 *53A34697248C767B663EA1B83A9AD2D4D7E083F9 damon.sanez
806,094,820 *53AFE3A6D6E196766431FDFB57A0A3413499C079 damon.sciara
806,094,821 *53A75ED342263A2A77F644667B64FF69B3941480 damon.stegmaier
806,094,822 *53A06127546A7FB18C7C97B9F4F4D3C13A00E7B4 damon.suydan
806,094,823 *53A556FBA8FE4091098F883243E4CD86EBCF25A9 damon.urion
806,094,824 *53A994DE6BB71BE7B03C7B8D34673401E932D3AE Damosi
806,094,825 *53A09F039368A43E95582A9D82A34DB9D0308287 DAMPATTERN
806,094,826 *53A0CBFC629AD7C7EA904A862FD1551AD217ECEE dampfgareinsätzen
806,094,827 *53A1F2D5992E81FEFDDBBB06306884503AFF7362 DampiLo01
806,094,828 *53AD7AFBBCA0999FCF5140EC73B7775030132E67 dampingkanlah
806,094,829 *53A779B2709ED93BC68CFAEFE3DF236BECCE5567 Damplijn
806,094,830 *53A208634D7499789E524C625905737157E4D2D4 damp with tears
806,094,831 *53AC66E99029B7B47ED794219FD9A009BE899158 DaM/q
806,094,832 *53AC595CEC278F3BF2B4276DCC90ED7CF8862CB5 damrootroutruckrunrun
806,094,833 *53A85960F76BBD5D4FFBB0999C595A21F4FF0592 Damshitaan.h
806,094,834 *53A7F6BA50240B7CD1984C7CBFE1C2CD52DB9E98 DAMSHOLTEKIRKE
806,094,835 *53A443FE58233A3654490252EF7C29B90C2F870A DAMVM
806,094,836 *53AA5EC2F100D86D03F40AE1AB45BDDCB000EDFD Damyanke
806,094,837 *53A2AF42082EE4215F383C1F87A7BC795879CF85 D$A"N
806,094,838 *53AB31C91F69BFA6232628B3DB575FDD4CA0DEE2 D"a.N
806,094,839 *53A9A3C89BD37E5F15773ACD76C8F78D8A81E959 Da/:n
806,094,840 *53A31C679F6CDE6F2D0D6BC2DC67F50B1CE85514 DAn0a
806,094,841 *53A0DA48646108DEC1D8ADF2F329CEF7059036F9 Da%N1
806,094,842 *53ABF354FE24AC73613DD2213E51B8280A8EA3CF Da)NA
806,094,843 *53ABA3E65B4352EE1F25B3A253E3CC9ED02606D9 Da)nA
806,094,844 *53A1CC72A8CAC489C1DD980E808BC17EC01B486C dan.abbed
806,094,845 *53AA7CCBF1861B7E751C290761DB05BEA2CB3F19 dan.abel
806,094,846 *53A386EE2D4518BC8392DF47C0EC4784FF0E356C dana.billie
806,094,847 *53A3E87D6ECB253D63797A4CA623706DA0E72770 dana.brazel
806,094,848 *53AEBE7FEAB0997B75960DE45E0E1C9F47464AC1 dana.calcaterra
806,094,849 *53A855F10169D42274EBDDC9B3F1EFF569F8F9B5 dana.capurro
806,094,850 *53A5040C2C3B093568FE5C901BF44087530FE499 dana.dasmann
806,094,851 *53AD353A00D68EF05F898DF752EC271B77D16E23 Danadez
806,094,852 *53A466F790470B1F6DC8366465C45BC29BC31013 dana.dirosa
806,094,853 *53ACC378080548EBF5E4BF9FFFE35DB210947F3F dana.elsensohn
806,094,854 *53A35A9815F1229E3F352674420A1E773964F1FC dana.frigge
806,094,855 *53AE4ED11A41C3558729F8B6807DBBD54BA2A15E [email protected]
806,094,856 *53A9887C5A40B4F99736C6C893917C28A1540B81 danai8
806,094,857 *53A972ED0F82FCFDF20D4F8597CBCBF2298B161A Danaindru0
806,094,858 *53AB1A8A2821DDB0A4DD4505FE793D33F8F54DE8 dana kiser
806,094,859 *53AB44A01BDC4AECF0B3C0C0A745D7983452E512 dana.krostag
806,094,860 *53A7F02A6E17AB09F6E72D3CD3A162984648C634 dan.aldo
806,094,861 *53A0A0DF6895979ED936512708185C0EAD241970 dana.lorelli
806,094,862 *53A732B7B1214D513DE9A1535EA7058DA1DFE772 danalugo
806,094,863 *53A99909485159F238E7BC43EF4A89245D17D9D5 dana.mcguff
806,094,864 *53A3173176FB0358331A71487ADDF08042BFD35A dana.milionis
806,094,865 *53A5AC41156D4687E7D50391E03EBE5B626D2DD5 dana.pesick
806,094,866 *53AC6BC199F12B488F15B66713943B299DDD282F dana sarubin
806,094,867 *53A6546A45B179E65E5B8C25CF39DF0C99F875ED dana.shoji
806,094,868 *53AB70BBC6AFFBCBBAB32D3EB0C3134DB42A408D dana.squadrito
806,094,869 *53A3BBB8CDDDAC7920424292EB255A20E688BCE4 dana.streitmatter
806,094,870 *53A4FD0ECB60A7F61C6687A3201ABFBD02C0A238 dana.tavolacci
806,094,871 *53AD9F04F0C03F995216F551E94A300B8E204276 dana.tisby
806,094,872 *53A5B56361E46C06646F7555CD3ECA09381721AE dana.wallinger
806,094,873 *53AF5896BBDFDEE7A191F4D517690070002A9E83 dan beauchemin
806,094,874 *53A4E383AE743FAFEBB869D929BD205A15FF2DE6 danbeer7
806,094,875 *53A0BC4380F3E225CD6E4DDDEB801F0ED0BEB374 dan berardini
806,094,876 *53A896F6799A834A499F047CEBB5BD8EB5B4B3EF dan.biancuzzo
806,094,877 *53AE314AC6A72D882AA3E062639E4EA161ED7689 dan bigman
806,094,878 *53ABF3172BD20012B1C6DA1B42CF233D58E05C0C danbohner
806,094,879 *53A29343B46AFC98364D6253B2DDBC93850F8B00 dan bouton
806,094,880 *53A312AE31AB90C805864C2BEE151B30F58066ED dan.burrill
806,094,881 *53A16BCC5B709973A69629F490E1A5B4E2F2D2ED dan.carreker
806,094,882 *53ACAF05F98AAA14C5479084F0372AAACD040B6F ¨Dance
806,094,883 *53AAE51BB572C6F5FC5E183A3F433CBC6752E374 dancebear11
806,094,884 *53A90655EE174A5C5BEBFC5F3A02B360C2996DCA DANCE D AE1 N S
806,094,885 *53A4EB4E80BCFC4CBA25B43602049D5044FD65AD DANCEINTHEVAMPIREBUND
806,094,886 *53A87E5B317992FE9F238912325ABD06C110D924 DANCELA121
806,094,887 *53A7F5AFBA4E95DE4DF598EE5B47D2D7790B4E26 DANCER#4
806,094,888 *53AD99DBCFF296F00FECAE082A3D84FA1E0CBD2C DANCERIGUANA
806,094,889 *53AFE31B37A52F3D18F996BEC725241A8BF0293D Dancermiles
806,094,890 *53A80F4EB5C345A5E7AA96BD780FE9BD173289DA Dancerpmc
806,094,891 *53ADABABA66EFD06558B7B4AFD94594A682984CB Dancerussell
806,094,892 *53A525FD09E7E9E65492DBD8C8275B11E4B74942 dancetrain2002,volume4:clubedition(disc2)
806,094,893 *53A2B17949F466F6281AE042F9A22B0520F1A9D6 Dancing Wolves
806,094,894 *53A1EA11C029FEF7B401EAF0A0BC2118CF3CC3CE dancin'likeagypsy
806,094,895 *53A231811870B0BBB344A9C22957674D93E0A1FC dan.coran
806,094,896 *53AA86C5733A84BE35DC33EE2F2D510031B179C8 Danczick
806,094,897 *53A1BE952601FC14D41D9C271B73404FB9F57538 Dandesigning
806,094,898 *53A720FE46DE75FC657EC31A26C27FE824258109 DandieDinmontTerrier555
806,094,899 *53AD4ED46FECFD08FCC6C302800FDB0490850297 dandoglile
806,094,900 *53A961D69E9CEB1C6F881E719A369789A16C0280 Dandrizzt0
806,094,901 *53A2AD8855EA466AE0DBBA39DE382858237741C3 dandyesque
806,094,902 *53AF7B5826EF365DFDD91E4D24EEAFA6BA6BA2C7 DANDYPRAT5
806,094,903 *53AB343BAC53DC0A0F1EC1EFF0B32845B22E53D2 dandy sese
806,094,904 *53AD948E3483D392BC5D63581880FAABC0457AF5 DANE1220
806,094,905 *53A7B2C41320BF19CF037DF0BC9B04D3BCE01722 dane.ausmus
806,094,906 *53A20FFBCE68A002D76FAB20A0AFB1F31D3BF055 dane.ayon
806,094,907 *53A51E6C566C38BCF65E0F0A1BDD58F24DDFC948 dane.bayes
806,094,908 *53A7CFC300322A901C1DFB60F115022F3BC5B28C dane.blommer
806,094,909 *53A21E6E1F5E8422BD5543A0A1A9AACF572BA18A dane.brailey
806,094,910 *53A4A2673D241E3B8A28BFB0FE15BDE224E8BE8A dane.dasso
806,094,911 *53A678A30A19F662FE520A7E5B38BD02E07DD658 dane.delaportilla
806,094,912 *53A67B3E473FEE2554403B2286CCB5E5CE5D79A1 [email protected]
806,094,913 *53A9DC7DABBF317E1C739106B826DA7A5CB280C7 dane.gunter
806,094,914 *53AD5DD3D4556157EC15209C4624CD8FF46BB615 DANEISMYBABE
806,094,915 *53AA8DC5B5569C321E63E473BB4CDA4B95ABC94D dane.kaneshiro
806,094,916 *53A40293357DC9CBA4EB0B091D38399DC2283FB0 dane.larner
806,094,917 *53A9C1C8B95CEFBA64E2CF77B3E63BCBEBEAA404 dane.maduena
806,094,918 *53AF5D64763183072D372046C34F67FAE3643FA2 dane.magginson
806,094,919 *53A3A5EA3F3DF55FC4F26B4B939CA7BAC94AFE2B dane.mcconchie
806,094,920 *53AA97A9E27E6EAD6E7265801EFAC395263FE6E7 dane.olnes
806,094,921 *53A83C27B84167F345DA1AD2CFCE59E7477558E7 dane.parlato
806,094,922 *53AB3A3AD01146A29AACC05EB822EE44787ECC0B dane.peretti
806,094,923 *53AACE7D042641F6C375FA6719FDDE3A3AF05F85 dane.pounds
806,094,924 *53AAD55BAE2BB68EB4BE1AE9EE5F035C1F797A8D dane.rudisell
806,094,925 *53AF1F106A9EB92B5A33198DF6EC6C5142A50830 dane.schliep
806,094,926 *53AE68BE788F8DA9B77D1AA5D5C3A3D6BB3C4FED dane.shinaberry
806,094,927 *53A1CE11F9696526AEC2B4FD356E2A10D7205BF2 dane.sidle
806,094,928 *53A65A358DFB1DF7D838DB16485E8399A14FB5DE dan.eskridge
806,094,929 *53A0477C4F81C8CEFF5BEF332AC1CA1652406A77 da nessuna parte
806,094,930 *53AE6CE0773F3C2B61F0DD28AF478A0F71921D1D dane.vanloon
806,094,931 *53A478A26D60FA4A40E1D8EC39C1D928FB298705 Dan Foster & Christy Palumbo
806,094,932 *53A65006B8BC8F310020754F2DF1BD08D521F563 dangelo17
806,094,933 *53A1B8F054D429E670EC95AA8E59777E2369D814 Dangelo634
806,094,934 *53A1DC6A4BD7D6C62F0AC5335CD653F21EA4CCBC dangelofields
806,094,935 *53A22DE52B7F8CE0C7195935ECFD625F8C02B561 DANGER123456
806,094,936 *53A876627A046411C81421F48C7D89485E6D8004 dangerous man (demo)
806,094,937 *53AD3F9D1B3F41CA9C747010DA92C4FC42152543 dangersweet
806,094,938 *53A47B27C22428173449D60076885109E3F7B223 danger »
806,094,939 *53A29ADBA72944135671B95EF86133590AC7C6F6 DANGLERS?
806,094,940 *53A5F979CA931C074714D95E0E37730146B2C4C4 danglozano
806,094,941 *53A6F9A50B117FEB7DF0074177C041FF643E9A45 dan.grodin
806,094,942 *53A030CB595F821762784E860EB220FA5A53B5F2 dan.gullace
806,094,943 *53A9B5C46E73DE48C682857FB27E3529DE3F17B7 dan.gurwitz
806,094,944 *53ACFCE02C2D729BEBC6D2810A79DD93CB14C37F DAN"H
806,094,945 *53AD44882793EBB1716D4786929B18E177EE7D2D dan heasley
806,094,946 *53ACF977FE0E2A9E6C7755D2FE5F4B1FB9312C3D dan hung
806,094,947 *53A2AF0A5DFAE492724AACF927D64D9347A5063A DANI1190
806,094,948 *53A653AB549099B8178969B55BEA8C54F7855388 danial.brandly
806,094,949 *53AD39248F32F6E94E0C25B08883DC626BE04149 danial.brunkow
806,094,950 *53A7E8F46A477F446CB79B8E55C51B878A33EE95 danial.czajkowski
806,094,951 *53A5EDA34F7BAED8632D296E202DC33BCD722EEC danial.flexer
806,094,952 *53A2833C4DAD12AED84EFDA175DEE858A0BE16CA danial.frates
806,094,953 *53ADD3B98B96C77700D32E0A458A25583A7676CA danial.goben
806,094,954 *53A8D774AA555903F5E0F40C8965CC4DC7A73226 danial.harges
806,094,955 *53A92DD6643B0813B8E8B5C53350FD65911E4B9B danial.heming
806,094,956 *53A70D4D72FA37310FCEDB418973266B22A66EC7 danial.kaye
806,094,957 *53A4084C7D39C824191B595E5F68A2A72356E0BC danial.kouba
806,094,958 *53A2A0656D38ADEA824EE00D7DCF247824653DF7 danial.lacasse
806,094,959 *53AC5C98CF8BD431D3BD54DBFD0EC73FDBFC232B danial.lindbo
806,094,960 *53A159F61507FCEA58C079BCD92E6D1514429DF9 danial.mcgavin
806,094,961 *53A699EBCF5F6A5BD4710030CC962F5CAD050D26 danial.rendler
806,094,962 *53A60C8630B055AFDD5B3AC398F4E684B93C6E2C danial.reseigh
806,094,963 *53AF103C1F2ABCE0A424415519AE9F79E43ABCA1 danialrider
806,094,964 *53A2EAF393ACCDF879B002B5A474DD79241DB22D danial.roes
806,094,965 *53A67F312E2C2DB345A41B79D75A22D1AD16FAA8 danial.southcott
806,094,966 *53AF1980BBE36A79B0BC307119ADC993EB46E756 danial.steinour
806,094,967 *53AAC7DBCAE9C08A10F8B25BE86614CB93D845B7 danial.vasudevan
806,094,968 *53A921FBAC62177616690BD3FE8DDF685EDB4927 danial.zander
806,094,969 *53A987B5C366BEF012DBBE36EC0857B8F7D4957F [email protected]
806,094,970 *53A36BA9249B1CC9CCF6C8D7A07EC346E5A13977 DANICAELQUIERO
806,094,971 *53A9D0632F3B78B0153D43F829D17BAD5BC3B1E4 DANICAKAMAKANA
806,094,972 *53AE400D58590C92317F03A223D308C020F5A736 DANICAR17
806,094,973 *53AF5680AD2A97938376C11B21760702E2DF4B8D Danicck0
806,094,974 *53A98A0728E51F6115FC1444D569546B05D74327 danichitu123
806,094,975 *53AE3807A9BD2077242B734E05E3ADE43261388E Da.niel
806,094,976 *53AF24C2A528B9E6FE902C729E5E9C0F54AD9515 Daniel062
806,094,977 *53A9C32AC16037BFA39E050F5F502CED77CBA7DB daniel1938
806,094,978 *53AC575E56112231A6CA86138D1913F9283FAA91 danielalancaster
806,094,979 *53A5C63B0AEABA27833EC71056F809AA4470273F daniel.badua
806,094,980 *53A93E9AE4AF894F12A01A4985DD9D6DA09D761B danielbittner
806,094,981 *53AE1005EE68B1BA3FE0129AE419320AAF34A0C2 danielbouwman
806,094,982 *53AA51C8180F6B1924C0E9037D9F462E92026354 daniel.carthen
806,094,983 *53AC09E3A84FEA23E20888D4504B525686DAE0E9 daniel ceko
806,094,984 *53A99F14EF9744E4191DB718E33E6255D978CB5D [email protected]
806,094,985 *53A4C24AC28D1F7EB796423FCADE9B5B08BE6BED daniel christopher pearson
806,094,986 *53A8E98DE07371F4FB776269CEE998100DED9000 daniel churchman
806,094,987 *53AE7E97A4B5E1D217A1D9A125EF9BD452EA766A daniel.dennig
806,094,988 *53A41917F48CF303317AA9DF3CF97588D9F1888C [email protected]
806,094,989 *53ACC501DBD226A9229CA7C8804BDC5DD138E6F9 [email protected]
806,094,990 *53AA075A23649E76B1B4A91FA5A4A72F0095917C daniel.eggimann
806,094,991 *53A089755B47E8156EB822BA4D6D749FEE6489BE daniel.fahlstedt
806,094,992 *53A7A6C525A93F48CCADAF0B4AA4F6023336C916 daniel.gianikas
806,094,993 *53A17D8166EC15A15EF1370FD04D27800A7C6629 daniel griesinger
806,094,994 *53AF58629124B552590516108B1330ABBDC0B897 & Daniel H
806,094,995 *53A3908662E135FC9FE25E463BA4A3064489BD24 daniel.hentges
806,094,996 *53AC2B0F9E5C7CE1E217E83E524C46D40E784C8C danielhk
806,094,997 *53A1ABFAA33661CBB2FDAEC46E1230B2B6CD7321 daniel.hockley
806,094,998 *53A9E80FBDAC50B6451CEC8E257B9678E1D24574 daniel.howeth
806,094,999 *53A95868D38326EF18DA181750DD2139D8266A28 daniel j cahill
806,095,000 *53A36BDAAD9A7067D2FBA59512DE9E7C3BD138B1 daniel josefson
806,095,001 *53AABD404C25DCF4109824AFED2D652BD975E2B4 daniel jourdain
806,095,002 *53A0EBBA5C7BEF225279F761AAD8309ED376F912 danielkenison
806,095,003 *53A78A9FADDBD525F6F548A8F247F9A81CE69A47 Daniella787
806,095,004 *53A62DE0F35FE37223C701A1B2CCA38B1CF1FAF5 Daniella992
806,095,005 *53A0DA2DAC3615B78496F78B8C9EF6D0ECD3D46C daniel.langarica
806,095,006 *53AAE3C2D33F35086F0E34F15EB2272B08F9939A daniellarock
806,095,007 *53AFEB5519BBF5184D702B38508A11D151EDA687 daniel lasiter
806,095,008 *53A591F462A7B05196EA78356D65BDEDF7FF4CEA Danielle1904
806,095,009 *53A924C388B5F9CB0601CD572081B55524F6B4CA [email protected]
806,095,010 *53AEBE1CD1523E8E56A88140EE2E8269E20BA47A daniellecompute
806,095,011 *53A7797BFAB7A3B3453362D88AC4F72D6B7EF788 daniellehagood
806,095,012 *53A9904C54CE93C58023B1FDABF1AE3D5D7EBCCC daniellehalligan
806,095,013 *53A9475F09638504DD3FC305F793D6C41674B472 danielle marie fortin
806,095,014 *53A2BD500443089010A2B4C9989DDDC74E5633B8 daniellemottram
806,095,015 *53A011A9660D98324D426E69479CEAC8717CD6DD [email protected]
806,095,016 *53A6C2FE788535D980E671BD30400DACF9F99B57 daniellemuhammad
806,095,017 *53AB4E4CFE33642155F7B5F872BE70041BF6F6E6 [email protected]
806,095,018 *53A1A3F7AA15AED2321DB4EF8E5D858CF3685F1B danielleperales
806,095,019 *53A254DC26B081B0E963B0BC72CF317D5258402A daniellepizarro
806,095,020 *53A57C205F5D9F57A4BBFE232223EF99EEFB8007 daniellethelen
806,095,021 *53AD11EFFE637F344A325AF8E1E3B5906B0CC486 [email protected]
806,095,022 *53A1DD8A355B46F7E18A67EE7B6DB2AE21086490 daniel.luedke
806,095,023 *53A4607BA0C10A6A99DFFD056EAD930BFE27FC54 [email protected]
806,095,024 *53AF637542C10D366C67236F2DE29263986FDAB6 danielmartland
806,095,025 *53A0920D25DEE623CC3D56C0B2BAB549CA5120F4 daniel.mccleese
806,095,026 *53A60225905664B6E39FF65F1BEA825FF9CF9288 daniel.mobilia
806,095,027 *53ACAB1352C9AF89EAB890787D11E17A30746EBB daniel mohlala
806,095,028 *53A7260504239D8761984149CA4120710C7DEE0A daniel.oelschlaeger
806,095,029 *53AD9C849F897DB4C6F063EB42762CCFBB1C5723 DanielPacrami
806,095,030 *53A53C26C6E63B44648448EF7058A1A9821B46C7 daniel.patches
806,095,031 *53A7D29F17A0234632DB0658E393BE0A357E72BA daniel pentecost
806,095,032 *53A5BB03CA5D34FACD97D77B66DD0931EAAB23CF daniel.prost
806,095,033 *53A7D8BC61A064AE32B9AE1858F593A438EA125D DanielPs
806,095,034 *53A485B0AB9A1AB85D9F24A8AF85DF637DA90BB8 daniel.rawlins
806,095,035 *53A168F70599F15800EA3B44FDFE551C66947744 daniel.ripka
806,095,036 *53A10BD5661EE27945B77678FCB21580571DC92C daniel.salvey
806,095,037 *53ABBB293D7D3E7F876819D0662251A2531DF159 daniel.santone
806,095,038 *53AD4C1E03B12F1259D9A482AE4F7E7C38973399 daniel.sawrey
806,095,039 *53A6B6B5EEA89E8FF1379823F6C4D191E83D2F67 daniel.schwuchow
806,095,040 *53AF4EE02C50BD553C26D4C2ACF051A13A539EF1 danielsgeeta
806,095,041 *53A8988FD645E8D61874A9C0309BEAC4C516951E daniel.solo
806,095,042 *53A729C4B863044702D5AB012FB34E16A2B5C01F Danielson:felcher
806,095,043 *53A8FCBFDCC29893B95ECF4F2218841732DC7C8E DANIELSTY
806,095,044 *53A60358B33A83CDE0423F29FFBCD4D8D6FEC236 danielus3
806,095,045 *53AEC22CE027FA2C4BF9ACDC07B5DE3BD4DF2C70 danieluvrapid123
806,095,046 *53A53D1253703DA5B8209DFD2B4FFE4F9772AFC2 daniel.vanderwood
806,095,047 *53A8847F9ECCA25F9336A36D76D42C109073AAE4 daniel.vanwie
806,095,048 *53A296DA698EBD4344AAE51BD122F496045D58A0 daniel.wobig
806,095,049 *53AE5BBDBC0F267D0EF27F26F28E35B6D1DB8DB7 daniel.zentner
806,095,050 *53A734E2C8C5EBBACD091B18FAB91590DE97A90D Danieri1
806,095,051 *53A013D7886596F589D4FF870253F6F89C1C36F0 daniglacial8
806,095,052 *53A2F14DE00FEDADCDC0F7EEED0D81BD67CBC784 danilo.bazin
806,095,053 *53AB2AAE082959F66CC5E4F17571900BD6704410 danilo.campisi
806,095,054 *53AC791112564555DAFB32567F03244D312308BD danilo.capuano
806,095,055 *53AC73B40AED27686C089EB3C8E20931F6415997 danilo.casias
806,095,056 *53A88FFE3C78E76D1683EA22338AB60D3261A518 danilo.codd
806,095,057 *53AB25D44BC93F1E149F9F7EA20348379922321B danilo.gormanous
806,095,058 *53A1938909C0632C68C1306F5E708753071B6425 danilo.heimrich
806,095,059 *53A7596539075712049ED9FD18EAE8AFB85E3E31 danilo.janofsky
806,095,060 *53A3018ACEC223B95884B8E242FFCDDE63915E09 danilo.kenson
806,095,061 *53A67C3CE5C8C847FFBEFEC91F31D59CA76871F2 danilo.kilbert
806,095,062 *53A464A43FF394DD1116AE401F135E38D9074759 danilo.leiser
806,095,063 *53A977A2FBE3A190489638015E35F1F1A67E57F6 danilo.lofguist
806,095,064 *53AE798C984399DF829C7A26AE872C58A645F39A danilo.marines
806,095,065 *53A3E38EC2E498CA7394CD97ABF81AD5B2F080B3 danilo.markley
806,095,066 *53A93836EA78638ABE2CD421506ABB3D0D9F8DD4 danilo.reburn
806,095,067 *53AD97899C7402C0430AABB5D6AC38CDAD477198 danilo.regusters
806,095,068 *53A3771C171CB2A4249B94E324AA34779F738B00 danilo-scipioni
806,095,069 *53ADAA54E2AFE18D59E470E3A38DD629A6C7CA28 danilo.siddoway
806,095,070 *53A5A1C5F7BA0E800619D608CF86B66709F70805 danilo.srader
806,095,071 *53A51FF9AD9BDF8CE47933398B97E74EC7EA51B2 danilo.szczurek
806,095,072 *53AF8D3496BFC4012D9F9AC8D71FDFE0ED6CFA6C danilo.vanandel
806,095,073 *53A7D254EE01723DF897DE6DBB481417B33F9475 danilo.vanstraten
806,095,074 *53ADE2791FD0D9C4A1599E45EEE7243E21265346 danilo.veselic
806,095,075 *53ABE19A3DDC747C321B32547D991C2AF7226B16 DANI_NANNER
806,095,076 *53AB1E7BA97B1102C08EADDF9369665E6B1F3E31 DANISH-UKRAINIAN
806,095,077 *53A207801441F948F49177743C071AB14E6D96CE danistarr
806,095,078 *53A03B183B30C38951EC81EE4807FBD1CB0A388D danites17
806,095,079 *53A5263AD23FAF83BF832283BC2216EC859B7BED Danjerry5
806,095,080 *53A9AF6B36CEAEFF26B5F2F109F1D569F4E4C9C2 dan kamen
806,095,081 *53AA6FB8BF6B1648C45C0D506BBB6C04D432563E Dankdagen2
806,095,082 *53A68922113999D98038C2957856EBF54C805B81 DANKER9
806,095,083 *53A3996A7EECF9C832F4F3E9B36EC2E59D821C50 dan.kirchmann
806,095,084 *53AA7CC5D9E40B1BF2715FD4597D5E27C06B4838 Dankitten6
806,095,085 *53AF8718E09869E45D38FF9A647CF79CCE5C2C50 dan.kosinar
806,095,086 *53A4A64AF0EB433E6A637C9EB9FE78B38912AC19 danksage8
806,095,087 *53A3E196E374AC0BA0C70BFF262DAE5E8E24909A DankteDankte
806,095,088 *53AD83B32AB1EA7684CA2FB01730B9FAFA4A83B6 DANKWARD
806,095,089 *53ADF50DBCB174AB522A552DE368F63814E9716C Dankzegd9
806,095,090 *53A67007BF45BC58EB830A3E24B42D27D454042D danlangdon
806,095,091 *53A6413EA3F1C83AA326A7138BD499D3FAA40AAC dan.ledsome
806,095,092 *53A3C1934CF9370B1CFDD6771A7E7F0B1E9125AA danlerner
806,095,093 *53A7255943C91AD1AC56A8712D550F2825EC0FC4 danloeffler
806,095,094 *53AD1A4B56ED283990DA86EBD4337E4F82F3911C dan.mince
806,095,095 *53AA000C0438BF80061DE73BE215929826B2B56A Danna260
806,095,096 *53ABFFD9CBB7500EEACBDED56ED043A30ED7A121 DANNATA3
806,095,097 *53AC5F5DFFDADD6D69E219E14843596FFD4B6974 dannatesing
806,095,098 *53AC081E144B5EF8E233B69F52A7954EE03B1DD1 dannbaue9
806,095,099 *53AD4823BE65A9A0C4432611ECD9E2B4E6DD87B1 Dannelses2
806,095,100 *53A9984536D7BA5A3D6DFF16036C43A651E23B47 Dannemorabygden
806,095,101 *53A2AFC19C72F7F5B1F30A4EC683B11A64CE95A9 Danniblog
806,095,102 *53A32404FE8C18524BCADFB450EC3A6D1DDDA963 dannie.carosella
806,095,103 *53A41DA4F070FFB557D3C76B4BF6D167E04C90B8 dannie.cruell
806,095,104 *53A148360647195F6BAEFE8D6D8B72B7D6FA6664 dannie.fritze
806,095,105 *53A327361335D86D3028D66D93C52DA68F184473 dannie.fuhr
806,095,106 *53AF9ADE28B2C44AE0E20532992D6A4CBCBBE3C2 dannie.kataoka
806,095,107 *53A4894C018904CDD54CC7DF96D258BD9B5958AF dannie.kiever
806,095,108 *53AE4EB5B80B4678C308871B0DB43EDABBE3D279 dannie.mccallough
806,095,109 *53A50F90E9C1F94E8CB6AC8184D91D19AB2F365B dannie.mooring
806,095,110 *53AB2E13CB67436642D26CF6F040593693D6A001 dannie.viar
806,095,111 *53AB71CB9CB1847D63B3E14E8C071026B209C9BC dannie.wheelen
806,095,112 *53AA345CF493A88029DA323BE636076FE8130D50 [email protected]
806,095,113 *53A3F2184ABC2A06FA089980C5178996C89C2FDB dannouni2
806,095,114 *53ADCA8226A30FCBD592188A3600B822FAA48D16 DANNY2027
806,095,115 *53AA98EE1B6F1DCB12339CC9456C5034423944C1 [email protected]
806,095,116 *53ADB4E225736C9912F98C20261C734F6559F3F7 [email protected]
806,095,117 *53A0F4C92615F3128932BBD1A65284291D150DA9 [email protected]
806,095,118 *53A6979DAA9BB8BD0C880EF74D80157CDF7C2CA0 dannybaskin
806,095,119 *53A466338B577D604FFE06DACE836B13194CF1ED danny.bramlette
806,095,120 *53A95EE69994164D7AD3EB83A8AB90809ADFC8B8 dannycecilio
806,095,121 *53AC00DC92116CB1A61999E21D939A0849320449 danny.chais
806,095,122 *53A741BDCD3E3D47738E41F9CC2C6456F2BAF934 danny clavesilla
806,095,123 *53A6833733891E707820D8C7EB2F869CF9BCAEC7 danny.counselman
806,095,124 *53A8E920B9957EF18B8FC68EE69A7428070DA8C3 danny.dekenipp
806,095,125 *53A0A4971BC6ED53A760366E325341DF2BA4FFB9 [email protected]
806,095,126 *53A8DC1A98D9FE0C6D446C81E00A0EA86C0DFA79 danny.egan
806,095,127 *53A32A1516B201A8BFD7D4D00B0AE72BA76227F6 danny farnsworth
806,095,128 *53A09F94C6A32777D7459E864EE004EC2DCE3CD3 danny.fenner
806,095,129 *53A2D57C4EC4A4EB875E4708658F5E5DF6A2771D danny.fuest
806,095,130 *53A3EA90EFFEA2DFA47D4607FD94A32BFF88281D danny.gahan
806,095,131 *53A65147E68BE0B3BA7B698571E0732961EA4B8F dannygaldamez
806,095,132 *53ABA0BEAEC45C547BCC2CFFE1F8CBE4B4C23F60 danny.hartsch
806,095,133 *53AC475CF323CBC96FD43D2B468E37FB17B213B8 danny.hauck
806,095,134 *53A7AC6E1D660108FA94274875F2223B08A7B40A dannyirizarry
806,095,135 *53A380A7403CDFF017E70F5BA13707DE7DF72CF8 DANNYISTHEBEST
806,095,136 *53A0EB2B12E6B560F582053C87CE11ED978B67C8 danny jansen
806,095,137 *53AA4BE38BB18B0535C5BBB2D3625A1E3A864917 danny.lampkin
806,095,138 *53A214C13CC3929C69810661AF7262C61E63B9DF danny.leino
806,095,139 *53A0A0E6E88872C2F0C6E7301C47E8BC7FB9507D danny makiling
806,095,140 *53ADC3C148693C3B088805526A1A353913BC4B32 danny.raja
806,095,141 *53A0A1EC067E920F05EE37B7A98C9ED4433D32AD danny.reim
806,095,142 *53A3828C08EA9FE6DE4DB90CBFAAF48DD82514BB DANNYRUSTON
806,095,143 *53A2A8D0151EB917830881D1CAB286A32E07309E danny teran
806,095,144 *53A3C468EDB8A5AF2D6CEA6C3227D079313CB33F danny.tinder
806,095,145 *53A9BF75DFBF4AEB07B0C7F017639AE8A1282E37 DannyVergauwe
806,095,146 *53A49B6870B3720E55FA922EF6B083949242E5E0 danny.wickert
806,095,147 *53AE40875577C7AFB50111D10B02759BE17382E5 dannywightman
806,095,148 *53AB5FE8B4118DD8DEC8104DAD6BDD1CCBDFC76A danny.wilczynski
806,095,149 *53A84E189587B286726E4BF9BDD28FDB5F826E64 danny wortham
806,095,150 *53ACFE7D7BCC1998C2BC2539D304A7EAD762351D danny.zahran
806,095,151 *53AA46AB062F73DB8F0C140AF4BB98DBDEA33D39 Danotnacs
806,095,152 *53A9C30E20DE7AE87591B9A84A136E90019D0C91 [email protected]
806,095,153 *53A928EE78A39EBFFB555125A67F368938C352E1 dan.portie
806,095,154 *53ABC4A9189FEC341246223DBCB268B38D11D59F dan.preisner
806,095,155 *53AB53C8CB80A9C00FABD51174EF1DFD81C21EED dan.ramiriz
806,095,156 *53ADCAB321B1C7B099F2C95DF1B09A76925D6D3D DANS1607
806,095,157 *53A2CDF302B454F1B765ABCE2DE0BF6C3C3582B2 Dansandied
806,095,158 *53AE7D115760691B9C43B34084765E2C08E09932 Danscarrière
806,095,159 *53A971A376F415E72B37C606B3035A64AC5451C7 DanseFlat
806,095,160 *53ACA09A0F55302B7C0AA80BA5A909D513619D94 dansegruppen
806,095,161 *53A2463A608E0F0E079EAC35BD26829762B150F4 DANSERAS!
806,095,162 *53A6EF3170CB2BAA82C79219BAB10D98E7BCF19D danse russe (live)
806,095,163 *53A12807F4EA452D9531033FAD47E7A5EE1C4024 dansette3
806,095,164 *53AE1E4F90BE96F34C4FD63045373433E43E56DE DanSg
806,095,165 *53A0132EA6F57DC6378A80913B008BF6CE9697DB dan.sidell
806,095,166 *53A6DACCD44610BAB3D68AA824530D507B383B66 DANSKI 1
806,095,167 *53A4D63519EAE38D0A9518D09832D3448179B480 danskrapdk
806,095,168 *53A569EA1675F19A9F75500CF28ED5C18B7EC881 dan sladek
806,095,169 *53AE2EB0298B9792C1260E622954EE4EAD3B7F9D Dans le choeur des violons
806,095,170 *53A76AE423F3959FBC0864A9E0ACBD03F15CF913 dans le jardin de saint cath
806,095,171 *53A138D4CAD039DB674CE7F551EE54646E26CAD7 dansoprince
806,095,172 *53ADF7913A496FC6F4E1936D0BFE2F03FAF76B63 danstarcher
806,095,173 *53A2B7F45FD392330907AD409216F56D57A654C4 danstemmer
806,095,174 *53AE6B68FCB4686F13A7687E23BCE63CCF6C81FD DANSWIMMER
806,095,175 *53A3B1C8CB2335AE9811DE7C7CD08C64B2E2B57C d’antalya
806,095,176 *53AD04E3D467D72112664C051B4809AE4D837E55 dante.adamitis
806,095,177 *53A51FB1C20FD2D203C274A965A92AA588F7E308 dante.bachorski
806,095,178 *53A3FAEF4A03A37224BA776537BF3EE72AF45E5C dante.bossi
806,095,179 *53A0880153E9AD23F0FEFB946A6F73771FE57A7C dante.delapenha
806,095,180 *53AE9C896947EF5924A22E4D49DC883B4745BEA7 dante.gay
806,095,181 *53A716148D5B5FD51FAD9698BAD9D1567EC55273 dante.geurts
806,095,182 *53A55F14F5493F44DDC7798524FBA520D0C8C31F dante.kennell
806,095,183 *53A3AED812E56C028E95BAC896F2FA11AECDB5CB dante.korslund
806,095,184 *53AB4049F2AF507F8753D140F283B57BD3F2C913 dante.mayotte
806,095,185 *53A088EC42B44165EAB56104D1B7AD8472E3EBDE [email protected]
806,095,186 *53A74FE2978C1B8F7BDDA2C8C95B6896F3EFCE56 dante.refazo
806,095,187 *53A9E1AF1D05F09CF24848B57125A1792AFE19B4 DANTES_444
806,095,188 *53AEC3F06164258365393FC7D68BD58D91A3D564 dante.sadahiro
806,095,189 *53AA1C99535B92328B6143A18A98770D8EB008AD dante.shackleton
806,095,190 *53AEDCBC3A1F7CE034BE964AE747B178B6FD9D04 dante.velie
806,095,191 *53A56219AAC539459C84B9F9E18B595F7FBD6508 dante.vil
806,095,192 *53AC8C946F16EBC87867ED39F5C75613C2B34702 danthetto
806,095,193 *53AED9CBD148332F7A64683EBE209F9110AC3AF4 [email protected]
806,095,194 *53A47CE9DFC977321030AF2D22EED4BDFFCF2C0A danukes
806,095,195 *53A8A55F74BE2E31EB2A77A851C69977B5F69868 danutgabriel123
806,095,196 *53AF8278017D22E0446B36971D4AB17A32582895 [email protected]
806,095,197 *53AD45D91B2A9328A24D24CC0AFDF33976E5BB7E dan wintz
806,095,198 *53ADFB752B61F54D1B16965842A11B56FCD2414D d’Anya
806,095,199 *53A66A73FDBBEB773B7EB1F7BF749F1565A3122B danyani2
806,095,200 *53A630B579F43C8F7FB197BF4458FC2FF7D5AEE7 danyauger
806,095,201 *53A877B070741009E84ABA49676477B53B101673 DANYEL15
806,095,202 *53ADAA31B128795B505118226E34F90E56DDE612 danyoest
806,095,203 *53A82C5AC15DD962360F6E579B24E02B23300C1C danyohe
806,095,204 *53A3D63CC0B980A4CB3306DFE34F92F5B49CA32C DanzaGaucha
806,095,205 *53AE00749D7D2C474B0927B8FDE61040B49DA341 D#AO8
806,095,206 *53AFDC982BAD0EA095FB1D9C7A4F9054C79CB0FD DA/O9
806,095,207 *53A6F705CD79B55406A452D01400F0653137EC01 Daodh
806,095,208 *53A57541D9737E6A44C3BA45BCCCCC9541B95C2D DAOHCNSG15
806,095,209 *53ABD002C6CC1CD4B5D3ACACFE311B331B6B4A0B dao_lf
806,095,210 *53A3364B3AAC411651DC9D8927B819A6677D0E41 D;AOm
806,095,211 *53AD13CF110EC6061E198E2842AB3F58768A5D2D daôm
806,095,212 *53A9AF1C4A2AB2E7204ED9D8D2FA18D890A7C36C daor82
806,095,213 *53A0D917F51541782AB23AB4D5AB95933C65113A DAoRI
806,095,214 *53AB7B8A9F108AA1ABA5A929B8B1ADC09421AD43 [email protected]
806,095,215 *53A2FA7772B90513F9218A0724EBED2B5AF5B4DA DAoT:
806,095,216 *53A042A9E10F65ED2AA5EC633C6D8F498C735308 daoudhayek
806,095,217 *53A38DC8A3A099434DDE83FE82F4B116F832C0BF DAow$
806,095,218 *53A42230D1310E521A7A60B7C2A781D02B3DC7AA DaOWw
806,095,219 *53A57BDF459EED734703DDF1844EC85A660A963E DA;%p
806,095,220 *53A9974F26FCAFD685463D925D97B22CF2CF01E1 D/aP(
806,095,221 *53A2144FD285167AD8A18A65B8A7E3E5A06FB4E9 Da%P"
806,095,222 *53AACF0D43362BE622B358498F7E7D2F5E227D85 d’AP2
806,095,223 *53A680D1006CC0E1D37BCB83A2473D754FD75F61 DAP5Y
806,095,224 *53AA053F530BD6A323535CAB6D5768FF6D05C93B Dapanhsaed
806,095,225 *53A8DD66F42249BD606D2F23B305498C94158378 dapanhse6
806,095,226 *53A8AF9B8C60B61D0BDC5BCF722A8653BCCA709C DA/PG
806,095,227 *53A42667C8A3CC5F7DBFEA12DCA98B9A353D6E22 DaP"h
806,095,228 *53A046B276BD174EF3AC7F4664ABF1424FC3F993 Daphhpad5
806,095,229 *53A1180098FD8F14A92600643B0A888B109A2AE6 daPhNa
806,095,230 *53A7535567178A87DEF76D16CCE0705D3902285D daphne205
806,095,231 *53A288325723FE6DE345B2A212105E4EEB4671AA daphneelaliberte
806,095,232 *53A1FE5514262F84235C8AED54D2FF5C646EA2D5 DAPHNETIN
806,095,233 *53A2F8071F85B83EBB7C2E76D957AD553B74F670 D;aPK
806,095,234 *53A7B0993247937BABDAA637A85D5D8E3A177E06 DAPL(
806,095,235 *53A20C1D9C54864028D3FFD1C61B2A3F74352775 DaPLV
806,095,236 *53A5C188378605DF7EDFFA1F227B8DDE56DCDFD3 DApM;
806,095,237 *53AE29AF5A5FA2424D11884ABB78E1492129DF94 DaPnM
806,095,238 *53A4A6235461E3F25A7DD16BF60C41F79FEFD07E dappiede
806,095,239 *53A339583D1D5B85D902BCB93E55D3A279A8FE92 DAPR)
806,095,240 *53A78FBFE01E9D93AF1E9FE4D7A72220B057A8C1 Da Protecta, Da Fixa
806,095,241 *53A95FB07D62025611B5A2086F5747A7D8C2E222 [email protected]
806,095,242 *53A18AE75E2F2A43F2998F546FB23451565E59CD DA$PY
806,095,243 *53AEF77F95DB441E04C1EE9C10DE693942906322 DAPY$
806,095,244 *53AAA31ADC71B834AAA38BB8F572D515499C5BE5 DAp)Y
806,095,245 *53AD591FAB25FD2FBE9CF80EA3100D183B7E7F42 DA(q
806,095,246 *53AD7CDA5398040851458878D0B4B78B331B1637 DA
806,095,247 *53A360C9A7466B47F9041AEBBD4763C1AF8AA1AF Da"=q
806,095,248 *53A7502D13F041120F64EAC5F3091CBE8877A58A DAQ5,
806,095,249 *53A96AA7C3C2113625AF6E3448DDC8D4F9472734 DA%q7
806,095,250 *53A7DA9D45D8DA2F79FA7392EAD2B16914CEF982 DaQaG
806,095,251 *53AE825975A84E920A17CE47EF52993CF0595167 DAq/I
806,095,252 *53AF3A97589C2357A0015273C82015D678F8CBD0 DAqOc
806,095,253 *53A77632939DB1573B6668F3FC300227ED48AADF daqshekk
806,095,254 *53AF780C9722F515CA85872F6F7D7066209AFF1E DA;-R
806,095,255 *53A8E593B913969E1061E752B63499648839D52F D.aR"
806,095,256 *53A4685A69FB7F69673B9BF2BEC5A78CF564E1DF D-a%r
806,095,257 *53A87486C0414EF2C4F35255DC88D8FBF1B96DA2 DaR5X
806,095,258 *53ACB80F1AB42E4B024C305CF239DED12B098DEB D!Ar8
806,095,259 *53AE7D40AC02E88206E6F6BF223495450710B160 DaR8I
806,095,260 *53AB99B2DF56AC343ABC45AAF4698E4CA73485BF darafba3
806,095,261 *53A4895E301ECE59B910A58C95F514E4DC27709C daraldınız
806,095,262 *53A1219C6603499F1AFA544697E4ED284936C8D1 daralinsha
806,095,263 *53A5A588D14E0C8EDAC4854B4C55208E3D12CE3E darančiaisiais
806,095,264 *53A3CA492DF201888658CE17B8835174DC9D0EC1 dara ninggar
806,095,265 *53AD1F6CEAE50C81F09AD040F89EB8573BF0ADD9 Darastines
806,095,266 *53ACE124A827BB9835FF63B707BF41CB3C8ACC48 Darasus
806,095,267 *53AF1CD91991EE61CD38756E5CD4510446118F0B Darcrea6
806,095,268 *53A9C7887D1D3592B7749F08D60B5E0D7F4C431A DArcyTompson2
806,095,269 *53AE75AE17E9A4AB7249BFF3C72E8848FAF26450 dardicked
806,095,270 *53AF69A5C60F7E5878854FCFF6B1F4E2434706E0 «Daredevils
806,095,271 *53A91EBA501DB4F8C4BAE3A3784D60D4A98513BC dareerading
806,095,272 *53A35CA4E744F465A05B162CD4DCBE2E7AB613C1 darejaniani
806,095,273 *53A01CC95C6F66172609D6D242BA0174977D1041 darekgtasa
806,095,274 *53A499A7F862B88325340BD882133938F2ABC947 Dareljivom
806,095,275 *53A191C3033E26F39C56DB617A8D849F0655D383 darell.arking
806,095,276 *53A092300C910FA5CAB7BB426BFFEA069C59896E darell.ayscue
806,095,277 *53AC80799D4F0032DC4E958ACE2D6AF749787690 darell.brandler
806,095,278 *53AA9D5A002A178EC994E12F3A1B55A6A3133DAC darell.ditmore
806,095,279 *53ACD9492C018329D2C8F0B48DA5315A6B3221FA darell.eugley
806,095,280 *53AE6CFC21C9E5146BA4F4C0E3D19E3F6FB2E97B darell.forbush
806,095,281 *53A764C4CA18470908F73B709CE9A0F2AB2EDF86 darell.hartill
806,095,282 *53A8260858D81ED889129D76458C632C5F0E4788 darell.haverly
806,095,283 *53AA2CB5900FFC6F3F6FED54A38E251651EA01A2 darell.hutchkiss
806,095,284 *53ADFE710672D2B6213E8005A222E3F388A25524 darell.mchenry
806,095,285 *53ACD4A7D781979F044A88804D92235224CB1AE7 darell.ovalles
806,095,286 *53A4940CD334406B94213C2A2B8B3FDE23183763 darell.rynes
806,095,287 *53AEFD92C14ADDFCF77CF2760ED4C2A14283D671 darell.sirignano
806,095,288 *53A72C811745AFA1614B86586644AFBD1F947327 darell.skartvedt
806,095,289 *53AAE73E0223741061C92AA599A6B4D5FD1A7B60 darell.stinebaugh
806,095,290 *53A0206A621A9C8F48C3670B03FF1C4D93CDFEE4 darell.thrall
806,095,291 *53AE5D8BF3444F3C4D09A786C928C92131AC9520 darell.tyms
806,095,292 *53A2F2B978A14380618623BA894538F331E1D210 darell.whitescarver
806,095,293 *53ADF1469ACFCD344A7312D30406B48C9220FC9F darell.yoeckel
806,095,294 *53A48306ABDD6502B643A457BE440413A8D31EF9 darell.zogby
806,095,295 *53AF972333D3C797C25C7AC2BD020DD9B3237E5F daren.brach
806,095,296 *53A83757A22FA3D1B0A0AD410E291F03F5A322C0 daren.brawner
806,095,297 *53AC04340F3C55BA18DD43BAD05E34FF40CF58C4 daren.briden
806,095,298 *53A0118A3DB0C94783E7FFEB773699429B8BBDFC daren.deeg
806,095,299 *53AF57C15B4009F62B42DD0CAAE1A903C3224BF3 daren.deloe
806,095,300 *53A9C477135344BE90C069B942D893DF679FF30B daren.dowds
806,095,301 *53AB672BDDC80A1D77471B3C7AA6D841A4CE9426 daren.fahlsing
806,095,302 *53A8794B1284064F7D1BD8DF7A11110E4554FAA5 daren.hanners
806,095,303 *53A35FCF01477924EA92511BC5009FC054967DF0 daren.hansbury
806,095,304 *53A113E616170E8048ADE74F315BB4861E6BB480 daren.kresge
806,095,305 *53A3C227EEB5573F6DB3CDCB36247DEF6AEB5C3A daren.liechti
806,095,306 *53AB05B517EBDCA4591E078C3539655CE468A17A daren.maben
806,095,307 *53A13678D82F936F18DF7A7FBC1B87A40E5A7421 daren.mansouri
806,095,308 *53A3B82332D43A7E7FE7E2C7C1F4516C85F567AD daren.messick
806,095,309 *53AC345C97859AAAF22CD1D82C0FC77254208F6B daren.morter
806,095,310 *53ACEAB30C0AD2DAFAF84413794AEAD95D8664D7 daren.passantino
806,095,311 *53A955F2D2AE281661F2462244157A30720D8CD0 daren.rizzardo
806,095,312 *53AD413AF84E042AFCBA34EBA84974E58971F072 daren.ruballos
806,095,313 *53A4386E2E0077FDE646F9612A4B5142220EB0FA daren.seurer
806,095,314 *53AB9D8BA94108509E6EF993A455329F4B043D4D daren.shiverdecker
806,095,315 *53A73B7725C23B285129C49D9872DC331A69F7DE daren.stoltenberg
806,095,316 *53A4A3C0DDFDBDEBE56E47973690C7E86D62FDE3 daren.walton
806,095,317 *53A688FCF996B530630E7919B8BD1B98AF5491A3 daresque123
806,095,318 *53A4FFEDC03B9924810D68164443D8D3F6BBC8A3 dargenio6
806,095,319 *53A950F7410FAB91BBEF133D1356662960B0A77F D'ARGENTON
806,095,320 *53AAF067B410A047FB932CB08BE92B7FF1C8ED85 DARGNOSC
806,095,321 *53AEDB1E3489CAB812278704A907C7DD501A685C DARGOTHAR
806,095,322 *53A88B3F0CD56B4B3B09FDB5432C56415BB6810D dariamaus160
806,095,323 *53A638E44F199EF538E6521E7E7D209FE27D77E0 daria miller
806,095,324 *53A6E2B0A4E6D4E5C7D38C52D7BCA337E2C5D131 DARICIO
806,095,325 *53A534C73A5F1BB77EB266F220EDF9E0FB33E904 DARIJAUS
806,095,326 *53ACBC75F545F6B5655AB9AE698A395EE12774C4 darin.botton
806,095,327 *53AD64F57F0F8992724777168A2C84A5909A84AD darin.colker
806,095,328 *53A638DB82949E0EA42AF5B3BDC35738FFB14F50 darin.coore
806,095,329 *53A903256CDC47620255C17FC0911D48E73DE07B darin.depaola
806,095,330 *53AAA48D6887085E2609F449788F833B9F515200 darin.dishinger
806,095,331 *53A3CB4AF549289D081CB03946358FF855E3FD0B darin.ellwood
806,095,332 *53A005C5CFC7F2D24CC080B68873E7E202737E20 darin.fernandes
806,095,333 *53AD626AA064B5C7A680C9AEBC814D3700E03968 darin.forsythe
806,095,334 *53A075AC08493340C51963C81CBBD9460F012BDF darin.franzman
806,095,335 *53A0A9F2A4D608A108AC2828A9C2C2A4021B7652 darin.garitty
806,095,336 *53ABA0ECEE652A2AAFE1A1A291DB89F18E62F9FF daringdolldinamo
806,095,337 *53A45EEF412103270791897361B716952E286C77 daringtv
806,095,338 *53A98159C0AA4323497BA6D73F53DBD09292A998 darin.innamorato
806,095,339 *53A5B978CEBC5C77A5B78F4B2E8CFECB30007F92 darin.jarva
806,095,340 *53A5733CE99A900BFE0498D0F63E596A03034191 darin.kitten
806,095,341 *53AEBEA525B949685FB007298CBC1B50143E9087 darin.krahe
806,095,342 *53A821AFDCB0FE2A4A9432C525DA2228E295F106 darin.lichlyter
806,095,343 *53AE86CD4EB38A37A3074A7307CA29B1DF089009 darin.lykken
806,095,344 *53AE4A9FD07DEB81E6E5A908FFEFD4460097F9C8 darin.pellegrino
806,095,345 *53A177E49C02D0B2E28E2013C0B3108309A8A494 darin.pollom
806,095,346 *53A83D08EE07FAD52543530270B7AE09E3E343BB darin.register
806,095,347 *53A3DED9706BC44D18A5A1B92BDB5C35693EA364 darin.rossnagel
806,095,348 *53A5018792AD8296AED3B87EDE2C89CA69455616 darin.stellmacher
806,095,349 *53A33FA8272DFED1D8A26F75B23689E723327C8A darin.swearengen
806,095,350 *53A677F79C5D2CDBB2DC0EB62F5F9F01709D9B3D darin.wachsmuth
806,095,351 *53A5CF49323E75088561A2559BDBD17139AF9A35 dario123456
806,095,352 *53A3462A9B1D1A2525730951A03EAD580842CED1 Dario849
806,095,353 *53A6D1B3F71672B25D08F8CDC8FF1D5EFE3898A6 dario.bosse
806,095,354 *53A48E3CA930EAB09A422BF5610793A3BE37C603 dario.brach
806,095,355 *53AFDB746EDB773F77CC0A226B77AA1F48ADCC20 dario.chudzinski
806,095,356 *53AF6D04BACBA08EB85FC3BEDAEE07FC5AC97917 dario.fowles
806,095,357 *53A6A46F18F81BA96811E6F7EC8E8ECDC66E66DF dario.gadd
806,095,358 *53A2C50F3363B0887D76A59C77E9C5490EB6B55F dario.haines
806,095,359 *53A62A885B10916C37F1BF1FB7AEEE31B58B2AC4 dario.khu
806,095,360 *53A2707206095B8D6ED57D7260E641713E49FB00 dario.kohatsu
806,095,361 *53A5DF387B5B272F7591769CA89A039FCC88B111 darioledesma
806,095,362 *53AC0EF76BB385D5DD6F7F9BA358C927CADA1A11 dario.mansanares
806,095,363 *53A10214C9FA2D3F6009E78193A2B1A34C6987E5 dario.mis
806,095,364 *53A92D0D1BDA7CA436646401A0ABE97A26DFD2C6 dario.monagan
806,095,365 *53A61A4B3EB924F927A051C11B603C725FD7088D dario.sabella
806,095,366 *53AD921E9C637F5B1E688E4D415A56C6590B12AC dario.schatzle
806,095,367 *53A79156B3150C3274B3EA07E8AC2BE14FA769DD dario.schoefield
806,095,368 *53ABFE69B5567ECC26DFF472BE74AE6DDE66EADB dario.sroka
806,095,369 *53A123B079AAB834AB0BFCE994ECF662CB16274E dario.tomblin
806,095,370 *53ACC3560FE27131BD40396AC9DD0427787F5BCB dario.unick
806,095,371 *53AE8E61A9C26C09FA30E8C1D5720387C8D2C278 dario.valtierra
806,095,372 *53A3D06402C3A53458EDE0528645A44190E81080 dario.williston
806,095,373 *53A8D3BD6EEA59E68FE75598799B3A086AB9AD99 dario.yantis
806,095,374 *53A522571674570F4DADE3DDA873DE22CFA7D14F Darius311
806,095,375 *53A718ABF4B39859DABD7053CE5D1B9EC25C10D9 Darius630
806,095,376 *53AB27794BCF27A28A8A8E51E086F217AEFD8BBC darius.arenivar
806,095,377 *53AA26FB01F81EEF4E6AB8A1D04AA65D2E1563BC darius.baugh
806,095,378 *53A60380887BA5CAF64E3247F91F95B51AEAD634 darius.bozzell
806,095,379 *53AABDF594B3263C6757FD53B2647E0468E385C4 darius.burgbacher
806,095,380 *53A8DDA7AF892B1ABFB9EDD6D315988594932C91 darius.chynoweth
806,095,381 *53A3767C592F91DB0DE657DE8109A1F35AB11F61 darius.courtoy
806,095,382 *53A08FAA556522ABBA22435337D7C6666F394A93 darius.dacosta
806,095,383 *53AE0CFE1BB4E0340C9EC1877C2F7C2E3698B31B darius.degruy
806,095,384 *53A2DB14F5E7ADD786D01892A5A20E26E2585A39 darius de luna
806,095,385 *53AD5964F7C84636FB9EB8367BF53B341E20763E darius.dziekan
806,095,386 *53AAFF9B5CDF8847007E449A567A48491FE7B502 darius.gally
806,095,387 *53AD3F0F294BC28B626D81F8A55B8FC604AAAB2A darius.gandara
806,095,388 *53ABA0223FBF59D301510CEBAD645C5872818123 darius.gile
806,095,389 *53A1BF251909FE6B1F5188687E3B645CB9B275C4 darius.hoven
806,095,390 *53A37FEB4AFA9DA9EB74CC93A8704C9DA881E936 darius.jannise
806,095,391 *53A6634C9D9CD3D82AEC8E3BA2672BFA87154DAD darius.kington
806,095,392 *53AFCBC569D79B74E5A2FEB49B459C2E16FC1286 darius.macdougall
806,095,393 *53ABF3578549273B53B4B794CF0BF7F0A4DF4681 darius.oeder
806,095,394 *53A38DF3E6AB82F09C4D12AF175002BE2D60131C darius.prazenica
806,095,395 *53ADAFF6444E2BC6E018069DFFAC6EDEBF47F548 darius.renart
806,095,396 *53A67A78F3F667B4F33D9B7AA1FA0098829ECC5F darius.stoakley
806,095,397 *53A1FC0A3C830728CE67C175A6EE6E0AEBC6CF03 darius.wekenmann
806,095,398 *53A7E9077241FFDD72F4D838317207A166E63375 dariusz_stefaski
806,095,399 *53AE1C5D64081D34EEB1462913737DA6447B90FC Darizona1
806,095,400 *53A98811A2CFCE36CC93A14CDD44B28DFAA4E95D DAR#j
806,095,401 *53A72ABE7A327CFA2DEC1C34BA10B5CE4902F227 DARK11ES+
806,095,402 *53A9BA6640B2DE814DE06EB228D8A248AC0C76F9 DarkAlbum
806,095,403 *53AA3C901737CFB1AC04E70DA991245B3A4CFAFA DARKBUFFY1
806,095,404 *53A26E0FB9A252E109AA7AB4BA66F7B2B22E2573 d[email protected]
806,095,405 *53A26AD36AC03241BF91D568F51DF2CC2C67A570 [email protected]
806,095,406 *53A73F57942354A3203FC469AC8FA57405E474A5 darkehmener
806,095,407 *53A835A23EDEF710CC74ACFEF3426477D94178AD DarkGaucho
806,095,408 *53A1DA235E342D5DE8D07CF27CCEBFCA1BAC4DE6 Darkgreen2
806,095,409 *53A5AB4D9F023ADBBD7040ECDD851139FE220B18 DarkHeavensPartI
806,095,410 *53A01A8545AF847E60F1C54FFD2D24D0E3FDD0F2 dark$ide
806,095,411 *53A6E71AA738D67B0D35EB261B04C8A386748281 darkmaster93
806,095,412 *53ABE6FA03EE35572023CC8FEA6159EE5F2914AF darkness33214
806,095,413 *53A3780F8B0BD2E2AB389083E923069C6C5A66A5 darkness & satan
806,095,414 *53AE98B17198304EB76841140F724831ADAF58DD Darkness (Stromkern remix)
806,095,415 *53A976FB9E5B1EAA3D0F528F65A89C698EE6E3A1 darknight32189
806,095,416 *53A78DB2B65DED85F7D7D29F6EB578FDA1B6B681 DARKNIGHTBOY
806,095,417 *53A7ECD11A8044200634680825490D3C255F596D darko61
806,095,418 *53A4F1184B535EECDB06800582D16998E9C3055D DarkReo
806,095,419 *53A0A4C02C67F741FC4ADFDA3E85304A2EBB54CD Darkrides
806,095,420 *53AEE994E29FDDE9B90A713783B17CE38EF76E44 [email protected]
806,095,421 *53A58FEBFDC2E836B48226EB1C8E0216435AF1A7 darktom1
806,095,422 *53A70E6ADAD1E069FA7F23995F3B524F19436626 Darktown
806,095,423 *53AFBCDA638CB964E7A4F88F5BFCEBCFDF92CEF6 [email protected]
806,095,424 *53A35F104A1C11EED296DF83E748A1D1063A9482 darkwoodi
806,095,425 *53A73129DDF6672299DDCF8F34EE73A16DBADE4A DARKXTUBEZ
806,095,426 *53A147B24818C8F12CA23804760F4C995214DD70 Dar,L
806,095,427 *53A152DF6896F89DFCA1FF3F987B5738DE1FA6A5 DarlEen
806,095,428 *53AE48E698373518C5915DC094F9B65D667D64D5 darleenolson
806,095,429 *53AFB9A0487E153AD6910D4B8BB698C1CD73B34A darleens5
806,095,430 *53AFA5524BD79488E51043DFD8AC2AFB569F2861 darlenejoyce
806,095,431 *53ABBA2644E9EA3F5C50696BC5D6117E23AE8B98 darlene_quaife
806,095,432 *53AE91BCA86CA2F8C2D60D5391EFDC2C5868A3F4 Darlink7
806,095,433 *53AD014B09AD6D20B00505756BEBBC52C4DE9CAC darmadji madji
806,095,434 *53AA7D2D5C142CE343403C0A42DEDE511B783C16 DARMON12
806,095,435 *53ABCD12AD5094C20488163E84242FFCD2489DAE Darmstadcie
806,095,436 *53A78DB921347178B706E1C79FBE3623A5D02874 darnede7
806,095,437 *53A07F66632166C2CB5A57B066B60DD3D3C3789C darnell.birdsell
806,095,438 *53A52F57A49C3F207E215D69AEB030C50497B803 darnell.bisch
806,095,439 *53AFEB347747B5322FA1E7025317C3400F4E094D darnell.brandon
806,095,440 *53AA23684BCBD9066D3BD505B73182635D4965E1 darnell.burnet
806,095,441 *53A2454D29429B2F03C448D3E537904EB6DBE6AE darnell.cuch
806,095,442 *53A46277D1135B77BFB7E3E3AEFF21409580A4A6 darnell.duba
806,095,443 *53A8792379FC0C6DBB2127DBCCD0A23745AF004D darnell.ewell
806,095,444 *53A29D5F68396ADB29FD773579EA7193966DD964 darnell.gornto
806,095,445 *53AB5316EE34D0F224213F7443E8F20E4EB804C5 darnell.joesph
806,095,446 *53AF9258617706E43966C4D3EFA4EA431551E938 darnell.kalkbrenner
806,095,447 *53A80C4135FF9BFB366E47C7B0B9324CC92D267C darnell.mccathran
806,095,448 *53A546B21FAA4AFE3B30623D4850659DA2614B8D darnell.mcwalters
806,095,449 *53AA84F366590D1DCB9C9C94D984854D63065FB0 darnell.musel
806,095,450 *53AFFD02129DA8535A3FE58A77730DFB394FBB23 darnell.streater
806,095,451 *53A96106B10A542D9FD7591E383AA9770176AB23 darnell tomlin
806,095,452 *53A4E970C111D3B5BD085952662FF6D43CADF967 darnell.wittie
806,095,453 *53AB7CEA423B12B34F41A3F8D3E571E68263711D DaRogue
806,095,454 *53A5D5F8EF56AC3BB633D396FBD306E69B0C32C7 Darolihp8
806,095,455 *53AF90ADE5B0DD2C275C817195D4F0ADBE2FF7CA daron.capehart
806,095,456 *53A91E9B6A99FF3A4E1EE524AC2BE7AFE3739658 daron.centrone
806,095,457 *53A4F31D62E2314A1B1EC5844EF7BC1B1C4940F7 daron.copes
806,095,458 *53A352DE3EF2C063573A56B2D6274C4EFCF0725F daron.gay
806,095,459 *53A149CA6B6AC30A61E5CD16A4138154177CA06E daron.graise
806,095,460 *53A8FBDD850CE5892FB6BDEBFC3F4F64076E7933 daron.millon
806,095,461 *53A5F6250A3568BC644B1E40244BE8C3D25CEFA5 daron.muskett
806,095,462 *53A76A1E47468A6042357CC3B205AEE482BDEDEB daron.orellana
806,095,463 *53A28B5E1CC4F58D2220BAAFA0FF76A8C49B46B2 daron.parrigan
806,095,464 *53ACFD88503E5B8B39ECACBA3527ADBEB5F66BCE daron.pietrok
806,095,465 *53A2F53C61799D65B02A043947FE6EE4379090DF daron.pippert
806,095,466 *53A5A98ED5DAB5EE3BC6DD0B7D7A5D47B8E2B27A daron.pound
806,095,467 *53A2EAE0FDA7E91CA3A848058ACB7845AD320CBE daron.steib
806,095,468 *53A140E9A6CAAC57743DB0C908B8E3D6A332C76F daron.tegeler
806,095,469 *53A649F4023FDA97856EB6BF98979B3FF7B58596 daron.try
806,095,470 *53ADF08DF291C9551A2CE82F5E71EDAE86D91935 daroslav6
806,095,471 *53A2D344309AD2520ABCF259F44F99DBFF4F3AA6 darovito
806,095,472 *53AA31C7840BEB985EC3E3B4E5BE54F4D0C328E0 DARQE
806,095,473 *53A2124DA28DE6D2F46F5BC1CAC00FE9E21F0CB0 DARQUISE1
806,095,474 *53A40877A00EF157AE2DAA6BB8C6C68834B2898E darraghfarrelly
806,095,475 *53A3895C41F71A6284A20062D8982D26A17AEC75 DARREHKHOSHKAK
806,095,476 *53ABFF8014BAD7C76E8BC5F152D226AC9769B7A6 darrel.aamot
806,095,477 *53AB818DDBA3AF04C0A672572AB541ADB2F11C56 darrel.amailla
806,095,478 *53A7012F2741A549303495D2016CF2A60139D4D8 darrel.bares
806,095,479 *53A9FF937F89977E53B0D96DE4144369A071FA2A darrel.condi
806,095,480 *53ADFBA22BE7E1294116D5A86775CA37101AC7C4 darrel.dajani
806,095,481 *53A73CB00F91C386CC3CF8F070B2E47D45F3026F darrel.dewitt
806,095,482 *53A92C5A9EE320761F287E0D1226F303FBB2B922 darrel.ferran
806,095,483 *53A8076E87666E9789C81E7ADA06698020310542 darrel.granstaff
806,095,484 *53A9EA8E6EA2CB020753209E654C23153ADD97E9 darrel.guevin
806,095,485 *53A5E060D40225C75122F319816F9BBC5235DB4A darrel.homza
806,095,486 *53A57396409BF480DFA879D3309DA793E024EDA7 darrel.keisker
806,095,487 *53A5CF366CCD50C55E6667CB59566F99B4CB5B1F darrel.kuretich
806,095,488 *53A3A3EC6178BD4F7926CC1C04CABFB66696C88F darrell.abdi
806,095,489 *53A63C8ED967A198A7605EFEFB2425763F2FDDF5 darrell.blakesley
806,095,490 *53A25A5375DF8CDF2EBF270D6A67645DD93AC5A1 darrell.boudreaux
806,095,491 *53AF3930F786433FC43710B06E2C7506106C42B8 darrell.bouyea
806,095,492 *53ABDC8C77BFF7312D883674077EA0E6CF496F34 darrell.brackelsberg
806,095,493 *53AAE5BEC73FC5647D94AE2EF986C53E8A2AA9D1 darrell.carretero
806,095,494 *53AA170548786F1F7A24D66AC45C9CE3A822A8FB darrell deakle
806,095,495 *53A02EF8291257985F19C30AA011066FF960BCD6 darrell.elke
806,095,496 *53A7A66791648E45943EBD7F99F6C605429FDF05 darrellev5
806,095,497 *53ABBC053801C4BDCE791183B2D1CF515ADA28C9 darrell.farlee
806,095,498 *53AE985C5FC37822E206BD727EF48AA4211EF6D3 darrell.harison
806,095,499 *53A55B00BDB08AC0784662BD9CD8E7A580A13860 darrell.lam
806,095,500 *53A817B5BD07FA2F7372586E7ED3093AD3E14ED6 darrell.magnifico
806,095,501 *53A5BD686875CED3C42892BD7B9A9436E4F39553 darrell.mcdaid
806,095,502 *53A84325049D5AAC9E3E9A5FE38DC28D5C232777 darrell.mckray
806,095,503 *53AB09E9B58BF0A58E740446A154C40AADDA21A5 darrell.millender
806,095,504 *53AE3A9B762E54EDD9C5559C52C5204D72920FA3 darrell.montayes
806,095,505 *53A9A6D27315B400FF355A33BF25C0C36BB7C996 darrell.murel
806,095,506 *53A6684AE027417D0745340DD36E82357778B9AE darrell.petrin
806,095,507 *53AD59056EA196DB29816F4DE86C7D1E372D3639 darrell.petti
806,095,508 *53A3CA74A51E677718DF12FD5E494D64442F15C3 darrell.popham
806,095,509 *53AD4AD81BE95C20B7171C089F4D4414DAA72537 darrellquinn
806,095,510 *53A2611F71D850849C46012004DEB058B2904335 darrell.raynolds
806,095,511 *53AB430BF64A84B829E7327D21F344F15A04F733 darrellroach
806,095,512 *53A50F5CEE8A61EC05DB9D5E927B18E40BEA9E6C darrell.scarver
806,095,513 *53A0A22FE304D14156826469230F71889A8C6D44 darrell.swancutt
806,095,514 *53A47FAFA01BB79DE0945F34A2B9670DCB74C6CD darrell.yray
806,095,515 *53A39C30C92272D2E932FCF1575A298A603FF21B darrel.mitsch
806,095,516 *53A522E9C6A4DEDF031C23A91DD3AD0BC5F399E6 darrel.paylor
806,095,517 *53A7864C2FB2B6E0DF75D6161D005AAFF38E92CF darrel.privateer
806,095,518 *53AB3F46AB12B991023EA3D3B757F3BBC6728C57 darrel.raimondi
806,095,519 *53ACF368D3962A455467684319D38CCC100027C4 darrel.reas
806,095,520 *53A9709708F3099E33522890941E4BDC49578053 darrel.rood
806,095,521 *53A8D8E3D18BAD297F83B857E5FD87EC31AE3F7D darrel.suders
806,095,522 *53AC9F8484BC3BCE60B440B7D8437851B928B2AE darrel.trunnell
806,095,523 *53A9A78766D61B4062430B44F77B92CBE3595AD5 darrel.trussell
806,095,524 *53AFE7713686E5EB47F6B45F47FE00849F28E92B darrel.vafiadis
806,095,525 *53A993A836E6425443BA1F22E030CE27876B7416 darrel.westrick
806,095,526 *53A4DC53EB20125A5979BCFA9AC7E1B0620FD80F darrenavery
806,095,527 *53ACC16275E83195699896513FF7D07374C7BC76 darren.baltzer
806,095,528 *53ADBEA2F2EA4C3CC52DAD5FA5EBF1F5E2AF11FF darren.bizarro
806,095,529 *53A9711FA1A86C5AA7BBA9711EE46A4C8752EC43 darren.bunda
806,095,530 *53A428F3FC5E13D370726A2FF8792DBF7F282C9D darren.burnes
806,095,531 *53A2708B71EBF62A11405FE7BA779B51E9E3B57E darrencatt
806,095,532 *53A79C0E989AF2D9BDD90434A98BF1C77AE1E296 darren.culbertson
806,095,533 *53AB2B001397B5C794C5BF496371AAE71C6A40E0 darren.derider
806,095,534 *53A2A155DDEA8D29D2D29C4421E869C34CE9E3FD darren.figge
806,095,535 *53A610879126C40914BCAB268E1F705AC914BD8F darren finley
806,095,536 *53A8D1C1B2B1060186FD9397DB419213E1443975 darren.fullmore
806,095,537 *53A76F784A591271EDC2EF4DDB1AF30DC1AC9216 darren.gilliland
806,095,538 *53A787E5890779E93484C1E2520743053E7AC09D darren.gotta
806,095,539 *53AE06C5C88988B6D4DAAED2C0BF1C77207DA2D3 darren hopper
806,095,540 *53AF4AADC1C6A621B4B49294E7E8F1B673233562 darren.howison
806,095,541 *53A411769962BFD74282CA3BCC19DC955BB596A0 darren.langham
806,095,542 *53AB7AA437D300D206C8E32F5C2C8A1E4DCDE3D3 darren.lyall
806,095,543 *53A0728162F21372D4597DE38870B55A711E9161 darrenmacgregor
806,095,544 *53A03B6798D557FAC47C03F2D554A163FEE987B8 darren mcdermott
806,095,545 *53A86D2BF672E6904952F662A6F17745E7F12B7A darrennichols
806,095,546 *53A44D87A40A787408689DA039222117BB5F56EB darren.olgvin
806,095,547 *53A4B5D6ACA007940D0C574E74045A997DB90DEF darrensarson
806,095,548 *53A3DF2C98348802AB7941208437C597AF832ED2 darren.seawood
806,095,549 *53A0EEA61860A2AAEDC4C9AFA44583E1E269939B darren.stinnette
806,095,550 *53A9ED1160BAFF3F7A972498A4AD37AD31F74CA1 darrentempleton
806,095,551 *53A396FC6E98FAD963B3691275B2CF3802DBF0C9 darren.troglin
806,095,552 *53AD5D437E27D33A325FFF1A219A84D08874A62F darren.vilaro
806,095,553 *53A420F08F17C2328D8D8A3269D525EC2D7D4AF2 Darrenwebster
806,095,554 *53AE6FBB9350480B533C571857B6C59892A1B258 darrick.bonde
806,095,555 *53A82EB5362E202D6CA3B72030C7BE23C248E185 darrick.eismont
806,095,556 *53A1366CA1166EB654F72774CC1EA079B40FD580 darrick.gerlock
806,095,557 *53AE4A06983D14410A57605894E1ED049D1B574F darrick.gochie
806,095,558 *53A52E1690E68DD85D9EAAFBFE3FCF39FF4D215C darrick.guice
806,095,559 *53A1C889B6DA2E6C0ADE35AA62F3A8F03AE8671E darrick.gutterrez
806,095,560 *53A7DDC1FB3D36354575B9751EF9154E8B6E5093 darrick.kanan
806,095,561 *53AFC17F5DC627BECFEF18CC94D1A660B3DE2782 darrick.khang
806,095,562 *53A493659F08E777D51CA1B74E8EF60443CD32C6 darrick.loften
806,095,563 *53A5601C8E0D800E7D35E47429665BD37C864C02 darrick.marn
806,095,564 *53AA0C6802AF290F2EDA2B180F17D28A444C9A47 darrick.najjar
806,095,565 *53A39376AA5B934429EB9D8A363F6E429FA5D30C darrick.nobles
806,095,566 *53A3ABB7F37AC1F979D0C2F83060228803B5EEFC darrick.poles
806,095,567 *53A04B49E3920CC2A99CC77FB44334D8A01D359D darrick.schleifer
806,095,568 *53A7EDBF5F5E70D45AB71082787E6776B3EBD0D2 darrick.sero
806,095,569 *53AFE8B3A1D16EED20D78C3F9CC8A661608C95A6 darrick.simpers
806,095,570 *53A969C112AC2FAB2A2FFBBC53F4699078473E2E darrick.snetsinger
806,095,571 *53A1E32C3D89D7A3F5172A87E2099A7CB9C5583B darrick.turturo
806,095,572 *53AA8C3B38CCD3A7A0B49E0A964FBB65B9786BF7 darrick.vandergraph
806,095,573 *53A4747AA81EC906258AE9053DB5FB480BB37BD4 darrick.verrilli
806,095,574 *53A596C4104AAD7EDE27EE2F72F0A42A7F1CDCDB darrick.waisanen
806,095,575 *53A183DA1A74AD2A14C944F3417B6E80E0AF17A4 darrick.wosher
806,095,576 *53A43B340387C7707D1420CF549FABEF6CA4715A darriel johnson
806,095,577 *53A11E10E25EA77FD630199FFE8ACB45C2344E6F darrin.aardema
806,095,578 *53AE7234A3EC7D445D294E90D607A9C01F13018A darrin.alpizar
806,095,579 *53ABB2BDA1BF69C273819EB5946E0007213E4398 darrin.annino
806,095,580 *53AB055B139C50F7992F65D43DC0468E2147D4AD darrin.bradberry
806,095,581 *53AB4CF35BDA9F515B18EE9DF7BDE44AE615877A darrin.chiaro
806,095,582 *53AC92EEAC66E5306EA847F11A0368140F814247 darrin.kost
806,095,583 *53A7647C83469DF2F37773340E9E40817D81E4B9 darrin.kuykendoll
806,095,584 *53A43DA963551535A8D2C0DBF10DD9061827BBA6 darrin.luskey
806,095,585 *53A03D6DC9E37D3F92D892CCB79A904E082CDBAE darrin.mashall
806,095,586 *53A6CDDF85A541A52417E08E9B492EFB6E2CD211 darrin.nokken
806,095,587 *53A4B7E462A32A8C157CD0ECDB6DD69C782647AD darrin.salvature
806,095,588 *53AA7052B5DDDF6C5E5A2400D35AEF67D2715746 darrin.sovey
806,095,589 *53AC5B7877EEBA42078B4D6B0D0C5CAB7B1F03D8 darrin.steindorf
806,095,590 *53A6F21AC7E4766CAF11900FAE7935AE6E7EBD7E darrin.vagle
806,095,591 *53AC87537E0935F954666FD2DC4816B96D3A8493 darrin.yamanaka
806,095,592 *53A88C5AA9F176EEF460A1A9B29CEF2ECEF9D83C darron.alvero
806,095,593 *53A59F221911EC8739A4B3708B6B73356F173B63 darron.bailard
806,095,594 *53A912E84B4BEFDB9D979624A985E9179ED30083 darron.cusenza
806,095,595 *53AC3FDDE0C782EF61F4EF7409E7E42965898742 darron.datta
806,095,596 *53A94059894A117BCD610DBB044B71A1E9CDF110 darron.duchaine
806,095,597 *53AED211464C42CD8A0D5E1D342AF1357392A38B darron.fowlie
806,095,598 *53A99986A122346FA7C5301DFC860A32C42CA0DA darron.guida
806,095,599 *53A71922DAE6CAEB0A4CBEB90106B9FC32435A6A darron.henfling
806,095,600 *53ABCA5027B0EF99175F821B62271BA1D46438D4 darron.hoder
806,095,601 *53AAD0F39A0C30BBA5E16C0F15DA882D7834ED09 [email protected]
806,095,602 *53A8D6AA20A030A9BAE7EBC0577B1E0159F9D5DD darron.lascurain
806,095,603 *53A7517CFBB068CA4A5028EF3BC0AB69179E41A2 darron.massaquoi
806,095,604 *53A4D988F09E041C4230E30427F159B30841092D darron.medoza
806,095,605 *53A09FD9F043CCE73C9922CA2D1CFB438F1EB02A darron.peiper
806,095,606 *53A214EA694733586C54274DE72D02463D5AFC31 darron.piskel
806,095,607 *53AE20B223873352A8E29196E3EBC8C08CBC7A12 darron.pottier
806,095,608 *53A79F79D2C8DB585FCE26DCD6DAD8747690712D darron.prouse
806,095,609 *53AA3B6237B9A6B8FBF23964E3CE3FBE7C396A85 darron.pudlinski
806,095,610 *53A24B5A6F49A55672B055C3CA6328E4B4821ED0 darron.rodemoyer
806,095,611 *53A55DEECC8ACF1986AFAC63167E805391440A30 darron.sanda
806,095,612 *53A08AF5AFD402D3EF0E77095348089676C8A5D7 darron.spataro
806,095,613 *53AD8F699FB9CC2878D6B2C4D7470D2694305014 darron.toupin
806,095,614 *53A3E3122140F6062D60C651A8AED54E6680F915 darron.wachtler
806,095,615 *53AFAA78F952D90F64083B5ABE20E4977FEA2BBC darry early
806,095,616 *53A98BF0A8C4067E955AB3E6E2E9039B98D299DD darryl.benberry
806,095,617 *53A37250A12ED8C94003FA9607C095245D08E248 darryl.bloise
806,095,618 *53AA0D9470992A20A5BEC4345102DB7203F3385A darryl.brisson
806,095,619 *53A3E2F583D650320348AD51E0DFD40568E7E14A darryl brook
806,095,620 *53AE27F92CA06F54703B580D2501AEA376209DF5 darryl.elzinga
806,095,621 *53A3EFDF9B6AD94077A827A5A59EC1A7D896F3C8 darryl.gutoski
806,095,622 *53A25B57001A77E6B80602A306157880450B130E darryl.harns
806,095,623 *53A6A851032C7F55468FBF0705795F84E8C76B51 darryl.heppeard
806,095,624 *53ABAC067D578CED94B7003B7D10CE0A5198049B darryl.hodgdon
806,095,625 *53A0930F1EB509BA2FDD6E0EBFB6E7EC3DDBB839 darryl.karlovich
806,095,626 *53AF8793426D7AB040D86821CE8D35C529BFA237 darryl keller
806,095,627 *53ACEE429247C4FB2DB36C7FECC21E8A39E007E7 darryl.lana
806,095,628 *53AB8D67D97C8D37FB073D31FF6368297C94C220 darryl.langarica
806,095,629 *53A18FBCC06276E6372029EA4C49D72CDB107676 darryl.morise
806,095,630 *53A4CCEE7326990C4F3D604EB9DD8A6C404E69DA darryl.mudrick
806,095,631 *53A220D4C91DD918CBA3C1141647F61F7580CDF3 darryl.presswood
806,095,632 *53A558E873ED86937B3B4E383F8A9C3974DBFDCA darryl.ramdeo
806,095,633 *53ABDF8FF6C2EA9B8CB9B7033E1A43137F5FF623 darryl.sudbury
806,095,634 *53A2CA672E55DAF6879DDF834269402780DF1B2B darryl.trichell
806,095,635 *53A807FA7AE3E69D2A49966D107F9DBCEC85398E darryl.ty
806,095,636 *53AE3D00D2FA0439AD81D6F11206BF0FB6EFC7A7 darryl.urquides
806,095,637 *53AF6545F4D3BC066B0E6E52D5DC4709BD5A8358 darryl.yeisley
806,095,638 *53A607EE4C1D625B52760A5D27C019ADD4105FA7 darryl.yovanovich
806,095,639 *53AA10C2A2285978BC8FA277A18935EFAD1687C2 darshan tamboli
806,095,640 *53AE6A70DF59B1B02AA91782FC5EEBEFE0C2FAD3 darshhii3
806,095,641 *53A38C9424C82E3F6CD0ADB1028BD7A0F2C5878F dartchaillychampmart
806,095,642 *53AE32AB1E7DB714780E051275F0072C9C466BDB darterretrad
806,095,643 *53A63C03A7AD6A88F0C7F99D91102C4ED9C52B14 Darthmau2
806,095,644 *53AEB6C1F16FAD605DA653196A2E01CD4952E1C5 [email protected]
806,095,645 *53A0140C3AEB4A11BFA9B918614DD566AF915BBC darübergezeichnet
806,095,646 *53A6CCC9FE4B81B57624396EFD4B1CA36FDD5BE7 daruntergelegenem
806,095,647 *53A4F0BA9E42D97BFFFAA8BF38BF5FFC6B2AD167 D"ARV
806,095,648 *53A6B66459E2364C5C1A378B7D86ACC9442AA8A8 Dar#v
806,095,649 *53AD59D463441B45613EA2C5FFEE9EBF2F6E3CE7 darvin gonzalez
806,095,650 *53A4A4ECB8AEE63E09978E7E5B146559994656DF DARw$
806,095,651 *53A68946000D91461C07AA1CED1A9DB1FBA3D8FD Darwin129
806,095,652 *53AA3D4221FF6FEACD5236F533634D6F19E6E915 darwin.baster
806,095,653 *53AE68CDD398E4DA074BBAAC97FD78463E4D64FC darwin.conlan
806,095,654 *53ABCC7FC7F2896B52A776F667DBA84F0234FFB9 darwin.coup
806,095,655 *53A8AE0D34C281D03A18CDD3FA7B370E701D8FF3 darwin.cuddy
806,095,656 *53A4666E1439F66D469A629E345B28B7BFA7CACD darwin.deyoe
806,095,657 *53A2E1FAD2A2F0B22A3BBB279EE0A3D9DA19C2EC darwin.dold
806,095,658 *53A4F14B84B1AD7AA29CC952B09177DC9309168D darwin.fellinger
806,095,659 *53AF65DBA14EE19DC85064AE892795F104EE7737 darwin.fulco
806,095,660 *53A1742121D30018157643634268569CBE1D9966 darwin.hosterman
806,095,661 *53A54DD228C8C127F05C4776D66B8024328A946B darwin.labarba
806,095,662 *53A307D0B9340BDE0AA09056ECB6C700EC99FF18 darwin.mccarrick
806,095,663 *53A7D053B2CA949F75F7DB5D532FC65AD329BA94 darwin.mcilvain
806,095,664 *53ABB4789AF3C707618C79BBC1B8436450874794 darwin.merickel
806,095,665 *53AEB79863903C13DEFB8E5DF4CF8ABC432428F8 darwin.nuon
806,095,666 *53ACDBD12D6B05A9171D58A0872636A6BF5EDDF5 darwin.obermeier
806,095,667 *53A5085E1E9F5CE4A342BB27D884F299B3B84954 darwinquartzsupport
806,095,668 *53AA259D5C5A4AB7E59F367086B495FE093BB3B6 Darwinsam3
806,095,669 *53ABF44384E4E8854E1129F1E311ECDEC4178CCC darwin.sotomayor
806,095,670 *53AC2F7C3D4B2E89B250A03F9324E5855F28237A darwinspet.comwww
806,095,671 *53AD089E2C33329E8DAAFCB93C25E326337CE295 darwin.syverson
806,095,672 *53ADE2F72AB4D1CFBA582BCC048FE655F23858C5 darwin.thornburgh
806,095,673 *53AA95129C5BE183491294ED62A81D8EF166EC40 darwin.zerko
806,095,674 *53AD456D3C410B7A61338C06D506FC7FB5219774 darydavusioms
806,095,675 *53ACD36CA0607F614F9E7954BAD21ADB9D057D61 daryl.bandin
806,095,676 *53A3E87D6E5EA368D91B800EEBB1152B57CD79DC daryl.celis
806,095,677 *53A72A91548E049A7EA184EA7D5E2D38D8DA3A8F daryl.chernosky
806,095,678 *53AA400AFE1990476F481A7FD25362696568A2C1 daryl.chivers
806,095,679 *53AEE9DA40215296081E94B385C0014370205D79 daryl.creary
806,095,680 *53ACCAA424A9FC2CD1387D3895EF843B49360B6E daryl.cunard
806,095,681 *53AEA4A0DD090AB2C3CF4683EA263F871652219B daryl.gurley
806,095,682 *53AE143EAA2E4667CBB2BF055E7950D392D29702 daryl.huddleson
806,095,683 *53AFBC8DC7C5E789E56068655A65645DA891D4DF daryl.kolden
806,095,684 *53AD26451305C2AA7FE094F70C4889E36C3DAFA5 daryl.laino
806,095,685 *53A5A987C2E5E0E49F4E0409F57EE0255312ED7C daryl.linebaugh
806,095,686 *53AB312EB651859FD6B0AF0036119AD1A04296D2 daryl.lutman
806,095,687 *53ACA902E4D4A2BA746B0453EA17DD9983FB1FD6 daryl.mcmanus
806,095,688 *53AAD924190003DE3F944BFEBFA3747B83A99DDC daryl.methvin
806,095,689 *53AF03D0E13F67A7EED4B6A94E44C491B13AB2BA daryl.obrecht
806,095,690 *53A593C4564C959C19D67836C823C5DFCDAD0AF8 daryl.quesinberry
806,095,691 *53AB10868443EF51C707FA37D4912E6A21422AE4 daryl.schlaht
806,095,692 *53A4450D856903A2BD3ABEEB227FBD4B78B00A7F daryl.skagen
806,095,693 *53AA52F976552BA6D9DBABF011061CFAC7004EB1 daryl.sleek
806,095,694 *53AF4B377AA7D0E9D318F84AF83998C5B78280B5 daryl.suyama
806,095,695 *53AA5F4EE5092D87ED6B9F583D92C2A04588A4AF daryl.vangerbig
806,095,696 *53ACCFEC0828685F53A4453285D1CDCB16D9323F daryl.vermeer
806,095,697 *53A283E5F79D2A6CA5AD42069DA3975459B3841B D;.AS
806,095,698 *53A8A885382FCCB5F0BD5D5A5B8C4D3590831B40 DA?S:
806,095,699 *53AE1E272BB220D7B18188A86E6A50B28101C294 DA+&S
806,095,700 *53A19D24366863F80A06869CF4E194BD14D4B2FE DA
806,095,701 *53AA8ED6ABF050F3128A4F7C0D57BEE3D0AB8E49 DAs6l
806,095,702 *53AF98FFC64E5CB793C9DE2109C2B67774BA8928 D&AS9
806,095,703 *53A3D44C19D615D403B800C45EDD77005F49A967 Da
806,095,704 *53A0CD03107D90969B0212C1E23ED89B8BAED6D9 DAS9m
806,095,705 *53AD5D564579D5B3CF95CF9B137AF62B8F040FAB dasaṃ
806,095,706 *53A4AE02ADD6DA154802D82F02BB0D5EB783E9B7 daśasāhasrikā
806,095,707 *53A0F07DCE4988B8B324F102F8AEF2AAF452AC7D DASBESTEAUSGOTTESLIMITEDALBUMCOVER
806,095,708 *53A2270A6DEB5B54313E920A1CE0C93777E9EC35 dasbuchdergespenster1
806,095,709 *53A8AAF82233041CBEA1C3F948F5CED712A588A8 DASCH3
806,095,710 *53A755CACAC631702AB985E9F9F93B408A537E61 Dascildaed
806,095,711 *53A3C90EA4F1C528BD0D5BA5B629C30C398CDA5C DASCn
806,095,712 *53A3B72143E8A793B6DBC0F9E289ECEAE87A9504 "das duale system"
806,095,713 *53AE54E52EB6E75E8C39E10C776FB8D50B297048 Das dunkle Exil (2)
806,095,714 *53A3C3F344ABDACA99E0E151DB97BABC7A64DC52 D*ASE6KA
806,095,715 *53AE24B29F003A39E94F59C84C09B201DF52CD28 DASEANLU1
806,095,716 *53A281C8D07980F2F99F2C9B069C83D4C07A2B85 daseinserscheinungen
806,095,717 *53A2A88467E9BD313B1A2E14D9A34FBDDEB08689 dasendedesherrnb.
806,095,718 *53A580EFBC967F16B71D80A5BE691715AC876223 Daserstemal
806,095,719 *53A948BEA67D1A9220F7C272B39AACB7E13E4B68 dasha4ever
806,095,720 *53A69DCCE88618B65CB7B2C9231D817BA870C519 dashadenver
806,095,721 *53A58E121B9B87555172445D02E4AE0D28E54D40 Dashafun9
806,095,722 *53A30CAB493B3DC0D7630EF084E64252B837F9B6 Dasharatah
806,095,723 *53A6997EB8E87ECCE585A3F6FEFB09790C54A2A9 dashaundar1
806,095,724 *53A7B3472D081F534503EE1E99918A49302B2DE1 dashawn119
806,095,725 *53A24BAC2C887D500DF94D8E9344891EBF862967 [email protected]
806,095,726 *53ACD261F490AA3E16FC335547B4E5340FFC3A31 DASHO-JAVA-OBFUSCATOR
806,095,727 *53AF7438A57A35F2E68C1E3FEA11437312F205D5 DASH結成のきっかけは、TANAMANがGONGONをバンドに誘ったことから始まる。
806,095,728 *53A91603A2BFDC6CA6EB2A2FBAA420606D8A2010 Das ist absurd! Das ist absurd!' ([[w:German language|German]])
806,095,729 *53AED9939DEC925D8DDBD6F5924A31F80083B01E DASJON
806,095,730 *53ADA4C3A42F729CEFD218561195572B49B69390 DaSk5
806,095,731 *53A80E70A3EBA3678164B9C885BDA19E62B56606 DA(SL
806,095,732 *53A3D5FFD02D65EC3FDC7CE83E638C08139341DE daslochuntermdach
806,095,733 *53ACA3B9A4622CF229A44943A894FC9F3EAFA8D3 DAsoa
806,095,734 *53A20CF913580F19452FBD0121C5678FCCC55349 Dasonda0
806,095,735 *53A12C5124DB91A286BCB30380E6D9DEACD37C13 DaSQb
806,095,736 *53A620CCA54BC58ADD3CC2617C3EB32C966AAAB5 DA'''SS
806,095,737 *53A3E2BF44382EC59D9A5EBEA73A4F0041615831 dasshoku9
806,095,738 *53AC7016A071D0FF4A218635FBABE02559E123AA dassichdichliebe-wasgehtesdichan?
806,095,739 *53AE2A1B7D011A60DFC333280E6CCD1FB1C80CE1 dasteam
806,095,740 *53A50B5C85AB0EB4F7D0E4E95B83DE55E19F396B Dastigering
806,095,741 *53A90C60FB2C82F9A730B813FC2513423E4A1B8F Dasuchin9
806,095,742 *53A937096D62CF1C68C529547B906FCF0FE47447 DASZKOWICZ
806,095,743 *53AB4872533B694F965514218C3D2E9E4B50730E D+a)T
806,095,744 *53AA391C8F70602A11CBBB8F6111DEF8A83C20C6 Da+:T
806,095,745 *53A17211053A7CBBCEE0EB5AE3E05E8564AE351C D)at"
806,095,746 *53AA91DAD244B93D7A4ECF287DE0874B4F6FDBF0 Dat<
806,095,747 *53A3DA57E19003E2EF616D805945AADCC8E52E5B Dat22
806,095,748 *53A99DBF60BA9D6AAEAA250A38D651748B1166E9 DaT-5
806,095,749 *53AB864BA75A53630E4DFF139EFAFABAA6CFC0E9 Data142
806,095,750 *53AE92B9FB5860836913CCD44E5D629538B40839 databaseinstance
806,095,751 *53AA1521553E95AC4DB8BB438F0F304DF159A177 DATABASEKOKO
806,095,752 *53A56AA8F881B0DB7A99FCA292E81C488EFBFCA9 data
806,095,753 *53A87ECB3E7A7040A5ADE429811CB036510BBE9D [email protected]
806,095,754 *53AE87C76A53E5512E30AF269970CD85F5572CAE DATADELEN
806,095,755 *53A19085D61C782A113FAE9EA868249E9A0F4052 dataeast6
806,095,756 *53A5511DE11C7D4A9C1CA00170CE205967427A2E data
806,095,757 *53A9126786CF2670467FF83089A0A9DB46905483 datajackBSW
806,095,758 *53A47D2B458A979A7F90AF88D6ECDD5367570ECA Datakopis3
806,095,759 *53AB30E5C90B9BE047F7A17929BCA0D485822AD2 Datallers5
806,095,760 *53A72F216851B1746A423A96A822F171CBBB7DC3 Dataoper7
806,095,761 *53AD37B24D2D227E56F33AEEF9BCCB2FC198F5F8 dataoverføringskapasitet
806,095,762 *53A1F019DA5EC6EE1541AEF07F9F14675E113B97 Datasaet?
806,095,763 *53A7A5756DCF3E662AA54562064168F70B8D8885 Datasets4
806,095,764 *53A0CEBBA93F92E0E1C8D0B635C984BE0F908202 DATASHEET-EN
806,095,765 *53A53EDBA786826DF3027ED594DDD6A655BB5430 DatatoDate
806,095,766 *53A69847F9E0CA7D2E0FE605C7F8558FC12F0735 datavo4
806,095,767 *53AC06AE3E42AED50335D13CA9FD1CFF1CB3BE08 DATBANGA
806,095,768 *53A2EF191DC500D45EC682D0A9060EA6FDF08780 DAt/e
806,095,769 *53AC553F7F51D8B080E3D039E2AE95662C35D7D5 date13-3-2008
806,095,770 *53AC1B639416B1649A6D81D5B32B46577067D136 date196999
806,095,771 *53A9218C9C46166E746279E69E6707CA34909144 date2007.1013
806,095,772 *53ABFBBC7F2B554D0580F6B7B91F1FDAE1CE7C6A date25152007
806,095,773 *53AC600D9F315F14C34CD2C0051D46979336DE9D date31dec2003
806,095,774 *53AEBAA6855E41D8CBD2A307B4602BF9C0FB7741 Datea8le
806,095,775 *53A4FD6A1717B0DD3CE03A6C112F074F91AA2F86 Datenaufbereiter
806,095,776 *53A46CEA932084551CACD6627F398F84A47C98A4 datenban3
806,095,777 *53A2F2F13E14EB8614D5BFAB5D333820B38DA704 Datenbankfehlernummer
806,095,778 *53ACBBD8FFB2430A6C7EE2E6E2C68ED79986DF70 D'ATENEO
806,095,779 *53ADC7D9ACB3F6F0A9BFAC4938E75E70C6AC3B92 datenfil5
806,095,780 *53A6B28E34E31D173DF7BC689E9B2264F66A129F datenformat3
806,095,781 *53A049D1E9BE87EBEE3C9FE758C0D7ABF0B9477A datenkas4
806,095,782 *53A92950E657A08148F742CDD376AC799503DA9C [email protected]
806,095,783 *53A7A73EA5C2CC1D6A7327321D5C8E88F541EE1C Daterest7
806,095,784 *53A7F90768D193A7B51C305BA08FCAD34F251A72 DATF.
806,095,785 *53A650B8F923D3866C5BCF0732E6EB65B1A9D26B Dathema4
806,095,786 *53A83A0632604C3BD5F8040F4B30CBFE215D9C6C datid3r
806,095,787 *53A495F2CC645277071173D44FB8B0B089831238 DATIERTES
806,095,788 *53A7D732EDA30BEEA278E7777E8CADA7E150491F datinfor1234
806,095,789 *53A119CD3695373C9F5307EDD8E31F35EB32F914 DaTK0
806,095,790 *53AC0C9D2BD641D5A8C4ED081296344789A3C0C1 Datmui
806,095,791 *53AF44B6809794BBE0DB90A4DCDB1D7325FC463D Datolinie3
806,095,792 *53A1041DE33106420503F7C2EFEC36820FB77856 datsier2
806,095,793 *53AAC5825412F8843D4E74447F4D96A24F0424EE Datssleds
806,095,794 *53A2959084678B5351ADC523ED3B3EEC990CA92A DATTA265
806,095,795 *53A187D0462C355DEC045C8E0767BC623AF1C8D1 dattaad0
806,095,796 *53ABFAC292FC0B761152729C287196EB2886B773 DAtu#
806,095,797 *53A54DDB979D019EFD0A88FB04BB355FEC2CEC92 DatUA
806,095,798 *53A23C80B66B6833BFC74F5761E4849B271E139A Datumsaagabe
806,095,799 *53A68B976F93303C217674DE20574F82629F3E03 Da"_U
806,095,800 *53A528A4D072369FF481A4343F3D60CEFD447D6B DaU)1
806,095,801 *53A1AE460365D9327FFA5C50CBAF19CEBC4691DD D+Au4
806,095,802 *53A90A9467E9FC480C2CBEC47ECEB7543A16CC08 DA!u5
806,095,803 *53AA9413CB036E93C50974E1C4765F16D35776FE Dau6Z
806,095,804 *53A9992C40D5DD0D61D4D8839111C45946CAC11E DAu9c
806,095,805 *53A0E0F8880BF8D42557D3928B871F5254E387CC Da)Ua
806,095,806 *53AF137E9A87D581CD39CF7F4C6A50A03B518718 daubariùs
806,095,807 *53AA20E78F0F0D7E1332FE9D87CBA8CE19DFE12C daubeny1
806,095,808 *53A982793678EDBF1246C578D881B1F4EA70202D daubervalphilippe
806,095,809 *53AFF87C595FD840651A430398805D3250ECC309 daubies8
806,095,810 *53AD61EE8BD7656E00E7154EDA53478F22EBF7D0 daubsums
806,095,811 *53AB0A11A38E9F9B2222CEE1FD8BB9D0691C330B D,auC
806,095,812 *53A5DBCEFFAA6D02501BABF59250D82C2628B111 Daudin,1803
806,095,813 *53A474B87A04E7A94180AA3C859636288132B853 Dauerbswing
806,095,814 *53AC4DB02B152AAB153FA0162BFB0C5A7E002F72 daugiamiačių
806,095,815 *53A19B4C3C13F991E2CBF661D4FC66E9859FAF5B daugkartinio
806,095,816 *53A9B923F2E2E456C5CF7D2C7EC5E4C3B79A975E DAuI8
806,095,817 *53A7B02CEC7D0A818B0014B81C3ADDD1B5D36144 Da"uk
806,095,818 *53A0AB240101665F71F4165C3958C8231A10F5DC Daunelles
806,095,819 *53AE7A6EB11CE1D7DFFBB7B9C69ED68FCE12B648 DaUo$
806,095,820 *53AB8F0F38C2132CC13DC90641DFD9BA2536904A Daus_
806,095,821 *53AEF1991781CEE95B7706DF24D9789600B9CB63 DaUSM
806,095,822 *53AD7C881499885CB761C951CEF90BA130C00E93 dauvray7
806,095,823 *53A5058B234649C6E7D3867AC390796CEBFF2E5D dauwtrappers!
806,095,824 *53A61B73689F2661E0FAD4EDCF2A7525990F7C0A Dauxlème
806,095,825 *53AB8EAB88913A5C5E1B13BE94AB1021F8F8D1CB DA)uY
806,095,826 *53ABA7B964DF4353A49B73754EDDE8C0C301E6D9 DaUYm
806,095,827 *53AB87699333D5E93DE6EE4C3BB4B5781725CB3D D$A%v
806,095,828 *53A39D034AF27F2560A644108AF9214C9C5E324A D#;Av
806,095,829 *53A071AD256EFB00A8CCBD8FC56AC4BF342D64DC dav1114
806,095,830 *53AA14EFAF741D66E7BA00C7A67F7C2ADAA497D1 DAV406730
806,095,831 *53A3C8B51A82F22650E38BC3D6818C0371CFE262 DaV4u
806,095,832 *53A8336274B50BED29C1AD97CC15B61925250E91 davamitalkfred
806,095,833 *53ADE91D070222B4974E653DB1B08F7C7B316446 davannis8
806,095,834 *53A6459590E89C8CFF328F8FE8F258BC6FE57F1C davaocity2k2
806,095,835 *53A59B92C34C22935B318ED5D1C8844297473ACB davarlarda
806,095,836 *53A608257D8145683DA485C0D7B5D2EF985BA195 DaVBV
806,095,837 *53A03004097129AD4E7BF9F4801FCDC8281CA1D9 dave.bai
806,095,838 *53A735D79B79146A8EE8A6E5C628D079B9A1769C Dave Beuchesne
806,095,839 *53A0A70B5FB50CAC1DB65518B21135B3AD7B8AC9 davebodnar
806,095,840 *53A0C5CCCADA7FEED4AB7363837A293932E327CC dave.bogguess
806,095,841 *53AC2EBFC2250ED9AE0D0EBD1654379FBAC3BAB2 dave.booras
806,095,842 *53AE1B9595988B6DA268060634AB39859A48F5ED dave.capehart
806,095,843 *53A66067476F992A67A8EB6BB233A372C2567681 dave.chiaramonte
806,095,844 *53ACFFE24C854CFBBFFD60D06D27174D1EDDBA58 dave:cossy1
806,095,845 *53A68AC9DC8FAAEF5E93666CDAC39B26941C72D2 DAVECULLEN
806,095,846 *53A28F7F755F3CA3C2B3B5BA6169B4878C544D06 dave.delmar
806,095,847 *53AF4AADC3C04A46F0A02C1889E8D61AD8DB2710 [email protected]
806,095,848 *53AB1830334950DFBE54641CC90AE999DCAADE1D dave.dipaola
806,095,849 *53A6B16E528931F5F397A2AC740AB39353B39EF7 dave dredge
806,095,850 *53AE5607CB5AEB0872FC4F5E3607F55FEF4C7278 dave.falconio
806,095,851 *53ACF049F841ED793869C12B052E3D6F4F2CC2E6 dave.farnworth
806,095,852 *53A2C74118DD1C68BED498B189F14A0BA12051D6 Davefool8
806,095,853 *53AD9E3B710DF4286EC2D3C6FDB672C0D8B3935C dave.golde
806,095,854 *53A6CC5A6F1FD3345141D938742EAA427B512408 dave.hesselrode
806,095,855 *53A1299A2E15CEB513658F411162A7CE7877A0AD davejan0
806,095,856 *53AE858114085A8EA1E6A71BE7B5E153B867B50E DAvEk
806,095,857 *53AD3D1ABD188C2AB59A9D232C8F8386895940AC Davekaren9
806,095,858 *53A57A6FEC0AA06960B74C51B9661661E6DFE1DD dave.koyanagi
806,095,859 *53AC166FEB4333B8DEF774A5503058919C138621 dave latta
806,095,860 *53AD4E99D14E1239F82B0EAE786AD850214BD31C dave.llarena
806,095,861 *53A4DB53E581EC0789578000F8C793234C917505 dave.lotson
806,095,862 *53A7AA2FB7996E07EE3274576A74C207A86890BE [email protected]
806,095,863 *53A6D1BD71DEA77B4EAA2A9E1687B26F08767DB3 davemercado666
806,095,864 *53A5D4E7D7463BCAC569B563CC1CECC2FC758C87 dave metsker
806,095,865 *53A790CF0C3918DC3CA1C1AC3271CEE25F77BEF0 dave.milford
806,095,866 *53A97FF3246AEF90702DD4F0955519C362B457A4 dave.monts
806,095,867 *53A364806B34323F9D1A98E84E990DC6180557EB Davemoser123
806,095,868 *53A672B5B86F9F5A7E3D33820865BA0172D3A2E9 dave mounts
806,095,869 *53AB43472A732DE4645D018B003D0C48A8BF8086 [email protected]
806,095,870 *53AFAF9F9B39B1708C572568AD10636CEA344DA1 DaveN
806,095,871 *53A5E50AFD8088DEA04A1B271AAD70F8EFCCE59C davendaven
806,095,872 *53AEBA2B6B9785BB97EEF7C96D55432F11EA9E03 dave.nieland
806,095,873 *53A0C28AEEA3F27C948868AA542FE5DB42A7D632 DaveNilo
806,095,874 *53A62A45100916F0A74774B7B5DC97766B780962 DavenportRange
806,095,875 *53ADE0A5BB74381A4A30E4339421335D11B03C52 Daveobsw5
806,095,876 *53AF34213C84FEB59871508DE981B0CE8F96BAA5 [email protected]
806,095,877 *53A83AAADD08E6D1A987130122444C2C7FB57ED2 DAVERKADS
806,095,878 *53A98DC6E19B370289F9F6E53C043375D538B908 Daves”
806,095,879 *53AD2BC5E542C6D5F61E0D392A92B16A2F089831 dave.sablan
806,095,880 *53A08CE65F96429A84E316BC014D38C0E1E2144A dave.salin
806,095,881 *53A13D95BC3576DD280D0536EBD507D3B270C9B6 daveschreck
806,095,882 *53AAE133D6A99AC0ED8B5E2307534FB8E35B75A2 daveschwarz
806,095,883 *53A66EFB7E19889B8C50304DC469BE1303A5C676 dave.sibbett
806,095,884 *53A8E2277F508EDA502D309F9B5BFF81F1DAF52D davesilcox
806,095,885 *53AFF88D99463F293CE60C953C60D28F0E572B0D dave.souers
806,095,886 *53AAAF8420C6E5CD678087CF6F2086D998D207F4 Davestart1
806,095,887 *53A4154F4EC2EFA29C9DD847835AA9840C52C020 dave.swarner
806,095,888 *53AA510469ABE367A9AE63D0E8E0A8499737B1A8 dave.vanhoff
806,095,889 *53A3427E2AE18DFFE45668E003EE1025513CDCC3 daveweezer
806,095,890 *53A664617226D83AC800D6E93D480A3738B14E95 daveweinstock
806,095,891 *53ADCB7E749229BC4BC25FCD412BFF41681E4AD4 Daveyba1
806,095,892 *53ADC7E63FAA4226317C1DCDF0B70F129C9B52F7 Daveyboyhg
806,095,893 *53AF238F3DD9AE3965BB8C00F87F27E194B250B8 Daveyjons
806,095,894 *53AA7A055F2242A8ACE8F2C6767022B3D874E48E davian980
806,095,895 *53A015B19820F254C5595A6476F437F1D2849A51 Davian988
806,095,896 *53AD19BA9344C1D860F8224EEEE6FFE508D42195 David10249
806,095,897 *53A58EE610716D49805CED3E388F5E3FBFF08D2E david160o
806,095,898 *53A87F29EC4741F73DC0843C840445655B496A2D David387
806,095,899 *53AB6946CCCC62B500F6B4425591F3AEC00F69AA [email protected]
806,095,900 *53A9448F251F4DA04286BFFE63EF434DF48B33E9 david7410
806,095,901 *53A8B1DD97BF4FA76AB21AD2A4CBB052028303D1 [email protected]
806,095,902 *53AF5D87B3A3D1961AE99BA97800655F218BFCED davidackerson
806,095,903 *53AE33E7E9EB042D55100268C968A12D0E5C9978 davidalsmeyer
806,095,904 *53ACBC5883B8138CF4EA4BFB43A02338B231185F david a rees
806,095,905 *53AF241FD9B9F73806BE4F7CAB46D04F8533B30B davidbilsland
806,095,906 *53A09675977CE28605F052E482F9CFC825CEEC34 davidbooze
806,095,907 *53A3A8B35584333223198D901E9DDFD8DE238F01 david.breihan
806,095,908 *53A5CB8C37B60A8346974DCAC4DD08A180CF41F5 david.busie
806,095,909 *53A364FAE67C073251AA5501972242C07710808A david.cantabrana
806,095,910 *53AA67805610E7D4178002E4129A18777955E88B davidcharroin
806,095,911 *53ABD1FAB1DDC50E42D1F84D6C4B6023BF077F27 davidchatburn
806,095,912 *53A96406EB2117452AEAC7E6208426202A54738D david.colier
806,095,913 *53A228B3FBB1095849A631CC9E4E8E86E9A52B76 david.dibenedetto
806,095,914 *53ADD984435C47C6A93F0A38A6859A61E82462C0 daviddirks
806,095,915 *53AC849699EE01C4DEA883E0944BE03F88DB5219 David Doesn't Get Hip
806,095,916 *53AF050030FC84A08A578D70284BF60355814235 daviddomenick
806,095,917 *53AA2E7224AB6E2274006000533F9B8D83D6A7EC david duke jr
806,095,918 *53ACE0F3743D073DC09CC50F8689099AA9422F30 [email protected]
806,095,919 *53A7A70F1879CE36120CAA536A2D70A986E491B9 david.eastin
806,095,920 *53A19A232E2D755A1D8A50A5B5554D62E66F49A2 davidetten
806,095,921 *53A230AC9F8F7E365E54F75F612B986DD783C281 davidfether
806,095,922 *53A3A09F3C89F47EE13F7BF9F1BFEA99DC35DCA3 david.fruehauf
806,095,923 *53A49D128BFB8B7E744B41768EFA3D8C79D6EEC5 david gaita
806,095,924 *53AE10534D04CCD8AF171073880731008BDF3CD2 david gonzalez martinez
806,095,925 *53ACAA868F092FFB29E687B1061296767A39B0F6 [email protected]
806,095,926 *53A69398E1EAE79F2A9E3DA0085CB6A8FD81AE96 david.grannan
806,095,927 *53A9B7B891F0874EC1B53772B2B6D9B904E994E4 david hammell
806,095,928 *53A4815E1782302CE2B3F6ABC0B6712F1B353FCC david.hamnon
806,095,929 *53AF949521C52AAEB0D399AAF32A43E40A232180 david.haynes
806,095,930 *53A39A43A122EF8CB8C0F50082BDB5F1EDF9B6AB david.hesch
806,095,931 *53A64A3A80D81F92D3D4E7C2381B2706CD6DBABF david.hoppins
806,095,932 *53AB48234E8BD54255DB184B7DB6E4C439A2AD91 davidhurtig
806,095,933 *53AA7FF89A3C5DF3568AF2555352BB41B34DC8EB david.ihnen
806,095,934 *53A1D782191E30320BB478A0DFBB4AF5E13ADA17 Davidja3
806,095,935 *53A290CB68C1E43446C09680653F84229FFC5D20 david jindra
806,095,936 *53A46E3690E387123ECEE6C9A8090E74DA400A5A Davidjupiter
806,095,937 *53A5F48B7C7139051D0FDDF215001A7E0E939C4B davidkachur
806,095,938 *53A59892D4902C929160F0CA5A5CB88881FAF8A2 david.kondos
806,095,939 *53AA7F775A7A200DE62AF45E866C6B09137AA564 [email protected]
806,095,940 *53A2289F858AAC665A9CCC0580E11052C5596784 david lebold
806,095,941 *53A7FD2E3CC53704B9B373282ECD7420BDCAFD97 david lee campbell
806,095,942 *53A64BE6DCA31BC067FB7CA3137D5EB25CD72F11 david.lola
806,095,943 *53A926D340F9709F43592BBD0D4AD8A0C0A34378 david.lunde
806,095,944 *53A1D593E17CB3AAD23F1AEC04CD63A272DD677D david lynch moments
806,095,945 *53A04490D461D638A5AE6DED688A734131795174 david maclin
806,095,946 *53A8C0E1E43DB66A8323004D478F3F30572A94AE david.madamba
806,095,947 *53A8DE46283DC316E3C906040B713D2DC1D3C4A6 davidmccarus
806,095,948 *53A2EE16DD88F4B499B301CCDA008338885065CC david.mire
806,095,949 *53ACA38B1431C6052EA1C0B985889F2CB086E083 davidmoorehead
806,095,950 *53AE48401B2095FBE8F6111CEEDE808DCA8027EA david.moulder
806,095,951 *53A99CA600C8EBEE04E888AC05F0DB7788F2CCD8 davidnaysmith
806,095,952 *53A97DA0A40541DEA5DCCD5383C4969FF4E5420F davidoakesguitar
806,095,953 *53AD35D2FD7D81AA279DD6D841294479FCC1D281 david.oberg
806,095,954 *53AA794310CB243327F97776106A445109D6CAFD david.peale
806,095,955 *53A5B99F79F8FF023705FDB4C90F97FFEB979BCB David Perian
806,095,956 *53AEFE488EC4E857259CCBAA0619AB2525C475C9 DAVID-POWERS
806,095,957 *53A0D3EB1BE6E9BE1C7ADFF86DFF39681C911CCE david rapoport
806,095,958 *53AFF1C95ADAFA16B4EB80F364AC4DCDA1FE8F8B david r browning
806,095,959 *53ADA269897A2A8EDA14FFD783D96621E10F89DD david reano
806,095,960 *53AE1678625CAA14F44DDCAC1F39ECD090D7535B davidrekhviashvili
806,095,961 *53A55A44173773B0E23E8983430CBA5034C5D2C3 [email protected]
806,095,962 *53A90827167B26BA2E4CB2761F47D3185C985CB9 davidsarich
806,095,963 *53A0C6E528D629A0662B3E223191A3F136AC74DB davidschiffman
806,095,964 *53AFF9BF6E67B0F401CCE3F145DEBE6CAD2D5141 david scott thompson
806,095,965 *53A6B6AD14B71BAF8273DCC47041F07AE032AA80 davidsnaith
806,095,966 *53A0FFDB4D4AD1148144C88D4E5370D9503F214B david'spsalm
806,095,967 *53A1D48DCFE31E7EEF858246696622A09CC125A5 david.steinhauer
806,095,968 *53AE95881225D2A06A84E24869ED151B1CDB9A21 david.tachauer
806,095,969 *53A9D5C6F52ACCE7D13D9B0E2FC2AD73F7541689 davidthomasmedia
806,095,970 *53A991A46B83F01CD9E93545A518EE9F07811445 david trevaskis
806,095,971 *53AA111A67FD8819B80118902DA70F69D33ABE08 david turvey
806,095,972 *53A0A4A1F45083692CF66A1A009908FFE5EE17C8 david usen
806,095,973 *53A16753D83C32F9CD53B91A60F4EF1D0D51CDD0 david uzoma
806,095,974 *53A5E2B27AB3596DF1FF5AB07BAE7CE254FDE780 david.vanheukelem
806,095,975 *53A7A4E2E5B076437031C31E485400443401EA77 david.venema
806,095,976 *53ADDE1E06F2CD252F2B2FC0E6F7920101771ADD [email protected]
806,095,977 *53A19837A6AB9E5BE8C8C5130F42E0F37CF12A1E david vizcarrondo
806,095,978 *53A32FF17B05773E6A773B552A028294D0980358 davidwarga
806,095,979 *53AC97256559390745521DC32C8D0735D06EB512 [email protected]
806,095,980 *53AC3DC5C2F1BFE11375E60C8E8817617B3299A2 [email protected]
806,095,981 *53A7A55719BD8F3193165238BDC010D9987DD232 [email protected]
806,095,982 *53AB96C063AA0627FBAD07C76EA65541434BD724 david yama
806,095,983 *53AA9DA07F22055B8682AB316B1845A444598EB1 Davidyeo8
806,095,984 *53A53EF4C9A51067BC7F74321B31C6B8DA0BD793 david zent
806,095,985 *53AE42425FDC1C22FC7015ED08354C8495D966D2 D'AVIGLIANO
806,095,986 *53A6A635E59B2EAD229F7CA241B031AD08013E39 davis.alexandra
806,095,987 *53A21CA48D8B8AD3B1A61BD36BF4587152EB5BC0 davisantal
806,095,988 *53A7462E473A7B5DFCB583706ECFA35EB3F94B31 d’avisar
806,095,989 *53A6C8FAE72C556AF63831AF5CF12DB6650F2B2A davis.berardinelli
806,095,990 *53A8FC3678953B6D3C4DF5837A09FC4E89525E9D davis.cercone
806,095,991 *53A1BB87E5E5F2E06355290FC63AE14B06245887 davis.deno
806,095,992 *53A7364F58E12899912877D723406556A8FEDC00 davis.georgiana
806,095,993 *53A5BE043A61228DDAA55F6456B7BA22481C589E davis.hejny
806,095,994 *53A3ECB2F3B79952AEFE3F3213B2DE00F9CDA6B6 davishowden
806,095,995 *53A525944965216CAD38C58DAF4D19FB27B05E9A davis.kirkendall
806,095,996 *53A2E3911A8E0CF3D2438EC9B13F90A5F6A23C19 davis.leandro
806,095,997 *53AD48C1DA0A46D20EC55B2317CF3B18018F56E0 davis.lux
806,095,998 *53A5162D4165D1892E644E927A9E8391A69C353C davis.marruffo
806,095,999 *53A4DB781FD02A4106E0B5EBB4A68B47F75C7E38 davis.maruska
806,096,000 *53A77AEC8C828FB137C7CB7B1E0F3FE24F695926 davis.moland
806,096,001 *53ABCBDC206274F572DAB4BF54A28A4B9E40C539 davis.nietzer
806,096,002 *53A76A84DBB137B98E334DB356D0C07C5BAF6AF9 DAVISON9
806,096,003 *53A91FAB0E6ACA9A507921FEB8166C2B0034AC47 davis.orizabal
806,096,004 *53AB65ADC3BE777B3D3D8205EFB87591B2A7D28A davis.perrez
806,096,005 *53A05202BF8BAD2609D952FFFBC2131AFD4C12DE davis.pidro
806,096,006 *53A416547D65BECBA0DAC2B937B7C00D0704F138 davis.radin
806,096,007 *53AC7225A7F8FE603E4F6BED7DBD4C2315976F1D davis.rollefson
806,096,008 *53A72D7AC2EF07FB91E8D25C7496C7015C3F0446 davis.sigel
806,096,009 *53A40C58DECEE13E7CCB0B19D55B022392B75CA5 Davis主持的體育中心。
806,096,010 *53AAA7182EB1B823035982948F0B1C0422AFF132 davitte9
806,096,011 *53AF9DCEDA1F57F814B2CE15E784ED88430DB7E4 davnb
806,096,012 *53A138A6D58E968C98CF7FD22BD42D51EEC2E0A8 DAVNk
806,096,013 *53AE549FED9702CE475874D5276A37EC819C8116 Davon293
806,096,014 *53ABD7D652752515521AF49377A36F61AF5F24C8 Davon740
806,096,015 *53AE1A087BD07D781A5334EA3121F57654CF9089 [email protected]
806,096,016 *53AFF2E59373C24BB4D613E41729BC88C4BC73FB Davorima6
806,096,017 *53A9E8193FB102B735AFCD7E14F76DC6B312C1F6 Davranche
806,096,018 *53AB5C4BA45C0ABE40F13EACCC177A0619CC3685 D(avt
806,096,019 *53ACB01C92F7EF8B8770C47690C7AA6D46B55BE7 D.Avu
806,096,020 *53A8F58B1049D2FCA033B6EC866D2F32BFC7316C DaVua
806,096,021 *53ACD22B66AA4E0EC97C7EC57A44D2DC811DED4E davverò
806,096,022 *53A359C66D3E09037CEF4A19E085EAADD2ACE02A DAVW2
806,096,023 *53AD9DFDD0D374000745BB19C136816C0FC05F16 d’avy
806,096,024 *53A9D56DABAADEBB75C358D1EC185B233FD144E6 D(AW+
806,096,025 *53A9617C8FF486BC7B2F2CAE65FEF2A82A1279B1 D&(Aw
806,096,026 *53AB47D62AD2A4052D1D8D3446698D77983941D1 DaW/,
806,096,027 *53AD9B25A851D408F170D99259AF80DB3EA6A32C D(aw)
806,096,028 *53A999A2CB88CA0D28EF68D7EED981093D758F17 DAW02
806,096,029 *53A52636027312A62CD0872F6F1050444BB146A7 DAW5:
806,096,030 *53A08EA8D7A7C96E4001E36E11E70683495A911E DA$wa
806,096,031 *53AF75012C4EAF3A13D53BC3B7D02A85387FD04F DAwaH
806,096,032 *53A9642B2D14C63EDD4115AB77B258007DF3BCD7 d’awara
806,096,033 *53AFCBBD5CDEC21CE7BC05B19D106C19AF1922B0 dawa(thecradlesong)
806,096,034 *53AA7530C96A47AD843234AE166E86DE8477C5BA Daw"d
806,096,035 *53A5D9A4ED638037C53FCD95DA192838BF01F559 DAWD13R
806,096,036 *53AB8527D9775B4CBEB69ACCBC4C40A4A273E3CE DAWG62
806,096,037 *53AA2B62EB00A921CC679ED6ECB64F3D50C25F6C dawggie1
806,096,038 *53AD58E321ACC546F8931FF69FDF2470DC6C8336 daw-''her''-tee
806,096,039 *53A7CF8DB77868A4E4EAE7BB4270CBADF00A5B0D Dawhoo
806,096,040 *53A81E628D4DC6C68A7EC839626D959FABEAF0D4 dawidkowice
806,096,041 *53AC1F44442A8D496454E088F0A7BCBC3B2F0A8F dawitdesta
806,096,042 *53A6BB046696D132C7F2ACACF64B348223F1BE86 DAW!K
806,096,043 *53A927B3B7A856840B23B2F27536F4B8E582106C DaWMD
806,096,044 *53AF7B4CA9F1FBEC5BD589757EB008FDD41A28B9 Dawn,Ahephi):荷鲁斯四子之一,死者肺的保护者。
806,096,045 *53A5D12862E3ACB6079788B3AC69AEF97F1C8590 DAWNDREAMER
806,096,046 *53ACF5A1D20BC7E37A1E071E36352C491DE6ACDA dawnFabian
806,096,047 *53AABB0E75B63366376E03C1C1B045DD1D3E61CD dawngough
806,096,048 *53A9DA353B20A6BA88D0FE9FD1F5F3D16F58DE78 dawnlachapelle
806,096,049 *53AABA7A1F0103CC2D291C23AFDB67FE2A0F35AC dawn mccord
806,096,050 *53A4CD01B81EB6642C5F5A447CD5B9E0D7589D4B [email protected]
806,096,051 *53A7E493BD70367A80056D44F3C22EEBE6FA75B1 Dawn's Highway
806,096,052 *53A0EC5C470812E781E4B085B6A6FF1D8886011C dawn,susanandgwen
806,096,053 *53A9A2872AEBFF2F0A658FD9698F26C2EF42C259 dawnwinchester
806,096,054 *53A9C165BA46D1352C42E6CBBA2198704B63F93A DAw(p
806,096,055 *53A190A16E8D332DE273E24DC89D270162DD14C2 DAWSHOLMPARK
806,096,056 *53AF56787B2F107300BF69F258B8C93BFB9DE87E dawsonsp9
806,096,057 *53A31CE572BFD0FEB027B23CE2D6D7A94BC2FC7B dawtit7
806,096,058 *53A10073B6B001CFABB25BA5447F0C80F55475A8 dawu1
806,096,059 *53A6A79C4EFFF37E3B8FE6EBE3BC77839730637A Daw(X
806,096,060 *53A10E60A3D266523B809BDECE2FEFEC03ED318B DaWYh
806,096,061 *53A2379EA6F11BC4306731124350429D2D9AC3DE Daxalipram
806,096,062 *53AC058B964650B66E68F0BC274BCBBFFC3C557D DaXmg
806,096,063 *53AB6A3C83C91980547450E39BC4A555CAFAA2DC DaXmI
806,096,064 *53A2F8B9C62B6E11DA7D63D43C7D8F6F13D688A6 DAY:
806,096,065 *53A1504D08FDC9B8FF5D15E16D7FA8E8CAEC0572 Day'),(161,'2015-09-07','Labor
806,096,066 *53A2E85219D2D7DC845D2620162EF7C501A8F106 day25j2
806,096,067 *53ABEF6DBBDCA6C7FB69359A78A3599A84F8922B Day'),(64,'0000-00-00','Cinco
806,096,068 *53A948DEF00FE9A500E56FA04673CE76F7971AAC DAY8397
806,096,069 *53AF36BAEB6E95687EE4BB39F3D8C15E41EB947C dayatmaz
806,096,070 *53A875B968308E52EEB0A32B5350AD4AB4FC94BB [email protected]
806,096,071 *53AE437F60BA50F8A893200120C542A4C5E59DCF DaYc+
806,096,072 *53AE5A3B55F95AC1A0642C63ABF4280E73A7425F Da)YF
806,096,073 *53A21B6854F26298D3E91955590632F15DAEB4CB dayformed
806,096,074 *53AA059D2A42DF7399D1AFFE0BA07331C27D6F6C dayingit
806,096,075 *53AB8A9D50C24C359B0A8F13AC1749C8DBFD594B DAYL!GH+ED
806,096,076 *53ABEFCE1516512A03437BFF614264846A5FD787 Daylife
806,096,077 *53A0837767CFFC098C4199F366606C9680831B96 [email protected]
806,096,078 *53A29A523F3E596B27A9FCF8A074923423F4F32A dayna pryor
806,096,079 *53A160F0D7825EC75D21C3E2507A32AE1E2EA26C DaYND
806,096,080 *53AEBB1BBF4EBEC4AB7D892E6E89838709A1CC5F Daynese6
806,096,081 *53ABAEB2689A3A6E1B4FC04E9FF9248BA8F09741 DAY-Q
806,096,082 *53A08477232844AC5FC6A43E1ACA7FCE40BE746A day...s
806,096,083 *53A99B4B101784C95DB9CC0F160CE132E27D8A7F DAYS GONE BY
806,096,084 *53AAA2C1E2BAF370C03D0320484C1766941BB5E6 dAytek
806,096,085 *53A78C4E22A061500D2DA4404C304FBBCE0AE5E2 Daytekabcd1234
806,096,086 *53A895443B5343D6E98BDB184AA8BFD874919662 daytime.2
806,096,087 *53A286BBBB25AC273263162F838B97C3AC71C523 daytimesyndicated
806,096,088 *53A61702844945FAC293650D5391F999853615F7 DAYTONBAKER
806,096,089 *53AD95B0A707D023429EE35AF253A8ABCF1958E4 DAYTON-COMMISSION-SEATS
806,096,090 *53AC0C8C72E11C76A8BDAFEA39261C19D4FCCC5B DAYUMS
806,096,091 *53A6C3C80711FB6DEF35F86A40BA5F23EFB367D9 [email protected]
806,096,092 *53AFEC0200F9CA29BC07C746218386B369546C07 day_vojvodina
806,096,093 *53A313CDDF818434AD94D4AF75FA8192080EB1CC day(埼玉県
806,096,094 *53AFAD150DD48364E36B0EBC8BB5FC9A39C0A304 D
806,096,095 *53A2FCF254B9409A7CDCD5D53295FB43C0232AFF D.=aZ
806,096,096 *53A5799249E6569DE52D788F55B746597570D3B2 Da$#Z
806,096,097 *53A2C7FF0026147E12FA28F9CB2B52A5EDF98DB4 Dážďovníkotvaré
806,096,098 *53A4D6555BAF952FCFE23775ED30E700E64E0543 DAZEU
806,096,099 *53AF5A3338FAB35E56B0B18672BCB9EBF66C6C60 dazgunston
806,096,100 *53AE79370F666FBAD550729A2B18365B175D467A Dàzhào
806,096,101 *53A1975C8A94BF617C8223E18482AF37BC1930FC dazhei
806,096,102 *53AE78D5B17127503E9BFC1017718CA0E2CB7BFC DazibIrode
806,096,103 *53A3DF807D87FD82AAD7062B4967EC4841595834 Daziruon
806,096,104 *53A2C8956E142AAA9E3B454EEDF70FFDFC1AB0E0 daZm
806,096,105 *53A26793DC161A935DBC880F09CA0B9EB0B7960B Dazugeh
806,096,106 *53ABF0007C5500C64612FB0A119B67A049E695F4 DAZWISCHENFUNKEN
806,096,107 *53AA3C90D1B85B6420FF512CF88E27D73E80106F dazyaku6
806,096,108 *53A1A05148DDA4A3507E5E638E400C9DD9CAEC8D D-B#+
806,096,109 *53A96D0A33560FD98AE2D307CABC77EA7E1AB127 D::;B
806,096,110 *53A14BF4693C26CBCC122B4ED5F8B11C9974F5CE D?B(-
806,096,111 *53A057443F52FDA0EB74CBD4E97DB378A8196E5C D".B,
806,096,112 *53A1DC246AD0A6F38B56C59953224088E6092670 D"B&+
806,096,113 *53A144F45AE3E95761AD0631D95C5677F39AF55F D$&B%
806,096,114 *53AB35A560C248C9748626B16F3DC5D713286527 D#]B
806,096,115 *53A9565CDCBA4902A3769D546534BB0E0486B49E DB<_
806,096,116 *53A27720C24977A97447CC5759A4F411370CA96C DB-$=
806,096,117 *53A02A41679B3DC7584BA645C245AF8640AFE60D DB,
806,096,118 *53ADEF7E240751975135CBB489271BA963D582B0 DB;.%
806,096,119 *53A6601119FA41443D2CD7C571F7FB17643814BB DB.:(
806,096,120 *53AD7EFC994D803D7DEED8BD195F52A4FB0F9C61 DB.")
806,096,121 *53AEC346DA79F9830081252EFC9A25DD31CBB8B6 DB(;_
806,096,122 *53ADC4048EAA39D53057EB27D92FD3EA29CA971C D)-b?
806,096,123 *53AEF1880148A6252C0261FEC7108D6412AB4781 Db=!?
806,096,124 *53A99A74688666D2E1D80551BC9C3C580A2B4BED Db;,,
806,096,125 *53A188AF53E4A2E540075CD2A1E7768420A345B1 Db!%-
806,096,126 *53A5570DC506C19A09C75BFC94B01F3CD1C61EDC Db+#?
806,096,127 *53A24BDA61BE0D531601C5E85AB83D49AE0B4855 d?&B
806,096,128 *53A320D047A246A8234999DE668D8042816A7F98 d\<B
806,096,129 *53A1451A844A2B298818FEAA4D2BC4682878FB25 dB~.
806,096,130 *53AC6704E5D71194BF4899E430B556C8578562C7 d]b#
806,096,131 *53A842E7EB9E7BB1B047B80D41DF4859CA47545A db"-
806,096,132 *53AFB72D8B517E4B6A6CCBB3FEAB7D6C94BB2B9E db}!
806,096,133 *53A9CD91CD2453AC22073CD9CF6DBDDC1C431684 D/b0,
806,096,134 *53AE2ED1AE7B013A658D5B70E555449DD4943825 Db
806,096,135 *53A6B9A0A8EB106AC105B39FF71B84B14ACE8B34 Db036
806,096,136 *53A4E68A0513CCE6D87622264344C9B07E3C7A85 DB04)
806,096,137 *53A46263253EA9761BFF8D0C2909ABBEC30F9FE5 DB0A5
806,096,138 *53AE301B759E5C8B9941609B7321A96B141C3272 Db0&Q
806,096,139 *53A4718554F34D33461F31B390083305F8E7FEAF D=/B1
806,096,140 *53AD8DBB91708B5FC1E15923C80A9A10D463117A D,B!1
806,096,141 *53A078F1F7A616C6FBD2D0B3C92AB9B8C9B364D1 D&?B1
806,096,142 *53A63D1128C9649F4F0FE4021CF1C17FCB11A583 DB141176
806,096,143 *53A3B76808D030671C913145C94B23A8979E1786 Db1Gj
806,096,144 *53AC2FCB9C988D156827E2C318451770407349EF D/b1q
806,096,145 *53A251B9C45B0003F4662E03CAAC171C9F06B32C D%B$2
806,096,146 *53A7AF9FCFAC58CE254D6DDBA63A3902486A50CB DB2/?
806,096,147 *53AA3FBCF66C22B9532AA5980FAA8940821189E1 D&b"2
806,096,148 *53A97BAA81F8CBD28941B9E1A394DF54F8104D51 Db2),
806,096,149 *53AE5C551A6F34BF5EE3255FEB1F4A38460BC354 DB_2p
806,096,150 *53ADB1153AECDB541D12B3B6C486DEF0E04A2C4D Db2VZ
806,096,151 *53A9090171104D8C1A002964FC1EB18DB26535E8 D"B2Z
806,096,152 *53AC7DA8EF7C2F356CC32F6780D37978F2327BA6 Db37#
806,096,153 *53A6E9082B9AEE3928B9E197F6A85FC9A981CC8E Db3a7
806,096,154 *53A2D43D145B93FEA0B1FE94961378C00D683D5E D?b3Q
806,096,155 *53A29950317A3CA2FE05F34CA7220CDDB4CD7E6B Db3QC
806,096,156 *53AB033AE4F1DC96AA3901B20C0F54805B1E2076 db3rn4rd
806,096,157 *53A16314251D51F985DCC2E395E7B6A100FEC1A7 Db:3S
806,096,158 *53AB79752AB5E42E3E89DC487952E4458A56E8CE Db&#4
806,096,159 *53AC2B7A4E3901377802F08DF860E48E5B201BCE Db#4
806,096,160 *53A11284A31F1F19E1CEE9F4E172A87F1F080DB8 DB+4i
806,096,161 *53A55E0B1471B0CC66553BA96F0FC3B784B60F2E db4informix
806,096,162 *53A8919F2AB04BB803D77EBC1E8A45FAC3F0121E DB!5=
806,096,163 *53AC4C3EB15D10C1280745CA90111F1FB9B8D067 Db5bR
806,096,164 *53A0DE6C506DE73AA17C0E7964415A4C7014D40A DB5.g
806,096,165 *53AAC769F2E6C243974FBE05552461DF713E6D0A Db5i/
806,096,166 *53A9B6D91001A6F2302EE4F4B1CB1166F723E999 DB5kI
806,096,167 *53A2FA52489E6271611F10333E6A701BF80CD7E7 DB_5u
806,096,168 *53ADD3E8759532D977C66B80D187B7279540E769 D!B6"
806,096,169 *53A5A2EF61BD870EBB6A2A6C5E8F2E69A87CDD95 D?b6-
806,096,170 *53AEDF9B03B21B726CD4D191B0B5EA07AF213703 DB6:a
806,096,171 *53A58669F2045975F61394BE921835C31FF6AE6C Db6BA
806,096,172 *53A36FF8B6C7C4DD00DFD4A12E064BD44FF14CA0 Db6TL
806,096,173 *53A92AFF12A934E9534F6C8D86BC758D3CF87FFC DB6
806,096,174 *53A3819CCB8AA27F1A8C2B0E7845448DCA4041B5 D(B7-
806,096,175 *53A62C7D12420AD015153688546B3FAC1872C63F DB7)a
806,096,176 *53AF4BBF22E13B244D156593205D5FB428D8E845 DB7DA
806,096,177 *53AC219CF077C4FBA24266571D4F818F88409DA3 DB7Io
806,096,178 *53A41B48C873310D7D4BCCF3D2704C775EF7CF1A DB7jX
806,096,179 *53AA1B39AD96144F2BF1A02703AF67C43D8C6807 DB7MM
806,096,180 *53A11D51ACE3B3E553B3C89C83A0FB91C565FDC6 Db7OG
806,096,181 *53A85D1C99898CF8B5115E235DA5792B01B11B86 Db=7W
806,096,182 *53A9CEBDAFA95843FF8EFE8C9BA7A6DE11B7C21E db8-
806,096,183 *53A390A10599DE92F890F9B59A2E10D7843474F7 D&B85
806,096,184 *53AE148741F5C11F27DB60BBED05C523ECE06FD4 Db8BZ
806,096,185 *53A3A0D190BF0B2F76C97AD08535FEDDB05184A8 DB8dY
806,096,186 *53AFB48B045BCBDCD8A563D79F5B5692113AD47C Db8(E
806,096,187 *53A7DB20E6CF1229454C146B734D66A125B041BE Db.8e
806,096,188 *53A54FE46FFE82007CFC133E5C3D62BE0362AB00 DB8NA
806,096,189 *53ABEBD0BD59E57AFF2A4D970C1C324F8F43B0DC Db8NC
806,096,190 *53A4ADCA896B9E8BD93EF814D24142B456D50862 Db??9
806,096,191 *53AD073C543948D32F9F57971CFF36B5B48FDAEF dB9c
806,096,192 *53AED9DFBA74C53289CEA3762287A6F26DF24298 Db9Gw
806,096,193 *53A9B5BA29F00BBE5D40E295034DEC2E4BE0F24E Db9tu
806,096,194 *53A3F9D5A9493BB606A25ABA64CD05A6E8C80D27 D#b(a
806,096,195 *53A3AE8EEEC931E08B3D87A0858E67CF0FFE8B89 Db;Aa
806,096,196 *53A0CEE9CC2EB2897E7C8DB1948645E5D9630B5B )D"baa
806,096,197 *53A062BDF4528E4E03A3517CEDD4BCC05A93D375 .;dbaa
806,096,198 *53A4A352741360D9D40358C6AECD03214D132B40 DbabG
806,096,199 *53A80F4D56E5BF1D282238814A725A57983A238A DbAcS
806,096,200 *53A7AEF2A51E471EBC1611F8470F34806BD32F63 Db+aE
806,096,201 *53A76FB59B31F286F1C68448E3D63238E2128AFA dballer2390
806,096,202 *53AD5496F9A156AAA7BBF9CFC43D94F921C760B9 DbA#n
806,096,203 *53A3A55FA2297968852BA299057103AAABBA6937 D/baO
806,096,204 *53A256A5C38287F67536A4952D8A85428360ACC6 dbarberi1
806,096,205 *53ABF2F383F237AA4C638D0A45BFFB17C8C488DB DBas
806,096,206 *53A32B059D4203F01A238328856AD7DEDF213989 DBAUi
806,096,207 *53A31346CE5CFDFF34D06633DEA30ABCF37581F5 DBB=?
806,096,208 *53AE011D297BD506A04CB9BFEFB27F53AD60FB2E D.Bb)
806,096,209 *53A2CC042F9D8A162BD7BD257CA54AF50F077C46 D(_bB
806,096,210 *53ACA7549CA72344B1F8EDD204B358AAE60B1068 DB+B0
806,096,211 *53A58CF0AFDD30190796005E429B6FFC91A92D30 DBB2B
806,096,212 *53AFC52F2EE14FF5221F091F0733EE0434F148A8 DBBA?
806,096,213 *53AC002AA82B288EC59B5045C612BB2DFD322AB3 Dbbcdbsw0
806,096,214 *53A376D74FDFDCB2E41230829FB904AC16187AF2 Dbbcn
806,096,215 *53A835633CB80F59FD1E86E74CBF04F84FBC219C Dbbcw
806,096,216 *53A079E8CBBF76DA0C1EF96F4D531939373AC751 DB_Bh
806,096,217 *53AF27830929789BA04A2FF4E39540514049BCAC [email protected]
806,096,218 *53A2C2160BDA1C0EE9E91B30B175368EB8697BC5 Db/BN
806,096,219 *53ABC879E5A25E1BFA84482F92CA2F0060B38686 DBbt3
806,096,220 *53AB500C8092CE569715F28A36F67F77A717CDB5 DbBTl
806,096,221 *53AA6EE512DD86E2882AFEDC3CF7299574B54B36 D?B-c
806,096,222 *53AEE5623CC6D97565782A3115793E05672B00B3 DBC7+
806,096,223 *53AC22BBAA0E3229E9321AFCA9A5D72516CFA63D DBCHAPTER
806,096,224 *53A305A00B2DA9165C9044F0BAC20D62E39A97EA [email protected]
806,096,225 *53AFCAB291F27A171584D8B53F27A4FA4080973E DBCi?
806,096,226 *53A8FB145B969478E87096BEBE9A2D8C2908BC48 DbC+k
806,096,227 *53A15AD0A32F552A7CB8002A45B26C1DCA095446 DBcn0
806,096,228 *53AD8777086DDC9C74FD93806ED2B3D0B6201BDA Dbconan1994
806,096,229 *53A2D163C1464DEB69D855F37A22F9BED5368C01 DBc-w
806,096,230 *53AF194E4BA1D46266557A48A5C8E36EE48EAD2E DbcY-
806,096,231 *53A6FBC781BE6A2D6F19C2CE6ED5BAF942B10F93 D_B+d
806,096,232 *53AB896F34BB75BAB88E5DC25366CF0CA21D4BC9 D_b$D
806,096,233 *53A0FAED9A05198590B21E345BFA75D18173AABA Db-D/
806,096,234 *53A2FB577D9813275BC25F4626BBAD83F7D8BB1E Dbdavies0
806,096,235 *53A02AC56495298514956718BD0EF7FB2AB3BF17 dbdg'tsrt
806,096,236 *53AFBC1EBA74AA0A95C7692F3BCB034A607C36BF DB_Di
806,096,237 *53A69912C70B7744C06454837E0F20598844C430 DBd"r
806,096,238 *53A61945E5D248351C10C4D8E1E04F699A384D4B DBe.+
806,096,239 *53A2AB613A3C017951998DD5B47E55E7E503FD0E dB%E
806,096,240 *53A598003DA4B101B3B3F9E2C9D0CA986B6735B2 DBE4%
806,096,241 *53A1CA123A7035D55DE4D16A6041C80F24DD75D5 Db"e4
806,096,242 *53A4DBC30559936CF15CA0C5CFEF2C1CC0F5645F DbE9!
806,096,243 *53A5925F87A24B600E729C6027BA9673D11970E7 dbeachbabe66
806,096,244 *53A2B8E61C7F7E59A1E00A810E59D60A3E15E7FF DB+EC
806,096,245 *53AB03DB52681594251C7D3B394FE217C63F8E7A D,beD
806,096,246 *53A93F72BF9F3A89FF99AA5A330945F3823269B7 D
806,096,247 *53A40D12BA1F1FE932C42A7F816204BD6B6FE18D DBeg4
806,096,248 *53ACAF3CEF3197278CCB8102396DFC4F6743B8F1 dbehind9
806,096,249 *53A1FC57C9E2041EFB3B50C0F1FF8E2B43F82125 DbEi,
806,096,250 *53A9992DD80C2FD0F0213B2656C8B9120CBF81DC Db)eM
806,096,251 *53AEE2B78853E6BF37C625C4DC2E739055A87502 DbEQ)
806,096,252 *53A72F63D18407C8FB900CB30959549A014D1560 [email protected]
806,096,253 *53AC971C6011BB433F16197BA81466D83BC3E385 Dbestide0
806,096,254 *53AD7CDF3E299EE525428D2706CEB5D54CDF3CEC DBEv(
806,096,255 *53AD48ECE72BDBECDA68EF2B058FBD62153D4BEE dbezou
806,096,256 *53A8995F81EF3DC35ABDFF586DA1B832D5EAEB29 DbF=+
806,096,257 *53AC36CA3454238BFF6F626AD47C2CCBB018A6B0 DbF/
806,096,258 *53AF34D87820BB7188105B5C14CDA40ABB8C2973 DBF0b
806,096,259 *53A52F0ED9C408186CB91AFB70B4991408FCD0F7 D-BF1
806,096,260 *53A0189FDF3C6528656F1DED24CBF2386337B5E7 DBFE_
806,096,261 *53A5CA5C40301BCFCC9FAADB90104451262DA19B Dbfh5
806,096,262 *53A9417F4B4A8AB770451B55ED7AC0CCFD823BC6 Dbfj_
806,096,263 *53A25363CD2514B84A314D7BDB843955E584290E DB.FS
806,096,264 *53A254DCDF900A2521BD717FABB9A5A970E17505 D!BfS
806,096,265 *53A3133C3C5C73DE8145F9C44A0551AEB39E4A6A DBFum
806,096,266 *53AE03D8887339E049B89C4CA7C3696AC0273CC2 DB
806,096,267 *53ACDF2AE9C394BA0200D6A98E6EEA77745C6D37 DBG4/
806,096,268 *53A5C2D7FB26A80F5563D543053186B601F413FB Dbgdm
806,096,269 *53AF2274DB35FC1E227136857673BE1466471EFB DBGh#
806,096,270 *53A0E82FBEF61672851297AAE58AEF17291968EA DBGpq
806,096,271 *53ABE6FCBC502393856D772F0A26DC0F1358795E D/BGv
806,096,272 *53AB35A20D0F1D29F637B33577F679C65ADD7BFB dBgY
806,096,273 *53A328D7FC56E09BE1573A4D5D2D71BDE2CCBA46 D=:BH
806,096,274 *53A68C3FD6555D28F57DCD5B55EFEF9D59068E06 Db?H/
806,096,275 *53AC7A04D6E9B57A214B82DB849C5B3AF96AF37E DBH2Y
806,096,276 *53AA6BA98D949EC265DB38AB129DEF7EC00B3E06 DbhD?
806,096,277 *53AEB159E209E295F955AC3A835B6F00CF97B9B4 DBh!f
806,096,278 *53A72E127FDD15E45B2E9BE61FCF83AAC4A80429 D(bHG
806,096,279 *53A6A779306DB1C669FC8066FCAFA1ECE9622D40 D$bhQ
806,096,280 *53A3002DD90ECAF42DE2882DA821DB661AAE7783 Db%Hr
806,096,281 *53AB11E950D1660A70BEC77F17FA989F7A2F624D DBH#S
806,096,282 *53A305208F691B35245E103DDC491A56859842D4 D,BhT
806,096,283 *53A62E461C752D2BDAD4F5DE2F4DCB6F79B26F0C Dbh.w
806,096,284 *53AD8543E96BEC9796D5DCA766637013E5C12019 D((Bi
806,096,285 *53AA5119B1546C02F8D3B7D0633134064D23BC04 D__bI
806,096,286 *53A7C2062A3EC977870253F2674D535E1377FDFE D$bI/
806,096,287 *53A0FA2BCCA86DBBEFAB52B00E832480B531600F Dbi&0
806,096,288 *53A5B381912C3F59B51885D4D88A261DE827C803 Dbi0#
806,096,289 *53AF8FE8FC0906D5A857713B7554622C6079A91C Db/io
806,096,290 *53A1BF58BE74BE84C41CF628F5722AEBD62989D2 DbI(Q
806,096,291 *53A3B4AC9EFA29ACDE97B8418CA843DED41A6F85 Dbi?R
806,096,292 *53A5890B27EAEF89B96F803F0D39CB67B08002DC DBI$T
806,096,293 *53A27D9C04A51BE17E5B1CD1128B0078AF189E9B D>bJ
806,096,294 *53A3FC520BA8ED7C1FA2D4C9E7A362DF53417E3D Dbj&;
806,096,295 *53A4300787DE89092D559007829EA997E9D309B7 Dbjo"
806,096,296 *53A9E47B20312CFB2E3CFC393BF01B5942323174 DB-jp
806,096,297 *53AC3CB09968D39035C7F63CCE06BD0087274FC9 DBjX:
806,096,298 *53A9FEC5299E1A966C211A63E746E0DBB4F549B8 D&B=K
806,096,299 *53ACF937C8B3265CE7741ABB9F36A686400200F4 DB/K$
806,096,300 *53A1C7FC259F0DFC94E684AF62D7E94DB0F7022B D:B?k
806,096,301 *53AB489BB2786CA01BF7AC7B54CF444F191B16A8 D.Bk&
806,096,302 *53A08838FA0E889DCE456953B1CE126F3670779C @_dbk
806,096,303 *53A8DE3924AC279989E8B7712888D00593D093AC DbkAm
806,096,304 *53AD21BC5EF762F806128B4C89EF8A7C7284820A D;bKE
806,096,305 *53ABC0C8400BA2E8FDF87DE97C2A68A6F65993EA DBk&I
806,096,306 *53A225B53EA82D68A9E9ECB54F7FDACEE147183E DBK)o
806,096,307 *53AF2D0F826B0997A13AE0CAD52E73A1A02D0058 @D$BKS2%%7
806,096,308 *53A9B2220590016B3D171424F6D3D00FCACBD905 DbkT%
806,096,309 *53ADE1596F44C2B0B69530892D3116AC809C4FE4 DBk
806,096,310 *53AF3173D76204F7BDB7376EB92B60B3DA152641 DB./L
806,096,311 *53A175370B942C2143DDBF306198F8A13765A41A Dbl4O
806,096,312 *53A97E8C9F7BDBDE04591E556568EE1A2E58355D Dblaient7
806,096,313 *53A10D1F5ABD4235AE39608B60789165E2820C51 D_Blb
806,096,314 *53A92EAA9FBEE1B2D0174ECADC7172ABEDDEE201 [email protected]
806,096,315 *53A0A83FB22539E7F3413FBDCBB46B47621F489E DB!Lf
806,096,316 *53A9F6719AEABD23D199FB848628E21B71F2841D D
806,096,317 *53A289F00F8E028A94C72FC27FC9F7A6B198F4AD DbLpK
806,096,318 *53A0E9A778EEA94C45B6494658019A4740FE24A0 DB&LT;4&GT; H
806,096,319 *53A102A260640E387141640A97E5B1F6DAC99A6A DBLWi
806,096,320 *53A83E03531AC030F295D0018330018314A294A4 DblYd
806,096,321 *53A8EB950A66F5126C9408FBCEFF31F918F27F47 D%B,m
806,096,322 *53AA30DDDE97D8BDAEC2A54C93C894B2E225ACE4 D"bM=
806,096,323 *53AD89C17E13D7D32F76CBB521BD8392EC16E54E DB/M1
806,096,324 *53A12B7B2B16A9B345334DD68085D9730782AD64 Dbm"H
806,096,325 *53A5C363494530DA55EA1DFB54ED76F353C9B1E7 DB+mI
806,096,326 *53A4FDDBA63173380A46AEAB84878BEC2A0E9BDF D(bmI
806,096,327 *53AC72B602E104293DEDB7E2D98891278B37417D DBmLU
806,096,328 *53AA9B9E3C69ED189E67C650B5608167B31566AA Dbmnq
806,096,329 *53A87A76C7ECA8C00F4B8F91177246385E743E46 DB
806,096,330 *53A20F340AE5E9F955502C32F20A6B05B39B2EE6 DBmrQ
806,096,331 *53A7A0C79ABA540F5A27EF364F7C768C39A20252 Dbm!t
806,096,332 *53AB08C885D9D30B723167A40E54DF2897EB2923 Dbm%t
806,096,333 *53A9DD2F214D8AD6F9289AEB790A55406DB1F1A2 DBMTK
806,096,334 *53A50C83DC6EE0FAC04BC946804F3D0C6C6F9A33 DbN6m
806,096,335 *53AF0FC19BCA0FC571894DDBEF31E33179D92E4D D.bNF
806,096,336 *53A231E250F651A1C4B6B5A60D3F86A4301B2219 DbNFD
806,096,337 *53A3EED258F5802A762D424578D2C5640F570414 DBN=H
806,096,338 *53A9561D134D7B5BE9BAA79372B662DED65176B7 DBNHh
806,096,339 *53ABB7A61CCCED2CA4D3C229776A3F0975E100E9 D,BnU
806,096,340 *53A764E5B0B069D3E7808455E5FB620FB894B565 DbnU%
806,096,341 *53AC6630DF2EA5ED9F992B4608DB0F1F67BFA698 DBNwe
806,096,342 *53A4BAE6E5D6B8E7D2CAEC1532F18D6273FBCAEC D+B%O
806,096,343 *53A487C26FEE31596BF147A152842EC58F1AD14B DbO7b
806,096,344 *53A4001509BE8603D7989BF3EB911AADBC67B822 DB/O8
806,096,345 *53AAC1C8931EF9D6D83207248311679740003E34 Dbo8i
806,096,346 *53AE441B1124C8A1F43CF0B95C175AF8C970BF49 DBoB0
806,096,347 *53A058468127FAC74A7B55894A259F378B75D9C8 DbODE
806,096,348 *53A3B4D85D1F1E834FD612A9199B968DE2F0C5E9 D/Bog
806,096,349 *53A188FF989422B773B6ED39A51B8EC02E7A790B DbOgn
806,096,350 *53A026E5A6E3EA7880EA03AFE6D1CF3E3BE3AD77 DB)Om
806,096,351 *53A3E182E14DB18A737EDCB444BDD7EF38E2B63D DboMO
806,096,352 *53A0F93839035E2CE82D4D32A6165CA3BD4B53BA DBoN9
806,096,353 *53AE5D1B58827F6B52DA3A39932B19D48566B8D9 DBonn
806,096,354 *53AB1CD1CF3CE00545CAD33B1951676099A81349 d.borgohain
806,096,355 *53A925677B968E3F52389955062B656D8AD182DA D!boZ
806,096,356 *53A7B2E510F08B6B663DAD6779732CD1340134AE D%Bp&
806,096,357 *53A0CFC572472C21F0B826FFB4F5F225E9CA36F4 DBPb/
806,096,358 *53A0B2EFA28F49EDEDF2894D80AB04A0A24E6404 D_bpc
806,096,359 *53A3255C2851AEC7800456779D41B22CBCADF092 DbP;D
806,096,360 *53ACF312C9A67ED724015D33BDA057C28B4F8C1E Db_PH
806,096,361 *53A2E8261FB586E3BD80BA19870F58E3BC60588B DBPIv
806,096,362 *53A7345E1047D8B5DD859EB846398A0BF4841BF3 DBPsl
806,096,363 *53A2BC5273CAFC8640D5D89E6992828349FA25B8 DbPW8
806,096,364 *53A6C37BB6A888202FEAE881B0A6A1261EC66159 DBQ-/
806,096,365 *53A6A0824B6B5F228135F7449DC8E0ABE331CFE7 D+$bQ
806,096,366 *53A6B4E759F5FFC746B752593A453209C0A838F8 DbQ1D
806,096,367 *53AD60A70432321BBC2958F0A212965AD0E531B3 D_bQ7
806,096,368 *53A322F1E356D985E4A81772B71E07AFDC19F23C DbQda
806,096,369 *53AA39D3E4E17DD4F16B9C424E8FD4400C5A2E9E DB-QE
806,096,370 *53A975E3A5A6859A41C2F2B1F7812A8D89AD03C7 DBQeV
806,096,371 *53AB35F35DDABECBB791CBE63FCADCAEEEFD7AAC DBq=g
806,096,372 *53A972FD53D66F603C5742BFBC8E6A5E6C78F4A8 DBqle
806,096,373 *53AEA14FFACD558C0BC18F51FD0DADF91E991139 DbQp3
806,096,374 *53A148EB6345DA5B706C200F2E374DFB6E8ADBAC DBqTA
806,096,375 *53AF5CB56A2DDD50DBFB3CFEFC7FF8A9E4F8746B DBQYp
806,096,376 *53A79C3FBCE8C9BED5A1CD7270E284B8D1B12F9B D:Br(
806,096,377 *53A75D9703C223702B411E55EFE127637841302D D,bR1
806,096,378 *53A44D9E5FA10C8E35F8B7C09390F6AC2B3511AB DBr1a
806,096,379 *53AB608B41946E146511387BB5FB2E0531A5267E Dbr8:
806,096,380 *53A1F661917C0A871C648194E4886E7BA10232C4 Dbraill5
806,096,381 *53A918E08E55CA53F1D6BCF3D196556BB44FF62E DbrBv
806,096,382 *53A805EF87EA1BFF93521ACA2EEBA59E0D235262 DbrD.
806,096,383 *53A2C568C39A97E4E4E7D523F1D4DF917542DFB2 DbrE"
806,096,384 *53AD8AC8963A995FAD6BA77FB584A19C9115E7E1 [email protected]
806,096,385 *53A61B8B34C3675624C8DF3500D7697D1C59B72C DBRLLNS
806,096,386 *53A91E51549CA5B1F8EFA18AAB0445576F02A891 Dbrllrt7
806,096,387 *53AEAB3A38ABA4E3215261D6782497FB4FAE702B dbrnnrbded
806,096,388 *53A63A3ED3F5756AECF154913F8A8000AA9A80BC D+bRO
806,096,389 *53AE86C8A8918A9693F7F557BA9B622AFAC5F9ED DBRXq
806,096,390 *53A2C55AFE3D10271B422076083CBE6A27D658F6 D#brY
806,096,391 *53A318AAC6FCE38FB0A951AB26B63CCB1A9B13B7 D!/BS
806,096,392 *53A6DA54D8C94DDAC132E9004A0EDEA33C234AC6 Db
806,096,393 *53A4587225D7E0DA706D97CA316198BCCBA5AA3B DBs0m
806,096,394 *53A450189473DB99A9B21CAB1ADED5071D58D417 Dbsabswing
806,096,395 *53A8A8D93D44E6DF29C7A5382853179AA09D41E1 [email protected]
806,096,396 *53AE7631FD87CA51E75C543F03AF26E3AF1EF35A DBSbW
806,096,397 *53A9168B3D1E0B608B4E993B886D7FE740D8B72D DBSi5
806,096,398 *53A72EDDD5B3162D1BACB2423DABE13671AD5604 DB/sk
806,096,399 *53ABE85E232A3789D0B5C3CED83118353C5EC7AD DBSKKV
806,096,400 *53A653A0F81C40DDB8AD77A5327EA5CB985D87E8 DBsL?
806,096,401 *53A58E25D156A2044C2E6AB2785EF066BB726E44 D,Bsl
806,096,402 *53AE9BB4084E41A5731C11367A60AA5798F65FE6 DbSm7
806,096,403 *53AEF1849A780214725EAC705F63D2C65BDAEDA4 dbstein:5685
806,096,404 *53A3DB7225EDB36CD54301EFAC81BB99A3AAFF7D D)Bt#
806,096,405 *53A3C127B02491C9B7915C95CF1634E083B8C703 DbTm!
806,096,406 *53A43EBA8ADE9D5C0F126AF22F6ED9C172210AAC D.BTp
806,096,407 *53A40F6B1C309264759A9C702C74799EFBE604E0 DbTpv
806,096,408 *53ACBCEBAB7BDD9EF01E93C361BBD1B76BA90C14 DBU%
806,096,409 *53A7D5FCB55E2D884191BF99F6885F3E46E50CA9 D)b-u
806,096,410 *53AF359F866A7BE1A91F7FDA9B59AC150B7EAD18 Db-UL
806,096,411 *53A631CA15C6261EE89395FB2C81E8478170F6FC dbUN
806,096,412 *53A8EBF21BBC170A3D1B66EB8A2042EE147CB2AC DBU/O
806,096,413 *53AEAB08E7999A3BBE0F62EE94C868977F54C298 [email protected],
806,096,414 *53A96F14D4617882B8A7C780B028355CFEABD256 D%But
806,096,415 *53ADD0A875753E7F490AF910F1000E09557533D9 DBuub
806,096,416 *53AAD4132FDE1FBEC0C90565433DE9F6647C911B D.bUv
806,096,417 *53A499DB538B797BA18BF8793AF874BF01F33C7B DbU?X
806,096,418 *53AEAFA5C4CD4DFBDF0C9D3F7A03DB52E656BA4C D%B_V
806,096,419 *53A39E35E3CE3698CF7819892A50F1078A8233C6 DBv5$
806,096,420 *53A31FA979AE777AFF3C8F4804B36788850FC3B3 D!bv6
806,096,421 *53AEEA11B205337D2FACE8FE10069E7610F6995C DbV_9
806,096,422 *53AA59513897F78BEADEA08AE00DC6B5BD6A4902 DBVaW
806,096,423 *53A362BEA0598BC8D01809CE7C86FE4F919354B4 D$bvH
806,096,424 *53A0EBE961C93E9AE0DE2D250F4E20DCFFA3ADF2 DB+VI
806,096,425 *53A2BB947EDF1986AC7BA95C0F3377582237E1D4 DbVM"
806,096,426 *53AF3037B975F51D2EDFC089FDB82DA4018E01A0 DbV"R
806,096,427 *53A1DA063E253A59160410C8CECEC362B266747B DbV
806,096,428 *53A6F6D344C5597AF0B67334DA0BDE402CD9CDAF Dbv"X
806,096,429 *53A5C11E54BC9D6FA68E92004F7065509B451281 DB/!w
806,096,430 *53AE4533307E166FD1553224CAF55469387C74A5 D"bw?
806,096,431 *53A3DBB7E378BC5B0B58B0C3153F9E8845AF5453 DbW0:
806,096,432 *53A65F5141C51EA063A54059548A024714FB1C3D Dbw/1
806,096,433 *53A73706262A539661B6C5F5D9B1FDEC8146B1C1 DbW5V
806,096,434 *53A2645F725375A1F68333725DD0B577ACBE37EF DBW5w
806,096,435 *53A92FEE341930458834D3EFCD58551FFEACBDFD DbW"A
806,096,436 *53AFE35A290B3C8EFB23E1ABA7E158B2B240F63A D:bWa
806,096,437 *53AAADD313E82D93BAE48060E01892C076BE87EB DbwA!
806,096,438 *53AF9431EB110C97D976D6F743FDB98E52F909BB D,bWD
806,096,439 *53AF556770CAC335FDFEE63D6AAEA55037142051 D:bwg
806,096,440 *53A70BBE84F6A47AB838829CC8120BA6C1DDDFE0 DbWlh
806,096,441 *53A6B9D35E39501BF82DDCDAB941CED0A64D2447 Dbw:T
806,096,442 *53AF43D43D7E5A27BCD0659BECB10464C48CB379 DBwug
806,096,443 *53AED269782B0904734B6384A2E94488E569E4E0 DbX1P
806,096,444 *53AB2EA7BC487D1A3600741F382637C62850A20A DBX
806,096,445 *53A2FE0C20994D8D08587766C1E82457F05A9C7E DbX#k
806,096,446 *53AB76FAFC3CAEC7F95086B7EC15FFBB8E85594D DBX+T
806,096,447 *53A4174F37F1D6D9AF0E95E98172FD4545EDDF7C DBXYB
806,096,448 *53AE717834D076808523171D5B05473D33531175 D#b"Y
806,096,449 *53AD6E8DDE70164AAC5DAFBD420B46D73199D5E9 Db&y
806,096,450 *53A33839A1465290FC531798E84A779BCB0BEEAC DbYbr>[email protected]^D{?{#+R-s= XpmHoR
806,096,451 *53AB8367DA691435E1A22DAE2D145920AB544635 DbYmh
806,096,452 *53AF8BD41ACCCC18941802B422C8FB7D23CA420C DBY(n
806,096,453 *53A43203AA6A537A9E84A58CBF39AD900AE9C9F5 [email protected]
806,096,454 *53A1BB06F6B50EC05059A3159A2C304BB77BFBAA DbYUD
806,096,455 *53AF180371C6230BE906A59CD0B619CE647B5ECC DBZEDISON
806,096,456 *53A50F5407928D33E95A30B64C6500885A29FC6B DBZWORLD
806,096,457 *53A14CFE715CE275A5944856159A3061A4546A01 D.
806,096,458 *53AC26CA92F03FB5BD5E2CA8FB3C7094CA1DBD26 D$
806,096,459 *53ABBA0974DB76E9FC8596E3315B9181CC134B21 DC=%$
806,096,460 *53A2E6A8E03D7824FB13EA7C6AC286174F76012C DC:=/
806,096,461 *53A5B15D30B283E783899FCDB7C60576E5482C5A DC"$;
806,096,462 *53A3AD4EE095B5550581F6C3B0DCBDAB40364504 D;$+c
806,096,463 *53A89AD49F774BF6801DA79B18D256C2DE9A641B D?c#
806,096,464 *53A5385D6D73184D924E9F82D4D5E64D8818B7C3 D"}c
806,096,465 *53A670391E61FC63077638C988E65D25B8EB2D6E D&c"=
806,096,466 *53A101521627D8B4FC636730A9944EAE95313604 D#:c?
806,096,467 *53A8C47C58DE97E82AC486701B1FD28A5C070C67 Dc"_.
806,096,468 *53A7818ADF501B43F01C5CF61901E57AD2EF32FF dc<~
806,096,469 *53AEB2C709CB20E899E588C617DD76AC046AD431 [email protected]
806,096,470 *53A0F4D092210E16319691AC537FFF379819442A Dc%
806,096,471 *53A19C6F6957CBFBA3DF932010339E24409BE98F Dc0_,
806,096,472 *53AB0128140CFC9E7EE3A4C80969133EB3C9A7D5 dc004560
806,096,473 *53A95257F0C51A24470F71E29A212ABF2DC6A074 Dc0D)
806,096,474 *53AB24512AA8D85260858291328E2EF98B85B236 DC%1&
806,096,475 *53AAFD85CE89358DAB5833CE974184411480F73E DC17G
806,096,476 *53A42953C84E76EAE514D4DD4F790F9149FA2768 Dc18C
806,096,477 *53A61ABE1DC7F554F84E29D98C047BF28F09B6A4 dc1902
806,096,478 *53AC5742AFC1E9E05DFF775CC543E3326B627A67 Dc(1O
806,096,479 *53A46203533380E32922516AC86B862204C119EF DC1Qk
806,096,480 *53A5E89BC45285C8F21DA39FD64E0D202CD47AC2 DC2!.
806,096,481 *53AFEA240A97F0551E47FF9344859B9B56180589 Dc
806,096,482 *53AFFB51D7C73EAD28ADF9CFCC5B5A14310FC612 D)C23
806,096,483 *53A2F45FBFC5811597410D2E4573736D0EF389F7 DC2F9
806,096,484 *53AECDF157AF19B8E28C65CD5E04A57FA13B7B06 Dc2HD
806,096,485 *53AAE69AE9230A185E6E85B19C6C2ADD1CDDC36B D&C2o
806,096,486 *53A32DF35ABD73663485320AEF88DFBA84CB0A71 DC2_W
806,096,487 *53A4D5DD67C6F77D7A5E8D32425AA415EF059F06 DC$3d
806,096,488 *53A5FF7DDB4924F9A969F4CAE86FDB0C664CE65A D,c4(
806,096,489 *53A5CB060ABD9191F10FE80F7CB5830AF55998AC DC4a/
806,096,490 *53A97F21669F46987A6D2A215A88DFE8D618B67A Dc4b=
806,096,491 *53A5801156660826CB7A5590D25C7FBD89C6A1EC Dc4,N
806,096,492 *53A0A0F5E92B4DA1370C27AE0EBF0020E60FABD1 DC4Y.
806,096,493 *53A2BAA078FF7D333D9A7EE0F98BE1E50119E599 DC5?;
806,096,494 *53ABB0F15930B3FD58EC885F52C4168BF774B272 DC5)/
806,096,495 *53AEAE62746EFD99ACDDD4F06D56A4D7E4AAA417 D(c5;
806,096,496 *53A211B8BF7B85327AD1321A38BB04A89282B412 (dc5)
806,096,497 *53AC73A4C6DC8A5276291E2FA6A9A7E51967F665 Dc57$
806,096,498 *53AA45B982F3D5FE8C51369ABC1055FF1C6CF506 Dc.5K
806,096,499 *53AE58A5225544BE80ED4F662C53DDC60539B1AD Dc5vk
806,096,500 *53A0DD1A07BBCDC050975DB3BB4D1B038C5582B1 D
806,096,501 *53A8CF0CC0A4E4DC3F2EA56885E8A83A678A515B DC-:6
806,096,502 *53A941AF21C3AA691F644740A2F22F83AE3699FC Dc6.!
806,096,503 *53A63B32737D3731769F48772175E708A81D5DCE Dc60i
806,096,504 *53A20B0CE978320168174F0E5C32B7DABF0D6943 Dc6=7
806,096,505 *53AA02D7227E62A848EC9062AD60887246959565 Dc6gD
806,096,506 *53A96574F4249A9882A93E4FE50EFB74871B3A92 D&c6L
806,096,507 *53AA9B6C4FEAF4429D3007EF1CFED9BEE6AD94CD Dc6p1
806,096,508 *53A0F7C37E485C61F1760803AF4950E7F0DC5BFE Dc6$q
806,096,509 *53A1CD3A19DA7F158B282D046E3B110E7B0BB3DB D.C6W
806,096,510 *53A3596B114F5A5D376F17BD0B16F6F0C1AC525A D
806,096,511 *53AD4BEB9D787848AD6A7D910B8B5D3C893D4ABA Dc7Ll
806,096,512 *53AAE026F07FE7AF78F6A6C13754034A23050439 DC7:m
806,096,513 *53AA1D928A8D690085DAF803319FC9E9F0EDF1D2 DC+7u
806,096,514 *53AD7907046B19E461561B293BA2ABDF64E4FBA5 D?c.8
806,096,515 *53A80C267024B2D29D85ACCAB4A70986B4FD6FC8 DC885
806,096,516 *53A632C07E06AD682590C5CE57ACCB924BD0B504 DC8_A
806,096,517 *53AD416C4DA5AAB8826A539D88649F3D954022A5 Dc?8h
806,096,518 *53A8D16B0E87E387AB63A9DF96D90C13BB2DB741 Dc8Kn
806,096,519 *53AFC0482675C24CB1721D62A4CA34F5F7989BB4 Dc8r:
806,096,520 *53AF118354571A2E3E324CC57CDB22AD086DB1D1 DC8%u
806,096,521 *53AFEA6ED174B2E2D3814AB287849B0FC4A6F06B DC9$5
806,096,522 *53A599E3F142A648D99BDB962218F45AB85F5967 DC977
806,096,523 *53AE89568867FF5EDF3DF33EA1C8D36F1C7909E7 Dc9C3
806,096,524 *53AC6E3D49CDC65F5A9DABDF7A6E22CA938B557D Dc9;d
806,096,525 *53A65181737530DD699088B8742546CF8608FC19 DC9(G
806,096,526 *53AF919FD17627EE013464C9F0DDED728645A1DB D#C9H
806,096,527 *53A709548C0C8F4CD2C20E520A4251D04108CE7E DC9:T
806,096,528 *53A97868BCD478E220065E6E98B7F4C69C9CDE37 Dc",A
806,096,529 *53A0E8ED4494273CFDC59E98E209432E05C8EC32 dca160icao
806,096,530 *53A39CB8C44791A1D57DFB83FA9F96908FA6E42F DCA7.
806,096,531 *53A9532A97A40F2940FBC4C5F6015C464F436679 DcAfH
806,096,532 *53AE83F8C86DED15607CC472DA75CD8B308E056A D;CAm
806,096,533 *53A3F29229107685E6C11D81A6E5765484282133 DcaMk
806,096,534 *53AAF3AA2BC9B48330B1FEB5B2C091EE01B01DC0 DCA/o
806,096,535 *53AF0064FECF0C587CA98269AD44927FE900ECDA DCas-
806,096,536 *53AEC8421D844AEDBBD432C682334D50C35AF03E DcAW8
806,096,537 *53A0007D2456798C9B6B57F61F403F28022C5530 DC(B#
806,096,538 *53A831EA7BFDC355572244F7EC443E1CBBF63A18 DCb&:
806,096,539 *53A954A7C47BCD78D7481A46334305523B6668E7 Dcb=
806,096,540 *53ADE6237A0B123D57C17C08C3F5470ED5B64AF2 D;CBF
806,096,541 *53AB19C5D2B5E84F2489820CEE78518904D3EF19 DCBR/
806,096,542 *53A0C071ADAE5FCD0BC5F4EDAA663E7CBE4A499B dccabsw0
806,096,543 *53A15405F3B77277D47E1D7EAE2BF5D2450D1122 D,cCc
806,096,544 *53A75ECC17F131182D1064F1038B4435EAF6CB4B DcCeU
806,096,545 *53A2AB4DA883EDA10DD0BC8F62A492C5C8A46543 Dcc:f
806,096,546 *53A40D4DBB4B550D3C6B9F87005AF543F371B55F D)cCl
806,096,547 *53AD83C5D395D4D2EBF1776C3072134351D0675E dcc=off
806,096,548 *53A5BB0038020636CD3FDB219705CACB340E20AB DcC&S
806,096,549 *53A68E8254743BC3A1E0DDA4A8165C0BC8FEEF68 D=C#d
806,096,550 *53A0EED8A7C531D9B58F47358A36805DCC0B2519 D;Cd;
806,096,551 *53AA5D7AFB6DDAEE1282BA6EE26264AE75534DBA D
806,096,552 *53A938820FF9314504AFB59BC596355117CEF260 DcDcU
806,096,553 *53ADAF3039CB7EE16C1729F13F4321BB1670CEF6 DC$dN
806,096,554 *53AF7CE19F2FCD7C4B98F64DAA9B80E3B7EEA2AE DcDo"
806,096,555 *53A9A5E72F2D858006ADCBEA82CEB9848856EA0D DCdro
806,096,556 *53A12A4FDAF23D9D4BEE8B7446369863F1996E28 [email protected]
806,096,557 *53AD3E5ED7A07A3094C155CC8E9649E8A7E7FF41 Dcd%W
806,096,558 *53AB55285271B35F9774B335513910D54A16B812 DCe).
806,096,559 *53AF8549589949C93553A97AA952E0A28C691D36 Dce".
806,096,560 *53A887926BBB8A8EAB4AC47E1FCBF4341C719DDF DCe9k
806,096,561 *53AFEA5984789236C49C88BE7B8304DC280E02C6 D"cEa
806,096,562 *53AE44269BD22BE21F48FC78E3521DB791C46F25 DC(eB
806,096,563 *53A2649851109CE68C6E3988268C59CB057CA3B7 Dceccqgy
806,096,564 *53A1F20321D1343D9D1A7D4B9CE0CB4C2809A163 Dc)ef
806,096,565 *53A7DE36400B6225DF200281632A138A8E43FF21 DC)eo
806,096,566 *53A233929A1702E010C1B293C508C9927D2ACDCC DC-Ep
806,096,567 *53AB6B7098618881EA0AADDB4A087996C3A59506 Dc#Et
806,096,568 *53A908E6E5332A3943B220551E9BF4D01E94ED87 DCEy
806,096,569 *53AD7E98A15170B92DE0AAD765DA59032B7A60E7 DC#?F
806,096,570 *53AD0356B211CD6B077FD41EFF4912C432534875 D~Cf
806,096,571 *53A03C0A8EC249522F1710C8F6E0BB4D8EEADCD0 Dc!/f
806,096,572 *53AE5D13D29043966E9D24038980B041D8F6A0DD DCfBP
806,096,573 *53A5474A9E5119171581DBCA75DE64E80CBF14B9 DcFeP
806,096,574 *53AF9AD3F86B6ECED9DECB6CDF2D9F2154C34F88 Dcffnt
806,096,575 *53ABF5412F7749B2C8FD0B3D8DB65C4B4E1374DA DcfK
806,096,576 *53AFC634C2F69AA2CE6B51123A6A50C33BF00401 Dcfpi
806,096,577 *53AE449E08C4AD13288AB260D19C094B5CB58B70 DcfTs
806,096,578 *53AF0952AEF6863FD2E9EE3DFB45A8A73B5AA06D DCg:&
806,096,579 *53A45E0C645E672C716EAE096134A48CB9A7E100 Dc
806,096,580 *53A80D20E9AAF5F07F86A262FD8E31E3C6170048 D_cg?
806,096,581 *53A65A6CA05BC8E56079B8235BA04A6F39EDCC8F DCG09
806,096,582 *53A13D260DCB3053D8A16AD066B85310CDA7289D D.cG3
806,096,583 *53A32D36C3BA28C46DE46B3029D491DCA1CFB4F0 DcGbV
806,096,584 *53AEF9B9DCD58B0E49466208F2DF6A421EB23E8C D#cGc
806,096,585 *53AA08AB7DD50D253D3AC8520240015C17DC0DC9 DCGD!
806,096,586 *53AEC40F74658347E5F02CEB917AD8BFC6382AB2 DcGH!
806,096,587 *53A8908B563623F9D55E1CF601D79353D53C6448 DcGHh
806,096,588 *53AD6DC233D33063BD08F477E98B7349E35339E7 DcGLY
806,096,589 *53A4DB38F9F92941D07AE1715D9FA591CA6359D9 DcG,p
806,096,590 *53A3DFFA2A1AC5032676F54CC1AF125EAB0A6BD5 dcgroupiiea
806,096,591 *53ACCB0E8B14614F665E87A0E708D0DA9A74D2A6 DcG#u
806,096,592 *53A2C8811E55903CE95E6B8467ABE7EF3D5807D4 DCgvD
806,096,593 *53A1157F3CD50F93865CBBBC5ACFD7CE2B123EA8 DCGYu
806,096,594 *53A4BDF94624C3989EA5335120E26DAD15FC28D9 D.Ch/
806,096,595 *53A23C0E93269476D9F53E1196E9D6F6B5FF23C9 DCh4K
806,096,596 *53AFB4ABE39831A603F2A4D589393E9372D1D235 Dch6A
806,096,597 *53A02E470029F7268DA43C2D8D7A348F32C280F6 Dch8i
806,096,598 *53AFA35E8F0504AE3B7B68CB75E5E881C28E7D74 DChai
806,096,599 *53A377FDC2589032CFB99E03FBFCA14A1D68972D dchatchv8
806,096,600 *53AB49E9A2E454BD348C5475EB610765B0F1E41B DChB6
806,096,601 *53AA1EB43771F916C6344C0403686AFBEADF9EB2 dchenwiedu
806,096,602 *53A1E18DB2312C78B42F7B83306879B106DBB8B1 DChjk
806,096,603 *53A787FD2E16E7C3EB7A116CF576B685A467AE38 DcHKV
806,096,604 *53ADF7DA3396669A9AC26C87F437340E1148A797 DcHPE
806,096,605 *53A84A60DAE1589080A6C45764082DC85381E60F DcHqv
806,096,606 *53A5A77FCA8EBE8D45F190AF6DE3C84224845345 dchrgrd7
806,096,607 *53A33ED1057A1A8B8822EC8F0F4FD3A4024D3A08 D!chroma7!$m
806,096,608 *53A2C8213492D992526423DEF0E3CBAEA82C44D2 DchT!
806,096,609 *53A0974F0D535EB39452D5AFA470D1119B2E0140 Dchtmzd7
806,096,610 *53A7ECE0CEF0FF7F8B1D436FA385ECB1702FA844 DchUW
806,096,611 *53A970DC160B356236A23536D905AF679A973741 D
806,096,612 *53A1BCBA4ED09B739286909DB9BA77DCF8B6327A D=!cI
806,096,613 *53AAF723B3B5832237AC03D07613CA9D5EBCB5EF DcI0R
806,096,614 *53AEE7B8C73D1D87C28FEAACEE83BE5938F39551 DCi11
806,096,615 *53A9695D4D4E4114FD5D1027882158040996F591 DCI8b
806,096,616 *53A7DF6D6024489B6008ED1EBA85C20034CA32FB D,Cig
806,096,617 *53AB17352BFC89ABD9AE670608EE9C4595AA41E6 DCiHR
806,096,618 *53A163D8D1269E59A1A038649F9174BF8A70BB5A DciN/
806,096,619 *53A3685D74AC9DB446DE1ABF7668A437E521202D D+-Cj
806,096,620 *53AB4151B21117C724F46A2092E763C18AAB68EB dcjgohks
806,096,621 *53A82E4EF0D2D07383940CDEF80EDC6D2C3B1367 DcK-
806,096,622 *53A219E6B62F478C17A985F0D9294B645C4D0A4E DC.K0
806,096,623 *53AC8DFC679095EE6D43C88A0569C655F37CFE0B DC?K5
806,096,624 *53AF70849E36BF289D75A1FD1413FA887B2BFA12 DCK7:
806,096,625 *53AB30592C896E7B9BE23F53C9D589D709088362 dckalle
806,096,626 *53AB4160E3A21E08292AC53020217A216959A8AB Dckinndnj7
806,096,627 *53A1CBD33AD5A8AB455BDBD826B4697FB2B553C4 D?CkK
806,096,628 *53A87DD4FFF2AA9617DD9E6399F62CFFED454ACE DcKPY
806,096,629 *53A966D5CF7E46A3DE610719DF36DDA27F9161DF DCL.2
806,096,630 *53A27C4CBB497F5745010D7268C99B87BB7753BF Dcl2D
806,096,631 *53A2FFB50EDC7BA710938B6D7E96AEC1686C2449 [email protected]
806,096,632 *53A832181230B6EB6EC36315C35420C64E5D8B9A [email protected]
806,096,633 *53A4945A9C55AEB106AFF705D790DB669DD4718D Dclcfctns
806,096,634 *53AE6E4B99E75F1028006AA7712EBECE5C7A3C99 Dcle0
806,096,635 *53AC294CAD46911F436DABC249FD5D93DC1688E2 DcLGH
806,096,636 *53A89D6BD39AFA91F465569D1935A2260E37DD9C Dclm3
806,096,637 *53AEEDB3E03ADBEFC480E7B2150469EA4A99E9BB [email protected]
806,096,638 *53A4FA5090C0048954B8EC08A27B530DF62BDC7F dclnrd
806,096,639 *53AFC8E606085E5141AF82F72BA01877E362189C DCLSSRNS
806,096,640 *53A8E1A82534D2B60CE96F22C7D99FFB9BF3B337 DcLV?
806,096,641 *53A94BB8476E7E544738C71950545F6E52C30B80 Dc_lZ
806,096,642 *53AE28C2214D3A71AF173FA47101229BD4738868 DCm,-
806,096,643 *53A52ACF69496E641AA4A5B50114D111401F9148 Dc/#M
806,096,644 *53AB39067DD24A855A56F7B80D21D490330388F9 Dc$M0
806,096,645 *53A6E78A00BB8DE99FED054340EAD78C34ABCAC7 DCM0S
806,096,646 *53AE41D7DFB85C432B5E079414E22633D10CA9C1 DCmc"
806,096,647 *53A8052EC8D1CA40732E7BAF2622DAB611FD3B4B dcmg!
806,096,648 *53A8E3EF25422CD5692612A71D722C5B746AF6A7 DCMt;
806,096,649 *53A9D467F12DB0C51C6C88A00CAC000387A8EEA3 DcmX9
806,096,650 *53AC2F24B28301F2A3FC354F427EA142BD07D322 d<CN
806,096,651 *53AC45752A3573FBF5291256F3B0B30D631FF498 DcnEW
806,096,652 *53AD68517031CE1DC74F9005295C99B1939B7BAD DCNg$
806,096,653 *53A0786AEB48D555C8A16635FC693F5D0B3691C9 Dcngstv6
806,096,654 *53A7A2F247C472432501C52A1B9CDFEE58A88947 DC;nj
806,096,655 *53A6ECBC661E4D61F9E16E2429D33E47DD20B376 D+CNp
806,096,656 *53AD851C68D7CADD18664ECFE2BD4908EDFF871F Dcnq0
806,096,657 *53A5F04AB1125DDD20252E01B36AD9169D26DD6D DcnUA
806,096,658 *53AEE202B3C545AFEAE9F7E8409BB0284E879EAA dcnye
806,096,659 *53A442850522F24AF2BDAFE08246C1CD5F77D0F3 D!Co.
806,096,660 *53A503B89D80F4D9AC549F4ED0CFF153C9E83452 D/cO:
806,096,661 *53AA0EF9BBB4CDB3A333B65324CD47C36AA1958B Dc:-O
806,096,662 *53A81A7E74CA64C383E4386152048AAA757DDD90 Dc"O=
806,096,663 *53A121BED29E1EBA9B7F21EE14050356A1D4B8F2 DC+oB
806,096,664 *53A0C095CCE656C8B12313D2E8993074ABD430F9 DCojR
806,096,665 *53A68E8BEC218507941F036AD06B4EC1A23FC5BA DcoL4
806,096,666 *53A3111DF0D7958447088C8A8FD18F286AE041D6 dcolschen
806,096,667 *53AD64567B9F821D4B4BF917305AFA01F4333235 DC;Oq
806,096,668 *53A39A88927F6A413266A74B9F7CCC68E051A6C1 dcorioles
806,096,669 *53AB805F4B5CD4865F76F9B984E497A00688F8EE DCoWA
806,096,670 *53AF3CA15081478017987FDCAC2FA10CEBD1016D DCoX(
806,096,671 *53A2619191A9EB8F2987898EEC75EC98A3BB2DB3 D"=CP
806,096,672 *53ACE46F1F9D7D6EAB3A1B355A1FB531D249D21F D=&Cp
806,096,673 *53A004A5C43097B3DA40A8AB625F609863ADCFB6 D/Cp%
806,096,674 *53A544DA83920B0A347CD795BD287A31F85C8F0D D&C-p
806,096,675 *53A5DF7841952503C3E74B93357BBB133146199B Dc?P#
806,096,676 *53AB4DC84586031FC32F605DC37E48DD768F4BD3 D=
806,096,677 *53A8E26476B8C101FCFEA419FCEA58DBC63E710B DcP#1
806,096,678 *53ACC479D28E22AA6CF36ECA284019735C011FB0 Dcp5/
806,096,679 *53A1787AF27CEC82BC39A0BF6A9C5EB6B706C8D9 Dcpc6
806,096,680 *53AB8D4E7472C016CA45BF8103A18486B990511B DCpHW
806,096,681 *53A6EE6FDB29FF938CF9DA69AEB2D4854FD94051 DcPL8
806,096,682 *53A5950B2E9B357ADC5A6BE0189E9EE6ACF8CBCA DcP.v
806,096,683 *53A26D8DD5EFCD63F4A89D53915C8035023085F0 Dc)Pw
806,096,684 *53A721D34056B52CBF879A175C6C020A9AE5075E DcPZP
806,096,685 *53A4DBE02A8F184B2DA92F804486A07CFDB13663 D.CQ$
806,096,686 *53A6D93912A88553EE3A90A38A15057610D129E1 D+Cq!
806,096,687 *53AD7D82D9C0D6EE71E0BEBE4BA91613840130E5 D,cQ2
806,096,688 *53AB587EC4B7DC185F9917DDEA3E88D2C82F2954 Dc
806,096,689 *53AF89BE3DC60C91966898026D4AE276C775200B DCqg?
806,096,690 *53A9B3848E5795C26B3E018E02CE1698770D940F DC&qj
806,096,691 *53ADF940A351F89207F2496433A9FA2385579DAA D$cQL
806,096,692 *53AB05D614AEB9D343A6A4C82B228A85F99C2787 DcQNA
806,096,693 *53A12B0BF3AE33D2F3B0A0A4072CF35842D6C5C0 DcQr?
806,096,694 *53A00A7515B1987912AE126ED3BF1623B2FF71D6 DcqZG
806,096,695 *53A3B4308CEB72F03D2ED003B6A24A6F21B58685 DcR;0
806,096,696 *53A88DA083B15A96215368DABE169E2E8A060DCA DCr3"
806,096,697 *53A5BA35F4569557604F0DBD77785FDC4DA2E605 dcr5c0m
806,096,698 *53A934C435F2F85860439A296BE38FA47511D0C4 [email protected]
806,096,699 *53A6DC628BAC4611B7432BFBDA06F8D1E6892C3B DCREW123
806,096,700 *53AAD8622D4290765E86318F45567D9F0A79D980 DCR;g
806,096,701 *53ACD7462E6FF8B5D8C40E14082E24AD3F966556 Dcrirez5
806,096,702 *53A1688D9E7EF258A640468955A0C40BEBFED530 Dc?rp
806,096,703 *53AA10C97AE0CC7DA1E8068CCDC4FDCBB3ED0FC4 DCRrv
806,096,704 *53ADD2AA774D3B5DBACBD0CBB29D26E4B9D5D0C3 Dc,rs
806,096,705 *53A089EB0962D2A1083C10A226A2247DD8645F39 DCRvK
806,096,706 *53A2CFE792841EBE1FC8860B1DE192BB269C3E8B DcRW,
806,096,707 *53AA7F0CA10449561426AF59AC6CDAEC02A7BA36 DcRwp
806,096,708 *53A93046CA6FEE606F9A87497B55706D51EF4420 DcR=Y
806,096,709 *53A8C77FF29D1AAF56B549B343348917509B5939 DC;sa
806,096,710 *53AFB04E54404EA54DBA46F4E5DA210CC76A8EEA Dc/SE
806,096,711 *53AC4A80E3A7B49112D28FEC5E69ABD08193166B DcSeZ
806,096,712 *53A58A7339591C32AEB6F84A00C520B788CE7D64 DCSHOEUSA
806,096,713 *53AD2921D6A12E8F7281CC97C3C5479A95226117 DcsHQ
806,096,714 *53AC755CD68560B95ED026EB7486A8514FF50B8A DC"SI
806,096,715 *53AE5433E26F85FE8734EFEB7EE37831E2F55B59 DCsjd
806,096,716 *53A6BA5F871C21C6A0C2BDA11520A9436C2E221F DcsK6
806,096,717 *53A62E6A66282C3CD320DC257D1ED0BCF22FA993 DCskT
806,096,718 *53A0DD26EF8A47A70CA58A58588946CA43CEE67D dcSl
806,096,719 *53A236D7BDC41E51B53B411B161A33B3DE35A095 Dcsm(
806,096,720 *53A468602D7470EAEF0B12EF68188094314B6722 DcsOT
806,096,721 *53AE288218932944E1AE1F5552200D6E83FF19EE DCsr&
806,096,722 *53A6CD3D3C2E8B8C5A33259A9E918D019B4D3079 DC,sU
806,096,723 *53AE3404937370B1ABEC41789A653E698441F5AD [email protected]
806,096,724 *53AE43EF2D78748E51AE5359C882874610DAB980 D":cT
806,096,725 *53A34F8FF4A4068D8128B1721FEDB1F5D3246CAC Dc_T6
806,096,726 *53AF504C0DC9662C52FD6BC62233652D7421879C DcT&F
806,096,727 *53A15ACCA6C17C0B5FD7585D488623E4D3942629 Dc&Ts
806,096,728 *53A30903EA125F1924637D175AC3F4029BA1BAC2 DCTTp
806,096,729 *53AD3960B0902BCEC813631D3E15C34EC99A7394 DC$U+
806,096,730 *53AE6D7B85F2CF608F5CFB0E66FB8402F53E7816 D!Cu$
806,096,731 *53A2999868B665A8E2DAECC192D4F553C38C0F80 DcU3K
806,096,732 *53ADCFE758D08F8CD838666F03DE0389872E2080 [email protected]
806,096,733 *53A3B290EAD5FA6EAE7FA79F77A52CEBC18F0BEA DcUiP
806,096,734 *53A03204DC5821E299CDE949CD9EBBC94AF04736 DcUj$
806,096,735 *53A35B875195E81A335CDBF90DC2DAA69BBBF1DC DCUk&
806,096,736 *53A2A9FC9613F5D97AC2ABC583DA4ACA532B5643 DCu)n
806,096,737 *53A76F9AA91867C24D5FB2F029DFABA42F8A71E6 Dcusters8
806,096,738 *53A8D66F45437D2C9B60D73FD74490FDA4BFEAF2 DC.uu
806,096,739 *53A25FC5C0686271E7EFD86A2CC4543F1F65B97A DCU.W
806,096,740 *53A603CFE2AC7C2CA2F847A8991BFB597EB5306B D+!cv
806,096,741 *53AF6FEF76C6156A8CD7EBD1307B2F44A5EC5C82 DcV?0
806,096,742 *53A3D82EBF7773EBC832BC7D57BD39BF6F2B4AB3 Dc!vB
806,096,743 *53AFB8AFB04FDE16B407FCDAB5306CA58184F31F DCvdP
806,096,744 *53A2D46876205983CCB5F0ED3C3A4C5EEF96C46C [email protected]
806,096,745 *53A36AFB2CE90E08954D408F326C9D1CE45180FC DCV#e
806,096,746 *53A538FEDFBC5E84D6120BDA0477C0775B3BD058 Dc;vh
806,096,747 *53AFE8EE749EEF0800B8E54148508D37E1805946 DCV(Z
806,096,748 *53A0767169E1FC5D439BD1E9950A03CBBF12B110 DCW4,
806,096,749 *53A3771FA611E3AC3813B690F232F032E0B049B8 DCW6h
806,096,750 *53A68EA8B6D6186D1746D1FAE2582FF5CD2E0A16 DC-WOMAN-TURNS
806,096,751 *53A96BA9DCA60A40314D4FE266884C008E35BC03 DcWoR
806,096,752 *53A48DB0BAA90A2F93D49649230F979EA06B63CC Dcww7
806,096,753 *53A1425AA68A0602478F2889CFEB443D92ABCAE8 D$C)X
806,096,754 *53A403C3080C3586F99550524DAF6B4C937294E6 DcX,%
806,096,755 *53AA1D83D4CBE3A29D4C10EC5478745A00A5D144 DcX8(
806,096,756 *53A9FDD4814D96F924A820C06C1DB00EA78A09C9 D;cXm
806,096,757 *53A7F8DC03AEF1CA0E80ACB191E41EFFA9F1CCAD Dc."Y
806,096,758 *53AE22293A8338E0845B7AC227D0FD84DA55B675 DcYH5
806,096,759 *53ABDBD2E8B139BE579FBC109F0677B5C3363C31 DCY&k
806,096,760 *53AF6D3FB5E161E0C8B3479956BD16DD974EBED6 DC_Yt
806,096,761 *53AAC88A3B00E6AB6BC52CB49F945361BD5B76F0 dczotokveo
806,096,762 *53AE054D80D05E8575429C512C0BB4FEC35E9FBA DcZqD
806,096,763 *53ABB4406210624126A4DB9D16EAE27ACF2C0898 D/!-D
806,096,764 *53A9A6E033F2F826C8CD9E71F459EE72538844BA D"%#D
806,096,765 *53AB585B042FD029B8FD48810F776BAD9FAD7B06 D)!:D
806,096,766 *53A711A914F689E26EADA7B85B12263C5AA1B464 D&=.D
806,096,767 *53A99602BF82EFA43390670D582917D5F7F92079 DD>`
806,096,768 *53A5DF160260947C424E3F63315C517AEF293AC0 DD(&/
806,096,769 *53A201B2505C15BBA6C5A949DE62E04B73622625 DD+(,
806,096,770 *53AE9C6028153F87C1124D68CA724140DD974D42 D`?d
806,096,771 *53A259048A6901D5ABB526D1FA880A8397B2F846 D_&d?
806,096,772 *53AD1EFA0A3B596D38FB44B37C401B6793A70322 D!.%d
806,096,773 *53AA4F64B598F929D7EBBF60E17B92CD0E9C7084 D!d,,
806,096,774 *53A47EBAEFD39BE91DCD70C876BBCE68E9D7CB13 D%d$"
806,096,775 *53A86B0144B68720E122B52F66704D1CC59A387C Dd,)"
806,096,776 *53AA7E5CE9413255C6CBB2DAE4C6E283F9AD9789 Dd)!:
806,096,777 *53AD31A30B58B9BFC46B756B03A81423AA27382F Dd%$#
806,096,778 *53A6D825A5234623149CAE47D5AC3D734EED572A Dd
806,096,779 *53AA4DC04A35F64FD52655A4407FAC9A1E093085 d(}d
806,096,780 *53ACF590233FEDED27CFF24D279C5E3C40376098 Dd0+3
806,096,781 *53AD4FC39D3D9B9318FD9BB6A404B043CBEC6A39 Dd0)A
806,096,782 *53A7E85C63795AD8290C5AE5C3E1E32FA1C556FC ð¡ð¾ðºð¾ð»ñƒð²
806,096,783 *53AEC723676C14CB1FAD3C5F9CE27907EA3A94C3 Dd0lY
806,096,784 *53AC46680C06CDA1EDC986E2056AAAAAE2622B84 DD%0S
806,096,785 *53AA037F10B9DB5A10DA618527D42B7232964149 D+d0W
806,096,786 *53AF67727FFAEFE0A3CE357794EABDA990D013C6 DD1+.
806,096,787 *53A78FC95BC040F51F961274EFDC9FD143172984 DD1(
806,096,788 *53AF5004A55A96B33912C914462CF8D3C15E1C16 Dd(.1
806,096,789 *53AC7A41929F09C0856C72273E1862460D1C99CA dd106b07-48ed-3d2f-a505-c245cd20a92d
806,096,790 *53A60E455C9BB5E11263EE636034F2286FE33E19 DD124
806,096,791 *53AC43B06C5270383652EF19CFF44B31869E88CD Dd17q
806,096,792 *53AA83E40E6265D13FE882D117F49A41AE811D78 Dd1uC
806,096,793 *53A78B8EDB25289D93A846192C0679B9EA3F165A Dd2_9
806,096,794 *53AD0F0E90BEF30BA0CADB53A3F21C8F7AE5F903 dD29
806,096,795 *53A59A3EAE95F202136D2D5FD56A514EB4260FBF Dd2bX
806,096,796 *53A69560AC2B391401676517A846C2E085F6F9B0 DD2%D
806,096,797 *53A0694328C4CA48035D16C63AFB52BBA1499EB7 Dd2n=
806,096,798 *53A99A56E6CD46F1A0386F488D5D37E246488DB4 Dd2r0
806,096,799 *53AF5F15638FF600E7B5B53542DDE76DC0C056C4 DD2w5
806,096,800 *53A905FBB233EAC43131965BF87F135EBEA6D3A2 D/+d3
806,096,801 *53A868ADD392220854444D316B636324C4C51CCB D.d!3
806,096,802 *53A93953F40B3DD20F20F72D8A7706283163E2EF dd3b3599-9ce5-3b73-a58f-3b01fd8c8b02
806,096,803 *53A87231A9CE9D4F58A7986785A844CDB98E8335 D"d3I
806,096,804 *53ACAA3A657D72748BAEB688909CAF9458FB5997 Dd?3k
806,096,805 *53A9AA9D19C30201E71D321FE15B3333B84DFD3C Dd4B#
806,096,806 *53AA55AC6FC03CE8D1C88072886F56CB23F79937 DD4c/
806,096,807 *53A5981E37183B6AE22E8C0598572F55EDDA1918 Dd4DH
806,096,808 *53AE386B419733997AB22FC5A4579334EC330401 Dd4e8
806,096,809 *53A3CAC53CD66BDD8B3597B07F69DB6565FFA199 Dd4EP
806,096,810 *53A78849CA5804D26050B8D5ADF65112E1F858B8 Dd5$+
806,096,811 *53A0AC6A37087825C1368B9A6513B73434B6993F Dd5hj
806,096,812 *53A21ABDA4EA5D336B34BEE883FECB98AC3713A5 Dd5,l
806,096,813 *53AFBB2502DF3AE4331CEF2A2F618E12516FC238 DD5nS
806,096,814 *53A032B0170A0AD76B0AC738073BDBD81E194816 Dd
806,096,815 *53AE3622FC3337922FA9F1DABD0AF44F06084B80 Dd5UZ
806,096,816 *53A185E39174D15B81A00BC2C529903F6A2C104D DD5Wk
806,096,817 *53A8290A1F4DC25B070A10F018BB3D17F1F9B3BA DD5XQ
806,096,818 *53AFFE79897852D93757875045F9E3027B60068B Dd60:
806,096,819 *53A6CBE8AAC165F04248D704D01DF6D1F8F4F256 Dd6B1
806,096,820 *53A65AC37E160EA56DC1C3401EB5FF1AEC4D555F Dd6o$
806,096,821 *53AAF52B5D81601B811D8BCB5F7BF6352116988D DD6_p
806,096,822 *53A4761EDB8331828C2F29081E85513199870F16 Dd7Du
806,096,823 *53ABE7B1DC10D0B634612F6D77A7EF7589EEA6A5 Dd7nI
806,096,824 *53A35AA5869874BE6EEC5DC577EF50EFF7F9D6D3 Dd7vV
806,096,825 *53AFD96B325AC87C96CE9CE988657D90D29CB32C DD_$8
806,096,826 *53ADE0413F65502F7A1D3AD789E21F17790EFD90 DD8&&
806,096,827 *53AB17C893065A28DB5B95442869A24082973C17 dd8ba7a88a7d77d8f60827bbed8deef5
806,096,828 *53AB82F04FDDE8DB98658964AF5EAC71ECD458FF DD8L
806,096,829 *53A90D56B12EDA2C43F6AA54CC0A3060730971C5 DD8N
806,096,830 *53A64E1BEA7C491AF495353076B1E550A000A3ED Dd-8o
806,096,831 *53AF97353A7BE15F6849A30297686067DA467139 Dd8qm
806,096,832 *53A64A59B36013023C9344316B84EA08F3C3E7F0 DD8YS
806,096,833 *53A9B5A9B4DF21EF05B8E0ADDA757C508965119B Dd93
806,096,834 *53A770401037AC58E463AC8F1B79C3EC23D97E8A Dd98f
806,096,835 *53A8D5AC29835C7713644A3E04F77B9C12CB0305 Dd9C$
806,096,836 *53ADBB67C25045C1E7D26FC9F55FC434F771C78E D$D9D
806,096,837 *53AE437CC08CD0B65C417D2C1B56C6C30E42C115 DD9g_
806,096,838 *53A913BC15FA8B45E75CD429F8927D1690559601 DD9_i
806,096,839 *53A95DFD316F46023C6924BD2740A80DD1C96992 Dd&9j
806,096,840 *53A49F35604310052622DA9ABA1195D9F7DD5104 DD9oF
806,096,841 *53AC7E9E4799D024584D7C17B4C7EB9656DD3DC7 Dd9,q
806,096,842 *53A3786FD3C6E2E0803D57110A47A89BFBE7750F DD9vt
806,096,843 *53A9CE646BF5549781AF26E86885D371AA134B92 Dd9wv
806,096,844 *53A466A4A00EA023C34B246E6A853727247F8C3A DDA&;
806,096,845 *53A7CB74B5263EEDFB109D68FF883BAEE397D4D0 D/+dA
806,096,846 *53AA8821EA86CD4692DD3EAAA124DDB4C09E3430 DD.a7
806,096,847 *53ADE8E630E6DBD65A7062121FCD922E995BA2C2 DDAB+
806,096,848 *53AE3D453874B5D7F4FC1E740D6E5DEB39690625 D#DAd
806,096,849 *53A8537131BC09E3CCED0CFDCC7DA6B76C49346C Dda,h
806,096,850 *53A87B7E25E299D66A8186B6A011AC79ABC8B887 Ddaignez9
806,096,851 *53AD0388D27C50B4B3959E4FDF431D3CD89F6218 DdaIv
806,096,852 *53A809C44EE4FE242944999F6C952C23C7DBCF5D D/dAm
806,096,853 *53AE4D17F9ADF898A28139DC7497039DDFE90456 DDAM2250
806,096,854 *53A4E60274854D60A4659947F334F68E4DCDF9DA ddanz123
806,096,855 *53AF620380CDEF6B8F093011F28DA2F5C2BFFE15 D&dao
806,096,856 *53AF126D2404419D01F522E8BD667E3924087159 D!DAQ
806,096,857 *53A260ACCA8259C19B264F3ACA4EFB024EC1A722 D.,db
806,096,858 *53A94EF752F6CD9BF97513D32EB635E2BB9DEF73 DDB1Y
806,096,859 *53AA5D5E2F3696EAA5F7DC7F1707A63593539E6A DdB5j
806,096,860 *53AA9B9329741AB3C2ED07EE5257C1C75A0EDA43 Ddb?6
806,096,861 *53AB4138E1EACA24BE0BABD4A3885CF6625792C5 DdB?7
806,096,862 *53AA205CAB46F5D0CA96E37097BD4D94851628B2 DDbL?
806,096,863 *53A014991B3EAC3F4442BB820B688F3D94899BEB D,dbr
806,096,864 *53A3835AA00C3EA5288F79E720E60007B31660A9 ddbrooks
806,096,865 *53AB59CAD7BC62183AE06DEE7280E2720FDD13ED DDBwI
806,096,866 *53A9CE41506957E25F3C39A2AB5148BA08A824A5 DDC6e
806,096,867 *53A1B34382BF7CDE833E42B0A2AD0C3FCF4BE96C DDc8_
806,096,868 *53AF55851F2C8F6F2E9D9EC14A168A6D064853A7 ddc97919df28
806,096,869 *53A1540D91A00845EE9CAC0472A26CF5E091A38A DdcaI
806,096,870 *53A64F85D1DBDC284893CD32686953767EBB8C69 DDc/K
806,096,871 *53A79DFA008F37A5F4A6804E361A53071A171BF3 D.Dd/
806,096,872 *53AE47459E122E9F2564D053AF13DF2E366851E8 D)Dd(
806,096,873 *53AACF4CAC43D7E6C3B1F3D5C5130BD3B383007F D?)dD
806,096,874 *53A22B42A3E0AFDEAE1E4D36A6EEB7F356A8C2E1 ddddqqqq
806,096,875 *53AC22998A8F5E9BA8FE66C909427A46885AD9EA DddEV
806,096,876 *53A361C4E06B7E4F7C01169AB0DF8A5E3CB70D21 DDDhm
806,096,877 *53A396A9342F3C73340C8F70F20F78892D2417C4 [email protected]
806,096,878 *53A9D49FEC572E954F5B58B5090A69005FD0F715 DdDvE
806,096,879 *53A765F673FB9AABB439A2F3A6CA2A7C08EBE040 DD&dw
806,096,880 *53A96DB4D463E9EBF3B19E84EC943F59A0CB982A DDdw)
806,096,881 *53A232E9770EAF756EBE61EE46D071CFF796AF15 DDdZS
806,096,882 *53A3CD346D66748406B6FA09F8C51F600781B2E5 D).De
806,096,883 *53A1094371915A1CF6435D78B08111E13500863A Dd+E)
806,096,884 *53A4B38E4FCA82326E194FBABD0F1AF60DDAD15E DDE4g
806,096,885 *53A07276D6C0AFF62CC90AB89485BEF5B1B46212 ddeadman160talk160
806,096,886 *53AE263532B3B95F76F8FB38D961B3D9D52EC7E8 D
806,096,887 *53A05A3847CCB62852B7162C2A4CBD5A81927197 DdE:C
806,096,888 *53AA8480801B7E9A463CECA16CA1EC20FD4EBC38 DdeeK
806,096,889 *53A847B1214FB1FA60A927A2D207D8D4FC5362D3 ddefault:1
806,096,890 *53A3E0E87B43DA09EDF733DB3A212218AF0D88D4 DDeK
806,096,891 *53A09AC8F7E07DE56CD06B684AF17307B7863058 D"dEl
806,096,892 *53ABD3B89C5DEC374E12475412086B794F96E600 [email protected]
806,096,893 *53A465D1B6E4AF8677ABF5E4953AB59714E48CFD D%!DF
806,096,894 *53A42878CB81BBB28FC1F4A8AAF79CF852072EA9 DDf2-
806,096,895 *53A6D47FC9F09D53D09480022BC3CBCE0420DEF1 DDF5%
806,096,896 *53A55DF48993D7697AF2F7504845530FE29E3F93 Ddfag
806,096,897 *53AB6E639CF3C288F7A2CBE0E7CBD11F857292F0 Ddfdsler2
806,096,898 *53A3A539AB2CF133FEEEFCDB700A6BD18AF5120D DD(fE
806,096,899 *53ABF5270DCACB0478F2155CA57203EF270EF131 Dd&Fh
806,096,900 *53AFE40A7F8FCFC2BC44C08AB1F8BB42D8D48EF2 DdfNN
806,096,901 *53AE123C10F8C5E3329F6774B0297793ED7175FC D/dfo
806,096,902 *53A69E64CD9DF9CC2C6987F10584D4BB4134CDD1 DDFTu
806,096,903 *53A20DBBE2968B2A07D34E50EE5F4F618307A2A5 D,(DG
806,096,904 *53AD7A3B085B57A795B2D14F0E567D44DEFB1A50 D?
806,096,905 *53A1C28761AEC506850278AAD6B4841405A12BEF DDg=
806,096,906 *53A4F10D27403E5AE6A0AB422C7BF0A1948F280D D_#dg
806,096,907 *53AD959F0BB3D22080DE7CD781C636DA0E73CC62 ddg.160
806,096,908 *53A65FA8B780780A488EC11E1B2B4126CF31E31F DDGFP
806,096,909 *53AD82171DC751B656F5928F67C0FCA698577C8C D(DGq
806,096,910 *53A36BB943BC31BEB285351406051D9DE95BEAFA DdGrV
806,096,911 *53A8DB5E590494B73CD43B3E651C9606FBD5B024 DdGuF
806,096,912 *53A1E26610EDF800F562CCA5899105F884659AEC DDGvR
806,096,913 *53A4DE4528978090331697A206CBFE08B3CBF090 DDgWn
806,096,914 *53ACB947A7F2747DD6F95869C5D4F69850B6C46E Ddg,Y
806,096,915 *53AAC48290CE5D109F7D72BEE13761408DF615E9 D/Dh&
806,096,916 *53A1CE9F973D149989FC92310AA6950F2A362698 DDh)+
806,096,917 *53A91D081E847B7219A392CF2F72F9FD73CD26E8 DDh1g
806,096,918 *53A187E0C1B6C1DF0CB2711643AFE8E400FB96BF Dd(h3
806,096,919 *53AF582EB450366F441E87C3BB3E4CBEA41CFCC1 Ddh3)
806,096,920 *53A34D3A7ABAEEC45638EC27E40F58EA67A67BBD DD/H7
806,096,921 *53AA77FEA0290A1B4CD93FC97FB91D3471AD6DCE Ddha2
806,096,922 *53AD772CC4EE85FD3EA2A62A35DB4658C2A12F9C DdHBv
806,096,923 *53A3214F9C1702FC37AE771C74C9F7EFDD4C4427 D:DHC
806,096,924 *53A7DA3D9F83E1B7523F6C829DBF37ACA1250A41 DdHC
806,096,925 *53A87219A7A8FC0BF34AA507DC11887048750183 DdhCN
806,096,926 *53A5E22F2A0ECF1F9E33DFE7B91EDCD04AB0C787 DDhp-
806,096,927 *53AF372A46626F717E9CFF29A5F05E0CF5AE6680 D:dHt
806,096,928 *53A79DAE2B94E4784D11443CC655525C86C4D1F8 DDh:u
806,096,929 *53AB05E9A2BB46182F6D97E30EB85986D5FB7099 DdhY:
806,096,930 *53A2492283B16B5535B3B20B73AEEE8E3C9A0E76 DdhZR
806,096,931 *53A49D36359BF8B320BFF801197DB37693D9D61A D&?DI
806,096,932 *53AE965FA948FBFF47B4E882E38DFE1E26E1653F D/Di?
806,096,933 *53AD70A17A290437B240A6AD005115549F74AD8D D"D/i
806,096,934 *53A09C068A881503AB8D966702432217965BC24E D=di0
806,096,935 *53AF0FDC16A5511F1A59DDB7798356BFAB51A651 DDI4T
806,096,936 *53A116B809BB558DD8EEFC372B3D1EE6D32098D6 DdI7S
806,096,937 *53A40FC8CEA45F9E6A38E732F9F34CACD849C499 Ddialect
806,096,938 *53AF92C43251AD9B0BE046F041C59C6BF56C527E DDIc_
806,096,939 *53A6BB5DCCB6CD147EDB6A5795CB2D7422EC9B8C DDIHk
806,096,940 *53A1581C701E4B9E67443BA7F2B1F610C960C7F6 D;DiL
806,096,941 *53A192E1A6D4B3F6A12148E84F630A7D942F6AE7 D=dj(
806,096,942 *53A5FF4A6BB2BB24B5A760ACD26B9FB7BFF064DF DD!j5
806,096,943 *53AF92C4507CACE0179E917E8F489B1F046DA95A Ddj9N
806,096,944 *53A3AA756B0CE34F73DF0CD7A635C8C91E7B6AA0 Ddjao
806,096,945 *53A70B213DEAEEBA4814A725F47FACF17AB050D7 DdjQo
806,096,946 *53AAAB72AF3BAB5D1384606C3CF5DBA658391206 DD$jt
806,096,947 *53A0C23D0BB22672ED939D0388A2259664665233 D;"DK
806,096,948 *53A0F1EFB8113BE0378D14B7AD6EEE37C76F9122 DDK/%
806,096,949 *53A8FAE091674CB9E8AD3F1D105F2219ABD4E67C Ddk&,
806,096,950 *53A396270BDCF9F51463B1924C486D7BD920BB98 DD#K4
806,096,951 *53AF54843B952D8E760884E17CD141029EADDBAD Ddk4U
806,096,952 *53A4EFDD52B08B817AD8B91473E0CB778F0548A9 DDKC9
806,096,953 *53ADC237F80BBA4FE97C2BFBC3D7C4B58202422E DDkfi
806,096,954 *53A34484B2274507A2F138E477E5B6436277602E D)DKH
806,096,955 *53A3FFFC19B04A6D3E2116D01FD576A8F272080E DDk;j
806,096,956 *53AF4A1192026E51E3E61B1666E9348E86FC6D75 Ddkj4
806,096,957 *53AE12B9B6F5A29F4328E6BC7A9F20F324C5D89D D$Dkm
806,096,958 *53AE0BAFF881809A76619E830712372F2E9B70AB Dd(Kp
806,096,959 *53A4EAD39B6210E595763755F92A78D69F8DFE92 D/DkV
806,096,960 *53A776CE7246469833881403CAD2847CDB89C88B DDK=Z
806,096,961 *53A1D631A9E0889C098007A6B0311EF633D87F03 D:)dl
806,096,962 *53A8EC81B3A635DD117B67A92CA27665ECA93C63 Dd$LA
806,096,963 *53ADE72D60BCDE9DF967EE1E31CCE31E5129A3D6 D(DLE
806,096,964 *53AAB3FA253AB99628B115E7F57AA3672F90BBF5 Dd/Lj
806,096,965 *53A57CA58C3AEB2E14D325F1902F6B1AC425970A DDLLY
806,096,966 *53ABE8EA6C1727BA83CD28EB909D32F56F70DB49 DDLMg
806,096,967 *53A4355FF780919B47BBD84145E79368B547992D DDLOe
806,096,968 *53A4E61ACC799DD2CB9AB7777CC8ED1837035C8B Ddl$s
806,096,969 *53AE76229B95706E0DA76FB6CD800FA8D33BAF48 D,:DM
806,096,970 *53A2840277E25F929ECE8294E957BFB07A9409DA D,D)M
806,096,971 *53A5738207A732D081E8EF2C83CA373B9FA749A1 D&=DM
806,096,972 *53A74483528A1D25F02650DCF733B4D9ECF7F25C D-;Dm
806,096,973 *53A0AA0909C51CA4E2A7D53E2F755B929C96068A dD~m
806,096,974 *53A2A2DEDC73ACC7E277CC63FD72CA3A72F961EA DDM1!
806,096,975 *53A94FB995C12B8A07D1FBA9E042B5DE37451BF9 D_Dm6
806,096,976 *53A9F2B1553C683B5704898DF357B16360837071 DdmAI
806,096,977 *53A97BB49909E2A22D35F795B0098B9044F2A634 ddmangos1
806,096,978 *53AA79F8D173F574358769106595270BC0F89176 DDmC5
806,096,979 *53A83CD87BDC6A3025A23A7539DA22EC7A41C12B DdMo_
806,096,980 *53ADE00728053E5E454E55D430060D560EE0864C DDmU&
806,096,981 *53A3DA364C8FED84F5D1719FAF551FC4B7C88434 DdM)U
806,096,982 *53AB209AB8D70E69825D2788C9705A6232AC45E0 [email protected]
806,096,983 *53AF7E5D24B1B7E105856C3906D01E1F8DE39973 DD;N&
806,096,984 *53A2C8B75546F143426ABA2829DF38E1749F1B42 DD"(n
806,096,985 *53A45B8A1E9D488234A19192B694402F3DAA6839 Ddn5m
806,096,986 *53A1E4E3B2FD29F898F329D2040B6F54A6C56816 DdN-6
806,096,987 *53A43A4864B18DD57B0C6B8A56862C269ABBECF8 ðð»ñŒð±ðµñ€ñ‚ð°
806,096,988 *53AB79C8AFBD70DB9B23620A46AA17F62088A24E ddnietsing
806,096,989 *53A304EF81A013600340ECE544409AA6CDB25DBF Ddnnnlsred
806,096,990 *53A14526752FA95F3B5904E1E43AE82CA724B96A d
806,096,991 *53ADA80CA1EF55B23C9F345A935981B04FFAF85E DdnpD
806,096,992 *53A042E2E55DC5A562207D7D9E21C463B02A045C DDN!R
806,096,993 *53AF09D4507C0CFA75429BC4CF685B83990E8F0E DdnR0
806,096,994 *53A2D34218769A3612D3F149B399A1DF15DAB903 DDn
806,096,995 *53AB983650E782295A3E571CD811D75F49625868 DDnW%
806,096,996 *53AA3BAC7A8418CB7360165C096562F084CD9B72 D"_Do
806,096,997 *53A2B8CBB3ECF5DC38164B11366A5641DF9B0279 D?+dO
806,096,998 *53AF810B2B88254ED2F126EB6D00942F5FE32933 Dd?O;
806,096,999 *53A56DC2F6DE83D8AA5048D6C8BD1AE2974FA994 Dd.,O
806,097,000 *53A2F46A1B5CAFA7777E988B894E3C1700D9DDAB Dd"$o
806,097,001 *53A1909A66531E202DA57BC5E5448AAA184D27A4 Dd#o
806,097,002 *53AAC84D57048D79C8D7BE1823E06B0239392A51 DDOCV
806,097,003 *53A9227DD3A2013F6C2E344C5F5AC1947E7E276D DDoF-
806,097,004 *53A5C4CBC0F1962B24860E0522BDDCCD602EB766 DdoF)
806,097,005 *53AE8914A43F6ADF93411D17E4FE0F7553315D2E DDofK
806,097,006 *53A50E69BAFB42E4062515E8F8C01707621046E9 DdOK3
806,097,007 *53AD34E6EABCA4D45B779A9500E270904E24DA5D DdoNF
806,097,008 *53A7177B0DB7525F6B38928BC6305D99E65F58BC Dd!Oo
806,097,009 *53AA27DBE860B27E2F19574FDC8CD6EAF92D85AE D,Dou
806,097,010 *53AFE79F4709397762A468E9349F27A1884D930A DDOwj
806,097,011 *53A8A38D6C8EEC5AA11C37E00C4EB002B0A560E3 D!d%p
806,097,012 *53AA8B5948B2576F1C6212566A8B4764E6A858BD DDpC=
806,097,013 *53A7D3E7D6EFDBC9F79A20A6916D54F0559ED440 Dd.pg
806,097,014 *53AECA0DFE4CC53745AE75BCBBE4B6D70ECDCE5C Ddp"P
806,097,015 *53AAD20A9E32FD634E1C3B2EBB4D9935D61EAC79 DDpp3
806,097,016 *53A717663557E942803BB8237729EBCB47D08ADE DdP:Q
806,097,017 *53AE2EB8C1CCEEDFC30F30F464C3B4E6260A54C1 D,!DQ
806,097,018 *53AA53C9E0806E31313A9FD802478BF9A0E836DF DDq#"
806,097,019 *53AD325E8938469283E7A7902DBCEFCF155D5BEF D)?dq
806,097,020 *53A7FDF49BBCFD9856E4C4DADEA504A25834486C [email protected]
806,097,021 *53AB72D7CC362B579779C945965B35235A05E980 DDqdA
806,097,022 *53AF1E78C9D5CB9BB534AEE9933FCAF414C57F07 D+DQH
806,097,023 *53A212C2F4537AC256D8508EF72237C1CAB797FF Dd"Qh
806,097,024 *53AE5F5DD1A15119AB0879107E992D208E4229C5 DD?qi
806,097,025 *53AA8F21896F01039660325AA05C219C111937A8 DdQ$N
806,097,026 *53AE93A51D0C619B921D7F3069A66BCD84A52174 Ddq!N
806,097,027 *53A93BA82DF30CDB9604A47AEEF3F7AFDDC634CD ddqo1skf4fo
806,097,028 *53AEB968EB4FB851A08EA812AA03030D84C6E838 DdQ$p
806,097,029 *53A041BB8E589177FE8701D963AA7699E96724F3 DdQv8
806,097,030 *53AA0FB0378C38A3B016159E021920E5E35DD757 DD?R%
806,097,031 *53A54EF7C5A6F6B8217ADCBE591527B355512FED D#!Dr
806,097,032 *53ACEEEA4451BECD293C9929CE70CACB68241E88 Dd::r
806,097,033 *53A9033F8F24C6233B951A2FBC908E7F27922967 ddr3c0rd50ut
806,097,034 *53A5B8B3783B79C4D2E5BE536D7D6797C9F8A129 DdRAn
806,097,035 *53A086F8853ED8AB2B9361FABCD028D7AFC7D36F ddreams2
806,097,036 *53A5A99C40A5911B7A2A890E8B6313B5E6AE2C9A D_Drh
806,097,037 *53AAFFBBFB479F457CC7A76C58B84E0EB0A54786 DdRKs
806,097,038 *53A3F5910ABCD93BD02D43FD6C3BA72FE196F67D DDr,N
806,097,039 *53A82381E1FBBB3DC8F95754396461AE3DED3D1B ddroaa
806,097,040 *53AAD0DD1E8C5ABF36CEBFCE469345D59A864891 DD;rU
806,097,041 *53A7642808D317B6E3CE73B1276C80C4ECAB894C DDrUt
806,097,042 *53AE33F12DB6A5B958340889B205F9DF68901AA1 DdR.V
806,097,043 *53ACFB307192B4C3CC5EC5F213DE8D1A58E668E5 DDRVO
806,097,044 *53A847DA4C45F077D525227D6C51209D297BC26D DDrVu
806,097,045 *53A255D7DB5B3C6A277F6AC7A820B2F6A2D834C8 DD%RY
806,097,046 *53AE272F05E4B8D507409FA7E62CE2397622A67D DDRZD
806,097,047 *53A57616C7D51C6D19A69E1EFD04E1AB816109E4 D-D$S
806,097,048 *53A6468A4C2E1A21CDDB99DED4AEF11EC3C823CB D$dS
806,097,049 *53A84B162930F51217F652C36BDF4BD762964AD5 Dds1g
806,097,050 *53A34E41B1C36C47CB48DEC15941487A8FA26665 DdS24
806,097,051 *53A2A07790E1F0AACB719E75639672E2416A84F3 D$dS7
806,097,052 *53AAC815BC1A0332AD4EC4740262A9CCFCFCEC81 Dds8g
806,097,053 *53A14BB7854B56F6EE5EDEBC944A90A933BE2685 DDScW
806,097,054 *53ACB85C8F56B0A04993CC707B42F70270CC3BD0 DdS$D
806,097,055 *53A29A458AFAFEC6FE9D9D49E68D7220D4B8715E [email protected]
806,097,056 *53A6BCD6ECBEBA5438CF28AC330D451F601D0AC7 D$DsH
806,097,057 *53A81B5F0D62E8069686DB347E396630B6524C25 ddskstn3
806,097,058 *53AD7A4A277FF3521A1E2F1B2F0E926E993CDB35 DdSoD
806,097,059 *53A7BE55D70318727E679379F40F9B03006E8937 DDsPa
806,097,060 *53AF4C7F7DC8B66903AC97BDEF1FD1B5462BD092 Ddsstrles
806,097,061 *53A034358269A2FD045D6A83F6E8382B5796F499 DdstI
806,097,062 *53A666DD3D7FD676E584E561DE4C6266BE626223 ddstkn
806,097,063 *53ADE9BC830DFED6DDBD204A8BE3BDAF46C2A2BF D-dSv
806,097,064 *53A49BFA989672B4C738D4067677A39C92AE2220 Ddswefp0
806,097,065 *53ABF508EBBE6EC0CF4D4654B1FE9A14A352BCC4 D_dT$
806,097,066 *53A63C3FE8980D0FBEFD4152C7E28DEB6078A56B D:dT
806,097,067 *53AF9F5A18E6E2FB7F04075AAE49E41DB9A4584E Dd!t#
806,097,068 *53A2031F48F8630A36BF15D940BD0E7211BC6F5D DD&t4
806,097,069 *53AFD53A1A71BBC8678CE2DB29B7C24D95534555 DdtEk
806,097,070 *53A6F47B98F7DA11FF50FEE8132C75639EE7FC12 Ddt
806,097,071 *53A5BC51BFA4FC31338969F42C547B26F946BD3F DdTOe
806,097,072 *53AAA8FB3B5F26CD9DB36EF2C2A9CB0B7B3BAB3C DdtP;
806,097,073 *53AF66693EE814C25CF076C730D1DCBEAFA78DFC D!dTq
806,097,074 *53AAEB3F73CADE15E0E02FEBA4B9E6DEB2866ECA DDTQj
806,097,075 *53A6D591DC67DAFA857C56B94EDFFB87ACF2AE3D Ddt?r
806,097,076 *53A264E31F3E3F82486ECD7A91F6037BF5E6A4DD DDT/w
806,097,077 *53AA043A9729BEDF7623CF19FA89A84D59C81F2A D/du0
806,097,078 *53A7A46D973927F8127A40BBD5B94553535E09D9 DDU46
806,097,079 *53AF646F99E29E53803C91AA5762CAFD27048F81 DdU"6
806,097,080 *53A148927B1865DADBA7C7FE5140FA1669C5CA57 DDUAA
806,097,081 *53A2F466C0AE4EEC07088D15A96D2ADD2579F30D Dduabsw5
806,097,082 *53A52B3DBC46F86840BE1661287B5C700F91EC14 DDuAt
806,097,083 *53A93D9BC11F0788475EF56228BD7D4CAD78268D Dductifs7
806,097,084 *53A6FC1976845A90DB26D97A774F68C35E128D30 DdUjl
806,097,085 *53AB15EC8632EB14BB35438AFDBA05766678227D DDukj
806,097,086 *53A754CA1E4E3BE275F2501AC82D34587CCF36E6 DduKW
806,097,087 *53A125746097B1DBB78DCE4EC4B6123255AC4330 DDUm!
806,097,088 *53A8CA71CEAC34E2D4869D2C626E9457EF387B4B DDUNJA
806,097,089 *53A43EF61AFB814149B9D9B5C783F85E6C9CEC4A [email protected]
806,097,090 *53A7EFB530C2D1305135AD89AC4389E33B09C26D Ddustins
806,097,091 *53A0CD5051D31AA4F643001446F0FEFBDAD7FDAB D$dUX
806,097,092 *53A12FCADF49911F9B187821E84D8AD085F171B2 D(DUY
806,097,093 *53A8CD87798A4457E99DF39A6FF03A6EAD7173E9 Dd.v"
806,097,094 *53A69CF14B995B5ACFB53897AFEAF3F6974902D4 Ddv2A
806,097,095 *53A8651FD8F3EE34D20FDB2E93CE1A089DC43340 DdV7P
806,097,096 *53A8D386CAFF836459CF92341ECC08EE2A1D35F5 DdVAN
806,097,097 *53AC39D3576773BF7B470D17EE2AD78BDDABF675 DdV+B
806,097,098 *53A57281C6A5515D377876EED0A5537E6326E50C D%Dvf
806,097,099 *53A333199E5C6B3B881844C14361147F90FDEE62 Ddv.f
806,097,100 *53A721CFB8E9712F779D3F4144C13446013D917A Ddvgtes3
806,097,101 *53A2B74DB314B1CC0D1FC64521B9F80D0C758EC7 DDvh+
806,097,102 *53A35DBFBCD2523BB0FE9DEDD2BA4FE850406E91 DdvI/
806,097,103 *53A973274794DC1FDEB55850EEB2C4D28530D0D1 DDvl&
806,097,104 *53A1237D8D975D6F92B14AE91D83A13CFD6C9157 DD_vP
806,097,105 *53AF6A67643DA26ED31CD0646BD662108A51AD71 DDVXH
806,097,106 *53A0D7B282A858FA314280340009B0D272E4EC52 Dd=:W
806,097,107 *53A792BEABF26844C15614126320BF7418B94860 D#Dwa
806,097,108 *53A2889E3FD0591276A411818BF3D773369F8B39 D.dWB
806,097,109 *53AFD1069BB15700F0F723ADBE97D7F1463BBA5D DD-Wd
806,097,110 *53A956307D58F0FBB0B737DEA9336849E394E0C6 Dd=WF
806,097,111 *53AAEDAD2AEDDDA0ADBF2FA1919DC138733906CF DdwHX
806,097,112 *53A625D4884D9363BADAF3EEA0AF96AE1C3B9B31 DDWpG
806,097,113 *53A7463D75A4245508B23320E286822005F073B1 DDwQk
806,097,114 *53A1F8BA382B52E6DDA4DCB24D967D0AAB895E31 D-dwS
806,097,115 *53A898C7019A5C48EC33106F59F9030CBD92C582 DdWVp
806,097,116 *53AEECF066B95453A376E478E12D9D4F86CF0A85 DDww:
806,097,117 *53AE8A3E637A38C7F75FEB4D8709EABB0FA03CAD Dd/ww
806,097,118 *53A92046DB9C33E5D0A4356799C0AC9176676A7A DDwwN
806,097,119 *53A7274301DC6A61484D9D626798CCF84888E9C2 DdwWn
806,097,120 *53AE13A95D9E21916C315D32F5E5A56139582ACC D-d-X
806,097,121 *53AE8FBFE454277C2FD5411BCBCCC7CDE4697F76 D,-dX
806,097,122 *53A090689CF7CD6F25F275ADD255F7B9F4ED15B4 DdXbt
806,097,123 *53A375013B2493453DF560F8D5770AF7B7E5CE98 DdXI_
806,097,124 *53A985205292761D4E3D9C2B29D5FA787ED5C1D3 DdX.r
806,097,125 *53A8E00493638A3589C32048A65809D848035E09 D?;DY
806,097,126 *53A800484E9C0D9FF414427AFEC864BD82DF80D1 D?!DY
806,097,127 *53AB63D0116C4475CAAAC47D9A70641779AC8F74 D"dY(
806,097,128 *53A2C8554ADE4F7D299DE2D9C3EC3E23D12A33BD DDY)A
806,097,129 *53A4699572CAAFE251726FE7E5C651E3351AF24B DdYDH
806,097,130 *53A69DE4AB3665FECC3AB55C03F63D45D1AED976 D"dYg
806,097,131 *53A589C7493295193255DE2A9E3D3DD421B7EE68 DdYN.
806,097,132 *53A2BFC2E5668B15D3D39BA5861F2EBD132BA015 DDYYY2
806,097,133 *53A63B678A15AB4BDB35F43F32830E6372DE92FF D+DZ.
806,097,134 *53AC4F09CBB0CBAA98455BD830A5996BD8C4B403 DdZD3
806,097,135 *53A07B975DC3762DBB2C19D2F3137CC9BB3C1BC5 Dd#Zi
806,097,136 *53ADB8D0C16413CE5CEA2E8AAAFF227F59BB68AE DDZv)
806,097,137 *53A0C5154017D0287DEC86145D230DEFC6F9D5FB D./#E
806,097,138 *53A9B9D82B307E99C8FD3B96D366F4158F7829A7 D
806,097,139 *53A186E974998A9891B3759958B5FAC5ED39BE4B DE:,?
806,097,140 *53A432B4F0AF244D80877D02F622178A695C9546 DE%!$
806,097,141 *53A30E4CE308A4614DCC49F3EF2C04E1A8EF856B DE%%+
806,097,142 *53A07B46614672DE1817B0920C00EBD2996DD75E D:e%;
806,097,143 *53A00906BA5D44BB73AE7C9C86EA2B708C3DC44C D.e=,
806,097,144 *53AABCF68C03230D9E12496A2EA0C944CA0FB06D D)%e&
806,097,145 *53AB361D3AC0FA6BBF584EEF0A07C48A2121B757 D%&-e
806,097,146 *53AC195AEF02FD0B623EC095572798188C978AE5 D
806,097,147 *53A0B4DCAE26085400040531DB6C0771A62A0788 De_:?
806,097,148 *53AA9298A33A4B4D6D42409803C4387A365E7EB3 De;/,
806,097,149 *53A038E3E653F4C53A943CB1C348CDE0A9DB7429 De#"!
806,097,150 *53A4BABB6C6EC402D22A1A1D39138C03530919D7 d!e}
806,097,151 *53AD88477562AB0AF323C1EEE6E289A3ADCF70BF De0"
806,097,152 *53A7481D626F2F8A1A2EC92EB5BA0E39D9FF757D DE0dQ
806,097,153 *53ADE8EF5DFBD9175DA286625B528EB98801A5BB De0)e
806,097,154 *53AC5A57D7B8C29160271E33AAD5DC8D6B32CDDF D-e0F
806,097,155 *53A74F4DE04D6E82A12FE3837589E603ACC682D8 D,E-1
806,097,156 *53A211A4BF60E3A2E9CB760F7EE15DD7D57A2849 De118er47ed
806,097,157 *53A0785655FCCC8A89D9431A755A35CE24107528 DE11NEATES
806,097,158 *53ACE813EC512F8496524BF0491AD5B9EFC3A2B5 De13d
806,097,159 *53A6DB95CB8BE896C5ADB76905CCA202AA86E19E De15B
806,097,160 *53A088FB7D9D171D45E14C2C58328E5088CB0132 de)1953
806,097,161 *53AB89834D113A34D1E9D9F3E328CB24498A16C8 De1bN
806,097,162 *53A976838FF94BB069C7BCBFA6DB46A8D93BBC18 De$1cc4+0r
806,097,163 *53AB8367A93BF04A433D025C52804445E8AD6D88 [email protected]
806,097,164 *53AF8480241DFB452D076EACA560E053763FDA6E [email protected]$
806,097,165 *53A9008D5B58DF81D1D7CB1A6CFBA43DADF96F62 DE1INQUEN+S
806,097,166 *53AB3671DB06883E755CB9BEE37CBF0580E21FA6 De1jZ
806,097,167 *53A071257FA1A05ECA233DAB94CA2AE97FDD9594 De1MC
806,097,168 *53A214DE62B6A9D0BFEA25C4BABDE2D8DBADB9EC DE1MO
806,097,169 *53AC5045DBCBC1664CD70431772BF21132B6544B DE1N?
806,097,170 *53ADD5C085B9B612AA803B778AE7E2444CCA0183 DE1"o
806,097,171 *53A302C0BE8BCAA483307627E03E41421385AEBC De/1q
806,097,172 *53AE56FB7A7815F6C6753492D0515BC658815C19 [email protected]+Y
806,097,173 *53A41BF53A8496971BFD3DFD4C9A48FCE88F1FD7 DE.2-
806,097,174 *53A730C9B2EEDC5BC7A68DAE3FD66B809C6DFDEB De,20
806,097,175 *53ACB9E04562FC02DFE2EE6CCFAB07D023AF01F3 De2UN
806,097,176 *53AA6F4A8DD05EDE6C861224B216DA1B501DC609 DE2"X
806,097,177 *53A7824CD96E21CDB72BDEEA7083260BB3534B34 De%=3
806,097,178 *53A2965AF9A49151B979441B02242E96F6739C77 D,e31
806,097,179 *53A7BDF36340AACA7E26D1F8D66AEFDF3768A826 De387
806,097,180 *53A2205CC0F2F08BF2FA43A8BAB94FB060F58CAF De3b.
806,097,181 *53A064EAC52F9A479E218192F56085B1A8DBF0A3 D#E3H
806,097,182 *53A6509A9D1F19790688D3275C2BBDAE8B82B2FB DE3IQ
806,097,183 *53AE9D43BFA3BA0F30A1B3F0BEC2232C5A51ECD6 De3#r
806,097,184 *53A1722335E204F88C6A6071D644AE7737246096 DE4=+
806,097,185 *53AD1E88518E9B2DCBBE68D8E1E8944719956258 De(4?
806,097,186 *53ADBC2886313616D1FE3BC505BE660350950B22 de-417
806,097,187 *53A30EEB9C898A81CBF3F71F6479A079A717F801 de4min4tion
806,097,188 *53AAE95C322D9AD7888306BE6774DB5B7F9041BE D.e/5
806,097,189 *53AAB3D4F3DE4FD48485CCAFD1D024B9F779FCDE DE50LA7IN9
806,097,190 *53A1CD6F0B22A0F9FCA0B1EF014F0296F6469BF1 de51t1on
806,097,191 *53A1F9861B5B0090A4EDC3BC5F6603D2E3BAEC70 De571na71on
806,097,192 *53A3C0D77AEAF7CA422FD733FEB3943BA5EE7DF4 DE57AIN
806,097,193 *53A13BD7CFE1998B8B333AD635123F7963183BA6 De5A$
806,097,194 *53ACE77876EE0024DCA52E144648971ABE199DA4 DE5dL
806,097,195 *53AAFEA7F17B2EBFCEC4FE49437336D6B17BB37F DE5EGREGA710N
806,097,196 *53A87A55F30AD60D6DE126D2BF8220576A1F448B DE(5I
806,097,197 *53AE06036FFA4139452899A2BFA97CA8BF28BA8B de5iderano
806,097,198 *53A0DB92C51DA5500FE337B19539CAAB953C9A95 de5rucib1e
806,097,199 *53A480B9A28F842987D188B8D1AFC5BC0832391F DE5v%
806,097,200 *53AAC6A62B94A4CA4D73732FB60A20EC0C029762 D=E5X
806,097,201 *53A4C93AF8FC5AF367B0F28D4B96DADA3BFBA170 de622062319
806,097,202 *53A2DEB9DDAF3C349C7F48DA0954FE261CE4560E DE64(
806,097,203 *53A3BFE62B73C6B9B962FCBB709E9AFDC7F66CA2 D_e6E
806,097,204 *53AF9AC3992373D2901CE1F94A7EE35E7AB0B14A DE6P5
806,097,205 *53A79DF79C570D8533D489A17DF34C7120EBD9D3 De6uH
806,097,206 *53A7C0DFC965EE6289A654FC2307276ED03D4D32 DE,7+
806,097,207 *53A3CD8F73602F762726F22989D4B7B486FF386A DE7ACHA8I1I7Y
806,097,208 *53A8DE0BA1DC6B6FF7CD319B8578E17ABA3E05AC De7e$7er$
806,097,209 *53A9757E0FE9E5151D18C3969CAD5D9DA4B91FA7 [email protected]$
806,097,210 *53A4603D57A772066019FC284C57DE79C96A7FAE DE7.M
806,097,211 *53A12CF91016A97C93C180DD669CA6BDCE672B01 DE7O5
806,097,212 *53A23C08AEE2E13F8FD1771606369A7C375F0CD4 D_e8"
806,097,213 *53ADBBBB9349BA55E5D13A48903362DF2496602E de8418610087
806,097,214 *53AEC9DE46FDB8F71C4812351CC064BD83A2BE5C D(e8f
806,097,215 *53A8DAF888AE07891A202168292D09BD3969C6B7 DE8rc
806,097,216 *53AC4DA2801215F4134BD1F2137738E9ECAC53B9 De8uI
806,097,217 *53AD40243864EDF489EC50319EE875C2A26A7B0E d%E9
806,097,218 *53A8E4029D986D0BBFFBF1813CD4C872218B2E11 de926407
806,097,219 *53A6299802A1F3C0A8DCE140A3AAC52427AEAFF5 De9.m
806,097,220 *53AD1CCC18A76085619A3752932DA2E9A70E0E0A DE9N3
806,097,221 *53A8C13A77A6A24C4F876E43822D197F039E415A DE9(o
806,097,222 *53A3B05FD0C6F5B90A18A8DFBDE20A1D7826C46E D-Ea/
806,097,223 *53A4D4D525DCDFDB2E52CDB2D178D4C7319D611C Dea?.
806,097,224 *53A16ED9D2869DDFC375E378A218D8D83258D354 DEA0=
806,097,225 *53A0DBEE0A2C8A3314FC42523E8140265D917CDA DE$A11NA+E
806,097,226 *53A170BFC073758323DBFF4E7E8E57E33ADDD8E7 D;eaaa
806,097,227 *53A89E8A26BE03A8F17C5B81D8B184C90982A067 dE-aaa
806,097,228 *53A2B5B1399BB9AB34680405B94CB2DA27992576 Deacon087
806,097,229 *53A728B3FD9442DC7135C02776A21DEAC41E8238 D_EAD
806,097,230 *53A35AA2193F9A876B5D9D6E8B7BCF9582ED1DC5 DEADDEAMON666
806,097,231 *53A10F3490880F7ABDC62D755278B08DF8E1204C deaddeaned
806,097,232 *53A2403CCB9EDA31CAD7C1A4809B147B1C86F5C5 DeadHeadFredCover
806,097,233 *53AA1998CEB87E6713B76A660AFE8A83DC269B27 Dead Husband (Tsunami One remix)
806,097,234 *53AEF41A1C50A5D92BA8100F756F2CBF4996A378 Deadinfo6
806,097,235 *53A86E5FE1C21B442049D9CE944D9F4179891551 DeadInside
806,097,236 *53AEE8E4A5CC6C3295359F5470A2BA1C4CA6C631 deadish0
806,097,237 *53AE1D02E47E46DFE92BF88768FCCB968FFFC35F deadline.in
806,097,238 *53A6904A31C17930CD7211EC8895B0EAC6CAC7EA Deadlines&Diets([email protected],2005)
806,097,239 *53A3AEFD4109A35F00E4A32A3FBE044F739D7121 deadman’
806,097,240 *53AE1CB78D45FA769A2B404095251D720FCADE6A Deadmiles1
806,097,241 *53AF933AB44CE005B6D579F422B67293A8CA8F1E dead president
806,097,242 *53A2F56F8D16E2A6FF528CD3C3704E34D32D12EC deadrob
806,097,243 *53A2339AA08AEC3EBCBE03A5424E8799A7C33C53 deadsters123
806,097,244 *53AF7EA421FEA64A5C3EDC3EF1E98A578EC6C9A8 deadun2008
806,097,245 *53A7EBC00D265F8D405F55C5FDD586B0C824D6A9 DeadWoodFalls
806,097,246 *53AF7E9FBA4105800850F28F1EE29B52C6991848 Deadziggy6
806,097,247 *53AC4F72FC515819303AF7E4EE469744439ACA62 DeAhI
806,097,248 *53A758F0A3807E8B32CDF25C991D27734DAD73E8 De+ai1in9
806,097,249 *53AC008CA9A2C61C3D61EDE7318F93F9B1FD711A De/al
806,097,250 *53A62806CEEFCCF9F7669E46FBFF5B9BE8A6E92F DEALDE!
806,097,251 *53AC50309E088065D742F88B9A2669435A0729AB Dealish0
806,097,252 *53A89BC36F70EB439E6E534E61BD0CEEDE3699C0 dealni
806,097,253 *53A1FFF562C41AA10C8FCD5BEBE85FE22ED877E4 DeA?m
806,097,254 *53A07CBE3072F092D8D9225776A1EBD5797076D9 Deam1
806,097,255 *53A7EDE7489EAF3DB6B26608E6BB5B99FB4B395A DeAmL
806,097,256 *53A22EFA115EB43FB8768DAE79D280A9BD4BA4F6 Dean4
806,097,257 *53AFCF38E86B7E22155CF8882020CA4B9AF1B120 deanach8
806,097,258 *53AF33656E041E7CE2A38141EFF89D4C16EAFB0B dean.belback
806,097,259 *53A7DBCDE360ECDD4A9C42C7F087F92DE68344B1 dean.bergener
806,097,260 *53A1872B6BDE010F6540C60FCDCFCAF0B2EEFDD4 dean.braitman
806,097,261 *53A0F0D4E90F4EA16F1A71C7C906041992B223C9 deancfi1
806,097,262 *53A5B1EE699C3452D407410D0BF8E103D69E2440 dean.delnegro
806,097,263 *53AD8767019BDDF208C5EA3E74CFCFE26E6635ED dean.derga
806,097,264 *53A90D10A94344A5A851C4FCC03DA97289677A85 deandra thomas
806,097,265 *53AE328FCA32DC9CAE160754E7444E4A2C598EB3 deandre.dreuitt
806,097,266 *53A455D41A4B8EF82C4BD251BA0B8DE00AFE6F08 deandre.ernst
806,097,267 *53A63A9492D6587CD807A39BE14A01FD82D5D850 deandre.farren
806,097,268 *53AD2C87AE5C5DAD8F41B8760E039006210E87CC deandre.garabedian
806,097,269 *53ABAC3AC7907E4634E8F4E19FECD94E85E921CF deandre.gotwalt
806,097,270 *53A4CD91C313696F4B70E0CB56BB0EFD0FB7F2F0 deandre.greeley
806,097,271 *53A9BA9E96D2306A91FC631898D4C390A131C89E deandre.grivna
806,097,272 *53A2E55D01B1A4BF660B45E5A9D2C5F7ACED45C5 deandre.kreeger
806,097,273 *53A28DF248D4E7A44D364A7F35DBE1BBDB530434 deandre.landolfo
806,097,274 *53AE588CF45735FF9693795D94661127502576C6 deandre.lenihan
806,097,275 *53AE381E3508E663448AC7338310A0059EBAFD6B deandre.lennihan
806,097,276 *53A92E303E46E613F0AAC50DD2E2B94842C274FD deandre.loft
806,097,277 *53AE38E58EACD5DBEFA90658EDE09A5184203F1D deandre.louck
806,097,278 *53A7A39F248219DE72F0F5252FED11BEBA05F16E deandremoore
806,097,279 *53A2ACC3AFBFA8BAB3D56B2E07C295D09FBAE0A7 deandre.soibelman
806,097,280 *53A09AD6D032701FD3F91D33E9E7877E5ED97865 deandre.tomkus
806,097,281 *53AAFF16FAFF1687ABB5E2B35D931519232B9B98 deandre.warsham
806,097,282 *53A339EB67804D8EE58375D09F620621314285F8 deandre.wheatley
806,097,283 *53AD4637496BF0D4FD5E221276F2748796633C9A dean.duhe
806,097,284 *53AA8F8E97D2A6FD57F044AC8EDA9F1C24EEF347 deaneehs
806,097,285 *53A7526A47ED161D46EB53423EB94868FCF721D9 deaneftc
806,097,286 *53AF96D300BBADA37F57D0D64412D09C0A13F215 deaneitalkacacia
806,097,287 *53AE1EC3E534926A0AF393C3DCE4C0D14C80FBAA dean.filarecki
806,097,288 *53A3D6F7D424BDD65D7D11A493DBA21A923ABBEB deangelo.arnio
806,097,289 *53AA0DEB06F600017D6BB756A65BC302C96E28A0 deangelo.bent
806,097,290 *53A10997F4F1E6B508FCDB518C5A5E401321FFC9 deangelo.boughan
806,097,291 *53AE1D9D8EBFB60166C725BD2D420A943C6B4092 deangelo.constantine
806,097,292 *53A0AE6E34B5B1FC14944A841E5739F68E8AB898 deangelo.cordew
806,097,293 *53AEB138F6B1C1AF3FD445DB308F011BA10E7E82 deangelo.danielski
806,097,294 *53AA46B4C265F2A5241524181FB7CF96868B6715 deangelo.denmark
806,097,295 *53AF7952CC3D6A05EA2981730A9C38F8CBB0653E deangelo.dintino
806,097,296 *53A086A5C546666A552F8FBCC461335E310A7480 deangelo.friou
806,097,297 *53AF8C78FD3C5FDC8BB64190842314843A5FF588 deangelo.kosch
806,097,298 *53ADB91DE18C542BDC61F2AA2477344101FDB4D3 deangelo.koziol
806,097,299 *53A16C121BB2C47B12C1967F2EA2D35F933374E9 deangelo.ly
806,097,300 *53A8635EBC9BDD966A6D3238DA701AC48A5FA261 deangelo.malsch
806,097,301 *53A1E455C22D0144D2DE74E01B72A842B0FA8BFC deangelo.marett
806,097,302 *53AE93CC957D2C615448EE9037AD041E57958F8E deangelo.mcfarlen
806,097,303 *53AB10A7126762072F45C1BE712910F960372711 deangelo.mckasson
806,097,304 *53AB20445885E130EF3CB97EB07B593A3AB92395 deangelo.mckeithan
806,097,305 *53A89A2FFD552257C05AE4DDD3B92F7D7AACEDC5 deangelo.moncher
806,097,306 *53AD0674137ED87304F5E18769BD1D1238346CB1 deangelo.paulik
806,097,307 *53A45F4F3FB278808DDD54C2B35377244540BA70 deangelo.zingaro
806,097,308 *53A8E922A89A034BB68476FB01B0D45441F4061F dean.gleckler
806,097,309 *53ACD38BEC711DA813105B18E56261DF8F1AF144 dean.gloe
806,097,310 *53AA423998E0F6F0BA66ADE17D14BB81BDCB3C92 dean.hicken
806,097,311 *53A8586931FE56EFA90B12C009BAC16E7F19E196 dean.huffner
806,097,312 *53A017A15881DD01657FA8384823F5A225BE4D30 dean jr.
806,097,313 *53A30826BD22D838BBD7F5E16C3E5CBD2FF4524E dean.levens
806,097,314 *53A37F9F7874A17A3267F19A588799E628C0555A dean.melot
806,097,315 *53A883BA7AD511F30C7ADCD54D7541DDCDA4F88C dean.mendel
806,097,316 *53AB52FCA69EAC77207369879BD2ECBD8DF9AA17 deanna calabrese
806,097,317 *53A750E754C3D0F649BC8FA165D35D9DBEE5C710 deanna elizabeth
806,097,318 *53A9E111E7407B67908033C4F300D9889BEA11A6 deanna evans
806,097,319 *53A9918E1AFD109B2F4C572C4CBD89CB39DC1BF6 deanna frizzell
806,097,320 *53A1A802AB6AF22D25B30F7D1E60EE38EDFD4F43 deanna ingram
806,097,321 *53AEE82D672055583EC1892CAD5407AF5D339DDA deanna james
806,097,322 *53A2BBECED1D8A9816F55A558F92A9746FAD9A4C deannalight
806,097,323 *53AFE59C748240D9B6B239028789AEF44358DA04 DEANNAOMARA
806,097,324 *53A44C5DF666E98A9C00965BA867C560C9E8F6A4 deannawalsh
806,097,325 *53A0366FD700FE22E3E8F7E9D48613981D86A08E deannearmstrong
806,097,326 *53A0651C43CBEDCFC9D273764FAF426ECC553D52 dean.northup
806,097,327 *53A25EAFE806CA80F4696C5CD1B31C07E8B9D641 deannwade
806,097,328 *53AD2460AC0E883F4E49D85C782F70E2C2BB0051 DEANOE55
806,097,329 *53A947A6EF1089E86F5D7B98E045C70D0025BB00 deanottinger
806,097,330 *53A7C7EECC7871729FEBFD0821696AA3E6CB7EB1 dean.parquette
806,097,331 *53AF0098345AEB92D2CCBE91FB4435A12D482173 dean.piccone
806,097,332 *53A85E4E4F92AD4A6FF83D7B848FF5726F28CCDF dean.prayer
806,097,333 *53A7D2B284122A754E5DF6CB2D949827ECD53EA4 dean.printers
806,097,334 *53ACCF5A3B8699D4EFA30BE2DEEB3088D5114E36 DEANSHIPS2
806,097,335 *53A1C3E8D76EB54F1B6BA2DF42BA89E7FE50ABCA dean sims
806,097,336 *53A0989D7E91EB11BDA3A8DCD5B8C4B1C05E832E deansteeves
806,097,337 *53A2B96DC0C7D2FB913A84A9BD21782A2FE33F08 deante liddell
806,097,338 *53ABB273CF8CA979F3D27CEE5BE364654EDC4FFE dean.tygart
806,097,339 *53A33B2A47AE3E424D1FA7D8AB27C52096129A45 dean.vallee
806,097,340 *53ADA9CAC83B080C660986DD935B6FCD06F01745 dean.whetham
806,097,341 *53A7C68B2E18C48AB9713E1722631918427AE16A DEANZORRO
806,097,342 *53AC6B01F29901E091F25684834D5BDA450A2C3B DE+Ao
806,097,343 *53A589CF6D47C377ABDD6E78537923F46FA9BADA De?ao
806,097,344 *53A9E0ACCFC15F70F9A164C3459A6227F8561ABC dearbornstreetbreakdown
806,097,345 *53A9CB293312B2CFEC1100BFF6B6B57186B894AA dearcoz4
806,097,346 *53ACD67665EE88030919F8DC08062123DB83A59B Dearthing0
806,097,347 *53A59D2012D4E686F422757591CD2D36358F8D35 DEa,S
806,097,348 *53A22B7F5EA24608E1D2E4332088AFED7FA82718 deasonia4
806,097,349 *53AAEAB9660326E402E289EF7280BFBF6A411B78 DEATb
806,097,350 *53A9600C57B8000FBA03FD205FFECC0777EDB0EE death-a-h-o-l-i-c.blogspot.comdeath-a-h-o-l-i-c
806,097,351 *53A7B143B9D820A5C1F999C82F9FE31FBF5984B3 Death and Insanity
806,097,352 *53A710F408EC81CF3983166F3426FBF4AB484901 DeathByNukes
806,097,353 *53A3AA93C98C3C201769DCEB4E419B3F2681B9ED deathcorethulin
806,097,354 *53A62AF161B91278C0BC3A4C5A219E864B0B5867 Deathjean6
806,097,355 *53AF848F4D1ED4F00C0B729579A647517B904DE8 death-of-former-cycling-supremo-joe-christle
806,097,356 *53AEE3C28B17CDCD8D83E558E6E1455A641547D4 deathrocker160talk16
806,097,357 *53AA54CCA1FE7AF150B6380FA7CA96F4CFA4464A deathsultramarine
806,097,358 *53A1FC5D467F4E3F5E43997DD41EA44D187E6295 Deathtest9
806,097,359 *53A22596A96E8A4DAD300E99EEB10B22F22E5F2F Deathtou5
806,097,360 *53A31713A6B6465C57EEADBCF4062EE9A263EF19 Deathtripper
806,097,361 *53A8B833DDD67F4D12EFB940CEBD8CA753C43490 DeATl
806,097,362 *53AA52998CB532322138405FD42FF8323D29F38B DEAtwADlQyMB
806,097,363 *53A1A4A9314478DA3B5F32604EC4F125B245F0E2 deautrasalmond
806,097,364 *53AE89AF2C7937B677DED672A00A84024D31BDAF DeaV#
806,097,365 *53AF94C781BF8DD08C9DD66F639DFC0A3FA76F50 Deaverpf4
806,097,366 *53A0BFB9385925ADDC2034CF3250889C18406223 Deavorered
806,097,367 *53A8AF6C9953337841E3B33763C7198D47709E3A deazle12
806,097,368 *53A4E79A4C7BB413A324A84B0745A7C695D05958 D&,Eb
806,097,369 *53AA1E73AB023EB8C50A2165B87D78CBEBCD50D9 [email protected]
806,097,370 *53A1E228BC8EEFD2D5EE7CE4BEF354AA767FAB9D De/B4
806,097,371 *53A6E97833F9806C01B4BD5A536D377D372C3C5A Deb4j
806,097,372 *53A8160CBD670EC6F46A09FB9194E6CA33B719DF DeB5;
806,097,373 *53A748F8AE5C7BD00397BD96867EC2A04D620414 deb9a62ce9
806,097,374 *53A04DE9011CE50DCE1CE10D7645D476EE4B4CE8 DebA-
806,097,375 *53A2FFA1F4F84C90FFD5942F33E116B3C437A617 debapriyachakraborty
806,097,376 *53AC4560FA76967508FD36CDD9A26EE93BA5C85C debarked?
806,097,377 *53AD52D23420E16A37E34194BFA31042F6C2B2B7 debartoloBSW
806,097,378 *53ACB4316357A34A2FE559305714B09523238E61 Debate2Williams1
806,097,379 *53A9886F05BFCD77286427BD49C8AC521ECBD45F [email protected]
806,097,380 *53AEE921BF5B6E89646DB2750352AD5754E4788F debatir8
806,097,381 *53A708D7D87388219704FD12F7F132DA188BDDE2 débâtisses
806,097,382 *53A02C66A9FD8AA4397A8885B2DAF15BF709C55D DEBATTE?
806,097,383 *53A6836D9B73405E4505ED22B832FDDAF2A2703D debbie502002
806,097,384 *53A9E963CB2A0491F9C34B5D2E80408F42AF3D9B debbie clutterbuck
806,097,385 *53AF4B7BBC28483CF12CBB6A9326735E29D03FBC debbiecollins
806,097,386 *53AD098281FC18F2FC016477A5CA72BB63F121A3 debbie flemming
806,097,387 *53A1AC7673D490AB0B8F2CD980C67EF7E5AF0575 debbiegiles
806,097,388 *53A7D79378F817D323C7B564ED99EE7B166DD8DD debbie howell smith
806,097,389 *53A059AAA4042A10A35D9228CB38089C899DD38A debbie hunt harrison
806,097,390 *53AAC34EEF6EB3AE67944E39A85E1C73A8883012 Debbiejustin1
806,097,391 *53A29641DD28ACEA42DFEE592187C4CC3C3A4B4B debbie macarthur
806,097,392 *53A220D2CF7E02D200597241F468F853A9BD2367 debbieschwatka
806,097,393 *53A3A1AFCCBB07DABEBABCE582FE95C966AD5B88 debbiespino
806,097,394 *53A1143674AA67A990143C001E005BC799885BF6 [email protected]
806,097,395 *53AA1676B794FF57AA1AA466A78F9FF8CE80B50F Debbo Hande
806,097,396 *53A33E67D517548AC39BFA891A8D056DC5E25A69 Debburgning
806,097,397 *53A023B9717C3512C09E2BD93D5F0BCB2EF11DB4 debby hopkins
806,097,398 *53A0FD1111FDE3E9E5DC2262EDED240C1093BF89 DEBEAKER5
806,097,399 *53A43D218605A045E82187978425236A7F2D8E21 de.bebo.com
806,097,400 *53A2B6EA0502C2CBC2BFCD4855611473816626CB DEBECKER
806,097,401 *53AF9CE80AF9E1DDB6E638FED65190D912CC01F2 de beer is los (live)
806,097,402 *53A875EF826328FCA389C7AF67179B0C3910F705 DEBEKO
806,097,403 *53A4C6B23D67ABF8BABC0EB738E22AA19447F8CD debenutzerbreogan67
806,097,404 *53ABF0BA8B6722554A36E88F1720F29437B50D5A Debesargøta
806,097,405 *53A73414B42B97DAC05A39EC013FE0CF0ED9BA88 Debessv
806,097,406 *53AB242CA8F9769468E16A51E3267E039D450C1A debildp
806,097,407 *53AEB9A70A964F42C4432463DB6530D9D61E044F DEBILITATION7
806,097,408 *53AD6F9469523EF47C00B794FAD7FFDBF6E49CF5 debillarderaient
806,097,409 *53AB8A43AF6808482EB1B2A9ABA74AFA19678761 Debircse0
806,097,410 *53A48A63261CBADFF00E1B04FE97916AD82F628E Debitable3
806,097,411 *53AC740C20B70203EAA5EE49691D564B440E5C60 debiting [business]
806,097,412 *53AB33FF81C7D80A6E3EFDC0360A5CB95568AFDB Debits5
806,097,413 *53A060AEE5D53EBB20B288DA81D30314E3E76EDD débituminisait
806,097,414 *53A2B93C388754990CB8465E395984C73D372347 DEBjr
806,097,415 *53A1B6136F57E25FEE6A01B98C14AFFBB5B38344 Debk8
806,097,416 *53AA3F2257D64E42D3AFBF8D6D85E6EC3D51959A Deblaiera5
806,097,417 *53A5CA5BE2939394D73AA75A5106060B32AC08FD Deblin
806,097,418 *53A1EEF68414534D4B5BE0B5B4FB0B7DAC52FE59 debloquait?
806,097,419 *53AFB0079E87630D2FE37C801DD098E73C9736FE deb mcknight
806,097,420 *53A220534BE372238D35B78AAFF840F0B3A7D925 DeBn+
806,097,421 *53A4D85A4AFCC22F9852CE495469AE4815B56FB1 DEbnf
806,097,422 *53A3297AF732C775BF560E1F3EC1A98C5579DA54 deboekerij
806,097,423 *53AE67D92EB10BDE29AFDA30159E221C04FF34B0 Deboiterait?
806,097,424 *53AF84D0E35715A0E0222F9C3B62D3E439012D5A Deborah119
806,097,425 *53A137EAA06B97F8E9B3F65C1F03266992D26026 deborahcypert
806,097,426 *53A4862DAEF3513860F7801CC3C376048F1D1BF1 deborah haines
806,097,427 *53AD0C41439FB184999DEE81C67D0B374B79E783 deborah-lee123
806,097,428 *53AFB2284B0F12DA59C953456FA81E1169BC1372 deborah olabode
806,097,429 *53A1DEFCCFC9FB43B9F742F5994F32CBC8D623EC deboraschultz
806,097,430 *53A2D9C2F10543DDCE2FA834D2CA604AC42AA243 DEBORDANTES2
806,097,431 *53A846615A528621D26761D5C890D44EB1E78030 deborderons9
806,097,432 *53A72D8C36B88980FEAB08C3B5A8CAC0FBC4F209 debourgeoisassiez
806,097,433 *53A7A957BD448A9B6836DDCF352DD32A9A520326 Deboutait4
806,097,434 *53A638F4B88E3A78231450F553FA9AEE09C8BC47 deb pittman
806,097,435 *53A46F270A940EF6C6AD6578A962B81855B0F60B DEbR.
806,097,436 *53AB889F6EB0298BC46470A0359B22F3254CABC3 debraberliner
806,097,437 *53A35FA659B6CB4B824BEAE46DFCE600A98687C5 debra buffington
806,097,438 *53A89D9E257175791A9BE5863C2E3BEE10E2E3DD debra ericson
806,097,439 *53AA3CF25D60980ADF7A907F65B783BBFAF60A84 debrafederico
806,097,440 *53AA2CA432B6EF9238B6FF533BC43FDF9904B937 debragery
806,097,441 *53A67281D5DB771F8EE73C0A36FAF2468D7C76F5 debra mcadams
806,097,442 *53A4B10AE4C4AF80F1B1047249CE21B5D56C60DF debrayais1
806,097,443 *53AB0A1283E9503DC01275FE2559174C9B6F0B09 Debrayon0
806,097,444 *53A4B884D5F82D6E14CE8DE4125172FDE6DC2118 [email protected]@+I0N5
806,097,445 *53A5AD57EA46B7F0121CF7C6B870EF2C27A980FE debroyt
806,097,446 *53A5C93F9632FD1380BEB712EF4C8C14FE6261EE [email protected]
806,097,447 *53A8C47EE997D07DDD841B7AF6378C04DA36BA57 debuadeb8
806,097,448 *53A634E57DC43C87CEBD8A9BDEEF600BE5D94027 debugget1
806,097,449 *53AB48F962A27D3A67F6FC5F4A9C72E8A89BE2CD debulh1
806,097,450 *53AA26E99F78E9109F3DEE0FE947E39A963A9AE6 debulked3
806,097,451 *53A3C4B532BB6C904E5BAC01D3D5D1990D2A27C7 debutert8
806,097,452 *53A48B9C10C49BE2C27738DDC170DD5FBFF3FCBB DEbvc
806,097,453 *53A2089507ADC573517BF93123D28A5A2C6904B2 debycozi
806,097,454 *53A9DDC55C8CEB3B35B97694568149C7EA185D59 debymadjukie
806,097,455 *53A76EF8DEDAEEF7883B9269795919369B02827C De%C-
806,097,456 *53AC320FC426C3B17BFC54D9AD2E8A36AB870CF7 De&+c
806,097,457 *53ADDB7EE78181CAC263E0A6B34779696D20DB1E dEC^
806,097,458 *53A2081C25478026D370717C5B2F88E19223AA0D [email protected]
806,097,459 *53ABAC4DC2A65BB21199BE176EEDCCCCA631C37D D
806,097,460 *53A25FC87F2AA305BB938E76C25E7519FC265710 DEC12BS08
806,097,461 *53A632E2C975DB68A1D9EE7F715B3A74F893D96F dec1frate
806,097,462 *53A12FC82E95A5DB15DF57426FF6E5522B3CBBC1 Dec-200707-Dec-2007
806,097,463 *53A6DA8FA81953F4F9BB95A6800FB0AE9DF2AF1D Decachord!
806,097,464 *53ADE4B4D8C71DA992711A7B4BCDA299FABD0615 Decaedron?
806,097,465 *53A0290DB861124D89EAAD7D6F4391DE85A3BBA1 Decagauss7
806,097,466 *53A8FE4CD744D539D0B1DA7AE0BC4E196BE849A9 decalcoman
806,097,467 *53AD1B7A83867B4335723C47C2B9714B81B25F39 décaleras
806,097,468 *53A512C642A514B9C616AE025615E31522987DD9 Decallings
806,097,469 *53A48E62A656898EAC2AAD7223A725BD8E69F3C5 decamer0
806,097,470 *53A0AF63DF4D5DA80A321181DB424BCD618A5922 Decameron, The
806,097,471 *53A11E72DBD6DBA08067395FE726A6E91803A2E4 Decannul6
806,097,472 *53AE3AC73B37D2E2391931C53680AF5A768E7DFD décanoate
806,097,473 *53A976EB603FCD2F46F39DF609D54A3FB8B67D26 decanoonaced
806,097,474 *53A6A079F9E72142FBE380345C641101C7A12EF2 Decapee8
806,097,475 *53A699A9BA49B1CF186F8B40E6290D5797FC5F60 Decapitava5
806,097,476 *53AFA16999BEC2F979489AED1A4F642A4F4CA6D4 decápodo
806,097,477 *53AFA58DB55E36C59EFEAE7B1D7A3584EA8A5907 Decartes
806,097,478 *53A41A32C92A94180E4FAEEF615DC65EA10E761E Decartesed
806,097,479 *53AC8C9F78DD595A726D3AF9DDC5D41958251E75 decasted4
806,097,480 *53A3380C49912FE33883CC3D7C71E7A2F17AFDE6 decaster0
806,097,481 *53AA4B4530FC0B9144A9444189E2B2704B588D7E decastes0
806,097,482 *53A77DE34F52EDA0DB11148ADF4AB31CC3ED53CD [email protected]
806,097,483 *53A72A8CC13EABA115DA1AF8717FF047755BBD4B decathlonien0
806,097,484 *53A30ACFFE23A035F1137A7788DBAE03254BBF30 DECATURDECATUR
806,097,485 *53AA0726743DA2F55E73B22B75D06389FFB809B0 Decawatts6
806,097,486 *53A15C9698A998BF3F9D0BD86FC25594838DF0C9 decciares9
806,097,487 *53A07BAAD3711A958FD5EB3C1DD03938EF13383D Dece!7fu11y
806,097,488 *53AB52C00E6CDF0F50BC8C091BFFC2FCCC541BD2 deceau
806,097,489 *53A04E4BC03A8B6156242D218E5AAA6BEFAC063E Decebal6
806,097,490 *53AF309BAFE7A950DD245393F1D6B3D577B1BA22 DECEIVABLY3
806,097,491 *53AC6E0CF46AA50929AE38B02FFCF3C3D61CCBE0 decelerates3
806,097,492 *53AE189FF34718306051F514D98829706395F728 Decelez!
806,097,493 *53AF23A0202F1D88D50354A6C04F86F833100127 Decelis9
806,097,494 *53AD146FF87BD3996031A7B1F51BEBF0F8081353 december_1_2007
806,097,495 *53A146E3E96BB9F95BA8BE12A2B34AC7F000404C Decemberkingdom
806,097,496 *53A6F468A1663AA5532E0507C30FCF7E7F285558 Decemberlibrary
806,097,497 *53A2273FB137B65AD25711A44F04DDF108F2E3A2 december mourning
806,097,498 *53A6C9D4C2FDD729599355842DC60768EAE9AE55 DECEN7R4L1$M
806,097,499 *53A78AF10362BEADB85F47A8E06995AAEA03CF00 DECEN7RAL!ZA7!0N$
806,097,500 *53AF99A93DBF34678B32DC2CCD8DAB279810D8BD decenniaed
806,097,501 *53A2EBB6B8D06D61E3A4F9EE3B74E7D7F041B1B7 DECEN+R411ZE$
806,097,502 *53A0817DD9982702D2D0BDB159C7EEB487A044D8 Decerpo
806,097,503 *53A4A0764C6BD6E64E633E999C9802BFB6451EC4 Decevre6
806,097,504 *53ACFB350A87F9DF9AD29746F2883B9A4ED46761 Decevrie3
806,097,505 *53AF9D28DB37593EB67C378251786D1143C5F66B Deceypte8
806,097,506 *53AB3988EBF27F898ED10F6D0FADE9E8BB2DACF1 de Chabanieux
806,097,507 *53A221021CEFE00EA28AD8B41E6CC4E4B6A7EBC4 dechainaient8
806,097,508 *53A2532DB1CD7DB6119DAAA3E136F725F2EF0EFF dechanoinisera
806,097,509 *53A45B3364BE092E6B6E33807A0EDE0F2B293782 Dechenned
806,097,510 *53AAF101C744E52B9B4E8EACD788512F0A5F659B DECHIRERIONS
806,097,511 *53AB408A37973109CFC2CEE9FB80E8136B9CBDD2 Decide Already
806,097,512 *53A45682C66AC78BB37964700AB47605DEA03FC5 decideva1
806,097,513 *53AB1E2C1CCE1505F6989AFDDA0F92A1B11F6C07 decidida7
806,097,514 *53A6813CB7378029FA1515448994BFCA9956FE12 Decifrati1
806,097,515 *53A6A7AB4AFCA089DD1F8A0D30AF8DC83FD0C1A8 decigal8
806,097,516 *53AD745AD55F707360DE8A66E04169587B988C6C Decimalu3
806,097,517 *53A7CF6B832E91C063DC177259CC9F26BC46AB1B Decimenting
806,097,518 *53AA463A8218F54CF89B9266BF20FD88EC31FE2E Decimerions2
806,097,519 *53A6FB1A3F0B1E5CD79E6F7A1774F04D91E2AF24 decirle7
806,097,520 *53A1AA626B64DA3CE767EA409E074547D204CC0E DECISIONE4
806,097,521 *53A87B376A63A5B2D421F009082F2324D5216CB3 deciverc0
806,097,522 *53A069FE3C2BBD1CAFA033051EE0BD1715607F07 deckardstheme
806,097,523 *53A3846832E4B602DC8AA42B1F1D056C18FB1B76 Decker82
806,097,524 *53A4DAE9806FBB54D8389DBD0BFD3CCC7F683D4D deckervillelibrary
806,097,525 *53A183881070F5A6A5F0C9C2FD98CB4BF8A7D24C Deckpipes
806,097,526 *53AEA918E2067FF339507FFB370F086AC9E028E8 DECl
806,097,527 *53A6347EF19624D73654135DD969A3B2DF049DF8 D,ecl
806,097,528 *53A4CA4CBDED70B2B1C3E04D79514ABAA881EE51 declamara1234
806,097,529 *53A9817CBF1D5ED18422B2235EE8DB1623F68238 declan882
806,097,530 *53ACD2BC3BB20C99E0DEB758FC56A7EC6A1C57AC declanhuntert
806,097,531 *53A00E5DE1508F92F1D0C17C2358CD25FD720D0C declarerens
806,097,532 *53A05EE2AF409C5D3C32A33C560B4633B5E4C750 declassa0
806,097,533 *53A0339004A635056228A5DD3B0B8744E4CE3ECD declei05
806,097,534 *53A02E0CE64C8CFC44EAB056241FF2BAEA6340D7 decliued
806,097,535 *53A3BB78267BA0132F01CCD2A3D07E6E8A34C3E7 De'cloisonneriez
806,097,536 *53ADC06461EE9DD83A155B30FB21F3B66E36B0E9 decmailpdp11
806,097,537 *53AA3BDD5683A3811679136DD1103EA7A40C6A92 D%Eco
806,097,538 *53AB57CDC830277DF24551AFF66DDA871B99C710 DECOCHES3
806,097,539 *53A89B0CF4BD9A3A2A62CA5FC6BF565E3E24878E [email protected]
806,097,540 *53A6B45CAF8C0254920FB38258BEEA0A788E5DAE decolletage2
806,097,541 *53A22D17127C05E720CBDAD1B02873A1F83B0114 decollising
806,097,542 *53A988B9967D3F917EBBBCB6E317C563656C1227 DECOLLO!
806,097,543 *53A15E9093904212CB27A8ED970381C4AF2EE46C decolonisasyon
806,097,544 *53A7FE7FF84C83407B208F7EA0354324070B19FA decolorimeter9
806,097,545 *53A53C4B340209F0F9F7481F822E6558A3F84A9B decompletant
806,097,546 *53AB0F9870D893F066D63938CF1CBEE8AC566023 Decompression EP
806,097,547 *53A96D6C746EDFFED2030AA74FCFE1020BA8C707 DECOMPTES8
806,097,548 *53AAD80C00339E115A837EE7D8A1F22F77146565 decon4min4in9
806,097,549 *53A7F7826A3967851621ECA3B93C36F275220BF5 DECON74M!N47E
806,097,550 *53AA2E414B6A084EA12DBF78E77E7F4F97EE4245 DECONCENTRE!
806,097,551 *53A63A967F99F5D2CEAD48F3FF1E442BF5A3066B deCondado
806,097,552 *53AC76C3235D4CC459DB9BEC3D7F48D6514C02E2 DECONNECTERONT7
806,097,553 *53AA03B8BBDB35E3E8A40A99D11F640EC269E1F8 deconstructionismBSW
806,097,554 *53A82359BF557085F927BDD868599155C3E04CD8 DECONTENANCER5
806,097,555 *53A82E7223315965AC5AE21E2B11D79CDEF1965C decoracidinamo123
806,097,556 *53A7F2BC5F4301051FC337168884DFE4ABDBECE0 [email protected]
806,097,557 *53A3D42DF4DF80CF3D38F4B40BF9D102CEF5C6B0 decoratorpaper
806,097,558 *53A396DB6BE5DFF4F7D4094C64D1058691980F41 decorerons3
806,097,559 *53ACC953E29C35D546AD945CE8EFE1E0964968FA decoreu123
806,097,560 *53A19785FFDECC0011BC17CC3B098529EEF072A4 Decoriana
806,097,561 *53A6BC53B2ED9D0CADEC2C9CAA0F5F52A4E61140 decorps5
806,097,562 *53A74348E4A59A93A90935F3177449BEF380EF4E decorrervos1eis
806,097,563 *53A79A042CA019BC3B766877BEBD2DE926453873 Deco$tate
806,097,564 *53ADD788A0497AB9657F6330D2CF272F8CA45D96 Decouragerons3
806,097,565 *53A41A8C07AA2EAD2CD560E49AD3F424F038E2DA De"cQ
806,097,566 *53A0EC49BCA7EF24FFBD56726D72BFC4F845B1C3 decrassified9
806,097,567 *53A67B449DB25E76930C534E14AAECA5100975DC decrecatu
806,097,568 *53ADA94ED9A017F10B63B3B9DD4E78679309E47C DECREPISSANT.
806,097,569 *53A0ABB1340BEFE30A973F70DAAE5590B5E87A0B DECREPITE1
806,097,570 *53A9C3B1BCF14DE6317DDEE3D20C66B9E0A90A3B decrétée
806,097,571 *53A676F3FE017B38CDB69445C58F1367B545C76E DECRETERAIT4
806,097,572 *53A1EA3CB81EA4B54851B5409E6CE78D022455B2 decretz7
806,097,573 *53A6CAB0C88079E007DEC0E9C1F3066D2F28AF36 DECRISPERAIENT?
806,097,574 *53A6FC0BB61E8CD43DBEA8D836A0731AE7A9328F Decrisperez0
806,097,575 *53ADFAAD2A4A613DA18BFA93506F5B1880A67263 Decroo123
806,097,576 *53A20C7670D4F5AD2F92E16E7FD5BF47222593D6 decroutasses
806,097,577 *53A6B447659FCB51EE5E9D040ACBB82236B1066D [email protected]
806,097,578 *53A94E62C7324A14CE7403A86D4080ADE28CAB1D DECUPLEREZ5
806,097,579 *53A43B6F37BC48C788B24F0C05EC519D5BF0F764 Decurents
806,097,580 *53AB098A79E8CB925E466A7472696C4E1C58D0B6 DECURIA.
806,097,581 *53ACFC8EBA11A6549D06DE14C1BB42596CFF063F DeCvf
806,097,582 *53A35EB26B5593F0A32512A54F0214B35380E4C0 D$-ED
806,097,583 *53A0A4B3D08D010305CF67B35E28162A12BA1282 D%E"D
806,097,584 *53A8C9F39D18A463AAF7C2EA9E420259A0D4205B De/-D
806,097,585 *53A737CAD8E8E239ACF01DB3AD63252EC81E3600 DeD+&
806,097,586 *53A7C955702211C0BCC25EA988244F17B2B6A26D D<ed
806,097,587 *53AC23E584027A7049FB5F8A7CD525A0FA1385BA DED35
806,097,588 *53A6938CB77826D4350D2E97BDA1784AF0E92FEF DeD3D
806,097,589 *53A3F2BCCB7F76A12E8289041AAAA7A550EBAC7F D
806,097,590 *53AFC6C47F81278802B50A52EB33446BAD83F952 ded903411e
806,097,591 *53A12A61ABB8744C18BB6D66ADDB685622532848 Dedaolre3
806,097,592 *53AD0E2618929D5D4D148C1AB3E4A92220ED748B dedayodeyinka
806,097,593 *53AE7B30C3296F208A0149D56FFF7175ED5AE977 DeDB$
806,097,594 *53A9B14927A69768BED265EE59B90BB4B69FE3C3 Ded,B
806,097,595 *53AE719064700B3A960C40CC2682366DB339DC61 Deddanus
806,097,596 *53A8697F1671A088BAB8234FAF872391B6093557 dedemdir
806,097,597 *53A3B5F1793E7C8827F5C214C2032EFF6D6C9D9B dederam4
806,097,598 *53A557E1A22E66ED555EB91A5838EBB795E33F04 Dedianu3
806,097,599 *53A0F123831EE0133A24C1EF06E06A028963114F dédiéaBouilhet
806,097,600 *53A9FDE3A4173ACC9A09F4797F3E4D1335883BB5 dedi muliadi
806,097,601 *53AB3B97D8758FFDA9694DEFCD11946866F27B93 DEDLOFDN
806,097,602 *53A355278D57A954CE1A4D4E2BCB4D46A930DE2F Dednuohnu8
806,097,603 *53A7DC97CEE42477128A10F0915DEA3957EBB023 Dedolks6
806,097,604 *53A1F14EA4C4E6156063166C4F81D6A3173C5558 dedolomitizatioN
806,097,605 *53ADBD149710F2ED27F73A328C3459B619CFFCB8 Dedommagements3
806,097,606 *53A1FB1A0B2386E3E2DF456E73D19C2892D190A9 Dedoolbe0
806,097,607 *53A510774ABA96FE9C6683AF580064A788D9EFBA dedouanerais123
806,097,608 *53A52912FBC2EB684646875978ECE5E7257405A5 DedP,
806,097,609 *53A16A2BE318712892C6001F099BC5538EB667FB Dedracalp4
806,097,610 *53A726F3397A7E69AD48576DC818FE7FE9420359 Dedraebt9
806,097,611 *53A060B23DE84C245E7FEE3BA3D3F2BDF8FE445B DeDu"
806,097,612 *53A79AB595E462CD09C10FF43563984593C380C7 DedU(
806,097,613 *53A05B18721A907AF383BB84B309E8939B3701AD deduce8
806,097,614 *53A2EEAEFCFDD5359AEABA27232E674D54213C9E deducete0
806,097,615 *53A74E51C7F3F1FA83E075C985BD60562490CB33 Deduci
806,097,616 *53AACB830D4BBADCCB4ECB0B9CA5E9664A2C7BC0 dedüíss
806,097,617 *53A00FCD4883FC8E6229CD2F869044F6636892F2 deduplizieren
806,097,618 *53ADE5CB41066BDC298180F2DA79F29C2FE52543 DeDVX
806,097,619 *53A22EC916B4AAE562D40FB9E8E62A37634352AB DeDWd
806,097,620 *53A3E6DD15D64DC12FD86DBBF0CD68BBA5B78750 D-%EE
806,097,621 *53A406F6D8F41D051987C883C218BB43D4A3C66F dEe0
806,097,622 *53A910B5140E025DF68E59224433964F619407B1 dee_68
806,097,623 *53A7B36E1F6A99A8DD2B0781CC1F28D6E55BBB4D De,e7
806,097,624 *53A737C656A3FED34CA0BD6C27996FD362755162 DEE8653
806,097,625 *53A2F0C7287D4EF403F9401CEC9237D47154EAE2 D,eeA
806,097,626 *53AC79FA62291665067EE01635A5EBC7F21432D0 DeEaB
806,097,627 *53AC8C04BAEDE6D04105725535814F2B1D0F5B4E dee.adolfson
806,097,628 *53AFF0BF5A306CF55EBB63DEF580DBA358E1DE9E deeannsing
806,097,629 *53A12B9E781687419DC3BCD043B9C74B29946251 deea popescu
806,097,630 *53A911FBC7ACC1740D207D3B64C8A79CF5AD2832 dee.astol
806,097,631 *53AE0ED4479E9F5AB35F6A7876CAA95F2C1A96CF deeayre9
806,097,632 *53A912F6F8199D20F0C0DE633A104A0D64AB4A77 dee.bauman
806,097,633 *53A449AB38AC277903475FEAE261E2C6CD4988A6 DEEBF8
806,097,634 *53A06200021A74F15DBD5A08AF7C3573B8374E81 dee.brinn
806,097,635 *53AF9F5CF0FAC04149333539F920CE08D15347E6 dee.bulman
806,097,636 *53A4BB3468145D989218D6EAA01AF3562E5D2A7F dee.chomali
806,097,637 *53ADA59DAE88A8C986987D203A8FF2144A626CF1 dee.correa
806,097,638 *53A978E4215E9FE24C9523A0600F55928D4DD816 dee.cuda
806,097,639 *53AC6FA3752CEE6866F718FCAFFE0CBF8788A42F dee.czwakiel
806,097,640 *53A691D37C911B2468C6C00B83D69DAD878073C6 Deed1ess
806,097,641 *53AD0300E1831BE30CC6DDD1D2080CE663A8EE8A Deedact3
806,097,642 *53A37AAF35844047E2BD7A53BA0EB005D826BA77 [email protected]
806,097,643 *53AE32281C446AC09D09F9F0B7F673C31B4D98D7 deeddew2
806,097,644 *53A67984751FB0186D5A0D7925D2C0888AC978B9 deeddood5
806,097,645 *53A5E990FDF04550ACFCFCA45DC458956F53B8B1 deededs0
806,097,646 *53A68FD0CB6A4D8B4ED9E506BD517893022B63AF DEEDEE!!!
806,097,647 *53AAF6572B4B48A6B3D3149DB570210ACA939886 DEE_DEE1
806,097,648 *53A971B7F4F2D243E73E97ECAB86DC45EAE8765E Deedeeholly
806,097,649 *53A7A0F3EEF9E3CB465DB48C8DD89836B06FD165 deedeet1
806,097,650 *53A33B4ADE670D9F2F1CC393593DE901C70725E1 dee.defilippi
806,097,651 *53AF800D0BE5DB46E7B1F5DFBEA6D5668F693774 dee.defrank
806,097,652 *53ADB86120877A7E7D8A2B36D9F92D7B7483F4A0 DEEDING8
806,097,653 *53AB9623D59730C6421E97C7032BD2D55D9E2F29 dee.draughon
806,097,654 *53ABB530936CA4D0B7E0FDC8E936A462D57AD17B dee esse
806,097,655 *53A00E0D653E1ACE571177062BD0610B1EAB3359 dee.fuson
806,097,656 *53A0C0F6730E5180C2A733A13D73D2C6228C5D31 dee.gristede
806,097,657 *53A9001CEE72BFB04DEAB8B3FDFC6BA3CD329062 dee.haver
806,097,658 *53A6B28222E9D0FA9755642BC53A76300A9F5945 DeEIf
806,097,659 *53A06B838E6798A7323CE5D553D6CA8BEA2EF895 Dee
806,097,660 *53A9DE5EF3918A714138D43AE879E8BA70FAC4E6 deejae07
806,097,661 *53AAE58EEC81BBFE16A085772960B6B8BEF8C14C deej stewart
806,097,662 *53A11686DB4FC166190DF74B089D210F14041F0E dee.karlin
806,097,663 *53A3922B2C730F50F9FFA1CD117AF873BC3E9037 DeeKh
806,097,664 *53ABF6F58F79837A1FC5EFC90249522F8A72665D deeljeet thounaojam
806,097,665 *53A58136A846861C7A3570EFF128376BA192CE1B Deelneemts
806,097,666 *53AE078A64D532741EC47CD0CB348A745F7D64E5 dee.manske
806,097,667 *53A5FA3A3CC7AC212A09B1E21D17E6048DBB1FB9 deemaxey
806,097,668 *53AFE4AF0F84D03FB327FE69D4CEE43366F7E331 dee.merrell
806,097,669 *53AF1472EB71C8FF5C9EF966ACC5A9177F9BE539 dee.metro
806,097,670 *53A05D0539DAFA2F03F793BC7D2BD5A52420FF9D Deemphasizer7
806,097,671 *53A4225AE337D58EB2F959A56973885DB576CB28 deenken
806,097,672 *53A40B36D1E20D30FB098AE8F1ED7137629BA6F9 dee.oltz
806,097,673 *53A7411252B8F3BC48A690D9FCFC47CBD587EC31 dee.ospina
806,097,674 *53A59AAE5CA1F6A4E6DB032A1A300A62A3AEDEC4 D%eeP
806,097,675 *53A56FC4E9E32FE66F580C32BBE509158BA65B80 deepa deo
806,097,676 *53A8F061FB09A4C88774F3919CE38F9DF61C3804 deepak kukkar
806,097,677 *53AD62ECAA479999D6167EB0E80C4147318D93AC deepak lunawat
806,097,678 *53AE29ECA2C8029B99E5A61C6A0870068648FB7B deepamimg
806,097,679 *53AF4BC2793D747E563FD1061748C185BF0269F5 Deep and Hallowed
806,097,680 *53AF6BA94923806889A425942633816824902813 dee.parga
806,097,681 *53A28742E2F903BCA3FDFE0045C82391B28D5E94 deepbmx.comwww
806,097,682 *53AC7012E0757FB84597D8126C46877D78B66679 deep down (30 second version)
806,097,683 *53AD5839CC09ECE22F1BF429512DBA1F3166F687 Deep End Boogie
806,097,684 *53ABF6CDDEA219D388FD4A2CB2A185189EF02013 deeper-blue
806,097,685 *53AE9E4DB3549334C45C14092100E59C94317C70 deepfriedcricket
806,097,686 *53AB99813AB9BE179D9FA307EBE3B5BA9D6DFDC4 deepikaduhan
806,097,687 *53A13614CD3C46EFCED20284A23B3DAF08DE9E96 deepika raju
806,097,688 *53A72F517CF85FEB9EDDC8427D8055EA52881AF8 dee.preisser
806,097,689 *53A372EAB7585465227C8CD58AAB6C28FE61305B DEEPSANDBEDS
806,097,690 *53AA4B86C517A2F9429623D804E3A8E56D4C1518 DEEPSKY'S
806,097,691 *53A1DDABF7E918BBB82C97CF68B4EA198898B87F deepti sanghvi
806,097,692 *53AA6789EDD8DBFDA1A59781EEBE95AD8C5D4E84 dee.pultz
806,097,693 *53AEF1FC78F5B249893F845A14DFDCC68C96A568 Deeqbswed
806,097,694 *53A1E5ADA99FF163FB3AC864AB87DFBC7385EB9E De+er!0ra+e5
806,097,695 *53A02E31211392FA9250DA503F69DA49E9AAAA93 [email protected]+1ON$
806,097,696 *53AA3E094E09482C2F9C0922592026626B8ADD84 Deercape6
806,097,697 *53A83612131813C76FDEFC7921C59BAB6BD54728 dee.revolorio
806,097,698 *53A42D45C4E3E3D015FE061A0DD715461EB93F4F deerged9
806,097,699 *53A033DFC5E39B73FF93F19B75AC46BF5377CA54 Deerniswaard6
806,097,700 *53A87EBF1F3117E8C0060B3B96C9EC3D2331BEBB dee.romo
806,097,701 *53A2BC5F82C65688FD8454BCCA1973171A5B63F3 deerstealered
806,097,702 *53AEDE75CDA419D88B5E69C7BA547A5AF7186FB7 dees5us
806,097,703 *53AAE0A9CD09EF5516A495D4943664A9E9AA664D Deeskalerende
806,097,704 *53AB615972ADB09748B365E474B538430F2CCFAB dee.soos
806,097,705 *53A216289DF7D3FFB3373DEC9E914D2713258290 deestparmessoins"(Herminie,Clorinde)
806,097,706 *53AF459B7AE059C79C15CBE84FE0E098258C8AE7 dee.teixeria
806,097,707 *53A2A8102FDB03BFD5782C0ED74E18699BB78546 deethen
806,097,708 *53A3A89D8C998F533270C1478F7711FE57BA486C deethyl-8-apocaroten
806,097,709 *53A1FB0C95380965572BB349087E7BC2226A48C3 dee.warmbrod
806,097,710 *53A349CF0BBEB58DFA0E8FCBE8E5FB2398393AAF dee.wigton
806,097,711 *53AAF779BE79B5A4B1E98F9B3D76F55A9B06F6AC dee.wintersmith
806,097,712 *53A35B6891CB41EBCCBA531CD53ABA853C043B79 dee.woester
806,097,713 *53ADB17826B6949405A2E11D39204E6C35253C19 deewrubs
806,097,714 *53AA1472355CF5BB1ADC27C811BD0B13127B085C Deeznuts1999
806,097,715 *53AC52D412DC284C61AC02B44B6A8D885CF62180 Deeznuts69
806,097,716 *53A23A6AFB6AE84CB6B9A4D3F8EC3D4CE0CB1DBE D+Ef
806,097,717 *53A5BDF95E1EA9A1DDD454D62CBA02593DE95784 De.$F
806,097,718 *53A42EA2F048FDD95A90B75A136399CFA8400035 d[EF
806,097,719 *53A067E39633253E1E6AD40F22868D8DBDEC296A DeF7E
806,097,720 *53A3CC8884120F8037339BC3F2DCE1752978E20C defaillons!
806,097,721 *53AED3A3C75437C0D8A006DABF6973570CEB3EC5 Defaisons1
806,097,722 *53A0641CCDBBC92F0917F103E2F31DCE7AE49C0B Defalca7i0ns
806,097,723 *53A6F46BCAC8088CC5D121662AE2216A5A9A29A8 Defalquee1
806,097,724 *53AA47C7E07DFE0132956062CFACAFCA56D3F4DE DEFALQUEE9
806,097,725 *53A8A29FEA65EAB52449C0DCF585C876E30AB51D Defameth8
806,097,726 *53AE6051A441B8EF20E08E86675E26164A81CA80 DefaN
806,097,727 *53AFC79E2F000BA421E46A193CBCB39C9724365D Defasados3
806,097,728 *53AA8E244C4DDC203E7F8CD508B022CA377BDA79 defasse?
806,097,729 *53A7DA8D6F027CF1C626E5F232615E83611C4EA4 Default)
806,097,730 *53A3B3136BE4BA09D90B07ED7B8E8862002D1057 defaultbrondello
806,097,731 *53AFA7ABC1DE6F8A45261417F017CF857B766578 DEFAULTCONFIG
806,097,732 *53AC7C3612936EB14C7693E57E38B3F6380BD26E defaultpopupredlinksummary
806,097,733 *53A18FEF735CACDBBFAEF139DBBD1612417363AA DEFAULTSORTの誤適用
806,097,734 *53AC16E678ED791D66B812580E4AF01EC82D7B4B DE'FAUTS
806,097,735 *53AE774464F26378D88B0AD591021CEED097DE42 defcon은
806,097,736 *53A8D5D344634A5104E9353E8CC0D6E3D8B84155 DEFECATIONS1
806,097,737 *53A3C59D67A4A6F8C08C0352929DE1A342B09669 defecerantque1
806,097,738 *53AEEB5CE7DC8CD04DE56F7F953315ADD3A72AB1 Defeciani4
806,097,739 *53A284D9BBB09C48B0CBBB7CC43E9C8C544750DC defected in the house: eivissa '06 (disc 3)
806,097,740 *53A9F7543888BE3D02DDC802093CF873B5E9B1B5 DefectedintheHouse:Miami09(disc1)
806,097,741 *53ACB1625C5D0902D9BD830A0B85C3E73609EECE Defectuosite6
806,097,742 *53A5C8613677219A21C5C1FD8AC93D6654C986CF defekten6
806,097,743 *53AB292F71DA972BFF5D8774B9A8C84E41200BE1 [email protected]
806,097,744 *53AC90FC02AB23D04BABD8435DA46AC869A0DF61 DEFENDNATIONALISM
806,097,745 *53A0336DB99BAEF09DA44A7D86F31BE6E2C3E1B2 defendolinio
806,097,746 *53A2B53C15A2B3A64E00B8F34E77D23FF021C41F defense1931
806,097,747 *53A8E58DB19DF84701CE71CDC542924C7BEF16B1 defenseapple1
806,097,748 *53A001DDC63A68655A97EC826C8FBAB3D13FA24E DEFENSEDICKHEAD
806,097,749 *53A5CA03A6C7917DEF51881A3586EED13167CD60 defensemorgan
806,097,750 *53A081A23BF30DAA82439CEA21B705A3F63A443A DEFENSIEWEZEN9
806,097,751 *53A9A645B5A3C8F190F27A02A23EE5BE78F9B01F Defensis4
806,097,752 *53AD1DFBF04FC147CEAE58F23537B2F32860B9B5 deferriserez
806,097,753 *53AEF9DF7B723D48E58C38455AEEAE4994A0152E defeudal1ze
806,097,754 *53AE0145BEE388C63D3E0EFA2D42E2FE8E3AB2AE De&FF
806,097,755 *53A3B7385FB21E6EA48A142AC40D19C186904D68 defiee6
806,097,756 *53ABD1A075BF91076BC4323C306163C1AC3C94F7 defiesseifed
806,097,757 *53A02CE02652CCA859CAC05341BCDAB25E8AA708 Defigitur2
806,097,758 *53AE73A3FAB5CE321264DAF7620BF88FE5745CD5 defilaient1
806,097,759 *53A0B4E0B41EE4552480F4FB167FA0EDBCD7A425 defileervlug1
806,097,760 *53AFB9DA293055CB1705ABD533197557E8AF54F6 Defilerai0
806,097,761 *53A80C3F730B941FC5E3657F21C25883E2CFAA60 defilesting
806,097,762 *53A2D9F6E726FD090F7444E7BE7485704B828B59 de fin?
806,097,763 *53A287F3ABC4FAD2D26EDF7D42469FD83C64DDF2 Definieer5
806,097,764 *53AF9DD384C6BB1EB5852CC3346404F06B10A75B Definiera0
806,097,765 *53A62804F95143D381D4A0D0E237D2B3DFAD25D2 DEFINIERTEN.
806,097,766 *53ACAD093810FF625642CDC193CC31588DFD1C90 Definiram1
806,097,767 *53A329E86A9277E4F7C5701011FB5A5B7C791E7C definitivamene
806,097,768 *53A9E90F8480244B33FAA9AE9067DAAD9929907C DefinitiveBreaks
806,097,769 *53AD7CEC9D0AC041A154EC19A45D6BD27525D3EC DeFke
806,097,770 *53AEE2CFCEB1F420332BB0CA5F922265D0112213 Deflectors5
806,097,771 *53AFF829F4198815FF47A5D86F66AE01B2D9CB3E DEFLEQUE
806,097,772 *53A6B14349428C73ECB1ABA04C02D6E6EBA38FFC deflication
806,097,773 *53ADD96D51048F57A0825D881FCF3DBFFC07F286 Deflize6
806,097,774 *53A1F6D20312B32958611A98160E6D5C3259B9D9 DEFLUISTE1
806,097,775 *53A7CD798AD4B33661E746E8E07807DCC07442A0 Defnoc
806,097,776 *53A009B5A6E8B85B5502766F6FA48098A85CF9B5 DefoeDefoe
806,097,777 *53A10341BE3E6C904B860228152251678322EA40 defoler8
806,097,778 *53AE53744ABF8C29FFF99C5F2FCCE5CC7ED3D8E3 »deformacije«
806,097,779 *53A270A36774DDD51E72B501A0DA417CE9425B9F deformastE
806,097,780 *53A6651C079BE456B55ADB0813EF5C6C7FB42CC9 Deformedsing
806,097,781 *53AF2F6AB5DE08EA226268160866874321E73052 defoverd1
806,097,782 *53A0F57ED842D7CEA1F3139C7755B3D6C53D02F4 DEFoW
806,097,783 *53A08B2E12441487C4380B0228B79FA10051B172 DEFR057ER
806,097,784 *53A1C9C405A3F42C9910D121F2236E0EF174DAC3 DEFRANK1
806,097,785 *53A9E2BE6909F1EE005D7D24BD3D3DE0866C70AF Defrayerons7
806,097,786 *53ACD7EBADFF1F0CB2CB0E7E6957C4EC75032710 [email protected]
806,097,787 *53AA501171FBA80DCDA6586C4709898CF8BEC640 defront
806,097,788 *53A55F80CA4B6BFC0B481A0B5A99FD2EA7C6B16D [email protected]
806,097,789 *53A068B3414C2349CC7366B46693CC5D86A2938D Defuahca
806,097,790 *53A42C46CE18BAD87A966F42A36A6FAE4685D44A DeFum
806,097,791 *53A64333973F7E80D813B5BFF09109AEE1E433D5 defundsing
806,097,792 *53AE4E56385F658309605D56533B13F27421C7C6 D;EfV
806,097,793 *53AC2A3321B80FB6804BC9165C1421DF767902DB defying?
806,097,794 *53AC7DDDD91A8778A3E6E3072F08DBBDDD45E8B3 De,G!
806,097,795 *53AF06DC0FF44CF7ADE0C7B5A46384151F9034CE d{EG
806,097,796 *53A280C4425D0BCCAAE6E39DF282FBB2C1CB1B46 Deg1!
806,097,797 *53A6FB0F847E7C339A396F42982DECAD7767820C DEG94469
806,097,798 *53A81EC1D7E6F19D6F8B320D6CD53E4B7577CA59 DEGATS?
806,097,799 *53A64E2ABC226A61ADEA671D00C4B95A6C88FDA7 D
806,097,800 *53AD4E029EAAD4615FF50AB53776EE174F19F941 Degdehwe5
806,097,801 *53A5DFC33C0E935795E3818A938D1C1677B80E7C Degebat4
806,097,802 *53A1B4EB9AA1390D353AE032B5DF5F1F2306DAF8 Degeformen
806,097,803 *53A04F82E44AAC783A042334CAC0EF01DD5B9435 De gekte slaat toe
806,097,804 *53A1DB1E49E7981B08E910FE7693B7AE72654EE5 De'gelan
806,097,805 *53A6440547F0C89C75C43FC58917736C9BADF781 DeGemini
806,097,806 *53A37DED826AE37F5F6805E92379D8BBB03E2BC8 degeneruchu
806,097,807 *53A9D95B6AB4CE883BFB955F0913F43418238703 d’egeu
806,097,808 *53AFDC3F78466BE65369DCBADFEAA5FFE69BADB1 Deggartt4
806,097,809 *53A81E0D38E9D3E3733DBEA46E383F78C384CEFF Deggawgi0
806,097,810 *53AFAC4EF624D10515AC35696E5D7E6EB33C5989 Deggler2
806,097,811 *53AF4190F5EA2D79F5337FA54B6D00AD2987429C degnavas7
806,097,812 *53A83D4E5EEE58FB59819A00C9F36FB1EE9A024B DEGNERO.
806,097,813 *53A5B31AA8B852D00BE46EDEE40D215A5C5152D5 degneté
806,097,814 *53A40A7868B7CF59FEF40EF9F53C6B7F56BB147B Degnupxed
806,097,815 *53A0D21DFFCFD01F806818944924215C8D6D5F36 DEGOISER7
806,097,816 *53A1D7A534206F7F38B43FF79202D98DA3C26ABE degonfleras!
806,097,817 *53AC13F2372F7898A5FF6B15955736437C3FB62F d’égorger
806,097,818 *53A1EAB9FF6A1D1E2D90F6BBF1044636D7ACDCB9 DEGOZAIMASU
806,097,819 *53ACD982C770AF06C0770EDF90143DC17140FD06 [email protected]
806,097,820 *53AD37C81B15B99E46DA3CFE206E671F9FD0A733 degradatiepositie
806,097,821 *53A1F75795B9C55A84F91EE5C74CEB176C35D515 [email protected]
806,097,822 *53A63483DDF27563E4D78754D9E46571FD5C64E9 Degreeff3
806,097,823 *53AA95DF9E110EE3F09A0641248655EB479BABB6 DEGREESEVENTS
806,097,824 *53A19634999AC388568CED6B0AA8D4AF86081DE4 Degreeto9
806,097,825 *53A090E62254283BF46A0D0A1F3A475A13C37ABC degreewi0
806,097,826 *53A888075EB11C56B555D2E2DC503893C642E378 degreneront
806,097,827 *53A964A64B83A381D84DB052CB9290C04A3DCEDD degrisees?
806,097,828 *53A2CA0B4D8D4E57E153FBDEF8EA5FC8CC387A6D DEGROOTE-LARGEST
806,097,829 *53A4E4DFEED8419D8A5D9C00C32C5475DB32BC02 Degrossissage6
806,097,830 *53AA5CF56874AB22907670D1A7FE166468F7007D De#Gt
806,097,831 *53AD0C5155AA57D403D6C4F6C03E144BDA232001 DegU=
806,097,832 *53A46EDDBA3232D47112C29BED0F64F2BE3D2464 deguelta
806,097,833 *53A433348EF0429108EEC3FFB777B19975F04F94 Deguerint
806,097,834 *53A166444F745F6E7FB0A5D8742D12EE3C4CBB10 Degundised
806,097,835 *53A0A68D4AFCE91987E19DAC24EEB88DA412E244 DE+gw
806,097,836 *53A8997FCA5CA298D919148DDDE7BAF0E6C0A583 D)EGX
806,097,837 *53A5076AA49E5D8A4B20D0772BFE90823A7015BE D!E
806,097,838 *53A491EFC9644FB69335430B35C1B3DC790D1C80 D$E!h
806,097,839 *53A109082D3E3FBDA91557176A3CD6082817DCD3 D-+eh
806,097,840 *53ADFBB114C4972625784B8747818FD854C63876 DeH4n
806,097,841 *53A2C60B2EC185851AF1AAC7B0EA0A5113D50E60 DE'HANCHE'E
806,097,842 *53AA68E4C8BA2E9399A0AB458A60C9AE8DF2DC99 Deh
806,097,843 *53A04104E1C034A6F0631D85D920265E15C5BB61 Dehcuodn9
806,097,844 *53A8A6B84107431A4DE0B6CA76B13F601FAFFC5A deheloten
806,097,845 *53A388DAC92DFAAC6E929734673EB29D63F56188 dehgiens
806,097,846 *53AD7CA6B62812292E07CC8AF7AFD25DC9CFE7FD Dehkslad5
806,097,847 *53A869D897FDCF13F01DD30233BA91E3EC558D37 Dehnunys
806,097,848 *53AA9567DB94805334BA4F0185C880D205217609 [email protected]
806,097,849 *53A97615206A63D5A4C4C76C7EAF580ECCC77910 DEHQN
806,097,850 *53AC9BA50361A4FE3B061AF0AA4B340DF10DCE2B dehsalpsing
806,097,851 *53ABBDD51433369B97E55D138F46FE6587F14C82 Dehsifwa0
806,097,852 *53AFC9EFC0ED81E0DE6CBDD3A414155229D309B6 Deh;W
806,097,853 *53AE5097787D346328A3AE8E0A885438EEAEEFD0 dehydrogenase25-dide
806,097,854 *53A8CA32D931298AC0BB9EE029B850914942EB72 DEHYg
806,097,855 *53A64710F59E1EDE35420191DA4560884E86B1E3 DEI)/
806,097,856 *53A01CB88BCBEE12F083E49D90BE6ACCA6F7D43E DeI
806,097,857 *53A017314EFF68F6479A844199DAAE831DF96121 DeI06
806,097,858 *53AF83BF63B97E457D70BA5D225480C5474F540D De.i1
806,097,859 *53A1B80E87F27DB9282E8301724EBBAE99E70F4B DEi9g
806,097,860 *53A5EB6CB862BF3628F7C2F6D1F7548C05AB23FE Deibegsk8
806,097,861 *53AB531759C8096014C8D375E63FFDF7AE739263 deichhausenwesselbur
806,097,862 *53A519AC3092D9E654D22E0F2D73E9A8AABD8921 deichkorsett
806,097,863 *53A93BC60783E54BC5C83634E75ECFC2C6DED455 De,ID
806,097,864 *53AC0364815E9BAD5EF5ECB873DB9242F03E47C0 Dei&D
806,097,865 *53A2391DD7BE7C585E089BD8658B46DD5E793D0E deidra robinson
806,097,866 *53A756264DA0E5BB886369BB2D5BB03E67E0B0A3 Dei"e
806,097,867 *53A10105521CDF0DDB6FCC7A667E1A2460E847A6 Deillebg1
806,097,868 *53AB259687E2CE4C8983551DF23AA3BB60EB0866 De!iM
806,097,869 *53ABCC6562AE7A1A40039A0B224D1EA7A7B27C34 deimheas
806,097,870 *53AE731F3A52860A1C866C7D16DFFC98B1A8471B deinarkhos
806,097,871 *53A30EF8B14608B45BFCABD7D7BED9369D798537 deinems4
806,097,872 *53A1F8E5B5282CD7E3446E36B1B9D0C1054C8A63 deinetage...
806,097,873 *53A4E983E0EC1A380747C1ECC74EDDDF48FA5D93 deint9
806,097,874 *53AA371FF69A6305A973D2BB05D032FE84D282A7 DEiOj
806,097,875 *53A84E8441CE47F5572F6E179859261347224C89 DEIONISATION
806,097,876 *53A2C16E365E282823EFFAE3379BDECC7C8EF1FB Deionta0
806,097,877 *53A8D5F0D7DF018E9BC4D7DD243849C8FB22F1A2 Deipocsim9
806,097,878 *53A556B4A27D1A338293D69F707555B665A65D46 deirdreandtherasheeds
806,097,879 *53A0DDCF659DF7007638CFA31144AB8E1674525D deirey#9
806,097,880 *53AB3AAA2BAD521F653A801BE284434C20CCDF71 deirtno7
806,097,881 *53A37128EC64F6C6008F1F52FC61566FFC5CE8D4 Deiseaned
806,097,882 *53AC0F21B9B41A0D7E71D84807BB72E8F2901C07 „Deism“
806,097,883 *53A79A3FE6DD8798864AB085BE8054DF94D6598F DEISMS3
806,097,884 *53A1ACF8E025D959C3430C0E4EF5EE110464F88C deistic1
806,097,885 *53A95B759606C3928FBFC18B26FC46DB8C286C15 DeiT8
806,097,886 *53A1B3403DF05A34339AB3C76F0BE15EF01322E0 Deitelind
806,097,887 *53A348DE96C46DBB1B7EC7F38ACC6C97E2101FC1 deitnahses
806,097,888 *53ABB81F18E96A8410A8A9EA4FF769D848403AD4 dEIv
806,097,889 *53AAAB3DC20A57A09C63E4E95707D5E8E7653713 Deivvihc9
806,097,890 *53AD361A8317C36AE0889090CE3D202FE6975727 déixovos
806,097,891 *53A37EC0C10BDCB7C6330E36661EEF2894E39463 DEI+Z
806,097,892 *53A780A2D114C122613A6EFEFE869B9E8BD48311 De-.j
806,097,893 *53A1A6B88D9481ECF4CAEF6A67F776554DEB02F5 Dej1R
806,097,894 *53AFB15289990A168B8432692CE609C13DEA8950 deja173
806,097,895 *53AAA1A47ACF5B7F1B4B08CE586509EECE904ACF Dejagtige7
806,097,896 *53AFD332E029B4147840208834CAB8F0B32778A0 DejameGozar
806,097,897 *53A8ED91A7AFF3F0C49A15CF8BA6CD9334FD7196 Dejasteis1
806,097,898 *53AAFB1F0351953E31BA977F836BB6CF740BECF6 DEJAVUE06
806,097,899 *53A02B29148F4B598217083D2AA38C1B567B35D2 dejay\
806,097,900 *53A6B33E4A2D00ED98546B76B62344DEC321F4C8 DEJEC+$
806,097,901 *53AF7F716C8DB7EBA629378C1EE05172755CDA1C Dejectin3
806,097,902 *53A4EDD42DDCCB510357CB423963A0D4C63C856E d-ejfl
806,097,903 *53A33CEA03949FD6BE6D7AFDC7C9A34251C35BDE D#ejj
806,097,904 *53AD95F29196C8FAE30BAB0A832C72D5CD25758B DejO3
806,097,905 *53A4DBA5D0C7C7B0E1BBB6BC3FDB3ADE49AE0C54 [email protected]
806,097,906 *53A96A6DAA1071FD075C6ECEB744906DA76A388A DE(ju
806,097,907 *53ABA21952659D0E5A74BDBFD1DFA599B3D60A30 Dejugerai!
806,097,908 *53A7914369DDF604BD0BDB476C686E7FFEFC2792 dejugerais!
806,097,909 *53AFA3F5028F3B35B0C416999A23054351C7DA90 dejulius5
806,097,910 *53AB65A733AF8533A9F8F057BA04DD12025402CC D?e!K
806,097,911 *53A1AEDEFF8B712EA5D78B8D426F3A3B1872827E D?ek9
806,097,912 *53A2A1A1BD19F4E1CB437A0A3C72C5F2FC2A6214 Dek9r
806,097,913 *53AAA5A2BBFD5FA01002C52DC1F5B9D9256A4C44 Dekaolcl6
806,097,914 *53AE415BD14A178D8C7C7E5AA052DB5A5DCDE58D dekartellisierungbeh
806,097,915 *53A605B47594D1E464C275F96D538432E514AF04 Dekasome5
806,097,916 *53A0197E691C67BD1722DCF212114F95338D88E4 DE_KB
806,097,917 *53A2A35B940F4D73A3ADEBAD547FD15D5E9B0B6A DekBf
806,097,918 *53A9CBD98FDEFAA9441FDC691C7C5A71698F1FAB DEKbo
806,097,919 *53A6FB88C65ADC53C52BF062EEB915EB4FE4C1B8 Dekcilf5
806,097,920 *53A8B0DA8C50813A29FB5CD373F75DEA9C5F835F DEKeC
806,097,921 *53AEA310F80189BDE17C49B73FAA451700A4DB6B Dekendas
806,097,922 *53A43E72E9AABB634075A985EF42C88B1518BD3E DeKeven
806,097,923 *53AC978CAC712FAC83A99ECF280DD1137F08F5C3 D+EKF
806,097,924 *53A5902BE629614D2628F85AFF5AFBE8CAE6063B Dekipsesed
806,097,925 *53AEB297628A091CAEF63F1DCA187E126B727A71 [email protected]
806,097,926 *53A13F70E51E94FD696222B22A587FDCE4B4570E DEKKILISTOJA
806,097,927 *53ADB44F639692CDF3C752D9B3327BDA4E004193 D)EkL
806,097,928 *53A7F3D07DE65EB50F5BFA052D16CF172A0ABFB3 deklamovala
806,097,929 *53A8CCCD65B225EB56EB47E058B39439C38E1429 Deklatsn0
806,097,930 *53A6CB2FD555EE0B29B3EADF070C26FE9CE02A38 DeKn7
806,097,931 *53AA92E9DAA4BA8786516CCF5D2AD9A437DC7B13 deknaald9
806,097,932 *53A5999BEFBC648555F2F81AD37953EB8936F05E Dekoderes
806,097,933 *53A80F9E1C4ECD3935557717CFFA8145F8FA96C4 dekoders4
806,097,934 *53A4ED68C0F1D3BE92EBE197B20EA955BFB1716D Dekompilatory
806,097,935 *53AA093C68A001C766AEB06BE1E1995869F04CE2 Dekoocma6
806,097,936 *53A2DBE46241813DAC65EBD42CE4A450B919F9DD Dekoppeled
806,097,937 *53AB52981FE6594AAA902C0621E85B6613133521 dekorációkkal
806,097,938 *53A7A8F103FBD9E98E726B9A0C098342CFD7CDAA Dekorationsprodukte
806,097,939 *53A56945B9A082C9986F3F91BA15A86ABD131FD4 Dekorcu5
806,097,940 *53AE379CE123ECC32C29C44EC9516378FB8436E1 dekorere2
806,097,941 *53AA2F0CC6C7C59738E8FA1D4AB450F0E9E176F3 dékoulakiserons
806,097,942 *53A2ECAA1A4D2E1616BF5AAD98AE2DA81C5FF115 dekoysiding
806,097,943 *53AA627184445D10E3485CD7C60E5E14BDF36CE1 DEK+Q
806,097,944 *53A8304907E622D4F834DDEC6B4214A2A5A3C299 dekremened
806,097,945 *53ABA2F328D43369298081929206DE6558532EBE Dekrofnu5
806,097,946 *53AADB6BFFD50BCC1F2290B91C78939FCEB5454C Dekstro.
806,097,947 *53AC582A10D09D481BF4526B81413F2706259066 dekten8
806,097,948 *53A1F629DCA7CE017368D9DDEFD5588892ABCD8A dekvlerk1
806,097,949 *53A0041388780912A56DF89502F82D841519B69B [email protected]
806,097,950 *53AA7EA874B862106C03B517DA057884EB5CCA93 Dekzeils1
806,097,951 *53A209933BD80F2EBBB6E8995F2EA13EAB55122B D.E/L
806,097,952 *53A1094329DF362870CC590D5E1DC68493E90DEF DEL+!
806,097,953 *53AE888DC77C4BA307F1371848F6E96BB7C38FDA DEL1Z
806,097,954 *53A7C60240A349C5702D884242B63F915FDC7A74 del2pr
806,097,955 *53AF34B3D9588948DBE41D06D0C898FDB2ED0CD0 D(EL4
806,097,956 *53A4B3ABA896F3F604D4707C223E9093A99AA11C D$el4
806,097,957 *53AD15190D518FA9441E4B081362E79843307BDD D=eL7
806,097,958 *53A53C6CDFFADD1EFD6DED680A29E6C0B1F3654D Del!8er4ted
806,097,959 *53A0ECFCC1D5FCAA8FB04C3CA462EA40652B9490 Delabrees8
806,097,960 *53AEDE9AF615D1C01723564566105740B3A01149 Delaehnu4
806,097,961 *53A209BADCEFC25077C60C210C3F73F7073F1CC7 delancie5
806,097,962 *53A01B6266370E50BC7386FFD05EE97C2BF86EAB delaney919
806,097,963 *53A879CBE82D1D72E30E6BC4FCB0CD2BC934AE58 delaneybates
806,097,964 *53AD0CE2ED6D07F4850ACA13606E9B25866B4E9F delanines
806,097,965 *53AE2A86F47E8E3BC831D2585E9D35E497569BC9 del.arkontaky
806,097,966 *53AA1FC127A560B2759C3FAA73DE7D180D4BA31B delarvas
806,097,967 *53A799CA61ADA7809DB6192DC28BAD280C3FF148 Delawalla0
806,097,968 *53AF1E959BD039BE68B83236981C8451D8790B08 delaware-radio-stati
806,097,969 *53ACDCD56855201D677E6AE0DACC7C523BC2A958 DELAWARESTADIUMCORP
806,097,970 *53A8E67AB4F68DA9031A5C7C2E8E43B7CB71ED3B DELAYED-BINDING
806,097,971 *53A82581B8D9302A8618A077BB2C5CDA32D746C8 DE_lb
806,097,972 *53AF3DC3453AFF232B3E0815C1FD1956B37B3F65 .delbasid era wohs
806,097,973 *53AE3CA97687AD08ACD594196958AAF1DCD170B8 del.begg
806,097,974 *53A9C52087EEFA437D3550B188BA731492F53799 delbert.cauthen
806,097,975 *53A22BFEA1441AA5F4DC01EA451A6FF0179C9142 delbert.deeters
806,097,976 *53A977D030ABE8DE8695763487CE4E40A4342733 delbert.ficarra
806,097,977 *53AEB552C867C5C03E1E90A85D485CA3782D2597 delbert.fortgang
806,097,978 *53AC14B0A57E897127CB1067C8E323FD796AC780 delbert.gannetti
806,097,979 *53A15186AEE497E97817B2AC8E0BEFC6C0ACDEDC delbert.gattis
806,097,980 *53ABCA471D637E8B093E3774B8F59B0D89BDD77A delbert.ickert
806,097,981 *53A898C389EFEB8A72AEF76C4971D77279E22353 delbert.jerald
806,097,982 *53A3063D6A9907F8E5EDC1BE0B449186245B616B delbert.liebman
806,097,983 *53A2ECAE0A0002BA85071BDC47FEDA56B40FECAF delbert.loats
806,097,984 *53A0FA2860D27C6A137F7E43B51A37504415ADDB delbert.lollis
806,097,985 *53A64C263EC2630A6452E43AC2A2606716D710C4 delbert.monohan
806,097,986 *53AB82052778978E0E24B89A3802267BDF57EA8D delbert.ozer
806,097,987 *53A88D0B89FBECE222CC783B4029DDFF027CA60E delbert.rizzuti
806,097,988 *53A1953E7726A40D317ECB24447A4E559DF4CA08 delbert.shewmaker
806,097,989 *53A4CCC52A9E6108F0A5D808159F67547D3CB108 delbert.steinhoff
806,097,990 *53AD8BF56F25CD0DD62C6266C33D765E418EC5B8 delbert.teems
806,097,991 *53ABCF3CC1C0760AE5A0082E148E7EF6F6989226 delbert.trettin
806,097,992 *53A8D7568D3C2043DA21D93B21A99D5EA67CB86A delbert.vinas
806,097,993 *53A9A00D8A78368F29E95313DC8BE0EB3A8BF568 delbert.walraven
806,097,994 *53ACFC81C03FC8C5569D2848AF1C4B3962CD9D57 Delbrek6
806,097,995 *53A67267CF3180917ED8E6CFCA51989EA335D216 DELBUND
806,097,996 *53A8AFF4A292E05D82A9659300754DE40C93457E del.cavez
806,097,997 *53A639D37B87BB8F03AE5B16DD9EE2F7AA184524 delcita7
806,097,998 *53A94936D4679C9367DCCEA7F8702EB7CAC6DDBB del.colello
806,097,999 *53AF545AE7B0C00E07D4392AC0B9DCF45F578039 del.dimaggio
806,098,000 *53AF74A45BA31C5D2DC8D000422D798335A18A9F dele24di
806,098,001 *53AD5A52B3E42554E263AAF0A454E588DD4B038E Dele7ions
806,098,002 *53A9648804FF6D087AF25148E8848D05585F4F1D deleberk
806,098,003 *53A34E3DBD698EB8890D21335F0AC4EA604929FF deleeeeeeeeeeeeeeeeeeeeeeete
806,098,004 *53A1C30EED0CB511CCF9CC2FF7297120A095CC22 Delegeis7
806,098,005 *53A87849647A55E13373F974E33710DDD710680F Delegher5
806,098,006 *53AD6700BA4CF86E6298BA45FFEDCDFB9D701352 Deleg
806,098,007 *53A362575B2B50D77D496C8FD98FDD356274829B DELEGOV
806,098,008 *53A00F6FA2E984679D442DE162C5BD0A7FF35FC4 delegţia
806,098,009 *53AACB607988446C46AA6F862872747E95C8CC3E [email protected]!ONS
806,098,010 *53A7738A854FFF85EC676C7E6491BC02D27F43F4 DELEGUE0
806,098,011 *53A957DE41BB22D34BF1347D54C49458D104FF1D deleguerent0
806,098,012 *53A1ED5C90096673B3257700B9CA0920B5D08682 DELEHOY
806,098,013 *53ADC7E7B2B8F950FBCA47397D42F2455BD24814 del.ehrismann
806,098,014 *53A1F9C8B2E2D88AD2FEC70C5D759FD39FA168B3 Deleitar3
806,098,015 *53A7B4A996AC2F0177B8A7094DB2E84C62031EB8 delete…if
806,098,016 *53A1BB836CA4C224598DDAD3477E16F92C9C4A8E deletetweeq
806,098,017 *53A8A1EA588E2EBEE5438E6EE4040D491E869116 Deletha2
806,098,018 *53AB232C615CDD1C1E3B8C3AE58D0F5FEA7B8510 deletion01207
806,098,019 *53ADEAE216CA3CEA1EC6E29D23EDE1F1970FC665 deletion160piotr
806,098,020 *53AE965499227CACEA3C6C95B8B533C1D15A95A9 deletionanti-prom
806,098,021 *53AE23814056835AD8E00ABB4749ADB0B6775649 deletionbiyc
806,098,022 *53A8BC4628716005C605388A585DCC1BFF0C454F deletionbret
806,098,023 *53A65EC222D8BC8C574983506822D531FF5777CD deletionchronicle
806,098,024 *53A8469279244413DA0748DBE7F6C25F1015229A deletiondavidson
806,098,025 *53A8EF8CE5AB49D6166F66E180A694AF685415F9 deletiondonggala
806,098,026 *53AC15130A60D917405B9E58C67532CB1D73D4AB deletionferrugem
806,098,027 *53A910C57C33E693700B1555D9F403EBB3E64DB4 deletionless
806,098,028 *53A59F55E8F5F370523F09AB81A8CD4BBAF0DB15 deletion.magicfan
806,098,029 *53A098B1A5071CB207FB26A2152715C7DF45D63B deletionmurda
806,098,030 *53AF637288AF026FE0E849E616DA5708891B6D0B deletionrageh
806,098,031 *53A2946DA8DEC74927336135C579C0DCEF11DCD3 deletionthierry
806,098,032 *53A37158B1406B0B61F9519D5D2AC670CEA91E3B deletionuserforex
806,098,033 *53A28DC77B77C7D30C36B66D3A16394AA58D1856 deletionusersimfishb
806,098,034 *53A663B06B390876F3B2198CF385C3D6FD3B6991 deletionwinny
806,098,035 *53AA0C6CBF74FED1771AA0C38008307FEB4914EC deletionwtk
806,098,036 *53AD6FD8400F34D07DDB6D6C4815D5F27B3F54D5 deletpage
806,098,037 *53ADA8E095CD6AEEE2395E4098857DFEB8776F85 Delewod
806,098,038 *53AA6F3D3AB91CFDADBD2597341FE94131EBA0ED del.ferdico
806,098,039 *53AA629AD04AE242DEE1E98B7CCFCC013E401782 del.fesler
806,098,040 *53A71917219468EE318FE5B9B9922C54B010F42E Delffuns8
806,098,041 *53AD4933E330C654E618013C03E1E32453ABCB4D DELFIN7
806,098,042 *53A43A67AB6265B5F1E1D5BB3FAE2E474ED44010 DELfQ
806,098,043 *53AD7D16AF61BAD1116C4E4C08D02CAD9647EE88 delgadonerves
806,098,044 *53A1DF3ADDE1C4F93702DB86AD77F4E067EF75BF del.gillom
806,098,045 *53A8FE8AF9309F4DE4CEAE3E5C3D46E1B1878227 Del$h
806,098,046 *53AC9A72350D9692ABF22CF898FCB8A1B1DC7898 delhipastandpre
806,098,047 *53A28BDBD392EB04EC6A97F5CD71273825609CF0 del.hurlbut
806,098,048 *53AA86AC9DEA03DD09FA730BCD72AD681B6CCC44 [email protected]+E$
806,098,049 *53A1455840CA5D7E08F716E14942D0FC0F615BF3 delia delgado
806,098,050 *53A0043059238A2618FA303076AB06B2BE4C6BAD delia fuentes
806,098,051 *53AD03612F0CF9E0EFC04898EF93F85025CEF62B delians5
806,098,052 *53AA3CDD081E48ACDEC7F19054C9622B0CA849A5 deliasthe
806,098,053 *53A18A7576D0DA8F65CB322AC7577E5F89884653 deliberato0
806,098,054 *53AD1D0EF5A447A4277E10247B4CA1399F54F26D Delibozov
806,098,055 *53AC81ED301743D6C5322F7BB0084FEA92E5E533 DELICIOUSBABI917
806,098,056 *53AE951AAD8FB4C45D549F72928E6E6CE07732A4 delicvi3
806,098,057 *53ACCA0ADEACA65D8EE16FFCF9C424D6415D673A Deliecdl3
806,098,058 *53A9707579A8D65B62938B744E7C0B6333881ED7 DELIE'ES
806,098,059 *53A610E61F0B623C5605E17A73A814B0C89C6600 Delight the palate
806,098,060 *53AEC898677A32544361F3ADC5EBA69E1966B35E deliğin
806,098,061 *53A21378EDA6FEC91BB0AFAADA320AD504CE3628 Delija!
806,098,062 *53A28FE500A318A4E8B248C556D0A9BE14E5D195 Delikataned
806,098,063 *53A64748865475741EF08796D37F6AC50CAC125B delilah549
806,098,064 *53AFDDB297C5E9323B746F777C68B04155D3185B delilez
806,098,065 *53ACD5C138ED16435FA88D43CE8A9632D2EE1C10 delimerter
806,098,066 *53A9A71E4320D8E180FD0E4E2BE40F897565453D delineative5
806,098,067 *53ADE5FC6EA6CA159B0601D9C25CEEF2AE0FF81A delinform
806,098,068 *53A8A681B9E7EFA328B28FB6EEDF8E4EA2D45BA3 Delintsing
806,098,069 *53AAE15F67E09BEA359C380A8C2257FC60A5AE5B Deliossa
806,098,070 *53A04D834E17F13D2836BAC635F03BF45DBCB565 Delipkcis
806,098,071 *53ABC3E49EF64660578450882BE7D6C9267B2B10 delisahill
806,098,072 *53AB32F2673B25A8AE1288F2D4FF1AF5A2EF9A9B DELIURES
806,098,073 *53A05D1B016C5A8AB20F771F7FF1C28A96EE8719 Deliver73
806,098,074 *53A2998C67936FA452085DAA7E197C989156C30B DELIVERHOBBIT
806,098,075 *53A9DD194F815418BE997D91150C6DD4F96B3FCF deliverusfromevilthemovie
806,098,076 *53A73CD5D5E1731CF224FA2EDB1C8984F6590F7B delivery.1011
806,098,077 *53A38A9DFD6A40E22F52B14D1D03152ABE2B65A3 Delivrais5
806,098,078 *53AEBD6EFCDEE9BD8CC7424F8888E167FDF3A8BE delivrerez3
806,098,079 *53A551FC9C70D50A7217D8DA186754D0B1D82F1C Delizée
806,098,080 *53ABBC25F5B91E3330AFC573895734AD4BDF9188 délizée
806,098,081 *53A02E69FF4C986A5C0E95AB77B3EFBF75284D96 del.kaylor
806,098,082 *53AE15C3770B0FA1C94818878E2E4448DD44D232 Delkdrobs
806,098,083 *53A55C1B0ACBBC13DE175B38E6A7836C1CD6691F del.klaiber
806,098,084 *53A9B490469BC8E481E61A03D76B1B3C49ED1EC3 Delkoveho3
806,098,085 *53A08545B642814EB1A8D8BD980276D28B4E7C44 dell’abitazione
806,098,086 *53ACD1B44346DE6AC2B9521134C17E5859576513 dellam3
806,098,087 *53AD3771B182E183704E4C2DC15A8981D8E10ECD del.lamarsh
806,098,088 *53A5E44616304F6D03A75F294A6EB8004D8A9969 Dellamora1
806,098,089 *53A162F346CB3A59E072D31297F29741342D623F dell’esimio
806,098,090 *53AB1133725D8682571187E1660C7AABC4A085F4 dell’hawaii
806,098,091 *53A16CA2DDC24AF168438F6234FC9AFE36FA69ED del.lonie
806,098,092 *53AF581AA9CB4C6E42BB552BD3F0855D28D5FF16 dellonie9
806,098,093 *53ADE25B5D977CC6984A4405202AFF99EFDC2103 dellONU
806,098,094 *53AA27701144BE1B9293332A717AF85D92C09DD5 dellta2008
806,098,095 *53A664AFE309DC6138BE90AEB39ADDF7C91316BC DELLUCCI'S
806,098,096 *53AA82318FA94C9ECAFFB237418DC2551325F5DB dellyutzadellya12
806,098,097 *53AA579B4025D504A2F4167BCF0B5C80BCB82B55 delmar.agresti
806,098,098 *53A45E939F8A627CDB0D98C2C20D297267BCF80E delmar.alejos
806,098,099 *53AE56FB843A00B08EDCE4484EE17CA830A48D0E delmar.androlewicz
806,098,100 *53AF1055E6829F3A652EEB63BED578E4DE95252C delmar.castro
806,098,101 *53A9DE555C6A8956F86BF296957CFD41950BA83E delmar.corscadden
806,098,102 *53A856EA6B4861CA40CA593A4B2D7871EC727737 delmar.fath
806,098,103 *53AF294F9C6BE7D95E6E0C44DC677A010D8E3A89 delmar.fowlie
806,098,104 *53A3B105F30AB7CBCD5B7C306F8D7DDE54D0A7A1 delmar.grob
806,098,105 *53A994C3D8D70854332007FBF0487F729A9244CA delmar.hasan
806,098,106 *53AD7F0FD4128A00C68B2E1F09DC1DECAC4B74B6 delmar.hipolito
806,098,107 *53AED321726C3D8622BF93CAA2E1FA55C5BD3EAC delmar.jaworski
806,098,108 *53A26D296E256FD3165166EB4686F5A7EA0CDF8A delmar.kintner
806,098,109 *53ABA827E38579D2889BCEF3FD568BDE433EC95F delmar.lagerberg
806,098,110 *53A1D42C310EE09341B64B5CDF120AB2538A13CD delmar.mcmenimen
806,098,111 *53A713913AFF0682D17B6E27513259F489E9DA68 delmar.menchaca
806,098,112 *53A3F15B7ACFBA7087B01CF662AE2998661BD86E delmar.menjiva
806,098,113 *53AE749F3019497C807079034D0F9267DC3EE04E delmar.morosow
806,098,114 *53ACEA1EC28E4E242E39FE769902E6412AABB9AD delmar.nasby
806,098,115 *53A21CE4A526D69FF73AF7EE5D20FD72D13F4705 delmar.prchal
806,098,116 *53ADC30CFB28D8EEFADEF2CECB774FC78064459C delmar.terlizzi
806,098,117 *53AC1982482EF9696FFD9F762934C16F182BAF66 delmar.villanvera
806,098,118 *53A18C8BC3E99FAB63E10540117F87CC8E71FE49 delmar.weisbecker
806,098,119 *53A070178F280A45BBFE9454F300E6939AC559B8 delmar.wirtzfeld
806,098,120 *53AD8D6DE1492655F227C79B7B667E5CEEDEC580 delmer.bulla
806,098,121 *53ADFB8D384FA6776921AB86260898FC35644415 delmer.dibenedict
806,098,122 *53A2CAA445B5D48DB148F03B59115F8AD51C843E delmer.duggins
806,098,123 *53A32C7B344D673A8926505A1CCCAAB2B1CA5805 delmer.ellington
806,098,124 *53A5B0EB9D00756F673F964352A85FFC53D8F978 delmer.ferndez
806,098,125 *53A590FE8D3FB1646A51DA057C4CAFDD4FA50723 delmer.gholston
806,098,126 *53A692094715B1B0F5D2B49383410D25B51D1A2C delmer.hames
806,098,127 *53A0F19833E629C3EC714F93EF1AF34B25AC6005 delmer.hoyer
806,098,128 *53AE150C55CD8C9B9E5DCAE0F37AC624BAD63935 delmer.julsrud
806,098,129 *53ABB9DB38C1EFE89170E212D404F16BD88AF4ED delmer.kintop
806,098,130 *53A37BBEF8472CEF1F0742134675C896507C108A delmer.knapke
806,098,131 *53A2EB290258819F366782E15486AE336983258B delmer.liscano
806,098,132 *53A90B8E4B0436B15E70A14C5142F7B86C7B847E delmer.mehling
806,098,133 *53A3242F1D4F56C530277B06549EBC6504D6B90E delmer.niblock
806,098,134 *53A53683923CA297C9390FEC640449F18E589710 delmer.setera
806,098,135 *53AF70E6713D6EA4F0B3BFDE8600CDF576F55030 delmer.stierwalt
806,098,136 *53A6BECA8A7830B901D04EA0DFAF94847252038E delmer.szilagyi
806,098,137 *53A572982798DB3ED7A9630FDAF10834E4B8C159 delmer.tumlison
806,098,138 *53A16B55C3D06658CA7CD47DBBE081A3829840DF delmer.waneka
806,098,139 *53A0923F45C75028FD1060356D76A672FE46A169 delmer.wary
806,098,140 *53A87693589391EC78E471BD7BFFD68E46F9B65F delmer.winkles
806,098,141 *53A64D9B8AF5F34790317A7E661F58C166E742E8 delmer.yaroch
806,098,142 *53A974BD49A495B3D5CD1E215257592670124525 del.mileti
806,098,143 *53AD41FFED54C8850675343CF8364057BDE46A2E DEL!NEATE$
806,098,144 *53AA421B00737ED4E0748A18FD05FD4CE762EEF2 D:Elo
806,098,145 *53AA5A64B3D0505CB754FC079E387285DB2861D5 Delomrders
806,098,146 *53A58F3500C464691844527EE82276B090FB25C9 Delopdat2
806,098,147 *53AC48AAC7C5B041F656BB2C5BB59F485FC815A6 delorentos.131
806,098,148 *53A793769929A0E66879E8DB787790CDFDC22B87 Delpeehw4
806,098,149 *53AE61CBD273633C6787519A6861CBE6A0F97349 DELPHBOY
806,098,150 *53A6E3BD011C109DD233C0292E2895CFE3A41C76 delphi blues
806,098,151 *53AAA99ED782CF08F5BA0ADF30028ED4E423F4DF d’elpin
806,098,152 *53ADA1D26406E357729A90F8CD0CF6F45EC32BBB delpurcs3
806,098,153 *53A9ED251226D9012DAF9B27E486F4399F5589CD DelR4
806,098,154 *53AD93EE1A45528A012BEB09189A9111CA6334A5 Delricco6
806,098,155 *53A49CB82E1649796EB799DA39F5F59E69C8C7E0 delridging
806,098,156 *53A54DD1F693D77CCAA70DC5850797E3AC23D779 delrucpu3
806,098,157 *53AFAD43E698C7442CBBA802BF4E4EAEBF399917 DE"Ls
806,098,158 *53A62233FDA2C8A7F06E2D1A963069C1F00889E0 delsalg3
806,098,159 *53AF983A4D76B8D5F088F722AE6FA3C6DE6BF547 del.schnibbe
806,098,160 *53A8CA8ECA2120DB2962F5ADB09D9D8BDE12E086 del.segobia
806,098,161 *53A6D912D0388FC2D90FBFE0271C519950BBA860 delsignpostwo
806,098,162 *53AA5F626E5C77E3409A339E6F362F93DD0B24E2 del.staniford
806,098,163 *53A647874414C3A2B03E5EB54A1847818F1F277C D;ELT
806,098,164 *53A73FD41E18989C4F73E4B8ACD754CDE0A0D0E0 delta236
806,098,165 *53AAB1ED6BDC5158CA32AED7BE8A5A3505F4E0AD deltaalphanovember
806,098,166 *53ADCAEFACE667D0C5ED49D4BEBDBE590207D14C DeltaBot
806,098,167 *53AD48929BDFB17A784D5AA3514667715292F316 Deltabuit
806,098,168 *53A69D1FBCAED0C3CEB5DD8F08C9C1A3AD036046 deltacapricorni
806,098,169 *53ACADFF9570DF683D02FB8623426A8AE9DE9D91 DELTACI
806,098,170 *53A74E97F3B12CF979A3B44D9FBA10250684AC8D deltacultura
806,098,171 *53ACF6DCF79F8EC605B0832236211AC58EBBE856 deltahf1
806,098,172 *53A0F5FC5948FF94648D800B9D6702E8218A9FA9 Deltajim0
806,098,173 *53AFA7F1E6C5982C973EF1E586385371D325F27E [email protected]
806,098,174 *53AA538E8A471D3FE69D5D6C3E249A553EB77875 DELTASYMBOL
806,098,175 *53A7A22E30F9040B8640A648F0C842E30E89126F deltrie2
806,098,176 *53A6008E475CD4BDC02F600FB33A15F26330488A Delttabm7
806,098,177 *53A5A3F257F9A8BD29DE26DA9D4EC9CA58DAA699 Deltuvia4
806,098,178 *53AA7AB84668E08FEEF61F093A98EF95E85A23E4 delude4all
806,098,179 *53A1E3B36128CAA748E3710101FE69DD50E9ED3E DELUGE1985
806,098,180 *53ADB993B3F67CFBBB7B7C922136FA970CAD13AA delugegucci
806,098,181 *53AC28893EED2F675E1E978D9FD2685AD46956CE deluxe (87
806,098,182 *53A73DBBD85C6C83920BABA819EE61A45FFB1D96 delvalle02
806,098,183 *53AA209AB5D8E55DBEEC8A8A75E318CB72AF120D del.villas
806,098,184 *53A84EDAFE7C6330F51A5A9EBDD0B526ABF0B0D0 DElvisQ
806,098,185 *53AF1318538801C383F9F7E80E2E097051EE30D5 del.vuoso
806,098,186 *53A6C18B144B353D6B960C0742E459DF1946207E del.walzier
806,098,187 *53AB11DC42559FB582BA6EB12A0E547FCC26E0F8 del.widmer
806,098,188 *53A07ED6BDF1F9B5CC5BFABC1DFB56D84FCF776C D;ELX
806,098,189 *53ACB81D8DB97F5C158F77A2B15BF676D31E8551 dELy
806,098,190 *53A8D01F69BEFCF9B4FA41C3C5D1481FE3838F3B D$-em
806,098,191 *53AD91D553CAF4DDC5F2A592225DCF497D8E9EA3 dem011hed
806,098,192 *53AE9C0E77D91C27148181B9D6CC76214F1935DC [email protected]$
806,098,193 *53AFD3AE13548EFC5AFB8B4B5950E40E57FAA9D5 [email protected]!VE
806,098,194 *53AABFA5098B6294FC5C12F9D9228578590E374E DEm;4
806,098,195 *53AF478917F0D5DDAD751B4DFBDE711E521174E8 Dem4rc4+1ng
806,098,196 *53AAC20D54FE7EA4AB8D3CBAEDDC939423515953 Dem77
806,098,197 *53A97361B02E15753A24CBB54E9A23315CCB5E32 demagogismos
806,098,198 *53AC5DC148115A1BD54A8CA1F0A213A5CB124458 demagógok”
806,098,199 *53AF3DF11B8BBCF66F643177E94CBE2C4464797D Demallory
806,098,200 *53A0215B4683CF8BBCF5712A071F0440B5BC166E demalnu6
806,098,201 *53AA2EC8509E69094A40CD6645127ECBA9FF4928 demancherait123
806,098,202 *53AE541F0447E60DF5AE5CCCF2FB8600FE793FDB DEMAQUILLERAIS!
806,098,203 *53A6F3B3205E1FA2A9E94E56DDAE7ECAEB663C5A demarcae
806,098,204 *53A1225C6C82AF6D3522E880F5EC2B4BF5F4D328 demarco fletcher
806,098,205 *53A0C41124434172D9133D8D9E7B361714A76476 demarcus.besson
806,098,206 *53A666C85DE3F3B5099DA7C38146AC581C5C3D63 demarcus.boyko
806,098,207 *53AE6B41AC6957857C62556C443A358A9EC12AB1 demarcus.ercolani
806,098,208 *53A46C18694631EE1FC3E3E7438576FF29AF029C demarcus.grindle
806,098,209 *53A7D368845A8D61891DEEC3E705EDC9205D27A6 demarcus.gude
806,098,210 *53A4762B5ACB51B00EDFC01DA726686B7206E7D4 demarcus.helgren
806,098,211 *53AFA285135EAF2EECDA0F2AF2AA35EDBB7F0DF9 demarcus.jagoda
806,098,212 *53AE44DF32A2D281155949994F61E218C9F4A2DE demarcus.kornblatt
806,098,213 *53AAEFCC38291602B00709FFBD8682E977F1566D demarcus.kvaternik
806,098,214 *53ACB80F06996C4FE3FBCB8D58CF126D2C6A40FC demarcus.loll
806,098,215 *53A604836FD85C1A2816043EF686CE0FDBA57F30 demarcus.lorick
806,098,216 *53AED4CE7BD930A4F251B154D6DFFD7EE8FDB6A8 demarcus.mccann
806,098,217 *53ACBCE4CD852685E7BD38BF4B6AD7E32084EC49 demarcus.mohammad
806,098,218 *53A7E3C30761950E95BBE786FF9112388E798792 demarcus.pocock
806,098,219 *53AB65A0DA1B10C96C21EA49FE70B874A1B678BB demarcus.robeck
806,098,220 *53A22BA59AD5E38B5EFCC28E9459B3C1B6EC6D02 demarcus.rosoff
806,098,221 *53A65DCE7A12B52B9AD5E3F7BC0D2A71054D9C8B demarcus.tasler
806,098,222 *53AC6C5ACD88F7B6FF6E0079D192651485102075 demarcus.telander
806,098,223 *53A9CE4BA6A1BA3275DA64074FEBB110D63A7334 demarcus.thaden
806,098,224 *53A899F4D478C3D965B981BF5432DA43BACC2A39 demarien3
806,098,225 *53AF37C6839F83B4DD4E06B73605F28542766CC9 demarkr1
806,098,226 *53ACDE97941514845F93B46D493F090264F094C7 Demarrassent0
806,098,227 *53A0916C4C65F93AE77A9F34A1AF5219759978A0 Dématerrialisation
806,098,228 *53A844F27E3F213172956C0A6B14FE1C73CA2C39 D!$EMB0WE1MENT$
806,098,229 *53AFACC29A9F4A215A19E74BC589147DD3CFCC10 deme7re
806,098,230 *53AC0F821BCC479DF159EB41A5EF74C961835240 DEMECA
806,098,231 *53A20EA676585DE0F780E4229C0482CF9C174219 demeesha8
806,098,232 *53A332981218D439979B9FA259A3F6F2FE1CEFA4 DEMENAGES!
806,098,233 *53AED3078558C296368CD5F7E354696B50D02EB5 demeneront1
806,098,234 *53A34514EE58362355FB8CF4804C297659F04442 DEMENONS2
806,098,235 *53AF960BE65E6E6952A4D825E15F292479BB8A29 dementias.
806,098,236 *53AF90E029E8CD8900FF365C1D96947F33285567 dementievu
806,098,237 *53AE818EC15CA75E925C25CBD39020F919B87D85 demerbroeken
806,098,238 *53A64CEF8C306D0A7E255197584F4C9BC680EDFB Demetian1
806,098,239 *53AD6A065CB541F67D99EDD09624525ECAA618FF demetricehoward
806,098,240 *53AD2CAA023FC9B2E32B42CF06EE04904AC924B2 Demetrining
806,098,241 *53A57D3037B25C43E57FD5828BE8D3556CF9CD0E demetrishenderson
806,098,242 *53AA304D6085FBEDBB1E2A615EF31D8187C73A89 Demetrius232
806,098,243 *53A073F313CF35092CA06BE5D76803250F4C902C Demetrius894
806,098,244 *53AAE67BFEB4A085A718DE3DA0DC738B368BBB0F demetrius.alo
806,098,245 *53A9AAD5EAD1CAE91004AF1AD20CFEA29B4F6D24 demetrius.bannister
806,098,246 *53AE4D4524EF8141A7F096C558991499CE13CE91 demetrius.begg
806,098,247 *53A91E7A2675980B6EC5A2C9241780D5BB8128CC demetrius.beulah
806,098,248 *53AFB51B1D563B9BA934DB978987C50C1C23EE50 demetriusdyer
806,098,249 *53A31513EC6176E6335E9E392A066C565CB07AD9 demetriusferguson
806,098,250 *53A7778CE8A800FA814B0D5B326B829E72CDB21B demetrius.gierke
806,098,251 *53AB74BF1B60E7CD760628B34F5523A34EABE23F demetriushope
806,098,252 *53A4E1101CE0B0C0F36ACE66A5FB66FCCE072D15 demetrius.kollar
806,098,253 *53A9ED67D2BAA8E7E1D8436CF994B5453833CC2D demetrius.korkmas
806,098,254 *53A0901DBECE1CDE76C7010399275D73D370E20D demetrius.loudenslager
806,098,255 *53A4939A5288DE1C063937933729138BA04FB3F7 demetrius.maden
806,098,256 *53A08D55D6F35C7455410742113AD1ACBDF59EE6 demetrius.nordmark
806,098,257 *53ADEE4D05FDBCA38B1274D6C39886523ECF9864 demetrius.pollitt
806,098,258 *53A235F4DA52A434D6F9E50CAD30D5C0B1B251DA demetrius.rash
806,098,259 *53A734F0F2CB915818B8D3AFEFE3861284B983A8 demetrius.reagor
806,098,260 *53A15C04E731743EB58877E6F378D808249BA3C4 demetrius.shonkwiler
806,098,261 *53A4DF28324E71597ECB11B2B026AC2DAEB23D8E demetrius.shorb
806,098,262 *53A965BD014DD66B7C0B34C291BA147A6E5E8F04 demetrius.skabo
806,098,263 *53AE4B4A43956FA5D93799B2EED0C863D88BCE0B demetrius.stemarie
806,098,264 *53A4EE376B099827D93D00D0A39CE27D6F4FD9F3 demetrius.tolliver
806,098,265 *53A7DD0D51B03A9DBDD48FB63A6F93298BF3844B