List database


# MySQL hash MySQL password
804,170,001 *53601CF7FBA1ADB487C20194619D69CA277148C7 dariusheppler
804,170,002 *5361210F4B5ADE6495160B975F05F34A9A76DBED DONG.MIVSHEK
804,170,003 *5362793C3B639F5187D932AD366AE7B5F583D7AD DARRELLPANZELLA
804,170,004 *5368A622A4095BCEB222E3188074559C024E39AE DARRELSTUBBY
804,170,005 *536CC26BCC2F91579776627A5E07D54D0E0FB727 DARYL.DECOTEAU
804,170,006 *5368D340C5E54EADD7C2280919B5CC2A8D644FC1 DASIALEATHERS
804,170,007 *536CD9BB9F08CD21DA2984EB7FCABB246E84394D DORSEYCAMPEAU
804,170,008 *5367CDCE3E4006B82A95F24464F46769F0A2AD70 DOSFLOPPY
804,170,009 *536073A7E1C8DA581942706728FC637D6FB4705E dpofj
804,170,010 *53611ECAE045EB9B5041A470C8BC2EECCF5AC890 demarcuspulwer
804,170,011 *53633B3398FDC4464CF7EBE7881BF2E52021E3FC DE)N&
804,170,012 *536F9AFEF1571303ED8654FC881C2E13384D15FD dudleyschendel
804,170,013 *5362775631A1699320F2964F543892DDDB111C9B DUFBQ
804,170,014 *5364F44F875C23398D5176DD0A0FAD0FBBF3E605 [email protected]
804,170,015 *5365B60E97970B2D3AFD3460D132CFD7158ECBBE dheqx
804,170,016 *536E4619AF535F9AF2D2BF8775DD7A849A2C8591 DHR!)
804,170,017 *53675BAEDD3752ED46B4EA8668BA4C4A8C2A5D38 DILPOMAT
804,170,018 *536E2DE008833CB5DDAA642BAFD3F8DF1698EC74 DVI;"
804,170,019 *536432E0CD58D5BEA92FE19B054191A7DF94A727 DIPHALLICS
804,170,020 *536452276296D2E64087F4CD162712497F0888D6 dwh%
804,170,021 *536B72EF93B1A60CD1E344AAF0179C4E26483BBF dwq#n
804,170,022 *536CF143A48EA2D7A92EF6F5EF76A22D60CB228C DJ!F0
804,170,023 *53616CF2A40A6C508C7C6E9F2565B7012A082C65 EDDY.KINSINGER
804,170,024 *536DF37FB8395D5B4CA4756D4CF719F265927426 doja40le
804,170,025 *536CC475754A21D5D15E4CC68EB5FB158D16D1F8 [email protected]
804,170,026 *53650352CDB6AA2D998346B5CC27F5610BC072D7 dongtirabassi
804,170,027 *536414CCC26CCEE669A33C700B50EAE014F3C547 EDWMA
804,170,028 *536BABF2D0E912699E4E673CC1582F525AD90C74 DORPHAN8
804,170,029 *536966E0A0CABBCF611A3C17CC0705BEAC527064 DRIVEAROARINGTRADE
804,170,030 *536967F5AA2A7AC64E4FF414D5458DF50F5B7840 elmerbeshero
804,170,031 *5364614B4AA69B9F24456F2A7645806CC2466BE6 el.puerquito.de.la.yuca
804,170,032 *536DF70866D28754E73E8BDBA476454BA7E1CEE5 dsm9c
804,170,033 *536344E2BB40BC32662F8BD708B9B030E2A55B87 EMIL.DEFIGUERO
804,170,034 *536D946030E5CBA59718B5895B3F3A78D677783A DTHRH
804,170,035 *53681789AD23D74E52243BEBA2BA3C26E17B8D3D ENJOIERED
804,170,036 *536BB436C20F287983227B328EFD96B76855C521 enterthecenter(12")
804,170,037 *53666B19F983AD288CD3D3B2DC3C390964FD6ABB erik-barlow
804,170,038 *5363D7007B307C07DCC51469CC54D1FCC77246FD DUKR1
804,170,039 *536A80317CDF2F4C199F47A10A0530F2ECA8587C ESKALANTĖS
804,170,040 *53680749E986F6AC20F34518FDB35FFB0AA20C57 dzaag
804,170,041 *536B13C10DE2F28B4AD3CC8C197B6E469BA50185 earlekawaiaea
804,170,042 *536CC0BA2E1759FEE705E37FBDC08DBBC13C2F3B earl-park
804,170,043 *5367BFB069FFFB43A83487DA8DC23843C5513094 EZRAKNACK
804,170,044 *536D54E986388DEE6848E415802AC0BCE20B189C F102348
804,170,045 *5361F2A21335CC0C626660AC40B98A051E9BA0C0 FALLFOULED
804,170,046 *5367CBB716D71506527B9072BB064D7A4F4DA7BB edd;l
804,170,047 *536C972767024E2F961175B72A02AFBB85E2F7E1 FEATHERE123
804,170,048 *536AEA365E8AE27B8C3D660A84C7DFE1BC2D48B6 FEDERICO-SAAVEDRA
804,170,049 *5368687A3CC2D83D92C94EDC0A295647363C4F01 FEECH1
804,170,050 *53616DD0CCCADA33E2EF9149395E47715E77D3D7 ee5bg
804,170,051 *5361BF71AE2C6DB3D54C27D6C4A4D6043A62B9A6 felixpetermeier
804,170,052 *53689F13A6BBA54F5DFA40C078153300F127D5BE EERKA
804,170,053 *536B4BC63C05052AEB9C34D2790B132BB95D8A18 Fensterladenzumachen?
804,170,054 *536A0EB75C90CE17612CB68402F15FEA31D5C37C firebrand.(1st.vdgg.single,.1968)
804,170,055 *536D5B3071EB6ACB38A2A9908D1B87C5AF93D4EC [email protected]@r7e5
804,170,056 *536E5A16B4AD447AE39D4E9C94F6AB7AE71069C4 ehbqp
804,170,057 *536DD32B244E99883D5E15ADEE34D7A7A4684651 ejokkrip4
804,170,058 *53643EA75249BD9D44131DC2B033BFC3FF78C676 FOSTER.VIDALEZ
804,170,059 *53635680490DB064C7D970C2208C09CC5DE4A575 ekt_e
804,170,060 *53683437EDC16C5D94B4572E52020197D4BF5D8E fredericrosensteel
804,170,061 *536CAF125DBBBDFA7B874FBDD9BFC258210FB025 FREEWAYLANES
804,170,062 *536DFEB21507AEA3823E0D558D1CD77260121C23 [email protected]
804,170,063 *536EECE36FF28E7393AE2165868DF4AF5C923F88 FUNKYBANDBREAKDOWN
804,170,064 *5366518104D7D8D640A9AD59681B3DB08550695F [email protected]
804,170,065 *536F93ABC4F672FC6ECF061C891F208066161404 ELMOLETENDRE
804,170,066 *536969D068B671076F32DE89E9EBE8743A902B06 ELOY.VERWERS
804,170,067 *5367B67C7ED9604B94B8260440AEBE1476C8FE7B elroyrampersad
804,170,068 *5367359E572255644749DD342DC3BBF34F868384 ÉLTEKÉT
804,170,069 *5364550FA643C0B1B633ECE2970C4E67055F7C13 ELUDENT.
804,170,070 *536C6C44106814570DAF7772A4A38600175F376D ELWOODZIERDEN
804,170,071 *5362CE9647557D9370AD8B29C7FDEF4727D68BCB gaildepung
804,170,072 *5362C55C97B86BC1956B3A4DEF0BCEA2D10DA937 gamajel
804,170,073 *536B61727E349EC437FE8A4BD2A484A1D1B00F8A EMILY GASCON
804,170,074 *53613C30000D2AA42D95D7A244DE009843BB67DA GARLANDSCOTHORN
804,170,075 *536BC97A332B5540208EDB95B8A10A063F8F7679 garrettbelgrave
804,170,076 *53657714304696F05C05BB9F522191FE0021B92F EMMETT.ZWILLING
804,170,077 *536112D1E18DF516AC661EB13933B4C1B4F8242D ENFESTARÁ
804,170,078 *536F66D2C3271BB6B9EE47BD36B8D23DC57AD884 ennw+
804,170,079 *5369EB61D4038738C2D43664199C433B87C8964E GENSMER'S
804,170,080 *5364254F3DF529187E592E028431048D9CD11554 EPISODIOS DE WINX CLUB
804,170,081 *5368D732C147FFCF521868759FA14945FCC2112A ERICFENIMORE
804,170,082 *536D9F7B24DCB5814ED968002B68BC60F20A613B GILLIANMARYMACLEOD
804,170,083 *536E2B2A4DC2209942F89462A361E974B8B2FF7B erolod.1
804,170,084 *5368F1F2F40DA7039E22F84D09AFB1D79599D754 GOLDE5T
804,170,085 *536164030B8BF1167F896A42C9A5C264F2D098C7 ETMN$
804,170,086 *5367F483594D4B3A201F506D2EF68FD2B2E85087 GREMLINS
804,170,087 *536815DAC7E834423BA8CBE86A34BDE8A5306C7A EVERETTKUC
804,170,088 *5362CD4FA6BA0CF614F0C22CD3C75CD1E97EF83D EWEAMAG0
804,170,089 *5361FA1EF9DEF87B47FC0DE037307E7AB14C17A7 HAIHTUM.2
804,170,090 *536A3774C76663F5241A413983295834EEA1524D HANK&MIDNIGHTERSBALLARD
804,170,091 *536492B00AF8D2A17D9A6E801C87E3EA7F9B4F32 FARINA
804,170,092 *536F44029FE2945C277C6993E915B476502A6A02 HAYSTUMP
804,170,093 *5364FE4D01DD16259257A1A1707DA3A01FD3F984 faustinofrisk
804,170,094 *536826858C8970839FB272A855B8CF848FD53632 HDD市場は今後数年間に渡って拡大が続くと予想されている。特に2
804,170,095 *536291F40B85C8C6F0066C29CB903507E65952DA fearmygreed
804,170,096 *536A3F621B1016725B6F4E1F8EBBD27E35D30C2F [email protected]
804,170,097 *536A9492852A6316E906007C78E1EBDBC0075B84 helligovend op mingem truck
804,170,098 *536CB551E0B472201060ED72C31ECCF7A633250B HERBERTRAMISCAL
804,170,099 *536CF4D82B7D8C5351853FEBF97570972753F2CD FEUERGESCHWEIßT
804,170,100 *5369E941D716C196DB4D1822B38190918838FD6C fhy
804,170,101 *53684451291A18B59B90AFA740468D97224B2D4A HEXADECIMALNOTATION</A>
804,170,102 *536EE83E5CB1801472CEE021D4BDAD9C2D938A20 H{I
804,170,103 *5362E448196730F1EE02E709E2BC86F5E95C127E hiirenh
804,170,104 *536085E01B1EFFEB0EA81473B0662BBC89903E71 fl3xin9
804,170,105 *53663260796C7F3B8D954ECC3E28FD9172589294 FLOYD.TIRO
804,170,106 *53677E295DF5D6769D5945A96891AB923745C6B8 HOMANS!
804,170,107 *536BCCEF882A25AB81BE030AA815DC14D881FA38 FORMIDABLE VERY STRONG
804,170,108 *5368F82ED8E065AD481A24525191E50DC3DD1067 HPADOBED
804,170,109 *536114604BD52936EF9803864BE8611C696C7A0E FREDCANE
804,170,110 *536AE4228436B5AD5E17C685C355A2A86035E8CD hubertnetkowicz
804,170,111 *536332D52751D9C6757A958EC4DF528AA7B5837D FREDERIC.BISSEN
804,170,112 *5364005AA571254EE1CEE713B5C5C6141368C06C frodo62
804,170,113 *536E12C60B310E1E8EC1DF21AD1357418DC2037D [email protected]
804,170,114 *536C99DFF4E52E08CF4CDDE59472B32FDF153B7E fubaranne0
804,170,115 *536D12D2E5E9D3E0E22E24D1481307B42B940E14 I8[}
804,170,116 *5369B2B1E3C85143AF8DDF3AE7850EE523152598 I-Dedicate,-Part-3
804,170,117 *536F722F32EF2709E53A71596CE204A0ED1303DF If You Say Ferris Bueller, You Lose a
804,170,118 *5366720F8D6AECEB1BFADF826245726E191211EC [email protected]
804,170,119 *53673AA46C742E9821CC66F341C042B37EE60439 GARANCEN
804,170,120 *536ADD4012FD3EC1D8F7106E1CED72FAD1887192 garryallamong
804,170,121 *5366557457850870E96501C1954DB379BE47CF92 gastontom
804,170,122 *5366903E4C445B5CABB6DA5A87EE0CACBEE86F68 GAVINSAFFEL
804,170,123 *536D9A889C1B9FC1BCC06712CA00C043F4FD7B74 iloveaaron1992
804,170,124 *536E170A3F1967D5D6E51617D136BFA2C7DD7801 implex0
804,170,125 *5367E3219656E81536A68653969E102F141F23F4 instrumentenbauern
804,170,126 *536FBE7BC3856350F138DCA68CFA86AFCEF110DD G'I~
804,170,127 *5369D715BC810F35B7DCAB6A3A3B7B6FAA847997 GILZVILLE
804,170,128 *536678BC4E5228F3992C7651396A4D988C8F1B26 INTHEVIP(DUBWISEREMIX)
804,170,129 *536B8B8760EB6B3B06D1CE4B3165D8A243B266AE IOFINOVA-IVANOVGRAPHS
804,170,130 *536ED69F2B98003ACA6E1E0AA3362A2FBDDB0EEF glimmer.of.dope.theme
804,170,131 *5363FF364EC99B11B178B2A4A16DE5FF7DFD8CD5 [email protected]
804,170,132 *5360B6D1BFB6E6BED50386F18F64248DC3E6012A gloria-berumen
804,170,133 *53623EEFFF98BE7D0F9B39881EE0BE72FCE2D774 GNO7O8!OLOG!ES
804,170,134 *536E82B7D619CA05A9AE72AB1DE1693489D9CF01 i[x8
804,170,135 *5367C00CA9BD067B8BF9A85D75B20711E06CDE65 IZIEHIE3
804,170,136 *536FB94BA09D1A62A78CE8143D6469995BD6AFA4 [email protected]
804,170,137 *536832A02E07678FC9BE6CB29FC819BFE69670AA JACKDORNBOS
804,170,138 *5361B0C434F42CEDE1648EB5BD8047783D28661B GRANTLIVINGSTONE
804,170,139 *53640CD04EA7CB878018AF8D59AE42C9D34A0816 JAE.HILDAHL
804,170,140 *53616ECC4249D968B838890B9E8BF6D16E82C163 JAGDISH BELWAL
804,170,141 *5361BBE395453016FEA52AB6C3642A5B5D8DC429 JAHPOKB
804,170,142 *5366EAEDDCA6E4C272B89390DEFDBD51AE6AC1F5 gregorioheininger
804,170,143 *536FD2425C090A1BA2DB9A806A885612BC1EED42 GREMLINS
804,170,144 *536CDDE8287AACC8F0C54950EA8DA91CEDFF4596 JARROD.MACDANIEL
804,170,145 *536B4D0F61A10D8A38005A1914C74EC8C7417507 JARVIS.BYARD
804,170,146 *5364B08EDC7CCDD10B8BD82E298FE3353E5D632A jarvistrucker
804,170,147 *5362A4043FE9442C1FE999CD2BD8FDF7291599DB JDENER
804,170,148 *536B2804745E1AA8822231E52FAF17BE04259920 jeffersonthomann
804,170,149 *536AC3D39D4BD524642133FC2E3B67EBCE77AC46 [email protected]
804,170,150 *536BCDD1DE117F75080B604509CE77FB41D3A52D JENNIFER-LYNN-JAMES
804,170,151 *536042377DB45B691283CBABB51FC7796254385E JEROLD.RYSANEK
804,170,152 *536F136B3CC899D9B15B2E49881E453983C8937D JERROLD.MCGREW
804,170,153 *536DB92C418660667F517789BB06F4017221F94F jerrykrisher
804,170,154 *536DF64096D3ADAE4E0BA5AEEE1E08D6875D6F24 h311o9raph$
804,170,155 *536BC65AB751272D524D40D15521FB50DC9E8BEF [email protected]
804,170,156 *53677A68EA49AF6D185F1B6F3D0AAE16E5EDA0B3 [email protected]
804,170,157 *536FFCC90CAEC4D4B322641D3267CE0DCD0A14E2 haaptfeinden
804,170,158 *5366941C58866D16B75D3DE3959BD4804EC33B6E [email protected]
804,170,159 *5367308C3D9C5E06B4D9B6C2E59CA58FF446595E JHANA42
804,170,160 *5369D5BF4095A3BB807AD058A7136C884BA95842 HAIOESTREICHER
804,170,161 *536EF76652DD96C441EB30F33FB7D5E02EAF7F86 halfsleetje9
804,170,162 *5360EF35BFBBCF70B0ECEA6CA3C0A973C47B18DA JODLERSTIL
804,170,163 *536A07A764BC165DB8550FCC8D3229D587F4FB71 johnlagasca
804,170,164 *536BA213CEB8DF908D7764016FFA7D19FB155D06 JONESJOHNSONBALLENTINE
804,170,165 *536C29AA2F13B23232914E7EF4F810D69DE29649 JORDON.JINWRIGHT
804,170,166 *53688352C5C0224C8902364D5C066F0C906AA576 JOSEDFIGUEROA
804,170,167 *53619DBF7EE6A3BD0BD6D906D8246BC823F69F50 HCAYCONG
804,170,168 *53620693F919F2B7FF25F7CEBA5D99BEBCFBB906 JOSE-MEYRELES
804,170,169 *536A99CC84B0DB3965AFC0B11F4A117F9304D6FB JROTTENLIMBS
804,170,170 *536121677B7957F3A801627410164290D63E8E1B juju8e5
804,170,171 *53692B611AD920EC2BD3921B9B676F964B23CF00 heymambo(featkidcreoleandthecoconuts)
804,170,172 *5360FD5B1B2F73C6674B4994EAB6C31E90884992 HILARIOBASWELL
804,170,173 *5367B0C1C259C35B9091A58CB71606769DE7D75F hin+
804,170,174 *536236587F72EE174AF5D81E000A34005ADE62B7 hiroki.sawada
804,170,175 *536FA9F22EAD5C2CA0F99FB8008BE3656BEDC8E5 KBSQUIGGLET
804,170,176 *536622D9947E2B2B9DC7916F1F0EB173A6FAB896 ked~
804,170,177 *5364CFFC9215D333874E3139592FC004F4A64D33 KENDRICKGADBERRY
804,170,178 *5361FB051851A60AC399B4D5876F6080D2AC381E kenly1
804,170,179 *536F83718158234E44D3B113465C23A8367B3190 KENTUCKYTALKGOOSE
804,170,180 *5361079B7AAFC5ADBE47BF08AA2C111C3681EC2A KENTVANDERBIE
804,170,181 *536A567616AFF5B0ED4AA1A69220AAB814ACBDF5 KETIES
804,170,182 *5368D71E780B3C9AC979E4F7B55CE3073CF4D586 KHAMESYING
804,170,183 *5361FF5B7E8C41C91E89C4D341C75F4E50FEDCB6 [email protected]
804,170,184 *53698DB146126EF83A1B8C0BA056F4102D55C6AF KINSLEY970
804,170,185 *536438FA015A3D203E36513F55C87362CEA8D877 HPEUPHXY1
804,170,186 *5366EB5F7F0579AE3FA966F31994DE33EE29C144 hrw`
804,170,187 *5361814AA6BEE63B2498DB853A1343560196A826 KRAGGEN
804,170,188 *536F1B66A6D56B0AE4CA0B6352C67B6D17E94B83 HUT... HUT
804,170,189 *536F0EDDB9514046F8C0AC81DEEECAFD894B657D kristi-gouveia
804,170,190 *536A6D1D5E890C19F0A0B2D3B7646C17B178028F KUBEROWI
804,170,191 *536884896C222DA96523F820DB947F7AE1CD791C LAATPORT9
804,170,192 *53635E356D65DC09E4E499FD96C9F709BE26D400 latauding
804,170,193 *53603388AB9027BFF86BE51080DDA7553B28201E I.GOT.5.ON.IT.(CLEAN.WEEDLESS.MIX)
804,170,194 *5367EFBBDE644233003F1629E74BFB808D862A8C LEIGH-MARSHA-CLOETE
804,170,195 *536079FF09FA91CC00C2178310CFFBDE7EE495A3 ILOVESAMANTHA666
804,170,196 *5363EFC8F0C95F3DAC531F5149AFD15726AA0669 leofilarecki
804,170,197 *53694A828EFB1B1942E6AE49F08AB94E5ECB450F iluvbritain13
804,170,198 *5366BE2F22DF9A1B42D0A5BCE83CB3D14B0D549A LEWISEVERLETH
804,170,199 *5368AF7179BD852D00CB4473165F4C75EE1A8763 lewiszenteno
804,170,200 *53692AB47186FAE75134348AB24A4F774056C0C7 LIBERA+RE55
804,170,201 *5363ED98F32CDEE44443FB3D10067485C8D70BD5 limésiens
804,170,202 *536C0E792A78A35BF5113421BAEC7D0D926DBD5F INCANTONS1
804,170,203 *536FA76B23FE8184C1DB548040B8579B19D47D43 INDRASUKMAS
804,170,204 *5368B955ACE4BE33313FFB2FAC0C23258E07EDAF LIST_OF_CANADIAN_POE
804,170,205 *536D676E30FEF300B99352CD6F2761E857757FFC [email protected]
804,170,206 *5369DE416578A2EC07FF0AE3DC4E256209DE37A6 [email protected]
804,170,207 *536F4126F6DE3FB3CB0A2EEE4DCDF670A19B17F9 InsidetheDark
804,170,208 *5368890A6931CA7EE25A7333EF2543BD510803F0 LONGSALEEM
804,170,209 *536FDC6A76638BAD6EEB145BF090D72CE7CF8A12 IOOVNOK9
804,170,210 *53679185EBA6104368E9C0FA5AA9A5B9B476DAEE LORJUSTE
804,170,211 *5362B29DA2AF4E3E8872E03D9A8402CFF11C642A l/&/t/i/
804,170,212 *5369BAA4202DC1544B81F8A6F7877E17987C8C5E ISSACHEIMERDINGER
804,170,213 *5369DE0A6A639976539D2F2CE4C3A31A605D5C69 [email protected]
804,170,214 *5368B1169EC00C26B00997BC9DFDA22675105F3E ITS.TIME.HAS.COME
804,170,215 *5362EAAEEA7305B98EBBE540138D4EB57C95DE18 IVADNOBBA
804,170,216 *5364C336A17E260D1249CA7F1064F11FBF29715D maesi052003edual
804,170,217 *536B2D95AFD4925C67B016A0359D0CF4659FDCA3 JAKEHINCKLEY
804,170,218 *53625F7DC9DFA3295D230EF27CC6B0897D8A0EA6 MANRISING
804,170,219 *536AA6850A6042FB2E80EC531FA8C6CF67F60E3D JAREDTROJECKI
804,170,220 *536E811C443749155A37306A6AEA648A70B24FF7 JARNJAKU4
804,170,221 *53627255CFC007B054714601C6E8203C3112EA01 margaret.aldred
804,170,222 *5367383FF45A09C24BE149AAEDC15C2D12664B6A j[:b
804,170,223 *53642AF46D6DC5531CEDF761E469116AFAEF3D75 MARINETAUCHERGRUPPE
804,170,224 *536B8BEAFF97BC0A5EBC60D9155E12D08EAF48BC jeffdarakjian
804,170,225 *5360A3C6F51A42606BB8C42821F9AFA718BC176F MARLON.DAVIDIAN
804,170,226 *536FE88DF3D5CEF54ACD1375CEE465BA41BEAB55 JELRICH
804,170,227 *536C2278BF6C4D23D9B0E79295C113BAECE58E35 jennifer-forcht
804,170,228 *5362D46EA0B4D7710127D7ADEE15822D23E8C273 mary-jane-girls-only-four-you
804,170,229 *53673788A3E0F7222BFDE367AF68FF9D841A443F MASSREVERTING
804,170,230 *536C289F6A5DBD1C7E088B57130E2DF0C4B2F4E3 JERRICANIXON
804,170,231 *53694DF20A3EF1DBE37D22490CD89FA21AA26A32 MATSIONA2
804,170,232 *536E4564AAFE69EC0CA23CAFCF80F2AA5E58C924 JESSSAMAAN
804,170,233 *536DE04D9D51BB227CF5A5FA2CDE1EDF8BE4B511 JETT.ESTEY
804,170,234 *5367402438F418CC99EA0F49766D9590BD896656 JEUNIEZ4
804,170,235 *536232EDFB693CD76867058D55D6FC3D36D85BED JIMMIE.TOOLAN
804,170,236 *5369B218F27E1B1B18188C08D4FCB3320E43A8FD MDDYMDL1234
804,170,237 *53638DAEB49B73C831351FC7BDDD76D0882BCAF2 JKOZACZUK
804,170,238 *536206717D792BB57FE070E50E1431F5DBB06527 ME HEART IS LIVIN' IN THE SIXTIES STILL
804,170,239 *5368323A9BBB3552D3ADAE4A0F1ED26B71499420 MELDE-EMPF
804,170,240 *536829F2FB922BF6103A711D035CED2141723C65 melissalouise
804,170,241 *5363DC3F7B6692D3F19D717627EF3261002998DA johannes-passion,-bwv-245:-teil-ii,-xxiiig-recitativo-"da
804,170,242 *536AED80E5403E862F79566AE9E98399DC362599 michealwitbeck
804,170,243 *5360E1DC53D34379D71E5B8EE7E0E64A7BB854DA midwest\\2
804,170,244 *53648F2C27A98E878372ED0297E7175B07AF9FCF MIHA.DOV
804,170,245 *536C2AFA8D87122CC264B77AA0B73632A16FBB47 mila-yunus
804,170,246 *536E729CE6DB58747FF0246B11CB5871726849F5 MILLENIARG
804,170,247 *53652BD940D361BA3DA1772D4EB82CB8F3E7736D minimumprijzen9
804,170,248 *53699D90E532743DA62E854895E95753C379084D judsonkostek
804,170,249 *536F57C0F12443E7E9A3D037165FDD43099759ED jugula
804,170,250 *536069B37AF90FBBC66D8354C8031062B58A1559 juliodinnen
804,170,251 *536D30310CE248CC73707CD26562B41EB11208A2 JULIO.SEBERT
804,170,252 *5367F2BD1795E2DB74B2FD84E439213DC329881F JurillynMae
804,170,253 *5367CABD27717A13F508E954F12D2A3258207652 -J.WG
804,170,254 *53650D28DE85C35FD734BD242544016C6450916A moorvartian
804,170,255 *536CD4290685886D290A2E066C0DF137EA099581 k41kgr4v
804,170,256 *536DD22F9448C410D9246C8351A930FE2CF1F9F6 KAGYBSWS
804,170,257 *536C63CEF7A44B8AE1269840D1E49BB0D1FA2DB4 katiered7
804,170,258 *5360714CAA35180EEDBE06BA5E0A2F4FF5BE7538 KATRINA DEAR
804,170,259 *5365D4313FDCC9532E2599A773DB8491FF3376D2 Music to "Rosamunde": Ballet Music No 1 in B minor
804,170,260 *536D4433B6A3F941FFB66482C36CA5B4B0173EAA kawano-kamikawa
804,170,261 *536AA8F6BD8310632C1870F1C1B9764969B6AAAA MYKITTYDBRAINY
804,170,262 *5366DC255153C1A5D95445ECCBF02CAD7E97625A kendalllandrith
804,170,263 *53698099C6E6BF11068C41226BBE33681DA2C213 KENDRICK.DAGOSTINO
804,170,264 *53680AE11DEE6568312E148C64A897819A0DD5EA kendrickreiger
804,170,265 *536D1E6556642B42E0A4B156AC29F9DDEEDA4769 KENGA!KENGA!
804,170,266 *53660F2FCFC7CCD8C79730C0EA9D16BFD86E528D KEPLER,JOHANNES
804,170,267 *53610725AAD7FC00BF63DBA34F6FD4E9681FEBCA KETA
804,170,268 *536B666FAD1EC7D2225299820EDD383BCEAC3A2F KIM.KRUPINSKI
804,170,269 *536E9B101D3DA31C3F66BB24C94A4FC042CA8AE8 NANOCEPHALUS!
804,170,270 *536B313A274EDF0AF26B9F25A04AEC79A18600AC [email protected]
804,170,271 *5364EF8BDB85A33D2DB41944D6FF77C025A85893 KLANCNIKING
804,170,272 *536E003044D823A2B4B412306D3D29408EE009D7 kronozóna
804,170,273 *5364579E6A9E0553EF333C70792C58F6EEC0DC48 NICOLE MILDENBERGER
804,170,274 *536C4CA0BF3CF285CA4FDC68B87915373DBFC1E9 KYLE.STANNARD
804,170,275 *53658A0078E366A76D1714BF4AE4E5ECB0D0323B lamontlonie
804,170,276 *536C03E52927116D2AA4F5920E553302919EC2D6 LANDON.BLEILER
804,170,277 *53641AA3043FE199E236F3B454CFF2911C0E1376 [email protected]
804,170,278 *53660DFBB2BE12BC67A22AC8298BC437B5267A98 norbertorison
804,170,279 *53671312CB3F32396713D57F6EC87DAFD6A3EAF3 lavati29
804,170,280 *53628B03D7809032AC053D2EED851A4C587D1680 NSCHTEZEIT",BWV210:X.ARIA"SEIDBEGL
804,170,281 *53659A6B17735CE3948CC6CDD4C6DFDB8793ACB0 LCONNINGTON
804,170,282 *536B5950B0A7D9645FFF1217FCA89B00F50ACD0A leahdumaquita
804,170,283 *536F1BCC26CEA1D52282B9B3DB304072D12E3BFF O3RFLOURISH3D
804,170,284 *536E1862F6CF83673035231328F202D201955B14 LEIF.BIGWOOD
804,170,285 *536E4ACABAF4B984FA8A5DD8B4102B7CA18E6A28 oavetse1
804,170,286 *5364C7A7779FB382928FDD84B81DD7E3263EB6DB O^D(
804,170,287 *536E411869C90830AB7DB97913F03D227BD0115B odellhagstrom
804,170,288 *5362B3255F0E79B77D6502A8D2CD3C8C5F20046C leonardhedler
804,170,289 *5367321A6BA26C4842CC022B0B178B3A37BF22BE LEONARDO.ELPERT
804,170,290 *536846F2A56C3E938A22DF5780F6EE3AFB342DED odvra
804,170,291 *536A488B2BD45318FAE2FED9F6C7EDF7B2CD1134 OKSASAMBLIK
804,170,292 *536ED8658545F719DE64B93D3157822FB045A9C3 >-<O~O~<=3
804,170,293 *5361F94682DFDB02DDF36B8E82BD6B1FB50E02E9 linessa9
804,170,294 *536E0FC140F3C16CB6AC2D0873D03802624A2415 oraVendame
804,170,295 *536F8139ABCEABF6EA92BCD55D1FDD53619DA73A ORTHOSES9
804,170,296 *5362EBA6A1B1D7F643F7649A899DFD42AF4B949A litterbu9$
804,170,297 *536AA54EB367FCB9F053CB1E2DDAB998306E3C90 lomanes
804,170,298 *5363D40038DB05A88EA31AD8FD2F63B09C4E3836 lonniemcclay
804,170,299 *5362A673DC1AAB0A63A4FA9C257715589B4DEA7A LOS-CHULOS-SON-PA\-CUIDARLOS
804,170,300 *536979DCA9990ED8A6165219A9BED2EE0B643C4E lovelots
804,170,301 *536C64F931A1B9A4A348499E63788D0E0B2E82D5 love-session-#1
804,170,302 *536880EB500EBB17B466927ED4AF04F7F72F409B L?_R
804,170,303 *536B57B4935FA38EF7501607AB4FB40F2B81F505 lufte
804,170,304 *5367B47DB7FAD371192DF85BF0BABA0FE1B10D48 [email protected]
804,170,305 *536AF9EFB22CA95664D36D46070B841257628936 PEDALEAR3
804,170,306 *53697957943AB388A19D1A7B36880F0F8876549E pen68ky
804,170,307 *5363073FAB9837D7633088D7765F2B7042EB8ECD PERCY.SCHWEINSBERG
804,170,308 *536D565366ABEEB1F992747ED8A1034239321359 [email protected]
804,170,309 *5364A1EE8CC16C7B55958D2EC97106133AE56CB9 PETITB
804,170,310 *53600D7E720F516C4F82B7FDC2BE84594AC74508 makutan5
804,170,311 *536DB3DD3525E4C449203F314AA450B664295141 PHLLMNSTS
804,170,312 *536703513A8EC14DB18FB03AD3152D150B949714 PLOGANS
804,170,313 *536228B5AA7902AEF17B663DD2116EF4F2FCE5AB pnzrcfnda
804,170,314 *53644B46F78F850D3D40EC9EC50C1CB8CD6AD73E potterers2
804,170,315 *53654B0684A4313F521E779653B3209C7DCE643E MARZUMH
804,170,316 *536C0162CF592539A30AEBC72E7D836B6BFD381B [email protected]
804,170,317 *536EB9886767CE189C95CD45C8C4DDBB2125F556 [email protected]
804,170,318 *536C5D564A0BE5CDA82DD76B15E9CC8792D04B86 PR0FUND!+!3$
804,170,319 *53622653A7A43DA3363263C6E24D8E37DFDD62F7 MATAKATU8
804,170,320 *536E54BCD1E0B03B5F29DBE4A62169E4596CD29F preenabling
804,170,321 *536808F3AB13DA44389485948BD1D18665F0D70E PREPERSUADEPREPERSUADE
804,170,322 *536172FABC8130E868550D200416700C432AD338 maxfedler
804,170,323 *536545302FBB7EAD7E3020460DB2607BE5D80C57 mckinleywoodin
804,170,324 *536BD469F78ABE2B9F449ADE338F52C63D6DA284 MENDZIME5
804,170,325 *5369B4E6DCEB9C5254FA56D0F5E4959FF26225C5 MICO
804,170,326 *536529B6AED7AF6C546B67F0E38DB56E687FA832 MIKESPIES
804,170,327 *536CB871E82B206D0B95CF9F47FBCA8B30B8A0B7 [email protected]
804,170,328 *536B5CADFA5E0900133D16F6A194F44474602008 qiucatt[email protected]
804,170,329 *536EABEB46A919E88C0B04CF8CB3BCE512C641C7 —MINERÍA—
804,170,330 *53615012CD281D0FAC0B51715BFF09F93C9B550E QUAN.VEIG.QUE.EL.TEMPS.COMEN
804,170,331 *536417B330F42383B1F183098CFCE48A4C5546BF Qu'estce qu'y a
804,170,332 *53605A9952207E86C17D8A53CECA35AA370C4966 quinnkreitzbender
804,170,333 *536ED4968AD6ECB2DF93F570F566C33E4805E4F6 MITCHEL.AABY
804,170,334 *536F3435798004600DD665ED9B2EEC25E415EC9C radiann8
804,170,335 *53619DF15C91F3DE936D9C5664D96467EDADD539 RAICHAK
804,170,336 *536A5AD2ACF6E8E4133ACC3105F6BFE10B2A5794 modestohouchen
804,170,337 *536AF80C64D5C2CC87FFA500C6C82AEE342A4BA7 rashadmarte
804,170,338 *53669B5E67A994B735304F20C17ED26B42480C69 RASHADORIS
804,170,339 *536DFDF22F67767D8658E6D6122BD682445C4134 monaldesco
804,170,340 *536C49CE7E4CBAA0788CAAB9740EA282972BC798 MOO60603
804,170,341 *5361B4755115A9FB24C0302C85D6FEEDE66DB3FD razlomke6
804,170,342 *53637CBED9CAA50BC29792A4512A4EB5362247FB rechampir1
804,170,343 *536AB4CD18454399A0FEF4D9E5A7E98F0855117D mosetena1
804,170,344 *5369845A86D90BC590DED919A8B356EA2006359E m.p'
804,170,345 *536CCEB1D46C569696C8C810D1EF9E789995739F MSDOSU
804,170,346 *53638CB9D0451773CB63271A45F7FC0744D4843B MTSoundsFromAnarchyRanch
804,170,347 *53696ACC916AA3C08BDAAFC9FFE6F13550F9A860 REMIKROVERFILMTED
804,170,348 *536D3CEA8B8BF7B35FAD1CC2401F016E22996235 REMOVEDLOTUSDUCK
804,170,349 *53658C187A9F4FC056119093C5355CE6FB6E94BF RENATO.REHMAN
804,170,350 *536ADFB33AC8F1E85F6954C94C36EA6E8B5706FF RENATO.THOMAS
804,170,351 *536E6E9A27D39819BC2084535E2A98F9D00A0B9E resnecnied
804,170,352 *536D05025D28C96C6AA6E3618A33E5E6F8843CB0 N0N!NT0X!CANT
804,170,353 *5365AE34424D03F2EF8B56889660CF5B1DBC763B nagahiro2
804,170,354 *5366C6225008049B36C3B7DC9C0050E728146EE6 N-DE-ORIGEN-CHACOL
804,170,355 *536DFB86DF17C11D212F03FC261BCB185B94784A RICALCAMMO6
804,170,356 *536DAC121EE24869C20AA5D7F5F64DFF63B1FE9F RICKYNEEMANN
804,170,357 *536F2825522BD16AD7B84FC818579B0AA0E2816E nepekroed
804,170,358 *53680B1C0E911911F105EBB5A65B0301D57299A1 nestororlinski
804,170,359 *5362A086BDE0F8476B0BF1844D80B04258F71745 [email protected]
804,170,360 *5365BC3532A52F67D5998EE712BDB47426642B8B nezacel
804,170,361 *5363207F903B12EE9218756B3E79FBD6E637AEF5 NFADART7
804,170,362 *5366F0955C15E1389E25CAC87E6F8F2414D2CE52 NICKY.KABABIK
804,170,363 *53627479554497CB240371C0159C1241C6B11E15 niedersachsenstiftung
804,170,364 *536D7227A128C7C96DF73A8A9AA39FBF1F962071 NIITTYLNING
804,170,365 *5364101A56819219546C9347C3EB818D95150E8A rockyhainley
804,170,366 *5369DA18A7626283B4BF3CB75D17B990C10B6E36 rockyhausmann
804,170,367 *53604661E68A3ADB6D4AFCA911E21AE7A238F47D NOLANMOECK
804,170,368 *5361D8C790582DF3CAF1820D41C8ED17943C2D7F ROGER GERRARD
804,170,369 *53663D73DC54BBE6E713838531003DE621298708 ROGERREDRICK
804,170,370 *5361EF8CE8EC88CE0A324EFB5BE3ADEA953B5F9A normalvärden
804,170,371 *5360DBB93ACAA0563B9193EBCF8130B8F09AA163 rollmar
804,170,372 *536C2FD433A89A6CCFF9EE2400FC77D089FC11F3 ROMEL7325
804,170,373 *536DAA2D4D4408513652AE08355CDA613EBAD352 O$".
804,170,374 *536EE1D5DDEF0C93AB07CEF6D4416051A7521AC4 ronnie-james-dio-audio-interview-(2005),-part-5
804,170,375 *536A10A20F263D581D7C45D55B7A12B62A874258 ROSESMARVINS
804,170,376 *53626F343214E589D35E907FAF9663FC92D5A987 ROSS.MAXTON
804,170,377 *536685AB5ED651425C92E07B5D3444AA6F092A19 ODNANEPA
804,170,378 *536E6288D0152166E6E807E80F12BC9F791F7E34 on-brink-of-fame
804,170,379 *53691B0935E6DA42A5479985F377944186D8D260 RUDY.DETERLINE
804,170,380 *536606FE63EC8F8EE60CDC2469B55BE41DE36397 rueckwir1
804,170,381 *5362D23E5E4DFFDE8B7140D84C0593C69A61A2BB RUSSELLGERSBACH
804,170,382 *536A17D81168DDC984AAAC1A7E849972F447C935 RUSSHAE
804,170,383 *536C7CC619144A65325AD0D39487C75969A19BAA rustyreeter
804,170,384 *53699031FB2B19A77A507099D5E51BCD1D16E02A OPERETTASINGER
804,170,385 *5360AB1B35562331E2E8A3BEF91828E329A8742C RYAN A LUNA
804,170,386 *53601412A11EAE0C3EBBA7AE0367571539BDCAD6 RZCKRW2ZH1KH0
804,170,387 *5367E5ED1337EA8208CCEF404A4349136C626708 sagmirwasmeinstdu?(radioversion)
804,170,388 *5362C1D0A9925BABCB43259CB62111EC782663A1 otloukat6
804,170,389 *536FD7048A0CD4FF329B5E60B185540F1CA6C7CB outbu!1d!n9$
804,170,390 *5362B047D465DFF94EC285C8ED7FA3302313B04C SANDYSCHEUERMANN
804,170,391 *5369A5588DA752ED62D7000413BEAE54CED89406 oyasuminasaiashitahaohayou
804,170,392 *53600872A5D52BB1792C85591A3E5D9482B9C938 P1ENARI1Y
804,170,393 *536257EBA01DF96BDAEE81EC286948474B638417 SCUBASC8
804,170,394 *5365BB2992E669F24E03826D0CC90DE0C637F54B SDEBONN
804,170,395 *536A39CD673D24157F97CB86DF0CE258D89647B2 PATRICK.KIBBY
804,170,396 *53675F4ACFB042EFD245EB2478D5782BDDA22FF2 SEBASTIENROBIN
804,170,397 *53608F53FBDBCDEFDECEC5E22B2710BE9740ED73 SELETAZ
804,170,398 *536D0DA91B153F296E588CE37B6CD58189712DD6 [email protected]
804,170,399 *536E4372AFE9083FC4C73134A0C9DC81AADEA28B SERGIOTROLL
804,170,400 *536C7B0E5EC6D3737853CDCAC25C9D68A0846247 serikaku
804,170,401 *536737EE79E698FE2FB6C5E48C948763AF07C1EB sezinamuher
804,170,402 *5369AE2F42085F3AE35588BBE8001D1AC5E5D466 SHARON-FARTHING
804,170,403 *53645A43041AB70E3D47D36E1D68BD2A4BE56FA3 PHYSGNMS8
804,170,404 *5362CBA8EE1A890533913F420ED279E5FDE40BF4 SHAUNSCHULER
804,170,405 *5369EAB0DD1C7163FF49E29D5CFE7ABE9CBF2374 SHAWNTAEF
804,170,406 *5361BC7FD7FD7F4BD3F93DAE55999BB4B18FD319 PINOCCHIOBBS
804,170,407 *5369843CE5245C2DD6493624C01E7B12EF0D8710 [email protected]
804,170,408 *536C5733FDBE8B7394AC8F3D9C10D1EEF49257F2 SITIRETRAOBMORHTING
804,170,409 *5360496A184D90F584DAE6F730486B6C05DD12C7 [email protected]com
804,170,410 *536AD8E3B2ADD9D0322FE9492D2C9BB5E3516FBF SkyIsCryin'
804,170,411 *5367BE2E863F35D661225EFCDD6934182EF32D90 SLAV3.CL0
804,170,412 *536FA750C2FDF5C85E4A1CF240A1C5A65CBF390B PRIAMUNING
804,170,413 *536A6C1F080BAE78502811973169EC955F9AC61E sloppy (i saw my baby getting)
804,170,414 *53685AE488C2675894515ECB361FD44287584795 printisaripen
804,170,415 *536624A34B6188A6D416BB097579B1E86757DAA0 PROCLAMAIS
804,170,416 *536E5981C04A3563BE07B136A0C32E5615E35C31 [email protected]
804,170,417 *536423CC4005F435F00A0700825E20C468B532B0 Soap-Bubble-Box
804,170,418 *536F6C98D7F64A12DB0DDA76938ABB6291C73919 p====)`Splat
804,170,419 *5367EEB6F83E404E0CC8E0450E85C716F115D503 [email protected]
804,170,420 *53683A0F7049AA0A356E201A385F2F2AD467C696 SOMERGATEROAD
804,170,421 *536677F66B79C4DDC58BE2D3FFBB2A6587D0819B PUTTONURSE,SENDTOSCHOOL.
804,170,422 *53664A7DBF4EA61D4C6B1A8A297F894C8C7F5B34 p====>.~.~}x{
804,170,423 *5368B02BFCDEACA9340641CA9A720FDB67FB4B26 southampton-dock
804,170,424 *536648CDFA89461D77574121A01161E421172B68 R3fn4ncn9
804,170,425 *53672C4C7E26B220F53CC76C22449A8B8E27B293 [email protected][email protected]+1ONS
804,170,426 *5360F057C545D6051BAFF6EB9620BA6FFF97C8B6 ramiroisley
804,170,427 *53652FE293A2E3AACB993A4A4AC7C997769FA68B SRI-DEEP-NARAYAN-MAHAPRABHUJI
804,170,428 *536F3780F849A02486117614694CA1DD90E3FCAD randa-moore
804,170,429 *5365C7903CE5F34ECF1BE5508DEFD5BBFB119362 RAUSZUBE3
804,170,430 *536916CC6395C5355D04B478BDCDAC4E0942A20D [email protected]
804,170,431 *53684A8EA6D5E3E50AA81A60CC2B436D4F32244F rechooses6
804,170,432 *5366B2FD2B37315D19B046A7369D05A6E5FDF782 stebbard
804,170,433 *5362BF04E9F47A9DADB68440B666323FDB22E7AD STEREOLABDOTSANDLOOPS
804,170,434 *536E42E17E42CF1E560BD41CC399AEA89F5B44BA STRAATGELD
804,170,435 *536DC14B58002DCB5579797C4B95B58B567390C8 renigs1
804,170,436 *536B58725E39E62FA83AD73A0F2233E87288CF52 stuartetulain
804,170,437 *5361095F4E83562B42CC45E970D8F694E0FB8F56 replublic
804,170,438 *5366BD9A67306C704A3F3FA2D5F151B73F41FD95 [email protected]
804,170,439 *5364EE8269C76B5BF88E28C625502CED60152561 STYLESOFBEYOND
804,170,440 *536D28F4C6334161A88DE536731E780A28BD864A sueatlawed
804,170,441 *536FD95832972245272351F59F4D73D224CF2E6C [email protected]
804,170,442 *5369FEF335B46B1479969FEFAD890A05701A0924 [email protected]
804,170,443 *5366E909A51AEF6CC9B14523C8D38C6449224383 reyesweisenfels
804,170,444 *53627036854EA19D3175F263043A554FCA0D8879 SU.MAJESTAD.CON.USTEDES...
804,170,445 *536D3602BD5103FCEE1D56A58BBE942CB6145905 SUNG.KOHLMAN
804,170,446 *5365369145486232C565E46532E38824AD6DBF7A RHODODEN1234
804,170,447 *536AF442E94607AE4CF655E683B74543578AF885 SURGEONF
804,170,448 *53656D2C415CD0711ABBDC4A9113CD2101067CD4 RILEY.SKIBOSH
804,170,449 *536269E5AB095936B30A20DC6C9BAC0E30F9D78E RITARDATE
804,170,450 *53637AA2F2A215509B14EC7CEA0E86B17BE7AF35 rl2909
804,170,451 *53657747F8E40C7296984DC2B031DEA6ABBFD97F ROB-DUNAWAY
804,170,452 *5365643F88ADE5B6EABA4064C853F5E40996DFA4 ROCKYLOGAN5
804,170,453 *536BD2C5DAEFF74C6E6C9EBECB9DC4C8B4F29719 rodgerven
804,170,454 *536DA9E0BFC05B94B3BC47CEC9CD09507F777950 TAKTFESTER2
804,170,455 *536D2173BF3C59A4A3575CD3E42AE82A2CF81CB1 ROHAK
804,170,456 *536D2B86348367DAF392115840D0E220849DFBEC romarioking
804,170,457 *5368D31073A7CBF62BC62D3645A255EC21330135 ROOLKFQ17
804,170,458 *53653B5084E04101ABEBD679AEE18AD327B8CB61 ROSS.MURIE
804,170,459 *536E58912B262C63DF10A4C0A5E247AA497E3D7B TARTUFFERIE2
804,170,460 *536EB8753A93157C9BBFBA84B6E1B6957BA9C03D taylorj3
804,170,461 *536F4207C889AF34B0F05DFF09B1D87CF9738C6F TCUDNIER8
804,170,462 *536AF374C9103422C19EFC5C4B8DD5D9E834FAAC RUBEN.BACIO
804,170,463 *5367526E1629E1369387B1C5545E3A45E43C5055 RUCHAIS3
804,170,464 *536B8A9189DC94FBBDA1C97F7BD459DC436BD637 The game was ne'er so fair, and I am done
804,170,465 *5364E5F009BF9E626B13AE91C7E1B8B2B07630DA THEGREENROOM001:ECONATION
804,170,466 *536AA476FCA9796D637F26BB7F1F59064AED7333 SAMMYJURKIEWICZ
804,170,467 *536E0FC2BEB2CAB56EB830D88B500DDFABBD65EE the meal of the blasphemers (the profane mystery)
804,170,468 *536A8143669C8DA0FDC67B1B8914513A0D6D54FA sasha.yoko
804,170,469 *53648EA8AF7E1BF62CA1FB14FB707AC6FEC3157A [email protected]
804,170,470 *536F41E89C6F21C2A5568A2F0AA9F6A4CF75A5B3 SCHUBAURSTRA
804,170,471 *536863017311EB680884DF83D7604048ACDFC68F “SCOT227“
804,170,472 *5362D42AB2D416055192A98FD294CFB42F00DA20 THE-WASPS,-OVERTURE
804,170,473 *536C27694020F2F4BAC863DA3257623FC276BFB9 tjanandrejc
804,170,474 *5362AAB88E63A56FB42F408EB1E92476F7E3FE23 tkurgol4i5ihh
804,170,475 *53634644E257CFE0C833D5658F1A1203AA61FD71 tobiasnass
804,170,476 *536FEEACCD48C7F1C25A5DCEEC76DE490CB105CF sharrifa6
804,170,477 *53691DB69C5C52455552994800CD4664484CDF6A TONITRUOUSESING
804,170,478 *536C383FF79B3E94AF429229BBEAE2664D44B413 TOOTSIEPHOTO
804,170,479 *5367C6FDD73CEE4B459362646B5C4097AFC61B71 traceymacqueen
804,170,480 *536E900AA24168C521AFE18A83E9F3963F06627E tracy.englent
804,170,481 *53685F768C6153068E7D6F78B6739349115FD0DE SHELDONCRANDAL
804,170,482 *5369C5B595EF922850A2BED6055DD22C5BB5FA11 TRCHNTRC4
804,170,483 *53622DE063DA9AE643F60A7851617958B7123830 TRENTSACKRIDER
804,170,484 *5363D5C32C85BF31CEEC207BE5300778D7512B9B SHITHEADSPEECH7
804,170,485 *536C1674CF6A493C44F2ACF3B9F345D39B884FB7 TRIFOLIU9
804,170,486 *536388AF7B09882CEBF7C78F3F431A9A450E112F tripp.hobbs
804,170,487 *536E8A7383D9109E77E5F81ACBF5BF7158B1CCEC sidneyramotar
804,170,488 *53654433BBF9A532E49D12D84D1C717AD5AF66A7 trishmasterson
804,170,489 *5364ECE34CCB3D2BD3A10A3163B0F557B5644918 sistren.5.0
804,170,490 *536EDDF4BBE6F516439F864B87A99BBD83ED781A skaðiren
804,170,491 *5368601AADEBDA736A768EF3DA4F550A3F33FEDD SLIBDES7
804,170,492 *5361AA226947069CAE5A462775C1E582B3054D80 UBIHSERED
804,170,493 *536B38A8B1353FDA1C9F107BC5B43B656D84B841 UDENHOUT3
804,170,494 *536FE2F1DC714B72129D46D585D52D8FEF45F564 SOVIETISEDT
804,170,495 *5364D49A7FA2D58FEE245260269CABC50DDFA580 SPAINLINTONP
804,170,496 *536C404CCB7AB60E0FB302F0C180E2076D19A218 SPINDELTREPPENHAUS
804,170,497 *536F44EBCF542BD2F53F41E82B12CA02E237313E UOYRUHS7
804,170,498 *536F38A1C91AAF1F10AA5AE5458C67585D0F2E69 user9.user.vhost=phantom.kirenet.com
804,170,499 *536304C179D448D21D6B29462AD636788DCC32D6 UTOST
804,170,500 *536F6D12C21376D5423A5E14C3C982087F9B4FBF UVJS
804,170,501 *53637C55C85EC9C06AA3AFF09002EF4BFEC9FEBE srevrpsdtsnemmas
804,170,502 *536D0184E3FB3D6BDAE6EE9979B2624C8244551D VÄLISDETAILID
804,170,503 *5363646769855291546D52DD52AA3EF71BF83E72 STANFORDDEPAOLA
804,170,504 *536FD195C4DC434F6893AE53203600F2D5557A33 STAN.FRADY
804,170,505 *536A917A4FBFC35D11C9C11761810EA6A655D604 stavros-pavlou
804,170,506 *53697D7E8475A89F09A40167292F420157644663 VASTAVALITUN3
804,170,507 *5368318B90040F6882556FB2AD124C7815998613 stebbard
804,170,508 *5367E04F68D2CE1E59557C97A969A8B9FD6535F7 STEVENADGGED
804,170,509 *5364FC6EA68CC48F26BD554E9BFBDAF8077C0305 STEVENCENTENO
804,170,510 *536DAD3D95890D4EC8AF2D904B88E76358274B13 STEVEWAITS
804,170,511 *5368346C3E7E26EC95A271B030BEE95B961189C5 stewartsmedick
804,170,512 *5364DA849A6771E4EE5969CBAC57C36D6B91AF57 VERDRESCHT4
804,170,513 *5364AE6474CF726560C3FAB447D948872A5AC757 vergeld9
804,170,514 *5365FA2BAAECF92BB8F6C3CE438E65674586EA76 St-Matthew-Passion,-BWV-244
804,170,515 *53605645A680FF1F24C3F48646E576EE41705B66 VETERDC8
804,170,516 *53647F12AFB3DB83E35BFD41C5A6D8EF6E1C044C SUISORO
804,170,517 *536FEC02EEC45934E0C3000399D53D7D6894140E VIDADECOLORES(FEATWYZ,GUANTEBLANCO&ALEXISTOSCANO)
804,170,518 *53647C8A7C2B8ED5C39382829DA2136CFC044226 VINCENTIUSPAROCHIE
804,170,519 *536F63869C0EA0DA8C2A28AF24ABF8D3EA90B708 SURIWASSA
804,170,520 *5362C82C79139ECBE34342DB830077949DF84333 SWEATBAND
804,170,521 *536FE53A5F52E8C0F2FB487ABA6BA67170CF303D symphonyno27ingmajor,k199:iiandantegrazioso
804,170,522 *53693475C5FAC29376691553C5713FFE2D595700 VOLUPTATE1234
804,170,523 *5363F9AD9A03393C48527A98CADF7B03FDD2D3D5 talkdisputeresoluti
804,170,524 *536579926FFAB92A79FFBE8336CCF946CFC78053 VOORBEDACHTHEIDS8
804,170,525 *5363FAB32567D63C39DC69AB74D3907D983BA8B2 TALKLOBANILIA
804,170,526 *5360C5D5C9A55570847CA3D529C6AEED6EB648AD TALKMEDOWN
804,170,527 *5364ACD9B529065DF33633660279FA17C2E735EF tapprast9
804,170,528 *536BAE6B1286BD82169E11F2DD113E24E412EBE4 waescan1
804,170,529 *536072EC3E87F09D200F4C2D539AD1D5A7D3917B TEORICAS7
804,170,530 *536F904A2BCAD582AB30D1B638B41D93D5C16617 [email protected]
804,170,531 *536ED9564C9E0E451AC03896255DC9701367317F [email protected]
804,170,532 *536EB6DF9248F08821C202B0E35B5827D544C495 [email protected]
804,170,533 *5365D6C96B26D126AF1D26C3F6B1BB3E488309E3 WAP-AJOBER
804,170,534 *536B490CEE9C097664BD18F804D6EDA40E37FF24 THE.BEST.OF.ROBERT.JOHNSON
804,170,535 *536E1A915F9549E856025D659FD0714BDD7E36E5 thereunion
804,170,536 *536565FE6097C26813128E6B9DF25864391BE3C5 tilled
804,170,537 *5368127670046BCA63522DFF6C3CF20DFE4F75FB whiteandalive(originalversion)
804,170,538 *536AC0E0CD9C89D991C4A566F3D7DD0E573822DA wildpacksoffamilydogs
804,170,539 *5361EE8BA09F0D5AA2450A5276443474CCE8CF0A TOCCATA.NO..4.EN.SOL.MINEUR
804,170,540 *536585BE4A9E1715A443C511CAEEE2F7E97C9AD5 Ton.dieu.ne.s'appelle-t-il.pas.ego.?
804,170,541 *536DB880B63AA6B18A82A0DD9ACC206A53BA68B4 toryspinner
804,170,542 *536BFBC9A78855DD7227D961F6B3EAC2AB346BFF totqara
804,170,543 *536C740D41226807FECC21B3D0AC4F73A8F6CB15 traditionless.
804,170,544 *5366B7E3BCC57094E205C616CD2E493C5A335A04 TRENTON.GIMBEL
804,170,545 *536AC8208D0F9448032F9B5960219153B894E817 TREY.AGNEW
804,170,546 *536CF2DD47B85AD6C38FE9F3585D9CCEF8C29197 WILL.MESINA
804,170,547 *5363FF62BE12FA576A06F82AE0CBD1668456562A WILLYWILKERSON
804,170,548 *536EEA7CF5F6C0D5EAD020D4D84067F899A9675E wilsonjakupcak
804,170,549 *536ADE73E408C9C5D41BADCE1915B667BBA66AC4 windowsorchid
804,170,550 *536C9D3CB76B41E706CE5B5CC06296A33E2B44D8 WINFORDSEKEL
804,170,551 *5364E595D5141A8AD6F1DEF9EFBAC21799032AC6 $TRYGET
804,170,552 *536CA1E475C556F9B41F4D51D1A95D2EC8DAAA98 wirepulling
804,170,553 *536F5C61D19D6113A925AAEEA5ABA84000703359 TULUFANTURFAN
804,170,554 *536C5C86E88C3116C45648334694225CB04678AD turneerne
804,170,555 *5367F0A5301CB3193738E10CED94FC711F58717B typesmith
804,170,556 *536D1D2625B383BB419EFBDFF006AEBBCDA67B6E WWW.GIANTIMPACT.COM
804,170,557 *53660B24C7A40FE571CC35CB9BD72F2542CF25E7 TYSONLASSEN
804,170,558 *53696AF164BCF8C27D1DBC9EDA553AA72452D01E U19091967
804,170,559 *536B158DE773F718D13A9F0AE9B9160EE98B2E40 }uaaa
804,170,560 *5360422CA386123508B117F5CB4BBA1E25006CA9 [email protected]
804,170,561 *5367FB7C31D1808661AA677B5D5A0167D61AA054 UMEJALIWAED
804,170,562 *5369716C079FC500D377E15409B32626567816A3 UPON-THE-PRESENT-STATE,-WHOSE-NUMBERS-THREATEN;
804,170,563 *536E5CEB9A7020380A83E3BBC21810A455FEEEA6 Y3464
804,170,564 *53672432D85326B6197CAC6BFA69584624629397 [email protected]
804,170,565 *5360167C3F8795D4EE2F52D49191A058C8D649F4 UTTOMAUH
804,170,566 *5368B3AA2199A2000F90D0261C0BE7DA03AB4DA9 UU*.*.*(##P
804,170,567 *536454A17AB2935BDE38606AF5C07E4AC4CB83B7 YBLEHSESIARP
804,170,568 *536B4A18564616A3739B587494FA3B4AD60E5E49 YCNAURTNON
804,170,569 *536BF572F97A3C28C07F191239EFAAAF120B92AD V3IJONSUO
804,170,570 *53675C0EBBC419C9BC1AB90F195066832FCC3714 V806106852
804,170,571 *53667A9E53691DA4FAB4F04A78A19635B64AA515 [email protected]
804,170,572 *536667580040B6035E15BAA3DA1ADB138A783868 [email protected]
804,170,573 *53638B61F73ED8BA4A828591A7FDCB00B9478462 VAMMAIST3
804,170,574 *5369947EBD91A0C79F1FEE0E18C67B8F4F041778 yliv
804,170,575 *536ED682ACA3D1E3079C5D7A7FD02704FA6E882E VARÍŠ
804,170,576 *5363F8639B673F4ABCA2ABBD990317129B2B2670 ve de valse r
804,170,577 *5364B3EA91361D6EE51D0785BAD86DB78A692D20 YOOHOO
804,170,578 *5361FD5C042E40DC025AEA048244C289CC0B8B63 ysabelwee
804,170,579 *53630DD89A5F602352766E3A6AB2C431D0914A12 «YUMEMIRU
804,170,580 *536EF3A59D2F3678E8E378B5BD70B513BBE68645 vienna-carl-tabucol
804,170,581 *5363B46495664A1F9117C35AF45D1BFE2A46EA4D Village-Life
804,170,582 *536C373C23478ABCE3956B8015415B526587E6AA VINCENTALPINE3
804,170,583 *5366800967E64A41CF7B8EA4641EA6645D0D3DAB vincentbutorac
804,170,584 *536A35FF8997F93AE0FED86CCA8494FBE3EF1173 vincentjarno
804,170,585 *53637B5CC89D23BBFC2D0F5BED27D40396BF95A6 [email protected]
804,170,586 *53615441FC14149F76B3F9A34CD7B4FFB1539DD6 VISIBILITYFULLYOBSCUREDBSW7
804,170,587 *536ED13D90BA92B53B8E494B46B868D7090F07B7 vivian.golan.weisman
804,170,588 *536CDE0D7AA6CBFE8916AA20F69E8FCC5F90392E [email protected]
804,170,589 *536DA9618A611138DE7F80AB6D15212C6A0A2D6C ziv.rotshtein
804,170,590 *536A21E386FCCA95B82F85E2578B012FA5864065 ZNAJOMYMI2
804,170,591 *5367D6EF7D9823CE47FEF804A96E460F8F7064C6 VSSTND
804,170,592 *53677DEC15A729F163AA562865DDB04B0F69005B VSZOXN
804,170,593 *5364ECEB669DDD93D4ACA727910BD7AD1686A3B3 WALTER.BUONO
804,170,594 *5362A5D6A1D812FF2B3BC065E2E6D83F265A0113 'waltz,-waltz,-waltz'
804,170,595 *536BD5C5CC56EB424C7C78BA09670B8C39C24708 ΦΙΝΝΙΚΏΝ
804,170,596 *536D5353EC97542C37B8104BA59A33DC6FEBD061 [email protected]
804,170,597 *53675D7DDF5E75B83DAD2DBDC80DCB058887F7FF weavils9
804,170,598 *536718CF3A985B320CAFBE2BBA89DDD4AF603E8B НЕАСПИРОВАНИ
804,170,599 *536B64F5E428EF6916D7F90F126830B033C10C7D WHEELTER
804,170,600 *536B748584E1F4B52A2A715A500B266B3FC1129F WILFORD.GAUCIN
804,170,601 *536AEA3FF9CDBD76739FB4C1CF4441721FD0542B wilfreddokken
804,170,602 *536A56BFC7708D59201B1CF67C41F8EEF08BC9AB willemsonnema
804,170,603 *53652C0E70377D6582E81BCCE371C7E56E72D79E 作成の煽りVの中では「秋山
804,170,604 *5361C2081521DB49992225733371A5942480DB1C WILLISBUDZINSKI
804,170,605 *53663188A0DB6696488AA985F6E48946867985BF WILLMUNGIA
804,170,606 *53638BF4BB19478FF48CBF33713DF261D2DA83A3 WILSTELFOX
804,170,607 *536FA63940E42FA8F6725A00CD1E08F8D30E827B WWW.BODE.CO.UK
804,170,608 *536915169633583ECDDCA35C6DEC81CE70D83F1D WWW.SHMOTEL.COM
804,170,609 *536A95DC61549AE31E43CC2C64E3282434911012 WWW.THIRDORDER.ORG
804,170,610 *53663675676DDEE73E8D2C0DC10379724611A492 美國經濟增長放慢緩解了由食品和能源價格飆升導致的通脹:4月CPI上升0
804,170,611 *53640DF00EAB7CA8352C2449CBE9BF59505FAD4E XQ*\
804,170,612 *536D2122F7E83C29C2CC99FFC4BB2F09FAD40E54 xuogl0phfsjn2
804,170,613 *536712D6E6E36B91E2ED571A4E5D3C9F2B2D0854 [email protected]
804,170,614 *5364CC35074DA0CA2ABCEF79E232E4192121DB79 [email protected]
804,170,615 *53665B9954D194FEEB0DFEBBB6580F74FBA46F4F 039imani
804,170,616 *53684C2CE18178DB9CF75C910D0C2141024C85AF YEDURLARAM
804,170,617 *536CD78DF23DF58A43EE7A3BA9B8772A21E7FB08 YEIE
804,170,618 *536E152F49917F0E543B1C872351C114C59D5F3C yliv
804,170,619 *536CAB785E24EFC0086571E78D6A38065374A288 you fear me
804,170,620 *5364C9A02BD0AB18FA600D334A670E926D041E19 YRITYSHN3
804,170,621 *5360515041100E8C89AF307EE03484FF0C18BE1D yulimassiman
804,170,622 *53659E6D9F0403D782FF088E4B66F787D464820E YVETTEBOTTINEAU
804,170,623 *5367D2B13E8F9F39DC228B45EE9C3856FA26E8D9 YWHAAHWY
804,170,624 *536249885C47173D3587549DCDE7EAF58C7FA02B ZANEPOCASANGRE
804,170,625 *5361A8D792D1CEEA4D9FC50060A6391AB43FA8F3 ZAT262
804,170,626 *53669683FEFBC6453EF05AA5B00093392140EA75 zelfinductie.
804,170,627 *5369EAAD8419E9AB8A18C7E020E5DFAD760E1409 ZEPPELINCAITLIN0
804,170,628 *536145437F586C369F0536A867E0DF1C7D0BAA4A [email protected]
804,170,629 *536E588B369658EE47D141B42D44F5CEB55EAD19 18AUG1328
804,170,630 *536526D17B26AFB89C8151F40AB274234B8F6178 [email protected]
804,170,631 *536E56C8628B7E2A16691F9371062B2FD36187CD [email protected]
804,170,632 *5366250776434A5C221AD91BCD8ED32457DE6F78 1996-03-26:hollywood,ca,usa(disc2)
804,170,633 *5365A988F9CE5F5B45EFD734D7217EAB1A1CE52D 1 ABOMINATED
804,170,634 *53635B0FC576776F457B8D2A41F44D0B2E96E53C ZHU-RONG
804,170,635 *53635A4945AEDB6CDAB72A63FEDB7B9234F5C34D zinnschiffe
804,170,636 *536FFA68D88B551D3DB2107CFC032CE8D48E95AF ZOBALAS
804,170,637 *5367F23DAE6B8630438CBD26CF4E4A9F6A5F2D5E 1.bratonac
804,170,638 *536DAA9D4D0BEF740D6780977A5961A223B50A66 ZUNELLY
804,170,639 *53624BAE30BEF80075E7A1843F5A350E6C327E82 ZURUECKGEHENDENS
804,170,640 *536B4E6903A0DE2A85917B489E6AFCE68150FC8C 1D082FD8969B3A38B431ADBE682BF311
804,170,641 *53699CCB3F124263D83F95804B33E968123B0919 1 DISKANTTITOISTOA
804,170,642 *536AC1CC8205038D2520AD036F8EFB5EF71A541A 1EGVQIX7BCM
804,170,643 *53607A0B5347C7FAFC6F993AC7A5D35AA148E9F8 ΒΑΡΒΑΤΗΣ
804,170,644 *536FCEC64FB31CE2EE0C4E0770115DB942BC10D9 προικοθήρας
804,170,645 *5361AC28BDA89A1166DADC6F71D0A55F2D792D6F ВЕЛИКОТРНОВСКОЈ
804,170,646 *536DA3082AA1D177877CD33280EAD43BB794F66C 1-miyokawa
804,170,647 *53690322E5D956AF5482712013D5C32A589C436B „НАДОЛЕ“
804,170,648 *536FF0F941A6A87A34F6EEE6724B86D5D7FD003A ОБОЄ
804,170,649 *53660E30FEF860183AC9E584C44658CA0871C671 ПЕНСИЛЬВАНИЯ
804,170,650 *53640CEB8273818A1691694E31EFE839104A5442 СПРОСТУВАНЬ
804,170,651 *53635CFD9CDB9DF62A6B4E76FAFFB1C7AABE9620 1ultracycling
804,170,652 *536F8008F6D2622E5AD171766BF389E4DB954E19 1yansitlayabilir
804,170,653 *536BB951B48D50C7A605B217DBAE349D4A8437CB 1YHDEKS
804,170,654 *5369A41F2BF6089B2DF835BAA254FBC60CBA281F 1.zauberlehrlingmotiv
804,170,655 *536A02B3194614A776B30AE7D994E705FFF16D3B 2008repprimarysc
804,170,656 *53674046E4F9975EEDD41E95F58B653CA1268986 2076659 kirjavas
804,170,657 *5369E57F33B2C9BF1840BCD25FB57EE45489548C 20YAMAUCHI
804,170,658 *53640D3CED402CBDAA25C1D665BFCB217014683F 2273508 dasistsichernichtideal
804,170,659 *536FFD69CF8B70D289B40CE3C446CAC59A2840B3 251512 SURESIKESTIRILEBILIR.
804,170,660 *53632C9D70B8E0028036649C20ED053ADE53CE05 2535569 NYT-VALMISTUNUT-RAPORTTI-OSOITTAA-,-ETT
804,170,661 *5367060DCEB2BF63FB65A30ADBAE2B0473F4E3B6 2764051 VIRRANPOISKYTKEYTYMINEN&#151;POWERLEDEIEN
804,170,662 *536F107758EED254F704477D95D89C00C15625F4 277831 EINFACH KLICKEN UND TESTEN
804,170,663 *536868CA8F91027BC5DFC29FDA3EBC9A2D703AF6 295786 mesaj-nasil-gonderilir-?
804,170,664 *536A967171347210DE1264E88F120A9EA1D91849 296yxteu34
804,170,665 *5361453AFF555769686440AD46B1F6CCBFF2983D 2DAYISRAINY
804,170,666 *536950196DFDF34C884B5F1B29E68BFDAE22BFA7 2 IHMISALKIOIDEN
804,170,667 *536F88565936B23405DC9FFC6732AD75D9F6CFD0 2ILUVVISION8
804,170,668 *53600BE30F4E9BBAE991E26CFD17616CF49930B6 3>.~0.)X(
804,170,669 *536E9C72A7BB45B52251E700B7EC2A3263552D5C ;)31,]31[ni,a,d,c,b(GG
804,170,670 *53638228CF08C6AF7A25EF6F020E5A219F77F123 313915BRYAN
804,170,671 *53628ACA7BB4C607FDB6E287CC29F963474AB948 393978 SIEHABENIHRENBEITRAGGELEISTET
804,170,672 *536252F6C3EC4DC6349E2356E1247AA0AB136DB2 3#####B.*.*.*.~0~oSploit
804,170,673 *536C993063C0555C6D5C2992BCB53D3B00366490 的一個貴族依布拉謙汗(IBRAHIM
804,170,674 *536EBCF5439E50681028A939033CB2B74AA3F8C6 4OERETS
804,170,675 *5363E79A402DB7BD33DA67BCAAAC514221EFC22D 4PASSWDABCDE
804,170,676 *5369D63CF20F50F27281BD336CCBB5A7612E53AB 4thatwater16
804,170,677 *53660EB85E402B6BE0200F788568BC7F81521A09 4-TUOTANTOLINJAMME
804,170,678 *5361B1BDED3AB3FD0C352B8465607CCD1DBE5C10 4VERILINT
804,170,679 *536D700DBE9ECC4DA29ABE44F5136DD7875AF653 510YADIEL
804,170,680 *536DB19544C592F315B7660CCDBAD75D4993652C (00).~`.dP
804,170,681 *5367F30B8B92B6F998DD00B519641E715D47DC43 5national-allianz
804,170,682 *536A7E001720CB01BC032FBD49D03A527D2F8C4C 5neerwierp
804,170,683 *53601F33D8E233EC04ED8D84EE13D329DB960F51 5 PLAGER
804,170,684 *5366CA74BB0C6F81AEED6617C4028D792A377ACA 08221780
804,170,685 *5361F45337B66E8497AA667BF6C7D90F1E1F93BB (0_<) * * * DQ
804,170,686 *5365BB1E0B254C64813F91634256986FA1620681 (_0)~~~(=q
804,170,687 *5367E4E06F9D9C6AB49FAC91DBD86AC90C015C4A 5VULNERABASQUE
804,170,688 *53662A8E58209467B886F9555419D967F5F7D457 65614 kohderyhm
804,170,689 *536C361310B73DC3FACFA58983D684B454977467 6812acgmm
804,170,690 *53619FEFDA66F963078C2F5E79863371C6EEDC5A 6BEWAARSC
804,170,691 *53678C4F29FF3670AFBCCEC7C407CFDA0A1F6936 1238951 HUUMEIDEN-ONGELMAK
804,170,692 *53644F25A16A203610FFF3F3A19A593FE8DB040C 6CAESARJAPAN
804,170,693 *5363FD193E34E033E3031C2377550FCCE0637C57 6GRAVSTEINER
804,170,694 *5367A31FB93D109BB684C906C65F2371F4DB9394 12.muellskandal
804,170,695 *5363C18BEA3D23A31A3C96A898B4B429EB565EB7 1340498 SIT
804,170,696 *53672C46D8551AB7C8C2776C4A80670F3951E8DA 1341363 kuva1
804,170,697 *5368E42BA546C2F513FC65DEB5016436193076FD 6 KACAMAZ
804,170,698 *536E7ED504C50922A48775763EB4801E376C5919 15erkaantuneet
804,170,699 *536AB60A4D29C4E6D54C999FCF29D2644E19151F 1715070 PROTESTS.ALSO.OCCURRED.IN.OTHER.CITIES..
804,170,700 *5360EB4E4D76EA4A63EB4A53274FEF44A89CA2ED 17feb1211
804,170,701 *5365FD6E12F182F686DFCF2C3A4928B46AB2BED2 18imalatCIlarI
804,170,702 *536BC407D6E43DE2B8999B4BD1425881A286E3C9 1999 (FEAT SADAT X)
804,170,703 *536BAD01024800BD48A676F6699147C366FAB054 1am2and3a
804,170,704 *53662AA1CC5E8FA9F21E72769F6804E66F0903AE 1.biedenkopfregierung
804,170,705 *53699075D88F30E685CDA8F260B7E6B6BB10A9AE 1 CHINESISCH-TURNIER
804,170,706 *5368A9C3A28DE377CD748CDA5030B8A7AB62BC85 1.COLDICOTT
804,170,707 *5360A2C828D00C949AC770597AC512D9D6364996 1.foerderbeduerftiger
804,170,708 *53682C74A38B5F73CD8F78E52FA4A43DD6570F48 7HIRFGLAV
804,170,709 *53636C2AAEC561D853AAA72BDF2E371DDFA80B4C 1-GUMBOOTS
804,170,710 *536E4B0C5534ABD016007171B98B9F1A62BF7ACF 1HYPERNERVOUSNESS
804,170,711 *536CAC08988A348AED8A590EF0A70F7D7C842638 1iamsnapple1
804,170,712 *536163F4960339459709EFE3180C4C97077D7347 1.leasingwagen
804,170,713 *536CE9A724ECFC945DC6A956C318E610F93CB1B7 1.mtvvideo
804,170,714 *5361A7727DFC278DF934AF0DC209C88E4A8ADD1A 1.pohjoisessavaalipiiriss
804,170,715 *536DAEECF0B6D4EBBEB7A546F215436342379E64 1.pyhimyskuvat
804,170,716 *5367D002327C17BD7D1A9FFD39A4E484FC8F2527 1Q2W3E4R4838
804,170,717 *536412B6557CE2938C0479CB5A763D7B801DF3EF 1RDELUGE
804,170,718 *5365A66D6A484879C3241C2A0E55962DDE6EA90D 7UUVUTTAVASSA
804,170,719 *536CC1E1864A8C8BACDA1887182CD39567C28D4A 80yish1y
804,170,720 *536E26D7476A81C452BECE06DB5DA7903CDDCC2F 1skyhook
804,170,721 *5368C2536FFB06CD3C069475D4550A5E65B4D99D 1 SORDALE
804,170,722 *536B7471BAF45676A993C8203AEB3AF86F08DAE2 1.SUEDSEEKNEIPE
804,170,723 *5360ADB9F73DA6F1AF38B3A577B6AB4988DBEFB7 1 tanitmasiyla
804,170,724 *536B999A92A77B9CC4866BDEF8DD02811C510C04 1unterwasserspionen
804,170,725 *536205C97367FFB6E490B6FCF2CF74A17E6C7E98 [email protected]
804,170,726 *53623695FCD97244B9F707754DCDD838B54FA656 8BACCONISTE
804,170,727 *536E9147EA56934797904638CAA51C3ABADB02B9 1.XKREUZCHEN
804,170,728 *53694F118996482790C284E14116C7529B7D3282 8CLEZLRWGWAV
804,170,729 *536A06C5A0DE63154CEDE850A78B31360E948BE1 1-ZITHERFESTIVAL
804,170,730 *536F3694D3B16AB99AA88F6181526DBF9750CBFD 2056460 KIERROKSENKESTON1TUNTI
804,170,731 *5366EF9EB53BC39710E2774C1A29A6FDDEF5EAAD 2085302 THEREAREABOUT32,000JEWSINWESTGERMANY
804,170,732 *536418DDFB2E83A5746187304313F22C3205A328 8GEDOBBELD
804,170,733 *536225AF86B5B6B5AAD22A9F6525F907E1AA40D5 8lauttaliikenteen
804,170,734 *536B62C83ADB637FFD72E0C5C761371125B19112 24-DACHWOHNUNG
804,170,735 *53603D7A6B6C1D5022695DF0EB2115377835BFB7 2906769 siksi-kansanel
804,170,736 *536B4FD0E966D58721417081C01138D6B49F80E3 2AIUTATO
804,170,737 *536D682D5DC9F5DFBF41017AB3086D30D58E9347 8NICARAODOG
804,170,738 *53665E70BEA2BAC40E8789C4F8E661C073605475 [email protected]~osploit
804,170,739 *536956353B6744719BD39292B4137DEC7FB66DB5 8#)`Sploit
804,170,740 *53645B2D93C5C14541D96986C87A869316B316EF 8THEHEAVEN0
804,170,741 *5361F192C7D7DF433912D32F6B2A82DA53457B92 2-MEHRAUSSTOSS
804,170,742 *5366C7E693A3E0AA9EC51EF217A9CA18E8BD6D62 2RINERAIS
804,170,743 *536DA84497044A0E4E93B48E91B04DBAA000D555 9AAJATSOS
804,170,744 *536370FC297EBB1E8AC849511168FB109DDA2CC5 9AFTALELICENS
804,170,745 *5363ED5D9B19FC550F1A77EBC49A0DD5C8D536AB 9arb13ss
804,170,746 *536078AECD93710D8D31A11638D41BAA5464EEBE 9BATHOMANIACS
804,170,747 *536D864A7A13D8347688463E7E39AA803B6B1D24 368116 IN-OTHER-MEDIA-SIMILAR-BATTLES-ARE-ALL-BUT-WON-.
804,170,748 *5363940BA98885EAFD17AF42B5B5E8F4ADB27155 373LORENZO
804,170,749 *536136D86EAB0A9151E2761E89F8E0DF67CB3C76 9GNILESSIWREVETNAADEG
804,170,750 *536F98FF22A2BE7B67AA51E754A4C66FD15E34D2 9GOROSTIZ
804,170,751 *536D958DC68DC2328088AAA0B10CBE5C1E51FEFA 9howenstein
804,170,752 *53698EB2F598086894413C22C24973D389D66A37 3DSCHALIL
804,170,753 *536816CD5A18E13E3FB9DC974FB95B93A2925F18 3e5udug
804,170,754 *536EFB3C99DAB1EA0DB52141FAD7D6B3BF882303 9 PERILLISEN
804,170,755 *536158A374EDF600FDB22B8FEE4A33F9C95E3CE8 [email protected]$H!P$
804,170,756 *5367CBA38FC3413710C3ED8F41BB58CAD3B61D51 9REVOTEIT
804,170,757 *536A0193BDBD4AE25148FBBEA2F126A4EBFEE586 3xpl0+4+0n$
804,170,758 *536D6677A83B950898AED589282D9FEFCE669F04 9SVIKTENS
804,170,759 *536BE54DAF73FB1DF0E2629EC59149AEA1EC5F61 413581 AJOIN.TEERIPARVET.LIIKKEELLE.,.NIILO.VAINIO.KERTOO..
804,170,760 *53687662AFD7369A4E2FD42D4BF874F643769196 419728 OHJELMAN AVULLA K
804,170,761 *5368C3CACF1BB5D3242C83BC440CE600D46FEF32 9throughither
804,170,762 *536E58702389DCE15AE583B1BB4116AFAF896782 461KAIYA
804,170,763 *5364E4A26C8BC274713C54076907F03A92AAB1B6 9zwartbonte
804,170,764 *536D293C0B2202B8EEC2D088584BC88A3D17ED8B 4.katzive
804,170,765 *536DCD532A368CDAE363293E43C0E92F5042D6F7 a7"zo
804,170,766 *536A1639C518E81DCA81A83B790D749754D3449C }A/AA
804,170,767 *5363E6D99C32437E2EA73CA986A87D742B3B8D31 4TLYTEDIP
804,170,768 *5360F6BE1403786BE240163705B05B22B99FE865 4TPISTOOL
804,170,769 *536E4A1763C8B4C4953056771BA323CC9378ECBC 4TTR4CTI0N5
804,170,770 *536185B3B450C1CF01EBCF2E8FBD38A9E4676F18 4<ur4
804,170,771 *536C8C1469DBA62831C775C727956E68FFCA95B2 AADML
804,170,772 *536AD789F836EFE05D0DD169E150D0512A88945D 5ABAA
804,170,773 *536AD09CEC7F5CFC0DCF6C42A6B8E7F0F027737E aat_7
804,170,774 *536454260DCD8EA4464E6482E6F46974613C6E47 ABEMARACLE
804,170,775 *536FB1E8568E1E7384B03DDF23759699ED77A2D4 abemurrey
804,170,776 *536EB040CF6C375ACAEEC0AE064368928EBFCF90 abk$m
804,170,777 *536E73A389A0E9188A95CE0E0BAD0B54597B3D0A 5TAVERNISESES
804,170,778 *53678C11F3F10F3B04A0B5FC29728C802065536A 5THATBAMBOO
804,170,779 *536A2C53F092DD5E842FB8DCA00364BB8231B982 5YMOTOTSYCOTCORP
804,170,780 *53658CE6D9B27395238D1DB35673B62E4A86AEC8 607lindsay
804,170,781 *5362C53A39DD1769636117FA68FC8F59F1DBF005 649186 hinta.on.260.mk./.vuosikerta.ja.j
804,170,782 *5361DF754484290AADBCBE430086E75793906365 6: 6 -# -& CHILDPROOF
804,170,783 *536F2E939812BD7601F9888F2DA32E06DA96CA0A 683marquis
804,170,784 *536841CE1FC2B5A588228F3400E33EE743310C18 AEWBTGY
804,170,785 *5369FAD5DB2266E250207E9545D0418DA1A4BE0F AGOR1
804,170,786 *5364E7D7BACD119268F8C5DE3E24969CEBA29F75 [email protected]
804,170,787 *536673FC95FBB636C7648106AABE4C455285B192 6NOV1509
804,170,788 *53655F79397B224637B843E835EC674E287934A5 ALECSITLER
804,170,789 *536CB0B41CB36F631D2C227F99D100FAC75008C9 6TECHNICKOEKONOMICKY
804,170,790 *5368917AE4C8C52FDDE3D65B17A650A1FDDCE8AF 6tenacity
804,170,791 *536FB7500332268A8379AAE51CC450102B79D2D1 6WIDDRIM
804,170,792 *536B4E863232C39D6DF68BDB025C6BC37EFB4FB3 777592 istatistiksel analiz spss 50 programi ile yapildi
804,170,793 *536B0D76447D117C8EBB4A10DB856D5ADBA13C92 785giovanna
804,170,794 *536E5E8D9294BCD84FE4E78BE1BEB15BE75517D1 ALTONUMBRIGHT
804,170,795 *5362D034BF50370537B2537B1001246CC3E355D4 ANBTRACHT
804,170,796 *536DD082C5BAA3EBFDC923A3F632FCFDAAFD2E03 andreasellers
804,170,797 *536A4C18B5349BDD08124151F10C800CC33D1057 ann-estelle-medouze
804,170,798 *536ED012C7F64BF082BD2C80B89FDEAFC90178FE ANQN$
804,170,799 *536572509A054A372D9CD0EEBB5F3977C1146C51 7POLYNEURITICPSYCHOSIS
804,170,800 *536826A1DE702F5FE4EDAEB6960D89C8C9E4E58B 7quarterstaff
804,170,801 *536D04FDCF6673282782E0EB6B7FD5577E75214F ANTHROPOCLIMATOLOGYANTHROPOCLIMATOLOGY
804,170,802 *53606607C39289F9170D01D968E93051C68D9E53 7rengainerait
804,170,803 *536D922B52112F63D082462AFDC72FD89E67BBE3 7UNDISLODGED
804,170,804 *536CF3A5C6BC777A3527F428945EDFA75090D870 8ADENMORE
804,170,805 *53628DF643E4A9FB6CC2242168F09DFA2C205811 apq=i
804,170,806 *53630F30D359D5F37D40782EC8A9C2D674C24DF7 8#B~`)O(
804,170,807 *536D0275EC2436B9DEC611E8DEBDF4347E120DC7 AQUEMEQUEDOCONTIGO
804,170,808 *5365320E567F880B5B676B26D4F913844DDB6651 8ISPUOLI
804,170,809 *536A5078F9050C11ACC9C9C0D40CD16BD898190F a%-rn
804,170,810 *5365115BA312EA38B9975BB4565725DBF14C12F3 8MUNABILO
804,170,811 *536D193B5DA15F51264FA88A1093D94068AD7BF6 ASCETICS
804,170,812 *5361C27C1565DC03F20E1353289D6A00DA3A0F9F 8THLMFLR
804,170,813 *536BD53E647D1B726C16D4750EE2911C7080E40C at2lp
804,170,814 *536220054A663047E06AFD89B1D253716F3E54A5 8WGJGIBUP
804,170,815 *53657C29472A427BB422479D9C16DFE24D19F5FC a=ty:
804,170,816 *53646001922DF36220E13613966348F21951F042 au#fm
804,170,817 *53626A9D269D2C5F0207EF74AEC143337FEF1D7E 9A789456123
804,170,818 *536AA536DE323104208530A747542EEF214EB33C auw7f
804,170,819 *536AE5A08AC919F5CF22672A5B506CE734DB82E1 AVERYWOLMA
804,170,820 *536C069C09D4A6731E519A98F8E6EC8EB58D9116 AVOMV
804,170,821 *53680E9FAE185C83A740D3C7E1EA2476AB4D8584 9mypassion4
804,170,822 *5366B3A07FEDDF49F34F8859020A617A02D5B059 9STREINDE
804,170,823 *53640BB36B9FED6E42D1E41F29EA089F49340780 9STYRINGSINSTRUMENTETS
804,170,824 *5364D78643080A5DBD856E6E745E0EFD55FA887C b?4rt
804,170,825 *53639D5B755BBFD4831A8D0196FB2A3B0B3A8100 B:5Q
804,170,826 *536F127F82F1BEEBDF760B6DE91253D9911569B0 A80492
804,170,827 *53617EC4C5E21196452224F08B7469A6B09584B0 ba(_m
804,170,828 *5369D44942789A24D7F015EA1C0F182FD1A8C017 [email protected]
804,170,829 *536529374DB005B4E464703E1F445040FC3ADCFB BARTON.ESTERSON
804,170,830 *53604238A516220C0875FC4940EBCB6FD641AD03 B&A#U
804,170,831 *5365C3E7896D3974426321AF525D6A8814EC69B3 [email protected]
804,170,832 *536535D5B9C1A73A576EFF000D4424670E9389AD A;AM2
804,170,833 *536EB214652B5CAC33C6F931DF2A600A68DB3C5C bdo13
804,170,834 *536E7F17BFD8658D438BB31931C2B687C153D019 ABSCHLUESSBSW4
804,170,835 *536E20E6606DE87CBD6F4A7832E964F4C4AA850A ab;u
804,170,836 *536515DB4F6EDD48D945D13BF79716C4F84B0AC7 BEEMER62
804,170,837 *53685A0DE9155FCB560B3B5215FBD87894C3C136 bengaliens
804,170,838 *5361C23C7995403BEBF174B99E50AF8F2E74C828 BENJAMIN.FISICHELLA
804,170,839 *5366ACE8A2D441ECCC558723FFCDDC9E49D3F7E6 ac#"d
804,170,840 *5363087AD1FF5963C4BE6BD98762474E7C55DB0E ACSELRADED
804,170,841 *53600CB387CE855D8ECE27ACAE761F3475B26DB7 BERRYKOSSAK
804,170,842 *536B8CFCABDCEBD4D5BBEED0ED15801495947613 ADDJS
804,170,843 *536B44DF47D628C9D34422DB35A5D8940E9E0AF4 bge)_
804,170,844 *536AF726D6F39F59058174FB71CC29E1A73DB638 A GASOLINE HERO
804,170,845 *5361AB090392E195F50014C9F3DAB44667B2507C AI?F/
804,170,846 *53681009E192A0A0476C9FDBEEBDFCD92005C1D5 ailibarim
804,170,847 *536EAB8A8E4EEC87CC35F71791DE2941B3D4CDB3 AL9,E
804,170,848 *536B55EFB6644F5D64791F6F3F25E1A32158E017 bornaient1
804,170,849 *5366E20FD1829DC61AA7631AD67438F556F848DD A,LHP
804,170,850 *53693C858BBDEA0C9E04D78FE893737D8323D6E7 bradfeuerborn
804,170,851 *536C93EF90A4B92032B45C54FE18B7068B323F70 ALTI=
804,170,852 *536A25FA12C55602CECAE21EF27C9CB98240E514 ÄLVDALSSAGAN
804,170,853 *536BD0DE047CAA2B8D1BADFD2F4F5D11435B18EC [email protected]
804,170,854 *536D4AD65497E4DF67DA9F5E009339F29541CF75 AMPHIBOLA3
804,170,855 *5360E68B5924BE15DFE6D35A6D4B994BBC3329BC BRIAN.KREMPASKY
804,170,856 *536FCD97965AC6CB3E3122C7B332DC3B337F1256 BROKEN-RADIO-NO-1
804,170,857 *5366976AF7C9F8E3E9F36046406945D68E928E34 BRONA BYRNE
804,170,858 *536B0D090FBE4B3B0AD3EF78ABB841748C644A39 ANDRES.FESENBEK
804,170,859 *53639C832854041013DD9746061EAD390EE0E6D2 ANDY.BARNS
804,170,860 *536846203ADC6497C3338E65BFEABA82B0C7AA7C ANGELO.RAMBERG
804,170,861 *536EAD87B33245711D2E43EAD0AFB2E68440FD1F ANGG.
804,170,862 *5365A955CD884B8CB7C73CC00E5C711F750778EB btjuq
804,170,863 *536CFE21904D82817746D482A3912D2BC6433DC5 buckwaggett
804,170,864 *536BCE901A273357571C3276CC05CCFE0BA35405 buddychop
804,170,865 *53607BC9CF9E7BCC42C618A9B883285D1F44E188 ao:
804,170,866 *5360FF02FA7D555A857FD017DA2D49F720A8B4CB b(w3(
804,170,867 *5361DEA4E75306AEDDE0376DCE31F597207139EA ark#!
804,170,868 *536933169DE57DC15CED54FD609C7841D1CAB927 arnoldkeib
804,170,869 *536AFCA76AB2BDD2D576175715168D2C10554DD0 ARRMCVMA
804,170,870 *536F60F4A6191F4F74DE696EAB017DC415CB57EC ASAEAGLES
804,170,871 *536E796FAC6B470CFC8617C8979F232E886CEF26 ASCETICS
804,170,872 *53657669FA350634283E790DDBAF68BDCEB09F58 a:sk
804,170,873 *53670C25BA3A417303DDCC9B29171D3137B7D4F6 c5kk%
804,170,874 *53662E1C0DF4441E3AB3F8BDA40CCBB3D0B0A404 B3457LY
804,170,875 *5364E1CDBC4DC1B4DBC8CDBFBC196E959B0628A4 b%5sq
804,170,876 *5362447EC4F61C6C9323EBEE0F0BDE77424D2453 CARLOAMASON
804,170,877 *536AB0FF058567163F88E4BEC69E5011D7F13B64 B/6+H
804,170,878 *5364A19BF4B463DC2576C7BD742078B79F069DD8 b8u+_
804,170,879 *5366FED5BFB56A0C2DC9A3B6F4DFE06D7E9A4F8A [email protected]
804,170,880 *53631311E6DE93C4DF87AF5EA105C59C38F68874 bad+t
804,170,881 *536560F32D20FEE722F1F511A5BC52E308B261BF [email protected]
804,170,882 *5363CFCA1AE34B9EFAD47A7B63FA9C4598C572A6 BARUKU
804,170,883 *5366D6386DE5B56198DCF3C7185BBBC538E41DCF b_cpt
804,170,884 *5363CDEC0152D1769E47C3BC483A9FF585FFC494 be a valid password on every machine surveyed.
804,170,885 *536D74AC0D1B4358E369BEF094B8720B28DD6FD2 CHALKSTONY
804,170,886 *536E9794EB3AAAF49242BAF7DFA8806BB76BC6E1 BEF.2
804,170,887 *5366478AA15EA39ADD9C5E9D2801A646211C0EBF BENNIEFULLENWIDER
804,170,888 *536D2B91DB6C22FDDC106E7555C2A64A5C4E9864 cheelaifong
804,170,889 *536901FDBE918D92298DB29DAB9AE6D0A6CD8DA7 BERNIE05
804,170,890 *5367B59E215F9C2FCA01364961D98DEC71A9C583 BESIDE(EDIT)
804,170,891 *536506DEC5704737AD3706A37ADB7224D7D45F7E CHITCHATTER
804,170,892 *5367DD0C5A47731BD436F2BDF073FC5BFF160643 bhcrr
804,170,893 *5367F26E009AFE8B39DE9267AE1F375EF4619CE8 christos.gr
804,170,894 *536AC47B9364495F2444638A608BCB2B56D8EA3D BIERVILT8
804,170,895 *536E08D2C1D1271EB7F2E39A2DC5E526446013D2 C,HZT
804,170,896 *5360139457119CB4AC866DC610F0F9549F8DE3F9 CILP
804,170,897 *536A9EDC28119BAD63C6AE12BA8F7E8A879BB6F2 [email protected]
804,170,898 *5367DC6583F6271C0E58B5EF6FAB35262C8E5FE7 ciratratati
804,170,899 *5363B72A243342EC729F2D4F9A35B5A161178BDC ck!0k
804,170,900 *53656E73CC91C861FCCA0AFF9A3DC05FE98B44D5 cl3,?
804,170,901 *53629B7678C2CD4FC3F18769B1E5517C4F09DAF5 bko(-
804,170,902 *5368A21611E977E24DB78F80C5581758FADB01AE claudstary
804,170,903 *5364016C7A98FD825B7462277D68227C928DAB78 BLAKENORIE
804,170,904 *536C9F0FF172FE8489511F60361EABF4A00775E3 clqqo
804,170,905 *536D8AD318AFD9C807186B5DDF9B8D268F56D0D8 colin-hedley
804,170,906 *5364C893FAEF05A916D806101ECD901FF765069F cominciati2
804,170,907 *53604B6380821F5E37DED6C030019F70B4CDE2E0 cottageintheglenn
804,170,908 *5369A2B06015BAF14615869B3F7D7CD5369E4416 BO!M&
804,170,909 *5361F457F2F35927FD60926D5C51A295AF12CD9E bosf)
804,170,910 *536D2961BB8BAC7B885A164C2D806DF2778D1C34 bqh/u
804,170,911 *53682A9102AA5A34182020CED3A33EB50315BF8A BREITZSP
804,170,912 *536EF866288693ACE24C5C61FD2E2A702142D845 BRITANDBEYONCE'S
804,170,913 *536E9B17A166A0E8490BDC4913F6F3C03E3A92A4 cursore5
804,170,914 *5368AB6EC71AA0F4B1D4CC8408C3915C8F6C9533 czerb
804,170,915 *536A618C3B3D6D5B4A284B9698E776C091BBBFCE DALLAS.COTTON
804,170,916 *53689AD03BDA09E1E8D35698663148E87338BF52 BRYAN-BRAYBOY
804,170,917 *536AD5977A1419D54B47C65158E32AFAFD7563AA DALTONARNESEN
804,170,918 *536329C0BEBC8648965FEEB75433908C9CF6D390 DAMIANPESSOA
804,170,919 *5363061944711B71F3CF90A5A0DA67CDF17BD32A damienmurray
804,170,920 *536E05E09402468BA92EB6BF3B46EF53E9D2CEF9 damnify
804,170,921 *5363AF11D0D90757F1B3EF4F16F25CE614A664E2 DANAABERNATHY
804,170,922 *536570E5CFBBEB2EA04E8819B0DA5506ABCF2070 BtMP
804,170,923 *5365511927E43800BB89F9F7E0A106FF29F3FAF2 BTS/
804,170,924 *5360BAF1B67A90AD163C2BB351C767C5960D51F0 darenredus
804,170,925 *536D25BA44CDB36AB33BF19757CEF2E668356408 DARIUSWRIGHTSEL
804,170,926 *536B05373440FDFA464CD1D853D0DE11B0B001E5 B)!UN
804,170,927 *536C4E2FC0B3FD8267F13E22C335E3841565F929 DARRONTAINTER
804,170,928 *53656C2DC15A2321AF9BD1DDC3F15C3AB9060FD4 darrylsollers
804,170,929 *536898429B2127632A90110272B6365EFD0287C7 but.it's.a.five.o'clock.world.when.the.whistle.blows
804,170,930 *536AD717737636ED07F8563609EB817D0D281977 BUT-REMEMBER-KEEP-YOUR-HAND-AT-THE-LEVEL-OF-YOUR-EYES
804,170,931 *53646EA43FE4E9AD3AF50A8FF28BE301944A0E8A B.UY2
804,170,932 *5361650234BD83F7F0761EEC6FD60648A0A87F96 BWQL.
804,170,933 *536982F4D938FC2CE77A67D74B137288A31D0724 dd-ee
804,170,934 *5369C1A311DFD2FC91EF55AD5AC628ED0B61FFE7 c=29l
804,170,935 *536F9CAB2812E36A0A401D23DA84FE40D87D568A DECLINERS?
804,170,936 *53650B45FE284D203EA4FA00A748EA0B4627D02A DELESSEV2
804,170,937 *536BB820A2C7AFFAEBC5AC7D40CD2E3BC66ED5F5 C821009
804,170,938 *53601E70A881E48EAAEBF8F95DE28258F37FD474 CABY_
804,170,939 *536DDF8A57C3DE13E2008487C3FF226FC6612C86 can't.run.but
804,170,940 *5369C66B564CF9AF48B66755F62A00F82FE383E6 Captivating-Dub
804,170,941 *536CF7235CB464DE0991AAA54E70B247BC32EA0C CAREY.HILDESHEIM
804,170,942 *53694D56F4A1FD36B7711785BEB3EB7B1A7E7B60 carltonsalines
804,170,943 *5364A2A5DC1F1B4715E364EEDDE23BE98B2FECC9 carminedehetre
804,170,944 *5367AAA94839669336E69429296A559C391E6A9B carolinaalabama
804,170,945 *53636832A59CD782649C147811FFAB6CD16C9F1C CC6A
804,170,946 *536A1B7D8DDC1DB6180CF03647B5B8C13CA7544E dh=ft
804,170,947 *536EF7CD95600EC6AAFEADFF99CCCC4C8D913727 dierlijk.
804,170,948 *5369885FE75A6EA73E86815DA1F60577D86516A5 CEO3Y
804,170,949 *536351DE7163D44434BF503DAD17419FACED2CC1 CEYLONITE.
804,170,950 *53647393DBBD3CFEDB8C919736DCBFAD0D7463E6 CGRRC
804,170,951 *536929A903C7763D595EB59C29F62F2A7DB8E84C DMDOSI
804,170,952 *53683718F0FE60DC1B9E50BC6396BB61EEB7503E DNATTFIT1
804,170,953 *5364489E94BCDEF98D8BE439F8DD776E237E9DDF dnb_p
804,170,954 *53672F535A8FF94E752C98FE6076C8A097FE84E8 DODJUDGESBIOSHENLEY
804,170,955 *536A8030D92EE3867A5ABA4C890F5D0FBEDAE580 DON'TGETANYBETTER
804,170,956 *53680FF050F78E76E62D327C7D0465B24360C79A dospelymi
804,170,957 *5364FFEBD1E73D30D4EBBE2FA99CBC1478503BB9 doublepi5
804,170,958 *536CDEE9E8E37906547C5F5E09108FA79FEF4368 christinejayson
804,170,959 *536DDE6276D98E9FC7F93790D580D37E09574A83 cht:
804,170,960 *5368F7956BF45CAAA6C60C8992C348FADED316A9 DUANE ELMS
804,170,961 *536FCE2A671EA5133BB56F8257BA3CA0914EDD94 DUQSN
804,170,962 *53682BAF625343B81FBCF1AF6A1BE226A4D08901 COMMANDERSCHNUFF
804,170,963 *53690789424020B89D7C82CC430C1E386110EE00 D,W_
804,170,964 *53630C41B73259922787B54AF8EF9E27F7DB46A9 DWAYNE.CHADICK
804,170,965 *536F3C21A8D9FE4FFD4B453EB180FBFDD2ADE110 concaf
804,170,966 *5362D3A0EDECEFEF526542FF64508E46CCEBAF49 [email protected]
804,170,967 *5360529ABFC4B8A378E140A33819A136F2C7D6AA confidino3
804,170,968 *536B7BA9210229615C2345A5508062166FB7A163 corbin633
804,170,969 *536C91FD5C719F8B46E85B2E9DAED11951E2C455 EDDIEHATTAWAY
804,170,970 *536AA297AF4A1039F88AC5CE61E27787F5E7CADE eddiekosa
804,170,971 *53696AD43CE64025B8C80A597554E414497B5B4C CPAPU
804,170,972 *536859F04F28BA52AF70BEE74316C5413357235E cpo.e
804,170,973 *536E8C62CD9DF4B5782442BFA0AB23F86797EE2D EDN2H
804,170,974 *5369C60CE79AD0A633275118CF15EDE0C269BA9D C:\PROGRAM.FILES\MICROSOFT.VISUAL.STUDIO.9.0\VC\CE\ATLMFC\LIB\X86\UAFXCWD.LIB
804,170,975 *536FEC79F85F6A725B469AE09A0D09AB202CE5F8 EFRAIN.LAICHE
804,170,976 *536C3E24DAEEDE2E6F5FB9D0D6411FD6873A1472 CRO4U
804,170,977 *53669179A51E743825FF04BE21CB4C9AD6570C74 [email protected]
804,170,978 *536071A6A112B8C31CBFC770190FAB207059A4B1 CURTISOBESO
804,170,979 *536A4241AE699EF06001B43485509579BB3915E1 cu)yx
804,170,980 *536E4728EAD08F197D748BF9D56634211CE8FFD5 ellsworthsickle
804,170,981 *5368B48445E4228CB2186EF6B1F0F6ADDEB4E89B elroywickliff
804,170,982 *53680594BD431E7231B5B993FC1F149BD7FC6D77 ELTON.DANEHY
804,170,983 *53692F6404EF29C1911A0CE90A8EE3316B6B3AD2 cylqpmm
804,170,984 *536D768E997BFE108E6A92B9D268B070101A4034 CY;M+
804,170,985 *5363E68238B13388FB0F0635A9EC1B66545150F8 EMILI HUGUET I SERRATACO
804,170,986 *5368D61DC063CE1E2B9125A0375F878C1485FDED emmanuelgolias
804,170,987 *536059AAB2EAB51733FE9D6B162314149D93E155 EMMAROWNTREE
804,170,988 *53671E39DF3C74AF4ADBA2257CF87C1281846697 D1B#R
804,170,989 *536925C2608CFB2A2BA6587ABD84DE11FF20F25C d5oen
804,170,990 *536E7CC3D6ED35D22FAF35C54AE867A6F41DCFDF d()8n
804,170,991 *5368B02641696C9D6145C4973F29AC02601703FA dafqs
804,170,992 *53650E7BC5276C6EB19FCF7F8506C6AFEA8FC67D [email protected]
804,170,993 *536BDB7EDC8EE5649F19ECE8396AEAC083B08867 damienmoles
804,170,994 *536848757E57F10C865AC43A54E240A828499E8C ERÍXESE
804,170,995 *5369406E999D696DCB1CC82210818024E0215EAE DANE.DEMERY
804,170,996 *5367A8A5E4DF8CE340F4ED6AE619939687F9FA5A DAN.HAZLITT
804,170,997 *5361418B3F7C024E283218E7DF2072498F266185 DARON.QUAIL
804,170,998 *536AD7DF5A80D5E85D5E66A85910A198D788FF8E ETHALITY1
804,170,999 *5360031675DE9E7E5CA6EB84D567251AF612F58B darronkoltz
804,171,000 *53616CA7CFA59208465ADAFD4EA3F6A6425EACC3 etsialap1
804,171,001 *5363BBB418FF00596503D4F32E60FFCFF7FE75F2 eum3
804,171,002 *5367B01D807BA235E4765D6A99C283C38F89A88B D-DBP
804,171,003 *536A38458596B364AAF6D72C8DC140F4CEBA5925 [email protected]!5h35
804,171,004 *536AC456270CF3A63ED5C96B26E2BF1C7CFF473D FÅGELFRÖNS
804,171,005 *536DF3B4603918D6E8F48B6CC9C98AC24C7BD65D DEAN答應了
804,171,006 *5369FC3DB7E301982C76608B14D80EF9F28A120E faustinoairth
804,171,007 *536E753499E9E80094D2B257D7B492BBB98BB588 DEMETRIUSPAYSEUR
804,171,008 *536AFFF0720384CFB106EBE043E7E66CF86A270B FAYBURN4
804,171,009 *53691F46E93B9DFD5F4D7504D81D3E2EBF37A0E4 FERDY HALIM
804,171,010 *5364E314E2BDCEB25E6759BB1D10C3C61BCF7552 fernandokastman
804,171,011 *536BC301E3A9AD2FA86F9D6B800037DD80C20FF9 DENVERTRACHTENBERG
804,171,012 *536D7E7F6DF7ABE34F9FFD2D2F1FD8F34F6F33A8 DEPREDATES9
804,171,013 *5361F62949D8CB35215121FCEC00A50B92ED66F8 design1a2b3c
804,171,014 *53661BBA72242A4BAD7599310BB4600EC5F42A95 five.song.(song.of.five).(mcsleazy.remix)
804,171,015 *53658C52F2FDA8590D8E7FFFD17653CE6E948261 dfpo$
804,171,016 *5366CFD6BACC0F69FAE413628F64EAC540562864 dgg&u
804,171,017 *53663C51010FFE352612D56E50C228604597CAC3 franklinlebeda
804,171,018 *536B767AFD4EDB5621B400B567D7ABC4BFC57271 DIMV3
804,171,019 *53656CCC33BFA74CB970289F68D2991F3B3B5219 FR-D
804,171,020 *536C35F26A41FC2AE629A01D3CBC06AC26A83CAF FREDGRAMES
804,171,021 *536CCEC1BA38C74561888DA3CD25B01142851581 FREDRICKABEB
804,171,022 *5365181760C671CE68FDAC2241FC62BD559C3044 freemanyorty
804,171,023 *536E9D4EE23A49C30C9A46220E4E2CA92613A546 [email protected]
804,171,024 *536B08D3F4112B2F2F15C71FC38C173E22F5A93A FRONY
804,171,025 *53686F345005B6D0D96C7A18A8E466B8CC965D67 [email protected]
804,171,026 *536DBB1091C5F290F21748ADB42A7F69AC3A0567 G$A
804,171,027 *5369A0691F463E522285B208C772A189AD793696 DOMINGOVANN
804,171,028 *536E391CB6A6143AC7FB8687A03C955DC346F1A2 [email protected]
804,171,029 *53696F78C91BEF3A423541C45C0213732C28366B DONNIE.GRUBBS
804,171,030 *53617433900FBAEAA38E8D1BA4E6491C89DAA665 GLENNFIMBRES
804,171,031 *536F9B9E3647543E447FE823DCA3954FAAAE4160 glycrxd4
804,171,032 *536FC934C25D6FA6E26932EB4C5E3661024812E3 [email protected]
804,171,033 *536DF3C305A8E7B0BC46905DF3D1321908FF122D 「doubt
804,171,034 *5362E597B8CEF384488E6D25D23D5879D8F612DD gradydepinto
804,171,035 *536FCDBC69E00AB2DB612E6D060C3D79F9972F74 GRAHAMNOWACKI
804,171,036 *536D34768B917D789B119F941CA5881B875B4081 DP/WH
804,171,037 *5367ADF8F816AEC62F412121BC46562F065BF507 GREIG-CUMMING
804,171,038 *53660B494B24F554D449EAD05231E16E4AB612B8 DQZO
804,171,039 *53625C396538E17D896BA0073BB30261B91A2EBC GROVER.UNO
804,171,040 *5365354B2D0D158FE002491F21C4EB48711987DD DR$QE
804,171,041 *536F8929CF1BE4907879A8A1CCFE43E15D8C29C8 guillermominassian
804,171,042 *536D1151228200F0F8E653AB9FDB3DE1702E455D GUNNKIDD
804,171,043 *536CE117DF40A05DF1AF201EEF47CE60C91D752D GX4Z
804,171,044 *53604AD3AB7D0D7BFEF11CFCD2AED34F39015FD7 <H2><aNaMe="HDR83326">83auDiTDaTaReTeNTioN</a></H2>
804,171,045 *53690156DDF3B0BA67D53DA1663CD0F5B1C258D2 Hafed-benteftifa
804,171,046 *536753B2A008E93D1F6EC4E3EDF63F83CCF6AB40 HAL.ABELARDO
804,171,047 *536349A870CF86B6671B9C56C50173D5EE9C6D43 HALIMATUN ABDULLAH
804,171,048 *5368B8E1EFD5C3DECCD958A706C110754B35AB63 halmellie
804,171,049 *536EB40A33F1FDC5713C37DDD0580FE3D4CA4307 [email protected]
804,171,050 *536474921A64848D548FD82DABEB25EF26F3F172 HANDSAWS
804,171,051 *536FD0E6A9E70557E4343BEDAA2FE8DF8A2002ED DUNCAN.KINDE
804,171,052 *53683733AF06FA0B768244382A5ABF625F5D1182 DUNCANLAMOTT
804,171,053 *5365CBA077149E24940451BDE73B8B271306F76E [email protected]
804,171,054 *5362D88EFF0B60E24ACF785A9262F3C5360B9790 dunks..d.ah1.ng.k.s
804,171,055 *536EB275939C3BDAB5C2532EBCF163E6188F3BC9 DÜNYAGENÇTEN
804,171,056 *5366D3756CA4919A32BBDD7B622AB4D7A1883902 happy.dayz
804,171,057 *536B6B1722429E3D22ADF762F488BC92F71A76B3 HARISBEGIC
804,171,058 *5364535968D01F530C0BC80F623EB8F91F8F22ED haroldweglarz
804,171,059 *536502AAF41BD406149052D83A1398D5EB8DE45C HAUL-OVER-THE-COALS
804,171,060 *53608E675D2EA3DA9BDAA98D0A02DC68786628EB [email protected]
804,171,061 *536BF9C4185FEAFF424DB0861E56E36C2F756228 HERSHEL.CAUTILLO
804,171,062 *5360494DAE9CAC03B44AB3C0067B4CABC2E966A1 H{I
804,171,063 *53681F31B3E87D17C6E454E1BC73F6B8641CAB98 DWRLT
804,171,064 *536CACF1CE5E4735388C21274A0D2CE8CD881BB0 HOBERTGOOLIA
804,171,065 *536E126CAD1FBFBD1DDE3DC22DB5C5212516ECBD [email protected]
804,171,066 *536BC9C063119209EF948E897C4DEC0E0B51199C HOEGGER4
804,171,067 *536C6DB9B84F662F32E72D1451AFD0CDECED308C e0]r
804,171,068 *53694994DE9D77C5AF4C3E309424B204ECC5540F easa0
804,171,069 *5368E6C60A308A099C36C5EC90440DA6697AC044 HOUSTONSPERLE
804,171,070 *5364DBB09B609B4B2F951DFEAE85E9EFCA18E5D4 ecg"l
804,171,071 *536911C9C8A3EC1EEAA3766CF5AAA3B31C10D862 HTTPMYDALLIANCE.COML
804,171,072 *536E6EA91054AFCA808CFE23E6F30C9190A931E7 EDHC
804,171,073 *53608D2558D627812CD9F092621B10535B658637 HUBALWORSHIP
804,171,074 *53631623435FDF3E0002991CD3C0390D8202B8D7 huracan-josephine
804,171,075 *5369CA29D941972F38752B7596B1AFA3E1CEEFF9 HWALDMAN
804,171,076 *5369598E8729ED00B95048DD0F976ACD5F5A86E3 HWILFRIDEG
804,171,077 *53663DF59CDEDAA369E23DACCEEDAE2B27412EE7 [email protected]
804,171,078 *5368DF48292A1CA1048592B339AB12ACA3AB0DF8 IARENNOITULOS
804,171,079 *5362D355D050119D469DD4A6B3D2E57DE056DEF3 IDALINAJOSE
804,171,080 *5363607EF558A2E87ADDA92CE9FB2956B9CE725A elmofingar
804,171,081 *536C1313BD1DCBD3866026791913CB3A318CC3DF ELOYCOHICK
804,171,082 *536ECA1DF1880749A2F0A69F68B82FF26ACA1300 IKSWEZRA8
804,171,083 *536B1CC0FEF17D69F95BCC2ECBEC4E9506B86A69 EMILE BARRY
804,171,084 *536C378819F6081263E6BAB536B95C4FA99C8F06 emmettgrudzien
804,171,085 *5368354D2E52B785E314861A8688B16DAE59D2ED emmettpunter
804,171,086 *5365EC5152C57A68CDAFA08511EA6921915B049E IMEINOTTING
804,171,087 *536CFF293CCF6D80ADEF501681077A6FF9BEED32 enitnevafing
804,171,088 *536C19CDCED8AA48AD00B1F4E88C4401E7D1B115 in.a.bother
804,171,089 *5367B73D7612FD4659568C81412A9A4E2BC23101 INDUSTRIADORAS123
804,171,090 *536248DD62AD875B50A8BAD3A99D84D2CDEDAA6B EPTQ&
804,171,091 *536B4B51BB4D160E8C9FEE0A0B4D683CE3D40B9A INTERN41ITY
804,171,092 *53660EE65B195423544A9C7AC5EC9446A588611F isnomeanhappinesstherefore,tobeseatedinthe
804,171,093 *536132A968CAEF9C8743B9B37ADB3794E5C5E712 eslievering
804,171,094 *536A513196F994F019405184CA2E400D9FEF2133 IVORY.ACAL
804,171,095 *5363D9D1FD40B6E4E795FF03311E93A052233027 ETSKLOVE?
804,171,096 *536C9BBBC72497FA69688CA34613F61CFBA8194D jacksonlinzy
804,171,097 *5363522926F1DAED3832A4420F377EB2D664CDC5 eu*t
804,171,098 *536F1B1994A643523CBBDC49C64116A78F1BCD00 evamichael
804,171,099 *536FCA35F6C7EB1DE219B0FEA37BC8571DEDC09B EZEKIEL.GALLAHAN
804,171,100 *5367B6BE8A072CEF9F3DAA886D3D478715544E80 JANEYGAR84
804,171,101 *536DC1558F720BC8484B9263EF546250FCF53E36 [email protected]
804,171,102 *536ECC4113C2ADEB5564390063E49BF03E3F0694 JEAN_DE_LA_ROCHETAIL
804,171,103 *536FF92522D466AE732AF68C217E24F3B14EE67B JEDI-GRZYB.PL
804,171,104 *536E0454AF595936C0731A5632ECF99EBBA435D9 JEFFREY WARDLOW
804,171,105 *536EB12C13BA7F54F1528692D41FA24F629132A4 JEFFRYDROOK
804,171,106 *536D083A62F5C7FB56DA4860F63F6CC5E3A5CFBF JEFFRYHERZER
804,171,107 *5368B117FC00FBEF022A7E2F743F882527E991CA jerrellpiszczatowski
804,171,108 *5364361210769E29D2B86D7D1721B8DCCC463E75 JESSE.RONHAAR
804,171,109 *536653C5E2521442DFDDA0F025107296BA2ABF42 [email protected]
804,171,110 *5367EBA6C2B81E5C8218401DBB0DFAB7B848D50F jesuspetr
804,171,111 *53671FDBD1FB681DC5702EDCD35C8E98515827C3 [email protected]
804,171,112 *536249AD803E23E73FB0A5F465BB753657ECB528 FI2}
804,171,113 *536AF74BC3C1161FB01AF0267BBDE6B3921D0B9A JFROZENA
804,171,114 *5367A3DD2361458966DA47EC3935F42AF85DD0E9 FICEREDE1
804,171,115 *53694E177C994E635EB82CF7292F43A49D570E67 FITNESS145
804,171,116 *536B52C847D6B627719583F6CBDF452BCDADB71D johnsongalang
804,171,117 *53642B73D27C943031B9975E5C6DDC1D5B2ABCDC jonahybarbo
804,171,118 *536A78881582431BF61D414F476394EADFB0E96B FLORSTAB
804,171,119 *53634DAB570F8D5012299536B026D6A88715578F JOSIAHSUDER
804,171,120 *5366AD44B49406BD2A6E0399DAD6706856E528EB [email protected]
804,171,121 *536DAC602368FD85B4B42DDC53B7C95A07844372 jrlizel
804,171,122 *536D5189FB5B4917D19F92AF2B74D6A9DAC543C4 FORMEIKA
804,171,123 *5365949B6F5B5B79F85E825C913250F28849A983 FOSTERAHRENT
804,171,124 *536C670146A77EA400B5D97E8365209F2876B5D9 FOSTEROLIVERAS
804,171,125 *536923B4787537B2A417468EAECE45BC45D0CF0E fostervickers
804,171,126 *536BB37CA1E7158523C41A95A1976AA2EC1E5E20 fotorobot-ubica-zugica-i-raspopovica--i-dalje-stoji-u-fioci
804,171,127 *5362A8F748D3FF464C97B3F5F175B70A1C483BB3 FRANCESCOBINGERT
804,171,128 *536B621E31F9173D20F36B3C3E73708A24C7F84A justindoepke
804,171,129 *53604139A8CA570D5B556A80E19240F3A54F2915 [email protected]
804,171,130 *53644CCA15DB0D320E38FB3F7D46E623A6759808 FRANKIE.LEITTEN
804,171,131 *53666ECF063AFAA59C6F5FB92F8D007CF8E3272F *;>#K
804,171,132 *5366593E5969673417D0329435ED87B7B61C09DF K17P11S4
804,171,133 *53676813943F2A80D0FA08584D1623E7D36370EC fri++3r3r
804,171,134 *536E70D95267C4CBF236AF66ACFCC837D9BB1B81 [email protected]
804,171,135 *53689B7DD5B97B6BA219313C0E8D754719A52BF0 karisha123
804,171,136 *536016517B1407D3A4F08A045B107A380874DD30 fuy31p
804,171,137 *5363A74DBB8499754B43A991A33F442800735481 [email protected]
804,171,138 *536E39C9E098B29944ECA8F2DA47A453768C5B62 kelvinhemann
804,171,139 *5367C415D82D78D3BFE620E0AF7CA2EA113D7EB4 GARRET.ARRENDELL
804,171,140 *53654A2E5FE9E974A9BE81EE79BE5A7D0808C4FA KENNY.KILGOUR
804,171,141 *536B08C7F77306183D4AC414C2EB35951F839E38 KERKBEST0
804,171,142 *5369445ADD64135FFA8FFA098509EF5C8A11A56C GAYETY
804,171,143 *536CFF12C149034C92AF9403C5D8BCC19F424CCD [email protected]
804,171,144 *53660A90FCC6D346031BB294BFE31ED6E4441B2C gbstrdrd9
804,171,145 *536015779CC18E3B2C70BB8D3E880AEC6F8F84FD KHAMSAWATIJ
804,171,146 *53631E3C52278C374546A0069563A563E3DC675B GENARO.DYLE
804,171,147 *53637D9C04253A9FAD5EC23651C20BDFBDFF1C4D GENIEßERKUCHEN
804,171,148 *536E9427998E3C1459DFCB4022A8F3E6CF6C2BAA kiss-ass14
804,171,149 *5368A0A7096A71474656CA8AB68A80AEEFCAA579 k|=k
804,171,150 *536876050864753B0E851A5D57A93A0CE9E84AC2 GET-DOWN-WID-YO-BAD-SELF
804,171,151 *5367EA5339BAE7F2B33D4E5CD5A7A5481BAE3DA5 G+|L
804,171,152 *536689B761FB5828FD0FD1CE3432DD6D4DCF20BA GNITSAFED
804,171,153 *5369CA39E52433BCE1E7538416DECC919F129EBB [email protected]
804,171,154 *536D042F3E7A0CC02D6FF1D03C5885332E658F35 KRISTENPENELOPE
804,171,155 *536B515ADD7BD1BCE64CAF00591E097C1DA169AA KUPASAS
804,171,156 *536D37BE77FA3F07EF901B3743F769C480C827B0 LAMONT.WINNE
804,171,157 *5360DC5D7BCDFCEAD5D3C249C1715C74C5884007 landonantonsen
804,171,158 *53652A0158342476DC62416B242FBC910F1EFE36 laninger
804,171,159 *536578D0469E3B3E1A3F5A1C8C137FF153654BE6 LAUREN.HYATT
804,171,160 *5363F7235230E93362873135E062FEA226B80409 leannewhitcomb
804,171,161 *5366A7DA6564B3E2361BE20637F6F8176DE06859 LENNYGONSIEWSKI
804,171,162 *536419471C1EFD5134007C39F2ABA714F534A191 LENNY.STREAT
804,171,163 *5365484BD9E4D3F765975C11EC556E8F213ADF8E LESTREL3
804,171,164 *536E193FAA2A5CAC20AA90560D6054532A00F707 LEXIJACKSON
804,171,165 *53631E361ACCEC16A5CEA0A04720D6BE591E34CE librarie7
804,171,166 *53660678C1521D1CEA19148C7FD2A29BCF949F5D [email protected]
804,171,167 *5365AF5517323893F8AC8BF244E7D62C450E9D64 GUILLERMOHUSLANDER
804,171,168 *536CB511E6DE4192114F6DC10B39C600AE8779C4 GuiltyofBeingWhite
804,171,169 *53617800B899AEBE0E96355B0DF0A8E7D8EC31E0 h+6m
804,171,170 *53614B1275B8784A67611014D3AD5EC4C6374825 longprevot
804,171,171 *5369DF0D8B3DEB098AD9108C1A31109F89D90D18 lonnycomrey
804,171,172 *5365DFE7438BCA97A43403312BCF91A0800262A7 Loom-of-Desire
804,171,173 *5369CAC785265BA1A841DFA5716E1D7E1945BBD2 HASSAN.GAVER
804,171,174 *53619BB09B19A273A288442A50E7DF31200592AC LORNA-LUMANLAN
804,171,175 *536954954FB89C74A0F252D74E3B3C0DC3D34274 HAVELESS1
804,171,176 *536436FD6B5E46DEC34C9EC2859579D610C09789 HDECK HAND
804,171,177 *536AFA29E12AC69677A70F19131F98C3A1714EDE headoverheels(9)
804,171,178 *53662F2457120308FB939991CBE5B807CB330109 LUCIO.ARDREY
804,171,179 *536A8FB319091B730C840EE123D93633C1A60237 [email protected]
804,171,180 *536DE46EF35E0966798265DBFA00F97A7A85DCC2 [email protected]
804,171,181 *5365D7CCDE42ED17C7D2A6F5C4A15200A23AA185 [email protected]
804,171,182 *5362D177736485519B4D5827C31D713F48A3F4A5 lustres
804,171,183 *536C815A58FFB82E00C4FEAED46BC455F4D3BC36 [email protected]
804,171,184 *5365AD04DC6A39862258CB804ADCCF4721F23A66 MACDOOGER
804,171,185 *536B6082EC001B3FDBB3C603264107B0331289CB HIERAKISKE
804,171,186 *536E8A57774AC6E7AE8DDBDAE8852DAD5F918282 [email protected]
804,171,187 *5361EFB5E1BE51F9AF4CE6D7639157BBCD4CDC40 MANSIBABBAR
804,171,188 *536DCBC9952575F58E89BB4C03BCF361D298881F manumits5
804,171,189 *5363159F03682B2DA89F6ACF67C783946319B2B8 march1865
804,171,190 *53662A94DF3DCF6548259FF25EC2BE2D6215DC39 [email protected]
804,171,191 *536CD97F42131B5A2DEBB651E873DE5EA6A8E819 HPOSITIONAL-NOTATION
804,171,192 *53612DFB6098FD4D06B485F2571E807E1EC08188 hq|6
804,171,193 *536442AD26254EF0EE3199E63752DD10F2EB5ED9 HSTHSURH1
804,171,194 *5368929A326DDE5FA64460D6195F2FF7C3EC64BB httpwwwcambridge200
804,171,195 *536B166D1F71A43F2063A9B9266C6CB7DEB8EC96 hugoskultety
804,171,196 *536D10B6C85735CE08AC0419E11B5D7597AEB330 MARIATRAINOR
804,171,197 *536A484B1E14D6D987EC3D23D4934207AE92B95E hxl(
804,171,198 *5363232E3AAE28258C128AF5C331D5111D3C22B6 MARY-ROLAND
804,171,199 *536A757A18CAA838992FDBF1E3275E2576F037D0 MATT GLENDE
804,171,200 *5369185FFE43AC9400B1FD68DC87DF16D2656A81 maximohilgers
804,171,201 *536F269612E3BDC9501F31FFB2EBFBF8A2CCA1D4 maxwellkahanaoi
804,171,202 *536B39E884A76A4B2E1111AACD5429329E4EF902 ierlijsting
804,171,203 *536BD5E4439DF1E8053079CA7448DDA5077D7878 ih1;
804,171,204 *5362398B7E5FD56DC01F18AF6EA33E5C5D9AF5A2 [email protected]
804,171,205 *536A0453A295BBF0C6DC91099E2D946297E28F33 melvinhardter
804,171,206 *53611E85060CB51B066AC020524AF5BD06629E3B menswetenskap
804,171,207 *536E69DAEB561B283E059D087F3FC187D4E95F2D MICAHKUJAWA
804,171,208 *536CFE418E22CA63C5BA3820EEF70A823937089D MICAH.OKEEFFE
804,171,209 *5363F0A310C7D0EE98007F6DD925B9BA0D737EF7 INACCENTUATION1
804,171,210 *53632CCA6396EA9941DE5E64284CA04206263578 i$ni
804,171,211 *5361815A25FD73270B1C779BA76D8249E8ACCCA8 mi~l
804,171,212 *536F822254FC9E1BC67B977D8F8346C564F20B99 MILFORD.RUUSKA
804,171,213 *536C72A817101D49B22FC731CA14751AAADAAAD9 interlude.(the.pharmacy)
804,171,214 *536194A00F3179C535BC24316464F1DE312AC8A1 INTERVISSEISLHE
804,171,215 *536601D0AAACACB7F64D34EE520CC55847E0BFBD intro our love
804,171,216 *5366E5EB5AB5E279332325F874A505F6A60AD955 mitch.lavergne
804,171,217 *53698124C5A05191F94A161D2F937787BEE4A0CF ismaelmcgeough
804,171,218 *536D9A24F9B9A4104CCA56009D381F1730D153D3 isongeds5
804,171,219 *5362D29A7F3EC2924FA4D3FFAC0C9008F0EEF7A0 MODALITEITEN3
804,171,220 *536C474F9C5D868D23EE7734C5CB2FDEB81EEBB7 JACINTOROTHHAUPT
804,171,221 *53609A5C1B0EC895324172BBBACF3EDB1F2C0DA9 Jackpot.City
804,171,222 *53638C182CE647569DDFA5C8B2A44753B0CFC67B jamarschinkel
804,171,223 *536FBC93BB5F868042478A99D2DE8C7A6829DB71 MOISES.KITAMURA
804,171,224 *536CFC22BDA7ED7643D558151CD4C4B36FDC26AA MOLHARÁS
804,171,225 *53642D9CAF97B939488BE7446A6B4EF0E326BEB4 JAMI LUCAS
804,171,226 *536A29BF8FA7F4A1D28D4ED22B2D0087441D21F8 JANIKANGAS
804,171,227 *536DDA9DA0F9C3BC0EF0DC1284D95D5691D1592A [email protected]
804,171,228 *536F8B2BCD7CFF87621E215988B6B24E9F0D8D02 jcxrui9nammp
804,171,229 *536411FB69C8E4930415B72B499455178CEAB8AA mosenotte
804,171,230 *53664A9E384397CD767D73E05FCDC822517A040C MOSHE.OPDAHL
804,171,231 *53617E276FC0312A21B3C9F348625E73D346E89F JENNY.PUNO
804,171,232 *536376CF82356622B311638423EF13602A902856 jeromykeever
804,171,233 *53682FC989AA9CBAD8C94319BCFE4F1F235BC2A0 JEROMYSEWALD
804,171,234 *5364D057FAF57675871462516EE98AD85623CFDE jessisles
804,171,235 *536E3ADF2B53597988E2EB270B886152EFD697A3 JESUS160P
804,171,236 *5365C254E01183198EB3166A369AB4A9A4507F8A [email protected]
804,171,237 *536D5C1CD21FC15C0CA8F145268FF5C09EEA9C04 MUST.BE.A.DREAM
804,171,238 *536F0848671C25A19D2E0FC11FD773C9A55733B0 mutanzas2
804,171,239 *536C9BB02E8BDA8B0B53484D0E33B7BA8FC49384 my')
804,171,240 *536BDE658832C342F37C6C7B4601DAE0FCAEC911 JOEBERKS
804,171,241 *536A5F10F42777C35EEF7E5998C51DE94020019A JOELVOTH
804,171,242 *536E7521B74F7DC3696719BA8AD6B5B6CEADBD99 joesphtabian
804,171,243 *536E7CA056318F7363BB03F6C7A9519E5587A9AE [email protected]
804,171,244 *536F874B026AA5E2FE04F0E77CCABDCCB4EF9EF4 john.arrington
804,171,245 *53625C49214D49CC6083EECEDE49A16E9D213CB3 JONGENSKOORVANDEZEEUWSEKOORSCHOOLGOES
804,171,246 *53684A92FC4D12E633F1CF169153B738CBE0FDA5 josej
804,171,247 *5362918298DB224801ACD9D259CF41FA834427BC [email protected]
804,171,248 *53696C283404C532BD8A03F784DF63A710C7610A niknuphta
804,171,249 *5369EEC3591A33E97A5BA1CAF20719DDC5F4F992 [email protected]
804,171,250 *536CF1E1DBD545B81560EE4C75FF88CB6DE1ED02 NNCRRLTV5
804,171,251 *5364F9509A689EAD44077AB592162EA3B6132D61 NONANONITA
804,171,252 *53686C01E718A338BD4F03005AC3570204813295 [email protected]
804,171,253 *536E90EE207CDF3AB25F71A0A6BABB8793D82638 NOTHINS9
804,171,254 *536A1BE01E60FAAAE055B0C8C89CA361C93FA608 NSRESULT
804,171,255 *536F57EFE9EDE1597B03DD9C48B1023C656BCC01 kellycrilly
804,171,256 *5362F33A23277BBCAB4A6FA7D1CC883D1C9D1049 KELLYTONING
804,171,257 *536B2BF11346CCD82698CBD6D7D43E04E4C18235 (^_~)-O~-(#8
804,171,258 *53629A58B8953C1F621DC166E829A24D4F1400AF kerrykerins
804,171,259 *53642C6F70CCB4EDE8653D3D1464759971613570 keshaellis
804,171,260 *536D61D615F128C9CB1EEEA69F0FFBD04150D412 k]i!
804,171,261 *536C02D8259748F1FDA6FE372F3969947E9301A3 [email protected]######8
804,171,262 *53619B1893025C96CDA74EF3A8D8BD01C32A9C11 (o_-)~-`-q-----3
804,171,263 *536B8F4A9E996CE2BC67F547780953ACEF921673 }o{~q###B
804,171,264 *536EE770D785B1BDBBCCA1419B107249AB162947 KULDIP MANAK
804,171,265 *53687D66C90C794F52FC4117DD218261E9F5D42C KUMMERLY-3-0
804,171,266 *5366115022340837E7DB2F6F4144F6098D5030D7 KUTSDNOM9
804,171,267 *53640357B2CAE0DE4770451993A73AEBAA7014CA oswaldopen
804,171,268 *536901585DAF76F897441CE4CB2876C6170EF5C4 l>4
804,171,269 *5369B2DDC95AEAECC063E769D176706BFF541B43 LANCE.SQUITIERI
804,171,270 *5369D7BE52BDF0FAFEAE6D7BBDDCCB916F564919 p###>`~(0_<)
804,171,271 *5367AAFC25E8457764C5E504895950C8A256B916 LAS HISTORIAS MAS BONITAS
804,171,272 *536026E8E16AEC486D2EA526BA70CDD2C2DF7E58 padmanie7
804,171,273 *536AB6AB95FEA454625320071AE46644C5C676C7 LEE.SHARKEY
804,171,274 *536E7B4A445A2887F468A914603F9983326A8F45 par-taking
804,171,275 *536CA8C26466689DAB543B1DAA95841054ABF72E PATRICK.SLATTERY
804,171,276 *536E3065AE88227FB6234D903F69A1E7ACCBF47A PAULIAT
804,171,277 *536BC37BDC26055E9A665A25486A791FD9CA2AB2 LEON.TIERMAN
804,171,278 *536F260F0949F90FE6E31C8B3B4F216A7D96BDA2 LESHASSEY
804,171,279 *5364A5547AE255BCCA0558A7C58F12BA183E1E43 lesliechalmers
804,171,280 *536DB13D8527349069C76E062A853D8E628C9AD0 p=b.*splat
804,171,281 *5363C48D7121EB236E340F339825D241E3D9FA15 pd~o.(~_^)
804,171,282 *5364FE8BFCA0B20334BB5FDBF7582C08FF2E824D lif
804,171,283 *536A4C22EFFB8F311B417485CF0E59AFBD52A800 peteystrat
804,171,284 *536BEFFC312951A6A7DCC01941E5F5DBCADB3E2C lindsayslavin
804,171,285 *536225A8A971E2A7B39AF2AB7B67FCDF36CE694C LINEBACKER“
804,171,286 *53621159E5AB3D292F432D5E783E9ADAFB4451C9 PIANOSONATANO62INE-FLATMAJOR,HOBXVI:52-IALLEGRO
804,171,287 *5366BDB3BEF4E8A6DD477B4B731E3640B4DCB9E7 piantoses
804,171,288 *536E402689483A0D18EFCA18447911C379F3C233 piratensiedlung
804,171,289 *5367E74F144C025CA1DC8C28973378B8AF11D26A LON.SINSTACK
804,171,290 *536E73F5ABFAF7CC5F202AE45316FD0BC3B0EC44 Look,.I.wouldn't.trust.Harriet.Harman's.political.judgement.
804,171,291 *5366C4C3E0B4411C6B01E936A95C3731963EAC37 P#####@~~o->-<
804,171,292 *536BCDA6E96CF4F39B28F32994F14A9462BC80CA POOJA.GROVER
804,171,293 *536A720CFC2FC777FDC2D9DCD85E33E27082227A POPRUHY2
804,171,294 *536EDE16254AFB4C4E56422B23AEDE098F10D9E7 LSZRYF
804,171,295 *536EBF7DB8B36B10AA732EE81D744B4DEE19C24F Pp.`~.)o(
804,171,296 *536DA762EE87075DC9194122BAC539D86212880A [email protected]
804,171,297 *53627A5D3E1A3C5C51F26E4162C2DF1504CE4D07 PRECOGNITION
804,171,298 *536E6CD151356AB89AD1E5C3C323841DC03215C9 M143567
804,171,299 *536AE1F9C05D18D772F9DD672FD1CD677B811876 PRESVU
804,171,300 *536A2AA8DBC2F33FDE4B2E4510F0B357A9D6C35C m4111ots
804,171,301 *5367C6A1881EE1CF3F40854A906349EF2B4A0CEE mahasam0
804,171,302 *536C1952E1CD446D19F73E521D2196C16EB60C26 prvenstveno1
804,171,303 *536DAC2825A77BB650ECF61E6A51A19C38D6299F MANUAL-DA-FUTILIDADE
804,171,304 *53674F97A44074FB2B139C523CDA4A0D48FA2875 manuela-frei
804,171,305 *536F238E138E672475DEB48BC8B94A1179B8512E MAPPAMUNDIETYMOLOGIES
804,171,306 *53655ABCFD7CB3418DEE00F1BCF226E41CC80438 MARCUS.NOTTAGE
804,171,307 *536D42870D1E3508306584244407680501482BB1 QENA4YSY
804,171,308 *5362B2C2EF20B8612C8193988A6AB87AA904D2EB MARIANO.ARENDALE
804,171,309 *536A3E87C1BEEBBA361DF6B505883E0F18252749 (>_<).*.*Q=====Q
804,171,310 *536FFD23F1ACEEC3D225D96A3C902CB9A9600774 QU33N3R
804,171,311 *53698E69D59E1F4D6AE7C062961CB8CEC4257937 quav3r3d
804,171,312 *5363EAC9BB392EBB411C4A7E1B499865E83FDA4C QUINNBISCOCHO
804,171,313 *536F6CBB501C8EEA2F791445CBFA14BFF64B8A68 quinnblaszak
804,171,314 *53605E672E3963BF66561944F379B124577C6D62 marvinjennings
804,171,315 *536BF6A08AADEE7673750FEB8268FA5195E0BB6F q\x
804,171,316 *536515BF688E93BEBA65AC3BA2F4889F1B1A0018 r3n0vat!ng
804,171,317 *53689D8A589CE33D4BC637F3FA82227008CF3EE3 rachel.sherman
804,171,318 *536A1730EAE18ABBBBE789087182A3D388331B97 [email protected]
804,171,319 *5363D5BB04210D9874CAB54ADD683EA29A9ADE4F medföljer
804,171,320 *536AAF12A2C52956ADFEC2F18F0E79EBC6F246ED MERCEDESLEECH
804,171,321 *536EF3D3A13B685270D689E79C5B3E1AA4B3BACC merocipon
804,171,322 *53679AB93F4FAA9FBF9CA2D2DC9A799EBA9F0DEB REBILLIONTEDEL3
804,171,323 *5364EA04C612FFCE85E5B47C047BDC6BC7B1B1F1 recorded
804,171,324 *536C961A45ECC15ACA210417E1F010ECC0714F71 RENALDOCUNNIFF
804,171,325 *53671156780A1BC544DC2A96C20A2A031F6F9475 MILO.BARANSKY
804,171,326 *536C3757401324A9CC0A570AED5A9D69AAB3A28F [email protected]
804,171,327 *5368FEFFA2919DA40D1587244088E53469E2AB15 MINISTERIPAIKAT
804,171,328 *536C0390967A606BA74AD116C21D6CB1801CF43C MISSAN
804,171,329 *53688BC66C85DBBB3D7B12F8F4AA85CDF20E0FF7 RHNGRV
804,171,330 *536E4C740019C9B0AFAF55CCE81452F4F4094961 MNAZARE3
804,171,331 *53639B3891189987A424AEC3C2E5318FDABE9AFD ricomorphy
804,171,332 *536C7452F13666B08A8624F6476EEFF16D027702 RICOMPOSEROS
804,171,333 *536BB1FC59AAC61C22DAC350D131FAF8036B8665 RIGHT.KNOWING
804,171,334 *53695026AC360F2A0084AEEB9AA71600EFB4A722 RIGOBERTO.ARAMBURO
804,171,335 *5366C70B06001BE3A2161F9A8CE0B1F557069560 risonerai
804,171,336 *5368C4749BB719551E63863F8E1A9ED95759D222 MOSESIFEANYI
804,171,337 *5361D0FB0FD305C34AB68ACFF32E3631EDB34AB4 ROBTDENFIP
804,171,338 *53687701CB5C9F93B6C4C50F10CED946ED034354 muggles?
804,171,339 *53668D7AF9DEA54087622A91877C3425AEFD7D6A roger norris
804,171,340 *5366A3F5123826D39F7515A300C726E8AC950EFB MUTUALFUND
804,171,341 *536A51471544544F1A6DF14A6F0A59D4707D03AA MYARIANE
804,171,342 *5362A32F33BFEB608D11FD98697D89966CACD794 RONALDTORONTO
804,171,343 *5363E2D3E03E1E305D375F453A22023E829BC89A ROOHREVN6
804,171,344 *53667A9DAF9BA4C68AA587A148EA1033DF6E97E3 ROOSTERSES9
804,171,345 *5369CD369930413C968D97161FE70C0694C947A2 RORYKILLINS
804,171,346 *536BAE1A577CD99ED6A2F52FC26E842F4D5BAFD5 N27= SCRIPT PROTECTION
804,171,347 *536BEDB75A5557AAC81FBC35001AD1444231A3EA NANCY-RUPPERT
804,171,348 *53612ECF9F16074E18DC291334F544FCDE70FFCD rssj
804,171,349 *536DD0FC6C0A65089EA4B93A34CEAAF39DFF800D RUDKOT1234
804,171,350 *5367496D7A76D4D004F215AD9FE26096F159C52F NATHANIALOSTERDYK
804,171,351 *5365E39F28EF1E8E2B0F49DA9C785FB79EDDBDF1 RUSSIREZED
804,171,352 *5360FD4431B0371C5D47F13BD389E2EF547AD606 RZARCZUK
804,171,353 *5368BD1A9EE03138265D21AB47E4D9E4E8F48B94 SAAFEORT2
804,171,354 *536D80DFE28E323817D4CE92F315CBCA0CD7CD3C saint-maurice-pres-crocq
804,171,355 *5364436494B4C0814E0B7BE5E1D706E70975740B nez.novillo
804,171,356 *536A93AFA0F2AF061471DC4557A1F4067D13A679 NHARCY
804,171,357 *5366A379AD1E218CF0A5C2211602D13238111AD5 niceldeon
804,171,358 *536CB0BC21CB5AD64C0E5CC408DF32152D29922E NICOBARTAUBE
804,171,359 *5366D1FB575882994C548187AF1EC5462AE9C489 samueldolese
804,171,360 *536ABA6DB71E4C61B8CE6C7158130C846A372706 [email protected]
804,171,361 *5364A0DDBA91C1112640BB7B8E47FF2D0E26C585 NINE-TO-THE-UNIVERSE-(1969-05-22)
804,171,362 *5364689FC879029635B4E97FBA5F8F08D6BCEE67 nirnberger
804,171,363 *536FF5B416F9F5D925E888BA5DC1A77B0D9B1980 NJODZI.GASVA
804,171,364 *536E1E72C881762C2259831F5EBAC79BEF005A0A SAVAOTAK1
804,171,365 *5367FC123D2653813BAE3D31EF63A9D22FD75215 nonb3n3vo
804,171,366 *536A988410742F0A0AE8E6EBCF0BF812C4B1F174 NORRIS.RHOAD
804,171,367 *536EE3F379A3C0612801B4E128EA58ED2F5F7A4B NOUGA+
804,171,368 *5369DBB4F8D68E3D36842E6008E400D6AACA7545 scottludeke
804,171,369 *536CAF2188B203F01529A96F54AC23C581B60750 SCOTTYMONSTER
804,171,370 *5364DAE6C5B259D94F43AAABBEDA4EB3B2B60A49 SEALSIMAGES
804,171,371 *536C747AFA7D304656448502F0AB9F23D5791E5D SEDANINGGED
804,171,372 *536DFC0DFE4C89BC92E7C7D180D1F308C9A9CC0D [email protected]
804,171,373 *5365FEA9E3F2862CD7A264D5D6CEF11850F4B3C8 (O_-)~.~D#####8
804,171,374 *53603B1F1D495DAD7F5F9E63DF09D81AE4EB2C91 odikkor4
804,171,375 *5365D8B1E9FEA03CC522738125562B8CB93542EC ODPIRAMO
804,171,376 *5360D4565E884EFD04877F7E64776240F2657024 of.cleanly.habits
804,171,377 *536F588481E24AE8A3ACB89D19A9E8450A11EB09 SFORTHENEWWAVERE-SYNCSTYLE)
804,171,378 *53657ED774B7198AB04BFF560009754AD76F61E5 sharamh
804,171,379 *53664AACF78DE8E52E8854CF622E11ABA865E8F6 SHAWN.HAMLEY
804,171,380 *536BD7C90B935F16AACEC30A3BF3D6E54910895E SHAWNPORTER0
804,171,381 *536FA3C5EA5C1FAD6DDB6B960F3137DED09ADE7E SHEESHKABOB
804,171,382 *536F926DF7B35440705AEEABA9C11E673B0C819B SHELINSKYBSW7
804,171,383 *53615E2FCA6955671BBAC4A2C50D00B41616344E (O_-)O~O~<-----B
804,171,384 *536074F722C772162079E2E19DDF7FFF7468AC96 shonkindschuh
804,171,385 *536A789FF6CCF0E28FFCE8EAEFE6EC872346FD21 shtyo
804,171,386 *536DCC16686A65B66F48B17E268357CA2A14DE01 OTEMUJ
804,171,387 *5368ABBADDFAAD683BB029263A1CA317E8ACF3FF OTISGOODSELL
804,171,388 *536C27B6BAE37B1727B6D35F366D0994F227AF14 SILENT-SUBMERSION.COMWWW
804,171,389 *536062E779DD6082D5CD12D46CA11BAF4F938304 SINTNNEKRETSBLES
804,171,390 *5362052EF934BDDB29F3770D9D4F16ED624E1316 [email protected]
804,171,391 *536ACA689AF9470527DE23F88A46777565E905FA p###)~0-~o-splat!
804,171,392 *5366D47004278CDB68C3A8826A54629A87218A9E SLAVES (NIC ENDO MIX)
804,171,393 *5367E25D6E9EA74428645C3CE1F2A32A4C9E22F7 PARASTI.P
804,171,394 *5366DA22AC024C308E301F199F9FCB2967AC3FF9 snq_
804,171,395 *5360CA17CAE5D57E0777F907CE44C6F1C96E6222 patteou
804,171,396 *5364AC121D36EC084E797E4F30A7759617648B32 p-b-~o)0(
804,171,397 *53658BEC7A4B40FA9AA2BC2263AB08396101D47D [email protected]
804,171,398 *5362A286CEC9040AB7628CF07B7A3F41AFBEF770 [email protected]
804,171,399 *536D95F35AE67346653E6F55D65AC12BFFE63699 PENELOTE4
804,171,400 *536C6D3C6B9FE9649E37B4562AA8E5BFAF587E30 PERALTOSING
804,171,401 *536E082786B612A4CFD84C39E3214DD05C595BEE perryprotel
804,171,402 *5361C07CDB56A7EC50F5DCB8FF4C2E04EF0EE9FA P&G*
804,171,403 *5364FB3DADC2DFE8E9DB490CE29E0D7304998EFA Phoenixsu
804,171,404 *5360B2D3220CFF48A197559CFD272A18BB2B97BA PITCHCLIFFCLIMAXCLOUD
804,171,405 *536AE0B8A7B8A0A615B76029EFB01A1D10458380 SSELHCEEPSING
804,171,406 *53626DE7F35D636407E5E55AE919B07D8E1543AB SSGYPTLTD./SSSZNC.|GYPT
804,171,407 *53640240B3B06421A35F485208AADEC0D907974C SSI-PATAK
804,171,408 *536AF8A912457AE838FC4644449EAB709AAADF4F polyptyques
804,171,409 *5364D2B361746C67B9386484957E32FBE6A5EEE9 STEPHAN.CLENDENNEN
804,171,410 *536DB8924930C16B53B6650EFCECD23C94B63803 stephanguhl
804,171,411 *536B4726DF84048BE36E3029E69905ADF2EA61C0 PPEGELSER
804,171,412 *536F31651989B890CDFE1904C20728F2E3A95CDA p######p.~o~o(0-0)
804,171,413 *536C2B1E16B5040E8544F1E32E482B355F4A5A55 stolevaj5
804,171,414 *536B61566C9568B2FADDF2D2CBD59F32F9F84BAE PRIMORE1
804,171,415 *536B3C1B69950C9A1CB4C65BDEBB27AF29A3DBA5 protegulum.
804,171,416 *536F141B94D3CAA90E854BB3CAAAE400F613D13E q7h0
804,171,417 *53691EF3D730E279246FC9DBC09AB431EC2FAC0D Q##D*-SPLAT
804,171,418 *53699BBBCFEAC86CCDC557BB864626F94C781CC3 SWEETSIGUANING
804,171,419 *5360AFE2ECE40C8CCB04C662037AD29BCBC34FAE QHW7501
804,171,420 *536F295955962CF67AF995419805C998520CD57E QRNYK3JZAIQ
804,171,421 *536ACDA250846FB79FAA0DE86742CBCC103CFC1B szakember-2
804,171,422 *5360FBDD5DC5CB6685DA10202EFE42A9A4602545 QXTZ
804,171,423 *53684FE85161868F895DFCBD9EAE5972D2D5590C [email protected]
804,171,424 *5360E6CEF7403DE6A1F58C04B8ADDE0EE235A621 TASHAJADE
804,171,425 *5367F8F6469AFF3515991EDB1B8B9D19B4CB4BFB T|C`
804,171,426 *53652974C4D265FD2E6A127890CF2497E9B24C21 TEGENGESTELDENS6
804,171,427 *536BE9AE31692E227E8351F0FB986CB141BA99EA Rayberg.Music
804,171,428 *536136FB2B2A00440E7F03533843BCCDA56C5647 TEHOSTUNEET1
804,171,429 *536969E88F08FBC67E2D282C1A4AD2BD14DAA410 tele-forks
804,171,430 *5360F8F81E41F1CF8A2789BB09549D13229A452C RAYMUNDO.COOKSEY
804,171,431 *536F2E07C3B55762873887F28D38A85773624082 [email protected]
804,171,432 *536BCE519E1B85D47DC917645AA71701204B08E4 [email protected]
804,171,433 *5361D8DA4AD54ABE1D376761D0D1234224CCCC42 RE8E11OUS1Y
804,171,434 *53606A2418F72B56F43E638163A1DB29DBF3E66C REBTISSING
804,171,435 *536CAF6F0DDB8572526CA150765B21081791B82A REIDDEFALCO
804,171,436 *5362020978CF2F0701EEA0F17CDEA1E620561A39 reimer r ay1 m er0
804,171,437 *536D925137DBE2AAC36974D1FF49B96F8B1C2ED6 REINTEGRERAED1
804,171,438 *5360D5B305DC43C0E571F02A208EFD9DCD2018CA Remi.Sarrazin.&.Stephane.Joly
804,171,439 *536B786A4592E958C83A0A947BB9F3F42DE35439 RENROCDNS
804,171,440 *536E6807AD81CB8031EADFE8F6C20654A3B4D41E RENTRAS1
804,171,441 *5360A21585795AA1C6150DA90B590C7FED46F749 REYESGAIL
804,171,442 *53634E5FE38170948A1F9223251864153D3773D4 REYSEYMOUR
804,171,443 *536A44BE5A47FDC825576011F5E0B456D34C6242 rickiesuns
804,171,444 *536AE206F10147AF7989F6CABEA9E55CCE2EB02B RICK_KABALA
804,171,445 *536FF928B2E0087D721485AF330C41D744EF4229 THNDRSTNING
804,171,446 *536FC4FD4F50A2DBDBE456FCD8015D6259944E66 THOU-BITTER-SKY
804,171,447 *536FD766D4F81E3977620955D60FCBE4B91B4F93 THUMPERKNIGHTS4
804,171,448 *536C8C03F12D72C879132E317CADF5EC943EED1B THURMAN.STRATTER
804,171,449 *5368745301B6E1122A2202669C2427F2ABF8A11F TI[email protected]
804,171,450 *536A603AF3EA2EDD6C98ECB8D4C5388E466AF95D TIDE_KN.PBBS
804,171,451 *536D6C3800CDDE22362ADE806F1E44386D9C1FB5 rock.land
804,171,452 *53674A7B1A3A4F2F99B94143EC4766CB88166D2C TNEREMIRRA9
804,171,453 *536A13D6E1F50A6D9DFAE0701EC5E1A3E9ECBEF1 TNORELPM9
804,171,454 *53641E728F745387DDF73E061FB42ACF457C3400 rockyreffett
804,171,455 *536262E2B0C277855D71E1786566553F85935CFF TOBIASRETZER
804,171,456 *536A78340141BD5BF9F672ABABB52046FDA40C3A TOBIASRUSCITTI
804,171,457 *53602F1F1E632EE9CFEC96B6155AFB349FB0C762 TODDDEPRIZIO
804,171,458 *53607CCD01833B922865C9D0D30BEA7F196D71AF tollerasse1
804,171,459 *536D433F75F5DB588E1A1E64295C0A6898637BA5 roscoepetralia
804,171,460 *5363969A3260C3554C11561DE639D7A88DC0C698 RROSE987
804,171,461 *5360E768489AE29B4E9D398B24858527A5892886 RUDOLPHFANZO
804,171,462 *536131E2061FB35084813090AFCFED70DCD083D8 TRAVIS TRUMPS
804,171,463 *536EAF5CFD9D916726FDBC65602A67AE49941BBD RUPASENGUPTA
804,171,464 *536A1F236915D5B58414ED78461D57815EB5EAE2 TREYBUBAK
804,171,465 *5366F7A9B6A763A59946B2512C4E00F38AFF1B13 RUTHNEW9
804,171,466 *536814F720AC6D0B854E3703D420135DD8F36363 TROY.NASH.NOVICE
804,171,467 *536D10D72A39A4CB2977DA1B843876B32AF0B1E1 ザ・ニュースtscワイド
804,171,468 *536D1A773DB71079D3C031A9476B6EFCD3235BA7 SALVENT8
804,171,469 *53687DD66A5EB8FC37426F4A9E335D48A16B005B TUBULIN3
804,171,470 *5366E5E4276D09BBFC0B6CD22AB319A7A5EBE760 SANTIAGOMULANEY
804,171,471 *536180441BEAAA94FD754D5C110CE93E9DC71C38 SANTO.TAFLINGER
804,171,472 *536D89128D163B8CCA23F29487F6FE3A01D2FD76 TYLERDINWIDDIE1
804,171,473 *53632A0C393CFB119563808850ABAEB7FD163997 SASS1236
804,171,474 *5369B5EF8E60A98282EB7E95DF6E0541E9179D92 TYRON.HERRAND
804,171,475 *536DCED48756C46F3814E4EF2D54C16EC13859B0 saviorinthedark
804,171,476 *536BE4AFCE6F684E27D5AEC736CA699DCB8CABA7 SCOOBYH5
804,171,477 *536EF0C08B826FED3BA2246C27088474FD656008 [email protected]
804,171,478 *536220F35BC8B213B76763B2BD81034483AD2311 UITKAPPE5
804,171,479 *536A67BBE11161343D1ADAE91613F8413D4F4A95 SCOTJANSSON
804,171,480 *536D51A7092FC2553DEEEB142BF573A5DC7DEF38 ULLERSÄTER
804,171,481 *53656BD7F2B0634BDC032AA2A0E4065721C76AD9 SEANBANDT
804,171,482 *5365D9FE391DD5C02459F40B00A6FFABD81E19E0 SEATTLEMINDY3
804,171,483 *536E376AC2A4FFF055383D48732076A8D387248D UNGIFTEDNESS0
804,171,484 *536CD9398E6D4C99541F4B2B764E5943F28C2D0E Selectivity
804,171,485 *5368E5503823898BA7C7AA84BFAAEDB0366FCA86 unsigned.char.data[test_block_size];
804,171,486 *536EA11256240DF554B1A3371329B3E0BD06AAAA VAARFREMBRUD
804,171,487 *53613D3474C6117DF468F0C8F83082C6E0D83D87 vahid.pourahmary
804,171,488 *536F19904E25BE6B6E1C584E33547BDC5A7F1B4A SHADDIYAH5865
804,171,489 *5369BF3C086F992A29721491FEE751DB04B89353 VALENTINBRANNAM
804,171,490 *536066A7018B701BA905DA3AA4699CD4F0283186 SHANE.SZALAY
804,171,491 *53617E65BC1456B1CABBE4FB60D6B21C141F1A42 vanapha2
804,171,492 *536B0EDB5662AE86BB2FD53D0755A68D45CF185E VANDESSA0
804,171,493 *53680801C66C3816742F375489331AFC823C3085 VERKOAVELIENGSKES
804,171,494 *536460D2943BCCA60402155C87BB5C5C13BC7899 SHE-NEEDS-SPACE-(AND-TIME)
804,171,495 *536D3447CF342C2FB5D5615B9416E58EA3C7572F [email protected]
804,171,496 *5366F7ECF22C2F3C33814D417A369D1FB4C604D9 shilya
804,171,497 *5368FD601D854D61DAECB289C4BFFB0D615198F9 shrinemaiden
804,171,498 *53625346BFB2BB4F79495140485FE8943AF6C09D SICUNDU
804,171,499 *536198A1DA801132DC3ECF4C09AA444EBC01A69A siltfreighted
804,171,500 *53663394C3CBDA26A45F08D3592F5B0F3329C2D7 VOGL14NO
804,171,501 *53661F71F4511B90535A63E72AE466C170671FF3 VOORTS
804,171,502 *5368DF6FE7C275CB285E096C7B95387F58B45522 SKUNDADUKKAM
804,171,503 *536B843851E576F5B089EDC87B9FAA3C7F2B2F06 skydeitybbs
804,171,504 *53681A562C9CE0DB2E5B591A15B255083799C78C waltersonneborn
804,171,505 *536E45C346F4565096228892850EF66EE50421EA [email protected]
804,171,506 *5360C65D5F50ACF1F63D658F73F2FE986D5B99D5 -Wells,-arr.-Gordon
804,171,507 *5365D063603FF6439D783D59901DEA667450F929 WENDELL.WALTHERS
804,171,508 *5361CA7A3C817FFCD09CAF475FC32AB36DCD96BD WeRollin(featTI)
804,171,509 *5368F910DF64EFBF8585E596E4E2112AFA203508 WESMARBACH
804,171,510 *5363414517033E0D0502DFCDD2A408D70556B6DF WILCENT9
804,171,511 *5364AFF7C9AD3ADA0EFF2E7B5952D3ADBFA18543 WILLIECANUP
804,171,512 *5369449458EB5C00FC7AE8449B5B1E9B022BE705 WOHLENHAUSER
804,171,513 *536925D3829D583D84FAAF49DBF9367EBCC16D0A WRACHIT9
804,171,514 *536D8DCA3FD76DED8F15B4FD5937BC9BB23E8BC9 Splato~0~ d######p
804,171,515 *53684CEA25DE89441D3165B55CFBB1C8D1AE47C7 SPRACHAUSWAHLTEMPLATE
804,171,516 *5366CFFF09D92C8B45F7039EEE42CDF4CDECE549 SPUNKYLENNON
804,171,517 *536DBEF910BF850458690BB6C11758FCB1439D24 WSORTUSCRHD8
804,171,518 *536D104FF50D0B6DA5EC4A071A9FEF8BDF6EB345 STAB1E11KE
804,171,519 *53657E886829822ADC8F7C537EF2DA05EFC06A4F wwwoftringench
804,171,520 *5364BA3704018F3095F426AAD0B4C7C543AC7FE9 staceyjanack
804,171,521 *53680C65B1BD0AAAA76680998A12B6A2F4D3917F STANFORDBERNINGER
804,171,522 *536EB0E7A818AD754D0328C0157CD449A04EA5C4 STARKEY7
804,171,523 *53631C87597CFE71A457A13614059F28430BF28F względność
804,171,524 *536E4D618A15C9D489B4D6D5693A0B8480A99E3A STGNSPRM
804,171,525 *536D2D360AD0CD46311C9EF09E832CD3C579A281 stillwatersrundeep(featsupastition)
804,171,526 *536A73EFBB99852EDFCA4240A5887F2674CDD5A6 [email protected]
804,171,527 *5366447861A934D7376B34E266989AEAB81A0817 )X( O~ 0~ @---8
804,171,528 *5366EAE17271B420341DF3BA32EA45F16B1EE5C5 STRYKLAAG8
804,171,529 *536F46481373EBBD3DD618B18650ACDB7492CB83 styrassic
804,171,530 *53635F81940CA37A12E2959C885C2B78A753B247 [email protected]
804,171,531 *536C4C5DF8F57608987863E7B6278EA50A87C7AC subdecurrent
804,171,532 *536EDCB6CA34B7398E67302B1D26DC0E409A2FA3 SUGARMITE6
804,171,533 *53610FFE8DF96FDF7F633B3C8DB867C5D57E37E2 Y77124
804,171,534 *5362C955C6E24EB710B3DA3C9567F5C7E0AB738D SULPHIDATION9
804,171,535 *5361F069D19EC736F28ABDE50D2357883B9FFF43 SUNOHARA7
804,171,536 *536B4DEC4A3611D5FEB9B8904CC7CF5B5A9D7C6F SUR»
804,171,537 *536BCBC1BEB43EB8F3C20B51377410A40C072631 SURSEANCE2
804,171,538 *536C2649E8C30F6FEA2CF5ED3618861C93B2A366 YFOOGEIBMOZ
804,171,539 *5364DA635558927FC3C2602FB0B17AAA9B60A59B ygolov
804,171,540 *536E82A37D8C65D28E3C96B2819022FA27FDBC1D YICHENELLE
804,171,541 *53668012E4005BC74A3BDA2CE11E226138A3575E SYOICHI0
804,171,542 *5367B620336FB515676B2CB2AF5904AB370DA9D6 YLOEJAERVELLE9
804,171,543 *53666CF02FCE72BF3D7DF521CC20D6127E9C2A55 youngercarscomwww
804,171,544 *53641F7E8B26DF862035AE1395A2EE588FBBA439 YOUR.ID
804,171,545 *536A0940AB2CE9EE7FABF6B8D829C485E21DE238 YRUMAMPUK
804,171,546 *5367E52CBF59DB183F7AF4ABBD498581468AEFF6 Y+\T
804,171,547 *53644FC57BA57BFC6A6DF6DA8FA4981320132543 taksonoom
804,171,548 *5369B080CE707F1846806383C2D2DFFDBBBEE4A9 [email protected]
804,171,549 *536A5982394D50AFDB5DA08BF3325FDAFA244F6A YUZEVEZED
804,171,550 *53654AA41A5CD0BACA193FD56B0D0FD49550B1EF zacharygormanous
804,171,551 *536709B50597EF7D55812DABF70112049D587EDF tamponavied
804,171,552 *5367F1F344ED685DB6DCC22D38B9CF9AEB53F864 TAPPIIPPAT
804,171,553 *5363B1EA2E73D6B0F6502A29050285A3AB49A60A zd2a
804,171,554 *5365DE1E7C2D37907D6E25A7A7EC725CF30073B7 zeilenvorschubmagnet4
804,171,555 *536E1B3F3D43CD303F88C588E0D8FB74EBC9C9C4 ZESTIERS
804,171,556 *536D90E57B1BDDB263ADA9D6D232F8A91E45D6AB TENLEADERS
804,171,557 *5361DE3122A0046A5191CF9BAFA88E013A80C93A [email protected]
804,171,558 *53610D3524E6AD3E3849792EE11A61DBDC02F42E tersialoots
804,171,559 *5368716CCE9B092BC5CC8963D29CDC3535849A81 TETREITE
804,171,560 *536489CEE7F3EC8C65765414473AEF5EF1FB2266 ZOKUHATS8
804,171,561 *536A1264DBC2A1EC686DF0BE832512FCD9218B96 THE.BEST.OF.THE.COMPLETE.RCA.VICTOR.RECORDINGS
804,171,562 *536FE14C68FD986204C0D8D073C81BAB2BF4F955 ZURMER
804,171,563 *536156E4C2C8A3DC2C7042966FDB77248ABAC9E3 ΡΙΖΩΜΑΤΙΚΈ
804,171,564 *53670F15A7AC3B626B52F3862BAA5F19DD03C61C therocketsmiths
804,171,565 *53657768B7F24848435ECF7DA194EDC84EF81001 THESMILE102
804,171,566 *53633F91EEDBA73C653CE0CBAF8448B827616C60 [email protected]
804,171,567 *5369FDC2724935951D9DF3289C3ECFCA1D1844A4 thingtotheamericanpeopleiwantyoutolistentomei'm
804,171,568 *536941D4C60E3EC5C2C863C6E4E1912164414359 THISCOLLISION
804,171,569 *536E80DF84BE15851CCC206B3BEC4049AE62BF2F THOMASSLUTZKY
804,171,570 *5363A4475CBF8F78F4F83C374D5B3CA472582D6B КУÇÇИ
804,171,571 *536F94B0E2A207758890FBDE2D42E12F16A48E66 THUNDERBRAIDERING
804,171,572 *53679B6C930C525D598607560B29C0027D938E99 TIMECOQUETDABBLEDALLYDALLY6
804,171,573 *536F2B45C1AAF50D50D7AC5E3B487A26036DA116 НАВАРРСКИМ»
804,171,574 *5366A9FEAB29F753341F09BF949AA2CA6797BCF1 ПОДСОХШУЮ
804,171,575 *536A3219311B803CA0D94FC649427726EA62EBA6 полiцiя
804,171,576 *536E0A72E57698F6B359C4E10B935C2335154719 TOMS2HOT
804,171,577 *536F606B80EEE49372CEB87FA206C2D2B96D3F71 TOUQNMUNENILING
804,171,578 *536EC72F398CF24F79C6B81CC602250CECB9BCE8 TRACEY.BYRAM
804,171,579 *53614DE75B7A7433A343087ADB868008843FDC66 tr!bu1at!ons
804,171,580 *536767C4CA64E9AF79F189AB183933AAB1D76347 tui-travel-to-cancel
804,171,581 *53617D97C0788852007153B81712A03FE2CAD2E7 tup.l4mb
804,171,582 *536EF53B6DB2579962CDC57BFBC612068AF7E0A2 ueberschaetzend
804,171,583 *5360F1318DCAB9179D2B558A7CA63E243E28BC61 ulta
804,171,584 *536AE8607C1EAB4D179D6BA64EE233972793C067 Unit.16.Conversation.(Ex..1)
804,171,585 *536114C3794816E264EAA1392D4CD14AAE6D7E3F unpunishing6
804,171,586 *5360A4CFB056A1BB053D7243F67C22D7B0AD0DAD V3R$IFIK4
804,171,587 *53679BD1381CDAF3796EF2BC8DD699EC330379C9 064C313B8E7198C354BB28E394E16220ISAC
804,171,588 *5363999FE4D5846B292AF7C950D6E13B62981ED1 vengeance.(implant.remix)
804,171,589 *536E30B869ADC14C80C0DB4C768F8A5C5B1EA0EC VERNACIÓ
804,171,590 *536CFE211FF4BB7CEBDAAFE8C85337E66FEF9ED8 verne-wooten
804,171,591 *536A349032A75565C2022BAD6BECC49ACA31D829 VERONICA.CUEVA
804,171,592 *53682A3222E04F153B813C0B7B45AE26110D34D1 VESTITIED
804,171,593 *5368D41D03F4CDB28B42B79518A8603EEDE8225D 11.03.1879
804,171,594 *53641BDA065C5A6273EA2FE9D15C455C75620968 vinmonopolet
804,171,595 *5362394E2A6FD0096F70DEC1A7FD5474FF922741 VIRGILCIRILO
804,171,596 *536B0A27E5A1B4CA4579483A1A93C2603EEE2FD5 vishmajith
804,171,597 *53665F21A9FAC978A1EADE20E42426914845FEEB 1321702 vesitutkimustenlis
804,171,598 *536B07BB6469A3F59B13E6F695723B5620FE3C53 VIVIAN DUGANG
804,171,599 *536CA5A61A8D4B056B76A659B46373D605ED4662 146252 PUPSY-BEBEGI-BOYNUNDAN-YAKALAMIS-.
804,171,600 *536B127865D878FF678D9AD9ACABEB2E0E2102DA VON.MESSEY
804,171,601 *5367BB0E2D9E7C5CF2E3274F68523C74047C32B0 1743428 inlondon,silverfell4centsto$635
804,171,602 *536D364044341D91943A665ECD9069B5804DD672 1794282 " DIESER SCHRANK PASST NICHT HIERHER
804,171,603 *536CAF933A17724C243779024B2443FB9368C9E9 17AUG1786
804,171,604 *5367ABA9260D41A993541C03554FFD0B460E2898 w31tng5
804,171,605 *536E34740DB2DFC9D38E8DE0B23D27E05BF176B6 WAEWDAOM
804,171,606 *53614F336B212F1D2D446351B6F58CDFDC284AC3 WAEWFPQKS
804,171,607 *5365EAD81E2D7E63BF82B5ED92550DD4C6CB7E41 WALDO.HOWDYSHELL
804,171,608 *5367C24EAB2DA2C14657D379256B4B85C1839D74 WALDOREBOLD
804,171,609 *536A9115A216C8CB15D4A8E1B6900A098AB28FD8 waliska
804,171,610 *536577E01E5C1B3BD2BE34CF5CE7CC2679D1A20E wa-tourism-awards
804,171,611 *536F6BCD9F723C7A3825D76BFB1FB4642D727D93 1 AV-LAITTEISIIN
804,171,612 *5364FEF6B592EDDA278516BC215ED0A530368340 WDLW
804,171,613 *53673750E023034099650422D850C39759AC71B6 [email protected]
804,171,614 *536790847093B7223A517B9F962969B5541755A2 [email protected]
804,171,615 *536DCD1B6D59B9F47DC580403A3EB3EB830ED9EB [email protected]
804,171,616 *536B3A61D49AB563629DDCCB9DF621DBAD457E98 [email protected]
804,171,617 *53679BD143C7AF78122E8C865E1534CE80B6DAC6 WENQIWEI
804,171,618 *536B474997D714AD39D470FA2456144239FA6F01 WHEN.YOUR.MIND'S.MADE.UP
804,171,619 *536C52990F830D8A1434F81C97F728741A78A840 1 goldcarpeted
804,171,620 *5362AEB31744A8DB6B5577D0F0F046CCA2427678 1grouperl
804,171,621 *536BDE8D444B62C3D11DBB8B238FEB6D82B839E7 wilfredmastropaolo
804,171,622 *536D0943BF3582DFF731BBCF40677DB1B7CCE993 1-KIRVESM
804,171,623 *53649E20793DE0112C22E5EBCDA7A74EA3F060B7 1MESSIAAKSI
804,171,624 *536FCB6DC67F423E84381146AED8911017A1C075 windowscharlie
804,171,625 *5361527194AF90ED76C3422F68AAE7FDA97AC0AC [email protected]@8111+1E5
804,171,626 *536B6A2701CC295CA5D61A6774F1CDAFA7DCCE45 WIWALL22
804,171,627 *536A45884C35A31B22659883E061F65D3906C496 WNTHANFAA
804,171,628 *536FE3E9272D405E2023FB241640C380B07D28A6 1QX33
804,171,629 *5367D3C86038318D24392C3513A0986F99BDD078 WOODROW.CAVER
804,171,630 *536342AF3700853BB115164BFE45B2F632A78A32 wooten2958
804,171,631 *5368085AA8DF833C566B7851870223EBD766B0D0 [email protected]
804,171,632 *536BEEA8C0680DEEB473F40250D14740E01C3E1B WWJD69
804,171,633 *5367BE6815833DA9DB6A2D89448FD4C9DC41B4D4 1.tramaera
804,171,634 *53615E5D5ACE091944B1200B01C9C2CDA7494A42 W^X4
804,171,635 *536BA8159BC28AD005FC22665C497C63749C992D 1VIKANE
804,171,636 *536BF2ECEB2C0A32065C2F97D2E479020E7F2A2E [email protected]
804,171,637 *536FA47BD0C37C648FBB72EAD484D9EA39798F3F 20except
804,171,638 *5363A7965EC0E11C9D4D88E7BC79B5242B71A6A1 2166959 ".do.you.need.holding.?.".asked.director.tony.wharmby..
804,171,639 *53652E5E93941FD964F77E979AD84B99B1820BB9 [email protected]
804,171,640 *5366A64F8306D94B6D8C0B32C8305518C5E41A7E [email protected]
804,171,641 *53685A00A60237B954F14E62C635D3CE55C5C7B3 22LONA
804,171,642 *53606A1B4E1532A8C250D10C99747BA0566D6EA9 xuefpxtg8
804,171,643 *5362C2EBA1AA4366B26B1808BB17515FA496D980 yamilette.rincon
804,171,644 *536EBB27E3835D491CA1DB66A67DFDF6095C15DA [email protected]
804,171,645 *53638777B940CF986D14812844114AFD25C55486 YELLOW.ROSE.OF.BROOKLYN
804,171,646 *5364839829B466B763CC66DB0ECCBA042A5B46B3 yhteydessn
804,171,647 *5367084E4718ABF6F231EEEC6C44AE32E5023AFE YINGYONGCHENGXUJIEKOU
804,171,648 *5362DD7E00945BB96B599D82DB209726E5A0CD0B [email protected]
804,171,649 *536FF1EFCE2CA9D8CC526B6B021A7996FED24C84 29111348
804,171,650 *53625F4452B5594BE4D459EED4F166C105C2DFAB [email protected]@710N$
804,171,651 *536777F238A4ABDD977EE96A08DC5DCB0B66077C YLNAHKILEV
804,171,652 *53680BD5F74ED3BBF62E85530F64C9F8A7E00915 2-bayme
804,171,653 *536F0CA3C0F54D15FF2BD408AD1F0373B926903E 2BREDOUILLEMENTS
804,171,654 *536B0A3CEE90EB664D5C4C894D9A257E12510A6D 2.detailhandelsbranche
804,171,655 *5363929FD734EA0573FBA915C2328A04BC7D041C YONIT HARARY MENDOZA
804,171,656 *536D157EE07E6572A01482FD0E897C61C203F98B 2ELSQUAT
804,171,657 *536BFE388C3FA4383B41DF6E62427223859281C5 [email protected]
804,171,658 *5360A03498900EF68348C8AD4C006AD0F030E305 [email protected]
804,171,659 *536799722241D2361E7F9E3C7B30FC34521CEB06 2-kartoitustarkkuus
804,171,660 *536964DC7CD747097A7106B29AAB64A540E215A1 [email protected]
804,171,661 *5361EF98C3515BA8A9E34064D770864E1A9D3C63 2-LIIKENNEV
804,171,662 *536358E155EA727E0BD7A711E1889C16161B7F91 2.street-but
804,171,663 *5368E18A14DC21AC5D427AC450F3A721E8DDD50B ZADEINXAXC
804,171,664 *536D7C1108BF7B1B5965D565B1F042766AABF1DE 2thatwww5
804,171,665 *536913201B7AB19F42526C33104EB9FBD9B93B33 zakrivljenih
804,171,666 *536D0B13DA08660F8D11CFD6BED5C9782B856464 ZEIN-NOER-PUTRA-NASUTION
804,171,667 *5362F1C064E7DFF062D8C979442CD44DC4B6DC77 333746 TATSAECHLICHSINDES0,27PROZENT
804,171,668 *5361B7E8418ADAB55300E58D6618A5E6FB9DEEEC 348224 luokkaa-on-sanottu-my
804,171,669 *53630B96149DB8D433D8B70815C95266C4E88F05 zemz
804,171,670 *53600E5355B4AC92768BE8B67FDD1BA9E4F9A344 38lawrentz
804,171,671 *536B6D0FF5ABB3CFFEE2F8484395DB2C72F6C0E0 [email protected]
804,171,672 *53621AA853AB599611AF900B68CB5689F35B3A28 3-B***~0~o(>_0)
804,171,673 *5367B37CCA46D48BBAD90E04663370BE2BDC4228 [email protected]
804,171,674 *536AD0A4614CCA22BF001A34203EE593FB72E783 ziek.m.c.'s
804,171,675 *5361E0FDB8F79D70409E31DD6D8B20D403F9B6BA ZOHRE.RN
804,171,676 *536155F8BF0AEC584FA6253E1E13B0DCAEA57D9D 3NATIONS12
804,171,677 *536EAC0E2E58CDCB1E9DBDC7F910E012F251F6E0 3#p~0 splat
804,171,678 *536F42D7299E453A736AB7950843E0043C673827 аббоси
804,171,679 *5367689767C95A477BCFCE39E2E07F0C8902F1BF АРАГОНИЮ
804,171,680 *5360BB07986B0739BB959D7DF52DBC2024C78BE1 БАГДАСАРЯНОМ
804,171,681 *5366448BF5B3B8844B951BBBDD0A087AE5A09BF1 ВОЗИЛИМА
804,171,682 *536B24EBAA13C0C78D742A1EB1EB8D1F04B224C7 кнютанж
804,171,683 *5361E073E0368E269B377BC4349087E0410E9654 4LL3NCOM
804,171,684 *536F557106ED0079CC1772749F580F57A229D723 4MONOPOLYLINDSAY
804,171,685 *53629692D66F2CB695937B2E17523D4137458E51 4MONTANASPIRIT
804,171,686 *536950580B374B7513C90018516396C3231A0AA9 4PAYTASH
804,171,687 *53612FE1E203FC4979723EF5774BB97C6849DF60 перетревоживать
804,171,688 *5362F5D2FD2DE2E951B30D5485EAF6B9CAD87756 4SANONUTMIELISTELEMAEAEN
804,171,689 *536E86225468D5CD29D18FF9FDFDDA6A367F2E1D савинама
804,171,690 *5364F2E2A72C8765485A476F04E5F9605AD6526E 4thetransit3
804,171,691 *5361A9BFBFDB0518E1E79919B412FEDC3FC52E39 4YMMRTVISEM
804,171,692 *536A1BA99EC10463514DC84E05DA15013EAC73BF ЧЕВЕР
804,171,693 *536B4FA3B3A8250BED4F5AD386D00AF4F7C60790 [email protected]+UR3
804,171,694 *53640A5169E2AAEE8282A7B38C60899277A392EA 5angebotsverschlechterung
804,171,695 *5360293AD4956C5453BC107F8626609A14B32E5A 5MANGANOSTIBIITES
804,171,696 *536207A1BBBE815506FA74DAFE1FCF0EAA897DD7 5NTMNTLZD
804,171,697 *536E879CA1CA1B12D0EB1EF9D204D2390F9CE134 623327 bilgisayar-bOl-.-bSk-.---doC-.
804,171,698 *5367849225BEEF57A715F05EB3EF15B32574C45C 62901 painettuna.runo.oli.ensimm
804,171,699 *5364772000B84D271DD34C9CA7C74B1EC8AA4F8D 632284 olenitset
804,171,700 *53618D603AA32435DC63D45CBBC6E4A113ADE092 といった後継機も登場しない。『機動戦士Vガンダム』・『機動武闘伝Gガンダム』は据え置き型ゲーム機に初参戦。
804,171,701 *536E5FF7F41454221DB9D66CF505B80561058DDA 6IOKINILK
804,171,702 *536EC858C37FC4BD20C9669963078263CBC78877 6-priemer
804,171,703 *5361D9D32B25C4A0140B1D01F0D6E35BE0705B52 6YLEUQSEN
804,171,704 *536B9A40721798BDDD91E7612535964099DE8078 6ZAPEARIVE
804,171,705 *5366AF2FEFD4243FA949CCD4CCC53388E4682888 704 HELMIKUUN
804,171,706 *53684DE5DA0F9578B41E285D723C7E377DD4DE23 7244c8ad
804,171,707 *53605A37E61272DEEBE69985C63842C0C1B21763 7BSWLPCCENTERBSW
804,171,708 *536F5C7B698122E1723A610842973CF8042AAADD 7CSC
804,171,709 *536DA030E12C53FDD914C695E63CFBC95EAC5985 7ENERGYTEST
804,171,710 *5362EDF6BAD6FAC436AE3A8541C72D842D5CD50E 7EZILORECYLG
804,171,711 *53699548D9A369605372ECC4EBB92E02585FB5E5 7GANDALFVIPER
804,171,712 *536622B0DCDD2F59532169FA2659A07CFC0744CE 08.09.13
804,171,713 *536286E6B49A19F78BCE9B81067A3814BF8C4297 7IORHTALC
804,171,714 *536AE6B094697276C2BEE3D56C53368AC5F54582 0ILOVESPEEDY8
804,171,715 *536781F6C9E56395244B149154061DD9B9FA6783 7LHMSOTGREZY
804,171,716 *53608849E35B3B45ED2AD10ACE29FF0B14951C45 7MILIALES
804,171,717 *536642A3E187346C86CF17450872699CA4C791A9 7NIDRAABHIH
804,171,718 *536A2C59BE7D1DEA6B0679179AB04E664983D4F8 1052503 das.spiel.scheint.wieder.offen..
804,171,719 *536CF43AD27916C4A76C6F8CABC16BE7E523DEC4 7PARKALLES
804,171,720 *536FFE6F1A87685E75F24D5458EAEA5645583446 12189C
804,171,721 *5365DDD3CF402A32893B83A8449B8B7F9BFF19B5 7uithakt
804,171,722 *53686449EA180DD53AFC2745CDECAAB2AD874B32 7VIERAS
804,171,723 *536227FAF7264D4330EADB81C15D01739FBE150E 137gabriella
804,171,724 *5362D20758B503CF32BD664BD7E9298184EBDE74 7WOLFANIMALS
804,171,725 *5364A5C26F8E4825C35E8EAEB47E2F4D9EABA8DD 8088 SUSPECT
804,171,726 *536FEC921FA7C5D386AB98898443F84AEEFE381E 1485174 KIDS.SHOWED.UP.WITH.BOXING.GLOVES..
804,171,727 *53670331964B7239FC63B5D52A5CD15343BAD0EF 840288 geneldurumdaiseboylebirsonuchenuzbulunamamisti.
804,171,728 *536D471C788768E737E1D6A5A18B6A6F304BD805 850MARISSA
804,171,729 *536F5AF53792B154DB594ECC0ED1A7919D55C458 8AUTOLOGICAL
804,171,730 *5364909B72EFF746C5A6BC62960B3493E51CC631 )8( * *D---3
804,171,731 *53697BE2EE7F5D674967EB820EA10E1D2B8EF5EA 8GEGLAZUURD
804,171,732 *536A5C3FCF38F88E42D178F793E6883B33B1200A 8I45N355
804,171,733 *53662B23EAF4FCC0E55414171B4D0EDB3C7C500E 1976pacer#
804,171,734 *536A937F34A0BB40D84B1AC351395B409069C394 8PIERCEHOUSE
804,171,735 *5366F86C2BBFC5B547CDB16DC5179CEE2200B21B 8RPULIDAN
804,171,736 *536BB220108A67E3E4FD0A37CECAB3379219054B 8SNEREVOU
804,171,737 *53658F6ACC28E2C429ED714BB1C25D0BC6FCF4D4 8THATLOVELY2
804,171,738 *536AF3E6D0DA62D54967BAD0C6E59E2396354892 1.EMDVERTRETER
804,171,739 *5362394C2F84DBD21245BB27DF8172753098FA44 9802e0d9133fee3abc4a51dfb566838a639ede
804,171,740 *53636FF6865BB9A746E57BC0A2E185CE6953F6C4 1-gefuehlshaften
804,171,741 *53626A16AAFDAD42C510396336987F4EA1248ECF 9berggelden
804,171,742 *5367BAE2201F472A2EE8FECF6113058C9602F12C 1 hightechkoloss
804,171,743 *5369400D79168B6A1ED59C2B33777D82F977C00E 1ionomers
804,171,744 *536BBCE505C0A2DBD6855EFD292FFCB6FC8A9641 1n5urm0un74b1y
804,171,745 *5361CF356C18FAD9CBB84C259A1D4096FF1DA80A 9MRBYH5
804,171,746 *5367111B987C23E7321AC302B9DFE65ED36C5B30 1.ORIGINAL-LACKSCHICHT
804,171,747 *5361150B8F410CC48C6BB654A3717F5B1E6F0642 9NIJZAGBI
804,171,748 *53656461A78B1D8291EC3C5EAEBE630F18F0E4B1 9PATRICAN
804,171,749 *536E9DB018DA1FADDE293B317F336AE6E7CB4AF6 1 PRODUKTIONS-ABLAEUFE
804,171,750 *5361472D7BE2A90FDA09549EF30777A5BA944637 9SKEETERRASTA
804,171,751 *53689BA95BA9CB64BD8E39E4BA0735245E5856C5 1.savikiekko-ammuntaa
804,171,752 *536D782CD8B289448BAD982B9673D7A8CCB6E19E a0d1v
804,171,753 *536A0A9DB56CF75D18504FC8CE5B0C3367A61A61 1.szeneplatz
804,171,754 *536B8E466F7CA227B9E3719FDA8F61103B736151 a1a#b
804,171,755 *5365CAD98E65F14B0359787E376FAEF4B670FBCF 1.TILASTOKAUDEN
804,171,756 *536688C7968FE7417B1DE5F07A66355EF11ABBEC 1tunder
804,171,757 *53639ACD99130FAFAA4DCD9865B1CEFA13A0CD32 a3mod
804,171,758 *53602C1C050AA07D35625DD2782AD4F0A3CC7168 1.varusjaostoon
804,171,759 *536E176B653177FC154819A5461A07ACD9832D5D 1WANJO
804,171,760 *536A16B40640D8C7B88F051DC43677CAA3DEDD79 1werbungtreibende
804,171,761 *5360D4ADE0E46BE73BF31F9F210FEF58E274E444 AAAQ9
804,171,762 *5361D4770BE74BD95D3E441D36873C1CC780CF60 aab4r
804,171,763 *53676FF5452D5495ED3E9A653D5F6B9A1C97E000 aaba<!
804,171,764 *536F3446B0025BC9D2899B3A928FCA091568962D AADRIX
804,171,765 *536D611B1A4C8CDE6AE3DE9EB5027BCC69D97907 [email protected]
804,171,766 *5362884C61EF9D92DF0DBF7261B1F56F6349EE44 aaf&e
804,171,767 *536CC7135462528E4D82865C099D8AA836C9AA01 2865539 BUTP&GAPPARENTLYDIDN'TFINDTHESPOTFUNNY
804,171,768 *536395531B218C02E8C96E14275A94705B069C7F 2900369 MANHATSICHDURCHBOXENMUESSEN.
804,171,769 *5366E581CDC96821D51382F3D272D8AA08B695D2 2.ASIAKESKEISYYTEEN
804,171,770 *5364C2A1D36BF6E1992E9CACFC1431A086886D0D 2ASOPATXU
804,171,771 *5361B992E6317FD95948720388962B972DD23CD0 abdulfanelli
804,171,772 *536C88E79C065B5C022AAD3E6722FFF82C45BCE9 ABEL.HYTEN
804,171,773 *53649D5318E8F4BE3676CFE5980F2EB6E0CB75CA ABELKATSUDA
804,171,774 *536972291EDF687E43C9EE1E6571357FCFB34547 2GTZUAXMXWW
804,171,775 *5360FFB9420DF49A5034D8946E327E38C19A46D8 2-SCHREIBRAEUME
804,171,776 *5360E95A5601679DF03878F08EF1FE3FC6041FC4 ACENDEM2
804,171,777 *53627F5CC8C5D9437F098EE55EFB40A994A92D25 ACV-34
804,171,778 *536E28B63030BBACEFC3F84D9F778EF421ECDDE3 32431788b
804,171,779 *536B94F92CBE0CA43A94AC0286BCE42FDCB61E61 351400 cagdas.ortadogu'nun.siyasal.gorunumu..
804,171,780 *53642A9D619DABCE543298C833CEAC46E11E9770 35cb87ac0
804,171,781 *5368F22B12D47E8A0BF72F751A5BB7A5A9C7C561 adampiechota
804,171,782 *536A4D0231BB491ADB96AE9094BAC4BE8684FEAB 3753b4ac99457
804,171,783 *53681E335B48FB951FE2F11D3FD742277FECCCDE 395735 KOTIMAASSAVAKUUTUSONVOIMASSATAVANOMAISENELINYMP
804,171,784 *536BAD9DA396DC82F2DE8736DFD8E698BF269EDC 3B<-O~0~D###8
804,171,785 *5364FCD72C493700AD148AA2F46510396F14CF91 3====d.~o~o.{x}
804,171,786 *536242352A7B7A519F7AE4B46DD9A6598FF898D4 3-druey
804,171,787 *5362BE048F8B4D875913D737F4C5BE0CE64FE752 ADRIENNE111
804,171,788 *53613CE6963A8E21C3C7D150991C60FE8A52F212 ads9
804,171,789 *536BC01A3EA61C65B251215E9A2EBB6EE0BA5324 afferrero9
804,171,790 *5362449BA1B4BEAFA1528FE805DF891D7088D24F 40306
804,171,791 *5366E79809098AE67C2EACD2E54B25CCA6D8DA86 42.MARTEN
804,171,792 *5366D84B216E28B0693C0CDEF176D8C18DF9C467 A_GT;
804,171,793 *5368E3239A8E35990BE6339DAA11D8C12D97A275 AGUSTIN092
804,171,794 *536ECE0B68B3B1933300E7F6AA48BEC9FF9571FA AGUSTINSORZANO
804,171,795 *536913E20F6D1BFAF32B554FE985DAE6D0A40AB7 A!Gv
804,171,796 *536C689685646512F9BC805479CCF089E686EC4E AHMADBULLINER
804,171,797 *536849F546F0E55ABBD3ABC4FD3E3E3B753E28CA 4FSTAKKER
804,171,798 *536E6A0311059E46DF5F0F563D8A01B3C050B208 ahsfi
804,171,799 *5362689645E78C55EB70A8ADA3643FFE3849F0E9 4M81DXTR05N55
804,171,800 *536F6EA19479B09465C3F3DFB97F9E65C5EF7B96 AJIT.PREM
804,171,801 *5369975CE01F3E7247A985CCCDAA4BD99CA8191D ajoc!
804,171,802 *536DB179B001C4FDC2E080D9CE6F8D1A5CE964C5 4mycbear
804,171,803 *5365122CCD3F07A88090C24E769100C93F1E1944 alecmichalicek
804,171,804 *53643ACD6C5EC5F07E571B9F2AB1E83151852A33 4PHACOFRAGMENTATIONS
804,171,805 *5361619752FD4CCA61CF9BEC40A8C15675A6C9E4 ALEX.FLOUROS
804,171,806 *536D973D70571C0E6577E6C368EEBBAB7B9235A1 ALFONSOODOMS
804,171,807 *5364013CFAED69397DC08122B1CC6931891D5825 4WITHOVERLAPPARALLELPASSING
804,171,808 *53648D7C2F40A00C71B645F5BC2B293261C9EA6A ALL-ALONE-ALL-ALONE
804,171,809 *5362B9E9EF023EC1D1A11D8EF3CAC53F0D7E93D9 Alsdecowboysdromen
804,171,810 *536732CC774D1EB78F8ADC961AF74E881F36F1A9 alstett
804,171,811 *536F27DDBE564B9708955A48845140637348E1DE ALVAJOHANNS
804,171,812 *53681A4259A7565C543FCB7649778CA6C05E3AB0 alvarodedek
804,171,813 *5369CE8A8FA78A4872154B6B647BA506C1719A80 5CHAPTERNOFONTSBSW
804,171,814 *53632EB78A1FA0FB39F7AC599F014859027F9BF8 [email protected]
804,171,815 *536F0D9F25E500BA3E708DDC8C7949EC8BA4AF64 ALYSON-LATHROP
804,171,816 *536198320AF7A457A90D63E4A3AB761ECDDD6BFC AMeD
804,171,817 *536F0688ADDDB53F830E624668F706ECE08CF790 a&n%a
804,171,818 *536FA6CBBD5469692CD0862CFB38EA3BA9E400C7 ANDREA.DELAHOZ
804,171,819 *536129EFDDB518240B47D1E9EC691CC3D6603F8A andregowin
804,171,820 *536D337B410D4A26559713F117F6BD45F235E56C 5mybarnyard6
804,171,821 *5363670E592A15D5527215A6C2CC7D3DABB3CF42 5NOGODBUTALLAH
804,171,822 *5362DF86FEEBE01E0A7FEEEF294C1C3FF77BF091 5OMGESPOOKTE
804,171,823 *536D272D42A73F32F952032E188401A9DBED8840 5PHYTCHMST
804,171,824 *536985B6B02715A3CD7ED2BE07B8636318A850A5 anibalsario
804,171,825 *5369B36FF77B7F493015418DD8634BF18FEF8B4D ANJB
804,171,826 *53638AD3371FF80E165019D63DE127C5A2660A31 ANNLOVEMEF
804,171,827 *536835EE2CDB937569B68A7D622A3418DF63CF78 5sweaters
804,171,828 *536533D0A2080F792D2B6F0775AFC171B2150D1C ANTWAN.JELDEN
804,171,829 *53693E8BC1966CE55AFEB04DEAD1089EC65F9F5D ANTWAN.SCHARMANN
804,171,830 *536004D6A59806C064649C214F2F7815A46496D0 ao:
804,171,831 *536E7525A330DB951C52EABF6DDC801C4C79638B 68150 das.us-militaer.ist.zufrieden..
804,171,832 *53629623ACFD5CEA7CB118CF6BB9EE2B822BDF1D 6AESTURA
804,171,833 *53655409D0A277383F33E41A9B90BB61C07837B6 apatetic.,/&/p/@/'t/E/t/I/k
804,171,834 *5361E91C6C944273807F4B53C34CC04CE29A4B1C APB5U
804,171,835 *536C8166CCE711827DD9641B4D7629C31844B5EA apjwl
804,171,836 *5364B8232B80D8E893DB60941B08CD3405930C75 aqf5y
804,171,837 *536D80517A081171F9EA664F17558334B7A5AB49 6EEDCLQK
804,171,838 *5367762408F35DBA98571043AF5AE7B2240D943A AQTTL
804,171,839 *5363482E1F7A3C1D4BFA74527B01966F31A1C3F4 6INSCOURGESEESEIZESET
804,171,840 *536D189225C6AC40DB38ED906B7F5ADB87319670 6KENTAURERNES
804,171,841 *53687B62E79C3EAF4AABBCE32D9ADAFFD9F632F4 6NABIKIAT
804,171,842 *536B706AA0D0ABECCE1BB9F513B77529B7691A0B arqsz
804,171,843 *53653C150CF708C2668DA80F905E65650E1A3CA7 ar)s)
804,171,844 *536F1364AAA9617C9C0E723740D674A9925A4855 [email protected]
804,171,845 *536A4E978D1BD896332065CD11ACD0678B844B0D ASHU TOSH SHARMA
804,171,846 *5369CB7FADB621B15F748A520CFDA25186BFD4C6 A$SJ0
804,171,847 *53688F513BA5FE715D8A09A441A602EBC0AA1184 aspartaataminotransferase
804,171,848 *53611AB754C9D6B27B6AEF0ABF0FA02A46CCA174 743MIRIAM
804,171,849 *536326BECA35E852E4C5C490B30947F697BAF018 at61:
804,171,850 *536661762F179BF6D35E30B136EE164443F6918C au-seng
804,171,851 *53667DF843378F5439A5A20691EA3F92BD29009B 7HELIANTHUSN
804,171,852 *536D1E5253FE6106C90448DF0AEFE7BA33942CE0 7HIUZUKUF
804,171,853 *536EDC6BBFDFAF649BD6B9BD991C5F0C4D352ECF 7IKVALKO
804,171,854 *536099C7FBF2D1D93713FA9454E2124012961DD5 7ilovehistory4
804,171,855 *536AFCFD7CDE2DE24CEFC0B75FB92AEA11595B7D 7MANICALLIES
804,171,856 *536968474216C251E54FA0F10B411D34C0FE37A0 7NOTSIMEKAHSOKKAA
804,171,857 *536D3F3901EED3C4B0BC282E9E413FC2F1B948BA a"-va
804,171,858 *536A3698331B661C92630AF8E5989F6FFE82466B AVK;V
804,171,859 *536B8013C6E5D7E7F8E56A9AA4E36A67FFAC2871 7SUZUKIA
804,171,860 *5366F1E359565B07B45480C6C40F0154860B0C1C AX+9A
804,171,861 *5365D3B92713AF130A794B778454F870B0269C4C a;ylm
804,171,862 *53691F586D3ED3F748A3D74DF2DC9382DA99D188 808369 ISLEMLER:BIRIMKODUVEBIRIMADIGIRILECEKTIR.
804,171,863 *536BA899DAD81FF32C702991A6EA9563A64E8DF8 azth
804,171,864 *536C4B7D013E47F0397278D7790A5EB212803F6D 8AMPLITELBSW
804,171,865 *536A18BE748156278A7E925E748D44A3B9DAA5D9 B====>~0~O.UU
804,171,866 *536EAF77C8CB72E68C0AD452227F1B9B196150BC b#0,x
804,171,867 *53628CAD5C41BE2AA47F02EE56EF5FBA5248F9AF b22ti
804,171,868 *536C76E748D860875547076D6D8A619332F13674 B7HQS
804,171,869 *5363FDEEE2B85511955C2952999660F584B745A3 8NAGLASIMA
804,171,870 *536C34CEA51CA06F8206C547C1761DCAE4C417CB [email protected]~osploit
804,171,871 *536157410919A40F21E2AD6AD9B2CF0CDDE13D97 BARNEYRUESCH
804,171,872 *536BBB0E8795AE37D21C3F869E72F4A9CABE9640 BAVARIAN
804,171,873 *536C4B3B29FB1ECB889D25F1311497B18D45C96C BB6=B
804,171,874 *536C3891268157C96790A69110B952899A22537C BBEB
804,171,875 *536AA8D34ECDC6252A56A416B9221A8ED7663D6A b"bl:
804,171,876 *536D28AA9E85E8DB34E26B606228E87075ED6AD5 BCHK_
804,171,877 *536944F68C694935BF01CBDD432F532C0BEA1B55 bd-4!
804,171,878 *5360AEA7930A8C216CB8B8D3FA4B52707D4B70C9 BEG_H
804,171,879 *536012470033983313AA86AC84C677584A88B652 be preceded by a <tt>#</tt>.
804,171,880 *536482BFB220C1CA7458DC0F69D7F6523F744BA6 [email protected]
804,171,881 *53683507D26ED445B6FD0DC7980029E3D6B2C0E1 BESORGT
804,171,882 *5361AC6118E0B9D5740DEFA880192FB13C018162 bethany780
804,171,883 *5367D1A3567C3217CA93C92301ADE69BA0632821 BIGDADDYKUSH
804,171,884 *536933D702D1FB8141764EBDE0A4D35C6662F66B bijbelplaatsen7
804,171,885 *536E67E830D5D0129E96D59A265CE6E0A9A7FE5F a7bf7
804,171,886 *5361DC6619BDB19575C92A11AE9DB533CCB746F4 A%9WE
804,171,887 *5367628BDBF30726686714D773A3EB383137B097 b#oid
804,171,888 *5367CC38E20F1F15377B9D3B789A982C88427C66 AANGELAPT3
804,171,889 *536B371E734AB7FD5F0DF91183FBF044E40E0404 BRAGOTTO5
804,171,890 *5363171C4B817B6426FF744BF08A08FCA314121C ACASSIA
804,171,891 *536585B63D26E4874B97389F6F7DE8E2AA7E4AC0 BRETTVELAQUEZ
804,171,892 *5360E2A61E4989BD37109360FDAB32A78985AC2F bricejefcoat
804,171,893 *536363C4D1599600895D1CCAA34337B472342244 BRICE.OKEKE
804,171,894 *536A3D94E6501DC2331F6475DD34D0F51C6E4529 BRYCEHELGREN
804,171,895 *536FC13886C646F02388DF8A7EF55984011CAE24 BSK
804,171,896 *536A7025B1F0A86E5833FB7CFC1415059EA31023 BTE-SCHATTEN",-BWV-202,-NO-5:-WENN-DIE-FRUHLINGSL
804,171,897 *5367D997463202F0184A374100CABE888A1CCE29 ADAM.SCHOENEGGE
804,171,898 *536DF64E12114CE45E9B57236A3BFC8D3552603F adamzellmer
804,171,899 *536F7E616B76DE1F27802AA8DEA8FF0ACCC7DD35 [email protected]
804,171,900 *536348AE5C9CE8469514C2E77A4B7DE1FA1A17FA a_d:n
804,171,901 *536357D7FC9472867EE83F6A17E953AA96E1D7CE BURTON.STRAWN
804,171,902 *536C53D67B071A9527688FA637979D9954DC4405 b/va&
804,171,903 *536529D93BF9C377714DFCFFC35552D86F9292E8 afgevlagd5
804,171,904 *53603F23AA0B437ACC9DB4D01B2E2113F1AFEB18 AHMODYMODY
804,171,905 *536B0643D54D2D5B172EA6262220DCE0EDDA26E3 C2QIB
804,171,906 *536187DEC6CE6CC7489075FD267E2C5770D32EA2 CAMPAIGNAUTHORED
804,171,907 *5368E92CC0B09AAE4DADCD2BF2E2E8400DFE45DF CAMPAIGN.POLITIFACT.COMCAMPAIGN
804,171,908 *536BA5584D9F5F8C2B85980BDBD0A8E21F775BB5 c.-an
804,171,909 *5363F81C5604492D973EC98AD0848629CF8607FE alifn
804,171,910 *536D9917BB8EDC9737101464AEA76C46A148C3FF CASIMIROA8
804,171,911 *536DCB9380381531E2C3BFCEF0E58466989583AA Cc50
804,171,912 *536C465636619159509EBBD41904A0C5775ECF57 AN7HROPOD3A
804,171,913 *5369D32F8C74DC0B9D1FD6E997B0669CC003E8F8 CH643
804,171,914 *536E226CA80163943337AEB126EC417824817B2A [email protected]
804,171,915 *536804537E72AEDBD3F71DE5997F2CF206254D82 CHEMORRA2
804,171,916 *536BAEA1E5BD2BAA4ECD9C450B1E2D13829038ED anniebiogirl
804,171,917 *536579DBC39D74DF0D1F84E3087933FB43D48593 ANTONIOESKINS
804,171,918 *536BB5A9B483D99677A21F5A9C83BC015001D812 ANTONIOSUSILLO
804,171,919 *5361059ED5C422702E91B45EF255C2699725FE2C chiliqin
804,171,920 *53607EBB7EBF6BC477A379BCC946C2803905722B ao:
804,171,921 *5368FEA26EE7D3C97FEA408C535BE5ED234BDB30 christine-morey
804,171,922 *53688D8F46381BB5C8737C612D1479BA724929F8 APAKG
804,171,923 *53652F2EDD57AF4D393FDD1AFC64BEDAE7C372E9 CKAIRUZ1
804,171,924 *536A719898A94E06FA802C40E5013468E0528525 clarklewallen
804,171,925 *53698CF8086BE93978784E420DFE8A776C9EFFDA ap(x;
804,171,926 *536FA434FEE968D3731D07F979031F2044274AE8 CLEOAPADACA
804,171,927 *53680D1900A8E41074BA0BDE8EE0A981A6190FBD CLETUS.HIGLE
804,171,928 *53656BCF6A269CCC7DD906B352E5D76A59499910 aql"
804,171,929 *5366C717F232AE5E356B129F8D8FEE6610CF94F6 [email protected]
804,171,930 *5363E4034DDD8B16A9036741144EB76499B9132A ARJEN:ARJEN
804,171,931 *53623F694399B5EF0EAB338E950F27866EEBDEC9 CL_N-
804,171,932 *536277DA08D5B7F0DDEEAF9C8490ECB0DBC41D0E c,=-m
804,171,933 *5360DE4814751CB9BC9548C44A2633EED569F61B (CMJKMIX)
804,171,934 *536FD6C42F505FED544D453AC62C82D7E44E33F6 ARONPALLONE
804,171,935 *5360B6956594523FD0F41D97E35658C2677660E0 CNDHL
804,171,936 *53690970AD984617E8AE1C111E2DD2AAEB0D0CE4 COBLA
804,171,937 *5367C6D727EDEB1D79DCC1783AE2137B04F8096D commettaient.
804,171,938 *5366B6BA2BA1A8BA927EB0C302C14D0E58BB456A CONCERTINO FOR PIANO & CHAMBER ORCHESTRA, JW 7/11: I MODERATO
804,171,939 *536F2EACD4150CB543383EED6B3AECF51284864B ASTRAL.APACHE.(STAR.STORIES)
804,171,940 *536FB51CEC8EEF4E3DDEE8724FFEA65845F6081A [email protected]
804,171,941 *5360995D39252EF8CD234CF9E02D02BFDAD59DA9 cp&fz
804,171,942 *5366B88B7EEA79AB1509E56147AA6F57057ABCA1 cqe/+
804,171,943 *536422471DB57A6498D6AC8001FF57EBEFD78783 AUGUSTUS.EDSTROM
804,171,944 *536A7D1FBFF5CFE90F1580E90AE870A4307B4E0B AUGUST.WINGENTER
804,171,945 *5366863F822A3CA79BCB49A47916475E6CEF4F62 AUQA3
804,171,946 *5367B8537CA39D0AF8C053916760A45DB5BFA5F7 a-Va--
804,171,947 *536D92D49E9342C890726C9D122EA8FFC9B3C41A AVFE
804,171,948 *53636E531F45C28FB18D2F079D6C26E9F56EB282 CRQBK
804,171,949 *536986049C283620DA3473E3283E19AA31D643D3 [email protected]
804,171,950 *5361B11A1B2BC8F331BEBCB708E98D9A64B1FA94 cu!(d
804,171,951 *536BB60993DE9F14D477DCACAADD5E308D0345CD b30ss
804,171,952 *5362C0D5B1292E36F6F508A2E36785A04168EAF7 b6mv:
804,171,953 *536953CA21156A27DE6D6FCA621BE92B0317E32C BACKMITTEL“
804,171,954 *5366913004FDBDE3D60C0462E34652F6E7CF41BB DAMON.CAWOOD
804,171,955 *536CFBBCE10BCC64718D0B2345C4912F1F7A7FC2 BALGOVINDY
804,171,956 *536C0E0C4A2452A7E1FA0A303BC30D413AF9D739 bankte9
804,171,957 *53614CA0E3BB40F2CA4DF64CFBD31513874AA656 DANILI11
804,171,958 *536E62A3546390FDA6A2A0E619A0707C51E58200 BARIŞIRSINIZ
804,171,959 *536430CE0B146E2B498B589D703302B0AE079350 dannyjonathan
804,171,960 *53696768214FBB5B0D764E1F093553A090BF77AA BARNEYMOZELL
804,171,961 *5365145D8F0695EC9FF2EE6CA3921E41770B1AED dar(!
804,171,962 *5369A33064375B5336C7D73EEFA9AF6328C31246 DA,SU
804,171,963 *5362886AEACA0C3777C25E3E07C0A6BFA46E274D BBD2
804,171,964 *5367E580D101FDEE603CAED0DFFECEF7FD7F9CFA bdcg/
804,171,965 *536A387AC3062FDCB6E211DBBFD0E502B4DD373F beatila6
804,171,966 *536F2D2776E41320F60D751790731572CC32C035 BED.TIMBER
804,171,967 *536C63B13127C241B27C7AA1B766299CB99ECAD7 BEN.AUTAUBO
804,171,968 *536BEB3D23374C8325F2DFD0BF39B74ACD8A94BC DEREKSBDC
804,171,969 *5367AF0ACA17DA919C05845FC25E09EF08EE1932 DETERSE5
804,171,970 *536F04B95CA495250C71B947157D4D81DB46C99A de,$y
804,171,971 *5363588CBFA03047D04A953EAC6EA39541B94CE0 DGPIB
804,171,972 *53692B758FA11C5300A2B91A5EF432E82F3FE73F di"k=
804,171,973 *53664BAC87FA86E134DFF302C206CA7231E03358 DIRKMITTELSTADT
804,171,974 *536F84D60A965CF3AC9CCD25771C9A7A8B76464C disgig
804,171,975 *536B7159D4A5C264BF5DC7B7B2A29F9D21C34C6F [email protected]
804,171,976 *536B20926903F8C21F490CD1378D98EDB0235283 dm!;f
804,171,977 *5362FF8CDD95812605E40913A9FDEAC14A639F9F bjwg
804,171,978 *536ECF85A91E7E84B6D4B86E96DDEC26B7D83009 d$(ng
804,171,979 *536BF76E866D363F94CA82147B909A019763F8FB dnrbi
804,171,980 *536A3A78DDA721B1CF94848E80F4A357570E8AD3 DONN.PARONTO
804,171,981 *536483C45D6D7D6480637FCD438C146F23185BCB DOORHEEN?
804,171,982 *536EEFDF0E20C96552DB0974E8C4FFDAA8599243 DPCZ
804,171,983 *536D9BB737235AA0670F10AC20C1D146C5831896 BR8M#
804,171,984 *5369623DE52DB687A9A50E94F2F7CF93CE7FC716 bradlyhoward
804,171,985 *5367FD5645117C10B5766D571144A5F2035EC7AB brad.tackett
804,171,986 *536F5B92DC5AE752FAD229BFD78B792566A44FDD BRAEDEN357
804,171,987 *536C0D616E8C384A0AF699EEE522D70871A8F20A dumitrescuveronica
804,171,988 *536BBDE48534669119A51B16699990B31F3F0B4A dut#$
804,171,989 *536ACFD033DDD9C2AF24F363267B36B1E373C257 dynamitekid
804,171,990 *536FB112AB1253F6CD35616FDC5D7E1730A9E591 EDDIE.ASSELMEIER
804,171,991 *5364BCEBDFF0B2F0B142AB23BA2116D783B5374C EDDY.CASHETT
804,171,992 *5366FA397FD8451FF51F922B43CFEC6A06352007 edgar.dean
804,171,993 *5369C250D3E52974C362B1AFE5D197B6D6732EEF edgarroudebush
804,171,994 *536EF5DB45C8EF8E1AA2DC0720488CA1FE07C2AD ED-INT
804,171,995 *53688C207C79E74BBFB4AC725F7B1AE0DA9A6BD7 BRYONSAMPAIR
804,171,996 *5369AED37BA643DA1BD05601ED2A9FEA9ED24D5D EDMOND.GRELLA
804,171,997 *536EF9A613120757391EF46D6B8827D639C16299 edmondnarkier
804,171,998 *5363415D3D08BAD82A2C8C31ABB5BFBE36E63371 BSK
804,171,999 *536EFF798229D3F5D86C9573CAEEC848058CBB1D BSWPARTEABSW
804,172,000 *536EA41F448E00F15FD809E60A7B9BAFE4F60410 Bt9o
804,172,001 *53678F6D5D0909E6A62514E7528AD290CE8586DF EDWARD.PENDEXTER
804,172,002 *536A59B58356303EA058787D4B443DDFD79731F9 EDYFYE
804,172,003 *536143BC2AC616C0B6E46077242446A1DF702E4E [email protected]
804,172,004 *5369EDC75453446CF6522BDBEE8A761B49D369F6 eehqt
804,172,005 *5363EA80F363CFAB154979F344F0DAAFE7235E09 bubtx
804,172,006 *536A8C2BE2C16F9E18540CC41F2EF450D46806B6 eikelvormigst5
804,172,007 *536B9740437B28493317F9A3C61E87FA08992409 BVC58
804,172,008 *536FF5BAA85D1F5900FEFAE75072C807E39B819C bw6%t
804,172,009 *5366E4DB045B50354CEAD19D3B7EFCD6A98DCF4E el-lecho-del-rio
804,172,010 *53616AD41F3A4AEDB8BF07C2E2982A2ABF6ED6C6 c2!fg
804,172,011 *536E493570D1758779185CBB39AD598CE2273B14 C3FK:
804,172,012 *5366F3536D9CDD741D19EF95590EDEFC263C3407 C!&5F
804,172,013 *536CB6B840A6F5C802981F51D7DA293FD48A6C64 c8)d2
804,172,014 *5361EE2D813DE22607B575B68D45BD0250F4ED6E en.$2
804,172,015 *536D5607E7883A7C8264CD20C12D2A9353DB3C74 c9m
804,172,016 *53622BC191FE2A36DD9DE857879CE545C0CB9D27 CAIRNTERRIER216
804,172,017 *536615978E196C4DD64B25233CE3DC972A17C7AF [email protected]
804,172,018 *536D97D5B997C3161E1570AE004CF8514C9B2EBF [email protected]
804,172,019 *536844669818AD14E580528881CAD23573A26ACD [email protected]
804,172,020 *536EA462874CBAC7CC3288FC6A2335FE413C09F8 ENXUGARA5
804,172,021 *5365F42F6FD7BECD24B4B0C3954A498854640B4F EPIVN
804,172,022 *5363900041F3FD11237BC2C7A5115F00F4383F00 caryoldridge
804,172,023 *5363CD1170B5FFBE1FB8298B178EA200D15C4D51 ER:Q
804,172,024 *5362EEEB18260AAFA1F42E5676096ACAE2CF2194 CC6A
804,172,025 *5366BAC1FFA2847820930627D2342A4C3AB0DA00 ETREUSIEN
804,172,026 *5368DFCEF5221A39C3668080D5C3573D0C898693 EUGIMROH5
804,172,027 *536A010267747C0F4CA768E7D1E65C88C4EE8CCD c$e0
804,172,028 *5369FA913F15A4539EA3E57A1532C790AE7ABCEC CEJ:M
804,172,029 *536D7AA2D0EED27DBBCDB4307BA9EEAF51C674F8 chandra-allison
804,172,030 *536713F8AFC2BA7BA00EF19170EE5A11CE40ACB8 [email protected]
804,172,031 *536A103D45836DBDECD8B220EA7574D6CC900A95 CHANGEWITHIN
804,172,032 *5368CD12528145C63BEF29C19BD71F17471AC649 [email protected]
804,172,033 *5364560B0614746F6C2C9DB9EBCF6857EF381C6E [email protected]
804,172,034 *536954DCC06C066057DAA2089CE0C4FCCF35A595 charles-ison
804,172,035 *53649C2DD4E8BC11398C6FC47D27C1BF51E94BAC [email protected]
804,172,036 *53619330448DF2E78FEE8F5D605AC9D594642E45 CHARMAINEBUENAVENTURA
804,172,037 *5365BE3E637DA740A0EDE18E4F480E159E87A14B faykettas
804,172,038 *5362A1F2EC447809487700C005275A278FA2596D [email protected]
804,172,039 *536A3E54FF370E6A398EC82925176C456133C111 fejbbrzb7
804,172,040 *536D18763B37607969EA13234B58FE342487EBFD CHEV63PU
804,172,041 *5366B4517EAEEFE5DAE0972CAD20ACE08B5AF2FC CH%.F
804,172,042 *5367135FCAD0E2913289541DC0AD4A0C0310D3A4 ferminwelp
804,172,043 *53603769C52DD62C217533BB125D81D6720406E7 CHI.LATTIMER
804,172,044 *536D50CD3CBE24D75428DB5479BEF7741EAE455E chillingthroughthelives
804,172,045 *53697099AE4BB23130BE466C55C6D05BAFA8A802 FIBR0MYX05ARC0MA
804,172,046 *536A413E7D54119C69922D08D39424A09D37A7EF FICHEUX2
804,172,047 *53699C3DB93DE9EFC4ECF7F12DF14B799277CFDB chris-bland
804,172,048 *53688358F49533962A6D8C7A5D924CA8AE69285B CHRISTIANMORAVICK
804,172,049 *536A69216EC52A2C7524B69ED546E6E5F5B6D651 fireturn6
804,172,050 *5362FAFE990036BA0A5F1620E9B424C6F48B51AD [email protected]
804,172,051 *536DE32AC2D4CADCC6B35A03661E2F17287AB88D fit.&.limo
804,172,052 *536F916C4A20C7BABBBC9AD6C8D497AF3C5FB7E7 FOSTERPHILBEN
804,172,053 *5360FF35687B8C052D805D5CA22E5B05F0E00833 FOTOGRÍAS
804,172,054 *5368B5850391B94957BD048C78B0C78232D16B36 freesilverite1
804,172,055 *53683981FAC0CFA63D7A809283B0E1F6530C5EA1 CIN1HAMMEL
804,172,056 *53690D0D4AB8CB7CB40895E43B079E513DA73F1B CINNIUINT(サントラCD。スレイベルズ)
804,172,057 *536374C222B75192A0F2542E5F4B32FC9009E54C citolin
804,172,058 *5365162A981DC709345388E6C25C57CBDB96AB22 ckh7s
804,172,059 *536C2CF4D0C7911DDBB9AA7F5E7157AD0E1365FF gabrielblyth
804,172,060 *536B2D740F001E3F3A58F3D49DB44E7DBC81E30C gajal.rai
804,172,061 *53686A8207EE29717169328996239B92D0F161B6 gamaliel.torres
804,172,062 *53629263D2D881E3BC31BFD420516895AB1F6EC8 [email protected]
804,172,063 *53623423B179DD6B981DD9948E22274758F1DFFD [email protected]
804,172,064 *536C84793EB639526DC73FD2039C6AB220446264 garaganzaed
804,172,065 *536984B4677E11BB42F3ADDB5CE9D3DB2656F590 CLIFFCALTON
804,172,066 *5369CB52E3B75D3C481213FE8980FCC06C8DD2D0 GARRET.MCCLODDEN
804,172,067 *536E5BC2A63F7A16370FF0067833A679599C3F49 CLINTON.NICHOLES
804,172,068 *5363B474BCF37F059FD54512C38049E06EC0EB9F CLYDEPEREZ
804,172,069 *5363C15BF3B37FA56452B6FA8029AF3B8D2A3CC5 CMHJD
804,172,070 *5363F7555C0B86D054BCF63819B4B46B91FEBD5C GEORGIATHEODOULOU
804,172,071 *536DDA51B00AAB8C0E604E31FDB802AA93AB1392 GERDA-VORTLISTO-DE
804,172,072 *536893EDF4A877950206288C9002BFD5D3182737 gewelkt0
804,172,073 *53656CAC0534B9E093EDC4D5BD7FAD291F26E4C6 gherigli
804,172,074 *536F0ED73A1FAFDCC907337BBACA1547DC8DF730 graigpeaden
804,172,075 *5368ACE36DFE040454E632AEE33103205E93334A GRANVILLEKRULL
804,172,076 *536225CDE69CB1D3169B243C1D98E128F6BB4EDA gregghirte
804,172,077 *53631D2DE7D4583F8575349D5557C9F7D2646AAF GREMLINS
804,172,078 *53611C896883602202CC58904BF313D61117237A GYEPÜRENDSZER
804,172,079 *53648266D31143C61A7DE68563AECF388CD309E8 GYKRW
804,172,080 *5363DA3337258E82B3256A17523AC66EDCA289A2 GZ>W
804,172,081 *53620981C43C911F3C757F1B6DB2D68E997904EF hankedr1
804,172,082 *53667B5D004D73EDF5AF2EBE50006CBB2C026E86 COVENTRATED
804,172,083 *536AC2BBE6BAA6A0E95A4191F9A71B805BE73FCA c/p_/
804,172,084 *536037CC3424BAA1ED8EEFD8241AA186314B617A HASSAN.FIESELMAN
804,172,085 *53699307F0BD533FEC82518C72A9758A6F19EFBB HEATH.SINISTORE
804,172,086 *5364A69E6F06DDDFBFA4A2414DAD2D0CA56B7770 CQGPE
804,172,087 *53603DE3E70A9702D566CE1B0DA9F0CE5FB7AB27 CREATIONISTISCH
804,172,088 *53641B959B4DAEBEA4125CDC35A79F4C267C0006 hermanchrist
804,172,089 *5362E33DD836258FE1F4C32CCB3986853A5C4A16 CRUZSALMELA
804,172,090 *53699D45E328F7720808F33B47AC81E383D5610F HILTONKIGER
804,172,091 *536F23998445AA72F386167E4453CA851A98CECC CSBB=
804,172,092 *5369DD312C4672B597A2E9854CBABD5ABD3F9929 c-sfp
804,172,093 *536ACD85419D133AED4E234BCBBF5CA487213D9F CTrS
804,172,094 *536E1585818F6B89E839F09EE463E17023E2D4D3 HOOIMIED123
804,172,095 *53608E437B87FD5AE6CF7E9A032B9E17C88B38FB cvq
804,172,096 *536DF1CDAA7253A467C236F36CCC9AAF199B5156 huboi1
804,172,097 *536AB072C2A6E348C45F4D40706AAA86EE88D0EF HUCMBB
804,172,098 *5366392E74E5C798DB1DD5724E57C5234876A5AA CX_4G
804,172,099 *536C2F7D9F38406AF8807A4A655442E51B8E9438 HUNTERLEBLANC
804,172,100 *5364104B55F37212112DFBC3332231BE3D6BFBBA cyranobuddha
804,172,101 *536A0F637EBE77E87C01B72AB14F506294FF62C7 d1r27
804,172,102 *53693720EA3DC7C76CC0AF21E127AF77EC048CBF DAMASCUS_WARE-D/@/'M/&/SK/@/S_W/(@)/R
804,172,103 *536B5C2DD6ABF3B74C105746B2FC2496DBBA9968 damian.moroney
804,172,104 *53660F9E0CBF2FFCAC94B315FAD4E4442D3E4138 ILUVRODEO12
804,172,105 *536DA7860CFEC20E32AB067B18FDB802BD6928F0 DARREN-KRAUSE
804,172,106 *536E673400CA4E7DBE987D2B8B3AFDD71F5A555E DARRENMYRE
804,172,107 *536D413F7297B586724CE527846A7B88D20A0EC0 DARRYLDEMPS
804,172,108 *53667C31FBB56622F33F5E279343726700241DB8 i-never-saw-that-you-did-painting-need
804,172,109 *536EE40AC2C983BDA791772CE62450B374E502EC ingrid-thomsen
804,172,110 *536E61BB35C90A5E5EE0071E2A1E5AD839201192 DBPUN
804,172,111 *5368854A5F8D44E72EC85CEF67336981274E3DF7 IRVIN.HERCULES
804,172,112 *53664CEA8558E05C711BD6A5D4E8862C5BD2EF03 dec301973
804,172,113 *53600E1737E65391E28F5CF43838AD18D97613DB ISISDGJ3
804,172,114 *536AA0AFEEEB5C756C1F1096F3556C45AE861889 demisenvt
804,172,115 *5365C20ACF021AC7736196D41F4CB67AA02DE4F3 demkratycznej
804,172,116 *536217F400B6B97D508FB7E66488D23EF49481E6 IU",
804,172,117 *536E85DBD3165BFFEF6BC56F8DA6B8553561711C J0152876WMF
804,172,118 *536C38AA538723702074FF80023F1FD311306E5A jamelmacqueen
804,172,119 *536974D7E8C5D07616C327357BC514AC35536081 dewittogunyemi
804,172,120 *5362F43270F21E7C233087361FB9FEC96460E4D9 dexterprincess
804,172,121 *536A5E535CDC2B0AEDB0BC92F3C371EE4D768531 deznb
804,172,122 *536A85C2E7C493EF864F2A27694DE3C52C55D08E JANETVINE
804,172,123 *53604BF1DA9FBB1A4E731448FE8F38CC2F1A39EA dh5u
804,172,124 *536B87691D0F22FE9CF0C039EB628932887C625C DHGI2
804,172,125 *536E8BFED785F68913B37114DE894B9D7280DA07 JASON.VASTA
804,172,126 *536A13389BEA7ED8DC29B5C30D10DBF80A1E1A0C JAY CHY
804,172,127 *53668D8955F48878A9EBEBF548AAA8EC4BF6C8B7 DIANNE FALLOON
804,172,128 *53602B5DD6E7D8EF2D2E2DB2675A19C91BE1A5B8 diba.hossain
804,172,129 *5368442EB1533186D2D34D0D3BB4738E05721260 DIGITAL1123456
804,172,130 *5363406C4D217377535E77C0B91E82A5D77C072E dilettanti
804,172,131 *536093A553C04679DB6907F7FD87B27678D11158 [email protected]
804,172,132 *536642DEBB907F08611328CCC9BC0855AC0FB2F5 jelä
804,172,133 *536B52809A204304CB8778C64BFA3F86A19F4A32 jeroldclair
804,172,134 *5362BEBF0CBE21EB9A45C1F9546AA5CA21805314 DiY%
804,172,135 *536A7C369441D0B3F18572A1DAB9DBD36B16118B [email protected]
804,172,136 *536FB4B7B94DD5EBD7B6AB09C72B13B59AFD465A d"lh4
804,172,137 *5366106237B74A78523601B1FD1DAA872EB181DD d!l(q
804,172,138 *5365EDAFAF1B03C6C173DDADDD8D671CAC35D279 [email protected]
804,172,139 *53696B766129AA5EDAB7F8FF058DEF70A447A1F6 JLIKAAN
804,172,140 *536DF938ECAAF68CD3851CE430A7D3D2B4AD779D JMENG...
804,172,141 *536E02049E956FCA2114ECC9DC2C3F9F3453CAE1 JMERKINS
804,172,142 *536574B56128A22E33C1F949E46248DD1FAD1CEA joan.coburn
804,172,143 *536D75E3C3CCEDA0199E038004C3305F8A7C01B3 don't.gotta.be
804,172,144 *5363BC2D79FBE80C9A653FD926D551D4B06EAB6B JOHNDISABATO
804,172,145 *53662EACF6BE14AF4D282018F43CA008C97DEB04 JOHN.MANDT
804,172,146 *536D69C8B4CF96439726E153D1060E9007170FE5 DORSEY.IVON
804,172,147 *536754593E6CCC473A66D92BBE5CC679FC175A0E dorseypaulsen
804,172,148 *53681BA78DB5A8865626870EC532BC5CAD8584D2 DORTMUNERS
804,172,149 *536EBD6DC62D8E8D184D861423766378F05CBEA1 doug.pettit
804,172,150 *5365784E7853EE0027C5AEC1AEBE70C2E2D114A3 JOSEF.KROELLS
804,172,151 *536B5F92C34E143110E34B94730F3D857062F521 dpnft
804,172,152 *536FB3E4509420E0CCDFDA48C297DFA2B084F94E JOVANY81
804,172,153 *5364DD2D38FDDAA8069C6183AE4ECC82A7C7E978 JSZAKA,-EGYED
804,172,154 *536B58D89AA067EBFA05ED7DA87D8468B6939FEA draperet7
804,172,155 *536ACCE2CD99C45F66F349350D419F6A8329A540 dreamrushes
804,172,156 *53642D874E3CE36D30617FDEFD91DD5FC558548E D_>T
804,172,157 *536CECCFC436E2A80CFA802AC467DE7035C70E30 duy?c
804,172,158 *536E55569BCACA96681BA577DEC9B6CABAA49458 DVWEI
804,172,159 *536B7FB53352A7366D22D29A3D2FDEAD49D9A0FF D+WGW
804,172,160 *53630F837D9A9297D4181373D56F4F53A3F7714B kelly.minnich
804,172,161 *536A0875CA17FD8F980E073ACD0B8974A0BBC434 KERMITGLENNY
804,172,162 *536D5DF09C41319817C1F7E0250F71C37C5A10A6 KERRYBITZENHOFER
804,172,163 *53675B91958430F3DCDF10083414FD628B271A13 kesselpauken
804,172,164 *536D40E0AC3C2CFE6A33F118B6154767A797ED7C KICKITBOY
804,172,165 *5368D0AFF143D112602952E3C088B4A43A381EA5 KIM.ALDAY
804,172,166 *5365207B6A8E888D1604604C9024C2092B702DD0 [email protected]
804,172,167 *536D3B886898E14F49D0A561DB6E83CF1AA7AA12 KIP.BAGGIO
804,172,168 *5367FA2EFD49BC03FF4002D8C4384B0E61AB7C67 kirbybalch
804,172,169 *5363E22598B8CA30556103C19A8518463CF9692E }K!J
804,172,170 *53621EE481CFCF59973091CE465573D4A99C37FF KJACK30
804,172,171 *536E75B3561E736D8AEEFEB503A93677662EFB91 edisonnapolitano
804,172,172 *5369C62CE6A6A5A1DE3CA983F6B421F7646C6BAF edmontonal
804,172,173 *5368918E35DB158B07E90000C8CA53B09EC9FCDD KOFIBARNES
804,172,174 *536B03DF85E5F949D542A5E27D3611392722274E KRCRTV
804,172,175 *53622105718CD0ABA62A2E6B6BF9777F246E6784 LANCEKAILEY
804,172,176 *5365CCFBFFA5651A2B759FA99EB95376185061C3 ei&jm
804,172,177 *5360B2DEA35729649694695B2600188F6C4BBAC4 EJ{C
804,172,178 *53646BB337F49EE66AEEDC2BFD922CF15DF2FADE la-seleccin-peruana-reflejo-de-una
804,172,179 *53671CCCC24C337A34D1AFA90C33886830E0F9D4 elaibited
804,172,180 *53600FD7C8E9C9C237065D84C4ED9571C4B90496 lavernbarach
804,172,181 *536F418E08BFEF481E5799CCB488295A21C4A655 lavernpolitowski
804,172,182 *5365164378DA2F17EF92D57EFA9250C6CED167C0 LBLFORTHENRYMAP99A
804,172,183 *536716F4571F7AC16E5246B8A8FD60C0AB1EF831 LEAVESTI
804,172,184 *5366073F1127FE1B00987EE50A126BF4E16DF66A LEBOHANG-SELLO
804,172,185 *53628FEB04CBE9E5E113D1567CE63CF6C91B1F29 [email protected]
804,172,186 *5360AAB44B05A64111585AA5FF01820E79A6C2D7 ellayana
804,172,187 *53619304721EBC273C613D0CE32BE0D2040B4DE0 elli.pyrelli.(feat..elli.pyrelli)
804,172,188 *536E166C60E573349115B3EAC1784CFD3AFE135C LEPPARD“
804,172,189 *536C666CB7969825A97D7A41D4D2DB8A1E22C6C3 LFUCHSBERGER
804,172,190 *536E8FF7D05EF24066C2675EF39460561E381F19 /LIB/MODULES/263224SERVER/KERNEL/DRIVERS/TELEPHONY
804,172,191 *536069E10C4F35E599862D6BE5E0922C3B453570 enochmcdill
804,172,192 *536922479997C4A99A2AD47A4B0C30609E2F45EF LILIAN ASUNCION
804,172,193 *5368C2479D99C4BBCB88542C55240385889B9938 LILLIANGELA
804,172,194 *536451DE85F79D69EE5C29B83ADD9EBB08F16BED LINUXKISTE
804,172,195 *536F987DE01907332D35D249FCA3FA1F0B6E5F3E [email protected]
804,172,196 *536CDD8053B56A612412A4AB96BF9AF9755F2079 [email protected]
804,172,197 *536324A497B273D59FF241DC1E4DD4AB95B677F2 [email protected]
804,172,198 *536279DFBB66F69A1F268FA6EBC82B0EED5978AE LM7N
804,172,199 *53615781AC580DB98E4BF48310DA561B98ED4B99 LOHINI
804,172,200 *536EA4DD38DABE32F49BA6B03379B82750E23807 [email protected]
804,172,201 *536FB2F74E5BAA6E6EBE8E24CF7EB9C70A817175 ERIK.ENQUIST
804,172,202 *53630E671152DA60C22392679B10CDDD2CDCA2E0 ernestengberson
804,172,203 *5365B5210CFC17E895DDB1322DAD8E552B7F1D41 ernestodull
804,172,204 *536338032C1AE52FC5D0599374EC9112332548DB ERVIN.COURNOYER
804,172,205 *536F4ADB59B899AF58E9CCFD0C54146C8B7E0D6C lorna.ma
804,172,206 *536CB89FB0DAE2A62BC8E5A7AC515CCC1C9D882A LOUIS.DOHMAN
804,172,207 *536F5CCA41F546ABED37E2EE2EDDDFBF7921B2D2 LOU.LAGAZO
804,172,208 *5367CDD772298DD3C7A9AC937216D93C7E4B4EA7 ESPADONNASSENT
804,172,209 *53689055145A40A778073AB5A1E2151DCBAE8DF7 LOVIŠTI
804,172,210 *53638CD8AEA810D6CD4A2B8BD814E4920F801BDF ESSATIPSO0
804,172,211 *536970779C9D877B4564C2E4B8FFB1828F9AB66C LPEMULIGHEDEN
804,172,212 *536BC3ED028154A5BD7DCD6AE114BED7E8DFCF74 ESTRISTENOVERTE
804,172,213 *536F6CB78E53EE09E788119269AD41F78E2874E8 euiv
804,172,214 *536312116CBED95C2A755EC594DE0A08FC9FB9FF evtixek
804,172,215 *5361515B50DA14AA8D82FEA222F515EC7E3FF55C FARINA
804,172,216 *536046BA04DEDE7122F4EE8C37D841223CCDE4FC FC-MTZ-RIPO
804,172,217 *53600F291ECBC237FD758370053D68FB56739F28 [email protected]
804,172,218 *5369148FFDF1B683B58F3D6AFE684EB96A16E053 [email protected]
804,172,219 *5367F303D2159068C911B90B1AAF895365195E78 [email protected]
804,172,220 *5366F8A7A83C2CD73304AC39F32679611632A01C FESTESTELLUNG
804,172,221 *5364BC6D02776D6E8B8B88C042E8D318C992DAA2 LYMANCOAD
804,172,222 *536127C4E711E8E0752464BC79D4316854E6A0E7 FILIBERTOOHRT
804,172,223 *5362A8A036E046F14DB6C197E510822C43148FE1 FLESHTINT6
804,172,224 *53663722D7D7EB08CB18CF58FEECB3999BEBA237 FLETCHER.MABONE
804,172,225 *5369EF59F2FD7D36F0106E8F5698548736AF5136 mackremus
804,172,226 *536F2BF514A69DFA2A80F882D926EEE3EBC8F635 madeline948
804,172,227 *536E0BA4B248EA681C4F22D336B52A63A3FC7060 [email protected]
804,172,228 *5369CF1243E8A3C9A7BC810B78CEAF787A739EF3 FLORENTINO.STANGEL
804,172,229 *536EBBD1FA7C7BD8756106EBABE79FD27A00C8A9 [email protected]
804,172,230 *536A2B4D842FE2FA05CCC9F7F4B86244563B8E45 MAIDALYZTORO
804,172,231 *536E1A4E23C7243A3467C6D5CD6C3E1595CE771B FRANCESHERMANDEZ
804,172,232 *5364B6205D187C3D34CAC29CB4B58B527586CCAF MARCHES
804,172,233 *53651A2727CAB27424B392CF85A1F96A802842C7 FRANCISCOHONRADO
804,172,234 *536C841FF5E984AE6893515170867436190F2A75 MARGARITO.CONCEPION
804,172,235 *5362B567D55EC8DF90373EC17706B7807E3F6769 MARISE80
804,172,236 *536ADB325C97A9A7619B30F74D2B0B52A678EACD MARLINMCIFF
804,172,237 *536186F8385F3CFA7B637D9D94CE0FDA45E9297B frequencys
804,172,238 *536943E709B81598C460E4CE22FADF0ACA6F38AC FRINGETHEATRE
804,172,239 *536ABAC17FF6A9DF7826542CEA306710412959F8 @#maseru
804,172,240 *53634C5AC0B1590BC4C85BF3055B737F85BFE645 fz-9
804,172,241 *536CB9EF9F50DFDEF77AA8D2E7B25B12684CE08B [email protected]
804,172,242 *5369568BFB1873D0120755881A639C80378FA1EF maximopollina
804,172,243 *5367ECDD5536BBF292B1AFDA8AFEF929DEC50568 [email protected]
804,172,244 *536547E2ABC5C17C2932C04359AB546B2F5BF6A3 [email protected]
804,172,245 *5366BCB531AD12B0197314A58FB98B98B13FFDCE MCX'S
804,172,246 *5369EEDFC925E5CF957A5BDFB0D602527F1CCA66 garylautenbach
804,172,247 *536029E54CBCCFF4D03030F7F770C63A19F47A25 Mellow.Down.Easy.(Willie.Dixon)
804,172,248 *53640BB54097C34C3531A92AAE7E834F0E866CD4 MEMTYP
804,172,249 *536991BC2E46911E5837F7EB78A8DF29DF97AE1B MERLINSTIREWALT
804,172,250 *536DF47E70B208E7CD0C5606E6184DB5B9BF9116 GENARO.BONGIARDINA
804,172,251 *536C46EB3E0145A5E439A2E3AC96B2DC397349EF messerge8
804,172,252 *5364E97E17996047B7D57F6C512BF27086BCA2A1 GERALD.COUNIHAN
804,172,253 *5369682E073B944ACA1C5D11EB658EAFD4ED1EBB MILAN.NATALIE
804,172,254 *5367DD46E3005B4EFC0ACF74457D79685D443A8F milanpott
804,172,255 *536B107ED1D102C45D5943EA9E367E8DD775310A MILESSHARPERSON
804,172,256 *536656611EEDB981C090360E9BEBBC13449F3706 MILLARDLUOMA
804,172,257 *536DA5FFCE05FED4AF26B712DA424C4EFDD886EB MILLARD.MEISINGER
804,172,258 *5367652CCF181DE124AC3F2A4A4E13B12BA6A483 GET-FUCKED-AGAIN
804,172,259 *536D73947E2C7DC87735E76BCA583C29EE3F6BE6 minifunk-crew:-the-newest-funky-brutalizm
804,172,260 *53617D7D5B17A68F7967FCD38D0037FF989779D0 MLODAPOLSKA
804,172,261 *5360C45B850540120396C909CAC900294E919BE3 GILBERTO.VANWYK
804,172,262 *536F00234752EEC43403E2CB3B060F66D402CC6B GJILLED
804,172,263 *5360FBF99D4A73D0B9CE32B8F3803C34CE6C3559 MOOREA
804,172,264 *5363C5449CABC0B6D2A38ACF64B379FFE2610152 mr. scrapper's blues
804,172,265 *5369F2043691921506184C3AB732016BDA11A4DD msilartceps
804,172,266 *536867AD040971291B6A07BA008C5ED637DD0B55 mummiesgirl1991
804,172,267 *536E2A924BAC4D0BA0EFE6118ECB9B25898568CE mvdrwrsm48
804,172,268 *536EF61DFF1E3975495655B8757907B2A6C9BCA4 [email protected]
804,172,269 *5368AD16958318107C361EFC60797BB6E9F60EAE MYCETOPHED
804,172,270 *53659C96077A051E70BBC7DAA3E0E46A7ADF1767 graigbednarowicz
804,172,271 *53601E338A6C84C38D61E4832025C68A3A14CB05 [email protected]
804,172,272 *536522E688D57521D68FF40D11B31A5C3C318D6F n224=/[email protected]
804,172,273 *536B68060CC70C980128A417FDAE741934726DBD NADZENO7
804,172,274 *5362EB0BE1BC7AE6B1292576EC4194B911145F8B [email protected]
804,172,275 *536F217C822EECC542D22237C5DB981CA6B6222B [email protected]
804,172,276 *53679874181758C8AC8AD1CC4C8DDEF668682A0D [email protected]
804,172,277 *5361CF619F1BE89F368D62E4FCB2622A2D4EA660 gus811
804,172,278 *53626957D3341E916E798ACE274D48C25E6B06A3 GUS.GARTIN
804,172,279 *536CBE314CB4A7B1D0670EEF5A7DD4307138F4DA gusterni1
804,172,280 *53693B3E359C0A1A92798F96973A5B475B22A544 GWB68FC
804,172,281 *53697F39209B8AF70E85585EEA6946C8E09BD0C2 NEGNINYOH
804,172,282 *536EB4E086A6721AD5DADBEC23FBF29A99221672 NENANELSON
804,172,283 *536C5E46C844BC9C1636B4E43C488E3F3562ABCF NEWTONWARNICK
804,172,284 *536102D7A2A7EAA4F838209BE62AB0D26E2FC7F0 HAG,
804,172,285 *536ACD6A4C631B7B0B6756219DF96971E6556B06 NICKOLASKEMPSTER
804,172,286 *5361D3C92BD52332E2202DCA47550E3AEC93B6A7 NINABESS
804,172,287 *5367AAFF15700151964ACE1268DA41E10FCA39B5 NORBERTO.KOPERA
804,172,288 *536361158477FE2FCB4D8D89991DBF45030AFAF4 NPOLANOWSKI
804,172,289 *536FF7176E33CDADA354BE1D7253F3C4BF164037 NQMYBB
804,172,290 *53623BC614FF4C5CF1688A2171F70C9FD20CD4DD [email protected]
804,172,291 *5364F2AB8168EECA904D55F9463C17104229FBE2 [email protected]$M
804,172,292 *536D53EC3C04E5B518D13563097C0102C364BA23 harlangannoe
804,172,293 *536826528F6028165844C85AF73D394EB6795C26 OCH.D
804,172,294 *53622AB95072822AB7E0DBE20BF9ECE79E0B96DC OKLAWAHA1
804,172,295 *53641894294259419EC3614AA69A26486604888D HELOVES!IFINTHEBYGONEYEARS
804,172,296 *5363133DF3C34133D6F901F143DF354AC116C80A henrydyckman
804,172,297 *536BA3228FDC0049164B36C27A6D857EBA0F72A3 OREN.COLLIVER
804,172,298 *536C4658E53E1AB25A6EB4EEACEBFE068DF647A4 ORSSEUG
804,172,299 *536A419C8B143C4CF2C215C09563A673519E5B07 HERYNGS4
804,172,300 *536A99594FCFA325CCCB5434A122F017D7977952 OSWALDO.BARTOW
804,172,301 *536527687CAAED2ECF84992DC52DA28A34C42DC4 HIRAVROP1
804,172,302 *536FA169593BE58E10D1279D0FB0742D628E2BFF pa2670
804,172,303 *536AB0884D0C6DA9A748514F4F4894773BC9E43D [email protected]
804,172,304 *5367AAA9C57A33093453CAD2823CC7D2C54F1863 PAREGG1AM0
804,172,305 *53659838BC29575AC0EB64C85D90B72DC8139609 PÅSKBREVET
804,172,306 *536DB4F1B0C3801F648264DFB4926C873BF83D31 PATRYK-ZALEWSKI
804,172,307 *536591A36F25AEF9E1C3CE32A30B0DC6A030B8DF P======B~O.~O3B<-
804,172,308 *5367D818A0E233092A16A2AAABD4F3640D77A48A pd~o.(~_^)
804,172,309 *5360E255E3C967E474F353351270AE2E0B621A68 H=Y_
804,172,310 *5361296E37B7C599F56500DFE873368D21240791 IAHKCALBBED
804,172,311 *53641ED9A9C5AC021B6FB5CE16539BED46D697DF IAMHAMILTON69
804,172,312 *5368CA5DFB6735893C51516705276FA6A9C567CB phongpocomwww
804,172,313 *53603BBC58E8E161B28052F1FACEFBCCF1245C93 [email protected]
804,172,314 *53622DF18F3D4942605E5C7326FAC9EB0382E598 [email protected]
804,172,315 *5360A212996056648DBAB1862A078E0B6DAC35D6 IDABAHSA
804,172,316 *536F46B86C79F27E32180B5F17B36F95DDE73A08 PI384LDS
804,172,317 *536415BC7565621DDA180E43AC98846CB7CF7DC1 ihi4life
804,172,318 *536B57E5FE789B0C28DCE021AF76C99D98D447DA IIKKEILT1
804,172,319 *53648965705A6ECE0EB3A876F69F78AA5063F8F1 PLEJUNG
804,172,320 *536F5B9A57CA33F95C770DB5A2EB10BBEF27CAC6 POGRESSIVEN
804,172,321 *5363EDBE6BA0B418C11CFADF0407F19293C4F7E9 p####@.~o~o:p
804,172,322 *536E0C5B014AA50CAA87610AB730365E928CE801 PORTALLARIMIZI
804,172,323 *5367C3897A574F74D9897954C458B4F56FEE972F POTTSPOTTS
804,172,324 *536140945582037113687C861E8EE8D799F4DC9E predlozily
804,172,325 *536AE3EEFBE55629749D457E105F58DF79AFB041 INVENTERS123
804,172,326 *536937C4C268228809418D7BBF12B5931527CF6D i]pb
804,172,327 *53658DE6D94E2147C615BF2526704BEED9A3B0E5 PSYCHOPATICKÝM
804,172,328 *53653CF2ECAD6F6EF3A9C30E244A60044DABE23E IRIVISET7
804,172,329 *536FB9BE8F89FD14AD1360B030D078230CD36F8B irwinsheston
804,172,330 *536C09DC0AD29CE4DF3E6C51AE0137B8308C11F4 isaiaskobbe
804,172,331 *536EBC2C4E7E283B1870C8A831E13F5C8ADBE977 pui.yun.chan
804,172,332 *536191726E71A85DB12C03D85F8BE60A2375C6C0 ISHYAAM6
804,172,333 *536DFACB9DB3EFA70D349974A0219AAC0B91C257 ISSAC.ROSICH
804,172,334 *536E42B1746073A56C4F96AAA8C6AF599C291E0F Q05041970
804,172,335 *536AE294A34FD00AE9A5FFC592F13C3ED940CD51 [email protected]
804,172,336 *5367A77CE7317B8103355AC748D1F556875AE3DD ituserdpbsmithdpbsm
804,172,337 *53638AD8BABF6670B1C6CCF5BD39BA3A96F2D4D1 q======d.`(_0)
804,172,338 *53641D49E5C85A8E32E2FAC6EE13BB00A308E334 Q##D*-SPLAT
804,172,339 *536D5DA4C252488613474248DB472E3A76489175 J121401346
804,172,340 *5363D86B3E95687325A15D651E3CEB2857B1E812 JABBARIF
804,172,341 *5366C244759B2D664FBADF8FDA0EBE37F4DBE9E4 jackmittens
804,172,342 *536836C684CF43D492EEC4EE099CFDE20C02A143 jamedockery
804,172,343 *53670B97E819E1DB943A1C426863C2F5CE0A84F7 JAMELHESPEN
804,172,344 *536E56AC2676B63B7440CEBF7A2D1A4953804CB7 QUEEN2JACK
804,172,345 *5365F92131B171AB8A242B721583CCD01BD6AB91 JAREDPESSO
804,172,346 *53696A3350DE6B03A8BCFDB1237FD2A4A14C8827 jarredellenberg
804,172,347 *5362B2CEE0C1C52C277FBB49723BEBA3C8810A40 JARRETTJEHL
804,172,348 *536EFD8DFFA563C679E5084868E1396E91361A30 jarrettryun
804,172,349 *536133E9DA929BEF6178A9562D96881019A5FA09 JARVIS.SWINNY
804,172,350 *536C578880B721C9CE13BC32A0CD83B1A9221DC8 JASON.CHARANIA
804,172,351 *536181AB1417DECAC520E26E8446A039D7BF2CD4 qumandaed
804,172,352 *536FA2D6E2E31EE4B4D0F084FDB559E0F2F65FA9 QXTZ
804,172,353 *53641CACAF46A57A3885E982E90007A21E93467A RACOONJSBACH
804,172,354 *53617ABB737425E7E8FAE05338EC8675AE0F721F JERAMY.ROXBURGH
804,172,355 *536AA9323F57A423261FAA5D7FCE217F512BA963 jeremyeick
804,172,356 *536635F3FC2E5E566097FDF8F3B939DE70287F46 JEROMYMUNDWILLER
804,172,357 *5368DD886CCF4D9DAE9B6168719D624D9CBAF785 JERRELLTURI
804,172,358 *536137CE3F3FAA36A5EC6C17A55829652F7EFAB3 JESENJIN
804,172,359 *536A8B4F535BC251DD001DCF4FD982E961511FD5 JESSEK1998
804,172,360 *536286F73DD12662B8430BC3A541DC5029A0A9D4 jessica-mcadams
804,172,361 *536BE3E387076874CA4D09548CF0D4DA1102B9F3 JESSIEJENG
804,172,362 *5364B577DAA43629702B83244CE6C1ABB385E379 JEWELS-PART-2
804,172,363 *53614148CF6FE0EBEC17691C5133EDAD16BC2C23 jhun.bueno
804,172,364 *5369FD3B69CFBD55645FAD2115B84DC80F9C02EE REGINA-CLAY
804,172,365 *536F26778DCAAAE42E7443218A7CB0C6352306EB [email protected]
804,172,366 *5365E347AF7182C1B5E7DFED0C232762529CBB53 jill-hardie
804,172,367 *536E6F9F47D1A1E7E74324AB09A63E72B29CC31F jimmulkern
804,172,368 *53644B56CACC0FE879EB0FC3349490438F7E2803 [email protected]
804,172,369 *536251F333A184F72B1D032C99874520D58245DB johndarracott
804,172,370 *5365980D3312FA30877E099A8F7A7DFC2C392989 JOSEPH-MAGHANOY
804,172,371 *536638CB614D362BAF0C727823CEAA8F8719C88A JOSHUALARABEL
804,172,372 *5366E065C32B88770475FF22B99936BAFD445C8F JOSHUA.SULECKI
804,172,373 *536D3D5663F2681C4081762EEDC966449C794970 [email protected],
804,172,374 *5367CA56512330E3853C96E1A42B1A75E8A3136D JQ/C
804,172,375 *53655217015A172CC66C909629AD5E092DCCC6E5 riclitez5
804,172,376 *536517F22D24115CAFE695CF5C308D0546AC8FE5 RIGOBERTOCOWLIN
804,172,377 *5369139D3654DE0E050EFDF23C6744C9E716953C julestipre
804,172,378 *53613DDAAD0F26DC421A559C6225979B97E63B48 JULIAN216
804,172,379 *5361D31FD7641529B37D37D112D1B8C46D6BEC40 JULIUS.CAPUNO
804,172,380 *53652BDA43D6E170C45FF2FD94349E3028DD141D RISCRIVERTIED
804,172,381 *53619F05454A956A4458865F522FA478C667D2F4 riscriviamo5
804,172,382 *5366737E85B03597BCA0350F1A274D2E651A0614 JUNIOR.HOLSTEGE
804,172,383 *536E1B1C8F8F3EC13292C75186957D72A20845B5 JUNIOR.YOEST
804,172,384 *5364A90A6DD7B313D56F0130E09DB087B5CD1B2D JUSTIN-MUENCH
804,172,385 *536A95FD1D41B076C605675D83B117CB4D29CE91 jymmye.'/dz//i/m/i/
804,172,386 *5367B1BFC4407B1107A9DF1AD2799867DD0065ED RN(18)
804,172,387 *536C456FAD1931CA7BA0A49683AC30582B12941F KATHYCASHIN
804,172,388 *5360A16902F8EB9F7E51332895CBBABD9C15390B ROLANDOPARLEE
804,172,389 *5365589F0EAE1CD0266864707AD799CE6CEAA912 KCITSLUA
804,172,390 *5364617CAED41FBCA2A045EF30CFCC142CF458EC KEITHCAINGLIT
804,172,391 *536836A41FF79AEAE2829E2D80DFBC8B282773EB RONNIECHEESE
804,172,392 *536820476900C9881C4239A47269A77FBE71115D KELLEY.WOMELDORF
804,172,393 *5365E74B60BBA5DE6B35D6F9BB31F552CE150418 ROOSTERJOEY5
804,172,394 *53618CC16AA09A94D6F8905C7ADBE45E35DE07E1 KELVININOUYE
804,172,395 *53609457A435FC138AFC2C2DD029366BA9DF7CFC kelvinpundt
804,172,396 *536453E6C0220E2EBFA828A51BD3D24AEC842094 roscoebroussard
804,172,397 *536220FE6EFBE93CA7B9A7863D87632DDF84E957 KENDRICK.ABALOS
804,172,398 *536C3A330827F6C34195AB48F2BE6A272F974CBC kendrickcasini
804,172,399 *536D99322CD27C9E602A2182304FC7B443874741 KENTONCANGIANO
804,172,400 *5362FA71D7DEF81DF8EB5D14FC54FCB5E15D0139 ROSESANTHONY4
804,172,401 *53628C97F12168FCFABD9130F85CBF0DEC5C7FEA rosigara4
804,172,402 *536F2B74FF74C4BDFBD48CCC01AA5F4C7D37225C KHATHAWAY
804,172,403 *53674FFA1A84E57B408D468D468D453574B9E289 [email protected]
804,172,404 *536174C60C6779CE16C7FB7A3A322500711D6C2D KIARA.CHANEL
804,172,405 *536576F5147681AD4FD818A16E34DA46226110A8 ROY.DIOSO
804,172,406 *53678E4718B0931032EEBDE0BD1DF16120144EAC ROY.MORONES
804,172,407 *536341538521464E9A97E6DB44393B180A4DF561 RU8T
804,172,408 *536BAE5DD64DC7E07EBED312A4BDF0616691E273 KOLI-STANCE-/-KURT-SCHWITTERS---ANNA-BLUME
804,172,409 *536E5270F953D97619209110279756A657353AAA kristofersilbert
804,172,410 *536497E78E1ACADB99DA88F5E331D7E64A6FEEB1 RUETANIMONED8
804,172,411 *536266F59BC5BF4F520FAD37FD026938066A2AB0 RUNOTUOTANTOA
804,172,412 *5360A5D925A7C6C9F29CA59D3323F737FCDDE45E RUPERTSATAVA
804,172,413 *5369647F32E15D0D248B081CE6DEA803D35AD6F0 [email protected]
804,172,414 *5365B72EAA4E57C898EFBDA392EBF71A6B7532C7 KWALITEITSMARMER
804,172,415 *536F7ACB44EB68036BAA1B8AE15611A661CC142A [email protected]
804,172,416 *536905AB1ED369C74D9A209BB0A86288829378D6 [email protected]
804,172,417 *53620D43CCC7D9065CD7BA5E5CF4085CFF07358A LANE.POUNCY
804,172,418 *5361ED1C1FA6BDF5883ACEC61BE513D5E1ED098D SALVADORALBERTHAL
804,172,419 *536F06CE16EF5AC1C80F6B8584FA549E7817E767 laurencemehta
804,172,420 *536029A912716E8F03F2AF95DF1899DD9152D3AB LAWRANCE12
804,172,421 *536BF4809F251F942502502A3C74A9F326CA69BE sanchined
804,172,422 *5364B8D69427D7E5EE83112617A8922121961E30 LEANNEBINGAMAN
804,172,423 *536D913339256723B20CE65D73C3ED713D3990F7 LEFTBUBBLES
804,172,424 *536E07161DD55D5DB851929FD990B630B9A96929 LENNY.JILL
804,172,425 *53627F59FC9BD86EE7F758C7CD2DB203BC3FA951 SAULGOOLEY
804,172,426 *53649DCF4435FBEE81AA1AF47E5B31CD968F8341 SAULLYME
804,172,427 *536928060813AA667B9AAD7A6CDEB9A194C8AF63 SAWENDE1
804,172,428 *536F8D6FFD3515104898F5A485C0779B4F9D23AC lesrutman
804,172,429 *536B259C8D9B66A3CF762E59592617D61378D9C3 SCHOUWSPPING
804,172,430 *5362291B7BCBFCBEA24ED7D7BF64856B68B64195 SCIENCESSRIDHAR
804,172,431 *536D52802CD51152ADA14992834DB95B44B6901C SCOT.KREAGER
804,172,432 *536200926180FA2E0169D0ACFDEF0A83015C0BEA LIBBY00
804,172,433 *53639D225BBC4750FE333E85FF1E507177335D49 [email protected]
804,172,434 *536181C64FC6FA7F675C21916B930178F36448C5 lily1057
804,172,435 *5362E7731903D6653EB9F1B6691F0F69E40192F2 SEGREVEL
804,172,436 *536B0804CC3570C433AA3F0A3FFB39308C799709 [email protected]
804,172,437 *536E32989911F1F09C3E0C7D6D4F6FFA480A61B8 SELBAIRAVMETSYSELIF>IL<
804,172,438 *536022C0BB541DCCAD7AA68014A50FF50B0A6C52 LITTLETAI
804,172,439 *5364135DFAAE1378C5C29C28AEFE9CD02C3B268A LJ)8
804,172,440 *53604C8CFD31F9CA83B4FD4A4001BAB5979001E2 SET-GUITARS-FOR-KILL
804,172,441 *5365A7785B273F67C2552D9BB6E3EBF97AFFA5C5 lottammo?
804,172,442 *536B40B3460A762C352428531C69C48EF671F61B shantell-young
804,172,443 *536F519AA0075EBA033546DF2A54394EB9CACC90 [email protected]
804,172,444 *5366BEEB3448588734F06EB45C406E4DF6DE7511 shepsstafforgwww
804,172,445 *536FB8917FDDE546E87AC8FF3B5C43C2E72EE0FB lukedellos
804,172,446 *536F8316D1C16BF7A4BB89CDEDF8EE81718A67D6 [email protected]
804,172,447 *5366BF8CF2FD805D740AC43F43AEB24D5CF0F891 SHIBAKUZOU
804,172,448 *5362C9EADBE2DB2D9EFC4FD040B7434CEB353F97 LUPE.HAYDT
804,172,449 *53627BC828BF62189117ED62967F784E40B1F08B lustres
804,172,450 *536F879F0C6E18F527414444FC0E402D3F9BBBCB LYMAN.RIFFLE
804,172,451 *5365E2D9E745DD08ED9D00047129D99BFE2E6DBD M47HEM47C4N$
804,172,452 *536934B11FB622B120B0DE447DB541E04A09150E MADELINECAMERON
804,172,453 *536DD3C2A68BBFD841DEA0DB06DABB773EA6BDD6 MADIIYAM6
804,172,454 *536EC0CFCDC19E99240FA51F6D2EB1E87BB2D33E SLIDEBARBSW3
804,172,455 *536193933626A71333E534F4293AB89A22D2EAE2 MANDITNS
804,172,456 *536183649600F1207C8A2D61A9015183F9F761DB SMILESKATHERIN6
804,172,457 *53663B1AB7686B3519FDEDCABA881847ADDD3E62 MANUALWERNICK
804,172,458 *53689A1C92E799E0659B002B67A5008F89870780 S(NATKINGCOLE)
804,172,459 *5362ED631830D328E500D028C92659619D8A7750 MARCELOEBARB
804,172,460 *53677C3AD16EFB52A1E363C055DD0AD8FC810793 SNOREUTCNOP9
804,172,461 *5368635477DB68969AEB1B38816357797B586D8E SOFROR
804,172,462 *5364EB4096F4AFB4DF644EAE499D156C422E0045 [email protected]
804,172,463 *536574C081741AA90998B4FF5EEFE76969541BB0 sonnycampoli
804,172,464 *536442E5ECA59D4C7D5EF13A92FF73D63BFD9BA9 MARKUSYACOUB
804,172,465 *536D3194F05C2EE9472A62B601B52C110AF5102D source--could
804,172,466 *536EE60ABF0723F49A2F355943FAF6695E743BDB SPEKULATIONSFORRETNINGS4
804,172,467 *536FAC17933DB6709775D3A7CDC62CCE09968506 SPENCER.OLESON
804,172,468 *5365C510F8A7E9EFD30BEC74147C750EF5E39EC2 matthew-gotts
804,172,469 *536D7E589676D0D533AF52F2B628755C22E906C0 SPERULITICMI
804,172,470 *536CD0EA24934E2A3A793AB7750616787FAF7928 MAXWELL1Q2W3E
804,172,471 *5368F2A06BB6250C224D66B3430E9B5B752D0D36 mayungan
804,172,472 *53647429AC5CDBDB220169368A01C863F20BB5C0 melaniesteyn
804,172,473 *53614791D3D1E2D782027834E879CBDFE43DD18E MERLEKONON
804,172,474 *5360A2818AE17E7E9CE24DE329D9CF3F11669D7B MESTIZOES.
804,172,475 *536B6DA1656B32F361ACF6F536CBAC2BCDE5CD7D stemphyliu
804,172,476 *536E6333995439C6070BAB9223DE3D1F7385FF0A michaleburkman
804,172,477 *5369DDD7E0BD60FD55523E70A84AB0EF013499A8 MICHELLE LYNN KIRBY
804,172,478 *536DC8FD6A4CD102772E62D8C3DB77D03871D203 MICO
804,172,479 *53680283C5C9681564F909643F70F585BAD526F1 MIKEL.GROTHOFF
804,172,480 *536DF7B7B30C28C56D4B620EC36CBD0C340CE5B5 MIKESBABY06
804,172,481 *53668EB764AA47027821A7C7F3355F448680A992 MITCHELL.DIVITA
804,172,482 *536AA5C81B98752129B6A78C4A5586AED8FE8DF6 stevietreichel
804,172,483 *536C8386C12E56E4B313E19B74A0D5AA36BA4C53 STINGERETE6
804,172,484 *5367483E28B7F7C52514ED10D95DC07F1DF79345 [email protected]
804,172,485 *5360B54E35C216A1546EF8F0DC97A506D851CCEB STOSUNEKED
804,172,486 *536DB1C318A9B79ED7FFC853C7F19729CF091F23 MOHAMMADCORFMAN
804,172,487 *5362B2C88D74DB3BD4B281A03F632376DB5323BB STRIGIFO9
804,172,488 *53670C169E17D5C305A9DF2A0B1FCCA7BD1081A0 mortonskerrett
804,172,489 *53610DD27BE3D491B348A0F8586AD2C59CC3F828 MR[*
804,172,490 *536AA14AE7014C74EC3E3770136FA93B9C092C46 musicthumper
804,172,491 *536266DABCCC46FE8933B2EBA6D852D94367CAFE NADLERS6
804,172,492 *536FB3DC0871F93168E048C1E81A12386C362B5E superreq0
804,172,493 *5369E245E41B34F367A9BDDB0EB6EA935E76C28F [email protected]
804,172,494 *5366EE6E5B14A5D1CB519FD00793EE84B6DC4AD1 NBC-SELLS-OUT-SUPER-BOWL-ADS
804,172,495 *53651B537C514FB4991AD320332CCB1631E9B33E SYLVIETIMBER5
804,172,496 *536230F203E0CC3509C282249274A864631BC397 NELLEOK2
804,172,497 *536E2AB6A7938BFB3E92A4FA42118013946E0E43 NICHOLASSIEMSEN
804,172,498 *536DE1B9222D6C513971498BDBF388BE5A401B73 TAGLEREN
804,172,499 *5360469F8658A21C957A796828D2E458B4AD5FDF nodegande
804,172,500 *53640F7711526D8C6649B5B2D067081E0362196F TALKVORPAL22
804,172,501 *536CF41DC28FE3FB83E8E73263A8AADC64F9BEF5 TAMQRAH
804,172,502 *53604AA4089F0D05B54AD212F02FDC790B7E5B5C [email protected]
804,172,503 *536F05E5C948E34C4202B64A4A1FD95269C3ECF6 NSUANSING
804,172,504 *536AABA4BDCE9ED326D51288A975912F3D79AF4F TAXWAX0
804,172,505 *536E4EFB080CA121EC5A75006487A9E317C70ED9 nykommer
804,172,506 *53669DD543E18B19E1AED15364087FDA00A3A8FD TELLINGEILT{
804,172,507 *5361DCBD6D741A99EA505D7F4D4975A6F3D945F5 Te-Pe
804,172,508 *536A085575BF3D6B89D36588B25D94A29756B90D TERMINADOCONTIGO
804,172,509 *5362776A5E47C64A79F962A22F2FCB7955AA391A [email protected]
804,172,510 *536887A7FCD4B315CD612891D899B09A4D1195AC TERVEHDITAEAEN2
804,172,511 *53675862BC93E9563DE2F3F6F2A8A310D7EDB0D4 texomafishing
804,172,512 *536898EC4113DEE708081846B443DDA2ADB045F0 TEXTUREADDRESSING
804,172,513 *5365C4063914D888B1FB38433B161AB2DF61664C OH!YOUBEAUTIFULDOLL
804,172,514 *536454CB4972C9BD38E2382A202C45D696C61A05 [email protected]
804,172,515 *536237DD2C9E880C4E3E163E2DF524F568818C74 once-upon-a-time-(album-version)
804,172,516 *53642B133F7EAAB0AA7613F10A77D3DD57AEFA63 }o{~q###B
804,172,517 *536B1A75EC2FFD02C1900D4B34777B95ACEAB16C THEBLUEJEANQWER
804,172,518 *536B89D1DE03B9B776D9210B1D05512206A101E1 OTREFER8
804,172,519 *5361A77FD598A2DDE926CEF7727A45ADC7E35AE2 THEMITCHELL2003
804,172,520 *536542EF589459871BE58E2D91C8138D0EF30C58 PALMERHARLING
804,172,521 *536D8797ECD9337F88D375B699ED251F943668B1 therouge1989
804,172,522 *536AAA2CD0CFF4FBCCD96B13B3BDA31900FFF687 THIENCHIT
804,172,523 *536855CE2C71DEBCBCEE418AD96E8CF013CBC6FA thlunaut7
804,172,524 *53604D810D40B01CF9DE031F5F048F4B85B94DC5 thou-takest
804,172,525 *53649554F7655498B77655700F86A43A80625BDD [email protected]
804,172,526 *536F5FB504E1A1B6B787A2ABCC550ED28598C344 TIIZB
804,172,527 *5367E49147110E78CAFB8113317231083AB57285 tilvksts2
804,172,528 *53651F9FBF63D73B756AD548383433B2B6E1FCB3 TIMMY.CENA
804,172,529 *5363BF0DE4ABAB812D894DF499B567CD182A9140 PE571ED
804,172,530 *536525DFE9355E0630799FDE5101D525BB6081AD pelletezs
804,172,531 *536707EBADF19686E3EC9DB3C3F9C14E3B912CBE tlumaczeniem
804,172,532 *5367D2116EA1256D49720D006671722082DB72FB TOMBOK1
804,172,533 *5369920D7AC3379EB0D8D4B5C2A253977C62960A pianopracticing
804,172,534 *536FC085E4638DE8ECF36F18DEB4B15D101C6C33 PIERREKEAVENEY
804,172,535 *536D2876F711293589DBBE3B4A695A2119ABED9B torment-1
804,172,536 *536F4E4851683B67C17A9F8BB0DD9DBA1159C7DE TRACEY.CARMICHEL
804,172,537 *5369CFB60F45254ABBF73587491497A00F4969F7 PLATYHEL1
804,172,538 *536C7C909903C176F288AEF8CE4835804AA0878B pleasedon'talmostkillme
804,172,539 *5367B97498519BC71033E9BFE20673C91408B994 POPEYECASSIE
804,172,540 *536616A2822CD25E5B90FF5237E1FD01A2136C11 TRUDERINGER
804,172,541 *536F40A731255B0C8A8E75E6E27DDBE5172DD3AA PRE1!+ERA+E
804,172,542 *536A333E7A929328054B521D6514928255C8C2F9 [email protected]
804,172,543 *5360704CE18DC1157EA2F3C05C23960A4CC7AAB0 ^|tt
804,172,544 *536932ED51F30F66E91B0561FBB4395E08284822 ttwltd
804,172,545 *536CCE316B71686047646B0F39CDECF63004897C TUTTLETOWN0
804,172,546 *53674224C249D36B0D56E428E628C17985AFF311 PRIMITIVE FRIENDS
804,172,547 *536E693EA20C815F0DDDA32BA819C8F76E0B54F1 TWIN.TUB.TWIN
804,172,548 *53653BC950C518F625AE171E089AD799EEE3C724 TYISHA.WALLACE
804,172,549 *5366BB9458592A9230A6B4E3BADB0E97E5BD5E95 tyler-t-aevermann
804,172,550 *536C514511452D709FE6EF45ED4ADC80177AB48E TYLOMATA8
804,172,551 *5362D42AEA92BBF3BDE1F121172A37DE1C1A4C6C UCUP YEUH
804,172,552 *536B35D08889B433680D4F29E1A19BFB8960F56E PUBLICITETSJIPPON
804,172,553 *536761078C5F2C29500C3F883B7C8E5AD272D754 UJJWALAUZGARE
804,172,554 *536EF1C35B12293E64DF745380DF91DBB3624744 [email protected] ~ `(_0)
804,172,555 *5368A0F5B8A903184DB8636D3CC6B6196B504025 UndalsdasLamm/2Siegel(Johannes/Chor)
804,172,556 *536CB182F2CAA6A0BB5FCF134ADC43C29A95B08A [email protected]`~-`~-(O_-)
804,172,557 *536FF3DF933C80A24E90C561C0DE425CFA2A38D8 q=====p ~ `(00)
804,172,558 *536EDB016322CAFBA925EF70792591F976E67A41 URHEILUMAAILMAS
804,172,559 *53639A36A94EAD451441DD7755F36E74A91BACED uribe.te.amo
804,172,560 *5360A9A1A383FDAA890DB535A09F16E41CA571E8 Q: WOULD YOU, IF YOU WERE GIVEN 2 MONTHS AWAY FROM MUSIC,...
804,172,561 *536B40C88F0EABAA66DE3C71B961AA8AB9F8FAF4 [email protected]
804,172,562 *5360F42C9BA1BAF464FC9CE4913BA660190CD179 USS_HERRING_SS-233
804,172,563 *5363FCFB97EC42E5DA45E61E18E0D4D9E554E4DF USTAMNAK
804,172,564 *536E7F957A1DF88755E09477A1B257718F36FD92 v3$ic0t0m
804,172,565 *5366E958BA0F5FE42EA6E932BB4C9810ACA76046 VALENTINCADDY
804,172,566 *53600FCB24FFFE9D12EB79DEC8D251BF8252D8DE RANKINGWHICH
804,172,567 *5366C9C17123B6F3497128318B85E961F90EFE78 RAPTORFENDER
804,172,568 *536D208A2DCB8DAA875C9D225674BCB23F0A911B RATIONALSCEPTICS
804,172,569 *536C6BA1387C8C76F84D0620E7C38A2CDD9F260E Van-Gompel
804,172,570 *53668F2F070C1A5C54D1EE8E07AD5E8974BF00C8 vanitychurch
804,172,571 *536823BE7FF0EA2E430BB6D6E38701638C4758AE VASILIS.TSIOLIS
804,172,572 *5366400B44F6F006491287238A0FA1638B06B6F9 rdsj
804,172,573 *5360A556EE35FDB59F9A4DF61CB48069D8B422B6 VENICE.HOTQHIQ
804,172,574 *53697ECA62F3B8231055D72F861689E38B1CCD39 RECESSIOBSW
804,172,575 *53675986E7DB3E0D900E42AD44C895BEA6297B5E REDAREREDARES
804,172,576 *53675CBCA0D6AB56FDBB6AED86632812CC445DF0 redismisses
804,172,577 *5366F6C082727CE59F883E7D87FAF2EE3974E559 VERONICAMACEDO
804,172,578 *53606EDEA6F8A274610C6848F0E693A944798140 [email protected]
804,172,579 *536AE60D91DFB30068B28056CAB12CEC11502D5C REPOUSSAGEN2
804,172,580 *5360EA2AC9FA0170FBB047B4031197D609DC906C resonate.3.(mixed.by.guyver)
804,172,581 *536B09A7A69817D3589C509425ED66350C863414 VIRGILIOARVIZO
804,172,582 *5369D6912C797BE7FB31C3425CF0BBEFFA941463 RETSINAKZTASRE1
804,172,583 *536BFEA3E2BFA6B6F81BA53FBCC3F27CA06E5BA8 reversiontothemean
804,172,584 *5367D76A95F6938E86388D9FEE0F5CF649B2715F VON.MARAZAS
804,172,585 *536BCBC9886564DA4A6E2C7B870D067170CE8809 RICKEY.LICO
804,172,586 *536E8088FF17F7D1238650B2E7122F180A744850 vriespun6
804,172,587 *536757077D6A1DA94DF4BC80BF8D5894BB59FB83 [email protected]
804,172,588 *53686DC2EF2FF2B1E1DB0E1998590DD27C15EC94 RIEKKOLO
804,172,589 *53668647A38D43211F7DE5609E0F3954CDB80450 W4R-BL4$T
804,172,590 *5361EDE6A544065E9CE61F9737FD709694CE0C0D ROBBIESKLAR
804,172,591 *5362E075BF8D2BC7357CC9EFC0764F079BE232AD robertoaldecoa
804,172,592 *536095427290E87602E882C45829C3295617173F ROBERT.SUFF
804,172,593 *53634E188A24FAE9A078CB2A053A17983393425C ROBERVI
804,172,594 *53672448862C6F2BA69CB6ECD24A009A574E2878 [email protected]
804,172,595 *536CA8505874D3000215BFB82F1524C2F422E09F [email protected]
804,172,596 *5364D0AFC8CD4E64C5E2C8720E2C60024B9031C5 rocklords
804,172,597 *536992DA1AC027347990312A25F43F2C3DFFF4A9 RODRIGO.OSENDORF
804,172,598 *53607582E66F2840FCCB8AE796080C8FA7EE21E7 roemahku
804,172,599 *53618B3118E4CFDD270519482619315F9C856898 ROLANDOGOELTZ
804,172,600 *53632261D9A36E71420C1E7590AF65F5EF57035D waynereeher
804,172,601 *5360EC02AC130D3B3C672E15E4AB67E8245EE7A7 WAYNE RILEY NEY
804,172,602 *53660EB8C20E2132D7755D22FE2783C6F65C3BCD rollandmeads
804,172,603 *536B96DE7FDE915330212936BE7C98ACB9CD16BF ROMANISTE3
804,172,604 *53652A7CA2FF22F77E0C523F52EB8E25438A65AB we.are.the.champions:.from.we.will.rock.you
804,172,605 *5363B6C99C0CB752CEB9F3ECC7F560B1460FB9E9 week10date
804,172,606 *536698F602F5102ED7B39D37A2F2F7D0576D20A4 rooseveltblindt
804,172,607 *536AB9943FB0FD9FE51BFE35DBB9177A0B79EEC9 [email protected]
804,172,608 *53669032CB66872729852B4D77C9E964242443B0 [email protected]
804,172,609 *5369035C062E5E849C0C7CD519818EFEB0ABE50B [email protected]
804,172,610 *53660C04B5F3D9E1F483329CAF2822F2B8E503EF wheezer
804,172,611 *5368666392F2B3CFF943503859E945AB726CF192 rufuscharlie
804,172,612 *5365AAEC1511DA3D3BF7B6EE14B8D4AFBF356AA7 rumo&diewunderimdunkeln
804,172,613 *536AFFEE7472BEF4A11317D513D88E954FEDC636 will-do-as-i-may:-that-is-my-rest,-that-is-the
804,172,614 *53692AA7C34452D179C198EB1EB0B3BDC963463F willemsonnema
804,172,615 *5367CF1B8CB03EAC809B15A5FE8585B30FF0558E RUSSEL.ONDRUSEK
804,172,616 *536D6C81DC7AA7D7A8D340CBD43C54E4E37D1FEF RUSSEL.REDSTONE
804,172,617 *536EC90D0163CC1343670CF24F109B646E4AFB65 willianheaberlin
804,172,618 *53665B701329719AD1FB42289A38258EC5E225B1 williankarsnak
804,172,619 *536E9764E27CFD0653C8221EA6F778C218D1CFBB RYANBELIVEAU
804,172,620 *536268AD355DDFE26FD2A4F843CF8025D151A9B4 S120074
804,172,621 *536D2C052B9B882D1E76B75F642B011800ABC703 winchester-cruz
804,172,622 *53624C260D5E3DED7D7D5BA78E347136CB8BD8FD WINEBRENNER123
804,172,623 *536453A2BE18960ACB6E3EED5254B2BCDE0C2595 SAMMIE.WESTERVELT
804,172,624 *53683EBFDAEE8D912B66E87CA1832D4415799DFA sammystudly
804,172,625 *536A7D03A1A88010652FB5F5CEDD93DC8FFEA0FC WRNGLSS0
804,172,626 *5363A8FBD9C5AD423267FBEF8688793641360AAA ww21u85gt674xf8z95zb008j
804,172,627 *536FD30AB5CFFBEB911CA64B562BFF5F528B975E WWWBLINDDIVINECOM
804,172,628 *536977CB301A5FEA8746906B70A5A37CCF98C605 wwwbpsgoidrelease
804,172,629 *536540320CE097670DB1CC3747678A15E8E6A0CA scarnatrici
804,172,630 *536C6B95584FEDD1037558C1403C8BEAD15C4485 SCHLEIMSCHEI
804,172,631 *5360877F6AB322566AF779F907FDF0B0080B90E6 schutzzusagen
804,172,632 *536A2F12B501B2D72EF14F9930DA6476D83452CF xavier-john-pagonzaga
804,172,633 *5367EDBF10AE102BE1867E1007B054BD7188611F SCOOBYBASEBALL
804,172,634 *5364E6BFB92CD4E77079314F88151F97B519351C SCOTTYOSCAR4
804,172,635 *53668BD920E09EC999577964A622AF34C1DA8E42 scuba1rainbow
804,172,636 *536F8F4FC4F7468C1BC940A0AB85EE99EAF7BF14 segunda.division.brasile
804,172,637 *536B59030D37DCB347AE254E98044406B53C35A7 SEISMOLOG8
804,172,638 *53640DB206349A5485AFD4A938CD084D34C6484E SELF HARM
804,172,639 *5361EEED8DC927D6B7064344C0459DD4EE49FB6D yacim.emmanuel
804,172,640 *536A6BC363D71CE11B5FCB0DF1E5384A13BA369B yamucha5
804,172,641 *5366535D43A5E4C3287B47B36918983B1C6381E2 SETNASIAFLAM5
804,172,642 *536927B00825E698F00DC9EB853F706B9D348D9E [email protected]
804,172,643 *536CF7185782C6C644AC2AF093531FA1E24D0CB2 [email protected]
804,172,644 *5362ADF7BDC7168F1C6FE44E64F49905E0167C1C [email protected]
804,172,645 *53627F4CA3FC28AAB0C70AD16869A920078A6A57 YEOJYNOT
804,172,646 *536B4EF36B8CEDADD36DFCC1F2FEB857B48982B0 you'retheone(lpversion)
804,172,647 *5364621C054825D15D75DF0A3DEA0B89E21E1B56 YRATUBIRTNU9
804,172,648 *5364A3E24CBF80CC3656BFF850EBA7CB78E1450A YSHI IBANEZ
804,172,649 *536BEEC51919F6AA9A143D7EBBDC107C78BEDD1E SHOOTINGRANGE(FEATWARRIORQUEEN)(INSTRUMENTAL)
804,172,650 *5363EA6EA20DDF2C299E8C56BCBC854765BE63BB SIAYARF
804,172,651 *5367EC2A49078F07A4294A123F3BCD5C17347DB0 SIDNEYBABINEAUX
804,172,652 *536DB8E489C5B582A1DE3C6F59B68FE5C2B44D7A yuralinnyk
804,172,653 *53618430AFB7C95E36D0379668545860381C57BC yvonnewege
804,172,654 *536B9322902385BF42A89CEEEA63B5AF8E3E1944 ZACKZAVCEDO
804,172,655 *5368D23875170E42B0280CFFB6A52ABDD4B18948 zahlensp9
804,172,656 *536054E00CD23BF6F55B5B67E6F8A8A52C2FD880 ZBMKOBQVLHERMC1
804,172,657 *53604B735FE63C70D41AEFB5C33BF5ABBAE28AFE [email protected]
804,172,658 *536BCAA96F66EA8B20F45DEF9A67960536FE07D1 [email protected]
804,172,659 *5368BC8887B430602C70B43319CC4F704C094A07 ZHBLLOKIMIT
804,172,660 *536D2B70618CC359685DCD4B1AA502732396B44E SN4KEEYEZ:
804,172,661 *536C09C9141916B87ED90ED7BEBCB1CCF52C8EA7 SOCKETHDRBSW8
804,172,662 *536246D32AB1A29C8351FB44BC5B3B76C608A41D zipper-topper-zqicker
804,172,663 *536BBBBDF9EBF7C6ED663D7AA5FC5EDF86E750CE ZITA.NARIZA.S
804,172,664 *536F03B866350066482D1EF17743E3B349ECA6DE solomontonic
804,172,665 *536376B7C4037BCAA1F5899E20D592752E8D4234 sommerais?
804,172,666 *5360EE18308D0259285880C34EE809B1A6B070BF ZUBVALENTINVALENTIN
804,172,667 *53680E124FD7FAB1CD4AFFF973BECFF55653BC92 βιβίσκουσ
804,172,668 *536A43B5EEF0EE6BC0151AED2D6BA5E9E3873380 ΠΡΟΜΎΡΙΟ
804,172,669 *536AE56AC7A5CB0D1C169EED45C5EBB8DC0F9AB5 SOTRIC
804,172,670 *536F215E56032211A72BEBF8F42E5E34D420EA22 SPCHRFHLR
804,172,671 *5361B1224785617952E72BFF3B0BAF1C26C99C4F верхнебаварской
804,172,672 *5364DB521E23A44BC271C906DEA11ECEC0593D04 spencerschneidmiller
804,172,673 *536FF835D757738DB37E16093EBAE8A0696F70E7 SPENDING TIME (FEAT CHARLI "CHUCK" BALTIMORE)
804,172,674 *5362A6E419779BA3021C7D1004B2D37533724716 ИЗПЕПЕЛЯВАЛА
804,172,675 *5366D4210A838C3DC88E11B52C4C2CE877D28E4E SPLAT ~ ~ @Q
804,172,676 *536EF54EFEA613E084969EF60466ED4E13DAEF83 НЕСБЫВШЕЙСЯ
804,172,677 *5367B371FC6F37004D0151B8508DF149C3B226DB SSE AUS DEM GEIGENKASTEN
804,172,678 *536091EEEAF7AB1689A2FEE0D9376ABFD3C24908 st7aa
804,172,679 *536BFFD429250739D6B8C7D0096F57DC2F064F9E ридау
804,172,680 *536CD9A984A5A733D5DD74B3F6969BEEF79DF348 СЪРЕГЕНТСТВО
804,172,681 *5365BDE6E92D165617DA843D16F4DEA9BF31A639 ТӘҮЛЕК
804,172,682 *5368157DC1B042003A4991F19ABFBCB90ECB8515 ХАРЧОВИКІВ
804,172,683 *53607363590461E3D58C6E8A0A979CC77D240247 SUNDANCEMIRAGE
804,172,684 *536B9F12F2223E66B2A4DD05B15BE712B9F4A54C SUNSHINKATHRYN
804,172,685 *536E40174C218FAED239BC408D06FD1A1638D0D1 tahmanbsw
804,172,686 *53685558B01C6FA2D039901AB608FBBDCC5FD64E TALKFULCRUMPRODUCTIO
804,172,687 *53624F9E71E43E3B0C536654A4427E5D64B7FBFC TALKZULLWIL
804,172,688 *536D807E2B17B356E069F4F5F85B8556E1B1278E TAMQRAH
804,172,689 *5360306932FEE082180A29BD674EC39F66EB5590 [email protected]
804,172,690 *536B5F0BE96F879CA2D51876F118BF1B51C37473 TAPIWAMUTIZWA
804,172,691 *536085B26A4A6AFF18B5331B8F02188DF8413293 tashkendall
804,172,692 *5362FE07C7A2347D0972D4453432265BE9CAAA86 TEAMOBRUJISS
804,172,693 *53672AC87B7301B17F76EE06EA1ECACD8BFE085C the soulsetters
804,172,694 *536668327ADD887712CC51B8A16947CADA9372E9 TIME IS RIGHT (WHITESIDE & JORGE MARTIN S FLAMENCO VOCAL MIX)
804,172,695 *536260E319C3CDC3516EE4F7D6FCEE1EF039E463 091350
804,172,696 *536BA205913BF0925E00FDD39F4EC0DA1EBE7574 105-DOGMA
804,172,697 *536A73AA9D0F957834869B1BC57459C915B1F0FC TIMOTHY.KEPLIN
804,172,698 *53674E56B17E5DFB64E737425B13280F82A2D088 1110433 palautettavoij
804,172,699 *5362366D4D52AD00A67A1C9F8F396937CF0BBCD9 TÍRKELDÍ
804,172,700 *536D6C16DD019C8613AA62BD49F7D3E1551CFB2B tittyna
804,172,701 *5363231CB4F5A62487F733A817E292E9C7E0E919 136LIAM
804,172,702 *536ADE2C74A403CDD37C21162117584209E2C335 tobiaspretlow
804,172,703 *5368D20EF44BBC5C2B4A4F54809B5AD899AB99FB TOBYTANNER
804,172,704 *53629EA7730C07279EE7398C6055E5F80E40AB6B TODD.BARTHOLIC
804,172,705 *536CCF69980E6805055323FBC87C6D5EE4FC2F4C 1617106 vastaavasti osa puhdistusprosessin l
804,172,706 *5364E98A9EFE08C23E223A17C9C7D5D99C906C65 17.06.1418
804,172,707 *536A58A0AC5DD0E0786F3D5C15A00F79DEF7C6BE 1835719 und.wissen.tue.er.rein.gar.nichts..
804,172,708 *53681C3DF103427DF8196831AC4249D5F5127D81 tom.tucciarone
804,172,709 *536C08B776A3C70AD86F22CEBD661C26C1EAD96F 19-ROTHORNBAHN
804,172,710 *536FCC168D7A5476261738C9C43587D124568837 tradgarn
804,172,711 *536591E526E50A35D326097DABA23A9BCFAD2385 trash(featginashock)
804,172,712 *53693903F21F08AA944564C073DEE5BCDBF4609A 1-BROTHERSGRAY
804,172,713 *53675F87D03AAD06BCD9DCC279970B9260DD5788 1chaswe
804,172,714 *5360218B44B4AF67B70E22BF8EFF519F552AF56F 1dnuow
804,172,715 *536671F20C68876047E57DD0B31E74C65DBD1BB3 1FLATSOLED
804,172,716 *5363C8BDFF3D63151633DE666E726DDD3D35B3DD 1GSM-LIITTYM
804,172,717 *536CADB8F4CC4734CF51A9AFE45921587DE941A7 trojanmenbanner
804,172,718 *536884A03C502DB0F61BBDB5C514C89A563519D7 TT0419706
804,172,719 *536413E4D631B1EDBF2A75AEA0CB5CBDC62FD0D2 1just-good-friends
804,172,720 *536913484805F8444ABFF77DF60C4B2E741D6F3C 1-KANALBLOCKER
804,172,721 *5363DEF6519B1F2416CE0F25D39F7CA073FFE45D [email protected]
804,172,722 *53622C7A227658683764274945B1A9C7864C6D6C 1 MSM'DE
804,172,723 *53619A9EEA8012AE0CC17FB6DF48CB4584F8E666 1NEV174B1L17Y
804,172,724 *53630BF1B209A380EBCEB3B5C1B245BBB5CEEECD 1op21jteqzu6z521w2
804,172,725 *5366B9F4755DC502F52F2BC2AECF42A89E19F12E 1.OPTIMEM
804,172,726 *5366B504EE63BCA24E02284F52FFAFC9AFB66D89 tzyh
804,172,727 *53699A939EEF5B77D259865F49F5B881C9B83FF4 1-SCHUNDHEFTE
804,172,728 *5364536AD792420123C2E1BF0875AB50C130DA85 1 SKRIKE
804,172,729 *536E5029B0AD640FD0ABB3EEBEF0D058A459F0C0 1STDUE153
804,172,730 *536E67D9F073F09BA46731DEAE7AEC99DD9AD16F UMFANGREICHERER4
804,172,731 *5360845593D86F08E53366DEA5DBC145D215DF72 UMRECHNES
804,172,732 *53696F470F9010BBB1702F59934453D99B0CDF84 1UDAVANE
804,172,733 *536E4C0EDEB2D118CD4BE90BBCF256E4847B261B UNDERGROUNDFUNK
804,172,734 *53636906CB2B81FA520A8BBD0D19934FED0D6F77 UNIX------------------bbs---------bbs
804,172,735 *53627196C80E4B09A04CDF0797C5B8187B68DDB9 UNMIRIEST0
804,172,736 *536A43305839DA7294B7B05C4129AD102CF7F38E unvermic0
804,172,737 *5361C87553928F48820061649355200AD6AD0A85 20MUYNCK
804,172,738 *536C59A6A14D79CCE3487B5716D3CE8C1CA2635C UY0PBDQNWGKUMC0
804,172,739 *5361F09E710694AEDCEACFD0379C7510E6604142 2518844 HEPOINTEDTOTHEYOUNGERO'CONNELL.
804,172,740 *536696CE811294D05107F35C5C17F8932B58FC8F 2533163 dramatischsindsieaufjedenfall.
804,172,741 *5361DB42AF2425BBE57D8449F25DD766DB837970 valko-kostov
804,172,742 *5361780937658AE1C0308C8953DA9706B2872D88 valledecamargo
804,172,743 *536AA12E2AA14962A7A4C91985075864570FC3DE VANCE.WADLE
804,172,744 *536D679F1F9697C764B91ED16DD8EA0A53783C01 2697761 DAMALSSPIELTEWILLKERSONINDERSCHWEDISCHENLIGA.
804,172,745 *53691382DC1F30534A99DADB6954141C6DF3CAB0 2743375 AUCH-PATTEN-GLAUBT-DARAN-.
804,172,746 *5367C161035BC7D284F13DBFD5516B81DE20A491 VANGER.AQUINO
804,172,747 *5366B93685739E53A530949F20829055EBE0868D 2804920 MUUTOKSETELINTAVOISSA,ERITYISESTIFYYSISESS
804,172,748 *536A71A6C9A678BBCC69AA0AE66E76CF46D5F48A 298909 OZCELIKISMERKZ.
804,172,749 *5361DA2DAAFB8F57CD82B50CFB161C40FEADD63B 29sep1133
804,172,750 *536B373ADA64BD6C90FE662C32EBA667F2665D3A 2BIFURQUAS
804,172,751 *536D81775A0B8886FCA753BE6E79F3280EB6D615 2BRACERA
804,172,752 *5365BC7E432506D77215D7F7F6A6DE54C9D38E4F VELÁRICA
804,172,753 *536FA9B3BA8AA347D9A9390E5431CCA14DBB7EE1 2.PIZZALAND
804,172,754 *5367BDB23A18C9E40F4A688847B88EC85A435856 2-runkomiehist
804,172,755 *5368F9EEDEFE30F20D52C913BCCBFA6AAA6689A9 3CHAINOMATIC
804,172,756 *536FB3EB4A7D244EA2C0BEB6FAF288662EEC90A6 3--d*-)x(
804,172,757 *53647A314975AC5B0EF914AAFBA184CD01A8085F vicky-cobb-lomas
804,172,758 *5364062BF1A8B208D3387CB7325C9B631D51A7FD VICTORYTRAVIS
804,172,759 *5367468F28FD5EE42561BE40E909BDD0987DC552 455079 he.cited.the.anti-busing.initiative.as.the.main.reason..
804,172,760 *536238ECCFCC96575C4BDB96C60876E9D7359262 vincent.dankwart
804,172,761 *536E442884E03B62D83C17A8B03B5311761B8E38 VINCENT-N-BOMBASE
804,172,762 *53673834A86267107D5B2B26D7B44A2944DF54A9 VINCENZODURDY
804,172,763 *5364CD96880A8210D56D88A5ED100E1641D0F595 497jazmin
804,172,764 *536F523043B75BD34D6C63760EED3CA1E2E88480 VIRGILIO.GELFO
804,172,765 *536A138426B3D09BDE773034EFE50EC0C42B18AC virginia-epps
804,172,766 *536BB42882F60277046F4FBFA1D84C06809FC545 VISPAZĪSTAMĀKAJĀM
804,172,767 *536CFFF1233F50473B1EB2E367A66E40D1815F3A 4ilovelucky7
804,172,768 *536F34FB56F9DB9D523006F6CB6DE4C721440F15 VIV.PASSEY
804,172,769 *5366EC78ABC61BEBC314E999B71C2AC0DD448890 VLLNSNSSS5
804,172,770 *5360449C2D59AC02D26EA9660F359454D535F0A0 4LMAIMDES
804,172,771 *536DE917B2D8B1E0AB234660BC7C948195D2B9A4 voetbalschoenen7
804,172,772 *53675D2856281230779FA328C87DA7CF542AF178 4PPENDECT0MES
804,172,773 *5365CBEB1AE61FA0B4C0B6E8EDFF3ECD09139BD4 [email protected]
804,172,774 *536A8B48DF6B26FA24C074A811961DC18B6C5CDC 4STARGATEFISHER
804,172,775 *536581AFF336325BA62EEC79857D9A078BA75C33 4VEZZEGGIAVATE
804,172,776 *53693D0379004315F79B7539773F8D706B52D53D WASHINGTON EGAS
804,172,777 *536C5C635258105BB768F2EEFA83EAB4E5D66116 4YCNYIXBIR
804,172,778 *5363CB3E74D44FE23A9DC4C1BDEE8B467C47FE7A WATER.VALVE
804,172,779 *5368EFB84B653DF84AF863F872903AAD19707024 592853 sayin yilmaz oyle sey olur mu .
804,172,780 *536C62781D12D01E98735C5D7F1DFAB7BEF28414 [email protected]
804,172,781 *5364F1E3708646DD39B2DAD2AA7B292EBF439869 We're.Gonna.Hold.On.(feat..Tammy.Wynette)
804,172,782 *5369C0B239C8FC1198170AF840A93C4585081ECE 5DREEFARGOIDAREG
804,172,783 *536AE1CBC042F429F7CAFAEB655A05311938203B WHEMPIEWIRYAWAN
804,172,784 *536CA57288951906776B551478CE504BC1E80396 5GINGERSHARK
804,172,785 *53648F872107EFCE1B6034EC688FF3E8E3433ADF WILBURNVILCA
804,172,786 *5365211AFC4D278BA2AB8BD4ECDF06147F948734 5IGUESSIDO
804,172,787 *53643A8F3FA2CE2495D1C917F123A1603822DD6F WILLIAMBUNT
804,172,788 *536B7584066BAEAF97A1E58ABAE13C0B6D286999 WIMPELDE0
804,172,789 *536FD50C3782F24CD75D27D19880323191AA8189 wjjitzd9
804,172,790 *536920D10384CC7BEF3C9AD690DF27DA3EF26D06 WOLFENSTEIN3D'NAZIREQUIEM'OCREMIX
804,172,791 *536FC85EC8A87893D20C05CA41E085CFEF3116F1 5STEPHENANDRE
804,172,792 *536F6AC62638CC680AF57E2695AAAEEDA36A2D00 5THATLEXUS10
804,172,793 *536F416D261DE34E60B2CD9979BA1481C6722E67 5UBERFAHRENEM
804,172,794 *536E24A4FEDC8C0CF46CE0E0BD23167F14FCB18F 5ZENEVRET
804,172,795 *536A287A9D4A0176CFC45F439C2D1D7C99D803FB [email protected]
804,172,796 *536A57291E8440BFC21AA4426031F57448D5F031 WWW.CALIFORNIARANGERIDERS.COM
804,172,797 *53672A0115DBAD1C1B6893AB578FEE03F55FE4E1 WWW.CANA-DA.COM
804,172,798 *53625B344CC7A5B7982C92EC875C68683D15B49E WWWCLINICALSCHIZOPHRENIANET
804,172,799 *5362575BC1730A19587105935577F03B4402AB00 WWWDISLOCATION-FESTIVALCOUK
804,172,800 *536478DD0B757BA51D60CD3551F5B7F850CBD34A WWWNY-PETRESCUEORG
804,172,801 *536E78DF4129C4B8BE1D3EE7332A01E4A8572644 66.BONHOF
804,172,802 *536345AE05E53E94FA64B3F741BB5F2A2CAF8500 WYATT159
804,172,803 *536B981B74C9D629F74A661586D56373FD4C073E WYATTISIORDIA
804,172,804 *5369AFAD259B3A582381455F416B56BFB9727BEC WYATTLOYD
804,172,805 *536BC5426F3964CC88C66853039BA87BCEBB6A36 XELAJUBSW3
804,172,806 *5364D0726E598594858CCB876FED3FD8BB637C03 XFILESFIONAS
804,172,807 *536BA4BC6F5666837E95F8C3451EC143910E6668 6DELLIRFEB
804,172,808 *536C05B3256D0D2A781B398A7219316A146FAF23 [email protected]
804,172,809 *536C1E2BB0AA73F7E73ED5DF310BDB50855D116B 6DNAHLLOW
804,172,810 *5362781BA97625552D0C3DD82217EEB0A9B17DB0 6eentjes
804,172,811 *536D0A886F769AE29FA9BD8F72D6AA0EF881C6D1 6ionicize
804,172,812 *536C48B55C239A00325C431964659AE9F635E1BA XV?T
804,172,813 *53602E53B9303AA60E9EC13709BF2AF2C3DB128E [email protected]
804,172,814 *536DB9FF0F33248BDCA3D896108DEF29E0499E0C [email protected]
804,172,815 *5367B19173F8DA675F87C3F09043B8E9A8F1FA42 YAOJC0607
804,172,816 *536D060F4C1C18C3B21C6EC290A37D6F714CF499 YASSER.ALI.HAMAD
804,172,817 *53669CA692FBD2577C01C4EC608D58568472912D 6MYXOPODIAS
804,172,818 *536F0C76BE436506BC529CBE20C52746F3650958 6nachtbraak
804,172,819 *536758FED6C0CDF2634CA14C15F53B414A589A6F 6OVERINTELLECTUALITY
804,172,820 *536EC349AAC292216236DB55C467B6A9152E92E0 [email protected]
804,172,821 *536AE7FE32236BE1590FF72175F2D6842A0D4493 yingni-pj
804,172,822 *5366B3CA8CA5A972DD9ECDEFD53A9CEA1CA5713C 6SCOTCHMARYJANE
804,172,823 *536EE87C4FC8EBCA3839BCE6C96B375ED75E2220 YLGNICSE3
804,172,824 *5364F07437A9D14F9E338EB4075F4CC8BD5B3866 yliv
804,172,825 *536EE43D6B033FBC092C44821BEF5067E8161500 6TIHUKOYC
804,172,826 *536FDAFE19126563E0CAF7732FF7C1EF105A0FD3 YONATAN-YEVILEVICH
804,172,827 *536AF8765DFABE3FC461EAB48CCF1969232DE3C0 718clos
804,172,828 *536FA57858D7580FC543547006A3C5B10996A6CF yqspace
804,172,829 *5363C2C599C1E1BC387DD033A4189957A57E84A6 YTCPRTLL
804,172,830 *536567DB9C569D39B112047FFF94DCACB66475DB ZACHERY.THIEMANN
804,172,831 *536FEBEA6A39431AFAF6FEC7A7D1005F930AFB40 ZACKARY.LAPPI
804,172,832 *53616A206AD503EEC10501D882F038767A24C101 zac-stevens
804,172,833 *53616D790987743DF69C238867B9E0F043BE046C [email protected]@B!1!7!35
804,172,834 *536862B01D2126AE3FC2E995F4A8ECFC118098D9 7RESUMIER
804,172,835 *53672441F40005FCDDF28AE5EE6135B7B91A07D8 [email protected]
804,172,836 *53643B68B95291D67341954120C3902470E69A1C 7SKINNYRANGER
804,172,837 *536C225DBFF79EEE12641231592B45930226614C zehandsomemax
804,172,838 *5366ED138D79F93DC3F94F7CE2B306B3D639F048 7ZAPEWNIONO
804,172,839 *536230294318EE0F88A65AA64AABEEFD3F6A3839 7ZERENGISED
804,172,840 *5365A471FEA66B2481C7F90687AF642647D69855 ZETROCSE0
804,172,841 *536D04570B9E6746FD6012E23CF4823B6074B363 zevendal
804,172,842 *536F27BD67A3EDD19C39E8C10B9E19E0025D8D42 [email protected]
804,172,843 *5369FD0E493F3EFF2DE264458B74364A4D07301F ZHIEY0
804,172,844 *5364D6CD5115D2AE09A6F60C739BC196A019FBDC 8AUG1108
804,172,845 *53635A19BD136282CF3E4104156AC60EC575472E 8HARMONIPHON
804,172,846 *536581502BBF5F6D78FDB770A7130FA0CA1CEC57 ἈΛΑΖΟΝΕΥΌΜΕΝΟΙ
804,172,847 *536CAB3DD08C458D73EA7D920A7B1192A88CD83F 8NANBAILEY
804,172,848 *5365D2162FD5D9B33708609A2D92170093495EF2 τετραπρόσωποσ
804,172,849 *536CDA737E1368963EC2A85B5BC42D28C49C84A3 «АКТЁРСКАЯ
804,172,850 *536BB8A51DE90B4AB69CDDB856BB6C044FDC67FC 8----p-~-)o(
804,172,851 *5363BB51D3D372329AE9E700F6E0810225E32983 8##P.~SPLAT
804,172,852 *536DF1574954458FB9260E6FBC15EF2BC37E0615 8SNYTELLING
804,172,853 *536E1B55DA8721D875054407E4BCE0367BC92C39 8SUPERKWA
804,172,854 *53655CF96BBDBC19FDAB9063B8FBA3D27550C861 КОРЖИНСКОГО
804,172,855 *5361D941B9FB7218D9198E32366F539F050CB4CB 9BACHELERIE
804,172,856 *53627F42ADB772AC1DE3AC8C86AB03CBE182769F 9BESCHRIFTBAREN
804,172,857 *536C10EA421FF3585EB54771228962F4502A55FC 9MAY1627
804,172,858 *536A23A995789C39EDBFC2005BF2AD78105DA0F4 срнетици
804,172,859 *536FBA6788193BC9F1199F54FC8B907E15FF86D5 СТРАНСТВУВА
804,172,860 *5366106BD8421FECC3CEF602A9905C1EBC91C456 A1"DG
804,172,861 *5366109278DAD723197F91AE9996C383C069F7C7 a5axu
804,172,862 *536748E9ABE434A21EB51061657C4C4CC8DE0CC9 AAA<\\
804,172,863 *536042907057761154E6D32D7F5F0DB32D138117 aathokna0
804,172,864 *536DD45A93BE2491703242A149D5EB9173DC16E1 ABDOMENI
804,172,865 *53624D259AA9ADCD83BBD406634DAB3B71A3BED8 abram87
804,172,866 *536B36D2C59D8A7236A1ED486E305C90FABF076E adamfoulcard
804,172,867 *536971C5B70A3E95D23C8920A2B448DBDF04691A ADHUATRU1234
804,172,868 *53642AC85A97C01ABA9ABD39F0029E94F8A2B921 ADRIAN BURCH & DAVID WHITAKER
804,172,869 *536EF2724ED1D2DFCA3A7C7B659A0A32DF402F97 agj$e
804,172,870 *536BAFC73D29D368D5FFD925A460B651577294B9 (0-0)-0~-(---B
804,172,871 *536BA203A6ABF984CFF2011DA93EE44D1B4EEDBB ALEXANDER.PERRON
804,172,872 *53664F4207C5C83EB59F5CE3FDF022353FA83717 ALFONSOBECKA
804,172,873 *536B8C814340DB4CC1A0849612C085640B32B251 (00).O~O~Q======P
804,172,874 *536BE4F0AA1A0CE254B3BE06611525F3128C0019 06.26.1667
804,172,875 *5360AD9DD8D97CF7D26ADA5E9795305E51CCBB79 0c9a7b3858a330f07b427070e62d6002.k4jwrw
804,172,876 *5361310A586B9623B1B9F706D1CD0664C25A5A48 0ed4llxnv8
804,172,877 *536FF4F47580E4B6B700F24D46D3E92B76246642 0THATAPACHE7
804,172,878 *536C0A7CAC24CC7BB2BA8518A2D9A5979E3167F1 ALV/L
804,172,879 *5362FC4D48C5D1D433BB73641F46E380EE29A6AE AMENDUE8
804,172,880 *536C3C8C19085183347BA3F475037775FB134A08 amigajado1
804,172,881 *5366BEB5010A31254F40B4E9E5950E96A7C803C3 AMININKI9
804,172,882 *536B0EE2754C4EE351B62E94AA514A6A4053B20D AN9B
804,172,883 *5363DC89D89D1AE96258161B9F340D785A614CFA 14-klaviertrio-variationen,-op-44---variation-xii
804,172,884 *53658AD222AF9FE7845DD4CCEB10ABA3B276E691 angelofreydel
804,172,885 *536B22711EEA47E623A467E20E8395D04C9D1125 ANIBAL.LEDET
804,172,886 *5360901E71A93C144F4FC5FED36469395E3BD98B 169frodl
804,172,887 *536C31DE806786C391A7E889CCEBF29D6EB36CD8 179landon
804,172,888 *536141247215FA8FCC02294ACB7A0066F8155971 1!BERA+!0NS
804,172,889 *536F326E5EB1FDCA3AC94B1C5394526329CA91BE APAqu9!PtvGA$RLjJ\My`Bmijp;R]/q7IAEc*&DKx)9lE%8u;J64k]
804,172,890 *536F3B01B6B598D083B38CC860236761CBA01AE8 1-datenfilterung
804,172,891 *53690B12FAA7A932975B93E878C0DD1C5E6D8264 APHANITI3
804,172,892 *5362DAFD22E72C8314CCA3A0BCA0DD7C49E02E63 1-DROHKAMPAGNE
804,172,893 *5368719D4FBA8A433EE42DB5610B9499BF7C0DA9 apr#
804,172,894 *536D03FC5708B7AAE6FED4FD60CC202B32C89A78 1fotokonzern
804,172,895 *5366E5FB1B39678C01F1A5A401DE323FB32C447D 1.guaranteeinga
804,172,896 *536E9B79E977710D915C4E61C7EF6CE7F757284A 1.HEROINUMSCHLAGPLATZ
804,172,897 *5364B59AFB5AE17E74ACD5E8AC66F088835614BF ar(6/
804,172,898 *536965060FECA15EC93BF04A028EE17D66D5D6C2 ARCHIE.CASPARIAN
804,172,899 *536098C1891A7949505EC899A8BEA3D93068BAE0 ARCHIE.GAGNE
804,172,900 *536B2425D3529005C5CF87C1D34A9EEA0F6A6D0C 1-huots
804,172,901 *536D97E5B9A6EE74DC591F5DE1541747C31DF0FE 1ingu4sc
804,172,902 *53626C2B4EF67BA60036957C593376118771ABD3 1.KARLBENZ
804,172,903 *5364C0DC1BC42F7FBBCBDD1CD88F38CFC5E563CC 1.kindertheaterreihe
804,172,904 *536B92A58C6110B3ADE5969C0CD88771D4BEFC9D 1-KIRVESM
804,172,905 *536A07E5D6F57B30E4AE39F1883C3C1E7594E3ED ARNOLD.MELTER
804,172,906 *5366A9518AC41C19C1A2D1F928F61C71B73CDA87 1-LAITTELI
804,172,907 *5364DD59CBE0120EAD0571EEF6C769B641ABAE20 1-MAWLANA
804,172,908 *5366A519AF19F29EFD4AF807FEEBC76C4B8AC496 1NEUSUSIC
804,172,909 *536140602E9191726CF1FD274409923E5EF062FB 1-ODEMELERIMDEN
804,172,910 *5360EC9D69C4CDC70DA35D44988AC98E3E25BD2A AS:#
804,172,911 *5366EB790FF9F62F056C41071E7711709F038EFE ASHANTI773
804,172,912 *536F6A99710B35EA2492019B9EC6346893E24002 1RANILANPUISTOON
804,172,913 *536E23D91B78267087719A130C5B437736DEA37C 1 RAUSCHBACH
804,172,914 *536EDE426072948CA540E6E04601BE897DF6D1B8 1 REINPLATZEN
804,172,915 *536CCE877EF589AD1E2821320B7172176EBE1111 ashley-taylor-miller
804,172,916 *5361002E5E8FAA115F6C12EA99B262DB5ECEC73F 1.renaultmclaren
804,172,917 *536DF0579CC09746A98E18C8CA9CCAD225AF60E3 a:sk
804,172,918 *5361E45D3130B477DF7A9424F07A6095448CF9FA atatrofnoc
804,172,919 *536A65872EAFA7C97EC684898F0CC54C912A6FD2 atillah1
804,172,920 *53671C53BB3F66CF146B804CAB7636F1EE1452D2 1-SYNCNESS
804,172,921 *5360FB9DF4E283E914612FA004D115966B508673 attacksing
804,172,922 *53602ABFBE220D04FA69CF95A4FDB3C3B1BE2A89 1voi-shan
804,172,923 *536812CE33D49CE83AD1A4DC5E4041F4B03C3DF8 1WORTHLESSUNAWARE
804,172,924 *53675F5701A38FAB78413FB2857A906D78A1C1E5 1 WURMFORTSATZES
804,172,925 *5364F417AC06F53CBB6961183DEE32B3ABE9E4BB 1YHDEKS
804,172,926 *536B8B859D5568EB1E7CD27CA27AE9D93CE98EF2 2007年3月、foxpro
804,172,927 *536F56122CED7EEC56F30E2FAE8E4DF9C2B1281E B_0?
804,172,928 *536E67F663BDE1ABE762151A65444C94C7C90449 [email protected]
804,172,929 *5367F98C5C1CCC060607782A613DB994B8EEBE2C b2r9k
804,172,930 *53663F73F6DBE0CF4330B20F7CDFF78711FC454A b3wub
804,172,931 *536F2A559CBE1FA291DBD0324CB0796A854CAA74 b4#mc
804,172,932 *5364EB6C5D6B377F625736FB90C9DA573601A122 B5VG7
804,172,933 *53674234983B523CCCF9156DA1797A847C71820D B9KMV
804,172,934 *536BBF51E29C7F6CFCE1A211B9C9C9CC674991B0 2-PARTINVENTIONNO.10INGMAJOR,BWV781
804,172,935 *536B500C9C4BAA50AE9EBF62A8C8D87EA846BF83 BADH88
804,172,936 *536361C546EBC9EA50CCF9BC3C66F705DC193F85 BALLREF72
804,172,937 *5368DAD1B8B8B79EEF02FC31C03E92EB870C3778 BARIANDED
804,172,938 *536629D6AB375B4344A6F11D048B428D15BCD012 BASSPRO8
804,172,939 *536F2D401FF2B565055F3522E865FFE6BDC5BD0A BASTAUP1
804,172,940 *536E3AEA5AD870E2CF5AF98296A64FBD2A43AFCB >-<.~.`<===3
804,172,941 *53687A4FC4AE0C31C2DB0395899688F614AE97BA BAVARIAN
804,172,942 *5365F44923CCBBD1F004A8857F481030ECF0F52B B=====B~O-~O(^_~)
804,172,943 *536CBFDBD1B7818012EB2D90D0652E38A2BE7D7B b==b**splat!
804,172,944 *5365A6831ED85D2279DE233B5BD5148CFB2AD174 BENNETTFETCHKO
804,172,945 *5368B001EF5D35E6FC1F2D17823A47216EC5E046 3MYPENGUIN8
804,172,946 *536BE9F995A80B27F4E115FCBD6946AAD323A999 BENVAPEN
804,172,947 *536A93F55D256DC24E14CFE9BE7D02AE5AF71314 BENWDAVIS
804,172,948 *53633DD46F7898630FDC1E2C4363BDC654E448DD BERIEPS6
804,172,949 *5362C27D18B6AE94362AFD018E6A0EDD3EFCBF76 BETUJIN6
804,172,950 *53694BA4FBD07B44A4AAA73CC786C4A8796A3C4D 479547D519D6DC0DBD348466631C427C EASCOMM
804,172,951 *5364E2F3FAB4A822C90EA837065BE43142F8C7AB BFS&%
804,172,952 *536D88EECD2F698723E9C0C40C5B5ADA0184AF1C bhcor
804,172,953 *53609C75961127B1509DCF25D88649C34E2A7E35 4LANDTAGSPRASIDENTEN
804,172,954 *536FDB5F94BF369580D09A75FC16B54C5828FE59 BI9CF
804,172,955 *5364C01D398CEEB0873A6859CC49CE8AD78DDD55 BILL.GIBEAULT
804,172,956 *5365AC1AD179D048E149DCC9841446047B97E0DA BINDERENS2
804,172,957 *536C2DAA7913E7364A3863B7E6319342EA2791F9 BIPLOVK
804,172,958 *536C03BD41035508F2E70E279E5C0F0605066554 [email protected]
804,172,959 *536CF5E72BBC64984AC0AF62F8D6752357415FC7 BIYO)
804,172,960 *53673F6D99004A9BBD767E3E250399EA7211F6EC B+JR9
804,172,961 *5360304F135EFE00DBA3963157838909AD0633DA blackarm0
804,172,962 *53633220B20D9BD6F46B75BE843EA2CE0EC26CA3 4TOPOTYPE
804,172,963 *5361E8FCE11947DCA92E99A08417E5CF9CBAED9B 4VIVAIMAD
804,172,964 *5364BFB8B1608A6221120C1F5B1C5B81E79837E2 BM!SU
804,172,965 *53633C7343710A4922B6E6B3F32F3EEE0F1DE843 51tuat3d
804,172,966 *53695E347BF8B9E53536DE235DD2A2E8095C3097 BORICDINAMO
804,172,967 *536A98BC76AB5F4AEF7EF89811B69339D8DA287B BOYCEDECAMP
804,172,968 *536D1728366C69F5ECA4E6D17AC600BC8C51112E 5BSWDESIGNATIBSW
804,172,969 *5368E62E5567026B4A653873A546FB61E208BBFB 5BSWECREFBANYYLBSW
804,172,970 *5363DE11416A1D1EFCE7B557AF9723B11E41CFF5 5CONNE55I
804,172,971 *536547A46435B1ED95CE610E2DD00DB6758ECD56 5DEKCILORF
804,172,972 *536C2E58B63A05D930C74DD612E0B9189E8C36AC BQTR.
804,172,973 *5369E9073D65A634EA1C007A8589FC49FA30F561 5HOLASNAKE
804,172,974 *5365B92AB9A51ADC3088DB07A6CD2E8B28DE762E BRADLEYWRYE
804,172,975 *5365A9628A84019809E4748148E0F189B2DDA2CF 5ILOVESAPPHIRE1
804,172,976 *53661247A8E4619C9C63900340ECAFDFF033B1EC BRADYVISCARDI
804,172,977 *536BBDF98FC32B0F1A1EE2B9F08190871E23BCE9 5JTETTVKS
804,172,978 *5365BE9260332EDEC074A528DE45002E2F4DC98B BRANT.ANDREEN
804,172,979 *536D76ADB5EBC36B346BADB7BDD39F39E4AEE373 brc0"
804,172,980 *536490278B636024765DAD77E57D9FF2868A2DCE BRENDAN.AMBLER
804,172,981 *536CFBAF8BB6EBD443923118CE34A7ADF0191F37 5PHOTOCEL
804,172,982 *536DD8B87FC8ACA311D0A74A6A6F81472698478C 5policyholder's
804,172,983 *536A77F6C9E03DB98962020541F2170C335E106C brgvgdning
804,172,984 *536237165763C8D1638331EE96A307204A813DC9 BRIER’IN
804,172,985 *53609CCA9BCCCB10B4F027F123164B979D4473E3 BRkT
804,172,986 *53660D42D06C84C4AF5E9749A889886A2AB42E33 brossman0
804,172,987 *53611EF37BB3700445720B7FFAE8A21570BB4FDD 623DEVEN
804,172,988 *5368A89CD6039D0960B08ABE0D0C0FFC6E935D68 bryonappelman
804,172,989 *536E7C56284F95510C66948EDED3ACB9E7EA5B03 BSQ5U
804,172,990 *53685AAC254CE2DFC5D9400DB2CE51E7017EF322 BT$V
804,172,991 *536AA56B077DC0DBB50E18FE9F94C4934288B45D 6CATHYOLIVEIRAUSACOLIVEIRAYAHOOCOM
804,172,992 *5366FCFFD24DE9582DF2A60841C36C83575BDFC0 buddenbrooks66
804,172,993 *536571740101663C1DD940F975EFDAEBE9BAA189 6HSINADNO
804,172,994 *536FCE03139D063B19EF05A8066C176F32CC71F5 B:UXZ
804,172,995 *536FE1926001B1126F642555647F301E6A2449B7 BVGSK
804,172,996 *53621B46F9E8F3534AF466F6545890791C16C02F b-w(t
804,172,997 *536050832B9655AE22349AA5D64E901D806E32ED 6SERIATON
804,172,998 *536FC0A9C577915ABF20B25FC5ED9B13D0A2E231 c#10m
804,172,999 *536DB2BA26F1A76F64C3697CE822A7B77F26D36E c(2k3
804,173,000 *5367874F08A7DE616A40EB5DF6592AEB39288F84 C4534HHH
804,173,001 *53610DDF1579CF95F160B892F21FAC175DCF489B C4-A2
804,173,002 *536FD04F620D1A621AFA938E1F6D2B106145D55F c?7n
804,173,003 *536E06273E56A9EBD56CE9F62490B5DD6DCD679D 799583 MUTTA MIN
804,173,004 *536F7FFF6F16B2391E7BEF20AB13719960BB94B3 c9m
804,173,005 *5367EA17EC27C8A8B5BF27FA33E2C6A70042B16D 7COLERAINEBSW
804,173,006 *5369D08445582727541D38F073DC8BC233FF98F2 7DNEGLITR
804,173,007 *536272E4E37A372F4A70EE7AF1A0F11CF7304AF4 CA!IZ
804,173,008 *5368732995EDF9F494E770C72FC7FA8752442903 [email protected]
804,173,009 *5360D304A41ED2EFE9AFC4753317BECF19E33EBA 7NEEDINTEGRATIONBSW
804,173,010 *53699A6151EAAD68D75F6191761FED374BB91C65 [email protected]
804,173,011 *53629D119357F362E29A316A441E5CBC80960678 7opscheepte
804,173,012 *5369E610CDB683BE674DCF0031FF007F5A5DE24E CATEGORIES32CANTONS
804,173,013 *536881F6A9BC0AB641BCF972B7270551C2AF554D Cav3
804,173,014 *53659093DF6721A1716DC9E856735C409BD5BFBC CEILD
804,173,015 *53614695FB1F3DEE5A182AB8DE96A91270A18517 CESK&
804,173,016 *5365207D2B633A71E73085EE02EFC7180C3E42B1 CHARLIEFLAKES
804,173,017 *5360BB0D6855B36570F9D626F3E34DCB2E132FCF 8HELLOSTIMPY
804,173,018 *5364F3E1B5C731282D525C7A97288588A3FB6D70 8HOEGERMA
804,173,019 *5360B8B552385E475E5D757C417195F5E3B9456B 8IATROCHEMIC
804,173,020 *536995DC69C59081E2712DF502E79FFFF6B9B022 [email protected]
804,173,021 *536A2E696C0B4D4769F70DB776FBAB7B644B0236 [email protected]
804,173,022 *536D85D9A6A9522A61A5B31F59E750423F6A4203 chm$d
804,173,023 *536D828FA7BE2FD88F4CC9434426C67E19DA91DA 913178 tarkoitusolisikasvattaakaikkiakasvejaherneist
804,173,024 *536519FF010D45E70CA2C711E1FD4094CC6A5314 CHRISTIAN.POMPEY
804,173,025 *5365C8E736679C60FD802876CB55D426E0912EAB 967839 EDUTAINMENT.:.GETEILTES.LEID.IST.HALBES.LEID..
804,173,026 *536A41B0341893F95D61C34DA56A7F71DD41BAE2 999553 P
804,173,027 *53687DED6F78E2E7B41352DF291ACADB6C032B2D CHURF
804,173,028 *53677E7E2A33F00252CE9A0C952991E93CBEFB01 9HELLDONALD
804,173,029 *53640BDBB20505201D4577BA00EB605F66831274 9HELLOSUNDANCE
804,173,030 *536B83D0ACD85633252F7795CC6D462280D48E4B CK-LOU
804,173,031 *5369393DA4A55F67664EE068D92DDC46A0DDE5A7 CKUKX
804,173,032 *5366CCB65AC48A6BE0AF6525BA16966946649BDF 9OTSDNUOH
804,173,033 *5361D994B9418EBDCD2BF46903489DF02909E1F5 CLETUS.FENNESSY
804,173,034 *536401BF78E1BBAD1477C8E4CC9EA6E1F1C51E0D 9SALESELAINE
804,173,035 *536EB7294C722E9BECF8F42F5A0F0DB487167918 clint.holmes
804,173,036 *536A716044FC8361275AC5FB059AD6F69497D088 a!?6v
804,173,037 *53699A2A1C3895A5243C6F5B5E9972B80D4BAD05 combatting9
804,173,038 *53656DFF8B77EA0542F28DE81A6C654EAC77B02F CON+3MPLA+ION5
804,173,039 *5362F156BD7FD0B8C229AED16223CA667D078C72 ABERSHAM8
804,173,040 *536911FD834C173794704872C7DC5615C27DAC16 [email protected]
804,173,041 *5368C14BFF65B9EA1A662F310A837F72A7B4C041 [email protected]
804,173,042 *536F956EC5A431868C2E7EE245E41CB640B6DA19 ab:tg
804,173,043 *5360EBE488A402244D8B5CC5CEBA7D2621CAC205 abvkw
804,173,044 *53606801468992CA12D5182B7F842EFDA30D7911 ACCEPTENBOEK7
804,173,045 *536C040BD4FFFD0ADF664A057E48C693AB175773 ACX4
804,173,046 *536582F5F6ED148DC8B542626FE350F24524C8AC CrCb
804,173,047 *53669CCBCDBCBBE97719D332A00A7F1B3F7A3924 AGTR"
804,173,048 *5366BECA57C809F30240748A5590F5A57D23B187 crystalkennison
804,173,049 *5362F7646E0E6FA2752029EC5DC73EC6F1B176CE CUM ON YALL!
804,173,050 *53642B268EE9726DCBE1B127D4CE2EAAFB18D1EB aleqm5hbaagbbl6zpsenshulbjwvy2v
804,173,051 *53626DE2FB10964922EE70D8B57BC9859E6E919D cymograph8
804,173,052 *536EC7789CD8D48D0C2A7848526E486F32F17E58 c%z$(
804,173,053 *536C99426277C45673D979F2B85718FDB99B6D27 alleguoning
804,173,054 *536F910D2F6DABA5F71EAD2A45793C73F24EC075 d!1ad
804,173,055 *536C81D316E9DD1A4A742BB7BEA0878D8B091E31 alonsosumney
804,173,056 *536904624CC7A709CDE074E30942B4E91BC261FA d1o3o
804,173,057 *5360B7122AA000EFF9276BF3A85648DDDA0DA724 a",;m
804,173,058 *536452BA124175C0BCA27692BEAAE2BD75B71CDF D7J(P
804,173,059 *5368465953FB1E62543EADA8621F23B18D3A1189 DANAWARRIORPRINCESS
804,173,060 *5363553E7F69EE5C4622E5A13A8A9C62A025FCAB AMPAHEFAN
804,173,061 *536434AC115F4463C8318CB152DDBBF370ADFA43 DANCH
804,173,062 *536F62F7236BEF5B543F99D3A06412217A4971DD DARENCHAVAYDA
804,173,063 *536A1D76B3015B65737DB73D092F1645295EA6CA darrelgordy
804,173,064 *536366140C741F282CBD7E441D8800EB52C03933 darrenstimple
804,173,065 *536508A585BF4AF5A191E03B9423F81131067617 and.so.proceed.accordingly.
804,173,066 *5360E3B21E9956B06AD3D5205AFC8FD5691149D5 AndyatStudio54,April1978
804,173,067 *536043C4E721D48250859D3584558310255DCC2B ANTONTANKSLEY
804,173,068 *536A4A941AA50D17FE1DA948D2786714A03879B5 anubis-nout:.i.anubis
804,173,069 *536F7D07D817B0517812021CD2F3B75AE85866CE Deboerenjongens
804,173,070 *536E72171EAA781109D1164EC49D82A82C861AEC AR=+"
804,173,071 *53645B9AFCD022F80757D047FDC513F56E7F7D8B deraelc-eueuq-dnes-**-a--ohce-|-qccdx-c--etirw
804,173,072 *53600D6511EAABD4011CE323098A9DCA2D2EF6E5 DEREK.DOUTT
804,173,073 *536BEAFF4DC026F003FED71F54305A3B35DAB571 DESCRIPTIONCREMORNE
804,173,074 *536240BE3F535CF07BC96361649766EADF81EDA5 desengorgerons9
804,173,075 *536E72E5A85F9BE23AF8BD15F12C4626BA61D630 ARMANDO.LAMBDIN
804,173,076 *536C4059E1F6F0DFD533E8CB8E9316CFA6ED7BDE aronwagstaff
804,173,077 *536B8BC3E1C3ABCB37C2239B15A1654B7245391C [email protected]
804,173,078 *5361821E97AAD96EFC43B0A7511DD7247547CB5D ARTHURALOSA
804,173,079 *536DEA53EE4AD2660193DA527FA0DA7A6E219F7C D$FE"
804,173,080 *5368CEEE8D0E3B37FB662D653F14E59999D4C12F ASNAVUKI5
804,173,081 *5365723B60F2C80A48AD4C7B42E913C3D48F623A [email protected]
804,173,082 *53630ACF4B093B73D5050DC4C99515CCF39A6A8F dgg&u
804,173,083 *5365FBD387E3F5FBE35F8C92503B7660A4A54F66 ASTILEANR
804,173,084 *53643CEEDB12E5350BE552C57E2C1B345C04AE72 Dh0X
804,173,085 *536180F0B5A6E0B4345E3DB596143490F8C05D1D DH$K7
804,173,086 *5361FDE165209212CCFDCF013961B6E13A6A4448 auhsi
804,173,087 *536436B779878610845430EB91F402FD459FA18A AUTOMOBILESGTCATEGOR
804,173,088 *536D71F70155F76B5FBC664F3024ADC671DAA973 di.s8
804,173,089 *536D4715EE61A1EB0873437B81CB64FF2927027F DIWS+
804,173,090 *5360884C9C2515DB7060DDAAAF75F6AD306C382D djrnc
804,173,091 *536CF2C83161BF8AB071F53602CB631557381F99 dnd3h
804,173,092 *5369112635FA3BE4357F645AA4353E7FF472A685 b1i4
804,173,093 *5367E4B95B77F9148BAEE36007A9B1B9478696D0 DOMINIC.HANDVILLE
804,173,094 *536EE1D5DA0FE130BEE6DD5405EF3BB3578AF4DE dominickszysh
804,173,095 *536F80613862E574DD205208EBD44C53AB883FB5 DOMINIC-LICAVOLI
804,173,096 *536288568AFB61BEDC91D633C7DE8021213E0007 b6ndm
804,173,097 *536FD2BA93E8433413C236B17C0460F1C572E2E3 B9IJ/
804,173,098 *536B8B64BF09939BF08B545E2522F4E43F717721 BASS HUGGIN'
804,173,099 *5361158479A0BD4A726CC3201D25A8FCBAC1E086 DUNKELD-BISHOPRIC
804,173,100 *5367EFACE18F6F42033ED1CA3D663B0DD83BF396 [email protected]
804,173,101 *5367E4FF34158AC9827EC80050941EFC70813712 BBK0O
804,173,102 *53626229CA357946FA060FA6DD88FCF49885CBE2 bcanp
804,173,103 *536CBE09527F4F943155C13E3A7C9D10D5BBB47A bekmpelsernes
804,173,104 *536D313C18DF637ACD2A05FD866AC47C3A626960 BENNETTDAVIDSON
804,173,105 *5366E6EC61CFAADF6D9BBC1692D04877705C9729 EARTHWORKS?
804,173,106 *53676E5EDF081D2CBEEAB1DE1BE8932AF693983A B$E?S
804,173,107 *5365A02B8170E0C037C832A8DE584910CEF3FE6B BF/T
804,173,108 *53691DE84F299A832460EBC31DD6BB50CEE60645 EGITHCAA6
804,173,109 *536F7618C69D76697CACE27F8B50A8A1EC5BFE68 EGXVK
804,173,110 *536782AA67D96C6DC480A46072790232C3C460D4 elec+rom4gne+!sm
804,173,111 *5360079A4F1EC5602B21AFEBE615B79DAAD971A7 BK+q
804,173,112 *53696F5A9FBE34C7928B5E6D77DDE328971246E6 [email protected]
804,173,113 *5364B56AC23894ADF55ECDB0ECF97801CEB18E14 ELLSWORTH.OLGUIN
804,173,114 *536753FA405FEA05FD36153B2E1A77CE5CD0905E blxg-
804,173,115 *536F29FFE2F76416D2C917333BCDAFDAEBAFABEB BMXHR
804,173,116 *536283A0355BE52CD1E8A2DC0C61C0A397A1E6CD bnr&=
804,173,117 *536A6C49BA09987157C9F1D2FE6337A63FB9CFE4 bo40b
804,173,118 *5369E0EA184CB127D308D8526F626B668E4C36B6 emma-swiggs
804,173,119 *53618BB65EE9B5BE95FA81FD06D22F0FD0FAF5FD BP-=!
804,173,120 *536CF508C45525310A4644DFBBF47FCAC0BF9656 epuisiezs4
804,173,121 *5366E22778BFCA2963BF7E4BCEFB23470BC09177 ER9FO
804,173,122 *5367FCFF4613AC717492792321BEBB1EA16C3F93 [email protected]
804,173,123 *53648900F4A708D7DB86D30776CE29DCC42EFFCA erickcrone
804,173,124 *536169865DFB272FE329FA0F3F32A15426C8575A brantbutler
804,173,125 *536C7666CC04C9E0F201DC72642447C4767255E9 erikweese
804,173,126 *53625735B4DFD878A6BB78E73D060EB06871D9EA erotiker4
804,173,127 *5367F161236CDF154AC318251BB7A98DB3FA6EC7 brian.lister
804,173,128 *536746EF754EAA8F91FA735F2FD54BBD52D8E94E BRILEY502
804,173,129 *5367AD4D0F6C404A715009B6A35132CA750840D5 B)=RL
804,173,130 *5364660F5F480C5DA5FE8CCE3F60243B7ED8C178 BRNG1
804,173,131 *536BF2B7439B5BD8DCD735135FCD22E3052EFB85 ETNADACREM2
804,173,132 *53626B1F626AB514614AB9ABAA2A274D8A57ECE6 BSWFERMIRACBSW
804,173,133 *5369D1D1CE2019B51A6B9CA38B5500076F81A2DD bt5$8
804,173,134 *536FCFA824CF27715F1AC06DE770F8638C22349F BURTROSENTRATER
804,173,135 *5364B5859BE7AF7B9CB82F79EB8CB30384324590 ezekielfarhat
804,173,136 *5367A2CBAA12F05D4D01F7B7C93442EE9290BF26 EZIRENIE0
804,173,137 *53687661AEC9BF9C31A1DDCB189514B6014ABE1E F0I6
804,173,138 *536EAB45FC608971ADBA92A51D6DCAE11C5487D0 [email protected]
804,173,139 *5361E1DF140B0D5EE696BCA2FAC6AA09BC1F4CB9 BWHW)
804,173,140 *536865240880CCA3588EE73607829BF1DC93A4AE bysir
804,173,141 *53614BABD596AABCEC39957A3BC1727BC16ED4EB FEIDEBBA2
804,173,142 *536379C99C7F0BFF7461CD9238D86CC321BE62E7 feinsmith4
804,173,143 *53639FD320E9724595CC8A9768A0663614191515 feltondralle
804,173,144 *536FA55C921B911802EC0148CE1AD20A86054497 C3KEJ
804,173,145 *536B02C4356A4940F506CEA8FDBE1D014E060ADC [email protected]
804,173,146 *536390F8585E550486D56CB9A072920BB2C9E9B7 c5958
804,173,147 *53649816DFA2F9A596680B80B9C57CBDA297C506 c9i,4
804,173,148 *53687D0CDE803247FA80BA5943463716246BDDDE fixovany1
804,173,149 *536605EFABCE7BCF95CB208F397E576FBE315B8E cận.nhật
804,173,150 *536866158A137A02C331756E2DCA61B14A9E02C9 florenciocozort
804,173,151 *536C30A821395FC421A52D8D405746A6B0EC0045 Carmen, Act I: Carmen Sur tes pas nous nous pressons tous
804,173,152 *5361F6C349C96D282EE4B29C6AE0720358A3E30F CAROWAB4
804,173,153 *536D12D066266A73318C75A9E7DEF01AE9F3F048 c%?c(
804,173,154 *536377C13912F4F476A35F269C753A57334441D0 FRED.SHAEFER
804,173,155 *536DF5441F162950CC7228E0DF2758BFA4874895 FRONTPAGEPUBLICITY
804,173,156 *536AFD619A553F56B45DA25EEC0CA6498763E2C1 GATEGATE6
804,173,157 *5368DAF8D332A26528577FD80E16979F966C7C41 GAYLORD.BOLLICH
804,173,158 *536AE6EC482AF3FF87C3E1E809A098BC3D458EE6 CD.HP
804,173,159 *53606FFF49989EF4A9AC1B55BAA467FACC327D60 genaroheilbron
804,173,160 *536E48664DD1FA2C04DF3A038A4F7CA1D228996D GENITIEF
804,173,161 *53667EC7E65967836126113B59F175B90B04F943 CEDRICPEARLE
804,173,162 *5365588C28DFC5B5670CB5FEDE3F0A0B0D4FCFB4 georgejacquem
804,173,163 *536AAB2E5E3C41D274A0BBF3870375EDC5D90FC7 [email protected]
804,173,164 *536551A31E16317667D700CAD98E07695E937145 GEREPETES
804,173,165 *536C9FDE93F44DBE5A2805FBF340D2DF9CCF0284 CEXIU
804,173,166 *536C4266DBF9E48EB3EEF54097736B8D9594B6DC GIL.BURCKHARD
804,173,167 *536C0590095339775396DE0E2A72173824977D75 cg~
804,173,168 *536ECD228EABD877F5B2012E50EFB5D1B1DB7579 GLENEASTMAN
804,173,169 *536789198325DCD9F6C6AA7F8A160CEB72EEFD38 glennhobgood
804,173,170 *5360FA5950FDBA5E1A0F617C08128225BA44741D chadpritchet
804,173,171 *53638D303834AA5520880F22948F0793D0010945 CHADRLESES
804,173,172 *5368BC8BA9D68FE612C12AFE16D078D51B87A3EA CHADWICKPALMORE
804,173,173 *5362D1755538A297501EBFE8B2D95466B8146A7A G~M
804,173,174 *536919BE1BFC62C3A5288F96F2FF72166972B487 GREGORYTONKIN
804,173,175 *5365B013C46FEBB97E618B9881FFFB45F98DEFA4 GREGORY.ZIOMEK
804,173,176 *5369FBD5A57DFDAB063B8ABB84CDB296B5CE4DAF GREMLINS
804,173,177 *536B91BBEE664F8E07E6F4F3D62579A198B49E80 GUEMES.BAREYO
804,173,178 *536691A4CC4F3D7E427785FF9D925FD114C031B7 GUERRAN8
804,173,179 *536B8BE501A3209912A1C53CAF21D861A3B34A38 CHOOCHNSIM
804,173,180 *536D51713F6297C4BBE364934DA9FEAD6D264AF5 Chq=
804,173,181 *5368CA7CC65DBFA47E66222AFE293475BD3B1778 H4NDICR4F+
804,173,182 *536D9CCEF8C41AE86B1604FD1EE2093E3C0E6C9C HABREBSW
804,173,183 *5367C6885BD10203A12E503D7B4C4574AF180BE5 CHUCK MULLOY
804,173,184 *5364C19BCFCFD897AC47A7A91581B194F579948A chug chug chugalug (push and shove), part 1
804,173,185 *536AA263EA55D09A3BA65018143601020263FBFE HAL.NOLT
804,173,186 *53652EB29EBA978F0A5AFFA24544C02BFEA002F0 [email protected]
804,173,187 *536017A5ACBB081A79BA74B9C87263B82566E706 HARDTOTRACKDOWN
804,173,188 *536954BE5F85766DCF6FAC79BEE6DA57D2F4702A harrionlove
804,173,189 *5368C5903AB0C9E123BDBF8F27C48827B9BD00E2 cinemas
804,173,190 *53668F2143CFAF76B2DDEC452C3F61867D848FC4 HEIRATET9
804,173,191 *5368E48BB27BED95B0C4C16CD4ED5341CB19250B CLAYTONGOSSIN
804,173,192 *53655263669946EC31E607089C54DA64B98C4523 [email protected]
804,173,193 *5364F4DE40950B6B131A68D65421700354FA518C HLBGKMW
804,173,194 *536607E1D8B9AF52B5D4F75D16AD7C538BCE96CE hooikoorts8
804,173,195 *536C81809EFF4AF0E62B8EC6D3D29CFFADFEA802 CMT1Z
804,173,196 *53611ACF708652B61F5DEE190B9C6AFACDE1AFA4 CN#FE
804,173,197 *536F07A239D1A59DB24D995BE55E39360650B2D2 [email protected]
804,173,198 *5366F9227691B5A6050AE54B33A292C38FAE2C5E HPIDTSOP7
804,173,199 *536CD8C9F59B3ECDAD78E15EF64A2CFC704E66CD co_hb
804,173,200 *536FCC2B2C8A36597A432A007D2F338A49D98AF0 comparaison(n'estpasraison)
804,173,201 *536188597BBDB54E22616470FB9FDD829FEEB3A4 C",ON
804,173,202 *53608197CA72266FD795B61F5BCE3C61681D88A9 Hulluna-humpasta
804,173,203 *5363BB29F4D31AADFE11D83E6F314CEB26C1B93A CONTINUEGAMEOVER
804,173,204 *5368B2F61FA1F26954C2B996B5E35E73E60A81C0 iluvjose4
804,173,205 *536A361286269FD3BD2E1E90F0E3E7C216CE5F32 CS.SJ
804,173,206 *5367658079507F82CCADDED950446083995C8DC2 :d
804,173,207 *536F514BB5FFEF0C024470BC2CB0522DABEFC70E ISIAHCHARBONEAU
804,173,208 *536035BB849409F864124C58DCC60D10386C5EA6 D313947ONS
804,173,209 *5365B0D483C796AA42823F4F5B098BCF5F1948D7 DAMARI568
804,173,210 *5367B5F6BAB799D0717592996252B4C55B6A48DD DAMONAMADOR
804,173,211 *5367BE7B4BAC339D20165AFA739A3CA455529723 DANNIEDRUSCHEL
804,173,212 *5361EC899A9C25A290A0E9B912D51B141F18F8B6 janeparnham
804,173,213 *536478A07370AEE65274D53743FA2039C1E6315D JAYSONKENDI
804,173,214 *53648F9C87E1375F4A077FD1CCA1566D3B590E88 JAZZYCHERRY2007
804,173,215 *5369F581019F0CC779326EC3C434655FF0E3D5FB JCHHIV
804,173,216 *53633BF1DAAA7CE95CBBD2C9C6AF69F081B6CC70 JDUBL1
804,173,217 *5369C9568084396014C41EB3274CD6F827302ED1 DA?S+
804,173,218 *5367C62344CE723C1BD47C78EC7013ACFE7E4EDA JEFFERY.SIEFERT
804,173,219 *536586FB3167C82D930582009AD099DC5DA44F10 jeffpracht
804,173,220 *536D9E340EA2F699163DB0D6F27AD21596374C43 DAVE BARON
804,173,221 *536623FA637C579AD1AF77D4D271E87F47FCB232 DAYS-ALONE
804,173,222 *5368342E3609478621F6A3CA6F0C21728E7B9193 dcbt-
804,173,223 *536A6725F23C356C0DE3B22E66724B5F8CA801B0 D$COUR$3D
804,173,224 *536D3422F01DBF1919176173B2B021830C7A47F2 dd!sp
804,173,225 *536E790BE020139C60E82CE2820094694125AEDA Death.Is.Alive:.1981..1985
804,173,226 *5361C71132CE4FBDBBFB3CEAFC9E7065E9D1BBE0 JMOHBAT
804,173,227 *536F8085668C9ADB4D735891B798A28543CBEBFB DECAGOULAIT
804,173,228 *536B24E492BAF7D8C6F3D869D8356A6479A8D5AC de?dc
804,173,229 *5363E85345A84F87A53ABBDFF021F21C60ECC672 JOHNNYRUBINSTEIN
804,173,230 *536264E31BEB030EAB1A5F9FF1293B2E1AD8E99D JOHNSON.SADVARY
804,173,231 *5368686DC7DEDFD9B1BDDFD1D635C788C82B2107 jonathonlempka
804,173,232 *5366CFA3CAB1BBBCA33FDF867DC32001CBC60D3C DELPHINARIEN
804,173,233 *536BC2BC757F1CF9FFDD6D05C8EC29A0AD13519B JOSHUA.KOSCHO
804,173,234 *5366CFADA9314004AFDEE8763094CC2B72047B0E JOYCEAGYEKUM
804,173,235 *53683BAD20A4ECBE8706E133A460144E21BC2FFD [email protected]
804,173,236 *536984752F8972A93C8A9BBB3AD27D6E75D6C09E j&q8
804,173,237 *53686DAB9C5B0121ED77439D3C0674DF2F55FEA9 DENVER.PRIZZI
804,173,238 *536F9792DCD6F2934A65AEA18638C5D9D32B115B [email protected]
804,173,239 *5368ED8C365922B592CDA965399C069D1E92C632 dereksanker
804,173,240 *53631A8A486B4D1EF47E559F6DF8D3D260F78BE3 judefieldhouse
804,173,241 *5366273E9C8E82B4A21CA1858A5D47170AB8795A DESCRIPTIONLTAVRTES
804,173,242 *536892C7631AE2AC3FD63AB50C7FF3AEBC4BDEAE juliuscaesar,actiii,scene3:i.here,curioandyourlegions
804,173,243 *5366A302C354556375600A7C3C8EFE8B40575EBB JUNGEJR
804,173,244 *53618A3A6330B685956D3DC90213E6077EEC199F DESPREVENTITA
804,173,245 *53632573497775489478965557B371BC0E3F362E devieros.-.erotic.of.selfness.iii,.part.1
804,173,246 *536C080B7935D20442A2F3C7B3149E536CBC03FE dextergladney
804,173,247 *536DDCBA7B15494AFCC82D2F8D231BD6F14AB796 dextergordonplaysthebethlehemyears
804,173,248 *5369A79EF9A43B454D56EFBCD8B0B67524F52FD4 KARPAGAM5
804,173,249 *5364BA93221D23007AEBD2D343173168112FD9D3 dgu7x
804,173,250 *53673DEAB29026C181C7E22B82EC436C8706D954 KELLI DAILY
804,173,251 *5360DDD2336BFEAD43740ABEB189451FD2D57C49 kenethlana
804,173,252 *53630D43EC82613899E7AC8B710DF62D638526F6 [email protected]
804,173,253 *536D14BF61A730586ADB3D9E09B4F13C81A10A1D [email protected]
804,173,254 *536516448F2450FF29602A12946B342B315A682F KENTON.MANGANIELLO
804,173,255 *536C99F85051019305AF680BE32A20EB3DD6C1EB KERVAGAT
804,173,256 *536AD28394D2A147BA78A342492CB50936147766 Kicsi.ember
804,173,257 *536A76605E430486AE14A6474F4978CB38C60F31 DK2KE
804,173,258 *536356BE86DC7A1760E191BB7884DA3732AE7EFA d#nkl
804,173,259 *536C010E3CDC82D78A1CBD9283FCA172D3F82160 DOMINICKILIFFE
804,173,260 *536BDC196586DE27F94F458EFD77E04D0DCE015A [email protected]
804,173,261 *53677858CC032FC007095512D604CD3AB9C993F6 KPTLSRD5
804,173,262 *536B6CB5BD9D722C7AFB8B2D513AB01190A43607 DOUGLASSCERUANTES
804,173,263 *5369E76505B75E1C92A8E2A249269F868B3784A9 DOUGNYQUIST
804,173,264 *536C936856789C072A820152E24F44D493E63CDC LABLEEP
804,173,265 *536DFCB4EB7D6556A6CC3C7A193A6B9F3CB4C283 [email protected]
804,173,266 *5368622DF2205F1CF750E6F46A8F2CD0621A28C2 L’ALARACH
804,173,267 *5361F4E2CE5DE5618F3D1073276FBC4050CFD8CB landondesue
804,173,268 *53630C33D2786A07EE181C8DEC1E003B53511434 LANDON.SANAGUSTIN
804,173,269 *5364A6FFBC9DB8B3DDDB4694EFE91A6680592798 DRAWNSEXCOM
804,173,270 *536AB9A4869FDD14713E400C4D488A8BE4B7E453 LANGEVINS3
804,173,271 *536C703A38385EF69676018C31A2BD0CE1AC799E LAUROHERNANDEZ
804,173,272 *536225C32E31C490B17CF8EB30FA61F8DF420FF6 [email protected]
804,173,273 *536430120B695D81BB0E79399DA0D3664DF07F24 DSHADOWS7
804,173,274 *536FB9BE82FBC20495D9BA509EA599F077D60287 LENARDVIAU
804,173,275 *536706107C37C017FBD59EFB8B7D33B73FF9AB3C lengrennon
804,173,276 *536B4E759723C158D6F16BCBA33AE2C6630595AD DUJ;
804,173,277 *536700B06EF54DBB072D6D9F7AF62A1A5403DB3E LEROY.ANDERMAN
804,173,278 *5366225837DA0D189635D6B86E91602B64C4C744 duymp
804,173,279 *5369298C42105F82FEE98BEDB642AFC124B35846 dvohh
804,173,280 *536114D8146A32DE36C99B525AB3F8992E243691 dzhsg
804,173,281 *5364C9D2469DBCE54877F1A7E382136EF88D7A8A EARNESTDAVID
804,173,282 *536F60D1EDD735F396125F169318674AD62EBBF7 ECC2005GMAILCOM
804,173,283 *53629C830C0E71BB28CAF51F8FAD417872604674 lj#p
804,173,284 *536086B7F3F91E5C4D67655F4829525F91D14A97 EDUARDO.SOCCI
804,173,285 *536EB39D8F8D8A1A0CAB7C80029107B55C50BB2E edwardodemark
804,173,286 *5369D911C544502AE9C73089FD7F67240463381C EDWARDOPILSNER
804,173,287 *53644170E9965F5E2203E52990593D4ABF3A7A3D efgn,
804,173,288 *536590196BAACC7879242404000F2E8245D3A926 eirikug
804,173,289 *53616BC27CFB2805A7497A36D3CDE7238EC9FE29 ELDEN.FROEBE
804,173,290 *5369FB351D911408E1BF56FD61AB99E4A2935551 ELDONSESSLER
804,173,291 *5366A96045176295F8478624F3A54160B831E0C0 ELI.CABALLERO
804,173,292 *536ED2A79AB9954CDB7384170C1B28DB1E52464D LUI.BBS
804,173,293 *5361AD42B3E423CBB0CF5F18C2B5645BFC4100B4 [email protected]
804,173,294 *5362AD8578E3FDF1ADCB945977D7B8093C5D06EA lustres
804,173,295 *5368BFC61A1EAA47F04742F797257E4F6A230375 LUTHERMARGIS
804,173,296 *536C6CC71C85F324A362860907378D1C05ECD802 ELUDENT.
804,173,297 *536955EA1C4AA3F3E3544A8BE93E7EF6C3E2358A ELVIN.TAGLIARINI
804,173,298 *536C421DDDF91D1E32172EA0FA6933EE72198402 EMERY.WERLEY
804,173,299 *536AB5C30076DD170C64AE0EA6969676C503E109 emmettflanary
804,173,300 *53613AF7131164B2EE1386E4822831FE5DB192CF MAJORDOMII
804,173,301 *536F4C4D7E70CF02C9244E2EFCF7D0E2D3E639A6 MAK
804,173,302 *536BAFD9BABBA0F172B3397DFB10B58FEDFF70B7 endless-love:-main-theme
804,173,303 *536C52F652A3ED3841E776A1D4260E0FE02A03E0 maracana.madness.(agent.dan's.remix)
804,173,304 *53634A9B03CE2C1D852B185D19553DA4006B056A enterinant3
804,173,305 *53689F4A07C2A7999DB0D16D0A7F3B01316E167B marianoweisbrod
804,173,306 *536EB946245B406480D1B92058606E9AF77155F6 MARKPLESKAC
804,173,307 *536940AEA5C912A97973B79DB3E339CFB74988F5 EQD)0
804,173,308 *5361E21185190BD8EF5C0B44DA082D907127B0BD marvinnybo
804,173,309 *5362881DA0A5B8FBCC6A8149668DD0E6444F73D6 [email protected]
804,173,310 *53633BE5FAC9A77E0FE596AAE977E8E7861527DC EREIDSAA3
804,173,311 *536FF3CBF575B3214E93216AAC991B4273F9735F ericgould
804,173,312 *536DF96F42C63F68C52F57EEF6534740CC796750 ÉSOTÉRIK
804,173,313 *5367D9F996FC446FD9F5E86E7C39FBFB4DB129A7 [email protected]
804,173,314 *5365050BC40331A8E7C7A70F055202499983FEC9 MAYBE-YOUR-BABY'S-GOT-THE-BLUES
804,173,315 *536CDDF25665484B7470BB5013CE3E74B7795A25 meine liebe zu dir
804,173,316 *5366D1D40CE1645EE8454E61DC57AF3A4B45C0CF [email protected]
804,173,317 *5367C03535E16426D1EDB860FD710DA221046717 etiovlev3
804,173,318 *536F424EDF49FB9DA619D2F113EAE406B689F2E7 MENFÂ
804,173,319 *5365C4A0B19BA3CF8A3CFFC2B147B1317463A0B5 EUK6I
804,173,320 *536C9CAC85C4F896BCEDABB38BD122DE43F4FAEF eusebiobouldin
804,173,321 *536A0C77F30C374FA3B9CD3AE85CD668F9CC8CC2 METETVN6
804,173,322 *53642622E2A2B806B33F25F2ADBFF9AA907ECED8 MICHALE.BILBO
804,173,323 *5369D962EE2F69C9B832256B37FD4E8B71816C6B michelezephyr
804,173,324 *536DFCBD4D6AD8CC2E2756690C3FCE17579C6308 MICHELNUSSER
804,173,325 *536A095CF8343F3FCBD594620A9ECB093A11F2F1 fantasia 9 in g major: iii grave vivace
804,173,326 *536478C6AA28A36D6DE28B8D76373348DD5673CA fausson
804,173,327 *536A53267D5AA9BF92DAB58AE6943309D8FE47BC MIKE.SCHWIESON
804,173,328 *5364F3EB66DC1E75C050279BE11B3275DE1EB6A8 MIKETERRIAN
804,173,329 *536C2589B65630DE5C5B853BF298F451ECE8151D FEETSENSES
804,173,330 *53630F838FD09FD6B79E0A00BE126E5D12907AC3 MINHGUEDJIAN
804,173,331 *536AD43AA042DB2AFE6D248FAC92268E4C2D2897 [email protected]
804,173,332 *5362B471CA16587FB5334F4595F0DC6DD7685E3A mirmir3603
804,173,333 *536537A5B02BD421CBAFB52F5366A03EC45B1F5D moils
804,173,334 *53633A6558BADCD448B42FBE071D4DB7D7A4BAEB FLOWERWOODY
804,173,335 *536625201BEEECA3C5BBA034D983BFC97104514F MOSEPECCI
804,173,336 *536394AE77312C2455882653C367632D50240CE0 mosesuhyrek
804,173,337 *536A12EE0D3F8BD19DED42E4E88460F24A3EE54C [email protected]
804,173,338 *536B040185D03E7C169F4CC585BA2E51D9543115 fourseasons-thefall
804,173,339 *536AE86A6A21FD5DB948BCF499AA21C69974CE18 FR33M0N
804,173,340 *53691988063232A87132ADF34BC24AE60956D224 francescohaddenham
804,173,341 *536CAE11C039971329017247DED44E8C323E6226 MÜCHLET
804,173,342 *536FFCB3EF9E267FABE9C2847395CEFEA41A40BA mukivoru
804,173,343 *5361BA9CD39DC9CFF071232358C5A7B1CBBD7625 MUTANTÓW”
804,173,344 *5368BD86FFC0DFBC093676F456271EAB54E4B3A4 my grain
804,173,345 *53633AB989BD847626F68ACB360260D5718D7A2C [email protected]
804,173,346 *53667C2405662287468C4E635EE60E83B7BDEC75 FUERZAN2
804,173,347 *5364C5CE774FA41D1B10F3DF140FF504B7F776AF FUSIONSKETTE
804,173,348 *536B282BB2F158575ADE495CB3FDEF3F1377FF9B GANATSU
804,173,349 *5361171C0FBC30A1E4FBA8D97B65574AC133B4FA Nashville'n/&//S/v/I/l
804,173,350 *5363D61225C7D5F25D2ABD3963B8E4EE67772A62 GARLANDMCCLANAHAN
804,173,351 *5362FB2353AB98FE5C194D85D0A3D828E942B81B NATHANIALRAVOTTA
804,173,352 *5368796D785B5446BA981B5FA6C56F97CAFC1E9B GASTON.DIOGO
804,173,353 *5361E015581C3F5931562BE34D0F173D2C51ADF5 gaylordattilio
804,173,354 *536C8B2C570CC438407EB7D633E4242480CAEC03 N.DE.BORDILS.JUI
804,173,355 *536F45A5676B7B4197B7FA2E380C4C453211DE3B NECROPUKING
804,173,356 *536005E9919DA7AFE3C0A2C5E5AB63DCC5D77B59 NEOBBSW8
804,173,357 *536D4643D2C0D408F7A8D94EBA780D25277B1BA5 GIGMANESSES
804,173,358 *5368C55731801096F18C46629D0CA70C0D58E7AF nickgopher
804,173,359 *536B8A261E649BCE18B73BC699637E6F2F8A58FE NIGHT—THREE
804,173,360 *536A8BA47942E506614A429A2980944C81E36BCE [email protected]
804,173,361 *536E0A45F653F799039F29567E9B2A0D0868FA23 NM0028674
804,173,362 *536D8B25211BBEBAF2C85BA9E83485B6D3C162B4 noah666
804,173,363 *536E0EBF63540B0363B0501BB6BF9DCECBC57B36 gormqft55
804,173,364 *536DA9BDEC8019FE0231CDB3B7E1AF0174F8507B [email protected]
804,173,365 *53681A1870E0C510D723F2215F600D7053A44898 NQCNZ
804,173,366 *53636E175034A8662279514FF7BF20725D546A9F nup7i411y
804,173,367 *536E2BE95EC6D65CF102CA42BD4A0576F6CF389D GUREBECCAF
804,173,368 *536ED2040CD315777CD429B5D473289B01D378D6 gusmallary
804,173,369 *536759C51E9272620A790BA5EA06C285E1BF2954 o><* <=====B
804,173,370 *536910912566C8C02DCCF910D72F9237445354E3 GYANSAGARU
804,173,371 *5360E0C8713DFF8CC5123E8B2D20C188EB77D8FF octaviomaret
804,173,372 *5365A560C16B509E7DCD9A84C2E3CBEF9E7EE797 OCTAVIO.MAUCERI
804,173,373 *536B042E531F9E4D0E28C773778F74FD2479B0C5 odieux2
804,173,374 *536A399CFA47327705A74B9552CC46AE8E72C00D HAGORAMO
804,173,375 *5369AD3B240E017509DEA1A34B2948B06438E74A ohioboy74
804,173,376 *536E8C6827979CD1F7C36F4FA736998FFB65FDE4 OKIKUSTING
804,173,377 *536C7768F7249F084404F8C0927A8CF0CD79F0D9 OMAR.STROHECKER
804,173,378 *536F3DE9AB4903A75CC17BDC304902E7DFDCF55F OMMASSIF8
804,173,379 *5362F1954A9F5627A64D286BD64CD336B8519E07 ONTWELS8
804,173,380 *5369877BBAFD2FF52EAE162B39A69E1E8D932945 HELL'S.PARTY.(REMIX)
804,173,381 *536F041A0A7F785C1B6E1A7FC7A1A7634838E69D orenauton
804,173,382 *536663A88256553828EE220B51F24B6A11D9EF9A orłami001
804,173,383 *5361D708FC68C64CDED79695C4ED1ADC092AEA60 HERIBERTO.MESECAR
804,173,384 *536DECF3400EEEE7A24751CDCC171875E8D9D1BB HGXTX
804,173,385 *536976492AB4B0E86B22382F9820C6037DA20753 hiphop1412
804,173,386 *536954E3E2809B2E53D4631D133B4EA2349C636F P1UNK3R
804,173,387 *5365AC1FF9B71AC0E9D9525F2608E30EC8A01085 hosearodine
804,173,388 *536848C52BC2584E7E0E56174D48012E2464D164 [email protected]
804,173,389 *536388350C5041D5B21CA5BB94761B836CCC1FB2 hoytmendelowitz
804,173,390 *536748A9DBDF91594E02CD847ED737FCF88C990F HRC30L
804,173,391 *53624BF01476BFDAEB8937E8FFDEC5B110EDED3D PAWPARKSANFORDORGWWW
804,173,392 *536A3569F42BD3BCA2BE0C400B1954967F45CE12 payton.hampton
804,173,393 *53692AD7BF392ED6B3B5D801A202023260E1CA0B pcaaa
804,173,394 *536AACB1B22E373979163E1A7E5CA81945C6380F Penpon7s
804,173,395 *536E2AF0A35AB1F6FA3CC3C5547BF84133B09107 peoplenick_names2c_
804,173,396 *536C895B8BB861A1A977C6395A2214A7E14BBF2D HTTPWWW.THEKANSASCIT
804,173,397 *536031832F9CB28D4C67A1096953F26A77EAA687 PERKUJTUAR
804,173,398 *5364D9AB8A1D7FE093FDC74E2A39FB55C173170E PETTIFOGGING;-BENEATH-ONE
804,173,399 *536A12B6E18368F9BDEA7A2BEB6DD3CBCD1E8E60 PEURBAD
804,173,400 *536A6BC24A7C1DB6D3590C6689182B60BAAD3238 PianoConcertoinAminor,Op.85:I.Allegromoderato
804,173,401 *53642F2F130B909DFFE4F34F2AEA54201B7C606F IAMDRAGON4
804,173,402 *5364D12CB1C749D14C12A7D81CBF518F71BC217A PLAPPS
804,173,403 *53626030C0F357F35CD7F10628946B8AED1B628E ILIRDORC
804,173,404 *536C0518796F13BF0322C5FDC5554CFFC7D8AB45 INDIANSBLACKFOOTBLAN
804,173,405 *536131BFDCCD49263EF8BD37EFC387C6363A1FB4 PRAAVAA0
804,173,406 *536D0CA5326D6B968949B5E07789392A9163AF7D PREALPI6
804,173,407 *5365289C353B3F4B7121938A8D64982F7D71C61B PROCURERETE
804,173,408 *5364D66B3CE8CFD11F8A9F8A3401B62EA1E43A1D ISONHOODINTLEHOUSE
804,173,409 *536D5E046BDD7109E876096C9CDCD43E09A4A964 [email protected]!Z3R
804,173,410 *536D9E9D443AA4842FFEFBF3181A03A03E12D866 jacksoncrespo
804,173,411 *53624B52ED670B2A27F60CED36556F43351829A5 QOAM
804,173,412 *536AA13D11C81F122B10A3BAE5BF108E573A5472 >-<-~-`-Q####Q
804,173,413 *536A098AAF9D7486B1C1C63FAF3255EF181AA46C jamarama2
804,173,414 *536E8E19D53FC33C509376FD05A05DA3A9E39052 QUE SUBA MI ORACI
804,173,415 *536085C69EA3182189930956916AA6BDE0D8FA11 quintonsickel
804,173,416 *536BB59AB901D43D7AEF3D66D92AE5B4F0AA7741 JAMEY.FIERST
804,173,417 *536A028D1D5635E86B41D44F4FC4B414A79C1163 jandockstader
804,173,418 *5362EF66752A0238E498654191330C0268BB1A8B JANSLOVER
804,173,419 *5362EDA76597FF4003E110F9FDCB7660D33C3FAF JARREDMYNTTI
804,173,420 *536BD56D1CBCCBFBE983925B726EE61863A8E880 JARRETTBETTERTON
804,173,421 *53677FEF43C84523A1A9E5EEC57A52BFB0988B1E R3UNIFICA+I0N5
804,173,422 *5361AE4F3B551822074F94D1EDD76880C4F7F7D9 jaspercardoso
804,173,423 *536FDA4F0464F0E8CE093C9FC536E5F5788C7148 Radio.Flirt
804,173,424 *536EE5484644530A81A6F19607582FC6B8445AE0 JAVIERSAWAIA
804,173,425 *536497B3F5B4E9424B9440D9479F7E905C33D54B jbfox
804,173,426 *53666E750B92F3F2514E1B6759FF5D6F4DFA3D9B [email protected]
804,173,427 *536817B9E6BD9E880E2ED17ACB3BC622216CC184 JEFF.SCHWENKE
804,173,428 *536758B0BE71E5419B6509AD7E01C8A73E33953E JENNIFER-DURO
804,173,429 *5363B9BB484BD9A1A48D959DB3412FFFAC0D9225 RANDYLETRENT
804,173,430 *536BF2621FCFF961695734BFCDFD996BAE0045B6 JEREMIAH.MAUTNER
804,173,431 *5363F2C805F038E0943F3F09CC16C0B81B2C1E82 RASCALPHILLIP
804,173,432 *536EB8006F8FCBBFAF442FEAB70C3090173850EC RAYMONDBASURTO
804,173,433 *53613CCE6709DEAFDEF680F6B9FE6D090CB91934 [email protected]
804,173,434 *53688094D42BD18F31E4B5A78754AA46D53D8454 REARREST
804,173,435 *5366932A6EEC399F7A059E1EA873B71E4760CCA5 RECIEVER7
804,173,436 *536D434FE8E672619D6D8C539B0D1226C074D4E5 REDNEWTBSW8
804,173,437 *536067230F236EB13588F5A18280185B9788EF05 REFLYSTYRT6
804,173,438 *536C5E82B354B81E36C979DD352B93C48B944647 reggiebitter
804,173,439 *536DC358174DA48B5067E5C758DA313F0F10B1D7 JOE PELLA
804,173,440 *5364C7E9470DEF385750A6582CF4359B156A3BE5 joeriver1
804,173,441 *536C52738B6342634CBAE3AFF22A9145526E734E RE$INIF1UOU$
804,173,442 *536310CCED04221BFAD8981ED264A1B5A828F0D5 JOHNVLNA
804,173,443 *5361D4F86BCE3205D92AC4B25752A95F82ACCC85 repentedanatureza
804,173,444 *536508EFE5881138BCBC99792EFEECDFB2F7BF12 RESOS7U8:TANKER
804,173,445 *536D92D4AFD220B6F6A85AE62657CFEED7B01655 josephdillow
804,173,446 *536C598B4669EF4E2CFEC4DF1D68CF909F1A3160 RETIPUJRD
804,173,447 *5367E26F702F36CB15A07D9F00541757A57E5944 [email protected]
804,173,448 *53689AF9B4EA8CBD576FDF0AF2CF4DD2178057F6 JUDEDENTEL
804,173,449 *53650F95742E79DA741BB40C39DB7F112926838C jugula
804,173,450 *536582278CFE1FF3A5D9734EF44EEC513224DE3E riavevi3
804,173,451 *53615B6EF3CB45BC43B7AFE032817E0489FCCB1A RICHFEITS
804,173,452 *5362F098DFFB59B8AD1FA16978B0C1E29876D46F rickjankauskas
804,173,453 *5364395E108EBA25BB90069DB32EFEE89E01D51E JUNGEJR
804,173,454 *53646B1A302E83FAE98E9834693A38A500E859FB RNEBRASKING
804,173,455 *5360A05250E2A9F34E04FCC0F15760D399229045 *k0aaa
804,173,456 *536F42C3AA543553103975BB4AC6E2B6BEF0879E KALAZDOR
804,173,457 *53663C6462DCDBB84BAD990902142866EB505561 robtcrail
804,173,458 *53622A3D52B361390A528752F4219FD734E54D2B RODRIGO.GRUNAU
804,173,459 *53645D4FF588C2470135E601F0D64458496A7512 KARENDENAULT
804,173,460 *536BE2E1AFE9783BAB4CBA54EE7226DA3974A47F kaseywetz
804,173,461 *5360384752CEA2BA96B0E19822DF230FF4120433 KatchinKa
804,173,462 *536172C9A5FF6B655522EFE276499F60B836C71A KATRINGREEN
804,173,463 *53618627CD02C8E935982CD177F1BFFB15E4FC0B roetine0
804,173,464 *536CC571D223DCB6B35882C7D2B1D1A2E7648EB3 KENDREWRY
804,173,465 *536A26861DDC1D248074955E6BD3D3260219A56A KENTON.COVONE
804,173,466 *536DAD40307745FB6DDDC64AAFBB4DBEFA987728 RONDABEAN
804,173,467 *5363D204D2D7559B0E2394A19CD2A395CC796D0D KEVINWANVIG
804,173,468 *536F6416F2460C3BAB796CDB5B0FD1AC0E5D276E [email protected]
804,173,469 *536D486C47AAD8EF0615569D0F5968FE4E800E35 ROSENEROSENE
804,173,470 *536A3C25B1B9235E5BC6E8265FE7BA37A4603474 ROSSERPEROC
804,173,471 *536F5B4F886C9BD07B342DA885A29516284F330A rovenia4
804,173,472 *536ADE5A17D64F13179B7ECA988A6CD11C40C696 KIRSTENFLIPKENS
804,173,473 *5365FBDEA690F058C6D9ACF5BB9B2F8F95177EED KPORRIS
804,173,474 *53634385B637C54D134DB06350872DE856166C38 kraig.grady
804,173,475 *536DA35A5EE074CDD7C59DD58E44171E63435F0B KRISTOPHERSCHUTZE
804,173,476 *5364F86E0727CAF0D72C5114C59827DA1D11837F rvshdly
804,173,477 *5363CC9EC69C4C279F7827F5C93AF8527252B65B SAARBRUECKERZEITUNG
804,173,478 *536A6CE57A0579EDF12BBF9D575AFD1B366BF91F LAMASEST
804,173,479 *5365A224D88759A57449DA3264967F9E41ADFA81 LANCENAUD
804,173,480 *53622876877694B47F9F286CAAB1F32DA545DBD7 samuelmaclennan
804,173,481 *53682592E0C7B46DAB22015EA94CE33ACCF74183 sandyrattner
804,173,482 *5369B44FAC688AAB735B10055B5377C238B0D1AD LARRYFODERARO
804,173,483 *5366F9306C49CF993DAE662C1C9D82AD12CE7069 lathus-saint-r
804,173,484 *5362CF8CF03EA9E5FB785DBF74707715BB2CD5D5 lchrymtn
804,173,485 *536D4CB321A0DB0EBE88EDFA7ECBC061A9C92C9A LEOPOLDOBRASHAW
804,173,486 *536979B5CAAC850D6408838F4490EFC4578950EA leopoldopanchak
804,173,487 *536FCFDB6287A90C763FA0E6A4C191F0B7090A44 lesgewangminnen
804,173,488 *536B189EB4CC34F0867E17C79BC17BE10DAF70C8 [email protected]
804,173,489 *536136E3E5E40C6995C9589D7E735237C04F050F SEDADEIBUD
804,173,490 *536D406DA5EDDA5EEE0A04328ABEC58E4613F9A3 SEEBASS2
804,173,491 *536ADE414C58D4EC359DC96D46ECB3E70F7C7572 LINDSAY REAY
804,173,492 *536A082AC4192964FFE9B3FF14EFB7E3E3D4D878 [email protected]
804,173,493 *536E947D81BAEA6AB4FB242DFAA74E3C84698C11 [email protected]
804,173,494 *53633B6C31BA245A46EE50346E63657F47104F22 LINOSCHEY
804,173,495 *5365B2CE7A7E90E01ED663E8A98EA21EF88D8AD6 SFASCEREMO1
804,173,496 *5363FE3AE631E725B62CB4C18B71F5067A6D3A02 shadowchalleng
804,173,497 *5361A2EAE2516611515478E4B0A7B5E1388E30C1 sherwoodyoxall
804,173,498 *53662289A81D6D55853A96F950454348EB4714EA LONNIESTEEVER
804,173,499 *536120755F5BE1E5A2D344D11D3523FE4A746E4D LOYDVONNIEDERHAUS
804,173,500 *536FDD30AFFA4668245647686DB373F85E938286 [email protected]
804,173,501 *53689F6A64CD845335FAE918AD4EC0961495AA69 SIHCCARC
804,173,502 *5364D7579131F4BD8E8790FFD7E7F205DAC38DAB SIKARTETS
804,173,503 *5360937F1F2752E8B6FCCD05A8990F417998E67C SILVERISH9
804,173,504 *536D924A990B0F4FEE5ACC49691F9B15A64EB4A4 LYNWOODGREENHAM
804,173,505 *5369941FDB60B010CDEE1F2967D4D653A44BE94C M15071507
804,173,506 *53687173944645744088DFCE64568E6350AD1B9F M3RCUR411Y
804,173,507 *5367FB980350E5192B26B804AF46C63D0897C6A2 SIX-YEARS-GONE-(2001)
804,173,508 *536CF47BC186D86239BC7483BC4423EDCAF68AF0 [email protected]
804,173,509 *536B1830D46319C04B0E0D3B0DD127F0D0F1ACB4 MAKEMEWONDERINTHESKY
804,173,510 *5364C9CF1D3302404C97CCB52AA58B6EAA53B579 MARCELINOPFAFF
804,173,511 *536971757FA0429BC399EFE2DED01AA0FB4136E3 MARCELLUSSZCZEPANIAK
804,173,512 *536B958F7784B84F35EA1E2EF0BCE9FA1A353D7A marianne-brama
804,173,513 *5368156F1C08240B31218953BB4BA1A4A2E30CA1 MARIO.SELSER
804,173,514 *5369E24F4867ACABC5F93A0FBD73D5DA255E7545 MARKKROMMES
804,173,515 *5360B36A2FE064CD83665BFEE3BAB822862F9941 [email protected]
804,173,516 *53617EB5E97298D90426224AB8CB20E7D0D85D7A marquiszeise
804,173,517 *5362977C0DAE54CFE1E3B4EEE4C8B4F0CEF47A18 SOHLMANS1
804,173,518 *5362AF26333D531B0B8C0C285B842BE35AFF7A97 SOLOMON.COMMENT
804,173,519 *536465C2C96A70435B234A9022079954C77DA708 SOMEBYBETRAYAL
804,173,520 *5364AE8068688F9DF7EB3BF8F09E524D44CB9787 marylimber
804,173,521 *5369B15503A341445D1774C17D145843EBF2886C mashed.potatoes.'66
804,173,522 *5360319CDE3B0CF98AEA2338F7000843A6C48BA3 MATRICULACIÓNS
804,173,523 *5362F95EC4E01482646BB1E14F2CD18166BE913D SORPRENDED
804,173,524 *5367B0786104AADD9F55F2339844004EA5D57C21 MAXBOUSSON
804,173,525 *536182F9DC71BA3FD56D051001AF15FC860FEA28 maxwellredenbaugh
804,173,526 *536FE7E6BAB95E22E629D89A9B19608C2188D529 SP3LT3RMAN
804,173,527 *536FAD74293485279AA4374BBCB768A39FDF0215 spit-at-the-truth
804,173,528 *536AF1DF11161BFE08A91160354CE11ACF04E88B SPRINGPOTE0
804,173,529 *536355EAAEF0BC7B430CA6552CD00A5FD8C7BA91 squeezebunted
804,173,530 *536ABDB98E4BCFE08D898BA13189DBA233545E59 MIGUELDORIA
804,173,531 *5364645022ACAB6B91484B1F5563E85F8CA835C1 millardiburg
804,173,532 *5360CBAFFC94B22F1B03E2C5CE25D25F0C5D8585 MILTONESTEYBAR
804,173,533 *536497462A57278C02F6ECF1B288928E06E248B2 [email protected]77netcn
804,173,534 *53695D3A16FFD007747F206593370001BCC2D04D STANLEYQUIGG
804,173,535 *5360113668FF205D9B7AE2897AD91196847D7E91 STANOVIŠTNĚ
804,173,536 *53667CF528953C3910AFD89A4FBA8CF4BC86AB02 MINTAKA'S
804,173,537 *536C845E5E862FFC00DCB705B29126076709760D statlarge
804,173,538 *5360EA24473C09C0F9903854D9A156772C6FF34F [email protected]
804,173,539 *536A49174D6D3DBA0947FF3E5D176ED3EBA99E42 mladostice
804,173,540 *536782827F2167035E0D270F9A4B59AD5BC20C48 [email protected]
804,173,541 *536AC3ACE09E102A479FEB769CA9CE46DD2A5EA5 mnawavumilia
804,173,542 *5360E71FD697C48DAEFA6B0391F938E88447F9C8 MOHAMMED.ROLON
804,173,543 *536F2769F6B1B3ED92F9B60642CB075EB19C5E62 molenaars5
804,173,544 *5360AE5D31CB12891FE283244311833472EF6FC5 stevenganser
804,173,545 *53603BB2B792B3DE145C190CE0F9030E5576C1BD stewmilkmulliganmulligan
804,173,546 *536DA747B668BA84BB61F417CD3755CCBC56288E MOSCOWSIMFEROPOL
804,173,547 *5362FCEA1C4964875868C350DEBE03CEF1503056 M!$$P34K
804,173,548 *536AA8525A404A2882B5325F904F70AC1D70A52C SUNBURNTPOST
804,173,549 *5366584BD9D099AFD54C7650E06349DEC98F4362 sungmadeiros
804,173,550 *536E5884FF32CD5845CFFF42AFA71C44C0A0582C MUSIC-FOR-DOGS
804,173,551 *536F568B950546ECDD1AF22F450F884CA73BA6C1 [email protected]@7in9
804,173,552 *5369C1FC95E903E576646A462311164659DC3BE2 N2\\604
804,173,553 *536C1A2DE56971B2141358535C6EF2427DF287CD tabishandrabi
804,173,554 *536055F7EEFE125A2C011A3B6D6B1CD68381C178 nærveru
804,173,555 *536FC488E636E8A54CC58B71E7F59D4139EE62F2 natashasheridan
804,173,556 *5366005199B2DE4F26FC072A17EA4773055AEE5D teamsuggesti
804,173,557 *536A0E53F1646A8DCA3BD6A855B2C476D55A4C22 teddysforza
804,173,558 *53684328AAFE53DFC00CAA6FCE16F139AB37748E TED.GLAVIANO
804,173,559 *536DFDDC48209F8687B08153CB3620953883A2E2 TEENAANBODED
804,173,560 *536CD10CA8142A8C87D692EA41D74AB191D1B266 NELSON.DEROUCHIE
804,173,561 *536DBB023A5E417CE7C9E00E9C9ED495C8678083 NEMOGNATHA.GOUNELLEI
804,173,562 *536E3A26CC55936CC570B4AA52976B04F08BDB37 TEMALAAN0
804,173,563 *536BE546AD79A43A808CB81EF8624DD037D89F57 TEMPORAL-CONTINUUM
804,173,564 *53648698FCF7B64CC97A220BB8D98F19944126B9 TENEAKO1
804,173,565 *536C8B1FE95F7A8650B0D6A709B6BE8E4E4D20FD NEROFIDA3
804,173,566 *536D95DD060AB94F7D9750B880043A61F7FBDE39 thelaplaceresonance2
804,173,567 *5361D164F8789666B8C9C9A8EC6DB57D55349089 noriel-asis
804,173,568 *536B5E4F0A7DCD7925B6C477FF6CEF98F71EC2A7 NOWANTIQUATED
804,173,569 *536AAABA1DEF8BC408F57E88F07DBBF10357BB18 tiarutased
804,173,570 *5366A22104E36120E495678AFA52850C55770EB4 titusgavula
804,173,571 *536F1AF27AFDF9F3FDB041231C1ABFFCDC3F8F48 [email protected]
804,173,572 *5365F9D3FC83E6B2DA51F1817BACB03893BCD281 tleppog1
804,173,573 *536BBEC6B5F4459AEE93E76AB4452282D47B4BD6 OHCGNUS4
804,173,574 *536F7231C9AAFFBCD3D9FCCBCB8BC77D83F4A3AC OLENMOUNKES
804,173,575 *536E57D530D971AAFCF73E5C200EDBBD923F81F8 TOM.LASHBAUGH
804,173,576 *536CFBCD7654163621A53305D8768A0D1F0D96AB tonokura
804,173,577 *53677CE66E0E0892828C740FB00CF716F7559B6A ONE.HOWEVERFLAMEY
804,173,578 *53623CE4C75ACBD5D1D943394392C022C65782D5 ongeagted
804,173,579 *53605CB5D6DF9A0F8965C87297EC185DEEA11283 TRÍBUE
804,173,580 *5360868DF4A85819D4FEDAE1BB3E49CC6D2BDCBF OSCARARNE
804,173,581 *536B3A892EC154B0E7521A1ED125A34A5C61D120 oscarraub
804,173,582 *536B39CA56FA74B620A62BE8521BBA96305EFB05 TRISTANRUNZLER
804,173,583 *536F584C9B3E131BE80E42A872BC59F17A4CBF8A TRUBIKM
804,173,584 *53678BE06FF7EB4093ACF0613AF6C3CD964EBEBF [email protected]
804,173,585 *536107630D141E9237AFE49879B58B521D94AE8E p3nolo935
804,173,586 *536D7122217EAF0F3699FD72C1838A6B73D7E924 P[8+
804,173,587 *53612180E2F9EEE20C766DA640BA781BFAC85CB6 TUCKERRYAN0
804,173,588 *5368E3FCE53068C4350C77754DACF141AF8D4043 [email protected]
804,173,589 *53604C24A686B21076798511BDD33201FEF744D1 tuohker8
804,173,590 *536CA1B8C10D1104A14F75B279648D8533187AF2 PALUASES1
804,173,591 *5364782802DF03394B30FB6D1309F72D0C5BA501 panagiotismarkopoulos
804,173,592 *536B53737562ED1B1D23A79015A70267CB66AF5F tuxkitty88
804,173,593 *53655DF51A1531C82AB685147F65DD681220577D tw1dd1er5
804,173,594 *536E65DC35543AFFFCA0EFE55997FA98AA465989 PARISELMER
804,173,595 *536CBF8ADEEA66E99AF5BAD32571968B8C1B77E5 pb *)o(
804,173,596 *536CE66EEBC7F30BB9DEC86492E70A4BF388E3A1 $UP3RCH4RG3$
804,173,597 *53634C98B2E4E2116494546C8E39196FC345F33E UPBUOYSES
804,173,598 *536847DCA72E28094B0F21BDE4B34A06894233EA PËRKUJTIM
804,173,599 *536328C0D39E8F4F7E348AD78A9FCB59C34C5632 USERPHILDAN1989
804,173,600 *536D8C9CAA721590E7E44B54AD387FA151DF3B81 PETLIKOVSKI
804,173,601 *536C5FDF54FA340267FBE4BD5476CFEB8AFCB947 P. GOWERS
804,173,602 *536FE56B44070C3046DB131F8BB693DFA8B9FA12 ÜVEGLEVELŰ
804,173,603 *5369A8EDAF35DE49EE8EB93DC51FB623E22FF0CD VAJILLION5
804,173,604 *53638D95531291749D691E4006872271D862EB4E VALERIL8
804,173,605 *5364C0BABF3079A062C518CAB26C7EF83CFB7D9A [email protected]
804,173,606 *5361EBCAB7335F0F9B6382DA31B7EAB238156530 vanessa.erin.martinez.ramirez
804,173,607 *5361B10D6281DE9593107B4B4A76E00B8E9F6E7B VANFUSCHETTO
804,173,608 *53629A92439AB7E030E8A5F882BA0ABD8368A0ED policianacionalcivilguatemala
804,173,609 *536F2FF9FC1CFA305F644B73DBF2A963A4DD02CE POOCHANDHAI
804,173,610 *5362042E58854C8661E6B53E621BB02A28181CBB VASU-GADDAE
804,173,611 *536AC5CF9CF9D8821141B15EAD86AA99F312918C poop-hog
804,173,612 *536218BEEBF7A4DFD1D4D1713CECDFB1EAA1EA92 verkrimpt?
804,173,613 *536754E362E6E6545409976C74899128DD2EAB42 /PROC/42/NET/NETFILTER
804,173,614 *5369DE1AEF7F1E931A66C2F8E8C6A12BBD9DC780 PROPORCION
804,173,615 *5369C55271252980052F8EDC1979A96EA4877238 VIRGILIOCORPREW
804,173,616 *536C6BE7BD94D6B3A46900A1D28ED981DA456F0C purankadba
804,173,617 *536CDD419C2AF04EEAF2E3A7BA5FA72913093BB6 Q======D`~-`~3B<-
804,173,618 *536408D5168179F6C78BD6527A09A55A7CEFFB74 q----D`-Splat!
804,173,619 *5366CB660DA8FAA37B51F8A2FF73FC96CF7BB176 VSHRM
804,173,620 *5369F171D1A658062F3421EAA1ACBFBABE869408 VULNERAVISSENTQUED
804,173,621 *536821ECE989FCD6A6F42BE33D3477E4127C04B9 vwxpupm37
804,173,622 *5361407220AD7CFD870BCA642851E6E31CB79283 [email protected]
804,173,623 *53660A291EDB65F8225A64FB0D60981EF6E095B0 [email protected]
804,173,624 *5368AA42A283617A8A14E606B7602DE0C46BC4EC WACHTHUISJES8
804,173,625 *5367777F34B829DF2BE5AE1641012EF0D55D670D WALVISVAARDERSES7
804,173,626 *536546A6F72D7F3AE22174FA019658B6F662B92D [email protected]
804,173,627 *536C4F8CBE4B8FD25AAF24F131162B930546A59D qunnions
804,173,628 *5364E0B6A05948A727FC747D363040F729161891 RADHIKAKUKREJA
804,173,629 *53698E20CE2C70413BE5BA56C9BD1BCEAB7D8763 RANDY.BERGUM
804,173,630 *5366CDD45C3FFA8809722D6B8A6C875A96470D41 RAPHAELCHUDY
804,173,631 *536D5579A3EA868377569232B1591DCA80A4DE97 WEERA MATIKAINEN
804,173,632 *5365502F60AD11DD7D69B1A24D3C32FD5B8B3A52 [email protected]
804,173,633 *536B737A72767FBEF7CE8AF21A181E98ED325DC9 weldonpass
804,173,634 *53642B9190362C814659F8361671B4F111AD7163 WENDELL.OLMEDO
804,173,635 *536A1696A944254E4EAC8DD9C9AD6C25CAB2B73F WENDY.GHEE
804,173,636 *536E1D33DC16618917D32243EADD41DE69622616 [email protected]
804,173,637 *53615214FC773177E147176943C21E25ED9FC7A4 RAYFORDFOTH
804,173,638 *5361EB348AE9246AB1EA6112055D60D470837EBA [email protected]
804,173,639 *53682639DFF77792C5038F01FA02467ADABDF920 READERDOUGLAS2
804,173,640 *53681C2BCE086AF7B93251496A2827B9F426C209 REARREST
804,173,641 *5365BAD62F6D1A8EE7CD383D1B46643CFE38DF8C Reese-Wilson
804,173,642 *536168BA8D3CE42224A005E01A4A8CE83CE64B16 REGALEDSES
804,173,643 *53622EB170C9CCBEF9280ACECE546F4E719BAA0B reggiepapandrea
804,173,644 *536AA4C496AE7A7EC76A4CF73B32EDFD7B1E8960 REINE
804,173,645 *536FC41D12626E1005C7CB7EA067C64667D00707 REMAI.
804,173,646 *536DA8215060A95B798D65059064B4FF37B1BB09 renaldoregan
804,173,647 *5369303D40ED218BD7A313DA34A3E2C15632CE62 wochenlo"hne
804,173,648 *536C3372AB47DB7E0D73F1F520872560A84318E2 WORRY9
804,173,649 *536993C386E5F90FCF9B0CE5CEF19A848CD2F45B Wouldn't Wanna Spoil That (feat Mista Mil)
804,173,650 *536BFF570CBC0722D1E4BAA0028D43D9AEF24B4E WPAFD
804,173,651 *536C71C29FC16F5B0C6C7C91E55C48438D7D0EFC REYNOLDSVANESSAED
804,173,652 *5363F24D26CB2E6D878AF77F458580D8AAD5E6B0 RHETT.MUMAUGH
804,173,653 *536289A99F5214CC31898D1677710B2060AB777B [email protected]
804,173,654 *536E71F9E99FF3FA6FA0616C3E3D52511545FDD3 RICERSSRECIR3
804,173,655 *536039A8FF88DD015F5998D3268ED302F9EFF8F1 WWWKINETICPOETICSCOM
804,173,656 *53659DCCE81D5EACD6C2629B86B27B27CD698CF4 rickymcdivitt
804,173,657 *536944832389B2100E5BF9259F68405A597D474E rileyvachula
804,173,658 *5362C62DBDEB5A63FB0E50125429710DF4D8DA06 WWW.USAHOCKEYMAGAZINE.COM
804,173,659 *53682B22533C79ACCE090D3E4A30158923A62A98 [email protected]
804,173,660 *5366300C29F84DEDBBA81BC78CE3F5C0D977DFBA WYNZEVANGELISTA
804,173,661 *53633165D3F71432F488A476A6C4935AA548C13F RKUBALA5
804,173,662 *5368A437F6630C014F0C4DAD81C30E5C4E8E6DFB XANETTEGAMOLO
804,173,663 *5360AC371191F9D4F7EE8C41B43231F76CC2F631 ROBBIEPARILLO
804,173,664 *53638F0D7662D32E1168F94745C839CB504628A8 XCOUNTRYANDREW
804,173,665 *536A5DE92838957416F6E37C48048FE9D2AC5E65 ROBTREVOR0
804,173,666 *5369B7301DAF3EEA16B8ECB5493FA8EA6F740D07 robyn-english
804,173,667 *5368E3F66F37B03FA8E4E84C6227F28F7CDAD2EC roderick-de-vries
804,173,668 *536639AE12DB295C9C2F949677A009D5D3A2BC9B [email protected]
804,173,669 *536508D9E4A17731CD6B8E3447A3CACC73B13F16 [email protected]
804,173,670 *536391AA94065B09B5CF172B3F2E35385FFAA641 rosendogandolfi
804,173,671 *53668536CDF4DBD2EBA36A4D4C5E66FFB1FF59E5 ROSENDO.SOLORIO
804,173,672 *536615F4235E90C8DC093E6B805A5C69E2E508DB ROWNALD
804,173,673 *5369C471D986DF27AB3DBFCF8547B2C422D66B6B [email protected]
804,173,674 *536132C31F6414377C7C812E125C10E91F2E047B ROZUTCI0
804,173,675 *536B9E89B69190229FDD534C9AD6ABEF1DE67913 yan-windeswari
804,173,676 *536ECEC084139824AB860766D1F6240397636F1C S3RAILS
804,173,677 *536A643006B442DB0DA1F9A5626515284522386F yasmineelgebaly
804,173,678 *53653E7D77536C44EF31FBDD705945D6D7B9650E S411YV8
804,173,679 *5369269368757EED0A772D4D01207A687154C485 yentlintiara
804,173,680 *53602D39EB606E9B4DF4ACE2E17EB0B9C64F2F9A SALINICK
804,173,681 *5365F36ED5220CB8C1CDDD8E0E32A27EBE7A2849 SALVATOREPASSY
804,173,682 *5366ED9E4D63F5A6CE50D78F22EE3D666BE327E7 YIUEANG
804,173,683 *5360C6D1D00F77C53E6250D0495255A4E36AA6D8 sandy-amborn
804,173,684 *536DBC19A081347F15A10759DFF4E86B7B8CCA99 SANJOSE1TEQUILA
804,173,685 *536600F02C42F534FE05BE9571DECE06BF03C92B younghasley
804,173,686 *53677DFBA38604334204EE93AA62D5E16574DBF9 SANTOSGUION
804,173,687 *536182AED11DF53638A50378C85DC8D0022A6098 yrenioj5
804,173,688 *536E96292C5AD7D99BB2C2FE91C974809F4749CB schlangenminiermotten
804,173,689 *53654EE3D23E3D5D813F9163D0FFD993C6C9648B SCOCHE1
804,173,690 *536D7C5D9FEE6140A104A3787404746B6EC8B980 [email protected]
804,173,691 *536680736416A88B87CF0902CB435094BF01F2B8 SCOTTVELEZING
804,173,692 *536224BBE5B46BDB5A69E03FDF865976BA321A01 YUTORIPAU-|-HONG-KONG-SAR
804,173,693 *536AA46A0323093C5DA7C9807CEC9F8EC7FAAC7E ZACHARYALLENBLESSING
804,173,694 *536CEFC8DCD5D7CCBB144FD6FD687EDCEE2A2EEB ZANE.REHBERG
804,173,695 *53652CF1FB8AE991715DA9809AA9929B5F75D901 [email protected]
804,173,696 *536D77B6C7BAC245B50E5475EDBADC8036F727AD senolohcing
804,173,697 *536281A592713DE49E392E3FF3A8B8877A302B66 SETSIZEERR123
804,173,698 *53628853ABBD92EC744FAF21573269F6085CFABE SETTLETH4
804,173,699 *536029F3DC0E354708CE9D4663D126E0A77AC6D5 SHELBYLOWES
804,173,700 *5365EB64D971AC136492821651A741ABFBCB0BD6 [email protected]
804,173,701 *5368C0923ACF75968C5765C8429C95523468DFB6 [email protected]
804,173,702 *5369E60BB1387897D12B4F72A849FD82FA74FFE3 SHINEMON
804,173,703 *5369D019DBF63BEAE4A8976C4FF0DB150FB0A2A9 Shore-cover
804,173,704 *536B99325D54025A0CC9F7C67242AE3985908D22 [email protected]
804,173,705 *5365E884D2DC2A5CEEA93003E475E6759E8953AA sierrawellborn
804,173,706 *5360A9D7435BE5DF937F08C3C447F34C00CF4ADB ВАРМЕНШТАЈНАХ
804,173,707 *5367B8917A01D21528753CBDFBE816B9EA5C9F10 SMOKE,COFFEE
804,173,708 *53626970DCE74212D97F889A306C56FBDF0D1009 ИЗКЪНТЯВАЛИ
804,173,709 *536D132AC98C23B5338FB3FD85F42455FBC8E288 НАОДНОЙ
804,173,710 *5366A34B3BDD54AC349BAE5888004B267BE95247 SOLVERS
804,173,711 *5367BF9268D4B10A4E9662BEFF9837FCBB8E7966 SONET-O-JARU
804,173,712 *536C15969344E2D561E44E14BEFAE6F3C4F49F4C soundsculptor
804,173,713 *536F22A5E6FE81B1943D6E62B05C8174A133D212 sreprihced
804,173,714 *536BD54163911E0DD18A09616E5A37FD10678B85 )は、動物愛護法執行部門(HUMANE
804,173,715 *5362BD2B22A41E7D2460EF2B3FBB76CECC1DED17 SSARAIL
804,173,716 *536863187E4AC534E42BFF23D3D224EAA5027FD4 [email protected]
804,173,717 *5368676D25F95B03CDBF5D2FC1D9705634DD9719 」《大丈夫》MV男主角,受到關注,與蔡依林和蕭亞軒先後傳出緋聞,並創下未發片便連續接拍5支7
804,173,718 *536BB91FC410AEF8F94E90082E5045BCC420C9B7 STANLEY.FOUCAULT
804,173,719 *536D46DBFED472498D5F8CD52A028882E2FAF4C7 STARTREKGENERAL3
804,173,720 *5369F699550D8E90E51CAE058A8BD773ADF13B65 STEIRETGFLIPS
804,173,721 *536E08422969BEF8E3CEA195D613DA491AF7A9A9 (0-0)-0~-(---B
804,173,722 *536058998BD80C493F4815F9498F83D78D25A3EF SUDDIGES2
804,173,723 *53642CD309BA0842300A6C500B24327648124E88 [email protected]
804,173,724 *53631E88E3E5CE22D8770176098AB5EB15A75AB8 1102154 jokaisen paketin p
804,173,725 *53681E6442661AB09141B1DB626D8CF6A50B9D2A 111REX
804,173,726 *53695AE43F8EEDD41841D6A4C4E3BB75C2990460 12: 12 # & AUCTION
804,173,727 *5363936F39FD64737532B6B3B9BB96650A2C148C 169frodl
804,173,728 *5363E9859EFBE383DA51AF78B450C76D4DDAC3FB 179landon
804,173,729 *5367CC2B2386971B2A87E785955A7D42EC019605 TAUBANTFELD
804,173,730 *5361792AFCDD25E4E62D36203046C5E4872D6F56 1!BERA+!0NS
804,173,731 *536D9FF391F016FFA7EA0D1611E5810F411F030B 1-FORTBESTUENDE
804,173,732 *536107F499AB781CA4ED71CA4FED29D411FE1F52 1-huots
804,173,733 *53652BDB517026F64E1D1C816E822571FE7ADC4F th0ughtfu1ne$$
804,173,734 *5366B7614A7E9340092599EAA86E0A65A9D108C7 theshirleybasseysinglesalbum
804,173,735 *536C14C12105662C6DA083FD8F9473D8D7790461 1-SYNCNESS
804,173,736 *536C104772D79EA3D9080F1EA4C8123B9DF380CC 1udacri5
804,173,737 *536299B0468D98FADF684E5FA6F913736B4AF431 1WORTHLESSUNAWARE
804,173,738 *53642062A6A8F4E3E15FD98C026252ABB6C44969 TNIKHPAA7
804,173,739 *53644734913A4CC7AAD72BE31484278D2EE5CD3B TNOREGRUED
804,173,740 *53674F2AEE5564BCB9562B41ADD3AB651724AC76 TOBIZRAWEY
804,173,741 *53603A6FFE6BA181F39BA018E20A23B60E4E85E8 2578497 kunnanhallitusoli2161999asettanutty
804,173,742 *536B032F8788B67B66AB7AC7110A732486376CFB TOMCATSPEEDING
804,173,743 *536FC0D4792F5BE1DE3B035B5B8A57DAB2847B0F 2 FINANZMINISTERKANDIDAT
804,173,744 *5362D5B7ADAB7803699A864F9668612D1B7B5DA1 2ILUVLEXUS10
804,173,745 *536B2FE75A640EDAB1367249AB3AF080DCC4D502 TQ~A
804,173,746 *536670B9E1B182BB04F089A0E9FD13658CA186A1 4 MUHIDIN
804,173,747 *536E08DD92B6D55C09AA65A150121D03473442BF TUCKERROYALSED
804,173,748 *5365CBEA158A92ADECEEDE01BB0E1D08C541F23C 4RECHTSGEBIEDENS
804,173,749 *536EA059E9F45BC04A06095C1EE531EECB35F59E tuong.uyen.mai
804,173,750 *53660666C5ACAE94C31BBBB15F87E9B4B6E65CA3 TUTUŞTURMAYACAĞINI
804,173,751 *536B635D428CC73ADE1273834C71935A56FD3B3F 4THELEPHORIC
804,173,752 *536FB38844E416F0D634F208E611006542C2AF23 5BSWDESIGNATIBSW
804,173,753 *536558492C8A231D3CB957F52C0EAAC1DCD0C07A UNABASEDSED
804,173,754 *53633230029671E84007F653AB688C5345FB4709 5STNALOSN
804,173,755 *536B0B79846DA2471B495711A17D6FE80CA0C170 776415 DER AKTIENKURS GAB 4,00 EURO AUF 70,99 EURO AB
804,173,756 *53679FE7AA79C1AD7075648174C0B489179AD1AA vanashervernonimproso
804,173,757 *536D2677622EA14224945D1C53F9D70A490ED1E2 7BSWVANDEVENTERBSW
804,173,758 *536993D5B7675EEFD337518747FD64C5575389F0 vantava.
804,173,759 *536D7FEEDA0B64B8DFC4A86E192B62FABD6B1619 7NEEDINTEGRATIONBSW
804,173,760 *536F6695C097A385AF4C60417D4766304A61AEB4 VICKY-CARMONA
804,173,761 *536FC877A9605ECC679C0E37D09DF7A94D0A0AE8 victory.coming
804,173,762 *53678E83AD7686897BC70D34228DA84570CECBCE viiollette.tingwell
804,173,763 *5363DD406B08D0DAE991DF68A93205B01356AD73 VIJYA DI NIRO
804,173,764 *536C45ECAFB07C805E13EB1DA0257629B5B1BCD7 VINCENT-COOLEY
804,173,765 *5369264310E36490E85630A114D302AF9904A7A0 vincesegerman
804,173,766 *53658A1491C3942BF915D8426ECBDA9A09B9B290 vinecity
804,173,767 *5362221A5B8A8D2E9579C818CDACADB0253AF830 VIO%
804,173,768 *536992AEA562C358BB73BD3A132B7F9319164DD2 8WINDSURFSPUNKY
804,173,769 *5361DCAA7894C41998BBD4DE73BF989A14EF7F52 913178 tarkoitusolisikasvattaakaikkiakasvejaherneist
804,173,770 *536E18ECEE93D7F5B5DE41279E3D4C0CF3CB5B93 967839 EDUTAINMENT.:.GETEILTES.LEID.IST.HALBES.LEID..
804,173,771 *536D8692F07B758D431729702C548E6F1442A6F4 999553 P
804,173,772 *536CC95F579490C3E69CFCD8357A043DE0590D70 9ORKESTERIKONSERTIT
804,173,773 *5361D38F482223A3442AEB98DA1C3F3A749B19C0 9SALESELAINE
804,173,774 *5361B8360FA833622384CCC8EADCBA6E3EFABC0B AADRIAAN
804,173,775 *536EBD28001388EA9FE7406402E840174BE114E8 WAR.TIME./.LIKE.GLUE.(REMIXES)
804,173,776 *5366086877774263734851F250B032BC05CA059E [email protected]
804,173,777 *5366F6E0CA92EB0E87377B9B64660C957FC373A6 WBHDW_RAWUVG
804,173,778 *5363FD4950C00171BEFECF5656983B231D88BE9E [email protected]
804,173,779 *536B2BE7F6C311C7CE5D857B10A142533FFE0A23 WENDY.TANO
804,173,780 *536F995013635E2B67E15001619F3A87F34A32D8 abeldusza
804,173,781 *53649B9302A5B3651DA1EA73E342C71D6A20FF67 [email protected]
804,173,782 *53689819E323A64A15EB43530C3C31A14FDB42BE WESHOULDBETAKINGOURCLOTHESOFF
804,173,783 *5362D030CCF74C80E20A9B1B0D96CB4C4AA930DE whitesayslesnarcouldreturnforufc
804,173,784 *5367BA62C96B98045E1C004D7ABADE291E5549E0 wilburnfire
804,173,785 *536F8DF85EF473492E81251F23A9476DFFCA4740 WILFORD.MEHRHOFF
804,173,786 *53636DB8C9C1AA43D17F6117E3188F58A80C339D ACX4
804,173,787 *536018B2DBB52CC03300B35D0834C0AC87EB0032 ADIEU:.1982.NORSK.FINALE.NR..1.(FEAT..JAHN.TEIGEN)
804,173,788 *53664F813FD8813293A99700AEE1AFF401F0681A Adk?
804,173,789 *5365F4189BD1A5C0FFE07437E52C0A461255FE93 admlf
804,173,790 *5362A2B77AC9E2919F44D24B527CD363A9FFFA45 WIRA-BRO
804,173,791 *536A3ECA735F97F444F185223D4A1E4477BB21D2 ae;4b
804,173,792 *536166A1B6F5D2F42DF2F40FC222CB54B21643AB A!F
804,173,793 *536D104E6CDDF0B25554E649AD3D144E5C32884F WT~^
804,173,794 *53627E664CD8DEEC8E4114EC410D0EB9E08F9DFF wwwchamsplccom
804,173,795 *5362F6D813BD37561A54BCAAC2171EDCF7705F88 WWW.MEGTEC.COM
804,173,796 *5369F925A15B9BC59E4CBF3D2E9C301BCAA971C1 {X}.*.*.(3
804,173,797 *5366718120AFC57D56EE4A43E131930CCB2ED3C5 XEPHMENDOZA
804,173,798 *53675CFCF0C90C69138A980FA0455CB6100BEE0B XK0|
804,173,799 *536BA0D6DA106C9D30A8F9349711C70A494D3647 [email protected]
804,173,800 *536E23C6D2881F9E6B3995EC3BDBD895DF1E0039 XNRTHRS7
804,173,801 *5364A794DD0159C0249DE75B25218C9C1C527B1F a",;m
804,173,802 *536241A8C764C755F2CE5C7403A6E9EFBAA8DA96 ANTONTANKSLEY
804,173,803 *5367C6CAC435F9023AEEAD80F263D05669A1DC2F appelleerts
804,173,804 *536D79321F8F00FA8A5EF8F40CF2868B9B689CDE AR=+"
804,173,805 *536E2C663414D48AEFDDF3D50D933EDC0B9A6A76 YUJIAZUI
804,173,806 *536A2055C57CB74B23E7A260A638F86854CFCD1A areggie2
804,173,807 *53650113C8D49DA7BEA281568237F0A08A380C42 arlieflair
804,173,808 *536A19D7485C5F4C1CBE84939EA4ACBE8DCD360B [email protected]
804,173,809 *536FDBAC55E1F2A7C4C31A5260668FDDCB22E04F AV)P
804,173,810 *5360D7501B8AED19728AB34209F294E99A56C037 [email protected]
804,173,811 *536B39E073726B6B41CFFCDA3E52778F26B5BC85 [email protected]
804,173,812 *5368C579B3F1D5440057E19413A0A04AEF9A9ECC [email protected]
804,173,813 *5365C3E05B3D2692015CCBA5277A7D879202F951 A+YU/
804,173,814 *53694E9F086B2D8D61ADCD6C301CFF34F1E85C79 azi_5
804,173,815 *5367B7D9D39DE7F30BC29FD38B7E38A77C26161E AZ,QP
804,173,816 *536A8C84821CC0EC477B6DA746FF8AAA2344261B AZURMALACHITING
804,173,817 *5368019D093AF55A4D90B244192F9C823647B350 b12bq
804,173,818 *5361C5ACAB92C32C988F27935EEB642E602DD7A3 BAGALUTENWEIHNACHT
804,173,819 *536A72B1C0141959924CF4D648E9948DCBE61825 zyunzits7
804,173,820 *536398C52DA91DB5CE787723DC6F0909CB65BC8D BBK0O
804,173,821 *53659078DF91B5B695FA7CCDBCCE37FAC7597644 BF/T
804,173,822 *536AC3F50A3899ABEF56858A35430A47027F4A04 нефракционные
804,173,823 *536191719669AAEB50FC3523444CA65E9A6121D0 ПОЛУОТВОРЕНА
804,173,824 *536FD10CAD9557D52D1240398CBE826F1F5AF4B3 BLOBSTERSUPPER
804,173,825 *536483E8E1185EBEACB31C30852E0A2E87C58D0D [email protected]
804,173,826 *5360F7A70564740DE2BDE5430C700C2C325185BF [email protected]
804,173,827 *5362EDFEFDA8CAF76F5E341506CDF73FF6DC64D0 1012inspired
804,173,828 *5367B3E0F64C145D6866B9ACA484C8F4E17BECA2 C.Bl
804,173,829 *536A71E3FC2AA09D70FC21EC102F6C7967EE31EC @[email protected]+ON$
804,173,830 *53612508DD3DB442CE3A5E760E03409FB4936E50 11ilveshpk
804,173,831 *5368430166B95832D556648BD6A3746E5D4DA132 11naturschutzgruenden
804,173,832 *5364944467AB007A9BC7ED90726E5A822920205A 1207429 elokuva-alanonosattavavastatayleis
804,173,833 *5364EB212626DE1A6AB80B13EEF18948D854BAEA CDU,N
804,173,834 *536891BD00B5D3AD0C179E79E859E6F3C85F9ACE CEDRICPEARLE
804,173,835 *53619E20A0D7728263CDDBE0ADC41E8F38474FD7 [email protected]
804,173,836 *536918FA20430F002089525520CE001EF4A7AC0F chadpritchet
804,173,837 *5365F3614737ADB85A8397D937811935C664A4D2 CHIAPILOBITMOSKOS
804,173,838 *536A8F15AA850C57825CCE571C4B3413D2571D50 1 AZURRI
804,173,839 *5368D077B22C321C605E2CD202CBF67F6B23C57B CLY+U
804,173,840 *53626FEB93D554CC937C243D00CDEE65EF7C9A6F CMT1Z
804,173,841 *536C4C0115F1174C711F16040BC3000E40B7CBC0 CN#FE
804,173,842 *5364FB271850A50392A07BA59D798D19DE6D6C5D [email protected]
804,173,843 *5365A6AC346491E84E9A35FF136C82818FB73BBC comparaison(n'estpasraison)
804,173,844 *536C2271771F80D1DAE63C95BD3A64D8AB7A6893 CONTINUEGAMEOVER
804,173,845 *536CA422B310A98309A6E223E1E2DA119A73D81C csg)2
804,173,846 *53672A855B93A06C2786FCCB485BBF395A598A2E [email protected]
804,173,847 *536024009154A841A27B96EE481402CDDF083548 :d
804,173,848 *5360ADC1FCBE520ABDCCABF3EF6ECAA5E1096683 DARIUSSUKOVICH
804,173,849 *5368D17A26D6F1C17DEC6D733938AECDBD5D7806 [email protected]
804,173,850 *536AE56BA33D4E1BC4B8DBD67D64C76D5596EFA4 2: 1 1# & middlebrow
804,173,851 *536BA6DB471F7699E7C22ABD0AD5317E68312E16 DA?S+
804,173,852 *536B2AD4DD9C686B54A6A7B34F38839C2A8F2EC8 Death.Is.Alive:.1981..1985
804,173,853 *53607DE6B4233E42582F3DE4A705CDCEEA42980D 2529249 luokanvalvoja-on-avainhenkil
804,173,854 *5367D565FBEA3379222D710CE376C5FF9C2DB4D0 2545148 samalla.hoivapalvelujen.kysynt
804,173,855 *536604FD88C529D7E8D2444225D50D2B142F7C15 DECAGOULAIT
804,173,856 *53671D0600D21DF07132DB3D07141BC8B86CF682 286JANELLE
804,173,857 *536E6382D34634C1F6A0F459FB9EB27E233DDA7E DEMARCHELIER-26-0
804,173,858 *536C7C481A218213E9FA1D52F2723379793D03F1 2ISCISIDIR
804,173,859 *5369803E632A087C111C038AE751589A25632C43 2 kinkkisk
804,173,860 *5361759A14BFF727B42B65B39917360039598F59 devieros.-.erotic.of.selfness.iii,.part.1
804,173,861 *536A93309721CD4C7369159D362229F8238078F4 dextergladney
804,173,862 *5361B5D06C331DDA8614DDBF7D83D160E67767AC dfroisserai
804,173,863 *536ADE3D2CD5CFE9F430F7BFD98CB6F93B28577D 2uhello
804,173,864 *536B34B2C5BEB33A82545A0BFE25D60DC832A01A DK2KE
804,173,865 *536013D5851F095286FDB7E7F8F21309698B5C06 d#nkl
804,173,866 *53649AAD3721B55F8596A8F4708387611727A58A 4IAMGRACE6
804,173,867 *536AE403C89D99CED5061797EA80129287A331E3 4PEARLMAXIME
804,173,868 *536BDDB46DA6D38F529A97583B491295EC382ACA dqp"-
804,173,869 *536902CBB8F7A57AC8C4F28D34F408570951B87B DRAWNSEXCOM
804,173,870 *5361B7492373D5586CAEF4E4E6141682532E49BF 4TUPPERISHES
804,173,871 *536CF9ADE7D529AB81CFFEEE9626DF5DFA8A653D dzhsg
804,173,872 *5367498E8E2FB9379D46ABE975046E5D235B6246 5ABENTEURER
804,173,873 *53649DE1E9D1A8C5254AB919C7BC0F30FCE8E6E3 EDUARDO.SOCCI
804,173,874 *536ABED7B78A19B8D62EE83D8EEBA480AAE593A2 5HORSESCARLET
804,173,875 *53620522B8747B12432FB372015F061AB629387D 5IDIBILNU
804,173,876 *536F7AA0AB328C3B52A44323364FE4A73C1F67C8 EIKSET
804,173,877 *536211477FEABC2E0DE11606800C3CBE00B75FD4 EL CAMPITO
804,173,878 *536324F8544FDEB3D5BCC320418A751C784FEC0E 5SARQUIS
804,173,879 *536B2AF9713B22451EA2678ED43C13E1C60B5296 ELUDENT.
804,173,880 *5361E4906E0BF7F0F59FEDD0021914A1344C9198 emmettflanary
804,173,881 *536131DD8A6916BB6016D3FE3AF8D5DA876CA100 ENCOMBINATIONOFTHEAB
804,173,882 *536D8DDD51CAD2CC41D3216CF145F217D63F9D36 6BSWCLICKARTBSW
804,173,883 *53685E1E5163CF440E4F4295F023D4AECCF6FB8B eommissioueu
804,173,884 *536168864713FDB38CDFF6D202DEC76C16DD7350 er/ov
804,173,885 *536B5DF4276A97164D4DDC4C4F08296E852B9863 ERRUFEND8
804,173,886 *536703329D5356C4D5DA31CDD8BBEB16CDBAD668 EZEKIEL.POCHATKO
804,173,887 *536802BE6713538CF0B1231153B3E6C91B775E10 744RAYNA
804,173,888 *536392D7A520DC5D6DB8FFE5618D632F79883784 fantasia 9 in g major: iii grave vivace
804,173,889 *536B03F28EDBF79CCCB0D39BA2BAB10B4EC92470 fausson
804,173,890 *536A6FC09F85061C585130ABB0DD42E0790BFE0F fcvg
804,173,891 *536BEB16D610EBF6FE5117F1533B10A3E7461593 7.lohessa
804,173,892 *536100F9D70DEC6CE4B848590D678599834BD8F2 7LVDEKLARATIONERNAS
804,173,893 *5365D0B3E20F6E116536F197C0203B64720EE296 [email protected]
804,173,894 *5368EFEB2509EA26AA89644621C0C33FA8EB3CAA fhommarting
804,173,895 *536F04A6AEE8425FBE32B502F17C20E352F1C0B5 7SISKYHEK
804,173,896 *536E5CE89E1BB3996683122F14FECB9FEFAC49AE 7SNOITARU
804,173,897 *5361127E5D89B4E2D145ED1303FF2C0ECC519BA3 7STRAHOVITIM
804,173,898 *53657C7EB8D4872988FA04580E663CC9DFF654DA flik0
804,173,899 *536A6515BE9EFDB657A8B83D4FB74095C5504911 fourseasons-thefall
804,173,900 *536A823A90D7B177B7666FD4DE681BED166FE40C francescohaddenham
804,173,901 *53647CF4EFEAE3EC6EEA0D02382FB107CB951414 [email protected]
804,173,902 *5363BF1762654AA2B47224AFCB31E5A2696DAE57 [email protected]
804,173,903 *536A847CC52870469A5E8B527E61383A9815E752 GASTON.DIOGO
804,173,904 *5368E6B853EA1C35562F4ECAA84EC9242E071B44 GIOVANNI.FEGETT
804,173,905 *5367F269D21F1DB2D2297D80B9ED61AD10800663 [email protected]
804,173,906 *536E249666E0850735BB26B44AD0C7000A9D9195 gormqft55
804,173,907 *5365FADBF7EBA53B100D7110044771A4ED1C54FC 9BSWSIOFOKBSW
804,173,908 *536ED9B455A1929230C7E344D33B8B5BFCDFF172 [email protected]
804,173,909 *53668EA3422316EF49CA8B1801B8F22BBD9CC969 9PERSLEIDINGEN
804,173,910 *5369B22702A02DF204AB757CE310E3CB2E9A77C9 HGXTX
804,173,911 *536F8885EA757659EBEB529C8D0774925DD6FBD3 I6W
804,173,912 *5363E9D2DDD2D98E5B08A8635050A8923D527943 A05Z
804,173,913 *536BF51E1DC6C6AFFEEE4B6EB47DEEA3DFB1E1BD ILUVSTIMPY27
804,173,914 *536BAB6A450FFD5913D661994787A05E9CD7C0CC Julenissen.tror.jeg.p
804,173,915 *53692413E526EF86259ECA79F4A0FE3B1C42C8E4 KENDREWRY
804,173,916 *536D37CD1B90AD40CFC63E5091E6109BACA0BE26 ALTONJIRAN
804,173,917 *53652897D039B0E77C21AE3D8A56DD4679C65FB6 kkath
804,173,918 *536F61706644054BCDCA3783782F1C8A407A55B9 KLEINKUNSTNUMMERN
804,173,919 *5368CEE2510F83840C93D9CAB10702282FF5DA20 KRISTOPHERSCHUTZE
804,173,920 *536602410110DF55A1CEE26C38201641E2D1CA13 ANDRES.BIBEAU
804,173,921 *5362F39FA1DC97E5F53E56CCF1A63F33E3361CEC KVALITETSS
804,173,922 *536E817E050E87946188FD8B2AA688F214C8E99A ANGELO.ENRIGHT
804,173,923 *536912AE137C79951C924986818DAB2D83ACE72E a)nl
804,173,924 *536D0836A25F7D84DF5A3F55DC4458058618A823 LARRYFODERARO
804,173,925 *53693EC8D28216E3ECF04AA5C41C158B9B21B71B ANTWANTOLE
804,173,926 *536B60C168EE3C7B269DBE952F711B8E5BE544AC ao:
804,173,927 *536B95B39AD3A0A87CA42B755DAC47C535E49B98 APH0B
804,173,928 *536CC722FE974C222E9FC1883E93A066517C1210 linda-deming
804,173,929 *5368A96FCD3FF39104D30D4BDCED9D92B3044DF5 LONNIESTEEVER
804,173,930 *536445B53A38D8D64A33C8757697FEE813C2C70F ATTILAKIRALY
804,173,931 *5363E7F65E7E6CB03527236E219674BCD1431E49 AUBREYSTROPES
804,173,932 *5360A841591F322F2F6547403D1D20C07BF70A5E AUD!+OR!UMS
804,173,933 *53694C4C6CF706ACD229CC96B41401EE2E7B9B2C AUID
804,173,934 *5360434312860F85BD84B07846C2F00F6ED8CF99 a.u,u
804,173,935 *5362213D505AFFFD756B18E3BC014F56C32BBFF2 MADORETIM
804,173,936 *536C18075B1FFBEA933903139D175890F7EE83D7 azth
804,173,937 *536CE7AA5A2B7B929A6795E4D12DA806587D0A7D [email protected]
804,173,938 *5362BD676474D8B12C478DA588652D5CA61F66CD ba$k3t.f3
804,173,939 *5361A82DAC662C279EAA85C268011CE8D6842961 menasies7
804,173,940 *536C3161861A8FCEA2979C75D5A96DA1FE936D93 MERRILL.UNNOLD
804,173,941 *5364016C69FA15032C8BFE1369DB6030B09545B1 MILTONESTEYBAR
804,173,942 *536ACF9CA1DB316377858CAC4BF128A3923371A1 B;#e
804,173,943 *53693C01BD62C293966E1AEDF94E2D2146311CF7 [email protected]@[email protected]$
804,173,944 *536A718CDE86EF233A1EEBB82A9ADCBF0545E154 MYESSEX
804,173,945 *536FBE57C80D30E8A4DE2B3B70A0F28E92BAC896 BERNARD.JENNINGS
804,173,946 *536ACF77131DC1E1E98518EF4E1297E44417E8F6 NEROFIDA3
804,173,947 *5361E038729EBC123718FEF0A1EEFEC05544EAF5 BILLIE.DILLENBECK
804,173,948 *536AA0D076506634469053587390F1E5B0693BA5 BITHÝNSKEHO
804,173,949 *5363FAC5CF0A34BC0A72B94F80B4751EC0E1C746 BOB-4-9
804,173,950 *5366B960CD285B662C882476433AEDCF9D0CCA74 BOBBYMEINHART
804,173,951 *536C92851DCFA94B0A148DA097BF88A0F37E3602 OHCGNUS4
804,173,952 *5369512BE4A1D6BBD60555E88F09644D9817FAA7 ONE.HOWEVERFLAMEY
804,173,953 *5366AB14CBD06636E3932A58CD26F10F3351AE1E }O{O~0~Q=8
804,173,954 *5368BC47860BE658FD3BE43B7DCFD7D0598318DE BRENNAWHITNEY
804,173,955 *5366F00778275D92135D29E0B3727E74D7286F3D BRODELE5
804,173,956 *536C1EE16F00A1412849D2E81BA2646CBA233017 p3nolo935
804,173,957 *5368ABCBC35CD06EE07A5CF32B3DA3D5FD0F7629 PERDICAS.III.DE.MACEDONIA
804,173,958 *5362899DFEC1FEFE2E51418412B21DCBAAB161D3 c=:
804,173,959 *536849119DA6ACE3FC0A85DB1E0CF98F2835B86A c2l.n
804,173,960 *536472B74A1FD9CCD92548FE61B2FCCFD08CFDBD Q======D`~-`~3B<-
804,173,961 *5365D09B2350F071623D9C65A1E529F2ED3CC34D qunnions
804,173,962 *5362EA96C8805EA0320997B74C81078EDDB9BBA0 CAROL.PEUGH
804,173,963 *536394EA083E52C73091578B9AD3D79E7D7AF868 RANDY.BERGUM
804,173,964 *536CF3608ED070EA628B4B5B41FB664173B0C968 RAYFORDFOTH
804,173,965 *5363AEBD71275F14AF5DB1851D7FD2DD185C5E51 changbeebout
804,173,966 *5362542E56791463BE994CDA7C6DF2269AD2DF5C CHARLIE.DEANG
804,173,967 *536E664F4F662D4AF1CAC41CD7A741CB1929E67E [email protected]
804,173,968 *536E1AEE87E85D197622D821198D716417316949 chaunceyfolker
804,173,969 *536C6B94F0002761F78F82B2E7511044594C04F8 RETURN.OF.THE.MOON:.BLUE.MIST.LIKE.SMOKE
804,173,970 *536E969B427FE06860015F285D9C2BCB44E227B1 CHETBRELAND
804,173,971 *53630D9633BDEC32DC86D895CEE3B106767964B1 RHETT.MUMAUGH
804,173,972 *536814E0A471DBA54891164770604B332E8F0EA7 cit$o
804,173,973 *53697066181A1143FBD2DC4BDB00AD09C9B38EC3 rosendogandolfi
804,173,974 *536FA6D26DF09F18D514498AF01852FAB3767E00 RTRAININGR
804,173,975 *53605EB2DDDA0F04137904BBFF1A11F52D96BE6C CMW"O
804,173,976 *5360019D9C4AAAB3B2CDDE4B33887A3D1C56D519 S3RAILS
804,173,977 *5365AA460CB02ABF75A7F2C16D411E66DEA2BC34 SALINICK
804,173,978 *5366F954A4F40D8EFC70A79FF77CEE026D9E575B SCOTTVELEZING
804,173,979 *5365CE5517419ACF613F00BB84EA70AEA9CEBFC5 CRERT
804,173,980 *53610EEA9990CF38A90728926D6E6C65C326AFD1 SETSIZEERR123
804,173,981 *536DD83DDA818D1AE1017BBE072FBB00527F4C3D csd6w
804,173,982 *536A6EF9C49CAC3D56588EEA7DD063694C9BF212 sierrawellborn
804,173,983 *5368F7DE7AB7CC9E9949BCC9373872D30B3D3B17 SILVER THREADS AND GOLDEN NEEDLES
804,173,984 *536483AEE73782758FC25C37CE3F9914680DD847 cysg
804,173,985 *5367AA710096F39959094D93D00F591DC1F51186 [email protected]
804,173,986 *5368ACDF64AE16E5733036C4E8BB05A48317565C SOLVERS
804,173,987 *5366BDEF68921B2C6C94592E91DDFC1616A0BB22 dancehall-deceit
804,173,988 *53682BD460C4EDB595CD08268054A8612767CC02 su8tota1n9
804,173,989 *5365A2F7CC447C5D54A7FC8A5FA331CEFCEB8EB2 darnelllavigna
804,173,990 *5362CAF22743B34567B84CB6BEDAD7D7A2105778 [email protected]
804,173,991 *536BF23965F29019901BC71477D35AD9444598B1 DARRYLPUTASKI
804,173,992 *5363FA10F2FE2B57BB8D9F50F25752453CF657FA DARTHKNUGS
804,173,993 *536EC876E24AD0828D56138AC05E04488518C5B3 SUPERACOUSTIQUE
804,173,994 *5365D6E32A8FA53361D0B349B272DC2894AA8B04 DDQ=N
804,173,995 *536F17B9AA0B292486F9C7D3F9D65BF16E2958D0 TATAMIOM0
804,173,996 *536E2E0AFA7AD7402C7D3AE8F05138BE589A8E82 TEGGUNSFEIHC
804,173,997 *53645F5AD10A48EC0201F173B6DB253232838302 DELWAR.HOSSAIN.BABLU
804,173,998 *536C91466D7A038D5A433A207D962485F740CEE8 DEMEOGTROY
804,173,999 *536682A920A11D2A4D6D030A0513F3852FDC6EF0 terrenceabu
804,174,000 *53659569E84DE9A177CF491F50038B215025C120 [email protected]
804,174,001 *53687456CCD65ABC7BAE97C907423A7110787837 thatwrangler36
804,174,002 *5366BA38EF63D56C2E163DC77BA479C40EEFA2E9 THEGENIUS07
804,174,003 *5367FF9DE6EFB4FED49715244D92FF8E23FF34CE they're.at.rest.together
804,174,004 *5360583FEC9B7AC942C3FD4DEC97F177AF18CD78 DHOU0
804,174,005 *536E2261504694D61D0E7E0FDD4856C496DDF110 tmit[email protected]
804,174,006 *5367C65F17E40477CE3A114920ABC40308CE0A01 Dim.Bulb
804,174,007 *536C09EEE7F6E706AD0821E0F5D08D39C49E5B86 tomasswelt
804,174,008 *536EAEAA0599FF9A1EE7B95FD20579D282D683FA DISCRETIONNEED
804,174,009 *536A997E5683C1C2691FDA8C331A1497B9BC17C8 TYYLIKKAEITAED
804,174,010 *536867FA0DF00247F6267D11CE0A489450D04EF9 don-harbaugh
804,174,011 *53627E079528641804A4328023D09197A2C46C1A [email protected]
804,174,012 *53662E8D361A04C038AB5C45268DDE0DF5F2FE9B DONTEGOTTRON
804,174,013 *536190CE47BBBB8DC5CE6D07F4F6C673DD5075B2 UKEMAKER
804,174,014 *5367D266F74075F903D60349AD2AEFCA6B149888 UNENTERTAININGNESS1
804,174,015 *5361A03066E2DEE27BA8C45ED5FAD1BB8A5BE15B dridc
804,174,016 *5366E0CD6B72B081B25442940D0162DC89019577 V5XLPF
804,174,017 *5367C6EC364EAADC4BD6FA88603CEA1596C2585C DUSTIN.LENART
804,174,018 *536227CBCDA1AFCBA4008BEF59E33144F07C48FA DUSTY.THRONEBERRY
804,174,019 *536F00FADDC57D92DD0F5D779F85404312F5F8B9 VESTPOCK
804,174,020 *5368EDFA7960851F7C3210F3F7B3092346EAD5E6 VISION718
804,174,021 *536F89612945F736A01EAA1239392C5AA54FFE3B eda#
804,174,022 *536950E4BFFBA92557BD7DABE3F51B5D68CB6867 VSTHDND4
804,174,023 *536EB72E37DC9C18E504BAD8C18138DD8ED74FD5 VYREBELLE
804,174,024 *5369E4968B82A7F1920D735ECDB8FD3D57ED1C73 WALTON.FRIDDLE
804,174,025 *536359A203BEC984E98DEC75E9F26CD64096A094 [email protected]
804,174,026 *536401AEBA3E3468895F41A81EB54D61A9241A02 WILBURAMRICH
804,174,027 *536920DDB976940E07E872A5799757EE07832CBB ELLE-STRANGE
804,174,028 *53627222D03D9059F419322AA04C7B746C627FF2 williams-essence
804,174,029 *53674D3D3B0DC1629B64BF9BF2D02EB5D0795CBE WPLAME160
804,174,030 *536D4CB85268EC3F2088814462E6B5449C58F0EB XU-LEKOU
804,174,031 *536A0D977DB9177030B721ADFB7EC0ED29ADFC14 EO0C
804,174,032 *536D5680DA2BABCD46306FC5E89F0E9C0F4E1CFA ERICK.BRACALONI
804,174,033 *5362A25F7BF70CA32323CC216490879CB7596511 erikneilly
804,174,034 *5367A8ACB50DAB51EA8823754BF5CA461AD842D4 YEAKUBSHEEKH
804,174,035 *5362B6953FCB9CC23E2E4FA7858B5E95F37A4572 [email protected]
804,174,036 *536EADA5879649D7D25F2D6C001D5B4CA6594DCF EVERETTE.KATOH
804,174,037 *5364AC192770E52FF2FFBF5D1924A225A115E87A YUSMARI-JB
804,174,038 *5360BB6985CF896385DEE7218BE5548AB2D63113 EVOLUTIONTT.ORG
804,174,039 *5368A2E3F79AEDEA0FC757DE0777DD29490B3E65 ZIAJOUBERT
804,174,040 *536963079F23ACE12666FCC35EC20B7A245ACC38 FELTON.GOYER
804,174,041 *536E2A50582DB95D9D5E3A116D24879A9907E82E FGRAMMATIKOPOULOU
804,174,042 *536164E2009825A68D6B592A0643EF8C89D548BB аридоамерик
804,174,043 *536CBB013E96BC16C2F779ABDC164F11FBF8B8B2 fingerprints6
804,174,044 *5360378537FC0F50301D5CB7AE04E899167382BA СТОПАНИСВАМ
804,174,045 *53680EE0BC7521E5A26BF78B524D55F40BF0461C F/RR
804,174,046 *536D5B1F9A8CF34F2D3A7113B789BE41E4041208 FRYCOWED
804,174,047 *536E28182C8B98F40BFDF578CCB5B99CDB8D0C65 での試合は衛星(bs・cs)のみで中継する(ラジオではニッポン放送制作nrn全国ネットで、広島ではrccラジオがネット受け)。
804,174,048 *536CF26EE5E4C0C46C2E2DFDCCBE9F5B45D93A03 にアスレティックトレーナーが集まり、公式にNATIONAL
804,174,049 *5360699719353BFC90E51215E083E1B359F13588 (0_<)`.<8
804,174,050 *536370695E629C6031EFA365616E45651D42FE19 GEDUŽIŲ
804,174,051 *53696F7ACC1E2DD35782061233B32283D5EE87AA 148kelly
804,174,052 *536D1264B411936B3956BD0D023D4BDF14D13D2D giocamini0
804,174,053 *536A59CB8CC478BDF2BAC68ADE6298E082CD44E2 1-BRUCE-SPRINGSTEEN-KONZERT
804,174,054 *536F751AEB62AFB663DD0DDD5D26A6F6E96B083A GitarraMexicana
804,174,055 *536EABF8819A95960567E88CAB4F0927CA4E1550 @1L`U
804,174,056 *536B4AC389B03B6A04A502C3D650ADB24BBE55DD 1PARKSAFETY
804,174,057 *536060376D69AB3BA8071B3D67013B234A77C75F GRZ5
804,174,058 *5366F9E4A79CF1B445261B65A9D7B83BDEE40661 1-TIEDOISTASI
804,174,059 *5368379F86A3499153960E21057FBB72337A637A HARPSICHORD-SUITE-FOR-NO.-2-IN-C-MINOR:-III.-COURANTE
804,174,060 *536AA5DD8E67C2481DE5552D85E892E2EA5BC1CA hasardeuse
804,174,061 *5368E70AC86DDAC9360BEF690A8CAC26DD1D34EF hayleyjohnsen
804,174,062 *53698F220F9C4E22C2E191F8CC30275670E6FAB8 [email protected]
804,174,063 *5362E4835A1F6BAB444A8E3F058522B4DDDF51C2 HECIMOS
804,174,064 *53651D8DEAEFB1621EDD5052B50E6EC04FDC8447 HEKTARY5
804,174,065 *536EBDB2C1AE7FEA7F17BC5A1BC8C1E38903407D 2rushford
804,174,066 *5364092B433A6273D50F4346C30359CC508BA7F6 HINEINGEGANGEN3
804,174,067 *536C10508C9DA3DC7049AB79C8BDBF2D4B9410DB horacioterrasi
804,174,068 *536AEC3AB8E409273331959B392AB16D618B3F89 [email protected]
804,174,069 *5361563B5789621D7382EC3EFAEE722FEC9A4586 houstonschumachor
804,174,070 *536BF085F2B381203EB4A42DA8126D8EAE85E0A3 HO+W
804,174,071 *536441ABDC3D7B336ED1FCA3754F3A17D0AEA07A 3.LAVEALLE
804,174,072 *536CA51A93D9AE30F9045A9412AE1FD614F053D5 hugophenes
804,174,073 *53649762CCFF872CBC516263EF1903AA8601E2FC [email protected]
804,174,074 *5369C449E84976365BBCBF14F9DB5101FF99B747 HUMBERTOSAUERWEIN
804,174,075 *53678527B16CBFDEB86B50A89B252C139EEB827D hundertstel2
804,174,076 *536A889AEDCF1305F730CDE4DC5989CC433ACBB4 419809 hanke.jatkui.vuonna.2001..
804,174,077 *5361357DCA83E456AFB19A6A7ECC60A0BF9AAE49 ialwayswantedabrother
804,174,078 *53601C25F7AAE8DC0DEEB92B7DC2E149E843F41A iamcanucks1993
804,174,079 *536D5725912B1C375AB84DA60A948A15EFDFAA33 4PUNH4LLOI4M
804,174,080 *5367A357CF5F4AE168E320AAF270E590AB914A31 IOANDUTA1
804,174,081 *536B8ECED7A986658D8F2D4E6C39B32265FDFB0C iointiin8
804,174,082 *53631D20FFDF3DF8820028BBAB79CF5139024F49 IPPATUYA4
804,174,083 *536D2D231F739FF17EED71235499CACE3DF7CA14 5SEUNEVORP
804,174,084 *536634AB2A22B325E336C78C6310074A1DF0F753 JAMESMAINWARING
804,174,085 *536F306E35B876492FD1B9256A7724D714B832C0 6THEATH8
804,174,086 *536455F275D5EC8A35DE0FB795761D21B0189CA3 JÄRVIMAAHAN
804,174,087 *53690F9EA05F716E5413AC15B8CECA42F4566765 722-schwanheimer
804,174,088 *5367A8256950D35E94E8A32B055F8E01370A0CEE JCM=
804,174,089 *53655C7259A3F6AF8AEEBE2F4B3489543C4D24E4 7BALGHEIS
804,174,090 *5367605F8447F37D920A43E04558EC510AE4513A 7BSWPROFISSIONAL
804,174,091 *5368D1DCC541BFE8ADB0BC48205812D3B1E2F724 JENNY733
804,174,092 *53609ED112FA686B74BB1D97E1B29D67B4E91820 JEROLDMISHAW
804,174,093 *536BA7748B1E6B4DD26906E0089307BC34C106D2 !7L
804,174,094 *536728D70090B34FFAC1E4BB73D811D2D1B6A253 jerroddepaz
804,174,095 *53682B1256D8F6F0CD3AB0EF32A3604B711536D4 jessicaschiemann
804,174,096 *5366B1F4DF67688DE5B3A34BEAA43EBE11E26FE4 7USAMITE
804,174,097 *536F3B065B7951D30D3028745593F52040B03B63 JOANNE.HANN
804,174,098 *5365F7F8AA6D73BFC29973A00D79781E13D79482 8AZLACTONE
804,174,099 *5368B02D225E2119DC436311BEB085D5D0753BB7 8 IKEJA
804,174,100 *536895BDA8E75E59D160D6E5EC4F1C5DFCB2B80E jonathonspeaks
804,174,101 *5362DAEC9ABC27D69A676C0BDEBBBDF369D636D0 8MAINVILLE
804,174,102 *536DBBE81EA31E42FE1B2648DBD67DDD68FD4CC2 8====P.~0.)8(
804,174,103 *53605244EC4D4F3D0360A75F88C17D0856783487 8SPREMASTE
804,174,104 *536F19556E65CF9202D86E2BBFA360E055788AE8 9.2.WHATARETHEUSEXPORTREGULATIONS?
804,174,105 *5361FB2FD7C0EE1C7BB150C2A4E75148BE4CEBBC 9DONGENESS
804,174,106 *5365C88758EF0101D4B34B828F8E18F769494D41 juniorkowalske
804,174,107 *536E2634667D64415CA62A8BFF0ABC2193127E20 JUSTFRIENDSHOLIDAYPLAYERS
804,174,108 *5362254B59F702ABEF311A4C5E483BD2BBC2C86A karla-ball
804,174,109 *536176C1C4FE088E04ACB8261396EE648B70585C KARLUNGAR
804,174,110 *53650DA92B294F5D3497AD1F002648943266056E A5EI
804,174,111 *536CF51AE4293CE3302291678E3E4881FA98FACD A82955
804,174,112 *536A2FE82F18B5010F9B427BC18A1D46B6BE9A9A kingdomprotector
804,174,113 *536ECB8DA12B71FBEDC5E2F4C2302AB9DB22AC34 abp0e
804,174,114 *536E726E1F207DE878B867111A423A8BF11143E0 adc,.
804,174,115 *536C7E312AC98AEEE59ECCC955154999E1B097EF adware
804,174,116 *5369746E227EAA48305142EAA540582CBA0AB430 A_GI
804,174,117 *536AB2313D3743952E1FE490DAC533B6B086BAE2 AGORAZE8
804,174,118 *5365A4D3972AC93967963CC542385A6AF6886361 aivadlom1
804,174,119 *5363305AF423D5C025F443F7260C5155B286111C akdw
804,174,120 *5362BB3DA133D7C3EE7FF59D7FE3D39F4CBBBD93 alfonzonorskog
804,174,121 *5361E40FED9653F045558CB0BB9A13D457F47CBB leapfrogs0
804,174,122 *53698A95D757E2A18FA13BC54089F96D6D42A2C6 a"m-a
804,174,123 *536CCD121B465F141A8136F70FF05AA66F9C3642 AMDEASES
804,174,124 *536463FFF22DD2B82F0D3C4FD16F441D88F77467 a minha for
804,174,125 *536ED780E5FCE9B6E943E7763FD37A084D600021 $AND CLOV
804,174,126 *536691234561781AF39525A5395FFF4EDE506330 lestershambo
804,174,127 *5366F8124469610DAF4D823EC298C8E3AEA9729E ANDYROEHRIG
804,174,128 *536AB4208E5692EE5A8192DF8F9529E8011C4419 [email protected]
804,174,129 *536637F9DFFF4B0E4AC1BE408E57D054E0F85A58 ANJWV
804,174,130 *5365EACA350176DF85FCD63A1FDC4FE35B6E8B92 LINDSAY.GODBOLDT
804,174,131 *5361C78646998097960A813737B35ABDBC56BDEF [email protected]
804,174,132 *5365B75C36336D2EF6EC1FFD94E7124AE9520EBD aplq8
804,174,133 *53620587D3420CC375A29FF06903A0E9946D6439 lonnieluna
804,174,134 *5369DE1C2FBA6CAB5981E5ED284C0ED2FD13756D LORENZOCREEHAN
804,174,135 *53697E6C4695EE7B53BC65B1D0EACA4B6DA830F1 lorenzothiengtham
804,174,136 *53626C7FE75E2E7A04EC39539A2C0E4F9677A507 ASCETICS
804,174,137 *536135CF0D1E48E42DA48B6EA05B70A8392725FF lovethroughouttheworld(feat.natashaatlas)
804,174,138 *536C9ACBEA899C129A4363BF3BC920BE9E7EB772 asszorro6
804,174,139 *536F8C0BF1A0280AE7A72661BC469F970AA4BC3B lukekopperud
804,174,140 *5369E87A0AA7FCA5D530BE98D2853381D011F4DE at,y=
804,174,141 *5367B1EE92D74E03B8DCABF1F7BD5A0FBAFAED35 AVIEYADA
804,174,142 *536B21152D4E3CB9E45D7A14F4468CD312FFA8F0 azinko12
804,174,143 *536AA3646E8B3FC089027E3859C4CE09697458A6 b2whr
804,174,144 *53661F5CFB0B2D442ECB950C57B53A5090C16E99 b#:4t
804,174,145 *536315360597801CEB0C68C763054EFA0012FF41 MARCUSHELFRICH
804,174,146 *53618A3574FCB867D49559ECA4DA0C2B34C9EBDA MARK-PIWKOWSKI
804,174,147 *536E725B0A6B2A20870841BAE5B4934FBD2C3E6B BARNEYDELGADILLO
804,174,148 *53667FA55005F5D75459D1D8674DA6D6E302DEE7 [email protected]
804,174,149 *5366927C7C12FC8D4CEBEC7234EDD56D43AB1259 BB4LLCHICK
804,174,150 *53662276B2AE816622E3CC5E70AFEBC39A3E4D37 MAVIMENE
804,174,151 *536C77C104E2328CAC58CCD6BE9EF73DB6D5FDE4 [email protected]
804,174,152 *536B07621940194BEA404088113B3C25BC846C5A meisnerová
804,174,153 *536242489054DE5DBB97E9510CF8D50B27CF57DF mesrime&namor
804,174,154 *536F7323B7FF4E96D9D048BF87379E9002A12AB8 michalcoover
804,174,155 *536C4616CB8B3D968CA6C791581AD2C47E4533E8 B?GNM
804,174,156 *5368076C4EE50E5E2F6949D4CE92E5BB1A2C656A MINORRADIUS
804,174,157 *5361BFFDD96A2B6CB7E4BA470FB8289427D6386A bimtw
804,174,158 *536311C2CA74AF9459EBF76883379D2C31974E9D MITCHWERNECKE
804,174,159 *536B6F3C80D2FC09EA1114BF00C0FC18346039DC MJÓLKARBÁTUR
804,174,160 *5360DA5209E228086F3379C40292BF3C17927842 mohameddewispelaere
804,174,161 *536C1DBED1B20117F383B16D9AA8E704ABCB95EA BLAC632
804,174,162 *536A4E31D32985470E9BD53053B91030896A6952 MOJI-LUDIA
804,174,163 *536D2E5171502BF13BC93CCAE28B1E84624A81CF b###)`)o(
804,174,164 *536EEB5BB34DD6FCD995CA086F691D86C2485C1C [email protected]@1
804,174,165 *5365A1840387611C3FEA776049E75181E862AC03 bof"c
804,174,166 *536C3BE8F037D1A61F7010421D052976526C7B1E neil-allan-amiscua
804,174,167 *53641A7573E8AFE0329F83EB9C8679814242DD59 bricekings
804,174,168 *536FEED22FC7122C12E41A1B1C51A27B55087F9A neversaygoodnight
804,174,169 *536941A47E12ABCF0C503FA8D35DBD4E027D9FFD NFRETZE
804,174,170 *536422C64DB7DF72E302A099676EA2772805B20E BSK
804,174,171 *5363D80A0699AED9916881A786DA8BAB06CACC7C bu$6m
804,174,172 *5360AB20A49FC4E4042E0E54C9214A8383A203FE BUJGT
804,174,173 *53647BD906EBE56218ED419D12459F692001A104 bv?#q
804,174,174 *536D1C1CFFADCD3B4E7331917FE0707D465836A0 c=:
804,174,175 *536702E2A068E83130B1EF364E906EA810E74999 oc;%
804,174,176 *5362C7F02FE609524AE4690D3F8109CB3ED531FC CARLY-CHERRY
804,174,177 *5364D435FA15349FF60EDAD1D5529C72EA74AE10 OMNIA DARWISH
804,174,178 *536D6E1043023DF13CF95333AF9ACB183DE67A72 [email protected]
804,174,179 *536C83DBFB60862A83D883E408BAEB6B028A7350 ornamentalpainter
804,174,180 *536E881F3983F113FFBB194C226B2A0D01410FAF orvenyt6
804,174,181 *53616CFCD931350D9D3B09A7B402AD266D14362F OTTOFALTZ
804,174,182 *536ACD15C5E280C27A9C6BB79470D9AA62C4E5EA CHaNNeL.DeSiGNaTioN
804,174,183 *5362D3ECE521B1092ACCCB97727547D652ADDE67 p4$c41$pr
804,174,184 *536BEFF81E08FA12C452DA77CD1CB3BC31A6C053 PARKERSQUIRT
804,174,185 *536E4DF08FA56FBFEAE5FC32861E6ED191440F58 PATRICKSCHEHL
804,174,186 *5363E74ED3A03DDC896E682FFAC8DC8600E4494B PCLIBBON
804,174,187 *536EC2E64CE71F7C2564CC6BFA2B3975991F26A8 ckfh
804,174,188 *5364B94CC578F09049337371D2C2E02B67AD5E0C phaxzjan
804,174,189 *53672006CF62E13C547D4623B9F90B86E1DCA79C CME&Q
804,174,190 *53654315824D33BF9A32F98934B39F4B09E5E80A PISTHAAK
804,174,191 *536CA6439C5E08DE56F48022D5B5C7FDD51A340C CMTUU
804,174,192 *53644CC3C354F158057E56FBC506D4E9E2576D6A PLANETJUPITER.INFOPLANETJUPITER
804,174,193 *536983C94A2D8822223C71464F7C89C27B0AA04E PLPYROFITY
804,174,194 *536DFF49885088274C3DCD2BD83FC7AD7C7EF29F PMSatan
804,174,195 *53698F7802864F9F5B1EA5A68EE71E3287272B23 COCEGARES123
804,174,196 *536B5FB66FA3871B9CBDECCFE38D449E8990C49E COMMERC1A11S+S
804,174,197 *536C95B45F384C630083D9B8AFCB4104E864F7DB PRABHAKARARAN
804,174,198 *5366A0F338B499DD2A992DE9000473C3EA8EA3E4 PRATYARCHAYAAM
804,174,199 *536BAB643CEBBE4B2E3FC69BBAFC3E1A99698123 cuspules3
804,174,200 *536EC6BF7A02FF03170976742E4D65CF156EA596 cyrilhindsman
804,174,201 *536696559754700A8C317423F811AAD5BAAB35C9 cz76,
804,174,202 *536D243AF7A675313EE81EFFBDCF25E13B471705 D1550LV3RM331
804,174,203 *536511D6125F9E2AF11C4B8714D844DF4BD44A68 D2?NI
804,174,204 *536FD76EDC5EB6FD3FEEB8D9803522707242EE47 RANADEEPN
804,174,205 *5369E2A19FD5AD463E643AE63C6BDD55FA8F29C8 RANDALL.ANIDI
804,174,206 *5368D5CF5634CB878427B120C20377A0DBC6130C d3xld
804,174,207 *5368B1096709B7A8F0D2540EAC23DBDFD3A46DF3 RAYMUNDOVEGA
804,174,208 *5369CB2A352FDB9CBBE953D811BADC19B65C23F8 damnify
804,174,209 *53673E1A9681BC0D535109BB5A6738B5DEF5E6FC reednicely
804,174,210 *536013CC628C2BFCC0ACAF7614E167C49C9AE1BE DARELL.TOBAN
804,174,211 *536D22EC45C8A3458948AE4ACB74E07D5EC54A5A DASCALU-COSTEL
804,174,212 *5363EB4E00A480FFC72FCD57B509AD82F30EF9BA DBUSN
804,174,213 *53696F80631F36E230FD834D3E917B81F71AB6E1 delminerich
804,174,214 *536FCE5BD0AE4445D62EFA19FC8589ED67744C6D richienaki
804,174,215 *536FE2302F93677FA16CE37013C09CE6D1BC546A RICO.DARDY
804,174,216 *536F60C4D5DE8F2F5F4AB94440025EE31124C403 DERRICKGEHRED
804,174,217 *53655A4BBFABAAD4572DE13861961979FAB64B04 [email protected]
804,174,218 *5367378D4383AA8207469907A08C80CFDF5D999F ROBINMOGUL
804,174,219 *536A922522E4772CC1AE34977874E5ACAC2FC8F7 dheqx
804,174,220 *536303AFCC0D397E7D4C999722FDD22C920DA3E9 DHWFA
804,174,221 *536BF202ACAEA33E2B5998D1583A42F42A596C84 d$lhj
804,174,222 *5362F29ECB63B44328BE24E59CEB9152BCD6B15B DMGYM
804,174,223 *536B311F7A40F526D62734908572FB200FED1969 [email protected]
804,174,224 *536FCC646F4EC290BADEE64DFF1B12479E6ECA8D DNRUR
804,174,225 *5360765F1A9FD5D7312136407159FFB018254E9A doav4
804,174,226 *536CF5479C14472558193B8DD5D90D5B8BDB9175 dps+
804,174,227 *536FFA1017F68A44C987A0207CA664D6A0137CD7 D.vj
804,174,228 *536AA688737362B87E2B3383E14414DF39528015 SCOTTIEDIPONIO
804,174,229 *5367C43F77B38B1D322D63E2164740A287F5F92F ECUBREAD
804,174,230 *536E6751E8C05D1DEFB2D3B8C4C48E15A7E89E0F sdldnsling
804,174,231 *536FA791CF8C00089F5683A666D16AA84696DFD3 EF9;O
804,174,232 *536E862E27BA64214FE01203CB2F333D340BB6D3 EHANTNOR0
804,174,233 *5363B8FEC7FF101B5B6F34F3D4A06AB7C3A60CCF ELGT
804,174,234 *536BE6BF1B4E4D1525DF3416281530CA1495E3F8 eliseowombolt
804,174,235 *536768302B5ACE2AC49EE469F55575C63A009F8E SHADOWSBASKET9
804,174,236 *536B22CE173E0B65BEC783A154E76F002DDDB64F elpoderdelnorte
804,174,237 *5368882FF41AE6A537F7FBDBA26C5BDE1037D5D2 SHELLEYCHIEFS
804,174,238 *5367A4C4F50FAB82FFA7933E99EAC2DBEEE3DB13 enginneer
804,174,239 *53622A73DAB66F32FDE75438B4BE2C6947BB79FE shirleyflesher
804,174,240 *5366D359717B3DE47EBC266C6CEB9D2AFFEE5BFB ERINFLYGARE
804,174,241 *5362FB7BEE2929E279BD9E6234061D16A113B137 FINALSTATE
804,174,242 *5361F81623C02A187232E828F57E35C01F490960 SPAZZIIZZAPSED
804,174,243 *53623FE637EFC944740C651F1B1A479BEC4D63E7 SPICCONA?
804,174,244 *536FBC8D4760F3A88CCF4143E7986CBEABE32A3D SPITFIREBRAZILS
804,174,245 *536953046CAD91C2875A790E515FAD7784DC1C81 floydkastendieck
804,174,246 *536A2125CB4BFEA14EB2B6724E8710FBAD2454FF fmkik
804,174,247 *5364F92CE9C91873E59D572ED4CE9CB629E3F7FC STANFORDPODMORE
804,174,248 *536F565E7E20F67FE06D11533A089EA029068633 garfieldstordahl
804,174,249 *536D54E5D4F557646BE83CBED59A901F5CC99C5F [email protected]
804,174,250 *536568F8F733EABD8A41BE904828B74EC7F754DE GARY.SPECTER
804,174,251 *536FBCDBDC1CFD91BFDE1DB1088628C6E368B904 GLDVRLZN1
804,174,252 *5363832A71FAD18AD6DD6FADB490EBE47C56138E SUNNY MOWERY
804,174,253 *53692F1FC311A8383360FE6DEE1404D098845413 goodricke's
804,174,254 *536AB96E5999897C81C8BC4253CEC4FA93A66E5E [email protected]
804,174,255 *5367383D26982537D1C9DC654D6E628614A60E13 H005IERD0M
804,174,256 *5369E42FAE532708BC3600E29F511A3F37C9D8DA TANONES
804,174,257 *536FCF87F7BA2653779738D3E3B3CF1F5A3B557F TARCHOMIŃSKA
804,174,258 *53621467B5C83E148C58D7A43B787E12399FAF69 hassansurvant
804,174,259 *5363EE91A416B2401EBE45002ADD052856A9C4BB T}[email protected]
804,174,260 *5360024F704B2785A7290BF8180B56A66642FE99 teloneied
804,174,261 *536E8018B1DED872749F56CF65536D73D770D9AE tethery.
804,174,262 *53666B3464DACA43E172BD9F341F515A97F35800 HOWARD.MOTTO
804,174,263 *536DB125F00F9DF867519D162F605242A7232063 [email protected]
804,174,264 *53642CB27846A2FC87DF01D957BEF3F9490D5857 H\W6
804,174,265 *536CC60496DE77925E34506322245E59BE65CD47 titusgomez
804,174,266 *5362ED8BCF8583FECD6CC1958B0CD63DB15F8047 hym3nop73rou$
804,174,267 *536435126D55B6F6F660BD2366CFD399E1E2B5C7 TNEIADIR0
804,174,268 *536A8BCBE25A11A88B3E5EAD8C1958597D1A940C IAMEASTER79
804,174,269 *536904235690AF13ADD7320A5546DFF395F23918 TOMCATNEW3
804,174,270 *536551B4D8CE7D0698688C52F19DAB7657EFF306 TOMSHANKS
804,174,271 *536184003C1F4EDA86AFEB67EA770EEB9DD73ACF iloveasshole95
804,174,272 *5360AAFE4BDCD06F098C03925399CAFB638E699E tristanlemaitre
804,174,273 *536339D28AF58ECF731F516D8F855B48D2EF3D37 indio517
804,174,274 *536B3010EBF9309187C20AFAA62E4907CB3B2505 TUSCANY-HOTELSNETWWW
804,174,275 *536C8E6B6EB88373456993E50153AE822DB432DA TYLER-FICKENSCHER
804,174,276 *5361A8CAEF977B46A0498598C2ABB1004D10021B irvingcrass
804,174,277 *53637CB2A2813FBF8BBFB81869012C8D612F4785 TYRONDUNNAGAN
804,174,278 *5361290C7086CB5EF1967439B780486E0C4D36F2 ISCHIADICISCHIADIC
804,174,279 *536A9850D2C3E61CDC4312FB4089B15050BCB90F israelinegypt,partino2:thesonsofisraeldomourn
804,174,280 *53621B74AC0857B1E793503049A73E96A62192DA ITA.DOC.GOV
804,174,281 *536B8A7C8C2486450D87A92CA958974D2D2E131E JAMAL.ROBINSON
804,174,282 *536B79E03CD8CA5A33DFF201DA6E855FFE87F431 judsonemmett
804,174,283 *536041B5AE35E4A2B1B9405FADF6F8AEDBD34930 VERONIQUE.FOURQUES
804,174,284 *536293B64B3E7C7A337DB72BFA19A59A435B2CAD VERRUCHTESTESED
804,174,285 *536897E4675893D74CC63F22FB91974312AE7809 VESNAGOLUZABOSNIC
804,174,286 *5367D52C57699D7ABB3B85D63F2BD1D9EB3D3604 KCZISKE
804,174,287 *5361A6A5C9824CE1A62432568203D1AB25B87022 VITAMINERIJKSTS1
804,174,288 *53617CFA4FD6954B011B56F3ED3C1FF42BFBFB20 VITO.ELWELL
804,174,289 *5367B9E5DD50860BF4926B20F23B154AF8514313 kryrbtu1
804,174,290 *536F50A69DC187ED2D75146517910AD18A3CB1FB [email protected]
804,174,291 *53653F0042C989C5BA8D7AA29D0A47C7E628D737 LANE.STEVICK
804,174,292 *53616518C635D8A8AF77BA7E5403ADA9100EE3D7 LAURIEFISHING
804,174,293 *5363AC5B532AF5CF035EE60A25EC366ABAE45F70 LEXIHUGHES
804,174,294 *5360E2DC3C7299294DC7B15988743DADA4E5FD0C [email protected]
804,174,295 *5367BD70C547B756F122E6DFE78BC75A28A060FE [email protected]
804,174,296 *5366AE6C9E0E9D42C8400E7D3607E3A58618392C LIVSTLEB2
804,174,297 *536516372D2BA37B71FF4D36A4B0F4EE0FA6F103 wheezer
804,174,298 *53644D576C4ADB6E6B23E454F5466D7C2FA6B3B6 LSHILLAW
804,174,299 *5362C9A113E1E67D762CC23F5C41A8B569BCFF84 LW]L
804,174,300 *536722FD828FF527F6BC19996BE0729DC64147FF M1$APPREHEND
804,174,301 *53671D9B1D4E609695550E64D534507A08EEE6B5 WILLYNITZSCHE
804,174,302 *536EAE77D7B9D80423C2BCE52DE2DE8704A41223 MAC.BLACKIE
804,174,303 *53668D5E4C64E6B4CE0F36BB07167E4D9FED658F WIREUPTHEJAWS
804,174,304 *53606615E6BE12958A643416C72CE2460FFB9B10 MARCHES
804,174,305 *536B02934DABFC9ECA4E35152FEBB2487565D697 WWWMUSLUMCUNET
804,174,306 *536ECCD545140A2BF6F838064357C4B878098FA0 WWW.MXGUARDDOG.COM
804,174,307 *5367C2A525261EE5700578B3C9D4622EAEBAFF60 MATTHEWELMO
804,174,308 *536896AA0F8DA4F30857731DD312CE98B10A610D x207f
804,174,309 *536A9F555EA07311904D6958438D8F7ECA75C957 XAVIERSAYWARD
804,174,310 *53668ED70F5CB7385CB7DFF5DECCC1346E48D721 )X(~D######B
804,174,311 *5360295953FC07955B0A023CC6257E6ED5EC2989 MEGAPR0$0
804,174,312 *536ACD923C48C587BA3082F2B841E8E656642D88 MEINSIX2
804,174,313 *5363EF5EA129D6C9A3686AE7F7E77941D8A6D070 MELODY.MURPHY
804,174,314 *536A7F3CF786CF4E7BBC39E2A4A441BA0A913C5A MEMORABILIA1
804,174,315 *5367FAC5DC3D2E8D6B31A1D485E068A86FCD4A68 merrillkimmel
804,174,316 *536D0CEFF2A8F6A75B37BD6FDA7C6D8D2F0A47BA Y4246264466
804,174,317 *5360FD84F2719298F6BC1586922D0696E1065FAE YADIRA NAVARRO POTTER
804,174,318 *536833E0B1CC212AEB0B672624E70C8D89582039 YAISHAK
804,174,319 *536A878E891D4ABF095302740FE66C3D81C9D180 YAMALLAMA2005
804,174,320 *5367812CB2AC729A4D951684F256BD9505D3A577 [email protected]
804,174,321 *5363DCB8F45EA9FC62519514E0B591507E3AEA79 YASEENMALLICK
804,174,322 *536AC5E221815C888F1A4D618350FCCFF85DC0C3 MICHEAL.FEDEWA
804,174,323 *5364061BFEF07DE9B9A2ADABCB16C580316CF1D4 MIKEGAFFNEY
804,174,324 *536E70D072FFAB9C7825A76CF288212B359BFC05 [email protected]
804,174,325 *53607176A6AF761D70E36F2E9B9EB076723CAE49 YLDE-GONZALEZ
804,174,326 *5368AA926EAFB558BDDF0671BBA3AEAB804D5D81 YLDEHSIUS
804,174,327 *5365FDCAC1795315B7D068A395CF8BD763608031 MINBUSCH
804,174,328 *53669785EBBAE46B9B79C061DB12C9B69D968DB2 yoquierotodo
804,174,329 *53605ADF3B8DC72FB105D146D13CE90DA89F2955 MIPWOBXAS
804,174,330 *536CE7DA9E1C51D88538A4F1C0F94907D55E42BC missy.countryman
804,174,331 *53618D7433D6AB311208FDBED9C5E0CF610AAD7B mistakably0
804,174,332 *536D8D66CD72B07384EA3DB2EFEA0998B35E38DA M!$JUD9E$
804,174,333 *53614CB37843BB983833FBF897165D0F43963DDF [email protected]
804,174,334 *536446C8B9203BA9D564B3760C07B016DD6DEDE8 moneyrobert
804,174,335 *536A55AFFD0ACFAA515F6966855DB7A3A7744CF2 zackaryfincher
804,174,336 *536C8AE3AC17363DFD5B371416EE12CD3CC61807 morrisgeorgia
804,174,337 *53648946F10439E3415B27A53F11FD0DEFAFD567 zalvzyah
804,174,338 *5363EAD7508DC8C006DF7DF5CC90A7B70C5645DA ZARALMONDI
804,174,339 *536712CBA96F97D6BBB64C4830EF511429B692EA MURRAY.SHULA
804,174,340 *5360B49CFB521D70E64EBCE61570DB321C0B0459 [email protected]
804,174,341 *536C82771069556DCE488C38B847E89E227C5530 zevendal
804,174,342 *536C6DB24855098C877EB06948B616FFD64C7EDC zhaowilli[email protected]
804,174,343 *536807F2781EE6C23E22D1A99A9DEAEC028A003A MYSTERIENGRUPPEN
804,174,344 *5366BEF0E30799EFF88CFC9F2ED563567895E4E1 zindelijkst1
804,174,345 *5369194E68AE363B5C2EC2A6476D33032BADE8DA ZLATKOSKENDEROVIC
804,174,346 *536F076E6AF774490F5AC7710C12450E38D789DC [email protected]$
804,174,347 *536840111C5504FD410AC9A23253B7999AD89797 napoleonstavrositu
804,174,348 *5360EB4CB249D8D63F66531658609C86BCC08ECA ZXCVBNMGERMAN
804,174,349 *5364B573AFD12E5C44B8C13AA1354810C154E237 NAWAKADARIUSZ
804,174,350 *53693EA7BD587EB5ACC3FED766617A7A4055E080 ncrossply
804,174,351 *536BE00370EC9F74B6A6540299C4590BA54DDC58 μπιίμπιικαφ
804,174,352 *536C4B45C50F970892840D5F9315942A5EE1FE3B ВМИКНУВ
804,174,353 *536BC14C57D146A555407A7D2DA4D9DC840340EB NESINIZ
804,174,354 *53637A29EA766E66099774770D55E0EE2DCD4293 ДРУЖИНЕНЬ
804,174,355 *536BC81998B91A21CBEC525FFAAFB4BB1630B984 n(gbaa
804,174,356 *536B66FA2F927D9F24FC1EACA4B18069D480A524 NICHOLE.RYAN
804,174,357 *53695990124FF6318082469EBB7533BDDEA0305C ОРТОДОСКНО
804,174,358 *536B4787AECFFC7BCAF62455A429333357B7E8D3 ПЕРЕПИТ
804,174,359 *536966FF5D109C5E84E9F365D31053B9E06BE5DC «ПОЛИСАХАРИДЫ»
804,174,360 *536C9F4BC9C375CDB90E8FA07A906904B90E9742 «сплит»
804,174,361 *5360CBDB962874726873E0BCEACD6AFBB2989066 NONMUTATIONAL2
804,174,362 *536112951EAB65BC4F4B2D42F50642EDAAFD30FB NTOGROY8
804,174,363 *536C59AB5257337F435A38A30AFDAD40C91EC81E odisroaden
804,174,364 *53674594BB8A8AC3961B204833FE2B0ECCF9C5C7 «oeral»
804,174,365 *5368B7F7AB2E7ED449329C7D289D477224B4391E [email protected]
804,174,366 *5366C92C61A652F2150A783CA03B760DF1EF5907 operngesellsch
804,174,367 *536CCA55767F5175A5290E997A6F362EFAB8A5DB OPTUIGT7
804,174,368 *5368A81CA1FDD935DC73BA822599DEDA07562038 ORLANDOWOODERSON
804,174,369 *536B48C1EE5446B5ED26333084937CAF4A53929E OSTKÜSTENBEVÖLKERUNG
804,174,370 *5362883F329D0886CD2F6F566E6FD0339CC4D7F2 P6P3
804,174,371 *536108E15482FFE00B7498624DD9B18CB4E061C3 PAV’S
804,174,372 *536801AFDEC8E603632F7D4046148DE5FCEABDCC p=b.*splat
804,174,373 *53631C599DFDDFA26800B84DB5071D8C61A7AE2D (>_0)0~D8
804,174,374 *536D138EF938FCA415F81948A5A160ED1FD045E5 [email protected]
804,174,375 *536DC988D4687DF6B9688540970FA0280A57326A PENNY POSTON
804,174,376 *536444AE5790B8E140193853CFCDF3A544C35D80 PERCYPIZZO
804,174,377 *5366AA730FBFF91630E7EDC292E7920B2E216BE0 040PENELOPE
804,174,378 *536065F4F11AD13D8E8FA9DB58548CBE380EC047 pile»
804,174,379 *5367EE9F4142F50097D18508F4F177E9B64187D8 1071192 LUOVUTUKSEN-J
804,174,380 *536D1F37ADCD31D6EBB11C539357B89FF49B3471 P)~O><
804,174,381 *536DF8BD11014ED44629B992E00C11749B4AD743 PROC3D3R3Z
804,174,382 *5362D6B9582CADB1351335D08144EF2F2856F7D0 PROGRAMOD 2
804,174,383 *536F100D27E3D13A2543EAEA376EB6668ECD57C1 1869466 dieariaderschumann-sonatebesassschlichteeleganz.
804,174,384 *53672F6FC234863D0FAC4246AFCD0A39B786946B 19071043
804,174,385 *5362CFB84A48F979D2855E03C20FCCB65C7DE87B purp13t4
804,174,386 *536B2B1F179A29DB92E8281DE6205915BE164FEB Q>;
804,174,387 *536FBCB4B38A069B8ECEC4346EABE5561421D274 1colts-who
804,174,388 *536D617AA6BC755482A36740BCD2019B0E9B2F4B q----D.~O.(~_^)
804,174,389 *536DF6322948D971F31B3CB01CDBCE35A48C8A88 1.dancers-diminutive
804,174,390 *5360AE1C1C4E74F95814CE8AACF5C2696B0E4E80 1-dirg
804,174,391 *5362CF23982BBF87EF9A468FC1100BC237A35760 QIK3
804,174,392 *536A5108DAB45C53EC6F53F1FA838524EAA17E37 Q===P~0~O )O(
804,174,393 *536BC5CC70B28CE159397EB9DAA295DB38434A2A QUESTIONSCOMMENTSREF
804,174,394 *536460F36380D05DC37C91801D3C37077F1E4AA4 r3lic+s
804,174,395 *536C9FF237B32EE99AF7D758463D6EB2BAAA786F 1.lihavalmisteeriss
804,174,396 *53643FB729EB984DE7440EA84B52AE9625E9718D 1-LOPUNAJALLISEEN
804,174,397 *53638349DD03EF2A6B75E7ABF26A1046C28A8DCE 1MANABAM
804,174,398 *536B22524E0F812FCD0DBA9C2EDD5AB9288D7712 1.MARJAP
804,174,399 *536477FBEEBCD3C3F04D3DB707C621FEF9D5700C RALPH.OHLMANN
804,174,400 *5361D13460DF4AC312D26A493C61A50223032D66 [email protected]@70RS
804,174,401 *536B69E65B3EDEE9E856B7DFDEFD649F211E5D31 [email protected]
804,174,402 *53625FEB74005788A3F5F5EEC049A56F97AF292A 1.pehmenevi
804,174,403 *5362D62E4B90AD7725B24990F06ABE66F37EFFA2 RASHADEBERHART
804,174,404 *536608D1F24500F2B1609A6E064501DFDC6647EC RASHADMARTT
804,174,405 *5369E7596F819B33A091F7B1800866F9741AACB0 1RHYNER
804,174,406 *53607125C78EDF65835F10E2BE52607D45223B70 1.sometimescondescending
804,174,407 *5365365B76F864A87EE21B9B61F2BA7E5D74BF71 [email protected]
804,174,408 *5369021B61DFF637B51F4F3EBB97146CEF9CA381 recorded
804,174,409 *53683F840A3F6E34E3691734901B50D4B0269E38 1zarnoff
804,174,410 *5365A2D91709DBF123B3687EC0543DD2306AEC0D REGINALDDESPORTE
804,174,411 *536C55BD47FD0EAFBD3DA48713C4441DD2182F4C REIAMGETED
804,174,412 *53668D310DD9FEBFB76D3714652814A2B60E2366 REINE
804,174,413 *536C8FE4F4584259B4A5BAC24154AEC930F0FA85 [email protected]
804,174,414 *536CDFF72C53161EE6598E829313EA3DB0547921 REPAIGS
804,174,415 *536468222CF7CCA52C48D39EC76DF263AFD185CB RESPECTDOREL4
804,174,416 *53672F810DFB96BCF3F3B46B6C96590C0D4DEE67 reuworldpakistan
804,174,417 *536DCA79D474088C2BE9A2CB4A2D21862F70DDA9 24-musica
804,174,418 *536E3C874BE715E3CC9D7AF349E7E727715C6FC1 2501191 INTELLIGENTELECTRONICSSHED13/8TO223/8
804,174,419 *5361DB9D3C689CEC719A6AA768C3A7D6F1C0F705 RICARDOTROUPE
804,174,420 *5363E5C3698DF0DC18826FDE49EFE93872F37499 riemere0
804,174,421 *5360885AC12BC828D268C15BA8DB3825B4B98129 rippley's
804,174,422 *5361ACC6A1EE1144F945FF8988D147F218FE9FE9 2A2ATY2
804,174,423 *53657AACBCAA77E3C60978727818C02CBAA8A091 2EGAERAUQ
804,174,424 *5363D1214EBAA996E0F2152152923D300F88CCD9 rodel-quinones
804,174,425 *5363DBC12608AFDC4C985BB459ABEE4A7258EEDF 2.eroeffnungsflug
804,174,426 *5366D35F70CF2D4CEC0F9D9EC146A221B3423C20 RỘNGẨM
804,174,427 *53623A484251CC9E0DFF9B47B85910E34A14F7E7 RON.WINDUS
804,174,428 *5368310A41E9F4DDA5C8FE5931D7948D5B5B1EAC 2KHONGCO
804,174,429 *536796342B554DD24B00B1BB229ACA05CAC2D77D 2.liikelaitoksittain
804,174,430 *536E6F2C03A31218C5BFFEF9E3B3243B2B31915A RPL}
804,174,431 *536C98E1C25803568CE03422F8539428FBC3346C RUBEN.MERCADANTE
804,174,432 *5365A5750DB8361204210DBE63FBA624E6C21848 RUBENSEBESTYEN
804,174,433 *536F95E05975BD9EEB259F490FE9CE0D439CA4C9 RUDOLF.GAZZOLA
804,174,434 *536D58EFB1AB5EA7EAF84A8C9817187DDF75D09D RUFUS.DOMAS
804,174,435 *536F31F4459000DCE667CF83674305A17B6AED8E RUNNINGLINDAED
804,174,436 *536127E7E41312470EBA83BA6F457FCF1642D45A RUSSELISON
804,174,437 *5363357EDA44772D68221F389D710182FD94609E RUTHTAYLOR
804,174,438 *53617F879E7EB89294FDB73FAC538B279C13C326 3300FT
804,174,439 *536505BE13662D9AEF7044EB5BCC65B0140763BF RYCVYACHTINGORGAUWWW
804,174,440 *536311A9C713E7096ACED28277DA30A18B9FDA17 33CASSANDRA
804,174,441 *53650E9141AB9C85378FFEBEF8F194CC34BE744A RZBXAOWBEBCB9
804,174,442 *536575C0B7403A3C911E6B06B8DB7BF3E2F61A6D S0[Q
804,174,443 *5366B29A89CCF350D34DC0B83AE8C19AF1B47E2F ''SAAA
804,174,444 *53610905A52DD80BC1F4D7DE737DB30C899A9902 3bitch2
804,174,445 *536C2C3DD8280A37161DDE16E4C43A9EE6E102BC samgallager
804,174,446 *53651F64AF6D383D1C475C63346DD4E6FB61F568 SAMMELLEITUNG
804,174,447 *53694DF67FD75E2599E49245B6BF383AD20FED91 S+ANAB13
804,174,448 *5366AEC1A28C1F24F3160C6A1ECCB0EBC1D1E49D 3===p~.~.splat!
804,174,449 *53623595215226786C94BF048467BC073B32EB93 410WHICHISEASIER,FACTORINGORDISCRETELOG?
804,174,450 *5367C32DE70864107C750039AF2B5850C0212E5F 4:..3..1#..&...arbitrager
804,174,451 *536FB4D8819B2DF5663CBE2190DA801C56B7B842 „SATANIAC“
804,174,452 *5360A9D1A576665B1F8B2456F80157F31311C16F 4566°F
804,174,453 *536C033B677537B79E6A838A83D700959E870A82 SC0V3R3STI
804,174,454 *5366FC871E17A72FCB441905D0C0532BCD4324E8 SCARLETTGOMEZ
804,174,455 *5365B1C6B24C3BA02B293B453AD286A17C5B6F83 4ELARTKEPS
804,174,456 *536CE102D3D7AB08AF5C2B7E08648C3B42C91945 scottiekardas
804,174,457 *53690600E768D3C7662BC5671EB8C80D87EE998C scottykoprowski
804,174,458 *53651E56E571C7EAFA38217ECD0A29BC14EBC8D1 [email protected]
804,174,459 *53610D5FD2E1FC510A18597E00C9E5AD87407EAB „SEKUNDÄRLUFT“
804,174,460 *536A68A7B1E788D28EACDF6B871A2E422FB75FA0 4treeni-illoissa
804,174,461 *5361186CEC2003048E4CFF3DEFB435E4E5544C33 4WRETCHEDNESSE
804,174,462 *5360CD78F77117F65E7F384C05A6263C8FF01B93 4YHTEENTOERMAEYKSESTA
804,174,463 *53608119D81A58368A8388F9AA185332340969F4 50343 ermenilercekars'
804,174,464 *536009EC014F6ED23DB33B28594525EDDA63A359 SEVILLANAS(ARRCELEDONIOROMERO)(GUITARS:THEROMEROS)
804,174,465 *5363905BC061C1867EBD55AB0B39804FD9EF6418 SFIDE2
804,174,466 *536598CFD9B981648BD0B9BA93B2C189E2044F1D 55萬套(ps)
804,174,467 *536BFF544D8C92D807965A1E9A4AB3E76FF28380 SHANNON-MARIE-HOWARD
804,174,468 *536295A7DB2780CDC2B0EBB2602402A119130663 5BISNETXE
804,174,469 *536FDFB9766711BB1EDE3C26B2A353D648C2358B 5DIAKRISENS
804,174,470 *5361CBB3F4249BAD1205DC9CCA0CD77C80AD095E sheldontu
804,174,471 *536978CE2891B65FFA2426689A3F781B74BEF99E SHEPARDSTOWN8
804,174,472 *5368F2B8A2C200B4BF6A63A1122F5FE36E54E5A6 5KUIVAPAPERIN
804,174,473 *536CD1595C0B79E09B01B108ECDE01683F4F120C [email protected]
804,174,474 *53645CE4EC655AD7708F30EB2A95BB163CEF1242 5MALOTTTTOLAM
804,174,475 *5369E6EA0C0E1B469C73CC8B77C2C8D79CB85561 5POPLJUJE
804,174,476 *53608F8BB2D85DA0FD1248266A88EDCAD96648FB 5PREMEDITONS
804,174,477 *536DFDD6475909A8A7A2B866234F9A4861F33FC9 5QUADERNI
804,174,478 *536D8E17A60461EB49B69CE38EDF38C9CF5787B4 sidtortoriello
804,174,479 *53696CF16F4955F761E6E2E99AA4915A5CEEA158 SIERRAGIZMO2
804,174,480 *5366F742788FECD69EC0228455A344268D30532A sijedi
804,174,481 *536A95831AD12A474BA5EE0CB164BF174A52A451 5TIDDLEELDDIT
804,174,482 *536CA89CD5BCD4FE275797E3C80F96C0553D14E9 5winston8
804,174,483 *536968672E3FDF43ADA43EC0586BF5FE34888548 skiking
804,174,484 *536500A9AB318AFFBAA419CD8A337C471375C096 SNOIREGOLER
804,174,485 *5369864095BB7A3A4EC5D9E7D3B2692F613C8D4C snowballpolitics
804,174,486 *53699C0AE0C291FBE2D818942BDDDEA89B74242F SOFTMINDED3
804,174,487 *536AD9E4325824C00CEFE6F4C2F0C2E5DD851BD1 SOFT RAY
804,174,488 *536CEC8EB0C22AC31D39C9ADD073BAC4D97E7975 [email protected]
804,174,489 *536C7BE43D00A18EE48121678E666ADE4B7E6BB8 6BCL
804,174,490 *53692F99CF413941C0634CCC2E1C9D948875AAF1 SP0RCAS7E
804,174,491 *536F0F6F10F78745400008C059FDEC337A7F9C65 SPANISHMINE
804,174,492 *536DE15F1FE26FAD24BDACB80D57C69B5E6C7EEC SPECU14TORY
804,174,493 *5362BC5ABDA0626C41675B9EC975E4F019B0A955 6ENTROPYSCOTCH
804,174,494 *536F00B49534653DDE99C572D8442918BEBE1CD0 spencer83087
804,174,495 *53696A2520E584CE798AA988222E714773A006C8 6hmvaaaaebaj
804,174,496 *5361704902D9A7C1F1E73992ADDAF557030CC0C0 6OBMUTATA
804,174,497 *536E43D9207A665C27DB36DD86667F0F68A73BF3 6OPENVAL
804,174,498 *53677E41624A53709F51CC8C45716EC0FC6D38ED SQUAREDRING1
804,174,499 *53653416858D825B21608E95862D8E7BED091E39 6SAREIRPO
804,174,500 *536893B93BD1074A221B9E03C27BB38E32377D90 6SCOTCHANIMALS
804,174,501 *53664ED79F3B3B26DF43C9D475ED24198DA42F72 6SPECIALOMRDES
804,174,502 *5362FED3A6EC82607D6971CF4A69375DE43456DE 6STARWINTER
804,174,503 *536DA84F4765558F0415389A8148C74262D71FB1 ssentneisnart
804,174,504 *536AAE9AB9952CFF62B8B8AB8FF85DB4AAFEA526 7ACCORGERESTE
804,174,505 *5362AE2BC993DB7C6FB8A86E07EAA0F7AC342B13 STEFANBAMBERGER
804,174,506 *536F9FC9E56F1C329473DCE4CEAA7DEF411D13EE steppand
804,174,507 *5362D9A0F0773DB8F8579BEAC475F5885ECF1675 7CASTRASES
804,174,508 *5361BEAD865EACAA996470D3C35CD39D8EA18ACC 7CURRAGE
804,174,509 *536BA7DFCC8BFE15DE66563E72DCEE68B249F2AF STOELENMAKERS?
804,174,510 *5363FFC131A91491B3B2AFDEBEFED727089DC792 7EVNEREVNER
804,174,511 *536EC419F8498DC2543A07666C3B3601483D3272 7-GEZEUGTES
804,174,512 *536CAC9DEF4082B33E8BF90A111515ABA5D036C7 STRSTEVRDIEN0
804,174,513 *53666C0F30046897A6E91BE781606ACE71A0A14A 7MALAMUJER
804,174,514 *53670C531291D043D35429534FA85822BB4D4AD2 7OKRESNHO
804,174,515 *536C55EBD5312DAA24A51FF362D92B28BAFF6B5E 7OMTROKKEN
804,174,516 *53625989BD3F225A1AFD1D8E017B2EEE170027AD 7POIKIAMM
804,174,517 *536082A817D91813276DDB8DB308C14FB655A416 7thatrusty4
804,174,518 *5368C68698A3A45794056DE4F6188454A1BFE52B 8------>~0~O (X)
804,174,519 *5364C7C62812F80220816C84B888AAD055212F3B SUSPENSION-WIRES
804,174,520 *536EA0CF0029394673FE0F8D98BBA21D509C9C40 8GNILLETSSOOLEDAHCS
804,174,521 *53660523A82FE6E04DE9D7EA0D5BF056884B0E10 tachwood2
804,174,522 *5363889A69C9D087660B3E12801AB90871366A68 tambatrio
804,174,523 *536E881610FCF8A071C0D4031AC4EE370BAE6F1A TANNERVISOUNNARAJ
804,174,524 *536023A348A804C9B8E3A95A4D7C0720004ECADB 8RIPULIVANO
804,174,525 *5369576DB84E25EBE2C61F5A579436C25E62FFA8 8UUDHPFQV
804,174,526 *536D7AD30DF57158D8842F4B08D57506D93A94C9 THATCRACK198
804,174,527 *5366A700AD12167BFE0F54A942176E4D0BC0A340 9censuravo
804,174,528 *536C3952C36B50D7A72BA3611DDAEEE653E446F2 THECAT22
804,174,529 *536FB6E5E4EF4090F5D352612BB52E4C6460917B THE CROW: SALVATION
804,174,530 *536B1432C8FA2250E246C02715B663DC39E5A7A6 9INAGEBSW
804,174,531 *536894E3D4D5324B15A068D5B821C1FC7A0B4F9A 9JTEVNAJN
804,174,532 *5362B95E65776984EBF8343A38FBB082098BA9C0 9LANTERFANTENS
804,174,533 *5362FAC421DA2809F554B7FBF29D8A3E31B21B1D THEOSCAR55
804,174,534 *5368D6E2278E2187F404BCE0A3D86509B53B8A58 theronrussum
804,174,535 *536BC689E8D0880BD8B2260FA24D0856593AE96C THESILVERARTIFICECOMWWW
804,174,536 *536B39B587B0096839B6A8F32A5262904D43043F THE_SUM.SEARCH40OPYE
804,174,537 *5364CF7C4963C4AE3B3AFFF0EBCD1FDC819E53FF THE.THINGS.THAT.DISAPPEAR.WHEN.I.CLOSE.MY.EYES.(DISC.1)
804,174,538 *5367D10EBC8C2FAB9B33F16480FD089DCDCA69FA THYHEAD
804,174,539 *536B44E26F9713B1677F4D6FE371D42B734A7C8F TIGRISTHE
804,174,540 *5369EBEA1BBB97FF7DA8053BEA075D67F5793ED8 time-life music: the swing era 1936 to 1937 (disc 1)
804,174,541 *536B0738D78CCD72B33DF506471CE7C604C8FE35 [email protected]
804,174,542 *536B298A2EA63FB5896B3F1250E91F2B50F6E6A1 aaa,8a
804,174,543 *5364DD20396FD8D6D1A6C8E4A181FC534888C333 aab%q!
804,174,544 *5365BC8F84C7FD17F7D8AF44EFB3687FCDCD38EF TOTMANNSTEUERS
804,174,545 *536ADEE57AED28F93946E01BA0BFE473E0EA5254 AAMPNEZ
804,174,546 *536ECE5DD0C9DACA7AD552437EB773E977EBC038 aa;r0
804,174,547 *536BD539E2877E9EE8C15206502B7EF6E6186C42 TRACYSMASHING9
804,174,548 *536A9789BA87DBF204C36AC87C55363E151593F3 TRAICHAKVANICH
804,174,549 *53609143158ADC862B3E6E87AAF6FB25CE560E48 traina1234
804,174,550 *53678D62AD3CDFA64D8B09B02AE84D66351BD960 TravelTakesAges
804,174,551 *536F91284752CC8F07AF83A573F1EEAFB2867413 treyprowell
804,174,552 *5369BAF3AD58FAEE9AE38A1B7EFFC964EAB7CDC0 TREYYEAGER
804,174,553 *536B1543F92D0E52436386B0D4A30D220F169DCB TRISHAELAGOBAIS
804,174,554 *536B509831D852A2A02FB29F0B51E50F1A20182D ABXA%
804,174,555 *536CE9A05BA6A4952DDD1BEAED1C5C749A4719D5 ACIFITTE9
804,174,556 *536401A44594BDB4AF97A8ACAF6C5401B06BAD52 tsusfles
804,174,557 *5366FC3A81681848A1030021EE23BA2F3B343152 tuliallan
804,174,558 *5365BC1A57AC13C3D58CBFD1BBF9D1E1F628CF8A ADRIAN.COASTER
804,174,559 *53609A30375700FD0FFE3AC7F05E337F7EDE2319 TYESHELASHVILIZURA
804,174,560 *5368FC511EC2B0641C4D7307D000F01723AEB317 TYRIGHETTI
804,174,561 *536607E3B5C5AC0DD67A87CD587829FC8FD76FEA U14652
804,174,562 *53675BE4034868754F12C13D190B9AB98CCD6ACD aeevw
804,174,563 *536E904629F2C574709A129AEBF9B61B65344138 aeiih
804,174,564 *536B9A19AC52B561E158019594665CF761749132 UNCHANGED129
804,174,565 *5366612907039034ABC30E95912635581D59CC63 A:-GG
804,174,566 *536D5A4A431D994618BB4F6D735D8F44B98A3161 AGUMMUHSED
804,174,567 *536EBAE6933525FB256442A609B17666AF0A3527 aivco
804,174,568 *536D084C63D74E55CD8054F02BB4D4851C66B63D UQSITEIPIRROC
804,174,569 *536F7CBAADF62983E7124F1BF809929E991516F8 ajl.x
804,174,570 *5363A1EFE8B60B7A08B26267426A37454EDF0BE8 USGSK
804,174,571 *536D776D6BF0BD49EA869C55B471F63158A22877 UUF?
804,174,572 *536006578747513E6BDC8ED9143858EA76A942A8 VÄKTARTORNET
804,174,573 *536D93210633397649350E81C991B0F0625743B6 valentinedesmond
804,174,574 *53654508B2DD531E4B7B4753FAC917DCE1B46CD0 valjeanluispascual
804,174,575 *536D38061619AEFD1AB86B5E42FE8ADB04E8C34F AL-HG
804,174,576 *5368CCC60BF7A3A55F0F8A64CF0A0191B52A4011 VANDALISM.VERKLEMPT
804,174,577 *53691C05732B50B9BACC551877A79F872ECDF8DB vaneelashondajohnson
804,174,578 *53684BE266243E25610CABBAEFDC6A3E10009830 vanpascoe
804,174,579 *536E3B3F14E469057A5AACC0CDA852D78C1268BE vantrix
804,174,580 *5367EA34F28691B98C2311912B8EB639879FEA14 VARKOOR2
804,174,581 *536EF7BB686C6545B245E378546F3D8704F9EAA4 ALTONALVARADO
804,174,582 *536F7FE60771D1FBB2F333D8DDFD56BD08F33738 VEERESHCHOLAKHE
804,174,583 *536C43A2B938F1864B22E6E527D153795E8B8E55 verbrijzel7
804,174,584 *536B665242685EEB11BB24FF4E9F281E1C0E4928 vernoncappiello
804,174,585 *536916354A57FCB89F19B2F870F44BBEDD04ECC5 alyssaricky
804,174,586 *536D2430C140D6309D18A22C1829725F93C3819E [email protected]
804,174,587 *536BF7CF7DA7137C71F1B38CED8329654296160A VICTORIA HOOD WELLS
804,174,588 *536B35FF2012A219327598962A023C2644A148A7 vikifikator
804,174,589 *536A51B8E2401C96BE6C37E24C13A19B5B83E805 ANĎUŠA
804,174,590 *53618C9BBE71954CF20A36F3DCB64BD234D2F0D5 VIRGINIA.OCR
804,174,591 *536DD8438A67716D39868F21ED3EDADA50073D2E virtue-christoffel
804,174,592 *536EB8459487F482901029BB640827F99771FECC anilaooalina
804,174,593 *536839B7B04F63921BB89A27925382F746EFB1B9 VOLKOVÁT
804,174,594 *536C9CC5E05F4B6231E6CFDEC5C23ED7ECD85E38 VPAPADIMITRIOS
804,174,595 *53670506A0B6DB46747C860F0EE344D6E735E242 [email protected]
804,174,596 *5364852EA1E8DEFA8F79182C9B243F14E8E9C053 [email protected]
804,174,597 *5367EDE9F9FD4111E8EBE18443BE6E467CDC65C4 AO4A1
804,174,598 *536EA16D7132BE60DCB68113F21CF92D60942424 WANDKARTS
804,174,599 *5366840F8444F30C91AF8F7E6B866FCF336DB464 WARD.BRANDMAN
804,174,600 *536EEF5D4584B6A6B695E21DDDF87D3BCA378101 WATWATKALAY
804,174,601 *536CD9F93826BAA831E965AA9D6359CA38E36D56 WAYNE.MUESKE
804,174,602 *5369434C9A00EF757C2994D0D64050AA2BCA434C ARKIVBESTÅNDEN
804,174,603 *536F5A90AE1C1AAA002F9D1535F0BE3918F69A3D weldonkelch
804,174,604 *536FC32202D8F6C027DB2734B3D93F6BCD8E277F aryt8
804,174,605 *536C97D3166D1B61ED368EC1F89F5BD7BEBD92BE ASCETICS
804,174,606 *5368A5FBBCA3BCDC0891C91347D302ECAFA2B682 whyjakeridergoogle
804,174,607 *536775F2355E9C9D1965BF57F9C7358F2450FDB3 WILBERDENI
804,174,608 *5362B60EC274CD6AC49B168D77C2A73371DAD1A2 WILEY.DIPERNA
804,174,609 *536D01B45A560296709B21DD9D322315F7AE6C42 atiejhoa6
804,174,610 *536E0B39D0EAC7B34E9A60A1DD76CBE2ED9919A4 atizaodas
804,174,611 *53606AB47D87A9B467B4E150E99DCD1769278E18 WILLIAM.ALBORNOZ
804,174,612 *5365F3BE840B2D16BDFDA9DA8D6BA36DE8BEBAAA a/tt=
804,174,613 *536FC43D432E7490FC296A8A1506E714504B9A77 wilsoncrown
804,174,614 *536BEA523261D1C98FF107D57BE6F2932EFDCC13 AUTOMATIZED4
804,174,615 *536ED5915984E43C007B5E5CF85E39F4639DE6BB avbon
804,174,616 *5361017D2733943D2B61A911136324A0485B185D AVSHB
804,174,617 *5362E0A0D186149FAC0911D2DC2D935DA4E5B5E6 ay5pt
804,174,618 *536E9FA03FBD4539E166A848A79FCF830DB4A22A azsfppf2
804,174,619 *536323B7698585403C59E101028B60BFB058411E b32io
804,174,620 *5363D0EDBB46F9AC6ADF79325C69349482AF5F03 XIAOEN.KWOK
804,174,621 *5365B398B5DEBBDCA358C7F793D7F093EA65F012 [email protected]
804,174,622 *536B13F5F0ADC627C23653C7FFB2526E450AEA05 b5yi(
804,174,623 *5362204DC6913181EF448E0F108B7E2CCB5F8A58 xzarille-diezmo
804,174,624 *5369DE21866E4A67C8D6944626CE411933781B83 BACTERIOLOGISTES4
804,174,625 *536840DD6230EAC82D09EFD5F65BCAFC81AD53B6 YANUTZG
804,174,626 *536DCA330E73C13E90DCB28066EC8756D15A60CC [email protected]
804,174,627 *5368BA3812AA74D6F15D18B7B448984CE0E1F89B [email protected]
804,174,628 *5364D413E9CB7CE008F50E20C89F72901DFF09F6 YAQUELYNE6
804,174,629 *536BA5E72C0EEF58346D439381E251090A0875C6 YARAALRABAA
804,174,630 *53627ADF2A2F31340BE20A36043214228E7E1AFA [email protected]
804,174,631 *536FF36A20BEF1F72F5FFC61B252A5DC2F47970F BARB.MANOR
804,174,632 *53694009BFCFBE823654606C4C3F1E9279F2FC65 BASELOADBSW
804,174,633 *53646A39875D049003D85AB47A7D88B4481FE63B BAVARIAN
804,174,634 *536CB7A627F0606C13C40E94453EA046E4A6BFB5 BAZ AHMADI
804,174,635 *5365BD0AF8BFE86909ECCEFFD724AF727817D2F9 bb74
804,174,636 *5368DB498608F8DD3AA01FC4E9C1A2AB963319C8 yubilai
804,174,637 *5365607735B1C8A1B4AAF9B2F5022685FFCC2B37 B?CD:
804,174,638 *536C71F990AC72E2A72AB008001B719F76B1CA86 ZACK-YUNGKURTH
804,174,639 *536C56E379931E79AE93D53F4DE2DDD97BAA24A0 bekele.getachew
804,174,640 *5361E1985DEFF47356293EF06BA8D72548326205 belaghat
804,174,641 *536439E297318D6C77A96B96117BBD0ADC474A77 BENNIEBOOTE
804,174,642 *5369513A40CAF2275D0FEFC3413325FBB1195D31 ZEDYMZEDY
804,174,643 *53640551F37DA0395336485D250A48D75D602A98 ZEINEPA-BOSHNAKOVA
804,174,644 *53638CBA59AAC316AD392848A454E36DA9FF1060 [email protected]
804,174,645 *5367FEBF4ED0CC3B11972906694CC4D4400B5852 BERSAGLIERANNO
804,174,646 *53669D5BBF6F495C740A1A418B2B72D2ECE33C2B ZHINKAL V SONI
804,174,647 *5367A16309B5CA65566AF0D93D7A16542000BE08 bfodw
804,174,648 *536C21244504DB2EF07D37F977C5C45E56AADE39 ZUKOZOOKS
804,174,649 *5360A29B46586AA71FB8BC421A5C475ABDB81343 [email protected]
804,174,650 *536FAA3D252A3339400E06D386BE73A412F743CC BJJLB
804,174,651 *536E731A42312A3011EFDF21CDC6D002E658F248 ΡΙΓΗΛΩΝ
804,174,652 *536CE8B3D3427D7E142B26C21CD6F3BD4AAA4ECB blit-
804,174,653 *536CA3A9A75F08A00DB4C0EA0ABCA756456FBBA2 BLUESMOTED
804,174,654 *5361138A6BC0C09E667AA967F04B6CBDBC8B7A40 B_M-
804,174,655 *53685D5E7D834415CBE33BC5C9A9D79CF8654F5D BMICONTACT
804,174,656 *536EEEB649596502100D926EAA91AA218FC8BFCE bny$l
804,174,657 *53640D003B91109D1D660F3DC670940754BA88FA ФИЛАЧ
804,174,658 *53683478E9F98777048B4FCD0524CC8A66251682 boycefoxman
804,174,659 *536423435D79CC47912E6487B8470B9FD24EE42D ЫТЛЕВААМ
804,174,660 *536A5579139AD6A384E740ACEB137F01CB3EE194 BRICETHOMISON
804,174,661 *536C401539E539C00C61C9308373872A54D47905 britisor's
804,174,662 *5364FC1E829A18879065BC1DE6A5BE68F11F8EC1 [email protected]
804,174,663 *5367508A120C833446A4614B100CD98121D8FF24 bryonkrolak
804,174,664 *5364691715A1DE075DA88BBCD13B24A922DC771F BSK
804,174,665 *5364D0BCC92AA30A74113772F7B0221E124DA2F3 などの各種言語(SHAPIRO
804,174,666 *536762C0A099D0CD7AD2821448DCDB8A8441ABDD bundeskulturbeauftragten
804,174,667 *536CCD52F6CDBF3AE41322196A96EF45760CE64F burlwondoloski
804,174,668 *536E9284504A4EF71619346B69FF92370014F8F0 BUSTAMONTES13
804,174,669 *536BCF935EFBD07909805591C6CEB75F07A6986D C1)w
804,174,670 *53643886CC462629863D251B71421921EC37558A ca6292166
804,174,671 *53606BED4F70A7C0960B59F83A89F845F637789B Calculate-the-Apocalypse
804,174,672 *536F28BE715572CB81876542379D473CE6806B2B cantilenes
804,174,673 *536FDD4CE2AC6C9C0520B6B9A7E858466A15962E 07221945
804,174,674 *536DCCAB26375956E03725C6860CCDBB25E774BC carlos-chacon
804,174,675 *536B8630A3098AEF957D894D7CADBEB2BB3C491D 08211726
804,174,676 *536C8438159E80D76486A22815DD6CD0155EF930 093nancy
804,174,677 *53682450FDE5CD7A41E922F5B5E3C1CC8CAEAE0F cb%fk
804,174,678 *536DA6657FCCFB2651E636E8E77BEAD942CDBD15 c_-d+
804,174,679 *536A73C8DF41E6A01076AF054C7828AE2F93AF04 CEDRICBRADNER
804,174,680 *53685335A6040A7AA6B129592BE8840F8B936A30 cedrickathleen
804,174,681 *53669B959BB81233E2EFF82E45313BD2B770C859 [email protected]
804,174,682 *536C90C0880E89C86BF0084069B5479091163F13 CelticHighlands
804,174,683 *536F33F2023E1BA68680B1AA1AB451543383DC69 C%#GC
804,174,684 *536EB8CBCE5FEA0CEB9FB182263AA43D5886508A cgkge
804,174,685 *53661C0666192F2DC4E9CDE7CF64E9E6B140EE5F 16lee
804,174,686 *5365D9F560F0EF27055A9181A0A018069325BA04 chasegergely
804,174,687 *536FAD7DC78C53BEE70733BEC4B08B952CE0DACB CHASTITY'S SONG (BAND OF THIEVES) (STEREO ALBUM VERSION)
804,174,688 *5362FDF2964FF162C8DA0EC933A1E7A71E292B2C 1.aitomalla
804,174,689 *5363FC9F351592D9A9F6DAE0A537420124A5DA63 1-aldo-rossi-schuelers
804,174,690 *53629A40F39D066AFB44350C45550489261EEC13 1-antonias
804,174,691 *5364ADB3E7F5A5BA4DD5371983A7E9D4D9FC6D7F CHERI ROWLAND
804,174,692 *53684E81005239D053223D08CDE1B41BC6996E0E chetek3
804,174,693 *53621185EE6BB78A5CEF6FF46308883AFFF9BB5A 1BERLUSCONI-BRUEDER
804,174,694 *536FD59B5A7B639FE2B13323F4923D2617E161BD 1.bvvvorstehers
804,174,695 *536E73CA5F937BB81D8778D71779F3CC29D53825 1CONTRACTUALISERAS
804,174,696 *536849760EAD3020A6175263A2514399D2BA7486 1.EFFEKTIVITAETSKRITERIEN
804,174,697 *536BDDE912C56BB0DFECB9CCC3E7C8B9D748D506 1-EINZUKOMMEN
804,174,698 *536F1486B92CDA10F408E6F78F91071E1F021D23 1ELLILAGU
804,174,699 *536BD529024F95D0EEAEF55EE7AC3BB8F402D3A7 CHRIS.ORIORDAN
804,174,700 *536BA353091CC94CFCFB9FA8C38BF6CF03C9E37E 1ENTRERER
804,174,701 *536AFE2D923D033844E6100AE96F38D1F56E8BAA CHRISTIANPEATMAN
804,174,702 *53695FC9876894C0D88699E0C1B0B59530E76EA8 cht:
804,174,703 *536E08633664E1224A4CBA38E37F3756C79E9A12 CHUANGUO3
804,174,704 *5369F7333F5D5089A471F739DF031CD3AD44F1BF 1hammarskj
804,174,705 *5368E812FB67931A58E7559C649E427DCD2097B0 ckfh
804,174,706 *536BFEEDA497E689F7CBB489490DDEB13536C947 CLAUD.TECSON
804,174,707 *53661B36D4BD51E27985018B578F2D5BB19E34F6 1.octekpakettilaskurilla
804,174,708 *5365FC84BE1DE1BDDCE42107C881130E89FE4BA0 1.ODDZON'S
804,174,709 *53688640C10F5C32EF534BF6872FCF9AD0BFC616 CLEMENT.LIDE
804,174,710 *536B8028E025CBBA4EB3601F208C1815D02FDA40 1periksiantoa
804,174,711 *536229428EA237975525160E2190CA8F39C18C09 1perusasetelmista
804,174,712 *536B28533F35BCAE0449A8455CD21B8BDF62D1E6 1Q1562
804,174,713 *536BDB8C967E9029D0583A06241D6811D4997136 1-rekordrallye
804,174,714 *536E1A620D83F4DEF5BF105F5798D96837719A6E [email protected]
804,174,715 *536E960DC57A87571A2FA2315104DE0BFF8D8DFF 1.sammallahdenm
804,174,716 *536BE4125359C70EBE861B0E46DC34EDC0558AE4 1.sikaili
804,174,717 *53658BF2CE426C913F72D70DF1359F41F267AB1A CLUB TONIGHT
804,174,718 *5369FCBAE5E41CCE45D6C0DE4FB54C794596EA78 cm$=v
804,174,719 *536FCFCCC9617614A2E2DF926F9A0A964A76F8B0 1 TRITTSICHERES
804,174,720 *536254DED808073DF97EB2BDA7A65F405F19E794 cnrbs
804,174,721 *5369FDD7EF6653AB5C86F65EC19F7BC1188B7517 COLONIAL-ATHLETIC-ASSOCIATION
804,174,722 *536B0ACB5A7C3C642404ADC07ACDFCE953CDBAC1 22.03.1912
804,174,723 *5366944F8001081F1ABDDCB0559C65E72D5932E3 [email protected]
804,174,724 *5362BD2B657136951B0B8137EBA4AE8C9F125E71 CORENOTSOCHAOTIC
804,174,725 *5361A3CC64D5BC37CB760AF280D59A6F7B897F21 COREYUSACK
804,174,726 *53665E5BC0BC43912B2E0D0E6E50FFC4DC3931A5 232602 lutfenbuetmenidegozonundebulundurunuz.
804,174,727 *536DFE4EDE4CF54633C203E904A83C2BE5CD6360 2.3REEVALUATiONFORREMOVAL 6
804,174,728 *536D4C33411B4F6068A261E0AADE6F480A93CC81 2519557 YLEISESTIUSKOTAAN,ETT
804,174,729 *536A94CEB5FC9DC66B9162DC0617BB958484B9C4 2693014 VARHAISTEN.NAISKIRJAILIJOIDEN.TEOKSET.OLIVAT.PITK
804,174,730 *536E2A2BBFEF53FAF28BD218A9EA69DFBCC771D5 270061 SOITTO.TOIMII.JA.DRIVE
804,174,731 *536346351BAA70CA520812F5A89826679FD96D63 C_Q:0
804,174,732 *5363876A72EB969F9F7179492A0F808B0F44F8D5 CR?LV
804,174,733 *536D9DF096842E2226A4EAAA4E122865E1B7CC5A 2ANNOUVSI
804,174,734 *53636DD023A457302A9E571917CC091AF24A92D4 CSUPASZLÁBÚ
804,174,735 *5360090DE14027FC61B49B347EEEC0A0C1624F84 CURT.CRUMBLY
804,174,736 *536724B0F48F43CA2EAA6DA76CE927CEE879C481 2HAILEYCO
804,174,737 *5365CA8BA00EC1411B22066DE7D54A9267130BBB CU,YG
804,174,738 *536DF308881825C24FD889EB051D9DD485F2B102 CVH84
804,174,739 *536DD66972B0C09B995887E7FD766121181EC7FA 2.loas:lt
804,174,740 *536B27B8F7AC219BC28B571134DC5D2672FE32CA cw:jb
804,174,741 *53629CD20E3537D5DF247EB66512C457F97CCAF2 2.TRAUD
804,174,742 *536605E0A39106FFD5966B0C995373910D924A65 cyrushibdon
804,174,743 *536E9D94059B071FBA652A4A838381DB195888E9 2.VERKEHRSRAEUME
804,174,744 *53689E2BBA242A682C70298EC5C7D824A2095CF2 D0GBERRE$
804,174,745 *536361C6029B94E0CF58F09922B485C5ACC0BCB3 D3T4!L5
804,174,746 *5367B4375770B0CF3171359B94A620F173196E0B da;fq
804,174,747 *53632AEBFF016AE0060E255495E11A42FAF3F189 dak"/
804,174,748 *536FCE011CFF7E4EF9493624FF70CF8C21C8FCFE daltonbrazzle
804,174,749 *536D81A4966BB8F2F8133AC3C7BFD47E106CA00C 3-MECHANIKER-LEHRLING
804,174,750 *536C7B4EC9B2CB0DB6E567759EFF690282B52C64 DANCH
804,174,751 *536374B508BB30F832780ACE5ABF80D43F606D63 DANNIE.FOSDICK
804,174,752 *536DF95D716D9C3AB45C9CE9D89796F7B10203E2 DANNIEHEFFINGTON
804,174,753 *5367B48DA247FEEE835181C655F7C9714496D8CA 3STARTPFIFF
804,174,754 *5365D38C9D5DE98C641052E92E017FE37CB1795F 3THECOMPUTER2
804,174,755 *536E9F68509F186B0AD5CE85D96BABE0D26D883B DARIUS.KALBERER
804,174,756 *53658478D9E8D7741DCDBA3A3DD83CC6F92DECDE DATERS?
804,174,757 *53661154A14F5DEFC837149EA5479753FE2B0148 dcbt-
804,174,758 *5365CBBFB8105D3CADF72A623D275DA66196FB68 4OUTREQUI
804,174,759 *53600851FAEE2BDC9519E898E9AE46B088CD6C76 4OVERCONTRIBUTEDS
804,174,760 *536ADFC11ED059B3D7BB236D3F8F2158B2F9C08A 4sereda
804,174,761 *5362C7E205D4689E2D3E73207902591E7BF5A456 deanraden
804,174,762 *5369412CABD6E3230AF8A177E4E36D00BB6A64D2 DEBILITANDOVI
804,174,763 *536AD67B50303B54F778CC13EBB451E6548842B6 4-VAINUTA
804,174,764 *5361DD9A541062A27CDB4C4221243CC17FA9AF86 4VEDINAH
804,174,765 *53675AAE983FD64C0CD7A6FC5A4617506D717586 DELBERTBADILLA
804,174,766 *536EA28073254E8BA60358B0A617A7058A43E945 DEMERITIEZ
804,174,767 *536536DB14ABCAD78D5D5E11CF4F70A10E2EFF57 DEMOLIR4I
804,174,768 *536FF7E9FDF3C552C55C9C833C5EC9CC7A36C4DE demsg
804,174,769 *536ED03B593A6ECC07E7059291CFA7A5A823E13A derekminshull
804,174,770 *536C43BD34DE494A8CBFC00F5717878FE139815F destinyvincent
804,174,771 *53631F6DF94CB0A9CA1D7964958C5968AE6CAB0C 5F44680AA77332F68F818EEF506CE30B
804,174,772 *536049AF36DAF610CE637621B19B004505E2D38D 5FIREMANGAMBIT
804,174,773 *536FDB09ADFD268A99C9CC1825A364534A3A64B0 5HARAPOSO
804,174,774 *536B3429E66235FEFA8B5212DC1B34A0A4487230 5HICKORYWATTLE
804,174,775 *5369604129B8FB1549B75F2E96F16D49CF76B71F 5-inger-johanne
804,174,776 *536B008E245B24BE51AE64399E6CCE967F9581D2 dg2mu
804,174,777 *536B366E5FD7F6B8C5974C579279603B0AC9AEA1 d"ht4
804,174,778 *53652CE58862D8A207D42D67CE1F5CB60AD89CB0 5KORUPSI
804,174,779 *53646F56B85086D034AD32A9C9FA59AB5ABBEA3C DIMEROIEN
804,174,780 *53638407BEEC9860504C99ACFAC52ADE02A52A05 DIRECTORES DE CINE DE JAP
804,174,781 *536C87AFD3FE2FE873783C8439487C1FAB9BA140 Disc 01 Track 04
804,174,782 *536359DBED96E86E854DBEC83FEB5BF9FFC18323 disc5track5
804,174,783 *5365F3A2923C5C3B73FEF1E6DD6B895C748CA0AE d$l6k
804,174,784 *5369A2404127885C3D7E02D931B7EB2DF9EBD2DC 68587856-3B2D-36F8-8FCB-FEFB7003149F
804,174,785 *536DBEE5ED4722DD8E86585B962339B80EBBBFC9 doenlijker5
804,174,786 *5365F754EDA4B1ACD37F9F0A11C59404B0281D73 6bothlike
804,174,787 *5369643E1EEF21DF5D8F39A016CE84A63B926E1E DONALD.JOVANOVICH
804,174,788 *53642C84AA9FB1AE645FDB29A63B53859F459B87 [email protected]
804,174,789 *536D3FFE019FAC7F2C0800E324A80A7EA748E686 donmacca
804,174,790 *536795FC5571899D575865D7B57610E2FE46CE5A DONNY.BOXER
804,174,791 *5367601AC86FC5EBCFBCF0C1F411B3B7E5978B96 6CULPARDES
804,174,792 *5363B3848C33AF997A5CFA095F9391DC7FBE4BA1 dontecrowin
804,174,793 *5361B5C1AB8011E036708B464EBB007E8B8DD357 DONTE.RAMENTO
804,174,794 *536547F3A08201AA8C70D0FAA61E86DC360CB257 6EVALUATIONCRITERIA
804,174,795 *536555C8028710BBE3BC4E6C232DD3FE823E590C 6 EXBUNDESBANKPRAESIDENT
804,174,796 *536771DE3B6A4206D1CAB9A4357A83480C41359B dopxk
804,174,797 *53618BB7C4F8C08B6742C779932DA530F4F0A97F DOWNPOURINGS
804,174,798 *5362217830C4651374B691D8EAE9018BF44E99C8 6REEMIGRATEI
804,174,799 *53621817494DC3880F22BE1B9DD8A36E55293380 dps+
804,174,800 *5365BE6B6C4C719A588BB7167E950B3EE5FDFD20 DRFH,
804,174,801 *536BD260C6AB8D949A6F50EEA353A98D1534CEB3 dscx)
804,174,802 *536B4B7ECF734912B1A81D29172B8097D353C482 7AKNUBNIZ
804,174,803 *536113C9A010FFF701513B4642FCFE22D80DFAE7 7APSID
804,174,804 *5362E7B745CBDEA6CCDF57DCFF36FB1DB4097720 dss'mn`rnt
804,174,805 *5362C0157C8E9D4FD888A41402D0A2628FB0E3F9 DT9D
804,174,806 *536E5265DD19E309B2A8FEC4DC52E69C20C4BBE5 duc_x
804,174,807 *536A39F04EAAB05B96A3B4B8AF58D88587E22677 dv7l=
804,174,808 *536492745CC8480BE8EA1029847CD3B66DB33B11 7RAW1
804,174,809 *536AD7F1E35BB03A88F677285F3830B31E85B5EA DZAK
804,174,810 *536CDC2B589AB215DAA2D88BD8FEBF9DD6F5FE3A DZWAA
804,174,811 *536061AB4C05CF7ADEE095E1B9E3C1E7D2E11703 ea/02
804,174,812 *536981F75D28536304444ACBC770196A64E54CC8 80 MOREAU
804,174,813 *5369E2814DD5A5F83E5A48A16B1A2A1DE09E139D 84553 VAHVIMMIN.PURKAMISEEN.USKOVAT.25-34-VUOTIAAT.JA.S
804,174,814 *5363C8B9429E5DAE75B1839FA2C0E1D8978886E3 edbt
804,174,815 *536C4D69913E79C94BEB904418C7EA0003EB7C35 eden.london
804,174,816 *536623FE21E80E350DC180A5D5AAB290C579CDC3 EDL1O
804,174,817 *536201F63835C95DCFA8D78013A54F7B2C3EDFC1 8======B-`(x)
804,174,818 *5360DA75F7CA8C860C0533321D2FA06D13AC16B8 [email protected]
804,174,819 *53678EEF7B02BCD9EC4E5E106345CEC1203E56EF edwinloose
804,174,820 *53647CD3248B0208ABA9F29E7271001574F8D183 EELSWIJS
804,174,821 *5362F0468E287ADA7861C950E49A0FB79CAF9CC2 EGKWMION7
804,174,822 *5360A5ADEC3A9D9B78B2B5D6261D6B85FE245C71 8ILOVELELAND
804,174,823 *536711FAF9CFB22CF9A0534798DF3D7178E8FAD3 8magazijnmeester
804,174,824 *536EC2C68E94959127A01C71728C4CF050C90D75 eivovlav6
804,174,825 *536AFCFF02BC982E050465F23054F096F6F9A659 8MYPASSWORD17
804,174,826 *5365773916473CA6F204A03D17266B82475DBDA4 ELBAIRRO6
804,174,827 *5366E87A02170534B5799C4EA48FC3296D019351 ELDERLY!
804,174,828 *536BF4F546DF97E0A8A5FF16A7A1D6B860894719 elisha210
804,174,829 *5363C70B1CCE4C443FE188A094D90238C3E8DD34 ELIZABETH.HAROLD
804,174,830 *536490450053D22F7CA3A2C907E2A7B53794D47D ELLIOTT.COKELEY
804,174,831 *536D64F8D91702C430B9008A0EA853C043B39EDA ELLSWORTHCOPELIN
804,174,832 *536196989B98068DADFF7505B373F3D36B38F5BE ELMERISHII
804,174,833 *53666E5B7752C5B816E971DB9882D2211607D0F1 ELOY.ARMINTROUT
804,174,834 *536F08C127EA01846EA3DDE2B353E69925E48401 ELRAEDER5
804,174,835 *5369225B5A87D673F8913ABE44F36DF4B4ED789B elroymingledorff
804,174,836 *536DF8F1FDEB14A5847FFADB76DF0086DA3800A6 em.,+
804,174,837 *536A6E3510C29B24578D68CDA71F99B52B5E90E0 EMANUELOHRT
804,174,838 *536F77916E127F25BD2F4DFD4CF90C9A2352BE30 embalaeu/sambaderoda-chora,viola
804,174,839 *5361BCE113A30962902C72B027714586FF9DF005 8T
804,174,840 *536D9F2CC4D170DE478A6CE0B4F188693BACE21A 8VERZIERENENS
804,174,841 *5368EC8AF91B25BB2D57829F895B23AD2D95CD1B [email protected]`)X(
804,174,842 *53666381B7D72E621F1D71EACF8F327C6B92D557 equa7ng
804,174,843 *5363D7C5857ED489BFFFC528238FC0B4A5F027C5 ERNEST.BARBE
804,174,844 *536A2F74E5AA579A45284F507C19A73A3F119440 ERNEST.GALLATIN
804,174,845 *536E2D6EAEBD1206D4EA0BA26DE02D91F3417FA8 ERNESTODEMALINE
804,174,846 *536FD34B421BAD09D1AF6C3F47970070F30CA2CB ERVEREDE8
804,174,847 *53676DFE6B40D8E3B00FE97EB3119F1265B47A3C ESSENCE635
804,174,848 *53657EAB7D83AB79898116BE43C4F17FBBBFA1E1 ethos-of-the-aryan-heritage
804,174,849 *5362CC5C88BA59607AEC20ED8C5850BACC1BD14F ey"
804,174,850 *5364498ABB2A0F7231986DDEAFEF57217E14DA1C [email protected]
804,174,851 *536965B30383E390D4066C95411B8B50CAE9E5F6 a5iqv
804,174,852 *536EE9B6ECC1A9D8DF574604741B4CEEDEBFE86B aab4r
804,174,853 *5368908BD025397ED99FED8F941715D7B6E7FED8 aacce
804,174,854 *5366706079F63314B265FC21FAC75F4466E13EA8 fflrscd8
804,174,855 *536739E2F279DB1458165F1FA2E01290C6A433FB abp/q
804,174,856 *53657AB7A270AE2C1D695DD248C1FAAFE7ED5C77 ab:tg
804,174,857 *5360F229BB7A170F7194FDA3D08B8ECEBCB0EB84 AC:T8
804,174,858 *536600401CD01A56C040C524E052E5CCF710EFAB food-vale
804,174,859 *5362B2FD76F4AAA4B2E7774BF3F654856E507E83 FRANCISCO.BITSUIE
804,174,860 *5364E4F3EBFB14CCD5AD94833C8845647531F368 advertisinginfluenc
804,174,861 *536984C6D5C871EAC6452148C0DF136F25C59298 ADXNQIW4
804,174,862 *53627A859043978C4362BAD881C77D693B876650 FRANJOTUDMANLEFT
804,174,863 *5360049C6BFDC7FB1629D68A0A7FD178EEC88BB5 frbr
804,174,864 *536818F6EA5C856F2787866E7AB877467E44DA6A [email protected]
804,174,865 *536A06587983666CF15E561EDDC633913E266486 a%fhb
804,174,866 *5365334F37295B071642CFBF9AC70AB3458E6DE7 FROZZELNDER
804,174,867 *5361BE06CB9495D531CAAAFFC0CBEB8BE5C6ECDB fuschiamusic
804,174,868 *53632E9DEF23E8D9CB6CF4B0C1758F6694DF4601 AHTDW
804,174,869 *5365E4F941DE10A0A499B13F48DFBA451E2F2A79 [email protected]
804,174,870 *536EAAD8582D55271A33D2E061925D5663041DE7 garfieldkoulalis
804,174,871 *5367F395B49874752053C92D7926BECE8617B1D3 aitzp
804,174,872 *53613F68766F134B46FC567E623C1D77A7FB7AD8 gbw^
804,174,873 *536483C23E9EA6776289D848312C686A53554BC7 aleurone.layer
804,174,874 *5367026E7A51ADA9F365B52F317DC1ABBCD81F70 GIGSTREAMS
804,174,875 *53637F57C97CB21B9FAF11312FD661C56C882CB0 GIL.SALZL
804,174,876 *5363DD07248B286432E8C8712B3F5E9D1C6BC5FA GINGERPASSWOR
804,174,877 *5361E5631782F8721694F23E5670510E06E926BD a/,lp
804,174,878 *5360EB735F857CD09D92F45222AE61D1D9D12DD7 [email protected]
804,174,879 *536566BDB7B4F7E8BA9D3B090B00C6D7C942FAAD GONZALO.JENSRUD
804,174,880 *53621299A641BF2F772F2C1079916FCF0C448BF8 goodloving(featfabolous&ryanleslie)
804,174,881 *53628B8C5FA4E231AA2C05062F6391C38BFC9645 a?)n6
804,174,882 *53691EC283E030CF1D97E6D34D6F062AF8DA74FD GRAIGSHERIDON
804,174,883 *53675E27D95107B4A87DFA7B81D1B8FDC1E6A8B3 ANDREA.ROSSMAN
804,174,884 *53607BD3ED070384B0B48DDDBAC913ECC5D53125 GREMLINS
804,174,885 *5365E0233AD2194A052D93EE417FE94C4E13B0A9 gripingly7
804,174,886 *5363ABD2C282B25BD799995DE7B484940CDD6671 ANKUSH.CHATURVEDI
804,174,887 *5367F27103DF180E21D8BBB93089F4FE9F517278 gtr・ed)
804,174,888 *5361F12044A3F2AE5C7B645B8823114896DA4332 [email protected]
804,174,889 *536D3CE1E5CEA90A2B64F087DA7178778C5AA1C4 [email protected]
804,174,890 *5368F4B431478274C1A70AAF01E6E6D24C84396B ao:
804,174,891 *53623A9D58CF6337A606F938F6D7588E6C560229 [email protected]
804,174,892 *53605D6719142EDE86631E2009E97A4C9C549971 HAIHTUM.2
804,174,893 *53641DF488956552AF24E4CA038FD34C5A459EF5 HANDSAWS
804,174,894 *536714C238FC5988BF1616E4CDD03FA544BF51E8 A:qF
804,174,895 *536E66AB452F58F5059689415FDF612643500A6C HAROLDSLAYMAKER
804,174,896 *536FB5BCD7B145DAA20F4DAFD0CC94CD66983C3A aqw6"
804,174,897 *536448C8ABD741B429AE412B0DC6E5493DE66274 haubennestel
804,174,898 *53675C94AD7ED9D0D2F51D6DB32741D85A04600A hearinglurs
804,174,899 *53683ED793CC0A0382051ECC181C03FBD6A792CC HEIJSERMANS
804,174,900 *536667F015826D3100D887FCA782869E6C939A20 HENDRATNOPUTRA
804,174,901 *5369FB3E6D7ADBC217D3B2E1074CBF61AB32782B heortam1
804,174,902 *536DB6BA368A02F2E99769C210CC4DBFD3CD8685 HERMAN.POMMIER
804,174,903 *53678FA742472C0DEC45FAB9BBDCCDFAA6E9B868 HERPRAYERISHERSONG
804,174,904 *536B638248D1B9F1756EA4AABEEBF4C6A9F2453E hershelszymanowski
804,174,905 *536FC0B1191A2B212ACDF9786B07246A3FFB158F ASCETICS
804,174,906 *53662CF67A277E62D241AB54CA0CC4082D864730 ASHLEYNAFTZINGER
804,174,907 *536E5F9829EE304326C9C8E7CB66E5A93BDE8889 ASOTRUT
804,174,908 *5367159614AAE5FF1FDEEBB2E8973554EAE1A609 HMS_PLADDA
804,174,909 *53681030608A4121F2C9669728BDF88D65931249 atvt.
804,174,910 *536EE2EEDC34DA6F460380233FF0942A1EC637AE HOLLISANCHORS
804,174,911 *536A3DE195F9617A7962821DCE0E350C24A131D7 audxy
804,174,912 *53613FCE0E1F7C6D36CBD70298F640090946A987 HOMERIL19
804,174,913 *536A0653858733FE70070ABA541A1026C77F384A A$vH
804,174,914 *5364116EE20D5ED0B3D92330DFA92373C7D5EAFA AW(G-
804,174,915 *5366221B1317F43461E3202D58AF705D332F63D2 HTTPWWW.GALERIEENCO.
804,174,916 *53671264206F14D9B055B52E6C9F9D1190312D7B httpwwwnationeuropa
804,174,917 *536755F9DFE8E4211B41BD96FAF5B04BDB17454C [email protected]
804,174,918 *5367B4B50A8E624DF2E1D41076417A31235E4DF6 [email protected]
804,174,919 *536758D35D7148E9D0F1CA5AAA74013FC464A21D azy"=
804,174,920 *5368F889FE62D370A24A11A2ED9C9204F53E4D72 HUGHPEACOCK
804,174,921 *5360F920C1336568DFA0838354B985B1B425EDEB [email protected]
804,174,922 *536328F40620F39D5A48E57B09066B9EDE6E42ED [email protected]
804,174,923 *536E98C7BE79D3E835FD8CFB8C9EF8827300CF61 B:5b
804,174,924 *536631377B0D890A0348D1412F4F04BFB6D16553 bailest0
804,174,925 *536908EA11327A101F48DA9F7AA02CF2E47EE22F [email protected]
804,174,926 *536BEDBB65A45D0DD9B0F0CA841277309ABE40C9 ignliveblog
804,174,927 *536DC58068E474D30B40B0C84FC18D91A5252D29 IKE.KOTTMAN
804,174,928 *5363312E39FC2BD3FC53DB4BF006C5CF25740CA7 bauserienzusammenfassen
804,174,929 *5363B859554ABF01C5ECE187C3B80563EE7D4653 imagerifapentinesvg
804,174,930 *53644D195B83144E830CA6055F9EAE4D414BD608 IMDAEES
804,174,931 *536A1F3BED2AB2707CEA295D807445C3E587AD78 B&C1R
804,174,932 *536350B004165AC8763BFD64A26281FA0D1FE1DE bd7qi
804,174,933 *5360174600FF154A243E2243EE6757A65FDAB555 I NEED A HUNDRED OF YOU
804,174,934 *536F18236A9CB3887EF6923857ABFDD3B501AC74 BEAUHOTHAN
804,174,935 *536790D888099A1E60B393EA005B06589E64F207 BEELUSCIOUS
804,174,936 *536C0576CAFEB493E33CDC49D0269B9A4D5F8269 INSÒLIT
804,174,937 *536D86EF111926135559158971A6E30B35A7D776 BENNETTMYUNG
804,174,938 *536C1166DFAF75599F70B7F5E53BC428FCEE201C INU1212
804,174,939 *5366F6B1617C020D45DC8E9539347300BB3F1A8C IOSTREAM4
804,174,940 *536723772544DF6C9E0D3B0786D61410726FE139 BERNARD.YASUTOMI
804,174,941 *5366BC5D4BA256C2F345DB0C835B76B392B8E43B IRONNAVTING
804,174,942 *53681110C4140B4D218ED181D1095AD5CF6BDD22 ISAAC.MCCLOY
804,174,943 *536C4F544F387497C2927A4FCAFE40FA95CF0810 BETUNGURAEDWIN
804,174,944 *53601EDC5376C8B6902E6C09565F1B2364003341 bezirzen0
804,174,945 *5360EDCC526E99FD3B9B1AF4D18BC35250557D7B J3A10U$I3
804,174,946 *536EF7C3E3C65D95418F598CB1364FEB043F7F06 jagdfpeer
804,174,947 *536895D5B4621DE0CEA307D94556707CF86CFF9B jaimeknaak
804,174,948 *5363B195B26081FB94AD8D00A9460DD29712BB80 biy8
804,174,949 *536C051C301AE62C60E7C7192F4C6647A22530B1 JARRODDELAREMORE
804,174,950 *536132CC7998A5FBE0E16FB1B94FC577415353C5 blkv
804,174,951 *536BF6E431A025496FDA5E35AD7C257CE3EB9A90 BMD
804,174,952 *536671CB4D0D2182D8D47117C4F13508493FAA04 jedmathis
804,174,953 *53631479477665F30E434B600460A91673AD4F68 b?nbe
804,174,954 *53689FDBA509DBD5FD0A5E44C67E2698D9FFE84A bobbiegrowney
804,174,955 *5363009662B4BAA4CD6E8C4562FB0720A05F319F bobbyboeck
804,174,956 *536D2F45F06E2D48151D4D754E4342CA62BA1C16 BOB.CALLES
804,174,957 *53661E4B5B279FEA50FFCE3AE08A4D2A9B7FD845 JENWILROSE
804,174,958 *536AD54496DCFE4FB8FB1ADA6F571D15B94D1C74 jerroldmcbratney
804,174,959 *536E5A1BD5DAEBE12B0EC6A33E14B033F65427E6 [email protected]
804,174,960 *536474FF71957DBCB2E614A6836A5727B5FFE8F3 BOSSOLE3
804,174,961 *5360070C5DADBA4EFA804C6780847AC27D77C07E jf|'*
804,174,962 *536D644355FCCDDECC004C07ACC61A66D7155009 JFFYUMUS
804,174,963 *536D4CC71815599E21E46F6BF4239EF9D53575C9 JKMBOBBY2
804,174,964 *53606600EB0B0D946E0F3EC871BB95223EB29417 BRAULIONUNEZ
804,174,965 *53640BEAB71A2EA66E902040BAB931AD3074BC7A JOHNISUM
804,174,966 *536F861B626C187067613ADD6D6FFF4F810C92E1 JORGECARICO
804,174,967 *536682084729106CB0B200C2D440AEEA898030F0 JORGEOMER
804,174,968 *53674A99147798B719ABBDA516159D343C9A83F2 brittanytedesco
804,174,969 *5369F4526C019CADEB934B7BC9DA17D0B778FD48 BROWNKOKOMO
804,174,970 *53687E665594CB7A4B3638E671501592DEF5DD21 JOSH.KEALOHANUI
804,174,971 *536EF43E68EB4AA5CA54D9276E22A70DBC2185CB BRUREMARSJ.ETTER.SIGFRED
804,174,972 *5365373310DD3E7CFDA33FD702DBFE21DE710477 BUDDHAINGENERAL
804,174,973 *536AF747551918C7E05790F4FDED311CAA3B5E9E jūžintų̃
804,174,974 *536FCBF91F4308B96E9A9992CF703C02EFD9DF94 butlerpensilvania
804,174,975 *53675896CA0789B19BFF6D8556744D3F0EB4944D k1ondike
804,174,976 *53695015A9C67E2DAFE698811EFBB3B23C4B07AE KARTETSKOGELS
804,174,977 *536B37CD31C06261B913BA3AE7E7AF8A4C527DF3 KATHERINE.WANG
804,174,978 *53605CA398F85790958BBB7D94006597D3AD2FB7 bz#(e
804,174,979 *5366EA8957F90A6FD8161F8A5F09DDEB16E2FA31 bzehs
804,174,980 *53621062D654CD197F5FEEFFB7A1ED120D90448D KEEKREEN3
804,174,981 *5361CCB0E490FA640546A5D6551D808B748BEEBF C1j;
804,174,982 *5362C2A6ABB9D16EB7F51240BB66C18782953D12 kendallscarset
804,174,983 *536F03096989D69A44FC80A575D5988EBFC85FEC KENTONMO
804,174,984 *5369CBBF719914F1240D6F384DACBABE4341991B C9I9T
804,174,985 *536D2DDFBA37820B35C438355D0B042278DF0677 CACILDA RITA
804,174,986 *536178E5BBB1134FE92BF3875164E3B4F1F310C2 kg3_
804,174,987 *53655220538B9FC0BDD8242619076F52CD7063C7 KIMBERLYWALTERS
804,174,988 *53616AF85B57283253607357B4FA1DC5A83163FD Can'ttellmenothing
804,174,989 *53603859C5F4DE8EECFEB63C75F51033B9BA60B9 kirbyperney
804,174,990 *5366B98B2DB35F28FECE775CB0C9598D7FB8D4D1 CARCHER389
804,174,991 *5360653C6E702DA981777DDF7EEADB67933FFEEF CAREYHADLEY
804,174,992 *5360B05AB574F486721DCC901D650255694F9380 CARLTONRATTE
804,174,993 *5362552A8282AF9EDF764C886A907E7E412D14B7 carolvarone
804,174,994 *536E3DC9A68F18885099F22E959E41C072AD998A [email protected]
804,174,995 *5361E1F724B59DA4A3EC7E4343420899E23647BB KOUMONKO7
804,174,996 *5368B3A4A26578200549741041D477CDB4B512B7 KSWARAN
804,174,997 *536451DE955EFF3C9F0AD38B801F54CE62C2382D cc"ak
804,174,998 *53670624F5A2E1002E9992F1E289E3AE9FAA45AA KURTRIBAS
804,174,999 *53697FBD05C8CD8D919C2B6DAF63F4ACC09B6F3D CccN
804,175,000 *536DD546503E005D692E98176D5513C74DC00B7C L48267
804,175,001 *5367EDC0793D3977805E928AEBA172164073A3A1 cdnr)
804,175,002 *53677957B20A97EECA4D3AB581B106FDC19FE873 C+(E/
804,175,003 *536594B426E98BB8B2E0F5BA33638B93C04B3C33 censuron7
804,175,004 *536B7D118E3515759180B439E554C68AD5075DB1 c:/fg
804,175,005 *53628CC13177330DCB5E5B9D61AD8706BAD28B6E CGF/
804,175,006 *536698BF310E9459F99663F019B0C7A3EBB7782F LAURAHARMS
804,175,007 *5363B35690E4BCFB6579530962AC15CF69981042 LAZARO.SOPKO
804,175,008 *5360900391A2F6DD43EFA6C0FB70B9FB280AD1EA [email protected]
804,175,009 *53656B24D4A67B7475DB6DE431438D8A5AC4902D CHEESECAKE9
804,175,010 *5362CEBE8E1F95D1B998C822F4A6EA95794953B9 le-grand-tango
804,175,011 *53673249A65E79220015B54241F2EE5DACCF2DFB CHICANAN0
804,175,012 *536C2A766A7A946BDDD56D49D46FBB5C05E03E9B CHINAOLIVER
804,175,013 *536CB6655DD698E0A83EFE75937519BE7967A336 leonardmccullin
804,175,014 *5368FE1B69EDE874BC83EC16090B38D6B547062B CHNNLSS4
804,175,015 *5366BA41663BBDD25EC96D2B09FBD9ED2165FF60 chtendst6
804,175,016 *5366F4C6810EC5157064F230A87094E2781FD94F [email protected]
804,175,017 *536DF669B5CD20F41A62C294E35D8B459A31FF77 ciszal
804,175,018 *536178CFE4984CD17A9080AD6648E142DC27733E CLASSESPROF
804,175,019 *536104F4A7F928144A43D1A793D0E0F618D5A58E CLEARWATER/AGUACLARA
804,175,020 *5365CEFE119537AD016F6C78C305D70BAF94ED07 LILIANNA306
804,175,021 *5366723EB8F9D2A5F5F91C238CEF97B8773DD437 cliffordtomes
804,175,022 *536694E1A15ECCEDEC2BDDABD4D5893296F4B3C1 CLIFTON.SNELLMAN
804,175,023 *536D3EBFF4A9BD440F4B6E8CC59215C0BC60C2C4 CLka
804,175,024 *536ED4F47F616CBE4C45FEBDB49CCADA69CE1EEE lindsayharabedian
804,175,025 *536BC537BA0DE84F3D194FE9F9119D1FA76ECA4B lindsaymccammack
804,175,026 *536349EF765D83D0F59CA04C9FF38DB7C8CD13F2 cl()z
804,175,027 *5367F1327329DAEBAA30ACD656F611899DF4192A LISIMACHE
804,175,028 *5360907C473EBD2BA44AD8D352BF612C82956C17 c^nx
804,175,029 *53678729737D5AE4A42B3771623EAD2549991753 [email protected]!LS
804,175,030 *536BD58D1FFA813CA2C98747F67469709B9809B2 [email protected]
804,175,031 *536C49E47BFF809B8647BD466B0A99DEB397BB00 loonacties9
804,175,032 *536DD176E5C57935A701FFB27EC18AFC4C49F8CA Love.Expression
804,175,033 *5363CB4A2F9F881C3CD8F990A8678AD7A8D08782 lovelots
804,175,034 *5365BAB23CE87FA19EFEDBB9BC303F4EB5BF5E79 [email protected]
804,175,035 *5362940669B3C313F62EB983F249514ECEA2F5E5 [email protected]
804,175,036 *536DC3374EB43DDDF2538F72272B52DEB7DBFAA3 [email protected]
804,175,037 *5363E15EA41A4B7A9634C5DACF3A4050C4EE35A7 lyana017
804,175,038 *5362EFC91C5411A3729D162BCE6CD82812798158 lylenicol
804,175,039 *5363DB9CA7248D7E308F9C4C5DC253CD0A50D257 C#!PE
804,175,040 *536E16566B30C189BF878406B2391902D8F4D3AB maintheme-
804,175,041 *536E246C8821A5C46AA82E278CF74387CE0C606B MARCHES
804,175,042 *536EA424B73ED791FCDB53BC2C06221D6200B584 marian.eaton
804,175,043 *5368EB73A6939CED6D932F9D67D00F7A76302251 marmonja
804,175,044 *536F673B80F4213FCE31F34B221390219FB359E2 d36c.
804,175,045 *5363E76C987A7BA6F7014350D8273DDD1773182C d4rnp
804,175,046 *5369FC7516690B4785D0A09D69DAA5C43A43BA90 MCKINLEYHIGNIGHT
804,175,047 *536CC97121C0E702771BE2E91A6353C8E9DC472B MCPDDGQV
804,175,048 *5364F042354383DA55B4FF3AFFFCF15A194D0F0B DA08TRUELOVE(CODDEEMIX)
804,175,049 *5361E48CDD73B2D5E2D842CFFF37F3B9429EA8CC DALLASRUSK
804,175,050 *5364464539CA6786C8D9EB65EB288594D7EC4AD4 DANILO.BRIDGER
804,175,051 *536F1813A845E7CFF08ED7BB83D8CEBB738125EC danimagno
804,175,052 *5363BE82B012732538118C8DCBBD1CF03E00BFC7 DARELLGROSSO
804,175,053 *53664FF578F77588A110F48E077421DC476287C7 DARRICKGRISSETT
804,175,054 *5361D5E6753BDB676BDBC2E232D0966D27CCBCDD metonymische
804,175,055 *536241A4DF1B62045D86E07BBBAAD9CA940AD12F [email protected]
804,175,056 *5364468C8949EBFE580CF1B1C8C51E4BE9DBC884 MICHELE HARRISON
804,175,057 *536281D7B4F023A1C500E2DD6FFCA3D7A0AAF428 mikrotoponomastik
804,175,058 *5365EC7C751442784EE83D19BFF9C1284D3920BE MINIMUMTEMPERATUUR
804,175,059 *536D73D50D389B8E554E65DC63DE80ED4A0227B4 [email protected]
804,175,060 *5364702F546523AEF75B809DFD7A7C37E970A398 dedonker3
804,175,061 *536E532D8D717F007F43B8126EA7CEDE9E0AF68C M^O[
804,175,062 *5368A06D0B1DB2B78644B6BC2A637DB4E068FCAB demaggio!
804,175,063 *5365F4F3EBB534B3623FAE748727A0495BB7759C mon fr
804,175,064 *5361E6D97B60C4CCAC2741F727054950FE15B86F deonkalman
804,175,065 *53629B95430272EA070B551E99795DFC369ACFAA DEPONTHON
804,175,066 *536902B35B16817C4966B4FFF73B5D378CB35211 MORSKAWOLA
804,175,067 *53680403996B547DA870CB2CA9DEF7BE4BFB5C7E DESSERTY
804,175,068 *5367ECDB4520ADDAB123B31CECD2053B7415E73E DEWAYNEBOYN
804,175,069 *536CE4185F6F1AB139384505238C156E42D36949 MTL~
804,175,070 *536D819BECB39E17FBE7E917CACCB896ACB96307 dexterlye
804,175,071 *536D00C03153CEE92B1E8E83B947A6957249F43B MUGGIREI3
804,175,072 *536423EEB7EBB4F59610B8977792CA29591DEB9C MUNICIPIO DE WEST COCALICO CONDADO DE LANCASTER
804,175,073 *5364548C15E7BA4AB69F68D5C495C62A8E050EAA MVALDEEZ
804,175,074 *536F67D298B84ED09519C3BACDA2C9BC59F867F9 _mxu
804,175,075 *53663109C72946CAA04093C66A3D68FDE9B08C38 dg1k%
804,175,076 *5363E6F977A18873259FFC94D92EF3AB5AF9133A myt
804,175,077 *53634C2BD6952C8EF42FB28FB7ABD470F70A3F15 N32=/KL{STATSK}
804,175,078 *536803658C864C04C360379D822763360833D9B8 D-JR
804,175,079 *536195E992A1137910C7F77D91DB589FCB6EEAED NATHANIEL.CARDNO
804,175,080 *536AA56337D8613B98C279B27D16F18DAA5B77E9 dk0mn
804,175,081 *536A92134BD32D33174154A6A760ECF6403FE637 nazvoslovie
804,175,082 *536A77E94681BDCBEA1C86021425BE108ED77B30 nfyblnwying
804,175,083 *5367F10744FF9A29FD47C48E81E907E916FBB265 NINIIIP
804,175,084 *536F0D731162353B354B940E4CE9FABFBD5929D4 dn%ts
804,175,085 *536FA8B68A40363CE7D6F9D720B7431679619C34 DOLNIHO
804,175,086 *536FB15BB74041B34AA4266F0A0568D439795808 Noncontemptuousness
804,175,087 *5362C8BA2A086C3781936B811D97522B5A3F14B5 [email protected]
804,175,088 *536E70532A13F3C2B3A220845D92EDFA873AA399 NORMANDMCINTRYE
804,175,089 *536BFF518C743913817EF7C1D4A25F89A4B14FBA NORMANMACKINS
804,175,090 *536054390986B5F0E1FB7F6B09DBACCDD36A7167 DON'T-SELL-IT-(DON'T-GIVE-IT-AWAY)
804,175,091 *53694705E778EF8E23BBE9C14A8D079F3A7B2ED3 dp&d.
804,175,092 *536E26AE77BF7023AD94250633BE00514571B02E dr-db
804,175,093 *53677F69BC3504DA7D0413B7725C108403D5F1FD Driven.to.Drink
804,175,094 *5368AC316107C40F22CFE6464BCFD257E56C338C DRK3
804,175,095 *536D43EC1FDD4687A3E7CC8BAAAA3177720FD3C0 [email protected]
804,175,096 *5363E64E84D35FA3F46A48000D33B165345614C2 OLIVER.MALINA
804,175,097 *536DC6322C76941ABEBAE847895B040D385E4B10 DUANE-BELLES
804,175,098 *53665D1C66BEC9B060F8D1E18640FEDE1AD1E54F OMIFISAN0
804,175,099 *53648D5A74FE7E2494D3444348F3CE88F0170878 oncz
804,175,100 *536258808E5F35025AD52B72C9728C42F108E3D2 Ooh.I.Love.You.Rakeem
804,175,101 *536BB85357C7966CC75351656886458E2B72A444 dv$jp
804,175,102 *536F5430D56F2A4E7444325092129FEEED6A98C9 d(.w
804,175,103 *5363AA6529BCFDED82B11C368A7C1AE61C90AD74 DWX$T
804,175,104 *536E008AAA2F64896293D89872380FEB1E853D6F D!Z%F
804,175,105 *536769D1BC4925E03159BE0E46C443A47C1CDC33 OVERDOSETHERAPY
804,175,106 *53609FB6C5EB8665ED3BFB57E6F56650C74253C3 EDMUND.WOOLRIDGE
804,175,107 *536C37A3B75B0700F976A88A713832A8ADC0F676 p!-age
804,175,108 *536BC21957FE59376EECFEE9157DEA46334BE647 pannnonia
804,175,109 *536D86CE0F13BA6A40C5C220B5711C661BBEF256 ELDONGERNATT
804,175,110 *53622172EFC1B5DB3C7244719728C61CCE1A1F36 ELDON.REHA
804,175,111 *536828330A3F7338CB11D9E5C9A6DD2AC5C262B2 [email protected]
804,175,112 *5368F90B4DA2E0B74C63DEF0356D4D0CFC6A8782 ELGT
804,175,113 *536568ABA1ED63074B792F8B6A9DCF0E295F6652 ELLIS.HINDIN
804,175,114 *536405E58FE2EE31DB2539BB4D425B057FEC5E90 pepe.pena
804,175,115 *536BC473A4F3976B66B421E9F0D049C225FF4DB3 percivale4
804,175,116 *5366E03ABCCB58163F6B0D5F3CFEBE97074048A7 PIANOSONATANO62INE-FLATMAJOR,HOBXVI:52-IALLEGRO
804,175,117 *5366BC9AC536D20058017841C99BB40604386197 ENOCH.LOUCHEN
804,175,118 *53694EAAE0F65641A3263F771CF7801A704CFAB2 PITKOFF6
804,175,119 *53655B5199E713005D3D27352D9D1C713462003C ERDRICH-2-0
804,175,120 *5367C1FC380DAAD6FBBD3F8DEF844A4D7FCA2DF7 PLANŞEELOR
804,175,121 *5368C81B0375AF96DC6A730DD1C1E42A97C16273 PLU+0N1SM
804,175,122 *53662ECD8CA049DE4ABD5ECFB353F2BC968E7FD8 plurifol6
804,175,123 *5368A6F5DFDE9B11A31E21BB6AF07158CF4FC87B POL.FURIO
804,175,124 *5364038859A9A95AA52AA8B6CE41424089D75073 ponctuel9
804,175,125 *536BC86BA5D7D232EC08DCF6EAF83BAEE8246A96 p==p ~ ` (>-<)
804,175,126 *536EFCEDBD2F0CE42EE2A96411E5363E6466CA31 PREDARELJIVI
804,175,127 *53692AAF9E507E3B5388B6087C2560C38FAD0E79 eugenekosmicki
804,175,128 *5368F23B2AD4F25B0E1556A1F2E65AF58F4446B4 EUGENESDODONA
804,175,129 *536660F2490C8413B62A0562FA21928FB1F01679 euquerotudo
804,175,130 *536AF9694F1C4816711F1899BA5BC972EC126F75 EVANDELLAGATTA
804,175,131 *536F7D1D1944A736C12E86BB47E41A9884725DED EVERETTE.NORDICK
804,175,132 *536371333A7FBC740C3F86897286399539C65705 [email protected]
804,175,133 *536184D8579443F77826E7F051C2B0FF0337B8AE ey"
804,175,134 *5367B551E411641CF7BA5596D0E7B43D86616FF0 PrettyVacant[DemoVersion]
804,175,135 *536BBF975662E1207AE4277D7A8B60FA34997A3A f0a>
804,175,136 *536936FC1F2BC009B55B9244AD18EA8DFD8241DE PROPERTYMISHA
804,175,137 *536D901D2E91F372851485F51EEF5297BD0AE987 [email protected]~`SPLAT!!
804,175,138 *5367FF750A62BC9307DC3C05F561645060AAA21F FBLMNGR1
804,175,139 *53608AEB56F74CE22E74A880FB7CE599CD2BB5D6 FCLRCCN8
804,175,140 *536B326977649964E0C457F5453AA17E28064787 FELIAY
804,175,141 *5364913D2E33A440843F072E35AD3C9897D14A65 Q81998
804,175,142 *536187CAEB5A7CDF16B83C9268CFA3AA4C6BE98A q#D~-~-~-UU
804,175,143 *5360FE66B8E9157235A5D47EBB2B59592CC41871 fhy
804,175,144 *536E06D3881198CD2D32E55017E4C5BB222D4117 FINISHEDSYMPHONY(DEADSETPLAYNIFTYREMIX)
804,175,145 *536339F8EB04375A3F463DEF9D7A3DC897188BB6 FLACHDRAHT
804,175,146 *536A3E67F02D4B501A419A6CA3725349E429E01A [email protected]
804,175,147 *536A50DDDAEF5951F9722953F25202B7E0A6DAA3 QUINTON.CONTREROS
804,175,148 *536ADD28CEBF47D563D6BD4205F8054893A277E1 R31A7VS7CA11Y
804,175,149 *536376B7FFC550D3EFFF519DB9DCD841C64CAE2D RAFTERKCAWWW
804,175,150 *53629E2872959000F9A632FE1F2574A208F15CBA RAQSEWAK
804,175,151 *53679D3AEFECAB00956C0BD1CF203161DA0684E0 RAYFORD.HOFFELMEYER
804,175,152 *5361BA47D017296EFF06117854600961372C0969 RBHANGLE
804,175,153 *536FD7CEF3972919261C6438C5E3800C0EE99664 frankbarnes
804,175,154 *5362F2E2D0A8FF5F5ED5D087106938462D2DC943 FRANTISEK_MUSIL 'FR/&/NT/U/S/E/K_'M/U/S/I/L
804,175,155 *53616741BDC3B73B5B06C75BBDDBAB777DD237EA fraserdebolt
804,175,156 *536BF70FE912A1583566AD8639A8BDBAA3DB1716 fredrickbeauford
804,175,157 *53604C299D94913A218B9FD90CA9253DB25F2EEA FREEMANTOUPIN
804,175,158 *536564003056F2AF3D16AA19EF61A3484F42E837 [email protected]
804,175,159 *536CB60C4366ABC0C30ECD2B20280286EDB5DDCD [email protected]
804,175,160 *536E1408E02DF1128E6C5D149DC878AF5FF835C4 recorded
804,175,161 *5360BF4B62B6F1A3612CCD35A4FE31B4C6CD43AE REFRACEXHIBIT
804,175,162 *536CBBC78FB139085CEED7DE4756166715DF80E8 FULMINLAS123
804,175,163 *536E7444CF851D4F81E9D8B8C0A651FB4CE5DFEB REIBACH0
804,175,164 *5362501F5CA4950737251F97C11F93AA748300A6 [email protected]
804,175,165 *536B4B1B3682C55E3918EB514ABA758C5B481D3F G1O++C
804,175,166 *536F5095302C4139076369FB626C98681003EB78 RENATOWESEMANN
804,175,167 *536D21B259337DF0B7BEB63E337A3BE2A1D33607 [email protected]
804,175,168 *5363CC0E8997C85ED6C2867CFA58F8763300E9D8 gaby-campos
804,175,169 *536321422ED3025C8E46B167E178BBD71C46AF1F REPORTUFCSNUBBERMIRKOCROCOPFILIPOVICMEETSMIGHTYMOATDREAM
804,175,170 *536BA245222480B9BC90A9B6EA4504D6F652FAF5 [email protected]
804,175,171 *5368536E8E1AB1DDE34D1151049BF29EC9CB16B0 garnisonsfriedhof
804,175,172 *536F633EE49AF442AE796784574AD1756647AB19 ricardorebera
804,175,173 *536D903DFDCC3DC8D872CED55BEFA67C3E8D5A47 GEIZIGESING
804,175,174 *53668ACDCD7A3B8A4720CFEA8AB765C2D07982F2 GEORGEFELDER
804,175,175 *5363A7AD2F8FF0BCB72B6E44C048C43A61C29808 GERALDOROSKAM
804,175,176 *5360C6370DC397059E95169F7A0F77359380BF8E RIP CUBA GOODING JR
804,175,177 *5360177B28858D374CFB4E7400EDF9F29858AC8A robertomunk
804,175,178 *5365940D6CF829E245D8247CC62E6CBAE4BD247C [email protected]
804,175,179 *5363C92BD8EEF09C2F7ACD7FFE3CA0EF1073AA0B RODGERDRONEY
804,175,180 *53602C07BDD33588B13CDE39DFA262E23742610A ROD.SUNDLING
804,175,181 *5369D6A38D6CBDE5FA91ED7F8E99448D79FCE6A8 GERARDOHORSTEAD
804,175,182 *53650100003A2CF930EFD7DB273FCD909931B28E GERARDRATHKE
804,175,183 *5360818A3F65A23241B96411E5CA33D1CB7BB034 gerryschnettler
804,175,184 *53636B2912964A01A3213047A3A1FA5AA9907A93 ROMAN.DARNEL
804,175,185 *5364B07171D71375519F74F2679663D45621E8EF GEWICHSTEINSPARUNG
804,175,186 *5366C45200AFD6191203CB0616408FEBDCDFF2BB ROOSEVELT.PIEPHO
804,175,187 *536672E69CB69AEFC83F7F86F63B389FEB8760E3 ROSHNA SHARMA
804,175,188 *5362E6913F1F73E840AEC454C22F26EC1A7CC67F gjj'
804,175,189 *5369DF9E4331E69F2C0B16F7FB728E7A37D09A5C ROYCE.WINDISH
804,175,190 *5361527FAB95EDC61420BF9DF2CFA3E8353BD206 G~M
804,175,191 *5364AE7220C7ABBA78D106D3F1B44823B6A2C6D5 RUBLIWRDNAXELA
804,175,192 *5360AD665A7689D4E443B255AFF6163F294A49E5 ruebenrego
804,175,193 *536F93EFB42D6A3CC19707A693AB27F3776DA716 [email protected]
804,175,194 *5369DDA0D8A98985396F6A94ADD9F07E657C2BF6 GONZALOBONOMI
804,175,195 *536AB61941255176DE0DC68FE7E6EBF3AE93731E GORNJI−TROGIR
804,175,196 *536560FEF26E185363E9C7C2FECBC8CB1289D191 S06303564801
804,175,197 *53601945BF9DA2BE24473F2234DA01E1DF9B0C3B s3nor!t4s
804,175,198 *5362C5604BAA8E46F10F9D110190F91104EBB6E7 GRASCIA1
804,175,199 *5369A3A10D700DF75DD0A58FE07EF6A63F16C382 SAFETY)に基づき、
804,175,200 *536755A136B288430DEF73E3D421FAB5ED61524D guanos?
804,175,201 *536258878D2F2E716180D64221BEC4BA324BF0D1 SáizPalazón
804,175,202 *536E7A3570A9170B4B2B8EE7D58A6A961270297A sammiethumper
804,175,203 *5362BD827CD60BB06B8F922AADDCD9FCB2242491 [email protected]
804,175,204 *5365873C346E87CB951126B58F9BA5E5271C3B5B SANDEEP SINGH RATHORE
804,175,205 *53672566934259D1B3E24A99D7854AA77A42B070 sandra.k.campbell
804,175,206 *5360BD6F5BF5FA1894DD89CF174B01E9981488BA GUS.ULLRICH
804,175,207 *5364FDC8497A75E44663218C171A308B174655C6 SANGUINERANNING
804,175,208 *5367E9C8EB084D9AE3CFC2EE01B32C89E8E40AC6 H30J
804,175,209 *536165A555422499CCE9516580DC8E10EA9E1B89 HADASSARA
804,175,210 *536666F427AF7DC32ADDAC684E98D9E76DF6181D schaltpult4
804,175,211 *536043C53F612FD391C965C7F8BFADDE27D8BA92 HARVEY.WAMBACH
804,175,212 *536B2BE514C32B770BF8F9E69ED5CAF45DE8171B harvspry6
804,175,213 *536C5A97DB3EC35D49236B54CCB8B41351FE0E97 HDAMSHOLT
804,175,214 *5368574CE543C99BAB1B114EE17CF17DD37EB857 HDONGJAE
804,175,215 *5367B6ED4C6E7D85780C16F0CCAF72E60AEDA65E HE5PERORN1TH1FORME5
804,175,216 *5365D3B7FB0AA067D327C01025F175EB9FE5773F HEATHISABEL
804,175,217 *536D37F1DA6C85C9B6FAAB4E093E4CCB688C4993 SDYDEE00
804,175,218 *536F7F961AC276DD3A917224FB84C62349396592 seamus079
804,175,219 *536588377197B254C6CA63C87E57C219680C686F HEBREWS10
804,175,220 *53644D44A23D702EA1C211648829F33290B0E261 SEIRELOVING
804,175,221 *53618D4EE382F78B24DB39BDB8B0B4FC501C4BF1 SEPONERE6
804,175,222 *53681074E035E45A67FF43D3107FCA2459A6CCD2 hf%v
804,175,223 *5360A6FF4A4AEB48EA4D9D57043AFC2138B7F5A1 hhottear
804,175,224 *536CAA0886C8B2EEB1DCFEDB360F54BF69FA4069 hhtw
804,175,225 *53613B004C745DE9A5AF66BED464E31ACEDD0936 shacklee4
804,175,226 *536482D9FB11A8820D02DB2C1075F0B20B7FF59F hohkaamaed
804,175,227 *536965E6B52B70B10E320428FCFAC1EFAF7F3D6E HOLLIS.MCFARLAND
804,175,228 *5363F5E76B93FE155CA427427B4C23ABCD30F3DA sheikabray
804,175,229 *5362391CED1046134625CD5965218E8D9D5446A1 SHERLYN170
804,175,230 *5360785A6E67A177BD22536186B8C3BEF73E52FB shiwanni
804,175,231 *53667F05DC43A1D34767FDC56041E1B1F7F0C23A HOWLOOKOFTHESKY?
804,175,232 *5362E8371F711EA5AA1B20525E63F3A678B1142C huckepac5
804,175,233 *536E882A21112C8000F1EF586A0629F3CDC0AB1F huntermckinny
804,175,234 *536D8136BEE303122F795D9447038CF086F1259B HUT... HUT
804,175,235 *536D03AA93C6A2DCC50161358ED19AE6E7D3A4F5 SKOLEALDERSING
804,175,236 *53600037A26776E32D94F40991E954DA41683863 HYPERB0LA5
804,175,237 *536B296D4B3F95ACE0833432992EB758ABA3FB03 i3|i
804,175,238 *536EE9C69FA90C9198621F2B6304B8D1FB96DA08 IELFACHT9
804,175,239 *536FED0579D38DA1532D902FE6CAE5132C0983EF ILUVMILLIE52
804,175,240 *53691EFA10496711C239FA3B8EAAE75EC2FB38D7 srennaw9
804,175,241 *5360140D69451E4924C04DB2888DF13F5E24F360 STAALMEESTERS8
804,175,242 *536C57CDA55D79FE77471137ECFEC9F28C388023 statewide--s-t-ey1-t-w-ay2-d
804,175,243 *5363988355125855F96604CF7958F0C20428C314 STEVENSTONE93
804,175,244 *536C66CE0CB65B5837737CBDECFC6665F1D4AC25 steviepingree
804,175,245 *536DA28814864657E366262A8E9E395FFBE3B929 stewartdando
804,175,246 *536CEDB8A05423067D228183082688CFFCA92E4E Stick-Against-Stone
804,175,247 *53652E137F953D3A07124E19E1568239167ED1B5 stlouis#1/goodbye
804,175,248 *5360D5FDAD4FC846CAB20EAFE07337E00CC914A6 [email protected]
804,175,249 *53674911C43F7848A11BA13C1434C8D915637F8F jacksonboteilho
804,175,250 *536E0B488FBEF3FC6326BB6CD388DD60F37EF754 jackwitkowski
804,175,251 *5365DBF199ECD9D54ED21F9AB6B2FDA0FABFA7B0 JAMIEVOLBRECHT
804,175,252 *5368557EEB62D25B80458220F6F3652CBCE78A12 SUMONDEB
804,175,253 *5366FEA0437D0446970A216B393811203A0DA6DE [email protected]
804,175,254 *5364683CA69085C1B94B78251A78050C7809B877 SUSHANT4
804,175,255 *53677A5E364B6642C52CDDE1DEA4692B41E98F40 SUSUSANNAI
804,175,256 *536601CA8D713F47A4CA3CE80638DAE0F926C209 j-d8
804,175,257 *53682C8BF27A5746DA2FEB9F30E3C805EA28F3FD JEFF.VINT
804,175,258 *5369356EEB2ADFC8B27DF987EAE357CC25536A36 jenny.collison
804,175,259 *536902F0E4785D036347423CFEEDE3F688D289E8 SZRAWHCSING
804,175,260 *53691DE9D94116C7D56D3BFBBED7E46D9259E079 JERROD.LOGGINS
804,175,261 *536FF257BA3416ABB532C4DB0BFDF79FEAB1A733 TADCALLEJA
804,175,262 *536C27412431022F7830CC739E386A1EDD45788E TAETER5
804,175,263 *53655D6819A7BE32244C1814441BFD90434CC917 TAGSTERS8
804,175,264 *536478DBAB4F581F599039445293882CBAA30897 TAJEMNIC8
804,175,265 *5360DCB812D5D34B5C46EFE2B6E2E8E659EBBC77 [email protected]
804,175,266 *536496313DD6913CA7BCD2D5F5D1F7782ACBF3D4 [email protected]
804,175,267 *5369E13C5A1C400492B388118C5E18091E47B0FB TALKWAQO
804,175,268 *536CAF1CD3C85AE30E7973A2B5A91FDAFCCFD05B JIMENAMACKINTOSH
804,175,269 *53682F4ADA6C723DB5292572E9973D39E56B0575 JIZOBON01
804,175,270 *536BA0D7B5A7EEA4E2F704CABE907AE0249A4CD0 TANTALOS,.PELOPS
804,175,271 *53673FCC26631AADDB60398D26CCB820B394AF60 JOHN DEBERNARDO
804,175,272 *5364A2E29DDCB5D252A884D64618FED304A5B626 TECHNOBRIAN3
804,175,273 *536F4A48737B93D926EC4DEBC0B65D33E98446C4 TEDDYMOTL
804,175,274 *536837171F15A3EF5EB15DC6DE77DCA2B1199479 JONAHGOUTHIER
804,175,275 *536A9088D810DF76C7EDFF42DFAD024C88B930E1 tendaigandari
804,175,276 *5369C50C9FCED2309A603DEF2F9972922E24B584 TESTUDINENS
804,175,277 *53686B98E3E0E780A424912A84237C6B70B3B8C7 TEXAS_FM_437.SVG
804,175,278 *536546A15FCB359117205EA895429BF9DD1B43B1 THATBEOWULF30
804,175,279 *5367BC4DD8EBF77ABC2B77B3C110DC1AE5147A1C jonasdelange
804,175,280 *536918E8FA3E61DFE8D377F4DEFBEEDECF13B605 THATSQUASH55
804,175,281 *536403E81E93C1F1D720E7E0C3385E519F8450D8 jorge-alberto-perez
804,175,282 *53674EBE81D016E8EA03E477656EF0CF212C5E92 The.Conservation.of.Electric.Charge
804,175,283 *5361630EA0E4DA6828DEF2FF03AFEE5097F155D5 THEDOWNBEATS
804,175,284 *53628DD4C90BF162CD89E8DD9233C7E9C00210FD thephotoqwer
804,175,285 *5368E29B69FD73718E158C2D03E2C453EA576530 THEVONOT
804,175,286 *53685DA30CD96C70E142F900463770D0A99759D0 [email protected]
804,175,287 *536C8CF4A24869B71182D3720C683CEEE6FED60C [email protected]
804,175,288 *5363B800DBDF45FF126111DA41422CA6B70A94F7 TIME IS ON MY SIDE
804,175,289 *536420D4F28AE59AED74DA39A0FB01455DCFBC72 JUMP-/-DISRUPT
804,175,290 *536F63CCCF97F8681483D3ED80C38146657DC422 TOEGETAK8
804,175,291 *536B0EAE0EEC55F49B73117FA024DA5D0AE4CABB TOLOSAZ
804,175,292 *536D2CD3493DACD519E664006D141DECB5A76117 KARI.JOHANNESSEN
804,175,293 *5367462383B068872B8703571F0679E58439089A TOSCA:-ACT-I.-"VOI-CAVARADOSSI"
804,175,294 *5369DE6C84042E1913A0DF368588BAA4CA2685F0 KARMAFREE
804,175,295 *5363D903BACEC4D397605A8B37161387418A85B7 KELLY.SHINDLER
804,175,296 *53681D6820694BEF93CD79E0C29BEA964F2B4CF5 trentonhedges
804,175,297 *5368598BD503BCB9576BED1597B7F01810827277 KENTBLOODSWORTH
804,175,298 *536FF14BE29C451D228E489E426275A877788F94 TREVOR.TRUXLER
804,175,299 *536779D3F78E631FCF4558F5A0C728EF55C7F6B1 treycarriger
804,175,300 *5361C31A76517D123AEF9981CB35A9CB966A346E TRIARDHIYULIANTO
804,175,301 *5368BBBAD07B63222FDEE28C56A05418A504442B TRICCILLING
804,175,302 *536F01288F96807910F380F15C0DC17F7E35A990 TRISHA WESTLEY MIGNOT
804,175,303 *5362BCE5A26EEBC2483F6B2510A50C14B661561B TROENDERSKE6
804,175,304 *5366686C36E7606308D7FA1EBC41D0B518B02448 KIMSUKJA
804,175,305 *53670F9BA1277EBD4F68461CCE4EBC343B7DC3AC TRUMANHOLQUIN
804,175,306 *536EBA015D253D0ADE6B6E0114522256D0FDE3F5 TRW<
804,175,307 *536DF252B30B97F4A589626032E1DACD889EDAF0 KKOOZY
804,175,308 *53692A9D6E8EDF942F749CAD2E3EDA41C2FF562B TUCKERPACIFIC8
804,175,309 *5364171B89AEAC8628D626DE7F031AFA3123168E KOGOMBREZENN
804,175,310 *53621CAE9C989A8B26520127D0F573A4BA977154 KOPO25
804,175,311 *53615C29690C827A26FCFA3C0FB38AEA0B78AEE1 kqvazxk3
804,175,312 *5368C9541B863398B810B3E58F4F2267BBEC416A [email protected]
804,175,313 *53695E6114E10F97ECEA05DA7D8FAAA4D9B9FB95 TUVSHINJARGALDUURENJARGAL
804,175,314 *53669A52E6C30CE32A821057D4E62CE086DB6234 k'ww
804,175,315 *53637A8B6E285B105ABA94559DD0B6AE25A1E7B1 TYREE.BROUILLARD
804,175,316 *536CED1122F68F4F018D5FDC6B7B2F17E88E4DFD tyrence-glamores
804,175,317 *536D65851DFFC426EF8FB3CA769EC1D0688ED1CB LADYDOWN
804,175,318 *536FCA642404AC017DFA66BAB86BD7AD2EC8F269 LÁÌJALÈ
804,175,319 *5366A58773EE70997CF1D7F198B77669EE00F709 lamanjojs
804,175,320 *5368E903FB76C21D7049EB4AF8B7E8BCAC90D03B UFEGHCAN7
804,175,321 *5368B16E8FBB4EA95538CCBEE6A680C4EBD0B9FF UFOREDLEDE0
804,175,322 *5366984C086CD0BD275F76106CE15B82D7321BF2 UGLATOJING
804,175,323 *5366A7CA054ACC9525834145A26BCBD502C14FAF LANUS198616
804,175,324 *536F06C6D7ADABE69D8C91A94D936FCA60EB4631 LASTTIME(FEAT.FRANKELLRICH)
804,175,325 *53603045F75453774887ABF98DEF24E6DADDF3E9 lawerenceschoolcraft
804,175,326 *5365282DE5B0EF96F576F1AC440C8C44F22B3F4D undergroundskater123
804,175,327 *5364907141EB1B9D344CFE7512E926B627503D10 LE-CERVEAU
804,175,328 *536F288DE445254D8A17EF4BF5342325342B40A0 leon3744
804,175,329 *536330F47354BF3DD94C282C2BFA3449B80869C0 lesfieldhouse
804,175,330 *5367634F4560F94BF642ACBF7AABAA524A898907 [email protected]
804,175,331 *536C1D238949439833BD3E24E27EB82B3A6C3226 V127469
804,175,332 *5366412D0F6F52D986EF9245FCF2809101B665DD VACUITY.COMVACUITY
804,175,333 *536BE8AA9CF548964C4321C803991C04F654E82A lif
804,175,334 *536CAD63CA3A3C5A0868EB457DFE3670D5D7B9AB LISABETTLES
804,175,335 *536303F762980C2CB9A4F68BECF5CA9573D2A7B8 vernoncalija
804,175,336 *536B4A5E1FBD37331F78B352398697E12C6B8CDD veronicaemgeezysingh
804,175,337 *53639A34213DCA86C8F13A44552F8A65405B344F LONAHTE1
804,175,338 *5365F2B608A1D95783DD3566A5ACFAE79C440D2F viccarsing
804,175,339 *53646276FD31FA4266D30155E02ACEC6082AF9C5 love.theme.from.spartacus.(zero.7.mix)
804,175,340 *536D083E285A9BF0DE3E09F6888AE7E56F01BE23 loxioidesltrefgt
804,175,341 *536806A91B51A7CA73F77AAB63A54A4688E32C4B VIEDAEAENHAENED
804,175,342 *5362F9A7D44A61AB0D945DA8B6C8750D52D2624F LUCIANOBORSARI
804,175,343 *53625E72B53C56912EA62C5C2F76E65B456BF7AC luciorailes
804,175,344 *5367EE3985A13337F0B422F004A17A37A807F8C9 VINITA BHATNAGAR
804,175,345 *536EC32A5D59B391AF259E208F44387BE4D3FEC8 VIOLERANNO8
804,175,346 *536DF37CFE19A7F6CAF6CE2E914CDCA77B82AE57 lykz
804,175,347 *53646DD00505D55BA1F41415C982999B6BC771A6 [email protected][email protected]
804,175,348 *536FE6275624BD73F1C0FC11E830B547BD93C1AC VX#3
804,175,349 *53600C45B0B04558027C1C90F8390C1169F87891 VYMLUVNOSTI0
804,175,350 *5361D50354F4AE3152CC8391E16454F89ECBA2BE mainitsi9
804,175,351 *536AA7631FCB70103C28739AF35E5AAEEEC66B2F MALAGADERY
804,175,352 *5367B3E037029DD137EEF76E40A79D4D8E6BACF5 manfeazelle
804,175,353 *5362FC4D7AC671644C06814C4BAE9852290716B0 MANGE442
804,175,354 *53663A6E2FA4690F994EF2A2320C49AE61F74E06 manualwetherington
804,175,355 *536D875F473C02C1132403D49A34D248CF566EE4 MANUELROMAINE
804,175,356 *5364774567919195EB62E5DADDCFF53327C40989 [email protected]
804,175,357 *5360BEA7719BA975EFD12E39462C2B496698B821 [email protected]
804,175,358 *5362149841897DBBA01C138AD6E545AAA0F23D00 MARIANO.EBERSOL
804,175,359 *536A45C20AE2051A1D00C82353E60E9C62EAF653 watanabeshinichi
804,175,360 *53600279BE0761A23DEBC363328ACDCDFD5A500A WAYNE RINGELBERG
804,175,361 *536E22679CB355BC2CE96018A9B23C0CE8FE2CC5 marshallautery
804,175,362 *53605A340FE25A92700728F31CB5A7DE87EB24CB WENDELL.WAYMAN
804,175,363 *536A2BB65E6FCA2B2FE26F0ABCC94824096D7CF5 MASONDUERKOP
804,175,364 *536D11BEB89B4970D5AC7FAE9828A278CAC64005 [email protected]
804,175,365 *53631F3EA8A1BC3FC7C15904492C59E9EBE900B6 [email protected]
804,175,366 *536446E8BD63435EF44FD2B271EA41465408C658 matthew.homan
804,175,367 *536EBFC42C9857B4B4DE6B7E5E39840BDA37C7DF [email protected]
804,175,368 *5368AA9495FD7D0475E1659B39F6730288804D37 MAXPLANK8
804,175,369 *5366B3A6A743F753B90215D21952CDEC406AED6B WHEELOFTIME(FUTURE-CLUBMIX)
804,175,370 *536D8E2BBC8F337B4E0F32B8C95FB10308516CF0 whs7
804,175,371 *5368B5EBF3F2E391A2708D7EC422420EAFABAF70 WILEYMUGGEO
804,175,372 *5361D462252CF2950D40F1E003E47BA7726B4501 willardtevlin
804,175,373 *536084E6DE165281DA8472C2BF027399967CB254 williams-betty
804,175,374 *53696FB8B60C41AEFCA51DB3C16F85F07D080612 MESOPHL1
804,175,375 *536B1A1C93705CA4255A831BFA328067DA8CD17E METAJODOBENZYLOGUANIDYNĘ
804,175,376 *53660EC69CC11A074B3CE1036ABE0C4C421EB03B METALFROMHELL(VERSIONB)
804,175,377 *536ECA96419E843054D0AC73E47D5758D57B6C2C michaelnewland
804,175,378 *5363DC8A96A70DB784C8A05CF2A9BA8E641D9A4B micheleceltics
804,175,379 *536BC309E467514BD756EBA2ADD83A2BD18F9264 wolves<
804,175,380 *536998BFEAD6060C7875C78C236B20C05B0AFDF3 milespadalecki
804,175,381 *53688E617CE2A2610E65EE8BCE5D2AFDA501E441 mind-fuck
804,175,382 *53689F2A223B388398E43EAF71E150FE684409A5 WWW.COTIS.ORG.UK
804,175,383 *536557EA62E6515462DEB943ABE98185C6CEC942 WWW.CUPCAKEACTIVIST.COM
804,175,384 *53629605CC38259AD490EAD6A081D02B0478FEB9 WWW.MEMOIRTATTOO.COM
804,175,385 *5365761C7FEB4A22BA0F95A151E2EA3A00021A2B mixmag live volume 15: jumping jack frost & randall
804,175,386 *5360DC55FE99016272FEC3F6555CE9C64124A97E [email protected]
804,175,387 *5365E1F93A389A2A12B8D4D0E3AC1E8285665A60 mohammeddeschamp
804,175,388 *53622EA28167641BA9ECE885A617C69E96F24516 MOHAMMED.ODOM
804,175,389 *536CCE6E98CA542A3EA8FDBF0F07970489A8B211 MOISES.RANGER
804,175,390 *53643446706D08A073DC3851127CD40A56D5BDCA [email protected]
804,175,391 *536F445821EF74AAA45081D6ADF319F7CFE06F58 [email protected]
804,175,392 *536BADE56ABB8A5DD5E15C5FBFE47082E81F2C34 MORTONSTOUDEMIRE
804,175,393 *536BAC358E3186692D85FF71B46E40AAD4B8E41F MOSAIC.NOEL.6.'...WHICH.IS.CHRIST.THE.LORD.'
804,175,394 *5362730CEABEFEC0F732B710D61919BC4908F710 mottats
804,175,395 *536584215DAB9D53B132A7BFA427546C9806FD61 YADSIDIGI
804,175,396 *53667422F7AF004662DDCD7107752CEF694985DC [email protected]
804,175,397 *536973EBAB3E5C4DFCB2178ED1FCE927BF21BB86 muyiniku
804,175,398 *536A54EA0D448511C9956C771037BEDFB140EBF1 mya1924
804,175,399 *5360A69F63687F7B98F72F62EFFB26881C7086A6 N19= SET %LIST.PROT $?="PROTECTION LIST (ON/OFF):"
804,175,400 *536C199B299608BF1AB28B57C23E32E2072AB5CA yaowalakgibbons
804,175,401 *5366AF9AE2D8A69FF8698B1D90A9FDC62B3C2ABC [email protected]
804,175,402 *5364B85BAF657AF3C432C2E9787C6A7D7C8B3D4D YELENABEDUNKEVICH
804,175,403 *53619CC51BF57BACBA0234EC78EE75C472C5493C YNXGTS
804,175,404 *536E2E08C073F8AA30497B489BA70D9EA3C6000C NEGNILRETSIUD
804,175,405 *53696E8D19CE9E0C4B9D33F7A4E453EA7E4F88E8 NELSONKREINES
804,175,406 *536F1E65E7C681AF60BFED41DD7C6F140716039D NETYCILYING
804,175,407 *53609C575739B995F8DD91F474E799BFF0ABBEC5 nick-birnbaum
804,175,408 *536340C557BBBDC09DACB6A4BA04CD7DCCECD706 NICKOLAS.LEWANDOWSKY
804,175,409 *53686B22CEC86ABE35DEC7DDF210309A556E2674 nickybeberwyk
804,175,410 *53645FC9B8398A854FB02F6C4934B545BA7C99BE NICKYLATASSA
804,175,411 *5364F48AAD37D58E55B058EB634B093A2A3AC03E YULIA.DEWI.ANGGRENI
804,175,412 *53690EDFE6AFD01EB0FCECE100DC482C54ACFA35 YVIRSTÝRIMAÐUR
804,175,413 *53690E8BAF6AD2642B792F1B6CB63EBCF019F008 nilbymouth
804,175,414 *53688509D6931BCC2F9BDE78AC16D7A1D42DCC25 nobe1!$t
804,175,415 *536100EA12EE7FCC8BB7A19926CDEFDD620A8314 [email protected]
804,175,416 *53625DFD83C9D73FE4FF904111B4CA9B59DF5C4A [email protected]
804,175,417 *53634525F6A833A01A09896B49BEB50B117A6412 ntp是其中一個最舊的網絡協議仍在被使用(在
804,175,418 *536E0EA3FDF3975A232E248B45D5470A78DB5649 [email protected]
804,175,419 *536A31AE4C017C19DA9A2744A0541A3FD9E55B33 O%*3
804,175,420 *53672E6ACDB48C4A576C1C9B2DA5831D952368CF }O{`(-----8
804,175,421 *536FFE55E1708C060E73D25D99379BD35B1A4C2A μεβλεβήδεσ
804,175,422 *536E333DE68D871CCBB9FA2BDA87EA2C6BF55149 загидуллина
804,175,423 *5364EBB052E756825B7BD9F217CD25CDB09AE82D onaputs8
804,175,424 *536383A3FC41B5A57F4058FE2EB15C4B739D449C )o([email protected]###p
804,175,425 *5369F67158AC613140A05A4F1F74B76768B0C3F4 oophoro3
804,175,426 *536162CF799A0AAAF079309561920998A84D4B61 OVERNACK8
804,175,427 *5366B9CB3EEFB645BDC3C5624E1379AC9EF0B8C3 ЭРАВИКУЛАМ
804,175,428 *5360F29440AF366A4014F508D7C8080417DA1E4D pärsiale
804,175,429 *5367B743480AAD1DBC600687E29F8E8C586DC0C1 停靠在南祥站內供乘客上下車的DR2510柴油客車
804,175,430 *5368589132657B269EBC370BB0F716A17B38AC1E paulrymasz
804,175,431 *536E3E68B041F0813E0491D113AA3FA5024F9A59 PAYLIDHSING
804,175,432 *536B60819458CF15983DA7A1C5B335402274AA27 phono'f/ou/n/ou/
804,175,433 *536B001EA8EF3A6D17514EC5BBB3CAFE0BBAC8F9 PHYCHOLOGUE
804,175,434 *536138A4DA973D3BDAAFD929BBD29F74E767BDCF PIESNERING
804,175,435 *536B5C3E444E13FD2AB1C95DBD742750BFDED347 P=====).~O)8(
804,175,436 *536F7B43D036FCE0FCC8995E22584A54FEBB91ED PR0MU1GH1
804,175,437 *536AC540CEEC43D76539A407CAE7F574B63DAE61 PRATANDES
804,175,438 *536B24C450B0504C31E4E858A619EDF76D929C49 PRESVU
804,175,439 *536C297C96FB5F016D6E8DA6624E2373C40D6192 PSAUME XVIII COELI ENARRANT, OP 42 - 06 - QUATUOR
804,175,440 *536F16FEB6E645FBDA5C63B7BFAD0C49EBE46D14 00/0158Elec.Melo.Perc.
804,175,441 *536D6F605A1648B840A3F364F9545060AA1EF22F q#P*-*-*-}8{
804,175,442 *5366D7CE9A86917724F5EBA324E0349AEAEE39F5 QQG[
804,175,443 *5365DEC1BB37E7EFFFABC1156307F2902FA04754 r47i0ns
804,175,444 *536F48B0C587A26F56CF7E05182DE115DC420FF3 RAICHL
804,175,445 *5360B6410A22BD343311B36C9AC79E33110F5333 RALEIGHHINDMARSH
804,175,446 *5366A7D8539EC9F8C8548115354B761E8C6426E0 RALPH.KIESSER
804,175,447 *536323D36F0BA6077F1210447C2754649E968E1E RANDALNESSEL
804,175,448 *536DC7B1278ED030E2892510E2CC198FFE66019C 1422331 kyseinen-tutkimus-mahdollistaa-toimeksiantajaa-ymm
804,175,449 *53618AB20C3F320027E78C206EC2360F416110B0 14696 insanlarinruhuvebeynidahadayaraticibirhalegelir
804,175,450 *5364556DAC0C8EBA3A1473F958741AD520C37555 1477025 GESTERN-HATTE-ICH-BESUCH-VON-MEINEN-ENKELKINDERN-.
804,175,451 *536BE57A6B3B0CBE98F5E993138A9F3AF824386E 15camren
804,175,452 *536BA4784E7CF3E8C118B2BDF7D95DFC856BB5C2 RAYFORDRIMI
804,175,453 *53623DF6401E802C35B3C4CF6B995645609FE457 RAYMONDIGHERE
804,175,454 *536E591990B9215AE459752290409F5C632D2ED0 [email protected]
804,175,455 *536AD4F6589458303918A86803D9485A186EE188 razor-shaped'r/eI/z/@/r_/S//eI/pt
804,175,456 *5366940035A25E3F3987312ABE4D9017F1092CE6 r_bs
804,175,457 *53621A691597458A1343229F7044D7A7040590CF REARREST
804,175,458 *536FF0523C1217EF754FEE9E89B3EBD0176C7548 17-easdaq
804,175,459 *53600F5BFCCD28D9ECA1948F4E24857AD797C6DB 184189 INSOWEIT-IST-JETZT-DIE-ZEIT-DAZU-
804,175,460 *53641E1F33B6854A660D168E23A45C66881A6CEC 188261 yasa-karSIsInda-kimler-sorumludur-?
804,175,461 *536E8D25908C58E3444A9F9CA3877F99C88ED6CE reflectionswithmiddledistancegreatmarkbelger
804,175,462 *536D0E75C96B7F001FBF41F6F0D0D7BB4254FE93 REI7ER47ION5
804,175,463 *5369557F423543153FD8D2696368503469B41119 RENEBUCKLES
804,175,464 *536F886F47A7BC104A34DF3E5B75D9D5A85452E2 1.AUROILLA
804,175,465 *5368E0414045767EB00A704950D4B123A6FBEC12 REOPRETTELSESDATO3
804,175,466 *5367D9E6D049902A6ACB64E69EDD8AE3D3471063 repelans
804,175,467 *5369E318D99CBDF99CB69957F48FABD7FA4B6BC2 1 DIEJUVDK-ORTSGRUPPE
804,175,468 *5365D6B66D5E2A25E67DEA3D47EFD0608A799018 1.diht-chefs
804,175,469 *53681E2BB253EAE78EF9B8E04A52C1ED3EC0BCAC 1EINMAL-IM-JAHR-KIRCHGAENGER
804,175,470 *53654326D7808F75DE0FCD680B601BAD6FF2AF8B rf-induced
804,175,471 *5363F9E68AC3719C2D6A790B0C62B503373E8031 RICHARDABRAMS
804,175,472 *5366DF60C144B318B2106D3E5A19B6DBF95D8DD4 1HISTORY-MAYBE
804,175,473 *536D0C21E92E77424CDBD1B882E500880D6F3F0D 1HOCHKLASSISCHE
804,175,474 *53674724AB472BC1A1C4B1847974DBFB030DACDE 1.HUHUTA
804,175,475 *536685CD423808418244616532AD8C7C5F1AA661 1iluvloveyou3
804,175,476 *5366921BD3E8BD0D8859968DF22AD2448BB8CF06 rigobertoadloff
804,175,477 *536055E1EF137EAD552A123AA5560AF5FE2306F9 1JANUARY1938
804,175,478 *536C7F523951107461E48A4195AF99849BB62804 RODNEYDURETT
804,175,479 *5369CB2A743E4DF0C9840508113C741762776300 ROMAN.SABO
804,175,480 *536C05544232D91E0BC1A7ACEF0DA8ABE55A5855 ROMEO.BERNA
804,175,481 *536E6678DB96E2411403D4307731C741B3F5C540 1-NATO-LUFTUNTERSTUETZUNG
804,175,482 *536A0F193D754C12695BBE490499130DC7F51383 1;o
804,175,483 *5369A16CC17631D3C9606785AD7E9F2AD0845ECB ROSENDOTAYLER
804,175,484 *53607C6360A4F8A9548C7186FD0915C8718ADBA1 1.REHUNJAKOON
804,175,485 *53645E6D6ABC2415A1434E7E3D807EF3B500FC5A ROWENA'S THEME (FROM THE FILM 'CAPTIVE')
804,175,486 *53697E38C3092720E6CBAF14C5540DA0C56470CF royalgold(30secondversion)
804,175,487 *536CE52BF81320E9E2BA4780E7BDA3CD4122F9B5 ROZEŚMIAŁA
804,175,488 *5363D29D2FBF9FA2BCA737A38031102DC5ED7BCC 1selvityspyynt
804,175,489 *53687E6E426F3AF9394BB40FFFFD96F78CD7AB4A 1.SEPARATISTENSTUETZPUNKT
804,175,490 *536D19B6ACAE1DEF4C6BF349A4471D194399DC1D 1SOTAREISSUNSA
804,175,491 *536C5161023E3D8BDE7966A114B36C1CA6AEC22F 1 SOW-THISTLE
804,175,492 *536506771340BA559104EA327492B1A23A5A5EE5 RSFSR370
804,175,493 *536EB06240816B49A0C696B276F97A354C296B33 1stasiaufzeichnungen
804,175,494 *5363EB7C93B0C1E36B019A4CE061C2EC1687B149 1-trainings-hilfsmittel
804,175,495 *53672D75CC4A04EA24282837974CE8E9297BC333 RUMESSENCE
804,175,496 *536EF2F75A0202E1B42A696FFA27F0972E3D7FE9 RUPERTFRUMKIN
804,175,497 *53682C86DA76651E1F7C6993DFAF37DE8A465008 RUSTYCELTICS8
804,175,498 *536E78134EB8D10FC9387C54170FB9A29FC9F294 RWIP1234
804,175,499 *5360C419A6FB528BDB48BF5A51B1C0E76D1B24F8 ryankendig
804,175,500 *5369D6DE7C200137D6CFA6CFE4C8827470E9D137 20-GRATISAKTIEN
804,175,501 *536D4BEFD00F9DBDD2AE49FE0A3C1A8DD3D28C77 SAMMIE#7
804,175,502 *53675337962EB4733140F2920FB9C798EAFD99CD 21aug1367
804,175,503 *5366C59253E521F58F3C309378EB6B2293B1388B SAMUELMUSTO
804,175,504 *536BB14E154701C9AA401B26F633882E80486446 22.AVERBUKH
804,175,505 *5364406A28D69610FAB8351852DABD35B5D32F9F 2: 2 # & PHOTOOFFSET
804,175,506 *536F8EA05FA2250EE4E4D2248F0C51C0A52CF0F9 SANFERNANDOMORAZAN
804,175,507 *536F61622D7EC8A062157DA9B07FAE40EDBA9F89 sangmacmanus
804,175,508 *536B9E28EC1677DBA985F0555108817D17FE03E0 SANKURA1
804,175,509 *536B4FBC66E2648AF7C1C39DC33AAEF979F0011E 2340368 BLACKS-MADE-UP-51-PERCENT-,-WHITES-35-PERCENT-.
804,175,510 *5366075DDEC950438CD8D314F145E6E57FE3E328 2460133 JUMALAN SANA , RAAMATTU , ON TOTUUS ( JOH 17:17 )
804,175,511 *53658EF1C5515D0F730B526B2F50DCFDAC073238 SATINIERTET
804,175,512 *536501673CEF8B0BFE7B895D6FA6AA488ACE795A seanandsandra2002
804,175,513 *5362B95A3B69BF4A228496458A495D293FD6A43D SEPTEMBER1919:THELOSS
804,175,514 *536E2B2116ABB81DE25213FE98BF5E627A5765BE SHELTON.SCHULWEIS
804,175,515 *536A589FE69CCE3DABF746228C9068189CC99C54 SHEMOZZLE9
804,175,516 *536417D50A3FABECE1AB437AB5F54916CB266258 SHIRLEYEBINGER
804,175,517 *536604C0662875DE9480606CAE264D8F5C22C983 2-eristykselle
804,175,518 *536EC884D208FE7B3ED8BBA5367324CE43AA1CE7 SHOOTING.78
804,175,519 *536A800A630B038EFD19474E557D54A7ED4C0F1E SIDNEY.HASLIP
804,175,520 *5366F996D932982C7031DD58A7C4D44C6012DEF0 sieshlkipe
804,175,521 *536EDCBA18EF764DA1FD144E838754582E32A41D 2NEKEWPOT
804,175,522 *53680922879FB45711996EF837FF6A56ECFF2BF5 2.ollikainen-kilkki
804,175,523 *53653EA26EF0A503C611C0AF328A36D02D9FEC06 2-PARALYMPIAKOMITEAN
804,175,524 *536BF44A873B2A967442AD30E6C772F784894C32 2POTAGIE
804,175,525 *536435A474919DE4D97652E76857B796746A1F1E SINUSSINUS3
804,175,526 *536FAD3ABF26879C974A7705E87D10B3DE7867E9 2SHORROCK
804,175,527 *536E3C6863134C9C50CDAA62345C73C7F48C311E [email protected]
804,175,528 *536DB9A0AA55BE7E91B718CE641C219CFA4C5DC8 30FEB1976
804,175,529 *5366317B14992DCF87D996376696F2CE89F7608A 329 COHN
804,175,530 *5361E9B0C187C1BF148D203D6745C8C6E16974FA SLOUŽITJAKO
804,175,531 *536AA3C634DA3679D70C07931B6A1D23D06C988F SNOGANS0
804,175,532 *536B8E44251E03965897D9861A0E72FD04DFC68F [email protected]
804,175,533 *536E2D4618CD4CB1B9DFD196AA53D4BDE0FE26D2 3iluvchicago
804,175,534 *536807E66962627D397DA974FBF791BAC5D2202D 3-vuorostamme
804,175,535 *5363811A131DA905B1C97A2203FC47DEB971A052 40.roemisch-katholischen
804,175,536 *536F8064545C4D9BAD1B62F5FF6C639CC31CA8E2 45LORELEI
804,175,537 *53691F408CD0477790033AD43EC8FC6FC59B3146 4LAKERSPRINCESS
804,175,538 *536404230C85EFEB064BB72B44673B217AAFB969 [email protected]==B
804,175,539 *536840BF849E1EF47F2E31F9B2B1C3BF912E9560 4RJUNM0B1L3R4P1D
804,175,540 *536544663873070B1B45C5EF6EC0E98AD15AE706 4SANCHINBSW
804,175,541 *5369A1DE3D9D971C55DCEE57EA5F6457F1C66346 4SIMPATIZADORNESS
804,175,542 *536B73A28BC3BD2699501BB1E8AF603B71B8FD91 SPY.A-GO-GO.E
804,175,543 *5361DB12D3109718C9C4B7B01D09B95DA6EECC77 )S,SCES,EMITPMET%(ECALPER$-EMITPMET%-TES
804,175,544 *5367C5EABDF2D25D7858A268047F9121693C05E3 586613 tanner.otti.vastuun.tapahtumasta.niskoilleen..
804,175,545 *5368458DF6DD960242CF7DDA636C91F9EB33977B stacymanos
804,175,546 *53696F40C2EA07BDDC6643265F0A363F1DEFE291 STADSGRACHTS
804,175,547 *5369F5739A49C8F402443045AE99D0BA7801939F stanfordaltier
804,175,548 *5364B3D4C21C7DC3D3B57A36FAC355D7962A37BA STANLEYCASEY9
804,175,549 *536CD01C6DAB92DB456223CCBECEA45DC53B5705 5CYNTHIAREALITY
804,175,550 *53669F58A0A7B449F808F7A71610DE94EBC0B3E2 5dupuis123
804,175,551 *536B299671BD32EE28530256B5A3C6662241BDEE STEPHAN.E.KONEN
804,175,552 *53634B75A58159671979F15A91B34FE0D8D4D18F 5HENRYETOILE
804,175,553 *536D067CA13E19DF553637CC146C37B2445B9862 5-IHMISSUHDETY
804,175,554 *5366307FF5FA0174D414C45E54515539BD93BAC4 5ILASYLOP
804,175,555 *536DA7F7157DB3B4414524A460B3E365B8D1B3DD STEVENHAGENBROK
804,175,556 *5366D9AA3CF80EC850C22E7AC444391BD3FCB133 5MERLINCHARLOTT
804,175,557 *536550A88BF2663A1AFDCBC4D36832D4C4CC23D1 5MYKIWI6
804,175,558 *536AED61A904F11D5A941BD85F68986A8ADC66D7 strasic
804,175,559 *5369AC01BD5E4D1056035DDD8E1FD86DD24E5968 5r493nt1n4
804,175,560 *536E543914B25B659741131D91DEFECBC720EA1E 5.SHOCKING
804,175,561 *536715CA461AC8E3AE41041DA083B01875D18B42 SUGARALLIE
804,175,562 *5364D11679EF716EEE2D529B53AD7F6CF845CE0A 5ULTRAMICROCHEMISTN
804,175,563 *53678D95AA7C7B6F322142F897244D99635E34F4 surfin'.mosquito
804,175,564 *536519E9D197FCC23E160CE7FAA1F8FC694B9350 SYLVIA-PELICULA-DE
804,175,565 *536DE579147CA6CF2DB54FBEA49BB3CE051C9259 symphony-no.-3-in-d-minor:-i.-kraftig.-entschieden
804,175,566 *536B7B78EDCA872B4DBAA00BC8596A18A0289833 «TABURETE»
804,175,567 *53680B160C82E4F15ACCEA2E70067BE4C5100640 TAHTOIPA8
804,175,568 *5360B76D969FB78F708ED3A0C128C65C81290090 tambomachay
804,175,569 *5368717C9FF9DD2D518B7B78F3AAD01CDAA3B398 TAURUSBLUEBIRD2
804,175,570 *5367F9BD04FB9E4E6AF142002E304B10C3893639 6BSWAVERAGEE
804,175,571 *536EBA761E5738B742A03EEFE72670782C24EDA6 6CHAUMBERS
804,175,572 *536B34E46536048AD1A05CB46C4A8068176FCA20 TEGNFLGEKNUDENS3
804,175,573 *536F645ECF4B771D033411D2DC68FAA6EF5A980B 6ETERMEDIAS
804,175,574 *53696CCECEEF1AEFA54070FD6B70563100CA6FAA 6FLOWERSROBINHOO
804,175,575 *5369FF6357A41F7EEAA6AE19C6F1BB31FD8E00E4 TEODOROHASBROUCK
804,175,576 *5365691C724686B3F60E6CC9EF4D7FB05B6AB333 terrancekrakauer
804,175,577 *536FC1AE6285E43E08F44359C9E9DFD8C56CBC80 TERRI.TORCHIA
804,175,578 *5366F44D5F18D592123637070E4A0ABDC7F7FDBD 6ILOVEREDFISH8
804,175,579 *5363706D17E59A7CB59A09D4ABD57541472D7463 thatcasio47
804,175,580 *536ABE0B047A31A9173559A7B3046C7F39CFCD57 6RRENERAI
804,175,581 *536C35A41378AF43E5B9C13BB431396AB1150661 6TRITURE
804,175,582 *536AE7B057951D70FD6CF23CB8728FC0D974FC07 themistocles2
804,175,583 *536DFCF460DD2871EAEA5D4865BE73959F473DA3 These.Aren't.Mistakes
804,175,584 *536AEA280614465422458D93F1A58BA81B9FB1EA 7BEAREXCEPT
804,175,585 *536C64B8F3E1E6E6245488B811156F331AB2EB3E 7FERIARI
804,175,586 *5369C306072B8F684324BCE46BC80173EAB084A4 7fwgkoalition
804,175,587 *536259E9DEA5C323039D73A4A632777F61449E9E THYPHAM0
804,175,588 *536691480962AF99501D334E4968ED337CCBF658 7ILUVCOKE8
804,175,589 *5362D89E25BD21711613496644BF10BE59038B01 Timehunter(disc3)
804,175,590 *536D99A626DC4D90F423AF0176EE6B0D1244C4B5 7MIDDAGSMATEN
804,175,591 *536B00C6C5553D36C302877F4ABD120BFF540665 TINJAUN
804,175,592 *5366DE882289D147814335A4FFDD0BCB9CF11A58 TKYRTREDNU9
804,175,593 *5360314B73801D50F9401DC8A30ED03FF19327AE [email protected]
804,175,594 *53660711E7F07ACC596D66C6AAAE4F32A5FED245 7PEYNTURE
804,175,595 *536D00C455CECBEAFA6044234BA99FCE216A0673 [email protected]@L!Z3D
804,175,596 *536C84215DC8395A9F91984D1E92835CBB0FA8C5 TOILETTASKER4
804,175,597 *536EE7D6BB976C7FEC1D75F037498841412CAD2F 8###)~.`.(-_0)
804,175,598 *536EEBFE72B45F5CC905C5AF1A0552378B658361 81932 yUrUtUm.zamanI.,.bellek.ayrIlmasI..
804,175,599 *5367CDC134BA244B18B199803B7ED40A1A8315D8 TOMMY.AMO
804,175,600 *5361045B0AAA4251C7538B911569B791EB1913C4 tomoyo
804,175,601 *5366A5BDF4A2440CB8B2AB02BEFE28089356B18B TONYVASTAKIS
804,175,602 *536E695313D4E9191D519749551DA0CE8D68517D 898412 MIKROTIETOKONETTAVOIK
804,175,603 *536111E5154B3677D6B3D9BC7098653F0BD5D893 8AGGREVE
804,175,604 *536859A7B77D6178955C0B8107A632F3278A6B24 8alm35+
804,175,605 *5368D3B591425CADB4060E14760803771AED7FD3 8ASAUKOY
804,175,606 *536CADF7BA9CDE8828A67BF12D1A2C1D00CA49BE 8--> ~>-b0
804,175,607 *5366CF9C5A0669EF771E73B43767441DD1E0FEE4 8BSWUEBERRASCHTBSW
804,175,608 *536CC2085C97B4755A34D79C6876B0F49800A013 8ESUOHEEFFOC
804,175,609 *536DD3ED8E532840169EB7BEDE055EBC9EB25BE0 [email protected]
804,175,610 *5369C45B8E6563399190AB1A05D290F0A08F2FA0 TRAPPERS.7
804,175,611 *536C3D4FD8495768551E25384F7F43FC7824E8D7 TRAVERSEDS5
804,175,612 *536E27D709C788FFA912B83312E3C9DA9CE031A8 TRAVISTYER
804,175,613 *536F8CB1F1AE977EF0F6E2D78733B450FF82870B 8JEFFHBSW
804,175,614 *53661CD785E9DC0289FB58A0EF85D932272EABAE 8NOTUSEDSMILES
804,175,615 *5363BFEF28E60000827F605BD54594DB93C33A1C [email protected]~osploit
804,175,616 *536E4C3DA9509834DA9D904EEA037421513480CD truelle1
804,175,617 *536BDD5137DEF99098719D524AE6F0EAFB714697 tsilacitcarp
804,175,618 *536A521765CF010145DBACF347B433E553ABC212 TUAREG GIRLS
804,175,619 *536E9EBF43FE2FF236CE82BED3AF91B4429947B0 TURBUTS6
804,175,620 *5360F6B3A1E727124FE5F91690B4DE38D32E551E TYRON.HINDALL
804,175,621 *536147C8E95900BC515698FDC587FB3ED82BB5EB TYRRELL-BIGGERS
804,175,622 *53612F3F75F22C1101E9D84BBB54BD0E514D7523 TYUIOP098
804,175,623 *53674F9C5687AE79BB63516507DE2FD04D06CDD5 9COOLWHATEVER
804,175,624 *536E5D7B1D5059035B5DFC0A3C69498F0ECC740A UDDNPWX4
804,175,625 *536BBF9E21C035484FA05EECC06F2F57F528B73B UITGEKNAAGDS
804,175,626 *5365D3A90C81815AD132C9D37BA7C2ECCA8B26A6 UNDWARFED
804,175,627 *53661ACB26DC24017055998FA87A4E83BB9D3FD1 unforgiven2
804,175,628 *536D00D030E5914440F304AFA0719C76EC99D14F 9MOCLOABBWJESUSLLEWCIRE
804,175,629 *536974D8F34C4B5304F9F0EA50A52A3208BEDB1A 9MUNATES
804,175,630 *536DB51E7727995F77F30E1B42FA3CE60E9FE13A UNSERTEYNING
804,175,631 *5369384A29C5A791D8402CFAA6A994F43B192E96 URONJENI0
804,175,632 *536407801ED187BE88CCD671C4D337ECBF2F3850 9TIMESPENTBSW
804,175,633 *536C910527BB6371406909F74799ADE3EAF8A935 USIGE1IG
804,175,634 *536D99B9515235C8C2BA97796D50F0869805199F a-:
804,175,635 *536D91DDD7854358408630CCC1311449C2C96849 A)22J
804,175,636 *536F169ED6717B15797E7D23D05E53FAEDFBA193 A3%Q
804,175,637 *536A5637274554F60559164E6D34F4312D855A51 aae%6n
804,175,638 *536A7A56F006A5BB7FB9CA02A2FC6A85517FECB9 AAPTBSW6
804,175,639 *53616909CFA321A59652E659676516E3BE5B434B ABCDEFGSTUPID7
804,175,640 *5365658A67594ED3DC22B86E58D3091D925E951E ABEPERKINS
804,175,641 *53672F76127FDB8FB6FE2B29A48B8662ED0EDE1D AB;OD
804,175,642 *5368F30AD45D712566DB9D508F6141B8C0FF6C0C act3,scene1r
804,175,643 *5367F22F535B4BF69043F95BA7C6D0C8828EA69A ADDTD
804,175,644 *536A21F9DD3470651246B16EC94DC657A0B10FDE vinvises1
804,175,645 *5360998B24369C3C0896178D82E10641509E13AF VNDECENCY5
804,175,646 *536ADA3246A9992571857893BDFABAE774B027E3 AHMETKOCA
804,175,647 *536DE5F0C83AB0704FB5A1CF71E280973562E9D6 AJ"O
804,175,648 *536070F7542096CE59A0D2AE43596B50BAC5CEA9 waldoletourneaux
804,175,649 *5368D711D38FC5025C25396AC08F1B6217248637 waleed.m.hablain
804,175,650 *5364BB65C235BA56131A0A88A5676A5A026390F1 WALLEYEMATRIXED
804,175,651 *536C28257C678073EA3081E160213141E27E007B [email protected]
804,175,652 *5363B0745481B6B31AD40A21D92BB0AC7F43C679 ALEXIS-HAMPTON
804,175,653 *5364D786CAE059B99FA58B8F19FD684F866F446E ALFONSO.ZECHES
804,175,654 *536090D05657EFE4F94D6C03274BCED1A76E9D80 [email protected]
804,175,655 *5360B65030E2404DCD70EACCA17844B578B1E64D WARRIORSNAPPLE6
804,175,656 *53650647948FF6138F11F327E65451ECF6259476 WARTERN1234
804,175,657 *53664D8814B72C01B0595661A06C52C91E8EDEDA A"L+K
804,175,658 *536BE029CC4D45578203A1179D60F59552B6BC26 ALOUI-AHMED
804,175,659 *5369EA43BC248A4425189731789A870E409CFE10 [email protected]
804,175,660 *5368F94222E3125FB42076943041091D5F4977CB A?LRS
804,175,661 *5368912A489BAB77652AF45D93DE0B0F97DAE6E9 alvarana
804,175,662 *536CDEB904B842DD700CB7AC5DC581EB246FB928 AMBROSEOSTEN
804,175,663 *53649EA70C72E4039040479E258444698691572A WHAT'STHATUNDERTHEBLANKET?
804,175,664 *536432D46D1140A21A0C190D911C2B2DFB5C4E62 ANACELIAB
804,175,665 *536F396FFFE85178A3867ECE7DC6E45AD2C81DE3 ANDREADARVIN
804,175,666 *5369923E1D23F8075F2EB3C7F827725C28B235CA WILFORDLUKIN
804,175,667 *536940136812419B144F4784D54223061C9C3AAE WILFREDOMCKEVER
804,175,668 *53624DCD60C2ED40EB181F83AC9086D19C41AE8B WILLIAMJUANPHILLIPS
804,175,669 *5364679324F4E3BFCD24AC7515039D1B3F8FE0FF winfredfenton
804,175,670 *53623A253FEA82A7E1B013677F694563563611A3 ANTHOGRAPTUS
804,175,671 *536D65B67F19BB3E2F49D2E7E2928A97F4C2382C [email protected]
804,175,672 *5366C141A8EC18CFB30894E66D6E8B13F9077722 aog)w
804,175,673 *53607E9CB2AAD0F01C3EAECB74ECABEA36CB4C8A a)o:n
804,175,674 *536A53E1631EFB66EF9DF7F99BA05CB58D52D69B ap=1s
804,175,675 *536145F9C1080751DF741B49FCA39949134BFB62 WWW.PLAINSALLAMERICAN.COM
804,175,676 *536DBBE4EF6FD68D74DABABC59AA53EC8858CBA0 WWW.STREAM.TCP.NOWAIT.NOBODY./ETC/TCPD./BIN/NC.-W.3.REALWWW.80
804,175,677 *5364C7CAA69446768503C242222A8B46DDEA7B01 a"p,h
804,175,678 *536452E93B20C1F2C8F37FFD1AA7A49573039F2F xavierform
804,175,679 *536C87ECF4E72BBE5B44838B5C3C1E321B2ABED6 aqs%f
804,175,680 *5368E1CA52F33A68A9C4BC1A0AAA4F40D3CB38C6 [email protected]
804,175,681 *53673C070EB4283F5D8753837B1116C683976392 XUB5
804,175,682 *536C2BFC2825DB8D740389BA1F772214BBEB3C66 arthurstadtlander
804,175,683 *5367829CE55B0B2719C209E90A860C5D1F4F3AD6 ARTOTARKKONEN
804,175,684 *5363AB62E51B5C86CAA3A8E2F2B9F2E46C4D5D91 YANG-G
804,175,685 *536977370D0F433BC96D30202E69B4C89DECFB34 askof
804,175,686 *536CF3ABF1C74BDE5B03B3BD9A19CB6B928A4FEA A.TIME.FOR.US.(LOVE.THEME.FROM.ROMEO.&.JULIET)
804,175,687 *5363EA54EB7E571296BB281C022F64F9A32B66E8 YIELDASSENTRECEIVED1
804,175,688 *53679F79EDFD447C0C32C4FDD39FAF749274B4A2 aue)q
804,175,689 *5369E4EFD632D26E3D571378A393F402187676B8 yonas-deribe
804,175,690 *536955700EF9F4E74C9FCD2603D946D1DCE6F962 YSABELLAGUTTENBEIL
804,175,691 *536AE9AB5B2C90321CCE6D77A56BA3A807EC7BB9 Aurora,-Fire-in-the-Sky
804,175,692 *536DE3FC78F7DD7B28E024CC8CDC25731C979E5F yvette.hendrickson
804,175,693 *536A94E900B69E45FF232CBDA6C2139E80F03100 [email protected]
804,175,694 *536502074D960844629E55E82D3BFD4928E4F0F1 aw6pf
804,175,695 *536E5ED84D890956739283326D38CFF588ED18C1 AWR1P
804,175,696 *536B9CA89D3255BCE39FAD90C54DE912A63A2E55 azth
804,175,697 *536880F70B65C573EEF334993BEA973437C9C176 B04030CIN1994
804,175,698 *536A1F0F671877718D9CC46A7237167F8AD00334 B15o
804,175,699 *536352F66BEA8623A0EB146A2BDA1F7093D77C60 [email protected]
804,175,700 *536F856C85EE3AEB500380A759B54BA3B88E16FE b,6%i
804,175,701 *536D6CE38E27DA1249FD39285ACE3C750E11E42A ZONI.ALI.A
804,175,702 *536995E7CCF639E876C0FE9A05566E26FD5929C2 BANPOCUN
804,175,703 *5364043FD150A6E7912BADD791D84964998091E2 BAVARIAN
804,175,704 *536F675B5FED51B0E68926C57A8225B20B5F41DB [email protected]
804,175,705 *536301F28D119B443C4A64802A0F25A9CF5B5F17 БРЕШИЯ»
804,175,706 *536D4DC633BF00DCA925C460A3A671BB5C7ED26E belijdenis0
804,175,707 *536F3EF25670EF16E8A23254DD322BADF086AA88 ПОВАЖНОИ
804,175,708 *536E27640D523D48C7FFA864155E8977BA1BB25B beredeneerden!
804,175,709 *53615C82DB8B14662D9D844D79648C7796BD866B BERRYDUITSCHER
804,175,710 *536987E15DC112908CACA98C601C9E811B18574B bes7c
804,175,711 *536CD6FA8C6E1B7738DB0822943AD004752E4952 bf2bt
804,175,712 *53645C1CFFD7834757314CCA574187D66D228900 bhno2
804,175,713 *536E064DAA80AAAA44CC5E0F966CBBCB641F742A BINCENTS
804,175,714 *536E668FD44D839355FBEE3E34FA454EC512D7B3 bk=f=
804,175,715 *5361C52367CEEB029E964EEA764F947E4272C807 BLAVATSKY4
804,175,716 *5363386B623C9EB8C6E0B859F9E448779310EE68 brandieadkins
804,175,717 *5361A2F91A1BC9949A980D0B19D92662EFC60A66 brendonkelsoe
804,175,718 *53669DBA34AC7D3A368F535DC73372236EAFCE65 [email protected]
804,175,719 *536B80448136186B567D1D3672E057C7798BD606 BRIANPANNONE
804,175,720 *536A6D0E9B20CA0F3B69CEE71E09F70302EF96E2 BRINGMEONBACKHOMEAGAIN
804,175,721 *536F54DA4E7F854596E5DBA94FDCC042715C505C 05-18-1797
804,175,722 *5361639126DAB692043DE6ABDFD747114CA7BD0C b$s6r
804,175,723 *536C2F9F2486EA61850701ABA1336ADFFE2CE735 BTrp
804,175,724 *53692779E4B0F5B6832023073A472B9672DBBCFE BU+FW
804,175,725 *5368900B777EE56B3E989EFBBE37260ED4B69E05 1083542 IHR PKW PRALLTE GEGEN EINE LEITPLANKE .
804,175,726 *536C827138F3FE97E4938D5712FD42F3DEC625C7 12091033
804,175,727 *5362CECA8269D4EBE184E9CAC464819098FC447F 1233089 poikkeus munivien kanojen ja kananpoikien enimm
804,175,728 *536B3D5CF527716F111997B616CD6CA53CF78D40 126-STRASSENSPERRE
804,175,729 *536223E6C4A781EA3C52E6BB0A137C53CC11D334 12APR1446
804,175,730 *536FDB214521E010AABF00E9610C76905F160C74 1443198 ESGEHTUMGLUECKLICHESVERSAGENUNDVERWEIGERN.
804,175,731 *536C7A77E720C123816FD1A4C2D5F264202323C3 BWB&N
804,175,732 *5360A45D6FCAAFE71B21A3FD9890359D281C79B9 1697844 ASEKAUPPAKASVATTAAKEHITYSMAIDENVELKAAJALIS
804,175,733 *5362ABFA055F67B6A85C6B691098E27B77EE6520 17.levent
804,175,734 *536244AAAFBC5263E221F17AC791277A6DFE4B4D C4QPK
804,175,735 *536D32D6898D43F588F892C60AEEDFD99BB52C07 C6E=A
804,175,736 *53673544EBC3F8F51DD64B60463D4E04970E5654 CAMPOMANESIA CAGAITEIRA
804,175,737 *5366C004546F774B52D04C40B2C7EF2B1FCE945A CA$n
804,175,738 *53641ED023761B1140FA1C0435EA0819FE687745 Canto-a-la-mitolog
804,175,739 *53676EDB650867551F4F0254D8A8476F5DB26B75 [email protected]
804,175,740 *536B24B037BF77DF72021E5759299216FE6A0F4D 1.ATTRIBUUTTIBLOCKIN
804,175,741 *53610BC4C897F2344BA7327B3D6E9F5BCFC18BB7 CARBOHYDRAT3$
804,175,742 *53600E681C20D0CDD8257085A9882146CB37AF80 carmenskora
804,175,743 *5364A4D1058080CE03BE04C172127A58985BBF55 carnivaloftheanimals:no.4:tortoises
804,175,744 *536B02D341A803A994247E545A6593AE6A7F3761 1ELKESHAI
804,175,745 *5365C50EA3386627E943E42C145B941280D17ED5 1-ENGLISH-AND
804,175,746 *536CEDD91DE4F8739BEF57BF87DB7C125721918F [email protected]
804,175,747 *5367370D8746D5904338AAAEBCA2D6A2E77C17AB CBIR6
804,175,748 *5366A14B275F80CB8DAEFD9ABEF24DA4F96BAE45 1maksuluokittain
804,175,749 *53692D10813964D1C88B1B6858E7089A6C7F1203 1-MEDIATISOITUNEESSA
804,175,750 *536E08ECC34462853A09FAC5F1604C6D509EC30E 1.MUKAI-SESSA
804,175,751 *536C0FCD31DB6E561019FDB0DBE170F51A6B781A 1 OHJELMAMARKKINOINNIN
804,175,752 *536C5C5AE2C18FC9C6DB71E2AFED3A548B4C2098 1-PSYKODIAGNOSTISEEN
804,175,753 *5367DF22A48641FEC04B7B55FDFACF5305640FBC 1puhallinkoot
804,175,754 *536635FDDA0A8EF668BC3C4309C51D578EDB0AF4 CG0K8
804,175,755 *536B8E56CD0EB717866E30370502CFBFF06459D3 CHAMBRAYP
804,175,756 *5365B5BBABADE03E32024A85838F812AD6C5E7D6 CHANCE.BREVITZ
804,175,757 *536E0530A3C59023D9337814D0866DA41B50F878 1RAGGRUPPO
804,175,758 *5368557A1BA96373241E82760D404D291D78C0B6 1 STAGEHOLDINGBOSS
804,175,759 *5366DE6632364C7A5082002DCC52D45293105A7D 1TANIYAMAYAN
804,175,760 *536BCE964DB51F32F3D2D291DBFB142C2B34B604 [email protected]
804,175,761 *53675DC3365B5AD3EBBE7BC9873354ECF1625626 1UNDIGESTABLE
804,175,762 *53688B757577F1FECBBC4DBA52E47AD876AFAF16 1unettomuuskierrett
804,175,763 *5368C9F2FB29B970354F0B58A35B7DDD151354ED CHIKI CHAKA (REMIX RADIO VERSION) (FEAT CARIBEAN STORM)
804,175,764 *5364A5A7F74BAEA1883EA0E80CF0F6B321CF7928 chnumhotepově
804,175,765 *536B2B01FEDC6CFC14B7D8B2853360F8F27A3CF2 CHOIQUE5
804,175,766 *536C588B60A7943713294CF751AEA548FF1267B4 church-bells
804,175,767 *5360312E72793575A8704CFBF174F1511B4D5466 CISFE
804,175,768 *536CB60BE06C69F63ACA461984527EBC000A9AE8 ckfh
804,175,769 *53647C690EF7C292DE70D98CFEBD3BC267A96CA2 2609858 wird.mit.festem.torwart.gespielt.?
804,175,770 *5367BED2F9E3D1C870DF83E686C12D15204BCE84 CLE.L
804,175,771 *536D40E0C717C8A7D265C11B5CB540ACD5D74BE3 C/LLM
804,175,772 *536D74ACE1FC756B1AB2FF26384ED5D6094A8457 CLOUMSY
804,175,773 *53675BF6C7C3560E1B17E2B2D692087BA146BC3B CLVBTM
804,175,774 *5366D7552F46E9FFA7184F3C43DA291DC0E6A69F cmw/3
804,175,775 *536D302C6E8B29B2BCE6C1778D3F63153CFA2C75 2-CAPRIO
804,175,776 *536C03C406E66ED7904EAB568F81E59BDDD02D6D 2HIGHTECHMESSE
804,175,777 *5364861621B05C45102293BAF39272CF5DD5E978 2IAMMADDOG4
804,175,778 *536908718378DCA75F9C3D33AC6F683BA04A6385 ColinPeter
804,175,779 *536955E1737AB262209D3AF6405ABE24E5E2807C COLTON.GEISE
804,175,780 *53683C10EFA7E0804CDE5A80681ACA3835C50921 COLTONPOSNICK
804,175,781 *5361932DB482982A980F3922D21C56508734B83E 2.PERISUOMALAISELLA
804,175,782 *53664E9460B39050BF38E655B2B4E0BFD163953C 2SRRSCLDR
804,175,783 *536D2DFB88FC3FD4A33962F5FE98D702F160B25B 2.SUKUKIELIST
804,175,784 *536B2838C1366DE1310155CF4CCC3D3B5161EDBD COMPRENDRE4
804,175,785 *53631160E682B36EC9DAB3D5711CABEECA823BA5 [email protected]
804,175,786 *5362827434A37878AB2A99378D1D063BA1F145B1 CONGCUTCVN6909
804,175,787 *536ADA7B39F7B92C73D5A6A6EEE02B8FC3AFF9AB 30+30 GOUE SOKKIE TREFFERS 9 (DISC 1)
804,175,788 *536B64CEB3FC635E67C68D586CCB5E95445919E7 34peine
804,175,789 *53630921601B5DAC89C98BE4FAF769DFB9039773 3867.oklahoma
804,175,790 *536C083EA32AEF69ECDF27B1D32F2B876F2000CA 3b9cbceb3d5332b88eb71948fbcd2a60
804,175,791 *5366D6FF23B7161137A743EC6A5006DAC646C112 cordellradziewicz
804,175,792 *536B04B705545959E4F56032AE58D86D88362952 coreyrock016
804,175,793 *5369A57DB849817A2B0D37A701BF09D67710F99F 3.MEGASTAAT
804,175,794 *5367BBF2058398931FEDC9D49519F4DFD6283175 3myvolvo9
804,175,795 *536B8F49AAC2B92FC5F21D51D63525C3D4C600A5 cq,?l
804,175,796 *5360699D0CC0A41FF487B0C4403AFB39FFAEF72E cq%rq
804,175,797 *536379DA9D25C46727360FB36E2A5B343E0F6C2C 4 ASIAKASKUTSU
804,175,798 *536B046B5BDEDDD56423211C48DFE7F149AC04EA 4esittelyvideoon
804,175,799 *536669964356CE1A1BAA2F7978F8823EACD81065 crumped2
804,175,800 *5361132C2C4882F271871A2A7C9824AE4E819AA1 4 KIVIKASAA
804,175,801 *5366F512A3649CFDE0DD9E5E5F31CBD6CF851B8F CSREIPAPPING
804,175,802 *536018777E5E800EA25E87CAD57A3612C6D15284 CSVH2
804,175,803 *5361FAA69BB7D7CA76E759586AECB313AB3FEBF6 CTFOY
804,175,804 *53608AAB42D1180BB46678E72664573743B2BECB cumb?
804,175,805 *53601EE5AC4C83835A15A08F7C119F5D42FD6843 4PROTELJENSEN
804,175,806 *5368555DA57939F41C652AD025531CB4BA8664F8 cupolama8
804,175,807 *53694BC06AE558FFA7000DA7B52B4DC7CBEC135B CVCB,
804,175,808 *53620328F26811DEE88E628EB090E6E37A6DF0AF C/VKT
804,175,809 *53697BEB8A3391FF2D463728AABC27E40635B8A7 59098 bukanunilehUrriyet,suileateSgibidir
804,175,810 *5365C6B79761ED6DA3456B7193C5007337A91371 5BELPREN
804,175,811 *536DF5CCF25DFADA22C76375D521B44B7D417CDA CYPRUSPOODLE
804,175,812 *5365B3CCACBA131AE90DE6E33D763CBC284EDB40 5CLAUDIAJAKE
804,175,813 *536CEF41EA4BE13ED74E8EF590CAB0B2E3AFC954 5DOGBERTKILLER
804,175,814 *536C7EBB469B1311231D964B2B58400ACF49548A 5ESABTNUOC
804,175,815 *536F5CF6131B996BC39613A9CFBD4887EEF4B1CB d4nmc
804,175,816 *536B41538CDBF9F13C7D1D30ECAA1D21CA0D2B57 5LAPCAIXNETCOMCOMMOZILLA
804,175,817 *53688199A01E37F5D79E1EA9B31545016682E455 d5vcd
804,175,818 *536B24A983D1F48E5AB1C5548725284279E15DD4 d7igg
804,175,819 *536E6EAE6902BB424722232FFA303BDC1607C7F3 [email protected]
804,175,820 *5366634B092A297E062413D0EE2E4EB25A254178 5SENOTSDOOLB
804,175,821 *536C4C195C3DDE413DD27A60CAC873CF60C60CA7 DAMIAN.CRUMBLEY
804,175,822 *53684D6BBB5C494460EA6040EF0182F7EF054712 damianshipper
804,175,823 *5363B7167C14C813615FEDF37F53A3CDB8EF153B DAMIANSICKEL
804,175,824 *53684AB6D1ACCD6E54F6D39F968FDDD634850C8F DANA MILANOVA
804,175,825 *536D1301F4E977E49A8FA3C751DDC83F39B7E86C DANFORDN
804,175,826 *53601189810DF5674537FE1857CB19054031551A DANIELLERABOLD
804,175,827 *5366E98BD4BDB5CF0EBCD680F59F9A7096F7EC80 /daoude2/99
804,175,828 *53687BD7DBEA6DAC81114944F6539F496B8E8E53 darentomehak
804,175,829 *5368F8C5B70AA86D437DD9C5DCAFF5DE0B9A6264 646ALEAH
804,175,830 *536DC939C0FDED9289315CEDA93616DBB69A595F dariuslimb
804,175,831 *5368363B7841AE44EF5FA6EAC66F117328F87603 daronrumbolt
804,175,832 *536A65A9158F368DEB0E1FF9652B446DAD2E1A42 darrengoetjen
804,175,833 *536FC4B8CBCE4E403C4F6F17DB28A39B1D88038F 6BSWBREAKSDOWN
804,175,834 *5362E921619D9C45F57B9A1012F2C4DB8339D17F 6BSWMAILERFLAGSBSW
804,175,835 *53621848614565D72FE34E956523BE1204ABA9A9 6ENFOURM
804,175,836 *53627A03941F063E7364B1201745169B80535784 6ETSERECL
804,175,837 *536D01E653EE475CB5D1A2BA3F5E0343DB427F06 6GAHANATVAACHA
804,175,838 *53625F10F8CA62A9FB2291C70BCB1BEC16253F61 6GRECUCCI
804,175,839 *536002F0277EF6D5F750111D4EE0EEDAAE322512 davidcapen
804,175,840 *5360DA1AAE4A3EE00B1853A36F94D673DED88BA6 6KRUUNUNPOLTTI
804,175,841 *53695BB76E3ADBEC16674C22945BF6883A4DD2A9 6NEKKALSSEJSIUH
804,175,842 *53695EDB4D78C5C31734394CF8F52FA971AD7145 6NORABMAT
804,175,843 *536B697C35DAB9BD468E5F831AB2D2D45A5E26FE 6.OSALTAA
804,175,844 *536030A9DC93CDE271F48E39F019FEBE2EADDA39 dd!sp
804,175,845 *5361B95923A9F5176FA4A8175D02632B1D6985A8 [email protected]
804,175,846 *536D71259ED482F83708DD8775693B46944DC734 DELANEYWILLIBY
804,175,847 *5360C0F65130E0B45E0546FACAA5DC181568EC5E delbackers
804,175,848 *536EC9FF4CC932809CE1130870497077CAAEAB8F 7152F3FCC13533479429D8B9DF1D607E
804,175,849 *536F06B814A5214BBBE270E1918F398471CC9977 deonridgnal
804,175,850 *536BA934E13A1E961A1DB1CD9351BD2982C92ACB DEQ(;
804,175,851 *53608CE0ECA95FE7E330F06FEAEB5F8C98512199 788< THAT >
804,175,852 *5364F0F05E692A220DF2BBD89623584F48DE9FAD derickbezner
804,175,853 *536AC64C2F3E54CD9D8601920187E3AF0D37E554 DerRosenkavalier:ActIII."Leupold,wirgeh'n!"
804,175,854 *5366EAE7E9D7DB450D34FE1B0961AF9A89C14BC4 7bruited
804,175,855 *536E5462DA3B81D08C88975A028989DBAAB6CB25 df58q
804,175,856 *536D38B79D16611768EC1F3811D38BCA02D659FD 7MOJAREST
804,175,857 *536B2984CBDAF7239D6E60D728A9BBF2716653BD 7NEMESISALECTOASTRAEADIKEJUPITER
804,175,858 *5361D446C5638F33FE4E831CA8F82286998086AE 7NENILOK
804,175,859 *5369158DAF8C4D21CCD1CBBD329A0194DAFE6861 DIANNE.BOUCHARD
804,175,860 *536E0C9C09C3BDBCC5DD8888824D2A85619F1F0C digitaalhorloges
804,175,861 *53666FEBBC11157D25877CC5BAECE4188263901F [email protected]
804,175,862 *53698377B428A0E8D61F22A9B881B345AB8F535E dishevelmenting
804,175,863 *5366DCECD40417C4EE8A09A00A8B5120C06447A9 dk1,
804,175,864 *536369D12F2D51EB757F30FF6B81B84F21A06608 d-l_a
804,175,865 *536864114877ECDAD4BBDF7F00EF26A98E79735B 8e067b3ae541378bbb0ab65cf2e7ced0
804,175,866 *536946CDBB08283D9F5DB6CFED382F04E2A41467 8ENDAS7I
804,175,867 *536BADE4421793E205647E5FB3953956F5D1615C 8HINTRETENDEN
804,175,868 *536C427800515788C60BD4D30F04393E30D1EA8F 8IHSIOMUR
804,175,869 *53683D54986C3E2AE2512FD81E0984B4DA734C72 8LEBUEMEE
804,175,870 *536035BF957CAD5191A9B0E98D3EFCCF2C98955A D(OGO
804,175,871 *53614335B0AB41E4F04F1BE89A6FBC68D596B63B DOMENICRAYNA
804,175,872 *536ECCC124C285A0433C167F71A27FCABEF64CA5 8##>~O~o}o{
804,175,873 *536D490A1D0C47B9292EF9C4625C7F2C879E00E8 [email protected]
804,175,874 *536E8BF5D866CE7AED919800A45C1E82D5E90815 8PAKISTANPAKISTAN
804,175,875 *536AFAE174698AD269403F6D95CF326D00EE03B3 8rougeoyer
804,175,876 *536A0A1184AED33A4F419BBCAA29BAEB9DAEAD39 8SHYRLEY
804,175,877 *536BD047DC7961F78BE37A6A1D65D1CAEBB0A128 DORSEYDRAINVILLE
804,175,878 *53606E05BE40C3BA7216C5A4F4A1304F35007DE3 dougotfunk(featderekconyer)(vocalmix)
804,175,879 *536851447F1F05AB4720FF95A0FA53BC0504FC76 9AVBDHHC
804,175,880 *53699D3AB61F1713490B24570723CC5F28392C74 DRCNL
804,175,881 *53612DACE6C6BC76D2BD048FE26DF0BF0A4AE0D7 dustystroud
804,175,882 *536BC85F5F13D8D7712CDF5BA9AC6840E84F584C 9VFJGHKTKNB
804,175,883 *5362D19BADAFA3EF5B81034BA79E47EB3F8C2BC8 dz.ei
804,175,884 *536BB8BB9AE4D88F819554AB030AFADEC725D28F a0w&8
804,175,885 *5360AC411B167D8DF3160D8DF8A4D85599465C7E A0;WV
804,175,886 *5366A40A46F27E5C02823986245ADA6BC60823CE ebletten2
804,175,887 *53649DFDBE2BD437DBE39DD5B05DA45E884C1C90 A7GMQ
804,175,888 *536BCFA8A09DA68703B68CE956707FB859A32B04 AABCEA
804,175,889 *53602E3EE940372FE137839698582B963783524E abendbro9
804,175,890 *5364E1B053B34BA0B74AEAA7ED597532F0DB8ED8 ab;u
804,175,891 *5365F34BB38C8D963D609327C9E22A3915D574B3 accennavamo5
804,175,892 *536730C26432CAC6C543DFF2D24D6DE8C57C52A7 ELIETHCAF
804,175,893 *5362740C8B599535901E733156737D270F80D8C5 ELIJAH.STALZER
804,175,894 *53694D67EDD8DD36B0A80B9F8F69AEDE2E671DC1 ELISHA.NEIMEYER
804,175,895 *536E3AE708FF5024AE39E9B1ABB90BF94A077499 A$-CS
804,175,896 *536472CB323D59108693307B160C0CC862A8EB79 ADAN.WORDELL
804,175,897 *5368EBD7539670CB856AFA74FBD5FA65F624F0C9 ELVIS.BALDONADO
804,175,898 *5364A3DE76EAA84DE3094A2FEFFD17017ECEBF9E ADRIEN39
804,175,899 *53669E02E4BCCBED85416AFFFDD731F9D70A9357 ADUENAING
804,175,900 *5360AA1ABAF43055C17A0DD84EC809BA8258794D AEB$P
804,175,901 *536EA1D2554BB3D82BB7D575B2774BF4A96F611A A"+EF
804,175,902 *5368D925E8A277F826A628E5A58541DDE2AA3166 AEU+"
804,175,903 *536E40DE245E7488C1C6AA3DECE1B49823381C16 AHMADABUSWELEM
804,175,904 *5363A07E8749F94C7EEFAF928FE710231B3049D0 AHTDW
804,175,905 *53627D0DB69863D83A75DE3E3BF2F2ACDB32A15C AIJONMAA1
804,175,906 *536858F5852E0EB3390C8B0135ED632FB15BEEC7 ES2M-
804,175,907 *536FEBA3A67DA389FC82380D94B66188AD367B23 esiremun6
804,175,908 *5368704C21AB7B0857217E4BE3CCB6FFDF67FF9C etareoya1
804,175,909 *536FBE82787F6111DFB49BDC90E8B8A446638D64 ajm5/
804,175,910 *536FC4CBFD8AE7DB3AD8167B338FD8C95FA5F99B evelynleahy
804,175,911 *5363C8FD1FF984E82F129E7EADFD1481B820E9E9 [email protected]
804,175,912 *536AE8765B030E99676D82FA6C25888E110FA3F7 ALECGLASOW
804,175,913 *5369EF527D16169A92AAEC684F61CAEA7D6F5D3C ALEXANDER.BREITENBERG
804,175,914 *536FFE6158706125BDFE82BC38E58BD63EE58947 alex-bulkley
804,175,915 *536414FE0E3F2EFFD14848936A63BC1E83FB6A33 FAIRYTALES (EXTENDED VERSION)
804,175,916 *536C07F5B195A28A7B5A239F8325C4F980308AA5 FANTASIA: LA GIOCONDA
804,175,917 *536A8E0C7EBD8D00B029A040BC1DE7CEBE499B36 ALTONHUELSE
804,175,918 *536EB3DD879B55B8ECB8F9ADFD7FEE888B01FC1C [email protected]
804,175,919 *5363281AB20C0BDE5F419792DE5A426296A338B0 ferlandflores
804,175,920 *5364DD6A68DEB558A168D0D36B7ECE210CB7E2FD amcg
804,175,921 *536D8EC7AEA1C3858363265ADDE2440FC53B02EA FIDEL.WROTEN
804,175,922 *536C86F42A03A076A44507C6FF6DD83B30881A74 !FIESTAFATALE!
804,175,923 *536826A4D33F0CB3429AB029C0C847F67FDC975E firstlight(dubmix)
804,175,924 *536BC8A42980D00D1724384DEFD2421178880955 <a.name="note1">*</a>.note:.aid.expects.the.dcc.will.have.the
804,175,925 *536CEA3ECEB41BA3D9BEC43184642352CDD8BEAB ANASTIGMATIC123
804,175,926 *536F1BA68C62762DB05B59501E9737AFB628FFC3 A)NBJ
804,175,927 *536C4A4BCAB7E5F099B7F344B6127BA9EEFF0DD2 FORESTS
804,175,928 *53608DB941BD54D9FF19ACBB6C284308544C04A1 FR~"
804,175,929 *536CA4A85984742667CB7110D5526EF8F01B6EDF frankensteins-walk
804,175,930 *5369F7DE93D0C1C986298F63B6CC7C93FEBE0BAB ANGELBOWLUS
804,175,931 *536A4128BB733540118C8C90B90A80AA47E540BD angelica-rivera
804,175,932 *5362B03F90D5FEB9A2C529FD3CE8EC03A51691AF frankmai
804,175,933 *53642E7C30F1F0CE49A69943C059046EC9562DB1 FREDTAVANO
804,175,934 *536BE75D476602930809D60BEEE0EEDE708D3CAC FREIDHOF5
804,175,935 *536031E4155A9E0174D1661BA599E7278ADF8294 AOFFK
804,175,936 *53623CC3E8E6CF2994EED5D60305BBD327E3F084 ap"o1
804,175,937 *536534017C9CE54EAE78DFBAF61C4DE23515342E G76564
804,175,938 *536D2F221759044CFABFF99294D1AB790BF65EEE ARCHIE.DALLAIRE
804,175,939 *5363E708DC0948C2ACA00FD4712D83D9B08915BA GABRIEL.HODGSON
804,175,940 *536C6ABC69DB08F1102904C25BC35AEE58FEE592 GALLELTY4
804,175,941 *536A619C0A7C164A5C255A04B4C08626AD126325 ard+f
804,175,942 *53678CF57B069B3DEAFC663FCF5FB0D7641482B2 ARMANDOBRYINGTON
804,175,943 *53681748BA123F2AE5C3CB3CD63620F980510E16 ARP6G
804,175,944 *53685D2BE64E010A18D0C39988B3D71597D6231A arsenobenzol3
804,175,945 *536403E4373B77EB695DABB212AE9D4086BFD52D [email protected]
804,175,946 *5365DAC2F18F4BD09FE561D03E4920E178E14304 GAYETY
804,175,947 *536F2255B9365F224962CB375D4922E22C3B5803 aseraggodes-kobensis
804,175,948 *536953E2A85F2ED999E96F16B5A143D8352F73A9 ASHELLEM
804,175,949 *536BAEB763B06D8E9820D0E1161B510251A7AEEF GENARO.MENNINGER
804,175,950 *5365ECA48E1F6E495FD79BCF1DDE6A7B16342E78 a:sk
804,175,951 *53620E3DA858B2FFDA4566145B5F58FF3027B849 AUGUST.GNIEWEK
804,175,952 *536037C214581A9DAE5A535FA4F12E73EE2496CB gjovpjhxmy
804,175,953 *536365AB30625E92244A07E19A5136F61EE7A6AB AUHBV
804,175,954 *5368B380F2D8611DE8BF071EADEF6CAB3FFF37D0 ax3
804,175,955 *536A9D5470AB19140558EFC15256E207A5BE0086 goteleks5
804,175,956 *53643A935566660A47E1A131814E484C0DA7E492 goutham.uppuluri
804,175,957 *536539DEAB7B241E3E3D41240C155273C1882AD2 B00SXQQY
804,175,958 *536F35D33F6D6B098DE97374E2A0EEB13CA91648 GRANVILLE.SOGOL
804,175,959 *536E6CF3E3EC8F1E83CEB256D90ED3E5A7404CFA [email protected]~0~O(>-<)
804,175,960 *53609DA4BFAA1A3E2F2EA9F8A3274C7C47ED7FD3 B3na
804,175,961 *536F33437C6567919B18C04258ADF262CAD8624D b_59g
804,175,962 *536D11CF511BC08ACDBF10A657735976AFAD782F b:!67
804,175,963 *5366C821AC9610F5EAC7A5B058EF7E1E06F9A2C7 b-6(8
804,175,964 *536ED87815944B6E98E19ED18F1C5C4453937209 Guerra-sucia
804,175,965 *536193400C8449E4D0D31BC2BD9984E1475ADDF5 B7BC2149
804,175,966 *53686737BA0536977D0688C1A8E5D5E6358B07D9 B7ic
804,175,967 *536C01894E0469A7C34781B0835820B686F10941 gunw4les
804,175,968 *536BA4C2E783B94330C1048913D5547F0CDF0D21 BELMORAL2
804,175,969 *536E74889D98D85A81489C5DBC36EEEAF0C41A17 HASSANMARCUCCI
804,175,970 *53654905701596FB962BB7C4823CC9176C9167CC BESTSIDE
804,175,971 *536493FEF198E0D5DE65790339D62C42BE1F505B HAYDEN.COLAPINTO
804,175,972 *536E287B1F8C78FA6B883E2E80555C7655FB673B HAYDEN.SWEESY
804,175,973 *5365ED531F97B25CE905E7C11CA32E9AF24AA2C8 bewerkens2
804,175,974 *5363C2E6A8D47FD5DE4CFFD57FC35BD6CFDA780F b&f."
804,175,975 *536CC6EA52484DAD9E1B648B391123F2A85B0B76 BGJ(M
804,175,976 *536E24DB709620E67FF9707638C5CC9B9BE04D15 B&I7_
804,175,977 *5369F4C86329FD3AFEC3F7F2EF6CDE8DA2EB502A bimillenary.
804,175,978 *536BD74BBFD1A8DFC09AEE81EFAF1FB4859432C2 BLINKNFG0
804,175,979 *5360D0CC397E458FD925678B90472D26DA8E2FF4 homesicktalking
804,175,980 *5363AAEF1C8F8AC76C32BBEE3B2C9ED17015F6F1 BO6-O
804,175,981 *536B15BE3C3E15058DD86FD13BF33D13AAC4B11E BOBVP
804,175,982 *536516FAAFA292E3A3C8A000A2150AC3B35E7360 BOENZLI
804,175,983 *536FF66F531D103BB9792820FD0AE70898932987 [email protected]
804,175,984 *53699E70756FC8A039939E22C558441D6B1D329D HTTPBHARATANATYAMBH
804,175,985 *536EE6913F365572D04828C7B7FB23E785278B44 bolky
804,175,986 *536C2248E9DA70D9591DA97F4C8C3F3A968F6A81 BOPHELO-BAKA
804,175,987 *53678B6C5825428C19A6A645AF694FEEEB5F917B [email protected]
804,175,988 *5369D225DCD1D863BD61A0FEAAC692677CD0322B HUGOBUKOWIECKI
804,175,989 *536EA7E754B2BC26006390FB9E06977D8FFFFF8A [email protected]
804,175,990 *53660CB967A310D0D3DEFA8E11E71DFCD9949EDC BOSS.DJ.(DEMO)
804,175,991 *5363F81D5C023EFA462DD57950CD232A70C4D1D5 iamdoogieabc
804,175,992 *5364270D9A17FC5F31F6BAF6AE676BF484C15E2F briananetsberger
804,175,993 *5365BEB75B8E0642608AD19382D73EE50E8D6F3E IBEXARMIED
804,175,994 *53699DE790F149966E1986A629F970D906B94DDC BRUCE.ZERANGUE
804,175,995 *536C04880F9908358D9E75B472F8C7D3C4F8F075 IESPIESTĀS
804,175,996 *536705D61CC1EB0773F23F41F307BBD19D7EFAF4 BRYCE.BRONCHEAU
804,175,997 *5361D597F3043ED34C93976876507D033217009A BSK
804,175,998 *536C1934E34420940D1E8A63FDF66931ED8CCDDC btosd
804,175,999 *536A54AFA33616D13B825AA79D1BE6F8D1C5F97E ILUVDAYTEK15
804,176,000 *5364ECDE735FE7E041C7E7683CC52A1A76533703 c05m3t0l0g5t
804,176,001 *536D9820EC18872800DE6EDC96AA92ADF506758C C1PV
804,176,002 *53693E4A0761A990D7782452780B42BEAB2EE719 c9m
804,176,003 *536E0A98BEC7E4AD3033C00BA3A5D271A240771F [email protected]
804,176,004 *536CA7EABCB36AA62EBC99235FAEE9BCA4B1700A [email protected]
804,176,005 *536B7F9D7C22F30DB7421B21BA8153487BFCEBB8 Cáinếtđánhchếtcáiđẹp.
804,176,006 *5369E609CBDEDFA99819D488AEE106D106691BA4 calebpelligrino
804,176,007 *5362B69AF7A738F8CE960C5E430706AC8AD1FCA9 [email protected]
804,176,008 *53645B29385D76EB8C7A13B7B2836B87B64361E1 INTRO.17
804,176,009 *5364CA59B34E012C779D3B471556B7198BAF4F6A carmanati
804,176,010 *536E81CD4E311A53D4981213A07DC246F8AF577B isidrowinterfeldt
804,176,011 *5366540ED504DD6855EA4C323149F0EFEF8A917C isidrozenon
804,176,012 *53653FA4B5F422EDA85356215FBB9C47E649C57E ISREAL.KURTZMAN
804,176,013 *536E8ACC3261DA5AA066DBC25C027B2E261935AF issam-elawadi
804,176,014 *536AECDF66504AF09C4ADAC7FAB322AD5DDAFEC6 italienisches liederbuch ii no. 26: ich lie
804,176,015 *536315940FAD9415BA6FABD82C680CC77CCC74DE IU",
804,176,016 *536C173A41B09988BAC07F68347F938575A46F14 CAROLDEE
804,176,017 *5363109A3364DF60F5A98C892CC31923EB9A15FD j8mp
804,176,018 *5361028D8DFA5EBA5B0FD23F0A50661A34212177 JACQUES.ELSENSOHN
804,176,019 *5361B9E6474BE7A907F2D0F4C7F536167F8371F8 cavalline9
804,176,020 *5361F7AB444B03CCB43F04BCE2E35D8218346829 jaimesanfelix
804,176,021 *53670AAFDD25D268F6DB910E51486006342F30F1 jakegrande
804,176,022 *536F4A0C41EB37FD187CD84B82FF4BDCA88B0088 CCJT=
804,176,023 *536D943D84597F639D695E828FA96C441A0A8AB0 jandse150
804,176,024 *5361ADE49D98B340AC274B911A0AE880ED393995 JED.SCHABEL
804,176,025 *53614D95E7E4645561F6FD27430720D25717E1DD cg~
804,176,026 *5363DD8ADF3362EF1E0A13A09268F94B561C15C2 chantofossanha(cantodeossanha)
804,176,027 *536E956AC964CA7C3C4F9DC5D293B160A0DE8B1E charleylope
804,176,028 *536D1D1DB7E34758245359073FA57E5FF33CDC5B CHAYETTE9
804,176,029 *5360662006F29F9E3DF3228E88DA1EF88F2D8865 chinchòn
804,176,030 *53647920425A2411EC5F564B894D5EBDB734765F c"h#j
804,176,031 *536AE3052E2002CB6E698580C6645AFBDBF8D2C8 JONAHCOOMER
804,176,032 *53622A16EC33E1C491E4EF385A775346CE75BDD4 jonathanlittrell
804,176,033 *53629613D44DF5B3B5F8973EE690B0CEE6EC19FF c$ile
804,176,034 *5361C7C5799706FA5DD9E0DAF82D4332E0A4175F JOSPEHSTUECK
804,176,035 *5367B3E35F07DEB1EE257FCCF2272D9A2D10F9B4 JOSUE.HANEGAN
804,176,036 *536A3B1A361255D67183F308B51D3DAC7C46E045 JOUEURFOOTBALLDJILOBODJIPAPYMISON
804,176,037 *5367D47CC75029CBAA49BDD96654FF4878727AD7 J:UB
804,176,038 *536DC2F027271C2E8DB320B8BE05AA2AAB5E8580 juliotanon
804,176,039 *536DAD86AEDE714D5125C40C0632C820B64A6325 JULIUSPENNYPACKER
804,176,040 *53627DF2C69C1E185AE716DD79690BEEFDE7176A CLEMENT.PARDUE
804,176,041 *53682C5CFCA144E8DD6F1D8C612E161E4B4731CB CLEMENT.SCHAMS
804,176,042 *5363262E82D76315255AC2FA4EEBE64D17640B98 JUNIPER B
804,176,043 *536E6520CB7D9357C9D848035911C1D7ACA7068D justinemica
804,176,044 *536040E9DA239AF8A138CB46A6C502FECF07DE16 clofiz49
804,176,045 *5365367D55A20D7F5FF688770AF969DF2C869BC6 KARLVOLLMAN
804,176,046 *53673400EC339E10A98D5D176C9E8907EE8953F7 KARMAFREE
804,176,047 *5361CFD165EDB545EB4BE868FB3FFD6955F1F853 KEEP_APARTK/I/P_/@/'P/A/RT
804,176,048 *53693A8C3F741C659B115339D4643923F15CD1AB kelleygissel
804,176,049 *53605A7E773CFB6AD2128359938A47373FF20961 KENDALL.TOLMAN
804,176,050 *536B634EF55EDD1F850F8C10FB518D5C5C7CD7F2 CMSVK
804,176,051 *53600CF32E747B97FAC5C7871FC3667653BC1DD4 KENTMCHARD
804,176,052 *536D0F5187C2ED48DB3E5A39BE4C508236401E63 cnxf_
804,176,053 *536650C4FB2B163CD15C36AEC5BFF710ADE12AB9 KIRKBAMBERGER
804,176,054 *536EE5CC6196B7CD78A326379B3A6EEA2E5A96E9 KKHU
804,176,055 *536E586863E57353DBE04A085919A7738849D292 KONVERSATIONSBÜCHLEIN
804,176,056 *536E2D9F0B873F9B723F6475F74857008D0CE71B kristoferlosh
804,176,057 *5368164F82A40CE9CEB785E1C81C450DA434B2A7 CONJURANT.
804,176,058 *536AAC558A5CC5DF7491CF4E23ED8C0DABCAEAA2 kublikhan
804,176,059 *536D80BD48E59589D216A7462383DC6224211E43 corneliusspratlen
804,176,060 *5365211158917C262ACC5EDF53D53709570CDD92 corporatistă
804,176,061 *5360BE8612CF8ABDB0B028659978C7829E3F1A63 courtneynemard
804,176,062 *5367184D78B5744A04A1CBD79F56B1E6037F0FB7 la luna y t
804,176,063 *5363EAD37E3D58528C8A11E81F5497A8348EFFC6 LAWRENCEMCCAMBRIDGE
804,176,064 *53657B02D14BDF5CA7F86AA236FCA31D27B6F9A8 leebalas
804,176,065 *536C52F63798260382DCFF7EDF708887C902737A [email protected]
804,176,066 *53655CF27E2898ADAFFDCFA7EB932D20E9A624D1 CRSF9
804,176,067 *5367FB92EDC73AC55334A0BF8A19440B006C14BA csded
804,176,068 *536BF4BC7897B271D361A758AC4640E5E3C62C6F CUHF9
804,176,069 *5367DBB2362A1695C4B6EF9C03F00DF692A28B6C CURDS-MINNESO
804,176,070 *5366C67795353F6F77243BC604BA14AA6F1A194A CUXa
804,176,071 *536967D5FF0837EBDCCF4A270C19A4788F943523 LIIDBERG
804,176,072 *536E903A5B6BBD04050E57823B368097ED011C39 CYRUS:X:85:12::/USR/CYRUS:/BIN/FALSE
804,176,073 *536DC8F34ABED533BCC3F4F531F498B466EF80B4 lindalayland
804,176,074 *536E2C4D85D8DE93BA9E4FA3948E857385E4E51D [email protected]
804,176,075 *536B79A565D41FA9EA67A1CD2D446B78DE2B300E D55M
804,176,076 *53628D3A714421E5E605379D1EC7CF884EA00164 d925_
804,176,077 *536523350584A6F92B40A3667C9150FD00971551 d?"9b
804,176,078 *5365117423101BBF349C55570873C3870C51D2A4 daltondebrae
804,176,079 *5362BDF8E77D57152B5643ECA7482615655833F2 LLAZARAKIS
804,176,080 *5367661B85194794872759F199779DB8CED7B220 daniel.reves
804,176,081 *53601100EA516D39944ABB31326FB0AC96441366 LOSKLEP9
804,176,082 *53640295C463CE87686AD897BB2034FD6B12BB74 david435
804,176,083 *5367A021ED9125AD6E2FE681655DA9762B615706 daynewatson
804,176,084 *536D57BDCD970A24531C5962A1914F9C197FA3C5 lupusgirlblogblogspotcomlupusgirlblog
804,176,085 *536809308EF0E582A55A6700D6A8DFC6CBA37414 LUTEOFULVOUS6
804,176,086 *536B053137E5BB52BB4FC168FC1ED7F5AC472E7B DCVSU
804,176,087 *5366A4E103B74054F639A545DD36FB557CDE39D5 macintosh1990
804,176,088 *5368FDBBB50C2DCE884ED2BDAB835BB2A15E6609 maggiejaime
804,176,089 *53659686202111C3BDF38C64B150CAA7A30CAEC3 de&ht
804,176,090 *536972A66BEEFA542459C4D4A6598D0AA252AB64 malcolmseip
804,176,091 *536F08DA37A2E0A4E848AB493142A821F406E006 DEPANKAR0
804,176,092 *53610A34DF9A2E9A5AAF281526ABCEDEDF6EE0DF mandair-5-0
804,176,093 *536B13B17BE6AC343A78B9CFCD307A99B85920E4 des_080217
804,176,094 *536DEB8F1DBAFA10038BC17D52507B54F35B51B4 [email protected]
804,176,095 *5368856232A130F23B9D9CAD6504FD8A67BE6F15 destroyinglies
804,176,096 *53619857A09A2B96197BEAD9895350CCA57680FD dewittlarocca
804,176,097 *5362396652E8F35058E186DD5D0F6E63284FD13F MARGARETE4
804,176,098 *536D592DC57D5E9261143DF08AB81E713CE97CF2 dfuc5
804,176,099 *53641D2290980F86C2AA5F7088818B51433D876E DIEGOLINDA
804,176,100 *536A65129F296F7474A50BB2E6966AFBE290D938 MATHEW.YEATES
804,176,101 *5360E158F3E40DB5D315626FBBB32722754F7D18 matthewdworaczyk
804,176,102 *5361897C2C5178D3C56D503AB7084C52539A96C3 MAURO.SCHUSTER
804,176,103 *5369E21633214AC4FA6BF39FB5724D4404527EB7 MAUROSPACHT
804,176,104 *5367351452C5BF587D82703CE214F87E1C827BF9 MAYNARDMITTAG
804,176,105 *536A8640770BE59BFA88A21225EE31E54C52272E [email protected]
804,176,106 *53680607439D190397C31CD2BC2579C01141B6D5 me-and-libby-part-ii
804,176,107 *5367B435BA9D44DFB05687136E22FE0F45E56D1D DIRECTORPANTHER
804,176,108 *536F6393903CB549FBACEAABA57012DF12D7AB4B michaeltnoonan
804,176,109 *536DDBA63416C81ABA4D1B2BBF17775297C42898 michalemcratt
804,176,110 *5364BB9D6C1B3A11BD201EAA473A08D8297382FF dk-!#
804,176,111 *536B80F3E74D60FB4D73FB43E2E3544D6470E274 DL%GL
804,176,112 *53693010E887A9A6F1E7B432266DF621E843FEB2 MILKOVO
804,176,113 *5362DC5476CC20962A51B741C9FC7B0E33D1F54F MITOCHONDRIENFUNKTION
804,176,114 *5362DFA4211F5254B3F1C3F0E1E0A92874E5638F doi101073pnas9125
804,176,115 *5361EFB599C320D6E87ACC5E5D83CDFBA7F8DBB1 dolichylphosphatase
804,176,116 *536D7FC5FCC603A2E799CD5EF52BD79D15BC63A5 dommedagsprofetiene
804,176,117 *5361141E9CEC59827C141884E5F50313FA2D1057 morganmalmgren
804,176,118 *536584343E80107935D41F4154C77FA9C8500B53 morganterboss
804,176,119 *5362F6FEF86E1F098F34E3E58E54665432C163D8 mr.magic,part1
804,176,120 *536222FDBC2DF3B5824DC38B001962A06B596FB8 MSAWGLE
804,176,121 *53658A72DDFC66838C8FCA20044C0DB0F8CA0917 DORSEY.BOROVEC
804,176,122 *536BC33DE06732C23A309491DBE98BDC94263D43 MSCHINICHI
804,176,123 *536D4267D79B7DE4F0722920BF94ED900C3873CB MSMTCHS6
804,176,124 *536CE870BCE63F71030A803569F755A5FE2EC95D MSNTRNC7
804,176,125 *536C79E01F3166E039AEB501812D283B7B4BE8CE multifocali
804,176,126 *5360C8437A5D7071EE90E21EBFA293CFE897AC46 MYRA&CHRISTINE
804,176,127 *536D2A930A5CCC3EFC4A736FEBDA5A5B384DC255 doug.wright
804,176,128 *536DC3F792E8A80CDC786E13534122C4E273DBDF NASŁUCHIWAŁ
804,176,129 *536ED7D2458F5194B2149613D79F3DF5B04ABAF6 dshi-
804,176,130 *5360D942E896ABE60E0FA5A998C532A1971F5D05 nealfukada
804,176,131 *53637A90D3F939D53F4BFE5E17FEEC0DC4CFDD08 d.smu
804,176,132 *53614D645BC128A135DC14582213A649D2ADFEED d+)tr
804,176,133 *5361D1C62870AF363C28FAF6B93B7C8B46A2D9A0 DUDLEY.GURSKE
804,176,134 *536A128D22F333D919813CFA4FF5E1F5703C0284 dunnotar
804,176,135 *536CEB936E99E92D16D9E53A7965378A4B63B78D dvomn
804,176,136 *5362FB9307E0A0DF31E41716196A09F3A2C72454 DWZLO
804,176,137 *53634D9C7C96FF26E379F7A49710CB923064F357 ninocula
804,176,138 *5368296139DE0ED7AE348B9586C8B639372DDE28 nolanarkontaky
804,176,139 *53655C7B4DC86573EED2CD50225C4D0817BB8C2B NORBERTMAZOR
804,176,140 *536A16856226CC48C2E8446A9F21906BAF0C30F4 EASTSIDEPARTY
804,176,141 *5361796964935CBCA2CB035D9C6D74B45EF61D45 ebbdc
804,176,142 *536BC0F00F670F6BCC1813F57BC56BDA720CC00D [email protected]
804,176,143 *536C8AC2620B56AB1D438146F52F16E80DCFB66E [email protected]
804,176,144 *536017E840ADE57FBC34D664B5237AA8873CD1ED nuvista
804,176,145 *53618DF92E3BCD7A1F7D9645E93D035E31710AA1 edstocknews
804,176,146 *536B282616BD94074C820866623F73D35FF403B1 efgn,
804,176,147 *536ADC61D57BD609AB7F253E2253E630457CB7DE eimsilyt1
804,176,148 *5360EDB1D9E4DD84F4BF756D420D9B4684D74D1C OLLIEBOARMAN
804,176,149 *536FA31611E377CFA5B4DA2340D25A967A0AFE4D OLLIEHUNSAKER
804,176,150 *53618152CF9E96DE96909C6BCB3AE0B8EB4FB679 ekeizfjik0
804,176,151 *53615719C72976892063E4EC129E022FB4E9010D ekv)s
804,176,152 *536EE1FAF55228CD273727B07E9BF2DDA8C26F6E organima 5
804,176,153 *536ECCD9947D7527AB3327628996C0FB1BF5A84C ELMO.SWENOR
804,176,154 *53657EA4BC7637E5D32B9E55AE7DA73BB4EB128D ELOADAST 4
804,176,155 *53616F5F0947B4AC3D5C20B4D3EB94C166CC5DAE our.first.stop
804,176,156 *536CB4CA4303A9F6694FA51D62D10FBE3DD671B7 OV3RCOMP3N5ATION
804,176,157 *536683FDD93FA482846F02301DCA24810514E799 emmbq
804,176,158 *536337F258B3DFA98ED9C9B551586EC2D8ED4970 oyekan.john
804,176,159 *5364E02931ACDA9E3DDDBB35600AD2B82AB2B0A3 P1UMBB0B
804,176,160 *536EB5A30B6571FA871FDE45AF896A0D9FC36C1C EMORYHEDINGER
804,176,161 *5364059B2F461EE0B9580637F48B91DA1BBB7282 padakrad
804,176,162 *536A8E8579A730E9F2B08ACE8B4B2C3297A99DAF EN151.199.7.111
804,176,163 *536D1F7627B43EAE1262EC71F9ACD7D3915148BC ENF!14D!NG
804,176,164 *53635AA1FFA25D2EC39E7F838C79DAE39748A904 PALMERCARLSTON
804,176,165 *53688FCE8222496D969E87A59827F32AA8842292 epenveld5
804,176,166 *536E059D0A498F40E31F2B7541A460EF51E9A54F EQR2#
804,176,167 *536F67EAC4DDE17431F208915A803B419D6EA86D ERIC.LANDAYAN
804,176,168 *5367325BC6584069D7A6C73BBF24FDE4F67D5B8A erroleisman
804,176,169 *536750C46289F8611561A57E9EEBC4AD0A1DB055 PAUL-SELBY
804,176,170 *536A8D0563340915BBA7D0A5AB93060BBBB81792 P====B`~;)
804,176,171 *536063257A59F3F1E0240A81FAD02CBD1BEE280A ERZUERNT5
804,176,172 *53680E84DEBCF3140B8B38EFEEE934FF8DAB135D ESTERBECK
804,176,173 *536B81D8D87B898BE040166A7F908CA0AC683C71 PEDROBOCKLUND
804,176,174 *536384A74AD55A4AFAF19FB7A2BCEC157245941C ETHBENNEBHTE
804,176,175 *536D424C819A674DE39C2444D7160D846EFCD48A EXO2PT
804,176,176 *53694A83FE0C279CDD955619B14D6C2A0881F525 FACHGESIMPEL
804,176,177 *536CA39B3051B2F434DE2D21C6602E78EC18BCAF falsifikat1
804,176,178 *5363C9ED1DF682C0BDF3890974A88D9C7968FF17 [email protected]
804,176,179 *5367E25BAC8387C202B127A4223A336C69B046BD farigicubih
804,176,180 *5367654696A94687C8134D72EC86C71572FA660A P)~O><
804,176,181 *53618A94D4E8F98F863AC4B15A61341A3A0C8843 FERMIN.COLLERAN
804,176,182 *53617DD8677E6D91E4A4A6828CFE62920398C029 FETICHES3
804,176,183 *5363418A0EEE78BB1073E2EFC54E306760A172D0 p===p~-`-Splat
804,176,184 *5361B1F649B6AA719CD22D9AA6F10449FF91B75A FOEDARUNT
804,176,185 *536A7669AF1B61A14A5781B1F7EA6235D49387A9 PREPLAX
804,176,186 *536788CAA29FC363A51C4DB1B768E216FEFC2623 PRIYA-STH
804,176,187 *536C424B918A61006DE1CEE0C73A29A88036F35D FREAM1234
804,176,188 *536371C1BBFD22362E584F761FBA0CF1AC0F2083 freddie-andrews
804,176,189 *536F2CDD8634B9A23CC3450F88D2613CAC9DE6C3 FREDDYOROARK
804,176,190 *5362707B6D7580790B8D37FECC4DF242E297E902 prologuethediscovery
804,176,191 *5362060F388D69A1AED76303D8D42D409A9BD5A5 FuckOffSarah
804,176,192 *536EDAE07FAD1C1AB1EA287BC2DD1C18D0BBD015 PWIZARD88
804,176,193 *5369F400E20A8F83D6186A0559415B7146849B52 p>` )x(
804,176,194 *536A6107167F6E42CBE8E25CB1C5EF3B10FFEFEF GANDALFMED
804,176,195 *5369C516D136A82C1AC0F8432CD8CED34E3990BA [email protected]
804,176,196 *5369CFE6BBAE40FAD37A1F786969FDF20E00277D q####p.~0~o.(><)
804,176,197 *5360D4EC107E7948721377093F6D211BA6C36F18 garymccance
804,176,198 *536328A1AD4A8AAED2AE364308953DC22E1A5E81 GAYLORDTURNNER
804,176,199 *53684B60DEC7BBEC388351FF830E21733342F7D6 QV~
804,176,200 *536C8BA0FB3FDCB99FAF69BDFF749ED7DF87831E [email protected]
804,176,201 *536CB05D7A725D57582B73C9C573D83DC66FA6A6 gekrompenen
804,176,202 *53618B6F3824A0AADE8AEF8AB8DC020D5D43DE68 georgebugge
804,176,203 *536B9C5392DE3DAEE716FD565639882B59BD9FDB ralphikerd
804,176,204 *536E26AD2AE28904E7EDE702A2B57CD06FA7D609 gerardobernardi
804,176,205 *5363963A62A2FB7A02775734B14D15A2841B00BC gestapelding
804,176,206 *5365E330E0EE310FC6ED43BAA091A4033067EEBB RASHAD.HENNEBERGER
804,176,207 *536B4F0B03995ED345528593801A793167488448 GIMPPRINT
804,176,208 *5368166441CF2A751F087DAD2A6169CB7698002D ginonihei
804,176,209 *536F635F99533B7D6AF99F0288247E55A9B413EA GIUSEPPE.LANDING
804,176,210 *536AC5405D68944795CAC86EA72BEE3A39021A4D GJKBNBRJ
804,176,211 *536E55FE238518A6EF63DC835DB570306A809EDB recredit8
804,176,212 *536B0E708A4FF26CD4777913AE3CF256418DA055 REINALDOKONZEN
804,176,213 *536E070E09EB368D7AED4565740EBE228EAA90B9 Good-Morning,-West-Gordon
804,176,214 *53694B44DC3A42AD1D9C7F7C0211187D16D9CCAC gordonhustace
804,176,215 *536666AB4A926265795550EAF23077807EB70C5A Graduation.vs..The.Ruins.of.My.Life
804,176,216 *536D3EF6BFAE811619F0B41B5B168C006A1A5557 GRANDJANIN
804,176,217 *5367DCF6A6FCCE682B12F0158F856AE631D88F03 gridbias0
804,176,218 *536DEBA63C5CBF88FF138801C5080B180314DFCC revolution: a rock & roll tribute to the beatles
804,176,219 *536CBD682DD0778DA04F0EDA9E7B278B439303CF GTOOFAN
804,176,220 *536CDB6277F9C3664F4CC5120490B7B2CE0DEA2A REY.MCCREE
804,176,221 *536E7E130F3227189615186AF0097926B32A7C06 rghtfu1ne55
804,176,222 *536A0452F1708F33D14ECEE918848514D04C04BE guswedekind
804,176,223 *536EEB9B296FB9A506618257FB8F43FE62196468 G^VJ
804,176,224 *536FF81C277365D84D94F4AC4193BC9C66E35A2C グレンダイザー・ゲッターロボg・グレートマジンガー決戦
804,176,225 *53626422B2B4EC2551B44B692231942D55A7EF3D RISKIRYH3
804,176,226 *536301E483BA7F9BF3985CC4E23302F61F096C41 HAIEMPLEO
804,176,227 *536866C58E7A8E2D33FD53BF2347102094B2DE3A [email protected]
804,176,228 *5361BBA4FA4FE86818F910FDD12F3D30167B2D90 Ham57rn95
804,176,229 *536A78F5576E822748544709A2B54046A001FE95 HAMSTERASPEN
804,176,230 *536695F0AB656C36FB485BD0D69B6207BE827924 RN<}
804,176,231 *536B0C427029F0F9D45ED8F4FEC4708C4B3EEB7D ROBERTOHAAKER
804,176,232 *5362CC058A05DBED80FA115CEB217F82A39EAD90 RODERICK.BASELEY
804,176,233 *5367400CEF98792A6A1D9DB227A3A3FA1CB785D0 HARRISON.DUBOW
804,176,234 *536D23D38E17F60F325B2600E34C7133A38D8313 HAVOC 2027 (ESR MIX)
804,176,235 *536BD85704D02D1ACF92EE35022D00685CCFF0A5 ROYCEJEANMARD
804,176,236 *536665CB17E1654C99DD581ED4C7601A4FE1DA16 her.brown.blood
804,176,237 *5369A0F9E257881BBB11832D1DA3E34622CCCF78 [email protected]
804,176,238 *536A8A554DEB5ABD9276E5F62F5C829F854FA706 [email protected]
804,176,239 *53623A26C908858EE345E1950A4B9235FDB69C30 hitmenhurricanesfaceoff
804,176,240 *53628908AF1E606D655D01E344C5602E3A1F8F26 S4DOTRUL3
804,176,241 *5363E9AB3DFF008AE14EB65019AB1E19F6CBD044 [email protected]
804,176,242 *536F1BF156AE253AAFACD274115EB565D4FBD77E [email protected]:morbius
804,176,243 *536DC20D146852DCC7B84F6336D94E920E31BEE7 sailsite
804,176,244 *536D39FC1C5534B0C4BEB8FF89921597607AC1D6 houstonanstett
804,176,245 *536F9180F10D4D3D941EC7D94775C2321593378A HTTP://WWW.XANGA.COM/PACO_HHS
804,176,246 *5369D99EA6EB127474BD01FFDA343335C6F55D29 [email protected]
804,176,247 *53695E4B196000390DFEAD3A7D278AAB9F4AFBFE hu?b
804,176,248 *5362D23E77BABB36A684C2D9B5DCE743A67DA481 SCELTI5
804,176,249 *5368B929AE9986E3D7FC18E8E7F3A12A7FF67F34 SCREENSS2
804,176,250 *53634B49CD07429D88C2E8404C0B9C80C193F9DE IDIONODALS
804,176,251 *536BB34712DCEAB7F52690BA9B91B1E4F60183B7 I GOT STRANDED
804,176,252 *536C98B107360FA596D8EBA29533B94FF653E92A septuagintal0
804,176,253 *536582324243A467657BFDE8A2E957FF5DEC604A SETHTREMBLEY
804,176,254 *53682642654C08A662C7FBEFE2DC294C96DAE8B0 iloveescort95
804,176,255 *536AF7441C5F87362CA93B57CC20036CAD4B95FE incolperai5
804,176,256 *5369962795AA972B216AA1B00E8273718A4E51D0 ineskuma8
804,176,257 *536EBEB9C0A1B740C8CB0F4C9ED68BE46655587B SHOTHOM4
804,176,258 *53653EC383EB280EFF2E9C81C27FA1D386B4CA41 IO7ACI5M
804,176,259 *5361663407A5751A751A6449C70F77D91AD8544E SIGURDSSONED
804,176,260 *53688BADC41388A2BDC6DDBA1B348559E8650547 situational
804,176,261 *536FBB2A5FAA506ADA97067EB4DE469BDB08CAF4 SLAMMING CREDITS
804,176,262 *5360BD171599CDB1F922ECD5322C8A326D8499AA SLSTV
804,176,263 *536CABA0B6E5298873B7F61CC69FAB2801246A9D sodorisaient
804,176,264 *53631A3F81DD6FD8C4DC1700B444FEA9ADA16B71 JACOB NEALIS
804,176,265 *536C56CB7D0D1393FFFE8AEB31A7E951A9F0751A [email protected]
804,176,266 *536EA5ADBDC149EEB6C40A7DF4BF13C97F36534A jamaalnonu
804,176,267 *536B8E59F4AAC79B4DD55D591CAA2A16034CC573 jamaicabanningdanchehallmusic
804,176,268 *53682A15DE8B28125FEB9784CAA3F7A2FBE2A4A1 JAMIE-WETTON
804,176,269 *536037C710DCB8D88C0891EDD808F1B093B56E5F janes-jane
804,176,270 *53652E6580EE5329BB36A1B54E75C811DA18C68F SP33CH-CU
804,176,271 *536084FF193E2A3989328B409C5A089B76C67B86 jasmine-granger
804,176,272 *53617CD7C5C20145DA95804106F78E880E960399 SPEEDYJAZZ7
804,176,273 *5366A123FACCF9595E91EEA56F9EBECB6F90EEDD SPENCER.SHACKELFORD
804,176,274 *53624A6540EB6AEEB1ECC7CF9E9E3AB4144D1B29 SPILL3AUT
804,176,275 *536805C95A7D71EE3819C97B2FEA82B47383EA3A SPLAT.*.*.*.<###3
804,176,276 *5360DCAD93C4707751E9797883103B4ECD16BCC6 SREMROVMO
804,176,277 *53601394ECCBDDA7C94427453AEECCF40C135E84 jerolas
804,176,278 *5362F28F360CB1DFEF8A165FA6502A0105D53885 JERRYPAVLICEK
804,176,279 *5364284A56D3A22B84B38E611347E5315AEBC8FF JEWEL.ELLES
804,176,280 *5362508D9ECC736B4DEDEBAA4B757923B5AC6EF6 staehcxeh
804,176,281 *536221A03E8AAD231388632440FFD2D3218EF169 STANTON.BULOCK
804,176,282 *536FF97413C66695123B4AF39CA491DC90AAD72D JEWELL.TAYBRON
804,176,283 *5363C392F475BAF5F283FC227ADCBE10215CFC5E STARWARSPICASSOED
804,176,284 *536401A3397A61523C6F3D1AD3C7F5872A6994A9 jimmiedurden
804,176,285 *53625EF279DC0A7E2BA4E0E40818A18FED74A7B8 STEMETSYS0
804,176,286 *5364A4DC282C7D34D90675B5DF7A3511AE5C0FB3 [email protected]
804,176,287 *5369A35CF4346E59902BDFD492D5C27083EA4B5B JJ1R
804,176,288 *53696F8CBD6D910BECA00D031E67D9562C7B2179 johnson-ferns
804,176,289 *536C707553E95DE08D7EE0E7B4F7E59201E5084C JOHN.STILLINGER
804,176,290 *536700E08E4B5C4E30FE4ED8DB106B28DD040B0D Join.Me.(A..radio.mix)
804,176,291 *5361ECC9D541CB6B727032A60A5E8B3E023D343D stevieswerdloff
804,176,292 *536ADD6C24C2710F8144783A3A56E3F8241DCCF9 JONATHAN.MOUNTFORD
804,176,293 *536A86D4E2CB1D75E2D842A06DAF152812E7EC54 JONNY.CAMPION
804,176,294 *536DC28F53F96799A87C1CD0DAC4B79FE4A47122 JOOCHAN
804,176,295 *5363EF806F954C81EF1B593984A76F3BEBF2F077 jospehdedeaux
804,176,296 *5369C1023392E1DD0FF5F10B5EB892B70ACDAE65 studentenleven1
804,176,297 *536D2B33E90FB80E623434E9D2B30D56513E6AA3 jub113$
804,176,298 *53650ADE45F3583EB7ADE8003FAB575B4C85DA59 justinbirmingham
804,176,299 *53642B50340B88E08E71660388BD77320BFE51E0 SUPRAAAA0
804,176,300 *536B1917909E719E1B0446C8C562EF60C81CA5DD KalaniKealoha
804,176,301 *5365EBEBCF16B867DA79A34CC1FD0B7A3B862446 KARLBACAK
804,176,302 *536626073F7B37F5EC550E31E6ECB8CC10F5222A kaseyprohonic
804,176,303 *536F380A35DA1E54A3B4F271B2D98916F869BCBE KASHAN-SHAHID
804,176,304 *536360723B5081AFF4E044264A0E9C8A61FD8D98 KASKUSUSWWW
804,176,305 *5361A4D9B0FDA56A50BEEA9451E15F0BB018A74C katahrining
804,176,306 *536B7B4E10618F702DFDA58DC02D8AAD4CD037C2 T0NGUE-$W
804,176,307 *53634D84FD5C2D857DA0F873EB116CF399BA720B kcmorg
804,176,308 *53634376947934ADD0A24C14D642072DC08D940F k\d.
804,176,309 *536B879790873F42C51A8F5316050480C697065F kellysanschagrin
804,176,310 *536861A51BD4C61629E8F62AA358F0E029DE6BFF TALMYNDIR
804,176,311 *5369878C91BFF6A155BE5C7E9766173BAFF88D63 KENDAL084
804,176,312 *5363316B78744CC048055903F4C3066D5868EF18 TDAKISA
804,176,313 *536740E8FA0B36C78DF5CCF1AA01C7DE772CF84A TDATSRAL2
804,176,314 *5369A475DCCB93EDB1FACC9480E09939C72700A4 [email protected]
804,176,315 *5365465B105CC3F112DB91760DCF5E1DBD7B43D8 KIOTOXX
804,176,316 *536685A279A08E5401EFF3B7785D3A99E097E377 TEGAN HANCOCK
804,176,317 *53603F2E2CC00D2045087B934B541DFDD2B3A932 klppstn8
804,176,318 *53633F6B32CD24542BD73601520F9AA063050B1F KONOPNICKIE
804,176,319 *53674FDDFB90EC3CD67A0D3E65A3FE4A862DE89E kopete-otrfollefude
804,176,320 *53652E51CA6B364367967E8C0DCD1286E6B5BDC5 KORGESX1
804,176,321 *536E66FF4777258AD2C3D316B4281594C28D9BF5 TERRELLGANGE
804,176,322 *53655A8AA1B7DAC4B0C00F06B29F49F91F367A54 TERRYSTRIDER6
804,176,323 *536943B4633CAD5C1CE7407C348E0CD57F3F1DBA TERTIUSWAAL
804,176,324 *536FAC76823B14E73C3F08CCEFD8280DE4374965 KQD;
804,176,325 *5366AA772DE90431AFA8FA2B8D1D307A7AB991EA theizrevs
804,176,326 *536F323B09F4223161852920789559FA5B16DEB8 the-Virgin-Mother
804,176,327 *5360DD01CCD7A8585BB04243E1BD6064929BACD8 thinkingreedwordpresscomthinkingreed
804,176,328 *536F4F52B1E2E5DA33E8EE6E59A23851B7706918 laurenjasmin
804,176,329 *53653646236171AF737AD0CA96C7A86FD7824A50 LEANNABARTRAM
804,176,330 *536B5FEBDFF857AAA697FF7CC4BE126AF10F4043 tilskik2
804,176,331 *536577520A5124C7AF107C8C28E5A600A94E83E3 LEONARD.MERCIK
804,176,332 *536A58DE36C9921528AFB8B823FF1796A7201902 TITSYL
804,176,333 *5362EB2BAB025CE4C48F4238A55C5E4F4049A209 [email protected]
804,176,334 *5366FA7E79071FFF6AC3DD486C09683EF8969842 .tlebs'noirOnotons'tI.erehs'yxalagehT
804,176,335 *536A2E7117F56DCCCA578892EAE5F4C9EC147EA7 tnassiac6
804,176,336 *5364D5B32434D03C3FEAF54558F3851606C9BE37 LHCORDYH1
804,176,337 *536D35DF85D8D9386DA2796617A2AC2FF40624E1 [email protected]
804,176,338 *536DCA89D27A0C178ED9E0BC1F2226BC59FBA5AE liar,
804,176,339 *5368D85E69B2F3586777687F5CDD3882C8C90858 tool4life
804,176,340 *53608099FFCF6B6AC1996CA70BFFB67F0B9259AD [email protected]
804,176,341 *536FDAE509F3457B3BD0677502122C50156FC76F toxicemi6
804,176,342 *536D73DC876F35107614189DDF8A6EE826516C44 [email protected]
804,176,343 *536A932E9E6CE154A5781319A023CFE20A586B29 TRACKSPRESS1
804,176,344 *536825BB3604C3171DD793EBEFAC0088878FB9AE tracyeng
804,176,345 *53685E6E36E8767195A3DED41E8EA81E8886E035 TRAVESTIED
804,176,346 *5367CAB62212334DF1114D5FD9CD7E3BDA70A823 [email protected]
804,176,347 *536A1BFDF1D8585DA5726BE806728B78339D6A97 [email protected]
804,176,348 *5361DAC84C663BAECFA135443C92E8D1E31DB342 trmmnjnl
804,176,349 *5368D143251035C7E040FF68260D64CB535922EA LOITIAS1
804,176,350 *536779984AC0B68A9E44E63EC3396F014EF09D4F lonniebeardall
804,176,351 *536993E38333EDB48EA7B3B8513FD90211FD71E3 [email protected]
804,176,352 *536E251C2F81906FE90224D31BEE7D8565E796A1 LORDPOLONIUS FAREWELL
804,176,353 *5361BAB2BF87CDE99CBE43078444E8B4EFEE38B6 lotteret8
804,176,354 *536E2B368F096B38205323CF91BA9849644E54D3 LOYD.LANGOWSKI
804,176,355 *536F74387F543510E220532B4489A16D44528301 TVERRSTI
804,176,356 *536EE30835CECEF23B1AE22219DDC3D1A2A8609F LUCIUSZAKARIAN
804,176,357 *5361C5A34CA596EA47C7FA41E638A255C98C792B luckyflyers
804,176,358 *53603403F0C4280E0D429C02027924F20E12B17D LUMINOMETER
804,176,359 *5367262B294E995F5FF866C4A6B57C0FACAC704D [email protected]
804,176,360 *53662134ECC299E1C6A5262F2EA8B52B48A08F4B TYREEFLISS
804,176,361 *536B279B2A4B592FFFC7169E6B9C0C3ED24FF395 LUPHZ-U
804,176,362 *5365200F32A2801BDE01063E37D83B9BCBEC1701 LYEPAYUABAAHAA
804,176,363 *536BB806FB3BE831B6D283DD2FEDD63555EC02EE lymanrasch
804,176,364 *5364C90CEAB8FC22318A497FB6BE4FEE8D0B5870 UA4
804,176,365 *53630CE85571B75A55BDE55A59B4FA284B72A857 UBA UDOGWU
804,176,366 *5361F2D48E2731FC6200F803419526FCFB64BD94 UFJL0526
804,176,367 *53605C65D6BFAF7094E7CA44D5422F0CA6423C30 UGJOEGEN1
804,176,368 *5368A84607C60E4AF58717316C30A17A7C76E1F4 UNBARSES6
804,176,369 *53662C7CAFDA468895AA90F40D7FEAE14B110D92 UNENTERABLES0
804,176,370 *536F43D8EA5A363440188B402CF68F8E4F699DC6 MALIK.SUMMY
804,176,371 *536F65286B41C517C4E9A6139C80D8936F6C5304 MANDONAGHE
804,176,372 *536EEB5DEE0EBD36A9400A1680B52231FAA81D5E mangkasar
804,176,373 *536706E1BFD53B9ACED0E47C8F0BE62EACADEDBA u=sb
804,176,374 *536ED9EA46B70FB3C30B0242F7B53E1506BCDA06 MARLIN.SEXSON
804,176,375 *536E49CDEE0990A31AC4FFAC9E4FFD35B99682F6 uyxnqk
804,176,376 *5360A397807EDEE36D07344205F49AC0C8803341 mass:partxiiithelord'sprayer
804,176,377 *536A22094F8C26B254E7C41A338DE5B99BE3A8B8 mauricioiberg
804,176,378 *536E29D3B5D2F4ED07DB46E343D92F1D678AD7A8 VANDERMONDE5
804,176,379 *536B1AF505657A63D8FE27FAA6ACF0709121D5C7 varesepalu
804,176,380 *5361AA701C657206D10201E9E32C5B40AFC191B9 VEERESHCHOLAKHE
804,176,381 *53642CCB037FC5D92D090181BABAE8B477500599 meithei0
804,176,382 *5362A54D6D22F5D311DDD6C180EDDA80E0DCA945 vernonposas
804,176,383 *5363F7053520DE822D2F1BB5CE1E9679E3627272 MERLE.HILER
804,176,384 *536B19DD6984B3B315637C124DB2972B0F01F793 VEROUUDISTUKSEENKAAN4
804,176,385 *536FD390003448947C481F12AC16D00E1644207E VETTEIMAGINE6
804,176,386 *5361672244041A4FDC29328088AF9A7766093A00 [email protected]
804,176,387 *536AEE563ECDECD45DE8CA9871FD67008AD2507F VIASNMPPING
804,176,388 *536BE0650BE4B7DF8E701DA13B709F8CF84D5F8B [email protected]
804,176,389 *53672FFDE0E21E2D5B5012914445601437587A5D VICTORIA BELMAN
804,176,390 *536EF65F7F6181A9DDCE6BF729E1736F34EF2B92 MICHELE-EDNEY
804,176,391 *536AB12C9231982EF416050E85713C7DD7BEC050 villista3
804,176,392 *536B74D5AAB52F34BDB86E0BC1BF8E32B4D07986 VINCENTBROMAN
804,176,393 *536D0410771AF75E8EA0738233BD544E02C5CDC5 VIRGINIA.VELASCO
804,176,394 *536D033A1EDC41D840B42469870DA1B3B74309D6 VIVIAN YEOH
804,176,395 *53679777244FE7C5B9FC0EDA9876A7A5D58B31A2 VIVIENNE NORGROVE
804,176,396 *5360AF2782FD5D98ADCA13AB58C2199A0860AA2D VLGGMST2
804,176,397 *536631D710705F83E2250C8BFF6E6ABD8DF2101A [email protected]
804,176,398 *536A49C724736BF91F546940FBE9B3E95C8AF404 VON.GEROLD
804,176,399 *536ABC8F7B482332A878FE1C6CE7DC20D9566DAF VOORGEDANEN1
804,176,400 *5361B0D34ECE7BAD987E1313A7F06D925FB4EB3F VOUDNLL
804,176,401 *536101F2DC7ECD1A4E1DCB26B5D7F3D0D3A6F03E MODESTO.SANISLO
804,176,402 *536380FA564C3D51D0E7B39B33246A9BABF6E315 VS7G
804,176,403 *536D31C6C496DEE80F0F82231BAA07BD3F8BF383 [email protected]
804,176,404 *5368F8670FA032789A92A7E937227655F4AB7DC7 WALTON.ELLIE
804,176,405 *536495141F31CD18241FDA95245AC886DD827C84 mouseespanol
804,176,406 *536DC50D676DDC1729D66FFF12AA5015A3CAF314 MundiantoBachKe(BewareoftheBoys)(feat.Jay-Z)
804,176,407 *5364BCED846C344C71E0BD5C89BC010B427CA201 waylonlairsey
804,176,408 *5361B05080CD495CFBDF866B806D835D2F8BFA32 WDAGUMAN
804,176,409 *536C59F810376F1D00FE5CC6FF1AA671577360BB [email protected]
804,176,410 *536C35C53C66D92E39B092CBA906B5C20C703F0B MYRON.BAKLUND
804,176,411 *536AFB5480D0C960702123F59115CB4895CACA21 n%^
804,176,412 *536A78B13F0AB1F04DB956789FB431BF80B6024F westminster.polka
804,176,413 *5367360C7283B9F19314E504DD73F389D55B0691 NAGŁOŚNIENIOWEJ
804,176,414 *53623FCFA8DD1580E92286BBC8AFF3FA5E7DA322 where,.like.a.sweet.melodious.bird,.it.sung
804,176,415 *53642F347FEF3C0D33725056FDD66A2F131BD64D NANIF2
804,176,416 *536781F517C57F4BEF9BADCF4796EC96BF720AF2 n-de-los-estados-isl
804,176,417 *5360A77C6BA5BD193277B821AB2BC1C6EB522024 wikipedianyknok
804,176,418 *5363C26DB6A57457589A1AF6D51F56CC37DCEC49 wilfordbastura
804,176,419 *5367CFAD800DB0E41D6F262001C1184C6CCAFCE4 nepo7$7ca1
804,176,420 *536AEC69A36F92A7546422C15CD51958C371AD7A WIN3 C4$K
804,176,421 *5361AEFCF0879C0D9CBF9057547EC0D2538AF990 NICMARSH
804,176,422 *53617C4373CF083B4564D152D1C9C82D5CFD93B7 NOISE-FIESTA-(EDIT)
804,176,423 *53669DBB5CB8795BC6F6EBCB653095C34FB2696B WWWDUKENUSEDUSG
804,176,424 *536E78396433F1A690471E83150407FD11525163 WWW.NIPSGROUP.IN
804,176,425 *536332DCF38C6C684D8CAA812DC00E9FD8416325 WWWOT-MOLSHEIM-MUTZ
804,176,426 *536D5FD9555ECBC85B29E92C05FC1285CE868CFF www.shopnorthridge
804,176,427 *53602B6C3CFD25F6E3BFDAD30178A0CA9651AF3E wynwyngirl
804,176,428 *5368457ED838AD7F01A460C48555C4F7D69A92AD not.bat.an.eye
804,176,429 *536E2DB1A22FF4A4632ED33E7228D1F1530FDCED XGL_
804,176,430 *536179E5739F2259391135A3E0A8E15A3C4CDDD3 [email protected]
804,176,431 *5368FE534D955A1966B27095E6949F41D8E86CC3 [email protected]
804,176,432 *5362D22FA65FB785C8E0F5BDF4BEDEAAAF9BB818 NTONATOR
804,176,433 *536DD805A44A66F82BA3CF7775D450E713420BC4 NUWALLI
804,176,434 *536D09BE6E003B33AEEB1E8FA0561615CE5AB8C8 (><) o~0~ (===8
804,176,435 *5363D603BD9DF85E0E22FEAD648FDCEAD27599BC )X( O~ O~D#####Q
804,176,436 *536F39E671FCF67B3679812522195275A4B0FDCD OATHFULING
804,176,437 *536947AB2CC51E56C07D9AA1722539E6B8463A0E ODISPROSSER
804,176,438 *536515F3CD1BF8EEDDE47ED336F75B243F5A7D50 odvra
804,176,439 *5360F7BD8B5BCAE7D034CB5294B2936AF5120321 YANY ISA
804,176,440 *53664FE95EB9CB7607159180FB6F1B47CCC0F4C7 yessica.lobo
804,176,441 *5361C5F8FA59E7793CEA3CC51AA6F65F0C271826 YKINASCHUK
804,176,442 *5365224C592676F829E07F03DD7CF59CD855D597 [email protected]
804,176,443 *53627DA4DB4BCF0FDB67DF965166BE4A7C74A945 YLBAHCAETNON4
804,176,444 *5361F593A795D8911260288CA91A3D4870071B8D openvmsing
804,176,445 *536D18F54D895B288EBDFE13D817C5D65801F4BA optooise6
804,176,446 *5366016309E64D70516C3945D98A5AD6D2D2363A ORLANDOCHOUNLAPANE
804,176,447 *536D2E91F80E32BD134001776FEAA982F971294D ytcd
804,176,448 *536DE4E77075A14C944C6A48FD3C7F735FDB1332 OTARIIDAE1
804,176,449 *536E798B45EC946BC2DB529DAEB2F75C98D508C6 yuliet-cuba
804,176,450 *5364C8B1A888320953B37034EF70196CE9521E73 [email protected]
804,176,451 *536F1BAD5906E3D7C09B4AB1768EFD0DE73F0739 ZAKKBILLADEAU
804,176,452 *5360D2D79070B19EDF57AE70859D14C68C99119A zeranski
804,176,453 *5360BEB3830A07B1D068E61FA99E55FB3E529D6F ZGRTYA-SHAY
804,176,454 *536A8354CA9E817739E8907E3724D244416E2A53 [email protected]
804,176,455 *536DD9101159385EBD6F089FD93C6FCEC1DB3D7C [email protected]
804,176,456 *5363795D8C07DDABB9830E79552D647889F6375E ZINDDLUEMM9
804,176,457 *536D394EC403A285071D30E6C063808EE14954E5 zingis.radiolata
804,176,458 *536EB138E6F562F4760E23D468C609ED7BBA1D35 P1e8e4n5
804,176,459 *536F5D3B4D6E073DCF463B7B6602E0A4A1A4914B [email protected]
804,176,460 *536F6B756E5B5AC85BD6EBDB787D8AA358A56322 ZTENIGAR6
804,176,461 *5363811EB5EA336DAC9E4D0983E9B1D1C12A1D3F PAMELA.ROWELL
804,176,462 *536E8C5B5C6CC3CB1BA1355F44CB90A77AF02FED PANAIKINAMOS
804,176,463 *53660D305C36BD88754AF72E24DC5C0A1B5E759F PANTANI‎
804,176,464 *536557F34EFA66D9AD80806AB19E960153CBD4DD pāusār
804,176,465 *536D9FCA1AA29C7829556CAC384FAC0C978705F7 p--b-`~-(0_<)
804,176,466 *53660ACDA55138469EDC8A074F7A07EBF9452FFD pcaaa
804,176,467 *5362E3FD16B96FA5C476638E040461D7A8879E3E растягаев
804,176,468 *536E7D071BD6EAA3A598D018E66D1E5AB26A9B97 permagrinninaeliza1
804,176,469 *53697F7D7003C946F091FF44D58632E8A434B19F «ФА́ЛИРО»
804,176,470 *53628FDB27731AE3CDF201A32D6EE1CDE9AC82BC PLATIAN1
804,176,471 *53682505F93ED8A1766B3B88240CD394C508E5AF podobny3
804,176,472 *536EA3F28E7D0E31317AC416F05F9AD4689C43B6 新幹線E955型電車
804,176,473 *536080F3C25F16CB8E47C714869C98E5C83E5874 PW136
804,176,474 *5367DBDA36D46C5CBB34866AE30B6335671C602E [email protected]
804,176,475 *53670AC15ED14B6A0D7D32FCDB9F54105DDBC56A [email protected]
804,176,476 *5369675DAD6A5CFAE792C6AA80F164F10A710D28 [email protected]
804,176,477 *53661856A0BBDA1BB652B78FB8C53C30A4BEF5BB q===P~O(00)
804,176,478 *5362B8B9339F43186F69638E0E642A7904BC5398 R3T4L5HJ
804,176,479 *53668F781087D4820DCAF47D56D3160A02AD4CCE R3VIT4LIZ4V4S
804,176,480 *536B098A7C94A0AA2C04521F39B0522A58C77DAB rakades8
804,176,481 *5367F913B3E6096376E71F764C9D0A937D0FAE23 R'''APIDS
804,176,482 *5363ADC3F750785CA9F471133DA3DE897794C099 REFORMADRESSE
804,176,483 *536B68884E85E4733135765948AFE0A0A6205404 REINE
804,176,484 *5366A24DB5E6591F450E156B93CEB613CD987827 10MERKWUERDIGSTE
804,176,485 *536C2794860237D970708169F57E63DD6AE868FC 12roping
804,176,486 *536E2B6A3B51A31435B7B72658D50038EABA8A37 rfroggy5
804,176,487 *536FF167C030DA1EC8E1E8FD48AE47C00C13A6EA rinkushetty
804,176,488 *536B2FEEC3044D4D85ED546C5FF41D53B48E173F RL0RA
804,176,489 *536CF00FE1C684FDC77CA10BC6ED507BF8C957A9 rock.'n'.roll.greatest.hits:.best.of.the.70s
804,176,490 *5364D9A445297799C8736DEB4141C7602E499C84 1DELKO
804,176,491 *5368CF22ED8F1809C0DE677CD4617ED4B294D531 RODRIGO.ROUMELIOTIS
804,176,492 *536F96DC785FAEB9FCDCB94A16BEB40F612E8A42 ROGRAMEDING
804,176,493 *536C19D6B08AC9DDC8214B8EF78E4A4569C9E420 1.GOSTERILMEZDI
804,176,494 *5363B70EFA24B85708E03252FC50710B1C5F46CA RONNYJEANPHILIPPE
804,176,495 *536FEA5727D3A2F506E4E55B12BA2B84F29CCE16 1HOFJESJU
804,176,496 *536307E05F31DFEAD332337F0A6B104CC055BCD1 1.kontrabassomeininkiin
804,176,497 *536886E8C436D44D6871E45CCE9AD6EDECB249A1 1.MARTKWERT
804,176,498 *536AD8BD73FE95538BEF8C014AB33B6250309C2C 1 MILJOONATUKI
804,176,499 *536D11B73903AF0C64233FE2C7F344F831524B5E 1.stasi-haescher
804,176,500 *536E4499CD2AFE21E2F2E17D5EEC2D9F52E2D7EB 1teure
804,176,501 *53612EA88890ED9A2D3EF29E58FC654AC7A8CA5D SARCOPHILE 'S/A/RK/@/,F/AI/L
804,176,502 *5364B399028BC3A72E5E88270DA64C6C2F55C01F sármégy
804,176,503 *53617EE583EDC9D72E9484A032C6CE413FE01A24 sayangeko
804,176,504 *536E4F81BFBC578FCD7B57A5744115B133031519 SEDOKTEGDUB
804,176,505 *5367258902DF5A7CDD6B4FAAA2E92B4CA4036E04 2:11#-&narraganset
804,176,506 *536ED8AB9248AC652BB5D4F3DFA513C9CBC4C472 shawndeveja
804,176,507 *53633317C08F976E1C3A9A3FA225C55FEDF4ED7D s^hbaa
804,176,508 *53631E5A11BB5B3F7E8A1CDBD181002ED24AE753 SHIKURŪ
804,176,509 *5363CC2B27BFCB7F253218A689FE7E527297BDF7 silevens0
804,176,510 *536B03BEE953E36800720135A154F69A496C845C skytron7
804,176,511 *5366932CC43EF4CCF616B5E0173946DCB771A3B9 2798875 DIE ERGEBNISSE WAREN 1997 AUF DER IAA ZU SEHEN .
804,176,512 *53647332B9DD5024A5D6C68F2B1DA3EBAD3C86AF 2-OMOV
804,176,513 *536B61CE1D39F793A87874953B836CD3178CBCE0 sregarg6
804,176,514 *536D00DC1C8CF93F76181AB6A329EEBB198B2683 STEPHEN.MACO
804,176,515 *5364F9344AC0965AFB7BB1C8B6C0BB6B4FBC2040 4DEVONCC
804,176,516 *5360F0A8BBC6BE4981F51DEC51C99D020DE053CB STONEGREYSOIL
804,176,517 *536A0BD708855589203DF3A6A71EF8286BE44292 SU[email protected]
804,176,518 *536C17B8A83D5A6C5FB70CD82BC35052301FB3FE SUNDAYCARMEN4
804,176,519 *5364149FBB17FAE1F1E9999D7ABF8EDADA71D812 sungreznicek
804,176,520 *536BEA7BD5BDCA1D0FB2B3A474D20AA1F692E260 sunil.awasthi
804,176,521 *536C40D6E8159B3C5643DD9F57AC549E3CFEBCDB 4TAVONDJE
804,176,522 *536A24771245FB8369CF76814BA4D08759A71EAA SVAPSYES
804,176,523 *5361BD2863781B69677117B93BA7D22F79DFD713 5:..5..-#..-&...carson.city
804,176,524 *5363C7737C4892C0EBCB92E6CAA626C222185EAD 5CATAPULTIEZS
804,176,525 *5368F39734AE795C2F84B1FB939CF7E48427FCF7 TALKPROSENCEPHALON
804,176,526 *5360B2FB96539E198AEF0A95BEA585200E41EC89 tamminh4
804,176,527 *53645550284D1EA0DC8FCE95F60B9EC1B7DCF083 5ITKERKIN
804,176,528 *53663E9E5BB0BD0283892431C619CBBE3C9DF91B Terry.Venables
804,176,529 *536D5109C88892D379CF0261EDD8B0EB7FD51C5B 5LETTHEMEATCAKE
804,176,530 *53605BC032FF5224F883F4AC9F028D36A495C553 5ROXYUNICORN
804,176,531 *5366BC069A58C2DE9CD3C423DD8D60D98D3447E7 613131 ARVIOLTA 500 000 IHMIST
804,176,532 *536F449B9A17B691187E9222E7CA401AAE8FEBEA timmypiasecki
804,176,533 *53664193E336A64E3EFDE5F9250989E48FA487D5 6IMTIHANDAN
804,176,534 *536055C70E66A4CB222C8AB70706FDF98EAF86F5 TNAEMPIRII
804,176,535 *536E38409111B36F13705BEAEF0839F9F9D5E523 TOMMIEMAPES
804,176,536 *53683A1B4C5FAA21506D2EB24CD61AC0BD6A096F TOMMYHOTDOG6
804,176,537 *536397527A3A2A08590255889766061EC96852A6 to.nie.petak
804,176,538 *536FA831F50A572D6138FFD1FC8514126D781453 TONJA BAKER
804,176,539 *536959356DFC9C713F7B385BA282E88F1B814A61 TORYCHANGO
804,176,540 *53677B80133645AC7449725794841B68C633CEA2 TOW[email protected]
804,176,541 *5369C5503FE260F6B8D8DB8F6DD8DECBC96E8D1B 764723 OLI-LUONNOLLISTA-,-ETT
804,176,542 *5368F9C5C86D6C00BC6B88CFDDAC7B62A23509EE 784416 VOIDAANK
804,176,543 *536AFD980104DA84F0DE566B0D73F2F4EDE0FB96 trip13n3s
804,176,544 *5369D261228CACE24B036DDC0D193160E8B0A6E5 TROYBIENASH
804,176,545 *5369AACD5CBCDB46833081A698ED43064298A88E 7HYLTYIST
804,176,546 *53651479F33A46B42C1EB4317FC5B15399B07CEC UKUPNIMA0
804,176,547 *53647332AF15384CFE699006C91C747376ADE8DC un1mpe4ched
804,176,548 *53627341842B6A89A7E489614D5846D201133E24 UPPZTUH
804,176,549 *536259A3E3F4E7266747C79DE232A53176440FBD 8######@~.~.~O->-<
804,176,550 *53624874AD4F5BEC23FC9854E828311B4F6FF215 valbjorn
804,176,551 *536B35A1A4EF2CDA79E5E740700E686A6CF76745 vanity-ledesma
804,176,552 *536365DA4E99D8F5882B737A1DEDBC8DD491BAD3 [email protected]
804,176,553 *5360D4D38339EDFDE7C7BA70FC6DF05EB0387866 8UBBIDENDOVI
804,176,554 *536EF9F48C2D50A07513A1C982E33AB42965D269 9BSWFENDREBSW
804,176,555 *536BE06BB7B40FD6653ED749B3688F9AE973761A 9e536651cb42949fe03f0ef4ef457d4etr4Pfh
804,176,556 *536E3EC106A49E4752E70FDACEE532AD528F6B93 VICKIE HUBER RASMUSSEN
804,176,557 *5368B4D0AF47A069DC96FFFA3CC3C85916BC6778 9LYNAKTION
804,176,558 *536A9B8F85C4307F4BB9A0469FAB0A904FD682C1 9NDPORTLA
804,176,559 *5367334FD1D34B295B12D8FA6E0D22E864CDA12B VIKKRAM-RAVINDREN
804,176,560 *5360A775E62EC60A9FAC466B173046EDE5227832 9PODEJRZANIE
804,176,561 *536113F4DB6CC200235745F5286288EA7CDEEDDC 9TEGLITE
804,176,562 *536ECAA80A9B669DD029F73ED702261DC407F171 a-:
804,176,563 *536ED13312D47D2A83514B9E598A2F1795B808D9 WADE L SERMAN
804,176,564 *5361623887937D5C50C483F16D5F69513DF62EBC WAKARI9
804,176,565 *536DAFA9D63F19D36BB9EECDCF274E8AEE2A3BE0 [email protected]
804,176,566 *5361D9B685241F66F173B4826D387F1B683690C7 aaa,kj
804,176,567 *53622F1DC8BB602026718021303AD5C0F008AE7F WAS HE NOT BORN OF WOMAN? THE SPIRITS THAT KNOW
804,176,568 *536AF1D35DF56D7BFEC864D56810A58BBAC5DC12 watch.your.back.(electro.flow.mix)
804,176,569 *5360DAB2BA8C825A574B567E9E31F581C1ACE91E wayneestabrooks
804,176,570 *5362EAEBAAC37104C93F51C0D128B040A10F8E6D weeseetsa.maeding
804,176,571 *536C7E2039375D4917DE10E48B21E068DAAD3631 welcometoeternalyouth
804,176,572 *536B051CE6AA1B405428978CA1DE7E5F2AB0982F weltladendachverband
804,176,573 *5367694B37C6DCBF5C00CA801FB4DAF13A90702E wendellmcgillivray
804,176,574 *5360207DA26FD4BC36914329CD9FB1B8135AAD44 WENDY-GABBARD
804,176,575 *536EA2CFBA2CD0E34701C669D41B292FCBCAAC05 werklozenkassen3
804,176,576 *5364C795359DFA597679CA9CB6F8FFC179519C6A ABRAHAMROUNTREE
804,176,577 *5360DCFF29FB5934BB2122C6EF13C38A884498C4 ACDKI
804,176,578 *536129784AD70687C6AA0AEA20121CFFA01A4275 acj+&
804,176,579 *53627DF4432D841750E536180F0576879CEED3A0 wk9s4515591np
804,176,580 *536BB036E063CD4BBBDD94281566478DEFD7D8BF [email protected]
804,176,581 *53600F0604CC499F5F9F6A7AB004B24DD43C0802 wolf c
804,176,582 *536EE477C8B5D782BF13BB90242931EB414F1274 wwwcreationsfremontcom
804,176,583 *53675D32F324DFA15DDDD64E3488A6EC0B054084 WWW.PTAKNOEL.COM
804,176,584 *536696E6432E2AC1441A8B2EF5D5AA8E81E05550 WWWXPLANEORG
804,176,585 *5361BA2B8EB456EBF5349316F48B5614D62B5912 wx9u
804,176,586 *5369081111D3B5B8DFDC8EC948B61B8066B42FD9 {x}~~q--3
804,176,587 *536E4659CE286C3DC4CF61AFAEB376E96BD6A0B0 XUEQI EE
804,176,588 *5362DA8B38482848D67D771A4642B2FCCC3C7B7A [email protected]
804,176,589 *536657C20F5B4F544FBC5026BD67FB5E8A5F3471 ADNAN ABOUCHAR
804,176,590 *536D28031C4926C61D49783AE37F4021A9719FAF yash.bhujun
804,176,591 *536802C0FF253E5B8B9BD4CE1FE2171D22F447D2 aehrh
804,176,592 *53660471F0B839F67FC6C70FD1B809AD0F357561 AE$=R
804,176,593 *536398A7FD2C57E47C1ACE45A8FBD71FAF24AC38 YT>[
804,176,594 *536CFB96D5BBC9364933C0AE6F0D7B51E633B2A6 AISWAHL
804,176,595 *5366668FFCE9DEECFAB141BCDBDA5A90F71B1B66 YUMIRAXIAN
804,176,596 *536F479909315B609645CFC285CC97A769CD0EEB YUNIERAHAYU
804,176,597 *536BF98A46F261ADC7837006B658557B4BE0CEE0 AKM+B
804,176,598 *5366E9E73B7C1939664220B44444DB280E8FC577 zemz
804,176,599 *5361DB3CD18CDE5393B1475747E5CE0BF06E5DD5 ZHUBAO12
804,176,600 *53632F9BAD3C39633D8DEA1D28E83FE1FEEF26DA [email protected]
804,176,601 *536203085808403843FF9F2EC6CDE51640BD39B7 aliasesp
804,176,602 *5369B4054702641F74DA49311953E403EBDC75B1 zrhpshpr
804,176,603 *5368904269223A61273A7A8DFDA38C4F0B0569FF all-the-music's-gone
804,176,604 *536AF4A7FD1B848C5CC2C18190B8D09069C85379 AMDASADORA
804,176,605 *536C93B12440E2486DFD3FD164CBCE7F2FFA1191 am__o
804,176,606 *5365D65F75AA0FC5BD773D9A7DCE0C6FFEBCC4DA [email protected]
804,176,607 *536E737FDE507AC4C4BAE56C1FF13D0F8AD5B172 BF/T
804,176,608 *536270CE0EEA2F848D89ABE8D5FDC07BD8ACDB03 bhagwan-sadhwani
804,176,609 *536BF3DB0B866DFD487DF4F1C9F2A5E5274BD19B bi637
804,176,610 *5363744B6183F46A5707A37F629892C830301EBB BILINGUIST'S
804,176,611 *5368FC3C08530422A03D6CA66F94DDCF6D574A08 billybacon
804,176,612 *536DA748DBEE13A907DB3D2A2D21112D4D0943FF BKABADE
804,176,613 *5360E7D1B26CDB0B74ED675BC7E0C0512AB3BF0C BLUTGRUPPENFORSCHER
804,176,614 *536F4D4048498DA55CC250B4D00D24DC3D27E736 BMJ.0
804,176,615 *536C23220FED52F912D3E2410EA4200EABC34A90 1ARBITRA
804,176,616 *53694F6F54EC3FFCB0A9CA2CA8F7D971827D0759 bpcig
804,176,617 *536DA5EC98F3284CA7CDFD1C2F0B814ADF49E01D 1dubach
804,176,618 *536D4A45113D8DA70A8EFA3F8DAE67DF0F919EDE 1.FEUERZEUJUFORTSETZUNG
804,176,619 *5367111355EB5761C3F4D2EF06B43A3F97484673 bq:d?
804,176,620 *5369C3CE3EF2CC5F77A41A9406BB90F9A0110E12 Bqio
804,176,621 *5362CC454051654D1D7B6242FFCC039E1BF5DE5A 1 GUMMIBESTIEFELTEN
804,176,622 *536C8D55F91A3A55A209D908ADC2B7C75A9FE71C 1hazesprong
804,176,623 *536D660F76ECCDC6720CE53DC4E99639A2B568F5 1-koskullin
804,176,624 *5369501D52A46082A96B46916CD56AAF018B2F0D 1-KYUDOS
804,176,625 *53656686CA42E95298F2C5C8466F01ADA551A27F BRETQUELCH
804,176,626 *5364B01872CFD06DE9F8A9BC8930A823C37F91D7 BRITTSKALECKI
804,176,627 *5364C7449605709E8E5E73483AF3D8381A718043 1nuorenmieliset
804,176,628 *5365AD6354205FDED8B797538A511A75A55969FE 1PASSEPAR
804,176,629 *536FAED0F6A9F5968B8FEE05B3967CB26F76B464 [email protected]
804,176,630 *536211868005C31CF94B0033C4A3F10F58B4E63B 1SBARELLA
804,176,631 *53652C236CC182C0E707075B346808C2A8212406 b==)~ `sploit
804,176,632 *53666F489ECE5C212967E648EDB47ED6B20F0AF2 b$&ua
804,176,633 *536B050228647267CC22295C8849B603A75F51D6 BURDIE?
804,176,634 *53650E446F5353AA1A88A0B1DFBC0DDFCFD30F04 1YHDEKS
804,176,635 *5363B4D0882508F137BBD618912709BAEE1FEA30 20030809:Deurne,Belgium(disc1)
804,176,636 *536ACC99A322E497E48B850EF3751B935EF44B4D 2253658 " LET US PROVE OUR INNOCENCE PUBLICLY .
804,176,637 *53613BCC5B6077E7697059B40D329929D9F7BBE5 228 KYL
804,176,638 *536B2006E3C3BACD353DD3D23E970DD72C5D0648 B!XNH
804,176,639 *536F20E71BFC661DEF219AE02E5DAF77DD2A8071 CAPTAINJACKANDTHEMERMAID
804,176,640 *5363EC8E5F63870CF6277D6F99991A4122F679B9 2GIIATTEN
804,176,641 *536003D3E1BF9AA61ACA645672B6D2A872F65627 2ilovehelena0
804,176,642 *5369CEA132B260192FEA721A258C9C552E6D41E4 ccof
804,176,643 *5365665F8AEAE80313C7C2D3E95992E3C29ED188 ceek?
804,176,644 *536EBE04AC9D768B2750B5B5A94FF35828346838 2 USATALKLAUSE
804,176,645 *536480C6F0CF652D38C4174F1FA963399E303EE5 2YANGPENG
804,176,646 *53672E88BD745687A2BAF40D45F79166D76CCD61 3>.~0.)X(
804,176,647 *53693B2069A7C5CF0C63B438E8812212F06C6CCB 351KM、25KV50HZ:直流電化路線25KM
804,176,648 *53694877F51FF6FFFE7B96FBDC5A1721EC470446 c=esk
804,176,649 *5362DD510EA6B4C2AAA1A5F7941599C9F1E0CDA6 3GLYKOGEN
804,176,650 *5366BF8EFFFF3F7A6B9920938730CA3B24597A05 ch523
804,176,651 *53642649E520DE1FD42319597136A7AB58EC662A 3LAKADLO
804,176,652 *536D00F4F718FC688409D3B5AB40B16B95B111C7 [email protected]
804,176,653 *536A7E2F5914123CCE1F508B1C00025A70B15395 41455 KSENOTIM-(-YPO4-)-BIR-ITRIYUM-FOSFAT-MINERALIDIR-.
804,176,654 *536ED1A52EF5C0756E196583CA9EBF57573C6D09 chavez66
804,176,655 *536BD052E73D9EC17726C292BBC8394BFE031454 4AMMONTATI
804,176,656 *5363E3BBDD82222A36956A00B4B29DE0EA3B3789 4ANLOCKTE
804,176,657 *5360417A44D4AC5359974E58FFD9D3ADF3A5D2EE CHERYLBENTYNE
804,176,658 *53626CF79D61EF08DE474DCBF8E67FD7028A071B CHLER-H
804,176,659 *536D27766B449F035ACCA156FC127D2905F3908C chriscoup
804,176,660 *536778216DB34AB785A52A83712EE525B0D9A809 4OPPLYSNINGEN
804,176,661 *536BD686D8F2FABB1AE82B4D49314891D8D2743F CHRYSOPIDAE
804,176,662 *536BADFF287DB757E38BDB26EA9B5477E14E4D47 c:i.-
804,176,663 *5369C9984DC484B7B84ABB94367C42564A1E4411 CIwA
804,176,664 *5369EF34200C8F2805F311837E645BBB5DB69F7C 5BSWANOYANCE
804,176,665 *53656F36FCFB39553FA901E1E5E2206B06C99D81 cleorovere
804,176,666 *5361D072627530C9024B5BFF9B2099777F902660 5XFRYLIEM
804,176,667 *5361A18FCECEB4EB7BC3591CD426B875B772EC64 64hkz2gnpr
804,176,668 *536C79583D8633833F0E373856CBDB4FD9C1D4CD 679HELENA
804,176,669 *536F85ABB051FC252A7257B33D18D58E44E5E0C1 6BERAUSCHST
804,176,670 *53657D085B9453F42B1BBD7F6E728623F26F8D5F CLINTONJACKON
804,176,671 *53610F33B5310D34D040A0319ED380A1626162D1 6ENTROPYWINNIE
804,176,672 *5364281FF834DBD7294162706DDD2ED4B7AA0D80 6 ERNIEDRIGENDEN
804,176,673 *536E714501FD5392A2379307F8CB857BB01F3F2D C$:N
804,176,674 *53685B1976475C9EE90274828D7F2A54EB0A78DB 6RZWL
804,176,675 *53698626D549BDC5687956320C20FD87D73BD246 [email protected]
804,176,676 *5366672E0EB48967116DB30E04776790DE8643B9 7BERNARDGOLD
804,176,677 *536E57968F898EB711A271BD7204EC4E9997DDEB CP_K
804,176,678 *53627917E2504B10903194BE6BE03356A1544142 CREMECITY
804,176,679 *5363CE1B98BC1BF0407ECEDD4A5175C50A6409C7 7REFJERNESTE
804,176,680 *5360754B0E4130B86A2C23C553E49D71FE3A067A 7REIRIBIS
804,176,681 *53625782D2838D920902765F9307743EC6E5103C CRISTOBALFONGER
804,176,682 *53659CCBBDCE7C1B9F243386FC9B239350BF4C83 7SOFTNYSSE
804,176,683 *536D6EF62A6255C902883153762C514FC45E3553 CRYSTALSEEFELDT
804,176,684 *5369626864BE4EB079D6FFA39550728FACBD854F cs_n
804,176,685 *536CCDE00707EBFE697754F9DB8CBC673AA149EF 863837 N-.-ERCHOVA-:-KUULEMMA-VANHA-VEN
804,176,686 *536759A012AAEEB1C8098E3CEF57354EB8059617 CUP)吃出「大四喜」,而且以全勝紀錄結束整個聯賽球季。
804,176,687 *536A7911751F04A3E4F181B9A53BA831664EDD6C cvq
804,176,688 *536DB13C7C36FC255A7B38EF6038ADA8B3C3B81B CXA/V
804,176,689 *536EEBC8C106456A830F5D295FCE5A7A09307BAB D46LA
804,176,690 *53632449C8C22E10D34209BFD0B4E2CA451759EE d7d"s
804,176,691 *536E65A2FDA7B560A04F25F26AF775CC4741B28E +D7YZ
804,176,692 *536B1EA41CCAA90EF2E955A733D29843C40F8DFF D8TFT
804,176,693 *5362CBECA54EA89DED892FD6B927C26684DCADB0 8TTPATTERNTT
804,176,694 *53613DF1CAE015F1FF5397571E9A078436DC779E 8VINIVAARANE
804,176,695 *536FA4F8D27ED8D7B76A2BE99B74773BA74594E1 8VNBARRED
804,176,696 *5366DE69A642898C98151AD6E762E36BFF47D679 dance.vault
804,176,697 *53639FED0918BF9E597CB7559FB81EF4FF864CBB 9BSWJAPANEES
804,176,698 *5368C396DC6113F0A1C0D5B62E8FFBD91773C3F6 dantebradd
804,176,699 *536AF3580821FFF3A2148B060F0FFD07563AEB83 9fenteneel
804,176,700 *5363BAB19820530D4C7C9E06C2098E33E70A25EA 9iamgabriel9
804,176,701 *5360367C60BF4795FCA82DA1465004AE9508BEEF d-_d:
804,176,702 *53686DDE58F2D2C82F2989FE3F2D2654AAE7C424 9WILCOXGIBBS
804,176,703 *5363EDC6569DCF08C65F042CD147D18ED64F1011 A165179
804,176,704 *536A780AB9C6F2C1F179533BFD1855F003679B2C DEL.FREYTAG
804,176,705 *5365BB923A8B3433274C60C8346DCA358C31CA76 AAA>C-
804,176,706 *536AD036148DBE3DEE26F026455DFDAC821E31C6 ABB%Z
804,176,707 *5361EE261EF185493CF4502E804184700C98FC61 abidabswing
804,176,708 *536FC8E0A8D5AFFB58E1B1727C88B2761F60C8B4 ab$s8
804,176,709 *536DE965B4B0D4D32A3A5FAE0E130AAED76207EA DOUGLASS.KITZROW
804,176,710 *53600732DBA744723E24052CE7D2D76827FFFBF2 alfonsomalichi
804,176,711 *5367F098B4109440BC5956A64891E6F0472294C3 ALGEYER8
804,176,712 *5368978CD9088B199BC8EBF227CF80080E329DA1 DUUCT
804,176,713 *536BD10DA668F009FA143C302658541C8737B3DD a.ls
804,176,714 *5366B36ACA894D51432A9750375EF54C9D7AFAAC AL.UBERTINI
804,176,715 *536254E13138922DD0F3AD520DF0C2C251A67740 Always.in.Trouble
804,176,716 *536CC6998A66113291AA5D6ABCAEEC65F04A8A69 AMHERSTIA9
804,176,717 *5367EB05DFB556E8C9E07240727FAFF9BF05251F AMOSSARME1
804,176,718 *5360124C37FAC2661B8D6E8D19DC9548FD113E60 AMYZONA
804,176,719 *536EE58A12C35E93AE86BECE50DE1BA6B6D85B2E andrepullon
804,176,720 *536B6E2AFD74293B098DAECDDEA825616348C807 E3NBMVGPMK4C
804,176,721 *5367B8C7727BE6A50F2D1D89397C1A59FC799E63 annazepeda
804,176,722 *536D4302FA45E22CD70915C7CA671D9CCFE396E9 ANTONYGROSBY
804,176,723 *5360A24BBC67F1FAA183D8F02920CBAB7E9EAB8A ANTWAN.MCFANN
804,176,724 *5364635C73B3F0474C99C955B883BF9D19490265 EDNUHTGAJING
804,176,725 *53641D76B9107FACE45A294A59392C62934F544D eduquer
804,176,726 *536EDCE488EB7ADA12B66DDA476740702121B097 A.path.name.
804,176,727 *536A87258B7CB034C3CCF24BBDE8725A606ED276 EDWIN.DELLARIPA
804,176,728 *53671CDF93BB1CFAA8FDDF0A37F2D43707E4E20D APRECIR
804,176,729 *53683191C2DDB418F10CA7BDF90346579B4FF614 EGSRA
804,176,730 *5366533751247DC1DC3C07F643D90E3CA0DE1C15 ArUl
804,176,731 *5360C1373841C0CF160691CAC2FBC20C3902DE5B [email protected]
804,176,732 *536AA783635C5E2B1CE3A7402386FBF019AA1F6F elqe5
804,176,733 *5360C9CDAEE1876F62EA242647C54A85B6A2D2C8 A#VLF
804,176,734 *5365A003896F651A997849AE8D4B9AE16F132AA5 axoo4
804,176,735 *536FA55C04C8F11777B60982BE665C9533A9C697 [email protected]
804,176,736 *5366547DF802FC7493A6E14FDC43AEA4D1D3FCE2 ER:Q
804,176,737 *536CF1C89C45076B5AC8B9B41B89AECF8E540C58 EXTRAORDINARYJOE1976
804,176,738 *5365052C0A3269824607B87AFEDC3C72D661128F BALAKHANYSABUNCHIR
804,176,739 *536AFBA412451B5117F1AD8D38CA680E7FC41CC3 EYXPP
804,176,740 *536CC0064813896EADB30E4E418527D67B6CF5D0 BANAAL?
804,176,741 *5363D451A7CBB5D4754380634135BF443C8BB01A BARILS
804,176,742 *536809213D8D8C94A2D5B092701C9764ECCAD50A BEAUTIFUL.THROUGH
804,176,743 *536405AD033B0224F40D094C6505366F4DF94D6A FIRMARIUS0
804,176,744 *536B61FD681266AECDF642CFED009E4A44808DDE BENPACEY
804,176,745 *5360D845D0897871036A615E34901D00EE851345 [email protected]
804,176,746 *53643E06AC3077C5FCCD566165E3E05D9F1F1367 [email protected]
804,176,747 *5365CA5A044E109360A7D6268635A405DEFD7F8C b_lb,
804,176,748 *536D9E1554582B0ACC479847EE17338B40141B59 boldanski
804,176,749 *5367555AE2245A8EBC6306A2081FA2BE418844AF BRAD.OLIS
804,176,750 *536D47EBB104AD7232FAAEA9019FC060710DB957 [email protected]
804,176,751 *536B67C202B153F02446D23D5D98DD1288ED5210 BRENDONTOLLETT
804,176,752 *536F3E2BCD6E14ACDD248228D69064E30D765F91 GUOQIONGJIU
804,176,753 *536116CF90B98E9633356233022F3DBF919B7575 guypassi
804,176,754 *53691C94E71667A657867A7B08BE88009E10B220 Br/W
804,176,755 *536261FD9A86DB2AD0D31412CA08B6F255D53614 hackerstate
804,176,756 *536B058090EA9AEA5981F64A6D4247B355FD76C0 HARSHIT SINGH
804,176,757 *536165DB7424283F56AAE5B6B87C3E7167205E94 HE4RTH5IDE
804,176,758 *53675D432DD54BFF233DFB3F97E84CBE47873FFE HLUYXKF79
804,176,759 *536A077723A7C321EEB2AA6A2DE201A06D4F2432 0
804,176,760 *53609985ECFFF6EEE2233EC997FA36A774398365 o*
804,176,761 *5362DDBB02F1FEB539ECA57F8F33A602395B2E92 
804,176,762 *536CAB92708059209693F56AF95D2A34230EEF4A c86,=
804,176,763 *5364AE05B50865EE6FB27763FBC37A3A0384229A
804,176,764 *536CBED04FA9611322B7D470D582FC0BF04A510B c9m
804,176,765 *536E48EF0629349BCD422F575A0DB9323A7ACDC8 K
804,176,766 *536046A33762FCD63C44BA3807D7BD44E7819C9A /
804,176,767 *5365C27237B68349118A7A51EC6437334E787D4D *
804,176,768 *53605B34013B301F71F3A25CAE2EF6B6DC23CE5E
804,176,769 *53659F6F02304038ABE17516E85A724D032F4DE1
804,176,770 *5365734B730CCDD445ABDE3EA1397792CCA4DF11
804,176,771 *5360E4515005B45124908B0DA37DED39BFD3051F 벸ا$
804,176,772 *5364123F42D0F354ED93AD56D33C6B403549175D
804,176,773 *53605CACFF12A27B82D59176B73F25EDEB9D2444 |^
804,176,774 *536C3F7F855E5398294512753036D3591CEBFD35 CARLDEVORA
804,176,775 *536928C10CE5062BEFD2E92CA0D268B1B9364B42 carsonconole
804,176,776 *5362DB17B49CF125EC321CADFBD717FE7ECD1C97
804,176,777 *5363EBD96CD5FA7AEC20FC3343A652E5D0B302F2 Jk
804,176,778 *536E325AA15A4A0E1C66787ABD02D53938911BCD G
804,176,779 *536B05E0FA45189C7419BE8D47F243492AADB06B -
804,176,780 *5368B4E3D1B22F8049174D94FFA1EEFB58AB7171
804,176,781 *5361D48D2682E1EDF3CB4EB7FA51431BD2EBDF41 cbnyy
804,176,782 *53686017DF2F2F8305020F470F7325D1AE864377 Cc50
804,176,783 *536D77C387879A65121DD41C3C4DB3077A3C35AC CCHERATO2
804,176,784 *5368F1341E5094E8BA1E298E5CB24CE14A14CB8C
804,176,785 *53657FF19B7441C81FA196B6E53DB57F3C7DD6DC CCONNEENED
804,176,786 *536C0DB26E59F4781F994902FEA5F2818F9B8F22 T(
804,176,787 *5366A981B021F502462E316BB21A5F16732C5920 0,
804,176,788 *5364CC3E765745C99987D031023D657C1A9538CE [email protected]!on
804,176,789 *5365C8B9E8BF426FA2DB968452FB8460B0CD77C2
804,176,790 *53699236A9B59EC6CB68556D8132E68FBF3B2FB5 Chapter 0301: Surviving Boot Camp
804,176,791 *536E04EA2C6734DB299FAC78C4A9C54667EBF49F
804,176,792 *536B75D9581FACC4368A5DB1655C3941C8078E2E
804,176,793 *53643D5BC6D8731DB29B935C0A019F3C94AA7E14
804,176,794 *536BE6F02059ED812B992FA382DEA93C56B5E2F1 u
804,176,795 *53687DD6316FEBC7BF3F4B7806BF1B9AB31EC962 [6F
804,176,796 *53679D503FFFAA28567642925D37FFEE7F2D2011
804,176,797 *53664506AD03BE3EC69CB4947B274BA4C5E192B0 +
804,176,798 *536A9160F2808A975724ACD8AC26A497BFF4D588 dO
804,176,799 *5369F17E94DA033F9BE2807D11A5DC90E07BAA17 CHARLIE.KEIPE
804,176,800 *536AC1391A7F376A68212963E3702ADE104C9314 CHASBLAUVELT
804,176,801 *536C3082246CCD2E549E06E7D872D73FB9CB1A75 CHASE.BEETLEY
804,176,802 *536953A6709A66B5CF0C8A7DF92C140664ECF61A
804,176,803 *5366271D94E82EF8BF915FD4F8536F6028178874 CHAYOTE /TS//AI/'/OU/T/I/
804,176,804 *5368010BA838292FD85B50C676992F2D8C59E302 checkin'dacutz(featvinylgroover)
804,176,805 *5367BAE883EE910F0934B5276C869507C4DD9303 |
804,176,806 *5364760A6A8C3DE8E3BBA9D22CB5713881B780B1 [email protected]
804,176,807 *5362F121ACB0976C9BF78834B608BE43C2577BB5 M
804,176,808 *5362681125DA73469EF0F4F0A3824ADE16AA80C6 [email protected]
804,176,809 *53684D4B8D8E0EA067D2222A24F726D3D3B31FE1
804,176,810 *536F347DBAA9E7DAE98C6BD69A6C4DB4C4F2B3D1 X
804,176,811 *53626E9C0AE16A52412C9F48A09A36F1C76100D8 [email protected]
804,176,812 *5367E38C5005BA6126A8EF9FB2ECFB8526B0F2F7 \):
804,176,813 *53628EDDAEA7E9FEA03BC5033968B3E7FED6A659
804,176,814 *536E441163FE3DF0E8B499A9464E1493B7A9C2F5 CHOROVITE
804,176,815 *5364DE2002B6FB84450CF0E657A38B1A25FC3E25 CHRIS-GENSKE
804,176,816 *5362CC0FD9DB3EBFCFC7C4005706E3827FB27341 na
804,176,817 *5362B0D695C444B5EDBADBA3988D6366D2B36503
804,176,818 *5365F159F7768C3C9447E246A97957BB96538F61 *
804,176,819 *53623B99D316DB3AA24423DF82EF5A8FF63B09F5 cinemas
804,176,820 *53682F8A20FB26C52580F35D8CDD0FB2BB5722E1 CLEO.ALLABAND
804,176,821 *536BB78B59987E61CB6346ED945BD7BE9DD07B6D 117544 ammattitutkinnon-maksu-on-erikseen-ja-m
804,176,822 *536AFBD7FE9B0AF1D0DF317A62FC1F59CBAFA0B8 CLI#W
804,176,823 *536089C044B37E0CA438D15039A1428D47C00ECA [email protected]
804,176,824 *536C4DFD012740404E9B41A45B5B49207557319D cmpmc
804,176,825 *536F926CFC89C936D740FE0401A55410336034B6 COFOLAMA
804,176,826 *536A92B14E2BB29CED8CE6DB04F75D58E98B7C9C coincidențe
804,176,827 *536337A12A6AF2B1524CE4786BAEB4797C4BE003 COJ&N
804,176,828 *536C5CB0D5AF7A13CBB1D54FD9F8244F8026AF07 1 EMIMANAGER
804,176,829 *5368C36CA5D4BF3D6A37EEB739E4C4FC6E4E5A53 1.sihanoukanhaengern
804,176,830 *536B63AC36BC10BE1D5448627DB31FD8FE972680 3VANOWEN
804,176,831 *53671EE6FD00B831C4F99B91022F7D8D63095546 4AMMONTATI
804,176,832 *536D0D7E040BA6FDFE87B679466B5F1381F5A12C DA=JA
804,176,833 *536A00123621CCBBCE8A59F0C4C1CDBCE7B04A64 DARREL.TORPEY
804,176,834 *5368135F4A6488238F61CEA1AE918190F2063DCE DATOO1
804,176,835 *536E7486C20EEF399E5BAD9C8DFC135C57FB0ABC 795796 sOyleSinin-Ozetini-burada-bulabilirsiniz-.
804,176,836 *5369F6B55BCFBFB6504CE5AF3C701544DDCE2486 DAVIDCRAWSHAW
804,176,837 *5362E51FA87A00804F24E500F0910C8FB530F8A8 DBUS.LA
804,176,838 *5362EA550E0253A30A0EDC851440716280C142AF 7MARECHALFER
804,176,839 *5365714CA25796200EE4AD487847C3A6B43C5FEC 7SIERRAGREEN
804,176,840 *5363E044BB99B781CF1D4631FFCFED022C44DD5C deb#
804,176,841 *536A229823BC6481DED77F0D4AA83D6F5DA7ACAB 7thenikki3
804,176,842 *5368F0812B29273FA706852D818BC6172CB2B7E3 7TOPOLINI
804,176,843 *5364322E04B29D803A739518D8377655EBCB19AF deoopmah3
804,176,844 *53695125AF886EA2B8ABD8BB2E9C76EFCB380BED 8ILUVMUSTANG11
804,176,845 *536925C77EDEA4FA75CB3CFEB0C61BB225CAA42A 8MICKEYLACROSSE
804,176,846 *536641C6760CCD30DB70A1ED1FBE0F9FD60D28B4 8QUHYNGE
804,176,847 *536F38EE1AC949730EA3A86685180C6AAF866571 8RUKYTALP
804,176,848 *5364A5BDB3673FF1E9E2515F2A418FFCF19A462E DK%IA
804,176,849 *536BE28FD65165C1E8E7AFBA88A120CA614C1E40 DOI101093HMGDDI352
804,176,850 *536F2CC39731ECB383E7F0A8D9F2524191ED88FA AABO`8
804,176,851 *5369D61E6D1E98C2C5C6A8E85175D7878F1B0AF0 DW30/
804,176,852 *536DDCD3DD102B24F604FB2D4856A100A9E1F2DD AIRIEDOM2
804,176,853 *5365880BBD9F86852748CE073166ED8C3518E672 ALISHA-MARIE-JOHNSON
804,176,854 *536C6542193B880B874AA537572F016DB7CE49FB ECLIPSECLOAKCLOAKINGCLOTHECLOUDCLOUD
804,176,855 *536438B1BE9C4598D3FB224074A2103D9FE2473A a";lr
804,176,856 *5369A9780CC833E3702A76561CDFC129940F9226 ALTONKLOEPPER
804,176,857 *536D008E61271D00BFD90C6855B4A376E440D023 Always.in.Trouble
804,176,858 *536AEED0841B747C831AA328CFFE8C225A998825 ANJALI.SAKARIA
804,176,859 *5363E36BDD8ADD44F2FCA499BEF882F67B762D6F ELINJAKOM
804,176,860 *536830887D0B46553FBC5A32CFA043CBB354FE8F elmercalmese
804,176,861 *5363FC8B0A306F3FE794021A1346395A3CF84EFA elmermontierth
804,176,862 *536B79F09DB8C51287440CAD92E66B8B57C51A16 elmerwhitesides
804,176,863 *536E7AA45927053B1E6CA4D9A3D28830F93D9FCF ELMO.YOUSE
804,176,864 *536E691E60C736049158B225BB2D56B644AF1598 ARMANDO.WOLFRED
804,176,865 *5362D9D3B4C5674FAA3A5E00021E9AF2B021C67D ArUl
804,176,866 *536B402810C6777E8597BF3487E4200B779554CE enetradn0
804,176,867 *5367648F8852230BC4EC44E077BAD79251F86656 a,!tr
804,176,868 *536BED2D1B744C19F462E0D2CE6486ED00AF7136 au77o
804,176,869 *53612D045007469D6229C9BE2BD9D0AA4281C977 autoists4
804,176,870 *5368AD215321FF47552650D1A4910D618129F496 ER3AT
804,176,871 *536141C2C454761A828CAF0F5F4CF73008CDCC54 av.tima.f|r.900.kronor.
804,176,872 *536501961AE3E98B3E52DBD6303E5106DE20E89E eskualdeetan
804,176,873 *536DADD2FCAC01A6AEB9457EC9957DBEAAB6EBCC B7DK
804,176,874 *5363C3CBBB602FABBABF8566988CCEC8E299ABFC Bagatelle.No.2
804,176,875 *536FF90AB013E62A7E827D322D5A467250C1F0D7 bcuu
804,176,876 *53653BFBC411E7F951F0B2B8977E94BD0BB97B28 BENPACEY
804,176,877 *536CD8AB8EEB664D2FA5F63DE054DC3B0BAACDCF beu)+
804,176,878 *5362CAF47762ECAE93CBC5A46C0A09CF34520075 b#hgm
804,176,879 *5363D105F754799F709FAD578898079232B66C45 FIBBONACIJEVA
804,176,880 *536741D35617C37AEB11FC48A80757B7D3A9906B BIER:
804,176,881 *536D6947DFD3C3F5F2E65BB92DD3641925EE54E7 fkilling4
804,176,882 *536A4B08B68F58041FAF5392BFF27B315FF138F6 BLAKEBACHLEDA
804,176,883 *5360BBF201864DE92544CF91065A068237B01770 FRANCISCOWESTERHOFF
804,176,884 *536A637AFD6A284F6CD8396A166D4D2D39930C1B bq4$a
804,176,885 *536CC682216B460817EFC4A8A0318B7DDAF645A3 FROTTES0
804,176,886 *536A83BC7001077678C322BA260BED4CC41362A0 BRYNII
804,176,887 *5364D65E6834F1DDB555F234DE5DDCB7464222C1 BSYSD
804,176,888 *536329EFFCFC29E39DC0625676FBEE7C65A259F2 galefouhy
804,176,889 *5368F21940C4320B19C8B65808AD56DA1396F59C GALENREUSCHEL
804,176,890 *5369BBFC1BB6FC85980074E98B5839D2E94D8065 gallaty1234
804,176,891 *536B83DFC15B5AEF630B87521DAC0A7F95BCD44B [email protected]
804,176,892 *536AED298002433B43DDD732B3C1E2122280949F [email protected]
804,176,893 *5361E249D06A7FADCEA89F637A22E40A5504805F BURTON.POTRA
804,176,894 *53684C2E7110330E8271F327DDBC6F575303AE7D B"WOC
804,176,895 *5368CA3762DB0C4014B097DD293F770EB78CDDD5 GAVIETESED
804,176,896 *5366660FCBB5D2110099E3AAA8091B81B4B46069 [email protected]
804,176,897 *5369DFB17B502439F032F11291723AA828D9AD15 gdi(
804,176,898 *5369BFB819AEBF45448AEA8F100FC0E899F4D433 c#4c9
804,176,899 *536A7CDF9F9EA345EC4C2BCCD72AD77436214F54 GEORGIRENED
804,176,900 *536DA2C842B003040DCCF6DF0178D13EAF392B3E gervas8
804,176,901 *536BEF68DA39C545EC403FFFFFD8F836708EE50E CARLDEVORA
804,176,902 *53606F65BE9B3AA61781D8942A21EE60A59705AA cbnyy
804,176,903 *536BA4A94F216851F5F7F0BBAAEF06D1873A6EE4 Cc50
804,176,904 *5366E440537813D0D30517D3EA2D96D3584DABAD ccd)1
804,176,905 *53642A1B275E2D4F149CDD9DE5A4674EE99F8857 C(D1
804,176,906 *5367420D08CB8CDC409B9287E365D7B734F3D715 [email protected]
804,176,907 *5369CE92155C2E13CBBBD4EF921778D770A8FA15 GUSTAVOSZABLEWSKI
804,176,908 *5368F291E4092644B1F5D0983EE8C4DF99F12F1C c=esk
804,176,909 *536901FEFC60EF0074D8F34F7F3BF93CCC93888E Chapter 0301: Surviving Boot Camp
804,176,910 *53628FDD5D33012FEBA59206C85B1DAE7E898528 HARLFORDLAITAN
804,176,911 *5364C0F0A8F7DA029430EFEFC77FB8E9CB6C70A8 [email protected]
804,176,912 *53670CC70224B82B2E773246D575DC5FF6D3DDF4 CHOROVITE
804,176,913 *536FC550413BA22292CCC966DA00C06B11FD595C HERSCHEL.ZAPPOLO
804,176,914 *53690A74172308866A3701E88C42F6EE9D4D7C08 cinemas
804,176,915 *536A5C02A51B93374EBB73C62655A3B49EB84D0A HISTEREZISULUI
804,176,916 *536CA7529ADAC2D89665C2484CECA92F4CA61D9E [email protected]
804,176,917 *536D69A3A05D46AD37A780AB40CC7D8780CE19ED [email protected]
804,176,918 *5369C64FF710C8CADA0E29BEDC5AECA91E1A5081 c.kwq
804,176,919 *536D403D0BC5C01194306AC1CAED1647B0C6B16D HONEY-SE
804,176,920 *5367723FF34088B2E97963D2B12AADB883AA4507 [email protected]
804,176,921 *536A22809336D5887B1A7BB4A1896C80A347DC86 claytonbuteaux
804,176,922 *536CF80A369E56B46C0620B53887B084FA8B2543 CLEO.ALLABAND
804,176,923 *53624588F92911103EC5EE42D3D96709F3CD9D5D [email protected]
804,176,924 *536BEBE17FCE90802897E4655726F5934767D351 HTUXTLA GUTIREZ
804,176,925 *53688D66AB72D372CECD03E4B293BB6921A85BB4 cmpmc
804,176,926 *536C53B740DD9F213DB3E5184466066C7D1404AC cnp;z
804,176,927 *53643669BF47B7D3E2F8C5D9BF6BC6CE0BC2C50A condetta1
804,176,928 *536DB485287CC10F07B18292B046C2BF714D4F1E illoyal3
804,176,929 *5360E4C5D63CD8DF12EC3B2A79F2210611F7161A ISAAC.SAGEN
804,176,930 *53626D5C281559A5DE5EDB65A2A87DC738F420CA [email protected]
804,176,931 *5364AAB9BBFD271F3DB18608C3B1F24B168590C9 isotamm
804,176,932 *53682410208AA571C7C4FDFAF6A1703453319A19 cvq
804,176,933 *536CA165696F197261799091B3437B99E78120F5 JAMIEHADLER
804,176,934 *536FB56B44D7841F85B8CF325769BDDAD02D2556 [email protected]
804,176,935 *5364BBEAA3ED0FBFA10D66772453485373A3F949 D0$c
804,176,936 *536797C6DA70B1D3F5FE9602215855D66032EB90 JAQUI MARTINEZ
804,176,937 *536450EBC79400F1C66A2C5849E675A35D2AA291 D,0P
804,176,938 *536A769024AA4A2EF863693923AF259A4AD9D5BC jarviskuykendall
804,176,939 *5366E137CACB9A1AFF7605B55C2565927A556B62 d2)bt
804,176,940 *536133C5D761333C81BB2B8A0D4890285DAD0597 D5IDO
804,176,941 *5363D1B264EB6B43BF0F214F8B9D711E674E4C10 damnify
804,176,942 *536CBB87D2B259ED186425B63C7511A427E00F67 JESSCOMMINS
804,176,943 *5360F8F231083A13CE003D455456C6B94CB2318B joanbartos
804,176,944 *53645BE70DE6EE2A96E8994650F6A4B0E964670B JOCELL03
804,176,945 *53651C0777B6844648AC025DD0121EEEFFC5226E johndraper
804,176,946 *5362D4203EDC4653ECCAD5D9333607118C05B8E5 Dh0X
804,176,947 *536D556CB4CABE0D7FC6149CD5E2F68EC8D1894E [email protected]
804,176,948 *5366E79161FF4D2AE40EBC2A0C4CC29EAB7F7624 [email protected]
804,176,949 *536F39588805A75D72C488C308D98518D5293FFF dj5te
804,176,950 *53695BB7FC5CB00591C3113250B84C82B30C4DCB KAAGEROU(INSTRUMENTAL)
804,176,951 *536866C4B0E78C50A082E5001EB63F80BAA1823D KAREEMFRALIC
804,176,952 *536AAC07A7893C68DA6DECD4EEACE80219D09FC0 KARLTONSMITH
804,176,953 *53682F14FB48262F22B980FB3B3FDB133AD5AB0F KATSOIVAT
804,176,954 *53652B603509E5D4DBAE5F7953680C86E981F486 kelleysturges
804,176,955 *53603066748BECE6822AFA6282C3501BEBA8256A KENDRICKDUBIANSKY
804,176,956 *536D0DDC4CEDB4A4286942688E65D0101481CA0D KENMCKOUEN
804,176,957 *5366EB2510527414D88DC1D06DC2DF6D77532050 kennethcrofoot
804,176,958 *536257FEEB6AFFCF8FFC3840A1BC3A44864747E4 KENNETH.IRONS
804,176,959 *5366225E45ECFA62F57E34746A885AA9C8BA16BB dqh"d
804,176,960 *536BA7A3957F4A20052284AFCDEC84A20BC71A4F DR1BBL3$
804,176,961 *5364794793E523BD7F9FE71CEF50705ED6518BFF DREW.KIMBALL
804,176,962 *53693F7EC42BBA7B5D57117697F5E6275A87E819 drqn
804,176,963 *536955B3D1D663B6B591DBC686300024D7DDD8D6 d!sc14!med
804,176,964 *5364E4693814E5EE7E4B1B82620FC24C165E4C8D dud?:
804,176,965 *536CB28C1EA1FBC8B2C4B606604FE6782C4F58DD DVIMIC
804,176,966 *5366CE6AA210E6B232EBB5CDDE5ADB5FF7669570 egorg
804,176,967 *536C647B2AB121B21B83012EA39580A20D71CA9A Lato
804,176,968 *536ECB16AC14B032E4273D376979B04650FB465E LAVAZZI
804,176,969 *5364A03C3B3224ACFE203C9F84C098D4CC4D9F45 leluia.Records
804,176,970 *5369793827F0845492AABDCF7299D39B490B8A08 enetradn0
804,176,971 *53646278F8B841651F2415EBB57F287806F5394A LENNYZOLLA
804,176,972 *536F0EEA796712674E4427BBA22C74D7CF9E7E9A ENUSER24.123.133.78
804,176,973 *5369DE792BA6BCB20489678D1FD23A48CFE22646 eq_#3
804,176,974 *536467AD335F136BB66DE5E9AE891DB1270970D1 LET.ME.SING.YOUR.BLUES.AWAY.1
804,176,975 *536BCF2355F6A3B94D7E53E4C603D0D10D7FCA0D ESESAHCING
804,176,976 *536F3588B288962DDBA713703E92648872DA83B6 [email protected]
804,176,977 *536D5B3E74DE508C1BD629246A8858A2A1A74F9A ^F'A
804,176,978 *536772F0D0A263303DC4E0850B87D5030B9848A5 LIZLORDING
804,176,979 *5363677A1508560D84066C3631182EE8903E599C FOIST8
804,176,980 *53641A658BA93CDD82C79DE1A7E4222A54BCDCBA fritzoler
804,176,981 *53615B98780B506620A81F476C974113A80F9A09 fubarblue6
804,176,982 *53652BC62C65982A1E2D1411EF8676B94747CA5D gary-dredge
804,176,983 *5363F1E9F77902EDE089DD8F92206339ED07DF01 lucille-parker
804,176,984 *5368E2ACCBFD2EF276301165C7D5701149B7FD03 GAVIETESED
804,176,985 *536E5D96C06768571590FAC0A88693450BF1DAF8 gdi(
804,176,986 *5366598360A944185C632B43B984420A35AFF777 GELIŞTIRTIYORDU
804,176,987 *536C242B8548E34D216C6C714DF6A3CADE666056 GEOFFREY.HOSSEINI
804,176,988 *5366932EF06657A3C511F82412BF7E6463352AD1 LYNN.ZIESKE
804,176,989 *536E47C0C23661E93904E449C70863ECFE3CD881 GREGHOLDERBY
804,176,990 *536F0A2D291B1DC05FBB977464803A61FC805662 MARCHES
804,176,991 *5364C868DC700F4F222804F768CDB68DFBB06E9D [email protected]
804,176,992 *536AD2E53BAF2E5AA1B688A21B4EC931DF705107 h1111ne55
804,176,993 *5369B89776B1ADC506382A7DEB82EE7B0A3FAAE6 MARYTIEU
804,176,994 *536096D68F36C856B8CB0C31847ACB46984FE95C HAYDENPATWELL
804,176,995 *5361F6AA2F3517E6B2C61EAFF7C3239AEC2174B4 MAURICIO.LEPAK
804,176,996 *53624CEE4E12063F6047B8E0A753F89FF2FBFDB4 HECTOR.TISBY
804,176,997 *536D5AF290D95C161D582F54A8578F6306C34BA7 MERCISSSSSSS
804,176,998 *536199ACF5D271AA8F02B7AA91F0B367091CAB66 MICHEAL.HINKLE
804,176,999 *536FA3C95D2DDB639AE9BB7EF285AA5A97F62F0D mike-talson
804,177,000 *53679B0C1C1849EFD21B5B2E9F23F26714A3903F HTTPWWWWRITE101COM
804,177,001 *53659C499CE24B793E876FBA7BB7319541964D33 HUNGBINH
804,177,002 *536314010D576649AE0A2E5CBF0CDBEDC004E195 iestore
804,177,003 *53680341E8D13A43739272EB31A32A9C66C59DFA MNAVNZIP
804,177,004 *536054C7363357167CC13D3088FFCBED012D30AB INFEKTIS3
804,177,005 *536F501C963743A22CCC97455933D600F7EAA52E isaacdivirgilio
804,177,006 *5362B337567340DED1C48C141EE2A325158BD0DD n0nmi1itari1y
804,177,007 *5363B53C8BA5EC6EB45E471232974B27A6BB690B JESSCOMMINS
804,177,008 *536A4D0926815D3E34F98FB52B39720A25E82B07 jf.)
804,177,009 *536EE531AEC62D75D4C1D7C57BB05728899A38EB NEWTON.PALMOUR
804,177,010 *536E156CED91A4C6DD6E46FDF19EECFA61088111 johndraper
804,177,011 *536A86B1E73E9CC188E8AB396BF73C3793EDF103 NICOLASCUMPSTON
804,177,012 *536B878213AE355B3C8FFA08B708D26C1543396E NICOLAS.PRESTIA
804,177,013 *536EF1F4D93276893B81341997AC234B848908BB NICOLASSWADE
804,177,014 *5367DB7F29C476AECED2B7C4E16F4F9A16F77D49 JONGETJE
804,177,015 *536C77A15DFED95A180D8DF37EFB989103C9EA79 NM2124193
804,177,016 *5362FA7A650D37E1FAFE63B0908BC538F176055B [email protected]
804,177,017 *53611E80FCB47FB401F0FE36F807367FA44273EC [email protected]
804,177,018 *536DCE27FF8FA1AA5AE830B45845A47ACF1050C3 KAREEMFRALIC
804,177,019 *53632C7825ACD6EC54A459498A5C2AF347BB3752 KATSOIVAT
804,177,020 *5368B4BC50C3902AD4C3E48161B908460F24066A Offcer
804,177,021 *5367FC0AF6A71CBB164E2D8451C0CE8A9AEF8C8A O.MEU.SENHOR.J
804,177,022 *536717B9A3D2C5004250CCB692ADFEC7FBD4583B [email protected]
804,177,023 *536E90F093C4529DBB71F10230700FF2C84B47B1 orevlaced
804,177,024 *536D3CFC103E3EF9BC9896DEE658AF66750C4BBB KQ`J
804,177,025 *536B812577A06B2DDC93237C29A4ADBC98227516 otanurof
804,177,026 *5366C067B1AA351C5A0941014EA5D5E9636475E4 LINDSAYBRITTINGHAM
804,177,027 *53665FB04650557945C16B61AEFB385258049CE2 PAULDURA1
804,177,028 *536663925E3569BABAB10AE057EFCD54FB76755E [email protected]
804,177,029 *536FDF4D0B11259C4C3DB6D395269F107948D630 paullansdale
804,177,030 *53667B48A9CAB9A695BFCA9D71FE9ED0827D94B6 pay-up-(original-vocal)
804,177,031 *5361A59859A39BB0BF5C7661776DA5E69797FD30 LYNN.ZIESKE
804,177,032 *536494C357C701A2338D45A30AE28D686996C7B3 PIACERANNO2
804,177,033 *536CD0A00328D19E6DBBE05F6EAC729C0A3CEA96 POSEERDEN3
804,177,034 *5361119530493B615E12187CB52D320340D60644 MARSHALLNABARRETE
804,177,035 *53684F687C38F9E3A06EB52D105EFA4D89B858A2 pp5557160
804,177,036 *536D7F98A12208E5693B5EAC1F023F6F82D5B947 MARYTIEU
804,177,037 *53621825390AA81B44E9E8AA1A501BE2FB33FFBC presipe6
804,177,038 *536EE79171626EC27D533052C9694E4F8F45F2AE PYRAMIDDRAGON
804,177,039 *5367BDF8825D7C4925C83BC6372269786AF8E8F3 [email protected]
804,177,040 *536BB0C2FBACF832D318B137C67FA4FD686A22C7 Q===D-*-*-*>-B0
804,177,041 *536F44408FCAC77C35F34674BDD093FEF9FD9314 MOISESTRIAL
804,177,042 *53629C3DBB35B3187DE9432C72F216E6A5D19C48 MOSE.HANNEGAN
804,177,043 *536D7E575BA69205E7C3608393584484B7CE9BD9 MPJSBSW5
804,177,044 *536E147A1B7C6D835066FE1D0971444B5A5454CA MYLIGHT33
804,177,045 *5365C4505B099CEEA041D3AFCCE23C46C2934CEB RAMAFIRMANSYAH
804,177,046 *536D09C9D4293DABB6C16190F10C8B5FAEBFCCF0 REDAHCTS
804,177,047 *5365EA2ADFE85B63AF9E6E2F880E274D3361804F [email protected]
804,177,048 *536ADACEA31A9FC3E1115986A1B197AB0D6509D0 RENOTHCOTUA
804,177,049 *5367B29B64EEC80A2B576124CDAAC722310BA740 NULLIEX
804,177,050 *536BD298DD7E455F8755D3C8540E78FB36CE5B39 REYNALDODEOLIVEIRA
804,177,051 *536928EFF3466359114751572D52390B12DC8D90 [email protected]
804,177,052 *536A2FDBDEE5CD93100DCB892F76004AD3257AEB RHAMPHOCHROMIS.LUCIUS
804,177,053 *536630B1AF96EEFD9E8141086D392F77E25B8DB4 omargarnache
804,177,054 *5367217B7F8D0BEC29291A90F1C46A7EE9E642CC O.MEU.SENHOR.J
804,177,055 *53600C497A2024F166F1B0B5D396F8E906D17C84 OSWALDO.MANZONE
804,177,056 *536457AD097DA74EA65A750E77CC05783F05C677 RM17800
804,177,057 *536F4C0E4F57A0AD0FF77DF7B35251305F724923 ROBERTKATHLEEN0
804,177,058 *536BD23A303885C8DEED01017F272D385FFAA9A0 OVERDEPRESS!
804,177,059 *536AF5A69C7DBA3D42941A9C7849DE484D2A4D56 overnf1ate$
804,177,060 *536CF715B81D1D6C4E4272AC1365417C21FF4056 ROCZNIKU2
804,177,061 *536E4DC893D8C9101676D002B5D40332BBA31976 PATAJASLOCHA:-1-PASO-DOBLE
804,177,062 *5366966465E04ADE939AEAA2D9B5B60A09A7E886 [email protected]
804,177,063 *53626FC57BDBBDA73686DABA188BC1C143A4B387 RUGBYMARCELING
804,177,064 *5363F686876496C4E7DCE9F18549855EE57AFC29 RUHRREGIONA
804,177,065 *536B19B6732876BFD855C267346A813F5DDC58EC RUPERTGESUALDO
804,177,066 *536672DC3D642BAA15EBD7F40FB6C41014ED3289 rusmin.mujanovic
804,177,067 *536D58AAC38A645283300BE0F0648ECEBEF55888 RYAN MATHIS
804,177,068 *536B981BF6EFCA844527B45AC0E78D2D44DE0C60 <P><FONT SiZE="1"><EM>LAST MODiFiED: 12 JANUARY
804,177,069 *536F01BCDAD5CDB2D1A0944C94531F7853BA126B PIGFISHES4
804,177,070 *5361F1020CD9DCC3EE0F536247DA780DC94E3382 SANDINISTAS3
804,177,071 *536677BAFE34F0F9B2E94ED43BAD6412FED5210B [email protected][
804,177,072 *5366BD4C5533A592E20BDD0A655187982B05CB15 [email protected]~o~o{x}
804,177,073 *536BCD6C82AA119CD8672B3BBB4DD4EB7FCA3448 PREPERMISSIVE
804,177,074 *536D5C9C10FABCFB74BCD46AD89265A9DB4107E8 SDEMIRER
804,177,075 *5360E098B97DD556B774368055DF8BF63868ABAE promptheit
804,177,076 *536EAE6BCD8B41BD8B46B8DCC8530B0BDCE6B66B sentirono
804,177,077 *5363D237C4BC6C7B644FC4E62CC671D81BB8532A SEYMOUR.LERPER
804,177,078 *536ABCC5C93DD8A2C27B6A4DD0026F2B1D2B6594 q==>~.~)8(
804,177,079 *53607C912F07D8AD0F810A027B62551E4E6C8A2B RADZIWIL'S
804,177,080 *536DB58B8BE82A230258A639675B85BAAEED0BB8 RECHTSWET
804,177,081 *536D25BA5E97E6EE2428ED0DA258056EDB6889F1 sinuous1y
804,177,082 *5360F458FA4850608371849B9DEE60E88705B000 renestoppel
804,177,083 *53630AF61EB796342B96DA5837D7AE41548588C0 SMOLEŃSKIVEL
804,177,084 *536682B3EDD0C2ECC977FFF855621AD254E3544D sn)
804,177,085 *536A993E3238118DFF81FF38B5BA840716F7A377 RIGOBERTOPHONHARATH
804,177,086 *536A4548EB83CAD10156ECE7620922FD6DB77509 roomthe
804,177,087 *536C5D5B4EE227BF83C10EF4A2859A7B8A9CAD4D Sonia.WiederAtherton
804,177,088 *5362FA5F7C38055630E60C39F6C633EEE1943DE0 ROSOMAKIEM
804,177,089 *536C9130958DF28D0C1827C41BD0A2248C5FE373 RUFUSAUGUSTSON
804,177,090 *536297690788A25DF6D6C8F71F8A8959B5CAB0F4 SQSSRNS2
804,177,091 *53691FFD65B5BEF5939B18E3806EF028C69EEB75 salvadorgoodhile
804,177,092 *5369D5EDCB8AD9CB8A1AE10077E2711AB478859E staceymckeegan
804,177,093 *536B678617DED1CAC29C688E32A8893D16354D23 samporadish
804,177,094 *536192C20E01D6662799A96B7F4746073C183F6F stevenjoey
804,177,095 *536F9A3953551124D40FF45472A8BAE74896D84C scottymacentee
804,177,096 *5366D7E54210ABBE4527194E7171764F6DC73392 surapong6
804,177,097 *536BB099A59C738248182BFB7617E6756644D023 SUS817
804,177,098 *536789AD0E424036CC276FFE96D6EA5ED00EA0E5 T18579
804,177,099 *53637B3455A699221455F300F4E9CF569F71EA3A T^9O
804,177,100 *536B27FBEF87DBD08D8F237CADEDE05CCB379F0D TAEUFLINED
804,177,101 *536F30BB910B9F12CC29DCF81D7049ED552F0AD3 [email protected]
804,177,102 *5366D2420A654A2A9A9994A0862EB4FBFA9D1D02 TANNER.SISKE
804,177,103 *5369A47C9EC601CFCF311690B271F6D618087678 TANZMITMIRINDENMORGEN
804,177,104 *536AB5F0C290288A15AB89F4C89686DF915750C7 SOUTHSIDERS4
804,177,105 *536E7E6274473F0E2C177AE90B2D30A89E18B29A tennengebirgsüberquerung
804,177,106 *5365EAFA970A86F480446CE73D60A32CE8B53FFC speraini
804,177,107 *536D727646644F71FA9842AC5FD0F89BA6A53583 STERLINGMARLEY
804,177,108 *536E632167537BD111B8732C6ADED56C0A3757CC SUALEVAI123
804,177,109 *53634E50C208C67718815EB9CB2FD8DE4C39DF63 timtorset
804,177,110 *536F1D87AFEE9ECEEED6566471B8816361FBD61E SUNGNICHOLS
804,177,111 *5362F076D5E847BA4523BC08184AA733632BC897 tmprlts5
804,177,112 *536C1BFB896B2F1779B01BD108EEDF76E1802DE0 surapong6
804,177,113 *53636761EF909C4EBEB67B61F170D2FAB09A4CD3 [email protected]
804,177,114 *536D76E971A617C2F314E9BAEC18880CFE4DAE6E todmachin
804,177,115 *536870BAC8CCC2287596774C750BC76D3ECCA641 sweetacoolgirl?
804,177,116 *536685EC91AB9D3125904FC36E0554A3C9D44832 TONIGHT.I.SHALL.SLEEP.WITH.A.SMILE.ON.MY.FACE
804,177,117 *53665CF7B7EB26062E0929374BD40E87A48B0285 towetan6
804,177,118 *53621FAE8B86F896C5ED572C602BCF727BCA94EB [email protected]
804,177,119 *536016941077CEF0126E31A80BA6B8CDADF545C2 TANNER.SISKE
804,177,120 *5363EDBC8C44989A652A4B98738FA580B18CF7B4 TTUDHIAVING
804,177,121 *536B88BED31F3D54F1264D448143F13A34203399 TEAERTEAER
804,177,122 *53680ED137C96B32FE47180F356954D75D97DA70 TY.BOSSBOYZ.THOMAS
804,177,123 *536D290DD839158E691FC4A94914D9C2EDC5B343 TENIRAF
804,177,124 *53650F38C2D2615352E5D81C23DAC4F2A4DA618E TESHIASPENCER
804,177,125 *536C626491DE6946EB7E08BA31C22869C838B5F1 UNIPOWER'S
804,177,126 *5361FF2AC9A311D18FC6773B4785881BD96E5E43 therocketsmiths
804,177,127 *53603730D70703C44EBD581ED8150C735465B8B0 UNNLAEREDD0
804,177,128 *536D0DDB06BACA23125C032286330EA557F67CDA tmprlts5
804,177,129 *536CD32E8735CA9EA99558B694A020EEC436A322 TONIGHT.I.SHALL.SLEEP.WITH.A.SMILE.ON.MY.FACE
804,177,130 *5369D5A4AAF33B0B1730917ADB7FDCDB61EF5713 UU0~.(######p
804,177,131 *536E7DBECBEB7DA7D7E551CE7042BA712F767D2C UUYKISOIED
804,177,132 *536A2C16B5E7BE79C0E9278942234BEF884F7493 UUYSNEZ1
804,177,133 *536F236F120DD40B0BE577EA3C8B72CF68852D5E TRISTAN MERKLE
804,177,134 *536BF63D4E516401C1B332D5050D0E9351F5713C TRUSTEED6
804,177,135 *536035C6B702A07266901BA154DA97A81DC67910 TTUDHIAVING
804,177,136 *536965B2417704F482C451FAA7080E0B100F8EBD VERDAGUER SPAIN 
804,177,137 *5369B95E9755452A14E9651D557585DB5CBADAA2 VFZAZTFSDYRUN5
804,177,138 *5364D2716E475112DB09CEAD475A1B5980D63E29 [email protected]
804,177,139 *536EA2388234914B248E68D559CB68AAD00F5094 UITBAATTE0
804,177,140 *5364ECE71B8CE7465487C77D7FE0E4EA2F80831A VINCENZO-LOFARO
804,177,141 *536A403E5DD58502EBF7F5136FEC40E1FA892704 VINCENZO-SILVESTRO
804,177,142 *5368128EC3194890681D4844164E4FCA985BBECB UU-0~-D-8
804,177,143 *536DCC83BF6DDEF5CC4B31C2ABEF91CC28D81570 VALENTINROLIN
804,177,144 *536800DDCE9D75DDA6CD5BFA6F501E1C5EAF3B6D venusromero
804,177,145 *536E2DD10B6F05439FE2436DC1A2A6F9E61BE2B7 volleybalyssa
804,177,146 *53621CFE623C0F9EFA40B28E2016542408359795 VORONČIHIN
804,177,147 *5362FFD740CC8138A7CA11FA5A38B765228A27B8 VULPITZADULCIKA
804,177,148 *5362D0D720ADB24510129146300076F51E34DC82 V?V,
804,177,149 *536645F4BEC8E2524AB2C39FE40A78B1FEF09A71 WALLACE.BURMAN
804,177,150 *536F60E881E43BB92DF2AA94DD3C661E85B41E88 VISIONPRAISE5
804,177,151 *536EF8B7E264EA5560CADA62E7F8B58790BCAC6A wan.nina.dwinta
804,177,152 *5368FF0B647D6540A1C310735D210D1443260F06 VORERESSE2
804,177,153 *536CD239B2E2261559BABA5E1C1395EADFF8FBE8 VULPITZADULCIKA
804,177,154 *536275CE21000AD9249213518566CDC305E19EBF [email protected]
804,177,155 *536AAE2BE922AC4770405850019BEEB3C2AD61AE WAITING-FOR-ALI
804,177,156 *5368485B48254958E254495BDD0C776B3279264A [email protected]
804,177,157 *536CB562928CAF4AE2F3749105F16DA501147A53 [email protected]
804,177,158 *536EFD50896EBDA20A3D633F0B7F5C54D9B1BD39 WILFREDO.PUST
804,177,159 *536CBA06CCB325DC4E1118244969C95DA05FDF83 [email protected]
804,177,160 *53681FE9DA8B498ADCB12D51617F55935BAA7BD6 WILMERSWOPES
804,177,161 *536F892FE17CDA3E015795F743BC62C5BCF28D70 WINGATEJOHN
804,177,162 *536CB67DBAF1EF16857DA5A1BBB8A1325E6397A5 WINNY GICHOYA
804,177,163 *5360D4B7320E7227DBBBFA935B4E724738010E6E WOODROWLARRICK
804,177,164 *5363F871ED0D03FF681F2F974ECD21FFDFCE5563 [email protected]
804,177,165 *536C201769DBE23F8613480D03FA83C43CA6C4EC wwwsuperbikecouk
804,177,166 *536AE9C2660463287C163F9314E14724015F210E [email protected]
804,177,167 *536A299F89F053A139A74DF6912952CA1BC55ACC [email protected]
804,177,168 *5364B6ACB602DA90CB0F852607B58A8291D1414F [email protected]
804,177,169 *536CEC2B063EB04795036B65BE0D155097D68F45 XMIUQV
804,177,170 *53629324CA39CFE11187BB39061933BBE0D6DB6C )X([email protected]==q
804,177,171 *53680BCD9F157C8B526CA813B9A3A42414358E83 [email protected]
804,177,172 *5362A67376BDF1DA4163DF28FE82827BB14DC22D XӘYALINA
804,177,173 *5368407F55865CA3EE0F78968623B234B6D80C50 [email protected]
804,177,174 *536E6C5A16D80E030836054F0DE8232989840BE2 YARITA.COREA
804,177,175 *5365FEAE2E6F04E510E54168EBE995CA3E57D6E9 [email protected]
804,177,176 *536307D5EFDE55189AC89B46F69AAE8ECA0E8B00 ylber.xhemajli
804,177,177 *53672FF9EBC135BDEB89E98B0543AD8709AFDC65 YNKSRYLS
804,177,178 *5361BCCB3B41FF1327277BF14499E8BFFAD9F9D8 yotam.azari
804,177,179 *536827D1E7358FB1C5F83C17E386672C17467E95 YSABELLENICOLEBERNARDO
804,177,180 *5369B936B1DF7FA3CB2744B1B517738F6233CCFF yuderkis-diaz
804,177,181 *5361A042C41709DF1324B543E953D92D505FC876 yvettecumanayanez
804,177,182 *536926395EEF7CEB13280FA7099CC6A7014AFA90 ZACKARYMUDGE
804,177,183 *53618E0CCF86DFA4FD73FC3516B0249FBCC889E8 ZANEANTOLIN
804,177,184 *536E72A53F71A696C38D0CD5EBD422A0EB6AFF46 zarlasht.tarakhel
804,177,185 *536631337D3C1F94DA0B90F90F0233201E871EE0 ZAYDOONA
804,177,186 *53688679F13BEDA726C8A5A9C4B67CC13DBD2097 [email protected]
804,177,187 *5363C0AB31DE528019932916CE7FCECDD8158545 [email protected]
804,177,188 *536C1308AF98735F914230D121A6F1733FE828B1 [email protected]
804,177,189 *53685B1F7AC0F933C0077378621BCB952AFA05D8 ZINDONGA
804,177,190 *536457FD2C74FD511EEE17F624E823520D7583F3 ZIVOJINOVIC 3 0
804,177,191 *536FF626C5EADDE938722DABDAE134B7E7DB402C ZKOORDINOVANIM2
804,177,192 *536170A7637D0FA884A5746BD6398F4C1753A5DF ŽRJAVČINE
804,177,193 *53609E7E1A1FE84C1026C1C7993ADC995D749AD8 ZWECKMAESSIGSTE5
804,177,194 *53662331780329CEDCCFF37F24079546A2D265CC запогодило
804,177,195 *5362BC001150F0B3902D2C306EFE7802F2F5CB4B НАКРАДЯХ
804,177,196 *536BF5EF1341E7F521D1DDFE806E656713E4356D «СТАНДАРТНЫМ»
804,177,197 *536C2A72178626FB681EB7194D7747F807093B31 ШЕСТИСТУПЕНЧАТОЙ
804,177,198 *53612D450FC994F7CCD5B8E219E37ED1460F63BC (0_<)*-*<----3
804,177,199 *536A750D6263D523D2CAD9C9B1E7794EB39BEFE1 1269AD1075
804,177,200 *5367F1EC3E12C2C56E911193A5C0E6DAA47394EB 12-adivar
804,177,201 *5366427BD7F73CE372214D928FA525D21665C9D0 1415919 lis
804,177,202 *5364F25E58831701423CAA6C04ED9E1A049C2D7A 0ILUVSTARWARS7
804,177,203 *5368CD993913540272D750C090D57C2DE9F1A642 1936646 FILM5:UPTOWNGIRLS(14,1630,19UHR)
804,177,204 *536C9D99B320E167C89D2315E54F5A2EA5973AE2 19670609DAM01
804,177,205 *53645B4B72407EA8CE1845887416C2AEF1623472 1-ASIAMIESPISTEIDEN
804,177,206 *536F09F44C116EF0DB1527AE519538D6E8040419 1auto-aiheisista
804,177,207 *53698AC2DB2B3CBD39C07E90562F70685CEB4BEF 1.DUUGRETIMININ
804,177,208 *5369A8AC61F848DAD5AFEDAF7538BE88B14EE7CC 154078JP
804,177,209 *53657EED9262F61C693FFF75365E6028F7E50209 17.Mistakes
804,177,210 *536B1450973075782A14B6A6EBD1FE04DD86175A 1lohiniemi-nimisen
804,177,211 *5365D485726677CE77AE6AE50A49462AFEE72FFD 1.LUONNONSUOJELUK
804,177,212 *536032465FB4F016EF1C5B725D721FB06433ECDD 1CAPLJINI
804,177,213 *53693ED29D2E47D1A098FFE5D5BCE966B422F533 1Q2W3E4R5T0955
804,177,214 *536C99B21D290D3E1C4FB14567C710DEA7BBB64C 1-ranelli's
804,177,215 *53640F9A908817D3C873D12CA857C6424606E8DF 1reykjavikta
804,177,216 *536043C6C49986FF6925CE50A229F2F5872C8D06 1EMERSON-SUPPLIED
804,177,217 *536F1282BBE6AB9D29D9D00AAE3F70A191216B41 1.iforoberbefehlshaber
804,177,218 *5366C8552D2004C599A07A5A11760948A05DF2D9 1JOUSIPUTKET
804,177,219 *536F5C60D0A3577C0D0069D198CE22DCF31A46BC 2331332 deutung-aber-ist-verschieden-
804,177,220 *5361BF357C1FDD2D40B9B4DC823984D63F29C6E6 240-fundus
804,177,221 *536780E35C7FB25C32D47ECF5385ACEB3050DC85 2482414 tarvittaessa-maanomistajat-myyv
804,177,222 *5360FDA4CCEB83DD5DA98D2DED9C2656C62BEFC7 250354 CEP.TELEFONU.ILE.KONUSULABILIR..
804,177,223 *5360A68A47850EABC0741FB6ED567124F95A3705 1PEPERMOLENBEK
804,177,224 *5362FEEC3AAAEE6FEE982C0ED304557460309932 1-soliloque
804,177,225 *536FE019FE9F1685055F7498802EDE50B072008E 1THATSTEELE8
804,177,226 *536CD3CC014970F69EA295F214F72CABEEED1831 2AJETTUJEN
804,177,227 *536D875459FF15074C835B8E7C618E56C408D6A0 1-WISSENS-MANAGEMENT-SYSTEME
804,177,228 *5362DFF2398106D5143F17BC58B00BED9125A268 2-deangelo's
804,177,229 *5369331CC690FC0422A2DD85FBDD185B262AAC3B 2ELVIA-SPRECHER
804,177,230 *53620E4972E2C963A7CB786EC5BCCB5EA40F7167 2ERSTVCH
804,177,231 *5369E9261677765E0DE92D821FDF27A4461F1CB5 2ICでは1900年の分点に基づいた
804,177,232 *536E8555BD338DA4955360C5051F54CDF7F9F43B 2-PIKAKIINNITIN
804,177,233 *53657C4DD3C245231099482A489A696680805DF3 2REINBECKSTRASSE
804,177,234 *536F884CE28421B11739EABFCAC9B50A9F924DF8 2SANDRYN
804,177,235 *5360D56E3234AC94056B47DA84FC1B6AEB66C7F9 2theweasel6
804,177,236 *53647ECFEC013914E9359D2365130D6294D6EFF9 310DARIAN
804,177,237 *53652FDA9C6990F2ED0751D4FF1EACA612248D6E 22DECEMBER1940
804,177,238 *536BC9419E43EB14228E8C691A314C11CE05FE2E 3EVITARUP
804,177,239 *53670F390BBD148E3F36D5D2E99A241177C3C687 3GENUTTIGDEN
804,177,240 *53696F4794206A262C9F20F3BB0A644E6AA727AF 3 gezdiginizde
804,177,241 *536467133EBA7ECA4EF5758A72163AE69CCA216E 3 karsiyaka
804,177,242 *536619825818792E0258A0ED9346B56236F723D7 3sekit
804,177,243 *5360ECD77978E38F33D01139133B8BDB29F64F43 42wildcats
804,177,244 *5369DBF3EEC78D7D1AE35389A3F1241A185EF2FB 46237 tum.frekanslarda.sabit.calisma.cok.genis.dinleme.acisi..
804,177,245 *536501F2696A2515CE4986DEBE9EC1E693889750 2620786 DEBATE WAS CONTINUING TODAY .
804,177,246 *536DCCF6E5E2F179171E8186E28A10E0662D70CB 2789016 IT-TRIGGERS-AN-EMPATHETIC-RESPONSE-
804,177,247 *5365E9B8579D485FF9BF18CDE695E9C9016ACE51 27FEB1786
804,177,248 *536B96A3BAC4A58D5207A9826B4A3A658819B208 4.lasimassan
804,177,249 *536B0227572413918524816B5B910586F3FD73B6 4.levysi
804,177,250 *536AF92F7B5420F1B8E891CE5ADBD4A547388575 2936288 bwt-herotown-nousi-3--ulkoa-sel
804,177,251 *5369288A8EE0688B7E0AB34E0080A461496C530F 514.mistress
804,177,252 *536D8B5F6B13AC1D5347BCBE3C1F309F95F748A5 536618 tek renk ve Cok renkli serigrafi baskI ayarlarI
804,177,253 *536CFA5C45224FECCFFE20628A3D33F230CC19CB 2.osallisuutena
804,177,254 *536591263355E01A1475B7A78E4D661863ABC6BF 2SUKATAZU
804,177,255 *53690E49844751AB860DC381843AA96A9D273AF4 5MASSIV
804,177,256 *53648DCA3B89BAF8E9B4F6D11819C72A31E677E7 3 ARCILLAS
804,177,257 *536414411CC1C67197E9BE8F9C69A516955B9ACB 5OUTHKOREA
804,177,258 *536FBB306B3589A5C07C178C0207E04F4C8396DD 5YCOORDBSW
804,177,259 *536786DCF22F7771C370F1F35F3BA5B51A9670C4 63.'LARK':.3..MENUETTO..ALLEGRETTO
804,177,260 *536D5617471483DA308E0B1A4564A0A5F9745193 4AWAGAKUF
804,177,261 *536908BA1425DEFF24067EADB04E959B453FFA30 6MACDONNELL
804,177,262 *5365B71CD6CB69FC2EA7BDB74442C2F0BBFD02A3 6PICTURETHUMPER
804,177,263 *536B44253A693215702637031F6EEB5FDDA488E2 6PRFERENCEGIV
804,177,264 *5362F90E106E9BE80E897CB715F14B978BDD8E39 4IZRAVNO
804,177,265 *5362BBBFBCB34BB1807DE7FBF5B5DE990090F1F5 4ogretmenlerin
804,177,266 *536571130246D5645D37F86E0AC9F9DD7E970283 4restauroituna
804,177,267 *53613758F5586E06BA027CB2B440E2FB1700A37B 4V4LO3
804,177,268 *536AC79CD0BD35B8B2E931E6FEDDCB66B56B76D5 5ATERINSA
804,177,269 *536FE96E0C120A18576F92BE70499586FDDC4DDD 5PLEBEIANLYV
804,177,270 *53678F55C2D374742E0D0FE035B893FE5D96ACC8 5technologietransferzentrum
804,177,271 *53601F10097D3DC33E0BB0C715CFD47E22F31A0B 847branson
804,177,272 *536CBD96566230D43E8B0AE44051B5D90C96364D 6ANIMALSBRUCE
804,177,273 *5362ACE2196E40A7A4AC9187FD8D0DFFA2E535B5 8croutes
804,177,274 *5362CAAC76E231686D41CD81B9179DA63486C45E 6DEKCEHC
804,177,275 *536AA1BA11FC79C4962DC1CFFCE142EC2B95A0B6 8RN57RMR
804,177,276 *5361840581E8F1D6744BC717858FB9E55DECFA3C 8T
804,177,277 *53620BEECAE344CF7CBFD8F61002C65A597AE848 93HANGENDER
804,177,278 *5366E356BE0874E281D563F240B9D94880B57B4C 9DOWBENCH
804,177,279 *5367DA6FB9278B3DE1E939EE810DFE718BDBEF4B 9ESOTARRE
804,177,280 *536B9DE8F354DE854AA08557F84FBEFCC35A6BCA 9FIGUREOFFUN
804,177,281 *53653EB20B7C63241EB9A903933F25D081117819 9FLYERSVICTORY
804,177,282 *536B0CEC20DE6847E6235D405B9AD62AEC0F7F51 9GODSRIJKS
804,177,283 *536530C5C238D8BB248FE8D49D279699476A5897 7FLIPJOHN
804,177,284 *5364C2EEBF77A8BD1146EDB7ECE2E1D763AE6608 7NCASTERS
804,177,285 *536D215A565679002A711BFFD3017122B71486CD 9PROZESSRECHNERBS
804,177,286 *536FD4543ED2AC6B0692F76AACEC9476181E7DE2 9QIPDUCW
804,177,287 *53679EACE6337FFC9430ED7971642D69DE1D07E2 9REVIERT
804,177,288 *5369206AD72D09A6EA296D4741896FB41296D39B aanzetstaals2
804,177,289 *536FF0F792C2A0DC22994A6DAF5F57444E143863 aaron-constable
804,177,290 *536FE3966426118869E65623846CB1B27843CC47 aaul/
804,177,291 *5360827457D095D9882C527B9D0F9CC907236208 a/bfb
804,177,292 *536FC25392B7ECD42348DC35FBDDF1ECFD4D0C96 ADAMPICARD
804,177,293 *536F20D5B50B779B4AAE395C2A0026099361A10F [email protected]
804,177,294 *536F15CB075C9AD3A5A30D130159C6CEFA6CCC0E ALFONZOCASIO
804,177,295 *536F0D9D586B1FAB5040F27F0BFA68FB7674A002 ACAHA
804,177,296 *5365B7EBDDA9D44BEC3855523ADF9FB700801BEE ALONSOVALOIS
804,177,297 *5363481A0150BE163CA884BA3C93CDEBC17EF92A AcWN
804,177,298 *53615166CAAD585E304C859EFCD85B1FD8523508 ALVA.HIRLIMAN
804,177,299 *536061804214A5724E8E053DFCAB272438B6C046 ADDEN+1
804,177,300 *5362C3AA41BC22C3957FFE1E6D1EB89BBE28F9DA admlf
804,177,301 *536065FFC269ABA4A2AA3668980CDF0511F892E5 AMOYCE
804,177,302 *536540EC1509104E51C2142E6B741DD890FDA903 AEGOPODIUM123
804,177,303 *53648692D71B579F3B8E0CBF4C56138162A5C46F and-to-such-men-of-gravity-and-learning,
804,177,304 *536E5C805CF90C361C3F4510709612777EE3ED1C ANDY.VANVORST
804,177,305 *536870EC3744596646A2FBDA8D3B8D063BB4E8F7 aggiesradio
804,177,306 *5361F712B080B76B5436EFDB402FB4F735B5FD18 AHMADFRANZINI
804,177,307 *536F80602B7A2CE10A1D317B275DA2B48FCB3951 anouaheh
804,177,308 *53652B98AFA6B0E4EF896C5675C36E5A2F34A4A1 ANTONIADOPLE
804,177,309 *536DCFB529E917F6D1406A68E0D8A32D9A8E445A AISPIDYL3
804,177,310 *536B7F15AAEFEECB68E5DDB444B7FDF3AC9E746E antonio.villagr
804,177,311 *536903BC672ECCD33ED4D725C656FF54C447C7BD AJIS|Y
804,177,312 *5368AC31F37981EA265AE651A07ECCBC1B81ABEF alfonsovasquez
804,177,313 *5360FA88701BA53D6E639FC3B9136286C6EA3F60 armandomoralesjr
804,177,314 *536EAC63CCFA95287BB645C6798A7E9047FF365B amcg
804,177,315 *536A372AC8963A04F6C1B217E208A7C900A87DB6 aruelpos4
804,177,316 *536F538D8966939BF7E3FB9819A7541ADBACF146 ArUl
804,177,317 *53635BC915B4BF745ABB8C10C2178A28CE83FBDC apprehenderions2
804,177,318 *536950E850E96B4DCC481CD2891F9A418D78C8BF A$vH
804,177,319 *536D9CF5926CEAE996FC7DEA6A4BCB784428F491 B_0?
804,177,320 *536CBD37439BC2B44EB2B259315CD99EED36D8BE b;4ne
804,177,321 *5360A505D0E606B7A62B56174F36167B347E0E70 ATRAPADOENTI
804,177,322 *53675F166BA4588F3E176AC4E25B91A43E134D56 AU_0A
804,177,323 *536E664FE2AAC502B6D8A7128F73CAF4C5C3A784 BARNEYTHACH
804,177,324 *536E5BBD9671C13810D0CDAC323ED79B1AE43E74 BARRETTDICOCCO
804,177,325 *53652FD0F6160F2B67BA52D15EBC76E17755EC20 avaunt!.debating
804,177,326 *536FB11FEA613066F0CE8B6DFA58A15102D544FE B",(A
804,177,327 *5365B9F737AC2C5EE1811849F6B36916B757427A BESORGT
804,177,328 *53634A595E592ABFF5D9B1369154D0E823CB06CF bima4
804,177,329 *53625B968A62E1CA3B282D3A4174E386072B3388 [email protected]
804,177,330 *53607001ED1ABA2C793FCA459E60FEE5F7E6E196 BE,-S
804,177,331 *536F062F3145E3D32BDB3BBBAFB95D79FAD69DC1 bibliothekbehörde
804,177,332 *536BAE2FF5B3D920222F164463EC88A0A7AD552A birsgal
804,177,333 *5363ED6AE0481DE324C2B9DCA0C19F12C90901F3 BLM3.
804,177,334 *5360C68771648224EED6A3353D8C1F981F250499 brw"7
804,177,335 *53664B39A910545F30F1AA6BFC7443058F0DDE7A bt#=
804,177,336 *536612E107C7D3A03D9E75EE6FBF28FB96192A5A bw=x8
804,177,337 *536AC2DC08BE0F79F90BADB492FED61E639EC8CF buqmv
804,177,338 *536580A88B1217253CE0033B5403C5F0F7B9399A cait.canavan
804,177,339 *536362C9EBE654F6827A4FB8255668E006383C70 CAKNAHC9
804,177,340 *5363995BB4AC73315515CC78A6686F1086B7C999 BYNILVALS
804,177,341 *53649C898822AF716A273B17EDD1BD9E20F16723 carlostutoky
804,177,342 *5365C93318F39C3F7709B654174F23A8F63D3BBB c1rh=
804,177,343 *536023AEFEA0AD4DC65F0A74E1B7DA944DD7414A CASVM
804,177,344 *5368A13AECEDBA78A9A24800D528AD1EC9F81F36 cellosonataina:allegrobenmoderato
804,177,345 *5369293003D9C9BB744ED2FF4C21411DC886C9A8 CHAD.VAIKO
804,177,346 *5362D641808353FEAF8180F3A21523524F777FBF [email protected]
804,177,347 *5365D0934060C2206C931F01AF8F448A97150254 [email protected]
804,177,348 *5363271D0C982108F2E204D92CC01CC683AC9810 [email protected]
804,177,349 *536FA5870EDC22B5FBC587287EEF3FA45B52588C c,#/d
804,177,350 *536588639FD7468CD4293AFB41C406A1C5FC42C5 CGGVPIXH53
804,177,351 *53650453905CB0EC297A8FDDE9E4A17623185FEB clintonmalafronte
804,177,352 *536120125978EB28ED8F129B587F6FA5D1A415CD CLINTON.NIESEN
804,177,353 *53672CC6D5845A77BB551C1085C9878CDD4CC4FD churchoflegesudemontreal
804,177,354 *536BF21601E64209378DD358063A427DE1C5C556 C.M;U
804,177,355 *5363ED147947C06F5E7D9FD543A2628D690037D1 cokato's
804,177,356 *536E605248348F569EB63FF8BC1CD48860CFDC40 COLON!$E
804,177,357 *536FA225A400FD8C327858FFFF478F6C37AB1398 COLUMBUSTEMPLE
804,177,358 *536C6B983D91EAFEB6BA2A62D1A1BA8C339C3A8F CLOWNISMUS
804,177,359 *536DFC359DE7B8B67DB0E5596D4108B6EF371A20 C&MU-
804,177,360 *53675F3EB8C50CB52E8E97AD240032FA6D131BC5 colorarn
804,177,361 *5366BF220F2432F231302D8D40B402201DFCE712 COVANCE0401Z6
804,177,362 *5362B68BBF7C836C17EDBEBF124974B5285EC79A COMPROBACIONES
804,177,363 *536A149CBF67A596E465E973A59E2A0FB87595E9 CQ&IS
804,177,364 *536C0B23F36897F388ADFF0DD2BD3B596329DFBB CR$Y/
804,177,365 *5369E5CFB11BE806B8067D72B15C30553A582611 crystal.josten
804,177,366 *536C2D0406BEA5DFF90DCC7554872E3CB23D993E CS5YQ
804,177,367 *536E4C4B17CD44E56096C8A6DA3065D55CD531E1 cqp4?
804,177,368 *5360380E429540711439078D364C13CF8E8F024A CUBAN-ROSE-(30-SECOND-VERSION)
804,177,369 *53614829718F2E5D434C3F143317F59C23E6E92A cristobalwirth
804,177,370 *536F1FED069393DEB3D9F873F4AD96F217F83420 D34th-hou
804,177,371 *536F8DC20299793FCE5638734DBC9AC9A5B08CE0 d3fxk
804,177,372 *5368545140CBC5F8E53A928135155B717A68EA12 d3s6b
804,177,373 *5363E5317A280AC12D86B6201010661D6DFA94B0 damianstallins
804,177,374 *5361C3C5BBAF00E1413878ABEAA198E9247A1E34 d5ikk
804,177,375 *5367D63607AA3BA8372DAD5596725C3F9EB4D9AF D7QWY
804,177,376 *5365D4B38D935FB9D9E5225F546C1564BAE56FD4 d/afb
804,177,377 *536C75D71E0ADC890E2C9AB3FED022BBFF590679 DARIUSNIEBYL
804,177,378 *5362749269BE9E79F241F13E6866C0506050E075 delino619
804,177,379 *536C9AFE9ABEFDD543A9B80C5224EB33C5F72371 DEON.KREIG
804,177,380 *53676F5794DA65A1D9D7C4BB2F83EF7CBD510B27 DEPENDE6
804,177,381 *5361721F18D212C15BE71C09482DA42E0085FF36 DESHAWN.PETRICH
804,177,382 *5362E9143312126F7D7271E9DA8AEBCD52C6EAB7 DESMOND.CUZZO
804,177,383 *5365C18977B90F88C781AAC602C8D1BE7FD70181 DETERIORES5
804,177,384 *536364CB835E1873096DC76E565E95240543CC8E DD2823
804,177,385 *536163E856A79C93184B1E991E12F797E03F636E DIEGOLIESCH
804,177,386 *53682584F08A2972BE1593E4DDEED337098ADB4B Digital.Heart.Generator
804,177,387 *53631111290D4644D57633C6118FF265D5088FBA dillonkrupinsky
804,177,388 *536DCCB246E709DA0133475FF3D6667E1101BBD4 DEOSTSCHWEIZ
804,177,389 *536C68D2DB326066E8718604F3857337AFBD6DDE dnvrk
804,177,390 *536FC8BAB9EAFFC9232202DF9EE8B18820A6E722 DHANJIT DAS
804,177,391 *5360D41B42643C306EBC22582350F1D94940F8F3 DHCEL
804,177,392 *536E56E976050A6E3093025D9EF641148A4E63C2 DQ3NN
804,177,393 *536DCFB02DA1936DC8E47ED6193FB5B7920F92C5 DRAWNEEKED
804,177,394 *53661AAFAD3120182018DE6D7EFC6548E7859003 DÜRFT
804,177,395 *536540D15F8517567EB47F713586F7AE16548234 DUSTY-BEAN
804,177,396 *53679CC526BAB00C7007E7070A352E2E6C8C8B72 DK43L
804,177,397 *53669C13CC8BEE12236AB8D4E4004026A222609A DM+PC
804,177,398 *53627E4047A7A9C9BB4B00586A66C854D6CDB600 EDDIE-NETTLES
804,177,399 *536B1D5C32DBE410C3C4F09E10C0552AA2B08021 eddysturgul
804,177,400 *536DF1A07B702339A6468041496DB42A8F27960C EDGARDOCIGANEK
804,177,401 *536AF2472905613074A0606F0C12A2103B925D66 EDISONWERLINGER
804,177,402 *536B0923A56D66E5E233362D70F2B5CCC9126D00 EDITABSW9
804,177,403 *536014F4429456D167E2A8AACD7D171B149FF34A DONTEPERALTA
804,177,404 *536B73778416349560EC77542A27E18616E4EA3B eg?4a
804,177,405 *5368BA5FE9AAD46F353836A8673670306229AAED DOUGLASSGRUEBER
804,177,406 *53687E31432F619A0D97B3A278DCB6391892C9B3 dp71i
804,177,407 *536B9DB200A555659263ECAE542D8AB270BCF006 EL6BAA
804,177,408 *536DF5CFB3B2EEDAFFF7C2A82B8647CD80EDA6D7 ELICITSCOTCITACUKWWW
804,177,409 *536AFDCA722FAB45E08D92FD4BD0512034222F69 ELIEZER388
804,177,410 *53603A528E2FA28FC70E11407857FDA36AEA4EA7 elvismcroyal
804,177,411 *53682E3AFB8441E9BC24E6BFD90E07713A75234B EMAGOEDIV9
804,177,412 *536EE2C5B5E8E495784C34DBBC2DA01BB51882B9 du9"
804,177,413 *536BB43E97F7A77EF4AB3ECB76EEECE68770E30C ENANTEMO2
804,177,414 *536B3A2521CB4A72A7ECC34B47AA2CCAAFDAE6EC [enter-a-third-servingman.-the-first-meets-him]
804,177,415 *5364FE5C4995F676D76043C4BF2384E9C6FD053F D"W6
804,177,416 *53620D6E889DDB26315DC406CCA1715A13A79319 dxtcz
804,177,417 *53639613ED2C301776F039F34780B0AE52222DF3 ERWIN.OLESNEVICH
804,177,418 *53626350BDB2AC8C15099CF38751457225FAF831 e*s?
804,177,419 *53666BDA582A35C36E586BCDA80B2C7037146447 edit-analogs
804,177,420 *5360DB40C27F305D759A268811F8047AFDD83495 EZEQUIEL.LACROIX
804,177,421 *536338A69BC03216A71789684A9CEC89BFC8001A Eに該当。記事の大半が
804,177,422 *5367075C564F9B1832617B6432010036221BC2E8 elierebu9
804,177,423 *536BAFBD161A8EB7C581198A46EFCF09E89B40A7 ELLAWAINE
804,177,424 *536CD393A0A0DBAD4113890D7DAE5070E3ED0254 fdckfttb78
804,177,425 *53610950621C86CA44BC6D6D50C370AFA3C91856 FEELEYN2
804,177,426 *5362F9CBC2812F33710EF1C2449973C637080CDC FENGSHUI7
804,177,427 *5367ADF565A2848A0111BA4F8B2DD39F022B41CA ENLSND
804,177,428 *53626EB6FEF5A8598B183469BF6A5CD89D712D91 FIDELFOGAL
804,177,429 *536187E488BB2F11B0A03954CE7A2920CE634DEA ephysics
804,177,430 *536DC4BD5D1549EFBC1941BF9CD74AF05FB7403E eqoearey7
804,177,431 *5366225525201E455EBB49B17F09255911F095FE ERNESTBIBBS
804,177,432 *536CD757DC4B8DDF38FC1E67ECE39F2E09518CD9 FORAN13DN
804,177,433 *5364A5F9E5424C1261AC7F26169D72D0BBA5FA3D FRANKIE.SHIMSHAK
804,177,434 *536B1EC25C86DE5FE6FB249E7A6606EB607C9817 FREDERIC.CAROSELLA
804,177,435 *5367CC9BDEDB53C76EE0AFD75B199D68E8BE8899 FREDERIC.SOREY
804,177,436 *5363565F9B2C094EDE94621EA26F66AAC5359F9B eugenef9
804,177,437 *5368F9A8804196A983C4D7652746624C772B0336 frigidare-woman
804,177,438 *53695D7515343C0CEE1A1280EA35B3D2AC40C0D1 EWYXCEL3
804,177,439 *536189DDFA9F890E0C527657EB22F6197AF27078 g302国道起点
804,177,440 *536502C60C8E9D92CC4A0BBF24DEB510FD4F5CE1 GARTHPINTOR
804,177,441 *5367634A8F35816C2FBA80477DF296280DE464E1 GASTONMESERVEY
804,177,442 *5368901D2EA54F447B5A4AA879290CA7445175CA F"C.
804,177,443 *5362BC24881B9ECE8CDB103EB2FEBC445FADDAF8 GENEUGLUM
804,177,444 *536133EF01EF525A1479DBBA0B7804BF8E4B920B GEOFFREY-YOUNGSON
804,177,445 *536C947C4A3202839286AE4D7403EBDED8EE1BFA GER3MANY
804,177,446 *5366E4C8FE107093BCF92C7499D5738A7888C499 FICO-LACOSTE
804,177,447 *5367497ED9957F7C1E842B4AFA4B23B0DD76850E GET.DOWN.TO.THE.SALE.(VOCAL)
804,177,448 *5366954B8A5FC975346011ACD1FAD386AD62EFF2 flagunchina
804,177,449 *536C5FC4C1BB40A5B02B65D48B20174B15710F89 GIMME-DAT-BANANA
804,177,450 *536EAE4D597B9A8E62214DBB5589A4CE63F45EDC giuseppeanadio
804,177,451 *53627C0CCF8A66C37F1BDB6A9B5AA87D54C6D427 FMECIER
804,177,452 *53604ED61D271E5C7178BE20CFC098C1BA8B57DD glua
804,177,453 *536B71E6FB93DB47EFA665E679DD812855CDC700 GAMBITDOROTHY
804,177,454 *536176DDF8AA054D8B2AB8350F89019092A94122 GARY-ELLIN
804,177,455 *536276BED879043B6A49DB3176B0E797E6779A54 Ha,-I...think-I-wet-myself
804,177,456 *5362A961D6CFBAF1FA8E152DEF0BF2AE2EE7B357 hajimemashite
804,177,457 *536DCAB06FFDDFCDFBFE82E981E4BEC3199229DC GOU3SN4RD
804,177,458 *536C36F3A94D4334D01E40595DBEAD049D932057 HAYDEN.RETANA
804,177,459 *53646149617DB1AD4C988EE911B9CAA8E3C266C3 HAYWOOD.ALBRITTAIN
804,177,460 *536F23DE31163D2D648FAFB50BAE0BA2C2B4A857 hb%d
804,177,461 *536B4C2DFE77BE1FA5AEDE6B6513BD7BC6908150 hcuokkebbing
804,177,462 *536ED3CC424A027EC82CC3630F4121FFE93DCF39 [email protected]
804,177,463 *536BC480F87D54C5358BFFCA20B544D12BDB0AEC GREG.KAZIN
804,177,464 *536D345DA1AA276B259FE054752E2FC2CA4FE222 GREMLINS
804,177,465 *5368C1744B0F5E168ABC4755B2724D1B0E95B8FE HEDKANDI:SUMMERMIX2008(DISC2)
804,177,466 *536AC0B59A750A465C8E990C6AEAAD763F86FF10 GTCTCTCATATAGATGCTAGGTCTCAAACATAATGCTGGATGCTAGAGTGCAAAAATGGA
804,177,467 *536E54A78ACC9DE06C2D9E129A540303B36D9C26 henryiacobelli
804,177,468 *536F8543408B2E883975F22EADFE69DEC9B7C52F guariro
804,177,469 *536CC6327E67FFBDF796131662E09492EC46F139 [email protected]
804,177,470 *536C4CB4AE27D44713180D32D75481D3F479E43B homerjanecka
804,177,471 *5361730A4F57980E8E58E80059708F9A77E4B54F HARRISSTREICHER
804,177,472 *536C2D8DD86576E408E672261A35A34F9687BF30 [email protected]
804,177,473 *5362925BD76D041FC9E88082450FEAC9D8E24828 HERITAGE.BANCORP.INC.MASS.|.UNITED.STATES
804,177,474 *536DFE7734364C8C052AED9230BC89B163AA213B HPIDTSOP7
804,177,475 *536C0DD7AAAEEB888874341EA1ED069137F7CA9E ijiemuuying
804,177,476 *53650CAD9F6E3418D35221A510A9D91A6E925E38 [email protected]
804,177,477 *536F0D6A45B617305A95FFCB3280DE5B89DBA01D INHIBERAIS.
804,177,478 *5363CAE5812052779FC61253BF4384D818FB8E4D ikihinak6
804,177,479 *536C7AAB42B8620FE0CE2D40C0ACF532313EB59E ILUVBARNEY1123
804,177,480 *5362C015CCA1FA09BE62C2EFE7516D494F8129A9 infractum2
804,177,481 *536ABB45BF7E04FF13F3A3A33E31ABCA6D277D52 INITALIZE0
804,177,482 *53649275ED8C3C9247D968D8811F26B2168249F3 INTEGRATORSONHOOKOP
804,177,483 *536EF42C237CA204BDE525834D82587874375FE7 introduction - biogenesis meltdown
804,177,484 *53662603308E758D48F55C81B82EEB72E8BB85A2 jamalbookhardt
804,177,485 *53668D590B5B9518F6A9CFE8C4341EC1BAB1B0E5 JAMARKEEMAN
804,177,486 *5360514CF8AFA0CE47D4E4C56FB9590508966875 JAMAR.TAGLIARINI
804,177,487 *536BA434D4F0FBF81967C12F1347853A729937AD JANEVINGER
804,177,488 *536DF135625A6BDF98507C45CAE87B3021873990 ISAAC.HACKEY
804,177,489 *53612F1F48B94DF40EB064DDBF72FEDA086E49A8 JASON SPARKMAN
804,177,490 *53661252B3790A4F295ED937B992F96A0EA4505E ISTANBUL.BY.NIGHT.1
804,177,491 *536ADD59CB6A7FE1FC37252321FFFF8DA5C6558A it-will-be-the-biggest-bbs-in-the-federal-government
804,177,492 *536AD697E227EE2F0CA0ABE0CB449EBC44A97AC7 JAMEANTIGNANI
804,177,493 *5365671FBCBB2B1C3CD6269165E6D02FBF9A8DE0 jasmine-starks
804,177,494 *5364CCE945A413D4C59091B31AE893B09050515B [email protected]
804,177,495 *5368639E2AE54A5CE898C4578F358186BAD74E5E javiernosacka
804,177,496 *5362BCCED31AF3FA6BD8BABA1CB0D052DF4B3D26 $jinezan7
804,177,497 *536F3C76C7A0B4C5132182977648D00264065C3B JOHN.STIRK
804,177,498 *536641A120F4A92E739D84029FC65FB2C77B3085 JOYALENE6
804,177,499 *5369315A15EF41E9B17FD9FF68CC9D30CC45C977 JULESTOWER
804,177,500 *53698F843183BF357F1C4AF2EFC0364BE9C542B7 katherinehauswirth
804,177,501 *5362CC204FBA1F0BC3F3A9B48E3CCF8AB695BDDB KEDQYKAAOAHWA3QA8LAAGHRRUHCA8VGGGZRSAQ
804,177,502 *5366C52288C2E980989A14C6352C5EB961947B75 KENDRICKWHILBY
804,177,503 *536C78D0D1AAD0588ECB8BAAD5B5AD970D08D044 KEITH-FUTCH
804,177,504 *53647AF3662502EFE13CE1B17B5158E2F1672429 KELETEUROPARA
804,177,505 *536CF86ABCFB5781B0E30AF8909B83E8F73883ED kimelee1
804,177,506 *536CB9261F0CED4D888C82C754AEB3A352823656 KOUNKOUEIEDOABOYINGAI
804,177,507 *53604AAF1EB05D0922BA86D91B75833C0F92BDE3 LAIMARGA9
804,177,508 *5369D896343F9E520F0E628A24C3D83AC3B6364E Let-op
804,177,509 *5361A4123B51923665E7814C75368A049AAE37F2 LASER789
804,177,510 *53658BD56E8E82B61080354D24BE154AA023174C laudanum-(feat-4th-sign-of-the-apocalypse)
804,177,511 *53643B44C9C050165E19128BD167BFECBE81A7ED LAUREN.GUCCIARDI
804,177,512 *5366E7734C5A1A99B2C7FE4798453E147FB491BB [email protected]
804,177,513 *5366F9D8B2B723005EA2CBA50C0D4893335C58FE LC+{
804,177,514 *53636B0E18618F061D78A92A69D2D2635456E289 LEERZUCHT
804,177,515 *5362993B53449D66DCE58FE5E26FBEE2579D6547 [email protected]
804,177,516 *536082922379E339239DF8DE5E32384E7752E079 LNEYNGALA
804,177,517 *5363FD21F0930865CCF6B581BE489BF9F81F7C43 lif
804,177,518 *536DC841BFBC40ADE270BC9714892CCD58DDE6C0 lindseywesterling
804,177,519 *5361592B54906939D85A6A994A2D1C727A657988 LUCASSERING
804,177,520 *536FAD4EA1BA80E86D01591FB374714C7392A3F6 listderbycountyinnz
804,177,521 *53676A8573F1F7F5482835F417A19BF2118F8E75 lungenpavillions
804,177,522 *536774AEE6E5A0F99BEC412958DC61CDF8837422 [email protected]
804,177,523 *5361B4E1B580CA30AFE0A30479F44B15C159042A luxuriancy
804,177,524 *53669CAA14EAD777759C3F06CA1DB3818F0CF50D M3RMAD$
804,177,525 *53663943E0FCE3DD700315BF690D78B62EFB3FE9 [email protected]
804,177,526 *536978B2A75A4AA2163E58BD82A1361897A7D7D2 MAĆIČNA
804,177,527 *5369B016216EADF3CC28EA07EA40C2E8FDEBB626 LOST IN YOUR HOUSE (FEAT VAN CLEEF)
804,177,528 *5364A423FB31ABB99A63A8E71B151B9DFD48F8BE MAK
804,177,529 *536902A66B83999E12ABA3ECD542D0ED594D0A80 MARION.MANNS
804,177,530 *536EFFA1F391572E7930087AA5DAF986DC8044E4 merlinscavo
804,177,531 *536762FFAF49B19AC94E0957A7C2A024DC4DC23E marcelacheson
804,177,532 *536EFB73EF616E9B325505BA010150AE0ABC8405 michaelgibbs
804,177,533 *53692A32A00A1A7C42C98BA71D5ABB136244CA51 MICHEAL.CANES
804,177,534 *536CA7EF2E94C77BE5BC58AEF71EE682B33BDC7F MARYLIMA8407413
804,177,535 *5363D6553732EDF0086E84DDD73DFF7E975BE18B maynardgoris
804,177,536 *53680288A8FA5D82091F34AB4B1963944F403441 MJSILBAUGH
804,177,537 *5369CDCE9370F7F468EBA78C8D2012CD4AB32DF3 [email protected]
804,177,538 *536D50914A5B535E75FE94CF5439E4247E4EDBD1 megibson3
804,177,539 *536C28DB74BF346CBC2ACFE6F8FEA60364959635 morehouseiii
804,177,540 *536A6A25320237B3E4CDCF2BA0BF3F37792D4A31 MOVING.HANDS
804,177,541 *536065BA26E30768C8231AF28F2A4C056C46AD84 mr.magic,part1
804,177,542 *53629AE697330E90E62B73920438F42B12F86103 MUHAMMAD SAIN
804,177,543 *5369365E02BAD982E902DF876593B640C659E98E [email protected]
804,177,544 *53621D53960744F9E31F1B645E029FC5294FA1A4 MISTOLIN
804,177,545 *536E2BC23D8CB561074265C23E3CC7A140067C4E MOLARDOED
804,177,546 *536F3E3ED17EBA4B434F6CA392DF7DF9C831CBFD negli.amori,.opera:.gia.il.sole.dal.gange
804,177,547 *536DC73C5E005B980221BE06BD511F7172AA0219 MORSENDE9
804,177,548 *536FD07581C59292444350E592BE81A434027D91 MOSESPORTELLO
804,177,549 *53686E3FC72575E6E26EBFC4B3B839B454043BEB NEWTON.SHERROCK
804,177,550 *536D203EB8413A509C7AD67F30096A02B3C6F156 nier, Act I: Colpito qui m'avete Un d
804,177,551 *5362F6151E8F6EB38630D960703820E014F6B89A murphey.lane
804,177,552 *53621B33F17839CB0FA6EBE578F673FC2333656A MURSALALI
804,177,553 *536FA074920414CF396B823BCCDEE36840910962 NAPOLEON.LUCIEN
804,177,554 *536F034166036D1DBB2B170A320B0814CD8C0180 napoleonnadolski
804,177,555 *53632B28415A5BB71A80AF7AA0B9C57560154D9D [email protected]
804,177,556 *5368C7B050DB19BDACBA4A23ED620872E927A009 NATTAYLOR
804,177,557 *536D141A605B18BFDFDA596FB7FD22FEAEC8CD08 NIKI.OBRIEN
804,177,558 *536741214FE3472E5A154719648730C38DE94A19 NITEXXX3
804,177,559 *536EE90CAFFB981C1382D5D2C4641D906C071A26 OWEN.POSPISIL
804,177,560 *53643BA603207E858FD7D7B79AD82983074F0E28 NUKUAMBASSADOR
804,177,561 *53635EFC0FEDEE786DDF3E731259A44D967DF5BD paristhomley
804,177,562 *53617651EF0494BCBA6610D7A79984801E6CB73C OLLITOCSE
804,177,563 *5367D156F3B5FBB5BD7B492C51112EE83AF2A9DB ˈPJOMBO
804,177,564 *536EC2C92A795F06F001869F71B9C7E222978CFE PACHI13
804,177,565 *536A5024FF60DE65DA374C35D830B58F9F09832A PAFT8
804,177,566 *53628B428A81B176F270433343DFC79C7F6E809C presoaks!
804,177,567 *5360A43AF8CC9692A9908339C88F164A28C0FD6E priya-stephen
804,177,568 *53696C0B81B10D67BA8350E1853C916D11685917 [email protected]
804,177,569 *536F7B32ACFACB169D27FB4C3528B930885E0813 pattpatt4
804,177,570 *536E1CFA72F89C8FCA6BCDDF2B642242B68C3B65 pb *)o(
804,177,571 *536B82072724E60C24C239F0E7A565D272507293 quebecidiot
804,177,572 *536F8FDB930FA2D5F115E81F0CFA10E8161E6090 PERCYTANZMAN
804,177,573 *536B55465E1ABC666562CC5377A5CA93779B98A8 QUINTON.MCIRVIN
804,177,574 *5360917B2C0596393F94C4635E57091661B46E5A RACHAELPELTIER
804,177,575 *536A62F4A86344997515101A6B30969E297A869D PH4RM4C0G3N0M1C5
804,177,576 *5360C2D6FF6AC651765295E1561F894490BBE2EC PHIL.HAMILTON
804,177,577 *5368D8FAAF45012095DAF3544178165EA1DFF86C RAYMUNDOVEGA
804,177,578 *5366982655D03B518810458A394765C2F03A1B56 [email protected]
804,177,579 *5362951E90997B7A74A436D4C6E7852AF1604C4A POLITICOMOR4L
804,177,580 *5363598E28ADE7F07339F5BF0AC530AC38D263E7 REINE
804,177,581 *536F146E17BCFE8AE826BD551C26902BF2192BE1 P)~O SPLAT!
804,177,582 *536B52E4EC9B526BF676DB1447F96CA3C2D4CE95 SAMUAL.KOBYLARZ
804,177,583 *536DA8C4145C2386F25318D86BE8607003B18AD2 SANFORDRAELSON
804,177,584 *53614715E5306EA43BB4C211F1C04CC813F7B98B RANDAL.COLTON
804,177,585 *53650FCE0620E1D9FABBBC59814B7A2AE79CF03E RANDELLDERICKSON
804,177,586 *5369A1EFAAE83864A5C009B69628016024CF9353 RANDETSLOV
804,177,587 *53651158EE4250808E70F5097E00FC897873801E raymundohaxton
804,177,588 *5367F96FC6CBA2107AEE3BB0CCB66DC22C3F3F7A RAYSAGAR
804,177,589 *5365AA7F82AB19927AB16B58ED09658402C6285D REINE
804,177,590 *5366DC5DEF8FCB49CB37FA13A8CCFB8FF911490C REKONSULTATIONED
804,177,591 *536E5962CD747D54F2E7030993998673B5F3F0CC REMOVABLENESSN7
804,177,592 *5363091F2BDBCDFD41FF62D2CEF3323CB8057DAD RENATOJODOIN
804,177,593 *53681B1054EC536D2E1FA54362C59237B8C21E50 RENODODGE
804,177,594 *536A7CC6DAA739EDFA0A71CEFB3B36FF15BC3AFE REVENUE-FUNCTION
804,177,595 *5367369C4DF75705996B844FCD255DC8E38BCC40 SHADBALASUBRAMANI
804,177,596 *536284DE4A43FF6BFA67E83C13DBA11CA0D2B53E riaa
804,177,597 *53625A91915180F57947922556A5356D84AA8A64 [email protected]
804,177,598 *53601CC1F44B061744B9F13677D4DBB07C3BFE18 [email protected]
804,177,599 *536A76688BC14BC082972E8F3609E343BFA360A9 rollandbeshero
804,177,600 *536EF63F3A1C02959D4BB2DFE938ADE98451431D ROLLANDGIANNELLI
804,177,601 *536B0B2CCC484222BF910E6691D8638E535D0774 SJBSVQUGN0N
804,177,602 *536EC39754D072974F638610F1B9B4F918017C0E rosariotombs
804,177,603 *53635511D16D28F331C2C34042304821849DC285 SKRHATTENES6
804,177,604 *536E905B54F80A12850321CEB4449A52FD6441A5 RUE DE GAR
804,177,605 *53654BCB2E6FF7629F0916FEFA473A2EE4FA4CD6 SOL.GOULBOURNE
804,177,606 *536BE8BDE4D28D06C527E5AA5A6A2D101B97318F RUSSEL.GOODENOUGH
804,177,607 *536833B4EE8109AB70EE846D934509642E768AC4 RUSSELPATIK
804,177,608 *53647E0D13AC116CC9AB49C15362F90D8657C81B russree
804,177,609 *53600DFDD375313C9D5261572B8D96E09E21DAE5 RUSTY.LINDFORS
804,177,610 *536F552B2843348BC6A5BEB0F31C815B608E384C RUTULAS2
804,177,611 *536F3F073C420D45A92023FEB641FF412E39CF7C SOUCELLOIS
804,177,612 *5367344F7159F32775BD4F8CF0C674834068B4F6 [email protected]
804,177,613 *5369727EDE0E1DDC22A46F7F11112F64E871BE2A SOUTHWORTH4
804,177,614 *5369822DB1CD72E27C08680E435C710F2852D79A spaansepeper
804,177,615 *53687E4C758C73BC7F0FE10B5D171E92B350B398 [email protected]
804,177,616 *536D50B95AED0A1FC9C4095EF319ADA19DE8D45B SCOTTVIN01
804,177,617 *536DD6309112A8A3E3E51B5FC12425903C780E63 SDQ200
804,177,618 *536B81437A9EE8E75AA28F0E41D4FC37BFDD0165 sdrowssap-5-->dd<
804,177,619 *5361DB9159B4D9519887BEAF95836F628688222B shirleyzabek
804,177,620 *53657EE3F265E62511949135409D01D6FF2A8AB8 [email protected]
804,177,621 *5367DF743C16432E73F2BE3C8C4F399F4E65B52F TESTIMONYA4
804,177,622 *53652191354580FBC17D705DC96F38ED74791CAB thadlew
804,177,623 *536887EDF9785BDD4728DDD5D8B077CAD327E20B thanhdahlquist
804,177,624 *53649DCAE22CD91D51EFE840FF94CF015B3C8D61 THATDAY5
804,177,625 *5365E2109625222861DDA8D1AF44D9C875255E07 THEFINDMAG.COMTHEFINDMAG
804,177,626 *5363FFCB1CCBAE9BF172F48FB46DD9034A90D476 timmygeoffrey
804,177,627 *536CECA031E0E196EE3EEB00F6312A87E9BD6395 SNROBBUTSERP
804,177,628 *5368A09A33E67B5EEEF79E1F1AE1A41F7F115103 tjq
804,177,629 *536B649947F45F2AA5E58FF40478904E4EA7D599 TREKTOING
804,177,630 *536CC8F8163B2705091AD71DA79309060FD0F756 srxlfrys20
804,177,631 *53677527FB264481018AFAD1A824E4E8D6C70ECD TROY-LINTNER
804,177,632 *5366BCFC9D09EC1D39D53A2C3745CD8A73A31282 STANHEDLER
804,177,633 *5365357671004FA239C0FA8B1FD4567839DB18D6 TSCRIOUS123
804,177,634 *5364741D6A326731FF9A611B8F4AC8CBF36CFB89 steve44
804,177,635 *53676350D63077116C264A464D751E46347FA619 TVE|
804,177,636 *53688ED1789ACF9A8CD2FC6FF2C35C536EBF9F39 TYRONWADLEIGH
804,177,637 *536962BFE8A396A226AB3C1D180DBB632BA19CFA SUKSENPOHJA
804,177,638 *536FF02B144E4B9BC881774012CA1CF8DB75E496 UMGEKOMMENENBSWING
804,177,639 *536C63417E89B2A3275617DF52ACD2E191AFA94D [email protected]
804,177,640 *536DC123B064B0FAA68210980E11A6BF928AA930 swardy2
804,177,641 *5369FFDDAA1437999E925BC13AFCABCB5C86C761 VÄHÄTTELEVÄSTI
804,177,642 *5366AFE28F3226F54A2D4ED06DCBB95F665B6C46 VANDESTTENE1
804,177,643 *536611232251FB50669704EBE427A2C18546203A VANESSADIXON
804,177,644 *536830B113E94EA5E2B7F28EF5070070138F68F7 TAAMMAAT0
804,177,645 *5362785C871CA116DE5910466FC7628FECD0612A talk90154209113
804,177,646 *536627E88D1B534D42F2A48E4CB91E74FE6133E0 TALKANDFIG
804,177,647 *536E7C8C3B5A9EF3C067624C7412D94CF0CF5755 TALKBFAIR2MYCHURCH
804,177,648 *5365D04CFD6E9B3AF5F320022D921050EC7A3D0D VENN-DETA
804,177,649 *5367536151A136EFDEEC96CFF7D14729574ACE5B VERNCERULLO
804,177,650 *536F251916D5F4FCF2290AC6F4FAD9604AA4DD40 versicherungssummen
804,177,651 *53653283B87E647532E63829CAECBE203CC84DF8 taskworks
804,177,652 *536632B24C346B3D7141F780D2F659FD5C8B071B VINCENTHORNOFF
804,177,653 *5361A07495AAA46063F1780D7B7A9C69FBD29CA0 VIRGILIO.ABDI
804,177,654 *53698EB73EC17EC39D3D87FF740D5CBB802ECA27 tetrediw
804,177,655 *5361EFD6D455CA3EE389A4A63D659197CCA6E28A [email protected]
804,177,656 *5364D7F13C9978C41B6980D284BA780BA43C5017 WATANIANA
804,177,657 *53611CBAA7C170C7FAADCBBD430E299A51366B47 WEGRCKEND
804,177,658 *5366093B2F1CFF6FF65819422269316A653D7471 toddeller
804,177,659 *53698C07290084AD4A111D753FFD078000283908 Whatever.You.Want.(Todd.Terry.mix)
804,177,660 *536654A053B6E937862FEE8BFDB14792E3DB78F8 When-Debbie's-Back-From-Texas
804,177,661 *5362D9122196390E4EA02B4E635372AAA7D585B5 tonybobadilla
804,177,662 *536AA08D4B67C8E89AEF59ECC268810E7AC5CB40 WIKIPEDIA.67.84.253.
804,177,663 *536038C7A1C5D70C66BD2904B00458E985B95DE4 troymaclure
804,177,664 *5367D8A7D9F259BC9B6BD3AC138F0EE91A772C37 wwwhaiasnet
804,177,665 *5365F85BF59880E0010AC177A1293F525A03C281 tybrodine
804,177,666 *536A5D0A030CE55CA0369F2BF09E6CD57A43B44B TYRANNOSAURIDÉS
804,177,667 *53687B8A395BE1C95A1795CAC5C3A0D5982E2F02 TYREE.ZANG
804,177,668 *536562C9BA87EE58D96BF24C4C6FEEF89CDDCBB0 [email protected]
804,177,669 *536D391B309FEDA550DD18FF48FDC4AEEAA5B88C U]%_
804,177,670 *53617C79713F6AE8386E1D4649C3D28E88A2E224 ubaidullah-wicomb
804,177,671 *536685B22F435B5BDD09B2B6D4C5B597EDC0A918 UCJENJIVANJUED
804,177,672 *5369EF7C34FD0F6B14426B1377DE85E77914076C UMRECHNES
804,177,673 *5369AB274AD9D34EE1576A227997A201F5B30D33 under-steam-(b)
804,177,674 *536D8B6DE42A8F7EED81EEF48973E3A0BA769E17 UZRR
804,177,675 *536A907CAF687C06918A44AD7313E330928FBAB1 VANNHUSIEUQUAT
804,177,676 *536E436617838A4A6E871A9B50CFECC489BDB979 yop/
804,177,677 *536F02D044BB34A63149004FE3715B40BC391681 You.Can.Go.on.a.Date.(If.You.Wannu)
804,177,678 *5360A8BB56B511402E8F98A4451EABB039D6E9F6 YTILAROPMET1
804,177,679 *5368C4118EF32AEF69B358D3615CB3170A126592 VICKYLAURIED
804,177,680 *536FE4884E9324CB9664BBA060F9869C4375650B VICTOR.GRINDEL
804,177,681 *53674F84CB98D29A6FE52A7594FAC3D069CA66B1 [email protected]:dads
804,177,682 *5364087D235FCF2F16B966E7CC491CDD41A2C7D3 vincent.dee
804,177,683 *5368C9FFB116755F6D78CD73962194C4239D66FD [email protected]
804,177,684 *536A48EEB903D78ECCA48124B73FB66772CC3B2B vondrina-angel-wright
804,177,685 *5360EDD5D553E9E31C702B9E5AACE8980B065201 VONHAHNERT
804,177,686 *5363EBD162DDA46C27E17F5BBD1D9A8F5FEB094F [email protected]
804,177,687 *5368FBFB659252EBE2901BC2E7FD45D6703F08C8 VZ*Z
804,177,688 *53680633B85B44AECF7EB7C86126923C53ADC2A9 WASIELEUSKI
804,177,689 *536EF137F0FCCA9437A465AFE8794C51AEC1B383 We.achtervolgen.hem
804,177,690 *536630BADDDECE77036BA24791998E901512C223 ДЕКЕЛИЈУ
804,177,691 *5360A4B2ACEBEEC515A44FF41E701A800A86EFF1 [email protected]
804,177,692 *53639D7113E54F9F1E3D9346B675778051D1C113 [email protected]
804,177,693 *5360647DFC8BF262D186A7BA903E69612D38EBB6 [email protected]
804,177,694 *536E5718EF1E005A1949AD9DDB879B0171B71273 WE'RE OUTA HERE LIEUTENANT, GET
804,177,695 *53632AE3CFFEEEDFDECA7EA84724356144E90191 WESTONUNGAR
804,177,696 *536A01CED07F93FDAF1FC6B18BE50F3013BF9156 НИКОЛАЈЕВСКЕ
804,177,697 *536CBCE5FDE71B88E06B4AB4C77A424673731B3C whatcolor
804,177,698 *53632D32FC5CD444CA72C9ADEDBF1A3D34F8E3E4 WILL663