List database


# MySQL hash MySQL password
804,160,001 *536B0493857381A01B31EDC913FEF887B8AFA213 PRENKIN8
804,160,002 *5368BDC50DDEF465AA0A12F0F217BD7149D475C6 k0ai
804,160,003 *53635093A81443536B6DA651068E9BA0B1343396 pušta
804,160,004 *536E1B17F453C1E34AA3C0872FBB2D50446E5537 [email protected]
804,160,005 *536A64B546B29C0062D6536D93158BAF6D9A4718 q------P~0splat
804,160,006 *536BE54BBBF8192B4DE03E18525CD467992322CF KELLY STEARMAN
804,160,007 *5364B8D55B67ECC371354121CB5ABC49CA2C6103 QUIETLYMANIC
804,160,008 *5361A55752456800C6C472AACAAA4E0466B11382 r3fr4n9ibi1i7i3$
804,160,009 *53640F96939A4816FABB37E8693C62A15A05F116 KINDERGAR7EN5
804,160,010 *536497BB16F4A99A5D116447B252A7403F45EED8 RANDALLMOSTAFAVI
804,160,011 *5362719A976D547CC6820610E33672955FFCE290 kirbyanimashaun
804,160,012 *5363632EDB20AD6113B5745B4CFF54C271027992 KIRBY.WITTMEYER
804,160,013 *5363987C2F21FF153F66D069E1A063A7A6EA4D36 KIRK.CRISPO
804,160,014 *536316ECA69F859591FD63C6CE6497399C893474 randygreulich
804,160,015 *536A62D5A1CF21CB4A84011F771B1BF5B89DBF47 RANDYSCHONINGER
804,160,016 *5366D75B73DE32824D57323F2C14775A6CEE91FB ravnine3
804,160,017 *536E13E0C2BFF33733C310F8888533076DA69D24 [email protected]
804,160,018 *53660513BB4A2F4C5F6B34B27C72D29E00CB002B RDNAJNAP
804,160,019 *536A82A1B5AD4013A586733CC289363799DA575D KORALLENKOLONIEN
804,160,020 *536D3341ACCA724A647AA058300A9802904EC0BC REKURSUSCENTERENING
804,160,021 *536A291A7D2B2F37AAB8C44D3EF2FF31F98FC5D1 [email protected]
804,160,022 *53656B202F98200A6CF85E47B6EF4E3D30E46E80 remote.
804,160,023 *5364FAD2441BEF63F1493450D4CC351D3077DF04 RETURN-OF-A-NINJA-(FINAL-APPROACH)
804,160,024 *536DC94039D8D0C2A3F6DE08C2F5AB983A7BE5F2 KURT.SADEE
804,160,025 *5367D7FD3D81DC3DB6381D2E2E59AF38DEDAA30C kurttrombino
804,160,026 *5367489C3EDCEB21A7D24B31EA382D86B602D917 KZIGRINO
804,160,027 *5364B9A821DFD99CE331458149022CF66AF0EB3F LÁBIKRÁIT
804,160,028 *5361CDD15F68943D40AC030D561DA97B7EC43855 REYESFAMAGELTTO
804,160,029 *5361363074D216D6DAD4D90F108F52AA21B4D87E LADEVORRICHUNG
804,160,030 *536B47A6191B4B4446B74E7E3715D494020417A7 rickiefaulk
804,160,031 *536CDF157E0281BEDEA04EAD50EA1D43525F88DE ride of your life (extended)
804,160,032 *536E5069F64F2822B8F8C2E9DE94CB119917738D RIPPERDUDE7
804,160,033 *536F93CD43AE24D626EC48237B3C474B041F8270 rmula.renault.v
804,160,034 *5361D99E71FFCB2B26020F800AB35894A22C1735 ROBERT.SORIN
804,160,035 *5367AAF0B81C619B57580307947137977CD389BE roccorenigar
804,160,036 *53642CB3C7F5E37C69FE06704DB0506AECDDE552 LAXIFLOROUS1234
804,160,037 *5367AD74EB3B9340F6EED60F0A56015028DAD80E ROLFBOLDIZSAR
804,160,038 *5365CBDE2936F6A90BBC64EB796C14723BDE0C30 LAZARIN
804,160,039 *536763BF3AB896AC1215B987C717C645EC50E84F romanstillings
804,160,040 *5368EB7F2B0424E86777413D591E3848D67F08E6 RONWINGERT
804,160,041 *536E991089B00CABE7EDFEF70806724C171941C9 roodhuided
804,160,042 *5365466919F1DA9989AE038C25415A21172CA9C0 LENDELL7
804,160,043 *536452EA22373BB1C263C7EEB18394861072B657 leonardovanier
804,160,044 *536189AC7A65B221A467EAC85B262A6761193CE8 leonpense
804,160,045 *53647B047C5A1453839F3CC88D41510A92FBB7BF RUEBEN.BAXLEY
804,160,046 *53699A98FB4A9BE63E4275802A8B6C21DDA6EB77 RUSTYBULLDOGGING
804,160,047 *536DE68A7542A33CDF7CD5E3AE888EC70EDE1E62 LGOODLIFE
804,160,048 *53614C4C03FD76370BA52A37D8517195C5FBDC3A [email protected]
804,160,049 *5366C07A198B85642BD53B827B0E82DA8C251C07 S10U9HI3ST
804,160,050 *536C7473B05961D6CC7308CA7E4DA03E9BF04224 SAMADHI AOS
804,160,051 *536D9F1B5A52DA2086D6C8341476B058797C1823 SAN3CHAN
804,160,052 *536DEC9FF7FD4C387C5664D9C18AD02D1613363A SANDÁLIAS
804,160,053 *53620414A3FAE63DF7DD1A145C8E370EC64E789D SARDANAPALESCO0
804,160,054 *5361242538B4B6AB6C23A9CD047C95A19059261D sarengiol
804,160,055 *53640E04977FBEB237D81B08892A5952001A1A5C SCOTSMAN2008
804,160,056 *536C74A2F0361249AD9146EE571A339F1B2E6B18 LISABELLOTTI
804,160,057 *53643E37C911616BCB49525DC264E975C0C1CDEF SEMORBIF9
804,160,058 *5363287AA48638A9AA7414AAAC039081CBD72F89 LORENKOSEN
804,160,059 *53605BCE869A57BFD86FD7EC6AF9227AF67D199D sheltonbielawski
804,160,060 *536EA353402E00EE014868A505FEAF62B3F115EB SHE SHOWS A BODY RATHER THAN A LIFE,
804,160,061 *5368ADE453F0C5210B1DC7DF3C3DA9C0A4CA95F9 [email protected]
804,160,062 *53630152F669E54FA4EF261BE723C55B3A118755 lowlatin
804,160,063 *53669C58FCB363B0DC2B2E64FD0D0955F3F7E52C LROME
804,160,064 *5364135CFB1165E0CF2B62E555D221CAE90087D3 luigigliues
804,160,065 *53605A25B9C837D15C5E1B1C8B741CBA4A4241F4 sidspevak
804,160,066 *536523E59E2F4D587828CEC20092679FF8138748 «SIGRUN
804,160,067 *536D83847C281F80D3418FF391A52456BA61288F SILASHOFSTRA
804,160,068 *5366DDE6ED7C94A973F64CD263592F34AABFBAF0 lustres
804,160,069 *536A855E9B695755F0D5EC2D9FB485F146E5799F SLOW-SPEAKING SL/OU/_'SP/I/K/I//N/
804,160,070 *536266E5B06F6B31B0E0C09A8C823A173897743D macfusty
804,160,071 *536058A71F4B0AB214C162B8C446BC24ABD6DC46 MAGOHOLY
804,160,072 *53699F14347D6DE05491960A5BBB3306C3F6AEF9 [email protected]
804,160,073 *536B225CC87BD50B55EEA04E932C5D243DE2FBEF SODDIERS3
804,160,074 *536C7A705C1AB6FF98AF7B8FD8D7B588F5C3322A southernhousinggroupcoukwww
804,160,075 *53635C7E28A1C450A3D39F1096E51AC1F0CE53D7 Marches/caressonsLaBouteille
804,160,076 *536B94DC49A33707FBF6068C579148A6B48055D8 [email protected]
804,160,077 *5361D74732E001CD65CE258820540B621B487B3A SPIRITS.OF.NATURE.4
804,160,078 *536FDD3DA096E0727D21DCAB089F267A0A0E936B marianonitti
804,160,079 *536B6B1F65B53F69DBF7CAEFB87681E2D1E59EDA MARIKINIE
804,160,080 *5369FCE14AC8253C730D8729B3DFBC529C0D86CB SPLAT*Q====8
804,160,081 *53678CAE895EAEBEAB2A425E6F58C3C1A65A08C8 SREKIPS4
804,160,082 *536EBA0427940491CD7B049EA5066A2D1E68C12B matrix112
804,160,083 *536EEEEC08A8EC972F48A41445D2ECCE68618976 STACYGANTT
804,160,084 *536C94F0B31E1AB6A18A009033BFBD2560DC3819 „STARENNEST“
804,160,085 *536B12CBA0707310A809BAF2ED5B5EDFA7D572A6 STEERING KNUC
804,160,086 *53690E8D213CC65D3B86A956C622F51E2413E84F MCKINLEY.HUFFSTICKLER
804,160,087 *5366DB7376830602A24CBAA144887D95A006147E meevie
804,160,088 *5367A251060CC20B6BF6CD73D5A1D2EA726A7370 menofanto
804,160,089 *53647E08C365F6E64BBFCCE3A4AF142C87D9CAE8 MICAH.PAUKER
804,160,090 *5364B41D46443DDBA59F6F88FD598B8DCA2F72C7 MICHEL.DELACUESTA
804,160,091 *536567CEFD5E64AFC297C4C1F042320E7F5D3B4E [email protected]
804,160,092 *53634E85E57ED10C52539457E1EE9ED3E2626007 SUPERACOUSTIQUE
804,160,093 *536C3B0EA8FA5AE7F467D8772B311AD26D1D9C32 MIQUEL.MORADEL
804,160,094 *53675140BDE0E89767864454938FCF702B3647D6 MISSCAK
804,160,095 *536B0BF1C6C172DF8F6C58A44A4F7754672F0325 MITCHELL.JANECKA
804,160,096 *53620E3464825730FB97E69434B84D428A83BD29 MIUGLEB0
804,160,097 *5369981A30CD334F1649B707997075C668CCDE7E SYVTALLATVYS9
804,160,098 *53688694A4BAFAB4DC27CF9C8F5EB5319A0F0B9D mohammadmailloux
804,160,099 *536290932DB6C94195D9CFA5AB6ECF309AEA8191 MOH.GAYE
804,160,100 *536F459670AE452C34D6100B934C69D93C76E94A MOISESATCHINSON
804,160,101 *536B1FB299E7028624AFD15BDB9E312E32ADA631 MOISES.SHOMAN
804,160,102 *536B964C7455EB23EEDC84DC362C184F7B64A2CF MOLLYJ.
804,160,103 *5364BEE164EFAC59E88524574C3AA976AC08186D MOSBYADIE
804,160,104 *536AB71BC32E5EB6E22B2E710673020CF3E58DFD [email protected]
804,160,105 *53679D90187446E96789D16EBDFB89800191430D [email protected]
804,160,106 *536FC3E1C9CA485319D5B160B7814C895C30C0AC [email protected]
804,160,107 *536661148EDF62A2056F4A49911148AD06A093BC TANNER.COOEY
804,160,108 *5366CC1F25B4F2E75C67C26DE69805F7FA76ED03 MP4W
804,160,109 *536E95BD497B85D1E8792CED674425BF887301D8 tavar-warren
804,160,110 *536A8C8DC82AA637BE8DD38B1F5BD085D05BC79E mufa's
804,160,111 *536EFC7DE56896B5D576D4FE442E8D33F883B60A teatromuseodali
804,160,112 *53605C741920005861927080D35FD64A30BF53FC [email protected]
804,160,113 *53601C0A39D8232E6D61E6CC136383DB7536CEBE myrontesh
804,160,114 *536A6CB707205E1314CFF897471202552F9EF249 TERRANCESTRAWS
804,160,115 *5367F352B587EFF086A34EC98DA6178CC21BDD99 M[Z>
804,160,116 *5369E25D3994E0701B523392DCE111150CD8A124 TESIAMO2
804,160,117 *5365BCB14C23D36AAF01EF4D4DABD30D30D165D4 thailand—27
804,160,118 *536A350D523B7A903C4EB36B32748DB81AE11FD6 thevessel
804,160,119 *536B447D2DF93F15C47B5233833E8831281B2356 NEWS1OT0PART20
804,160,120 *5360B08CDF5F133F0BCE835FACD370FE59A21B5D NGIZMAWA
804,160,121 *5365F7E03C1470DB8196210AEBB076D5CA42F95E tjub
804,160,122 *5364C668213F90541C87032FE269758529C7D339 NIEMENDAL
804,160,123 *536C77B0C305EAF60F2E9AD4B17FC2CADF40F3B0 tommie-gaston
804,160,124 *536C60B5AA26824DA66C9C742E152B099D3AC715 tomrai
804,160,125 *53630054C229FE07D20E71D8AC1EEA6FC18A1F0C trasentine's
804,160,126 *5360E561070753BDD98E12A779B809BFB8DFC858 TRESIBOLDEN
804,160,127 *536EF1682BFFC9ACD90A9B58CA1D9E8F054FA693 TREYWIEGMANN
804,160,128 *536A17BD990BFBCE9DC61E10B4DED39285463AED TRUDI VOSS
804,160,129 *53610AA9EB06DFF0EAAC4FA281BE1565588DA7E1 NO.1GFL
804,160,130 *53676607CC0DAF60B4A7BB19B62A133D4600DE62 noaharlinghaus
804,160,131 *536F3345557F6AEEA97160AB82E3183D84EB3A10 tsigolodicec
804,160,132 *5366B452210A7B968D6F15F253D7A20C0775FAB9 [email protected]
804,160,133 *53611D3B313E28765D886ED47019B8A2228EAED2 TULITOKA8
804,160,134 *53612B879ABF08DBC75447A2602226DD3B086630 TURRNEDD6
804,160,135 *53665092F6F8B75DC34A64FD65EDE98DA8025939 normandklitzner
804,160,136 *53679E1BA7BC45FD9B82D8598D6B15681C5E63D6 [email protected]
804,160,137 *53651BCA170764838063FE3FEE525B95FDD81A1C nova-/-wall
804,160,138 *5367FB002EEDD8A84463E94F4F7CFA3213134286 TZWVSCFT
804,160,139 *536CE28D2AAD1A7E95D82FB55D7CF0C24E899AD8 }O{ 0~(8
804,160,140 *536AC76A9B35BE56D40305034EB5B27E2BD4D9CC UGROUNDFASHIONFEST
804,160,141 *536E7E1C7B0CC94B62E4F870470075A75AC6A2D6 odvra
804,160,142 *536B2DFBC4DC3EF26C42F4C1CD0D16654578EDAF OLEELLISIMPANA
804,160,143 *5362B507FCEF37EF9357CF10D8379A800C4F8D44 olfa.foufa
804,160,144 *536FC9C777267B7AC228F4AC26A789B089D45772 [email protected]
804,160,145 *536CBC27BF15D2EAD22B4F14F430CA69047CDB1E UNPUHUA2
804,160,146 *536B5B43528FDC5A4EE9DE598CB8B4E5F7590BDA onlankacomwww
804,160,147 *536EE534BC2E279641862E49B9A9B6FBB432B207 ONPERDPLEIND'MONDE(FEAT.NIGUETTE&NARKOI)
804,160,148 *5362BFCB43618725E86CC048C7C6644958B82DCF }O{[email protected]
804,160,149 *5367C8523A6C403C8F8DC849E4248A3CC380F2AF USHONDAM
804,160,150 *5365A999D53EA871D4B133EA0FA90B310DC7DE47 OPENINGSZET?
804,160,151 *53693B1C4F6E66974444CEB06123CD6B811FE149 [email protected]
804,160,152 *536849A834A8A98D500192168683DE87BF83F502 OSCARTEWES
804,160,153 *53627BFB6D51A250A18642264ED6B04638CF566F OTANOTSES
804,160,154 *5365805F4C1EA651DB86701D994DAE9EACAE9EE6 OTIS.LAFERNEY
804,160,155 *536D8BFF00C1FF8AF9091E06A466AE4B52669EC3 OTTO.TONCHE
804,160,156 *5363422B7E1F0EBF2CFC1AAA514AD96A532D7FF2 vanessa.mosley.greenlee
804,160,157 *536539D93B804421BB62120DD44E8B9F2CEED817 [email protected]
804,160,158 *5363A6973682F938EFF8A7429B6A91C539F2CDB8 OUTWETBACKWITHDRAWAL
804,160,159 *536D397C579A5931E3127122765CF8574D01E785 [email protected]
804,160,160 *536DE01A819A099A033BE77B37C1B4ACF4DFB09C owen-galea
804,160,161 *53646D5A4D7DB163EA31532FD96D1E7EFD2B23F7 VDAHILAN
804,160,162 *5360EF7E2E61B67DB77C0BB765E38B8E8D3AF7F3 VEERIESES5
804,160,163 *536935CDE469970248630513534C5415AD5617E3 P######)~0~OSPLAT!!
804,160,164 *536A047F3A8E28A8E456BB745985CCBFDBF27FB6 PAC0RR0
804,160,165 *5363F7DE91DB745602E3ED3C3BD48B82ED6BA17A pagherei8
804,160,166 *5361753F7B338FB052207B808893DA78B63A339F VICTORIA.MARIO
804,160,167 *536CF18FCA35C723F06BF3C3C86D831B4AF6961D VIHINEN7
804,160,168 *536FFD10F31E43E8E21A42CAAA3CE7B9C6FC8AA1 vincemcalary
804,160,169 *536D0A66B8203E4D51E7AFA60ACDE256097F8B2B vincentchatters
804,160,170 *5362DF9EC141448EDB8F66E36D7D23384C8E1CD5 VINOD.MADAAN
804,160,171 *53643FC605D8B2D83E5E11E956896D144E163CF9 parkeredey
804,160,172 *5366F5739DA0F5AF656957C79F98C27757050192 VISAYNTHIKEBINSOORIYAN
804,160,173 *536A8C74BB3A3B7CAB87A157B7E47AB58027003A VITO.HAAPALA
804,160,174 *536D0540635EED13ED888A399C1B17FE2C17ED4D VOLLEYNUMBER1
804,160,175 *5368E1A458A413197291906D7B03D1D9514CAF3B :P~`.~`.D---3
804,160,176 *536746014FF6DB17CCC9B96ABDF56D24E2EF3053 PDBC.RES.INWWW
804,160,177 *5365648BDA88D9EFB8991070249419F16CCDAAED V{RT
804,160,178 *536AA4B9A801D2E7FB0E0556F75A64394D806336 PENGNIUZONG
804,160,179 *5369D555912B99DB869DAA9A22CE49520F708AA2 PERJALANANMU
804,160,180 *536BEDCAECA456B187C8DA44FF09521C7A75BE34 W160630160
804,160,181 *53610501D458AAC2C918F287E2B4F58985D7A40E WAHRHEITSBEWEISEN7
804,160,182 *5366EFCC4FE9C5D74FE911CA60BE8CC40DFB707A PHILIP LALOR
804,160,183 *536F97CE139CBB0AD871DF97F8AFE22E4ACFA375 WALKERSECURITY1
804,160,184 *536E11888AC80EE458FFD1F9C8102E0B0385F33D PHPADMSTEAUA
804,160,185 *536032B008808721C3F2A47C0D48C30043D5E252 PIECES.FOR.PIANO.13,.BASED.ON.THE.THEMES.OF.YELLOW.UMBRELLA
804,160,186 *536D7D136A43C69D96FB01F7CEBD5D247FA81131 pierrefaver
804,160,187 *5360E0F16A4FF6C6D6ACC85953F77D49E8BFEBEB WATERET4
804,160,188 *5368AC8B97E4D14E42B2D8EB4B7B8419B1E04090 PKREISHMAN
804,160,189 *536E6AC54A56639CF3A71FF14CED9CB689ABB782 PLAGITOIS
804,160,190 *536EF53B72C9A4A58967E1A2A4E270A85962E2A5 plassedal
804,160,191 *53661BADEE00A0D10337A032562BCABEF789CDFC P)~O><
804,160,192 *5364309CA15FA3AFAE34D58E3EB1B631D5052D84 pokerishness
804,160,193 *536FBEE6DF6F4CB8FEDBBC1ACE8AFC79D9912E63 [email protected]
804,160,194 *536003444DB6AA36867FF8B78304C349B41C795A [email protected]
804,160,195 *536A265E25D14D18B505FADF34D8AA4E47DD313A P#####)~O-~osplat!!
804,160,196 *536553C4771B0207A81C69A1177AB7CA6231EC81 WERNERVIZENA
804,160,197 *536A33D686F6079B9D70EE8279F53A3C0AA8F39B POSSIEDED
804,160,198 *5362C04C22578C3DC2BC4C4491EE654B1DB264EB WIE-BEN-IK-ZONDER-JOU
804,160,199 *536C70F44476E35EF0D4DD20A4635447FB4A6BBD wilbertpearle
804,160,200 *536EDC3595EE0DC9FEBDBFC4418DAC51FC91525C WILLYEM2
804,160,201 *536E960C4DFCF2803A79FB2D3CA3CD1264B95D3B purity&thepeach
804,160,202 *536079F5557E89870D0D10E41F2CE9353D724737 purpletower
804,160,203 *536B181BD79A57D0EEDFABBAF01A100DD9C91F7F WON'TSTANDBEHINDTHELINE
804,160,204 *5364F5753846369B537F6A7930FEF4EB1761483D wqhufm
804,160,205 *536D9FF508E2DC9E52B8EAF60B29C809EAE891D4 WWWLANDEDCOM
804,160,206 *536C6676141A1C27F9FD026342077B82A3A8F557 WWWNOTFORTHEFAINT-HEARTEDCOUK
804,160,207 *5367AB6FBF2C4C9360CBD5A171E368649F306D94 WWWSECKINGAYRIMENKULCOM
804,160,208 *5360BEB2ACEF8AB6D07084BC22A0E57F76A07CD5 WWWSTUDENTBEANSCOM
804,160,209 *5362B5A0B8E4384B67F7AA0A114E654E29030671 WYZWIJ
804,160,210 *5368AC3784A2BD6C85B3F45F596091309058DA26 xdsaujxc7
804,160,211 *5367ADF800B07296571B901C0342A61F78CC58D0 q####P~0-splat!!
804,160,212 *536B8E1ABDA6F9AC8DC3535AEBAA9BF0EC663A83 Q====P~~)X(
804,160,213 *536C9735CF4914360EB570D291A8991B9CDDC8B2 [email protected]
804,160,214 *53651C482341705CA585E104FF699B684820AF91 [email protected]
804,160,215 *536F16388637A136999E3068269138909F2141BB xinguensis
804,160,216 *536AD68EDF83E244EEF15F22BFDFCE19C3B1D8D2 X}OL
804,160,217 *536DF5FA65FA4BD36B67E421DAF3C1CA2EB9D3D4 RADIOMODERATORS
804,160,218 *5365C6BC3142CE04E524B6380A700B36BB063D05 YDALEIDAS
804,160,219 *53651875597375688DF83498C7F7405435725E31 YDCKPL
804,160,220 *5368406F647330E4A05BF7D2C972C24FB4E62D65 YIANNISTSOGAS
804,160,221 *5362B1C686F760E01D53B4C5F3594E3BCB9091CB [email protected]
804,160,222 *5360F18140280E14A1198F95D04CD185491AC47E [email protected]
804,160,223 *5366DF563FA79130E5E1595AB0DB438FB32C21E9 :yka、
804,160,224 *5361AACDCB696C42E70AE14134D7008B8B8CAA29 YNOALLED
804,160,225 *536ED7757B038996910B7AE97F058E733E512398 YORK-AL
804,160,226 *5361C4578E8653D427711C4DB7C0B63F10465CB5 RAZINUMNI
804,160,227 *5366A6966A2E366DE4D2D4B525192751AAA7EB78 YUNWENSU
804,160,228 *53635F7E12B8B628EA48032251665279D4762165 REALIGNMENT
804,160,229 *5368AB054F7F7EA8C7A707A68BD80C5BAF12A401 Z050905
804,160,230 *53652FFCAD2904316D8B1491E527E3043C0C5006 zackarybartha
804,160,231 *5365F0DB04B4E45BAB90B01C0C6997ACBA7216DC ZACKEXCALA
804,160,232 *536823A97B696517135285660AAED90717FA7B3E ZANONJEANLOUIS
804,160,233 *536B41F46B082A5268179007174D6FE53D9A73F5 zd2a
804,160,234 *53651401EBDFD2E6A7291720E52644CD24C13458 REGELRELEVANZ
804,160,235 *53622A00C3B4CB80D882AA8CE432560F79CD348F REICHSKONSERVATOR
804,160,236 *53670D39A68B16B597264075E09FB54307EAE931 RENE.MCKEEGAN
804,160,237 *536BE451FC1F38B955064EB0EDAA60D7A88902A4 [email protected]
804,160,238 *5361D12B3358F3E0F0ABF1F73CD742FC2BF8F488 [email protected]
804,160,239 *5361A643CCD2C656E6963F6A0B26E919339E76FA REYNALDO.SCHRODT
804,160,240 *5366CB1FE6F6F5702144EEB70C3FB415B4D1A34D RHAGONYCHA TBLLISIANA
804,160,241 *536CBA424F3AE7F08238FDEC0890A5F388DB8727 RHETTGRUNWALD
804,160,242 *536DFC4404FA0D6F79A0B881426E32301843C3E5 rickeymizer
804,160,243 *5361D05088DE7391928E32AAD581C79575EEE1AB ZYSBERG9
804,160,244 *5366997484FC797378751105494284564736A3EF ROCCOMAYBIN
804,160,245 *536EED78C71DBD080882DE8A166049E88F6F16E5 RODKEETON
804,160,246 *536C343F67119B481DA1F4ABA930DF3735919632 rodneymccubbin
804,160,247 *536EAEBEE6ADC6B4D5040929C0B82CB33E43A1EC ВИДЕОКОСМОС
804,160,248 *536CBDA4B76EF2AE4DF1E266EEDDD2040565A441 RONNIEHIGHFIELD
804,160,249 *53692081A676A0027B1C1533667C992084771992 rorke’a
804,160,250 *5367954494EC40E608F8C924FF3CF72B32B81A13 rosa-saad
804,160,251 *536EF5B51ED393AB3CE0A882F892F9D66C892E1D ROSCOEMANZ
804,160,252 *5361F06CD7480FC964B0B74D8F5F7273C8E2A346 royungaro
804,160,253 *53662529DDC7136A8ADCC91D7EED7B5FA0E131F6 RPRSNTTNLSTN
804,160,254 *536A28DE1081676DBC11A646477F4A7BED307146 RUDOLPHURQUIZA
804,160,255 *5369B02092F32AFC377CA63AD3B1EB2345BF4ABB ЗНИМКУ
804,160,256 *536DA45212464CFC6D317AFF32BDB0C9E0802328 кадију
804,160,257 *536A4E78548F7DE2E0AD3C11B7A75A1862F360D2 ЛУКЬЯНЕНКО64
804,160,258 *5363D2B2DDEECAE2278A7EB769A4ECA0647FEF03 НАВАРРСКИМ»
804,160,259 *536F9710F367975300060E4C8ABBA18AF81C194E ОЛЬГІНА
804,160,260 *53665F481D784B125E7D7832C0C459E25805D45C САДРЖАВАЛИ
804,160,261 *53627D29FD9FBF0B1AF498D927A594D5BF41DE8A s7ru77ers
804,160,262 *536A6727BDC59B1798F0A21C0379F88F12D405B6 ТЕДАЛУРІ
804,160,263 *536DDDC1DBF86CFE1E347A7417E984D533E6632E «ТОНГ
804,160,264 *5366907C81A9BEB472B90BD97EE8FB48E3A10FD4 ФАЙЕТВИЛ
804,160,265 *536E92FD46ED7317A3A08800404309C561C1BB46 SASHA.SLOAN
804,160,266 *536D2AC1A18EBD19DED60B21531BADBA91326363 SBACHEMHED
804,160,267 *536959105E81277FEB09E750C2C8C935B9954475 SBRGURKIWS
804,160,268 *536851041664DF2FC9BC9ACC226B52AE7FAB9F74 s.cy
804,160,269 *536865660DF60A9EBCFBE2EB36ED2BAC10BE361A SEDLETSPOROOV
804,160,270 *53686CB194B48BD10E01B0887000B62A711E7C7D SENETETI8
804,160,271 *5362D9C318668553E3EBCB7A9608975B5A428E5E sengep14d
804,160,272 *53611E9E6EF36C7F5B9940E9B91CC2B07B7E482C Severed-Heads
804,160,273 *536C9A3BD54828FE44841BB97FC2ACCC994F4C25 SEZIMOVÝM
804,160,274 *53678C3B380D96A75A473DD4A807DB3601C1EA05 SHAYNELEWELLEN
804,160,275 *536BB0AA37747CCB49D79854073B3A0613E4C32D SHOUDLSHOULD8
804,160,276 *536F6D53D2F504EEAD5FF1BF3709C85F436F8CD9 ŠIBAZAKI
804,160,277 *536CAE955ED0603E2B6B301CAAB3F68CD1870DA8 [SINGING]'.BUT.SHE.WILL.BE.MINE,.OR,.SHE...WILL...BURN!...
804,160,278 *536937062885FE1B3E89536C049DB81BCBACF985 sishuku9
804,160,279 *5361DD75CE5C401E5F8B23DAF9D6AE1224B331E2 [email protected]
804,160,280 *536E3410CA647514CF803D099FD475F0500700A8 slopingness
804,160,281 *536C5A273350DD0FF74AC4B957BF9383455C2CBC SMILESBOOTSIES
804,160,282 *536C1587C81DD029BF7B68A3007D750EC4366E1F SMMPS
804,160,283 *53642BC572A74CFCD3A3DA93F571BF60F2305692 SONATE.NO..10.GDUR,.OP..96:.I..ALLEGRO.MODERATO
804,160,284 *536005B072BD574C6E02248AFBE8997351E4B4B0 SOUMIL SHETH
804,160,285 *5362824F7791D4DDADDF3074C79C7925E1794406 spaindawn
804,160,286 *536273E2C3A2AFF3D174A3241BB5DEB411BDC4FD SPH4ERIST
804,160,287 *536E96AD7BFA0A7F2FB14A1D43775FD39EE9655B SPILIOPOYLOY
804,160,288 *5367B9F0653326954999C99080CF3761BF908239 splat!~`.~`d----8
804,160,289 *536E1AA97574E2D9BAB636AD8E714D22134C445E STAEMT
804,160,290 *5365EFC73D458074C9BC6E5C6FB208A3A60515B5 )0(`Q======P
804,160,291 *53603194571FCEBECABAD4EB55812A60BF934757 stefanandreola
804,160,292 *5360FF437DA0093A2DB3775B73A49A42A16410D3 stephen-pounder
804,160,293 *536C26486C2AE4D6F03339457F3FC5B46F6A9378 stephenvanlaningham
804,160,294 *53678EA5B920ABAE4B3B51D9710EFD9D6F96CCF5 11191728
804,160,295 *536FC7A6047E135933D232FB5829F1C0EC25DF6B STEVENZMOLEK
804,160,296 *53612FD471183F9BD320CD08B2DD737D336991BE 12ELBOW
804,160,297 *536C7E23AAD0BE5FF43863781F36CF4CACAA53BF 1348519 NIMMT.DER.SENAT.DIE.BEZIRKE.NOCH.ERNST.?
804,160,298 *53648B29B98DD1705A607F40683D6EC7554AB52B 14-08
804,160,299 *536A0B05961999F5B6107289B40004FA557BA0E4 [email protected]
804,160,300 *5362D4695D1AB20C06B73353985B0B654D0CEDFD 15fazlasIdIr
804,160,301 *5364D3FC514F0DD575E61846DD51D4B16A0A5E70 SUBINTERVL7
804,160,302 *5361D7974E045B58023CA6EE3D71D30D47F4F1DD 1738593 KASVUHORMONIN TUOTTO LIS
804,160,303 *5364AE6A5E202061A94151FD57AFD5C15D6EC198 176513 NYKYISEN
804,160,304 *53684E8CE36F67E9B3C0B4205F6C19DDD9063C2C 1823877 kilpailukomiteatoteaakilpailujenjohdontoimineens
804,160,305 *5364F5C2E7739E9CEBE177EF96D929793C196D23 1861csa
804,160,306 *536FA7821E91B9E1ECFCD0FCCAD141E37A289B9D 1-automaattivarastoihin
804,160,307 *5367E98D430E046DFDFD85E102F1B02F539A7C0B 1.bayern-konter
804,160,308 *536AD260EFB483CC36EA081CC923DEC9DD031028 [email protected]
804,160,309 *53677BE6AF2C721B4011D180EB9220CC9E992D24 1-daal-to
804,160,310 *536B8EE75C8B7650E2BBC7FC55E99C40E5BC2EEE 1dishatlar
804,160,311 *536481FBB3A12EA0F729F1BD6AB0A53BF56F202F 1 DOPPELWETTKAEMPFE
804,160,312 *536BC95D0283D844274981FC9B05F1CEF0684F6F 1-dust-storm
804,160,313 *5364D95F399233B3A46E172B6E1B83CA58B3BCA2 1GETAETIG
804,160,314 *536D879727D3212BB35B1D50FC1E210E3320991F 1.HILDATOERTCHEN
804,160,315 *5367C28D6DF8D46149522AEB27D896DB3D231364 1HYUNDAIJOINT
804,160,316 *5361C0AA9D9ACEC894B4879C3218E4118A09B8FF takahiku0
804,160,317 *536512D1B002CF8FCE710C577DFD0C74DB99A744 1.leistenbruches
804,160,318 *536C2C9CBF5BB2375C89AFFCACEFEB0150161DE2 1 LIBERAL-DEMOKRATISCHEM
804,160,319 *53650181FDFA428732F34712C388153D2D11EAEC TAMARAUNDEAD
804,160,320 *536C48261244778A37D200B6B7AB8B4C613A5A5C tannerhomme
804,160,321 *5361934C6CEE85C5CEC947A8469810889DA10664 Tearcompelling
804,160,322 *536BBB7A4C7E5968C611845A1C8562482B22D956 teRap
804,160,323 *53680BB35D297F0AC96AA3521826AF3C8433933F 1 NNES
804,160,324 *5361F35A0084FD4F7402376BBDACC47F84C95690 1.PERUNARUTTOON
804,160,325 *5366081924E8464C5C79048EB422764DB013D787 1PLAYERSSCHUETZLINGE
804,160,326 *5368D9B6A38131565D31C085F429D1AF59B17C6D TH4N4TOSE
804,160,327 *5362977DC6B7CCDF3B3F86FCD65330135ADF4A0C 1 PYRKIMYST
804,160,328 *53643557032DF985A1334631988CB55FAF99DC07 THAT NIGGA AIN'T SHIT!
804,160,329 *53678FB6F804D4AC5E166391AE46B9F95BEE59AC 1SUOGYZID
804,160,330 *5369DA3A05389501C87BA15EA51E460885DE42A4 thediaryofhoracewimp
804,160,331 *536463630EDD6EB61131F42C3320AFA2BC44F413 THEJORGE1234
804,160,332 *5365EA05A7A0DFED0C210DCDE851ABD6318ED6FF [email protected]
804,160,333 *536D3C318D5E6BD159F24954B91C4935B93CE02C 1 VERBUNDTAUGLICHE
804,160,334 *536C6BCA0254500DF6226F357F9F5BB00976416A THE UNLIKELY LAD
804,160,335 *536BE10077D50E641BC3E1B07E841F61776307BE 2012806 vanhainkoti-tarjoaa-lis
804,160,336 *536941991E4B57C6EC463E755B5FDC86C88EF60E thomaslapeyrouse
804,160,337 *5365D0D8977A0F20EB09D7CB180DC2ACC4BF7468 t'hp
804,160,338 *536DFFCBB1BD2A3EDF3B58E307B41BC684047AA3 [email protected]
804,160,339 *5367D26B0B4BC7800AD9F0F6F4DA8C4ED3CF7C2C 2481036 EI SIN
804,160,340 *536DC3556E1858F9F652AF0B5A123EA688181B5C 2486239 schmunzeln.ueber.seine.eros-bilder.ist.aber.erlaubt..
804,160,341 *5360155ADBD6F5E2E79BB50FA63EC05C80522EAF TIMBERLAND BOOTS
804,160,342 *5363039B11E61252694BC647E5F6FABFF701DD0C <title>VendorGuidetoTrustedProductEvaluations</title>
804,160,343 *536BDDAA983177748721EA926DEE302B77BF0F5D TLEILAX7
804,160,344 *536342F89C551F31834D3A0088581070AF054A40 TNOREIALED
804,160,345 *536F781EC296A4BE1CD11CA63EAC6E22F864CE0F TOEVETHEART
804,160,346 *536083D864C9BEADED4512397FBABC94B606F8EF 292QUENTIN
804,160,347 *53652B8A7E565C5C2EABD5BE9CE0D5B94A96A654 295E
804,160,348 *536BE56D1941D5B66660E008137581F2F8116E83 TOMAS GARCIA DE ZUNIGA
804,160,349 *5368CFABA8648174D4B47804B19236C5C502A6C1 2ALIETAT
804,160,350 *5365C6F2042BACF145A920AF33E1D6A688CB76A5 2cinayetini
804,160,351 *536DA3F958868E71703D68E4147C14C1485F2E4B 2-geigende
804,160,352 *5369C127CD56B28A7A47CD009BA118C069B483CD 2MYMORECATS8
804,160,353 *536386A787D49FA22FB350A17ED8F3D05E3AF18F 2OVERFATIGUING
804,160,354 *5366085A3795969C10FFF41508B7720DDFB8B732 2-petz
804,160,355 *53657CD0105772708565F0CBD23971A8D9059A09 31-01-1407
804,160,356 *536AB4A70423B678759E33673D31D0307BE57615 35ODIN
804,160,357 *53692180D056E4CB40545F63B516A452348572B8 TOTALDISPLAYED
804,160,358 *5363960C4770D6DBEE60A877B8D885655A15689C tr49es
804,160,359 *536469872FDC30926E93E32DF2F6640E7D77C432 3.OFFCUTTER
804,160,360 *5364E00644A475CC873D08AF358CC8683537CE60 3-PELASTUSPALVELUSTA
804,160,361 *53618F13D54625732FB78852D6A650227DD0EBD3 3ROUZA
804,160,362 *5362FA10A78A8DBC55247C4BBB9D4CD7FA89B1D2 3tutkalIn
804,160,363 *536F87DDC46D7D9F37DC3EE89DE524F5EF0BED3A 3unsquare
804,160,364 *536080CE1B699C1150E6603FE44D91EADAA1B10D trishaneeleyjackson
804,160,365 *536A3DF9ABB9D66520FCCD9D43C9670A0EC41841 4MYVICTOR15
804,160,366 *5361246100CF91376532A0265B9A0AFD4796843A TROY.TRUFIN
804,160,367 *536106024C1C20A9B3CEB82B0C73C19F116C5067 TRUESTDAMNEDNET
804,160,368 *5362D393679A829F4EDBD893AC9BB5E7CAC8ED1A tseladaed
804,160,369 *536AFD28B297F3AF68130016815A173011BABB27 TSRUWTUL7
804,160,370 *5368ED1A51C9D49F919A1DA25337FF607EA3DF07 4TAPOTERIONS
804,160,371 *53608BE7A802C632AC68FA878324B712C00C948E TTNNEJP
804,160,372 *536719D1F55867D47B2EC2603B4CEB817F767222 4thejared8
804,160,373 *536471C33B4D9C0B47B284BC6CFA5D397B94E570 4YLGNIDDUHT
804,160,374 *5364EFC985285A2DAF3A8235C9996C10D6D73210 TURKIS3N
804,160,375 *536F1D554FC9AB23A51C0D3DF92C460613EF0CAA 51.CIkarIlmasIna
804,160,376 *53626332F4B59FD46FE295B54B19E9CA405018E1 552584 ismail tanyaldirik ekgm 155 .
804,160,377 *536889BF6F741027ECA68F0FC51ABE196AF92168 TYCANTELLA
804,160,378 *5367FACE9E2589B726AFD9D51820E2EF58BF417A TYERTY
804,160,379 *536925D301E9F90F1873A44A76D848853A523A99 TYLER-DIRTE
804,160,380 *536C5871F93111394C6FEE1058230FC9CB4394ED tylersavagelifebond
804,160,381 *53607EBCDBE949C9C51B09BF49AA759B4B8B1B84 TYLER-WUNSCH
804,160,382 *53621423D13B6C1AFFFCEFC0EFC8CF1F0DA16A52 tyreecornelio
804,160,383 *53602EEC509E4878615ADC582DF3B433CB0BB72E TYRELL.BARCIK
804,160,384 *53663117F51138DB4F62F29F7041F63571A84D1F 5FIRSTOLIVIA
804,160,385 *536249533A8D88F3030262A32D5434E3BF9DDB84 U`0T
804,160,386 *536AA72C7977C7F4CED6BC93520B6FF2C9099891 5GUIMBARDA
804,160,387 *5365BA8FFE5BC4A0271D4980DF8B497959F6552A $UB$+AN+1A11ZE
804,160,388 *5364AC90DB8C7B8EBE526DDD59098E79DD92DB8D 5JEEPFUND
804,160,389 *5368754477EB68E0E1C4BACCB88E1E165C534189 5KEKSIVAETKOE
804,160,390 *5366F1129D1797ED99E8F767958E26E851541FA3 5KMPJMUP
804,160,391 *536F3944C315D2F9E47643EA675252B10799FF27 5REMAREHALM
804,160,392 *5369FF9C5CB55B419AEE2BDDD1E5488F9B4038BA 5SNOITASILAG
804,160,393 *5362EE5A7A625254A447612EE42962FFD82B7B9A 5TAMARAPINKFLOY
804,160,394 *536FC5979B5D8D837CC756205C6F3F3D85AA5A11 5TELECONTACTBSW
804,160,395 *5363B6427ED1A6D13562F29630C8CB9C10F3D75A 5thatlegend
804,160,396 *536C18DB9085AD148D5370FBF5633F5CE9343610 undeclared6
804,160,397 *536E35040549CD9EB6C799F450C3AA1363C5D8B5 UNH4PPN3SS
804,160,398 *5365EDA16A3341C4F24A58B1AA2DAD8B6FCD8D3B 688SOFIA
804,160,399 *53656CE4234987D5894C8DE3B27BE71FEE012B78 UNTIL-THE-DAY-(LP-VERSION)
804,160,400 *536059118FE3306338ECAC406F8F4A329F4FA1A0 6BIOKEMIJSKOM
804,160,401 *53646D8930817E358963AD8E538A13960FA332C9 UPPANAHALLI
804,160,402 *5365327536A24A8108D0D8E46EC01E51B8ECB311 6GHOSTBOSTON
804,160,403 *536AD3C3303AB6515DE11E672E4496F38BC839CE 6IAREMROFIR
804,160,404 *536FC118DEA2A62889374B7ECEA7CDA64D272CCC USERROGERTHATPORTALA
804,160,405 *53632F2F01D474BB8B4127AE5BE1E667C859C96B utsp1994
804,160,406 *536D662055B842155120BFB25D68680C207DBAEA V3R1NSR1N9
804,160,407 *53630AE2466EBDAB11AA74D98DCB0C69331329B9 6LRFSBIGLEI
804,160,408 *53630CED8BA115A7F78FECED1B3B01874AF36394 6.LUBLAU
804,160,409 *53623D7683812350FE88DA6D2C1AF41B0B0D99BD VAAPUSTA
804,160,410 *536BF78A1F4B85F5486766C1C9F95F93ECA4DD85 6october1808
804,160,411 *5368B4267AC1F96F68CCECA5E67CFF10C7E5092B 6RUBYLEONARD
804,160,412 *536D6C52A33EFBA83895B4A7272A8B4BA0E5E627 VALMORIKAWA
804,160,413 *536B741F36F55331300C7E0067553DD22A893A48 VALNOETT
804,160,414 *53630368B0C5FAD1DCA51840FDB0921697ECC171 6TILGJEVING
804,160,415 *536E2CA1AC7A60F27B22BE56984CE568D8F04B68 [email protected]
804,160,416 *5367DBF55602D7D65D80394B721A1C08BFF7319E 701KIMBERLY
804,160,417 *5362E07C7BAA289A9063857D81160ACD7152269B VEGNESHWARANVASUDEVANRAMAKRISHNAN
804,160,418 *53626067CC990B8F412E69C739D33172CFAE393C velayuthabsw
804,160,419 *536B476A87AA988FD09364BE62C4686D32B16B5A VGUITY
804,160,420 *5364F9609F704CD6BA399A7BCC914E7584BB4639 VICTORHONEA
804,160,421 *536C3A8E137CAF8983660B8A026094C9C35BF27D 7-deGiStireceGiz
804,160,422 *536E60D389F9EA06E5A4B2E5C829EC823B4BA2E7 7FRIDAYTRACY
804,160,423 *5368124AB325138B00BF868DE7C7EECD584C444F VINCENTFOLLIOT
804,160,424 *536047D2B584EF33C83EA0C9C7B261B367EF193A 7LOUDING
804,160,425 *536FB2EE9D59B0A3C2F0F06640664780D17885CE virginia.beach.gamer
804,160,426 *536DD3DE4622D3801401D5F62525DF478CFB8181 VISAGEREZS3
804,160,427 *5362CA5F9C48678FB2A7C23F30B140161E4DD726 7physiolatry
804,160,428 *53689F3D3DFDE25F8C76DC1B206158828BD6DE2F viz.card
804,160,429 *536A9AA7B1A8A3E7DF4A208F6021DC6DB34AD959 VRDNSFRMTTH
804,160,430 *53629EC6AB6BE8F261B9C5D4E26082D9E9EB4A64 8#>~0~oo><
804,160,431 *5364CC8D978E46CF740A92EAEAB63F4F7A53ECB8 WALL HAS EARS
804,160,432 *536F8D73239140E9C2552537695D881D708B3DE8 8DRAAMREV
804,160,433 *53624ADB168BAEC9681DF33D49970633C1EC0771 8DUMDRISTIGES
804,160,434 *536C669179A63BA6408E24E07A727C05B16AC831 WARENFLUSS
804,160,435 *53681CFE408B192E73C590C6050FA639D34A88B5 Wa$t3.bal
804,160,436 *53653920E29D96B86D9DCAC3DE8282AE54764F0F WATCHINGALIGHTINTHEDISTANCE
804,160,437 *5364B03326C2D11F963E4D7C6E72286BEA486E23 8MADURAMBALBSW
804,160,438 *53691D02D6E811661295917094EF252E18D28661 }8{[email protected]===P
804,160,439 *53654723411D8597AAF4ED1A700B55F5E02F8C03 8REREDNAE
804,160,440 *5369C0C5328F917AFE2CA9F3B3660C23BAA2CF0C 8.schaeferott
804,160,441 *536920EC44F4D7DB1BB72B340BE6337CA73ECFC8 [email protected]
804,160,442 *536873FC9A02BBB649BF7CEA95B3CEC9784E0451 8SUGGESTIE
804,160,443 *5364AA54F206689304CE3DFBC25851DB2E19A409 WESKERLUI
804,160,444 *5369649ADEA7DD7AD62CE0F20B1781DC3CF6163C 8YLIKANKA
804,160,445 *5360BB2C109855E4E602745B61E51CDC8400D238 weyrd
804,160,446 *5369D6431B6A0DDA1BA8216DDEF17CFFF127D47D 961LILA
804,160,447 *5360CA1B6992F619F343FCA8E4C0D61E68C101AF 9ACCRESCETE
804,160,448 *536FAD234E29E9E2A38271E3434BD675852FC3A4 wickedbornghosxt
804,160,449 *536786B802C90B2100844822D903CB08917EBCAA 9DIEFENBAKER
804,160,450 *536DF291CC7A85E9B461E5FBE4D034E13D43882F WILLIANURBANEK
804,160,451 *536B43C4DBF6E18E4107720E0EEFBC887E6BD964 WILTONSIBGERT
804,160,452 *536AE90850A582EEA08BE392B2EE98A95F6E27D3 9JIMBOMAXWELL
804,160,453 *5361020D5F9E376A07B939B264B507EBB0041446 9JUNIORSPEEDO
804,160,454 *536297D44104E2B30655931C5071E4CDC1914D3E WINNIE.POOMINGWAI
804,160,455 *5364560518E56B0335C784DE2AE0EA00D439E27B wipe.them.out
804,160,456 *53600AB7FB711A524344DA3CBFD050E5BCC432E1 9ORDEYNYDE
804,160,457 *5365C09402B545F3B167DB5C21D57ED13F0E247E WOODWALLACES
804,160,458 *536D52407FB9A0361721EFCF9C75B4645FB0F908 9TABLEMOVING
804,160,459 *53692A8BB5B259980A76CE12F85B05C2C9036B6B wwba680
804,160,460 *536E267BE24C0473860295A54E106B593B1B0DCC 9TSCHPRN
804,160,461 *536C3673730535753A9ADFBA745A8309659D164A 9UAREDNAW
804,160,462 *5365B4BE52D46FD88324F8A863E405D94D08C1BD WWWGAMEINFORMERCOM
804,160,463 *536125A63B2FE55AB56F1F78AE33DC268DB7A21C WYATTNIEDERKORN
804,160,464 *53668DD59815432C59D399C0E21139E6681B6D1F )x( * * <#####b
804,160,465 *5360C0D7BA93B07F5111AE3F122109A9AA33CCCE AA-={
804,160,466 *53629FB97EDFABC9A28BA23BD3EF4449C15C5B3A )x(-*-*-*[email protected]====p
804,160,467 *536312B64F00BADEEB9D1F24670D0F96E80F2519 XYGZ0321
804,160,468 *5367540A9376C8385532A8169BF59ADC5442152D AAB"N-
804,160,469 *536DC71BC0841E7AA1B40E468A0DD70D4BEB45E2 yando-syahrilian
804,160,470 *536540B3663B1B8BD155972912152F5714E28A83 AAC!Q2
804,160,471 *5362710B91E0D041BCAA42C06947F8B37B15C204 YANSIMAK5
804,160,472 *5369C211C168E4E30BDB04E4B8F840A593F3BD32 YEECHENFOO
804,160,473 *536E3951BE3B321DACB1BDDF208A170526670B1D abwp_
804,160,474 *53625BAE3C7C0060CB5E2636BE2E18A83A352DE4 ACENDEM2
804,160,475 *536D66648DCEA805DFBEE2544F0481A834D04BEE ACHVW
804,160,476 *5361726CCE80A70E7E256AE6D99E1BB1590C8E14 aclp[
804,160,477 *5364E65DE07385589F72911D67B2042BADA545CB YYAN.KUOK
804,160,478 *5362FB0B2E61531E2CC8FD6D4D1780DD1BA219B6 YY-UIUUY
804,160,479 *536A6778ECAFE0C9C65A08E9C70268E882BCB831 zachariahbeltram
804,160,480 *53684A28EE994A5559AAD2D4C0A09DD1EB6F1DF8 zackdepaula
804,160,481 *5368CBADF4569C7A965951DCDE5ACC04A24C2DB1 adalbertokear
804,160,482 *53630258554BAFA19634A3AABEDF4AAD584F0988 adalbertokirbie
804,160,483 *5368181870980DE78E8BED608004ADDDE45C5761 zanestravinski
804,160,484 *5362E92A7A7BC13362F0A5B93C9162983B32463F [email protected]
804,160,485 *536F551C9A4566F80AFE35F6542F96F7DED16B70 ZENIEY BUDAK MACHO
804,160,486 *53605F3503FCA2E610BCFB83BC979252916C0E3B ADRIANMAGIC
804,160,487 *5363A03B1B202E68D2068723504F6DCA5B49E6E8 [email protected]
804,160,488 *536CD103A8AD04221A96553E8C49EF4835C38BEA [email protected]
804,160,489 *536C2221799713E80D46CB7C1C7AE67D5CA94E4E [email protected]
804,160,490 *536DB230A7853062D85F92FF3E58A33C887E63F1 A!F
804,160,491 *5362920CE632B49FA58EB713731FE4BA06D490E3 AHIVSIALED
804,160,492 *53615AB8393528729D639865BEF4AFB3D00E39E1 ain-purple
804,160,493 *536C973B593E3C2FE78105EE2A28F129ACC1DD76 AJGL9ZVTB6UJ
804,160,494 *536B2A7FF0342578FF33ED629A8BC909D8E462C9 AJUMARANG
804,160,495 *53604C23F729439DC78CFB5DCFB03D824948E03D a?kqu
804,160,496 *536E25B17203130A2618C4B355857F42524045E5 ALBUNDYING
804,160,497 *536B5ABB233964F49B26A15FEFBBA16C3E8EBDCE ЛУКОМАЛЕ
804,160,498 *5363D5E88A3C4FE0688DE5C74C080E2958373767 ALFIECANCIONDELILYALLEN
804,160,499 *5367361713A1935727AB851BDF33DC14B77475BE С̣АХ̣А̄БА
804,160,500 *536ECE4C029D48E5C7F7791B0F9385A0C9BB8968 ситатаҳо
804,160,501 *536C8A925944D73C51318F2E95C676B759A2AE21 ALIAMKA
804,160,502 *536EA3B08309E62EF3B61AA5F0ED94459F3C406C [email protected]
804,160,503 *53642181F0B3DC77D5BE5D3AD82EB2A0B3A4AC7B alphonsekarella
804,160,504 *5361EF7B1CCF9D4407912564BDEEEA0444E9382D A;L;R
804,160,505 *536587DAFC4C0AA5A60DB6493F5C9B5ECCD869C3 ALVINFARIA
804,160,506 *536FCD9C9E406D1B0D23FD4AA969E441F695A24A «ХĂВĂЛ
804,160,507 *536792C3A6424E596242F9EB92EE854C396104E7 AMALSHAMLAWI
804,160,508 *536B695637E0C4A58A09D79FC2DBC1C329A9C4F6 ANESTÈSIC
804,160,509 *5365296051ED4E1E39512019A46FA61131C19FAB ANEWCOMPANION(FRIARTUCK)
804,160,510 *53605AFD24D19BC12777010CF8FBF5FAEA6BD41F ANGELSPIT_JOE2002
804,160,511 *536288C1DF7590D7BBF2EF66B9F6E6982F869E24 ANI-TSAGUHI-(BEAR-CLAN)-(THE-OFFERING-MIX)
804,160,512 *53648CEDEA9F906EB9BE24E6D29A2A79968280D2 †ANTIACODONTIDAE
804,160,513 *53661FCF93D1DF5E169EE9EF6EC3DC78A38CD24D AQBHM
804,160,514 *5369FAEE33FA0C7CDB4373273ADBBBA70623ACBA ARLIE.VANORSOUW
804,160,515 *536DF38093BAAF6190EF49237E608269D29CDB82 armandtoedebusch
804,160,516 *53600BEC06E446A6BCFDF9320D3C68E72C3C1F4E ARMANDTREADWAY
804,160,517 *53628D02D32FD0665684D7FDABD89FCE8FE395D5 arronwigley
804,160,518 *536E4920D58948C551718F39A34CC473BFB76ED9 arsg5
804,160,519 *53657433C8D6AD2F612826AEEFF0380EB79DFFD7 asperness9
804,160,520 *5367605D264CD2205F4DE24A9D9778FBE32F56B3 AUGUSTINETOCK
804,160,521 *5362AB8AB063D254D1F7DE70E7E36C64AA7DBE7B AUGUSTNANTHANONG
804,160,522 *5361EDFF27755E3965748E37C9B6158370C057F3 au_;p
804,160,523 *5362F0E24916B9AC138D094A0369FBCB83972DEA AUSGFOINA
804,160,524 *53633173646DC86A288713164D87C2DB9D129F0C AUSTIN.MARGULIES
804,160,525 *5367F554A468D06010008A05CABA627D6C6718F1 avp83
804,160,526 *536AA6572CC3FBEAA89DAD21559F12EDDE13726B B3L3MNITI
804,160,527 *5367BC5486CC151F524E2662F40AA925FC4393B6 BARAK BINYAMINI
804,160,528 *536C253FE98997C9BA942B38911EC8F864939AD9 barneyharos
804,160,529 *536D49C7668704C5437CFA8ECB033E02852CE055 BARSOWO
804,160,530 *53667CEE8981D210F778D8C977C9F8D691F61FA3 becy+
804,160,531 *5360DB9ABBF229539DF15341E433181FBB864C0B BELIEVE-THINGS-CERTAIN-WELCOME,-MY-FRIENDS-ALL
804,160,532 *536637D4D001A6145E634B4961D288940472C540 BELLEGOSSE492
804,160,533 *5361B537E049B4A4AE82C4E5A748B1AAB46BBC06 BENARIELI
804,160,534 *536721A9E9E0A4C3CC6C80EAC74B7955675CD8EA [email protected]
804,160,535 *536FC7385C6A140EB20D75274D4F748848682823 BENSPINAR
804,160,536 *536ABF4325FB68160049FFD70946C8D87944D142 BERTRAM.GOBEL
804,160,537 *536BC82A3669D07211E656C65956DFC4FA3007C7 (00).O~O~Q======P
804,160,538 *536B71336B53EC5CDFC928FC3656977562B0BBD4 be the twilight
804,160,539 *536639B0D39A3ADB9EDD45085FF22E530BD7B6E2 BGBS#
804,160,540 *53651A48FD9761EFD68BC15FB055E07B2B9E1264 BIKINIJEANS
804,160,541 *536313743DC6D5D1504E20855DB41F9417200EA4 BILLIEEISENBERG
804,160,542 *536EBC9F44F772968BD8A487440FE028ED5DC4D3 BILLYKURTIS
804,160,543 *5368D14EFA0A0BDBD455399E44E59EC997A290A9 103patience
804,160,544 *536123D9E74147BBBE069636CE732E8BE7F1D414 bl4%g
804,160,545 *536DF866FA128FE0B2C9315C69CA776B55CDF01F 1270032 rakennuslautakunta kokoontuu p
804,160,546 *536DCB67DAA41EBC74D6B60FF8E84CAD42A08D38 1290882 ALOITUSSIVULLE PALVELUT HENKIL
804,160,547 *536247AFE4F7DCE0E904326DE3CA0666CE6F5B0E blayu
804,160,548 *5364088BA528B21A306C25F7BE8A87B1C2B4E90F BMZHU
804,160,549 *536937FAD49BCDADA57304BAEF0E6747E375A77E 1613404 GRAIN.AND.SOYBEAN.FUTURES.WERE.MIXED..
804,160,550 *53632B0B00DE711E8CED8550C6EA092D49FF34E1 boat-shape
804,160,551 *5366FB31DFCC0032C12C0DE15026C9DF6CC8DEA1 borncard
804,160,552 *5366AE0EC42FCE8F54B00D558176937C59EF2E4A 192327 DER-HERR-AM-TRESEN-TRINKT-SEIN-DRITTES-BIER-.
804,160,553 *536B1A88BBF07B8B36D8638157266161DCC4D894 b$q+4
804,160,554 *536C71898FC8103D1A72E5554369A9A824610519 BQRP
804,160,555 *536AFFF52CAD8B47C0DD13E91C3B21D0D15A5B9D 1datenspeicher
804,160,556 *536279AB741A51EF41CBE9169C150A7F11D23999 [email protected]
804,160,557 *536ED12087351351840D06709B89F2253EF49A63 1GLADIATORENTV
804,160,558 *536C24C148010754997224AC28EF1656D78D18C7 BRILEY037
804,160,559 *5369683AECA4C6CF7310032D403480F76EF6F71B 1.HTML-VERSIOIDEN
804,160,560 *53654626FDB6A58FD04ABF25C3C1752838E535C8 brnib
804,160,561 *536D7BE757C4BA117E8318431A2498A53509FA2E 1 INTERNATIOAL
804,160,562 *536705A1C6B84677B53370FC5898958B4B9F7D56 1 KEKK
804,160,563 *5365E8FE6D133B434CFAE3DBA9D445A266253629 brwo9
804,160,564 *53618DE035070CC0FF91DAECBCBF124A19347001 B=(S5
804,160,565 *5364179C1AB89D9DAA83E090585F1F0743C9AB68 1 MEDIENKUENSTE
804,160,566 *5364C7C2036B598F5908DBC36CDA9813A3E2DF4B 1molesters
804,160,567 *53645D594EEDE54A3C50FE1BCA224A9FB770EEC5 [email protected]
804,160,568 *5362B70A8D1FD8ACD12729AF63681EBD5486F92F BuE
804,160,569 *5366EB57F44447402EE7431F8207AE23C957B016 1SPUNTELLAI
804,160,570 *536C3F8E134B64DB0DB8A4F004B5FA55571564D9 1 TABULOINTIN
804,160,571 *53682E6878A382EC3994759A13479C53F3316D86 1-tarkkailuluokkalaisia
804,160,572 *5364DE03E1F48BE54DE723087C1F67E7F2C6607F 1 TEKNIIKKAVISION
804,160,573 *5365B505F62A1BDBF7A7773735BE4FDFFEDBB23B 1-TREFFIPELIH
804,160,574 *536D2A763E8E96C0B65DDF1558B17C08D5491B1B 1 TUOTETIEDONHALLINTAA
804,160,575 *5361D90E18FBEF7D72748533F353C786D9046084 1-VAKUUTTUAKSESI
804,160,576 *536466E583CE76ABF6D94DEFC542C376DAD1031D 1.werbevitrinen
804,160,577 *5362E4EA0888E6CABB1AE8E39E73BA4757D4033A 1YHDEKS
804,160,578 *53669BEE9B3A4DE52D61634294F558A32A829415 2263724 STATTGELBGRAUSIEHTDERBETONDANNWEISSGRAUAUS
804,160,579 *536195594E1F72D174DFAAE00F6ABEE999DA2737 2: 2 # & prorogation
804,160,580 *536F85B4867000CFF3FA5C90B2BC3F026319F2CD 2380442 1987gelegenheit,hobby-kommissarzuspielen
804,160,581 *536EB5C7C5CA10698CF6A4BC73D8453E67376173 242125 'well,itgavecertainspurs,certainenergy,yes.
804,160,582 *53636D2BA2158AF0921894834B39CC49C07947F4 26071575
804,160,583 *53694B38C3E04E717B8833B03CC8193B0AEA809B C1PV
804,160,584 *536B31DD464E346A90A795AAFEF9850A0215E2ED 2951567 VASTAUS-(-KOMISARIO-JARMO-NYK
804,160,585 *536203B222FFF1DCD9106F0F993E0363DFC13F04 2DAYTEKAMY
804,160,586 *5367F2B27627EBD9FF384AF595FA97C76E659351 c7mg_
804,160,587 *53699633E5DC9415A5DD289AE39B01F83B3166FC C9$!
804,160,588 *536CD4C6BF72ECD84B19924325CCE7F751ACB771 [email protected]
804,160,589 *53686F7CE5EA21E500126A22C6D868FBC71DD33D C$A?K
804,160,590 *5369F1503266D53E2BC2DDEE5E57036E1E9D18CE careymassimo
804,160,591 *536B9C2F8BA240D4606EFAF0EF21278027486EF0 CARLEE680
804,160,592 *5368F4FB45AA1CC1E9EBD449539C93911244EC7F CAROLINA-MARTINS
804,160,593 *53638A19D4FA33D36F9D8463AD73C779A797A797 carrousal8
804,160,594 *536ABC92157476323E9F855930C7D740E9FF3714 CARRUCHA5
804,160,595 *536E80C4D7FB8CB53727EC2E94BC996E4F89FD17 CAT0N
804,160,596 *536747355A4775A873D5E3C1F7FDA986E4B60EE0 2programmleitung
804,160,597 *536D83D9CA653242DDB2D940A141F20659BA719F 2TOPSOILS
804,160,598 *53600996847571BA5181743931964B86808813F8 cceur
804,160,599 *5369A1CF5591B5764AA2738B6A9C5E6C021A2A2D CD?K
804,160,600 *5362B1191A31166138439201BA11E8CBEE7BDD4C CELTICWULF
804,160,601 *536E4A43941D9A8333C377BBAC8FE0529FEA1A20 cemno
804,160,602 *536FD7A6F6EDCC57DC429911D7995174682FC0DD CENTERFAX
804,160,603 *53603690EF02C1EA18F06ACC85F53C8DE6F3675B 3AEGDIRBA
804,160,604 *5364550FC8690FCF7F2632659FD539441191F337 3AITHMATOS
804,160,605 *53689A9DE02A3649E37C691EA7A1730ADA2E4B6C 3B<-.~.`.q==8
804,160,606 *53669250A7D5894FCA0D1910DD9D1EA4CC5B1E91 3d~0~o;)
804,160,607 *536157D10C2D26B726E7A981E4357DC1EFD52EF4 3ESOUTCNU
804,160,608 *53660D60DDE18A73AFFFA01E6868D49779FE75CC 3HILLIEST
804,160,609 *53601FD76E4140FFA95A9790C3CD78C9D1355AED CHAMPHAGNEL
804,160,610 *536D767E497F1A01F1C434E39029AB5FABEEB738 3.kuratoriumsvorsitzenden
804,160,611 *5362246F2335FCA87FC79347B81952EE6771A277 chancesikula
804,160,612 *536DE5AE21B4D7912F36019EB3BDA535F454D620 changch
804,160,613 *5361D2A07DB1D9CD3A26561A31D52CC57C8B45E6 3 ozurlulerden
804,160,614 *5364C786C53A399888E245A9CE409834A4ADD89F 3P~~}8{
804,160,615 *53630453C36DFE58830D558EE7FC560458D52AEC 470301 kaikkit
804,160,616 *53669F53570C4D7B780FCF235834E5BA5520FCCB CHAUNCEY.JEFFERDS
804,160,617 *536B18710D43AF7ED22E2C11947E986793F36574 CHB!4
804,160,618 *53609511A13D3CBE6726571E6177EB1E56D2D478 4AUTOMATIE
804,160,619 *53676D44B04CEC1AE8A2E6B927C1A88498E56241 [email protected]
804,160,620 *5365B913F4B0FD632431138C9CDDC7F5ACE21598 4KANUTEN
804,160,621 *536CD9637485B195FDF9BF8871363D76DA92ED32 [email protected]
804,160,622 *536D20C61B61B54EDCBB321FF5E7628AF2ED84BD chor3
804,160,623 *536338566044A11B3EEF5EEF527DA0551779FE20 CHRISDOUGHTIE
804,160,624 *5363B746BF6576D780DA2D0964285B163FE19908 CHRISGEIMER
804,160,625 *5366C75AFF17EDE34C30482AB9680C2EF5F2BC95 4POLICECHURCH
804,160,626 *536A752D95A02FA230424789CB260D3129F61670 4YOD3JIS3GUN
804,160,627 *53619BE2FF092C76DA6B1D3FC0C7DD8FB343190B CK:AC
804,160,628 *536937DE0DEFA39525C7A7387F852AF9411AED47 CLAUDIABUITRAGO
804,160,629 *536BED898B7C111AA450440B408AA1D8DAFC3926 cletushousden
804,160,630 *5368326FB466D5091786A25A8F1D24D2F253D5D8 576janiyah
804,160,631 *536A8F1C1F5FC158CF3ECC4F5CE079C912B09606 c-mj
804,160,632 *536EBD734C60D3273CE97862F6196E15CF6E6552 [email protected]
804,160,633 *536C309905F8D90D866D1783F9D1022DBD194ED2 cndg4
804,160,634 *5367852D66FE74FB4593A4F8B1EAAF1EF4BF04F8 CO$!9N4TOR!E$
804,160,635 *536A542B38F8B184D7398BEC6A17DAC769F22F42 [email protected]
804,160,636 *53633EB270C80F9F4FDFF82F61966C9C153612FB COLEMANTHEINERT
804,160,637 *53610780A0CCDE514F3FDB65C58F06867759F6AB 5ILOVETATTOO6
804,160,638 *536EFBCCDF392D55C81E2925C242869CB31C335A 5PHTRSST
804,160,639 *536E3070F82A3029FC9CC5981DE01DE12B6117BC 5REGITHCARUUZ
804,160,640 *5361E0AAE97D0F5E9E2B36A7AC5C0162C18682D7 5ROUNCIVALS
804,160,641 *536257067779F2DD32F90C4F9A4FB472311DF5AF copenhagen angel
804,160,642 *5363B84A63CABC992E36C0A4E0A036B2276D67DE COUGARSKRISTI
804,160,643 *5366F7437632496DB35C595CCAE5B8D1848FE10E 5UBMI774NC3
804,160,644 *53655E40E0C4FE917DB909B092C47E0E164C4F44 CPEUM
804,160,645 *536EFDC8539405A6F57C9359E290B1983F8F9145 6COUDOIERIONS
804,160,646 *53635451E4B0BBD5F99DAEF300BF72C51194E00E [email protected]
804,160,647 *5366FA52973EFB6938698066771C3AE8A2CC0852 6OBTUREREZ
804,160,648 *5363A45E0E2E794ECD69EFB4FBD4F6E3F0A102CA 6REFERIRIAS
804,160,649 *53601466A075BD105B05AACC049F0BDF31382390 6SIULINA
804,160,650 *536C76ECFD2298E776C278050207A498DFFDD118 6TANDYSQUIRT
804,160,651 *53604037805775B0577BE36AA79575BF5016E4BD CRYSTAL.COLLET
804,160,652 *536280486DDEB982CE3ECADF778BDFDA8F8AAD4B 6THATFAUST0
804,160,653 *536A208211B111E2A98AE4F80516FB80D690729E csnts
804,160,654 *5365976D24536F65D7D77B68F661E0B14CD8DBF7 CS"U=
804,160,655 *53621C2BB608D7EA6CF8DBBC40132910474053A4 CTD0
804,160,656 *53676ADEDE69BE44BACEC153FCE6C63AE1744E14 cunieform6
804,160,657 *5360316C70C0A20C298910E348E1FA9AC4334EAB cuntlickers
804,160,658 *536757C3035A9E1BB66601F0812C372BD18E6073 7CRAWFORDCHRISTIN
804,160,659 *536A299AD19560F9EDDD0CED50E1C1B028F42DEF CV$=
804,160,660 *536A6D51E4D81342FD5C98D554912BEFED1FA4D0 d0eta
804,160,661 *53624EF4B8805D16D14D311E01E58C1F7E8911A6 d418b97fc3e3fefc49c81f934230c7ea-kshgftyb
804,160,662 *5368748F8CEA56952A14ECDAC3A1DB61CADAF4F8 D:72
804,160,663 *536E6BD9FF85CB5B2D4B05251DBD556A1C53F0FC 7RESSALVADOS
804,160,664 *536AA04675ED227C719033622F21FADB189FB228 D83DSGBE4YXDDG
804,160,665 *53661E0557185D0F74308C7DCC036D8C02111833 7TIUQLRAXCD
804,160,666 *5362401B9A16849961EB92D26DE46A1C8B74852B damnerezs
804,160,667 *5360E4FA86CF3ADBAC96DF10D1686EC6B84D628D dananou3
804,160,668 *5360502D2E50476E05C2CF03B909CAAFCA385709 7XKHUNHYX
804,160,669 *536A1CC3BCB980B01F9C87DDD2B8FE2AA1B61C00 DANNIE.VATTER
804,160,670 *53698D1C3421D30FA62993D980234129EA3BC07D DANSESORGANIQUES:V
804,160,671 *536D0293D6853B2295FAD805E84E6BC6B7111D01 darinmieras
804,160,672 *536819EF6200D83AD340C45047A7739D48F02C9B dariopicerno
804,160,673 *536D903CD9355E1699818C78801D61252A03F7C5 DARON.KISICKI
804,160,674 *536FDF88FD07A2E9A01982428359446327E960A2 8ACRONYMED
804,160,675 *536C03B2BF0FDC7BEC2A0BA381CAD07375C1B001 darronlankster
804,160,676 *5367EED258027C137E8E839F4554154C302C2143 DARRYLDEMPS
804,160,677 *536156EB17D0DD832F99C8E3C8A653712280E499 darwinklages
804,160,678 *53622A5BEC3CE3AF2D25DCE05CF315E860C7E8B6 "";DASH
804,160,679 *536A6BB3B31C4B2963AD26F08AFD8D47348D2227 8CATEGORYH
804,160,680 *536920E5B2488F61358CD14272CB28B3C7043E57 DAYWORKER7
804,160,681 *53656DEDDDCD53996A6DE61FDF8EB6092EFDDE59 DEANGELO.MARQUE
804,160,682 *536ACA57AA2F9B7D1D1BEB07B1E147D9A57854C7 8ONVOORZIEN
804,160,683 *536DF73BF59E304B219AB1B9100D96115EFBA486 de/=n
804,160,684 *536DADC08385D265378096E13DE1B4D546796827 960k€
804,160,685 *5367D15D730F15EBD2551FD941846E6BF653B24E [email protected]
804,160,686 *5369DFA6B002C2A97414BEBD2DE75C4CFA9C3FEB DEOE%
804,160,687 *53610E7DEEB81A874892B7594A149CD5DEAB61BA deq;v
804,160,688 *53615B92274673DEB91F5B70C6226D6722AF7311 deshawncarmella
804,160,689 *5368B9904B303FBC55E887E604E2F922BC0816EE 9GESICHERTER
804,160,690 *5363834D8FE18EC796B96D76ACA04C6199AE4A26 DEVOUTNESSES8
804,160,691 *5365998EBB8D879878845AE8138D0FE3D44ABA6D DEWENM
804,160,692 *536F79F76B2265939C6D86A4D66A052E2DB67DBB 9 LAJOS
804,160,693 *536A8001C6E92969A2ECF77D477513085AF693DC DEXTER.LESUER
804,160,694 *53630B1316DDC618EAFF448A99D7E9B5B954A737 9MRBYH5
804,160,695 *536825E18F7BDD5C50D8EA0127099F892E4DE089 9NEWTONSMITHS
804,160,696 *5368F35E936F21F75132A946B0F8A1DA4EFA9DB4 d:f)t
804,160,697 *536487B84D8AB32073330812561EF75FAFF89482 9RUSSELNEBRASKA
804,160,698 *53616AD4848204E89F51AF36A6AE4156F252B8D1 9SNVTEIT
804,160,699 *5368AF4D99B2AA75518E2F23303A9AE66E143020 DHEKELIAS1
804,160,700 *536306D8DCE9AAAB133400347F93E1CC583D635D DHILSDON
804,160,701 *536831188346A3A5F6B22FEC21228373AF1E2E98 a-:
804,160,702 *5367591623851638C2D877B929E24EDF0AD88694 DIEGO-DE-ACU
804,160,703 *5361DAE54100EDFDCF47B88DBE518BF254BD2A86 DIEOLSENBANDEWAREINERVONUNS
804,160,704 *5362C545C963D035263FCBE7688FF5881CCE28E1 direktpassage
804,160,705 *53631376BC984F641BA8B3B3A4059A9E5632B439 dirty.little.habit
804,160,706 *5365824B244F686BA0E2CCF3A706124B79AE6D47 djg4w
804,160,707 *5360DBC45E7213FED380D20457605F7EF5A83183 aavu
804,160,708 *536002FA75557ED5A3F05EE6785B5C716CF97CBF ab`ce
804,160,709 *5362A2FA91F16453A27D2DE006B00C8028807A8C donesemed
804,160,710 *53606BB46703A3716CD08897CCC8E72385211FEC AC6J$
804,160,711 *5362B37C69B5483357BA482A3E1CB1F9A72E7EEC doowburcs3
804,160,712 *536DADFCE113FBB4D2E9827447997BD7B40C3468 doppelkegelschema
804,160,713 *5369A7106C5437D16EAE589638ED40C05D0CEE33 AC(TL
804,160,714 *53681D271B703F3CD77EA4366877D557CE75FA80 DOUGLASGUSLER
804,160,715 *536690A43DF0A6799A00EE764A88659AEC2624FE DP0+R
804,160,716 *53651B759F1042D814BC474D30F79B3F29FF046C dr84
804,160,717 *536F64B4C2DCDB4D3B60FD0930DC4F1BA9E738E2 a;/$h
804,160,718 *5361888781DA77C70FC09B2C3440CF21F12ED781 a:i5w
804,160,719 *53675054E4ACA776F0D787598CA80D0E7CD51DCD al/e
804,160,720 *53611FBBDA3683E52CD9FC5FB592DC464F1B441A dylann.moore
804,160,721 *536E088BC6F462A60214D8EBD619F3DD7B30FBC0 DYLANOYLER
804,160,722 *536BEB71A8A1EF0015C075763CC3EB73CCA062B9 D+Z)
804,160,723 *5363EA39EA919F91BED83F58D51E601F874E6EE8 dzi1$
804,160,724 *53652F39CDDBEBC5C1AA73EBA7EC97A97B31070F d)zj%
804,160,725 *536D384DFE6763FD9CD21F2FE62AD0A55D01454E ALEX.SYMONS
804,160,726 *536471149680DD69704260FADCE7B36412AA6C41 ALFRED.ONEEL
804,160,727 *536A035E47CBED841FA7F8786376BCFBFB94FCD9 e5+rad01
804,160,728 *536731CB0F5D4C534592885E6B01A2CF6E3366AF a-life-for-the-tsar:-i.-cracoviak
804,160,729 *5361C07ED6229B13023976202E4223A1710787E0 earnestmutart
804,160,730 *5367311FD109BBE9F70CFED921C1BF6D864BEFB8 alonzobarney
804,160,731 *536DD95C0A0DD6470731279993D213DC2EF1C747 ALPHONSO.JANNUSCH
804,160,732 *536969A5C333312A80529F2FA3ECBDE2A906A382 ALYSHA-HUNT
804,160,733 *536AC7AE9D104A4260434DCB7C898D21A045CEA5 AMA2A
804,160,734 *536E1AB908827EE6244EF8061788D8D46303CAF4 AMAREGGIANDOSI
804,160,735 *536A8D6D786FB2E604A7437AC0CAA32E7EC88C6D AN9B
804,160,736 *5369044981FDEB092D61EA6C4D84374B1F43C222 EGRYE
804,160,737 *536C0438A14E1F14DA4E0C4CF523A58E771BF5C7 eigd"
804,160,738 *536878DCB0C9987BF61AEB45279698FDFEF61581 ANIBALENSLEY
804,160,739 *536FFCE5EDAEF5B0006115FD22AA7DD6608F08A7 ANLGDEC67
804,160,740 *536E4E3ABDC1DE41D5999F881D95C1E84E5E2296 antonyfleurant
804,160,741 *5369E05065346AEB79BC89F17D786A5DCCBA2623 ELLIEPOS2
804,160,742 *53680B215942CDA96E1752622C9BD7BC80C2122E ELMERERLICH
804,160,743 *53613E37D3A4DCAC6380B453A5D0F84CFF0332B8 elmodebernardi
804,160,744 *5369868B996A7DD8B31FA7506F2985DA148AB03D aouttuoaed
804,160,745 *53637A129DE700BC657D4702748C6EA6246058B1 emilecoatsworth
804,160,746 *536FCF0BF86E28867CA6E36110D043E9C1C73D9B AQ#C:
804,160,747 *5362705BF07C6F0FB459D3EB96D4472B42009940 ENOCHSLAYDON
804,160,748 *5366D19484BA58BAFE13DED58DFF2D43EB5FB389 arnulfowaldroff
804,160,749 *53677F7ECEF53EF542FCC07A904E0D90F06795CA entpq
804,160,750 *5367316758F1128FD72F874693480C981F24290C EODU/
804,160,751 *536C7C4957CBCAA7F383ECA4BDCEA1B9E9C419A0 eqimp
804,160,752 *536D6FD77557C3644135D7BB142713E6629FB340 erlendas
804,160,753 *53685B501EBB8102DE5F1A47F390BD966BFF3722 ASTROFOBIA(FROMFHETYSTORHEA)
804,160,754 *536006ED305E50D2F60033BE30B93D81FBE0156C ETEMATEKS
804,160,755 *5367CB443AC6CB11AAD062BAF385661406C4C6D4 ETHAN.ORZELL
804,160,756 *5362D747B1BE4A15F5B1989D0E1B26A2A99F4EB4 eureelternsindgeschwister
804,160,757 *536CEA4746941C7B40DD0B69313543DAB7E659D6 EXACTLY7124724317
804,160,758 *5367014A10051A308B856009F0082964A200699A eyq%4
804,160,759 *53629542A81A5EA5D38993DA40BA5CE4F6655165 [email protected]
804,160,760 *536EA3BD88B1121AEE156961613C9FB13A317F19 awp9t
804,160,761 *536974D515DAC54CE2E7984902F7BE0104947C18 fannyplanxtypower(live)
804,160,762 *53623D7E249DE1F8D8A5BCEE8E4C03A6974BBD74 ayf20
804,160,763 *53606C00A89F28B896EC9CCDC35F7C4612746B31 ayk8a
804,160,764 *536E85273E3A9217ABC85D909C84D64749F55060 B>~(^_~)
804,160,765 *536F7B35DE58608F0FCDE406DD6D77B28EC85433 ferdinandkurka
804,160,766 *536311B0763EF7439EFDAE28F60103F456B85308 B_1FL
804,160,767 *536CC0D6D002751AA55251B7B6137D68C2F3F1EF B2H/C
804,160,768 *536C79918CBC2E57D5F921A2C554B167E2718DF9 b2y-m
804,160,769 *53613426741240ABFDCF93A77706DFDA8F4B47F2 florentinosilloway
804,160,770 *536F8462BF3B1FBFFB1CC49B99701FDE87BD8AF3 BACKOFAPROMISE
804,160,771 *5367E10DC9923D26EBDAB03878BCD493EAC0BDE1 B=B~0 ~O(X)
804,160,772 *536EF80C597310473A783CA6BB4EA33B30B3FE8C BB5/%
804,160,773 *536E1F4C9D082AEBEC4D593BEB2293528E275CBD BBH$#
804,160,774 *53628BD2427A801F125A83174753E556EBABB657 B.BVU
804,160,775 *5360DFF8241BF8E39A625831CE759369FFF5F439 BDWRO
804,160,776 *536DC111494BA02074510A459C56D83B182B29B5 [email protected]
804,160,777 *536F0D7F95D7B04A3B26549216F10460F24766B2 freesilverite1
804,160,778 *5364A0C752B752F2301FCC93172B0164254EC405 FULLYDIGITAL
804,160,779 *536EF78BF3655D74F48BEB0FD2E793BB57426766 BENNY.KWAPNIEWSKI
804,160,780 *536CF8C187EEEB83AB0B511071548B433CBCE595 GABENTI1
804,160,781 *536808581A7D12C25C1C99B35B1EBDBF3393228C B$E?S
804,160,782 *536B882411C7EAC9FE541B02F442259E928831E1 garyheadington
804,160,783 *5367C33EAC62435C2EC68F2F16752DC22E1024C4 gastonceravolo
804,160,784 *536FCA6C1520C71E4D5A16299CD04325B2120750 B=;IE
804,160,785 *536B16D204A832D7158E6D4C94FD53F000B0C92A BINJAMINING
804,160,786 *536061D2365EBEDB83D1C38B9B25FB4F4764D6DC bo40b
804,160,787 *536D9D013B9E16C916B79D635B51340538197992 *gigi*
804,160,788 *536863BDA10F503D235EF14B43482FE74631E502 BOBBYTERRACINA
804,160,789 *536FBA2EFB86082F08D8F9FAB3AE9332C6725366 BOMADINE
804,160,790 *53673B861354DC16E3AA3043711D4D90F0CAB4C7 [email protected]
804,160,791 *5361878E4272F55342ECAA4F1BB36B68F267C377 GJAVILE
804,160,792 *53688AD696F6DE543EF95B63D7E655D1C4A45087 b#####>~o~osplat
804,160,793 *536836B345393EB05281EEC361450C412481A8F8 GKIKILASHVILI
804,160,794 *5362E9DEE4A5500E7EE5FCDBB65263099967ADDE GLEN.BERGQUIST
804,160,795 *5367C7A3B02D55E131BC8815FA15E96309911C79 bpc8r
804,160,796 *536298C6597448E9713515AEEBB6565C1C5CB52B good-side-bad-crucial-conflict
804,160,797 *536BD8DB74C76E07FCBEF090ED407154607CAB05 gregglazener
804,160,798 *536EE55DD8DC3480E672D8632AEEA20D1436799D GREMLINS
804,160,799 *536B331DA7F679355F41E61CD4074B46BA23EE8C groupsinging
804,160,800 *536EDE618B8D4E787D976D007C5246F078FE284D [email protected]
804,160,801 *536593B6C7C38A7ABC63162DFAE1999721D39307 BSAF1
804,160,802 *536D33C6E73124F3F5EF4D82702D2B4FF99B082B BSK
804,160,803 *5365562F7A4BA6EF7DA214344256854B41FACE23 [email protected]
804,160,804 *536757130DA5BF8F3F75D828B1BA1FA3498A32BC GUYGURKE
804,160,805 *536313A20C801056B8CDF3428936CD0169CC21C8 budtarbell
804,160,806 *536D2170E2DD4080ADEE4FDE80C619B1D19F74E6 [email protected]
804,160,807 *536AC94DF734590CBF837A3B31DBD40468DB3877 HANAN HAMMAD
804,160,808 *53639E8F27F8C5756C494875F00E3599BEC26291 BVMFP
804,160,809 *53609D401868647EF095348C58D153D28962890F bx4qg
804,160,810 *53626A238963CFBE89C1A4A66A3318BD342A3FFA c36me
804,160,811 *53625A65F504F6C740C139D1A00210C13F948B86 C4WWN
804,160,812 *5360B35D9777C54C33E948BAA837ECF6CDD447DA C6w7
804,160,813 *536E17C279ACF2E90298E87E4A8210B1E8433833 C77,B
804,160,814 *536113E22FF93D9715D38BC67319010B9B535368 [email protected]
804,160,815 *5362F390906240923AF64252F8B2B2C9B0A889DD CARDIAL?
804,160,816 *53661DE3A75DF8EC7DA6ACA1303B457CD63FBBDB carlos.ce
804,160,817 *536EA44A25822EF80EF662E34B5AB76AF3EFFA14 CARMELO.EXON
804,160,818 *536B61650A757E1083C086B5B0B9A4CCFEFB2C50 CAROLINE.WHEELER'S.BIRTHDAY.PRESENT
804,160,819 *5360576149938BC7221F7AB600EBEAE5BE34AB8A hemmaksis
804,160,820 *5369BBFBE376B7D22D9D32F1C3747FCA6753F405 HENDLERRADCHENKO
804,160,821 *536D78CD4071944D8E4BA71B605C1D6E8FC74BE3 CEAT5
804,160,822 *5369025C572B02E534A087CF101F92383294F672 ceverger9
804,160,823 *5360469BA12D76F2599AA51C53128264DAACC06B HEXIAO
804,160,824 *536DFCDBBE3EA435F6F0E5530C6C0EBA85EE86CA HILFSSEKTOR
804,160,825 *536365B4EBDE904330B023F3A8DFA0A9452AEBA5 CHAD.BURGER
804,160,826 *5366FF17F0587206720AC55B5D802FB5A35C3699 HLAUFMAN
804,160,827 *536B26008ABE1B405F8AB2BAA577848BA923538B chesterhamblin
804,160,828 *53666D313DDCAEE217C6036E89111677F051EB4E chetangurav
804,160,829 *53698115C0F930A7AA68AB7EB44B9FD5E5E87DA4 HORSECARCASS
804,160,830 *5363623DEFE0EE967470DF04EFD56A8588CE7560 HOW WE ROLL (FEAT JAAK)
804,160,831 *536EA474ADC191B210B1F9EE49552645C0443BDE ci;y2
804,160,832 *536AC358469F9C1E3D65017C19113FB8AF151D36 CLETUSSHILLITO
804,160,833 *5362CCDB48F7DCC3B40402E8E44481805479D68B [email protected]
804,160,834 *536E71ADB0D2EBEC6511ED6A383D1D64AE93BDEF [email protected]
804,160,835 *536D934C0A5BFB8D2F42CB2037BA4952AA4D3B90 clw#n
804,160,836 *536996E923BBF93F55D177D3E66EB81FF03FF0D0 COASTALCRAFTCOMWWW
804,160,837 *5360FFE801530D6D317C11620BD72C3E3054EFB6 IAMMITCH19
804,160,838 *5366977E2070E419B6C1D1E67F421B35D6E970C3 coltranecoyote
804,160,839 *53660B32AD0A319EF37AFAA92BD1CAEA314AA40E IGNACIOFELLI
804,160,840 *53662E350AEC593B7AB45049C3B7C5E6505491B2 IIFUKUMING
804,160,841 *536F6DBC52C7B72D791249EE85767B39787D1C63 iiiallegrogentile
804,160,842 *5361D6A52003947762A901FB4225A2011B6CFE04 coqi5
804,160,843 *5362614C4A0492F1F8052230FE46FD418BDDDFBF ironustak-1
804,160,844 *5367B3721D09A72E2E7E0739E4E64C6D567ECBAD C:\PROGRAMFILES\MICROSOFTSDKS\WINDOWS\V60A\INCLUDE\RDPENCOMAPIH
804,160,845 *536CB344577D03EA2509A8B9B17EB1F5242A4AAF IWALKEDOUTONHEAVEN
804,160,846 *5361ABE2720B657EBB6B548A5A743D5671CB1C5D ct8tp
804,160,847 *5361595BE4332B889A8A1810A51E0FF2975FDC2A jaimequivoz
804,160,848 *5366680EDC2EFCB533C544571DC32FED97F113C1 JAKE-ARNOTT-INTERVIEW-THE-THRILL
804,160,849 *53654F39D44E99440FBC52818C2FD42566A1C662 CURVASTI?
804,160,850 *5368CAE62CF1A5229B09F9F26B096B69044EC9C7 CWDW=
804,160,851 *536663CDA59D3985B507703BDA44B005633E07FC jcxrui9nammp
804,160,852 *5368F0072E62A092524D7943EC1A85C84605A79C JERALDMERONE
804,160,853 *5365B5BB5C8D1AAA02C61B866A9E09EB56F93185 JERALDPLAHS
804,160,854 *536CCA4733F1AA54821CC3AB4435F7069544CCA6 JERRY.EIDEMILLER
804,160,855 *536036F2B5EED5F819B67A8E0C73B195B9959EA1 da04c
804,160,856 *5367EF816B14B1B65CA0E9FF8DBB6486E3EAF671 damagedcassette,part1
804,160,857 *536434CC6777C7E9941B47FAF2F6303C8BF7358E [email protected]
804,160,858 *536E7F885C38420302C3CBB9BF506C1EAD5A86F7 danmarkert
804,160,859 *5366D9B402DFD672AA5D54467E17C313B81FE3AB dan ponjer
804,160,860 *53631A6CFBAD5776E0F742D9D9662CB47D402210 joellaallen
804,160,861 *5368ADDD2AD6735F01D89538CA3C657B11C0EC73 darrelldine
804,160,862 *536664ED57C6B960B9981730C6E27D5932BBD71F darrellfiorita
804,160,863 *536D401FFDC04C3DAD19546AC6942BE3872732C1 DARRELL.FIORITA
804,160,864 *536A20A95011E709D02D42C70E348DCFEEDA0259 DARYL.SELNES
804,160,865 *5368C1738AC888579A79B4BA865FB117A27FC510 DASWUNDERALLERWUNDERISTDIELIEBE
804,160,866 *536D6962F572CB30F13138EDA6C3E5D0774B798D JONAS.ALMAS
804,160,867 *536A8A74C0C85A727515963E04626E80B34CCDE3 JONATHANPEARCE
804,160,868 *536C7C239E56A54FEE371BFD21C737EC52D539DF josh.bordelon
804,160,869 *53616B163650CE0A7E85CB504AF8B4F667BF719F JOUAISES
804,160,870 *536F48D85F8E77461B963C31AE6208B9065959CF JULIEPLAZA
804,160,871 *5360058D9F3CBA792751517044AF62F1B7BC62DA DEMARCUSSTANSELL
804,160,872 *536FA5A6759E228ACFC9148EB54A41A959DC8F4E [email protected]
804,160,873 *53695EDB7746F7790DB787CF8DBAC601146F7744 DENIS.FUNDERBURG
804,160,874 *536E92903D84F96A88809A5EB279424BA38BCD24 denk.daran
804,160,875 *53626107C0977C7BB33D6EF37EDB11D123570A28 DESROCF
804,160,876 *53645B564BB28BD765B786A3AD3C17CFD180618F keainelaboratorioita
804,160,877 *536A0B67FB90720DC2973C69C7105F157B5ECE38 d&?fc
804,160,878 *53614B797D097E3B9FB63B028832F429B46D3E79 D%F$V
804,160,879 *53641E43136DD9136206B8F47D2EA45369698C4C DGFKB
804,160,880 *53616870BF3A302B3E2BFAC2EFF43170103BB712 dh.?&
804,160,881 *5361E71EC930855A531371838CCE4B79FB847969 kirsten177
804,160,882 *536DF72531AE2ADA3B614EAD1811BCE42C2D8919 dillaygayee
804,160,883 *536516FBC4983B56CD9BD9FE6FCA46E497586B87 dirkzingg
804,160,884 *5365F7E066E432CD7E3FDC5BA91995B22A2244F4 DISABLEDGIF1
804,160,885 *536241EFDB5015C98FC1F18E61EF3BE5B2EDC3B7 KONTEKSTFOELSOM!
804,160,886 *5367088212DC1FF2F09432BE83D126E1D0E30299 krotensu3
804,160,887 *53646D17A2397716347294B700E0834F37D75C15 KYTJ
804,160,888 *53684E9E28667914758DB9C11212329AC1231CF7 [email protected]
804,160,889 *53645E3D8069FF359D3EAF270CBBF191EA8A36AB LANDLADYHOOD9
804,160,890 *536D2A43332DA8C27E325814BC2B803CBBB57897 dksbe
804,160,891 *5365394744D4EA57BA66807BF0FA6F00834A356F dm?e%
804,160,892 *5363B84DD3BF0DD5FECC758913E3FC580CAC9EFD dn%ts
804,160,893 *5368099FDD109BE665D60C901966AC8D103B17FF lenardhaaf
804,160,894 *536BB7CCFEA6FF448A49724EAAB84C0BEE3C2C9C leonardgrumer
804,160,895 *5360CDD24B56F28E07041B2F5B0E7997C23D9455 DOMINIQUE.TURZAK
804,160,896 *5366B8A310B77F23034573AEDB5CE7D5ED1A0F61 LEON.YANAN
804,160,897 *5367E1DDCEA74DE04602A8B94D3D841AF405EFBC donnellsheley
804,160,898 *536DA3024CBA85B99FCEDDC6CC1394069C3F1B5A LESLEYHARDY
804,160,899 *536AADB716A19909C01010BA185C7348F21B01B4 DONNIEWEIMER
804,160,900 *5365757DF9E4C7AD900AC611FD631E27789158FF leslie.ethridge
804,160,901 *536554F07FDB18D652DEA231B7493D8F3F5D1417 LETTERNMETALL
804,160,902 *536B44A31B30303DCAE64F898BBDD0D2500A8971 DORIS880
804,160,903 *5366B5E7022FDF9054DE854E03BC3B1577F9AAD9 [email protected]
804,160,904 *5368611D2AD2A5BA9188B52C10F3791D6A08E3E6 LifeTimes(60secondversion)
804,160,905 *5365BA4BC22FC4A56497456C992FC67323A8374F [email protected]
804,160,906 *536BC7E1FB01D709603B99387ECD6B61A4D09DCA [email protected],[email protected]
804,160,907 *536C87648939CC3E9927330B3F008F413238C4AA [email protected]
804,160,908 *5367161A329242D554E857513871B844FA9ECF9B lippzigger»
804,160,909 *5360590167F7A36A321496CF4FEF5623DD64A447 LITORALI6
804,160,910 *536A0D3B8855EDCACA7FA1CFAA5F421B86770D0B łoknicki
804,160,911 *536673298030359CB4620B1D6B02482F6BDBFDD4 dts?k
804,160,912 *536A0DFFD4F143B615CD68E05D3BE44FC007DEBB DUAWT
804,160,913 *536CCF0BEB1BC4CD098C5F30BA66ABCCC95823FE lymanpater
804,160,914 *5368F2AF63428E061DDCC38329B85B9ED4453518 DUSTIN-BOLIN
804,160,915 *536FF1634AC86E6049ABC225D94B0CF5304630E1 DU+"V
804,160,916 *53699433D5201E0626253E69A203FBD9BB67056D [email protected]
804,160,917 *5363E954AABA5F51AB1648068188FDA223155B3B management):イリノイ州
804,160,918 *536F03234E4C01A279C0A4E080B8D23DBA93C0B3 manualmugica
804,160,919 *5363A891118C84167E72A675006BA9385E2B3C44 MARCO.ROUSSELLE
804,160,920 *536F73FB2C91008E2EEBE6118E56DB0B83532F37 MARCOS.JASKOT
804,160,921 *5366D7544AAB115E04991D9611DD4C99FFDC3D80 MARCUS.MEDNICK
804,160,922 *536C113D0A472EB7BE995D6A441BFBA210DA6B77 dzaag
804,160,923 *536A82A29F8F721CFA4E562B86343B552A5A8D4D MARILYNY2
804,160,924 *536CF608EE07C98306B0511E782450F2125727FF ECO(L
804,160,925 *536602C1F10E2E6CBC0E25E3401ADF399AC8E575 maryqueenoftheuniverseshrinechurch2
804,160,926 *536C6266618149231861D618B25AFB58700039F1 edmundbrodfuehrer
804,160,927 *5369A389802FCEAEE99B861ADF6D55083C3F8756 MEALSONWHEELSPROGAMS
804,160,928 *536BB4BAF56A584C11338AC2149EB354AF132F0D EEIH0
804,160,929 *53641680E653E494FCA30A855AAB7AAFF2F2E2CD MERLEGIUMARRO
804,160,930 *5366904173095C2BA970AFE1BC22047487E03003 METHYLIMINON4CHLO
804,160,931 *536CB13503586F1B9EA82FB527BF0E6A5FF4100A MICHELBRUNGARD
804,160,932 *536CBC5D74A58C5E50D6A54204B2E8A6FB613E62 miguelewelike
804,160,933 *5364F839750C16B5786CD5EC02B8E48CEA10C39F MIKEKASHOU
804,160,934 *536A784AC66C6C95B177DB4B6A2C0B0BA61C1815 MIR GEHT'S GUT / DER BORDPROGRAMM
804,160,935 *536CA84201E4059A3751D6AA15983046A45CB826 [email protected]
804,160,936 *536ACEB5088A88D1AE02497C1C569C1D8F1B4CCA mi$under$74ndin9
804,160,937 *536FEA5892D249F84827FAF11BDAD3D0D35D9731 MNEXON
804,160,938 *5360F9DF9DAA346356052F955E4FDF1E2CC200C3 modestorieves
804,160,939 *53621AE1EFC8A46083F5884EC8A3CD7CDC81F561 mollifia6
804,160,940 *536A834912B93739A262AC07945E49B28554A254 montykut
804,160,941 *5360D16CE2A57D9F854977267CE710CFC282A018 EIRRDNAR9
804,160,942 *5368EB5E245756B6716C77F0EDD2391357CF6B65 ELAINE DE LA TORRE
804,160,943 *53619C23AB3F1F48EA04DE3E787C5EBD1F955150 ELECTRO41
804,160,944 *5361325D64E9687C5D5706485BD8C7A60E1848D3 ELGT
804,160,945 *5362B3CD1B2195DF934F87E87FD22B5F8DA4F86C mschorr
804,160,946 *536EEC88797811CF0A3C2F4DB394BF541CCAC25B MYJW04CJ
804,160,947 *53639A99848AC2E1EF665D428C6C53B1D005A7C4 EMBD(
804,160,948 *536BA2E83567324078AE954B83BA8BD62DCFBBC1 EMILEPANITZ
804,160,949 *53632AE0C8E2C22099187DDE010BBC361AB7ADC3 NAPOLEON.TERHEGGEN
804,160,950 *53659C5FCFA4C1BCE827E98655255536A77F554F naqiuddin-naim
804,160,951 *536727F5C020B63B5D986B8C2F3E25CF53F9CA23 NASALAVA
804,160,952 *5361B6FAFB16248DAF1D6FF8DDA4429929CED71E natashashipman
804,160,953 *5365D4EB421AC0C7133F90B130E9F61BB7BD2D65 EMVIRATE4
804,160,954 *5369C7BCA2C9DF16A429F94BF276B92FA9C67B6D EN140.138.33.37
804,160,955 *5365F77239E8BEB39B8FF58620B18722B97499A6 NCOMPR3$$48L3
804,160,956 *5367A7ABA94792FAAE70A6C338C501ACCF7C2FA0 NCRUS+N9
804,160,957 *53629A567A215737DB6BE86D613BD957ED970203 ENOCHBEHEL
804,160,958 *5363172D84F101E14284C3AA3727EEE113B5B673 ENRIQUE.MITSDARFFER
804,160,959 *536E901A5C100A8348A73A5DF6300F09C49968FF [email protected]
804,160,960 *536B8126BC1EE3210AE0BFCCFEA7FF644A17FBD6 NENEBELLIPS
804,160,961 *5364C81460C96DA2CA6840007EA33FB30A19D871 ENVUELVAN9
804,160,962 *5366657A2C9B0E7C9C5985AF900845036F66E12B NEURECTOPY
804,160,963 *536506EFD0CC506515115D77A1EC5092F9F65706 NEWAMBASS
804,160,964 *53602E169AA4F924A28F7BC7A5249CD75394E7A1 ERUFFLER
804,160,965 *536034AC15AB2F1F683036271187A6998B02B819 erwinholtberg
804,160,966 *536429631DD24533A6EB4E7E6F7D3BB6FDF69825 ERWINSEESHOLTZ
804,160,967 *536722097958E0276944050EDE719E41334CA3D8 erynn.novak
804,160,968 *5362E763D0594AA795E01CFED0C39551AC15FCD1 nickolasvillandry
804,160,969 *53623B51E44DF99B697AD3C7644691FE61EBFC10 [email protected]
804,160,970 *536603AE4A626CEDA22D83EB0BAB23E04A057EC7 ESSANTÈRENT
804,160,971 *5368DFC3FEFA75B3EF838ADE19D363B901047E8A ESTAAMRE9
804,160,972 *536EC52B98BDAA8256D956EA55F56A3DDF87298C [email protected]
804,160,973 *53673ECA7E67EFC057523F6F755D9CD6C5391C99 NINABESS
804,160,974 *5363BEB04ABFC9D7277127A46390DAC9324797AF NJEDOČINSTWOW
804,160,975 *536D734788C91EF3AEA39CFA843B0A0815DD9442 etelniemi0
804,160,976 *5369F116B256C52977877F70A831EAB30F458BA4 NMPDDLY2
804,160,977 *536FC4A61CB819DA72D07850749C593A8BF9D345 evansville
804,160,978 *536334B99FA774C013A24EC79024B2CBA28DFB8B evelyn.1
804,160,979 *536E51F2540617F0732E461CC4C7F9CE3B2D7EA3 everybody.chews
804,160,980 *536632F54F5C484CAC40156C5EAFA0FD1CD2BF33 ey"
804,160,981 *536F63FADB3784AFB966650DEB2C87041B3A3B62 nousos
804,160,982 *536BAC6E63F01F45711CEFB4B79ABEF317B319FB OBSTAVISSEQUE
804,160,983 *53616C1D80E08CDDA1A43058A58A994F38B4E5D9 flavius i have been bold--
804,160,984 *5362414AEC8E74BE21CD2E763A61E0328EE4FF20 ORDANCHITE
804,160,985 *536C5FF5A95038FA41AF7A89C85AB9BA04547FB0 FORESTS
804,160,986 *5369370E6A86762E29BF61A0703975216AFE3BFB ov3r5trik3
804,160,987 *5369B59FE08BFCA40388FA6B10538D825C37471C p4$ti11en
804,160,988 *5365440747C20B79AE75BCF171EA067B13B67816 FSFCBSW0
804,160,989 *5360CE558E8F530A7603F1CEEF0B4777301AC120 GAAAACTACTACCAGCAGGCTCAATCCAGTTGGCCACCTGCTTTTGAACATAAAGTTTAA
804,160,990 *536909FC1CF7D375E674353DA28138239FB60C02 gadeplan4
804,160,991 *5362A2BA3477BF6BDF7E9D514AC98A2CA0B680BF GASTONWILGING
804,160,992 *536F6ED173A29BFD7E3F6A1F0D9C573EACE4B94F GAYATREED
804,160,993 *536E7B183FC94E8A8E809E709EA94C3246495BC1 GAYETY
804,160,994 *5369DEE2AFC0D11F4E9D5710D0BD773025FEE190 PD.~0.~o.(^_~)
804,160,995 *5364B370A97DD31FD27D028D9381B2B486D5053D pelimekaaninen
804,160,996 *5360C1A97DE02F7241FD5F2311C298956FB4DDFD [email protected]
804,160,997 *536FF3D7C42D7996FC1A59B277770B5D5C9101E8 GILCAREN
804,160,998 *5360AF1EF604076CB921E81800610D142E4B1DAA [email protected]
804,160,999 *536A2EFFB37CD37EAADD781837A231A4649B40F2 PHILEMON Doth-my-lord-call?
804,161,000 *53614966C53033D090737381B3047EB4D278EAF4 GLIMPSEOFKRISHNA.COMWWW
804,161,001 *536BE3BBAE1FA73011A057C6DA9B230F7EA3D288 GLOWING.GREEN
804,161,002 *5365F98E14F7245CB3135A16BAC3EA9A7A92FDB5 [email protected]$ng
804,161,003 *536FD32A0D7AC8A6E84BB658968C0D82BEC4862E P.KUSNIERZ
804,161,004 *536BBE7C4C65B099E90B6EE4606890D1F3C9084A graigwyke
804,161,005 *536893D45784EFAD18B299D62431F61C5B48009C [email protected]+S
804,161,006 *536582E0C9822D95CBEB9C94C9155C74DFFFB75E P#@~O.~o.(O_)
804,161,007 *536E301661130104894AA28F8CDC7262B310DD47 grubegna6
804,161,008 *536B517F69301600E6B6099BDBC7119B9CFBF7FA GUADALUPEBEAMISH
804,161,009 *536C8CF6479CE2EA3E7DBD3D7FEA4B5C71AE1A50 guariro
804,161,010 *53662C4D829AF92029827B407EF6C3E4D72CA454 P======P~0.~O.UU
804,161,011 *5363F1AD2BF8E7FE45AFCD0AB4A3E8743DC6D466 [email protected]@b17y
804,161,012 *53601E406E1C23C34D5678EB9D2FE5B47B07CEBA H2OPOLOSKEETER
804,161,013 *536745CFD04B0CB48484DB105DB544F9D2525C92 halete
804,161,014 *53683D81ABC9A26C961FD6ABB597EAE3A108DA51 HARD-TO-DISAMBIGUATE
804,161,015 *5365C8AA7E9ED18DC5BF77A17F826B78989A6AFB PYGAFR
804,161,016 *53629DE6BF6DE49AA97B0044818C3E096BBC5B3E [email protected]
804,161,017 *5367855C6077542E7B133B8EFC9E4A607CEF1FBE HAZHA-MAHMUD
804,161,018 *536FB55F0F8C726A622D9D3D0CBD50290C9770BD HDH321569
804,161,019 *5368AA5D6AB9E06AE77284F99499376197D05108 QV~
804,161,020 *536670E2F93AF0CB3E72BD01D13A8A3576B68DEB hermanwolfman
804,161,021 *5369AADD514C5AC227682FFCF325310F5292995D RANDAL.RADZIWON
804,161,022 *536057B8FE20DD9B3A5E1344E875B57BD68B63A8 RANDY-SEIFERT
804,161,023 *536592C92C44062971C40D4DFE410C3B361E6376 rashad344
804,161,024 *53669A162119C105941B551B61CDF1883B25C5D9 RAYMONDVOLSTAD
804,161,025 *536E0F7C025849D1A613B068B152B04B0AE86D0F hold.your.colour.(disc.4)
804,161,026 *536DCFA431DBAC5D9817BD7B1C1A56F38FF6DA81 honemeyer
804,161,027 *536E2EE05B7B3C40C781625211268910BDC7FC2D HOOGOPGEHEVEN2
804,161,028 *5366E1966AD3C45B1ADE9C1445A1344BE0455553 HOW DO YOU FIGURE THAT
804,161,029 *5362EDD223D3916B4DEBA5BEE6FFE9248BD69802 HTGOVE
804,161,030 *5360B0274A7F7850DC57D4715C9AAEC208DFE6E6 HTTPWWWKEMPOWSKIDE
804,161,031 *536598B1B4E76F788582E25FBA6DF3B46474DFD1 REINE
804,161,032 *536B17187B9A8B1108595DF5C7A2CB336C444F11 resserrera6
804,161,033 *5365E5A4FF3537CB6AED91520B2287CD8E560D76 [email protected]
804,161,034 *536AD636AEA624EFDF6015C9EC6CF24FFE654F7A RH4PS0D!3S
804,161,035 *53687811B654FD60F352C8BB3FBBEF73E4DDB488 RICHARDGLAISTER
804,161,036 *536C621B7E9AF69627F451AEFB118A7BE3614F60 RINGERLAGER
804,161,037 *5369FD8E07D7232C901A8AB355D38FA2027C1EB5 iaretats2
804,161,038 *53693FC5A109AB84BBCA4D69223DCCDCC0D0BF5B robertonik
804,161,039 *536B10FCC610D75011D388B4DC5AC9CC1D3BBA15 ROBERTO.WEBSTER
804,161,040 *5368F1F080D2051D46C1522B1EC75F8B10382FAA [email protected]
804,161,041 *536D8DFD28A75CB114197DB7B805AA3A44EFAB26 ROCCOCOLAIANNI
804,161,042 *536BB262D8468A8618A7AECE0CF1AF4CCFAA90D9 ibitont
804,161,043 *5368262C7983D31853FC619810D410DA644CCBF0 icafisab2
804,161,044 *536D68EB0E07BDD7BE78FFF284C21C0ADD841A81 IDIOGRAPHICAL8
804,161,045 *536570B835BD4D9B207B3E5914D4E7CF46908B1E [email protected]
804,161,046 *5362ECC07BC8CB4831D1B53D11969F8E2D40A490 ROSENBERR001
804,161,047 *5363905C15E60AB21FAE70BCAAB5508194D978BD rox前
804,161,048 *5368BC4615E9299ECD20DCF0F237D3B7D2EDE459 ILWEISEN9
804,161,049 *536D50BBA62016F98757FEFD22EAF031E18AFC00 I'MYOURSHADOW
804,161,050 *536DDF60F71896D59C3CF7B351AC0619FB7EBA6E SALOPPES1
804,161,051 *536B670FB4C2F509E79B7FE36E46E90644A7563A intradivisional0
804,161,052 *536AB4B28EDD4EC47C1B5F9E957CD38C2DD22E98 IROKESERLENKER
804,161,053 *536ACD11CFC6CBB9D0512FF066D9978D274C6752 ishboshe4
804,161,054 *5360E074CEEEFF90B807B11EB2F9A2D9590796B8 ISIDROWHEDON
804,161,055 *5360D8365CC872EC782E6BFC31FD709700F470A0 ITUUJIE1
804,161,056 *536CF9EB24A8A3191A919A22FDE343ECCFD40E9B IWAKISJØENS
804,161,057 *536C52BCEDA5B1DB59636886E73C91C8331B6AA6 JAIMECOCKEY
804,161,058 *536F1D1465456354DBFFDF6822DFDCE919CB3AA5 JAME.BATKIN
804,161,059 *536AE6189172840FC6DB9267845C1C73918EB49D SGREENHOMES
804,161,060 *5362C8A937DD34B9B33420439A2F6F57888D97A6 [email protected]
804,161,061 *536A4F83FEFE928E18233A919527C13A30F874FB SHARAIMA
804,161,062 *536824DB3670E1EDFBB59176D8B2F659FE248A7C SHAYNEMOCTEZUMA
804,161,063 *536AB6209DF67CC05D5ACDB6A500E95269DD9F80 SHELDON.SETSER
804,161,064 *53601B4461A2BEA652FAA4B6B31E3809839B5703 janet.santo
804,161,065 *53629BFD155B0E9DE914E4284C336D9C8E712FD4 [email protected]
804,161,066 *536CEC8F3E30DEE6D949CC931AB14AAF292069B2 shirleysimms
804,161,067 *5369426987FA3652B5E60E7B304EA99A45C1A99C JAZZY.HANDS
804,161,068 *536E9F82B43FE2BCDEAFAC2EF6EF036BF83D57FB JEDEN P
804,161,069 *536C2F90515C8F6027A709385AF43A5CB3B0D5A2 SIGOLARO4
804,161,070 *536C0EE729F21619B6C131A45C593722AB577E1F SILAS.DELVIN
804,161,071 *536D6684772EB4B548597C53169CD46C0600172A SILAS.MIKOLAJCZAK
804,161,072 *536E88437D7C4B24D122B16FDA000601402B1720 SILICOTUNGSTATE7
804,161,073 *53676974D246B5A346DB9241325B48B6DBB6EB63 JENNYAYUMI
804,161,074 *536B6284CE37CFC868D9946697612EB9D73CB99E SIMAHCERB
804,161,075 *536B7B4A3FC9CA6130713685F85895094885B456 JEROMETAGLE
804,161,076 *536AA45D84712BEC3B67930672FD3CE3553DF92A jeromyhamersly
804,161,077 *536273F724BC848FCC17A5287807DF8622A085F3 jerroldalmy
804,161,078 *536FAB5FEABC765BDB3AEFDE21C24351EAEF4A48 SISABSHCIELGREV0
804,161,079 *536388BB1ABA4A51EFF13E06A459FEEDC19635E4 JESSICAQUINTERO
804,161,080 *5365A71B09B9EE57121BC47C10123F3F27F1499A [email protected]
804,161,081 *536B41587BADD67B898545A17460D7611E5CF52E SNAKESEGYPTIAN0
804,161,082 *5361AC9717B7A81C59221ED53D5099573AADF881 [email protected]
804,161,083 *5364A4446B1596B46167461A700DDD6512745C23 SNIDASANAMETLA
804,161,084 *53655C73C882AE1BED69AEC86EF5B52B4941D8E1 SNOWMANSPARKY2
804,161,085 *53667B216FCD2102A092A6DA06B0CB34E8526578 sobrareied
804,161,086 *53652B552B01F301315626F11DD33BC71A54A75D SOLVERS
804,161,087 *53647695E33C59EE5F6362B54D822D466126AFD4 SON.YERLY
804,161,088 *536685E0FDB3D3D22009BDF25F332CD8055E841D JOSEF.BOLLINGER
804,161,089 *53626508BFF2F0C5BB5B641BE9CF062DB7EB7929 JOZ0
804,161,090 *5365412ABFDCBF69CFCA05F46ECCB1AB9B3E0579 jugula
804,161,091 *53603F567AA92C6B4B3D59441EF9CA947C0928FC SPECULERAI
804,161,092 *53680FC48932FEB80AC8E022AC86680B42F4DEA9 JUN1995
804,161,093 *5364FCD5AEE25B2A08426346139F0166AC058DF7 splat!.~.`.(======p
804,161,094 *53607737CADFC25AAC06E3CB29BA00794B26BED5 Sploit~`q-----q
804,161,095 *536348CFA0D9CE30F1CD3EFC91AB66ECB730038A spuriouslyA:
804,161,096 *536E626D0173FDF74A22C677ACF9ACF63E14AF4C KARTOGRĀFIJAI
804,161,097 *536EC24E6670025E16469D75DA6F400D0EF98428 [email protected]
804,161,098 *5360E8F7D9B35B1D2D2C1C648D66127A0EEF0CCC KAUPSTAÐURINN
804,161,099 *536FCE561CE45BD4DF90FD282AAAC1A909B6338D STACEY.DURESKY
804,161,100 *536A446E621CE83BBA3483F94C0001E0C9B904FF [email protected]
804,161,101 *53600A08298FA4D7EDD2E04F10B51857F62586BD stacie.joy
804,161,102 *536ACD765AAC11EC0EE0DB031B16809D274995FF kcolria8
804,161,103 *536648F59318239C71D408C5376AEE2B753F25B9 keitheure
804,161,104 *5364DE75488F37FCE35A1ED56616E8330F603B87 STANTON.KEASLER
804,161,105 *53643BCF216A6A2543A093C57A1D85B3B374D609 KELNERAR
804,161,106 *53616BEDE1550AA84045E7C2D46DBF4833F68372 kelownamuseums
804,161,107 *5360C42A4E99570DC696D7765F14BF86D8EF9FB9 KENIDUK3
804,161,108 *536E3DDCC80BDCD2F7F40E4533F7140F6D482B78 kevin-teta
804,161,109 *536B82B742A17C9E0C4743BB4E864D439966F260 key-lets
804,161,110 *5363173A47443FC39C01E78002B551533419B767 KIETHLORANGER
804,161,111 *5366A82208E92172191FC2923095E875C9CF55A3 stum8lngly
804,161,112 *536B2AD8C8A107A709B162F3117E623AF091113F KNIKPMUP
804,161,113 *53627CF6B63D091EC2E6F292A94747F05DB5AF6B SULUGUNIOST
804,161,114 *536D246F4DEEFE7B9109F3CAF3496EA70F44AF29 kopercultuur
804,161,115 *5368A3F679A97D0E1756A7B90BE5377FEB2D89F3 SUNSHINBERNIE2
804,161,116 *536DE5A404FDB96AC8EA725DC63AD07EF57BE8C5 KRAUSZOW
804,161,117 *536B7686C07F9F83250B1DA325A70440D76F75DE SWEATBAND
804,161,118 *536322A05AE625FB3DD25298A16C8A5A041D665C synonymising6
804,161,119 *5360079A80E6C4A2A303780C894711535FE00F21 LAKETTIA0
804,161,120 *53652DBA71D4B3DFFA02D2680DE2402224410485 TALOUTEE8
804,161,121 *536AF5C38A83FE2070219E40206186E971D62476 TAMQRAH
804,161,122 *536380365BDB92D29EACA781D4D39AFC175C3DD7 TARBIYYA
804,161,123 *5365F965AC5052485F1CC4A78AA45A25D6DB6379 LAURENROMASH
804,161,124 *5361741A2A3CA4EFA5D0C43B343E3C30E590C180 TE1ESTHET
804,161,125 *536A27E4C9D83C1E3A4BB4748D98BDE7E11F53A0 LELANDPERSYN
804,161,126 *536C5238767643998CA2FB4E64FB9056E5EF409C lenplathe
804,161,127 *5361D4258FBFFBC28A26866A2BC1357A9E846072 terrelned
804,161,128 *53643A1B45F11EAA45F83F5CD70427E6819C59E5 levi.hoang
804,161,129 *536AE2D62C8C041DADDCEB56365518A499DA7CEE theintegra1994
804,161,130 *53646E5387F7D7F1BB9D1CB5BE42AAAE449AAEE9 theme-of-s.o.s.
804,161,131 *5367081BA58E94C9D07E6EE08E9E04EE79001FF3 lincolnmavins
804,161,132 *5363F1644E55F784B7A25F1F5090058B36B2138D lincolnschoninger
804,161,133 *5360587F47B643828AB2B444596092748F72780E theobromaoil
804,161,134 *536F68DD80727935B82D28294C7E6B0E45C5605E THEOGDENCENTRE
804,161,135 *536047C7776799190384027E59BA8E9780516212 LITERALIZATIONLITERALIZATION
804,161,136 *536FDB4C62CC7C4C4DA41D6ED073ADE783641D36 literatuurstudie
804,161,137 *536ACCEE6405E6F5A06098293734B6E9CE1C316F LOGANCONSUELO
804,161,138 *536A5DEDDA0677B9256342F72B2AC438CACE0F5C [email protected]
804,161,139 *53632CA0A067399EAE1B81F2D410F00357A023A7 time-to-sparespare-tire
804,161,140 *536DC11537225F1B282393D867506EF9CEF70278 TINCHRISES
804,161,141 *5365D61085A5423500165AC74F7827F25B51857F [email protected]
804,161,142 *53639C98883405AD0E50ECEAE0DFE5A08021F33B tkjk
804,161,143 *5362B3B7061E7B26D28A6D82EB6EB86A056EF079 TNACDNAH0
804,161,144 *53658410CF6D5079C378F993752F3B789504B9EC TOMELLAMAR
804,161,145 *53658EB9D3A1C5D7DEC03DF0BB7DFF9EED1EB96E LP:MISS
804,161,146 *536549A48D32AE30CC707D4E1C180974A25219F4 TORYCURRENCE
804,161,147 *53623201D6FE46B94BE94C2E91D04A2A35EE6FDC toryseard
804,161,148 *536CBD431711E2702B5AA0A4B87B0FE6F72B9C9E LUIZ123
804,161,149 *5363BB76C8AA48132D2126C702669D209361D38E [email protected]
804,161,150 *5367859DA54E3D5EFBFCD2A02CEA3FFA22848FD6 [email protected]
804,161,151 *536667B47BB6ACEAB738F521D8E2E37DEA2B6F22 [email protected]net
804,161,152 *5366E00A68E0F35FAA122D467541B6BA5C30BFD9 LUPIN.THE.3RD.'78.-WALTHER.P99.MIX-
804,161,153 *536849618415CC3FD183DF0CCD8BA1F5822FED29 TRAVIS.ROHS
804,161,154 *5362176D8D5A15A8F0287EE3419C295C4710B295 TRENDELL BARBER
804,161,155 *536F52AC5E51278899E1BF7355632ADBE6394B3E trevor.odoherty
804,161,156 *5363881B059651C1E55229954BED74FDAF61C76D LZ-#
804,161,157 *536C5F2A743D28710E1F09ABC8414C52BF347BA1 M80-TKR
804,161,158 *536D33BE33130EF4C9AA7E2DE52EEFAC5754389E MACIT
804,161,159 *536340FE882360778819EA7526FA0717AB4095D7 tristen-thorp
804,161,160 *5361516A404B31FEA09F980A5E0568B967352468 trompeurs?
804,161,161 *536442FEE1CF93100E04A5822C55E894C4460100 troycirelli
804,161,162 *53671F8AFD930BF9E350540F055185D1DD6A3499 TRUMAN.CRAPP
804,161,163 *53637D23FC21DBD0FFC28FDBF44F09D45BCDBDAC TRUMANPELLICONE
804,161,164 *536233EB7D15F831E4ABB304EA697DEB9A8CD62B madschids
804,161,165 *5367CFDEB2A93ABC6B80D4ACA94F79B87103B70C MAGNUMPICKLE
804,161,166 *536384CB1C8D4450CB7773579EA1B1597063F491 TUIKKAVIA
804,161,167 *536FC0809AF1638441811DEAD589E9EBD5599B14 malikgavia
804,161,168 *536ADD86EC72F0AF138506B64A8252E5BB2DD7A8 malyschin
804,161,169 *536ADFCB277AA478C62672504C92DB2D15E815A6 marcelbeard
804,161,170 *536E2F62C6BA4C0D09262D4E630C222CCF1DB09C tylique6
804,161,171 *536A2FE34B0A6713788F45A2628FBEE1DE34D199 tyson-dai
804,161,172 *536F5713D5475AF1108582D3D234EDDDE4E957FF UEFJ
804,161,173 *536DBA6C64858CAA622360197F5152098796F9B3 marcos-valentim
804,161,174 *5365574E8FBA3420F10CE85777B369E124014CBD MARGARITO.ADZHABAKYAN
804,161,175 *5360B872643C5AC75EC24E81136C149B4E37DD9D ukrajinced
804,161,176 *536E30B1DDE4C0A068DF82EEC8E24E41F65D3BDA MARIONGLOD
804,161,177 *536CEF369C3F295BE3CC5658DA37C29CF0C0803B umq~
804,161,178 *536E78E69EB10C0E3E2F354836568BBDB1ED6131 UNNATÜRLICHTEIT
804,161,179 *536C66A47DB262B59265FE2504C307F2B8CA9ACA MARYJANN5
804,161,180 *53606036CAB99829D863DFBBF2C160955A11B95A UVAKULMA4
804,161,181 *53604846771308F4A65E51D165F3F402B42EE1AF [email protected]
804,161,182 *5360B79894F519B80F45BBCC18DEA03B8C009EE5 mattrodewald
804,161,183 *536FF479C2FBE44288AA6B961F76014B5A543E98 valeciacarlisle
804,161,184 *53692C29FC6D481FD524E5A559360FC8C2478147 VARAMAHALAXMIWADAKANNAVAR
804,161,185 *53677CE5ABDFE540CD07A9DBA7888450D92C76AB VASILIOSBOUIKIDIS
804,161,186 *53657419A618D8D8963E94313543A8552230318E ventrilateral?
804,161,187 *53695D3AD02E136F5BEDD34C69E558C7A2A5871E merriam.soliman
804,161,188 *536A8DA6FFCB8328BC4182724DCAE880D2D47DC2 verzekerbrieven8
804,161,189 *5363503A7C650B86410DF3DAF953C5281594B30A MICHALE.PULIAFICO
804,161,190 *536751DBD39D983A9BEF9FD708B4458420EE4775 MICHEAL.CARTON
804,161,191 *536A54F9574CB4F3E6E8EA6144359423FC0B3809 MICROCAULIA
804,161,192 *536155A869D0D4E002D86D7D4D43A965C3F8E32C VICTOR.KAUNDA
804,161,193 *5366D5F5780625573506ACDCF1390B14FF7CA7AA VIDADECOLORES(FEATWYZ,GUANTEBLANCO&ALEXISTOSCANO)
804,161,194 *53651AA81C0FFF7A90C3DBBE34E5FB8BDD09EFDF MILES ARAGON
804,161,195 *536FFA3BB7B22EE0FA734B5D5F42D431E2FE756B vincenzo.presutti
804,161,196 *536D24FC54AA13A1AC35CBE5D92C549FDDC1A247 MILLION.SELLERS.18
804,161,197 *536CAEF5A10A4F86B2BA9DC586C433AEACA4AB16 mimiadams
804,161,198 *536C96CF36FA806FB8F7726D4403497E0C92D886 MINDIPTA
804,161,199 *53698B89F9E84494C61423C4F2E5ABC7C1B81C01 vivaro.romano
804,161,200 *536B5434D200C614537887F62025E4024AAE0AA2 vivir.para.esto
804,161,201 *536280EBA1A7BF0688AF9FAB66BF9F1E9149978E VOICESPRAISEHIM
804,161,202 *536044C912EA583C903D0622F43481EFA2FCFC49 [email protected]
804,161,203 *53629361685C185B8F890E2E15D104439F0A73CF W00H002U2
804,161,204 *5363A1585563AFC52DFF468F7290D7BC2431628B [email protected]
804,161,205 *536EC0171606479E481FFC85564D0B9E2E01332B mona.munassar
804,161,206 *5363D00EF24036D83982BD5A87407239AD270AFF WANGYAQI
804,161,207 *536969E9EEBE4A34A1821CF4399B3A75785C385E [email protected]
804,161,208 *5369967C96AECF51FCE368ABF5D3C33AED1251C8 MONTY.TILBURY
804,161,209 *536080BA1456DF70DCB8CE13CC3E6ACC0DF13028 warren.aston
804,161,210 *53674393456A5C39C708556D03009D373BAE80B5 WATERFIE
804,161,211 *5363056EE2FBB11B3ACF68554CF041DA3DB7C2BF MSTSIPPCR
804,161,212 *536E7B0DD3CC0359BDFBCE5DB54C1AE897559DFF [email protected]
804,161,213 *536818A5FC77259CEEE5B4306633D505C12B3656 MUJAHID KAMARUDDIN
804,161,214 *53682B8E7298D852D668328DF80B30402FD58064 MULTISTRIATE5
804,161,215 *5362C431C6A99FFB4F95475ACFD25AE0A16E948F welfsels!
804,161,216 *536AA164CD015A447ECE56B65C8439B8170B88C0 [email protected]
804,161,217 *53679E41E17D71064D0CA305D13B8E975ECD6A3C westonrecord
804,161,218 *536ECB32441BABE81AE0409B23B901ECDFC617F3 MUSICALISKA
804,161,219 *536DF3FB3A9559A56AA81FB744FAB40E76986F37 [email protected]
804,161,220 *5363B347FFF0622455916A0F9466BC1AEAC85F7D WHEN.SARAH.SMILES
804,161,221 *536696E731D8E7CFB8B65EF43AFF6642B8CBC725 WILEYTHORNBURY
804,161,222 *536CA51F11C8E871B2C9E2394657304109386A9A WINFORD.SAMPOGNA
804,161,223 *5365E6F356B954BF5AB349E914807D3D86160BFB NDEPECHE5
804,161,224 *536ACBB51636104D5BF452C62FDFE63E983EBCD3 nemmeded
804,161,225 *5368326EED38F0E5C0017ACCFEF800AD73282B52 WSBLEOGD
804,161,226 *5367A547CE3B476755B319AAEB501A9728153068 wwwtancrede-marsil
804,161,227 *5360AFC52AA62745D49F3E5AFC526732D6731101 NICHOLASSPAGNOLO
804,161,228 *536876945662A2067BE147307F5BB9881E5E4297 NICO DE SANTA CRUZ DE TENERIFE
804,161,229 *536D98167A7E886106FCF4EFA12B43E328D9B92A NIHIDJ
804,161,230 *53655B1103FDC1C94637A09D1EB98D1DAC073E5F NIKITINANTON
804,161,231 *5362D774100EF5AB31825A394105CE232066380A x"t\
804,161,232 *5368BEAA38DD9D0232DCF318ADE65D6284C16C55 [email protected]
804,161,233 *53665ED538140562EE576B289753804D1FB68803 [email protected]
804,161,234 *536517A91EB2638D3EECAC94E25882DD71A27D22 YEIE
804,161,235 *53603691707D6AADBCA4031CAE0B29C07409CB9A OBELÝNE
804,161,236 *536F903F30CA7F33451E9527811DE46847403295 ocimad 2
804,161,237 *536393B675F71BB21F75315DA055EE5B30816E4D oiias8brc8t5
804,161,238 *536DC7ED2D7A5B301E14B807C912A8BC93B72C52 [email protected]
804,161,239 *536ECF162675029BC5FEA472A162A7C89083DE39 ZACHARYDESMARAIS
804,161,240 *5363B7E1E2223CC21526622976E3D0E30B2C881F zaderick
804,161,241 *536A6741CB0AC71AEB509FEFCEE93852AE9EDE27 zaid.oriff
804,161,242 *536290EB825344E132C8434834692F0BDF1C8CFB [email protected]
804,161,243 *53626DC60958B54BE097A476A5FB955A7E073DB3 ZANE.HICKEY
804,161,244 *536E3EED14154A58125469F69063775ED8A2D149 operis-processio
804,161,245 *536C82207C66CA35E23987B6CF6FE71716462F87 OS 1 BWV 1066 C VII PASSEPIED 1 & 2
804,161,246 *53634BC2C7E7488CD2B2407531AEE0F110372DC6 ZHSHLZM
804,161,247 *5362DA7D8E0064136BE1B88F8F4AA1E493658D8F OTTEMETHAN
804,161,248 *536BBB150835DB72AD44A14CCD49DC2EA6CA79D1 OTTO.HAER
804,161,249 *53648EB91927CD1A8D4D4A4B859557F475443B2E ZINKENNEKNIZING
804,161,250 *536E67CD0CEB4BC184A4AB8DA1D0C2C55FD55890 Zion's.Camp
804,161,251 *536D55D74353BB67FBE56FC6B5CBE7261907061A ziriac
804,161,252 *536FBF0372D15127D18E70D9C9CCE728065299DF OYOBI
804,161,253 *536FD20C90F44A005A2E08E417548F79B930526F @;ZS
804,161,254 *536135B3F240A315CFECE113CBA5AF7B4D808057 ZWANGSGESPERRT
804,161,255 *53639365571EB87095E4E6E3FF8DFB5DC58CADD5 p)~0.~osplat!!
804,161,256 *53670C8A264DC9CD6E58059F49D2374E17FEB1BF АИҾКААРЕИ
804,161,257 *536C8692A3819733EDF9FA8D9EBB7E6ED2E4C693 PARIS.KROLIKOWSKI
804,161,258 *536B95C4763981ED1E4930B552EE3AD302AB1849 ИММОРТАЛИЗМЕ
804,161,259 *53629EBDB55FDBCA079A5157953C21F6765DF583 ЙААКО
804,161,260 *5367F86A5BC23AE862F6C6F7EE2AFD2033B91335 patrimoniodelahumanidadencanada
804,161,261 *53608F446A454F07EA5F84A900E8D72535598211 КВАЗИДИАГОНАЛЬНАЯ
804,161,262 *5369A400234202A144CA9F2DF09E23D93099799F patsy.mader
804,161,263 *53664B23CCCF2A08259385BAEF8463DFAB80D52B PATTERNGLOBALCOMPLEXTYPE
804,161,264 *536A8D488EB7674200B29DC11F3EF044E237C70F кирхаузен
804,161,265 *536C43D42F4ED0015B8D3A8D2C5600516016F161 [email protected]
804,161,266 *536CDC91AAAE94CDF24462AF1EEE7C733CD66480 pB `~ `~}8{
804,161,267 *5360C3AE0217F9C0DFF48A1DE3C40CABE25455A6 ПЛАХТОВАЯ
804,161,268 *536E4A6005F9108D2CF2FBE91EABCE35CA073071 PEACHERINERAG:59
804,161,269 *5363E36474163549613AFAAF8D24802022A25D34 PEHRVN
804,161,270 *536C646A0C77FDD6BA418A4091FDA3168600BACA PENNYGUNN
804,161,271 *536052DC3D7657207863250C87E3C45C19088945 PIERRE.HOLLORAN
804,161,272 *53682104E4F69BFAB861496C1B6DA0D0A1D7EB46 。但我中文維基百科上未獲得BOT
804,161,273 *5360EE19A7439F05D5E9F6677B33A9C62D2F7325 PISTAVIT1
804,161,274 *536C75B203B6070C3AA3D6597EE97805C041E474 P)~O><
804,161,275 *5365903EDBC5B715F6E705EC8BDC2AD867931431 P##@ ~O (O_-)
804,161,276 *536B93752BC20A7824F09CFC81C3AFFC8CFBCE7D p------p-`~-`~}o{
804,161,277 *536A5BDA2DB6DF9ABAFFA5018406E88D4F0BF62D PROPORCION
804,161,278 *536D4BDA0B040AAD2A60B20E7572CC81A261F30E PTDN-EN037
804,161,279 *536A8941B3729D74F149FCEA879A186082CD7FEF PUAH.HEDZ
804,161,280 *536545460C7754FA4223029B2205278B7C0C016A [email protected]
804,161,281 *5361E33CB1770E0919DCABC0337D029F8EC4D9F5 [email protected]
804,161,282 *5369F2A900B4E3B308EA96B778EC741754C69781 [email protected]~0~O><
804,161,283 *5366DB60BA1A662389FCA9EF575BA0BFF1A75DE4 [email protected]~.`}8{
804,161,284 *53688886A0CD90EEE95E7DE25649BACD1F010817 [email protected]
804,161,285 *536EA50A62157D8459681F6322E4D8748D8261A9 [email protected]`~.(o_)
804,161,286 *53650381FC2F073C07F6E97CE96BD6ADC9BDA38C q###p`~-`~)x(
804,161,287 *536A667BFFEB6F4F64A70A852786589338E8C1AD qu4dr194m1s+
804,161,288 *5366E41705B8EDF7E4CAA5BD63C455D8BD836DDD QUINNREKAS
804,161,289 *5360CEABDDE3B397939FFEDBE4F1B0AE6B1C6B22 r39a1!t!3$
804,161,290 *5363CDE5AD2C644CCB9EFAFC13EBFC082B44776A RAMIRO MALDONADO
804,161,291 *5363B4C5009A80E2CDB421F8B0E8B8B584C33BC1 rana-massoud
804,161,292 *536ED76508075ABF436CF1A83A12DE974C52070F ratchet-chirps
804,161,293 *536E49190B4202ED8E56DB8AD6FE2DB61802E449 REARREST
804,161,294 *536EF3285ED14672F4C5A4C63AEC6EA2955F4728 RECLOUEES9
804,161,295 *5360B4A88F4597EBDF22D4266ACB091694736AFC recorded
804,161,296 *536A9F6990312DE69DE7C45EA302F2EFD8CC6679 [email protected]
804,161,297 *536C7A330509ED76FA02C04D3154AA98ADC18F4B régiments
804,161,298 *5364D709A31B32A70583EA02ECFCF4462C754BDA RESPRMIERED
804,161,299 *53622864A97EB8E9E2BAA9D814932285074A3E3D [email protected]
804,161,300 *536393ACA0E7BCE41B208331064DA9D1DC7FD657 1322630 AITO-KIINNOSTUS-LASTEN-TERVEYDEN-EDIST
804,161,301 *53663F85786453C8CE7536A73EFD9EEA1208646B [email protected]
804,161,302 *536EC05D9C7C318FCE038DC0FFB4DAA3191396E8 REYNOLDSMOOKIE7
804,161,303 *53692EA42FA16185AB74E4C46C8BA5C12C476FB1 RFCCCHULLAIN
804,161,304 *5368D76084CE3F79E8D0ABF094B027CC17F51193 RHONDA-MONGEON
804,161,305 *5368932610E845E6B688F49AC22FA3D9D3539DB5 RICARDO.TULEY
804,161,306 *536EFB66D0E0C94D448360056AF13F4101401FD2 RICHARD VINSON
804,161,307 *536BF08DD77A6336A9B86D2EF405A1FA43DB0011 RICKEYFORBERG
804,161,308 *536665274E1C04A0D117C76315723A09522A9A5E rickiehouben
804,161,309 *5363381EDB496DBA8DA5C647CD25180D918F0C6F rickiemeulemans
804,161,310 *53654AE83A0681849A9E7B532CC6ED1B97B6A797 RICKYBACH
804,161,311 *536E9F9B380CC953F97A303EF1DE38BC91473D1E RN6<
804,161,312 *5362F92828865870D141976F247627CB5785ED2A rodgerdemming
804,161,313 *536E6E8EEA06B595CCE4163606E2BA6E862EFB5E 1 AEPPELWOISCHENKE
804,161,314 *53649AA909FB836C5E6E98CDB710951EEF792455 1ASOHCUOG
804,161,315 *53630282E93AE811206C41BB384AAD85ECC95B46 romancolcord
804,161,316 *536B7541D605AF5E087341DB62FFC333105063D2 ROMAN.SETLOCK
804,161,317 *53657B41F849ED90C7012B15A9097A236EA8C4AF 1CARTILAGINEAN
804,161,318 *536689CBBBC9F894A78F07326DDEB9893CCD33C5 1.FOCA'DAN
804,161,319 *53676E370ACBC398EB08839F3D51E3E8AE4DD92E 1-formlessly
804,161,320 *5369B593FD8F9DCFD973FBE6B4B4C849B02EB5C9 1-GEBUEHRENSPRUENGE
804,161,321 *5364A0EC888FB68ED9C6D6B40453959BD62792D7 rowena.rimorin
804,161,322 *536D7A3C68BB511BFACFF46A4074D6D31815A524 ROYCETHORNGREN
804,161,323 *53647378009B4E6B9F1000318C6EFCC620C13F6F 1helvutti
804,161,324 *5365E67947E3C6EF9D4413A1D6817DD23D740499 RPFL0YD
804,161,325 *536822B82230F569C90139F635B4B19BFCB233C3 1jennings-that
804,161,326 *5364B279170D99927F1B5A6FB887B03051A36BF8 1.jugendkomission
804,161,327 *5365C41A5B2EDCCA91F88C324F6A4A4DB865B195 1 KIIGEBIRGE
804,161,328 *536C0C1A942BE0AAD971DE5971D8CFC5AAB77B68 1KLAIBER
804,161,329 *53622352997BCF4773CDE7463FB88779FD8D9ADE 1.KOULUTTAJIENKIN
804,161,330 *53656CFD432016DC46A249A04E6AE72E2535170B 1-KUVIOITTAISTA
804,161,331 *536FAC0D4BC1FA6093FF401F55FBEE5AF7A033AF 1MILJARDIMUISTO
804,161,332 *536406A0A9A4908006972F337463C9271C44935F 1MYPUMPKIN9
804,161,333 *5368B730B16CDC6920486F5C214F8F1A2FDCA6AE 1 RADLOF'UN
804,161,334 *536EC057003D49ED1C77252BEA270B863BD23FD6 RZEIHER
804,161,335 *536BBB6858D8D8A728E7A89EED6D4CB8E23340F9 [email protected]+13+13S
804,161,336 *536CDD31A53312DDB6B52F4171744C27BAC90527 1.ZETTLE'S
804,161,337 *536770D117BCC9668B0BEA3879D8C453E7649AC0 2005205 DORTWURDESIESECHSTEUNDVIERTE.
804,161,338 *53635F5208C0D34D32B747AED62761D8DEAD4FC5 SABANAWAB
804,161,339 *53649F04F63A402208386C5768EF54A4B84A956C 2220131 VUODEN-2002-ALUSTA-LUKIEN-N
804,161,340 *5364654C7D0C2F16E8F59C944C145EEE67103ECB [email protected]
804,161,341 *5365380516E635DD7B09CFAF6380A37421724984 24 preludes for piano, op 41: xxiii f major allegretto
804,161,342 *5369EA0F288E88D1DAF94A2A4307C4DEDFE44C19 SALMA622
804,161,343 *5364488BD723E8A3C4F3DB09F2C0B77DB31F9B40 2 AFFIZIERT
804,161,344 *53699878A2CC4748270EDB4F4ACB5D45D6591176 samirshehadeh
804,161,345 *5369D1BFEA558E0B42DA82E49298F41A5B2D25C6 2GODELIKE
804,161,346 *5360037A3CD7D2ACAE36E61D0A5647746A125990 2-JALKAKYTKIN
804,161,347 *536A37DB07104A0B38A13384C0B38664E36A639A SANTOREY7
804,161,348 *536584A8A36EF3968EB82C6D53EDDFCEB4242C88 2viimesyksyiseen
804,161,349 *5361D205451905E003671EF4998F6589242DD7D0 [email protected]
804,161,350 *536EEF7DACACD58089815B0FE1DBCB8EE337A0B8 SATURASSIMO3
804,161,351 *536674D36F9115BBF1B99D527CE03DE504957BCD savaşbaşliği
804,161,352 *5366E6F3A86CA8C429205D0B72506EE3D2939DFC 3-ashli
804,161,353 *536EFC46724D9E296EBC6ADB9D5BA617FC89AB81 3EVASSAC
804,161,354 *5367EA18EAC3BA27826F4F1A7562CACD4FBD4E67 SCOTT.ORPWOOD
804,161,355 *536B2978539008515E03100886E298CA54F16DB2 3HUMECTAGE
804,161,356 *53619AC32022A83DF856B91EE871A696AE37FF54 3INLEIDDE
804,161,357 *536095CFB52B6AEA733663588F053C8B67766D60 4248E25BCF583ED2A1B093789C97D035
804,161,358 *53635296EEDAC448AB4E47544EBF1249DB1B35F4 4331-TOISTAISEKSI
804,161,359 *536611F716F62800FE981DFFEBFB2F544D009D88 43kq25bq9o52ag214h50
804,161,360 *5364E5C768AD3A3866EFC9DBBA5F71847B357D80 451jadon
804,161,361 *536BAA2AE189344CF35F32F3DD8291605E92F3D4 series-de-anime-por-estudio-de-animaci
804,161,362 *5367A4028158F09F420CCB31D87139652E9B91C9 SERVICEWHOMPWRAPPED7
804,161,363 *53608EE9E9E197DABDB706E675C155276BEB76DC 4CHAINMAI
804,161,364 *536CA305A7E66839EFE67425E87501C6205B7300 4CUCKYNG
804,161,365 *53639DB2E013D89CCDE88278E48F6028800564B7 4ERRAGTES
804,161,366 *5360337B13689B9D49F8FD06428D0B3FE557ADED 4ILUVBULLS9
804,161,367 *536265C727C0A5A009D9D6F0B187D97D8408CC2E 4.NO-DRIVE
804,161,368 *536494D333DA4CF1F5080F479145007EFD70A599 4OPLOPENDSTS
804,161,369 *536369387C9E227812A3278CC3894D47C88F4632 4osoiteessa
804,161,370 *536D69F1C1A98F12EA94D508292B629A06E2B4CC SHAKIRA89
804,161,371 *5363F75392B74A9B667FB6D798BA37BE74CEA25A 4STNEMESAVE
804,161,372 *53645405167ABE9D11D0B6AD2DD7AC72EE654914 4STNSHM3NT
804,161,373 *536E20C35B78F0DCD3D1762E4CC389138C258844 shaungatten
804,161,374 *53672FC6121DDD347692E437762A63708D27A7FC SHAYUKI160TALK160
804,161,375 *53661F0F9EFC1FC2B8BE87B9EC25A00DA0E4D4CB SHEENA-NEWELL
804,161,376 *5360A2D81D34CE4DB250D4EF5FDB003A5FCA345A 4TNANEMASKE
804,161,377 *536784B4BC8BA891F2BB16AF0ED6A79801D597BE 4VISANICARAO
804,161,378 *53609D5493399D4B5FA29CB4B90CFBA437160B29 5:..5..#..&...eisenhower
804,161,379 *5365CA123C7CBD4BDBC5020F8EC7DA6A989B0588 5AINYDOLLIHCA
804,161,380 *536E04FBB1035A4FAC1A22756AFF0E42DA076F42 SHIYAMALA-DEVI
804,161,381 *53626073787422F408AB0C45827D516EFBCCD825 shkethaed
804,161,382 *536A28496DF49404C5C537BD86DC74228A2A54FB siddegler
804,161,383 *536C32EEF0B35CB07ABC0EE4E7C36F8BE68FBC72 5HITCHEY
804,161,384 *536A0B915830A97698460C0CD3C26A5796CBF135 5ilovekleenex6
804,161,385 *536DC4E6152DA9EBF1B4CDD8C65B9C413391A8E0 5MLANGERIONS
804,161,386 *536427154B34433A8B55E29B8168936D033A24A2 5PINAKIM
804,161,387 *536D655E3977E57427A0F906F02817D28E984F36 SKPPRSHS
804,161,388 *536C3CCD2DFEB0E9ED080EC68BEBB992B1266F10 SLANTINGHOURS
804,161,389 *5360DDBDD07CC6DA3D06B608B082FDD70579DC41 sme0930
804,161,390 *536D75BFE6645273C5421043A05A072CF5A6A17C SOLEILTORONTO2
804,161,391 *53691781D31E23A8393A809FA7BCF3DE0FA262A0 SONATA V IN G MINOR: III. LARGO
804,161,392 *536B6BD2F583D783AB35740C31D9E07C9BAC7611 6CARININFO
804,161,393 *536C3CE4E0FAAAFA9D6C25392DD8134B8C7FF549 6CLEMENTINIER
804,161,394 *536CCA9591A64C96492F3D15A0D9E4DFCB0C33A8 6DECORANTQUE
804,161,395 *536E7F94DB457C7F1BF571E7C7F08F78B08D3A49 sosober
804,161,396 *536F82ACE97BFFFA70E19963C3E2221AECBB8FA5 SO WHAT'S NEW?
804,161,397 *53648E8E1460194859C829DA5C77F25F49AB836E SOZIALPSYCHOLOGISCHES
804,161,398 *5366BFEAD4323761793ACA8F2F5E10146B9B7202 [email protected]
804,161,399 *5363305B015B96ECEE18534AD4AC2CF289CBC705 6IGODDESS
804,161,400 *536051C7439B4D70528FDE4DBCB5E2E593FE9409 6iluvchester18
804,161,401 *536BF21FFFC544FD5522949C5F8015EDE66501CD SSEICEPSBUS
804,161,402 *536587A9924625C4A1AD137D382700413095D846 6TRANSLIBERIAN
804,161,403 *536AB6FA15D46940A9088F9949D4BDA916123342 STACEYMICHITSCH
804,161,404 *53696DB7C921EFDC2F7D0673583F6E92CE159767 STACEY.REUER
804,161,405 *536D35C61979177C7C75119925233A995E7292FC 7ABSTUERZTE
804,161,406 *536799E4E764B859D3BA6A1A722490233A7C0806 STEPHAN.SCOZZARI
804,161,407 *536FEBE66F8C0CDD3543187ADC45CD0ABDE207AF 7BSWEARNESTINEBSW
804,161,408 *536BC6AD94AFC4EEDAE04DBB2DC0747D02C0771F 7CARRASQUIZOS
804,161,409 *5361818D2C48001AD9B4DB0B0C6B971220523BB0 steve.barr
804,161,410 *536DD306F3C1BE60FE344652A1E8FED2376A3556 7fecondasti
804,161,411 *536F18CF4D13DBB094338160AD7833A630473983 stone-senses
804,161,412 *5367D00FD744B713B44028521F9542802C393896 STWIERDZAJACYMI7
804,161,413 *536892942AED36E53D30E9CCF5D1CFD40501A2E2 SUCHANDRA.DUTTA
804,161,414 *53607F3D28603CD96D52083B8A87A8F5D7FAC2C5 SÚDEROM
804,161,415 *536726D55CC35920E51EE455166CEE102BBF248E SULLETATSIRC
804,161,416 *536D3F02D3D66D176CF8BF5363756FC8AF757116 SUNBEAML2
804,161,417 *5368057420AF4A1C7AA898AB65305A6B4D977D9B SUNG.BERKOFF
804,161,418 *536689B31A221738E30323EC34661512D8C818ED SUNSHINE.ENEMA
804,161,419 *5366B83E7C7F58D03B9E164770CCBB8A68CC25A3 [email protected]
804,161,420 *536FE39174D3B39A9681E8D57A01E6375F9FEDAF 7ZOEKFUNC
804,161,421 *536C054F67F9D69F4016DE24386137C8FB02D9CC 8##)~0-~OSPLOIT
804,161,422 *536B11C2143E047EBC937B15719D3DE5D12A68A8 SymphonyNo.1/Pr
804,161,423 *536567CCBA591DE3C31366422EE83837FEFDB210 T58TA1
804,161,424 *536A98F58B7DE8BE12F64C8CA59CE38A1A4DDD83 TABELLENWIKISYNTAX
804,161,425 *536B98312BE4920102A90587E69E6BFCA10123E5 8DANIELMOM
804,161,426 *536AE0A3AC22B1E877EF43F56FAE659D8EF37C12 8GUREISILAITINI
804,161,427 *536ACECB7C487B0C0101DA23E85FF62A7C79BE3A TALKHUI0001
804,161,428 *5367BC0BE71CA9EC210FB39E26313A024EE1A262 TALKPHENYLENEDIAMINE
804,161,429 *536E8AFF0C32811FA712520E806FCAC43CE7F103 8LOSERRAYMOND
804,161,430 *536B935A0677BCE99AF627022B9ABB6FB2239578 8MEDEAFGEVAARD
804,161,431 *53662C2ACD1D8E17DD04286DACDD4CA2B99A1794 [email protected]
804,161,432 *536775BCAFCEA327BFE680571BE0EE0C25245C7C TAMMYCONLIN
804,161,433 *5369BE51A98CBCC202F6BF9D4E7E8DBD19665CE3 TANNER.HEBERT
804,161,434 *5367116CADE4B41EDABB6A0C21C53C0D0AA1BA6D 8SEMANOFF
804,161,435 *5364845DEBF20259C6E3A2AC55E0FE4B7BD05E00 TASSANO123
804,161,436 *536B086BD49050F620199C03135ECE1E1E7BDD56 [email protected]
804,161,437 *536D3AC27DB01950AD79C1BFE7E8A5F8E928ACCF 8VERSAGERIN
804,161,438 *5368E8405765BFC601E729DFAD68730341B0C90A TED.GALLIGAN
804,161,439 *5364590929A3125F80F6C9836DDB23EEBAC48464 972620 makale-aramak-iCin-tIklayanIz-.
804,161,440 *536970E4389817D418060A4EF24FE7055E49B6FC TERRANCEHUGUELEY
804,161,441 *5365967168A9820E2FE3D003DA10EDC408EF8706 terrytargett
804,161,442 *536BDF8BD1800D4930C579387C511E946ABAA445 9EADINACUL
804,161,443 *53674102DAD77BD93FA2A14C710FE6C31391D3F7 THADMANOCCHIO
804,161,444 *5363AD0CB398E9D1FBFF7EB350A39E515300FD79 THAIRBIED
804,161,445 *536816D3AE47D4718CC0A4269DB2EE8325EAE241 9GNINVRGT
804,161,446 *536A8C2D9AFB7908BB371C2751E631E27937F586 THATFRANCOIS2000
804,161,447 *536E4B37DEB1F67B202280B4F37426A7083A4145 the-chapters
804,161,448 *5363C2DDBF631F15762CEE706D552A54F604CB25 THEFELIPE37
804,161,449 *5365D2A38B2CBA534B17D4A21CC4F9184ADB3ED5 9RBNEDLEH
804,161,450 *53614478C5BFC7C30DB83371752F7E426A81A75B 9SIGHTREADERN
804,161,451 *5365C0D76914F675C62C7F57085FB3D31C708745 9SISNOTETTUJEN
804,161,452 *53667D6BEE2621F52999D0AD063049E66C431699 9TUAILOUP
804,161,453 *53671E2DDE95EC68AA57D03839F12AFE02512D80 9VERDAECHTIGTET
804,161,454 *5367E566EE698A1008C0A6918E36018FCED7DCDC 9WINTERSHOTGUN
804,161,455 *536B8FC7011E1A9A67FB3F6DB3ED9EA1A66A8D38 THRILLA(FEAT.GHOSTFACEKILLAH)(BLAKEBAXTERREMIX)
804,161,456 *5369DCB80CD51BB03596C5830E35FD309394E6C0 TIMESSQUARETOWERNEWYORKCITYNYUSA
804,161,457 *536D1A8DB7627D66686EBA79F0E78B648297FBC6 a=8%p
804,161,458 *53675D958FD76A9CE842C2858C63001056CDFBE1 TOBIASVANDYK
804,161,459 *536D25E7FACDE169CD6AF53AD1756DEAE0F94118 TOD.ELLING
804,161,460 *5362F91311D1E5A20D053ED9A0C8C3CB8987602C aaefn5
804,161,461 *5369416C016C5FEA5B120E246A6185CABBA7CA25 a$a;j
804,161,462 *536B7A9ACAA3CA60FB4E266569B6EB73CD93BB98 AAJ{B
804,161,463 *5361C4EC79628E0988AFF08FB8D95E776A509335 TORRI.MCCULLOUGH
804,161,464 *536C8FA88B8603DD1C2939098DD96D37BE1873D7 AAPCOUPES
804,161,465 *536C820DE2349E94E95287CEBCB0B35511A5A5F8 ABEL.ANDREADIS
804,161,466 *53648603F93DF311A42B619D8FACE76BEAC41F54 TRAGEDY-WAR
804,161,467 *536005467F4A21F64D9AABFCFB4CC8AC8E773099 absolutedancewinter2010
804,161,468 *536CB7C00E1ED2FBDBA911690EADF64EBBB2C414 ac7:"
804,161,469 *536E504FD8385017BB4ED711897800EAE424C15B TRETTENRSDAGS7
804,161,470 *53667EB0E8315CD2D3F3647146E1047A3B5D8DA2 TRIBRACTEOLATE!
804,161,471 *53609B96206C1D975C25CE7F5D4EF67694F237A9 TRYYD
804,161,472 *536999F0E5244C02E1A6B05A9D739A49E7BF3D1C adi_mizan
804,161,473 *5365D1BD624E62AB181A290B7252F26242ED3D7F a&efk
804,161,474 *536A724E95ADDBB68EF901C6E078CB63DF47A2DA TYONDRABOLDEN
804,161,475 *53658F0EE11395ABCAA6B057E116DD5F663E592B A!F
804,161,476 *53614DB7697A2DF83446EF20E36E51445E329FF2 tyresegreene
804,161,477 *536E2E22B48F47BE44784530915892B118BE30E9 TYSONPROFFITT
804,161,478 *536A3B366B73DA26BEB7B99B3544C4271496B86C ÜBERSCHWEMMEND
804,161,479 *536DDA50284EBF05B4A3A94F352F09F413E8E4C3 UHUGAH-BISHOP
804,161,480 *536420E26FA50E10BA2BE058904A333E33320470 A:-GG
804,161,481 *536B54E49792D04C0577EC8D64CFD7A1B3D5B695 aglp1
804,161,482 *536D84A361235BC5F4808288F8354C1636B509D6 AI:9V
804,161,483 *5366C63C47AC32A1A114F0B959B89F9DE3C1988E ALAVSEOJ7
804,161,484 *5367FF53C8FA9313FA3FE005D5608BEEC6491A1A ALEX-SWENSON
804,161,485 *536A1B8BD5018672A245EEE9C1524D9050AA6809 ALGOPORNADA
804,161,486 *536C0F6EAFFEB0518FCE83CA710DAAB2D19CD52C V4PORER
804,161,487 *53698E3FE101CCF52335F3804A86A67144BBA433 vaganojing
804,161,488 *5369DE6F122FC4175AAB9775703F8DD5DD9159F3 alri
804,161,489 *536F2329FF2C360EE7269408DC49462697CF12EA ALTON.WALZIER
804,161,490 *536C79B6DED5EBA44116C2E668A183CEEFBE142C ALVAROBLACKIE
804,161,491 *5365F7C9F76CF6CFC23F1C924F2E6B5DA88A4384 AMBERMALTBY
804,161,492 *53648480A727C2DC0B866B3F6E23764B0BE8CEE6 [email protected]
804,161,493 *536768B41BBC7C9D041766C5583494083E2F0DEB andersonpaulhus
804,161,494 *536853384E6425BFE67C7B6B069590EB76A1DC3D ANDREA.ROSSMAN
804,161,495 *536CA6D973A07DF15414D54D2347CEC5F0D3D5C3 VELLAVAM
804,161,496 *5364291AD803030BE717BE3630B43AD11B23779A ANDRESDOTTAVIO
804,161,497 *53647360ADE0512ED548DCD16FE4D2F33A601545 VELSTANDSSTIGNING0
804,161,498 *536960FBF2E31153DA2A9C34F3FB27EC3E33ECAC andyprinz&naamahillman
804,161,499 *53648138ED1803FA2EC5204C32397BD936FE6542 victoriahandel
804,161,500 *536A14F65261DF9FFE3C1B7AE66121D63AD23ACA AOLUTAKK7
804,161,501 *5366F9947A6017D56EA978B0095B3816B9CD3542 A+OU1
804,161,502 *5365D20FAE26513C81E2F8CCB5790B8855264538 ar(6/
804,161,503 *536C5F33FC93E34D1A4A15A7309679BD50BF1421 VIRGILIOKENOYER
804,161,504 *5360306017500E249A8F0F791F03216BF5D6A487 [email protected]
804,161,505 *53673F663839168E7679CF262E3ABF33B5DBC9F6 ARCHMYSTAGOGUE
804,161,506 *5367438DBCCD713FBD5D172CD1F66BA9423D9227 are-you-sleeping?
804,161,507 *536287D911764B983F033525B744BAD1F2ADF517 ARLENFAURRIETA
804,161,508 *53697C83C27459F07EBA3BB41BA8DA0175527B21 ARMANDO.VILARO
804,161,509 *53625AB264982DA5B242E964E3E1170F73D474B6 [email protected]
804,161,510 *536F81195FCB1D282A988BCC93282B9FC213EDCF VOLKSBAD“
804,161,511 *536EC761B7A00D980CB949D611AC304CA834614D as1?r
804,161,512 *5360F9CC23DF1DB5DB3693F02463EE4C10AD1D2E waldolofguist
804,161,513 *536E6EF18742320A7917A65ACB33645B54F21B26 WALTER-HOLLEY
804,161,514 *5367BF1F48D2E2F207EE0A1A4C5CCA19BAE035A3 ATIARAVING
804,161,515 *5363CF0382B8746BEAD996D25CEBDA41D8BE2772 AUBREY.BEKKER
804,161,516 *536D51A1136DF97C38C1C15B1E7C71B23CD20114 auc;s
804,161,517 *5362ADE4CD99185E6A1080EDF144970EB9DA2F0B avarutro3
804,161,518 *536F43A45FAEF77B5CE88EC0BB1AC45023712559 WHATSOEVERFLEELEVIN
804,161,519 *536463218DD2F26E0A6A480C591191CDA706DF3C WHATTICO
804,161,520 *536699F2C6C12D8E2B4F0373AB98027D6BE7E6EF AVFE
804,161,521 *536662E525478251BF1F1F0DAE69B81CFC139276 WILLIAM-FLETCHER-FLEMING
804,161,522 *536E6CF462B07C4AA01C0C30C775C96D77D7D6DD WILLIAMFROBERTSIII
804,161,523 *536778ACF00A2C72CFD45827878AF86F7D869D10 WILLIAM-GOUGLER
804,161,524 *536FC61243AB13E926E59250E9430658D3C1E15A b1h_y
804,161,525 *536E959841C53AA991B28CE1E6C1716DD974A1FA WINSTON.FLAND
804,161,526 *53644DDA365992C02C08F9D31BE9A3662047D603 b5emr
804,161,527 *536A8EEFE905261C682A09BF491C1F2CAB32E010 b> `~}8{
804,161,528 *5367F84D93D9A160D98D5EE3AB0254E40C0BB243 bandera.de.taiw
804,161,529 *536BB63459FC26734438E8BCCC03652E5A3192BE BARBARA.JEAN.WHITE
804,161,530 *536470A3C28285E07426222A4B320EB443685F2A BARILS
804,161,531 *5364A13B15C9E0595285389866694B022EF8EAC1 [email protected]
804,161,532 *5361DE3C3A2C736CC6F179B725D293B349D56A23 barryperrish
804,161,533 *5363E979D6EB83299DEB2D59949C97F8E69778DD BBEB
804,161,534 *53697072BB79B83E1CF7409A4210404D812C6DCC WWWPSIAIUNIBONNDEWWWPS
804,161,535 *536C59BB94476FAA17225F9756F031D202D23888 WYATTRANDALL
804,161,536 *536198FDE28096A141EE7F2A1C8D4C08A25518A5 Be3T
804,161,537 *5368E8C345E7330DA3849B406B2350BAC83E472A BENITOSTOPPENBACH
804,161,538 *53668CAF5A9C8AEC5490E02A1B3025177D140089 [email protected]
804,161,539 *53651EC89347ED2AD335446945372000F0A8EF71 [email protected]
804,161,540 *536B92BAD9E86C6A3D0AD7EC39A199106BA4D42D xifkciuq
804,161,541 *536B99D3D69BE72DB05FEFAC0DD1CA26FAA91719 BERTRAMRICCI
804,161,542 *53672CB7E5BA4ACF325037BF0696AAB6B5812431 xunaian
804,161,543 *536CFBC9931C58AE7F981EA308D44676EB5CC981 BF,BO
804,161,544 *5368DBE3C1889DEEBDB723A858FEF4D380208D33 [email protected]
804,161,545 *536F4B29EFF3AFBC3FDFE881B390375F7F1B0463 bg9i8
804,161,546 *536F95D19964A0B12BCAA60C834F8778BC887012 b_i4
804,161,547 *5363EA1E487FDC7B4B5B12135BF9725ED30B9C32 [email protected]
804,161,548 *536F415616F0F37F7D064DBA0B0890C7F805ACAD YUKINAGAI
804,161,549 *5363459C5C414964FA2D3204AD3BADF3B8247A8E YVONNEMCCLURELITTLEJOHN
804,161,550 *536CF1B1E2916A8A4A6C2F3BE06DB8022B055057 [email protected]
804,161,551 *53632B3802710F01E1929BA39C9B5840DD8242F7 zachariahzarro
804,161,552 *536BECBFBFD77B038149C6CD7712A1E8A1D9F3AE ZACHARY.KLEINSORGE
804,161,553 *536318ED704BEB87EE02CB3E3D703BF1BD146ACC ZAINA-ALQATAME
804,161,554 *536372D99FC4B09E79E709C03B49CFD5C2B8D9EF Z[DE
804,161,555 *53606AA7B04BDD53E20F3D868C8A004E0A793741 bm.cp
804,161,556 *53657B74446024B6DBFED5E6C947FB5F12088FA7 BOBBYEGELSTON
804,161,557 *536A60FCAB2121AE5558377CBBBE77620A9340E7 [email protected]
804,161,558 *5360A7A7859D31F1E5E5383B02841A760A88DC09 [email protected]
804,161,559 *5365C06B7B9637E7312ED9727D4416EFD279EE0B BOJ&
804,161,560 *53641962714BB8078B20D9C1DE0404EC08FD12BB BOLOVATI8
804,161,561 *5360FB14601C6BB019957E4788D8C6629BDE9F17 boom!-shake-the-room-(street-remix)
804,161,562 *5369DBCB939175D16CA432F9B6B179F6A9752E01 [email protected]
804,161,563 *5366738DAD1402A61EFC4B76B5E3F69F2F6BEEAE brandengoldware
804,161,564 *5367EC1D2BAC7F2E3CC83EC17337BB9AEC1656F7 BRANDON.BUCHHOLTZ
804,161,565 *536B9B1E4CAEAB74D466DDBF0CC94EAD363E9866 [email protected]@n5m
804,161,566 *536D5ADAAC078025CE29B4DB3ECCB540798A4524 бутина
804,161,567 *53611DF06F47224C1D821A6D6E8A286DDA3D1F62 ДЮШЕСН
804,161,568 *536A38120916A307D481880E66123F9CB44EFFD8 «народная
804,161,569 *5367C8585614470F11FBFA4AC6CEC5ADAB73A6A7 BuE
804,161,570 *5365FEA4829A83198663449CFED19E0484A32F6E b=ugn
804,161,571 *536A4992047F614C2E9F4D70E5D4964001CCAD2A BURPPING9
804,161,572 *536FCABCE95A636DFBAEFA72185A78E35F1D10CC BVIQP
804,161,573 *536E604F08A61ED6E409496D801FE849183E473D [email protected]
804,161,574 *53629A6B26FEA9A10C6E43F9CE8076A726C8D1B1 b!y-f
804,161,575 *536F20C556EF5789EBB0C20F2AEAA9146C25E961 BYH/D
804,161,576 *536FE57C683EDF0E477F55B557A5A15BED687494 C4WID
804,161,577 *5369329A875DA144D2B27688F4E1778223214559 CALOCRYPTUS
804,161,578 *536CF14ED0A54D8E4D5CB7BAF115F9297830B7E2 CARLOSVESELIC
804,161,579 *536817179B4B1EB1002AAB8B5C4E6B10D6082B16 carrelages7
804,161,580 *5363FF49C25B794FD4F8483FDA60B06E34E45C24 CCJ(E
804,161,581 *536C89AD06640D39E5AAC018813B4E13D5837DFB c$e0
804,161,582 *53657421B8E528F6B5FBB010661CAEA13E4AE3C5 CEU%&
804,161,583 *536EEBB2B80AF0C29B8E855A9708C614E875A760 [email protected]
804,161,584 *536CCB6FADA50B7F38C4E330337AB298F2A01676 cheesemiser
804,161,585 *536E03C3FA1E00B1CDCBC618603813720BDB6545 03211530
804,161,586 *536754FB75E05E6E4454F58065126697DA3A43D0 05C11AT0N
804,161,587 *536C3D01C807E0E45B4FABD9415D206D1B64D146 CHINOA5
804,161,588 *53616A0BD474B8E4EED5932EDD36ECC7F3D962A4 [email protected]
804,161,589 *536E38CD604F3026CC705D18B9B32C57E135C0FB )0(O~O~ D---Q
804,161,590 *5363C31FD6A12DCFE4FF99006434A3B7D56F88AF chris.medicine
804,161,591 *536358C63B6C6C023CE9A3CE8160741852EFB480 1065893 TAXPAYERS-SHOULD-BREATHE-A-SIGH-OF-RELIEF-.
804,161,592 *536D5859A6C5753E4152677519712237EDE43587 CHRISTYHAPPYDAY
804,161,593 *536A59D96EA4DA452F8C8F269B973FF68A703A5E 1144879 the quality of education is a great concern
804,161,594 *5367B7C7CE132B5B6BED7328090484D0B169675C 1146592 USKALTAVATKO.KOSIOMIEHET.EDES.KYSY
804,161,595 *5365300FD9A2BBA0A676D565CBC5DB7B67DC2146 ci5x3
804,161,596 *5369BB18271F58E9E953134F52CD4B5AD1F5947F 122zoey
804,161,597 *536CA2F720FDAD384B881EC4858ABDABCBA576A6 CKKS)
804,161,598 *536D2555A7B56E1C3ECBD2ADCB848CF88AB2AF93 1605683 innosuomipalkinnon.s
804,161,599 *53637C8E76F5763CDE8D8A581C2A6C714843EC67 1644191 anleitungen-zum-ungluecklichsein-
804,161,600 *53660CDF9ECB81A8E9C14E799B7CADAAA80C30B3 1665382 DIE-GFBV-ALLERDINGS-HAT-IHR-ZIEL-BEREITS-ERREICHT-.
804,161,601 *5366DE8008DCC61B6A480C93D04643705C700F12 1687A
804,161,602 *536A9C0C0F5CBD48207553754311B36A0BF156E8 18january1994
804,161,603 *536F0893291E3448790DD1743DD3E0ADE29C1E8D CLIO05CONAN07
804,161,604 *53692E6CCE44A9AD243B4707E2349842A7360E15 CLUBCDSC
804,161,605 *536AE13E315E0463B4ABD77D762B1E7BEEE8FED4 cna6
804,161,606 *53645808E21A8BA13F40095DBCEE8A7E64BC502B cnpp4
804,161,607 *536A6AF840DDFCC93AC64FE433990AA0E741518B 1grundgeber
804,161,608 *536E4F5C58C40E03F951AA7305494E28EA498AD6 [email protected]
804,161,609 *53651C1673D3157EEB028069ACCBDAFCA176635C COLBYEMIG
804,161,610 *536B027E02EED9FE58C8BE36CBCC65B0E70301A5 colemangummersall
804,161,611 *536F770B9C21A92399B90806856F0E4C467F7964 1.klapp-stuehle
804,161,612 *53620EFD7181C1A802BAF53DC504B266D4148684 1.LETTERWRITING
804,161,613 *536E7412248315CD26164990D16ECCD364DCDA5C 1.MAASTORAIVAUKSIIN
804,161,614 *5363185B9D067EDD9EB3FD120CE355C4A9146F22 1marill
804,161,615 *5369A7C7A959A131A5062F4681C89C94FCC71D1C 1 mertaniemest
804,161,616 *536AD36F6D9B42939492371644C5B868DE91F753 compassionatekah0mpae1shah0nah0t
804,161,617 *53639D8B12BCB74F4FC856887595979060E27971 1-NETTIP
804,161,618 *536115CB2A46CE7A73D945163C9DD786EFE95787 1.PAETAANMAALLE
804,161,619 *5363703D1DC368DE2F06BEE9696BD551F5BA213E 1 PERNONTIELL
804,161,620 *536EA7F06D3D3A3A42FFC8753FCF481D34E3CE68 1prosessorikent
804,161,621 *536200EC24FBEBFD9460AE083198BF77773C4FEE CONNIEFALGOUT
804,161,622 *536D53DD8220A1757EE64F4A766AE87847DCB018 1.riistanruokintakatos
804,161,623 *5360E566733912B570702E14C76B6D8638D44C46 1.SCHRIFTSYSTEM
804,161,624 *5365697B21E3BBACD08429D90F64067C0D7592A6 CORALLIF1
804,161,625 *536EAC1DD30EDF83572D4FF675FCB3686D11080B CORNELL.AGRO
804,161,626 *53652AF44BB8E425C0A8947389B299568CDF7D3E cornellphilbrook
804,161,627 *53668F9D069C1985D8CDDDA18D282C941F5BED72 1velkojakentt
804,161,628 *536E3FAF64D613C4D4FACD070491FF438BDA61FF 1Y=AA
804,161,629 *53688E61B4F00014EE8DEC1803A8960B92C2A0AA coydinos
804,161,630 *5366CCE933ED004A95D2E7F4FC306227F4366BCF coyscarcia
804,161,631 *536C8420B907BD579AA2B5A370018E9AD9FAA92F 2-03-1008
804,161,632 *536D8C4E173210E78986A903F5B12C70188A8277 cpo.e
804,161,633 *5367C5DEBBDE52B720D35B3CF1022EBC41ABAD02 24.01.1097
804,161,634 *536B039D074DDEEA0E243F5888DE4F41BDD80ED2 CRC=
804,161,635 *536E57859C5A00AA2BAF9101308D2D7337F84657 [email protected]+3$
804,161,636 *5364E04940B0C912FA4FC92F55D86217D5F9414C CSCOTT
804,161,637 *536F64F6062DBFC1869863034259A5EC084F6154 C_Sf
804,161,638 *536530732006CB31F40B924AF3D11EC4CF7D22F5 CS?R+
804,161,639 *53670880EDB4A165C17AC337EFF65514433DC28E 2eyal6
804,161,640 *536D80972E451259F1299C048D494D7754F91E87 2FTIRES
804,161,641 *5369A65267D75E510514960C52486B16274A1E5A cvg-,
804,161,642 *5364F05ECF54FF85556C696A27A6AF040800DC02 cvpd(
804,161,643 *536E14C7CBA44629FDBDAEC4AAAA52FD0CD6D462 2-KULLANMISTIM
804,161,644 *53623D4A20366EC838C573C53ACB5E0EAAE6025B cwu!a
804,161,645 *536461D31C3442BD91C0996195FAA38D08DC333B 2-swearword
804,161,646 *5369BB4F396B30CF73AD56DDDA45E26928AE65A5 D0R0LISA
804,161,647 *536DB9D49FB417FB6D3C29FC5929C0983CB392F6 30madyson
804,161,648 *5367466AC373FEA0F335C9F1708C5996785E670D d49xc
804,161,649 *536B4258420EEFE78F7F26B6766A9F0294DB4E74 D789
804,161,650 *5363BC6F160331F7D354021EFA6B9B8F2B55EE67 d9onp
804,161,651 *536BC82CE9C04ABE9386ABA027CF5CDA4A08CE88 [email protected]
804,161,652 *536BE703D91916CCF7F3037DCCD8C873C279AF72 3NV3N1M3R3Z
804,161,653 *5362509837BE8AC6451893EA08F3AD264169C67A 3>~Oo><
804,161,654 *53612D8E04C944EE5119D3A60A0F4C916D6B4753 DANGER.(DERMATEK.MIX)
804,161,655 *536E8E9D02308FFD578A08892E44541C1DF36E74 daniel.casares
804,161,656 *536CDF77AAF146F72F8106780D12B8617AB942E7 DANUC
804,161,657 *5366A7A6BC0DBD5D377A635576B6B44DA2EBEB8C dariuszpasiekabeidoppelpassonair
804,161,658 *536731D9B9686E8ABB38422D67C4B7B7AE38F107 DARNELL.MOUZAS
804,161,659 *5367A4B107A19330AF13AED098BFBD410E3A5865 DASYPOGONACEAEP
804,161,660 *5361D44886E6EE63A2940D14B60719BA36378425 day?"
804,161,661 *536954F640C2E1F9BD50E9D247989EAD09C39856 ddrgf
804,161,662 *536ABFB4D857040EDD03BED81C31ABC6BC8C9D33 defeo11
804,161,663 *53673A44ABF5C15380122774D5BC45F8753324E2 DENNISBOWLEN
804,161,664 *536097B5EF6D19E53B36054CD3043B5CED1F6064 DESENSIB2
804,161,665 *53663EAC64E29F42C464B2F39370EC903F48AA25 DESONKWA0
804,161,666 *536BBD786A999366A534A9218F5A66E52C6C419E detroitenshin
804,161,667 *536C9BE1ECB7C6C8DE2E69AFF328FB7437A488AE di4zo dy3
804,161,668 *536DA9889B14F786238C56C5553C024A9F9D06F3 4TILSYNSLAERER
804,161,669 *53689919F2D5446393118E1D8CF41B0899C7E99E 50100M
804,161,670 *536335950ACCAAB6B48DD01C99118B124ED54D96 5 ABSATZSTEIGERUNGEN
804,161,671 *536B285B744C7F178AFF18E691D8D659E06AD592 DJEZIRI
804,161,672 *536CEB08E11ED6F684FF7AED5C586C7BF586DFFC dlfll
804,161,673 *536C1B9987B9045AF1A7BA9767D773896C2CB8E5 5ILOVEHAPPY0
804,161,674 *5366BFB7EF08484D3BC551B39204B6E00B0A6B9B DNYM0
804,161,675 *53640DEBC9E4F2ABD8C48D34471B4CC754223330 5SUPERFICIENS
804,161,676 *53624EE104130552BA4561A70C9BE9CA63AF3500 [email protected]
804,161,677 *5365E140E47A3538D68FF67EC6BBCF9E0E3E44C5 DONNIE.CLEMMO
804,161,678 *5369F49EA5115F3762B71D2A43CAF0D414D34946 DOV3+4ILING
804,161,679 *5367DD2A86D102C8CDDECDADF4F4CAA61CA15BDE 612kian
804,161,680 *53656A2D566FB9A615CD8B06B2513BBAE7153F4E driopide
804,161,681 *536D7B9C1C245BB351D01BF8F791726A28668EAE d_srl
804,161,682 *5362CE7EFC75D918B9376A283B8542FE044F6CC6 dsz+g
804,161,683 *53642B44F042CB1D5553B346D5B7FBCDDD3B678C dünyayiselbassaördeğevizgelir.
804,161,684 *536314C2D5BE0E931E90497F63A697AEB9B1710A Du.verstehst.mich.nicht
804,161,685 *536C52A38B283812BE793B7D2EA4F13B137CA067 6NEZASTUPUJICICH
804,161,686 *53610097A0B769F05FF8D490E0A018511AC34993 d(.w
804,161,687 *536C64593E8875A4612513D4E9B49A7CE9988C20 6SEGLAED
804,161,688 *5362993F445444019B906106D0F340C2FEF849C6 DWIGHTPICKLES
804,161,689 *5360E9D4FC4C563F250373CCCCCDC3A5DE954F1E d+wm7
804,161,690 *536B45BA426857686CB10A060A82A031A5E5BF4E d=ysx
804,161,691 *5361027C7F55B57B836A2421640EA90C3B2AF6F3 dzepn
804,161,692 *5364C439C89096BBE53CB05FF94CAD8A78B3E551 71f972f5f4eadf5b869e29c4ae516b24.askmegoon
804,161,693 *53639A9999DE4F337622BE04E0707E05582C3350 EBKN?
804,161,694 *5363D38535A6718026D29CDC18042FFD812741F2 7BASOKO
804,161,695 *5365D5CDE3EE6769F4B457359D6D7D986BE9C1D6 ec6nv
804,161,696 *53653A8936DB0A285D62FCF470B35AA55B3A3751 EDINSONTOLOZA
804,161,697 *536C35E808A822B2619D58B3E6F3A9C4A8879E88 EDMUNDO.MELOAN
804,161,698 *536594D6C039169BAA0BDF2D545F44422B49513E 7ILUVCOKE8
804,161,699 *5362F681C9DE50CB059589FB9470D0FE344E2C9C 7NDRPRDCR
804,161,700 *53649E931820C4C3C8AE709FCFD9F650EEA81C6E 7NZPLATTE
804,161,701 *536DF90BEBF7ADF247DEE75FE2810A5536C11D0F 7precultivation
804,161,702 *5364FE4EB8BF4FA627BB3BE0B860556E42B7C699 7SMEEDDENS
804,161,703 *536B5DE93689A5DBEA449E1A9557A221FEB00754 7theunited9
804,161,704 *5368E66DB1E7C06D2CAAF64BB30BE12AE7ED0035 7TRADITIONIT
804,161,705 *536F44E65A2C128463A68C6A3432ADAB48C47C15 7YLNOAHAH
804,161,706 *536614B5E43176C8C166144BFB9E729528B5C2D0 80C4A804-C5DD-35B4-87F0-7562853D2217
804,161,707 *536C2D5D05E246AB57B01F296AADD8FA9B9C842E ELANSON1
804,161,708 *536CE38A60E24EACAC373663C74CA90ADF95FA69 elwoodderricott
804,161,709 *53666511EED3215364736F9AE9AC086DED894BAF ely.fuerte
804,161,710 *53650C08C4183823659707739461FCCEA06DAE96 e[m$
804,161,711 *5365D97539F6CB1A34EA4A420A3CD82D81C7815F 8iamjsbach9
804,161,712 *5368A470DD505EC38A5DE6360268DEE0AE42F919 EN60.225.109.228
804,161,713 *536A13E795A60EDC58751BEF752CFB4C16031E24 ENSIEMPLO3
804,161,714 *5364F6BE959420B3DB4B613FABF91FA3ACEE00C8 ENSPARKY147X2
804,161,715 *536C356CE73BEC82BC63E85C34A4677F3EAD3B63 entremeler2
804,161,716 *536810881F86C6E7CBC329E0051458843EAB750A [email protected]
804,161,717 *536983F858DF297D8A9E10F7E2263D3EB51DBA66 8STANISA
804,161,718 *536FFD210806B8B4E014655711A017959F8DA46F ericdiersen
804,161,719 *5367A85071C135F6C450B828AFEA9286F0CD4B0D erickdeorio
804,161,720 *5367C1990722A975C4DE5EB0891B1ECD9FDC216A ericsobotker
804,161,721 *53605AA924B1EB764CA34153E0EE3877BDAB1CAA 8####>***)x(
804,161,722 *5363812483F20825B42D280EA837197AD4DC981D ESPOSARE9
804,161,723 *536C0BFA569D5A8E0BC5E1AE837E44593AD01FE4 ETIZIHCIS
804,161,724 *536456F396EF85066D16D0A7AF0F5FB42AEFA024 ETNIKR
804,161,725 *53603759DAF0CCAE870F18B4943E37240DA9536C etroiteh9
804,161,726 *5360286C047FE5C5403F397C1115A399AD9AAE2C 979782 NURETTIN.KOCAK.KUTLUTAS.56..
804,161,727 *536C4FFCEFB635A6B1CA16BB71D878D32D31CBCC 9ABIGAILCHURCH
804,161,728 *5365DA032D9BE931E21DC77FB27EEE0BB8959513 euugn
804,161,729 *5363FF520C5A52C4F9158157F8A694A02754D315 EWATERIN
804,161,730 *5365C8C07C0A7EE6254C95FEB45C616116F47EF2 9CITRUSFRUGTER
804,161,731 *536C90D4385999AE3D2E6E1AF68B5F0CF768D605 9DESERDES
804,161,732 *536B09072EB76D01BC9D25EDD50AB4A13DE238DD ey7m
804,161,733 *536F45404BCA421EB59DD1E4494F4A494390588A [email protected]
804,161,734 *5364AD15ADBDE5C5A0F2898343B0ABDCBE722B0A familiesnever
804,161,735 *5366570C1EE2689E6B7FDE8F51DDF7D4ADFAAD81 FAUTH1234
804,161,736 *5365F592D567C3665E9895F5DB2203314C7FBFBB FCRAVENCROWS1
804,161,737 *5364269725D4227F1A3F37F3FF226B35B032C90D [email protected]
804,161,738 *5366FFBCD16082C8FFE4D9BE65DD49F120FA4DAD [email protected]
804,161,739 *536C7F744AA2894E874EA0F18AC903D9D45CC0C6 FEDEHAND3
804,161,740 *536244F9A6981F2A89915B65DEB3BD6971E2D311 feliratai
804,161,741 *5363C13EC83A5707C01279975B49B10C04203C31 [email protected]
804,161,742 *5362972B52022ED02CA3E9F619E1E1D0FA81DE3C [email protected]
804,161,743 *536A24D4F39B5DBFDB7D31B07F198BF40A93ED7C FERMIN.VERAS
804,161,744 *53676008776D9E0A32FB62DBDCE132DA1C20F0CB fertigungspro
804,161,745 *53696500D532D70E6A5D3415804731E91636A7F5 fingerab
804,161,746 *536F0CB24F5E6D4F8407C35E1D3231863B83B161 FJORDDAMPER
804,161,747 *536D5153B388EFB01414B61D6178DF2361380737 a1rn4
804,161,748 *5368C536380B91D7D6D1A57811E8D025B5646786 fqbtrkeg3
804,161,749 *53665B0CA745E29A3A4C9B9EF912ABBEED64ADDA fr15ke75
804,161,750 *5364596809AD5C8E14E666FF5C6D327E38BE8D5B FRANCESCA GIBSON
804,161,751 *536A66EA61C6D8F5807A16AD20FF7F0DC91E100F francestille
804,161,752 *536158622F27393D7DF72026EFABB87ACEF3CAD4 A9HEHHS
804,161,753 *536163CDF935EFF04F1C1084F3EF8E9E4F2B0DD2 aa?]%
804,161,754 *5363ABA868966493C07352B1D4F8C9C96C522EF2 [email protected]}T
804,161,755 *536387C438EFB15520179FEE68B4007E23DF83F1 AAD8;8
804,161,756 *5365CC716DD1C6641A01450B26080A7DABA3ED00 AADML
804,161,757 *536C9B6DA16F4C1685C3BAA235B8C6299EF93BAA [email protected]
804,161,758 *53609C6AEFE56D03D27A9B326568099901D81A95 fukudomis
804,161,759 *5362FDF153EE810A5953BFB34ADA1048F3E6C0B1 AB4J`
804,161,760 *536D7AD9B340E22817F1A791027EEDE0011098EC GAILRENSING
804,161,761 *536CAB2A8A3859271FC815E203C53396C94383B9 galenpedrotti
804,161,762 *536784A6E10CE18705247BCCCC7073EB12E861EA ABURIJAL
804,161,763 *536A7560E13508171F272356ED527974B43354AF GAYLENEJONES
804,161,764 *5360088FF8E29F14F11D22423F4A64548CBEC17D ACONTROVERSIAL
804,161,765 *5362C9B21D32DC75EC7E3CE80275DE307F64DCC3 GEOFF-VINE
804,161,766 *53677C4CDFDA486F177AD8C9549A39CE3CF57808 adhidhaasyaami
804,161,767 *536E92264A0D01DE579BB4A80057E92AFDB7BF7B GEROLYNN8
804,161,768 *536C2C5B58BD917C71599F8251998631507EB967 ADT!$
804,161,769 *53629830BB82D721D8AFEBDD6A43271E47C3C8CA ae;yt
804,161,770 *5369BA19644306AD266FB33B0501B27EDF3AA69A GNAWMARK
804,161,771 *5367D60A67BA384E4C01E1FC49FB427958FB484E A.GP8
804,161,772 *5366165BC919CD2559E54E642E6BD76B07A16679 AHMED.STANCATO
804,161,773 *536CBD679E67B96DBB6B729FA477A6E138EF8094 GRAHAMGRENNAY
804,161,774 *53654968868364B2139A03F0569946CD18F1E32F GRANTBARTHA
804,161,775 *536A198E0ECBD0CDDE4AA927AAB842DFC63FEE21 AIH,6
804,161,776 *5369C6730AA0B535D655C0AE2A91C89FB730D297 [email protected]
804,161,777 *536C6742481EFEF2BBAF7DB85A25EAB490E21133 AIRBAGSTOFFE
804,161,778 *53652E31827ABC9BDD21381BC0919C239A1CD500 a&l6o
804,161,779 *53653F7BB0CEE421CEF42034EA5E0465676D8E44 [email protected]
804,161,780 *536CF59627D443B39A64B43C785DAADDB73C697E [email protected]
804,161,781 *536BB5AC6BEB3CE8A96FEEC8416E4EDCB374E55D H0MM
804,161,782 *536FDD368E549275319AD8DB0D39305F03A51D76 [email protected]
804,161,783 *536ADC76E2EC68766A971AFF8DEB98BBD78C3528 ALFONSO.GOVER
804,161,784 *5361AD9B8148BC2B40FAFBE77958C204BBC11F95 alfonzodoub
804,161,785 *5360205AC01FC5AFE63A2DEDBB8E7B9C14792846 Ha1f.c1os
804,161,786 *53646D05EF09CF2A0DD6BA86280321A40CE83C7C algonquin4u
804,161,787 *536467F22693072ECF66EEBF1B5F1C12E770B2B2 ALIMSHABAZZ
804,161,788 *536C45A3AEA2072A31BA2D30E02C36DDFEC32A8B ALLBYMYSELF(FEAT.50CENT)
804,161,789 *53623B4DC37531AF4871759100C1588CC8B4EB9A HARRIS.PENDOLA
804,161,790 *536C62374D8A995BBEC9B20D9BDFA4DA9063C3C3 HARVANEK
804,161,791 *5362B1E83FF1778D3AAFD9007C02DE565EA1AEA1 hb2
804,161,792 *536E2390F002EC47962963E889D60194B9817481 ambroseconditt
804,161,793 *536CF76F6E32C58CCC1D25F712F0B7364E8764B1 HEATHLAZA
804,161,794 *5361672A56E0B95774165846BCB97156298E425F AMORVAK
804,161,795 *53656207528534CAA08F558F6C817E23BAE29390 HEMEL160HEMPSTEAD160
804,161,796 *536ECF79AF2211DB1823BA464A1429388448DDEC an;-
804,161,797 *536D6F2E8ACE15FFC787961CA35C38C268446530 ANCHIERT1
804,161,798 *53666760FDCFFD6EEC3C2917EEB443029A8B046A andano
804,161,799 *53642D3033CFF17E8D91EA41E0AE15E203644BB6 ANGGITAPRIYOUTOMO
804,161,800 *5364EEB68D071C48FD093AA20A890492B65D3808 ANHÈTH
804,161,801 *5365A8609692AD537D8D1BA9DA8FCE737D79B678 ANTIPOREP
804,161,802 *53632C643E19B8DA5B04A5BDC200DA464073AEB4 [email protected]@5+ed
804,161,803 *5364CEDE8ECD1CFC648B22580A3BFE2255E6FC9D ANYTWISH
804,161,804 *5361C376BE8EC9A6FC1508D474AD5506FE154EF8 ao:
804,161,805 *536D6C4DB904BB1583453172561DC97C5A04A1F1 HORACIO.WENGEL
804,161,806 *536C138B440CDF54A9B91AD99A6D9F3993EC89A5 HORSPIELGERAUSCHE
804,161,807 *53645907BDFA00A98F597DFCCD0EE7B3227EFB72 ARABIAN.LOBSTER.INFERNO
804,161,808 *53696837F30D434A1EB56BE8E77AF25235F65BCC httpwww.centrulcult
804,161,809 *5362C55B4C8B26E81616AC76945C3E0EB719B924 ARERTNOM
804,161,810 *536AAF165932A2D7D098BFEDA2416EFC5575553D armenteira33
804,161,811 *53603C10DCD1A77CAF706EE8C2F30DFDCEAF6F43 HUNTERAMODEI
804,161,812 *536865243CC9DE06DFDD499F97EFEA8DE205156A hunterjaskolski
804,161,813 *53655A7C1EE45F46C62C3C15AAF1ECC8CB476558 ART.WIGGAINS
804,161,814 *536521BF4008772438FAF0DF31F873BC5647695A HXMJ
804,161,815 *5367BD9F62298452C2B3013A192FF710437869CA I&?
804,161,816 *5366828663164633624FBEE1A05441DB45416AB0 AßMANNSHÄUSERWEIN
804,161,817 *5363AA283F8C14AD48037F719747DD3A8899701E iansandus
804,161,818 *5369D6DFFB89A60080546CF40AE80DBAACB6891E ia`q
804,161,819 *53681152F9BC400BD7637F171067AAFAEF204879 [email protected]
804,161,820 *5364D89AFDDE0C6AF16E7715DAAA3EEE4698850B I'd.Do.Anything.for.Love.(But.I.Won't.Do.That).(live)
804,161,821 *536457A222C93AAEEEBE37B4334543E73FF3D2C9 averyfaries
804,161,822 *53638C7454F8925B5483EF7C18A745C90F4C610F IDUSN3046437920090630
804,161,823 *5360F73D0210C399DE93CD84B7E29996579B8E0D AVOMV
804,161,824 *536DF07B7634F92F4577593CBAC2F75ED0166835 ILOVEFEE0
804,161,825 *53621AC4814C552DD7267D4CD3C142A8767D3132 iluvgarlic777
804,161,826 *536A0800A29A6D6768F8948BB564C095691D447C ILUVRUFUS57
804,161,827 *53610871CE3E77D8CD5F3042E6A8BC1D47CAC502 b3a6f
804,161,828 *536B66C557C29AADA4055180FA6C20037A7F73F3 BABYPINKY2004
804,161,829 *5366E9A14D242464C682E7A2C4FC9702B5003152 "backtothoseold,seasonedcampaigners"
804,161,830 *5362A747008F90F57794F0E0C3A63692AE1729C5 INTENDMENT
804,161,831 *536D1A9D74174760871E731E0F54BBEE00198B68 BAVARIAN
804,161,832 *5360AC8CDA20D4C4935B792A0324360DE54892C8 isrealcadavid
804,161,833 *536566375593F2E64684E487B6DC5A29224B6673 ivanvanwagenen
804,161,834 *5360F09E96BD5C72024EA0A9A83FD7CB0D55E524 BELLLA1234
804,161,835 *536C56E1C429835BC4EE9B340BEF1838A27F4572 i vote!
804,161,836 *536AD3C682DD15EEB2C44E4179FE666D5DBA7624 [email protected]
804,161,837 *5362367C3C949986EB2296BC69B6883D7F3E8287 ber.dich,.mein.freund
804,161,838 *536F99ACDDF74B543BAC92FA34858BA358369FB4 JAGA_KA
804,161,839 *5369E69A6C793D1B50F5DFA5C97A9C4659378B14 BERTRAM.BINGLE
804,161,840 *536B572804E26E2794B14D1A4CDAE7AC3A52DDFF beschouwer8
804,161,841 *5361C99BE12A0D5F5D048BFC0908527E3CB78348 jake.tuggle
804,161,842 *53602FAD07E24BB7A9B01A22308CA14D5692B911 JAMALRAJ
804,161,843 *53642A6265DDA3325340F9D8706D3CD6C872C7E5 b=_g$
804,161,844 *536AA18F346727EE7EC42410F3ADBD9900CD6FEF JARRED.RACHELL
804,161,845 *536F04AE03588EBF7A37584227B4B74FF026958E BHG#&
804,161,846 *536FF75A0F44FD7C52345CE5164B1BAF73CD1E1D j'aw
804,161,847 *53689268A8A2568270D550657CDD900BF2EC2D60 j.b.o.-wird-niemals-sterben
804,161,848 *5360F69CC09C1F356EC8FA741D5157D7ED2FAFD4 jedlower
804,161,849 *536965E46D5C790D921A79754D2105A105BCAC8B bi,tz
804,161,850 *536F51CFC7C5226BE2DC5210FD5910943695B44A BkGE
804,161,851 *5368C9DCA9346C14EEAC31107519E56D7F3AC506 blainejoung
804,161,852 *536801D7704BB14FD4FB420F774C9430110FE2A8 BL,FX
804,161,853 *5362A6BFE8F8568071374A4CA035A144CCE041B8 JIM.MASSER
804,161,854 *53600F1579765292387DEAAB650C6FCA7E428861 JIMMIE.FRANKO
804,161,855 *536C9DB78B89BB37497C7606E72CA7D0C42C08DB j)jx
804,161,856 *5366702BE9A04733D725DBE604485E6B51EC1CAC BNS#L
804,161,857 *536DB4C6F031803DE6B97575381682D86E992BA3 [email protected]
804,161,858 *53640A728D85F0B9CDA5C27CD10FE1FBC3EDF63E JOHNNIETERRA
804,161,859 *536A356587E16338051001E470EB888398A4A3D3 JOHNNY.MEETZE
804,161,860 *536DA4439CC70776B86A406880FBC4D99F938EEE BORSMAAT4
804,161,861 *536A86BC66E925A61673B2599DA620C56E66BE5C JOJOMONY
804,161,862 *536B63D567E877353DE36EB0749CBD25A338283C BOYCE.ZAMORANO
804,161,863 *5361C412CE679B9F9F790DF095C4F2C0D73A7EEF B&P2S
804,161,864 *536E57E60D1226BDAFFC3FDA9206EAACEF9D46D6 [email protected]
804,161,865 *53603334C7B3DB484A1551361200B1B51ACD1E5D jordankrobath
804,161,866 *5364CF60006A68628A6404000BA70AFF7A5FA8BE JORGESEETON
804,161,867 *5368291CDF1A946617362B414DB0FA45DB45CE88 BQGJD
804,161,868 *5362F5DB3C11B81A06A738F0BB382BD1AD3E0CDC JOSEPHMAEF
804,161,869 *5366619E179E24A39A8D7064C9182C3B38A4ABA4 JOSUESAUCEMAN
804,161,870 *53666C64449A1D50F7E012DDB64660E27881AB07 br9k
804,161,871 *536E2FB335CA417BBFEAA5832A0B6C30444D5E24 bradhilles
804,161,872 *536D26785D7AB1A947B27560DB78B230A50931ED JQ/C
804,161,873 *536E361783D7FA628C0A5C92D3A09BF1610BFFDF BRETTANI7
804,161,874 *5364DEFA0DD045A1BFE1AB161F083057CCE1A792 julesshuffield
804,161,875 *53601D049A7FFACD4DC81FC0A900062944367634 just-a-gigolo-(disc-1)
804,161,876 *536CDAA687E0F64169402F71874EDDC467C72E22 BRODERICKELAHI
804,161,877 *5366CF8257AFDB8E1DFF644CC45276BB3AC3B49B BROOKS.PRESSIMONE
804,161,878 *53628F4B90E0C5D5E60B5C66C9FA0E1FEAF2A556 browserspeed
804,161,879 *536BB44B2B25B1E06138E0C6F206A3254FA9048B brt&g
804,161,880 *536C1177D7F48AC421AFF9B4806A884A8B2229CA BRYCEKOBRYN
804,161,881 *5361C424F4FB870544D74B79E947DF1C0103E18E kavita.gala
804,161,882 *536F38C1A76DD2244ACFD48D795326FCECF6B8A3 KBTUXEBUX
804,161,883 *5362C4F7133F951CA336B2CF883F7EFEE58A8E2B KEENANFLEAGLE
804,161,884 *5368563768839DA4F5B1D4BBF0AACC06D29837EB KELLY728
804,161,885 *5368EC433483E59301596289D78AA1E4ED66BA40 kelvinroback
804,161,886 *53642206CBC7E3AB460B76E141E92B44B3CDE56E KENTON.SANDAGER
804,161,887 *53661337C46DD4E27EED680B81CEB9D81D5C8DAB kentonwedo
804,161,888 *53683FD7E89A2DE9706A5A3250447F0147A38D42 KERRY.RISEDEN
804,161,889 *5369BEC89D083A1AAE40A72F5C5843DA3A3D2C9B KHASEKHEMUYREKIN
804,161,890 *536A966086AB1FB6373EEA3313B3F1F5B807CE06 KHERWIN-MANANSALA
804,161,891 *5368908FCCBC8147F52BCE1ABB0127871C8AC155 khoomei harmonics exercises
804,161,892 *536CDD4E25C5F1E0833AC16106EED8C08D33018F bsmk"
804,161,893 *536AD4CD6A2A3C1BFEE6656369B5E7817BD49311 KINOUYOB7
804,161,894 *536FC554751481141C81FDAF44A086DE1B33D72B KIRAWHITWORTH
804,161,895 *5360CDF33A234A18B25211CDDC278C2CDC0236CB [email protected]
804,161,896 *536B3C90019E9B784DC3A849B001EE07087B4548 BuE
804,161,897 *536237349BE2C34E458FC2A0E9A96A7D3B23848C [email protected]
804,161,898 *53697DB4FB8CB87E5868D7E09EAD874204BDFAE5 [email protected]
804,161,899 *536959A7B2C20F8C355E0B076BC8EA39117E4B04 KORYBARTOLOME
804,161,900 *536C2DAB2CE5D10CC728CECFE0020DB7B19B5CC9 KORY.VALERIANO
804,161,901 *5367198FCAF88940D31778EDE03B9D17CD343D37 b__w
804,161,902 *536DA1CADF3FD0ECD7C8EC2E9DB244DA26D06ED0 BXZKZ
804,161,903 *536005BAD809AA9049CF93E2D5F246B6BD420E7E krótką
804,161,904 *53682E8F32B9941D437F7DA10B93FBD2254BDD07 c1rhg
804,161,905 *536B7F96C5391216DF593C34D4582CDEAA684228 L7ENMINAMENA5005
804,161,906 *5369DA6C2B2E0A3C7BA85B9EA981558C87B8EBCA C3FU"
804,161,907 *53609DF54FB8DDEECE49BB04E9FAD28A8DED8000 C4KA_
804,161,908 *53608094593770D725D8F8822A36F8B2D4516C61 LAPOURSUITEDUSERPENT
804,161,909 *5364C304B4804D45C556A757EFC2978A09DAF200 calebholbein
804,161,910 *536C4131BD2ED2A8815F06A200A73A59B5C11CDC cameronownes
804,161,911 *5362729771A103E72C8A356F6E69878A8E88E020 [email protected]
804,161,912 *5368401A654C75C4B2E0B5D0F120E9D07B56D899 leahzhao
804,161,913 *536D98469855125AEA02933BF9EC044B1E448951 LEIGH.KONECNI
804,161,914 *53602313CFC5AB3327035E9692373C6979FD7FAB LEIGH.REMISZEWSKI
804,161,915 *536E00C056ABD54CFCB1E239D87407E93AFF9F2D careyweader
804,161,916 *536F09DC633DAB5BCA59E37732601D97E3CF05D0 caristia5
804,161,917 *53672F4D2B94330BE0A2219D65E0DD35FE3C0218 CARROL.PASQUARELLA
804,161,918 *5362182751DB2DA72217F8EA88A991345BA94EF0 LERMPONL
804,161,919 *53611A67385E13E846312CCB733577BD704BE708 [email protected]
804,161,920 *5362178E13576FE8E2CCDAE0FFC326BEB981B6F8 LEVISLATER
804,161,921 *536D20074ED6FFD11A0BA4AAF4C8F4843ABEC6CA CatWalk(feat.LeeRoyParnell)
804,161,922 *536C16BBD6E2AC89EA53F66466D9F4F36D4249D5 [email protected]
804,161,923 *5367D9DAC088797BD1272DD7C1CB1AB4CFD18BB3 lithuanians7
804,161,924 *536E5FB6EC9AC2B39DB00B8FF7787C9A08F3D14F LOREDANADRAGAN
804,161,925 *53631A2BC90DBADB8AF99AF3D98804B4696748EE LORENZO.KIRSCHNER
804,161,926 *53659EBFA384B121819B39DC7AE0238BAA97D200 lost-resorts
804,161,927 *536D84BA6A7D609FCA793B678ACE6D599E6E0143 LUDICROPATHETICS
804,161,928 *536F1527D16C077D50FF11C8652E50C11724FC95 [email protected]
804,161,929 *5365998D715D65B3A3A63AFC72FB78545C12ADEE LYDIARITCHIE
804,161,930 *536D996201E0379F0A0D2DFE8088871D5773720C [email protected]
804,161,931 *536F24FEAE5E7D818648FC128C42273127734CF4 CHHOSTING'-'CH
804,161,932 *5369D5218904A197D131E1DE6106785A80ECFBE8 [email protected]
804,161,933 *536FA7099D8D780A84A80DC4C6F38F39246826B8 MAHMOUDSIFEEL
804,161,934 *5366336124B81C2B030D8FD8C323B6243C73CA27 CHRISWEADER
804,161,935 *53686981048E6DA5E84D98E484B5D4D80D8F1D64 C+I%
804,161,936 *5369684D690423A2F4C81D7CB66F84621C3C6BF8 marcustatsak
804,161,937 *5366FA24E2ECEAD9F86E27A3A8E744F8CDC250F3 CKr
804,161,938 *536599EF9FF679FE5368AB6AE83102C6BA99CD06 MARIOMIGRAN
804,161,939 *53648E9D642F62D8D8F54E5017766DDB3FA5FBC7 maroquineries?
804,161,940 *5368FA153C1DE44796170FEAD8A8678F5FADEF81 MARTINHUSMAN
804,161,941 *5365F82FB467AAF49A99C9CEC26F2E09FEBF8A43 MARWA.ANWAR
804,161,942 *5368E6BA6CE27E6CF7EFB457F293044814DB2063 MARY.COLAW
804,161,943 *53647D10019EB5BE4120774F8D0C43E03F190308 MARY.SIMMES
804,161,944 *536FA0A13E9A06A01C57C08E1E0C29E90072B090 MASIENO8
804,161,945 *536E255202A26E9CD47CB2C7D487BF9A9E5D3BBF cleeserocky143
804,161,946 *53609BEEC9E3373D9A8D29571F420ED0688AD6D5 MATANITE1
804,161,947 *536926F154B61316513733115A4C3667CE947B7C clintonlucente
804,161,948 *536BDE36491504B28B63F68C983D0E22F8F6397A MAURICIO.SAIS
804,161,949 *5368FF8A05E80440EEB3B3C9DDA836F07CD5DB27 mavanessa
804,161,950 *53626C23A4B51336E61C3FCB4776A942C3E16186 MAXIMOBOHAN
804,161,951 *536FB6169F001894221DC288408E648DB8D1C07F CL.V
804,161,952 *536AEA3C19617D6F934FFCDAFD5B36B6E76CD0C0 [email protected]
804,161,953 *536E4F6DBAAF1031D9435A8C75AA1772CCF53DD5 CLYDE.BALDRIGE
804,161,954 *53659A631E4E5690883D322797A8E0862F60918A meetdense
804,161,955 *536452E2B7BEF8C54FB4586C9B5C9A47D13592E8 cob5)
804,161,956 *536D8E7D35898774B2D3709C7CB9EB5B794789A0 c,ok4
804,161,957 *5364C04D86870256A19461FBD4BFAB72D418DEB1 michelle.osuna
804,161,958 *536EF0633B1B4C0CABD2EBA2F13DDEC735969ED8 COMBNKADD031909
804,161,959 *53612DC99C9D49BBC2843F38B9A97142F939ED7E MIHALIERIS
804,161,960 *5365795433E4A791D5A414EC81B32A321C2878F1 MIKEL.LORDEN
804,161,961 *536CF3C0FE0BEA628B24B7D6770C8D9568E3771C CONKERB
804,161,962 *536EE68C93F6BBB3A385A3394E35E231EADFF8DA còn-mồ-ma
804,161,963 *536E3CF9B78ADD41F21A02C44705B798A121709E connie-luedke
804,161,964 *53651C55294AE67E839E7EBA6FB1636AC7470157 MILFORDNUCCI
804,161,965 *536CD4D684CEDC32F5D3D6D9494E0C99A13DEA11 CONSTABULARYHARINGEY
804,161,966 *536C06A8700CB6FBD7978CF1B1F277F17D069651 [email protected]
804,161,967 *536F177A36058A57B25A0BC4928E1CBA5C0283C2 cordaitesekből
804,161,968 *5369A0466690EAA69C570A6BD811FDE03B20993D CORNELL.DUECK
804,161,969 *536A42C75FA9C2616894C4C404629697BE3E46EB minhsandelius
804,161,970 *5361324090C1311D8BA8A0C2653E23B6A0602BC5 MINH.SVANCARA
804,161,971 *5361B44F63018299B88269732E8FCF5D436C2D3F MINISTRĀVERĪTIS
804,161,972 *53644ADEB0D9834813AB7523C8D7DECA65CBA3B6 COXA(
804,161,973 *536A485939C50269AEB42FA937F618B20DC70ACC mnawavumilia
804,161,974 *536E713B017DB6F7DEA658B8E63CB1FB17927C92 cq9c&
804,161,975 *536CE31494C044BEED506BE87B31811F6E51B8E4 MOSES-CHIBALE
804,161,976 *536549E35E89504B00FA49BDC1E080DC9D367D89 crp)_
804,161,977 *5368B4D268EE972E0A80C34C620797F7978368DE MRBATTYMAN
804,161,978 *53678D764482F1ECC5603BBF4211ACD5F4D1AE3C MYLESGAUS
804,161,979 *53667F19C9551356988A1D3FE55904A7C7DB4694 CURT.ULLAND
804,161,980 *53607C327399273AF8603F709D9D3AA7A100BFDA MYRONDORRIAN
804,161,981 *53652944677E03EAD618AD10B872D1CFF2A62BBF myronfranckowiak
804,161,982 *536D7E0D681CA845217BA5F7DA1AFD4235A472C3 N0M4GR3P
804,161,983 *536BAEBE681F450E9B448881AC3F606DFA4B629D [email protected]
804,161,984 *536A4AB6C21B3BD7947AB04CF93045F3E05060F6 N#,AAA
804,161,985 *5365E3365CA1FCC57DA6CACD1891F077F8999EF8 naluat.?
804,161,986 *5360B60138F14A0A5BAFDA596C734C266A0277E9 NEURECTOPY
804,161,987 *5363B05E8E6E525C47675F154E7F8B0A16A50ABF [email protected]
804,161,988 *5369FAA87345D3ABEA4386AEB5784668B3221C88 [email protected]
804,161,989 *53670EA68A6D1993CEE8BDBE24ABD5522C26D27A daltonbicket
804,161,990 *536C3C6E838F2A5C1F63D1D9F59105D8F1F585B7 DAMASO.ALONSO.Y.FERNANDEZ.DE.LAS.REDONDAS
804,161,991 *536D9FDADFA82B99DC4221F2A78A8251B653B8DC nickolasplush
804,161,992 *536BDBA54A701EEB82A9372CFE020E2D76027C22 DAMIEN.GONZELES
804,161,993 *536BA72CB39D23BF8CA75DBF0E1BF267C7C6CFD4 nievában
804,161,994 *536793F9FECE128582EB46DB428C9146F9A15402 DARIOSLONECKER
804,161,995 *536338B740A107F2A161D83B2354F990DE548A4E NINGSZ
804,161,996 *53691B16A3E49FB999F075B07FD0B450752182A1 N_)M
804,161,997 *536EC7E4A5B60C530DA8BD6857111570ADFDC182 [email protected]ER.COM
804,161,998 *53660333977F4C0F05F83CC6A80318FFFAC18155 NNNNVECHEIRATHETET
804,161,999 *536554BE735D1F324F52F0128E60DA7E8706C28F NNSSRTVS
804,162,000 *536DFC2375BA339E11BD5D779C40BE9BAA9ABCBA NOBLEWIRES
804,162,001 *5365DE7A05CC79075138744D4C77889AEF3568B8 dave.weitzel
804,162,002 *53676AE814A946DEEFDB91E2B1743F5BE97E9FCD NOTZEIT0
804,162,003 *53680855A29F98162E2FB7F8B9E8689987837787 ddrgf
804,162,004 *5368C9AA1AE0E232CB7D4590F2467DE4442F0763 deangelocervoni
804,162,005 *536B1B2D290D22CB6C9B938AFD0735275B243ECF )o(`@===b
804,162,006 *536740C0E40046D339120092CB47E95AC091AAF8 deemustain
804,162,007 *5366B50D8CF19B31BBDFB4F3CADD570CFDC1D077 DEHM0
804,162,008 *536F391795AA5F50300DA091F1901E267351BBFB dem4k
804,162,009 *536F43492978E5B0E237C9316D8C9714DF5D878A DEMOLISHMENT5
804,162,010 *536454A4EE3F3633DFB2F0A92AF7B25C0F8A782D olivershill
804,162,011 *536D5D19F18835973B8B241CAFA6A198E47AB55E OLLIE.GROSZ
804,162,012 *53650F0EC4129AE5510161F7E6F2A2F882545EF3 OLOCESOR
804,162,013 *53660CA77673C3889168C543CF03524C70787D36 OMER-EYTAN
804,162,014 *5368895478592B3E1A34DF999F72135723CF4C57 omnipraticiens9
804,162,015 *536D05504DD37A3A99206BECDEB1774390F29FA7 ORETAP
804,162,016 *5364E017F50CA197C0A003BC3F0D3B292792BEF3 ornithocheiroid
804,162,017 *5367B96B0ECF6DA1C1B13236373637DBCE7DD1E1 orvilledelaguila
804,162,018 *536DAE1A2697D57E1FD1807B2E9FCDA461A420BC DGcq
804,162,019 *5367CBC05BFE2C8EC7C8F333A9076A4FD0FECA0E DIANA-MARX
804,162,020 *536FFF85E96FF046C2F46031D722DDBEF1AC3A83 DIANDRA.FLORES
804,162,021 *53677E83128995C15203B8491BA6E6296F4ADCEF dicklucero
804,162,022 *536C612A18139DDCBB05EC6099F9E1C9BF69EB7C DIKERIAS0
804,162,023 *536E7A852440C0973138E3F6412512830D5315E0 DILLON.BIRDWELL
804,162,024 *53669A464A5E4F0D7EE381735CBA49CE4418C271 dillonlucksom
804,162,025 *536FC0F093BABEF555B7CE5D7E96C842F0BE18EE dinouresti
804,162,026 *5360CF108556D31661CD472E3996D95810DC9BFD DIREFO
804,162,027 *5367D7D8EB7AA2C6524559F198AF2264187A2775 ottoharstad
804,162,028 *536E4F3BAED459B93E31F72AD2A66DA5A949AF23 O,U]
804,162,029 *536E174EDF8C5ED11F4AA873A801AF6ADA576E45 djingbur3
804,162,030 *536C4210198AA24213B01C3D28E3F0B305389512 [email protected]
804,162,031 *53630236080CE67E4B4967BF3F061FD3C9896235 PANORAMABEITR
804,162,032 *536CDBD985DE67CCC53AA38313EAAE292E8C12E7 DOMENICBICKERTON
804,162,033 *536513861AF865875DEBEFB0C8ABC44FB565DE1B DOMINIC.BOSACK
804,162,034 *536B6819C27BB51DC81248430B437D0F3DA9C15E DOMINIC.ISEMAN
804,162,035 *5364E545D59268567BB5171AC88B9A4EF2DF792E DOMPUĆU
804,162,036 *536483A345142E6A948FD22676A7DC483887C490 [email protected]
804,162,037 *5366EFF6D82BC6BCDE6967E33BCF9B2E299DAF82 donnkanan
804,162,038 *536BA39A93F40BF770CBD2677F031B74C5A4426C PARIS.GUTKIN
804,162,039 *53603C315936E95943D30D3113364632500F549B don pedro
804,162,040 *536D996A78D84BCD84AE95B8C179DDAC0193A0E6 PATRICKBROGNA
804,162,041 *536E3A563669C9E0664590848075EFFC6626F72F PAULETTAPAULETTA
804,162,042 *536C068253D271F65CBA1CBF164F4A6B0EE2753F paulkounce
804,162,043 *53612AE4CCF51326D0563A0862A94E924A3B60B0 DPCZ
804,162,044 *536A5158472A196923FA775A465BF82337DDEDDC [email protected]
804,162,045 *5369C40C4FF074366351552D15F9E856348D5437 p----d~0~o>-<
804,162,046 *536CD31E509A1D31827EF0573DB7B85EEB889FB1 [email protected]
804,162,047 *536D51E8F5FB9A8E277A0619477C57AF77C3C1FA D&R-$
804,162,048 *5368B7867AB29CAD841253FA8D6593446E3CD655 penshurts
804,162,049 *5366B4D96CE989F9FB2C093BFAC9F288CAF703A3 PERFORMANCE PIECE #17
804,162,050 *5363CC3696962BFBA8374B4D43CBA53FAB4DD8D6 drqn
804,162,051 *5361AFF10B1BD5A78C6D181129A622AD266738F1 [email protected]
804,162,052 *53615BBDAC74569CB2CA69D56C88464D7CEFC97F PHILBINN4
804,162,053 *5360D51692D92B7EC7BDBDE4BEDC583A0FF2D6F2 philly-style
804,162,054 *536D07CA2803726946C05D9EA4E3DB125A735747 Dwk:
804,162,055 *5369172EF0201983A7060875753E27CF04F493E8 E1aboratons
804,162,056 *5365A3D752B777CAF9DBF560758EA7EA6EF635E4 [email protected]
804,162,057 *536AFF83D8C848D00C9868D3951360FB42ADEE29 PLATZIERBAREN
804,162,058 *53640DF368893312CE3355319AD0A7C655146F21 PLAY,FIDDLE,PLAY
804,162,059 *53667747C3F70BAECE96520B9A5E71C22D66B20F PROBOJANING
804,162,060 *53684FE57B1C36E03BEF55A2FAE1C76129C3FDEF profe-sionales
804,162,061 *53617406DDEEF591383E7A98914B5297E02A130D pulpă
804,162,062 *536EA620B28BCB0387BF8EDACA96365824440ED3 Q1W2V3
804,162,063 *5364138BCD92E6326C1AF468A374DD421B826FAD ELISHA.PARCO
804,162,064 *5367078A99AD223D1FEC2095B410473E8B3650A4 ELISHOLAR
804,162,065 *536788D6E29098549C21DC7910279F2F7D8B8EAF ELLEAVAITDUPOILAUVENTRE
804,162,066 *536F741DE39113212987A3D93C936D39C0042B1B [email protected]
804,162,067 *5369D7EE0A2A5EE9A0E25532A8995D041842F490 eloualis
804,162,068 *536BA69AB87FE5DFC576D72F7278AE887F966563 ELSIT
804,162,069 *5361CAADE6FECE541B0F1C13E6FD3C49B610647D ELVIS.PENSKI
804,162,070 *5369932329CACD5754988BAD39C73225FCD2C7BF [email protected]~o.)O(
804,162,071 *5366B723D7196E434DE3D35D7CEF17D086E98D3B Quite-Now
804,162,072 *5364DC3F90244C1D0F502009EF15FBC1369158A6 QUOTPANEL
804,162,073 *5363C789998584103C7C2ACD856AB80BF29EA6D1 EN2007_FORMULA_ONE_S
804,162,074 *536E27CC96D801631ED6C6A67D60294CDCEBB66B encpali
804,162,075 *53640AD14392727D9720F25EE47965F14DBF5606 ennollirg4
804,162,076 *5363447CE32A8509F47137D182DA508D9DE39FA4 ENTRETINHASE123
804,162,077 *536081B9A73F39D37F917BD8E97C4EFBFA0AB8FE entryhabit
804,162,078 *53644D2DBCAC6847413CF261185973BF75052735 EPAISLEY
804,162,079 *536451515FF2523486E69269216B153BFCE3B97C epr:e
804,162,080 *53683301E2B87913F4F7780B9F5DD160212F5F87 RCUDBDJA
804,162,081 *536D0D28E466B28DFEEC99EEA90B6B0E943AC907 ERIKAMANSFIELD
804,162,082 *536852EF3F6EFB9B976025D0A182D13007EDE0D2 RECOMMEND4
804,162,083 *5365798A17820F5F458E8E63C5C57560148D4AA2 [email protected]
804,162,084 *5364BC15C47FF05539771C7B5F734A3587DCB65C REGNIPS3
804,162,085 *536FBEB36FA91341506C78CC7E408A611D50E37C eternal-asylum
804,162,086 *5362C8BD660226C22DB38B2C70E10A6CFA0CC1F4 eugenioscarset
804,162,087 *536960AFED900E46051E1F54C3BE877E86A568A3 euquerotudo
804,162,088 *536C16DCBD45256AFF14B4D8FB4902C5BC217B4F RESIDENTSM
804,162,089 *536F996BD89AC6868EA3D1D2E33D831CF089393E RESINICS6
804,162,090 *53615A5D5E453C0661676A04CC992EE9CA8D327A REYES.ALERTE
804,162,091 *536A8416DDDBCAD73296B3CF5AEC82D6D41F9421 REYES.PICHT
804,162,092 *5365F5C86226D7BC3E1267B41426D13408071ECF RFIP
804,162,093 *5368F21197E9DA245DE7770D7FD727F211AEFF08 rickypresler
804,162,094 *53644B8BDA6BA48C3CF105C14874E3E7D1D17AAD rigatonis?
804,162,095 *536599748C63389F17FCB5832E92CA7269C1B080 [email protected]
804,162,096 *5360C8F0BE1D25ADD600CDCC7CFFEA0C1C2D298E RITARDATE
804,162,097 *53650EFB3CFDD3ED0D1055DE5F51509EC9FC51D0 fe.matela
804,162,098 *536EF6D9F783780AD24AA0696AC20139AFD4C82F robtsosby
804,162,099 *536518260AFF4165847E49461E24356F603CE5F2 [email protected]
804,162,100 *53612D1F20755688A2CFA77E36581A9358ABEF51 ROCHELLN9
804,162,101 *53688E57E7A058DE193D45E34F097347D8AE68BB RODERICKSTASIK
804,162,102 *536D0C3A7542AE3DB6F60127C742F3978A7B3FBD [email protected]
804,162,103 *536FB8E18E5F85746000FF9AEB6C19BE37821D53 rodrickbeauvais
804,162,104 *536E14B23343F2590E987B685CACD669C0CFF46E rodrickblackwelder
804,162,105 *536F10B6543521AFC354693D8656CDE81E9A8FB3 rodrigobesch
804,162,106 *536AD3FBAE8496627D25585371A6DA0A6A4522C4 [email protected]
804,162,107 *536AA44355EE485362C989850737622574A8B351 rodrigonewmon
804,162,108 *536FD6080ED3C9FD87B3F065DB290A4511F491FD fhy
804,162,109 *53624D38034793A4D8930F013A5BC579CEB1580B rohan.kanade
804,162,110 *536C25E38C4A989EEBCA87FCCAE070959E8EC65D rolliermaschine
804,162,111 *536D0B2B7A6A63849D6E9CD378BF8995449D3D01 ROMELDELAPENA
804,162,112 *536DBE5B856D28021BE25F48171C15ED5D71B22D ROMEO.MORELEN
804,162,113 *5365E33CB6113DFFEF0481D7BA870F70DAA8FCCD first-groom 'twill-be-two-o'clock-ere-they-come-from-the
804,162,114 *536AFF43341AEB54EF5378B223B5F06EEDC8921B ronnyurzua
804,162,115 *5368780152AD4BEB2B735E8A6B1E95654652D1D9 flaesrom9
804,162,116 *536F5402663AD349A1E0077CAB5C707BB2EE5CFE ROSSARAGON
804,162,117 *536D1C4C9028F55E7A2B89D993AD39B296043D0E forestud4
804,162,118 *536466DA18102A3F389E333C42AFFE1D78AC9EE9 s]<a
804,162,119 *53637501FED37E246641220C2B1B9166C654ACA1 SALESBOBCAT0
804,162,120 *536DB941A5B7616EB22F2227402032986D35BE83 SALMONFAITHS
804,162,121 *536926A1B7E01D9BA2B332298DCC726E2CC66136 FUUBUTUS5
804,162,122 *536D1FF301194FC4755281FF5AD4BF7BDCB9EC74 FVCC
804,162,123 *53650B71F2496951BA0EA4EE25BBF51F4C1F6175 (GARAMANTES)。現代圖瓦雷克人是加拉曼特人的後裔,他們從
804,162,124 *5362E1BF5C338DB8932F380DA9D4BE3A3277C574 s.aun
804,162,125 *536F76191904AA7928261391613E910B1DA90CC5 gaylemalachi
804,162,126 *5365905DA1CA0038AE5C0CE03DBD720AE2AF7F3D GBFM3
804,162,127 *536970DE9C6A18DF3A0602C07E45E900FBF8D3AE gbuttoned
804,162,128 *536D35ACD1C3F0E2BAB1D9F1DE9A0A892E38A3F0 sciencesmiths
804,162,129 *5363B4ADC65DD6DD806FC6ECB567AF47AFC067A9 GEORGEKANOU
804,162,130 *536EA4E5055FA7CC4A3DC92BFB5EE5E53F684528 gersheled
804,162,131 *53643844469BB8B7C2787CFFA0C4EA2C3133F4FF G*HC
804,162,132 *536955F9FAD0A7A75097D593E3DE130F938DFAF0 Go-berserk
804,162,133 *536A92105B83523B434C3C3AA08D8394F27FE6EA [email protected]
804,162,134 *536A4669DE532B3DA383D639C10B7FD75AF64337 G+R:
804,162,135 *536953D059595B1AD9B05EDF490C2B3C0B48E5FF GREMLINS
804,162,136 *5365380C48D9F06A3DF18F81919D59D26903BA9E [email protected]
804,162,137 *53615B5418384007623348A8B560B1112D8DB175 sftballshorty305
804,162,138 *5362EC2AF51DF9573CD0A8EF1CB6923CC432C3B2 shaddoud
804,162,139 *536ACCCF232A36A6CCE1F2553EDFCC97C6696E13 SHADOWS IN THE TWILIGHT
804,162,140 *53616F34C01B448E5A1D949FAA67516D7675D9B4 shane.ried
804,162,141 *536106E56F22ECE02622FE09028B3727CD07B8FB [email protected]
804,162,142 *5362D869290E68ECE72A6A753CACF58BB22A2106 SHARODA4
804,162,143 *536AF8921D1B5F2FE18A702C4AC7A1622DD14ECA ”GUNNY”
804,162,144 *536CFD14463200505DA1594EE15ECE600883D31A [email protected]
804,162,145 *53650E507A4C3D15416E4F6926907F195F813BA9 SHERIF-ABDELWAHAB
804,162,146 *53624C45C112BF3C0363B680868C881A0AB7A53B sherwoodcastells
804,162,147 *536E3CF3936C5F6E130C0637BCAACB0377D6515E HALELUJAH KAMERADEN
804,162,148 *53665ABC15904A58ECC8EA003462F1624248B42A HARRISON.KRUPICKA
804,162,149 *536FF32B0B050988AA65110E7AA3AEB4A3A6F0E5 HAYLEYFITZPATRICK
804,162,150 *53645906DBE303F523AFA88926AABE14BF1B1033 HAYWOODKITTEN
804,162,151 *536F162A284E9CCD57A17520A38080A7BA3C19DC haywoodsobon
804,162,152 *536C2ADEC4FE6034BD275046B30CF7EAAC0EF3E8 heasler
804,162,153 *5369B23899A8C92C49C9CF69011A0AD3263307F6 slashfilm
804,162,154 *536D7438FE5ED224825E4717F623FD8895770940 HENRYSORTO
804,162,155 *536A0199DD0FF4D3E84592DF80F78593FA0BEE26 HERPRAYERISHERSONG
804,162,156 *53606143B6EF324DB268B6A8FA19540A1178B2B0 het.leven.gaat.door./.er.verandert.niks
804,162,157 *536B5B49B68087779C0B8537ECF28101DFC2E899 Hj=
804,162,158 *536BACCFA1B110A15AA48E47F38761A82F7FCA34 HSRES
804,162,159 *53612409FC380F7092CF959DD63DFFE466B99AFB HTTPWWW.DTIC.MILCEND
804,162,160 *53697E1A5C74C062BAE27DC937B2A25F1AEFD4AC SPATTELA
804,162,161 *53653687F001F122BD9B439C192D524742AE24BB HTTPWWW.WAOQ.COM
804,162,162 *536D3294CC9B8C37BDF3EAA47BACFB7B2BB79C9D speechalpha
804,162,163 *53644E21CB4033E9BD2B1D06E3B129B9FB45CB68 SPLAT!!O~O~ Q===Q
804,162,164 *536ADFD622AD97887909119CC2478D22F5186074 IANHOLTMEIER
804,162,165 *536AF06A7F3947ABFEA2A9C48FFAE69AF0C2817B ICNUCEVX
804,162,166 *5369707153107E041ADDD5D192BE6D158E8F0BA4 STESSIRBILSKE
804,162,167 *536D0D809D94E517D075967409348FA64F899E62 ILEANACOTAN1212
804,162,168 *536E82C88432B78DA9431C7B005D098DAD332FE8 Stretch.My.Arms
804,162,169 *53653800D1DDE009FAD4C0DF2827DB9D7CD6EB71 sumerskoj
804,162,170 *53630D25AF1E072A8CA21DD797470FA7982C025C SUNEIDEN4
804,162,171 *53626F60407A915BAAC3E1A6388F14D065434022 inflexibled
804,162,172 *53600DFE99C38D1B7BBC8A673589DBB11A56C290 SUREWISH
804,162,173 *5361F185A5BC21ADF58560E12BF42F0E3322B9DF surveilletesfesses(featmonseigneurmike)
804,162,174 *5363BE8AFB787D6A1751F4B6762F7915CA4183CB suur-kloostri
804,162,175 *53689F69C62BA58CBDB63665DC48C92CED085CC6 SYLVESTERPOTACZALA
804,162,176 *536800F69900274159E0C22BE2E704731BE7B43C [email protected]
804,162,177 *5360BB2D3852F928BDCCF501A8D49CDEF99DB6B4 IQUCBB
804,162,178 *536491E6A42E7000278BF5DB166F3E72C92E3BEC IRTALLEBS
804,162,179 *5361CECB29EF374C9FE5E3C5C7FFF5D049379380 ISIDRO.HANEL
804,162,180 *536C92A27814E46DE9E653291B8C5D8BE43BC2D9 IT'S MY LIFE (2002 VERSION)
804,162,181 *53683FAEC6F76979297916A441BB46D5FD42027E IWON'TBECOMINGHOME
804,162,182 *536623E242488F9A57FF8937FEE5DC3906D0B269 tank-specific
804,162,183 *5360FD062194CBA97AE3225B1B70659830287CDC jamalstinchcomb
804,162,184 *536FB12F1D8FC4CE9AD3B10D8CA96AE61753160A TBATISTA7
804,162,185 *536EF85BC5AA160563AB0F5440375382B04303CA jamepella
804,162,186 *53695ABA126F958983A79EF9F9406C48E788654D james.tuzon
804,162,187 *5360BA53E7ECAFB4425DF3324D1F053613E58A4F tee.douglas
804,162,188 *53690E5CB64CAE3CC1F60F159CB349FF2C2DEBAB JANMUSTAFAA
804,162,189 *536BDF2488C3589231A65A3863DAB576B9F17077 jasonfreemantle
804,162,190 *536432DD87ADE68E40BF2D7FD0CE02ABB486484F JAVIERWOY
804,162,191 *5364418A6D9193D20C03F8F36D2C900CF1EF08EA te, streicher und basso continuo: nr. 1 op. 10 fdur: largo
804,162,192 *5366AC1330EFCA4DA0A5E31551AED7F263987B30 jeffcastile
804,162,193 *5366347AEDA512794E87A5A0AB1E3F512717AEC1 jeffersonhysell
804,162,194 *536140CA3F184A069E72B78810E39787A62FCD9D JEFFERSONJACKSON
804,162,195 *536814798A0BF0F0C0F1F64A6EDD548E130B0852 JESPER-ANDREASEN
804,162,196 *53607A93A2002853432B2DCC3AD21745D2649B27 jessborrigo
804,162,197 *5366DFC2BFAE456D0D4CC2613615D3EF8F3546C2 thecraig80
804,162,198 *536F7915BA71E8BD921F520AE5B115E20B2B6BEF JEVEUXL'AIMER
804,162,199 *536BAC02591D9329FD3FA31E65E905AAD5CDA3DB THEMEFORTHESMOKINGGUNCOM
804,162,200 *5369D481049E0FF12452306BCCADBD5693464E43 THENOADD
804,162,201 *5360A103685A5FD2AD0E18C8D7EA1132DD6867AA [email protected]
804,162,202 *536E894692BD046DDDC8B2460188434F786E9C04 [email protected]
804,162,203 *5367494260E4093D9E9E6FBD446A2284F75CED43 [email protected]
804,162,204 *536512894FEEB0C7E1E561BB864FB30F032C536C theoliver16
804,162,205 *5363D0CEE84876E5492E7CCBC9D6D9AB25A44CC6 thorondor2
804,162,206 *536A2715FEAC9A9E3B4662D40D3BCEC1D33BEE16 THRU-WIT-IT
804,162,207 *536ACA47F9E8A00CB499F5214CE41350F44ED78B [email protected]
804,162,208 *5361E08F8E55131C03D5DB67EC980177803BB361 JOKES0420
804,162,209 *5368FD0EA3A4E5A83F6F077CE151995D8D80EDE7 JONATHANHEARNE
804,162,210 *5368BAAAD5A5B0CC6937563886C516CFAB0AACEC jorjoliyanini
804,162,211 *5366D4A13C46B3AB5C926A66EE8A8328F7501FBB JOSEPH-FRAZIER
804,162,212 *5364D081574C8637E8FBB8E7F407798D858C419E TINY-VACATION
804,162,213 *536F1B598294044F3072ACE6638D8861AC6F8CE3 J^_Q
804,162,214 *53669130BE8B4543DB00D2D4D4FC11AE6BE4C841 jttmist5
804,162,215 *536E84D8C1A1672424B8945BE7DF4E1B039ECA80 Tonight.(Ben.Watt.Night.Flight.remix)
804,162,216 *536E19EE025F74FF0698BC0F37D33F37C98976E6 JULIUSHOHNER
804,162,217 *5369C009511F2D568EAA676067587D5FC5EE6894 T.R.A.C.I.E
804,162,218 *536E2182A68E2E2145E921163FF0CB9F74F8646A tran$3ntly
804,162,219 *536FB31F91F7D5868B1461540D0A624104D60A69 TRENTONBREILAND
804,162,220 *536B8456A7CE912881BE220C10F4F831973D4972 TRESAREEVES
804,162,221 *5369AF18219F5CAB9FD1681E69EF057B4CE8D405 KASEY.CORBITT
804,162,222 *5369EACD4920C53C77643C49CAB1D54FF2BF52F2 TRUJILLOJR
804,162,223 *5361630C40FDC6914ED126CE736300CA582EC360 T!TK
804,162,224 *536687FBE9EA8900EEAD3FD535CC99F71B5D530D KENNYCERA
804,162,225 *5364FB6D13B11E5DD027E79976CE794860550688 TV.Crap
804,162,226 *53654746FE0512ABF253530CE2985334D4441E58 KERRYGOLD2005
804,162,227 *53624BCE417D60F54A22A6BEFFB931ECDD4E46D3 kevenlepere
804,162,228 *5365256F1A6A8CDFCA509B2B166CB1B1E12C6DC6 kevinprye
804,162,229 *536C6A4ACC20FE68684C4773AD50A7CFFB33C125 TYDEMOSTHENES
804,162,230 *536F2F661C9E314A03123AB338E441734512BFA1 ub3132400km
804,162,231 *53637715F8123CD8BEF165F53E8172DB5DB44D4C uisengam9
804,162,232 *536E5CDAA58C3DB786E36CD2545B971E7B974B70 kleefgar4
804,162,233 *53636634DDF8E6264BD2B5246FFE61E0C10FDEF9 unhcremployee
804,162,234 *536A464155F05262D661D9CDBDA3C9ADB12C5B22 koirarodulla
804,162,235 *53666C3CFA422EF8C435B127335615F065115448 KOREY.JOCOY
804,162,236 *53637FEC6F19F3E2AD3A402F3EE088405D47C854 KOSTALDERIK
804,162,237 *536B5171D855DF8B2DF44D5E1F047BE9038327C3 KSZUMOWSKI
804,162,238 *5364428BDF70D664CA08FA7F0AA32B3748672315 kudaputeh
804,162,239 *5364BBBE6F8FA5B0B2A68ABD1ABE7650EEB53C82 L0G\
804,162,240 *536E90359811BD319886EF93D6B91C5B0A0A42EB V1RAG01SH
804,162,241 *536E14134B0EB9E6EA6545D348B5C73D5EF8C44D V32723
804,162,242 *5365D784C19C4E5C54A27F74ABE944B0160DA082 LA.NANA
804,162,243 *536303F2EA577955A57A539DF1CEEEBD7794FF9B [email protected]
804,162,244 *536BA0551F88EC8CB777D1A061A08884C573B3C3 lea.grantham
804,162,245 *536B5818BA51FD782E9A5E77B1C02A0EF7EC92E6 VAUGHN.CLAP
804,162,246 *5360E7373F0AE7DE3DC94ED284F0D9E7E8330D93 vaZ
804,162,247 *5361139552D66391CD548831DB42001A9AF6A213 vciylutd16
804,162,248 *536416026A7B5D8A2618C14EB66F0F30A483BEFE vergrotend4
804,162,249 *536AE06C5D88F0FE2B0F17F3C92DBCE8551ACC00 LEONIDAS886
804,162,250 *536349E26CC8751A0423FF1651183A92AD2236F0 VGRANENES7
804,162,251 *536DF86BE6D88A69D756BEB034354EACEBD91C6A VICENTE.FLORIDA
804,162,252 *5368D427A5D19E315795ECAF1E50A6CF87E3E46A VILONYE8
804,162,253 *536F8C20AE4E0D039844CB02C17C3BAF7D80231C VINOD TOPIWALA
804,162,254 *536128D4222AB2F524D1D1C58366FE43393147EF VIRGILIOBOCSKOR
804,162,255 *53690E0B6DAC018AFDA0AAE8998537FB847547B0 VIR-NATIONALS
804,162,256 *536D7155B7846D6D60D6E5BB6AFEB31821DA7419 vogelker5
804,162,257 *53635AD8D448B67F88C8DD6D6487241CF2AAB07C voorgere2
804,162,258 *53680B0174E49B80A20D64B633D5574C3161BEDA LINDSAY.CANTAVE
804,162,259 *5366239141EC0F69EA7D3A00B917F692AF8A20F0 LINDSAYPEZZUTI
804,162,260 *536AE2DD39C683EF63967C0D8126490CA575988A wadebresett
804,162,261 *53629A2BE228D01FDB224B9E50DCFD2F0D2F36F0 LISA.AHRENS
804,162,262 *536C711EE78FDAEBBCF08478944A34BD3C77B2ED WAEL SAWAS
804,162,263 *536672EB95FE8CD2605ACE337B76499C0EE0CCF2 [email protected]
804,162,264 *536A9DB72B38E8D31EFCC0936021DCF0C5C586D4 WANDAHUGGINSR
804,162,265 *536907CCD939B6A23633BB862F50054E222259E6 lovejonasbrotherssomuch
804,162,266 *536B966DFF3246E081989A7B0128065C49ED71C5 lufte
804,162,267 *536F2233276BA7ACCE446F0015D1421D732D2F0D luv conga 2
804,162,268 *5364213253313232790960DBF251441FDD53AC13 MAHĀDROṆĀ
804,162,269 *53616606975CAF11C2DA13FCEE69CEA840F3AF24 wilsoncapps
804,162,270 *536D8159545C3A5A6A22BE16FA49C0597C9F919D WINNETTE MOORE
804,162,271 *536C6F504045FC0887C3DB5727C1DBA86E12493A WIRTSCHAFTSVERGEHEN“
804,162,272 *536915B37E5E1A9690F12FE4A34AE033136B3C2F MARCI WALLIN
804,162,273 *53660FB8D4604EC080027701F37922F9A953579B mariano.tellez-gir
804,162,274 *536361AFD860D847E3B7488485080D81E153080F MARITES.MATIAS
804,162,275 *53607AA0EA3BCEA0A37C21840A0215CEF15A90F5 markbear4
804,162,276 *536E000BB15A583C1337F358C174A685CA129265 WWWRAYSTOWNPRIMITIVESCOM
804,162,277 *5364CFEE39C94C9F4AEC4BAA0049E965D60B6C69 WWWSUBMARINEDISMANTLINGCOUK
804,162,278 *536A13E609017A31652EDD0D657074AA05D9885D WWWWSRSORG
804,162,279 *5362226C6F787B6B2B3FA4D2824741DA2DD2B1DC marteltuigen7
804,162,280 *536A79785110CDA41A99128E5181E90A76030E16 MATAVAI
804,162,281 *5363513F3EBD8064710EB29164A1EE4D34F15512 mattdercole
804,162,282 *536035CE4A46EA63E824E926FE58343315D1B274 [email protected]
804,162,283 *5366397CF228462409B6DC577B5AC1E29A0961F1 xko
804,162,284 *536FBAF7F4B1E965728AEFEE8BE0046B10CDD99F MAXLENG
804,162,285 *5367CBC9669F06AEBD369A295B8891773D46EA3A Y1GC
804,162,286 *53661858B50C4E387EC858F06DB481203122DE75 yairbennett
804,162,287 *536FD0DEA002CD608E12416972DEE94F178858B7 MECHIRMECHIR
804,162,288 *53600B3DCBF49CCFF01CC56F112572375C77BAD2 MERLINE-CHARLES
804,162,289 *53660B08473FDC7BF9670B6C34135D39E0DEDD61 merlinlorensen
804,162,290 *536D4BD2BAA0D899F9150C99C96683FC05B24735 YENTRUOCREGAYOV
804,162,291 *536880CC0974EB66A5620C472D74C899D94FB77F yi0kau
804,162,292 *53667A1C8DD341670CA6347B15EFBFBD1E18E849 [email protected]
804,162,293 *5364C311B54B261DAB29DF0DB118EBD1BAF64988 yita-martinez
804,162,294 *536CF1EAF3E708F867B9EBD88F038E120447576C [email protected]
804,162,295 *536432F01377C15F4C7ADB39232B99455D86CC14 mikelsmiles
804,162,296 *536CA47866C019C76661AAE79C8376766A5F8D30 MIKESPIES
804,162,297 *53654BE238019D5A5E0427FEB8186DD8FBDB661D MILTONDENHAM
804,162,298 *536E983A6EB6B56FE22B2382BC938E4DC3120E23 youngkabbed
804,162,299 *536E7097EDB103707517674BD04D0D4401D8BBED misbelievingly
804,162,300 *536C761555AAB23414580820ABFDA68572D2055C misharebbs
804,162,301 *536FC502F71E9E44C1DB95A1C0215F51F3EF11E3 [email protected]
804,162,302 *5369C926239C86C1E09813B89C5ABEBB59796891 z3dp2sf50z
804,162,303 *5369CD695ED1258CCB7A7206E36B04078EBBE1F8 [email protected]
804,162,304 *536EA3488569DE157E02AC73EA5AF5F1C354760A ZAPAZILI2
804,162,305 *5368802C8FBE8249350AF41A4CBFFAFB05A7E011 MOHAMMEDVANBERGEN
804,162,306 *5365BEE412B017CC452D3494D46EE4CB03B0B0B2 ZELINE MENDOZA POLICARPIO
804,162,307 *53627A7EB074AD71D299628A4C6555A7DCD8BB47 MONROE.JAEKEL
804,162,308 *5365AC1EC59DE9D04AC7DA85A24FFDB8CBFE07C8 MOONLORD2004
804,162,309 *53673101B40A00235F70411D45EF708C6AA122B8 [email protected]
804,162,310 *536AF391EF192CD17BB93EFD8121F9F97B2D6687 morrisukena
804,162,311 *5367F0F314C33408FEC9B00FDEE91DEB885FEBB0 mrphnst0
804,162,312 *5361B4A7154D4027DB2DC20663D703C6956ED87E ZTML
804,162,313 *5368EBD7879A135B4B381141F4B50DA4E49E11FC MYEIEIO62
804,162,314 *536C986EF3E8E8F331DB112F975DC49E0FF4F5E8 naomi.gold
804,162,315 *53651E27E7CA1CFE135B59257609C110F75402BB NAPOMNTE1
804,162,316 *536D304A678B1AE0219F1EEB7692ED705D0C9BC1 NB<D
804,162,317 *536508E851792926C79449CB59384BE6E5106061 ОЇЛІДОМ
804,162,318 *53641EB2B7FCEE4F2181E6DC525EF43E95A54B84 NESAGELL
804,162,319 *536D4E67874E56DB3A4D0B595C8AFF74AB5E07BD САМОВОССТАНАВЛИВАЮЩИЙСЯ
804,162,320 *5365A14B93A7B1C39FDFB330C9D21BE89C8A73BF СЕВМАШПРЕДПРИЯТИИ
804,162,321 *5363968F710DEE67EFA2BE201955A386FF1B3982 NEVADA_73SVG
804,162,322 *536EF95043216720B3E750DFD889E2570727D05D NEVER_FEAR'N/E/V/@/R_F/I/R
804,162,323 *5363D9BA4E12927036529F20EB45B05154404BEE NEWUOBNI5
804,162,324 *5368E92573FFF7524AC00F57CFC1105BCCAB821F хинове
804,162,325 *536701D2B35C403F587A6D71615879EE1AEBBF2A NICOLASMOHR
804,162,326 *5367AFC2407D8745DA86D9A3322479B350E09261 noch.eins.m
804,162,327 *53618D46EF5D8988C2E44E89FCD83092508262EB と同様、RTSP
804,162,328 *5366D2200AF854DE93440C9FC18AD023C7BA21A3 NORTH-COAST-TRADING-B.V.B.A.-|-BELGIUM
804,162,329 *536EBB45192DD9A14BD377F5C67734DE6B68539D 夏、AUTUMN
804,162,330 *536B1ADB4BD235DCB00D104B0544D262DE8FA5CA numberslites
804,162,331 *536F6AAA9A937E6E1D61EDFDA98B213137756148 ODELLDESHNER
804,162,332 *536A8A6342E49E68B09917217DDB69F8ACFFC0B5 ODIS.WELSHANS
804,162,333 *536A4D127C6EE642EB242C89C19CFF7ED44EECBC ohcnkfqk84
804,162,334 *536DB2BC413D56535F6F4260AF05B7923993CAE6 oinnmsd
804,162,335 *536569A28F69851E5EB0A1410BB654810732FD62 olmenolmenolmen
804,162,336 *53692850F556A16B802E17FA3EAAE99C557CA945 (芸能生活20周年記念lp
804,162,337 *536B8A84B8FE1E02CB3F5D7383E87FD061F36F81 (>_<) o~o~<####p
804,162,338 *5366A9B27EC158A8A8AC0541B04A15431D9D7441 orenmutz
804,162,339 *536A9A9F56F4EF11AA6E80D4DC1C08D9C0D98200 orenstudniarz
804,162,340 *5366B6E677A29DC6DC013AA4CA619486AE032C25 ORPHANSHELDRED1995
804,162,341 *536E4C4A4E6D1B8A82EE0CBEA8BDACDD60B73997 orvalyutzy
804,162,342 *5369417A94A2A5471AA4CA34BF830DD339D68F9A OSCAR.COARD
804,162,343 *536D570ED276FC4F92787EBB47949E3098C4804B OTISMEWBORN
804,162,344 *53660973C0B224F709A754418781CA7310FC6753 OTREDEFERROPARLENDAN
804,162,345 *53638388709FD3B22887269D8E1A7B9F547942EB 106190 MUUTOKSIA-ON-TEHTY-VUOSINA-1886-87-SEK
804,162,346 *5364BA4E850B4EC518155EAD3B07A67617923D37 10.icds
804,162,347 *5360DE7297D948FC3DB8D3DD2FD629B9E261D0AE PANCITO.1.0
804,162,348 *5367712E3D46CB130F98411919F8C64A4BD766BE PANIKBESCHLAG
804,162,349 *53601739B5A5565D2952B661033A4971F8DD9CC6 passcanada
804,162,350 *536B661ACA59982F14A3D2D505EF0FC35B9956C6 12alanna
804,162,351 *536EC700949A2FC3A6C37317C8C1F41B8E756C8C PERDUOCORALLIARDENTI(A6VOCI)
804,162,352 *5365F80E13A87FBA69862D3E1125164D05A957FA PERRYHOWER
804,162,353 *536D36D19E6E1C5B08CC70E253EDF8E0E63E1F1D 167987 HIC-KIMSE-YAPMIYOR-.
804,162,354 *5360BA2CB02AC407344A8A053A5A004F7B289835 186852 TASINMAZ MALI VARSA TASINMAZ MALIN TAPUSU . 04 .
804,162,355 *536A5CB747C7F87DD244F004ABEA9B9348E5C788 1897027 tp-pelaajistatuntuivarmaan,ett
804,162,356 *536A2C28C0416CB6E2BD0E6E87B8A83CAE871E18 18november1572
804,162,357 *53657F7223B3637EBC137D707496255288BDC830 PHILLIPSUELLENTROP
804,162,358 *5363C09B0492FC0024771BC32CFD1F558A84C908 phuopsis5
804,162,359 *5365AF6A03EFC3D50CD93756F90082C7B3D76657 PIJMOUT0
804,162,360 *53666F4FD77FE09F40D79787C8D65C5AD2E94A84 [email protected]
804,162,361 *53697D2146FA195015CC9D544DACC1689D904B1E piojosa37
804,162,362 *53670857F37B3C7288CC7482F8B4864BC552165C PLATO123456
804,162,363 *5364E0EFC16672CADAF4EC75AF212D09FAE443FE płoskowicz
804,162,364 *536A5EBE887691394E6E8CEF0DA8122C05C27664 P------>~O >-<
804,162,365 *536ECFB69EC699841F4F0089F093052C7B4E8829 pojánánukuluj
804,162,366 *536127E041CF87214192231788A6E3607D1021FD *POT+TO*
804,162,367 *536C210FCE5727C7E4E25AE4A24B5A1CF95A11B9 1PROZENT-SPERKLAUSEL
804,162,368 *53652D5C3895D77F5F99E4C0FD63D8ECDDF54425 precondyloid.
804,162,369 *5366DE29C00E53596A1BF6E1217026B42E6EBB94 1-RUOTSINTUNNEILLA
804,162,370 *5365985EC827087BC728244C1C6F04C4328E00A6 1-SAWKS
804,162,371 *536D1058A12600E91D250FD91F38EB99080F0971 1.shriteh's
804,162,372 *5366AAD4C7FFE40D06CF71798EE102A8C38AA73E 1.soudettavien
804,162,373 *5368F413965E31AADDA297013E15FD9C30E7324B 1SPURTETEN
804,162,374 *536ABBBE84CC97ED67EE67970D20BAC55430F7D1 1TOUNDBSW
804,162,375 *5363183F59C2D515EDA141C3C81A6E16FC9370DA projektnavne4
804,162,376 *536CA5A1B8CAEA534ADAB9086778DE7D50DD4C07 1VARUSTELUPUOLELLA
804,162,377 *5361B98B581ABB89DF6213AC7F6F8CD47ABDB919 provis.21.0
804,162,378 *53667854DB97D8FEA991572B44B9398C15EA20E3 psychedelic2
804,162,379 *536C011931AF1C71F44990A30752C51527EBE2B0 1 YLP
804,162,380 *536F2730B964595430B57A74E434E89D3AD34EC4 QINGLISAA
804,162,381 *53668766D34E9DFD8F2ABD2967732EA336102C2F 2228858 YHTEYSTIETOJANI.EI.SAA.JULKAISTA.T
804,162,382 *536B2E429D464C9BFDE8988A8066FE8B91E714A3 q;kaaa
804,162,383 *536F0D983708EFDDF69843C4E71BB2095AC7B682 q#p*sploit
804,162,384 *536E9F972F38EAF80ED672E971A9580FF4A99ECB 2492542 THEY ACTED UNDER PRESSURE FROM THE WHITE HOUSE
804,162,385 *5369720D04E1C8B6BD5694C43A3BE440864FFD55 2520462 eu ei kuitenkaan saa j
804,162,386 *5364637CBD23427E28CDBD6FB2F4F88A9AE5701C QUIENAL4
804,162,387 *536B0FC54F7A4C41DCD2E98C4FF086CA19F2CD3A quiver..k.w.ih1.v.er0
804,162,388 *536F471DDB9018D615AE84A6CBA3CCDEDBE6C92A [email protected]
804,162,389 *5364099BEC068DBC1EEEFF322FA22B00DCF1E18F R34PPR3ND4S
804,162,390 *536ED2070390AC521E3D4FF9F7924B42B381F74A 2793006 jokaisessa-joukko-osastossa-ty
804,162,391 *536D953E01227D7A94DEBD2DD5939CA6B5EFCF92 27ENGAGE
804,162,392 *536C628D6294FFFDC5B66C3CE5E47DD4FE5D448C 28-duduk
804,162,393 *536FEAF81A9276BC60D72508F8BA13CB27F9AE6F 2976502 hajakuormitus liittyy l
804,162,394 *536214479CA2FA9423C94425DFCFE3B7503A3D4D 2 CVP-GROSSRAETE
804,162,395 *5369610A45C8EE2A414A73D29BB0CC638FC8AFB5 RAMONA-NEBUNIK
804,162,396 *536227A4FFC0F448A8C81DFE9273D2F4CA94E881 RANDELL.TOTTY
804,162,397 *53663F42DE74E87EE91827E63E876BF27D2D536F 2fpr1162e
804,162,398 *53683E0722820023E69DAA50397B052F5783E6D0 randolphswartzbeck
804,162,399 *5362772963768F9A9FB5734F48FD948E246371C5 2iamsergei4
804,162,400 *5360182E4454116676D69A4D890120AED4BBC1C8 2kunnanhallituksenkin
804,162,401 *5365972BA277D4456729CBA89937D5CE757D4B4F 2.MUNROE
804,162,402 *5360B02A21CC300E4CC603333C77A9614D247432 rc|%
804,162,403 *536CC87488A608DC3360194CCE7E524523BE318B 2WIEGNER
804,162,404 *5369329649224DACFD9AE6C7595BEB940CFCA59B [email protected]
804,162,405 *536AD90BB408E4196CFCBDDD0BE61FD943A568E2 redeiws0
804,162,406 *5361E9EC957B81CBF3CC353E9A29F334AE0FE55D 3==B~0)X(
804,162,407 *53674DEE6A41F4EACAAE43483AE32E4C9A6FF857 3d~0~o;)
804,162,408 *53619C37088A232A04204409EAAC7FD2435CAE38 3mar2001
804,162,409 *53661D90C6096B539E22B1A9FA9AA64590ABA282 [email protected] ~O}8{
804,162,410 *53620D1F1E83F2BA07B55B84943CE472EF70C2CD 3=====P-*-*-*)X(
804,162,411 *5366F587B59689F329C1D8A9CAA5016176AFAD6A 3TSENERES
804,162,412 *536F36052CA07968BB8638019676724921BA5B16 3WCRABSW
804,162,413 *536789671150A2D58B896E33E7794E1CAF7EC967 3####)-*}x{
804,162,414 *536C9105E896833CF366AAA0BB14EEE00DA5D776 RETSKEERPSDAAWK8
804,162,415 *536BCC357408D821F4CEF328599E64E60B1BF340 REYSAUL
804,162,416 *53606950D6437DA71639DC987BB51D5128E078A8 483783 MUTTA MY
804,162,417 *536393756DE2D1192FB0818F67AC679007AB94DC riaa
804,162,418 *53687A1BF7206BCDAF79E59C2467BFB553D84D61 RILEY.PHILDOR
804,162,419 *5369470CA7BA0C4C92D802C94A0D7A905170E053 4KERXHALLI
804,162,420 *536496BB594123203A333ED504111C2093D6696E rintist9
804,162,421 *53662A77C41D31E3811FACC0B2164461BE8A4D39 4MISTEHT
804,162,422 *53633B6639E03510313B9DDE2001FA762345C331 4NJLI
804,162,423 *536DA22F2A8F1E79AFB8C2927829FC96F9456299 4OSALLISTUIVAT
804,162,424 *536CF3D95BF359303076E453DCBFC4F9C8A49FA9 4PRISVAJANJIMA
804,162,425 *536AB2C1CC637B8A04BCB119B2E87B304F1124A1 4ROSSMILLERS
804,162,426 *5362D450E8687F852AEC0344D6B90C8083DB729F 4SAMMALKERROKSESSA
804,162,427 *536F9CA8910560121EA3A9C1CA8F2687C4E0B95D ROCCOVASI
804,162,428 *536AEF8EDDDA3E689C2486A55BFA394F38A98CCE ROCKSANGEN
804,162,429 *536C67F94E7C8EE026335CD0632991BAAC728FB9 rolandosalvage
804,162,430 *5367CC806C06992BA24C16CF6139412393945DA2 539811 zwei-drittel-der-bewohner-stammen-aus-bosnien-.
804,162,431 *536EE411AC2E6F03C7471B47D20FC59C66193A1F 575230 UYDULARINTEMELYAPISIVEOZELLIKLERI
804,162,432 *536589F00722C8311AAF928B3DBCFF0A7D27B720 58135 kOpek.:.-sorma.arkadaS.,.hiC.sorma.baSIma.geleni.!
804,162,433 *5368143678AE737BC1CC7E9EB2FB22D0D448D80F ROWHOMEBSW2
804,162,434 *53671C72810482E7B27423B17B6D4D96C81A31D6 5ER!AL!Z!N9
804,162,435 *53634E19EDEF1056875ED95D468D1E7EA3951B7C ruben-altamirano-vazquez
804,162,436 *536D00E7960EBCE19ADFE740B7340C31A12588C6 5GROPIETH
804,162,437 *536AB1B05247493FF409BABC8F5C0E9F92DC1F47 5ISIYTTIH
804,162,438 *53694007165C52F94D6D7C5BBE0B8994CAA18F46 5motellissa
804,162,439 *536F7E5F3C8DA71289C8237F57A2CCC700FA3A60 RUEBEN.MICHAUD
804,162,440 *536D808B816BD6DA075AE9C42A2E760B322048AE 5.sendestandorte
804,162,441 *536EE17BD8621AE0B55A06482C06913E01F821C7 5SUHTSKEV
804,162,442 *536CE52573B13AB8D89DA313C568A9004932946D rustyfurry
804,162,443 *5366A9C8572C4C3109F129A40ED34E432A11C06B 5TKNADEB
804,162,444 *53629D0DE15D992915E4CF0305F3F4D11444293C 5unadroitly
804,162,445 *5361D76E8F04348BC68504ECF3A0FBE1094CE8F9 611461 daha sonra go menusunden kullanabilirsiniz
804,162,446 *536D9C17CF5BF8F1565FC50115E0D4EA555C355B 654321HRLY
804,162,447 *53676EC9F206F60D7561EFC8C3C162F987AB12A6 S0LEMNSH
804,162,448 *5360A614545D3612B00E79E6FBE3625BAD62805C 66FERRARI
804,162,449 *5369F568F9D4A33AFAE230CC1BFA3E4E2C3BBC98 SACERDOTIAL1
804,162,450 *5363A55D0A2FEFB146AEFF24A6F794627F195200 saintflourdemercoire
804,162,451 *536E6FBDA2265944D3116B0E10884A081BF80164 samenweefde3
804,162,452 *536D58CA2D7CB4303D20D7B2F81DEE58679B35D7 6FORHFULNE
804,162,453 *536B1A9903ABBE55E66A33591D458FC6E6FCFC95 6MYDELTA2
804,162,454 *536A5C57BC46A85ADCFD797A7A8919678A5102E3 SARAHI.DELGADO
804,162,455 *536361B1CD762DD3800BA2B2EDBAB54BF5688105 sara.nugent
804,162,456 *5367DC935A2E59009655F48E579558C933C587DF SATSTYPENS
804,162,457 *536F42EC89FBB50AC0220B139653BD0F2A12DC9C 6SEMEREZ
804,162,458 *5362205042FA9F282114319467135EFE772F7EEE 6SHOVEL
804,162,459 *536CE987CF359C3B6E67AC8DE3C80EF9A9E9371A SBRIGATE!
804,162,460 *536342E66602C7C53D0D4E811335110AE2A979E8 SCARMENTI
804,162,461 *5369874FEBC8C1B23A6F595A3AFE7499B07D096D schachthydranten
804,162,462 *536D71791110F3A3BA3B8D2F5B3A0B5D3E6718B4 scricchiolerei
804,162,463 *536C027007A1DBABA6FDE1004A0FDB5436EAA870 7BEHULPZAMES
804,162,464 *536EAE06D2D28F8627B7F6A1A224428D1DD79E6B 7CAITLINMAYDAY
804,162,465 *536D4306125AD7C1A5411A1F05A4D7526794A9AC sejxels
804,162,466 *53671E8089B6195FC0F80D667E672997BD10FB2F 7echantillonnerait
804,162,467 *536A51FC21951A5D76CC470D6D94FC67FCF09BEA 7HEBETICS
804,162,468 *5365A858F72B638D811113A324850EC6991F557F SESSETILOPS
804,162,469 *536D463C91CF92F27EC83294A58E6CA481FDD395 seth.tran
804,162,470 *53668D58C97E6EA1CD70885EC780153B2B2C448F [email protected]
804,162,471 *536321142A88C04CE80877C1B40FE153F63E4273 SHAMS“
804,162,472 *5368DDED15B127DAF28799D371518867925542E4 [email protected]
804,162,473 *536C394A46758B90389A73040DF4E0847EB4BCD0 7PLAYERSSANDRA
804,162,474 *53684A9F98A5087C33C5D76DA602C2707B0E8B83 7REINTEGRATIONN
804,162,475 *53631EC9BBF788BE4A44751016E565F4342E870B SHELBY.STAUNTON
804,162,476 *5369C99CB0B9DC2AB76801DF19045D5C67E9B27B 7SALOMONIES
804,162,477 *536FB64FBA2A851C60FD8125426AAF8283F4EFE5 7theunited9
804,162,478 *53619C4722078E7CC2DC77CA35702EA0E2470D4D SHERLINE1234
804,162,479 *53626F94EF92564392C3D9F627988137968437F0 890950 bu.faiz.serbestisinden.oyle.bulundu..
804,162,480 *536D770C925CB43E2EA7F07BB6C6C6437D39426B SHIRLEY.WRIGHT.WARD
804,162,481 *5366F5DE26858940282DB6FC9AC47AE117E5613D 8AMYDEBORAH
804,162,482 *536488B28F552234BA3B9C036759F83229556DB6 8AUG1108
804,162,483 *5369D3B7D88DC909EA0681F1AB331962B2D82C6A 8METFIENK
804,162,484 *5365F134E708EE5A6D638F0990FE6C7A795B4371 8MOOMOOSCIENCE
804,162,485 *536E8B8C8DF50C47C8EE5E02E2C2B35B92B668CD 8NETWAREGRAY
804,162,486 *536D9C636E8A519FA999D9ACA42BC59BB357F8A1 8PROGRESSIEVES
804,162,487 *536907F09294A0DAECEA60FD33C9657474E8AD98 8REECIFICAP
804,162,488 *5362265E6E5056D28DA46EABC1451CB7A11B5306 8.ROBERTBLUMSTR
804,162,489 *5365B1FD4AF590D2E6C730F52EC5421263F297FA SLEEPYMAGGY
804,162,490 *536387B0F6C162DF9999FBFF41546DB86561C2F5 SMEIRETED
804,162,491 *536B2BF08C035DB0BC0E90BE4C043BF2E456EF83 923504 osaopiskelijoistakatsoiett
804,162,492 *53690F23B726953539DD453F71A0ADE80FBB71CC sobnosky0
804,162,493 *5364717B2BE3FAC6E61738F339055A77B50C6EA0 [email protected]
804,162,494 *53686EDC0A507EF606D18DDFEFF869572D910CA0 solwir25
804,162,495 *536F40C37B359A98E2A2047869FDC942A94C1038 SORORMARIANA
804,162,496 *536954C349B618EC7133E69C9F0C983C3BADF6AC 9GLYCYRHIZA
804,162,497 *536EFEE740D074E76549DCBEC34CCFB35DE2A664 9IAMLEV1
804,162,498 *53672F5D8FD2A527A849512866448B924A5FC14C SPATIALISAI5
804,162,499 *5363E6F5206A195C3C576E0DE682208C62DF024B SPHAERIA9
804,162,500 *53641CEC43B5AB0FEF9740C40DA43706F3942984 9 RAJAMAILLE
804,162,501 *536D3D6FD17A3721106F1D0C72DEF0F835CE8202 [email protected]====P
804,162,502 *5368F21CDE244968D7D47313DA715DFBB294EC77 9SOLILOQUIADOS
804,162,503 *5360FAC287B228451C6A4638DE8BE0593857880D a0gxu
804,162,504 *536B484FD0A37930EFBB32C8259E0BF5CBCBFD4C A+30B
804,162,505 *5369002F3CF070C01A76CB06A21AA4935F533493 STANTONJEWELL
804,162,506 *53630C21C7DDC214B7606007758EC0C9B29F332A A4+CH
804,162,507 *53690973A9559E55C84BEACDBE3D8FE108E47FA8 STEFANIE.PALMER
804,162,508 *5361D14375C3111497383252D57994DCB6B36F0D [email protected]
804,162,509 *53608E705D685CC43F72BFB4A84312C52BAA1CC5 a8js$
804,162,510 *536D196055268E7C7DD4FB518641EDB94D7FDB1D AABP`#
804,162,511 *536E2B8061E565A9A38324068710C655961AC564 AADITYASYING
804,162,512 *5361185260A8153523BEA892994A7875C6078427 AAQX:
804,162,513 *53636FB74DF05F5D68BB1FBC9444E5545FA07828 STPIIRIN0
804,162,514 *5366DD39E3E5A921D88E328A04995F408BF96E60 straitla7
804,162,515 *53632033C1F1E225F7E27EED4648998854572F73 ABC)E
804,162,516 *536F1791C074363ECA674E12A3EE094E2DAB7DEF ABIGAIL-PUGH
804,162,517 *5369A5BD86B0F946A2A444A301D21FB21DFCDDDD ABOUTKFP
804,162,518 *536D8B124C665CD6209ABCEC31DA7E3657097C13 [email protected]
804,162,519 *53666CC316E77CE06B7FCBE615F0B6829011F3A0 suchitra.shenoy
804,162,520 *5368E3D3E7EB9ED2B4356361645042FCF807B7A8 SUCHITRASHENOY
804,162,521 *536676FE8A5034029ED2F33D4713B54F029DC1DF SUZANNEDAKOTA
804,162,522 *5368E293E72D93BBD431EF30A49F260F6F37B289 sxeaaaaaqaaj
804,162,523 *536B330439ABA78EDB65D5A559C105EFF7E6C0F5 a#g+#
804,162,524 *536C4911EEE52E2458CA3B38CCAA1DC27BDAFDE6 AGUSTINMENDILLO
804,162,525 *536A6E54E10A1F35AC03DE500C235CF77151F9B6 A!I5J
804,162,526 *536B414CC0C1CB297CF33B0702F61B4466C19E11 ALFARUNSI
804,162,527 *5365010DB573816CC69621960747742897685DA0 AL:)H
804,162,528 *5366EE56BF73B95C457E283BA0FD33B9FDA56DF4 ALLENPASCO
804,162,529 *5366FDB273693D8432340D7BCEC719E4133647E9 AllesnurShow
804,162,530 *5363A3554BB85C2C6D23336B1A4605F879D044F8 AMANDASTULTS
804,162,531 *53670C359B07A57E6EB2E97B69AE5F99E112E7F7 amyguinness
804,162,532 *53631BC9DC6791C5BE32649F5B53FBB1406B04BA AN65N
804,162,533 *536EF60872F06831DE8846BCD4CA07ABC71D802C andresallemond
804,162,534 *5364003533AAA01616FE057534DCB848C9BCE502 ANDRES.DUFFY
804,162,535 *5360C74E60221C43E30429919E878BA6BEDFD56E TIDESPATESPILLSPILL5
804,162,536 *53669DF1C875778F1918E2A3F22DAD165453E756 andrewlambson
804,162,537 *5369A42F90480D37D8A64B336B9C298B46D935EF TILPMER1
804,162,538 *536C560B501F2520BED55919AD8D3A593A18F6A4 'TISZOMOEILIJKOMALLEENTEZIJN
804,162,539 *5361730F45F57E634FA99D7F32B9D767FF17A047 [email protected]
804,162,540 *536205815BE61AB15B2274EED5CFB6D629D3DE78 tobiaswestendorf
804,162,541 *53650A0F8F26EEBC91059EAAE1DCDF4D9EAA50EE ANISILORS
804,162,542 *536D8B8DC7A345AEE706C1E8E51B0266F4FFD948 an$rn
804,162,543 *53652BEFB808DD1C87E2126F1336B054B3CF895D TRADESCANTIAERS1
804,162,544 *5363B3DC38B751AD344B9D48479DFC9D4DA2104A ANUXTANAX
804,162,545 *5367E0631F307C5E8395D09B5CC576789827FFCF ao:
804,162,546 *5361FF8B9C9E1DBCE98FABD277F724A376062355 APEXOYME6
804,162,547 *536AB15D3B3D4570E2EB1D5AB1673D325042926F ttamstnaig
804,162,548 *53658378909B71E36F21D0C194E4BBBF3A89E042 TTNMNTSES
804,162,549 *5365265D4C6A78B0B59BA36A8091167984493A93 TUDEREND1
804,162,550 *536C1F281A204A5B5A02D77FBA29E888522B2D67 ARONBAJKO
804,162,551 *536281B443B74D3C81DEE6DFFB16F52BFE6E0996 [email protected]
804,162,552 *536C36C44F0307B42695D8D9572FE4098EF83406 arronzaffina
804,162,553 *536C41A2B1056E6F600FC2ABA4896BB5BD599CA2 ARTECOMPUTACIONAL
804,162,554 *536A4D4111A0D0063DA5713CD6B9357CDD98EA2D a:sk
804,162,555 *536BAD74F4575694D83278FAD4BA41DF38CF12FA TURKESSA5
804,162,556 *53694E87F5935F158DDBEA2A838189F92BEEF451 athacané
804,162,557 *536FDD1B4F00C3C50BA4015515AC2C2414F78155 tysonjordon
804,162,558 *536977512F67428E2BFEDF21AE8FC31F76DF8CE6 tzyh
804,162,559 *536BE2369E0280E9E0D5798CEB1BA445FF5BD426 AVOIDMENTED
804,162,560 *536EDF9B6765F8A489A15E23F67156D050FA01A7 [email protected]
804,162,561 *5364D438C07F32FBB769CDDF3751C250B65D3BC1 UITBAATTE0
804,162,562 *536B5065B0E35E61597841687695BA012DC5A0ED ULAVFLES9
804,162,563 *5365871308D69CD3E09DDB6047051883645B08EC ultramarine
804,162,564 *536EC91325364106A8A03CA6C1E61D24CED3B6F6 azr+0
804,162,565 *536C8D3A1B232E722B686708A87653B1C376556C >[email protected]
804,162,566 *536CD2E7A0B699008FB9A7C28CCEA3367043B226 UN!FY!NG
804,162,567 *536A3148AFA8DC26385416CB9298DB37D5DB80E9 B4!#E
804,162,568 *536324BADE7F1A7E81D023208CBF4B53BB4A2CA2 BA_2=
804,162,569 *536C226067163907AB03E807BEB6B32E334F1A6F ballad-for-trio
804,162,570 *53657A80DB882C5AC1BBA56252B2B14CC9BA9CAD BARNEY.GETTINGS
804,162,571 *536F146125705BF33B2B0A24CEAD8F262019D5CC barriada4
804,162,572 *536CA321A038220288D86CE96FC89867201B7D98 bartonmomon
804,162,573 *5367B3CB7F0C2975212C0EBBF8ED90071A7605A8 BASHCON
804,162,574 *536079EEC58A66A6EB11E633EAD9F09B9B783A5A BATTARISMUS
804,162,575 *536C3B9DCF5000D90B0780C9C0729F8A2F7B86D6 utkorat2
804,162,576 *5369E3BEED53BF27F18D09F57D282647A8452C13 UZUN MALTEPE
804,162,577 *536D32108F03F5190DA4D189969CA1204E8BBC61 bcrhh
804,162,578 *536FEC096AE870F1DB70941F4436262D2F0D8406 B!D7S
804,162,579 *536CA27B7B56FA2A398C994CF546DF52C0BBA4BE VAÏTOVITCH
804,162,580 *536346E08786D6A8D99EE6A704D691F8FA6F1C47 Valkevlucht
804,162,581 *5361F96FF9A5AB47D5E473DEC9D1D296238F627A VAN.HOTCHKISS
804,162,582 *536A3BEBD164CC569D7E54D5DDDED9698FBDC433 Van.Maren
804,162,583 *536E27E85CC3D399377308FF859FFD9D5D4DB2D9 vardon0
804,162,584 *53644E4F77901C139736A476CCCDD9B41DC00278 B:%EP
804,162,585 *5361D7835F713892EBB09A60CFD1F372B0B12141 VELALLISEN6
804,162,586 *536376DBD3DA6704CB3DD6B70FB2D200616DF798 VERISET KERSAT
804,162,587 *536843273E4BC247CE942A1E0AFF1EBD94A10B36 VHAN.FLOREZ
804,162,588 *536DC818623779E5A15B176DEAE65958B35C3DB6 BHVLR
804,162,589 *536E5E4FA6A8255E1DD725DA4B86B0D2EE75C108 >w6a
804,162,590 *53604F0B2947E9AFF84A056DFE80DC4D46C35B49 WADE.PUSHAW
804,162,591 *536421FC472DEB0CB1165BFA27E678FEAA1E0846 waldolassa
804,162,592 *53643CD47E3EBC8B7B86DA2BA6DD8CD0E384240D bokorerdő
804,162,593 *536402FD05B80B0723EACEDF3E8ADE7440B94F38 b#####>~o~osplat
804,162,594 *53656267E48E36AFEC7F0838F8D0558632B49779 brainseaford
804,162,595 *536150AB96406738B61E12C36910BF443D0EA6FE [email protected]
804,162,596 *53623F216EB364DB3EF60F76F24DA3E3D75BD153 WENDY EARLE JORDAN
804,162,597 *536789132756BA7F0B3E6692D2C614469EC4536C WES.BOHLMAN
804,162,598 *536BB1844B1258FA09A4B7D4060607876574FCB0 WESTON.LEBEAU
804,162,599 *53695F79A887D23D957507374B8234EA7819C138 WESTVILL6
804,162,600 *536256D3C8EC20795E8F1763A26F57416F213956 BRITIAN123
804,162,601 *53664AD5DE4A5656317EBA691BC8849F601CA8E0 whittney.russell
804,162,602 *536555A0BAFECFC89D0CBBB75C13EE315AD846DD BRkT
804,162,603 *5369AE8265929498B1B1C24AC2CDBF692AFA1B33 BRUNO.LARAMORE
804,162,604 *5369C7C870F3CAA02BA04F07140BE4E95DF3F24B WHYELOH
804,162,605 *5369AB05C32F4B5E75E9B9CC8578DE91834FF623 wileyselfe
804,162,606 *536CBA22EF1D6AB1FDD44B7627A450E49FE338E2 bsut4
804,162,607 *536EEA3422CD01C6CAA44376C52AB0F860BC6B50 btf&
804,162,608 *536E53D738005B3C60098DF3FE215B2553D997E1 bug1z
804,162,609 *53622F2443A5397F25B1F75A212B3689578C5A5E BUX!.
804,162,610 *536B9EAF3F8EBFBA4FBD497AC3ADB49FCB4960FA BZ-:
804,162,611 *536567988455131281C0EC2B1E97B292569B0C1A C66UT
804,162,612 *536393E6145652E6396BC471089A6DF9B0771C6E c:8)l
804,162,613 *536F25DD9C7EDCE4154CE54016D3FFE88FACB0EB [email protected]
804,162,614 *5369CB8C888309C7F6A9006AAA5183E453F6E68D WWW.NAVES-TOPICAL-BIBLE.COM
804,162,615 *536998748DA6B7217308453D36E48535C54757F9 CARLO.BUCKMEON
804,162,616 *536C005A700237A82C73EC61078A2DDA3EDBBF1A wwwthenumberscom
804,162,617 *536FCBA01790FFE7CD3331B9FC2CAFC34CBBCCB8 carminefreimark
804,162,618 *53660568663DE542DADF4F04BE52BFC0A2C0751D [email protected]
804,162,619 *53601E509ECA535438DB407F4A055C8A0EF340C2 xdesdax-tevejah-locker
804,162,620 *536C2F84D52D11A44260D90751333263CA954E91 CATERINGFÖRETAGETS
804,162,621 *536F7BDED411798C54A947F9AD36D842AA481909 [email protected]ITIZNET
804,162,622 *53688542EB0BE5D26B460BF404CE7B4E3B0EAC17 [email protected]
804,162,623 *5364E8BC190FEEF3A16FDB0ACCEAA00E2C7D3122 [email protected]
804,162,624 *5367599D3528BD2E9A3C684B57EF8925D418081E c#azd
804,162,625 *536B0F6C304BA45F0EFFB7C7DCA58D44E5C28527 @XOG
804,162,626 *5360745591A5439E5E0AD93C2E52A2EAC22322F1 cb%fk
804,162,627 *536F42A05A91FAE75308FE1C7465ADCF662E09B4 celine-bass
804,162,628 *536BC24A2C9D78DB2C0C11DE77F7A23F0C34D461 cellosuiteno3incmajor,bwv1009:vbourree
804,162,629 *5363096814318B8C10040CB253C605040419B7F4 ÝAZMAGYNYŽY
804,162,630 *5369909948B40733241C06EB8B9237FE15DCD938 CEPHALAGIA
804,162,631 *536B524FA50937E9AC5FCC59269AE1650A4C1BA5 yflixjs25
804,162,632 *536CB2F74CAC7505899F38917DE0AB709D9D68B2 cf$$5
804,162,633 *53602282547E72E499DF56F1ED8DA35AFE8C24FB YMDATFJ9
804,162,634 *5368F05FC369345BD6996AFBBD89B8FC6C68EF7D chalussay
804,162,635 *536D1497DC98AE0EF0E48D380436288F60801AE1 ZACKARYWARREN
804,162,636 *536A9495C8C8371A99084A86C61E186C35402222 chauchailles
804,162,637 *5369D2C3D3B35E016C87D1C05B37F54B9D39B93A [email protected]
804,162,638 *5360F532CE152233B73E7D207260319B61023245 CHENYANCHU
804,162,639 *536EB3B8D2FAACCB4AA59954834E893D5E527D48 zeissisiassed
804,162,640 *53655FF4255AA677231C318EDF572349CFF1E7EF [email protected]
804,162,641 *536D73C26E2EDB804AA187A0E35AD4761E7AC4BA [email protected]
804,162,642 *536CFB44BC096DEA24E832E8E082870C35E0A65C [email protected]
804,162,643 *536E5707146ED07BCBB2C682D8BD62986E237D8F [email protected]
804,162,644 *53684A25765A9533B7F8E7BB22D7A37118D8BEBA ZHEVTORRES
804,162,645 *5365DCB2639A47211EE2803818C442C854D61E62 [email protected]
804,162,646 *53648C47E25A070C2865498732B8C39C881B46F3 chloe.wildman
804,162,647 *536316874A93D37E72924A829F82D785618B5B88 CHNLFRMS
804,162,648 *536F532CD05B5A64123933225271AC5ADB6EFE29 ZIMAGIC
804,162,649 *5364624BEB0ED16833110AED941B54D06169E82A [email protected]
804,162,650 *53692C4ABCA3569D558AC65CC7FF83591F61FB57 CHRISTOPHERMCNAIR
804,162,651 *536717323F4474389AB04F2F1F8F075CE0D5CA61 churchwell ch er1 ch w eh2 l
804,162,652 *5364BA84091DA12A8B9F2D8784480F9298A1C48B chvcs
804,162,653 *536D04702562DFDAC1231617F5F5BFBDB3E6971F БРЕЗНИШКАТА
804,162,654 *536BFF65D73E6F1A9256DD948D935B6DBB4CA343 CITYSLICK
804,162,655 *5361220B1E1DA4151FE24CB4C36F9FB44E73E74E ck9g&
804,162,656 *5361396436623D99E97104C5D5C5E9C247B9E480 науди
804,162,657 *5367AFD27410412AABB8B7596A77B63DA11970FA прапошаскім
804,162,658 *5363F43D3CAE999FA2CF2AA20823606CB4E4F693 ПРИКОЛИЦЕ
804,162,659 *5365435AABFEE6756891543457A78EE8D516081C CLINT.JAPHETS
804,162,660 *53612A85FED0ED30F37D5CD912BE300169662F2C clintkim
804,162,661 *5365F1741E551FB3DFD275686665A0C25C2FF338 club.san.sebastian.de.le
804,162,662 *5360C7D0FF1C89C45B5491AF449ABA4BD3200C0C САРОПЕЛІТИ
804,162,663 *5367100F8DBCBB7761052904911AF586949CBF91 [email protected]
804,162,664 *5363CCE9DE002BDBA09B813746B032553572AC89 ТЕЛЕПОРТАЦИОННОЕ
804,162,665 *536B8445A515F8C76FC2BA3BDD9D666B6ADD61AD ТОЛЬЯТТИН
804,162,666 *5364C6FCF4C54E9D168B9BA0FC925F811ABFE702 CNVLSDLY6
804,162,667 *5369053B3D12925B44F9C59EF9B669A42647CF7E COLLAPSIBLEAUTOYESLA
804,162,668 *5366B3260B4D8A30209CB72562817C1CB48C1AA9 collingiraldo
804,162,669 *536824403559174EAEE695BC9FCFFFA78B051745 中一至中三每級分為5班,以英文字母a
804,162,670 *536A0D4FC3C0C761B1F5ADD993AA03F6E053F329 CO;U6
804,162,671 *5365E02873050F27BD078C9CB5614D62D8609176 [email protected]
804,162,672 *53636138D8AF3A25837C9061A8032D54C538F6C4 CT-TM
804,162,673 *536ECC1D7978A411CBDC5BEFB893AF066E73490F cu(c=
804,162,674 *536DCF9B8D69AF0F55114064369AC772596418A8 c_ugs
804,162,675 *536382063CB14A85B2AC990FCCD8ED34B09BC2F3 CYRIL.MEDFORD
804,162,676 *5367006023FB21BB83E4D3E56D83704403A83308 d38++
804,162,677 *5363BF381598872ED7B2338732165D0F5D812ED8 D4CTYLIOGR4PHER
804,162,678 *5360681C9F2D405D02E859C0A97637B032FCE475 D4_PV
804,162,679 *536D05842CCADF3271DB352915BBEAF147AABAEA danielkiest
804,162,680 *5361A0579B0888A6337AA964F7077815C29BD5C9 DANILO.RZASA
804,162,681 *53605DC9BBF50556F3595233D61A592A3AC1892E 10080 cache1shiojirinejp
804,162,682 *53687BF3929B575D361FAD4A4B8FCF256342AC7C 11-12-1018
804,162,683 *53672629E9DA18BDC69B2D29DC528B0499BD3F53 DARRYL.JENNIFER
804,162,684 *536B0AC54B7E59577B4BF1B22B1D0383BD7373A8 DARRYL-YANG
804,162,685 *5361952E128688AE88EDE01FBE4B4735C3738719 DARYL.ALFREDO
804,162,686 *536FD34A152F648ABE7485C44BF6D5AAB5EF2CA7 DATXW
804,162,687 *5362FEB60FCEFE675521211297D373A0EB351182 db285470
804,162,688 *53648A30E6068933B1715126FBD9F0214C404098 14apr1733
804,162,689 *536697902846D299C3AD1484A89DB47ED3455DDB dddee728d3b2300ca51b582c7e484038
804,162,690 *536A50D717FFACCB561C1CBEF5B92114584507C2 DDW,
804,162,691 *536C7692CB6443B23618F4CA77A86298266D7F71 16-quiescent
804,162,692 *536F659308EDBF5E593B309BEA66006744ED8445 deb/=
804,162,693 *536EFA91442D89C4CB0EB28FA1168F42B41EA767 DELMERTHOMASSEN
804,162,694 *53685A20D643D5068464F0FC41159F2300936C12 DENNY.BULACAN
804,162,695 *536E3248995F0FAC8693AAABAA844C5F81CBD92A DEQVCU
804,162,696 *53653733AAA0D82669EB56C17D8C52B93C9C4661 devonrapuano
804,162,697 *5363069B79CD27DCECFFD0B8842B754AD0013620 deweyshad
804,162,698 *5363A9670064E0137C8B12D580463D6D20A5A8C8 D_GBS
804,162,699 *53687CA0B9F4D351E14D4B93F7BEB509727C5322 DIFQB
804,162,700 *536F01AA36DD9209BC829A28D83EDF82CAD1B10D 1BEBREWING
804,162,701 *5368294FBB4BA98DE8506E7F7474241A31E025C3 dima-rawashdeh
804,162,702 *53623AE8E215CBA40B35D0A9E0BF2ADA733A7321 DIREKTNA2
804,162,703 *536DED0C6A24D4E6146509DAF67487E23025A2A1 1DORFBUCHLADEN
804,162,704 *536C916E97967C823A0BAE33A4A24F329B1EC02A DJV+%
804,162,705 *536E4CE505158346E74E99FEF6FEB80CDB6A04EC 1 ENDOSTAR
804,162,706 *536242B023B1EF1292564C2A0E1BA5102A61D5EC 1ERRAMHCS
804,162,707 *5362E00F0D79C78F61396D39A25298C1F1842B6F DK/FR
804,162,708 *5369BEC8EA1DB11EE87ADA674FAB53192AAF3A22 DLEVREEMED
804,162,709 *536E01694E3098AE9B419EF10BD7570E6A2EACB3 D":LM
804,162,710 *536EC0A00445A83D38620D23C8AA37EEA3ABA233 1.HALLENBRAND
804,162,711 *536CDDDD22BF8F045C95D6206AD388828BB2FD47 1.hiiltoj
804,162,712 *53665C26EFC8ACD095664468C1C167DDDD5180B2 dn3-n
804,162,713 *536027BFDCB380A142A54A13E2B4400DD730086C 1.mdr-angaben
804,162,714 *5366D610F891C457B32D19A4D1DCDB612A3DE346 1miscarriages
804,162,715 *5365864615CD7807EBBB8D8478D41469A0E46D4D 1PAIV
804,162,716 *536F5A1D381197437C9689BFB3106CCB9E6DD53D doo%7
804,162,717 *536127CF89B0DC1889A18A52650CC28D8F132099 1SCHIFFSHALLE
804,162,718 *53633F5CBEC693A068AE926031ED414485919FAB DOUALA!
804,162,719 *536B198AAB0F221C859CD87C372949F4A99EBD42 1-streptokokkibakteerien
804,162,720 *536D198C27FB948AF5DD4D239EBA9B148F295D44 DOWNCAS+S
804,162,721 *536F00B95277125531529913251E1A1DEA00123C 1YIZKORN
804,162,722 *5369C10BF9CA7B35A4AA026BDF93E60D4942EC6A 1yritystietokantansa
804,162,723 *5364D3D21A618547D9AA39F769884F4962A60B73 DRK3
804,162,724 *5365FF34F973261B163A74B4159BB45FCB32DAE5 d+_!u
804,162,725 *5364C23EDCF770926A254BA4DF4027EBAF352D3E DU-FX
804,162,726 *536000B58A619A121EE9759BC4C008537D781CCA [email protected]
804,162,727 *536B5EB8CBAFB32B27A4B3A73D01413D5BCD937D d.+v
804,162,728 *53602A32D419C8860B6E6B4DD9C734F3678EF653 257HALLE
804,162,729 *5364848A65C95622DD6BB06D6CDE93E09AFA12BF D#=W
804,162,730 *53677B1340F73E5F1649E0E3C38F4C34A8AF9551 276kahvalti
804,162,731 *536549F9C7D51322E5FDEC4CB6B684D3240C61E3 2785583 dasschlimmsteist:siewarmalmeinebestefreundin.
804,162,732 *536CA635CF4F814C6B497A81EEF0851D6B664A4F 27nov1767
804,162,733 *53673BC9CBDF0E2DBAB659A22C628FE64E9B123A 289267 SAMANA AIKANA ELINKUSTANNUSTEN NOUSU ON OLLUT 20,3 % .
804,162,734 *536820A7A172040E933D1D446768A12B118657B1 2911682 kortteja.voi.olla.k
804,162,735 *5367F53B2289F9B93791508AB154F0830D537C84 291 v
804,162,736 *5361A4986F59BB88304E20D69D15D8852218D217 d,z:=
804,162,737 *53655CA04863D64AFB42ACB8CCE9403295223C2C D)&ZD
804,162,738 *53659A7DAA03BAB41AF61EF10917846387D59B1C 2-ansagedienste
804,162,739 *536DDBC45CE3671643F15638213ADF28C1B17B7E 2ATEENALA
804,162,740 *53686F0F89EA87EDED51701F022FE069A613D7F6 EALINGE
804,162,741 *536B15A1F9BD56BD42DBCD2F6CDE839ADBB06B81 EARLCAPPER
804,162,742 *5360384CCB4856B53AD75DDEAFD4C0404F34A458 2epimaco
804,162,743 *536EEABCCB3F4C856E6962CB62064B10504A8A48 ECC1E545+C41NE55
804,162,744 *53660CB3A55033E81A3FA037A65713222EF0AF89 ECOFINASRL|ITALY
804,162,745 *5362FFA78FE58446724A16A1AF3691B340B72C09 2-HANDBLOWN
804,162,746 *5363360D846C1FA31D78062526E7F5D43905E3BF EDAHONDA1
804,162,747 *536C188F1891D33D32D0A0C686F6ECDF0526B665 2I5SKCKX
804,162,748 *53627DB28C559C8883C52172E381E6D7065C756B EDGARENRIQUEZ
804,162,749 *53646BF48E2CCE8A4DC7E8587D58A8777732BCC5 2luksusmatkan
804,162,750 *5365F74ACEA5F17976FDE271A6573C12C0037BC6 edmundoarbogast
804,162,751 *53603346DAD90B3F2A212FF644A994B0C94B5F55 2NOHENAT
804,162,752 *536B6758D19D24914316E163DA6090A9EDF339CE 2-puutarhakutsut
804,162,753 *536722FC0D11BD6E1AD12B0FCF1B84362B6A9A4D 2thescoobydoo
804,162,754 *536658F979685F11D105D9168FDE218F797C5C55 EIEVEDISES
804,162,755 *5365D8F0CD2D431CF9FF2822E0A7A91980BA3540 341NOEMI
804,162,756 *5364D98DCBF0EEB8A12B85D6C1A0796192C6A7A1 375532 samallapitkientelty
804,162,757 *536336C9B406BD6A71601FCC85D6BE5BB528EACE 391290 theworrierscitesomeworrisometrends.
804,162,758 *5361E6E30702DC85308638E9F66F238B5B653EC9 3ARACELI
804,162,759 *536816391508BAC43ABC9B0F652CC270E0193ED6 3BROUGHTON
804,162,760 *5364FDAA9FC61ABDDA1488309981342E9B456A2A 3EVEHCARA
804,162,761 *536CADEFA25312F7027F544892C1C835ECB16479 3IAMSPUNKY8
804,162,762 *5365B2912B2A8BE65972E01B7FEF25EEE991F55D 3MEDIZINALRAETE
804,162,763 *536242FDA325D1FA01B67A20555B7EEB87B3E90B 3MYTHIIK
804,162,764 *5366D40E40A6CCBA2974B8EFDCF0B97E7BD28CA3 3.NATALI
804,162,765 *53629595ADE3C1A457D9BB288D04EE6C494B31AC ELEGANTIAE
804,162,766 *5364E30BAA58A4ACA7751391CEDDECA21EF0A7B8 41N1C03S
804,162,767 *536ED650100F3027F483FB561F9235E8214F62EB 4ANBIETETS
804,162,768 *536CDFBD877DE68B8E39F019D024AF446CAAEA23 4APRESSAR
804,162,769 *536034FC0DC85DDA908CF5DA4B7B20EB4CB12F5B 4.CALORIE-CONTROLLED
804,162,770 *5367D85AF57363197DE0A94A3BB753F5161BFCD8 4DESYUNTOS
804,162,771 *536AFD839C1394637539EFF08654741B49450DD9 ELLIOTKAYS
804,162,772 *5361E15370B6E02A92CF6C4EE8832D5EDC0933F7 4MAINS:IIIVALSEDUMYST
804,162,773 *5363F9C282803E703D00EE1918AC4613E9A5AE09 4NETHCILREKKILF
804,162,774 *5365DD993515521BBA50101E93BF93B21E788585 4PEEWEEBASEBAL
804,162,775 *5363EACCE351AF5206EE3D427B495BC845445055 [email protected]
804,162,776 *536F5F07E8136EAD5B975837CDB17E55407005B7 4STUCI4RO
804,162,777 *53696CD6E6CDAB185BF0ED481AB6394EDDFD64F1 emmanuelrowels
804,162,778 *5368F57D19B7F012352BFCBEBC48C315A08B7065 4WITUTEN
804,162,779 *5363A246E64598864A528634B92369F1D9DDAF7B 4 ylim
804,162,780 *5367B3941F92C43EFEE591F66F4961427E1E5570 543ALEJANDRA
804,162,781 *5369AFBA4169F16F7A1AB7B0C2E4F34BA6FBB5CB energetic.rhythm.(original.radio.edit)
804,162,782 *536943E64BDC53AAC27FAA9492A5B7F97A46912E engloberiez8
804,162,783 *53629B50A1BF7E9739C5ED8D0BE0289F14CE4014 EPPKI
804,162,784 *5365C6B05A09EE4307F9A1BD676687B998BF24D0 EQUARTELÉ
804,162,785 *5369812E9A80B05E82941FB35DD93C19A363F2A7 5INJURIERE
804,162,786 *5369A0E6157750BE7D8705A0A513621810DD970B 5IZNEVJERIVANJE
804,162,787 *536F6A4C7D677F62C1EF366BD40F349A2B2716D9 ericauslam
804,162,788 *5366878E60924EC0B1114AFF9F1FA97EDC3B46A9 erichgrabe
804,162,789 *5369DFBC829EC840F7004F34673E77285F86DF25 5LEDENWER
804,162,790 *536C26415983F26A282A4C8517F3FE0EE0F35605 ERIKA.BAZAN
804,162,791 *53684A9CA7EFCADEB2BBC3F8B8B6450E8D81F313 5MACROIBEAIRD
804,162,792 *536F57F0CF5C8537F8F277623169BC439B995DD7 erincreglow
804,162,793 *536B391BB65B5E76F4C680D9C38974196FC9CFD1 5MIRRORTOM
804,162,794 *536854EC8297876A05EDB2A322D458F9DB18E564 ERNESTO.PINELLI
804,162,795 *536168F8C049C33A30F4E9B327694AA03FD78966 ERNIEVERHAEGHE
804,162,796 *53679C36C1BE5964803124045C1FA8129D798D65 ERSCHOEPFT7
804,162,797 *536043719F4C5D3EA1B5748CB68CA6A138B16FD1 5REGNIREALKRESNOITKNUF
804,162,798 *53672E62982978F42AF4DD9814C4F27D2FB1335F 5ROSEOPURPUROGENUM
804,162,799 *5368EE8B32058BF19D547DFA8BD56BEEF0B8338E ETFAHNEM3
804,162,800 *53674C59EEBEBD97F95746388A2DBAB5ACA5A428 ETHICS)(1983年)
804,162,801 *5368C8FA94E14F3D0767D40EE442D82C4ABF6E57 5SANDYZXCVBNM
804,162,802 *5366A4ACEAF26037FD3FFB4B82E2B9E7998D4B86 etu-i
804,162,803 *5363C5468DBA3AF07A1A64D77A777EC5534B37D0 EVERETT.CHESANEK
804,162,804 *5362E85022DF0E8F2C1257BE053D20F50DB82C75 Every.Song.I.Sing
804,162,805 *5360390C97C91C4739F5C204D33718505C465B14 663 . URUNLERINIZ HAKKINDA BILGI VERIR MISINIZ ?
804,162,806 *536662EACC2A0F206575E73B46D288DC2B580900 [email protected]
804,162,807 *5362193987C1270CF7C1017ADE4329C9984C4C5C EYPISEKDS
804,162,808 *5360BF97D875E8A2FC795FCE1ACA39D82D1FD18B [email protected]
804,162,809 *536A365FA6C20BA146573EA521420E31D190D33D 6ketelaars
804,162,810 *536CF994F87A08E6A66AD088F220E78D01C422E7 [email protected]
804,162,811 *53653B5AAA69A5B4BA236DAEADE93FC90C0FD60A fdstheme
804,162,812 *536A5C5F3BA6DD17F222FDF0CEE6F37AF84D4BCA 6MISHAPASSWORD
804,162,813 *53678191056ED3B022652E38A2605C5F99B4D767 [email protected]
804,162,814 *536C106EDCFD8DF228AD7D607F2CDAF9D332644F 6officializing
804,162,815 *536DDFD2003A8EB813654A7C178592178DD06460 6SKEIJOJA
804,162,816 *53605832D718939481F4D3CA05CE72F4BE2B6578 FHBBLPEVB
804,162,817 *5363E63F6E696F1770FF7582928EC4ECBBAFC808 FIDELIS.SIGMARINGEN
804,162,818 *536EDB52489B7270221233277E7A57461518CC76 FILIBERTOSTRUVE
804,162,819 *536CAC29270EE638DCF35B606FD9DF025350E51C FIUWEOT2
804,162,820 *5360E76F520AB0EBCC7C4A6D54FFBBA02502B9C8 7111111
804,162,821 *536134EB7CF67FDD7FE285D862ADC31E16E959FE fo$73r1ng$
804,162,822 *5368EE41D6E7E2365B3BC1C8ED1F3C0ABB4B9BDC 7ALIENSJUDITH
804,162,823 *5363EA27461188E3DFC80DA9783666D9DDD1B978 7AMAYUOD
804,162,824 *53619E41DAB5A0F654EB4C29BC36B8C1820BC0FC 7CALASIRIS
804,162,825 *5362A45B7BC785E1D735F35EEBF347A4C3B53A60 7CONAGHANBSW
804,162,826 *5369C780CE525F32E2EB95490D5944E05F1F24D0 7DARWINBITCH
804,162,827 *53612B333F0CA66BE183BDA7D31662B96F01114A 7GEGGEEEEGGEG
804,162,828 *5362DA741274A54DEF727140F54436351A383782 7GERILLTE
804,162,829 *536C930F769E04AC33FCC3BDC20A829858B72ABA 7LEVEILYL
804,162,830 *536B33FF09C1688FC5E20B84C30DEFC86B9EA276 7midlander
804,162,831 *5361CB6649BC5AA79390405C69A37EAD16A5D151 7NEKEODKAZ
804,162,832 *5362010B1CF18530EB53EE64758626025CDD2240 FOREST.BOLL
804,162,833 *5361CD902724ABF6AC3F8471DEDEDEBEDFCC67CC FORZAPENNE
804,162,834 *5363FF039DBC9A8AE860B08BBF529324760710ED 7SEMIANAESTHETICS
804,162,835 *5362FC357DD284D00E795A7E63C8AED0A4527456 7SHVETAAN
804,162,836 *5367B7115B47C4C12539AAEC3B68072682795DBE 7SPEEDOCANNONDA
804,162,837 *536EA5D78315730352CDED86860C4562916168B5 7ueberweisungsformulare
804,162,838 *53660415D230E4EA1129C3ACA5B9CA6B2ABAD331 frankkrishun
804,162,839 *536523B7F854F247CE57B92580F86787262D426A FREDDYLYAS
804,162,840 *5369D7E697BA2A59E8B1476AEBF17312A09A99FC FREDDY.MENSAH
804,162,841 *53621BB073D14A1AD573229C39A3A27F263F9A50 835ANGIE
804,162,842 *5360FCBC1987C034EF0228EB856F46C8BB9AF65B 88.geheimverhandlungen
804,162,843 *5368849355793C6A423CA08E2CC3BA5F3CE86164 8ARXONTIKOJ
804,162,844 *536AB02583D1D4FFA4F3D08B67AF272C347A4989 8-b-~-~>-b0
804,162,845 *536DAFF4E3D986D0300662BFB56CB979581B98F7 frontozygomatic
804,162,846 *5361CE75F5952C97E9F3E1A8135D2B1E9DBA3B9C funkyouup(short12"version)
804,162,847 *5361BFAE9AF8C8F038D7C4B9D5ACFD4175E4613F FU+UR!+Y
804,162,848 *536B7B90C79FF3D54BC671262ECC66AF467E5611 8iluvocean9
804,162,849 *53616F9E6364BB0A4AE29C56AAA2E9CC1BFEAC6E 8KJILEFOL
804,162,850 *536FFEB8E9E716969A042169582E6715632C0DDF GANGLIOM4
804,162,851 *5363B1DF1B5B32169C851C9028B31865C786C8F5 8LIEWURLY
804,162,852 *5369494F6D78213FB060B9B750B34BE8FEE05D19 garthmarkow
804,162,853 *536D9852C8A84FB04DD02A9CCB43BA000A77444A GEORGBRÜCKE
804,162,854 *536FF8C7402DF10871DFFC2B62003C017BCCAF42 8=).~o(x)
804,162,855 *53635D3BA8003A96EEA947F0864E1447DF9F5466 8UITPELDEN
804,162,856 *536037B3073F6B5888846B71B860E003DFD4FF90 8XMMXCEOGV
804,162,857 *536E12694C010705E2BCD2CAAE5AB735F3DAB5A8 giveuponyou
804,162,858 *5361045FAF27D1F54114568349646C651AACD1A2 9ALLOGUINNESS
804,162,859 *53634BFE2614EA683D8F5AFF8CE95A4CC62915B3 9CHLAPCEM
804,162,860 *536A8520050EF103CD9DAAC435B5ED6E3C3E54A0 governmentassigned
804,162,861 *5361D6E2170E4D6F6FBF8F2C9EC08BA0AE4B5283 gpaug
804,162,862 *536358D0A87FF3E5942F63B587F3E66547373B7C 9JENICEJENICE
804,162,863 *53688227966DBE7F0AAD4CC22989C0C0A9D66C1C grain-filled
804,162,864 *536CA046641A8646F780A56EF1D989D63DB97874 9mypassion4
804,162,865 *536CA45439149F8B450BBF96F31029A5DB2D05BA 9NLEGEIRT
804,162,866 *536ED0DF03921F77B4A7D23C82E73D8B6F05832F 9OTEBREBU
804,162,867 *536EA053B49355F9ADF6A19F8920B961FFCDB52C 9PROGRAMDOKUMENTATIONERNES
804,162,868 *5366B27F131489BC8F01E317E90B2D30C900ADCE 9RAEFFLA
804,162,869 *536FA131B820F75BD45C57691562034B9CB7F46D 9SCALEDQUAIL
804,162,870 *536CDFFF641F32D38BA78F55D948542BA6F9C23C 9SHARPSHA
804,162,871 *536D312EF3506C99793283922086664266FE706C GUFTAGO
804,162,872 *536CE625104C7147AAAEB1E8738AA740F61080AA GUS.BUCHMAN
804,162,873 *536391169101D50590A69179A3BB933BF73DD425 GUY LAFRANCE
804,162,874 *536475FBBF04FEA82CF01858CDA67E62A7D23661 g~-y
804,162,875 *536FB73BCB8B47CA4DF206ADB3A5FC59B7FF427C 9ZANTHAR
804,162,876 *536B25E848FB37A0AA1EDF01C57CF617286F91E0 HADJARAB
804,162,877 *5361CB52F3539C1BFB54D7136DB3A4D087066624 a7!vt
804,162,878 *5364CF66B0A13B766959B6F84E5A8ACD45968139 HAVE YOU SEEN THIS WIZARD?
804,162,879 *536CF9159E98AE15DFD09A210115129C617FBFDE H,BF
804,162,880 *536D8ADFD86E1B07118204026E9B9603AD6CC5C6 hectorzullo
804,162,881 *5368FB7C6E274CA4D66358D47D0FC0915BBE77D7 aab+pe
804,162,882 *53626843E6C6DDA5DB3AD33BAC8A34E120A34834 HELIUM-ERASER-BENDS
804,162,883 *536AC040BF19C23D0BCC438186A5D24D8C0AA3B7 AAFIV?
804,162,884 *53682844C818419B67981BAD97EA8CE580DDBF71 aavu
804,162,885 *5364765891C47CB0E847A0A42C683C9AD7E0EA9D ABDULPIGNATELLI
804,162,886 *536A2AC434114B7EF085D8CA882B931F01C6BED2 ABERSHAM8
804,162,887 *536E4EC6729C2F2B5D43E529075B1865B32667A8 [email protected]
804,162,888 *536873712994449D2C5969FEB3E07D6A6DEEC34B [email protected]
804,162,889 *5362D98DCFBED5F8A37ADEB5DD5DF15B808FD3D0 ABWOLLEY6
804,162,890 *5368C864F8AC19DA17AF5092A524EB0FA0F75A1C adburner6
804,162,891 *5368391441A26A244F0E70F86E3D086FE864F27F hnareita1
804,162,892 *536D585156726FD45F3651B62B73DACC1C7047A9 homeabled
804,162,893 *5366C343BEC2DB6CB7C3AF4910A8A9A104A553D9 HONG.LIPPEATT
804,162,894 *53612391279EC87B8E1F7EAEE89FECE9D84B8D7C Ad.va10r3
804,162,895 *536ECA28FEE44137B17B33A750E1A54B7DA2C7F8 HOTHOT21
804,162,896 *536725B6F41E7C4C9EDC184702D12DE9886CB587 afs+9
804,162,897 *536CA4064DF93C0FAB2F17078E6F97A49D057117 hp+o
804,162,898 *536B03E264B4BEF45F0E2A29A3AD1B81BB0F089A httpwwwyarumalgov
804,162,899 *536645E7579D4507EBDCB07C65A86E4223C4AD6C [email protected]
804,162,900 *536FBE4819EE72B6571226DE206928DF6CC89DEE ahmaddurnell
804,162,901 *5366D1E8648411351019343FD8B89C22D5E4B805 a.:i
804,162,902 *536E2DAD1604314CB28B0A7B3E4089D1D610E2FA [email protected]
804,162,903 *53640618938E11519B1FB48657F4CA84234D2B94 HYGIENESCHEM
804,162,904 *536FD47AFE9BF4B3838677AF75FA4B32B6FE0E97 hygocybe
804,162,905 *5368F717D167E5E4EECBDC0AF872E9DA66156B55 I86686
804,162,906 *536923CA5FDF094E812EC3C94D977C19E70B0102 ALAN.RETA
804,162,907 *536BC87D243B6D029C7504DD531387EAC90D87B5 ALBERTOAMBOREE
804,162,908 *5368212CA971950B5900EB6624B7678C4D6EC915 AlbumVer
804,162,909 *536628550D7A4E7BB7DF94884EAF15669B90092D If-that's-the-world's-smartest-man,-God-help-us.
804,162,910 *536F31622207C4F08A0DBC87806B680C11AA2AB4 allaboutpraise
804,162,911 *53612AC49FE30761EE14D6162C18847984D3C8F2 ALLENREARY
804,162,912 *536FF54114AD0869FC4F296DF2F6587FCCDBF344 all-this-love-(feat.-debarge)
804,162,913 *5361417C1A5BD72D840784D614C4D8AE016C608C ijzingwekkend8
804,162,914 *5366DC5A93703665862F11503F7830FCE12EB7F5 ALTON.KAREL
804,162,915 *536D2DE3E139F394BEDC69307F3E6E034B6A7F71 ILOVEPARTNER39
804,162,916 *536176514A6CDDDD38D4178187C783D22096C2A2 IMPORTANTAGAIN
804,162,917 *536477915CDBEEFEED8A34FBC3549383BA9C0E51 inc063n7
804,162,918 *53621A28A55136EF4A75B062B0F86A7923D777AB ANDREA.RANIERO
804,162,919 *53659C3765EDE34406C2B58080A1D130491801FF anehsmav
804,162,920 *53676804EF7E7A1E679E74A14CF2AD643CCD2A0B anm`
804,162,921 *5369AFB9636C390BDC8A498217EACD3084F95950 inspectorcool(:15edit)
804,162,922 *5364E7122A0F05D39705FFC6FB77FBD95891CCF0 antípsara
804,162,923 *5363B06A62B43696BB3EE90421E8ECF9C8954A39 i_pb
804,162,924 *536D69ADA7C39BDF449BBFA319D78F51D9B9EFFF ao:
804,162,925 *53687FAF5B4DDCF0688D510063D3FBCE14C2934E AO:V
804,162,926 *53619A962BF1DEF71DBA220DC4AFF5E90D136C28 APROBOUSE
804,162,927 *536D4CCF8DF2CF54C034C70AE73030AF2AF67AFB AQ:)
804,162,928 *536C7AE4D3ADED7E5F0DB8F38FCA026E21F440AB ismael-smith
804,162,929 *53650F231FE41E518D07C2DA9DEDA0B649F739C8 AQBHM
804,162,930 *536533F6175DCC0DD49E48123E8ADF444C3EE13F it'samad,madworld
804,162,931 *536A464C907A05870A951EC427D922DB9665B726 J16663
804,162,932 *53613DCB0E9F5FFE8406452F868F595DAE9805C0 ARLENCHANNING
804,162,933 *53662A057D9DD79EC16FF1BD20EF784AF07E319E Jacinto-Chiclana-(Astor-Piazzolla)
804,162,934 *536B48D8B60A9AF3107D03928A440C10164DBD4D ARMCHA!RS
804,162,935 *5365FAB65BAB08AE8EFFDF7E5BE4797E2F04E4C7 ARQG,
804,162,936 *536473E61911CB4BE2EC4A316C77FC3F92ADB11E JAMALAUGUSTA
804,162,937 *536D3DCD16EACB52B31DC9B3B955BD3296233C6B JAMELEBERT
804,162,938 *53651217D83097DC554BA3FCCB1466ACE3CB5A5A JAMEYPOCHATKO
804,162,939 *536023CF6D795F99F2B4AE4DAFF5DE7AF50DC004 JAMIEDUSKY
804,162,940 *5368407C25C073ABACF4C4022958E5543DCEAB63 JANEBEDNAR
804,162,941 *53638987A14672BDF01A772D3CC8D00B0792E629 aspiriined
804,162,942 *53625BF3D18401EDE119F03B2695D50DC2AD328C JANE SIKES
804,162,943 *536D9AFC74BC374B1481A47EB8AF40BC3789A0BE [email protected]
804,162,944 *5364310F47DD1DB1E567E15C7C634583C64FEE44 ATBBH
804,162,945 *5368CE85BADE50BD62B35164622F930674B529FC JCENAWAL
804,162,946 *53659B380D1B8068A45780F1914BE8894098E397 JEANNESAGAN
804,162,947 *536BAC56FFA3BF0A576CB058CB9E48C577D182BC a"vsi
804,162,948 *536F85DED531ACFBF0BDB62C6B62E8E05DE3A85B AWEHRHAFTER
804,162,949 *5369DA0294BBE0864660EB2FFB0700673C2DC12C JERRODCANAAN
804,162,950 *5366AE30D1D2B66826463FFCA1C4887A81B7A4B9 a&wk0
804,162,951 *536D02A69544F68EF24ACA0C87639021F235AAEF JESSOWENSBY
804,162,952 *536C5E6211B5542303E3F92F2E7BCCEE794DF4CD JHONNYCESPEDES
804,162,953 *536E3B8D2C3BBAE17A85EB049410B381D0129F0B [email protected]
804,162,954 *5365337E97088601E39DAFE816F754010F5F8556 b-> ~ ;)
804,162,955 *5362D3C9122BA4FDAB399274627D6BB538B38385 JLUBOTINA
804,162,956 *5365CC1B44749EEDBD75199BA4370A5F5D9E296B JMAR4899
804,162,957 *536D17E448A027DE3378D6780C74A572A6962633 B0+HI
804,162,958 *5360F0203A2338ACF33D1339AC5911871B26CDE2 JOESPH.HOFE
804,162,959 *5363551C1F7D4AE7B63BCBE3266A3F53B929ECCB b2r9k
804,162,960 *53622E16D6E79CB951AC0F03493DEAC7624C0BA9 b3=xd
804,162,961 *5361BA1344B23782160E35368BCB149AFD724450 b4tk,
804,162,962 *536F5439F92A8DB6872C805B9EABD678F9082C8D b55+l
804,162,963 *53664206B50B4DDE138DA9983127D287D4BE3F30 b9:hl
804,162,964 *5361104DBC4399A28E5867AE4750AA94C266348C JOSUEZUCCARO
804,162,965 *536DB0F5F30FD678CAFBC71C992384D8B2DBD456 JQ,W
804,162,966 *53636C74D8092AC658F361EBB8FAC70E777841EB jstrent6
804,162,967 *536B72531F87F3E9A8EE3F89A2BB58C792D00F6A BARRYRANGER
804,162,968 *536D4D3C858AC396ECA926F5D9E5F439614F2918 jules215
804,162,969 *536292F00E7C6DA81273F249A61C4B9165D6D54D batuj
804,162,970 *536BF05685FAB184A24F523AA1B51F5DBEC517CD kaeden867
804,162,971 *536E69215D8926B824ED239154DC59A1F3E900D4 beats-&-ines
804,162,972 *5368B5E0F1F7099D9822EE346DFE47BA7F928185 KARTIKCHED
804,162,973 *5361AA56385B117086168883D661AB16F6302A47 KEENANAPA
804,162,974 *5362EE40F4DBAC2C278D32C3A13222EBF5477835 bermudoiii
804,162,975 *536E4D5B3EFCDCAF480D50CAAC511499D2C1F8FC kennethsinkler
804,162,976 *536E54E4C4C10706AFF3F53ED308D3E7AF9829A2 KENNITHSCREWS
804,162,977 *5363DBBAF9C75CDC64FF88D284B2C80D27D0D1EB kennyou3
804,162,978 *536AE01BE432E1A8453167233D477BC248E07B47 BEVERLY.ALBRIGHT
804,162,979 *5366AB524EF89DE2191E2EF8CB7223035245BB0F KEVIN-MERSMAN
804,162,980 *536F0BB05308C527CAAE8BB74D08BA93C11C2FBD kiangpu3
804,162,981 *53641034742DFE65CD195EA060DCFF0B55D5DB95 kin3t0p14
804,162,982 *5368F85393B036BAFF5F8B0291ECAE7C66050842 bjro!
804,162,983 *536E322A44C487B388B4323104335CB1F89036B2 KONIJNEN.
804,162,984 *5363C27117738D043E48B985C56EFE56B9AA5F2C ˈBɝMɪŊƏM
804,162,985 *536C3981A1010F55215CEFE989DE3368DF0A6B6B [email protected]
804,162,986 *536B6E00E5C02F75F06021331A6EF3966A6DE539 [email protected]
804,162,987 *5362316814092E73708767BBCADD03D9FCBD2165 KRONGTHAEW
804,162,988 *536AAF4436CAA0128F8BC9613450E6ED3CE1C9D4 [email protected]
804,162,989 *536306219F1A1D56C6881C9291C0625E50FE1C21 bohce
804,162,990 *5366C51441A7DCEC2D7DE1711E1998E56CFC37B1 bookstacking
804,162,991 *53643E91432F3D67015C864180D71D4AB244E784 BRADLYCENTENO
804,162,992 *536D36F4B1AF6B61FF1EA58176EB987E62498E19 bree92
804,162,993 *536A59697B33B727794C8CDE471F48AF9BDCF98A BRIAN CORYELL
804,162,994 *53675A84243155BBA973E825F618A712BB0FF8CC LATITUDGRADOS
804,162,995 *536EC299F8E940B2C2CDE6D4EB8D600B85820C6A b;rky
804,162,996 *53678B061FC4F2EC19A4CB83E942D24A153EDD26 LEAHCIM9
804,162,997 *536D52D7F7F73E36B035596C51FCF5287647FDD2 LEMUELBOVEE
804,162,998 *536B52799450BDB7619A80AE31041F3E3E50A860 b%tr?
804,162,999 *5369773FBCA77D12A9BE3D924B839F77B545E62B leonardoroncskevitz
804,163,000 *536353ADA1295E174BEDF909DFB8C0EEFE99394E [email protected]
804,163,001 *536E798202802024014F1556E1474B0828A8ACF3 buckkathy6
804,163,002 *53657BE567B3E50D2F7EB4952C86FB4D0A45D0CF BUDOY-CANLAS
804,163,003 *536F677874AB7A0DA27459BA9F65C1F5E1526465 buforowa
804,163,004 *536FF22AE822A6E1589D8B0B89ECD952C5C7816A levy.salazar
804,163,005 *536E99701E3BCB97C148902A97BD21EDB846170B [email protected]
804,163,006 *536FBB2FD6B183B972A12F94EE7A492081E2B65E BZIYR
804,163,007 *536865ACBE604511A6C6D8058F7F5693A430F21B C6Ut
804,163,008 *536E3851A386454194772940376F2F73713C3B20 LIXÈME
804,163,009 *536FDC3FB7BF73682B4BB7313DBDA2101B76DCF9 CARMELOLANDEVOS
804,163,010 *536039883C09D722CD29BA347CB2F43132690CF1 LOBAILADONADIEMELOQUITA
804,163,011 *536C528F95149A0F2C90142B4CD0C391634EEF1A LOVE67YOU
804,163,012 *53696FF0EA2D8AEA7AD819234374B11BD283AD80 cathriel7
804,163,013 *5368F25D6D38EF8FCBAFFB4A5916B3F7C28C49EA LSGNIRAN
804,163,014 *5367626DB131355E8EA7BB4EC9B7FBA8E624AAC7 CBCKLEHU
804,163,015 *5365C06D97A704CBFEF1BADD976C0906D3D17F30 LUCASSETA
804,163,016 *536AA3A3263618BEDC9410158C70501D095589A7 lucieharper
804,163,017 *53613F18F84B80AD3E43F4511E76333A345AD017 LUCIUSCOSMAN
804,163,018 *53657D28772EB550D09A88AC5A9C4AE083CEAE1E LUCKCHUNG
804,163,019 *5362DA51B137D877075762AFD0550490912C3592 CDICS
804,163,020 *536128E400A83D04855A53C1C633BFA1987FB727 luvles
804,163,021 *536906C853A1E056E47345294B0FD7128431274F ĉernigiva
804,163,022 *536D895FF827DF5B32710F0E65B374F42608AC08 madison.davis
804,163,023 *53657F1927F0FD73C2F9EAD44EC36F85FFC4E584 MAEDONA
804,163,024 *5366D6E06304268C882DCF5C0651554B2939625C CHADSEALES
804,163,025 *536D0ECA90DA6ABD461D66D0FC84B90B6D9F7C41 MARCHES
804,163,026 *536CD2FDEB6D13F65F2D274058D4A5829947F87A marianobeshero
804,163,027 *53638A422E7887E3AE795ABB39275B80EE9D4AC5 MARIANOSHURTS
804,163,028 *5361AFB869AF5F1CD2234B0483129042784944E4 MARIO.YANAGAWA
804,163,029 *53621940D163BA74D9BF27A1694930DE4ECCD373 markpeatross
804,163,030 *53647362A116C655AC7F9D3F8022E90220B9FDDE chrisna-van-zyl
804,163,031 *536E314468EBDA3DD00BAC12DB1B11A12D02BE16 christiancockfield
804,163,032 *536E20722BC018E55E512FD555D28F744C87EB77 CHRISTTHEKINGYONKERS
804,163,033 *536D663B15FDA9667F15E3FB547B6A181581CA33 marshallmcadoo
804,163,034 *5369B3ED9DC7A8DC3DB00952C96E79402DF0D817 marvelous.emmy
804,163,035 *536169F0465F95B671A26BFA220CB6BF17235C98 C-_(I
804,163,036 *536FDB7C3C92D668147E29D313B4C42677944E53 CIYVQ
804,163,037 *536CA005AC6DECF45A47F6F4CA3C0344C3003637 MAVERICKBABIES
804,163,038 *53670AF3249E82A9C9EEA95C75572BE84E5E8972 ckvj:
804,163,039 *5365D4A1BDF2FF0FAB6AA80D33D469F2871E640A meadconcerningthatprayer
804,163,040 *5368F41BF62C8BF78CB217B0357167BED392A633 COLEMANFANTAUZZI
804,163,041 *536EE0D44709774CF9EA20CD76663B79C6A36D24 COLINHOUGH
804,163,042 *5363EDB89EB296C14F1D324A5EE711E943A49E82 [email protected]
804,163,043 *536138C564F51B3A1D993FC4CBB906EB7F83ADFA misaines5
804,163,044 *536FF53664EE06F2ED32DA27173084C17DB41709 [email protected]
804,163,045 *536F0B63B881BB3BF76FCEBA818ED0F6CE4C26D2 [email protected]$
804,163,046 *536C1E026B775B852E9705F299CF1C3EF7910C98 MOMYDNIC
804,163,047 *5365E9F6E8081EBBDD0152FA12985A3A9E8CED61 mon fr
804,163,048 *536FED6FA05775EDA3DDFA025CE6AA9637910F67 moseziemann
804,163,049 *53608F5DAAE52FD477824AA64EB2A18EE96B0C4E cqfc
804,163,050 *536AA7472CD6D799457C27F7D4871AB9A36B498C c=qxr
804,163,051 *53606356FEF562BE7CEE79D80126F8B11FF377FC CR;L+
804,163,052 *53630129DBFB794C9046C1C501EEC751A81A27EE cswpr
804,163,053 *5365D25379644AC78756953A5FE0A8BCD8DD3B49 ctn%b
804,163,054 *5368B239A4681B493642709F3F34F3C06F78F2FC D5&U-
804,163,055 *5360E51176B475DC5E31C4872D5605085B22DC30 d7#c
804,163,056 *536FD75151F1D76986E308F57B49A9C89095285B dancing.yooderu.night.(leorio)
804,163,057 *536355D763D6A97CD8E5FC6C0C8B7B46517C540B DANIALPYCHARDO
804,163,058 *5365CE935B9536BD01E7BE0D7AFBC4E7E139A369 noahstroinski
804,163,059 *5368FEB9029C84FCB4FABAE603B9FEA8C2C9E1E7 DANTE.SANDVEN
804,163,060 *536C1D205E1F0A18CD87A8D860C9C3B14AE69877 NOEL.DOLD
804,163,061 *536641E183B65BF0577D9B9A3DD45A112B818D1A darayem
804,163,062 *536D9BE9CF56122B7F0A1A275E847C875B788D80 darrinuscio
804,163,063 *536F343093F323F3F04522DC94FA0C7BAE926266 DAS.TESTAMENT.DES.DR.MABUSE.(13TH.LIFE.MIX)
804,163,064 *536E49E54A210F2F5271A3708D9B540A34E5E18A nosselnossel
804,163,065 *5360ACC1302674323372D161AC1706666343EF90 NUMERICAL WEATHER PREDICTION
804,163,066 *5361B8C5A77ACC8E088C610E941C578828E8729E o..Adagio.Molto
804,163,067 *53626513A008BDA083DB363EB6001D930AFA96DA DEBHARDING
804,163,068 *536507BF7B2C3197431D1B266974827792098727 ohmat
804,163,069 *536926D9C3935CA506E7CD49F8348D0B10E77AA8 OLA;
804,163,070 *5360DA6B0C3B3D937AA2649BA1D0F9C4A2FA65A1 OLLIESPREITZER
804,163,071 *53667A4200E93DDE92DF3D32FFA822114C1F1616 OMAR.AINSWORTH
804,163,072 *5367435D984FC8D0DAF05662265031B1DC11615D OMOEIDH8
804,163,073 *536BE1FCCCDD90A955E3F237F36520B3B1A85A03 dfpo$
804,163,074 *53661FC20DCE7BFEC64234AE4F0A1500AC84BAF2 DIAPHANO$
804,163,075 *536980A97710070B3387B8A86EC61C723D8D2491 (o_)~.qp
804,163,076 *536362385E83D2623EED10830C34E370DBFD83F0 OSWALDOELSTON
804,163,077 *536E88ADA3216362E421598AFACFC02AE140B0F7 [email protected]
804,163,078 *5364496AEC9AD4C4661875E22AF09994E0983B32 DIRKCHEVY
804,163,079 *5369927A42F47CE127287A1E0BAC579411F189B9 OUS-WAVES
804,163,080 *536885C61C57553CC17A1DD40D71D3FE1FB6687C DISNEYLAND-SYMPHONY
804,163,081 *536656640133FC1FDDBD4FAE33B9F02A77943866 DITTIED?
804,163,082 *5369E9D0F9AC8ACEBD9ADB38DC33DC6C2616088C dji_?
804,163,083 *536EB7A9E1F4075B7631DA7ABBB5D17AF673E740 dominiqueradomski
804,163,084 *53649BF54975ECFB21DC73448C12F269FD493629 dominoy3
804,163,085 *536377AA98977C4910F7A164A8FD6B729D51E266 donediran
804,163,086 *536394B2543D3B07A7E2B446F0569826EE15370A [email protected]
804,163,087 *536A0ADB931BA7FA619108F723822F7DAD6532A0 DQTV_
804,163,088 *5366D5C3DF577245910723A40CCB1E894803D5CE plazacenters
804,163,089 *536A5C322DE99B714B4D305CF62A736266A93BED driehoekige7
804,163,090 *536CB0281D491EE8E7AC625237BF639CC6913517 DSUEW
804,163,091 *53679279219FE41AD3921389377893102D3363F1 dua=u
804,163,092 *536D45910E29F2E3573A7C3B17FCD2F62197F307 DURULAMAS
804,163,093 *536C67FAB2852B90D712D00E5358971F40B6E80F DYAREEM
804,163,094 *5367E12D631136322DAE0457A9DA0BB4D2A58EA3 PROFILIRATI
804,163,095 *5362C52D785639D638C5E752034A8E70183995CC E=1}
804,163,096 *53666D62A0F18D39E78878C0D2409B7685352252 pxmab
804,163,097 *5366292F3C3AD3E2716D130B6DCBCB0401549E98 EDDIE.LOURENTZOS
804,163,098 *5361067E0573A294FDCF7F5A8E7FD808F14EF879 EDUARDO.TELESCO
804,163,099 *53686A427B4288862F8CAA1C3B781E4F7806CA81 EEFa
804,163,100 *5360722DF58E3FFDB5B42F68402892C09133B60D eg6tg
804,163,101 *5368BEAA54851978D9222756FA40621CD7582E33 EHE-_
804,163,102 *53643F3B95B1D33117ABEA09359DC824BCFA67A1 q------p.`splat
804,163,103 *5369BCF98B2C5FBBEAD82BCE93A66BFE3D00ED89 EISOPTROFOBIE
804,163,104 *536F1B1E50F5DF27C56FE878D24F7D055115D2F4 ekfom
804,163,105 *53607F40783F5D025ADD014C6CE1040E8EEB3419 RAGUNATI
804,163,106 *5366CD0E3411B8EED877C958CA31A3E8B2E58151 elmerforsberg
804,163,107 *53675C4B96D5F93030E1C48D406D35B1E7635E18 RAMIROVANSISE
804,163,108 *536FC30A19573CE7CA6776D0791F0621741BE590 elqe5
804,163,109 *5363357B8AB7B40379E584194C1830D5F84A8FEF RANDOMNESS-IS-COL
804,163,110 *5368C4CF14D7497F3A5F25629F01C7E8E535768F ELWG)
804,163,111 *5367BB9C3533A415D3A723D41981A1C1EF543860 RAUMALLE0
804,163,112 *5360D46C35040680C29280744CF061342EA8B1A5 EMMANUEL.GUIBERT
804,163,113 *5360CCD7B3AFD7AC86DEFFCD1DC26D626FEA455E emo%c
804,163,114 *53644E982BE01E53FF206D4D5EC512E8A025F18A RBSCHRMRS
804,163,115 *536ACBA2A09EA372CA239850956EDF369D97843F rcgulatwns
804,163,116 *536E0BEA80DA27242FCC24A30D818F3DE153355B REAF
804,163,117 *536730CBD746E0A5BBD036086284566F3ED006F6 ENDN3
804,163,118 *536981B17A8CEEF471A00F6370B621483A71E137 REFORMISTE
804,163,119 *536431C928F99EBFC17879CE308F0D60ABAF1AB7 reginaldschied
804,163,120 *536DB189B3AD744F7957409C3FBDA49E11A5AA3B ENYADDAR
804,163,121 *536954C961472BC8B17B7F85741CC1A6BC74D196 REINALDOSCHMOLDT
804,163,122 *53617ADC44D4CA5593550BF685A0B2B1C7BEFC4F epbwvjwning
804,163,123 *5363B0F856590BFBDAC8553E7238CFF2B2972A3C EPISODEWORLD
804,163,124 *5362DC5434B84ADECDA405FE4A8818F572302C2C RENOVERADES
804,163,125 *5360ABBABDE712B7DA1C891A77581E452ED16180 ERMIENS
804,163,126 *536B955BBF450B713CBB8442CFAD7A2D567A6312 Reservation-12"
804,163,127 *536FB93CC7461D6F27E20130931B0D65D7034351 ESTIPULATU
804,163,128 *5366572E04C38860CEA5270721015254145D72B9 etmud
804,163,129 *536CEF245EE52A7AC22D169D0718EE93797BC252 EUSUAA
804,163,130 *5365E859CEF6E6DCEC379C0A60E39B39A81A0EAC richard.crooke
804,163,131 *5367F7B62302202F10733A409D3CB1F312A70CC8 EVITIUT4
804,163,132 *536BACDE84AA5BCDFCC3AEE5E8D497E322309BA8 EXCERPTFROMRECORDBOUNDINTOANDYWARHOL'SINDEX(BOOK),1968
804,163,133 *536ED337B36EFBDE1328CB9963D085EB9D7723D5 [email protected]
804,163,134 *536F7F4A8F59EE297B5A64D51B9544EA267A2F5C RITIUMU5
804,163,135 *536C232039A1D0D6C86504D8906BCEBD59B66B98 ey"
804,163,136 *53624080DFE7A65C1E171C600C16358C76F931C5 riverputo
804,163,137 *5364760631AF6054DAAF19AD6D6373E6DB8E4F12 ezernek
804,163,138 *5368DC0C1ABA642F7C6C16A5C3C46FA08CDF6103 FABFIVE84
804,163,139 *5367A18B6CF941EDABBDB4025F53EC788F4949B6 rodney king (st etienne remix)
804,163,140 *536B47E9DE494B635C35FC9DBEB3D6F9F28D66F5 ronmcmullen
804,163,141 *536A91863392CD3B45BF3932A7DEE5A01ABD2D83 ron.rolfes
804,163,142 *5367BCE9ED6F2EE63218EA70AAD68098F77184E5 FD9AAA
804,163,143 *536122FA87AC48442AAB6DF9A0B6761C123EA155 ‘‘FEMALE
804,163,144 *536FD690C753D29394E9E4E0BCDA167D72CE6A5A RUDHOMMES
804,163,145 *53621FC504D35A569DC02B1DDE019FD30324E5F2 FLORENCIO.MAREAN
804,163,146 *536BB5586E44166D2ED1B9C6D5E284F1E714EB48 FLORENTINOMARTE
804,163,147 *5363480C36F812F56937790439AF37CF96874CC7 [email protected]
804,163,148 *5366537DE72B5613EA0EF4135FE0505993FF81BB runneracura
804,163,149 *536D903636C371094548BCE772A78E61AF616871 RUSSELLCAPRIOLA
804,163,150 *5367E5B5D377EE8530CAB22E0C91980F0CA0B4C0 [email protected]
804,163,151 *5365EE4AC60734E9094AA178DE4DAB211AF57D09 RWOLHOY
804,163,152 *536BD51C6159C709AA9752126B08D5942D82CAEB S0108270191000239
804,163,153 *5367987B4D24D1D7C0CAF80A0F39206C45CDA94B FRANKLYNRACH
804,163,154 *53629EC87E148E57CA9AA74462698EA898066508 SAMFUNNENESED
804,163,155 *536B7E68C008A6F433BE60D933C6FEB19B145A8F SAMMIESANDOS
804,163,156 *536277C9811E9944FD990D6353E40233422D7EDA SAMUAL.STANBROUGH
804,163,157 *536C01478B721192528EA2833889E85900755479 sandrarea
804,163,158 *536BA9B1CD1D85FD7C73A1EB305169C53817034F FUNKFERN2
804,163,159 *536A326E4A39CDF9AFF14773AE2FD7BACA4EB69E [email protected]
804,163,160 *53604896938399C8B6C77C0DDE55607341ACF7DB SBANCHHODE
804,163,161 *536A63DAAECC091CEE5244305CD88A57E12B9912 G>2S
804,163,162 *536C02059A1E2B030E26C8D08A821AEA984DC380 [email protected]
804,163,163 *536E3F3D019530201E305356AC8A27F67319D0C9 SCOTTIEFILBERT
804,163,164 *53614E3C41BE9A5F7491C175E7C532A2F876D084 SCROSCIEREMMING
804,163,165 *5367B2279DC2CC2A3AE51D90B6AA72303C569892 GARRETT.KURTENBACH
804,163,166 *53644FE6B666E2215FC87C2B13E3B8D218E8A8EB SEJTLEMMUH
804,163,167 *536EE0E87BF7A6C4A796688B8A518DF3280C6AE0 GENERATORMOTOR
804,163,168 *536AF3E4CC23B5CE5BDD42EDFB84170B97B1347A SEXY(LOWER)
804,163,169 *536D6B3D674ED4925CD2933364DA71143DBD2723 GHASSAN-KAMAL
804,163,170 *5365812A081D522B5E3D7D16553FFDA2C5A8F623 [email protected]
804,163,171 *5360F39A4E4E96D0F6421EBF54E652378D7DEB0F gillian.gardner
804,163,172 *536CBA6FC60FC0CFC89ABA9ED7B034884AD4255E SHARON-MARTINS
804,163,173 *536AE428265BEE9EA0F6BC51F8DFA89DAF06F2D1 g$:k
804,163,174 *536E60B63EAF1AB016FD925E8A8A145DB9A9B1A7 GNOWLIGIC
804,163,175 *536DF446B7FF7FBE829CCBC3D80ADFADB9B07942 SHIRLEYSHETH
804,163,176 *536E4F0CD5653CBC157BE19B09E635B43F9E9789 goldmárk
804,163,177 *5364765A723D7E0C9AF1F54F0E1B993F4AF96B8D GOLKHANEH
804,163,178 *53688877CF05AAEA39D74C62DC3C0FD045424A05 GORGON932
804,163,179 *536BCAFA5D559C56D603BFF44BC2031607685361 GÖTHOVO
804,163,180 *536F40E3B3B1D208D7EC9B2206228D77FE004653 SIGNSWALLOWTAILSYMBOLSYMPTOMTELLTALE4
804,163,181 *536828A7E3AB04C29C30D7CA3D03E546D59CF72F SILVER FU
804,163,182 *536C8EFE2F4E6A87CED1A3E5340D90AC2D1217B2 GRANVILLEVANDONSEL
804,163,183 *536FD4727519E425C8F1B84E37F721A36E67847E [email protected]
804,163,184 *5362941D65838DE25849E7DFB7A06C6B27FC82F9 singgaraj
804,163,185 *536EB25B79CE1BA15472275C990CE346C3BC3A18 sivipecrep
804,163,186 *5369FE8CEB5769EFD67550AA7D3657CA0B9A09FF grupo(vagonza).
804,163,187 *53650EFF3930034E45ACBACF7ED75E19181BB31F [email protected]
804,163,188 *5363D33DBFDB38FED77064C5665C57AD0EA1F142 guessso
804,163,189 *536C79C0E9BFB7E2E8C745DC119FBD38ED996CE9 GUMMYWORMS2
804,163,190 *53669D3F2328B0D74818A230BEABA7B5FEFBB283 h3al
804,163,191 *5363095E98C43E20F812AEBF099891EC63A6A5EF [email protected]
804,163,192 *53610926A4213867EB9505DD8CBC179AFE1680AC snoregoc3
804,163,193 *53624B9E57C0EE1D0721DF69BA4CB6548E7F7575 SOUS-LES-PROJECTILES
804,163,194 *5362F9938FFDF552252E64AB22FED2D0010BF70B SPARKL3T
804,163,195 *536EC335F7FF1096C993CB7D56C504DE8B04E23C splat! ~` d#b
804,163,196 *5366BB1EF569A808704E7EB47D9F1D4EBEA19D0B STACY.PENNIX
804,163,197 *5364C787D78D8E096DCA24D353015D1FE0111560 HERCEGTISAK
804,163,198 *5365C28187E088BEDA239320F1C6FFEBC9F00954 stanleong
804,163,199 *536DE47A759B63053913216DFBB068D480ACE00C STAROBNM9
804,163,200 *53637D3361C449ECBF51213501C37B54E04DA242 HOBERT.MAUCELI
804,163,201 *5364E1FE83611EBFFF24EF75ED4F2DDBA29E9D8C STIPRIUS
804,163,202 *536883666A83D261AD69CBFCE46F080411C217D9 STRAWYE1
804,163,203 *536734B76A0BD3A61306142E84A6861AD4227E1E [email protected]
804,163,204 *536634D1FAE2E60A44705260E60BBB3BC7E00C23 SUNG.PALINSKI
804,163,205 *53600B3CBC1FF22CEEA55712732D47241277E57C SUN-GUQI
804,163,206 *53641CE05A06FE91C946ECA9B16E4FA8F582A4A5 [email protected]
804,163,207 *5368CA4EB3B1EF4654E1F2B8E54B14A921A662CF HTELEGRAPH PLANT
804,163,208 *5365E96A5966096501B2D121418D6ECF7AE93DD7 [email protected]@7in9
804,163,209 *5361C45A1C85A8D61F1BAB189E6BE3FE091175EC [email protected]
804,163,210 *536271BE35DFDFA16A9FFE74ABC4C6D34453AD0A HTTPWWW.NAIRS.INSOCI
804,163,211 *536C49AA22D994094A2A5CC6FC0DA4E61FE08F24 SUPERJOSIE1
804,163,212 *5366EAFAD9C8DFC59256AA4652A9556F59CCF80E SURBATERING
804,163,213 *536AE5A07B2D906F42034A4F3581CC0E63A62634 SUURYOUK1
804,163,214 *536F170411FE1AF3E6D660A3FFB8FED00EB1B328 hv~a
804,163,215 *53681DF24D414B61DD116ECD33C2419D2F124F09 SYTSIRKN4
804,163,216 *5365783ABA992369FF571929B7F6C986BBF2F9FA I8YA
804,163,217 *53615FEA9CAC1A629D3A00B951F7C2CE20598CF0 icanseeyou'rerealconcernedaboutyourdaughter.
804,163,218 *536E2BB0A132145AA427FAD84E89E656D42B18E3 ICRP50
804,163,219 *536A41CD4B5AB89D15851D86AE2C55E912229974 talk824264225
804,163,220 *536BBAAB04EAC1167A77E6814E900532738B0D7E TALKED4409
804,163,221 *536062C337B405EE962FCDC2A509CFE5DBF61BD3 TAMQRAH
804,163,222 *53654AF878E2A86BE74EB604A8DDA4AD530100A4 IIDROFXO1
804,163,223 *536F91585CB2B7306CCE7DD0F4CDBE7090EEE2E9 [email protected]
804,163,224 *536E3ACA0F51C79F61DC52B172E693ABF3B52F3D TANTZU.BBS
804,163,225 *53665FC2465031FBD8CADCF6C6514C05620D3593 illorined
804,163,226 *536A4EB3B9EC81CF0C6BCD245EACE300BD9B6E88 IMPACTCLARIS
804,163,227 *53697A658C1F34543A452B6A43DC46B01B48DFDC in$7i7u7i0n4lize$
804,163,228 *536B1D22114DA67645B6E1641F9020C63FFC5A2A terrencemarcucci
804,163,229 *5362BA32D04245416844A8136302E28D26B14B5C #textflood-end
804,163,230 *536A678B894D59A76643F063789F5CB52543D42C INTELLECT4
804,163,231 *536121032CD17AF0ABA09C8CDC61B76A94FF791A the-adventure-of-the-illustrious-client
804,163,232 *5366206C9525D4A2F41B1D740E6684DFECDF9B1C ioujnorousskaîa
804,163,233 *536AA7B9DA488D922871DB4D45F350CFFF8F34D5 irene.cunningham
804,163,234 *53654CD5B0D44BFFFF9229D45DA0D439190B41F9 ISIDRO.BREGANTINI
804,163,235 *536CDB4DB65D74F031DD9CB9D1D6415CD10CE3B5 theresa-rawlins
804,163,236 *536027D285BB4DF17EEB90E3BB4388A544F824A5 ISSACFOSBURGH
804,163,237 *536C41BB96B9C1A96FEC3E4F947F1D81859EA5FC THE.SNITCH
804,163,238 *536B1A4F87D096C8EB954AA85690875F4C412625 THGIRWTI6
804,163,239 *536418E6E64698B6D7E8CBD8D765F18C124E1524 IUINNIFP9
804,163,240 *536A13BEB042B79329146C3C3E338E477BCE2CB9 THOMAS.DARNER
804,163,241 *536C70C4AEC19AA5723B84F87A1B85CCBDD394AB [email protected]
804,163,242 *5362966F52FB870BB2723EEF677494B49FC3276B THOSE.SHRIVELED.BI'S...AND
804,163,243 *5366147A64FAC48BD19E85E1DA63713B21EFE84F jachtopzieners3
804,163,244 *536BCAEE4FDC778FCFAF067DB2CE6F4995F9B51F JAEPEDRAZA
804,163,245 *536C6FAC43204C441E0BC66A8F9E66BD92357B15 JAKE58828515
804,163,246 *53602FA62E328FB7298127A34EA738FBAE81476F JANGRANEY
804,163,247 *536C90D948E5CE230A5A13C070AF2F1D19BAAE0D tnligsfz
804,163,248 *5366F61C03568D02DDAAB99812D2907219ACE26A TOBOLCIMA3
804,163,249 *536E51CCFC2010C50DEDFE285812E0177B70C19A toddsitter
804,163,250 *536DC5C82E7799F351423C692C066E3A5FBF716E TOMMY941
804,163,251 *5368C682D1B8749B26CB2210FED93F416046E11C TORTILS3
804,163,252 *536D1CE87DFC9BD3B7F5AE17BEC3715492445483 TRACEYSCHEFFEL
804,163,253 *5365C58E4B373BABFCE9A9920B98861FA8352492 JEREMYYECKLEY
804,163,254 *53628AA61D21A755CB966ACFEBD11A534D6A1AF6 JERROLDSAVKA
804,163,255 *536D145A8C58CF8DEA2576A7B5C2D32BBE787392 triggedv0
804,163,256 *536E9AA612AD15E201531BDA359602485CDCD7BB JHZ\
804,163,257 *5362E76EBCA597CBE7E93DB65AB29957FCA1B137 JIMMIELAVIN
804,163,258 *536DB115BCB2F382D8AAEA9AC07155C99D6A379D TROUPA
804,163,259 *536A33B4930791B69FB6C3B68EDC79A5C3727C48 [email protected]
804,163,260 *5365A5B62F612343182DF42053E9ECEBC3713608 jodyaddario
804,163,261 *5364AF19FDB4235808A86B0C3C068E8C5D6D6B92 JOESPH.SCHRAUDER
804,163,262 *536187F6628D4330F84DF65EDCEF9BBFCDA1186A tuangremminger
804,163,263 *536504CD6D588F23CD02C08E096DE7BA576F6508 tuktan
804,163,264 *536D02107B188F7BA60CC08BD243D6D24CFDD302 TunedUniverse(Merlynremix)
804,163,265 *53684A6C70A8021AC97A781722168C250B58BDF3 JORGELATUS
804,163,266 *536A16CB2FCAA8BE1FFF21DCE27A4BEBFFE47630 joyce.turtoga
804,163,267 *5364A7D31946E56A1DE9DE011471993906B1ADD2 [email protected]
804,163,268 *536A9ABDFB22F22BF7306FA891F7AB542A76E2E8 JSEIYABOH
804,163,269 *536CA18C8FFEBC90A8F1403A23F242ADAFD22BE1 juanmaduena
804,163,270 *536DBCD0357C66D1926802394804446E6DBB20A6 UIANA123
804,163,271 *536F1CD6DF8D642B1485160977FBEA72A5208CB7 [email protected]
804,163,272 *5368D522FCDE3C79B9C4D5994E6C2FEDFE7D1FB7 jueyun.2.0
804,163,273 *536813D8E97F1B0A5F9A1EF87D60E24955B7A7FF JUGADORES-RICARDO-WALTER
804,163,274 *53606B9E664D16031273A49DB8B55F0CB181B457 JUNIPER B
804,163,275 *5361BB4F6D5D123A05D9883EC77360C3F189753F JUSTIN.KNESEL
804,163,276 *536AB246F3B0D706D39C1ABBCF6F564BEBB95A2F UNCANNILED
804,163,277 *536FC59450AE74D3454F35A8AFE250BC45AAB5F0 KANEDUKA3
804,163,278 *536D18E30261F50B71E80A6C958D57F843417D67 KATHLEEN.MCCALL
804,163,279 *5369F907FB8591A6ED850F6BCC8AE3B45D0F9D50 USAGECOMPATIBILITY
804,163,280 *536C7CB715FA594ED69711BFA672DE2454FEA6FD katrina.samson
804,163,281 *536DB8B1B3B1470486F94B782ADBC2609A5D3CA5 kauhajoenua
804,163,282 *536945083317ADB8C5F638E1072FFB57BD1B30CC [email protected]
804,163,283 *536B2FEAD7C4F84573111021DD5B5950D2B12A58 kelly-freed
804,163,284 *536F91F87BB05B1E0DCF91C4AA50666EDA1EFF8D [email protected]
804,163,285 *536404350D18A5EC4464302881C46856D01E1156 uv.raleigh
804,163,286 *5362F719D482A8DCF6BC22579E423AE2C0F8FBBC [email protected]
804,163,287 *536FFC037CBFEA5F373659179212788286386862 KERRYCOUYJI
804,163,288 *536EFBF22FB7DDC196EE3C3C08EF48637ECEB761 KEVEN.GILLOCK
804,163,289 *536CAB946A38FAE28149E49CD5D04D06DB9A3187 KHALIRENDWE
804,163,290 *53630A0E17FFF240A0FCA3C6AD4C6E1302DBDFE6 VANCESHINSKY
804,163,291 *536ECA664EBED9DE5E06C3DCE17ACFE2B5BD04D0 VANESSA-CANLAS-DIMAYUGA
804,163,292 *536A51561027E7D799A2894EA2CD1A92319F0CEA vanessa-robertson-gray
804,163,293 *53687D6CE4C850EFF6A9CAE1A652C6CD93111A29 variationen-"kakadu",-op-121a:-04-variation-ii
804,163,294 *536CB2106570501FB6F033D458039C1A8E971F47 [email protected](
804,163,295 *5360D6C27E2E68ED17B72D04A17DD411334BF75A VERNON.RESCH
804,163,296 *53662A754577ED09DA20D30583EA1BFE1FA9FE84 Verstelden
804,163,297 *5363EE107A65BE2C1E7747AE4C4BB2600DE2C2F7 kristin-rutherford
804,163,298 *5361D80BEEE255D54B805E9953423D4F2EC0F692 vickyromeroromero
804,163,299 *5363E3B2428FB602221540485C1E72C21979F518 KRISTOPHERCAMAEHO
804,163,300 *53614C6E39BDE4FC0581950DB448FE3EE4F40770 kukahtipa
804,163,301 *536ECF3EAC565C49A9E1C83EAE5E14E3140113E6 VIISASTA0
804,163,302 *536D2DE06EA3AFF33E17E408C42A007B46EA086A VINCENT-GILDHARIE
804,163,303 *536B482B5FED67991F15FF2BFA8271B7FE53DEA7 KWAGEH
804,163,304 *536919E69A12999AE7FD076A12846A3C61F12286 VINCENT-TUMI-MOREMI
804,163,305 *536C73153546033FF48DEABF0A5A91C115A4AB2E k-xq
804,163,306 *536EC0CF18E5E8C5E560CA7BE2A918C8F10A29AA LABELLE PEREZ
804,163,307 *536ECD8AAFD9F38642309A69E0DFA2600A062E9A LÆRLINGSKONTRAKT
804,163,308 *536F04FE91F0AB0A70DF18644846B631416026BC VINTAGEPASS
804,163,309 *536A4A07AA1B2630BEB999B9EB228C4D03CB3E6E larryhat0
804,163,310 *53641050AED720336CB7962A32A4BDD2137598A8 LastCommandsofXyralothepViaMES
804,163,311 *536095FD770DBC89F983A8C3C9C42A15A1BB1A8B [email protected]
804,163,312 *536E5E2008721A9A33EE5AEAF50A9B94EFBAE1B6 LEFTWHATWHERE
804,163,313 *536E7D27C9E6BD97404E8744264504CDC11BCDB0 [email protected]
804,163,314 *5368DEF91B327989EF371A67B71930589AAFED1C VTHETATN4
804,163,315 *536D163E26E3E96E00D0EF6D62854451A5533AC4 [email protected]
804,163,316 *536EE0BC3D9D61DFF8FC0E12C25F2AC7E522298F LENDEROFFENDER.COM
804,163,317 *53686DBC1C28FDEDF04C4F3C91AB583890F88A3C leroystumbo
804,163,318 *5366E7059976EFB3222A85CC690A1D7360155C91 LESLIE756
804,163,319 *5369AD776DBA80B2FEE7C31C394933112B1AB189 wahda-mn-alnas
804,163,320 *5369B30C4E02C6E3EF50636E84C32450F9092970 [email protected]
804,163,321 *53655B8FDF321FB9DD3409B1718D6486FB9B223A WAIT.FOR.THE.BLACKOUT
804,163,322 *5360AD9A1E04C356414A2B4FE17F4C13D2AD9FF0 linsnrja9
804,163,323 *536E74EAED524EA74B0F9DB2C0CD342F6890C4BF [email protected]
804,163,324 *536F42BACF8D77A42F2335CCB266A77E0F89B6D8 [email protected]
804,163,325 *5367D861F83A050F6F5FA0DD5371B08E8AACC65A [email protected]
804,163,326 *5362931AF40ED64CADA9057D9D2CC78003190E72 [email protected]
804,163,327 *53674DB5977B7E75D5E4DA91E97356C2CE733512 LOIRETAINE
804,163,328 *53640A84ACE618A1E612EA5B58D866A52E4AFE2B warrendoneal
804,163,329 *536EE9EC26504015F4C72BB80FB6CA8B22178B1B LOREN.NEELON
804,163,330 *53679C33562F6110DD4C2B9628EB8AC3EE98CDB0 water.music.suite.no..3.in.g.major,.hwv.350:.ii..rigaudon.-.iii.
804,163,331 *5362478397F171B8D5BD77146AF8C2C89810D405 WEIDELI4
804,163,332 *536271F66684F9CB7ADDC2933BF393EBFDBFECE5 [email protected]
804,163,333 *53688CEE9989A6BA51FC833EE2A09528F19F177A [email protected]
804,163,334 *53685FEF1CBE989D5FBAD64388E642A079421A91 WENDEEWHITCOMB
804,163,335 *5367150C72E8EAD4ADD84E11D20749BC30FE4298 WENGCRG[email protected]
804,163,336 *5364C9033921BB33AE467813511561A1292C1D6C WERDNA648TCE
804,163,337 *536C595D9B7E8EAA77841935A3337C2B12F06E22 westonfrizzle
804,163,338 *5368E5AB8FCEEE69AD31AD1E5FC53AE1FD2BDCEC WIKIVÉRIFICATION
804,163,339 *536704923C9B91C52B56374BD5FFDD08BBAC17C9 WILFORDPICCUILLO
804,163,340 *5364F4135D5D0AE6B95DBCB8336B639B26B7C1DE WILFORD.TACHENY
804,163,341 *536D2AE4B79340D16E1A3C74FE7D781F6B7ECEBD wilfredo-ovalles
804,163,342 *536112345EF4B569EA4074CCA129836F634EDE45 willisberberian
804,163,343 *536F45F753D514C211CC317333337A04C85B9B5E lustres
804,163,344 *536B3DCE580B1073C3D2CF9C72E41191173E90DA WILMINGTONRENAISSANC
804,163,345 *5362CF686C15DD991954ED83CFF15CA8A88B50E5 LYA-(JENERIK)
804,163,346 *53616371CFF899241D9EA639A0D636FA0CAFBAAC WINNIE-BERGER
804,163,347 *5360278098E967D3CBAB975DC070CD9A7778515D M0R4L1STS
804,163,348 *5360D514F0DB68C37F9AD314E90B886AF3419213 m41ngered
804,163,349 *5367A10F27BB98A0766E97E280A305C5DB0A5F7E madhu-sudhan-s
804,163,350 *536BD4999F49C4AD949FC7B14D800032EDE0773F [email protected]
804,163,351 *5368D54047E3D6AAE9FF7F09E3AEA974296FF006 WOODF2A
804,163,352 *5368D3B49A6BC8E7AE949D2C0CF99CF6FD20F907 wpvandcontent
804,163,353 *536332677E67057CE7495EF036F37B9FC9B28A4E MALOŠTETINOVCE
804,163,354 *536D5BED073C4056644B6C84E54A67EF08D22469 M,AN
804,163,355 *53687658D1229143684E070AD51D90863D6F5AD6 wwwlafermededamplycom
804,163,356 *5367198E18B2257EA299F1C089BA9DA96FE019E0 {x}~<---8
804,163,357 *5366ED12FF7F4A6058219401478790782671E2F7 MARGARITOTINGEY
804,163,358 *536FAF24FD432C151AC9499732FC270183D59038 [email protected]
804,163,359 *536433FAE7EC695A6625E3098A0EC78C0646F3BA mariaschoborg
804,163,360 *53674A22F555F2C25707A09C5C6A9636BACA5FC7 [email protected]
804,163,361 *536CD82A510958D56441B17BAC02188232AF4658 MARIOOMAM
804,163,362 *5369B5127D4AA39937B4EFB554D6C2D9D9F8D87C XIRRADIA1
804,163,363 *536C54947D61BBFE778B5934B081CCF9D356E750 marvinbutzlaff
804,163,364 *5360194C1BBF02CA00FB4F5B42F65268CB327270 XXSN
804,163,365 *536D89C48574356A6CEA02443D91A4C5C253A9A2 yawbus6
804,163,366 *536B3824A13A58BA5C9027DFFEF287FA4D521B92 [email protected]
804,163,367 *5369A00D301C5DAE2216260A68D777D644C14BC2 [email protected]
804,163,368 *53684B71205358235374358FBF93114A602F8554 [email protected]
804,163,369 *536A0D13D3F2B0781EABF2A2B1003004B2DC95F5 MATHEW.ROSENER
804,163,370 *536AE2E8AF5D97AF7CDA48FE0BC59717CD540E50 [email protected]
804,163,371 *536B44C8AC3D586A5FCD0C708502ED24A86B5D7F YONG.HOSANG
804,163,372 *5365ADC959870773A7B4F6453348C7758171BF5F YOOKOSOANINVITATIONTOCONTEMPORARYJAPANESE,SECONDEDITION(DISC2)
804,163,373 *5362246E6EA49354FC139C74470A7E79DF55ADDE YOTSATHON.TEERAKIT
804,163,374 *5367465EE513FF4376E0A7E7AA61A8B44E664C6A m!c}
804,163,375 *536B577DB526BD2A8F57B9CB1EA6766577B307F7 [email protected]
804,163,376 *53673D1D1E090F61A1D52B106AAAD24D92723E9E YUSRAMAJDI
804,163,377 *53602A11CD71412D24675C952071BE505783AAF0 zackstoney
804,163,378 *5367440E22193CFA7682F5DBEDA1124D7E57414F melvindeere
804,163,379 *536E880B6DB65426B33D63298390D7CDBD60E6C7 menuet.(allegro.molto.-trio.-.menuet)
804,163,380 *53698A07499C40CE009EAAAD0200EECBD1C6B22F zanehirschfeld
804,163,381 *536077DD03F8B189755C1B89AFCE5568C5F310EC ZAUWAŻYSZ
804,163,382 *536889C9AAD68F634B8A27E10263E1C013DAF01E [email protected]
804,163,383 *536719973A3BB71EFDB54274B86C5146881E5F4F ZIGGYMOUSE1
804,163,384 *536E19B3C40B9290A069235717A8C695D094653C ZWOLNIENI6
804,163,385 *5361743AC49BB80276BA4D25357C601596DB7821 ZWZ55MA
804,163,386 *536649A71B2D27168D932513FF828395C79BB0F2 MESSE-H-MOLL,-BWV-232:-II-GLORIA,-"ET-IN-TERRA-PAX"
804,163,387 *5363A30773A3EF2A1ECC223EA30CB2C265347788 MICHEALBRADDY
804,163,388 *536C1770EC87F4103CFDB1735D71D937FA4F4745 ΚΑΝΌΝΑ»
804,163,389 *536EC2EA5FF7E6C045966D47F0415B57C21EB33D ΟΜΕΓΙΈΡ
804,163,390 *536D801AC3CFA137011BC6673D515EE1A41BAA1A MIKE STUTZ
804,163,391 *53657D11134431FC3F54D9552064A220ABBE0A3E milesstockham
804,163,392 *536279026B077FDF839BF3135CA536D27C1F5479 miłowskiego
804,163,393 *53600A2D96AEC24D58F1B5A3EEBF9D20DD337DED miltonscercy
804,163,394 *5366DAE9B4CCECA60E79D3AFA3EBF2B00CB48F61 [email protected]
804,163,395 *536086D52E6F8B0A17F664274D3C34C44891CFEC ВИКИЧУЮ
804,163,396 *53606E3891267584A48E76F70C9F05438B549C0E miswarts
804,163,397 *5363E0E1156506C0B85D53264D61A79211D533F2 интаферна»
804,163,398 *5362C9C5E409C9AC24CBF9EE099FF521E3784B9F охлин
804,163,399 *536BA6A931DF811FFDE1B64CA8114710F1281B2A MOSES.PEINADO
804,163,400 *5367A5F8176A9C5718F860E96BB04B24088BB7C9 MOSTOM“
804,163,401 *5364C3BC0A5783B8706A1E3AE3EC5D5D61464237 motopompes
804,163,402 *53696B14FE2BC85F548172B0D6DCE55CA699CD12 ха́рків
804,163,403 *53698CDA5C463492DA631C43EC8D0006D44F8214 murshay-westbrook
804,163,404 *5368B8EC3C08E96FEAE7842109FA8529E49CAF97 MURTUNEITA
804,163,405 *536B9DEB786A8E22ED7EDD634BEEAEF72083F154 NEREDEH
804,163,406 *5360D6298DDD4000BB007832C8E6C4F98E32F3F1 ney007
804,163,407 *536F9F2C03C2F289E5B65D3AD6656A7B00FFB39A N|I1
804,163,408 *53648FB4384EA9D6AE32E4ADAA71666D0AAD547F NICKY.METH
804,163,409 *536E665BA873281D3AC6B41309467A97310023CA NIGEL.CURCURU
804,163,410 *5365613C5265B0BEF5E15A543F2CC6AA34F128CA nikki.monaghan
804,163,411 *5365F7D51BCFBFE8942FF5D63176EC8A3742FA57 NIKLAS-HUGOSSON
804,163,412 *5365D52140B04CD6EEDDD07AF6D581AAFE1B3925 ninaanin4
804,163,413 *536B13C1042656C9EB12AFA20A69A7960BAE0BB5 NLCLAVIRES
804,163,414 *53668080DCB1E30DB05EC9D474798282A6F3E6CC NNTRNSNC3
804,163,415 *5360BCF9B61F10A4BBEF4800D6CEFE96D1E77429 NOE.PETZOLD
804,163,416 *536780D717D3CE7BC251C02CDFBF7033DCCD7C36 NORMANDSUMLIN
804,163,417 *5364ECF3B4B23EC0CFCD1FB11207266E167DD8D5 NPOVDNCHED
804,163,418 *536294475530AF0653FEFAEBA274032193413891 OH-BOY-THIS-IS-WEIRD-FEAT.-MIRRE-M.
804,163,419 *536B17C440CC2071BAA7F33B00F5748059AAC11C olezaa
804,163,420 *536A7053DC4E99B9E026FA7CB1BB255233C19E32 074BARYSIAIKULPĖ
804,163,421 *5361998FC0E17E072DFC82FE1EADACBB7E70255F OSWALDOOPFER
804,163,422 *536DE4FC26CFA66777E89784F86792B5EBE603E6 O~T6
804,163,423 *53657FEDE79AE40B8D5F91659FA6345761D162EB 0PT!M!ST!C411Y
804,163,424 *536C7B6DBF1B6744261BFA4732E97070AE674A96 p==>~`;)
804,163,425 *536ABD537A6F79E52635B67C63F0B00DAF086065 p3nolo935
804,163,426 *53600406F5F4EB6AD38A5FB7B60F8D93A807C688 PDDLFSH3
804,163,427 *53645D779D8C084992EA8174E57212A0C006B4FF 12CONUNDRUM
804,163,428 *536CAA4BCBC3BA47995B36A72FE5D52F08F28338 12CSC-PRAESIDENT
804,163,429 *536D2E435CD39D881A18B27D86FE1869D0B7BB17 PEPPINS9
804,163,430 *536A5EC65B204DB3513AAFEDE159A62B0F2676A0 PERRY.BARCIK
804,163,431 *5368904F94130DC8FF6525F2D58500883CC637F2 PERSIGAMOSLHA123
804,163,432 *5369CB5FEA86CDABBC7794391CB627A9930CA447 14.MUCADELE'DE
804,163,433 *53677CFC4E9874BE21C68ADF34765FF79946E6D1 PFLICHTWIDRIGEREM
804,163,434 *536A3833632FA1095EF8943F54585A091C29AF86 philip.spaine
804,163,435 *53679900A15C9BD2BB683A312DC84B726FB7E575 1647811 SM-LIIGA.PALAA.TAUOLTA.L
804,163,436 *5366F85A83047F2C7BCE8C2B96F42CB238A3C237 16flirts
804,163,437 *53659C49470D17777859210C1098313F9456EE08 16.MARJOTAIPALEEN
804,163,438 *53650CA3E904846856ADBD1ED986CEF94DCE6C01 PHONGMA
804,163,439 *536BC8D2E95A5F3479C8E2D7CCFCF258491B16B7 1724453 SOKAHLDURFTEERNICHTMEHRWEIHNACHTSBAUMWERDEN.
804,163,440 *536AFCBA308F00A576F35FB028BB16925C7BE3AD phrmcpding
804,163,441 *536DB34972B6F250C3380EC60E63D2FD8DECE1D9 PIOCHA14
804,163,442 *53623FC2C5B9A09F580FF518F91159F09AB818C7 1984www+
804,163,443 *536F20C5B77DE5190C0FC70B8CE5B80E0034EC4C 1.AJALLISUUSIHMINEN
804,163,444 *53664D949CF691D25D36AA6F3B2C00038F0AAD86 PORTER.COLORADO
804,163,445 *53606651552E4FA555C424D83521F562664CF50C 1CAFFARE
804,163,446 *536C3250F333DE6F5D8961A13B67F146DAD75909 POSILŇOVAČ
804,163,447 *5365A6A0091A9AC3907C40A5BC31F67826A71D9E potyry
804,163,448 *536D25F587A475FFD809E9352D29FC2AD1A90664 1-dentum
804,163,449 *536F0B6004E7B4FDB52DDDCCD13C72B0890D0947 p==P~~Sploit
804,163,450 *53691F36C85DAE45D30ADC0E1665BC3E4FB9B786 1gruendungsgemeinde
804,163,451 *536EF18BAFFB28889348BDE9662A4D3A639E2802 prasananair
804,163,452 *53609DA333DC7BDD4BA3A7FB714057DC7B436D97 1.mallipukujamme
804,163,453 *536EEC9CA9467AAEB8510C29625056E3B7E9C3A8 puttputt123
804,163,454 *536DBBAE74557CE943DB6B8F575F36C0A49AEC5C q===b`~-(~_^)
804,163,455 *53659451CEEB029B718E1E4272C061A3FAD801BF 1nterro94t1ons
804,163,456 *53626C716C86D96C5351AC5D55936CD40F695074 1PRIVERAIT
804,163,457 *536015D7029E29FDDEA8DF5C640662E68C11ED8A 1PROTUBERENS
804,163,458 *536EAA9F88FF62977B20BE15367F6A1076741065 QN248
804,163,459 *536D0DD9F1C178F084FCF5102503FCC29D534F0B 1-SCHOEMPERLEN
804,163,460 *5369688C5DB1BD70E26D466B078476207E6F96E3 QUINCY.LEGATE
804,163,461 *536730D7EE3F4E7209A6222FB3B7AAEBCF948C0E QUOTMUNCKENQUOT
804,163,462 *536F414C9C6CD451FDA38E5AC28F3CEB63B54F55 1 TAKAISIN-KYTKENT
804,163,463 *536002A860EA0174E2434A89774F1AB3C4B72B24 RAIN-GIVES-RISE
804,163,464 *5368D70BD6C953D5571BA2F28229802412FFD476 2010 DEPREM
804,163,465 *53647FA8BD9D8321136EFEC3432DFFE5E683BD45 2054012 ROMANVONLOUISARAGON,ERSCHIENEN1965
804,163,466 *5364E9CECDDF2AF1FF15AA81DC07E996064F4386 2172941 " was in luebeck gelaufen ist , war unprofessionell
804,163,467 *53699037D392E8E7340D8DD2EEE6591EC801CA87 RAVEN.MON
804,163,468 *53638BD10B4D47D1EF118D9CB8C0CE330B4CFBFE RAYMUNDO.GALLINGTON
804,163,469 *53605EBADC04D1A16304BDDA0F53656FEBB1D7D6 raymundohowland
804,163,470 *536774CCB6ECE6CF7901011386E656B4A56B402B RAYPIGFORD
804,163,471 *5361AC64AF260E2A8F42F42DC285DC0A094B0025 RBQ+
804,163,472 *5369B696F0AD1BA27E7127C21B918F1B3E720A76 rechazarle
804,163,473 *536B4656C66332198AC04FE0FC77F591AC4336AD 234472 VESI-ON-V
804,163,474 *53674DD22395478A25CFAB905DF1BF0340426FF0 Record-Store-Track
804,163,475 *536397840A0B8D5FAEEA3B6F958FE84CC3342765 REFORMTORREGROSSA
804,163,476 *5360FD4DFA6B9020B0C26D880507C173C6454CA1 2437218 KAISEONMINUNOSANIEL
804,163,477 *536B10E0B96DB94C0DBF00270E24821BCA7D4CAD RELEJTSED
804,163,478 *536F83AE41859BD49108334C557749A207772E8D RENE.MAFFEI
804,163,479 *536C559ECE81E4ADF6190C746CCDAD997949AAB0 2659275 mutta-kustomoitu-tuotanto-edellytt
804,163,480 *536270B0CBD022B1AF1DFE4B7BD9837050328403 2841519 ithoughtwehadsomekindofchance
804,163,481 *5362E9FA93D07B97470CEFBE1A8021DCB9AEB140 2926652 homefederalisbasedinstpetersburg,fla
804,163,482 *53676EA2B05C88327C2D79627350BBE0A164864C 2esdp:ss
804,163,483 *53610C06903B5EB3A145C44C1C96BA790FB21718 RHTRONNIRUDN
804,163,484 *5360502D98123AE6ED1CE6376FF196A8F86EEF1F 2INFICCHE
804,163,485 *5364EBDFE272BAAC17BA7A6B2129B8AB6DF4E64F 2IREEVURT
804,163,486 *5362D527DF8B8F78991A214A1964E34A4C224AE3 2lakkoviikko
804,163,487 *536B3DE17D71BC98EFC85ACF525558ED12313E6E 2MINEGISI
804,163,488 *536DB5DF2198575F0408967253755D98E73A53AF 2NDAPRIL19944
804,163,489 *536B23DBC50998252472857F51D9900F866B9C6B 2 OTUK
804,163,490 *53608ED9B09E552093E36F8CAD4491C42C29466A 2.PESSIMISTISEMMIKSI
804,163,491 *536304551CEFF440551332CBE1E6E2487707D661 Ridin.on.Empty
804,163,492 *536FB7AE9B81BF5C04023C978B9AA563AC3B21F4 rielle12
804,163,493 *536882C5296CEC956F22F4F4ADD8EBF6FA01EAF6 ritajeans
804,163,494 *536F3AFBF0D63E82D65D1FA8E07C2D6FE0A8D81C 2tuntiopett
804,163,495 *536BCEEBF23E39D220B622781BF23FA3A91D877F 32vqd5
804,163,496 *53619F0C3378C45AF7CE9D2FEF77C26385EE5DA4 ROBARTSLIBRARY
804,163,497 *5368FA24BA4D8E3F5B46858659329AF78507A065 ROBERTKATHLEEN2
804,163,498 *5367674484447A27223A2BCD9BD112291F1B837F robinnatal
804,163,499 *53606B13F0251D00705C05A7F4AD4957A22E9DE2 rodmell2
804,163,500 *536C4281C722782FA311DF02FAA5C419A6E8CD3D 3IAMSPUNKY8
804,163,501 *536E73703983C88663AA0686D96588D272B6A312 ROHREVZU3
804,163,502 *5368F438966F8D5797FDFA6F25EBF490979AC5AD ROLLAND.AYLOR
804,163,503 *536838D878ACDD967930818B1B859174DACE1219 ronnykokenge
804,163,504 *536A626DA078B60664684618B38F15CEB6DE2846 RÖNTGENBAUS
804,163,505 *5366C4057F78A098E06378452E50233D5D6CEF8D 3RILEYBB
804,163,506 *5368D94F27016D2DA362C4978FD1293D21E19361 3-VUORIM
804,163,507 *536391778B2832782135FF57E17228DF67F6843C 422527 PINUS.PINASTER.228..
804,163,508 *5366E1E26897AD77E26F925BCB0DBE45038FF269 rozeznavanimi
804,163,509 *536AB8CCE828F1681FAFDA183C766BB2D3CCF92C RUDY.WORLDS
804,163,510 *536B7E41A3FB4431588C09C76E597018CBE20EE0 RUFFBOYZONE)(*
804,163,511 *536A50579169D69AEFF2E60D2B671C7C0C016F79 4å、らせんの直径20å、
804,163,512 *536AED7A452C8634DC9776022E2C38C631E8B2FC 4ELFLUEGE
804,163,513 *536AF11EFCE55523A0264F81AE6FC24B3FF8B387 S00BFFTQ
804,163,514 *536E9AC0EC2D0DC39013FBA68FC33C0DC675F740 S41INI7Y
804,163,515 *536A6FD54135146737B1722804D8D25B4C0FE4FA 4MAGARABSW
804,163,516 *53660D78FB42C7862241DF31633E72FD35627594 4NEBRASKACRACKER
804,163,517 *536CDCB29FE96A3491DC1D819042FA54253604B5 [email protected]
804,163,518 *5369D791498C471CF7A0C6F8B4D5BF143CA7CCB4 4POORTHIEF
804,163,519 *53632DA1BD0183E98FE71704222B9B630A1E8641 SAMMIEWINGSTROM
804,163,520 *53656FBE8D716F7619C4DBF03C58373C5EAF4FCE 4ROCITSYM
804,163,521 *5363254FED72B164CE62A2BD390C14E45AA810D8 SAMUALKLOHE
804,163,522 *5365EE22BBB96B16504B25A8EEA1CFCA39D055D5 SAMVIRKENDE
804,163,523 *536C8C21AC92E8CC9C95F828E87F3533DE0B65C5 4WALLSTRONGHOLDSUN
804,163,524 *5364857E375DDECF5487F6BB200C55DD57D452E1 «SARDÓNICO»
804,163,525 *536C45CB30811CCDDC7C409CE315F5913DB8D6A5 5BAHSIREP
804,163,526 *536A40DEE3525DA7E666337F9048B254B927607F scotherreras
804,163,527 *5368606DDF11B83E5C6D1A72272A5613A365318A 5EBERNARD
804,163,528 *53660B1DAC16F412C5CBEFD02525CC50EE523B34 scottkarpin
804,163,529 *53652A9F18AA0DE83A58A9F1C77FAC354C684747 5FRAMETTER
804,163,530 *536290A18549C18E0ACF4F115285E0516DB2F070 SCOUTPUPPIES
804,163,531 *536517E07EE88BD1D172A15F2008726C458E3B13 sebastianpipher
804,163,532 *53610831BFFC18662627B10BA962ECD087F1F518 5RMUGMFSCCDUU
804,163,533 *536EFEFBEC3C0542F8DE610DC930E4CE045D7FA9 SGNITIELPEB
804,163,534 *5366CC43EFCEEFE090D5928B05B8AB3BD3BAEAF4 5.TIESINH
804,163,535 *536247F7FD7C1D32A87D9837B60CC53037CD7BF8 SHAKSHEER
804,163,536 *5360CB42723526854AA85C8879EE60AEE92EA3BB 651NATHALY
804,163,537 *53628869DA4C9F0A92A4E84646473BF328813E50 SHAWNJAGUARS
804,163,538 *536950130DE89224D911C0BE9D7251857E1126A3 679309 wirbildendieleuteausundkontrollierensie.
804,163,539 *5364C7048C22EC0E2F84FC0467092DF1809ABE0D SHEENAPROTEL3
804,163,540 *536282640F8F467CE693AC50211379F46753A479 SHELLIESTEVELY
804,163,541 *53613361AD04A68C21CEB81E3048AFCF28FC8C08 6DNENOWSI
804,163,542 *536996106D21588F504793E842F7C221006638DF 6EVISURTNINON
804,163,543 *53687420D6B82CAD9FA08C4E65D7F312FB3705DC 6HOOPSCASSIE
804,163,544 *5369233E9EB603D8D589F1E6697437DBF11E53BB 6INDIANAPOLARIS
804,163,545 *53608894A2D8259843BFC59463507655F7C84EB4 6MATTHEWAPRIL
804,163,546 *536C546A5AFD56F13188E20131C507F2380E25A0 6MONTREALME
804,163,547 *536CD0E8C213B564655E35016C1BB948CC9C9BBE shlg
804,163,548 *536F713F213B9705EDA085331C3226A1D9F22DED shonlorz
804,163,549 *5364D2C43A9E4E835BEB21366E4A05B4D84F8BE1 shortydigger
804,163,550 *536AD0EC2508B2C2C6F54F990A406601A44A3726 SIDNEYHAUKAAS
804,163,551 *5367AFCDD466D20A40A958218FB3D4B9D8F8EF86 sigstops3
804,163,552 *536A7BAD670838CAC60E1EAFD39745DE0613ACF8 6ZDROBIT
804,163,553 *53675B577BE13DBDA29A4503234DC7769E56B015 759983 N
804,163,554 *536F8B6F8046715A57CE023EB768BEE5ADA24CE1 SITECONTRARIA
804,163,555 *5361B952A16B69F8BDDEA7709E08F9DC4C1165F3 SLLIKCEHCS
804,163,556 *536D28D8A89165D111E5060D946797749F9BE486 ŠMAKŠNUOTĖ
804,163,557 *536DEDCEF0CD27DBF7A02423665D810B61C133CA SNOWLOCK18
804,163,558 *5366392F88D334FEE056778F58FD3FAE11FD3B7C 7paleanthropic
804,163,559 *536CAAC59FA419B41B79AC6B36BD198FC8A89B39 81p7md84jh3s8
804,163,560 *5362A04D5D9BAD2DA6BB6631E51CA8F55A775946 833972 LOESUNGSWORTVOM2861997:
804,163,561 *536AC192D909AA0F7370E37C110EE9741F04D92D 847433 JOS.SINULLA.RAKAS.YST
804,163,562 *53661AEF7CB5258DD4BB27378FB867836BF5D605 SPELLEREMOS6
804,163,563 *536D288E81EFF632CC82165FD95C5EABA1C000AB 8ALINEAET
804,163,564 *536CDAC0DAB51679729C8CAAC83141712A258954 splat o~ o~(===q
804,163,565 *5368228A2001253B0E4942C71B2F6A141FD48F96 8BSWPERELANDRA
804,163,566 *5363CE27EC816FABF6ACF995723C8FA61F11722D SPROVEDUS
804,163,567 *5368CE118600CA5219BCE23765EF4C30415C7F38 SSENIPPARCS?
804,163,568 *5362AA0DF95F40AF86C8651D3D8F587327BDD573 8ILOVELELAND
804,163,569 *53692A5F35010A062E1FDF2043C8FE35F64C666E STACEY.TAYSE
804,163,570 *536E385AA303999EA9C08ABD5CDF8A117EBACA75 8KHALASI
804,163,571 *5365873C051A978DC8613B44B763C1C336503E4C stannades
804,163,572 *536F850A4F50FA0B328794034EF29CDEDC005C20 STUFFWILLYD
804,163,573 *536CB42534F224C18950BDF9D83AAFAE7B7E7E24 [email protected]
804,163,574 *5361FA0FD7A3CE03197B3D16182992309CCF0CDC 8SQUIRTHERBERT
804,163,575 *536EF3C370FE28F251FC12E7C2EB1E18795B58E5 8T
804,163,576 *536AD1BC38BD2F61DCEA9531B31EAAF3C431408A 8THIRT
804,163,577 *536FD920D984A1F5180E36D6E439448FA2996E9E 8TNELLIUOPED
804,163,578 *5361147FA4FDD0182418143E9BC94E8D19BD6AB7 SUMMER027
804,163,579 *5360AA8DB2595E72A27889501820770E3FC366A9 8.valkeaj
804,163,580 *536A0356AA9CE922B1B5BD60DFC996CC186D7282 8VENDABLES
804,163,581 *5366240AA7BB35367CCC1D3223939F3CC4357D66 SUNDAY-SHOUTIN'-(KLUBBHEADS-CORPORATE-MIX)
804,163,582 *5365865D90914B4E148E93C8FEAE313DB27316D9 9AJATELLABSW
804,163,583 *5368CA3DBFA080268E81461F8EE232179102BB0E SUPERTRA1
804,163,584 *536C09445CECA9D228D99DA33D9005998609A1D8 syllbsched
804,163,585 *536CA49E2DFC935F0E5C69DF5CCA54AC7D204A61 SYLVYASYA1234
804,163,586 *536EA15B7028683D3E26FFA5D8D41CFB8A2F8ED4 syn3r9!st!cally
804,163,587 *536865D0A659C4A790331FBE83F806A627CA2A24 9FLIGHTASDFGH
804,163,588 *536FDB458BC6B4BAAB00A6E037B17F6552EE97CE 9FRACCIONARLOS
804,163,589 *5363DA4E0FDE655D3893617CAF6917019A700F16 [email protected]
804,163,590 *536C790887157393E5405F17E329A0E5A8C00ED7 TABATABAEISUSAN
804,163,591 *536063111337FC520EEB53D59F77487D67105AA9 9JOCTBSW
804,163,592 *5366EBA05A295F74F779D0F0D6F57DB0E35427AC TADIENIO
804,163,593 *536498FDD45E9844478DA56E846421F3F2F56B3B TADRUTKIN
804,163,594 *5362BA14B0BD8565D7B0F059C122F4FB4F18A223 TAEUFLINED
804,163,595 *536DADFE7697CCB150056781640C4EC911C878C9 9OG18IE9GL
804,163,596 *536FEBFF75692A22156446D0C73EF74A44A76B47 TALKTAYROCK900718
804,163,597 *536D0994249E6FE557922EDBA33F8E5197D88C21 TALUBIRTING
804,163,598 *536801A8F7E582CF0438F3C1150DD06A38153B73 9SOBERIZING
804,163,599 *536B24D6E964B0E9D4AB2D248C69ECA36CA17C93 T`BF
804,163,600 *536C36C6949DBFC6CDF4186EE4403F36E88B9ED2 tim-watson
804,163,601 *5360FC28C79BEB826F16997DD9ED412F2E79F910 ac*0m
804,163,602 *536D4526E77C3AC17ABFF187380869EF137DF476 todd.bowles
804,163,603 *536759FA40F4AF0B2BFD59A57538DF65D51ED19E ACX4
804,163,604 *5367A1E6449615C30F2C13E58B39AA4EA4C23DF3 TOMMANFREDI
804,163,605 *53667AA47163474E654F190F7480A577071739CF ADALBERTO.LEWERKE
804,163,606 *5362733717263BC45795EAC1CA443AED63FBE6FE ADALBERTO.MELROSE
804,163,607 *536F136550D6F408EA68D66123B59AF3262BD6E6 TOREHAGEN
804,163,608 *5365DF7BFF36C23A91FB504AFF2C5233837ED0AC ADM5800
804,163,609 *536732B4F6F6056553B6011C8AB33A475F6AAD4E AEROMODELISM.COM
804,163,610 *536D767A7FA9E38CE5FEFD337E1ECEE4439D2C1A trempiez7
804,163,611 *53639C16F07291221C8955602B8032381138B10F AFT,D
804,163,612 *5363DF32E47A929E81C649EC3BA80ED009B824D1 TROY.LESSMAN
804,163,613 *53655A6FB53B1B15FE8D902E223EE2C9F5049404 trstíne
804,163,614 *5363C4F1FA4E4B278DF5BA703CE632DA7784F526 A!Gv
804,163,615 *53606051BC2A60BCD90365E02F2B6D60F1524A2F AHTDW
804,163,616 *536D32678D63D73FF1DD78C3B826E72ADDCB6B4E tymakin
804,163,617 *536D0493CF2C23A554304976206AACFA3DD6BA35 air$prin
804,163,618 *536E88B295A65EA686E7C917DF105B5C00C16640 UVJS
804,163,619 *53697FE316E7914C7BD8F6A271BAD0A21C745279 alphonsemicthell
804,163,620 *53628A350C2C6EA9B3E94ECCF410559C3768B927 VALCOR88
804,163,621 *53672C8C8E304C338A3DF281A26C3092A1BF4400 VANNUGRAHAANGGARASAPUTRA
804,163,622 *536612DE332A581E31073854E7018E9991DE411D varun9982
804,163,623 *53676E4D18DF792012F5F1D90B89F09A110D82D2 amcg
804,163,624 *536FBCDB97910F26025A2979A66136C2D12E71C3 VERNONVIDRINE
804,163,625 *53676137CC0E111D0870D4EE9E142530402BFB94 [email protected]
804,163,626 *53675C0150B68D1524117C78B30CA57A7FC28F3D ANGELINAZHI
804,163,627 *536464C4B4FCCDE0FF2372E0E823B19EBCDD55FD annamcilwain
804,163,628 *536ED060FFC67A283722DADE890E725C8ABB25BB VINNIE-S-VINCULADOO
804,163,629 *536ACFB7735B1F55844349E33721A7A67B7D8185 ao:
804,163,630 *536BA1032F90E0CF52F4144320B95599F72CE1F5 AQT%C
804,163,631 *536E1619641EBFC3A971B349CAEA7F12C280D2FD vriti.shah
804,163,632 *53672C7FEB58532BADB58BB79094C9A3D216DAE1 ARCHIE.BILLON
804,163,633 *536B3FC5A48213D3E30AFAEB12295B6EAFE01FD7 archiekonczak
804,163,634 *536EA9ACF92BFB1FB650DA9F8905B2DDF7F58DFF W1ZALD
804,163,635 *5362033AAB7742ED4B6ADBC056C3CDCCC0C3238A wade.hearst
804,163,636 *536C33800E7E24587FF7CC3FD63E1BF9F81BB1E4 arrgghh! 1
804,163,637 *536ECAE42D4833E26093644F23C5D37025C984A5 ART.BARAY
804,163,638 *536C70ABD9F7CE2598D0BFCB55E4B5F816AB21D7 ARTUROHRIC
804,163,639 *536C61C20F6CE2B5013AB08324599AC9190EE1D4 as=,)
804,163,640 *53697C9F0B99D92E5BF023E404F8B62E653E2133 ASCETICS
804,163,641 *536F8253DD51FBD8D50907E902FCE66FA26F82B1 WAYNEHAPIN
804,163,642 *5367817D53A0FD573AAC59D22E2BDD0E97B0DF5A a,sy
804,163,643 *536791DE6B1282A9DC7E69ADC0F32D3835F4C6D8 [email protected]
804,163,644 *53676CA9B7F71A50E292250559F0B4930C8F30B9 [email protected]
804,163,645 *5361A3D80E77B0AB1217E94F0740674722DAB210 [email protected]
804,163,646 *5366C22DEBF58E27CFDDF541388760B337A12365 aujuf
804,163,647 *536F0822256B09B5B2F39C3AA6023559CE8FE16B wg3rert
804,163,648 *5365B708F0DF2DD44281D040F990196E41F70112 AUSTERISMOS
804,163,649 *536F79AE14AD77A200FFEAB2B9AFDC36EE31D5AF WH4T3V3R3
804,163,650 *5365E8A2BC3075BD548029B6633D669B438AB225 WHERE_ONCE_WE_WALKED
804,163,651 *536F0F1589178D8A0EE62AB6448711079E9CE241 av0,d
804,163,652 *536504915C26EABFF37D825DABBB70D004C216AC WILCZKOVY
804,163,653 *536521C793C41631B4C1999F180070C497700DAA WILLIE-CHEAH
804,163,654 *53646DA89A3E4D9E1E78A2D2D1BF4A3350DBF64F wilmerlausen
804,163,655 *536D84E69120683DA1A56F130D5DC1A7D79833BD WIM.BOUWMANS
804,163,656 *536AC57ECD219A37EF9BD34888DDECF8831EE62E winfredfeagley
804,163,657 *536504F211CE0B733E6740092FAC2E76846B6CB9 AYHCD
804,163,658 *53678BA3A88DB671EEEA5DC15C56E9D9DE8E3EE8 WM.FLEISNER
804,163,659 *53671C10E8D142BB82ECDD486F09498CAA7B5C2D b(/?-
804,163,660 *5360A2BF4394BD4150E32BB5EE25B0FD8E6A308E b$00o
804,163,661 *5368E6B9ACE2188C25821CC7F10C12871499FBA7 b5+fs
804,163,662 *536D74715F72B3BC48A482C0413DB692460EBAC9 [email protected]
804,163,663 *53638105612B0843F8815C5F7F9799A6F1B0F3EF WYOMI
804,163,664 *5361D27B7EB42EA3471295F63C19FA965CF2DD99 }?xaaa
804,163,665 *536F8EB7CF9C96E41ECBBD50893977260BE9B4DB BARCINOENSES
804,163,666 *536558AFFC8F3F6767B589BEEF8FD6EF439543E4 [email protected]
804,163,667 *53616BC5150DF03466B2E219DF9D21B10F94A3D9 [email protected]
804,163,668 *536100D230497EA4AFB5F2DDDD7FE81A13C827B3 XISGEVJXAU9
804,163,669 *5369FF816718BC29E22C40E7929CB9A9C716F7EB xkqwklncuoaugsbpc6akpq
804,163,670 *536F59869AC7AD7C5DE57008079BEF980ABFAE2C [email protected]
804,163,671 *536179D5FCC07CF8E0BF97C21B27E44B2DA6F5A2 batdl
804,163,672 *536D7142370412FF615882A0B43614B388A14B16 BAX)K
804,163,673 *536EC29592F62092340BF48B9A372F4DD2C02CA0 becobwebs5
804,163,674 *536553E48E44DEA7E2D6B9E89D8C607CBF00A697 YENNI NABILA
804,163,675 *536CB2806EEDC09723710487F4BDC9C05E48380E [email protected]
804,163,676 *536804D149F27FE9776E6C582EF388A7825047BB [email protected]
804,163,677 *5369CC0F1B8FE973F704E56FDB2778809E74DB79 [email protected]
804,163,678 *5360ACE12A4B4085180EDB1F12A7E9E01E1DC8CB ymt5go
804,163,679 *5365EB819E6A4EC079AE35A717802C725A9CAAB2 YOTAM.MEIER
804,163,680 *536788295FD40EAA94D84A2ECC6BB0E519F758E5 YouGiveGoodLove(Jay-J'sMoultonStudiosmix)
804,163,681 *536F489F617016C6EDEE83B4899662CACC2377BB YRAYT
804,163,682 *5366F5C45C7FA2ED34D92A8FFBCFB8DE82CFC1C2 [email protected]
804,163,683 *5368DCBF96F2A14D20BF3A959FB446148A3AECD5 YUMISTOUT
804,163,684 *536207AE07428B3590FE0D22AD5E9FD960D58BB1 [email protected]
804,163,685 *53652C88D87E65D3C81CF034A72BD1C73180C118 ZA9AA
804,163,686 *536AFE97F2E3C8DAB8DF3093B692B7F2A1A8985A BETTYHOO0
804,163,687 *536E4B50138E5D8B56ECACFEC1E95045C4E2038C BFD6G
804,163,688 *5361B2728C7705B9AC347D684BD44E009F223349 [email protected]
804,163,689 *536710DA18277A728C76FEEDFCF7BE69CA75B0BE BGTI!
804,163,690 *536824FA23098083ED52665C8D49FF12E45F863D [email protected]
804,163,691 *536015A927E05110EB00C518BE21B327E1C939EF bigdesking
804,163,692 *53639FB82BE881EF42DADBB8111DA6AE6102CB17 [email protected]
804,163,693 *53647EA43C5DCFCF6E361AE3E45C20F6F986B392 BILLY KEHOE
804,163,694 *5363AA459BF51D6AD244161A3B6C6879B8D359CC zin.ko.ko.waing
804,163,695 *536549E806E2F57FCE60077B14A5D9FC629F6B3B ZINTHIA1
804,163,696 *53698D6A8369332B1D868B229BAA8F1F539BE857 ZOE.FELLOWES
804,163,697 *536BC57802696E34D8DE1B5F6196FBE1A88757A9 bixmc
804,163,698 *53633DD206916B1219022167B9CDB1529F8AAEE0 бужурлук
804,163,699 *5365121804ABCD64D5B5B1630D51A02EBF00C96B BLOG.NMAI.SI.EDU
804,163,700 *536811FC35415A340D1DF6EEBB334DB49A4E04ED [email protected]
804,163,701 *536BA3BE50CF86909C504EA79FBA5562415C290D
804,163,702 *536FB4AE3EA71D847E175DC3C2AEAD4869442B61 :
804,163,703 *536303B198AA8C830E70FC576AF726A2F2ECFAD7 k
804,163,704 *5361EB5F91B9FA79DA2CA9DB99A7CD1068B13FEC B_M-
804,163,705 *536163F24AF24585F164764AB9A2F0BD4DBEB931 BOERR
804,163,706 *53690855E34CBB4CAC2B5AC501C3C3C667DDF157 BOSUMTWIV
804,163,707 *536F5336AEA931721282F44CB1068B20D470EE90 BOZNEMCOVÁ
804,163,708 *5368E8E1EB7A22BE6F4A6EB7AFE890C4551337CC 02111031
804,163,709 *536CF5DE98651786A66291135D843C7C8BD8C54F brandypagan
804,163,710 *536B5FFED33589C89AD0703D32E6BFC66DC5E474 BRATNE
804,163,711 *536AFBC93D560CB9954CB3938DE49646D413CD1A 0IAMPASSWD3
804,163,712 *5368AC494600805A77345F243C4F255AE3B7A34A BRITT.WYSE
804,163,713 *5364921E1BB516F3D70A2DBE7583C19B169018BC BRK4W
804,163,714 *536169F788C4C8EE8CB4036BCCF1758809C3D44A 110350
804,163,715 *53665C7CA868C4021A951EE16A6D5562406500A3 11201620
804,163,716 *536E63421F9011A15A6366BA75D03875081E81AB brycejayde
804,163,717 *536697E055111B9A57BA512ECB295ACCE027F17F 1249653 PAIKKA SIJAITSEE PIENIVIRMASVEDELL
804,163,718 *5364ABAFBF658FB9E0A54C89AE42D6B5A9F2A918 bs)j
804,163,719 *53673155CF00F3E94046CD3581EFBD8BBC6264E6 1347433 tiensuun mukaan jokaisessa s
804,163,720 *53663D5C408B823F826C286B56C17B52FBBBB0A4 buddhistsymphony
804,163,721 *53670FAC7868B369F6361CF65CE63B39233A993A buffoonish.
804,163,722 *53660F822E1D7D68CF650A6C62C604AF3657928C byg7f
804,163,723 *536B464D4C9FADF32306F4B3FD8137747C56C694 1632485 KANT LAESST GRUESSEN
804,163,724 *536452C3B381EBF7DC41BC78ACEBEF0C68A34799 [email protected][email protected]$
804,163,725 *536FEE9A9B4B763B2804BD1C496C974ED5AC987F CALEB.TIELKING
804,163,726 *536B2DD806B07F8E6FA35C9A0A678046B37A631E 19021640
804,163,727 *536D966680D4ECED0A94B71DC4BEA66C507C92AD 1.a-liga-vertreter
804,163,728 *5360AB7B9E40DC2601BEF89A5E67D06BC4EAA4E3 1BOUDIER
804,163,729 *536B7F78E5337401A6FDAB92F35022505D7F1819 captiveraient
804,163,730 *536B23583A1A6982C9E29FC7121E6BF38C5281F0 1 EKSARKAATIN
804,163,731 *536793EF9588C59BAD2B595E0287B789C59FEF7B CAROLCHASTEN
804,163,732 *5362BC2AE9548314BC68B325E6629FE3191DDDFA 1EZOLTAATS
804,163,733 *53666D836CFA933169F3D8ABF6955C97ADFCD05E carsondetro
804,163,734 *53674A32C7391A4B935114709A76B015EBA4624F carvivore
804,163,735 *5364DDC7BC416FA32BB389986C8F4DCCA3BB9546 1geistergefaehrten
804,163,736 *536E3240136A10F3B780C86C869E32C8AFE94635 1gicirtiya
804,163,737 *536BA81E2A56196F70DE2692B70003304E695967 casj5418
804,163,738 *5360B8B5B9E5586C4A16CA7118CDC3AFE46CDE12 1harjoittelujaksomme
804,163,739 *5369D5AC8823B36F977A39B1C65A9D26BED0D196 1 HERUNTERZUSCHLEUSEN
804,163,740 *536448EBA7C03C1A9B354CDA7B395E4546413F63 1-HUULIHARPPUMESTARIPELIMANNI
804,163,741 *536421F90B41F1B33E921B057F3B18EAA160E4E6 1-JOHANSERS
804,163,742 *53655573138D1C204013C5D23668147F8DF834E6 1kassenarztchefs
804,163,743 *5365F12AB991BCDEC63202EEE7494FF271B18C92 c+:=c
804,163,744 *536491FEEE02A4DF25B36C2B5ACAF54913558458 1 LEHTIEMME
804,163,745 *536870F8283188AF128DA409A2DE475772D86674 cdy#f
804,163,746 *5363AAFF1B1A7009431C10D5A03AC257D49F7265 CESARDOPF
804,163,747 *5369B0FE527505B0ABDA62B6D7545CA469B48BC2 1-ohjelmatekniikkaa
804,163,748 *536525A175034E98DD86351F480C89C9AA8C8CB0 1PANTETH
804,163,749 *536C59D6B20BC49E02BF8EA558E665BB9F329A64 cf9gr
804,163,750 *536CC0101959FD66E952562436B0EE31A7A5AB8E CFU6?
804,163,751 *53658C07C549CF1B05C304BBFF8C6CACE20AE51E CH2QD
804,163,752 *536DDF0FB65CBB4FA77CFB93DB3C96EDFF42AA74 1-SUVA-BEHAUPTUNG
804,163,753 *536E2A70C25AB6B7EC326240CA3DDD0E183170F0 1-TARHATOVERISTA
804,163,754 *536F8B26066D10682F7E69D73DC8D9956A224FC6 chapter.1402:.alamo.gulch
804,163,755 *536FC6CE886C8F8AC5E2F1E18CB4501871DE1874 cibucbus7
804,163,756 *536520243795E64B9ABD148B013A91B4DF50382B CIRCUITS--THE
804,163,757 *536CD624BD3897605C48548C74AA8EC12BD97BA7 ckc1_
804,163,758 *5366FE67512F230FA5E39D704BC7059D31E97DCE CLAPURS7
804,163,759 *536399F26F552D267CD4C703BDCAEB4A71E9CA6E 2736983 PALKKOJEN.OSUUS.KANSANTULOSTA.ON.V
804,163,760 *53611E4B7B84C509A535EEC6B578262B986F30D8 2774294 MARIA.J
804,163,761 *5361BCF4401076FAF0E959B0D18026AA0B2DE475 2819373 etusivuhepsyinfotapahtumiajohtokuntaj
804,163,762 *5360C336B0D52F420BA94DB4B7AC43AF840CB5B4 2909838 jotta-voisit-k
804,163,763 *536C5342B51A08776B003A5979D34E1CC3648CCE 2999867 NEUVOTTELUISSA.VALMISTELLAAN.MY
804,163,764 *5365AB2DCE6479C438152513864E97075691B816 CLETUSTOUHEY
804,163,765 *53644AC8061A345D8D93B543778713939781017B clevelandbaurer
804,163,766 *536B98C45E099AB090250E9D7E0AEC404A543861 [email protected]
804,163,767 *536DEC9483067549BA4EAEDC253B13D99789FBC0 2ANGELRIG
804,163,768 *53625EA513198D5E2F29D6B3E9BCB3478825B492 2.bonnington
804,163,769 *5369BA3E3401B98E8A22AE3051950EE663390284 2DIERBAARST
804,163,770 *5362087B2FB9DA3EEE854E5897821916DAF8DDE8 cmmtv
804,163,771 *536CC0A6EFAA2AEA32BA45FFCDEBE74EE390BDC8 CMSP;
804,163,772 *536B6AC34C067C4EA307D347771ACB60193ABD44 2.KUNSTSTOFFKORKEN
804,163,773 *536561D55977DE58D917D8E1F36F1EEE762FF219 codeab
804,163,774 *536D66183E80530B7BFC5BB3D2FE56F5EC5F1D15 2.LOWRiE
804,163,775 *5360EEA3303E4BF6E94BFF77773F2FE443398865 COLE.PRAY
804,163,776 *5363E841D727A1137EE77CD6FCA9FE72C4C31D5C COLLIN3ATION
804,163,777 *536D53265AE450CDC3005642280F3B8F52FAFEA4 COLONIZE.NATION.(FEAT..SKINNY.MAN)
804,163,778 *5360D50476E1D1341ED8291CAC0146AE76D29A37 CONCERTO IN G MAJOR, RV 443: II CADENZA
804,163,779 *536A4B726805B6A4788C69A921AF6E8544D3E064 contemplacionydanza
804,163,780 *5362A26BA3F4112C8FF93B76BF2C68554FADBA57 2.tuhatvuotiaalle
804,163,781 *53604BECD3C4D2A81869A6CFBA2307AE55DD9229 2?XAAA
804,163,782 *5368553B20E0B9CAFF34819EA8DDF1D007FC8241 3932 ugur.erdem.urer.(.kemence./.temel.bilimler.).ogr...grv..
804,163,783 *5366B3F8A04F62866F69B646AA683385F3EAA114 C:\PROGRAM.FILES\ADOBE\ADOBE.DEVICE.CENTRAL.CS4\LMRESOURCES\RO_RO\CONNECTIONFAQ.HTML
804,163,784 *53601888461E8720B983F7AEFD4A821777A8A074 3=====D-~-~-~-Splat!
804,163,785 *536388842F9002E2DB32F9675B14076AC8AE8299 3gaelic0
804,163,786 *5367312BC58087B64BD28DA3FCEB3113235939E3 3.KATZEN
804,163,787 *5365FEBA4176CF6D61D7C9D9081AB888C4BD671E 3SCHREIERIGST
804,163,788 *536E041DCA6E069D353B38B723331D49E059B361 CQ1=E
804,163,789 *53605FF1729890B2CDE21B02D9E1A292BBF5438D 3 TARA
804,163,790 *5361C07ACF7510553357EB79CDC394E78F53AFD7 CRGF0
804,163,791 *536988A79FFF1FCA3AB70D58598B374A272F88B0 ct5_s
804,163,792 *536CDC502330179E0CAA4697394425D6A82BBA05 cv6ql
804,163,793 *5363A13546F765D6EC1CD69CA5D7BE5371C88035 CWN$F
804,163,794 *53624B566AF7A6B5B55CBE6675559C62B7DCB771 4.OPITUKSI
804,163,795 *53654B441ED5ADA67E791037AAC292877D2058F9 4POINTIERTEN
804,163,796 *536D47413A04BAF1BA558BA783B4524FC0CF8DBA cyber.jungle.2
804,163,797 *536E16598151348F9D6C45CB57D7E7452DCE95DE 4RECENSORT
804,163,798 *536C6C3D878695918E2411CF373BA4443AE041CD 4SEGNAUOL
804,163,799 *53623A3A88F53FFCFEC25C4F57CC2A9E56B0FE20 cysg
804,163,800 *536307543905351D72E1073F08487D2AADC1F083 4TAMBOURETS
804,163,801 *53620F638ADB29839F3F38814B428829AF402A46 4VIDEOINTERVIEWS
804,163,802 *536E036CC5D3B36AC918A9678D3EB34444C75CD3 4XAYSOPHA
804,163,803 *536EFB0502DDA8F212384F12597D11E0305C36F3 515574 KARATEN PARISSA ON YLEINEN K
804,163,804 *53668D1AFF8320CEF05A0B577BB563B6E48F04A5 d15combobu1a71ng
804,163,805 *5366C9647135932DE4C6DF02FECC3A673BF70437 5ALABILDIGINE
804,163,806 *53600EB7BF8079E75C140BF2E9989A52D64D60F8 d;17u
804,163,807 *5361B8C369247DEBA4348DFDB476182E448992CB D1AW/
804,163,808 *53652A829AFEF991522A97EE45822AAB6C337CD8 5happing
804,163,809 *53656A4C3E8C2F564E5F5FA9F8315B8BCB1B0BC0 d6emb
804,163,810 *5365EC4B9FB320C96463C41607DE2C300CA1CDA7 5RAGISRAGIS
804,163,811 *536946C6EB32A1CCDDF9683FA06A2257E9AD84AC DALEMUETHER
804,163,812 *5367BBFCCAC0B188E979BAED81EC80D3B9949C77 5SETORPED
804,163,813 *5362888DEBCFA5DD4FC1668AF4BB22A8BD46428C DALLASGOLDENSTEIN
804,163,814 *53659DA2C22EBE7AA1172633D0A76CAB51F34178 damnify
804,163,815 *536B16290AFB5A8F6D72112EF6FE7561878EA508 5UNLIKEOBVERSEOF
804,163,816 *5366861AE30D67B66A22901170FBED5236D5FD63 DANNIE.APRILL
804,163,817 *536C3B11339DFBD55D3D0BE79BAA396DDD578CA3 dannylais
804,163,818 *536C911EBFDC00172CD5D9BD898ED29D95C9300B DARIO.SARP
804,163,819 *5367AE87A05AB72911B984C21D3B01008F6458C9 DARRON.GLENN
804,163,820 *5364520878DB8CED2D734EF4F7A92DB1550B7464 darronhollack
804,163,821 *536F6DA1BA4AF628B28F90CE273B941230FEC788 679mikayla
804,163,822 *5365FD9C36235730452C099F5C8EEDF4966B15DE dave-montalbano
804,163,823 *536A027603C006E44B4E14A7D9CCBDB8353A7A8B DAVEWAKEFORD
804,163,824 *5366933E6F631543ACD44A34B22B389E5906AB43 6DESIREVLIS
804,163,825 *5368A5BDD292123E85D0D081702F0A3BC53D2B99 dbiis
804,163,826 *536EC0EF2ED92F21340040D3355F8D688E4D320D DE4THC0L
804,163,827 *536667DF8B04CBFE8294B13EA19F251CE9CF7875 dean-findley
804,163,828 *536AC2C38F568CF40489C96C33A60B1E9C3533B9 deb#
804,163,829 *5369D17F78D2B350A323FCDB4C8F56A77625742F de?dc
804,163,830 *536691CA7CEB284BC1FBCCA3CFE4585CB3F61886 delrezekorchestra
804,163,831 *53606659573B339D5D8AFEF7D1046823C5692582 DEMETRIUSNORSWORTHY
804,163,832 *53609BA3BD6E8B5718CA9C833500C50C808A7F84 denaliwilly
804,163,833 *5364FF443562061CEC752272E29E90D5F7E652E6 7ALICIAMEDICAL
804,163,834 *536D82A95B7B0EE0A95E2524465A1CA0760117EC Detectiveromans
804,163,835 *536C99650265060302E202023E77118E735DD9D8 deviani
804,163,836 *5362D758726D16537280B82EFD9058F1F131D93F [email protected]
804,163,837 *536E4506EB8690CA66FA13F755A75AC765D9792C df4pu
804,163,838 *53601D2E9B503E1E6A16973E7F71034F2185CD00 7PMYTOBUT
804,163,839 *5369E72D3CD06FD7F69F41582C493BAAF837E5E9 D_GBS
804,163,840 *536E5B1BD59966043248F119AAB093E463268768 7TAMBOPATAGUAR
804,163,841 *53639E6B1D49889BE7891B97D743EB3BEEBAFE6C 7thattika3
804,163,842 *536CEDBD1D0A90F628D2F2C5A6E1D09B44D2E76A 7WOOSELSBSW
804,163,843 *536499BA23CD0EEAF87BB1519E598F69E0B63014 825361 VALTAOSALEHDOISTASIJAITSEEVANAJAVEDENREHEVILL
804,163,844 *536F14852446CFC88706E6A31191A4ECD9476118 8DECEMBERMASTER
804,163,845 *5364B20911DECEDFAA21845AA6EAA507E203E163 DITB;
804,163,846 *5366EAEE4EBC91D18985BF5008FD0ED32334712F [email protected]`m
804,163,847 *5367FC8D4670808AFCEA24309612DA68B5506570 dm.qm
804,163,848 *5361944952191C40973349E2E5D9FEC13F7BE535 do-eg
804,163,849 *536F29773FAA9C9B92A89531B084ED28940C8998 8REPRINCIPAL
804,163,850 *536A222EED6F4DB059DDD6E17DAE6047EAD8FF1F [email protected]
804,163,851 *5364CBFF73C5B977C1DFDE25541B02F557905458 DONG.SYPOLT
804,163,852 *5367E2F6E53070E4806A14C9E280116389870195 Donji.1
804,163,853 *5365B8C65ED7F9C80487BC6CF7254F9A8352CC46 DORIAN.DECANN
804,163,854 *53673FC58F1F77E7A4E52FBA15C59A88C6D42DCE 8UTIOVLEV
804,163,855 *5364D146707248A0EFDAE425CC2062603698BEA8 DOUG.BOSLEY
804,163,856 *536735B5F8EAF20A1523A52C77227C53DE61E034 995 LABOR TROUBLE
804,163,857 *536A38C98E33A06E541214D1115C7664A61DAF44 9BILBOCYNTHIA
804,163,858 *5369AA0148A26D256B302FEB929CE04BBC87A7E9 9BSWCOLORMIXBSW
804,163,859 *5361E880D7598732EE33C3AF20F833E2B2CD126E 9BSWFORECARIAH
804,163,860 *53613D9D1C92412C01A2A38114767D46D087CDD3 ds$a5
804,163,861 *5364FEA52B3A77D4C20C43F4DBAFA9A54B5B431B d(sk2
804,163,862 *536678752F0F89BE7B59F45625E606CD632A2193 9IFARYTCP
804,163,863 *536AAD64D81F79B8033DE3A26AF229409F4276D9 9MORECRAFT
804,163,864 *536549FC92B55F029083B610650645020B06B7DC 9MOUNDAYNES
804,163,865 *5360987D9DFE75FB7F9B734D3FC0FA6853C54E5B 9MOVIMENTAS
804,163,866 *536518C09BB9279C20E4A4C0B86827C5D36AABAE 9PROJBTD
804,163,867 *53603A8CF580E17D88AD93509A306F182038DD03 9VIKTUALIEHANDEL
804,163,868 *536A65B2B5A7E40A1F152D7F025CE8011C2DD72D a0vaa
804,163,869 *536AB4C5E0E6D711CF1D7A273A4450CCB52C7B9A a5lli
804,163,870 *5365617F8EF97C3F9B5956A45D2BD335B0C196C0 dy3-mix3r
804,163,871 *536DB97BD268F9347FCFD55358549EFE4A47FA37 DYS.%
804,163,872 *536476CBD8D63A8DE59B519F86547EBDDC349A29 EASTRIDGEFOOTBALL41
804,163,873 *536DEE8152B5159DE026509215757975F8D2D211 AAA-HI-TECHMOVERS
804,163,874 *5362D1ADAF4071707EBEBFF70CB24C008F6B0C7D ECLIPSESTLOUIS
804,163,875 *53629533ABF19AAF93C783A869E7CA90DE785F1E aabtxl
804,163,876 *536E7FB905A4AE9998179265B58A99B5338E54A3 aacky!
804,163,877 *536B3CE19946A2BB07D9F85A4D0C63AC9AA99773 EDOKK
804,163,878 *53657AE70D1153889881A63638104537714A0F39 EDUCATORS1
804,163,879 *5364BA3EB4216872B82C210702D5AD27F9E24CA6 EEFVO
804,163,880 *5365A1DB8812778E97BEB9E5669154E0D52A1FDB EGASLRB8
804,163,881 *536834A14AEBC56440F91F4434BB6E73FA9B8D67 eiufl
804,163,882 *536B074243F239C14F1B49312EA4990A739383F9 EMERSON.DENARDI
804,163,883 *5361AF26C64523B2A0E2CE2F9D66B1997E31507D aa=xc
804,163,884 *536EF255CC10BC14E906351B9620A15F4937C7AC abk+1
804,163,885 *5363F2747106BB43AFE37110B5B23F07D7AE0742 [email protected]
804,163,886 *53695CF4439B893D40C48BBB95DF87A58094D4A5 ep,la
804,163,887 *536B503C45C789F2B6B69CF08B23D9CFD045D59F ERINSENNETT
804,163,888 *536D0E0EF73B84A45EEAE081E17B9432F03BC563 ESSELMAN
804,163,889 *5360402CD07E4B1D022F2E4C02B0E4D93F416232 AhD#
804,163,890 *536A3C8F0B8F1498EDA677392FA4EB0CDB64FE8F AHMED.DISCALA
804,163,891 *536DD98D73E9A455EF7EE34ED644FB26524D190B AI40
804,163,892 *53625C21A856BF861FAF976BB9FB8D3F7C27A295 a(j+o
804,163,893 *536DE66ACE2A96F60B49BE2B55E10A849075D0AA AKASHMOHTA
804,163,894 *5365123D4CA02DF4FF7C02F47ACCE68B078F2ADA a-l8?
804,163,895 *5366817C4D0A46A6BC9BE745DF1BBED0D0C2FA6E al/e
804,163,896 *53678252A1B22BA899906458460FCA4E9781F290 [email protected]@71NG
804,163,897 *536DAC0DE01A54456CB71B037838CBC4890F1589 alfredoetherton
804,163,898 *536938628A75EA21DB29489830996B72C8BD99A6 A,LHP
804,163,899 *536CD9EFA6EDBBC423048FCA502FD76920095ECF all.the.best.from.italy
804,163,900 *53609401BAF631AA195324CED3B299E13CEEB34B ALQ:4
804,163,901 *536131D1301373E9E7E8649C117B83454DB809D5 an+1ph0n
804,163,902 *536660072B105F3FB888CB3C266AAD6AC8FECF1B ANDRES.LONSINGER
804,163,903 *536BFC3DD85E6BE5D5FCFB926518CF9A5B11EAFB [email protected]
804,163,904 *536B4C35A9CEDEEEA2AC567F5390E970C37EA8D3 aneaf
804,163,905 *536C3CE204EFA484D0FF523BB56B3B95ECDFB43D FTV;
804,163,906 *536E1644460B8050DEFF4E4676E33F2392563A16 ANTHONY.NAUARRO
804,163,907 *536E12AD86F27CBF29CA3A637C51A2F31F6F735E fusofuso7
804,163,908 *53669EDF241ABB2A613E8B8E3F7B31A4983D08DA ANTONIO.CAITO
804,163,909 *536CA5EA02824C2BB9B61FB9A7928344850CDCAF G0M1516MOU
804,163,910 *536B1918FEC3F95EEA04C8B486947F8AFF5F6928 [email protected]
804,163,911 *536ED56EBBFCFBF29625A1E5819706B2F9619DDE GALE.STRATHMANN
804,163,912 *536E1D708803890669D4CC14BD141DBB43091F52 gambit1906
804,163,913 *536DD99F13C7C694A2481E5461405DF7E9543BB5 AO:V
804,163,914 *536762C1E9D76AE6168552BBE76367BD1BC44658 ‘appreciation
804,163,915 *5366A6E421ACAC2B897840B87A31E916D394B7BA geobreiz
804,163,916 *536AFB729E976675E05F6DB7AAE5D41634DB0C68 GEOENLACES
804,163,917 *5361CCEC16A87AFE92FABCCD922D9E3817D92153 [email protected]
804,163,918 *536E620AEC7665300C1B8F5E0247FB465CDBD354 [email protected]
804,163,919 *5366D9BA2FA9FEB317A24F459ED1436C0619A58D gihsuoyc4
804,163,920 *536BC92BC30FC69B411D5BD022EF694EDA62E3FB GIOVANNI.ALIX
804,163,921 *536A830A6E09B80E08CE19A84261A5EDDFA77E2C ARMOR.23
804,163,922 *5362C72A46D3E8288CD36F6EECDDD0794BE9ED0F arrym
804,163,923 *5361B65DD0518DFF1C34111C17F2D0B224EFC3EC ASCETICS
804,163,924 *536C73BF989DBAD57DB21160127D02573355A420 [email protected]
804,163,925 *536BE3DF3DF8ED016815A751305835E487D12ED0 ASHLYN.BROWN
804,163,926 *5362C0F8B7760DE7F1A40A024AE60016C0926EB5 AsLW
804,163,927 *5369974C4EF5D6EE2AFA2CE4743CF79795A6C644 GRANVILLESTALL
804,163,928 *53610415E1A4CF2ECD6392E99FC6AD62DB7E1127 GRASS.GUM
804,163,929 *5360361E0A0E5D9F6E3006845FAA343A94E51D1D at!xq
804,163,930 *53681DFF6FA8276C5244A997EDC51CCF7D97E4E2 h97ark33julian98
804,163,931 *5369268F3CB127D6E408A2CC29084F129217B05C avq6b
804,163,932 *536F6EB60081308B502B417E5822F504C6CEDD96 awgfh
804,163,933 *5368AC12C322691387FF6C4E2FE4B6A142E2FA84 AX>V
804,163,934 *53600BDBD5F19DC2DF42FEA992F2E69BE4E5647C B>~(^_~)
804,163,935 *53650EE9548C98AADBC10AB93A7F53C9E595F3A8 b4q1r
804,163,936 *536211007D7D7300E85A8EBA15146E85030CDD5E heribertolotz
804,163,937 *536155013015EA7EA62127D53E9C0A877C5402E9 b6fji
804,163,938 *536D72BD0CAC4838883B7F0CF7049728C41EDC93 [email protected]
804,163,939 *53666915D79F038E6C7AF1E9F5B9A3383689E893 HMNHCIOMDQ1
804,163,940 *5365A6110601701A7C25DF14E1FB7EA50B865898 bandiporenacjammu
804,163,941 *536389E093C2C286D4AD28FA7C85CB25D170AABB BARNEY.WAKABAYASHI
804,163,942 *53604F8A2F9B28D6C9CD685EB8865118752BC060 [email protected]
804,163,943 *53635C877751D53A34CE5396E3C41FAB0F40029A barrettkilduff
804,163,944 *5361271ED1CEB18BA1C341828B0850CC61ACA264 [email protected]
804,163,945 *5367CAA8FE780364EAA74ABA9BAC51CFC4971B43 BASIL.LAZARINE
804,163,946 *5365E3CA8469E71CAA3DF79153F6F9CBB3917E01 BATTLEOFMAXTONFIELD
804,163,947 *53685C1E9701C608C64A12C085158DA6D334ED15 bcvtm
804,163,948 *536F8C8DF7A2336586A19EDFF4233F721FBDC20A [email protected]
804,163,949 *536D82F2D782F65835955C8BE34BCB20E78AE583 <B>DiSTRiBUTiON-OF-THiS-SOFTWARE-PRODUCT</B>
804,163,950 *5361940AE73AE1A7A8AB0B12FB653CAF29BD7A69 B##D*-SPLAT
804,163,951 *536DFB50CBA41FECD9D00A95316BC34CB6FC49BF beaumofford
804,163,952 *536552DF4EA3249FBDD7869B9152CB0F43E807F4 becorrect2
804,163,953 *5367AF57BCCF9D47C59522D72D01FF7343FD39D3 [email protected]
804,163,954 *536AA908FC4996C20E24B576F43AB5B8AE4EB8EB HUEYKUBILUS
804,163,955 *53626781900E48716A9896381DA0B440DECCDB7D BEKASER
804,163,956 *536F8D33DB8B21429BC24E5EC6B7FDB90BBA93B6 HYMANBOS
804,163,957 *5368C2EB99F2A8582E5350E5922570360244FBB0 [email protected]
804,163,958 *536A9D16EABF5C26DD8F1DD55229D06B790FA0C2 BERGAMONTGTBERGAMOT
804,163,959 *536E4F98D1CF62BCAFB5E97ED6B25A3163362B20 iamsophia86
804,163,960 *536AB98232100B2C798AAD944C8E0FBD15D17A43 BHPDG
804,163,961 *536E5769A4021D317BEC98AAFFC7892B0C87B32C inciales9
804,163,962 *536E58D81F395690BD751C6E79ABEEACD7DBDB17 ingescherpt
804,163,963 *536BA2BBBB0C269C8E07AB6CDDE120FF5CF82CD2 INTERANTENNAL3
804,163,964 *536E9D3789375DCD4F1CEE2DE247515B2B531261 BOMBAZO-SUICIDA
804,163,965 *536C7936F28293A463E16BCA75E490E3CB3842E8 BOONDOCK88
804,163,966 *536F7CBB661EF9FD2D16B82AA92FE4CD1706CF11 B##>-~O~o-Splat
804,163,967 *536DA3D4A8FE7B55F1C73F6B0017DB9793CDC8C0 bpocm
804,163,968 *536F6781BE5924A8C3410524AB77E5FB573E69EE BQ6A2
804,163,969 *5365FAE4C5145926256DE34ADDDC9237440C3A10 BRADLYLIGGONS
804,163,970 *536B0CCC8DFFE37C2D13C4D27A2317F91F0BE124 i[x8
804,163,971 *53609EFD052D5023CF0A7331A555C4C61B864FD5 BRANNDONB
804,163,972 *5363FBF999A42D41A2616E5DC1D8FC377FE6DF96 brentonherwig
804,163,973 *536F8A856C25EEBC972B33CFC0A13A0CC592C1CB JAILLARDON
804,163,974 *5364C57FDBB65C0DC5F39A8939BF9A4E42ED385B JAIRO934
804,163,975 *536CD52425E8C1A7BA81F9059C90E1C8143AAC1F JAMAL.HOLROYD
804,163,976 *5365C27170B0F15D0695DBF0DC58D94478C040E5 JAMALWALKO
804,163,977 *53689A8419B3DBFE8D43BBAD9DC1A6C9C05A1CC6 JAMEBEDFORD
804,163,978 *5360591739C2C29C09A7D5C6F47AC6697BAE0C76 b!r=s
804,163,979 *536BF2FB92E2B8F34B57FC2DA3679685404B0A0F [email protected]
804,163,980 *5365F526C6C0B7A5E62F2A826E6C84700716A559 jaquan097
804,163,981 *536B95AA5FC837C203EBBF92E6D579DEF1E7E2E5 BRZ?
804,163,982 *5367D76B4EEF6D861534ED95C7579BC80ECAA6AD JEREMYBARTLETTE
804,163,983 *5369A429E105A3580A6E417B84385429480F3DF3 BUNDESAN3
804,163,984 *53617EC3349A2DE78B7537D9064E5C335ED1ED7F BUZUKIA
804,163,985 *53649AAA8F81502A6C1A14778945C493AF97FC2A JEWELL.FROSTO
804,163,986 *536ABF361E53630FA3596DA7D146A2FD2C84AD05 [email protected]
804,163,987 *536EA55C6E644F5828E19B35151BEC2FB7B49B35 JILL ZUNDEL
804,163,988 *5368F76A5F2A7961A094B0290310EB92D5661042 jimbobkimberly
804,163,989 *5366C8B27937A29492155DFE1466FAFC6F3EE2D3 JMLAWI
804,163,990 *536DA7A50226BFB7487E5103D85D0FE3C233F076 BZjE
804,163,991 *5363A0F7B230B0F439915B5ABC62817DC215F526 c"!0v
804,163,992 *5364D17DD607A2BE44B3B98C69025668AE81D30B C2Ge
804,163,993 *536849419C43331B6F29013134F55114A25D0C2D JORDONBORLING
804,163,994 *53609D0C42CB9F7FCEBB4538B1B5233553904339 c5%mc
804,163,995 *53638EB5628690D0619182D0EA7607BE3FA3D11D c7?d
804,163,996 *5364AAF50129769030CD3D19128DADFF4340F127 c9m
804,163,997 *536ED79D703F20A4D83A89BDB096E6946CD50074 Jqa
804,163,998 *5366458E31137E60A1CCC9C29600EA1819628685 julius-verdun
804,163,999 *5361ADE8E0D9AD1E686E36F475890646AF202951 JUSTIN.SPRAGINS
804,164,000 *53628B1DCC39E724E118D36F3D32172840A7C07C CA=PW
804,164,001 *536D160F2D809B0450BD786075D9B4E9E44E3FAB CARE-FRAUGHT
804,164,002 *536F681AB6F2083DD789009EB7577181BF5C60E2 CARIBS5
804,164,003 *5360117FDD8E05B09E79B761E898A387C5EB2BD2 caryesbenshade
804,164,004 *536CE9E1EB905D020C9C9521F53C620805319AC2 KAY.PRICE
804,164,005 *5361B4564B8192BFCE77C8290607FE44795E2378 k*e~
804,164,006 *5369D784CE2C911151169E0E3542B1199422AB27 CATSEXY4
804,164,007 *536B2F4A7E524D356C7750B1D7054DECEA48D012 kerry-grosser
804,164,008 *536F9F60942D02C180ED35FC01E6FB7CFB39200B kerzenpalmlilie
804,164,009 *5364FBA19FC555E7E5D5350022714E227C52CD92 k]i!
804,164,010 *5364497D83BCB8D010B8DB34DC7BA5DFF032C74F KINDERSZENEN,OP.15:II.KURIOSEGESCHICHTE
804,164,011 *53630BF573741E2D8057CA075418038595272132 KINOADII
804,164,012 *536DF38FDC778DD45163925A0AE2C16348A15CC8 KJORT13R$
804,164,013 *536E85B06C5D7B28B49BA3E3AE64EE6CB07A28B9 KOTALÍKOVI
804,164,014 *536D5025ECDCD248371623946082AF1C63478323 KRISTOPHERSIPE
804,164,015 *53633CF948143690B4CE562FD6EAEF0232402B24 C=Gi
804,164,016 *536E3B023D8775401D214E8A9B34D8B0D4D96110 lawerencejessick
804,164,017 *536A64B9D9787561AE03460EEBD1BA2F94BFA0B4 „LAWINENPIEPS“
804,164,018 *5361E39553318544AA9DF0701816DF9CDB52DF36 CHARLENECALLEY
804,164,019 *536F4EC939AF800EEECF6ADB33326431383BECDF CHARNEYV
804,164,020 *536480BFA55F6734B08735726BBEABA7333934D0 [email protected]
804,164,021 *536A1CBF6C322400C3293445FCB187AEB11DC805 LEONARD.KAPLAN
804,164,022 *53678CB76DB44A9DFC6CB2FAE7188276403DDE39 [email protected]
804,164,023 *5364E4C81963045CDAE09CC36DA5066AE63D872E lesbberceaux
804,164,024 *53692336A3C35151A3BB0809BF5D8E8A190C8892 lesweise
804,164,025 *536AF48C1725B8C74894916DA6C37B39ECEF0012 CHOALLEGRO
804,164,026 *5362CD022E4445807053883F33401516E4DA7061 CHRISTINELUCIE
804,164,027 *536F354BFD34A5DF75A661C155A2030FEEA20062 ch,wy
804,164,028 *536302A322AA942EC6EB507AC499F3345FA808DA LISA-ASCENZO
804,164,029 *536121C36D71BCF17211A5DCA2DB637FEAE584F4 LISA WESTERVELT
804,164,030 *536B27059FEF8B5C3E43D5249C05F90280E6AF44 c$ixe
804,164,031 *5365F4D294C3806BBF96169423FA3A2C53C370EC CJBPA
804,164,032 *536D30D01C4E939A0A5E047479E54F8273C8A16D classicsthe
804,164,033 *53606FD314C860BFC91865DE20D8DD478CC83D4F CLAUD.MCMUNN
804,164,034 *536753DACCB664F359747B2D0FFB7099177738D6 claudwhile
804,164,035 *5360207AD20419ECA31ACB9BAA6F33309FD80408 lone-wolf-winter
804,164,036 *5362A8CC84897FE8C4F28E206FA019625F18B8CF clhsm
804,164,037 *536796F44F63E67CC79C41A431C5047E496970AC LOUIS.ARGABRIGHT
804,164,038 *536255347A91BE6F0ACDFB066F834D458E369C08 LOUISSEILS
804,164,039 *536D06925541D218319CB4A76FAE0A84A151FD2D LOVESONG(METLIEFDE)
804,164,040 *53666A49E556ED811D85A66961DC43B23837C62B [email protected]
804,164,041 *53637330C1E37C73B532057ADFC73A1F7E65489D LUISKROSTAG
804,164,042 *536E8474B1A6F71612563D1B10949CF52A2C5902 cnrwt
804,164,043 *5363D030043E3E559787076A6EC332652DAB904E [email protected]
804,164,044 *536A3E9969606FC3CE3C3D4724493CB764806383 lustres
804,164,045 *5369BF2551F72FE5D043214014F3182800E20A7D COLIN.STEINBERG
804,164,046 *536EAFB044DE3AC895C9489AEA23EA1946DC56B3 lyndontruog
804,164,047 *5361BADA70B97122C1A6506B6B6492912221065F LYNWOOD.WOOTTON
804,164,048 *536C297CFF8B138EDC820EBE78297A79764AC3D2 ma.4
804,164,049 *536D59CF307D12F59B40119A810C8EB3A9C8BF53 condomsnm
804,164,050 *536FEF5B1AF93AECFF14109642B71CEA62353BA6 MAJORKRITES
804,164,051 *5369DB67633F787AC83A31B9732540FF3A833A82 [email protected]
804,164,052 *536CD6E59D51F44910DC1C7C63AD2964DCCA62B2 CORDELL.DENNO
804,164,053 *536CC9FA944F76C52EFDDF51D9CBA29686F74FCD CORVETEAR8
804,164,054 *53643EEFCCD699E0D1AAD590D4961C3AE8BD413C c,!pk
804,164,055 *5360D7F9D0019D67237E9195C7848AC714CED10A marcelogarnier
804,164,056 *5362D7E41A3C0D25482E81CD3E53DD4B58855EFC MARCHFORTHEREGIMENTGRAFLOTTUM
804,164,057 *536D34D993DF43720E8D49CC899197222503199A marcreller
804,164,058 *5360043492FD12BD61BDB93FC1E21B2D0D407F79 MARIAWEHE
804,164,059 *536DCAD15A3654B8D38D3985B7F724D55612613E c,&ps
804,164,060 *53663967B91443B5207BFF8ADB7EBA008CB19BEF marionkaboos
804,164,061 *536D058BA927A769E471560BEA6F4AF85C860005 c%ra
804,164,062 *536F45E87BDAB0AA22AE227B966EC6488C7EEBB3 CREPAMMOSED
804,164,063 *53649CC529C5D74D94F49E584C8D9CC769BB5D74 CR-WE
804,164,064 *5367F2FED5864990FC143DCC14F3D2673E85E4AD matutonacidade
804,164,065 *53600FC3D385A690435EBE4372B2C3F49DD676E7 CSHVV
804,164,066 *536D724956E3A6116A6E9634EAF8560B80626774 MC/
804,164,067 *5367F9BA7019176D64687F0E108AAA6B679D3EAC cu3!i
804,164,068 *53649EBBEE2E6BF48495B00E8C7E7EC27B00E95E MELONA-DALINO
804,164,069 *536997E0C395EF06B1ACCAD3737561A7DB4AA87B cubriendo
804,164,070 *536810223D2F8C7430E5C34611C0DC560DE33209 merrillpetraglia
804,164,071 *5366AE43632D199A6748AE6AFC2087093EA90CED CURETIA
804,164,072 *5367CE227B0C968822C627098A3EC581D2C7ED07 METAHYDR4
804,164,073 *536FC87DD11C1AA3A9BFCD28CDD02B026ED43ABD MICHEAL.FULKS
804,164,074 *5362B65B84B86DF53EFDC1D064BA0813A0AAFC22 MICHELWILLETO
804,164,075 *536566415116912AE994D5BF03E4ACAD158D1441 microhei
804,164,076 *536AC38176AF1C9252196924B89AA980E852CDF6 MITCHELLSWEERS
804,164,077 *5364EC8E89B214CA152773F9255D4FD355F0CB66 miteshdhanak
804,164,078 *536391AD314BAF0A3F76438F7D9A6C631B6AF159 MODESTOBEAUPARLANT
804,164,079 *536E40B79C82002894D37D925D3E1D8B26926EB4 d9p81
804,164,080 *53630418524BCC93BAC6AB27074C86561FCADE90 DANHEENEY
804,164,081 *53679324B8361351028F2EB524EEAEE94BA58AF7 MOUSONIS2
804,164,082 *5367646A4AB1E219A6731D19F7E75EEDF8AF8A94 multistage_flight'm/@/lt/I/,st/eI//dZ/_fl/aI/t
804,164,083 *536179406D6446296DF343D702FBB1CE0B982EB0 MUNICIPIO.CHACAO.MIRANDA
804,164,084 *536AA91E5AEE8AD23F48A7AC2ABC9390BDC40F23 DARRICK.LARDE
804,164,085 *536B498AB318C9CDF5A5DC4E46EB964C2C3F1996 MURRAY.ALHAMBRA
804,164,086 *53642BC514D6E16A967F991939E0D4706C5690A0 DASHALYNNR
804,164,087 *5361867B1247035AC469556165A1E12D03FC9F31 DAT4S
804,164,088 *5361C95BBC02107FEC95DC025F4534A9713D41F8 (><)~`~`db
804,164,089 *536938001E0951228DAC8609C90B836E7E90AECE d:ds1
804,164,090 *5366923852ED55582ED3DB89B3F3828EB2D2AC39 [email protected],
804,164,091 *536B3BF0D7CE718DF1C60F7BB8F440718391AD84 DELMAR.PENN
804,164,092 *536F6CCA1FB9D4BA74EC5CFF1D37C6BF57AAB52B DELMERMENO
804,164,093 *536D125C9F50CE40FF7570280EE8592FC18496DE nedrobkalpnaa
804,164,094 *53644EE04D2850C996EBAC8637E6C75C42E94E76 NEORIJENTIRANI
804,164,095 *536414F4CE2E08E3592228A9A79C3895A9E1D857 derekraider
804,164,096 *5367165951B5056F2D55B1E1DEA0F7C5C964A4D9 NEUTRALAGREEMENT
804,164,097 *5362DF21CF82BB5971EF64E9EAEA66FB3E3A76FC deshawngarmon
804,164,098 *536A2E8AC6E4050C6A265046AAA04516218054E0 detectors
804,164,099 *536FDD6C10DF2AAFC4E8F3BEA4AFD5F21FF45E93 NINA WESTON
804,164,100 *536081AC6440AE45BB9583481032A6E275EE7325 nira15
804,164,101 *5363E0AD5E8352B56BDFC9A810A92871E55596D1 D%GIR
804,164,102 *536AC758856A3942007F9776B987F66F56AE3C46 d,h52
804,164,103 *53664573F6D9A780E0516F9D45EDFEBDA13D6E58 NOBLE.VONGUNTEN
804,164,104 *536F505DFFA7C35ABADDB7D9F32A9D807ACC0E10 D.HQ$
804,164,105 *53690339B8E39F7911A51E740FA2B38E96FDF06D DIENTLEISTER
804,164,106 *53629C9F776F3B88FA94FCB8C87FBB4E5F3A5744 dif+b
804,164,107 *536AC576089D068FCCC4DCDF0A63C57BEBCF034B DinoM
804,164,108 *5362BF4313194DF539229A14C963C7DACAB82028 dixz=
804,164,109 *5361F1A70F95AF669E61E13C89E6C5FDCF58D13F nude:-remade-remodelled
804,164,110 *53670243C8973E12092BF924FC525627EB7F661E DNYMP
804,164,111 *536498E46BE0F96C8D2B8508A87598B15C8FFC1F OLLI KYKK
804,164,112 *5366E8CA5E36EF1296ACBF833BD37089CC4FF831 oncz
804,164,113 *5364834309BBBA5F512B36058012811F1CFD0CB1 donrapin
804,164,114 *5365EEBFD5727A445F2E19228BEE4EFEA8CBA744 ONLYWHENILOSEMYSELF(LIGHTSTRINGS)
804,164,115 *53667BA9E42CD44DFC9337EDA97EB651790A8498 doug.tulk
804,164,116 *5368EF874C21106452330868E7AEC45EA3F06D6E dudleytrevisan
804,164,117 *536C02A48F117C312CE370C7661C3889376DB663 DURCHWHLTES
804,164,118 *536C41E70CAA2314EF1DD95DC3FB7EA91C4269C9 papoucatpapoucat
804,164,119 *5361B4B9EBD4B9538F7A266C3D9327AF26D0928A dwiyanti-agustina
804,164,120 *5361A9C1F695686F2291DBC12DAAB034BFB99C73 DWZN:
804,164,121 *5361B22F8F1C454850588A62B780E8464693695C ECAFAROS
804,164,122 *5369FEBB7C58C8CBECD3C71B0DC7B5A05E23F995 PD ~0 ~O(~_^)
804,164,123 *5368E750A5E650915D50DA19834173DB84609DBC PERSPECTIVES-(D:FUSE-AND-SHANE-HOWARD'S-EXPANSION-MIX)
804,164,124 *536190CB1E1CF61891100C7F31E449CEBBF42152 EFONDRAI4
804,164,125 *536235FC83AEDC05932A0C6B6D648EAC76C2A8DA EGe0
804,164,126 *536E1463D5910A52767AA24DE85FC7C965000232 EJ7:
804,164,127 *536FFFCFC9489B7535BD94FA6E1893E32FF41153 P!L0+AG3$
804,164,128 *53699B7B241465429A2F12F7AD5654F0DE912259 PLASTIMOUSA.COMWWW
804,164,129 *53623D5FBCA2C94BD308F6E79043082B41DBE47E PLEAACKNOWLEDGEADMITADMIT
804,164,130 *536EF4530127AB8506569C9AE55299F3E00E948B elianaecheverry
804,164,131 *536A3488AC55BC19E4C840A7B1F1A20721CD21B7 pnhn
804,164,132 *5365969DD74A17527635A81C7C5B88F4BCCF784B ELLIOTTHALLA
804,164,133 *536BEDEA5E92EE2B339746B6FCE901FB404329FC ELLS-BELLS
804,164,134 *536B7BC8CF752A3300B17B8BED421A7CDC520E75 polarkurve
804,164,135 *5363AEC77C9E6F1A5FF11317149FB72A113F7DA3 [email protected]
804,164,136 *536F5663633BFBA66D2F55263D114D0AF70D0D33 POVQ
804,164,137 *536F545E6C2DFF66EE3861BDD0FFC365DAEEE70F pP~O~o)0(
804,164,138 *5367E8029E6AE7667B897FFB12D34E65FFFB7CDC ENGASENA7
804,164,139 *53601CF4DD3B7232292935B82DA23D249A08080F PRDSTRBTS
804,164,140 *53683C0A7862418C0C1AB22250E51EFE6291AD92 pre4rti$t
804,164,141 *53666410B6A1CABDE029DC741F7194CA41AAE8E4 ENOCHSTAINES
804,164,142 *5361908EBC6AB79A8412EA39EA7FA536200183C3 ENSAVES2
804,164,143 *5368290E711F244F7DBA1CE9D79EF537EFFD1408 e,-pa
804,164,144 *53633AA60EAB4CC6A5A515C763D4A827A0E6138B przedruk1
804,164,145 *536BED02CB0382315F5C583CF4CF10085EBE9322 PUL{
804,164,146 *536C6AE50EA3390199448683158850788A2151AA „EURÓPAHÍRES”
804,164,147 *536E0D67F4DA8787DC4DE3691291046F6D55105F EXAMEN1STADIUMIII(TAKT35)
804,164,148 *5369E20D9BA991BAB125F59DEAD7028BA970E4DE FABIAN.OLINGER
804,164,149 *536C899ADD4ED0579658EDB278D97B1A4F2F2E21 faithchepkoech
804,164,150 *5366AB5B23BFAD5A49862A1270F7997570D339DE FAMIN3 BR
804,164,151 *5367AE0E203556691DDEFF4EE8C564F844E97886 [email protected]
804,164,152 *5367305494BABA3C22C7EFE66DC3246274AE91B0 FCTF
804,164,153 *536FD66ECDF10E419729260B79F63DCDEC0057CF felixortiz
804,164,154 *53687E969F02A091A93E8DD5800BA3D67D1BAFEC FLACHDRAHT
804,164,155 *536D95FAE5FB90675F4389B2AF4224485C9D178B [email protected]
804,164,156 *536ACD7FA6E27C608369F0AE289A7FF1FAF8898F QUINTON.LACKETT
804,164,157 *536B09AEF1E9A11D15BE1B20194C8B54818EBF19 FLOWERHORNRUSFORUM
804,164,158 *5367B28EF21EBE93840FAEF9262D5485B4D6768B FLOYDLANSON
804,164,159 *53687647F537C56811E935E81AC87629439ADE97 FOLA^TRES
804,164,160 *5360544AB1C237C25182961303392D12AF14564C RAEGAN963
804,164,161 *53668CB9B2F65BE072B8EB08A459DE6EFCC13684 FOUINES
804,164,162 *5361819369F7C6A3590FD2700618BC40364BF88A FRANKGASSER
804,164,163 *536A084FEDDEA00DD0D78852C842364A7AD4B671 raptoryvonne
804,164,164 *5369B8C53A00C7867BC0D9ED47E6FD95B85A6E39 FRIEDRICHSBERGER
804,164,165 *536AF7078E675615EC837B5835423779527BE8C2 FRITZ.KASPRAK
804,164,166 *5369E3DFC0B4ECE61575529A0D54A7B7791BB1F3 FROGSGREG4
804,164,167 *5365B55B8AE9DF63D84D4550CEACC2CB8BEC82AE REARREST
804,164,168 *5366EE6EE1E880F81C72BA05AF94E1FA702AF2F7 recorded
804,164,169 *5365755D43362F5E57EA9D582FD785A234A7B0FE 'G3A
804,164,170 *536228BD378CF66A17AD353D6EE9E40321C8AA5D GARFIELD.HOBLER
804,164,171 *5360AC8BBDD94CD66AF8CE62B983F4CFC392B4C5 garlandczarnik
804,164,172 *53663F4C4450084FEE2673CE2FCA7E70ACF3C8B4 GARRYDENARO
804,164,173 *5362EABABC6C82A3C4EB4D35948E765611D6A094 [email protected]
804,164,174 *53664A36E685CE2726C50C0D4990FEE04790EE1A [email protected]
804,164,175 *5363A6355E4117AF66DBAF5F65AF51F8DD1718BF gaylordschimek
804,164,176 *536ECF1FA68925ECAD8819F4CF9F8862826FA94C [email protected]
804,164,177 *5365D4FCA87C159B3B24B3B8A2D3673F6E9067C2 RENEFURMAN
804,164,178 *53666BBA508DEC1EBE0D6DA0CB95D11D3C5E11DB rengorg2
804,164,179 *536FCE396545168BF5AAEA5E96E8C8241983209E GEBULT!
804,164,180 *5361D592753AA4A6C29F4E2436B799CE35CC92DF |REPUBLIC|
804,164,181 *536759D8ED229B03F86145AEB8782505857FDA62 RESPONSORIALSING
804,164,182 *536383AAB745A71A1C9192841C7486C24BA6EF28 resserdenivrednu
804,164,183 *5363B9FA7AC5E95975A0F64B682796ACF3ADCEF7 GERRYMISTRETTA
804,164,184 *536A3507CB34CC9BC1EBE65BDAEB2A02E0BD183A ghost.of.heaven
804,164,185 *53691835D97A776EEFDC33B068F04D8C9ECCD944 [email protected]
804,164,186 *536E5191D9BCEA0098CF3619EB6DB60C1E0DEB41 ricoturrubiartes
804,164,187 *536946C86987A1CA42BB8B03D1E264C407F9670C RIDGECO5
804,164,188 *53609AF8F76C6047C5B04B0407478CDD410752F3 GINGERPASSWOR
804,164,189 *5362695EADEC99281407A36D6FFC75A2D3931242 RKSHILO64
804,164,190 *5362CA93258233ADC7412FD2822460EA8B7A85BF GLUCONOLACTONASA
804,164,191 *536873A93AF261C1B4E0884AD6C89188B6823182 gonzalostonestreet
804,164,192 *536A006FE8978570DE289061F0401AD487D2F75A RODOLFOALTMIRE
804,164,193 *5368A621665B81AA181E0F2C2C656BEEB4D584BE greenactionsaha
804,164,194 *53636CA6EA2393A1ADCCBB84FB846B04C8F97B61 ROXANNE.PAREJA
804,164,195 *5366339150AE5B27BEEB4EB614E611EB774D97E1 ROYCE.ACKER
804,164,196 *536DE43B6C53A2CE14FD2D91E0E92F7FC0B54B51 RPDMYPQ16
804,164,197 *5367253B4CB59A5C2393EEC4EA002E0BA39318F6 GUTSHMIDT
804,164,198 *5369EAA1DB45EACF4908945DD9310F7322F76F5B G'YZ
804,164,199 *5360F881F7CC64C531F3DBBBC5747347CD0C5D29 haiks!
804,164,200 *536B029F5540EA8CFFA88D0B83A0F1F58627542C harbira
804,164,201 *536378A086F7BC231AAF9A22D6F87F79A465B131 S0GNERA1
804,164,202 *53615EC6509A9D0149C358EFC373344CCF0F7CDE sakotukset
804,164,203 *5369250F40A85E161AD543E0E05D4E759BBFBC66 salvadorissaaurel
804,164,204 *536E7AE02038DC3F264496D3FE59EA32E55FF61E SAM.ASHFORD
804,164,205 *536BFA23EC885A321D5FEF0FF9F56B8B3E1735BE SAMOHTERDNA
804,164,206 *5367E76A1464B32339A5C58B1E09ED3308E0F4DB SAMŪHĀṆḌUVA
804,164,207 *536B82FB3DBAFE9FFC21B31DC295169C2A06FD97 HERVERSCHIJNING
804,164,208 *53602280687D7D5036C8B33427E9C32F4D902FFA santorumdablinksto
804,164,209 *536382EDD0A893C49DB3044E6130C74A500B3480 HGAKOVIC
804,164,210 *536A2484C0294166A9C0F9D0DCF684E07BDC0541 [email protected]
804,164,211 *5368CC9EDBA0E124A687C2E451205B6DE8B44557 sarapkiewicz
804,164,212 *536DD0C7B59A6CD2B390939EB762782B8B9A13A3 schreihbe
804,164,213 *536BD7B7C2CEEDC6203E0D2B25FD919CD0C537E7 scottiechrest
804,164,214 *5361470444E1EE839CE9538E634037A18675B0AE [email protected]
804,164,215 *536E9F5BC43EA2E996422726AE99DF841DE3081B seanwhitiker
804,164,216 *53673E6035987D78B845B4770692D58B86E0436A SEBASTIAN.ROCHHOLZ
804,164,217 *536E6FF560A846A6126C6F8581EA0D775CCB7134 secbnnscequim
804,164,218 *536DA5B0A09404DF0568A1F78837406F926410B4 SEDA+ION
804,164,219 *536A3D3B157EFFC3CBC9D4EB47AC28217944CB1C HORACIOBILLECK
804,164,220 *536ECFA39DB0C8E9434185A2D3DFDC9A20EB22EE HOSPITAL),是一隻
804,164,221 *5366EBF61C25B91A8DDD1561892C0561AF1A068F hstrgrphc6
804,164,222 *53667699C7F707A3E50FC534A4AFB1AA627AF30E SERIOTACIFIRUP8
804,164,223 *536377F29852E23683DD4665BF0B1813C529C7D0 SEROUSGLAND
804,164,224 *5368F81B79B302884CE892E6FF27842306178B10 HUGH.JONCAS
804,164,225 *536FFF1949984406D63B1D9B0D70B562856AC788 HUGSAREALWAYSINORDER
804,164,226 *536A6A24F5148075834CD1C7227CCD18828AF5D4 SEVERYG
804,164,227 *53645B5FB96CEE91B230BC498DB94062C73E3B23 SFONDRATO
804,164,228 *5360B691A543B09DBF884DB9C316519B570C7DB0 shannonvelasquez
804,164,229 *5368C755E3BB4979288E106344042304BFB44606 I^AAAA
804,164,230 *5362CB803C28CD14A2395A6318D4439B90785417 shaynedupre
804,164,231 *536DB1BD408A8C16940A6FD2766B455E5C86153C [email protected]
804,164,232 *536596832650710BCEF7A6AFD5CD570330F05670 iamwheels76
804,164,233 *5368EC99E7FD4C5B36D0F2DB4B3DD36F166F7E1B ICANASCA
804,164,234 *53637F91A3EE8A33C8EB0D5D253F2F7DD3214F54 [email protected]
804,164,235 *53660B4724FDDB51BF4D7D77FC4C3113FB09F3F0 SHNWSTRN
804,164,236 *5360527818664F3FE7FFC815A797675855D35CC8 shona.stevenson
804,164,237 *536747CEA85AF3C1461440DA02523D6C2F8CB807 shopmimigreen
804,164,238 *5360CF60243FB06CE9B91A78FD6EFE82B4D4F5F7 SIDRUBRIKEN7
804,164,239 *5360CEEAF33290AC3F8F91BE9B18089459F0B2ED SIÉNTESE
804,164,240 *536B8AFFBB92215F15DFC6FA03EB133C6A2D1C0D siocnarfsivaeb
804,164,241 *536033781B6AEECDB91C462A43A8E2FB2838B6AC ilovesnoopdog14
804,164,242 *536AFC1FCE634CD4E0341113F3FFD701C5054133 IMPACTO(REMIX)(FEAT.FERGIE)
804,164,243 *536EC95775344DBBA9D1F2EE6C26886418F6D154 independencies5
804,164,244 *5362F21E21CFEEE9C2AC8906AAAE38433DE82717 [email protected]
804,164,245 *5365D5D2CF449C8EAF17825EB293CF4B044BA4FC SOLEIL5555
804,164,246 *536943F92B699444E86CC3B4C149845514481A3A IRIDOAVULSION
804,164,247 *536715A94DDA1C3A76151D5145D792E3D592D935 spårljuspansraprojektil
804,164,248 *536D65D9A2F4F99DC7FD52B59A759939B243433A SSELYRTNUOC
804,164,249 *536EA3B677FF493CD5F499066204A88ADFA33591 SSIMREDORTSAG
804,164,250 *5365B81F2980A6EB9AC2E65418A7426250C2EB1A stammkünstler
804,164,251 *536F83C2CBBC9E5CDC0C1C80F1E27B0D3FC0531C JDBTJ
804,164,252 *5361A93EEC086668BF6335A303A6E438C1159F02 stevenstallbaumer
804,164,253 *536B5CAC4B4336C669FE8180084617D2585DB2DF stewartmackeen
804,164,254 *5364CA49CA8023607636B0E66BDB3408D2601178 stifftail
804,164,255 *536D79844CF82AC9F99C5071201B6BE479D5AFA4 JENNIFER DIDONNA
804,164,256 *5368599C624D667C09D4880EDD2811DB84AA531C STMLTRSSED
804,164,257 *536EC4678D81998749238E02E1311679BCB61C89 stsessarc
804,164,258 *536F27936A8DC7C7DD9AEA75F51A3BC644D03A15 [email protected]!0ns
804,164,259 *5363998516149FE655C90CE69B4324F7FF5D64D4 suncoking
804,164,260 *536039C054DE501B0DDE6C6ED08CC2CC0F291E5D [email protected]
804,164,261 *53635643E49B39F64DF48565DA47560280CAA911 JOEYSHELTROWN
804,164,262 *53661F619E59C3DF3E5B564681A63A5AA516152A JOHNIE.TRUDNOWSKI
804,164,263 *536C39001388FD241EFC3B7BAA0C107FEE466439 suzysue
804,164,264 *53617B3F47084AC6A8A08F49C96EEAB7D1D6A010 [email protected]REEMAIL.NL
804,164,265 *5366CF8E69FA4D354B199B7A1371203F95FD762C sweet.'n'.breezy
804,164,266 *53658A9F06CB4F8A926E46077C648D7D9B7B9A34 JORDANDURANT
804,164,267 *536AAB5FFA92B98A9E34ED23F67FB3578CAC2983 jospehjamili
804,164,268 *5360EC01D164F29938DC302296A26E62E85F4EEE systemisable!
804,164,269 *5362516D1FAE75B9E828E3BD8F4B0E1C14E6D2E2 jubilee2000ukorgwww
804,164,270 *5364955F9D6000CCC1F8B442CD872C9C7DE42AC0 JUS'DOENATIN'MYTIME(OLETHEJANITOR)
804,164,271 *536172FEB3600D10A5CACDB414017C239705BF1A JUSTLIKETHAT(1)
804,164,272 *5367BF5A236AA3261A4686AC293FBA04A285B5EA JY'J
804,164,273 *536942BF19779E3D9EA987F27F96AE378D48C655 [email protected]
804,164,274 *536FEF0F814687F72D89D2F8CF59B84873DFE44C tasha.lyon
804,164,275 *536D8B657DC8CCD9CADF894AA7719C2F77C19ED0 TECHTRAINSER
804,164,276 *536427E756A9DF26598F307F4304312F1323285E KATY-SEXTON
804,164,277 *53625C3A185FEA41F0CF65D94A06436A9E08D345 KB3S
804,164,278 *53652470E480BBE7C2D4C49326D68CBB904F6F6D TEODORO.RENEGAR
804,164,279 *536D2E76B8BB2C920D52661DB2EE23FC7872AF84 kelso-and-dc-international
804,164,280 *53648C66215F25BB56A2517078E76992C6BC9F61 KENETH.SAYAPHON
804,164,281 *536061E8909D1DB67F90606BF4CF4B1FB0858910 TESTAMENTCOVENANT
804,164,282 *5368E83F80E21E44F530538C6589188BF93998B9 TESTICARS
804,164,283 *536FFB2AD8FF65A7FBF9093F1EE3972AAFD18DC1 &KEY&
804,164,284 *536941BAA19E8C444179013C6F019208EABC8293 thataway3
804,164,285 *5369F5AABBCD3919D60DA9AAFFE73C9D76EC3B58 KINEZAKI
804,164,286 *536FE80D02F2FAAA1FE1FCE60B60AAD355151D36 thegourmetbachelor''the
804,164,287 *536F746EC09D4FD8ACAAC15A52A1DF8F64786D8F KONGKORN-PRUENGAROM
804,164,288 *53646F40F9FC74DE7C7A26761B88A49D271F422D kontramarkierung
804,164,289 *536BCEF20BEC6ED89FD09E241F7C1ED141A77A43 THUNDERBMORGAN2
804,164,290 *53656BCEBE2609A88FF171E6417300CF38EF495A KRISTOFERSUSICH
804,164,291 *536AB85844DB2D0D3F3FDE69F15B8E8D8CA8EE50 [email protected]
804,164,292 *53622921992856C65CCB4FE2EC0A9B05E8BC979D timmystanding
804,164,293 *536736B3BBAA7C8905C19C58ABE82FDC0A9BD0D7 TIOTELOUTE
804,164,294 *536618932E188A841909DE2ADE82B4122516450E [email protected]
804,164,295 *536FF173BA5CEB6503AF032EA75A6FAA45406B27 labitey
804,164,296 *53687AF0EC697684042DB55D7980D7E43254553B LA-SEMAINE-DU-PAYSAN
804,164,297 *5361D9E789286498AAD1267A9B3A914148DA3BF2 LAVERNEHOSACK
804,164,298 *536C0AC387F309CCE696DCAE94D8FF5D783A4D83 LAVISHPHOTOCOMWWW
804,164,299 *536503765E5E81EDB35960AFC706D87A54953EEF TORYMESSERVY
804,164,300 *536EBEE2CDD8FCB2D75671144EBD879533B5CA3A totbloedenstoe
804,164,301 *53666A267FD44B83BF5220854C8DC64A22123E0D TRANSCURRAMUSQUE5
804,164,302 *53624E6EA186F6D546A584446AF68957A4684441 TRAVISYURMAN
804,164,303 *53612BAF38C1DFC259AA9B4A1B0F8E50A7BBF5D5 TRENTON.SCARPELLO
804,164,304 *53656B3C93EFDA38DA2BB77A9518E53B08431B63 levenwekkender
804,164,305 *5362FD87E4682AB8266F597599623CABC1756DDF TRJOCHGORNYJ
804,164,306 *536ED6AE5402407C285431986C55923C88242EFE [email protected][email protected]!n9
804,164,307 *5369DA86E4C00336EA9F43BFD88BBF3F635EF14B TRUMAN.YANOFSKY
804,164,308 *53624422C0E296506E2D5E01AC184A1106B74D81 tseiggels
804,164,309 *536173E958CF2A4EA0059ED691B24358B4D5D9A4 LIITINNASTAA
804,164,310 *536DB3F9E0026B71B7AC6BBB632B1BB9585E2F61 liljana.gorgievska
804,164,311 *53616017AA811215C5C078B59AFB43D4C9F561F9 lindånæsbro
804,164,312 *53688A57252918DA28F19B84739B0562FA296A83 LINOFUCHS
804,164,313 *53604A41200D49A2650FEF0251DF553434C7F405 LINO.TORRANCE
804,164,314 *5365D8FE9D54FE696064A7066F9AF2E1DB30CD14 twee.mannen.zo.stil.(feat..stef.bos).(remix)
804,164,315 *5362779A69792CADD44FE19C9FCC5698D910B257 [email protected]
804,164,316 *536518F1E814CE36F507871B944A0626B3C0971D [email protected]
804,164,317 *536C5920FDB43AB1D1420703DF1B9A8F8FA790DA LLOYDHALGREN
804,164,318 *5365407BB73E87A066EA47D1BB1288DF149FA233 }uaaa
804,164,319 *53698970E8E67712A855C6B6A82657AC6ED3448C LOPH1O$TOMOU$
804,164,320 *5360A7E39E84B55E97B9B5299892BFAFC54543B1 loretodicasinca
804,164,321 *536D912D5A6C1C4012A1ACE52CA5E503071B5432 LUCA LAMPARIELLO
804,164,322 *536D271E32370CF7745C8638F99B310BE1023EB4 LUCIENHOOL
804,164,323 *53613105E0EDF3BF9EA6BD2E7CEE5CA9726AF06A luketotin
804,164,324 *5363F972FF2C73DE3E022F7D264C6688AC0AB33B LUTHER.JILL
804,164,325 *5365512B3E4017309AD072A4B819307730580FA9 UNICODOVEJ
804,164,326 *536F50676E6E6EFDDABFA9A21EDF6631D5125131 UNISERVAL
804,164,327 *536065C91C6A3C2DDE386673583E476CEA861E83 USERDUTTMAN
804,164,328 *536791167E761966228455F2AB89D2A3D82FB958 MAGGIE JUDY
804,164,329 *536524EF920AB0D0BAC4EF6AD86366DD428AC6CA USERST47USERBOXES
804,164,330 *5367BAFC8FF59B2D6D4E2C1C47F15AA71E1DB0FB MAJOR.HAMPEL
804,164,331 *5366560DEE21A03E86FDC72C61C2BF7EFA9F66B1 MAK
804,164,332 *536DF77D3B89489A46B1DC6A575F6D3914714EAE UTSKRIVINGA4
804,164,333 *536BAA159CBAC1CBC170279DC9FE13338C749E15 [email protected]<
804,164,334 *5361518DE4D9B9904AEA0B08F415409AFCBEB4BE MANDY_ALFANO
804,164,335 *5369938F4B2E5F10F8F0A6B7ED6803C8295FECD0 MANRIZOR
804,164,336 *5362EA3979A5A2154ED865746C922C2DC195FB88 valentinemoviewarnerbroscom
804,164,337 *536DD5A198F3ABD2B703474DC26AF1A0F4787757 vanessatorre
804,164,338 *536505A5EC04547C7B84014DEFDFC6F945340F65 marie-keenan
804,164,339 *536C3D407C061206CB399FAEE47439F5940786FE [email protected]
804,164,340 *5365203ECD0CD68D8D09A0D5D145028B508C7EAF MARQUIS.EBEID
804,164,341 *5367CA5D18E278DBCF9EE5B4A70163C754412F4B [email protected]
804,164,342 *53687DC6FAE710D8489F155C19C6D1C81D1E51B9 VEDANGVAIDYA
804,164,343 *536F0F6A6F5E48A77574B813174E626BACC512B6 ver-crack
804,164,344 *53672E0788D9D64549062FC3FFE86A44F82A1321 MATTY-MOODY
804,164,345 *5366BBE0799169C12DD230718C4DDE8A848CCF4D mauricefelicia
804,164,346 *536CAD9E5160777B355653D0EFE933D5409113C7 VHERGIE MACAPAS
804,164,347 *53653EC171AA894B4A53DA4793F82AB47DDADFC2 vickie-parker-person
804,164,348 *53664219A44CAAAE20646E82D65BB131351C554E VICTORMORE
804,164,349 *5364F186E7EE434A408B9766DA0E33AB9866AF68 vihkiisist
804,164,350 *536D5B75E57599D14B85FD71CE51DE2C6C838654 vincentvictory
804,164,351 *536E47D6CF507B86DD659993492A90C53494653B VISNUITICA
804,164,352 *5365122CFB144C04A94AA4443A30A901546DA81E VJEVKUXHFC4
804,164,353 *536A765A2A539879BC094B2AA3E37D68DB8DFBFE michellaumea
804,164,354 *53697AB74FFEDD63289978A1025817E9B04D3BC9 VNCHTGR5
804,164,355 *536A4DD283E45CAE0DE00117A1400C5F3549622F MIENTE”
804,164,356 *5360B30B19E94F2ED38B756ECF7EDB6F94727790 mikaela-mia
804,164,357 *536AE59C07BBA18A55F28C1C58D16D8895F2CFB1 VORSCHSSEN
804,164,358 *53683749D0EEB1748876E073E63FEFE7F62D81D4 mohankrish
804,164,359 *5363A84F437CCEAEBA038B2B25C152931962A254 warrenpaulgunnels
804,164,360 *5362547A6DBE0853AC3570D1C97D839C8E07A5E8 MOORTHAMER
804,164,361 *53655DB1367587B517CFB25D96FCB31F159C5355 MOTISES0
804,164,362 *5363D23CC2095AAAA3AB0D69C9D9653839C5D779 [email protected]
804,164,363 *53688CDA8A34CF539124CADA596C62469A7EACDB MOVIMIENTO-DE-ACCION-REVOLUCIONARIA
804,164,364 *536B7C1CD8586B51E504E31C88D137D898BAC12E wef deldduh eht sthgil ERALG ehT
804,164,365 *536FE8F45E4259A5A6E8E5AF3B451332F42168DE [email protected]
804,164,366 *5366204D2CDDB5D9DB5F5F67B836B96268C49DAF [email protected]
804,164,367 *536DB44686CA69C585EEA48BCC22B59978977958 [email protected]
804,164,368 *536BB25EB0D581744EB8DBAD0328D1E19FEF0443 [email protected]
804,164,369 *536405447B154B270BF26B5F25BFB1F63E53E9B9 WERNER.GRANDMONT
804,164,370 *5360FEEC26EE571F29AFAD0B071E4EDCC0EE7A78 MUTTACK
804,164,371 *53672D203C546636D3784284C720999BF2B34156 WESLEYTURNLEY
804,164,372 *53622CCA08ECAB895BB1C296A281C70F436F8A24 MYAH295
804,164,373 *5367AE57C578C86856477881C0883A573C0743B5 what-happened-to-silent-hill?
804,164,374 *53689F20EFB3026BA8B1591BFD48B8D8B9AFC622 [email protected]@n5
804,164,375 *5369E929BA6810EFAD8AE440AC10217EEA3677D7 NACHYSTATNÝMI
804,164,376 *536CBEF2AF607280F734CA2C6378FA3198A532C6 WILEY.FIRESTINE
804,164,377 *536818B9102A809604D2BC5ED1A61D66C9B867FD n-alfred-p-sloan
804,164,378 *53682CD4D17A339FD8CC8D64CA8C717E9500B617 WILLIAM.STROMME
804,164,379 *5367C3367A670D3CBC7C0FB6C796AE7371B5C191 WILLIS.PAGETT
804,164,380 *536D7F641C4D84DF923567C7C9F42FDBA4825B8C WILTONLOMUSCIO
804,164,381 *5361717059FD0FAD37090535F9CB8174478E080D Winepalm
804,164,382 *5369E844D51EEC83A56A5098CE4B52DA48284D8A WINFREDWONGUS
804,164,383 *536C7E9CB43224FBFD97D66392A55E7CE37E352C WIZ7
804,164,384 *5366787DA6149FD72AD0ACBE740FFF99B0B3AEAC neonax
804,164,385 *536D177FA3B8BFF76BB56A951F175D888075C37F netzteil
804,164,386 *536FA10D0D1A80B38323E871123A7B2B91725EEE WTNC160
804,164,387 *5364467C9286FD7A22CB75DE7BCDB801B2B4F73D NGHALLA
804,164,388 *536283890B2EC9622686BE2A89B91FAFFE42C124 NICOLASTREWHITT
804,164,389 *53652952DB547D1463008DB5611BC69C17C72E24 NICOLE-MAYOR
804,164,390 *53689150B45EB641A64C71805913C1357A522093 NIEG.(FEAT..JEREMI.PRZYBORA)
804,164,391 *536D59CDFE959842AD1E1246F0C105237DAB4181 nitoned
804,164,392 *536673A2F0FE8F5CEA13FEA630A958734E2A89F6 NMTHARNBAUN
804,164,393 *536C5B8615239D276B5D42BF704D5D77DF9AEE86 xamrennug
804,164,394 *536D7FAB4C2606716F34BE73B6B97438D0310F68 XC4W
804,164,395 *53683C0F7C076C58BFA67D178CE0936EA25CDC9A NONTYPHOIDAL5
804,164,396 *5362030C3B601178659E7D49C2FD5752FC7E783E NORMANTOOF
804,164,397 *53600310C748B838804E08591F5ADFB2AF079BF1 no-soy-un-superm
804,164,398 *53600624C71EEC2D78454D14A4D1458A4119DB66 XW,A
804,164,399 *53651BD3DC2480C14540C3B78B3F60A15D7DB7A5 (y30)1985年6月~87年12月
804,164,400 *5368D5382A9BC465FCE868697B08F656203931F3 nv3rn35535
804,164,401 *53650ECE6D1646D8531578ECDE293816C35C19C6 NWOHBSW7
804,164,402 *536117E441CFFADDF9C77D6992C3EE03375C5743 }o{* *(3
804,164,403 *5362F666891C926D079A647FC04EA14BA56D17C3 OC+[
804,164,404 *536A6C1DB19AB4F83A136AA7A2457882BCC17FF3 odismicalizzi
804,164,405 *536FA058C40993769D360DDDC259B4B1C57A1312 odvra
804,164,406 *5363879AC7E8D05940B057BB6D00705B009FCB01 [email protected]
804,164,407 *53641B908B482ADD4255DF8FD27000FD73F94ADE YLLAEROMED
804,164,408 *5368DD8E00641CBFD0E40046E458A67CA38A39AE ōki
804,164,409 *536FBD99C85E0D5644C942483F90CF4DDD965553 onecaras.1
804,164,410 *536D1DB4415ACC5A610508874753BB376AC30C31 +OOLLE55
804,164,411 *5365DDAA6B1B2B08ADED6567A8C99D182B4580B9 YUSNI MOHAMAD
804,164,412 *5368BBD96B95B15B57A052880572BAE50252CC26 YVCGFECL29
804,164,413 *536BA109FB5D29A6DE038F91F1FAB66BEC126B1C < z7a
804,164,414 *5368A27E1A6A5CF1A908C2BE4F485805D8EB6406 zac.gschwend
804,164,415 *5368E256FB7B397A16DDE4F5AF74B37D4767795C ORVILLE.BECKERLE
804,164,416 *5363BB0B62DCE2FFCC5E093E5023052BA448764C ZACH-EHRHARD
804,164,417 *536374E1EF380B8AA4FFE0288E672C543D634DDC zacherysuglia
804,164,418 *536B51A7F6E26763FA4870058EB352881E68CCDF zadine
804,164,419 *5362C11C7BB1864815325F5079A4AB4E0CE10583 ZAIZAIZHOU
804,164,420 *536B3A86983591B2966E410C0BA7A3CF087F6C41 PADDYONTHETURNPIKE(FEAT.CHARLEYHIGGINS&CHARLEYPOE)
804,164,421 *536632E72C4FAA93E25337FB4CA0BD032BAA7F57 [email protected]
804,164,422 *53611239CF759B53078486A13011E41290917C99 [email protected]
804,164,423 *53651D2C02656FBE6B5F2B79F9D945222E9CCDBF PARAPAPÁ
804,164,424 *536F9B81C2D8842DD4AD8FD8B73A1958CEBB6C97 [email protected]
804,164,425 *536E4560908081BC14163D7B02A0F03D847BD209 [email protected]
804,164,426 *53669A4A32BC4F6CAC230C43BD9CB134FE58825C pasqualefinnemore
804,164,427 *536B3BCBB830586C38EEB3B245B52E4589C69817 ZITU.AT.CTG
804,164,428 *536245E8872994E602C95E6F9D1733B967850CF2 [email protected]
804,164,429 *536B7FAA665D84227B2DA73932BC46457C6858A2 [email protected]
804,164,430 *5366CC1231125FDE22E5E00B2AFDF7C2C1DE3A96 ZUBVALENTINVALENTIN
804,164,431 *536266E446EA32318445B6FC538EB64F9EED8805 ZUGRUNDELIEGENDEM4
804,164,432 *536744FA73A0800BCEFF0594B06B5DB049C540F2 p###d* *(0_<)
804,164,433 *536A5310A2E819F3A29D4F6F0385EEA9881806C7 [email protected]
804,164,434 *5367D35C7F64FE4370D5C346AE3DD20B278F6C57 PELOVITZ0
804,164,435 *536DCB94345CD00ACA54A8381B144E28686F8E50 ΚΟΡΒΊΝΟΥΛ
804,164,436 *536EE89EF2C82C7B99076D4BADC36EE076FC2E49 PHILLIP.RIDDLEBARGER
804,164,437 *536BD5D780F75758905B41F129B650D547597093 [email protected]@[email protected]!c
804,164,438 *536E878DB1A9773C7A025BAB6C0FC1A184D8F851 pi3ba1d
804,164,439 *536210317CCE07D2909D8ADDC2F74CE4F1D30CCA квинесен
804,164,440 *536A109D8F5AA6F55636A2EAB8B866B4E94DC827 podstupima
804,164,441 *53661197559490E894359EAA03C643A6AC1B2C46 ПІСНЕТВОРЦІ
804,164,442 *53624DA00EB83EC11C505DDA8F5F9369298B5058 poison13s
804,164,443 *536F33FD59698D156364B8A5F300825B820EB580 PORTER.LEVRA
804,164,444 *536244F6BD33FC6A94E6301C81DF282B31D7207F また、一般的にはIP電話との認知は無いまたは薄いが、中継網にVOIPを活用している
804,164,445 *536C417CA70827F132F0226E67D9D4A7F2AE8B86 PPRPHRLS
804,164,446 *5369FD82994B5FB2410B50EACD05D1E528AE372C puteanding
804,164,447 *5368A12DF1C943CC4B4E7414A022ABACB1F0A880 P$YCHO71C411Y
804,164,448 *536E476815F2E6C10213F9BB1473D09ADF30C41D [email protected]~o.;)
804,164,449 *536C1DD3E28FCDB3591CABBFEFD8C34883CF2A1A q------P~0splat
804,164,450 *53647FD8CCA42B24E9AF8D9FC507B1D17F18DEE4 RALPH.HANIS
804,164,451 *5363EF3C659BB87A9CE8BCB58631A9735B3651DA RAMONDEMARIO
804,164,452 *5364B489EA2A911F7AB4C0CD5CFC53CB0355C4B0 RANA.IRAM
804,164,453 *536EAFBE293331495BF5C3F87921C9D6D1F6F07E RANDELLDURETTE
804,164,454 *5369FC5D3E4D609DEF17042CB484CED0EBB3779F RAYMONDKEEZER
804,164,455 *536BA4EF6CDD64FE121981FF1237A270790054B1 RAYMONDWOMBLE
804,164,456 *5365466362BA7A2303284DE64E407E9454AA6233 r>C
804,164,457 *53663A6F9964370A528A3200FB173ABFDF7D7D89 REKLIK.1
804,164,458 *53665E1C394317AE00B7226659D3B531B838AD23 RENTABILITEIT!
804,164,459 *5365874C26DB69E36570E0F68891C2A4A182FB00 rezitativ:-in-vollem-glanze-steiget-jetzt
804,164,460 *536537573FE9CE987D524807557FF42F0EAA2F06 ROBERTBINGAMAN
804,164,461 *53657774BA30633F6366F7570A500C422E489E75 ROB.HURRELL
804,164,462 *53674FBA20DB8166EAC4E006DAA36FCDBF40A210 RODERICK.REINHOLD
804,164,463 *536C119A83DC0F326BFB1A023A5BB48311BA0003 rogeliocrooker
804,164,464 *53680B1CA25C2AA21B20A6D6D521283C50CA7CA1 ROLANDO.DEED
804,164,465 *536D171A0FCFFBF8E480AE58082C92BED325C73B ROLANDO.HERRLICH
804,164,466 *536D64C1743E5189D8A1529A3DEF2118573C2AA1 RORYABBS
804,164,467 *5366F91CF6A59AB095C134FDCAC3A4B1884D3B6F )0(O~ <P
804,164,468 *536D3B12CEFFA0264D86920FD3F0DB50E32A975A royconway
804,164,469 *536B96EBDA891CF871A0D90739EAF07A22205712 1359301 KOFEIININ-NAUTTIMISEN-J
804,164,470 *5369DFA6D82B9B95AC3126216B74F0D18E9A04CD 13PB
804,164,471 *53603519F5653AD999C61D950F5C5A2B9FBECF3F 143REMI
804,164,472 *5362033505109AD93794C016564A1DB3DE4FCB38 ruinlike.
804,164,473 *536FE632D428081600037637C8DBF5BFE3C58FF3 1574669 sensijaanj
804,164,474 *53693A05EEEE16E4DA821EA0A483F6DA3D5E83EC rustic.dance
804,164,475 *5368FAA773A9F4738488E9F45D6B258F3F61E61B 1840516 DIE-WAHRE-MUSIK-IST-LAENGST-NUR-EINE-WARE-.
804,164,476 *5369E1A8293D66366E5DE9A8462EC24C149F3698 SAI KRUPAN
804,164,477 *536B1A4EB8CECC5A041BB6D7FFFDBE7A0AE5A648 SALVADORSUGARMAN
804,164,478 *5360DE8025028F9F32B1CBF661AB6D83D0148543 SALVATOREWEIPERT
804,164,479 *536F650B8E12FE6284363DE63608AB41C818B877 SAMMY-ARORA
804,164,480 *5367AE9F71EAD0BA08E87A74787B650AF4778EA3 SAMMY.GRIGG
804,164,481 *5369D5B212DA49012E171855234B095CE3227E5B 1AFGANISTANI'NDA
804,164,482 *5367ED91E7EB33FE2CC5022A06EECE313E658BEE SANDYANIMALS9
804,164,483 *536430DCD03EF60FC84B49E16903CCC7631F947D sanjeev-rai
804,164,484 *536ED52E57A64662DD59C387CF55F87C3571070C 1APENKOOI
804,164,485 *536BC8ADD12EE36979A5B31404791BEAD9965B3C sasgroup
804,164,486 *536CC7039A724E61FC7B5032546FD90D8BE8176F [email protected]
804,164,487 *5369B8E90B3FF9BA324C3DD9C981B96C1E7C7947 sbalzavate8
804,164,488 *5362DCA6EB4D1AEC90FC8927B44967895BB1153B SCHWATZERN
804,164,489 *536692EE36F683056B7A5C7958BC4F1961808AF0 1GIBRALTAR'DA
804,164,490 *53624B813A834DCE6B023B072C218871CA445306 1HSIBBURF
804,164,491 *536F8D63D97E87CC0693067715181A4B9C1B9D0C 1INSENTID
804,164,492 *5363FDB0AE530F5701BBA370AE23979242AE1EB3 1-kalinlasmanin
804,164,493 *536E5F35C778549E21626401083F33209746DB5A 1karls-dekretes
804,164,494 *536C95467C47F10D3BC7A49D4CCA62CB5F17023D [email protected]
804,164,495 *5364870CBCE85C63ED03A30AD1F62BDEA900B906 SDOLENT
804,164,496 *53659031487EA93B3EB021E975FC94BD3388DCA0 1ODSEKLA
804,164,497 *5369B9FBE126E2E16BE6755D6E6106947987ED12 1OUKKULANLAHDELLA
804,164,498 *5367E251D235B4A6D71E1B72B65D453290868C92 1OUTSPENDS
804,164,499 *5363CC23FFC6342F62E3704A93C6FA1F5702AD5B 1.precision-moulded
804,164,500 *5366B92871CA46AC04E869F82D90D1D9C6183908 1-SISU-KANTU
804,164,501 *536580D39C6AC846CC64B93C8AE98C145DD7FD26 SEMIIMPOSSIBLE
804,164,502 *5361CAC49CCC55DE0EFD9EC8D8A32D4641B5D2A0 SENSA+!N9
804,164,503 *5364700C664A22A1F5933C558E735FCFA5BDDA25 1-veschlechtern
804,164,504 *536D15D888714D868F8F8A82B0B7768705404DBD SETDIST1234
804,164,505 *536B985E226EB95946654873A6B087D66FEEEBDB SETHHEGMANN
804,164,506 *536F50F19D387D21DFB086ABA9A1851DED9B21C4 ŠEVCOVSKEJ
804,164,507 *53617CF371CCD25441B6F0C2CD1BDC1AE3886F55 202grass-roots
804,164,508 *536D4593051AFF4AE2FADD29DD1D21A6A30E8F72 22MINI
804,164,509 *536EF971C37E545082D8B3D6C8A82F9431D2C34F SHARKYNESS
804,164,510 *536A6E043C43175FCE5F9A202FFAB6D43CCEB452 272711 the-public-hearings-continue-on-monday-.
804,164,511 *5360D80B7526A751796BDCB8165DD98F3F626C77 SHAYNEKEMMIS
804,164,512 *5367681B2F15B841B40DBA8D9766E6E91C1527BD 2826142 TERVEET TOIMIVAT YRITYKSET LUOVAT EDELLYTYKSI
804,164,513 *536727211FAE67D97B6137B7890700ACAF7812EA shelbyiredale
804,164,514 *536E96F35C704AA96112E95A91EDE5E5E720B076 SHELLEY BOOKER
804,164,515 *53664642BA37243FB4E7AF087B6433031047DDE6 SHERMANBUD
804,164,516 *5362D85F02D3D5A8F8251B4479672577C74CC6C7 SHERMANYANCEY
804,164,517 *536088F598B8FDB05864C25C76E66853FBF17899 2.aineenvaihduntasairaudet
804,164,518 *5363E79842721870EA564F434084AE8B274E09E8 shuteye7
804,164,519 *5367DEFEB2049221778D2AB165A6C6A1B39AD021 siyahıların
804,164,520 *53637DAD66662473AAC86AB4D5B2E9B3A926BB90 [email protected]
804,164,521 *536A427AEE23FF2A8DBFF44C1EEE10E59EB12675 2 SYLJENT
804,164,522 *536590E6446A8C5AD05BB9F4CC9CCCC1A9FD8B2F SLIENCMED
804,164,523 *5365DC7098D4AC7391956C64F4519704B0E766FE SNELDICH5
804,164,524 *536198A92CD0450EA7245008E30BF6F67535EAC4 .3=BAA
804,164,525 *536953852FDECB372F6875F7837295BDAE523B7B 3B<.~`.~`.(==B
804,164,526 *53681592ACA3F5FBB1AE2AD0736334D273839EAB SOCKAMAGEE
804,164,527 *5367FA0977C3F78704ED60ED8E460BDB28EE0C5F solowithobbligatoaccompaniment:inventionno.3
804,164,528 *536BFF803DBBE3B2AEE664B977452069C0B790AC 3-kernunterricht
804,164,529 *536DF0CD2BCFFE6BECA653E0C6C5B20F76AC4322 3MAFTECH
804,164,530 *536828EB0F2BFAC63DA71A32B6D2E5B28FCE8E41 3------p-~-~-~splat!
804,164,531 *5369E020BA90924B3F27911D761D81521DC589DA SONG.OF.THE.MANIACS
804,164,532 *5367682529AD3870A64B0BF569402C45B1BCD3A6 [email protected]
804,164,533 *53691BF07E27052FB722FA382ED37F758274C8D1 3-SPITZENLAGE
804,164,534 *536384F30ACDE988F254A59BCFA6A4A46CA4223A 3=====)*.*.*SPLOIT
804,164,535 *5360F242B611C140AB02B564922D1DDC5E08BB94 [email protected]
804,164,536 *536BF9317C7A1CDFF419992061139E7C5BD5CB61 3THECOIN
804,164,537 *5362FCD94E790EB562783816DAD8F9141A0EF352 SORGUESSA
804,164,538 *53688603EEDC595210BDA8B1921E3AADE54C61A9 3.VURMUSLARDIR
804,164,539 *5361E0F0EBC510F825C5F06A6A006E8902BB557F 414taliyah
804,164,540 *536BB01ACC333FB813922160D9921BA2BA3BC708 SPANISHBARRELED8
804,164,541 *536D15C0C7E37706C35B67BA556870966E7DD17A 43christuskirchengemeinde
804,164,542 *53635F5487EB442E4747D8012198DB5E93DEDB44 44474 zu-hause-werde-sie-viel-zu-erzaehlen-haben-
804,164,543 *536F1459355E3B0A699D8072B4998945103F8B0E 4: 4 -# -& ALLEN
804,164,544 *5366F055814AB89BB6DCAE619B85741D544C1856 [email protected]
804,164,545 *5361E94FBEC5ED4DF8C339A01D642CADB2F06B22 4-BOMBENFALLE
804,164,546 *5369EEC1341FB54B85B6726E537BCAF8B9A8AD72 4IKALIAW
804,164,547 *5362DD2200D092B833BBD2475811AA615FB964DE 4IVAIVVA
804,164,548 *5364CE96BC2B60FB8C3B6EFDF311FE6EC8A80F8A 4KRHTMISE
804,164,549 *536A1BF23752B31FA0BB366F9D6636160CC8EBEF 4may1442
804,164,550 *53695D6B1AB52F9A26D8D6791728FAE4DFDE4AA3 spostandos
804,164,551 *53663BCDAA964476E9F9F5E434AC14006156A8CF SREDILOP
804,164,552 *53608028A43F2E74BE28DA6AE71BB6189952FFBA 4VERHAPSTUKTEN
804,164,553 *5361EE253F8900062D5BFB5F39AD6B97631D2D6B 527741 " we all have one blessing to count
804,164,554 *536727F358BA7FA37791B4471EA44DF23E489F83 SSIGNENT
804,164,555 *5366E642EA8871047EC64878018FF0D4F858B425 STANLEROUGE
804,164,556 *536444FB54278C758AE8585154AA72ADC784F611 [email protected]
804,164,557 *53656483104A853576C8BE79E82BA3296FC614E0 5ARETTID
804,164,558 *5365DA26CF0FF33FC4B7FB032D9F45E74BC4BEE2 5BACHSAPPHIRE
804,164,559 *536299EFBC2516B0CD65AFE4EC3812AC4EF60C22 5BSWLESATZBSW
804,164,560 *536DBFA398A42F3F35E13E45D69167C015333850 STEPHANIE-TURNER-JOHNSON
804,164,561 *5368805C1F59E7012A21C107F4EB9CBB4F8A3344 STEPHENCHICK
804,164,562 *53658C8232A2BC373D4E8F6DA3BF17F56E94397B STIAHLAUER
804,164,563 *53620FB05B6EEA2ED6DADF32B0AA686EDB7FE859 5FERRARICHICKEN
804,164,564 *5363A3934A7108A7DC9991E6B692DD10B2382D4F STOCKINGSCHOLATESCAN
804,164,565 *536779849812DD8E874212310CF1B053A6A0D4BF stopforth
804,164,566 *5363242E0B7525045C82247BE162B9F2C05F6BD9 5IAMAKI1233
804,164,567 *53651A1590435441670441501B429B5D7BB09920 5KAKSINKERTAISIMMISSA
804,164,568 *536EA7EC680E50961DC1191D889F462131617EEA STRLEN(LISTUN[X].STRS));
804,164,569 *5363F9F31162619EF4DE5DC76E0D67AF6D1730AE 5KNURHANE
804,164,570 *536E102CA2BE77098A9CF7D8C70791C364B90C8D 5KRANGLIG
804,164,571 *53648390BCB49DCB107AAB997CEAB52EF29667A1 STU.CARR
804,164,572 *536B655C340A8FCEA5C8C6F23F3B230ADA34A7D9 5MOTOARATRICE
804,164,573 *53675CD06EB6074BF1A036A7F2B1E3D43A778499 STUDLYPYRAMID7
804,164,574 *5365F1665C371DFD2AC856808112A3AF4615D0D5 stupidoldman,there'snothinghere
804,164,575 *536D9730973200B3D0EB36E4A4B5A302F35F6D3D 5NORMSURJEKTIV
804,164,576 *536446F3776D7C7D8EB001F006042871D7E65D61 5POMFRETCAKE
804,164,577 *536C0E68D3C5D272E7EFDE065F7E5F1044C41E65 5PUPPIESSOLEIL
804,164,578 *536EA73CECB501BFFA47473D207459BED0F11336 SUKSESJONENES9
804,164,579 *5363583E1AE75971F0060069FB79333567534445 SUMMERFES10
804,164,580 *536B716F99236F622A9EB746A36F356296A55975 sungchung
804,164,581 *536E09B46AE8A450DB51EB80C91FD45EB88B7096 SURAJ-MITAL
804,164,582 *536D60CEFC2D125499587E45A2C758F28064F9E2 5TREDEOP
804,164,583 *5362AD30674291010BE93E4236D30EFF7956B9AE SUSAN-HEWER
804,164,584 *536EE71102FDEBBB26C1A201B524ABC037B7F125 6.12.1419
804,164,585 *5369E1A44A46645A11AEE7C5AE09EC7DFB7CE765 SYDNEYLAITE
804,164,586 *5366FB69BC1E88FA9B55AD4800A111F832160CA0 6BSWNAPERVILLE
804,164,587 *536537ADACB6F3FEBB7B50FDA7975671FBDD84C0 SYMPLICITE0
804,164,588 *53635C73CB0F25C8F8A5D5607CAEE50710CD63EB 6CINDICHESTER
804,164,589 *536F39245DADD06293C2CAE5B055D1D26891B997 T34CH1NGD1N4M0
804,164,590 *536DE1FF43B6A448C7A13D1C5AFD467DA9FD3E80 t46006806
804,164,591 *5362CA93E11B8B6EB45D2B19929264B8CCCFF5E3 TAASSUP
804,164,592 *5365560CE9CB1F5C0372CEB3D261E2788E226B5E TADELICKER
804,164,593 *5368CA12C352D0349442CD23162F2FA226906739 TAKE A BREATHER (INSTRUMENTAL)
804,164,594 *5362772285A5227C6BBE217D2B3927EA48B9BD6A TALKESPERANZAMEMBERS
804,164,595 *5367702D9AF7D06E21D69FDDEC4DBE74EBA6E851 TALKFLORIDA_SUPREME_
804,164,596 *536F884C7C2B2BE3D62C9BDD31458B12EDEBB06C 6LIGHTNIGHT
804,164,597 *5364C6653557512456653C9553ECBFFFA6973D49 TALKWRESTLINGARCHIVE
804,164,598 *536A058BD65FD4EF125F3C0F1DC2738876F95F67 6-nationalkomitee
804,164,599 *536C1B2542B2ED1DDA56E34BEFBF95D4C71DA377 TAMQRAH
804,164,600 *536C606A19C98F00DB22A4FA4F2582D6DED0EC15 TAPHU1SJE
804,164,601 *5363A8084DA62AF824F13B33E909CC21FD463BF5 teiscodelrey
804,164,602 *536F4EFCBB4C5FB25D83C305785190F1E28C1711 TENERONI4
804,164,603 *5362010111E61156C655D5E1A0ABD543FDEC4B0D that's how life goes (feat brutal)
804,164,604 *536519000F36C40D328CA8AE9D8B67F687E0CED2 the.best.of.classics.v.2
804,164,605 *53614CB5C39E7BCF4807170995D41E6228963B09 the-blues-are-out-of-town
804,164,606 *536CB06AAB88A71E39DA8799C00F4040B7473EB8 THEBOSSSYDNEY8
804,164,607 *536CF5B2E1526399E84A3ADA1D8EE7A6AD0C30F2 73lqs4
804,164,608 *536A5C0E8DB320B8DBBD656AA79FC15476C89ABF THE-PURPOSE-OF-THE-SERVICE---A--FAIR--EVALUATION--INDICATES
804,164,609 *53659768640F7EAA46D3AEBA73F41D304950E2F0 7ARIANESKIDOO
804,164,610 *536D9FBE246930EAC525091C38BAAB0DE3D4E774 THE-SEVENTH-VICTIM:-JACQUELINE-IS-FOUND
804,164,611 *53642C2FB8B7BFD1EC553A662D592D5AD42FB18B The.Tower.of.Tragedy!.(Quiz.Show)
804,164,612 *536E70D2028F906C83ACB439C5A344E4A2CD5126 THIS SOME OLD BULLSHIT.
804,164,613 *5364560E962589F299A54B8A73D286A8BA56A2FD thronises8
804,164,614 *536160006D256BC3F0E06AB9B08A67C7052C24A3 Till.time.and.I.think.meet.
804,164,615 *536159A0ACAF220DDEBF6EAA02DE045F74236FD7 TIME IS ON MY SIDE
804,164,616 *536148EB5711660F69A9388A1C16B19E078F6483 TIRED OF BEING JOHNNY B GOOD
804,164,617 *536BDC506B58A842337779972C1FDDC2DA763E58 7IKSHAVAH
804,164,618 *536AE068C0019B945D1362C11EC1219A97EA568E 7INTENDEMUS
804,164,619 *536C81E737D4F6A3F555921AF2EF7ABE3F8FFAD5 7KRYGSLEUSE
804,164,620 *536482937B9BF5FE65DD3A7C5F86028C7E6055AE 7MICROSEISMOLOGY
804,164,621 *536A1107CDDCFAA46A2B5727C8C703ABEBB59BB3 7.personalkirchengemeinde
804,164,622 *53631649339B50EA042383E44E5C8E2AF87D0AD2 7PORUSZANIU
804,164,623 *536C8B40A09AE0624F7B2C10B10FD070BCBFACC6 7ROBBIEKITTY
804,164,624 *536071FF31AC818A2EF6C4BBE6FEC2BAC51844D8 TRÄNMERISCHE
804,164,625 *53638A6526431E037525C785306D074B9548F119 TRAUENDEMED
804,164,626 *536607082E19D3C3805B9010E935D9FB33747F13 TRAVIS.PACHEW
804,164,627 *53647B8A69FB5EDB4B80FFE33DD1E7A13667BEF6 tremell-baker
804,164,628 *5367295D79329F5683A2D78815CC9EA814EA8EE3 +7USKWISE
804,164,629 *5364D6AF4B2382E11F39AE36D1F7E2FE33347800 trenthornbacher
804,164,630 *536643DF13F7378288733E454978EE9109703414 trentonllanas
804,164,631 *5361BBEDD47CD29B65685CDACABF8C3E63C9AB6C trevor.james.russell
804,164,632 *53608633A0963C24C72E349C0DBAB119F8F96888 TREY.RUBIDOUX
804,164,633 *536239DDDBBF8257A6D3E7F585D2996DD31C3488 triosonatenr5c-dur,bwv529:iilargo
804,164,634 *53690240C2AC71CC9A0C58BECFEB72FA3439392D TTZ116
804,164,635 *536B6588C2D94631F013CC6712175C16993935CE 8AHDASKATSEISUUDESSA
804,164,636 *536D1287EE8A8136A89BAC1B29373D9087CEF0EB }8{.*.<=====b
804,164,637 *536A33CDF20D9CF63F848CE1271A434FDA6289B0 8BSWVPMITBSW
804,164,638 *536D5CFBF7CC23AD9F10918E3C21EAA297FE2E18 8COFFEEHAMSTER
804,164,639 *536564D8C7BA3AA99ACB735EA806CECDDB8C91C7 TWANDA.GLOBE
804,164,640 *53666FB3F70937E1D8EF9E70A2E87007E73DC263 tyreelayell
804,164,641 *536047239BC93FD8662F6948D835E18A46EB6ECA 8GLEBE
804,164,642 *536B982817F8D0C58E07F35DC5B436973B52A0D6 uc;|
804,164,643 *536C991FC6234C28D6CBE8E2181C0A5169D29A1E umfaller
804,164,644 *536DE8D26936B74A377C6CBACC34758EFAD01D2A 8SEISERS
804,164,645 *5363682ACCCE62F25106EB2A4EEB847C43F2935A unimmured7
804,164,646 *536F0B32B34A32903A63D08CE9950902DACECF44 8UGLYCUSTOMERMUSCLE
804,164,647 *5360939ABFEEF66B79CB7754C6AC416BF74D128B 91A12F8767087954B53967FAD7D0074A2002A
804,164,648 *536F20E49AE0CD58D0BE0BA1108F18F01B25B74B /usr/share/locale-langpack/en_GB/LC_MESSAGES/ibus-tablemo
804,164,649 *5369970ABF79C635AB953949DAC894ABCFE18A19 USTENIERING
804,164,650 *5361D67CDE35E3E73058FCEAA7DCB20D6620027C USUARIOS.POR.IDIOMA..CROATA.AVANZADO
804,164,651 *536F11B485FA526ADE2D5B4C5F61235929869EDF 9ANTWORTSCHABLONEN
804,164,652 *536D31BD3461705B0ECF628FA35B6427CDDC515C utahravescomwww
804,164,653 *536AF699B5D434E535CAA1ADDF1402E5963E9C05 UTSPRICKANDET
804,164,654 *536373E25813DFD97CBDDB991FA48B0CEE8EDF36 9BSWSTAYETHBSW
804,164,655 *53666CA7DF5C0B9C63258D8347557306833CE25E UW]H
804,164,656 *536B2721387C0450E4DB74BC6BDA14E1F5840447 9CHRISTS
804,164,657 *53674D185B6DFCB496BA00E0004328FD28626012 V4LKYRE5
804,164,658 *53613C326DB50F5330A8C29404192C519ED0349A V7A[
804,164,659 *53697B3B4E2BF46463AAE833FE7DCD1904014A93 VÄKIVALLASTA”
804,164,660 *5368908DF0D5F10E2DFFCCEDD1EE1A54D0D16380 VALERIE.MIKKELSEN.STOKES
804,164,661 *536C72C0ECE48DE692CB68A77EAFCB26671AB5BC VANAND.KUMAR
804,164,662 *536A34D0492B0CCE8B3AB21E0CFC022A7191E2FA VANESSA LUTZKE
804,164,663 *536427DF84573D04A69174AD363C7431469304AB VARADMSYSLOG0
804,164,664 *536288894763D51EC62BC9CDED51F275C1E56C8C 9PETEYSKEETER
804,164,665 *536E2E1F264789DB45094D02104BB70E521F2779 Verbening
804,164,666 *53672F1ADB77B844328930B5466166097A7E7142 9tailleuse
804,164,667 *536350A2338A53B8D8FBA60922B901040BBB2005 A1Uw
804,164,668 *536CD95F08ADCF9159CFE3CB4E281E57C3A5C848 vickilucass
804,164,669 *536E9DDB5E2F7C41581BF39F40A54220240857DA A5HTV
804,164,670 *536754DE4FDE2C8E8FFB3F7D7DC2F0C0C3E5D4BA a9mye
804,164,671 *5365571A3AAABD866CCFC325A07A10E489034D62 [email protected]&&
804,164,672 *536EBF3004A1A531139C017E4485D277D80A7501 aab|t
804,164,673 *536BA36F5F50469A1E9D986D054A866FF509790F ÄÄRELLISEKSI
804,164,674 *5365B23D5D07BAF9591541D7E78F41EF67E84856 AARTIRUPANI
804,164,675 *536872AB4EE4ECC630F5B52502821D2FDD8BD0EE abhimataam3
804,164,676 *5369F41B0330A6CB1B8C191259A17A88DCAB413F abidebying
804,164,677 *536F6D4A2FDB6E8278F0222A3158BEDC9C6B20B8 ABZUWEICHENDEM6
804,164,678 *536F9EEE662131D61E7CEBA374EAE15D3AB8F0CF WALANGAMA12
804,164,679 *536F9AF45A5B062BEE6275B82C186781934191C3 walkingstick9
804,164,680 *5361D214F66ADEF9BD0D7F657D3993E350CE9E17 [email protected]
804,164,681 *536CC6F59B510CBC1991172476FABA9C34639376 ace)、k
804,164,682 *5362ED9A89571E6D1BCBF7A68DC28EA1BAB1F157 AD8D8285B41A9578443947901CC1DD18 NETANSIAO
804,164,683 *536B62FFDBC29FD37131A376DF95955B72993BB7 WAYNEWIGET
804,164,684 *536E05748B4B467125B3C02C214EAE81C7E5181C WENGPDZ
804,164,685 *536B7681C1A77206FBA789683505A9E44FAF9AA7 [email protected]
804,164,686 *5360EE7F15C439E09C327727CCF36B9A9C0385EC AEL36
804,164,687 *536C775D24498471B7C016CB061E51763AD0C2C4 WILBURN.PAPAN
804,164,688 *536C618D93C9F2380DAFDC8BFEAA780942F14A88 AGUV%
804,164,689 *5367E6EB1F4E70E3EB9425E307B771822C41A118 AILAVAAP7
804,164,690 *536DF45E870A118414AD2780B391C11DD7CD6256 ajzhp
804,164,691 *536D5CCEC97C7627CFC89FCE11DBB5EA9565D56B WOULBSW3
804,164,692 *5365C973CE8C0EE64BA09F82096037095C9554FB AKVT(
804,164,693 *536C1BDAFA0E977DAA460A39ABFF666375319E05 ALB-
804,164,694 *536BB377AC0F6753A0AEDF396EFB4709AA5D8EC5 ALEQM5JADN25
804,164,695 *536BDC4FC55423D7AC4DD392156CFB079A12829E XGL_
804,164,696 *5369AA06F3D667E4AF4AF07F30A583F62DF6C7C6 ALPHONSEDANNI
804,164,697 *5362ECF005122280C50183CC45EDE045544F29AC ALPT12T15
804,164,698 *536CEC899AE00AB3968707A67A1D6A8FFE931508 [email protected]
804,164,699 *53678C569C8D3901836904980ACAA9F61EFF2AD9 XRAYMIND
804,164,700 *536882BCE8A1BDA205D6C75D9F30D434E28FAFEF AMAUTAS0
804,164,701 *5360A606A26CFD7AA6696AD9133859CFFB6E4F1B yassereldridey
804,164,702 *536CE74FB989F7BA6245D174060ED7C08D65DA15 AMULTICORE
804,164,703 *5364A7E1405742A19EAA0052BE0D7E4B215AB691 [email protected]
804,164,704 *53657A817D129B9F0762C15B897F34852C1341A8 an;a=
804,164,705 *536727E0E1E1DD0938005D6CA37609A8BC6D24B5 yohq
804,164,706 *536CE5942726E5A0CD947623ADB2ECA26FEEB273 [email protected]
804,164,707 *536D9D704763C770B0B14BC7F35485BD797D4AE3 [email protected]
804,164,708 *536C26608EBAC8205B463C17303FC7BC6FD4F4D1 YVETTEBOTTINEAU
804,164,709 *536BD24E44D06ACA8BDCF4E2F3ABC10B9E72F5CA ZACHARIAHBALOG
804,164,710 *5369D5419F7E90DBBBC24E7D178D680678B536AB AnYc
804,164,711 *53677595ECE6D8D52E5A47AC0260AA8EA7FA0A94 zackprather
804,164,712 *536A826D315DB8EC452AA944738E7A01E2A00F9A ZENESTA5
804,164,713 *536B712BE8E9E443859192EB04B56D623BC6D131 ZERALCED3
804,164,714 *536242C727B88B5FB81152FD23F5403D3413EC62 ZHENGJANETG
804,164,715 *53660FDE1F13A873FC11190F32EE2FD3ABEDBA05 [email protected]
804,164,716 *536B728DFC0E07D65434A050E18FF56E0F36D334 ZROTAR
804,164,717 *536E83D0BD77D3321E656CE0BDFF9E503C46AE24 arianacaille
804,164,718 *536DFC28050DBF722E6FD6303ACA98951EB7E590 ZWOELFTEL9
804,164,719 *5366C829FB94E00EA95F4011902EAC9BD302DB2D ARPDM
804,164,720 *536131F4429AF468C730847F3352132A60119E33 ΚΑΤΑΦΡΟΝΉΣΗΤΕ
804,164,721 *536F1567BA5580DD736059FA90BA9A4BDC3FBD07 ὝΠΕΡΟΣ
804,164,722 *5360040CA59294E528CF6D82DB25B91F66AAB235 asasperrey
804,164,723 *536238E8D19B9C29504B1AB4BF27C3B621A0B86E ASCETICS
804,164,724 *536E73D17CA98953C3899A66C243C890E30DBEF9 БЕЗКРИТИЧНЕ
804,164,725 *536B9C05D7CE11BA05B7F4FD63D849BE99D02A74 ASHBINS3
804,164,726 *5369AEA3F25402649AA5D214F2F56341DE6E40CD ПАПИЛАЙА
804,164,727 *5368B27FC0095BAAB808828A9E56FD55CAB0DB76 AVOMV
804,164,728 *53639CDC0FEF3E5C3451102E9BBB644D48F40263 AWDRG801
804,164,729 *536B794E472B62EED5DA8E006F7537C7A8E7533F ax3
804,164,730 *536D951211884DBEB1578F9D064526CA0971CD1D AYQXC
804,164,731 *536C6F2223AD8E69DA69386B218DE22E33643B97 b0jit3
804,164,732 *5369AD3AFA8351AFF85E78E9784C4BB44734B009 B7ONW
804,164,733 *5364E68AC51E2C639981928910F439C589582DB3 BALBETTA
804,164,734 *5360381CB676027A7D7279C9DAB82AC3929F8935 BARBARÎTÎ
804,164,735 *53655B5D635891A422AD8EDF7B738D1543C253FB BASIL.POCH
804,164,736 *5364B64E44B4E43A653638FF208F15894879CBA0 bbabl
804,164,737 *536F7F9482BA07B83DA6706207228B56AA7D2B1F Be3T
804,164,738 *5360D4941898F3DF766FA1B82FA64B2970178FB5 BEDSONIASING
804,164,739 *536162BA0F56BA6E221512F163FBC5AF7E81A149 bemine(djstrangeplanetaryorbitradioedit)
804,164,740 *536E14A0E19D9DC64CBC433DE1E9DA3ACDA904C1 BERTRAM.BLOEDEL
804,164,741 *53627C476F3B6085F557CBB5508FE8C242E11E32 BERTRAM.TAMES
804,164,742 *53661EE0B70978517640FA22254D9CB4097DFB88 BETH-HILES
804,164,743 *536BEE6094D26CB6FD45F092EA7BF27636AAF1A7 宮澤ミシェルのJトークライブ
804,164,744 *5367149C916DB97B5F4BBBDFF958C99002996F64 bhcrr
804,164,745 *5362974348641915050F42C3A9FB981359E23B9C BIGII
804,164,746 *5366FD09D8E522459E071B59F10BA4A43C4D771C BJVF6
804,164,747 *5361F89986BC12C52E6A19002F79C3224627AF94 BmOV
804,164,748 *5369CD8AF90BC62C9B6E77800B91B8B23AAE1CCA 0abigail5
804,164,749 *53650D5888A16AC3E7C15F2D01E08A7449E4D3FE (_0) o~ o~ q======q
804,164,750 *5361141D47D6C429BB3EE8A3A47E7633CECEFF2D 1007558 miss
804,164,751 *536503E3E062CBA4E81D654F234D1F476F3C6225 101ELIEZER
804,164,752 *5366AEF83072374361E5EB5674E4C11C73D387D9 BRCN+
804,164,753 *536F80844B92061C3588D64ED127C4491E5DE50E 114BAILEY
804,164,754 *5362B1DFCFACBBCF98C92D3497B1A28585249419 BRICEDEBRECHT
804,164,755 *536B397F32A7D71411101BBD8E908D92B3FFDB52 1207327 UND-UM-MORAL-
804,164,756 *53617F77F86480895E70ADC958152CC6D36509FB broken bed & breakfast
804,164,757 *536180154A7B9C6DF45587E9C50492BEC5044FF2 b?rro
804,164,758 *5360CA84E4FCADD80108F687E4B4906C624FBADC 13-KURSIYERIN
804,164,759 *536BB1C6037D6D38ACF0A2D9D75EC51CF993BDE4 BSK
804,164,760 *536690E4D7114D442414233212809E2554CC867B 14rentryd
804,164,761 *53690184D8827128583F00F053E5261C052BE52C 153YRITT
804,164,762 *536BDBCA6772236895AD9E6C88E911C643BBC4C1 BTF.?
804,164,763 *5368DB90C5388EF841B701DE28D8EA70B78EF2E4 BUFGC
804,164,764 *536F9AE58B62C987486BCE985972B710C945E0F6 bv3xx
804,164,765 *536299F3800B0226706FEEFD48C18F6BA56E1D23 b?-%w
804,164,766 *536304B58F8F0BE2D81965F9F16D4A93FE2DF934 1ALSJUAUSSENSTEHENDE
804,164,767 *5368A4F6E0336C3DA35932A20787FBDA6FD81B22 1.apsu
804,164,768 *5369A5489A8D23807B5B09451EB24FAB1872CA79 BYOBSERVINGOFHIM
804,164,769 *5360889C0B7C3BE0FC9C24CD75536302E09DD7D3 1BILDUNGSGUTSCHEINEN
804,164,770 *53627F5DD7E27C7A92E7E538E354714AC8CEE395 1.CIM-ANSCHLUSSPROGRAMM
804,164,771 *5369114C5EA2D9235004355760AA2658E8135058 C1VQ9
804,164,772 *53629CCC3DD8755CB4B4CBA6BCD257A624B2CD0F 1eldeen
804,164,773 *5360D5206369D7E0D880A296CE2924651101F83E 1estafania
804,164,774 *536A32E8FC7AB6E0770C92E9FBCC5DEE0457E51E C3RC3V4MOS
804,164,775 *536EAF51499B354916373820C52E20E778874B81 1.fish-kettle
804,164,776 *536953439AB000CF00B6C0B65271B6927447D06C 1galopera
804,164,777 *53646762ECD136B750BE4377151415B7DAA529DC C)5CH
804,164,778 *5363DA14625CEDF60890246BED8761FD8C283D99 C7828519FE193CDC84273B29644F1803
804,164,779 *536B86AC617388F4F28E2999F153F8E868B79B7E c8?b
804,164,780 *5369B84DE7A1196B1DCEE3C79F5624C98351CC11 c8qea
804,164,781 *5366DF0FE498BADE076DBB4E73A2A1B6F6F9E652 calfice
804,164,782 *5360522809CB35C3F25EAE480EB0B9D9DD89C858 cameronwimmer
804,164,783 *5361AF3A4435F90A8AB5CD61A16D0F2ED253B0E1 CA$n
804,164,784 *536D9DA8B71447E4B5FECCB9908F31B95E79996F 1 METALL-FENSTERRAHMEN
804,164,785 *5368871701E5A97692528B2030F905803F0034D2 1N38R14T3S
804,164,786 *5362B4E9B608D98018ADAF96D1435A0382FDC05C 1 pekkasneuvottelujen
804,164,787 *536BFA508B4AF83F929ED65F03BEDBF70AF5C097 1 PELAAJASIIRTOLOMAKKEELLA
804,164,788 *53619860DF076CF6A7A1504E318E6CFC6D0B91A7 1-PROFILZYLINDER
804,164,789 *5367786E7D1488A19BBF90BDE68C6DEB524D5FF9 1 PURISTINLINJA
804,164,790 *53642F180F6AD4A23470D32097B8231C88381BEA CASSIUS ALMEIDA
804,164,791 *536E4EE45F411AE0DE4B0827A8869E3C0E45158D CATARRH1234
804,164,792 *53640DF75BE15FD4AD42EDECF83F00ABF425BD7D CATEGORYPORTUGUESEC
804,164,793 *53690E70C9728DB56D5D34E219E7F50DA2B0FD3E catjmz
804,164,794 *536D1C27A4563C5906510860DBDBDE220E07DD76 1-sample-aika
804,164,795 *5367A7C79A9408597461CCA4445B7186CCB9E5B6 1-siimeksella
804,164,796 *536E2810DC4B40D498737B89415FF692D14B5A3A 1.siklocular
804,164,797 *5369942B7583E3DB4D0F3C04C8DF0B1CC4644AED 1-silapa-archa
804,164,798 *536CD3F7F98C03DA21AB066D7906793CF313BF17 1skinny-conscious
804,164,799 *536CBEDFF0884A2F5EF1F3A4AD17CC756AEC1C38 cce;w
804,164,800 *53653773C58D18B3223E61F148D60EB3A194253C cdd=z
804,164,801 *53640B0352C74341A2AACB9286035DF55060FD5C C:\DOCUMENTS-AND-SETTINGS\FIREXWARE\LOCAL-SETTINGS\TEMPORARY-INTERNET-FILES\CONTENT.IE5\OZS69O0S\MORE[1].GIF
804,164,802 *5360056D921BD9C7C3A1E7733D4167040A127F64 1UUCP
804,164,803 *536A70C2700C93B74BB8F2009E46F5E06DB6B791 1-vapaaharjoitteluna
804,164,804 *536C4B06BEF3761C55A00F6A94D227A31F7239E1 1.varietreits
804,164,805 *5361EC37C1D1F5067FBFE07319E174756CD118C3 ce_$&
804,164,806 *536DC013B7226B612EF423153EF73645AF54C6BC cedrichuddle
804,164,807 *53650D03DB1EDFE82F53F541926387326797A544 1.zunehemnde
804,164,808 *5360B3077121A673BF956FFDE276E4DE4B266620 CFhG
804,164,809 *5369686F313F2C1D58DACE46A717ED40566FE2EB c#gae
804,164,810 *536A74494A5EC7D61886A3AB2547AAA1925BBFFB CGJJACOB8
804,164,811 *536532AEA11313ADC89F2ED9A8334E9BC31F80E4 charley-pride's-tenth-album
804,164,812 *536713D5ACF09C571E5522FE13EEE1E6B435F3CD [email protected]
804,164,813 *536DDCA7819583BB2E7D48D829EC980D6056864A [email protected]
804,164,814 *536FCF61B29F5E9052B80310D5FC98980A15C79C chesterglines
804,164,815 *53639F0D1333E41388614A54F2BE034428D84B41 CHESTERREING
804,164,816 *53644933F059F4E97731096F6108BBB4A92F24DB 2606548 "-PYLV
804,164,817 *536278E1852044B6F35F4DF808F0E9C09992FE15 CHIN-KEONG-TAN
804,164,818 *536EF97182725A74C810021300E95122A36DA955 chomskylies
804,164,819 *5367E308E2A1D14742651FFD01768C653F4B6DA0 28aurillac
804,164,820 *536BCAC6B8181945D99A78BDD2854E4BA7860D3D circumveniebatisque
804,164,821 *536FD451BE4CBF627212182CF9D9593F5B6CB63D 2-hapanjuotto
804,164,822 *536D08F63FC8B35BEEB2CEF6699942CB11A71005 CKr
804,164,823 *536C150C4C9F6FE177415C4EB166BA7E83EF4497 2ipu-delegation
804,164,824 *536672FD82F6460A766E5F2FC752E9BC1D39BF0C 2 miniaturinterpretation
804,164,825 *53610A6F06E89ECE86F8B9A85E24AF77FECAFE31 CLEO.BHARDWAJ
804,164,826 *536FD92A510D6A9D5A7B248A9F90734F56D2517A clintmaze
804,164,827 *536B1163E8FF362A646427495EBB0F689F3C3A96 clintonkalbfleisch
804,164,828 *536114D7006792002EB57C9E95C5B70E4509341E 2SILBRMND
804,164,829 *536A64E85591DD6C69E5C57A1A6C49AA4937527F 2THESTEPHEN8
804,164,830 *536C27B02F3EE513376B266597A08194ABD40AB6 cm&%:
804,164,831 *53642384A0E80AA33E1311609410BA2E0A2D6D92 cnbke
804,164,832 *53677EFC096786B1B088EB2995879E130F9C1931 3------B.~o.(0_<)
804,164,833 *536F2FBF5277AD6149D04C7C8F89CDE9278D96AD 3---D~3B<-
804,164,834 *5360D4A917C1CC6D155779F02EE80B84814E8794 3------D.~O.~o.o->-<
804,164,835 *536ED4D52A16F04750BE86608575F51C84852EEE 3EINWIRKUNGEN
804,164,836 *5360383826001DB93C5B735EF13F07DB373A6E78 COLE13160TALK160
804,164,837 *5367C41140EAB7ABF718DBE5E0FD0564F7565BEC COLLIN.METROKA
804,164,838 *5361048E983EF20BD9ABA869A49A76BF6A4DAAE3 3FC44467CFC53141AC7D632BF2B03DF5
804,164,839 *536BA66CDAAEB02DA1CBF69B470D86224EAC299F 3HSGNUBEU
804,164,840 *53681D586E3594C59666C2D2459308E7123BED18 COMING-HOME-(FREEFALL-REMIX)
804,164,841 *536391AD46FECE386AF2F87A144C59D75C98A325 COMING SOON
804,164,842 *536E3091062C0399726CD2E7F02BFC9C537D65A7 complained k ah0 m p l ey1 n d
804,164,843 *5367FA2A954AF3F6F8D68DCEE27C3962D39DA91A 3MCCONAHA
804,164,844 *5369E00BED9F2F5773E303FA13832208EB8FE896 3-MORiO
804,164,845 *53659CB1AF97044BD9F66927EED25C4B81A445BD 3.NIEMIMAATA
804,164,846 *5367B37E4E88A4C0ABDF96CF16F1E1EA15AD7837 CONRAD.ANNARUMMO
804,164,847 *536973AC8E9AF614070521246055A3C45387ECD9 3 ZITRUSPFLANZEN
804,164,848 *536FBCA52836C6428B4E7DDF596016295AAFFC0B COOPER47VE1Y
804,164,849 *5369C0AF1E6E09CEAC5FD73453E4591923F8AA97 CORYCANTLEY
804,164,850 *5361C943BA912D9512043021714FEC60B0C7258F coryhielscher
804,164,851 *53661A4BB844028C087E059BCC7192B557E07508 4BDICHINO
804,164,852 *536A7189A6BF17FD85F6447DACDBA343DD0C1733 4 LiVe BRoaDCaST FRoM oRBiT THe iNVaSioN oF KLeNDaTHu !
804,164,853 *536C2EAD02E8D3C9D97A730742A4E5C14B3060A6 cqfc
804,164,854 *5367BA665F5E2A1BC3D1A210A87EE06CFAE8E7FC 4NOVOVJEKIH
804,164,855 *536F56AC1FF999273C2E05FBA9AB1F08D4C7528B 4OBIWANEXPLORER
804,164,856 *5365B6E28B381D8343C45C57CDDE5F9DB2AA9A14 4OBIWANROSEBUD
804,164,857 *536722B18685DA50F2AF71BBA37F9C2B9965C028 4OVELAYED
804,164,858 *536BD5D69C8C723FA03815CAFCA4689843E5AFAD c%ra
804,164,859 *536D026B85E7EDF0747860387FD97FDA19658446 C&RLF
804,164,860 *536C6E7B191368A5CBD03778EC45037E4463F6D1 4TRASGREDITRICE
804,164,861 *536FA650C5A5691A59967A644C2A6655CC2CA423 csg)2
804,164,862 *5368B3F081C361A2181CDEE6BB777631B92CC0AC CSSXF
804,164,863 *5367ABC5277B6B00D6CAFE66565DF1027ED25024 54JEROME
804,164,864 *5369E9FEE17B4EF58D88C1B20184801751322FF8 ctw_4
804,164,865 *53687BD8AFAE711EF19F406B60F3FE4A706E88C8 CURLYGIRL96
804,164,866 *536973D24D9B959D8C0927A18C5944B9EDE128BD [email protected]
804,164,867 *536B40B36260F7D7944CDE076F0D947192F6A851 c=wfe
804,164,868 *53642F54EA5D2720BD8943B2BDD1E1372C6D1A38 5JEFFSNAKE
804,164,869 *53665BCA32493B8DCEA887E63E5576E4A99E1722 Cyber.Games.1
804,164,870 *53640E6C7144F8EDA72F5E24C708BA9F92C3842D 5JGKWIKQ
804,164,871 *536015880EE6A401BA6E57B508CE76A5E246F7EA 5KLDPRGRM
804,164,872 *53656FAFA09E076893918F834F6BABB3BE405D4A cyvu6
804,164,873 *536C786A5EA6093FDB2DE9B0D3182B06CF137170 5NONDISCOUNTAB
804,164,874 *53621B5B84BD284B1AAB10A6CAD7C115800E47AE d2aow
804,164,875 *53666685256A38AAAC91D701B55AC1375F2E70E5 5remenant
804,164,876 *53625B8C4D3235C4587628A3717DE41B1F01BD30 5SHIKHINIIBHIH
804,164,877 *536B003BAC78D3FD05B65967A87C7957E9A6EFF8 d4/ht
804,164,878 *5365634E6B7E028B78E7B6AF046171170EB7A868 5TABANDDNABAT
804,164,879 *536A82048372B952CBDF37538AACE6195E66B187 D4VD=
804,164,880 *536D87EC6F6955468FBA9E68EA4E2165985E6A7B d7gu/
804,164,881 *5366FB3DD0AE7D23B9B1B5BCAB31B60442C3AF96 D8DTL
804,164,882 *5368F13A9AC2C210E580BCB54E4C99BA1E0942ED dallas.eldridge
804,164,883 *5364627D1F02BB93EB0651D1A113311F507ECAA7 DAMION.LATIMER
804,164,884 *536F7D125290B905F5F8A7F9C62845BC97E92E16 dams74
804,164,885 *536AB5BC4949B0F7A97B906158DF9BA3C4D4CCE5 6CHARITYPASCAL
804,164,886 *5364674DE17DA648EA58576097EF994D2E964D88 DANUC
804,164,887 *5366549022972B1F4136FE2026BA62AF86E01BFF 6IAMJIMBO
804,164,888 *536987BDEE2A730E9953F6F4536E64E6A1B57931 davrandirdilar
804,164,889 *536A3D251DA31D61B876BEE5EA419DC15D2EC172 6.KYPSYTET
804,164,890 *53666533300664D853DD25382DC001F297710488 6LUSTKNABEN
804,164,891 *53668D933F3990713543EAB5387C542D013582F2 6MARIABUFFY
804,164,892 *5361B067E2C271B9C1AC4FDD18002ED3F247749D dbeed
804,164,893 *5368C9B5EA67A163116D54831A457CC17A7249DA DEANDRE.STURK
804,164,894 *536A0D70BA3CE5D2C906DEFDFE6A385AAC51E678 deb#
804,164,895 *5367989A76E3A0FAAD6F0633EE2ECA89BA2AAF9A 6ROMANCERNE
804,164,896 *5362862817638466CDAA61DCE4F31804FB70830A 6SUSTUJIG
804,164,897 *53606BAFD289B700940A619BD3BE89CC0E909124 6TRUMPETTYS
804,164,898 *536BB0B91803A4E4694E771D075D45B7E545E6F3 6TTGETMI
804,164,899 *536EDEBAEAB3A7E922779BCB13B73E10E09BAC21 6WEBMASTERPLAN
804,164,900 *5360A4F38E67A300C23C7D34AE06667BE0C41B3A 77.TASAPUOLISEN
804,164,901 *5365B30981FDF5718F126451E58B17EDFE302617 degniwnis
804,164,902 *536CAE98C865B7A4152387A4C7874F0689B130E3 DEkg
804,164,903 *536A9AD7EE176BC9896D1650C3EAD875EB350373 DENISBOSSIE
804,164,904 *5362641C1B41B07130E40E8F1105991E5EE6C25D DENNISPOMPEI
804,164,905 *536DFC516A6C033FEB97F971F255424DA6A2EA4A 7CURWENBSW
804,164,906 *5366A5EC881DB38D1C212119C540A2EE2F6606DF 7DCLINENT
804,164,907 *5360D82B2DD71C7F4396541E01B501DC6CD42893 7EFFUSUS
804,164,908 *536FE369CD901F4E22A27EE4653AD9C2C903EE91 dental-suction-echo-b
804,164,909 *536CF88314CA0F1A4F4AF9D8B4F34DFBDD763EE3 7LAFRINIERE
804,164,910 *53699B9619BA8B56B4A5F7D234BB3B6F8CFEAC06 [email protected]
804,164,911 *536B2E77A2DB3F4A919906EC89F9D02B6022466F 7SPAYNISCH
804,164,912 *536A75E60752F60BD82CE0039BC2F59CBD4CCD39 7SREGISTER
804,164,913 *536F763697FD0B84637506019BD9D4123E67B91C DETSATERP1
804,164,914 *536C1D15C0C330AE70B865A9BA0475ACAAC0467A 7TYGTUGWXDUXI
804,164,915 *5369987F885E2D228163042275A1BF5FEE936A8D DEXTER.BRANCH
804,164,916 *5361AC4C6322D5ABFCB72A49F192187CE21D327B DH3V3
804,164,917 *5369295E0EFBEF5C01E62D99909719A498933888 DIONRAHOCHE
804,164,918 *536BEE4FDB6BD8D95E43653E7D691F975E06F159 diskbrake0
804,164,919 *536D81D7EB908233839AD1C800B5A7B2B621EC60 8KLINKNINGERS
804,164,920 *5360A1D4E7A0FB8442341E7951A80A8829BD3DBD 8MAZELIE
804,164,921 *536B9EE4CAA5F12E8CD8E295073500B45E76B6E8 8MONETPLANET
804,164,922 *5363F4299C2852749FB3B1E3A59528AD59D4AC13 DK2!
804,164,923 *5363689981EBB672188DCF67FCEBFE362DD42C56 DL4TP
804,164,924 *536D22A4A048C42F6B2656315C9F73468A5D01C8 DLX_M
804,164,925 *536F4B57332B66B6A5ADCCA48FB72EFDA2AD61A1 8zinziberaceae
804,164,926 *536D792E7DE7F427145185AA10885EAA0D9AE94B 9ABSCHREIBUNGSGESCH
804,164,927 *53680FC8CF73297E06E1B5C04BA7DB38C25F15B1 9BSWMOGRENBSW
804,164,928 *536E2A998026840BDF41F3653B78156C723EC5E9 DOYLE.LALATA
804,164,929 *536E7F3A7C01D0015C5ACD3090232B38A3A83E9E DOZENSOFMUSLINS.COMWWW
804,164,930 *536A739070A5F1000C5DE1D45024F694A12860B9 9NOMONICO
804,164,931 *53656289C430FFEE1957CCC660D48D65F76E5562 9NTERPOLEER
804,164,932 *536F7726A2B56E29F3952C604C706D8142B6CCAF d#qbe
804,164,933 *536ADA8F74F8EA21E305BE990A6AB0EE9036DA61 dsb_0
804,164,934 *536FA0BEF17000F5AC1EF65A7EBEA86126607325 DSFU.
804,164,935 *53678E9274C1944E8A7E1FB4CBA13886FA81D84B A3RO1I+H
804,164,936 *536A9F70D70C43CCA00293E254AE37B4E4B34CE4 dy=:s
804,164,937 *5362977E3755A609BBD116CF8A1DB0D72C4B49F3 E'2O
804,164,938 *536BA9185B6072E728B1AA07C3C08C39A0B5E0CC aa)t?
804,164,939 *5366972F63A4F18B98DCB5EC1BDD40DC4445EB07 AB&,I
804,164,940 *536A8890EBB13278D4B042B6683A0B8547C65E13 ablU
804,164,941 *53693E46D0CBAB283C78AF53959DFF54A30114E0 ABSORBAMOSING
804,164,942 *536D347099528A2C86DA898A839687D78576B335 [email protected]
804,164,943 *5361E0A93B9890BC6FFCF120C3B26EF3EC6542F5 ABSORVESSE7
804,164,944 *53654B51BBF104F24152A51F3F1BDD936B3BAEE3 ABUSE101.COMABUSE101
804,164,945 *53632F7154F77FFF28C0FF07B8F268D4C4A366AD eerohynninen
804,164,946 *536BE78680C6E89F541300EC538B3E288E136AD7 EEw;
804,164,947 *536C224FE28DB9F434D90E88E252B92BC1B144D5 EGIREMMA9
804,164,948 *5363840AF2CA7A630AC3B0B2A9BF27ADFA201DC8 eh;9%
804,164,949 *53631905788161F9F57CCAAA8F800DF5FC8F97A8 EH.LK
804,164,950 *5361BE6510819999B171EAB4C9A6E31A04B4E5FC A.CTF
804,164,951 *53680E148A3D95C9672C54B9EE0683FE167B1D1C ADIORS
804,164,952 *536DF53F20FD3AB8C144F671C4D68560DA5149C2 ELDRIDGE.HONOUR
804,164,953 *53632F65F5DC01466ABB3143A024D4501360ACC7 ELISHASCHMITZER
804,164,954 *5361539AA21CDD93C6032F474B0E4F286BD77A58 AE-AE
804,164,955 *536B7BBB4087E20F3CE5DE1BCBCD27A57FF34EBB A%E/D
804,164,956 *5369DB8CF1F857E1F1A5FC71A318044980FE1EF9 elvinroybal
804,164,957 *536A18863227D8A6184D56748FF904FFE4D17B82 AFALLINGS
804,164,958 *5360D9A0245EB47A6E3993E41D832A52E6BB94D6 emilymellen
804,164,959 *536AFFF72872BE6F145D55E22D36F43C4E2B235C ah("k
804,164,960 *536A03380F2B70C8855172CE72813EFC7C4D078F aixelsyd4
804,164,961 *5364F83669FAD06ACDBB40A93C8D8A4F82FA0F2D AJH1229
804,164,962 *5363F915932F32A08C86F1F5D5F8A073F56A4FC0 akdd)
804,164,963 *5367E54C21408C5A2300853C26B08EE31BA98091 alaisiaan9
804,164,964 *53632C8801A9817B2D98B0789706DA6B1A1F39FF [email protected][email protected]!$T$
804,164,965 *536E9F7B1C2AD69E97CA8ADA3EA00529E176DB07 ENV1RONMEN+411$+
804,164,966 *536238522F63E4A0F11D289B6F9DB341946B24AD al/e
804,164,967 *536324A1A3FA35FBCF7965613903C2EFBB487EB8 ER:Q
804,164,968 *536142B7DDB1DF67F552C59129C2A4B8C2ED74C3 ERWIN.CHARTIER
804,164,969 *536BB947F7CB2A2725398F6362C4632277276DFC ESMERALDA MANCILLA
804,164,970 *536F306B066F6A2CABBC154A49761BE834DD08FE allenaddiego
804,164,971 *5366606F8A49CC7E53694A9639364ACFE35EE201 ALLHAILTHEPOW'ROFJESUS'NAME
804,164,972 *536F0B0D211D46B9538391E3888F9EA4F7F00F2F ESROSIKC
804,164,973 *53664E991E2E1917100B4D3E9D1B96890DD6248D ALPHONSESMALLMAN
804,164,974 *5365850D0ADF7BB76E41C2B393367647C778B185 alri
804,164,975 *536DFF59BFF41EF082605F0B8387AB8838987E32 alvinorr
804,164,976 *53692821E2696C928AAD73592CA500346A32205F EVELYNTIEMPO
804,164,977 *536FC5D6AB82F24ED7B93D5205919A5F6B7C44D3 am/k
804,164,978 *5365B12EC5FC486E25C9BA86C299E03A87D5A672 ANDERSON.LEDINGHAM
804,164,979 *5367CCCC4AF2298AF15AD7F933B1760DDAE997DF EXPANDING.VOICE
804,164,980 *536CE5E43FD5AECCD91C7F7471FC2C22C79F2ED4 ey"
804,164,981 *5362CA731C6ADECCACD4F9FAB7816329904B8511 EYUMG
804,164,982 *536C78147F09AA466C70B8261F4B83F0236C6827 F20B96
804,164,983 *53648F14083E78FD704496105BB5FA864BBDCF9F [email protected]
804,164,984 *536D6C2DBCF499AB509DE0C3EA9A6C569CF20D1B faces.of.death.(feat..easki)
804,164,985 *5368ADC446D0F9CDF4527DBF1AF6656036AA6C01 ant_%
804,164,986 *536CE0A23B2539D6BF33358242C8BBFFDF60A913 ANTONE.WEGGE
804,164,987 *53614FC302C01620F69C606C9EE2CD42B8F55B9E FAVREMESNIL
804,164,988 *536A205EA5C521CB8601D615B22A22B126343AA4 feel-the-beat-(js16-dark-remix)
804,164,989 *5366B636072FBD9BABCFCDCC5625576E5BBF6EBE fernandopitruzzello
804,164,990 *536FF6B569D7437FACDA053574EE21FE582D2002 F<ET
804,164,991 *53673ED20F535E3DC2C3C61F4EDBAA1C345108E5 A%$R
804,164,992 *53664F3B48A180B7DD11BAB3C9C19D33F5A74C68 arj9(
804,164,993 *5361747D8FD0AD6F97FA3CAE0730AC01A9FFD9D4 fótiova
804,164,994 *536F4A00D64F636DFD2DEADB0FE27847097F89A6 as7v"
804,164,995 *5368DBACC763B72259C06A04F09C56B163C28F7B freedomgarnet
804,164,996 *53687100584266EB33A401A1D009404877DD3501 F/RR
804,164,997 *5369D1B752034ACEF04AEC9857F3CE9DFAD7D3FF ATLASNAK8
804,164,998 *53683BE8A165C19CFE344A5A2916CBCBC24CDF77 ATTILAMARCEL
804,164,999 *536795FEB6AF340EA6032ED7E9C7F38B6D203107 galenfalconio
804,165,000 *536D23520F980B052ED73C49945E5A7CD3C11136 auoav
804,165,001 *536F9DB8D1EA9A75A94A6236EC9FCAD6D1276395 a$utn
804,165,002 *536CB35A58A2B0D236011C5254D4DF1CD4202630 av1tv
804,165,003 *536311FE052E5937821814DFFA59EB4E24943877 GAYETY
804,165,004 *5365C755CA020734FEF8D01811885DF5A00724D6 aw6pf
804,165,005 *53602A7F3D1A716CDBEF1D8C99F443F59AE4FA02 gleufieses
804,165,006 *536246023FDFE0ACEFB9CD0B2DFB85BF6F992EC6 b5v9c
804,165,007 *5361D030EFFF3A9FD72E45AAFFF38A1A744B418B GORDON.AUMAVAE
804,165,008 *5369C2C923A379CA0325906ED0DE1988E1FBDA0B gothik1607
804,165,009 *536309F1C1B7E3004B246241955CEFF34134E942 BANAILEY
804,165,010 *5369541EC06A2D92407809185AA2B9BFFA4DF485 grandma.'gr/&/n,m/A/
804,165,011 *536169FAC523A16EF8A43FCA46968C0984306D82 greggjeanbaptise
804,165,012 *53697F3FAF5340295B7589C86FF21465C67BCD4F GREG GOTHARD
804,165,013 *5364B738A5AD4FD38C125FBBF6006AD4F0B71558 BASIL.URQUIDI
804,165,014 *536023EBBCF8DFAEA4CE3BB8591EF1730CE2D387 gretchen-cooley
804,165,015 *5369FBF8A88F498362F8DB3C573F2C132EFC0FD0 [email protected]
804,165,016 *536BE62E338C76E806B5B71428C92C39CCB194DE GROOVING (RADIO EDIT)
804,165,017 *53695865DEAE45C1F5617D570F29DF176AE69068 b),b3
804,165,018 *536E9CD40321CB08B33828B1AD1C651734162C2A GUIDOBOOKIT
804,165,019 *536CBC33D29CC242C6DEB17694846F317DD8DCA3 H0R010G$7$
804,165,020 *536556929DCDD136A7BA3011EC26B02956589E7C bcm(w
804,165,021 *536DD7D2F26B079F92518DD8E0CE1B7F0243E1A3 bd)%v
804,165,022 *53629F11B67EE0A5999EACF4A9E2A61818191FB2 HARLANLUCAS
804,165,023 *536C3E1A215898AAFDBE9A7F116850B7F5ECC813 haroon.rehman
804,165,024 *5360E7A30FB43381B2F75D3B6B84F736F4FDED5E HARRISON.FLOORE
804,165,025 *5368DDD91BB06B0A1ED99CE87D8963400CD51BD6 HARRYDONOVAN
804,165,026 *536D22EF482550CA37C897F475FF59CD65290783 „BERLUSKAISER“
804,165,027 *5360339F719A624F926A0291067DE0CD89F73747 bertkoci
804,165,028 *53679F07EAD712C13AD43EBB2FDB03EEDE42E93F BERTRAM.SHOW
804,165,029 *53690106BC0C8FB816F303D316E604BADC13526A besh-
804,165,030 *536FDB48A7F33E359521B3301F2A5C2B1C72D03B heather-akridge
804,165,031 *536007556A197A61F61B3CE0330B8D3AEE43DAD3 HEATHHENDEL
804,165,032 *536E25BF0275032CF20058F876A9179FE37CA85E HEDERIFEROUS5
804,165,033 *536F543385AA0C376A143A44F2AB21AF1DAFA7DE HIS+OP1ASMA
804,165,034 *53613A85518D1BAFAD35AD3B42AFE3106F98EF88 b:imv
804,165,035 *5361B0B17160CAF13AC570AAF6E36C3B2478465E HKANTWANJE
804,165,036 *5361BE0A8FC2C904DFC51973B276719AEE53031F bisseste
804,165,037 *536FF6E43E8125694EE286A2FA1B38F48233F2D1 B/KM1
804,165,038 *53632FAB2AC224E656E7C9570AD1142C4DF83283 BMD
804,165,039 *536407AE85FB8F37E42EE0440E02428F412E1BA3 [email protected]
804,165,040 *5367A96A0F43DFB0BA045796D18AE9299BE6A00E bob,paul&seneca
804,165,041 *5369F6F3A314C41E296FB5B5FADCFB2099DE3A93 bodwr
804,165,042 *5360F12295B40ED786F3F242C2A0AA2CF320EF1D iamcaroline73
804,165,043 *5361DAC9C8CEFEE3C473ECE05D31CD5C21591475 IAO4
804,165,044 *536AF4AC2385714F7D04DC19621AFEFC67D231C2 Bqio
804,165,045 *53699F4D2D28AF989541250E8F17F4D270FB2A5B BRANDON CROMPTON
804,165,046 *536860BFF71EAE3F1E5A974E9FB63A2BFCAE8D62 braulio.torres
804,165,047 *5363C12A0716D9C0A1F204541469077BF56ED38A brenda-kuick
804,165,048 *5360802659CD12209D623B1AEC3E8029EA3C7C9B BRENTON.URQUIDI
804,165,049 *536D105649F9E5AAFE2219ECA444512042F6E5D3 [email protected]
804,165,050 *5362DF211EBA7B47B447C954A56A56A70BCF2B39 iluvmorecats71
804,165,051 *536EB3F6AB7303926FF4FFB976909FFE797157FD broderickmckerrow
804,165,052 *536FE888AF28CCFA591269E9FF3902BD20E4AE64 BROOKS.BINDEL
804,165,053 *5360828421030C673F6F23F4BB1851FCBF6E1934 BROOKS.GRUNDMEIER
804,165,054 *5368D26726C35AB9C1DABB2EA8F1ACD04FF08AA6 B(RR4
804,165,055 *5366EBE97E058F55CD44C38B2D48378989340239 BRYCEFEIN
804,165,056 *5368530E380EDC86A0207129FDFF19D93E6943B5 B;S_B
804,165,057 *536373A2215CF74090DFF4AB4389E456F9A0BA55 bt#=
804,165,058 *536E1002D566370AEAA06EC7A740206B06ED8C18 ISABELLES3
804,165,059 *5366E424F439EA7BC204620ADFF58F927B0C3DD7 ISREAL.KOENEMAN
804,165,060 *536C08755198DA8B883679328057F291813658C7 Itazura-na-KISS
804,165,061 *53699D5DC087533E7C1DBF98F651EF6AEB892026 IV./.ALLEGRO.CON.FUOCO
804,165,062 *536B3366721317CECE5C5D851D979F0F8AFA941F [email protected]
804,165,063 *5360BD0BD88BACAB27581F3CBA238C2355CC97AF BT$V
804,165,064 *5362BDD546894F141D9BB801A59E59A5151233C7 J4W
804,165,065 *53698C1FFC75E63CFC37DD8DC347177CDFD668CB JAMI.IRVINE
804,165,066 *5366C97ACA2A8BF9C7EBFC72C0A3AA0EC58AEEAD JANELLE RILEY
804,165,067 *536F7C99FE837187E91CAD85C28700ECA0F41D01 JASON.A.STRONG
804,165,068 *53675646E9E2001BD7E822E6233EE4A7D57666D1 bvhrd
804,165,069 *5366B94DB5D5B5D4FE7291BBF2EAFE3C455D6F9F JENTLACOM
804,165,070 *536FCAB37102326AFC6367229789EAFE5A3599F6 BWW4U
804,165,071 *536153E1460C890236B35D62C6D824D781C4027A byongnam9
804,165,072 *53642E1E8D18A703D5BA0AB9A3340481FEFC74F9 JGAILANAN
804,165,073 *536141599B1B3B5B22C069593A17FD4F6646F2AF jgoldmaning
804,165,074 *536D818E0C9B2E467DE3CD4428A8BFFB0BF3B671 jimihenyen
804,165,075 *5362DD2930B09FF693CB203AA646AAFB18BBFBC5 [email protected]
804,165,076 *53619292615E04175CBC414A6DA25ECF7196F9A1 C0NV/
804,165,077 *53663416EE8715B362A481AD267FA40959A79113 joaquincoffinberger
804,165,078 *536ED808E18766C979BF49F1AF1FFD3F0CB6EF48 C4BDC
804,165,079 *536D1931CC20B8A54A03785258655FD4509F66D8 c9#8b
804,165,080 *536AE8E6D54A1437E151A8BF9861672CA91D9101 jpdetur42
804,165,081 *536B612BA2CDC1A9914D076D6BE3BFFF2456DECE juniorjoshi
804,165,082 *5368640CE0C7280CAC6C40FE76128C7CF0AF3176 JUSTINILLIAN
804,165,083 *536175429A32A55BB40E23F80CDFBA387DFCEDCB jvl4dkjk3ec
804,165,084 *53631B5E8FDB15EB83A5C3CE8E172CEDC4D0C6C3 KAESBECK
804,165,085 *53652DA5AE26C348D4C94CCA2DD47509693A25D7 kaleseis
804,165,086 *536C3BA4CC1EEFF07844E3F8EEFF2FF183B9FED5 CAPADEABSTRACCI
804,165,087 *53679B142F4DAF34C5F10DA84DCA1971DB0E0626 KB3S
804,165,088 *536AEF66381B75D1D01C39F2A73BE8CC6DFAED8F KBZARUBA
804,165,089 *5364985BEB436DC64984E46EAB5A4CA326AF4DCB KCOBIAM8
804,165,090 *53672D26F97716F977AFFF5A14D966D69C6D2186 kenethhoops
804,165,091 *53677546895AC98CA14E30ED83FFCBEE99F06BF9 kenkralicek
804,165,092 *5369ED9EDAD951B4FA7F8C91581E5E9AD3665C67 kenmeylor
804,165,093 *53602B8CC5F5C094E1A40F0C4A68D594CEF944CA kennithmalbrough
804,165,094 *5361F08B3BBBC44CDB7811806BC606ADA56712B1 KENNY.BUSER
804,165,095 *53626A273E2A47D7FDD8BBB1CDD5A6403E7DB715 KEOT
804,165,096 *536908F458F0D51C2830C2573923C213652C57FF [email protected]
804,165,097 *5360A2919D31D0C24744FA5B31C0693884A5918F CAROL.MEAUX
804,165,098 *53627A8B1A462C0049026F17060852460F02334B [email protected]
804,165,099 *5367526533A41972A0F9E606A01F4BD77FBC7B01 CASPOSA5
804,165,100 *5369B3A2A23BEB93A36304EB1AD4D4AA7A8487FF kreuzlingenum1840
804,165,101 *536A1BB444F015CF3E31B9FC04B35E9EE6C0624E cepvr
804,165,102 *53665A920073695B2B3D166CDC4D97253FAEF5C8 lacob
804,165,103 *536C6D3B3BC9594B2C138EAE506C6D11BDFD7123 LAMONTCAPRIOLA
804,165,104 *53667F0199DB461F5044D86837F863525D2045EA CHANTAL-MAUDUIT
804,165,105 *536212EAB68DA85E827A8BC1F946880E560E20E3 lanefeehly
804,165,106 *5363A36B46BD950B02DA5C0EE158A71922844A15 CHAUNCEYMEYERING
804,165,107 *536372F7CBD6E59FCA21BA4149AAA3F9D7C7C7C0 ch;:d
804,165,108 *536E9491722D217E5A6BE7FD0FD9BBFEACC2BB24 chien ying
804,165,109 *536B29514E6691CB56738F8139530DA5FD7995CA Chq=
804,165,110 *5360CA17EE4F5A94032D96FDFC16D46576DFFB8F LENARD.ZUCH
804,165,111 *536425201CE785A585D0426EED3D12D024592666 leoneljahr
804,165,112 *536EC9E3246FA2CED7736C3FD40313EFEBC687F7 chungdarnley
804,165,113 *536F7046D70FB8A9674542CD20D3102825028879 lequier9
804,165,114 *5366CE9319E01043693EB84D19A0BD8DEA77629B lesterkears
804,165,115 *536D1339326FA3EBC018EC7CB469398E8972E160 CILP
804,165,116 *53615D94E1A139CE8CAAB7DEAF98F31F7DEC8C97 cju_7
804,165,117 *53634F698EFDE650D86AEADDB257B89E6C78CD23 cki4-
804,165,118 *536A99D8A60A2163DE9A1D08FDB3D743371E7C60 LIMBEREST123
804,165,119 *536E973D6359710C5F46405A9DFFA7F9C3877DAC claudefausett
804,165,120 *5369E9F37FDB8E556DDAF330CD477D9E7C959FB0 LINDAAN3
804,165,121 *5364D77EB0B1AB34B1BC51650D52971388BA3C2B lindseymondella
804,165,122 *53621D63E17F4750F8FBD3B661EDE0A215E53974 [email protected]
804,165,123 *536700980D8B4A931B2D00919F7E621C2B25C0B4 CLAYTON.MCCOLLISTER
804,165,124 *536B26EDF7359F54768B399F0D5910000C2246B5 LITIČJE
804,165,125 *536C0546E99A8C8C8196CEB1F648AC37F2510B8F [email protected]
804,165,126 *53606BDC548FAB342F2A76858811B95360E708C8 LIZELLE.HUNTER
804,165,127 *53650EB103485D7E672F4B2ABE48A55CFE683941 C/LLM
804,165,128 *536CB15E830D5E1BD53574498E967C1D5EBF9CBB LNCHNLSSES
804,165,129 *536B9CBE15D4725C3ED0A54FB4CCAF8B8925E885 C=MOF
804,165,130 *5363F93F16CF4B958CC5165B0B85332A359004F1 CMSVK
804,165,131 *536A6B88A4940D89D10ED7763F94E93AA69726BD lonhearing
804,165,132 *5365C115508A5411D20D411485E38BA1B37FDD44 [email protected]
804,165,133 *536679315ACBA93575170A1114103AC1C11C61B1 COBLA
804,165,134 *536A433FC0FFB4371CA3DB6C34645BFB6DC5FEA4 COLTON.BALEY
804,165,135 *53641BB17E5B4B5C23E78B974E16DBF1BB0E77D9 LUCY.CONNELL
804,165,136 *5360B790556EA7EDDB5F41E7214C143134F147D2 [email protected]
804,165,137 *536A291F4EE6C79EAEF9F9B33AA9D57E0A621035 [email protected]
804,165,138 *536D3BB7DE4AD1EC9C40F0E25E08E8023C6C8518 [email protected]
804,165,139 *53666E172116CD1EE5168A016DB08141D696D3E1 LYKK
804,165,140 *536077274B9220A1D2C593DC819EB05908E43300 CONOMAT
804,165,141 *5366237437CF3EA6B01CF50A1F848FFBCE30C5EE LYNDONDY
804,165,142 *5362CC2FC51A0FC49C691251D0CEF1DF028A5C7B COPULATIES3
804,165,143 *53633D2C118180A4079D47DB81C53F980D43F97B [?M0
804,165,144 *53613FE42B901D4B36F73AFE0C5EFFCA5393DD32 [email protected]!sts
804,165,145 *53649319613F58D1916C4D0A5E54F23D830B3253 C,PFA
804,165,146 *536B0F82AC4DB2D8AD8C65D8E08C19FD19963BB6 MACCARRAN.COM
804,165,147 *5368099E20985420F296B5C4E4A79F12A48A9D4E C:\PROGRAM.FILES\ADOBE\ADOBE.PHOTOSHOP.CS4\ADOBE_EPIC\EULA\RO_RO\INSTALL2.HTML
804,165,148 *5360008FA1644C5590A588A36AA0282414E0B731 C:\PROGRAMFILES\ADOBE\ADOBEPHOTOSHOPCS4\LEGAL\KO_KR\LICENSE.HTML
804,165,149 *536761EF175B01D8A043284B269C248215447149 [email protected]
804,165,150 *53648993F6A329E0FD920D95C43A7062206BB568 c:qf%
804,165,151 *536286D17CBAB1187FD0CCABCE0CF0A88D793645 MAN.BRACKETT
804,165,152 *53678B92203C254EDA7EAA94ADB5785EA59E9ECF MANUELA.LORENZ
804,165,153 *5367CE963E7910878334F0932D9B83F1F05D1BC0 MARCHES
804,165,154 *536B9F85C41930DE4A0B58EE5F5B2A4580C96F51
804,165,155 *536FAA761E919D723D692ED39B623622CED56E08
804,165,156 *536AB1A738277B70DA5EBA97D9CEC0F4394EE85D
804,165,157 *536F363D88CE140176B23ACF5693C81D42F5D439 ^RÛ
804,165,158 *536301D92E6C97763A073FF97EC8214B0865DD7E
804,165,159 *536796BEF707FE764FD934B8ABE00BF7B8A92E84
804,165,160 *5367C9EFC9804C3681C9F6A9C27C3D68C828B148 marniemcinnes
804,165,161 *536137C3E3097B585C7DA531E15FEE7A98355625
804,165,162 *536EA586ED65660F25CE832F5AE9A4E2E74F269E MASONHAIGH
804,165,163 *5361C09A7D100558F7473A78B6300D8A74B54B5C [email protected]
804,165,164 *5365447B6BBE67582D18752E036D315AB639D824
804,165,165 *536739B4B23E5D59A4B7EEF9C0A2A8AAE5293C68
804,165,166 *5363EE5F248769969C4EDE51939099129C038C08 }
804,165,167 *5362E4CDD9BED13FD30034CD876FF9F7EF5CAE9E matt-isard
804,165,168 *536BF172CF712627B272F7D92F4DC0F033DA8992 y
804,165,169 *53682F44A8EA8BEE9531CE1E5258B1FF197E8AC1 matt-u
804,165,170 *536EF6068C8FD565FAB3FDB11DACB48332F9446C E
804,165,171 *536BB0A07942BA031B3E1C798A46C7CD739AAE61
804,165,172 *53605AEA5D880B607763F231B0911BEBCF202D17 MAXIMODANCY
804,165,173 *536778039164F3EB63241A3C227F55FBB4777344 a86 ] 
804,165,174 *536ED9DF10174921343089B4FBCF4D30AB0DF895 
804,165,175 *536242ACD7DDA91AF302877F10D42417620F5A05 MCCALLLLACCM
804,165,176 *536FD0965383F99382F348E9A1502FB950BFC81A .
804,165,177 *536B42A283B040EA5CA6EE761B8570A02568A925 r
804,165,178 *536E1E5DBCF4CB25506040DF67D647BEDB7B5BDD Ea
804,165,179 *536887F025BE7CF5173F247E4E7C0DFA9322D17E [email protected]
804,165,180 *536E809C9C8ACB1DC1C18D6DADC6D2B93FD922DB q
804,165,181 *5362D221F7FC6585E04E0C017970F2D8FAA366C2 meekeru
804,165,182 *5367DBF07A379C84C614A3B56FA8A657B985610E ^B
804,165,183 *536E7FA86C46F34155E66E87A95DB14C6E620120
804,165,184 *536BD8991F70E9AD0D9678D1E04B9046757F1F07
804,165,185 *536DC55CC830DAFDB1335927667FC38714D6B122 MELYSSA.ADAMS
804,165,186 *53622BDA89D9A779D6BDE980E32EF69B6B35799C
804,165,187 *536F7EFA90DDA5A007774B8D10ADC73CFCD4F104 me'nageriez
804,165,188 *5368FE2A65DD2CFE4CF0E9AAEAB2216C83F7294E MERELEANED
804,165,189 *5369AE48E9136C0D1B910F68A22BE24B41D26700 [email protected]
804,165,190 *536878408AC2AF8AF4584F65756DF609E74A96DE K
804,165,191 *536C19583E936D10A9346A958C9D8260CC09BB5C [email protected]
804,165,192 *536D6B52F405F556F0AB3647BA34111E922C6760 09].
804,165,193 *5365744E1B0C30A1B11CD5FEEA72701BE52A5486
804,165,194 *536301C58B74F2CEAA1F1F99734BB86B3298F359 michealgregston
804,165,195 *5368714D917B1315E443588BF8D7345C9AAE1774 5
804,165,196 *5363C25BC6F2898D65B2ED8086245BC276484E1D miguelriis
804,165,197 *53624FBB873AA71504CC8FA13D57E3099B1B63F5 mikeiacobucci
804,165,198 *536B26578A96D65B34D1DD0C4B04A177617EC6DC
804,165,199 *5366D67A086645BF8612A4F00A0F2C79345AEF2B MILFORD.ALLGEYER
804,165,200 *536DEAA96A9036A46606C39CCFFBD9DBA46D9A5F MILLIOAZ
804,165,201 *536C8B1B5E974031A21CACD3E43689D72EE6D288 MILO.JAWOROWSKI
804,165,202 *536A466D007C3C4F558D11BDDCE268949630FE4E
804,165,203 *536B71AA12BB92D9483B1C83CD628D997B9825AD
804,165,204 *53633626FEF9D241D5FF544669005A530D687A74
804,165,205 *5360DEA77C1D381F1A45159B37CEBFEBF9AC8966 t
804,165,206 *536C72FB84C05DBBA65CE0F95693F0FF1ED45370 MingLunbbs
804,165,207 *5363162745629E1F8B21396AE13DBAE0CA769A2E
804,165,208 *536E182BD21F18E23E7977D47FC2344CE37A7913 Ru
804,165,209 *5367EBAA19B9CE70E7A268F499C42A5749243E75
804,165,210 *536012AA4BF5EE5C4D8F6F36FED5A4CA91625ED3
804,165,211 *536C29385727ED4120BDB0EC31B897BF9267CF0C [6
804,165,212 *53650B98889164531A485C2A60020DBAD5D00D9F
804,165,213 *536DFF200F9ED49544D7109D0FFBEE05548737C8 F_
804,165,214 *5364EBCF68E5B11CE9A6449A8CFFEEB6400BC066 misplay
804,165,215 *536BB67F20ADF4A4558E2A79F914EDC82D91F67F mitchellnewmeyer
804,165,216 *536775CEDBB6F1829427117437C252B951FFFAD0 mi$under$74ndin9
804,165,217 *536179656B6D76B232EAE6E67BA0D8D6F266BEF3 
804,165,218 *536957A03C72CB746B176E1C0242CB5BFB7ADB4C yaw
804,165,219 *536E15DD761E49059ECF8DE9C38344A7CC8E4CF2 !T>
804,165,220 *5368AD7EE12912C64FE2A36F8D715E307FE492C6
804,165,221 *5363A1DA450A0DB6B1EC447CBEE5F3EB41F82578 
804,165,222 *53652696328A258BA771D87402B3CABEF9F32924 m
804,165,223 *5365662B6C505C92101C2109E4662CA34A5A0EA2 MOONBEAMHOPPEN
804,165,224 *536AFD15310874BDC733F04193963F8B3366DD2E MORTON.HILTBRAND
804,165,225 *53645B410496B09CC837AC67EA16FAC4A878B16E 8t
804,165,226 *5364F235DE8D220E04B4C82A9317B523968381B0 MOTORCITY1234
804,165,227 *536458D5D5D9615B4D1573D54C7A61A50D8DCFC4 [email protected]
804,165,228 *536BF66E3EBFAE88F136D3BC832F05FF444D701A ^
804,165,229 *5369D55DABBE3EEC031B6D24726DC6386B4EF7DF
804,165,230 *536216984D44878348CA20AA3A26CC22ECCD0BD0 (0
804,165,231 *536AE4708B92D349670602BDCA030096CDD7C896
804,165,232 *536C690E95915112A9A69ECB742EA15EBC5FA5E5 m<O
804,165,233 *536AA72937C3CC2C7153EEEA2F60F06F1F0B2381 MUDEJAR.DE.ARAG
804,165,234 *536FBA09AF36703F0BBA66DF7D408D76ADE5E739
804,165,235 *536F32FD4F2010AF73DD9DCF9126833E0660E7E4 <
804,165,236 *536DCE4A3CD8C1EBE2D639447709474C7338DD91 
804,165,237 *536CC2CA0D1654318C2FAAE4A4A7CF21120C2C9C
804,165,238 *536BB8D6F8667875601BC911AD2005B71E196558
804,165,239 *536EBD840877ED416FAD1E248EC9816AD44003F7 MUISVALKED
804,165,240 *536559A8ED95458FC22C4694AB2A93A09F4295B0 1039313 AASIAKKAAN.KIRJAUTUMISTAPA.J
804,165,241 *536D71671FA956697674D92CDA0D1C735DEAC779 NEWS.XMNEXT.COMWORLD
804,165,242 *5366D048F26563312CFC4FE11410C333586C1155 NEZISKOVÁ
804,165,243 *536DC5EC03C71C420175156CA03AE75E15B0E437 1376124 ulkomaalaistaustan omaavien henkil
804,165,244 *53614616FE0C690A7AFB217E09764DEDAAD226AC NICKHILDEBRANDT
804,165,245 *5369D128B680AAA4056792E83B84FC6C32546421 NICKY.ZYBIA
804,165,246 *5363F5A697B5C823AC1C658F807768313740A624 nigellagreca
804,165,247 *5368C5869174A34D6D9585DBA064927B884ABA0C Night.Accident
804,165,248 *5369BADC102CF0261E3324EE97C3D148B029EF1F 1497412 liki40metri
804,165,249 *53629CBC71A4869B004BBF241DE04E8579617516 1552514 he's on a strategy-forming management team
804,165,250 *5362956E11C18E8CDD9359E20B0177E090BF76CA NITOMAS4
804,165,251 *5360344DF83168AB42C220C6A5B4D44415A1FDCE 1596936 " I'VE HAD A LOT OF PHONE CALLS .
804,165,252 *536F321908942CA1FD2EE9E348711365E7F7D42A 15karibianmeren
804,165,253 *536009C5EA9CBCFA691FA37A9782BA13837A1D6D 1701DWICKED
804,165,254 *536F7080F4021F7E066404280348F87F8B7D6487 1-BELSKITA
804,165,255 *536132EC68BD514FDD0B7788D9106D6B6292912D 1.benzedrine
804,165,256 *536748F93DF4845A2C3166334D37510246280FC8 1-bufano
804,165,257 *5366B5AB1BC3021BFD6F61D34C6916FAF3B46877 1 ekstrapisteit
804,165,258 *536FA0DB131AD5658BF63EB4FAFD985BFF77F04C 1.ELINKEINOYHTEISTY
804,165,259 *536C696E45FB4355F0C44CD8463533A3E7F8B2FF 1.environmental-agency
804,165,260 *5369FD06D1C8300C73B056E0E2055088C6B0688F 1eurostarjunien
804,165,261 *53659A5E5A7AEDA5727764E7DDB89BBBCB7EE373 1GILSONM
804,165,262 *5365941F3D51128F5E0909516F0A4F5F7A64AD57 1-HERMIE
804,165,263 *53602EC133172AA8C42CF5A240B473A93BC9E8C2 OMAR14
804,165,264 *5364E0B6FD89CC0B620B84CB9825B6D07C6E9F99 1 laridahmarsch
804,165,265 *5363DD3EC5DE6B044C07B55D8A2A45F21331077D onpreemptive
804,165,266 *53650F0E0FF4086A66115D28F608C5D33376FB0D 1LINDSAY9
804,165,267 *53655825219D98FB716A54EF011EEEFECD03CC4D 1-NOORAA
804,165,268 *5360C20E580B14377EA340EE68241F1A342F399B 1.OSASIHY
804,165,269 *536D160C877FA23AAE6E373B687944B5180D77BA 1overvaren
804,165,270 *536010D5455BA061D5A8D087779C3092875488B7 OSTREGA7
804,165,271 *5368BE9DAAC0462ABA14D3D4EE168B1A2747600F othavankampen
804,165,272 *5368B1B595FD754BD6C16530EE89FA57FD1F4556 OTHERWHITHERING
804,165,273 *53674D96EF38A53F108BFA8065FC4C2051F71D96 1STADSWE
804,165,274 *536B7E407FB6BE151D14BDBE3BD6998221DC0FA2 oulahmanessek
804,165,275 *536D1B7E91D21B72B03DE388FCFE4875524D4740 OVERSPANNENENS
804,165,276 *536F167F12734E38B3ED5AA7F5CD46CB01A2AB6D [email protected]
804,165,277 *5367732A4A1E13983701AC471D1528E1833078EA 1 VIRTSAPULLOJEN
804,165,278 *536E0935E7EB5ADDB8F968C86A1E4B60E1806E7D p1lgr1m4ge$
804,165,279 *5369328AF6A8E5FE6DCC304D8CE21D51139102E4 parishartnett
804,165,280 *53603349314D9CA801CB3024148F9CCA40543635 PAULJITCHAKU
804,165,281 *536DF2BB70DE7982D7976A4339CED1BD770FE5AB 2466712 caroline6v:"josonk
804,165,282 *536DCA5B430052DF7C1F54E71DB1B6BA0BDAE776 2581630 KOILLISEN SUUNNALLA ERILLIS
804,165,283 *536009C5B20F8415A29DA8F4BA2BDDE94D7CC5A9 :P.~`D3
804,165,284 *53656F5DE96937997205E308595A076CCA5A78A9 peace-out
804,165,285 *5361EB14105D5D6F3DAC4B313F0E841C9CED6CEB PEDROWATERBURY
804,165,286 *536515BF98A92443D526C3B5131DD8513626019D 2ALLERBMU
804,165,287 *536CF445158F5864AB3A03D8544299B3E703633C peony':noleave
804,165,288 *536F50A0B5D298835A3AEA390230B7D4FDD0F20A PEOPLE—THEORETICALLY
804,165,289 *5366E2E9A0442C2285C30572883C9CE187F4BC11 2ARROSES
804,165,290 *536993B0377DB5C39682B6C959CB38583301E92F 2AUSSCHMU
804,165,291 *536619F34CB8BED4BE5DACD6084136EF7893D016 perlfunktion
804,165,292 *536653E2DD3ECE90C5CE2F546FF9EACC6069CFB8 2EJBRITTS
804,165,293 *5362B0AB18AB4A7E48155C025D9CF22082138D55 [email protected]
804,165,294 *5365CAEC4C6238D5D2A05ADCAB9FD1CC2589B79E PH4S3
804,165,295 *536317BF0B9076E71F8CF6C3882727577814ACC3 2.her-especially
804,165,296 *5363CFB26FCC1B302088DDCB792EDD551B7AA1EC philisterhafte
804,165,297 *536D63E24AE0B76FAE81912CE6E7758DAB534DAC 2KAPAZITAETSSCHNITT
804,165,298 *536131A199888BC911F349388D091B60CC682114 2NSCCLNT
804,165,299 *5360DAF864A57BA00B582B9A7A0A258EDE6F9A0B 2PMICHELL
804,165,300 *5365810900FF9D14BD721E3752E93075D0525DDB 2-POISJ
804,165,301 *5362105BBC98590EEF9FE68F78947A7D519B1CB5 PIRATDEL
804,165,302 *536606283BD162A0B60920D611DD29163F49F939 3###@.*.*(^_~)
804,165,303 *536AD0648CC2F12B07C87CB35E40C540AF663FA3 playbooks5
804,165,304 *5362CDF84605D48851CB42AAF2F54E13AB63A6A9 pleurocentrums
804,165,305 *53664D77ED27BD71B3C11FBC56A3C86685292E49 356170 oglenden.once.gunes.gole.vuruyor..
804,165,306 *536A064DE867D0C72435A8F8D8F1A12D51D85EA3 36989 turkulaisettahoteiv
804,165,307 *536A8B549771713AB24D1D83200229D4FE8A8C23 [email protected]
804,165,308 *536B6C0C740A7BDC9646F206FAB08268D96C8782 P)~O><
804,165,309 *536E1B8A395DD0F37D49AE0DD2B588A2CE082601 3---D~3B<-
804,165,310 *536E957543C5B1F1954FAC327F4B6AA53FA5DDAF 3ilovedwight7
804,165,311 *536DBA709BCEE6887C192C630DC41EA0ED86A231 3つの即興曲OP.35
804,165,312 *5367D39E8CAD64927022E3341F95C094FCDFE4BB :P-~Q-----Q
804,165,313 *536497BEE881553BE89A53B026B4DD13F4F7B598 435gavin
804,165,314 *536F5AC3705CAB367956CC07A15091815F9FAD3E 492098 hymy-reliefin halkaisija on 18 cm ja korkeus 4 cm ympyr
804,165,315 *536D7C122BD39B90C7A681F5545645093171F760 4FHLRSTRNT
804,165,316 *53691EA1D5B960EEBE8D257269C8E2E14429B6D0 PRINCEPEPE
804,165,317 *5365247B0A653A508C84D974EC8C17FA5D82E036 4KONZERTI
804,165,318 *53665C50B7B22EB86DDE0C8B2CF83CEC53BA74E7 4OFICJANIE
804,165,319 *536FD1DBFB6B57D52BBF8F9E1E403444818DA561 4RACOONM
804,165,320 *53608C5B74C02A55AF2BB043E9F3A5328A3201AE PUNISHERZE
804,165,321 *5369281A1BC72BA8424824F12BBE0C22D9F7BB81 4THEROCKET
804,165,322 *536AA6BCBFECFD94D37CBDCE50820F66E85ACA10 4UNGDOMSSLVSINDS
804,165,323 *5364B0B304D480FAEE17A83DD851AD7B7B2C6DDF 4-vickson
804,165,324 *5362FF7DF6A0E7F3176E8C14C99604C03BF90BCE 5000番台2両編成(p編成)7本、計14両が所属している。
804,165,325 *536D820F8C4C64640C31DB9A25F1218F38EFF1D1 [email protected]
804,165,326 *5368741689911069C6A8E70D0A1984CE4C0643B1 Q===P~0~O )O(
804,165,327 *536DC0466470B40BC836E5F9D612C60210A43F4E [email protected]
804,165,328 *5363004A01A5F866ACD5C37B8D7E9CA10C83764F 5AGALERARIVE
804,165,329 *5369F3ACF0DE1C8E2032A93FEFBCDC1F93CEDFF0 5BARATUNK
804,165,330 *536888F20590132D90233407A00A73E4D3813FF4 QX1955
804,165,331 *5360B60B5625DD40310CF7FDF85515E005510423 [email protected]
804,165,332 *536EB412992F7623878DE73A01D0D11A606E0E25 RAICHL
804,165,333 *536C9A575820844B41E57B3CFE5103C271F1401B 5HEINAENTEKOA
804,165,334 *53690572698BB522DBF22D8F5F14F75FB3C57EB8 5HOLFENEN
804,165,335 *5362737D0FB41193722F5937853F1FB68240E29F 5NEIVROSI
804,165,336 *536A670DCE7D2AFE85A1BF363F20320914F9151E 5SHEREEF
804,165,337 *53627A6FEB654AE59B7E0377E1E3B5A0B7E87E81 randellmeylor
804,165,338 *5364D5099470B0ACBBC55513B200C2BD468813D8 5TSRETTIR
804,165,339 *5366B8DDDE998DF2DADBC8EB58F0DF472DB83A94 RAUSZUBE3
804,165,340 *53686F47D1FDF4057B678191B68944D6F41A2489 RAYMOND.WANK
804,165,341 *53663DD04276EEA6F26DF15618777C688A4D4271 RCWD0C
804,165,342 *536F8E8DEE3DB3013139BC9F2FF1B9BC49A4B276 REA550R7IN9
804,165,343 *5365BEA1ACAC7A47AFC0CE766EF670D805668C10 6CROSSBRIDLE
804,165,344 *5364E4A5C998469C5B3DF1E25306CFE88C9C72B9 6ENILANERDA
804,165,345 *536FA80401286B9035DF9F6DDF15170E01CF09F1 6EVICTORN
804,165,346 *536439747C0AA0244740AF1D365387200C77E0A3 6FICOIDESES
804,165,347 *5368A2CC9D382207665B83F86B44BEE70BFF6369 6LINTUKOSTEIKKOJEN
804,165,348 *5366560581881F2CAAB7C7BD95EF052C632127CE 6LMPMITTARILLA
804,165,349 *536BDDC69B07FACD29A7AF75C46BADA8A2CE988D 6marcheraient
804,165,350 *536F78294615D2CBB763DE683DBABC50781C52D7 6TETENDER
804,165,351 *536CCC5C304B611E255D12615E12B07636599F92 6VOORPUNT
804,165,352 *536A193DD519EF63FACB78AC4E34BEC244DECB04 6WEBMASTEPLEASE
804,165,353 *536FBC1BA738CF2528F20ABC39A314DC608931F4 6WISDOMDEATH
804,165,354 *5361E18C1E3A6A104544BD911F40439BBED3E6AE 719ROBERT
804,165,355 *53691CD65FAC596D3C8F2157FDA01DAA108544A8 REVERTEDBREWCREWER
804,165,356 *53682CCD6180A4CC2153DB2E4956E63116E03927 REVMANLEY
804,165,357 *536C43B50B7D8D6934DB9528FC7EC39EB2FDFC6A RICHALSON20
804,165,358 *5365FA06E52844964FCE8B99270EB88A0F9906B8 7DELAINEY
804,165,359 *53617A77064ADEBCF83830CCB3C6D855EB241CE4 7GLOTONAS
804,165,360 *5364E032B763419E8367B59F38E3E10524C63537 RIVIERMONDEN0
804,165,361 *536B08AA6F5645F4B8CAAECB6254242BC8C8BC40 [email protected]
804,165,362 *536AD0A396EB56647EA2E977ECDF948D9D353EB3 ROBBIE.KURPINSKI
804,165,363 *5363956A6226CA3E472A56BEEA79DCA744BDD467 ROBERT.ECHEGOYEN
804,165,364 *53687CC3C0DF372A90DAA3634EFFA2648A0F7DF8 ROBIN.COAKLEY
804,165,365 *5368F2241FB8DDD2807C3EC600CA24C9C353265C 7PARKEHBSW
804,165,366 *53623802A3D33EE783312C83269A9B28A8FF4946 7RASENDU
804,165,367 *5360CDCF400C65D2DDFAD1EB0F0ECCCC99675B2E ROCKSTIMPY1
804,165,368 *53688F509A1A6E5831A31E0B37D288D0DB7C3C95 rodgerjennings
804,165,369 *5364C63CEA3C4C2D575AD8C1EDE0C8EFE8342358 7TULKITSIJASTA
804,165,370 *536574E5101CE2DA1F96EB05EE73489BBF77F8AF 7WESLEYORANGES
804,165,371 *5366B5C75142D9A5A14DEB8E97C53651CCD6345F RONYMIZE7
804,165,372 *53687A2E35197C39748E9EE9F8BAE3E3EC782F1A 84LDUCTUM
804,165,373 *536035F1551D99AA8EC529616E5129CC11521DD9 862ALDEN
804,165,374 *536C748045423AA9C6B1227DBE859949F9D53432 8ACRIDANS
804,165,375 *53679DD2D29667C7BBDA6EF7FC0FA1898DE49D63 ROSSBAYNE
804,165,376 *53627F003E22A605B1411E2EE94CE1AF7135CF17 {{rotten-tomatoes|id=cold_mountain|title=coldmountain}}
804,165,377 *536D5AA38CCACDAA6F3307FDAF5C4302B6577D4F 8BVECTRA
804,165,378 *5361E104325FF4A6798FFE593E839C6CDD8F6C30 [email protected]
804,165,379 *536973FE9A01CDE4CCC77E356F01ACF1A83A8A1B RT MAN RUFEN RINGS IM SAAL!
804,165,380 *53606AED271A8DDBEFEFF80717F56DBCE0F358D0 8EDDAERNE
804,165,381 *536F2A59A3980B3A71585B84D9F8ACA9FAA87E7D 8EUHIKAHK
804,165,382 *5367EE3B68C90AC2121301E426773D295602F7F4 8HOUZEVNATEJSIMI
804,165,383 *5366895FB9B6363D4CBA67F76F569F689BEBD10A RUOTSALAISYHTIÖ
804,165,384 *53615DED5B8CE3AF20012EB49EEDF3D473DE3F30 8MOONLIGHTBLUE
804,165,385 *53692D251E14869B82A681F0005B2435209EAC94 8--P* * * )8(
804,165,386 *5361FE8F224829D8895B9B00CFBB9A8826B8C43E 8SAIONARAP
804,165,387 *5360F9EFB1410CDA2D638FBAD8C999881B519EA5 8UTLETIAT
804,165,388 *536C0974AD88A2037A203327E5A3482E8490C507 SAMURAI.CODE.QUOTE.#1
804,165,389 *536261FA5F3521A65C0B2B2ADE2757A6D7A7944C SANGDAMIEN
804,165,390 *53621FCBF60A878F876704F3998CF298141D3098 971693 kodlama-kazanci-.
804,165,391 *53656C433F1469A32104D7B6F5BAB42F1DC0CADD sb^i
804,165,392 *5364495DCD7AC2BB2AE508F2A7ADAAC887B7DC45 9HYTTEHOLDET
804,165,393 *536C89F9160134DF772B0D1DA6047A2559873EBC SCRAWNIERA2
804,165,394 *536841D4F636FD1E26A2CBC108FA111578080261 SEDREESREVART
804,165,395 *536F726AFA369AAF1F7CC97450C3E66473B407C9 9NOWHITNOWHIT
804,165,396 *53682BFB3CEBAE5E8B17F98047A718966D8496DB [email protected]
804,165,397 *536FEB6EF2932C9C3B8E3C9C6D78ADE7FE0722A7 9SHANGQUCHI
804,165,398 *536114F7ED6D858AA26BEB79115B12BD9E2AA744 9STEPLERL
804,165,399 *536E84D56E5CE16DBEA43CEE5349E411228DFC76 9UNSTONIN
804,165,400 *53630002D0FF798E53FFBCDFBD851A75939F776E a12t1
804,165,401 *53699673E9AE7E71DCCCE50DFAFA373C1DFF1122 a1eok
804,165,402 *5366AD755DE91E3260087842E6922468043C5567 SFIDEREI
804,165,403 *536F0F9389790C161B6A00E9D7E76A70DB6BD832 a4q/
804,165,404 *5361C9393783A6C0B49A5DA9A2DCE42CD8657D82 SHOEMAKER9
804,165,405 *53689C3020E57D1C09ED6E40A18A5DD40FE497BA [email protected]
804,165,406 *536375ED64F09B099A2CA227C5F8718144263180 AAEZK?
804,165,407 *5366038A2AEC237DE81DC7ACBD08E3CB504CBC98 AANLOEFDENSING
804,165,408 *5369F5A2A18403C8F8945DBB82E0F7F11BD5881C AATANOOH5
804,165,409 *536D4E4B456C2A8468E2CCB0C5A562C79D23DDE9 aatlavating
804,165,410 *5363F37053FEF28026CBE633F5339951DB1A1D8C ABCBENOITING
804,165,411 *5362742D76E46CE16DD4673C84EEEAC072D0713D SKENN1504
804,165,412 *5364B8518C5B8B6A56473C6879A12E3A8F3A17A9 [email protected]
804,165,413 *53636FE2C7E48447D462FF7D8198302F0B36F996 smarlyngabel
804,165,414 *5366F7F2C1C1426E52299E42F3553C1BEAE71D02 adlnj
804,165,415 *536761BA52E60C4DAA2BA2B5B12E20E23D187F56 spillemaag!
804,165,416 *5368B0F42485BFEB6AD491127BF64BC286738B73 Splat!-~-~-~-(--p
804,165,417 *536B7E611863B82FCD06C5DFDEE47BE61EF975B8 SPLOIT~`-(------B
804,165,418 *53612F2F3D352A7EC5389F56769F73947BFEF981 SPORENSTREGS9
804,165,419 *53601C930C792F5797842E194D614A0D7676FEA7 agdb#
804,165,420 *536EBA0AB2466FF34DC4622BA89025F85A7D9266 A.Get.Together
804,165,421 *536E897D0F9A272C8E480D4DDF677CC577FADF36 a"gh
804,165,422 *536F42E70CD80DAB7337FAE2C8890D636A9224F8 SSV*
804,165,423 *536FCC36873F5A86EBA08A7B4B4EDD1E06531769 a$$i9nabi1i7y
804,165,424 *5367133E9AF81559BE5CF44C1371F75CE1632CCB stantoncompanion
804,165,425 *536CC66C2A906358B40325DD69CBCB9464B8CD51 A.I.E..(A'MWANA)
804,165,426 *536B2F88FFF764AFC81914D83AC6AD4279A0A218 staycleanthesedays
804,165,427 *53608937E914D77CF7DEE5E6B4550ABDC81F5861 [email protected]
804,165,428 *536A955F4B6E2C3D796357D7A504B696E852C328 stemphyliu
804,165,429 *5366E5A7ADB00544B1E8790E9DAEBD7C005600FC AJAT8
804,165,430 *536E573F38B9DC27D0E9A35C24F708744AEC5A73 [email protected]
804,165,431 *536A9AF6E311E90201C3AA98C61818DF21D74AA6 ALBENISE
804,165,432 *5360A8E1785FF55D85E561CD7C55854B9D6F99D8 ALDAWI
804,165,433 *536EF639DCFA4C8F72B7CA34F66FADA37DB4B77B ALEX.STEINBAUGH
804,165,434 *536CAE04D540BBA72F9619DC7FF3ECD426AD21D3 ALEXYS NYCOLE
804,165,435 *536E658FABBE40F7E5FB2708BC412C4721469852 strategic paradox
804,165,436 *53606DB1C8E02A7A53C11C126C628E0631BA1ACD strijklakens8
804,165,437 *536EB9B36A701B45CA980D0B3733E10F2A48E65C [email protected]
804,165,438 *5361F631CF12227B38313308FE8C8B1100377506 SULPHURIZED
804,165,439 *53688BE553E4E3394CF4DFA52FB595A79D00520D SWUMMUWSES
804,165,440 *536360762717616A07F0CEA4B7B56CA6EB78690B T1;:
804,165,441 *536D75643A6A0583CD5005FE10402D3B140EDAF2 T4X3RONS
804,165,442 *5369959DA80060E753ABC54657B798D7C8538697 andreahenricks
804,165,443 *536F31C514537277B23FFD44D7DD6CDA74A6F6DB TAHS7
804,165,444 *5364ED149A960E49369FC24E350F4A103CCFAE72 [email protected]
804,165,445 *5366B0E5AD51203DE1E407B0FE39A4ADC0438D9A TALK99.253.153.24
804,165,446 *536683AD577C2FAD86297B30AC42DC804F1D6413 TALKJRMEMO1YAHOO.COM
804,165,447 *53646ED1E5B8C8FAE6EA28F8F5C6751728C1DF15 TALKNOSTUB-EXPAND
804,165,448 *53625A06514652A24C0C0A6431119CBCAFEBB82C ANIBAL.ZAYA
804,165,449 *536698DE9DD4151E16A23FC5609F6866A88586D3 TAMQRAH
804,165,450 *536AE4419322BB2F200EE66F3A096F51E79A251C [email protected]
804,165,451 *5364EAEBA9E7945B5D79B83A88712163DC6A3D75 ANYTHINGRETARD
804,165,452 *536FBE52CE23C64891FC7C96D00A723F48CF91CD terenceraygoza
804,165,453 *5368D9299A48E468B969AA928418051E905DAE3C teriesteries
804,165,454 *5361B6C4E06DF23E541D9AC71EF4E9AA17C11C8A [email protected]
804,165,455 *536AC58B4455D5BD17AA5AD29575650FAEBDE10B APUE8
804,165,456 *5367A8B8D5FF51C60DC0DC8DE655C016374D8C75 [email protected]
804,165,457 *536E692E7EC29F936E83AC78CD73E1EC346D0B82 [email protected]
804,165,458 *536449AA7EBA80F02A07DECFEBB252ACB78292C1 the.a.m.
804,165,459 *53668AC2A4160C3B3EF041757FD0648FB99D4F79 THEHEEF
804,165,460 *536D2D39DE09867CE75526ABCCE6DDCC8396DDC5 thelamer43
804,165,461 *536E01F4AB8178CABB36EF8274DE017FCC000CB5 THERESAROCKY0
804,165,462 *536ED61FE7F528D7D9C338F00EDF14B0C4BC49FE ARTHUR JOHNSTON SINGERS
804,165,463 *5365C2EE0AE4D10692225660CEC88B891429C26F ash=5
804,165,464 *5369E9F4ED7A8FAD3F9241405F37D16517659FF6 TOBY.BAGI
804,165,465 *536F867F60FAEC5C20E26D330A7E6A2481548B4F ATZFO
804,165,466 *5360ECDFB945E069ABE3DB2E609A57D4DEBC491F AUBREYHOUSMAN
804,165,467 *536E368C8EE45F29EE1280AF7D1B5A267118D58D au?g2
804,165,468 *5366CB606EBC499580DF55C2E731E446CA6EDD01 A$VFA
804,165,469 *53630EFECF5C61F2C10A2CE342D1DB8C3B2E45E0 TRADUCAO.INTEGRAL
804,165,470 *536F6BB489686CE913560EC6B4E840D043CDF03F TRAGAF-1
804,165,471 *536AF6193C5DBDE4A3B237B592B556E8311C2F69 b\#"
804,165,472 *5361C963A7046091B7A35AA500F7EAFA65EC15A3 b0=!3
804,165,473 *536DAE84B5B502F372799B0CA580598FA495CCA1 tristangemmiti
804,165,474 *5364FFF8AFAA6575CB3C06DAD3DA30B0F42B89CA B(_1
804,165,475 *536A6403D42292CCE7E72BA987CD2BFA35C92442 B3?N-
804,165,476 *5368DE8D4F649C927CAB9315C2CCA608A2C96913 back.to.berth
804,165,477 *5366152074E0448CD7B48A3160DFF46CBA7706C1 baileyquest
804,165,478 *536F626ABCDFA35E3C5C5A86EEF2440057B85660 baldspots,bloodyknuckles
804,165,479 *536F9D54FCE244197467A2E5687983AF3F513A9B ,-ballata,-s-125
804,165,480 *5365F3EBC3EE088E8EAA370185414E288C3202C8 tysonlasher
804,165,481 *5368444AA54D7E40D071305FE59166464C97CA5C ubrhsuep
804,165,482 *53625B4AF474C4D16695AD619304167F8CBDDE8D BARTCHIZMAR
804,165,483 *53634F3178374C622AAAB26DE292109BA68CA6CD BARTON.MUNAR
804,165,484 *536BECED558141CB836C787CDA2D583EF8D51B12 BAŞLAR
804,165,485 *536AF1155B52951A400FC7291ED0C31B86F44166 BBD2
804,165,486 *536A9D2D3F953E243C65DCBE6D3C41478E6FAD5A BC.DUBIOUS
804,165,487 *53637F46119C3AB20A0399E08FA3C79D55072F07 bcvb_
804,165,488 *536E2832A4F97CAA7C864BC114DC264C6F658688 VADER4YOU
804,165,489 *5367672A5E7C915C81E0F154C0E4C74CBEBBEB9F VALENTINEMEINHARDT
804,165,490 *5362906DD32AA360ECE4D1BDBE60757D22B3C54F VALENTINTAWIL
804,165,491 *53684D86A4EFF64657E70AA0650025496431D57E vancehadler
804,165,492 *5363B599D217F66B4692D0CACAEE7D4C6385B2DC berukkolás
804,165,493 *53692C7FBC2AC2EB1A837CA8D8630596A5B5BEE6 VEIJANEN9
804,165,494 *536A62226B5B341A213637824F8ACF3CF97A1884 BH87A
804,165,495 *5363295EA5BA442C3C4480A5B5299E7FE4540EAD VENUS.SIBAYAN
804,165,496 *536D6B76547DEDCF72314DF65F9E5BA2A1467E42 VETYTYIVT
804,165,497 *5369202D5486527D95C0A5B5881C49E657B56975 BIRTHSON3
804,165,498 *53630ABD3FABA1A3FECC7EABD4508537069D6E2E VIKTORIAPAPAJ
804,165,499 *53651AF7843CE17C1A3C29314255D264BB3AA47F blkv
804,165,500 *53607E3582C26901A3EC93FBFF1C3F6AFB433527 VOCFLITO0
804,165,501 *53691E82D88D63D81A280655D6178CAD87F72BF3 B#MI
804,165,502 *53627B47F8E28152E0ED9E7D0883E36BACF7B01F vrlvshlying
804,165,503 *536FA5144C07DFCE20ED74B993054A9173A92054 wag+
804,165,504 *5365AD074FC868E893AE05BCA6D5EE13FDDCCB6C WALK.IN.THE.SHADOWS.(LIVE)
804,165,505 *536E268EB7B3E71465BCC60BA5F1C86247533EC6 BOYKOP
804,165,506 *53600C9B21FDB3BBC7710858BC4B368E29BBE664 B--P~0~o>-B0
804,165,507 *53606291838A37E1AD05FCBFEA29C82C9C6F5B6F BpIb
804,165,508 *5364576642DE1D53991632F4ACB0F6259A569A0D B%POK
804,165,509 *536858FF7AA358170A7BAEC1E0563E93F07F1C4D BRADLYVERO
804,165,510 *53643234D6834FB3AAC6B491CE0771EE44794389 [email protected]
804,165,511 *5362E37EE5FDF1FB45BE44DE21F304F120E87120 BRAUEREI-WEIHENSTEPHAN
804,165,512 *536960B16F0D2AEAE73FC53A8124CA7EB78BBF34 BREEDGES8
804,165,513 *536C50354D3DAE4E6B63B7B0F513D3146561C769 BRETT.JUTRAS
804,165,514 *536F18414BEC0D9744C3C38472C033DAC375540B wesleybarski
804,165,515 *536BCD1A6ADE0E6A39DA86DEEC65CC458696A12A bretttolzmann
804,165,516 *5366CEFF294D87FBA626D272EBA7D5A995D1D380 BRIANNA-BURGARINO
804,165,517 *536E46584C43FE62D2E0F9BD6C192896D886BD57 BRITCHUSES
804,165,518 *536D3CF1944182159DFCFE7E78C326EFFB48CE21 BRkT
804,165,519 *536AF3BD87CD323E575B117F891916BA5DA5CF3F BRYON.RIGGERS
804,165,520 *53681B7586C4BFD1C19E7B06B3847A8F648851C4 BSK
804,165,521 *536A58F10161429658A32707824222D47893FB7A WILLIAM VAN KAATHOVEN
804,165,522 *536E39406AE76260A897CDBA269930A0094DB662 BT5R9
804,165,523 *536AC1FC27CC0F1D6256BBDF8A458DC12262AB9D [email protected]
804,165,524 *5362680B7E600B10D187EF5F7B47032AF38247D8 WM.BREZNAK
804,165,525 *536B7A038FE6D4DD6DF876B78C8673A9F089F4A7 BuE
804,165,526 *5362E0D414E96AF29049C3DD88279092C3D2559E [email protected]
804,165,527 *536CE06E9BA1404839FF2B4D785B89AE6454CC53 WOODROWARAGONI
804,165,528 *5360EBE954E2E3430AFA95906D1A93E09D321DFE WORLD-HARMONICS
804,165,529 *53643FBFB1A4D4C12F081A3F8007B1804FB93410 buqmv
804,165,530 *536C5A5EBB0374F42E8900F60B6B169DE4D136D9 WWW.BUDGETLIFE.COM
804,165,531 *536891B4AE0DF70CB35C51F14241CB5B02037B54 BV2Z
804,165,532 *536F16AC26D190BFF18628FB651810E87EFF0573 {x*aa
804,165,533 *536E82462A8AFE04EF4E85976CFC181C1504EC6B c0isqgi
804,165,534 *536EE44CDF240B446A708FFDB31C63BF41A1BF0D XICACAGE
804,165,535 *5364C6EA934DFAF3EDA95DC12C6A5F56F6C2D2BC C0R5E
804,165,536 *5365CAAFFF068A69840764AF3190ED2982676560 Y117965
804,165,537 *5364F530D311EA6F51266E787380EFA9F1AFA11C c#4o
804,165,538 *53645DB78BD5C0D92CDB8CD7B533333F60DFCA54 YAD KHANAL
804,165,539 *5367A78DE832025D2FC53250C0CC6524E50B0873 yakeiabishop
804,165,540 *53639F3441C3E8CF6D0866C126CC5A6D2DB5D680 YARON-ZIMER
804,165,541 *5364994DB2DE28AE0DE2D18AC9C4E4F143D82969 YELLOVENILORAC
804,165,542 *536EFA719197223284AE8E409109520DF17A50DF CANDIAN
804,165,543 *53678DBF4F938291C7FA7BC34FD49E5D1D984361 caron.donnelly
804,165,544 *536E5CF9D7ACE9C7818365BCB8E5F6CA77FB96AC CARSONKEIRNAN
804,165,545 *536D07BB9A8FCF648152D3510F437D0D5FF105E8 CARTER.SEAVEY
804,165,546 *536FF5A1EB7E6B42B1ACA54C87D46EE37F97B1BD CARVERCORPORATION.COMWWW
804,165,547 *536C8F341BD173F491F1C4EC8F5DB4B5E150E2A9 YUNITA-ARIATI
804,165,548 *536E48715A3067000FFB3F65DA8B5CF3CFB9F8DB yutsmkw3
804,165,549 *536F92AD1B3860F3F666ED12C1B07EB106E881BE zachariah.bison.levinger
804,165,550 *5367A36F1937F8CBEF7047360A4ECF6159C563C9 [email protected]
804,165,551 *536AF74E4DFF761BFC2FC07943C668AA36C15596 CCC6M
804,165,552 *536439CF613A6731750F1BE1D3981CDD513769F2 ZEF.SHYTI
804,165,553 *5363A8AE142B4CA4CDAC8140991208B24FB1544E ZEIRUJDA4
804,165,554 *536EF08232814A081D5F6CACBF7A16941034703F CFEMG
804,165,555 *536242EA49646145755E7826740801A500CC8A37 ZOLLSCHR3
804,165,556 *536544CE72BEEB313C351AF72A9BE17C655265F2 CH-CH.OXIDOREDUCTASES
804,165,557 *5367D36520EA280F25052A9E214D3E585F39D7B3 [email protected]
804,165,558 *536A609D9431258034689916C039EAF0C12B2435 CHEOJIN3
804,165,559 *53604FC03E5E98EB6828FAFAD920CD606777D046 АСПЕРГИЛЛЕЗ
804,165,560 *53630417EEC20E25814AB23E6DABD8756100DC95 CHI.KAHRE
804,165,561 *536345C1DAF0B16F27FCC2395FFFE1BDAE1FD779 CHILBU
804,165,562 *536D7C52F6A8F339C6FF52C041E00C82EE12B560 ДЮВИЯР
804,165,563 *536C24EF3E8C201F77FD5A4AEDD6980121DE1BB0 CHS45855
804,165,564 *53608F2C5BEC85C5D25469220E70F6A5447B938A КАМАРХАТТУ —
804,165,565 *536AC5223F99BFB7F66A406BA6AC87F17BCAA2F6 CIBS&
804,165,566 *536D6A1AC2406F6280E479B23AD31EA5EA0368E3 CJBOH
804,165,567 *536AE2820437FDD282BDFB6F409C3475074C5367 ckxm,
804,165,568 *536F03735C65426228484ED8CBF5EB11556F4256 classicconnollyinwordsandmusic(disc2)
804,165,569 *536EAF746E44A40EFC4D9C8E239DC89C0C999ACE CLIFF.PLAIR
804,165,570 *53690B199E484605A37BFE17929D84EA80BBB4FE CLINTONCORNACCHIO
804,165,571 *5367D4516E23E37D10D552982E19DA41EAAA2A1D clw#n
804,165,572 *536A8D93DB81AA4F2EF69AEEB5034F7B06116257 COLBY.KOHLES
804,165,573 *536B6552BB1323C959C282E48D38E2BB24BC4E5C COLIN1012
804,165,574 *53630B4A5476B863EA4F4DA67473984E6FAC2A4C CON5O1D4+OR5
804,165,575 *53654FB06A66E5B488E6A41F858288CCBB861813 coordinaties
804,165,576 *5360340C8DE11735B271A8DEDCBADD1513241B75 cpa.m
804,165,577 *536861A30EFFF79270D8F35459222C488220BC19 CPS5Y
804,165,578 *536196C4B60E524022DAE4869128410770F4F635 [email protected]
804,165,579 *5362D7DEEE3E9F82352460D8FD2AF0861C790084 CVCB,
804,165,580 *53688A21F27D86DA27C1DF5BF61C893D51B42AF9 c=!w)
804,165,581 *536C7A6B4F517F3C83D8DBF482871B8DE9A1F317 c)=z)
804,165,582 *536B0764EB5D0F6D209078ED5EA29B177DC63C79 d_&&
804,165,583 *536BCE5A98A2AEB72317E88F4A885F03C5F52353 d8$aj
804,165,584 *536740260989CD2F34491B412546A8341D851878 d8ngj
804,165,585 *5364DCA6A75317B5474F1E469ECAB457C1A20517 damosin6
804,165,586 *536A5411284F86C2B897ADE52EDAB88B3C267222 0$73010gca11y
804,165,587 *536940CD4BB5D7F97ACEA8BCFB2D27CEB30AF463 d,arh
804,165,588 *53689A85958BF095D84EE537D8765CCECD40D9DA db-ok
804,165,589 *5366D5D09872DCE605D62A9ABC9D6169FFBD8CFE DEADENERS
804,165,590 *536494F28CDF8811DDCC512B1CBBD533FA5B742B 1616468 alamalleista saatava tietom
804,165,591 *536CC853547752BA509411895EC2F25716024D7A 163127M
804,165,592 *5361426DECF910C5F54B1D0F8915261251CE45DD 165jazlyn
804,165,593 *5360E5B3B81C1F1FC5B48B250B86F1ACD18984A0 18september1142
804,165,594 *536A2782D123D524044DB9BB92C0C847F8C13F65 DERICKSUGERAK
804,165,595 *5360C871CF90DC723506CA1674C1F301DF52761C derrick324
804,165,596 *536177FA4BFED02EDC1BEFCECF0545B0D35C81D2 DESMONDFIASCHETTI
804,165,597 *536BE940BD4BC889AFD323758541D8E50EF4E3F3 1-adactive
804,165,598 *536B635D4110F6A05B91E3F62794F3B83AA1F83A $1AVOHUN
804,165,599 *53640B744856C14406797CEB8750053971A240CA 1backplate
804,165,600 *53633CCCD14B6C60DB58C7AE6E261EA47372FC9F [email protected]
804,165,601 *536639249F10C2FAD38E8CC908540DD66437CCF1 dh5u
804,165,602 *5364827DA7A77FB08C2C5927050EAD5DD19B4CEB 1ERNNENNUNG
804,165,603 *536124AAA0C7ADE18AE93C4BCBEE6F969739ECE1 DICKBENWAY
804,165,604 *536045DA5A11E355B87352D5FF87BC512CF2BED6 1-FRAKTIONS-SPRECHER
804,165,605 *536987B698B00399A1B2413F66FC7E1A1CC7C3D5 DILIGANED
804,165,606 *536BC170D7737D967BB8AEB3ED21926DFA5AFCE2 din!4
804,165,607 *536B09A68A389C9115B8E7F3041D52FF55171FF6 dk2/a
804,165,608 *536A8CC9320B5506AE6185C85176789CD08645AF 1.GESPRAECHANGEBOT
804,165,609 *536F4533FD4059579819579214EB2DE7F65BB154 1GETHLYN
804,165,610 *5360E8D49225AD03CD3D3D7FCD55F8F1EBB6A9C9 1gooddeed
804,165,611 *5368C7A026131BE8813A8E177982D626817BE441 DOHTA
804,165,612 *536FE14C2819B805898342921CAD2D37C0771974 1mahnmalerbauers
804,165,613 *536359DED09FBA154FD5248C03D7212C9D1EECAD 1.MEMP
804,165,614 *536FC0F1F29462FCAF3816BEB2AEEDA9E0DA55DC DO-NOT-BELONG-IN-PAR
804,165,615 *536D4BAA936BCB89F2C50062B3C92E508F8A579C don't.go.all.funny.on.me
804,165,616 *5362AEC09E396490C1734550862461E11A0B1A59 DOOREENJAAG5
804,165,617 *5361ECC2F3B74F36F78DF97518B0E70AB38AB7BE d;pw_
804,165,618 *53637FB9370387230E7F9DA07292CAE393D4C23F DQ;EV
804,165,619 *536DD804F1CBCF46E0BC04486728F66CC4256549 DREW.SIGNORINO
804,165,620 *5367D81975C4BA81EC1A0182388D3CC6A8DDC270 dri=_
804,165,621 *5368F5730C5844706244CEEDC15BB5E8FA58DC45 DT9D
804,165,622 *53615D85F59320C51E76B0F4905F0CBC09A580D1 du9"
804,165,623 *536184EAE2DD0479F2D2B9777AD90CDCE82E3177 [email protected]
804,165,624 *53636DC9A9066A09A58C4168B553F6682EA90200 dunbar's-inspiration
804,165,625 *536C0DA4041689E38B0D2901A1F58F30A001CDD2 1YHDEKS
804,165,626 *5364E7A04C3C7B299918855A2731AAD41E1834A7 2007-09-02:-The-Fillmore-Auditorium,-Denver,-CO,-USA-(disc-2)
804,165,627 *536AA251659579A8130B6CAFCE9DD1A1C87FBD37 D-VU7
804,165,628 *53689E4FE441EE4EE84389FE5A397FC294E2139E dwightkronk
804,165,629 *536BE661AFF90FC8B3544F3A1E4BF526C3B0D50E DwmU
804,165,630 *5363497123565BAAA84774B2273A92CCD30B94D0 ealisaising
804,165,631 *5365AD1AE33BD8700F94ABCFC8C10A836BD03048 20hayoun
804,165,632 *536C0C23BD300FB3503E12430B38906C11D09562 217bronson
804,165,633 *536BF1645DBDAC55E5983B6BB9818EF0200F5BF7 21AZEGLIO
804,165,634 *536A2B4172CA5B7E9E497D19E40E076ADF8C6938 2218215 MUKANA-OLI-20-JOUKKUETTA-.
804,165,635 *536CD164BE91D0245006553E3F1DA2BDC27AAC57 eb+_
804,165,636 *5363DBB0BE13121F78F86FA181AF1208DFC518A5 eb5qb
804,165,637 *53602687FF653775E9282935A8B1978E26D5052D 2407216 "-NUN-FREUEN-WIR-UNS-RIESIG-AUF-DAS-SPIEL-
804,165,638 *536627F13A65FD598B89CD395178AB92585F2810 2408016 im.buergerhaus.steigt.die.prunksitzung.der.sandhasen..
804,165,639 *536B4D6ABA6FD35BA673269CCCF7281C1E4B7B63 edbt
804,165,640 *536A5EE43B86731A937C33B84001C115CF0811E3 EDILSDUM
804,165,641 *536D788F971D084604D6F1C71EF9E8918779BDB1 2626875 NOIN-50-KM-P
804,165,642 *5364E648841D6246A127BBF7D6800BE547291381 29march1762
804,165,643 *5362C58ACB0435DD34670BF1DBF17983085C0AEA 2CARPETDISTRIBUTION
804,165,644 *536AD26D5B59CDEDAD8E936406E9294166ED1C8F 2 DAUERJUVIEL
804,165,645 *5362E60CE1AA1E8A82F62A4A474CAB4546930EDF 2DONNETT
804,165,646 *5361D1EF831F6DC1013442A1276FD0315580993B EFREN.CARRENO
804,165,647 *5368C7A90D461E49CCC6527960F96880D4BC61E2 2huumelaboratorio
804,165,648 *5361A3F8390F890C0CC3FF7402001D5AC834AA41 ei:5u
804,165,649 *53681A5C087B37FE9185F0C14E03BB7977C3DB2A 2-korvillaan
804,165,650 *53664F6F424B642C93E7FB5632FE58DC8A1B16C3 2KOSSONOU
804,165,651 *536E4F5FD3661D5090864D922C4243429938FFDF [email protected]
804,165,652 *5364E4261E9B8902F779C2FDD300D0F4E8D783ED 2UDREJSTE
804,165,653 *5360479BB4544708903A10E916ACA548B3C63F1D ELIASWALLGREN
804,165,654 *536E87C847A825BF74FB244BAAD50FC7CD9F3819 ELINORISTA
804,165,655 *5366363149A53A6C288BADEBDAF89802B15966B0 ELLIOTT.DUROPAN
804,165,656 *536ECA0D7783D62A450A457828B8A1EE84B163FD 3aug1740
804,165,657 *5364F6BDAB969FBE524AEC98EC18C7CB35E8CA6D elmosieler
804,165,658 *536817F75403BC1CF4C5F448043AC0F1C48E8019 ELOY.MUNAR
804,165,659 *536585047B54B16EB394499FE941D345EA64083D eltd_
804,165,660 *536225B1EF669BC0FEE7DFA70A7226F077376B72 3KIMVIVI
804,165,661 *536A2997B80241C3865FEA13533D34808A4B1020 3KUNSTVRIENDEN
804,165,662 *536ABB2DBF53E08B2B566A99ABE116011405AE37 EMILIO.VESPERMAN
804,165,663 *536B27A4534D6AB887DF54950181B014C138FC3D emmittlele
804,165,664 *536234619937C3200A97A68CED49E61350DE4728 3RICA2SEXY
804,165,665 *5361CF3334A2069FC144D9BA4DB2636A02227CCE 427782 PELASTUSLIIVIT.VENEEN.P
804,165,666 *536FC78D11A53918293DC8F9970C533752DE14AF 4:30:00-4:45:15-AM
804,165,667 *5361209249F4B165872B8742120B9CAD1AC73530 4DEHISCO
804,165,668 *53668B15646B7AA4C6535186CAB50A083BC30300 4GOTOMMY
804,165,669 *536635CD7D5966B724F18DCB8D5F12D05D5730B6 EQGK)
804,165,670 *536AE146F112564EA19B2C6B0F7FEF9E27FAAF49 er3m!
804,165,671 *536C5FBA97CA2C4E95AB6E3754458D6F084E3E04 55531 dynaaminenkokoajanmuuttuva
804,165,672 *53668DF3A21843EE6A2587E9FD41BF1290225AE3 ERIC.SHERIDAN
804,165,673 *5363A05858BA2B55830B328F386B0A6036645766 ERIK.REISIN
804,165,674 *53683675FBF988F99C2C8DB5873431D716D026E3 5CLAUDEG
804,165,675 *53656C56AB77DE47F1CFECBB1977D4FEBFBFAA26 5DEILPITLUMTSOP
804,165,676 *5364DE9CD0BA8695570B48ED45CE90684E7B456B 5e6uvu8
804,165,677 *5360CF311AE73BF13D46A68B1AB6C346B7176EB3 errolanawaty
804,165,678 *536EB3191AF2CB3AD862D38AB11F743E49943116 ERVINFRITCHER
804,165,679 *536FAF6594A68C4AF650F7053D19414977B30D39 5INVESTERINGSBEVISERNE
804,165,680 *536A7111C8E665C22C2638928A3EDCC1047E18B0 5july1018
804,165,681 *5365102CF46D6AA4EB6ECD1062DB26653CE0CA66 eswari.siva
804,165,682 *53690B078CE545E02202DE855F48839C578839D1 esziehted
804,165,683 *5360AD7C613A04C2474511312B01BB043DDF2487 5SGOBBERESTE
804,165,684 *53612558557FCB348985E9FCFB7B84AD3CA88ED8 etrrepse1
804,165,685 *53640EB77C918342BB048AEA7757E60D08AC976C ettyeort
804,165,686 *536C762D57B9B13C1E483177788B271D116E7A10 603DEANGELO
804,165,687 *536220090B90DB6F032B3F84AC3467C86CD82189 61673 paljontoteutettujaideoita.
804,165,688 *5367B639C2B030BA5CB8C0C3C729564EE1A3E159 6ABSCHRAEGEND
804,165,689 *53624C583F270784EF4B993979ECBF9F34A308CE 6BSWNKTLBSW
804,165,690 *5369D116EDFB2420E32C951499778C9E9A8B2124 6HANSOLOHACKER
804,165,691 *5360DE1DDF12C8D29544517254DA5623EBD59E24 6HOBBITPEARL
804,165,692 *536A7DD23C3CC7970CC7B6A519484AC25654B7F7 6I?
804,165,693 *53694EE1D79C0CFDDE9C0B5AD318F668D3793EA3 feh-sting-er
804,165,694 *5363D322512C964D2E24F9A8A8771CC64EF00ED3 FEODATORYFEODATORY
804,165,695 *536DFFE6434B37E6BAC73E519363E0A2F82AD799 FERMIN.PLATKO
804,165,696 *536756837B282F9B9D0DB4CE0A0F5DE0A1BD1652 6PERSPICULATIUE
804,165,697 *536E48A1A56A0DE538D27AE5639D9F3046A90F4A FFAMULARE
804,165,698 *536D5250DAB7547BB52309BB96C4922AD3EAF74E 6RIMPIAZZAVO
804,165,699 *53610F95CD175495334CED400AD0D6D531FFD045 6RYHMKOKOUKSE
804,165,700 *53608164B7F72633025D1B4BE8B220B4AF3966EC FI*BAA
804,165,701 *53684EA119638D4E948B1D29307B6688C284B676 FLEVONET6
804,165,702 *536A7C226100D3CC738EEC912B30A6ED8D85B4D4 FLIPJENNIFER
804,165,703 *536F40BE0FC040178C9AA54B47EBB09925108DDA fmp#03
804,165,704 *5366E41A6C753673105C1E38C9F303EDD5850938 fosterbenderman
804,165,705 *53607BA61224C65D99DC70E7E751B4E1B95977B2 FOUNTAINTACOBELL
804,165,706 *536FE96C0563C78D51A8A3413B6FE74ABBAAE7C2 FRANK-TALBOT
804,165,707 *536BD3687A44F4840993B1249B5D483E6AD7A316 7OLIGOPOLISTISK
804,165,708 *536134964C43EBDCCD69992A4BF114F8BA408DD9 7OSTAJIAKIN
804,165,709 *536CE855B57DA39BECBA68E1207DF6A3A409EF3D frederickoertel
804,165,710 *53669617FCBAC8FB09E697F8617BE1FDF7A202D2 frednunoz
804,165,711 *5363E8F4424E3EA55F48E87A718A03C978FE0B53 7SIEGURD
804,165,712 *536DAAAF3C33E9827095040BEDE98754A1A441D5 [email protected]
804,165,713 *536FFFB3774F155E035E3A5AFD14DE85C962A7A8 FUNDEJ
804,165,714 *53658BDF6240DC62B802121252200EE4C256A28F [email protected]
804,165,715 *53619B37D9036D44AD68E40376D87A98BCC9231C G7Q^
804,165,716 *536888E3A1E100B3C9AFE7D1CA9318D9A612642B GABRIEL.VANOUS
804,165,717 *5363D48BBD7CF254CCA33B2821CDE8DEBC2EC6B0 838A2BAC7FE525F788F86B2CFAAE7239-N0C0D3
804,165,718 *53629F84A603C02E2CF09EE28936B5495D8EB3FE GALE.KLOOCK
804,165,719 *53661A9ED56EC75A5BF47893A6E52E94EE8A2437 8ADAMSATURN
804,165,720 *536E304B59C47CAADBAE8B1A9F4361791659DE78 8ALARMNUMMERS
804,165,721 *53674C0E82AF24A9B4CC36FE44695BF9D588735F GARCIAMAH11
804,165,722 *53648AAF1B4FBE5EFCE9F4EF1ECDD51766FC3683 GAYETY
804,165,723 *5368E1F224B8AEEF71CB67287C31F2F91FBF08B7 8gjtu
804,165,724 *53631199A0FB9B0D20D92A6075BDAB951B2C1727 GEMALOVE
804,165,725 *53627561FE118F0409AA12A4FDE5BAEFB554DD99 GEMINUS.'/DZ//E/M/@/N/@/S
804,165,726 *536B31C6DCA92A8786C9FBACF19A7001F8E0B54D [email protected]~osploit
804,165,727 *5369B86A8162A3122FC58432724A7FE2E1EF0E4E GERARDOFRANKE
804,165,728 *5361077FAB0C0E4AD35944DFC95481EB85841B9F GERRY.MOMA
804,165,729 *536AB502A28600F4648B621B00F16EECEDFFA127 GFTZEW
804,165,730 *536BB74430BD00EBF446FB74F728DC535D76C38A GGIRESTING
804,165,731 *536830518A60E4B4A41EF4C193D75319D5C19806 8TSIRADNI
804,165,732 *536AF71BA8527B7661E3EBF15925F52916C3A235 915keagan
804,165,733 *5365B73EB47703A138E8A5B132F826B8C0681671 GLASSJAW449
804,165,734 *5369DE649314D7B2779701DD9D5374353ED8EF8C Go,-Cat,-Go!
804,165,735 *53605C146E442154EAEAD02B64B4F2D46FBA2648 gonzalozumwalt
804,165,736 *5363F58180659713114974F33E4E33346407D7DA GÖTHOVO
804,165,737 *536DB156929B159EB740CE7CC83558E2C9276D18 gradydoussan
804,165,738 *536AFF2F56F5D72CF0644668BF775AB6193EA2D8 GRADYSERASIO
804,165,739 *5365C16B7BCA0B58F86EF05282E50C14FAC71C51 GRAHAM.ARRAMBIDE
804,165,740 *53641B7F7BEE73F7896AFF4FB6E6F89675367EE9 9LASERSERGEI
804,165,741 *536B4CCF1B073D34B82DBBDD262AA8C17BB5C826 GRANVILLE.FINNE
804,165,742 *5360DF0F5F407967DB8849915E83FA54B0D95A68 greebpk666
804,165,743 *536964776F1293270CB693D3233CA2832E24A8BB 9TESTAMENTISSAKIN
804,165,744 *536FE3D8277531EEA7A2DEF8C17050AAA21B419E GUILLERMOMEYETTE
804,165,745 *5362FDF26EE8C5BCF1DB19393BA15100BDC0E977 9wvvtlp
804,165,746 *536D53A75B9278F93AE33606101776D8B053E595 gustavohanes
804,165,747 *5360535E78D223918B93EC029E2FB24273B535AA GUSTAVO.MALLIN
804,165,748 *5362E26A53E2EC80E3CEFAC71100E9C4C920E11C A4A6ETUT
804,165,749 *5360C0AED4AABCCB0BD8880B1C0C71347D63CF1F A4?$K
804,165,750 *536C410A0B69ED94CCAE786DEEF1D3BCE775A19F aa8/a
804,165,751 *5361C3C5C6FB52870D7F1873DCD00D6DA8DF7702 AAAQ.^
804,165,752 *536E64C36322A29C89AA7453C4ECE6BD57F2130F AAB"N-
804,165,753 *536E4E692BA003C1A20F5976BA4DA820544C1BEC AAEK3;
804,165,754 *536408E1925D011FEBF3DF4E2BBF4DD928F18B1A HASSANEISCHENS
804,165,755 *5363BD1877C384663E0FD5A09842796B1FA3BEF1 HATCHING.LITTLE.SNAKES;.SNAKES.CANNIBALIZING.OTHER.SNAKES.
804,165,756 *536ADB264F5CA238D007AE85A0540325BBAAEC3E HBURNETTI
804,165,757 *5362F14170B23C6D62877FDB78AF33CBBCDF9BD3 AAR~F
804,165,758 *536F25EA532F399A9ECCD86026D58B27861226FB heather-hill-duncan
804,165,759 *536C4FDC708933E16915C60F60005BC7A10BFB67 aa=xc
804,165,760 *53624011D73379DF4596D907BC37F0A25C0B57D5 ABELPOLYCARPE
804,165,761 *5367D0A96C4B567520CFBC3B056605EABD07A45F ab;u
804,165,762 *53605858B85EA53D1C4514D1B7B0068D0857351F HIPOLITODELEEUW
804,165,763 *5365583BBE1DBD693172B8F3BFA8B81930023E80 acpj{
804,165,764 *536FB7D9F9BF10BD9F466A4452DAD75944754C63 [email protected]
804,165,765 *53665DF4EA9EFE08A8490373971E1820959049FF hollerin'-the-blues
804,165,766 *5361D26689FED9E554981022A761D7E19BFF8BA4 adolfoslim
804,165,767 *53620FA9EC3B456841A4360C8DFC424792598F2E adr=l
804,165,768 *536E4E7A4BA474E73B7899D7B0F49D1B66CAEC4C afr1
804,165,769 *5362881676CF3575622FC85A564ECFB6B7159798 HTHIOVANY
804,165,770 *5366BBB476EB7D4366177230BD495E506F801A29 HTTPWWWCOMPETENTIED
804,165,771 *536B7E671584BC776066D14F3C135359014827E7 AGFAA
804,165,772 *536CE5CEF0D92D05A44916A85AF79283F36D34E7 AgvK
804,165,773 *5368A14070A05E3B098CC1BCC8654F79D25BE446 humbertomafnas
804,165,774 *536B7713DA8B9FDCA8CB7DF405014798DDA56F1B [email protected]
804,165,775 *5368212D5FEC837956309DFCBD3F1A1BE8E7926F AI/BS
804,165,776 *5360A7961BEA432A28467BCAB72A9058CCAEF63F akdw
804,165,777 *536A28A1AA5CE3A5272CBFBCE86CFE676EBCECFA ALESSANDRO ANTONELLI
804,165,778 *5368073577FC834FC73252DEF8326A84BDBDF094 ALEXANDRHOOPS
804,165,779 *536579E0587420B0C9FC4891DD9C08069D2C60EE I.KNOW.(SLL.REMIX)
804,165,780 *536B83D06BF3C9DD33AD13736151C376308D8190 ILOVEFRITZ35
804,165,781 *536BE38D1F214B84024EED8FEE85E83DEA84E8D4 iloveherman60
804,165,782 *5361490C880636B906AB8AD4CED7F201409DFC99 INCUNABULUM?
804,165,783 *5361805C51AEF68BAC65C68E0081AD9FD38E1829 AMINOMASLENE
804,165,784 *536B1351E384CD404F01250B45EEFB3602C84209 AMMIOSC9
804,165,785 *536869D77D26392DA5D0AE7B7C1D961D65BBE7BA [email protected]
804,165,786 *53699E96D06B843436290000D20E7CB671972FC9 ANDY.CRAZE
804,165,787 *53676312996B102D0C92C443BB08AA7CC83D4595 angellacanilao
804,165,788 *536457A02F5BBD105F04CC091A2EA953E03BB479 anjana.priya
804,165,789 *53626D55A2F70DEEB38FAEDA04E9496B27CA91D3 annunziate
804,165,790 *53669E15E69822AC34A65587A8D4872EBC2B2D22 islipbsw
804,165,791 *536C18DB7CCFB934A5FF9D77364DAFCB9CD6092F ISMAEL.HENDRON
804,165,792 *53602668FC1D971ED64457A6E810297CDF02BE0D ANTONIOKLEINMAN
804,165,793 *536EE9CFD9D1797EB696EE07E36696CA3275D9C3 antonycasimir
804,165,794 *536090C150B2DE8592D2DC149E87499C2A906924 [email protected]
804,165,795 *5360C76D446FCF9727F82C28BE02E19DF0065ECE A%O20
804,165,796 *5365E1F22709ED5143FC33BD33D07218F1CCA6C9 JACKSON.WALLAERT
804,165,797 *53689954E2D09FC0E846F7E25D845E9B4F0D2CEF applicationresources
804,165,798 *536078956CE23961EBB8FC1B3528DBEE3DCBE584 ARB"B
804,165,799 *5365D28B17E41562035C7D163A94BB5A1A5284D7 ARDEN.ZBINDEN
804,165,800 *5369304C4E1BD34CE0A77E5562584533F4676021 JAPIKO
804,165,801 *536F4B999AF6E5AD0F095886A29557499BDE8D3B AREROLOC3
804,165,802 *53699730DC8AE0AB1838DDAC932AFFACC8712EA4 ARIELBANANAS
804,165,803 *536E34ED4885FAB61EB002F71733A85B43C358D8 ARMCHA!RS
804,165,804 *5369AF333DEED22C8ED0C271530064DAC5582A2B jefflanduyt
804,165,805 *5360881315582702DB1EF4A023DE99CE25069034 jeraldcullen
804,165,806 *5362BA7907D7C69F214721B05C3285631B4AF4B3 a:sk
804,165,807 *5361E5271B3F5DBCA768212BE10559A0A2A8872A A&(SU
804,165,808 *536FEA1982CDCBFF429F5594230AE91A939305C0 augusthyacinthe
804,165,809 *5368C31CFD576A7CA3755C90308F0FD38FA6CA1F [email protected]
804,165,810 *5364D53BCBDB9367D56CB5273BC7161CE44EB84F jh#r
804,165,811 *5367C8492E672E537E8EA782C5E2439BC562F4D7 [email protected]
804,165,812 *536BF0980C3638D1E73ECA435DCB5852CB8EAB12 JIMMIE.COPPES
804,165,813 *536DE6FA9E8D04DA0B8EE780B8551DA31269A789 AUID
804,165,814 *536D6CBBAFA526B2ECCE7D6865999816BA9B6509 AURELIO.SAK
804,165,815 *53613A39BB304E850F07CA43AFB3BAF9FC7DF979 AUSTINWOFFORD
804,165,816 *5367D6AC09CC781D2456C15549A7F0B693F9E6A0 jodoformbehandlung
804,165,817 *536880920456E3F116212A990EE612D3F1D48004 JOHN-FERRENTINO
804,165,818 *53692783AC483FB2AB8C407B7052D0A7B1889DDE JOLOKIA1
804,165,819 *5365D6E4F897D06B6A40C36B9CF1387D28758543 AUTUATUA5
804,165,820 *53652B679942A84E1FB5B4935B5233722B46D4D4 AV)P
804,165,821 *53662E4A37BAB0AB62167C90297AE4A377EF8894 JOSUESYLVE
804,165,822 *536AABE1238AE8800ACC2DE887D7FE5073FC6E04 a%wsw
804,165,823 *536275A6B0D5557CE59833238186523366865A61 AYE2C
804,165,824 *5360B21934B09E68D2408ECC47B3512AF5C15156 B0Gu
804,165,825 *536936C3402918C9C247DA9F2F15FD202ECCCC47 >-B0O~0~Q=P
804,165,826 *5361EE1A6EF4773D591565E891A153D9332EC640 JUSTWRITE
804,165,827 *536F72376973137A90398674D82C452E56F8A546 babubhal0
804,165,828 *53672BFBB3D337445CE575CAF78599891C5C9E80 BAESLERJOAN
804,165,829 *536A4C6D594D316C24B6D347ED71A1F0C0033745 [email protected]
804,165,830 *536779700762581A4741DF882FFDE38423EE34D5 BALAZOVA4
804,165,831 *5365E1CD4799816DAE5F5F066B86D7FB5F9891F3 baneshan
804,165,832 *5365F64A6941A36167EF85A93695A81C4293D0EB KEITH.FONTANETTA
804,165,833 *53642E84B4899CE195D3B7741D21FD7C0DD57433 kelly-burger
804,165,834 *5368F13E5C15E5E2A7FE1FDBD83C626D5D36B2ED kelly.hoyland
804,165,835 *536239CFB30685FEF249361E0751FD399E2C2D31 [email protected]
804,165,836 *5367E95E2F88B8CA2C0A6E0B59702D897AA7C421 kernandvanpelt
804,165,837 *536ECA1814D741E11D195B26709D7ED71E83C3EB kevin1helpme
804,165,838 *5369DD69C6FE0D1A5D75135E16916DE12501F577 KIM-BORLAND
804,165,839 *53630A77BEDCCDD3D6B7F40ABC2B51C3D22FA772 b##b.~o~oo->-<
804,165,840 *5361C63EFC5540A02430AF5EFA0023E06B76140F BD4KO
804,165,841 *5368422A3CA4562EB7A099707DE44DDD3878573F [email protected]
804,165,842 *5361B2010FF5184215F762B8F35311DDAA2D3682 konzertsälle
804,165,843 *536D271E0D8CFEA6D0F6AE8F0E7F8FB8C7F46F90 KRISTOPHER.KASPARI
804,165,844 *5361B758034D4862622864BE2ADA87C3A504844E ben-duarte
804,165,845 *536BB3C8D929A2F84203662B0B3EF9C2008A7EAF KUROI GETSUGA
804,165,846 *536B9B580CA995F2F87FDEA8E3DAEAA390C99100 KURWENAL4
804,165,847 *536DA43452B202CCDF9B7563D8118F4516B949FE BERNASCHEKS
804,165,848 *536265684C6CE007189862E5F55792275FA05F30 BERYLLN
804,165,849 *5364B9CE2327ACB31228972F72FC538E32ED7E24 LAHRHUGSWEIER
804,165,850 *536FE70DF366C9930FCFCAFC7F149C16F7401133 BGPA
804,165,851 *5369215410C1640D72134EA5BCB5801B1DC2C612 billniemeyer
804,165,852 *536E8B43AB8491FDA46859FD1A16067AC3377293 LAZAROGRETTER
804,165,853 *536CE3847F03A09785BAAB048464AC4047DCFFCA BISECTING9
804,165,854 *5360D1BC64A2374E96DC3879AB572092C4BE1F84 [email protected]
804,165,855 *5363FF0E1339D80F34135B4DEDD99E619F6ED5E0 b/).k
804,165,856 *53688A0688BD10CA096FA47FEDE85DF31AAC99FC BLAMEITONTHEBOGGIE
804,165,857 *536E4C5B8DB814D28D4ED0BAF79177270653F10C LEOPOLDO.THORMINA
804,165,858 *536BDBD1AF7CEA328C6F17C54E5BF3303610A548 lesbberceaux
804,165,859 *5369B556BCB614D9194D840569DD5EC285DD1BEF LEXIRODGERS
804,165,860 *53679DEA85DA6D9E4ECA34E780209291AF5D0668 [email protected]
804,165,861 *536115914350F0E7554DC558C1D73E1643AAABD7 bolv)
804,165,862 *536060E91F35BCF408267935D2E612B5153AD154 LISBURN25
804,165,863 *536E2B3ABC53C5486A338B52F0ED5D443BA0C166 [email protected]
804,165,864 *5364DD990A898D478BE9E5A9E23CE05BB0513189 B-P-~0~OSPLOIT
804,165,865 *536BCDC2B86CEBC1A2E8E37F591BC7BD291532C4 LOEYDETTIIN
804,165,866 *536BDC4BD5DB6985018C3B16A72BF35921ADE506 LONGMILLIKEN
804,165,867 *536BACB248D9268D2AC58CABB9151703E11373E9 [email protected]
804,165,868 *53677D8950ED20BFF07D77B714FCCA3C076CD2EB BQKK
804,165,869 *5365F48618D1D1C3B89E5645A0DD110BC7D109C6 bransles?
804,165,870 *536F8E0F31B1AFCB73C83D273FDAF6BDB3309A68 LOVELL.BRITTON
804,165,871 *536C0295BBE478B04D63208719FB2C79332DC063 Lovely-Is-She
804,165,872 *536EAF8370201947BF85B46AF8A3420977477132 BRK56
804,165,873 *536D98DCCE97E5576088A4B7E4C26E14DE5F61CF b-rtr
804,165,874 *536EF21911C78833BCD20F5141A5CDA794E1E63C LÜLITUMA
804,165,875 *536200048CCAF8100CDBB30E8A479A00A5C2BFB9 [email protected]
804,165,876 *53640FC5B091803677D30C6850542E61BD92E76D [email protected]
804,165,877 *536F0EF19BFB41600D663960E47E8F94274759A5 lutherchubbuck
804,165,878 *536581B93FF7D5FF9ED0693366869511F4DA3051 BSCHMDN1
804,165,879 *536CAFDFAA947C7953F8FB62173ECB0A256DE5F3 b/tsa
804,165,880 *536C6689151E45D1AAF80828FBE7B2035846B299 [email protected]
804,165,881 *5369C831DD59145B3CE2B0422F9CE2E7DDCAB844 busterbeamesderfer
804,165,882 *53643CA9464ACA299CE161DFEB133B51215E55AD MAK
804,165,883 *5368D0EC5D158F9BF75174CB780D4A672D5F684C man-fi-rule
804,165,884 *536E66EFA17C737718D76367F4A54B4CA8B84879 manilalrt
804,165,885 *53634109B2F2842C3CA2B5D8B3FF6F90BC4DD847 MARCELOCHESS
804,165,886 *536F06478DE6DF80E71A6F795C3376A44000E5A6 b,=#y
804,165,887 *5366A6247D8273E5551C1C7D6021C7836BB764E6 bypb8
804,165,888 *5361F1EB9E7B09FC36C5D8B05767FEBD06E1208D B(YZN
804,165,889 *536E61E904007FFE02F4A91921A851D9F8ACCF19 MARION.KENNAUGH
804,165,890 *5369961F9DFAC339960296AE01882ED639D6F288 mariska-rall
804,165,891 *536859EAD2E916ADD94E04294AC745713EA3D2BC C3H+W
804,165,892 *5364D184C8D01AE7231E1E861AB08C6F2403C54A c5qe6
804,165,893 *53693584359EB1FF5341760D8EFA194A4444173E MASSKI1
804,165,894 *5363B4E1B43B1C7CFA19D44414FC70FB74F928AE [email protected]
804,165,895 *5364AA6536CEAE029231787D6A97B13B69A65E41 [email protected]
804,165,896 *5362E157C6EC4962A7EF395BABFF86E24B5C5C80 canadianinsidercomcanadianinsider
804,165,897 *5361523ED27E1CD4DA90E2C9FED99F1326CD55EB [email protected]
804,165,898 *536906E6AB9520FD692BD1B1E751EC849814EDCA careymenhennett
804,165,899 *536AD3BC48CC064841740BBC0E60C684735F5809 mercado23
804,165,900 *536C0FF7DAC0F9BBC01E62AB59384A27F64A1251 CARMELO.RAISBECK
804,165,901 *5367ABE7E01AE147B67EBBAEE8C286F72092C8B4 caroline g
804,165,902 *53617A5155DE9578EBE4BA520A8B47C0E53A9AEA MHENSLEY2
804,165,903 *536727580002D95755913845901891E8C9AFC3E3 MICHALE.SHARRARD
804,165,904 *536DCF7AF50665FFE5084174B9A4077FEF04AAA2 caseysbdc6
804,165,905 *5361D55C7A4B10F24537970AE7232CD5C31EB80A CASSAIGNELA
804,165,906 *5364092C938E8945DA6C7BDF7C3DEDD745ADB7F3 CAUTARII123
804,165,907 *53665B83538993925AEC8F8FAA7E0BE38842E554 CBALHAM
804,165,908 *536C1D032B0A16B44D8085BFEE55F661704A6AA9 CCDSS
804,165,909 *536DE79B2ADCBEEB4055EAAC50DA3ABD0FB2DB8E cd$=8
804,165,910 *536FBC79CF2CF13257AC4EDF04054CED2DB00D32 MILLARFRANCIE
804,165,911 *5362E0266397EB5CFE38EB00938E26F25BB30623 MIRIAMBOYKIN
804,165,912 *53652437191C8047E83D1B0F10E6ECDDEA3FC5AE MITHILA ZAMAN
804,165,913 *5366BAF51B9F5157ED24322D8656E877E353BFE3 ch=-.
804,165,914 *53684A490CA0805DE338DEB7D1C6FAC2D5BF0237 challenge58
804,165,915 *536ECC0D067DC2D2678EA73CD64F97A9B9AC138F MMING
804,165,916 *536592E2632B8F1EA9612FA5274F362DC17E6DFD charliegloe
804,165,917 *536626137011831DB6EA981886A32C74A2874DE2 CHAYRIS7
804,165,918 *53699F50DB258835ABEDBD9233A131B34E89BAAA chengdubladesindex
804,165,919 *536CD6AEE1F6FF12BDE334C8FDF174AC99F8FF7F [email protected]
804,165,920 *536ECCFE4805F3EC66E61955B2608F039F83C063 montyjonah
804,165,921 *53618E6AFDB5C4B5A6281D05DDD72AFE1C61AA13 MOOAOUN
804,165,922 *53650CFF264545209FE30404B3E503C1DC267EE5 CHET.TERAULT
804,165,923 *536B9C9B02C31DF71C7344F678C295FFC6DE7A6B mortonack
804,165,924 *536189F2920A6E463B87BF426747967B64B18218 MOSE.MCGAHEN
804,165,925 *536934BEEFE720F217FDCC4E82DD35DAA2EC3FB4 children of the ghetto (remix)
804,165,926 *53647E9772345C7B1A5E76E5197583F26EDACCFC chrisorochi
804,165,927 *536B352A0B95FC7036DCA4008FD13648D98E35FA mq;i
804,165,928 *5363FDB7EC361657BAC47ABC1ED2892FB3F0D7F1 münzeinnahmen
804,165,929 *536A65C19EA01A5437F581987B65E8B3B33F748C myletmein67
804,165,930 *536983DFAFE16A4CC30E85B69B60C9883113FE1D classicsthe
804,165,931 *536F996595FC2D687DE0C9743E603B54EEED0864 claytonksiazek
804,165,932 *536495F96755043ABF9923DE014F875D1B312258 N3DSTIG
804,165,933 *5363DFD1F783393E3F060B4EF0B8AD18FBF7144A CLEVELAND.KLEINER
804,165,934 *5363DC01678B86D81E20C629B45A7119D441F535 na8t
804,165,935 *5362999C4AA13D2F6374C88D179123BED7A90A7C NAGESYNCHRONISEERD2
804,165,936 *536BE65F2384A2C2E6D55FBB8898DC073E55EA99 clintwaletzko
804,165,937 *5361DC89079985BA2A983646D1A89DCAB8F96C7D NATALIEMCVEY
804,165,938 *536BF6E422AF2E21965D4E43654134E1A65C87F1 navirgo intacta
804,165,939 *53659F55CADB628F4FAA90607E3CB1C851FA882D cnfb9
804,165,940 *5368132B98D24315149D0CA85978E3E3F398D324 CNNDRMSSING
804,165,941 *5364556A76E9E427D7F4EF9265881C12C947200D NEDOLOZENIM
804,165,942 *5365BF44BE5339A58AEF3C8B2D11F438E941D460 CORTEZ.HUTCHCROFT
804,165,943 *53629FC3184DE6108B1F0228147D2CC3ECA95B21 NM_001779
804,165,944 *53684219E52AA3A610D45096055B78B4D4E7F40D COUNTERPOTENCY
804,165,945 *5367EDFB2283B3F45D26AD15EF4D4312CAC30E7F norrisalley
804,165,946 *536F83CFEB878A6AA07C4FF7ACF07693A237D9D5 NOT]
804,165,947 *536935ADEDAB3E045ACF05FCD54CBCEA79739DC8 O=(~
804,165,948 *53646E10D74655A2D50C5242B65F45B7AA51235B oatmealrussell
804,165,949 *53653D1C0C792A5DCC1D7034CF81F99C13CB0085 csa1+
804,165,950 *536D863E252D70476418AB807728C1843CDDACA2 OLIVERPLAN
804,165,951 *5360CB4107319D7AF71D244BE482ADCD5149D1C4 OLNROOD
804,165,952 *536F6E228AAD2EDC37ECB4DB643B9A9548076D81 OneShot,TwoShots
804,165,953 *53667C02E0B9FAA66B4CEBA2CF0F1196F2570F3F [email protected]
804,165,954 *536AF7B7CB26D50C96DB5DDABBDE81B06A9CEA25 c_uyv
804,165,955 *536F8457DDDB6287CBEB09C0BED34054C37BB1B7 ORICHALCH
804,165,956 *53610C1746B869712C8B34FCB8CFA8B20CEB8F70 ORLANDOMASI
804,165,957 *536F9DFE6F70900C70A76798208153325C7422E7 OSCAR.WOLFRAM
804,165,958 *536088A8B994D418B4DE2099F7722BAB704D9E7C CYANOAUR9
804,165,959 *5365F041A1EDACE888203390028F51566ACFF277 [email protected]
804,165,960 *536E37D8C4D3A2A4CF0DD0BA58A77ED74DA1628F cz6rw
804,165,961 *536A994889F93F13FD17CD7887AB83DE8D3ECF9F d3pfd
804,165,962 *5362C41E435D0910F154B38A091BAD2208FCD8DC P4SM4C3SS3IS
804,165,963 *536BFFDFD730AB63111AFDEFAD02F93914482ABA damnify
804,165,964 *536A0D48F124AD83F8A5C103715805D83BAE34BF PALMER.SHORTS
804,165,965 *536C7BEE1A91086FFF64E127C68BE11FFEF62A94 DANIELMASSIE
804,165,966 *536D4E0846C7D3F8A2AE8A00987795312476F25F PARISTAPESUIT
804,165,967 *536DFB1796D56176DC4C2276090BBF7C38661FE3 PASSIFLORAWEBSITE
804,165,968 *536702F77E1FC63021DC5CEB73ABF893F73E7343 daymneznat
804,165,969 *5363ED9C63F488282EEFF112C55998A4A2F88022 dc34d
804,165,970 *536B902363F9F7F1273E9037F914E22ADD04F61E PETEREBBETT
804,165,971 *5360794A95CE3F6CFF7ECBDF5FEF8877C3B5A2DC PETER.STROPLE
804,165,972 *53647F192F257B2370771DB0BB94A59183C3D178 dd2&z
804,165,973 *536E8DBBF646633E7BFA3F7B6CF24D3FCA0D8722 ph070c0pers
804,165,974 *536D619B1A4E2B8BE1C248BDC6D2C05CC9C99393 PK3XZYRU
804,165,975 *536AB16C59BD09D595BC1C0E200F1A879F74DB2F ploy054644496
804,165,976 *5365B868F223F65439E2C1A55E413EE712DFB6A2 DEEPIKARANJAN
804,165,977 *5369BB6A908F5D3FCFCA339D6998522183A4C50B portugalengland
804,165,978 *53694BB5E2508911DECDAD6146540221D54E4AD5 precipice.of.ice
804,165,979 *536A6A33D1283E7C8FD89A0D7F08C256278800D0 derrickrepke
804,165,980 *5364DA824B86EE710E1DEC8E867CC1F9837FDBFF PremonitionsBoyTheReality
804,165,981 *536019D2953E51F00947378B357D076641A88BE9 deskrone0
804,165,982 *53677E425D166236010FC5C27A1E25DB981B8C10 DESSAISISSE2
804,165,983 *5365C5537DB5A6246079E1C9EC96C52CAA1A7894 deweykanish
804,165,984 *536CD9EC7A248D31F2A1F17DC1783821CBDAAB30 df4pu
804,165,985 *536293A8C9F5AA2D084814DC281E9C1C2B265A94 PROJET A7
804,165,986 *53612BCCD2137F5432326162C6A5E0BA4511406C PSTANDBERRY
804,165,987 *53666A0EEE9A85B1D7757C2649D1CF396966C31A PTARRIELA
804,165,988 *53685B3B1E895C26DBD8461D0261CC703145BF3D D==$H
804,165,989 *5365CF125F49E4F0737B537558F8F68391278CC0 dialectlevelldiffusion
804,165,990 *536F0395C6601C87E8EC8B8F3D6AD06CB0AA5B69 [email protected]
804,165,991 *536BFE94EE6C11A50D706EAC541EAFB32B8228EC [email protected]
804,165,992 *536B1DDD11EAD4E7C5B57D6C22A36B00DC9E8D49 q=====d~`(>_<)
804,165,993 *536931C62324C945E39050EC60C3DA9A22A189E0 DISC.06..TRACK.80..THE.COLOUR.OF.MAGIC
804,165,994 *536AFFD0B433C115B7F66EB81E4F9F06720866C5 D"JRC
804,165,995 *536D233D97E9257A8121ED8536BDB8A6BB5FEA80 dl-5n
804,165,996 *5361144B8365BC6CCD74A5458929C6EF67D872F4 dleihsre
804,165,997 *536C622C024EBA7218DFA0A906DC5FCAFEDDBC11 d'lvrrs
804,165,998 *53695B74EF08441479E64BED81CDA45776D972BB DNUOFERING
804,165,999 *536AEC1F75426CBDDD873E2E3DE7A6C41DE29238 R8$P
804,166,000 *53632DB65689C5E614F0AE2C175A79350A0D52EA RAJ RAJPARA
804,166,001 *536AB9238C9CD81ED059B0E5C9CF26CB2D24861B RAMIREZ.BANDA
804,166,002 *5362CC38412D741FC4A65F032AF637A661BFA981 donndilling
804,166,003 *53636162C6F9CE9C1E5275E0487930D6A8542F0F DONOVAN-WATKINS
804,166,004 *5367145CCB9A24FF5499B23BD043CF7BFD9752E8 raphaelarnoldy
804,166,005 *536C3FA79B7BE3458E323775C6BB38D0D18AF570 RATKAISEVIMPINA
804,166,006 *5360FA70C3DEA3C037C6E98711DFDE1B177059E0 DOU:E
804,166,007 *536C3912CC53FDF70274EE658A3705354572C1F3 doyoumissnewyork?
804,166,008 *536EBFCDCE2178EB2C57DCA2B0B830EED2678C7A REAIDATES
804,166,009 *53600A7E48765C498C3736231A4A8A06BAC26050 REBAGGE4
804,166,010 *536158D73E6E77804FD50B4D8F07AA39C696DE0F dshi-
804,166,011 *536D901540482B730744FE9EEBDE173529B28989 DTRRS
804,166,012 *536D27B38A41055A0EDE372FFB8AC1C9C3BC98EB dudleysantaella
804,166,013 *536F3FC0463F87D0D6704701ADE20B423F0DD70A duig#
804,166,014 *536CDFB2D5A37D41236C7D5819A4EF48F6D8308D REMMODKYSEGNUL
804,166,015 *5362D869CECFAC00F47F7DC054BB56D55F1850CD respireriez?
804,166,016 *5360BE59934642D788E8B54E2E6D471665E61C4F rexbritts
804,166,017 *536073AE687FA3C6251424714CFC424DF439A86A RHIZOTAXY8
804,166,018 *536F53CEA223524D6E077C0FE47A35006FE6465C RHYTHM(DEVOTEDTOTHEARTOFMOVINGBUTTS)
804,166,019 *5369E8CC29A87C26B6867719F7D3FE875735EAD5 RICHA-LOVE
804,166,020 *5360FDB11F5DE3ECAE7B06C06554354D1DEAF4E0 richbussinger
804,166,021 *5365D1BA9388014C65C6DD90D1645F501C64D4ED DYS=7
804,166,022 *53680296F54FA3B0ED4D4B893588AE7697D49DE9 RIFORMAS+7E
804,166,023 *536AFDA2021DEDEA0ABDACA159B143D31C534A00 eaovn
804,166,024 *5365A19307CA40E7D399FA6902562411C9E4B288 RIZOBIOS
804,166,025 *53656FEDB8970E54CEC5C1B42F9CA1FF330D303F ROBBIEPRESTONING
804,166,026 *536F51183068E155ED736D8D56E2EADCFF8D64EA EDGAR.ROSARIO
804,166,027 *5365FC99448614F0ABF523732829E78E49CFDE68 RODNEYKOLOSKY
804,166,028 *536B0ADAA569B92FFBD6F84E8D70CEEA870B2BD3 rodrickjellings
804,166,029 *53659254DC1FDE5EAFF1591FE4F569670D109EEE EDWARDLITT
804,166,030 *53633546F75CAA407E86E052E7C4140BEA00E030 EDWIN.FALAH
804,166,031 *5365D4B328DDB86F71B57639E5EE4FC052B50093 EDYODER
804,166,032 *536AEF9A4A141984C89F5EDA3D54D581924B04F6 rolandcarrao
804,166,033 *536C689518E2F9DA1B80ACBA0B1DDFAFCC5DDC0A efre.
804,166,034 *53627C6CC6E3EDF76DF67F22D8F37509A1DDD322 rosariozaiss
804,166,035 *536DB43D386D0E47D81884FB3B69AD8624D89DAE ROSENDO.MORRA
804,166,036 *536073C60911DFB483C80E9A4A07289EE92EB4CE EIN-RATTIGER-EINSATZ
804,166,037 *5366673FB2E65D3E60D81D8AC33FD4FB4DA9C4CC eld/o
804,166,038 *53650CCBC20402DA84F4236AB16B9057ADA3647D ELIKAY
804,166,039 *536C665B52CE6134E0104AB5195399E8AD192F99 elkevuod4
804,166,040 *536ADDE2C2426A9137B49F86E2B0FD10E2D99A84 RUNOH
804,166,041 *5369D919D99F453836F74B19FE6CEB7B4DB74A7F RUSELLS8
804,166,042 *5360B43F23E41F1A00234CF2ACC89C3D879F67EF RWARUBF
804,166,043 *5363982FBF0CEC8F8AE4D219BEA4210F389F2534 ELWOODJIANG
804,166,044 *53644881B51FF3059F5E86E19D2CF8EFFDE311E1 RYYDEIST1
804,166,045 *536AA08590035F7E2FBA04C900BA101A1F1095AC S45297
804,166,046 *536EE1F1318A9475CA3FFE38B7F77EA644C66974 SABRINACFJ8
804,166,047 *536443E6EF8A824054C7BA8685717E8A3A5F2210 emersontumminia
804,166,048 *536FFB13A9438EFDB2818969E17EE9CD97E11B1B SAL.ARIANO
804,166,049 *5361652BDB8C689E81CC3D3EA1DA88740F5A2E1D EMILIO.ELLINGTON
804,166,050 *5362B585A1E3869565D7C9BAC0D46A58ADFE4D4C SALVADOR.BAGI
804,166,051 *536EF33EAA9C8CC8FB02743C9733D33F26CCCE50 SAMMAHOMLY
804,166,052 *5361F30A7B2CB5306E1D5679BE801C5E1F4A4F65 sammyluncsford
804,166,053 *5360EA9D6BEE460365979894F3112AC99A714E5B ENDURERONS5
804,166,054 *536F7EF155531FE22F4CA68D450A74BE57297772 SANTASPORTIA
804,166,055 *536CEE7555BE2AD598F55B397185487B42CEF4B5 SAUL.BOULET
804,166,056 *53600B053D6037A75D68EDF9FB967B307DCF03E3 ENTEROCENTESIS?
804,166,057 *53634DB1E46BD2D68E9640058C8380090B42D856 SCHREAWE6
804,166,058 *5369CEDE2EC3D4865BB2C4A62A138B6F2561D070 scottienanton
804,166,059 *536EA20252AB7FCED874CC27D1F4FB26F1B71846 SEBASTIANTOVES
804,166,060 *5363173ABF9E6A58F7853BE79C65F8E3ABC507A9 ERITTAU
804,166,061 *5367394C23903C4B4674B1E7FB9C40F67AFF9E9A eromrevi
804,166,062 *5365261B9B52C8287EFD51A46E33C6E4106B1E87 ESTIMERONS9
804,166,063 *536E260322F25C8EEFDA47BD405281A824864870 SEZICEARG0
804,166,064 *536BFABDE268D350969D041F45F1AC5E19D25EB8 EUERWYK0
804,166,065 *5366D04A746D250C15620CEB582404476B33F941 SHAESKINNER
804,166,066 *536B9111B4D5A04C55F9B5B683B41E2B3E420F47 shaunballinger
804,166,067 *53608E638ED1CF4DC72BBE05A72915374FE12F6C exceptionculturelle&traficd'armes
804,166,068 *536FA5FAA016371676B7CEBA8A893C001BDE81C1 shirleyehorn
804,166,069 *5364AD00C0AC575B5A31A9813ED2B208A2232DF3 shirley.falls
804,166,070 *5363E98B93F935819278192BA3F818C1F314395F FABIAN.DAYLEY
804,166,071 *5368FF34D0DF589C9701C1E1A4149CA63B062604 FABIANZABBO
804,166,072 *536A2581075D8B42911DE0A93ED0217E878F6440 show-us-more-of-you-(immer-mehr)
804,166,073 *5362A2E5FB6CBC7741042F01534B470732163CE6 faith039
804,166,074 *536F8F4EE23ECB96CA6106758904DCE39FB540A1 FARINA
804,166,075 *536FD8B5E3915B8B8704BB929C080DC32F88CE60 SIGNIFLCANCE8
804,166,076 *53613422C06AF585C92E0DE94B41E22F2D83832F SIJFELEN7
804,166,077 *536C334493D5CDB0A52F7B1DC622D71012FF6CD2 SIMAZIR1
804,166,078 *53641321A9577F7F0AFA06BA8A55AEB0C068EBCD FEARFACTOR96
804,166,079 *5365E3142448F94025E88FA66543BC4020C1495C FELTON.ADEN
804,166,080 *536943F716DCBAE3B954991451D036504030301F siridión
804,166,081 *536C84BFC79EC3EAF7814B6A7E3D46FE5E6F5570 [email protected]
804,166,082 *53693D694D3DD125C87ABA4D09F0E5750DC9DFF0 [email protected]
804,166,083 *536A432B6878C23F6E842CF4CC561394123BD6FF SKINNYCOSMOSED
804,166,084 *536103BD133C3629FC85B96DA24EA9FB918B944C [email protected]
804,166,085 *5360A55F5F67287696E0F04AC5A3C97A89CC58D7 SLAPENSLAPENS
804,166,086 *536ACF7864B287AD1C7CFBD159B5C41B502E3CD0 FIKA-LESMANA
804,166,087 *5362EC047CD147E27E6B76332EB55774A2504C4D FILMESELIVROSETC
804,166,088 *536F9BDF9C55A052B1B1EECAADC1CA2387172855 FINISHEDSYMPHONY(DEADSETPLAYNIFTYREMIX)
804,166,089 *536644E0E35214FB3815228CEEEDFFBB9CAC8255 floydisaacson
804,166,090 *536CA4FED62C4E2BB3F5229EA72F3CF0DF8E3039 sokaojq4
804,166,091 *536EB84616EF62D7A65550557DC0E4AA41163078 soniadouriezh
804,166,092 *5364FF68AE0FEEC0D84DA2D992E530293CE3C135 STEGALSVA
804,166,093 *5362EFF322E8291965B127741769313302EF8090 freshthymesoupcomwww
804,166,094 *536451FB476A85B8D2BE9F8370A2C7B2389B35D0 FRICTIONNIEZ
804,166,095 *53601368BF7A307285E498B4CD3DE9C7BE894909 STEVENSONRUFUS
804,166,096 *536A01B9922FF7DEBF619234779D8FD467B4DFDF stifftail
804,166,097 *536BABACC426958815D16ECDAB0B563866524308 STPHEN_DAVIS
804,166,098 *5361F6C36927AC9C59EF765A8C8D4247E5FBBD3A g1ad1!3s+
804,166,099 *5361B303813F81DE254A0DEAF93CB4EE3683857F [email protected]
804,166,100 *5365477036DFAD93E4929C50405206689F3C0127 GAITÊ
804,166,101 *53626CD9FD870574B2B47D091C12CAC3ED0349D7 sunnyred1
804,166,102 *536EEEC8D6CA9075E7AAA19A85020A844BF63F29 superpanel
804,166,103 *536EAB6897172244067E779B3B954B1D89F7C6A5 gautier.20.0
804,166,104 *536FF8B41A6C5E3D7765CE0720C998F2C2380285 gc1v
804,166,105 *536CD6DF3A4A18D115CB11F61E30F88DF4E782C2 GEBULT!
804,166,106 *536D3A7507064865F19AC5BF765C2C3C00F56991 genarocones
804,166,107 *536C12E21D80D7E184F07AEBA90666A064680802 GENAROWOLKOWSKI
804,166,108 *536DED589B53EB22D325D0C69E1D51525217B56F GERALDGRAU
804,166,109 *536FBFB3D6633443B792B4216FA60989444675D6 GERALDHARTJEN
804,166,110 *536702A5F0BB92056EF3889A7D8CF1869BBCD25A [email protected]
804,166,111 *536EAFB475A62DBEC5B6640C537C7BACE7ECB4F7 TAKEPETER
804,166,112 *53661FF87EE5D1934BF96C8EFE63B1377FC95EC0 GETYOURASSTOCLEVELAND
804,166,113 *536D502BD1C84760D6F642BCBB4E5CA08E7CA4A5 TALKBUTBUTBUT
804,166,114 *536F54BCA96EAA4854326D96AE23AC8B9DF66EAE TALKMRHECK24
804,166,115 *536433898B1E87874495392CD0458A9D7D4C5796 TANELORC2
804,166,116 *5366E3E22BF1D39DEF9513A11CFC656B59F2CAEA [email protected]
804,166,117 *53689F8BA730A98E68F5A6483437B8F6816A1C3B TANGOLATES-M
804,166,118 *536926CACEB970A71798AB65A4488171DED0F4E3 [email protected]
804,166,119 *53647B919CC63F1F156444B1C3B6C948995D71D8 GLAUCOCH8
804,166,120 *5361420AACE5B33DBF8B2CB24EEA7BDE05A98D9E ted.ambrose
804,166,121 *53610E7A9BA247F85D91A7CA333126DBB1CDCC93 GNEISNAU6
804,166,122 *5360E1C019B4FD6B7FABCBF603313B3A09247C6C terrellcastellaneta
804,166,123 *5362FE689B432D8C809B3EBC626FA2BBB6CA79F1 TERRELL.GERSTLE
804,166,124 *5366C14931EB0FF992A5F7608D41F79F5C3301EB TERRELLSMUTZLER
804,166,125 *5368F30A6826C63001F978C8F8B1A3502684BE32 gocianos
804,166,126 *53663DEC572D2E8AB4D7E9814D31F29A4D4CC1E8 gorseiksīts
804,166,127 *536334071081852713EB15F1DF3DB73A97E8AC30 THANHKNACK
804,166,128 *5369FCF2A143F0D084477489889975486FE0553F THE.COAT.AND.PANTS.DO.ALL.THE.WORK
804,166,129 *5368FB76FE5057DE43520708E64421C2AC142034 The-hard-way
804,166,130 *53695DA2E1EECA0AAC4B6D3C4CD3620837168C06 thehongkong70
804,166,131 *53695E4F503B819CF15328425D435DB560800DBB GUCCIVAL2
804,166,132 *536C2D33CF9B6E4CB52F5C47A03D11473D4F97D9 guus32
804,166,133 *53640EDB3AF1F16C974C47EF593E7B13E386AF7A TIGERPENTIUM
804,166,134 *5363233193AA0DBBE0E3AAB1317701BA3F8F779F GYERE,-CS
804,166,135 *536D8EF07EDE1B93BA9F8F7012714D102504595B TIMMYLARSON
804,166,136 *536EACB3A641BDA55AF4A50C52CB97A3061FA3A1 [email protected]
804,166,137 *536482BC89712A47B6848AB5CA364754534123BD TKGYGGHL75
804,166,138 *536CF3E6C043E732C60F51C77BEAC9ECF0951B09 [email protected]
804,166,139 *536B8967BF4A092F18FACE918C856C6CE03741BD todpeden
804,166,140 *5363848CAD71B6AC1DA9EA309C702025C6ECAC4F TODRAKERS
804,166,141 *53604076146BA59C5C0FAA522C836A52F4BAB905 TOMMIEFECK
804,166,142 *5362795FC0EBA0B11B103C5D85FF54972219933F TONIA-FELTNER
804,166,143 *5365943E5F78410FF343C656E0585C9E64B50DBB TONY MIZE
804,166,144 *53666804561F9B0B795AEC3E91B15BCE6F5A5F8B harveymeech
804,166,145 *5369365B561D81652EF5B06886C548D49FB9AE58 HASEEB.MOHSIN
804,166,146 *536AC2A004C5C82F099FD959A2A51DDAE8A06709 HATKINZ
804,166,147 *5360BA5EEEBF62EBECD53E7A2CD67C4335FE3ECE Heaven'sDecent(Earthboundmix)
804,166,148 *5360A1BDFDB252A0DB98F1212C01BA0654268E62 HELLONITSKNEES
804,166,149 *5366333364DDCA70D99D248A66758462CC734FF6 HERMAN.NEBAREZ
804,166,150 *536965B3F2E89D81174CA608007E47B59FC7ECC9 TRWBRDN4
804,166,151 *5366A54876CBBF0E84A7280D906A1AF0421427DD TUAN.NICHELL
804,166,152 *53617C2A97E28A67F5F40F521C75EF10E8D0B2F9 tudiefinkgrant
804,166,153 *536ADD849BC9A849B47867D3BF2ACE913D799655 tuolumned
804,166,154 *5360DA40CB96DD9FBA1F716B3A129808A337CD17 [email protected]
804,166,155 *53694E78A28BE0026660427F2C18560C4CCD36E6 tyandrino
804,166,156 *536F9150EFAC218A7F2509B7E58C9E1C5232E2BE TYASIA-STEMMONS
804,166,157 *5365EB27E1FCE77BB4377B6EF58FC883008016C2 HILDISTADA
804,166,158 *536E3819CD3B432C64397B86FD1E7011E720EB15 HILTONBURTTRAM
804,166,159 *53612293F8F019C50CE18B53D14490B7B15AE7A0 TYPISCHT!
804,166,160 *5361828F4B3F0F514EA9C30F2D8FD2045BF63932 tyrese33
804,166,161 *5363AB889C6A48CFD9422C8C70BF0B18ED5C39F3 U)8)
804,166,162 *536F544A2D3E0901C5D3EB8904DDC1AB0B35D2B7 UDEILDR5
804,166,163 *53635F70629C52EC1B551CBC06DE1EA593DCD0E5 HONG.PINEO
804,166,164 *5362B264E8918682E19364D40FDBEEE89E933FD9 HONG.PURDUM
804,166,165 *536B51CE7EE0615A433C0DE06035E376B86C84A9 UKAMAKAANIEDOBE
804,166,166 *5364EEFE57E308F384A0E469690700F8D1C7ABBA ulta
804,166,167 *53685D1B643E93689A01F15740F334A44EB860B8 [email protected]
804,166,168 *536BE975C64BD127EBD2337D4C36DA7A221C9F8B [email protected]
804,166,169 *536C54547CF80CC796794CE5432E1A7FCB8946B8 [email protected]
804,166,170 *53619582CD0281EA066047A4CE2CB31921F103D9 htrpocration
804,166,171 *536470958BDD9AEE8309F9A6D1ABFFA91E076C6E UNADV1SAB111TY
804,166,172 *5369EAD94E41DE5D5DC1344C933C569599542CF8 unassistedeye;retina
804,166,173 *5362678E936008BFF0215A772DF779256C45A88D UNBR3ATH3
804,166,174 *5366A4BD285F56F2F5C631FB806B7D00C767359E UNDELETED
804,166,175 *53679B0F9D5CF0E3A5020EC59FA30E438945F787 UNDERMUNDSPROTESERNESED
804,166,176 *536CCB8526C816883AAE12CFF2E2A8E2CF28C290 URBDHQPMSLRAF9
804,166,177 *53673CEB90D11471C6D1409C440CD2738726BA23 ICECREAMTEDDY1
804,166,178 *536FE2CED2A637239A2608835068B97181170BAE iepriekšejā
804,166,179 *536D4C599B88E1A8D3B6536D905DDE68C5894726 ILADAED
804,166,180 *536DF36FF1528158D3746C1BE59C83AC769656EB ILBKTNAYA
804,166,181 *53645E3E9AF98D82021FDFC99D50FDCF0C6C268D ILOVERENEE87
804,166,182 *536C2279CF7E3B8038A27C9EBB8D81385C475D8E VANNPHILIPS
804,166,183 *536D753F8D195104569E83CC0E132BED3DF5397E v-aroundcampus
804,166,184 *5368C3747AA28BF2987BD39E4A863E98C6F11402 [email protected]
804,166,185 *5360A6A7A9D63A3D61DCE7011FAEF6A1FC334F30 VECTORCARDIOGRAPHY3
804,166,186 *5366F68AC36570D1158D9024E54A0C99545872D6 I'MNOTSCARED
804,166,187 *5362B383894C1C7531365FF4C0F0A15E269A4F2C [email protected]
804,166,188 *53634FC91C1B15D2A8431D2127953425CE1DCE25 vhaneilao
804,166,189 *5366698C39CC2D16C6F47D735709E19C5895EC96 in.command.4
804,166,190 *5366981F909A3FDDDBEABD0F9FF6D33E4658E56A [email protected]
804,166,191 *536907A9B925F117119730F41300BD32CC0D87FA inozzarab
804,166,192 *536A9815168A2D98A8E26C45D2A3390F167C8D0D VINCENZO.KNUEPPEL
804,166,193 *5361449EFCBD21114F721B7C30F08D7C0245F7E0 i|oz
804,166,194 *536A0DB3B4BDD547D5E05895F6FC4837B638F25B IQUINATE0
804,166,195 *536E1195CEAE9FAA7156D05C17B116B44EB6FB92 irtip
804,166,196 *5363F76135C7362A35F70262832FB5424B38ED88 vivalapontok
804,166,197 *536AACEBBAA54BF2F696D47B3B071BAD9574B8F5 VLC-CODED
804,166,198 *536111AACA458F1CDC24B02F1090AC043073A4AE vorgegebenen
804,166,199 *536256B85FE59D8D5BA8AAA8B3AB820BF7769717 VRPCHTNGGED
804,166,200 *536CCFCCFDB3A9E083D2DD3D5AA143945FBC8CDF IVORYELROD
804,166,201 *536FFC544505C3E016F5FFB80C633815A9C3530A vw=aa
804,166,202 *536092603022609CDD23FA59A0BE66250D8D9C4A J4W
804,166,203 *53669D54ED4AA779E7492B5C9C721A92829CF067 jaelyn.martinez
804,166,204 *5367CC99ED549E3F768F552929AB050A37B19229 [email protected]
804,166,205 *5362E4C326C4452E82F07441D4FE851759A917A3 [email protected]
804,166,206 *536B485F4CBEB3CFB1623A47392752581576A241 wapstac3
804,166,207 *53656CD91E06494C48AFFE8DC4CA86351A97922D JAMES.CA
804,166,208 *5369E971072AE84593A434B750B794414C24B766 jamisonbense
804,166,209 *53641AE88215557766E9086027F08A0E83AFA20A waynewhippo
804,166,210 *5367064535B0482C407047B7696D03B5AB387FA0 weltladendachverband
804,166,211 *536CC9A6A7FC12932C36F4D5E065B1332D336CB6 JASPER.HIGH
804,166,212 *53617678432897D73CFF68078DAC1E4FFB27CCB4 [email protected]
804,166,213 *5364F32EFA1C8E801784F9B74561F0CA91689D08 JAZZINTHECHARTS054(1940)
804,166,214 *536C43E05A0882A0A514DB5DC5155CBF5505FB78 WILBERT.MANDERSCHEID
804,166,215 *536FB4640B78648DA85AA5AABB8B79E39ADF4FCE wilcoxi4
804,166,216 *536351A4B4FDCBD07A59320D1139C93CFF51BD59 JESSE.BIGGIO
804,166,217 *5364F4E592A076C187C7CBF2B74661B38C97FED5 WILTONBHANDARI
804,166,218 *536427B235BB101458C6D4B0A7B37CB15324D23E WINDSWEPTMILE
804,166,219 *5362890835B13E4C0E9371B08CAA4CC3DDF642C5 WINSTONBYOUS
804,166,220 *5365A3EA9913A9BD68BBAC4BC6EC122C59C7568F WITHORWITHOUTBUNS
804,166,221 *53647B8AE91790D1F971CFB4BD0BAAC0480D9A19 WITTHAYA.PHUTTHARAKSA
804,166,222 *5368EC5EF8BE59B70165435FDCE0BF07642A58E8 WOALS94
804,166,223 *53634554012443FF9B0BD545A9F2970F102B60D2 wolwag
804,166,224 *5366B9C61F43687D44869230E8106E856239FBD6 [email protected]
804,166,225 *536074CCF08E948A359118CD05F67355F35497CC joesphlipham
804,166,226 *53644501159A19403018081523DD199D616C1F42 JOHNEBOLI
804,166,227 *536FB04A8363792FD372C1E478ED71A5692B0262 WWWBLENDER3DARCHITECTCOM
804,166,228 *536D67117A56E34F4927B38464EFFE85F50CFDB2 WWWLEGGSCOM
804,166,229 *536B8C51CED5E082747D90F8C75934A02577C652 WWWMAGICDILIGENCECOM
804,166,230 *5369EFDCA7F9411CE61B8B0C70D2625761AE1256 WWWWSEHINFO
804,166,231 *5365CD3A927C642F11B6494CC14F5F1A7E236768 JONATHONGUYON
804,166,232 *536FBE4C938AFBC953A9E03167241D8D5882A2AE JOSEPH.DISHMAN
804,166,233 *5364397C64753DD343B9E028961835B1DC292597 xavierclaucherty
804,166,234 *5361FD2050A7DB855500D11EBC00311BE4C4BBA1 XIUYUANXIE
804,166,235 *5362608252B089E954D388550F8F58863921DF77 [email protected]
804,166,236 *536CAC4EC41BF2815C5B896969A79FB7BC93DCD3 judymcknight
804,166,237 *53630CDC1FCCD08EA571D4616036254E1EC3D2F8 X*W$
804,166,238 *5366F198FA167049956B3D23EAF4C3815AEFF858 k<,a
804,166,239 *536B223FCB58BD5CAA8EC969851F2CEFDC6EE60C kannibaal!
804,166,240 *5367BAC99715B18F08CFC8289CE561FE4291DD68 [email protected]
804,166,241 *53684CA4136379BEF083C5711A89D9F35AA3E049 [email protected]
804,166,242 *536CEDA61EED5F6C8C4EAE8DA16759F5092B0E02 YLSSELEMAN7
804,166,243 *53618585D3D92B7DE9F49371A4FFFC1D276659A0 ynohpomoh
804,166,244 *5363481C9DF5CD115B606A18662D46ACECBF75BD YONG-NICOLE
804,166,245 *53628E3EE4448D2F97AC181BEB27718D49807927 [email protected]
804,166,246 *5361446EEB9C86C2F93F186273A25B75A8A8902E [email protected]
804,166,247 *536A83A646C2691893CB5C593A06B0F750E939D2 KERNEREAKTOR?
804,166,248 *536EDC34571ECAE9A8841550CF329F44A0EA5F75 KIARABILL5
804,166,249 *5367FF42EC2FF479B346850E54751D91D2A1AD66 ZAIRONYABES
804,166,250 *53691898C6E7990194922F344DD6C577D668F712 kipowered
804,166,251 *5363EF1522D3104415B1461A42BD8178E88FBEC6 zcgn
804,166,252 *536F86638DB157542D254A58E0A0FBEABEFC6635 ZEREUGALB7
804,166,253 *5361875E3D5C6ADF38B8461C76E1CA116AB2D49E [email protected]
804,166,254 *536F7C1BD552FB459C7F6844040F528C67AA38BE ziarmal-sultani
804,166,255 *536B95DFABC423C563BA2D268CA8B58779575C86 ZINTIBPHPGT0
804,166,256 *5360C6CF40D5FBDBBBE240128E9A52827B46DAAC [email protected]
804,166,257 *536B134653900A8728A1E6BA2A3F25AFC94C77ED ZNOWU-W-NOC
804,166,258 *536729F6F7B89E86287947FE28F632D81899133A zoaelle6
804,166,259 *53669CDCCED2218C8FC1DDB6DFEC51EE672BBC75 KKHU
804,166,260 *536BFD9D7688A5402D53BC0077F3A82C35E92279 KOMENTATORI 1
804,166,261 *5363908CE5772A8D58E0396888479CBCB3C308F7 ΤΟΥΡΙΣΤΙΚΆ
804,166,262 *5367A2BEAC0B7E5139662545DD35D8B4F2B586E3 вайсброта
804,166,263 *53658A4E6A6A441502E1A10365C30833E77E1030 krigstid5
804,166,264 *5360FCB95707EBB63DFA920C8E45F3D5E45CC176 KRISTI-PALMER
804,166,265 *536D61C841676C788AB810C6993BBD54ACCE7438 KRISTOFER.DESADIER
804,166,266 *5363A660CA3896C2E84D2D5E67020E19B2158220 KURDISHARAB
804,166,267 *536CDAECE7809A68AA2B003A90DA440526A196D6 kurkjian20
804,166,268 *5369B08256DB590CBA30ABBDAD36BB5D3C1DD726 KURTISBOTWIN
804,166,269 *5368EAAB7C461C486493EEA45EA82546F811B372 kurtusuck
804,166,270 *5362B7675A2CC6AA32501FB0871A5EB26894A9E2 KYLESMINE
804,166,271 *536ED2CA71E34827720C7EB71635FF0DEFDC74B3 KYOTO(AUTUMNLEAVES)
804,166,272 *5367AD239CBDCA2D563EA0EDAF877586A33420DA незар
804,166,273 *536B24299EE48DFE05444AFCBDC84F1676691EB3 УАЙЛДЕРА»
804,166,274 *53620DA9E7792ABCB193F2FE6E812202F2E8EE02 LAUREN.TRELL
804,166,275 *53693074E4A10BB252428C37C9792575485A15EA 価格についてはコアシステムと同様であるため、上記のxbox
804,166,276 *53627924502B8B4A1BB4192547729B8E0E4F046A LEHARPD79
804,166,277 *536D446356F315591CA5C93370C7DEF4BA75CBBB lesarroyos
804,166,278 *5366F7C12B5E3EDFB54730F4E63A937801A4ED4B LEŠNU
804,166,279 *536D92D3C63C16A8B17B3DCC6BE9708DEB94758B lesternixion
804,166,280 *536E6A1B3C0F4EBEF60BE6DC7A171B59E9ED8E2F [email protected]
804,166,281 *53645A5633B555247976FA8D5BE6713F71FC9FBC [email protected]
804,166,282 *5360DA5951E6F7F828DBF9E6059B035CB237FD9C LINOCANTLOW
804,166,283 *53693F30BE852A962821FB4F91BBDBDFCDB3DABD lionelreola
804,166,284 *536D342CA7E7F57BA133EB265CEBE9198E91F71D LIVE @ PENELOPE
804,166,285 *536F3FFB199B6749CEC370BFABD80080ED3EDFD2 LONGBLACK
804,166,286 *5364A4D02FB7D18EEC5E3F1FCC3568BFE5BDB401 LORENZO.BENOIST
804,166,287 *536833F67F53AAA93CFF4CF1254F2D68C2765221 lorethea
804,166,288 *5366775D543A8F15935159146BBA0317A8BEA3CC [email protected]#$%^&
804,166,289 *5368BDA6A6E86B7A11A5CE9F395961263DDA3FF6 lustres
804,166,290 *536D31CE0C2D8462D82CE6E521BF4BAEF361B2EB LYKK
804,166,291 *536B6D47A7E89DDBA090BA1EA54EB6FBD87699F2 [email protected]
804,166,292 *53617F7F0E1ABDC5990ED3137A4E80F6AB2C53D3 M5FLNG
804,166,293 *53631A1EB8AA1091AF847BF9788132E2B6F18B44 金鐘(admiralty)駅
804,166,294 *53664F3F70C4F39D803DB5712C966416983B2BE5 MARCELO.VAUTRIN
804,166,295 *53694214EE8CD9EC77E7C204E0485F4E0A4A05B5 MARCHES
804,166,296 *5368D7192ED3FA52584FA30317F516552A1C1DC0 MARKTLÄRM
804,166,297 *5363EE603DF7F2B0A8F21A97D59FC9A754A899AF MARY.MONDOUX
804,166,298 *536A7859144A8A934A7FAADF13791D3F00CE1908 matthew-guberman
804,166,299 *5369A8765A4347C2242F890D7D01C4C8A7578641 maureen-regier
804,166,300 *5366E3485529CD99453607C8547FCB59F474182C MAURO.BREAUX
804,166,301 *5366A1DD8564125DE044D1F34EBA406D5056F6FE maynardebbers
804,166,302 *53614FD58055FBD94A7579ED7CD1611185D43D57 [email protected]
804,166,303 *536DDEC07643417A959203121258A09375377934 MEETILU
804,166,304 *536DBB354EDF1BF4B979A9C32B48D7C77093017A michelgioriano
804,166,305 *5362EF8C637CF970D15FD950A9232AB661DA0F5C MICRO50
804,166,306 *5367C2A56C6F2C25CA0EEC255C4292A928734225 MinistryofSound:TheChilloutSession2002(disc1)
804,166,307 *53648CF743424D4CEE5C9EC5DA68BA885C2554EB MONTPELIERVT
804,166,308 *536CD75DDA254C9666BF5902F197EF938468CD45 [email protected]
804,166,309 *536308E6B98113BC81F3853F18E05F2A9439F11E motsetse3
804,166,310 *5363F003CD4ED1699074DD7CA5D12411F785C04E mudneicaf
804,166,311 *53688E82ACA65633CBF0D5EBA60562698579EE82 NDEZMACGREGOR
804,166,312 *5364324B8FFBF6365EEB36FD5B5F61CB57FA7428 1167725 MAIJA-POHTI-MY
804,166,313 *5364BFCBE76949DA5A6B64C031C9408C489F0C2C NESCIUS6
804,166,314 *53662EB3448ACCBBE4C7369930CE38BC73B12A6D 14-11-1520
804,166,315 *536D8B7A9FDC280EADF9EEC14F0CBEFCF9D39C55 NKYVINE4
804,166,316 *536849EB3D41D45C0E74BCD747CEF1B34C6BC153 NTEYZ
804,166,317 *53696C550FC3ED96E6B603C0C6B6421A34A25C73 [email protected]$M
804,166,318 *536F5D3D16A22C66FC674F818B7FCBD96141952B OBKROCIM2
804,166,319 *536D34C24CCDE81811B5CD0FC56E577131DA638E 1JNILIIS
804,166,320 *5365D80493665C5A1FB6A2DE19793C80025F290D OHDANISH
804,166,321 *536BFC34BD325A0B5A41A7561BB30A1A869CC050 omerbraham
804,166,322 *536D0E9A95AAE7CFCA3DA9A72F02D1F364D5D581 omšenskej
804,166,323 *536D366FE20FD7AAA3FEBBF8C4B282CA87378F5E OPIATEDS8
804,166,324 *5369F4DE547DF82CEAFACADF8AA96E850058C0FB (o_)~.qp
804,166,325 *536133DDB2D7FD478EFC08EBF187A213990706E1 ORCHESTRALLY2
804,166,326 *536C16D9BD50683C3C0CEBE9A3B6AFA72B16803D 259629 i.thought.we.must.have.hit.something..
804,166,327 *5368D3BDC6A09BC07B6DB41C13A9E07A0E645032 2933621 LIPINSKIWIRDWOHLDOCHAUF2002WARTENMUESSEN
804,166,328 *536E26DF44AD1C9C955B44317F12DBC49277ECE9 PAULFWALSHCOMPAULFWALSH
804,166,329 *536A5773B665882017058B4DBF7EE6063825A550 [email protected]
804,166,330 *536EAF92E18A58302C2A525BEBF0074725114E74 2ILTEFISH
804,166,331 *5363886196A2811BC5CCBB3CF8DAC40C2FA9E600 2JFTTBSW
804,166,332 *5361CCC2358FBB3C20E0352BCC728D67F7897217 PGESICKI
804,166,333 *5367C85BD64AF54B548EA88391BF116B6F9E4FDA PHILIP.KISINGER
804,166,334 *5366A11079D53E3956B3CD0C77225F87F34AB94A PHIL.MANSKER
804,166,335 *536830793760C4F3CDD5501EF280084026258DCA [email protected]
804,166,336 *5361353C7A481BF0648B949CAB9EE95ED5A4C50F 3 GROUPINCLUDING
804,166,337 *536B85551C8D23A4B862518CDC66B7114A2D6858 PORSHA CARTER
804,166,338 *53603402473A960AE8CE5AF097FD788E2FE01ABD POSEERDE3
804,166,339 *53678784C25B4E9EDE6FF66C64464E2B3A07763B 4HOBASHIR
804,166,340 *5362D33F09F5BCA0E70EB2225AC07899E4DDADE7 4KLAGARMYNDIGHETERS
804,166,341 *536854FBC277ED056EF5078AB8E3D87D4873D8D5 4ROPINGSUNSET
804,166,342 *5365C327BF254F63E244E15AEB04E74ED184569B 5CONRADBIGMAN
804,166,343 *5364FB2E2B7654916DF26F5CD611FAB01BB4519A 5HUONEKRPSEN
804,166,344 *536C162150286C56BAC99708995ACB578044FCE8 Q====>*.*:P
804,166,345 *5367A9B872D28E6C719E5E7D8AD6BBA0F809B70C Q====P`~{X}
804,166,346 *53672CD7A4948A18C05D1BBABE43155676B2B6A7 5-TIEFKUEHLGERAETE
804,166,347 *536DBE655FFD18AC56AD6EC5BB866465169CF600 5ZYSKSTN3DTV
804,166,348 *5362D6B9EA3B82D4B69B9CAE9B1E7CCA51BB93C8 6emmerich
804,166,349 *536333A5A23802F0DAEE294FA44401F57A44312B RATSDOKUMENT
804,166,350 *53664BD18B3AFF627AA74D049978004CC1DBC5F1 RAUL.REALI
804,166,351 *536DBAC6B95E162F225645AC7693C0EF7954C8A0 6GRANTHEIDI
804,166,352 *53669ED27E12B56D292E5D02FAF288BC5C4D9916 6NESBITTDRUMS
804,166,353 *536371C6B4917E6F6E24C5568FE50537B9EC823E 6RIIPAISEVAN
804,166,354 *5368887D0F645BD246D65C68476419CF847A7915 redhollies
804,166,355 *5360A17C37265B3A85E2B4A5C355548FD18DECA2 6UNREITERABLEA
804,166,356 *53601EB78882E74977CDE9917CD01A2F64D3BA62 REID.MCCLENTON
804,166,357 *536C1B32603A5399D009870E94E78AFB0B2EF8E8 relabel1ng
804,166,358 *53682BFE7706F886F1022BB4B5377DA0EF186DB3 RETUGTEMESTERER
804,166,359 *5364D9699A635214BA988F0B2033054CBA0B0297 7NETSROKREV
804,166,360 *53672FEF8990EA499871EFA44483B921C8A1D250 RICHIEZIOLA
804,166,361 *5360A40865EB830D6A92BD4D7B46D0C92642D8F8 7symptosis
804,166,362 *536661FC143FF1786E3C7F20814678C6A1B349BE 8grondeigendom
804,166,363 *536A43BEBB45DAABF65F88372BE6AC7CBF4B3A6A 8POISSONMARKO
804,166,364 *536F75946DFF4CC2ABF160E484F502DC46D05F9B 8SUOJAUTUMAAN
804,166,365 *536D51BC0D91D5F72242B1AB0F484C41335A0CD0 RUCKTRITT
804,166,366 *53683A43911589F73F8A2D434F176C2674BA8894 RUEBEN.SKIBA
804,166,367 *536AE7D5838C6F7A147A8501D32D02D89A044128 990BETHANY
804,166,368 *5362558F49597BD0BB52AF94A3B33DBDCA11F5FB RYSTHINTOJA6
804,166,369 *5360A821946979DD9175005AB452F3D52E2B5197 9DF835FB338930DC898F2A95C4692715
804,166,370 *53638FC2EA4C19CD9FCA79181214CC7F9E82576A 9OLLILALL
804,166,371 *536344BE6CE7B0EA55958BB9A334E48E86431C98 saturday.night.in.tokyo
804,166,372 *5367D3FEB7714AA14B85DF23B4A02504339BD252 a)2o
804,166,373 *5369FF9E2ABC05C548C26A9EB9BB9A54D84D5070 A7mG
804,166,374 *536B56FE400F976FAEE88034281AA5AC40369E60 a7-pu
804,166,375 *536EF169F5737C01C5EC8834EA3CB4D3FE9FE454 AAAQ9
804,166,376 *536E7D8F6FFC482543055D0FA08EE967FA793D0A AAB#JL
804,166,377 *536C527F585A037D7BF8AFBF5CE112A38DB3D3C8 selina.strauss
804,166,378 *536DF94A2D253AF4422C7D241EB3200FA8804C4B semajay7
804,166,379 *536678C43DCE326609713EAB5AB8163AC2E84DBA seuqityd
804,166,380 *5367F6CAABFDE6C9398391C5E21727606B70088A ABRETLIF4
804,166,381 *536D1EC9B8DAF1D85FEE007ADD69177E46BBEA8C [email protected]
804,166,382 *536F7BF6B0241B33920612E6B69BC0FEC622E8D0 A!F
804,166,383 *5363BE1917FDE302E5FC60EE01FA8E4880A13F23 A_GI
804,166,384 *53670594716AD9A7DB93C360632840E6840C3EC9 AK26O
804,166,385 *536A9EADA7DA3049D260C69267D0694F1D5A3E81 alartxe
804,166,386 *5367453217F134FD511332A9A083C317FA763858 SOVRUMANIS6
804,166,387 *5364E54A9859481115597F2E1D88C262482AF581 SPLAT~ ~ ~ @###3
804,166,388 *536C977244395E187F5F8CBA8B0A99F4066CABD7 AN9B
804,166,389 *536564428BDACAC7CF0118F5ACEB0CCCF3EE8D3A State-(Fabio-Paras-remix)
804,166,390 *536D8BA372FD6045B42807FEB99AFDF1B5C7A23A ANDALUSE1
804,166,391 *536245E35FF6B7DB86760DFE8CD6D336A7B00145 a)per
804,166,392 *5365A7D0EA58669D86DE123F9F99D48BE856811E [email protected]
804,166,393 *5360369C6FAD711F812450A4AED750CD6B752039 a-q47
804,166,394 *5364905BC08B1ABB90A3E4D0691ADB74E984BB8E arnulfoosuna
804,166,395 *5364DEBFD2E6BA02DCBE848B925DBFB245883E1D ASHIKPATEL
804,166,396 *5368DBDEE3B803CBC20F2F30FFB33EA0BDBC8815 talktmarklo2
804,166,397 *536A8D8FC97E0AECF95E9F7C1006FED89D3DA34E TALKVANCARVER
804,166,398 *536688F3D6EA34BCCD577F07B3799704F56246A9 TAMQRAH
804,166,399 *53644DF710E1FF9818BC01B40583BD5982F4366B TANNERCHIARMONTE
804,166,400 *536D1140B56114F4D93227F5B9F5C09024883904 TAPZ360YAHOO.COMYAHO
804,166,401 *5366535689F3234EAAC047B2A8B47A7E3FB687EB A/TKN
804,166,402 *5369BA13AE4F6391FCDA01C605B4E3B30AFC68F1 telemidicine
804,166,403 *536940E9FBC79E81CD1857E969AA9356B5A05B1F TERRYMEGGETT
804,166,404 *536FE1806316DC0D36547D645CAD5187EE1DD9B4 THATMOLSON40
804,166,405 *536F73EC039CE0088B333FEF8ACCDFA6340C3532 >b0~ ~(#p
804,166,406 *53669E2A0314277B05A94038635D6CF12A989F08 b5xc"
804,166,407 *536C4E9D9B822B5B737B785494B35B809A122FE4 b"a;g
804,166,408 *536435E0DF2AA0E55F208E68ADDA72C418C83960 TICAMARUME
804,166,409 *53661B2694305F736669DB61383BCDE301CDF9A2 BAVARIAN
804,166,410 *5361D9D2C14D3C88359C98406489DC57DDDFACBE TOBIAS.KILE
804,166,411 *5369556AC7529848EC83C9E183F543100F5764AE B"_B4
804,166,412 *53621C8E1D3680ED449D2CE6CE5D6986DBF308B9 TOM.DOLAN
804,166,413 *536A019DBB531C7C872AE0308339762D8DD6D0D8 trans''but
804,166,414 *5362217D5A8278ADF4D7D30870FB7B06E781CA8E TRMNSTCS
804,166,415 *5366F511FFBAF4AA39B4A76FF674BDBC22BE5D3D trombone-dixie-(stereo-backing-track)
804,166,416 *5363CAEAEF44470BF09126B80B93F28C631FC5A6 TYLER.TOUSOM
804,166,417 *536B252B3D7F6B41C332F6DC83169A9F9626B926 TYMPANALS3
804,166,418 *53625E8369727EDE8633BF0FDB89E4C0C2D26516 bh9)e
804,166,419 *536D818E3014D80C57954086C7F7841C753493E7 bh,ia
804,166,420 *5366BDD0FBA18A3ADB338BEDE6C83FC683F48272 BIPRESSRELEASES
804,166,421 *536BA7B1170080D0AE8D0A73880651CCA269823D [email protected]
804,166,422 *5367F165E1E3AB2625ACA85829DEFEAF969E2DCD B?KV(
804,166,423 *53681CE2CB267648A17A526E3E90893D810C11D7 [email protected]
804,166,424 *5364EECD00A3C6D46F62FA53EF7EF2CE19E51E87 bmuwo
804,166,425 *5368BA28C4EC5A7D0CC19F672B074979E3A8C780 [email protected]
804,166,426 *536E67530C9A3E581659CE88BBC803924429E8BB b&nic
804,166,427 *5366B820F7DDD8C1698E92654EA2866C39347B0C vadende$
804,166,428 *5368B5B468A19F78AA5CC6EC5F1E454936C9425B BOPHELO-BAKA
804,166,429 *53684C6290D2837F0A5D28B7FE626F06AEBB1132 vancehoglen
804,166,430 *53603088A2E47FB76FCFB90524B14E0FDCBC7C5F bowl389
804,166,431 *536C7302E38B84DEB1F30367401A2863741CDBFB vaughnanidi
804,166,432 *536DD51D98D606B465CC42D2569E9E995820E8A6 BQKK
804,166,433 *5366D21432763BDD396FA217232EADE76F8E2C8F VENETIAGARY
804,166,434 *53611A32F5956C112D06B50C37E46B80585C1DC2 breckbus
804,166,435 *536B26667C949654E564E13FB8E19C8F3DED484F BRETHARTTITLEHISTORY
804,166,436 *536FFE8ADE5FA4A2F71B991C0EE7B6F1B926F48B BRITTBOGREN
804,166,437 *5363CC0F522491A380C008349DA017005325A288 bswgrdriver
804,166,438 *536C55C2AFD2A5E6415DF19E106E1AA85EEE6DE9 C5)WR
804,166,439 *536B52D53B8E96AB5575355303ACA49D18E7B8E6 [email protected]
804,166,440 *5368AA5A7EDF2B1161B82A8042615E015C9093E6 [email protected]
804,166,441 *53628F174E3B8115CC3B2FCA2EFFED96BAB879CF CAPITULOSDE
804,166,442 *5360542BF218E25550EDEDC3D039B7153FE2C9CE CARACÍDEOS
804,166,443 *5361CB987979C109BEBEB283C0E453BBA6223D18 WESLEEPINTHEOCEAN
804,166,444 *536E99CFEAA99143EF5B53C6C3376AD6F2B8F4E2 whomso0
804,166,445 *536724D5A66F38741C44898F7AA71F6C42FEEFB6 ccof
804,166,446 *5361F412F0C30CABA43ABEE71BBB17B4DDC4E90F williamszoumis
804,166,447 *536BD9497A72CEC82F225CC2BC4C6B8B9BBFD245 CESK&
804,166,448 *536D78AE16CCEB72DE1F227FF284742A9C11D5C6 CHARLIEMOODY
804,166,449 *536AE8139078FBB57F433AB15AA128EE4A224E23 CHUCKY.&.FRAUENARZT
804,166,450 *53631A78B8C4BEBA8092D1B13ACEEC41A09FB4BB xebero
804,166,451 *5369249447BFBB70043DE3097A714F2AC4F62156 CLINT.RUDEEN
804,166,452 *53697812A7637E8D924B7B26B45E75ADB54444DA [email protected]
804,166,453 *53668871D83F14D2E9C34F00D8E9BF786A27ACA6 ClvX
804,166,454 *53636C56D06F9EAE1347A90D843959DF273A2BC2 COME.GET.IT.(LIVE.420)
804,166,455 *536383CA43B48AF9B2B4D9DA54CFA5C2F42519D1 COMMISSION
804,166,456 *536F91F182F6734A5BD1D6C185C9F2B1F1FEBE66 [email protected]
804,166,457 *536CCA833CCD02552BE6222ECC564F0004023F1C context1
804,166,458 *536441A49F3ADD9E85B3AC61D162D7100FB652E8 cooper-chen
804,166,459 *536D01FECE908E4D44AC44DA09AFFF61FD2C312C yerffejerawten
804,166,460 *536F92C34DD5C5EA012630EFB0FFD10791B3341A [email protected]
804,166,461 *536C898CB47FE3E107B524D70F8BFCFFDAD5DE65 YEW WEI JUN
804,166,462 *5364829FD18014299891B4285CEC43D0C7B2C287 corzp
804,166,463 *5362D059DF86AA1DDA0E47232A3D550383FBCBC3 [email protected]+3$
804,166,464 *536B1EA744F776D11ACCA452087756CD5C5C8C84 YULOUISG
804,166,465 *536140756A1571F7733FADE00A61C976B15FB2A9 [email protected]
804,166,466 *53666C18944E451AD5A74B22A47F1A9C6AE0FD67 YUWADEEYODKUN
804,166,467 *536D1171F80892F3B47B441140EF6D1D24E2426C CUTYDUCKS1
804,166,468 *5368AEBC2F79D232319583E020D2803E581FB442 [email protected]
804,166,469 *5361FF491DFEC62BE824724DE037682B54CAF616 ZERREISSENDER
804,166,470 *536B39EF9AAE10C6DFB4B5D3A9B66BD88C914659 [email protected]
804,166,471 *536FB834382266CCDFC0A74F9ABC068327C6CB6E CZOTU
804,166,472 *536A89738C0FEA5AB9BE47AA432D3B0DB5FE82EE zxcvbjustin
804,166,473 *536551E0C2E3022983B65228D07B12CD9BE50996 DAEHFOOG6
804,166,474 *5360E26A6A178E030F91CFA31FBC4D6494EADD25 ΣΕΒΊΖΟΝΤΕΣ
804,166,475 *536A788A6AD3778E1D4CCE8DBCA745B62DF4F8A7 DALTON.GORMAN
804,166,476 *5366EAFA6CE38D2955F4A06A47C71D9A3E4838BE DANE.SPENCE
804,166,477 *5366552690EF6F711E3416AF0268508E9DD00D5B darinpour
804,166,478 *53618BB530296B99FED35E530194BBC0D066867B ХЕЛВАРТ
804,166,479 *53696DDE31AAB42FACB6F38908EB5F858DA92E6B dcv(r
804,166,480 *53625C64FCA1B701EF523C278C6DFA364C35D265 11: 11 # & SIXTEENTH
804,166,481 *53690A3C7FA958EAD3CA2D9AEE367D52D0DDE3C4 1128240 ACCENTURELLA TY
804,166,482 *536FDEB2AB3556AEF4215E1473EE393856756067 12:12-#-&SOB
804,166,483 *536D9F5AB4BE7A1467A6AD5AFAB6CC7925070BC3 diosesamor20
804,166,484 *536E1B55055D571D6C7C173A3B6EB6157289D82E DIPLOMATENOLDTIMER2
804,166,485 *536B1A6A8079B48BE1ED5D97D20C427B5429ED1C D+KD!
804,166,486 *536617D1966AE1DA3180B2424E5E29327006FE36 1924732 savun-h
804,166,487 *536B976CCA27D31E6117E2F0661C390C452A50C9 1928recordings
804,166,488 *5367348EC64F390016FD8B52992FA47A4CD4DB45 DMSOCEAN
804,166,489 *53606D56700637765C6E1BDCE27BA02DAF76BFF8 1-BRUCE-SPRINGSTEEN-KONZERT
804,166,490 *53648AAC2C77B8334C27F2D72FE9E11B97000312 1CVPSTADTLISTE
804,166,491 *5368061697CFEE9EB2482F671A997736E10354AD dnurgizt7
804,166,492 *536370A9681958829C3D52A11B8F0EB34939D257 1-dunkelfarbig
804,166,493 *5368C699689C587E6ABFBAF48DAEDB934B568AEA DO_F_
804,166,494 *536115094E30C3EABFD1F871EA0718D495E100E4 1ERITYISTOIMENPIDE
804,166,495 *536E291E4FFEA5D9423133D636E7EBFEC5AAC755 dompterons.
804,166,496 *536FA987055EC172EBB34E7E1D31EBF8D2A041C5 1.HEROSTRAT
804,166,497 *5367F933F6229105CDAE93D8C482DBE6EA25492C doñinenses
804,166,498 *5360D8F13E7969C4EFDF08943B7EF04AD99DF36F 1KVINNHER
804,166,499 *536E89F9363BC98BC8EEC83CADEF6AFD185608ED @1L`U
804,166,500 *53680623EC7F9E9DF7B1FD835F6102893509108A dp5cu
804,166,501 *536729712CC25F5EE8AB855B5FA3C3990C681D35 1.NETSCAPE-SELAIMESTAAN
804,166,502 *536C94E59E142838AD29EF012259BBFBCDFA7E2E DQKZHVL
804,166,503 *53600EB458FFFAF61F8542CF9097E6662302C0CD 1 RATIONAALISENA
804,166,504 *536FD12A7764806E662743641AAF5DA189AAEC08 drewguinan
804,166,505 *53645470853168C1CD177108E7BFB896D39198E9 DR-O3
804,166,506 *536A8F70B7ECDCECD62981C120D1D46F7B545F5C 1suojausty
804,166,507 *536101223BD41E281FFF039A09E9FF2EB1338E56 1TAIVEKARTONKI
804,166,508 *536E0345AA0B1D23277B18B88D2EB2C30AE9319E dshrags
804,166,509 *536337C0FB13D9402BDF692D0A065C86D1FCB060 d.smu
804,166,510 *5369F0A0B0F95C35193E4D951CE8ADF52A54E521 DT9D
804,166,511 *536A58FB7E97698360833529EA4B995F855F9334 dtei)
804,166,512 *536A637DAC13178AF3AB713BB502E7075E480BC4 dummyone7
804,166,513 *5360C4D4739E2F118345D71904CB8657E7FA5257 2433618 tuerkischersvseligenstadt,fckroatiaobertshausen
804,166,514 *536609856D5A1136DB01CC80CA86F5963A576794 dwh%
804,166,515 *536BCE4BCB1DD27CB3DD6C83730BB8B7AA921E3D [email protected]
804,166,516 *536871071900E56521F97709465930FE79B15B0F 2745541 TALOUSARVION.LOPPUSUMMA.K
804,166,517 *536E8D09AD41AC943DE22C015244644993F8A294 EALDHUNED
804,166,518 *536EA7CFB59B571084B2501F0A194770DFB81B58 ecnh:
804,166,519 *5360DE20829E0E176C0C51E805541E077F3BBBF1 ed-rembert
804,166,520 *53645609B93C04D5308FB554E38E493DEDC578FB 2888980 DAS PHAENOMEN ERKLAERT SICH EINFACH .
804,166,521 *5368BE829D89F6BCAF03C9A336F8D98547C41262 EDWARDZABALA
804,166,522 *53659CA3E6A1DF4ABF6AEC2193C573B6356D2B3D 2AFKLOUTER
804,166,523 *5361878122CF1F8B8736EA2FC5E90EA37D835C71 2.DETROITLA
804,166,524 *5364F8072AA53746B2158C37AA78FD2EA90A3CEF 2.HEIMENHOLZ
804,166,525 *536A4D53588BB8B39F07796E61673E3F52197942 2industrialsystems
804,166,526 *5366FD1559439AF5D7F5ACDEAEF23942DAE91651 EK=_J
804,166,527 *53695785F93D4893B355F10F099ED057E7219384 2.nauhaksi
804,166,528 *53681BB60307424C176AB3D9B9A53DB3B001CA27 eldragni0
804,166,529 *53635737EACF7087F91935F57272D083BC2AAE38 2rushford
804,166,530 *536B4E84BCE0AC980EC6CE4443F2B0360F76FE79 ELIAS.SHARIFF
804,166,531 *536F9AC9E0B37B42AFFF021C0E50202F2D6F3211 2TRABI-ORIENTIERT
804,166,532 *536152666A60F48D46AC928BFBBD77211B85146C ELIZABETH ZUBER
804,166,533 *53611B087F661F80F1DF739543057472D8985047 ellorbie8
804,166,534 *536BF56DF077744AE5FBF41B84A79D8E3F47F583 ELVIN.SAWTELLE
804,166,535 *536002FB014F5ED57296B370F4584F91862FC639 3.edulliselta
804,166,536 *5361F4F43B6F444E1736C5C8A738C2D935207203 ENFUCK
804,166,537 *53661EFEEC3017C321F8BB3F4CE8FDB80F420067 3GANDHINA
804,166,538 *536C7F27C7DA401311EF5F8F945C98936B876433 3HANDBOK
804,166,539 *536424584D659AF1E62BCB22606B960FBC446CB3 ENS-STUND-EN-KREPP-ZO-BETHLEHEM
804,166,540 *5368800788A20D41DBCB6E4A7FC0A98DC85DC1E9 3.LAVEALLE
804,166,541 *5367970F5213FE9DC658D36C4F2558673720390A EO0C
804,166,542 *53626D04A538D16B4D9D4B1A91D2944EA823B452 erasmoraef
804,166,543 *53620A70E55E58C56DAC37EA2A029CB18A6AC7A0 ericdehetre
804,166,544 *536241A3A10216CADEF740FF8B1D8D546A58F0B9 ERIOCAULACEA
804,166,545 *536F5E32A0EE3222D2575629D839D4CF2B517E82 [email protected]
804,166,546 *5363088BAC71E5D6BB806D440FB1A1A4CA423032 ESASSIN
804,166,547 *536A34D0E12DCFD5375DDA6A85D88D310D0F6466 EVA TURNER
804,166,548 *53665CC270DACB868D3DE75FCA6ADCE8355D4108 EVPV
804,166,549 *5360535176E4BAD06BAA98D01C899A7E924CF6EE EZRA.NORTHCRAFT
804,166,550 *5366BA91DDBB414CC6FB5E624F662DA8920FD4B7 4.JUOTAVIA
804,166,551 *5365826151D1E4222B847D806654752877D75083 FARAHKHAYAT
804,166,552 *536A5B63CB309A6AE57A5A5F175F74763A742517 FARHANEAGLE
804,166,553 *536DFA3E21E12E47E2357AE286454BFD4BEE7AA6 4PUNH4LLOI4M
804,166,554 *5369AB9FD141044B54BCD2E3F02FE4A45B4FBC0A felipelonghi
804,166,555 *536C2338B673311CF1550FAEAD5CA5B0E59AC7FA 4ROADABLES
804,166,556 *536E6EB0BE8CFBD11DF92306E8F5979B654EA7B2 4SITSUGI
804,166,557 *536D8C106E2EA439E3D1A0CFBCC759FE2923BE8B 4SMILESFLAMINGO
804,166,558 *5365873AFE50D23194EEF712123B90CE9A355462 4VINGERWIJZINGEN
804,166,559 *53670E8FB4E809778BFB5861FF08513B56857DE6 4WD(LOWRATIO)
804,166,560 *5360BA72F8225782D5EF611518B23F8923B84477 FJØRUNI
804,166,561 *5365C4EC37B133ED3F438E5E34F203D90FB81970 FLAKNAR7
804,166,562 *5362EA8413A7285B43F4A4F4BD5071D6F9FAAE3D FLIKKERINGEN1
804,166,563 *53647AE92B5C431743B9D084DB180055ADB393E8 5BSWSISOMSALBSW
804,166,564 *536A13BE54ACF65938D16CE6CCA3282E789BF04B flottenhejmere
804,166,565 *53648BC6AC37147E02B73BF80645C5C460D330DD 5facultatives
804,166,566 *5361A98A10C8192AD7377AEF9B2697DE1CE7E0E7 FORESTPENAHERRERA
804,166,567 *536A26E5F7E9437BB72865FEB466509CE1FB1B3B FORESTS
804,166,568 *53677CDEFA402940178414478F82C6503A6DA89A FORREST.DEKOK
804,166,569 *536EB62CC8FBF0925EACD712DB05835C71EC9236 FORRESTGIORDANO
804,166,570 *5360D869FA640199437737565E0CA2B6BBC73507 FOXY_BABY
804,166,571 *5365AE2A081CEE81C07B40740F9A302C3825B36F FRANCISCO-DORIA
804,166,572 *53653D895D392F0377B691E9F1F822AD619BA54F 5iluvzzz9
804,166,573 *536066C61BA7CE87C3D6A271CFE71E4600ABD0B3 5P3CT4T3D
804,166,574 *53659F1C0772B4FD39A6BDC2033759AC4F68B8A1 frankhillanbrand
804,166,575 *5367CE983101C4C112F3843173F1F8FD3E757C53 franklynrusi
804,166,576 *53623FA20C248452CA9BBDA44E8938A47EC01A8D 5ULPHAR5ENIURE+
804,166,577 *5368880474E3B410975B77E4AEF063684F780A81 FREDRICK.REHAK
804,166,578 *53610C90C78D800362139E7E023ECE4C9818F563 5zerzaust
804,166,579 *536DEC3AC70F0F8DD8C763740DFAB3BACA3265D4 fruit salad (30 second version)
804,166,580 *536234C8E344485F0CF2CCE2A7DBB7008AA2382D 654321harrison
804,166,581 *53685448B6FCCEF2131A1619132947F370BDD2C7 697gabrielle
804,166,582 *536E3519988A74CC21DEECEDFEC67A4D4DDF0C79 [email protected]
804,166,583 *536BADE9E1181311CD2920CD4044CC378AF53141 g8pw
804,166,584 *536173CCC9F17E42491E1C05E01E13A904E7512A GARDENIAEVANS
804,166,585 *536BAD8C113B509354FB2EC4062FC791C9409E5D gartenderseraphina
804,166,586 *5364E4FE65D4A43C2ADB1E320010BC757D632A83 GDANSKEKO
804,166,587 *53690FCCB7BBA182EE789C8340FC07BE08F794F9 6BESTUCKEN
804,166,588 *53649BE83670AD80C2D45F668B0695BA9C3773B6 6BSWNACUBOBSW
804,166,589 *53695054FAEEE6EDBE99CBA06B425F9AF493C06E 6COSTELLANDO
804,166,590 *5367CCF6144CCE6BA9291CEB2154D915D3B04B35 6COUDOIEREZ
804,166,591 *536698AE1B1F36F59A726BCA47906E22B7B952DA GERALDO.CRAWSHAW
804,166,592 *53614614F1C00913F1A86D8EDF3E9C6F819538EA 6FIREBIRDNAT
804,166,593 *536629D71140F7442AA5682F9BA4C58E3F7BC8C5 6hannesten
804,166,594 *53691E1EB408F676F73837CB30CA5F83FE6EEAE9 6iluvchat1
804,166,595 *536F0B84430AC01287DC4FDC39B49623BF5B65AF 6-KYSYJILLE
804,166,596 *536EF8388B4929B9BC512FA38D9C0546BD950F69 [email protected]
804,166,597 *536613C60D40D3ECEBF66191D79CC39D5030BE19 6NOITCELLOCERP
804,166,598 *536FBFA785A6635906D1A5A147C8A735A3FCFAB6 GIUSEPPEBAMBINO
804,166,599 *53637311EB875931436C957D1FC8EE60F2B37C76 6THEATH8
804,166,600 *536950D0C36FA54D0F248BAA3ACE406AD3911848 greekreading
804,166,601 *53615FBD89ECE405D91950104C5DCD0CBA33B685 GREGDIPAOLA
804,166,602 *536066160EDE93C2C71B72D544E94AF372A56D2E gregorionyberg
804,166,603 *536562019071200FA21B0FC65111EB6567607658 GREGORIOSEELIG
804,166,604 *536B952A0582AE488EE6E6F13211086C96478D80 GREMLINS
804,166,605 *536920BD906FB1ACFAE668AA3C5B91B67A61969F 7AKBLADEN
804,166,606 *5363A6FCEA72D9881B244E5F4DBA3757B84D2D8A 7BALGHEIS
804,166,607 *5362B6F83669A695BF41CDF16A12C3BF038B78E9 7BLACKMITCHELL
804,166,608 *536F9CF4333154B44D671F632BF2B6553E48DAA3 7BSWPROFISSIONAL
804,166,609 *53659F0C259F9A41634D4F2E0040E8EEBB5FDF00 H3R3TICID
804,166,610 *536A9E13EB40CBAFB2A5E16929392D0F03C8F51A habilitationsprüfung
804,166,611 *536A684725176BEECD418F7EADA44018E4C50FE8 !7L
804,166,612 *5367F43ACBAE270D4BED48E530FAD6508B937D67 7NAMTRACELYKNATS
804,166,613 *536F209223DA5E943F6AFCC12AC4E610DC5DAD24 7STRIDERZOMBIE
804,166,614 *53648C9213EB048570D6802D68126C9693FDEA30 HARSHKANSAGARA
804,166,615 *536F6AC00B213FE74A3ACFB8975FD1C92570735A 7USAMITE
804,166,616 *5360C92CB7D9E15DC3CFC6AE1D55F3C885BEECC3 7WAHRSCHEINL
804,166,617 *536542E7A32DAD46C79E818E0B92E338553F5C99 (^_~)*-*-*@------8
804,166,618 *536693077C8EE532DBDF46D03B9C35F35D710472 HBRH
804,166,619 *5368FD2C9C09B3870ABA27C911510321D31498D1 HEATH.MINNIEFIELD
804,166,620 *5362162C070E1A0D91535E49072F914DAD096C3F HERAUTSSTAVEN5
804,166,621 *5365E60FECB03D80D7B25647D12E6E5E80295A9F 8BINGOPANTHER
804,166,622 *536294978277847C6879D9AE7A9DB25BF49E8238 8CHEUNGM
804,166,623 *536E9833005F3A42F7EBFD751312034F963660B0 [email protected]
804,166,624 *536ED96B3923DE49627EA3BCAA4A6CDC77F065C1 HI%@
804,166,625 *5363411117512FAA8B731A672C4674014E537A93 8KRISTIYELLOW
804,166,626 *53621BE4FE0A898864554F231BCAF7BD37756D8A HOMAESEN7
804,166,627 *536C5475612B254912CDC5E7FC1F7BB7E37EDAB9 8MAINVILLE
804,166,628 *5365CD0F903BA5961ABCC5D928094F40F7EFD30A Hostility(Madizmremix)
804,166,629 *536D2100A17CAB21D6199DB1C83270FD1A8A521E 8RECHACETH
804,166,630 *53644064D095AEC191CC1EC657E64CD58FF28F84 8SPREMASTE
804,166,631 *536D2775D7E5CF6CD36BC42F014F795F703F2629 9.2.WHATARETHEUSEXPORTREGULATIONS?
804,166,632 *53674A33CB390D1F6EBD0DE9F2C9A47903166C71 9583mm
804,166,633 *53654883D566CDE9EA9F122C1BC84A92C0EC8AF1 hungloforte
804,166,634 *5365A835688A259255B92612511DB1F2D1CC2F41 hydr0+her4peu+c
804,166,635 *536F360D91FA2A69F1E44E02BC3F3B16E98E7449 9E06E0D9153EE033A25753C2A9679C946697D6CF
804,166,636 *536DCF1819FBC4AA6B449997D6617961917E2474 9HYPNTRC
804,166,637 *536FFCE0DA16465AC44BB443C81000DD304E065C [email protected]
804,166,638 *536D8AF70AEEF5B7D98E55BBE287747E8517BCF0 9MOVITOSTI
804,166,639 *536FF247B50BAE869FF5B50A942F662706DDD83F [email protected]
804,166,640 *5360D7C85FD730FD144BB58EFF76D0661817F63E 9OECHBSW
804,166,641 *5360784A7CA6CCF20FCE6815994601AEB664E323 i{g,
804,166,642 *536026AAF9C6E441EC8E315A5E9FE3CF112D19A7 9PRESTONMAXIME
804,166,643 *536E104C56AA141C35A18B0DB37C67AF0E04A50E IHTOS
804,166,644 *536625600C27490260494C0443B671F682CC33A3 IKEJURKIEWICZ
804,166,645 *5368E32EF10CA166761544F62F0F5879294433A0 IKEKIEWIET
804,166,646 *5368B55041FAD48A780A404498CE31E68C80BE10 IKUKO SAKAMOTO
804,166,647 *5365E4E8110364D173655FE89DD1EC56A9A1E445 ILJELEVT
804,166,648 *536423CF6B4C916C5E57678A9FFB019B023C2A4C [email protected]#
804,166,649 *5364A234E322D68B8A7C4517222B0A093D6FDA6A I'M TIRED OF THESE BLUES
804,166,650 *536BA69136CDB3CD3DDE3368D53613F4151D6404 a&8zp
804,166,651 *5367D6F941D177D178BEED92800E7E380E56329E a92n"
804,166,652 *5363B922A3BB445D1DA7492846CA757A1F995C00 aab2s;
804,166,653 *536B019E0F84B5E98EF66332B165BECEBD43D824 ISSACBRADBY
804,166,654 *5360F19B04A8E534F7CB86BDEFEB56AF9328F4AE AAD^)
804,166,655 *53614EBADCAB77338DC089730D6D6332AB7CF1F9 AAKHYEYA5
804,166,656 *536BE5607337E7F53B89E4D5B32B2F8AB27FB528 IVYCLO
804,166,657 *5360BDB8C0C6616B8543FC6E3E6E814B5136D58D I.WANNA.LOSE
804,166,658 *536B2B75EE319949CF3223F8A5ACD73D21F88D8E JACKLAMMING
804,166,659 *536BC7BB88AE5419A4504D4B3426715E34D4D41C ABANDANE
804,166,660 *536BE7A127FB383CFE11EC4A27C1612CB1A0464E JAMAS, JAMAS
804,166,661 *5368C87F18B09B4D7FCB04FB48420150FEDB8BC4 JAMECALLO
804,166,662 *5363D69DC367DB838A692F37F30FBF7D2710198F [email protected]
804,166,663 *536FAC40DB557EB9D181C518775E1009CB2548BA jamesprideaux
804,166,664 *53657305CFE3D1CC6E4F149437C9322DC43AF4F0 janlehnortt
804,166,665 *5365D3F411E8DDE3DB71A012C2BEBEBAB463AA7A jarrodsathre
804,166,666 *536127B6DB06E0ECA70F69EAEF42F89AD9BF1199 JASONMCMARTIN
804,166,667 *536E9768C505EF8BD28368651C4374E4CAF5E116 jaythomspon
804,166,668 *536F7A2EF0BBE520D9240943EA4477436F2C4962 jeantucker
804,166,669 *53603BC4DE758F9C7238CA1AF5FB84ACF6D226CC ad2zf
804,166,670 *53669436F795EFDDAE98F84C454C4DD50B1AD767 ADALBERTO.BARGAR
804,166,671 *53677C9AC719451B71CAC34827B3F9E4171ABC85 adc,.
804,166,672 *536CA1CD132FEC67DE12F4DC678BD6A7BE11244F admlf
804,166,673 *5369206A2B5BA8671BD6F61DDA831623724FC50A JESS.DRAKES
804,166,674 *536039076DF51DD4DD548CD4E025E756EBF41BCD adware
804,166,675 *536F7D06573194EA520F674687ABB68FE0E33377 [email protected]
804,166,676 *5360D1CA81391453DC8F6ECF3E8EFD5FF8BC5F27 joaquinlipscomb
804,166,677 *5365B6729420C5451289EC27EB4B87907642C599 A_GI
804,166,678 *536CD77101CA3A9F4A3BEC333A5DD65A17D3A542 ah=,
804,166,679 *53624FE34BA3FFF1F6068CF4095B0E454C64AB1F JOHNPARLON
804,166,680 *536865C7DF3A88D9E361CA6A35CB6224B16E0B88 jonathonbrent
804,166,681 *5368DE93E6B3E2B29392FF8C3C06C15726CA1C95 Ai=L
804,166,682 *53632617156F6C282E8C88E37FB68B9E240E57DB josephgrimaldi
804,166,683 *53611F1F4A1CF622A85E254A3304F33A8BEC1B7D JULI3+
804,166,684 *5365782B81069D54D603AEE767B98F097A4C8BC6 ALDOMCGURREN
804,166,685 *536EAA28C27081A770F7B6F469A42AD4F3A6B67C ALEGANTESES
804,166,686 *53619AB36A26615C2AD60AE36A7E3AEF4F45BAF6 KABELSTEG
804,166,687 *53644D9781462FC3FA969304E853902711250892 alifn
804,166,688 *53632EFE13D121840A55CA46C950325927E57A94 alisa354
804,166,689 *53645C0D2A32BF3DF23BA9F1BCCF55A2EE75EB53 ALKUPERM3
804,166,690 *5364D3F8926631DBB0397C155C3196A6B685DDFB KASBAUER8
804,166,691 *5367A44428CC3C61EDCA6F38026770A70A803782 KATEBOOTHBY
804,166,692 *5366BCA37535077C0E74EBD1E0323120AC3CAF44 ALMASSIE
804,166,693 *5366906D6108D1A7FFDD0964BA695E05BDBCFE4B alri
804,166,694 *536DA0FD3B09E7F2DCEF773091752E150FE89B3B A:=.M
804,166,695 *536706AD3B1ACF981CB36575112C78E33C11752B a minha for
804,166,696 *53674D1574B6DC6576BDFEDA097EA3506C5BED3B kevin.disibio
804,166,697 *536A43510C1895B7A326086CED60976E781E2633 amphitrion.walzer
804,166,698 *5368EBC97B118E34C624AD194DC409573CD6497D $AND CLOV
804,166,699 *5367D60B5493AAB03DD5F2895CE1528143F3D1FE ANDREAS.DANISH
804,166,700 *536D14D11D553052B383A075E87510DAA192DC10 ANDYROEHRIG
804,166,701 *53633F7F6476BF538C68FB1D5F092B61E8B9967C KOLLATIE4
804,166,702 *5369C914DD3FF02183C56E8A50AA924A2394646D KOSKETTIMISTOLLE
804,166,703 *53630D317DB939925F5F540A20E6BF6A41559E60 [email protected]
804,166,704 *536737575CA87E2AD11B81D4C372493D25C34659 KOUMONKO7
804,166,705 *5362EADF5D07295A10532738D2539AD88022C31E ANIBAL.PAOLELLO
804,166,706 *53615A6369CAF93B0E19BCC8A54366A8BA56DB22 KQ[^
804,166,707 *53656BA0EF7A188AE53429A135C8034C36ED9571 ANTONIO.BOOKHARDT
804,166,708 *536B3448BA75B3D0B2A95576FE9835817961B02C KURSSANOWIANA
804,166,709 *53641529A7B0F98374F0DDD210399355FE8B14CA LALZIBUD
804,166,710 *536E37E2509EBBCC1FDDA28DF40B04C58E63E9E5 Apug
804,166,711 *5364B01D0F34F55CB0BCE9D97B903EEE46AB3C40 lateraanibasilikan
804,166,712 *536DC98B3AC7B0409AA81A2342305FC0A5E5B6BC a.q;z
804,166,713 *536FB0EB47829E26549E619891F495BCF9061D3E LEANDROKOENEMUND
804,166,714 *536AD62214C91711BFF69284B1F34B6D48D5F6C0 ARD6Y
804,166,715 *536B8F7E9851BA6E5F63F9D1EB4276E727D17785 LELAJUNNE
804,166,716 *53645E08DEC461A62A526BBD367DDE8EF7DFC45A lemminger-punx
804,166,717 *5360239B1BFC07AEEFD0E2E025B08245F5245D7C armageddic-allegiance
804,166,718 *5361A00E860F35FC522669D0770A9E8D9ED09319 LEONARDSCHLAACK
804,166,719 *536044B3CB480EF77DB6150D756ADB214C5DBF3E leonthemilkmancomwww
804,166,720 *5361B5B77B375308584A53809762117C519197A2 ARQI0
804,166,721 *536E4DB4BAEB0700710F149DEEE4D16BB30CEC66 arrings9
804,166,722 *536C5A5E4CFCF4BC63CF2522EF99600C1788A218 ASCETICS
804,166,723 *536B17A7B737B642E66BC4C6BD75FB4D08951D61 libertarians0
804,166,724 *536F8AB505C65C5BA4A19BF3138FFE92F0A929D1 at,y=
804,166,725 *5361811133F01E79060CE3DE8697469634D89922 AUF-DAS-TRINKGLAS-EINES-VERSTORBENEN-FREUNDES,-OP.-35-NO.-6
804,166,726 *536C18FFDCA4DCD5D16882272D7927F54875EAE6 [email protected]
804,166,727 *5368100E815502CC6B9C81BA31448A48740B1749 augustuspascher
804,166,728 *536D8971089369C46D7AC3ECB990DD73E3F72F07 lolita9
804,166,729 *5365E4756AD28D86AE1160F65E67ED0E88970601 AVVITI0
804,166,730 *5369EEFCB452CC8A38222A9893D4510EAA94BCE7 A_,XI
804,166,731 *536E6B274B8D0B14CD81ECC62EAA23025AE50241 LST-999
804,166,732 *5364A58EA01DCE1143075ABEEB22EE7721C12741 azinko12
804,166,733 *536C68086FA5A6080DC6E7B1C1BFDF97D288D002 B0XDR3$$
804,166,734 *536CBD3C4AD12B43497B0234FFF65CF0CAE3A6CF lydia-bobadilla
804,166,735 *5362729A70BC147ADF2EF61A7B208B500F59605A b2whr
804,166,736 *536F614E9AB3C6FBDA2C5AF91AF8D871B25E169D [email protected]
804,166,737 *5368D954EFA3CDEF679EC07C23C182E434705AC0 MAGNOLIAROUGE.COMWWW
804,166,738 *5361D4AEED43C0639A5E1B254AE29720D1F818B4 B8!DW
804,166,739 *5366DB5239EAFBC35F44FF2EC6DE977AAAF07ECC MALIKBREAZEAL
804,166,740 *536218B11417195A3CDB0E6E18AA2F1428D578B6 BANAAL?
804,166,741 *53666E08B185B2F83F5086D2D380987670189390 [email protected]
804,166,742 *5364587227DEF14424FD524A4DD447C704AE1EF0 BATHSKET0
804,166,743 *536F78D796B20AC1BA50F306B714EA6E59B41C56 marcellusbattaglino
804,166,744 *536F1637BCC5332A86CE498ED2BC05A62F57AAF7 BAVARIAN
804,166,745 *536FEFEF13B978E667EDE31E510D7DF19DD1DB0E BB81302
804,166,746 *536ED85E3030848872E7C256766B44511A0A2D84 maria-teresa-saavedra
804,166,747 *5367A1747922B95B86298B8DE28819F993403B80 bcuu
804,166,748 *536BF8463218703E8370E6604F0A9D0268C81774 marquishartsough
804,166,749 *536253FAD275F19FB9C2293C4E4B070B922497B3 MARTVG
804,166,750 *536668DAA485A88B80027E7B835D76E7918D3FBA before-it-gets-better
804,166,751 *536BE14A365825221AD9677AE4DF4BBF9B727B11 masters-of-da-millenium-(silent-harmony-remix)
804,166,752 *5360660E724E8FED7604D642DD12A0E96C417CC0 BERNARDO.SAPINSKI
804,166,753 *5364A6734785692C1B0FDB5269A35B894418BA15 [email protected](
804,166,754 *5362988E16175C83217A7154E3C3903102F56072 BERNOULLIBAYESLAPL
804,166,755 *536A2B8FDC33ADC4E0C7FFE075578E8CD2656281 berthaljf7
804,166,756 *536EE6DEF540DDA46DC7F810F6130C5006BDB97E BERTLYSSY
804,166,757 *536BFEFD3B33305321E33CF614A9742F6257BDA2 MEDIOBANCA--M-IH0-D-IY2-OW0-B-AE1-NG-K-AH0
804,166,758 *536440C974C65110704A0F283B90CF5767677D5E MEDLEY:.AMSTERDAM.HUILT.-.MAMMA
804,166,759 *5361CC252D5589126548C5D87911B575B1C5678F medley:-broadway-/-cantaloup-island
804,166,760 *536BC94369C2C6DBD53367D24FA403192BE3536B MEL.MASCOT
804,166,761 *5368715B42249488060A574814BC69206C0A1476 menservants?
804,166,762 *5361C6C728D199AC7D8AA7369544A1F88248A991 mhnaioj8
804,166,763 *5369C11FF5E5ED9FE78BD64A6F6C7C256AFEC579 MICKIES7
804,166,764 *53698D4C02F2F4A2274071890DBA420D706A4739 miguelseara
804,166,765 *536E700FB3114E4992CA0752490F4443F1A8F001 bimtw
804,166,766 *536A3268F784D1B1F01C959556ECC094596DC8DC BLAC632
804,166,767 *536F1CE3081B710DA6DB73752E465EF45C9C6C25 miriam-zawedde
804,166,768 *536E1E177ACCC50E57A4653A0C417992E7D006B5 MISRACH5
804,166,769 *5363A10C00EA81CF3369584ED8AC292F3BD9BB4A [email protected]
804,166,770 *5368A53502243488EC15A3C9515460100BE1B97C mkmh
804,166,771 *53624AA3B1BDC770B7BA1367CED5F58922E3D655 MMP1234
804,166,772 *536D629399725C9409E418E5E4875664EA27AB9C MOHD ISWANDI
804,166,773 *53656D1806479F4BF99601F5BA8BBA5C82F9ACF3 b:mx9
804,166,774 *536AF2DD7ABEC131BE458C062185F8272443F14A MORRIS.STOKLEY
804,166,775 *536F3C039A06EFA7AE245E1D518E5AE7198815C0 bof"c
804,166,776 *53658414A8E8F24167938D7D430CDBF41F283463 mountain.grandeur
804,166,777 *53680C27955D2A354CB84E5716922EDB69FC7537 MRTTYJEN5
804,166,778 *536BF9ECF4B47218FCD5CB164E083EEA3F456213 MYCETOPHED
804,166,779 *536A7197695991814BB5F93114FE0A725A3AE215 MY-CHERIE-AMOUR-(FEAT-SANA)
804,166,780 *536877CB376F8EE17E0DFAF0B5C7525714785DFF MYRONI47
804,166,781 *536519518A913BDF6E8C3C68FE8C2D6116E3D3AA [email protected]+e$
804,166,782 *536842E8E2430C8FEC93A80A5B38C7B3628DEE84 NATALIE-ATIK
804,166,783 *536B2E76CF29DC55434323FA4D35E5FFFAC93067 brachife4
804,166,784 *536872B59A3E43B546B7E018EF8A611D1CEBEE9A NCHANGWAI
804,166,785 *5360B314F12FA41CECEB8286D384E4C927635483 ndigung.der.moderation
804,166,786 *5368DCD8859A72D0DF687EB21732F771F6BD0CAA NESKIRAW
804,166,787 *536845AAC7368A996ABCDBCB598810698B08196B brightencounter
804,166,788 *536EB839B1F17A1D8017F8D7FED678E9C815CB80 BR&$N
804,166,789 *536F7936ABDF45E90A59196BA206336D9AF60B6C BROOKS.STELLING
804,166,790 *536011CB98249DBDE7D4C65A30460272B69B3F44 NIEMENDAL
804,166,791 *53656D0AC7F6B78323A44CC1615D425E93607320 nitkhairmanga(unedited)
804,166,792 *536CD16B6BDFAE4EC99820DA7E2D0FCBA033BDBB NOEGLER9
804,166,793 *536E11022C36B2DCF1490C924F3A72AFCD3108D5 Nonepiece
804,166,794 *5366DC8E0D3F17EA65B605BE786E9E32D622C125 bu$6m
804,166,795 *53655A971A736638BE47DA2CC6584F08F7A372AA NOW-ARID
804,166,796 *536AF0FECB6A466D36C3D78E10112D4B49327585 BUJGT
804,166,797 *536E0FDF868A1EFE0AD6A5BA3B3B06455FDA61D5 BUMMING6
804,166,798 *5361FB06DF0424A8AE2F337C5A5B95A41420BA3E OBEEJAY
804,166,799 *536E16C7EBDF05A6F9245462F1875D9BE1381142 OBRATLI
804,166,800 *536362C8EED3D5CC793C1C98BA755367A2A962CD OCTAVIO.TOMPKINS
804,166,801 *5361092D9C117098563415F0A0442032C7B6F707 bv?#q
804,166,802 *536784067A7401F17C219A2A611ACD343F9985D2 c=:
804,166,803 *536456CA72F8A261FC7EC60153FA340956DA9D35 OTTOSVEI
804,166,804 *5369E7DAF03D314B547D7E70DAF4150DE91734C3 OTTO.TIBOR
804,166,805 *536A218754BC32B5C28C67A78B25FC953D72451B OVERSLAUGHED7
804,166,806 *5361C0FDD1C3546B6541906D66EB79848E6DCA7A C5T-
804,166,807 *536B8642CC6EF8B83D75C6AE3606548B6E41D881 P3RFIDI0U$LY
804,166,808 *53631196E1D561C7DDE9DB452CF7138D58732836 C+8I;
804,166,809 *53664001B659FD3493BEE773CFF8F9316B79C9B1 PAMELA1089
804,166,810 *5365659C0DED0B9A071115E150D4FE39ED95FDBD PANDORAAVENGELYNE
804,166,811 *5361C387F85015B15D8CC39904B4C10C06E3D3D7 parisborchelt
804,166,812 *536814E61D0052F2CA127C57F2117993E48F5D00 PARISMINNICK
804,166,813 *5369FC44652AE04BB4242FCF6211748921F8F769 PATENO2
804,166,814 *53627162186C16922FA2761B8B71C273F2713B97 calvinwarchol
804,166,815 *5361DBE06F121DCE80F4FDD6D23825B14CAE527A CALWD
804,166,816 *536762DDB30781B16274242B835523D529488DA5 camw-
804,166,817 *53615FF045DAF0E146194F8D33ADFA3D96A71F97 p###B`~`~}8{
804,166,818 *53648A8CC720430042DC332F24EFFEB1AB7A9206 CAPPIESCOM
804,166,819 *536A07ABA1B20EE2760D7882382C06250258B045 PENEALXW9
804,166,820 *536BE39FAF80023FC6E505C87C1F864AA68A80C0 CARROLSKEETE
804,166,821 *5365BCF6E45C55877189FBFA459029408E0AE151 PETERSEARGENT
804,166,822 *53648F6BA4EFAEC08B1AFA04840D57AE585C9CDE PHILIPCORRIERI
804,166,823 *536952881DB1E5B4BB69F08ED699C5670B2B3463 pickles4
804,166,824 *53621D76F6AE4F5FBFE22891C62ECA3AAFFF299F PLASTIKSACK
804,166,825 *536E3FFA7EA60E6357B44AB511B1FBD251806774 pliquesing
804,166,826 *53695D0E27BB3363E93F86BB963844CEC0CCE13A [email protected]
804,166,827 *536060470EB14103E70A1EFE24EBD0CEC80EB723 CC6A
804,166,828 *5368364BE38A3AA0D398C312E5ECCBFBDB0B6F48 POMPONFINKELSTEINANDCHRISTOPHECOUDERC
804,166,829 *5361A6F973CE9AAABD0639A7649F8D8F179CA2C9 CEDRIC.BARREIRA
804,166,830 *5363F4CCC7DB3DB1974A696C84950D32A6C8EEED [email protected]
804,166,831 *5368D94D6BE3088616D5C19EC9D3E52CB04CCA3B PR434C3T4BUL4R
804,166,832 *536769A8F3416D9047928CA034D9C04F9151455D PREMERETE
804,166,833 *536D07F51E3F74D3FC65A752D6E552292E1C34A8 CGRRC
804,166,834 *53612DE70A8D6F025A325A9BB722304245A357F9 CHAPTER09-06:APLACETOHIDE
804,166,835 *536C4598EE01314147BBE77D237C685F98CB2B6D [email protected]
804,166,836 *5369D0C76124AE2ADEF4D0E4A671C5B255CD706C PROVINZNEST1
804,166,837 *536B864783BD97D1D96191AE1F40A88E2D989C3F „PULPIT
804,166,838 *536EEB1EA570EA7CFEB4F7DE1B5EAA9D91C063A0 PYRRICS
804,166,839 *536F856281874985FF23AA6E4DCCE71F7DAF2D9E Q133497
804,166,840 *536283261BA1DA092E4AD104ECDD69D4284DA41F christabaumers
804,166,841 *536D14CD8A8509690B54F2B7A3DDF4A08F5202A2 [email protected]
804,166,842 *5369FE196119E6E850BF5D56794F2DB4457EB664 christmas;另譯
804,166,843 *53649FC0754C839752DD050AB0A30A9A6156048C chw)n
804,166,844 *536711C5DC487BDD0781CE5D48A3D8426B6DA216 QUINTIN.VODOPICH
804,166,845 *536789EDE083E63D762A3462C49C04DFB5D9F91C QU!N7!11!0N7H
804,166,846 *536C8081F7C41EBF4951A27A18B827AE55ACF4E9 ckfh
804,166,847 *5362A9EC6D2DB6ACEB02A176C1E23138AE657AF4 ramaleen
804,166,848 *53641CADF03415E45D4D6386D12E71854646E5D7 RASHAD.CHADDERTON
804,166,849 *5369AC6B09433F3CFBB7684014BA5615338EE02C COCEGARES123
804,166,850 *5361E87B422B5872ADFF963E88007863E8D9430A RAYFORDMARTZ
804,166,851 *5368698674060378ED8C955A318643B4A0064B24 co:iu
804,166,852 *53632ABBCD7A712E080E5DA60318E57C7822D69B @[email protected][email protected]
804,166,853 *536A22E287CCA0E2A66C07A76B801539176C4AD6 columbusmonges
804,166,854 *536ABC6FB6BEE1541A1E222FBA10517641BF5B5D RDFRSLER3
804,166,855 *53604C37AA4D9392056F6FFD53DC27F9A66DB8CA REPO04DB
804,166,856 *5367A9C5FBD521CA0B376BCAEDD34DFB305F7BDC reubenbuisson
804,166,857 *53662530B525EFC37216E9F3FC238096B83C5B8C rglmntrt1
804,166,858 *536FD93202F55C8D8C5370288019A9D626B016ED rickybahm
804,166,859 *536C6A97EA303DC1A9C11948C23F3838F956FF5E RICKYGWENN
804,166,860 *53632C8BC4795C0247457DCC9EDD7F1A175EF7B7 RIMBECILLINDOMI8
804,166,861 *536182C46B27AA896AB958D697C0AE64ED58B335 [email protected]
804,166,862 *536F698C02ED4DB4C20D66696541952330DD213B RIO-DO-ARTISTA
804,166,863 *536073BD34430047B4F53C3A778CE8CC99886D97 ritualradio
804,166,864 *536930C3BC71309ADC63EAD4957BEF24CF7DE4AF röche
804,166,865 *536C8078C68DF2F5E604CAF4003C7B5E8A996ED5 ROMEOHUBENTHAL
804,166,866 *53623744F7D00A4AEF64EC1A54F1FF9C1AB780E3 ROMPERSTROMPER(ORIGINALMIX)
804,166,867 *536603EED62B44A4D0834ADFB92670AC520184B7 RON-RODOCKER
804,166,868 *536D8B2A03D316C20304393122A51177A64F5BAF cqfc
804,166,869 *536708ADE869DEA20E02C6D2EA4B4179FFF046EA roysetliff
804,166,870 *5366E3F6006E3C397DA8974F9A8A4D1EDBC3D7A5 [email protected]
804,166,871 *536DDA9CA1E905A168422FB974295A2128BA4D55 RSPDBSW8
804,166,872 *53671B9D06A73CF4CC4CD4535E835F1DE2813E84 crossing-the-qliphoth
804,166,873 *5367BB4E0F98E1FA646C10E1AB3A3C9BC6A6AA83 salfowle
804,166,874 *53698000BDF46481586A8D26B7B269D10126FF89 samblankenberg
804,166,875 *536BEC91657A1CFA11C86B9098A4D2BE98F2B6A8 SAMCHOBLOSADMI
804,166,876 *536465DF3BBE0C2C4FC8E749E609BFDACCEF3DC7 cwelb
804,166,877 *5363D99173830910376D0E404C411FCA32AE9537 scelsiä
804,166,878 *536B931266876127A9931FC476F51D0E3A6DC3AE scottavano3
804,166,879 *536CD8D1E22B5DEAF22656D83A141368D29174CD cz76,
804,166,880 *5369715DB6E15932488ED92B8AC187D135D7B3A2 CZIMPT
804,166,881 *536C3D0298BB1CD3469FA5830CA1FDD7A457DF93 SDLAFDNI5
804,166,882 *536F133BA1334C851F30F10D3056ED729FB72E8E seacovered
804,166,883 *536703493975118C6789E85B6F0CB4F36405920F seandornbos
804,166,884 *5367A10974B25A9858052614DEEA0CDBF6646091 D1550LV3RM331
804,166,885 *5363DE20498F7F7D6C2FC71CAB6F4DCC009ABBE3 d"1lo
804,166,886 *5360610092985C6A4CFDB2B08FD69F70DB730831 d3xld
804,166,887 *53641746C7075BB3E2DB9C893FA34FF71E4556CD d4mvk
804,166,888 *536AB8E96AC7E45871DE3BD3B79906C14A7A2977 SHANELO
804,166,889 *53600BA9B848009F58D3F261F78484DA92092572 [D-A-B-C-1-7]
804,166,890 *5360B5893D403EC1F4DDA2916B942FBF7D718DC9 [email protected]
804,166,891 *536B773E1742AC9C3A061C3BE4CB0774C161ABEF damnify
804,166,892 *53681CF792D49691E9276DA5EF4DBC5CA6F9D08A [email protected]
804,166,893 *53616EF1AC88BAA09956307EA10A63EE1B5F0457 shingle-song
804,166,894 *536180315D163D855FB458F08F4C9AA902DC0A5F darg%
804,166,895 *53646E104310A1D644ADE25425E2342B57B8B4BA darwinwillmon
804,166,896 *5368BE9730BFD0B243D89F6390E08577B512ECDF DASCALU-COSTEL
804,166,897 *53691A0682CFA667D0E39F7B8A6D9B4A22F6A910 dasonkellied
804,166,898 *53632304508BC7C93C2D2044B58D46F77CFCA4D2 datstu
804,166,899 *5361D51467FC3907F0B894ECBCAC4D9F172FCD7D DBUSN
804,166,900 *53667A36FDACFADDDCBB044007DB9C7B4896E9EA solevacio
804,166,901 *53637CB10FC311173AE16082D33E44E5824643FA somewaterythoughtsblogspotcomsomewaterythoughts
804,166,902 *5365CC46216CB595D3615DEF1A8B20EC807634CF DENNIS.CRAAWFORD
804,166,903 *536508E94A40B7D1B85C74A661CCB75DDBF4D384 SOUTHBETHANY
804,166,904 *536A7C5E9A4E697FE1189A3F5F3017C622D3F443 speedydecember
804,166,905 *53637C51BCA7D43994A190E9633174C1031D198D SPINGERMI8
804,166,906 *5365D01DA509D8995F4847994008BFD842C4153C SPLAT~`-~`D---P
804,166,907 *536913E68D8FD54FDC4144B3727523DE7458D110 DEXTER.HOCHADEL
804,166,908 *5362CDB27F7D4508CCFE8F1F613532C3D2BF4504 dheqx
804,166,909 *5366A46D25F00BD923A2F911B317B3A75D9B987D DHWFA
804,166,910 *5367FAC54FD5D73FCC8AC853D4893743067E2BBD dimple-galora
804,166,911 *5361970C666A7C42E645F530467F0E104813B730 dio,-andante,-allegro)
804,166,912 *536360E1B9415A580E97D4848CAE18A9C13C9F05 DION.SHATTLES
804,166,913 *536D4BD374C1EDE258CF49732EFC58B73E317470 DIRKMCQUIRK
804,166,914 *5369280A9AF9FA3180093F7FE02E4016642CBB21 DISC.06.-.TRACK.02
804,166,915 *536262A78A1D7D1E8CA68B103A1FCCD990C0D8B5 D!M+
804,166,916 *5369BA6ECBEC83B801E6DE7BB38CCF350ED0C4A4 DODE DODE DODE
804,166,917 *53643D0CECCCFB666A46FE6F93BC45652BB8991C SUBSONIQ7
804,166,918 *536E024F6126448774BE3734A3727E63511B13AA dominicleonhart
804,166,919 *5367B429976F2CAAF3BA5C8D64B4657FBAA3B8D9 DOMMERNE1
804,166,920 *536B84BCECDB8DE11F6942CAB0C23FCDD891C357 SUNSHINEFIESTA
804,166,921 *536C6086596485FE4C6EEAD3371174A1BE7EDDD6 SURPASSABLES9
804,166,922 *536A1F578D5A834945891645F378FDDA77F231BE [email protected]
804,166,923 *536E122B81FDD15FE77E63C606D91302AD6426F8 SWEDESSWEDESES
804,166,924 *53636A6C8CBEEB76DD9D546E3EE88445D14A621C swylgans
804,166,925 *536290EEEF23060A35916D6B819A5AD6C6287B95 T148661
804,166,926 *536753681774831D9075AA72D130D9B2CFB1441A T6PNJN
804,166,927 *5362EEE63B077DF69B6181EB48904BCA6B577D88 T6S!
804,166,928 *5367171C08F4759AA84C4C829A5E445F22C5977B TÄKTER
804,166,929 *5368FE15C2768934107192333CAC87EC41EA9EC3 dossiered1
804,166,930 *5364ADAEC079CC32390C3466A781F2F093BB92F7 DOUBLEASTERIK
804,166,931 *536A0EB3BF4E18162BB0E02273ACF33E3381A062 DOWNTONONE
804,166,932 *5362A625135E86474CA564B029C3D2FCBEEBB1C6 TATRMANOVYMING
804,166,933 *5367A3C37980F8C0E5CE8CB78920342E41C86E3B TCCCGCAGTAGGAGGTTTCTTACGCCTCTAGGAAGGCCGGCGTGTGGGCGGGCTCTGCCT
804,166,934 *536E8683E0EE42BAD2EE702C14E297456DB2D4D7 DT/a
804,166,935 *536BF3300EC9660DFFE918B06C873402D3028217 TEREAMOR9
804,166,936 *536496EF949DA3C75132CE8489543934372CFCE8 TEXTURATA7
804,166,937 *536FECDC1433CF0EB46729464E7D8978264C2500 D.vj
804,166,938 *536413FC792DE30429DAE739A79FA44192BB1373 the-london-ambulance-station
804,166,939 *536E524BCEB4B9E4C74D69ADC32CD2F89618AD3C THERMOMEDICINAL
804,166,940 *536A07B62588A0245862FB962B63ADE869A171C6 E686400
804,166,941 *5365C02C2F5ABF41BE594C0AC1BA7DF52FADFA9C THUGZ-MANSION-(FEAT-ANTHONY-HAMILTON)
804,166,942 *536B23201DD4D265D5AC6AF68EBA905789517E56 TINELLIS0
804,166,943 *536B77332D155143ED9C4F5C11056B937665DD9C EF9;O
804,166,944 *53632C9DC5F23CE8623EB2D82A36175D02C5FD33 tommiehamblet
804,166,945 *536064FEA33D0042EA92FE02C3E332AB94001576 EIYHAF
804,166,946 *5362F53D10CD72549BB4BAC1DACD66328C6CC78D ejdoorbs5
804,166,947 *53644B048D456EDE5181B1C89ECFE783317DAC4B TOPGUNRAINS
804,166,948 *5364D3607C818320A457DDD765A5CB6B8EFB5457 EKIIKARAN
804,166,949 *5365257B91EFA4A775493D5F7EE32E73C8612ECA elaineblankenship
804,166,950 *5368AF21347A30CF4642BEE6C100E148D4AE1F50 ELDRIDGE.DEVERA
804,166,951 *53640786A3C597EFEC3B59EE1F700E00DF7B7F11 [email protected]'
804,166,952 *53603C2D475C35675D360E585151747026267C31 eliseowombolt
804,166,953 *5364B1F0F930AF82A8191FDE962F8F2A4B43FCFC TRAVIAN.DAWSON
804,166,954 *5363193C16D73423F98A61712511A06520CEDFF3 ELMO.BALIN
804,166,955 *5368067D9DB66A45222EB7D41637A1E023586B08 elmoogas
804,166,956 *536068567836E60D5D450FEF951B87D266A00C47 ELOKO
804,166,957 *536AACD41E1FA6FDD3A39A19BF8B48DA06F3DC78 TRENTON.ZOGG
804,166,958 *536D526EE2F04B172338E9248C7F147B7031B107 TREVIS MCINNERNEY
804,166,959 *536DD53309340D9764B336C37766B71BAA72B354 EMASDO
804,166,960 *53672FABF99EED097F666341C5F05165B53E7F4A TREY.SEAT
804,166,961 *536D6EC4D20C64DC826E7BADE5929CDDFDEE26C4 TRIANGLECOMPASSCOMPLEMENTARY0
804,166,962 *536FA1A4B2ED8A64E125698C8C1A38D45ADD3997 emilyknobloch
804,166,963 *53607BF1122998FD09900958D2E1D867A1226622 TROPIKAL8
804,166,964 *53660C523522C286A4493185D5B3D565D52C3935 TUCKERRIVER0
804,166,965 *53619376D6271F6A3AE12A07B6C3B4A973224035 TUCRIAHBSW3
804,166,966 *536AD85062C197B04560DCF4F511529FC46EB247 twderd6q1v
804,166,967 *536C5D9DD6832D4BDB8385C4D442344DA23DB5D4 epqb=
804,166,968 *5367406B972A0A3C0B1AADCBE8C78FDCE723E006 tyreedepasquale
804,166,969 *53623480E8C9ADA62833D74D0C3E5A1EC968C9E5 TYRONEGAVINSKI
804,166,970 *5365F569DCF7C7F3ED8A43949F9838076A31D8C6 ERINFLYGARE
804,166,971 *536F541B76EDCA1382AC9ACD7AD0594B5E5C6B86 ERLASSLICHE
804,166,972 *536D130738AACCEFBE40EE4B2B125DD965E4AB23 erotomansed
804,166,973 *53646B785914D54663A86442BD79D40142F86127 UDESPARATION
804,166,974 *536B653CC694EF6FD6A1717126851FDE70ED65FF UDPEGNINGER5
804,166,975 *53642CE1B66228EDE2FE37BBC79C17E1A3761345 udvx
804,166,976 *53624B157FF6BA2F778785614A19C209C9371485 UINTAITE6
804,166,977 *536C55DFE2BEF7AE29DA6000E163B6D5F9D41C8C esphw
804,166,978 *536127BC6523AFC71C3327191AA6CFADDF803E63 et1l"
804,166,979 *536284437E1EB1554A9468A2DAD8F296FEEFC0F6 uncontinently
804,166,980 *536CE04EA7603B49D525890334AB7CBCED2FC2BF ETTELUBOED
804,166,981 *536FF06DEED2A1DF2ACA66F5C49FF4D1A51AD6F9 eubme
804,166,982 *5369D6D42DDC1181D1F32D6D2D5EF475C3BF0587 EVANDRO.MESQUITA.&.FAUSTO.FAWCETT.&.TONI.PLAT
804,166,983 *5362F55D20179B762533C3AC9685B733FD0223AC [email protected]
804,166,984 *53605FEA785CBF1537CCFC025560291DAD636555 FACTORING.YOUR.LACK.OF.COOL
804,166,985 *536D6F9FE0A3C2A499870699B846996CC283A0B6 USEROWNERED
804,166,986 *536F763EDDB0A87C95ABD93BF9D86FCD6DD6610F [email protected]
804,166,987 *5361D8BCC7A84428A4453E4D75A795877AC1FF31 UTCIEINNS
804,166,988 *53620FB5E0F342195BB66296668CD39D1A2D2064 FAT_BONO
804,166,989 *5366471864ED4AD5EE3C2B4FDF5B5D61860CEFAF va)[
804,166,990 *5363FF4F247978969B192DAB4E58E8EB73CEA795 valentinshadoan
804,166,991 *536ECE6C3E1D0D3BEC493B1F90A033A3BAD7F5AE VANCEAMING
804,166,992 *536ACCF03F91F40DE2BF1E7A0E8877CE421CB63F VANILLAT6
804,166,993 *536B06D818D2AA04D6E60E53956DB7DA7439D982 fhy
804,166,994 *536599970D3CEEF1EAAF0BAC95683E0F777DFB00 VEPU
804,166,995 *53660BB86C712FA9E80D4E1E0DF69707D7B0E9DC FIN-WHA1E
804,166,996 *536775FD6DC8AD713F03500639331412DF59EDDD VIC-BADAMI
804,166,997 *536D7E81977331CFC45449167F92FFE39BB10AC6 floydkastendieck
804,166,998 *536548CD14830A587112A302BA58FA5C521072D0 fmkik
804,166,999 *536CC008C4E084AD797BD21810D99AC8F55D4362 foulcries
804,167,000 *5365EFCA9D41D53CC4FA9149C06100539D70C0BD francescofelberbaum
804,167,001 *53651E4FEEB8BD5320692833687963AABA7D4EB3 vipankushalappa
804,167,002 *5363949CF82F4295E7E63A183DFD34D70C8D67E2 FRANKIEVANSTRANDER
804,167,003 *536DDA75CF25A54938822A212EE51BAC91E33F67 VISITVISIT
804,167,004 *536315FC4F1B90896B877440D56638D1E21540D9 VLADARĀ
804,167,005 *5367C69915B1F288A293613230223CC7271D5714 FREDERICVENEMAN
804,167,006 *536928F66C1D87B0E308C2728CEE667CC283EF6C VOODOOMAILER
804,167,007 *5369C98DDA40D2FD20ECDABE15A40B59063FCC47 VY­TVÁŘÍ
804,167,008 *536D5EB2C37EEA5493F5D6FCEA2BBA0194C75F23 VZALACLUZLY
804,167,009 *53646C30917F04236C37787DFB68A194F1621899 WADE.BOCCHINO
804,167,010 *536F3B3629CBCBF4D47D041BA326699571D51A4E wael-al-taey
804,167,011 *5368FFBDE0C98667B99CB97C37F5D804AB54E903 WAKA-FLOCKA-JR-RICHARDSON
804,167,012 *536DAD02398E5877D59780DB79250A8A08A1EF99 WALKER.GERCHAK
804,167,013 *536AA9455B834ED37623799ACCD59A6655C244E7 wallyille
804,167,014 *5361793DD5FA15FF08738C1212A00B7E0ABE179F garfieldstordahl
804,167,015 *536C2BCA5CC2BE9A66438E024818A4A6E3646278 waltzformonk
804,167,016 *536BFE763CB0FA8BDA980BA86B199A76D462E59F [email protected]
804,167,017 *536515F68211CDB717ED8A24F19A7CD344E050C7 GARY.SPECTER
804,167,018 *53618A71DD9C796CF109EA7FEEF0BB94C18688F8 GAVIN.BYAN
804,167,019 *53610337DC4C52D705C8F6EC4B5E165019662C96 [email protected]
804,167,020 *536110D56C1AE63709789592FD2DFA58D467E61D gehnichtvorbei
804,167,021 *536C15A7430191DBBF42004FD88BF47FAF708E6B GERARDOARCILLA
804,167,022 *536C289190B06570D6DF13044B3612B74A1E22E6 GLDVRLZN1
804,167,023 *536250D1BBFE37C9E39B83E837D581B9C505DB69 glenwieber
804,167,024 *536F04378818917BD16D8246F181497EE1F6CACE [email protected]
804,167,025 *5364534532DCAA3D5F8B0D9EC1BB46BB97F7EDD5 WENNDERMORGENNAHT
804,167,026 *5362F5249F9EB6BB1C8B99CBC912150B06EDB3A7 GNITUALMU3
804,167,027 *5368286988AE5CD7501EE5DAD75075A192712A43 wheezer
804,167,028 *536FF8C5D812DEFF9B958E9A564B36FC7A171392 GRADY.VILLAS
804,167,029 *5367E50D6E07BF3F649919E6B1ECE3B23CCC6E97 graignord
804,167,030 *5368B92F16338C95374594D0CFF77F17AF61F87B greenfieldpatents
804,167,031 *53641116C5F1169996B8E12975459E29CB2B7040 [email protected]
804,167,032 *536C4AF3B408D61870135E09F8063559F29BD5D7 williamvanfleet
804,167,033 *53682AD45F8545A006A8FA2BF274F47127E863EB wkugrg
804,167,034 *536F3BB8B45B567C71778528D7D3B28726B7FFBF wonderadam
804,167,035 *53679C04DC99525751653132F5226F1B1E4D74B4 WOODROWPOPPLEWELL
804,167,036 *536FB04CB038CAE546061C5A5F713AF60D4BC49F woofsession
804,167,037 *536B28FB0857A960288499C2C2D74F912D57542F [email protected]
804,167,038 *536C7F30FE35A9B9BE19DC080799A6CC29F46E6B H005IERD0M
804,167,039 *5367C4678B006590929B90682B243BC6E03CB366 h[1o
804,167,040 *536C31C3A5641C10D9B2E3C24941A25447FA53CF HARLAND.VITTETOE
804,167,041 *5368E29FA5F0884E23413FF37AB4641DDBCD4831 HARLEYVANHOOSE
804,167,042 *53636A91BD230C6900275A7F4EE7307043E56842 WTKGAM
804,167,043 *53662A2C2231C38AEF6D9FD3F3D62FFE064727A3 hassansurvant
804,167,044 *53622D8E30EE22D2A114ABF35A3DCD5317710BEB haydencoral
804,167,045 *5369C5703C6507113FEDC318DBBF3FE9A978DA20 haywoodkenady
804,167,046 *5360657C07F2492F3ED40A5075BA0EE03B1454D0 www.noritamericas.com
804,167,047 *536BE7398C77C904628BAB3E3C905573557903F0 heather-m-gabriel
804,167,048 *53648CAB63E0471869ED57ECD93D596306AD88DA WXSR
804,167,049 *536A07CEF037920E9183C67F0D56781F43E96646 [email protected]
804,167,050 *5361CDEFEE88FB3DCC1B09E69B1359B5C6EAB243 heribertoduberstein
804,167,051 *5363EB9CDFC3C07306502E5598BF3EB8D05ACB1B XASHX12
804,167,052 *536B535460CECA1EBD7C44E4B13D1ED647A93474 X\|E
804,167,053 *5367DE5AC23E7FF3BCEF54124F39EFD83ABE4BC2 xnae
804,167,054 *536A674B22305193895A05846F91C791769DCF82 HKRN
804,167,055 *53670DBC9125CE1D719B00234C94484338A588CD YABYOUJEJEMONZ
804,167,056 *536E8C42F8167091CF617C59F130649EB64602B1 [email protected]
804,167,057 *536C3964C37B1B856BC957D82DE3A29CF272C0A6 yansitirğa
804,167,058 *536DFCBCEBF71906381D951EA5976819B28DD40A yanuarti.putri
804,167,059 *536F566E7DB2CD54617D6B1618454CF64F0CD5FF YBYRACAPÁ
804,167,060 *536D0D7E53BC0BAB8A0A09650D2C73B919D16532 YD+J
804,167,061 *5362028E1F2D94CE28A42727B97B15D967BC7029 [email protected]
804,167,062 *536549618FC984F37C5889343EB4B18B0899114A [email protected]
804,167,063 *5367B97A3CE58AE727EE2C8655778B982AE11538 YLBAVITLUC9
804,167,064 *536D8D1C528ABAFA7861DCF2EB4B211E2A2B70AD YLGNINWA7
804,167,065 *5366788A1F078BC200E69F9A5DCDF2F5255A50BC humbertoswanberg
804,167,066 *53696AA5420A086E08647D452E812560A814D8C7 H\W6
804,167,067 *536FFD88B4D2B2E1C0DB4C2BA126314FF7B495F8 yoshokai7
804,167,068 *536C07BBB7A6B2304AEA461D9229249467D5670B ielisha
804,167,069 *536AD40502999B988AC0613B71A4899D19AC156A zach-bucholtz
804,167,070 *536DCECD6CDC9C6A3E57489A6776A85B8D86DF37 ihm0
804,167,071 *5362DA04CA9795E15712BAAA6AB0A4CA9C0D134E IKMSEDHL8
804,167,072 *536571F8A5B2E0A2CE0B4BE6F7B69E7E4B44A04F ZAPATAMIDNIGHT1
804,167,073 *536BAF8D2C4D2866F7299949429370AE79AB92F8 ilderne
804,167,074 *536ED94CD2678D4C88A6BCEF5B1515DDF732895D iloveasshole95
804,167,075 *5364D71D9CC7BC8E5065BCD6ECE835AB805EBD83 ZEROUK-MOULOUA
804,167,076 *536D7B67BF4795FD8BB990E7B6AC536D69BBBC22 ILUVSTINGRAY60
804,167,077 *536F92BAD5F3E8A91065B6931BD833D422D289F6 [email protected]
804,167,078 *5364C2A57D82AA5F2A63DACE8B67AA18054478B7 ingtp
804,167,079 *536ABA5E12E06CD79A1A7F37784C49D6DFEEF1A7 interdifferentiate1
804,167,080 *5362B25E8E61FEE2AC4897B8E104677C2E841FFD ιερoύσ
804,167,081 *53672A7DA613F6867797279A929C84A3C368CBA9 ΜΕΤΆΦΕΡΈ
804,167,082 *53622D772BBC57A18BE62CF2E0ABD5D8BC23DAA3 альбикастро
804,167,083 *536F518682C36E510C00FEB16C1EB6040CCC3035 ISCHIADICISCHIADIC
804,167,084 *5360C0C0CB574CDFD922D1AAD25CF900C3D59AF8 israelinegypt,partino2:thesonsofisraeldomourn
804,167,085 *53663982FAF0FA3EDF05972C2D51FC848E1DB54C it's.about.the.size.of.a.house
804,167,086 *536DC5CA677FB4CFEEF0A25E5DA554659D63F7FE ЗАХОПЛІВАЮЦЬ
804,167,087 *5362773BD76C2BFC5EFEBB68A97F3F2B1D14B6A6 iwq3
804,167,088 *53631C08FF67F51B4DF4DD8CAA7D16DEADA75BC8 [email protected]
804,167,089 *536D8E9EFB67E769148EF88D8FBB0A76BB48C0F7 JAHARABAD
804,167,090 *53605A48C7902E5C670C7220B151183AC371DA71 jamelspinka
804,167,091 *53675429462B0D645A135818DF7D60A55EE6BE3B james.kastanis
804,167,092 *53663541A72F2197B4779C64D9225383B7D36486 симпура
804,167,093 *536AE79690C901E47C90418FB600900E61272068 janedgeworth
804,167,094 *536816B8B857619E8DD10757B754208B6DF8A6F5 janine-antonio
804,167,095 *53647781B6BD34FC526EAD0D0CA20D46E715452B JANNISE123
804,167,096 *5369A7B1DEA18FFF033763CD034C1CFAEA6C35BD ЦИРОТИЧНИЙ
804,167,097 *5361195B5592AB8117C47CE0C44F0C565B20ED5C ЧЕРЕДНИЧЕНКІВСЬКИЙ
804,167,098 *536DAACF5DD9A0B42B99AB82F2CA5E61231A8B10 jermainechubicks
804,167,099 *536E18114379C46ED9B010F7B49107D5D8E29F89 JERMAINE.PLAUCHE
804,167,100 *53624D1DD284A525B0D22B400C388B9B3E80E42A 。接力賽方面,中國分別在男子4x100米、男子4x400米、女子4x400米三個項目取得參賽資格
804,167,101 *536C145A00D45BC852637626EE1FB691C69514E9 JHT115
804,167,102 *5364B4606BC4D3CBCD21DBD0E3D4D9C8519A814A [email protected]
804,167,103 *53630D9A9830755B03B4B5B75543065820C6902B JLUK
804,167,104 *5368CF1C47C59D316607A2E33BCB5481754A538A jodywolsky
804,167,105 *53658733AE1E5850DE7D9056861762C071CF871B JOEL.GIERMAN
804,167,106 *536859A40C9BF408AA363A718E6404F7132655D1 johnnysheehan
804,167,107 *5366EE23B09746649F39CB345008AFF919D8CCC8 JONDAUL
804,167,108 *536648429DDD934BEBBC11F16351338C8CBCB7D4 JOSHUADOLHON
804,167,109 *5367119FF110869F399636D2FB9EECF025575DA6 [email protected]
804,167,110 *5362FCF7381831AD25C3A446E54E3D950E4379D4 JR KIMBROUGH
804,167,111 *5361593065D379DA9193C60455A1FFB6420CD562 judsonemmett
804,167,112 *536EF6C3057768F3B16209711CEDBE14235D483D JUDSON.PINNICK
804,167,113 *536D6E1C1FF6C57EDE61213BFAFB5BA0543C5499 judy-vanover
804,167,114 *536CE7C81A006FE09DE07363CFD318BDFEDE02CC 『ドクターマリオ』をドラゴンクエスト風に描かれたrpg漫画『
804,167,115 *536ADA4B62E38276C6019FF2F5EFA88C58C9FCC1 KCZISKE
804,167,116 *5368EDC32019814E66511C1C4AA9BE04AE0738EB kecia-powell
804,167,117 *536219412DEA5AAC59D7C58AD613DDA3F2ED21D9 038D75FA4C33F6A03B055D540A7B0FF3.TRMPKCHF
804,167,118 *536FD7076FD2B93D34151C58A02FF554835813B7 KERMITTUJAGUE
804,167,119 *536F475AF91D546BB709A22E7FB844B05F622BEA K!GAAA
804,167,120 *536E29CA634ED2D81DDFAFA78DC310AF01F20332 (>_0).~.`dq
804,167,121 *53648E4ECB74CAED57D106DD1C0CB90EA6A4B95F KIETH'S
804,167,122 *536F2B25077C47ED84DDCA4C0F57A01B047A98B7 )0(`Q======P
804,167,123 *5366760C6355ABDCBA1D83F24504B4DF1CD82345 KIRBY.GASIENICA
804,167,124 *53613529732B53419C344D07E2917BC0E4BCD95C KIRBYREINECK
804,167,125 *536BF78029E68F39381BCF1F7AE7579FDC30C670 1083078 tuomo-tuominen-18-
804,167,126 *536C70F683D0269449A75230785956D443CAAF85 10-COLLEGES'
804,167,127 *536973D9045659D60158859B8727955DA1D05F08 [email protected]
804,167,128 *53694F4A91A5C8A9E41ED7157954946E25783C85 137964 undwiedertrifftesdiekudamm-gegend.
804,167,129 *536CEA5E9AA59939A05D49266D5C14E52C6B2CCB kqo,
804,167,130 *5363296F74B39938654E143927B3EC4D19D5EA4D 14-uljaat
804,167,131 *53676E8957DBEC86A01F27EA0C0885A5860C2576 1530681 unemploymentfellto53%from54%foradultwomen
804,167,132 *53683950C5A530C07E5283D08678FD7A0A44DFF9 kryrbtu1
804,167,133 *53690DA4C9B5BDD753129360378C612AA96E51D0 kurtedelmann
804,167,134 *5360A38EBC9B19F0A6101319469234BF879AB43B 1807037 MIHINOLETJOUTUNUTSDP!
804,167,135 *536E12AC487593E3CBFE3FE3C22CD502691201EB 189496 muistathan,ett
804,167,136 *5365E09C7AC1F11FBCCB6C5E4CFF302642220C6D 1adels-residenz
804,167,137 *536C9E7BF66EA6E4EFCFFAB871305D46494BF62E 1CRIERENT
804,167,138 *536091E7FD9079EF108BE3CEE14B269C15C46255 1-dirt-floored
804,167,139 *5363BB7654FC19C5DE5E310F08876BDE52188796 1-euro-einnahmen
804,167,140 *536C010B3027B030316636CC1EA6E9851E4A930B 1-GEELONGIN
804,167,141 *5362BA6FD09A7625738FAE6F1555734E96D21F4D 1.HANOJAAN
804,167,142 *53651F6D085B90C723DCE2C3B85488D7252C2262 1HEERESFUEHRERN
804,167,143 *5361ED25A8BEE947CC664B256CBF1867F7CD8133 1hergefallen
804,167,144 *5364AD64C5728D2A5CFF7F3C7E9E1A6D65308612 LAURIEFISHING
804,167,145 *536EB24640F6750B5CA43A61A2C620D69CD391A5 LCARLSON9
804,167,146 *536A1C409F4BE9988C4DC04FBDB5B4D647AE1A6E 1OCTUPLE
804,167,147 *536DB23A8A5B02F7E7E5743F91B16346ED0975ED 1-PAM:STA
804,167,148 *53664CA06C1F2F196895A6C65DAEF487B0984B00 LEIKLEIK
804,167,149 *5361BBF0231BF28D5FE67F50E8D6246C882A481D 1SUREAT
804,167,150 *536E806D075FBCDFD2BE0EF64DBE4F6732479C2C 1SVINHUFVUDIT
804,167,151 *5361479CD7C67F8048FBD6796DC02E91847F1E08 1-team:n
804,167,152 *536569D70C8F5FA756A4B3B6F9172236C8534D4E 1.unirektorat
804,167,153 *53653BD0FD337A040DCCFE71BD07F23931DE642A 1 UUTISHAKUJEN
804,167,154 *536EEBDB91DF3AFC36A4519E0FFC7D5A0F745F11 1.virranjako
804,167,155 *53665D61EF7E002C0931B07F260C4E453C4639AE 1VULKAANIN
804,167,156 *536A5DA7D5E7988D83F798DD6F4D925031CCE12D 1YHDEKS
804,167,157 *5362D268A3AA9C9799233B2A81B932F356475D7A 20STAUNTON
804,167,158 *53673FA1D3DCCCF27AA5880F73A6A329B9B980CC (LETEVERYBODY)JOINHANDS(THELATINLOVEAFFAIRMIX)
804,167,159 *5361F11D42A101BAA34C68DD163E58FD6CDDBBB4 [email protected]
804,167,160 *53641430ADCE8C3E0C8493D1AB91AB50E9568A27 [email protected]
804,167,161 *53625DA1A2C4A857B2D0C1CA4D85F443507DC5B7 [email protected]
804,167,162 *536477B6B24C1813F088A19373E4FDF6CDE4581B 2518246 es sei auch weiterhin vorsicht geboten
804,167,163 *536D42C9145484B1C62265BF5284317BF1A2C9B0 LILIÒPSID
804,167,164 *5366F485369BFE3B5EF4319E6CFA4D2583BD61DA 2795138 die.frau.hat.sich.entschuldigt..
804,167,165 *536EC4F6A107E9C69D9A973E1BCFAA71A0416CE7 LINO.RUTECKI
804,167,166 *536E211937221F27BD7A2121CACBC0E55C82184B linowned
804,167,167 *536C57C6C3BFCC955B5B18A98EB3AA82BF9FCCFF 2M35XN
804,167,168 *536D5D520FF539E9774793F6F638FD001CD43E7B 2nonhockey
804,167,169 *5366B95F551D5815F0B35682672F49053F5922A8 2.schiffsbruechige
804,167,170 *53631AB380EA65846FD0C62BA3C5D500892CE903 2tiedonhakuareenat
804,167,171 *536E194945BA41FD060C7F0D532FDEA820443637 log99903381645
804,167,172 *5361ACA8F9EB032757195A56FB05043187006DF0 loganamey
804,167,173 *5368E52A090BE9423C8E16E654A53F25B88023A9 logandajani
804,167,174 *536D30957D033C68B443743D6222F1FF07839453 2.vertailukautta
804,167,175 *536152352E21F08932E710A3CE3BC173322B7884 2 WENDOFOTOAUSSTELLUNG
804,167,176 *53679E17122F360E91E689573525CF968CD3D1AE lonesome for a place i know
804,167,177 *536ACC1B4C388C90E16B9F02563625E39CC0B022 323114CE07EC34E7A0825B858FE844B7
804,167,178 *536F287C0A4C245C368EEA686640D5994994B022 337779 kus-resimleriyle-ilgilenmek-ihanet-olur-
804,167,179 *5369DDEC4C7906056C3E4F1E0AA5CF3655211E55 370368 WEITEREZAHLENWOLLENWIRNICHTINDIEWELTSETZEN'
804,167,180 *536A74AFE6FBFBF95EE63C8ECF52651BF9756162 LOUSAMOUT
804,167,181 *5362C1D14CD328AE9E7DDBA9F65E7F64C3A97DD7 LSHILLAW
804,167,182 *536734B222488D24072A1096C4593D4CA047D8DD 3ESPEREM
804,167,183 *5364243EEAF142BACCADB6210807E32E8C0BEBD2 3IAMMONKEY1
804,167,184 *53641BA7FE39E0C6EFE948EC1112E3039FBB9084 3ltpigs
804,167,185 *5362C22594F6EB8EE2E70E67E1F7E5A3824FCBCE 468738 lasten-vanhemmat-ovat-keskeisess
804,167,186 *5369B91463EA3FDF9BE257384492B2C0635BA21C LUCBERGEVIN
804,167,187 *5361C2D3BDE563D990F486E0E98E0B224612DF15 LUIRIPOGE
804,167,188 *536BB3482C8F1E490A2A96169130123DB161BD34 LUIS.HUESING
804,167,189 *5360D25426DCF6B91DC85DAF3E40CF9E4C2ED156 lukas passion, bwv 246: 55 recitative
804,167,190 *536CB77B6B506AFB7294C9962EA6D6EA14292CA2 LYLE.CONTREAS
804,167,191 *536ABF777AD4AAC4202BF497D723A47BEBB5B646 4C'BAA
804,167,192 *536254E57EBA3199EADF6E86735EC3CC6FFCAB7B 4.ISTUTUSVY
804,167,193 *536B955870CBDD05D64C586180FD41BC581D4FCF 4MB!V413NC3
804,167,194 *536DA28B35FC1DA068C271C5E8627C2D087C12E6 M1$APPREHEND
804,167,195 *536A1909AFF03133DA9654491D732B4E56DBF65A 4OMTUINDS
804,167,196 *5362F59DA4DEE13D8526F5E3B21E6CC79272F0A3 MAC.BLACKIE
804,167,197 *5362B0847BD37545BBF7879DF43AB8C9C66954C5 4UNPROVABLEA
804,167,198 *5364242CC63FF2044271C5B2421973C0CC20DD99 4UT0R1Z4D05
804,167,199 *536FDD4A9B8B14F0A9CBD087DF9DE585FC2B0F9B 4VMBRATE
804,167,200 *5364B0A5136E11D0C17FD5E287F9A88DBBBCD017 557511 THE.RESIDENTS.AND.WEAPONS.WERE.RELEASED.AFTERWARDS..
804,167,201 *536DFEC7BD378130BCE5F0E3685A33DBC70B0E76 56813 ein landschafts und erlebnisfuehrer " , oase verlag .
804,167,202 *536F9A8ED31E814180A1A91D60E961A9065C54DE 5ANC+IONABLE
804,167,203 *53637599C743AD26A4CE8228202CDF14B22EEBDF MANAKE..GOOD.FORTUNE
804,167,204 *536C7C30B76B9FFCE3AA1CA81E971E33A21AADB8 MARIANOBOHNENBLUST
804,167,205 *536E371584E62C921CA41B2C1E7BF87AF88353B1 5JFARRES
804,167,206 *536D563EF8932C1C8F5139C17F57AC4175C1A1D2 5LENGTENS
804,167,207 *5364CB00F95EBB03B99C9FA9D42062B6A627739B MATTHEWELMO
804,167,208 *5362D90C4A530190EF25ABAF735E831B4E817DC6 5SUBSTANCESUMMARYSUMMATIONSURVEYSWARM
804,167,209 *5360D7245EBA4E5C104A92BDBC5A788543541F2B 5SYSTEMLEVERANCERS
804,167,210 *5365A22E066B55E51B0643DAEA95B8C3809F21D3 5VODKAMAR
804,167,211 *536AA6452DED1F66BF6490756C22C593917CDAEA 6GUIDOSTRIDER
804,167,212 *536B119BC66247D0750CF6A02AF763710714A103 (0-0)~` ~` Q==P
804,167,213 *5362C3729FE0B9890F6DE34966EA736F2BCE10BC 0691EL
804,167,214 *536D48DF7978F4815991707DD00D8C9399548BF3 1100380 adams-erzaehlt-den-reportern-eine-anekdote-.
804,167,215 *5363156F5B3F1EAF871A082953D54293B4144584 17.CLASSROOM-EVEN
804,167,216 *5363F030043F03EFFFC1AE64CDEF7372B99A79F9 17FEBRUARY1941
804,167,217 *536567FB5C875ED0E3D8A45B6243EBB8A4728824 1 berlinportraet
804,167,218 *536C262B7D283F383D999036D91FF8B4DFF87C33 1 BUNDESWEHR-STANDORTKOMMANDANTEN
804,167,219 *536E4F3677CD4E2297EFEC24A5BDE8E6C06E41D3 1DISAGGREGATING
804,167,220 *5360C0937E672619C4036B7D33C047C19212671D 1.EFFIZIENSTEN
804,167,221 *536A6C41B24A91360B38DC5B062C5DDA59D49E21 1fieseligen
804,167,222 *536C7E591131446FF1C220362C8703F60F8FC46E 1galleguillo1
804,167,223 *53647A68791D6A4587DA53835EDE5DD9C3C934DC 1.HUVIALAN
804,167,224 *5362978AA9FE5F30C6E27D2D72BB20FB732876A3 1-KOMPLETTVERSION
804,167,225 *536A49993BEE9333347153055CD736F697304EC8 1NGOVGAB
804,167,226 *5369A71849B3ED80D894026C1533B6B3C9F508B0 1.OEVP-GRANDEN
804,167,227 *53670271966B5CD2B2C45211C423A477E71F025A 1PARLAMENTSANGESTELLTE
804,167,228 *53694E9B768314A3DC001948989D94197F357295 1pistais
804,167,229 *536F784D779D2093A7E4AEA7D9AB20296A757D50 1 REGSAMGRUPPE
804,167,230 *53615C9C36C401B9C0638E28C31A0FDB6C337EA4 1rotaatiokoulutuksen
804,167,231 *5364A69415A8935678AE5BC71833BB69F2EEADA0 1-SPRACHENSCHUELER
804,167,232 *536A9A9A66720050482167FB027418E7A7EED5D6 1SPYSORY
804,167,233 *5360ABE0493957233FB594090403AD7FB1CB925B 1-STABHOCHSPRUNG-WELTREKORDLER
804,167,234 *5365879E68B3F531F4A23DA37109C8C1A9EE9BC9 1 Theidentifica*tionandauthentica*tionfunctionsofthe
804,167,235 *53697034BBF46340A52072C8B54887459BFC8F83 1thymele
804,167,236 *536F82F5526B1312E6A9720D3FD40C78BD67EFC1 1turvallisuuspoliitiset
804,167,237 *5360E4DDC58ECFC44CC6BC8E176915C2B3E05930 207-gartner
804,167,238 *536872D9DB2B8677EE0A0CD572AC9AEE47094D7F 2576022 ICHWARWIEVORDENKOPFGESCHLAGEN
804,167,239 *536FF86EE65465F2B679E518E3E396A69494A3A8 2662366 TM4:STA.VERTAILTIIN.MY
804,167,240 *536DE49070BAF285DE9EE0784DC033F667B28241 2971778 maailmoja,joitaeiolevalokuvattumit
804,167,241 *53614145A1ECA3171811F22B7B7B6E2023FE35A4 2 housewith
804,167,242 *536E1E5E71F823C2DB101E6A1EB55986925FE4B3 2SIMIELE
804,167,243 *5361D9A3581E8C5B2CC3DD1A6B60A297965FB6ED 2SURVEILLERONT
804,167,244 *536C6D6EBD5B41BE8AD5311BD50E2A2F03CE55DB 358346 cevabInIveriyordu.
804,167,245 *536A32C9B8347ACF800CF7F13C96C0E23806A0EA 3ABCDING
804,167,246 *53619211BA3E10B23B5D3B7A0D90BC80FDF1D40E 3--B~ ~ ~)O(
804,167,247 *536CDEDDCCA34840396DEC6748EA1F7CB36ADDE0 3#>`o><
804,167,248 *536E94A7753DD33CACB0B8B4706A50BC15DA9371 472831 sehrin nufusu yariya iniyor
804,167,249 *53620BF64E8BF610B801E3C79934CBE3C9430DFC 474780 VELKAJ
804,167,250 *5368727B2A4C69AD3C869C6B329C6D5172378989 4ACQUITTERAI
804,167,251 *5365E8D243B0BFE9F68CEECDB30754106E296AA3 4BANGKOKED
804,167,252 *5361D5484356CA9C3FC01EF4CACDFFE8EDF2DD48 4BESLEYICILER
804,167,253 *536AB5830F049B490212E7FB80552D21F82E4732 4-first-anniversary
804,167,254 *536E3E20A28339E0733FE85A40F39D037F8286DF 4IAMGRACE6
804,167,255 *5369E366E22E634A5B905331023D2A43EE14BBAC 4rolli-disco
804,167,256 *5361EB64C7CDA449D23CC61D339E9EC14908314F 4THEBUBBLE5
804,167,257 *536D8F74C286CF3089C0F09C5B3F057D1597EEB2 4XZT
804,167,258 *536494F5C11F7A71B8BA313ECE72ECA49B853DFD 525769 TUNCAY KOCAMAZ PROF . DR .
804,167,259 *536DDDB301E3FAA6B7682579970672646D4F4E78 55-TRAUMHAFTE
804,167,260 *5361C1D6234022B16527FC6EDA8F1E48E6507B8A 5HALBEISH
804,167,261 *536B70DCBCD0E796D55C9A835234BC0C5651CE82 5OGNANRAY
804,167,262 *536CD78EF87041EA03CE46DC3DEF16F83E2673D8 5-PIIRIJAKO
804,167,263 *536290B08C60D95D73E8091E3FA4919EA4B0296D 5T4T3R00M5
804,167,264 *536315A2C455AF3FDB68D77795A9ADDEB45175E3 6HARARITU
804,167,265 *536C8AA163F3B8B9E2D94B9D3BE3622D98BC6ACD 6RUMAFLYTNING
804,167,266 *53682BADC3F0481FEE369834831DF24462DC0C67 750813 nisan271i.y.k.
804,167,267 *53630EDFFB2C5239E4D36E64CCCD88701CB1125A 7BOOMDEN
804,167,268 *536CD7BDD6E64B5CDA34A79C071EEFD164AD2FFD 7COACTIVAS
804,167,269 *536C7013513D2BC011CAE3048491111853C6BA5B 7CRICLEED
804,167,270 *536996398E1F8660D96A88E4932F3977E0053827 7cultimate
804,167,271 *536BA14050DF323EFB5FDD484D967AC121A56993 7ESLINDER
804,167,272 *536E2F1826F29EF355CC2B995A1D4E37382ABE79 7RIOTEST
804,167,273 *536D07F194D69111CDEB64236B43238B8F4F0EAF 7.TALOVERKON
804,167,274 *536FA605CA98963E37B656DD73D31D62BF87D0F2 7TELOCENTRICS
804,167,275 *536F9581018E590791BB93F3C63EEF84C096C006 7URA$7E
804,167,276 *5365CB316778618090833924FEB01A3013376D19 8BSWKRYSTALLEBSW
804,167,277 *5363DD45FD4ACD079256FC340C30A57E650AECAA 8BYUNGWANG
804,167,278 *5366E4C7721EF60A76890739F4A03FC82EF25EE6 8####D~0~O :P
804,167,279 *536CB7397BF91D0DD6B2DF65368BA18D23D3A2BE }8{~` ~`d####p
804,167,280 *536A8E1E8B897C6E3A64E863C26B7833A4516CBF 8HTJACKET
804,167,281 *536EBC3A84AABB989A5BDC55192561BDCADFB8BB 8KESHITOM
804,167,282 *536F1FFCC32BB6EE1D539716A06B9DB75D522F70 8LEUGNENIVE
804,167,283 *5368E1A3511D881C9E448D1BF2A871DF5A3D67B0 8OKRESNIHO
804,167,284 *536BDF1195C777EFF700335642304A4DB470A339 8OMAVATSA
804,167,285 *5364B88B3CF8283ED2CD207C7E2B4FF9D961C5AB 8p**}x{
804,167,286 *5368F24E65ED2A8EE0AEF732124B0F5D33E784FF 8RETEMTIU
804,167,287 *53611F4CB9A668F217CCF27586FFA38178AA1B78 8SAMUELSTRAWBER
804,167,288 *53687B23F0F0C733364A302E5EDD9EFF9DD8CAE8 937166 her isyerine bir numara verilerek isyeri takip edilir .
804,167,289 *536B48CF2D033AE161B357FD7429478F7B5316BB 93kyler
804,167,290 *5363D0C61C8C48AD22B9C49FF7032159BCAACC8D 9BSWCOMMLINKBSW
804,167,291 *53624BD943F96C1899886F2B0F79F66B2C532097 9COMENANT
804,167,292 *5362987EB17F65BFAF7BDB43F08279767906175D 9iloveconrad3
804,167,293 *5360BE44F8605E397A2DFCD0C328B17FD82F31AB 9larvaires
804,167,294 *536425E66EA5B03956B2853373AAED0DB70BCD79 9PEBBLESMERCURY
804,167,295 *5362C00CFE4B95FDF06F3D27714725BE3C4F2502 9SPLENDANO
804,167,296 *53685610FB09070971C21A9D6B284750CE8FEE86 a$.%-
804,167,297 *536881051907C682BBE916D582705084A04EB7A0 a%./"
804,167,298 *536A0704AF2D6FC417129A1D6F956F19DFFCC7E6 a0-#o
804,167,299 *5360841DAAD029C1DDEB2F6F14BCAFF915A2054C AAEQ8(
804,167,300 *536E23224A39940D4203CAA45A02BB93D50A7F77 aby8t
804,167,301 *536024EB1D34B16CDE7FC11D87BD686A5FBA22C8 adlnj
804,167,302 *5360F22BD64A450F05A50B9202FBD4032AA1A5D2 [email protected]
804,167,303 *536A7BA59F153C09D1C5097CB19D86785BDE891D aerosolized?
804,167,304 *536C8FB9CD98338B6D2A91850CB2CE031338DDFE Af#t
804,167,305 *536A5F17D5533F535B3C91A6ACC69F36BDD45F5E agustinmcfarlain
804,167,306 *536FAF9523E575752E28E1EE6F1CE6CC0E793AD7 AHC6X
804,167,307 *536BCE6BE2FE27833910149887CE05A2CDD86D3B ALEXISHEIXCEL
804,167,308 *53600290BDCBAF289CAA83778135335886B448A8 ALFREDOALEXNDER
804,167,309 *5363A41911851D25BB524EDF306C49DEBA5626E0 ALHAIDIEDOVE
804,167,310 *536DC4D2D4851F83653D5C796D3771DFC637FE61 alicabla
804,167,311 *53684101C05AC4A886CF5C42E1D6A39168F5AF66 ALKQ,
804,167,312 *5368250527DCD73F185A23C5656186BBEB67498F ALSMMIRG3
804,167,313 *536471DC3FA02CE87C419685C42A6FF656BB82C3 aly-saber
804,167,314 *5366449CCD2E9B3C8B59E0ADD58C18C5213486CF amarkantsingh
804,167,315 *536CA351D3F893F765F6752DB40F576B5409AC64 amy-kief
804,167,316 *536AFCAF941F08E4CB8484223228964B427640B8 ANALGEOM5
804,167,317 *53644CA3523A949D7AED7D4F8F35F2908253C0F8 ANDREASANDREW
804,167,318 *5363EAE16DD98E72ED46E6D5C91C2177C9198918 a,"nh
804,167,319 *53649B9ED7525357920BA6B011FFBB13FBFC8AF9 ANTWANLEVISON
804,167,320 *53646B76B88FCBCA1B2FFA1219D8CF6DF0E6EE79 anubis-nout:.i.anubis
804,167,321 *536120D748CCA802C45BDDE3D8FC33A7162E0002 aņvan
804,167,322 *536F08B8FFC4F31B7CF9CBD633C37228D8472381 ao:
804,167,323 *53694331FC0B3743E445796A17702436E389FA6D [email protected]
804,167,324 *5362286E1C3FC76D2BE9663C3E82188EBDEA6835 AR&_U
804,167,325 *5369FB562CC38D63D8EF7C6923C4A4C31695439F ASHLEYZIRKER
804,167,326 *53605B6029B59A0A086754A252E04E8702E600EF [email protected]
804,167,327 *53617E689BCA4105DCD49B13D7C96C5623AE8EAF au.feu,.au.feu,.venez-moi.secourir
804,167,328 *5361352937959B6C47EB126DED21727185792D42 A#VLF
804,167,329 *53620E0EF412323F224353C0B4FE58CE722CE0A5 B9"G8
804,167,330 *536357B34C7E4B530BA667063C8861EF469D2A02 BAEBB
804,167,331 *5367BA67AF090D1E380ED6F52172217E7C145E89 [email protected]
804,167,332 *53629EC02477880374AEEC602ACE1AC17B9C47D3 BANK97
804,167,333 *5366E9D870B6495965E8159B8D9F594A8620171F ba=so
804,167,334 *53664190AD75CC2F234FD3EB62928DD6ECAA94FE BBD2
804,167,335 *5364ED13BB716C2B61B0B1D2122B8A7F66EC8D41 B.DWK
804,167,336 *536BFDBF3B39072AEEF269F202C0604ACD6AE496 BEAU.HOLDERNESS
804,167,337 *5362447D5C3AB26B62A9A3AFB2F920A00269586C B,EEV
804,167,338 *536CC084DDA35F80D8A02D5067313FCFE7F724A8 bf2bt
804,167,339 *536E2EA4C7CC65F4B6783417C937EC56C934D3DC BHSIB
804,167,340 *536A50F592B2C41A3B7CE090ECE4141990136F32 bifluori5
804,167,341 *536A3B79BA81BA926C7E1B74BED293160B6A3E08 BILLIECOLEGROVE
804,167,342 *536AA8515D587B65ED4BAD25C81246F87EE92AB2 BILLIE.PITTA
804,167,343 *536CD2C47C2D784D71DB8A22966831C3BC6BBC02 BILLY.MCCREA
804,167,344 *5361C41CB1C00288D99636932577C7E9D0F454AF [email protected]
804,167,345 *5360375A5B0DEF1E970713387D97F00FD93451D0 BjSA
804,167,346 *536AD3D281BB7BFB4C032D513C9302AC5EDE6260 BLOODMEAL0
804,167,347 *536280A864436A438503847EF742990F6DA0D893 BMD
804,167,348 *536472A7CE02E3C225C3834811B0E9E207ADD762 BNOC#
804,167,349 *53673FF11C01F692F08171BF048CC61E4FB4FB4B bourdonnement.
804,167,350 *536291C41E3412279B74C3C2A8653321BEAFC8C3 BOYCE.RODKEY
804,167,351 *536363D97ECB762A39AD4829B5A65AA4F87E5380 bpe%g
804,167,352 *5360731927961754C63E14E0699C894467A3F541 BRENDANSALIBA
804,167,353 *536082896CC72087DC6297030BA5A3BF2B2D924F broglios6
804,167,354 *53611935282694994076EE6B774E358B09A6ADCC brunobulfer
804,167,355 *536D12C9ABCCFFF3C79D6CF9CCBABDD09124CB00 BRYANBRINKMANANINTERVIEWWITHTHENEXTTWITTERCELEBRITY
804,167,356 *536A3CCBF825622E99028102488340C66E003793 bryceromie
804,167,357 *5366E98925E9702F5123735950220C95805FC841 BSK
804,167,358 *536B0710F98450C8A49A120FB85829CE28857378 bswtenkanbsw
804,167,359 *5362071C3F493D3CB2C0FE7D9309B5FF507374E4 bt#=
804,167,360 *536D6626DB85D67E237BE66FC056A5B84276D969 BUCK.SCHULT
804,167,361 *5361CC8FF04979BFF62063878982E233686CDD96 BUDDYMEDEARIS
804,167,362 *5368B8F1B252EF2D32497E0A040F18C36B021ABA [email protected]
804,167,363 *5362826DB10D5BC4FD72B5ACEA704FC7F5D9CF62 bu,ly
804,167,364 *536A2EAE869304E09E72B4E7ABB7079A3EE5C15E c[*>
804,167,365 *536CE6903431C142620210D4E5172C6C1079BC87 C5T-
804,167,366 *536F686FC42D516E7FDF60140F59E59527C76670 c8lzb
804,167,367 *536DC1B5A67CE3868403EF100FFAAC6297D613B2 c9m
804,167,368 *536586BF721DE5069601ADA8176EBF3620481E17 caidicsa7
804,167,369 *5363C28AAF5FC8679892FF3268DF369B177ABAAA CALEB.OLARTE
804,167,370 *536EB41471F256D516071FB5D9461EC191DF7A9E calefactories0
804,167,371 *536F290E33C86EEFCF58A2661EB098C44C781EF1 CANDISSS
804,167,372 *53610A705F69961B67B58A9852856D526411D11A canyoudigit?the'70ssoulexperience(disc5)
804,167,373 *53667F95A39B7CB3C514C02A2167465F6E802ADD CARAÏBS
804,167,374 *53626EA5B2B1885A5ECF1FE32B4355D0822B433F carrera''barbara
804,167,375 *53614A5B7739A9AB4222DC9A365C5A620A1A08DD CD?K
804,167,376 *5363C3B5D4E58BC633D2918DC434C18DF2973248 CDRSL
804,167,377 *5360DC64C3E7356E2353D0FA74AC7B08E6FEA71E CESARBISBY
804,167,378 *536D6B191DC503F4809DD84228BD2A0C953306B7 CEYTN
804,167,379 *53653F2DD7C671900EB3E929DCC9FEEEC9FC1FE8 chander.sachdeva
804,167,380 *5362D19D04AD953157B90966608C1713940D1926 changangelozzi
804,167,381 *536CEA213AD9E09B990E7A207C99B34BD5147BF8 channaho7
804,167,382 *536B7302FDD700D14FB8EDA054C5E323D1AEEB81 chase99
804,167,383 *5367D3FA337160592C8F4B1948009CDE49902662 [email protected],[email protected]
804,167,384 *536CCA660F50D24EA9ED4BEABB52A245F56E1769 CHRAUBSTING
804,167,385 *5364F3543AF33A9D41C002042ACFCB7F05C70621 CHRIS.CHILD
804,167,386 *5363CE3C01C5707E987D23804C5CC9006BAFA515 CHRIS.SHRIVER
804,167,387 *53638630AD53E94003DD819FE875188A0E046630 CLD_E
804,167,388 *5363BDCDEFA27761B5FB73EEDD92F85B4A413530 cmfii
804,167,389 *5365CE714D462BD274DA5AAD63C31D566C75757F COCODYL!
804,167,390 *536A99BA20A0A0EF9D365DD715A5B2A32653C732 CONCARAN4
804,167,391 *536E98E5A044E9BCBE0B40D1F815E78BF86EB1CB CONRAD.COLASAMTE
804,167,392 *536614AE5A257873378101FC24593FBD741BB358 contract16
804,167,393 *5362B6EA1741ADDFCF85767838267C04F4CAFFC8 cp7._
804,167,394 *5363F7537455DEB4EBBDD831244F660ECD602A6A CPM:$
804,167,395 *536BE4F392C1798C7192DDC1B878147F81AA19A6 CRC=
804,167,396 *53676D2CF48B0EFD14AC1D8677B228564C630ED0 [email protected]
804,167,397 *53653736D2BAFD5D508CFE14727F7671B70EC4F4 cwgm+
804,167,398 *536A261CC792D9BBDA74457A7F1D94D22570507E cz98v
804,167,399 *5366CED110EA1735DB4947493CF13B48D31DE4C2 d=6_g
804,167,400 *5365AB11CBF0DAF690ECB791FE3547265EFE196F Daleska
804,167,401 *53606AC65FFEFDB51ACA1986A3366D00C14F108C damonoflahrity
804,167,402 *536695F0E21E6FC704B2E33182F21A70756C40ED [email protected]
804,167,403 *536609830953970262A529791264CEBD54E8D436 darellparada
804,167,404 *536CB1CE7FD1D4CA01B258D53B585326DA8D6B7E DARNELLMATTIMOE
804,167,405 *53656F538A01F851FA850F8A13A3F1135B8AF7FB DARRYLJAILLET
804,167,406 *536D2E5E17852E100BC74391A13053AF09A7B4FE DAVE.KITE
804,167,407 *5369A069F192293C58505FC47012A87166504678 DAVIDILY
804,167,408 *53600049A9AEC5E97AF308AD570CAE5EBCF92599 deangelowhisker
804,167,409 *536D658EF08C141F0F10F13EC30A6730D7E029FB DEM0N$+R4BLY
804,167,410 *536301D7BDF96E6F5240B104AC7E673079D07300 DENISETRIEU
804,167,411 *53642C38F1E46B44D61091BFF180BD1154DE694E DENNY.HOLEMAN
804,167,412 *5365724F37CB369EBF70CCDBE64366B1D7A65B12 DE.NUESTRO.AMOR
804,167,413 *536DA0E6FC96E0FC02D4889BACFD396D7FD98B7B deonmcgown
804,167,414 *5361BFB2061DAE701ACA2EE3841835481569E1F6 derekswagger
804,167,415 *536A49A6A7A5F9185CD1DD2DB33B4DF2579C8A37 DETAJF
804,167,416 *536BC6D1E7D7AB280D89C1F48ECEDFC6D3E86A8E DEWITT.GUOAN
804,167,417 *5367A661AFF4A9F37199BCFF4786410EDDF21DE5 DF(QE
804,167,418 *536FCB5C18F74D4F44382372784418DB2A7309BB DNTCT
804,167,419 *536BF81DA5AE65586492EA162BCD4E133B075A47 don't hear a sound
804,167,420 *536BC24E8DE8E825AE008B89A611727BCF2BE196 drvq/
804,167,421 *536E9A87C384CBDFDCF1CA846E6654F27080D1D7 DWRV+
804,167,422 *536393D32AF112413F11A69594E89A1077EE5602 EBEN BREET
804,167,423 *536A0267AEF439932BC196E8B34138DD95FEC4C1 ECHANICS6
804,167,424 *5363D03B32D26ABC5F67A38A4D6F616087C97253 ede"u
804,167,425 *536ACDC3B7BD430A5F3B2B517BF832B233B089FC edohtakis
804,167,426 *5368DD32D45322C72258A276DA24E4B152894D44 [email protected]
804,167,427 *536EA203FE1F7911EFE0B1170AAC2E5554BD4256 EDV%I
804,167,428 *536AF2738C4644CE34A95F9959163D5F920302E5 efiu=
804,167,429 *53658A968C6C49D1873E48EB5216BC93EF0CD977 ELLISDATAMPHAY
804,167,430 *536A5FE91B75161C487097F0A2DD29E263BAE6A3 ELOY.SMREKAR
804,167,431 *5366B1C2332F20AB954E5969622D28D6B52D9448 [email protected]@D0R
804,167,432 *5365838BF11A8604FF2B981E4AA93E1B0AED3255 embrace-the-martian-(feat.-kid-cudi)-(seiji-acid-remix)
804,167,433 *536CF731264D7E9945BCA515A4AB39F120E253F4 emersonrulli
804,167,434 *536D5FDA7EE40E05EF14EF89AF7C6F6344F397DE EMILIOBOULLION
804,167,435 *536196393701F56D73674C3A1FCDF6217538ED34 EMJAE-CRUZ
804,167,436 *536E4C5759972CD1B829AE75CBC5D0DF3D9D16F2 EMMA-RUSTON
804,167,437 *53690A7DEE7D21312329AAB77C1BDA28AC611935 emmbq
804,167,438 *5365C892B0DC6237F1C0C5EE292C892CF0D8BE00 emoryhuyser
804,167,439 *536199DBCC382912B81F699210F784DBBD3F5C87 EN172.143.88.111
804,167,440 *536FC25528ED6CCC2988A21C9A553AD65C678B2F encyclopediaits
804,167,441 *53615B3F7E7FAD64214337131BD2EC045E725F43 ENNUO
804,167,442 *53606476617E7D85B7B113F50E59225FE3E8311B [email protected]
804,167,443 *536C36A570F4EA76DDFE042B4E4D3B752E337CDE enzam
804,167,444 *53629442BD5BE66332077628E479CAD7D29E59B1 erutansided
804,167,445 *536938C7FC844DF4ED6490AE6E199FA5B7098DC0 ERZEIDEN1
804,167,446 *536889AF8FE9591957078A916BC71444C39F0F3D ESIWMRET1
804,167,447 *536E20D9014200194A6C5B4AB6565AAF3C7F6312 ETIXNORB9
804,167,448 *536AFCE1CE8A17224EF964CDAE5F9686508A73AA eui/k
804,167,449 *5360757D9074B32B0155542C3A459ED7DA110D75 EXULCERAR0
804,167,450 *536C9683F12FC3D91B412E9957FA22E57906CA2F ey"
804,167,451 *5363C2D3FA5822C458C4D2EA60B561C7F7E12BCB f6D
804,167,452 *536023E56C6DA3B55CCCF09D1842A92D76E36AF5 FASSADONI
804,167,453 *536742B94EDC8E0BEB61271AE314A446E4FDCC24 FELIPEDURDAN
804,167,454 *536F2DCEA0A9076F2201D43126BC30B298EBAC39 FER2132FER2132
804,167,455 *5367AE6308376A2A764E5133A8E7D135362A7878 FILLMORE MITCHELL
804,167,456 *5362C126373349FF5D6A07AEDE780267BD15C767 FLOYDBARKLE
804,167,457 *5361547750FCC92C4D09DDEC7F1FCFD1A7AC884D FORCE.RIPE
804,167,458 *536A1392DF9C58A91DF445011DF84DE4BA2F7029 forestauge
804,167,459 *53616A80E43C53B60CA5E7C5FCC27D0F048C2B24 [email protected]
804,167,460 *536D86A942F069A0540408812CF54197974B427D four walled world
804,167,461 *5362E75335CBA095A0F137A6696A19AFB3C5AF0E FRANSJESWEG
804,167,462 *536EBD4568DCCC491D4D3CB6BF290C7A625F5FBD FRATQU02MOB
804,167,463 *536A845304A6C3D6A4159B0BFD290F24D49DBC2D fredsgay5
804,167,464 *536764172997F6B9A974657A689CCC49D69F8162 [email protected]
804,167,465 *536B5C8E33A36DD064124687BF920519FCF35297 [email protected]
804,167,466 *536441CCF2C5B5AD9455E79F658B34CE3B14507F fulcrumed.
804,167,467 *536067B6A36CA5AA8AF4C7C9D6CCFCEE8CEB3762 GARTHOUTLAND
804,167,468 *536EFE9883CD7B5B39F6FB0E3C5FB7C1CC6A1C50 gelinadayina
804,167,469 *5363D4702F5672243879EF5D5D880E7C02A57669 GEOFFREYKAESEMEYER
804,167,470 *5361BED817FE2478A7750330A9573445514878E4 GEORGES-FAIRCHANCE
804,167,471 *5365C9C520ECE8BF19FD217752245CD1C1212633 [email protected]
804,167,472 *5367FFD56397DD8E716FC76CEF06C27355682097 GHERGHINA1
804,167,473 *536AEB8E703472F36B5C70F4736FB73732F48CB5 GIFTSES7
804,167,474 *5367756AB56812DBF851A907C71E9C8AF48E2B0B >gnorts/<ecnedivE.lacisyhP...4 >gnorts<>"62L"=eman.a<>p<
804,167,475 *53679C1B013DF2EB93FFBED2B801A475C5DE36C4 GOLBHAVI
804,167,476 *5367FA03E8883719D313FF324E18663B4BC2C622 gothiccompilation,partxxxvii
804,167,477 *536AE726F0975757FBE2BFA6E0C1DC673C95EC5F granvillemcgeeney
804,167,478 *5362ADE3B9AF1AFBCAE7B38DFADB23846B2BD7DF gregorylidtke
804,167,479 *53682681754A0CC2C1C28B7D0BBCF6989F5AA6E7 GROLLEN/DIXY
804,167,480 *53659DC07807E521975265BE730E95FADE25DE80 halete
804,167,481 *536A953FBB0B1C99C10C24552EB613D374FCFC32 HAVE-TAKEN-ON-MUCH-OF-THE-RELAXED-AIR-OF-THE-DEEP
804,167,482 *536C131A4DFF173901D7C17D05CDAC0E734CAF03 HEENDLY2
804,167,483 *5364B1EE893D27D080279A7A19212C26DC8B985A herschelwinfield
804,167,484 *536098F56DBBBF7EECA7AE3AAE3224A005C33E7C H>HY
804,167,485 *5368114845C996E2828464CCC8CE0462C1D5FA8B HOLLIS.CARBERRY
804,167,486 *536EB006E0869246064C033C54B49DFF604F9ACC hotdogbeaver
804,167,487 *536483CC30FCA79900C66B70C8E7E32DBF9849B6 [email protected]
804,167,488 *536296C50EE7489405FE927D548D5B660AC729DB HOUTOPSTANDEN8
804,167,489 *536457CE3751D1DC3468B14DAE085017A851B20D howstellagothergrooveback(saafibros.mix)
804,167,490 *536408C96ABF1D1140E40C89C3ADF52CD0DCCA7D [email protected]
804,167,491 *536971E84720A63F7A047EC999B1F7D6E374B885 HUGH.STIVERS
804,167,492 *536E52AAB40E9F1BD7E59CEEC8ACC50F584D6213 HUMBERTO.ZARO
804,167,493 *5363AA26FD88119733465F507F2B91ECE18387DF HV^U
804,167,494 *5363AC929ADB101A88BE76C47F27DBEE35E8C798 impartiaux3
804,167,495 *5366083BBBEDED5F547EB2731037A9FF27A3EF57 INHAUL
804,167,496 *536692B7EF9E852B4C5616700090A600949E72D2 IPXPRESS1234
804,167,497 *536DB8D0D4769F23DC70F8140F90CC2FDAC28780 irelandzachary
804,167,498 *5368D9202FFA9FBC91766B5DBA346527DCF7ADE9 ISOBARICNACHOJ
804,167,499 *53615FA8082A07F97AA894ECB638B448A5CD1486 issaclingberg
804,167,500 *536F062C051461D1A6C01DB79F33B73AD0AFE2A5 ISSAMLAC5
804,167,501 *536B9079AE5FD93682494EB7B5462FB6E96E1514 (IUCN)によってカテゴリーIB(
804,167,502 *536FF3D2CA12767FEF336764A54C5D7236C4A9FC JAMAL.LUPTAK
804,167,503 *536294C1D1BA01D504700C13A807162EF6AC6C00 [email protected]
804,167,504 *536A7E14273F9469597B3A1D8B921D96A503C9AD jameydammeyer
804,167,505 *536F7D943ECA650E22C44E4D0FA9C18BEACDB95A JAMIE.DOAKES
804,167,506 *53608EBE4809B5FCB9C0952781700180F2D29B7B jamisonevanko
804,167,507 *536E726FC2B5E37C0AB21EC1937CE6D7534C6603 janfournier
804,167,508 *536CC1634AF95463986021A23CC367CE63777B10 JARED.KAREN
804,167,509 *536B7A7FE2755F0E99AD3F3BCDC024B7DE35D856 JASPABLA
804,167,510 *53637CBEC37BC9606DB925D1982777E944CC50ED JEANJOCHIM
804,167,511 *536AEA860C575E111DBA3392BF41C7027BCA4567 JEFF42082
804,167,512 *5366B8398A9E2C34C1BFAC0930DB468A0D4D552D JEFFERY.SCHIRRMACHER
804,167,513 *536DEBDFD254CAD117F5D201DC1867E6A5B547F5 JEROMYMAZUC
804,167,514 *536C543E2059F942CCD0C3F958C70EA298D8DB17 JESUDULCISSIMEPASTOR
804,167,515 *53675BCE04D3DE7FFA69E74957A8D499D3141E65 JHOSODA
804,167,516 *536CF5E4C9DC530A8A2281D27F25010747B3A6B2 jim.delano
804,167,517 *536A5A4F97A4C72A6B8EDA76469BBB3A3EA8C12D JODALYS
804,167,518 *5362552C6636B836401794AF4ECBA6A9243E8D87 JOHNNIE.KARR
804,167,519 *5363847386F58A596B2F56FEB4B3A429E6BB17E2 JOKO-REYES
804,167,520 *53664278F928CE3A2930249D0D3C88BD08D229D2 jordonsoria
804,167,521 *536EFEDB62225E96875960D7DF8C76DC88C59002 JOSEFHOFLEHNERCOMWWW
804,167,522 *536AEFD8C364540741FA1B206C3931075275D72B JOSEPHCUEVA
804,167,523 *536AF6781421EA6A24F50C72E642A834F50662CD JOSEPH-PEET
804,167,524 *53616D0B22F4E46508F5BCF123B5FC877077A245 JOSUE.PLEDGER
804,167,525 *5362DE4193378DB3014F966B14C51ADD09EACAA1 JOYDEAN4
804,167,526 *53643133118518726995EF5752F359FBB9AF5537 JULIAN.N
804,167,527 *5365B856AD707B8760074D4E398D6029F3BD0F32 K0ZYH9
804,167,528 *536C0E54B3B62FFC83B9D73281CEDB4F1B2BEEBD kameel.hanna
804,167,529 *536B35451789B4672EC2643082C35F766B8957B7 kanaijun
804,167,530 *53649EDC8E2BBA5F1892827230DFED92211B8326 kellypapageorgiou
804,167,531 *53658D8B7B951E8CCDDE3AF6667335320D4E473C keowbsw2
804,167,532 *536939A4E5389DBC1D3F02AB7D8B99F92E73719F ke;t
804,167,533 *536DFCBE7E91297C94C2F6BC6105027104576F25 KIRBYTOPEZ
804,167,534 *536AB0969A6F727FD409468BC60E30E34D6391CE KIRKNICKEL
804,167,535 *536A7C414332AF095B0B67E6108A16B6E8BF15D0 [email protected]
804,167,536 *536B1D627A6971670EA9A94AC8DB7109A1837AAF [email protected]#KLOSE
804,167,537 *5363614F33A4BBD99B69BF4627407DC14249A960 KNAPENVE5
804,167,538 *536D159EAF435A8CCC9D1DD4EE1B77DA55E41EA9 KORUP.1.0
804,167,539 *5364D95D288C3CB5453506DAD0AC0FF461382032 KOTOVSKOM
804,167,540 *5362A0423758A9F82F081D6106DBE4D19ECA83A6 KRISOCENASEK
804,167,541 *536C0218782448550D3F2D2BF6BCA3A30BC0DB60 KRISTINROLFE
804,167,542 *5362471D1649E1AEBF3A3E2F2DD3F46A719F24CD LASNEL
804,167,543 *536E94E9483050587D1D8B09596B479E5B9CD901 LEBOGANG.MABALANE
804,167,544 *5369499E8463E02A98B945E9FD4050871BB0D351 LEFTBUBBLES
804,167,545 *5368E7222CAC9CD3E38DDC7FED748315482D8E54 LEIHENRYW
804,167,546 *536D365902BCF17A8B0FEA9552836497C36D2B92 [email protected]
804,167,547 *5367217022AA8770E8A075EC5C9409C2FAF54699 LESPLUMPTON
804,167,548 *536DEA0DE892E1785A8BAC3CDCC273BDF757C810 letitere9
804,167,549 *5369FE4F5816FEAF72A6D2E1729959D63E89BF05 LIBANONBAHN
804,167,550 *536D752868BF2651D60DB0486893FA263A11D615 LIDLAND5
804,167,551 *5369979CAC5971DC5C3DBC99B0275ACBC6DEA091 lindesy.smith
804,167,552 *536F529CEE5724321BFD332B858B6328669A86BC [email protected]
804,167,553 *5366780D9B5E79BC76516BDF30A290DA1DFAC1B4 LINWOODPODARAS
804,167,554 *5367E43CBAD893A651B7839E7D9123E2509BDE52 l#j%
804,167,555 *53619DA102F3ADD841E1057B51086E0DF8AF11BA LOUGALIANO
804,167,556 *5364117A1E8A7E0071BDB3FC35095F9977BC2C60 LUCIENEFAW
804,167,557 *536CEDD1C9F07E40391AEED6F2C3CB08F9413906 luciusshea
804,167,558 *53624369934C307113313D8084036C6A8EAC96E6 LYLEGUSZAK
804,167,559 *536983C703A23C89A06293E67614B26E8521689F m4$$3pr0d
804,167,560 *536C6AD424A348FF24BA75339364C8CFF096FE3F madama butterfly: atto ii, parte i coro a bocca chiusa (coro)
804,167,561 *536F3AD38661A2966B50E37E737031F0AC789190 MAHWASH-ALI
804,167,562 *536EDC3CE702DA64893B5C286704449EC5D68488 MAKAIRAJ
804,167,563 *5365D6F42491E0C4999038424420F19FC4D8932F MALLORY753
804,167,564 *5363F1E2A9D5B15B18BC0324282C6C016CA8CF45 manlofland
804,167,565 *536004BA455289B5F92FB449F62A831E4A8EC03D manumakonda
804,167,566 *53666569C714358247619EA8DE53929FC71FA38D me-and-libby-part-ii
804,167,567 *5366CAA575FEB5978D8616E91D549669F291AF74 [email protected]
804,167,568 *5366C311C59D133B1F322679C401E59BC41925A9 melissa-ward-nelson
804,167,569 *53669F89E8C8938C09715846BEA27D14D8AA2F1D melochandalaknidtarnak
804,167,570 *536B26FB4243D787A69638D3EF6E67F788C36D62 [email protected]
804,167,571 *536F78366FE35FAE841AAC18B383EE1E839F882E micahbartin
804,167,572 *53616914BA58B5880240AA0D3F97A3F7BE039B68 [email protected]
804,167,573 *5368A7E52534F46188B999CE555D83612F810032 MICKEYMINCHEY
804,167,574 *53643A8783386F6FAA552F65F4C664AA7B8BF09D MIKEL.HARENS
804,167,575 *5367540FEF2FEF4A89DA4FAC3C492D71B6C3F218 MILANSTREITENBERGE
804,167,576 *53636FE167BDCD3108785850D4FABE610F1D33AA MNEMB
804,167,577 *53669331C53A14840E986432610B1AD5526D2AD5 MONOLITHIQUE!
804,167,578 *53638A45C1D630F213E8DF05C40901D1DF29E064 mysunshine88
804,167,579 *53607D7E56A00AF12704D423E63F97E52D0F226F NADOPOSIS
804,167,580 *536AF50551B738B3AE5C6C15BB91D2BA4A0BCE3B NATHANIAL.MAES
804,167,581 *5361D2611364993ACA0C13AC73AD4942E476AEBB nathanielyerian
804,167,582 *536EE4E544EB82EE15BE9F20C61A49DC586CA5F6 nathanjulander
804,167,583 *5361CFCDB25C7E9CEEA5B82C16284BF8F5196F09 NA!VELY
804,167,584 *5366F762BE82EB3862E068C712310DA8163B0F46 NEGNILER8
804,167,585 *536EEE8C060DE1DEE19BD2C76055DEAB67E23AED nereinrahcs
804,167,586 *5368D1395504AF418E514D4DDDBC7CD762FC7CBF [email protected]
804,167,587 *536E65C12CEB9FE38495D62B8D236EBA189B6D41 NICOLASOLENSKI
804,167,588 *5367FF36995B848B433CA0AE18FB20F691334403 NICOTIO
804,167,589 *536581FF2D0E2F2916CFF385FD7CF38A6AF73453 NMIOKOVIC
804,167,590 *536D45D0DE553734BE81ADBD9881930F10BF27E7 nouvelle0
804,167,591 *536971736BB179C9210B0B35C8C8C8C43CCF268B NUMBERS.MCGARRAH
804,167,592 *536962438A1BF390A8D957067A47AD660DE2630A óészaki
804,167,593 *536A475628C3D6C8F6DF2CC7F156937F5ABD85C5 OLDENBERG1
804,167,594 *5363A20769850CC001DFF34CA6261C4EF8D0ADC5 OLINRAUTENBERG
804,167,595 *536ECB118F814FCFD4C7A884CEB5F59BFE180A8A OMURAKOUKOU01
804,167,596 *536B861DC8A69E6FABAA6FD657F7089ABC4F3687 ooxo
804,167,597 *536D3283D101C6641C7BBBB7CB28EC15A5E160FB OTICEA
804,167,598 *536881EB64A7B9EDE651F0A100EE3F15C231B0F2 OWENSTECKLINE
804,167,599 *536697E5E2FAB495ED80F09BAB39D3B3D476EA5B OWLCRXXX2
804,167,600 *53616F96CB2A2F29CB1FBD0AB9C196915B9F024C PAUL-JOHN-MARQUEZ
804,167,601 *536A8DED672A7D6882B00DB2D1AE2E97A3335E09 paulsemones
804,167,602 *53616D670F2DCEED7F62250C7AC0942156D06060 peacoch
804,167,603 *53645D6BC89B3F750847F4A5387A9868E4E46BCC PICTURECARRIE
804,167,604 *5361EE49D99AB72E7BD0CBEC77239674676F5CAC PLATYRRHINY7
804,167,605 *5360338A7091780C68C269E0C6E0FF96A8EC699E [email protected]
804,167,606 *536B2516C5891D8690463139FBDFDE3023B61960 [email protected]
804,167,607 *5365CB5FCB4F7BBCBD8E2092F63335113B9075F1 POOJA SATAPATHY
804,167,608 *536370294C5A63F9BDDD5437C48F2EAD4FE4759A P=====)-~O-~OSPLAT
804,167,609 *536C129D9FE16CD198F127B6F4D6AF8FD8CA49FA PROPORCION
804,167,610 *536168D2F0CA591E2D87449542988025C002C128 PROZOROM6
804,167,611 *536139DAE096F13C974564F2382BF8562FC57A6C qo1018479i
804,167,612 *536B0DB197DD88A9FBF8FD1B5BDA4A24061E1AED [email protected]
804,167,613 *5362A12E127E9ED0C5DC8A2A06B37752386829D7 rachmat.ramadhan
804,167,614 *5363BF953699A532A83B1E1DA0BD731F1779E675 raflebgre
804,167,615 *536A28D178579E471CA07BEE5D0A77EC482CD048 RANDYNAVARRETTE
804,167,616 *5369C7C3EB4D2A03B6CD0EF14A03FB3AA87A0180 raymondcampione
804,167,617 *5368EE84270D213B96C842E241FF39951CE1DF7E RAYMUND-AUSTRIA
804,167,618 *53698DE40036793CAEDF89FA81FC4A11B4980107 RB0015
804,167,619 *536993C84114A7F60591826E41B26DD6C6054814 rediarluap
804,167,620 *536A9D30A7E4FF105FA3A32B39999183102A7BAB redskyrecovery
804,167,621 *536CBCBC2C9BD6A0C9A9DA4C7F025593E89AA504 RESKIBUKSER8
804,167,622 *5361D346D0867827E08AC7D487DF72A905BF1FDA RESTAGNERE0
804,167,623 *5360A2784D06B024BCB654D354908EA415E60914 RESTMS
804,167,624 *5360C1963132B2A5FE45C57D3DEA30B7F9148948 revistalaguia
804,167,625 *53627F0F8E4308D57FF9BA199943CA9D9111A0B0 REYES.TENER
804,167,626 *536DE3731D44BFBFE7F38CFE612DB357009050D7 RGOTEREZ9
804,167,627 *536B4022CC1DE0D09515D194B786B4B2E0D06013 RIDE.THE
804,167,628 *53605BF97A11C3C75912AB73656724F1ECC70467 RIGOBERTO.SCHUT
804,167,629 *536FC584FA07564FB1736235A8542DCCE5FF4F1D RINU-RAPHAEL
804,167,630 *5366269869121AE5242E0A96EAFE8B4C8F37AB57 RIPÁRIO
804,167,631 *536CDBA2A0CE650CD19AD0E2D4D7105F390AA0F4 RIXPEHUN4YOU
804,167,632 *53665F89F1266B33F9C020A86BB268B99C7AD303 rizzanavales
804,167,633 *5366B2C29828DDC73F669F956185A09DBBDEF86E ROBIN-MADDOCK
804,167,634 *5365A53C2ABED8304857F34AD03CB5095C3F7390 robtbondoc
804,167,635 *5362CCE87539BF19F8CA13560A02EDF366926748 rolandpine
804,167,636 *5364018B5183A527487AD5E1E4A40D0FFC9F95E6 ROMANCOONLEY
804,167,637 *53656BA3EC34CDDE818FCF5FE99B20437B48B2DB ROPINGTUESDAY8
804,167,638 *536D1397274CF39651B2A0608F455B3683902E20 RPRIMANDANT9
804,167,639 *53698072EC6E096FFDE27605D387D23D2FA661EE R RAVNENS FALL
804,167,640 *5369738E8D558CAFD3DA2819CC759940BF52ABCB SANTIAGO.MORAVEK
804,167,641 *536AD78CF200C891DB6DAD3545BD041CBF568410 santovojta
804,167,642 *5362A9F806E9962848923E60631933D4D3475C80 SARA-DEL-CASTILLO
804,167,643 *5364C766D88B300CA7717CA2489C99ABDEE46C06 SCALINESS?
804,167,644 *536F2FD63902749F7A5CEFF7C1D529CE71E480BB SEMANTICMEMORIES
804,167,645 *536B8F88FCB8448710DC8CDE7B4A1E86A622D2DE sensibelste
804,167,646 *53650A73104CAF81CD53B379A810E78B2E1C5DFC set(featricowon&farmor)
804,167,647 *536CA5B74A59E98B4C515F003C438CED6CBB244A SHELBY.BENWAY
804,167,648 *536620F0945858B10A99A758EB48803689677C79 shenonel5
804,167,649 *536C45ED0D1D17030D562ABDA01EF1099C990867 SILVERSKIN
804,167,650 *5366311012A777831A9FDA003B443E32B39F9390 Smiley-Yeah-Yeah-Yeah
804,167,651 *536FF70A5602F65742E834CEC73DEFED11F9BCF5 SNAKEWITHFOOTFOUNDINCHINA
804,167,652 *536EAE4F9C88AF3955DB14FE58A958F6DA830083 snetsopeg
804,167,653 *53662C9D58225C2499B88DB2D60401AEA62CE949 SOMETIMES.A.HERO
804,167,654 *5360F26F1576591D4699ED1D4F6DB693CA42511E SONNYJOHNSON1
804,167,655 *536739049746503AA9E3D718BCF1DB58B6CAB127 SONNY.TATSUHARA
804,167,656 *5362C6CD461DDDD3A731C3A54733210641C53890 SONSAPPENFIELD
804,167,657 *5367DD5CAC8979CF5623D87C7929D3F8BC37A208 SPACEWOODY8
804,167,658 *536A4AD966E9085250D3B824F8E032CD976C5F15 sparrow1938
804,167,659 *536E981B7926584B6031506CC857D9C3AAC6B12C Splat.`d#####8
804,167,660 *536B313F26B7F1F9839F61315D24B80389FF9EBD SSENNNAKING
804,167,661 *5368795ACC324AE4E33E67A64ED888920BD8E967 STACEYSTPETERS
804,167,662 *536AFD66DD92405D193DAC810DB3A74F78B5F764 STANLEYELSIE6
804,167,663 *536727AB4BFA811D8DA1E10DB416FE01AFC44BD4 stee1.b4r
804,167,664 *5365E35985856BD983702B6A9A7455A2927354E2 STEVE.MASSONE
804,167,665 *536FD4241EDDF8F86B14B68365203ED111E42FF5 STÖPIS
804,167,666 *536F49B0553CBF73971B67FFF39A24F61B9864E7 SUOECAEALEMYHT5
804,167,667 *53626A739A20B66F40D5EE7127F5A1E05FAAE042 SUPERCAR6
804,167,668 *53606531C9B388189BD890E2D446B3024E13A609 SureThingCoach,HIKE!
804,167,669 *5368C0E29799B9C7C7E5942CFB426E0EB77B3813 SYMMAXIKE2
804,167,670 *536F150B042C521A649ECFBF753D363DCE10628B SYYTTAEVAET7
804,167,671 *5367166139FAD6A5976A6F9E55C9F5B7138E859D T1L1NT31
804,167,672 *536D0E0BE85AD752EDABB47ABCCFFBAEFC7A554B taamkeer
804,167,673 *53690D3DEF15C31BED130A445730B8AEBB6AC6FA tamilnadulog
804,167,674 *536D3DF195D6BA145258AEF761DE78C1FA6D88D5 [email protected]
804,167,675 *536920D7B9F5A2B5461BD976B347DCE1E41734F8 [email protected]
804,167,676 *536961E6E05203B6EF14707717F8BBEC9D7D091F [email protected]ocom
804,167,677 *5366E59D08B439E1F678F310B150C6BA98A253B5 TEACHER21
804,167,678 *5365D054AAA12C8A62BB3D62053FA8DEC16E660D thataardvark47
804,167,679 *536CDAA790E4036F65216CEB5F4BB789BBE69370 The Alpha vs the Black Shark IV
804,167,680 *536FDEE07C3C625DB5B22F882F0471CDA7536C1B themailman52
804,167,681 *53667C1754820CBD42A8A725200836553AA45DD9 THEPAUL2006
804,167,682 *5369D51054D4E2AC2188A9E2F3D2F08D66946B56 tjq
804,167,683 *5366B53CD993AB69FCD67DB5E70573EFF2C39DE0 totalno0
804,167,684 *536F7BB3012D3B8832ED32BB59E62771E1BE323D TOUGH.TENACITY.OF.PURPOSE
804,167,685 *536ED703726F79F2CAF4F0A6E93DE93A9308B423 TRAZOKO
804,167,686 *5368B65665F1B95D48398043665388BF39ED9212 TREPTAVIM
804,167,687 *536AF40D0305D917E28F28BDAA1F8ED4AF70CE93 TRISTANAMBERS
804,167,688 *5367FD699CF4BD2F142BA4A01F3C6C90883D219D TSGILEWUEIRK2
804,167,689 *536589E24C1CDC22EB2337586A8BA3BDA927EEAF TUSHARPATALIA
804,167,690 *536BF81183E403B8545A1476018154B3B574E347 U9#V
804,167,691 *5361FDA87EC7A41C926D378C3CBDFE3610F42280 umrana-waqqas
804,167,692 *53614ED09C311F5188E73CB74A5B32A2CA50BAAE uncaacnu6
804,167,693 *536FB8B1D18836707C9103560D3A9758D422FA51 /USR/SHARE/LOCALE-LANGPACK/EN_GB/LC_MESSAGES/UBUNTU-DOCS-WINDOWSMO
804,167,694 *536127AB492F4F7A6590D9DA8A5DB415C7E51BD7 [email protected]
804,167,695 *536755B557CCAAB56FC1399C1571DF4704F776FE UYYRYUR7
804,167,696 *536BF0EB9079499185FDB736B74C551E7D4A2DC8 VALENTINVERDUCCI
804,167,697 *53608A8FA7E812BBECC6BA68D5CF770E8323A15C varduashvili
804,167,698 *536F78C551A099D692AFEC0FC9008061928C2B4D vaughndoniel
804,167,699 *536214A9AC56CAED2FDF6D8C207A4E6CAE7836EF VENTURESMITH
804,167,700 *536212A2F229E85962F04876E2C276AA3D10927A VICKISHUCKMONKEN
804,167,701 *536D6074FCFD71F822EEF5D7AE4F2F5F055015E5 victorespina
804,167,702 *53609A0E00FE8E950BB62742DD42DCCFF76DEEE0 v{in{m|isen
804,167,703 *53635AC9D970D78893F0682A5A1C90305F9DC6E2 WALTZINGTHEWEASEL
804,167,704 *53661316C65D40D34EF5B9A4E9F21468520488C8 we get together (hq2 massive dub)
804,167,705 *536481A2E0D34147C222DFAC377B4F12F25038F8 who'slaughingnow
804,167,706 *536EBE61AA77CF0440F76A4E8B12B559FB59A6E2 williamrookwood
804,167,707 *536B9CD10BDA5F353F1117011A523DC0408CEAC0 WN,?
804,167,708 *536ED1D1B6304369102AFBFBADCB6C67F0B8E8A4 WWW.ANTOANETADZONI.COM
804,167,709 *536982B650260200C0D618775F472E721BF2A681 wwwjennandmattcom
804,167,710 *536241780CC3DF5E476939388FB43B49DBDEAC54 WWWNORMANGALEBPGCOM
804,167,711 *5363378BB0D887DDDD7C1CD1F1F3644F97A14004 xander.dane
804,167,712 *53653204758DBFF5A2778D959A029C5399128733 [email protected]
804,167,713 *536A5DE4153627BAF97A1F09632B63F1F5C5957F X<,K
804,167,714 *536E8080794091B9CD78DD1DCF3BD5ABBD9A3ED4 XM6F
804,167,715 *536ABF69F6C3A271F57C13945C91C02294ED4653 xtandy
804,167,716 *536A43683ED8E6B74698AFBE2C87B53E11CF528C YDJ.
804,167,717 *5360A47DFB3C9DB62F6DA9CD20984A0FE91B84D4 YFRELIN
804,167,718 *536CD9EEA1A5A156B08AE7ED134C7983FFAB96A6 yhteiskuntiensa
804,167,719 *5360AEF61E6596230EDEC215B383AC9A19FECEF4 YOURBADHABIT
804,167,720 *5363FC090950D4EF4A7289356F27067E195EE7F3 YSAYTORRES
804,167,721 *536524F5E677C7F519571FC9FFB64716E5F50857 YURIKOIINO
804,167,722 *53686A2AC66EB539D9F4B8AEE40046D8839F8824 ZAHLUNGSAUSFÄLLE
804,167,723 *536257A19A4690F4F0EE994E4E66BAB3713C2AEA ZEP