List database


# MySQL hash MySQL password
80,280,001 *08874102A76EE1FE2AA4486159298248BCDFD70C ФАДЕЙКИНА
80,280,002 *0887C4257837B873C4CD6A90C8AC160A44C148C1 цурупінскага
80,280,003 *088C15DF89105B3C9E9C9FB2B22522F9FAF7C9A4 ЧЕТКАНО
80,280,004 *088C1D535A02AF8386C55D3E6C16B24049F95546 ՄԵԼԻՔՍԵՏՅԱՆ
80,280,005 *0885FC48223C4845292F91FDB2B215628CE6D041 怨女、JENNY
80,280,006 *0889B85F95A0428C319960F1531AC6AF46854E86 $(@->)&$(@$(&>#)#%>
80,280,007 *0881EADFA8F44E839DD720A26F5D23684A5A346A 005ANSLEY
80,280,008 *088739D2B44FFC4F4582B33133EBC24C55CAEA1B )0( 0~ dp
80,280,009 *088438B41DA8E0317FBD895FD6CCE25DB5F52A71 0$C!LLA7!0N$
80,280,010 *08892658101B8CACF4F8591427880F22CD0B43C7 (-_0)[email protected]======b
80,280,011 *088FD5F304734E530A18CBE719CA99B40C3D6A89 11NPTMXUMCI9CBOQRZAF
80,280,012 *08824366BE84165703DF613717BEB212E4107323 14AAE9DA-53A0-383F-A459-2032CDF1527B
80,280,013 *088E90C0470EFED62CFE60588A3125323D34439B 156239 ( es : 50 usd ) daha fazla bilgi icin creativ .
80,280,014 *088D6945C1AAF2EC90481DD8737FF4E244E56BBF 16.12.1630
80,280,015 *088E1F654E9015A52E18E4035E9CCD6C5BF92B97 16MONIOTTELIJA
80,280,016 *0882189BEADA2FF3E9356273019412AE584FB3E4 1AFOITAR
80,280,017 *088467A741FAB947EDB952D0F94FCB4155D4A3EA 1FELSMOTIVE
80,280,018 *0885448CF378520EF4BC07EDB7D75F1A2EF459E4 1IDEEN-RAEUME
80,280,019 *0886B59985A27687D4FD9382ADE89C618CA1E759 1-maschinendynamik
80,280,020 *088DC5435DEF94F83F2BC3A1CA1AB81D375CF3EC 1MATTNAD
80,280,021 *088C32A6B333B44CD067D0C2D5528ABB33521F2F 1MEKANINIZDA
80,280,022 *088C5FD877F90F48248C816C2EB39C6E0143C418 1mittelgewichte
80,280,023 *0888F0827D0EA8108101C1CDEF2C8371ED071365 1MOTOI123
80,280,024 *08837C38E88C3558439035D6F5A3496C8584B6FC 1noncontemporaneously
80,280,025 *088726A16A2EA93B929E34258DBCE8F9B887B37C 1-one-lawyer
80,280,026 *088FF586051D29F1D47DE1523BCD2D20F1E5FB03 1PAINETTAKIN
80,280,027 *088BE21B15AF389C604E09FB211949F051C02433 1-pli
80,280,028 *088F6F9F9862D986DE67010C0E5556EAF80AAFFF 1 POLITBUEROERKLAERUNG
80,280,029 *088D5D1BA1576321C4C00F3944BEA0F4AA41AC47 1-PULTTILUKKOLUODIKKO
80,280,030 *0883A2CF4E5176E1394C65ABC8C384BC86348DC5 1-RAUTIAINEN
80,280,031 *088161D44AC8A72167A063DEF020E1089EE0AFE0 1.tabaGInIzdan
80,280,032 *0880AB7F3C4926AE28A2EF4B8738D165452BDBFD 1tiedotusp
80,280,033 *088AC58E655AC960E8C61A95E474247F22C947E1 2122098 mutta.esimerkiksi.paluumatkalla.juna.,.jos.niit
80,280,034 *088E058217325C7EEC3ADA7195B66F536A6FC38F 2149879 DIE-KUMPEL-SCHUFTEN-WIE-FRUEHER-MIT-DER-SCHAUFEL-
80,280,035 *0883082D142DAEE59F9B830B49688850C9F45EBE 2332245 NOKIANWRONNASTATONRENGAS,JOKAPIT
80,280,036 *0884EED9D66C7F0A522D433D47A84836336192F0 2415943 PROJEKTIIN PIT
80,280,037 *088DFC2E374B788C28F9A25AEAF6AEF107F7B0AC 2723754 tiedotteet.kajaani.12.3...2002.kajaanin.hissitt
80,280,038 *088E63D9B63FE9B8C58C99F3717093D0429638B1 2728180 "-IT'S-JUST-ENOUGH-FOR-EXISTENCE-,-"-MR-.-RANPURA-SAYS-.
80,280,039 *08800889F984CFC3195050C91F56A840C2EE201C 2ba01ab5e8e3d79eb0e959e7f0a294d7-468221
80,280,040 *088D0C799F1634BB9EF736F9E58AA5C57D1358B5 2FBARBARA
80,280,041 *0882EBFF747EE3044A08A05136B5D85366D64A40 2NNANDEF
80,280,042 *088383F396DD39401C99BA95906192A33EBAA7D9 2SHIGIKEN
80,280,043 *0886BBA5007669AD4513B917CBE99A49994CA113 2.UCRETLE
80,280,044 *088DD80AFBAA502E653DACF1F57DB2CFD994DE09 2ursalaista
80,280,045 *0885E937BE0B88273552D4F2F06F2D9F370CDBA4 2.viiveest
80,280,046 *088B6F91C0C3F910DABA029D64A1FE63594D9A27 358069 siyah sah filin yanindaki beyaz karede oyuna baslar .
80,280,047 *0880D081ED5C38A2D0137AB9ECC293F7687FB761 3##b` }x{
80,280,048 *088CE874B559CE79CB1F149F29535FEDEE5E32FD 3FBIERHCS
80,280,049 *0880FBADE37F74B6F2B8E39950548E3CCC937D90 3ILOVEVALERIE3
80,280,050 *0882525E4B3CC95CEDDD00C9BC2046800B46BDCD !3PAAA
80,280,051 *0884E00304051E6AD65832DE013B6F85024BCD0B 4b71groof
80,280,052 *088D99E04F5F0DFCE07F5EE7E50B1BBEDA07D60C 4N14LM0N1
80,280,053 *08852A8B15F49F74CE271EE45A0EF6738C74E40E 4REGLERADE
80,280,054 *088B0E8A2853F0A7A9998B8C6DB2C4AAC9908A54 4SCARABBED
80,280,055 *088003D8D01FAD15A8FA71E9A3C88F2942830E57 4SESSENIZOF
80,280,056 *088AAAF04DC505FFCEDE31310379C985A2709A57 4WARMERES
80,280,057 *0883593C1094B9E0B3A2E91A4B89B4DF53E2F077 50287 vatandaSlardanbeklentileriniznedir?
80,280,058 *088DB5B155F739583D4DF1D5CD041DE803E8EF39 (51oz
80,280,059 *088A6768AB9293F9E13A51374C4984069FB5F37C 53672 bir Seyi seyredip de yazmIS deGilim
80,280,060 *088C3F19BAA013ECF07E1E113ED126748B587EAD 5DISSAEPT
80,280,061 *08813A0101B7FEA6666FF145A07A58A55F5BD5B5 5helhedsindtryk
80,280,062 *0880DF33940C10EEF77FB8F0871B2CDA98B61C40 5MERAANSA
80,280,063 *088EA0C9DA132B3D6CD470E43E7E3AC858AF7E33 5NEBILIO
80,280,064 *0889243BA0D0A6808F7D2B81D58C8A342DE938CD 5STREALING
80,280,065 *08800A9AFCC218F8697D37D3B12CD5049BFBFF44 5ZEREGEISSA
80,280,066 *088C0B074E636A5EA4556A75D3BB43C011587367 6:..6..-#..-&...button-down
80,280,067 *08885C6A97B161021782ADFC91B43F9C797E5ACD 672INSURED
80,280,068 *0886AE928F9AFFE5299E28B6243677A5DE835EC0 6ADIDASTOPCAT
80,280,069 *08826C8460A95CAA54E42675725C86F01E11C720 6BSWVAQLENTINE
80,280,070 *0889E1F3F9A735B6C49742BA32E84160B67F1A40 6DEUTSCHDOLPHIN
80,280,071 *088587A2F6DB459947A3328125342A5044242489 6ERVINGAR
80,280,072 *0888232722E26231DE7052698FC47B41E60C749B 6LIZATWOODUNITED
80,280,073 *088225801756EF2AAFE615357F392CCF0B81D4A5 6REERINDRIONS
80,280,074 *088F724606287329B8525315BBE6A2396EDAF4B3 6ZEITUNGSPAPIERE
80,280,075 *0881F3C5C04340479B73FDD5A8E4F3CBF0E5A4D8 72325020072
80,280,076 *088B230DC3FD705FB5BDF54CCC3ECF6BD3DC2B06 7GEBINTEN
80,280,077 *088C73F3367FD6E396FAC4CF5DE3FB58BEB7AF14 7play6
80,280,078 *088059FC6173F4FBE26D0F5451ECD3DABA240A16 823380 infocities-projektialkoi1997jasep
80,280,079 *088390830768EBAF4F8C8E666F7A5A34A8A33923 833208 BUT-TOYOTA-WANTED-MORE-
80,280,080 *088E31CE72D149A2EC7873A384525A9675A1D64D 8-B~0~O(>-<)
80,280,081 *088F6E9D06A4590760AE7AD94B762FD6F1382724 8IMAGINEKINGFISH
80,280,082 *08875F369C7E881C99D4C113FBA7F5DBE2274558 )8(**(Q
80,280,083 *0889CE8A82627C1C5776935CA53700B9E4C25B2A 8SHELL
80,280,084 *088EC03E87F74C3D8B4914D165D4002DEFF76D61 916647 DUNYADA VE UZAYDA ANINDA HABERLESIYORUZ .
80,280,085 *088E135F2EA5E79599F44A23070271959E3F2585 935431 hevosetkuuluvatt
80,280,086 *088509DE0FB1FC44E60C0801ED05BD4E1CC3FC67 97JAGER
80,280,087 *0885332410761F9F40986F5C7BD5CAB7B666D5B3 9BSWCRANKIBSW
80,280,088 *088CA25BC03AEB62471DD4CD568F6FAB56DBA7C3 9COGNITIONBASED
80,280,089 *088CE3FA48692B92366A45D988B6235E2D4AE298 9hooimijt
80,280,090 *0883146D79E075BF5E1F624E3FB85D5A7B333862 9TANKERJUDY
80,280,091 *0881963CDA496B0D8497CCFD28560EE018B01A85 A1(Bunker024)
80,280,092 *088F5C0F0BCB4B2BB36648785F1841757A20AF99 A%5BW
80,280,093 *0884E9155AD04ACABAADD6336A3446A240D77BDC ABERYSTWYTHONLINECOUKWWW
80,280,094 *0888D7D525811708F38B792D18EC55364258FA4E ABM)P
80,280,095 *08894DF8ACBEB1082F85BD500CF77CCF4EA18DA0 AD"&
80,280,096 *088D31CC38E7688D6735059275966E7E33DA3280 adldk
80,280,097 *088F9BD09A505F18F8FE8107908890245666DD3D ADS\0
80,280,098 *0884962DE494A5F3274DDD3DBF7C99574938F1BD AF6M
80,280,099 *08836D1D4BFC60D163653B690E93A83D76B9EC5B ah,t
80,280,100 *08858B5E123F8FA701282861B83435B078D90C76 AKKORDBESIFRINGEN
80,280,101 *08883A987F8DEA10D9CB0544E2A483464CFC6800 alacm
80,280,102 *0884D782C0C7889017A392D237CDEBC22C5A8E76 album's..ae1.l.b.ah0.m.z
80,280,103 *088F767B5EDC4180FECBB24C5C0E455BAB46B870 ALDOVASCOCU
80,280,104 *088651F32EE18E7ED8796A500A50B7FE0ADB09C3 ALDRINSESES
80,280,105 *0887B307242C4CFB4096514B149B0701E13A2283 ALI.BOOKHART
80,280,106 *088315811B9974D05E9E9D3373A947DA0D71E1ED ALKUMETRS
80,280,107 *088BF14ECED3962083E9500FF6ADBB3E99BF0DE2 ALONZO.FERGUSSON
80,280,108 *0886628429B9D4E97CE8A0851CCA0FF4FF930175 ALPHONSO.SHOPBELL
80,280,109 *088F689468CC6AC1B47D8F8B08013C4EB0DE062B ALSOZIGGURAT
80,280,110 *08810C622D60DDEDF0AF25D17BAC092426241DA6 altijd-bang
80,280,111 *088FBBE5D558D9294E5196B44308FF25A5C1A19B AMDWK
80,280,112 *088EA16DB3AD262E55F7C73445BDD1E62A2D7E15 amr!4
80,280,113 *0882BCD48E9FEC476A1D734E42A7B80EB908010F ANEGGYO6
80,280,114 *08881ADDEB2BB514DBEE49AE209896D11BCB622D ANNIEAMBROSE
80,280,115 *08879BF43D961C97DE404AE36A3CD9BDCC79C458 ANNMARAIS
80,280,116 *088051DF35E6C6C75F940F265ADFEC49B117F3D5 antydninga
80,280,117 *08894B83AD966E2C6757447C8894211FB611747B ARIELSCHLABACH
80,280,118 *08888F24B4F5568F6AD0A65F0B03A522F56948EE ARTHUR.CORPENO
80,280,119 *088FA9B4B2B0E13AF38EBBB29FEFFF774412FC7C ARTICLE.HUMPH160
80,280,120 *088D2BE7E26BA26F99323051A17481F8A9A97477 arunpanigrahi
80,280,121 *088C039942527EEFD632E3FCC4749E0CA67A221D ASMKG
80,280,122 *088470E66AF1E4E8DA3E3F86BE8D730F87FBDAEF ats0
80,280,123 *088310BF5BABCEE18AA0B498D83B3F5FBF0C978B AVL9P
80,280,124 *0881867FD6032FAE36637C075E329C419943632B a-zzn
80,280,125 *08896CF179CC4A259A5A879860B5CD2DE21F5083 b0laa
80,280,126 *08807399257D2F89EE0EDC262E9331F73F3FBD85 B4(2U
80,280,127 *08804F859A5616374FC6B0F28263A272B61136A6 B8#CD
80,280,128 *088B0E6190D2DAD6B3550BCFB5E900F64859149C BALU=
80,280,129 *088E73CFDD3E093946E5E73A49F695FE5FE98FF9 barrettspike
80,280,130 *0882B9FEA0F23BCC4A265F45703CBB308D9371DE B"(B
80,280,131 *088DBED55F1F7B75FC6E399FAF547F341942FA48 «berak
80,280,132 *088878F365B25198291C5905A7B2B2C99C45C02B b%ewz
80,280,133 *0884ECB2759BAE5EAEF153528DB0609A51A32141 BIKIHSITS
80,280,134 *08843719EFB86BB917586F5B86ABD305C828ADFC billyplatner
80,280,135 *088EBB0CACCCE6D08FC0187BB7FBC9003F313A4E BIPFD
80,280,136 *0882161A855E754F7376A53E727D9144F0FEB289 BLUEOXEN.COMBLUEOXEN
80,280,137 *0889B473E7138A0349EC0D30752CD1F98B9CF661 BMN!B
80,280,138 *088AE10E2D89414B8B4873AD00EC176550A9BC35 BoGN
80,280,139 *08847309F812B9ACC198213FCBCD4B2040724A41 BOJOGB
80,280,140 *0889B9A8F903F4F328FC6A6E3421E14F1352C1DE booz3$+
80,280,141 *08841C1340A5CCB4C3293B4F3B05D71B325D7196 bp(5
80,280,142 *088A81B68E3F69287BBB90560A4B7B62728F7ACD BR6XA
80,280,143 *088FEE81E84AE4987EC6A8F8CCDE9381A53F05BB BRAINFITZHERBERT
80,280,144 *088FDD4D883A4D7F5B9DE58290AB32CF44DCB133 BRANDENLEAFE
80,280,145 *088A5E243A887F3EF5E65DFA93BBFED58FAFD607 brittakonig
80,280,146 *08809D733DDD3A5BA64D13ED8E31F5C380CF9B45 brqig
80,280,147 *08862864184FBEA7EF469EE097B14295A8E72172 b.tg8
80,280,148 *088208CAF0F94917326E08968678C3B0029C385A But-f-i
80,280,149 *0884917615193B2FE142C5BD301B5DFD1FA4D637 b;y_y
80,280,150 *088DD40023EE09B124A34E8A4977927C653BA9D2 Bノードを使うことができなければメッセージを送った
80,280,151 *088C98476D4A48E1D28CA910C405DFB84B574575 [email protected]!0NS
80,280,152 *088834833FCF5399DFD408F755C083CADC881E72 C1_v
80,280,153 *0886B6A7657F17EBFCA83B786F1A17A57D388BF5 ca6ql
80,280,154 *08843DBBE827BEEC15BC9E70805674DB1F8E8ECB CALVIN.CLAIRE
80,280,155 *088D14CAC54FA1C29681DEAED46E0BB80E01C63E [email protected]
80,280,156 *08801F3758419F193B8B1CB0491E2EDCF6D319BA CARLO.RIDELL
80,280,157 *08842848026C60C7C572C1DCDA613AA99EF64F2B carminenovitski
80,280,158 *0883687BC5EC41519C58CB90BFEA6A0E24333F11 CARRIELOMBARDI
80,280,159 *088B187C1C5C4F84A9857F590C7F190CDAF485C7 CBFCL
80,280,160 *088B3F98AE19C8C025C7D52AE1A9847117BA3D7C CcNF
80,280,161 *08873DDBD6540B1403FD3371151A8C3E4206E8BB cedrickdorio
80,280,162 *0880DFDE0AE3CC784BDECFA592210191A3B6A866 cessoles6
80,280,163 *088E1BB0329072C1A3E9FB045E4E9900617128BD [email protected]
80,280,164 *088FA905DCFE5AC6166ADA6CC36960660F1707F8 CHAR1510
80,280,165 *088F1C2DDD2FE6520C786368BD4D96ECF5D3BE6D CHAS.SEIDER
80,280,166 *088A8ACECCC078CCF662607FE3835C4506A1E3A0 chbj
80,280,167 *088A47CD233DB415A49B11860F1B8D9D880466D6 child-star-gets-probation-assault
80,280,168 *088FB59A937E028FBB1B032F0FCCA83E5AE69D6B circlating
80,280,169 *088E64C12C214175DFCB8BBA9EC72C3472ACED4F CLAYWOMAN.1.0
80,280,170 *088EFEB49535A8E169755CE0A5F5F415E2D6FEBA cliveboo
80,280,171 *088ACAA90E3592A3F2BBB9F08124190CABDA58A4 color-neutral
80,280,172 *088F93F321AD1A71943C07F9C4C086B93A1B30E1 comorien
80,280,173 *0887DFCDCC876D5DFFCA0B061FCB86C3A7A3E9E8 computerai9
80,280,174 *08848F06F8678C526342C9864B427E89DA2F204B contos
80,280,175 *08856F39BF165C4102D44951F79DF5FBFEFBB9DA CSBS%
80,280,176 *0889144766D519E9FA5FE0FFAB5D96963C18DD3A ctnjt
80,280,177 *088AF56AD7DFCCEEF1D3DA8108E9BCE704A921EE d3r39ul47n9
80,280,178 *0882C548308B6744A9374D93FE5D08C56DA6A8D8 d5ibi
80,280,179 *088AFF0AE75DA1772C9AC557BBA76F457FE29340 damkibari7
80,280,180 *0885A6FC953BC79871B6F47826EC376F9D3FE184 DANCALLING
80,280,181 *088CAF5286789FCF278A4536A5B07DA8F96A81A1 DANM0987
80,280,182 *088D9CD8A07A065321CEE0281D6FEA1766306E93 DANNY.PICKLER
80,280,183 *08879C1864ACABFBB1719D70E8CE1A40E3C9723F darinthrelfall
80,280,184 *088D8E4A4C4C63461DB30052E324E7CFA9900D28 DARIOBUGH
80,280,185 *0887405DA495AD3783C2A7B641F5557E3E075641 dariusessery
80,280,186 *0883CD0E0F1E6859531B8DF1CC86CDA0FA207FE4 DCUL-
80,280,187 *088F417221949B11F186344AC9F19E7CB5A8AF01 deangelotuter
80,280,188 *0880EDD20363BBC0DA54E1BEFF5B581648611B60 demlehwrevo
80,280,189 *088B051458258FF712C620E295E200B081254D4F DESCARGATE
80,280,190 *0888D8B0C178F8A16959AFB653C76CB7421F6670 DF(;
80,280,191 *0885A252AA046A9274E4FFCF53253133CD1BF8BD dielec4
80,280,192 *088E539A78E86CBFAA39E7C16F970B7BDED9095A DIXIREN
80,280,193 *088E7627412F7D219DCCE708C389F96696327C28 d.-k(
80,280,194 *0880B97F4D6BD9370754FB5DC652AB184CBCA8EB DMR!J
80,280,195 *0880E3D394DD313B90FD34F9F1D08A83C19209B1 DONALD.VALLAR
80,280,196 *088C77BA2FB10914168A67249A66E61B5A4B06D8 donnafinnie
80,280,197 *088D7547868E3DCE139D58D3ECCC922F8D2C247F d.ozv
80,280,198 *088F721A419BBDA44DA9E4F017778609CA5C5669 dutu"
80,280,199 *088400DF39CCBA07188C96A97156FACF0681CBBD DXAOS
80,280,200 *088657F7A13FC53A917143AEB5605EFF8356CED1 E:BR
80,280,201 *088C7E618486793283FA2814836BF4077FE9C318 ECZJR
80,280,202 *08880421610F95D91770216F741C2DD66C662D91 EDDIE62:EDDIE622
80,280,203 *088FBFB51F4E73A4AAE1705B1D214211FD234563 EDDY.HOGLAND
80,280,204 *08809C84DE9E404FE814DE22A32E186A1F5F5186 ED.MEYNARD
80,280,205 *088E4851A404691371115342BFBF51A8063AAE73 EE6J9
80,280,206 *088C844D59FFD74C932A04F85F7FB5403735D6AD ef1w#
80,280,207 *088D2B96DA5B0E050FECBDC4594ED74DAB745781 efp"
80,280,208 *088D1E92957D012A04C1C4903FA3FA8E22A71D71 ELMERROLFE
80,280,209 *08814EFD244CC33DBEE0ADFE0C0A5E1D801A9CB8 ELMO.KERNODLE
80,280,210 *0882C2AB0109EC458DA56DF36CA3A892BDBC0A52 ELOMBSW9
80,280,211 *088AE6EC25F9DDE60D3DB4771ADB8A9675BADAAE ENTINTARLA
80,280,212 *0880ED5F71587959D0CB5D5ACFF1276BB6871404 eqc$l
80,280,213 *088CB61669B6DCF8F4776C029247DB28FC663DCB ESDV
80,280,214 *088770D60C2BDB6D1C3E22949B0A114455745FEA [email protected]
80,280,215 *0886444F0FDFC5F917E99DA014F38F9E14DD9995 ezekielrasheed
80,280,216 *088C4B55759DEEF62DFBA45E4652E3EB3D610324 fetida1
80,280,217 *088A8AC3A716BB0B09397031DEBA6D217DB08C40 FLORENCIO.HERDES
80,280,218 *088F0DFED99AD3AD77F988BF6F07934E2B9F3ED6 FLSYSTMR2
80,280,219 *088E29664FE41EC157453E0B53B66E491D33D2DE FODNOTERN
80,280,220 *088EA4FFF0ADBD7801F029F79734B2F5E012904E [email protected]
80,280,221 *088A212369EA917DC0323146D051CE0C370DE95D francecaroline
80,280,222 *088BBC10E77BC5A6E55ADDBEA6C2E0D2A922C7DE FRANKLYNIMBACH
80,280,223 *088FD096821B7EEF6446579EAF7E2C2FC6A711FF fualedns
80,280,224 *088BCB5D8C28AEDBEF7DD7898043566B83B03DBA GARFIELD.MOWATT
80,280,225 *088A3BCECB7338F5E613C388492239A0B0EC7D2E GARRETT MAYER
80,280,226 *08808087B088582930BAF49E54F0BB363B0C7067 garrettmirzadeh
80,280,227 *088A204C7CEA10E5D424CC221520D3F56696AF1F garthbrande
80,280,228 *088D2FCDC60ACF5D1AD9BB48B409E419CF3EE5CC GAWIDZIEL
80,280,229 *0886F29229F9E14B5E377F7F94DD3A480A888587 GAYLORDLIFTON
80,280,230 *0888F180CE8AA355071E6620F57A6E48AF8DE8EA GEMMA.BEENEY
80,280,231 *088E25CA06E4A64C798831B1BE3C30FC9BF3DCBE GEOM4GNE7IS7
80,280,232 *088FD14EE52DFB60A32C8323F401B6ED424BEF02 [email protected]
80,280,233 *08833E5E4960888821335EEC0D088B33A69E809E GIOVANNICLYMAN
80,280,234 *088E9124A7B486E9F656AC059AB02723F538CCFC GISELLE.LEAL
80,280,235 *088FC4B56F6D6D6FD93AC5693974B586E2DA0A85 GIUSEPPE.CUNNINGAN
80,280,236 *08800AFA86F6C8A53FFE101A9B8EE862A4D119E0 GIVINGIN
80,280,237 *0884F4501091D0B86E65FBE3CA053F4E30F8834C goatcatalog
80,280,238 *088878B610144EA560CD393DCE6B9B648B38216F gomog
80,280,239 *0889422649EC8578B41E148AB53DAF5B2B1F8357 GOODOLEWIKI
80,280,240 *08820FAC0EE052797BB163FE96FCE91A80020A2F goreacle
80,280,241 *0887CD97232FFA4820F0D71BE30DD14D9D2A5443 GRANIT3.P
80,280,242 *0887A8AA25FE035ACC952DDF4628390C3D2CF3AF GUNNER12
80,280,243 *088F787966F98AE587D327796BC339953929C8A1 HABEEB ALKOL
80,280,244 *08873F6C2BAE63EA199AB3795913AE9B8425CFC7 hackersupport
80,280,245 *088CBB5D7BA473DDE60E3C7DBB07E670AC9A3C59 [email protected]
80,280,246 *088C642FD8626F2706057FD022C1A36478F25017 happy1german
80,280,247 *08896EDA0EEE77E316C9462CA74FEE11C09C944E HELEN.HILMAN
80,280,248 *0884872F906823C8D64DFE8B6691DE0646AE71A0 HERECOMESDUMBGEORGE
80,280,249 *088F83504DA00E6B168BA2FDD89CA28E457BAFBC HETEROIHMISEN
80,280,250 *088BA564F65464E053FFB8427FDB3F23CA7FC180 HIGHONEMOTIONEP
80,280,251 *088C771E22FF990B0C416B9D8300E8F498AD7B19 HMICHELLE3
80,280,252 *088722ABBE0337E1D7FCA63B6A282BB3340499DC HQ=V
80,280,253 *088A35E52177B92E914FA30BD09C8B2B5AAF97B4 httpwww.rmcmo.comen
80,280,254 *0881E72C954439A691AAA68105E599F9BCF77454 [email protected]
80,280,255 *088D16298889A91B8E335BCDA6E4A8DA4EAFBE94 [email protected]
80,280,256 *0884A4A50F3D1BC289EDE5E0E32349E2B61E8B71 i7mg
80,280,257 *08842F8FC7C424A8E0F04B66E8929F278ED1AFA1 ielvoehi1
80,280,258 *088F35908A212FFCE2186632FA3FA5133B6A52D3 ilenefink
80,280,259 *088879492E6816360DC92EBF672A3D0408B3AC9A INHIBE5
80,280,260 *088A9675EE85E3276858BF1ED4893C3C3CDB3709 INTERLIGARMOS
80,280,261 *088152A90665834D46FE2A806BE592B3BA5B86BC INTERNATIONALE OLDIE-HITS 100 (DISC 3)
80,280,262 *0888B3FE7044E060D8A8F99125AB3618ACCC8B9A isa...isabella
80,280,263 *088EA28DB889FE8D9767334C78FB12ED3B0C2A06 J4WORZNO
80,280,264 *088B5E3BE7E6B6F21FCB3D84B5BF2F5E731662FC JAMAALHANK
80,280,265 *088BF7C3ACD095C01FF6DAACE371ED7A0410EEEC jamargougis
80,280,266 *088346B09D2032A2825F33D006D04D5D299943BB JAMEY.HUMANN
80,280,267 *0887E745D081F5B4F81FC4808C5A94B60B52BA54 JAMIE.NAKAAHIKI
80,280,268 *0880831D74E1D7894CC302272650DDEC14317CC5 JANICESHEILA
80,280,269 *088B8722CAE8D145DEA95060179305A77C9E19A9 jcq>
80,280,270 *08826476CF4D8E658579A62C34AA96499B649975 JEROMYMILFORT
80,280,271 *08804BD2CB092B817D9647CCBB62A14B2F1E8264 JERRELLNORTHRUP
80,280,272 *088D1BE0D7BB8CD5A46A0750C12B0ED6A76D2D1D JESSE.MCKEEMAN
80,280,273 *0880553D393E3F9AFC127F6D46EAFE793616782F [email protected]
80,280,274 *0882FC8DB5DC15391A634524E723D373BB32C68E JIMSONWEED?
80,280,275 *088E48F6F7E4F01570410E678A423143A47D733E joeystanderfer
80,280,276 *0885B10BC26BA6B964897686894C28637179C3FD JONAS.AROYO
80,280,277 *088B46B4FB758EFE1CCC14C94191B07D1DDE589B JONKANONER
80,280,278 *0882126496E23340BA773B06D9EF88CC09034230 JORETHIAED
80,280,279 *08894244A1D92877BBF3514CFB83DF5BBC01C6DB JOSEPH-ALTOBELLI
80,280,280 *0885DE40614E2EC59184C9E7B3772C538FAFCBCD joshmarchal
80,280,281 *088D7F385AD506F63C1960CEF69683081029F70B JOSIAHJOSEPH
80,280,282 *0884077C17ABC26AC38CFD32D60586E2D2687529 K0TSN
80,280,283 *088FFD4A33021E4797365347559F451FC42EEA7F KAPITLY1
80,280,284 *088913AA548B7022D63C83E66839839F7FADDFFD KBOUCHERIT
80,280,285 *088BC9BF0BBEBA1BC8FA87D36525984EB3E6F3A4 [email protected]
80,280,286 *0888F3028E4AF0BCB440C7F401E1247CA2A1E78B KCSEGEZI
80,280,287 *0884B9FD56AE9F08EBDB7A4D4DCB635C4284DB70 keitharambuia
80,280,288 *0881D9C871E94C4D45AB4E679213421F81DFF162 KEPAVIOR0
80,280,289 *0880B80444D652E06D9CCE9B3AFB6A684EA5A516 kevinflavin
80,280,290 *0884CA31D4E86C69C6BE7ECD65EB425A6DACCF57 [email protected]
80,280,291 *08868A7BA6860869E9C369F820219CE3B0A81996 [email protected]
80,280,292 *08896B43ADCF146B23CE26C7718F70006D8C7EE0 KORBMACH6
80,280,293 *0887FC0B32A52B5186E27F9BDFA31509978A675B krista.gust
80,280,294 *0881F9617FE7DB3FE4951C13A6751D4C6B57DB02 [email protected]
80,280,295 *088A3E20E35F369ACF0C7CF99119DFF2B2389390 KULMINIRALO
80,280,296 *0887C694F9D1E46977CDBFD2269AB06069BB2AF7 KYSELINĚ
80,280,297 *088C32E1A0A7E3068127BC153F36C97CEC56E917 L05825
80,280,298 *088229B41F4C450F7C9597A25B0C1FE358FBC498 [email protected]
80,280,299 *0887AD88C7DF3150A2F31EEB97DE85CB34FE7DDC 0\.AAA
80,280,300 *0888E230A3C9BBD15220C71E38868990F27E8282 0RACHELLE8
80,280,301 *0885BD5742289870385298D6BC0D00C949F11E40 10NE1IH00D
80,280,302 *088CF1375DC0E62794AEF277EEF310699EBBA176 LAWSANDIES
80,280,303 *0884649099EE3CC8730887BA6D859AC6B569ABAA 0$A
80,280,304 *088C325A531E08498360019205A0A1C5846B2F89 12: 12 -# -& SUPREMACY
80,280,305 *08821424949DEC983B2211038485334D53BD88C7 1269929 LAADUNHALLINTAANSIS
80,280,306 *08840BFBC757D695872604924764E0292407BA25 LENNYTRUEX
80,280,307 *0886A64CA92C156DF32C3A520396FD45E8CCA7EF 14.P
80,280,308 *08881AA9CE6D9063491E2321C4B6AE21B88E30E4 126.nielsen
80,280,309 *0889355299074C4969E402C3A71186ADFAAFF75E 12ETUDESOP10NO5INGFLATMINOR,VIVACE
80,280,310 *0887F829E1B400224B62F9A5831C889E19711BB3 15pa%$7
80,280,311 *0885EBDF457DD370D928BB4BAFE5A523BA891E84 1618691 TRUE,HESUPPORTSASINGLEEUROPEANCURRENCY
80,280,312 *088F3E526C0BAEE88A6083EE7DC42CFCEC249F73 139ALICE
80,280,313 *088C6F5D27418A2C5C877924D5694FCCADBB6DE7 1401236 THE-REASON-FOR-THE-NEW-PITCH-IS-SIMPLE-ECONOMICS-.
80,280,314 *088CEDEE7AD0FF1986023171C3C3DFCC041301EE 1779066 LASERIA K
80,280,315 *088AED31CC0626BB3AED8A022FE1FAD3B337D31F Let's-Bow-Our-Heads-and-Pray
80,280,316 *088564148A0272566F374FF97A8069D61A849937 1442402 PREIS:26300EURO
80,280,317 *088DC27C6CAFCC1821BEDC81048AE8B48AC8DB40 181FAE3ACEB93EF9A6B2DB68506300C1
80,280,318 *0882CD0049F731C5A3E48F0CF2E15E90805EC9E2 1864634 ER
80,280,319 *0885C5855EB5E360816E3339F631EAAC93464B29 lgtmstcs
80,280,320 *0889835CF4A230551C131BFB6BDD205AE7D89B76 17-LORENZ
80,280,321 *0886D473428345FAE1C8A44CF1A427D2FBA55475 17 VOITAN
80,280,322 *088E48F7EB2F3983446B7B4389F11EF33CE28441 1AKW-SPRENGUNG
80,280,323 *08881043C34C0EA2A4EB334E88AE67D2E477FE30 LIGNITIF3ROU5
80,280,324 *0883F8F4BF8D9AD2E3F77ECF61B2A7EEE0BF3F0E 1948087 JA-KATSOO-JOTAIN-
80,280,325 *0884A5CBBB67025EBF9E6E83A7D0452CE2370522 LIMPIAR
80,280,326 *088BDEB043946DA4858F6A53D63CFFA27635095D 1 ARVIOJAKSO
80,280,327 *08858EE93EF9A84137A7FC528007AE0A815F6A86 lindakaro
80,280,328 *088DA114D40F484CCA83D52CE8082103BFC9B1C8 lingwala
80,280,329 *088A37EFD8A2B8A3A0F1F4B68CC3E43368E2190C LINSDAU7
80,280,330 *088ED0529AD45E571DCC9DE874625B2F1A0D7DB4 1.diplomvolkswirt
80,280,331 *0881AFFB23C06E2091A29E510869B54740062942 1.deichbauunternehmen
80,280,332 *0887CB49B7EA29015A1E6A2C9DA7AC2A0A53CE06 1-dialogmoeglichkeiten
80,280,333 *0885B7E68397AB587C91F3C074976E85BBD59E39 1 DUMOULIN
80,280,334 *08865F0CECB44300E36C2430A9A2E5E431ECAA9A 1gastronomie-betriebs-gmbh
80,280,335 *0886E49F4DAA38E68A0F93C2AD3C2120CA44A033 [email protected]
80,280,336 *0885EAC17B64F8B60255D5987433C25BFA0D22D4 1GRAFIAYHDISTYS
80,280,337 *0885FB545F985DA0886D926960471FD3FE26758D 1.imeytymisaste
80,280,338 *088186C1B91E09CA4068833BBDDA4867C94AA10C [email protected]
80,280,339 *088045C1B09C80CF1CCF6BFC71E98FC7FF80947E 1JENOFFELS
80,280,340 *088DD787F14A31D8C183E68C1930750FDFECE695 1.kirjailijaohjelman
80,280,341 *0888DE59EDEDC02F509DD1D5DBAA6868136E2B9E 1.kommunikationsvetenskap
80,280,342 *08814B08B6692E4E7FA8403F4E2FD9B765719CBB 1 KOMPONISTENAUSWAHL
80,280,343 *088823BAB689BE9619270FE26901248728A1F2AE 1konetuliaseilla
80,280,344 *088C63E92FF0C95ED626947C6CDE85130D3E5344 LOGAN.JARRET
80,280,345 *0888A06CC8349A8C876EF7ED3EDF4CDCB2841EF7 1-KALLISTELEE
80,280,346 *088FD0C039D2368DB67EA8B42C258F3EE180647C l'oiseau de feu: danse de la suite de kastchei
80,280,347 *0888AE63367B1F1E2FF323B8C566440902D2F26F LOREN.BOCKELMAN
80,280,348 *08879532CCBC282C519B48F3F401BB4F6F993423 1.PUISTOSUUNNITELMASTA
80,280,349 *088601FD4E3F09BB9B37319368615EE1E7A4D4AB LOTTOSPI4
80,280,350 *0883D4EFC34CB4A46C7DE9E24B47A802D9F416A7 1NEDAVNOM
80,280,351 *088EBBD00545BA7C23373B8F5521E2C18417E01C 1-NEWS-KESKUSTELUALUEITA
80,280,352 *088D6EB34E90A556247994C76303A1494C97F123 love hurts
80,280,353 *08855AB0662DD2B07F1318CD3B39E6FA56311D37 1-suvato
80,280,354 *08804BF6B5D82F03429921B4D73171E1B7596A49 1SYLT-FAEHRHAFENS
80,280,355 *0889AE40A4D55F37697AEEE55D3CCF158FD0D128 [email protected]?
80,280,356 *0882F92CF417831B6F7D54C7435F09B8D318C0B0 2088149 PAINA MIELEESI MAHDOLLISIMMAN PALJON TIETOA KYSEISEST
80,280,357 *088CAB6905A340CDBA69771660AD88C162F4CFC2 1.slaughtered
80,280,358 *0882250EB7EE72DB769D84202518521A33F0EDBF 1SPECIFIE
80,280,359 *088CFBB7A36E9C39E95D19EC18E6DCA6D7715744 LUKEROBLES
80,280,360 *0883E17464B2E40F94A1760C88EE15C88617385F 1.swoonedagainwhen
80,280,361 *088519397CD01069A2EFB57DAFC5602F54A5951B 1.tarranauhakiinnike
80,280,362 *088EEAB2DFEF50E8D8B253E58DF0D3692AA53318 LUPEGRECZKOWSKI
80,280,363 *088A2A2208F591CB8410D5F56C3566939A98B40C 256814 THE.GAINS.COULD.QUICKLY.ADD.UP..
80,280,364 *08804F7FECA72A102D24C1B310C3E0CA93AA34D0 2640812 normaalissa.huoneenl
80,280,365 *088B9F905A7365BE45583270C26068B0BC2F52EF LYN$N4RE$
80,280,366 *088A0FE4F78E97EABFE4A6355EBDCFA581E1F89C 2923025 allerdingsmitanderemregierungspersonal.
80,280,367 *088B251E584578CEC55BDAB0E89FF2EDE30F1D48 》。2005年11月8日,一个包含《twins
80,280,368 *08891C946E14C02EECF1CDF6AC520C3170BE9B75 2ENQUETEZ
80,280,369 *08843FCC86EF92DCCB8AF66A0A5C714E0539DFBC 2.IHMISKUVANSA
80,280,370 *08837D3BF392A8DD91818C7A30B836EA0F3DDF9B 2ilovesaturday1
80,280,371 *088AE09681CD8774E6CCE1A9FBFD5E8055AB72DE MADMAXONE
80,280,372 *08861ABADAE6DD0C057D75B1A2DA2CBF5D0DE2B0 22MODOU
80,280,373 *0889406873A86571B74396AC8601DC1FA030C645 2miki2
80,280,374 *0889473BE8B3421BB5B2FF6E41AB93CD3BA04D0B 2sta
80,280,375 *088AAEAC90DDAFBE2BBB978D9507DF5391DFF7C5 MALCOMMUTH
80,280,376 *0883ECD390442088548592574D97A8400467274B malicchia
80,280,377 *088219FB3440DD1CCA691E7F9BF09A3B9CB68CC9 malikmigliore
80,280,378 *088C8D1E28874E4797DB71C08E015C7596C13A88 3594EE5BE8F837BA8DE988195AF56E6F
80,280,379 *088E0A675BBE5822587CC92BB9079719CE2698C7 2828871 on-s
80,280,380 *08887DB88150DD2A47EC03A093829A1A30A860CC 391098 AUTOMAATTINEN-KOMPENSAATIO-TOTEUTUI-SIIS-JOPA-ENEMM
80,280,381 *088A5D9687B0B01C8662AFC841AA7CFBEFBAD689 29041127
80,280,382 *0888790C980CADDE3241B3FD1DB673F9A0210081 3campact
80,280,383 *08879436DAD5E90CB4A8A972C9F9C583F8006C78 2ATLITAAR
80,280,384 *088A50A3C74C48AFC5403A8543CB4C161C1E022C marceloelshant
80,280,385 *088DFDB86D9234F74C61D8B523AA4B7C36D58EDE 3#D.~O.~O.)O(
80,280,386 *08885EDB46DDF0467A3B24D3F0A921EBF1D728D4 2c28d2035e32f8fd1659fe55aecd3a13-197676
80,280,387 *0889B5D356F6290BB3825E2C05E4D01E19B9EA83 marianne.keller
80,280,388 *08857DE9095AF1CA3063A1C8A5455617E79AB2BD 2FMONTFROC
80,280,389 *088562ED52EDA61DB6FC514EFDAE4A4F8EC818BC 3 KURDISTAN-LIGA
80,280,390 *088AFCA476CB16F517511B83E29DB6CF87C79E11 2 georgiengespraeche
80,280,391 *088C03BDB374949B394683C47414C341EA4168F5 3MANNHEIMERCHEF
80,280,392 *0889D326F2976AC2F2C4D751061ACDC9E4AE3107 MARK.CHAFINS
80,280,393 *08822AAA99C83742EC36713AB586A8F97F0E4C1A 2ILOVEFREDERIC3
80,280,394 *0887F2564C83040297CB39219CC0B4BE366DC381 martésia
80,280,395 *0889633B414D46D86F10294A5151590E558B1D23 2-museumsangestellten
80,280,396 *088F425DBD41548C04A93EB93773528FB6284D14 mary.rosamond
80,280,397 *0885388E199E5321D97958B1A5782AEC529B670E 3UPWAXES
80,280,398 *0884A3FE8DC3B3E6D9D46089378D4952C647EE92 2TABABET
80,280,399 *088311FDFAF0B4833C89BD75A8D553A52EF25592 2 THREEVICTORIA
80,280,400 *0886EA30BDC6DD5D1691D45207B761A818E278B4 2-umsatzsteuergesetz
80,280,401 *088363C5AE070C2CE14E108C0365D16BCFA9A419 MATTHOFFED
80,280,402 *088864D5B081D74DE1E807BFD43BAB1C0BA5474F 2wettbewerbsumfeld
80,280,403 *088F27576EBCAB22411F339E5EEDC8178456E41F 30-05-1935
80,280,404 *088736B4CF33B0307173DB7424BC7B9B81A64D78 487ZAYNE
80,280,405 *088476C9082CD4B60E91F3C9D411608F2FF91144 379983 AUSDEMFLUGFELDSOLLEINERIESIGEWIESEWERDEN
80,280,406 *088A3B235799C9DB8B75D12B44804B1BEF30A8BC 3b ` (_0)
80,280,407 *0888F15E49AB87C0ACFAA223207D8312087D8FAA 4LAULUKIRJAT
80,280,408 *088E3ABE4CAD22CF1BAFE17A28C082C183B0BD4C 3dse
80,280,409 *088A56D05657F0A4FAE0023E72B02E89F9C34D5F 3IAMGOOBER4
80,280,410 *0883ED212E29176D360785B17785061233A924CD 3MREALLY
80,280,411 *08808CAB5F0E2C597E66783F90ECE2B7C667AC87 3NCOBR3MT3
80,280,412 *088FD240F59038D31DFD83595CD4788E75CBD905 3#####).~O~o.o->-<
80,280,413 *0881DE70E8E46FE9B794010F21433FCEA590EF13 3-P~O(X)
80,280,414 *08890C9C066DA56AF8C3333BF1631695C0310E95 4021466
80,280,415 *08813B6524CD19827D7764A70E8E7C23782B046B melvinteslow
80,280,416 *088B0B0FE5A89E09B6910CFD648E4130B7C954C6 4PREGNANTN
80,280,417 *088B1A8CC49A89CA2718FF2E271201D99222EC7F 4SORIANENSE
80,280,418 *0888685EB2CF00772EA27C3CCAA7F4BC3D6F6FDF 4thatmimi5
80,280,419 *0887B000426BBE85375FFC31E417EA984F27E9C3 4GALIDICT
80,280,420 *08846470DA204DCC9E5CDE45D859BEE7C09955FE MICHAEL-CAHOW
80,280,421 *08827FD05B57A7608C4D94809388EC96A6DC8DFC 599B130CB2492952BF839BD8256B5E68ANASAZI
80,280,422 *08890831CB68F038F3568BF7011E77BC1B2075CF michalpicerni
80,280,423 *088D28EB88102297947C8FD276B52E27EE66D72C 5ARSENYARSENY
80,280,424 *0884D5FF2A82397E9BA155DFE32502B6D90F79E0 5ATAIDUTS
80,280,425 *088011D307659E4492323095D510DF80CB26CA37 MICKHAZEL
80,280,426 *088EC3E719C3ED7FF8C2A2C902CC521425D99E08 5DEFENSEIRONMAN
80,280,427 *088D2C923BD9EEF97A66411E7B3A19556397752A MIKLUL
80,280,428 *088D0C1C7FF84F0B33F98761CEF43587F43C89D7 4LEMPIVISET
80,280,429 *08863FD5F741E62639600F8EDCA00788C742F710 5GENERALJBSW
80,280,430 *088C9AD31E3950A040774578BCEFE1D0953307B5 5HOCHSEES
80,280,431 *088F5FE025D388DFB3337F94216E6A4FDEF92C88 4NOTUSEDBAILEY
80,280,432 *088943EEE3177D8DB5184EE06127CD431F5A4976 5JOELSHELBY
80,280,433 *0880E8175F022ACAC0BD8641933123EBE900CDB0 5JOKERPRANKSTERPUCAPUCKPUNKPUNK
80,280,434 *088CB0FC38419E87B3CFD3F0F04B7500303F61C3 4OSTAVISTE
80,280,435 *0881349F740BCFB49C32CB4373155A4CC5EC2849 4polskat
80,280,436 *0889D2DEF8980F34199EAB2FF0E39319FE2E482C 5NEGRERI
80,280,437 *088D1F96D206BC06155B57B37E34A07A13E2477B missari
80,280,438 *088B83D0159DE82A1DDB52C9FB771557BB7CE6D3 5RIETBROEK
80,280,439 *088767B803955A7433F7CF302BC1144473F94040 5scheinsieg
80,280,440 *0883923BAE04F723A591AC659CB103B83FCF7AAB MMARIJNEN
80,280,441 *08890DD352F9AE53CB36E7BA1C418E13F49C0613 mn-johnrinshedhouse
80,280,442 *08868F0217EC9F98499EEBCCF63969FAE7B01353 5414s4na
80,280,443 *0885C8A07FD951E52D32F6ED4A7B254325411A4F 5WFPAMAM
80,280,444 *08834C687883C7BEB0D8C9E1AB88B8E6108C0CD3 5ZAPINNO
80,280,445 *088AD02C5115EC84C2D1613B18E08AACD614A124 6BONNETED
80,280,446 *0886DCD680A4A0C48DD4694D8411233B02243726 5:..5..#..&...Mont.
80,280,447 *088D206786801DA0EF1002510EF673EB80EB959B monroemcburney
80,280,448 *08828A77F6EA1C023B4BC917981F878D1338E483 58342 NIIN-,-JA-OLIHAN-NAAPURIINKIN-PITK
80,280,449 *088D9FD226D179BBF3270A3A044AD5386BE51DDC 6DIOTECYM
80,280,450 *0888075546AF67963EF585E5839D1CF31088AA02 Morningside.(live)
80,280,451 *088E729DCB9B2A5583E41D83E09A3FA953D3BA30 6GLORASTENE
80,280,452 *088C25659894238861DD20CA350368AC18DC0F45 moseamend
80,280,453 *088A368B065036EA308703527BF48E2290A80348 MOSE.BAUERLE
80,280,454 *0883F4349A3C49C48B4DE5805F34DA62B646EB8F MOSES.SCANNEU
80,280,455 *08874AF8AA45C2F5536AA568546220914C36261B 6.iltalenkki
80,280,456 *088932A296D411ECD53D2B608725432F7ACC4C47 MPDA
80,280,457 *088C9C0A4C57DEB5F40FAA27AF88305ABF1EFF4F 6MCELLIGOT
80,280,458 *08826E88A947516FAF3ADFCE8E6C44BCB3CF61F7 5FINANSERNES
80,280,459 *088182C4FB2CDB5EA60AB7769AE6A7A0FB91EE5A 6MUSTERSCHUELE
80,280,460 *08802916905F0925A9DCD78A48BB1771CE9A4906 myjules87
80,280,461 *08822ECBB429756B8B5A420D2C5D19202FD4D8FD 6nonfaculty
80,280,462 *088724F4AA0FEDC70C93ED591271E0CD62021E40 5HAMSTERCHICAGO
80,280,463 *088B1C91728113D2478B60F55BD07B2CBB3E4FED MYTEST31994
80,280,464 *088FE1925AFAA1B886FA4C4735842A7C3E186E7F NATHANIALMCCADE
80,280,465 *0880719091073B1F2AE14E506B276B5A7FD71046 5KORELICH
80,280,466 *0883412351A5918C5DA2206D1A52720A9562567F 5LEEDNAASTIETIROIRP
80,280,467 *088BE6B4E74B3D42D205BEF7BF7F3D71BCC894AA 5LIZARDFICTION
80,280,468 *08890AE1AC44C3B32CEBE9A4973DBBE5FDF8F617 NBRENDING
80,280,469 *08812455FEA6EB3451A7F69E935154354E83FAF5 6THERUTHLESS2
80,280,470 *0886F276520BA6BDB5FC3808E242C6C7AF357702 5PAZARIYLA
80,280,471 *088F61761770CFAE52FEFFB99BB2C570C862CC27 5POLEDICAMA
80,280,472 *088944E5B90068ACF88D932D4190D016B31777A7 5QUINLANFABIS
80,280,473 *088586B6D670632218AE4B8C29DBF3D6991F0AED 6ZULASSUNGSSTELLE
80,280,474 *088C483C04BB83C29228149085EDF4E0F183313C neilburkhart
80,280,475 *088ABCF55C469B1BA450F6FFA0A05FDBD5C868D3 5SALETES
80,280,476 *08822DBE35F4CF8C47E9B4C1CBF90E129BEFD8FD NEKRACLARIFY
80,280,477 *088364E87EE760819F6124552687DEA108B6C1BC $73AM$HIP
80,280,478 *088E63E97947BE3CF8B7F145170C1FEFF0B7288F 793567 WENNDUAUFSFELDKOMMST,MUSSTDUAUCHTREFFEN
80,280,479 *0885BF5559D0B3F40929DF39AA3E977D1785F1BE 5SUZANNEMICHELLE
80,280,480 *0882649BBCF8D45DF854215C86AFB47478B82C07 7ANFGENDE
80,280,481 *08842227276A34F98DFDE94BA7E4783CCE467EA3 NESTORKICKEL
80,280,482 *08826DF0787DAF2EFF5316C4EA0E4B57883AA996 NEUFERN6
80,280,483 *08842CB661F9B1A2068CB323BD3F4206AC43EC8C 7CONNIEHAMSTER
80,280,484 *088AF04493DC75D4309A9ED1588AD2F3DAE15E95 7DAERFOORP
80,280,485 *088740D2781247422DF3AFB4BB82944AAE1AF1CA 7EBB96AC1F8AC29657DE77F799829C39-A348813
80,280,486 *0887B2E8244B1C33C49592092726A7C6DEA32A20 7EEMSAISU
80,280,487 *0880AA463186D4A72B832720CCCD5988E3BA9709 7GRTTNSS
80,280,488 *088A81A7179B753434595A607D6EC2C87DD27281 7HEAVILYV
80,280,489 *0885F5403A6E556AE4A84EF791D78AF559FE247F NIEDERLUN8
80,280,490 *0884B1BAF5D168656A43F81589E9802886F1E4E2 NIGEL.MENELEY
80,280,491 *088923E341DD67C84E726DEF0FBA713884E0F98D 7MEQGUSAQ
80,280,492 *088429D1FC217B807545AD044C24AE0664772F6B NINA-AGUILAR
80,280,493 *0884DE0214655976074217733E6FA4F57BA47343 ninlife
80,280,494 *088D6E5A68627D82F7CE5BBB4A7F96E009A375BA noahprichard
80,280,495 *0882D35B3FD961C7383839DF1C83C4836051FC37 noahsins
80,280,496 *08838E9BB06A71727C45C2CE0BBC6F951424FE37 NOAH.WITTEL
80,280,497 *0883D45C094D3B57A76D661F0F09654979CF95A3 noedeluise
80,280,498 *088B7137156BBFA62DE0F886F592FC4C2AFD3991 NOELLE829
80,280,499 *088964407ABC7B11DA710F8ACC34A54CCAD65BB5 619GABRIEL
80,280,500 *0884586B2945AC025163609BC1AD0477F969FDBF 63-TORTE
80,280,501 *088C70AD5A184150283759A740A231A118D0DEE8 non-compos-mentis
80,280,502 *088861EDF0696904DD1CB8F03D7D24B73E7A679E NONEXTERMINATORY
80,280,503 *088F404C9BAB8B49C683530C5F324D29A00B2726 NORMAN.KLAR
80,280,504 *0880B3B659D2F454440106A70011DC8F6FF8503E NORRISESFAHANI
80,280,505 *088E6959B94887939946BC60C10EBB51DE51B782 NORRIS.KEMPS
80,280,506 *0889CC9D0AD09A5D2E14AC1F4413DC571CC90D57 819215 akbelen-mah--akbelen-cad-
80,280,507 *088C8543CF68A304F7BFFA6F4DAC82DB4FFACEF7 NORWINE7
80,280,508 *0881C2FBBADA8BAA5C0A65E7D6076F81CE129A0F NOTOPAPPUS
80,280,509 *088CB9AA51D1EDABE2844CA8BBCF5747B1084D04 NUCLEAR12345
80,280,510 *0884091B35435E0FF5259AE87F27E123092FD08E NY?/
80,280,511 *088CC775277D55CF6D50A250C3232B9B5F6392EF %`-o*."
80,280,512 *0888B596DBD60EE109D45DDD6A5E91219110D755 6GBUNYAN
80,280,513 *088B713CBCF67829184181988439BBFFDC12A7B9 OBSESSEDWITHMYOWNPHILOSOPHY
80,280,514 *088F21241CF77D6F30CE864D2AE51E3E7DE954EB OCSUF3
80,280,515 *088C5F0773B5819BD9A527E6B379795D4657DAFC 8HERMESEUGENE
80,280,516 *088D2183D99F6D15D35FD4BC34717881B74F2EDF @OLSEN
80,280,517 *088596BEE863284073285EDE9D6867ED76A2F3E0 6MDAILLON
80,280,518 *088410282D8E98B4DC14060D6D188F01826428E2 @+onng
80,280,519 *088002A90F4386D42E5256CF54B84231372ECFF9 ONNOCHEI
80,280,520 *08887878BC2BB08095565BC74995E60A6E8FE965 6REINVADERE
80,280,521 *088C3FE181C10FDCAA54CDCACA2D80F7531CEAC5 O><`QB
80,280,522 *088EC2858B9CE2A2510F15703DD30EFD7B188741 ORCHESTRASLIVE
80,280,523 *088633B87EEC1B7F4E79B4D884CBFAF7EEF2D200 8SANDRACOBRA
80,280,524 *08825EA6844AB7992FFB2752864E4A39D2FE817B osnažen
80,280,525 *088B503DF1B12D5D0F349030576A903544D4EC0A our-firm-brian-mcgarry
80,280,526 *0880BB678A1E0FA5AA599666E7C9B11D1E0CB371 OYUKI999
80,280,527 *088EAE4605E2EE5233147880344AB355C83ED59D 7BSWTEMPSTRINGBSW
80,280,528 *08845106B581DE2FEC83B563B33FA8AB40781595 9CIRCULATIONIN
80,280,529 *088AFDE404F59BFC4FD1352AAAA76B97D7FCFC60 pakistan..p.ae1.k.ah0.s.t.ae2.n
80,280,530 *088D27FC0B4A4D632562D62EEE61E2A30E012F4D palkkatoivomukset
80,280,531 *088828E3CA35BD4A80BBAF6396499A6293A60062 PARKERJEDIK
80,280,532 *08816A0BDB75B8E3922B4F05E7124FF7C2478E05 PARTY—FINANCIAL
80,280,533 *0882C344B916FF4BE0EAC9AB40EF13070D48587C 9evenwichtsorganen
80,280,534 *088C54A59E4B011767642080FB430B14AEF0E6BF PAULINEBROWNLIE
80,280,535 *0884967B4B8B3B1ACA44C54F75769DFFC4C21953 7SUSANJERRY
80,280,536 *0885267BFCF2CEE32E0907586F31CDFEF096EA5E 9REKNACKAEN
80,280,537 *08876BA9D0EFD7B00D4DF30B6B4DEA62837F4A5F PENGANAE
80,280,538 *08848B8B176B2E828AEAA67C19E1CDAD97B889F4 7ZWTVVUEZQZMAPAJ
80,280,539 *0886981BD38798E43B0C9991EE9DC78F4D15956D 8###) ~ ~ ~(><)
80,280,540 *0888AD584126E56FAB6B026852B1C45E07B8EE1A 9THATJESTER2
80,280,541 *08875B0B03DEDC73279C9BCC18B296DA24FBF698 PETAS CITY ROCKERS
80,280,542 *0887DBBB5A8B3EABD0B3D4011A96E4404FD06C2B PETER.RIFFE
80,280,543 *08828AE92FADF75B1EFAA917D46A71F00C3AE93F [email protected]
80,280,544 *088002B8BF49B298CA862C8BA3FC577D8FCD584D 9WGGNWYMN
80,280,545 *088F4EDA468CB8B53313D5CAFBB3C9ED770352FC 8BSWCHUMBLEY
80,280,546 *088626C29108B17E97579552DA292651C119524C 8BSWDERIVADOS
80,280,547 *0888FC9DC58D78A674C845BBAF33DE24C8A3ED65 )8(-*-d####q
80,280,548 *088E474124110B41A1F70A76A89EB151494CF4E3 a1zbw
80,280,549 *0889F1A416405C1CAF74CC021E9F56075EA5B32B A2C)8
80,280,550 *088710DB19AF44A8785E3D93354E7EE74F680234 A;81Q
80,280,551 *0886724279E91E710577E467BE283F683C8F9B3A aabhbb
80,280,552 *0884C349440A86E1552E16F0EDAABC2AA4515E78 AAB.M~
80,280,553 *08845E84B9B3FF0121CAE9E4272AAFE1A22967CE )8( [email protected]=3
80,280,554 *088CFE0A0EDD3A27CE850418113CB20A065D0151 )8(o~O~q###P
80,280,555 *088AE3EAB12F7CD52968730D0F13A2F4D2D8D91D pmalsfji
80,280,556 *088430320DBF4D1FC7118D5A6C4D282AF8763DA4 [email protected]
80,280,557 *0886863448E11808777BA743480FBCB7A831E199 aangiert9
80,280,558 *088D82FB281ECC97413807ACD8AE1E5347E5DC8E 95xqac
80,280,559 *08841B0B449D96EACC9CC898A93ED75ACD30382E ABDIQUEREN3
80,280,560 *088A85A0BD29F6F3904C94AAC0714AEF9253BC65 pr3d3+3rmin4+i0ns
80,280,561 *088251262CA8F3AB1D764C7C92B4D6F390F4049D princesermon
80,280,562 *088D6362932E103AF0A82FC0764288709007D010 ACA'K
80,280,563 *088F918A562C121B747EC296A420D628DA568D72 9PIGLETAPACHE
80,280,564 *0886FA3A25033B40BED2BDDBB0E58223A69CEEEB ACRESWELL
80,280,565 *0889B91A38A3004F71650421C14A8B138CD6BDC4 ADAMSCHMERTZ
80,280,566 *08808695D61F867A3FEB96C783260B72AFA74059 ADEGN
80,280,567 *0888AC391FA4EA6EEDDC4E1A724A654D584CED92 9VAIHTOKAUPASSA
80,280,568 *088E9582000A87D1739C90DD59B4F2915D819DA8 9VISION5
80,280,569 *088C75066D21D96261941A6B7CF0ACF4FA9FBFAD 9ZGUQZRGR
80,280,570 *0888581D1D27269C7B2A91E62B4B931E9BC93530 ADOLPHWRIGHTSEL
80,280,571 *088E8ECE0284AF6F19CFA704FE0629380B6BBCFE A002789
80,280,572 *0881757F701A956543176412C27F0B012814A4D0 ADRIANBROCKENBERRY
80,280,573 *0887146DD0DB3529315CE175DE5EFE67DDEAFFB6 probeton7
80,280,574 *08877E44DA5561E8B234731D226AFD73E11B877D putumayo-digital-sampler
80,280,575 *0889C3CEBD0039F6C57BAD02D6B83AD2A046E592 ae.rc
80,280,576 *088D1D1F33F281113126FD4173165DDE0AA5D10F A63KT
80,280,577 *08823F5F053F79BC5FAFB72A4F0EF6F53F37E7E9 [email protected]
80,280,578 *0886458E701CAC4CF830A89980A8F491DD996FBF AGTFI
80,280,579 *0883BE739A4B04268088837A51DE0C65B24A655D q####d`~.`~{x}
80,280,580 *0884872BE5E6B46ECD1D7B11F9F70491D7F51319 ahrel-laxamana
80,280,581 *088EF72CBE6BB8EC6B1B5D563DA00C69AB7AE0C7 Q/G
80,280,582 *088D9DE54474FC04953ADD84A2DB8EE328F7AADC ;)~ ~qp
80,280,583 *08827ED4E97402D6C8DFACC4D91A865EA386FA69 AAD?C&
80,280,584 *0886D77981303ACC6C355564DC16F996C4C02C67 aal)m
80,280,585 *08895182CDEB419CA232910D4E42B05BF89179F1 AANZEILDE7
80,280,586 *0888E1E0D144AD3D506379C60944D9F025FFC225 r39r3ss3d
80,280,587 *088247CC1A8CBA14C8F5E4986A584BBBF109E557 abcsxcizzy
80,280,588 *088AACF8E78FC48DBDC15D34071E51E4DC0424ED [email protected]
80,280,589 *088C207608D768B63AD809D1B69089D972A1FAE2 abhaymehta
80,280,590 *088DB1082AF7C8E4B3097D46DB4A2EEB13681A8E randaltiemann
80,280,591 *08888E7C028BDC5A454F63D484FA7EA3E337C325 randellkarcz
80,280,592 *0885C1821F8A09C61C4F15F9F48A2DB64E2E8DAA RANDOLPHCEDAR
80,280,593 *08823C50F12F1DD49D1E023E553E0068B7B9BFF2 randolphconstine
80,280,594 *088FB93A9A22E841D6880B80E430309C85AFC649 @rangoon
80,280,595 *0883145E5851AE3B2F9610C226111A9692E9F1F2 ABMOLPRUS3
80,280,596 *088FF3A838A7FD514830403DFA72174BD4790B4F abortuses2
80,280,597 *0880778ECAA74726980D2E5B7766A2A2539B779C alphonsepalmios
80,280,598 *08836900323D2A71F6DD82DBE8ADA0F4D46546E0 abrahamhenly
80,280,599 *0884558C9759E146F29CBC2B6819BF21F4840D53 ACCESSJAPANING
80,280,600 *0887C02CA66E42AC3B953773C9C0A5272832A8FE acefise5
80,280,601 *0881DD471D735189E4186E485477ACE502E379A0 rayfordschiesser
80,280,602 *0883696F2DC47C4D5DB3D61E97FC56C78130B2C2 [email protected]
80,280,603 *088B565D27FBC7B1CDF4F0DB4A4057750C25E51D RAYMOND.DEGRANDPRE
80,280,604 *088F404D8632BA9CDB613895BE6BC3F7A0DBE8C7 AMEYPEDERSON
80,280,605 *088053B6789AA464FD9126E4B700F0C904ED17F9 AMFREEDOM
80,280,606 *08820071807662F9C405644809EAE0AB9B2B0711 ADAM.LINCH
80,280,607 *088D213A30CCB90973619310F0B4CD8B1D0A009E andersonsams
80,280,608 *0886DC87527085B549867A2921968AC79B6A3BAA addolorava7
80,280,609 *088BEB89646686837554871574DD83CBA51246B9 ANDRE.STIVANSON
80,280,610 *08840CC7F7A0D424152691A8AC01A9DA357EB4F7 REEDDELARA
80,280,611 *088F1C847E731CC084A877B994363BEBF81D7CED ANGELITO PARAGAS
80,280,612 *0881EA52BC8A304BCFAFAAAC1500002A683DBF16 REGGIE.VISKER
80,280,613 *0880E9899E39E3936925554F84BFB74483853170 angioneing
80,280,614 *08859199FA38C17E50A0E1F4A0B151F4D835D60A anq2-
80,280,615 *08848C5556DD99F46A64AD27E170EBF42E86E281 ANTIONE.LOUD
80,280,616 *088F9EB3B9FB1AFC2F4B61DA0714BAF3BE661330 antiquarenbeurs
80,280,617 *08890977F6F23088CF2C8D3E0960E52C588E357B ANTONIAHOLLBERG
80,280,618 *08805AA466A57D925A66D2FB80D0E680AEAF24EF AEDNARB2
80,280,619 *0886AECFFE278B25599E782574BAD597B9386851 ANTONIO.ANGUS
80,280,620 *088116672CFFFA0C6B1306AD6128360C0CC0364C AEW&H
80,280,621 *08860C296C7728937069F2AF42678989F32BEDBD afgevree9
80,280,622 *088BD3C02AACB76B8F02E5C8E47F2D392FAA7A9E [email protected]
80,280,623 *08865B10389D8002F1DFF62894EBDF1273179C0E RHADINOVIRIDAE
80,280,624 *0888C1D85473BCE082FB0F479CC607D691C886D8 AHESTA
80,280,625 *088529360F7EAFF54C85DA94F2BC68C836BEC2A2 AHMEDOZBUN
80,280,626 *088C18714B4E6A549AC28BAA2A720966B0665F45 ahmeto
80,280,627 *0886F636D74784E6910D4713B7695439A48FA9D7 aho=
80,280,628 *088BFC8FCDE751AB78B5E564587508DA555DCE79 ARELY567
80,280,629 *08885FB5CAFF3723FF5B41F86234C17A57C6851C ajx;f
80,280,630 *088A018FC7B13D626B28C0E811F791D24C14D8FA AKARTA.1
80,280,631 *08843A73BD9C9C15F94CF668E1F605386BFA7429 AK;D$
80,280,632 *0886E8073E4E43FC5B55161869A65A0EE6A2611F ARMANDOELCOCK
80,280,633 *0886C4FF8F56F26F08F87CB103AECF366698C272 ALCOCERSALDIVAR
80,280,634 *088A9112258138026235E7BD459714F6145C3A84 artem.ovechkin
80,280,635 *088AB679B4E053B1DACC2434B4E7E9C91CDE09D7 robtlemery
80,280,636 *0880334C745604828F1738115C6CB519F24134D9 roddymaxwell
80,280,637 *0881E33C6FDD8F5A6D7DB577EBFD9391A22B8C4C RODGERMUGNOLO
80,280,638 *08880E2DA240B79F6E8D167D3EF3AFAF6F3A7EE9 ALEX.THIELE
80,280,639 *088E3B8068894E6D9DFB84EBA6D6FBDDA675C5D3 RODOLFO.SPOTH
80,280,640 *08807E5398CBA6B25A2A005C90A326F394644779 ASENYUMSOKMO
80,280,641 *088B52DAB57561E1BF2881E2E1FCCD329B419464 ALIBE
80,280,642 *08823BFF5BBD876901C405118F9AAEB2264AD9C0 asidenew
80,280,643 *0886637F0ED6ACFE4D64034E6AB812E869B9D837 ASIF-SAMEER
80,280,644 *088B3A8CD5801C3C572BEE829FE83657C704D1F7 asilsin
80,280,645 *0883CDFC16A29BA828D69A98BEC16CEFCE92669B ASPECTEDBSW
80,280,646 *08827D441F98D190BFC82CB55B33F246012E6352 ALLAN.YANDLE
80,280,647 *08870F983DCEC7489F8C7CD4C8A8B6754EECD765 [email protected]
80,280,648 *088C42EAC441A067FFBF4815B870956E80D0A3F5 ALLEN.MARTEN
80,280,649 *088243ED61F56479DEFF4E356C66A979F96613FA at#2n
80,280,650 *08804ED24154334118FBCDD21D374C7239DEDC02 ATE+
80,280,651 *0889854D0432A8783AD9F4FBF4444B0CF40BA792 rosarioardon
80,280,652 *088DAADAF6F912A7D4E0AA5C4F7B921916C9F40B al+$q
80,280,653 *0882A70D573D3E9EEB4DF18D017860D8A3C31F1E altus.'/&/lt/@/s
80,280,654 *088A9FAAC492D804DFF10DBC0FC32AAFA16AF7D1 alvaseppanen
80,280,655 *088D38711CAB4AF716B2C227DB1154FA191E07AC ROYLAND8
80,280,656 *088945AF94F442ED8436368888DCC0F6E17B2232 ambrosemarchant
80,280,657 *088952E87BADDA49AA9ECE5F33C5E7DBCD3BBFAB attractance7
80,280,658 *0887761ADE53C10FBEA800A2EC74AFAC1B790CDF RYANREDFORD
80,280,659 *088645405C09B621710244EEDBD1964359A4F6A7 ANDREW.HUCKABY
80,280,660 *0889304FF99E1EAABF517BF607EA222DAA143EEB SAHKKOJS2
80,280,661 *088D17CA7E9F6BD870051770069AA10B6D7D0679 SAILALAYAM
80,280,662 *0884DB56B2170DDBB47B8DB97A0E2420CEC03D70 angeladecicco
80,280,663 *0887D1F01179D28238C19C57BFFD5B7BC9440814 SALVATOREEACHUS
80,280,664 *088FBF0F7F1C4F4B9AB94A5015505F340E1FF59D ANIHCRUTING
80,280,665 *0889B9AF9684929759466F7A0CD035E9F63A811D AUTHORPLATYPUSJONES
80,280,666 *0886C53DAF8796968936DF1A37991D92FCFDDC06 au,z_
80,280,667 *088D95BD8B649979EC8AEB1351139B0D2C36FDE3 samuelduell
80,280,668 *088A41FF3DC756BC8E641A397A53231FFBD23634 SANDYYORKS
80,280,669 *0880F8A0353D8353CBD7B5EF4AA54AE6B691692F SANKIBSW5
80,280,670 *088A069CF2274A0B00B8E9FB0162DAA1B0C8805C [email protected]
80,280,671 *08803AF3619BECBE150991F2BE6B3B8570E33C7E a;vu#
80,280,672 *08847A4DAE48148D944D0F40E4A7B2715CD0BB2D SANTOS.BARCELLOS
80,280,673 *088F1824962EE7E43455CCEFFB37C389080B00CF A#VZ
80,280,674 *088D60A0324AF02AFE2DBE09DD9F06A8790B9ADB SATELLITECRESCENTCRESCENT
80,280,675 *088C9C476EE72CEB5D04A294039141826E68098B antonlennart
80,280,676 *08813AC02DF393B760D2DE3083FA844F1D937143 SAY-B'UH-(I-JUS'-PLAYIN)
80,280,677 *0887491E83AC3473B81C92F6CC9AB8AE415E34E9 SCARCESTOOGEYP
80,280,678 *0880AA8CA13FEB17EA1FD94F7C2C30F495A54016 SCHLAGFESTS7
80,280,679 *0883791E7282F33924AEC1EDB2611F03F46E0401 SCHLANGENFREIE
80,280,680 *0885F5CFE4B4482E1CDCBBBA4D65F34FBDC68000 schndngn3
80,280,681 *088CDE9EF1D1B30FD2DBD01F1AA8356BC6A197A8 apoteoze5
80,280,682 *088A5C2FB5DFB63005DB8105962D8054884ED565 SCRUFFYSAMUEL5
80,280,683 *0881DBAEE7CB47E3C7B7FF783E4E876C24926CEA B0L
80,280,684 *088DBE3E3963390DB741DE33C82DB6D8D4F03C59 ARELY567
80,280,685 *088ED3F9FCE9F931430B532690A669766F798FBF ŠED
80,280,686 *088B465E4AF6E2559523FF405FD9DBA19021C00C SENUFNAED
80,280,687 *088A8E8617610568B9EF0841573658DA92DB7C69 shadowchevy1
80,280,688 *08852CD9035AC843D7DDF8D18698137DBD0700EC AR?U=
80,280,689 *0883DB900F69F4E86C96D954F657A47503012272 SHEBACLAUDIAED
80,280,690 *0888F6C4FCC290AED0CFA3485758AE40F2A13775 BAQUEARSEIAM1
80,280,691 *088FB1F5E684E33134F0B5C42F666A366CCD307A [email protected]
80,280,692 *088CB6A656FDA218326E0D0099D4DD63539A6C6D BARRY.TAMS
80,280,693 *088ED048B44E0BF6DD2E1BB9A904C20216BDD4F7 SHE'S-LOUDER-THAN-ME,-BUT-I'VE-GOT-THE-MICROPHONE
80,280,694 *0885CDA6DB4F5A05E94718733E77C181E9906137 SIERRAGREENDAY0
80,280,695 *088FDBEA900598A1795643610BCEA49B0A07E6FD silashayslip
80,280,696 *088595B4281B2800A95295889C545C53730C6248 SIMON.BATTINO
80,280,697 *088DAAD670BB1872AB1BACA6A4C5BC659DBCE6C8 sintetiza
80,280,698 *0880545C3B3147C39EEE8F51CFCC1F44DAFE21EB sneditad7
80,280,699 *088616BE5925D7C20E075C95903D4EB8CD61F688 bb6!
80,280,700 *088FF68B04FCC77EEA625823AACA43931EA80399 bbpnf
80,280,701 *08873847AD212EAD4CEC3FE83BF8CB770FC366EA somraning
80,280,702 *088B9031D39C5C6CE8782AB2D5A0A30ED2944BA0 BENNIESTRINGFELLOW
80,280,703 *088A317B9235B61FC50A53DFB4641C79D12CEAF6 AWDRGY285
80,280,704 *0887ABA5A7CF3C7124256195E2AFCAB43F596C1A SPANISH.LESS.DRUMS
80,280,705 *088AD42C8EB725B6A25ADF19E217E11A02C26519 SPEZIALFALL/ST
80,280,706 *088FAE44C8B4E6C0EB304F9A28EA173FA867845E AZBGW123
80,280,707 *088B389BCEC0C551E6DE9EE3EEE7A66608D73A03 A!ZI
80,280,708 *088F4EBEA099B0830FF3C7A1241E66B8DCAF1F09 b&#):
80,280,709 *088DF134C7E7B26AFDE3952B7C680258739D1B1D BETH DIZON
80,280,710 *0886E9C96116D3EA5DA3F39F2A79AF91F6F36B2F B0E4BF0EFA7135FB9D2D8FC85FB74125
80,280,711 *0888CEA0D18F2ABABFB4FF0A4963F5E0AD605812 B0L
80,280,712 *0886F11DCB2773D2BD2A44D09094453A9DF0C7EE BEZAULT4
80,280,713 *088267CCBB6F4B04FE81BECF2AC6368441F5D94F b1nv+
80,280,714 *08846DD1C460E32A2E14F77403924C7969D049C8 [email protected]######8
80,280,715 *0886D002C47126D329D0F73E82608CA580E58AD4 SPLOIT**Q####P
80,280,716 *0884710FFC761C647429134B80DB4CAC6EBEC446 SPRINGDALE123
80,280,717 *08849A402A273C7E88D0521417B138BD1B52B5E5 SPRSTTSS1
80,280,718 *0880A99A54564E0423AE43C90A02134E210199C1 SRATOJEN
80,280,719 *088429BAA3300DB31E0E15F6E84DFF9EF4C1F5E3 BJ,%1
80,280,720 *088D1C8F5D323CAC9C441F03A5142A3B4D2A602F BAIGNOIRES5
80,280,721 *088E2AA54D1681CC434C5C0F0D54C9ABFFE9A0F6 BKDX/
80,280,722 *088C2D5B9C952DF1AAD598E4576D1755CFEFFBA6 BANDASCH4
80,280,723 *088FC4AFEE7505B29CFB6230EB22C1291928AD8D baq3&
80,280,724 *088FD1B2FA368D851C6056D92EDE29066B92D7FF barbusai
80,280,725 *088E2A88B11CE0D2BBC5D7B67A0262A65BC18A86 batmanjaeger
80,280,726 *088416FE28C6D221279D1B38FF0F7131E86356BB b-:mn
80,280,727 *08851D69DA7883F1DAABDE2E25BC07AE4DA04348 bnlq#
80,280,728 *088AD0BAD4CBE079632DB47085949FF3053B713D [email protected]
80,280,729 *0886230A29C67A25B7C5783906EF9802132F77EC b)dk
80,280,730 *088614220A0F2B150B1046B4E30233583C78C5E4 BOESSP
80,280,731 *08852C10A2E1FE8906B81B50E2E7300C8B9D1A23 STEWARTLUZ
80,280,732 *088AEE0AE9DF647D140BDEA7012944E7E1522BA8 BOKZKELION
80,280,733 *08894494CC2BF0DF610DB99D600485AFE1231FDF BEAU.MELAUN
80,280,734 *088C4A01FACF3F5275A3BC7407DE588911B65AA2 stiravosing
80,280,735 *088928A3F33B31649F56C3CD8F5EC1FD6A55FAA4 borismainville
80,280,736 *0883F115B66175563E855B270C51B73049852DD7 BORISSAFFELL
80,280,737 *0884355F0FAB0BA46B6AD0C2B6603FF655759BEB borum
80,280,738 *08885D276795B8ED8A7033335DE5729BFEC998E4 BEMP
80,280,739 *0880F0BEE4058FBBBA6F957E1C2DE3761CE86BC6 bp(5
80,280,740 *088F4916CA11FE2EA6A6D64CE270B361CFFBCA77 BRADFORD.DAM
80,280,741 *088065D08CAEDD9002AE5E68402A40A80D5DC487 BRADLEYELLENBURG
80,280,742 *088A1887666CD00F9239D309FC34EE3F0861983C BRANDON.MEMORY
80,280,743 *0884AD303F321336D7F248D5162C3019770B8A65 branson110
80,280,744 *088E947F9CBE7CAD9602AC7585FE5E8EA59FFFB0 BRENTON.CORSETTI
80,280,745 *0885FC8260D750FE14A61226F516155BEF8DABDE [email protected]
80,280,746 *08892889C924C5A6441E0CEF97A128B0A7FA0DE6 BRET.LOSCHIAVO
80,280,747 *08824F0C40986EB6F827B9B92F70460B40D35124 bfjwd
80,280,748 *088C4DC0AA01E89A4F7322B33574E607D34B9D45 bg+zm
80,280,749 *088386E1B84C99EE43AC52324A503864A12E5E66 SUNG.BATTE
80,280,750 *08839F01219199DBCC2896B956A0D78597BFE5EE BROOKE HARRELL
80,280,751 *0881415FB6CFA8FC3D19FDBFEAB74A55DBF02ACC BRUCE.REDGATE
80,280,752 *088AF751F83E0944D82C12595155152405822251 BID(5
80,280,753 *0882E88F7D06E4E868F235C277697CF268EFDDE6 [email protected]
80,280,754 *0881B919B46739274E3408BBB420A276677E73B2 BLAKEBUB
80,280,755 *0888DAD7B2167F3F48B4E443DB0380583D7BA219 SYDNEYLOVELIES
80,280,756 *0881142A4CD11C764F3F9687ACBB02AF1BF7CA6D BURKHARDABRELIGIOSA
80,280,757 *0889256E29734113E5F426DF996A638C437A8662 SYNEQUANON
80,280,758 *088144F0C11D746BD14E81C93A135F3ABD514596 BUSTER.POSLEY
80,280,759 *0882C8EB9F2692937F470FB43EA44AA1C6B55A7D BLOODBIR7
80,280,760 *088BE598E26F197436DAD3F37EF534152F5E427A B&UW5
80,280,761 *088E318F0DB9C753A66F875D41371A2FB10E5E8F b;v5
80,280,762 *088D71DA41DB299B220AEDD24614D578F9E8375F TA.DIN.FAJJA!.(SKIT)
80,280,763 *088E09E1C4DD0605DB7D8ACA37B68BB28D02AAD7 bw)k
80,280,764 *088CDEC76A161C118AEBB30EC94704A76D4839B5 b#np4
80,280,765 *088A981C6365475D0EE69AF616658DC8A672DB65 BONNYOT
80,280,766 *0888B84E4BE2D4CCDC6D8DB37DD0D98541221990 bostning6
80,280,767 *088461C997EE85E885CBBC5BFE340475E8802C58 TALKJHUTCH212
80,280,768 *088140A591CFFD05126B7069A965545756E19BFB BYKBN
80,280,769 *088C5E9749627A91D6D04572B3986A2187D2B307 TALKWENDYMUFF
80,280,770 *0884208CCC087E2BB6350E64575A54E9899F9B9A bzawh
80,280,771 *0889985C7F56F56888EA82142C20F6F9DE27DF68 tariqsattar
80,280,772 *08844114363FE2CAC716B6B3FFD04AEA220B298D BRANDONSADY
80,280,773 *088862750A37C501018C22A1A4134F62FBBA1AA6 brentonmurguia
80,280,774 *0883745B8EE1044ECC8A7D7F3E7832A74016A3D2 BRETTSALVATI
80,280,775 *0881F56264F319D5C401A175FFDE17F57B2F39A1 BRGERKRIEGSARMEEN
80,280,776 *088FB3056E4349EECAEA952CDCDC87F62EF6C645 BRPD-
80,280,777 *088335AC6414572C84DA32B07A884DF0BA0E69D6 c2#e(
80,280,778 *088A92E075B542344542D6CB44A51099DF094D47 B#SEF
80,280,779 *088B9C3A3DEB66E9F07A9FDC82E37707EF7E4E2F bswxprevious
80,280,780 *0888A805A2DBA2D39410388D8CA409E925CBB038 btax;
80,280,781 *088BCC8E4713473312BEAC69948CA69D0020972D b&te
80,280,782 *0889DF5AC921A9B06CE371A42F60221F9CFA26DC CALYPSO893
80,280,783 *088E1FB8D634F2895E85F68D70EEB956B435A7F8 TERRESDECRIVAINS
80,280,784 *08873154932D86AEAB4BB8FC3622F63F428FB26A budwinstead
80,280,785 *088EE277646B673AF9898F158F1AB3AD4631AF8B [email protected]
80,280,786 *088CD7C1FA89645AFFC0F9D35D47F8EF587A59B1 TETREAULT6
80,280,787 *0889B3875CF80DA14E7D308238080F30D1C6BF59 BUFORD.CALTABIANO
80,280,788 *088327F7EF3FFFDA054E4D8CE0CDD49A89FA3784 bujaruelo
80,280,789 *08862B7B6F02CC1C70674729FE76C2B6AC17F45F BV/%
80,280,790 *088B043D33845BA6B023598DADEE503C438FB538 bw)k
80,280,791 *0889652B6F21118910DD35CA596CFAFE1369B3F5 the.yardbirds.story.(disc.3)
80,280,792 *0881745BF963BF126761656006D4C3FA3DB96444 THREE-PINT./T/R/I/_P/AI/NT
80,280,793 *0887E0E44E911EC92EBA2483EA10D9D3CF3D4C1C timrozar
80,280,794 *088C80E77605997238B8A914FE75583FF20F5E28 [email protected]
80,280,795 *088F54498BC406A626ED8EC1C968F5CE3FCD6659 t k of
80,280,796 *0888A0A271581BB3B81B17A8AAD22A25C1335685 [email protected]
80,280,797 *08814B703F1366F1D62C34DA8E22B2B5F8BB2575 [email protected]
80,280,798 *08833D74B91F3565D1ECC1F27EF6FDD5DA8B8AB3 CARSONSYLVE
80,280,799 *088AC4D9DB1073788A49EB035C6E9D5330725B86 TOBE,ORNOTTOBE
80,280,800 *088E38D7FEFFDE47412962D7156F28FA4A369ED5 c'|0
80,280,801 *08896C7DC0E4A51736360665C361884C96CD8B5C C3I;B
80,280,802 *088032BD646A85546D5C213AB4B3421F293BBD64 CCQGK
80,280,803 *08889EB8680E3497DC33B3F4020206AA2FCC25B0 TONYVEKSLER
80,280,804 *0884AF17F07C4136FBE097E7E2BB11925B54F962 c_=8=
80,280,805 *08879983B02C1B1958A39D8934C021AFB9A3EB76 CA5AQ
80,280,806 *088AFF95C90A131755E292F2CBC50303401D38AB CAMINAN3
80,280,807 *088329636D1F192458839B151AA7C09E3D25DB1E ch.-05b
80,280,808 *088A53CFA3CC8018F67FF6E2B9041CEFCF8AE217 CHA4
80,280,809 *088884BB11AF3C5F533CB5779E94F0A0597ED210 TRENTANNE
80,280,810 *0882664DB7142C905374AA68766DC0C2A74C44D6 cham–
80,280,811 *0883B21DED33D05ACE0117010E8B0E512F0038CF carrolwarren
80,280,812 *088E0A30E48250D6651B93BBA4B80B541F975B78 CARTERRENKER
80,280,813 *0886E2C5FB114E6E5395BAFDEAF5D85F4485ECE4 casariei
80,280,814 *0885B1EFC4B6DB10A4BABECFA67F7F306739CE1A trobelsdorf
80,280,815 *088039B711E3A0A816F7F170B674DAD028DA0BBB troyparisian
80,280,816 *08841563960DC30A02F60ED66CEF949CF452F987 trummors
80,280,817 *088145B0A067C637D20129EC699650D27FB6EF82 CHASNIEDBALA
80,280,818 *08885D89B2D6791AF890DB5A33BEBFFA076A0EC5 cb_4z
80,280,819 *0885666B590EB63E6C4621AC4DFE01E779BB7DCF CHAUNCEYTEXTOR
80,280,820 *088A213BBD981ACF82D1BD49ED84BFA5FB6F447A [email protected]
80,280,821 *088FAB13F9C3679A45EC3A41694D487D53D6951C CCC"F
80,280,822 *088F4A301BDA6CBB83FCF544498FF16184E9F4EB CHETRATANA
80,280,823 *088837A15A4E9A959F194B6953E03824DBA8A75A TSNARHCSEG9
80,280,824 *0889AC1A4ECE1B6C62C7B18029417B85DF413D85 ch(f:
80,280,825 *08817550157FE9DB139D9F3CC9C8E3B90BB2766E CHICKENGALLINACEOUS
80,280,826 *0889F66C3CDCCE347B841B50AA380236BCB3B44F CD&F
80,280,827 *088DD7C3DE6AE8397711F841D2134A08466333A1 TUELO-BABA-MOHAPI
80,280,828 *088AFE34E45A549C66F5C98EDD6E4224BAFC1F9A cdt9n
80,280,829 *0889B35E39D21EF576E8B99CBE1591C91C5B7019 tung-wai-lim
80,280,830 *088E9BF437AE5DD0587BD4F6EF623FE8DAB3FAF3 CHONGTHAICOTHWWW
80,280,831 *0885B9709CE3910F6AD3E0929B9F51B5F63E93E2 CHONG.ZAMUDIO
80,280,832 *088E8B361BDC48ACD65D5ED10711878C37F3C0DB CHPN
80,280,833 *0881C1AA9958458BBCF7876B14EEF9F788B10DA9 christina.arnao
80,280,834 *088501F20260FF4B6B0353666F0279DF909E0DEA TWINSSON
80,280,835 *088B845CA0ACAD945E82770815644859C0249FEE TWOSPANTEAMTETEATETETHE5
80,280,836 *088A2CB7DCD565ECD2630EBC5A5F913083E19DB7 CHRISTMAS-FAVOURITES-(DISC-2)
80,280,837 *08877D13FCD87F2EC554B5A000B58AA46A8DF4DD CHWENGSIRN
80,280,838 *088B94C4A013F9CFD5802A8C0B4D9B303371B6CC [email protected]
80,280,839 *08815D5C2905A6612B64B63A969A7B70B06EA005 [email protected]
80,280,840 *0882AE34B52D949595C68C114BB3069ECDF61741 cidnirues
80,280,841 *08816867E6212D5713C3B7B9168D32A54DBAFD45 chadwickhesselbein
80,280,842 *088AAFE5E9C6E55C4A5CD451F3CE0AA453E492F2 cjf97
80,280,843 *088BAFD7B1B667D9B5AB6D9BAAE4CA785540A7A4 ckl,b
80,280,844 *0883AF6EDBC87E6A7819498B29D81BF9611A8D25 umaandar
80,280,845 *088B38F2C34E153A4FF2B9BF86F444ACA5E514BB uniondelosdemocratascristianosydecentro
80,280,846 *0887DD20DA04B572FC99A03E6A1334C2BA229204 chelleeh_e02
80,280,847 *0883D79D37AB9AB7AF0ED4FBD8EF0C290BB3FEEF [email protected]
80,280,848 *08877D46236B127A45ADBEAC8E8C156B668FCBD4 CHESTER.BUDDENHAGEN
80,280,849 *0886BD5FD47504899E79EA9BC9EDB8FCDECC5668 CLEMENTE.MUENKEL
80,280,850 *088D479EDE659574F4E9E5C89414309D09BCA056 CLEMENTE.VASS
80,280,851 *088F5EF252D965AF3863E0D7E36DED929AC126C3 clementraupach
80,280,852 *088B91872221BDC887587D690D20FA57C9B91643 CLERVAUXED
80,280,853 *088B468AAD19434428A63B6B184477953BF1C7DF URSULAPALY
80,280,854 *088D840F82CD8C9E16EF52652E94F7D3FDE58324 clipse,n.o.r.e.,baby,lilwayne,kardinaloffishall&badseed
80,280,855 *088D97297461B63344A48854E2E53337C5C9574C CNQRBB
80,280,856 *08884D371F787169E4A54598C3988DE71184A116 UTUOGUOS7
80,280,857 *088D3D198DC44A90EB2DF2B810E81B69E716F688 CHRISTOPHESCHMIDT
80,280,858 *08884FE147DD3318524CE376665AB954A97A8E1A [email protected]
80,280,859 *088B9AC1863E03C844F43BBB1EA0963B32E116EA VAALACHTIG0
80,280,860 *088A01BA48AFB96C8292B3DFA64DFE4A3E78FDDD coll48or4+1ons
80,280,861 *0880A7D16F02F08E8448F4F9EB366062011D3112 VALENTIN.BRUTGER
80,280,862 *088B2A34FD55C3E08BFCDB381685B1689D4E4AE6 VALENTINOWAI
80,280,863 *08821B29E88234AE66902CE51FC03C4342339A4C VALENTINPINALES
80,280,864 *088F42FCEC31A0D4CE35CECD1D47B8062BAD0E45 CONCERTO.FOR.2.VIOLINS.IN.BFLAT.MAJOR,.RV.529..I..ALLEGRO
80,280,865 *088FA0B1D1E2C74F0B9A42A1413FC6AF4522C5E6 VANESSAMAXWELL1
80,280,866 *088A04031C6C386424D207DF5C5DFB0A26361D43 ckfs+
80,280,867 *088F849CA8D4FDE5F9C0C919490CAFCA8A057E9E CONTRATIO
80,280,868 *0882951075F7568F57C85ECDB1C6E592C40EDDE7 vassyliovytch
80,280,869 *0889A09C3EEC6F1549C86E495B4D996F25CD5492 CORINA-TALBOT
80,280,870 *08850E77FB226C42C1C280FD292446316E13FBBC CLAYPLUVIOSE
80,280,871 *088983EF4D440D01F7C3F0DA462C5F01257EFE65 CLEMENTE.GUTTORMSON
80,280,872 *0886B582EFF19C4EA56BC716D0EE86D1BD94FE51 VEE-SYAHRIL
80,280,873 *08893DBB1909CAD8DA42139255FC6F4087E08F54 VEGIMEVE
80,280,874 *088823D45C381C29545ECA255448969A822B708C CLIFTONKRUZEWSKI
80,280,875 *088A23B0D94C688028B8E0E9A6358F02948AAD5A COTTERS
80,280,876 *08868BB0CBA24975C59D66331E756C9912344C8D VEREINSLOS
80,280,877 *0888BB52D462798EBBE3F404A20AA67088944EAA VERN.MARTUCCI
80,280,878 *088649551BDE893D01AF29FED9FDFCA38F402751 VERWONDDE?
80,280,879 *0887E2F6BCA45D9669612BAE35B5F1BD494CB80A VICHESHHTAMAANOS
80,280,880 *08852722785EB67903B7123951B32AB69F92BD61 C-P
80,280,881 *08841AD88DB2D8D59F2F032809E3F74CA44BBB08 cmyep
80,280,882 *0887BB8B6E811EF0AAEFF6CFF9A59512B61252D3 c=n$x
80,280,883 *08824C450E262CB4A0BFD69982B84D5FB498A652 VIORELCONSTANTINBASTEA
80,280,884 *088C7AD5F8B2A3BD959A72A14C031978FCE1EDC6 VIRGILIAGEMENTIZA
80,280,885 *088EFFB4121BFA24D0461363EE8B254F6AA0F350 [email protected]
80,280,886 *0886186FE68CFAF62A5A296FBBB3737CE74E5606 conceptsmiley
80,280,887 *088A98D47B98B8B50B4A0875CA7A56D8B42DB4D3 VLZYVWRU1
80,280,888 *088559885FAB0835ADB8BFAFE659B46C76B6AB9C craigsasse
80,280,889 *0889FE604EEB173985DFD07866C633EBFFA9B45A conrad097
80,280,890 *088D416BA4EA2E502212867F267AB1ABB7FE4E9B CRUCIATI4
80,280,891 *0888BAD46A472F985D41C8CC5D1D8502B0871BA2 c.;rw
80,280,892 *088B4BE53E86449CCA0DFCFF242EBB836B443D3B CSCL
80,280,893 *088674A17019EDFF779686B01734B44E69C2F436 W395237
80,280,894 *0883EF032C62D5344FFA681F3BB902A82DD7D741 COREY.EDGETT
80,280,895 *08892908F44403C528FD3F020CE6982BB2011313 wadebuke
80,280,896 *088F9B7BC162BF127B0AB167831FC53BE7637AFF [email protected]
80,280,897 *088FA548A4F21E507783C255767B713F19726736 [email protected]
80,280,898 *0884553F94FFBF7FA8216A6F616A7E5EA0E712CF CUMANCS
80,280,899 *0889BDAA774FD08B1F1B57021256362E5D15A81E curioushistoryoflongtoedshoes
80,280,900 *0885CE82B4D1CAD1C7563B65F94616CCB8B56DD2 CURSEOFTHEBLACKOPUS
80,280,901 *0882B52399092AD9E4408A21CF7A3B92FC54B8FB COY.REYNOSA
80,280,902 *08805464429D7DE17E12E506E314B747B9518EC2 coz2
80,280,903 *0885A36B7B9C505197F008E52BFE1259768BACF2 cw&gh
80,280,904 *08890473B03A4F3A3BEB4F3549D47D91BED84E18 CY;I?
80,280,905 *088D63DA1B2AE240407F8BA52E65CC216CF61C3B CRAM3
80,280,906 *0884B20F59573E6A1FFDCAFC65430E6EF194E4DE CRAWANGENSIS
80,280,907 *088DDEBB7328E0079633EC8044B6AA0B69220C86 WENDELL.KIZZIAR
80,280,908 *088FD49EFB8C2CEE272675F138FBBA44EA618849 [email protected]
80,280,909 *088140DBACE53364E91CE319EDD52671C72AB14D d:;1
80,280,910 *08899D2D8F8FB8066E32B9B3EE328705513C8720 d9lq4
80,280,911 *088727825A6D172525E70DD4380DF28E5DCAA4FC [email protected]
80,280,912 *088659F78533D1AE061D6BEB6CF848DFEC590FFC DALLASMESITI
80,280,913 *088D73298B7D99A3DF3C2202CB0A86DF60B95DCE WIDENED
80,280,914 *08839263DC77242F16A0E7D2EFE5A42B95E3B75F CUOKKATDXG
80,280,915 *088B5E0B3B536F5D350F3AF077C214BEF1F13881 wilbertthornborough
80,280,916 *0884EB2A9B2A7A2C48EB8728BCFCD11F4A583F4A DANE.SCORESBY
80,280,917 *0883B8436A666E34EDBD372649BAEA7B5A6647E7 WILBUR.GROVES
80,280,918 *088624ED001F59913F5E21152692DDA82B88EF92 WILLARDSTROUSE
80,280,919 *0883BD181AB46BA705CF6CA53E3BB928787CDBEF DANNYGRULLON
80,280,920 *0889FFA14C9E38931EC35336B04716E4DDF1D5F7 WILLY.MALSCH
80,280,921 *088E60B6D2F7A3CE833FB80B1C77B3167C75019E WILMERBASYE
80,280,922 *08800BC1EEDDF781FEE726ABF40B9A322D3DE398 WILSON.BELGRADE
80,280,923 *08896DD06D5F99F30F06095F57497B1EF2843160 [email protected]
80,280,924 *08887A10DEFF40AF28DE16B062C13CD60C7FAE4D WINEMARDIANI
80,280,925 *08822A078C07CF062DCD4AD2AB7060981AECFF9C CYRILDUNNIGAN
80,280,926 *0889AB1C25346DF2B030E9B656C092B12E0632BC CYRILGARIBAI
80,280,927 *0884966CAC9F7C969F4EA52358F96554C6E7C38D DARUSSALAMTALKCOAT
80,280,928 *088FA106D9FD01831C5D4ED05D4DDB484910E32E darwingantewood
80,280,929 *0888A12FC5D1FE05207DFE35F89718D3A6C2E57C WOLVESEMMITT
80,280,930 *088F275EAF87452394E50EC4433B8C4451E24106 [email protected]
80,280,931 *088D4CD2CD7C16E600FE61D1F185CF209B635EFE db6l
80,280,932 *0881BB0371D56F757D53BDD958ACBC03E6302B4A wwwrocstockorg
80,280,933 *08840DFCC13D0DAC5EDD4C0863881C3154977C9D wwwtigerbigcatsin
80,280,934 *088230C25D99F038307EA50806FBD2249777F968 D?/BN
80,280,935 *088E3971982FFC27CD98F13EFE69EB3539B9A443 D3(U2
80,280,936 *0888186AB0271239D6C729177A9DE9EA0D032143 DE3M
80,280,937 *0882A704B2530B54D49C2461873CA1091AA4106A DEANDRE.SALIM
80,280,938 *088AE7417E0C0EB8FF364060661E059C3AA5BEE7 D/9G6
80,280,939 *088323DF1ED8680CC27F9F93B5FF8789DEB64444 DECCERTI
80,280,940 *088729DB61CF9D4D0F1CDD3231458A6995BFD18D dadsangels
80,280,941 *0889065B66F2CD3CDA06FA8FABDA801CCBF4AF62 damiondoud
80,280,942 *088648265059490A0AB9BDCC3F1BBDA81353B26A DAMION.GINS
80,280,943 *0882B6A1240F01FB060E0856E613F2774A715E88 DEE GLADDEN
80,280,944 *088FFA1E8BAF227C6AC455C580174B53BD0FFD8E deg=j
80,280,945 *0881CCBB00B49BC7B2D121C27663965CBB7F83E0 DARRELLSOMERS
80,280,946 *088F900EE8E7AD8FAF8AE8924AECA6C8CFC97281 DAUSTERITAT
80,280,947 *08897E095D517E47338B341AA81876F4EA8A764A DAVELEISCH
80,280,948 *088EC00C435B9B4A363C66BCD373B64ADD826B8D DAVIDMANGER
80,280,949 *08844EC21A1FA87BEDD56E17A1C4F4CB4A3355E9 denistunney
80,280,950 *088EF2922665DEABBF1D44FD9E38658F41101E04 denvercanney
80,280,951 *088280C244FC3AB24ED536291A2031FBAD6D6261 [email protected]
80,280,952 *088F82AF9435D390CA7F9139CC0310A50D6B35A8 DEONRUTTEN
80,280,953 *088DC96F4C18F14E1BA26F5A5B59CD76D0814EB1 ddy!
80,280,954 *088BBC9B1F54CE8C7E508077D3083C1A759FF1CA descombrimento-do-brasil-suite-no-1,-a-377
80,280,955 *088A10CB3B17594B1413D3649F092C117A5BBDAA [email protected]
80,280,956 *088961CF27898B8918352335CACADB1444DCB3A3 DEBLOKKE0
80,280,957 *088D22F3D567F3313CF013BF9E2DF69DDE9C5F66 DÉSINCRUSTERAIS
80,280,958 *0888EE38CEF865E2E110B8597CEF5332E678BA69 YIPHENG
80,280,959 *088AE2D42B7044266C8FE0A5790E1DF449485994 defri.saputra
80,280,960 *088E7E2A9F53CD8B303AB8B6507A59AA18D2B00D YJ[:
80,280,961 *0885312D97845E495DED71F98B98683880E2067B DEUTSCHDEXTER
80,280,962 *0884196A88EAC6AEA3487D06E68C7F3A63BD8ACA YNGSTESED
80,280,963 *088B6B523D0EF7E87EBBBDD83702EF7DE456F318 delnylander
80,280,964 *088137F5B4601CD3ACA643D10DBC45B84C9EDCCA D_F(:
80,280,965 *0886B6D3ADA0B02B46882C30E17E4A42D9B9E41D YOUCOULDBETHEFIRST
80,280,966 *0889D85AFCBE365DCF320C9869FF3111286FCF8A YULIA.MALTSEVA
80,280,967 *08895AA44FC071F15F2CD11BDCFFF95C08E96509 YUNCAHASANAH
80,280,968 *088E6DFD16B94CEE44D69C59ED1B30F1F2E673C2 DHWK4
80,280,969 *088B62E98BA9DC71E9353AD2AE3CFB8480B29051 DEVW_SANTANA
80,280,970 *0889CA4346DA97A2191D2321FD91CF6B1BD67108 DF$C"
80,280,971 *0886D0C3D933E27D2F9ED458A3C518522601E5DE DG?9
80,280,972 *088A9518DE814ABA448879EBA4630FB9DA8972EC di0zaaaaiaaj
80,280,973 *0885682FA77A5BDEC88A4BD277A1E6D930C008A0 dictn
80,280,974 *088AFB4D92A5EFD107D256F28B43661417B23308 ZACHARYDOWLING
80,280,975 *0885E1ACCBE2672B883317816BE59B76BE983C11 ZACKARY.BRODY
80,280,976 *088DD8D0A58DF7085CF284BCA2BC8A59B0BCDEA9 d"iew
80,280,977 *0881EF0694F44BF3C5776E401ABFC53DB9F0E860 DILLON.AMBERSON
80,280,978 *0880571806950203E69961F4B1041ED4590F9702 DIM4A
80,280,979 *088F6DA32AA94AB96A4145E344FE3911F1FADCB8 dl=&+
80,280,980 *0885FC9A5B6D2833C70EA81767730894B1B8BCE9 zeta-bourke
80,280,981 *0889F69592DF0911C3C44D0BC96561A0C8AAFD6A dj-marty-fame
80,280,982 *08810E2B2453CE43EBD264A3E5C838B378D1A18F DKOP9
80,280,983 *08857B138BDB3F91BE14425E16B7C273C38ED2AA ZIGGYBARRY9
80,280,984 *088BB737AC026BBEF9CEA6FE82852A7DEA2CAACB DMc
80,280,985 *088093299B865F840F828C9EC67DB966F8D2355F D:O1E
80,280,986 *08892C5E8BABBB34CEC8331B0393F7568346707C dni&g
80,280,987 *08888A1AEB75A3F6BB2FE536C84B13F43D52A070 D!$!NTER
80,280,988 *0889F308463A46B84E612022698EEE53F155FA3C zxcvb502
80,280,989 *088B5D6F5DC501830920FC2280EA8CE598F84575 [email protected]
80,280,990 *088F2C7EA8E1D190E7BFC6E31BE29DE3E7EAFD07 DOKLATE4
80,280,991 *088C3630661AAAE6B2422F3C58B07F5F3897D36C ενπηсас
80,280,992 *0885C2BAD082FCCA3A9D6FB3E7FC6C0C5122745F douglasgregoire
80,280,993 *088DCF34EE05836C0079D026E3A2DE0DB5837BC6 АГАНОВ
80,280,994 *08837C15EA07906695FF5637CB3B0B31EF650FFC DONNWINZENRIED
80,280,995 *08806E5D89C59A5CCB8454A9DE7B5C00937762F6 donovanmcnicoll
80,280,996 *0881ECDFFF66BFED6A63C5E446566EDEBAC964E7 donvp
80,280,997 *088AAA417D9229350C9BBEF6C0440F23C894058D ВИКИТРАДИЦИЕЙ
80,280,998 *088653F8F16DF61776EE6F7CB162E2F975CDF289 DP88517
80,280,999 *0886902B63CDFF2382B6B54E799127DDA2E9429B d)rsv
80,281,000 *088BA676E9D0BBF58F1A76B4F44CA59050C9BCCF КУШЧІНСЬКІЙ
80,281,001 *088D7D33407E51FE14BA0297205941BFF95A4A19 DtuE
80,281,002 *0881D99EB8869E4C3FAA888721A936027D0BBC9F drx;-
80,281,003 *088A7C4A307A6B01CF41C531245774B6E17D83A8 DUANE.PECORELLI
80,281,004 *0888786F66FA5198D99C61B9B92681D008466745 УРЮ́ПИНО
80,281,005 *088CEF51E39E48CC4A2228FE3B0002589B9502BC dv;z
80,281,006 *08804BCB2A304C98052B9AD97935BE5C817F2141 [email protected]
80,281,007 *0886C247DBDF1027DF7556F86B80A5BDEEBB6EB0 DWAINMCCUNE
80,281,008 *0884386DC4ABEE61C08CDB4FEC8D210907DBCEFF DWAYNEMARMERCHANT
80,281,009 *088B6E33AF52A84DC2ABBFA7507FEC740557A7BF d&uhy
80,281,010 *08818FB808413B390D7955D77E8ADD0DCF5AFD1E [email protected]
80,281,011 *0881E8360638E80EBC67E410D53780281948ED00 DUWL
80,281,012 *0887B480AA3697A7BFEE9EF5C7C793AC76A41934 e9.n
80,281,013 *088B3B8DAE69BA6AD0BA6E9BABEDC2D38F96EC99 EB0L(
80,281,014 *0884890DE051EC6F1398BBDD49BB48DEFF03B8FD edtlt
80,281,015 *088BE03BAC6D8944C7F90E703612C9893D84C935 EDWARDO.MABEE
80,281,016 *088AC0F44E8B466D2073736D933C0BA081E9660E EEDILOSN0
80,281,017 *088FE7D7CCF748EC86F0CF82F1A293943A208C37 eenhetenachtineenkouwekoelcel
80,281,018 *0884C3BAEEF79CD127EE8418FD61DDB850318A62 EFFORÇASSIEZ
80,281,019 *08898B42D55CA30A726451E8240E0A9DC44EA936 efp"
80,281,020 *088E229D1AECC7E242E692B0B03AA37F35991F24 eh|w
80,281,021 *0882623A0854C85895C9E0B5C616B6056D6A48C4 eileen.garvin
80,281,022 *088BEE5742D3F3CEF1866E7042DC82F82A8F3E75 eitapicn9
80,281,023 *088328664A687B9C44F84854BAA1E0049B25DE4D E-.K
80,281,024 *088EF43AD109F41BA14C1012E4296A15311A1BDD ELEONAR9
80,281,025 *088695BA2E1F7498D573048407F1A94E7FF0B0B5 ELASRETF
80,281,026 *08803DA8F775D499F5991F18B0B39A5AAC2C2936 ELIKKILING
80,281,027 *0886034E5D4A821BF527B3EA862A2BBDF31A4866 elmerfullbright
80,281,028 *088E45869067826C923D35E0928A55DE021F6833 elve
80,281,029 *08895CB64A50E73E8E5373CAA34403882BCA19BB emicate!
80,281,030 *0888519A823D83D3D56C7B1314583CB4B16D4393 EMSEA
80,281,031 *088D7A53F547B61D13A63C760173BA853CE33108 emqw#
80,281,032 *08809B82708F01BB35DC87A10545D09C31FDF97D en76014881
80,281,033 *08838D3D7553A1B4673E764282CE039E6E80377B ennivgur3
80,281,034 *088B5DC232E2721AA0B54D2C660AF2EEED59B6F6 ENUSERSTAPELEYWG
80,281,035 *088E0C43706CAC15C93DFC8F4E88F3CC910F1183 eoge/
80,281,036 *088DA275164BD816C4504F7BF804F95091EBEA60 epaptuho9
80,281,037 *088509723ECCC32A09C35A6D857231D505E4E742 erhvervsarbejde?
80,281,038 *08875824CC9E3B37F670C12223DE23D35CB06026 enviromment
80,281,039 *088ACFF0EA3257FBD17EF31419A2E6914D375C6E ERBNW
80,281,040 *088FB62599B440F326F1ACDF3C5AF4ECF48B8A0D ERROL.WAUGAMAN
80,281,041 *0882D0D814A03AA0096C9C73CC93FE77CC6FF4D4 euy9
80,281,042 *08816CD473A82A6637B56FEB40C6FFFF5544D272 ESDV
80,281,043 *08835F18BC73232AB024BB13649B1169272BB1D2 0iluvkathleen3
80,281,044 *088663C0CE9A3537F2967DF67E9F42505765401E FAGGARDED
80,281,045 *08839F5CD4D9A1A4B91308A3153935AE904481FA faithguerra
80,281,046 *0884775771643443712AEA0646E52F5FE4A3C008 etsetsua
80,281,047 *0886813C4A2C11BE225CE6E3DE8F36EAE2085997 ettennaj8
80,281,048 *0889F72FA1F93502992F91A3B84E5FE867A527D5 EUSEBIOZOLLO
80,281,049 *08882ADEA0B29716A454254A42BA267F61AC6C8F Even-break
80,281,050 *08895F2FF42397F5CC1737032B588F41A2198616 116averie
80,281,051 *088EE943B8D9F70B68BC2891CC5AEA5CDAE7FB16 [email protected]
80,281,052 *088F49D913AAB9C42FAFCC12E0B436B66D138572 [email protected]
80,281,053 *088E59BE9557A802807C22E5182C0B0D5A281A0C [email protected]
80,281,054 *08858811DAF09F0BA3FA3770793D9BC8576528B8 fannypepe20
80,281,055 *088A3892732856A8C357097917FFA49C4B690293 fatso-jetson
80,281,056 *088786635D505965DE024ECAE6F1F21D76010BA2 ezramarquena
80,281,057 *0887D4AE357033D37BB5F91B954B38D5B3FE4AD7 FE]
80,281,058 *088E7E2EC1B7C6A41920F53C4E1B066C2DBF53D7 [email protected]
80,281,059 *08873192C043A3E08373BFFC22486C98EC0540A2 [email protected]
80,281,060 *0884D2A2ABB37191635E8D31F07E0E314A872243 14.P
80,281,061 *0886F53564A66DBA42D53A3A350FBCADB63EDBD0 [email protected]
80,281,062 *088AC89943D63805874296E2218FE595DC2DCB3E fatimatuz-zahro
80,281,063 *088CE3A928B695181F2E3C056F7B940253F20D23 1617784 todettiinvaltuuston2912002tekem
80,281,064 *088F5876455AA31731762E929475C70B81D9904F F>C4
80,281,065 *08830F4A3E62CDA4AAF7CD46BF2733ECA662BE22 FitzJames.Stuart
80,281,066 *088F771DC6FAAF32EE29552EA76CC855A071F1A6 fe4+herless
80,281,067 *088240FE0AB395E35136F6E58AAB597F884C1411 184EAAAAIBAJ
80,281,068 *088E7531A1029B1872F9DD90BEA2DE2B09DDE625 [email protected]
80,281,069 *08838D13F8F449A4E07F378EDF705CF39D288975 FERDINAND.SALAMA
80,281,070 *0887D8AB44810CB3F29973F518801A31DC92DBB8 feudal167
80,281,071 *0882BE24D646D21515BF70789966E3E1DC106F0F FIBRING0
80,281,072 *0880BEA2C2F02CE495A4775CC197BF45F61F8AD8 FOR.BEST.CHAT.JOIN.TEAM.HE><.AT.#KIDSWORLD
80,281,073 *088EF15B0BDC67EFEDF33F9302EA8FA3E58FBDAC FINANCECALISTOS
80,281,074 *0881D389987D7FF5BDC3D2559203E05BE18AE698 FOREVER.CAME.TOO.SOON
80,281,075 *088BC6C928ECE9FD6BD290A2251D35B3E7FE67E1 FIVE PRELUDES: I. ANDANTE AFFETTUOSO CON MOTO LENTOSO
80,281,076 *088A94813D90AF337D935E611A86CEE84F1EEC99 FOLDERNES
80,281,077 *0883A0CFE12E49AECB26D30F802D5F5AC15C55A7 1DIATISAIT
80,281,078 *088316C9A04702EFEFD9C0DC5B87B9068F3256A6 FOURWINNS
80,281,079 *08884416157B95499FE3F368C778F802311F7EA2 1florencia-both
80,281,080 *0888676C62090372F7D862B145021990D47147B6 1-GENISLETILMEDIKCE
80,281,081 *088EAB47063C874D9620E978E973169C32B63CCC 1-ge-thomson
80,281,082 *088262D7AA8EB8F366E568C7940ECB0C2F9E64D4 francoistamone
80,281,083 *088962A87FAB4777DA38BC9A538F261176B203AF 1glaister123
80,281,084 *0880829A3C8F2524A2D1C2EA2E513D63C8C9E169 1.INDIKOINNEISTA
80,281,085 *0886B4FE038147F0D0D4795C71BEBF1232C955CF franklinonezne
80,281,086 *088BBFA12036209ADF496C73838F50EA69EAD15E 1 KORUMUSLARDI
80,281,087 *088A4B2ED1DF5D199A3B8A2CC018BAB3E5268DC9 frauenging
80,281,088 *0888B90A3C93A78D9872642B4840B4ED4F4B800F FRITZDOMANN
80,281,089 *08801407650D263AB5E64092553D03EAAA7AC249 [email protected]
80,281,090 *088EAD88EA9B58924C231874DA032CF3ACFC8EAB 1onnenhetkist
80,281,091 *088240EBA97AD79AC92F2A61948719D5F46533E5 1.priorisointilistan
80,281,092 *088CAA8D53B9AF3EF0A992F8AF5DED53A7493BCC FYOSTGY8
80,281,093 *08815E5C04649FBA0A93A209C7662700684DC731 G108A1I$7
80,281,094 *088A6A53995B82D4F8C6A83A8419052D7A85485F 1SWEMPLEK
80,281,095 *08881145A3741D71E578A6A9EE6223F067CE0CB6 GANNOUN
80,281,096 *088EA02C58653DE20A447D4EA9F95AD3934E806D GARDOSKI
80,281,097 *0888FA9BCCDE84CC2059EE281214471B35F012CD GARRY.LAMISON
80,281,098 *088F36E8E6D83B24F3EDF10231E8ED13B32BEE80 GEORGE.ALLVIN
80,281,099 *0886FE9237C86B3398522AF91C51B28700CCC60C geraldroloff
80,281,100 *0888181D08BB5F9F663B64BAB22C816F67E7C4D7 GAYLEGINSBERG
80,281,101 *088A2DA08104F7F48163523EF9D457E2A2FB2879 1YAXINGBENZ
80,281,102 *08801856A33729DDD4B813A80520ED5CC8AD9E1B gearomatiseerd7
80,281,103 *088CEDE0013E84835AC41B1FD35BC45D00CA231D GIOVANNA227
80,281,104 *0887AA3B218DECAA5936711C4C68F4D186BB00B7 20041113:CHICAGO,IL,USA
80,281,105 *0886D256AE103E9F10D021ACFA9A0280CE47EBB3 GENE.AUCOIN
80,281,106 *0881A76AA986A141E2A81CB2480966FD0EF094AD gologlavim
80,281,107 *08854867D0415D5D6D595A73B7E113F9320D13B8 geraldosearls
80,281,108 *088CEAE5E25CE3CDA90605A6ED5CED637BAF9901 [email protected]
80,281,109 *088EAB6736A8A3F1F84DBD6378CA57B6961BBED8 GRAHAMBOATENG
80,281,110 *0886CB6ADBD4C85A5A6926C52BBDD0C8269568C6 GREENDAYKDAY99
80,281,111 *088E05D8F09D3AB129EB224DA70A78293C608E71 GREG.BOLOTIN
80,281,112 *088999D0CF4A576EA85B0CB97158F50CAA26F686 GREGORIO.FONEY
80,281,113 *088E23C822268DA2D0032DDDA723BB5FD03D77E6 GREGORYCASBEER
80,281,114 *088B244A9CDEAF04F26717773DD27B1C8E66A036 grovermcindoe
80,281,115 *088ED65FE68B62E7ECE0E1DD261B00124DD7CC78 [email protected]
80,281,116 *088F0C58974AF5676220B6CF58F086F2DB991E75 [email protected]
80,281,117 *08872D137356B05712982A87B765BD8F30A5634F [email protected]
80,281,118 *088217649F6F9BC2B4C68ADC62EBD3D67B08C584 20 LEAVENING
80,281,119 *0889C1FB992143D0DBEE54A1D827B8ED37F17D5A guykettenring
80,281,120 *088100C4C89FE11794C63DB4555F2E9FC9E3B757 GET-OFF-THE-FUCKING-CAR
80,281,121 *088565A7928959AAE996B6FE0373E0A221E86DFD 21-remes
80,281,122 *088F5490C26E6CB76262A3F2D47F11C3EAF617BF クハ220形(TC
80,281,123 *088B7B8ADE17CFF37F0DE717CE061B1A2C88FB70 2222RACERX
80,281,124 *0889B45E8E201F69779E5A22508ABB9298FC29C2 GFTPLNTN2
80,281,125 *088AE02C90A626259C7EFD269C29A2A1A4D8281B 2396846 THE-WORK-CAN-BE-RISKY-
80,281,126 *08805E3265A0CA11BD142AA95F802927CB2D9BFC H#26
80,281,127 *088618BA0D30D5FF05FDC8345F0BD340582BC18C h4ir.33l
80,281,128 *0882E31445AE5409FB53AC250A58D09443076447 [email protected]
80,281,129 *08877C43263D2C19EEB7E1452270DCC416901AD3 GISELLEMONTEMAYOR
80,281,130 *08817D36CF87E55AA9A64705FCEB52F92FA69969 HABUMUREMYIB
80,281,131 *088DDCC6262AFDFBA55DABDB53D8262CCB808779 2525117 t
80,281,132 *088CB1DF74BAEB6D7126BEA4D0E7F9B3375BB5DF GLAZYEV0
80,281,133 *088DC698A69A54F671F2C2133E720547A7DD46D9 glfwrdgsted
80,281,134 *0881154AE06A9FD59A8A299E2197E601D067877D GNIGGID9
80,281,135 *088C2C3B7825793DC351E08EF82D7A7EF023F699 HARATEKK3
80,281,136 *088DC6A33322519AA47E5A3B24C54F0376755CED 2619639 EINGANG.:.MASURENALLEE.,.KLEINER.STERN..
80,281,137 *088AB0F4477099491CEB5CFE7B2302360453B849 HARISET4
80,281,138 *0884CD41CA807239D85062B948BC771301DB5C87 goin'upriver
80,281,139 *08849305A945627DE1CD50B88F03A3C2FC1503EB harmatia
80,281,140 *088F64E9B216E2EF08BAAB89D7F2FCC86F3FB195 GOODBYE-TO-LONGSERVING-CLUB-SECRETARY
80,281,141 *0888715011304F7D4014946F58DC43D1CAB4930A HASSINHO1
80,281,142 *088B37B295929232E3CCB787CBD6A79A25B58370 HC}T
80,281,143 *0883F87BA0E3D5DB93D71F16A77E466050A6CF41 GRADY.WEAVER
80,281,144 *08812BA020B55F5B52A1108E310058441D8CE0B3 GRANTNARRON
80,281,145 *088E70CF196C98CDECC7821704C6895DDFFE7B72 [email protected]
80,281,146 *08877AAF876E74B6EE14D7887E2E328B2E4AB505 GRANVILLE.RIENZO
80,281,147 *088460CE762D41707C548D046A5D8F39A619A878 GRAPHICLOVE27
80,281,148 *088D0BF9418C2C72F9ED74A8AF06AA8933DEFDC9 HEART.OF.THE.HEARTLAND
80,281,149 *088D3DC14CCC4AC0B243B7341CF9BA42FEF293C3 grassowling
80,281,150 *088CB16776907DA37DA2F9F77848CA80409C88A2 2HANJCDUY
80,281,151 *0884216FEEEA3D8510B31D3D1DC75FB0EFBD7B8F 2ILOVELADYBUG
80,281,152 *088C4A4D0A175C4A93CF50EF7DACBC0EB6940501 HEPATIZACIÓN
80,281,153 *088AFD37F0A68421D952BCF47C34072ECA20AAA3 guillermovause
80,281,154 *0883D6944DEF3C5894590CB59CC5733D2AD61C16 HERMIONI
80,281,155 *08867C833760DCCB0F079EC93681060F392099EF 2nd.floor.(girl.eats.boy,.back.for.more.mix)
80,281,156 *08879C70DED594AC34DC0FDDADC00D5DF8543850 HJULAKSLING
80,281,157 *08855F1992B98884C323D325E44654A8926AB7DF 2politisch-moralischer
80,281,158 *088BADF70D62AAB3D5EA5ABC9F32DE1E86858B3A G|UY
80,281,159 *08893F801B48A52BBBF8BA19E5C63336382458D8 [email protected]
80,281,160 *088A56DDB296AC154002F5034014A19D7927F979 GYLDENSAA
80,281,161 *088EDD19E92BB1E27C8F65474BF7487031BD57C8 HOCHUEH9
80,281,162 *0889886E1191CED5D36EA722E16D30F4857B628E h3+3ro53xu41i+y
80,281,163 *08853AE1B75FED33D0268A3C5CD67D8A95A0E2BF Horse-of-Another-Colour
80,281,164 *088DCBA96927C709842E8B8C742CFFFAD0DA224A [email protected]#
80,281,165 *0884E5EB686E9E499249CDE14B2D3E95754FEDBF HOUSTON.TYRIE
80,281,166 *08826D5CA4683488B9CCA055BF7AF3BFD56533EA HOZZAJUTNI.1
80,281,167 *0888A30D0B5BC8B0BD936DFD4C4D82AAEF05E0F3 Hadracadabra-II
80,281,168 *08857B49F3B95F479C5591AE76F34CD0593678E4 [email protected][email protected][email protected]$
80,281,169 *088D15FB1282CFC01E1CA36F8834E42605836A76 3AORDERINCHAOS
80,281,170 *088DAFE47152B48F3E33C285022211E0301DF250 HALUJEN2
80,281,171 *088F553C35684EB26F42D1E9068233B65B40032A HTTPELSEWHAT.COMTHES
80,281,172 *0889D5AD5CA2336ACB2497260ED680153C0DE2E1 3dse
80,281,173 *088AF362347F826212D486CF7EE0F9E7A4DA01FC [email protected]
80,281,174 *088777032A356FD538752F1AF5759025C73BF4B3 [email protected]
80,281,175 *088E897DF1606C9D9362FB879E70552811D96AF6 HUBIESE6
80,281,176 *08802D171BE6F5EB66B673C2BE47725C22D176B0 HUMANBEATBOX(INTRO)
80,281,177 *0880E8D02666D0731722F28CA3FF1BC885C39892 3.NICHIREI
80,281,178 *088AAABE937714FA13E179BA7DDF217648C892B3 3#P.`~.:p
80,281,179 *08899833F37170C58199CF061EBB23DC2517E507 hydr0t4ct
80,281,180 *088BDFD9E479F47B22EF93AB635FB58CBD4F7D23 3##)-~SPLAT
80,281,181 *0884961638FEEA214151203EEB3FEA6B5A27CBCB 3TANGENTIALITY
80,281,182 *0884EA9FE814C2488811EFA80CAB4360D42343C4 heardnes3
80,281,183 *08872A45A1919E9BAC50B84E7CCEFE0F2814DF4E Heaven's-Heart
80,281,184 *088892F27A2A200F786347197517A448E443E123 i7mg
80,281,185 *0883DD0409C6ED2788EDC51CCE6782294F3BFA1E HELMETING123
80,281,186 *088BAE78DBB16AED8C85EFDA4A988E767675BB90 hemathidrosis
80,281,187 *088604F3B42B980F82DE7C44C3E9A9F1587F1E4C IBBUMBUS1234
80,281,188 *0883D33B4D8D66CCB3E91BBAEEEF603CB6C38640 herfstachtige1
80,281,189 *0887E16E81A5AECE10478F931DA8C3B8481224F4 HIBORNE
80,281,190 *0886A4AB4E37AEBEC9D2699FABDC7AC27AEA4239 hichkihichki(feat.sunidhichauhan)
80,281,191 *0880814B85831D2975E7F558CA2BE0BC40371D7A 4MAY1172
80,281,192 *08826ACDFEC2E0410D275979A1EEFD2991EFEB7B 4RAZINGS
80,281,193 *0886212A02887D22D1435A0C93A74EBBF97948F2 4REDDOGTEXAS
80,281,194 *088282A91C71881C05B423D9A1CDDCC57E3842B8 ii.i.i
80,281,195 *088B58E30527E58D3AA67429C0CE6631D233315F ikakvomued
80,281,196 *088940006B91A596C58E46DC4E67CB0CE39936EA 50.avohoidon
80,281,197 *0885244D559270CBD9B025E6FF2C0CB9C927349B 513qazwsxedcrfvtgbyhn
80,281,198 *088C0A7E85302D3742B3941C79C5143BFA9C33AB hongschlosser
80,281,199 *088D0DE5B48D1B2D7D326711C22F48565560D836 560antwan
80,281,200 *0880EB6CA6581D4C56679ABE9970F2753A3831C2 5A1PICON
80,281,201 *088AE2B29951BAAA768AB3D6594E494C5CC5B0BE [email protected]
80,281,202 *08807C65AD872BBEF94A6C4CDF11951ECDE5DBBB 5AIGLAGYC
80,281,203 *088A772DC0D3E58344FED001416F21F111E66285 HOT-WIT-U-(NASTY-GIRL-REMIX)
80,281,204 *08881244AAB2AAA6029686BC314354AB1087B5F6 INDEMPN8
80,281,205 *08871221486A70615078A060C4C36C2ED5598D9E HPHOMEVIEW
80,281,206 *0882669CA866A489B811CF81DDAB245760F53B69 H~QO
80,281,207 *088DAE3E967CAEA050FBEF7FD25258535E107EF2 Inkunzi-Emdaka
80,281,208 *0889A62999E68D33680EEE48BE17A293291A2E69 5HEVOSETKIN
80,281,209 *08809130FE89BFBD1C42C20EFA4E0E8FBF1D67CD [email protected]
80,281,210 *088DF18D40C8B9D95BB95D45AF109EBA2BAB7DFC [email protected]
80,281,211 *0881870AEC21604E2FE93805D6EA9D4F7122E627 Interment
80,281,212 *088DAFB27BC67AE944252942BA525534C96B5877 [email protected]
80,281,213 *0886A198E5701F4FB8B0C3D4067E896F7BEF85A5 IRA.BIGNEY
80,281,214 *08861EBB934B4CD0774F54AF76ADC111B2F46198 5METLIKO
80,281,215 *0882579A7C7508362D74567B9D2210478FA663A5 HUNGCLEAVER
80,281,216 *0886652EBAC702B3E6274A23A17E4168E186950E [email protected]
80,281,217 *0887B2F5A543F242C35122C39CF9DB3A1DAF1BB2 ISAACHOESE
80,281,218 *08866DB156A8679638A53523C2FE5FCA5403A1D8 ISBN0786416866
80,281,219 *088D84BE33D2ABA3BA6E9891C334C4DD187B1557 ISSACGLASHEN
80,281,220 *088C3EAC9A897F43206D5828B7EB085B8789EA88 h?yj
80,281,221 *08805C4F8B83BEAFBDF7FAF4189794D113F7E343 issy.jimenez
80,281,222 *0886371ACAB5260716E7550D17FBE2574B3F6287 hymanpolitano
80,281,223 *08872C8A9DE55C9C697DD4237CA9AD1CBB186238 I2/Z
80,281,224 *08819E057503C0B0F1B5F2226B64BEF279798A64 iarelopa9
80,281,225 *0881B32CC06C97E68A1B95A9FC7117601174C63C 63kensey83
80,281,226 *0882BB2DC2E039CF92E004DEAA95D845A2900423 IG6C
80,281,227 *0887CB45E863F7A2637F4AFDF65B87184BE3D686 ihndqk
80,281,228 *088905E2EAC565445A4FCEAC4FD87E5AFE0A4C76 javierkrahn
80,281,229 *08898F58D69DFB5BF13B83A59A29DD8B72A9E3CF ILALSUONGLIEN
80,281,230 *088B0FDE4B16CD538C1D56467BD916F377F4C319 JAZZYTUNE
80,281,231 *0889637494E31460E901470CE3AFBF448E47C1C0 jc'9
80,281,232 *088977AB1185130E44741B10476DCB44D27AAD3F 6dodger3
80,281,233 *08806BB7EF8072D13979B9BDA10CCF80A2F5526F I'MCOMINGONBACKTOYOU
80,281,234 *088FB0E074029ED086FF4D01B60914317D161ABD INDIFFERENCE7
80,281,235 *088CF93B84A1372042422AF04AF70C00ED056025 6MAJORDOMSUNSHIN
80,281,236 *088E06679F80B7286E06E84769FA3F38502CA6B7 INFLUIAS8
80,281,237 *0888D0AADCBDB55C991A65C0CB4960BFE0CB20D8 innerassyrian
80,281,238 *0881B280FFCA7A6C4EEEDFCFE30E0CBB0E1AA03B [email protected]
80,281,239 *088B5018CD3FF7357B4B019E0D1DFA99C876EFDA JIMMYHAMBLIN
80,281,240 *088926E80051CB55D5204EB8757BF1F8970C1EDD IOTEJDUB6
80,281,241 *088AB72DD984A73590CE87FA8C711E46D6892899 JMUNCY
80,281,242 *088505F991555C933B9768379CDA1FFB02CC62D1 6UORDNUNG
80,281,243 *088BC23926CBF6CC200F2EE6B89ABC9172C4D50E IRZIK
80,281,244 *0882651635CA0F0A3AB504E578088961F17DCA16 johnathangrava
80,281,245 *088CBBA85010AF6BEAC044B98B560AF505887F00 ISLA-DE-TOUR
80,281,246 *08823CB797C80308CAE72A5C0A4BB80F1F5F35A9 [email protected]
80,281,247 *08804D45D530FD351C76D9BB11140856D0D3AFDC JOHNNY.SDOIA
80,281,248 *088B485E0109996C320829EB74B6FDF8CD4F062E jonathonarnaud
80,281,249 *0886F82B1840BA19B08E840083E6E1E1E2ABA48D JORDAN.DEGRACE
80,281,250 *08835201FAE3E66D689BE0AED2BC8DCFBCA2BC54 ISSACCEL8
80,281,251 *088DBDC55A4357028C70A2100817820D0B39B8DD iyl8p4r3o
80,281,252 *088C48B3752BA50C8431B9D8A8F8B2F6E0B707CF josepeach
80,281,253 *088F389B721296CB394B932B9C13E1E73DF29779 JOSUE.YAMKOSUMPA
80,281,254 *08879B2B2B92DB03E1A1A50DDA012B05B1C8AD3E [email protected]
80,281,255 *08800A8AEE054FBC83FAD44CE566170BACEE5F26 JUDSON.RUSSNAK
80,281,256 *08803A4343FBD2E65D92F4C5D405FE43911F92FF JAGUERE7
80,281,257 *08887AB2F13DD9319D1438C7E437B53AEAB85106 JULIUS.JAHNCKE
80,281,258 *0882FC020C0E122E1D6FBA91211328B55D7CB242 JUNGYUNPARK
80,281,259 *088F8DFC279A2F6B6589E7313234DAE6701CA392 7FTERHELP
80,281,260 *0888307BE348AE87CCEC4A552A9FA16C012DC850 [email protected]
80,281,261 *088D29306DECFFB11F40DC12D9BA4856942E46F9 7MERCILIEN
80,281,262 *088DA9897871777B614077B3CC299933A1E3DAEF JAREDSOIBELMAN
80,281,263 *088FF1FE8677F31DA215039AF28E1A194A8AA014 KAIMADA6
80,281,264 *08846E007798E70EBE9061186F02684CFF0F86DF jason.devereaux
80,281,265 *08801E018919F4EA9DF87AB536528A5A400E8121 KANDAKAI9
80,281,266 *088598825015FF524C832628A194794266B36FCE 7SCRIBBLESCRABBLE
80,281,267 *088A65B36DBC72157657322B9868C8554BCA6D1C [email protected]
80,281,268 *08839143748969A75C62560E373D0B07C46FFF9A 7SUSANVALENTIN
80,281,269 *088F4A1481CFE765967ABF397FD4EBA7466FE9D5 jclassic8
80,281,270 *0886AFD8F5185112E48044451C0D8C465FC0F237 7WASTENOWHEREOPEN
80,281,271 *08828EFF8A4C042772335FF8CBCBD334B4347A6B kartenschraubern
80,281,272 *088D5DFE5BFC9221924C36F504A40A6177412793 8411938daa34357eb234cdb2918169df
80,281,273 *088E641B3DFC690D685D3EA93B1986CB13F400B9 kautsky2
80,281,274 *088088DB746A8E7A40D80E1F3955BA16C23645E0 KCOSSUF8
80,281,275 *0882B3AEF24FCA6168789D801A1520CEEB21992C jennifer-canseco
80,281,276 *088A93901179B8CD168BB549A55D33D3D7F3DA79 8CM。おひめさまタイプは「おやゆび姫」。
80,281,277 *0884DA6699CF130C79475478D2BD981BFCE35769 jeramygeddis
80,281,278 *0886AF82B880A9C6EDFBC064E46E983C318462F9 jeremiahforth
80,281,279 *0883E7454ED305C7B5F4DE064BB4B17516F4DF10 8E1BBD11BA
80,281,280 *088B473D16D9C0F5502AF80F53DF387B53899213 8EGUABEIL
80,281,281 *0880E81493CEAD1BC99651CFB0105BF25CA21580 [email protected]
80,281,282 *0884FA5C95F59E5D34158BC99F59F071644C6AAB JEROMY.JUUL
80,281,283 *0882CB15CF4CD322D97BD16F1F8BDAC600CAE73F JESSE&MARVIN
80,281,284 *0888C450CF24E6D4B887624A9DBBECEC91F0F8BD jessie882
80,281,285 *08865192469EE1DBA1E3C0EEF714DD2AF2990878 8.mylod
80,281,286 *0884E2D1E83779910C3C2828C7354A67004AB6EA JEWELHAUSLER
80,281,287 *0884E2F4CC8525377B3B7635B46D6328DD5ECEF1 JEWELRYMOON
80,281,288 *0887CD7C447762F7C75A1CBDA6779918583883A6 KEVIN-CRISWELL
80,281,289 *088A519FE159B4D16DB27DC68A09E838C4019FE7 8PARIJAGRAAHA
80,281,290 *0881A5E2327D7F2C45D838D0F0D1771BBFDE36B0 8RENATUGLE
80,281,291 *0882A5FA9F969B09A68E01F0FF642D2624C4836E 8SOZZLEDS
80,281,292 *088BE3D76A6596653266C74D0D8E6564266F8352 [email protected]
80,281,293 *0886535902CF4929706557A9212ED22C940B9A69 JIVADAYA
80,281,294 *088326C1DA0B528EC598C441F179D149B095F835 JLC.
80,281,295 *08894F2FDFD591918CE8284EC98D3597FF13200C JLKIHJMING
80,281,296 *0884903C7B06536CEA20F4043936EAFD6A8A0433 JNNYWNK5
80,281,297 *0887D0E30D6E71FDBA88FD8D0D066D7B9C360EDC [email protected]
80,281,298 *0885A001561B9E4EE9AFC33655C3DA19B42CB22D JODURYEA4
80,281,299 *08888FDD1DAD92574FC6503C0FDAAD61EA64B687 KMQQHJTYU
80,281,300 *0881F06560984FF4B729B866B34C72878AF16BCE joeybergland
80,281,301 *0882E36AECFA5BE85C5534CABE883C88DF0CD672 9DIESELOLVERBRAUCHER
80,281,302 *08887BB75665202237AB57013F90C8449AE27DC6 9ESKRYMEUR
80,281,303 *088F83C6A2D57309F9DE8082A6633046ABD39B44 [email protected]
80,281,304 *088155481724A8C3416DF5A681A71488722BB7C0 9LEESSSSSS
80,281,305 *088EA197B9B09BBC8B8E3DDC140264BA7D4B1611 KOOSAMARTH
80,281,306 *0880509AF9AA6CB590BE2528D45F7B78FCB60E6F KORTOORS4
80,281,307 *088A4F45C7AFACBD15F195EA0D729F1211AB7298 JONY.DEB
80,281,308 *088D96610BCEA353EA6D7EE8BED58CA88B27F51D kraigriese
80,281,309 *0882633C08740E04F3D841B29ED11DA4EC2EEC31 9SCANDERBEGS
80,281,310 *088B0DDBB086815B3393446E92AA699CECEB8D4B 9TVITARE
80,281,311 *08892B778198D1FDA591A369251E722A542CCC96 K|RU
80,281,312 *088553718BA0139C2CEEE4C1DA77675F5D61B4CB JOSHYO
80,281,313 *088F5D60452E71DFA9C86E1B7D09DA9E8B544EDB JR1121
80,281,314 *088D547E08B2BCCA8EFC6BF8DDB096BF5DE19689 A1oY
80,281,315 *08834930E36AAC9106C325C935BBB504F4EABD9A A3QT)
80,281,316 *0882DB1FDC8991C036026E95F9B9D44AA38E2791 [email protected]@S7I
80,281,317 *0889C6B4B6DB688A0BA895C0E25A856011EF1A57 L9889
80,281,318 *088E9471179DDDA347B2FAFEDFA11B88691DCBBF JULYVYT
80,281,319 *088639E4DA17A95198A8F7647954D5215D342539 JUNIOR.VAUGHN
80,281,320 *088A01BB4EEACA193CFB4D13293EDE98A298A0F8 a8eks
80,281,321 *0881FB4C8DD7B9ACECF7A2CDF667102CFA527598 JUSTIN.GARRITY
80,281,322 *088148ABB00EAA02413892357332E50CA0E78EB3 k?/[
80,281,323 *088B3D99454DFAFCA19B4C4867761395BAD5F1FA [email protected]
80,281,324 *088593A5D06DB286C1B2D42497B603884B02FC99 AAB.:$
80,281,325 *088AC8F6450A29E7C220A2F75397357A597638A2 LATRICIA AND VILCHE
80,281,326 *08843086309AA67B31F3D15C34FA1CD0DA68196A KAP-ULA-KINAU
80,281,327 *088F02D0FA4F6735F5C982CA1D4DBCDE33A80C37 Karl-Siegmund-von-Seckendorff
80,281,328 *088604D0C2D7531C8AAA631BB1971C37776643BA laurenpalm
80,281,329 *088A56D6F1F5C8F46B9AE3EDEC09D6330A3FF9DF [email protected]
80,281,330 *088E13013D5364290CF3C99E7A4EF25D0A832E3F kaustubhthakur
80,281,331 *0888EA6565AAD21AD3985D16384DB3076B8413DE kc.legaspi
80,281,332 *0889CD13FEF6A9482F8E6C873A6F127860E760EE abb07$h!p$
80,281,333 *0889CECCD186B68678E5B4C52BFA48EC864735C0 KELLYPROUSE
80,281,334 *088B34B6A8130B330D0424D617EC39A1B15537B3 KENDRA INMAN
80,281,335 *08895925D8030BDC9E9BAD11FB70760BADB4A86A kenmandelbaum
80,281,336 *08845393F628F86845B412640AE4788F7333CB8D ABOO
80,281,337 *08875CE575468BBD186DB635C17E08DF2237E8E0 LEONARD.MINFORD
80,281,338 *088EEC37922C59641F27D413F2FDDE5581E48CA7 KENNITH.GALLUZZO
80,281,339 *0887BA7AFAD7CCB8AA2C0965C927FD1FD50521E4 leonardoslatin
80,281,340 *088204A9DF198AED4FA487E0E520DAEC4206116E kermitbrighton
80,281,341 *088CB85FCF0541E05509B0454A86BB99B7DEB130 a%c.-
80,281,342 *0888A1F397FF38E49D10A2DA696CD8693B61D520 lewisfroehlich
80,281,343 *0882B44BE979462DCE55FD0FB44BF6FDA30AC595 KICK IT DOWN (BBC - RICHARD SKINNER 26181)
80,281,344 *088E5ED81A0D48B27FB639AB84A5BB70FC6F7387 <Li><A-HREF=#Q35>35)-<CODE>RPCBiND</CODE>?
80,281,345 *08850BE15AF626FE2E141BA6978D2C2B68630E53 KIETH.FAGNANT
80,281,346 *0885828FF5AEA041B4B5F5805C68022824A12BC5 [email protected]
80,281,347 *088056E587AB696E622994E6AECD1669F8E65FD5 KIINTE
80,281,348 *088A7A54076CF3AE02383A41E7D23E7AAE47D41B KIMBOZ_ERE
80,281,349 *088356F1260F8299D459BA800B989FB567756272 Like-a-Women
80,281,350 *0881CF30F5081DB164BF564DEFC62226D0D2D212 KIRKMORGANA
80,281,351 *088E476C1A9A0025686681A866F9BAE601A66EAE <li>modify <tt>program1_1</tt> to print the input line twice
80,281,352 *0884C815228145A71C3C1F467FD154AD6310544B adhqh
80,281,353 *0880C220FA4A05528CA1E35764296ABF4B7008A2 [email protected]
80,281,354 *088D660CCAF5F19C0C27DBEA853CB835B48BAB2E [email protected]
80,281,355 *088AB8128B7F341EF30A83F988958C606CE6E8BE adottassi!
80,281,356 *088E2A443C58D30621085314FBC34A2D0B0BA524 KOKONAISVELASTA
80,281,357 *08837C5CC94F117D3E50661AF96033FACBA18CE1 adresujeme
80,281,358 *088F392D6C48269A3BF27D6AA97A3E38343C0C0C [email protected]
80,281,359 *0883E157A4D83EDD6C03FD6AFF63C9849CBCE599 LKELUMBAI
80,281,360 *088ECD2E8B7D396DEFDF580E1B6C20F0318BFCCB LLSOBRE
80,281,361 *088ACB9357FB089362C5F173E91D24DAFAA56E72 LMMNDGST5
80,281,362 *088A32F2C4106F5F2321FB54D666C7E090FC266A [email protected]
80,281,363 *088340556EB5CD0445229A73ADF31CC5AFAC08D1 A=?F0
80,281,364 *088BBEC8066D0C4F0FCB870D2FF8E293D3C22D19 KOTONAE8
80,281,365 *0884EA277E2ADFEBF42BE31D4224586FCF5582E8 AFW_
80,281,366 *088E64AE872BA99D9CDB7EB39D02448E34031A4A KROOKS.&.SNAKES
80,281,367 *088B597791EE19953AB9407D13EF9A8BF1D1B453 luisbattles
80,281,368 *088455F8CF37143754C5369C5B7CE883EE99A139 LUIS.DELGADO
80,281,369 *088AE4838457E48B74C41E07C783716410944DD5 [email protected]
80,281,370 *0884CD2E7F6AA89C5D5C81D6585E339C6582648F [email protected]
80,281,371 *088C6C778F11748BC129A16DB3FC4BF1938F501A kvinnodrom
80,281,372 *088908A28A08F465E49FEE3BFC8E41BF6F2A9718 LANEBURGO
80,281,373 *0887DED3674A31DDBE5326270EBDFF8E4D17A2EC LANEWEIDEMAN
80,281,374 *088AC84DE6BF448327178401560210A39E366CED LANNY.DUBOW
80,281,375 *08848499B06FDC5D21017DED8B0E735C03706E13 AIDORAP8
80,281,376 *088FFAFB82DB533FE35E87B9FE1415943938296B AIYANA911
80,281,377 *088E7E903CB973100F078E668AA90E4B42916BA2 aj(ev
80,281,378 *0881E820E75BE0E6BB8E9FE27904D7AD20BEF0DC AJR.A
80,281,379 *088F09FBF08E6BB7820AC0A758184F2C1F72FE77 a!k"9
80,281,380 *08816A8764202D9531C072CAE806F3C6E13033FD AKMANOV2
80,281,381 *0889FE133BE26E74B907D1CC36ECA22B4F24356A laurie.ray
80,281,382 *088F412010D9BC10208D661F0B9B09B87CDFB12E AKS#
80,281,383 *088FC9BCFA3610A639C96FF4CD5749AB9FF4154B MALCOLMEDSALL
80,281,384 *088471A9EE71F7AD6FFC21FC66A9A76A1B51C9EB LAZAROCROSSON
80,281,385 *088EDC5981BF489C6AF00843A621A30C89F4BA17 lbatsaws
80,281,386 *08851D40A2A68C30D1BCC50AA7591D7D1D5DFB84 aldenjoel
80,281,387 *08897C9C25DF111BB145A3E4D1E7B8E37177C92F alecplewa
80,281,388 *0884D8900641C0FB564C0799994CEC10CDCDA19F alexandrasinclair
80,281,389 *0885969FD33B51231071731C65B4E03AD32CCA3E [email protected]
80,281,390 *088A5E515262CB1A1D2F225CA0BE09EDD9374CFE leisolenus
80,281,391 *088C0E6251F6D8542BA9C2BBD8841F357FB84530 LELAND.TARQUINIO
80,281,392 *0887AFF407A6FD46DBD468392607D46FBE801AC5 marcelembrey
80,281,393 *088120BB10A7A0D91402C783183C5E2C6B91A468 ALLANB4871
80,281,394 *0887248958A0F4B1F0501A36DCB547F40748DFE0 ALLEALEKSANDRA
80,281,395 *0880CAC09CD1D43658E4E2376CFBD7600902EB57 AL:R!
80,281,396 *0881236224CE404B2986F25EBBB44E2B9ED2E86E altarses0
80,281,397 *088491BB3E9F01FC0DBA7F59EDE0BDC9B0F4B0E6 MARCUSMUHN
80,281,398 *088862FD747BE68D35FD594633802E9B5EECD703 les.hodges
80,281,399 *08885428F8C6FC3BD81D52B4BB69031E6A5455CF MARIANO.LARSH
80,281,400 *0888C6412A4597979CFD704288CCE290390E4A0B LET'S.GO.SHOPPING.TODAY
80,281,401 *0888AC9B1B770A96020B922AC8BD59142AD10FE2 maricel.hernando
80,281,402 *08875971839385A3B55EDE5131D63086C8412683 LEVERKWA2
80,281,403 *088A73B0AA2EA5DC89EBE619C222B7B8046639BB LICAROLP
80,281,404 *088F849F44DCCB1E114E60DFA885E8F98CC219AA AMOSHARBECK
80,281,405 *088448961AE9A70198A16E4A1721E8A8A9348ED3 [email protected]
80,281,406 *088003F1EE8BEAC5A514C1AFB84F9FA1B4EF0D41 MARLON.KAZARIAN
80,281,407 *088BE180DC170EC2265480F864E6B5C31E55B110 amph
80,281,408 *088DF2C3B0AC2B02364DED302A2546F4A54BDB98 LIST_OF_BOARD_GAMES
80,281,409 *088402DFAD399AF5E0B21176ED39247E6535333A [email protected]
80,281,410 *0886C67A56DAE6F5041690291B7FB5C8E0B7E0C3 <li>the internal reference number (inode number) for this file
80,281,411 *088214A611E560931F35CAB28FCB0F20B2068FB2 ANGEL-OF-MUSIC,-YOU-DECEIVED-ME
80,281,412 *0882BBC9B90A1545B586DCAF019B5BA73904CFFC ma-v
80,281,413 *08869685B3D47FF93DF9D722B7D140C587EB1BC2 annette.apicella
80,281,414 *088082B3BC135CFFBB06AB689EA996708C94EAA6 loconayo
80,281,415 *088053FA331899CD0EB449EA530109A01271AF91 MEANDMOM10765
80,281,416 *088CBD4AF38EDA1485613FD0BB9B1FADDF969761 MEENIGHEDEN
80,281,417 *088536479A84E09E5770D5794525A282F3BB1950 MEGANSKILES
80,281,418 *088876EBCF72EF6DB07782032604952979B157F9 ANTLER-LIKE
80,281,419 *088E3BFFDB7E38FD0B09F5BE3684FCDF3720E020 %LORRAINE
80,281,420 *088CA4121CA06E295E48317BB96AFE1C4439824F MELVINSTAMER
80,281,421 *0886F56AA655794FB3AB50D7C65C27AD923E3BF0 ANURANJANKUJUR
80,281,422 *08899771E23F91048D7133F6FEEC11327FF5BE1E LOUNGEBENUTZERN
80,281,423 *0885566A431E2A968FB24172BE1FBB4F635E1BB5 AOU2009
80,281,424 *088925D74D606B407097EE473F1EB52A2CDEF945 LOVE.BISHT
80,281,425 *0881A096B428D324487A64B870D785C60A3F7ABA MIAMISES6
80,281,426 *0888E10FC8041CCD57DDC333F804221688A92BD7 LOWELL.CATTANEO
80,281,427 *088425ED23F3427EC250B1B73B44C3656340BFC2 michael-maslov
80,281,428 *088AADF92D896621BF280DEF01AE96C234B8C548 MICHALEORLOSKY
80,281,429 *0880F21732C6C805506154CBFEA70E1402D9BAD0 appf#
80,281,430 *088CF77A487D9E801F7D67E5BDA1919A862E60EF LUCAS.SERIGHT
80,281,431 *08841FF130B0BA27848115EB777A691BAEC311FF lucaswayne
80,281,432 *0883C25ACF4680A2F3461AD185A08B7CBD0E953A LUCIO.ARAB
80,281,433 *08843C6C0517ED89F7AA51BA06C80606EC840336 luciogoodrow
80,281,434 *088BB7EF411203EB28432AA67628F0B5B17A3BCF [email protected]
80,281,435 *088D38AD27632904F58B78722C0A8ECD4E20335A michealselia
80,281,436 *08899625CBD449F3C926B09A8B090767F5FE77D2 mickeymccrystal
80,281,437 *088E8F83E0EA80AD4D3508C3465A6F2E8ACE677E lukraaks
80,281,438 *08874BF3D7376BD51198A282B6A2D3A1CF63B6FE LUTHER.GARG
80,281,439 *08845C30E8E02F9FC91ABE20413E2E28C75C9DE2 ARBEITSBEREICHE?
80,281,440 *0887BB1B695E00EC96E60B001A7D77D3BFA3AF08 miloux
80,281,441 *088D42E745C8FD451C35DA2B2C9119C6838C801F MMAGNAYE
80,281,442 *0881D6A572658F0FA3561CE539DD0F9FE33B892E mmbuvev88
80,281,443 *088C37B1ACB7733A3A12C5E510378654B591353A ARTDOOLIN
80,281,444 *0886FEDFDF16FAE5737A52BD0C1CA45D3914C59D ARTHUR.LEMBO
80,281,445 *0889DAB358CA96F11C5D6BFD3103C873CDFC34B4 arthurmerwin
80,281,446 *088146585B0ED65C49018E1138AC3CC5D1BD8B48 arthurtenuta
80,281,447 *088AD49E8E50AA2C088377B23033FC5A9198205B ARTICLE741727
80,281,448 *08873CED36168C2B684BAB10E27C7D2ECAE30D97 as an angel walks by
80,281,449 *0881B0B31D4FFA29A7EE706D947B192C0BFC3E96 MANDRES9
80,281,450 *088404EF9D84969C46FA59C930A199264793AF7A morrisfermin
80,281,451 *0885A83FD17439ABBA859365AF9EAFAE3181BA3F [email protected]
80,281,452 *088596B0D4C6BC8AEAEBE330A348734254E4920D MPOTZIOY5
80,281,453 *0881E171AB8A386BCF2212C4440B7DBBB1AF8D3D atio.
80,281,454 *088F49012A9B8AEA12EC86E469EA8D37A1FC621E augustusruot
80,281,455 *088FCF7C35DB93D6C34A78E51175CF8F6E9BAF55 [email protected]
80,281,456 *0883F2ADC91B7153EEB4592F4139E15D4D28B728 aupl6
80,281,457 *088A5E0275DFFCF5427C0C4909BF90D94C94E628 AUTODIENST6
80,281,458 *088B4253B42FB502B7AF0BD70111CC9E5161CACE marksmithy
80,281,459 *0882414BB3F162D819DE997E4D2BF35E5058C85B MARQUISDUFFICY
80,281,460 *088926CCF26B7DC11C1F13B17070E35432DF850E MUBEENA4
80,281,461 *0882D021F37EA38395C1E43DF2C289059225344A MYSTICEYES(TVEDIT)
80,281,462 *08847E3BD239ECB3D5F3D2A45E566DFFCE77E8BF marycecena
80,281,463 *088FBC401A67370568474F17B3D2C4EA2EA8571E ma$tur8at!n9
80,281,464 *0885AE6255B94BAE6A78CBB556DB4C2F696764EC B22E5326020F91CC525D187F7C416A34-DREAMER
80,281,465 *08897A19703940355EC517E0133956B4E57F758B B3VISMIDL
80,281,466 *0881AE77974663E970630AD130DD77600398BA50 NANCY-PECSON
80,281,467 *08843620D9A2BA7794F81C080F2CA6BFC85BF84C nặng-nề
80,281,468 *08886E601DE817A744F0CCCAB92F70FC29E78E3A b6vi1
80,281,469 *088F69F40CC4A6BE4EBDEAACC8258BF6C336B488 MDARWINING
80,281,470 *08898FB44C95762E970A06BBE92C1535749F8D6F nathanaelostiguy
80,281,471 *088ADF9D49A1C5F676AE57DD97370FDDF6C9A6EC MEGA1ENSIAN
80,281,472 *08816E4A2A5C73AFB77DB276828C0A66C80A461D [email protected]
80,281,473 *088B9A1A213F3F33D2967AB9A06C52FD457EF123 MELDOUVIER
80,281,474 *088BB51AA143728F25DBE47138528F8FB065EE77 b8pm-
80,281,475 *088A058E22B56D486FDDD4477613812BFD230572 NCPTLTD
80,281,476 *0883541D02F287BE0E8FCBD19284601AE79D28B4 background45
80,281,477 *0881924CA492FE441DB71B9CB037E9F337A50D31 NEIL.MOULD
80,281,478 *08845E25C0E5E76157BB1D89576DF4DBC668408A BARLEYB1RD
80,281,479 *0885C3205D58B71B8A451D75D885086B59E139C9 nevilletaverner
80,281,480 *088D3922379055FE10AB325FEB57D37C355BED97 NEZAVARI3
80,281,481 *088624501DC22917A6F5D3D0085D2C7B0CE58C37 ngvlgsting
80,281,482 *088D73AD16A7498AB8F1CF5B1A3D6060991EDD55 NICHOLAS.MANZONE
80,281,483 *08810480A6E616C872B4C6457394C08D4A4F040A B-----B.~0.SPLAT!!
80,281,484 *088D46EDAA794AF79B948F2B4B5EE40CF87B7993 MILENTAS7
80,281,485 *088CCAED9B2E2C63B70667938E3EC1B3AA1D557C no.121:twopartstudy
80,281,486 *08802E210D402185AC844F7D0427F2F116637343 misc4s+ing
80,281,487 *08819E1556019A381DFBD6441218F3DD182272B7 Bedropene
80,281,488 *08855A4EBD4B4B547DEE6E87A9FE9A3C2016ECEA M-/L
80,281,489 *08807C75A9805574F57449B470B739D0867A55EF BENITOLANTTO
80,281,490 *088CFAB7D2E75D1641DF806375889C6A62EFC295 MLAKALI
80,281,491 *08834474918CC22BE644AC2823AF7F1E36EC285F [email protected]
80,281,492 *0881B1925D38404F02A83D0F846CB076AC7132E9 BENTONBHATNAGAR
80,281,493 *0881F31AB71DCC2381C61E2CC668BF4E12B00F74 bentonhersey
80,281,494 *0887DF2B1614C072ECB927EE118497622507D43E mohineyam?
80,281,495 *0887693837E812F4874DE11BA55440AD542D6B0C novellodavies
80,281,496 *088719C94A683586DF0899BCCB4A266BB7BF4A4B nqaaa
80,281,497 *0882C09387347140A1807B9E4347CD5B25F59E4F nrerenev
80,281,498 *088E21E9F423A2538AF1A5F9E5043F2F61627166 NSUCCINYLLGLUTAMATE
80,281,499 *08816BC906C4F56120960FE5B5B1895DC4099719 NUMBERSRULLER
80,281,500 *0884E9E6B677F40D87C2A9959C2CF751D834F734 MORBOSOSES
80,281,501 *0882EEC38707994826558F7B1FBAF3D6738E8A1A nyc-(there's-no-need-to-stop)
80,281,502 *0887884AED57ECFEAE46EB0895AFAD0B59FDBBF4 (O_).*.*D8
80,281,503 *088F5BBCD45475C7B3EAFC216BBB2896A421077D odors&officers
80,281,504 *088B423619BCB744B65816CA1999CA77C6BC1D91 BHGJ7
80,281,505 *088252C560705E1569A0A27E96703071D03AF0EA m{=w
80,281,506 *08806BD02A7BB4E9FB7C9614741B8DFFF7D7F354 OKOPNIO4
80,281,507 *088A45547C99DC492B86E3DBFEEBF8A091AED413 b_i8,
80,281,508 *088521D3B0FD7B9A1C410F5C04D4FB08B7064ACF ONARPMET7
80,281,509 *0887B108EF20338AF3F05736A51366EF15AC11ED n8xp
80,281,510 *088D416180C097F858EC66A21BA9E64FBEFD1553 BILLYKILLER
80,281,511 *0881CE1C5A92C105C5126D103A429CB9B5393281 NAMALINNA
80,281,512 *0882D891F1572BA378D705E7A11C12B1AF4D5E42 biomas919
80,281,513 *088E0D4BE617918E907A237910CE1A9F9BD4388F NAQUELLEB
80,281,514 *088D6D94ECBCF64DF2B0921F85D248B1DC901674 OPENSHELTERDECK VESSEL
80,281,515 *088C7D37A770F93A59450706D2B767ED45261BA8 [email protected]
80,281,516 *088B3CF3A4AC2D09DE941EA48FC31907A012F5EF NA,.WIE.WAR.ICH?
80,281,517 *08873CE590AC5ACBA242C3B6BFE46C8AEAE3F35F NCASTELHANO
80,281,518 *0887BD5218F275BA876FF33DD57E36A6CFE91DE9 OR9ANELLE
80,281,519 *088CF562282FD65C9F1C530206AC3CF38E258089 ndterligheds
80,281,520 *0889042D76BE926012C8E4FD4C84BE2EB9EBE5DE blhlo
80,281,521 *0881DBA36A0569E9F42D020AAB2A50BA2FC5A11E NeverendingLove(Frankmonomix/1987)
80,281,522 *0885B75892EB550042F75A6C869D1B2F448019C9 nidhi.thakker
80,281,523 *0888B351A93C56A82465C76BE01FDF6AE55E0A1A bm&=y
80,281,524 *088021D99B1553780EE3C2F297690613A72DD80D bnj4l
80,281,525 *0883D56C4B315599EABF160CF94A20CFA4C9C29E (>_<)`(==P
80,281,526 *088E9D01F1F59C946DD01F3FAEFCBA887DD45B75 nobnymt69
80,281,527 *0887B41BF9DCF143DA5B326E3951E3797D64BA2E B-,P5
80,281,528 *088B46D1F2D9819C4B25BABC55351F6E4194B235 bqggd
80,281,529 *08858FAE1A549A747ADF151E1E84CFAB291D1658 BRDHO
80,281,530 *08852FBFD07996768073B2FEA2CA2B0F2F16C214 patrick.quave
80,281,531 *088C79E63BC4A512E8FD358C4484834970060338 PAULHAFER
80,281,532 *088FDFBA4C0E131E08F8F5B269819725284F80DC brian-rawding
80,281,533 *088D64A600220EE780E2019EA948F609A4CD02BE pcww
80,281,534 *08861A37DE073443CBFD5FC3E76A11614801668F BSRGA
80,281,535 *088256CC0D2DB8C2D84E9E831A21211347D1BFCB OMN1PA71EN7
80,281,536 *088F581CD7CE25DC40E0D3D3EEF662D06DAA2122 bulldogledzep
80,281,537 *088A8366EF879BB6A6412D409B082B94483938FB PENJASKESREKR
80,281,538 *0889B2812952A3D1F01F7679235630E530FD2800 ON-MY-OWN-(FEAT.-DWELE)
80,281,539 *088738168EA98A6FB3B6E9F6B460BAC0677FB3D4 onu-rd-congo-monuc-fardc-alan-doss-nous-a-rendu-visite
80,281,540 *0889DFDEF3ADD8654680F5452DFB2F4E5BD22EA7 perrysilvera
80,281,541 *088E37DEA4F52EEB6676206138E7FC18D4E9A9A6 PETER.PAGANI
80,281,542 *088538949EE44192CA71945C18F9D3A63BB32262 [email protected]$7c
80,281,543 *08886B6A7B74240615CC47DC6853A3168E1A0218 PFTXZR
80,281,544 *0886788678404CB13803539906E218A110A9E351 ORRIIEE
80,281,545 *08814DA880A563A8B84C92A960CA73DBA84E3D91 bv-p(
80,281,546 *088A2AB2B6C976EE657FF1A2E3A08BDE9FE79ECA pianoconcertono21andante
80,281,547 *0884DD2C00200CACBF300BA9551B64AF76E961F8 bwrfm
80,281,548 *0886B72C37A9E20C8D87DD74F438B336DB35FE2F PIFFERARO
80,281,549 *0884EA70AA475CA2B67C3AC0578381F530CAFA0B C09N1SA813
80,281,550 *088221DFE409302825F12094C7B7A300F7C9C5A4 P$3UD0-AF
80,281,551 *0886E81B9CE93DC55D9DCDC701EADEA8923662E0 P===@~}O{
80,281,552 *088675FD36E08CAFA6569F50CB7C3824BA622F0F [email protected]
80,281,553 *088C284AEF443309D1E004A32F1FB370D4295527 p----B.~.~.~.Sploit
80,281,554 *0881D27097A461AEBF45BC53598FC03B84201B2C canichess
80,281,555 *088F58F7CEC976838ABAA295E53F195F97F33B7D [email protected]
80,281,556 *088F036820C3E2486BE692E70D30AB26F18A52D7 carmen.serena
80,281,557 *08816B84D407F3E716EB0D775BC20CD02725B9E6 CARROL.RUBRIGHT
80,281,558 *088CE0F84D60D6C14802AE70F908A0FED2C919EB CarX
80,281,559 *0887618AB978714737823D60589233D04A069DBD CASEY.CLOSS
80,281,560 *088744D1BE4885F365364B98BDA74F3B4AEC3022 [email protected]
80,281,561 *0882D17DA54A1FFE8222220C9972AC57E78DF7A0 Q/G
80,281,562 *088FC7879BFBEBB733E9E1B1B757EEB194591A09 CC74P
80,281,563 *08833987B3BEC098B1CF211EB36BB6620879F205 CCMCN
80,281,564 *08821AA835F6A3FE169BD8E6771918AC2D1399F5 PETERTHORNER
80,281,565 *088EA35F101E3E5190A2FB32DA98AE5A640FAE4C PHARAOHHOUND128
80,281,566 *0883AF9442718794058DBF600AB3C51A9C2E60A8 [email protected]
80,281,567 *0885A47B5506BF0CCB8C320196842F46913FD45B PHG=
80,281,568 *088CD6204CC91E32808A6BE04BA49239CA6EC9C7 CEH95817CH
80,281,569 *088A72ECF16FF78C3BB09786770F38FABAA541A9 pifivdb8
80,281,570 *088013623C22BA9FFB6F127F0FFA22EA9FC7B756 PINKEYE
80,281,571 *088A7B2084E382BD6829FCBA64175E0B2E968DF2 PLANETRYAN
80,281,572 *0887D1DF2095511531477FA4DB78E0E387C461A0 [email protected]
80,281,573 *0884925AB522C5A62FD76EDBB0C94DAC1676E620 pokertournieren
80,281,574 *08864AAE1FBB50CB90551F75E5FB584B70128B58 RAPPELLEERT3
80,281,575 *08862478335D80E7F0755BB9C571441CFAD559CF chasderriso
80,281,576 *0880D52C0612B75E203827DE616163DE3B08E121 RAWUEL
80,281,577 *08809A6ABBD04DDDDBD876BB497A05DD1B872F04 rayfordschonfeld
80,281,578 *08894AEA233885707332BB92410A3FC94B609B31 RAY.SPENCE
80,281,579 *0888DB281A49D7BB0EC9E01551AEC1876CC0A0AD rchtbnkned
80,281,580 *08860F0D3CA7783C996A06FCB453CA2D46468848 [email protected]
80,281,581 *08813A6BB459F338E1BC123040B2D101387F8BE0 [email protected]
80,281,582 *08863C65B9F1E50C8BE054FD86DF251F39160909 pradeep.balaram
80,281,583 *088E552B62B0DE3588FA9F34C507755C0CABED78 PRANITASHRESTHA
80,281,584 *0882BD8FD9B88FB9E66D4098796F59E11B245359 CHIBUZ
80,281,585 *088D45AE809A6E6D0DBDF0E88AD518B9105C96F0 predatoriness
80,281,586 *08825FFC1FF5A03CB6D487EFDB8ECEF77A80AF4B CHI.SHAWCROFT
80,281,587 *0889EA043CAF64182DEE48E7A8C74E9EC89F3F39 [email protected]
80,281,588 *088700818AF933EA339BD6868700E6F251E9A223 CHOLLY-KEINTZ
80,281,589 *0881C4248CEF434C30BF2E5FB51E20C95F2AB248 [email protected]
80,281,590 *08834F856AB6471654CFB5FE2D73FFD136C1B432 christian-paul-garlutzo
80,281,591 *08815ACE2807B0540152174DDF0B6732A2FDB95E REJSEGILDERNES9
80,281,592 *08846167C638CB7690C07F77CB6D832ACFB858F3 [email protected]@+ON5
80,281,593 *08800E1ED94957CEA0167DD601F4616060C7FDE9 [email protected]
80,281,594 *088311AC175C7DBC8398950B9E7C0A218C7364AA ch"wu
80,281,595 *08871F554434C1D3F1555FFDE7D1014C6CB67288 RESDOKTORGRAD9
80,281,596 *0881D72CCC1E109F0F33AE9469BD3029E90F40F3 PROSVETOM
80,281,597 *088CC824B7C2E7478F99B351393B3DD7D2FBF60C cii=d
80,281,598 *08844321428E1C85F1188DACA61EA7F3AF33E2F8 reximeulb
80,281,599 *088DA7B2C522A36E583402B937B54A9EEBE28AEF RHYSSARHYSSING
80,281,600 *088099C3050CB2916B1D386CAC7C1D3EFAFCB156 RhythmDao
80,281,601 *088E696F6418123ADC1799A1704891FBA87AB580 RILEY.SPEH
80,281,602 *0883812D1848A0383BAC1A5AEEF12894011AA2B5 CIV56
80,281,603 *088A812EDDB6DE1882ECAFAAA8813B241BDB5BEF CKJVV
80,281,604 *088F6EB06674C3B0EA286C7D47A6BCF22A70D5C5 PTUMANYAN
80,281,605 *088F41D6677C922B1135A0CD4DD54FD8503659CA pudnuow3
80,281,606 *08843BCEA143EDC795B1179A6CC28A510DA15962 roger.da.silva
80,281,607 *088E1F396D2907F828EA35072FFCC52A58BA0FA7 QAISERE
80,281,608 *088DCD71D86025CE563E95A55EDE340E110E3136 ROMEYMARIE
80,281,609 *0889FC54A60EC7B7F3D9C3ADAD4D3BB3FD77F22C ronniedunkel
80,281,610 *0888BC971CC5ED09356C323249EC0E9A4D397B66 C=#MS
80,281,611 *088F75F02785B8B213C0695B9F5CA94575470991 QUINTINALMQUIST
80,281,612 *088B185F2E4169E5BA431A40474BA2A1FBED4E51 rough_guess r/@/f_g/e/s
80,281,613 *0881650BEB5303256F7DC2524AB5BA10154242D1 ROYCE.CORRGA
80,281,614 *0885CB01467955422B953225C457A5E7E1FC4B93 roycedemuro
80,281,615 *088790BAFE7E7FD5BAFC2309EA520CDD1D4D0037 RQ[L
80,281,616 *0886CC39A874096B616BB37493A0A41595DAB9FC RUEBENWAGEMAN
80,281,617 *088B29E43178802CE9CE348F9775C5B12D7BEBDA RAMBO.PEL
80,281,618 *0885F319869147CAAF2C3AE7FC37CAA2CF144352 concerto for 2 pianos in d minor bwv 1060 - iii - allegro
80,281,619 *0884C51BBA8263A58B037B522D27624030BD4185 RYANBANCO
80,281,620 *0882A70C7ABA5568876BBBC76F20AB6B5398BC6A ryanlapolla
80,281,621 *088115D7D20BC62B5401B60A139B272DB6CC3BB4 S09100603
80,281,622 *0889E4B40D113D574994C0899F12F11843EC93C4 SAGAR.KAMTEKAR
80,281,623 *08860626B1D1102BB1F4DE0121E652ED8A6E549D saints_10
80,281,624 *08809FD0C49B810AE084318473675DEE85B6F311 RASHAD.BROCKMANN
80,281,625 *0883CCA0C7EA09DDDE31309763BAA0B4ACF5CC78 salvatorepilarski
80,281,626 *08833827FF28AD323A13EDF2A07FEAB2E4B9F2A3 SAMENGEVATTENS4
80,281,627 *088067B7EC0FC40BF82B1206E1A7275677B06F91 confirmatorily
80,281,628 *088D58E30AFD71DF89E7325AFAF1D3D6492686AC RAY.LEONHARDT
80,281,629 *0883AAF652395DBFCC1EF4E96D60610EF751ABF8 controversies
80,281,630 *0883D7F47043C4E562C0BBDBC8446941FAC6A616 REALLOVE'93(ORIGINAL12")
80,281,631 *0884C50A8F82D21502E9405E76AD0EE3003541E5 SAT考試
80,281,632 *088112CEEFED094DA6ACF692B84DB1D16CCF2F31 SCHALAUSKE
80,281,633 *0882F4D4F416D2932A8753D4374E316BEAE4099B SCHLIMMES
80,281,634 *088BC48459ECC9667B97ED1AD28F84C78BD80EA2 SCIENCESPOOKY3
80,281,635 *08810A24F48C27F611BB59C741FD8D4F2784A543 renatoizzard
80,281,636 *08880487534DD24E1D219C04F2ABDAB24A171365 SCLEROOPTIC
80,281,637 *088690CC9212E8116C1D4F122520927C74E5A485 RENE.RITTICHIER
80,281,638 *088759CEFB69B5910AE4C3AD326B9055535B69B5 scorpionemmitt
80,281,639 *088DDF37B8618EE4CBE89C906741AF7F80C5D4C0 SEATTLEEMILY3
80,281,640 *088E469E7D41F21E78F0224D619FDDF74D95165D [email protected]
80,281,641 *08831FAC307C2320EA4216D2EB90DF902421C917 SELPPAYHTOMIT
80,281,642 *088F0B3787346CA1F766E9FF09AE633B6BB65A65 senketsus
80,281,643 *088CD43BE1473C8789EC7655456448B1FCDB49D9 SESPANYS1
80,281,644 *0882067758BB29A39B96B264D12FAFB3609D17D7 CTH3U
80,281,645 *0886A3C620AB06FD9ED7F1C83ADE049E43D0A7E2 shannonvalenzano
80,281,646 *08863F2F5664F33951F4BB0D65432F44B7A5E631 riempirti?
80,281,647 *08868F0394879F0B9436E95BB56BAF28E72654D4 shelbyamidi
80,281,648 *0880845060CB96453742982DCB1B43D0AB427AF4 SHELDON.ARAGUS
80,281,649 *088A218D2ACC091574ABB3D018E127064E664C32 cutu8
80,281,650 *088110952AFDFA191EC9F60CDAE5C817B3443818 [email protected]
80,281,651 *0886B010DAC2426BD8FB6B99581078B428439355 c;vnm
80,281,652 *08872DC3E18F23DE71C235DE0E7047197F4BDC82 RIOLOBOSES
80,281,653 *0886841F824824A87D5ACB65F8DB41BA52BBF447 shlumz79
80,281,654 *088AF22E3B6071B6E33F8B98BC332F004B4F712E d0095
80,281,655 *0889C13122FAA8D6F332B381BEC06C35D9BE9387 SIMILARITAS
80,281,656 *088B8208882E6C5D4BC5013A44A90F3BAB33DF7C robijns1
80,281,657 *088B3B4B98879230F177AB3CDBD21C5D4FE5AE52 d1st1llers
80,281,658 *0880FD248E9EB9D93C6D982D5207E09CF34E2C2C ROEYHKEAEKSING
80,281,659 *088D7AFC66701EA5CA73C87A6E2DE2F3F7ECF629 D2;.R
80,281,660 *088E2CF1942B74AAC7100252C38886E523C96559 RONALDCOWBOYS7
80,281,661 *088179F2AE84718A89FB8D4EF6B5A7BADAE024C5 SLAVERI8
80,281,662 *0881A394470E3E328C2433608F07FAC33C906E6F d"a1i
80,281,663 *088FDC68CA7076B2C4FEF2A1B4614163D8B9E384 [email protected]
80,281,664 *0885B359ABCC48B42E53C5AF61A85645F906660D DAN.ASHMEN
80,281,665 *088CCA8BBA525DF2DBC20F6AA5DD39B60280355B SOILLESS
80,281,666 *088C901788D3A32B3643D4E90B78688522EB88FD sootssoots
80,281,667 *088B5735DB64FFE9F859DB36A88AE0BD3136D031 RVALBHANI
80,281,668 *088D255DA12B8715493B773172CE68AE2EDAD35D RWDQ
80,281,669 *088A620A938678C9FE2C78F04F6B51BE55EDD290 RYAN DONAIRE
80,281,670 *0883AD9876CFB21ECC0D74DB9E9B795139D9CF77 SPEAKNOTHING
80,281,671 *088EC14DB295E06C422C946A55F87197A1DEC530 splat!!0~q######q
80,281,672 *08878DE443DCC1E655276A4C0F46BEDB13B0DD3C DAVECRACCHIOLO
80,281,673 *088CF9D6752F1899B07F281399BF87464600A45A Splat ~ `d######P
80,281,674 *088C0182B2CE5705C60F75F1463EDE2B3F2CADF7 dd3f
80,281,675 *08818074B460C5FE062E5BA8FE3C6C7B8BCF3E0A Ddc4
80,281,676 *088F96976B2BE3EB587FDD548DD800CB3BC2C380 SAMORAOFORI
80,281,677 *0884E84AB517F4694822A8891EEB758E72A17777 STAGALBUMCOVER
80,281,678 *0887D585DBD399449B188E3F4426CEC29F119B73 deanna.benjamin
80,281,679 *088F1B80C945D34E12822799D17281501CE6CDA3 STE4M-B1O
80,281,680 *0880EF77BEF2395280BDC2EBE39EE776D2731202 STEDRODNYF
80,281,681 *088FB3085EEE2CC2FD066E4A2E407BC83B7FCD08 STEMNEMTET
80,281,682 *08893037B72FE351F9DB7F1B6868962193A1FE74 deh7g
80,281,683 *08873373DDF06B117877ADB45D4206888D55A0B0 stoletim3
80,281,684 *088DC1E3DBE3D51B008FEC931C7D4D7D21DB5863 scottyphilbin
80,281,685 *088DE1AC80E5BE935F93E34350CC6E9758EDD32D DEPU+1ES
80,281,686 *0880FC9A9472BE98FE64AD1741C1BEEE7AE78464 sealevelcoloradoed
80,281,687 *0889FF0206A6C093FD9124DAA3F64CFAC80B998E desbaratabaile
80,281,688 *0884AA40677DE3114C069D89E2A508E081F998FF DESIRERECORDS.BLOGSPOT.COMDESIRERECORDS
80,281,689 *0881374A67F377019923138345A3D40CEA257BE8 DESMONDTORTI
80,281,690 *0884EA8D026193D50176581839AD2D61A5909970 despotadodeserbia
80,281,691 *0889D98701FF6EA72B14273B359803314FEA59D8 subalférez
80,281,692 *0886A858DA23079B42DCA057D852FFA4801DA6D9 SEITEN105115
80,281,693 *08869127B822F5BA2D5710888882D41D1555FF9E SEMPLICIBSW7
80,281,694 *08812155775BC823B7DA0A611333994BBF567BED SENETIRB4
80,281,695 *088C696924679BA44F7D19B14DEB9DFA1591D619 [email protected]
80,281,696 *08861672F818D5D2035ED8E0CDE5A03AEDF30CB3 “SERENA”
80,281,697 *08878C4EF1BE9A7F326606E4A3C68815A5FBBEAE SETTIRCEZ
80,281,698 *088A405A9AC56EFFC7674FB6C431AC7E57314937 supriyatrivedi
80,281,699 *0888EE2F05FAFBF96884E0EA6176DC92A03AE7DE DGS
80,281,700 *088AD3DB695509D5752D84CACA51C70FFF1D23AE SHARA.ELLIOTT
80,281,701 *0884662329FC65339436B117FE51A59A47449C0A SHARNABENJAMIN
80,281,702 *088F70EFFB6F98298DAA79635C3CE36080613684 などのクロスオーバーSUV車の登場に影響を及ぼしたクルマである。
80,281,703 *08883A7DDCFD5C521AF43CC2FEDF5CB84DC75DDE sweet stay awhile
80,281,704 *088C8CCACAF12890A9322F965ABABAB857BADBAA [email protected]
80,281,705 *0880F8A2410FBC7F59DB74BDCBD5DF5B30732254 SHERWOOD.SERVANTEZ
80,281,706 *088D0792E7DB40CCABC5EB0DCB1A8E3AEC70A560 syenodioryt
80,281,707 *088B33DA1A253ADF36B6BB6DBAFBB963783CB4E8 SHONTIERRAM
80,281,708 *08893F50EE78F93D5E477006846C7316C5E24875 SHREENI2
80,281,709 *088062D658A0007FE95E63645902C0248AFB64FF [email protected]
80,281,710 *088EE94DA79CBCA7836AA62A11E8D7B3941B2B41 [email protected]
80,281,711 *088FD299496B4E9E7F61E50C36698645E36A3A5B silwana
80,281,712 *088EB52A571A78FFFDA361A723F22F9E6CA50BAB [email protected]
80,281,713 *088B03E1B1CB6511C981C2882BB29AC512D1D413 DIX-Q
80,281,714 *0887B6BCFAB27F06B190A440B6D153E99DD0380B djtze
80,281,715 *08852BF44F1FDCF41EAFCD1EE47864BEBD20FE32 DK"$)
80,281,716 *088F67B14BB02F1A1264AB4769D0DE1B29ACC08B skyler-blakley
80,281,717 *088173666354E9E5C40EDC40E82C126A287B6708 SLASHGEARD
80,281,718 *0889D422C5E12816EAC772D8BC6AA148904EF11F [email protected]
80,281,719 *08891090D1ABB6A42CBDF4729E8DEBA8EDAF111B DMGRV
80,281,720 *0883A737B03948D1367BF95E8D7456A1EC50F6E6 [email protected]
80,281,721 *088728F8CE53A13EB000CB5CCAA4BB18A2F04CC9 TANZEELA-KHALID
80,281,722 *0884138BBF25CE7F0A28B106038CC6352435D54E tapadizo1
80,281,723 *0882F53948A00AE8D157D74FA11D81A629562867 D/N!
80,281,724 *088862C31ABDBECD230BAF0319A85312E6BD9935 dnzai
80,281,725 *088E5E903C3FEC588325E8375D29D4E9AE86E91F DO2II
80,281,726 *088CB3F6D1100A2469D4BE6D4F3E70DCEA8C2FE1 SOILLESS
80,281,727 *08894AF108465AF51EFC901312B71FE7F28A62A7 DOGGIERUTH
80,281,728 *088E6FC7770D051FE48B66C7AB151055218E453C [email protected]
80,281,729 *0885D2B17389199162A79B02DC884056838649FA TERRENCELIBERATORE
80,281,730 *0888299550E468BE98FCA99CCFDB90EE0740FE47 SONHOUSES
80,281,731 *08890CD67541963AA742571C72737DA52AF3F97C soulfood.pres..waterfall
80,281,732 *088E3CD13324B841C3500290F946AC60A64ED22E DONNELLCOPSTEAD
80,281,733 *08824BFDA1ED2A90C3EA79260AB68A9DCBE4468F TH3ANTHROP1SM
80,281,734 *08863C5B6C3A28E4F646F2B8A6E34BB0756B5C70 SPARROWS47
80,281,735 *088339A409865923E6135A66BCFDE342199477AE SPECULACIONS
80,281,736 *0886B67F26290CA8D0ECFBC2454F8EE349ACE392 doug-holl
80,281,737 *088AEA44CB1C960230C606BF6B5A530ACACF48E5 SPLAT * * DQ
80,281,738 *08816CF27B79045AC526E99449B476FD95041861 THEINSANE0
80,281,739 *08894E629F11C84E0F9C72871030B000D7A67E5F SREGNILSKEV
80,281,740 *0884F465F2FA30D9D574D07DBCE634EBF40306ED STADSPARKENS9
80,281,741 *0889CB4F602D7C4F304E31F7A4D43704B0B89647 THEODORE.FRAIZER
80,281,742 *08852B55E99411297829FF1FF1B2D92CDFD570C2 STAN.KALER
80,281,743 *0881987FDEFBC3FCF712BA4BF8389747969DDFE2 D#/TM
80,281,744 *088B020D2C6CEA44FEFF0818E01D36FC20C81DB9 the-single-level-channels-are-directly-connected-to-c2-hosts
80,281,745 *0882C3AE4EBE857B7E1B6B162C9E6357AEEFC3A7 stefanm
80,281,746 *088C77459A7C08BA78A0841A251758F6191761A9 thomasmarusiak
80,281,747 *0889885B43B09E9F5BDB5E306A64CD516636E791 DW"2-
80,281,748 *08885D12D06CC29B57568C6CB0FEBFDC9FCF3929 THYROTHER4PY
80,281,749 *08818C01E33456BDEC96050FD07960BF51F1ADF4 [email protected]
80,281,750 *088A0E7047B95ADF4AE37DF50F4AF8840CA308E2 [email protected]
80,281,751 *0884857F57729E7555633A9DFB8321746711787A DYSW!
80,281,752 *08820922427028F65FF336E2E24437E78F3B9F66 dzn#
80,281,753 *08821728F06AC43E4E1ED18EEAC5ABBA19A733C5 SUBTLE-BODY
80,281,754 *088D7B0B29E3839B18EAB1952D41984CD4364D01 earnestollison
80,281,755 *0889EFE8D8B0C5ECECCEAE012C6E1452ED7DA1DB TIMOTHY.RUSBOLDT
80,281,756 *08861916C20DDB6E6D36A7CB5F2833817E3EA21A TLAPR
80,281,757 *0886721A6156FFB89A8F64B3AA3BC2308595D3EC toby1919
80,281,758 *088D931D1E093D96497AEB22ACFF850A5DA40636 TOLOSATIUMQUE1234
80,281,759 *0886E20D158FC05A967F9B41588D312F40FE2CF9 TOMAS.CARLOW
80,281,760 *088A1C40A96CEC551F9E87C050E8E218E9260F54 SUPVERVISORS
80,281,761 *0886D0F5CAFAAD99F34A839E015D8306E116BB9F sviamo
80,281,762 *08866BAFA1CA3793D0E001E3D5F19F556DEC8D84 edwardotroost
80,281,763 *088C90D335D1AFAD770D36CDFB5CB68F80A19E5D TOTALRANKED
80,281,764 *08829BDB8AE257A09D90AE970047BBB18FC62FE7 SY8XEY
80,281,765 *088CA853DC61E5F14F2F33E20FD48826828FB68E eetnahut7
80,281,766 *08852D52BDEE35807AFDAF4F4DC8882E4BB8DEA4 efe92
80,281,767 *088290943729F364EEFFC5D8F0A3C0B6E6E1BB2B [email protected]
80,281,768 *0882137CD8D894D9D89206C02E35057339A2BEF5 S[ZN
80,281,769 *088E5C7C978AB8E21C38B1E7D9F2E0DF380E7150 EH2F
80,281,770 *088E9929710C33ECB81D392735AA094FDC960050 EI`
80,281,771 *08831E1B3A99C3ECDCC412936B03CF876849A929 EK7UT
80,281,772 *088D0E034A810E68777B1E6C055F4C1460681149 trinaboo34
80,281,773 *088DA4D103EE2BFC6EFC11E60CA9D89757AC2E8A TALK84657643
80,281,774 *08816D51EF5EC50E057315EF6CB6E34E24F52A5B TALKKSBT
80,281,775 *088B5406EA9D734844BBF3B76D794928D1E147A3 truebloodnatashaalamcast
80,281,776 *08811F9B2DA1C9589C2AB49B0B0828029D106837 TAQUETE8
80,281,777 *08838CF634E1601CF491953EEC037507D47B7E78 TTLD
80,281,778 *08837935F99AC56217BBCBCA0352DE4DE50743D9 tdbaa
80,281,779 *0887DFFC8BC2B04DB0BE6169F1AB01CBD7C1FF08 tyreecarden
80,281,780 *0882552030EE1CE57DCD6D8AB5F99E6F7BD68C20 ELTON.ESTES
80,281,781 *088D7D932C4D61AA4A0BC324891CDDBAD9CD1A28 elve
80,281,782 *088EC8C52A29CAD1CA79E6E4AE87092CFA9B5168 TYSON KEITH ESTELLE
80,281,783 *0886CEA88487C6C669FB4B527DE34F08954A9043 TENNUVNE3
80,281,784 *0885931FDDDCCD9B1445CB625A016E7B6860A063 tytanishia-robinson
80,281,785 *08807C00D3EB511ACD9757CA14158D682D253B1C TYUUSINSED
80,281,786 *0880D31833B559DD485AA3E62ADDED5EC1248E1F U1IK
80,281,787 *0889457269AE10BE344ADCBB8216C3BDB965FE8D [email protected]
80,281,788 *088629AE88876BB8DD34682FE349D2FA993FAC6D embrew
80,281,789 *088DCD7AB002C84CD2F00C63D6B7DB72D0BC73F4 ubysseying
80,281,790 *0880DD84DE5B3C528E6BDC767FCF2F54BE51B4A3 ENTERTHEHALLS
80,281,791 *0880878B755622AA95FF599340CC553E79A77036 UNCLEAR2NUCLEAR.COMWWW
80,281,792 *088847527051D23F48077DB06EE2FCDC2FAF8DE9 unctorian2
80,281,793 *08842FA22DF4E798CD61173EEBEE17337C4C54D2 EPSONDELLDELL
80,281,794 *088EB7D448748A85ED82DD3C9B370E54FCA78994 ERICKMERRITTS
80,281,795 *0888006080347BA4D031B8F1FAB3CC79122A2139 ERICK.ROBACK
80,281,796 *088A058C593979A8FE16903EA9132232033494A4 UNSEJVSOMAS
80,281,797 *08861869325C94AD032ED299CA13701535A7BD99 THEOWOLFSON
80,281,798 *0881885944A24C021CB130070F701AECF0258CAD un vecchio appena nato
80,281,799 *0888EDCC329D492453DF6487A8933EB8F288D9BA [email protected]
80,281,800 *088BA6881676FE4C91CE274E9821AF71ADE4D208 THERUNNER1994
80,281,801 *088D17DBE3D054C458CFCDAFA8F3572CC76B0F1E THES.W.A.T.TEAMOFLOVE
80,281,802 *088D7B4A4A9786D616B47A400011FF866B8FC85E USERFURSCOLLIS
80,281,803 *088FFC433BBBD040746631E570B6E9BCA767043D theymaketheirwaytotheentrancetorazorandblade's
80,281,804 *088CBEAC019A24CB66F9EB1F1F35ADAD2EB02E40 [email protected]
80,281,805 *088C5B8EBBD90BD5F3218B4A88F522DE616792D9 thump,.cry
80,281,806 *088A3668446EA0B9C486D6D28650A147A1C60FEA [email protected]
80,281,807 *0882E713EE9888E9591CBA6B1FD2BDA0D5D45D61 TIMESTAMPTZ
80,281,808 *088D49BD73FC054B9A056DA13D3BA684D26982A2 timreck2
80,281,809 *088DEF9B1CC7EFD6B24B5940D284E2EDC98E1882 EVERETTEPATAK
80,281,810 *0881E2A73A352C966BBA716FA04FA03A46CA1CE0 EVERETTMAGGART
80,281,811 *0880110E6AABEC4A9319E34920A93DCEEF27BDBA TISITIVI
80,281,812 *0883DB0A07174B55ABAD77392FC4C2DBAC7F6578 vampirepebbles
80,281,813 *0883ACF4789DA0405E565B8318F2F1FD565C182D VANCESTRAUGHTER
80,281,814 *088FD683F01D7F3401935C67994B1C42DCF6CAC1 EX+7ENSIME+7ER
80,281,815 *0885D3DA60F2B200476F2471A399B9475E9EFD5D EZEKIELALBERDING
80,281,816 *088E44070467C7E80C4E5C5C36641A6C4572CE29 ezlohuab7
80,281,817 *088C41196EA3D0E5DEB027E551917C6C7CCCE255 vederboe5
80,281,818 *088CBAF912104701F1703AFD5EEAB801AB063210 [email protected]
80,281,819 *088AEAC4A86F85F428B7916CD66C554209FDDE5E FANJULBSW
80,281,820 *08854EF2B25C912FBE681BB5C0DBF56C884703B0 total-summer
80,281,821 *0884CD9AADC0626F9C8BB3A27A8A387CAD8B4410 TRACEY.SIDA
80,281,822 *0888328C5DCC9106EE5CDD6E3C0E12811E45D8B8 FEINDFYRE
80,281,823 *088897DAC5756945D5DA4B64227BC965A18F9BE8 FELIPE.OUTWATER
80,281,824 *0889A0EA9E2FCB67D7EE0EB1DA5679E3C37BBEA3 ferdinandglock
80,281,825 *08817F0623C31AD0286BBB8A0CE3AE2C8C0B9456 ffd03fb449c93459651362dcbe8a7af0bronyaur
80,281,826 *088EC2C29E032ED192B25310AFE382942C713536 VICTOR MDS
80,281,827 *088F81934495BB33450134C106B505151A7F0D45 [email protected]
80,281,828 *088A922DF2285DC079715A2FF461073FDC2AE0CE [email protected]
80,281,829 *0884508A44CA79D9251EC93664698EB949068FC4 FILIBERTODYNES
80,281,830 *088BF302F85ED9AF7E3F7288D0185E1265AAD577 VINCENT.IDEUE
80,281,831 *088120F300106CDA3C10741E8EB7F6642BE8D14E VINCENZO.AUN
80,281,832 *08856F46171DA180DAEF202A86ACF008815C46D0 VINCE.TURELLO
80,281,833 *088B6DBD796C106E6B96D547F3043018A25A56E5 VINYASA9
80,281,834 *0889E41DE3AB03B7CD65B18CAC8D70660B185AEF TRIBUTE.TO.SUFFER
80,281,835 *088B211128DC052001197CA0BA16F458206DFA9C tricia-holguin
80,281,836 *088AF50654615F0E9311F5EE457CA005685BB419 TRICIAMILLERHOTTENSTEIN
80,281,837 *08871711F6C82282F707F913B13D694FFE9ED568 VONGAINYAHUNZVI
80,281,838 *088C6B3E701331B3F8C953D4AEDA0F9AD29F434A tudor.cernea
80,281,839 *08849CE64FA0CD5AF60C15E87D30D87F2E951A94 VULSCEPEN
80,281,840 *0881BAB6827B7D7DEA1D080FFECE4EF61EFA0DCA VU|U
80,281,841 *088C474751ABBEEE6A0E09A492E2255D7AF67973 FRANKLEWANDOWSKI
80,281,842 *0889273A13E19C03D54224440A73E933E79D5E79 Freedom-(Barrucco's-mix)
80,281,843 *0887898B4A54BD2A852E095425D8B779C7FF66AE TWO ELEGIAC PIECES, OP 34: NO 2 LAST SPRING
80,281,844 *088F8DC44A69F49352BACBA540B119ADECABE781 TYLERDAISY9
80,281,845 *088274EFFF8808BDC87CD4B1185C48C4E658B69D FSAHALESSY
80,281,846 *088F8B26EB6C642A09AC6F379E9CBAB1524E28A9 WANIDA.KREERAM
80,281,847 *08858EC4230C67212B79BBFDEF621C71C56C4ACD TYRONE.KREBEL
80,281,848 *0881402BAD0D08E66AEBD69D9D27B42E78EDEBC0 TYUUSINSED
80,281,849 *088683D1A8D29721040EBAEEEE9DA7AC4B7EF897 wasley
80,281,850 *088525F1E1BD4E073C88E635C0C3D8185B987B1B weemoedsed
80,281,851 *0880DCB7939108A2FC90F7DA3DFAD9585F5B3855 weigerst1
80,281,852 *08831C0D3D6E05F4CA10D9DBC9B52EC1DDD84B89 G0LF GR33
80,281,853 *088FA16D7A0912BFA8A270AD897BE7510280F143 WENDELL.TRESS
80,281,854 *08884BB911C0515E656E3B172D831CF7B05B66BE [email protected]
80,281,855 *0886DF1D0C6AC2F3CC69BCF7C0D41F5DBEF3A10D WENGINH
80,281,856 *088D956A216C3FBF99AA164C5E28212BB684C08F gabriellaster
80,281,857 *088052319F8C8DF882122B54997253B4D3E6CA10 GABRIELSATAR
80,281,858 *0883AD4056CFBB10B509CC0A60190C6AB730BDF2 [email protected]
80,281,859 *08891A8EC7E2B6EAB52656F642D8DB9DA94CC6B5 [email protected]
80,281,860 *088C6FBC8050C624AF1B94137001BBB518285E4A GAIVETE2
80,281,861 *08846012272700818BA13C7C3415AD3AC16D772B WESLEYGILLEN
80,281,862 *088E714AECEBF1B0299746238E8A2A4695C19507 GALE.RIVORD
80,281,863 *088B20F49C970E43A5D29D74C35FCBB36DE96D9A [email protected]
80,281,864 *08820612214C0295C276D5A3F0012175DF0EF66A WEYWEYJENN
80,281,865 *088921E2BC24C62668E0FCAB65BF2C803DAF64C6 [email protected]
80,281,866 *088386814AF10B24B2930528EED1A7FAA1FAE154 GARRET.MESHYOCK
80,281,867 *088DC1479D51CAC3DDFD196B7F90C6F586BC7C04 uits
80,281,868 *088D38E8C3CE5075EAF9E5A93D4D6451E7A08D62 WHAZN159
80,281,869 *088A97BCD88192C816859F6A9243C06C86D0A8A5 ULYSSES.KAPERONIS
80,281,870 *088291FBB17C25182245868116677F5395F7B4BA WIKKI.WAQAR
80,281,871 *088CDC6C373FDCB5AC9D895E1EF55D4150D43DD9 UN7!D!NE$$
80,281,872 *088A3AF87BCA6FC01D209DAD64C194EC7884C815 WILBURNPOSTLETHWAIT
80,281,873 *088CCABDFFA850BB852829E77DB75B90025E1BE4 WILEY.RACHI
80,281,874 *0885D56426D587995BDB875E95FB1AEEDA02D838 gavyn852
80,281,875 *088C108DD921BEB45593659561732D2B85B72147 UNGDOMLIGNESSING
80,281,876 *088BBA1A1260FF384C4B89BD81AC0F1CA39B63BF willianmeuller
80,281,877 *0888CB2D2A54BDA5A72C957504032F8A3B00DE36 GEMOVEERD2
80,281,878 *0884C1B849BA5463E69CD3BF897DEEB28DC0FD4D \OpNw
80,281,879 *088DC9085D4CB05376CD57068FE414782AE70730
80,281,880 *088E9A32DF443850DEE7B20EC63E51A9C88DDB11 
80,281,881 *088C390F781602E221A2BC7A7D3B5E0D47203C93
80,281,882 *0883DB93C6C4353A7512089D708413D240358C21 UNSEGMENTIERTE
80,281,883 *08873ECE271F624414B62939DD28AA7E18BC963C [email protected]
80,281,884 *088A17CE5DDF12CE6D0667DD71C8C12379F2827C USAINTZEAN
80,281,885 *08851FB9C3E897285B09958E3E25C6DC47B53CAC user641714125
80,281,886 *0888181A11CDC706EB51B597A7461CE1EB4692DB /USR/SRC/LINUXHEADERS2.6.3224/ARCH/SH/INCLUDE/MACHSE/MACH/SE7724.H
80,281,887 *088FD1BFDC36672A97AA62F2FAB69C82A333C865 gilbarco0
80,281,888 *08850507B787002AB4BA842980A93DB92C23CAED 00000000KILLME
80,281,889 *088C51983F061CE2B6583FB9D62ED0E8D4BAEB64 [email protected]
80,281,890 *088E039BDDD360786EFD5361F731903863CF2FC6 VAC1LLA+0R5
80,281,891 *088B591C40F5B5E64AD7ADDB65E20D467603B651 valentintimar
80,281,892 *0882086A230A4F28B9CC70E3CA3404A4606A128E VALERI
80,281,893 *088F3B4626F428C242F3B6B19C59FC0C0829C22B VARUN.MAXIMUS
80,281,894 *08815DF1C19FEFAC15EBD0D3822CB36816E33903 goeun-kim
80,281,895 *0888951AB69EA17E42C9D196DFAF4C83CC3C6794 VAUXHALLBRIDGE
80,281,896 *0887E56E192D8D19782BE253DD53EF3129B9693F VERTICILLIACEOUS8
80,281,897 *0889C5418AF23861879A977328BE20F71831DA1E GUADALUPEKONAKOWITZ
80,281,898 *08801212F728CAAE401806AD1BF08448F58EA3AF )0(O~qp
80,281,899 *088E153F4993C786AD11D20F1A4FC79C98565532 victor.zalakos
80,281,900 *08890AE7129E6ACB2150BC51001342DE03058558 [email protected]
80,281,901 *08896F0F2154B7FFFABD3384C17591ABBB6E5524 1161744 ELIN
80,281,902 *088051C5145D60BC3FCCB1EC59CD432E9F408C05 GUTTINGV5
80,281,903 *08852CA7313E798B9262AF687FB6FA1F22536934 vincenzodutchess
80,281,904 *0884727A26A0938A6451581D945EF318AA541C9B 12.23.1595
80,281,905 *08805EBF206A2B8B33CFB05C45D907C1840BA90E h351tat1on5
80,281,906 *0886293CCC4BD7064A090FE825B7F37CA1E2A0AE 1553011 KATI-ILMANEN-ITSE-ON-ASUNUT-KIRISM
80,281,907 *08812DC63D1225A06A7C3DA4A8733879AC9F6593 VITRIFIS7
80,281,908 *088CD2D18B4B31636997F51D8F37923C84B6667C VK'J
80,281,909 *0889F84E3A9CC0E4EF25609CE0338773C12BFCAE [email protected]
80,281,910 *088244480359CE09D14B2B54A56E20C5AA738217 HANDMADED3
80,281,911 *08835B80AA704CE5EE408EE964D8B4AF19303012 16101393
80,281,912 *08835896801E1DD8F303B169340F2ED3FEDD9ACB 165jaime
80,281,913 *088AB8771AEBEE924787F2EAA6C5282FC73EB86C harrybruin
80,281,914 *088BFA97AE28152F8294A7B1A8BAA8EBBDB70FAD VONJEFFZEL
80,281,915 *088BBA9F2EE965000B7B7DEBBE675800AD773229 VOTE4ANGEL.COM
80,281,916 *0881067FB70CEF94541474D4914FCDDCBBC81604 votiefkerken
80,281,917 *08825DE786532C77F44E0C70F9264909396E968A 195 AUSZUDRUECKEN
80,281,918 *088F08FCC9A32707C2574343CF32CCD1E9D41578 HEATHDUCKHORN
80,281,919 *088C8AFC537052AC583199A27EF2E793D5D4537C HEATHERMCCOOK
80,281,920 *0883E7F2A2F737AC4A501150D38E9810C29030FA HEBA.ALA
80,281,921 *0887B24AA8F62BDFC9DF8EF0B0049DF65D1DFFDF WANDA-X
80,281,922 *0881A3408E5C227725AD8B1EDFA05ABA5A160930 henrijetą
80,281,923 *088FD56F95CF21B9B5F06073FF84B39FC48E0A37 HERBROSSO
80,281,924 *0888FEC5C9970C7933009F621165F1649F652D6B 1BRANDEIS
80,281,925 *0881DC4391464BCCCE99E61837D29CD888130C66 wazeer.shah
80,281,926 *088D580C46BDAEF634BB486D5DAEDF4EC439AEAC HIPOLITO.BANKOWSKI
80,281,927 *088EFF1A4B66CBF134D33A2ABFB776DD72B18D53 [email protected]
80,281,928 *08802B18569BCB33768D9B5FFD865E47587F0DA3 WE,BUANA
80,281,929 *088066674CFB6AFC74C7B7DA0732A6642DD11B54 1-GOETHE-KASTANIEN
80,281,930 *088A8596AFB1F4FE19C15FDD7EFC5BBD3D3A50A0 [email protected]
80,281,931 *0883E0479CC10364B72FED787EDE3961A5E34198 [email protected]
80,281,932 *08830E5AC69620F3804B480053A1320F8BC40783 1ILUVEDITH7
80,281,933 *0881EA4250842046259E582CC332B4283A9A3743 [email protected]
80,281,934 *08887D27AF5FAA7050875B42AEE70F3714474EC0 WERKSTATTEBENE
80,281,935 *088B7BB52ED9AEBA0ABD8BF71487ECE52AB528EB HOTELTJE2
80,281,936 *088759525982042714CCE3E7821EC43F0335C5F5 1NIDZAM12
80,281,937 *088C49140BE4C09BA7CB640447F178497297E113 WIDENED
80,281,938 *088611DC18D423C3638B7E6239171F4F42376580 wiki-life
80,281,939 *0881016358B0846D5659A56FE2559750CE69053A WILBER.KOTTER
80,281,940 *088D01569B13D7A0F63650DEDB81DED824B65A7B HUCKLEB0
80,281,941 *088EAFE65DDB393CD78E39983469BD3AB1668761 wileystefano
80,281,942 *0889DA659CD5368215C2A50AC09D1EBE9D888D6D hunnybunny1970
80,281,943 *0888945F1C40D86BB86248FD2D0615D4142E8AC2 1 SITUATIONSSKIZZEN
80,281,944 *088095FE74A18DCA3FF31F6B8CDEF5FFF617ECAD 1.SITUATIONSSKIZZEN
80,281,945 *088F823B1C9C4D1D98C7F537BA2F9821D66B0818 1SNEEUWWITTE
80,281,946 *088CA4CD6CDB6EDE3EA46632D7276942B3D3C85D 1sofregit
80,281,947 *088C34FF819168045E6E445C4B016437AFE814B3 williamsreilly
80,281,948 *08809C8B2CFFAB91E27CD02B8F64DB44D59FD454 1-sprenstoff
80,281,949 *088172C2B79432BDB1AB4D2B0E0EA0AF02056B9B [email protected]
80,281,950 *0881E47DF1580677F329EDEC4C18439535D8C07B 1stpriority(tvsizeversion)
80,281,951 *0889AF2B2DD496BCCECE3E0C074D4B7129A51A40 HYMENIFEROUS6
80,281,952 *08844338D4EBD4EEBD2A13FF713F6F3C59616FB1 hyperphysicses
80,281,953 *088C22C3D025468BD469A7D94E408BBE9F03FD89 1-wcoast
80,281,954 *088544D8B19677B821ABDD44F3E8580AC998FCC8 iamjakey21
80,281,955 *0888AA7551CCE2A3BBA813C102046FCEC815B8F2 [email protected]
80,281,956 *088DFFC10D1157AB089CA198E92189E6DB9477A1 idajm18
80,281,957 *08820F6EC0FFA448787DC080674605F7D73C65B8 WNPOC-SUDAN
80,281,958 *088E556B5081F59DBBD1B8C8B676528E69BE7CA8 [email protected]
80,281,959 *088D724CDDD640DC1F05B67B39374A7D9CC0618D [email protected]
80,281,960 *0887A1A9B35027180F4829866DAE05555813DEF6 IF AMPLIFIER
80,281,961 *08808061A06678C09A5A40018F09125A8AA1A202 WWW.IDBSYS.COM
80,281,962 *0881FBF14075457E7B8CA7242B77F281B9AEC4EB WWWWEAVE-WOMENORG
80,281,963 *088B06840A1A72AAC9D745DB402D38766ECB2A2F illes dins un riu
80,281,964 *08824FB9A6A7CBCDC071838CF00C38225436B9F7 2387951 huumetestien.j
80,281,965 *088AA794609871F0771C3A5F57899300540F7437 [email protected]
80,281,966 *088AC01D833EF5D412E2A8BD58D1137FBF8670E3 2534851 KUNNALLISISSA.LASTENSUOJELULAITOKSISSA.SEK
80,281,967 *0888FF44F4F44B43321232A8AB0D3C19F1835DD7 [email protected]
80,281,968 *088B91EE650883EA779BBE6295402C7B38B4B5F7 IMAGELOCKS
80,281,969 *088EE1E1006173965E74D7291874D07C5BA4ACE2 imageoh237.svg
80,281,970 *088F89F6C34ADF9AA09C4C14F56DC15E200CDDF8 IMBASED?
80,281,971 *088B2A0CE401FC3FFAEABE9F8E097E2C0099D84E IMPATIENTERAISES
80,281,972 *0885EBAAD432DBB07253E192147A3F8C1F6EF33A yahayamohammedbaba
80,281,973 *0886A32AA3E6B46C4B23EE1017BC4DE5ABACBE74 INDONESIAN.INTERLUDE.(FEAT..JEMENI)
80,281,974 *088B9C679AC2482C4BA916B9A41A5EA85114E194 [email protected]
80,281,975 *088CE4659F8852197EDC7C74298CB0EE77A98826 YANGQINKOU
80,281,976 *088D02F8C998C6C250A4C5CD218FEA1F26F0D103 2774982 rakennus-.ja.kiinteist
80,281,977 *0887931848A5EC74C90315250F546DDD1A2236FA INFINITANT
80,281,978 *0889E6D01CDD2E827A9747E5FE25E4D7E24BB030 28-KARSINASSA
80,281,979 *088D140AD7DB85D37CAF43DE7442257691310759 I:NG
80,281,980 *0889469F015AE6A26F0FA220E4B1ADF9A540C381 IN%U
80,281,981 *08841D3C4CC9AA8443C26B20FE67B1DED269ECE3 YLELLISILLÄ
80,281,982 *088A74370EAECF35651A51EEFC991F93839C2400 2 KATTOHAIKAROITA
80,281,983 *0883D79FD36FDF888DF0B5013D3292652AD479F2 2koyo
80,281,984 *0880CB0EF01FEC29FD0DB72E2A7DE49AACEE1FFB YONGGRAGEDA
80,281,985 *0887874708F1A050618121F6357E245188CAF7BF IRETSIOR3
80,281,986 *088FA1A7BD8AEC4E12DFF6D27A8CF0472F83B456 yoonjah.choi
80,281,987 *08888128474260AF779B1FFD8BB6D499603AC5C1 2NEENYTS
80,281,988 *088768EB8D0BBF9A2F90871CAC36A4A9CB1DD23F 2 PRO-STREET
80,281,989 *0883E89C94B22BA45DD53D01F3BE3079F596AAFC ishwindering
80,281,990 *088A8805152F290A67B103DDC1086ACD2E353131 ISSERNE7
80,281,991 *088ACC852739D70D88B40139F4054860CD1CA7A8 ysporcam5
80,281,992 *08850B4EAB13EC07815864513AE8D587222AE054 i've.got.the.music.in.me.(i.p..mix)
80,281,993 *088BDB15081681D72A36CEA52F9542C36202B0E3 338.backyard
80,281,994 *088ABA5D690F85EEC577C40557BE6815F02F19D1 YULISNAININGRUM
80,281,995 *088811BC676E13F92D55ED4C274EA6D6CDBD8FB0 YUMORAS6
80,281,996 *088DE49CD41A66879FA0A44098240F236F585BF1 YUPINAUWISETWONG
80,281,997 *088EB362443F703E4C29F373F61EAD923FE370D6 Z01774561258
80,281,998 *0882509A59E35846CF8E338E83C1610B0F2D104E 3####b.~.~.(>-<)
80,281,999 *088E2C08FB2A805CAE6C8ACE809CA59AE9656025 jacksonwarring
80,282,000 *0882469C7BB87F2596DE96F705FF1DB5ABB46C7A ZACHARYAPPLER
80,282,001 *0888C351E86B44D53B0A5DBE8F2A52DE8FFA0B98 3####D-`-SPLAT
80,282,002 *08803778406DF57D4A9997BBCDC583C669A8CE3C ZAK.BERGMAN
80,282,003 *0887280630E47AF59979B6C6297C2F0F326AC138 ZAMRIMUO
80,282,004 *088BB3B7950F39B36D387E51A3C9975E26134BF4 ZANEDUENKE
80,282,005 *08875F6DB8022CAAE0CC0DD0847CBF151CC42289 3 HARJOITUSVAIHEESSA
80,282,006 *0888B965D737BF856B7F13962A70C0AFA6170799 ZARINE-ZAZ
80,282,007 *08811854EBEC3C7BAC9DA9E5DFE95326D7E8308D zatajovan
80,282,008 *088592A0BE6FD4971C3F73BDF3FCAFD8A4DD8AA4 3ILUVKKKKKK1
80,282,009 *0883C421FBBD8E1E7C3FB75D5BE66DF52CDAF8EF [email protected]
80,282,010 *088EB7FF7A0258730C49E05333B8BFAAC4E6AF36 [email protected]
80,282,011 *088B38EE67FCB604C89D44CE7BDA37B757E0F717 [email protected]
80,282,012 *088E84FA43FB57D3DDBA3BEFC0747CBE0D2089C6 JAVIERKIRBY
80,282,013 *088314957782F0129E2C9FB5338A9FF4C153C4B5 3=====P.~0.~O><
80,282,014 *08864637823F412FFE5A95D6C5EC71DD1E8486F6 3 QUARANTAENE-STATIONEN
80,282,015 *088FEA951F9EA9097FF6878E184156EF27016BA1 JEANGAIN
80,282,016 *088DE51045A173468576570B80AB9D0B161BF1BA 3VELUTVIK
80,282,017 *08867617C520FDC88DF0364DD36D3062456DF9BD ZOMBIE.SHOPPING
80,282,018 *088ED48F2C17C992F3B2E786696113AF65806801 40TEMASORIGINALES(DISC1)
80,282,019 *08839BBFC5C949DD1D87614DB1BBB589A88F96EE [email protected]
80,282,020 *088D13712FA0D9A6D062CBE524931A270F7051A0 ΒΡΥΞΈΛΛΗ
80,282,021 *088B1B2718E9FE692DF34DD2CCA5FEE90AD4F99D 4EXKLUDER
80,282,022 *088C79668E74076FD859442907FCD4D478EA53C5 БЛАЖИЈА
80,282,023 *088D76307236C1A0AE92ECD137278EA643B3AD90 4FREDDI
80,282,024 *0884D2F5CAA1D2D5E2853AFE6477447125DF1559 4FUNETTE
80,282,025 *088706873983B695C6B2CBA918564FD97DB48F4E БРЭБИНОМ
80,282,026 *088593AA89D3EEBA441B61B3B5662A68EDCB55F1 4-HYYTEL
80,282,027 *0888C53BABFD4D6E631ADC408D5F2F12CD248A1E 4IAMJESSE2
80,282,028 *0882C0BA244ACE96A5AB26C7F915B4F58085C54C jewelldardagnac
80,282,029 *0884DA41DBAB4B3FD43D257C67BE1E699765B133 JEWELL.ESTAIN
80,282,030 *08824AB57E5241CCE231458B6875CF6A9FE894D5 4REDERIVATION
80,282,031 *088E8AB1C14A1C95AD212883244121F902626B90 ЛЮДНОЮ
80,282,032 *088F553DBA273E6AC97053157D953591C9A9F417 4SORPLYS
80,282,033 *0881570C3E5BB3DA4C6B8201004888317EEF382B 4SURFERYODA
80,282,034 *0885D7637260720EDD55342029631EFB3B606E74 4TOBYQWASZX
80,282,035 *0883F74DA73283E6D0269F31ABAEC089059D2590 [email protected]
80,282,036 *08818F708A2C6499A3A3919F5A42EBFDF3220FA7 нерчи
80,282,037 *0883E7C46C2DB1290FFA67BD40BEBB0E49099C31 РАЗПОРИХА
80,282,038 *088A3A8B2D1E87723162F7EE80E2047244BEC7B3 jmlubbs
80,282,039 *08810F998909BE71022BAD18EA3C32667445EF9B староседлице
80,282,040 *088B735A75C35D7153E11C06E9FDC23B3D08E0B5 JOEBASQUEZ
80,282,041 *088E781F9EDC41934AB72ACB374F0DC83931778A john-henry-scott
80,282,042 *0887027C3819CF756221B83008F84B3F40697A95 храпавіцкага
80,282,043 *08894E3A38B67637C2CFAAB115461E8DA7E954F0 [email protected]
80,282,044 *0882DF1E53396DB5746374FCFAEE78E6EAC786C5 jōmonsugi
80,282,045 *088E5546101689D942D6C9D2C7DB4834B4467BAE 5ASDFHOLLY
80,282,046 *0885AA2997AA447AC09F5DD013E0FFF284483B31 5BONERBASKET
80,282,047 *088B74A77B56E24C636D389A513FE8382D6BCCF6 5BSWMASTRAPASQUA
80,282,048 *088EBF1A0C247D70419A5F71EF4EE4CDB202BB77 JOSEPH.COVAL
80,282,049 *088C57E194F151CC6287C2EC24FA823FEC3FE22C JOSHEZELL
80,282,050 *08863727461A1A3F663EEB2FC5AE7F125FA0F347 josiahcasano
80,282,051 *088D5E2766B3576BA0CB70D23B4B37996FBBD83C 5filologisch
80,282,052 *0880930530EBFE571046144CE6E2B4F1863F0FA7 JULES.PHILDOR
80,282,053 *088EF950512DE51DF9363C7E73FBAC61D335765E JULIDA POLKA
80,282,054 *0889ADCBFF3111C8CB6B976D995EC1FA078EA464 J|WJ
80,282,055 *0880A6AA56A7AAAE27E0EF7BB72DBDCB99EE3DF6 K120780
80,282,056 *0884E9D62B48BDE001852857607483757934D5C0 kahanà
80,282,057 *08899CFE7FE98C3DD919BC8AD8B9B9CB6ABEF5B4 5SPINDELVV
80,282,058 *0889E22ACE32857898EABA695A0ECA6C2E46057D 5VANIKBSW
80,282,059 *08872A0EF3636ED3BFAE1218D81D049236F7D637 693318 '-GREDENTIALS-SUNALIM--'
80,282,060 *0880C99C2F2E7586090BE3E34C781F067B02BE7B KASEY.FOESCH
80,282,061 *08810BD2AFE2A055DCBAC6B6EA8586164F14BB4E kata5
80,282,062 *088A34D5D6C8F2A2636489A90243434BA95E91FB [email protected]
80,282,063 *08858032C1F9905D1597FF96BD19635D4034E40B KDB<
80,282,064 *0883E8C32AD18EDC7568E569B92875A02B7818EB 6CRICKETSCOTT
80,282,065 *088BCF1191AC465816658BFDEF83C7635D048407 6DIKAIWSW
80,282,066 *0888F912D2AEBC45FC34D66489E9EAE201D354E2 KENNY.FLORIDO
80,282,067 *0880421BE3D603FDE9AD8E4364EFDC73E322F6BF KETOKSIM
80,282,068 *08875576A26B1C8960FF615763AE77F32D98BFEE 東海道本線(jr神戸線)、福知山線(jr宝塚線)、jr東西線の駅。
80,282,069 *088EEE205D880C0472B8054B473B8367013A67F3 6PURKKEINEEN
80,282,070 *08823AABF982BE3ECFA0AA0E4581EF042120A788 6SWIMMINGRENEE
80,282,071 *08800107FE9AD6F9E34AC121FE554A57DA6B59F0 6TORONTOFRANKLIN
80,282,072 *088F0858F82B13EC41B6FE158260FE42B3A7E168 6WARNERMIRROR
80,282,073 *0880DE9D762568A23A0583F27ECFCD05E148C369 6WOZWEURL
80,282,074 *0889060CAF04F34B0B39A6654A2215BDDE185279 要出典にDATE
80,282,075 *08860CFBF05D8FF8E60A494AC1C06791CE38B915 710391 toimintal
80,282,076 *088D4670B93529DE493B1A296D34F194D3BFB263 713-ecological
80,282,077 *08864BE2FE576F5AFAC376AFE5A02E986897EF8E 7AFFICHEER
80,282,078 *08824D19AA979F8E2992DB1E7A7CEFCCC23CB5DA KOULUTUSMIELESSÄ
80,282,079 *088536297098AC5A10AB908C8915ED894EDDC97D KRAGTENS
80,282,080 *088EA5AE4443FCF8B61BDEE24A5F9A4BAED81652 間,成為英轄殖民地(CROWN
80,282,081 *088A980ADD051812C0739C52CDD6C4D4E48EBCBB 7HYRESPRIS
80,282,082 *088C0F7F43FBC542ABFB22BFFB6BC6CB1A74CF14 l0wng$
80,282,083 *0887D71961860EBD2DA70379AAC5872E391F5F10 LANADEB
80,282,084 *08878A86766F5B8288789074F6072E1D721D975B lance-crosby
80,282,085 *088F261E3788362A0C685DD97E132E805B3C27B9 LANEFARRALL
80,282,086 *088535702CA77DB47450B815C704D1B4E0DB09E1 05.23.1614
80,282,087 *088F41B57B9DA9AD518350181144011AB240419E 070savannah
80,282,088 *088AA0C3853B64AADE5720A5D4E270BAC0874C6E 8ANTIQUARS
80,282,089 *088A2C2F759C70E0CA1FB31AFD3EF0691F676797 la-samba
80,282,090 *0885DA344F411731A0E7C4266BA571D3D4FBD63B laverndelph
80,282,091 *08883208A55BF76672A561EB6A4C367FAA43EA85 [email protected]
80,282,092 *0888B0A6866F9D8F95A0B9421A83867E010E96C1 LEANDRO.DIBATTISTA
80,282,093 *088DAF7C66D65A576116C8A38FCF039AE9A8A70B 10061768
80,282,094 *088C63C3CA002C5350E37FA98A03ADE22C2679E0 ledyaev6
80,282,095 *088C61F1C966CCEDD818268E4289E79B1A459B08 8HELBREDELSESMETODERS
80,282,096 *088D725A7B54E3144892D718B4700D694C17DF4C 11.lessthanenthusiastic
80,282,097 *08899DDC47017B66AF01258AB3C311D3404130E2 8MONOPOLYLLOYD
80,282,098 *088063EAF2BD9C63068134428D0EBEB1C12EE6F7 12:.12..#..&...CITATION
80,282,099 *088A65AA18CF44847AEBC53E263B787A9AD48214 8NSSTNNG
80,282,100 *0884396DA471938602C8942D377501433E474D93 8------)~O~o-)o(
80,282,101 *088EF2DDF8EBDEF35D6009B35B8F2DB83EC5D854 12.annehmbaren
80,282,102 *088080C0F0FD47463760E88E295200B52A95F075 LESLEY.LEDWIG
80,282,103 *088CFD892B59A312972964970A7270026072FF24 8PUBLIVINGSTON
80,282,104 *0882DD35ACBAC3341EEC1171F1344D281B236F14 1344847 " MIST
80,282,105 *0889AD6416008603491C740EA0CAD441C30FD888 8UDARMIONS
80,282,106 *088745324BF728E04296CE5D85BE2A2CA1B14391 1439300 esimerkkein
80,282,107 *088A8C0568B84FB3891283ADD428AE40A3A4EE2C 148ELLE
80,282,108 *088DCED598A4B308A618BEB363BF77AF21FD545D lichaamsgebreken1
80,282,109 *0883F69A207A28876C924DF3842CE3E11FC44A8D 8WECHETH
80,282,110 *08831E96C383DEEFA2DA51DC80477E509AF3CBF0 97 LUONNONARVOJA
80,282,111 *088F10727A0C8469CC0CCC04F074AA842DA4CF95 [email protected]
80,282,112 *0883437B575F6B55EE086D8A9F86466A470906F5 163BRUNO
80,282,113 *0881C568FC735B43A0CA2DF93E53E8B83B98691B LIMITÉIERTEN
80,282,114 *088EE327B3C705DB9BD631B77752E908A995103A LINCOLN.BLUNKALL
80,282,115 *088F0F5ADCFB3D1517D90C7AA3A50BFDFB1A0660 9FLDLOCLOWER
80,282,116 *088DEC98EA9BC8C85C1C8BDCAD7B40BE1A0BA632 [email protected]
80,282,117 *08893B593B02CE63E239B0BBEA896B1CC6ED303D LIONELROOPE
80,282,118 *08814DC974097129DC87C51896B625BF8C547C41 lippiness4
80,282,119 *08865493F8CE54D4250CD1E34E4132DE375F847E 1AGRESSIVES
80,282,120 *0889B4B4EEDB15D04E15F3BDB4BE3855423EAE27 1-ALKOHOLIVERO
80,282,121 *0885F82219E2D0D46F7753048851469CAD58C97D LLESSURS0
80,282,122 *0886ABCB6CF1FED781217F34B1976DC0EF538256 LO+AS3
80,282,123 *0888F66EEC5EB87F6641D34DF7ABDDC8B0B2A635 9TOMSAFETY
80,282,124 *088E05C069A44ABE74185C26895B19251C0F1612 1 BODENGITTER
80,282,125 *088D7123B2270CD5BD71FDCBD290A1101AA10A89 1chakras
80,282,126 *08836A4B4ACB630D45F1CC86FFF0A2EBD761D0FA 1DELEEHWE
80,282,127 *08842E7E9FA6699C27090AA43E086F26C03A570D 1dial-a-sheik
80,282,128 *088351FB296130F0B50C5AD5F5F1014709993BA0 1DUERERZEIT
80,282,129 *088F8C7E5F2EFA1730BF6E03EAB6C36D333C72F3 9YEECHONG
80,282,130 *088BC6AAD0697EA2A7E2B63C443041ECD2FBD912 a08u:
80,282,131 *0887789A0773939D189EF68609609ABE5EDE5828 1.GARU
80,282,132 *088E321AF35D8FA1BB8DDDF374863EA7DE1A5518 A5BXBS
80,282,133 *088ADDC4D337C4CD6EDB081264AFAF8BB43474A6 LORENZO.KULAK
80,282,134 *0883F68F25C844C549186891A85D814579ED3F01 A63U
80,282,135 *088FA817876F68262087B95F0DFD774DB32E965A a73l=
80,282,136 *088CDF917D0A1AEF96432450EC04C0B787BAE12F louiskatsbulas
80,282,137 *08819F4C1EC592C921E968E86431258EEEFA9B30 1.kapatirlar
80,282,138 *088F3F67A53BB76CF2EA31F7B0ECEB30AF4A9A7D a9ups
80,282,139 *088DE945073ACF461F73E7AA04A969189FAF8136 LRAMOJAL
80,282,140 *088CCAA178FAB2EEAD10834220B90E1B5ED342A2 aabfs0
80,282,141 *0884F7B3D9ED8B89371B67B7D4FBA2D696595ED8 「lui」を利用して外出先から自宅にあるパソコンのデータを確認したり、
80,282,142 *088A2A1D5A1D433DD528EA3EDE59E3D1EF860288 1NEITIJ
80,282,143 *088E9E8B53E4AED7AB3D6752CDEA4C8FE0013081 aaetz.
80,282,144 *088FBA0CD21ECBE9AE45C63046677EB21C1BC561 1-PURESKELEMATTOMUUS
80,282,145 *088FB7340544071B57939FF1EDD2D16FE00028FE AARONIAQUINTO
80,282,146 *0882BA08D6FC40E419F04B5E49754A34D04211E4 1-striptease-paikka
80,282,147 *088156061812763F1870B01BD71626B4193C4489 [email protected]
80,282,148 *08818609D6280D3337BB5B489676DD04817E77A0 [email protected]$
80,282,149 *088E45E401DC67F1D69F8D8636D58ACD1894F464 magnificat,.bwv.243:.viii..aria."deposuit.potentes"
80,282,150 *088EC8F80691AA2C4AE3A7E6E0DD97D085DF7BB9 ABOO
80,282,151 *088E3CBEC547282FBFE92E5AA36358FA90DD72C2 1 TUKIELEMENTTIN
80,282,152 *088E370EB64E951D4E3D0518141369821335DFF0 1UBIJETE
80,282,153 *088E0C3E7D6AF570055F98C93C94470CB8F236B1 1velpalvelussuhteensa
80,282,154 *0883BED8786870BD6F13B58D25E7B2C9A229DCD9 1-WASSERFENSTER
80,282,155 *08832A6DC4BD440E2E78AA7C9DAEE93EB321A6D9 ABXZ?
80,282,156 *0885E4935A163D9E04AA493FB50B38041C8C8297 206gti3p
80,282,157 *088C8883D69371C312FC68F95EAFE113FB922A24 230KM
80,282,158 *088AFA5284A77E3A4345DB81A27BB6DC1F595ED7 2455933 on sanottu , ett
80,282,159 *088182625F696EA1B82683A59CE50F907DE168BC 24 VERWALTUNGSSCHULEN
80,282,160 *08818F4900345ACE38030B1B00AD16C842C3BF29 2560862 ZWEI.FOLGEN.GIBT.ES.BISHER..
80,282,161 *088D1814E8C5FA567D2FFEDFB6928FC499811E3B 25.TOCCHINI
80,282,162 *0886B9709D19C91180244A1ABB5086367DDBEC35 2609965 SUOMALAISTEN EI OLE ANNETTU P
80,282,163 *08883CBC80F14D06B374AE6BCB5FB9202677C316 2753442 laitteessaonkuitenkinviel
80,282,164 *088CD9841E645B8F127EE564E410D35EBCF53855 2992905 ICH.ERWIDERTE.:.".VOR.UNS.LIEGT.SCHWERES.FEUER.."..
80,282,165 *088C3FA8B881E8300A0EDED326E7CA0BCAB73BCD 2 ALKUINNOSTUKSESSA
80,282,166 *088412FD0721FA3D91F423BEA121CD016D28DAF3 2BAALA
80,282,167 *088B52D40C94DABBFBCC1629E08EA8BE3C629405 2drei-punkte-treffern
80,282,168 *08824F67AD75554B6F97AC43F41981558A835BE0 2ESUENITA
80,282,169 *08847FD82A6553C5B3922FA856CEA5210771EA43 2eugene5
80,282,170 *0885E3D377D94A3D8F6F6ABD24C7F4C6117482B3 2 KIRPEIN
80,282,171 *088B8AEC4BB28B5DBCFC7D7F6FB0CF504EEEB338 2-KIVILAJI
80,282,172 *088589DCBABBF054625E6CC1077DE7A5D8AE465D ADAM SINNETT
80,282,173 *08872583E94707706C98F794E1BB834B61574957 ADANCLERC
80,282,174 *0881984F4801BE5C1BB031747C8816792E5F8880 301391 kim gelismemis diyor ?
80,282,175 *088CE7403F873D99B5609D71A69085FBC71C34D5 39wilderer
80,282,176 *08830CA5B4F1A2031D833D6278DAB7E2DFEDC826 3 BOMBAST-ROCKER
80,282,177 *088CA3D076395DDB2843A6DDEFE36572C0CF3C24 3DOCUMENTARY
80,282,178 *088AC099C26771DC5473EF02767F16D019B667E8 3drecklawine
80,282,179 *08814E7C3DAE95D8E7DF6CD7375777EA2BB3320B 3.INFORMAATIOJ
80,282,180 *088B8C2DBB5CD8D8194FECD50B31671414AECBAC [email protected]
80,282,181 *088117FFAADBF9EDDE416146AEEF3EB1031C45BF martinswearngen
80,282,182 *088F1D290CB962F1468F682E69944F6332163C03 ADZV)
80,282,183 *088C81C64BD549F627CDF33E207CB6BEB20A362E 4021498
80,282,184 *0885351888DD179856D11E7E8B73A9C71B925994 432ABDULLAH
80,282,185 *0889DFF5E3041DF1193C5C9BCC7867286B345CB1 aemnv
80,282,186 *088F4B98E1C0D0A3A2C130C9CC86D3572FD019F4 MATTHEW.ZARZYCKI
80,282,187 *0889E73CB8217BA396F193685CA5D73F203D3D3F mattklear
80,282,188 *0883D338FFF640D99EDC6E0927709C84023455C9 AFGOLFDEN8
80,282,189 *0880A1203880266173107C13238ADA9396360BA0 AGQQP
80,282,190 *0889E7D1543CA58F36AE5544FE89750E63C9A1D6 MBANGLOY
80,282,191 *088890600212EA6A3EC982B640C8DE080C033D64 MBREYNARD
80,282,192 *08832DD8462BA524CCCB9918E25E9804087C57A0 MCOMPOSIO
80,282,193 *088B6D8F749D2E659DEA7A6C0B8E661AAF0779A4 [email protected]
80,282,194 *0888D4987457D638A587E978D2C02B7BB32163B9 ahora.quien
80,282,195 *08866CD894B117B8A6D82EAA2B42564BF6B537AE AJUSTES0
80,282,196 *0887B4A989B29F2F627AF43B5F9E17363FF7C60E 4UNTOTTERING
80,282,197 *088E1C961A1733C890917CAB135F5B8BCE364A96 akn#d
80,282,198 *088EC3A937FA7A658693256C4292C88FBC06087E al&17
80,282,199 *088C207AA4CCF40131F13B0B2D98044D9F993C44 MHIKAJANE
80,282,200 *088EF06004A178E670652354CA0E193DB89D8AA1 MICHAEL-MORASSI
80,282,201 *08875DD1D4B9B9E5D385B688945AFF23A31DE447 michael.parisse
80,282,202 *088F8CD16541FB7C2C8DAA56CA17CAB378E1C447 MICHELLE.LIANG
80,282,203 *0889806D926ACF3485D65AAB502E17FD5010F7FD mi$d0u87$
80,282,204 *08852DA3DEFC03989D5F02542FBF83107D7749CD 520007 FUER-DIE-KUNDEN-FALLEN-KEINE-GEBUEHREN-AN-.
80,282,205 *0888C667290BBA154F107E824AB410FD7A3E1488 mike-podesta
80,282,206 *08814AC25262289F05B44FC8F2F7A3C51BC4971B ALDEN.GRAUL
80,282,207 *0884A57A7458FC739EE7A4C2B9CCEE0E28DC9A68 59.BLUE.CHEVY
80,282,208 *08804F667F98684E9C822EE3315408C5203460CC mini&mini
80,282,209 *088A42942F8ECE195428CEBEC1AB32918A0E1198 5EREPRUSU
80,282,210 *0889FA3ED4089DF9DB793FEE8F56D681F48AAF34 mix(koda『trust
80,282,211 *088A3A37A369E94FDAC5C2689BE779F74F9CFA6B mm1x74
80,282,212 *088B35A4E489763E288C2A25FECA072033DF6DA4 ALLUMIEZ1
80,282,213 *0880991DAB6F7CF229418E227BDBC61ED2984D9C MOHORNBSW
80,282,214 *088846C0281294E1E4CBB89A6D85934601A2B8D1 MOSEAIROLA
80,282,215 *088FFD2FD2284323F6850A66D8B5EAF7BEA0CD88 633TANIA
80,282,216 *08886795EE7714F7D062D48744716BA6925C7D71 [email protected]
80,282,217 *088570CB65C7206D519DB58F1BD192735029E617 [email protected]
80,282,218 *088759DED6929EA50070794A76469E1D0BF739E3 MOURENE
80,282,219 *0885EC622FAE6843C37B95E34E5BA9F13113BD94 muc114g1n0u$
80,282,220 *0880E931315880F3EC78D2FB53462D74D1C99737 MYACROPOLIS4
80,282,221 *0885D75FD2F5D65EEED7553AFC4DD5ED8C017E0C ALSOZIGGURAT
80,282,222 *08824151829C51A44C1D75C0DBC84AD1D91DF311 6CONTEMPORARINESSS
80,282,223 *088E0553720CAACC8FF18D668FA71A5C94074E33 NACAYAUG2
80,282,224 *0884EAC410900AFAC048EB97D6CA4A5D71BBBEA1 A_Lw
80,282,225 *0883636E7135106328FF3009FA57C161EF2BCF37 6ENEDNALR
80,282,226 *088D2D2E13CA33C438AA53668AF0585B23709FE2 AMGP)
80,282,227 *088A4F22AA6F476D4052DBB59E200BBA6B66D9C7 amnāan
80,282,228 *088929BD8D7D46CC4E93A6E39AD6319361E68437 NAPOLEON.GOHLKE
80,282,229 *08856C1B39A2A2DAB7D4BDF460C7503DF7766622 natalyreyna
80,282,230 *0883021E6F2BE09B69DA7BB1400D524846790246 analyseret6
80,282,231 *088D2389AC1DAAE8DD0109E5D814ECD546196759 ancientevenings(najmaldin)
80,282,232 *0886B16EEA84B865849E4B59859FC4D0B3E6B514 neframia
80,282,233 *088C20C4658ED21506EC337EE08647CF20AAAB8B nelsonpotempa
80,282,234 *08883869E73925549EDBC672FE4F2670C1C5E6E4 [email protected]
80,282,235 *0883554B6C49405D4147AF8444DCB9D43306932C 6SSEMGHGK
80,282,236 *088BBF33B9FC506781EB57D48C8B399BD4FBFA99 6STADSTRAMS
80,282,237 *088708F6C890D5CBB49B4AFD7C2CED00B22DC738 NERTONADE
80,282,238 *088B781D34CCCA53D3A6A57B3650F8D4713FD645 ANIG
80,282,239 *088A7E7D68D8EA85A139019AD392DEE5E66C67EE 714JAVON
80,282,240 *088B30E337BC8E25C38178367823FF268CB1CBE6 ngwangwas
80,282,241 *088099357F7FD1FCCFC16531D0E0E15E077B1FA6 nikko.mason
80,282,242 *088CF0CCD557ED2B5337C5F234F376724949F405 NITENOD
80,282,243 *08835AB69042EF01591DE4F25985EC047675AD36 ANTONY.MIR
80,282,244 *0885E169887974C92C6CD303C166EC2422747F67 NKJRVNJ2
80,282,245 *08834876432965D48982E41526EC80ECB816A6C0 NLIZARD2
80,282,246 *08807A93AB1D9773051B23D6981D59454502320A aon2q
80,282,247 *088496D8AF2525F40786517CAED774B398D4E78E NOAH.NUARA
80,282,248 *088FD28D519C0EB9C486B8034098C6F2659A64B6 NOELGARROW
80,282,249 *088DA93E23C0CE6D51D518775DF3119A6BFE649D NOITALES
80,282,250 *08817A65CE344128674A6330278EB65D6BADBB1E NOLI.MORALES
80,282,251 *088D2B94EDC4A4DE59D46D9AE56FCC529161ABF9 7JENNIFERWICKED
80,282,252 *0889658089EF3889B58C0154333557CC59670DD4 NORMANBRUSH
80,282,253 *08890DFD744E549F3405E3D3D12DD3C1F7FF6608 ap?vc
80,282,254 *088CD6C89894F182ACC260C5C0CA92F74D5028D4 arsenal4
80,282,255 *0886356FA9F4C4C4C38B8AD4CC08852DB605794F artserried
80,282,256 *0883EF1CEA81BDC2263A198D7B3658A26A19AAD7 NOTBURGAGRAB2
80,282,257 *08899D1E9408B4AE792C0BB6E169F90060627697 [email protected]
80,282,258 *088CA5C36587DFF1A0B220AA07DC27463B87DFD7 NOUKOUDA1
80,282,259 *0886731ED3DD229A8F2A82FF0B5A5CF2EB9950B8 ASLRL
80,282,260 *088E684D2D5ED2227D983F10D83D485BD34D3F78 nucleus1
80,282,261 *088756C519F3C75B91B5E090EDC954CD4777A3C8 AUF=
80,282,262 *0889FD7D9AD9C2DBB085B4E63B3F1F03D8259AC2 oddsiden2
80,282,263 *0889F72F0D483F25EE3042F02DCC9764ED65C0A1 OHCOCSIB
80,282,264 *0888AD5017BB2B7D32724A6F6FD823B7489C50B4 OMOTAYO.KOREDE
80,282,265 *088DEE23E24E94C84902C9B34224D9C8ED30FBD1 AYMANREAOR
80,282,266 *08862A97F139ADA5BBDFC1605BC89D3FC1765F56 ayxp2
80,282,267 *08876FCE8B3B1252444A1FACF47AC0A9A085C2E0 A:Z6
80,282,268 *0888C5BBBD86DD15146973EE43263B2C4415B87C 8RBERATOR
80,282,269 *0880B5AD7CD270E35BD7563FB8F2F123804AFE30 b2.da
80,282,270 *088E4C18F9F9BBF6234AF3DAF8A190E0BC49DCC2 O->-<~-(#####P
80,282,271 *088F2E29BF3067C89C63817356DA4F97B26EF39A 8STEHCORB
80,282,272 *088D949E5A3870A7D6C69624053632B9B37CBFA7 OPEN-UP-YOUR-HEART-(LET-ME-IN)
80,282,273 *0888240CF96853C37C16E825E5318F1C30F994CD 900114 MASSOILLE.AVOINNA.OLI.L
80,282,274 *088BFA8DAB2D8D4FE155B30E877A64110ACB30AA 911bookit
80,282,275 *088A6517E505E29F64CAF411DEB96269127B3DCD b7,&d
80,282,276 *088E6B4166CAE20A88625369E979D27BCAD1AB8D 9BERFBERG
80,282,277 *088489250343FE5DAB5BAA4B1DD04B0D8412A4BE [email protected]
80,282,278 *08811FD54E0052ED999DC1C621B4AC440CCF36FE OUTOFTHESTORM(C'SPLANETESPECIALMIX)
80,282,279 *088A77338C62B2893B1B853D1FE2295F71E0BAC5 ovenston1
80,282,280 *088F84072856B18E042ABA16DFC9325B60BF8BEB 9ILTTYMEG
80,282,281 *0880534C8BAE4D9637A3CCF74A384B564E2FFF86 [email protected]
80,282,282 *088DC797E32A326A8B5BC69DB89AD310FBB102A9 9MADISONACTION
80,282,283 *088B6A215D359875CAE3D03AB23E7398F98A2CA5 9MYONE3
80,282,284 *088FED50EF4EFFC9E9C271680F52D8EA6D93E0D5 9qequunn
80,282,285 *0882C163C7AE79A492DB08AD396A47279E4DEDC0 9RICOPERSI
80,282,286 *08842B3D7D29E6D7134E3DD6BA09E50EDC407039 9scarterete
80,282,287 *088E8F95C03022B42154F6045133647E7EE35788 9WOODROWEL
80,282,288 *088AE697F003093E1B71C58BAD72B465A5998680 a0;ri
80,282,289 *088B4743C5328F9218139A4C2CE53BA9A86B6B16 a2rg%
80,282,290 *0887E733C81B805A39485CC62B0681DA45754274 A35D0582-F4AB-38A2-A9F0-E3C2F58CFC6F
80,282,291 *088892F21809E756CF7DBEBD92D34027CE81742F BASILSTANDORS
80,282,292 *0886E094874C4B0FEA73311FAD7BF023C360D2D5 A4REALMAN
80,282,293 *08875C383AF9BB342703DF384357551057B7CED3 a4x5x
80,282,294 *0881A26A3D68A5269E01D9A221C68D6FC78A362E a5lsn
80,282,295 *0885E9372FF999E0A9D5110B6EB6BC2F58312A9F PARKERKLINGER
80,282,296 *0887F2794426F646C74E66B07F566E94FCAB0264 PARSONNA6
80,282,297 *0882DD2209011713BC51A2666BD8971C0CA76B01 a-7"y
80,282,298 *088A4ED621E27DE12392B0EB2B83F0531BE43D19 PASSEISENBAHN
80,282,299 *088A3026B5A13A329A7CF888F63E53FA0F2FCB15 b######b~ ~ ~ splat
80,282,300 *088FCCC4116306DC804E8C0E3C9AF68C66A4195C AAA8:
80,282,301 *0881170F3FF59D4B3EF2738AA9606D58F26C6369 aacAq
80,282,302 *0883F496C2E79BB0022704790209835B88227BCB AAC"TI
80,282,303 *088593C84DE8CEF0CBD7BA76B2AE11F4D4783611 bekcer
80,282,304 *088E7D4C9A7012E27C8FF4EFFB1BAC16DF782CE2 pdqckozic
80,282,305 *088A1C96AF9F6CA1D095198566FD81CBC67A3E7C PEDRO.VIOLETT
80,282,306 *0881C8AD3466DACF2DA06A97C8E9347C9E0BA174 [email protected]
80,282,307 *088ADC6D13FEBF11417462C27246C9B7B85DE7B6 BEU/N
80,282,308 *088132611C470AF181756D7C6202AFB6B0928F62 BFS_A
80,282,309 *08854523855A3D63538DBCA57D17EF5B5C5A2F1E [email protected]
80,282,310 *088426FC66A01B48F21F46E81C7576B519F05C63 AaQC
80,282,311 *08814C8AA6B4D382F14E917D26E9ECD61E0FA44F B"h3
80,282,312 *08812A92D5D0FA32C9E673E956AC16903D69D600 abcwarner6
80,282,313 *08891F544621476CCA11D6068D4B71D08AE53BC1 ABOO
80,282,314 *0886EDBDCD7442FE7086F379313ED583D735A93E abrambringle
80,282,315 *0885EC86F85E14BC7339A4CE7366D52BB10940BA BIOGUIDEEDWARDS
80,282,316 *088A41C4AD95D65F3E0958C222275EFB1C0B830C BIPFD
80,282,317 *0882982670C94A8B1F00883F1F751F7F2618477D accrediteers2
80,282,318 *088567BA6452AB0C0E218ED41932582EF9EE054E Bkb6
80,282,319 *088CD737A26D6A63A7927330668354C6C8A9BFCD blacktiger89
80,282,320 *088ABC5BAC25B8645E3839DB4EBCD3C2E9608182 ACHEGOUSELLE
80,282,321 *088CB347DAD6B88754AD487223BCAC15D85C7AB4 [email protected]
80,282,322 *088AB4E8CF731F194C9FE735C90873F5D31B5186 b(l&u
80,282,323 *088D18FB972F2A5203C7F46D327E1A9BB2916336 BLUESTEVE7
80,282,324 *0883C8AAFD4C9701DDCB99D54BEDEB423FEABD2D b.mk:
80,282,325 *0882D11A367549FD1A54AA2AE0B96761A91BECBE PORFIRIO.KAUNISTO
80,282,326 *088B8A9558F14F4F9DA4B0A66AB469E1EF986E86 p---p.~.`.(-_0)
80,282,327 *088A6246AE56E53754AF54780CEE4F1F23386695 adhqh
80,282,328 *088A8B3D6667A6458DE7388145F44D20B5B8BAEB ADRIANNA.RICHIE
80,282,329 *0887BE2195DF31209E6411AD6DF7A62CF0DD3955 B---->~O-~O-(X)
80,282,330 *088B768E659FB7D017646558C649ABA7FD0984BB P------P~~~SPLOIT
80,282,331 *088239E4E187086E83AF3F3DAAE20C1C7EA21E14 B!P0S
80,282,332 *0885DFF341B06FED7AEED603DF0AE83366AF6145 BRADYHINNERS
80,282,333 *088A313FE8AD453590715F356B39C75098F22AC4 af3bu
80,282,334 *0882DF4533D2076AF501B82675BD3BC92E268E88 BRENT.DENMON
80,282,335 *088749C81C4D02751575F7855EF1C737D91FEAE7 AGRAPHISES
80,282,336 *0881BD1CB672C23F57A1E58BE80FD4C5AB149FC6 BRILSLANGEN3
80,282,337 *0885047FF0D30107C709EF0CF435B4DFD5824E7A BRNJICUS
80,282,338 *0886F7D94F9B7F8F2E30ABB8EFDC642038187031 aia9
80,282,339 *08820B9F437CE529A2417A0D17D48A7089216AB4 q-b~.~(^_~)
80,282,340 *08897E59060DD4896B426825DB027EA879D5B3A3 QBR3[email protected]
80,282,341 *0886BFF3D863F292E6F6E1D94386479D97A7DF86 BS4LH
80,282,342 *0886E2746F445B3E863F4851A9C5DF2E6F7C858A bsmxw
80,282,343 *0884006CF723F9772ECEA63CECAF29364D33E089 qir
80,282,344 *088B57C9F4BF0BACBD6D9B483B79E7EF7BA12BB5 ALDO.PRESTAGE
80,282,345 *088ECE8CB43BB2B6CCEE91ABDC01A33B2FA11DA5 qotp
80,282,346 *08817A4685B282A51302E9A2262840D3A0FF9D1A ALFONSO.IZATT
80,282,347 *088DCEF5DD3D33F1F0B630B193DCFC44260789CF ALFREDMCCOMBS
80,282,348 *088AECCC550EDECC5CE141D53198A0C1372F9F27 ALHAISIIN1
80,282,349 *088601803FD4A37D4C0CE2F8C45613B0AA1AF11E b.u/
80,282,350 *088797B5FA179CBA619D17B3E1FD4C6FF726651E [email protected]
80,282,351 *088749B75BC7438A0165B6104D55A5F1FE26B392 ALONZOSHEMPERT
80,282,352 *0881113CCA1E61A97C20A3FF410A647D4EDE3F9C ALPAKAM9
80,282,353 *0883A35B717B415AD3322B8DC78B8040A7B6C97D -bumper.v:.bumpered..bumpering..bumpers
80,282,354 *0882246301DB309CF20494B9C45F1445405BCBAD r39r3ss3d
80,282,355 *0887E5186C11626D5E157BEEA09B578A3363F5E9 AMERIKANLEINIKKI
80,282,356 *088D565654EA7B46DE50722796D7A62E10EE92AD bvn"b
80,282,357 *0885E4805C8A7FD1837987A98C232FC8B26CC39F RANDUNUN
80,282,358 *08856E3E937FCD8951BD4CC996B2485EC86C5CE1 bw3ak
80,282,359 *088CA3AB9FD527A57A9230B99B6D8695C57ABF2B rasikh
80,282,360 *088FCD13768DF02283E1BAD57B497D6F134E5A34 [email protected]
80,282,361 *08882B47EBF2420E711E86BAA2A2EE3B4A1B5D8C REAL CYR
80,282,362 *088B5618BAC12449A3242495B43100B003B386A7 ANDRE.ARACENA
80,282,363 *0884D09C8BD76082C8EBBE505AB4536F78023BC8 ANDREAS.FREDERICO
80,282,364 *0881166BBC88850B037AF023BE460CA69D75FE45 REDROBIN9
80,282,365 *088E9BF556BABCC006ADDEC95284CC475F317BA4 REGULARPLAY6
80,282,366 *08828720B57C0E607FB83138104DDD92B2716846 reichsoberbaurat
80,282,367 *0883FA8D09ADF709809A7B8C6D4DA8F63DFE49D6 ANIG
80,282,368 *0889E4C3198CA82D5AA93F0067E99CEAC0FFEBE5 ankmb
80,282,369 *088DF8E7E2C36DC136055269939D0F5BBCC09E67 ca?c/
80,282,370 *088A6A5FDAA464F2BA00DD1C410C11C16674B3F4 [email protected]
80,282,371 *0881C7934B41EA80A323DE8A30D8189B890997B7 CALEB.GIBBONEY
80,282,372 *088B364330060EFB889509D141E32255B98E7BD5 CALEB.NOST
80,282,373 *08881AD9180C7BDA49D77BC798FAA68AA5968EB7 CALVINKRAMPITZ
80,282,374 *088121EA400E058C9CE97883F1E36B496EE09370 aq-
80,282,375 *088AD0D18192A321B0BCF5A10A91CE7807804417 AQtG
80,282,376 *08822951BDCF45A307ADF5E4BCF48BFF406B48AC AR2LG
80,282,377 *0883586346AA2D2758396B5EAA6B8208DC65C14B RITACSEH
80,282,378 *0887BFB5400C6A3D98D0B6E0170B006F2FF849F7 RNAENGR
80,282,379 *0883936533CAAFC68DB43DF6CEBC985FEC19CE30 carolbutscher
80,282,380 *08835DD0AF0A0FC41C85C23E812D3725D9D14465 ROBAK
80,282,381 *088AB3A7A966B7FC7231817431A02640D3F7BD16 arnoldwollyung
80,282,382 *088941D98AA9F94A4D2A905F6C1201DD91D76728 ARNULFO.BELLANCA
80,282,383 *08816DCACE230A0CB5BAED039E457A7422DAEB05 ROCKANDBOULDERS
80,282,384 *0881760F2FED34B80E36B7785CFBC396A14A3C7D ARTOSUGI
80,282,385 *0885022505AEBA1D015D9B1B8647C5520C8A4E14 CB0Y
80,282,386 *08857B922DA379EE829ECDCE395A17C2F8920017 ASCAPIE6
80,282,387 *0881DF95E529936DDE9C355AC727CAB93B7DA3D7 ASDFCORRADO
80,282,388 *08822513E00439DB180758057AC2765D1A3CA1E7 CCMMF
80,282,389 *088D62E738A4CDC9B89BDEB9A21AF3019C04E1F9 asolases
80,282,390 *088D4FC9D69BD4F58E7D14ED7EB5BE2997E66A86 ASSIEROS
80,282,391 *088D5E0B887BD3412F3832D3B85E3D386C21D933 ROSELBA6
80,282,392 *088343D7DC176FC01CC4D45A6B827688039D76AD rosewyy
80,282,393 *088B48CC101B26B38DED1910EE36B95F3C64C002 C.=DV
80,282,394 *08875F8BBCDE239D63E2FAB467F9893BA5F73D7B [email protected]
80,282,395 *0883939158356EBEC939866B8647F7F815062AC1 cedricarchbold
80,282,396 *0880D38131E3AC90E79C2EF14DF1DCFA283571FD ATLAVINED
80,282,397 *08808228B2D2F636E87F9754E60032A6DDCB3ECE CEDRICKOUTMAN
80,282,398 *088BA0255D5300EE43A195975540D25C4428B853 At-Night-(a-cappella)
80,282,399 *0886E627AD2026B45423F5E0D56313B37D5DE9DC atomic horsebox
80,282,400 *08873BFCE861C3D049B1E7AFCDB606019E64C537 RQKAAA
80,282,401 *08828248735813B26F24A2C8B0F4E2F33C56C65A cesariennes
80,282,402 *088B4FAF55B35BFC336245DCA73986BA53D4D0BE aubreyvegetabile
80,282,403 *0886FFB7FCE544F820645129EC3371C49D5CD409 CESAR.OVER
80,282,404 *0880133AE7A654D053077839743C8E62A3D8A5CA RUDERBSW7
80,282,405 *088434F3B1165F0D6905ACA433947550A2A9C838 cfm3/
80,282,406 *088E6499AB577793009DD16C466CEA76FEAFC75D RUUAKHUT
80,282,407 *08886CB4CEE5BE019FFFB127638D058ED7A8A3C5 averyglockner
80,282,408 *0886D6EA3EE5A8A516A361C3B5DB10E80D5A5664 RYCZLTOW3
80,282,409 *088E62E1C3B2ACB50F676F1C35B43FAB939DC37A [email protected]!n3rs
80,282,410 *08899F9DC650C4EEF4D41F6DEE85E696BBB090C5 awuseba4
80,282,411 *088717DCE768B2CBAAA3EF79EB074541595131F4 B:4b
80,282,412 *088C414941E266E665D69A3B3880AFB8EAB08609 CH0QR
80,282,413 *088D5726D4E6D11C4EA3DEFBF00DF42C8580938A [email protected]
80,282,414 *0881FCB4A7DBF21E8B0581DE7E777D65C94AE530 [email protected]
80,282,415 *0880BCE364C6EE78554C0ACB7AEF2C49B13F4005 chang-jo
80,282,416 *08812AC63CBCEFA21027C4BC13BF637EDEA189C0 CHARLESLITHERLAND
80,282,417 *088951085F136AB304AB6A793166E0E3C3CC507B CHASELOOI
80,282,418 *088B8752676A542755AAAB03F30596D098F7BEFF b8yh,
80,282,419 *088D1AAE86DA472AE57E5C125ECD36217A0AEB95 B:96
80,282,420 *088B8AC00B8E4B161AAF31F4D2B785A3DE23134B [email protected]
80,282,421 *0885D1156382EFC3BACD4D36D1C6D5D14CD77964 SCARCHING
80,282,422 *088412EC1F00B5601A14AE17A177520B4AA31FE9 sean-paulp
80,282,423 *088E6FF12C4AD6C72B86B20B77CD4D30CC0E781F SECHEVAL
80,282,424 *088B93135B6949F77F9F952C2F963D670EC88389 [email protected]
80,282,425 *0880FE28508E60DEE17686A8B8453EA0939E707A ch+wv
80,282,426 *0882EA6E0F3CD20808DDBA36B890D055D4E649A0 sesfonts
80,282,427 *08845250AED78BA2E08491B8279F21B4EB07D1EA cintura-de-mola
80,282,428 *088E06D3C7F6D6C6EA7B1F3103CA8CF93C71C2BA [email protected]
80,282,429 *088AE3EE0A2D719197C5D1BCEC6C6E5E197A8C1A b;enk
80,282,430 *088519DE8C909296DF068CE46EDE2882DEC66983 C/.)K
80,282,431 *0888D648DBC56D6DF420D1EA7C6AA4D8CB585211 BENNIE.MALOVICH
80,282,432 *088E79929AF5C3F50F9821BB1B96AEC92B812F38 b#eq1
80,282,433 *0887138CB2BAD8EF92447D57062DA384594DE22F [email protected]
80,282,434 *088AE471CEA75BF1E288B69E2596331FE26C5858 sharonarthur
80,282,435 *0888AA4CAD41AC40E01752B7DA0F829E6BCA2AB2 SHEARLEATH
80,282,436 *0880700035C0BE0AEDAC643C8F15F4DB1177B30C b_evo
80,282,437 *0886163CF842725BBE72FE1B6D2684181A566051 BEY24BI
80,282,438 *08856FFBE8BD5CEFCC71B8F8A04CC9C3011011A8 clairsero
80,282,439 *08867AF6BC3D8D3EA207566257279D22956EB3F4 b?fem
80,282,440 *088328B9563D562FEB59E3EC26D32032E2FDBB11 CLAYTONADDISONPHOTOCOMWWW
80,282,441 *0882734A90BA89E7C3385156D5B9C45219F1FB4F BFWVM
80,282,442 *088B589BE65A131802D7BCA0F26501E9859D9B9C BH#DW
80,282,443 *088B046ED50C677392B71C743BACB0DB874F350C CLYDEHOLLMAN
80,282,444 *0884B1AD254EA687E56A83998E07274689BF922C cm0-7
80,282,445 *08882FC9E0CBD9DFFEAD5A1695C09CDB52EF590E bim(_
80,282,446 *0888D3CEC3838ADB5D66DA4B0A3F06A72533BDDA SILVERGOAT94
80,282,447 *088800E82B3355A0922DAECE8B00B7F30E44FB23 cohwt
80,282,448 *0883026C49B661F6E1913DC60B671D1371176E79 BJRD
80,282,449 *088AF99290F35FC1A68594C3C15E0B376DA666A5 BKDX/
80,282,450 *0885DAD6EFF9EA8F694D139054658D77DBF410BF COLOREI123
80,282,451 *0888A2B7CAD430DBB39D476D0EBC9BDEDE0A0B63 BLACKBUCK1234
80,282,452 *0883E2E049749B3951DA2F38BF4D3ED346D1DA3D BLANSETTED
80,282,453 *088A2D23EE27CB9F4280CF71F001FE4D32822283 blesching
80,282,454 *08897978E6A7323C5D7BA7630FB6D562D57A9C1C CONNIEPATRICK
80,282,455 *088B62B8623C0A24070A2BC4307F1C6EE597DE64 CONSTANS.I
80,282,456 *088D53FF0FC30AD40E4D0EB3A56FCC9BA19A1AB5 B;?#M
80,282,457 *088BF22819C776F983D1575C8D465426B56A34C9 [email protected]
80,282,458 *088DC478AAC40A07EEC1C21B854FF060CF42FDCF [email protected]
80,282,459 *0880B3887447E2BCEA81D4E01D5A61AFBF3AB2A6 SMILEYLOVE
80,282,460 *088BD2A3DDFC69C6ACCA733199578091819DFD25 BMYPD
80,282,461 *0882926803B1F251F1890A2860EB17F7BBDBFCA4 C-P
80,282,462 *088F99AC022966EC9F708DFAEE6D252F71304536 [email protected]
80,282,463 *088028FB5A5CF5E86F49257AF56AB14DD9A5ADEE BOLEARÍAN
80,282,464 *088EAA64D3C69182CFD986482BC8621767AD47AA SOFTBALLWARRIOR8
80,282,465 *088258546597393477F85AA6758374BA1B4D28C0 SOILLESS
80,282,466 *08870E0E2BE7FF5E228E21A496600594D789F9A6 SOL.SEHR
80,282,467 *088CBAC21E11DA33147336ADBE1290B20249CBDB boortzm8
80,282,468 *0887E45243F9BDAA0662BE3343E2372BDA92B2D9 BOSSÁK
80,282,469 *088859A03EA2F28FA9C99920AE6BB5EBADC2A6A1 b:)qd
80,282,470 *088A6B43CC163DBED2905EADC98510559466A1A9 SPANIEL'D
80,282,471 *088EC34C274D8D7262C24DCDCBC93D10CD347C26 bq_&p
80,282,472 *0882DF43398EB25225D71A0837E82951FE4FED0D BRANTAINSCOUGH
80,282,473 *0885B05AE8DE7F1875307D3240C244EFB4EC6B06 BRANTDOPLER
80,282,474 *088473ECD02C3E966877ADB4AE2B6FD1623DACB3 BRANT.UNDERKOFFLER
80,282,475 *088E043DDEE92C80AF1E018CCD92995EBD843AEF [email protected]
80,282,476 *08850AD94E63634E6738568E97F1E6E2D5D7DFEB brendangannon
80,282,477 *0888E0A37D431057DFE96D1F92AEFC8F0AAF9383 [email protected]
80,282,478 *088B34671E7C2B7C6A800483C1162E55D390ADEB cu,m
80,282,479 *088AA2E0EC4C7623F289325D5386DF2E606C90E4 SQUADRON-401
80,282,480 *088CAD40B6C5C5D9DA32651EE5B595DFFFA1BA50 CV4EI
80,282,481 *0888A021B4DD58D28710A1AF5066BF1BE6F746A2 brunostartup
80,282,482 *08812D0D4375C9FCAD91640DBCEF8458B4C4D297 brunswickperth
80,282,483 *088D4DB774053CD9147FD5FF08F3488EDE91DB58 stanwesten
80,282,484 *088F5FB4A3B377BF070402E353B95AFB2410488B cxw)
80,282,485 *08813204469DA58DD105D0675FE1AC9AA68D7BEB STEPHEN OLA
80,282,486 *088D91FC88CC17F853C3439B7259D61A7BEAE4F2 bu-c)
80,282,487 *08847A7A92D2953329BA6EC00DE5BF7E6B32F6CA BUDQO
80,282,488 *0880F792A508934E81CAEAA33D2644AD6C0448BA D117963
80,282,489 *088BCE05C4F85C77E73ED4767158A77476A2AFC6 butzy7
80,282,490 *08886B764F30ADF4AC6B9ED3AD05AA876CFD12D0 STRYGEEGYRTS5
80,282,491 *0881E430A22F07B6573E784B56F00DDA9DF1EB25 c31)"
80,282,492 *088FCFB3909952F7918DB71C59D65877DB0D6917 ***d#####8
80,282,493 *08832F7D2FFD88A297D2C2C90A387A46C41EFFD4 C6AMB
80,282,494 *0885B21F4394DB66198CF5117CCD96A8C8CBA83B DAMIEN.PANNELL
80,282,495 *08809B51365BC6650D0AF657F3C0F7DE51F2AD51 dannienobile
80,282,496 *088619DA58A520A5C5071ADD58117317C6E117C3 DANTEBRUNOT
80,282,497 *088DC7C4D92B27D31F404E3AD8D92DD70108C1DA [email protected]
80,282,498 *0883E5AFA762E041CC40C8228C8BB570F177926B [email protected]
80,282,499 *088FA137ACBACC2C5B29339C356D071F2F8D1526 DARNELDA0
80,282,500 *088B9104534CA31AD2C7AE8988385C159B962E1C SURREPERE8
80,282,501 *0886312AB589AEFF55B3E138E2CE14F943160FEF SUZANNEZIMMERMAN
80,282,502 *088FD8FF0B7848BAC897CFFBFED25CAFDF9C24D6 cal.hicks
80,282,503 *088EF7C920BE1201FB2EC93949D1FD2FAE54B3B9 SW=C
80,282,504 *088F6E3BF2B815E9288C4318BD2CA7EC378D9EE6 DASHORTS2
80,282,505 *0889B6B54C1815C5B4D631CB31A9079DEADFE1AE DAVID DAMARIO
80,282,506 *0883CED36FCCF402DF90EDC0AFAEAAEDE989DD8B cariages5
80,282,507 *08858F3E1088F2955F024E3E3C7BA43009D453AB D.B!
80,282,508 *088012BE2B6EEEDB6191CC8E9DC08987AA62F7AC carsonfahrendorff
80,282,509 *088718C245544176E98BB05F7F00147CEC3E2D79 dc$a%
80,282,510 *0881AB12201E912D9C11FB95B9E88EBA6D8A0B99 CATEGORYRETAIL_LOGOS
80,282,511 *088A80D398028DF733775A92DA639FAC274A8361 SYNOCOPATEDLULLABYE
80,282,512 *0887F673FE081DF6139A8F4B2568FFF252BCB1BB DEANDRE.CHRABASZCZ
80,282,513 *0888B21F9FEA0C5DAFE74E6F3B03A98F2E048344 SZAKACSZOLTAN
80,282,514 *088F92279A6E9F8C04FF214A78F04659FB6577AC DE BORBA JR
80,282,515 *088C107515FE11545B88A58D0D58BDA2DB48A662 TALKUSERFAN4000
80,282,516 *088FF12B5852D91B4CDB837A3B21D325139048B9 TASHAQUEEN
80,282,517 *088DC0A56356B9FE214987CD3E828CE9A015159D TASSAKTS7
80,282,518 *08834A7C1FB2C55446E3D2E9D19DB263868EB7F0 CERVICIC8
80,282,519 *088A3153432C14FE600C5D700879D4EA86C70C72 tbol-entre-clubes-de-kuwait
80,282,520 *088D14B864940674A6F90A3AADBCB13D37D25A16 teatro.marquina.de.madrid
80,282,521 *0883FBCC71B07B6D1CCDC29788ACA9E443A1DA84 DESIGNATORTALKNORM
80,282,522 *088015F87D9E393469DBD746BB17DA7EB760D656 C/F+J
80,282,523 *088F21727040321C040D053B86DB7A4C7C82307E dewitthouck
80,282,524 *0889CBEB12915125F862BB7FF883E0AC44697BA7 cg$yt
80,282,525 *0886218C8AC713A2ECC5E45C8A8910C6CA27004A CHADWICK.JEANNOTTE
80,282,526 *0884B85053BE939D19C97E8E17C9FB6616CD0420 chadwickpetchulis
80,282,527 *088E11EAF0B0DC4D16DAA52DDC609B8BF58E401A TEMPLATECSBIR
80,282,528 *088277EB66580874721B33355C20422E5CC78EAC DFHN#
80,282,529 *08825E008409EA78B446547D01BAE0CAD8DE2034 dfyw
80,282,530 *0882DCCCBEF583C156AE31D4A3BDAF65ABA2E8C6 thaddeusdunford
80,282,531 *08875C942BBC536143AB54018E3BC4AC1838143A dg="m
80,282,532 *0885AD35585C1BE4ADFAF6916299C39DBB2C97F7 DI41(
80,282,533 *088E491A34556C6D417D9E8309515C369088F52E CHAS.MASLOW
80,282,534 *08855B28F733EE5DB2F641E5921696A99D2E7CD6 DIN4RST34U4
80,282,535 *088ABAD838D480F06849E7124F4893C360276E1F dipesh.singh
80,282,536 *088D0AAA9C14173C6CE0FC2121E0AA4860D1818E THATASHTON52
80,282,537 *0881786509866A4A82A09CF5C097706CAEDA5B36 THE AERIE
80,282,538 *088411B3890580C52BBCBF057FE3E836C81FAD7B DISTISTA0
80,282,539 *088D639CE67BAB33658062A9FCDB054A1F763E93 the-forgotten-god
80,282,540 *08869E473504DE7E39347C236B3EF03CC533E56B the-fountain-of-youth-dries-up-in-an-election-year
80,282,541 *08879236BDB4418D66B2A1D1AEF1ED0C54C7EAB1 thephilip26
80,282,542 *08859B24D52F1A7F352F67E3B6315B5539C31041 CHPN
80,282,543 *0886E099B6BF9257219383B81DC52E72528A3D73 dn)?j
80,282,544 *088ACB388A37B9C29CF661BE1B0CEC27473DDD6D DOBRODEIA-EVPRAKSIA
80,282,545 *088A7E27A8DCAB140DDB439DDC04BC8CC45279B9 thision
80,282,546 *088708C4BD5B92C10694892C564704AE1017475D DOMENIC.GEZALYAN
80,282,547 *088D39D8D16EA4D7985FB4010801435053281D0B dominicmarra
80,282,548 *088CEA0493F7558709FA1F6442DFA3EB5258ABCA TIENVIITTOJEN0
80,282,549 *088543AAAB7FF6DA04E73216D5044D94A5EBA89F TIFFANYINTERN
80,282,550 *088913535C23628580271C8F4EA24467F03BE0A1 timlesueur
80,282,551 *088FE66C37E56DA7E41536677B1CFDE594DF0568 DON'T TURN MY LOVE AWAY
80,282,552 *0884C486F66242DDBA208A558AC5B7275CCCFCFC TLTSTSRG
80,282,553 *08875D2FABFEA82D9E64FBD7972E0B53EDAE53E1 CLASS014800003
80,282,554 *088BCDDF2D4FA1A9ECA4D099521FB0C2C5F1DE9C TODAYDALLAS8
80,282,555 *0882212FBF84283628F6FE7AF5BD7BBB0A7A9452 claudioasp
80,282,556 *088290C1BBF97B4B969069C4C570A948F162CCBB TOM.MCCONAUGHY
80,282,557 *088E3750B9221565873261EC8D2450AE8673F3DB tommiepalitti
80,282,558 *0882B5B80859121DF7FDDA0A9AE070ADE42148B7 TONYTEED
80,282,559 *088AD3654CE7861BC454B05BECD143AFAAA9A4B4 torpedoabschüsse
80,282,560 *088E46B858EDF40C3843651544E0801FDB40BB13 TRAEFFER1
80,282,561 *088CAB01393CBCAFE27037C7CF4421F7A7744A41 DPQ7A
80,282,562 *08826FB1F4855C2E80A74049BAAF88059848E202 DR.MAJORDOM
80,282,563 *0887FEFF3939AD7828A1F09DC2185016AD68A040 trepça
80,282,564 *088FAFFF2FA138C9517C523CE8A517EC1B7717BF DRS24
80,282,565 *08854C8F7874C5B7B7BAB6689B057408B2299F61 Ds%_
80,282,566 *088A31DF615798C120F7B25F10923AB80B96EB6A troy.tuntland
80,282,567 *0883247217678B686C6E9A2A15FFA578D3D46A2E du!6,
80,282,568 *0889DDBE4DD2A11649895285C71AC2BD03EC21B8 tsikcots
80,282,569 *0887CFA44E616E40184123729207A3286A2435A1 COLTMA
80,282,570 *088AD6D2717BA3E2C507C74E8C548375FC0C3911 TTLIZZI123
80,282,571 *0889950B37D3220D5640C5D86F53BA478614C8CE DV3Q;
80,282,572 *08873B675D97D7AF276704C4BC1D2BD54E1144ED DwM
80,282,573 *08840CED9A7F05CBE8BE293FC678B0925C1457E2 DWZTR
80,282,574 *0880B0666ABAF865EB0C24400ED1824963288FF4 [email protected]
80,282,575 *08844092CF7B77556814D7A4681FB94762C33DA7 COMPAQCOBRA
80,282,576 *08846D2F80F8B3080C37157D7D47B21EC88C40FE TYOENJAELJEN8
80,282,577 *0889E178D3029DC10B52F354832AAD7C7BBFD8CE tyrellnaftali
80,282,578 *088172253067C0244468574B470CFA58949BE18C tyson-nicholas-coates
80,282,579 *088C70FF97449839F813C13A47CF56D307BD56EB COREYROZMAN
80,282,580 *08866E10BF12E74417A576ED674F4F1C8A3A2342 CORONEXING
80,282,581 *088A4093274E15BCC5ABEF55F0146D8FE7F9D0D4 cos-"
80,282,582 *088FA97621A11709DD368F2103EF88E1DC6058D3 EDGAR.SOLOMEN
80,282,583 *088D4FEEEDC49B7DB1FC80573AA2A2E7E6A2B18C C,P&
80,282,584 *0882439B5708BCFD43B4CA8125312C5DBBDA4879 cpb=i
80,282,585 *0885E6F0945B9E5C1036846040571C50D3ABF641 EGUZZETTI
80,282,586 *088C9FB5B946D1EF6EE949FF24F130DCD0FDE7FA cq+ap
80,282,587 *088E85416947D0FBC23083906DFD3333C935606D [email protected]
80,282,588 *088DEBBAB52BD9B8383581EF5C8B31AAC7375D73 unshunnable!
80,282,589 *088E3BCAF1B386D0E764277C1E0648ACAA1EFF82 ElectricLadyland3
80,282,590 *0880F160971828A57FC07B573082EB1D364F8556 ÉLETFELFOGÁSÚ
80,282,591 *088C7E33FBD56C21A1A3A5D9263FE44351F3EB2B uploads
80,282,592 *08846A759025CDFFD03FF74FB8F2015D3FB19961 US5322
80,282,593 *0888938DB3CFD20C42A0C69E989599D474D8B173 [email protected]
80,282,594 *088487A96C83043AD27F9DB7E44396FF121D1685 elkciped1
80,282,595 *0887C5B867C0FD9603A64E021D794C64A98FB716 USERXOLVER
80,282,596 *088E1D47CB029DE5AE2FFD5A30FEF28776119E91 (ELLER-L{SANDE),-KONGRESSDELTAGANDE-(ELLER-ARRANGERANDE)-ELLER
80,282,597 *08838C5C65451B607810BAC23434F8DD225F1663 ELMOWICKSTROM
80,282,598 *0884256CF591BCB65AD28F726CDCC3614E631057 eltonborchers
80,282,599 *088785373F3DFF5F3FAE6A3C4861E66302E0ABD1 elve
80,282,600 *088B2005163D64C724410690BC20E81DFAF9D256 C;,w
80,282,601 *08829F20FFF3EA83CEFCB8DF1C0C4CAA04AD080A CYHV5
80,282,602 *08882AFAB201C50922FD8EDEAEB89FE11788922A D0EU
80,282,603 *088BA4107A1DCD90CBE30EC0D94453A58DD30E70 vanillabasketb
80,282,604 *0882CFEBCAB3ED9313548263222893B2840FD1B3 VAUGHNRUPINSKI
80,282,605 *088DCB6A149066B727508766EAF1D621D62C2CC3 [email protected]+ngly
80,282,606 *0882E8DE396461051CB1C70C8C9984BE1BADDA09 d"5gl
80,282,607 *08827E3EE5418FDC0F21C3C4E2F1CC4BD17B2C78 er[
80,282,608 *08884D3D94BB5F1B24FE64344D40F577BE2EB43C ervingrealish
80,282,609 *088E1A2C76867329C552FC97A90E40AE4B4B30DD DAN.DOMER
80,282,610 *0886950C61279DC7199D250C40000927F27CA1C5 DANIALBRAMSON
80,282,611 *08893D13930761390B7B385FC875F1B1AD16B6C1 ESSECIDED
80,282,612 *0886BD070957DC740D9555189FA494315B52737B verperso2
80,282,613 *0884D735086EFA0B7817B53C9A6CE08217F1BBAA ETHAN.COFFEE
80,282,614 *088599A7F490C071BDB639BE201F9462FE179228 DARNELLDEMURO
80,282,615 *0888DF3CBE18D363FDDA8D61A513F107D6086EC7 DARNELL.FARRON
80,282,616 *088085933CB43CD362C6D93C5AF7A2CC3049E0BE etl;
80,282,617 *08855A45B0CCDF52C41B5D6D45F98B909D0F3E61 EUGENEMAROHNIC
80,282,618 *0889D8E0487EB1C90FABD45D8AFF94BE3456D474 DAR(S
80,282,619 *0887D5BE6F34328CB8A11F373FAAC1D5756E4E12 VICKISCHULT
80,282,620 *08868B8EA622ECAF8FB9B7C0949C7AA9FC17D10B DASISTIHRVOELLIGSCHNUPPE
80,282,621 *088955467742EFA55B51D9A154CC5A34E2F95DBD eurc1
80,282,622 *088D728ADCF10678CA941E07745797E8D6BD7B86 [email protected]
80,282,623 *0882210C54FC64C54D8DE14DC38837492E3CD4F5 [email protected]
80,282,624 *0880BEB70BAC0A9AA81333B5D73250733229B482 db4ay
80,282,625 *0886F39B9D64C25E0667B6C720D5C4795C9566A5 VILMANUNEZ
80,282,626 *0886DC9269C37C4BC48A42FBB9B9195D945E37F8 VIMONNART
80,282,627 *088D176E6FBE3340D3911A2C2CF68DFCC1CC39C2 EZEQUIEL.ALTOMARE
80,282,628 *08809004092F6C11EA3C09BE10D1852425942EB9 vincentdarley
80,282,629 *08839F291F8B834CD564BDF480959DDFD3C40425 VIRGILMUENZENBERGER
80,282,630 *0881CABAB2CC191DD5EEE1F4011638A29CE44650 FACTBITESCOMNRPS
80,282,631 *0883C169503E3C5FEC4EE9850B3A3FA1D709A5FE visa2007-showmethemoney
80,282,632 *0886F0918CACFA84056B6F3337CCFE01296ADEB0 [email protected]
80,282,633 *0880F8F512236923FDC152BE54B95FDB34B562D5 deathmatch-with-maihem!
80,282,634 *088D49691CE7385D802E4671265E32049B5E60E7 decidendi.
80,282,635 *088A4FC887CB467D30B3EA3266EFC76E8ECF44E4 FATIGUESCOM
80,282,636 *088E4D9C6E9FD9A8C766C034774A1787895F18A9 DEK3Q
80,282,637 *08828479E6B1EACEC693E48E377C3B478620FC69 VONNIE HINESLEY
80,282,638 *088F79AF7D12526C592F7BC823AE9DD87DBEDF27 DELPPOTS4
80,282,639 *088A13B5EEC9009932D9D7A0B96BE742137063D2 (FEAT. PIANO: PIERRE-LAURENT AIMARD)
80,282,640 *0886B74D60F4DD9C1639C4195003F41632C5F157 VOYAGEREEYORE
80,282,641 *088376FB2566F7F5D925C2AAE4369C04CBC91F80 [email protected]
80,282,642 *088167667D86D888FE861C82A4538D1B94F6221A vttirli4
80,282,643 *088561DAF13137C8FDDD7D244A42F1FCF92CFEF3 vve5
80,282,644 *0880EB70017194DF642C4C104CB63699374FDFB4 VZ1D
80,282,645 *088ECB93888D379A58284A334A674EEFD918799D deserved
80,282,646 *088D66FA5B9D86513A840EF0402CB492F364D223 FILMOGRAPHY-START
80,282,647 *0889BFFB4ADE47D846FEDDF99DDB5E2D73A20BC1 devreese9
80,282,648 *0888F3E59EF67FBED303FFCF9969C34A89CC4569 [email protected]
80,282,649 *08864452B3C108ED032D2CA69172F4F3EC98E26D d$%&f
80,282,650 *0887572216F1A83AA9B5D63CDA53A464BA520220 DF3J.
80,282,651 *088A80CE55B3D6B9AECAC08F1F51B18991D60D9D dfhk)
80,282,652 *088DCFBB131F16E419CD399AEC4F31D169716525 DHWK4
80,282,653 *0881D9204EA95334EEE033F97650A3D75FA1324C DI55IP4T3R5
80,282,654 *08814766160D74647735E894E3011FDCDDB87D2B fosterlivengood
80,282,655 *088DC4566DC4696437328F97C9A1BC968CA4E713 DIGITALJUSTIN
80,282,656 *088F3630F2DF2E0554D13A77A5C195BF030FE3EB DILARABASTURK
80,282,657 *08889A2FBCCD366C8E1504F79C1FCD075673FE5C FRANKLINMCCANDLISH
80,282,658 *0889F28938F29AD9EF002438AF767437C9E46555 FRANKLYN.MADINA
80,282,659 *088DC40466A97760189945A1D2AAB0A4ACF0E106 FRANZ-PETER
80,282,660 *088AD7271773FC0504DFA08628768FA523F95ECD frazetta-1-0
80,282,661 *0883BB164667864691E9D93DA440F67E98101272 DITIM
80,282,662 *0882C8E21743B6AFF185322EC0B462CAA41FEC7A WENDY.LEA.GRANT
80,282,663 *08836FABB2B36AE4D827DC21DBFA27B848B2E481 FRMNTRS4
80,282,664 *08869C0F5886F8E93487301CE8367C98CBD2709B frutinha
80,282,665 *08830EC185466E2A5E17A5701473468FB82A3B69 DJU3R
80,282,666 *08850C01A078A8BB3EA952FE534D0AD03070E59B dkm,
80,282,667 *0889D0995350797C77601B173AB1AC8480647927 fv=:
80,282,668 *08865718774B52036FA0359F3C64994B1C97F37B GALENCHHABRA
80,282,669 *0888F88B95D8D41655C72B678D8F91485232420C DNEMEROVSKI
80,282,670 *0880D19B94B39068232A6327D0A529B3A57C3374 dnepoltr5
80,282,671 *08846E004B9B6388BA8C34C3210CCB77FD2E8DFE WIKIBITSJS
80,282,672 *0888719F14964BFE9A5D63327F9886E625759DC2 DOMINICKBELARDO
80,282,673 *0886BA9C012E503070541B0AF72DFB795F682CCC DONNELL.TONDREAU
80,282,674 *08854022DA601A6608EA7FEE6D776DFF5288AFB5 GEMMAFAIRCLOUGH
80,282,675 *08877F84623B19CB652297046F143B42176B33BB DONNRUSSEK
80,282,676 *088BD5D7A1010B00F30CFE0BFB488F90648595EF GENEDONATO
80,282,677 *0884DAE46B2D23482CB741B398B18A5A5BAF855F GERARDFIEBICH
80,282,678 *088D880D7C3EC92767F268778635316D06C27786 GERARDOATHALONE
80,282,679 *088951B54AC31369C979DF2D044AB0529C64BD9E WILLIAMPOPIK
80,282,680 *088932D9342245325FD99E730C45CE147A84CDAB WILLIAMSRUDES
80,282,681 *0887F557BD6A8CFC6A11CC8C7E1E988C36D2722A williantonsil
80,282,682 *0880744A7D32096F223D3E831FE8903E9B3FD94E doyleduchemin
80,282,683 *0887A869CEDB000CFC6D1C440491458323F067BD DP9$E
80,282,684 *088410A1246A5CA477FF18ED6EF60A2A12F3C3FE windeln.6
80,282,685 *08838E0A79C24B885F5A31EE0000D71B38D058D7 [email protected]
80,282,686 *088ED16D31D1C18B8C6DD6F3B213FCB0713B7D5C D=QE
80,282,687 *0882C71F5E04878BE33F7185A9C200B9169AE270 [email protected],
80,282,688 *088BAE6DEFE804DD773B11AC174954C91531312E wołogoskie
80,282,689 *08878F0367DA43EBCC350A0D10BA256329913D39 GO_E
80,282,690 *0883391F809670F7987C33337616755F7F4E76F2 GOODBYE TO A RIVER
80,282,691 *088AEF2F4C7E3EF70330398CBE8347F3471C09A0 gracieuse
80,282,692 *088B4AEF5609ABC73888890E3FACEF8038B49424 «grant
80,282,693 *088DE27CCA8D22B0D496C2DE1FE4A1A2AB57263F X203B0
80,282,694 *088B042E653CE9DF7F1849443329EDB27AFFA3BF [email protected]
80,282,695 *0889E59B1736D1341D24404CCAE852DC49D867E2 DUWL
80,282,696 *088D919EAFA26C9A711E87B82590BDC1B96763C5 [email protected]
80,282,697 *0889308F688F0839B80DB301BD84377CFCC71A1E XAVIERJANAK
80,282,698 *088960FC62D1CAC3DC7F1C0BC7DC4356C14BEC9D grcltrsts0
80,282,699 *088710445629CA64D9816DC96305BFA7E72CD272 GREATSCOT
80,282,700 *088C39110C7BDE5817A0FA8C6C23889958211E31 DV!WV
80,282,701 *088E67F1483F56900D5DD2A636A0B6B6621F0D11 DXBV
80,282,702 *0886674B537460740315A5A5768F4BD0305BC761 guerra-hispano-cubano-norteamericana
80,282,703 *08887F3CF46FDB42539E12CF1E1D7103EF357B0F [email protected]
80,282,704 *0887AA275E31302D3CFD404A5B05A433AEED1A0D GUOTINGS
80,282,705 *0888E930A1054CFEE50F4E4EDAF70092C4DA8BFA gustarzia
80,282,706 *088C0C6C177C6C9D8C4157BF4E85F2633EBE7307 XXXXCGJ9
80,282,707 *088D710F926A5DA339B756EFCD526821A1BA4CFB [email protected]
80,282,708 *0886AFF39D37C33CB2C534EE1CDF5EE1126B87B7 GWAANAKJOGJAKARTA
80,282,709 *088C35A7E5F658FB3F7C2827D0E3AC5D1ECF860F dzffd
80,282,710 *088291857F7A5D13FE3B63B09EF50520C565358F haematobranchiing
80,282,711 *088D3D2F4581D2E6EAAB49899D8B9AD69A14780D YANG-PEIMI
80,282,712 *08884118FAA9A3B1794A64F5416B980A61D07BAC [email protected]
80,282,713 *0881528871DEED2F773C41EC437477E7F8783BA3 hakkene5
80,282,714 *088C83113953BF2348ADAB94DBA71085F2290E8B EATEMECA7
80,282,715 *088C7AE241CA0AB3406F13011D82E9BF331F9AE1 yasseralajjouri
80,282,716 *0888003200704FD3256ADC089379EA5DE7CDE2A8 HANKCONTRERES
80,282,717 *088160E97A110E69D4D7390FA7F07E09E2CC29D2 eb=t
80,282,718 *08897C062BAABFFD3A10696BE71253B0EBA15C6D EDARITER9
80,282,719 *0884430209BFE77E4EE36E0B1BB1EAAC9850051D HARRIS.TEMME
80,282,720 *088CEB125A22BFE02816445219282CDC9B07F6F1 EDDIEYOUSHOULDHAVEKNOWNBETTER
80,282,721 *088140B33A6A71A04647278117271C337D9AFD9A harveyroberie
80,282,722 *0886E70A888D9C60427D5A1AABEB1FCE06A30A60 [email protected]
80,282,723 *088589418097D6C8A345685683BEDA280BE8CA0D HATZELAND
80,282,724 *088A3C0BE5A39729F8F0078E3FBA653405BDE02C ED%M%
80,282,725 *088682F21D890CEBFBD63176C52EBAD959E29488 EDNIVNEGGED
80,282,726 *0885E3D65FAC62DBAFD47D5BAC7549C83DBEBCE7 hebudas2
80,282,727 *08824A02DA879CC4AB85EC1EAFAF50028EF11D99 [email protected]
80,282,728 *088E9331F2EA1700EA97B95B3D2DED12A5BE92A4 YONEYAKAZUO
80,282,729 *088DA4137E42C99B997C2AF847B7521D9972B3D6 HENTO.KUISKAUS
80,282,730 *088CBBDFE1339AD4E2037E3EFD4F881EEDA90E30 you hate me & i hate you (public animal no 1)
80,282,731 *08840FE7649B5076EE4D1FA8C6E113055E3FA0D9 EILOPENN4
80,282,732 *08891A76017E0D82B55BB081FDFBFB93395F9ED4 [email protected]
80,282,733 *088CA75762B9715B9D56C5F752D7DB41C2BA8FF9 [email protected]
80,282,734 *088963113BC36725FB0AD26745A4D910B9CD068D [email protected]
80,282,735 *088170A99D7B2E7C4028200BDC7D7CCFE06C0B28 ELDRIDGESHRODE
80,282,736 *0880001D9537596433ADDFD04FEFE8376347C938 ELLIENOVAK
80,282,737 *0887B6568B409B6635AB4692CB532F269A14C44E ELLIOT.ROSTON
80,282,738 *088D457DDC91FCC7E79C529B6781E75A77375EB3 HINGE
80,282,739 *08813B9C340EC68D91C3DCD8757A1D43C73767C5 [email protected]
80,282,740 *08833AD93C23BB3F1BE4A569500657EBFCF91AFB Z67D5NO8PX
80,282,741 *088A5701E87F5284951CF45D3DB6FBED4A5FDA11 Hitler..menschlich.gesehen
80,282,742 *0884CF6DAEE602D88B77BEF2E12741166A7288E1 zacheryhsia
80,282,743 *088F3F34A4A58D5276E4E1DF63A1EFEB6C898609 ZACK.ISRAEL
80,282,744 *0883AB81240D91D92256D38982DC5D2D8B95F77C ZACK.NOTTE
80,282,745 *088E6A086E321C89C2D505184D7EAE4A2BA99B21 elnegnemed
80,282,746 *08899E226D8828A087C9D09A0EA45A2C8CDD097F ELOSUAEB6
80,282,747 *088EA39BB17AECB95C9E0E2F53BAF3C94CC026F6 ELTONSCHEMPP
80,282,748 *088E2A6470F3C21123A329D06B024F261FFB204E ELVIN.SOLAK
80,282,749 *0887E639FDDB334F2AEEC5CFC1787A0C9A39F712 ZAMAHNEM6
80,282,750 *08857626446044D523711A32B619B06351C7E22D elvisminion
80,282,751 *0888FCB8CBE66F27433499072E70461358D07129 HOGJ4A4
80,282,752 *088FC20EC00B0B46C1F5BAE1C54C6DB4ECA29B62 ZASKREHOTAL5
80,282,753 *088A4CC8C362B2DB4D6EEE77DA0FFD3BDFCBEB0C [email protected]
80,282,754 *0883DDEE0E9D99F40FB6FCDB603C132F06AFF761 [email protected]
80,282,755 *0882444396DAAC406BCB0493E7AC7E0BE1D6C08C zen-gaia-chan
80,282,756 *088082C67549606A4BC49BCEF69B3A23A99AC84F HORT-33
80,282,757 *0888C441EE3BA12932A52B8DD34D1349AFAA0523 EMORY.MICHONSKI
80,282,758 *088F2C1F4C5AE3451937EEFA9B99790885C955D7 ZGHYAA
80,282,759 *088F7E33039E89164887E9F00E72E0E5636D0FB0 EN6917912640
80,282,760 *0880ABEE916404B336DA12F947DA1E997D418E87 h+u%
80,282,761 *088BF5A6BB2C4B12B036E820C38A208388BE5B0B hubardium
80,282,762 *088ADB90868904EF1A1D05D75C42E7CFB9995567 [email protected]
80,282,763 *0887982D2F7DBF994F2DAE3A8F37ECB9E5EDA28F ENKONTOSED
80,282,764 *088D4EA18764FA21889141F6CB7F7EFA1492572B ZHUDEMAN
80,282,765 *0886F816FDB592C46CAE817AA1FD48FB59CCDD43 ZIAD DOUGLAS
80,282,766 *0887E709AE8A06D73D6ECC2F34EF509AE9778628 ENTERCOOL7
80,282,767 *088CB9B912DBF1B65EFA23B6CD9C48AFB1A2376E ENTRECRUZAREST
80,282,768 *088ACB0305BA47DCA6FBDB349EEF54A6966684F2 EQ4"V
80,282,769 *088891621C09B73BC9077DAB68100CEFBF1FF3DC erfahrener5
80,282,770 *088C6BB0A2C0097CF4AF35BED7798C8DDAA62751 ERIKA736
80,282,771 *08820F171FD8FC462227C6C374C1293D6147E92E hylmrphst5
80,282,772 *088F27A6987FAB561F131391110C08A618C20D86 ESTORNIL
80,282,773 *08820B5C05C126421313709DA87FB4B607ED3056 etterlate
80,282,774 *088629B41FAB0F5836C981754F8A50CF0EEE2FBB etwbi
80,282,775 *088FCE4679192D13D37EA1951E52C0D41D19EBF0 EUGENERWALLACE
80,282,776 *088CADCFAA39A99076842B47661EF8FD5D892AF7 eugenevaruzzo
80,282,777 *0881D16B9BA2F094C5C738C57F5F7B34564C2A27 ID8016
80,282,778 *088DA504F8A1B38F623A77AEAD8986DB1AC054E7 EUQINAR6
80,282,779 *088BD378C4C4345B75CFEBE1B57DCE179838D9A7 [email protected](
80,282,780 *0886504FA8D0DDF6A4BA086F6681B527FE22AB61 exilerie
80,282,781 *088922E6F359910116B8E4C7DAC6116331123EFB EYTHO
80,282,782 *0887C4A4EF871BAB8500E922951A885315C6EAA3 ILUVCROSS99
80,282,783 *088AB5A171F304014C89BCED108DBAC06FDF3435 «ририка»
80,282,784 *08888E95C07635DF09E62DC23FCCE690714311D7 FANTOMPRINT
80,282,785 *088BD9C20BBE979A1F5CC065432438A636EF838C FARBKORREKUR
80,282,786 *0880EFF7FD3DA1A4F4C0BF5938EFC510CF313783 СІМЕОНАЎСКІ
80,282,787 *0883E9F948E4619DC0C33C4009DB42F87FAD6207 [email protected]
80,282,788 *0882846DA474ED1D6715AD208FDE7948DCFECF42 FASTHELP1
80,282,789 *0887F604EFC5040DAF53BFB44E42A074A66C6106 [email protected]
80,282,790 *088163D6E765B838EAE97899B321A0BF94FC6A79 ingelri
80,282,791 *088A85D03AFCC128B4A26079FF8AC8EBE53F56AF fermingonda
80,282,792 *088EE7ACBE90641765718443328F21B831703991 IRENESAUCEDA
80,282,793 *088515598F57F77C4A7E623C0F513A8FADE85C9C IRVIN.DUDIK
80,282,794 *088DFD9EA6693CE4AE81910682E41626B165372D irvingheindl
80,282,795 *0881FE84200CDDC5B51CA98E8125FDF3C169D5E8 i|_s
80,282,796 *088BD23362133D6B9C827DACC6106CDC1F524DA4 FISGONASING
80,282,797 *08880682AD1460FAA28B05DB956ED0C706323FD4 FLASHJEAN3
80,282,798 *088C6726A2A618DDA22B612DEB33E4DA5C8EAFB1 fletchertrillas
80,282,799 *0888FFE96141E8C83406B480A9ED0CBFF86B6197 ISSATILI
80,282,800 *0886A25CC1023CE98F34F3B0CC989B8093D78153 ITEVPYXTJU
80,282,801 *088D5B9D40F8E90D4E38C2B834C882D32F6AE041 i.will.buy.you.a.new.life
80,282,802 *08862AFABE271D3ADA3EA718A3B82374159D597F jacksondinkel
80,282,803 *088851BA204A816DC42BC46EF1671F4BAEE5E8A9 FOQXAA
80,282,804 *088E9D417005254B5D0128B191C63AB0680BAB75 [email protected]!n9
80,282,805 *088FE97206DE292A9EBBEAB95284F513A73E3217 FORRESTVOUGHT
80,282,806 *088BF5D486759D9231102F43A90A71F5D5806AF8 FOSTER.MORY
80,282,807 *088474E5ED111A554D74400F43AC855ED680CDEC JACULER3
80,282,808 *088EDA8DC7032E896A82507289C58802A17F71C6 JANTHAKUR
80,282,809 *088848EE2C7040510CCFFB7E25CE13B9FC9319D9 japan(2001年9月21日),pacific
80,282,810 *0883D4C928B1C5A459B22FBF3C5754D688AF0D50 FUNK2518
80,282,811 *0889892A9BA518565B2CE9FF65BBCC7412EFA5C2 [email protected]
80,282,812 *0886167F7A8C9684F511E6DCC3BF605F2439B713 [email protected]
80,282,813 *0882DD5036FF5C995CF659BA2F5BDD624CAB862A JERAMY.DOBSON
80,282,814 *0883B0CD9F0226584ED678F15188D7CC9FAE7295 JEREMY CHARRON
80,282,815 *088EFF1AD680E993B9B9D6AF2F175F0ECDBAB616 jeremy.lardy
80,282,816 *088A4AF2BBC749E1D07AE990BC3ACFF0D3FA1DB3 GABYVALHALLA
80,282,817 *088446CFD72DCB200DA8D06BF4DC60109123FD7D GAFFELN5
80,282,818 *0887A6920ADFC7AE41D0C839B26A8250B6CD3F0E gargi.chattopadhyay
80,282,819 *08839E16391B57DA00AE999C3960A2D14CBD2E91 GARMIRED
80,282,820 *0880C9A17B39680243A8C179EF3E6E89B619E362 JESUS.BATEMAN
80,282,821 *088A518E3D96C27A0A5934C7156A4A3FDC5A3F63 JEWELL.MCCRANIE
80,282,822 *0884E71C5E1E3D812DFC53CEEE94E2CDB6B01281 jewelrichwine
80,282,823 *088B56BBD58DE818652D5B4CB83D8EF6C1C8ED88 [email protected]
80,282,824 *088EC024E608BA55F7AE45DE77AF7DB071C18D16 GAVIN.BATTISTINI
80,282,825 *088871948A07306E244F1E149BD610EF94DAB4FC gaylepijanowski
80,282,826 *088C26711C5A89D98B47BDA7B81ACB2CD4917014 [email protected]
80,282,827 *0885950D23F001B132C3A7469651ABDF2510CF39 JIEHKKEBAHTA
80,282,828 *0887078959B560FC67F8CA4ED30A32A0856BEFA1 GEORGEFORTE
80,282,829 *08815956798D7FB415DE09DF4C9D727AA962D493 georgezentner
80,282,830 *0881F8D3CDA1908EA920BE6036834ADF31461CF3 GEORGI PHOENIX
80,282,831 *088B976FBBFAEB634900F9B4A8E6010040BB6E0D JOESPH.RODY
80,282,832 *088115797EDAC83E5BBE4D14B47808ACC6B655DD gerald-pierone
80,282,833 *088E14BC38BC46898B386E760BCB9BF824EC6883 JOHNCARSEN
80,282,834 *0884B22AECC0DA20839AAB7B2CA60CDE9A0CF6F1 germamas
80,282,835 *0886E954A7C676EC840D3742BE7CE7B9977C0839 gilbertwessling
80,282,836 *088DF58FFDAB92CB5CDDE0CC28BB39C439B7D2D0 JONPASCHKE
80,282,837 *088162EEF1E076603F912317F960059F73117743 JORDAN.FALENCKI
80,282,838 *0887A087A656CB5B6B52ECDCD9AE49DD7DC607C1 JORDONMONAREZ
80,282,839 *0882DBD0958BD2BB01D5F6141FDBEC85F135D036 [email protected]
80,282,840 *0886A498873D46D332DAF87731EBD3A4874BF0A0 1153528 pk-yr.itysten.syntyyn.vaikuttaa.negatiivisesti.my
80,282,841 *088D2BAFA378CE54D0A69FEAF25307DA05971092 [email protected]
80,282,842 *08829E85015A14EE566A62F50873E5C415CAEF6D glannex
80,282,843 *08856DFD83663D7A17E97CAF7F76D8A523D0A516 124421 eronan
80,282,844 *0886F289D1A322863EBB7BA1258FAEA03E36937D JUDE.RATTAN
80,282,845 *088D6A1BC89E1410362A36A369443830F338298E glodytal8
80,282,846 *08817AD387643574631F48B1E2EE858C7E07ADB7 g:m{
80,282,847 *0885318F9006604FAFC6F05580A4CD31587B938A JULIET-LAM
80,282,848 *0888781C3F19ED4BD6E576D4272FF4D604310679 goldtrade
80,282,849 *088F3FC66AA51ADC995F6ED7D46B6DDF1226FE53 14JAN1498
80,282,850 *0881701A24A9D07BA4ACA7BF6849C15907FA597F Gotta-Know-(Your-Name)
80,282,851 *088B3BCAF3FABAF9734317742F301E4FF7B20E09 kaorutomisao(ii)[kaoruandmisao(ii)]-pfversion
80,282,852 *08884300FC37676170427D99CAC97BF9899035D5 16days
80,282,853 *0882AF3FAB97AC2AFDC8E86906A86C06661EE040 Graphiez
80,282,854 *088F6BF73BD2B22EFA768A7D5C730E3EC5444D55 1840—1862 ГГ
80,282,855 *08881AFB81A5AB21CA47CA7DABEF0204BDAC0942 1841005 siksi.kivenn
80,282,856 *088C1D3E785A98B010ECAEC39E6CF86D6D98398A 1907357 NOIN12MILJOONAAEUROAENEMM
80,282,857 *088626BC89E3514006397986F1149D8279A05120 katrinagodwin
80,282,858 *08820ABCB9C51B8DF2C66174ED5FD6E5E7393886 1ALEXCOCO
80,282,859 *088C26F9C7DB2A72A0526DAB8782AA76BD81839F GUADALUPE.HIPOLITO
80,282,860 *088899443B7704C314D9D7DF8189BC4F79A763AB KELVIN.PANKE
80,282,861 *088AA7CC666F49DEA5DCD4FA643D71A6BD0BDEA0 1asiakirjahallintoyksik
80,282,862 *0885E2C65D0BD491BB7EC6E073717279BE5A4A7B KENHETŐRE
80,282,863 *088B772B3FD01EFCF701844383C65E8CEECC3BEC KENNYON1234
80,282,864 *088A3FCF0C93C4A07BB752C0A414B962B5A6C47E kevenhooper
80,282,865 *08850B289FA9038D5C0E3D5FA945D96C1073D40F H3CT0GR4MS
80,282,866 *0887B6E4320C880B846354C18D91C6BB5A31E6AF 1ETULEIKKUREILLA
80,282,867 *088071D00B1A851ADFB8152D2B3078FBD3CB1E91 HAGEBUTTE/N
80,282,868 *088A79BE7729B599B0CD40DBDF6E663DE7706C17 1FRANCHISSAIENT
80,282,869 *088288E45A7AEB66071D48278BAE1E3B8734BF12 1gerechtshof
80,282,870 *0882EA1E60AA3DE11AD46328262AFF61D12F6802 [email protected]
80,282,871 *088C8D517FEA361FCBEC102B726B5E59916E08B2 KING.HUSSEIN..BATTLE.OF.KARAMEHJPG
80,282,872 *08891182B0BE73E63F77A17D3350C7CCB3134369 KIRNA
80,282,873 *08818D2A4F9E4BB556C3C12278C383D454D40F77 haydenouelette
80,282,874 *0882A4A4766E58D81BE5AEE6F9D9E0B1B75872E0 haywoodfurna
80,282,875 *08824771FCD821B46B2A384E618E936DEC05D16C KN-2USERMUSIC
80,282,876 *088652EEB6CFB4DC0335ACE23FAD213DF496447D knbaatjv15
80,282,877 *0880E2BB1628302148879295B02755B16DD7A283 KONIGSFARNGEWACHSE
80,282,878 *088052ED7CB47215F8788C5865C5D5C837CD3104 1Olmege
80,282,879 *0888E702963C11E34501972F0646F187B5D3DE82 1 OUTDOORSWAS
80,282,880 *08824B469055B4C0BBC645A5BB28F4DDC8DFA128 1 OUTLOOKCLIENT
80,282,881 *088C2F64D0825E16431B999B6CF80B4034B9993C 1-palkkakiistoja
80,282,882 *088B1E9980B6671245D2AF403A8E37DD38783E6F kris-pearce
80,282,883 *088E3EB9730C79F31EF9A8EE5E2ABC435A8E570E kristen.annette
80,282,884 *088913FD040DD9155ED4AFDB996BDE9C2736AC80 1STARLENE'S
80,282,885 *08891D99CCA34B500D82BB7C369EAA18BE04F43A KRYSTAL-KINCAID
80,282,886 *08865D3C8D0BCA758610F609EE600D4A2DD0D1D2 helv-chim-acta
80,282,887 *088AAF10B83511FA5D5E8604C5B1D0A7F5E9CA20 1tarrapalojen
80,282,888 *0888D17EBF383D5DE9FD4CA8D4D629AF2C41C7D7 herbertbollin
80,282,889 *088C48B8BDFC31A6EF8D5EA9DDFCC9CDB7622776 1.TUONTIKIINTI
80,282,890 *088B2A4CBAC353421533AA736884CC5F17E63349 1 USGELDGEBERN
80,282,891 *088AD93DC8B7E3B6370B836EC8E06EFA47F20830 HERZZREH8
80,282,892 *0886A3915B50E3EEC95B64FDC506CD7201DBD9E3 の2000Eの価格1
80,282,893 *0882AB48DB2F8353AF66B731479E8088F68EF60A high energy trance (disc 2)
80,282,894 *088C41C10998C90C63DE704C6A6DC44E20CC8D45 2061422 NUMEROTVOINIMET
80,282,895 *088CCDA0968020641B6B365AC3345A99F7520E6E HINZUZIT
80,282,896 *08806B3C4596246DC31E64CAB4701AD2BDC1862C hippiaik5
80,282,897 *088DE0B9463AB0C952B1D62DE9C986ADC1B91EB3 his.words.were.these:.that.richard,.duke.of.york,
80,282,898 *088EEC3B587FB45DCDD4FEB5E0DE1F6E17452F54 2201959 yl
80,282,899 *088F173AB9F151ADD8BB224933BF78D76A68E407 hlpusd164115nath
80,282,900 *08878D5ABA23194CD4131304EDDD064C0E55C85A 2301881 WIE.LAUTET.DAS.FAZIT.IHRER.VWPREMIERE.?
80,282,901 *088B49D357EC89CF9553D2FFF9774A217A4886BF HOBERT.BROWNING
80,282,902 *088C00822EC1155418EF82967618379230227D91 2420925 joukkueella-ei-ole-riveiss
80,282,903 *08836525614059C59BC43EC5A8592DA6BFBC4B82 hommbsw3
80,282,904 *0886E5D94C43983479E9D2C27F9227D820077577 HOPE MOTTA
80,282,905 *0885D6A28746AA31ED86953C39E7139A98185E5A [email protected]
80,282,906 *08832CBDE0AE1F66D3DCB33A581E1B614AA71DC2 2888256 t
80,282,907 *08806AD301776BE99834E4589F1ECEEF6AD3C049 LACHRYMOSE
80,282,908 *088176E8FC1B14A7EA31971ED477667DCBFFF468 2-dag-vertreter
80,282,909 *088D5226323E9EE35D7A14386EDA20415E2F7095 HTFLLNSSS4
80,282,910 *0889411D78AA6D1801DC7320AA28F784068C02CF lancę
80,282,911 *088A51CFF1D3A4C4781E70C6FD4EFDCAA878603D LANNETNET
80,282,912 *08858C0783D8EFD401232F0C7C1CBAE06D508B55 LAVERNE.URQUIJO
80,282,913 *088CCD3607D22046BD5F38E9CA091EE350ADC184 LAZAROMATTAS
80,282,914 *0886ED17219768BEB6697B40751CE1A0BFBE4B7B LAZARUS57
80,282,915 *088E9420E6A20EB333EE76806735C5091649EB6D LEE.ORFORD
80,282,916 *0888305FB5F8E6FAC466A1B3170EC39A52DA7FEC LEHOFWARTE
80,282,917 *088BDFB075CD692BA972B42DFC32F21504E2A202 3D–MODELL
80,282,918 *088E6788F686C0B22452A7C155FF2D8473B5244F IFRS(国際会計基準)
80,282,919 *088D5CD4598CA32FCC1FAA0090BC5EF232921D63 [email protected]
80,282,920 *088B214056D1AFA7333CC73D302E64EA9F9BDD98 leonardbreach
80,282,921 *088A36D03EFF1FE7249EC69944F3EF730D908586 leonelstitch
80,282,922 *08849A74B6CC636E5B2ED4A86DB86A2C413BA822 iluvfidel13
80,282,923 *088BBEB70069C7BD062DCD22224999CD8ADFC57B lewisandclarkjournalsunledu
80,282,924 *0889F2227D805D9F8301150D9C1211570187479A 415443 NAISILLA ON MY
80,282,925 *088D99A8D1BEF902A22897FE86021872FA0F8DAE LEXYBBY
80,282,926 *0880F7F10A354897F3A0A8CF0079362A97D2EEF0 INICIRAH4
80,282,927 *0881F49D81C12838A75392861B1F41A70F22B2BF InMyPlace(live)
80,282,928 *088D13E5F0028E3F2E1C8D8B2D518FE3328A69CC 4CIGRALEP
80,282,929 *0882969BE64D753CD48422949DBB59E802D2C4C7 lightcavalryoverture(excerpt)
80,282,930 *0883592729F0935FB23D64B60894177B4A1A89EC INSGEHEIS
80,282,931 *088129043E72B43AE1CEBCF2DA06F07688D4E6D5 INTASASED
80,282,932 *0884F42FABF670A0F83B3FDC37893D154D11C237 IN-THE-MUSHROOM
80,282,933 *088B51B7C0228F124CDA35B93B03F61BB51BDF12 intimnu
80,282,934 *08854B14926D93D9DC4DCB03E79904157EC89CFB 4KETTENGLIEDERN
80,282,935 *0881BC44EFDC76B1CCC945CC06861E30E39ADF99 4MAIDONJALOSTUSTEKNOL
80,282,936 *088786E85A7AB8D884343A2F5A9178BBA60B1241 ippl
80,282,937 *0886311C758C3DDF854AF2B5C0257B7AB954E81C isaacmead
80,282,938 *088767BB73D651A2E470846D067E5BDB30602ED0 ISMAEL.BECHER
80,282,939 *0887E25E38725F1D8E552FE4E874C5F7240BC52D 4RECEIPTINGS
80,282,940 *0883581C7FE949E97515CE7C2BCEAB0E75476B16 issacdonati
80,282,941 *088AF539033B89F2D1F340280357E847443BCFA8 ISXZ
80,282,942 *088F3CA1BB0059BDF928C806889596E6D5806BF2 ixug
80,282,943 *088BB2E858D4CC2015ACBDCA50BA8F0514D93760 J152143
80,282,944 *0888F079167C7F5D5A0AEFADF178D1EB094F1033 [email protected]
80,282,945 *088C05F34BD8825AF2228632F5861ED0E8F3DDB9 [email protected]
80,282,946 *088D7E45DE04CD083356ABC78F19E681FE136282 [email protected]
80,282,947 *088E3029832DC93EC27107534F66EFB9A2286A9D JACKIE.WORLEY
80,282,948 *088426A5C86E9E3022A42894C88F9E209393F8CA jacobhammell
80,282,949 *0886F2AC1DCFE76327F305AB145BC89BF01F3AF4 JACQUESAHRENDS
80,282,950 *0882C1A29B183799E08D0C6043D86EB4F5EA9C7C JACQUESSHEETZ
80,282,951 *0884CD77E03BC5D4CBD47D12A645AF34500874D8 LMY5755
80,282,952 *088880294EB4C32059903D9B7E5787873AE90822 l-nd
80,282,953 *088005DFDEDEFD95A644F0A6FB02ABD65C588C78 LOCKERER2
80,282,954 *0887564C852E219789620435C0AED9D6CAB29782 5DENISEACCESS
80,282,955 *088C4479DE0D7B30DC8C895D5D89C4B5CF52C3CB 5EJTNEKRAV
80,282,956 *08832962B498712B61B46B750335EC8D64C6C548 LONNIE.MANFRE
80,282,957 *08801148F08FD1E1237B397EE83DEC0960F92CFD lonnyscurti
80,282,958 *08856A2CFD6A4A340AB7C4816D9A535F2872FF86 [email protected]
80,282,959 *088BEFF586992F76F366B3F258976884870CF59E 5IAMGIBSON8
80,282,960 *08868DCB3283F5714C227D23E312E07821139DB8 jarodbrauer
80,282,961 *088390B5CD0A6D61E9E4313A8E7863A3C57D710F JAYFRANKIET
80,282,962 *088E255B6A5176993B15F2E9A8768325EE9402C4 jazz.drummer
80,282,963 *088B14032C1E52E11F63AB181092A33C727ABECB JBP_
80,282,964 *088B9DB392F91B52D35F72F513FF10CAD2677A01 5RELIOTNES
80,282,965 *0880B824E3257FA1D493B628B7BC3DB1F0A9C8F5 jeankujawski
80,282,966 *088A1A88A42533A928B796C6A99F092ECBBE24D5 [email protected]
80,282,967 *088E2524D11A06F807FB302DE0D215DFBA038C16 LOUIE.LIEU
80,282,968 *08807557B3AFBA0F2B5BFADE55B0148DCD1325F0 5SEETONNA
80,282,969 *088958CBC3EC7B7BF380777260ABB56F696B7E88 LOVERBOY(ASPAPASPOPMIX)
80,282,970 *0884FCF8672276C03A1CFD2157128F3E1F6A702B LOWELL.GAMBLER
80,282,971 *088389285F024400BCC0BB37DBE8794F6C8B49DB 5SREBLOV
80,282,972 *0883AE22E8E87D68160FE7FC5FE3556FF6A547E4 5SRETKODSDNOF
80,282,973 *088DF5454C754BBA48547DF5E7A6A74D85EDFF24 5STUDLYTOMCAT
80,282,974 *08893809AA1C416D7492A2042018F17777586B3B lqez
80,282,975 *088AD24F35DB9B421E2C9474C04F7D93FA67DFB9 66601NANI
80,282,976 *088656E1392C015D80EB4372A19042FA44766AF6 jeroldsharkey
80,282,977 *088A77B8F1536296164458AAADBFB2FF3663BBFE JEROLDTILLEMAN
80,282,978 *08831CB09186AB560B23DBADF5207598C2899206 6DTACHONS
80,282,979 *0883BCE3AE3FD075140D60AE4C69295BE94A3D04 l,ucy106
80,282,980 *088F9FC6EAEC131D157DA5912F87D6432B5A951F [email protected]
80,282,981 *088108A2DF6A040C2A063191EA58E30BFCAEAFA4 6KREIFELDT
80,282,982 *0884A40CA2672922C968BE4DE3410227A9C4661B 6-KYT
80,282,983 *088DA7B003AA321000CE4D38FBEEC428C9B0DF60 [email protected]
80,282,984 *08897C98DE5C814AF75304614F744D0C0DC0F95C [email protected]
80,282,985 *0882C5E6C406A9E974D5560D567F8C9E45D54A2E [email protected]
80,282,986 *088CA33EFB5561DE6E5C9D0E186E29C6AA1C4150 LUTHER.WILLOUR
80,282,987 *088E83E24CDF72FB179673E06A2B6A74DE5B7EA2 luzhongi
80,282,988 *088E314F4C0A9CEECB4C2CF986B92C82A1B8E4EE LYNNSCROGHAM
80,282,989 *0882D8EB6CF301529B71796953394612B6495E7E 6OHNENNIB
80,282,990 *0884C5C0BB0CA5CCBDCAAF5D4C3AB749B9F2F9F9 joan-comorera-i-soler
80,282,991 *088CA10C278F240A0AB8C105209F6912097C00D7 6PETTIGREW
80,282,992 *0886ED29553E34C763D547595AE91EF134C5B4CB JOEKORKOMAZ
80,282,993 *088161710BC3F92E4C3F585C3B03F490344506A1 JOHANNANUMMELIN
80,282,994 *088F7D564753C24BF15AC752254E9BFED215A531 MACEARNHARDT
80,282,995 *0884C2B853CD5DC7C26267293274FA8A6F8221EB 6STARTCOLOR
80,282,996 *08881369B2ACD295D62E34BFF9B5D1919DEAEDD6 JOHNNIE.PEXTON
80,282,997 *08845935E95DDDFD458435D0C13B4A6A5A5C5620 6UITBLINK
80,282,998 *088E3E34D0B50EA1A602ABC613EC0C2957A93C26 709bella
80,282,999 *08825A8FF9579AF5570BB594334339B1BFF478B5 joneserror
80,283,000 *088833E43F95BAA98C66DEF8EFF85CE5C5051524 jordanowskich
80,283,001 *088E583E1738BF2D18E164A4CCAE5DC72BC49BA4 7BATTUES
80,283,002 *08888036E5D66AE1CD24B18C66EC0E2C97495FF1 7BOBBELINGEN
80,283,003 *088228CF7D68CEF9CAE09F67B85726DE7BD38154 MANMUSSDASLEBENEBENNEHMENWIEESIST
80,283,004 *088092EF03389D2E647456B3C2247E72840F99AC JOSIAH.CAVETT
80,283,005 *08848A0A9CB099E4F8C0EB6BBFB0684032FF110B [email protected]
80,283,006 *0880E0EB071452F228DB73E069A88D53B84DDA33 jr-shikoku-awa-ikedastation
80,283,007 *088A6D8022D77277766526B934A0BA9DB2B0ACCA marc.kalis
80,283,008 *088358AE18800463D9E74D2CADF1747A22B5D416 7KATHLEENJAEGER
80,283,009 *0887D35E02EC4AAD7032FFAF909460A95D71FBDD 7KESTESBSW
80,283,010 *088ABE9ECED6B4CAF552ECA9563D2BCC0F026015 7LEELANA
80,283,011 *088FDFD480AE77D6548846042EFBAF8CA50363ED MARISOL920
80,283,012 *088D68F4C6F5926089768BE404811165E45CF482 [email protected]
80,283,013 *08821F29DAD1FDA6ADA0C05C48185D4CD198118D JULESHUSKEY
80,283,014 *088932231A4AE7776296AAA30D72E062AB8B21FE marquisvicic
80,283,015 *0885C8B1A5389D95600001BC415C7C5C14070E58 JULIENNE.ATIENZA
80,283,016 *088355C2734BE94777E02641FEDE92D87BB34566 MARRETANDO1234
80,283,017 *0883FEFB3EC3209DC3E0E9A81224A6814ADC52E5 JUNGLE HOOD (FEAT SU DA BOSS)
80,283,018 *088117BBD1D91B296DA73ABB86BCE21A43542BC7 JUSTINVIDAURRI
80,283,019 *0880F50F6B1B7969B17080F4967B8B4DA9C63798 [email protected]
80,283,020 *0886A1318CF7121B97312C065039A94A36B89D37 KAANOHIKESHIA
80,283,021 *0883DFC553096C3B6D610DC6BAD6B19DC9E8AFF6 [email protected]
80,283,022 *08877D1C92EFBC823A396D4073F62C291AEAFA67 matthew.burkhead
80,283,023 *0888B49F9B24936DFDE26859B804936A49BE4BEE KAJIALPARA
80,283,024 *088D19EB4F7AB7B32FA40FD28384E955EFC5A812 KALSOUMS
80,283,025 *088423B131256854E21800BAF394A6CCC1C47B4B 7UNDERGRUNDSHRES
80,283,026 *088C15B4BED33DEB8B187413716C840100FC5117 KAMAŞMAA
80,283,027 *088D2F84B5D80D107A7D7A107E50B1BF91707B34 maurodickhaus
80,283,028 *088E4D9E3EECBDAECAFC82B3DFC16756172C116E MAXPOBLETE
80,283,029 *088A6AA2B85B354630550FB4947794156A0B7079 mayday
80,283,030 *0889E76974C6257D6EECC9A9BB0506C96E8E65E6 MDL39S
80,283,031 *0888169AB034849EF2F70AB064097168F6E4EF7C KEARABARRETT
80,283,032 *0889E0E220DEC7D189EE2705A0BCDC60DC5558C8 MI7GK_S2BYBZLT0UHPK
80,283,033 *088B81CA2B0BE34B1631045D5D545A2BB51E063D MICHAELAVN
80,283,034 *088EF3AF181673CA85398B43229E9D1B100DB7C3 8JAZZPETUNIA
80,283,035 *088BBFFDE41F3BE1E6BB3F978463623D7C11F2BE KENGEIS
80,283,036 *08840590850D1E341ADD50A2E6331A0D47C97A5E 8PMCMONOPOLY
80,283,037 *088C8892C729870E76A794BFA2E2A6504B658CBB kiethcorridan
80,283,038 *088D8BD604167ED90A129151EF008CE23A41C126 kingdomheartsseries
80,283,039 *088243D870C0B817B8AC23D27FFB77EB0CFB3E95 MISEZIMA2
80,283,040 *0887FB49994775684528F76FA6FCC0AFABA0C37E 8STEELERSCHRISSY
80,283,041 *0887649A89F54BEBCF6B9F5D9A59744D7EB6B55A MIZERNIM4
80,283,042 *0886F70317DE15E06E389358718BEDDC894BAC6A klavierkonzertnr2(2satz,larghetto)
80,283,043 *088F2EA7D9D7B70D47F77AD25B26E5FFF3927234 knevett7
80,283,044 *0885C1D358C636B0D7C616B7E0104310E15519AE kongi-1
80,283,045 *0887C77FBDA84E9D3ADCB2171E6A470EA9F99467 990f1038d1bd3787b3482ba0fac8c892
80,283,046 *0886EA4591F2A12DA209091F1F838E65770EA3B2 KQGM
80,283,047 *0888EEF81E7C8955C910FE23306C450A2904CDB8 MOUTH-ON-ME
80,283,048 *0889E6596F7547576C9514506C15D5A01A3BDFA3 KREDITTGIVAREN
80,283,049 *088DA3702E80B994DC76F64404C562BACF5FFF07 9BRAKEOPERATOR
80,283,050 *088853AE024F21D6B1FD3CF2FB970A7A7D1D3495 kristoferokamura
80,283,051 *0889E14B61187D9BAF278E44A10B00D36E5DBFC5 9COPAGOUS
80,283,052 *0886C8B46274805C1372A14C6506A02016B607FF MUNGO
80,283,053 *088D60066AAC322D62FCBD75915C2FF9DF7D9D34 9ETSEGITRUH
80,283,054 *08834CD2B46B5B3E4BEDC46639BAA90BDC96029A [email protected]
80,283,055 *088DE5D75EC0D6C4AEBFEB2DCE8EB86EEA354C3C MYASHLEY2009
80,283,056 *088CC99FA467371CFE28BD97EFA2E39D50CE66BB NANCT05
80,283,057 *088BA94F51ADF9F2212DD233538284FC6B0BF620 KY-EDWARDS
80,283,058 *088C1C18C620BD4A863F3E76ECCE4612C9F9F9C9 9REINGENDER
80,283,059 *088973EAF158EE7870E43F5323A9946456470FE8 L30092002
80,283,060 *08854A15D2351194F0D406093465D18C09AC286A NEDEHTSE
80,283,061 *088207D62306D79FA6794EC507F799B0FAE86734 nedsnerling
80,283,062 *0881D3F95FAD4068E8E8C88A7E382DD887AF6A15 la cupis
80,283,063 *08868BB1C024908158DDA62A55CB8B262D02A72B NELSON.DOGAN
80,283,064 *0887032421D96EB0650A8941EC151D323339783B 9SUNNY9
80,283,065 *0881120216AD846418BF7ADF28DECB6514E190CF LAFITTEOVOG
80,283,066 *088E4F5030FCE2FBC4BCCB1D8AC4AD6804DBF158 LAMAR.DOMINQUE
80,283,067 *088C4548F3ABB6323FAEBD7F1732F1A7FF042C54 lamarfagg
80,283,068 *08879F190DF0AE9997D5B1AAEF1E747C8FEB4A35 landskip.
80,283,069 *0885F72EFAFC94CE0CB6846D1D5D6F397E678EAF a37ah
80,283,070 *088F0001D611E7533330316274C731FA3FD4C47B A6&9L
80,283,071 *088023645781124961D7C38CD2BA99CC0D8AE907 A7N
80,283,072 *08848E450E915AA748350ACD49A587FB568B24B5 aa(73
80,283,073 *0886018ED34001A7A60885183355665EE4F368A1 LEEGILLERIST
80,283,074 *088181DA1BE69CAEB91AF2EA3BA61AA700F6AEEC LEERAEWEB
80,283,075 *08818BBB82D654F53FBE55DDCBD46B8B53F819B0 LEGADO-APOSTOLICO
80,283,076 *0889A6406FDB6B6C8E4258D3713A91A52C5F36A9 nonclassical
80,283,077 *088C3C8238DBB3778A10B88A94EA1F200D020CE8 .-Lento
80,283,078 *0886419379DF4CA96C8F3DB1A500D4827E93620C LEONARDBURSI
80,283,079 *088275AE0172CB8C9194916174C866855A527B87 [email protected]
80,283,080 *088FBC3DF82DAA4FC894281109EC46B0A91E677E NS060407085200
80,283,081 *0883661705958AB14900EA714938735F61349161 NTHERSIEDLUNG
80,283,082 *088DEB20ACE58B266A2D298DEDB49A84D8C81E7A [email protected]
80,283,083 *0881C89A8415718ABB0B0B3FE22E43BD7EF59D57 o*4
80,283,084 *0889FC939AC3B606BEE93F58BDD387FA3740A4B2 Aangestreepte
80,283,085 *0881EAEB0CBDCC6084ADBD9CB0CEF5CBF2D35333 OCONALUFTEECORNCRIBNC
80,283,086 *0885E56354375E8200A069AF097EE9C521302D4E aatuisia9
80,283,087 *0886DC2DB6772FB4F7752CDD98D48599C3F91192 Odiseovs.Gandulk
80,283,088 *08862DD183C9FDC0BC3F3D94F3160B8215F461E0 ABAPABAP
80,283,089 *08831299F307A454AB690E473AE4CC2D7D00F5DF abbocchevoli1
80,283,090 *088C830685940B709355E345FB6E8DD65231166A [email protected]
80,283,091 *088B60AF75DAC39B4530AC78A59523D370CBDB87 [email protected]
80,283,092 *0884216CBC13624BCC63A5F19E0A519762E1F02D abscound6
80,283,093 *08833101D08BA9A8463A1B9A25BE64312244E9C7 [email protected]
80,283,094 *088CD711016757F96AE4FB208AF2C985F0958DC4 accodavano8
80,283,095 *08800CA8ADE7251A158BF2F270FEEDD3911CD694 [email protected]
80,283,096 *08845816AF1526513C3D5BF7C472913266EABDA4 ORHCONOM6
80,283,097 *0884F31BEC47CE59591F1343A178074832B4A4B5 [email protected]
80,283,098 *0885EEBDCE4860301B1E8D1A98351EE23348D739 litvorovému
80,283,099 *0885D793EFEDDC90C7A77C4185EC85B5D9C6BC89 OSKARTEX
80,283,100 *08802E123BD0B225B4E9E26BC97F053EA5F3DD9A OTTOSTEINBACH
80,283,101 *088FDA86C41251C5E86C3BA6438B8BBEAC5E1D7F lmproved6
80,283,102 *088B04ACF28A5E2AD5874088C3009467C3F433CC lorenzomcglaughlin
80,283,103 *0880B8B270B70886F072AF7D11F700A7B3EAF6EA OZB
80,283,104 *08858F3F380FEC1FBB8C027FC3951BF479CB4480 paesisticamente
80,283,105 *08851A38CD86B626E91CB86AD400CDB0ABA81082 [email protected]
80,283,106 *0882C5CFE04454DF00488EF227B5F4CDA5122EC5 [email protected]
80,283,107 *0884562096EAEF6051A98908D0118952A307B680 ad_t-
80,283,108 *0885517DECA27CBF065DCC064A46870C9DCF6B61 adventureday
80,283,109 *0884B1B21D2DDCA9B48549B2A39EDCC9342C5960 PAPOULIDES
80,283,110 *0886558536C8D2733C5DDC9D00447C4C6EA31524 A!ECK
80,283,111 *088D090719C70BE5F001D0B8E0897659FEF95E94 PARDAHS0
80,283,112 *0888923C824AA4434F9B7350FEB247131B000E91 Passw)rd
80,283,113 *088DC3E6A69738A0C1B4DA96F703E5A42B29BFD7 patricia.regis
80,283,114 *0888EAEDB5E1AF365B1DE0ABF446C16E855BB219 affublee!
80,283,115 *088819ED72C05E7579301741B0223FE5E076B615 luvg1ove
80,283,116 *08863299A3DFAAEA37151DBC8E626260FB1FC211 PB4LTK
80,283,117 *0889F179DA076C31584B5F941C9282E0C1D9957C AGSS-569ALMA
80,283,118 *0882A94AE3B0FB9DAD5415C239CBB012BE5D19DE ah/2q
80,283,119 *08869161A374179D014B35F20D720E52756AADE6 LYNWOOD.ALMANZA
80,283,120 *08871E613433D41E789F281569856D64472A5326 LYNWOOD.CERNOHOUS
80,283,121 *088E1EDADCD58B515E5BEE73DCB25AFA34DA412C PCU
80,283,122 *08811DE82B94411BC52A6864166EE2ED59387ABB m$$0r7ng
80,283,123 *088AF5AA51D8C7B285CE85C04818F4F23B03471E PEEDA-&-J.MI-SISSOKO
80,283,124 *0884ED14D600EBD3679B5A7318B65F6A81638C9E PERILUNE
80,283,125 *088D96927BBBF294E1080306CF18C4DACE3B9ADE MALECÓNA
80,283,126 *088C11B29EEC9B4E178DF77101C2A90FBDD4058B [email protected]
80,283,127 *088308FBF2D43479CB53D1DA2907A77EEA8E6230 alexanderseier
80,283,128 *08846D004F3C1C2D8A72217CBFA3358E95AD4DE7 MANMEET-SOHAL
80,283,129 *08864D04C6F74A93BA04100E950FB125303E1E20 Piano-Concerto-No.-3-Op.-37:-I.-Allegro-con-brio
80,283,130 *088A32EF1BF582BBFB28874431BF4B2E88A902BE MÀN TRỜI CHIẾU ĐẤT
80,283,131 *0883202FD7BC6D341033874C408AE7FB73D22B26 MANUEL.LOYBORG
80,283,132 *088D312E80C98FF91F1264075D0DDE43CE51A0F6 podzolsed
80,283,133 *088AD0C2F5E72E9065409D857B9F173092A088E0 MARCELINO.SFERRA
80,283,134 *088E6CD123537D5639E661779E1C8DE11C5766F1 PORNVIEW...
80,283,135 *088F237B07730DDA90DC22C89FB94609C3B5585C [email protected]
80,283,136 *088B95F2864ED8B8F81C91F0DFC266F73A1F3AF2 pp180183
80,283,137 *0882BC0D02EB5D916EA00B8719CE2C7A925283D6 P######P~O ~O )8(
80,283,138 *0884B169CAB488CA3B67375FCD04D8F994A68E7E maria.vill
80,283,139 *0887C523ACA99A5A4B63B084C2D9587133D23607 MARIOARDAN
80,283,140 *0883F95A7CE74DB2E28FD0D1EFC7B2D6020E7138 MARLENE.FELIPE
80,283,141 *0886DD74923C0FCA06DD01017D18A593321D61C8 [email protected]
80,283,142 *0889042A97E09CEC435EF62EA89DEC59B6A96B9C MARVINMOSES
80,283,143 *0883B921F2F4B94239CE5DDEE60090D6F87321F3 MAXIMO.TAOMOTO
80,283,144 *088447A68955DCF7CAAC7644AAFC30B4DF498D2A mayday
80,283,145 *08851D4D4B41E5C2F3AA96AB78943924564A507D PRELUDENO10INEMINOR,BWV855
80,283,146 *088C55BC93DE3C5660BD69C0F8B65A2AD623AFC0 [email protected]
80,283,147 *08836BB1DAA65DCE1371585B771C91753BDD405B PROPERRDH
80,283,148 *0882C8DE3333F9C8C0C6C3242DFF5BCD69B3C010 ALVARODECASAS
80,283,149 *0881C7692830228C266C03251EC65CF4416C6749 przytaczal
80,283,150 *088A071673FA797D11A28C83D94B402836A2CBB5 messeinhmoll,bwv232:vdaria(alto)"agnusdei"
80,283,151 *088506FCA7877EC2CFD86AFE90C0E664A53E7FEA [email protected]
80,283,152 *08805CAFEA538C0554080C5AD4B9E09AFCEB6AE0 [email protected]
80,283,153 *0886BB8E80CA1B21C26CC255FF6D9FFD0AEECC17 AMS?N
80,283,154 *0886161B9613706520520FB59144CAE2F228A4A8 MILLIE.OGDEN
80,283,155 *0889F980EECFF4761CC6ED068D43E3C0D02B3CE2 ’MIND
80,283,156 *088C792DE43E0C2840A161B932BC26C1999879EF ancientevenings(najmaldin)
80,283,157 *088BFD86C92D60E41C89860AD40514ABFF7BC475 ANDREAFLITTON
80,283,158 *088A53C3EDC6F078D0B41082CB0CD9F82B873FC2 MISSYPMC7
80,283,159 *088892C4EDB020C7D8893F7F63FFBD63E019691B MOHAMED.MIRANTE
80,283,160 *0883A34D5B0C7F43394888CF6B59D996A59AA22B MOHAMMAD.RISATTI
80,283,161 *088494072173366B529DB4F922CA7BE60EBD91C5 MOHAMMED.WAHLER
80,283,162 *088EDC4C7AA0F2E6A4F2DE5CD3FCC202E7D3F730 [email protected]
80,283,163 *0886F1166A74422BC4D9EDB4B792F00575ADE789 q==)~o~o>b0
80,283,164 *088447B32DD36DD327708D52AB6C8BA64857219B ANGEL.MOSES
80,283,165 *0889DD9211AFD4BE41AD3A79D985CD764D036199 angie-faircloth
80,283,166 *0888E9B8BA23698D3152EC8EFBD54F6042257C00 q=====p.`~.`~Splat
80,283,167 *0888086613FCB2BE4AB8FEBDB1935F30E55C064B Q==P***UU
80,283,168 *0889BF9A7185FDA61314D164130F640B5E796673 QUIEROESEAMOR
80,283,169 *08888861692B3C6CCF0CC81964882B01915EAA25 ans%;
80,283,170 *088CDB80928A5C01071C55504504D17F4776AC88 mosgroene2
80,283,171 *0888519DA120218EBBA2F30E0EE6E585DB24A0E5 antoinetukuafa
80,283,172 *088B9AC54E616E784B26A5C99439C0A9A7D53CA9 rafaelnoseff
80,283,173 *08809E454DED916D0D0896BA8D3C8A8FC083F864 RAHULFRANCIS
80,283,174 *088B88F77E61E2C64BEB955E24C7DA0F8681F44C ANT!PAC!F!$T
80,283,175 *088C482D421F4F61E73A64D5FDAEE7F32E7A5386 ANY.TIME.YOU'RE.FEELING.LONELY
80,283,176 *088C5F33EB753B83BA553C3DB9FEC09C98EE5DBD [email protected]
80,283,177 *088B33C604CDBE7CAEF887E0338880C624508164 ap!l"
80,283,178 *088428E08E28D6AD501CD18F84AA41D59F8384D7 MUSIQUEDELAD
80,283,179 *0886411F6D86F387B6ECD9775A5CBE4EAB62278B mycobacteria9
80,283,180 *0885F9847A928CE0100E473406CF3E6F560A90D3 myrainbow2005
80,283,181 *08805CBCA0DA504DFCBE28F235C15E71D292D0CF AQ.&M
80,283,182 *088A2E7AE8257AAC1D5C0D1131D9ECC72D2BB254 REDISSEIZOR
80,283,183 *088915D3EE6BBC1C28820804330EF465D66B1C35 nalprekcets
80,283,184 *0888EE5DAE799B19D260BD2CB9D5467F089E6FD5 ARNAX REMIC
80,283,185 *08815709A0E3BADB8DFB0A1963C4195EF5934893 [email protected]
80,283,186 *088F921679FE92AA7D6E628E12B9BE7A429D2B36 ncbound1
80,283,187 *0885FD8C746EE63472C34C73D1EB7B700498B766 Renard-the-Fox:-Moderato
80,283,188 *088152F4C626C499791AEC2271070E80C657375A RENATOCLACK
80,283,189 *088A8D92B4BA8DFACB3906886E00DC073D763234 ARWINDELACRUZ
80,283,190 *0886A8DF6449ACCC3F76B47CDADD58571E17BE93 NESTOR.MOHSIN
80,283,191 *0886062B8C9A68D97A260EACC85F9B7E5353E7F4 NEURA1-CR
80,283,192 *0888CE6B539E3A4C7C91F2AC39869BA99E089236 NHYH
80,283,193 *08887C6410A9357815042C78097180A09BF6AF0A nicolascassard
80,283,194 *088DD4890B8B33E05CABE986CA232C1BE9E77BB0 NICOLEJEFFREY
80,283,195 *08889EF550BD14D61576CC455BC7246956AE9C88 RESKRIVERINGS6
80,283,196 *0884D4ABEEFE223CB2BD31693E6262BD76B6BD08 Rezlov-1
80,283,197 *088C414A10F2E4F7E6B193C6361DCACA08BE8BCC NM2166390
80,283,198 *088E5D24FCBD4E16D1B10521716668780DDB3F98 NOLÜDIKÜN
80,283,199 *088AF420DCAE98D6E70744C5715EE2DBCC909556 norman.mccord
80,283,200 *088688A7362EEA84C6C4047E74D2C22C86F8D7FF [email protected]
80,283,201 *088EB2CF1D8C3CA2958A2EDFBFED57D305E893A6 ATE+
80,283,202 *0883403B9423A08917F8A5BE6A7E37DF09DD6B18 ATRACIDI
80,283,203 *088501F30FDCB1A388747DB6F0C4DDC5534A07A6 NWAKUWAMICHAEL
80,283,204 *088E00EB3DD1C00375D28A969EECE91A3A1235F9 )O(-*-*-*(====3
80,283,205 *0882EFCB420252C2BFE5512F4EC2365EC30B2BDE O68J
80,283,206 *0887D0F48F41FF6485BDC284013067B1894EEF3D ~rkq
80,283,207 *088C61522CF5F79E5A658F53E13C673CEE99C1F6 OCTAVIO.FRILLING
80,283,208 *0882E3F773D6DD00B1717FABCC8C63AF346151D6 ODRISSHO MANOB
80,283,209 *0881743095FAA67EEC4BD263D06720C3451FC468 autoabstract3
80,283,210 *0885F7A9D2EED4623D7407A856CE3B19944D93A6 omajjadiese
80,283,211 *088075B10023EEED7043164A0B10E66AA643EFE4 rodrigopartmann
80,283,212 *088DF010E5F03E43A74F25B058BC5E539E0CAEAA AVESIHUT4
80,283,213 *08882F7B8B183CA44D5C4AD82131E0976FC1FC0E ROLLAND.CAESAR
80,283,214 *088553558BCCF9584249283BA11DB0C9F3CE5874 op119:andantegrave
80,283,215 *08848B80C6B07C1D9B20190DCE379ECFA831D63A ROMLEGGEN
80,283,216 *088C8337342D60072ABB682447A063F5168E7889 ay((b
80,283,217 *0889FD59FDC45DDCBC633A5D609D80D5586993B7 [email protected]
80,283,218 *088EEB3CAA998637A3CD5C59FB4DC37BE65FC2F2 RUAANCOETZEE
80,283,219 *0881105825A23C7A06D31CBA25EAE26B1C260CA6 oswaldofouracre
80,283,220 *088E029A60C4760D457896BC95D34E8C1B072179 [email protected]
80,283,221 *0880E0CDEADE1CDAE50836DC90869B20C2FE1D80 b%0r_
80,283,222 *0886AF49A46B88E0FA2430579745D6D6B2CF59ED outlodging
80,283,223 *08872651DCBD373CEBF896DFAE0568579D555535 r_w!
80,283,224 *08865830912766EB49350042F04B5DE38CC59FF2 OWLFIES
80,283,225 *0886F66E26FB4FB080D48969BBC3B778E632A07C SAFEQ1234
80,283,226 *088A76738A2408D86DAD7C8D63C4CDECB8E7E255 b1ind3r5
80,283,227 *08893565CBB707964AC43FD02DAEE33A2E99E584 SALINA.SATTAUR
80,283,228 *0887357F4861E2A21B53C154900D94E30B13276F salute7
80,283,229 *088284023C3E7432D0FFDB756420E2A8DE468AAA P64524511
80,283,230 *088297192D86715B577ADD899AA31A1C56DC75C5 P##@*-*-*-}8{
80,283,231 *08861A05F6D3356AF91A9793C06828AD3AC34467 salvatorezafar
80,283,232 *088E4B6F924324884E41614EA55A5540EBE0C30D B3DRA1
80,283,233 *088D4F28C0AA477FC5294D60D2959534EFA33291 b45zd
80,283,234 *0888EA26A24755C89803A79EC694F33AC3C0A442 B99456
80,283,235 *088F28FC3D957AB8652AC90FBC0C498ADEEF3780 B%9HB
80,283,236 *088BC354CD3EAE4C897908FB1169487BB0E0163E PAMPEYANED
80,283,237 *08825C5F0F26F6A894FC8EE1DDEDCCEF3D85AD73 sanjose1phantom
80,283,238 *08866637D5EC77BB4942FBD570DECF17435BA416 PARIDAI
80,283,239 *088FF27D5147FBA86A7B2D69D35A605D9FE21B9F Ba&L
80,283,240 *088141E170CA37C27840C2AE9EAEEB7A0AE247B9 SɪBRAʔ
80,283,241 *08838A8277F6FDEB42B0E4D82D821F32EC30DDBF SCANLAN
80,283,242 *088E2A867BCFC7070BAB8D6F9E049A4A7824200E BARBIECAT1
80,283,243 *088A17CA68E94DF5755E0C1CCB945633558F210D PAULAARTHUR
80,283,244 *0887A45B172A5E4BA86E44BCC576392493CCC847 SCLEROOPTIC
80,283,245 *08803E841956AA77F27FC0271A9EE66B3CFA9A8B [email protected]
80,283,246 *088698F4EBF2A7FFFE597A2FD3922893F7CC9C6C BCC.P
80,283,247 *088205AD0E6B0C5AF2EB0745DDDD75F3908BA292 PERRY.LAM
80,283,248 *08889DD85E85D00C8BFC49B821AACD34CA6AFA41 self.admitted
80,283,249 *088510C34E71A1B0E4A20F94F070A3816469E7EB beaglebmw9
80,283,250 *088FC3424E7D6EFBA9865E7EF8BEFA3F27C8E9ED semuasuka
80,283,251 *0889C304D7F5A4BD0762AF02C4648D1B8211D66D beg2h
80,283,252 *088BB4CAC7FFA0422AC1930FAAC8C0C86B472DB8 phut?
80,283,253 *08837D4516D96CEED1665C35D8A769B6AEC9FF95 PIERUCCI'S
80,283,254 *08821DAF69C8639A5974553A37BA45776EF5082D SHAWNROMAN9
80,283,255 *088A79CDD2B4E1773B996B65759F53B1EB575D8C pitsnaa4
80,283,256 *08818D7594AFD4259720F745B6739F79F6E921FC planetasiapainlanguagegolddustmedia
80,283,257 *08868CFAF634B41ABE72B22401E3A425DE7FC628 PLANTTE3
80,283,258 *0887F63BCE6F55441651D85FC7F685C40ECB340F bgh!)
80,283,259 *088B8EB5849D382FF2FD07ADE48618DB49B26B6D signaleront7
80,283,260 *0886602834EFDC01FE175BA4861D045584AFA707 PQUOST
80,283,261 *088B49ED7524E783C5978F634E6659E72DB6C33A PR0T0HERESI4RCH
80,283,262 *088C28C8E8E98D9E7256EDC69E258BAF40F5494A SLAIROTIRRETARTXE2
80,283,263 *088F61837BDDA398264C739D6F2E4B85F964CE3A BITCHABC4
80,283,264 *088DEEA6AE43B3D12590FECCF37058DE355A7372 prashakha
80,283,265 *0887266DBC9517E2C5D9A3748B3370188415814A bkf8f
80,283,266 *088124C1CB66036AFCA5D2E8BBC2DCD828A85B37 blvtn
80,283,267 *08865B25C8F75D454301FF2CC04C160EBACFDCA7 bnkv_
80,283,268 *08873D20BF8B87A2FF2CDF1EC9A4A0341F9536EF SPIRIFOR?
80,283,269 *088FA2215777FBD76347172DAA17C0AB63AC7C85 bobgiesbrecht
80,283,270 *088FD541B2FBE2B7FF904CB4B504A2F95AD21297 SPLAT * * DQ
80,283,271 *08877404A284B399ADFAC08240E98B8D8CED9907 [email protected]
80,283,272 *088C7DFB5589EFCB8BABB7E6BA670C3C82EC6702 SSRITHONGTHUAM
80,283,273 *088A60120E60FCC04F0F3631C13551323C5895DB [email protected]
80,283,274 *088935CF86BC3337FC1943F553634DFEB7C83FB2 STADTSCHLOSSFASSADE
80,283,275 *0885F1C31025ABEF23A8F9856A710581F82A4D00 qP~0~o.3B<
80,283,276 *088BA8FB879217E0C9703A5C18F4DE82503A3DA0 STARTREKJACK3
80,283,277 *088AAFC2F40C518B5A0D4180520DF12D1DC53642 STAUBECKENS.
80,283,278 *08863C96FC49424AE12E433CC50A83DA6CEA3B4A [email protected]
80,283,279 *0883C1D4F5B059FD0CAA78D89E013434B739DD4A quasinativea
80,283,280 *088CBD0124F1F3D9A060C458BED657628FF01C21 QUENITE1
80,283,281 *0884B67CB7B4C2FA853F12F8842F8C85CDFFFE1B R37r4n$m$$on$
80,283,282 *0885F6D2E2907F80EA534800778CC57712D0D00B steviegardener
80,283,283 *088AE48C5DAD0C1FD20A97E7C844662DBD8C618E RACH KERR
80,283,284 *0889C377D6467D179F45F404EBF33A9103885A2E brainfawver
80,283,285 *088BB9F1F7DE7AE5ACAAD3C9FFEF531E5A3173C9 RAFAELCHARNLEY
80,283,286 *088B3ADCAC1A82B1A6D2996C2A9811ADF8C837F2 rafelige.
80,283,287 *088974E1509BFC74DD0CE159A796D4685B098609 BRITNEYFINLEY
80,283,288 *0888248AD789B87340E5815D1BE3A7DBFDFAFA94 STTPEVDSYTS
80,283,289 *0882E4D5593D5DFD1769FF3267DD5F60D9E562AF BRUXRAMOS
80,283,290 *088F0A53B6C0AF42F4CE3FC934C440838BC78B58 raonbow
80,283,291 *0881015359C6F2F7909BD15443FFE618695CBBF4 STZQVIY
80,283,292 *088BEE7C5D926842BB4C892446AE6B750EE48517 ratcliff it-is,-my-lord.
80,283,293 *088C385DEE031A4B41CF5001328720335D1BF255 SUBSTANTIFICUS6
80,283,294 *08876ACCE57DBCF02A3CC024A5AFB28BD38EB0E4 rauhaartaschenm
80,283,295 *088382463D3F35F8D6477CDA95C23A185A2D5C83 b/s;i
80,283,296 *0880725E3CFBA9ADA38BC80021B1A1CA860316DE sulfamine1
80,283,297 *088E3BBA5A2ABE1D44969BB8BB65DC44CAC66FE3 BTEKNIKED
80,283,298 *0884A50F27158CEA6963C12D84C542401EC7A2BA REDACTS1
80,283,299 *088A12C160E95B095B2ADF196D8BACD8ED03BDC6 swiftnxp
80,283,300 *0881DF70CC54A86B5680A3F0493E6E3267E083C3 buddydrechsler
80,283,301 *0888705ABCCDDEDFBDF1693E6712F9BC4EFC027F redutora4
80,283,302 *0888F01DCADE4D7A5773F166940DE75933E47FFF burtzirker
80,283,303 *0884F8E3AF8FBAB4CE8FEC69CF5C1AC9B1402994 rela71veness
80,283,304 *08883181559E279CD576ACC8376DE67ED82C1353 szzru
80,283,305 *088794B08FCBD97DF5FA2E2D70D861480EE06587 TADESSTRAFE
80,283,306 *088ACD301C1836EE972405B0CE7532A3DFBE625D bycq
80,283,307 *088F396ADACE7141422E4A85BFF4A655B1AA4FE9 c0=,u
80,283,308 *0880D7FBBA3A33C921458550AAF0F7EFB804EAC0 C3S.
80,283,309 *088081FD4BB4EFD71640B1B4D42DD74A35B14527 c6waf
80,283,310 *08852E0B963B764CAE113C3CF4B8255962589897 richy3000
80,283,311 *0885ECDE5CDEBDEC1D4F5BD30BD237C913CD3BC9 ricquans
80,283,312 *088B8F3433B9001DADDC44708987779A944229DA C?ACH
80,283,313 *088C291D2028F6EAF1F61E1E8733BB40CE74EA15 RILEY.DOCKERY
80,283,314 *088333453431604E066F650DDE259FE40C29A4A5 [email protected]
80,283,315 *08868E8EF275B19569B1FA2760C8DBF624EBFF5F TEDDY.DEHL
80,283,316 *0886CFD83A250978B6797B6D89A1B3F0454D5C16 camille.rubin
80,283,317 *088F0D102E6B8BDF098C1824F2D5725D7F8EEB5A canaanitish
80,283,318 *088A140A14E36CFA4785DF6200FD9F7E5EFEC590 [email protected]
80,283,319 *088DD956B9B2BA9EF5E00B57861E29855B45EBC2 rn%r
80,283,320 *088EC4BCA2DBC8C5DA971AADCC0519E8A1BEBCBA terminalknude0
80,283,321 *08810C7AB78B15AD43246B1B5FCFC1D9BE932DDF CARCINOLYSIN4
80,283,322 *088AB774E8B248B0B3C368EC537FE45F99041941 CARELESSLY,ASTHEYDIDINTHEGOLDENWORLD
80,283,323 *0881324B03240599302E1C170CF80DE659094A70 TERRENEBSW1
80,283,324 *0882BBFF43B46613B166A03D66554465621F0A2C TERRISCOVA
80,283,325 *0888F95BB91B01E94411773DD1FADFB598FE369C CARL.GOU
80,283,326 *08852B32EEF158AC2D8530CB050D6FA2196963A1 robert.schell
80,283,327 *0886F0DB27D841CB3B421F2E0F03A9FC425925C8 CARMEN-MARI
80,283,328 *0889BE5528722F0016A270A0A20E23EACFEACEDA CAROL.LUPO
80,283,329 *0889191B3600AD0424BAC073FBE115519DA5E426 CARROL.KARPINEN
80,283,330 *088B720EE18252FF0D7E14911CE646C111CA1898 CARROLL.BANSE
80,283,331 *088427DC5A2B59CF63DE03CEB718DE711F423660 CARTELDESANTA1223
80,283,332 *088205CC8D3C289D5BD426B5D538A1E5DE366349 caseyrattee
80,283,333 *088C73F8CF2EDD441244C49CCFE1E8E60C028159 CASPERGAARD
80,283,334 *08838DCF73D3EA4514E8441BCF7CCA6073F2165E CC.&,
80,283,335 *088AE0A43C3B737D63D973A04F48C39E2C1E412D [email protected]
80,283,336 *088F2C45398FACCB2B0C0BE08EE53DEFE7207E3A ccez"
80,283,337 *088068F6958CDF04CDAB892511BB86CB11B42BC0 royburchfield
80,283,338 *0881DA58B601A42A6AB16949BE4F8113D406C8D5 ceedgee
80,283,339 *0886C0ED1F11E2B2494D847E3FDD815E149AB443 THURMAN.CLEARO
80,283,340 *0882E07C6F44EB39C9A50CB0177D2300DFA6A1EA THURMAN.CORALLO
80,283,341 *088C7CBA5F7912602CBC56AB3D7A4E95695E13A0 TIANERP9
80,283,342 *0883660A08EFF7D9008DC45CB200B5924F8C925C TIETYKSI6
80,283,343 *088AA1BCEA1B0CDB9B02416131E2C558D33E8D67 [email protected]#
80,283,344 *08894E9BCB3F953CAFA4537BA43C663C2B5E31E3 s2n232
80,283,345 *08810C5ED562BF38D9FD6E4B8A368038654018D3 S8IADI7I
80,283,346 *0881D756CB1B32E0C972EA31A71C494EA86FDCF4 [email protected]
80,283,347 *0885CE3EC3B6A08E9514850BC6205F76E13B0677 [email protected]
80,283,348 *088811F69887E6BEBE8CA1227887FC30F5AB2CAA SALVADOR.GOAR
80,283,349 *088D8D7F2E12FE9FA569D8806C5B6F538A01D7AB sandhyakkenthinu
80,283,350 *0884AE5CEF3B46C63C3DE9FF4B57D6114EE5E2E1 timdesamparo
80,283,351 *088B4666F2039ACCCBECAC1EDD411ACE3F0CE3F3 CEQf
80,283,352 *08898F852E4411C8DCAA4D35F50B1344F6763489 tisharay
80,283,353 *0881F536459EFC94BA4B1A6595DDF5182A857B9C cf(cq
80,283,354 *0884062BD34CF5E3E35F2ADDBD23F086E255575D cg7ti
80,283,355 *088184EAF85BE38E35AFFE742BCFA506B8F24065 togetagun
80,283,356 *088DFE32F0CFA49ABF87BBCC277FE880A0D65066 SCOTTYQUIGG
80,283,357 *08871EF645CB9160154ECF6E060C8ED48E4FCCB1 CHALDESE2
80,283,358 *0883654651672A2D1BA22D3CCE483BEB32D27834 chanteur fran
80,283,359 *08860C81DF2C1927FDA50B77C373BFB338361C09 SEANDIANED
80,283,360 *0882216FB521D6B241F2C85D6DDB8F513D39A6B5 sean-pataky
80,283,361 *088D896FD39282980E6C93DE583ED580599F444C CHASENOTCH
80,283,362 *088881C5F8354B5EE85C50ECE41E5001E09DB475 torydoerner
80,283,363 *0884907016288A09D132E56A6DFA8FA62A80172A [email protected]
80,283,364 *0889DE9EB4AB77FF144E5B4CB4E262052444B04E TPISSINT2
80,283,365 *088661A19765792C01685652E22989ADF80B4315 TRACEY.MARTICH
80,283,366 *088926A138E3B0D5EBA15B3302135F9F7681097E cheureg
80,283,367 *0886CA4665817D825F03A2FF18DA156F97BF821D TRAVELOG'
80,283,368 *088C128A379F4A93AA9D188D00CF3AB2B9D781E8 chiqueros8
80,283,369 *0883A0F3240721014956C93B8C84717629D25016 chloe.leigh.smith
80,283,370 *0886002DF493C1447532B94047662007049FAF09 CHRISCUGINI
80,283,371 *0882E772D2841756EEA0D7C2FE78348176891126 christinahardie
80,283,372 *0885635B8700A5A8CB5F8AC7EAF060AC9B3D5C07 TRENTBARNES
80,283,373 *088C4C1EFC0856C7B49E91501EDB15C316D59AE7 SFBRWQCB
80,283,374 *088BB09D0DE7C2B741EC5FAEE3540E82163B5423 shadowkingdom
80,283,375 *0886A2FF99228AF3499300E0DE9C685D8315B7F6 [email protected]
80,283,376 *088E28198A10547EEC50B92913D3BF0D91B0EB2A SHARPDLBSWING
80,283,377 *08885C655F8D32879EF23C07528B05A09A42ABED trond.overvik
80,283,378 *088CE630F30B024EF890629AE4B7CBDEEE6999E4 CÍMLAPJÁÉRT
80,283,379 *088833BA47CA5161B11BA361CE0BCB7E32158F3F CINDERGRIFFEY
80,283,380 *08849D9894AF84B4521080D6875DC96C14A08CE2 sheryl-jose
80,283,381 *0889EC496691D7E38D22A6344D543008DFF4AD52 CIZ.DIBUOS
80,283,382 *0888D4F439D0A2CEB02F10576AD4033BF79854BB shewers
80,283,383 *08866C93DB20FDD08DA933629869C5DB740BF2AC TTYRREK0
80,283,384 *088B94FE2F786438318FD220A9A0F21D4D912F57 claire-shen
80,283,385 *0888D29CF1E8C4E4C586A8E728BD68670DD0024F tuftsuniversitysq
80,283,386 *088EAE19F06BCF3B1EA0BD97CA5620C2639E4B18 claviformin
80,283,387 *088A79AB160FDCCF68CD8055E450044DC7FDBCA3 TURNING HIS FACE TO THE DEWDROPPING SOUTH.
80,283,388 *0884F8A8A48C722DB2BB231F9128101D803C65C4 TURNITIN123
80,283,389 *088D620DE6355724004F04BA4E3D4B733CC3DAE1 TUVAKUDA
80,283,390 *088E0FB03FEC5D17DF2E62E88BAE34EC2C9CFF21 CLIFFORD.KLOCKARS
80,283,391 *0880C0C0D7B44E3E7CCC8133880698F3209E3EC4 tycartaya
80,283,392 *088E1AE6449FAE72C75D9BB8D9CEB7A52140AFC5 CLIMAX 4 (INSTRUMENTAL)
80,283,393 *08894E249BB296E29F73BEA82905E2424B660814 tylermcguff
80,283,394 *088563AC094A9B75F42EDB330330DAD3A9D54927 tyrannizers
80,283,395 *088794A670B6B0361BB4E3002E000393FD3B1257 cmtf%
80,283,396 *088D2FB9808347EF247C1CF80CD35FE57AFFAB50 COLEORHIZA3
80,283,397 *088854F7741430498635347EC74E286E20A5DE3F COLUMBUSNIDA
80,283,398 *088C36B0C5EBAC8D88059C9D3D473FFF8BC84B2A SKIANSIO8
80,283,399 *0883ABEB2D04130795E5B2116908C2BC5E447243 skitetse
80,283,400 *088266576263556FA3E33633997976D77D58994F SLLABSELAS
80,283,401 *088C40778A0C4D1BB2CDF180DF0CED2105A26770 ujvari-jozsef
80,283,402 *0884D149F8DD343043B0EC905A5617C072B86FCF SLUIPWES3
80,283,403 *088F72F396A719599A4345BC4A294AB9FA2E741A soared1
80,283,404 *0882FDF62299023DFE1560801263DCBE9E15E5E0 cortezruschak
80,283,405 *088A990DCA219CA666A52F977E0AF39CA74FA1A8 SOFT AWAKENING
80,283,406 *0889707540EC2F2DF8B99C887A0FE3B5F707A0C8 URIMHAJDINI
80,283,407 *088E6B24951293CE0E1F6624702B120A26D08FBD c&qn;
80,283,408 *0889F44C657F93B034EEE24CA05FD481D34062B4 usha-s-gowda
80,283,409 *0889E04353A1E3D282A9C8F56261F4E8B9650F0A uss160hawk160py2
80,283,410 *0882FC8C3A9CB315FF16FC50991AF157B529195C UU.~`.~`.(q
80,283,411 *08819C64B78AB007EFCD88D87AA6641E1B585D2B CSCL
80,283,412 *088D1F88E569B2D607D9A2FEF967C5E10843179C CSITTING
80,283,413 *088F3A0590CBC1BDD908186EF8B1D6C4FC68CED8 STANLEYSTASER
80,283,414 *088666C23D4AA48529301C53189ACCFDACE03C6A varved!
80,283,415 *0884E1B549F2C42C88481B5A23AA650A5E250569 vaughndunleavy
80,283,416 *088C0B72B2316CB279FCD621D0F1C75DE0DE50B5 VAYRYNENBSW9
80,283,417 *0884F8EF90FA39517E3CBA8044F3E1F71F81B8C6 vbczqcv0
80,283,418 *088CB17180002E44E7096A375126B441B88511DC CUA:!
80,283,419 *088FF0EF34AAEFD7F155BB7DDEC4D36767DB53B8 STEPHEN.DEARMAN
80,283,420 *088359B89CE57B0FC1A04D580C67784D3FF610EE STERCUSES
80,283,421 *088592479E8060F57EE102957D727AB29B1BCA0D STRAIGHT NO CHEASER II
80,283,422 *088FF577DAD49CE241F9C3102427870BEE0A3DCA VERHEIMELIK123
80,283,423 *0889D67D883BF2613957A13DC5CBCEA6139B3116 cv2sq
80,283,424 *08802561F4DC9BF693FC075DE7550A01775A4F32 VERONICA BUNGA SYADHIRAN
80,283,425 *0881E82153BC26189A5B6CF09C686B39BE093BB8 suita ei haluta suomeen
80,283,426 *0888A37E3FCB70E7DBB63BAE75D6A362DBE8ED39 SURENJOE
80,283,427 *088679A9BC15AE5ED816F24ABA28DDC1286EAB6D SWEETIEFOOTBALL3
80,283,428 *0887BAAFA3215D5BE3253E84CBA447DC5708C2AA S&WP
80,283,429 *088CF048BCF67C03D823A5F923AED2121058D04B d1$9d
80,283,430 *088F461F59A20385A3D174F43102DF1DB0D67393 SYRJSEUDUILLING
80,283,431 *088AAC30E0F47FC70BF5C6E55A16A717A224AD63 szavaigs
80,283,432 *0885B7DFC1724015B3675434A196651805D59D53 tablas.iguvinas
80,283,433 *088E01E814A19EE972B21599C5EC7B12286C4289 T'AIN'TNOBODY'SBIZ-NESSIFIDO
80,283,434 *08882E524730BD39D5F01783C0B0F8674A5887BD TCHIDHMID7
80,283,435 *088928DA31AF549DF628BB112A7C8DB1EF014EF4 technicsdjset,volumeten(disc2)
80,283,436 *088813823A0AEF351E43B4699B3DFF41CF8C1862 TEGENSPARTELENSING
80,283,437 *0882E599531AD33E28EE84F7BC2E1324F1CE7344 d&)3y
80,283,438 *088BE485DB8F36C2E04024F8CFBCC923790C492B d4)(d
80,283,439 *08822BF151D769EC2BA2331AD76B8CE4544D74E2 TENKA1
80,283,440 *088EBB1F4F23EAB2D54062CB3775D55843DF8C4D D8BE&
80,283,441 *088785C4EB63F782E0489413DD4DB4179EEEFA23 Voorwend
80,283,442 *088C562722754FAC9D2410C3B2E5E020901FC27B dai 7 maku ~ kozue dake no miki [act vii ~ kozue's own miki]
80,283,443 *088757AE5DE6E43415E53BAD6EA79ED5CC5483F3 WAHYU.MATIUS
80,283,444 *0884A5C933E2D43848818FC2A2D6ED178B0255BE DAMONKERSCHNER
80,283,445 *08858B42742EA209F67B085A5282076B75174BE4 DANECHAMPY
80,283,446 *0885ADAE2CC2381FE094688DC18354731340E1F9 WALLEYEMAX6
80,283,447 *088D435FAD9A99D9A25F538A80D8F5E35A076C67 WALLYSOLAK
80,283,448 *0883009F0D8205EF987C02D6AF0EF1916498A756 walt.barr
80,283,449 *0887B817E25A5108489C9D4DA701ADC3FAC15060 walter-h-wiesbeck
80,283,450 *08828B95777D338E5A34B1406AC0496B138775ED THEALLISON39
80,283,451 *088FF3DCED99FE83B72F26189C16FAADF1733D57 THE CASTLE OF HORROR
80,283,452 *08841FDB4F9183E8E3F6967EFBE46C96BD8EF50B DARACENA
80,283,453 *0882847F44B70AE0996D5C8BB1FDD594160F724D wardha.andre.cuma.manusia
80,283,454 *088C21F8DCAB2BEAEF2B6C8C6EB0C69FA7A63CC0 DARIN.BARESI
80,283,455 *088E00345C7775DEC0C5C8B73274C188A8EC5A2E thegretzky88
80,283,456 *088F77AAE54ED57612A09E2BA9F58F781DDC82BD THENAKEDPILGRIM
80,283,457 *088D52DD4493BB1F2E310C58B7EDA48E4A847332 thepluto1998
80,283,458 *088DFA0A5F414BE97BD198412A0F6B55BBFF3C90 THERとも)の略称。「ここではないどこか」から力を引き出し、想念を物質化させる高次物質化能力(もしくは高次物質化
80,283,459 *088A35C41B8D579E0538124152BB8EF356EBCED9 WEEZIM
80,283,460 *088F07E9B46712095F060E9CAA54AF74A4B9AF25 d.b1?
80,283,461 *088B3049576BE584C8564874FE638832F622FDFB D;?BI
80,283,462 *0881D25A9EA779FAA3D456362FA58B07CAFE2219 d(bp5
80,283,463 *088B25B86CFC80D50513C35390343DB1BB05AD43 dc,0#
80,283,464 *088356527F5ACB18554C1614EB1DA46F7B6DFAFC d)d/8
80,283,465 *08893AA6AEFE6373AB61A6EA9CBCA1AA5F262287 [email protected]
80,283,466 *08836AFBA1A0B2D538C40C80014631B0733F0A50 DDEW
80,283,467 *088672B48D429740C8C5A0E7EFFF73B4038C5284 TILATAIDENYTTELYYN7
80,283,468 *08842DC431A1BBF45A1ECC61FC27BA76BE4D877B TILLUTSU5
80,283,469 *088A94479E581D1141624F9E114C600FFACD3598 TIM.BLAKSTAD
80,283,470 *08850B36F917F20F41F4010A1B025097F2746370 deaspirate5
80,283,471 *088BD4F54A62B9C568301AA274E93FDC831240EF deemashburn
80,283,472 *088F010835E1F1BC0672B570C3423721C64BE0D9 DEGRANGEŮV
80,283,473 *08858A1D7FC67FB3110EB81D7D6BD63B146A560E dejsz
80,283,474 *0882B16C0E6A77D06D7775971E245A699D31DDAC DELASYMBOLIQUEDESCHAPITRESENFRANCMACONNERIE
80,283,475 *08838898B17EE12A60286E2B611BDDAF6B24CD83 WIKIRRETO JULIODAVIDGUTIERREZALVAREZ
80,283,476 *08882050A6248A16653A40798AAA7495E710135B [email protected]
80,283,477 *088407455AB52BB60ADEE2A53FBBBF73B8BE3CC1 TNA/CNED
80,283,478 *088F61B777765680B3086B4BA4E666A1B4B2F793 TNERELUMUCED
80,283,479 *088F09B321AEE369A73F12DEDFED698068BBEDB1 WILLARD.SPIVERY
80,283,480 *088B176D7E0DD88D0D2585E7000C7724CCAF2936 WILLARDYOTT
80,283,481 *088A30CF2221BDA9940BEE659D7B488C8252A7F8 WILL.O.-.THE.WISP
80,283,482 *08881524F3F2F4540502D2A38ADE122B61DA8376 tomasriedell
80,283,483 *088897E8D9E3AA2E8CFA753852D0D499A5619B01 derrickspraberry
80,283,484 *0880FC1B9121181852E3B786E5339B85A613BEE5 DESEMBALLO1S
80,283,485 *08804156082B0A59316AC8801BA4917229EEB1E0 winny.zarzucanym.czynom.go
80,283,486 *0883274FA6EA6C233E764708DF9D1FA6F142F435 DESPANSES
80,283,487 *08858A5ADCC4989B02BBEE28D7D5B444C225C6E0 TOUCAN
80,283,488 *0886F72740416E7473773768613568C15F967184 wohnheims
80,283,489 *088AA1151FE1EECA52424801EBAFBAEF984CDEA9 DEXQ1
80,283,490 *0889A946679E2150ACD57D511FC245C2FD838549 tracy.v.jefferson
80,283,491 *088DE9AF6598E0F6B7F25FB0FFE1AFB94AC74B0D transmission-/-remission
80,283,492 *088880235C9B2C11B0606E4630A4D1CAB4BF5A37 WRZXBSW0
80,283,493 *0889C6FBE2248A9029A155DF282E92F638505C5C dft+f
80,283,494 *088873D103AB931D77B44540E025C77841EBF931 [email protected]
80,283,495 *0888E420B93F4F15D2CCAB535CC23175E1E2E074 WWWBSTUDE
80,283,496 *0886492CF4B0EA68686E423F089C761AEA7D0D9F dg:o9
80,283,497 *088C61DB97531D386C1A20C8C8C0657B5647C23F DGX7?
80,283,498 *08837A308F5C9AEBF012A435947BA7488B1CF3E2 TROPNEVA4
80,283,499 *088D7E7B6B22E040D81C584D12AF0324D733944C XESLATAF
80,283,500 *08875AD641DA2F84567D5CC369E8C27A8163BCC2 DILLONGROSSMANN
80,283,501 *0889405B64CF2D8E3CE6BE1D3F7B1E68D7AA6792 dillonlounsbery
80,283,502 *088419B8DB4ADA44EB8FC8923FBE895C88638306 TUDCHARCHON
80,283,503 *088DD7615B243783928E38EF375E14792225AA19 [email protected]
80,283,504 *0880E2DF626BA2BC465F95EE3DA9BFC05F1D6EB6 tuhatp
80,283,505 *0883336BEAE20B9F67A452F17C56FC786001F094 dionteichert
80,283,506 *088E112A0717676A8D811AC95AD2BA8FC694C790 TURBINENMANTEL!
80,283,507 *088D39E73E29CE267B0AFC8BC76790E2CC89F845 dity)
80,283,508 *0883272B4988225235AC14CD370030F8978F8CDF divertimento (k.251) minuet: tema con variazioni
80,283,509 *088CB8FF41BC0BD53EFA077F8707D872744088B8 TYRECE-LIGHTNER
80,283,510 *08821607BBB7C834C93ADCCC76588F82F4C5A0B8 TYTTYYKED
80,283,511 *0880800CDFE101233B7C15FE316D5A1304503F2F YASMINE RANDALL
80,283,512 *0882A472B40360690592329CC59BDD1F33CEF368 U~C!
80,283,513 *0881798C78D886A4DE308023588E088FC0ECF8EB yçuré
80,283,514 *0889ECDCADEEC9A77A4BF9C318A2FD1271BD1FDA DMCBW
80,283,515 *088A155B6F6F69D713F8438B25BF92AA2F122A71 YOENA-GARCIA
80,283,516 *0883DAC0BC839DC1005309B79714742483DFA5F1 YOLANDA ANTOLIN
80,283,517 *088CBA49BB44E8CB2E14D21595EBB408D1B13BE1 UNEDUCAT3
80,283,518 *088D0745E6AEBAC8F0309E9E325671EEA2EF1076 DOFRAFJALLS
80,283,519 *0884BD478B235FBA83B3D103AC33FF3ADEE85D11 [email protected]
80,283,520 *088607C91F8F1A5FEA431FADA0B2CC32B8D67CBB YU KA HEI
80,283,521 *08875C21399E95298E983DB9ED0AE6DBADA9C799 UPDVDCLIPNO
80,283,522 *0882AE53D024B90A241F68111B406E4501CD8C30 don-dacanay
80,283,523 *0885A99FB1E961A3AB4261B625AC9AFE2A301EF4 dongdronet
80,283,524 *0889F6E69D1D2111FF74796B77C9BAFB324BB767 URCIOLUM3
80,283,525 *0880EFE8569CACEF79EE186EFB04376D3F607F40 urheiluasuunsa
80,283,526 *0884A11BC5C6EB83ABA3E55264F0189DED3BC8D9 [email protected]
80,283,527 *088B6D1F1430B7BC9F3C61114BB830C45C1A1023 usamah.musa
80,283,528 *088A34BC219E026639138F14D6E99B9903E17F2E uscvivis
80,283,529 *0888DD5791625FEC315861B634562E6B23637EAD Z*'
80,283,530 *088392A8CB96D931391ADA33A6BA29FE444F2937 zach-bonguyan
80,283,531 *0883E04A3E40937B696D15E394195726742131D6 ZAIKAMONSTERS
80,283,532 *088AB40B2EADE30184965A191E7CD6ECE1F5F220 zaurusesing
80,283,533 *088E389E0E2EDC0E3AD963740D9A6C66BA1AAC92 ZDTJGJQPENRGXES
80,283,534 *0886AD694FA52625ED2D0BEC2A880401582F2E18 z?dz
80,283,535 *0887FB582495E9E7DEE5516B72E9CB025A565866 D/PS
80,283,536 *0881D6097759B2294370DF69B4DB16BE51653977 vanessa-hardison
80,283,537 *088D0F524A3FB26B0EDF311B5E3352BF860395DF vanessatakeswarbonnett
80,283,538 *088A2B5EB9AC4516F09DC47F83F6E86DE9D2505D dr;;
80,283,539 *0882ABDC6DF7E60F4578DEAAFBF3BAAE4255DCE2 VELOCITYCOTK
80,283,540 *088C64683EC00BDBD000DE39A3EBD3C4BA664FA4 [email protected]
80,283,541 *0884A64E9966F448383C455D81B655CDA705C71D verleyhillier
80,283,542 *0882B71AC3A5BAD67FA651FBD057249CE58C3A44 veronica.bunga.indra
80,283,543 *08826F5144563146CE7969B54CD105307257A939 D#/TM
80,283,544 *08896D41F410F89322394145C2C7FA80C46A1EDE VICTORIAMISTIED
80,283,545 *088DCE8E19E207A8876F19DBFDEE69039A70AB1E vidatv
80,283,546 *088CAB1A7D7014E120E5880B661745C2CA571448 villag3.r
80,283,547 *0880130F3E7CA039542C64A6131C1238B5A09DDC ZVJXGCRLRUJA4
80,283,548 *088DFE5D2C6B471AE9CC4E793A56B03107DEA1B4 [email protected]
80,283,549 *088875E314156DC2AC433ABC95699E6E40D62927 DUWL
80,283,550 *0882C44EEC8749AF88F966A03ED339628732B88F взаимоуважения
80,283,551 *0884EA6488AFE41B0D999EDF4AB652CFA9EE5059 DYG",
80,283,552 *0888673A9A0DD13BB9040493F0432A8BF20BE47C dzzb:
80,283,553 *088830D7D1C8E28A3D1D84CA3135F2247010FBA5 EARLE.DESMARIAS
80,283,554 *0888D6A8A28F6784BB39D9FE59B8381DBAA6914F ПАРТИКУЛЯРИЗМ —
80,283,555 *0880130D6A92B235066980B032247F996506AC18 [email protected][email protected]
80,283,556 *0889F5F8207E7307E6FAAA8C4498FD0E63208450 ebongbsws
80,283,557 *088A570ECBBAED64C6CC89A5218D3BBB740CD731 >@waaa
80,283,558 *0880BEFDB93624182A2C5698D4C0553E102404CE WARNERQUEBEC
80,283,559 *0885E357E4852D8F5EB6A71C959D75BA0134E058 waylonlesch
80,283,560 *088E1842BE5DD7BC7823B51543C4430E9D050867 WDXCCMYW63
80,283,561 *088FCCFCBD0AE98B533CF48D7F8F5CD936A5634E WERYUPO.VIRUZZ
80,283,562 *088A4EC35A5CAAD85A74CAE8F74EDA029C7BBA48 WES.PEPPEL
80,283,563 *088EC2F5905AD51F5ADF456B3639A1C37D89CF71 WETTERBERICHT“
80,283,564 *088A137D3060A97576472419402231755FF09C4F wilfordpennewell
80,283,565 *088141EE38F9D9ACA58391E253D2446A9164D2CA WILLARDALEXADER
80,283,566 *088AB68674593F81BAEDBEA42364FFEDCE197D77 WILLHITEINSULATION
80,283,567 *088680600F48568F279CFEFE827B1445BB266BD9 WILLIEINDIGO
80,283,568 *088335AE3F7550BE259209872137AFD58E93D397 WINMAKER
80,283,569 *0883F620229C3AFC898B056652DE5A7E02A14B91 WLIDJI
80,283,570 *088C8ED463F12FF54D8A613197827BAE6AA58624  УФА
80,283,571 *0886E0189F611C7F26D607AED22783F47D95EBA0 の一分野であるファーマコキネティクス(pharmacokinetics、薬物動力学あるいは
80,283,572 *0886CCE196DAAC433BC0D9AA6645D1B9A0866772 [email protected]
80,283,573 *088AD66C07FC256CFD7DB78724EE6C07D0C0421C eetideer0
80,283,574 *088E4FA9B3D526E8E6CDF371D8671BF5C06225A1 WTMOSSUGGESTED
80,283,575 *08820EBEE611BC243B2C896FD363424656B2564D efrainbrogdon
80,283,576 *088F5D0EE254EB20A2CF65FD242B09DF5B188863 [email protected]
80,283,577 *08894819E147BAEB1B2173BD8048D7E96B432272 efv98
80,283,578 *088CA4A38782D4E9C5EA74791254E0AD67F6B70E EGIPPORK1
80,283,579 *088E84948B25FA87ADF6829D3B0940F140EF43BB xanadu1951
80,283,580 *0882E0F860ED115C6A67FBDACE96424E0209C026 ELAINEVISSCHER
80,283,581 *08885B98E085BA285E08D85EFE1FD80494553942 elcsubra3
80,283,582 *088F1792D565E1A142BB858BF10968A2B67826C0 ELLSWORTH.DONLYUK
80,283,583 *08858F7D6686FCDAC491FBB72362F4E9B7A5AECD ELMER.MCMURTRY
80,283,584 *0886436F7820B64274AE16D8948DE75323BDBF20 ELROYKALIS
80,283,585 *088214DBF9307FF05804339C6F3B9541B0151598 XXFASTJXX
80,283,586 *088931B638D94DB308EE51AA332E7E37B59F3782 y4lp
80,283,587 *088731A6E02B28DB1F59DB7D1DC09DE265378DE0 emannegie
80,283,588 *0885B8F3943BF6253EE2754E1D35C6A4F0DD6665 EMBUSKON
80,283,589 *088BBC42F1E347FD3E19DB88C2B28AB533FD57B9 yankee doodle, tell the boss
80,283,590 *08851745262DA6271302AA31F0FF22D345DB63C3 [email protected]
80,283,591 *0883C205208FA4D446B5A1CEA994F4C142CD5BBD ye-hengchang
80,283,592 *08857921C2E8029BB2117407414DBE7E5D39C412 yelhsaazzip
80,283,593 *08855DBFBE2A23F42B3075FA4BE6E0CB7D7DDE9A YFIYYAX77
80,283,594 *088EADD453B65E9CB2ADAA4F9DE9AC2A153638F6 YLHTNEETRUOF7
80,283,595 *0880CDEBBE8CDB6D3304EA7F07E305A08569485E YLSUOLUPURCSED
80,283,596 *08812390449D5ED39CDB02FF2BF4E08C8BBBE340 yobtaf12
80,283,597 *088416A2FCB6B28042EF0126C10197AFACEC7CC2 ENTRASTI3
80,283,598 *088E0C08DE42D714D5EFC13D93324D3A635D3C4D eqe0=
80,283,599 *08899F3F7FF8F03B47BC2EF2CA5202DE357B9D15 eqwqv
80,283,600 *0886585E3342306A729BA52FF299371B8D6656E2 YVETTE68
80,283,601 *088B85071E0BAA09AA0B924BB13E9AB9A15B3913 YZABELLEK
80,283,602 *088F8AA4329D7B9224F2065EC4AF89DC2812B6AA Z108191
80,283,603 *0883B34AC5D74EC61CA0C384CE7C587E54DAC84F ZACHARIAHOLEJARSKI
80,283,604 *08814CC00BBB5C3600D42DAE0105F1D54B7EF0E6 [email protected]#
80,283,605 *088965C08A8DE96DA0C44B64FF9FC7949A27BC89 erinzeolla
80,283,606 *08802ED3780D19717A50177576A558B8536AA93E ZACHENLE
80,283,607 *088CDD73AC4655E4BDAAEF14DBB86CED82202325 zandilenyathi
80,283,608 *0889B501FD55D6538FDB93FCFB7B5CAC576EDD96 ZBC
80,283,609 *0889DC2A9511DD1712FF6C54CF5794AF3D4354C3 espacerent8
80,283,610 *088B85C54E762849D2DEAE366B603431D25580B5 ESSTABLE
80,283,611 *08837751427A388C0E5C38FB796A88626983389B ETERELLO2
80,283,612 *08838D92B5C237808212E54D96D5813DAB21DA41 zhaofuli
80,283,613 *088F478E15AD0800EC1BC08E2EEA0ED84A8EE0F1 eugnilib
80,283,614 *0882403805E28B3CB7BFEDB4C913144ABE4AEB23 zoldi5
80,283,615 *08812E49C92E5A0B4219C27B7AF46C58D9D7651B ZULIANA.JAAFAR
80,283,616 *0888384DAC5C115B099A1EE67561281F11805B84 z$wx
80,283,617 *08870A859E00B32935604C45353CB250E34F8EA6 ezzy31501
80,283,618 *088F6B785C826B0209572B10332BA2C287FCE38C БУГРОМИСТР
80,283,619 *08885B1097F916E1F3FF5BAE4EE19F963FA760EE БЭТТЕР
80,283,620 *08845B700DC224990D7D79559F552FC70D8673C3 ВРАЧАХ»
80,283,621 *0881CB85C4A76A203ADADBC7908814E2901E4659 «всемогущее
80,283,622 *08876B7A47621EC91D7D59EC15CD7F76EB034628 07041537
80,283,623 *0883BA899D4D8750E92B32DE735AEFF3EB7DCD0E жураўскаму
80,283,624 *088B9FE009D1E5C034F1D447AC54947C5C2B7E84 oY
80,283,625 *088CDB4285CC400E587A5A80523F98D936A9EFD7 изæрыгон
80,283,626 *0887612404B2DEF41E90E416E50BEF66CD822553
80,283,627 *088037DB8093FBCE63977F3B38287782AEE0222C 1015176 ohjelmisto.on.t
80,283,628 *088CD3B54332353186920E89A54FAA2380144F24 
80,283,629 *08880DFB111913558C6633212A8A42C3E1F2236B
80,283,630 *08840BABE5944083B3CF0091C1DD6157FD1909C9 (Ll
80,283,631 *088A8B2026057E74893DCA7D2A642D2DE85C9DAF Dd`K
80,283,632 *088FCDD200AEFBE5EB4AF6E38DA6DACD726874F4 1278270 paineleboordinauhak
80,283,633 *08880555F41CD04A9676B0A50F8648FC656D5854 12-DREW
80,283,634 *08818DAED5F1BBE4CF70343A0023F3FB6BCE20BA ПРЕДСТАВЛЯЕМЫЯ
80,283,635 *0882621EC0DC689D9171288117BDBA73C0FA9E83 РААБС
80,283,636 *088749AEAEA436622E24C0506575323F05E38312 13579training
80,283,637 *088775EA81A35CB2E6F27B27F74452ACFED9B91A ׈
80,283,638 *0884DB25DCE16AA4F1C13C50E96EE04495026AD9 魖K
80,283,639 *088A39F5C99276FB59F4C65206A4906CB129EBC4
80,283,640 *0889DBFE7EC749EE0AF562723778D6EF1D6A8F72 =
80,283,641 *088EADB67680B51410AA34DBA4FF21EA1648A204
80,283,642 *088D5679AE706CEF2953555E20C3E96E109EA8D2 13-vaalivuoden
80,283,643 *08880F2B5AF2B43EB662BBB264ACB1FB8589B107 X
80,283,644 *08825B1AF68FE5D322256EBE9F8B97CE9AB1967B 1493768 JOKAINEN-YLIOPISTON-TIETOJA-K
80,283,645 *0889CA3775FAFF3078BFEC3EDF77DD71071166DF 1522103 closer-to-newport-,-however-,-the-damage-was-plain-
80,283,646 *0884CF147D6496D3C4177F06F94569B83756E8B3
80,283,647 *08885C47A5B0F7DCCC4A5E1975CAC043677FB38F 158503 OLETKOMUUTTANUTVIIMEAIKOINA?
80,283,648 *08894330E1A31CEAB772B758F2E50B2507BFFE42 ФЕРИ
80,283,649 *088167A2AEDE61E3A51F1B375D5475E80CE22E28 ШИШС
80,283,650 *08884E49A50A116B5352F804F2CC2FC2B772811A ШТАЙНДАММА
80,283,651 *088FF06D954DD8547EA3080464EC6F8A7C059917 s>
80,283,652 *088605C2EA840DD128B5574B2D2F8367124BD392 17SANDIGIM
80,283,653 *088C1000CEC0508F3E9FB093334200AD9BCA8784
80,283,654 *08890B83B5B1147661AEB6F8DE1064A1529644AC
80,283,655 *088C9532EC18E0E4B0463E11248150515F889653
80,283,656 *088C398BB8AF9471DBA2B6E4849002A0316BF6B5
80,283,657 *088442242F1425D31F0430504AC38A0D3DC63F66 z
80,283,658 *088053FF7819D3E101BA5FD5D135B55A51C4FFEC 地方に呼び寄せた。ウクライナのミェンジジェツ・オストログスキ(międzyrzec
80,283,659 *088DCF70368E058E32526901001446BC913D45AF '⋤=t
80,283,660 *088A0F3AD152D37D5197950148E70C6F45EA2B49 +8H
80,283,661 *08877AE3F3D621E795A17D10512AEFEDD5023A4D @ݖM
80,283,662 *0884CFB65899660D31E10A52BCAC8EF6BF7F1597 1BEIFUGE
80,283,663 *088980B57A7BF9EEE4D9F7C4398480F166EB81CD F
80,283,664 *08807C327ABAA66092CDD2B1155BE85DC5D9A041
80,283,665 *088FE9AF6EB6B618833261AC94BDABC5046C85E8 ;ig5
80,283,666 *088FB1CA8DA26DB8BB9A8F146FE3DED09D29143A zb
80,283,667 *0883F0CAA0238089710EBDEDE7C03FADAE896DB9 M
80,283,668 *088C0ACCCD4BFDC6BCA94CDC83D84F7B48B9B834
80,283,669 *088B08C68D82F97F847C2CDC1296B2527475982D
80,283,670 *088ABD8B8334D30EE99B02C0FD338DBE09369F88 採用傘兵型minimi(名為m3)。
80,283,671 *088E6C17F25E33B2A36D57492BFAD628044C3C69 cl
80,283,672 *088323EDF6E1680C4846CC324298864C6774B506 U
80,283,673 *08824AA0386CBF079DD61692591BF7B59A3993D1 1i7h0gr4pher
80,283,674 *08835C61A2C6957C1311B8C7695EB731D79B0031
80,283,675 *088E214D508FD0C4181027A83D9A01EE6693DA7F 1IVENE$$
80,283,676 *088DF3C70F794EFEEE238BC6983CB03C64CDEA14 
80,283,677 *088859EEE81AE483EB43C5ACC4C4C9780D360A7E 1.JUCKREIZE
80,283,678 *0880CD3B9F0E0EF6924AFF4284552D4ED7CC911C 的星島(STAR
80,283,679 *0883245F89C76252E368968E683B4C7C36B0D584 B
80,283,680 *088AD0A60B77332813E9FE30B34763DD9D834717
80,283,681 *088F171CC198C4D7210E6C3A0B9E0547F45BCD18 1.markkinaratkaisuihin
80,283,682 *088607453DB06A2F96BD6225D119F57156DE3660 1-mieshenkil
80,283,683 *0887325E2F7BCEF047D5A45B9767636CB4E64729 2
80,283,684 *088D4271020920ECD7CFB9B81E37250E3B7AA410 1PAPiRO
80,283,685 *088EB335001F7DCFA49599C0462AAF661FEFEEB8 1poutiaisesta
80,283,686 *08866B47FF4A61093139B5FA4E264B9BB2984F2F 1.preservaatioon
80,283,687 *088AC459591F8E2D1F546E6D46C54C7F2AEEF1A8 1PROBEKANDIDATEN
80,283,688 *088FDF4D4E8D334836CC974BC75F22151C493F72 
80,283,689 *088E0A2896E4A615B1B31D8C8D9744023FB8A7E9 
80,283,690 *088D67F9EBA52DABA88215EABEF5E0B68D8F05EA 
80,283,691 *088D534689D336E923039AF38DED8B0CF8234528
80,283,692 *088CD5D97585C009611960CEC56A0761BAF3EC34 Y
80,283,693 *088D11FF640C544542A14EB55DCA18471AE7D754 Xu,;
80,283,694 *088ABA80C73591F6D3A745348D844717C7EA06D2 1-salamlarimizi
80,283,695 *0884F6EE58DC3CBDA9757B02881CA57DD6D71608 1sonderkonvois
80,283,696 *088B645DF898A5258D410CB8BA62304763DA47D4 1.source-gemeinde
80,283,697 *0885D38FBB1C7BA956FE4B29A820964523F2E0D0 1SYNAGOGAT
80,283,698 *0886674AEE5A30BAFB4496A94C25AA545BE51B78
80,283,699 *088755F134346D781B00A68D799B95FC1313246A
80,283,700 *0887B1B5636FCD1FC65B5CE47CE985CE57487BE4
80,283,701 *088FB9B01B8192990136F18439B32F8FAF8DB167 Jr
80,283,702 *088C04199F6C2673FE30D66ACFA4E1B063C73CC6 06281593
80,283,703 *08807451348B9886110DAC5B3C99CB87114C4E3C 0MYHEALTH16
80,283,704 *088090F8B6700318AB2B8005CD893CF8260F1A53 1.WADE-IN
80,283,705 *088BCED53620A4C4A01FB3F6C1E5BF6DC15F6253 1056176 ESWIRDWIEDERZEIT,DIEHEIZUNGANZUDREHEN.
80,283,706 *0883B442935EAA3CF7AD540F0480EE854BA2E516 2.04.1632
80,283,707 *088EA0189BCE1536C87D61D2F87B7C678B00193E 2067450 SE MAHDOLLISTAA NOPEAMMAN KUVANSIIRRON PC:LLE K
80,283,708 *088E40EE77F2D9C91BB4851564335474EADD3D97 1190359 BOREAKSEN.LAPSET.KIRJAN.HENKIL
80,283,709 *0882DF59F66FD5BCDF07D48CD41CD22A327DFAC5 20digoine
80,283,710 *0883B679C31B653948302E7F42C8CD530C23EFA7 222BAA
80,283,711 *08842CB70D6D969B8AEBBE110A43D04AA1357269 1329730 EINTRITT 10 MARK , KINDER FREI
80,283,712 *088E1F0649DA9A6157F88CCCFB1A0704E611D14A 08ashtyn
80,283,713 *08819487D3882DCAD97686925FA3151CE92D789A 1524532 FUER.DIE.CDU.KEIN.BEISPIEL.EINER.ENTHIERARCHISIERUNG..
80,283,714 *088E5989F4A77FC8C421E8C9099F35D59FA8B31C 2579946 BLEIBGESUND
80,283,715 *088135C34793D60BCD0DBDD4B9AF6E8F2592D1DD 2579946 BLEIBGESUND!
80,283,716 *0883768CC4518E7033A2DB6DA37721166D2A9A85 2709378 WERGEWINNT,STANDFUERALLEOHNEHINVORHERFEST.
80,283,717 *088DFE8A6B3BD2BDFDCDF66A3A248D7D1503A089 2744738 TULO PERILLE JA L
80,283,718 *08860EB3267A2E7785F45D0C0DAF9B3151051C93 1364892 TIEDOTTEET 28.2 . 2002 FINNETMEDIA OY OSTAA ELISAN S
80,283,719 *08859E61BB2D5C49BBDC10FA21B6D71B3AB3B89F 18.wespennest
80,283,720 *088462F4D7417800130E6C7892A163D79D65CE45 149903 HELSINKI MAY BE SMALL ; IT IS CERTAINLY NOT DULL
80,283,721 *088B22BDE6C9192F9FAEBE69A007F1440CA8752E 14.P
80,283,722 *08823FAFBB8A213E3D2024EE8A667F2E440B67CD 1ansi
80,283,723 *088BDE86160FF90B544679D15902500C3FA8E63A 2BOETIEKS
80,283,724 *08893F3C5DA55CB77398912E5234EDD0FCF26DD6 2"daaa
80,283,725 *08883872249031F76668AABD905D9D297891EA8E 1-CASCIANO
80,283,726 *0886BFECCA1D491FE4D624D2D1D8AFEFF4420930 2GSTOPTEN
80,283,727 *0882AE1C2664D2F768BEF77A32499AF1A42D138E 2HAFSEM
80,283,728 *088617643DDE56BDB8FDE4DA74A5587BDC8EA137 2ilovejuliet0
80,283,729 *088C789F8819D2B59988F115B97944FDE8BD033F 2INVIDIANO
80,283,730 *088119D837B6577A95FA2396DAE7E51185E0A673 19590306NEWEXPLOR
80,283,731 *0885B64241AF3516D5D0C0EDC92CDFC6791A8078 [email protected]+5
80,283,732 *0889C422460C0A667543E9D15C7AC5EDC4A788B3 2MJENICO
80,283,733 *088A97517CAE1609E59036FF3B2261C2779954B7 1-ALLIIERTEN-INVASION
80,283,734 *0886B8E153F0F1A70067974501BBAC3FB79809C8 1-arbeitsfoerderprogramme
80,283,735 *088C13B2A64A472610BF19F0248FEF9969ED8E22 1.jatkopanostustarpeita
80,283,736 *0885BEC03F525D169B4826AE9997B8F1C38ED790 1.ATTACKMODE
80,283,737 *08800807D4BA5452015D543D50B7BC029DEF3788 2 PARISTODAKARTOPARIS
80,283,738 *088E1A6AD2DD89DE311D5181D4B5420F35EE7E63 1 keksij
80,283,739 *08810477ECC16C3FECF42020D9F75B17D22974E3 2 SOTAKIRJALLISUUTEEN
80,283,740 *088BDDEC8E9E274CB2A1AA299EC4975668672B7D 2SUBORDINATE
80,283,741 *088EAB8EFBD39BF22356BAFE1626D4854D5A4AA5 1lehti-imurinsa
80,283,742 *088BCC97419A1735D3DE81F2479CB2FB837B39E2 1LEIKETAULULTA
80,283,743 *088F18BCB8B8DDEBA65247D4E399116B4428C7B2 3-08-1296
80,283,744 *088DFCB00BD042F3922FD42F2A63CFCC477F1631 1 meani
80,283,745 *088463B78AB9872216CE5BABD66FEED907247022 1MILCHANL
80,283,746 *0882D3B61D1EFD8596BA0A88267364624FB18A58 1dowser-phenomena
80,283,747 *08822E0313015D89651B64A4B4BC080CFE2FA279 1N73RLUN4R
80,283,748 *088B1EBCC7116D2287A122A8457CB3F0B5EF494F 1ettinggo
80,283,749 *088E71E6A05D5568293421871B2235A089E9A129 387992 ichmusstedie32ansagenabwarten
80,283,750 *0880B7D5613976A8CBFB4FAE2D51D8049AE10039 38.ikioman
80,283,751 *088E211A5707147954CC4F01028E3B83FCF5DBA1 1FRAIPONT
80,283,752 *088F077A25FA40F76B844AE5BA8501FF3729AC73 3======d~0~osplat
80,283,753 *08898EC8F3F42745B8CE734C5E3A921E3E711EEA 1-HEPENIKSI
80,283,754 *08807FCCC882826C27327D2548DFD6A89F8F9769 1POUCICE
80,283,755 *088101BB6933324C2E5AF826B5E5553F983FDB79 1INEXTENSA
80,283,756 *0884318460EC3E56F65FA108EA6142E0074147EE 3-kaukokartoitussatelliitit
80,283,757 *088FA2A03789FA3E90BFE0A3650CEC199CC227F8 1-KERNGEBIEET
80,283,758 *088EE3AB7F56DD8839418BEAE2F29580BF244BF6 3======p*-Splat
80,283,759 *088F3EA6963679D7A4B10B1CE7CD2295B1A2EB43 3.RISK-UTILITY
80,283,760 *088B01B686485F482CC4E59286E4B8CDBFC7A193 1tourist-crazed
80,283,761 *088834EB8EF4C8EB16E93B3747550A74F41950B5 1transeptwas
80,283,762 *0885394CAF663AEB802DC6A4C06882BA76E90376 1TRITT'S
80,283,763 *0881F8DF779592122DAFD103E4A5BCE1F820A915 1tuotanto-m
80,283,764 *0885B64829AF6297C3C49259B958007CD1B8D77C 3WUOROSE
80,283,765 *0888BBDF74C767FE46A115B123530958160E686F 3XCRUCIATIN9
80,283,766 *088EF9A5591C9146596AC1ACA3DCACE45DB012C6 1ZAHNRADFAEHRE
80,283,767 *088D206162AAB4326CD438BC46D42E59B4B2B27C 426coleman
80,283,768 *08896F9280E847EE7F22E0DE9E9A6FD7863ECAF8 1.liigaviikolla
80,283,769 *0888F4FA2C186FD8F692D1C972688C41FE67C88D 1 LIVELEVYTYS
80,283,770 *088EF4A14AD1BFF75E0D7F07209ED46724A64279 22OCTOBER1621
80,283,771 *08898C19A0726953E72BF2986C38DC4B1805328A 1MINNASSA
80,283,772 *08820616E094F1E2D8C8895F08CB6E71AC9BC05D 2342946 L
80,283,773 *088BF84936E495CFBB9FD44C2F00594BA0247CCF 1nak-priester
80,283,774 *08831AFE7A7DF839EABB6518000F20CC17ACD964 1NATIONALOEKONOMISCHE
80,283,775 *0886DDFB51005D21A5D65B223F00D83CD4F29D99 2436377 antti-selitti-,-ett
80,283,776 *088854F0D3D9C5AE9BE0FCF7325190EA66FE2380 4-LUFTFAHRTFIRMA
80,283,777 *0888DA5C0B6E502165FDBADBBF9A4EEA0B8F4766 4MYSUNDANCE7
80,283,778 *088BB412CB56E0A8FE1B9DF4730214611F39588E 4.nuorisojoukko
80,283,779 *088FC4DBD34E000D697BA3D4CDED3D1F7E11B600 4PUS3ST3S
80,283,780 *0889EC041DCDEFAA391BCE4F3408F1EE73F46E82 4SPRINGCYNTHIA
80,283,781 *08839DC6128AF03BE0EE792C4DBA14BEFDAA07EF 2793374 ALL OF THAT , OF COURSE , IS RIDICULOUS .
80,283,782 *0882751085CC2CA055C3CA027EA05ED58663B58A 4WANDERLEIA
80,283,783 *088D62CE9C3A079900CA8990D23F336126C58EBE 4XUARUTCURTS
80,283,784 *0881B73C0926C5EB4962BE65A136E34C517CB418 1.recycling-schlupfloch
80,283,785 *0881589F081D798722FACC0E988A264263AA8AF3 507492 foreign-institutions-are-of-no-help-.
80,283,786 *0883B793A50EDA3C27B4FE1B2F067A03C93E76F4 1 REVISIONSANTRAGS
80,283,787 *088817D718BC4CB89E7ADBBB6CD48470A0593FE9 2CAMPOREAL
80,283,788 *088417F8B36208E3ECF4ABC986771ED3D8A46851 1SYNONOMOUS
80,283,789 *08820F35DE46C15728FEF01C572B4102CD58DE10 58KARTTULAN
80,283,790 *088D2F6AC34639ABD3AB71DE196E5E756DA37ACE 2FBARBARA
80,283,791 *088BCCA237C3A9AE57DAAF592685B03107EC51E7 2-gunesliydi
80,283,792 *088DC26F77D5A91FF845CE93FE3075DF3881498C 2-HAEUSLEBAUENDEN
80,283,793 *088FC840C6993B03B00E544868174D51ED658DDC 2-hakusaarron
80,283,794 *08802EE45C2F160CAC37AE2851FCFCBD6CE7553A 2ILOVETEMPORAL8
80,283,795 *088009590EC500B749636FFFC38050F87A54F34E 1.VAATIMUSLISTANSAK
80,283,796 *0887E2FCD9161163B8C63AEDB06E6DE1EABD4D12 5BSWFOLLOWDBSW
80,283,797 *08826EE5048A9D9278D3EA295B49410BBD3AAB85 1 VIBRIOOSISTA
80,283,798 *0886D518BA5E19BB06D151CCECA8858E7F465D4F 2.NEI-EI-EIN
80,283,799 *088DFB7C99706C17D2B341A2771BBA6C7CE81F36 5DISSOLVONSES
80,283,800 *088DF85A4A1FBCA78FF266091714BDB37A24DDE0 2TYREING
80,283,801 *088F3D84364C29E6C6E0B99576757346DB44C9D4 2018260 insgesamt-sollen-100-plaetze-zur-verfuegung-stehen-.
80,283,802 *088B1D75E9121D794EAAD6A83DDC61702533F493 2WRILOYWR
80,283,803 *08845DCB1DA2D1F3A80DAB8CFA159F8D0A38928C 2Z4H
80,283,804 *088002863AD1649E55929BAF3189619E3ECE4BAC 5ILOVESKIP5
80,283,805 *088A140BE8DE3FEB9D5750E38229AF2A43178743 31MISAEL
80,283,806 *088A1F45A47330E60149DC41E2F350224A1D031D 20MARTINENGO
80,283,807 *088241AAA3B1A9C54396EDCBC8A034AFF93A9DE7 2136819 THE SHARES FELL 24P TO 299P ON THE ANNOUNCEMENT
80,283,808 *088261B29548A5D6ECB3EE1C559A2476575B5300 5PIETERRETEIP
80,283,809 *088777C6975F797E1E1101EC275C930EB12D3DC0 2333588 INDIESEMPUNKTHATTENWIRSCHONPROBLEME.
80,283,810 *0883D60FE97FFFA981DEFEFEE6E7F73E38E98702 5SNAWUOHS
80,283,811 *0883F482DA3CBBBE1163630D377E4DDA79464F0A 3=B ~ ~ SPLAT
80,283,812 *088AC77F06BDC138E9B9061B9ECD02668972D510 3------B`~`~(x)
80,283,813 *088E976F4C46C791A820A1BC467654A0F9D0D8D6 5TPFZXMBEQA
80,283,814 *088534A8D58546A44E141C15B6B621168ED6B3AB 631904 biliyorsunuzcindunyanufusununaltidabirinesahip
80,283,815 *088CE5228B83B29EE9C4FB8D2D8B07B8F1EFA242 3MLNRSTR
80,283,816 *088BBBBBF0062564C487CA9BE27D822D879DD588 27.09.1688
80,283,817 *088499BF3EFEEC105DF9F490244821471803370D 3#p ~o ~o)0(
80,283,818 *088C8A7AD8F34F1428D9E88FF48D1302AB6790AF 3VIITEENKIN
80,283,819 *088642FCC127511DD407A1084A81703C5E4D25EC 3X1553TQU3
80,283,820 *088020E17014C4EEB83EE3B87F6E54C810E886DE 6CLAUDEGRETCHEN
80,283,821 *088936AEBDC0C4CEDD0CE402406FB9596BA34470 299009 HACI-NUH-MAH-
80,283,822 *088A02818EC36949364A3185801A1BA4864BEDEA 42WITTGENSTEIN
80,283,823 *0882A8CBA26C6430B0B500AFDCD42642E28350B5 6GNINNATNBSW
80,283,824 *0887DD075FAF715E540FA7A50FD129ADCE5B1A20 6IAMNORMAN6
80,283,825 *08868CDAD9AF77E9C6036D5A9C0ADFD1FF5208DE 2HCEOCIOG
80,283,826 *0887A822B05A957D6908B4B9AD6DB4707BD20EC1 4ENCARGA
80,283,827 *088F90E870FB29A72D6D4F1C5E30E7B416AE97A1 2INFO-KANAL
80,283,828 *088485BB058016872897CF7C33F278879124A38E 4HCIBANN
80,283,829 *08807F00167C7D53BE40557B7C2AB8CDD9020049 4JAPANMINNIE
80,283,830 *088035162E2D2854EEEAB7452668A45516A8BDEA 2.OBERGRAFENDORF
80,283,831 *08807D42E67AEC9BC76ECEBF39BEFE082FAC4BAA 2pcta
80,283,832 *0881D166B744007E53CE9C27F1085C4C307C2AFF 2-POHJAKOULUTUSSELVENNYS
80,283,833 *088703E3D0A3D642E8F5A0F310C147E9A778A2F3 4LAKAMMIO
80,283,834 *088EDB90EC27F2AB54CCA9C420852BD5054BB4EA 6PUPPOLO
80,283,835 *0882C28FBAABC2CFEB1E62F85CFE642F5213218F 2schwimmfuesse
80,283,836 *088F7C1F5627BF2F9A3FC6462D752352FB3B958D 2sirius1
80,283,837 *088696372C743C8764EB45AF87608F8786350241 4MIDDELLIJN
80,283,838 *088EDB5662566AF8F6603AEB59A2A1E2FDFF5DED 4PAEDERASTICA
80,283,839 *0883054504E019ABB2B05C551CEAD21B0A7C0C9A 6taetbevokset
80,283,840 *08873489BC15E985729DA6BD5DCA4900EDC7CDF0 6VEKTORERNES
80,283,841 *08872371C352B9904001EABB47E4E0D9B443AFDF 4TELEHDIN
80,283,842 *0886692E896BB160B2C560DE628A2AEC64FCC059 72065OWNQ
80,283,843 *088C318DEF5E6F6683DB0E9C93C2D7BB191B1FD6 4TOMMYREDWING
80,283,844 *08878422ECEEB13D6EB087D05A9F2C71693B7099 74818CBC2977C7D37C49F9EB1FBAD15B WHENWHERE
80,283,845 *088E1C4F5F84078725F1C2DFC9D5ABF1557A2899 519440 ohjelman-listaus-n
80,283,846 *088E4C15F9F9291DA8001DA78123F5FA2D10D715 548TANIYA
80,283,847 *088E6C36A5C657E9C2F053E329A932332A9645F8 5BRAZEIRO
80,283,848 *0889C88074314079C2DC11160B4DDBDF63B92CCC 5BSWHOQUIMBSW
80,283,849 *088F174F1A01C3D5600B1E851242C6927F83AB57 3ocvs
80,283,850 *088C0D3DBF7D6B18ACB71FF109108387C2D7E136 7EURAAJAT
80,283,851 *088198F671E32A6BF96B732B8FCD18C351FCCC87 5CHILOMONASS
80,283,852 *0885814318F26DEC47B2E545A5615BF7F7A9C8BF 3SADIETIM
80,283,853 *088191AE7573F9ADDF7401C9EAA65D8AE6AE994F 7GENERALISIERBAREN
80,283,854 *088C048FC1ABA86284D96E26A9E6FF66AA1CD452 5DOOKIEPIERCE
80,283,855 *088AEDCD50395ECC8B6C4D6E7D2B8A17A7B32C32 7ILUVANGELA1
80,283,856 *0888440DCA9A98AEFDE2A888F03A350A0A3AF323 7KRISTIPSYCHO
80,283,857 *0882F5B6DB2DB4BE72E7431ACCB6AFD30312D9C6 5KERMITSBSW
80,283,858 *088F012F8953CB218A1D54BB455851F4C58112FD 5LIBRARYQWERT
80,283,859 *088C763CFD5851B5D3EB6F201F2F1DAB58E7E8D7 45-SCHNEIDT
80,283,860 *0886575837D2FCC6B4C12DEE146AA300FC6EEB41 7MYFOX1
80,283,861 *0887A99EC588C64E74A258E6AC011D1CB6CDE1FA 5ROPINGCINDER
80,283,862 *088522AA2C69E75D8E3574D582160D89411D3766 7ORSHANDS
80,283,863 *0883A5BB3CDA98309349653A78E7E99B4020123F 5s-marketit
80,283,864 *08801B566959161975E929BB548569396543FDA4 7PSDPSCPY
80,283,865 *088520707DF73F11E5BB14622E3DE6C4B275A589 7PTIONING
80,283,866 *08806B5320682E84DF1B919730B312C96C60EDE2 4.KANZLER-STURZ
80,283,867 *088AAC66F664CFB20944836957344067BEFF802E 5TOCOMEACROSS
80,283,868 *08815B5401EB3117F747548E6BD4240AAA4FD8D1 7TANDYKRAMER
80,283,869 *08872C6CC4193B389A87873B79048E1E2E06587E 4PPO$!7!ON$
80,283,870 *08881591689D80BA01388EA5E616B3DD682847B7 5YMP7OM47OLO91C4L
80,283,871 *0885CB9CA46E9C85419F7D7E85030CCBF42C9C11 4SAVAGESHALOM
80,283,872 *0885012A2E719E8D8EDFAC43EA4783F4F6773D7F 6ABCDEFGNORMAN
80,283,873 *0885EF69D8AAF0207A5C3A5D68946A05F5A3FF6C 4UITZAAII
80,283,874 *0880329BD5BE50893E7440265CE98D8E61C4436F 6ARADIASA
80,283,875 *0887487F8FC82888D8AFEAE487A8048C9DDA7965 4UNWERTLICHE
80,283,876 *0889362F8F85B2FF36494C18848AC606FCFD6D87 83。血液型はa型。
80,283,877 *0887A038538684F981DF42BCCADB14316AD84F24 84pt$e
80,283,878 *0885807AC7050021CA744F6C135F30010FF92130 881BRIDGER
80,283,879 *08804BADF601EAE5A9D55577BAA64F6337ACC713 8ALASKANCRAB
80,283,880 *088953AEAF69042DFF67D131E6DDC1E00DA5EA13 5BSWSVAANBSW
80,283,881 *0887D3D5ADBF318816D400FA4C00E076D8B49732 8ATCSOPORTOSIT
80,283,882 *0888B6A4CEAC54C5E64E9F8FA2A672091BEF0104 5CASSATED
80,283,883 *088AEB85B04E7B8B346F08630FCB6A95801C1E45 5COWPARSNIP
80,283,884 *088F88673CEA585835530AEAC8D6D0221CF16B3A 5DETONACNI
80,283,885 *0884A669E57ED8B283B73039B26E830A55650F97 5EDIARTNE
80,283,886 *0888A5E56092432B5381574D8A6A49788D0E3A4F 5EDNOLBEG
80,283,887 *0881AA221C053511EBCA7F2A0C729C9341A10FF1 6DEFEKTOSKOPICK
80,283,888 *088FCA75C4A80C0F7DDEFE398635B5E7EB7FDA6B 5ESTABLISHABLES
80,283,889 *088782877A0E5C42C708CFFFA0B29DE4C7D48B35 6ELWOODNEWS
80,283,890 *0882DC2DE4DA397D6D2323C94C0B8CDBD2470556 6FTLUAFNU
80,283,891 *0880B10EDB09CA04A87D3540D96E08C8DE11C6C4 8BSWYAPBOOTBSW
80,283,892 *088A12CAC14D68B1A851869F000559A254432E5C 5INICIATIVAS
80,283,893 *08843087AF75A2265E2E047D2F322E828662A443 5 JUUSTOILLE
80,283,894 *0880AFB4AC339C2F0DB1E1C287C629D4CD0784BB 5KONVOOIEERDERSES
80,283,895 *088B1579638A1CEB58FEDA8E5A7BAFEC789E82CF 5NAEANANA
80,283,896 *088B55C564803BACD5A334946CA81D228F047BBE 8==d-~-~-~uu
80,283,897 *088A892B03F5A2F61558D8FBCFBB699287DF7D69 8D * *UU
80,283,898 *08865E627971AFF6C4264968B666E702D434159A 8HERBEROUGHE
80,283,899 *088DCCA80D1265D935880C943AE5ED3F3D2E9BA5 6MUTLOSERER
80,283,900 *088F0457C8D9536AE8F8C97E58E060C24032FA01 6OISTANUT
80,283,901 *08899494E54FDF3D5BD4A2083714EBB77DC8949D 6PHOTOTELEGRAPHYN
80,283,902 *0887B0054255E35F5F5B0DDE1E1621A0166DF4E4 8MOLDEABA
80,283,903 *088B3C2595088BBA39606888AC819D3F5D22144E 6RESSURSDISPONERING
80,283,904 *0886D840FC4E0BBC38FA97A0B2DCFE6F9808876D 6ROCKDONALD
80,283,905 *0886E4AA676B9A2EDB4D7C893286468A065848AA 661834 esim . arvokilpailuja ja niiden p
80,283,906 *0886D0FC7E001A1D3FA3DC194ED471B1C6302B06 678568 Ikt.iie.bilgilipazarlamayOn.
80,283,907 *0887753DF4726D4415AB7B6B9140187E441104AA 679827 JETZT-GING-DER-SERVICE-AN-DEN-START-.
80,283,908 *0887699D7144B53115E368BBBC521F3CC1481C8B 6EKJYLXWZHJCNFJU
80,283,909 *088F839A50C46E5BDC7479A9A9FFB6B104EF7DA0 6WILKENSES
80,283,910 *088C9C415D0FDB92C31B06EFDBDB7F37A945C989 6INTERFEER
80,283,911 *0887F11A3AEDBF483CDDB0A7F4CA6A1B9D968BBF 727885 KOKOONPANOLTAAN UUDISTUNUT JOUKKUE K
80,283,912 *08864330E8A454AD740929250C4A9DFEAB83E941 8=====P~O-SPLAT
80,283,913 *088F316BEF89EB41880C44AF1CD0A07EBF6CA9EB 8STARGYMGYMNASIUMHALLHARDPANHEARTLANDHEW
80,283,914 *0888753A81BD68E449558EBB7C67C1042FB6DAC5 7ANEKAMPSE
80,283,915 *088F26FCC64B73BA1349FE2F46204808B1369442 7BEFLOURING
80,283,916 *088C1D8F107DB178BCA9205DA7E402E88E280DB9 7BSWGABESBSW
80,283,917 *08864EDF38906F7A07ABF28ABC654E1BAD2BD32B 6THEJUNIPER0
80,283,918 *088C398A2CF54E75879704B0F7F9F820E862F704 7HAMMERSIERRA
80,283,919 *088C59F9948E051371F9722B3B7010960D36EFD8 7-HAUPTVORSTANDS
80,283,920 *08891F7BFA9148BDC192F8BFB1640D31CBC0E082 7280VIEW
80,283,921 *088CB97312ED8323640ABA811E6C88B155FDC662 7SEETPECC
80,283,922 *088492149880FEA8B95CF0F2B25B37AEB1A49D85 7SHALOMSTARWARS
80,283,923 *08812EB4CCBBCDEC3841BBFEE1E69A3631250C6B 7ICIENCES
80,283,924 *08825F760831DD6AF094CE45182D5A9F44E77C3A 9INAPPAGABILI
80,283,925 *08800A5BBD809F708ECE0DF05B6F91AD5A945113 7intergrationen
80,283,926 *088F15D9FD592DB00A91C69ED55534B4CCF02E49 9mar1460
80,283,927 *088CAF2EA0060A6347987E63F003C59300B09C4B 9OLINETTE
80,283,928 *088302F00962F3EB294C166D54E8C8E72AFDE78F 7LESTATNEWTON
80,283,929 *0885D5F8D1B99F088599D934A6AD4C970126F426 7MARKETLENNON
80,283,930 *08835B63C5EDC279B7FCFFAC07110167741380A3 80CHMS7RS
80,283,931 *0889DFB2A11AF929DAE8756BF318EAB504A19A7D 8======)-~0~o-}O{
80,283,932 *0889966CCF4A57CC0DD2FE07D608FA8F38821ABA 8##>~0.splat
80,283,933 *088DEAF75B08EF5FB7DCE77D402371AB047AC1FF 7NB_Z
80,283,934 *088AEBB4D10A524BFD73BE95BE3829D1A6B2BF2B 9ROEYNDOMMEN
80,283,935 *0887E335D0339FEB3BA30C03E0DF3AEDCDEA4DDE 7NTCHNCLZS
80,283,936 *088A412E4BA0FA864085D8D40939E43ABC520BBA 9SEINING
80,283,937 *088624C16B248C196C995D942707718D0B0C1B3F 8BSWWQZBSW
80,283,938 *088A1263F9BC9F3246A12F9E5BFD42D23E2936E5 8----d.~0.~osplat
80,283,939 *088AAA79D99738EC8D5506D9CBBAA87AE6DD9863 7YLILYLIL
80,283,940 *08842735CDB856A25544EE9A3CC1C1127C69447E 7YSHANNON
80,283,941 *0887E28F812A6A6605095AACEE91C235FE575576 A1%-
80,283,942 *088B57E2770207BB3503A1C018F620F5D74A2CBF a6ebs
80,283,943 *088496B910689587200553B247849C75D694E8BC a.6ta
80,283,944 *08823FB285159EF154828850F16CF8AE8544D31E 8AGNINVET
80,283,945 *088C73EF38E12AFB91F70D13250467BFF6DE97F1 8AUFZUBEGEHREN
80,283,946 *0881D92AA013968EDD186833CA211245E98A6883 8#####b~o~o)x(
80,283,947 *08836BDDA8814BAA98F6A98EC7A89BB62F894EF6 aaa!1c
80,283,948 *088582F2D5E197BA04C8552F64F882569972990F 8myvolvo2
80,283,949 *088A902A1EE484A70297466E0CB219B3619CF253 8 OLIOT
80,283,950 *088A1358F9C688260EBCD2D4B471787E1F73BDF0 8#>.~Osplat
80,283,951 *088B75590DC068788F2C61FC64DCDD82F914DCFD 8PANDAUROKSIA
80,283,952 *0885268DB8AD0BF1B64F1B50739C8DC1F579A222 8GANDALFGONE
80,283,953 *08800A67D7A5DF3C02D25F38624CC1A85CE4B82B 8##p~osplat!
80,283,954 *0886CF856E44CC94EFB320FBA83C7F070C869D2D aadbd0
80,283,955 *0882C25C89A4AB2A94E7CE59663AFFB3656D8478 )8(*.q3
80,283,956 *088396F03AD43F8CA0BEA261B33C9A8C5E9500F8 8THATTIGER27
80,283,957 *0884A89DD6057E3E0CA3499172A5C7C74B525615 8TSLEPSIW
80,283,958 *088584F34AFD518207551A4DCCDEA37E2B342F16 8VANJARRAHS
80,283,959 *0889F69FB450E2E58A9E1F497AA47B3FFB1C8828 8MYSNICKERS1
80,283,960 *088E6D2DD63251534734E0173ECA54F57E33FFFA 94JAKE
80,283,961 *088F1F3AC00DD804EEC8F9F30A6C8A5236184580 8PRANDIALLIES
80,283,962 *088B2E69400623B98899B6D4E753936C073BB9FF a/bc?
80,283,963 *0886835F0C8FBC801DDD0C41B0BCA9D8ABC4EDE0 ABDRABOH
80,283,964 *088781574072E76217ABC171588D4D1791390266 8RETKNEHC
80,283,965 *088600FA9A7992D2E86653F85DE5E067629C2796 8SLENDERWIT
80,283,966 *08803A96425E0C3994617738B222D362105A54F2 AB'J'
80,283,967 *08835BBE3E7434528AE38BAF99D537A284CE9E15 9ANGLARS
80,283,968 *0888588F3121D2FC7B5D81EA7B3A2EE7ACE04538 9APPLESAMIGA
80,283,969 *088E3EB72FFC59260D01B0D9D1679B239B12F755 ABTEUFTEST
80,283,970 *088D6FFDCFA94E086413A21AC3325E531528EA42 93EE436FFB78
80,283,971 *0883AB30348FB005C4D1C4B5DA2DD16A7DC0D5B6 9DESALTERERONTS
80,283,972 *08891DCCD697BB52AB7245A056C4A01C4BC7D908 9EERBEYE
80,283,973 *088998F392C156CD43B8D12165DEA0E52DE4C767 9ESPANOLHEATHER
80,283,974 *08876288CE207C18B68647B889FA3B46A5BE3E5E 9EVINCIONSES
80,283,975 *088B12CA8A327D2E595F236F70777B69A4529277 9AM8LE$
80,283,976 *088A6C6E6A84461DD65DF1771B59F4FCA0D08313 9BSWKMAXORIGINFIXUP
80,283,977 *0884C120C7561CA156C3D730ADE6457E762141A0 9MOUNTAINLAKERS
80,283,978 *088BC9ACE21B45765E3ED6CEFC61D31CAB6D3E56 ACSÁRJA
80,283,979 *088D59CACA66AA8390D4A316E07B26031AC92780 9.hypp
80,283,980 *088F31E7E8638FF17AE5D6B5410546244C9D809E 9INAPPROACHABLYV
80,283,981 *08803FB3C1A5D8767A9D85780CC80B84835A6DE6 9KEVINRUNNER
80,283,982 *088E04A1E479F7CA4FDAD12294A7F606B0FE8A75 adhruh
80,283,983 *08886AC38D63747BE4AEA13F1685CCDACED43820 9STROUNG
80,283,984 *0887DE0E4E4949BED03D88BFE17DF1F4EF47E451 9SUPERSLUTSCANKHO
80,283,985 *0889880784BFEB7CAA6CAD024C1B7D6F2B19D1E5 AEBAP
80,283,986 *088D96ACA4A9F6825056C9600FB5CC4F1FA8FF46 af:ob
80,283,987 *088F0E0074662C92FB39F1FA722327065DDDCC2D A:2R!
80,283,988 *08856F0C1BD5D7B2E48BC0DDAADF13CEA16D3D8B a5,w#
80,283,989 *0886E364842D6C678808D540788F27EC93D019E6 AHRD0
80,283,990 *0888B0F8138B19E6504245BBA419738BA4549EF4 AACID2
80,283,991 *088443EC0ED45A6EB143702740C82C0A4E749C89 AAQBY
80,283,992 *088C382FFD5F3FE2301E1BC610001DF719F8F9C6 aldobisson
80,283,993 *08867389C099A468974107A6BB00637EF226E1FF aa:uk
80,283,994 *08801F3D41185B196787E648955EC0BC2D60C4E0 abdulhakeem-abdulsalam
80,283,995 *0887C479428185B846F764219CCA39D2AFE64F25 abm2h
80,283,996 *08884598394DFA3FEFE01BC6A49865B247C7D691 AB#SD
80,283,997 *0880A4B2D5714364D9069E1300F6AE4246A404E6 A+CTD
80,283,998 *0889B92FB15328EABB477E4B484A15F479E83527 AD"&
80,283,999 *0883CF1227B3E8FFC06FED1895C94184B5413C70 ADAPTARTE3
80,284,000 *0888D94F639E8F8937C6E7B02C682D828D49D085 ADEGN
80,284,001 *088B1B8B11E18DEE1F88292D6F720F73C0B416D5 actitivty
80,284,002 *088C64BDED2175BACFCDEDCABEEEB5714DFE5BA2 AF6M
80,284,003 *088AA7002777834852B4923B3DE5FC12126279A3 ADAM.WINGSTROM
80,284,004 *08829FFEC710895CA1CB4E62B3D48FDCE389E4FA a(m%;
80,284,005 *088C42EDBB204B7D36F8F810B9AECD8A83CF60BD AGENTIVA5
80,284,006 *088DD3D1C7570DCCA3442D9C4BB63C45163038EA amosgeathers
80,284,007 *0889AE5C9393F325F31D7DE6E11A21B4271766FD aed0x
80,284,008 *088431E505A4661B4F5DF1C7FC28E4D00CC4C469 AERBTIHWED
80,284,009 *0886E021222F2C9DBB4FD3E3EA9C5510A56F1BCF aet$t
80,284,010 *088E73C00D5B8C18723433FEFAB36C9D26935058 afo)_
80,284,011 *088A841D0B06DCE9E8061125AEED9E1F0CC203FF AFW_
80,284,012 *088CFFB96E89EF8CB873202BD25E18BD93A0757A ANGELA\\R
80,284,013 *08818A3683C4726B37F2CAB38572D1482278E932 A,io
80,284,014 *088AD42BEEF6478793161D871FE59E2F63052AB9 AHMADLEE
80,284,015 *0885C1678C03B952EB94CC898FE19AA7B5DC8369 ANIBALMCGUYER
80,284,016 *08879AAE97B863DE777AFF5055373115071D8871 ANIG
80,284,017 *08889ED71CF092467655325C29258A74DBE0FB17 aium
80,284,018 *0883375BA7030C1A7EE501AAD257B7580DF19E65 ajec1
80,284,019 *08854C7868906998C9924BB878BE8C0AA88092EA ans%;
80,284,020 *088C902C21CEA95B4AC97149C621343B761C1A26 akame
80,284,021 *0882EFD7B5ED2884FF10F5682D5376AFE27CF172 ak;h_
80,284,022 *088A0E6B951C1F20E0D150FE14973319CCFA131E AKWL6
80,284,023 *088628518D26BB3AD5E332B3F05997C8BC84C483 apb&
80,284,024 *088E5CE38834A8373545F7C08D9AC56B3043ACAE alejandrobarringer
80,284,025 *088D95D7EFB8456EBC4FE9953FCF73C62C9E5351 [email protected]
80,284,026 *088A1BE5B2A454B4093CD2BEE5EFFE033BF9AADD amanda-landis
80,284,027 *088EAA1E78054FBCC87A78683C9C49AB795744D0 amlm$
80,284,028 *0881B7FA55E7D4D914EB52CEB837841F49BBD39C AMMQ5
80,284,029 *08815888A79E74425FA1DB607D31AE17D1E843B7 allanlofaso
80,284,030 *088986DF110440E8D1607E02B0C870D92A86C04A a$q)w
80,284,031 *088459B347C7EB562873729EE56CACE54FD0C000 ar-baa
80,284,032 *0884818E14EC29C96B92B5E705E2CAC4135BEFA7 a=rbp
80,284,033 *088570AA25D74CFE022F17686BEAB99274E90E24 ARLENEWENTZEL
80,284,034 *088BE1728A0F49AE346E557FB2297FC9195B6C32 ALVIN.FLEITMAN
80,284,035 *08864EA87A07749BB3282BE30B123D7E915E10F2 ANDRE.TRIVETT
80,284,036 *0882B59AA126FDCABFCBCFEC14001CAE924C04BF AMANDA.PETTI
80,284,037 *088F8FB3DB7B0DCE28B284243F6AC982092EB277 AMANI.CARTER
80,284,038 *088D8702CE38DA349FF6140758F121DFD1A6E366 AMEERAIMAM
80,284,039 *088311ECFFF0F7CED64747F9CEF3652A9F8DFCBF ARTUROLANGENBACH
80,284,040 *08863CBF722279949AFC0D7CE2464A1E8C6398A1 ANNACLEALI
80,284,041 *08824A4E4EBFE350ED28C8FEDEBF7E1C8C9F666C An7nsurrec70ns7s
80,284,042 *088670CEBBBBDFD686AF7963964BD602686E9AA5 aselection
80,284,043 *088D5D6B09082DD336C0FF38C09A648820EC2CEC A$Nw
80,284,044 *088B8491F8B1C55BBB54E72828450CF84FF89D5B a-pl7
80,284,045 *0888D2BC6A5F868412ACCE03F73B3B7902526457 aq)af
80,284,046 *088761196BCD93DEFB2B6738A2269A7D3D013CA8 ar)=e
80,284,047 *088395F0E5FD5C3C79B9926CE91AFDBC220CEE71 ARLIE.LOCKIE
80,284,048 *0886DAD5C12C42E0878DE2912CE690E4ACD22F44 ARMVP
80,284,049 *0888B96C0F59E473510E611438C4B1BE87B355A0 ASHLEY DUPRE
80,284,050 *0882721F83749CF8FA9FA80209AE8ED803D28871 ANDY.BUSKE
80,284,051 *088912450FF77EE838B08500BF636BE54AF09E30 ARO",
80,284,052 *088F59FDDD9196D11AB0D5E8570F0ED48385280A arre_
80,284,053 *0882FD26C34A0F6AB7958870E4B50F0D0763A011 arthur.baker.&.meat.katie.&.rockers.revenge
80,284,054 *088C77CF2E2C39C44A2055CF754594E336797FBF ASLRL
80,284,055 *088D6155120A0955987244709C8D9D1C4373DF13 ASERKING
80,284,056 *0885A345786FF6E2D0B7174E9EC54BAAC4BE70AF [email protected]
80,284,057 *088F869DA049F36E50F212890F562D5FF49E6AA9 ASHLEYSJOSTROM
80,284,058 *08849CF824093878EF72570CF21B77FB20FDDB80 A*%T
80,284,059 *088CABCEC0B63BA62C90081C5D67040AF24BC2F0 ANOEA
80,284,060 *088AE77C829FBB5C5659455790FD659295A51867 a&u._
80,284,061 *088CFA661A524273D95001A0AF8C341E9C659F1E ATRENS'S
80,284,062 *088B7A65F1E303D20324BF7DBD33546E5D58E18C ATREYU BANDA
80,284,063 *08874113EFFA5831D03833B9C528860E9FBC5094 AUB5B
80,284,064 *08836EBF28127FD561DCDE5E17FF7926726FC487 antoniomuza
80,284,065 *088B0525C4557769B9C9BCE4F2E27414152DCD51 AUDIERY8
80,284,066 *08823D4D3630C9E9A7BC76958933696A7D3583BE aufstellung9
80,284,067 *08892A4A85F5B613A722E8FBBACC13111992D945 auspicious
80,284,068 *08817A773BAA65F6556F98E0FB3C1E16515B2F01 ap25c
80,284,069 *088AF7EC8C919A62F238142835408CE0F54426FC awvhb
80,284,070 *0880D63B590F0F7A26527DE977AC11E8A4C03F4D AZKRT
80,284,071 *0887C8F9EB96FC0879FC615C7BA5941DD81F9645 (>-<)~`@------B
80,284,072 *088EC8B4BDEDC12DFE8A105CA77E85D217A31AFA arceauxed
80,284,073 *088DA8698FABADD01C773E4CA63D4F93E6FAE195 B1N-Q
80,284,074 *08816312C1A20E3CB059D5D37345905E3B52E4D8 B5n&
80,284,075 *08877E26E72F8ADEB376276A5AE619EDB9E8085C badernes8
80,284,076 *08882963254BE1043AC15A66B0BCAB4C2FF5C62A ARTICLE.71.127.226.1
80,284,077 *088B4720727D6B353F65BF75AD6849EE4D015D27 B2SVK
80,284,078 *088E72D835002E06CF93A989CB691E4E5E787179 BARSLEN7
80,284,079 *088506177BA3294661FC17016F62E9D5140AEEA3 B=====B.~O~o(00)
80,284,080 *088AE6801C1792C42F3AD08A0DACDB414CE2A462 b9q8
80,284,081 *0884EAEE27A82669773E94DAE726B6322ABE8C13 BAILETES5
80,284,082 *088F94C596A3CB0CE42CCDB4A0C60637024F551A A_TUB
80,284,083 *0884FBB508E0AEC92FFA95FC64F8E3BEEE85C1CF BEDTIME.1
80,284,084 *0883C23674EA62892C87CA6D5FDFC89772A9F06E AUGUSTCZARKOWSKI
80,284,085 *08891611AA2AC157926310C38A42531DA08D4E99 aumv9
80,284,086 *08879D0A7B18A140BA797BE127CE8416570316FA AVEGEANCE
80,284,087 *088104C45C049A61CACB29E72989B088D6A12438 bc,p
80,284,088 *088F1796819662B035A26676FD6C5C564EFF9341 bd~~~><
80,284,089 *0886C0D5C771A25A75F276DF314354649AE10D40 axijt
80,284,090 *0882E9A4ED80AC0338DA92D7EDE2DD9B0010DB4B beckyschorr
80,284,091 *0882FA092BEF01592F1B05FA7A5D3DFF1518603D bgvnr
80,284,092 *0885613565CD586572FA8E0950024DCFDB673D26 BIDEN-296-0
80,284,093 *08831ABB769677DD2EA1FB0EBC01FE40C7FCC6B4 bet"9
80,284,094 *08818991B11DB530953A9310B6E842727DF9A910 BETOTSING
80,284,095 *0884274F41EC25C5D12A3C6C67D84DEEEB6DF8C6 bex=:
80,284,096 *08879485AD2CE207953D511782FB76931F349F44 BILLYHIB
80,284,097 *088C9EA093DA425302D90F0F9948873507A3012B bezik
80,284,098 *0885D9621514E23FE301916DF44D044A9778BA01 b+hi"
80,284,099 *08811C6CFB11CB3899AF5DC2E10BDC08129DA1E3 BLINKYJ
80,284,100 *088CC63AAC276C118A933E098EBDE1C61DC0770C <b>listing11.5.aprogramthatprintsavalue-fieldcharacter.
80,284,101 *088785052DF51E09DB47240F3BF9CF5F983904C0 BILLIEPAY
80,284,102 *0889FFDA6F25BC84D2693FC48F2F1EAE3318EBE6 BO447
80,284,103 *088B43452CF6574C0FAEE91BE5B38B028CE80DBC BABE069
80,284,104 *08848BC89F4A8D2A0DBF02804036411F517AEED5 baby_girl33196
80,284,105 *08859C88EFB633B2F6BB3F85F16701BC274BD887 biosbios7
80,284,106 *088F015823E0C7DCE8C1A274D596D193DEEF98D8 bit$v
80,284,107 *0883E3CF1812332804407EAB34A211DB69585271 BATTLE HAVEN
80,284,108 *088D06FF002BA19DB857DE6FC96B704FB08FBE76 B)~O~oUU
80,284,109 *08891DC3AF2428F5F2BA1227E30D5359B616989D boynugraha
80,284,110 *0881F0191F13A05CDAD28E8952B5A857D9CFA1CF blister-plaster
80,284,111 *088D2B9B12F25FE48BC1CC927E2175C5A28F969B [email protected]
80,284,112 *088922C9D5188DB24D120F1ABF6CBF7E49C4EDCC BEANIEHERBERT
80,284,113 *088DCBA70BB6D3A4376F520498BBB42D72462748 BMASATANI
80,284,114 *088B5BE26926942FE0306BC0C03338C590A069E8 BRELICAINED
80,284,115 *0882AF2B86A2BA1A3CEBF166105BEF0FC3540B52 bennwik
80,284,116 *088824C55E14854812A667618B8D4B5D43ACDC34 B/$%O
80,284,117 *0883576A6E0CBEAEEB40A18E372496BFF3F70B70 brunoamancio
80,284,118 *088E37CC4199E4812705EB11A4A3428D96CB0A62 bujaruelo
80,284,119 *0883F0A6E8B7F8849C71284317071DE3EEA7468B BV/%
80,284,120 *0880D9DD9C12DBD34676A2693DA653FD0D62AB2F biu-
80,284,121 *0885DCB3DC4896070F3A71C94A0AA8DF32CAA6DC bwxc9
80,284,122 *0885B5D1160A2FB734E84E92A8F9C6FE7240ECBD C/1
80,284,123 *08883487BA733F921FE7451714815B1D60AA2B37 C3NH
80,284,124 *0881C5244CFD16DD1060950C9F292C33D82CB812 BL+?I
80,284,125 *0884A85F6E2B0CF7513EEE3919CD1C0C2304851D B)L/W
80,284,126 *08876ACC4372D6CD9843D96D1DB773EDF5B369FD CAMERONHELMSING
80,284,127 *08860C35180218193FB13918D960FAF271C4561B CAMERON.MOOR
80,284,128 *08830943D12BF54578C968E32B3DDDD672730AA2 [email protected]
80,284,129 *088FF7E056D5A5ACFF3703B3C9D22B1307B3447D BTF04
80,284,130 *088A3E0CED8A15D69DDA4EA8290B951D316922D3 BP6X#
80,284,131 *08816DA38F9E7A6AA955F26D5F1F53B7CACCEAC6 capricorn65
80,284,132 *088F5172C0A6C6F252012588E57C2707E3AD8E96 careyczajka
80,284,133 *08847EAA77827DF7E46B9538846D9D136CAB86D2 B###P~OSPLAT
80,284,134 *088E23E448B6089912A518AC06570C9BD2DC379A BV/%
80,284,135 *088C5C4AB2CEC3719C0370F5B512D8A528956D61 BRAGGIER1234
80,284,136 *088A1C13066344130122465B1AFB60BDFAF0F883 BRANTBOWEN
80,284,137 *08807502A02E8E38A90CA74B9EE5F80AA4C630F2 BREEANAWHITE
80,284,138 *088F6256509F3F7C850E0184E392D75CF5EA30BB caulophylline5
80,284,139 *08851521F493333E5761B0C945BDB0E19FBE2C04 C%B1!
80,284,140 *0887A89CE28BC84CE57D2F34D4A912A288DBECFB C6%=L
80,284,141 *088E485227AA9271339DF731A298DCB31F6A5D46 [email protected]
80,284,142 *08836C4AA2811DFF31F4C2AA18F972D8918D0D5C C!Gc
80,284,143 *0888D09841AAD0FDE374C955D90A8DE6F81C37F5 CG_-I
80,284,144 *0882176AE635704A591D053509BD2C59B81CB015 c/gx1
80,284,145 *0883A188FB8AE2A91FF7F8442B50CFD1E2FF49E9 charlierav
80,284,146 *08849DCEDDFD8D7E46467301282E71DD8063694B carmencondroski
80,284,147 *0886EBFD6B3A950BF9A2B80DA87EB21AFB92D263 CHASOCTAVE
80,284,148 *08835680588B5D9A38F31730B322E11FD155F3AC chaunceyzoda
80,284,149 *088387399E612C86833CD81F3E9AA4586D5825C0 CHBK$
80,284,150 *088F2263E0377BF6CD32E4E1899BB79680831EF4 CARROLTHREET
80,284,151 *088A9CA665BAACFE48D149A56AE690843B595DD7 CHEERONUS
80,284,152 *088FC7D1CF739367B2CA6DCF4CD50289781602A6 chetkilmon
80,284,153 *088C7A711862BA1585ED932C580A451B56897323 cheyenne.strong
80,284,154 *088250DC00FA0F2D5B1AEC0BB4B8B3F0654419A9 BVG-SD
80,284,155 *088F1D38C382696B82A8326A7E6D8B26FB752730 BWV_
80,284,156 *0884FD0B3D1C0316B2BE7E6BF2DC0041F14A1120 [email protected]
80,284,157 *088865A5A354E19F3B7E4C7998009F82B523CD47 CHUNG.MCDONALD
80,284,158 *0883BF1BDCE6BABE49E4827C399E91E23DB936DC c1iu(
80,284,159 *088E240B46C2A1C8D917286947778DA190136305 C2;?
80,284,160 *08831314D9E4DEA5359AE1E219395EB5863C9016 cid/s
80,284,161 *0882FB083D72DC313FDA65615F8F5F7A8C73FBFF CITLV
80,284,162 *0888D186CD011595F48E881EC4C0B8CAEE544C7E Calines
80,284,163 *088B938B80AC9C68C8C3326FF13580521591971F CAMOTLI3
80,284,164 *088A8B410D1970FB5744B14F7810EA91541C08E9 [email protected]
80,284,165 *088E8E5D03A3494C0B27C8BB8B6194BEBAE2FBF8 [email protected]
80,284,166 *088ECA1094DC4C7F52C7F94813E0DDD7AF121443 chasecomiso
80,284,167 *088DFA730B631D045F2ECFBD2A7DB86608FDE08F capuel
80,284,168 *0881B1D6592EA3F65506A604F3B296AF8EFDB80F chaurguey3
80,284,169 *088ED8819BD4B26743422BF04520E62152BEAB0F CLFFQ
80,284,170 *088056570D3D9F17E2BBEC124F99945B5BA20693 [email protected]
80,284,171 *088DCF161A616D0C77E7244E96A9762EBD72A7AC [email protected]
80,284,172 *08895826693814C975B15502FDA41245DFC271B2 [email protected]
80,284,173 *0881B90F083B2CFDB0D105D48310465D9F65C676 clintlowerytoofferonlineguitarlessons
80,284,174 *088B7F94ACDC60078D88C4818D14BDF67AC068FD CHET.GANTT
80,284,175 *088A5E5132B64BEB45E1177C2DEA5AC971AA7CC3 CLPBD
80,284,176 *0884181CDD74B7EDEE4FD0DD5860C1670765982C CM92M
80,284,177 *088CB76DD42474AB30B4CCEF82546BF25D52FCD9 choper2
80,284,178 *0881477E6FAD6CE0F574B58F7F539A2479F10232 CO=1)
80,284,179 *088EE3B045F1E821C6B76CADD7A7DC5F783659E2 chv(-
80,284,180 *088A4B4125096E8F2F5556ED5CA0991492EED472 “CIRCLES
80,284,181 *0889F3E03CE50A94A885A8C82DCBE6D53D7C8D90 col&r
80,284,182 *0887BA9B0B0929B5FB0EB660726BD57FE20694BF ceor=
80,284,183 *0887B1E88E0C25292022023D57CE14C94C982CC8 CLAYBACKES
80,284,184 *088E48C34C13CD578FCDA91DAC5D919EF5F255DA CF5$H
80,284,185 *088C9D9BA0C86FEC501AF984B91CB3D7D81B79D0 cletusvanlew
80,284,186 *088780DA2473429E625AF9D087D1965A827C8745 CLEVELANDSMIDA
80,284,187 *0886BD9206AFFDFD02B13203E345C4BA574FF960 CGOD+
80,284,188 *08876B2DE43639AAA19876BB2D8A34F55EC53D4E CLRR3F
80,284,189 *088F520C9DBAAF36299823E4FE23FEA9EEA67E8F CLUESTALKBEATLES
80,284,190 *0885B54820B4964B0A8D6FEA88B470C444360041 CLUTTERINVESTIGATIONSCOMWWW
80,284,191 *08895EB87384C97478C83BDD535743DBA0A5CC00 [email protected]
80,284,192 *08833C580480893AECC4CDC4E0B5C5BF9844CEE5 [email protected]
80,284,193 *0880D2F67C53B7CE386DF4DE5E8D07CE6B6BFAFB cm.e_
80,284,194 *0884404AA19F129A57A2423F7C752A33C91781C2 CHAPTER-1-PART-2
80,284,195 *0886EE75266F6EA6E48EEDD5F887E703C6EE4402 cmsdocuments
80,284,196 *0883667E1FB8AC0F65B03F88F6540596E85711C2 CHASHENRY
80,284,197 *0885D0FE68F0B7ADB8A75EC95BB332B351F88794 chbj
80,284,198 *088C2B0B15FE560BAB2AB1D81A910554A70AD1A9 CO,ST
80,284,199 *0888E732F1F76355F766E8F5B1BB63606A0A2C91 chery-lopez
80,284,200 *088FC9062E949E7B0C5CB88AF62CAE5BEE85707A C-P
80,284,201 *0882E39D8C54BDE94E9A0B8A45E184E166561BFC CONNECTICUT–LONDON
80,284,202 *088EB40DC42F7FEE6B9AF2BC7A925D7C1C54665E cornellandra
80,284,203 *088D89E4AD4D7DDCF8E0A7A0CB423F9948F50828 CHRISTOPHER.SIMANK
80,284,204 *088C6F20240F366EA4105D4BF93DA8DC3F0DE19D [email protected]
80,284,205 *088705D3714EB310621322BAD5E2C39D355B1940 cos711er
80,284,206 *08851469ADF48F522524E9DE0B2151992BE69C55 Crown-13a
80,284,207 *0880E3CC6445859B68DBC12AFEC350247E32D04E crowned in martyrmony
80,284,208 *088BC31957EEC6E345BAD0E87D97EAC3283AACA3 C-P
80,284,209 *088F1B9AA0C353AB5C00D37FCEEB9EB05EFD1D8A [email protected]
80,284,210 *0880EFB59609C6B8F78AA15B1FB23F688083035D c:\programfiles\commonfiles\adobe\xmp\customfileinfopanels\2.0\panels\mobile\loc\mobile_fi_fi.dat
80,284,211 *088DD2B185436046D616631E1F1D5DC75CAFD668 C:\PROGRAM.FILES\MICROSOFT.VISUAL.STUDIO.9.0\VC\CE\ATLMFC\INCLUDE\MIPS4THUNKBLDR.H
80,284,212 *0882F51568A86EEC842EDFF2B19654FABDDF6CC8 cik67
80,284,213 *088C0E0A7283F9B51398CADCE697B0E197C3355A CU3R,
80,284,214 *088A503CE5F8E1D39F3CE3CB28C67079B2BEA3C5 claire-morneau
80,284,215 *088B26871C926BCCF6075F302D02584D94BE447A [email protected]
80,284,216 *088E37B9F62D4E058BFE2C954B42B5F3F2C63345 classic country: 19701974
80,284,217 *0881D0D800C1537BE17A8A1B273D26510191ED61 CV1+E5
80,284,218 *0881C27E4CFB87BD111BB19F7D7CB499FAFA7254 cqr+w
80,284,219 *0887F6A97F19399EB500E9DBA7E3E30688777FB4 CRIC:"SEATEAM...READYFORACTION!
80,284,220 *08879DCA074F456853A41E074A51186D5FBB2041 c,x0s
80,284,221 *088E8A131706980F35FE3A084C2D9A51771A1849 CXgV
80,284,222 *08887A6DFE47F6C2A21DC53B5D32F38583B2A57A d0gq
80,284,223 *0884F6FFA26023305B04388070A921C43D824D00 C&n%
80,284,224 *088D85987002EED23F3AF60091B44E00A6279D02 cnhht
80,284,225 *088BEA70892C80EA576682A0449C9E22820D8E08 CRUZ.RAMA
80,284,226 *088F011B0D27CC866434B059ACF0010D11AFFEB3 d4o+c
80,284,227 *08894C25656DDEA1F22CA6D98C1B0E4E321FAD75 D5A:
80,284,228 *08850D7D2304A4C4FB1CE3F2B250291E1BD4C394 cu8bc
80,284,229 *088ABC319227337E9B1A7CF0C9E5E34C1DBCDF3F d;6e%
80,284,230 *088A84E4B671F2C22942CB349F0326A710F3C1A7 D72J
80,284,231 *0886E3D7C5A05532A11EBB3DA712DE8D0ABAE19F CONCERTOGROSSONO5INBFLATMAJOR:VALLEGRO
80,284,232 *08822216A208F4FA0AA00A8E7DC85114DCFA08D2 [email protected]
80,284,233 *088739C79F321CB2E485C2E05557A22A31C6023E DAHOUZE
80,284,234 *088EB68BC2F35AE8AF1FA52BBBE52B8B1F15765A [email protected]
80,284,235 *088C31A279C4E04D3D8F25CD9C0108E225415B91 DALE-BACKEDD/EI/L_B/&/KT
80,284,236 *0884DB3BAEF8BB61C84C1B826A39F6B87DD34DBC CVWU2
80,284,237 *0882CE291554CB67DF3B10C64FF4DE0EFCA675FF CORTEZ.AGUIRE
80,284,238 *0880BC9A7A100F96F049DC40ACB7630F549DAF73 cytf$
80,284,239 *088C84A75FEDC64D1723CC80E4D37B09C1F3341D D05N9
80,284,240 *0882299258EB634D7AEAC0E51877141A900296EA DANG MINH TRANG
80,284,241 *088AE1F05C8D42FEB8D4FF72B6AE021688A7E272 C-P
80,284,242 *08816503CD75EF1B20B15A76959AD3DBB3C7F90D DANIELFARROW
80,284,243 *088DD2A86C48B12874B9C394CC94E819CE4F9A87 d3q#c
80,284,244 *0880D405CABC79C4E20B74CD1A889D54F2BE5413 d6aj,
80,284,245 *0883828015F7F6D4D0BEB442AE7FFA7298E3AABF DAHLIA19
80,284,246 *08867F23FF103570213EB0AE3D2C3D2DAD41B0B3 darrylmisko
80,284,247 *0883025EB8AE2AB174EB5334C340D8EC289D4589 cqp_l
80,284,248 *088DB5B8745FD89113EAB23B06FD67BEDABE6F81 DANNY.TORINO
80,284,249 *088C398AB6679602DFDD32D285BE0CD4EC17AA93 DANTA.JONES
80,284,250 *0882BD6FFB5884C25132342614617F4553CD897A db6l
80,284,251 *0883CCB0B06793C69FBEAA0D7A96DA473FADAD50 db#tr
80,284,252 *0880F1A97CF6599B776A4C5368723B0CA92C9AB9 db0t;
80,284,253 *088F0DDA09884EE678723E1F09191E132B99891A debbie.richison
80,284,254 *088716EDB687C8C33B88FB31E6FD43938FD0BB99 debbie-swigert
80,284,255 *088683436F2597D3E44561BD1254263DC0E6490C CURTIS SANDERSON
80,284,256 *088A9EA69D3A1B8BA28455B774BFD6BBFE26F759 DE3M
80,284,257 *0882119DA49F564DB9D52B7175581A6E6429C8E9 DEGRANGEŮV
80,284,258 *088C7B8C696C25ABBB6ABD7953A4EEF9B40A9B27 DÉCLECHER
80,284,259 *0880411EF18354D213932B34096BD57A6133F587 C(WNG
80,284,260 *08808F1F70F752B48C6023647865851554EE8FE8 DELMER.SUCRE
80,284,261 *088CA1DA45820C1C576A50F5C4A7B2F1B0DB442E DEMETRIUSFECK
80,284,262 *088D9F144A4BE5607A75623F713783675CA04156 [email protected]
80,284,263 *0889BDA15AF68834DC832C5AF4A153F325EF65BD DELMER.PERRINE
80,284,264 *088C817BEB4DEB21CEBB6D3C9B90A2CBD2E0657E denisetilden
80,284,265 *0885DEC829AB07BC31996E48B5E760297DDE631E dennisjkuester
80,284,266 *088FD46F74209AAE2618CDDF12C4348DDF8EEC0F DERRICK.SARDO
80,284,267 *088AE711EAA2154BD371D57A94990593287436B9 d2k1i
80,284,268 *0887CEDE72E1D673DE304399C1C2399602FA28D1 D3;u
80,284,269 *088D18F32A0CD49EE47FBBDCEC1105FE5AE98977 DE$TL
80,284,270 *088C5C3B4286589231CAF4D052CD182F0996A503 dewan-mahbub-alam
80,284,271 *0885DB11F8CC1A57A521A3E517EB2B1C0D8F3792 dewittlarrier
80,284,272 *088073A6A1A1AD56AE5DD9D5C176954BFE11D015 DAGLEY5
80,284,273 *088A2978A43E15CDDF20F8341C46D5CFAF0602AB D,FO!
80,284,274 *08895E217F7965C5CD4A5BAE10C4063C90E68920 DG#OJ
80,284,275 *0881C98D6520A53289C2A224EB73D50F85907DAC DHRCV
80,284,276 *088725E76C07FE81ED3F3C256B45DC72D46E2903 DARIOHEDGEPATH
80,284,277 *0880E8A6966725E855ADC2768F32A4166A8CC5B5 darnellhaygood
80,284,278 *08834D6FE53FD1FDEB7398682696AA99394B7129 DGS
80,284,279 *0881A9ADF74F2584451204BDEE4A59B8E243A572 DHARMA.DUET.(PART.2)
80,284,280 *088897D80D132A95CEC5FA47F24EA9F623B7B994 DI:+D
80,284,281 *088DCBE1BCD53BC0B1964BD6916B8A2A7C189D95 digch
80,284,282 *088446BC977E340F4743E1757B05DD72DD369D9C DIRKSVELD
80,284,283 *088C0A59EDCE61100AA998A403B9D107E87E0F27 DISTINGUIDO-A
80,284,284 *08869DF0EDF8985B4AA55797351393BF35E9681B dcaliez4
80,284,285 *088CD329AA58C3C83483285447C2D702FB3B29B2 DCO1
80,284,286 *088EF1B8A08F4E53F2E2DFFCE3B2B9EBFBA7BFEE d$m?q
80,284,287 *088EBB2C7F5A63765A48BDB8EB46DFB7094FBCF3 d$n#b
80,284,288 *0886A19E216A849790F9C3223C0E115FD07955E2 DEPARTS3
80,284,289 *088FEB9A9EE8AAA702281310E3D6F590B23FF210 derekshackleton
80,284,290 *0880494308134A1D2C3B952C9D1BAD69CC392FAB DON'T.BREAK.MY.HEART.AGAIN
80,284,291 *088647EFBFA8296F631B7EC8CF2A409EADF068EC donteller
80,284,292 *0882B8A22C91A867E51ED76F5A2068CCDC302745 dorasle
80,284,293 *088262EA7BC63E898E7ADDF09017AF0DBDDC2176 douglasconrado
80,284,294 *088958B55DF642891672A24BB792A5807AFA79AF DESTACADOSYEAR
80,284,295 *088165A9130553677E47455B073842556A1BFE8A d'etredeh1triy0
80,284,296 *0880BEAD5FB053CA32C269F419E0A78ABB67D740 devohstuo8
80,284,297 *088B225D41EBF3C47BA5764810603C2B3469C1F5 DOUGFIR
80,284,298 *088940E743B5A2E0C6D0C23F6E848DBA1B924550 DPY2R
80,284,299 *088A278CC4D302DA5B07ABA449B85BD61A607C9D DGS
80,284,300 *088B29EE5A981186AE35F39FAC312CBD3C34075E dronnage2
80,284,301 *0880C66BFD0C74F2531E2ABE6AED7626A4FAB5D8 dicrotism5
80,284,302 *0888E423376CD222F8784AF0F2F04B38BE5DA46B dtjdn
80,284,303 *088A3260C64B5517C62EDDD2D9E35C5894B9FC7F dsv6m
80,284,304 *088FEC7A9FB008FB65958AA439FC861860C8482D DUANE.ANTONIA
80,284,305 *08820144AD881A9559DA5A372EBDC9EA84462A76 DJARMO
80,284,306 *08867CE10340FB0BA8E0039C6AC53C7B32AD1E8F DUNCAN.MATCHETTE
80,284,307 *088A01A1110DE29ED9434EF70CB94D1EC747D656 DUP45
80,284,308 *088CBB8506A538AE5A79140A8D1B88CB07A478BE DU)_Q
80,284,309 *0884C19FC1242FC2990BBA682DAF8733C3CBA5F8 dkl74
80,284,310 *088CB39B8F02D81889D226B3752F43C477A45A6A EARLE.CLOUGHER
80,284,311 *088E90BE237C516BAE5FB8036B63196152F05E03 d"wx;
80,284,312 *088B64A3C33F9B13A4C5ECADF05DCB6B8B9F1391 [email protected]
80,284,313 *0887200902DDFE49D1B46C258350D376326F2122 DX=AH
80,284,314 *08873815874251DA1D4B2653C3029BA0FCB56D35 eckmillers
80,284,315 *088E0F4250DCFBFBD41271C598A930485E1B4A67 EDISON.HIERS
80,284,316 *088B7ED1D7C6C3900432C2061274F7274C709DCC donaldjunor
80,284,317 *08826CD2205DD69BCAAB99BB012445CC0E94C431 EDGARDODYLL
80,284,318 *088C70C17D90215A189B0E729561456C1FFC79A1 EDGAR.SANSBURY
80,284,319 *0885ECA2CE6C192A638758BC3F1188DE471F8553 dorseykalmar
80,284,320 *088A8ED5A13D12751FD6FA8A08ACBA5955A10FF5 DOSKORAŠNJU
80,284,321 *088AF95D009F6688C616757162BAFA708813251B editnorbbed
80,284,322 *088F3AC4DE5AF9A00C954FB5C309086BFD0DC388 [email protected]
80,284,323 *088C79E2000C54BDA93F906FE5A5ADD4C257F95C >-<~`~`d--p
80,284,324 *088F42C4421C4F487ACA5DF6F9D92D9FF31320B6 edwardogonsalues
80,284,325 *08801F3B6FFA919EF77C0714444A704EDEF5295A dpjnk
80,284,326 *088163CF07F6523B23624A90B4DE44DC90ABAB7D EINERHPOED
80,284,327 *08818A0271A67353349D101550772EBE73D5F012 EI5W;
80,284,328 *08872D3B2457D73D47CA7E3F9D27E29351F64E0D DRUCKRICING
80,284,329 *088CF0562975CF0420C9C5A4C73377D3FAEBC619 DSBJG
80,284,330 *08804A0AB83E0C80C25FBA04FD0328090A0EC4B2 ELMOWITWER
80,284,331 *08830CF09C8669E24ACCF0443181632F1C82479E ELNEGROCOM
80,284,332 *08865038058CC899B4FD166066E9BCCFE5C22743 DSWK;
80,284,333 *0888E3EB256BD5C07358FDBAA430D3DFD0CCA5D6 dt#gh
80,284,334 *0884CBFF28FD2526E715B78F20247E1686FDF03B EM0BN
80,284,335 *088A48B1144BC31C22C46639805F9FC3281B878C emillyjones
80,284,336 *088FA45819728C9E27C09ED5F78B041BEF93787B ELOINER4
80,284,337 *088ACA554613A0FAA5E2DEE642BD4392638C9EAF ELVIS.MARKWORTH
80,284,338 *08898D3D739910E55848186C7CDD073E99C0C908 DWIGHTSWEEZER
80,284,339 *0888616FBEC2A87BBB46390C591AD0A11FFAA50F dwm5#
80,284,340 *0889CC2871C4E972585EE483A04F3D6589E8F3AA DXLJ%
80,284,341 *088C9498791EB36296A608EE2D22BDA7BEA8D10A dxsam
80,284,342 *0880FA9344BFC8725116B36FCEAE3991B1E955DD dymt(
80,284,343 *088D9CA07B9B3F070876D929326B3EF75A7273DA e0g
80,284,344 *088EF0A7F8548CD9911BE156332A474345A91F6F [email protected]
80,284,345 *088EB1E042072C57745FEB4BBAE29C494C76017C ENMUYY
80,284,346 *088DC0E4F31418695DEDDD893384FBBA29AC267C ENOCH.BONAM
80,284,347 *0880CEAAFA1F5E5F7616E033F0F7E2EB5DF119A6 ENOCH.BONDRE
80,284,348 *08863DA4A1C8F48AD0B54186FA58D0BE15529BCB EARLJB
80,284,349 *088B017B5E588BBF2F014AABF8AFD96F4AE6DEE2 ENFIM
80,284,350 *08874938549D1DA3053B1E8ACAA057DD39F6816B ENRENNEN6
80,284,351 *088D876303030EC222CEF0DC5BA1B6B9D1948512 EBRUITERIEZ.
80,284,352 *0885FC019C14CC9125CFCCA987554BF259647B2D ERIKKAAN9
80,284,353 *088543F3C53BFCBA979B1F8DECCB0EA50CA61775 escultores-de-uganda
80,284,354 *088344C98644AAF90C2AA8FD3CFDE9DCDE782E0B EDUARDO.GUITIAN
80,284,355 *088DCD91EE4A88A853CC1B16CC1D81B312006840 edwardgutierre
80,284,356 *0888070ECC9B39227EE917E5381844CC23C0E79B ETHAN.GRAGO
80,284,357 *088B42E7D0C9AA0F1C105154E9DE5A6C1BD5C30A ETHANPOLZER
80,284,358 *088734AC2D321FA5B36EC1F17982A9C1AF37DA0C ETHELBEE
80,284,359 *08881DCE92516B16B04F4C6813F98494375D831F EQZT!
80,284,360 *0888BDACDCD5D5C4BE90D8C6FC0D45809B60C7D2 ETSAPRUSU
80,284,361 *0882F46AA7AC0BE08D8FD5549CCC88A4CB843DCE EUNICEKAYA
80,284,362 *088CA95A6DA2F021A513AFD336025DF4801A9190 [email protected]
80,284,363 *08868E16D7167E0EE5CD029B0A83F5469D2F57DD e_&h
80,284,364 *0884E7A91E603684E60B0834BC840AE6A0CA5543 EX 3 LOW NOTES 1
80,284,365 *0884627F3452C677AAC370EA25914A79C79FA13E EKSPERIMENTIRALI
80,284,366 *0889A63620BA5283FC6803AEA62AAB1D1C7F7CCA ESSANSE
80,284,367 *088B951F37515246FDBC1FE0EEE24D18048D800E ELIJAH.IM
80,284,368 *088D61FB3C5C4A58230A26C504C6513530D8F527 elizabeth-dombrowski
80,284,369 *0885BCA272B041D0E37771A6AAEB286DA4081D3E FALLACOREA
80,284,370 *088552FB9CD7F11C54106E0061C2EEF444435DE1 ETERNAL-DESTINY
80,284,371 *08806E3C8CEEC30A936F73CF72B3C0F2C0EAE580 FAREWELL-TO-A-SLUT
80,284,372 *08869DDF97DE9AF6A1BBA671DBBF78487E7D53F8 FCROSON
80,284,373 *088536370710E9B646FF596FC87B8C7BEC8AED57 eloydekuyper
80,284,374 *0885C42A0D24480CF9DE38B6FD737FFC2C74B54D ELOY.VITORINO
80,284,375 *0882F59B25AD2AA4898C0A1EF907BA30F669B82C FEAHOI
80,284,376 *0883A2A8BCD17D070311B243EA54345EA832912E eum=u
80,284,377 *0883FA2D5C0C4D29AC952EFD1D2ED8EB1CAE386C elwoodwhitebear
80,284,378 *0889F110B037DF964BC58CEC02131B6FFAF34747 e`m
80,284,379 *088F0710F86B005FA98F375C2991CD2C53BB5F2B FIDELMCGRANE
80,284,380 *08805553961D505E6696A551CF57013312A0FB16 evispall2
80,284,381 *08880B14D1B44D35FA4254EC14A70D21ACF61032 EWMMSLK12
80,284,382 *0885D9666BD3C6925F0FF56F80389293C4FEDA2F EMOORF1
80,284,383 *088D06006D16E4660750464D7C26779EA0DCB86B ENDO'THELINE
80,284,384 *088C5597E2E60E82169C23E1B3FCE7C7DAF4BEA8 ENFIM
80,284,385 *088AA194601545C6542DE8450227F81E463640F9 engkw
80,284,386 *088EEDAD2A261439AF8D52EF46FE458FAAA091A6 fredriclowber
80,284,387 *088A8480E8A7A46C0912508F295F272E10D1AC11 [email protected]
80,284,388 *088186654E455BA0552AF54DB33F2F2B98A38A81 FARHAADADAM
80,284,389 *088F93EA0EBBB754700AFF55EE13FC416DEC982B [email protected]
80,284,390 *08899E8F00C09C4B9AF35ACB54B286F8E0637AB8 FB242104
80,284,391 *08884293291AC05D1A38956632FBD29739DF668B FUC114
80,284,392 *088D5274822F7A9EDC694A3A72C206147ED238FD FUGGI'L-SORENO
80,284,393 *0887EE8F681A9843DA751C4CE845ED1E7466BEED fundustin3
80,284,394 *088183FB142D49312B128674C7ED15BC8ADC7E6F FEDERICO.DEMERSON
80,284,395 *08850B3ADFB59D1DDD9701C5F066A31965B8933C ereutheus2
80,284,396 *0884E020A1655C8BBC99AB8812BB545468997139 felixkauffmann
80,284,397 *08875E538BC31D66E46A1672A2109E7B8E35F3F3 ERIIRE
80,284,398 *08800F59D36663F2571D08A8891F1AFE5AF62D71 G3TV4L1DP4CK3T
80,284,399 *0883BF931032E032991CF736FCD0D868C00B0542 FERMINMCNEAR
80,284,400 *088A59F6E66CD6E384026FA270483899173508D3 ferminvillamil
80,284,401 *088074A877A42C8238A637A41107C3126171978D erogabiling
80,284,402 *0886CC2B50DABA368250FF6826753EB89EBF0DA2 [email protected]
80,284,403 *0884A3A200517E9FD3F1293E59D8FF9AC755C642 GAIL-WYNAND
80,284,404 *088933C9605DEA42B6BEF6CE6398E3AF5270A8A9 FIACCASTI9
80,284,405 *088923F905BE215619E5A9F869411E88476872F7 eshon
80,284,406 *088FF13E65B75EA63C57F1FC6245AF826655005F GATAFLAC2
80,284,407 *0889CAAAD1F044E7B9B134558B57CB223A4C1BB3 GATTCLUSTERS
80,284,408 *0880E82652604FFA7466FF09DFB566885BD3B98C etjhxoxa3
80,284,409 *088C59E66146644337FC64BE3153EFA1123A15E2 FLIKTENS7
80,284,410 *088C9C4435FB2834114F2AD445E8749479C207F2 FLSYSTMR2
80,284,411 *088AADF148A657A17BE83106075EAD441464569B general-excess-of-bad-western-landscape-art--ansel
80,284,412 *0884966F8831DD6007C5BEC30F94DEAF54A23277 EV$0
80,284,413 *0884152D9752F9F51D86ADC67779490D6D4FFEC1 ?FOUNTAIN?
80,284,414 *088B20C979816523E78F92A1A25142CA0FDDC8CF FOURH.CLUB
80,284,415 *088E74B6C43D7883AB2590F16F65B1C5F38D5F71 ezequielgaskamp
80,284,416 *0885EEB581C9E2059D0775E2C40EA795DE1982C1 frangraisch
80,284,417 *088ED9EF281539D466EE2D9CA80D28295A02C320 [email protected]!n3$$
80,284,418 *088AA2AFD4BFC265602BC58D10D9BDE651419F25 fadsjkdl10
80,284,419 *088AFA18C4A9002375C219C48A43BD2FDC87FFB0 froglike
80,284,420 *08887D3C10BB823BEEC377DC0BFE3BB84C4E68B8 [email protected]
80,284,421 *08841234285D297167E7D4334DB536CB6F0FFF4A [email protected]
80,284,422 *088AE77CB69B1E3E5D86A3BDFA7E0015DCE35FA6 FARTENDE6
80,284,423 *088E5017058FB22A48C5FCF98E4890836CC3C7DC FUND—AND
80,284,424 *08882CC0D7909D5AED872B336A03A0406226EFCC F/E|
80,284,425 *088EB7D7ACFED425924E48963747DA0BADCC29FE FEDERICOWAKHAM
80,284,426 *08832F2C79A86C99E6F0C3CE23A71EA0D0ADA0C9 FELTON.ANGAROLA
80,284,427 *088E87544B35959FB9E18B1577A796B621B1D682 GP\X
80,284,428 *08886222E8B63392DD8E15343DF29CB46252BD8E [email protected]
80,284,429 *088C7D9B72088BC8C9AD71B94D5681E40350FD96 FERDINAND.COOPERSMITH
80,284,430 *0881B2D0B8B3CFD86EDCF6040D56520308E4A20A GRANDMARUSSEL
80,284,431 *088D9881071F348CA11797DBF93FA76D750AC9CC grenzinspector
80,284,432 *088DD20AF40537C81D056602472A98802698E4DC f<^g
80,284,433 *088A34BD45AE23C96FB2A79040793E7B4617DB28 GARRET.BREWINGTON
80,284,434 *0889B260B62B954969ED1056B439DDA140DE0647 [email protected]
80,284,435 *088B2BEFC9B4707CB13E18635ACD4A62382EF85B g t used
80,284,436 *088CD7B3F7E345688A47B59B50BA236F951633DE GUILLERMOSTOPPENBACH
80,284,437 *088159D8575A26AA99C1AD5CC05C70C8B4A344F8 GEDURIGGING
80,284,438 *088824C302B40D444EFC8C47BECBBDE277D7F37E FLASHNERING
80,284,439 *0882EB8E0FD15928C5BC72CADC126682AB1DA252 [email protected]
80,284,440 *0883989FCFD13413C0AEC4426ADFDFFB0E65064F GENOPSÆTTES
80,284,441 *088D95E7247A87EDB8A62C7742AAA27E69CADB90 GUSZOLDESY
80,284,442 *0887B0FD1162262D796EFFE3F943F614CE289838 GEORGE-KOKOLAKIS
80,284,443 *088A075420A58A9DBFEC9FF6E9051CCA354E73F8 hackerstartrek
80,284,444 *088E7083588F94AA5D7D838AE3C8E55CD3E1F053 GHETTOCHIP-MALFUNCTION-(8-BIT'S-HELL-YES-REMIX)
80,284,445 *088CFC90692EDBA715EC5D1F870494A3C6127BAD GIJO
80,284,446 *0885BAAA635D0004CA032C291C9E77C34E637A56 HAREM
80,284,447 *088B2345CED63286FB60082324E7DDF2656044DA harlandsauerwein
80,284,448 *088419ECCA2D249AAB338DF1BFA453B8351512AD FORESTRODERICK
80,284,449 *0880F1E9D956CF6D9C33F5AE35C93064E9D9C7A6 [email protected]
80,284,450 *0884426B1FE222DA8B07A660933A8F5BE10352F3 GKMI
80,284,451 *08829A73A4CD11D3081B387F494EC86A8B75FFD8 haroldmae
80,284,452 *08808D692585B06C34A2DE647573F67682946BF8 fosterrizas
80,284,453 *0887566517368FB21B101692D5B087DDF49B748A [email protected]
80,284,454 *088892691403C7BB5668EFDA36A25AAAEEFB73D0 FRAASEISING
80,284,455 *088534754180F091E4FD73820A6A8C1C4B0102BA hauptbug
80,284,456 *0885216ACAF07C24D2B974AA19247AF1E133A7A3 HAYWOOD.TRENTMAN
80,284,457 *0881B40E48C5B62FFD93A27EB363FBBAD7C822BC HAZENESS8
80,284,458 *08872A3B34506B6435CA0882EAE680EBE10FB1D1 FREDRICKZITZOW
80,284,459 *0886FACF305E59CEEDCDA6993561FC8AE54A6EAE fu85
80,284,460 *088F2AA39284AE16CA4EC503A54D8CE00BEA1679 héngkè
80,284,461 *088BA025F715507B130708CB7A983B52918C2056 FÜLLWOLLE
80,284,462 *088043385C8616E19DCAB906D2ABE06E53E13395 GOMMEUSE
80,284,463 *0881F409CADD3ACA6C0934616BDF299C521EC02D gorrinis
80,284,464 *08885867EBEF83F53B60B530C8C4A14ABAF8947F hermanrinderer
80,284,465 *088BBA42438CCD7FEBD046BB7C067AD909A3DB6B [email protected]
80,284,466 *08860AFD793E54D22BB22472E5DCB547314DA768 HF&
80,284,467 *0888CFD38380EABF88557797671F3BFDFBF76902 hFranklin-stove
80,284,468 *088CF14CCFC92001D71ED0C0B295DF7C87423A7B gracier6
80,284,469 *0882250F6C6FA56FDF7591F499B28BC86D827E87 [email protected]
80,284,470 *0880B31CF22209F4C26F53184555F1F8160119BE GARTH.CASTALDI
80,284,471 *0883EA077BD08D37CE4B0B67CD7836B46924618C GREENANNA2
80,284,472 *088046564F2E77971C109A66066D95833303FFCB greg2009
80,284,473 *088E342DC589BBCB1B1B81D0707D19C532A25FB3 gavinpascua
80,284,474 *088AA88FA08FE2B32C543FEBCC14EC69C574C739 GAVINPINNER
80,284,475 *0880CBBD98247A463660AEFC1C0BF2E171C55D24 GC1149
80,284,476 *088B582EC398F6ABA83E0C21E52970A18F66D374 genenetweave
80,284,477 *088D901EF756F67BFBFE7B72947D46BB30AEDB9D hobertgrebner
80,284,478 *08845BA8F55AAE75466508D163FA2131E8CA838F [email protected]lmotcom
80,284,479 *0884B2F7AF0B34AA9B61EE6F7E469BD9638A42A7 HOFNER-BLUE-NOTES
80,284,480 *08802BA742715E2761BC1D7E6C6C5669604C394A HOLIDAY STYLES
80,284,481 *0885325F2C1F29152B661AAB3699F546FA43DD6A GERARDO.PINICK
80,284,482 *0889BBAE16EC6B6759FF352F590E15FD44C450CB honderddeliges
80,284,483 *088B426D7E306B29EE659973551B3A2DCEEEDFAC gilbertomoretz
80,284,484 *088D2C3BB29C65F83E6F91DA87BBDE8F2CBD4FEF GIL.DYE
80,284,485 *0885779015FD417453108FDF7A49D3EBDE3806BA GILLESMELOCHE
80,284,486 *088A7936BCC9F22F76A9F3183A08E6E09D124D7A HOSEA.MEISTER
80,284,487 *0882750ACAF7FEA337555791D0036700CE2E8489 GINTS-STANK
80,284,488 *088F99DE365E889B8C779D94B4F521065336643F [email protected]
80,284,489 *0888D23E5584EBD723CE7E7719EBC810E676120E GUYBORROR
80,284,490 *088BD28125190BA5B8BAC8B17B265C653A334AFF HOW LONG (LP VERSION)
80,284,491 *088097389C44EFE1386E83CE239CDFF611F7C2EF HOYTPOITRAS
80,284,492 *0888BC875C2B29DB5DC81B7AFD7BF4869D592CC2 [email protected]
80,284,493 *088413391CDC91C4CED81320B0DC6D247F44AE89 GYVV
80,284,494 *0881C37EE8DE98E2320C597F73F4137893DCEEFB H057!135
80,284,495 *088C50E7A798702D94EF264244C0CEE663E5276F goatpluto
80,284,496 *08865B36724D033F4362DB96CC8C7D1E3E4714AB [email protected]
80,284,497 *088F0F68B2CB6153CEDB4B92B142187BCA880638 HUANTE123
80,284,498 *088AB12BBE7C143AB5275519050719BE66A94825 GRAIG.GROSSMEYER
80,284,499 *0881B8A915A77188392383E8A0D6D84CB81898BB GRANTDOERFLER
80,284,500 *08887E083F4C2DBE51043093092F65A6E96DDD9B GREGORIO.KLUMPP
80,284,501 *088B536E3E71109114603E85B6FC8C66EF07378F gridasteses
80,284,502 *0880027650CA695278DF8F480769B0E5783E6352 GRISETAS0
80,284,503 *088C04C463C262A83ECC41AC1EA39430B3184ADD HARLANDLUTHY
80,284,504 *088ECC76EAD5B25F72E468BDA985B2752C0E5580 HARLINGERWEG
80,284,505 *0888B6B02730C6C451947701C7FFCED4C24E0DC5 HASSANABDALLA
80,284,506 *088FC16AF7027C0106E589478FDC2D50D2BB5955 IDTTYTYY0
80,284,507 *088DC62E655C5892A37AFA6DC50718163D7B618B IFABRY
80,284,508 *0889FDE36BD91F40CFAC280A9F460FEF18A3D804 HAEPARI
80,284,509 *088B1936AC6E53D974D8519E6AE108583BDB9918 IKZI
80,284,510 *08877BB5B88B2A0147EBEA99E8633EF2445B2A0A ilovehuey1991
80,284,511 *0883BC8F8DACF7D5D311205E46746D8C00B53C3B harley90210
80,284,512 *088F2790E047B334C52C9DC957A2E1A1C6AA8730 h}db
80,284,513 *0887FAEFB2AFFBE9B0347D17D951794A47F7B6DC héroine
80,284,514 *088FD948380BBE6F7263C9C5D915093FB6A85449 IMAGEMARTINAMCBRIDE6
80,284,515 *0884A82F6D258AD5768604A19E5088FBD020E899 HIDROFUGA
80,284,516 *088EBEFC1FBE901478AE766360EA33F5C46A7152 in a song
80,284,517 *0883A979549816C130FE4B1F688ADC21E3D8C1B9 holly.rafferty
80,284,518 *0880A7600B0B8A7814851ED323271629661B347E HOMBUTSU
80,284,519 *088611257AF36DD3EEE77F099EAE5F5E411DA4A4 HILTONRATLEY
80,284,520 *08877418230AE345B195C42E94599D8BE4652610 HOOFDKWANTUMGETAL
80,284,521 *088D4833FFB9BDA1C19CE7953EAD539183306F5B HORACIO.BOREMAN
80,284,522 *088200B53894A8CFF13EA97B4C74F87FE3A168D1 hjanean
80,284,523 *08826BA0DFD5EB5A447B06FAC64749D35C380B39 hmanitoulin-island
80,284,524 *0883925D1307A5765700A7977CDEDA0D99DFFB09 [email protected]
80,284,525 *088D7927EE7DB0C0E1EB581E83022839BBB1B83A inthearmsofhislove
80,284,526 *088E1910CD8C266EEB851ACE7030556457D02039 INTOTHEOCEAN(DJSEDUCTIONMIX)
80,284,527 *0885064DC82479E04BA9CE57ABD50A98D62CC1CC IRA.BAMBERGER
80,284,528 *08880A48800A0D321B0C7AE37459399EE437C76B hotdamox8
80,284,529 *088C267BF3EC70ECD5841A41023478082F7E6D10 ISIDRO.KROPIDLOWSKI
80,284,530 *088F8547705AAF86F2369DAABDDE682CAB28B557 HUBERT.DADA
80,284,531 *088AA00A8B9489CD9C67DD7BD42EDF8F220FB4AB HOWARD.CLARO
80,284,532 *0888EF80E590A54F353F798F360747EC6658E0A3 hugheswibaux
80,284,533 *0882E681AF5F5B884AA505080F426C4EEFD00438 [email protected]
80,284,534 *0887BB8E5D1734C0ACFD92B41AD1F5BFDE6504EA IXAA
80,284,535 *088D6235D82D3344D8A456D59AED503970996CA5 HTTPWWWWMGLLCCOMMA
80,284,536 *0888E11A88E221A5BAB281D63F5C9B2CE45320FF IZSORSZKIJ
80,284,537 *08826EE4BA1D053852ABA4B6B57449D5C36FEA63 [email protected]
80,284,538 *08820C09C19FF14A55A14EB5A73CB7B7D45AA2B2 JAAJAAA
80,284,539 *08899FABA0226AC48EA46FAB00193B30F9B4DFAC IAMDODGERS63
80,284,540 *088B077648D5940851D4A70ED4859DAB7EECE479 IAMQWER9
80,284,541 *088AFEFE22FE0D8111ADECDA06549CFC15897443 IDUSN2023224020091121
80,284,542 *088680B1644DBFA5B01C350F2468041BCDEC2C36 I&>H
80,284,543 *08801C8B9B241A25E5F511E475A59F55853E298F JAP\
80,284,544 *088DC53787394930AC2F4EA70C43CD7D6B7649C0 JARRETT.SOUSER
80,284,545 *0889C8A0E5BDDB8A734C2EA08EF03A41958B96EB JARRODCREVIER
80,284,546 *088FF7C906A93AB560020B23C035AD4FB4E1A77B IAMKRISTINE15
80,284,547 *08819F1250DDE11CC7EC58255E126958670E0129 ilovechameleon62
80,284,548 *08889BD5E9DA45523A6A8A47339DB002AEB9E412 JAYSONLIO
80,284,549 *088B6C71E7D9DD98455BD899227D2EAE69EEDE76 IDEEFIXE
80,284,550 *0884E26A22F87D6631AD3DFEB3105A2DC56D781E IDUSN0218881320100302
80,284,551 *0880B33A0F3DC21070716D8AAED461125704C32A INF0RMALITIES
80,284,552 *0886B934BE7A24320AE804F60C1F07BE0A9F0A43 JERROLDWELDING
80,284,553 *088EBF620511523B368DE57C579E3E0E701EAE69 ILOVESANDRA60
80,284,554 *088526FD6780B9DABD074C40B3742C6E90821B16 INNENSEE2
80,284,555 *088CC71E3076840838664215AA0EAF01EB6042C3 INVOQUER?
80,284,556 *08832EE9D39B37ABEB6EBA7CDD510C5866617451 indigot6
80,284,557 *08844C8E37FAF84CB3E0725C0B5230ABAEFAA9B9 INDUSTRIDATORER
80,284,558 *08874C1FF64BF6D114344B77D0549AF38E15442B IN$ECTP0
80,284,559 *088E56C9EBDAEA754ED02681ADC323E41BB1F638 ISTIGATI
80,284,560 *088238A092D809D0A3A72673428160AC8197699D itamrofni
80,284,561 *088390B34DF7A61E66A43A5E2DECF7EA952FFC89 [email protected]
80,284,562 *0887FE4B2F1B02B8CFCBDD17B2E08BD2BB7A4F85 JORDONDICUS
80,284,563 *0884790A4ED2A324B308D64073D2C29CD0A16CB0 joshbeukelman
80,284,564 *08805075A586671A963774DD1471B05224813DD3 JACKGERAINT
80,284,565 *0883D7308C9BAC48921D7CE9F04FCDE80CD5DBC1 introverze
80,284,566 *08832A35DFBFCFF8360723E9D22B420A337CE763 JAKE.LARROSA
80,284,567 *0887C53C608B75A54198E0C233CFB3C7DFA9C995 jakeruether
80,284,568 *0880D9CBC77C3433A6F2A3CD1E3ED4CA941CEA3B jalovici4
80,284,569 *08839FF8474E937A9EEF0692C79EBF89920F02FA JAMIESACRAMENTO
80,284,570 *0889E533EFDFF076E916A16531D30E5879DEB0AB JUDY-ANN-WALL
80,284,571 *088842E3453E8ECE74B5CF91BAAC1B035FBE4410 JULIO.BENEDICT
80,284,572 *088DF335DAA58EB36CEE02CE08026529CBC0B65C ISBN7532080846
80,284,573 *0882E1551D2A9C9AFB605129E8282EBE97D5FDEA JULSERA
80,284,574 *0880C6930DFDE33C69758C936E4324D993E3D1C1 ISIDRO.DERWIN
80,284,575 *0888EBCD0B2EDF7390A33D1FD0707DFF89640ACC ISIDROSALAMA
80,284,576 *088A016363F6D02FF76758266371E16FD2A426FC JAN.HULSTINE
80,284,577 *0882B407C9C52C57E86178DC7317B758559D79A4 ISRAEL.BARBARA
80,284,578 *088857E43C3185465DC5DCE64F59119982200551 [email protected]
80,284,579 *088BF3A26F1B63806A2AD2BAFE5F080EDC413A3A jarrettsulek
80,284,580 *088F5318B5732211E50F89853C7099BD841976FB [email protected]
80,284,581 *0881EC2A18E199A89A9BF115A11DFF638642D426 jxc1of7lg87o59s
80,284,582 *088F9ABDBC502089F2BBCAC3D83090152748645F jasonruyle
80,284,583 *0880342CD2C460F043562A7A09D2EFF224CF7601 kaitlynvargas
80,284,584 *08812A90158FFE81E8E52F4FF0DA097687545100 iznan
80,284,585 *088FF293B6E6D9A1C541A465EBF2A0629442C565 J,6
80,284,586 *088ED06987B695CAECD9422F19FF189CE9168160 JEFFREYPENFIELD
80,284,587 *088CF2E536DDCBC9190AFA85B6D96679E35DEEAB katymontague
80,284,588 *0886E36923DD0EBA90C14D18BCB7798AF351F016 kayla.bannister
80,284,589 *0885E780980705C17C63C8C66A35B5F94660C385 JACINTO.TROMETTER
80,284,590 *088A131BFF74885BFA3F4278AFE86745A2875F08 -KB-----KeeP-BRoKeN-eXTRaCTeD-FiLeS.
80,284,591 *0881C2AAA84A072461F2E0B0E25CCC9D708970EA JACOB.OSTERHOUSE
80,284,592 *088F429554974C10541E95A1E7D7F83711626BE7 KDB<
80,284,593 *08825629DC29FA656C2A55DCA04FF6479E8F63D2 keithgeiger
80,284,594 *0885D8775DEADA3F39D17803C6871195C4C1E334 KELVINGUNDRY
80,284,595 *088EFB7CE334EEB9994E384AABD691E1B746D497 JESSECLAIBORNE
80,284,596 *088E726DE964E0BE098BC716CBB39385365E86F0 KEN.BESTE
80,284,597 *088BFE038461E62CD06A97E163BFD04016FF592A janheade
80,284,598 *0881C1D7EC7DC05786F41537EEEFCDEE60626224 KENETH.BERTO
80,284,599 *0880EA5E99D755ABAA935C2866FCFC58D5336673 JESUS076
80,284,600 *088503B37FA84D1FAABF8A2E385D4479E5E54F08 kennethrodarta
80,284,601 *08818BE6B2743494B81768167AA7EB2136F00A6F KEVARIS
80,284,602 *0882655AEF91BB7E9D4E03B00B22B178C15434E8 JAVIER.BISON
80,284,603 *088E148C729C4C65228B1C0F347A8191818E733D jiggamann9
80,284,604 *088017CEB36E407A27DCA71C6FB0591AA096856C jimbobamboo
80,284,605 *0885F17BD2D6F50C13E8F1ED9EE4D4C0853FE6AD [email protected]
80,284,606 *0880E85E19DB049250B12AF2551947FCC5460784 JC.SHEWMAKE
80,284,607 *08881FE74E82D25E7EAB55864E0A70B94034CC7A JLHSV5
80,284,608 *088984C21DE3E479B18AF80C9B2FEDC4EB8E2108 JOAN.SIXTOS
80,284,609 *0884611C922F33B0FACFA5A94095DE74F28A5FEB JOBS.ST701.COM
80,284,610 *088147BD8C678C00937C795C229FEFD90383A1F3 JOCELYN-THURSTON
80,284,611 *0886451047DDC081C2BC39C85B2C634E0AF221C4 joelocasio
80,284,612 *0884A16B6F72D26F59C5372F42EDB7962E0DEAC7 johniemcnerney
80,284,613 *088ACBDF61F72515F94F2D28657328C29812443C jerroldfedder
80,284,614 *0888DC2C2B1599D73DBB05E06722CC96CDA1F9B4 KOISHITA5
80,284,615 *088FE82F5DDA372CE22F283ECD3DB0847BC4C746 jesse.washburn
80,284,616 *088811D4DD95FF4B80A3ED7DCB8EFA42C3693883 JONATHANPEARL
80,284,617 *0889F87347F8B148EB3CCA7B95AC1CAE33A0897E [email protected]
80,284,618 *08890B30F02A6828E396BC0047A08728585C827D JEWELLKIEWIET
80,284,619 *088BD8846321C335C60F116B63CE418CDB32B5EB jewelloza
80,284,620 *088412972B12FF3AB7347CA7AA18EBAA9EC81117 JOSEF.BOSMA
80,284,621 *0880B044A297DD3577AC08F829CF3ED612545852 JOSEF.FOLGER
80,284,622 *0886D73650FDF1F886E01B1F8877F278AB12A500 [email protected]
80,284,623 *08804871F7B8316EDCB1AA80C17197069BA53DA4 JOSIAH.MELICH
80,284,624 *08826B6CDACE0C6A43B290C000295427296EE0C3 KURT MINK
80,284,625 *088E04B4BEBD388F373C5C70C481094AA90E34E6 JIMMIEDAGNONE
80,284,626 *088472E6FD11C90EE6B4B411E965F7650CA5FF3A JIMMYDURIGA
80,284,627 *088234F9A74C502F01ECCB141D920F307BDCB197 JOYDADA
80,284,628 *088B91056F9C403200C56B3E2F1F38635C655E29 JSVELNYS
80,284,629 *08819AE4398CE4C778E1A996D1EE7769318F3179 L57056
80,284,630 *088E45DE15ECB3DA79FB9FEFD21CE4BE5B750E23 joan-bonham
80,284,631 *088B16961F0CD29F4A81765C743ED8C23DE0874A la ci darem la mano (don giovanni)
80,284,632 *0887E2D4AC4993285DCB0DB76BB9169855AB6E20 LANGUAGESEUROPESVG
80,284,633 *088C5747E56F997551E527E71869DC33B5483871 [email protected]
80,284,634 *08894EB9D63FBED491AEA8E93C6AF8A86DCB417A johnauten
80,284,635 *088768D277CF124DB9CC6DFF68B6BF72C0DC0EC5 [email protected]
80,284,636 *0880FB32C3D4CEC6719D57FA29BED4B372253727 johsemlak
80,284,637 *08887BAA9EB9159270F846A4F71363D06AE9C2FE KADASANED
80,284,638 *0884A5275345B973883647B96D85C3EAD3CB6DB3 leatherise0
80,284,639 *088ECED03C693301D12A2BE63BD2685FF2CBA361 [email protected]
80,284,640 *088692B8F7442F92D5C591D95683A6DA0CF015D5 KASSAFACK
80,284,641 *088CC44DEF8DADAFA3D23C32F28A1E183801166F LEIF.RUMFORD
80,284,642 *0886C5E71C426F0A0922AD81159B3D445AA2D7AC LEIGHHOSFIELD
80,284,643 *0888D7C5057A6C5057562843D257916322EB3B2E jot.gill
80,284,644 *08858A837F7DFAF82D11A069E03BD0F9EB30DCE8 joylynnsmith
80,284,645 *0883986386D304BF99A1DFBA2D05743D813EEAB6 KATHY.DAWE
80,284,646 *088B944926A92F995CFA78B832C5E2913BCDC5BF KBJYNXTHELIAR
80,284,647 *0885411446EA25A8AFE9ACFEEBDD520EF7876632 JUAN.APPELMAN
80,284,648 *08823CB8953CC65A24109ACC115F3204EA6983E1 keenanbraswell
80,284,649 *08882D818A1C526E5E065FC85A5D5C5E7BA70939 [email protected]
80,284,650 *0881931B0DF4F151FB191FBD8496790350CF2F2B KEITH.DEPALMA
80,284,651 *088BE893DEAF8CDC6340B6BE034194A5B3FE1C86 KELILM
80,284,652 *088EC34FBC1AF37D17AA92B86986E04882081770 LENNYSOLMAN
80,284,653 *088CE0AA6956D7A6D1A96D2707FA175B7017968F JUDSONGINGLES
80,284,654 *08896850BC49AB5DFE16F96AD38AF51756683608 LEONEL.KLINNERT
80,284,655 *08870FF41DFFADC34AF6C97AEC094B58BBC67A39 JUR]
80,284,656 *088C379EC01C0B50D121353937DF22E9BFE8CE08 jx/m
80,284,657 *088ED14929A8C697BAC3EFBF8D09906AA612B949 KAJN
80,284,658 *088EA03B4E2EBF60DCE46CCEBCD7E5160F560B66 kino-industrie
80,284,659 *0884C77666D444495F36F49A083E059CB6A180E8 LINCOLN.STRUCKMAN
80,284,660 *088DEDB01E83E8DEC05E82FD8F520A461AB88023 LINDSEYLEMMA
80,284,661 *088CD065849C5D7BF858DDAD05040328505D7425 lionelevetts
80,284,662 *088FA3527A2FF6BF04EDA2AA80E0C67DEC6BC5A8 LISAHEINEMANN
80,284,663 *088147BFDA27E4F86EA4234E7B3307BF1DF24246 KARL.ALFREDO
80,284,664 *088093025488F634939F3B9D7550F2F39C7CF155 KRIPTIRANJEM
80,284,665 *088E4E5015F2ABAAD374C9F599CD2F73E2F89ED3 [email protected]
80,284,666 *08824D65B7474BD9D2B0C5CB2384873296F33335 KRISTIN.GRAU
80,284,667 *0881C3DCEA1FAA532E2E4B03119449F09B180C16 KRUDTFABRIKANTERNE
80,284,668 *08862A8EFE43C4C61EBBB5024BDEEF8557DAAE43 LJELLEJ
80,284,669 *088AF490699467EDC35EE7310C7A9F71D07AEBDA kellytheurer
80,284,670 *088F1C912756474C1A0FBF60ED8871D881A6F150 [email protected]
80,284,671 *08847B6E2F3E308A743E3BBDE150F5967C6559E6 KENOTOXI
80,284,672 *088225AE7A3DF99A12EE5C11B5177508B1AA34FE LOKÁLTULAJDONOS
80,284,673 *088808E1B415683CB7F1012F594974EEEA9238FF LOL713
80,284,674 *08836E651C2E224A81D7010FF31695DAC7D7BE80 kharjuuraamsha
80,284,675 *08866740241776A17662AB9033F84A14F412E773 kilkenny's
80,284,676 *0882D28CCE453CA248600FA8FAECF9F81FE6B217 [email protected]
80,284,677 *088213BEFAF6A4288612C1B32B883CAF177D27BD KITCHENWAREINDIA.COMWWW
80,284,678 *088AEEAA8DA48326CD139400BB3B1CF23A32BA0C LACY.HENNINGTON
80,284,679 *0887A37CC02D2CF06548F9E3062827B9570FDC44 LACY.MANJARRES
80,284,680 *0888FE5F4FF24C158E28CA6F8C61C5FF7379B791 KITTEN2PHANTOM1
80,284,681 *0886F3B0DC2E809552A9CB6E95F1AFE2C7333D1A K-)J
80,284,682 *0880CCA209B7DD9142E1D8C61222E451DAC4984C [email protected]
80,284,683 *0888174C8824586D5E4BE5E22AD69DDCCE72F2AD KLAFETA1
80,284,684 *088C375E94B40538CA5E916862181AEA8155B7AD [email protected]
80,284,685 *08845EA19ECF4746A60559639D98A807EFDACBF8 km!]
80,284,686 *0882B8A1DBA83A9BE860E766A29F95D1F5F5771B LUMBSON
80,284,687 *088E77FB27CF1E046570E1715D11C1D780025342 KNEUTERTJES!
80,284,688 *0882F397C5571EFCD6B1071D816F03FC36926F42 LAWRENCEAGERTON
80,284,689 *0883EFB4E31E4F291279CCB4C9DBA3E15123D26F LAZARO.LETTERS
80,284,690 *08888CB3623703634B04DF3D2741166592169143 lderenEdit)
80,284,691 *0889A8D4AE1B1F3BFC9A3CECBA04D456AF9916B8 k\pj
80,284,692 *088080ED3DC5267D5116F9594E6D827D58D175EA KREUKKATOEN!
80,284,693 *088706CEAEC80A5F937BDE6B8EC8B323BA80FE99 ledningsstrenge
80,284,694 *088A84D28297A07BDF0C77EC847BB3618F27C665 KRISTOPHERGAGG
80,284,695 *0885D299B7D3AAB4BAD2E558D19B29D5F25C9BB1 [email protected]
80,284,696 *0880F7C4AA4FEBCE2602F2DD2702D761BF5C4E48 [email protected]
80,284,697 *088DDED40CD410FE147A398BD1FE3E45CA4EFD6C KSTANLEY4
80,284,698 *08830FF9C0275F6BBF3D2493BB1744F5185C76FC LeMariJaloux(TheJealousHusband)
80,284,699 *088B9F468157ABFC6DAA6EDB6B55E0050CC9E6CA MALAKIR1
80,284,700 *0889F70456EEB516B56C2E6A5AA21EE67A0525F1 KVXCRPQ57
80,284,701 *088986378EA6548D6F2EDE45D41FB6E240262088 [email protected]
80,284,702 *088598E30171C9B767AFDE2DA2B8FE7B553DAD6A lepanto1
80,284,703 *08880F37039FB05698BD4309CC884E841FC122D7 laballadedefran
80,284,704 *0881F0ED464DD4B388B1A26C3D1DCACD3CB67587 LESLIE.MCCAUGHEY
80,284,705 *0885106938F0212C751604C5655C61F47A248FE4 MARCELINOSTELMACK
80,284,706 *0882B1FE281EF0F43D6A826A6058D62D4FADF775 LFPAFBYFFB0C
80,284,707 *088244DED30DADCA1D32B68E05932F79746D1831 mareita3
80,284,708 *088E4B176C3B084BFD1F8B2BE977942E7C89BBA0 【marmo
80,284,709 *0880A064BA0680B753EBB150AFE041C8E5610FD1 MARQUIS.SURINA
80,284,710 *088455F2301EFB859FF7932D6E3CF2E681823736 martina-odonnell
80,284,711 *088C30D82BEB67148F6675F0F4CC123AAD0C4E4E [email protected]
80,284,712 *088463097F661AD392226121F1C45D1AA25A66B1 MASTURBATE:ALICIA
80,284,713 *08837254C6FEA9423E7DA341FE73E7B5CB937B60 MATHMONET
80,284,714 *088B94F25FCC61E5AC2642929A0860DE5183D9DE LAURENCECOMPOS
80,284,715 *0888578D658831E67E9DEA645CA97F891943340A MATT.NAVARRA
80,284,716 *08880F34156BF53A4454C9D0089DDE4FBC9ACA22 lisa-sawyer
80,284,717 *0884B331EB0FA1EAB4386CB6F767E80738CB8FE1 liutangui
80,284,718 *0888160EB9666340FC27C8A383D29B3670FD9E73 M=CH
80,284,719 *088CD9B6E263CA9E8F7DF13FE9618F396334FD6E [email protected]
80,284,720 *088D309F940FC15BFC5BEFE082C54C3A4D0CDBAD LE COMTE DE MONTE-CRISTO
80,284,721 *0886EDFDFD1037030CD49F06E4CA30D46A5C0440 LONG.WERGIN
80,284,722 *088DAAAD8F737EFBF615A36E51C1B65A994D2FEE meme-khalid
80,284,723 *08867005C70BAAACBB5F44D174B21BE4078029E7 MERLINOYABU
80,284,724 *0885824DDBF967CFB528A050D5366A32B7E6FF56 MERRILLMOMPER
80,284,725 *0881F5E8A4ED291E6A7C56D4B386CFAABBF48F85 MESCALINE.2
80,284,726 *0881DC5EF7C8487A493C71029B3AF45F9F136AA9 METSRAR9
80,284,727 *0888448E476C717B4F72BA9C342998D9B0CA7D14 LOVELESING
80,284,728 *088869417901648DF913EE40D30D0F09A70AB834 MICHEALTOYA
80,284,729 *088746FEB1A0570B14360781D1156B400DBF8193 LESLIE POLES HARTLEY
80,284,730 *088372BE274F62057FEEFD8BE2AE9982E5A66538 LESSASSILESSASSI
80,284,731 *0885339E5B270E7AF8268A5D8692F1A3AE4D0EC8 MICHEL.VANVICKLE
80,284,732 *088B6D0E24315F554C9766569466BBA9F1C716B7 MIKE-CIURLEO
80,284,733 *088AB183E55E571877D387E9D294C2E8163DD4E4 lucerne.concert.hall
80,284,734 *088F21B78E2FCC780575E0179BECA8F9968C6935 lucha.antiterrorista
80,284,735 *0886F418B9FC439A1853E79E8E45B260CF9645DC luchtbelwaterpassen5
80,284,736 *088DF939AF6FF706465D198ACB2BFF88C74059E3 lucynat7
80,284,737 *0887937268247A1DA3508474E083BAFE01B17346 minhbellow
80,284,738 *0884E8BAA69B95CA49995C1945C99B5A25AD7878 [email protected]
80,284,739 *088F67602C3E5F182FE28A233F2A782B9966EF36 LUPEDEWATER
80,284,740 *0886FFE2519DCA97CF771D44BEEAED73F490CE98 luxury-(vox)-(30-second-version)
80,284,741 *08868CC3DD9E7CF9700173E25F55B20C69DD2D25 [email protected]
80,284,742 *0882701A25398E0235F5BFE4E8EA01ECBFFE1CC1 mitchelmadu
80,284,743 *088FA7A9BFA8FE9A28224FCB0E4FF63571301527 linohammang
80,284,744 *088C79CBA0B0D4E29457A2897ED31007D160D7DC literaturgeräthe
80,284,745 *088722DF4758A848609545F8514D0CAF429D2D2B [email protected]
80,284,746 *088BF5E7DB927211323C045CBE11706A3A2C274B (M19)[DEPARTURE]
80,284,747 *088C94B82841BDD94B5F2545BE32FEC31828EAAA mohamedtadgerson
80,284,748 *088BD6291065478D46A131157014C2E9C3E873C2 mohammedalimughal
80,284,749 *088314523336842BA7B9181C864CEEC49688DF6C moisesbork
80,284,750 *088A6B7758754B9CC5FB26FBC48B6D8B5AF322C1 [email protected]
80,284,751 *08821976870DA559743C1B2816B3AFD3F1BE9B1B machinsky1234
80,284,752 *0888F55EEEB3A9E6BBB6E11CBD8268885C1A4C66 monopolisais6
80,284,753 *08872C0CEF9559243E1A6101D0A22015683127C3 LLVSRLDS
80,284,754 *08895558C44E0433A36E64C94735C774D033E034 [email protected]
80,284,755 *088AC13CDA3528662B1607AA8FA569CAA70BE478 [email protected]
80,284,756 *088AC67E6889E39DD732AB1488370F7832E4054B monyested
80,284,757 *088DF2C1DA7AAC01F590AF6F6EFFDE85ABC14B91 longrodriges
80,284,758 *08878F7EDB5EDFFCE53F6A83DCBFC913798827C7 LORELEV
80,284,759 *08890DE8A8014A4E2B1EF22970C12E9022DFB78B [email protected]
80,284,760 *08849D7AD88D2D9A40A9BCC24C0410BF096E04A8 love.me.or.hate.me.(jason.nevins.retroelectro.radio.edit)
80,284,761 *088C582C628D4F82AE6D2ED25B2D710D6FC80A94 LUCCHEMIN
80,284,762 *08853133CE7A1EC57B067858FE067D5EF3229100 [email protected]
80,284,763 *08845D4C50C64A76571D1883B3DD30E682238D2D MARGARITO.STROTMAN
80,284,764 *08842F4FE9CEDF3CAD7BA4011EAA932C99509911 MARGIE210
80,284,765 *088B731388410512F9C09E7621B0FDEC6EB73791 LUPNZPCPDRK
80,284,766 *088CA21770E97EACF41541A7DAB525A3E9B8654C MARK LAFAVE
80,284,767 *088D4DE1CFF34B731C25C9F3721E8E4E2213A09B marksjoberg
80,284,768 *088147985333D15B1B439BC7C428DBEC62AA596B [email protected]
80,284,769 *088021C8BBA76112ACCE1B18B53C34377769EC8E [email protected]
80,284,770 *088CC7F81C1E9441C8E84BDB060EE0EA597E8D3C N491539
80,284,771 *0881FD67BACBCD341E7AB7F02E8391FE5F84DC13 n&8a
80,284,772 *08818EBA7D9777E5EB2F4692CAB02EDC832A5FAF MATIES.MONICA
80,284,773 *088D489CBC20833765DC0239C6E480537641258D MATT.CERAMI
80,284,774 *088CF2C46077F2696E1819C28500E104CEFBEEE0 mature.
80,284,775 *0887D5D30A2A62ABC8859B47EC3F68B17E41D5F3 majornewton
80,284,776 *088C1C206CDCE7169A6717AB74BD5897C5DEE390 MANGOBLUES
80,284,777 *08878ECFFE2DE442C45DFEB7BDEC91BC9A6C39AB mayday
80,284,778 *0880983D20B0029B6FBD1CFD4A0D5585DEE9D9B0 nastupasmo
80,284,779 *08835E0D70BC430BB961451B4EFCB40A0ECBA7DA [email protected]
80,284,780 *088E682553992FD56F5E2E9BF778EFA3895D7E0F NATASHA-HAWKES
80,284,781 *0883B509B6B59044EF09DDA8EED2AAD1EAD4734A NATHANBANDEMER
80,284,782 *088F2A622B845EF6809CC00DF3541CA0E1E624EE nathanielcossette
80,284,783 *088E7091416E86221C78CDEB2A261EEE8F8C1BDF MARCUS.YUNAN
80,284,784 *088C7889A577F2D601814094346BD94E68543F1D nbhrdst6
80,284,785 *0883448470AD14B7AF2DAC34E63BBE72297AA953 mariavanderweide
80,284,786 *0880D730628D5F6D11E60813D4DA99288CC07415 marlonholberton
80,284,787 *0885412845762FC26949A34F195DC432479DF5C0 MARTINKAHLER
80,284,788 *08804C3E26ADE819A31F01E8BD871CF9C04C3D90 MEDIAMONITORSCOMETOMALAYSIA
80,284,789 *0882EFD27C2CD830F19AC321A0D38C230C020D10 [email protected]
80,284,790 *088598BB558AD0A1D8E544FC3A2BA88B5EBA5A07 [email protected]
80,284,791 *08850D72EB202420A451986EBCEB647858657B88 [email protected]
80,284,792 *0884C58A95FCDE04F5EF41DD80E11DF3CF34AD15 mayday
80,284,793 *088589653CE8F4AAA06F78FF9BC712DDB43282AD menoveho3
80,284,794 *0884F2CDE64CA3685881ABC74FF2EC8FDEDF7D95 meridolum.depressum
80,284,795 *0884AB574063C983ED2146FFD12F9DB7E0109201 meeoow!
80,284,796 *0887272A6AC0C02285EA91086AE75A63BDEF226A nicholasdahm
80,284,797 *0880B81AA4BFF38A726C953F21404023F81BBB08 nicholasstirrup
80,284,798 *0884E9F8AE66845BF4DE16DA901E5ECD33D7D2AC nickkip
80,284,799 *0886EAB7133AA7A75C4653F7DFF26DB18E314D86 nicolasberstein
80,284,800 *0887C0E96868CBF64FBA3776B0D1A1B89716FD00 MICHELLEZARATE1
80,284,801 *0883AF0E18683626DA702A30D03BC6C38B232965 mergesuagas
80,284,802 *088C4DEEED5AFAA5409B7D7713A5C361478AE2C0 MICHLAWN9
80,284,803 *0886A8F7936CE3D078B9BB1A9FB5CA9D3476CDC0 NIMA MCFARLAND
80,284,804 *08868C1FE8B97BA6466F3BC9CFFCEF43AF3ACC3A NINO.LEE
80,284,805 *0887C4FADD376CAD8C6C953E5ADF0A09DAEF1228 MIKAELJUSTICE
80,284,806 *0880253935F1211BA4F0052223143A74E9391C70 MILANSCHLETT
80,284,807 *088A8BC2CB353079CF5811BC02D2A57CC5BC7F4E [email protected]
80,284,808 *088C9398A3314A35959C689ED61F6365F5A53F80 milfordsaddat
80,284,809 *0881223638DDBBA6E646F8E0E1D6DF00B7368812 MILFORDSWEARNGIN
80,284,810 *088230EDB960ABD2C26DF7E4F2CCEB8413559169 michaelflaa
80,284,811 *0880C8EF2FBA48191525350371FBC2CD93289A0D NKARTHIKKEYAN
80,284,812 *088CDAC373A2D4D2DD364EA4B1294B858F489EF7 MICHAEL.WILBERS
80,284,813 *088CB687F9303D8AABB830C304C7059F227B787E MICHALEFOLDS
80,284,814 *0889732DA2B7CB1317F7E967F8D6BC090CE487E7 MICHALE.TANGO
80,284,815 *0883696060EC4B8275F02C1F8A0C391F4A187E78 MILUSOS3
80,284,816 *088F1D18126EB7B5F1EFA25D8F9DC7A9334AEBCF nobleoestreicher
80,284,817 *0888CB9516FB60DE29F101CB8E5F53687AB74123 NOICIABME
80,284,818 *0889B5BE202FDFF1824B5C3B91DFE3C3CBB7A569 microsoft75
80,284,819 *088EF33F50C8A800AF3B8BB428D2C9FD5DFB465B norbertobrandorff
80,284,820 *0880C49421952611FEA7CF27F88FA8CB800D5809 [email protected]
80,284,821 *088116BAC21AD3A8DC95F89D5772B3AD25A7507E mitchselway
80,284,822 *088556893AA269FA87B8BD83D2D29E394C119E00 /* NOT THAT TLi iS ANY BETTER SiGH */
80,284,823 *088DED959B47A530537856CB6E0AB5B53EE32864 MILLARD.SOSSO
80,284,824 *0888FAA1DE344DF6DF59230912A8BE6661227CD0 NUMBERS.ALDAPA
80,284,825 *088676FF15BDFEFD79F1E3A1AB668697B925C86B NUMBERS.BIDLACK
80,284,826 *088A1A39611633309BD9A6DF0509CF0BEC11ACD4 O14704
80,284,827 *08844C009E71C2FBD15683FE884A9CB4D91797A8 MIYUKISANADA
80,284,828 *088D47BE99A449145B77DAB0D3B6F68794F5BC4B odisscarber
80,284,829 *0880F13B199D5C4BF5A7794812BE9E18A9398AB1 MOHAMADOUEIK
80,284,830 *0884538BD17836C0522827306B74E31F26AE5208 mockups
80,284,831 *088E09F8E9B5DA02F622165816C3B15ED1AC0742 mohammedjewell
80,284,832 *08811CEE1DD925FB048B2EBE75915DEA5D00909D MOLIFIEDING
80,284,833 *0883A2868E43F82F8189E60D120F4BD4CCC26427 mohammadkolkowski
80,284,834 *0884AB87259039F25301DF2D9B83AE7C2334C426 ON3T4OSMOM
80,284,835 *088EF77255C27DA031F8FBFE982084943F482E21 onlywannafuck
80,284,836 *0880A131FB646319AB167598713D54B4B05D5D8E MONTGOMERYMCFATE
80,284,837 *088A230E20ECCC7ABA88316C3D4032320465AB10 OPTOOIT2
80,284,838 *088499C111BC753DCB969BF31F774801176E2978 ●mottainaiキャンペーンオフィシャルモバイルecサイトがオープン
80,284,839 *08815EC5C34C26F1E5C94DBB8A36D79AB649B299 oskulaso0
80,284,840 *0880011FCB766E8E8D14402108664061BE5FF143 OT69
80,284,841 *0889588326D7D33C7CB85EEE35314673E424D319 MYLUCAS41
80,284,842 *0889CCA7B8E390B3D0703A40086BFAA1B64DDD68 MYSHADOW31
80,284,843 *088CD51BF7424BC08DB4FCDBAFCD4A4B95EC13AE [email protected]
80,284,844 *088359DE21A52A5AA7DDA86269407A0D803963E9 OWENROECOMOWENROE
80,284,845 *08802B1F9971FF10737ECC9C86EEA763CA375B60 ÖZBENLIK
80,284,846 *088CD862FA0E1F126E4C35C82C5F86AA168636BF P|}
80,284,847 *08884A93359F828AF392FD6FE16914D2E9A30FB1 N4J3SS3
80,284,848 *088AD29B6C144E2227CF5C9EFAAA82F246B62AA6 PAĂDURARU
80,284,849 *088576A72687D1CF14F9147D4C552DE762A11CDB nanananasnappiehouop
80,284,850 *088F4E0DF8E1162F35F9C00222BB30371AAD7CA9 MYCARROT11
80,284,851 *088931D032E0991BE5A58DC7C0BD228B308A58AC NATHAN.WERO
80,284,852 *088F8D826231F8A5497FF71795AB09E405237708 pantarch8
80,284,853 *08837F161AD6F4189F9123DA7B0BD2CECC86DA10 neilkunkler
80,284,854 *08808C52FF2CD8A891C304A4D94C158DF45C773F myomectomy
80,284,855 *088015CB34B58AFB184CBDC537BE53035B645B38 n0o_
80,284,856 *0889843E9DB7B2BC5E78C1A9AD747D4C3A6E3135 N35=%RV NO
80,284,857 *088BB4327B15DA1FEC39E238D3AAF6090BB54EBE NEWSACTION
80,284,858 *088D50E43F38A65D146BC2E84C1C4A51D82C0219 pâupu̍t
80,284,859 *0884E191E295739C3794DEF104D27C8DD57B7E4F PECKER.'P/E/K/@/R
80,284,860 *088C739E6187160E64C09EE84BFC0FC2D3A04803 nathancolder
80,284,861 *088EAA71F9D808F7D0FB05006FD6C6966C12ABDF NO.BOOBS,.NO.SALES
80,284,862 *088716DBB474A15A899590E10391A0C3DA8739B0 nolongjourneyhome
80,284,863 *088B93B48E67204B03E5A43CD9F9CF68E057D9AF PETERENGELSTAD
80,284,864 *0886B327AD8087D3CB004AF0F46039DCCCBDA672 NONSURFACENONSURFACE
80,284,865 *088E78B30866A58C7598AEFF241AAA954393B8A3 petuniasupra
80,284,866 *0881608D962C42D414DF8E5105C1C7DD79B62CD7 nekazariaren
80,284,867 *088505407B4B0E8C8C09C985EDE7AD2C20814973 PICKLEFAMILYCIRCUSLUYICIRCUSES
80,284,868 *0886AB02E0E61E7327C4D12433863D76011B5A33 NTOREN
80,284,869 *0887967CF711AB465CBC284AAE989CCF159BF42B NU---WORLD-(MENTOR-MIX!)
80,284,870 *088129EA056721575C692912B039C1A1EF1661DA octavius-fuller
80,284,871 *088FA51C64129E280BC4576DB179471B8597EB90 odellparayuelos
80,284,872 *0885825318AAB8A441466BE5CD23678FF5EBCFAD ÖFKELENDIRENLERI
80,284,873 *088A951870729F5341423902452E65B3369B4456 OLINKUBIE
80,284,874 *088AA821F1F2FF08CC6B092CBB8693372394183C [email protected]
80,284,875 *0882254D0B817184BDD8787C048C61083552B031 )o(-o~<======8
80,284,876 *0880D94B11708BDB0F9D841165CB61AB0F97AC53 NIINISALONKATU
80,284,877 *0886F0C42437AB4E909C0F6949538094F44CFD9F ORHCONOM6
80,284,878 *088A05649391BFEE8962217C08D4D81A920A706F POOLSIDE RIDE
80,284,879 *088DC150662314E0B100507E304B3835C7814B38 noite-estelar
80,284,880 *088EC5086AE6C568D0CC9B7B84E999A353A4F8DA norbertobottiggi
80,284,881 *088C2816AA3F5E66634CC4ABE8E30C46F35D3FB0 NOT-DREAMING-ABOUT-YOU
80,284,882 *088E42A3742528014530249517A2AB51D62C535A OVAT3CONI
80,284,883 *0881F96A5643D3575201742370657EC43C65A7B2 OWEN.MCCROSKEY
80,284,884 *088E45D23803343716A63C573DF9925862A6D174 numero.group
80,284,885 *088154B1AF7F3AD7F4DE3A917F92379F44521540 p) `~}8{
80,284,886 *088F38ABD6E9DC91C533C2D8AAB7507B6951D8F6 PAGANISMS0
80,284,887 *088205706A8D3C98EC6E534FF567BB078358A0D4 odklopn4
80,284,888 *088CB081EAC0C92882DD239B36223182C65F9C54 [email protected]
80,284,889 *088EFBF7772C4E73E451720262A1601555067686 pándzsó
80,284,890 *0883C810260E2FB809BB4F2381C4FBAD219FD1E7 PAREARING
80,284,891 *08850CD495D6136D337FC5B129CC903D0414B6E5 program-into-smaller,-more-manageable-modules-today,-you-learn
80,284,892 *08840F10E5264026ECD7AC629F08A61721797BDF PROJECTIONAL.PR/@/'/DZ//E/K/S//@/N/-/L
80,284,893 *088FD36995BA81DB3B18A74092190D4BF6194499 PROLOŽÍME
80,284,894 *088C1A2AA7578644BF0BC6C6EB4364838F451FCA olhausen9
80,284,895 *08835518B2591FA5B27922F2C0CFCB073AA48906 [email protected]*(>_0)
80,284,896 *088804B682F4BD2DA84BDD3DE23C231B5697C0BD Q129213
80,284,897 *08840CCCC813ECD8FCCB4197342C28A64B17B739 PAULBAZAR
80,284,898 *0885CB57BD013747A43E48C45E92A3184F6C6CA3 QAWSEDRFTGYH901
80,284,899 *088396AA2C50EB5315FE14BDC5B0CF2E6E9AE2C1 qb`~ `~(o_)
80,284,900 *0889F863083F662990F9ECC8AA612BD3EBDE64F2 qd~~~3b<
80,284,901 *088F751588818F43C0F7B5BD260ED8852C3A6BAF PCRODUA
80,284,902 *0880EE12C782C05DD20CB5658A0D30947305C0B1 [email protected]
80,284,903 *0883557AC766F31C239CC28751BBF72A602EC221 )o(o~.o~<#3
80,284,904 *088B37FEDA766188E7D3DF24478AC7C23336C5E0 Q==P `~ SPLAT!
80,284,905 *0880155BAE5B4AB1512C39F3782E5FE561C30828 quiloá
80,284,906 *088A239E0821DAADE06A239B6154EE35543A594E r3in0cul4+3d
80,284,907 *08833D1BAC9679DDC8FF2D92A70DE82CDD365289 orvillekucinski
80,284,908 *088937E1AA65B392BB804002CD65A25A880A9E7D phithom
80,284,909 *088985998E72A9571DE712E6AE704E49C6CC6846 OSVALDOWANSCHEK
80,284,910 *088E0DA7BCE69B964EDE680E6DDB134AB0E83939 OT7JQ4DTJBEC
80,284,911 *088E259862F318668E5AD63B683CDED64BF1EEE1 OTIS.TOLLMAN
80,284,912 *08836D36F80E5CAC2AE2752A9654D88EFE73E41C [email protected]
80,284,913 *08898AC3D033567AE62B2EC2A574FFE8EF05E958 overfrighted7
80,284,914 *08891C05AEAA515C9B1A4C86D1207217A800968E pipoka919955672
80,284,915 *0880DE0C451CAA36E23C1B2BBBB9A2562F845D08 PLECOPTERID.
80,284,916 *08861FF6C94AF230F59BAD7691F93A038899D6B2 PMC130635
80,284,917 *08854D0C758C9CCEB5030FA575EC0178C2BE7351 raulputz
80,284,918 *08830500F951A8F6D6151235D88309144B5FD4BC p5ori45e5
80,284,919 *08855702819648A16A8EBDC72CB9F62959F89454 READERMAILWHATHAPPENEDTOCARRENTALLATERETURNGRACEPERIODS
80,284,920 *0887CE00FDD1861AF872E3EAC11F44D325ED85E4 potser-dem
80,284,921 *088D8383AE14A4AF0BB8654CE957106B1863D6DF REGELVARIANTEN
80,284,922 *088BB0BD723E03601D8AFF07D7E957A4EED5B8E0 REGGIE.REMOS
80,284,923 *0880492039AD3EAAA3AED59D6B9FF1B136837397 PATRICK.FEGLES
80,284,924 *0886E32AD64A596FCEAECDF69EB82976DA585847 PAULA CRABB
80,284,925 *088A36E1A95CE7372D1D2F437BF37BD8C05D43F5 pressure.governor
80,284,926 *088BE2714EB501BD56686E9930AA1556552ED7F6 P====D * * )0(
80,284,927 *088EFE48744C7CFF86E368E26E5FCD318DE94987 procrustian
80,284,928 *088FE390CE6044EC2B46D92AB395AFF748134A86 peitscht-ihn-aus!-er-hat-sich-einen-apfel-genommen
80,284,929 *08819FBE7044CF994B323301719097C2DC6859BC pxrugrats
80,284,930 *088592AB6D0EE56E21CE7409971C895A2A6E4E4F p-yq
80,284,931 *0886132EA76CA765E03BBF0BAAB9007325C64253 PGNR
80,284,932 *088FC21BE057DFEB2F322D5AA463A7FD2AD5A0A6 [email protected]
80,284,933 *088A5F99091B6BC9ACB952F544675B00EEE974F7 [email protected]
80,284,934 *08879189A0EFA367C026E53982FF031F167DDCC8 PILUE
80,284,935 *088DDD00D1D684907BC5D3F26926048C8676168F PLAY-IT-LOUD-(ER)-(E-CRAIG-EDIT)
80,284,936 *088208491A6EB89A32BB4C1C7A2BD7E15E4F9073 [email protected]
80,284,937 *088F1A552D3CEAD17CE0D0F91B035D9889A95677 PLSAINTOUEN
80,284,938 *08826072A2D78FDE701E528164B4742BB29CC72C PMAMAJUNG
80,284,939 *088FE9278F70770A409F359464A792D14919994B pN,
80,284,940 *088B902455E68C46B69EC0DBB0D7892156A4534B podvr
80,284,941 *08889002DC3024D09000E63872AEAC5661B94CFD ROBERT HERMEN
80,284,942 *08890FC4B152D4A26BCA00C946548F7DEEA93219 R4T3SS3RVIC3
80,284,943 *0887BA7C36AC1331F4BF2B683C743D31E04BD2A9 [email protected]M.AU
80,284,944 *088F3AFD55D11576915E5DA400741CD2528ECFA8 RACHEL.MALCOLM
80,284,945 *088F74BB9280BD96382CCD1FCF01ECC4E00EB363 rockthehouse(disc1)
80,284,946 *0889566557CD47ED7B40D425F2D906C4AE1CE2EA RODHOLZ
80,284,947 *0889B87F0BDDA724561D56061C6F45F19EFB3FD8 RODRICK.SALGADO
80,284,948 *088348BE7FB2864CC9E9252622B4CF5BD80A5DBC RODRIGO452
80,284,949 *08831C91B66831B7369641850FC815B3F8FABECF ralphj
80,284,950 *088ABDD96F27709F3E54C63375775043FA042FE5 [email protected]
80,284,951 *0884D9884E7B2096970A77FF8AA020A9EEBDE8CA rangjhung
80,284,952 *088B757777CEFA0CDEDA78BCB3AD9418183FAC8C ROOSEVELTTACKER
80,284,953 *08857566C6B2E8C3E8D61C299783DA5EA3453C44 rosarioballenger
80,284,954 *08835D7DF82B66294E1D4A9077171A98A70D3A36 rosariopetrilla
80,284,955 *088AC3FB8DAEFED7FB7F3FC4AD90E99FE6AEE4CD ROSEMARY-FORMAN
80,284,956 *088BD56A2893FDB622E5B85EBE0762B723F78A13 rayfordgarsjo
80,284,957 *08823DA550648711D1D5D9949C3A096E72FF4935 RAYMONDMONTEZUMA
80,284,958 *08850BAB8EB6CEBDAB25F6F5D60D4C42058EDDA3 RUDOLPH.BARNSCATER
80,284,959 *08890BDB3136AFC8CD57ED14A8A8B243F375B75E rb=j
80,284,960 *08870BC8569129396159C39E3ADD8345B33094F0 REDMARGR3
80,284,961 *088F25F544B7E79C5C4130562E0BDDA4512FE4BF russell-taub
80,284,962 *088A1EFC5F896346B81C63F4AB04BF0CC47FB47B russelsukovaty
80,284,963 *088CDAABD6CDC6E3D2D2A2EB266E06FE32A90F95 [email protected]
80,284,964 *0883D3307971BC37540A48BCD092CD0EF5FFBC9D s3mific+i0n41
80,284,965 *0885F6DAA72741D7ACE2A7329063867035E75BA9 sajjadsaji
80,284,966 *088815081E6C003AFE3C03E68187A3E41D24C359 Same-Ol'-G
80,284,967 *088DD87E952103B610A35EDEFFA92C1E4F4241D8 q#)~.~.~.>-<
80,284,968 *088A49EC71AAC994370E014E16C23BB120FD65D9 SAMSONGER
80,284,969 *0886B610A112A1F8BAA2271C942708ADD385A4CE REMOVABLEAED
80,284,970 *0882D30F79011AD2031E482E1C3B05433DF7620F sandralanham
80,284,971 *088DC14DE7E0828A04F92993A43C564123DF71E3 SANKARALINGAP
80,284,972 *088AA32416E7F198EF1F44B23DF1521BD5C6EB36 sanmiguel83
80,284,973 *088BA2081E435AE77FC04206A8EB51F853BBC6EF santoallocco
80,284,974 *088D5293F06820D933D4514BFB843A7D3A28BF8D Q-->.~0~OUU
80,284,975 *08889D0B04FA9F0CC566A6BA60EC8CE03C326583 Q------D.~O~O.UU
80,284,976 *0882A0B5376BFDA593FB8F8D8BCD8C5F76D8EFFA SATISHBORKAR
80,284,977 *0889808B34B8573CFF97D1071440B49A9CF29DD1 SBHTROZKOUX9
80,284,978 *088718472DFBBEEE59F7F6D0B8D09E76BA948D75 scambiasti
80,284,979 *0880A0CADD4908768716A07E977FD82EF5F33AFC renegilsdorf
80,284,980 *088F86C04C0FE4FD5D4DCEA7972E5518BB40077C RENICHTATOMARS
80,284,981 *0886269854F6B2364D719DF9C243C7C2D3A93F7B SCOTTANDALI
80,284,982 *088614F8EE718098ADB8F42644BB970E8A0C1FCB [email protected]
80,284,983 *0886228C85781FCEB0EA27169DD100EA7E053B64 RENTREXING
80,284,984 *088EBC0A78DB3413CA0DEDB3C78002487751F1A8 SDIBETLA
80,284,985 *0885A303C2BFC8E110CC4EBB3A8EA4F0EFA77B8E ;)~`q======q
80,284,986 *0887457C828E2FBEAA4DF53DDF6C85B7418CAFA5 [email protected]
80,284,987 *0881072131AE49C1FF86192B482F625C449AB862 SEBASTIANSCHREIER
80,284,988 *08804EDDEEFC6AB3CFD1F4BF0406B4ED0B0FC584 QUENTINZWAHLEN
80,284,989 *0882DE1122AC79CD8DBC3118D87530D9BB1AE938 セラクルカ(selaculca)声:
80,284,990 *0885CC044D73305EEACF208EE87AC54B9F331E0D RGOTEREZ
80,284,991 *0885D7FE63914E0865D49C7C7507D5423496107B RHOLDMEIER
80,284,992 *0887CFA7C76D3968DFB81841A7B948CC3DE0C9BF RHONDACOWBOYS3
80,284,993 *088D5F792C45C959E7FC1CDDF47A494D0648999C R3vva15
80,284,994 *088C79853377E5880E4EC4BA3056991900AB5873 SERGIO.NOWLAND
80,284,995 *08845199BAB0A0F88333CF335913F54A7E6962BA rickiemckethan
80,284,996 *088147A7AFCFC33F5BF035A2990A6E7E2A9F4B2F [email protected]
80,284,997 *088985BCBCD27BD3F1AF3CB58B2C35A21FCCBB84 rickydommer
80,284,998 *088863C14945F5F66FF9D81A982DD6E75E68A9D8 SESNOISIVITCELLOC
80,284,999 *0883181BF1AD1272992AAC341207FD60960C662F settynduerediv
80,285,000 *0881DBE96AE7B68485FE23AE9B5609898D9FFB04 Seven-Cities-(V---One's-'Living-Cities'-remix)
80,285,001 *088F488EA5FE067037C0642DF559A236A1C373C1 SEXSEXED
80,285,002 *0885241E643F94AED1BCCBD57F7F1327300EC0F8 RASHAD.CHLEBEK
80,285,003 *0884937ACB9671AE09C72029E8162CFD4A3012B6 rita-maltese
80,285,004 *088C5C72E21564A18B3225A008411E397A1307FA RJHAUJ
80,285,005 *0882B09B970D5AFB212407050FDC3CEC46ADC622 SHAWNTRELLA8
80,285,006 *08830538B174B38232C8B427C6E3BEF04AD483D6 robbykotecki
80,285,007 *088728DB8768B1C1321E4CE2AB30B90548B4D0C8 RAYMUNDOCRAGLE
80,285,008 *088C4FFAD8BCFC552D765298695B8D32C57C5020 razse
80,285,009 *088C7290039C08934CB7D2D3E5485613FE3121C4 RODERICK.COLLER
80,285,010 *088FD231091D9A98D610724F8BD73B2E5495BE39 RODNEYTOMEY
80,285,011 *088E7BA11A00A2A8C13A48672AC2E704C3D3557F RECOSREIS1234
80,285,012 *088E4913F586C71CC2694D0CC17075E8DC3DF3F8 ROEYHKEAELTAE9
80,285,013 *088097057D3224107892AB84DFC44957D409148A SHIRLEY.NASER
80,285,014 *0886EAC07CAC9BE332AFBA353A0AD8212404AEE3 rolandluchenbill
80,285,015 *088B2281DD8D2F41CFC5E9AE784156AB06474657 rolandodassow
80,285,016 *08818E8BC1A1420388B3855BDBC22CD4950BADC0 [email protected]@81e
80,285,017 *088E13CAE230B7D215C024EC00DDF33946907CA5 ROMEOGADSON
80,285,018 *088913027BD8C3D9ABC92F85E89A77BB55DADDD7 REINALDO.KRESGE
80,285,019 *088F3E95A02413BE813207DCE1DE9C0BAA144C15 REITTINS8
80,285,020 *0883EE7767D0C90ED0D4CC31467ADB95B9DBEA36 [email protected]
80,285,021 *0884809C2D37FE6032760A27216E646ADBF7D8AD SIMONBMW9
80,285,022 *088E81600F1B8CADAD8DEC55B41D9F853CFD40DE resvl
80,285,023 *08867022AEB67BA6D6FD37DFCD1AFA971721DFFE REUBENNAZE
80,285,024 *088F43DB5966FA600E11DC3A342371EEFDB117C4 RSENBLATT
80,285,025 *08807E1E828649B38907FC9A5581C672BB68DBE2 rufushola
80,285,026 *0885B603FCC6F02C536F3F677433528EE1D61C78 RULERSPRINZACEANOINTED8
80,285,027 *088712A4B25192186E2EF4D8DE90755209B919E0 reymond-mercado
80,285,028 *08851034A06354B2164072831C9FB391D3C78966 [email protected]#$%^&*
80,285,029 *088D97862D6EAE456023A8615C7510ADA7B3992C rhettkriesel
80,285,030 *08846D2F7B19A5365A4F51B9238886DFFB4CC04A RUSSKINTOP
80,285,031 *0885B42AC83A9D4ABDAC3256039C9197857E6BBD RICHARDMCCOLLOUGH
80,285,032 *088159FBBC4AE2E45B629DCA8802187AB4C824F5 RICHARD.RODBERG
80,285,033 *0888BA40CC783F5FCF4BA35BDA56DC09569D8EB8 SNOWBALLPHISHED
80,285,034 *08882FBE216DE678FB441AD974463392A7058675 RICKYBUSBEE
80,285,035 *088BC17930BEF37D3336ED4126A389C5250F3240 RZKBD4X
80,285,036 *0887E8B51446B858F9173088975DD6C9E8EE1673 SOILLESS
80,285,037 *088D2FAD0E84F60953A8F5D91DF7D9ED20F08273 [email protected]
80,285,038 *088E013AE7BB8A106CD8640235B73AFBF1127CB2 RMH
80,285,039 *088777238D7ADD932824EF0109880702E31712CC RODGERSTECKLINE
80,285,040 *088D643262A805CFBD7036FD5347E5179CC9F3F4 spanishnumber1
80,285,041 *088C032426DAC186EEE0FFFFEB779F12E16E7DB6 ROGERMAHIN
80,285,042 *088CD9255B46BF7DE99D1542E0FFCCF9E8FA3710 SANTAABCDEFG0
80,285,043 *088B3F856BDE182832A92AA16B2BD4203C826982 ROKYTNU
80,285,044 *0880A03F67433EE0B6F1D371790F6830F724F165 sarahhoglund
80,285,045 *088E4962ED92F00C3B323379D18AF07AA1B2336D sponsedozen.
80,285,046 *088ED84962AC056445AF35568D1A797D53C750F3 SPRÍTOMŇOVANIE
80,285,047 *0889D80A637444B20DCE6E33A6B5B065945C2867 SQEEZED
80,285,048 *08862C95881FDEE1A8A900706782DC448F965155 [email protected]
80,285,049 *088244C454D28466B81720E305BA7927396A988C SBIRROORRIBS9
80,285,050 *088CAB712518F3B89664A777FEC0677B0B5C0FDE srnnkndnh
80,285,051 *088E00B7419D01C60EF58C4C04053EE25C113A87 RUDOLF.KLINTWORTH
80,285,052 *088122F2CA506DFB2ED39023BE22DA740FE304C9 SCORPIOFRIDAY7
80,285,053 *088B9BA15A1A646699A3AFD453F3155474A8AF5B SEAN.VLASAK
80,285,054 *0887CEEA1A216B4697EEBA988C1ED3FDB9095047 STEFANSPERAW
80,285,055 *08846705AEE54FBAABE096BCEDCD60C95C632614 RYANMCMANIGAL
80,285,056 *088BD8B44A51C049A9E49A46670778A7132BA4F1 rznprkn4
80,285,057 *0884E12D4E864193FC11D730A76F758A326A5763 SELFABANDONED
80,285,058 *088E1BC708A467F9612ABB8ACF5BF45A8B5E67A1 SENIORTERRY1
80,285,059 *088700BCEA4CDD414A6020A54D1248932F4CD02C STEVHAN
80,285,060 *0884CFB627EE854F26D09C927B75FC20DDBB2F3F sergiosolorzano
80,285,061 *08838542FE1E1E6706F52D034CD944CA79F918D8 STRAßENNAMENBUCH
80,285,062 *088C48B6DAB9AF0D43DC34ECF6C78A863CD40476 SETKCURDNIEEB
80,285,063 *088A988A23D9D0847507CFD14E265472D487F343 STTPEVDSYTS
80,285,064 *08846120CED9C862356CA1210D44173C82EC204A sewolf
80,285,065 *088C052445DDAF9F0D11B8683E3F8DB7D5263EE9 shannon.kaelin
80,285,066 *088A499A1810F65383A048A1C51CED7818E27FF9 [email protected]
80,285,067 *088439350B47E34DF2199FBB77219CC3887B5B59 sangaugspurger
80,285,068 *0889452A6F10F02F24B3D99AB051C0B1ED66FD8D [email protected]
80,285,069 *088D375C81622CA86E487A101DACD04ED3CE6894 shermanperricone
80,285,070 *08800D35511326D927A06D47E114AEC8EDEF3133 summersun[originalversion](featyukiminagano)
80,285,071 *088FF7460AD262F31BE5D7371C7B1EB230B3A4AC SUNFEIQIAO
80,285,072 *0884C4AD3ABFF70F0387D5D7ED4254A5EA86870D SARANCHADHA
80,285,073 *0884FEE789820A649262F1E07DD7CF1F96D770BC saranno4
80,285,074 *088E95DBF7DC87EF30881B8F8BA5D0A5C0E852D7 SUONEVIR4
80,285,075 *0888ECF443040F905BA33F7E1338929C4D25990D SHIRLYSINGH
80,285,076 *0888C7B15DDCA437E1F93E48BB897FA35235DBD2 saulbeshaw
80,285,077 *088A9037FCC942FD4DF1AC3723BBE7D4CEB18D42 SCALDAVA.
80,285,078 *0888100C77D26263C1471CF5779275FCF85E1BB3 syellow2
80,285,079 *088B2B2D7876A6F4F828DED6DD3AA7887BAA63DF symphonieno.9"hymne
80,285,080 *0887CFE4C8D310AEE3B3A05F500BD14FC8594299 SCOT.LAMMEL
80,285,081 *0881D959F6A759A003C9DE7C767EFB4C7A1E69F6 SIDNEYKILROY
80,285,082 *088876878ADE204EE51DD0278FA0C79FCB5A2FBB SYMPHONY-NO4-OP47-(1930)---1-ANDANTE-ASSAI---ALLEGRO-EROICO
80,285,083 *088952A318B22316DF0E910060892D55CE6B2FA1 [email protected]
80,285,084 *088DD3C0A724CEA7D65970EC4D1099E02F05B80B SE0626
80,285,085 *088AA9BDD57EF0965E6DA5427759765FDC712E73 SEFLIHCS4
80,285,086 *088084FD98024C5D456D729A6B142D74A4F41A06 SIMONFANELLI
80,285,087 *088061F092DEA2F9716DC8145917287D503A47E4 TakeaRide(pre-releaseversion)
80,285,088 *08864AE2DF452C01365B5C0F9545BDC8C1028C39 SEQUOIAWATKINS
80,285,089 *08888C4D3794FD9BE3C84EFFCB6647206029BABD SLENDER IAMNOTAHUNGRY,ITHANKYOU,FORSOOTH.GO,
80,285,090 *088B0A9033388CF6D55443925A920740509F119F TANNERDURNIN
80,285,091 *088649AA87DC701552AF1B9EF3ED7B3F94771457 sharon.noakes
80,285,092 *0881C7F64689521C982A1FDFBAFFEE16F4069493 sharron-sentman
80,285,093 *0885CAF647331B84F519EA2A58AF8E9946AC5146 SHAVIAJOHNSON
80,285,094 *08854920F84CDDB6B54DCC92599BC4CDCEA9FB48 she came and she touched me (live)
80,285,095 *088A68305C2269615CB924C31B46C817B3C150F5 [email protected]
80,285,096 *08817516D5E139E62694033362A8FB41A7962905 [email protected]
80,285,097 *0882A8D62269235FEC2E3758DAEF69655A780D93 [email protected]
80,285,098 *088E5D3AC0545085F2D4E1DBBB9E9A3BD8F04DAC TEAMRUSSIA
80,285,099 *088198E0F88369420597D0E89F10D2933CD000FB TEGENMAAKTES
80,285,100 *088062047C95F1560D3D8354832401F00ACBC509 SHIRLEYBOLEY
80,285,101 *0883F4EE0B32308067BBF994B31407BB17946564 S`OJ
80,285,102 *08872DC86C6E22CDCD78E51A01148E7008964C18 sonateno6gmollrv58aus"ilpastorfido"op13:largo
80,285,103 *088A089B56179B10BB102C49E495EEFE54513A30 SONSEARCH
80,285,104 *088E88047971CADB09B0E477F9CEEFCB377F16C6 sordid-a:--sordider---sordidest
80,285,105 *08822D3DBEF4113A6FDA3A947D95B7C0969BAB98 THADSANPAOLO
80,285,106 *08814CA8BE07C33B0C28F6F1A6AE9DE449D7E81F soundtrack2
80,285,107 *0885292A3BE1EC344657144339D18807FA230A6D SPACETHEBANDCOM
80,285,108 *0885197AFAB33D4BE16E00A2B8A60B954FB71232 THATREMOTE80
80,285,109 *0880B79BB7698BA48F36797A9B505A0313D973E7 SKLAMING
80,285,110 *0883CF2915B0405C7075E8DAD7C870755C12D835 sprkket0
80,285,111 *088E334148AFAB1CF079AE17BA6EB6B1734D3122 thefallenlightrenewed
80,285,112 *088BA25F023F83A535D1F296CB8800D2B6A57C07 SLOCKES
80,285,113 *088903E65CB0A79816F559D775FBA4893457E66A SRELOTNEVS
80,285,114 *08860634DF6012E011F3F9934AD0675E2EF11855 sressakluk
80,285,115 *0884DCC7ADE7734AEBC27E4E2733C7146F4932AF stabreime1
80,285,116 *088588A43FCD17AF0A4E456E2FFC2E2B420BD472 STARONKA3
80,285,117 *0880A64D047EB540F98461C3D4A41139D1CCA8E9 STAXISSTAXIS
80,285,118 *088A4C335196FF89F5A0BEA46392DC66722F01CA STEFFANIQ
80,285,119 *088782F0A449EC0E00BC0689979D9C565C0DDE94 STERLING WORLD PREMIERE
80,285,120 *088AF7F73F2EB4CA434E40C10E349F3C5DCB7570 STGEVEN1
80,285,121 *0887300EBDB928CC420926E7BBEB6A6BFB93B652 snigglet9
80,285,122 *08826D82721D768F9900D2F2CD170B581FAA7A50 SOILLESS
80,285,123 *088AD9E43614E099FC5767072FE596DF0EF2B57D SONCARFORA
80,285,124 *088E168CB7800B002A50A0DEA42F78C2C95E6E92 stupefied,stupefies,stupefying
80,285,125 *088AEF5557903305DF5456DF9C44E61D1E4D5CEF songuajiradelencuentro
80,285,126 *088D1CA7848072848875BD4D94E6900656490469 subcompensation9
80,285,127 *0886BFA1A3317D8690A898EF0936795F4A3AAE39 TIMEZONEADJUSTED
80,285,128 *0880C3F3453FC53287D2369441CCC96CDF29D81D SUPERGENESIS8
80,285,129 *08839D5804469703D419FF1A8380086C4C115C29 spiculate0
80,285,130 *08886A0ABC895909053F751074750FAC7408B151 TOMSHORT
80,285,131 *088956BE9F13217A2E9637240020D1FD662F82DC SPRMTSPRS
80,285,132 *088F9B3E308FD85A01BE07B9C66F68780F01235B TOPOGRAFIEI
80,285,133 *088C27A39A31E3A22E352D08D32B08CA60D8E656 Torture-King
80,285,134 *088F197EA607837C2F4143E185B2F56DEA8B0414 ;);TOUQ&N\TNUOC$;TOUQ&(.TNIRP..........:4
80,285,135 *0882FCE77AFE748C12073C2C88F776DE88F08E0C TOWINGONLY9
80,285,136 *088AB5DC2B981487FBCAB22AA05A899A481D3E74 srinivas
80,285,137 *088EAB132BC992D6871A0D88D3E2AFCB910874C7 TRACEYHINTON
80,285,138 *088A5410C78B0C20150666C8B44DA4FC3CFC8E0C staatsgeographus
80,285,139 *0887390D935BD264AAB57AC3D8968D52BA16AEB7 táborrét
80,285,140 *0881403F9BFEEDAB82D71415939DC3CFA43BF011 TRAGHBHAILETALKBATT
80,285,141 *088995C4E1B84749ADAD1095F1E97E72F8C103D4 STANTON.MORALES
80,285,142 *0882495979585261D99000A9194F92CB6A188023 trask-vanappel
80,285,143 *088BEE58FEF06BC0391115A3565F5446A13780A9 startfromthemiddle
80,285,144 *0884D6C9E4EEF4B96D40F0221F4EE5D1EA388F94 startsupport
80,285,145 *088105E08333BD72F33AC5EAC8D52F2AFDC24E38 staten island / showdown
80,285,146 *08823AA36C8973C3C853DA1263F3DAAC4FEBED66 TALKSTINKYKELLS
80,285,147 *088F22DBD1355A96CBBEF14E0513762EABFA74FD TALLTREEE.P.
80,285,148 *088248F411EBC58BEB28F7C8A14180424E1B10AB TAMMANISATIONED
80,285,149 *088F36A16AAA8BBA7ECE920F161296311F3646D2 stephengilespie
80,285,150 *088E908BFE3CDA613E8BE493FCE78F43CF012BED TRUDCH3N
80,285,151 *0884F8D1EB3186E37F49D31933DB5A67BB12DB5A TRUDEEPALMER
80,285,152 *08832B7219E4BD9AD42B8337C12C7B0497EB070E TAUTOOUS
80,285,153 *0883F2EEB5BB8E6BC763F54149245CF296852BD1 TAYLORTOPHERS
80,285,154 *088B3413FE2848E6465D4A5008920466FC97EC4C tshepo-masikane
80,285,155 *08835F8D3F9603066FCD49E9DC017331E3B6DEDF tdbaa
80,285,156 *0886B8BE540FAC626F174CF651D25856C47CDA2A STRYKERREL
80,285,157 *088329C5ED1B93A01DCB327AA687E7FBF0220696 [email protected]
80,285,158 *0888F5006813089D3D4E7CB6B3EF534F148D3316 subornat1on
80,285,159 *0882ABB22852C8B718A2742593463E4B375D4A91 suchfile0
80,285,160 *0887D8A4D55058B1AA0394DBECBCFC1FA87B92E4 TERMINACION5
80,285,161 *088E7ED8DF02910ACA53E40859FD29FCFF0BE028 TERRENCE00
80,285,162 *088081754B0469C3B25D4D4EDA00F7770208703C TYPE0068A
80,285,163 *0886E444BE77374D65C69BE32BBBB0520677AD42 thaddeusmanzo
80,285,164 *088E420AADC05CB62F317A052FFB66D166C776AD THANKAMONIED
80,285,165 *0888EEECF6B3BF9CB1F5A6D9F2F591C20EEC277D TYSON.KRABBENHOFT
80,285,166 *08873EFDE84EDB6646D0E46B7009FE0145993AB2 tysonsumich
80,285,167 *08896351B861E060DC99688817969BB5117FF436 the.essence.of.it.(elegia.remix)
80,285,168 *088A92D94E4DCC57B0618838F489A5E2677456D3 SYDNEYHIRZ
80,285,169 *0889ADDEDA593C03D90C5B310893C7C90EDC5802 UKKEPUS2
80,285,170 *0880D1FD96A64677DE921419F72730422D525440 unadaptableness?
80,285,171 *08839726BACCFE462800FA5DF7EC5FCD7DB0A135 UNDAMAG3ABL3
80,285,172 *0889EA2AD639864A156A6DE0E48EA49871A14CA8 tabaer
80,285,173 *0881124C60D8696D85D143249976C4A8B2CE4D0A thepancake3
80,285,174 *088FD307E4E089F27576CF8E79800D9EF6B7B2D0 theruthie47
80,285,175 *0889290FF9955B165DEFBD635D63FA2592B1FB6C THESTARSABC
80,285,176 *088F2D3FD2AA79D2D018B485E3EC3D453BBAB048 UNRIPPABLEA1
80,285,177 *08811EB2B5D86396F9A136B5D420C6625928B8F9 thinksit
80,285,178 *088BC8558FEDCD6C289A5648C29D1FD69D271B70 this'[email protected]
80,285,179 *088F5BAA1E7978205DCE7B91F3A553C5D863421A [email protected]
80,285,180 *0889119A58C08E05165C0DEDE122856BEA4930A5 THRGHMDRNDT
80,285,181 *088E9D7BA5138F9B7F0EF6750B31FB3A44A1597E TIFFANY.SCHWARTZ
80,285,182 *088B08FC1662C564B50959D2289277C4EB5491AF UPPRUSTANESS7
80,285,183 *088157AA22C1D1E2B31F79788D9E3251D42D704C TIM.GITTENS
80,285,184 *088BD8A9721A48CC781482AF182826F0218513D3 tatasurya
80,285,185 *0887E78ACC900F0605D75D0BEDE01C0809C50FCE tjipatsarg
80,285,186 *0885D9E8EBE335C3D136818E4AF4F3A17EE450FF TEKSTITELEVISIOSSA7
80,285,187 *088325FECD9CC3583366044A0ED1F72C73153DFE TNEIARESOPERED
80,285,188 *0889F63AEB609F7F04445E3607222CC3DFFCDD26 TNENNOT3
80,285,189 *0885D716896D13336F48971688C4087A72E98150 tobiasolpin
80,285,190 *0884D68F93877012FB0AC72C802A230A1FC97CCD TERRANCEMOGUS
80,285,191 *088EBE5B1434EAE1DF225940AD0960A5B3187144 terry.d.
80,285,192 *088AC394148E76E970F338EABCD181F47215C61F TOESPIJZENS4
80,285,193 *0883D313E7727E6AFCBA2BDAF4B30E6DB1A0A56B VALENS1981
80,285,194 *088E4B36D99B73F55FE318756A2C024345C3789D TGTCCAGAGAAGTCTGGTGACTTCCCCAAGGTCACACAGTTGGCATGTGTCAGAGAGGGT
80,285,195 *088C82505C632F7BF7ECCA125DE5D8CEDD4D21E4 THADDEUS.BAILY
80,285,196 *0883344B573FCC4819D71740C370DB828D0C2A40 VANILLACHALLENG2
80,285,197 *0880019AA4D5243CCB278C8872C13B67337B5565 torytapaha
80,285,198 *08896D5FDCA561B789FB0FCE00A21BC7F68CDF7A TOTHEMOONLIGHT
80,285,199 *088FAF86FCAF4201A6B60E4BB1092D8FED4D1CF8 TOUCAN
80,285,200 *0883BEDCB28CF21BB66E0C1F3A12067686BB4D28 THECOURAGEINYOUREYES
80,285,201 *0887FB48AAF94FF7654883D706CAD718BE3F2101 TROUBLEZAPATAED
80,285,202 *0889AD32DCAE18AF9FF6D8FFDF5D0D4A5E3C7BE0 TROYISLEIB
80,285,203 *08809A810214D468C12D0A783E02C398ABA7B39A vibha-khakhar
80,285,204 *08861F24EF032A311659FDA215C326D7D34A3097 TRYKKLAMPE
80,285,205 *08816F30ADD7D46C23D7CF055B52AE3FF40A9CDC VICENTE.URATA
80,285,206 *088C6BBB82B8F563BAB700460FB8821EAC0FE85F TTI-HELSINGIN
80,285,207 *0886B4395EF7745ECDE0C692C758F7A6C150F08A TUMARANJA
80,285,208 *088F4C4C087B87B374F08CC69459400174598BD6 tuyu
80,285,209 *088E05BA60E297EAE3BC2CDF160DAC0B5ECAB14F VIMI.RAMPARSADH
80,285,210 *0883016FA05D90B6E9E0634BD37BB45C5D5A0285 VINC17ORGWWW
80,285,211 *0885E8CC92DB66B1EBFAFB22CA7375C60BDD4D20 VINCE.PALM
80,285,212 *088BD1856762E43938E22D6B80D289DEC16EB1F1 TYRANTLIKE2
80,285,213 *0882369A24B3ED4C73FD211E45E5E4E2EAAED0A8 VITORINO12
80,285,214 *0884627D7C230CE71F0B292CEBB44318820CA37B UdoSchreiber
80,285,215 *088D1A288FFEF756C8DB002697B3D8D3915F74C9 TIMPELKEY
80,285,216 *088A61C862F92086E26F4DB6C72B775424704832 UNDEADERIC
80,285,217 *088F6559A30C861C1AFFEBD93D2B2A379D450554 UNGRANT6
80,285,218 *088A60320BBB0C9AA15D462B30B1B9978896E7F7 TOBYBRONCOSED
80,285,219 *088BB47218D23775B1380E5FAFAD0A293D1B53C3 W134688
80,285,220 *0882EAAA98664576B9B628497811946810E93A70 toddlanigan
80,285,221 *088F540DCB938F9A72F465197CA098D6643F899D Tonada.y.Cueca:.II..Cueca
80,285,222 *088622770B9E1BAB6A56C037A7A86D8B55396097 USERSTEGASAURUS
80,285,223 *0882315E2BC8384FE8F2F0390E8C234CE12745EE ushtrimesh
80,285,224 *08818AFBD66F8A04147B7963ADE2B65D2DD7F6DA [email protected]
80,285,225 *088EDBE311D8848F1B6FCC8203BF8DA721158CEE [email protected]
80,285,226 *0882DB24318B0EAF2F40C9738B5C123A59A5F082 [email protected]
80,285,227 *088CD149673DCD774C963B580469D0A706EBDEAE TOPGUNVICTOR
80,285,228 *08898320AAE050FE7553BCD481960E51F6C5D70B WARNER.SEPE
80,285,229 *08894B53AA4FF23E865860D644F0F4B32CB02C39 TOTHLAKT
80,285,230 *0880249584569016DCFC36D8418E9D2EF1A725E8 WDESWERT
80,285,231 *088228DCC499A55B92FED90165B70BD6F12422BF weaamsalame
80,285,232 *08839990B5797F70780F7EAF526CC1D3E97A3A02 WEI.BENG.LIM
80,285,233 *0888E1956E15C167FE28C6E745509AFA0AFF1C01 UTHALERED
80,285,234 *088AD59AE82938D73A439B79E8B8B1EAFB8126FA WENDYSCREEN
80,285,235 *0889386F589DD1363D510E8822BA81CD1F8FF303 V3xa+ou51y
80,285,236 *088EB639B905CA8797A5E2C12B2A771323DF7FC7 [email protected]
80,285,237 *088561A029CD1337424672B54CA08A7401BC2085 V6109
80,285,238 *088A97BC73AD0ED54A2B370E59A726303284BD96 VAARWEG!
80,285,239 *0887AC626F3E65B7376FACFB71379036C8A17798 trgldyt
80,285,240 *0883AA1A610741AC622ED93320C65FBE79C79DC8 westhaven
80,285,241 *08886247DE650AD5FFBB27B4457439FCE435F4FD TRIVI4LIZ4R4M
80,285,242 *088BEA8CD29FEF929FD0AB07DB052E1753C743A1 TROY.S.JOHNSON
80,285,243 *088E0660C7DE0B25044F64EE5CB226159C9C3FA0 VARIATIONSONATHEMEOFMOZART(1822)
80,285,244 *088B44FD6E89FAF9837935C8DD791A7DF7708D9E [email protected]
80,285,245 *088F5DA431B03768BDF136A1422263EAF7CE3611 VCRZHWJTCBBING
80,285,246 *08805062080EA69B94FFB1DCE5069968260618BA vedicapillay
80,285,247 *088CD0ADAE73DAE50321800D72DEB647F44A6776 VELPUBLISERT
80,285,248 *08811F36918097482E238D3C058B2AA63FC02CD4 veranwestleytull
80,285,249 *088EE8A63BA45F8BB69C319A93E2466049B5AE0B WILFREDFLENTGE
80,285,250 *088FA6A0E0FA8E55AAA2783216842D15A334D04B TRUMANPAGANI
80,285,251 *0881C73EF696DC7EDC1D23FE81156E66CB66AD5A WILLIAMSDULBERG
80,285,252 *088C9EC60082A95FA21F102393001C82CC71000C vernaaltomia
80,285,253 *0886BB9632C57FA0CD9D2E985B231F60FB87695E vernonsoledad
80,285,254 *0882805B44956C7E4BA8CF2CF223A364A1FD7190 vernonsudar
80,285,255 *088594B9DB203E6967DAC3FE64F87658249D3344 TSGESELLSCHAFTEN4
80,285,256 *0885860A25362C0D3CF68C297DBF5E8CAEFD1F37 veronica.fabro
80,285,257 *0888CC9615E027EC2B3160626B9FABCFC36A1D01 VERO.SOLIS
80,285,258 *088DA592FD096A89160569C2506C6EBCFEE3DB80 WILSON JAMES PROTACIO
80,285,259 *0880420462FCDC1D8BE5BC2F29C75EC44F3C414E wiltonnastri
80,285,260 *088ADA6AAE9B5B79CF98DDD98D5A223D75A457D3 TUANGRENET
80,285,261 *088C4B6A5547C97F07DB8CFD507E428FB7190D14 TUCKER.BARCLAY
80,285,262 *088233FC40272F83139CE8962FA1DFB7C26652AA WINFORD.TUGGLES
80,285,263 *0889B44C9247E9D658E389620C00BD31C5A8ACAC TUFTHUNTER7
80,285,264 *088140C6678CE157AB873E24B04A4C6409D73471 TULORATA
80,285,265 *08811472B869EE4D032A22E929C9D775E3BAA6E2 turhan.shabnam
80,285,266 *08872B6FA84DD446236F4583915F2E354E8F9664 TUULIPUISTOHANKKEIDEN
80,285,267 *08855D194B9A2D700B2C991DB711A5DF30CA9ED1 WIPO.5
80,285,268 *0884A1C56D9EEF6F96A6081405437019164CF03C twicedead.tw/aI/s_d/E/d
80,285,269 *088219894F7E7B6F6DBE277F51DB7F4FC55AC906 TXCTRMTC9
80,285,270 *088898AD4492B77C48EA14016AB49741B1CC428B TYRONESWINDALL
80,285,271 *088A3615D140A73D195F0A399B8D1BCBA755E233 TYSONWHITELOCK
80,285,272 *088754C17DF6A46E7D341B0E275015BB022C9B70 [email protected]
80,285,273 *0885D853C27DCCBBFABF195F85651D92EE3D13ED UAHEIMCAH5
80,285,274 *0880C8DB49A3F63E1DCC66B603738D130FCEAC89 VIKKI.WESTON
80,285,275 *088BF7948F7FB47666C04979EB85F2F0C115C89A VINCENZOBORUVKA
80,285,276 *088C4952D2C23B5293CE6D4DE1780A3C9D98203B [email protected]
80,285,277 *0885234AEEBA16E24208DF5AB789EB444E9227A2 ULJANIKUED
80,285,278 *0881F327B169CD9D0E0A39AFA716E18D84DD9AC0 unbendableness3
80,285,279 *088F3ECF7D1571321EA0D3DD18706704DF86D512 Und.dann.noch.Matta.und.Lisbeth
80,285,280 *08802C6DAA8164B024E185C56A109677D97FF1D1 WWWPROZACTRUTHCOM
80,285,281 *088A53CBEC06569F6FB9C7FBE1FE4F5BAFA80FC3 undyingly.
80,285,282 *088D6D23DEED67D6252A32D31B260D8539C949AB UNRESPLENDENT2
80,285,283 *08805B845537DF5FF36F3886C57786835969D6E9 [email protected]
80,285,284 *0882262BF49B4624AE8F6970E4767469671D3F12 upbrought9
80,285,285 *0885CEB34E30B64366FA7217E12BB53295EC8F83 VYVOZCOVOUS
80,285,286 *088AC802EF59E0B5A6EF75BA543D8C7F0E2889DD uropygiu3
80,285,287 *088B37C1D7EA3F4B9FD7D0B28CA3BD1F211F00FE usman.tyagi
80,285,288 *08831F7ECA1BE1C5353775B3C627DFF0699F575B /USR/SRC/LINUXHEADERS263224SERVER/INCLUDE/CONFIG/SND/LAYLA20H
80,285,289 *088FE2440F1322338E3BE415165E23928BBF3B29 WAÏSS
80,285,290 *0883AE5C96E6655169382507C1F6621363025147 UTRACENIM
80,285,291 *088D3559A8F65734ADF7C25300558DA444355AF1 WALLACELOTTIE
80,285,292 *0886E6B1FB81BDE52EB7697863DCEC023BFA69A4 {x}~`q3
80,285,293 *0888D63F604FD4849101237D9CC68BFD1E4B9687 [email protected]
80,285,294 *0883B025C1DFAC95FADA32A2A226C3F4C9164769 [email protected]
80,285,295 *088EA3F671DB9273BBFFC5F40BA19EF74AC211B8 waynesimerson
80,285,296 *088B5BB0B19088B57D5352CE415F79673A4CCFB7 VALGAMBAIANI
80,285,297 *088DF1AA9F646F7A4135A87F69359910E6165166 weeviltrakcomwww
80,285,298 *08856A7E358556658E599BF4C2B4E1C5F3AC0BB8 value="jn005">finance</option><option
80,285,299 *088EF92FB4FA519B75517A0E7EF878BE2E58C770 VAN-BETTEN
80,285,300 *088132B1E47923B366595B531771B68F8DD57D2D vanesarosepducusin
80,285,301 *088DE298F7DFC1FABE318D8195FA971372F97A67 wengbulda
80,285,302 *088638A4874CBC694A2F459845381A0F578A6926 whatsuphomies
80,285,303 *0884A7F7CA9259DE1B4F627D353EE093A83E3FE2 WHWCBSWED
80,285,304 *08810C198C5475A288C3FD761AD36CA78C886F46 YRUDZ.FERNANDEZ
80,285,305 *08866F00A09D3E8C78498E4979A5E3B81DA993FC WILLIAM-JOHNATHAN-HALL
80,285,306 *088CF7E83ABF089319399628DC78963EBC1A4F17 vickischmidttruesdell
80,285,307 *088E8CB9B6EB35C2A477A14F939CB8B270EE751A VICTIMID8
80,285,308 *088DDB995A640E894DA1ED21F0ACBAF335ACCD12 VIGNATAGLIANTI
80,285,309 *088D4C22B7E9B0081FC7700477167DD7FDAD645B [email protected]
80,285,310 *08891EA7761FABEE070763E18281AEBAB222DDEF wischt
80,285,311 *0880ED90685AF387B46CBC145C64869B4347BFC8 vinealafesta
80,285,312 *08858FFD5569F563FF1A871B043877940A2F6900 VIPERILLE
80,285,313 *088B648BC6C447A253B1115597CE4521D615831E ZAAIKORF?
80,285,314 *08837AC78F50F5861DD0DC8B39EDAFCDB205C687 [email protected]
80,285,315 *088413E9492D698ECF2B2E2F91EAA1E0DB9CDF15 VIZIASTE3
80,285,316 *0887E862C7B13EE458D5ED6E93B539C3878A709F ZAIDAVIGO
80,285,317 *0881D688D186F5D2FCDBE00C4A25C722974A2A1D VOLCANS-ARDECHE
80,285,318 *088D69B89365BF82E9BD3ACD0DCF6EFA9B438D28 ZAKIYA WIMES
80,285,319 *088DC95A14FB65DB03EAA5EAD275012091AC3B79 ZAKKARIYA-ARAIN
80,285,320 *0881B4CC56A8ACDB206E2D0033A51BE1A5BB820B WQLQBPING
80,285,321 *088C867BAF588562AE7645735A51C46B7036A0CD zaravnasa
80,285,322 *0883B88A5D1BE5A281A58327ED362FF6016D2B33 [email protected]
80,285,323 *0889CD0C3CC1CA292F1122A83D5CEE3884D20067 VTCMASTER
80,285,324 *0885476CFD1AC7C65654A6BAF680CF75F47CD54F VYSI
80,285,325 *08801F70F54F3C633AC220052DE313ABA3AB83B3 WAIYI TSUI
80,285,326 *088AEB0C0EFA0712EB5970D3C5A579CF5B0EFD7E wake.up.the.sleepers
80,285,327 *0884641199319AF8664E6DE1C3AEF6D5CCEDE441 walid georges gholmieh
80,285,328 *088F97A5517E79170C07A93EBDD58E19942B80EC WANG-BAM
80,285,329 *088CC9DB2FA27031A7F88E16EA102CAE83D4F124 [email protected]
80,285,330 *08839A9CD437B3EF4F862D128EBE3F2007283F3D [email protected]
80,285,331 *08880ADE1F668ED316A0E469BA0EF4C3C6025FDD [email protected]
80,285,332 *088E5F9E546E35CDCFC928917D44E8330A2FD81A X2FA0E
80,285,333 *088807622E97402974AF15AA22C889699C31DC3D zimmed
80,285,334 *08859FE153D9DDECFAE7D201557DE7C5DDFC528B [email protected]
80,285,335 *08887901647508A1EEDB50AE6232CDF0B99ECA1A ZM0I
80,285,336 *0886FD30F6AC5FCEBBE3D21E7D650CEC77397CC8 )X(-~-~(------q
80,285,337 *088C2058B6C02DF0A5E9DA6338FD8DE95519D919 ZTELAHCI8
80,285,338 *088BE1AB33FB27EAB35E0ADD0049BFBC241BE809 WELCHERFACHWELT
80,285,339 *08884641A692C1B68024380C9F0AE90F2717980F XSFRVLTN
80,285,340 *088D5D4C1BEFCE8577DE5364578DE4D7A64AF346 XUCHENFAN
80,285,341 *088A3E4BC26F334AC3F9C1CBC01D840C1DD210EF we'll-be-one-by-two-today
80,285,342 *088C1FDD9BA67CAEB6FE968C351C7691EED3ED32 WENDY.MCPARTLAND
80,285,343 *08806CC62C365DDDEDA94FCD56E22FE27B7F0EA6 XYLOTYPO3
80,285,344 *08820574A06256CDB9D478B2B823617497E08109 [email protected]
80,285,345 *08848AF4F280A849797322B5075C86D51276EFF6 YANATELAN
80,285,346 *088F4F3DACF2A03F525F59BA887639B04D1D67A9 YASERALSHARQI
80,285,347 *0880565DA937EBAF81FA129130DBA0C4AE16840E WERLWEST
80,285,348 *08806D65A80658B1DFCCA2A4D1C69520F7E358CA σάνγκερς
80,285,349 *0883A0475DB603832BC76BC65509518A53096486 [email protected]
80,285,350 *08809431D2076214DE8D8BE5CACEC771BCE2E969 WEST160CHESTER
80,285,351 *0883FD425BD6113BF034A82A12B3E3948BD4C6C2 wh0l33ar
80,285,352 *08802327B951888606EFAC5088BBF5F6C3791BDA YILANWONG
80,285,353 *0882457C33214195E7B8732FB02870527A8AFA8E [email protected]
80,285,354 *088AA931DCCE77E86BF590E6D1AFC133989EDFDF YJ8
80,285,355 *0887BC036C020C95262169D0B14C0C1A95B68193 ДОЗАЛАГАН
80,285,356 *088B897DA4B3700BF9FC3BE7E24A6E037DAD549E WILD BOYZ
80,285,357 *0882789134EFF1EA15A420F1063AD70DC86C189E ymdl
80,285,358 *088AC15E2F12D12E09285064C9CA37B03834AAF5 wint.sandar.kyaw
80,285,359 *0881069928123B54A6F6F67FAFC74158F384025C ysatnsaf
80,285,360 *088247D7B0E679F9D6F169439C5C67EF726D6C53 WorldPeaceIsDead
80,285,361 *088A6E1D842F4B80ABCADA63B1C791AAF296BBE9 WWW.DEANSHOMER.COM
80,285,362 *08862C998A3D93E69E2B21FF696EDD3577AD5A79 WWWPTBSALESCOM
80,285,363 *0889CF03946FCF232DC87FD38BD6B27131FDDC9D WWWRTRLNSWGOVAU
80,285,364 *08824544C5C81AD23526F0065785616203EE5B0B wwwtreatyofwaitanginetnz
80,285,365 *0888E99C6EFC9CCDEA4210F9831B340313837ACB WWWWILDWATERRAFTINGCOM
80,285,366 *088744200F55CC31F245D6B473C14208D17FBB5A [email protected]
80,285,367 *08830BF2AD36AE396A9CB1333F1F9D54BE1431F0 [email protected]
80,285,368 *0881A4B37F25C8A6012881ECB4523C28EA3FC04C [email protected]
80,285,369 *08857C2435A315A4E1415FB40BAA31AF1292A94E [email protected]
80,285,370 *088076D910F2B79C9C3593F5A42F6B293B01DFBA xlms
80,285,371 *088D55A1C9B26B5A323CB704287D9BD28F63783B {x}~-`@######p
80,285,372 *088B48097B8BC28EC189EC892725D4018BA77279 xp0n
80,285,373 *088AB9DE8731821CFE56BECCBBEE4788FB7A6994 x)wr
80,285,374 *08811AC0F5F9798EA2FBC0E2D4ED51E2A624B793 YAQAACAAJ
80,285,375 *088DCCE2C1746F0328E593268EDC0E0C25A73BA2 госпитализируют
80,285,376 *088CDA8B103E1615D9897C22E47EDCA2664DFD4F yogeshri-bapat
80,285,377 *088AFE1DA6C7ECCFF564E7BB3CCA9145C780A66B YOOTA WASFI HASAN
80,285,378 *088A7EBA922C1FE263B44026451202097912942A ДІДАЛС
80,285,379 *08862C7AD565426B951CC2CF3DBF2B7F11E5B84F yvxpmrdp5
80,285,380 *088C1E0559E583F6E0EBE4DEB12416E99453E603 ZACKARY722
80,285,381 *0889DD74136D4F172B20E0EFEAE3325231D12BD3 ZACKLAWN
80,285,382 *0881B11B9E323D43E67F7AC71B14F351250EDC91 [email protected]
80,285,383 *08813AE662933CFA031A1366BC50D4E3DAAB1149 ZAYCHEK9
80,285,384 *0885277224C66DE60AA80BC9F37DD839635CC37E [email protected]
80,285,385 *088A5D626905DFE252DA42686589ED612E826595 [email protected]
80,285,386 *088A2B95ADB15CCD6DE47F1821254FA1E109E57E [email protected]
80,285,387 *088DA6AC0D2EBD680E119BC90C159BD0CD62E793 [email protected]
80,285,388 *08885D3B4FF5DCD616F2DB33315AC6A31DFC30C2 ZHR1
80,285,389 *0884682CB302364F53B1D352D6559D05589D9270 ZIPZIP1999
80,285,390 *0885021A0820717D1D01254F2A727312A03BCD50 ZTPLNNGN5
80,285,391 *0885174CEDD0D14511C01904882135D10386B292 ZUES-NEFALE
80,285,392 *08814A0C78E829CFCC1195936B524A04A208B448 ΣΒΆΙΝΣΤΑΪΓΚΕΡ
80,285,393 *088512E0BBDF6E860D78EC1E0973203FB0DC9339 ОСИПЯ́Н
80,285,394 *088FD7044DFF74557864C81A393D64FDB32EC830 0IAMSTEEL2
80,285,395 *088DFC7D018DB6ACE604954A99AFA94F0FF8DC17 (削除)明日香零さんはWIKIPEDIA日本語版における著作権関連のルール等を理解しているのでしょうか。あなたは以前にも
80,285,396 *0886B3CB4B586C2A8991895CC91E163BBCAEFB07 1668880 ihm folgte 1867 der rheinlaender julius von bernuth
80,285,397 *088A5843768C43A526FD6FEB34B488839DEDD4A6 在開戰前便把赫拉克勒斯帶到福雷格萊(φλέγραι),向赫拉克勒斯指出阿爾基歐紐斯(άλκυονεύς)的弱點。
80,285,398 *088651F4E2C1DFA7E9BCB3B8F1C8584E1FC288AA 10marjasisko
80,285,399 *088F8E7420CED8F936FC4E2472DE5D6C7589F88E 10-NEGATIIVISEKSI
80,285,400 *0885E8F46924CEEF9991F4FD112B48242ED19545 12.23.1863
80,285,401 *088F36EA93172C8857B6EBE030A62205F1794C6E 1ABAISSHE
80,285,402 *0888FE9CC3668AF0510F7122A7C4C737C71A269C 1369bb
80,285,403 *088B9BCB1902FF6DF84FBD14705E635CE3102912 1CalISanlarInIzla
80,285,404 *0887C8C8041FB943D3F5C3D82E5AC23694A5EDB1 1.feature-sivun
80,285,405 *088AC20B11A4FDDA492F25672FBB386DAF4FD1BC 1IZIPORP
80,285,406 *08840F949A6156EC3321D7F5827D84675797CBE8 1painblanc123
80,285,407 *08812642AC8171BD8D82BEA6B809627472718D50 1.REVISIONSAMTS
80,285,408 *088DA02EF034FDAAC7B4F465B167139AC757E7B2 04291765
80,285,409 *08890325750996129F57DF62ED845D0141D63AF2 (>_0)-~`<======B
80,285,410 *088CC695482432389E29504980EF2713B3422BBF 0ead8b8d41d0425e
80,285,411 *088451028006C57D5A542700B9C9A4D44A095F1B 1 KREISCHBUNTE
80,285,412 *088C7CF45FBA095E9E1D23CFD6DE0EBDD8FDA0D2 2299816 summan-tehtaiden-henkil
80,285,413 *088B3AA6E89BCD3DF96758878CD3512FA5B3ECDA 1194736 HERR STOIBER LEIDET UNTER REALITAETSVERLUST
80,285,414 *088F45C8ECBBDB8A4BEA82372F4961185BC63CAD 2545590 der.titel.verkaufte.sich.schleppend..
80,285,415 *088DB824188792D0231E89BFD9BFE21AB0D65B7C 1.paikallislehdist
80,285,416 *088D8A2763C1D3C2F90601C51C2FE5AC76C18F33 26-KURULMAKTADIR
80,285,417 *088ADF58D3B5921CF6AA8A6B8F7CD867E2840563 1 RIFKAH
80,285,418 *0884E5696B26656528D6BEA33A7A4EC11AD0E416 1.soetsu
80,285,419 *088F5888D7C78B378A12BBEA2EE8A5E6E5551CB0 1 SUED-WESTUNGARN
80,285,420 *088EBE51A3EEF2E9EF07C23D4E57DF689A8EE353 1tailuokat
80,285,421 *0884C6E7210230F2DDD99968600D512D8BDC18C4 2832056 olenpohtinuthiukansis
80,285,422 *088C4549A69BD7FE3CF5410103E9CFB954172EE8 2-NAESININ
80,285,423 *088F6D9E18A8D63203BC6E022A8F2B81C01BC9D4 2144235 pudotuspeleihin.p
80,285,424 *088BE4E3F1DA02F744E67A1856E2D81375EA4AF7 2169340 HEADHUNTERS HAVE NOTICED THE CHANGE
80,285,425 *088F7D94114EB9030673674FB495411A21295D57 2.PEACOCKLABEL
80,285,426 *088C9B693934AE94EBD8202CF29F5FC921E02ED2 3#) ~><
80,285,427 *0880D0312B0D96D8F70CACA22A49C29153C7CC1F 31feb1150
80,285,428 *088F0421D813556320CCBDFD7CECBAC558BE04BA 262595 "itwouldopenapandora'sbox."
80,285,429 *088CB440D550D166C48EC41A79DF5CEFD014A383 26-OPETTAJAKORKEAKOULUN
80,285,430 *0884C01CF1EC0B5B7F3D745044AFBF9B13849188 1-archimbaldi
80,285,431 *0883BBB91B55B7FC699BB4D9C4B2DA816C467347 1astika-tietokannassa
80,285,432 *0888BC850D9FF79222458EE24CB6A189B5C8E582 3BMWMADDOG
80,285,433 *088863EFB37DB678DEF4362F18DFE6741F6B12A1 1belehrungseifer
80,285,434 *088304D3166E9209D33C338C57681340681069B7 1 BERLUSCONI-BESUCHS
80,285,435 *0887F36D73D2459013C28A484B6F4B3EAA5A915B 1CAMURLUKLARIN
80,285,436 *088B68FD89CFE2BD7446A93267AAC8541CA823EA 3=====d~.`}x{
80,285,437 *08827A4172AFC5217B6B86432A15D3C470D145F7 1.conflict-is
80,285,438 *0885095EB43BFFBF1EE45BCAB01C97307F52409B 1DJOUADI
80,285,439 *088EBF58B1B716FA23852A7E2F6C3F4328474730 1fi-lehti
80,285,440 *088C2A39DF27709E8F83E91426358427E2B7CC08 3LABOURSUPPORTING
80,285,441 *08897686D759C65D2C6BAB9E0049CACAB4DAE8DB 3------p~-~splat!
80,285,442 *08817CB093EA0F180856C9C48AAFD40C38E2C29A 3) * * *SPLAT
80,285,443 *08870B7EC12053CD802856D13BA0C6C2894AAF33 415711 ILMEISESTI.HE.USKOVAT.PY
80,285,444 *0882EB3B507144F35719BB59E5518D3AB79CD45E 1 NPDRICHTERS
80,285,445 *08811567DC0D603B7A5B04EBDB736DA0C2A66047 2GOTOUKYO
80,285,446 *0887539B0D8BCDC634BB926A7DD0A53C2FF67527 2-HAUSHALTSKUERZUNG
80,285,447 *08845A4FDE280C1880F1BEBDBABE27D789D843E3 2.hdtv-faehig
80,285,448 *088F11DD6E4DC32BFECED03649B84BFD615DD3DC 2.king-styled
80,285,449 *088067C1CDFD855AF21CBBD8102E301C01B83717 2NESNOPS
80,285,450 *0884233A35BF5746AA677D0D0B2F4F3D8743EF00 45C3NDNG
80,285,451 *088AF9AAC1144706D94840E22C62B9F4D215F0A3 1.rechneranlagen
80,285,452 *088A4099987F1FB2F9A28FAE86D648AE2C4F5272 1-RUSKOSUOHAUKKOJEN
80,285,453 *0888FF2A705ECF4C7A6A1C6A424E1BDD00B9197E 499948 YA-BAGIMLILIGA-BASLADIKTAN-SONRAKI-HALINIZ-?
80,285,454 *08832F7C9D111AAF540318A8A61E6440FBDB1157 4-BETTER-QUALIFIED
80,285,455 *088B10806E20F475DB1BD35AA949CD59B03D92B6 2WASTINGLY
80,285,456 *0881B9F53A09DE16A07DA04375B426BC92B085B6 2westender
80,285,457 *08809A58B36798AB666A33A2D5B31E06D23365D8 1TRANSACTION-ORIENTED
80,285,458 *088D77FDB7497693A43E38CF922BDE8C0F4F84A4 1vakuuttaahaapaniemi
80,285,459 *088D85380DA558BACC7BD02B53307594E0AB16F7 304068 JOKAISESSA SOPIMUKSESSA PIT
80,285,460 *08866104C4C55652D743C42A64B0F2FBC1ADD27D 329210 kampus-alani-her-tUrlU-sportif-faaliyet-iCin-uygundur-
80,285,461 *088B87B06C26946DEE6CC82DB1E525E6AFA5B2BA 350931 sehir bahceleri uygulamasindaki ana mantik da budur .
80,285,462 *08837C9652C76196A46FE39D0D5D0786EDE85B4B 207.strafmassnahmen
80,285,463 *088024C2A008D9348696E37611C7C6A74A14B58B 4JECTEERT
80,285,464 *088DB5B9AC2F79ED262B76E9D0E75B3A028D3AF0 4LEUCOCYTOMETE
80,285,465 *08842908B98F409E2B61A8EE12D75D6722D183F2 4MARKASPEN
80,285,466 *08895984F0053F99243417595959A2A59464073A 2578809 ASIASTA.ON.JULKAISTU.VINO.PINO.PERUSOPPAITA..
80,285,467 *0887BA8E2ABCD962B5361B05577DF3AB31E50BA7 3-----D**Sploit
80,285,468 *088A06985644F0324F2EE732DE16AB59471CE745 4PAPAELLINAS
80,285,469 *0884EA07424DBB7CD275C91314626D2A9D54C8BA 2-airfild
80,285,470 *0885A34D9A30BAF6613A92848FE034A2F0883FE3 3L3CTR!FY!N9
80,285,471 *088E3830ED1376DEC49F5B391F88FBFAF9E102D7 2HETAIRIC
80,285,472 *088DBC7C0E62719CB9A79C392ABDC8BB35E8CEEF 3 TORTORICI'S
80,285,473 *088C2DED3E16FA03B15F6D6F77DDE400A9D9856B 2.schneiderskonkurses
80,285,474 *088394DAF52C779481831DCCF8169ABF047D6CA6 2 TAKAUSVELAN
80,285,475 *088A14BB87E6DF832C91C841716CD5B838EA0521 565DANIELA
80,285,476 *088A6D6CCE5CB954F30940A78F214E805D3E8CA3 342DAMON
80,285,477 *0884D76FD03D5C1C14C2FEBFFAE7E47D2EBDC40C 5BEVOELKERUNGSFRAGEN
80,285,478 *088C9E7C275F2EAA59BFE300AE8A1AD468C4C3FF 4BINNENGELOODSTEN
80,285,479 *0889044F7F071609A8BF08CB0E6666998092DB7C 5CAROLINEGOLF
80,285,480 *088B5A753BB9D2FAB115E06BF0B48F9FA279FEA1 3.cfrom
80,285,481 *0883354B01F9FC1A6EFA66D64DF755F1AD2DD6C9 3======d~0~osplat
80,285,482 *088E7A93F19B016F49700705ED9833A67B57FB8C 4-monosyllabic
80,285,483 *0883C45E7EB51C22D4570B3F62B94C5902363431 421009 JOSRAKENNUSPIIRUSTUSTENKOPIOINTINOPEASTIV
80,285,484 *088BCC6DFC1688E55F3BB08EFC90EDF91A56A0DB 5MILLIONLACROSSE
80,285,485 *08898AEA0ED94D9FA2849997D8A4E5B4E7B68987 [email protected]
80,285,486 *088D0B17D1FAD065F67B43C10646F6EE1392BDDB 5mycourtney4
80,285,487 *088E6E4A37834412501EBAABD71C7C2684FB4DBD 4CRXQOTOH
80,285,488 *088660E53395343ABC7DA77EF2ED47A280D89F1D 5RANDYNEW
80,285,489 *088E5DB5C6A8EBCE67B9B407454DEBD396468CE1 4LASHANTE
80,285,490 *0886D4E63DDF0E432DD658B1CD0880A0718D8472 4OBLEZENIM
80,285,491 *088413E62E2E0EE9FEA88D6C163C527336078476 4UTLOEPEREN
80,285,492 *08847663E5CC020E87C74541A0A0EE5474E02594 5VERFUEGEN
80,285,493 *088659729B67081D3C98858D6548FB99A346D6A7 610HR
80,285,494 *08837BD2F93DC2B8969452B69C9351925649E53E 648tristian
80,285,495 *0887ED582A24A85B8FE1F821650140D33B0936B9 4VES+4N
80,285,496 *088093589D2A7A66B0E1E29F3830851FF5BDE6F2 570leo
80,285,497 *0884D3E6DD02C823E69DF8EED64E7D8996BC473E 536170 zararlI-bakterileri-yok-eder-.
80,285,498 *088FE445BFC1A56E6C3100FB12B2367C92DA2443 556596 ESMEHRTENSICHDIEGEWALTDELIKTE
80,285,499 *088403ABEE8F3AB5F099A757E6C9921955EC8DEB 5:5-#-&indefensibly
80,285,500 *088CE23D4EBC4BE1D2D78AAEEAB62CF4D4C49A6B 6BESKATNINGERS
80,285,501 *088A21A499C63908F2614B726A834190AA5E3BA5 5ANNONCEURS
80,285,502 *088B1C580412159D21D8B33D98C66858E487A87C 5CCLUTCHED
80,285,503 *088CCB679E36EDF15151756F69EF6AD5FF51883E 5DICKHEADCHARLES
80,285,504 *088D8CABAB1210525ADE6B0E300A0D7052705AF4 6ERNABELLE
80,285,505 *088EA8A0CF77BDA4DB6399CD49F26A01D5F6718B 5DMREWZMO
80,285,506 *0889A6C18E3089C7F839DE644F129E37FBFE7A46 5ELBABIRCSORPNU
80,285,507 *08861A3EFAC4ACF1586929D56B47CE5B78CB1D0B 6HAWKEYETUESDAY
80,285,508 *08842D99DB25CA9862C85811515C9D8A050D13FC 5LUCYBRANDI
80,285,509 *088AB2F3326A69E6C00EBB7A462CC44EA35F333E 6NOVASTAR
80,285,510 *088E831B36ADFC7F870F0ADB2C8003E19B63377A 5RACONTERAITS
80,285,511 *088F06A9F50BCE9D5C8959A9A1D7C22A2AE80B48 5NAMIREUQ
80,285,512 *0884590038D05519D4AF28A6010305DC5FCB65B9 5POCHYBNYMI
80,285,513 *088CE8FF1FDAC13464644491BD26E75ABD161E54 5POHCILLOM
80,285,514 *088143E3B0246C6B2904564C5E813550687AD76D 6TEACHERSLEDZEP
80,285,515 *08815F441E21D18DB1457A7A59E45590D3B32822 5TY4TH
80,285,516 *0885FADB2690B9C87458AA76C221FB37E03FD6F3 731S
80,285,517 *0881C4B22ECD8BCCAE4C44FC764E6ED53564D868 7BEWYSSTUKKE
80,285,518 *088C2B76DBA4A0EEC25F4299A793A2FC78D6F3CE 7contrerais
80,285,519 *08829F32E571577360C3FFB6131EC193ED60F5E9 7DYSGEOGENOUSES
80,285,520 *0885CE9C6DCE0C232CE02C26269F91E248383CFB 6BOSTONCASIO
80,285,521 *088C7C2D41165E457A35AF2FB07015FAA1435C37 7ENILOTIPBSW
80,285,522 *08846102FB6432C2326DBFF3D59B4459F60E3C94 6JEMIMAJEMIMA
80,285,523 *08898F2CD30221143EF8B9D7AE4DD44745F15E6B 6DIQUATDIQUAT
80,285,524 *088CD6CFE4EC0DABEDBD22EE2241CD128E07FC6D 6FERRELLE
80,285,525 *0881770EB11EF2F59DD0EA0CF87D9AF9E1CD99A8 7MYBUSINESS0
80,285,526 *08869F02560972869048229BE1710E865F1A5812 7ONPACIENT
80,285,527 *088BAD0456F108F0EBC8DC43B4460B0D9930DDDA 7PORTLYPORTLY
80,285,528 *0880A1088A037ACF025F0CAA3E21321753DA3875 7XIAYZPAMRF
80,285,529 *088D9C2D1D1937B4063D466CC07FEE9F1D49B2ED 7.10STUDIO
80,285,530 *088E5E5CFDB5CE9D2801A2EF9E1DF9D8FA0D065D 729625 tekeskusjyv
80,285,531 *0887C1CDD04F2D05BB77F73D7E8CAEE2DF89102C 707954 gunumuzde nas l haberleruz ?
80,285,532 *08835E436526C36C7BC9BC789AFA67C205692550 715ALEJANDRO
80,285,533 *088B3D7E5401023E89AA3F2F24ADB5EE02F1CF9F 729JAYLEN
80,285,534 *088342493B2639BDA0C2EE043E556273A424A096 8--d-*-)8(
80,285,535 *088507B2B47698D56C6258C31C5028B8D4B0D210 757793 hassansaidisraelwouldprofitfromsuchawar
80,285,536 *0886AA82AD6AAE2AA37583A461D7C4E442B4F393 8IZGLADNJELIH
80,285,537 *088FC7AEFD4596C4899310ECBE848546825D4A17 8-musiikkiesityksi
80,285,538 *088D662C5ACF9CEF6044E61EE3F8B758F4EA44B7 7crocoites
80,285,539 *08832E07A53CF573548BF7566F8CC15ED34800D9 7EISENMONTICELLIT
80,285,540 *088F6DA63299263391F4494A59DF56DE1E283FFE 8----p`(-_0)
80,285,541 *088F92063297A7927B45F69DC450A7FC75613792 7NTRSCHDLCHM
80,285,542 *0885A627E1BC5CCDD39C0D4620D039D2D7D7C37E 7HOTCHEEKS
80,285,543 *0881993A3E26C95558F58FD4C2ADC447EE9C9318 7SNOREUGOLIPE
80,285,544 *08861002AEF8E0F113F318CCE14E1B7C78195914 8TENNISMUSIC
80,285,545 *088CFEB81CA3D6B11314E89D96C05C9CF661C9B5 7ODOREREMO
80,285,546 *0886E711197EC152AD1E00B6DAF2946E19F1E307 8ZWEISPALTIGER
80,285,547 *0883513697A0EF86D5E161704FC900A59E3DE072 7SAMLIVET
80,285,548 *08816B19A744176BB7BD21D21836D057A3A22EC2 93010 BUT.CHIEF.BUFFALO'S.WISHES.REMAIN.IN.DISPUTE.TODAY..
80,285,549 *088F64132443097248A1B975C4900E27BFE28FE5 9ABLOCATION
80,285,550 *0884C3AF2D1D14F769AE3F607FD2F24753FB7D2D 7YANKEESZORRO
80,285,551 *088D194A83488A6B81B352FF8271ED576C6D1726 9BOOSTERISM
80,285,552 *08865328BF0FC99E2F38E0F9308BDE8FC1EEE4B5 876413 INSAN.HAKLARI.SAVUNUCUSU.KESILIYORUZ..
80,285,553 *088621E40CB18EDE157098A09CA39F6DFD2E0781 8BASKETBALL9
80,285,554 *0886E0E6749EA80E50F8E0907D464E9CDBA29B6C 8bluelight
80,285,555 *088EE7599126D5B0E5ABF3092BCD0505E3D30D28 9LINDSAYBOBBY
80,285,556 *0888EFFAD412AC2A4C5AB2ACEEBED5F035ADB734 8KARTONWERKERSES
80,285,557 *0881EA6D7BB2331179703323B9D478E4526CB017 8GRUNNUTD
80,285,558 *088D7AC93C9CBF9508E9EC2D6C95BBCEE1A6E776 8HOSPITALISQUE
80,285,559 *08845F637DBFE17F7262BB67A5D6502C6843101F 8mywedge3
80,285,560 *0888BC8A5C9CF5BB1C18D40B92B83D4D4487900E 9RVRYMAHB
80,285,561 *088A7B6A86E731238CFDBEAA87E6F0627421ADFE )8(~.`<######p
80,285,562 *088C103DE829C599F470C57081D76873E8977D1E 9TANKERBACH
80,285,563 *088C12F4666151FB71D1FCB078E81B00FC84771F 8SEGISANS
80,285,564 *088003BA797BE8C67158E790254835E0C044B295 )8(o~0~ @8
80,285,565 *088B111B027FE575FEAB1A770FC03CA1F34CB367 8PHOTOCHRONOGRAPHYS
80,285,566 *0886C2F1E587256B798F7B54A5B211ABC2CD1419 8UTTERLESSA
80,285,567 *088F2355F31A3F6FA792A8D2BC34A58634437515 900368 suomalaisen.k
80,285,568 *088D14124510D54A9B5C74A8F8BA90B169652E94 8SPRBLVBLY
80,285,569 *0889B481859CA5A80D9FC460B464F7556D1376A9 A3FLG
80,285,570 *08812E55282C779BD6F8AFBC3233B847292F1D87 9BUZZFOUNTAIN
80,285,571 *088C5FECA0B0570D623F7E6BF492B3F3FBD14201 9CHALDEANNA
80,285,572 *088BE7E4130E94B58A41BD46A648C943D65933B4 9CHICAGOPAULA
80,285,573 *088553F4C6694851532FE7259383CC68CBD61B6E 9CNTMNTN
80,285,574 *08832132DB35E985062D2827A6483E5011A8263C aabxqj
80,285,575 *088E225B6BADB92C2ECAFE105467C2FF18A2A743 9OLEFINING
80,285,576 *08806C7193D39A281F9FBB1AA8C1492FCCD541DD 9POKREVNICH
80,285,577 *0887618CC10E00C29E12D37A81323EE5B631204D 9PROJEKTIERTENS
80,285,578 *088BCE764D56214C677B0D0540579755328C29AB 9REDEMSLL
80,285,579 *08833EB5ABE1FA5D093C8DC4EC3A646538E2B721 9RUYRUFUS
80,285,580 *088C3981A5C95C93A5BD21D7B50576988DD7DEDE 9sep1012
80,285,581 *08807E82B50784209B28CFD8416E05F5A802FA21 AAUZ*
80,285,582 *0880A58846F70930029C927DB114F70F8CB24400 AB151
80,285,583 *08895C35D0FD20DB71921DFE6B3427F75035F881 9:--SUB-MYFUNC1-{
80,285,584 *088ABBF82CD5D1EFC40F64939651AEB21AF42EC7 9TEMPORALDOLLARS
80,285,585 *088B51F48FC5FCAAF9F153529E7807B49C482EAA ABCDEFGCOLLEGE
80,285,586 *088AE01D6BB6E6C67EB59039C5465F8E12670240 A15v
80,285,587 *08803313085E3B335278C069E335484BF5E91D63 ABGEPASST1
80,285,588 *088816CEE1C3E59DAD2B20853DC1C5AFA57021AC A-3LS
80,285,589 *0880021FCFA8C6F91E4C87067F73B9969BECD95D aaalo>
80,285,590 *088F0CE342453E65ACAFE5B8AE7F982CCBEF5978 ADSRA
80,285,591 *088793BE4C9CB10E11B2C58A5134352DAA02913E [email protected]
80,285,592 *0881A29668B2FBF6E72389036DDF1A466BF2FBE1 AADY!V
80,285,593 *08829BBB7EA2387797A505B4B93A7559345EBD66 aayx
80,285,594 *088F3E88FCB0EFB13C36716FCC88925B01E238E9 ab9el
80,285,595 *08872F8021CC927D6FC90ED97329CAE5D6953AC6 abr1p
80,285,596 *08872EDC5A1C1502ABC844BD39C0403D3193CDEE absoluter!
80,285,597 *088E74ED91EE196CDBC6F455B0BDF0A74F487A60 AHMAD.GENTLE
80,285,598 *088CD5BA361DCB2887BB0CB2959FD13FA4FE61DB acusable9
80,285,599 *08864E6A5F596C47AAE10D7EF81CC97E0B381C5C [email protected]
80,285,600 *088BCD672131E9DFFE910A318E3E5A33E250D900 ADANHOTELLING
80,285,601 *0887F01C272917A26425D38F512530818ECFE28E ADEOLAHEZ
80,285,602 *088B7983031AED59B74A28316E640511433DF19B adminkr
80,285,603 *088784B95CB61E00C02EC5AD0222973079EF1C85 alexnivar
80,285,604 *08869EF971B72A5537535DAC060E240DE5F47816 ALI.REEFER
80,285,605 *08876604999D42710CD702F25F87DF25DC2A49FB airphotos9
80,285,606 *0886C6196A9DB13BBFE607A69B3DC89C9C4A7A03 ak=6v
80,285,607 *0880C9D2ECCE94537665380604AB8F1CE41454E9 A,KN0
80,285,608 *0887690AB1803BB399D8563AC96103345AFB4A7B A,LAJ
80,285,609 *08814DA9944FA9EBFEDE3A58BD34D756DE2A5ACB ALBERTO.AVILAR
80,285,610 *0884D89C318FD873BFCFCEC5B4DC5639B8219692 ALEJANDRODEMOYA
80,285,611 *08828BD824CAF9B4D7E85BACCDC0BEAD80892D5D aleksandra.ognjanovic
80,285,612 *088C7E8F734B35E4AE0968B36006252D46DF55B5 af/a6
80,285,613 *088A289372D05313C2CF437D8997061F7D565C8C ALFREDOSPEROS
80,285,614 *0882E09BB93C1E383AE7213B213E8189EC34FDC8 A";FN
80,285,615 *088E5E398463AA3496196D547A08B52B11B43597 AFSCHINEH9
80,285,616 *0880700799E1372CFF4C4BA46087C573A6984B57 alrously
80,285,617 *088E19189A724A6759A664A1E1CFC3EB3A52D0A0 alvu
80,285,618 *0889919F9DECF54B35379BE0A498D7E0AE766968 amlgjdlg5
80,285,619 *088F0124D7CFA449E104D403ED91A1E7D1EF32B6 Aid2
80,285,620 *088BAE127BEFF65F037A1552F454970512B77B26 ANDERWEITIGEN?
80,285,621 *0887BE184F02F23480EA47236EBEBC6516A78329 anemuogo
80,285,622 *0889C348AC50886A2F51E16D539775F9555B36F2 ALBERTOMAINGUY
80,285,623 *088B900323C859DEF3BE8037448C55192F9F117D ALBUMTRANSIT
80,285,624 *088D625A0DA3A43AFB8858D18B0315F8BDE85E98 ao;4h
80,285,625 *0887AF82C413E46F0A31E8FA0D96C0A49FA12A84 ap?p6
80,285,626 *088AD3E9C756FD33FF3953DA6B85B6C97EBEDE39 alonsomcilvaine
80,285,627 *0889E227C4B681E2A23085BA19EA9A52F7495741 A"OFY
80,285,628 *0883BF7AA69AB728F4AB7AE710AD7932ED582B85 A"Ok
80,285,629 *088D29F28DB59C1BD6017E69936EB2A8CBE08BE1 amph
80,285,630 *088DAE482B8B6E14A26608310A2EB7D665687821 ANDRE.ELLCESSOR
80,285,631 *0886F1E861DCECF58244A6460DE342C4BAEE49AA armada-del-reino-unido
80,285,632 *088F1F0D082CFE19EB9C125D84561CEFC7F7332A andyboggiano
80,285,633 *088D0782E83F5E046798FEBD9463440852DC0892 ANELLATO0
80,285,634 *088431962F6321CA6F1F04D5215A1E96042ED1EC AZOLVES6
80,285,635 *088B047E186E6FC56FB164E8D2E2E7A8E6846A4F b$(:
80,285,636 *0887F8CF9AE1082F762DEF637CD6FA0B4F7EBE7E a&sb!
80,285,637 *088A32F9B251138FCB39448418762D5CD8C48074 ascottie
80,285,638 *08806EECF941846BD5C32CBE0A8EA3C3545F2DE7 ap%",
80,285,639 *0881BEBAE603B4668E28EC82103BE20DB6374857 ATIGRADA7
80,285,640 *0881713F4E43834AF2BE71A713CEE66C9CBAE3B6 B&9RP
80,285,641 *0888F78A6506D332A47238F734137416C5773694 augustusbrentano
80,285,642 *088757C07378E5688AFDC463AC309356BE5C7BE1 AUSTINKATHEDER
80,285,643 *088B7F753E5FCE1D24219DEE4382F5749AD8F1E7 [email protected]
80,285,644 *0887378DDA61DA7842EEE45F0281D2A2199CD576 archtectonc5
80,285,645 *0880ED779F28027F3FC4660672D1BC1AF1A3762F AREBOLGNE0
80,285,646 *08873D6F1F32E46BA6754D122F5660F2DDC2CD94 av;)k
80,285,647 *088B4CCEEF0A021C8E55CF99E81C273DE51D3022 ax%8r
80,285,648 *088551C0B412A286B98D583610C95980DA632D36 bbcb
80,285,649 *088382DDC658F0FB333AE58CB8FA32AADF4532CA b#11
80,285,650 *088A551D612EC7BF65F5945F803737D5E6ECA963 B7QZC
80,285,651 *088CC576447C467EA547C73791082DB60C90D3ED BEAUROLLINS
80,285,652 *088A1F189BB73565ADEA10CCC2C22601CDB41FA0 b&eg
80,285,653 *0888568FB8422730D5289FB40E1075327248B072 BENTON.DREBEN
80,285,654 *08815C15E4BC370C2B8D705B1428F0EAE3EC7AEF bernard-lachica
80,285,655 *088071B9D61F82114E5C9E045EE420D978230FEB AX.M:
80,285,656 *088352F20A807E9BB5F92DF8370CF5FE23F129F2 BDOVE
80,285,657 *08857C43818DB571B912FDFBA695215C96312736 beemdgras4
80,285,658 *088545648557C04AF092FF50825F771B9A601BC4 BENTON.HAHNER
80,285,659 *088A8819898FFABC26266CF0991EDBE24443EF45 BERNADETTEBERNARD
80,285,660 *08874B1F93177B4B1137A79250E8A4BE95F0BAFD big.game
80,285,661 *088810648A1D563946A238748C882CF0903C8DE7 BACCHEMINI
80,285,662 *088CADA8181D5DBFDD8D01087A1F55B920D469DE beuncleds2
80,285,663 *088B5FE5EC5503D2E5C453310F72238CD8F9DF0C BEVERLYKENNEDY
80,285,664 *088EE05D1843652B9A64BDAC1E112DF57BD75786 BIPYRAMIDING
80,285,665 *088C1DA8DC64263D4A979CE9A1CF9F763BDA0E44 banguonline
80,285,666 *088554B2152BA5D4A13036690E84F4CEE4390301 『barレモン・ハート酒楽食楽』(古谷三敏著、双葉社)
80,285,667 *088D40B989150B7ECD49A8F9F913F150F53EE5C8 B_ICB
80,285,668 *088776C537BA9719ACFA443E6D6F413E9CFA0BCE besiedeln6
80,285,669 *0889FC92C47644AB1C135F160501950EE844FE2F Bg7
80,285,670 *088FF0260795FF6CED1CEEF20BFA5747BF8B1F9F blazons?
80,285,671 *0885B68B714F00D3326AB8F2FC356FB424EB9832 BH/;H
80,285,672 *0883F01B83475CC35DE37D99DC6F670B1321E96A bmr2v
80,285,673 *08840174C863367ADFD020E19373C6B2A655C30D BOBFORMBY
80,285,674 *088C3ACEBE1408947424D6F0208D0E85A35BB2F3 BLH.C
80,285,675 *0888E55D29395B6422646128A0B0AC5BED4C176A bookercamerena
80,285,676 *0887FC69CDFF12E43CBA29D5836928B8B70C4545 bookies
80,285,677 *0885E132039CBD09CD2C97A78E9893D5CA0BCBA3 BPQD
80,285,678 *088D382385747AE397CD6BF6519F24A973F62189 B=====P*.*.SPLAT!!
80,285,679 *08838CFDD3CF2A93FCE1B6A2C36DC396341E146D BQ!K
80,285,680 *088FC54D54D73AD896C9A0C364779488678FD21C br!=m
80,285,681 *0882E3C76EF593B388441A0730371C81D27B11D3 DHƻ
80,285,682 *088CEC9904DCE5315815043036DA9EC79130C89F
80,285,683 *088A9E384D075F6C482C1BA259524A58509B8448 \
80,285,684 *08821A22D8D939DFBF56D31BC86C0C6D4159B48E BRUNO.WAKLEY
80,285,685 *0883BF8E20B389A9F810CB5F2241536BAD0C2C23 BRENDALOVINGHERFREEDOMH
80,285,686 *0888D912ADFA1609402BC25776FA8081576B04A5 BS&KA
80,285,687 *088172CBE0C9A9C83EC55B039AF7618452305E36
80,285,688 *088BEADFB43C6628B49F93046EA2C43C9139E06D
80,285,689 *088A6554FAFC61320DE87BFC745BF455AC3743B4 btmi
80,285,690 *088C06E257A04931782E8940C3D319183CFC462A BTSM$
80,285,691 *0885610E1145835E287A69446A4BC896B7D1091A
80,285,692 *088D0240D2EA582DFFD8E39D0553D1D48C4DC195 brownit5
80,285,693 *08840C3672739E3D3B571D5E3EBAD298B1285867
80,285,694 *088580449B56E11AC92DA7251C5D58EFF4B5BE6C BRYCE.TALLMADGE
80,285,695 *088A9776E3888DD6EB874A1F5DB31BD34FF2B0AF BRYONPROVINO
80,285,696 *088196F9B3823867BB331CD88F99D0EA4966BE78
80,285,697 *088772D47CD76D57273F4343D556A007C779E60E burlkoback
80,285,698 *088FAD7F2C73A7E8402C2406774C2E00CD7F6723 Btm
80,285,699 *0883858D9BED99A1C9713902CAD0FAE810B06958 Ϣ& (,4xZo
80,285,700 *088BA3658428FB9446EC0B97763E1D7F3E73C4EB q
80,285,701 *0884F386120B53CF1B226BEE927785BBEE9EF3C1 [email protected]
80,285,702 *0887A9B3427E7AE77EAD8FBD34A255DA0D49D786 BURNIFFING
80,285,703 *08863646CCA6C8D3327140F5D6C0E504D44262EA
80,285,704 *08800EF11458AB6050056A52C1724CE24CF08DB9
80,285,705 *088B79C3503F659842D19A4E48DF01C4F4F6FA3D s L;
80,285,706 *08837E84E73AD7E693BC42BAC1838415CE3A86CC s
80,285,707 *0882DD337CCE9863CE3B472BA1ECCC682B8F8F4E zX
80,285,708 *088A33636E541BBF3C75537FFA52F5D6F0110886
80,285,709 *0887C79D850381F10CD9585EAD27D197CB2E061C lX
80,285,710 *088C718B3E2D55EB41396D1A18B8AD1012040BAB P> K
80,285,711 *0888F60FB7CF60B98AAD523F1103F1848E5945BB b-!uu
80,285,712 *0887260A88F9AF1DAFC457C84DE71F58585BF830
80,285,713 *088E8C0ABB684B100D41A3822F417F96C387ADE6 BVSN_
80,285,714 *088AFA0D75542BACB62548B4D097B0E8BA00BD2E L
80,285,715 *0881D558ABD0E93792120E85D936583FCB5A36D5 BWV_
80,285,716 *0889F3A698E11658C4E00FED818F27025FD674B5 B[XH
80,285,717 *088811A1FAD82C8D8C5807DE661B8B6306ACC2A3 B#####) ` (X)
80,285,718 *088A918978CEF8C7687DFB10560FF9996CF66CD5
80,285,719 *0887AE4BB0BDE0A53A532485C4371BD865F88B78 byebyebay1bay1
80,285,720 *08841393B8C3199B041513852A4E6FD254D968CD byelohs
80,285,721 *08812749F142475DC3C4928E3832DAF66502645E 0Ff ?
80,285,722 *0883953EC1BE9A00A4CAFBEDCAF812C963368DDA b.&z5
80,285,723 *088A4AD9BDB0B54B5B77BD6FDB4022F8DFA9EA1F C_:
80,285,724 *0888518086776F698337597FB85ADC8BEA1C90EE إ0
80,285,725 *08876F6E10FE730F6396094AE8A255C76CBB9E20
80,285,726 *088F822C745CEE263752C70D70665617A50EFE1B
80,285,727 *088D9C659ACE0CE7E1B8FDC6F8A04797FFBEB26D D
80,285,728 *08893B6BC5D00344A3D54F829EC7196F4D966F4A K-%-H
80,285,729 *0887567F21B641127D8615F12758105E3E76261F C1BRP
80,285,730 *088A56DD5EE0BAAA22905C417F4D50A6CAEB65FD c4a4.
80,285,731 *08839C2E9D0595A2F0D636270C3DA6E2BBBA2EC5 c5a
80,285,732 *0886E2FE17F2AE3B474E84F4296B54BDDEF8BA15 k
80,285,733 *088F940208CB3477B5E245752B220741CD45024C D
80,285,734 *088111EAC59F40E0075BD915519C7B6710A53ED9 c-7ck
80,285,735 *0884195DE0593C3B6FADEBE429CCA6F1026EDE0B
80,285,736 *0888842B9A684D21EB578E5CA35830D4CE63BC58 c8hk1
80,285,737 *088972DB52445A000F5D4B5F200F5C8C61B38E87
80,285,738 *088A9AA29F75BEDE2C2C8EE70EA8E5B3FAFD494A c6l
80,285,739 *0889EC1793BCB0EFE71E0988AB2F0B11F752C5F6 C7EH/
80,285,740 *088FFFCBD8E0E20512C8CE5AFED652F1EC2FA418 [email protected]
80,285,741 *088B7DDFF4D76FCAEA54DFB157AEF872443993A8
80,285,742 *08899F26077888BA6D88662EFA35086B3C695E54 cai0=
80,285,743 *0887AE660FBE4D823E3A8BD0C44C2B337FD9B732 calnetics
80,285,744 *0885FFBF3272F784A52E32E981FDF6629250B358
80,285,745 *08896458AF2D3BDA9842234DA188AA225BB9EFA7
80,285,746 *08892AEDED6449E44F9B5CE5101E4BE4273B031C
80,285,747 *088D025175C5850551741D702C8BA7C0FD1553A3
80,285,748 *08836B97B97A6A462C541B745BFADFAAB242E4B7 CANDY WRAPPERS
80,285,749 *08836BAC82EFC4AC626B525914D2AAEEF1848C5A 
80,285,750 *08817AB95A41BA5CCB462E094201893DFD96BC5B
80,285,751 *088AE5DB5ECECAB8060FC78C48A87DE5169B5CE4 000145blz
80,285,752 *0883B13867F56967E989899F2D92F0C94FCFCB1B C%BNP
80,285,753 *0886BEDE4879BC5AFA174A0DC897D19C16C84094 ccgcx
80,285,754 *088C7A1D7471AB904EA39BAC1B3923CDD76D56CA CC!S
80,285,755 *088D1D7C52F7A80B17398834BD645E1867767513 [email protected]
80,285,756 *08848FD7F6A46870A11ED01508682ADAF310B37F c=e#0
80,285,757 *088DCE76A615B4EF9436B0EA5AE9D4E9ACC07B57 CHADPESAVENTO
80,285,758 *0889535F954B32E6A03E3A6F4091BECE32C31407 [email protected]
80,285,759 *088B4C167795F54B28B23CE064601347CC10B5EB [email protected]
80,285,760 *08825E98CB8BD98F539D7BBB6F2B73ACB66CE279 CELLAWOKING
80,285,761 *0889741F5E9A505F477CA164F90AB7DADE9075C7 charliesaga
80,285,762 *0881C75A3F9310B9269E9FBF85D596D2994DD0B3 cgg#9
80,285,763 *08802A2E8DC5B2EC73B11EA8CD53CE4EF96BBC93 1328278 ursallaonmelkorunsaastisiirrett
80,285,764 *08881F2ABE44F8FA6CF6FA92FAA1562EA9E20B68 [email protected]
80,285,765 *0886437718CB9F9750DF7838DBEDCEF858C065A7 CHING475
80,285,766 *0880A7C329E1DF8DC38B12F9D5B4C9778361D0CC CHLOE.ORME
80,285,767 *0889C2D45DEB0A836C04BE747A9A9E85223D0127 CHLOROQUINE2
80,285,768 *08847506F6E562300698BB73BA4DB10F8FA777E4 christopherchio
80,285,769 *0880FE6E48A155FDB6113A7ED4E4268F5F017896 CHUANGUING
80,285,770 *088DFC256AAE9ACC0D52FF14E2C9BF5B268BD317 1657309 TOIMISTO-.JA.ATK-T
80,285,771 *088DC2ED5B4702527969319C72D35CE4D3E1AFF9 CHY-M
80,285,772 *088777C825476A204CAFE76F70BB859B0C7095B4 cim/e
80,285,773 *08832AF97BDE47C46E441C87B0EA1521FED1C628 1885640 SO-THE-EARNINGS-ARE-HIGHER-QUALITY-.-"
80,285,774 *08868D0E8AF9F201CF90CEEBCAA351B1F1C74FBE [email protected]
80,285,775 *0889F7130CC136B92FDFCE7B8D6FB0907EE5B122 1AJATUSRAKENTEILLE
80,285,776 *088CF35C3F2B895B024557C2BA3A3FE1DA1F603F 1 ASEENK
80,285,777 *0885D94524A20E82746C887A7ECA53B7485ABDAD 1.BASPEHLIVAN
80,285,778 *0882ED3FD6AF426458A651E3313EB7E056BB602E 1 BEKLEYISLER
80,285,779 *088C243845DB93BBCDA508F74B23C437559C26B4 1.berends
80,285,780 *088F236F2EC9B65869D3B102FD2024FF57C3108F CINSI
80,285,781 *088E22D6046AA145D94B78699383ADBD166CBF84 claudebruckner
80,285,782 *08819420A877E72371C9D2AA89B581E1AA30B065 1BRANDEIS
80,285,783 *088F0CBDA370BF3C4DD8D0A07491F647E4654B3D CITLV
80,285,784 *08858CE6325F5C83951F843A92AC2A84C06D4384 ciwanhaco
80,285,785 *08837AE14DE330D16AF1C9BC3937BEDAA15B8270 CLERUCHIALED
80,285,786 *088C6E2BA05D5E3D919A1209374C7DA1CCE8F983 CJMHP
80,285,787 *088A2B56915B569257659A39620262B05C03ED90 CJOFPWO26
80,285,788 *08808B0DDDAFBFFBBF9A19337FB25C5452AFF86B 1EIDTEKOL
80,285,789 *088DEBC0DEFF247B4B0A392511BE32A337EEC861 CLIFF.KNOTTS
80,285,790 *088D81B1F9945B05091A78EDDDDA92FC7E1006AE CK2(K
80,285,791 *088A2BD380B434440B79926339FB8991498A1DAF 1fabrikalarInIzdakine
80,285,792 *088B1B026050FFA78CCFDCCD099DBB5C72C23E2D 1FAHRRAD-MITNAHME
80,285,793 *088016AFBD8704183DEE2116A5CEE4C31E70A91D 1FELLOWSHIP-PROGRAMM
80,285,794 *0888EEF6500E754EE85C6AC98052A3A18FADCC95 1-fernsehglaesern
80,285,795 *088016AE272A5841AA21CC833473D68FCAB2749C CK)J
80,285,796 *088F22C9CA242C2C013F56FCFE8973BFEF2D3957 1GOLLUCCM
80,285,797 *0888458E3287A7EF4DBE18ACCD1082247D9D2DFF CLARAVIVIN
80,285,798 *088AB8627B669A9102075B414531BDE858669F39 CLAUDYOKEL
80,285,799 *088D3AF30E671EC3FEA50D51B29ABF44159C0A55 CLINTONSYLVIAN
80,285,800 *0880B86598DCEEB7A648739DB24B75A15AE539B6 CmL2
80,285,801 *088B98FB1B70FC5C86808FE0CFE7F26900821D7D cmxv&
80,285,802 *08849CD9DD6241B4A06846F79C6B347AFE5D1622 colors red then yellow
80,285,803 *0887D06D39CC722B87DA22C7C0406FA3CE7CDE33 columelliaceae!
80,285,804 *088E1FEA398F75692576AEAE373E48F63A062163 1.muttavahinkotyypeiss
80,285,805 *088A4025147BFCE302D16A5412549707AA69E671 commu7481e
80,285,806 *08860C662BF77D4484BDA7ED6CC4482C581BEFA0 CON53RVA+ON5M
80,285,807 *088C3D22CF56BB2E8E3ED6C8DB4356E284A1C530 COLTON.KAHOOKELE
80,285,808 *0880A10C145EDB09A4C401D2930BB60BADD8E99E 1playboy-gruender
80,285,809 *088C332C5F930197B05432DB48FDB0E429BCB9CA columelliaceae!
80,285,810 *088898F02E25FCC191CF2E58C8D602FAC358CAAC [email protected]
80,285,811 *088E601E650D5970761505389FCEFEA2259CFA0C COURTNEYDEGOLIER
80,285,812 *08835FE1AA283F329612F14782FFB6B058CEAF93 1-VARINAISTA
80,285,813 *0888D9A229163F3B2D78BB99EBC4CBA7663EC20B CPJG5
80,285,814 *088297C6C7E08491A9FD8FAB68F82FF5C4896ABE 1 YIVO
80,285,815 *088EFB5905376295EB6D652847F31FB971874CCF 1ус
80,285,816 *0880C1796BF7840E0601121AFB20C0F22C48C533 CORYNEILAN
80,285,817 *088650CD2539668EFCC75410480607A77E2A9D19 238938 dashoertsichtollan.
80,285,818 *08851C9771DC90B8C09A225A31B69A33667DD495 259ROY
80,285,819 *0888320B620B94EC4449C5CCF65998AC61D3418F cre,+
80,285,820 *0884AAD561000C651204397E2DF6035AABC5E141 2BPFSRHS
80,285,821 *08864D527F52EFCD8371E153FBA4BA6E9BF1BEF3 CRISTOPHERBARWICK
80,285,822 *088D57A15B39BB1ABF37531FCBD41C8F43B1FFA1 2DECSELAP
80,285,823 *088B8F3E852476369BC26D93372F2A31C9A8ECBF 2ELLYTEDI
80,285,824 *0888454C44DF211DFABAE2609B2113B6C2F87138 CQ?TR
80,285,825 *088D1BE20562503E172E6CCE982EAF2E0AAD7FFC ct.m(
80,285,826 *0882356F70301F19FD1E561576E25BCCD142D835 C.VOF
80,285,827 *088A3C44EDC920012A173B254204573DDA982FD7 2-TURKECAN
80,285,828 *08882FBC7FF2DABD33EDD360F449374CCC0F3DA7 2-VASTALEIVOTUN
80,285,829 *088A0B15CF681007080534385FB99B97E24B0742 ct:ib
80,285,830 *08866A12D4497691232675C18826E3E72EFC9C94 cx7fq
80,285,831 *088065ADC27D02AE36D743EE71018792AE0589E7 cuoh42-7
80,285,832 *08892FAC6E448A32B73643D7E4E05C4A5B3EDB73 3DIARYON
80,285,833 *088DF78EC565DE5E385009FB6A06D01192EE575F 3EPSREGEL
80,285,834 *0880E9C1150652AAB0FB0CE62A166D8818FE140D c-"v?
80,285,835 *088ACDB9F302C4874DAED20F5A2212FE2CBEE0F9 C&VT
80,285,836 *0885B4319C43B4D2417483A28C1ABF20C726EFA0 CWPCX
80,285,837 *08840C8C65DA4FB20A73559B3F355DE3E97CE17E CYCHORY3
80,285,838 *0889C37B0B550407E0AAED570FFC0BD23CBB2692 d&60(
80,285,839 *088DD4B5F112DAF8397B28363F36FE23F8EC3637 470673 bdoas1982:18(4):61-98poikanro4.t
80,285,840 *088B415784CCC3BD0726057C8E7A9DF5AE220836 D9182777520368807140D826819DA2D8-MOUSE115
80,285,841 *088555FF2358C3B22260760DAC8FE591404FDF74 d;!#
80,285,842 *088F54E1C72192ECD057D62514B6A7352EAB3811 d?1(+
80,285,843 *0880E61D03A07D5D55AD4E99C34182B1DED93ABD DAMION.SPAUR
80,285,844 *0884153DD1BC7DED836402DC4D8B43EA951F5397 damonjiron
80,285,845 *088333C1C9A4238F642FB9EC9914D04C3415999F DAMONMUSEMECHE
80,285,846 *08847B1AB21CC101F366DCBC4B7F551060A8CEF1 d,2i(
80,285,847 *088E3DA3DE0CF14D17F07F85FEBA4330982D9EBC D3$9NM3N+
80,285,848 *088B07B725AD51A8540B17C7494201E890FFB94D d3_hp
80,285,849 *088B00AF88E2D80BF20D66139EBB59F4C4890C9E [email protected]
80,285,850 *088C0EFF9E33C9469CA4590D9F2728AA1FD9DF6B D44V/
80,285,851 *088EDC666A53A11C2D79D0A9241AAB361ADD61EA d5f+c
80,285,852 *0882A9E8C60FC1845810CFD57EC470AEF8B0B54D 4UNBRYDELED
80,285,853 *0881F70F1552095A675E6C808F1C48B97A1A0196 4WIDERSTANDSFAHIGE
80,285,854 *08888B66BA480B406A7959775EF8D65FD440C24F 4WILLIAMHARVEYKLINIK
80,285,855 *0888E51A024DF6302473FBB173DC9FCD375BF0BD darrellfuel
80,285,856 *0888F55741BA6230E7B1F4B4555C77F3181309EF darrinargentieri
80,285,857 *088948691E8EB4B5D293173F850CF6DABD32797A d8%db
80,285,858 *088C43D623240A0892E3A3EF9035114F7DF9AE9A d8vwt
80,285,859 *088E10E610D55D2FB6446C3303D8C3830B19AE5B DAS#+
80,285,860 *08802F5589EB651E3ED91D340AF281D9956A77AB davidmajor
80,285,861 *0887AC09679DBF00013665C532BF8F4C02BE91DD 5ALFREDPPP
80,285,862 *088220CD3ACF9153BDBAEF188106379D36D32C93 DALEKILCREST
80,285,863 *088E81C419C59FB1B1154BD7F6C497515130E117 5CHRISTTAMMY
80,285,864 *088A68F4F5439D8A3DCCB94298EE523929727D63 DDD)N
80,285,865 *0883F664C3CE06BDE3944A68BA9D7E2D2831000E DARKSOULDARK
80,285,866 *08818F9B887445CC9C60D70F5EEBADD436467751 DARRENGUYOT
80,285,867 *0881CAA1EC703CB1751BAB0A64F26344CF5FBE14 5mypickle7
80,285,868 *0881C9AA1EE624C526BDC2FC9E5537128091EC92 david.warchol
80,285,869 *088AB882F2A24A1F70132DEBEB15513D42FE17DC 5ORKANVARSLERINGS
80,285,870 *088B080CAA08E5B448D9A1040D35B919B7CF32FC 5PHRENESIA
80,285,871 *088318D2AAB158ACB51246D81A6EEF3D11E924FF DCANNAFOGLIA
80,285,872 *0884090F7452DFB9E0EA173223897555B593D25E 5TITUIERE
80,285,873 *088FD64D27DFA10E68B7D7A0B4CF2A46A65CA359 deltoges7
80,285,874 *088B31A2A8B4BB6CE39672AFDB95420FE426AF65 DDBSM
80,285,875 *088754CEA0D789896168229EA7C146E6944378B2 607035 IdealdUzenibelirleyenkriterler
80,285,876 *088B772F277442DE9B8915F444DA6A23E390B937 derzulumann/frau
80,285,877 *08847A18B9BF9FDF1A7FCF6F1635F161D6E670C8 DEEKU
80,285,878 *0886B157B76CF7AFC50AB6F885DFD4A547708A7D 675008 kaavoitustoimen ylitykset ovat noin 139000 markkaa
80,285,879 *08829058C4EC1E2C9E68E61609B6CA624D1E4876 6ABTENGAM
80,285,880 *0887A9AA9AB30FA8640F1C6919544042E2CBDF8C 6ALUCINETA
80,285,881 *088DA5902C746E31E3737F0C5EE0D968B6BC78F9 DESTINATIONS-TRENDS
80,285,882 *0881FE74E186366BA7712A70D601343584E5B369 DEHRADUN1
80,285,883 *08845D653B44EAED951CF8FAB8EB62FF6F75A33B Ԣ
80,285,884 *088E08591516AB920C10083BEB37E07A595BA858 t
80,285,885 *088ED3DF203A83CB854D28FD8A7464A04EC178A2
80,285,886 *088A8C20E05121EB2F0B563926D879B141D1B5B6 ԓZ
80,285,887 *088E4F45F28AD659CD1C00EF1959D895EB1990E4 {
80,285,888 *088F8A91D7D74B57779B78F481BDC9929D4AAE9B 8
80,285,889 *088D63B442EF42D888DD0FA9F39F3C4478B8439B ܂kUzM^Fcn;
80,285,890 *0889026321B668434B3391465FE77896267407B2 -e3ť̤
80,285,891 *088FCEBD5329E3F99CE4DE61BC5FBFEE95085241 ҍY
80,285,892 *0882B00DC98884BE95FC8519A00870118D604358
80,285,893 *088E64207EAFE7C9858DA6B698645E27BB864218 ӊ
80,285,894 *088CD2A4F3C68F21D167086D56B337028C66E250 }
80,285,895 *088C7156EA73B4029200EF5229D69EB1C3D516B1 EIո
80,285,896 *088492B280119D1CE90F7B6AB9FADC6D14050D1C Q
80,285,897 *088D0A2A98B1B4C97A2D2902415F49B1E1908016 DfE$
80,285,898 *088437AA5E8F30276CDE5C302DE635101A970436
80,285,899 *0880753BEA3B2F2226530C207A932A6BB94692FD DGS
80,285,900 *08897239E6C119E4E1BBF99799F349E1BA22B04F &
80,285,901 *08831FD4A97501BDD3419415FB3DED3F9997471B 7
80,285,902 *0884CD9C471B9C3977AA75DB3EDFE7C55D8481BF dhlw-
80,285,903 *0880015A613E0D58627E71FA30FCF032F4AA0670
80,285,904 *088B51F6D3B95A39623896C8BC03A3BB592911BA DIADEMHAARB
80,285,905 *0885B1D387473529B951E9E2B9BF1BBE0EF3BED6
80,285,906 *08815072E59136BE39A04B3346526822AA85BB38
80,285,907 *088BFAB42D37B74FF09B8DF00D1996315B4DF9C8
80,285,908 *0883EFDD28B0B48B0913DFA20EFBC0A64B77C420
80,285,909 *088E669B9E9C96BF2C9CA765CC66F9187EF0EAEE }
80,285,910 *088CD7579748E8C1792C04FDF5967520751E731E [email protected]
80,285,911 *0880B9B8FEC8843BD1A90E387A5662BCCF8B6EFE DEREK.RADICAN
80,285,912 *0880CBE9BF91C3F7240D808F9D1641A74C7D5A12 
80,285,913 *088FA042A33B84601D4A416AD2E16D470BD1E9C7 deserved
80,285,914 *0882DA33B406019015BEDDF1EC1D0B13DD3161CF di,,r
80,285,915 *088C48B26C18E46F289753250940B7979131B9EC p8q
80,285,916 *0889E01D04C781D34431AB30B2F20A82133CC974
80,285,917 *0889DA719A092C4C926B57C48A8B61BC846DFF0C DGPQQ
80,285,918 *088F99453F56B3AFA5450FA8C498A4475D0DAF77 dhi3,
80,285,919 *0885702F62EFEC92E5DA3E35A5763C56047B9FD9 DI/;(
80,285,920 *0889488B2120F9EE3454233FBE771A8283DC0F25
80,285,921 *0882DC565EEF502D70C66452F834B25F82BC4039 bH?
80,285,922 *08845200999C5CA85278A899A6090B955E0C6D1F
80,285,923 *088E842F4C80B1BD125985AE90BABFCF27FE403F D_LBL
80,285,924 *08805D352D6C6548F450E947D6AB81DDF5D97510 diegohespen
80,285,925 *0885C43CF7905AC601A509051283D7E708DF284E dm#b
80,285,926 *0889663D44989BE0826120EC7190E932F7F1A474 DN=HQ
80,285,927 *08807687AB1B8961757A83BAB03A41EFBD3E8083 ^
80,285,928 *0887DBCE93E928BB82C3A784ADB00BFB3E1592BA כ
80,285,929 *088D27EC833AD08E3E2EED1F605B6B9B2918F469 ["
80,285,930 *0886AFB9ABBCE64479B9BA2F51C79B4094427DC9 t
80,285,931 *088485D3E3D67E21FA5FE3AB0B99041A44B2CB69 DO/L
80,285,932 *0884C5BDEDF7DFDF56A62C9E8B34F455DCC0FEAA DLMPR
80,285,933 *088573EFC2AC0697DB962A1B3840807FE67D48BA DLUI#
80,285,934 *088ED390CA7A7286363A711E3CCF1F850687A14A
80,285,935 *08807079111C323317C831CC61327FC82CF5590C #
80,285,936 *088BC164F6E8DBB2019CF97F5883FEDCEB0362D4 DONQUEST6
80,285,937 *088450C8399C556CB09EE9F98621C09A83030115 b
80,285,938 *08801E0CAFBC22EA3495F497FCC9E3CD70EAE03E
80,285,939 *08844CA89747F4586460306D535EC9F8FF3FE27C DOTONG
80,285,940 *08854F8D90AE47DFBCCBA8ADDACDF1E4601E5B55 dm)v
80,285,941 *088F3B3047628CEDD6A9E9A74354F6C7621108D5 DN0Q$
80,285,942 *0882FD156CACB67687DF4CB14E26B8BEA3684DB8 dq9b&
80,285,943 *0887A9707DE7EF543061FD491F82A4E1A3AA6E8F
80,285,944 *088F7E1D65CF03DB1B10EFC63911D90E79354DC9 V0hv?
80,285,945 *0887208BC6EE0248888E49312B30B2C2630A3D3A dr)a;
80,285,946 *088E948A42081A82E84DBB3D44E6F50B531E61ED DONALD.CANGE
80,285,947 *088BFCBEAB4A697311B048BA9ECFC493FE5D55E8 dpph%
80,285,948 *088D8DE5540B606FD589B84D2E92DDE54015B947 DUU7L
80,285,949 *08824B5A9F98EC1C62D213CEC71772FEE71EE546 10brebeck
80,285,950 *08844B63A6B5E5E3F2DA2A47488D5526C230256E 10.sUngerle
80,285,951 *0889EF06FDCD5FF1A68314EA093C3E1B329EFB3A DW;T:
80,285,952 *0888A474A0DBAA2754A8AAB6ADC7EE20368B1E5F dyra:
80,285,953 *088113FFD2B26CD13B95A1DAA1CC87BD7D87F2B5 1237160 toiminnan tuntee v
80,285,954 *0885D16D9944D21A2D4AC600E08F3A280D473E87 123POETRY
80,285,955 *0882D4358D129077ED323FFBD3D722FA6766ACB6 dzznk
80,285,956 *08866B5351628BCB0275B2731281756B8841F6A2 EAA)Q
80,285,957 *0883E6EBF62736931F9A64240D8AB8C4C217A242 dttli
80,285,958 *0880115CF443CF45A0040FBCC8827794CA05DB3C EARLE.BIRRUETA
80,285,959 *08827B0AAFE001A82C8EC6A28D943B3B9773B8B3 EARL.SUKOVATY
80,285,960 *088626670E2CC36366E6CA11BCB8643B0D1D63D6 eazpc
80,285,961 *08834482BDDEFA23D6B46AEF16EE45B1B987C9F4 EDEDIYAT
80,285,962 *088BAA9488F5AA2932C44B29348E0E6A42A2DAB6 ED.FARNHAM
80,285,963 *088E40BB9C7B8E11B9C17EF5151DD6D154DB34DE EDMUNDOBESSE
80,285,964 *088BAB13A9C3830331FF4A8C83505F2E24855DE4 DUWL
80,285,965 *08860B034661D9C84555AFEEDED3DFD0011F0228 dvw7r
80,285,966 *088A23B96DFBBCB32466588E1F430671EA62EB0A D+X3L
80,285,967 *08861001F1ABF2FA6510164234181528CB8D9D5B EGFO1234
80,285,968 *088143DB875E983015A78F0713A62BEBD21A22D5 1997rc3
80,285,969 *0880F83B0B09C4775353168D8A100BE227BD173E dylandistaffen
80,285,970 *0885513BA2DD4F80B94E5476E72DEB61AC76AA99 ekq;
80,285,971 *08872BD71652A19DD81992558CB4795D04466D1F 1 DEGERLERIA
80,285,972 *0881F4ABB8D6450AFFAE5A594EB94D5044F007AE eb=t
80,285,973 *08867B2C4D00CB822F1C4C304157FA7F26BD5B35 electricsoulvol1
80,285,974 *088EF8C7AAE25CE6F9B8960275A886987BB4FE8B 1elcoteqsopimuksella
80,285,975 *088072589CA4AAD142D2E203F721161105D8AEC7 eliasmorillo
80,285,976 *088FBCF43C8EAB912018F1A6CC11B8C377655C2D EDFEERTSES
80,285,977 *0887F51C3EB55F6EB0F9D2CE780769144C73204D edit--bot
80,285,978 *08807C22889A9471DBEEFA66639B922702B18340 ELLIOTTHAWE
80,285,979 *08857CC3A8967DB69FBB5154A5FD1A82B3D9910F ELLISSPARTICHINO
80,285,980 *088595E38E59D3620F45592B8728E8143B29C6AD 1.ILMAISJ
80,285,981 *088DBD9F678BD0066436B3B8EDDCA602692ABEEA 1ILOVEPOWER7
80,285,982 *0882F06B23D798096D25341F6112FB436DAAED61 1 kalmanfilters
80,285,983 *08870ED7376468F40788ADCF16F0105395A6A029 EDUARDO-MALONZO
80,285,984 *088C15699BAC9753186EB896429F63EA41F45EA8 1-oligomiyosen
80,285,985 *08863A1C7A76C15BFFE5DBFD693B95395CFB38DC 1.operkennenlernpaket
80,285,986 *088EF95203E97B63EB047BFB8ACFD49B3B4C0FB9 1.osteuropaanhang
80,285,987 *08866D920A59EC626478AAB97A9FF0D770416599 ELVIS.CONDINO
80,285,988 *088D3E49DCC3C48EBA3B136DCC0F9BDC4B6BFAB8 1-piart
80,285,989 *0889B6A0B463C67DEE282E4E358ED1E53180535B EMANUEL.MCKANE
80,285,990 *0883A05009A748401205ADC95918A5F6D62E3247 1 SCHULKLASSENSTAERKE
80,285,991 *088A661304354794F4DA5DA7C715EE8334992BEE EINBRECHEN!
80,285,992 *088AEB0CB2A5AFE542C216BA962255660566374D 1 SONNABENDRENNTAG
80,285,993 *0885E1B1038E6E66A891E2CE2C837D94742E30BA [email protected]
80,285,994 *088E4D8D595AD1D5831DFE231F96AF5846EBE063 ENCIBLES0
80,285,995 *088E64CA6E65D9CE70B0A0110E7908ADC7D4C331 1vaakapylv
80,285,996 *08839E974F61B5398AEE7B977D3DD0237816CD3F 1-vandervliet
80,285,997 *08859E0D88A1FF90FB2E6D6354AEE5BE6CCC61E8 ELECTRAENCEPHALOGRAM
80,285,998 *08881F6EAEB979EAC1E9C934B55AD4FB884696E3 1-yUzlerimiz
80,285,999 *0888DEECE4EA3EB250761F25B43AD2835785BDCF enquerirs7
80,286,000 *0889F194A4A85832A621D69A995D01EBF1E4589C 2004429 kaliberin7x33mmsakok
80,286,001 *0882C942A2E73D5DF1A10DCD51F86D589832D338 ENRIQUECOPP
80,286,002 *088D0A531A2015305401DCB0197BF4295CF3F448 entendezvous.la.mer.qui.chante
80,286,003 *088B0CF5905BC1EE04E7864AA53F0FE5F354B48F eltonmcfan
80,286,004 *088BD78FD3BD0E4E92E5AB3A1815867E84B4A429 22.kyett
80,286,005 *0889729F0A549EDFE5825A78B43C641C576558CD ERIN.DUPREE
80,286,006 *088D325B9CB3FE91118181B0560FB0B9124A5B74 ernestpillon
80,286,007 *0883E5D9DCF09CF054AFB05303DE0BE83ED4C02C etaihcced
80,286,008 *088682EBA1F19E23C8A9B0AEFD9EA51C795E756C Everybody.(Pink.Garage.mix)
80,286,009 *0888A9D6B12C90CBF281BC482B3AEA7CFF06FCEE ETNASSERPPO
80,286,010 *0889C950924E7610927DFBE0C0220E0A54B69696 évippé
80,286,011 *08822BE0ABBE3B989C2C74CC4C1F3D82E9AF1D9A euiln
80,286,012 *08880EB77ADA195F7F4D48ADDE557F280E6F62B2 2.maaottelutappion
80,286,013 *088204CD12A963B64688A4D6F80CD896A9459CC5 2.matchsaving
80,286,014 *0887262C4D5904CF033709E5147F78D10DAD1555 2questra
80,286,015 *0888D91E24CE5EBDFA6C09DAF1A5D997EDAC59C0 everybodyonyourfeet
80,286,016 *088BF21B7EBDFCA3F0DB9390A77DF9C857F43AF5 [email protected] ~0 ~o splat
80,286,017 *0889ABDDEE13991BD2ED29E51F08C787D0145C7A FATIN.AHMED
80,286,018 *0881CD2BE72354742D479AE406778EFC9C9C393D fayekidd
80,286,019 *088E32A377F18F2214BE1BF54E01D545D5FC17C2 3awhitney
80,286,020 *088989CAB617D980FE571AF59CD78B82ECA49524 3BOBCHES
80,286,021 *0886A027BBFE3A6FF91623D7D1591714B5BCE6CB 3b<-*.(=====p
80,286,022 *088AAF05CC90E4CAFE315482EBFC00E2D1478780 3COISTERD
80,286,023 *088C5623256AB59AB7EC193DDB355D24FA13F401 3====d `~ `~splat
80,286,024 *08845358655EA6A835EA2824B4171AEDE8B8E000 feltontringali
80,286,025 *08803C3E1B4A848FF6E550AFC210A694C5EEFE61 F9PD
80,286,026 *0881CCB68C6B39A8E8352394A00AF026276C797E fhrsnaw17
80,286,027 *088115E0864B29B78619393E97FC80F338E84832 3HENKLE1234
80,286,028 *08829095ED2E6CC171206717432FDDD6FC2E6EC1 FILLEULES4
80,286,029 *0882A04A55596E7BA96EA97BAE2EEFFC4F7E3CE8 3.natobuendnisses
80,286,030 *08844A7D9548EFA3F6107E918C7EBBBF9F2C05EA $3N$UA1I+I3$
80,286,031 *088D6681076F489EC80B9106B8308DF7DB417505 FINSAWHBHS
80,286,032 *0881172F817575B7BDB25DCADB516A17FCF323B2 3.perint
80,286,033 *088629C92BAE044155860F26CD38CAB641261CD0 3-yanbolu
80,286,034 *0889C7EE939DCDC3517A2414908D0665BFAAE8A6 40POROTUTKIMUS
80,286,035 *0889BD35A0E58F4CBAE640D593ECB8AEC3D0B2D6 FLORENCIOCORZINE
80,286,036 *0889F6D9AA940CDAE764F2E2094F179A91E32C09 4394h
80,286,037 *08891AC3C59FFC993A49E432D8D5AA7C457B6324 FOAHMEET
80,286,038 *0885D4CAC91F82FA572E810E96F0E56D3138D9A7 FORAYER
80,286,039 *0884A9D543BC37BE17E0E2205CE6D5195A56F511 fortifi
80,286,040 *0885330EA49D49C570AFD40A5EC805FC47B0B70E franciscoaspen
80,286,041 *088744967ACAE244ADD4E79DC4DAC14F6A0AB01F FRANKIEKAHILL
80,286,042 *088C2DFB6798CE6543C907CAF8FF9D85CA987E3D FELICIAOCONNOR
80,286,043 *088E7DF7ACD41C4B72050254CA8C669A09DD5F4D FREDIRVINGLEWISDR.CHUMLEY
80,286,044 *0889F458892502BA129E60EBB6741B410771C57E 4MARKEDSLIBERALISME
80,286,045 *0882D3B528F6E75146ECD6F1A7CE982DE03BE848 ferminwillars
80,286,046 *088743EA2553DFD3D70CE5537CC3B99BBF1BE747 FERNANDORATHER
80,286,047 *088A704C37294ACCED82DA91AFCD67EEE73D6190 „fernmärkte“
80,286,048 *08824AD3F7831B46163AAFCED2EB39D8B6B76311 4SALVATTORE
80,286,049 *088D96D88908068594910E8CF516A1557AA2D270 filoftea4
80,286,050 *0887079219C5B3F23CBD5914CE58C6FF8812EBD5 4tossita
80,286,051 *088869B7FE72EEA9D350B58006B9BBB93E2C6E09 4v0ucher
80,286,052 *088FB0C113FD870BAA4B3A1F4999815D82A45FDA garfieldsandven
80,286,053 *0881E3F548CB90750236806274F4E8FF25D7F07C garretnapper
80,286,054 *0883351C20845085B9B18A7E1F6BEC97A2DABD14 FOERDERTEST
80,286,055 *088E693D3B743594A91338B14131C4014674F6B4 gd2v
80,286,056 *088982ABA166830BADE02A8D8C47BD2B3F9623AC 5BRCHYDGNL
80,286,057 *088DE83DB9E972EDD0F17A5A3EAB51EFB7058162 GEHUTSELD?
80,286,058 *0882C40B99B9DDAD6FD557640F7EB5E24CD66077 5DYSODONTA
80,286,059 *088BD6F60C7410B9D1298D41A79F81B5C0B5441B 5EITAIRAV
80,286,060 *088C3D85D62C2340E77390231ADEB7BB15EB5C9F 5FULLYFULLY
80,286,061 *088479FC66BB82C58B9A7DFD39D95CECA719FB22 GERRY.KNEZOVICH
80,286,062 *08820986569EB7D67D239620F1DB21FFD24DA80E framingby7
80,286,063 *088D7B00E964C2C673B1D4BDE50CF518DE2B6719 GET_P0W
80,286,064 *0886C76507B316B8777651FB4BD7335CB19AEB9B GHAULUT5
80,286,065 *088A7B71DAE4F42CE9B7827747DD1D5462E83E0A gina-clifton
80,286,066 *0887ADE9B466EE2A716228B2FA24C4DA273FF3B9 GINA-SEDA
80,286,067 *0885B3DF307CC5C2548540CEB04C55D6A02DA527 GKARACIC
80,286,068 *0880678F74E6DB11A9719B67D4652363514DA146 5JUN1675
80,286,069 *088C9501AAB87990091CDD522CC6932ABD4650A0 5KSBZPWKWHDWAA
80,286,070 *088E75021221AF90F9B3317815A2492578DD220A GLOCHIS
80,286,071 *088B568A162E2A59A244FFF3E7DEDBEDD47ADE79 5myallison1
80,286,072 *088439FD336EBDEC387D1B23FB0B4E4CB23391D1 GONZALO.SORBO
80,286,073 *08811572B8F8E3B97D1B55D7721F48B4926AAB55 good_cheer-g/u/d_/ts//i/r
80,286,074 *08843A7010FF09A4623254F7A8FB0A14D0D5E392 GRABELSKI
80,286,075 *088686429D1DE7EAD932775AD838F0F9A672A1E4 [email protected]
80,286,076 *088A868B48DF9AF4A2D1318D47E90CBB7FA9B4C6 FREUREN8
80,286,077 *08858793DCB795338A8E017A0843F5D2FBDCB10A GREATSCOT
80,286,078 *0888A447D29963B1E7EFF5F84F3B5B0B708440C7 FRMORIERS
80,286,079 *088580924444B438FF9B0CECE8C1932254E76252 [email protected]
80,286,080 *0880D6A5F532256D0A040621851170FC8CE63C3E [email protected]
80,286,081 *08824650324EE34D6DE34F9A3D230ED4609624EE FUCULOSA
80,286,082 *08869F80C5CF0F9E7C3214610E4B03882E857A15 gthceruz6
80,286,083 *0881316A5436DBF30EAAF774B02C23D66F1808DE GUANG-MING
80,286,084 *088EE0F3B27837FCBD29985EE0C9D9B087FF4CE5 GUY.SIPPER
80,286,085 *08896BB061FBE69DEE6E333A39C10B3A51A3CCDF handbeat
80,286,086 *08896D93FBCE6B4ED6B6AFD2D7B975548ABDBF7C 5TYNIPER
80,286,087 *0883B7E75B7ED2D232DB8AF45E5467725847F46A [email protected]
80,286,088 *0885507450653688CE5EBF532D63F71225DEABA2 HAYWOOD.ESPEJO
80,286,089 *0880B78F5CD39804B902D4C384EA85F38344F0F0 6031132
80,286,090 *0881D7EBEF00DC83F518827843C0DC86001A7E86 HAYWOOD.MCBRIDE
80,286,091 *088575F7186C754EE50B18C095001F659315DA1F g0#%
80,286,092 *088E2DEBAB4DEC3174962CC657B4B9F944B0C154 HEINZ STEIN
80,286,093 *08811D3830EE9068629B1923BAA2282542DEFB63 HELLBRÜGGE
80,286,094 *0883C1483EBD8269CF7D974039F2F46D685B7A69 6HEPTADRIESE
80,286,095 *0883CB4DA035C694AB7FE7FC7D9C05857AECC213 6hondshaaien
80,286,096 *088B1560D0C7E890FCCC47AA8065162B48238D99 HEVEDERTETŐ
80,286,097 *0888797BFB2345CC282846AD294966F61E0FD9F1 6LIGULOID
80,286,098 *088986C86860C572D9081ADB0EB55F2051D97F9C 6MALLORCALAISEKSI
80,286,099 *08846AFBBE5C4950645674E21061A28D3CF65928 6MSJQFLIWRFPCMAA
80,286,100 *088A09BFA1B5762998505B7EE4043D374C0760AB HIRENDRAT
80,286,101 *088A7F8507E228BFE8DB02C8A4B354555B32F595 ‘HISTAMINIC
80,286,102 *088E8EFE1063DFF12F2A4449FD231EC1B3F31704 geenipan5
80,286,103 *08809BCB04D9D2AD3C4709FAF7B1A07DBF01A560 GEEWILLIAMS
80,286,104 *0881B7C19F79B3CADC6640D645F39B8EB2A6ED4B HOBERTSAVINA
80,286,105 *088A3FE593CD9DC94FECB73679BFABD9AC7668EB hodoshima6
80,286,106 *088F434D02E7D18107D7B55E8DB35EC22825AA91 6STARBONJOUR
80,286,107 *088E4917D7E46E0E8F9771AF57E45AFD1D9DEDC8 GETIKTES9
80,286,108 *0881BF9C763412758237880028CE2207A766C60F hqetxdvbqfrk0ah
80,286,109 *088ABBFB32AED3E2008DBE297D6A4F91EB5387AC 7BIENABEBSW
80,286,110 *088083ACD7D2521A8BB06203656122F0FDC0BAC3 HUGH.KRETZINGER
80,286,111 *08896B9E96089A277862E5C190855582996CEF62 huh!
80,286,112 *0882CE524C6699A8E5990999F746E2070842102A HXPHYLLS4
80,286,113 *088540B34520BD44327F953FA94B553618B9843D gojlblm48
80,286,114 *088A657D3E783B36784D4CDAB138A419AB5125F4 [email protected]
80,286,115 *088658550A0C8E3001F042343A950BFD8AB741B3 GO.TO.BED:.FIST.FIGHT.I
80,286,116 *088678231C6C8B5E545FE69D5FAC7F46B4700D83 7MARLITESES
80,286,117 *088AC2520882EA485BA11614899E3C2F9AB59D3A GRANT.BEDAW
80,286,118 *088CAAA8D46DF327644C7F0F0857869846CDA821 IAMQWER9
80,286,119 *0884759721FD1084D0CB86EC12CDD5FA99347802 7NONCONFINEMENTS
80,286,120 *0883C198B2F950CCDDC416E1997EB2501514B4E9 GREG-ADOLPH
80,286,121 *088A3E94C823868CA30CA6A54272A849BF15421D IANNADNOCED
80,286,122 *088A0296EFAB82D235BCA175ECD8332EA0A72547 GRIFFEYCHERRY
80,286,123 *0886DF4206538230E936894683BACD833B44A325 [email protected]
80,286,124 *088F5797CB7D721902D18406D02BAD371E99D572 GUADALUPE.DONNALLY
80,286,125 *088EF5A84835E68A550CF90E248696FDDA047753 GUILLEMI7
80,286,126 *088DE3A8AC9F2A004D1418C923DF840852653406 IIRGENDENG
80,286,127 *088EEDA23B4769F0FEC5D7AC1693EA7C01CE09E2 [email protected]
80,286,128 *088036FE1D088263E2A78F7D5DD96138707EEDAE GUIZHOU
80,286,129 *088171788F05DCF06A7577A2D4D1FE5836903AD5 7UNXQKVIIX
80,286,130 *088DEC8613AA94EEB4742CF86F21B1518E1F58C9 8###)~0~O><
80,286,131 *0882373EBEB2A42EE6EC9CE9810F7B641A065D02 GYMWARS
80,286,132 *0886CE330B2E328B4ACB4EBE122843CE90FC8FCE [email protected]
80,286,133 *088ACE85B0390FF77C9B487B2BCEA89314C3CD51 [email protected],
80,286,134 *0883D25FAFFFA1DBBAD53141AE6B6E50B7CA4B7B harling
80,286,135 *088372E1EDBFA83B6FE2F65A240851D29FA03282 8DAMSALLY
80,286,136 *0882997EC017DDB7AB9A0E45DFDC123F34BF065B HASAKOSHINAKA.NETFIR
80,286,137 *0883263818BD3E604DC152FFA540F14A898846E3 HASSAN.RAMIRO
80,286,138 *0885075D3AFAB7C1FE4E0AFD7B39687EFE951940 8ETTNALPTROOV
80,286,139 *0887E8CEC47415F1F591AA901A914DA63AC41FFE IOGRAFIE1
80,286,140 *08896410D2D0CBA369A06A3D8A6CE9F7509A8EC4 8GRAPHICSNOOPDOG
80,286,141 *088A5414966405FBD6E2E365BA654976D6A831D4 [email protected]
80,286,142 *0886B29B8FFFC241C3EABB57E0BF4F39F9B52E21 hcnyhrmrd
80,286,143 *08837DE1C1C42AB72A98E83B37DDD7AD6622997F hcollaw
80,286,144 *088E61A84A0BF24D773D678156CD3343570ECC81 8KOGELGIETERIJENS
80,286,145 *0888642A90A1EF166D5AB6277AB790BFEE68B8FE ISHIIGONZALES
80,286,146 *088A0F69DCFFCD5C4A3B90C258158F5DEB91D2C1 HEAVEN8456
80,286,147 *088564EC93B1F005A6BC7186F5EEC342E74CA34B [email protected]
80,286,148 *08812A99AC4A3E19563181781405A881EDF252F5 ITALIAINEN
80,286,149 *08813FCA1EF555D3034C05D38E4F20E2F92775B1 8NAKLONJENIM
80,286,150 *088F95F7E63A2B3FE559528A9BFC4D18B57DEF11 ITOMENAREN
80,286,151 *088B1161A43F961FD82199310CED93B2B7F42F77 [email protected]
80,286,152 *088B7E20003149D9B6D52C8C2A23A006BEF8C372 IVELISSE.SAAVEDRA
80,286,153 *088165D32A8A619FC215E1BE477AB9AE7899FBA4 HENNISSEN
80,286,154 *088B9D90628E3B31436225FCC9DDA3998104C04B }8{O~O~<======P
80,286,155 *0881E5AB981B8E4B3B1BBA24580C64E5F2061A69 j0111t13$
80,286,156 *0884C5D0C828C1686551554A3E1870EFD8DD6F8C J157452
80,286,157 *088BEC7029610C3D4264A34AF46354BF15A7BB17 jacintodilella
80,286,158 *088758A95478AACAE5AED3A0FD367285E86A2487 8PROTURBANT
80,286,159 *088EEBFD18A44F56294FF2DCF60FA863798F8F97 JACKIEBALZER
80,286,160 *0881A35BBED5A9E6401343BE8B09C8FA5134F166 8THEXAVIER8
80,286,161 *0882D16A38326A92F297F440548256D278A6766E japanesei-ii
80,286,162 *0886C408136DA17ED1C1628F283D98320897D372 JASMINE BORG
80,286,163 *088496AAC7F76E9F47CF2FA8FAE6C05A09FE3001 JAYCEE637
80,286,164 *088BB17B8A6818A6D09E95368992EA594E11EC8C 9BABIESCHRISTIA
80,286,165 *088ED4E1E7E280073404DC6A5B54A86A241D704F jereelena
80,286,166 *088D50B22364C4513D1319612C459B301A2B8510 JERE.ROLLS
80,286,167 *0888D02BBC8C0DE063732BB3330E583BADD6BFCF JERRELL.GRANDA
80,286,168 *08864DEC8EA8FE4D1F6AC0EB925C04249B99837C jerret.johnson
80,286,169 *08896AED99DB20D7D7E0F75A34DCFBD33E606A58 JERRODSTRUCKMAN
80,286,170 *088A5B69FC29C76516C45EE84E58DD19181E9E6F 9DEADHEADGOAT
80,286,171 *088AD9F4C1F4E9E5001AF4FC9969BE2DAB9FF85C HOSEACRUMMIE
80,286,172 *08899568FF02976DC7DD408E7E460ADEB03809D5 HOSHIYA6
80,286,173 *0889F9E99F546A28489E227526C6709A2124A6D7 HOTDICK22
80,286,174 *088D5D323772FDF6C9FCD6E275EDEAD82BFD8CE7 JESS.MOXLEY
80,286,175 *088D50B0262B81AD33E4888CE016838866D13D44 JEWANJIS
80,286,176 *08829FCBC1E20E8AB54B275D9508B653D18C669B jewelsimonson
80,286,177 *08845FD2213543BA68A78252DC7AFBA3D57E7B6D HPOPEL
80,286,178 *0884297A17EDA339E884B14F9487D26C01C184A6 9IDROFILO
80,286,179 *088896EEF8CB9E817D4EB75990C6B8AF911927C3 [email protected]
80,286,180 *088CD5D6619608108F254DA4E73678F6DB667F99 [email protected]
80,286,181 *088FC0963AF4BA9880F5F98F82D40439AAA23E52 [email protected]
80,286,182 *08895AFA8298AB047341FFFAEC7F4A7F4A555C85 JIUSHAOAB
80,286,183 *088DDFE10DD79ED9C872A75AFE47E10EC7EBB7A9 jnxxmtl9
80,286,184 *088C48E61F48586C2F43FF6A8A2200CDFE71FCFB JOE MCGIVERN
80,286,185 *0888E019DB2A3D7ED0E015E7E71E21FC89804347 hugosheller
80,286,186 *088A187333D7E1A63CD77E1365D710ABB6A78712 HUMANBEATBOX(INTRO)
80,286,187 *0881E636593D1E1ED36E1EAF232D53EFBFE824AF hunnecum
80,286,188 *0884C9C7CDC452975A4799745D7BB341D425FF2E A00CD
80,286,189 *088B83B7A8CF29D1664BD8962DA63BA9CE91CC44 HYDRODYNAMICS.
80,286,190 *088FC6A333316CAC2F50D08B58FEDDC2498904C0 A?1VL
80,286,191 *0883FDF054D4EE7D3E7FBB46C9ABABF3219D46FE JONILENL
80,286,192 *0888978384175A502ABA32681016CDFBFBF21F4D JON.LILJENQUIST
80,286,193 *088A1D51CEC5EB4BFDB14E7F283E22404FF4E8E2 A3FLG
80,286,194 *088FDED2908F2B95871B553ED18D6446D9014EA7 a3;ss
80,286,195 *08874B3B539F005D7BBE95AB1E30787802276BAE A%5BW
80,286,196 *08806C90F617CC247BDBE2F0CE90B41E0C487303 A)9,
80,286,197 *088A59DE3CA1FEB1C62C8EAFA091ADEE016C743E jresearchsupport
80,286,198 *088CCA98153D5C0EAE6C0D28CAD1A4C114E0F226 idioticyou
80,286,199 *0889DAF416CDD78A21E291CBDE5508756A834973 JSHAMNAD
80,286,200 *088562A2552F093DAA6254E263E8406325A3B188 a9ups
80,286,201 *0885FFC2355D564532F08E8D9D3455D1DE0076F1 AAAH42
80,286,202 *088D444C1666EAA0DCF05C11469058A1CC4E8685 AAA$?Q
80,286,203 *088215147A440537454FA0999C9FEA2CC338B80D aaeO)
80,286,204 *088C3A86AFAB5492D03ADA3A8910A681F4980982 [email protected]
80,286,205 *0883309EDD634A4F458A47FC084ECA682B48A80F I'm.the.Man.(feat..Lil.Wayne.&.Rick.Ros)
80,286,206 *088D27558C8899340D58FC59CED683B19C404076 AASPF
80,286,207 *0881737128390907283AB2D1E280271D01F7E8A4 AB>I1
80,286,208 *088909DC0F29863B45916A801315127B664C9957 [email protected]
80,286,209 *088F9523F072E94A92BB3126B861F0C9BC52434D ABM)P
80,286,210 *088540CB1B704C6CD1B1CF62178532D080D058BB invaliditieses
80,286,211 *088EEFD91015E56F8C8885DA044A46FCEC0D3FAB abzw!
80,286,212 *0886F36A5899EBBF9DB4F4B1076E819513CC787C irshad.sait
80,286,213 *0889D885D0F2262D1233AA784A8D512A222D1895 ismaelfuston
80,286,214 *0881A6D6DF41C3F47B8A0EACBB419F2CAFF03FA6 KIETHLUTTENEGGER
80,286,215 *088029EA08045FF950599F96C77A44ECD0D5B8F3 actionbuttonsbsw
80,286,216 *088B4E7CF89AADD7A190C66E103F3BCC824F08E2 ACT-I-RA
80,286,217 *0883F98C0F029CFA73FA00FED73676B3C535FF7F ADAGIO FOR ORGAN/STRINGS IN G MINOR
80,286,218 *08834151CF50985A48C91610A726FF38EF27EBE1 It's-Just-Another-Groove
80,286,219 *0882412246205B87D85F813CB7D31E5E2CD8115F ivana.jankov
80,286,220 *0884554BD2963BEA7416C98224BDCAF0E3E3BCCD KIRSCHOFF
80,286,221 *088C51F0C2D1CEAF2DAB95818A5B446CDE19ADF4 kitelike?
80,286,222 *088106E6AD9032B171D9EFB4591755A3CE4E8F6B adventureday
80,286,223 *088290653ED2F9D66AE6CC54948B0701D769E553 jamefriels
80,286,224 *0885B1C9CEAE8FA2383460E6D9E770E0B64A81F0 JAMES.CANTOR
80,286,225 *08860708CA3B210EE56BF1A9426F2B5FB90905CC KQGM
80,286,226 *08898572E025C232FE9A3AC62A1AC172002ADE49 KRŪMINUKAS
80,286,227 *088EC95B0891CE3DF355C1A691927230271D870C AGCACCTCCTGAAATGACTTCTTCACTCCCTGGAAAACTCCTACGCATCACTCAGGACCA
80,286,228 *08812C89727FBA150D356EAD0FCE9407E5EDD1FF a:gmx
80,286,229 *0884B15DBF2580C863BA22015AC2ABCFB451B6A3 AHOREZGA
80,286,230 *088403A61E9AEB08EE4845E3CB2D55B1290806CA AHOV6
80,286,231 *088FB6687EA623994FE44CA5806830F8BB8B42CC L76.
80,286,232 *088B3EA3C515AE72CCEC4DE09A3DF459C3872F82 AIE8T
80,286,233 *088DFE6619E2DDF772DC69BA49723BF6983BE3A9 LACONQU
80,286,234 *08844910DA963C4EBC5EDD9252678E4FB77DB180 AINEMYDO3
80,286,235 *088EF4D61F349ACFC0A3B82CB2C5B17BE4A89C71 LANGUAGEUSING
80,286,236 *0882FAE6C5763D1ADDF5F9A67878A2AE2C0429A0 LARRY KEPPEN
80,286,237 *088A86AC4B7FF11438FC07D9A126CCAD5FE08C32 AKUYSNET5
80,286,238 *088B6A60C3686568AF64D0EE9BF511DAFD387150 A(=#L
80,286,239 *08872B5097ED547A8924D161C861A4DF1DA184F6 alam.zahir
80,286,240 *0887909B308F64FE9D41135766DFE7829D77F2F5 LAWRENCE-TRAMMELL
80,286,241 *088911D1FC555FAE12D3CD97E840942EB7A58D88 LAWRIEMUNRO
80,286,242 *08883A2866F12AD06ADB07A459DD21E4AD0161C8 LAYALI EL SHIMAL
80,286,243 *088D98BB880FDF53506E24407B30BC114E408EAC jessicavaccaro
80,286,244 *088CFA2EC622ADDEF3E05B0EF6BB8E7EAB042F7C [email protected]
80,286,245 *0886BA225B43B9A07663076EB7949BFF09576765 [email protected]
80,286,246 *088BFE58200A6957FC9B8F764CEA869943885E85 ALFREDWADDY
80,286,247 *088918F4C95774776488ED0E239A2CB34FEF5153 ALI.VIVIAN
80,286,248 *0888FD7B5492676BA0D82A293014C05CFF64D992 allenkampner
80,286,249 *088E6ADD073F4B0CB1B09747302E2C09E3677B4A ALLO7YPCALLY
80,286,250 *088AA652B9244310C85A0D56C239524425A0BD52 ALONZORIESEN
80,286,251 *088D8FB55C551FFEE797D3C2BEA23206353401DF jodyigou
80,286,252 *088B72A262086590C805D7EFF52C637E20CACBEF alqbe
80,286,253 *088B2938B416DF79108A4C46C7E9220F38EF01B5 AM6V=
80,286,254 *088E8ED4D7B4F27A63C4D3436943E174CD3A1459 johnstrohschein
80,286,255 *088B0FDBB3DB16861791E9EBBD387CFBF21227B2 JONATHAN.NETHKIN
80,286,256 *088DA80BE28405962E381131565950041D6684CC JOSEGETCHIUS
80,286,257 *0887C30938144DA6AEA3C7818B7F04F23B3E4E0E LEWISAURICH
80,286,258 *088ABDB03243B09CAB6ECFD4FEC3FBFCA44C5FEF j'pg
80,286,259 *088E85B9E6F73C414235738EECD622F3304E65AA Amphicarpus
80,286,260 *08836F2B4B84B7D79150C244D013E70DE2DA1F96 [email protected]
80,286,261 *08861BD6F918B45BB161C804FAEEBD91D831201E andreasaul
80,286,262 *08819E3987911F0281123FA5CD010A919DEA938B lilj1234
80,286,263 *0884B3D917C5C6462370A9A0A1E23960754127F5 LINDSAYLYNGE
80,286,264 *088ADF2F19AEE7CD7B0B1950F2A2E40627A486EC ANIIMLAVING
80,286,265 *0888212B1C544E594210818BFEA0648219C380C1 ANISSYAKIRAH
80,286,266 *088F36B45958BBDD1FB33BC95D403F3BD0FACAA6 ANOEA
80,286,267 *08886043816CC26698514828AE80A78029576102 livinton8
80,286,268 *088F9C05F9BA8899F4FE6AAE452BCB5DFA765EE9 antioneterrano
80,286,269 *088F03BB9ADB7F50C8CD428B0E669BBEB8F4330B antirachitically4
80,286,270 *0888D44B5206B4EA85AA6D3D26BF80593F7BDAE4 antonymontemurro
80,286,271 *0882AB0E802A920C5FD92A1233B3BADDB07EB15E LOESLICHERE
80,286,272 *08888EE6699CCD0684541FD15B566A7FFAB3895E katabathmoksesta
80,286,273 *088ECD475F57D518F47EB9D37941EC5912A51BAA kenfaiella
80,286,274 *0889FF4EDA6173BE9F483FFA876EF7A47C1C0C70 [email protected]
80,286,275 *0888826A3C2EA2805E7910611F73D86DE67B6D8D KENNETH.FANDRICH
80,286,276 *088498548E40238331F8C7CA8C48B5C0E32A196D kenthurla
80,286,277 *0882BCCD91C5B9B4B53B222E20A795652BD7FF20 [email protected]
80,286,278 *0886DC5F68AFE23F5E1874E3BCCF0CDC8726ED1B LONBASE
80,286,279 *088566B54C3C3A5176CFD6178E2E09C158A52068 A$PD+
80,286,280 *088358E0B6AAFC62383AE600699B196F7F4903D0 KHET DURU KLASIKLERI
80,286,281 *0887662C1AEBCA774FEB83DB5CA079021AED410F kiki.kuan
80,286,282 *08860B6541DD19220E3B83A01DF49D10D259FF28 APSN4
80,286,283 *08875080B20C6F217C73EC5253D49877F7610091 kod-"chacun-sa-route"
80,286,284 *0882B755347F398ADAA688E07DF3CBAB59E3AA5A LTBACKWARDS
80,286,285 *088512E9B0E3B8E9078545076F0AA3678BEFF07C KRYŽIUOTOS
80,286,286 *08814308A23B10349B4B6BCC2FA8E417B13B95AE LUCAS.STRAVINSKI
80,286,287 *088391211571DD08CBF26CA21110745D703A9AF4 ARTURO.HEYMANN
80,286,288 *088F7908B794B0F8B56256E5EF1298F70D52E238 KUNTONEUVOJA
80,286,289 *0884D4CAB5E67A3075335DDAE41B449DCAC76AF8 landonpavolini
80,286,290 *08835FCDC03FD03FC88E030B667FDD34660913B3 asterixpuckett
80,286,291 *08841C203E8BB7BFA845FC405EAF15A5144777A9 AT3T_
80,286,292 *0888E0AC82F2998F3030BAF40B0158E40DB7CA2C LYNDON.BALE
80,286,293 *088FD1E32B6EE4AC46C1003853040F0CD2C2F31C LAUDEMUS VIRGINEM MATER EST
80,286,294 *0887DAE7CE97D0EAC10476CC7F243DCF5FE2E880 LAURACANDIDO
80,286,295 *088984954DED2F2B12572C440CD54A05DC680E4D LAUREN-TOMAINO
80,286,296 *08850E98A0E9EA81C7A51291263FAB03E59547B2 au;dd
80,286,297 *08802992A4485AFFC45A6ADCA58F7489EB339D23 [email protected]
80,286,298 *0881FD535D7C23A8BAEF8090257C67B7ABD4B0D9 lcorwin3
80,286,299 *0886843EF1C54452EC9B419152CD5705EBD7CB96 L\[E
80,286,300 *08851DDA9597A7343F0C18FE89E3607ED3CC5E5C MAKHTARIAN
80,286,301 *088E9B0D14AEA12C8D7D7BF283C309A7A24D7D60 MALCOLM.MCLEOD
80,286,302 *088C1D6B57B24511AC17B02B6D980656541F46DA [email protected]
80,286,303 *088EB22296C2C3A35EA1F71C12E09FAB2C272ECE Life-of-Surprises
80,286,304 *08802646D84D490DED582CCD89EF3E6CD31B54F6 LILPRINCESS519
80,286,305 *08805C78E8396817EAF4D771A7D02C93CFD24237 mamudou.kaba
80,286,306 *088F6DDFD5A8C1B91395F25762D113A7F69B178E [email protected]
80,286,307 *088386B42C946D03DB828D1BBEEEE599250FB942 MARCOSKHAUV
80,286,308 *0886CE674D37823BE75AE29450AC7C4E01F4A615 MARCYBOB
80,286,309 *088CF8A2880FE7050F4FC699050982A78A645F72 LOGORATO
80,286,310 *088982A38FB9FFF074143C73A1A9EC04BF86E74F A#VZ
80,286,311 *088C30D8BF17DA80DDFB05A66570F41BF7CE6EBB LONNIE.REINKEMEYER
80,286,312 *088EEF2B0416CFB00AD2EFD2205AA3D47495D0AA [email protected]
80,286,313 *088E8532913B15B6822B4BA602016BC786ABA2ED AWPJU
80,286,314 *08852CF0C69BBA2507C551219150D16FCC17121A MARLONVEILE
80,286,315 *088853599FC92A10E3E376D046A5F96FB5A58577 lorentz-fitzgerald
80,286,316 *088D4F28165E1F7F2019A19E572151EC687568A1 [email protected]
80,286,317 *088502F0FCD99F637F33E0075DBC7AA7C91A33F6 lucaamato
80,286,318 *088068CCB5088F86D9F727545E6CF059C5E3BBA1 LUCYSANTANA
80,286,319 *088487CB93FB393ABC0B24E0853DB83952420F1A lupeharring
80,286,320 *08895619ECCCBBB32F2251DDDDE42EC805137394 LUTHERCASSLER
80,286,321 *088EC070BD1C967C4110DAAD42F380F8E17342C3 lutherpyrdum
80,286,322 *08868D591313610293122ACDD8B0A6A4399E4819 lyndsey.welch
80,286,323 *0889FBDCE725315425566D8874D2B43681B102E5 lynettemitchell
80,286,324 *0880FA9F240B1F92B75E7CD82D81CCDB85D3ED1B B0L
80,286,325 *0880977252144829236870EA9B0A795EAFC693EB B;3Q
80,286,326 *088EAA438C3DAAD9BB5ECA05CF35429396CEAA85 maxwellridlen
80,286,327 *088C9A7A8057F5F5A2F91AF86FE66233ABF5ECC3 MAYNARDSCHULZE
80,286,328 *0882844A1C04AD6D56826AF7F2C7E504A734FAC5 mazda1whateve
80,286,329 *088FB5CE2B018A35B73F0755BD72324C1212689C mactrivette
80,286,330 *0882003B27ED7CD3AAD98BACE6A6EC821D846AFB babesias1
80,286,331 *0885AD5A9E5E1B2B660A9AE5807C0A971540C66F BACH.ATTRIBUTIONS.(FEAT..ORGAN:.CHRISTOPHER.HERRICK)
80,286,332 *088816CB9C83BF69559EEBAD9FBA2C4135158D1B [email protected]
80,286,333 *088666515786788CCCCD7B003E2C5B61758AC458 makeyourparadise
80,286,334 *08827BCD65717C4B2BC8D09BDC9231E232503E42 MANOUBA GOBERNACION
80,286,335 *0883081E9327097214CFA425477C22F25E49611E [email protected]$
80,286,336 *0885B91FD7614A86E90767B227E8B52DB9E81A70 marab0u$
80,286,337 *0884195D5BCE8CCF4C430F042F9CB9F6F145D9C7 marignyenorxois160
80,286,338 *088A2082E13B871DC587621A54C0FC8C3A3D3AD3 bbcb
80,286,339 *08851AC50633D9F3153B7FF08EB8D17BEBECB7D6 BBEEZZY
80,286,340 *08885F6B0E12B26811CEBE7E5802BE4B2719146C Bblophle5
80,286,341 *088177BF1B20A14A80CC68C30ACC34F46E784A39 MILOBALLWEG
80,286,342 *088EE2F15B6539FBABAA75B37A83D2716901E006 B#BQI
80,286,343 *08817AA771B3D027CB2FF9FB9E78036C84E10A67 bdnds
80,286,344 *0882F25E1B25CFCCFE79FD3322A65097EB931006 [email protected]
80,286,345 *08803D71880FDCDD419E472D4408D2259B1CAFFB mockups
80,286,346 *0887B5C55A4B5A3AA171698ABAA4339576C038EB MOMCHICO2
80,286,347 *08811F8FA6A014C03A1007E508BE09A45FDA32A2 b&eg
80,286,348 *08874461721E4B3BDC5DFAFDE1029203A32AFC90 MAURICIOCRANMER
80,286,349 *088382871EA141D607886458D8C8D73CDDDB8C6F B(EK?
80,286,350 *08817CF626D85CE6109C2376BCB7947449EC0DA4 MCKINLEYSCRIVEN
80,286,351 *088D212D0700750A63CA9BE159D67519040C24EC MORRIS.TAY
80,286,352 *0880BE6FA4D4405126CD1486B2F5A96E7EAD66E8 BENTONPUZINSKI
80,286,353 *08803921266F9E3ECADC4124D5F255849942C0B2 !MPO$$!8!1!TY
80,286,354 *0886949FC22A7855C76564BCF9BAE5BD676EC62B MERLE.CATANO
80,286,355 *0880717735D165591915C4B4C5886EA3F811D7F3 BETROCHTUNG
80,286,356 *0886A9367CAC8D4B651746DCB0DA90E11A084EE6 MULINO
80,286,357 *0885298407E627907245C6F0F77F743EFD8FD8FD MI5AE1
80,286,358 *0885D61CF82DD3A182C0072D379826362C24E663 MICHAEL.IRGANG
80,286,359 *08836C768DCB42DAB64E6415AB90C8A1F319214A bgjfg
80,286,360 *08897874D751BF33776ACE0E6EACE00A41DDB6F9 bhf2u
80,286,361 *088F27C399BCF80C44BD5445939983B89FF5575E MIGUEL-EDUARDO-PASCUAL
80,286,362 *0888B86A3999EBFBDDF2B1A98FE742242A8AB549 MYSTACEY51
80,286,363 *0889162561B72A47663ABD0B01FED8F1F7D8D454 BI6;3
80,286,364 *088939CCD6BA3A390FA4CAFBBBF991F2B62D25E2 MIKNUYH0
80,286,365 *088B43D3F618047AE1E4DC6710ABD2D70D501263 NARANGGA
80,286,366 *0884A164100C9D651FAD333DBDEF9A58E5F78E8E b+ip)
80,286,367 *088600879A38B90DB4FEAE3F0424BA5702578D0B M`IW
80,286,368 *0884D041BFB210C19A3B09F30863F56A7EA1EBD2 mktt25
80,286,369 *088C05F04A21A2C5037D4DF3582BDABF7434EAFF NDEBORDIGHERA
80,286,370 *08830DDD25B4A63C29C1A6BA8122EE60D9E7F5AA modemmom9
80,286,371 *088D1EC607E6243554C6880590E1C53D22A76C69 nebraskailoveyou
80,286,372 *088ADD8634C3AA4414A9536CAD90AE48A0C69105 B+lL
80,286,373 *088AC36AC4A2B17ACC2727DA40E9EEFE695B7660 BLOODSHOT-BOOGIE-1
80,286,374 *0885E374153B5C9E8B45D236AE92A00CED43DA1C BLUM-STYLE
80,286,375 *088B55EF82664150C777679F47D204AC13FCA266 b+(lw
80,286,376 *088353C258E8FB89DD2AF5BA393DB2979ADA6899 montylicursi
80,286,377 *0883340DB8B23CB6CB9E0A1ED68C9E2E95DCCFB4 MONTY.SMETAK
80,286,378 *088AFD9DCCB02D3F06D48CA24D6A33416543CEF5 BNBNCOX
80,286,379 *088F83BC15AD77472CC6A56AFEAA7632C2911D5D MORTONVELLER
80,286,380 *0882DC2D03346E8C395B0BAD555DC8C0B02E9746 BOBSILVIA
80,286,381 *088B5EA4FFC70C99F7B848A93034D00B7C152EDD BOELM
80,286,382 *088CAE0B217A32B64F3A8D3225B178634418EDB0 BONUSSHAKKI
80,286,383 *08896A112A95370F063A6A13056167FA9B50C74F bootwelsh9
80,286,384 *088EDE6F9B97D46A18B3BAB5C18D152CB9E032F3 [email protected]
80,286,385 *088107D05780857E03D4E4B9FC86698E307B46CC B"OS0
80,286,386 *088DC57D7089013D38796831798DE9FAAD9BB443 MXSJXLE2
80,286,387 *088158350A93F0F2CB5003404937FABB262E5E09 B:Q(X
80,286,388 *088919C8D55D49FAA6A8FCA809EF2D94DE2D107B nonsentience?
80,286,389 *088D0186B79F28CF245434D448F472815DE9619A briannacarlton
80,286,390 *088BEAA40E396C2D6EA50DF9EAE7DA5FE4DADDB3 BRIDEAU6
80,286,391 *088D27A411E7C89E5A4A1B700315B1FD467DD1EA brjby
80,286,392 *0880961FF8C07CE9F2CC8FF6D69F08449C9FA8C5 broderickulberg
80,286,393 *0886AE0701A0A10FE79ED0BBA3148287774A57CB [email protected]
80,286,394 *088538964002DF11A058AF5D327BCBB61D864882 BROOKS.MARTER
80,286,395 *08844F0A8F4B96BC82EEEFE48D70FC10A799F9B4 NESTOR.DAMME
80,286,396 *0884487C700189CCDF028F9FBA93F8542A788E0B NEVILLE.YEHLE
80,286,397 *08893561225DB967BAA10E88E6D117A81D75069E BRYAN.DELANGEL
80,286,398 *0887506DEBF66A5C99A205FD7516B2245ED46614 newtonjahnke
80,286,399 *088E40D096860FC3E8E897CBA4D7BA5FD52C04B9 NICOLETENG
80,286,400 *088A90B897300FA684D3177782E5EC450CCE14A0 BSWXERRBSW
80,286,401 *0887A5C3DA90D6BFCFA398EC33F42C842817EA58 NIKITABUTTONS
80,286,402 *0883A7476B0D5A3585F774020EA7A24F618345C9 NOVEMEBR11
80,286,403 *0883AE8AE3A81BDE248586FF8A80963DC27324A7 no.9:duo:leilaleiladieupuissant
80,286,404 *0883746886A9B172488D2DEBCE8F3ACB9432014A [email protected]
80,286,405 *08835B32265B2E9DE45924A7E7DCC0BF3EF84459 buw)+
80,286,406 *088E88374AD3B690877FF57FD5F56FE1F8905ACE ODHLSTES
80,286,407 *088D778484B69CC9112F759D147CB833605EA64D ODISBUMPS
80,286,408 *08844FEC2F94298122A342D910AEEF5A675A99E7 OFERFULL4
80,286,409 *088716D835E327B6E428950D27543037544A3ACB ohkv
80,286,410 *0880D4A6F6D5032BFDBE3FF8FC2830B570438C1D oliverphebus
80,286,411 *08890C021D6B7FEDAE3AE0D21D8DDF98CA158ACE On.a.Slow.Boat.to.China.(take.3)
80,286,412 *0882D4AC8A02F6CC955FCD06EF2584F90A54A332 ONEALRAPP
80,286,413 *088BB5FFC2F02C0A007E1A47DE82A7462129CB3B ongelukskind7
80,286,414 *088DBA2452E9617A6887A138CC1A0CA042B8921D ;)o~o~d------b
80,286,415 *0885FADE20D90143E093A5A094AD49BE43F521E2 OKERECHARLES
80,286,416 *088D3D46B03CBB2DBE7579B41441A7E9C99A2D45 ORNOIRE123
80,286,417 *088C9B6E62F27EC1EDFC6A86BD5D1B251B279918 @OLSEN
80,286,418 *088CD86BBBB3F52E062FF935F595819777F6937C CALKINÍ”
80,286,419 *088C38B284C5C5198985B7DAC26A4832944289F8 OT0L
80,286,420 *08876357E54C61A38CFF802127994E475CE06667 OWEN.SOX
80,286,421 *088C33F97ECBFD544F34513CC5ACA37775B2354F ozer45
80,286,422 *0882CF1476055A1B007EFBEB6DA60DAB432CCAEE captainpicture
80,286,423 *088BDDB56B4E078EA2296BE14E3C9849338C45BC carmelobyro
80,286,424 *0884D427861DF79B574625C83D6BC44CEF9028BD CARMELOIANNIELLO
80,286,425 *0888A1A28D3F218C67A4A66ED1983485D2288D92 [email protected]
80,286,426 *088EDEF4C5F8373698DB03EAE439FCC2143C4475 CARMEN.HIGLE
80,286,427 *088F92937EBEA8DDAF70FFDAC48627401113E0D1 ORDERLYS9
80,286,428 *08840DA76A98E2C7727E42A9EDEAA20B4852ED25 oseline9
80,286,429 *088B2BEF5547F3E7CCCFC085930BB19628B8EE15 PATRICK-PLASTICS-INC.-|-CANADA
80,286,430 *088AA24CD8E37B75D1DC2106597C90FA743048FB CB0Y
80,286,431 *088AB80BA474DBAB68F1B804FA2FA039053FADBA CCASTMM4
80,286,432 *0885459CCD4989F453BB15A24F57291C33DB3D3E P1K4H4CK3R3U
80,286,433 *088A327A7C1A1FF80975B7DC956BB861782AE33B CDSG&
80,286,434 *0880DD713D8A16CF930A52FF9A67A80D6353276C CECILIA.SAN.JUAN
80,286,435 *088999022118B89E032DC619E53E16946903A829 PENERTON
80,286,436 *088148403AF84D17AF21A510FAC47FC3FE4FA9B8 [email protected]
80,286,437 *08849C5028AE58F1221483D2CFFCB787DF3C520C ceeun
80,286,438 *088503C74DB8AA20EC82625847540F2BD1C0EDD4 PERILUNE
80,286,439 *088E4153591330F2412A61B9B6EFCD593C11D472 PETROUCHKA-APPLAUDISSEMENTS
80,286,440 *088D71B08D2AA7D8A4372DBD617A9FA5AE08A36A [email protected]
80,286,441 *0889B05B00FDF855D091AAB9396AC079347052AE [email protected]
80,286,442 *0883C2D5DA167DB7D0AD82AE5BBB6F1C4BADFBD9 phillip-roberson
80,286,443 *088755D93F1EEC15CE4DE4E9053ACFF4E0171E48 PARROTTALKSHARPSHIN
80,286,444 *0884EA6CD452ABD42BAF6115D35640AC24BE49F3 PHOENIX1SARAH
80,286,445 *088ED03C561FF9344BDB88F314BC1FA8822B70A9 PIGMAN6?
80,286,446 *0880B63C335FECF82BBF915FDE916048088E3E2F P----D-~0(-_0)
80,286,447 *0885DD0B494DA2492B0A89C20EC1B4C1926719D8 p##d.~)8(
80,286,448 *088714FCA5568BBE814E1579A1917C20BBFCFBFF PDJB6E6TJ6
80,286,449 *088673840D617109583EA4BA9427DA1D9FD4A579 p####d.`~.`~uu
80,286,450 *088349272396F15EF5E850368A60D304176D0D30 [email protected]
80,286,451 *0882BCD102EB296DA08BFE1B8F0D70755FEDF95F PETER.FILARY
80,286,452 *088E348CBC7B86EF44AAB01023E9926CAA67700E POKOJNOJ3
80,286,453 *08809C6B84ABF11A6133F74C7E757CEAC0B01DB7 polizzionlinealterv
80,286,454 *088B8067F745989E775C2BD25E75BFC88C6F150B pondring0
80,286,455 *088458462F0BE079873A2E414EA40816CE09B14C PORFIRIO.SCHILLACI
80,286,456 *088BF1FB68559A61D6EBAAEB3617D35472A9CC3C P##P-~O-~o(>_0)
80,286,457 *088F5A6E52B3704FCDC4439BDC175F156CE22E06 ppravky1
80,286,458 *0888003903E86511942E25B8AEEE41AEEEF2E1ED [email protected]
80,286,459 *0882A26EF4AAC5E2FD9C948C2DAC0626E4C7E084 PHY5!O9NOM!5+
80,286,460 *088D0E8B757F1EA73B8613093E92F91D44D7C72E PIECZĘCIĄ
80,286,461 *088FEF9F4A1DDCEE0C821AE3F847D303DC682D96 procareer
80,286,462 *088AD95126C3279A35BD61468B033ABCCF79B24A cjux
80,286,463 *0889BE5BB567BDF8C29262E7B0FD661501BF0BFD c(;(l
80,286,464 *088F836EDCB18D3A11DFBBAD3C3CDF5DE3AF25CC [email protected]* *SPLAT
80,286,465 *088AB789F8B466D762A8C25ACC6D7CD27DC8DA66 clarkgarrity
80,286,466 *0881C23A8DF22296ABDB3FF6F72B2452FB8C5416 Q)[@
80,286,467 *088C1876504EA1129E15E0B4C5241D5F9F9AC6DA Q=====>~0 ~O(O_-)
80,286,468 *088A053C83C4C0BD666681C2242C9CF7567268C7 Q75578
80,286,469 *08821AF5177FAE8C25B94AE01FA4A0F913A751A8 [email protected]
80,286,470 *088845F85F91115F4A39BEAD4BEDAAB171E7919A CLEOEVERSOLL
80,286,471 *0886275EC6336BFBB62022DF602A5BECF9082E35 Q-----D * * *(>_0)
80,286,472 *08883D3A9E3132A2C65D9687A248CC94AAADAF16 CLINTMASDEN
80,286,473 *088BB2535A62CEFF71D665D157CF61D2AC04BD54 [email protected]
80,286,474 *088EF94FB423B357D0DE4D71FA6430318589358B [email protected]
80,286,475 *088074632356212E546514FA73D838C4881B4543 QIKDNAB0
80,286,476 *08893E5331FD80CB5D6D49B167FA4A394E0C60A1 cm~d
80,286,477 *088EE1770CDC2188533391C5B755BAC449C71A55 quaggelhudds
80,286,478 *088DC9F21B18E66BEB142D0AAA88851BE531E0D2 [email protected]
80,286,479 *08828BFCF25D36DDC81F285B67BFEBC025C10754 quellaalleuq
80,286,480 *0884D391FC59AFFF17C48062D0345101FD5F4BA3 QUOTIZEM6
80,286,481 *08840B798117CC40B53F66F72635D58598F8EDDB [email protected]
80,286,482 *088E8A67595735BB667DBD9D6998FB94034E0539 coiffy
80,286,483 *088F8A3FC8FD936F323B03F2721E311C38FE0B81 [email protected]+OD3$
80,286,484 *088A8ABD3DF63907F4E3E1F7CD8F7B3F37C2A15D qualityfrankie
80,286,485 *088580F422A5A597A66A83AFC0338B4FF05368AD [email protected]
80,286,486 *088E9E1218EAD0570AE247DBD2779D45B35183E1 Comein,comein:I'llgogetafire.
80,286,487 *088031231C3E518BAE506607C9BB723CC045E3D4 RAISONNIEZ5
80,286,488 *0885207F6149C3C0B813CAC004E7CDBEAF2CED5A [email protected]
80,286,489 *0886721CA0E49DDD61936BE9B88C8AEB8AA95848 RAMOWKING
80,286,490 *088B052281F376045F486ED9ACE17E223BDA15EA CONSIGNAVL
80,286,491 *08892910AF968F3451AEBCD3E0A65A00C36656F1 RACINGHELPME
80,286,492 *088C5A0323EE9585581D4A5E9478DB0C4576BA0C coppia1
80,286,493 *088FA9954191713CE9B724EFA0BFEDB76E50A2A7 RANDELLGERYCH
80,286,494 *0889EA2D7BB2BF8E42DF1A7F07A96A4C311B80F5 Recitativo:-Ginevra?
80,286,495 *08874C2EF417A200BCC4BA9549176C5013E495FD REDAELAR3
80,286,496 *0885F7FCBA5F46D4E155EE5AE9C0A767D45D4947 [email protected]
80,286,497 *08870B2E126EF452E874FF94145CA9516AE32BEA RBERKVENS
80,286,498 *0889CDAD756A69AE5802F844FCC6AD956E9E6FB7 coronapa0
80,286,499 *0889C2C1122963AFD09CD65B7EE494C3024EAC66 rcf4
80,286,500 *08858A8424D836B1834B76520B39B5A1B98CF505 RECOMM$$ON
80,286,501 *08824751AB81643997CF0DF7F14FB05A499609BF retroc
80,286,502 *088A3B451FF69B8F175D061C3DBC3A42AFCAB7F9 richardlupacchino
80,286,503 *0887725B10FB93A2FA8CCCF46B1DC13DCCA829CA RICHARDSIAE
80,286,504 *088021497FD15AA16E5697D735458559397AC651 CRAIG.THIELGES
80,286,505 *08856BAD88D6C0D7CF2C2C8F447280B20B25C998 cranking-the-sirens
80,286,506 *088A876226363BE90474F72F7EEA02BCD46AAFBF RIDEROUGHSHODED
80,286,507 *088195C32D00D29A713B961BBD0595CC61945401 riodeoroed
80,286,508 *0887E7FE3C6CAE317AF75451A6F2A721ED0627BD RNVLLNT4
80,286,509 *088ED2E702DBE471EF1CBE3E047A7B6866C9EBFC CS1Z-
80,286,510 *088BD6F40CB95A1A4642DA16049FD33B07DE88A6 ROCKBANDJAPAN
80,286,511 *08830CEA01FFF38287E2C2AC030782956AEA8E28 RONALD.SHINABERRY
80,286,512 *0881E88CC6A7933C4D50AB1784E5EEE4ECE02658 ronda.lung
80,286,513 *088EAADA95786026ABC85604C54FDCCD718C85DD [email protected]
80,286,514 *088FCEB565836236C013284D8E24234E79FBDAC4 RETSIELG1
80,286,515 *088DECC333E8742E7657C5799ED8D4C2C4E7292B ROYCEPUZON
80,286,516 *0887EF11C9FB5F89C58351C2CFCBCC48A6716232 CTRMNSLYING
80,286,517 *088FC090DC95261081B495644620961C08127711 roygilligan
80,286,518 *088EB9500F6F051BF10BECE70A9D16A2A13CAE0A RPTERAIENT8
80,286,519 *088D3BC788630B64D3AF89E3C461E67D25568025 REYESMOSSIEN
80,286,520 *088DC99E7BDE10C38ACC8C0FA6B975B2F10DE64F RUBENFAT
80,286,521 *088F4C1566C5C22BAC74A883B236F026DC9576C3 r<=h
80,286,522 *088EFB653F6F8257413405AD19CFAE4BB01C2528 RUÏNN
80,286,523 *0882933DDA87AFF8EAC99B6CB2B1538B39F7F2A7 [email protected]
80,286,524 *088FB7B63B51AC2461BD8307C4D8CA35A9ADFDB3 RUNTERGESCHRAUBTER
80,286,525 *0888D9A1194D47D55851E19DBF89B508517792C9 RYAN.HAUSKINS
80,286,526 *08836B7AD36B2B70B5D43A8BCD12F9D1FC1148CA CV5%
80,286,527 *0886D4D6491DF5EA95C556D0D599B7499C844722 cwgh(
80,286,528 *088120C2C2AA3655D0CEA0EA6FBF358999BA1DED RIMNDENS2
80,286,529 *0884033683C145B2F7ECDC46B9BAE0C2222BCA86 cyrilreuss
80,286,530 *0885546EF6F9A9C75D23F68BECC1E53F9967D0F6 RKOHNS
80,286,531 *088910FCB64836AD60E8C4195DC47C66341B0C42 SANSHITU9
80,286,532 *088CCDBA7CB92A74B840C800FACBE68EDCBF4EB1 ROBERT LUCENTI
80,286,533 *088E49D5135C661381B84647AD0D2AEA01A66EBE D0EU
80,286,534 *08878768BA920C1DBE0BBE038CB2FF1F422DB859 SCHMELMER1
80,286,535 *0888517B360EC2797A2419B59611E8ADF1933A38 scobinaceus
80,286,536 *0885157B495CB549A73FD0413ABAFB7CF6EEFF2C SCOTT-SHOLAR
80,286,537 *088962BDBBB4D560575294FD09894ED1F7566EFF SCUTIGERININAE
80,286,538 *08818D4EB252D0B9EC6FBA185E143CE3D568ACAE SELBSTGESPRA
80,286,539 *08859ADF1CDE1716F74E3E2B7DD31EE25BD32574 SENRESOPE
80,286,540 *088D91BF48576C1A2D03B8873FE1A039DA85C261 SENYERA.CATALANA
80,286,541 *0886C7B43CFCC7F1A5FE634820FB44EF9D73F47A da:,1
80,286,542 *088D35432EED83F934A2695C6C2D3A3A5D797B99 DAMIAN.CONTERRAS
80,286,543 *088D3B97C93F9D4E7C0F796D17C5F44F66AA5CC2 ROMEO.HOVING
80,286,544 *0887654FEF850E4252E10B348B1A7DF231157E8B [email protected]
80,286,545 *088FECC66415F933092DF108FD4984A7B29B6E60 RONNYROSCUP
80,286,546 *088CAF85C1467586CE8E98866EA56F6087C2CB4B shanna.viola
80,286,547 *08829DA20307BDC1DA3B513FC787CEB19D78AE77 DANNYLOCKABY
80,286,548 *088F83D9390D85189266F04228467F0ECE1A01D0 DAPHNELINDSEY
80,286,549 *08861DF5216DE0F45ED62954E835B6298BBC6792 darnellkemick
80,286,550 *0884ADFB83A674603C2BBD18C9E05DF7DDF1A35F roscoemiltz
80,286,551 *0883393D8E842F9E6590938263CAB8A35F89C1FE rossgottlob
80,286,552 *088E1D20349AF881A624B26C07ACC051274BC1DE darwinbuechler
80,286,553 *088C4874B79BFC3D6E537BAAFE8291E5C08DEF3C DATZBSW1
80,286,554 *088105AFFC8069C42D78493D56B1D2ECC3B61B12 SILAS.BILLIG
80,286,555 *0886DBA700F693B155A181B88076335DAE9D3C3C db7/
80,286,556 *088940F373EFC7CBC3D58E311AE58C56E2CA3C3F singulfs2
80,286,557 *088A34231FB1A41FB4A8C1480DAB2313EFCAD788 siulsreving
80,286,558 *0883C9DAE7E9816591E5B742445B4A5B13E04736 dc/ri
80,286,559 *0884B32BF9108C7BFC4EC68CB6C3D39B2BC1E01A d,cxm
80,286,560 *088EE5041E9F99E25516CC91B9E48D36C0E72A16 runtergeladene
80,286,561 *08882AF3FA137CCC7E5FF98FAE61FA5ADC0DC53C SKNHEDSFEJLENES1
80,286,562 *088C2B8B177CD7A767D4B029FF17CC288D56D921 skrevne.
80,286,563 *088BF12B17207F847FEC358F1C09515FE356C0D1 delaney297
80,286,564 *088C682F0EFD733ADAE6AFD5EDEAFCDA788BAF65 SNEREISILAITINIER
80,286,565 *08843B72977A854998AD5FA65DEED3FFC630D41D delegna
80,286,566 *088A644E89504B107ED39723B424F81DB8C40502 DENIS.DJURIC
80,286,567 *08848B1D21037ADE9B4C9E3721E93FA3AD281C28 SOILLESS
80,286,568 *0889E0210A6020C67AA5C50093319359050E15E6 SOLOMON.KOEPPE
80,286,569 *088178B3F0B7CD57E0CC2725F49F48915E03FF8C DEON.STEFANI
80,286,570 *0887FC2FC9D238002E37276E7C626494A8E7CB50 DEPORTES-DANIEL-BILOS-RETIRO-FUTBOL-PROFESIONAL
80,286,571 *088228D6FAD9CBB1641A24AC8787B326A6B67E26 SASTAVLJANU
80,286,572 *0880A21F17A53793A7D267829AE9AC2219ED7292 SCHADENERSATZFORDERU
80,286,573 *088943C3982BD8E7D6188E38263DE341E7B094FD SCHOKOLADENGRUNDMASSE
80,286,574 *08887B29B49FC9D7AC093FBA1906D3530B3A8885 SCHRANDERHEID2
80,286,575 *088DD9C20D7E9EBD56C6FC3587A40B9B4980C9BE dextreque5
80,286,576 *0887CAED42B5E95D57F4E6C5276E7D931C0BA3DB SPIDER78
80,286,577 *088403CAA70D937B30DDC39C4259F9AA83D68FB5 SEEPROJA6
80,286,578 *088B59B7EAF292888D22C37A7AB19CE593B90632 Splat o~O~<p
80,286,579 *088DC2CC8CA5D9BE1656C61DC4968BFFB8C9D71B sportlets
80,286,580 *088E356588B2B80979D51FD0CB116057990947B5 DIOGOLEITE
80,286,581 *088F9A2AAF72E0049AB51EEE1F8837473AA5BD54 [email protected]
80,286,582 *0888B46C7072B4C58CD0DB72C3A4E6FE18028C4F SHAKILAHASAN
80,286,583 *088DE0A8395377035DBEDC66AFFD8CBA0544E4F7 SHANTICYCLONE2
80,286,584 *088C990EAC35E3F1FA376B7D2A14B6536082C9CA D?J6F
80,286,585 *0881362F9A22F2CE2EA401D523C078C877276B0A SHARONQUICK
80,286,586 *0886B01384BD119369B2FDFA403CBB3240C8550B [email protected]
80,286,587 *08813B75D7ED001577EED0913EC2A6428E65C79E staraly0
80,286,588 *08838D7CBDF93E5F73F23FDAAA19FD29E4A5C18B DL6?O
80,286,589 *0888B71E7E0F45312B327A3A0D362726CB83F86D dlnp,
80,286,590 *08819D52E5BFA805E3A5E9EE7347A5DFDF074188 DOLLAREI
80,286,591 *088FCC6E42768C5C368E0B99C776773E968BB260 STINGRAYFRED6
80,286,592 *08834EA842F8DE3A716A23816661AA664E788E6B SHORTPOSITION7
80,286,593 *088645CB62630794D5051D521D56BB6E9F634939 DONGBRODIS
80,286,594 *088D9346E827A908E62432B664F48787CBD79022 SHUNTIA.RICHARDSON
80,286,595 *08815DF12D8CFEB32641507895A9953711A4F533 [email protected]
80,286,596 *0883DD2BD4B51092D0C56D9A1EB2CE88AB4EB9B3 SIDCAPALONGAN
80,286,597 *088FA66A29587C61761ED5BD4B5431A4E8C725B7 DONNLOUNDER
80,286,598 *088C4E36BF4E4699B7AC11CF30DC5A9F5B803DE7 donnystauber
80,286,599 *0881C1E3F7A5E785D00E031F4210C169E96A2733 STRAFOGHIAMOCI
80,286,600 *088C4D0746D6363FF3216EF9B88153CC7B973087 STRAWBERBUSINESS8
80,286,601 *08877C5B5D85F46F93A572B273FBA47A761A917E D’OPTER
80,286,602 *0888185DC126636428E81B385AE7580E906649FF SIDSCHOENBORN
80,286,603 *08808BA907C577A5FCF830A6238C88A4D0D0C418 STUARTEDWARD3
80,286,604 *08818316A1CC4377995E4DE57043C1250A745ED5 DOSMERGE7
80,286,605 *088BD3EA0BB2D03D538E9AE02C3624FD2E42D8BD SUNGLESSNER
80,286,606 *088431ED5489E799D286B9B8504060DBDA1E37D9 skancesing
80,286,607 *088D3D31A29F05B78CD3DF387A802DFAD4FBC41E SLETROWGNARW
80,286,608 *08897B9CDEE5350C29F280A70AC0AC80EC0DC97B DRILLMEN4
80,286,609 *08891E417FF4A24C9F61256F18A254A3EE7AC96B SYMPHONY-NO.-33-IN-B-FLAT-MAJOR,-K.-319:-III.-MENUETTO---TRIO
80,286,610 *0887E528F91FE9236CE9F1DBA5C2A8D48FDEEF53 SYSTEMREDDOG9
80,286,611 *0884919394DDFFC5F77A3F0602039EE9FE054C87 s.zhikhro.dgongspa.ranggr
80,286,612 *08823834AF6E8A567BDC9493CC3E55E2C2B3BBA1 [email protected]
80,286,613 *088A9229AB4C1ABC3FBD74E4B92515AA71077498 SOILLESS
80,286,614 *088ACB28471E53606C2B124454C7A16E094A02E9 TALK90.241.55.90
80,286,615 *088AA1A169ABF714D5A1330DC7A89DEAC1BF7490 D"$VC
80,286,616 *08867C11FD8441C5FAABD5665C4B24A7BDF60644 SREPOKSA
80,286,617 *088069084BB088EEB2313BA43C56D68A6C02C4C2 D&Z9
80,286,618 *0885EEBA8010E2A5BEF42411D6EBF82EF4443D3A [email protected]
80,286,619 *088A778E4DD8D1D8F1F939F41F70178B1AC2D7D3 dzn#
80,286,620 *0886A905429BB35A381876A548DBC90345E31B65 STATISTICAL_LEARNING
80,286,621 *08801AAFADAC3F6CF246577BF55F8A4734F236EC STEBUEX
80,286,622 *088585DA9ED654020C23784B305C5F17C95F4756 EARTHBOUNDBESTGAMEEVER
80,286,623 *088F8C442B9359AAE9BF151E8DE6A906333F593F stevietorrance
80,286,624 *088C9AB636D9FEF600E19E55152E063037C0E8A8 edfn&
80,286,625 *0880A3C30FBCEFD7624983E49D2FA0AB263A8A94 stlanley2
80,286,626 *0888D82C26953D915B76BD3E1F0ECEECFDD32962 THEANGELANDTHESHEPHERDS/GO,TELLITONTHEMOUNTAIN
80,286,627 *0886FFFD7FA4D418436EB29AD556728B5EFF9C74 EESKTNYT1
80,286,628 *08812FAC6775B9C6448FA44B9270335D5101F7D9 STREVSAME
80,286,629 *088D55AC11EB9406B4774EBB0C00032723FCFFAA ef..m
80,286,630 *08895B9C92BB97730029E5D2BE27A5EE46D27ECA THE-ELEPHANT-PRINCESS-SEASON
80,286,631 *088342620D959905265C5FA4AB34BF666DFCDC5B THE-MAGIC-TOUCH:-AN-ANTHOLOGY
80,286,632 *088193F036F9F95D74EEF3AA824E711FD1411A8C eingebend2
80,286,633 *0880693B805AED30D04EE7D8D2EECFE3688CBE8B THEPOIUYT36
80,286,634 *088016A6371C94D660178A4A926D4E303252F528 SUNRISEWHATEVER1
80,286,635 *08875A9217B1DDF9A2E6ED5DA34C426D55495D14 SUONORHCONOM8
80,286,636 *088C26D87E23E4CE71E1ED0EF467562BB299921E ELABEB
80,286,637 *08820F25FAE0125318E8DDC90AAA5E94276FD733 eldridgebutz
80,286,638 *0883E5E02789964F49B5E3F8280FE771B0AE885C electricthx1138
80,286,639 *08873FEA58D2895A46DE0190A7A5D584F23CF6DF thinapathy
80,286,640 *088BD8254AA2132984246707B4DD32004061F500 THOUSANDSSTAY
80,286,641 *0886E7D95BE6285BDBBE101F8FACD8BECBA1B26F TIANITA8
80,286,642 *088F928702040F985C0C6BA653972BA35A196161 TIM.FITZSIMONS
80,286,643 *08815EA58EF0DFD7E52AAF5CE51C15182237ADE0 SWATIDASH
80,286,644 *088824AD94EB65DCC964FBE54C50FC00E97EF24D sx2z
80,286,645 *088B903EEE723E88D0983C2EA14870868ABF2720 TLESKATED
80,286,646 *088FB596032EF89553495E66771BE12A69A3A44B toegangskaart.
80,286,647 *08846F0222D07B6BCA94D8D78B631ECE837E5B71 tomasrisko
80,286,648 *088A4328C08B9D74494802299B3500EE463C1064 TOMGIRVIN
80,286,649 *08820207DE670518BF981DE959BF4D732F417D16 toneyyusef
80,286,650 *08808DBBCB71B457D210B6F065EE6D7EC3E23704 emmettzezima
80,286,651 *0883510D90C41D7D3BD67BC51939C4A03E8B840D TOOTSIEBONER3
80,286,652 *0880E205155F15BF6501E3ECBA76D0FBB2A2E5C8 [email protected]
80,286,653 *088489690AD4CE948F4547200CE1BC763E7D0413 TAD.SCHAEFERS
80,286,654 *0886CD106261F85FE5D7D60C1BC8266133B363DA total.void
80,286,655 *0887F932E9BFC839A1D497B53F14B5C72AA9823A e`[n=
80,286,656 *08850E0FF82261837BB342C25F37551143683495 TỐT.QUÁ.HOÁ.LỐP
80,286,657 *08895DBD13D64CC5346920F97A2FC1AB29E0005A trabando1
80,286,658 *08852B4D4F8BB07879B436165EFEDD7AB5F78107 TALKJASPERJ
80,286,659 *08849C9284A23042DF3C4A49BF95D230963BF21B TALKSNIFF
80,286,660 *088C1F972D6FBF375A2EC4916BE8E7AC0C8E9F30 TRAM.CHUNG
80,286,661 *088800DE5832B9789C3F3339CF147FE291F02415 Trameln9
80,286,662 *088D2689B3A1856CE4C86F36A18F93A67C92DA64 ENRIQUEDIGGES
80,286,663 *088B74506E352D584C78FE8E102B4ACB2B1884D2 entelevns
80,286,664 *0885AD5C091F8DFC96E33A685DAF218313FAC18A TRAVIS-EGUCHI
80,286,665 *088DC3CB654396B910564DF85C2E7DDE8D30198E travishubbard
80,286,666 *088B6C69C25E4EE0ADDCF51BF90DE488E34697E4 TRAVISTHIENVU
80,286,667 *0883DFBFD309A94611694C83F4BB2A6F142057BC [email protected]
80,286,668 *0888F8EAC0278B034619A819BD78499E40B5A1EF EO(VS
80,286,669 *088A523BB0C34E89D639F003D552B784E4ACCA8B TREY.JENDERER
80,286,670 *088B85CC6C8570E1696382505C613BD0493C6BCB TRICKIA.ALEXANDER
80,286,671 *088C6EB4842BB9BA099A5821477157FCAD2E8574 eq)rs
80,286,672 *088763B578CAB882472FBA3F41124540844CAA38 TEGLTAG8
80,286,673 *088326BB1DCCB405715209EBFED7CD7905945FCA TUQDAH
80,286,674 *08840E9F90AC91E1CDA6A190DE6D79E1A7EAAE81 TURCKEN
80,286,675 *0885CB11C55F3D328D9C8B53813A244396FCEEAF TEMPLATEONRIDE
80,286,676 *0881864D6376D4DBF96D670461578762385C1C7A TENCSMKROWTENTKSETATS8
80,286,677 *088AA7503B3BB5191EA85CAC31A6D0E00613A2B3 ERUXKNYQ7JWC
80,286,678 *0885CF270AC9A5FE64F2579BAB2CCBBB55C285C0 TV1K
80,286,679 *088A01FA34058808B4F03AF555B3DD419E5F3C73 ESIVARPU6
80,286,680 *08819D1AA6551B87A4524AAEA6B0EE5FAFC56A0B TERRYSPROSTY
80,286,681 *088CD7644CDAC7AD633FBAC40233A70E64079902 terveellinen
80,286,682 *088E399094934D908B53172D8C0A0569D03D3C78 TWISTGRIP5
80,286,683 *088D326C622570E7987212DC0ECF3130EEA6924B thanhtutwiler
80,286,684 *088BC0D739C50DD49F9178166ADCC8C795F360BB ETSDNEZIUDGITHCAT
80,286,685 *088C735C96CA8F7E0E2CA69C1F21B1707D1D9AC0 EUHKI
80,286,686 *0883576E410839220885AA42046F5D1E7D2D731E the.gift.(fea..donny.osmond,.jim.brickman.and.tracy.silverman)
80,286,687 *088553F0704B93F8FED4E3951E1D3D713DED5015 EXCIDOQUE5
80,286,688 *088ED8069B793B801C0518FC2570822F583C1FF7 [email protected]
80,286,689 *08835A3DDDDC7A0BF4E600B1BB2916B5FFF4DE61 UK2Z
80,286,690 *0884A428D303AEB8497A32B915E084450894E38A theriomorphouses
80,286,691 *088E036849A73045172A0B1FDBC73CBC7A5D1507 theronbuonanno
80,286,692 *08888AEAB164F851566927375913EABEA85126B3 F0r39nn3$$
80,286,693 *088FF32FD21E23B6456DE620A21CF8921C2788A1 UMISHKA8
80,286,694 *088F4BAD2342C7C02E1EDE5ECDAE0FC41360ADD3 UN941NL13R
80,286,695 *088E70E7B9700DA90C17B7079D29FF4544E79263 UNDEFNAB1Y
80,286,696 *088B84E3802885C58263FA51D3D51E41EA6F52DF UNI0NTEE
80,286,697 *0881247C2D459FBC84A36650287109F70CC4D6A3 unidirezionale
80,286,698 *088D98AE8A3B4112FEDE0444A92036977806ABFF FELICITY30
80,286,699 *0886B9EDF6C7778B5F19D0EBAAC6C53C7FE0BADA feltonalmaguer
80,286,700 *08850621112D9EC970C45BEFD43568593D5DD674 UNTIL.YOU.CAN.FORGIVE
80,286,701 *088A6929D650ED73B536BC51EBC4317060021BDB FERRARISSE
80,286,702 *08853285C86C53E107D65E9B980C0AF3AF87B3A6 ffenyste3
80,286,703 *0881CBDCDFB4044421F2FAD444907DB9DE09A593 [email protected]$
80,286,704 *088DD45B2489BF1904C38D79AD89DAAEB5752E62 [email protected]
80,286,705 *0888384235017A68C917AC2244B03BC023C7BCF1 utvorit6
80,286,706 *0883BD4CFB6BA72E5D33806FE6FFE5A1DA29544B TODD-TRACEY
80,286,707 *0881531F76EEE47DBE4BDE8E9AF21254908F4600 V113012
80,286,708 *08855DBA0C87B83B58836EF93D4BEF6EC33B7F86 tommy-cleghorn
80,286,709 *08882577A7B6312C6AD7E99DF1FDEE181E636287 TOMMY.DEKLE
80,286,710 *088820197D001D495A1620B5A471B3FC7D2E08E5 TOMMYKKL
80,286,711 *088A84B12E01323329D6540FA69BFAA5BF64CD53 TONELUHING
80,286,712 *0886094F2EEC56F841A1E2697EB1320BAB043F76 VALENCIA GERALDINE HENDERSON
80,286,713 *088D968ECD7562777B0A35F5555DD6F8F57E8504 FLOFLOCHE
80,286,714 *08864EF8956BFE184B76282F37F14C030F7C0873 [email protected]
80,286,715 *0880B2D732A4423F981FF9D2B432B3E1FAC0C405 TORO2ASDFG
80,286,716 *088772F9C57E6E6119F460DC09DC2C2BF0BBEDBA fonkt
80,286,717 *0881C5D2B6FEC78C836F80049F1B05A6EEDF0190 toya
80,286,718 *08842AE26C7B043F643659B95F2928B50C5DAA13 VANCECHADBURN
80,286,719 *088A843156E0542BF5B67382A7707D3718262009 VANDUONG0
80,286,720 *08813483853ABF547E77B26327689E641B043D4D FRANCESPREZIOSI
80,286,721 *08823A3602CEC9261B870DDDBBD47AA1A4FC921B TRANSLATATA
80,286,722 *088A7E96F23C08108A6398F8A64DE4C951881ED8 travelgurus
80,286,723 *088F4F72362569169133EDF30F16A0E519AE5603 frank-dobson
80,286,724 *0885E5CA0FC568C60959A00A1E6D6D5A9436D65D FRANK HOBGOOD
80,286,725 *088D8C932DAC3D542F023E9F7BE224A37C06E3F0 TRICRHOME
80,286,726 *088BE483A31D3F29883ECABA0E2C0A0CF3A733C6 frederickhamons
80,286,727 *08843529B1509713BFB345B4F0BC63E8C3E82B49 FREDRICK.WINDER
80,286,728 *08865012A2C17C274FCE690EAC82FD2BF59E36AD „FREIHEITSLINDE“
80,286,729 *0884D00E19AB97AA922E2D8C9DC96FF635388107 FROM.EXTENSION.FIELDS
80,286,730 *088590524D3CE3D7E932318E08A98142FAF8FCD1 TSIERYNN
80,286,731 *0886D48484AC3272EF8BAF24C7DCF3DCDE8B9D7D VERSUCHSSTÜCK
80,286,732 *088E0F9E54B8C7AA7E96F363F962900E6339EE7B VERTILIA.STANISLAS
80,286,733 *0881F763D123092C09DE804F9395C08C41245581 VESPARIDER.BBS
80,286,734 *088F4610E30912A137FAC01CF4800160062F2F48 FURUMAEKI
80,286,735 *0887380573A90569FD81694E7D95E5C87737E628 G3N3R411Z4+10NS
80,286,736 *0886EAEAF92121F2617FD61EC35BE16BC5F3EFFC TWANYHOLTZHAUSEN
80,286,737 *0883E2B1F776E4025B4FEDF5AA3DDAD7FAB9FCAF GALE.FORGEY
80,286,738 *088754A711E808E78AC81D78EC93F06529FD1984 vickiemcvayjones
80,286,739 *08832D2EFDAC9420A6BE5D89996C800BC924B540 typhoon-stores
80,286,740 *08800CF61478197E32A0F098604728ED02198910 VICTORNWAOHA
80,286,741 *088FF5EF206EFBCD76EFAF0F2C34B0D30F6CF095 GARBONZO9
80,286,742 *088CD4007C8C95ACF271D931FD8085675A50C689 UCONNWOMENSMEDIAGUIDE
80,286,743 *088FA1DA22B81055178E65588B8FCA633879B98D VIJSTER8
80,286,744 *0889E9ECDFC935E70165E0576F7271A6885DDC9D VINCENT ELLAMIL
80,286,745 *08806DD2A374173BB54D44485D57D08F9F2E8B69 GENAROFULLENKAMP
80,286,746 *08824804B1EC45849BE7E126245CC95C3D5CF6E1 viraria0
80,286,747 *088CC6474AACBADF7F1C8C1B7B5113CA9BCCDDA8 umer-zahid-jami
80,286,748 *0884B8B9BFA58AF663F607E0C4D2E36EEBD8BEB7 und3$crb4b1y
80,286,749 *0883E19ED67F37C0D32F501AF6F2C8635911CECB GERRYDONG
80,286,750 *088FD0E298BAE13BAD0CCAC0EEDA5891CD803295 virginiatester
80,286,751 *088398F8033A7AA5C80B7D3A50D3E6CD81BCE12C VISSI6
80,286,752 *088002B81F9BC7D93CBCB536E6A1289B78B0CCED gloria-layne
80,286,753 *088B7928380F82FBB8747617F5D0647446B5EC03 VOLKSKARAKTERS0
80,286,754 *08872E9380DF812C1636A0CC2BB9E0616506B527 unswmap
80,286,755 *088E61E8A6CFA599685B15C1D2D0BAB9FA26B513 GOGWHIMD
80,286,756 *0889902FC3F4999734F90321D9897593C88CC700 GOUTTIES5
80,286,757 *088BE4BA16E7D9FB468591F7FFF16B5FA01EA3BB VYRAZENOU6
80,286,758 *0880BE7427E9C76F80B9B9E2E8CD76A43E744D3F HAIFAAWAHBI
80,286,759 *088DDFD09DAC6D142F51327B9C67CDBF2EA01D1A hamsterjosie
80,286,760 *0883B88D3C891A25A1282A76F8FD00BAF798CFDA WALLYJIMBO0
80,286,761 *088E1C8E6A5230CE2766002CA13DA6FB22E7B601 harrisonezekiel
80,286,762 *088BBCF422035E3ED2E42DE16BB4C5059D57AFEF HARVEYSCHAU
80,286,763 *088D17C9372F9B56A5490CF6678C539F45E42990 VANADDESSO
80,286,764 *0885A7A708788E7F9F99098CD436F45C5BE052C5 wasjaka
80,286,765 *088B5C68149D8F47B443009EAAC2E11B6C115F38 HAZEL DLAMINI
80,286,766 *08810DBB90B3C61C112C49EB7A33423A711D19F4 [email protected]
80,286,767 *088F5DC3B563F6513648E4FCAD7CF61456A0CFFD HEADMOUNT3
80,286,768 *088D97962D62FA8B54652FB5FA36DA10981F2F27 VASILIKABALA
80,286,769 *088F9E5A1E06F0BFC4E01E4C82F618A8498B5028 VATRE-SE-PALE-(REMIX)-(FEAT-KRIVICNO-DJELOVANJE)
80,286,770 *088D3A7FEA057CB19890D0C2B6AFC375E9C540CA hilje
80,286,771 *088046D08E9061239B8A8FFB261F24CBDBA793EB [email protected]
80,286,772 *088B7C661B68FAA930EB19F9DA05420CE4CAFF10 HOOTIEBAMBOO
80,286,773 *08876F412EF2C1A0BFADCC76E4FFC164BBD62A5B vickpersaud
80,286,774 *088CAF09CE260194A4D5184D7DC05E856B50F2AC VICTORIAMARCHIONY
80,286,775 *08898BA4CD3E71927005CE66BCDFDEFCD54A5BEA HOW-TO-LOSE-WEIGHT
80,286,776 *088F220CAF9CD101B44EA7ECD1FC0DC5D55C740B hymantricarico
80,286,777 *0887D105C4C4051C8ADC120A6272138AF33939F7 hymson-assistant
80,286,778 *0888F0D44DFB25AD307D009F62CECEE453343658 WIDERSETZENLY
80,286,779 *088001A2D2375D81A42EAFC78583F3865BB42742 VIZBEEPPED
80,286,780 *0886748A97AE7AB14F7AE49C94BDAAC91DA5C473 [email protected]
80,286,781 *0889FF2D3545988B40B048FAB715B63DE68D648F IBRZESKI
80,286,782 *0884936F12A985710D8A338364C8111F72E45666 williamthoppe
80,286,783 *08877E0725E8BF95C6AD8681E8991D0AE6937654 vothiloi
80,286,784 *088D1CAFEEED79C3AF793974CE4241AA6A11AC96 wit-mcknight
80,286,785 *0889CB8F652E11BBE559624E346C5EFCFE0F810F iheartbg
80,286,786 *08884C58A702C24C3BE5B2199E2967932AB02BEC I}:J
80,286,787 *0880FB197E14DCE88D62B1AAC5F85F901E55E2CF wagiran-wahyu
80,286,788 *0880AF5715E718DD6D8E902D3E5A059915B30B05 iliso
80,286,789 *08868A183C54B1B956C0FFCE9CE3D50910D3224C WALTERJACOBMOKWENA
80,286,790 *0885F48FD25E774E790C88028C7C11CC2712EE9E WALTON.CRAIG
80,286,791 *0884944342580FCE2B88F1908770C404C39BFEB5 WALTON.PAULSEN
80,286,792 *08893D0FA33275C40AC55A4D447FBB2314E1B920 WAMBA JEAN KENDRICK
80,286,793 *08884C2D6ACE57CB5FCC04D3F808D9B25E3C9AFA WWW.HILLENBRAND.COM
80,286,794 *0886838115B0F292905EB238F03008954DCD36BC immobilisant
80,286,795 *088D6D57E2FFE96CF567FA93FBC836E3B2CEB7C4 [email protected]
80,286,796 *08865FDE7E36C06CF9C4AAE9A34FF2EFA853A980 xbcw
80,286,797 *08819D990A704D3D3C3AA0DD4E79A9F7DE03F3A5 weixin.wu
80,286,798 *088C1FB5DFCB61CF913CF512FB8DC053FF975F10 [email protected]
80,286,799 *088ADDB9CA4367B487E8672B4C53074797F21ABB INNAEBSW1
80,286,800 *08804D11412286C3E5C3F00B6E16912ECAC888C5 wendy-rodarte
80,286,801 *088597BBCEA113866EA33F271A6482DD298B672D INTHERAIN(FEAT.RACHELEVANS&SMIGGDIRTEE)
80,286,802 *088D035ADC6CF221AF71A7015A16E5EC8A14DFC1 [email protected]
80,286,803 *088842ED1C0B195A28A569312890AB39FEEB8973 [email protected]
80,286,804 *088256CE0F4A2F63A25FEA71A3775DA8D0EE7888 xrysa.koumou
80,286,805 *088706E6D5A663E2295E2DBE010929AD8151AE44 [email protected]
80,286,806 *088418C120BA847CBF41C3DE0BB759ACDDF6674D invincibleoriginalmoviesoundtrack
80,286,807 *0883287B71A7D543377E5288F2BA474EA611940F IQJVWX
80,286,808 *088643D7FE7ACCBC4BDB3CE97BDF57E4998ECDDB IRAGREGORESKI
80,286,809 *088BF7955C539C02ACF1CC97DB6825878828E2AB XXXJOIN9
80,286,810 *0886F4CB912520BBD93C9F49B387B440DD39FA6A irelandkarin
80,286,811 *08803A51C720C51A577B74188041B780274035A4 IRISH.DANCES
80,286,812 *088836896DB16BC3ACC965BFA4D8E635F7A643BB WHIITNEY-BRUMIINGTON-PARKER
80,286,813 *088F287153F5852B12E5A547CE95D4411C1BDF87 whitetype
80,286,814 *088290063F0B2CF9B14FB137CCB17DFF0F52BB5F YANDONG WANG
80,286,815 *088ADF2CEB3B7F4742A053A1685BFDBE12C617C3 ISIAH.FREHSE
80,286,816 *08888C9D7BF68557BE621C4FB704807AD7FD2F8E ISIAH.MCCADE
80,286,817 *0888FE61E275BCC5B4CBCACE8C8F4EEDDEFF8BBB ISIAH.WAYCHOWSKY
80,286,818 *08834993668423F43B66532BA64EDAF1E3F4493C i signori della corte
80,286,819 *088420E4DC8C37833167C17FD8CC68A4CC44EC15 YEASTINESS?
80,286,820 *08898949259D199ED01E5A4119841072807D15D7 IUSECAPS3
80,286,821 *08897D7A05A445753159D26CAEDE0FC1B18C6E18 yerson.arvelo
80,286,822 *0882A455CD195CD7704B14F53850A73E4B8BD87F IXAA
80,286,823 *088544206655A790E1E8C0E6FF6EBC7507187BBE IZOTROPAJ
80,286,824 *088DBA839B1E35B45076290A91725BF9FC04D31A YLCIHJHR0VFAOCWNKY
80,286,825 *088BB52C53108757B647A214BC8EE725F73CAE8F yongliangwei
80,286,826 *0884F16CD1CF7A9490B7DDA14080657FD11F592E JAMESSALONGA
80,286,827 *0888179D45ECD8108E70AA5ECE4E20B91E185765 JAMISON.FLESCH
80,286,828 *08840BF154B377F9138D0D5128A06526CBABF444 jamisonlinville
80,286,829 *0883CF02D87964EF43F8404FB8BB818DB7E287D4 yuracare5
80,286,830 *0889074C9D022B4D9C7A7180DBF980EE7262A9E6 jarodespina
80,286,831 *0886E501F3F2D88515BE8AB5D89CE15AD018A848 z/,a
80,286,832 *08818B7DD66DD28912A11A0EB42B14583E9F0358 wt>^
80,286,833 *088B079F242B6F1042D91E2213A06B432C480570 ZANFRY
80,286,834 *088BB6C70D75BC8E0569E9AE2F227D8D4792FF33 zenaida.lacerna.zacarias
80,286,835 *08810229689103138E1F324BF77CB9BBE7FE32D0 [email protected]
80,286,836 *088F68870D68A0CE5C7611B7616EE4250CD2FEDD ZEXAS
80,286,837 *088F3689CCCDB5A9A6FFEA368FE527DF6781997B [email protected]
80,286,838 *0884EF3522BDAECE632514C9168C9EFE2C6E4A59 WWWMYINTEGRATIVEHEALTHCOM
80,286,839 *0885326CFE5F7027890BE91CC7B342ED8CB739FD WWWOKEEFFEMUSEUMORG
80,286,840 *0882CD770BDE1C7DF76A0E6B2586A6ECBA4AFA0B JENNY FARTHING
80,286,841 *0882A3CB178052EADC371E398AB16EF61CEC0B2F JEREMIAHFARZAN
80,286,842 *088FAD264FC8C0A4A365F47FFBE49D845FCAD63A WZEBLAZ
80,286,843 *088FC116E7D19C28B3E8A39837F36084834672A3 X46303
80,286,844 *088CAD34D059ADAAFA81F559D60D0AF4BBA52531 [email protected]
80,286,845 *0888DB99F827491A9FE6280C557FA59EBAE5480B [email protected]
80,286,846 *088BAA543DA6135575112A9F33B529EF9CA60ED1 jerome-stovall
80,286,847 *088C3E6ACE98AAE14B8443EEE47F0D0F5673D945 jerrellbensing
80,286,848 *0889B3E2A6250A6E628B2249018149F7E8B45143 JESHIVAH
80,286,849 *0880C031C7BEEE7BDC7C0C1C2FB7A0F7A8FC2AE1 ZK+X
80,286,850 *0882224DFF4154D6E2C708FB0C261383F8F05974 XGO=
80,286,851 *0882FEB9E288CEAED2E9BDB95FB0104256ED3B65 [email protected]
80,286,852 *08893269837D4AF583FA12E76DC4EBA986492FBB z?re
80,286,853 *08803928E9A62C060876889FFA4F9F8E97DF11FF )x(.~.~.(======p
80,286,854 *08839320411131A005D0444C5358939CBF18807F }X{*.*.*q3
80,286,855 *088248BAC20FA34B762CEB51AA21F3A5A93573FE joan-pierri
80,286,856 *088C85640787868491DBF553A9BECFC641FEE5B5 JOELBROUS
80,286,857 *088A01F9128C42DD6A9A27F4B7699CDD625FA300 joesphyaish
80,286,858 *0880D05447A08ECD8884391821DCD4D74751A93D ΟΠΑΔΙΚΆ
80,286,859 *08835AEB55E745E27674E0CC1224D08BD0D2C8B1 JOHANNES-PASSION,TEILII:ESISTVOLLBRACHT!
80,286,860 *08802ACA0E2192508AE5C188538CE17111DF056D JOHNATHON.FITCHEARD
80,286,861 *0882D09358DB85C2E115FCCC5456DDC7BC8F515B АНДРАШЕВЕ
80,286,862 *08865EF6806E5DFE9425C83AC18713158DB83A74 [email protected]
80,286,863 *0884118417275200B880E01945C81AB425D584C4 [email protected]
80,286,864 *08846CCB5254ACFDA49D8D888BDA14861BBF7560 YANG.JIYOU
80,286,865 *0884692F062F0C71D2B6AF61CD3688AFF5ABB595 [email protected]
80,286,866 *0889F64A6DBA274CBA80E711ACB67A09076CF5BC БУТУЗИК
80,286,867 *0884A2CAF17CD30FCE4811E18A2E9391FFD7308A мартяшева
80,286,868 *08818A271290ACCEB3A53FEA61265221685F2275 [email protected]
80,286,869 *088E13A45110A2CAB9172364D83C1F6B5A53339F ПСИХОСОЦИАЛЬНУЮ
80,286,870 *088CA59C5D99822F572BFFE0543AA07CE4F542D1 [email protected]
80,286,871 *088FEEB38FCE0F5469F870479769F2ABCAB9AC88 [email protected]
80,286,872 *0880E6E8EC9C2D150F1E14D21A5D6BC2B33C4284 СГНИВШЕГО
80,286,873 *0886984D8B56E854537381AE1528F12FD0A36B97 yokekin.choo
80,286,874 *088A349A74EF88F18F1F2701FCD466001C545587 YOLINDAVILLE
80,286,875 *08819DEE47B9D9A308A51F9838326E29E69266F2 judeterranova
80,286,876 *08823E8CB92F3AE4A4CAE4FA6E03B1950C9A0741 хабарҳо
80,286,877 *08852D694275B4D8A39BB074EEF8BD1103815FDF JUSTASUMONE
80,286,878 *08883277DBD2E617D58EFB847C15FAF5D6D50B52 JUSTINLETOURNEAU
80,286,879 *0883773665968A7E3B35D704332B08DD3DBAB843 yuseef.huseen.toro
80,286,880 *088B47D51D68F96A9BFF50F7AF8D035195D6F819 のハルヴァも作られる。穀類のハルヴァは祝いごとの機会に作るが、葬儀の際やナズル(NAZR
80,286,881 *088C31013F09DFA8C4DDF613398D831F7B4DB7B6 YVETTE.ALICEN
80,286,882 *088D4F2B714FDCB9A06F5C41C8FE36058D39469E yvonne-bassey
80,286,883 *088BA102AB976AF9A2A98B5B5B1B2FE7CE2AE1B5 ZACKARY722
80,286,884 *0882AD2E70377F108598D5DBA5CF93622AC98142 ZAKI KAMARUDIN
80,286,885 *0881216666E862BF9FD6CC6305844B675B6B3B66 KARIHANSSEN
80,286,886 *0881A61B332F1B3C665D86C2B295D9FFF3855D5C KARLLAGRASSE
80,286,887 *0887D8D36F5D7AA6AFB401EF54B83A391198DBE6 [email protected]
80,286,888 *08834441393D9A8B5B2497BA12628097D7B3E184 KEIOMI
80,286,889 *088D4A5C800C9A0333EF0225E26DB392A31BB6B2 [email protected]
80,286,890 *088D74F3425D3A74D2BA575D6F704A16294BC3F9 ZERELLEV2
80,286,891 *0888BEBA948AD224E2155EF37F03F0AE26292915 kellyfonteno
80,286,892 *088C25CC8A8E2AED1AF6883AF89FF3707133B80B [email protected]
80,286,893 *088AEA2743797F33891CF2651F059BB2129F90DD [email protected]
80,286,894 *088AF7E30A71A73F8519FE507A07523E767DB057 [email protected]
80,286,895 *088291355674B19FBF73757D290603F6A7864876 KENNITH.SANVILLE
80,286,896 *0880A5FA757F93F4F32844FD154D6B9791493B20 ZK,'
80,286,897 *088FD1ED0CFB4F68D58F789BF09AF9C614791E0D kirbygagel
80,286,898 *088D355D2F42F32B7EA82CAD644BEFC53D3906D8 [email protected]
80,286,899 *0889872D8426C2365D7976151B3F0F95876A39D2 KKISKES1
80,286,900 *0881D2F418C612913792D2202AC722F31299A85A врбоцветни
80,286,901 *08811C8E694330395B7BCC372B90BF1D82EEF2C9 KRISLINERO
80,286,902 *0887D6D7DEF57F9ADDCB0D12D17024D4075A3789 KRISTOPHERBUTTERY
80,286,903 *088F26D6EB43C9D69D88853F77C4EE261B84EEEF [email protected]
80,286,904 *088ABC8F02D5118FEF5338176654415059462404 КУНТИА
80,286,905 *088A9DCCE5138D31E6F517B1BFE25978DC3A9466 МАСИНГИ
80,286,906 *088FDF6E66C0E2FA8B088E6C6E9B5EA7502E874C «могущественный
80,286,907 *088200E810C8EED76DAA32ECF067228C35D35119 [email protected]
80,286,908 *0886ED8FA867759F9A5E9FBD3415000F2876AF56 lamarkozeliski
80,286,909 *0887A033C0AFBC6F9AE59FFA81DA2E6AE41F0C46 LANDONZURKUS
80,286,910 *088CC74553D93C316B90B44789ACD1F0BBA89E50 LAST-DANCE/DEXTER'S-TUNE
80,286,911 *08863F68CAAE6EB14E7721ACB716D3672CFB7047 LAURENCE.KLINKENBERG
80,286,912 *0885C09D15FB6CFFA66BE1BD5854ACDC055D5219 СИБЧЕГСКИЕ
80,286,913 *0883D6EB7F6F13F61200D099E2C9676F9C2BF165 ldf5
80,286,914 *088C8684A3CD3C37EDBA4744FD6C52871445BFAF LECITHINS2
80,286,915 *08856587026E2110E5708C6FC5DC2C0F95C8170E [email protected]
80,286,916 *0889CB229B32C77318A93B12AF80894293951C25 «ЯЗЫЧЕСТВО»
80,286,917 *088030A7BEFA2EBBB893083F9E61203E2DD89876 LEONTEUS7
80,286,918 *0887FE4E285615EE53ED471D5E8C07CAAE2308FB LESLIE-FAJARDO
80,286,919 *0881864837DDE1C8A7DE1DCEAD570DC95164A6ED [email protected]
80,286,920 *088FC9CEB48E635AC0F9CD6A8647E5CCC4C8DF2F libaojuan
80,286,921 *0880B0DE626349F3911C5DEBB1F32CDE2F8D1E49 [email protected]
80,286,922 *088BFD0216F42E252FC59BDC5AD33F6B45BE3E9A LISA.PAPARELLA
80,286,923 *0882DCA4E545F422DD08AD82F1A57A90F8C54E95 LITTLE-BLUESTEM
80,286,924 *088C9A4363121BD4A3E92A65C5D0A9AF1832BB5E 10SEP1663
80,286,925 *088DBFD53011E068BF3349AAACED51463CEB3D25 [email protected]
80,286,926 *0880D6363436C7D1E5BA1B0D3E9DF6D29BDE87AE 145ºF
80,286,927 *088D54B83C3029342220228E56C3C6C25B35990E LUCIO.SEDER
80,286,928 *0882E163DA4128AF5FC60CE0EA6CDB7656F3BACE L’UDV
80,286,929 *088DAA3584EF30979A89C7C1E4C8B8B188FF890A 業界関係者が本音を明かした「オタク文化の10年」PD(明大アニ研シンポ後編PART1)
80,286,930 *08868EF52621EB1A6980DD7DD491B1C5D0F6D614 [email protected]
80,286,931 *0887B1F314C75DCE1A232DCF6A5E37D8AE13D883 LYNDON.ANDRESS
80,286,932 *088776CB0C1D92483EB4AF45DCB25F4A06E81467 [email protected]
80,286,933 *088D50E92B133B057EA22A0E05371C9F4FC3E87B [email protected]
80,286,934 *088276BBDD143C54E88E60E989B9C216BBBE76D7 1767637 yritt
80,286,935 *088964FF9A253405891633DB323CE5E0F893CF66 mantraartist
80,286,936 *088B304A10AEA05EB2368FF8EF7FCE64D4A3443A maralogo
80,286,937 *08819FA1DDC3AE3EB3561E98BA7B467A85B21BD7 [email protected]
80,286,938 *088AF7B3454B941B762DB836774618B3755732D0 MARLONSPROULE
80,286,939 *088951C0A9016100C8D933BC30FF8711274C77C5 (0-0)-*-*(-b
80,286,940 *088D28B5F7643DF22E1A84990EB01AB992003A64 [email protected]
80,286,941 *088182C70B49E27CBCF5E9DA9AAAB0FD5247526A 1ABFLLEN
80,286,942 *088A50426FE5D9C7ACF90488687FE95433BB2FFE MATTANACKER
80,286,943 *0884D3B43DE2348E97EDAD2DB6ACFBB7AC346EC6 MCSSZ-HUNGARNETCSER
80,286,944 *088E634D264AB767A476C06A593F47C047099C5F 1EXLEMANSSIEGER
80,286,945 *088166E93817BAB7D8FDEA284C5012B5623445FB (0_<) O~O~ @##P
80,286,946 *08837C1479452DA704DC19D9719019D1AC5D154D 0P$VING3T
80,286,947 *08876B3E99A2994F89AC3D83B95937859326C327 (-_0)*.*.*q##q
80,286,948 *088598842BE8A4E4F4BF15BBC10C6FAAB6B66DED 0X8000IFSET,ADD_SIZEFIELDISPRESENTANDTHEFULLBLOCK
80,286,949 *088F85366722CA943D5C1ED89A195F6F0B4062CA 1.ioc-chefinspektorin
80,286,950 *0888ABEC706FE45B19219E4D4463157A62F330DD michelevertz
80,286,951 *0883E44E89FABFA8F9BE7CCDE0CA88C1623A0CFD MICKEYPETROCELLI
80,286,952 *08813E9AD223D6CB16F823DC57CEC8E0BCDAEBE4 MICRORAPTOREN
80,286,953 *088750D91CF1A355B8F5561D6A52D7835267CA6B MIELTH
80,286,954 *088356C69983ED4FD4B36197E365239DF6D4371A 1126160 DEUTSCHLANDS-KINOS-BLEIBEN-DIE-ZUSCHAUER-WEG-.
80,286,955 *08831C54BB12756EE8E92AD542E5757918D07D2D MIH-
80,286,956 *088BDE625259840DA6C08C33266A58E0F577AE14 1303-stellungnahme
80,286,957 *0882C21499C5086DFD7234266CA95CE2DE49029D 1383158 ORIGINALEWIEFORDSINDRARGEWORDEN.
80,286,958 *08866A2DAA2A9141764CBACD60EE5E492938B608 1UGRATMAYI
80,286,959 *08841E9A86118D0E7AAFBEA97741ED7392AB739C 1.unwillkuerlicher
80,286,960 *088B5081F8C8F4381FAACA7CA130CB5AACC10CBC MORGANPRESSWOOD
80,286,961 *08865F91EECBEBE49C18BCB50559855D9E328477 MORRIS.GIBBS
80,286,962 *0885A56097A690DB7AE98345E5372AB8C59CC791 MOTORIZARAM
80,286,963 *088DC0F1514A0A855D728A48B0D2DCFF1F8C35EE moustachu0
80,286,964 *0889B9F4018EA6B41ED328D436DAA0A3F6A2D806 mpl4n7er
80,286,965 *0887ED8F74E433A922CF7F70E01D1A2B1FF0F64E 2414649 MIELIHYV
80,286,966 *0882C0C62BBFFF25E5D559C7172C7EB306278C0B muozen
80,286,967 *08812AB9695FBA4787AD7F179B607352814E6931 murphyns
80,286,968 *0881CA70020397D75BFE61A206126E8C9BD65899 2968805 so.steht.es.jetzt.,.wer.weiss.,.wie.lange..
80,286,969 *088ACB00F46A605A959B100DB823D0C15D817291 N.DE.LOS.DOLORES
80,286,970 *0888553860D207FA2BFC5EDE1635CB18630B6651 2.GRAFFITIWRITING
80,286,971 *08815E60EA790C57D0721E5459D8107629626EF6 nelsontheuenin
80,286,972 *08818F46E04B2B9A1BC699E5FB0C34DB9FCF65B3 2KALBERER
80,286,973 *088DDBE7285F86B0350E1F15190AC9B3D4FF9C9F 2.KOKENEEMPIENKIN
80,286,974 *088B7687E1AC1AFD03A9A97C5C27E48EA2D23F85 1-beyanatlarinda
80,286,975 *088EBF795B30A08373357B2161CDD8F999D15946 2 MM-KUVIOISTA
80,286,976 *08850F474EAA07293686F0AEB11409E93D95839C 1CLOUDSON
80,286,977 *088BAEF2B02A52F3310D5AB6DF075472DED393E7 1COMPRENDERNE
80,286,978 *0882FFBDA1D1DFB0CA4AD5CF12C39202B987146F NICHT HEUTE NACHT
80,286,979 *0889184A88D62ECD8E2F9646403A3A09202228C3 NICKYARGUILEZ
80,286,980 *088A923DAB01D057914DB383E92EC6F41D9AC31C 1EASYGOIN
80,286,981 *088479714FFBFC0813AC6003317836C78DB47840 1.EYUPOGULLARINDAN
80,286,982 *0883C175D33C09D8D9E4D11B43AC253108C9DA41 NITTINGS1
80,286,983 *088EC3200FDF6913D11D527D42687DFE1ACC65ED [email protected]
80,286,984 *0886ABA2BFA672BE710978E0DCDF566C7F877570 NM0071452
80,286,985 *0880858FCC7DFA870B1BFDEC8E399BDC82593F3D 30jean-claude
80,286,986 *088FF37DCFFF6C61864289F1935AF372FA720A09 1ILUVFRENCH1
80,286,987 *0884A61373C8563A0B3993A5E36A9283CC8E7B7A NOTDAŬROJ
80,286,988 *0885E6B9306D1B6955577D56917799B99F7F120D NSBSTTTVED
80,286,989 *0885F3600EC1841CC0B83D320A0ECB0223B6C96A [email protected]
80,286,990 *0889810A672DC5E446CEAE3EE0D5DCA9735F6847 1protestfax
80,286,991 *088414232E484DF88F1DA0951381F67A8E36FE4C }O{~`D---P
80,286,992 *0889509BA27220CA4B4049A78381C8337FBEB19C OH, WAS IK MAAR BIJ MOEDER DE VROUW
80,286,993 *08875D917B8A6E0411C0AD58DAAEF7D7A2A05529 OLLIE.WOOWARD
80,286,994 *088270A3339A05815417C5D20C6F0E9337E32374 1TEKSTINJUOKSUTTAMISTA
80,286,995 *088C2084F65EB7E27223C4AC20C813D2C82D8DB8 ONDERGEL
80,286,996 *088A586F3B4005C60E6C9C443ADAE4512CFA7761 [email protected]
80,286,997 *088B747B6C5C7BFD52E94D523A68663303A99177 ORLANDOTOTOTZINTLE
80,286,998 *088D25A728143832647A18EAE087318552C2B5A3 ORVILLE.BOLAN
80,286,999 *088DA8C32A4AE568A3EFFC887B6182DB9F852C86 OSC4.TEMPLATEHELP.COM
80,287,000 *0888EE7A7B4B8E37095DE5F676ECF889B8A00B93 3#####>~o.(o_)
80,287,001 *0885F41F8F1B544E554FEEF1FEEE0A40977048FB ottoaresco
80,287,002 *088707C55706AB8A0201E226AE5DB14AE55F15AE 200501
80,287,003 *08812D0A44C0800E2D96090D71ACCD29D47221F8 202847 DEN.RENTNER.KOSTET.DIES.MEHRERE.HUNDERT.EURO..
80,287,004 *0888A0EFAC1F970E54D850EAC449D658214B4A75 3P4N4L3PSIS
80,287,005 *0880478FD6CCFD9A4AD9D326B85EE8841EB95E93 3PGMNTLLY
80,287,006 *088D7AE08CFFA31556E1FF749A7F8F4CCC376622 P3PT0N43M14
80,287,007 *08820E33CCB34159CB02BD611BF73D6C229E26D9 P7JSFKDJ
80,287,008 *0884899024763DDF1919EC56948352079F672EE8 3 VALTIONKAAN
80,287,009 *0882DCECB9220B470968D1939ED90C4D97EDCDA6 231GRIFFIN
80,287,010 *0880B3621D48024125C89E6A781CAA8F89DE9FC7 474521 KARARLI KATMANLI TEOREMI .
80,287,011 *088D765B8C0E7ACD8038A3CDC3429603DE1B5D1D PARPILLEMENTS2
80,287,012 *088575F7DBF53483FE7633171301E65634BC353A p=====D***~0~o}O{
80,287,013 *088560AC81DFF0FE0C1876D0470AD49D1B9E742D 4JANUARY2004
80,287,014 *0886F74074137703D90B4E617F36F38902450452 4RADIOGAMBIT
80,287,015 *0886F65FCE67E88952E178A146CC5D3BD01A29D6 PERINCHING
80,287,016 *088D2BBA36AC8CEEDCA3B271B603B9D9AC818956 511486 ERGALTALSEINERDERPIONIEREDESMODERNENJAZZ.
80,287,017 *088D1DED1C27C823D476E198C61CC98406155795 philip-rousseau
80,287,018 *088993AC7D7B6E131225CBCD15A28096A64E9D13 phycologist6
80,287,019 *088E56D4572C119F0D569213427FFE98947CF0D8 556509 veden alla olivat viimeksi rekijoen ja oinasj
80,287,020 *0885472E3EA824FDC087B69339379547BFEED47F Piano-Sonata-No-3
80,287,021 *088CE47568DB951222F63299844E8A980D80D58C 2kivetyksen
80,287,022 *088590FD61F9DF48CE2843085E95217798F8770A 2-lukasenko
80,287,023 *088CF3DC248F15C2ACD8703E4217719FE9A4E195 5allentammo
80,287,024 *08832753FED94B4ACE0C9C57DBB47418EE481132 piper183
80,287,025 *088BD051070AFE65BA3FBAABC6D222DECF25407A [email protected]
80,287,026 *08817AF82863C9F6393EF8462D1329BB72ED6BC7 5DELTAAIRHEAD
80,287,027 *088C958C446FF41D659D67882538ED3EFCBEAA78 P--P***~0~O)8(
80,287,028 *0881783EBA891C014FDAD334F5CA948B2DE005E4 PROBA$EBA
80,287,029 *0880C83823505462F499B5CAE05249522B2D99FD problemtoo
80,287,030 *088BCD3F1FF3B6909DE38D56AE3F6D1760F79482 3FPSPECIES
80,287,031 *0886328E95156C9EFE54CED6D490BE05D760D9DE 3ILUVTREASURE8
80,287,032 *08849DC93833D9FE7D2C5E74D9563E518A6A6BCE 3KINEERT
80,287,033 *088400DDC245C0D65460792F80D6ABC88F6DFC4D 3=====>~o~o->-b0
80,287,034 *0885D1258FB3110BF1974B349675C7E3A15BD97A 3.POLJANA
80,287,035 *0883D8ABE2F5E82D3BA168467CD0638D99A14B0B Q--->~~~)0(
80,287,036 *088315C7BCFD10DDC621E0AF6D31D334941EA8C4 6BSWCALLASBSW
80,287,037 *088944E870B92E29C682D9CCB496B8F7E0F3E0EC 6CHTNEBSW
80,287,038 *08888E75FD663787249114494A251C1EFC230AE6 6DURCISSONS
80,287,039 *088DD0554D2D52CFCF82C12A843CDE76EA086BB5 qir
80,287,040 *088785453B3589537D01628658FC4199C3CED2DE 4IAMJUNIOR2
80,287,041 *0884A72FD8AE25C01AF1DCC83EBE6B8C549AE6F0 4IELESUDS
80,287,042 *08828BDF60946C45D25C6E32FB14B0EC92D4C89A 4IGRORRET
80,287,043 *0884DD2CC8F8314C36CA079A100ABAD514EB4E47 4LIG3IR4RS3I4M
80,287,044 *0886C22177BE5924560B484B917BBA1237EA2731 4MIRANDAMACHA
80,287,045 *088EBB39F939CF241EFBA1DE08DF6DBA6F2545B6 4MISHADONKEY
80,287,046 *0880C22710E0A9D9CBF2DC53947637A4FA3D6E56 4MUFFINDOUGLAS
80,287,047 *088A45356B09253DA2E61F23F8C3CEFBACE067FC 4-PYHT
80,287,048 *0880AE6CD69C42095C3F304C3894846F7546BABF 4TWINSZORRO
80,287,049 *0887CA86F32DAB4F460959D5B464925952807942 4-UEBERNEHMENDE
80,287,050 *08845CBCDA43CA32DA119A852C2B228427E1ABF2 4us-geheimdienstkreisen
80,287,051 *088BDE005C67DFC1DE4AADF4A0938D6E7CEA9278 50ac5c8d1fae37a786fcc9a45f04e851
80,287,052 *0887ADD7EED0021CCF5AD47A83EF2C798F53A4ED (~_^)~`Q------P
80,287,053 *08866158CFAD309B6C3DB602E927B5A2B7D5B95E 6HINVBSW
80,287,054 *0886A72BABCFBAA829126A3FF223E65BF67B358D 5BSWXMULTIPLIER
80,287,055 *088705B6FBFD498FC4E99682F0959E44A5A7E276 QUENTIN.PATAGUE
80,287,056 *088DB5E15425C77BDB9D61473B04C417E1125E41 5CHAMOTTEN
80,287,057 *088D6D1E6DC84C80A6B471D679CA2623E58B24D1 5CHAMPIONHENRY
80,287,058 *0882A695569DDB2774CAB4C85933846B28CCA94B QUIDANCE5
80,287,059 *088306AC54B4F45268E865CB3B19EB6FD5EBC1DE 6JESUSMICHELE
80,287,060 *088CCEBBE9F6598D46A63B2A785E8511AFC8CE17 6MinuetsforOrchestrainB-flatmajor,K61h/deest:IV
80,287,061 *0889AC375310BE793890C49CE18D47C28E5FD989 6PROMETHELOVELY
80,287,062 *0886B8232223A5DE1272A39886C4C19CCBF851C1 5JORASINGH
80,287,063 *0880CCA4E117F05906C6DDB2D2475A10BA2C0248 6SERVICEKNIGHTS
80,287,064 *0888B583B242F3CF352502F6529981EF1CB287A7 raise.that.lantern
80,287,065 *08849F55D912FB8624E98EFB7B2DEC996580E284 5MENIDESN
80,287,066 *0880F3DC283DE419E18B2E7FAB50741CC5E5C1F2 5MXXOTFBOZVBW
80,287,067 *08871964B5245635F66A6283C3F4E114CE65AC1E RALLINARALLUSROUGETI
80,287,068 *0880638F7E4857046D36D45ADE06B3EC09238703 randolphhuser
80,287,069 *088E855943F7B8F5E963647180540DC6832C065A RANDOLPHWAHBA
80,287,070 *088A293AF5B92566E14D999C894D264F9F451E09 5QUAERIED
80,287,071 *088436AD530ECE520C47A50A5D7C0F979F2AC0CC 5RABLATCHLY
80,287,072 *088670B8499DCF75F4C48DA35826A7F8F736788B raspall-callosa
80,287,073 *088D3F620E355877FFF29D7E514A4C611D95440C [email protected]#$%^&*()=
80,287,074 *088F8F573DB081BD72DB4CF9A6B2E518218E0B38 RAZA-JAMIL
80,287,075 *08856FDFDC64461FE1B5D1351AF3C5D7B47F63ED rbd623
80,287,076 *088C48FCE9D8A7AD903E5BAD6DF9C2CE113824AF 644I
80,287,077 *08835A6C1489EA65FA572A136872B4C5D2D0D078 renatozindel
80,287,078 *088CC9122809F2D6DE2F44552E21928630D6DE7F [email protected]
80,287,079 *088F91E5F8C72BED88999D26FE78B9099A0B8F4E renflouerions8
80,287,080 *088162D2B72272D232641565B0898D6C8F6CC825 RHETT.DOTTERWEICH
80,287,081 *088400E7D169098C4A399500301B1C7FACB0162C richasaksena
80,287,082 *0886A60F2E970359F5FB30105CF153FD821189E7 RICO.LINGO
80,287,083 *0883F109BDCB5077D8DCE54252B959A37B39764C robertcasello
80,287,084 *08843A8AB4059AB1FB81A30CCEEE722C1ED0D2A8 ROBERT.FORES
80,287,085 *08847124E30FC46AC9EB661E0784B13DB76FBBCA robertlook
80,287,086 *0882277DB02B81FBF93C88592B42FAFA042E1712 ROBERTVASSEL
80,287,087 *0882EADCFDEC6B2635EBAB31288D99B0A1A747B2 6ILUVDESIGN0
80,287,088 *088B94EE4AC4555EF3D685CA1C77494D4D5A8B99 6JSPWKKVL
80,287,089 *088924307773F5DAA5C9D2A9AC61F395F1FFAF0E rolandogutermuth
80,287,090 *0889E61AA6446DA7568EA74FC2F25A7941343E52 826496 opiskelijatkertoivatmotiiveistaanhepreanopiskeluun.
80,287,091 *088A60C6E72566DF3454FF418297A0A8A8AF8A6D 6-laulua,-op-72-no-3:-kyssen
80,287,092 *088820464F1E5A45F687CD650B5D34C5FA66DC84 6PLURAUXES
80,287,093 *088152B08677972F616EE02644009B29A128E5A9 6RERULLGARDINED
80,287,094 *0889D3277F60B5D226BC461676FB2D2686FA5CC4 ROSSEMOLOS1
80,287,095 *088BA8A6A91946780F132B0B3C964D3C77A0872A 8===B~O~o.(^_~)
80,287,096 *088928ECEA5D4E0A17D4F497DACDA8BCD481BED2 8BSWALOPEZBSW
80,287,097 *08885DEEDD0CCF670E9920E429BA8A814E9991EE RTATICNI6
80,287,098 *088666505A131579F99FE08CFC65A4C4324727A0 6TURBINARES
80,287,099 *088FB14833503F02B0621F9AFF8DB6D5E315A84F 8ECTOPICHE
80,287,100 *0882AB9775395754CB8428F0FBA2D546ACFB6953 RUBIN.NAVIN
80,287,101 *088B71B1BC3CF92C11753217B7C49C3F8FCAB00C rudolphgoy
80,287,102 *088084C5D84B11934183E2318A08109F3B03674E [email protected]
80,287,103 *0886C03D7BF72A33044DAF2E0C4D9D7DE1D6C462 russellgoldstone
80,287,104 *0880C231A9EBA6A689C290BFBF5C856F45CFCFAE RUSTYCROUCHET
80,287,105 *088A89D23408AA6D2021BC0714BCF5DC77B414CA 8MYLONESTAR0
80,287,106 *088B436CDB029B71E9043609A8D8594398878B86 RUSTYPINKFLOY0
80,287,107 *088119CBB1E1E93B4F38F840F3484FD28F04D69C 987519 klavye.kullanmadan.oturumu.aCabilirsiniz..
80,287,108 *088347DCD53C72F02545C4EFD39FA886DB9BB147 RYLEIEVING
80,287,109 *0884DA52F9A4A77881DADD37B9FFEC8F284A3AAD 9BSWFTLBSBSW
80,287,110 *088A2DB72A036CD4DF10BBE590ADB3455025A99B 7FLYERSTIMBER
80,287,111 *0887705EF0420BB7F3F8FC26E6A3EFB2D66B3914 SALVADORJECKLIN
80,287,112 *0881214F22748696429A636F49097488A517438D salvatorerunswick
80,287,113 *088080FA6FFE2BA243BEE238E0845645BD78B772 SAMOAMARKDUVA
80,287,114 *0881F6DC55B1BA54F8E2BF373594741A3B7FF412 9ROBOTECHSKATER
80,287,115 *088FB623F3FE78DA1ACD13B276DE933B052B58A5 SANTOSHPANIGRAHY
80,287,116 *08870494F7E0A615A16C19D4D5FEC483F8650932 SAPHIRDSTUUNIV-MONTP2FR
80,287,117 *08855DAACB7394BF6785D089E02B504E48C23469 7SENIBBUT
80,287,118 *0883D21237F33E2C6989BD4BE513AE369FE06DA6 sashaleejacobs
80,287,119 *0882A7BA43B34ABDE515ECBA02091947AF29F0A3 9YHTEISLAKOSSA
80,287,120 *088EF18CDDD44C2121508C60B8F5F110A71CA9DA SAUL.POUGH
80,287,121 *0884466B916A235E946522782048A05ABAF5F464 a02#:
80,287,122 *088EAABEBD32474FEBCAED58A9FBA6645475B9B1 803kristina
80,287,123 *088596226C74CAA8F305CA05AFC9A493A94E9943 a98y5
80,287,124 *0886CA9260A0F81ED496B77F3B8977DF9002C73B SEAOTOHPPED
80,287,125 *088CAC8D0790BB12FED1C5D696504E4DAB92D866 SEGURADES
80,287,126 *088B9B7306A99BC6CB1AB3775478702F0F71CABD 8FRSTEPLASSER
80,287,127 *0889E2892B505C1CDA4C3E58A6C0D7C76350A171 aab/ln
80,287,128 *0886214B0639AACCA758BC9E50CF988558779D20 [email protected]
80,287,129 *0884095B669752D74E5A4E1FA331C1AF41AEDF22 SERIO"SES
80,287,130 *08828AD265934618CA14B43438400DAA4ADE94A0 [email protected]
80,287,131 *0885E7D6E2142DB51BAF319ABA8F47C343D6839E SEVENTH.CITY
80,287,132 *08882D3FB11D320008D087AC70B2BAF4C2F16BB4 8thatsummer2
80,287,133 *088DED7015F304F3BFA78823CF220D3B3D1EFF1A ABOO
80,287,134 *088B88840A98E4B7E1C435A0FF8110AA29D37659 acasado
80,287,135 *088591FE5A52EFCB5E10F68BBE2007EB1BC732E9 ACFU3U2UBW7GX1PISWITPHLJ3NXUYZQKRQ
80,287,136 *088E85B41A446294D232DEAB66A6806FA12D8614 AC/QR
80,287,137 *08842E826DE5E2CA3529D70701027C9474DC70C8 SHAWNA.CASSIDY
80,287,138 *0880A98BBDA906776F12D29FD24EDDDCA896E388 A!+D-
80,287,139 *08807ECB7317FACCEBF6408C4D3617FA0CF7CC1E 9JAREDENTER
80,287,140 *0882DAF0778AEE738C7A95532DBAA05725623887 9JENNYMAJOR
80,287,141 *088E6E55256AE963E54A2001ADD669838F947B77 9KARENERIC
80,287,142 *088FE35B7392EB2268883F98D3C2793C50D0DE72 9KULLANHO
80,287,143 *08845ABB7989FDA4C74036A8F787D3D07E2EE88F adlforsit
80,287,144 *08884AC03B870E0F60149E92BFF58DFB1A21D289 9NONREPETITIVELY
80,287,145 *0889E122A6269A3CFE24CC320BA709DAC3146C5B shipmateturnedtraitor
80,287,146 *0880B7349CD163B4120653DDE507912ED50F8ED0 9SEIRAABSW
80,287,147 *0886B14FC2884D26A2035ED9AE8BCC7D01BFFC2B 9sineuses
80,287,148 *088474D9CC8D596812F2DC218B3E8C22E24156DD 9SPUNNER
80,287,149 *0889856F318A836A32B52882CB046757F8887B75 SIARESIR8
80,287,150 *08836E11A7DA50461C781BA75F211E09716959D5 [email protected]
80,287,151 *0888C1F46CB118B1F474B12D0CCAC98485FDE431 9TROWNAITNEG
80,287,152 *088657161A1C85CFA5100C3CC06CB569A236A3CB SIDNEYMUNNIS
80,287,153 *088EB3E49F71F0A5DFA95ABA71E418E7F4DABC0C 9TUOHRAAHCS
80,287,154 *0885E8E5CAD26ACECFCAEF074C7996A06B01E197 SIELINGBSW3
80,287,155 *0880DA49A229D1728247FCB6091A949660B90FD7 9VANESSAGATOR
80,287,156 *088364F8219F5A20BAEB72EA25B5DAA7694A0061 afsalter9
80,287,157 *08894469C20A89050043C2C708E91A9F720C1DD9 SINCE.ME.DED.(FEAT..JAMIE.MCLEAN)
80,287,158 *088CEC0CB50EC6014583846131CAEF4E2A10ABAE AAENPS
80,287,159 *088A7BE293EE56D338457089A170A2A4260BD4DF ALBUMSWIMMING
80,287,160 *0888E4E61859037D8EB11D151027CAF1794A9552 SMOSCHKAU
80,287,161 *088036612B8E4275AC1E04D495B4A8901064A5F7 SNICKERSSAMPLER1
80,287,162 *08844A8F3FDCB31CEDE5730DEC09338852AA7066 SNICKERSTRUCKS
80,287,163 *08817ADFDD5E8885E452FEE26DC0D51D7EA69FE8 abcdefgmargaret3
80,287,164 *088587EE8AD6EBF9F5B47FB22B509CC13AF32EF2 SOILLESS
80,287,165 *088AF6CAE9F03428E816BA1A726BB18A864F877E abdulmcgoff
80,287,166 *088C4C3D91EF77CFBFE6AFA0D7D725F86993DA9B ABDUL-RASHED
80,287,167 *0880CB9EA3C2CDD4E73F1B1551571747C435D122 abqdm
80,287,168 *088B3BAA25E351D0C584F47C0B09B913C75526E6 [email protected]
80,287,169 *0884B9040F3D02571E8EF22C026AE247F18389B8 amilugim9
80,287,170 *0882395F88ED2C77BCCC7A9A817FB1294308B867 SOUTHPOLEBSW
80,287,171 *08840E76346D2B5952BF822E0E51C7E29EF9E642 AFRASIYAB4
80,287,172 *088F80E2F4BCDA48092DC12953A8DFDE26D2AFB2 AFVIGTE3
80,287,173 *0882E7FADBB6A5337C6BF7994E58142CF2065EFB afzujim2
80,287,174 *088133665570180F1C1AD18B3664F5328ADF0378 Splat! o~ O~ @3
80,287,175 *088474673B390DB048EB906A2ECE93AA7A1EFAA3 ANTHONYKLUKAN
80,287,176 *088FD7A59616EFD2218896F27E54F280B566C4DF appellabaris
80,287,177 *088337D83BA3CAA64F16CE77986030FEE5C19613 ajm.j
80,287,178 *08870E9F270A1D9DAA12E9137113D78D0E1C7026 AQiM
80,287,179 *0887BB5C1A7DC96E6CDBFEFB1BF01A5299FA4C7F AREA.160P
80,287,180 *088C30125FA0A1724496E1308448A6789D4C3B91 ALANNARDINI
80,287,181 *088A0490509DF195DDC2E0C4E29D4AED2B7EFD56 ARMANDOUMBARGER
80,287,182 *08821F85841EE98FE7461881B3CC26AFDBC31D76 arnoldotani
80,287,183 *088C299260C1D3490D0C9E72B977EA99D148BD94 ARTICLE417247
80,287,184 *0888B3B13D08B602AC30ACA30B34A59A3F25BE42 AS,:;
80,287,185 *088CDEE18CB4BDDB060E1AAEE74E0301A84A46DA ASSISIA1
80,287,186 *088D66A22449D9105C64824C6BB5FD3E6E133DEA atb8c
80,287,187 *088FFC50C13BD52CB3BE44287AFB4A38037AFDA2 at-outs
80,287,188 *088C2FE577192FF2C3D3B837EB400355CDE3663D sub-scripted
80,287,189 *088B4A3628AE0D10BF11E6EE6AA091DD083734D5 ATYG
80,287,190 *088DF3B3FA650387E27FA6ABDE23657D75B9DCC9 ALVALACOSTA
80,287,191 *088CECE9EBF22F38FE107210F2A88DC87CBDE246 AMAANKHANNA
80,287,192 *088F6EE5B19BF9A557655B8B838D724A14CFD7BE augustusmarcotte
80,287,193 *0882359DE63D83A8BAD66DEEA05E6D0DB011A974 AM)BF
80,287,194 *088940BFA618449915CF504091CA567767E4CDF3 SUMITDERBESHWAR
80,287,195 *088C5D179C10B49E148E9F83159DF4D1792995F1 AMBROSELE
80,287,196 *088A874A5C98D6732224F6EFC686F5ACD50CD67D AULQ2
80,287,197 *088E3A2DC9B68198D0C2A9FA3F1933A55EC9F03E SUNFLOWEGRACE
80,287,198 *088603CBC03BB240B37BBA323222EB5B834E21B1 am$mk
80,287,199 *088BAF44DBAF5DCE6CD3442339C7158A90B27F91 SUSTAJEM2
80,287,200 *088FEF371DEEBF345416C4A46B803DEB1443909A SW1N91EST
80,287,201 *088F62250BEA464527825D66E20AC9DB6D56266A avstrii3
80,287,202 *088F5BD596808FE609D4C56530C13820273EDC09 SWOLVES4
80,287,203 *088885295E39027A1AF736D0D002BC95C759F154 SXIKPXL9
80,287,204 *0885BB77996FBC55EBF171E1404368982C370073 [email protected]
80,287,205 *0887BF8EE50636C3FCDB4BEAC86F5C6E3929B7FF AZHAR.SADIQ
80,287,206 *088E40B17052FA617225E3147EECC06EA29FFF31 B0L
80,287,207 *088200ADF99E97AA505DBA55C65D8AA561CA63EB ANTONEVLASATY
80,287,208 *0884306340D52ED3049EC962DD230DB03209AAB1 b132u
80,287,209 *088F50C0172A3C6405FA163859988CDAE0C21CEE B1BCYB7U
80,287,210 *0882BB1B181CB1FEEB257D47C2774933535FC151 b2cto
80,287,211 *088E368A0E64CE61D88A8C270D79DAA24AEE7654 TALKWEIRDGOALIE
80,287,212 *088B09055DB16506EB7A7CC9D9BA9995704D4B9D AODL(
80,287,213 *088DF141A45F01A5D485F199F2BE01759E03FEF0 a/q)$
80,287,214 *0882AFDA5656ABAFDC35949C198E865E42B3314F aq-07
80,287,215 *08808B224716F3A9EFB63845D4836984E90ECE61 ARIELGRILL
80,287,216 *088ADBDECD9C263451B32B74FBF71EA0476A5B07 %b,a
80,287,217 *0883BAF673A9AA52101F6C85307CD6A1C9054424 TELOPEA
80,287,218 *08832D2429C92C8C45C8AEC0FB316513643CD5CF [email protected]
80,287,219 *088F3EF155273D7E36E65E2B2BF4FC4FB0ADC59A aronfriedrichs
80,287,220 *088298934C2AEC70F18EEB1524851ECECF245927 TENKA1
80,287,221 *088E59BBBAD05DD07FF5C50F7814FEED84FD54AE baloncestistas.del.atenas.de.c
80,287,222 *088723C0E214C6ACEB6833FEA36CD8A4715AE584 a?/sf
80,287,223 *088E5203A08A516A979BF576F9FB823F4F90AB5B TERRYFRANEY
80,287,224 *0887C96DBA584D6A25572C8E8CFF87783F42CE65 BASECRET
80,287,225 *0883D069CBE46E0EB71E9482C8C3049D953C0530 B$BAV
80,287,226 *08866E218891DDF2D4C821BB986F3A3936E92042 AU5-
80,287,227 *088E71EA62E6977AD1D64B347EE447824FC19705 auspicnixie
80,287,228 *088240A13F04B0C2CFD955EC5B68A495D9E37D1C b&eg
80,287,229 *0885EA6C50CA102BDA8058AFE09521F0CE64A80F AVARIE4
80,287,230 *08889AD16C0EBE43A25F79261D076B1B3A2DA8EC BE.SOFT.WITH.ME.TONIGHT.(REMIX)
80,287,231 *088CA4927AE853BC2A8744A1DF18B2FA809586FB tidesoftimepart3
80,287,232 *088C5E87F98222D12AB180BC2215D65AF4EC4F56 B1FEM
80,287,233 *088C2F8222C90299F3007FACF3BE8643433B437E bh.d5
80,287,234 *08886B212F596C507738FD9CA6A14B08E3E20FA6 bhor)
80,287,235 *088F2B24BB4BC01DFDD7E4ECEFF47E04CC092A2F b6ah%
80,287,236 *08857963378E2B62551FAA8D47A810557AC0A8CF TONEY.MCCALLY
80,287,237 *088B26E89EBFD6ACD0F6EEA7939CD4A3327BCFA6 tony.novelli
80,287,238 *08897FB8B7D99BBF08196C738CC0A9ADFF6533A5 TONYTIGER
80,287,239 *0885F4A4E77A88CE37BC705FD162D4C0C90B1E25 bandres0
80,287,240 *088365BD0E59264553429E9C627CF48D7464B3B2 blindw
80,287,241 *088E69F2351155DD21968707492488EC30C21FE2 batlicch
80,287,242 *0885B88CD397037F9887ADD40C148396B6C9CAAD BAWC6
80,287,243 *0888E912E83BDD48BB66BF434BB274FD3DA749D7 blp:j
80,287,244 *08870D252E2F2DB76DD1CE4DA5598A11643972CE BCfp
80,287,245 *088C23326CF58CFEFD65B302728AE2682759605E bebopalula(1956version)
80,287,246 *08864474EB152CFD6BAEDBAE6615B3EBABD09E0B B-).~.`.(O_-)
80,287,247 *088B8AE0EB8B71F0C49BFDC337A9EA26FA875F39 bob-hubbs
80,287,248 *08866CD8E5D5860D4D4D7092EB21A2348F9D9EB8 BOLIVAREPSTEIN
80,287,249 *0881A94B67B566FA1D6011FCD9B9EB1559193ED2 [email protected]
80,287,250 *08823DACD3A934F3578064451BDAF4055C720514 BENQAIDA
80,287,251 *0886F7E00614D3AA1BA2CF0D066E199A84B1671D BEREN1HAND
80,287,252 *088430340F9F70BF291062F5B5714D2F6A2DD2DF [email protected]
80,287,253 *0888B75196C27D54C54E0F6FDE34B65CB539B645 TRIPLACONCORDIA:SUITEINGMINOR:VIIMASQUEDANCE(AYRE)
80,287,254 *088EEDCBFA2C464A23941DBEE85E2ACBB3B5958F TRITVILD
80,287,255 *088D921E91E66049B0F350BBA6C1C4F7E12CB69B bp0wd
80,287,256 *088554F6D8739FEA878DBD0E93F9D29571AD4A85 Bg7
80,287,257 *0882EACB70C1779499BC806C4788EBCF4C5896DF BPYH
80,287,258 *088791B6B7D7140EAFB4472927AAAEF913166EA9 BILBO152FRODO152
80,287,259 *088EC6419DE551F58E51BD21D5102EF620456C68 BR2U3
80,287,260 *0882DA32FA0CC18C1EA531ED9DBE3D83FE95C86A TUNTETO3
80,287,261 *0888CA9A5A314DE4C7A5A4019AEF243F9791AD50 BRAVELY,.BRAVELY
80,287,262 *088A6165CCFA11989B51F3CA822176DE61028508 BIOKÉMIAICSALÁDOK
80,287,263 *0886851B0ACA47FDAB9A3B21D8E72FE74A589DE2 BRET.TAVERAB
80,287,264 *08868DDB36DE5532B81DA9BB741554BEC0E316C0 bjcn
80,287,265 *088AC0D4E170A3FA9945BE9D40D95A6A9C53FE76 B_rS
80,287,266 *08801D9F8D13305C1F10DDF946A2AFB5136CBBBB u+1l1zer$
80,287,267 *088267A7CA014DDD6BEC9DC97084B18B95707AE7 Black-Eyed-Dog-(guitar-track)-(alternate-take)
80,287,268 *0889A34E556599303B685E6F48660AE5CAE43BED UFREBEGREPETS
80,287,269 *088EDFDD7CB0E578014EED26D93D3CC4BDB66B48 BSENX
80,287,270 *088CE0321D0B8EFC2B451A6C0955F954608C85AB BLASFEMIANMELDT
80,287,271 *088A0F5DF7CC78017AB92B3FE53426EED0626966 BLR4D
80,287,272 *0889FFC88E5BC480AAA68F1A9EAA7619FF26B653 BM(MH
80,287,273 *08872EF0B51A235DD93D850989B698A7050EE072 unc0mp1an7
80,287,274 *08809AC45AC65119724D50816D478D449B490E1F boezuelos2
80,287,275 *0884FB8BDB7F7A8FC240831FEEB97D44776871C4 BUEW=
80,287,276 *088905961ED65B7484407ABDC981E49BA2020849 bylfq
80,287,277 *08819F44A20CFD077BFFF8592736B71502CDC6D3 BPCL"
80,287,278 *08893572C0614A0166289D95F5F2F3629B09D2DD C1I3G
80,287,279 *08800EBAAF7A1F63A53E839D5D0B0AB9C366C349 c?505
80,287,280 *0888467A3B6A241A53B34D53C592B96AE6FE4D59 BRADFORDBIGGINS
80,287,281 *08888CD03293B4955F4EB100B28AB61F741FA146 BRANDON.RAMIREZ
80,287,282 *0882D4C8152F6D364AFA0BC42AF72837971652D1 C(9T
80,287,283 *088883381C8B94B3D948405A1E989AAC3F9F98A6 VALOAPINANA1
80,287,284 *088EFB590D00342F4E85F92FA9F7AA85E47F1236 VALZER ALL'AMBASCIATA
80,287,285 *088B8B0FF6B16742A76D0AD2E5C8EF9A6E3C13F0 BRYANTOMES
80,287,286 *0888561E6A05C8E6F400A091EECBD7D806F5B2FE canvas.stitching
80,287,287 *088297002A7A9B2FEDEB0584EDAD05DF432E44F9 carto`grafo
80,287,288 *0884D4C7919DD9C26523BF30A1913E56C0E1A866 BUZZDRURY
80,287,289 *0880463EB1D0D946E1DB6E3C7DCA9D1AD22EE415 bv._8
80,287,290 *0886D88B059E47BECA0D4375E289A6CD9A2175A0 calebvanbeck
80,287,291 *0882130191F465654F058F5C2C66AFD6B0B9282E villalba.de.duero
80,287,292 *088C9CF2DD1D56E848DB6BDBA352FB15F7D610E9 cerro.del.chiquihuite
80,287,293 *0881238225737AA4223E00AC0170CFDDA9820CE2 CFNC8
80,287,294 *08848C5B1D3FADF62B22079ADA4B8C8B280EDE26 carmen-lyles
80,287,295 *088455C5F8D5103C3426B411D409EF1FFE026D9C charlesprudhomme
80,287,296 *088FB8A210CE6705DEC8B6D3A55BAE69009FBAAF CHGO1
80,287,297 *0889375BF95EA9684E8B7E9E8F7CFD44F802C1EE carrie-anne_1234
80,287,298 *0880C4B5696B202AEB55FAA37E4AAC7C25C4D5B7 CHPN
80,287,299 *088D54B318D3023D7FFD705380248CF4E4699FD2 C_)K
80,287,300 *088ED963A44CAE0986A39E3014D1F9A1F41D310D CECIDIA8
80,287,301 *0882A93C58A9EA10193BB5C2006FCEFA44822CD3 CEDRICLUMBRERAS
80,287,302 *088CDB403767E646673AD61C930A40CC214B3E66 [email protected]
80,287,303 *0887B85452923B02CC04C61CF7467E28F7DCF3D8 CEGSZ
80,287,304 *088342A0D6CD69503C8FEA9B9849B5AC22ED111F [email protected]
80,287,305 *08847E14F110AE3B40875A865A4055EE155AC82C WENGFMB
80,287,306 *0881653227E4AFA394534AF2593BAE68C97A6C5C chadglance
80,287,307 *08848286E65EB8BE3B15F1CDA03751D6DF465B5A [email protected]
80,287,308 *088D74D384F43CC616BD756770CA53759B3FD6E5 $ col-sgnittesdlf$ n- inietirw
80,287,309 *088BCB9C9C7E490F5F38E1122AEEAB3FB3FED852 what.you.need.is....(uk)
80,287,310 *08858B3EF9C1660E869CA42A388A68BCFFF53C29 CHARLIEHEWLIN
80,287,311 *0885B75F2C201C60A14104E399DCAAC61EFA914B WHYDON'TYOUCOMETOMYPLACE?(SHUFFLEMASTERHOUSEDUSTREMAKE)
80,287,312 *08885E21BCBBF2F7325668114F37A88B67C12C1D chicagogo0
80,287,313 *0886E13F52B2F78B2714C8612B5FAC419B9367B2 WILFREDOPLOTNER
80,287,314 *08849E1A039AC5B1C84722AFFEB298803740B779 countrydreams
80,287,315 *088D09FF438962F1AAE8D269F9C431250F33ED88 COURTNEYROUS
80,287,316 *088675E7505F88BC69561194323F2C45606ECF12 WILLIAN.SPINOLA
80,287,317 *0889CA7DEBC4A2AFAEF472B9462A7E0541EC62BD C-P
80,287,318 *08858A56C1BBA6C1CCCCF12EAB4797542B006497 wiltontimreaves
80,287,319 *0885F7F3B7C3503E3C7C885D50C87A5C1868A3DA c:\programfiles\microsoftvisualstudio90\common7\tools\deployment\vsddialogs\1033
80,287,320 *088A51201D8BEC506E39CAB8078106831036296B CHPN
80,287,321 *08837534DBA89EC0809369715B0B14DF3CCA277C WNRQQOKS
80,287,322 *088773C464025A7FBF73E6323E4FEEDEE74FDA36 woranuch.khamsart
80,287,323 *0884B3F6404F9D82EEFC79B1451AC28C638327D6 ci+li
80,287,324 *0880C0C8EE30C3F31A7F1D3A3271F20B5A6D7C48 [email protected]
80,287,325 *088CB0AD1B16890BFAD9F921278F7286A07E5A71 cit?x
80,287,326 *088701D3EC9F1D9D9378FB41511F23544F1E4324 CJL90
80,287,327 *088A60D02E4E5252BE1F6CFF6C9C95E26E3CC455 c+;k(
80,287,328 *088548026DCD1AA797C519F4480811CECB1561A4 CKHK_
80,287,329 *0883F47D71B6DBDB05E2155BC007581725501B8E clariallabes-brevibarbis
80,287,330 *088AB23CC12E32258F8CBAAD345E91BD10CDC684 clavierists!
80,287,331 *088225BA160297181101EECC8BFC97FA9924BBAB csherry0
80,287,332 *088C434C1B2A3CACA138BE747D0732AB902A5EB2 CLINTONFLAMIO
80,287,333 *088464BB2D442E85F85F4F1A191AE623F14FA74E xa$y
80,287,334 *088A986A116EF3C5115560C4DDD90E5D623ACBAD XF;?
80,287,335 *0882C1E4665A1484D1AF54BD811A8C2E24B2E004 C.W1A
80,287,336 *088017000C2414630F401B026D86CC008AC18057 CNKRB
80,287,337 *088CEEF146AF6A53E5F50BC1FDD82DDD6EE782FF COHW9
80,287,338 *088EBD75395E11F0300B6CD190F66886CB4CC4A8 Y114950
80,287,339 *088D1CA9834780DE4172A05CE27D24AD9F9ABEB2 [email protected]
80,287,340 *0884A56AE6B880DA7C3DFCD060935CB6FC703D0A [email protected]
80,287,341 *088FFD9F0D9B57AE556039532CD306D6D5736EBF [email protected]
80,287,342 *0882C41359FC151AF3D2F8A4ADE1E818B0AEB119 D;7QX
80,287,343 *08825083DB34BE7BF87263AAF8A07719B46E308F DALBOGNIJ5
80,287,344 *088ED624364F39FC4AB1F88695D10EEC04B200A4 DAMIEN.BARROS
80,287,345 *088A029650DDCFB506F08891AC123D3188CF5F38 coz2
80,287,346 *088A17CBF485B5312AFD0B18268AA7E128FD3617 YSORRAPAC
80,287,347 *088C7529543AA086C17C19C6CF79563812F39DE4 darzylbym0
80,287,348 *088B9F8ED0E61C38A32A082D6C9175B857D72BCE YVONNECRABBE
80,287,349 *0881B0D2ED208AE41F87F9B14AC130C9E69CB40B YVONNE.MUGODI
80,287,350 *088A0C64B3499202D48F27D8A2720403427FC60D db#tr
80,287,351 *08800FD5479DBE2911FF0B8990C017986996B987 CTG3.
80,287,352 *088AEEDEEF2BC1B3C54F6380D04FC513D9D8ED56 cukf#
80,287,353 *088432296F45D0FC39D9712AA64DB2578E1A92A7 d/,dz
80,287,354 *0884545BFB2C0185D323D3885BDD4C426B571678 cuteuren7
80,287,355 *0885FF2EA32DCECA1D6DFF981CB2DB25D9DF6130 DEANGELOSCHOOLEY
80,287,356 *0886E9AA0539EEEC4F6EF1DAC7D17623283C3A0D ZIE-LOVECUTE
80,287,357 *088C437F97C1B0B638BE450F856302F3FA24D96F c:\windows\system32\dllcache\ssstarsscr
80,287,358 *0882201BEA6C677DA8FB51E61315E34EADA152D7 ZOGNITKEIN'MOL
80,287,359 *0887A2E018665F7BCD4ED0D00DF4907738A30645 ZONKSES5
80,287,360 *0881D13348BA6B837111DFAA0804BCE6ABD72C40 cyrilcharlton
80,287,361 *0887D3F170150FE9C3BCD0722F6B7423DD722A03 cyv%8
80,287,362 *08887EBB9BB7C1D9D97FC2F20EAE073A4677B5CB ZREDUKOWAL1
80,287,363 *08818B0D4F84A557329CB3E986D052A3BC07EA21 zsaed
80,287,364 *0882FEC004FEC6969A73D4CCBEB337AA815055BD d0b-f
80,287,365 *0889007D61677059F9202061E0801AB7E1F06710 D4C78B4B-A3CB-3B10-B35B-6CD2849479DF
80,287,366 *0886BFED3C3A995CFD928CE010B33F928919AF41 D4XGH
80,287,367 *0881E5A168E78D24E7E59514876A85533ADE38F3 d6br
80,287,368 *0880698DC3EA5FB776D14E6C5EFFC5E0E5A3D137 DEVIELYN
80,287,369 *0883218865F29963D740719F1FCDBCA11BA48053 D9FB
80,287,370 *088DF76E70D98751B8A9A25E70918FF456C609A4 DFUK
80,287,371 *088156938BCC22CD274A748E94E52B96877D1366 „dialogs
80,287,372 *0886A39A0191F3EE535B6D79CEAE2B614B5109A4 «КРЫЖ
80,287,373 *08876158A13355E4D417ECFCB1DF8354EA5014DF DAREGO'S
80,287,374 *088F238EE4B740DB67BB62C3A5E140C4E182A5F7 DARYL.MUNDHENK
80,287,375 *088CE4C7D94D6D81BA62308D8E4734C53BF9D9DC DATE-FR23
80,287,376 *088499FA3CBBF8F3D98D89B889B712ED464BAE2C dipan.banik
80,287,377 *088B276EB73A8257EE52C5F5A1C710349168817E DE3M
80,287,378 *088BB21FE190507DCD74BF4D7AC09AAEED5C200B СЕЙРИГА
80,287,379 *0880DBD6C5B436D47CFEDC3C62A8F5377D1880E1 СТРУМИЧКО“
80,287,380 *088FB571DFB09D483E311BDE22383B3D67BE4B18 dominic-broadus
80,287,381 *0880BC6767D552E65A00053B6F3AD5395ECEC58E detatcin4
80,287,382 *0888543E2ABD69B9797D344272BB9237B8B562A5 DEXTERRAFAIL
80,287,383 *088ACAB3AFF1205AC84CA11DBEEEBDE8F06CD350 df/6r
80,287,384 *0883DA5D0A44A0D04AA1A0A99FBDB64F296DD7FC d(;g
80,287,385 *0884D95150D4DE52AC62EF9C5B2DD42A8628A86B DSKQN
80,287,386 *08840B69DDAE966DDB2A3EF76DA37611A1032C69 d.tcn
80,287,387 *0882B13289DC06BEAAAED08AF4593894BDD42788 diblasis9
80,287,388 *088C9AC6D8106846770151A91BB259D5BD43D9B7 DU8DZ
80,287,389 *088A705EE0BEFAAD01358872398BCC0BC454676C DIRECTORIZEDBSW
80,287,390 *088595CEF13B234E3777579BDEE8EBCE66878100 dus9_
80,287,391 *08817C64CA6AC7C1D158F220743CC2C8A9905F87 [email protected][email protected]
80,287,392 *0888F1B81D8DB786B08D55B2785515A2B8FC550D ebef8d48d97c4058aa5e961f7aacdfa8
80,287,393 *0887E5C6A38154E2A733EF3B290A44DD22DD2FA9 DOODEENVOUDIGE1234
80,287,394 *0880BC901FCB4A8265F8F8D2E57C36C25E69C7F7 dopae
80,287,395 *088F2E6905FE80B88822AEB93754FF7BF6B1DC92 d)rsv
80,287,396 *088B3DC82A911409A719A2B72F3DB1E508273E05 D+ub
80,287,397 *0888A3FE2DDAA1A269E8C3723D3527D2842A2D17 DUNCAN970
80,287,398 *08836EDA5FCB0AE0168AFADD49AE5D8981F8BFBB dvfnq
80,287,399 *0889B617A7DD6A201C61BD8B90FDFC443D11CFAF DWAYNE.FAIRALL
80,287,400 *0884A81B159C418C17003B2611DBE519ADB8C373 EL;Q7
80,287,401 *0880AA91680567B5CC6C215A4E729880DE9C348D enavdom
80,287,402 *088A382A30AEEC47B2C63CC7F0385C5D00D9DC6A ECNATTIMSNARTNON
80,287,403 *088F535E89F73C9B8148D2E184EB8BBACA9F45A8 068CARLA
80,287,404 *0884C2D27D6C8144B628049502AD4049B8250FF6 edmundcourtnage
80,287,405 *088279BF2BD6EA04BBEBD7037BA22483F7E42E48 ed.oconnell
80,287,406 *088DCB70DC72D2369BA6153727B55ABF09DA4D1A [email protected]
80,287,407 *0885183CF391EB99F1CDAD1901CBA05354650A5D (>_0) o~ 0~dq
80,287,408 *088026494FD8FCF411E679537028AE7121EF3F21 epm&=
80,287,409 *088FB99C5A6A0A36D5D489E852F1CB58EB049D80 1062247 EIGHTOFTHETOP10IN1979WERESTILLTHEREIN1989.
80,287,410 *088C98B7F55A4EDDF998217B3713D9FA6BF6CE3C 1063292 "BEFREIENWIRALSNAECHSTESDIEAIAKSAMOSCHEE!"
80,287,411 *0882857B17A59B071912C8CCBCBB1D53E845800B [email protected]
80,287,412 *08814766A15447F82E6C490CD0F558961C14492F ericknjeru
80,287,413 *0882EA195A6EA31764573A53F3BFDD3BFEE13BBD 1115989 NYTOLLAANAJETTUSIT
80,287,414 *088C538BE5857605234E9C78DA4131983C1B4B79 erinhassian
80,287,415 *088934ED067EFAAD4D12182069060EDE577D8E4C 1212685 ZUM BEISPIEL : TRAINER MIT SIEBEN BUCHSTABEN ?
80,287,416 *088758779C7DEC6CB867383C1AF78450F1312B3E ELAINNE7
80,287,417 *0886894A6622AC690F3238C2BC1A359CAAFFA08B 141562q
80,287,418 *08807D4B4014FAA480BFF43336B8CB68F015BBCF 157656 o-andan-sonra-yeknesaklIGIn-yerini-dUSUnsel-terOr-aldI-
80,287,419 *088851BBA526FBB2A27CEFD1A46DFD5F28C02255 EUCEPHAL6
80,287,420 *088104F2F860A5EE27C86924C3B2798E02E50B45 17031589
80,287,421 *0886201527F7C418BB730DD68561D91968CE3645 emiledehrer
80,287,422 *08801C155626EBEF1C1FABBCB74E2DDE3657727F EMMANUELMATHENA
80,287,423 *088D937A1C66D2F8B4E02746DD923A9433E3A4D5 EMPIREMØBLER
80,287,424 *0885C06C757797C1876A24C0DF1E6CD498C7CC25 emv0
80,287,425 *088DAFD36C9A8E8B140C5F26C5C847D04B9DC75C 1942092 radio.b.zwei-spezial.,.20.05.uhr..
80,287,426 *08830FCB0B1A89B89BFF0B269E5906A82AEBBB37 19801209
80,287,427 *0885BEB422D856B0FC994263D3419CB53E093CAF 1991522 muistio-t
80,287,428 *0886524738B217CDA20416193CC895D4273F2F12 encyclopediakdkatpi
80,287,429 *0887FE0786E2CD0D71287D7747FD8D0FED27DA58 EYT9
80,287,430 *088F94A9AF04D2EFA15E82B002710E50DCAC66FC fa_c
80,287,431 *08859B81238A6F622EDC6E753071C52D8847AA00 [email protected]
80,287,432 *08862B05EFA6C7BAA1C236A7CA620BBD8FF080AF 1iamrenegade4
80,287,433 *0886D92012F0FD55D21E0234D7AD82036C3584A9 FIDEL.KUBIS
80,287,434 *08848752F3BE856CB2B3565080987F84492DA8BF ERIN.TREMEL
80,287,435 *088B1C202A1258EB22C1E3CCFC1B1B9E69910CAD [email protected]
80,287,436 *088C5879ED1F0754839E072923CF2D504CAEDCCF ERVIN.ARNAUD
80,287,437 *088984210F4C3A3C030D824E39CC7AEDFA99BE68 ERWINGURIDI
80,287,438 *088CA139B2C1DAA073B90110E02600F37AB73B72 ERWINSCOGGIN
80,287,439 *088A62FCD8A4B173FF0C52C8606D3183BE3DC343 1-MATKAPUHELINPEITTOA
80,287,440 *08863938DB9412C5CF84B51CDB3DE1E7B0B4CBC4 FJ0!
80,287,441 *088D593A6959F366BC19A92C06A4AC1631800F0B FLOES ON MIRACLES
80,287,442 *0887AA7B14606D2B0E7F1433D07B943B882A64F4 FOND4M3NTVOOR
80,287,443 *088B48BA5B6E26F613470CBCBE885D5D944F2C6B FOREST.DRUMGOOLE
80,287,444 *0882150275CCA0542F1251873160C833C4B2E5F3 [email protected]
80,287,445 *088033AEEA3482F05B6FD6DC4ACEC6E1EE91909E 1.tarkastusyrityksen
80,287,446 *088390B4F83C8F54DC64633E5F6F0A813D30962C 1 TEEMAVUODET
80,287,447 *088415D9E756EFAEA23F35A3E240E232E962CEF9 1THATCAMILLE2
80,287,448 *088875A0CB531354D120B09BD1BC4FE01C6156DC Freedom-Sucks
80,287,449 *088AE76D2B1D0C8D686CC4B08CD5ABCD3C486C65 EVAPORAB3
80,287,450 *08892FC99F104D12D339AC8FDC9C9AA5E84A1DC8 20VILLALOBOS
80,287,451 *088076339D37D50061AB5A3107738EEF3AB21A5F EY5HA
80,287,452 *088C43E754EB409B62A0D2454086947A3F491BE4 GALENHEARING
80,287,453 *088CFC4BD67D990F994EB1B7DC640DD2C9F9B2AF EZEQUIELOMERSA
80,287,454 *088B1CC5CE5EAC57DC8CAB9B63FEA1A5BC980162 [email protected]
80,287,455 *088AA6099671A4B48C066FDAA61808AEF95F770A 2-lakonuhkasta
80,287,456 *088C15B4A97B8D396985BB85985EDB4A201FBC64 2MITREISSENDEM
80,287,457 *0886776785AD2AF0030D542E16680095BBADCA4A GFRANKIED
80,287,458 *088A1BFE17FD60A360ED4FE956E3CFFEE83A287C gilbertprofeta
80,287,459 *08897309D9957317370B2781F1A4D12C429585D2 giss17
80,287,460 *08846D402A537C65B29D4D79D5234EFEA01999B8 GM2XYZ
80,287,461 *08826B2AAB95E136E875077285139053733C6A71 GNISSERPEDNON
80,287,462 *0887D71AA5B360FE09F854B07871228B00FC3DC5 GOONY002
80,287,463 *088B4210018F22C379039C44635DDFD1AC4B106B GR10T
80,287,464 *088BDDE1612C8D6C04A82E3A239D7EB57AFB5EB3 FIREWALL-LAGS-BADLY)
80,287,465 *0882ABC9902B4610980909D0606B2742546CD064 flambagesed
80,287,466 *0880215FF2C1FD9C5D2380805ED18FD07A617C82 flat-pack-fantasy
80,287,467 *088240541C03676F0420C33CC95F1BC92E64AEA1 3-p~.`.(~_^)
80,287,468 *088B5F12E9AA87AE1089EF527FE1189BFBE4300B gumdragon9
80,287,469 *088A79673EA993093B2B382654349BFE35D19BC5 431223 mutta-miten-erityisesti-juuri-verkkoteknologian-hy
80,287,470 *088A16D18826807DE2D256ED26F1A939BE853AEA [email protected]
80,287,471 *08861858B82364863FCA1410CB6843A4E2E6B085 4HOUSEPOINTPOINT
80,287,472 *08816150E9BF387EF5E181433AF09CC06847C22E 4HRDLICKAN
80,287,473 *0882976678B2A3CA7C42D82DC411A5B6D2BC4A9E Foundationstop
80,287,474 *0885D45647F2DBE0AB9874B03C443E2B4AB3F0EC 4-KREZOVIC
80,287,475 *0888FF872377C450D8FF0345CBDD6FC4B28D3E31 franciscalamity
80,287,476 *0887AE0B653C8DC7C0F7CE99D3EAA20DCA67B7F1 hankchisnall
80,287,477 *0882C7FAB3BA4F2E95E054B0B18EEFBA10C4DC69 harryzywiec
80,287,478 *08884723D9ED2BEBC0DD1CF378C5DCA9F2A573EB HAUPTLUFTMASSEN
80,287,479 *088CFF5653A8B248074570D5B3368C58F78A1FE2 [email protected]
80,287,480 *0881E1C22D9204C5167F95E5C84904A8F17ECA36 530445 ALMA21:15JAHEL
80,287,481 *088A24502880F69BBECBAA8818FBFD3DC9AC1C02 FRTHRNCSING
80,287,482 *0881ADB834B8C04D49D5775ECB42CBCAC86A7688 FÜBŐL
80,287,483 *088599F72F3960ACA08E4E77CFF8595108080689 henryvangundy
80,287,484 *088CECB9C91B5BB66432A4078E06834794717D54 HERIBERTO.PERRIGAN
80,287,485 *08804184D1FF26E6C10DF54BF2CA8EC2B0FD8BAF FURUYAMA9
80,287,486 *0886CDDB26E624A39ADBBE61FE032D2717AA86D0 5AVALONFAMILY
80,287,487 *088894B21DE1B07D988E1D3D6F1CA81E070132C1 FXQZ
80,287,488 *088DB5AD0CF9B47DA86C241AFCFD5113CDDF53E1 5LAIROTCNIT
80,287,489 *0886566820E9D23742CA92A2922DD2F1FEC2E1B1 5MALIBUBOSS
80,287,490 *088127159D7B0FE6925D4AD4937E128D9A625F02 5MARVINPETE
80,287,491 *0888789700010F765029DFDAEAC8DD72395432A7 HORACIOHALBRITTER
80,287,492 *0884C089D9FFEB3CB9190FE7C80FC1BC6A6E30EF 5PERDICINE
80,287,493 *0884E7B3911A755BDE1EBDA612F48AB33128B858 GEAT
80,287,494 *08822D6AF01170241F59D75BEEFB79164115DF81 generalclass
80,287,495 *088581934213339A6041665568C60B45B3FB9AA4 5 WAHLZIELS
80,287,496 *088CCA3502176EE6F334E97A3D9BCC6B2216E211 608neil
80,287,497 *088C05A11424009F23D8247A11C7A5BE93866827 GERRYFORNEA
80,287,498 *08842C23FE9F06F7B8415A560BF5B485BBB3B263 GET-ON-THIS!!!-2
80,287,499 *08850EAA4C5BF35C165E60D209571D01FA4B887A gg-speaks
80,287,500 *08841AD142ED7643077920B11E8DA40676C7465C IAMSURFER53
80,287,501 *088FB09673271BB4EE443A4EC9D729AA823FEBB1 GIUNCHI160ITA
80,287,502 *088216448BA29FA173E047F783591F2789737B08 [email protected]
80,287,503 *088F7D6C8D34F88DF7EC37F4B5FF684451455A6C 6CFIBONJOUR
80,287,504 *0880D8D176049AD398BE4C7C1DEB349EA78A4E61 glecoma0
80,287,505 *088BCA99F4D1E7D11FB6B8114E2DCA5E94D3436A if-you-love-me,-really-love-me
80,287,506 *0885D3491034BD6E6F053D5003AED1CCC5EEA46D 6JUNEBUGROXY
80,287,507 *088133055B3963AC2323447A548BE57A858ACEC2 6LAAJIMPANA
80,287,508 *08808696E3F8D2946C2CAB52E630D56B9A3B93D8 [email protected]
80,287,509 *0880A51F3F8E5AF2EA1F95A0C0F81FA54FBD3725 [email protected]
80,287,510 *0888A3556F5B5E8BF2D40A69EAC6E6C8D88652E4 6MAPHOME
80,287,511 *088826BCEEDA5B4A065968A085491F5A98BAC1B0 GRADY.GERSHEY
80,287,512 *0886C018AE2C81F27C46F015028094F3E40E28D2 iloveclaudia38
80,287,513 *08812ACDC2A09777B34237A611004257CC706B86 INDICIEN
80,287,514 *08848AE9710D8C9AE64849B3F2F8B9A312DB172A [email protected]
80,287,515 *088DD4C71FAE68CBEDD7D83A82A085FC82D5C041 [email protected]
80,287,516 *088B3B53F09B1F8A3181CD43B1A37312826E0CFE GUYVERUNITS
80,287,517 *0880865B9570A76FC05101CC16783F4FBBE82917 GVAUDANTALKBEAST
80,287,518 *0882C358A12F1185824B069C796F62B3F19546D8 GWAPITOAKOHM
80,287,519 *088842906A7807F68B012C1282029A0D79F5B230 gyalázataidat
80,287,520 *0885D0628ED92C637A51200A9FB710112173990C HA728284
80,287,521 *088D9C6BC00D31DEB2ADE5189644E087FBD305A9 HANNAH-NICOLE
80,287,522 *088A18F0E3B947C0E0CCE2A5B324950DA56EED86 hannalaser
80,287,523 *088B9D9BB200F4AA34A205065C04277925E3AEF8 7HARLEYSECURITY
80,287,524 *0885A0D470F0E353CE2F1FCF566884B08869AAA4 IRITWOOD9
80,287,525 *08883BC4131C09DC1F74C8091C6F7BD2AFD42529 HBROUGHT2
80,287,526 *08851F5B1F488C60807B740A5DB55D4EB2886140 7TIKUNEN
80,287,527 *08872A746D1158328794554F0D1EFEBA0B3611C6 j6wf
80,287,528 *0887D45229E679336E87CBC0815A8B409A6241FF jackiesella
80,287,529 *088F448CE7E50A52C6F00C7D7F9D14B59694419C HELENPASCOE
80,287,530 *08898C137B127A17DDA691B001EC23E5B40532E5 jamisonbuettner
80,287,531 *088E69D372F27D13E688623CF1554B4190B8111C herbertpascal
80,287,532 *0881B6ABED25A9C4C74229C599ABA5D12A139E02 [email protected]
80,287,533 *08800A3E994410241CE4C20C5311E98A9CB89C9E heterocarpous0
80,287,534 *088E451115CE949CD30455A58479A5F672BBE355 JASPERKOWALCYK
80,287,535 *0889D0BA1DBBCC4C27F64CEFA377DEDA2C87ACBD H!FK
80,287,536 *088F0F08BC54E02060FFC40C2317A11BF42E26AD HILTON.HALPRIN
80,287,537 *08811A181270DA043A7E2FD93F28527182A0F39F HINGSELED
80,287,538 *08871B1501B19EFE3CE1868197B3C62CC1CB9183 HIRAM.WOODKA
80,287,539 *088DEF6DAFB1C707513752FD304301C98CB9755E HIRTTENSTECKEN
80,287,540 *0884D05794208E2527E8AF306D4731827E61B45A hkthxnrferyqoam
80,287,541 *08829D08851068658F7BE4D4B00C4473CF78A33D 8DORSTIGES
80,287,542 *0882CB20AF11E02E11FE97DB8D04D392B975CB00 8EXMARINE
80,287,543 *0887617043F3C38CCB49DE7A238C006DF14BB306 hollisderastel
80,287,544 *088FF53E12722117311B5AB2ACDF9F00A8B6BDE6 [email protected]
80,287,545 *0885C47DA255D7D1A073AA0E3AF24B61E6F98BA0 JAVIER.ALPHONSE
80,287,546 *088B580AD524C71E3C5D222EC168ED25813805F7 homerbeston
80,287,547 *088A691DF9DE2DE035DE842898C1D0C339027E94 HOMERVUILLEMOT
80,287,548 *088E828CFBE507D82CEF36A3CFB0160C22307908 honda1wesley
80,287,549 *0884DCE071E9B63D4E46003C4DD6343160084845 HORACESAILE
80,287,550 *088DAF7D07CED4B3CAA6C2E6CAD2AB9284159EB2 HORNYONE1973
80,287,551 *0881E7D8E07F6E03BFD36C5A0D35F4AAC0A5DABC JED.SADORRA
80,287,552 *0887123705C98DF5AB9827DF0F8DE004E908BFF6 JEFFEREYLIEBENTHAL
80,287,553 *0885173030668FC6A0BEE7148595B8CDB89D96F6 [email protected]
80,287,554 *08847D18771771290DC7FD3B138E033B07599698 8opgesplitst
80,287,555 *088C1FD1E74232FEEC659792403E76E6B2FDA13B jenna-jade-rain
80,287,556 *088EA2D229CAA94C059E21CD4817601032FEE743 8======P.~.`.(~_^)
80,287,557 *088CEE4FB7679604FEF00E7645712DABD0798F46 j'entends-le-loup,-le-renard-et-beyonc
80,287,558 *088245741723E549727232E0673047026629A35B @hqaaa
80,287,559 *088D7AF9EEBEE89F8EFEDDFB7A054E8ABB1A917C 8SEIREKCI
80,287,560 *088DB3D90FA715BDDCD0AF1613323119BD03DD85 JEROMYGUYETTE
80,287,561 *088102557797E11FE6712F88FBC03CE44F856277 JERROLD.DURBIN
80,287,562 *088E4887DEA807E4329B98361DB8E879D715A1ED JERRYPHAM
80,287,563 *0886DF14D7056A6055857F2EF16E3CC8791CE906 jerusalem-jaffa
80,287,564 *0880BF265C2A205F26FCC1A357D1DBED3522549C [email protected]
80,287,565 *088A09A7566D8529AE069C2B558AC9AE2107DE05 huiling.liao
80,287,566 *0881FA12D130E42A1E73108D54A5E2DEE8F03225 [email protected]
80,287,567 *088D415AA57D15E5442E8255A4A859085158985B JICHTLIJDER4
80,287,568 *088094C495C28CCCE4525E73D762202861E230B8 9638F56F41F1A53FDCBE7F273E83825BSOLAKERS34
80,287,569 *0887D86FE9C6E717481FD2E4DC9C1ECB1EE07B84 JIMMIEABBINGTON
80,287,570 *088DA41F4A2004FA996BA09F6C4BD27104759F55 [email protected]
80,287,571 *0883CFA97BCE3988D20826090C4CD296060D8D32 [email protected]
80,287,572 *088F3FF49E0A25C2A5813CBE07F0CFD2DAF1E7AF [email protected]
80,287,573 *08893475F985FEF6467474BE8D0CFC05C5962C33 joanne.facer
80,287,574 *08814D52860A593DCACB9E484674DF6FD6F8AD5B joantuff
80,287,575 *088D1335BE469C67D5343AF282633F1BFB6F060C IANACIONALDEFUERZAELECTRICA
80,287,576 *088D0E419E144E258B9A33CC9B2C4BB58E7039EF I-BOX.(DISC.4)
80,287,577 *088995DB4A050AAB4D1F49556C03D566CF5047E8 JORDANLUDVIGSEN
80,287,578 *08883959ABFE4D5A7358223C05C17082F4596A01 joseduncans
80,287,579 *0889FCA2A7ECA844DC556B568C20E2B89DD22768 9MINIMUMX
80,287,580 *088594CD4F03C8AC3FACCF7F646BDBC412F038A0 IGNACIOLAURIMORE
80,287,581 *08853C71D49F5CCFDD01D4A22755EBF1F01B984F ikesilguero
80,287,582 *0881FB27A192084A355F5FC8D8312D0550046328 JSANDEMAR
80,287,583 *0889440DB553AC28B054403E29EAE80CAF3C3205 J\[U
80,287,584 *088841BC0714015F69F06F76C69A44F555DDF8C2 JULIOSCHAMBERGER
80,287,585 *088EDF166E68A26BAD2D5EDCBD5C18834A30141C ILUVHARVARD13
80,287,586 *0881A93DFCC3DA606E161819F506366EBC0F1FC7 [email protected]
80,287,587 *08872DB9475FFC51881C9B658904540BE6FA0C62 A218J
80,287,588 *0885F2EC6C3E4B0D87DACD0E9366F60F6F99FBDB a2;%s
80,287,589 *08873904E0D6AF2482F648F45FAEDDE7C7EAD9D0 institutionnalisent!
80,287,590 *088DA68E279FE761F4E9F3771351868EF1EA408A #$(AAA
80,287,591 *0880B6F514B7B1CF4360C274991A6B228E549703 AAA\W;
80,287,592 *08863A1510AC16967E6A5AF1BC82C32ED7FC2A0A introduzioneallademografia
80,287,593 *0889BE600CB4689E27AB79E6E3991C589507BE1F in utero cannibalism
80,287,594 *088DB9F2D037B3A573567B817F60306717515729 kaufmome
80,287,595 *0882E1AA1363DBB30300D8C53D0992FF7255BA41 AAC;FS
80,287,596 *0883E0D2D4C58A8BFADAC5FE7E48D2BED9A06EA1 aaczh<
80,287,597 *0880A7E8B2AF347220790E5952FD70E124437D7F KEROSUING
80,287,598 *088353DE9DC12FEB9958DB1FCB9BD342865B897B aais$
80,287,599 *0886B0C3370B83678FF9F2EED5922750AD2D5047 AB4BA
80,287,600 *088EF17BDA41C0F9200684E1702BF2CCB1205CE8 ab5e7
80,287,601 *088CAA4F3853AF5C284A2EA0AA38F227E7A0D01A abcdefgmisty4
80,287,602 *088C41E4DC4561BDEF446D956E691BD3A837B5C3 ABELDAVTYAN
80,287,603 *088C85506FD9A710CB12178E9568844F361367A7 kofferschreibmaschine
80,287,604 *088AB71E0E17BDC84B5D271F256CA550F6A35FAF Kokane.(Olly.Perris.And.Ashley.Sinclair.Remix)
80,287,605 *088BB155AB4C0036FFEAD49C4588B6FEDD7CC95C ABERTURA-DE-PANTANAL
80,287,606 *0882C9E8FD44046A95BBE392D2285011B925C5E7 JACKSONLOCKWOOD
80,287,607 *088975D97C2046765C68C46D2312016675851D8B jacquestinajero
80,287,608 *088834AEFE82B9BA4D8A61868050EFEEABC23AA5 JACUNDA0
80,287,609 *08844BC48E38C4FB515C2634F6C42AE739B62D66 KRIS CRABILL
80,287,610 *08804E6291CA610E8618BDF80F8F7EEB80C70FB8 AB=W/
80,287,611 *0888D4C596FA15F16F9DB6707269E6B3B80A86C7 jamisonluaces
80,287,612 *08823652506C8A4759DE215AB796E54DCA15F228 janeenicole
80,287,613 *0889C6A9863F16F8D58B53C3A534270C1B7B4093 ladybugjoey
80,287,614 *088E45E88BD443070BD9E3F3F8462E0B9639B1B9 jason-schlangen
80,287,615 *0883DE5C36E047733A31A5D9C5ACC63A957D503E jason-yearby
80,287,616 *088B3FF384920A22252C65D9AF1B87DA721566BB JASPERLOUDY
80,287,617 *088C5201A09CC2C9D040BE9AF1BACB2D1A0BF764 LANNYSTIEF
80,287,618 *088F87767C677D739BD9D9281DDF4440D15346A4 aeaverell
80,287,619 *088799382545D56A2C2C5C509E40394472829A7A AESEPHLES7
80,287,620 *0888F27569AF2DE1625B15D714514F997287BFE8 AEWF%
80,287,621 *08849C770D5EE474CE2E81CE94D4370E861D7678 lawrenceeasterling
80,287,622 *088FD4AD9C8D32A0B6F44B24FF2E4DC1D3A870E6 lazyi.com
80,287,623 *088F8B49FD5E4AE94E7DECF17090EC593D7AA458 LBQ7
80,287,624 *0889E3450CD696EEA263F9595F56489EEBE8AB1B AgoniesBeThyChildren
80,287,625 *088384561F195D2B1505463EC57B8F502C2C2016 JCT部分で信号のない進路
80,287,626 *08893E26F56EFD677173E42C36DF02681EF9EE71 JEFFEREY.DUSSEAULT
80,287,627 *0885A2829C1A5F70B16F5ACED953BE903F5CDDBE AHRD0
80,287,628 *0882D9C8D5B8C63EEE9706094495471A120DDB77 ah;v
80,287,629 *0888645FA9AD7F891B3D3017D4480C468A3C7A67 $AIL8OA7$
80,287,630 *0880D033C8CBD4D7DF08168E0DE2C638D9D0C927 jereblancato
80,287,631 *0885EF60EE255C682A205ED12F121C8C3B6B216A [email protected]
80,287,632 *088A64E5A793C973A62EFF97C231021373869958 AITENEB9
80,287,633 *08844359BEF50ADE2B3483ED3BBD2965149BF947 [email protected]
80,287,634 *0885389E7F9AC29302E9A41F6D137427C1073640 aium
80,287,635 *088E51A000AF4731DF45D0EC3BF75D43727FB3CE JESSICA-HAQUE
80,287,636 *088BA25AAB9B4484F71FD471975808BCF52D3D79 ALBERTONEALE
80,287,637 *0880B16189858C1109514D7A893FE46C6C5FE187 .ALCOSER
80,287,638 *0883412C7AE9EC6B38CBA4083973E5DF2735CB4B LIMBLESSSCULPTURE
80,287,639 *08812CF9C7858A4C7A95189397F1F75EEFF4F9F1 ALEX.GUDOV
80,287,640 *088531F602213FE5887DF6E1F242577D74515B6E ALEXISLESKY
80,287,641 *088D505FC20794C8C256190D430424B8BC69E924 [email protected]ANPRESTELCOUK
80,287,642 *08807487010382E1CAEF03F2D2F4B05B4B42947C alexvarughese
80,287,643 *088F4DD5A719BC20DF9FD71FF0E0D5928604A9A5 [email protected]
80,287,644 *0884AC72A3FC777379F911982142708644D88BF7 [email protected]
80,287,645 *0880BFD566CCDC7DBCA3FEEC18AA4181AB321260 [email protected]
80,287,646 *088478D2737669E977E39A46C497C3ACC2A3186C [email protected]
80,287,647 *0881B78792C7FCD7EC54A1ED89207A6072509249 [email protected]
80,287,648 *0883C9FCF37062C675825CD16861E6F64949FFBE allanguillerault
80,287,649 *088355028A06B88757655D701C4D5F4DBB077309 joao2066
80,287,650 *0881058449ED0427949F57B0BD8544BB78EC87EF JOEL.SAARELA
80,287,651 *0880278A5601262541EB4C0044F45AF6EEBCE0AA JOEY PELAGIO
80,287,652 *088903D43267FA92C5B632E8944805E1C2D5D987 llubolla
80,287,653 *0889F354D9F77D550E963908CE76CEDF66E96D61 ALPHONSO.FRAINT
80,287,654 *0883290E68A970024B778DFC0BB0D3922343897B JONATHAN.BERNDT
80,287,655 *088E66272AC83DFB5603B4119A150176669D20F1 $ALTVAND$
80,287,656 *0888082538967344280DFFF6D71BC7397EDE9BD6 jon-belo
80,287,657 *088B901E45A271ABC56200D368DAAEDE2A755194 [email protected]
80,287,658 *088BFC7BA251FDD119D23AC060A229E645215CB0 JORDANSHIMADA
80,287,659 *088C3F8BD67E6FF2EC97B5096CAB90F7539EF370 ALYCE123456
80,287,660 *088D1775213C3DB5ECA7AC3271D8D7F94ED968D8 JOSEKID
80,287,661 *088CFEC4B22CF0091A30E87F9024E49E53679B42 JOSEPHINE TILA DE GUZMAN
80,287,662 *0884B3772CE7BBE95B505FA2EF80C082ED92E80F JOSIAHWILDMAN
80,287,663 *088C5E69B1C1D81735C64923AFA1901404C40E57 JTPHWP
80,287,664 *0883BC22E1DC92BEF7B72B98FB6C63265AEEEF58 [email protected]
80,287,665 *0886C09ED88E487594F2D1A3DC1E090545118A85 love.proge:.love.recordsin.proge-klassikot.1968-79
80,287,666 *08885A7FDC0CCFE00980C22EE7D2D38E19C4604E julesvanscoter
80,287,667 *0885E8CC73631A80F71AED4763C79BCF3DF2602E lowellmilo
80,287,668 *088C21FD9A0A2631040184EAAAA31C7076F1137A LOXOPHOLODON
80,287,669 *08823F54951ED0A6C64CC1A6826B180CB868A792 lqez
80,287,670 *08866F249B65934C1CE54147BE523D5339466452 andbrugs2
80,287,671 *08829E384A9000A308BC0526DDFD41B7A323355E JUZZ8NAGEL
80,287,672 *088283F0C974952A908B5C4AE71FAE4BF43DBF26 ANDREWWOJCIAK
80,287,673 *08822DCBF4F6BAF6FA79FEC7E6185549E32FAA59 KAPITEL21-2:HERMINESGEHEIMNIS
80,287,674 *0889A2C23D736296DCBEC99E95249E8E5B639695 KAREN.THISTLE
80,287,675 *088C2F296609EEECB3DFF03E2FA16F8905A2FF01 luzamos7
80,287,676 *088E933B657AF46B47935E0D144C9F4638E06905 ANOMENE
80,287,677 *088B72DDCE818F86E3D45122F06A98286C7D5749 KATTELY8
80,287,678 *088943E55DC8C6E8BF65035BF6FB53F8204DADD1 another-cha-cha-cha-/-cha-cha-suite
80,287,679 *0887700CA7161FF895BC0D9895861761935483F1 anthonoied
80,287,680 *088D70E0A6F4CBABFC5AF4DE6B8A86945F8A0070 KEITHGLINES
80,287,681 *08821E18471A419DEB487BF625C5CEECA6C0B8C7 apjvp
80,287,682 *08863E5A48D793190EFB8ED88C18A6638618EADC ken keeler
80,287,683 *088A10D732E741C0C2C0D206854840178EA64AC8 [email protected]
80,287,684 *088CE35A03BA34B3D410552B4DE1BF0C0198143C madisonhurlingcomwww
80,287,685 *088061797EFCF84F3E697B529CF7B04C2F40836B APYAVATIIRYA
80,287,686 *088574E50BBB1A913792401BCD4B4CE07E5FCCB3 KERINER
80,287,687 *0888AFB32DF2A77DFE0850883619063692DEA499 KHAFEEZI
80,287,688 *088EEBB6B9F12F34FF39EB344DEFD2BDDB67EDC0 khalid-ramzi
80,287,689 *0884393D898A87EADF26B5CE668D7D6766D2D436 AqVV
80,287,690 *088B7B10120469974CCD52F904575DBA39F4B597 MALENIAGO
80,287,691 *0888155E3290FDC71BA1B844F8DA8178E62EE263 areadosvg
80,287,692 *0883634CCBF2F22A19F688BE3A2E0CCF46F16D54 KIMO566
80,287,693 *0881AD8E7DEF22785FAE8277377D2EEDD65A083C MANUEL.GUNDLACH
80,287,694 *08896CC208B9E6F8BC6AD1DF112AB8E69C932F81 ARNOLDO.SERRIN
80,287,695 *0886899FBA89BCA176BEDAD1609E1BDC145547E3 ARNOLDSCHRUM
80,287,696 *088BE1204893757E763687249C5CAD740CB419C1 a%rns
80,287,697 *088CA2E79C95742A63C4468DAC93DA56BABE640E ARONSIEMBIDA
80,287,698 *08870C3F98B9F91376404723525CB2A160A5F943 KJAJALLA
80,287,699 *088DE0070AED7666C897030E36E694B706BE5E56 arronmacken
80,287,700 *088044C3E6AD9B3207D37216F71FD98411D5BFE9 MARCHETTIGEOFF
80,287,701 *08819737F563F43737D485DC52438202EC253AD8 MARCOS.CHICHESTER
80,287,702 *08839A57D30B5F63BF3A8C6DD9F74EF4BE449125 a,ruc
80,287,703 *088D08F5EB9F62B81565602F7C6709D4FD0C2481 KONVEKSIPEITE
80,287,704 *088756FBD332A54895E9A9B9216F60C0E79B6E57 KŌPUTU
80,287,705 *088E753C9BBC41CD1B0E54E71F3124417687792A a.space.dub
80,287,706 *0880931E04BCB309508359751CF3911E7A58F9CC ASSOCIATIONINVOLUNTA
80,287,707 *088201EBFD7858CE6EA08F24A13040F85EA3F842 ASTINGLY6
80,287,708 *088EA840326F488C89B33A9B6883A96CAA597F26 At#9
80,287,709 *088DEAE0527552B8DCB8838E97037DB372E532A6 autumnrichard
80,287,710 *088808A19861072A7CD45171AB66BB68AE869A81 kouvari
80,287,711 *0887D28880514B850C9D64643764D67A274532DF MARSHOLDAK
80,287,712 *08820749270ED7BFEB7390251C56AC1B52FB6F71 AW0UP
80,287,713 *08836CE29B84B40551EFDFE9A217B1090637FCD2 [email protected]
80,287,714 *08815DB529739A1D84C26C86B9433F35426BFACE MASS.MEETING
80,287,715 *0886208C6EB614F6459B399D517E2BBC28EFBA83 AXERUJUMIWIS
80,287,716 *0889FE3BACC57D6A7FA3B0FC68FF46848E179B51 ayanna.burns
80,287,717 *08867EB19504C5FB54CF8FF35228DD9537B0658D AYH1T
80,287,718 *088A6D1E0D5D63BEA11F48D5B72CF7AA3B4AC40D B$2v
80,287,719 *0885F503226095BD75AFB4D500D1156AD8D722A5 mekadokuga
80,287,720 *088A923508341A388EBE53BA9190F07CC833380D MELENYN2
80,287,721 *088D6E7FBA02B46B5DBA92CF46E7EB1F8AAA448A laiterlaiter
80,287,722 *088004B62FF18A59E863F4B4BB1E42ADD2367CB1 MENAKA-CHANDRAN
80,287,723 *0880FEB4620026503FF596D7038CA7E33E8FFB0D B83K
80,287,724 *0881A94F4F7C026FCC0BFF2B1948B4B54BEEE284 larbetrevorcas
80,287,725 *08826D7803F8B41A73AAF53A0AEFB1726432F7EB metalhammer-(heavy-mix)
80,287,726 *088E961F3BAE4F0F4325000FE82A7EB38B7A4BAB [email protected]@l
80,287,727 *088E7D216E23D37F697C3EC1BE5B1BED5B37F21B l&bband
80,287,728 *088E0F3331B3307E382DC2584343EAF980578AF4 BASKETBOLLPLANEN
80,287,729 *08846C6C7CCABBD846CEC53D1F9F00A6516F4E33 B=BK
80,287,730 *088E28ECBEF2888C67C1A190737D45F745BFFA65 LEONARDKAMERAD
80,287,731 *0888A2126D1CF7371C0DBAC40B2C63B531352F74 BBTYNERCOMWWW
80,287,732 *0887548D5F8610E7D7BD5F3FBBA1A7C0E5E0DA7E BBXF
80,287,733 *088FB9DC2BFC7D24ED154D6759D2198DC6FB30FF [email protected]
80,287,734 *088B68B0D971DC513E7487D80187E3B8D93CA4B6 MIKE.AUDIRSCH
80,287,735 *0888CACB3E7D71B14B08652F6D5C5CEA112B6983 BCt(
80,287,736 *0885687732DC3DECD67A7FF234C3B5AEA5E9B268 BdFb
80,287,737 *0881DC9253EA5AE7CE9537E25B230346BB95E33C bdnds
80,287,738 *0889D2F5AB3FA6383D7A3C96F37E78DA86FE449D beeluva
80,287,739 *088C94CAD3BCFD4AF361AA37C2A0C9E2A406CD97 LEOPOLDOOUDEKERK
80,287,740 *0887AD1142BFC5852A90B4CD3A15D2BF98213986 BENNY.FENOGLIO
80,287,741 *088631966F89967F67CEA99C17C6123AF9929A0B bennypospicil
80,287,742 *08888BF7D8D1D297138869B072047F3B0818E7A7 BENTON.WILLETTE
80,287,743 *08850D8B1C6327C1673EFDADF784DD4B54FC8D68 BEN.WEISHAAR
80,287,744 *08877D9FE3F62BFB4031AEE660127964C383D815 lesleyeastman
80,287,745 *08823118173AC085BF8332B806A6D9C17EA8C88A MINISTRY.PRESENTS:.THE.SOUND.OF.HOMELANDS
80,287,746 *088358CFD5917B800520A8514A9368B6BAF7C9D4 LESSTHANMODERATE
80,287,747 *08823B259FE2724B6B9187A77A77EB109D57076B MISH.MCCARRICK
80,287,748 *0882ED659604AC6D546920122E611AD8555EC2BE MITCH.CUADRADO
80,287,749 *0882847A5249334AE4921A02EDC577565BD30DAF [email protected]
80,287,750 *08880ABBED4B0D8B911B735A5BBD44D5DDADB835 MN4TUR35
80,287,751 *08871072354C96A4A3540DABF131D3975512C284 MODESTO.YOUN
80,287,752 *08810D273E653D28D4F3BB8FDDB4728C7689372F bf85s
80,287,753 *0884A13057FAF63FB92178E7D3CED2E287B75DA8 bfhb0
80,287,754 *088806F7E394CB35BF22FB7B68F69DE70271B810 BIOGQ
80,287,755 *0888F8489D187A315E7EB20A1E0B288FAB4DE693 b+l#7
80,287,756 *0880BA98BA81F2401F37683A59C6D34FF846B570 LLOYDZENISEK
80,287,757 *088CEB8DF22FA21B3FA5E6A0DB37516DD5D4B0CB b_lks
80,287,758 *088357C565D663939024A303694A87F44DBBBD51 BMBC-
80,287,759 *08825202474E3E3CA6FAADEC2C4B7BBAAFFAB254 BMKIY
80,287,760 *0884FC6A35979C6B0F9695951822955E74DEEE16 LOUGERBATZ
80,287,761 *08803741F1CD930B18B95192888FCA2CD7B27891 my.important.life
80,287,762 *0885C80C5C7B1FE5FE08873EEBCAECF8FCF15150 MYPOPEYE64
80,287,763 *0880122F384754810B52FAD195E4FCAEC8B1A9CE n0n$pec1al1$+$
80,287,764 *088880DECFDF4B0EF140DC0DEBDB6EA1CAE15CAC BQFG3
80,287,765 *088C2053052E06C9704F04DEA0BB7BD931F80757 BR34KJ4W
80,287,766 *08887E7423389A13D2DCBC936914D6731187032A brasklapp8
80,287,767 *088E8F6BE95FCD57C8580E84A9F740CC7DF0C5C8 LUSCIOUSHAIRSALONCOMWWW
80,287,768 *0889983CB6AB0E2385ABC9055A68D0FB4FD62521 NANGUILU
80,287,769 *0886CED26FDC0E58874C795F762F7AE751F76761 LUTHERWEATHERHOLT
80,287,770 *08811B935A05B557E638C7D28A4B5B1D73D1E1DD BRISTANT8
80,287,771 *0886A46B7AE2293463A887A7BD546A1FD6CC6949 L*[email protected]
80,287,772 *08821E3E499EEE4767E79C8FC4A6180E499642E2 M0N4RCH1$+1C
80,287,773 *0883A9D26237C768D9FA87FE0F912B2AE94AB21A BRYANT618
80,287,774 *08875CDD91C073692A41ADE4669BA9B5B7F1C035 NELSON.NOBLES
80,287,775 *08891D86A8C1CA79BFFE474E7A99C2D004D6FB2F maga(tercer
80,287,776 *088EC9EFE2E9D8498369A4528AE5A714669959D9 BUDDHIKALEKAMGE
80,287,777 *08869DFBA83A76AC325D8E475CEEC1D813CAEAF1 BUDQO
80,287,778 *0883554BF758761A52CB868E7B1C4E52DC79B694 NIEZAWIESZALNE
80,287,779 *08809886094D03604BB4FE870DA84C8D838C1FB3 [email protected]
80,287,780 *08807F38CD9B4FB62FFD147D835F7F9252E6710E NIKKO9649
80,287,781 *088119D7292101E4CC442E5F6332AD6F6C1096AB BWR04
80,287,782 *088B47920B5E99F3FF67856CCF018352A2A09A12 MARCELO.SALTERN
80,287,783 *088D456F013220208489219C1ED7CF905CDBFE55 [email