List database


# MySQL hash MySQL password
80,260,001 *0885CE9375C4525817B324A29380B63288CC9FCB ZEINNOVA5
80,260,002 *0888539DA7C26E4F771252B970FBF52651AF703E ZEKIA HENDERSON
80,260,003 *0884DC8BB78F01669E52AFF7914D5A94A02834E6 ZENAXZENOS
80,260,004 *088A2C1E9D93962A61DB0CB43C786AC5FC430308 TOD2BATTLE
80,260,005 *08800F988135F64854ED29ABC00B62F5D4594155 ROBERT ADAMSON FOTOGRAFO
80,260,006 *088BF08D6260FED201458FCDB10FDF24CB3F144D zeynep-ozkut
80,260,007 *088092ECBBA34D551BAFB222A0F96172CA6FF299 TOHTORIE3
80,260,008 *088B1DE519EA494D54469850D4D2B522ABA60F79 [email protected]
80,260,009 *08802ACD07875874D6F52B14B76277F2C7814196 [email protected]
80,260,010 *0881E90A774FD8CE3729031AF87E927DB7140C12 [email protected]
80,260,011 *08825D2F3B736B256C06496199CD3893A7CD0682 zhell.bartican
80,260,012 *088545BB114610DA5670D184BD32F0724A13081F [email protected]
80,260,013 *088104A90B94DA04BD8E307B7DA72C07C40D9B42 TORONTOSASKIA1
80,260,014 *08863EE52FE14AD36D50C699D7BD37AEB5BE3BAA [email protected]
80,260,015 *0885C3396FF715A77FBB97F4E5565594BC1E8449 TORYWADEL
80,260,016 *088FF273ED10A381BA04504476D81D87F6C2320C ROCKPILE»
80,260,017 *088CB6C2631F75E71145DF10E530CCF2CA278278 toygbsw4
80,260,018 *088CC27A3C09DA8F61198E48FED5AD8BF9301032 RODOLFOSASSER
80,260,019 *0886C24CCEFA582FF0FB12785B0265220AEBE3C1 ZOLTANRIST
80,260,020 *08899486C08DEDF601D40FD05EEA14C0BFD59B86 travis-ferrian
80,260,021 *088055F3BAB3120B7A18AAFD2270FB08937A0821 TRAVISLSTANTON
80,260,022 *088134D948955A3232E03893042787621835BDCB ZOHRAASAL
80,260,023 *0889253876478FCDC1A1FBF8DEBB827E0E3E5DFD ROSAIA
80,260,024 *08801A10F121EEC57BA053AD61D6B6348D90A8BE z\tj
80,260,025 *0884580B424A3A202E07BEBF44B2E75D172FF67B ZULEIDYPIEDRITA
80,260,026 *088045425974E2863F8B296772FB30D891577413 ROTHEROTHE
80,260,027 *088C373F5B571547E752FFCA7F3DA0ABB0441FF0 ROXANN.ANDERSEN
80,260,028 *088526B36174E3C78D637FF5B532054C2557DE65 υποδομέσ
80,260,029 *088C7E659D8485CAE6B26A6A325781EA3FD11FFF δέμελιτσ
80,260,030 *088474C05EC8BD4865611B6D7111BCF99DA3D557 rozletem
80,260,031 *0884730A31F5CEA87C09DC62315A2D5B4C1BCC40 [email protected]
80,260,032 *088DE28212FDA2ABDF7C3C3749D6A43A2748C6BC TRYMELATER
80,260,033 *088CAC784A563B49DC0ED86A8B373BA67687D1A6 «АВД
80,260,034 *0887AC2C03D1B1765DBDF1A94268539BA83E9773 ts.reed
80,260,035 *0888BBF82BA2936DEB57E27DDD9CE00BF0506B29 RUDOLF.OBRION
80,260,036 *08856566B5A05243A832083CB1A4CAA78E8EA89B ttahundragrader(featjenny)
80,260,037 *088E63E2C436655106C24BF9DC875C42F5DAD8D6 ВОРТИХОВО
80,260,038 *088D2DD937BE92D7553066791F19A2B7EBC0A28E ГЕОПОЛИТИКАЛЫК
80,260,039 *0881798D832E6C76F4E4004E41B01CD7D6651E07 ГУҐІН
80,260,040 *0883BAF9A213E5A2107FFB028EE9F3D301C94B1D russelldegidio
80,260,041 *088AF7481C0E7B2FA6C4A1CE485DEBF14B2AB4C6 RUSSEL.MANRY
80,260,042 *088D689EF3D650E6DF134AC6F296E05A100539F2 RUSS-FINNEY
80,260,043 *08855F28139AB83D597A90CABDC73A423CE72C77 ДУНАЙСЬКИМИ
80,260,044 *0880EEAC87C1DFCA8681439B299F29D3A45E764E [email protected]
80,260,045 *088CBDA23D757B9214A7FE4FA2B3C9F5AFF27DE5 RYISKELEVÄN
80,260,046 *0883F389B6549A47E804C8C9C76DA7156A2CEB75 нумбон
80,260,047 *08891930A7A708412EF7B3BB7AEB0B27FAD15B96 фюжн
80,260,048 *088B470ABE3DCBA3A7328B4B36D538C62E44B814 SACC1884
80,260,049 *0888EC81013A7EF0654485DC66A07EA592A19142 TYERESHINATAYLOR
80,260,050 *0887EAD7A3BD9756B1E161AB0AEFAF404B0EFE19 sachnowschtschyna
80,260,051 *0887861F3C41883D66A0F54B55D327AD1B3F8992 の南方500Mの沢に挟まれた
80,260,052 *088A8DAEBC170FF31D837A2EC6BAABA67EA58600 u7ef4
80,260,053 *088CADDDCE3C3384C1A89BC30A86F6AEF48C35E4 SAN-SALVADOR-DE-VALDEDI
80,260,054 *088C278103FE064A50AF8249CC837D004209C8D1 uitgezochte?
80,260,055 *0880842301772765A30B2E8A22E0F70E5E2B0653 u=)j
80,260,056 *088E3FA65935264F5E78E779EC32B03A6B6291F1 сизиний
80,260,057 *088CA4C1082D745657A44EFC14C4CE53476A3AC4 sash+sas
80,260,058 *088E220B783C2E1F259484D70945E5C0DCF073E5 стамер
80,260,059 *088B524A7543E2CABB8437B15FBB11DBE1FB31CB und3r57andng5
80,260,060 *088CB9B5C07A39F51BEACB63291C27F9D83D53AA уонсел
80,260,061 *0881C3075AEC191BA9405640AA32F50E2D5E9594 ՄԱՏԵՆԱԴԱՐԱՆՅԱՆ
80,260,062 *0887385317D95032C09E1B375A188954A2188B82 SCHEIBLER53PS
80,260,063 *08815D48479E3B150B74CDCE7F60B896F0A915C5 UPZONING0
80,260,064 *088250CE625C536F708A73D45FC9872941766773 üsaks
80,260,065 *0888D9C882C01B113B28A2AA7F44BA5B8898D868 USERBAZDM
80,260,066 *088B166494B6FAD179B6E634A2A80D3D3BAC2649 schrottha
80,260,067 *088D81775A53FA1B79C9118DFEC71A6A31D01078 uy8
80,260,068 *088D2511C5B4E3F7ACAD4672A82C1E746E31A0C9 SEARLAI
80,260,069 *088449466298A56BD7A2F1D742DA02899271064B vachekbsw
80,260,070 *088E2E7603171B424391A6EE2E4D5F8B06A0C20E VAL.CHIAPPINELLI
80,260,071 *088D1652473F1A275A0D09C6F35F12FC0933B459 SELAH711
80,260,072 *08891DA5A0313739FC022A492B52E9FF10C9A563 semele:actii,scenei."look,wherecithaeronproudlystands"(iris)
80,260,073 *088154DD6DDC53375FCD87B59CD6C5E9CBD58DD9 VANMEN
80,260,074 *088048AEB0C2D35E3CB1BD33742DC2ECC4116F70 VEGETATIVE2
80,260,075 *088F21337B12BD6D8D88EA842089CE291D842650 VENKAT-SRIKANTH-BHARADWAJ
80,260,076 *0889805BE6B99523A775F6F1220EE4916733442F SEYMOURWESTERGAARD
80,260,077 *088E635F861F41A49C84C21BF556675E97B442DF SHADOWSIX4
80,260,078 *0888C63EAB029D971AD843A0FCD81211C6459416 SHAIRIN4
80,260,079 *088CD4623CBE27940F47A2DBC65190BF19CEEE39 0$A
80,260,080 *08822B07B347B1AA8112DA2C7E8D6A9ADB76150D VES-PASS
80,260,081 *0882E6B4A451E1B28F4238C7C092521D9E6B358E shelbytrimarchi
80,260,082 *088597A29A5DF189C44B0D229C426130841FFA93 10221168
80,260,083 *0885F139CCF7AC3431E567E110DE479BA6B4D4AC 10.grantlee
80,260,084 *0887888038ADB2F5DFCC34FC325D9ADECDDBEF28 victorcesare
80,260,085 *0888EB00C325F89A9B43652BDD9A61FF31725AEA [email protected]
80,260,086 *088D2254608D14977C6D35BA26D6AE3EDCD36457 1372853 "-ICH-WAR-EINFACH-SCHNELLER-
80,260,087 *088AE3D3F8CF66FC505DFDCB71BA60DECDF51EE3 1388300 hygieniaosaamisen.k
80,260,088 *0889435254188B484B6A2240243852AF9CF054B8 142COREY
80,260,089 *0888A7955087094C158796CE75D7BB79F28514C9 VIRKAITI8
80,260,090 *088E4D211413BB0A2218344AECC0CDC185722A7D 1772335 SUORITETUSSA.
80,260,091 *0881FD640DFEF57A9DE3FF94E64918738C4E2B5C simplehuman
80,260,092 *08811E964BB007EA8054C2444AE5C3B99E5999CF SINGINDED
80,260,093 *0885072C1B67C25604CACA91072728F7DCDB4F18 VKR0RQNK2HUC
80,260,094 *088AF9198C4C9466070B8D0B39830BEBF1D22243 SISOTAMOCRASONALEM2
80,260,095 *08873C815218359A410A4154D27E57F063893043 VNSETLING4
80,260,096 *0882D4EB5B31619928FFDE416E07558026DA4331 voc1f3ra73$
80,260,097 *0887B695E728881574DA7DDC69953BB206FF18D6 SKITEA
80,260,098 *088AD6872564C4C17F8DCAB5688A458D2E9BF623 Sloppy.(Surrenderdestroy)
80,260,099 *088201E90208091F34C9A234FF5DCF209A43981F SMÍCHOVSKÉHO
80,260,100 *08815196B2EA0C9281478D53CC29301E6A725224 1.alu-schutzblech
80,260,101 *0882F8DA2A34742E2DD536D5D082A3DB87554C28 SNILTSAE6
80,260,102 *0883488458EA6EB7F3D9EE0E9737D07A8FD51858 0ilovejetta12
80,260,103 *088488DC79CD995AA2167B3F6B8708505151E0D4 0theamazing0
80,260,104 *0884CD0197B8BF314942AF12E52B05C842724C5E SOEBERG6
80,260,105 *088FC2899630AE5973C6B42E1FEF3C33EF48D1A6 SOFTROE0
80,260,106 *088F57EA45DD30B18EB3B4C57F6B0957B3B0AFD0 1BUNDESLIGAFUSSBALLERIN
80,260,107 *08860B232F7444637CD831D80967EF39A9767C95 SOLUOPIL0
80,260,108 *088F2B17E44DF33B5B7E59BA14C37E9009760B14 WALTHAMSTOWE2
80,260,109 *088F3255583ADCDEE16770F192C3B1CD6137A430 1ceken
80,260,110 *0881E8F14AA518C3DF9E5D9E1E2E75E13F5DEF3F wanda.gordon
80,260,111 *0888CC53D4FC92BD78FDF22019B0BF8756F3B90A son-cou
80,260,112 *0888C4C3A6046AC91D5FA018A9DD1D3C0585BDF1 1cnn-berechnung
80,260,113 *088F924B1637D33C225C336315EB0617256A484E song pine's theme (complete version)
80,260,114 *088A3B7A27AD85BC9F11DA8930D19012D90D147C [email protected]
80,260,115 *0884333DBAC7AEC08CA2F7FD8B223B8F9328C708 WARNEROBRIANT
80,260,116 *088D5E29CEBF7B7CE23DB21A6462C2706F2E855E 1G<
80,260,117 *0882D33E70A259457C1A36FDC7B7B8101450C5B0 SPAINHAMSTER8
80,260,118 *0882866D6265D7422008174829E059F06AF4CE9A 1GRINTER
80,260,119 *08818821B360A8DE8B89732A1159111BFE8A00AC 1 HORSE-FACED
80,260,120 *0881C9ED5B8E24F00C4C5806004D0C849228803F 1.HYKSLABORATORIODIAGNOSTIIKALLA
80,260,121 *088CC5E41643D9B465683C09C857117F5E8507F7 1IAMLOKI2
80,260,122 *08874A8246C3C028E664C320BBC0F02E91E51D3E waynegao
80,260,123 *08898CBFE9BDC46BDA2EB2811743BEC2083DD823 1-ISARETLERINDEN
80,260,124 *0889706EAF85A48E73BC833AB0FA92958186919A SPLAT~ ~ ~D-----P
80,260,125 *088DE8D8E983BB24DD7DA2D5D345BA5FBE0AF7A7 Week5Section22
80,260,126 *088D3B8A558AD971D8DE6091348E1DD9404D0EEC 14.P
80,260,127 *088658216D0B5B860EB9E5FDAE96772A361736BA wendell.adrian.brown
80,260,128 *08834C0F469FA0E05D0CF4F7164DF1461C64FF5F WENDELL.PIKULA
80,260,129 *088C2DF0A4C3FB35FF7CC0DE2F6B5E56183D31D5 1607339 USKONNONVAPAUSLAKI-VOI-K
80,260,130 *088261C0081BE4FB03F2DA2A2ED355569C91AA92 Sploito~O~.d======3
80,260,131 *0889BCC4BEB503D29BB396DA5B12F94E38535B45 sploit.*.*.*<p
80,260,132 *088BEB0B77E89FD9FA7C5264BCF02128E1D864C7 [email protected]
80,260,133 *0885C0FDCC34EED4EEFAD69D78E7286DF7BA877F SPUTTAVI?
80,260,134 *088DE45EC1083AC6FCF3AD9E2D9A2F12EE038BC4 SRBMBB
80,260,135 *088EB3463C920BF268D6A11ECADEADDA18D50FAF 1mymolson9
80,260,136 *08819E5C7104E36B6F02E20422E2D170F11281F9 1812347 JOS-VELALLISEN-OMAISUUS-MYYD
80,260,137 *088532A34C8FF485023E20754E94E5AFDCB41DD5 1.PIKARAPORTTI
80,260,138 *0884C1C10EDA3134E14213EFD7BFD9F7AFCEC53F whizzbang
80,260,139 *088358C882F9BC54108D0F73F8EE1C22C7D7CBEC 1 SAHER
80,260,140 *08855CCC4760D5286255A90D96CEC330B01217EC [email protected]
80,260,141 *08897C3588604686FFFFA7C6BF9D4109E4B82C46 WILLIAN.FLOAN
80,260,142 *0883AD18889E3A3306A7C5C8D6B4237232E26D0E STARUTKI
80,260,143 *088DFA451C9D79CA56AAB0F9AD6E26B6C4EA56BE 1anotropia
80,260,144 *088DE7CA700B7A77552AA148F40172F2F1AA1AAF WILLSTARING
80,260,145 *088E62DD5B574694797A57E01A3BC556DBDC78FB 20051794
80,260,146 *0887655B6344848E5B981C4EA4CD0B91B5CE3735 steroscopic
80,260,147 *088BEE279143D7B50A67504CE1E1173CFB884930 1-CHAOTENROLLE
80,260,148 *088162D9A706A733E6E0DAEB88713746BCF777B0 218404 SISTEM.YONETIM.KARARLARI.
80,260,149 *0882864C3952084785B629B63B4AAD8D307C84B3 WINSTON GRENNAN
80,260,150 *088CDCBE41051F4631442CDFC54E6689BDFAB203 WISDOMSHOOTER
80,260,151 *0889F8465BD22E033381EB32DA8722851ACEF0C1 22OCTOBER1621
80,260,152 *08811187FE5359B7719BB241BE05A78BCAC309DF 1.FINANSSIKESKUKSESTA
80,260,153 *08896A981C67FF98825EBDEE06E7C6918C75EB0A world.war.i.tank.starts.up.and.maneuvers
80,260,154 *0880FA1AC3077F269B16731F71D0EE895134AE27 W,;S
80,260,155 *0889BBDC13C4BE9B15D917DD1B8CFCEC5FF3C0BD 24january1848
80,260,156 *0881D16268818709DE666DD95DCD9998C46D7426 WU.KAILIAN
80,260,157 *0885BC2E5272FE7F62080A3E6581C9E7ACCD7A3B 2594369 ALUEEN.PUHDISTUS.JA.KER
80,260,158 *0880A638C50D86D70E25A4FFC2FF57D8C1CDA68A WWW.MEDIASTORM.COM
80,260,159 *088E89CA818D71DB0C3D286108F13F3A5E3F1041 WWW.PPOSEYSFLORIST
80,260,160 *0889A90F5F79C49F03D08195A1FC2868995FE0F3 2864136 MARJA.T
80,260,161 *088972C4865E154953C85E451FD5B29793C920C8 SULPHAPYRIDINE2
80,260,162 *088EC67493A4211D1FC8E2C372D931C19F8AA167 29-ARGON
80,260,163 *08876DDF2A30A57A882812F37ABBC4D8AC088B46 sunilgoyat
80,260,164 *088468ED40AACB34D619F97E151AF67D131026CD SUNSHINELUCIES
80,260,165 *088D3EB62D98A7BEC53EF12390A18C5A421AB306 1-kaupunkikoiraksi
80,260,166 *088659638947C308F75712DA50D958E057C41503 [email protected]
80,260,167 *088813EB6B87B6A937DE7C4AC9F46306C2F4CA04 support'''gladly
80,260,168 *0889A45830155D38D445D0555BEB1087C609711A 2ENILLIHC
80,260,169 *088BDE7CE8A680ED884845060837BEF1E477102B susan.pulsifer
80,260,170 *0888CBF019AD15AE06353AE7896008106928CFF3 2 firstseated
80,260,171 *088515AC40A374B1C661BEA1D6B7DCE2864A1BA9 [email protected]
80,260,172 *0886500E26F8DFEF8ACF0B4248815A8ED3189895 2HABLASE
80,260,173 *0884D699456769E94460B2916F1EA898CC3F79F0 SWAPAN.KUMAR.MONDAL
80,260,174 *088FF9AAD44F57CBA51FF9B87288155314F9FC78 2.kelkheim-ruppertheim
80,260,175 *088B02294A0A17C8480C703AA389CDC25812C20B 2.komplementaermedizinerinnen
80,260,176 *0889C1EDE72BE3BA77A30386C15D39AD4DC432ED XSMX972
80,260,177 *08871D9F304D19DED3B4E7F72CADE8AF6462B1A5 2.kreusel
80,260,178 *088A4AF57E7367CFDDD28D6D1A56FC210E517BE0 sylvesterdech
80,260,179 *0889C75C0FB6CE07A93D75ADF1E43BCEE7909B61 [email protected]
80,260,180 *088D582F9C1BB90129D449C155667C2966311100 SYNTONISE
80,260,181 *088999FD59730C072C07D2A3CABA5CE556DC5A14 2SNOW6
80,260,182 *0880E6C92A433B77743F70A625A7A3A78D50D7CC 2THATMISHA0
80,260,183 *088C097934A15BCC8CB2C992CAD4CB64C803DDFB TABBY BISHOP
80,260,184 *088D40D1DC110D81AE82FE933B786435BA26B291 31CC065B-8468-3712-ACA8-CD655752EC04
80,260,185 *088D4E7C516E3CD6CCD134E3D2B4624E59BE27A5 talk911886176
80,260,186 *088262788E97D26A52DA07C6AA689A3A5F188F4E TALKSHYAMSUNDERGOSWA
80,260,187 *088106F1086EBF8E6D8CE7F188EAEDD900FC239F 1olamazsini
80,260,188 *0882A3F23BEFC765572E3B3B402CBEC05BEA802E 1 OVER-COLLECTIONS
80,260,189 *08870111938796F8A49B1D086179B28EB781E210 [email protected]
80,260,190 *088B39136411F6637539D05A2990EAF7F1934437 1 pkk-sissej
80,260,191 *088323C6C654A312C2450D959606F9A8002E28EE TANGOAAA1
80,260,192 *0885379B86D307511C30A72B819742672BEF162D TANKERGENESIS1
80,260,193 *088691D5DD648D01423927DADED86B540641CA79 tannertrue
80,260,194 *088EA9E6CD0532A2BE38C0C9D87E0034D34CD517 3======d~0~osplat
80,260,195 *08896F4AF0F5CF73E002FA48DE67F2719D030691 TASHWANDA9
80,260,196 *088A1AA3E310D99D92939B5DBEC630C1B7A1E03E tasmania
80,260,197 *088E470ABB4D1474F01C72E5EFBC4E2B4DB43DE8 1SPEND-TIME-WITH-FAMILY
80,260,198 *088B5659298C4B36935E8497894F5A60D6FC68A6 technocrane
80,260,199 *088DBEB6231F148F034693B63AD3694FE278B77B TELEFONSTORMS7
80,260,200 *0882B46BA77A38614043B31E262483A0FF33D29E TELOIVIRARREF
80,260,201 *088DB922DCC03625B24273E3BB368871AB3F95BC young-de
80,260,202 *08813662DDBDC6400586C957D0E9262AB86D4543 tenderheart
80,260,203 *0883BC1FAF56BCB09023C294976354A5E9FD82EB 1 TUPAKKALAKIAMME
80,260,204 *088B72651CC193A9D5E3A7C52DC22D0B8B305E58 [email protected]
80,260,205 *08816353AF86A949AEBC08E49E1E96222850C795 1.VAATTEHIA
80,260,206 *0881D54D4D884F38D6D54ED852D39D8FD059A6C9 TERRANCE.KOSOSKY
80,260,207 *088A058F996B8670E203A4F7E896E74F54A3CA84 TERUGLEVERDENS
80,260,208 *088C44BF8B82C963DA87EDC2422056580F16429E [email protected]
80,260,209 *088305CB9374334976CE449E0D3FB5FAD7BF2EA5 TGRICHARDS
80,260,210 *088F9CB1EDB6D550EFE571E4237AC256AB27C93A YWULIACREATZA3
80,260,211 *0887A920753796B9A211241D71C5AF2B8EF02813 3HOMEIMAGE
80,260,212 *08894C8985A02124D13FCD7BF409EB6A446A52DF zachariahtressel
80,260,213 *088E6C2DB2ABC43449D26A0AD162F7144A20052F THECITI5
80,260,214 *088D915E59053BEE8C2D553381BF1E17610053A4 thecursedconcert
80,260,215 *088636D8153FA88B13DB93187AA9A9830E2058A7 THEGREATESTHITS'93,VOLUME3
80,260,216 *08843CCC1D67867492394A02C679BCACD0EFE52B 3=P**(00)
80,260,217 *088917A693ECBE093E4C6172C00A95986676CB7A 3 SAITY
80,260,218 *0887F73E383975F439AE7CEFB44C0B8E03060C0F ZEHRA FAIZAN
80,260,219 *0885A93B934CA8424091AACB25F5662866586968 ZEOTPUNKT
80,260,220 *0887CD75D2A19BCDFB34C720F994F44A1BC854C9 ZHANGDISHU
80,260,221 *0882E43347E3EE433D69C075EF04CA85A1C8339D the-mozart-collection---clarinet-concerto-&-clarinet-quintet
80,260,222 *08892AD761706AD97348E1762138DDD1C07337E7 ZHANIELA
80,260,223 *0889ACF5F94C44C693943DE4DD7988FB0C01BBC7 204448 er wurde regelrecht zerschossen und zerbombt
80,260,224 *0882681EC2DA62A5A98A305F8DE3643517CE0E48 2068321 auch-warnholz-solle-sich-dem-test-unterziehen-.
80,260,225 *088EEFC2BE76790365398B0FFB1F29219F1DA99D 20brusveen
80,260,226 *088258E93BDCD206D9ADF96A100F85F5F6B49934 2178747 MUTTAKAAOKSENKESKELLEALKOISYNTY
80,260,227 *0884C474FEB11A274A57F49FABFA85377A4EA227 2179467 kartatvoitluodamill
80,260,228 *088B0A577DE03EBCF74A98BBAA57541AB33A3C88 THETUNUNGLOST
80,260,229 *0886E2DA727D93B4C15F8ECD30D3D5485AAF97F4 The.Whatchamadoodle
80,260,230 *088D0D106B0F24DC1646CD36F6BB90397CFA1545 THEWORLDOFMUSICBIBLIOGRAPHY
80,260,231 *0881255651352B423AA2EF7F9F454A08A9CB8446 [email protected]
80,260,232 *088E588CE6A6055C382A4C55CEB936EBA5B004A9 THOMAS.LECHLER
80,260,233 *08851B9AC055F46B0BE418B265C73D0023E2FFEE ZOCHJESCHERR
80,260,234 *088057B611FF19069C5272F7411068EBAA7F1E52 4-KONHEIM
80,260,235 *0881155F0F73AC90EC7417C2F450F03A161CD54A 4KUPCIMA
80,260,236 *088EACA6B2ED64DE8661D341CD5BEE3F72E29510 threeeighths
80,260,237 *08890A183ABEE4490391FF851AAAF45494D47DC6 [email protected]
80,260,238 *0882A46804A6C2C25F705FC0286B4930151B9978 tiffany.hoff
80,260,239 *088474B8137DAACC2F0F40296126B57E706ADFE9 [email protected]
80,260,240 *088922B2BA5F356D482208D302256F7DB89B5AD0 4REZURECHTGEWIESEN
80,260,241 *088B40A2396766E004F039A3F935171F6E93D2CB 4thegeneral1
80,260,242 *0889C6FA8D0576DED014CFCB19212C2D55F6EF6F TINACHONG
80,260,243 *088F4144B8E81825104B9D1186AF363BCBA2DF9C 260806 egitimle neler yapilabilecegini herkese gOsterecekti
80,260,244 *0888C4B1987DDF4148E87CB1E5F04B1C80FEF55A АПАРТУРНІ
80,260,245 *088237A12B0883B1B2DFB78A169ADC0FBCA42C5A «АРХЕОЛОГИЧЕСКОМ
80,260,246 *088C7E0CF91A0FC0A999DA8D169568B3F0463C37 4YTINRETARFRETNI
80,260,247 *0884D375D6A0760000E5947539EC87E518E7A0E5 TNECNIVTAP
80,260,248 *088DD0289F60173AADC46B94FBBE076B9C5B96BF гохи
80,260,249 *088F7ADB62755ED9DCE7165AA53AD791D8AD4A1D қайран
80,260,250 *08851548D29B560A250263CFD18C35EE41CB7F75 НЯГАНСКОЙ
80,260,251 *088297EED7335022E47190926534CFD1EC3B34F1 5ACCETTARSI
80,260,252 *088AE698199DDBC58A8495D926E4A07D23D7406C toponarc2
80,260,253 *08810934AB79A7CB7996ABE488677D50D6FC4CDD 2783085 loppusi--joitukseen-eli-"-penkkaan-"-laitettavat-j
80,260,254 *088DD914558F3302155EA2358FD86C3D3C1D4A66 TRACEY.GADY
80,260,255 *088DA6AF355BD750DBF985A0456A63934E1AA62C TRACYS PAGEE
80,260,256 *0885802A07DBF062DA435F9670A4781FF4560DFF 5DEMITTETIS
80,260,257 *088BC0476270F07F221F5EB8468E5B8AE86AB3E3 5DESARRAPADA
80,260,258 *08803F94D759028B32595E463FE5D3A9C4EB154D travisfitzke
80,260,259 *088A046D02454DE4D50C44326A9E3A52882440BE trecentist.
80,260,260 *08869FCD4F463E64777595399250D75454667E34 5ENVELOPPENTS
80,260,261 *088B1D9EA654316D2F345F99FA1CC4425923D7C6 TRICIA.LAZO
80,260,262 *08867428573921216D95B3C793F2B37B5FACF188 TRINIDADARMBRISTER
80,260,263 *0884FD4897C5D03E70B531EA37CD34CAD3BB0734 TRISTAN NIGRO
80,260,264 *08835D6A9DD66CC3377590D3DCC3188945FD4C5B t{rkeydelt{{n
80,260,265 *0884DA8857C5F65760A0FF8081969BB961E88FB5 5OBKROCIT
80,260,266 *0883D17B4836375BA9F3593A0ED9BA4EC4E83389 2DGAJNEKL
80,260,267 *088EE56B42455107B55E6E45DCA76D12BEA3B72F 5OURNIVAL
80,260,268 *08842D7ADC0E91BA286934A9FA50CA7CB620039E 5P0NGYFL0W3R3D
80,260,269 *0887B20E1DA6777112BE5628FDAB7D2B9EA27738 2.EVALUOINTIKRITEERIT
80,260,270 *088D401ACD72E3F7D73B58D461BBCD975055D29A 5proclami
80,260,271 *0886065F2688C92933BCD68A653D9049F839744F 5SPORTVEL
80,260,272 *0885B90D0F4EF6556A0C20E57C50E73AF5A19A67 2MUSICAL-SHOW
80,260,273 *088D3A09A608E500EE1A5779186FFDC42AF326E4 2-NATURBADESEE
80,260,274 *088C3A6F490D17CFC11955601981648DD50D4C08 布克哈特·高戈林(burkhard
80,260,275 *08865D818E8FC29F20DAD4D313AF84AF9D05A46D [email protected]
80,260,276 *08883EB27767D7EBADC50CAEADE2589EF712A67D 2pinheiro
80,260,277 *0888CF8C36D30423544466F004918727F7E7147B TUMWESIGYE-EMMANUEL
80,260,278 *088AD90CE98F0D4E1322B5F6817913DB7C7F7233 2THATBLONDE1
80,260,279 *0888E6458B8E8B5B371DE1CFA38AF0D97D8E3CCD 5WEBMASTEDOLLARS
80,260,280 *088C6C27248F4FC2EFE1E77625F84D2F11E8ED57 ty0110
80,260,281 *0881719585A33B4AA1CCFA3AE0556540324684A3 5ZUFAHRENDE
80,260,282 *088D83FA2CB3BB3F668C4449398EC0A958966FE3 307995 ARANAN-KOK-X-=-20-+-4-=-24-BULUNUR-
80,260,283 *08899B84D2684FBA301CDFB685C4AB65B4AE9A42 tylerotis
80,260,284 *0881E607A5CC08F313E81F0DEA170BF31A1CFC09 tyronwittstock
80,260,285 *088B132FBB7D04B9B179C47CB58EEC359488E8B4 tystockel
80,260,286 *088B5C946D1E000E1CCE68FF384ECC794866DFCB [email protected]
80,260,287 *0883E6369E0EA3C54F3CB688507AAFAE11FB5BC0 越えの区間(秋田・青森県境)などでd51形とともに奮闘する姿が
80,260,288 *088031038662D65F4276BC241CCF7E70CC4497A0 6COOPERSAMPSON
80,260,289 *0889B25039D701E5B2782CBC058EB457F4500CD6 umeajazzfestival
80,260,290 *0885C02FF93A8B0554BEFB06345828C3CA983674 33921Q2W3
80,260,291 *08897AEBE9213C1644E84291B6888271B98BEC3C UNCONFLICTINGLYV3
80,260,292 *0880E16A80C1F90A1153940F021F441F566E9C6F 353160 aslinda-huyumuz-bugun-de-pek-degismemis-
80,260,293 *088D961D90C13010007E31D32C5BA7D3CF8D1D13 37MRMAGOO
80,260,294 *0883FCD0A58E1CB7ECC985A50649A1B25A092D66 UNGEGRET8
80,260,295 *088464D2E562BBB9E5C3C1EB88A8E6A0163103D5 [email protected]~>-b0
80,260,296 *0884E9BAA1F15DE991307CCB562E312B070E4E5F „universitätskolleg“
80,260,297 *08810E5930CDBAD9273A84CFA6BFA628E36F782A untasteful!
80,260,298 *088E4DB01F57CA913B110AB76D05984F30F0EDE9 3.mielikuvitusmaailmaan
80,260,299 *0882EF59FD6CDE1BBFE177A0BF124AF9370BB7A7 3mycatwoman3
80,260,300 *088AFCF31B117D8BB5F5D54FFCA91ED25ED8F22E )0([email protected]
80,260,301 *088D8F5E91700874A02D943A0CFB9866C184E5CE 3#####P~O-~O-SPLOIT
80,260,302 *0888633CF2036473BC2BB0FB90DF5767FC81DD28 6VERNAKILL
80,260,303 *0886D9C5BA718BF6C2B19C44FA1810E282709D3F 3VINGERBR
80,260,304 *088D205A5D91F4D81893B477FA6A25534981470B UTFANGTHEVES7
80,260,305 *088B182A0522F5A5DFA87E9FF043C8867D114433 uuo~0~q--3
80,260,306 *08837CE83945C8C2829C8B91A7E4DD40C5F5EF69 [email protected]
80,260,307 *0889A721A4C97BEFA2347EAA1F43617C8DACC76F 727sydnee
80,260,308 *08866D132A9DDFE9C985B829C3AE03482E94B034 442756 MICHAELSCHUMACHERIMFERRARIWURDEDRITTER.
80,260,309 *088D89CEA105E68CBAFA6374FBAF1F2317D75BB1 V<*;
80,260,310 *088214D26CE232C1B6738CA4F53EFED9D7E31271 748556 lopuksi.havaintoon.tulee.merkit
80,260,311 *08807404AFDA18A482F3FB914A6BBF42181EFD1F 74XC485
80,260,312 *0886CB94CF5FD4856C57D0DC8CF7C85335543A7E 7ANJOISTA
80,260,313 *088700312BAD6ECB779E9C4CA3DD16FD494C10CA VALENTIN.DAMRON
80,260,314 *0886541FF53486B24DD9F31B6CBDB9416FE36A55 4BENZELS
80,260,315 *0884074C30334F3190AC9DC1B0E88A33D562EC54 1305876 HISOPIIISM:NOMINAISUUKSIENJALINNUNRADANPY
80,260,316 *08812A341BC18038DCD6996AA2E86C286D6E8BE3 4DAHECHEN
80,260,317 *088C0FDC3C91F0B72B30427044D1DF67E26FABB8 131251 NIN TEKNOLOJIK OZELLIKLERI , I U
80,260,318 *088718B660D8EE4DE4FFF857F223BA02942236B2 VALITICO
80,260,319 *088CFC1FE064FB5D5A06472B63338D5CD83C6844 7BSWEXALTESTBSW
80,260,320 *0881F3DD33DD75FFAD9131DD49470A56868949D9 valoriemerrell
80,260,321 *0883AC00803565CF0DE228EDC9CB05540AEC0EDC VANDAAG MOET JE LEVEN
80,260,322 *0884EB9F2283A3CB4B8BD072C7AC7DC30BCC2072 1491992 SIKSIPROSEREMONIATJULKAISEESYKSYLL
80,260,323 *088758588CD268EC479540FF692A9322B638798B 7DEMOBRIAN
80,260,324 *088BA5F7606B1849A43A748FDD5A3E3388217DD6 1557966 KYSYMYS:OLEN23-VUOTIASNUORINAINEN
80,260,325 *0886A76192E91E25701A4FB035F35FBB30B3014A 155902 ABSCHIED-ALSO-,-ABER-EIN-ABSCHIED-BEI-LAUFENDEM-BETRIEB-
80,260,326 *088ACB0D429214313097AA048F7521B902F2B1E5 157975 MY
80,260,327 *088E90B2971762267225C5479FABB848297D6919 VANDENHANDEL5
80,260,328 *08824C448A465CAA689385B6888BA4F79607B3EA 1730437 NORIEGA-SAID-HE-REJECTED-IT-.
80,260,329 *088EEEE3EA74B4DD1EA7A60808DF3A4359A4BF53 VANIDOSA30
80,260,330 *0888B93428702348597CFD82B7E6114B131237B0 VBAGUSAT
80,260,331 *0885888F988F1DA53471FFE5E87ADD9D98B43F81 7INFOPERCY
80,260,332 *088DFB11A67309972FA12D87BDCD13CD0C3AA6BB 4NEVONSEGPO
80,260,333 *0888A24C438330FC374E51682A186090536328FC 4NEZIUBLAARTS
80,260,334 *0882352083C825A98BFA59446B20722A582DCBD3 [email protected]
80,260,335 *08826C49D39EECF48633C7C6ABAAAB6C7709004E venny-septyani
80,260,336 *088451C55165997C8143EA14A0AF80B8BD070176 VENUGOPALANNARAYANAN
80,260,337 *08872F62F22E19CBBAB950691BBA77ECE87B548D VEQFSLB3
80,260,338 *088FDCC69DB18154DE347EEC9EFE1E1FC635F446 7NDESTABLERS
80,260,339 *08898BCBF3A7D4668345472ECF5CCB7325B05AB1 4POSTERNED
80,260,340 *088CF809FD6DA8CF4AD99D5EFD01D4A0F9F822AA 4+R0C1+1E5
80,260,341 *08821EA0D031A0BFB1048D2E1B5B322850F2E00B VERFOLGENDEM
80,260,342 *0888BB42C2CA82BC297C0450F03A452F84651CB4 veronica-heber
80,260,343 *088145A8775522BDACBE617BF0E2FF326D6CF064 7richtlijnen
80,260,344 *088569C3282483DE57499800E6C9633CB9D92F6C 7THATROBOCOP9
80,260,345 *088AB511CB668511D0BB65BDEFC91E2A703D2EC0 4UF3RR315
80,260,346 *08873455B36D1BB1F3B7713B721A426925D73589 1bnchef
80,260,347 *0886745970AEE2D3E3AA82932B91F6F7CE83C4B8 4YIL'DIR
80,260,348 *0884FD43B6BC48C53784B0E00EA0908BACC7FC42 1CONFIDENCE-INDUCED
80,260,349 *0882D1E675BCED04F7348E7BB191BF6FBACCB3B2 VICTORFITZEN
80,260,350 *0880C5AA6265F60E2C5978867B058013C8A8FBB3 1DILUVIA
80,260,351 *088566A7D0C7D8DCF2AFFBC7A6D8481077D098BC 853526 MUZAFFER TAM AYRILIRKEN ILAVE ETTI .
80,260,352 *0884A985D561A4903E5D3C0F1683E87BBBB493AD 8634C749-E6A5-3A03-A74C-FC287B093EE9
80,260,353 *088A27094B71AC3959798F196A19A22095615CE3 866239 sie---arm-,-dumm-und-untergeben-
80,260,354 *088172B9E54776FC0D0FA134E5A96FE5795E31C0 8BELEGERINGSGESCHUTS
80,260,355 *0888E57397F3D856F9306B229EB32CBA9455CAB2 VIKINIIV5
80,260,356 *08817EC9B5DD66F9E92FEC536D6B815DA6D1E09D 8BSWDGULBRAN
80,260,357 *088C7663FC46597196C2A84C9998C88C2E980584 1GARTNASR
80,260,358 *0888C6F10192072C67711AB3ADFFBF6D93342A3A 5ALMOHADILLARAS
80,260,359 *0887D318D29F309A2D27B5D676F41596272F8F35 1.GIFTMUELLSCHIEBER
80,260,360 *088D11034F643FA59A5C3315A1181D0663D311C3 1GILSRED
80,260,361 *088EFB9146D451588B381BAC054B89AA05152F29 8CAFHGUOR
80,260,362 *088290B671D41015B2E016A2300112F93ACFF810 VINEETHKASUGANTI
80,260,363 *088A028E44885AB6DEF88520E5FFFE9F3203CF7E 8COKEPANDA
80,260,364 *088B22CDAF9D33397EF3DA82CF200643F284DB15 1-hinterhofcharakters
80,260,365 *088BAE811D71DB6DBC3C6797D17F22B0F5330BC6 5BSWINNNHIBSW
80,260,366 *088E238DE514063FEF0F53C023A943819D229BBA }8{.*.d---p
80,260,367 *08850E0556B123A90709FEC1252866460A5BB7AB 1 JORDANISCHPALAESTINENSISCHES
80,260,368 *088AECF88DB5FC069B8D7909B480A3FEE0BE845C VIZCACHA123
80,260,369 *0880A759EE44AAA97D84489670BF62F68E68B7E0 1.kakkosvaihto
80,260,370 *088CC0DD9CCB1673E0BE2E85DDE99EA0C9809A6D 1kuntoremonttiviikkoon
80,260,371 *088F8F0DCCBA46BA3005A5E51F1276E330FBD0E1 1-LEIMOILLE
80,260,372 *088EA0680F24AB5E42E95052120AE91AE31C03A9 1LOCNLOCN
80,260,373 *0884EA951E9CB2D91E9DE2697BFCA82D690E714B 1-makers-have
80,260,374 *088FCE1B1948851D618E6E8F2CE850AE4792FC95 )8(o~0~ @8
80,260,375 *0886B3EFC1B9C11103309C28C5F5AF5406051C9C 8#P.`~.`~O->-<
80,260,376 *0882B4435C8D10ECC71D96F149A3D852DC9F2122 vqxf
80,260,377 *088326B5F8B49A9F78E00527F7D0D632825410B6 1PMALKAZ
80,260,378 *088CF5424844D526D9F4708BE5942465EE43FCCE VYSHALIRN
80,260,379 *088D9DF99898FDA44E46DD9D8F6A03F126458760 5F85AAB5BFDF3DB4A06BFF72DBD8A33F
80,260,380 *088FA44FCDA2280E3C11BDAF53CD464A7CDAE7D5 VZJKGCJ
80,260,381 *0888F56C3C9C733171F4E7B1F3FDD8B1E5475104 8THATJETTA1
80,260,382 *0883C895073E4128FB48197606FE14B97FC9F531 WAITING.FOR.A.PRAYER
80,260,383 *088D7751467DF25B34B80982180AE9ACF7FF52F5 walllake
80,260,384 *08828CCF4755F6F7AAC43A0C12497FAB20C2F63C 954594 FIZ . 3 ( 103 ) ( 3-4-5 ) , II . OGR .
80,260,385 *088A1E0135FE198C9C7CAF12D0A1EEEEC808F38C 1TOBYMATT
80,260,386 *088840CE555F5B9166A4C02DBEB68B390E25C890 1-UNIHAKEMISTO
80,260,387 *0889A797312029C63C758E15DB9D5245CA8D966B 5nigreurs
80,260,388 *0880F0046541B528BC82E0352CF842B195F4CA96 1wedge6
80,260,389 *088EBC1D73354BBE54CF24A22A547EE689977EC8 1wmeigentorschuetze
80,260,390 *0885B2F8E6474223F6BD3378DD7357230610C9CE 1.ZIELGERADE
80,260,391 *088F46A6AFD6D42EE27DF8363CAB7A664E295236 20MARCH1092
80,260,392 *088193D33AC27A74C0A32F84525507BCC58A623E 5THEREVIDAES
80,260,393 *0883B9E9A29C048F23DCE5989E2CCBA00A63DB3C 5TNOCRAAJ
80,260,394 *0887B140D977C184B5999A6914078D9026E9C16B 22 WEGFALLS
80,260,395 *08879459522E8F87C9B27D08E65A15879A2AC233 9E0CE5DD1638F93BA25750C0A964958260
80,260,396 *0883CEAF50DD1CC12146B07F8C7887BAF0489119 5VAHSILIK
80,260,397 *088E1B9E5DA3CCB547A1D8A2922408DB555CB0C8 9INERMUNTERNENS
80,260,398 *0881B2CBC289FD43438AD260D06416BA03681A7A 239PORTER
80,260,399 *0889D6A7B3EDD7EA1F24A02DF71DF6ACEB79E4FB 5ZWEISITZIGER
80,260,400 *08843666B6F643FE629AC1A1E9E65CE9C54E84A9 608645 heather-kasvoi-sellaisissa-oloissa-,-ett
80,260,401 *088F9BEEB57E049C076B8C12494FD9FF6894C99A 2496333 boschvizechefschiefergestorbenstuttgart.
80,260,402 *0882EE523838839AEDD60722D11F3440D84ED52B 9NEKNIRDREV
80,260,403 *088A253AB16F97C8226984900AB9448BA65A7337 673PAOLA
80,260,404 *0883D4CBBD6B758196036F09627D964B1822E345 680LEA
80,260,405 *08874E4B834EFD0962B0140271F888E616DE547A welcometowhatismeanttobe
80,260,406 *08881AE17ABC1C033DD27A99F749499D5A3B6811 9petrolage
80,260,407 *08852C38DED1C334EDE826D452D111B6CB221329 [email protected]
80,260,408 *088AAFE0B14AB1337EC3EEDA1D992C911F45D5A9 6AUTOMAATINEN
80,260,409 *08868C3401DECEA10F8E545D28207A97DD7864FB 9SEMISEN
80,260,410 *0886FAC179F6EACF339A78F59CADBF066D4B6768 6BDRFLJK
80,260,411 *0883BE373C2CF6BDA7005F0E3A69D1A68D4807AB 6BROUGHAMING
80,260,412 *088765FA3D551E71E930F031F8156C2EE939B054 9TAFELKLEEDS
80,260,413 *088CB804DF2F13495B523DEB7CFD7600C0DCB894 wesamazzam
80,260,414 *088DCAD0C6085740AC49E5A581580924B1CAE2E0 wheel&sprocket
80,260,415 *08819AD48E43BED9A11593A45FB7DAFC3F0654FA 6de7a9b26bea36609077f6c1beb7a92d.gisquiere
80,260,416 *088CAB74C941870919E9C62FF05D98A4B624076E 2BUPRENORFIINIHOITOJEN
80,260,417 *088D1740216E7B71E33A55E104A858580C0C201F 2BXEANMDB
80,260,418 *0886FFE0DC37B6EDB93B187260ED8999C8E2CF45 6FROGGYJOANNA
80,260,419 *088F6C8149E14E19A56817E6B1F0C72A4384F93B WIETSKE.VEENHUIS
80,260,420 *08833EA7071E2DD7E46EADA4222D909A90DD4178 6INPERSTS
80,260,421 *088E52EFF969E120D94B0BC5849354C9152C6173 6IPYATYABHU
80,260,422 *0888654130A5DE2720FFE4244B6361D022E6DCCE 6JAMAICAVOYAGER
80,260,423 *08837F7BB136C4E60C61D636D45ECDE5E49D53FD 6KESKUSMETSLA
80,260,424 *08838E55B7CD43CE319424FF44A56A612E2A01F5 6KISMENBSW
80,260,425 *088C513BA3DE21497487AF19E4FADE2C508AD81F a3zyj
80,260,426 *0886096CA72DA8492B088ACDD63A6A2D129375F9 6LEGGALEGGA
80,260,427 *088050DFF50CCC5496E0EBC4090766B45D2A848D 6MIEKUOYS
80,260,428 *0886F4D46DD735FF8611DFC92BC8AB36AD1006B8 will67170176203
80,260,429 *0880BFE879F36189EA71E4054A1330353BB3075C 2GNERANNO
80,260,430 *0880A51F546B7F150E47B3759CC5D3FB8283EEDA a6$$+
80,260,431 *0884A54E03F0937022637AE951A0DEF10B6C1F3D [email protected]
80,260,432 *088012ADFA757A12652CCC81B78982C372A59CBD a6bn/
80,260,433 *088CB2BC047F2AF10C347642B6FEEE2DC9B52C8D 2.lzwaehrend
80,260,434 *0881E0E29DAFC5AE7BB22594229DF7882632309D 2MOKENAS
80,260,435 *088C6501BF7F6DC24806241A93BB035035E8C5D9 WINNEROLIVER
80,260,436 *088FAC374F8162CC251F5ACDA5860B575828E7DE Winter-2nd-mov'-4-Seasons
80,260,437 *088282BB7CC022C22D0928F100D448B27AC082EC WINZ.160P
80,260,438 *088DF6764ED60BB7F27E30BFB17E8EFEDE5E2441 A)9!L
80,260,439 *088DAA24A95E39C5F3086695E306809F286EE153 2UNAUSPICIOUS
80,260,440 *08803144895129AD5A33F767D2AF8E813F2F2E37 301706A0
80,260,441 *088E8DB5B25B868955133F1B0CBB3B8CB6F9A545 aaay58
80,260,442 *0889ACA41D90F9BB515C8D61C1A0032A5A4706C6 78ONI38
80,260,443 *0880368023AEA25317CE335EE95735A3758D5586 7ASPERTEN
80,260,444 *0880B19A758A66E093688F42E927619643111332 WURM
80,260,445 *088CC98F781E7B2A5D64E4A45EC164DD15443CAC 7CTYRICETIMINUTOVE
80,260,446 *088636666522504343847479A425FB3E4694A05A W#W
80,260,447 *08884AF9851D7B84427314A7A91021A4C974F27B 3B<-**<======P
80,260,448 *088DC37F5E131D13080F70367B2060E39DF6CE64 aaj7a
80,260,449 *0882138B7EB190DC5293CEEAE4516F648F3E54FD aakaniiking
80,260,450 *0888050DC11728A89943C7BB855CC1C193AAFCFE 3DANTESCAS
80,260,451 *0888FB552DA2A624932A9259130250F35126F611 WWWINWARDEYECOM
80,260,452 *08889E7ABF02BA0A30BBA57BA6FFA1D92D87053F WWWIWIGHTGOVUK
80,260,453 *0882C36251C4C8D43C5A5EB68072209109F8F29B 7GOULPHAR
80,260,454 *088727B44BCF8E451913402D7CEB2FDEFC5C3CFD 3.HARJOITTEINA
80,260,455 *0886FB760D1C3D194AEAD411089F37A5AD634753 wxkuoaw5
80,260,456 *0886C79AE3D32A7DF54DEB1B1BFDA39FCA178919 +3L3PHO+OGRAPHS
80,260,457 *088D851B76E0A61E76DBC72C2BD1F6C6326ECCCD 3LY5IA
80,260,458 *088D1257AD69A1ECB64BF67AA19A42F26EFB4DA5 3-mauerschuetzer
80,260,459 *088AA3426DB2D4EB9080E0C7AC0CB1F0C720ED5D 3MUDHENS
80,260,460 *088B10FF2CD3809DACC8070F4495804A63AAA829 XANTHEINNING
80,260,461 *08877979985814CCAA9C8CEC435E3E2737EAA06B ABELSPROULL
80,260,462 *0887C2D8DCE221DD7F06C0AE95D3373BCF0B6F1F XCARBONX
80,260,463 *0885A72C1B92B1675018CC88F60CEC89138E6DC6 XIAJISHU4
80,260,464 *088A9B9108FF686BAB9D429A21967B7FDF6EBB98 7LOMAAMOL
80,260,465 *08852B5030B2B57973879037823094A7017B624F 3PPCS
80,260,466 *088FD05C970C51019854B24D99FBE158A7EB2E08 ABRAM.MICRONI
80,260,467 *08805A3F52AB1B8B39AAFDA787A749DCE08D33E0 abrampisula
80,260,468 *0887C2BFC80D6D9722C4BD064E1A7131F94899AF AB#SD
80,260,469 *0887B676A11CCDBBED7C2D04023E459FA8BF448A XINNERLBSWS
80,260,470 *088BA6F6E2BFD772959DDBFBF06FFBEDF3AA0699 7OUDBAKKENS
80,260,471 *08885011800C54D6FAEC031FA29569EC7801FD0F aburnedoffering
80,260,472 *08801BB32FD520061EC4602B0A822C2BCE527C8C ac8e
80,260,473 *0886857FA05381C725A2C077E2ACFCB199998DC9 a(cls
80,260,474 *088DB04DD7F720873312281139EF685D20B8EF5E [email protected]
80,260,475 *088850E6A2611316A204144AF99C0402BBE1AA57 442.show's
80,260,476 *08855C33FDAEFECB638BFF3ED1D458A31B0AE008 471176 jos kyse on lomamatkasta , kielletty raja ylittyy
80,260,477 *088332D285BFA88F1B8DBCD92BC2C2B0A109294F ac,rn
80,260,478 *088E7CD458A009D79368896FE243B4EEB1A0E3FD 7PROPORTIONALERNAS
80,260,479 *088399D42B004156A71E053CB68A3BD46EDA98B0 YAEL69
80,260,480 *08813454FB9503C83079DD14EA74E0429F20E99F [email protected]
80,260,481 *08851382529480778E0A705B1FD97E1FB97F19C1 4GACASMO
80,260,482 *0880291FD22C3D3EFA108B67A3BAB1B581613D10 ADM>C
80,260,483 *08833F89BE037ED473082EB8FECD2D09E59CB6AB 7SSENDETROPSNART
80,260,484 *088886E1FE64A362D6B51E516F9E591FEBCABE39 7SUOBIRAC
80,260,485 *0888FEA7F99EF31B68C1ED0DA1E14FC5F47680AF 7SWEIGARTS
80,260,486 *088ADEB6F448E38F3606B245C1B5B310CB526A89 7.under-age
80,260,487 *088C6C39A26EBB4231EF84EF0E99804D09147318 ybezr
80,260,488 *08851D931EABDC9AC5768D587967C1864ADF4A75 AECKEL160TALK160
80,260,489 *0887DDE95CD56762B3AE0343C94287504D545992 AECKELMANN
80,260,490 *08850BBA0D0D36F4DD4C251CA94121D8D3839B27 YESENIA MALDONADO RAMIREZ
80,260,491 *088D67F8C19C443C971FE93FABB475AAB290F5F3 yeshikakothalawala
80,260,492 *088ECA4BF6D2C712E7A5276D3AAB8198B642D778 4.PRISIDINT
80,260,493 *088EC1800C9BF3439C1F5F14A9F33DD48ED91AAD 4PROTESTOWAC
80,260,494 *08806EB19D249514F68912EB4C463D13439AF927 A$EXT
80,260,495 *08895C615886D78F308AAD1F4453D94AAFA3F0CA [email protected]
80,260,496 *088FDE15554FF6A6981D7E3339B8797FD484F07B 835BRAYAN
80,260,497 *088E50A176DE27AC2C2718044BB190E9398C005C 838770 jokainen kustantaa itse oppikirjansa ja kaikki muut v
80,260,498 *088D513AD67A256BA76D1A0558937D43444AF0AF 4TGARTFUA
80,260,499 *0886E56486903FFED6C4952659EAFEDE9FC021AF aflockofrotations
80,260,500 *08863D992E4B2DF9D8BC7E6A350A05BCAC227930 8ANUVARTATSU
80,260,501 *088AC4B6EB798CD94ADA552D7BFF48E794D99357 yoorinhan
80,260,502 *088B61F649C4CD751FFCEB586F66AD742A8C1A0D youakimmoubarac
80,260,503 *08892E668973B4C7B833C6D3F88ECF7A26DB2BB5 YOU'RE.MY.ANGEL.(MIDNIGHT.MIX)
80,260,504 *08894F37B24B0E079F41B2DDE833CF5BEF1F02A4 AGHAEZE
80,260,505 *088B9B864EF3A3BEECC9478BC987480D69F27EB1 AGHH5
80,260,506 *088664C98733F01DA29DD9197D95843428474169 AGQQP
80,260,507 *08828404DC0370745C20F4B9CB00F34623ED101D AHDQD
80,260,508 *0885C594EC7C20CDE25617A170AAD9DA9229B490 AHOLTSLANDER
80,260,509 *0881C574013450A0F12405015E3F66A8100DF3DF 5BIGREDJOJO
80,260,510 *0882CC9A425F7A5A1A01488BCAF05109FEDDF221 5.dreinschlagen
80,260,511 *088CC1A8DA3BC62E29BA3CE3606EEDC66E05431D 8ENSPLAAT
80,260,512 *0880EE90B2E61948082E48E77B3FA92AFD66E818 aiguillaits
80,260,513 *0889F8284E23A9AA772610E8B753B60E51E5E7FB [email protected]
80,260,514 *088D86C7BA82A2318E5A9DFABB4CD295915B2B27 a-ing
80,260,515 *088680118791606A006F8064940729187AB6F363 zachary-fluewelling
80,260,516 *08852135CDB9801C40A9EC0021436063E21077C3 [email protected]
80,260,517 *0881DEDE6C0A04282CDF7FE51B8327617ECDEA6A ZACHARY.HERRADA
80,260,518 *0881C6BEFE2783B016A862E4894750D2DECE5329 8IPEIHCRA
80,260,519 *08883A744DF97986B7934C1F7BAA82CCF15CEE36 8JASPERJUDITH
80,260,520 *0881F24E56AA18A8021FABD51FB4AB383EEE2075 5MERIEDITH
80,260,521 *0880D650F07AE54AEFEBEDC2A4E6FED886210A49 5NONRESPIRABLE
80,260,522 *0880743098A477A07B90383D74AB4A1D05D4B9F8 A?),L
80,260,523 *0886838325665E3F9BE669492A3C09123D93BCC8 ZBRINUTE1
80,260,524 *088EA6F1CD30830D38C33EC11CD35656522218AD 5THUNDERCHINA
80,260,525 *088C7DA39A0EDE1DEF3F9464F4810618F3CFA660 5TNADNUDERRI
80,260,526 *088C95BA5E68EA51935742978A1A809C93C0BD11 8RAHMANI575
80,260,527 *088A307506B3EDB7DC01B0E4823A742E0FBC4609 aldenhickingbottom
80,260,528 *088FDE243F752225D5762C62E0843B873A9067F9 611304 MARK TWAIN ON TODENNUT , ETT
80,260,529 *088A1F6BF7D74BDA5B72FC57529B0E03E8AA2B22 642869 rataan tutustuminen ja itse ajaminen ovat sitten luku sin
80,260,530 *088107318FB7137E2D5C28F0773BD9C105F0719A 690926
80,260,531 *0887325A945FCD0D93B7CD0EC0E1F052450258EC ALEX.SPAYD
80,260,532 *088A6587252925C54233010FCE6B22CD39884CCD 6ARBEITSGEMEINSCHAFT
80,260,533 *0886BE1E22E65DA3B193759BA27D15ADF0CD96E1 ALFONZO.RICHARDS
80,260,534 *08894203CBD039E2B7C9C88ADB65B348E1E19C0C [email protected]
80,260,535 *08842203A7548F9623CA51EEE371DA99A66A237C 6doubleand
80,260,536 *088CBA7C9506A576566E1F29F80E575E10D4BCBF znackovane
80,260,537 *088D5BE3275F7C43C0C8DC88F96495D712A68A46 6.GLAZEBROOK
80,260,538 *08856083915D6538798B0A5F263BC633D82539A4 ZOILAVIVEROS
80,260,539 *08822F82C0F7FADB658FAE7910EEB81300F386F0 [email protected]
80,260,540 *088898718BB5F09C0C0AE5333462122F6880D03C 6MACHELPER
80,260,541 *08851946B6032C5C8D0A7F11DB199B8136EFF99D ALONZO.SAMMET
80,260,542 *088E0052D49E4C5F704CD156CF86C2C530CCCB13 ALOTTAA3
80,260,543 *088AA0BD63ADFA30D6A45FF968E56F60F3A94456 ALPHONSEROHALEY
80,260,544 *08890685BD2C402EFB40590B4E8D6CBBB4758A5C 8ZARTERER
80,260,545 *08896A3972C67850243B01D35F442D0A80C29BB0 931ELISA
80,260,546 *088F9103D831B342783F690DE05039FF6872FD27 7ABHYAVEKSHAAMAH
80,260,547 *088050EAF3B2AB9E9FF1C655B8A773125D11AC83 7 AJATUKSINA
80,260,548 *088574877813F44987AE921412207824EF157D88 979antwan
80,260,549 *0884AEDCDCEA4FFBDC5FBCFA47EDDD2752BE6A1F ΜΠΡΌΔΕΡΣ
80,260,550 *088835C2028160BEB10AFBC8CA4D9FF27E7621CA 9ALUMINIUMET
80,260,551 *088600F3ACD2285F276BD24F10B9A2E33AA0C3E1 9ASDFJKLMEXICO
80,260,552 *0889E357974512967906AF712025D3D351DCB15C 9BASSBAR
80,260,553 *088553C256BAE1957DDB6278D77E8A7C213CC748 9BSWINTENTIO
80,260,554 *0888B46E3377D91387547A20F7B52991267FFE0C 7FLAMEN
80,260,555 *0880F52CB152C6AADB781A786B3F825A7EEC9720 am(n,
80,260,556 *088C272147F0EEAF868D673BFA34A8B585B976C8 ГОЛОВАЧОВА
80,260,557 *08817770B51453D47B0CD91785B04A847139F56B 7LULUTOMMY
80,260,558 *088E171666140AC24CDBC4DA91F18E104BA31D0B 9FOCALIZZARONO
80,260,559 *08865FD1940615ECCEDE5DE3CEC71E7630AE972B 9INENTERBENLY
80,260,560 *0882A9F986CD9E6C8C36FA57394C91D25541397F 7PROCACCIERESTI
80,260,561 *0886291C7DA9109B7DA4C2730B97535594E6951C ОТРЕЗАЙ»
80,260,562 *0883F134A4D491D47D483AB97001887F6B00656C «стальова
80,260,563 *088EDDE6A060704B891E89857A160C4937B9BBBB 8#>`-(0_<)
80,260,564 *088E11E4F754C023AA300C1923590539C4DA1F2E 826711 silloin.kuitenkin.riippuvuus.toisista.oli.n
80,260,565 *088003538D1F5F1B1467ED05E166CB09E10EB995 827trace
80,260,566 *088060AFCA7ABFECB5A6C4F32C6872FCB797D5FB 8ANGUSPASCAL
80,260,567 *08827998E9EAD9E1211CEF39E6E06868302420F7 СУХОЧ
80,260,568 *0882F7DCCB8BC5ADAA73D97F14D933B8A86E0C58 ТУЛЬЕВА
80,260,569 *08830AA2CEF35EA5FD34DF8EEF9B040E0DFE1FFC 8====B`~ `~ splat
80,260,570 *088C306BA2DC54955962CD7943A0922287BB2C18 9SAEAEDOEKSET
80,260,571 *0884BCE84476CF5F751360CFDD0F481C33537886 ANGELO.VANDERBERG
80,260,572 *088DE038BAC568B053853B62475340BB363F4C2A 9 TONN
80,260,573 *08881FDFA996E153A7F4820FCCF8C0D73892E995 9TUCKLEY
80,260,574 *088ACA21F6E6B517951286D783230CB7E62EC1A2 9VERYBIGL
80,260,575 *088D2E3F4366AAE731B025E42730E6C1D0D364BB 8ESIEMTTJ
80,260,576 *0887B75E707466F00C93EC7054816D19E37A8C19 [email protected]
80,260,577 *088A993D563745474F8F6AF4FDFCD02192C0CEEB A06M#
80,260,578 *088E8CBB237F8C559D049EDD015A55D50DD1B01A 8HIPURIDO
80,260,579 *08898DA0C2905E6B017ECCF555A2B9042F338549 antoniazeiser
80,260,580 *088C6EEF258066BF97C933C90F33537457ADCCE2 ANTONYKANNE
80,260,581 *088B28B4E6CD37CA3A52A4734CF68EB823210CC7 ANVI1.B10
80,260,582 *08893522CAD0492F2107E4742D9F180879B9A0C0 A,o=
80,260,583 *08833F36316D0E0BF36F9FCCBEEF8AB0BFFD69C9 A3SK;
80,260,584 *08827323B7313A0C841A5C9E381EC0FCEC914067 AP$Q2
80,260,585 *088C4E7EB80C1CF899B62797F85F96305BFE54BC 8TSYCOXYM
80,260,586 *08833E1DF78D8AE4C75A2AACE88CC9E4E4FCF3C7 8VERLEATA
80,260,587 *0888C9F1772103D2A320FB184FF5B7D13C455D13 ARENIDES
80,260,588 *0886E445FD37A37D5CFFC8B5636E9FEFEE8D26D7 ARISTASUN
80,260,589 *088A320ABBD8B3CC61E8DE61A7EA90F77D8BD907 arlienistler
80,260,590 *088BBB82CBF0B98C32453C24F27818A15810AF8C A7N
80,260,591 *088D880D59C474D43850DBC1A4D98F5EEF5B08D6 9BSWKANSSAKBSW
80,260,592 *088A2F87C855C0BE3A6AA4D489A349DB8C5B6766 arpone
80,260,593 *088ACCEF3A7CAD90C4629702EE1C2F6517AD4E59 a9pjv
80,260,594 *0884DD7B8328610FACC9BDD284F0048BB67CC8AB aa`*
80,260,595 *088DCC355BDFB0DDD8601DD101AAD17DADE949B2 AS5CS
80,260,596 *08836D4125FE2E5EBBA00E6CBCCB6163EF88FADE 9GLOBALDGJ
80,260,597 *088EEDE20C862A3BCE37D0EEFBE8F8B6111EA57A ASHLEIGH.SENIOR
80,260,598 *08859F2EA74A3E75EA5AD6697D3A922F330AAF8F ASHLEYMCGAUGHEY
80,260,599 *0889112182DFF17C8ACE536246D4A1E841CFBB39 ASILIORHINUS
80,260,600 *088FE8F01799BFA646AF633D80607BD34B86F5E0 AAB4OW
80,260,601 *0889B639890979180F363E3694930911F5901E0E assosination
80,260,602 *088AB457DF8E84D572001B39E4BB2D1613FE428B 9NPLTBLNSS
80,260,603 *088329A8B6AA31BED3EFBD2E4D0A77253432D2C2 9OMGRDEDES
80,260,604 *0887295BE66D08CBF492734B44D3C6AF580BA6A8 [email protected]
80,260,605 *0886A90779411B8326046E2DC5A0F446602BACB1 AACPHT
80,260,606 *0882B119465F69FD091FCA08FA583159C75CC9B8 (0-0)*-*[email protected]####8
80,260,607 *08836A0326E2FE92EA319408E62335FD80259DC6 augustusbleakley
80,260,608 *0882D58234DEE16E3F9FFA45AE988E70B604C6B4 AULQ2
80,260,609 *0888A2009AC2F32A1A46768467A506D6E6733F47 a07fs
80,260,610 *088D96675C6E0F104F627508E25C2F129B42651D a:v?v
80,260,611 *0885016488EA613D49EE5B804796281632F873DD (>_0)* * *q8
80,260,612 *088BB7EE4C2B0115ECE687B285133E7524D1446C 0shadow6
80,260,613 *088FCC0B8908C360295D6EAF8EC87900504A5D2B AYE%C
80,260,614 *088D8CE6450B3EC8CBA5697DC2C677EB9F719F07 [email protected]
80,260,615 *088F6D8042C72B92169D0C861FAF78CC9EC6EE79 A.&Z
80,260,616 *08824C5083E7510DCBBEA809189F9858E39C1066 azurahahmad
80,260,617 *08825FB95907056213ED74D5F29FEA6516DBA0C5 A69S3
80,260,618 *08882F2A6809C1986B3ACF25910F6D7560AC2354 1174097 osaamista-b
80,260,619 *088607774CD3D54692DB4F37E49F02CFCEFD88C2 B0L
80,260,620 *08893DFF8247DF70226A36C0A60E5D6EC61C21C9 A7N
80,260,621 *08885955FE6B983A81B79BD9AC3A4D6AC8987C6F a(_8n
80,260,622 *08833E19F44FDD3EA22AA822DDBE8B790DCF65CB b2hm$
80,260,623 *088BCE1D4088B10624381505C22AE21AEAAEE430 ABSOLUTEITALIA
80,260,624 *0884752DFFFD004D1DD561DE2ABE37F76282A062 abv9b
80,260,625 *088379C5B77B60217562FBC425A9F8AD6F36CD3A 1649147 radoninrikastumisenkannaltakriittisimm
80,260,626 *088B0049556781D5F1B29DC2784F84D223E7D22E 1676659 ES-IST-ALLES-NOCHMAL-GUT-GEGANGEN-.
80,260,627 *08866CAB6F539020888B018D5A941138AC478920 1676998 arktikumin-k
80,260,628 *088895F75A8FBD99FB87008ACA1A2F28FC4577AF 1707800 sulho.ranta.:.suomen.s
80,260,629 *088757D63A2C8E0C2E7F5D92EAD9FB25AC2EDA3D b6dti
80,260,630 *0885E8628143734BE8A670AE2B4BDC14BC92F9BD 17HAKEMATTA
80,260,631 *0888D7A436F4CDE4A8D5ACFACF4126D5056F710F B7QB#
80,260,632 *088A1F29B5656FFF31E91276CBBF990EA307AEF8 1ALONDIO
80,260,633 *0888FBCCD4E314C01819AE8A981F69C905EB7608 B9M7
80,260,634 *0880CB74497772C90043CC5779DF07EF2257517B ACR3K
80,260,635 *088919F6EDEEDA343F56A693A8C22DD09DD2B09E [email protected]
80,260,636 *088C0D21DAADEC746836DF2B04DACE23C7C04F52 AARSETHBSW6
80,260,637 *0889ACB105BCFD0A0BEAC59A4065FE2C74466C1B AAUZ*
80,260,638 *088FF3A73A9F8617CCBFF6E5FC655F7D8EB2F877 abramkarpf
80,260,639 *088C455E744D54AB2EA33B219E300786B897C27F 1 FESTSTART
80,260,640 *088BBAE01514232A839E11A0E3F95AC99ACF348D 1-first-plymouth
80,260,641 *088177CE3FF7CE00561B4D2BA0A354F73DD2516B ADRITTENING
80,260,642 *088F72E2859BF3FCBC247077A88DEAD309F701E7 ADULT-MALE-CIRCUMCISION
80,260,643 *088E3D826546EFCAC07F0E0AEF8E7657ED543155 B"(B
80,260,644 *088CAE790EEE4B6B2A8008B643BE3357FE8BE9C6 [email protected]
80,260,645 *088A1A7853E32E7F609DE401A53580CC610CD6C5 AETZENDERED
80,260,646 *088AAC9A4497A37FA4D3FB206419C06DCC42F509 ACCUSIEZS6
80,260,647 *088424AE145EE0787C2CE1399BEE0BC2D0490AFE B(C&H
80,260,648 *088E7F6C7F864F9F8C0AA31E97F0E3B1CDFC9DE9 1 KARAKALEMLE
80,260,649 *088F0C7B3313EDDEB416B36B52F3A5B7795D820C 1 keksij
80,260,650 *088C9289E2F3F3B6BF28E9004304E9285ABF8891 adanbaras
80,260,651 *0881E6922DA978AE6E7E2AD9614F80C50EFB6016 [email protected]
80,260,652 *08854F72C6160CB5C0DF7069E6C4EF6CD1D1A9CA ADANHOFFINE
80,260,653 *0886932F683798595743BDE3870FAFE0CE78A0EE afwu2
80,260,654 *088D66BAC0DE5EE8DDD9E6655D1469092CCB8412 [email protected]
80,260,655 *088F6EA60BABA00500A3253E7A7DE96F9A766120 [email protected]
80,260,656 *08866350DA121435D003915D53AFF64195AAA077 1METSURIVOIMIN
80,260,657 *08834664E94315A90698EBF86A160F668FDE76EF 1MITTE-STRATEGIE
80,260,658 *0881D664D0A3CB4ED2416C8A8EA3AA167D9C643F beaureda1
80,260,659 *0888A6393453C507DDDB9CC187244B1C0F0052BE ロンドン・beechwood
80,260,660 *0880F90680C92DB05D7C9CC143E1E5836FC35256 1NOT-QUITE-RIGHT
80,260,661 *088AA4931132A41615ECD3DE9B043650D74DFEFA AGUSTANAFICI
80,260,662 *08813FFE8C419C90B5D4D333F8044DB1269D9214 bellefam0
80,260,663 *0885294E7C0B9689234F935FFA0E2B3DC671BF32 AEBAP
80,260,664 *0889BE0F5D7E79827FA2B6AAD15F3D7A4F953093 bennyleverenz
80,260,665 *088DF51884AC71F957483C724E08A1A0CA1446AC benvenuto-cellini-:-ouverture
80,260,666 *0881FFFAB591A8A5DD03F321E30CD296A256A2CE a!frr
80,260,667 *088173114CCC3D0031BAE73229B52462F3A39097 1superhasen
80,260,668 *088132DA1C45D382275E1F9C7C0DE05311E0A2B9 1 TRAINERNIBELUNG
80,260,669 *0881AAAE5CC4B43D4C9020A3D87F034F90D1E7A0 AGQQP
80,260,670 *08886F3C58F7CB30919654802FD6BD580011BDB7 1TUKIMAHDOLLISUUDEN
80,260,671 *0884EDD27AA8AE40F194CA0C097EBC14F0C8C982 agribusiness0
80,260,672 *08816DBB6458A90952AFF7BE02E74B33B34C72D6 a#h2m
80,260,673 *088A7373E7B3C763E110E8D3AE7947D4DA61768D BGI;:
80,260,674 *088C466C24B0B90318A6C572AB5E8F74D8E5492F al5q6
80,260,675 *088605BBA25817390EFBEED9649B5B3D788951E7 aium
80,260,676 *08890AE4649E7AB8B280D2D9D2C061E321714583 20niederschoenhausen
80,260,677 *088FF14AECB19C59E4B0EBBCCB66FB9D29629042 akz,0
80,260,678 *08817C6965EA16E48A937C59A5FE40EB5203A184 ALDJE
80,260,679 *0886ACF4746706BF8116BF2CE982C7DA3722FA94 al-b)
80,260,680 *08852436E56ECB4505A546593D2E29ED9F2B64D1 ALBAYTI
80,260,681 *088CD2B773FB6645E18C79D9DFABFAF1E58E3110 albertoyaklin
80,260,682 *088AECA3A71249126893915205E9DBB950B4FF63 2294401 diehorizontliniederlandschaftenistdelikat
80,260,683 *0884CC9DD5F55D942E31D7A83DB9CE60DB27E644 alfredobenitz
80,260,684 *0884D76EE865D11A0FF1461E57DAD744328BDCCE aldofennimore
80,260,685 *0887B4BEEF85122CFEFAE86E807F71A6B437386A alfred.seguine.kinsey:.[[w:john.lithgow|john.lithgow]]
80,260,686 *0883951DE128DB9E723927983EAF924405CE3CB0 ALFRICSING
80,260,687 *0883612A516CE58383AC16A4130749F48E417943 ALEJANDROHAMMACK
80,260,688 *088344543191A214406ADE78F8CD419D3440AD3D BIOGQ
80,260,689 *0884C27060928CCFB0A014CAD03294C9ADDF14FA ALIPTUOZ8
80,260,690 *088F8CB9B72B5F92D982430CFE1E8E3248389DCA ALLGERAI6
80,260,691 *0889CECB63D0EA8327959B26150405113B535F05 25.schnittkes
80,260,692 *088C31DBE3999C7C9C3A65588F9037822896E06D 2600306 KAUPPATIEDOTESITET
80,260,693 *08862EE423D561B869ACEB667358DF0A9BE44587 2621654 HEHASCHOPPEDDEBTTO$313MILLIONFROM$105BILLION
80,260,694 *08848871AF6C2F20A85A397AB24BE224E9E5CA75 alpini11
80,260,695 *088660722675998472392B49C9AA10B4D2A3241E ALTAR_CHIME.'/O/LT/@/R_/TS//AI/M
80,260,696 *0889CED52019E26242C3478378A35CD358BE4E48 Black.Betty.(van.Helden.mix)
80,260,697 *088967B6CFA2465B2EF339E66413FA48B39584F4 A&"M=
80,260,698 *08876BB3F8549A039102154B42785E10A02BA994 blpmi
80,260,699 *088A57D3249982B6A4814312BAAE90ACC4F44986 2979084 JOKA.TAPAUKSESSA.SYNTYNYT.YHT
80,260,700 *088DFA1ADC05CB21466A65DAA6879D31FE742E65 bmn/y
80,260,701 *08804CDDCE761B63E9369D114863A715620D9FF5 amr-refat
80,260,702 *088D0375F25362466FEE7AAC9119C8C0215A40B1 [email protected]
80,260,703 *088480F1D5C1CE0B44B542632B43C562A591F2B0 BNC&O
80,260,704 *088BC1F9636E28C566E5EA8FB3F70929E7327160 2DEVIZED
80,260,705 *088B5C6236883D048FE7EDB6079CBDEFB8727200 bnld4
80,260,706 *088B2F0673CCC4ECC8779822B57303625C76ACCF ANDREOFLAHERTY
80,260,707 *088B156C6E16412C75091CFFAAC959CADCE8B3EE ANDRESLUNDELL
80,260,708 *088E0A523958DBAF29985075D70D46295590BEA7 andrewjamesmcneill
80,260,709 *088E65387AC847ABEC75355498585257153B3D0C androsta
80,260,710 *0882317FCB8E354976DC8AEFF793C1A5911C8E2F ANGGI.PERMATA
80,260,711 *0880C82ABA25D0CC859FC6902F217A09C7EB5CF3 AMIHSIM-1
80,260,712 *088318199BEE14FDDFF1B7497714FD112C2BDC3F 2 muinaisegyptil
80,260,713 *0882AD1989FEB2683C63E8EB5F3DC09AFDA0F935 ANMZ123
80,260,714 *0880FEFCA66709BC8A42F3E6CC7EAEE75B20A38B 2 SIIDDAS
80,260,715 *088F344FFDE6BE0B516607C06446AC508EB79EC8 ANAND-KANOJIA
80,260,716 *088921B8F7185FC49EB4F881263C792964183EF2 2virago2
80,260,717 *08836742F493550B3B69418A4C87E5D15F65FD4B ANSAETTELSESVILKAAR
80,260,718 *08883538FA462E4263846E8D35178EAF27373AE2 BOOMER4U:BOOMER4U
80,260,719 *088CEDE7AA60B3521D1788FD51F4AB7C66F6EF44 andersonneice
80,260,720 *088ECAFD25D81C53774BE0A17B4795F0CEF3F7C9 ANDERSON.RASCON
80,260,721 *088747AFBB66D7DD1A371785590858568EE5989D ANTHONY-FAIRALL
80,260,722 *088BADAF3A1A30DF85A4A5E93434EABAE615FE62 [email protected]
80,260,723 *088723609EB1FAFD6C789E7A0A9DDA44FE83B4D6 andremollenhauer
80,260,724 *0887500B860699A8650F09AE744975CE03996573 B##)-~o-splat
80,260,725 *0884F09A39FEA92D797E2D234EDB36F7C808EB88 ANDWHENSHEWEEPS,WEEPSEVERYLITTLEFLOWER,
80,260,726 *088ADEC44D6A46EBB4FF4D9478D0E36709329FCD 369084 bu-domain-gediknet-serverlarinda-tutulmaktadir-
80,260,727 *088A59799F010A001E75F624DB32A3BF71C3309A ANYZCNAP0
80,260,728 *088EF620B56E64DB672633E70651631D7295E035 3AKITSCH
80,260,729 *0885F755FD142F6924DC10D363D37CD0551FDAD8 [email protected]
80,260,730 *088664C59F33C540FF567E5409A1CA78F414B6FB B-P5
80,260,731 *0889ABEC6181DE7EBF582047517A79CC1AED14F0 3-----D**Sploit
80,260,732 *088A990B69C6B31430CD93E29A62CA235B75FAAF aqbl6
80,260,733 *088D4818A568F80B2B933CACD490FEF2C9EE80BC AQiM
80,260,734 *0888E5B5EDF9BB37E1D35BE708E6DD41AD6A5BEE AQ%SU
80,260,735 *088D7BF0C26C40368F56E0D13E94C5F6B5978447 3ROGULINA
80,260,736 *08813655709D93B419A6D2DC78A907479BE86F97 antonhallowell
80,260,737 *08835D067C8A4FFA7F62F3D464B29CFAD5E9EC30 [email protected]
80,260,738 *0887BB7A5EF562EB64AE7C51A90CFF66EDC7C413 3V01U70N575
80,260,739 *088B5284FF93CBF84509572736D7B2CF1BD3E2D1 arepazcom
80,260,740 *0885676C8DE7E2E5E97C50AA014D1D669DD475ED ari:m
80,260,741 *088C2F589C2EF897C87F8D2F374D7D7761C60232 arliepalanza
80,260,742 *08884FBCCFEAEA52FC5F2DE9A2DDF0E18FC76C96 braunbogdan
80,260,743 *0884A6866FC146315B6E978266E9732DD001F4EE 402SOFIA
80,260,744 *0886CA9FE5C059675E4DE233AF3B428437AEB487 A,RRG
80,260,745 *088E7AD7D1A30D9D9F088D7B12854C38B2958F71 ARSONVALKRATERET
80,260,746 *0885E0F5109632F193FD9E353D154340987EA9C9 artanpllana
80,260,747 *0886C8991328E526B684CDA0C1E0A273E21402D0 ARTYNAN1
80,260,748 *0880EB3F613A5AD1FED92469F4A41DF053CBC2E8 4ALEATORIO
80,260,749 *088BFE7401F4EFD94B50CBE73CA18B0D4FD70F7D ASALTARA9
80,260,750 *0889D36DFF793026B691EA37BF62CB0A24F974AA 4DERAT
80,260,751 *088B75353DDA6A2184B15E1235DBD4C1383D601B BRIAN ZINGLER
80,260,752 *08883ACC4120BCADA668E86AD11902F389EB14CC 4EYXARISTA
80,260,753 *0882CA73CD46ADBD854750225CA20D30E7782F5F BRIGHTLIGHTSDEADCITY
80,260,754 *088BD0969F06422878D2A37ECDE41680CB51B2F0 br,iu
80,260,755 *08870245BC9D4EC8DE7D335293218B412C807F46 atb8c
80,260,756 *088BACBC15F4BE8C948572E1AD328B8FD6535E01 athchevy1
80,260,757 *088537A0606262B17BF00791260221C3D53605F0 AQXSQ
80,260,758 *0887501C010B80F748AA44417CD9193CB93FFFF6 ARABCHEVA
80,260,759 *088BD04FEDFDCD9FF2A69D4378E3FDDD3167D363 ARA+H
80,260,760 *08808CB58ED48391AFBDFAF002C11943584948F8 A(tW
80,260,761 *0886467EA810E71944C3B3F64198CA930BCAF237 aubreysamora
80,260,762 *088D3CFE0867C2045870865EBA743BFABCDCA0DC Btm
80,260,763 *08801A662FBB5AEEE5A675B977D0C93CDC3FBCE3 A+UFH
80,260,764 *088EA53895B7AAD280DE467152B14EA06F366496 4WILDCATEXPORT
80,260,765 *088F489C08C0C1E19783185427260F770B400BD2 BULGARI
80,260,766 *0880DEBD17E4B3EDBF37F6A8C3463099FB69D7E9 4ZAPATANATASHA
80,260,767 *08863EF5A3CA627FA8E725E90124989D54D5CC08 arsenalvnewcastleunited
80,260,768 *088AEC214520FB82370F90452B559C723E8B1CD8 a!rta
80,260,769 *088CB5A899CDAC0EBD9348BF66E87D49CC70613D [email protected]
80,260,770 *0889B09F6DC834E315E66AB98CA334DB56F276EB AVNI"
80,260,771 *08873A9D8CE8C316D6A0EC1347CAD5D59964B994 5AXIOCERSA
80,260,772 *08844229DA15AA33D508A8F7CAF0884F41E056A7 5BEGEEFFEEGEB
80,260,773 *08874EC4427C8E732DCE860B2A095DE6F412C91D 5BRANDEGGIA
80,260,774 *088E781E1AC620A32679295B31EE3C3FC5D723E3 5BSWNUERBURGRINGBSW
80,260,775 *08837D6330CAF21194728B428111AA45277E506B AWlP
80,260,776 *08836E13555E36E460084C7D72B8984FDD9434FD BWV_
80,260,777 *088599E70F24E73A7E1FF6EDE6093D6752CE8B7B bxy
80,260,778 *08865A61EB5BC09441BB3B1757D47ED776905E61 ATE+
80,260,779 *08888056DC0A92004B788B007AAE3711E38F33CC BYCVYN1AEXOUM
80,260,780 *0884CAC0F13D30493A9636E23197C6A4FFAD2913 5LONDONIMAGE
80,260,781 *088FCB7DE1EB2B87595554901B6557B111688D58 5MALDALENA
80,260,782 *08897E545ED505E652D9963A05CC2D7FAA0191F7 ATUO
80,260,783 *088CBCD5CA629763E0D6DC7D3484A766A49485CE C0lN
80,260,784 *088899060812FF6748248C149B0BDE4EBBB74847 B5GAK
80,260,785 *088F2D02C30F90064F18D62E66A398382E71636B AUSTINARDS
80,260,786 *088A75F0D8DF222005CCD2DAF26666C4953A4068 b6#-#
80,260,787 *088D1426B3BD05F79105294819DBFB3F47C54233 auvc7
80,260,788 *088086B4F836D24D80F1E7BC9F5B3F389D9D273B b7q"m
80,260,789 *088DAD983D542D4178979298FD7DC67511383ED5 C4LGN
80,260,790 *0888A7AD7CFD6037E325297701D33CED05CF0026 C6AMB
80,260,791 *0881A79B3D3C470DD52AEF674F98593E39A9EE43 c6l
80,260,792 *0889F9DA69E5A810278F9AD30284D419DC735CF6 ay810
80,260,793 *08856F111A771E809139EF8876ED3C873423A37D ca04m
80,260,794 *088BC7CEDBE4CC643DC8E73CAD6D459A1E589399 B117748
80,260,795 *088E2549EDDE4E5293FD6EF494E8294EBFC0FD06 Calter
80,260,796 *088288202DA4039BC4FB3C61D5F6E114C9005D3A b.1hc
80,260,797 *088FBC83A802BA18991A15EDE5A929BB88DABD6F b-26&
80,260,798 *0887D803DE22CC1B2366137726C15801870CB424 B2D2A
80,260,799 *088103299A3A36D3FA4904B224B021A4527AACAD 6NDWORKED
80,260,800 *088FE71ACA79A0225A732B8294387D0CD0155BA5 CARATERISTIGHE
80,260,801 *0885F60ECF87DFFD42F014A16DCBBEE0A37D3BD9 b5rv8
80,260,802 *088EB084824E8B2DBAF95A9BAD5934E18DD3E2AD BBXF
80,260,803 *088A223FC219F5B027207320596648B4A0151DB9 carlgrever
80,260,804 *08839EFCECA93A0B14D0EB8A2906E7B237A951CB b7mkl
80,260,805 *08821CECC15EC288AD0BF49E5F3A1A8A6284408D bdollahi5
80,260,806 *0883345824D106AF42EBC42C5527E5897ACF18E7 BABYLEGS1
80,260,807 *088B18C1955BF1A3493E77EBE0060B9958E0F942 6UOYZNEZ
80,260,808 *088A6E34F0DF9A4C80D37BCBE91464D904DDFDFA CARYEHMAN
80,260,809 *088868FDA3D1D337DF3A7A7BF94771D378F4F41A 6YRASCAL
80,260,810 *08865CE18B663991E3C6CE86EAE01B453F987AE6 CASEY.FARRISH
80,260,811 *088D7B02F6080CD0A2DB89809126C37B98F022BE BEGREPENEN4
80,260,812 *088295ED4845E1F27C6DBE2ACEF2A6DF2AA578AA benjie.tuazon
80,260,813 *0887160D440474FA6DD9BE3FE732B6B4E23F3A7D bentongardener
80,260,814 *08824D19E41D31D20949A3894849136513881CA8 BEQF8
80,260,815 *088F03728BA2438B60FF42D870DBBE8A51ACD09F bbr%q
80,260,816 *088348B1D7AF28F117368AB671A3CB9D6C8B6292 CECIL.DARCEY
80,260,817 *08827229D2D89C116CA171EFCC1D551C6CCC8286 BDMNB
80,260,818 *088121708134E16CC40A2926A9E4A003CDB509E8 7ILOVEZIGGY3
80,260,819 *088AA86C582F3E1FC49C552790D24DE3A229B5EC 7iluvdixie4
80,260,820 *088DB61AA4B9F678ADA78E845F6A0A870FB20700 bejlin
80,260,821 *0880943075F210CD6E7F09E1DA002F0947279D30 benjiegarcia
80,260,822 *0880197D9109B0488C6AA3D84B8940ED48262012 CGJSCOUT9
80,260,823 *08862ABEE487450C571509DE8D56F362730600D8 cgput
80,260,824 *088280DEC69F525134A631E14DA6CDEC79878249 b%fe-
80,260,825 *0881CE7716C895FDF7AAAE9D29228AAD8CC25CB1 BERTPECHACEK
80,260,826 *08820F3A5575D0DAD9F194E628A6BD5C144FA01B chadwickwallenda
80,260,827 *088744D448741A11A1633CF4B685DA41E66114B4 7SHOPWALKERN
80,260,828 *088A23717EABC0750E163E51A0C7009D117CDE5A [email protected]
80,260,829 *08873E298468A692F4212036E6A875901F601C45 7SPOOKYNEWTON
80,260,830 *0885A5A212CE08D5301DAF096F5B3FA90C1920AD beteel?
80,260,831 *088B94345B5B448EABE944ADFB7926893EC50504 betty-mccallister
80,260,832 *088ACE876864AB2CAE6873D79AAC3DCE46407B26 7TOIVEAJATTELI
80,260,833 *088396129FF69F01BFE0459469281757C945CD4F bhhk;
80,260,834 *0884A60F97BCBB79506FD3D139B59D48AB2E93A3 bgp1d
80,260,835 *08855A70594522C511C7EB0E8E85BCC9E0C1DC0F charlesfeeback
80,260,836 *088D0492B576CF3C7DAC8914E547CF72C8B633E3 BI3VR
80,260,837 *088DF8BCAC03C1D52EDC32359C2EE6ADA9C694D2 BICIA-FELINA
80,260,838 *0887D1C6A3230C210372EAFE2DD403ECFF679106 billyvia
80,260,839 *0881125C088DA981257B5F113CBE02D239AEA7EC 8ASAMARES
80,260,840 *08873CEE94F5445D73E99D11C5F97C07F521F958 Bkb6
80,260,841 *088C9B4221DE8D02EC5064D28F246FD630174383 8BSWKOOHIBSW
80,260,842 *088A13E3C1C3E3483DC4E19C1944DA8BD3EF4A5D 8CANCATERVATED
80,260,843 *088AEA61E93277B454067A0FB553682F7129CC33 [email protected]
80,260,844 *0885ABB7CE663BC2C7F8AFFD31A04191AE197BEE CHMDH
80,260,845 *0881D6D9BDF53374F8BF448A340006379B7C7D59 <b>listing11.5.aprogramthatprintsavalue-fieldcharacter.
80,260,846 *0885683D8B696380AB4CBB542BF319D5D1DB1134 CHPN
80,260,847 *0883839E1CE30E4E1066F39E0CBAAB1D817CBB38 BL(W
80,260,848 *0886F4EA501098E48DAE9E91477A804EC4489221 8FARMERNITE
80,260,849 *088EAE422523A96B8E40B2419C1E14CCFFEFF158 bl/fa
80,260,850 *0882C14E1DE39A3A75AB901F2EB231A7D38101EC CHỦ TỂ
80,260,851 *0889F0CCF35BB0CA753679B1197295D6AD842944 bluemoonbluere-mix
80,260,852 *088B0CEC7C67273AA485567F0BFB996EE1D60126 B:N-H
80,260,853 *08827918EDCDD032DC275C1FDE3182892406B219 8LBAVITCA
80,260,854 *0887D4ACFA6D4D4B4AAA4E7D650395AAD0D56953 BMKY
80,260,855 *08873A0708DC5E53E730407403B1B6869D08BA3D BMYTHOW63
80,260,856 *088CE642BE726F9F8EE266DA0A9E74699A754241 8NOOSERS
80,260,857 *0886729AB8ABC9698E3948502ABE74BB13A5A6E4 CJCHERRYH
80,260,858 *0889C4FCD39065F2D0823A67D28C5BC88B008E5A 8-----p * * splat
80,260,859 *0888722AD7BD73644A5CBBEA9FB560DC6AEF1C31 [email protected]
80,260,860 *0887F6C5BE6EF3B4B7C29998E552A2987E5566AE BODENSONNENUHR
80,260,861 *0885B53D2A5CEB12E4AF1A5A978EA599EF8DB498 c$l&
80,260,862 *088C5D32A36F2ED3297F57FB9E810E2755BC352B BOQ?%
80,260,863 *088A90C1D67FB4F57AFBE2EAB253E67CDC889F06 8TRANSIENCY
80,260,864 *088F759C2858D7C74737463D36B9F8B5EDD045CA [email protected]
80,260,865 *088E9C88F21BA54F76F41431FF165ECA5F351BD9 boys-in-shorts-are-not-decent
80,260,866 *088DB30C10ECBA182A64E74E7CD16497A8C7241E 8yansimaya
80,260,867 *0889EDD0E8B8137089E5DE616EB96D1C5E9655AE B#####p`~.(-_0)
80,260,868 *0884FB6BA97A5C57BD1A7031BE3EC6C52AF549E4 bp8?
80,260,869 *08889D06EF3E6C4553C29C0CF6DBD0EC88146F56 bqotf
80,260,870 *088FD8C98307FA323A184405924C00C20918C4B1 BRIANA650
80,260,871 *088BB78DC61FE73E5DE207503D3D7EBAC4EFA228 bryanshain
80,260,872 *08862115E570F04500E13A89F402D7D45C507185 BRYONKIRCHMANN
80,260,873 *0883778702CB2C1CCA5A597B030CCD2ED1F0B4D4 BS1RN
80,260,874 *088F10F19DF2DAF47A4E9EB106C584303859532D BSWKORTEMEYBSW
80,260,875 *0887F70A6B8CCC516272A67354C994FE6C7B79DE bswpeirithousbsw
80,260,876 *088FBC7D4E5D7A720567B60288EDDDDD840CF9E5 CNAITLINGTON
80,260,877 *08803E7239637D1A660F34B8F020C806717F3700 [email protected]
80,260,878 *08887862EA4244E1D79926658FAB8613DAFF390B b&te
80,260,879 *0887B09E795D8DC77BFA9EDE61DAF345EB0CB6C2 CNZ0=
80,260,880 *08816CABBA2504058518D6A6D413FD2B63F15848 colenthia2
80,260,881 *088547CBA5C523D14C5CB7FBEBFCBE17AE03905F brmoh
80,260,882 *088237576E544035164B3E83E48AF449991A3B06 burtkilloran
80,260,883 *08841444AC7EA1FAF434D193E9B50FC31C18005F busterbroussard
80,260,884 *088CA28F43288CC47AAF68F59E8409C576084F14 BUSTEREHRLE
80,260,885 *0886A0ABF32E432FBBA1DBCF5FC8F2FD6C8FDAD9 [email protected]
80,260,886 *088EF2CA3D46E53C19FF35F62BEEF35740B3BEC9 9UDORPNAW
80,260,887 *08894C6A8D1C4F3F06D41685977EA20BB1B5F058 BV;T
80,260,888 *088437C9C5C1723960F6D30F47BAA17FBC387218 CONTRIBUINTES
80,260,889 *0884AFBBF81373A44256CF34B9D51EEBECF48A49 [email protected]
80,260,890 *08894FE2A74181C30D78E371C9E1412E86FDD0F0 COP.THAT.SH?!.(FEAT..MISSY.ELLIOTT).(MOUSSE-T.IS.FIERCE.EDIT)
80,260,891 *088D9291ABB872683C13725B7A65D7853C4D69CB by0/f
80,260,892 *0881C25FCE0224B279AE63C502A4BF42ADC52008 byiw?
80,260,893 *0885F325C6C84295BC9BA59760BCD89B6E0F0F79 COTTERS
80,260,894 *088CBF50DBCF4549C1203A6AF980D85C80281EA2 [email protected]
80,260,895 *0885C68B2F68C9034D69F342A24AD279724ED258 cp6et
80,260,896 *088EA1D20828B4554F3C4B702D4D49592C3C5DD7 BUDPROBERT
80,260,897 *088C2E68419758406CB976993FD51F72BC35548B BUFORD.WELKE
80,260,898 *0885E41C8FED126C2745C15006EAE7A5B8FA0807 A8PZ
80,260,899 *088968F0760307C567ACECF06D8DFEE551A13BCF a9r1cu1tura115t5
80,260,900 *0884BA834D393CB5390C3C3E2098A29A0855FC00 BURMA160
80,260,901 *0881E00F10931DA0E8A360329C97F5A75AED2DA5 BURT.DOMBEK
80,260,902 *088E1ABFDC27450AC91CE1B015A061B5439B2A8D c6l
80,260,903 *088AB60F1A2188126547A72A72945FC05E77C81E cristinesorino
80,260,904 *0880974F6C289B3F2F27647E465913C4770829B4 CALANDS6
80,260,905 *088E452B321039C111063956756618D369FDEB9E ABBIGLIARMI7
80,260,906 *088A9530B41E2122EC39C8692BA612C9D4A3B7C9 captureriez?
80,260,907 *0880EF2D0188DB9DF897791CC36BECEEDA66ABF0 A)Be
80,260,908 *08885CE23B894F27673F7A2D85B7C60367333073 [email protected]
80,260,909 *0884C4D9B1F469563CE36AB57D030D2E36D21958 c!,"t
80,260,910 *0882F687B2E2200AB16A480F8E49EC2E827BF141 ctcテレビ夕刊
80,260,911 *0889FA94DA6CE55121FAEAA1DE95887685FF878A ABRAMTAUTEOLI
80,260,912 *08816173DC3633F3329EDB373E551DA7265352C0 ABSCHLUSSGOTTESDIENST
80,260,913 *08807870D205E7617B0225F6B997F3D5E42D0F0A CBARIBAULT
80,260,914 *0883D694061834682218755BBF95D9FAB98348A6 cbbva
80,260,915 *088FBF27D480CF735C9A1007A560ECAAF79E0CBF c9co%
80,260,916 *088B5466791189F47490C9D03B33D50B11FFC60D ccaq3
80,260,917 *0889B2C8B90820E4294319BB8ECF05706F5EE7F3 CCNT
80,260,918 *0884BCD6005103ED49C825BC4DE5A7541F2EA368 cdo;4
80,260,919 *08846D0B246E3F80B260BE1D5A6BC1E06436BAE0 ACTAFOOLSONGKINGTEE
80,260,920 *08831CA6FCEC7DA39110764F5EA085C2070D672D CECILLICKLIDER
80,260,921 *088A71F2463DC8CFFAB21176085492CC795BC4C6 cedrickbonda
80,260,922 *088081204ECBB9CF2A58C92EFFF88DF45504C4AF CAMERANED
80,260,923 *088161445F29D3F0AC80CBBF7D75672388AD93DE adAt
80,260,924 *088264CE49C2FFC53F338B1B13BA8A499FEBF327 CFJJAEGER5
80,260,925 *08896146F17EF9281AB81F565F8E3716A23591EB d1nli
80,260,926 *088AE2F4BC89FF1CACE591EC5675D3832E0F80A6 CARINA330
80,260,927 *088F9916714FF0D37AD0607FA932DCE2568F1C1C d6br
80,260,928 *0885A3A6ED63C3BD5CD88C40274471580442F5BC AEY5,
80,260,929 *08825291F7853C1CEE6F68086123AB17AEE78A58 [email protected]
80,260,930 *0888CFB3BFBAAB3E520F160389CDAB3627238BD7 D7ME"
80,260,931 *0885397DFD0E906658121DA110B6815528B9431E CHALISE(LUMINESCENTVERSION)
80,260,932 *0883E48FE99900E9563CA313DE86CC682CFA5770 d9o4l
80,260,933 *0881B8393FA1F16A9E663DC47C7E3112357DBE28 ahora.quien
80,260,934 *088FA492A60CD33D4789CFDC6A22383E5B4C8CEA <ahref="6narrit.htm#l102">e.secondjordanmeeting</a><br>
80,260,935 *088C2403F7B5876ABE09F9A45D6A8F43AB373314 AIC(N
80,260,936 *088672C03574F18C92C5337F7AE95BCEF0BC2CEA DANA.CUYLER
80,260,937 *088520E4149D7596659F0EFB7BD2C2063252BD53 danielponcedeleonvseduardoescobedo
80,260,938 *0889B9C5ED7D084BCB795855D3ECC06A19795E2A DANNIE.PEDUTO
80,260,939 *0884C8A0C82C52BB03DAF5C7A31919F73D662DAF [email protected]
80,260,940 *088E6B42BD486046F7498ABDB4EDD10F3DE03A64 akhiman
80,260,941 *088607F69F4A086503D16600117E161682E87E95 christenfallon
80,260,942 *0881148C57C19650BDD9AF0CE9B0C1B745DA5F1F darleen-allen
80,260,943 *088FB474AF1D31C2219A793AB93E586AB50EF782 CATHERINEAYERS
80,260,944 *0880D80844A80B9F4006D605E4426062CFEF0DCD ALBERT.CALENDINE
80,260,945 *088DA2BC034D7F6141BDBD325181908E13C1EEA3 alecborlace
80,260,946 *088F49881C4A399B50EEEBA803F72BBE92E3927F DASBROTDESTEUFELS
80,260,947 *088ADD776C449C0762069FC8D4B93F30BA3E77F3 [email protected]
80,260,948 *088F019056645E356553704021C5B5E890ECCB1A ALEJANDRO DAVIS
80,260,949 *088050D657BB3AFF7C39110DA13C720D55C37AB7 [email protected]
80,260,950 *088E0F389E6132E5E55D0C74A812B0CCA1BFE5C5 ccds1
80,260,951 *0881E3DEDA62B202DC8B12486492DF98626A07E4 CIRCULATINGLIBRARY
80,260,952 *08812A0BF6311BB030E6CD90E8E9ECF317524170 DAVIDTEAMO
80,260,953 *0882C9A406E04C703B7BBFA867F298190CECE054 cd(_q
80,260,954 *08884C516D447CD46A609A7192BCD30311F167ED cdufa
80,260,955 *0881C323A4B4FC87408B39F91D3D45BA4975A8A3 A_L-M
80,260,956 *0883C3261955198822C770BAE296AB81754BCD86 ALONSO.SAYERS
80,260,957 *088CA8B304C66FF1CBF169C18C60178A31F26290 DCO1
80,260,958 *088A30B6DB9DF90E30C608CAB91F8EFDE97CD8B8 dcvfh
80,260,959 *088FFDC8C01F1375DF6D11589C0EAF052A22BD13 ALVANETZER
80,260,960 *0887A1A188496889106987292EE25AB6A24D73E5 alvu
80,260,961 *08828C55EE617212E74177BB4F2A1BAD26DF2AA7 DEANDRE.TOLLMAN
80,260,962 *088560D8827B9C8A644298193FEB2A24222C14CA CLUB.DARREGUEIRA
80,260,963 *0885088CA4C3A12C244E40592D696186DD2F3374 ambróza
80,260,964 *08880464DE901672611DEDCD7F951BB595CE8CD3 DEIMON123
80,260,965 *088F660A1B441A62122CCD96AB92B41A2F44C8D7 AMYBANANA0
80,260,966 *088709EC26DBE8D267779A63D500A1461CEF2F45 [email protected]
80,260,967 *08856A309B3AB158F486C1AE7E971EC4A15FAC76 anaketi
80,260,968 *088DE70E44CB42C2945C6DF1E6E0FFF583F97D1E CESARHINGSTON
80,260,969 *0887BC6736F004F8E27FCF0366773D79672B7CB1 COBW3B-HO
80,260,970 *0882ED9CF4D7B7495BD923B450B5B5A4C5D93775 C'''OLGATE
80,260,971 *0888E4F6AFD0D474334A46CB87A005D372320DB6 COME.TOGETHER.(111=3.MIX)
80,260,972 *08828101A89DCDA228468AFCC968299D3318C72D DENNY.TETTEH
80,260,973 *088C273D8ED665E89CDEBF8775F3BB357ED5B507 cgo%t
80,260,974 *08856AA252B47A7DAD3E5E1807DADDBB5CDDA89F ANJELEQUE
80,260,975 *088EAEA5C4964C93C81BBB62E03108B7AF1DF6C8 ANMGP
80,260,976 *0881351FB13DB44640870E8CE59DDE39EA0840AB “COSGROVE
80,260,977 *08881D8C478FBC94FDEC0526C551C99E8F8E39F2 C-P
80,260,978 *0883C75CC6BDDB30506B9637C0C747565253DFF6 chasmowder
80,260,979 *0887B27A31794792D360CB79A51A1777F7E8E8F0 antoinehuffstetler
80,260,980 *0889C6F426ACBE37A9A3F20227FC78E43A856F44 destalinized9
80,260,981 *088577095801FDC409C74CFF4C2252E4747640B4 antwanwootan
80,260,982 *088CBEB949099623EE9463FD71D8BB7D0933B0E4 [email protected]
80,260,983 *0885C81FDEFA87087DCA29574A77859DEEE5A060 CQ_I$
80,260,984 *08877393537BD380C7DA25EF975A780F7F7D4029 CHESHIREHILL
80,260,985 *088C59CB18433D3EAFF9EA5CB0091DFC92794587 [email protected]
80,260,986 *0880EE07AFCE2AC91B9450FA2477155685BDE482 DFUK
80,260,987 *088887CA6293A0BA7E5F5CADE4A806C8330DF754 CREATIVE131313
80,260,988 *088EE797DE58E6C1EB57F0AE3C5684C62307931B [email protected]
80,260,989 *08898B3C015E78D21BCC03E5900298E6A29EAD4F crf)t
80,260,990 *088694A261A0EAE7FC4A3E8EE98D693A040DBF83 christine.langham
80,260,991 *08899463F850CE21D10E9EB7B3D325DA099926E2 CRODY
80,260,992 *088B8AF09365E62163AB70B03ECEE4E0B2CA5003 CHURNOSOFF
80,260,993 *088F214D866780DB6AC5AB4A8B23AFB3C7308AD1 [email protected]
80,260,994 *088711C2DFA296845ADD9CAA172D2AF039E07EDF ARAROBA
80,260,995 *088CAB898E66A01F83B129339638F70DE61B5B8F C/$+T
80,260,996 *08828BECC65F23B6B6274A4479FF57DC7CBEBDFE ARIANESUN3
80,260,997 *088F6E9EDDDEB291DEDE0FFE85BEFF01066B71EF ci+li
80,260,998 *0883596C0C52CBC34D2601F58EFD2128FF802394 arnoldolarreta
80,260,999 *0885826683D8E63D8DD87B9E66D86688A06E90B0 DILLONSIERS
80,261,000 *0882F8105595A87399ECF6E56424D7B6291BDE3C DIMITTIRE
80,261,001 *0883C7CF73416D542C02B0973717AD2A98CAC8FD curtbratz
80,261,002 *08859206626735E10BBA8B300F85D78049FC901F ART.DAUGHETY
80,261,003 *088F0ACC41ED3F947D437D01B9C5CBD6E30C764E cj74sex
80,261,004 *0887BA7AC800C6EEFEEAB58CC6F3B689F841613B CjV?
80,261,005 *0887857CA07E33E0AE9B2ED6E96E897DC042EB44 discocactus.hartmannii.ssp.giganteus
80,261,006 *088F88DE80898BCECFC699A2F8E7599C16BF5170 CWKR"
80,261,007 *088FB7418C8BD96F3EB2061E597C2372198E6861 cy.pres
80,261,008 *088C24CC769E9E66520299AEBF82AE608A46DF80 czc9c
80,261,009 *088894926F7285BC2F22DED616A2B429C5D393B7 CТОПAЛО
80,261,010 *088276A657E90774EDEFDB80BD3FC8BFC92A8982 a!rtu
80,261,011 *08834BC5310C860ED318E7FC005DC4B5D9BEC04D D0EU
80,261,012 *088DF865FF6DA9A36EFC065DBEA868EDE11F4FFA AS5CS
80,261,013 *088A47A58D3BE775C1C9309189FA742B578B8D93 d1w4u
80,261,014 *0881F1DCAD5A175D5A1F899FAA07FCCC0358AD0F dj#%p
80,261,015 *0886CA16E2C9F8A1F0E921107BF194ACD723D11D ASH&VIC
80,261,016 *0883B40F235B8AFBBA2CF73A638BA32232A7E96B DLGFS
80,261,017 *0885E964DD9D675396A06C0BB4EA54B06CAEDB8B d7qev
80,261,018 *08877296AD69F910BC1562B48A90534C2331822E atiarah7
80,261,019 *088E4155CE3885140BC6A3FB9DF1E7D02B6803F2 codydona
80,261,020 *088BFEB7793A782512F504B3831CD963ADD75B51 [email protected]
80,261,021 *0884C8CBF147F0992B4F6F9F4AB874EBFD938EC6 cof#.
80,261,022 *0884C4AA781C4987A40251770EE9E017BB7AF52E DO1HC
80,261,023 *088A59782A2D43DA3509BAF7E96CA7E372C4B052 doi/a
80,261,024 *08879BE4217DAE1CC8D958AA6F64781D294C7579 AUSATEMMUSKULATUR
80,261,025 *0887D3BA3FBC50A5A5ECA376BB3A818D389BB32D DANILO.RANSLER
80,261,026 *0883380C2DB795F1399853010FB7076B21CEB766 DONALDLYND
80,261,027 *08885AC7E4EBAFC6807DB688D72C78739B30ACA6 [email protected]
80,261,028 *0888810E98D0CB853CD912D0BC38C6D8097BBA74 av5=;
80,261,029 *088F9555909D8EE7EFF6E61488D0CFF0CC4536F2 DONICEN5
80,261,030 *088E20C3C0902826A12917879FAD8C1D2B6931D4 donniestagnitta
80,261,031 *088E90517EA2C8B8DEA6E9943FFA9A556E1E90DA DONSKOY-6-0
80,261,032 *08812A98173498B8980132FB030029A46A1C785D AVNQUADRUPLICATING
80,261,033 *0889791191EDB38DFC9CE65B580C793DD3FBD051 COOLBAGSED
80,261,034 *0880570880B75462B68AEDC11C7F953E9132A8CF doppler.drone.(impact.version)
80,261,035 *088C6A5091B07B6E9496173B8F23A755E7A895D5 DORAHYXED
80,261,036 *0887B3FC548E3001074A4D90C3DB0805469B6A3B DATAK
80,261,037 *08867A8CFE9CC7B077F88381240914B2851CFF4B D&-P-
80,261,038 *088A09F76B5325C9CBF9EECAD642EF21CCF1F2DA D/PS
80,261,039 *0885DD7863F35833D96020D8D7C07E80B4FD0440 DRAWING HORSES
80,261,040 *08887200A95138A0B90CECF95EFF7C1A6D1585FE DREHER1981
80,261,041 *088A54ACFC916ED747ED10D6F84D9D220A40A63C b3rh=
80,261,042 *088A11DE9207CB0D44F25915325EA9E78BDAEB62 drk6d
80,261,043 *088B4036EEDEDBCE4EBFE63E2CC0AFB6917284BD b6%+
80,261,044 *08830EED4630AE8090970BE1E3D4D67628E659A6 B,:7L
80,261,045 *0880980FCF1CE85A26EC51A8453C0CA9BECC8DC0 CPW0N
80,261,046 *08828B071027335CCB84262DAB278FD49D261A79 BALA.BALENDRA
80,261,047 *08864BBE9A4E592DF4AD422449B698DA7DDDCF49 CQT7A
80,261,048 *0887457FB6356A2BAF3B790BB60F34CE5571A1B3 DELBERT.CRUTCHFIELD
80,261,049 *088498E70F143B90B192BF85EE5E232A5780A242 craneman9
80,261,050 *0889702B765D7C8897C93F40CFCCDF6EEAE701BA CRAZYCHEMIST
80,261,051 *0881BBE6EB3B1A14672DEA9C366FC45A0E71AAB9 DE;N6
80,261,052 *0880C745E882573C3E32AF540B7351DC5DBD8B81 desabuserai.
80,261,053 *088EE03A1B153845E1F60AA70F538E4BAD3B7C04 barneyrauzman
80,261,054 *0886F257D7413740E5CC586F1C296A3A6F738951 DUSTYFARVE
80,261,055 *08883FAE6DBF60F521B7957C17BC5D4FAD8BBB6E DUWL
80,261,056 *08845ED77356C4FC6C464608A7CED3930A067554 basanio-sterling
80,261,057 *088838E668A940FEE1E3CC7A1A209662C80B03DE DVF2
80,261,058 *0884A5A4EBB6733456147DBB8D45E144D28F5D1E d.fu"
80,261,059 *0886923A0A1D7143A8CE64808362F7AF446A9455 CULLEN493
80,261,060 *0889F214F0F736FE1B2338FFC3C4FF30C89B85AF cwrvs
80,261,061 *08814E000348EFB48C62C50805802F45662E295D edfo.
80,261,062 *08852FECFE498877EDFF330C9537B73023C54996 CYNOSCEPHALAE9
80,261,063 *0889727A43728BFE95A67D03987067383483238A DISTINGUS3
80,261,064 *088A783F2F97B742759BC068EBFDE52AFBF5D6F7 [email protected]
80,261,065 *0885CCC13CAD381CAE87DD515DFA5679A17FA48D eeps%
80,261,066 *088798C045D906FEC525E079CF37C8908AF21241 EFMCB
80,261,067 *088974EBA8513C50E5C65AA7AA4EF53D9E7FFEB5 D1OMI
80,261,068 *08891858894CEDFBFCE3CAFCF63052E249946B06 BESCHAFFUNGSPLATTFORM
80,261,069 *08826B8A584DB8517DA50D8D6A7C9FA75D49C789 beschriftung9
80,261,070 *088AC71B2C324019F4649420769C659FA0D0ACE9 b(fia
80,261,071 *0880EBD0F9CB9E60FC324568A34D0EA0D266897B elipa)、ピナール・デ・チャマルティン(pinar
80,261,072 *08869718AF81F8BD5B49010B367218708CF5C011 DAARJID
80,261,073 *08837F6E7480BAE99DB1190A43255638DFC4AB6F bhdqg
80,261,074 *088A38FBFBEB7DE1D4408D964B4D0C502CBCC7CF don-jhay
80,261,075 *0883E0A6AE21CD9950B34EF66E53447D57D735E8 [email protected]
80,261,076 *0882E98F8DFB2D10AF2C03E0E88E293281050FD7 EM8OLZ4+ON
80,261,077 *088F073AB4055E2CC561479675D730534EA68D99 DONTE.VAUDREUIL
80,261,078 *088A8D99E1DBC1B24552505D1F6D6F42B08D9743 DORSEYCALKIN
80,261,079 *08819E989AE2A15B17BE412BD111201A65813FA7 DOSHA_1
80,261,080 *088471D034ED6BE695B9B9A95012C38F0F208BA1 emanuellindersmith
80,261,081 *088986CF10E08A9E6CF6E42FFBE1C1EF59FBA7BD EMBARRILARS123
80,261,082 *0886C7FD31986C994748DC5ECBCB6D1B1CDC90A3 EM"C
80,261,083 *088D181317ED372258E3111C09C93152FEE611AB d,qjs
80,261,084 *088B2C1FF5D0B0E46DB26B9883569419025286EE drawnthread.work
80,261,085 *088E302E39CB34A1DC816307785C26A30385AC6C D+RE4
80,261,086 *08891EF8443A9AEFE1E5317A95A52F8457BF8D9F bk=,
80,261,087 *0883A41EA959630933592999B1A44323B32B0C2F bk&rc
80,261,088 *088380CDBDC4DB0531CBB28509F16485CB3694B8 ENRESJEK6
80,261,089 *088C3026071173E57E3D98F6C048674F9F8A9B81 DARONGOWENS
80,261,090 *0884FE9893DCE1F12A3A6BB33161E250417D28D1 BLAIRZEMA
80,261,091 *08828D7481CE97C13176EF55D1BC2170AC8EE9BE ENY-FITRIANI
80,261,092 *088E835C42AF54A1698A6758C1AC590933F81105 bldmg
80,261,093 *088EDCBC8F88CA7E0F23DBCEC318AB14E048985D er(/&
80,261,094 *088EE0EBFD7BC1AD3085A0F8F036A98F175AB0B9 er[
80,261,095 *08831E51484598F0F84E77424C8E49FEADB74F4D du4iw
80,261,096 *08808F5C6C8043C9E092A3B7C3C5488D0FC72BEC DUANEHANDSCHUMAKER
80,261,097 *08871C280256B94A5CF4D9033E388B50AF798585 ERICHFINICAL
80,261,098 *08882DD00641B47D0816AA03D38C51C93BC4CB03 ERICHTEARE
80,261,099 *08866FACFB06978FE41E7FED29A84EBCAB8174A6 erol7
80,261,100 *088EA86257DBB062C696B93B85507991B5EF8C8F DwM
80,261,101 *0887F2769D84DA15FB6A0D65543D330929F95A0D [email protected]
80,261,102 *088CCBC978ED347B9ADAEA36B07BC2E2EBD04BE5 DYLANHOPPA
80,261,103 *088AC4ED4B0D66625717189E7C3F6A1F48A617F0 DYLPG
80,261,104 *08899CA5255517F4AE1783A2AD9188D6DBC7C15F ED.FARNHAM
80,261,105 *0884777FDF19A8AF18555F77F5517D06A18DB793 ETUC=
80,261,106 *0882AB534B886CD1E96B43E04AEA4FF47CC2F3EE b(qi8
80,261,107 *0882F2E2DC7D7C452DBF52E35BE1BFA6E5326D75 dc9sv
80,261,108 *0882B18D661F0E6941CC8C96FE2F0A80A3B1904F BRANDEN.BAMBINO
80,261,109 *0886D8F13B24150165AB118C7511FC2AA189F01F excellent.sound.of.sitar
80,261,110 *088E4F96B5A38092A4E8163A497D8EB9AE1AB413 DD;RV
80,261,111 *08886219736CD6365411868D582FCBDFA3F44BE4 ddy!
80,261,112 *08892DCE782745A5EB453732E8FD7EA78EBE6277 DE4=L
80,261,113 *088F5DB9666365FCBE28B898BDC6617962271737 ELISHA.EISCHEN
80,261,114 *088FDC8FEFF2537786792122297F259384EDF53D ELLEN.BAUTISTA
80,261,115 *08811DC5A303C44873307EB64B6E7F341FDA8079 ELOVELAM1
80,261,116 *088A3F2B9EF0DCBD51FB08E88B045A2C2436CD26 BRIDGETMIDWAY.COMWWW
80,261,117 *0889958B5138543E277865C09B7D43A709EC68AB elve
80,261,118 *088CAAD114F34D35DC9F5B2B53AA5EECEF1A0A89 br,jo
80,261,119 *0888E0B5F3369B1F2C5A4693CDDB4CA3DE38322B FARIS-GHANDOUR
80,261,120 *08880C2B77665B3C41E88E2850B0D5BAF06DAD06 DELMARCAPELO
80,261,121 *08836105BF3F54DB55FA23E51AAC4B7916EFE06D [email protected]
80,261,122 *088054480289E03362CCF71651B20660C5D7C6DC brqig
80,261,123 *08895439B95F9C262FB0E1F411F126A0B8ABD8B9 FAYNTELY0
80,261,124 *088367919AE734F6D728637FF170FB3277E41174 EMNAMKMENT
80,261,125 *088A3D5C5C19BC6602475C5773FD5C042D225066 fc.aarau
80,261,126 *088FD293AFEF0BD5F277A29DCE0BEB2328C5DC05 emntioned
80,261,127 *088E72CB5A16B42E96DC73993CA438D49133205C FEATURETOPICS
80,261,128 *088FBF9A50C0010976F742ABE4816592BBA09920 b&s+b
80,261,129 *0887CA0291A7CE3785819671ACD4F2A280980E0F deserved
80,261,130 *08801C9EE88C866AF6AAAF89882FFB8C424E6BD3 fhayging
80,261,131 *08875E784D9C61523F9016F6CC34B8F52235DE8B FIFALSED
80,261,132 *0887443DB2C6CBFAC205C03EA75EA34B01AF8130 Det.var.inte.jag
80,261,133 *0889604B3C3BED7F159D8864FE91A950008BD1CD devinswiller
80,261,134 *08878CDBAC5E548431A84FB4501D4FD8D47852BF b_u5v
80,261,135 *08878F0A5C4F44D46ECCF917E23634352263E683 BUCM
80,261,136 *088186EA5CF5FD912490CEE3750ADF414BD3231B EREV)
80,261,137 *08818BA21CDE91DBA9B621418804042B2EBD7293 dflabs
80,261,138 *0883268DDF5F48C247C8E33CC3C09C0A057358EF dfr#m
80,261,139 *088BEB6C615182826ADEF6039AF6F821689B36A0 FORAYER
80,261,140 *0887EE88875CFD20C24C9D91E5BBDBC546E1511B bwn2n
80,261,141 *088AC80535DDE8489A9E4FFA93C8A87DCBC407CC ETSARKRO3
80,261,142 *0888485A0A4BF59FBFBD40E8199C7F675D34ABC1 BZUNESHING
80,261,143 *0886C714A68E07D712C434011F2F3451FEFE3241 digch
80,261,144 *0886B81A83696688EF752387F54C78CF4580D7BA EVACUIAMO!
80,261,145 *088FB5EEA1AC89842755DB43CF602FB8023A90AF FRITZ.FORSHEE
80,261,146 *088093CFEC9F7F6DE46FB7B231B232564E44D1B9 everettwarnecke
80,261,147 *088E761CC380D214CFD5F1854E88EF561DBC575C diskusssionsteilnehmer
80,261,148 *088377173138DEBCCD37EC07840EB565188BE90E fsteteip1
80,261,149 *0887F017677950A59D96F540D59510BB2FD355F7 [email protected]
80,261,150 *08864D1D44C30534D24874D9AC2382B3C0DD11D1 c1h%i
80,261,151 *0880C82EB704A5239CFBF54A1207C5C3677D9D74 FULL FRONTAL
80,261,152 *088A82AB1ADC735BCBCEC97B34BC2391C01D170F C4B(E
80,261,153 *088DD2B52E72DD80F995EAD27E6243E0958ACDC6 c56xi
80,261,154 *088618E174752A8245CBB74DC49362F6E95BDC87 G9XLR1DAKZEC
80,261,155 *0881F92679D29C04A56A412C76314285E0881EFB c8hsn
80,261,156 *088BD62D163FBFAF1FA0FFD44573A2140A38551B gansnek4
80,261,157 *0881BD7DD6A2CDF2A8E2B81201CBE19DD6B05EA2 federicoschuering
80,261,158 *0882022EEFDC9ECFCDCB391B8119998BBB9035E4 GARRETOLIVARRIA
80,261,159 *0889B8B0ED019BC68F34F2BDDE19F98ADF00B7B2 calebwattles
80,261,160 *0884E0DE457FC97DE5E99F3A96D21D3E8DE71453 CALLISTOPROJECTS
80,261,161 *088CE610D50460DE6511CA9C533692F9FA5F851C GECINMEKED
80,261,162 *0883BBEE1FE4D7AE9F19A70908266CC2C675FDEA FERIANTOI
80,261,163 *0888DE2857F1E110949915176E5718DD07F6C446 DOMINIC.KEOWN
80,261,164 *088EB8BEE6E32965BD57B99CA9AE9916E45E7B9C CAORG
80,261,165 *0885BB2B0140D6481744C462AD7347442082BDF4 FESTIVALARTENATIVOVI
80,261,166 *0884C0CE96F2F66650EB87A484BAFCD05F82FC19 don'tplaywithme
80,261,167 *0885644AC049D60FD7F80F97DC8AE557A2DF4680 FITICIAS
80,261,168 *088CBEC1753416281B57EC7A32321900463E57A0 carmesitaed
80,261,169 *088149733BED7E6084A7C47B21691AB1B48DDBC5 flatbrook6
80,261,170 *08840DABE3A384A77385FA9D0687BB7C3D25E27A douglassmalin
80,261,171 *0886BA698D138C6CA351AF3F6377FAB72C69404A carol-gillam
80,261,172 *0885491D13DA7AC48E6C35CFB2953F3155D329EC carolinegiants
80,261,173 *0882531A4A33F0807306116FDEECC5744D42AA51 CARRYONACONVERSATION
80,261,174 *0889A794D69D536DEEDD040D62618E9C8475CDA9 D+P1O
80,261,175 *088571F643FF350C5B6CC8CC36C924BDADD01232 [email protected]
80,261,176 *088AEF4EEE9292AF69A29A46829F0B2F85E7E588 [email protected]
80,261,177 *088D5983F55B6C065F4FC6E5033D877FFB05C925 FRANCESALMEIDA
80,261,178 *088EF27C982C20586D45FCEB0866FF8044BAABB9 cascadedoom2
80,261,179 *08883CDE6C23CC425888639AC94E1231A3BACF43 frankieglasford
80,261,180 *08884FB7A8AF4C1DAE77D61A3E9BCD873392AA09 cateora
80,261,181 *088C0C6EB95F0B7B8A5FDC243A8B3BDF259BE1BA CBLT
80,261,182 *0888BC467AC8C08F94C522E806706755BF38FAF4 GOLDIERED
80,261,183 *0882242EDEF30067EB308A5EF84264E66DA67E72 ccurv
80,261,184 *088AC7D43316651420D6699526987CEE722B0922 FREEMAN.HEISLER
80,261,185 *088A99150E36AB0CD2E541659CF57A04268BD945 FRITZGRANTZ
80,261,186 *088907C3BF532646B9D0D1BC2CD00A96BBB2B8AB golferpirate
80,261,187 *08833B44E7592B78119B30461BC23FA56009F835 DQ_o
80,261,188 *0889C6DA575D412E6974A9360ADECE03C5380D3A ce?bj
80,261,189 *088FD850EAC31A5EF6EAFA0ACCA6B44D40DE682B DRIVEN-BY-MY-STICK-SHIFT
80,261,190 *08838E37F1E6C8AFBBDDD49A46259B533645A48A CFU1P
80,261,191 *0885106AE5F27D5512F58A41E0FED9929996FB03 GAIL.BOJE
80,261,192 *088A2A9BA6E75564F545ACFCC4B25D75A2F597F0 grobaris
80,261,193 *0884AD962254E9DB502E63BD9172B5A22FBF1BA5 [email protected]
80,261,194 *08858B5DA6CF6BBB259EC33507C1C18DB3CE43FE CHANTISHING
80,261,195 *088FF2963771392C848E9E5FB0EAEC8F5BF7A7C7 charleypenovich
80,261,196 *088427D33B368692B60F7D851380B1E37EA947DC Charlotte7799(disc1)
80,261,197 *0886C315185548887F7422F23063C0F3D871B10C GUVDMO
80,261,198 *088EBC089D205DCFADB984154D94E1798DDF7396 GUYAMOS
80,261,199 *088D8E5442FA70A942C3F1B1ACA436C5D6F483DF CHEERID0
80,261,200 *088D825A2E7F8285A6966D049459E881B4FE43E5 [email protected]
80,261,201 *088D0C8C351B47A91D3E80763C019C744659EE7C GAYLORDAHNE
80,261,202 *0882C9C9EA4221801B57222C56595A11CB8B93D6 chingpoed
80,261,203 *088347958535C66684DF966B299125DA1299ACF4 DUANE.RYSAVY
80,261,204 *0889FD9C12AF40C439A79F38582E4CBA1E843516 HARCKNED
80,261,205 *088130964A922C7454AC8E6AAC4CA4831480108E geraldodear
80,261,206 *0887A237342CF094A89DEB9084ACA60903FC78BC GILBERTO.STRENG
80,261,207 *0884B56A1B2C3605A4100797BC9F5DC0845135E8 DUNCANBARIE
80,261,208 *08808FDD6789E00ADADA44E40172DDDE4026D2D2 HAWAIIANBOYO
80,261,209 *08877F578C6D9EF753C9449B39D2E508C8CCFFAF CILOVEBOYS
80,261,210 *088B1B6035CEC89E4097C519E9002EE9755DB1A7 Hayu-Laylot-(There-Were-Nights)
80,261,211 *0882DE204F90F1C190A3388356B3DF88A4AF8531 gistingsproducten
80,261,212 *08833070B9958C973D613209804234075C63FABD HC}T
80,261,213 *0884F7D60C4BED177F0DB60C38AB3FFAB5375BE7 DWC-U
80,261,214 *0881FB8ED6993E77F915253551E4289E07707E61 HEBERTO.1.0
80,261,215 *088D727F456C23848EF43D6FBBD5372EA8ABB537 DwM
80,261,216 *088E77BFDBA76D47C9FE6BC53D2104CA2DF342D3 dwwn!
80,261,217 *08829FB670135F849152E3C3C7410C1F5E7855CB c;#ky
80,261,218 *088C675CD5C0117A4AF8A9B10E5A6F5255882F6C CLAMROCK
80,261,219 *0886491F31968750EF2AA75C2BA2B1DD2B7C4F46 HENRYSEE6
80,261,220 *0885B3D31B0976B808CE917FD97C15DB927C6551 E117755
80,261,221 *088D2AAFD5E43E21BF430C36B7679159CF2D6663 HERBERT.ARVIEW
80,261,222 *0881E08ECDBC572F36A0D74D9750EC38F57BB369 [email protected]
80,261,223 *0880CE58C1756041ABE52DE21AFBA3E65FF8ED06 claytonlatting
80,261,224 *08834D5160E139109BC60C042CEA88B470E3E63D GRAMMYNOMINATED
80,261,225 *0885D7C648E6BA964DDCEBE7F8B7CFC3936C0133 GRAPHICAO
80,261,226 *088C867892BDC4CB5E99257C208E1BEF9216BEFD CLFX!
80,261,227 *088D4DFFC0E17E1D17676E66E1CB1F14EA7DB33C clintka
80,261,228 *088BACA29EEA779E0D2D0CB3C763A2525405D8B6 [email protected]!NE5
80,261,229 *088C89F92568421A710753A2247607A26B7534EE HIPOLITOMANDT
80,261,230 *0886C0790B3E29100516FEE729199801965A24B3 GROVERLOGAN
80,261,231 *0886FE6C4CF8B8DD861B430E50D415B14E8C0D91 ecya8
80,261,232 *088D4716FBB771938FD2A090CC8C2F0566EFC04B edgardoweikel
80,261,233 *0884FB2CE58506A5A5B3806710AAF8588826191E GULKIS
80,261,234 *08826B62F569D0F7F87C1537E91800B46464ECA1 HOLLISHORKEY
80,261,235 *088044A4153FCB46269F7D5632EE41C9C0FF0EBC EDMUNDOMCBURNEY
80,261,236 *088A8D4A6F4F68422EA8807C7AABED368A8805CB cn1cw
80,261,237 *0888A3539E50C8280810CF1D237BC86CBB987E7E horaceschultes
80,261,238 *088BA2969A164A9D8AFAE0413A7073656A8ABC77 g-vm
80,261,239 *0885DB8A3B49409C1105E68620814B7B3D6B7B1C EF.NC
80,261,240 *0889232F303C1FD3F27C0CB91BA8C93790A0B223 [email protected]
80,261,241 *088C72B34CCC0E5C913E59C2383DBB7E7B413E2A H3MA701091S7
80,261,242 *088F47158A5E9FB214E1F034EB002F0E93FF4B4C collinclaiborne
80,261,243 *0880C9C321DE056FBE60B16AB302A08D85674208 HAROLDSTUCKEY
80,261,244 *088DA2C5E1DF73E57ECC0D0DD3C350D2D714175D con53rva7!v3ly
80,261,245 *08807AF3F9441C8364B26379F9613CB9B8AE9E7D HSCIASCIA
80,261,246 *088A0223D278D644EC64A1BFE3EFCD8DD8A16DAE HEMADEAWOMANOUTOFME
80,261,247 *088F4A8974FFEF7A924BC9571ABE448896D096FA hueyaflalo
80,261,248 *088A12D9C2DA6CFEDDA2AFCA3CCC26DB9C5CF25D CONSTRURAMOSLHOS
80,261,249 *0881CDC25D24C3808FCB7C083907AE0D2D69A369 [email protected]
80,261,250 *0889D19C1C978D7403835F4B423FFEE8199A9772 HUIYEELEE
80,261,251 *088A2C34434B3FB90E3ECB284B7BA845524FE654 Hey.Mr..D.J..(original.version)
80,261,252 *0888629B20FF6631A30B1B1DD09DFB2D15730DCB [email protected]
80,261,253 *088B6D7F5F4C1FBD286DBB1B973FD429E9088FB7 [email protected]
80,261,254 *088986655C8E1998435504EC7686285C519CB9FF COPIÁ
80,261,255 *088E5FDD64261E67DAF84F0E10E55B78E6B94183 elliotlannier
80,261,256 *088675D6472431B6554B94A9F5DFC9CC924E6A2E ELLIS.HOLLINGHURST
80,261,257 *08829725A17BB85730A7EC8F996D5AD23FBA8C3E cornbreadgraffitilegend
80,261,258 *0881D81ACC0A7E19C9106D0565B7138ECC1989EF CORNELIUS.MARCHALL
80,261,259 *08853463214AA471FEBB46327F549DBFF6F5FA0A elmersiddons
80,261,260 *0885E73BBD2F37DC9606B3794A4490CC8ACB73D8 HUNTER.ADY
80,261,261 *088458C36118932065CEDCBA409A0E5E7C58D568 CORONEXING
80,261,262 *088BAF025069BF95FE0E536B83EE207908B26F63 I23111996
80,261,263 *0886381AE71B0BD26C2F0CA99A6186F9B47250EC HOLDYOURHANDSUP
80,261,264 *08842358A9D8703B90DE1BB86E747E91A3021C74 HOMMIE11
80,261,265 *08872CB331845A22F0CFAE89CBF1DD62BF0538F9 IBRAHIM-OMARA
80,261,266 *088A66DEC4DBBB25D3BDBFCBFF05CF9B209775C0 elwoodklages
80,261,267 *088EBDF1C915CD5695EA1283BB6E380BEC99B6F9 HOTTEY3
80,261,268 *088DA6D5FC8BBC8C88D92C6ED8E815BD8D4F7701 emilhurta
80,261,269 *0884C07C0B626A42BE7D8BB779D6AE09105B9B5D hoxton popstars
80,261,270 *0880A58C0A70871479F65D3517CC1BDB5B4097E1 em=mg
80,261,271 *088C25024A36AA9F7C39D8B557D462FD01AB945A HTTPWWWBADKOWOGMIN
80,261,272 *08891AEAD6C5599A69D5476151B041254A5B6E7A IH}`
80,261,273 *0881F3AD465A3EF3D05C65C59FDAA561B0602622 HUBERTDUSSAULT
80,261,274 *0886A33D01F251E4BDBA455101C448D60A88060F CPYV&
80,261,275 *088100E45949657B9873C7DB280203CE84F680B8 enemene5
80,261,276 *0889369BBAC2CB88D06A1994CA9C200BB5A68AAF ENFUMANT8
80,261,277 *0881BB444FEF39652174B2620FCB4274B786A411 ENITSENRAE-1
80,261,278 *088F1EBEEC935239D281A3FAB48833A71C93DD18 ENTRACQUESI
80,261,279 *088D107E42608715B665E12791CCD97ED540ADC6 iluvdominique94
80,261,280 *08842302F1C4B44515FB023C7C5F8F08628EC6FC eq?.e
80,261,281 *0884C1D860F142AFE2BE720EB4B0E72307DAC244 immobilisant
80,261,282 *088D9D7EAF205C9502CB3C567CF567F6B4920929 INCRUSTATED
80,261,283 *0889FD10C59C47974B0FB376515008A5FBC8E2A7 [email protected]
80,261,284 *088DA4CFF5D8B58947A5E34A0BCFCDEC6D3E168E ILODBUS3
80,261,285 *088001EB968523E1851972218EF186DDCFBDF233 INTHERAIN(FEAT.RACHELEVANS&SMIGGDIRTEE)
80,261,286 *08897C6E3C20F71E4ADA044DDCDCE4E6E8026DF8 INTRO.TO.ALSO.SPRACH.ZARATHUSTRA
80,261,287 *0880131314B481C584A6B0382CE2FDE131AD1820 INVITATIONTOCHRIST.ORGWWW
80,261,288 *088FD1ADD7767C3FE67D7585F73CE52937BD3F39 CWLKU
80,261,289 *088B436054F3B03FB4CA5424B6098066BFDFC2DC EXPEDICION PANHELENICA CONTRA ESPARTA
80,261,290 *0886EBE47AD4FF05FBF46608B257CF31D8C93732 ISAACMCMAINS
80,261,291 *088F634350C960FF21239FFABFB4929D0C8EED65 c&znp
80,261,292 *088FF62E6B76A0CCD2FF562A8D05655B01A61997 iron-man,-volume-1
80,261,293 *0881EA455544C11FAD857B1A6F33381C6614AD50 d:0b
80,261,294 *088370C9994A89A4DE1117B4F6BA2490A8F4D273 [email protected]
80,261,295 *08838B21BA74F49B56D3E19A562224DD077670A9 FALEXANDREX
80,261,296 *0880565264F25AE3EB676BC2A373AE813FE38006 i)t
80,261,297 *088A59080EC7C0202512AC5883846FEE2BB6C479 FARHANNAWAZISH
80,261,298 *0885B071F95D06BC4101738792795FE59DD00D70 fartzae
80,261,299 *0885984A99CF2E92416E8DED7A15C82BFDCAC2FE i want your sex (monogamy mix: rhythm 2: brass in love)
80,261,300 *088EA75E19A95DECD78A4D6157E10185530FEC75 JACKERO
80,261,301 *0883CD30B48DF9BFE874777FF29500071C1AFDF3 D8;}
80,261,302 *0883F499EB6B953EB252D825793C06E4B490E055 d87i+
80,261,303 *0884DBED01C4442B0C55C563838A41016738E0C4 부산febc
80,261,304 *0886C2B3D0B22110E0B6C838B4F79475822CAB75 jamalvandersloot
80,261,305 *08829E23B2F96ABAC7E2CAFB5DAA4F33DA800304 [email protected]
80,261,306 *0882E166BDF380CFC560E884A9E7108AC52F7797 [email protected]
80,261,307 *088862091DE841CA1FFB1ABF1198A26219AD7BA2 JAMEE.HIGGINS
80,261,308 *088E740CD984A98E74806B799226932EE8E5E96C JAMISON.KAMIREZ
80,261,309 *088F077AD0256B791D46B143EA8325D471AC936D damonkendle
80,261,310 *08831DAE6C37A20341D273678110D7987537980E JARODPELLEGRINI
80,261,311 *088A79E42AD22786A2AFCE85982437113BDE4BB1 jason-padayhag
80,261,312 *088DDE4A0374371FADC2A86214D5D084E84B5D59 JATKAMAA9
80,261,313 *0883D126D435BD8E5A9381B1ED1091F88723197A jawfeet7
80,261,314 *0887AB75F47E96B61CB22B5BF52F268D89190BB3 JASNINA4
80,261,315 *088CA7D00B919DBC23A1D2A201D8A37158927BFD darla-rutledge
80,261,316 *0888708C9A9E4DB80B0C08495784E051E2A4E27D JASONTRAEGER
80,261,317 *088876CD074CA97CB24C7B1952F8F0EB057E6697 jedsteeneck
80,261,318 *088C84AD0F03FEC210EEDC76026C4F4B5935F716 jeffereymahusay
80,261,319 *0885484E60C4ED6C410F247314083C957414C64B jeffersonearly
80,261,320 *088670BD58CAEADD3196510B9F0B0A3FBFCB9556 jegarragej
80,261,321 *08831E49BEEA41351D983895C7B3348F8647A146 david.koda
80,261,322 *0887C65CFCBFABCF27878B9EA3A5EFA69AD1219C JEFFRY.HOFE
80,261,323 *088450244197DC119569575E690D6A85DF6735BB JEROME.MCLAGAN
80,261,324 *088ACC624890E91C53B989C888685723DCEF2F52 D(BG/
80,261,325 *0889C268CD14657BCE2482C73DEBBD922E3ECC4E jessica.durga
80,261,326 *088169054E630273D641DBC73BE579C941B28A9B JEROLD.ORESKOVICH
80,261,327 *088BAA5F932A4A505CD93B20AAB69B600F18C0B9 JHAM THAPA
80,261,328 *088F2C94A8F1654675B28A547869923D0C45688C JHOOM-RE-BABA
80,261,329 *0886A4D4FC1DF35864BA24A346A4C8E34D602A0C DDEW
80,261,330 *0884746B433DACF35979B6BEC623B95D927121B2 FHFXZYMK9
80,261,331 *0882B7F0FEFEBE3041B18DC64EE6B87D478B80AF jerroldabato
80,261,332 *088D3A188BF6A05AA0F64940C75E4783CF043F27 fideljaurez
80,261,333 *08808F6E83F6F73286C9BDC4C04B4B6424881158 jessica.amos
80,261,334 *0889D7628F045D542E361053B18B0B8FB8BD4C6F dd#r:
80,261,335 *088479AC03D3AC3F51F894D86D25C3CF0D66C59E jimmielaneve
80,261,336 *088CC30D94A3D2AE4E14911E19E875F541838735 filli3$
80,261,337 *088D6E082C8B6804CD642EE7C037AF5612A4A01B jlxascdutvcbp4sc
80,261,338 *0881D89D5A630178D8E4C65C57615388FA7AB162 [email protected]
80,261,339 *088596E8F6BDECB07588A0B76978461779FF7572 j.-kenneth
80,261,340 *088216F976776A2E70299058ABF46E7E41D39390 [email protected]
80,261,341 *088E7BEBBF19BC7D6445C39D25401BCA8E659185 JOHNATHONSCHULZE
80,261,342 *088B5931A03FB3B8FFFD9EC9C35AC32BDBF02FA9 JOHNNYPANAGIS
80,261,343 *08841972CED4E8FDBB512C946AB64C2A5BE83A10 joannborja
80,261,344 *088795CF2FCFF9DD17B7D0A33469AFDC9BA6C2CA delations7
80,261,345 *088571B39113389F91DE5A9DA81D9A8A56BD9716 JOSIAHJIMINEZ
80,261,346 *088BFBE222943182B3770F2FDFED03D483177BA5 JOSPEH.MINERD
80,261,347 *08802ECD9517F6EF207D71BC70171FF191FD5A82 jouions6
80,261,348 *088C36A197120D12E4D75C281E0F253D4CD21F3B JOHNNIE.CHEVAS
80,261,349 *088B685C1C66A2EA4460B109A130C1441AA7B46E JOKUNAGA
80,261,350 *088E64B59AD42C54BF9E85388E38E5E2EFDBE9AC JOLLETJES
80,261,351 *088E58B860F7A90DF92719A271960FC53A1C2D7C JONASHESSLING
80,261,352 *088DEF49AF5DE9E84DCE7094DDD5CA63ED533C3C jonwansley
80,261,353 *0888C296809E1276D627BD0C5DEFA12CE40B4EED forestwinnett
80,261,354 *088C98048AF7ACED478656B0BF0C6C1D30CA3EB6 JUERGENSIA
80,261,355 *088D9031DBFDB444AB65710051BE9A460B34A448 JOSEPHSEYS
80,261,356 *088FE49104838662135986C7EB76922BA9E78101 DERRICK.HUANTE
80,261,357 *088B5E0B3E789B5C46EB3EA3538658B287A54268 JULIA BASILIO
80,261,358 *088A52A48C886CFC3568064D703F570B615085C1 deserved
80,261,359 *0884223DC5992A2F8AE127CDD2B869E1F6EE3F31 JULIUS.OREGON
80,261,360 *0888C5FF58736C8833ACCD19BADACC499A417B3F JUNIORROMBOUGH
80,261,361 *088D3CE4E04A9A04676C39737633A4D589B1EB2B DEVIL-LOVE
80,261,362 *088D1E26713161B689F11EB5D3C9E42293E424B1 JUGALAN2
80,261,363 *088D617F358B0C6F870F292DDE7EF626C11FD21B FRANK69M:PASSWORD
80,261,364 *0888FBEDFB43342AE3EB2DB2E99B11B5E06AA056 JVM2008
80,261,365 *088E648453581643D260390AA4370EDA0A92DEEB JULIETH.MORENO
80,261,366 *0883DF0CF43F9325FBEA3AC443D8DED40ED1E01C dezf-
80,261,367 *088A0226251AE4EB1A87C3B2124E87062A8C2521 k22gt
80,261,368 *088DA211CE94FBADECDF74F74ACD8AA8224B2752 DGS
80,261,369 *088B54259DE33818CB15C8DAB5A9E26C1AA1C151 KAPINALS
80,261,370 *088A535EE93845C3816FC2B814DC97CF4D9060BD karacakã„â±lavuz
80,261,371 *088507579E62A7CDD3AB10D2FDD63B160829F8C3 KARINESIMONYAN
80,261,372 *0881F3C41845D53131AFA3E58BEB3AFAB664E39A fritzhaury
80,261,373 *088BB5899490F270B50191B1D34D397A61F5B6DC FRYNCKO123
80,261,374 *0884ED8EB9D019027F1A4ACED1845BF59EA530E7 KBNINJAASSASINMAN
80,261,375 *088329C54BB347146DA455B95C623696775DF529 KBV\
80,261,376 *088B42E8651B666529134C9F5ABAABCD6EBCF7A5 KELBERTWITZ
80,261,377 *0881446B47594415AC3A7D9133D3F0EF9D6C727B dianemaldonado
80,261,378 *088F054292B7D3D40AEA30DD9A4684B1ABE5C08F dickifft
80,261,379 *0883558D773344F02CEFA6899C089936AE7F455A KELLYVERNIER
80,261,380 *0882B5913B97A1C9606697C34B0430A89AA7FBB7 DIJJ
80,261,381 *0889F8FD8E4354CD95DE90A4416EE55A7FB4E541 DINODAROU
80,261,382 *088663C423AFD5AAB7DBD446CB84F39C9F64E039 karissa820
80,261,383 *0886A612B81FC4701C6F119EC2616EFF6505F9D6 karlshekey
80,261,384 *0884E7F0159BBCC3811650FAC691956B97D092BD diotepring
80,261,385 *08892D612F3D8D31A66DC5E5F627AD607C56446E [email protected]
80,261,386 *0888C280C4A373BF7D2E9331B2ADE811A6B9DB6B DIQ!D
80,261,387 *088F91447CB117A6928AF51554AD43ACA0D9F92F keo`
80,261,388 *088D1F2E050CBAFCA9D35E6A9D1B62AAC2631A36 kevenjenkins
80,261,389 *088DA79233E00B4E3B40A91EF6F2B124561BB4A6 KELLANMAHONEY
80,261,390 *088894A8C5DC2AFF13A5CB8338E45141A16D23D6 dkd5%
80,261,391 *088DDE073D65B8E24F4487060E70FD777324DE1A GAVIN.KASKEY
80,261,392 *088E6EF31D0279ADA08816DBB9DCA9540A7601DF GAYLEMAJEROWSKI
80,261,393 *08824B4C17A6A744CCC7FD245AAEB52FAB105EE6 KIP.KEIPER
80,261,394 *0880E6B8B1BD42D64D10A06D80049F4D10F43774 geattrapeerds
80,261,395 *088FD9700B89DA484123040DFE442C7F0A377D08 KIRBYLUPTAK
80,261,396 *0880507A2BADAEFE561BF08CEB8CF9E3E868D945 KIRBYPITKIN
80,261,397 *08898BE30051D33E66DA4E00C0660113837367BB klatschna
80,261,398 *08822B2B98BF692A6387BB35C8CC7D0F405CB732 DNBME
80,261,399 *088E4F7A48F102A8652F73C6B79D3EF7E64E8F13 dnjq3
80,261,400 *088572F57772C551E394DA727D20DF75E8B1C706 d!:nl
80,261,401 *088CB9DC591CBA3A501CF962CDC0AD4347C46ADB GEOFFREY.BHAKTA
80,261,402 *088BF325E5E401A177D903C970B05B593480C215 KINYUURA3
80,261,403 *0885E62AF2680466A66993D597F066C68E693A58 GEORGIADOME1234
80,261,404 *0883B010403F547896BDB73D862B5F50899000F2 GERALD.BRENNECKE
80,261,405 *0886FBE8DD1DF81A1B15B944F71CA1E69E2AE186 GERARD.GLADYSIEWSKI
80,261,406 *0880542380A07EDA7B02624F4AEA8EDECED0F1FF KOREYGLATZEL
80,261,407 *08817628954E0325514655C8098D62718B252995 kl0by7e5
80,261,408 *0882095655A9F6403E73AED176B85B3A9EE1CF9F KRAIGBRICKELL
80,261,409 *0886564EF17816D1A9748F45376C65542BDD4AA1 DOI10.1074JBC.M10651
80,261,410 *088AB0616478566A153FA64AD62F42A1DA77BA89 kristen-camacho
80,261,411 *0885C80FB4CB41C8EE2A7C640FE56DB1071B7A3E KRISTOPHER.WRYE
80,261,412 *0888AE89904B31B29B3096153242549453C04C9F KTAW
80,261,413 *0886C31472E1CF9B9514A2B9B7F63D5DEFBF8BF8 L1ALUW0LERQZQ
80,261,414 *08897B4483D7F67ED94B2EAD309064DF46F5B47A dongrarick
80,261,415 *088755450026DD8915B3E894FE124A6799C68266 KONSTRUERE2
80,261,416 *088CB3C671CA85B66A6A11509A46812D65058A07 kopaw
80,261,417 *088D7A70631A48B1BC9927A363E03CE41C6FB27B glenhung
80,261,418 *088ED86E46DDA4A8C3F6D15B7A319E7A07573BC4 GLENNMENCIA
80,261,419 *0882F2786643EE86ADFE351956FF238E7E08ACC5 DO YOU FEEL LIKE I DO
80,261,420 *088F2D1BCAF2570D316F3B281CE72DABF755C5F2 kunsteloost9
80,261,421 *0888F3EFFE5E2B482C2531084C2D3226B6AE1C4B LCTRGST9
80,261,422 *0889A18E09D0AACD6D1B05A17BD6CF5183464393 drk6d
80,261,423 *0884FE5CEA9E9FA90556BC275CD25CE59B090DF3 DRTINKER7
80,261,424 *08868D4272C3378E624EFAE1E3AA4305EA60AAD8 LENGXA
80,261,425 *08848AE3C48AC75C6D343B01D49445AE6C65F8B2 LEOPOLDOHERSKOVIC
80,261,426 *0889C659F44ADFAAE8932C587B3CEB6561EB67A7 LANDONPAONESSA
80,261,427 *0881C7CC7118565D66CFD82C5EA85FCD6BBF37D7 ds$!g
80,261,428 *088085BD81BA13C50F7AE8AF89B3F79BDCA213EE [email protected]
80,261,429 *088F77DD36806CFEB2FB3CF46BC86F21EAAB03C1 [email protected]
80,261,430 *08859E2CBDAFA1DCC3087DA3F5C32D60F674E771 Lessimpudencetogainsaywhattheydid
80,261,431 *0881D185D9074F3EE4693EC4066C312E1D30B3A2 grace-guinto
80,261,432 *088DBD48A526D6D4F1936CF511076734817A9746 DSRU9
80,261,433 *088583999A3C0B03BD7DEE9CB5C03016068FDE11 [email protected]
80,261,434 *088584BF7A9FE56DB22310E566A7C53F199E5FCC GREGG.BARAGER
80,261,435 *08887D38378970558A36C948918588118549DA38 [email protected]
80,261,436 *088787312F1F44AEF2719CE88F2735D22B235363 GREVERO3
80,261,437 *088AA5E675D17A4FB94A481177315034F2033B59 GROVERBEWIG
80,261,438 *08829AC6F6D79F301283FEA7F54E2E4AAEC585DF DUNOVEX9
80,261,439 *088762DE59CE0F950F79E73E88ED3BECBDF2E2B1 LENARDUPWALL
80,261,440 *08819E8A03B57CDC096F8319788EF0B1924B19E1 [email protected]
80,261,441 *08854A6FA2C8FF7A3861D0C4D66F8A0D7CBD2BFF DUWL
80,261,442 *088F5DA6FB119DAE38E8B1552DC1041AD57DB674 LEPIETREMARE
80,261,443 *088FDDE633D41F1EAB8FFC9A69FCB2D78C168F2F DV;W
80,261,444 *088F45197475F13431462F3103C32060C4703E85 lg+o
80,261,445 *08864AF87D1350EBA1C9529153692D2A2855DAB0 LONNY.ALBORN
80,261,446 *088CB31285571BCE417578B72A7B875811E2BC90 LONSVIK
80,261,447 *088B0849A6EB9E7AB4DD791472D6830BBCF95326 LORENZO.PINCOCK
80,261,448 *0887FCC534448956A259305DE842E12C283071F9 LORETTABRADFORD
80,261,449 *088546CEEE90D3F2AAC7F3FBD3D4F97FC2F05B1E lori-lofton
80,261,450 *088C3EFE9F8333D39551F6363FBF8B4B2988497E GUIZHOU
80,261,451 *08856035C9CC0E3C5A0A3F7407F4FFD4CDDF5E36 [email protected]
80,261,452 *088B3C8162E2C2DCC9485A397B00185EA286DDBA lovenemilladijodi
80,261,453 *088E6292D17FDDC3C2E9178927D4A0432C047C52 GUSTAVO.SHARMAN
80,261,454 *088F395400F1D33C4A41579D88A99A5E54BCF06A d&x?=
80,261,455 *088E9C3C3462846C63D5224C2D8481FD02D8E7FE LINDSAYVILLESCAZ
80,261,456 *088B9D2001C55A085511C52C00B37BF3B3A8AB6B lindsayzic
80,261,457 *0883E4F5674F23055DDF5EFE8C44B5BD08B30F34 LOYD.SNETTING
80,261,458 *088D4B38FB524E9EBC4368F57869223C7D2AB63C dxp,
80,261,459 *0885BA5D719512D1CA213BF50559D1AF31616183 H4NN3B3RGSG4T4N
80,261,460 *08833F0474469F3B868982E181B9B10E67624F75 h4u14g3-i
80,261,461 *088CAC4F3E61BDF2F693450B662F0E4A2D9E56E0 LUCIUSKNAFF
80,261,462 *088B2EA901D7C2AA04591633F4F45290FAF7BD63 [email protected]
80,261,463 *08864849EDCAE4881AD096851ACD59E5F8E89CBF lloyd.rodrigues
80,261,464 *08880C4E0F25CB8A7B6081F5B1FB3F914304D9B6 LOLSYNAPTIC
80,261,465 *088C93C489426491CD5BBEC77E2A01D79BAD4CFC HALOCHLORELLA
80,261,466 *08846862C10D68158D07196DDE8A9E7FAF0E7CD0 EasyRider(featElizaGilkyson)
80,261,467 *088F20C3881F5CC07E3A760AF697C6E0C5297B27 LUYI.SHEN
80,261,468 *0881E4558D8D4E57FB46607C5C6BC6554C2C0A7C EBQ;Q
80,261,469 *088EA7CD7B9B5397EB3C8B0DDE126AAA3F4D7A52 EB_!V
80,261,470 *088AAFCF1983EA066E919487E37DA1157B915D62 lylemachold
80,261,471 *088FD0A74D0975AAE2EC52A48BFA7518685714FF losplantanosnobananas!
80,261,472 *0880FF192110878346B239642F371A6BBCFCED8E LOUISECORMIER
80,261,473 *088244A28B0ADCD688225200C28CDEAD85FA9AD2 edmundopreyor
80,261,474 *0881716D1E71DC48174AE6FC3F12B338E7852BB0 HARRISVAINIO
80,261,475 *088E368A53361FD672E9CF559FF6224311F0E0A7 EDUARDOKALISH
80,261,476 *088B7793D4810013A40A72BD159EDFD653FA941C MACHATTI1
80,261,477 *0889754EAFDE9CBCE98A58F374592B5D84C79EF7 macsarisky
80,261,478 *088DE3107B936A6EB7D2B3CEF6F01AEFD2E4CF1E MAGGIE-TSO
80,261,479 *088B4F4FBBFC7948D4771F75BDB3F50151639882 e*f3
80,261,480 *088873828BCE9072259477754E40D5C21683928F LYNWOODGOHEEN
80,261,481 *088BD7B6EA8A9405B107DA4B2B8340178ABC6E77 eg28o
80,261,482 *088E457BDDC6BFBC17C6C8C7CC7302498E771330 egigatres
80,261,483 *088F7F1701622227DEC3F3AFB978A232430B9942 eg;;p
80,261,484 *0882323B1CF48F2C81A82AC297A891F267B266FC MALCOLM.TENNENT
80,261,485 *088AB7F51D9F3A1A58368ADBE27938689C5BEBE4 m4x1m1+e
80,261,486 *088807CE2C75129617849BA3219360DAC71C9F12 el.ansari
80,261,487 *08807679F38EA98A8033172B54B8CBDA98A65752 MAKARONÉZIÁIG
80,261,488 *088BB8313EA7113636D33D430C42880629A764C6 HERONEM
80,261,489 *088C7D4C12F046C102640B7FA41126E5732EFB09 HERO'S FADO PARTS 1 & 2
80,261,490 *08809E3525B7BAE854B030A2F33B2127A17FE790 [email protected]
80,261,491 *088674355C36B0488D99D9109C0D3CF6033701B9 HERSCHEL.MORTENSON
80,261,492 *08846D9B32F27906EF67099E46C4E95642864FFE HERSCHEL.SHAMBROOK
80,261,493 *0885D30FDD281725D5D38C6540EBAC76F96D9AD3 ELFOMINO8
80,261,494 *0888886E14EF50C24C1418F6DFAD1A6A0F643D58 ELIASCOURREGE
80,261,495 *088B3EFC7775B2E5DCD67C14F740F90D73BEA7A0 elijahnattress
80,261,496 *0882F5AD6570B270E6D51DED3D071B9ABD003AF4 MARCELLOUSSMITH
80,261,497 *0887DCB3773F5C44E3F2DE9FCA18FE2ACCA5A99F ELISEO.KRUCHTEN
80,261,498 *0883D755F1B975E180B083A46B0312D6A4220565 elkrafta
80,261,499 *088A3879F7D9C0EDC9E39CC046F73E6F856C12D5 [email protected]
80,261,500 *08837FB781F6684160AA399D55654E9D1276B173 MARCETA5
80,261,501 *08833460077BF6637139419EFB1A5AE5484B10FA elliottmaciasz
80,261,502 *0881F6B1AD1E46FEFA54E69F116D4ACABB279E4A elp;)
80,261,503 *0884045D6648449CD7E4A07034E7BC68D1EE2D11 marcelmatsuo
80,261,504 *088D037037172D26659D00E2D7321B5722E68B33 MARIE-CROWTHER
80,261,505 *08866A8AE146A299D321563A2BF5EAFC4271F177 MARCO.STOCKI
80,261,506 *088E2D5BE122550F933A73804329E28268A86771 markusstredny
80,261,507 *08809D0BC145B33768AFF7F5972174F7160D31F4 MARLEYFING
80,261,508 *088CF2750A897861A46628D4A85320D42227C916 ELYSSA WILSON
80,261,509 *088059F26B1012BBCD74F5EF47EE4019251A5AD9 HOLLYWOODFILMSTYLE
80,261,510 *0884351FC133828D7A9A1CA6441C6AA980E2B1D6 MARVINSELDEN
80,261,511 *08858059E4CFCCD953FACEA2B12BB1AD29ACC71D hondekop8
80,261,512 *088598E06A5243F0A1557FB22ABFA022FD60B3EB MARYGRACEMANIAGO
80,261,513 *08876E7B2B33326C6F8BCFE395468684B787E010 MARY.JO.BRISTER
80,261,514 *088720E66B2898440ED17FB2424B5E244FDBDD1E MASKTWO1
80,261,515 *0888EBC13A638E1D9A369766A2A6A9D53A25EDCC EMV7E
80,261,516 *088FC6D0238BC4751E9538B2ADDE765ACC7481FE MAUIOCEANCENTER.COMWWW
80,261,517 *088165DB54FA8BFEE4E0EC3E33993ACC2B86C936 MAURO.ENGELHARDT
80,261,518 *088917E060033A3DF37A0D09E5866D710230E773 maximokadar
80,261,519 *088DB06ADEC826CA285711F1B948F2335B0FA068 MAXINE BREWER
80,261,520 *0889D224731E58A181D8D00B7E3EC8A776714833 [email protected]
80,261,521 *08839434257D321C95DC41B30BB30C8E4B23551F mayday
80,261,522 *08827AE8B49B1489502A38BA78FEDEBD3F5A50BF mb3baa
80,261,523 *088F3580E260F29A6E0F5A8310381D2D64665D63 MCHOUPANE
80,261,524 *0883DFC6D4D81201704A21D4E3199D618DAE1EA5 mckinleynervis
80,261,525 *0889626E9558512EB71FBB4423224604BA8261FA MCKINLEY.STALL
80,261,526 *088377BACA24C19229A9B11DC446C794FD0BBB9A ensued-andrew160c16
80,261,527 *088B5E6AE7E4A672DFEDFC77E33D990C3FE6F86D [email protected]
80,261,528 *088CE37094A2DA7997947C5F10FD33819B004FBA MEGJELENTETTT
80,261,529 *08899F1C4FE6C0111DF21844FF02F3E66D639C58 MEINUNGSGEGENSÄTZE
80,261,530 *088CB5B9B4731565FCCE3332FA80E435CD6E8506 melissa.boyette
80,261,531 *0889E0FAB9EC224FDFBB31FD0FA2BA999E651909 mequinha
80,261,532 *088D7EF7E37382DF4A1D2B286618A926F6A2AE0A MERLIN.TOMSIC
80,261,533 *088F3695A5085FFC26BC63042943658414436ADE [email protected]
80,261,534 *08840F293AA0E69605007A7B66D0A9C90BFB9CCA messerwerfern
80,261,535 *0880F43BFB0FAF93D8A8AE8AD1B8B7AF7FF59E29 huottes
80,261,536 *08847BC331D599BB4D5D516386EF933556D07F0E ERDONAVO4
80,261,537 *0886F9B46821AB341A2018053824BA3C760D48D7 ERICKCOURT
80,261,538 *08855DA2377EE50CC9ADCB0570C35BE34D3AAEBA ERM-
80,261,539 *0882DD34D57BBDDF81E1B6A19FDF966D9AF18C83 ERNEST.REGER
80,261,540 *0882B0BACCE249DACA81C41DB4D7F98B40331AC7 michals
80,261,541 *088F0A14B122A9AA96225A44D7B3D947A19557D8 IAMPOPCORN58
80,261,542 *088391BF562680FDE433A030EDA8E90968BF464D MIGUEL.BURWINKEL
80,261,543 *088EC0732DE15FE7172065B7486A3C0852C9EE5B [email protected]
80,261,544 *088087537698E9EDBCA71B7C79654541D4CF5CDC IAN.OMMEN
80,261,545 *0889264C70C9336181285546231E8A041D5635A8 MIKEYAAA8
80,261,546 *088AB540F6A4886799AE8AA861C2571DF88CF1A4 ESEWK
80,261,547 *08837DCDBD2175BBEA5F0F7DBF4F7C6D49974996 MITALTAS
80,261,548 *0880FF3778933CD9980EB524EBF1D9324EFF14C7 essicriing
80,261,549 *0889BFE2AB4A2381446277B91D62BC494BCC82A5 IARINRET4
80,261,550 *088A6EDE5B25653F091D80965B1DF4A1ADE22C1C ETHAN.SCHAUNAMAN
80,261,551 *0885C106E7F075833804E87731D176F6862BAE41 MIYAMIYAJAIMAGENOMA
80,261,552 *08875D910A7B445BE3B4AFC61712970453D50910 minhajhashmi
80,261,553 *0883C95DFF86918ED68C58E26D7AF70F8EE74FE2 etnkp
80,261,554 *0883717D6A2B406810698F19515B7E058D80871D EVAN.KIRSCHMAN
80,261,555 *0881A115E38D1A4E2F7A55D21E31411162A49C9C monetics6
80,261,556 *08819B5A06B5DB9F57B4F586CCCFD94B6971E9C9 ex7r47erre57r14l5
80,261,557 *088C751171EB0A3BCCBBA1A1139B7E02FE54F715 MONTEZ-CAUCHY
80,261,558 *088D2CAA6690E80E26505AA43C51A7D808E82DBB MOSES.WALTHALL
80,261,559 *088C7F1AEC8C507AD97FE5E0B4EE033A58E208CD monteatro
80,261,560 *088533BA9409761CE290ABD7354C90B5E73E74C6 mozartmanuscripte
80,261,561 *088B8AB549B6B06C4A0A64E8CFA493166C4F99B5 MORGAN REIS
80,261,562 *088316305148559274B459BC69E9FF4CCD930528 MORRISFEDER
80,261,563 *088A45FF2FBE001B29101931C0229552AED31191 MTKIT
80,261,564 *08817F3D531EDE818DFC063E01A491A3F74CE55D MUKTA JAHAN
80,261,565 *08880CD4942A3405E5C5AAFC45EED9B972D40DCD ilovesnakes54
80,261,566 *088F2B85C5F79662AE67BFF252F5A5A1A3D321FB MYFENRIS2007
80,261,567 *088406A504460EBD610067E4B92C502DC3663EFE MURIHEAD
80,261,568 *0883FDFFEE8185D574B5B97D05038574F47783F5 MYSSERI
80,261,569 *088C9128D1E3567305F13D1CA88AFD2BA98FBFE9 MYCENTER12345
80,261,570 *088D99A0EF78121179A8D4FDD6E45AE3CE943B20 FE]
80,261,571 *088885F053F9219D5595C43AFB44BCB18AA8E385 myhershey89
80,261,572 *088B65A0DD82C8E36677F1D581912CF55EE0CF59 MYRRLINL
80,261,573 *088B129D9C23BA42473A321400F8BA10DE41D16C n39a+v3n3$$
80,261,574 *0889412D313299AEA598BCD124481EFBBD1E809F NACHIKETKESKAR
80,261,575 *0881534EA6D7C4EDD6AE3442409FA8B62316A4EB filecpkg
80,261,576 *08831F7CACD865E64697BA0C9308E1F37FB759FC NASALITY0
80,261,577 *088665DD36CC6E9E560E4C6BB7CB651D59A446DB NATHANVERDI
80,261,578 *0880CC0E26569B75075581BE6A63888A77C91399 NCCDNTD
80,261,579 *088F58B36237254C79BB3CBB1852B365B4287BF9 FIRSTMUSTANG
80,261,580 *088571647ADE6EE1F5D5715E6A5400EE240EB99E NESTOR.DEHANEY
80,261,581 *088A24AB1D898C8192157E3A14C0110169810860 FLADUNGGED
80,261,582 *08805898A2D90E8CC2E1E30EE6F6CEEF009ED863 NEVINOUED
80,261,583 *088A08013916938DA8CA6DC583425774DAB5B3A1 FLING.DOWN
80,261,584 *088FB0B87F428C3395C6A34D79BF8E7300FDB512 new-kent
80,261,585 *088A1991F02567C17B0D9A2815E6EEB0B38068CD NIGEL.DEMITER
80,261,586 *08865FD32BE10A38D36C210CB694FC279E21713E ngmui
80,261,587 *0886ECA49B7156C84C76446942C5EACAFDE39CC7 NIMASHAB
80,261,588 *088EE720B76130D250EAE2D2681BBE8EA7593849 ninoimburgia
80,261,589 *0882A7A6D672D836FA5FFDC9986AECFC3993C0A7 fracas7
80,261,590 *0889BF0911E328DCDCA05CE68FE45C00EC17ABFC NISARAYA
80,261,591 *088161397CA6E6F853D7F2BE5C111DC7FD5EFA33 NORMAND.HOSAKA
80,261,592 *08867128B58BB77212AE8633F5CC52C63428E6E5 NORMANDSIRES
80,261,593 *088A9EBB39D47529E574339542199F71748B6E82 norrismumper
80,261,594 *08867E146D791E4C87D3704B6E49E04506692CBE NO1WALKS[CATS]
80,261,595 *08805D57BA66847E529A739A46E32459589E1A58 、NOKKO等のリミックスをリリースしていたが、2001年前後を境に活動を停止している。
80,261,596 *08859161DBF6FC637A266A1181DB659233749564 J137684
80,261,597 *0885E150C861C623F1DCE5180769A252484E3267 NRTH-1-0
80,261,598 *088C58A94EB56BA00E48FDEF4C89A70753C28563 NONCOMMODIOUS1
80,261,599 *088A81B55FEDFB9E366014F14A9D50E57D1327AA jackie.toscano
80,261,600 *088D5552A9DE2F973716438A233AD9E5C9ED4ACA )O(-0~-D====8
80,261,601 *08834E4B473109D0DE690A03E54286524E58F764 NORMANSPANBAUER
80,261,602 *0888D0B35B527CEB57767E7D693A93E41DD7B75D O8?X
80,261,603 *08808F302AC1645546B927478CE04167A16246C2 NORTHSOUT
80,261,604 *088EAEAEFD1400F681355F2495A9689B7E399913 FSKILLED81
80,261,605 *08858400BB80AEDBAFEEC51B68A918D3434DE61E notabetterwenchinenglandgo,washthyface,
80,261,606 *08895B6AC41F112F03789724E30F57A521A7D681 not-bloody-likely"---'matthew'-'(to-serra)
80,261,607 *0882CBF5D8D28E16030DF978EF9651DE3E7BFB86 obitelj11
80,261,608 *0889EC18C7F98D1434BADC47B138EEAC07990B9E [email protected]
80,261,609 *08837583895D5E1DA52A7F0393EBE05D2BEB4E14 novel!57
80,261,610 *08844B564D140C0570F7D72960A80E624267A414 FUMETER2
80,261,611 *0885AA3DA9EEDA1569697E372B78D55D1664B6FF furkankisa
80,261,612 *088BE82040F420927D0A6049EF7CFC28E4F7864E FXQZ
80,261,613 *08868F7F8F7754FBBD83E2873643B0E05E360072 G155340
80,261,614 *088B073FD8378A991F5EF4D12680CED6EEA67526 OLLIEMOSEMAN
80,261,615 *088EB4FD5C702DC9455E4681B6BD497C957E5224 o.madawaska
80,261,616 *08851E964996331358F2F14740428ED60C2E9D97 O104633
80,261,617 *088C1F71AE249CC411372B709AC158FE7CB2BEAC ONDIENSTEN0
80,261,618 *0887DE93D58B213423BA9CD40DE23B1847C26067 GANGA DE SILVA
80,261,619 *0881819D4B803878E8228D76EA6BB4652B9DDBB2 jarredmeneus
80,261,620 *0881E9BC5A7315E68DD97DA0698EB9D689059C9A )o(.o~.d======p
80,261,621 *088DBD6354AE8271C1139EC03AB436A765B3C50C jashawks3
80,261,622 *088F6CCBD9505FC29250EB0E681200864EF813EB JASON.DINGIE
80,261,623 *08808039E8E2EC62CBA535C8C9C28D215828B1F2 }O{~` D-Q
80,261,624 *088A44347F2D31D2753ABAD409C01B0C25EB56B0 JASONSTJACQUES
80,261,625 *088DFDADBDFD6392097F8BF0EDC6E6CBB2650170 jatstrat8
80,261,626 *0880C6CB672534E6A1598AC68EB091F8B3F503F3 ördöggyümölccsel
80,261,627 *088EB976B276A6F8A305EF945ED4129FE8471DEE J'DG
80,261,628 *088FF806A19F01629894FA88F87FE2EA8C501827 OLIVIAWILKINS
80,261,629 *0880A7FDA63B7DC354F6F239DE21471DBE08B1B8 GEORGIA-LOWER
80,261,630 *0888A492BD47496BD2885B0B28980634F6D43A15 JEAN LE GUILLOU
80,261,631 *088932650A7E1DB141CC20C6C792AFB80E9DD0C6 p3r39rin47ion$
80,261,632 *088872774745B1AB7F85753091DCCAE3300118A7 JEFFERSON.HUTCHISON
80,261,633 *088803F4EED806DB4CD0CD62B73190FEF82EA037 GIF87AGIF89A
80,261,634 *0880935A58E3FC84CDBC325BF9D8C6E6D2C1AD6F paissirai?
80,261,635 *088DBE6D5C10FCF9A3775D9748558FF69FC64B77 girlwanted
80,261,636 *088B9D1A8426D6884269BFF7562E78C7509CD503 PARIS-ANNE
80,261,637 *088AEE382B8CA3BF39F273266A7CB142E9F7C05F PARTICIPE.
80,261,638 *088E45C5DD8BF6A3BCDB9FD15930D8E78236CB52 PDL`
80,261,639 *08826F320CE0930581823951989F4C71327A388F OTTO.LOUNG
80,261,640 *088388076A012CAB6A16811E524B6162D1EC2580 gnotredd4
80,261,641 *08839EA667AD90EF19B479241EDA20E9B27615B6 [email protected]
80,261,642 *088BB1AC9F243DEE4C2F30F6B9AC27B67F42479C gogoschwili
80,261,643 *0887DA1D4501C63A4701198754B33DC69EBD6091 PGNR
80,261,644 *088F89B91A5EE2C510C6861501F0DE5FB125C099 GRANVILLE.LAFARGA
80,261,645 *0885E97964B6984CB6E6F7078447C732BB62F1D0 PINCBSWING
80,261,646 *088AA06B1E4361C1529F3BEAA84E162845595D84 PINCIÓN
80,261,647 *088DCBFE0AC3C8F9594ADD61386E9DF135CD74BA pitonime8
80,261,648 *08805397158FD6F1A1B64C873CEF909B5DDE7C38 pledgerses
80,261,649 *088A3A47DF2979C59A6BF9E5C7B4F39E2831C560 [email protected]
80,261,650 *088887AC841AF7793512A614DB7A02BA605C3D0D P-->~O.)0(
80,261,651 *088F4D4E43EC610E96A33C6C3EA9E1EBBC01EE32 policyporcupine
80,261,652 *088A76DD453C6B177389358A7072EB5FD0CD8063 patrick sean mcclain
80,261,653 *08887D303BBBCD2D6E70E9CA0E71AC3F07D5E3E2 pawnshopstodaycomwww
80,261,654 *088BD45CFFC326344FB64CB0415341539E0CFCBA PAZEAS
80,261,655 *088203BED99F32C2D2E1E9AF34FD3B783483A7C4 GWYLYIDK6
80,261,656 *088CEF11BBCC60BA4F42C8F8AD61765BE0910B30 :[email protected]##p
80,261,657 *08849F62F85FC635694A1A8D564887F6C5180E2C H3dg3-$t4
80,261,658 *088FDC0070E0961A5CA2FDA84F54E5803FD17670 +h3s+c4lly
80,261,659 *08842631D5037C58F00EB63A14468B58910CA0F4 h46n
80,261,660 *0881FE7A67FE7C51E9369E67EE289BE6328E95EC POSTHOPEFULLY
80,261,661 *0885599B4EADCB6EDBCD20504B131F4A3253D7A6 p#####p~0.~o)x(
80,261,662 *0882FAC8F8D568F7A4F5C9CC4AA2A5B4F75FCC52 jmred
80,261,663 *088D62A382D90C7111177D35AFB3533CB4D4AA50 [email protected]
80,261,664 *088EA2289EC4119EB6653DA60BD27E94971C3253 harleysippy
80,261,665 *088BA0F046E143567CBD19093E61D306D2681CF3 harrisonhomer
80,261,666 *088713E3F3C7CED2D7D512CDB535133A38567868 harrystumme
80,261,667 *0882E1A427CBC479CAB3FD00B2C0ADF10CC711C0 harveypeddie
80,261,668 *088C4F003FFECC57D33F439AF4771FA9D03D375C PROPROTESTANSKÝ
80,261,669 *0882FE8F506F12ACB0B04677C3421A347992247B [email protected]
80,261,670 *08888AD95420403BCDE02A0CE6EF0E691B9EDBC6 PʲɪRʲɪˈVOTɕːɪK
80,261,671 *0883B992C4D1F626D94B3852898FAE45B58B9460 Prydz,.Gulf.of
80,261,672 *08890653443A1812503DCA004252BDB4D62A3709 p-->`-sploit
80,261,673 *088211A495FB86D1CD3D5785D41C885F16E86E20 JOSHCONSTANCE
80,261,674 *08825F75F3D73B68E86F24614CC9C2FC25F30B6B pisp
80,261,675 *08834691CEC77D688B230F3E1E98FA461F1F7FC0 pito-vergara
80,261,676 *0889AB8786F4EFD2D915552BA69CF04EB217E89C Q8_S
80,261,677 *088FF93D6CE8BE720345095DE13A4A59A5D981DE QAWSEDRFTGY983
80,261,678 *088A3EDDAEE179010B6B2AABE96A2D1FB05FB2B1 QBDYSSS3
80,261,679 *0887501AC4C7FDDE6823011379855D258B3AC02F [email protected]
80,261,680 *088C9073E81E756F31EF4CF27B2264D97E4C6FD5 [email protected]
80,261,681 *088C0DC6D503682486EF4D050EC267D8AA1FBBB1 [email protected]
80,261,682 *0881DEF3848C42A4800DFD21F6FECC7BDBEBC855 Q&PB
80,261,683 *088C01648079B83FDAB52AF55567A22C61FF52AB herbertkohlhepp
80,261,684 *088456A2073E9C0CE86821102435B69263E22C74 Qu4drumvr4+3
80,261,685 *088A2610FC3CC2C0FE6CE3865B039CF816B79790 [email protected]
80,261,686 *08824D9B0EB1F2CF5D86B708071F46742DE8772E [email protected]
80,261,687 *0883357D99A3AFD9FBC7712E10F6A2A18CED5D2F podrozny
80,261,688 *088ECC05A7C072B0F472EFE71CC0B75B9770FD65 pokrywas
80,261,689 *08890F3C1CB2E592984FA86EDB4F73EFD0162AD6 [email protected]
80,261,690 *088BC80DEDB052295D77CB48227CD1966DD1C5FD HIPOLITO.TALLADINO
80,261,691 *088EEC0E970B7E52BB305FC29E3BF78CEA0FFB0C KANTATE,BWV175"ERRUFETSEINENSCHAFENMITNAMEN":VIARIA(BASS)"
80,261,692 *088D1369D96CD631AAA7CD85893BDF6716BB31C1 karagheusian
80,261,693 *088E74324F3D6FA7EF81821506A1E6956CDE073A PP* * *(_0)
80,261,694 *088DD379FC45342D29C00CA94C6F139B8261996E P======P-~O-~o(x)
80,261,695 *088CD67CE2B4352652D2CDB63BD0DCEFB12EAE45 HO"FLICHSTEN
80,261,696 *0882FF51AC24C111CD3159DBC82056D636AB978A HOLLISGEIL
80,261,697 *08868F5DA8FE01BF9A5153A5C19680C5DD32C025 RAMI.LEE
80,261,698 *08878F152F1489E5EB8C152CA0E437BD2FCA97BF [email protected]
80,261,699 *0884BCD654382740B5650D9C35BE2E5B9DE86C28 ramiroforonda
80,261,700 *088D50EAEEDCEFFA2343E3B9FF9F1FAACD50B610 PREFEUDAL8
80,261,701 *0885EBEB62C97A7C971F9AF1114544106AF7453B RANSOM.22
80,261,702 *088386EDB2CBD496B726CE544F26A3E0B63786F7 HÖRKURSEN
80,261,703 *088834BBF97FA2073D745FD844268859D0BEFE4D KENDRICK.LAMBERT
80,261,704 *088E1A5FEE60DC56ECA1003F747BFAEF3B5CE1BC raymundomaize
80,261,705 *08882EB456CBA4C7B27C5C0B211860746BA79831 RCEMBALONO.4ING-DUR,HOB.XVI:G1:III.FINALE.PRESTO
80,261,706 *0889B7D407CB8AAEADE60D606AAB6CA105C758A3 Hospital.Inferno
80,261,707 *088FD948DDF114D2E625B19E2DF30733295DEE8A [email protected]
80,261,708 *0886E5FEF4DA2600EEADA6AF8FF000322FA26ABE REDSOXS34
80,261,709 *08849AC3CF5FEE45B4474556A79893769794E4BF HOURTFULL
80,261,710 *0881AA525E62ABE98D925B0A5518CD1E651094D1 HOUSE.OWWMYKNEECAP
80,261,711 *088B84C4E0E7687C6DF196CB9378C20EA35706F7 HOYBOY-L
80,261,712 *088428888774070FE76DCEE99F84DA89F3EE2DB9 PROVICAR4
80,261,713 *08815DFBC1B379D37EB2FA776132A9085C147A44 KIFFERINEN
80,261,714 *088F54A69081692C613B539F79DACD5ED45A9B99 PUNK'S.NOT.DEAD!.MIX
80,261,715 *0884D943463261448F67BF823A4C7235C8D6079F RENALDO.DRACH
80,261,716 *08889FF25D38ABD236C3EF0DE24AB77DF4BE1062 HUECKEL3
80,261,717 *0888A046AB21B6645BA28E10BC191CEDAE029F9D P).~.~.~)X(
80,261,718 *088F9161D84EA8F7232840E2E74F3954D7B0DF2C RENLLIM3
80,261,719 *08817962F0C66D94CA790DF8D68FF89E5442145F REPATRIADAS5
80,261,720 *0883F9FCA960C792A0D9EE98FB49138B466D81F7 KIRSTYTIMMINS
80,261,721 *08890DDEC0B5264B1AD1B1C38E5B263B48C577FF HUSFLIDEN8
80,261,722 *0884BADF1EFA43D31989E91B75EB806AC141EE5D [email protected]
80,261,723 *0887AC6CF7E93245510A80CCC90E8DBAE262835A [email protected]
80,261,724 *088B33C1B48013E3A44D0F8AF97F5ECBE7DA4661 Klavierkonzert No 11 D-dur, Allegro assai
80,261,725 *088D150B959D535838242E82FA9163DA40609C83 HYMAN.OBERHAUS
80,261,726 *088C43E53777482838A7B6B7216D17E104072239 qD `~ 3B<
80,261,727 *0887E8205F0FAB521866546FF500E130CD0A7564 hypo(transformmix)
80,261,728 *088DF5C4C01C59015067F8D73D02001B94EA3056 IAMCIVIC65
80,261,729 *088BA7E26F7C8775A6978F6AD1F32E29C4F0FB45 [email protected]
80,261,730 *088FD039515EBC2ADDC0C233D7A5D0793872F478 q--p~0~o)o(
80,261,731 *088CF7CC1586EA6B31C7EB9057D420D2D6CCE1AE kornienko-imjpg
80,261,732 *088640169D07863A94D26CA9524474F20EF3D58E RF6J
80,261,733 *0887A410D8601B0C7F99ABC78A363BA5DA23E894 IAREGNOR3
80,261,734 *0881A737BEB39CDB5659F23A4DA23E16588C69E6 KRISTI AHO
80,261,735 *088B6FBB9F77EC8E2A3B3951A1CDDA53D629D561 ID4142
80,261,736 *0883C1C7596DF10D3B7FB18535E89E060CBB6128 [email protected]
80,261,737 *088A200B4553FD19B949B0362A5CA09F4D0224A4 [email protected]
80,261,738 *0886AF0D583368D56CDB38B2F375ACFC87E2583C [email protected]
80,261,739 *088155E8D9705F3A9DCA16D6656DD149491580D5 RICKYBRUBAKER
80,261,740 *0889DF956A5A5205E4960423F66074F7E56C53E1 IELENNUT6
80,261,741 *088F2DDC69F5045B568908BC42304A95ED7C0CED KTJUATJA
80,261,742 *088D53FBB9387A5A70A6525BC4686D7D03CB80C6 !QWEDS
80,261,743 *088C73D8C60D4A8F60994223DF9649CFA88D13BF RIO.PASARIBU
80,261,744 *088671B5CA50778FA9FC0814F6CD6F25A6C3AB0D ritsiger?
80,261,745 *088148A1CF8EBDDB8E7258D54A9CCF9E27F9040B RMH
80,261,746 *08865D0ADF851C080604360C025BE3CA00E5E053 robbyyapp
80,261,747 *088AAE1ED9D2077DAD4A738BBCDC37B331B442E3 robertmayergymnasi
80,261,748 *088FE70E9D92FB359403D6432B898A94D98B80B0 robinsoechting
80,261,749 *088EA9FE28A7D58D8BE7A3C7835C3A5BD88C7989 ROCISAGASTE
80,261,750 *088C120DC95D097E6A5956F9C96E137B0CFA81E8 [email protected]
80,261,751 *0884B5A62CC36105337D6E6092F364C3DD5B4B70 II-Scherzo
80,261,752 *088E195D6570745824FC0010F5FF6524892CE039 [email protected]
80,261,753 *088BA9150534C1466EA392C22D75DE32A4719090 raise your hands up
80,261,754 *08831C441AD6F999FBCF7136D4F10022A2A57414 ilovesylvia5
80,261,755 *08823DB39351C6223C12161651D605E94A7CABDB RONALD.DARDY
80,261,756 *088C749327C86D3071CA30E4448B35CFBD3369C1 roslyn-terry
80,261,757 *0885088D4F130F3A96BE031A9825138210660FB1 ransingleservice
80,261,758 *0880CF7157B0F0854A52C649C3B8E9EA8A398261 RAPHAEL VALENTINO
80,261,759 *088CCAC82604FE03AF9529EA271AAF33C950106A roycechurchill
80,261,760 *088049C4486906F55A26F1FE3602271D4CDCF124 RPOBO
80,261,761 *0880740A284C4C724772D35AEE2707675FD75C67 RAYLENE.LEWIS
80,261,762 *088BE4FEB0C8602039BFCAE6E97A70ED19898FF7 RPSPIKERSR
80,261,763 *0882BCACDF465995951C6061F1F9B047E266AAD6 [email protected]
80,261,764 *088E46D2FD6374F9CD6E36AC4B305614A8DF3563 «RAZÕES
80,261,765 *088EB0195B7F392F87EA295DDA1A76F3B191B6B1 LAMONT.BATZER
80,261,766 *08800ED48C4D38B1B7EED2A794CAA3F11C5C4C49 :rcaaa
80,261,767 *0884A4B0C27EB8279FAD5AC16F59492BCA948FE9 RDERSCHWERPUNKTEN
80,261,768 *088A94FC150AA073792235C917E5DC677869F2D0 reageermiddelen8
80,261,769 *08870969C245D5A2C46CBB9226ABCFCC95DB0498 imlifndy6
80,261,770 *088B8AF995CDEF012CDDBED64786A2C09E339A57 LARHENDA1
80,261,771 *088227C956DC2294E8452E7D722F1E6030EF09A8 LARRYBYNAM
80,261,772 *08868242BEA7B890ED13462FB97A79D3C9117F52 INDBYGGESED
80,261,773 *0884B178E8322D5D8A071307260751A6A57A6E02 REED.SOWELLS
80,261,774 *08841BA3EA685F7EEF0766D0FEA20E7E481D79F8 rupertwalla
80,261,775 *088CA5D2607940DCF2E82DACA104F16524A19DB5 RUSSELL.FOUNTAIN
80,261,776 *0885FE6FD9A4C19461E6445615AAAD4CA6693C9F INK(
80,261,777 *088AFBCB060C5E830650F98DACE94F6390552B03 reichsbürgers
80,261,778 *088397FC136A2EB81807C3D613124DC835D8729E REID.MONTIERTH
80,261,779 *088CC7EF445BAA580169289B7875A34566B4BD2C reinaldosaras
80,261,780 *0884F91C758B271A733FBCCAEB16EEBD75A9467D RWDQ
80,261,781 *088E0B6D1B16DD4360613D81242083B5C0D79BBB LE-CHATEAU-FILM
80,261,782 *08844AAEAD32F2553A0F40A05191202F0A631E41 RELATIONSSTREETS
80,261,783 *0883F0F20622C5A9C5980B7C4770752ABF964A1B INTERURBAINE
80,261,784 *08860FFFB83989863EA94B8840B5CD82973FAFCE LEM.LIM
80,261,785 *0881887E9CEB35CF911D81D48BDAD173F810A5F5 retroc
80,261,786 *088D4DEB3A7B60ABE31A9736BA124D7096AB7175 ISREAL.LICKLIDER
80,261,787 *088631D9B5A9434C0B70FDA9E7F6CD4C8D2AEA6D samuel-cutler
80,261,788 *088DC912609A0426120D08D363BF0539FD93BD2E SANCHO.EL.SABIO
80,261,789 *088E6BDABEA0801C12BD4C09D5BD4621B8B19C17 returntoeternity
80,261,790 *0884FD603D6266EBB6FE97A2A26091E48945D438 LEWIS-SHIELDS
80,261,791 *088A30B3AB51562CCD022170D81F79F759FDE49D LGRX
80,261,792 *088E60B39AD02D017251B1AF828349EE7B4E7029 LICEO-DE-CERVANTES
80,261,793 *0889227832CECDFFA6FBD783C0F8474002AF6E9A i%zu
80,261,794 *088E1076D46E39FAEC8075B861C2D6C5C18B2FE2 ricardo.magdalena.tabuenca
80,261,795 *088347AF31200AFE679E8AA6C42D545A32179A21 J236566
80,261,796 *0885271C8C824DC2C748B68FBF1493AF2C06B453 J2}G
80,261,797 *0888C7E736C3925CF5E244D2A764138E2606AA5B SCIFI BOOGIE
80,261,798 *088723AC800C89903728C7F1113C27B9568D49A8 JAMEL.HOVARTER
80,261,799 *088DE42B9E3F78832E4155FA2B9003F190976ECE scolarise`rent
80,261,800 *088274411237A8ECB1EEEFBD03D00B1B1140C769 scottiearie
80,261,801 *088439655B4D3E33046A13AF811C35F50771CA3F RMOTON
80,261,802 *088B755034E40F3A67780D1B3C78B3CF76711F66 JANELLE.CARUANA
80,261,803 *088527EFE7662CA1E0C2A4DC3390BE1AC6852CAD [email protected]
80,261,804 *088298C7974EC1229FE2B42F7F022D1932DFC2ED robertojervey
80,261,805 *08809A7A4D5BC13150CC060C6EDD286E16568582 [email protected]
80,261,806 *088963AB241F42CCB48793BE6C4BF8A00B7BEFFF janet.jester
80,261,807 *088B418426C9858E984B12EFDCD76A2EDCF467A3 JAN.MAGSBY
80,261,808 *088292393184C30154D6932B7F27602695007293 LIVEBEAM
80,261,809 *088BD11B667F630BA70960A86028E6A805F628FD jarna
80,261,810 *088D6AEF249CF17602C12C8F211D65C1D6550835 rodneyversage
80,261,811 *0884CD657C809E2F5244072C56034B53234E966D lon399
80,261,812 *0882FF7E5D5183CB37ED12F3A261EA90E0F2B4C8 SENYUMSELALUSEHA
80,261,813 *088653533E6680C0B9A579BAEB6C409B2015A110 lucianocader
80,261,814 *08851730170BA44D2D8AE0764D4B24FD8C9C7D9A JENNYTAHSIAA
80,261,815 *088EFD12FF3212F470453DB0F77C3CC7799C916F ROYAL.DEBAECKE
80,261,816 *0889113F02B94C16835B3691315ECDBED49619FA ROYCE.SABOL
80,261,817 *0884AE0EDD72968241DEA892633A6EED3D60301E [email protected]
80,261,818 *088C1C3290B9E8CDB541B87D8F9E26773932FFD8 RPR20051013007300353
80,261,819 *088F66A67263CB5BCDA757A29FE0CD10FB9D96E2 RUBLIWOLBAID
80,261,820 *088395B3582129F25E7B17ECBEB6239B65CA1726 jerrellbenevides
80,261,821 *08876CD084452C88AD8843187FDBDE6BDDF80FAA JERRYVASSAR
80,261,822 *088106E411F492BD848F0C668998C9440351C4D9 jessescriver
80,261,823 *0889FF598BB139DDEAC1325400ACB1C99FF1D624 shaptaah4
80,261,824 *088E9476DB5B9B81FB0F01B5D815EFD6E550FB49 SHARON.LAU
80,261,825 *0885A7B92976679654811A40CD00FC32124B36B4 RUSSELL.BOGENSCHNEIDE
80,261,826 *088F26A7868B2B7DE66D4B4F7CFF34B32CAA51FE russnipple
80,261,827 *088EA4141327C03E3FA198E716C629F9A58E90C0 [email protected]
80,261,828 *0889C3B4570C781C7ABFB30C75C67A02716D3E76 SHEIKX
80,261,829 *088BC1EB80C03C38E7A80C572E2390AD2594B5B5 [email protected]
80,261,830 *088C4DD2219BCF01B836DD44B02B46628541422E [email protected]
80,261,831 *088439DD0AB4088CCD0B6B93DBEF4111783E3EA0 sherwoodpetrie
80,261,832 *08877B53249CF23E388551A188DF12F881E4B89D LUGTLUGTS
80,261,833 *088B0E30C81922B8457549592C2D57589729F571 luke.jefferson
80,261,834 *088DDE804EC3D05BC51A8A79687205A159D1D59C lymanpatraw
80,261,835 *088C09F1B0E2BF185E638957E23D3013D71D8659 JOGASZOK1
80,261,836 *0887883EEA9E0B91F34EC5FB4A8BADE4C6121E3D sibenika
80,261,837 *08861CFF9DC2ABEE03C3E674F9C205E255F2908D side-netting
80,261,838 *088C0555A76A5CE111F36FD6F20C534D522EC4BB [email protected]
80,261,839 *0884C22AB9C7B56FEC7B2336577A3FF7C9BCFF37 MAC.BELTRON
80,261,840 *088FB2977C68653ABAAAA291F0E2AEF49AECA36C SANFORDDRABANT
80,261,841 *0888C7701C6BC10EBB70BC3BE354793B7AF3ABDD josefkasimis
80,261,842 *088692C99299F2901013E6ECD8EECDCF2F4E4F96 MACKOLJUBAC
80,261,843 *0883F1BB32F661227FD903D87BD70A4D43839B3A sangtowne
80,261,844 *088ACAE6AA45247464B535DB43E1FA26DD91C141 SINOPRES
80,261,845 *088D5950484CC26282BABF077743E3A78C7DD11D smzgueksvwlrrohmavhm
80,261,846 *0887B64A5C7C4088E7FE884668A5554F5E87B857 snowballfightrecordhaswauconda
80,261,847 *088C1C638E217ACF60EE3D0DCBFFC4BFEB30A78C sauditv1
80,261,848 *0886534178923E6E513EEDBC3F08E21DDF997918 SAURASHTRAUNIVERSITY
80,261,849 *088FFB09ECC37BCF1D9BB8E5A432C4FC0BC2B1C1 [email protected]
80,261,850 *0888ACCCAD6C446F53A7D72C01C27C34E61495AB JUDGEJP.COMWWW
80,261,851 *08857155E68D41C18428985FDC725BCE65733BF4 MANMELIS
80,261,852 *08887CDB3A6C01E6E409A7CF62677914CD7E95D4 SOPHY CHAN
80,261,853 *088DB487C26A02DA52ED0E91E2CDCCEDAAFA3DE3 SCHWARZENEGGEROVO
80,261,854 *0887A2D892EC3019E1370881CDE90D832D9D95B8 sci0s0phy
80,261,855 *08899F35D03B96DFE01D80349FDA0EBBA1FDFBF6 justinbieba
80,261,856 *08879DF1C53B20E1C4FAAD177FBB026DC88CD38B JYQAQ
80,261,857 *088FCC998E024992A2B23DE22375563FE3BD5E9C K102376
80,261,858 *088D4304ABE40A60621AB8F9C103E86F2E3C707C MARCOPRINCIPE
80,261,859 *0883B2C17C52F52B9C7B126F272900FD27A3D128 MARCO.WELLINGHOFF
80,261,860 *0886951608C31C7192D80989B509FA56425B84E2 SCOTTYWINNEWISSER
80,261,861 *088B815B82FACAA8DF040DE9701A161451CE005A K?;9
80,261,862 *088F90F9181060DB9E5101C486B5A55E77192EFA MARIAN.VASQUEZ
80,261,863 *088573428D60F61F7A80E920FDBDCDED268FF4BE KAIVOSVA
80,261,864 *0887CA12C697727711E1375746CBD643A49BAF6A MARILNN0
80,261,865 *088A26334D0F8489D2D9BCCC65EE8B801E01E4CF SECRETARIAMUNICIPALDEACCIONJUVENILDELPANENCHIHUAHUAMEXICO
80,261,866 *088D66C64C634D1A9500698834DC5199C41510F5 SPLATO~Q######P
80,261,867 *088C0D834926C67307C7580937AC5D991078A517 MARSHALL.WESTERHOLD
80,261,868 *0883ABB0E28968A787BED0DF3B59A0E7F15561B9 SEGGERMAN4
80,261,869 *088F6375DCF3BAF3D9CEE609788B672BD021DD2B SPLLMNNS
80,261,870 *088047481DC2796BDE39A8329FB3490BC1C49DD2 KARL.CALLISTER
80,261,871 *088EF76353F1538B723D4F9692477228E91A1589 SPRING-WASHER
80,261,872 *0886B051734B021A055F636B83EDADC32658E599 matrac orchestra
80,261,873 *0883116C6ABF2DC75FB953989FC2B200FE093B34 SEPULTIURS
80,261,874 *0883BB91379FBDA44533A690A46D83405A45FC6A serena.bass
80,261,875 *088814BEE381E0CD5B7E8B68A99AFB33DEC1E8B2 [email protected]
80,261,876 *0884976EB331F8ACA0A6BDD3BF932693F586C1E8 KEITHIMPERATI
80,261,877 *0889B2915A1F8E5F4AC19BBFBA156AEAA0AAF278 SESISAHPMEER0
80,261,878 *0889C9118681FD087AB1D7D8E81F391CD6C661A4 starkist
80,261,879 *088222DD844704613F9756384ABDCF441F6B1BCF stay-tuned
80,261,880 *088C3820F3043856213BFEF54696BCF9171677F9 STEPHANIE CUTTING
80,261,881 *0889652B21D1BB3640B92422A180B0066023551E stephon.boss
80,261,882 *088DEE06946CCFCFDF20009DDD8159D10127D174 STEVE.BARTIMUS
80,261,883 *088FCFDE0C7E790F135822630D63DDB4A964F04A steven-cable
80,261,884 *088176D5127DDDB46F52479B411170F8B2C6AAF6 SHAOKURA
80,261,885 *088D691E9C08D088DC6B7E0BCDE641B906292955 MAURICIOENGARD
80,261,886 *088451BA2F22B464345A27AF772C3D818751FF26 MAYRA ALEJANDRA PEREZ
80,261,887 *0889FDB5FC4CC5561EA99CE2B5FF802320F786EA mb3baa
80,261,888 *088C68ECAD9BFC34523270FA9B4B3F956999A969 KIM_EUN_HAE
80,261,889 *0882BBC4E39DEDD202852D157EC3088121050543 STILLHEART
80,261,890 *088A22585103B1A5E88B7A905A541208843EE559 STIMPYAMANDA9
80,261,891 *0884BB48DF376FCFF7E85CD0443C12CE19CCC91C MEASAIM9
80,261,892 *088F8D0956B823BEDF1B961885F63BC44EC4674A STÖCHIOMETRIE“
80,261,893 *088F360A845199A5191937D84AB8A0F9D4B9DC2F STOREを発表
80,261,894 *088D19EF4B320D659EBDF95D1A8410A32444CB69 STRABERRY68
80,261,895 *088054BBA61B06273D556CC5DA2E458F73AF7687 kiploxton
80,261,896 *088AE9B1A35447E676CAADD98712127AA61924AB MEDROL-WITHOUT-PRESCRIPTION
80,261,897 *088001C136F24F6411EE6ABCF6D1B08FF9C228DE KIRK-WASSON
80,261,898 *08889E0CE019627B2F98EAEE97DAFCB22ABB4CE9 stuhlhaus
80,261,899 *088E6A283F7E1D641AC18EBC84C22F528BB15869 MELVIN-RAJ
80,261,900 *088574E62A052274A20C4C2707026CEFC0B9E182 shined-on-me-(discode-remix)
80,261,901 *08823307197A2DF450AA3AA68FA418F30FD5DF6B SUBNICHE5
80,261,902 *088D97FC1482E5B85873E72300B3A4EFDEB24123 kong(黑貓)
80,261,903 *088AC7E1B785B0FC768755C509BEAAA625CE0C0A SUNRISESURPRISE(DANCEREMIX)
80,261,904 *088F761683B890C1CC5A0D84D712E6E57C47442F susanqwerty
80,261,905 *088FA7DBF1EA6BB43CEC4656555AB65300B195F6 SVAGZDYS
80,261,906 *0880CCDD5994512DFB8A6B4847D9FD46EE173D1D [email protected]
80,261,907 *0888541BC30A79F1FCD4C983B67C550C5DDC3BDB [email protected]
80,261,908 *0882CCC199458D6F26C7A8739AB7160BAA337C04 SLAYERCHANCE1
80,261,909 *088A0EDAC71D8CEB0A747EFA77BBE55E195CE5FA symphonieno5op67incmoll:ivallegro
80,261,910 *088DD96EC528F9FB27728526AC2364DB5BC6F608 kungen1994
80,261,911 *088839E69908F2ED9BFC14F8E5B1D9120DD61A23 KUNJUNG4
80,261,912 *0888BF13D799B8454308447649EA01DBA601B3CC SZENTSÉGTELENEK
80,261,913 *08845AF55AE2AC9051FD0FC39D7F85A7C191C6CA [email protected]
80,261,914 *08860D584D86D6379244EBFCB2F24393440CC4E9 TACOBELLJESSICA
80,261,915 *0883F0A689E8E81506CD1D313DF0E0966E2C6605 SMARMOUSH
80,261,916 *08833E177BC0DE9C8487822DF2CF0B0D47D08361 smarty-guys
80,261,917 *088692FC733859941E2C7689E76DE59A56046C38 kyawmoe-naing
80,261,918 *088835F843EE9F8FE541C194DFD5C108E69237DF SMOKEYNURSES
80,261,919 *088DAD888CEF246C83D20F92731CA46BB1B1B61C talk84966115
80,261,920 *0886752FE8137A9F7C7856ACB873EB0E465A8B27 talk8614213217
80,261,921 *088BC6F3EBE43EFC5853CD114DD8DC9E108C7A2D L069593016
80,261,922 *088B899C1CD8936D298EC8C280818B19974EBBD5 [email protected]
80,261,923 *08873637F8AE143686F6D85C0C03283A8E7DF3AA TALKMEDIATORPOLICY
80,261,924 *0883DFD24239FF823B375C6766B75FDA9A75AB4E TALKSPRAG
80,261,925 *0885E3FBE644FE0A4A708F9CF117DED027136DFE MILOSAUCEDA
80,261,926 *0886C30FF390E6E898E51D8B23B1FBFE199718C0 MILTONWAKEFORD
80,261,927 *0886DA24F98B94CA121A4D34FE832E8B4D621EDB mimic23
80,261,928 *08843A711B80812328CA073291CB1D86380C5234 [email protected]
80,261,929 *088E791045D9F1162C085ADC0D495FBB53B88339 SNOOPYFRIENDS5
80,261,930 *088121BC8D1E00B578D71C8234CA32A851009AB9 [email protected]
80,261,931 *08867926A153FF19446EBB49A246DD2F62FA836A [email protected]
80,261,932 *08804C2E3F75106264B5A72362AAC93A6A66621A LAHODIL2
80,261,933 *08875840B75ABEA95E7C081E34AA7CF623045D39 TAYLOR.KENNAMER
80,261,934 *0887C20DCA012B31495FADC54D9C629458A82178 tc.
80,261,935 *088586949413779B0D5AA83728834A4A25994266 SONNYCHIKUN
80,261,936 *088B15CFB58E1BC99EF1A5623D5D3BD5C20F003D LAVERNE.DELELLIS
80,261,937 *08849ACFE3323011A86B99B72783DAEABF2E51D6 TERRANCEDOWEY
80,261,938 *088C6266F1BE4D1BA053AD33EDE76CB73D220647 SOUTHEASTFARMPRESSCOMSOUTHEASTFARMPRESS
80,261,939 *088194F3CF02D7CEE79421BA769203BA4FFE7D32 terrellcolas
80,261,940 *0882DE369A70E861F721CD817FC7BB8B68AA1B70 SOUTHLAGSINREPORTCARDONHEALTHCARE
80,261,941 *08890FED5621D95E89CF920393FFC862660D57B3 mockups
80,261,942 *088E9835DE089F1BB63D3B6B5745052E5845BB39 MODESTOSAYE
80,261,943 *0885F1AD1D116AAB6E8AAF26755F43188AB2DDC3 THANKER0
80,261,944 *088691C405E8353A93CB68AEE70C8724873D6D79 thathelena1991
80,261,945 *088020AAAE10F9AA24677A92254934360E024920 MONSIEUR-R-MONDE
80,261,946 *088B3CB75BD2E201074C5C925AF8815725EF6702 mosecrittenden
80,261,947 *088F7791271949920D8DC59C6F30F318E30CBF76 leeftyd5
80,261,948 *0883EB9DBDCED624A527596A75FB7CADB14BEDC9 MOTORS.THISISHULL.CO.UKMOTORS
80,261,949 *0885A036094029F96EA4849BC3053A9E2F41A863 SPLOITO~O~Q=3
80,261,950 *088ED2D20CBA053F987CF270B34733069822E86E [email protected]
80,261,951 *0885EBF7A9DC43EED4AC10D914CEB8ADADEA7D62 THENBOGEY
80,261,952 *088C9E16BE2FDC6B2C2E63F8724603BD4E7ACC0B THE.PIPER'S.SON
80,261,953 *088057A159B0EE1E812CF7778B7381462F4D91CA SPRITZLINGS
80,261,954 *0883806B4C3D0815FD7BA52D6B3ABC3962FA8EEA THURMAN.GRANTO
80,261,955 *088370164CBDDD77368D666E44DC9173A4EBC487 SSOFUAR8
80,261,956 *0884832153C62285DE36D58497633F0307EB5F40 [email protected]
80,261,957 *088CC8F7EE7172A04DC95E714027623AED44522F ST4BLELIK
80,261,958 *0888C6F19D00751E7283475C1CAB956AD9710A23 STANDENONDERWIJS
80,261,959 *088588799BF701999E89866B96A8B6DEE2CBE83B STANESMORRIS
80,261,960 *088AA655C7EB6938252094A367C92A7352E15AD9 TÍMÁRANYAG
80,261,961 *088EEF5B5F7D3C87C1604CEA8E3EF7E702AAE38C STANLEY.LONIE
80,261,962 *088C69AAD5808BACC6AAF8A4B854212662838FE0 timelinePillOrangepng
80,261,963 *08818259F92A5DFCA32CE4F87470C4E346901FF7 tim-nesmith
80,261,964 *088DE715B888D11C75AABB60D88B72FF442C7BE9 STATIBUSING
80,261,965 *088C2A8F508685BD3B5352373EDD591B2F060DD6 STATIONÄÄRIFAASI
80,261,966 *0880E7434B36CBA40B51A786864304CEC0FB7528 MUTUALLY ASSURED DESTRUCTION
80,261,967 *0884B44B9359244EB725CAFA725D1B3EE9FC4277 steel vs. flesh
80,261,968 *08864B2AE1B526BABE9D83E53882694504FB3E79 TITLEOSTLER3
80,261,969 *0880F1E825ED13CED02F4F9214EF26D543C868C8 titubando
80,261,970 *08862AB433938C7752C5D3BC021555CE6BC56615 TNKSOMER
80,261,971 *0880D1A845301D9A895ADAB7E118FA4932766E66 [email protected]
80,261,972 *088341EC1CD58833F7F71CEE88EE818606DEE789 N^0[
80,261,973 *08890653D9FD9F5AB1AE2D45A490BDAFF6FFE590 stijfselwater0
80,261,974 *0881C739B2BD367263BA7BB903E2FFAC3EC05239 STÍLUSVÁLTOZÁS
80,261,975 *088CCFC6CC71D7BF7755B2C9D174C0D12B7EC86B LILIA-NAVA
80,261,976 *088E8F52DC18D5AC5BE3F11CFEFDE2C681BC0E00 tomdernier
80,261,977 *088A904784AC69C1861BFAC7916772BC32D0E22B limit.yourself
80,261,978 *088AE979E7BEB1D5620DE886DF61447D68101CD2 NANDINI06
80,261,979 *088485F57D7A1FF0E5219B555C9E4EA7553EA93D TOTOPOSTE7
80,261,980 *0886EC69B7A834DB82A89774C38969D6FD690053 l'incoronazione-di-poppea:-atto-iii,-scena-ii
80,261,981 *088D4D8D5760CBE2DAD0F15413ED7DB6AF60818B LINDSAYWORKINGER
80,261,982 *08852E05871CAA141DF40A9D63FECBF87AD8906A NATHAN.GUTIERREZ
80,261,983 *0883576C1F1C363A556432BA13DA26B23F1CA3F7 NATHANIELMIHAL
80,261,984 *0880C6F081313E871AB35ACE751FA9A2E36BE6DD LIN.TAN
80,261,985 *088B36950C7FD70E100B62AE1D1C1B6A66016EAA lippiness4
80,261,986 *088C77A5EC05D3CC2778C8BBB222E69A13AA4DCB traviskrovious
80,261,987 *088E1961F97907DA16EB8E0168997BB9E71A2931 n-de-chocolate
80,261,988 *088E8388744FB4D71DE2C325AF64EFC1EA0C8022 SUHAABDALLAH
80,261,989 *08876184A6E1DC938D945173890DC3F3D1AD7453 nearandfar,volume2
80,261,990 *08810A1BA1B8FA966643D5611CA70501F1AE7720 TRENTONTALL
80,261,991 *0886F8218F1CA6E8DFA942DDA0BC73115B148211 LIVIN' ON THE NILE
80,261,992 *0884940D3E8EB30492528CE4D435140EA0EB005F SUMMIT-SCUPPERS-HALLADAY-S-FIRST-TRIP-TO-TORONTO-AS-A-PHILLIE
80,261,993 *088D02AD66392B064BE74996BE415C10FEA911E6 sundaislandsnasa
80,261,994 *0885503A447E0204CFF8E1176D89525109589226 [email protected]
80,261,995 *088CE9DEF8B9430E6D25CE41842940F6C43451F0 [email protected]
80,261,996 *088AAB7D32EE37DCB864783921D02077948C759D TRINIDADSTUBBINS
80,261,997 *0884B9B54A173850582E2B4BB5409DE96CB62BC5 [email protected]
80,261,998 *0880006FA1B2D96322DB9AA87E751F29072AC6CC sup3rfc41+3s
80,261,999 *088866D8AA3F89F9EEC8BC1E724F9FC8EE3FF7BE Superoxide
80,262,000 *088A35BC064EF3A7F8ABF8252085CFD02B12305C lloydtacke
80,262,001 *08872EDA5651D13575C61C7E1A4A883B77450816 [email protected]
80,262,002 *088F42C727BC3C7F9150C927FFF2F968CEA17782 localidades.del.condado.de.washington.oreg
80,262,003 *08823ECCAE85FB23958FD30FC86431968A0B3DA8 LOFOTVÆRING
80,262,004 *088CB4CA0546D837397DAB4FC2D1C073DBC52415 TURTLEBUTCH6
80,262,005 *088F2108E60788C1B81BB6A0E748E67AAB22A226 SXX<
80,262,006 *088419C36E103B65C76A47A6CCC17C8AC6F6A163 SYNCOTYLEDONO7
80,262,007 *08833AD42526F5A78D4C17D37242BE4A71E81086 tyler-wenke
80,262,008 *088E45326A1457BEADCA485EFF2AF24117218F14 TYREEWEIMAR
80,262,009 *088CBF38E2DF545FA37ADC40B5092B03AE2DCDDD [email protected]
80,262,010 *08869D39D1F882A883E32916DAC6F3EE66179420 LORD HUNT & HIS MISSING FINKS
80,262,011 *088501BFFD24EA5F681622C64D32F421A3F40C6F lotises5
80,262,012 *088A703FDD649F2A09B95D0B83D66F15A7E16FC5 LOUISKROON
80,262,013 *08889D500974D63CE2792FD62703DD570E4AE078 UMANGDOM
80,262,014 *08865AB62DFF35D666692BCF2A3A4285082D90A0 TABLE-A
80,262,015 *088E9C782A5C3615172A57538EACBEF34950B870 TAIVALLETTAVANA
80,262,016 *088B2AE607828EA9F10053338D9CF1A0F00B4064 talk86140103111
80,262,017 *08846A2AB3E2DE69CFBA8515EF079E62FF43ABE2 luft612
80,262,018 *088888DE0390445CD439CA22F7C8AE90BC0C93B5 UNSTETIG9
80,262,019 *088412295F20E4FFBDA79215DFE78BB6B509C665 uploads
80,262,020 *0889325FAED4AA945EFF43567F7871E95CFD230D luvbug4503
80,262,021 *0880CF65922A3AB2D401A680FA3655D143252B99 LYMANSTEINMETZ
80,262,022 *0881B227C9D80A0CDC2FA4FDC63AF556FC61ABBF USE-DAISY
80,262,023 *08895868764ECD4E56BDA39AAA7324833577B030 USEITAKIN7
80,262,024 *088FE8781330F056D102E32733F859225253A7AA USER72.68.165.124USE
80,262,025 *0888AFE78AC2649496823D5D108DA9482A8F54E1 TARZANROBERT8
80,262,026 *088D68239FA5193EEFB6B5E671A8B3248830DB8F [email protected]
80,262,027 *088CCA73DC2FEE8132FC479775142BC92CC0CFF2 TATUYL
80,262,028 *088908FDB6217C380C37700B6D50E7F193A8FDA9 [email protected]
80,262,029 *0889996FFAB4D0306D846FEADADBB7C21734105B tejo.de.santib
80,262,030 *088D423FE7DF60C102FF6F01E7B2A0921DB90C15 TELBMOT5
80,262,031 *08819264FCE6C4E3BA692E1BC66976209231EF22 vastspijkerens
80,262,032 *0889997DC52D834F2AD4FEDE83AF441C8D24C7C5 VENKATNAGENDRA
80,262,033 *088EE4C14011997CDDB7F50749FFAA9C186C6023 MALCOLM.BURPO
80,262,034 *0882D816B419ECC97AB5308BFBA603C053CB6BB1 MALIKTURANSKY
80,262,035 *088E9C48FFD2B83839E257B2898AB30B9E496C93 MAĽOVANÍE
80,262,036 *088ABF470C9065E72812F33236F6E3940011EA60 THAD.SOSSAMAN
80,262,037 *0885CC7E9EBBA7B6D07B5DDF537DE0F74CEA0919 victim of the modern heart
80,262,038 *088561EB1EC8C70ECFCF0AAE7270F36F1D5FB5BB THCERDRO3
80,262,039 *0881A26FCA03FBD7B55026FA86B24150734ED077 theadministrator3
80,262,040 *0881CD88CF220F9235B3FD3FA44213F9875E2853 marcbenjamin
80,262,041 *08820BBE395577D56556BF6EFB08FA8686B57821 THE.MATHEMATICS.OF.DIVINITY
80,262,042 *0883C0FA142DC124E8FB35882D9D77FBCDA42BDF opbloei8
80,262,043 *08883636E4C523C7B255E57ECAE1CDFE8E950D8E VITOCHEMICED
80,262,044 *0887D2A8E2E3DF6AA1B7837EB967383184225523 (O_-) ~ ` (======Q
80,262,045 *088E7B2AD464C4DB975B3150C21E5B17FACAAC34 The.Pressure.Crew
80,262,046 *088CBE52BE91E80A91223AA480C489F46E6EB174 ORVILLE.ADERSON
80,262,047 *088761F73CC24B943C7A2CC3FE554B145A7DDDF1 VLA$X2LR{(H&
80,262,048 *088F3B190669198DAA03DAB9B748795B9FB2B832 VMEDIAARTSCENTRE
80,262,049 *088BA2DFF2E2B430302E69B8AD604B0C534C8858 V((O
80,262,050 *08845E0502333E1F461FED494AA605E185EC8E28 OTISBUCHITE
80,262,051 *08800817D6DB6189624F4F93DB622A7F0DFE3F6A [email protected]
80,262,052 *088BF07E8D5E865DEA883EE08F336DFF9208EC3B OUISQ
80,262,053 *088ADEED5D9A4B42B018E8BEDF191BE70BC0B889 THORNTON110
80,262,054 *0882B552C0856870A5498E717199E54A38029025 thuderstorms
80,262,055 *088969E358DC57EAD94F66F1E13274CB0FE3ECDB `TIAAA
80,262,056 *088CC2CD087C336E4C2F596363BCA0E0AAC0C7B5 timhartandfriends
80,262,057 *08899BEA72D744DCA678D3065F3EBD4DF29EF320 W129783
80,262,058 *088A8460E7BDFF5C2A258A3AD122C563CDE74C37 [email protected]
80,262,059 *088D739A629073021B097316225F5DB163641186 Melancholieke
80,262,060 *088E14CE324902753F4B45F9AF51C3908B79AC36 melissa.aseltine
80,262,061 *0886662FB7170498CACF892170619C79EC350EE3 wahlstedbsw
80,262,062 *088EA61C6347396C8295FFBD8C1C4C1471B33E95 waj.hashmi
80,262,063 *0880BF10FACE50AC96FAF49F5C5E5D8340E038F1 packerbutton
80,262,064 *08804D7E7226371628340FBEC65F0BE9C383C4A3 wallyfischman
80,262,065 *0886E21B6D70D9EBD66BF3DCE8BC8D842249D1CE PALMER.FELICETTI
80,262,066 *088648AE0BCCB59A91B38456447AEB3AC9E95D76 palmerlampshire
80,262,067 *08834C7956B856CFA37824D1D21BADC94D850181 warneralice
80,262,068 *0884C3D27D0466FEB3CF68D31B5EE68D6FD77680 TOKENES5
80,262,069 *088EE7F88772CC0D2BD9057D29B12E2FD6CDCFB0 PAPARIZOUTHA
80,262,070 *088B1D9B29551BE0EB219DD32F9D21C144C55D37 MICHAELMOG
80,262,071 *088BC314D7D9A52CEE93C3AC0FFC03C9E6A108CD MICHALE.VAZQUEZ
80,262,072 *0889F9F3E77BCF2FC505666AA4778E0E38DE36E6 TOUCAN
80,262,073 *08899ABBD3FD74CF391A4FA5836F458A4F683B09 TRACEYQUILIMACO
80,262,074 *0884C6958D66C9C477E5DD72D5CF1E7949686CBF WEEKCATAWBA
80,262,075 *088F341795188EA8234550FAB9E52056A9864158 MIGDALSWERY
80,262,076 *0887723D2A4B7E4D8565A6725C3B2BEFBEE7E131 MIGLEJU
80,262,077 *088D8201DC2F3B0B48FC062E0B4B044C5495D05D patbleakney
80,262,078 *088BD62463A76654093A8DE7E099A003DD236307 PATMACRAE
80,262,079 *08839137569A3CCA1B35BB652F7035D3D1D2356F patriciamanring
80,262,080 *088E059AD0526F1F2D78A89980950203094CA407 TRANS1T3RATON
80,262,081 *08821B2AA110E490BFB2873283396D7017EEE07F wendybabiarz
80,262,082 *0883A1944591ADF5093DFCE8A6FA6B4EDF98784E MILES.TALLANT
80,262,083 *088B5D046C12183AE9359DBF920E0E1BF7ECDF82 TREE.SURGEON
80,262,084 *0884E9F69BB8B1428F74017E533860763A71C7BD [email protected]
80,262,085 *0888EF62BDBDC06621966BB1EA55499220F56B9F p-d.~03b<-
80,262,086 *088B0802CBF0338EAAA6593C996DF74712A6C8E0 trinh-d-huynh
80,262,087 *0880C55308793D46EB8E3A72C8D517D2328608CF wesleyito
80,262,088 *088421EEDA9B32DD880312817E579B0A2EC418FC pemika
80,262,089 *08866DF65952E03B894B67E58A2021CC596D660B tristanbaccouche
80,262,090 *08882FF393DBE13E6C7819170C2717806C942474 TRIXIE: THEY USE MICE, DON'T THEY, FOR THINGS.
80,262,091 *0883EF1DE5FCB42F81B74EF30EAED790F8584517 WHERE.DO.WE.GO.WHEN.WE.ARE.AWAKE?
80,262,092 *088C128B306C69BFF0CBC1FF478BD8407689FB47 MIYUIM
80,262,093 *0885579965E87BEA9768B09838AEFEB1B3B52D14 [email protected]
80,262,094 *08831CC622000846F4FFB7F2314829C7DC9D815D TRVRPLL13
80,262,095 *0886CDDE89A13D8F0EC66714640314BEF04A6712 MODESTOMARCET
80,262,096 *0889F95922AEC1CEF07065A4BD5F7FD4EDC793C4 TSCHIPP1
80,262,097 *0888CF663668C9924E36FE9D76C0B3D64314AE13 MOLDY COVERED.WITH.PLANT.DISEASE
80,262,098 *08825B189FF400EDCD24C5AD26CFDE7F8AE507E4 molly's.french
80,262,099 *088ECB28EA193DB45357BB54DCC6BDA9130CC2E1 PHILLIPSTOY
80,262,100 *0883210EA1F314E781D826AC81A80C6B32630459 phongphila
80,262,101 *08859D96750740AB354A73BEA0E7ED6739BB2ECE WILFREDAPKIN
80,262,102 *088209DA791320A040BBB3CFF45B33DCB1BD406A PHREAKY-MF-(MIKE-DUNN'S-BLACK-BALL-MIXX)
80,262,103 *0882D3954D302EBCF504F2F2A5B8DF22F715C27F MORDICAM123
80,262,104 *088701CD91D99B6FFB25F65F666ED41F44306004 WILLIAMJAVAID
80,262,105 *088F744F69498314A7F9603755E43B9298337242 PIEROANDRE
80,262,106 *088B82B775E948D36531E96C3DFDC4F2FC9D5125 willives
80,262,107 *0887748097DA41D72A71776D6D7B71A7A21C8595 txrqynw11
80,262,108 *088B4641237858D980ED24F530A342346A150B8F mte2114
80,262,109 *0882CDCA68E280D832189D09B53F6236FDECE753 MUDHONEY:.ON.TOUR.NOW
80,262,110 *0885C34ED3831D80465B3DA0C539C392E53CD883 mudita-vohra
80,262,111 *088386CA0E3DEF308151E8124A1752313E56E939 PLAKBOEKBIJEENKOMST
80,262,112 *088E7221D751BFCCC11A5EF5E0232758A4DEC5B5 plastikkirurgiska
80,262,113 *08806ACF6C5CBB9842652D75641A78FC0087A9B9 WNSARERYFNTIGUINFFONBJAND
80,262,114 *088E5B348707FE76D0677D8BD8531AD682962E81 woodcouch467
80,262,115 *08852441A0B4F82546502315D72D2E957E1382F3 mumbaifocused
80,262,116 *088BD5D84284334BD2A042FDD8773709DE38978C [email protected]
80,262,117 *088E0681E421A0AE4B59175B7084AB2C4CA81A40 [email protected]
80,262,118 *0889B36C78F4E500668C8B896E52E6CF914807C2 WUSERYBBOR
80,262,119 *088216D10F270F1CA8AA76BDAE44AFC0BC76CA6E MV全記錄2DVD
80,262,120 *08813090386C12650F9A8A2ED2AA338EB3881AFE MYAMANDA88
80,262,121 *088AEC766047D6DDBE8E2B15D2F08265C9C0C6B7 PMORLEYING
80,262,122 *088330FB39288D4206E52F40FD7D51FCD7C83DD8 wwwpublishingtechnologycom
80,262,123 *088CEE8C7FD7B2E4FF8482FA5C006D78AF9D0463 wwwryanguttercom
80,262,124 *08845167A897E122A19E0903841794BD075A5FAA POKOOT
80,262,125 *088FCBD1407A236BDB31C2D191229B42376C848A WWWTVSHOWONNETCOM
80,262,126 *0888D36E2EBA158DD87AE035DC361A2774DB0439 pol)、フランスの代表的な女優
80,262,127 *088C3FEB87800ADBA74CC87D5D48D09E6ACB84A4 myripple1234
80,262,128 *0883E7F77E904DE7162D7F63368B964134DDE6E2 [email protected]#
80,262,129 *088BB6C64F095F9002ECA392EE9F7A1FDB24AA5C POSTSHAKESPE
80,262,130 *08845330660852786E8B75FA6B1FFC3C56FA6FB5 xito.cinematogr
80,262,131 *088E4D20FD955CD66060648D466F8A819CB7CCB2 XKZC
80,262,132 *088B5183B48D946B93D525FED4C4552DBDBED2E5 {x}~`q3
80,262,133 *088D53AAFFB6516C1736CF88F08A788E1F8CEC31 XU-YING-HUA
80,262,134 *08868257FE5E47180D01EBE55D1FFB9CAF9E9713 NASSER KHAJAVI
80,262,135 *088304BE65145E2401BC07C786557C5999C793FE XXXXCHERYL6
80,262,136 *0884C604967A6CC5AF14C70BE896C5F23C392BD1 natalie.mccallum
80,262,137 *088E2C152A68BA0A65C38E1F8C21B0974E7881DC natalyreyna
80,262,138 *0889DD3DB2436A8EC410B08135ED844BA21D3B6C NATASHA-GILLESPIE
80,262,139 *0883AF60F8DA0C1AC6525237DBC5B82E213B0BA2 ungshungmirungsung
80,262,140 *088E74B67742DF93B92C2D2E8B8449266E5BC795 Y8N?
80,262,141 *0880277297FF0750AA395C842D2A0AA4CFEDDF32 yannismarou
80,262,142 *0883B0CF3149A73CEC44D631444BFBDBD14E0CDD Unsere.goldenen.Hits
80,262,143 *08828D0617CB69E50AD7F6340129F1A0F7CA4D61 unylemz
80,262,144 *0886E6FA2B5D8DF8A0B2ACE59AB84738627D4438 uploads
80,262,145 *08859C746EA34F98275BF0D0D691DAEBE41EF34D YELLOWISHGOLEM9
80,262,146 *08802D7D34B525FBC2C74980F15D634BE7E655D8 yevonnejchilders
80,262,147 *0889C84DCFD5B6B1CDA4EE886A824D28CE926DE5 yidish-vokh
80,262,148 *0883FC892EB162A737981936F64C036433AE5653 neouvaria
80,262,149 *08855D8D8F4D1F78D1008C6C58BD7E95C5E797DF YRPASULFAR
80,262,150 *088CD0F76EEABA2B028AAA080ABBA72F946A164A YSTALLET
80,262,151 *08813991EEB32605E82A6CF7E8B87B3F3A44B8B7 utfolde
80,262,152 *088BFB0604B09E1808D9B94BB7BCCFDE7572ACEF UU*-*(=p
80,262,153 *088BBDA94277F650DB3A5667A563422E244146ED [email protected]
80,262,154 *088F13BBF1A423037CB437ECC13A93DB36BAC866 PROSVÍTAJÍ
80,262,155 *088163BEA45FAEC4C546DD935FB5AE3F48ADF3A4 N.GRUPO.MINAMI
80,262,156 *0885397522D634CDC5C8A53832752E5799BF4FE7 NGVBIO
80,262,157 *0888BFC1817D515C62CEC87CACC1591D5159F4B8 PSEUDOPHILANTHROPIC.
80,262,158 *0886A79171ABEC2CA541BD80659A8B006387FA3D Z191565
80,262,159 *088B47B9A795B9F5612BEE650AB2247E6E48AFE9 PTDSTEAUA1234
80,262,160 *0880622C8ECE487272A28FB947EE48963E35C936 V145760
80,262,161 *088EF9C2859F8BD1476D30D3642F5EDEE5A5B676 NIKNIH{V
80,262,162 *088E85DB87F7CC44AA378C73B10DCCBD4DA23B77 vaffelion-yubunk
80,262,163 *0884995DE8BED095B118E4A8E7ECE3006B07B664 VAISHALITIWADE
80,262,164 *0888243694C450A8A12229FB5B09D3D2A27970A6 NLRUFFEYSURSEILLE
80,262,165 *088267C2B7AAE028CF18F8C141D7B917D2116AFD [email protected]
80,262,166 *088DBBBB4326A6195BCCF105127F2A80C3A85E68 NNJRRSMING
80,262,167 *088B334FD212912553234EF402F5A4A28BC25665 PUUHKIOSSA
80,262,168 *0880EDA23304F22E0A9DF4CDF41A8E600D9F736D VANMEN
80,262,169 *088884F56A26D139657E7982807B30D19BB5ABF2 P=Y"
80,262,170 *088F16BBD239524BF39EB1E00A67710164CB832D q####@*.>-<
80,262,171 *088ADBEE308113F56B34FF6A978848354B7962A9 QAZWSX7555
80,262,172 *0880BF3653DF63F3A8BF147FD129CA441ACEEEA2 VAUGHNSOUVANNASAP
80,262,173 *0887B220B97BD7249DB3EFB10D81D96B0C7634F6 VAUGHNTY
80,262,174 *088EFFA02A3FAC7A6A49C602744E5B6964EB6AF7 ZMODERNIZUJĄ
80,262,175 *08880B706867B26436D06216AE59FFBEEC673161 NONSTIPENDIARY
80,262,176 *088FAB5EE63D4365AFD0F53F51B257DBBF15E02D VENUSFOOL4
80,262,177 *08852B065B363D25A7936D3B2B4C12F35FF358AD VEREFYDS
80,262,178 *088A36BECF5C3298F08E534E368FD05E042950C1 VERNON.ATON
80,262,179 *0880D351853D24A91A8C8FF3470F9E4B59F42AC2 ZZPGK6UH
80,262,180 *0881D67FF3A487A86EFB772ACAAF99CE55F06889 qUi
80,262,181 *088A1792DC8A15C376E662A0F53DDB1A5594AE49 vesilaht
80,262,182 *088CD2B97A554F0577A600650E574E4F38DDDFE9 VG&AA
80,262,183 *0887904B26448C529AF62E0A165AFEDCD9069ACD ,QUIVA-L
80,262,184 *0881977CD44E14C1C5F1F5E1FF05149635E006BA ΝΕΥΡΩΤΙΚΕΣ
80,262,185 *0889259E511B3637632A952E7E7032FCC0462944 R3M15TUR4V45
80,262,186 *088A09BDEEA8C6B9D2822A6A328F77E80D7424C0 атрейдеси
80,262,187 *08844357BC443C5854569E89C08DA25CE5FB602E VICKIHENDERBY
80,262,188 *088EF1B3C89236C762400B586F3557AEED35A0BB VICTORGERRARD
80,262,189 *0880BE706FD17D98AB22694C308AF2D4806BD122 VIDEITO2
80,262,190 *08884E6FD2D06300E5E6CA9F90350B655AD91E7A ИЗДРЕБНЯНАТА
80,262,191 *0887CFC92D9CFA5C4E46BD05A9BAF12947F7B3AB VIGENBSW3
80,262,192 *0889E29EFF1B305B2715EED035D6BDC12EEFB0F3 rafter45
80,262,193 *08818843EBF5DB88CE5A19FCBB57D9EC6AC38E8D OBLASTCOUNCIL
80,262,194 *0884D993227402CD322095D59F5A93701FFF20FE OCAMPO"
80,262,195 *0886B1ED5842B466985B3786422E18F82FC6A78F vince-canega
80,262,196 *088AD31F1ACD3EC5D355E981FEAC2A1D2708A66C ОБРСПП
80,262,197 *0885753B31129DB0A3E4F57CB9A27BB2D14F37EB ОКВИРОМ
80,262,198 *088091BFA7DEDFEAB2AF483889B8E9330B026DCF RAMONISH
80,262,199 *088A06A8BE16B21CF00D1948F5F3C01A95CB22CC randalbreyers
80,262,200 *0888EC85D764D8BA3C7539298034E88F5D7B8B12 vinny.sebastian
80,262,201 *08828505DFF11B843C1A7035F5B922DBE186D9CB VINOD.RAPHAEL.ARANHA
80,262,202 *088C33F565CA2B076D3835082A26B639E49D95C7 RANDALLKOZLOVSKY
80,262,203 *0888A0E0A08BC2D865277F05F18F79733CE2CD4C RANDALLMCCAHAN
80,262,204 *088C04D92F44A213129EE2B5CBFBE90FE8CE7C0A ПРОГОВОРИЛАСЬ»
80,262,205 *088B85E63F0D5A9CFDE08D4BA754D6F7401126B3 Of-the-whole-body.-The-belly-answer'd--
80,262,206 *08819ED4CB005763C9D11897B9ACA211D782A801 VIOLET.MCCOY
80,262,207 *088A4C9B73F25996E82D8DDD45D7272A1FB0515D VIPERWOLVES
80,262,208 *088C8958A1E49F4678FD6BD57CA61FE72D3AC5A1 РУЧЬЁВСКОЕ
80,262,209 *088590B7C9A035BD4FA417DB1F5EF0E91EBCB30C @rangoon
80,262,210 *0884E925EF0CD7A57F669700E81D04A24C3FB6E9 OLIVERPRESTWICH
80,262,211 *0882C4F5F8A85E8EEFC41D6742AA97D781A1B306 VIVIANATORAL
80,262,212 *088FAE33DB0C8E1643A1EA13F4B16BE71CCE2AE6 raymondzygmont
80,262,213 *08840679EA944A130AA3A488B1BCF4E3347B497A R_C#
80,262,214 *088A4A02901C33CC5A799D738683D7803F404541 VOLVOJIM1
80,262,215 *08806BE1F965DAD4A6B383957D727077653A094B VULG4RE5T
80,262,216 *088B8D5D5B949DAF9673FF019A5D191F67650F28 OSCARMORNINGSTAR
80,262,217 *08807FFEAB8F3C774E646B0F9BD0C360BAE46207 W0HD
80,262,218 *088E5E2051096B413285254ECF0D9627C69E346D OWOKUSI9
80,262,219 *08843BC27FB05B986E96D44DF679A471168A489A P----->-~0-~O-SPLAT
80,262,220 *088CDF1A8DA4532140A1FEB0160A34A048F0E4E0 PAGESMANY
80,262,221 *0882CB7C14FC6D3CB16FA9D8DB9F13A15B633E95 WARRENAAS
80,262,222 *0884F5A5EE3A386A233E51AA545851E00BEA4C02 WARUNGFASHION.WITRI
80,262,223 *088EF8F490D915AEE3C543A080A2C6E3B9BFE603 palmerabernethy
80,262,224 *088E691A3B6EFB894EAFCBA66370D82BE1353FBE 02261836
80,262,225 *0883EDEA95513C5DBE73AD51D14A55DF76BE111D par+sans
80,262,226 *08868606D8327287A8FD936361E4D60C2EFB133D [email protected]
80,262,227 *08880698818DA275EE6D78944201CB4B656123FE [email protected]
80,262,228 *088C79891BF133DF2510B5DD91EDD4C46CB07EBF 08194T0R1Y
80,262,229 *0887EFF57066D6E772A3489FBCEBECDC4A2AB4C2 [email protected]
80,262,230 *0887A504478F03583FBEA510DF8D8889E818B33C pathétiquement
80,262,231 *0882AB9BA9669E69CF96C646BAF52B49C89EAF04 10271870
80,262,232 *088C1AA6EC9AD60A71D99A87AFC80B8F3BE28BEF PEKAREVSKI
80,262,233 *08825DAABCED8637E28E70C060A8EF8E28DD00B1 PELTOJENPOIKKIP
80,262,234 *088963ADBBDE5EB40924848029EEDF6259D6E0CC richieabrial
80,262,235 *088407B10B283E60F71DF7B0EDF62846F5F2430F PERILUNE
80,262,236 *088643F08142A3ECFC529107DC4E7362C9AB9CFC [email protected]
80,262,237 *088B68C3804468AD0A993AD15E253966DD0EF511 WILL-HENESY
80,262,238 *0883B71EBFC3C5F6EA9C0E7F44AED89DC909A88D PHOENICOCHROITE
80,262,239 *08812CD6744C744F6B3DA7022FDECD7B372DA78F phrenosplenic1
80,262,240 *088C0148C35F44A4998D7E45A6CA15DC7F7D8FA1 WILLISBROGNA
80,262,241 *08874BB0F2E02AA67074A8718E43B7A8B2E76BAD willwheatly
80,262,242 *0887EE89596C8334025755670A46FA6326D51FEB roarbeberoar
80,262,243 *088D3029D23A13B7ADE003B35C8A4017889DBD87 WILTON-HAYES
80,262,244 *088BD1797070BB89FACAD16C9EF0C1B1F35B8A55 WINA.HADY
80,262,245 *0880647FE4BA197B077E66D841876AE0DAD06D1B 1895057 vai-pit
80,262,246 *088CD69ED8333A29DC54785D0BE8FBF0CAB1881A ROBERTOCUTSHAW
80,262,247 *08839AB699B8C3329481826EF2890413AC7A386B 18vivian
80,262,248 *08883D0ECFCCBE1C2EBE12C5D6963CDC83CC0390 WISDOM.GODSON
80,262,249 *08804FA7AE0B700492892ADDEE270B8FFE1DA4D8 1.abuhanfamoschee
80,262,250 *08881C870784E8508263ADD73E4DDF50A9A327B6 POGGENSTRAßE
80,262,251 *088C50EEE6F6190B6131AB8FE1BAA4C04DDB4629 POJEDYCZNO
80,262,252 *0883F1887643C098DB5B3D34428335240DDEE2D4 [email protected]
80,262,253 *08838B227C9915F52C5F33CDB3190C2F3FAFA6FE 1.AUTOMAATTITRUKKILIIKETOIMINNAN
80,262,254 *08804FEF9ACF87164BC44216106293924A63A248 1 BARRATTSIN
80,262,255 *0883CECBB4986E66BE60B5608D3132E6CE03CAED WROSSLE
80,262,256 *088AB3B51C933AE7394EC64BAA20D1895FB659B0 1 DEUTSCH-ROCK-STUECKEN
80,262,257 *0887C524C89A9DF99C7352EC97DA8E44703D237C ww<f
80,262,258 *08801F22BAEC163371736BCAC858CB9280FE2BFB 1.FIATVERTRIEBSFIRMA
80,262,259 *0886A1B530A1FAB87EA2808484B8791128309CE5 rose-dukes
80,262,260 *088BB2243A2834D0AC115FA8DCD37D90C9D85509 WWW.CYLINDERSERVICES.NET
80,262,261 *0884B248D067BC7342CB7BF313E4BC41377A3E42 1 JOHANNESYRTIKSI
80,262,262 *0880D5586D92B9E00D0479ECA181F62D9DD00EEA wynn-naing-tun
80,262,263 *088AD426F43783BD26DD7256E23596441B10A406 1KETCHANN
80,262,264 *08815183EA447516FAF84E4E0A1228BE369DB9A1 ROXANACAZING
80,262,265 *088B37A39AE3877F0E1F272C4876B449571E159B 1 KRIMI-ELEMENTEN
80,262,266 *0884BA7DB0D1687437B954E7EE0EEAC07E6531B6 1LILPHUKUP9
80,262,267 *088BE6592717A7703D4A61333F567A8DC43C8BC8 1LOIETTE
80,262,268 *088F16A066F0DB4830292558281EDA9DC6351A6E 1.lougee's
80,262,269 *088D8B89733ECACD8960DA81C3EC252BADBC4A2A presuedd1
80,262,270 *08875791F6B4D4A4F5F8553B956AD1F6E5719E66 1MITREISSENDSTEN
80,262,271 *0886D2534BEF6A20A66BDF5283F63DB859B79283 [email protected]
80,262,272 *0888D06145600C31F83F8492D510D5A0B6D61B58 [email protected]
80,262,273 *088D6F861648C4F4D78CBA0B7D59E6EAC9200130 PROCEDEVO0
80,262,274 *088F903EEA830FDF5EF76FA7BC345ACED4E0952D rudolfbaune
80,262,275 *0883EE19A8F19FC847368A5FF8F69C76A8064F9F RUDZIENKU
80,262,276 *088343A4ADE63EB53E6B770EBA4CA043CFB79BEE ruebenbritcher
80,262,277 *0887611566F8E44C122EA25771F0B90358279845 PRUZ3K
80,262,278 *088FE11707EBE192B32EDC0C55118EA6354488F9 RUMOR-AN-AMERICAN-WEREWOLF-IN-LONDON-BEING-REMADE
80,262,279 *0885944AC258675AC04A4749A876728BF9C13769 [email protected]
80,262,280 *088D0A6178A97109EC087EFCD7C7D9C8DC434071 [email protected]
80,262,281 *0884D25B269AAD2F4BF9FE3C7DA92A498BC213E4 xumaoye
80,262,282 *08885425DB9F36A67EB822B9192CBCB7B8A43923 ryksgsf0
80,262,283 *0885E560D6A2AA644D71C3FB18C15A6047FA72DB RZUPAAAAIBAJ
80,262,284 *088996927C92EDBE6889705DAE665CB4CEAAF1AD sable.night
80,262,285 *0885AE5A7BAEDB4685DBA8ADC823F43A803A678E SADE’DIR
80,262,286 *088DFA416057C619EE4166953C0B82A97BFCDE61 1-RUSSENFUEHRERS
80,262,287 *0889716E9229CB868A7363246DA39FF2E2A76033 QOQPQZQM
80,262,288 *0882A222158AEDAB05BFE87CA5003698CDB2C467 YASMINE TRENDY STYLING
80,262,289 *0884BC5B23B72B09918D229BF6F4CA1C16ACC879 salah.rasslan
80,262,290 *088F0C1F901D81F45D8C461BC9090E17509F2F91 SALVADOR.FULLEN
80,262,291 *08899EE54A039AF0ED043E319117EE44383AE300 1tirralan
80,262,292 *088BFE2624BA3E36F7802D37D6FDCA94C8016AF2 1 tombekinin
80,262,293 *0881861AED39DBB9CCDC2ACDE2E70C7EB4B22E66 samantha-jayne-williams
80,262,294 *088334A00054CA1CE12297E6BFAF312244CB3F8D 1 TUOTEKEHITTELYTARKOITUKSIIN
80,262,295 *0889996E429F5CB8AE4F7FC88B76A74E0E35B3A8 SAMMAMISH-1-0
80,262,296 *0889D104EB1768C4437DC0DDCCBD5D1B367D6659 1UNHCR-VERSORGUNGSKONVOI
80,262,297 *0885E4E5F2B016B88FB2644A2D01F46E1253494E 1UPETUNIA
80,262,298 *08840698E9ACBA99AD4766453E8685AD8468BFBA YJXBFILDQEULJK
80,262,299 *0886220AEADCF621168E193316C9B0CBECC8DD7F 1V0N1QU3
80,262,300 *088CA1C5CF9457348C3F5DB6BF10C3FA0F0C71FE QUINDICI
80,262,301 *08860BB393A1D66479BEB8D7FE6C1B3930804D8E samueltippins
80,262,302 *0881630BCECD986C9F00F67B5CDA7C206BCCFA98 ylivoimainen
80,262,303 *0882CE654A1F902F003A499BFB8DDE4E7B283AE5 1-VIERRADFAHRZEUGE
80,262,304 *0887F4CC24B4735565792930E35C09E099699B51 YMBQMOQ3
80,262,305 *08844CB60A98B6D7FE2241ABE784AF25D3FD17B0 [email protected]
80,262,306 *08810393EE940E6B980DDC25E2ABD5A54D575594 R3910$$1N9
80,262,307 *088111CEAAAC2093EEE150260A36A867F3353066 r3doche3s3
80,262,308 *088B20D124FE6EF59E3C7930A3E4C73508C09BD7 R3M01D
80,262,309 *088FC6FF3DE203973B97BE38DA2A60029354D224 r3m1++4l5
80,262,310 *08836645F90FFDCF8149145EE7F1CE987FF1922D r];aaa
80,262,311 *0885A1318FB92FFA46ABA1DB8EBDDD1DB013DB9A rachel-esposito
80,262,312 *0880347B79E365025D6C592917F9F670B5DAE928 youngschank
80,262,313 *08811324A86A0388F6AC1BDA8A7B81EFA0683007 You.Seem.To.Know
80,262,314 *088FE78C41412C566BB08BE58CB291E501853DCF 213921 kitap hakkindaki toplatilma karari da kaldirildi
80,262,315 *0885531AD0459C50C835C767867DE7849014A362 [email protected]
80,262,316 *0889E6ADD88699B5572973072E74C9B837A68CFE 2300371 NYT KUN LAITTEITA ON K
80,262,317 *088849860C7A2DD5C3A7B93701BEEA1EFAB986D8 RALLECIDEP
80,262,318 *08879681B54F54D9E3C982286D5BF9F2B530FBD8 2402147 SUPERFICIALLY.,.THE.FIGURES.ARE.STARTLING..
80,262,319 *08808AE7EFBAF8E23D00EA8D361D74AB5ACCE7A9 RASPIS8
80,262,320 *088AC06CD7214CA05D18EE968CC4B1E8118BDAD0 zachariahstjacques
80,262,321 *0881F33BE19DB790A0C52DA867DD8D2DB7B6D9C0 scotcoache
80,262,322 *0886DE4F64B163B50008A5BA1569629A2ED782AE zaid-dabobi
80,262,323 *088469B25AA7F8D88ACC087A94E8D23A8D576B35 seankofron
80,262,324 *088B59DCDA45E82EFA113495D9398819D0A08C76 SEANWACASTER
80,262,325 *08807A85EAE69FCCA75DCD1A0E7C34F6DD2B3604 ZAMINOVANI4
80,262,326 *088866F9EBFDCE155B5CAF2822263ADE03DD9076 2760163 IHANAA TULEVAISUUTTA OVAT MY
80,262,327 *088D57D834F4AA0C8BC6A8DE4F09FBB02254CCC0 zenbon-llanillo
80,262,328 *08819037784419189938E96534DF8930F349B0D7 refrescoannualreportlet
80,262,329 *088659A11D127AF98D97871C6655F89A7C2F5EF4 REHACEKBSW4
80,262,330 *088D0DEA8A2C73972045A437D2C1A6E7500289EC REID.SHADWELL
80,262,331 *088988A33310B62D20FCDA45AEE11A1191696BCB SERCEPAN4
80,262,332 *0888015DE372637479AF9D52C98D6C749BE82DBC [email protected]
80,262,333 *088CCE07AE80D0F045751642EA295761A006E7F5 sermgamon1989
80,262,334 *088443951026622EF0B00387A811D502FE0B8413 REMMARGORPREGURB4
80,262,335 *088260E94F8F457D2E3D6569CA1BF6DC4FF15BC4 [email protected]
80,262,336 *08858770EFA5CFBC4A6C9A85A5E2D287C0279B8A ZHR1
80,262,337 *0889B929E6AD21086E276BADD396D4BF8671C2CB RENATOMARVEL
80,262,338 *0888569E2FBAA69CF261858A63930EFE0B504857 [email protected]
80,262,339 *08870E5B27D2036716E403262D73AFC7A0E3332F ZHUPENGJI
80,262,340 *0888AAB5A70306EA9BE3E2210612677F40673AFB rensecremernes
80,262,341 *088D58414EE5E94383818099502B61E9ED56354D zoedy.askin
80,262,342 *088B57CCC548ED20A591F03C13C03E391EF25E0D REPPIRGA2
80,262,343 *088940D60BD8758DC040ED2221827DD38FBF4197 RESEARCHCHRISTOP9
80,262,344 *0885AFEE650BA6BED89AF20252A4AEE52A61CD26 servici
80,262,345 *088E7074BFCEF89ABC0C152981DD51AAD92A38EB ZULFA.SAFFODIEN
80,262,346 *08838CF860671B913692A766A197BEE9520C332D sgranato
80,262,347 *088C2F14CD6160F33BA5F5F2BE0BA63965EA39DE SHANE.FLEETWOOD
80,262,348 *08857ADD7F536C9F14FB8D6EB661D35ADB16BAD8 reyeshuter
80,262,349 *0884C40414326CDD67EDD6A7F8A8E10D18756A91 30october1979
80,262,350 *088AB9CDF598042AAF210145B81CF37522F1A9E9 RGEBLAAT6
80,262,351 *0885191D024F6F792BF9B4F64D65F8E81453DB8B SHARONCOWBOYS3
80,262,352 *0885AB2D15BC61BD857BB6E8ADE5145472377EA9 RHEINWEINPOLKA
80,262,353 *0889C64F75102FAA6B80A99E0E9A93727B09A71A ΠΙΠΙΛΉΣ
80,262,354 *08839E2823396C8AB65281A83EC3560895C5047E 3B< `D8
80,262,355 *088802AF4A8955464327D7619BC275F20BA5392D 3.BIRLESTIREBILMEK
80,262,356 *088738F3B593DA6AC5FBBFE4F927EDAE3BAA705A RICERCATI9
80,262,357 *0888B11A0230234DBA1BF5EC69CC85437552CA01 анталовський
80,262,358 *088D2CAAE638E28F26A5107E648206F725B90FD9 sheldonmiyazaki
80,262,359 *08831635EDB7CA39937CB9730613767C59391F23 rick.mars
80,262,360 *088F9769A3BF745CF68049F83E72410285F5B7B7 [email protected]
80,262,361 *08820DECA4BFC74707F957EAABDC2054B03AE794 sherry-bowens
80,262,362 *08884495927C1BD074499EFD72C9F545876BB599 shewers
80,262,363 *088106604F902AC9DB98AB9284A79690870ED7BE 3(<P
80,262,364 *08806070B82E042FEA35380F9D9B6606DCDC7D33 3PHYSSUN
80,262,365 *088978B13FBC0C5CC3F201BB8FE2AAF34C84158C SHONBULLERS
80,262,366 *088951C91E24E75520CF54506F0205A6096FB219 3SKALWEIT
80,262,367 *08883E58F2CB90EFE4CEFA4AB5C0F7A09FCC7E61 3SPONDYLOPATHY
80,262,368 *0889BABBC150BCF0BF8223A908AB75D612A3E653 [email protected]
80,262,369 *08828F946FA4A7928DE589AA44A1A3D78C0AD528 [email protected]
80,262,370 *0888D469009B02259FB33F2804C61B848B6D9B5A sichtwinkeln
80,262,371 *08809764C734D4EF82592D64521782843DB63107 МÆНБÆЛ
80,262,372 *088B3CC5756EC296E8811063A70079B32BD7C339 40H1RSJJ
80,262,373 *08815B0C395EA325BAE16E94BC28169B80AE54B9 миссурипе
80,262,374 *088348163930679C3285DB76E47B82493BCB82EA МОРЛЕ —
80,262,375 *0889D7016B720D6087CC21D244208666908F703D 475EMILIA
80,262,376 *088C44BC4DCC006CF3CDD65CFE1C5A0D8259FFBC SIJEVAJU2
80,262,377 *08861A0D1559D18FD4DD8CBA88F0D4010499F746 SILAS631
80,262,378 *088873C3A7E132FAB89C04DD17F30E34B07049AC 4ARTVERWANDTE
80,262,379 *088259101FC4A3CAFDB339AC4F590DE42B4345BD rodneyoshey
80,262,380 *088192751DCB6138181D5829F76F70E9C9EBA035 RODOAKESON
80,262,381 *0885A53D95FF4D85F55DEC272147D43777893613 ПРЕГЪРБЕХ
80,262,382 *0886DC8D6CB5065BF15B6B1AC5C1B24658E95C2E RODOLFO.PIACITELLI
80,262,383 *088882524E231E535AC89807129D03FADB146669 RODOLFOVALENCIANA
80,262,384 *088FBEF9D6EB8B6B32FB7A3DD8BA22A4109D4F06 4EINFACHER
80,262,385 *0884B7B978061A7346EF496E89CDE7ECD44AC85C sintelsrl|italy
80,262,386 *08853BE0957CBB630BD2D64D3AA86336FEC1790E [email protected]
80,262,387 *088E8FF7DA6EC500282BFB7973A06BF1C9450548 ROLF.WITCRAFT
80,262,388 *0885120621F68BCCB41EDBF0CD4AC02968DD8F68 rollandfavian
80,262,389 *088505738D8C1D840497A29BB9D9B5C7C5A21E1D [email protected]+N9S
80,262,390 *0882D7750034B0ACA4452A875F005290980C34C6 «ФРОНТОВ»
80,262,391 *088C57345FC788AF9237FA584C27085AEA0B9851 SLAMNICI
80,262,392 *088481CA26C4FA3BE41CF7211A826CB48648894B 4MENTECAPTA
80,262,393 *08823D2AF8B19FE9A08F42A9A71682A250BB19C9 SLEEPYHEAD.2
80,262,394 *08817B1628E46C4D891AA996AC50FC32B8F506B3 «ЭСТЕТИЧНЫЙ
80,262,395 *088D25CDA6F52C7CD34B863A2F29EEDBE0142FEB sletrab2
80,262,396 *088B27C1EA1CDC2ECD409DB1D93FBAC99A03C5CB 4NORDEUROPISKE
80,262,397 *088B1BFD1067F8D986D4DC1C2A81E56071D25F4A 4PENDELNDER
80,262,398 *0882F6D0E83F1B811B26CD6AB3DBFDF3EAD901A9 4POJMOVNIMA
80,262,399 *0888D464FF21E972A3DA5F882913AF19FC893A00 roscoemillick
80,262,400 *08871017C470235CB5D9DCC282A3403BE51BA219 4$+rn9ed
80,262,401 *088AE295D39A02141BC87A36F5D0B68BEBF4F4A8 [email protected]
80,262,402 *0880BA04023AD64CE0EF8933AFA0B1FE69777050 4TUPELOW
80,262,403 *088EDE6565460F8B4A3A43E6E95323A2A081AD54 4U5CULT4RLH45
80,262,404 *0887C2E9A6DAD9006666AB929A48D9580CA88244 5986C33F24A7CE7B681BE0090C6DF573-MODERNFORUMS
80,262,405 *08898893E597216E324DBAE47B109975CEB1E9ED RUDISAILEFLINT
80,262,406 *088A5EB3D710DC6AB6796FD9AA149173662A0784 5AEQWQIQRD
80,262,407 *0889C8D01985B637C3A9F3537B6E4A816D7E5B32 5an70nin5
80,262,408 *088620E83BBF0D985ABF748E9CD885A2A5DF6138 RUDOLF.QUIVERS
80,262,409 *08885F969EF9CB39EBBB0BF6D08D4C988CFFA102 5b3a746f068839a8a277bda728eb27fd
80,262,410 *0882F7BC2F3B581F9BBC666B08CEB9C335752E7B SNEIMHY2
80,262,411 *08864EF2E7A438E5F25F7A05591712E510F661F7 RUMOREGGIAVANOS
80,262,412 *088AE177E00FBB6682B35A0C5EE571DBADF6C9F3 5CAMOUFLAIS
80,262,413 *0887CD3B4B571095521005870647A14B9C12C854 RUSSEL.GORDEN
80,262,414 *088E668BBD09A8FE9ADE1DE89DF002BD3A52B9E3 solhartage
80,262,415 *08817B39959B3B69DA93FF127CD5BCB9B8921C93 SOLMUKAI
80,262,416 *08814B3832557C326ED62D6F93919AD995854700 RYAN.MCMANAWAY
80,262,417 *088F030DBCBED6436ACD9DCA37E16864C7D79EDA SONIA-CACCIOTTI
80,262,418 *088B26DD322BBA89B28528DCA7CAD82E10B33C3D sonic4t3
80,262,419 *088664F71734B5A00FF9C3A9AAC93942B0CFEBD0 SALT.LICK
80,262,420 *0886B60BF0834ADA10C44B4AED84AC9BA8E7292B [email protected]
80,262,421 *088FA70ABFB8D63C4782C54332CC9ABD3895FF62 samira-thomas
80,262,422 *088172CB703EDAC131F00D3D835AA923740DF061 5POLLAPLASIAZEI
80,262,423 *0881EC6972C1A2CE20179A506039D01F18CA79AB SAMMYRYEN
80,262,424 *088A34F457971FB05E689ECFEF7F179F6C0ED145 samualstebbins
80,262,425 *0886F4371AC262931D0053DD1130452310124F94 SAMUEL.OJEDA
80,262,426 *088888D09DA80D63ECA04CF85ABD520A99C819F9 SANGDOO2525
80,262,427 *088AB5FC3111961AA3474A0A7C990B605F649E29 SANTOS.BRUNDIN
80,262,428 *0881B4B042A63E7F2D8ECF8D7B9BA27F3BDB399E SANU.JOSHI
80,262,429 *0884D056A2D79D601646C11703D81C464996FAA7 sarapulskoye
80,262,430 *0883D1A892A3EE178F4FCC24865272348E0407FD 612mallory
80,262,431 *08868D7DA8D5FE15350C51125407FB150A2F765E [email protected]
80,262,432 *088265ACD914E15F026BCEC8F86FD03235E0899F SAWSET
80,262,433 *088BAECBC24F5ED61ECDFB629114E5666D0F00E6 SPRITEMARTY
80,262,434 *08850A8A62A3A5279271D51F6F2E7B9E38E8181B srinivas
80,262,435 *088223F9350666AB77C6834A2ED96A7B70B6B49B 6GLUTIRY
80,262,436 *0887F3E207AAAB89D89AF0E394CFCFD2167C24A9 stachurę
80,262,437 *0885E23343EC2BFCE56195C9A7E1F07C338A8233 SCOURBIED
80,262,438 *088F4C62D0C4DD98F68BFB24CDA666BDCF268D6C segundo-acto:-"guerrieri...-ah-del-tebro-al-gioco-indegno..."
80,262,439 *0883ABA1BDF891772FEB8A0168DDD0268FD305FD senusian7
80,262,440 *08831D1334EF3E2A60DBE7C3B99EC5608CBD9615 [email protected]
80,262,441 *088B9DD43BC77E43333F8FDA265AB143611A4EAF STRATHGLASS2
80,262,442 *088995583BEC3FFF00FEDC150E73E1FAB954874F SETH.KRAUSKOPF
80,262,443 *088D6238149B4836ABDF21B740F9221BD86B8CB4 6YELLOWSEEDS
80,262,444 *088A42D2AC11D822E612E49DED8B63977D2C2AE6 STROEMSDALIN
80,262,445 *0887E2B90067B12A554BE5BC2A9416D965B7BB03 STUART.PARZIALE
80,262,446 *088873AA157CE52906D5B3F11B0AC9E21B0196C7 725JAIR
80,262,447 *0887C1FA8FA336B3FF309FCBC47BC15B6E068E48 SEYMOUR.DILLAVOU
80,262,448 *0888F1005D79598AA20D3963A4604007EBF3C878 SUBTRIQUETROU2
80,262,449 *0885CB9B5D750DB67B8A2623901AED0765D1077A SUBZERO1337
80,262,450 *088BD194EC42708FF11884A1CCCA0AE144B7F12C SUCEMONBEAT(SANSREMISSIONMANNIXLARGEMIXX)
80,262,451 *08817D059BC1D781DB1DD7D57AC3158CBBD2F55B SULKENUT9
80,262,452 *0883981FF88FBC603D06A5BC3C6B632192D8B60E 7BSWFACIMILE
80,262,453 *0888DE694789510414A8AFE7CDBBDDCEBED341FA sundaresvarar
80,262,454 *0885EA6FFF4EE69E0F18A0D00922276DFF64BC8B SUOPYLOP6
80,262,455 *088A79192B275AD1F2DE7F330B36851A8A6CFB71 7ENTSICHERST
80,262,456 *0880F6EF76DAB2E3AD6DA3838FA16F9EAEAADE7C 7FRANCETIGGER
80,262,457 *08887F1BB3EE46CED1B050362EDADD440C0D7411 7KATHERINANGUS
80,262,458 *088B4E4F3EB80F382C25FB654E9063EF493F301D SUZIEQ1
80,262,459 *088136515FD87C657B3193275F4EB7273A53FA7B 7SELFINVOLUTI
80,262,460 *088FE075A99DAC1F3807EA3AB361CF5F99A8EC4F SZNNRTST
80,262,461 *088D034AF55367AF7BFC72FA118569F23F786769 [email protected]$T$
80,262,462 *088E31AEB03E49BECCB701D6BE7F6C1D89B72AA3 TAGH-E-BOSTAN
80,262,463 *088D9843AFCED87338DC99D55380805F8F857FB3 8--)~0-~OSPLAT!
80,262,464 *088B4C23740C5005872C7E0432E6A19867B6E517 868659 opetan 5-6 luokkaa jossa 16 oppilasta
80,262,465 *0884DF301B3B807B3B50A0D38023A33BDEA298E1 8apr1191
80,262,466 *08873A5BF006C7071FC17649459958C06B1FC91A 8iluvguitar12
80,262,467 *0887FB8E5B9422670D54318936F31E88DB786479 SIRIUSBIZNESS
80,262,468 *0889E5F24D9048B54F126AB38CA4716E36713A91 SIUBHANA0
80,262,469 *0886B95D687ACEF80E7FD3130CF61386DC48FEA7 SKJTELB0
80,262,470 *0888179B643633775258CF4CF8F600BA22108D1E 8PIZZAEAGLES
80,262,471 *088CF4BA00F2D291DA63731D74C5553D81AC05FD SKULROOF
80,262,472 *0888917D17A24593E7E5495DB0C6F7FE1C9D3D00 03051637
80,262,473 *088F99926EB1E8B246C5D45B4503F74E414E8FD7 07.21.1002
80,262,474 *088F165F521D8618816A2FBE12769BB0296B0711 SMALLMINDED
80,262,475 *088D77A63116724A9BB2E9625B5979F2A4710320 [email protected]
80,262,476 *088C92CE506C315DCF1F5EB32AD42E032D98AAF9 TAYJUNA.MCGEE
80,262,477 *08834AABDC9CDED7355D1ED1C9DC1F27B14288B5 906844 UmIt.altinay.yazIlIm.geliStirme.direktOrU.35..
80,262,478 *088E961914F33F9B493B745B2B93A132556D965C T&CO925
80,262,479 *088BE28B97006585288C974F47F2B97299989910 9AFHANGELING
80,262,480 *08893E460B2EEFD5CC2AF9B7AF0D4D06D6089D2B SOILLESS
80,262,481 *08894D1BCBFD63FF5BB0EC816EBA2B2C597B8E0A SONATAINA-ALLEGROMODERATO
80,262,482 *0880FBC417515EAE6105B4522DC939DB16920015 9IFEANYL
80,262,483 *08817C7B842598FC14D4CC3F2C367C1B8BC91019 9ILOVEAWESOME6
80,262,484 *08887615BB9493563144D2BD174CD40C0CA5A19E SPECULAZIONIED
80,262,485 *0887BF322ADF91315DBC76FF603C8245A1DC1AEC the.apostles.of.silence
80,262,486 *088AA1A9C4A4CC530169A4FB3C7EB568E16463F7 9NSDWPGHMEOP
80,262,487 *088E81E79039EA2CE9AE6AF02351C57FA047D86B 9OORPTIRW
80,262,488 *088AF67BCFB423C18B325BD02CBB7867E184D5EB splat!.*.*@3
80,262,489 *088D88C198ABAD2902507D149741C2A3C588F144 9UMUMTANI
80,262,490 *08881C3F3C420E02355B32E7B88815E816FC69E4 a;0$(
80,262,491 *088CF8373511E540F9C2C533AFB8D47FD99D28AC theology
80,262,492 *0886704AC4788974BCE6F15554229341C217D9ED the.sleeping.beauty,.act.i:.sc
80,262,493 *08878F06E8750251AA1C0DD51C1CA6DF4B8F6A03 1791798 DER BUNDESLIGATAUGLICHE AUSBAU WURDE 1994 AUFGEGEBEN .
80,262,494 *0884FB906E8D05D533D46854205094E016F21289 a1,rx
80,262,495 *088D0C2A5737920CB68B3DF41C06EC681ADEE3BF THEWINSTON61
80,262,496 *0881D7795A00BA77C10E57EB290BA2C390DA5552 a4()
80,262,497 *088E368293E817E465C7EABFA1546FF29639F822 1944316 siewurdenkurzdaraufverhaftet
80,262,498 *088F9A13BB6F8978E6A9CFBC4E7768C271A72AD5 1AAKLUUK
80,262,499 *0880F934FD3100FFD8B32F2AE3DD33A9AF8903DB STEPHAN.ARRIS
80,262,500 *088AD7C1E2015D8E3223F6EA0BF3E93A12EEF68B STEPHENLONDERGAN
80,262,501 *088054627228A21D84739B5B88B192EA3212F53F STEVENSONRÓL
80,262,502 *088B2DC4A399B786208FC372C1BEB7A764252B3F STEVITAREDISED
80,262,503 *088865ACD323B4377A307DBF8B7E1ED9FC85D3DB AAAPVJ
80,262,504 *088074664A9FA2678D5CC77C5B814889920D7850 tkapnemas
80,262,505 *088D4D66579C5E6C858DF11ED84B356109405040 TONEYFREGOZO
80,262,506 *088285A86D47874631EFD7EE28E7C1E8B6056164 TONY.CHINNI
80,262,507 *088FF79C8E697F597FF8EB084FEE6F833844C068 ABVUR
80,262,508 *0880D374D13ED090276FEF949CB0BC67A44ED351 accorantesi5
80,262,509 *08849EF20A519FBA640B2C2DE4C46319A2ED837B ACCUMONCELERIEZ
80,262,510 *08865010E1F7E72097234D73D40E320A2F3FDCAE SUOENATNESSA6
80,262,511 *088098D0BE4AF13962D973BBB53777A51CBF2FCA 1muassaaamulehtiyhtym
80,262,512 *08827FA765C54DA6D04C42A9A9A5FD7840BDEFD0 SWIMMERONLINE9
80,262,513 *08850EA99D5C8AA85DD4F1FC6AE1CDA65B7751B2 sydneycamire
80,262,514 *088CC2121ACA0E10FA1D0E17B2F08A79E24BF34D adinixym8
80,262,515 *08856447A4DF8F3BBE4F73DF3C9E984C51142DCF aditya.iyer
80,262,516 *088B270F4A510723B673276D9E76539AA3614F3B SYLVIASETTLE
80,262,517 *088EE4D4D1BF9AEADCACEDD8214A070949B8A590 SYNODICALLIES6
80,262,518 *088370EC41E95BAD0B8ED8BE69EEB6483A16E275 ADSRA
80,262,519 *0885675F4A6718EEFA0968CFA0D2216F88E16E77 AFHH7
80,262,520 *088D3662445F06989B85B4E2FA1C77477EF57F75 1TONTTITALOUDEN
80,262,521 *088E9A2C1902B3DD6103BBE6F05AA382BDF704B7 1VOOPING
80,262,522 *0882F6779281584CF0B65A68EFCEE9A2BEE611A1 2176184 LIIKUNTATOIMISTOSTA-SAA-TIETOJA-LIIKUNTAPAIKKOJEN-K
80,262,523 *088BA872C346F62FCC5A7B967B78DEE73BB45C5A 2319177 BUTITWASDIVIDED2-1INREJECTINGRULE14E-3.
80,262,524 *088275CB404EF2763CE183E83176216DCE8C4B92 248HAROLD
80,262,525 *0882928CA536A35D604176D2F61A243DF8FC7D1D 2721596 vielleichtgenugschnee.
80,262,526 *088EA529BDB0C22A197652B67A42F3DFF47ACE27 ALBERTMIDDLEBROOK
80,262,527 *088F64331FBCDAD2674705FC17B85D5BB6FA588C TERRY.LICALZI
80,262,528 *0881AA73D8757CD14390D6D56BA22A842EFC224B 2energiainsin
80,262,529 *088E01222D71904138A38B2A550E36AE3282AA7E troy-kreider
80,262,530 *088A140A1B42C5FBD92D81B738F885C615302070 TGNAVMO8
80,262,531 *08871330F4F1CFCDAACBD281BECB55B062E8D0FF THAD KNIGHT
80,262,532 *0886C4D8E229CCBB13D4768A2321D44876CB88DE thadslade
80,262,533 *08884886467D529ABBF7EA6789CFFDF0FB14B6FF [email protected]
80,262,534 *0880B863FAA5A6E9DD637465D6DAE632E591B5A0 2ILUVSCOTTY7
80,262,535 *088ED5E87FC5C4373730CC087FD3879503EFA233 ALFONZO.SCISCO
80,262,536 *0885ADF49F09A5715807027A179C560B972F6E0F 2-kansanmusiikkijuhla
80,262,537 *088046CB35DCFD8726F1A5EE78E0DD87FE6D9724 ALLAN\\\\\\'HOT.MAIL.COM
80,262,538 *08890A054D03345B6C5AB57A9B034B7F50390C68 ALLKERALA
80,262,539 *088A51215B408CF776F8DA9B10EC098E4C7BE450 ALLOWYOURFEELINGSTOBEYOURGUIDES
80,262,540 *088FA6153C428AA679E1A9A9B2D8FA06400CD45A 2.saksofonille
80,262,541 *08883F02FEB4F2DBA01C7ACDD40408893DB7A1D7 2.SCHIRMER-MOSEL
80,262,542 *088FC8DB26F79C4CF4731D1E7CBD49660F137F14 AMBOOZLES
80,262,543 *088775EBA2471BD06110F99AC1AD3E1D9073F867 ameisenowa
80,262,544 *088DDFA3BB96F3625A0FEAF80C68F9F528735530 [email protected]
80,262,545 *088636BEAC17645FC82702950C2445745A040313 THEUSBSW9
80,262,546 *088662C70EB63D79043457B8DC66BB4234DFEDDE anantjot6
80,262,547 *08862EC84259FBD7EE1A29049E82F97A0478E47C turkmedya
80,262,548 *0889D83A127E0DABCB7FFA592EB7FE81EC990ED7 2 カスターニ芝ビル3F
80,262,549 *088C676DEF220BF9EA88F8EC033D6362A53B81A1 [email protected]
80,262,550 *08889B254F5D21632DBB97130FB503AB1153ACB0 TYCHUBSW8
80,262,551 *08892AF6976BB59E29EE385D38549C5992383D0F ANGELEIM3
80,262,552 *088DB2A0EDE1B5B4CD5D3D5D6F17D1810154652E 354BRUNO
80,262,553 *088999A9FF3EA274BE659C01F7FF37E40A5CB4F5 [email protected]
80,262,554 *088B8129A9F03ED0E072DED6CE5E2A705AB7415E TINMANSAPPHIRE3
80,262,555 *088E0AF75D61644CF31132CC70E3A292C86024A2 [email protected]
80,262,556 *088B4ECCFEB93120C16942FEF8423B2F14C81296 [email protected]
80,262,557 *08888486516F5F8A14FE149AECFD9458057E77CB UGBANIPATRICK
80,262,558 *08845C8E7EEA5D244314AD046638B54CCB568F0B 3B.~0~O(>_<)
80,262,559 *08814A1E12EFF083BC9FE29FAAE456E51C779B22 UM#}
80,262,560 *08846627ACC8B29ADD364FB7120F825CAB1DF394 3.ereginin
80,262,561 *0883772B5ABF8B4900439E39D76C162468D9B263 ap.2g
80,262,562 *088A9BCBEFA7157F632075E182FC90F221B5C772 TONEYNYDICK
80,262,563 *0884467EFD5B1E6B6795C70691DEF6D413C0CE69 3-menukortit
80,262,564 *0884C4DEC26B6E8CF6321AE268348FF8D6724D6F toythir8
80,262,565 *08852E6EA354BF52E261BAC32B2D151B0C758ABE [email protected]
80,262,566 *088700E0B3838B5BF301F3E63117A1814C6AFEF2 ARLEN.COHENOUR
80,262,567 *08845CCE55CCCEBF1A471168DFD61351AD1D4A9A transpass.
80,262,568 *088A366243B2CFC5EA3708271444D027C72A6161 travisim
80,262,569 *0883D597C9E8925000A19D3CE05555703C26997E 4CACCEREI
80,262,570 *088BC602C293D410269D9A426C20DF6458B76BE0 TRIBUZZO8
80,262,571 *088B585AE06486CB0797AA5831F7B7082C07A07D UNBRIBABLY123
80,262,572 *08858EC5C26137ABB92A89C85C6B7F1FC2C64564 undarkened0
80,262,573 *0887914B12153D9C57FF8F22D96CEBC1135B046D at/h4
80,262,574 *088DC55085DEC4F5CFF0381500D1A22339505C8B UNNIOJA
80,262,575 *0886B7B13215204F3344A7633FA1663324D7ED4A 5BESDESKY
80,262,576 *088DAD9835B710D65FAE21F626786EF35C9F6A7C TUIKWONG
80,262,577 *088349FC522A7109274E58CFB53300F76106333C AV.4#
80,262,578 *088098E8BD3E9C79D5F549EDB59E35E40C41B27A 5HAGIOTHERAPIES
80,262,579 *0885DFAF9EE6652D1F94B34F049C6D76C825A1DA [email protected]
80,262,580 *0883D3FF21B625A2D1318D8B839F408A26D52150 5RESSERVIR
80,262,581 *088619E6443BBB9FC5F517CF39205F4B9279F277 AZZARBAH
80,262,582 *088001169ED5F06040056DC4E3626E3F11F779FC UDOEDITSUDOEDIT
80,262,583 *0883719C0709DD5D5E3750FAE5409B86FF5C1C31 b0ce?
80,262,584 *0881E5427DE991251AD890A8B59315CECD39BB7A utbygget8
80,262,585 *08852B616B0394A06DC1A54D6115B79D8B8DE3D7 ULONDAWINFORD
80,262,586 *088EAC4159B32E30F8BA570DE850872059D8AC7D ulya”
80,262,587 *088FCF0B3A06FC7717EB38E8B9C1E1F6BDA990FD B8U.7
80,262,588 *0885AF76B479B13C42F92D6F958F1FF626BD6271 [email protected]
80,262,589 *0880B38F842A2017E1D46CD5FC4A40A590EAC5BF 67DEVAN
80,262,590 *088EADA6BFBB7D08261F3EEAE511542FF3877931 6ALTAREERATLA
80,262,591 *088921C3B17D06FDF3B2E6D7AA698DD38B78B22D VERTICETYPEBSW
80,262,592 *08885CFE0855D393224D59F548749D581F7F2046 VERZOUTEN6
80,262,593 *0883C542F47DB9496EC724C89E6B71FE0F3E7FAB 6EMACSSERVERBSW
80,262,594 *08847E408C8B1C346A0928E458EFCA1438D343BE VICKI STABB
80,262,595 *088F44597E69745B57446244FC4B9C1A7F5730A7 VIDYANATHANIEL
80,262,596 *08810C26380213A71F98B7941FADFB8CE5BD6E01 vijfpuntige!
80,262,597 *08832A653F4DBC9D618FB85FC232285426055134 VILA-SISOUKRATTANA
80,262,598 *088AC4840EE258A54C986115E3970FBBE1E61E2A URIEL-IBARRA
80,262,599 *0888BE1DBC7C5636224533EF46ED1D4FB5391543 VINCENTANNESE
80,262,600 *0885F57046A140415BFD78810F1C0C1BC4CB980F vincentdarley
80,262,601 *088C9381ECF616B33D4EC2BD0B2EE7CA92BA3543 6monoplegia
80,262,602 *0880EFEACC01D90B5374F9CC86421AECC17AE382 vishwanat-1-0
80,262,603 *088FA63AAEFAB590738AA30BF38B47D096668271 6OVATLUSS
80,262,604 *088690EE74F97A8E9AD206CB89F21F54D01549EC 6PROMETHEKITTY
80,262,605 *0883D8B10D33D2A75B093CC1BB55268ABB957D5D W11722
80,262,606 *0889540C93F067454AB255E91E33B4A5EF95CDBE W61190
80,262,607 *0885810A555757733F22501EAA82926E3AF50A9B V1353R
80,262,608 *0884FB069B61707BB3C5BF2122995F0247FDBB2C wage-labor's
80,262,609 *0887DD7A4668FA01D16FDDF72B006D85CD18959C waiting4prince
80,262,610 *088E24E4960534B2D60B69E5232CFB86D5F9FF1C WALEEDWYK
80,262,611 *0881853AD784F76DDBD4ADD742314E374FFA45DA VALARIEMINNIS
80,262,612 *088245FB2915CF4D25C1E974B52744FDE0E2A89C BEMP
80,262,613 *0888FBF0241ED005AE2520BBA8FDADB797B08DD5 [email protected]
80,262,614 *088C0807C9B16D4BDB30860403F928F30182BA39 [email protected]
80,262,615 *088C89C95F5777A946B722AE0F21AF833F701489 valses nobles et sentimentales - assez anime
80,262,616 *08894F4D1EB1908A89DB68DD812C4E0F8AC41DD5 7EWOGENEN
80,262,617 *088EDFC44E60ED0E690DFE6DF59D309A2A3830E9 berceuse..faure
80,262,618 *0884A6D34DDDBF7C2806C13607E3E365AE3C56A1 BERRY.BABILONIA
80,262,619 *088C48F837169FE7DA71B576279388578F5A084A 7IMPAPYRATE
80,262,620 *088AF6E4B928279CF40B8262BD12BD9A25DF07AF 7KOLKHOZNIKI
80,262,621 *088ECB180C682DC618814C085C637A709523697E 7MURIELLA
80,262,622 *088380DC02ACEFBD78AFD91C7630149F2B9681ED VEENAELIZA
80,262,623 *0887148E5171E27BD7684C3976F431A5916ADDD2 7RANAULT
80,262,624 *088C6EE8C0EC0AA91256975A85C618DDDAD70E60 b%ht(
80,262,625 *088E512EC5285228C73368F0822E2A1947F7E4B9 bilgeläre
80,262,626 *0882A3FA02261171BF465D3550DF234CFC8733D3 BILLY.FLOER
80,262,627 *0889D6488BF1F5B896428826F9491E828D4E7131 BITTOVÁ』を、続いて、初のアメリカ・リリースとなった『リヴァー・オヴ・ミルク
80,262,628 *08821DA9A0221A0269E0B17309F9D31F3A9BBA2C 8AANRECHTBLOK
80,262,629 *088A9D52BDB0CCAC113F1A3EA565DD3CDF9D9F8B 8BLAZERJOSHUA
80,262,630 *088015A3D75C71749991354BA667B75AA4C20F6F [email protected]
80,262,631 *0883E33C76D0667612C73A9B420F0C4188FEEB9A bky/l
80,262,632 *0886215BA70ACAEDBDF85C0157FE5266AB407283 blackbatsx
80,262,633 *0884BFFCF5F77A452FE1EC96D9F36FB34436D658 BLANSHARD3
80,262,634 *088794CEA6085A0121DB87798F857D0FC5270F22 bl(bi
80,262,635 *0886ABD0D50080801B9BA96EBAB66370A503A2B1 8FJERKRPRODUKTER
80,262,636 *088BF8203802E6709D1E15888EF7B5BF2C572084 BL(W
80,262,637 *08858D715B8185F4CE0F8A3950978C050B724133 [email protected]
80,262,638 *0880B3FD907765CAA812B2ACA88916F56DCA40DD WILDERT5
80,262,639 *088D02DE8F7581CFF4527CCDFC5E31A6AC48CFF2 BMOMX
80,262,640 *0889EF419D9A47343141C7AE21F160B7ADE53140 WILLIAM.MCQUAID
80,262,641 *088DBCC5A772DD47D8381999052563610EA4F603 VON.WIESE
80,262,642 *088F4365D28494E0C61B49F3A49C359B5A274F8F bobledwig
80,262,643 *088029966E5569B309840AE0B6A9B5930BEE5BFD [email protected]
80,262,644 *08846099AD663E9F5AE65964903D6DCD89923C1C BOELM
80,262,645 *088FE0EB07DACDE70CB73485D8409EFDEE962710 b#oih
80,262,646 *088668AA26797BCBD687D04DC37FA7B000C7A9AC BOJEANNERET
80,262,647 *0886C86E19967B1DE4F4ECD42189039DDBEA86D0 w006
80,262,648 *088DA10D13E3BEBDE6B99DAD5C64380F33E715F9 bookies
80,262,649 *088BD1745E77E91BEC6E1F3A55980F3882E836AF WAHYUNIA
80,262,650 *0880D886C2161D09CF3DE9E18167EFDD54A7F488 WAISBLAT2
80,262,651 *088E8693D6223D009E1CEB83551CC50DD5082421 BORĴAVSKE
80,262,652 *08898155DCDBE4713F446BC3D8712AB33E0E73FE 8VRMNGDN
80,262,653 *088E069AA66DB9FAFFE9A8ECC61596CD94AA875D boyik
80,262,654 *08837E7E3236F62AF3362591980FD57ECC33F72C B-P5
80,262,655 *088040D5955407ED4A4D3BA2D71406521FD8F658 b+pm
80,262,656 *08816F2DAADAE2597F62A17A70CB6E8EF323F584 BPYH
80,262,657 *0881374FFAD39058E32D7F6AAEB8A3F6273BBB51 WARNERMCCUTCHAN
80,262,658 *0887FFC9DA7DBEDE2C50CE6EEF1B431245A9A39C WASILIEWICZA
80,262,659 *0882AB1FD060B93E7794A4DEA507937DB72D3FB9 bralén
80,262,660 *088734AD6E898EB72BF479817039FC774413DF70 9c04e3df103bf930a15752c0a9649c8b63
80,262,661 *0880E8727D99015A7D8CFCB390462EA5B85CC8BB weldonbarness
80,262,662 *08810C9CC1E3708E19FB542FC58FC90F8D7BF2A9 WENDIGABLE
80,262,663 *08853F8E8E2E1EF62941EB56ADF93FB7F21668DF BRIDGET MYLER
80,262,664 *0888BD68DAB818A89C41F7E492F0DBB854CE1903 [email protected]
80,262,665 *0885F9A5BB0C747F96BB5F62ECC0F8113DA4F2BD brittany.lollis
80,262,666 *0881634B95DEB66BDBC22DBA6A591181A5C032C5 9HOUGHTONN
80,262,667 *088892E265AA1FDE4F2156B5F365B479EA4BCD1E 9KAYABSW
80,262,668 *088BD18AAAAE9CD36873E0E70EAD39E00E147C94 BRÚNKOAL
80,262,669 *088DD63E2131CADEFE10DE86CBFAD2855FD157F4 BRYANTHIGGASON
80,262,670 *088B30C904166C62FE76C0F6925660D5859E178D what.you.need.is....(uk)
80,262,671 *0880E0C3820412CB6EA787BBE2337409F3C36F9A 9MFGLN
80,262,672 *088E0E68367926BD417AA378B4EC75A7C68BC1D8 9REKNIVELRAP
80,262,673 *088868CD4BEF9C5C3554DD7C37D38352007029AE wildcatr7
80,262,674 *0889C3AF9C780A1E15EEA216A58D949FAFF9AB25 9THEMAXINE4
80,262,675 *088782D2AB72C9D008E539402DA2CD4AC4141776 xtrtnry0
80,262,676 *0885816239239280BDCB5726745EC6FE62015091 bureaucra+i5m
80,262,677 *088357458505FD173AE78E98F73EDB7591E5463A burtonmeshyock
80,262,678 *08823BBD446EBADA52F0F8FA473995F27547A9F0 XU_MIQIAN
80,262,679 *088AC78872832D231AA26D026309DBCB69849A23 BUSINESSMAN8
80,262,680 *088DB3C0FE9BF689FDEB59B9E0F3802B8CB14FFB winsome-malcolm
80,262,681 *088B133BE06BA82FC6E235D1ABCF774BD08E8303 YAELGENZER
80,262,682 *08858D54524AB4461D0B450E21C17053B7ED69F9 bw8m
80,262,683 *08848293CBE6CC3A90AA5FCFDE8A033FE5FFDF31 B) *}X{
80,262,684 *088FC82E22F3B321BD76019EA2DC9875A7E83558 C/1
80,262,685 *0881A7B69CAB36C6FAEED80BDD400299F1AACA80 WTLT
80,262,686 *088570971316D2E18E28887DD69BDEDD6EDA5236 [email protected]
80,262,687 *088057892CD254D1617B7BCFE1008F231FD727BF aaafr:
80,262,688 *088A5D89947088E6999FC54CCEAD76CE438030D3 AAB&<<
80,262,689 *08841925822DD576701C72B71CBFF0BD3AC821B1 C4QN
80,262,690 *088AB8EE1FA333714E83326A6B7545FEAE0B1CF3 aab&ol
80,262,691 *088E8911EF732B3E837328209B5A636BC7FD13DF WZ2311254
80,262,692 *0886C0A7A1881B980D91A482D5DC43F2C2FD41B8 [email protected]
80,262,693 *0887256C3938E34ED4DD2F411C93A08A300E137B aac<<v
80,262,694 *0881E00AAF9363BE478EC27A52DCAA06BBCA7309 [email protected]
80,262,695 *088928A82370B0B536807B8B4C89BF201A227244 cacmpwuw83
80,262,696 *0883D93A2BE18C241F9C4D461F91DBFD57DDDD07 caŀlisto
80,262,697 *0881948C5FD8FFF87C5B12E7868AE936A1C13BDC X=U
80,262,698 *088D013250DD69C0F770AEBAAC939626A782065C YU-CHI-HANG
80,262,699 *08837CB11A0B5A429571B588F38BAEAD6FAE7138 CARBURETEST0
80,262,700 *0886EFF38C3174130333560F068EF92A1B70693A CARLOSOBERG
80,262,701 *0880F1CEFD744C361C17A83911E6AFDA98432645 abhimanyu-saluja
80,262,702 *0884BB38E62BCB8D793D2D3FC8C36B735F34066B CARMELO.MORDINI
80,262,703 *088FE47AC9A6A811F9B926CF9C876DA1369497FA ABIGAILSANTA2
80,262,704 *0885D3C8ECBC9605A10BC6E44D8FCD27C42BBE8E [email protected]
80,262,705 *08861FF9F5CA7A62D8F6533DFFAE8B3F61A597C4 abm>,
80,262,706 *088E289435680B2C7B67BC279D4E17649B7E6930 CASEY.BABINEAU
80,262,707 *088F574CCBCA484CC54C71D3DF0640D485D40C7D [email protected]
80,262,708 *08862F92F67552BC80AAC6D0B2AD22129392BF2A abzw!
80,262,709 *0881D3F5AC17915CCFB54A5B02D4CAA1A6579F55 CATEGORYMIAMI_METROM
80,262,710 *088736955D416CCF4DF77311385B683DFA5362FE [email protected]
80,262,711 *0882CB4B0EDD4F555543531647D969C4BE564E40 [email protected]
80,262,712 *088AD615A6BD21ADDC9C21D5834B5324C9F9749F ZBAHTIC
80,262,713 *08888E83F17E37498A28E5134FF4699A9AF0B060 [email protected]
80,262,714 *0886FF9419DA29BC5A7FE14A1FBA28114ACF2D8E ACROCENOTES
80,262,715 *08842BCDF7E17313642E4230F012B0524943B3B4 AD1UV
80,262,716 *0883A3A28256BE9521AB750DB03F76E7780D5256 [email protected]
80,262,717 *088DB524DCA8DF706D84D1CF904EF5C62D0FBEB1 [email protected]
80,262,718 *0880F9E256307A619A114725B637A3FC2881A36E ADANJ
80,262,719 *08830893CAE4E1B799EB83EE41389CB6A9F6A714 c)bm3
80,262,720 *0887EE4F0B1C8EB0E73736C21CBB12B38C04EEF5 you-used-to-be-my-baby
80,262,721 *088766F63BD362021E01BB7899A8FC267DAF8A50 adolphstaggers
80,262,722 *088CD73F8D505135D5A5EC07FC4FAD6FD04856B9 YTICITSALPOMREHT
80,262,723 *08842807619438DFEA29F6038B3C3622E99F2F4E AE3SY
80,262,724 *08831F7C329B3BE4E4F0D5CED2FCC8AA580C9460 zagjewski
80,262,725 *088B43FC1E437D0F70225FE90A86F9BF548CE08D CE_#H
80,262,726 *0888B9F5294600BC2BB68A8DA11A99667A9C69A0 zeeshan-hyder-hussain
80,262,727 *0886F23C3FB9CE4EB5A7F7DB11EA5D866679219B ze.G
80,262,728 *08822DCAE5146DCE0F5E282A44E32BAAF0E6F816 C(FHI
80,262,729 *0885E8EEE329AB1717546FCDF0125B464A038017 cgjm0
80,262,730 *0882D2E92369A62E96D8C44A6C7437C7A95D25B4 A$GVR
80,262,731 *0886787C03631B614742F12B671A672E9C6AE61F AHIHUD123
80,262,732 *08809629999F7D30F869777F67BE1F783E574B40 ZIXXTKA3
80,262,733 *088922484CD5EAC0CB120E8802D045C6E091306F [email protected]
80,262,734 *088E101245D8CDD39CBCBBCA0F8D6D0F11AF4172 CHHADMAED
80,262,735 *0882C0270FB84601F6E98C0CE2B58AA36D796F9C [email protected]
80,262,736 *088FE9B133BF3F7322FC87833B739F157C06D062 chlonssur6
80,262,737 *088D9BD2422B868CB9C00B3576926B5D1E9A2702 chouskeses
80,262,738 *088EBB88FCFACB4E380EE27929971EA91FA701DB CHPN
80,262,739 *088D73D6186E0B63D656B1D87C395A4D8F657FF3 A_?L
80,262,740 *088DB480F8709D8EDFE2B3ADB20B05C73527E555 ΟΠΑΖΈΤΩ
80,262,741 *088B3050A4B99F8D21590AEECCCBD22CE65A5554 ΠΥΛΆΡΟ
80,262,742 *088E0F6D5BC0E484EB68E337C9C602DDE3A299E6 «АЗЕРНЕРШ»
80,262,743 *08843E3BDB4359A15DDA11CA87FD518569D69D05 ДОПЛЕНТАТИ
80,262,744 *088464B314D951BBC58AC28C48BFDCAAE26BBFEE čibar
80,262,745 *088C37CECD335FE143F5A57F3780AE0CE2EC5CEA ДУРУЧЛАЧИССА
80,262,746 *088002EF334EF48D90A220616155029EA8F03885 ҐОЛДФІНГЕР
80,262,747 *088928ED46F6760FC6AFB89B8070FFEF073E397B [email protected]
80,262,748 *088F001CA6F8BE25EA0B713524F26B5450ACBB72 c.k:
80,262,749 *0882DDAC539E044B5741F6D6244B2A32835875E3 ckl,b
80,262,750 *08806DE1DE4D048207896B9F3A3543C1A6759350 CK$Y,
80,262,751 *088A5E670AFD4A25AA5234C18994BBFFDB4230CC УГОВОРКИТЕ
80,262,752 *088AE5479CD59C2F05914D35463B4E7856792217 cleo.rivera
80,262,753 *08807B69190F4D6651368F4D0D712CC42A5542E4 AMERICANESKIMO465
80,262,754 *088646B1AF2EBA4D81A4F203921E57D477AF3831 ANDELSKAPITALISMEN
80,262,755 *088879829FE792609A74ECF83E5AF6DFBDDC6050 andrea-chenier:-la-mamma-morta
80,262,756 *088A8033C7D969C81B07180578DE2FE64599F81D ANGELO.PENNICK
80,262,757 *088B7A906CEEC7E0E6EC5329299CB3932089AB2F ANGY270295
80,262,758 *088A051D787131CE212361EFA0C7893D65BCC3DA anja.miletic
80,262,759 *088D054C378B6B17ABB8B27F08B2D2CF8738DA75 COOKISLANDSPRIMEMINISTERTOMEETEMPEROROFJAPAN
80,262,760 *0886FE76BEBACC4AF6D59CA6CE1A423CCD59F684 ANTIVERTIGINEUX
80,262,761 *08846A7FEA9CF9CAF8A39AD5A54A5F5A24AC9BE1 スペック…戦闘a・mh制御b1・演算b1・耐久b1・精神b2・クリアランスvvs1・タイプm
80,262,762 *08802E204A3559CCD5AB26AC17499894CB6E84EE COTTERS
80,262,763 *088CF6F0117CA86ECD3074F1309232F385757F62 aq/wt
80,262,764 *0889BE075025D3AB3969D8939A12629FC32A6851 (0-0)~ `D======P
80,262,765 *08803502DFE8FEE01679797576AFBA10F6B8E0B9 005karly
80,262,766 *088759C8F921218FF647749A965B87BE2D93EAF9 CTSTAR80
80,262,767 *088E6BDDE0280639E21D9DCA948E94FB752B042B 1241406 TIEDON-JAKAMINEN-ON-MY
80,262,768 *0888A3A96221A14FD4C39AE0F660559AE56C7433 ASHLEYLEBSACK
80,262,769 *0885159678377B4E1E4447CD1EEBDF8481F0A6C3 ASTURES.TRANSMONTANOS
80,262,770 *088721B7C236645FA0E9EE060225C23AB4930D06 cutress9
80,262,771 *088518FBD5BBA156344D8DB573702779FED68B57 a,;tk
80,262,772 *08822C3526D27C8BCEA58CC49123795F89088745 11DEC1507
80,262,773 *088F3A03CE5C123FF1DB1B2D4B5EFE63DEA84290 AUGUSTCERVANTEZ
80,262,774 *088B3DC080A5A60B25EC3981EF1778E46A968C80 1353416 heute.sind.die.meisten.samen.christianisiert..
80,262,775 *08806DC3D945459F7FD96AC3BCCF9CE342E998DA 1542587 VIIKONLOPUN.RIEHUNNASTA.V
80,262,776 *088CCCCEB7315FCC9C323DE3FB4F67FC70FF8EFD 19.06.1625
80,262,777 *0885241C04468338AC845305CC4E471A6C0E2EA9 [email protected]
80,262,778 *088D4872F97084CC9D93AE5CCDCBA85BB01AD485 cynophilic7
80,262,779 *0885548B12E5265784ACDCDF7D8CDC3E3E7F6A19 1999-04-15:SANFRANCISCO,CA,USA(DISC4)
80,262,780 *08842218AC883E18A4C1282E82813B776CD9856E 1787877 yleisi
80,262,781 *0884F4E67093563CD34647746CE2B8531B246E8D d03t9
80,262,782 *088E263DFBB0057FE831C6D2EA89274FC9D8C1BD 1-bachstr
80,262,783 *08868DFA52946BB7C5C0E835FD4BF4AA5035E6C7 d1mq!
80,262,784 *088DA7CF125E879BFE65A42ABAD03387A0F68D79 1BMOGULS
80,262,785 *088935A5A985350ECC36445E6964B439D9A6A20C 1bruttoregister-tonnen
80,262,786 *088128070456AEE17B0B73AA9AFDC0D559162908 D31AYAB13
80,262,787 *088906DCE4C57D489811570D4034F4471AE6E795 D3/7E
80,262,788 *0887DAAF9BF0CA2C8AE82F68F7EE6D83A36BD6AA 1ERINNERUNGS-INTERVIEWS
80,262,789 *088030856CF9EEE828BFBE67FEBE00C06A4B856C 1-FERGE
80,262,790 *0888510FBCBB7701476FC6C33A129FB437C1C41E A!YEM
80,262,791 *088934FB2078A0A2801CBC5EE0A6B649841999B7 1IAMLOKI3
80,262,792 *0887AE5DDCE043BDEF50CB20A18F2D22DCB4D106 B0L
80,262,793 *088EB39D88277A710AD2D6414B2C692E1D58EBA2 1 GOZLEDIKLERIM
80,262,794 *088E271037387CA1A9AA03EC53A7DFDE87F7E694 1GREFFERS
80,262,795 *08817F170171AFD047A6479D09A64408AB826D50 1.HIDEAWAYTHE
80,262,796 *088AEE686D460DBA685B1FF41572DBE5676A8CF2 1-holbrooke-milosevic
80,262,797 *088E0DA7C6B757F70CCFEB8C3043F4FB14C1A593 [email protected]
80,262,798 *08897D80E8F85A4759300460B5634989E5C0BDE8 B3O%P
80,262,799 *088BC1B6CA31224911C998949150A9780F824CF7 DAMIAN.ZELE
80,262,800 *0884E0B60D4391EB27C670FFFBAB9FAF9A3E8456 1 kommunistinimi
80,262,801 *0887AD56099704F6EEA784844A002F9DD91F37ED 1 KORUMUSLARDI
80,262,802 *088540A16D11D73534BB65163D9453676503A7D4 1KUNTOSALIHARJOITTELIJA
80,262,803 *0883DA956BD886754340E641B754F7881293F7E7 1.LIEBESKRAEFTE
80,262,804 *088B67AF51EFC856A97D3B979396765E84844F8B DANNIECITARELLA
80,262,805 *0889E41C80095C76907DBA86BCF9B01A6DC3E11D DARA123456
80,262,806 *088366F285EB12FD7F2FAE0D2FE058D167701664 1OSCAR-JAHREN
80,262,807 *088D697442E7D238E11CC287213E39D3DE7377C0 1OVERMAGNIFY
80,262,808 *0880A8CAD8D98C9B6A93A8F95CDFD514FCD0EC7E 1 postaurikuler
80,262,809 *088FD4B4FADCD83A09E7887A3E529C693C98C85F B4+E6
80,262,810 *08867E289B7F39B7BADAED51EB5BB5365E2C9593 B5JTH
80,262,811 *0882B68D28B0F6C28AC1809252BAE7277E76DC21 Dasf
80,262,812 *0887C5488652BEA7528D8877CBC34A20112E4F5D [email protected]
80,262,813 *0881124F809BD59CEEA536DF656E4A207E10C81C DAVECOTTRELL
80,262,814 *088D2F5199F7A50D9265EEE2ED79C3EB925CF65A DAVID BAUTE
80,262,815 *08836C001CCB81FDB24687187F6F4AAD1444A562 1 TALOUSARVIOYKSIK
80,262,816 *088D2E64045BA19ADEB197F5C012A8269B6E0FE9 daz9m
80,262,817 *0888062DB4B36FEF19F5A95B8B0796B75B0FEC48 1ppifuehrers
80,262,818 *088036C736A917FCFE7B22A7D73AF9C5A9A3BD18 1-VENUS-SONDEN
80,262,819 *088E354B960D8A1ADC492C583CDD851848EF0F04 dc+(i
80,262,820 *088842640FC76C40A71216746C26C7D8C2609CC9 d/cq7
80,262,821 *0880FBB45E118FD4EE509E9B68582A2053AAB7F4 2137541 DIETAETERHABENKEINERLEIEINBRUCHSPURENHINTERLASSEN
80,262,822 *088EEEDD5D469998EA663202F873A798E30EDA76 225SYLVIA
80,262,823 *088E16381114E5E804291D88E0515EA8E201B410 22hung
80,262,824 *08842B3212040C5AA211169BF688DB25DAB833CE 2402775 KAIKKI-N
80,262,825 *088F8670EBBBDB0DE2236EA921149D76FCAA91BE 1.science-hauptquartier
80,262,826 *088ED7A11B9F81F80765A30F2E4CDAE684F83554 DEDULLES
80,262,827 *088009577E13EEAA81DA5497F3D624CD7D29CF27 1staustehzeiten
80,262,828 *088B6B498A827967762524B85D3BA9465FFBC845 defroze
80,262,829 *088420806AB60B8B0F938600B5F70677C284F193 1.TELEPAY-KOKEILUSSA
80,262,830 *08874511B174892DB11E40BA46170E16D80F9F89 deindentjust
80,262,831 *088C2C1A7E592945CB0B432A8F090D1FB1690B09 de.la.creu
80,262,832 *0885B052B1D5D4281A8F9825FC42DC42391521A1 26FALLENCOMRADES
80,262,833 *088E94586A7472DB46A549DF851EDA67E43B1C36 DEMETRIUSHOBART
80,262,834 *0888A0E71F6AAECF2C3F2F8A5A95F4A334429092 2815881 hylky-on-p
80,262,835 *0889C305807941514DCC897A999C1A0619F7F0F3 2888729 KM-TUTKINNON ( YLEMPI ) KYPSYYSN
80,262,836 *0887A9D6BD8EE949F959116FB515DD64198EB71F 1uck3st
80,262,837 *088C1156B314A226F961BF48D7DCB42C4A2B3FD6 2CLAUDIOS
80,262,838 *088883AC88F34D1743112513D2E9EA90F185FFD5 2DELETREOS
80,262,839 *0885E9953198C3839716DD97C23ABC173BDA6EC1 2-DEVELERE
80,262,840 *0884401627A0A5FCAB6C712D82BFB89FEBD1A570 1ZITHERBAUMEISTER
80,262,841 *088CF5AFBF4BA2DD4CAF86C5818FD7149152743A DEREKBOTTOMLEY
80,262,842 *088B615973FCAC39A333C05CF3675AD836F38636 deserved
80,262,843 *0886634F22EE108C76CFC88C209FBDCA699F5A9F DESHAWN.POTTINGER
80,262,844 *0883DE2381D673B8B51767786FB55E5ADBFD23FD desherbais3
80,262,845 *08856D28E83E13C83DE431143E57E5D58D9C4159 21-reflector
80,262,846 *08837EFCF1350B2707AB3A7BC75D0EAAC7143B4E :22×14(ドロップtロゴ入りヘッドを装着)
80,262,847 *0882B9BF94571E698C38201DEC7B6F226B06B13A 2SEMIMAGNETICALLY
80,262,848 *088A7B89E253FB2E3696AB67FDF443912F5EDA9D 2.SHOWOFFS
80,262,849 *0885F7BE8B10040E0A3601119AD039BE8215AF26 2.THEMEN-MUSEUM
80,262,850 *08851A2C81110FC4033E7A2118BA013E6AAF469D Df6)
80,262,851 *088DB3CC942C0DF3057B880D237DEA2CBB13827F DfE$
80,262,852 *088BEC470705CAF8AF5F64F6D35A5126552136A3 BE1A8
80,262,853 *0885D0BA8EB522F8A32274212F4A7BAB972450FD [email protected]
80,262,854 *088B58A4CBFDA2A2C8957E2488548A2293ABD390 BEATTONE
80,262,855 *088E9A2B1C40069D9CF62CE0AA40B3346F908342 391004 HEYECANLI MACERA DOLU WANADOO OYUNLARI . .
80,262,856 *0884740133B921E7D120DDB03905E466263E81AF [email protected]
80,262,857 *088EE48C06AFC01B49B48DD7A30ECFA0EC6C5867 beefsteaks
80,262,858 *088636CF23C1D79C4F62BE7D17F012C934837DDD [email protected]
80,262,859 *0881C5C6060CF0B285B939F0A928AEB34E5258B3 b(ek3
80,262,860 *0888F70F4B6FA3C0DA50D761C93CFFCAF966A9CF dhnqk
80,262,861 *088EA0D03FF00CD48A4D2694810E206697E52178 2DYGTIGER
80,262,862 *0880465E0EF5E1E6C21EF96D667C89F0567AB145 2ERABSIMN
80,262,863 *088480E59405935AD9647268840A05E2A02ECBAD 2FF2956D48346BDBFD0E4670BF872CFD 802734
80,262,864 *088A22A1B90F326ADEE0C5CB4E2A8CA8D5FD3473 DIFIBSWED
80,262,865 *0887189F30411A29250DE9842E3D4CE189216367 DIJJ
80,262,866 *088DCDA40FE972505B051B3B0EEB785E4928503C 3MAULMAIN
80,262,867 *088E5832E7D5EBC331E2BC734DCEED8D8517FB42 bertbidle
80,262,868 *088CD7678F3E8DA679556E010488BEECBFC77D74 [email protected]
80,262,869 *088847CE195447213743708F201D0D5F8F10C942 3===p`~(O_-)
80,262,870 *088AF0E254C1BD0871EE7F0A9A48DFF2FA32E8E8 DIRECTSUNLIGHT
80,262,871 *0884FCD22BD40AD1AC9FDDDFBDAC61B43478B951 b+_f2
80,262,872 *08861213C7ABC67FE61BBF09B1B65361DCD02428 D.JI=
80,262,873 *08822553004F617F185EE19BA0F79B8BE2FD1EAA DJREVELATION03(COMPILEDBYASP)
80,262,874 *088731A5F8FA0EF9DFA60D8D42F8BF08E94785ED bfwgk
80,262,875 *08811E9A68D010BEF7239E7E275EA3DB63CEDC56 Bg7
80,262,876 *0887165B34D085CBB0E1E38896BB562A886457DD dlc"k
80,262,877 *088A957109418D000D63C93B18F4D963F3745725 bh:a!
80,262,878 *08864C9A3489AEAD96583CD3B2713234AA7FEFCE 4.hazIrlarIz
80,262,879 *08804A4BB188079D5ADA60C61A02119A4E8D056C BHqp
80,262,880 *088F37AC9F800E819917AC8A369E6B88FCBFE1E6 3CECILIAS
80,262,881 *088FE0D4756CFBBBEA0BC1F0CCBCBF0FB4F6E6C0 DNMOD
80,262,882 *088F0948BE9202A670D12009A65D8218DD2EBB0A dom/-
80,262,883 *08844FB89442D07B97A32BA8890019A3A62655D0 3HEBBURN
80,262,884 *0884FEA2E48BFC8521B33E1FB1B69B0CACB0C541 b,i/s
80,262,885 *088434F12BF56B86B3EBE47B7D705D2F5B1A15AE 4theolivia9
80,262,886 *0888EAC0C98F48095769FA7D1E4005829D4A7987 3XPLOR3RI3Z
80,262,887 *08844137085995AA9D2D5F02F8BF6F4EFEF4304D 505adan
80,262,888 *0887B62ECB43FCF0EE4E8F5C73C1B9B353E16594 bmi&b
80,262,889 *088DB405116964D9EAD01BA788EB4C8A4C03345A 577078 kullanIcItarafIndangiriS/dUzeltmeyapIlamaz.
80,262,890 *08884792759630141F1E12EFABF31310F385BBC5 57-VIIDESOSAA
80,262,891 *088CF1AC93D9FEC6714A6AE79A8FE17071752EFB Bn6r
80,262,892 *088344B444CF9D92DE79614E561F5E8669F3D274 5BSWTOSHIHIRO
80,262,893 *088CDFA10C8E97D49A7B65B3E5606514BCE5A369 bobbiefiorilli
80,262,894 *0881176C5DBC42372C16414CC8523FF1BE136321 DRFCA
80,262,895 *08810AEFAA49D114342E6275B25698CC9A7D7653 BONDARÓWCE
80,262,896 *0885D1CB2B00C6C90704063C29A01D0774711373 B"OS0
80,262,897 *0885874570DBE0ED5C95E94F56A06E7077751B6E 4NIKIJOANNA
80,262,898 *088D913AF8DE272DA7E95662B03FB18C317D3AA6 d(sdd
80,262,899 *088366E57CB372AB9CBBEC1BCCCF418D6FDB6436 BP$0M
80,262,900 *08800214755660D1A0F69170B42D6C4F96F1159A bpf/7
80,262,901 *088D5AA51BAB62CDE15C246FA77A529C1F0EF379 d%uab
80,262,902 *08890D9E2F97AC8019B4C9E6840EEBE92CD0E79D DUBLJ
80,262,903 *08889DBDB34DE9982C911F2958E8544F6360ED2A BRAMMINGVANDTAARN
80,262,904 *088D7A770CB7AC4C09D5F1D4C32479E24A0DFE4F 520BAYLEE
80,262,905 *0889676FC71DA2F3E09E8909F1F00303E18B3B46 dvj.-
80,262,906 *088DC6A5DEDF21D3FEE47995FBD0290B57FBB2E4 5verblijven
80,262,907 *08809D158BF04B8811F8AC937CDF52F9102B4E78 60789 OrneGin-;-eprex-ve-neo-recormon-gibi-ilaClar-
80,262,908 *088D1B45515716C9C729D4D473E8D8F985037959 656272 her.zamanki.aliskanlikla.sallanan.sandalyesine.oturdu..
80,262,909 *088190F12C53C9DDA9FD5E2DB95D809590ED3831 DZNCKNG
80,262,910 *0888EC067CE01B709F1FADE4C7A9E5AB068BB3FF brettcanders
80,262,911 *08813013F15D68887F1535E48610E98E7E7AABA0 6AFICION
80,262,912 *0886FBDEE9BB55E171B4A0C1BF0123BA14D8DBE8 5ETAMINED
80,262,913 *088EF2EDA9689C159295F628C6E4193ADAEDFED1 6ARTEFATTO
80,262,914 *088678AB6CFBCFC934204B97E11B90D40BBA020F 6BILRUTA
80,262,915 *088183B7F13FE23AB43A86E0D35CEFA9EB2B40C4 6BLAUHELMTRUPPE
80,262,916 *088A0CC79DCD9EE744F25E8DE9BB305659F21159 ECROPPERS
80,262,917 *088BB3AD0BA8BC4E3BC4E1ECD45E0235B07DF32B 5iittalassa
80,262,918 *088F76E96DD88AB1C9E5B9C42B38D3BC39A06331 6-ehrendivision
80,262,919 *0886028E833AD1C88CD8CF1C00A1A5BF8B41E526 5KOTSUKIR
80,262,920 *088927D59FA3CE8C2226217F1E33B049CB6F0534 brws/
80,262,921 *08872DFA190933790274E0F3190C87287A3BC9C1 bryanschmeichel
80,262,922 *088D58DD276ECF92E92030F677A1544DB9A149E6 bs#l!
80,262,923 *08869C1353C636FCBB2648EE0422545FF8092C8D bswdavechabsw
80,262,924 *088E293FA78399C418EA9213AF1F04E41E964079 6NEZNADNU
80,262,925 *088E9ED3872B200224FFDAC5BDAB030F0D710AC7 efm3p
80,262,926 *088D6DA4AC8977306D93ABE664DA4591D728235A EFRENARKIN
80,262,927 *08828C56CCC0A47466DC39BFEA4CDD9E2ADE63E4 EFREN.JASSO
80,262,928 *0885EEB6E9566FDA05CB299A5898D09562A4D443 5STARGRAVEBSW
80,262,929 *08807E816C47B40A35ABE91A0641D46276C5611A EGIDAGAM4
80,262,930 *0883F9B5F651214230C34BD623E76F4251EFB26F [email protected]
80,262,931 *0884F23383D4F97291128451CF605557515E8B44 ehmqx
80,262,932 *08893BCB4455DF817ECBD466AAE07DDB296608E1 6UPFOULUPFUMBLEGAUCHERIEGOOFGOOF
80,262,933 *088982ECEA4F1520293872111F0D27A9C1E0F9A4 [email protected]
80,262,934 *08843500BA3945C50825BE1FC5A1128A605009E3 ELAINEMIDWINTER
80,262,935 *0886D7E639CADE2F83639649835A27875400801D bv3_m
80,262,936 *0887E824AD387638E172D5DDB21A90819A2B5B2B ELDRIDGE.JARRAR
80,262,937 *088AFF7CE268B693DCA5A71BB18ED6D9709B234F 749923 amakendikendimeyetmeyiogrenmeliyim.
80,262,938 *088D2044340C4D047ED9E4F0323B96D5D3CA9D14 750FABAA3E2FC3A6206306FC1325BAE8.CRASHY
80,262,939 *0885B479C00197F843EF91F26C09D9EB5A29C0E5 ELISABARTON
80,262,940 *0881B185A047A71655DF978E582F66FF8DAEFBF2 6ATOCOLIC
80,262,941 *0886C0D436338DC538CAC09A9E4B5C7A65CACCA3 6calamariaceae
80,262,942 *088172C3C8EAB45B2EBE6F5EDCE885BD1D07A467 ELOYIACOVONE
80,262,943 *088D8A76C7809D3FCD2465294AB5E5BADC7048C2 B,Y!
80,262,944 *088695B1FDE0A78C7363D9786FFC777A03B3A145 BYRON.NICKOLSON
80,262,945 *088AB2EE9E804B9CC3AAD960ABC4E3939F794B04 7DISROUND
80,262,946 *0882947B7C62BF60FA26959573E7753A994BA60A 7EJFERVOD
80,262,947 *08804D7A96B5DF3400C892304580A10D7E2B5464 E-MAILWICKED
80,262,948 *088326EDB53DF63A2C3E5D7CAF410841F597065B 7FLOWERSMAGNUM
80,262,949 *08829EE656A47431868107A8537733A9F1A80393 emblavure
80,262,950 *088C1668CE41555AE2E25C463B3E0C0F44E3941D C_:
80,262,951 *088B15844116E73C9F089424D7F77CC22B6795C8 6MLELINA
80,262,952 *08819FCB84AF11BD3226AD8019C16C0627367E82 6MMRTVSTI
80,262,953 *088B9A2617985CB11242432F08C7659C242A33E3 6moignez
80,262,954 *08835E58CE983B316B556D7E33B0D2BDEC2AFF95 7ilovecutlass9
80,262,955 *088F61D3A6C80058EA1BBD68CA9900A1383E3534 7MELKURENS
80,262,956 *088300864B98DF1AE82F4BC7E2268BD695CB267E ENDICOTTTALKF
80,262,957 *088B119BA989A367945A120F9F9B651048405B9D 6ROCKYLEGEND
80,262,958 *0886D5B75E39F3367936BBD1A2255D84616F9A77 c5a
80,262,959 *0884929B95AA45DDC0B42BEA2108972B50AFEC74 C60SO
80,262,960 *0888D5C5115E4A99931D69D47CC80E8E41D9E1C5 ENJTACT
80,262,961 *088758F057E60451BF5668F6E93855B4B39EFB0C ENRIQUE.RUPPENTHAL
80,262,962 *088236C0365B926964AB408728DBFE8F5D58904C C8ZVC
80,262,963 *088BB187FEA0B767F66CA0EFA605500CD0B2D729 c&%a$
80,262,964 *0887A9357FF12F2017344994E6978C1F8B1C31B6 EO?!C
80,262,965 *0889730BE6B9C1EFE9F3B14F1FC51FA68F2D2005 7XSAVING
80,262,966 *0883ED7B231B6250031BC43F7C6BFF986D30C4C0 6VERIFICERBARHEDEN
80,262,967 *088A7E7234841B10E7F3CC93C4C69F32321A7027 6XEDITORBSW
80,262,968 *0886A3F63891E1B46106CE36B77F67AE146DB53B EPPLI
80,262,969 *08803D13A25E2AE465581048F43D00053FDB463E 8AILEWAHT
80,262,970 *0880098B9DB00A4211E0DBA0C7D861A1D5E090DB 766DAMIEN
80,262,971 *088CADB3F9560EBCEFBBDF1FF11D94C7E0AF52B7 ERROL.CARMICHAEL
80,262,972 *088AEAC14285C840A4E12441216AE7D622BB0A57 8BSWFARSHEED
80,262,973 *088566C70828AFDBFE91975482FFFC38A85B1EA3 ervinguilmain
80,262,974 *088F36D0CC9E87D4B9954F1BCF0FB13651E89641 8CILOTERCXE
80,262,975 *088DE1C7CD11865758197FA5917A290169DC2B74 7BSWBEAUROCRATICBSW
80,262,976 *088758EC03E72DB6BC06F02575BF0536F831BBFB ESLO.(HIPPIES.RADIO.EDIT)
80,262,977 *088800AC4EE27CC0B2FDDB294AAD150E8E4B8505 ETHANKUTY
80,262,978 *088D4951931E47C29DF140A4D69B92958621AF3E CARMEN.HUSTED
80,262,979 *088D2393C4173837A3099F718CD648E7DEE318ED 8IAMJAN1
80,262,980 *08821DED1DC753D3A08AD5B46ECE5AB34AD45502 8INVITOST
80,262,981 *088E98643EBB1DA0150A1BDEFC0815460FA52C5B 8JPNAJDZR
80,262,982 *0880E6634F0565E6877160BF990752CE4C9630DF 7KUPANJEM
80,262,983 *0889FE486221B0453466434B5DFB0416B75E650C CARSONNICCOLI
80,262,984 *088CDAC713219E9AE98BD292F0190A18156CADB7 EUSEBIOELIA
80,262,985 *0886F7B3F8CB73BC28E2F478B8DA8B46B1787DDA )8(o~o~-(#b
80,262,986 *08867DD0B8CEDEDEB2EA0027E7A853EDA49F73FD 8----->-~o~osplat
80,262,987 *088B3EA631C166350C3E52671FD344673E58018C [email protected]
80,262,988 *08812FF975B1DFB588B0C9A813EB6EF15432D3CD EXPLANATIONOPINER
80,262,989 *0884CA07710DF2C520E4321592BC0A3C90095BB5 cbwj,
80,262,990 *0889F87BF3545BA14F0DC69BA90E1E3E651D7DF3 ey#uv
80,262,991 *0887BB66EDF6956152E9887920510224C87A8CB3 ezequielsugai
80,262,992 *0887DAE370EC293376B808856CE2D257BDA50BD5 cc8?i
80,262,993 *08866EFE35ADB302D4C194D622D146681DD580CB 7UNACCOMMODATEDMAN
80,262,994 *0888F7A62459BC067AB311BF13EBC846D92F627C F684B2F3D4218EE06DAD551B3BB2074B-THISIS
80,262,995 *088231A60B2BE8F7D12E3CD426FE8C951488DCCD [email protected]
80,262,996 *088A142DA94E65D7F69CCB55C38EBBA3117AA1AB CD1T.
80,262,997 *0882EFADFC6CC739F2440E76F8CB425DF79421A9 CDGI.
80,262,998 *088E02F9E7253780ADCD4D2D088A89C72A94BBDC 81ephar7$
80,262,999 *0885CE5AFD2809D578C9D343DF93B94A8BF3471B FALL_HERRING.F/O/L_'H/E/R/I//N/
80,263,000 *0886FC44D09132772D531D0BC88D71552414EDA4 851MOLLIE
80,263,001 *08843886B1377D2A667DB169242EFE47E095CD36 fatalgr
80,263,002 *088A147CD237C2755FFDD11D64D65C979A01E535 celialib
80,263,003 *088E5D4BFA9C86B92C00536131A64B314DE8011B FCLUBFIST
80,263,004 *0884E3542A00ED9354D1E87310C961BB66D8CF48 featurings,.bsides.&.rarities.collection.(disc.1)
80,263,005 *0889A1EE6531C77A8D28EB6BBADC15324B6A5E5A 8daunter
80,263,006 *088680C7A9ADA0A6D68EA18081E59F8193BA51C9 felipe265
80,263,007 *0882A4BF42654AEF4DA936680F33D001EAC6133D FELIX.GONGALVES
80,263,008 *0881CAB8C48A418FF95E99949715D9F41570DC90 8EATS
80,263,009 *088D52B516764C3DE63FB08CFA522C89AA65BD9D 9EKSKLUSIVITETERNES
80,263,010 *0885BD664BEEB92B6611B03494FADF6EA027A90E cfjapples0
80,263,011 *088DD1EFE7AE3649924A0FA71D8E14109DCB11B0 FERDINAND.SHEEHAN
80,263,012 *0888710C746EF9BB8D6D4E0C4EF6F4CDB6148231 feryalkhanoom
80,263,013 *088C7C0ACABC08859D388E9F9B5A066968F1AD8F [email protected]
80,263,014 *088ED9E2F037B3D23996D708B275B848565F5813 9SEZILAMR
80,263,015 *0883ECB7C3AA0B3EB5F3027D186505353646E09B 9SIBIRISCH
80,263,016 *088FC117A9D07424D1E46BB6F6CCCD3319F88C06 9SNUFFYNIKITA
80,263,017 *088ECB2E317CD43487C971852B0DC6E935ACAD45 9SUMICOLBSW
80,263,018 *088E9B171FB2E32A40B19ACEB3EACE35DB4293C1 CHANDRASEKHAR1
80,263,019 *088FA414004E4C7F6E32AB6EC0E3AB325E756D34 a4ohce)no==kng%(fi
80,263,020 *0882117D0172F27CDFFC22FC0EEAE6055E571856 CHECHNYA'S..CH.EH1.CH.N.IY0.AH0.Z
80,263,021 *0889D93B83316577E9EDC4299E3AAF9F7A0DB42A chen-sau
80,263,022 *0882E3BE845AD732EEFBEEF098EED0FD7D2D3E9E a87gf
80,263,023 *08881A6818F70D4A53E61398761D836DF2C68C18 8taiala8
80,263,024 *088541516FA2E4734A0ABBC11582278D9890CB91 CHIPMUCKS0
80,263,025 *088E17423C397D539BCDCA16E8F3598E74E74DB3 AACD?Q
80,263,026 *08850788C5A5EC72999AF78710BEAF93829EC83C FREDRIC.GILSDORF
80,263,027 *088633571FDA2C1F95F2938AF0D3CA814F4CA324 AACOV(
80,263,028 *088B45D3AFCCFB3188D6BEFC30970C100A3F4FDF AADEQ.
80,263,029 *08806E0ED9F3C1676ABC795EE98DA19A49DBE331 FRIRAITS
80,263,030 *0887D97D04A4D958B89202AAEAFE57E6A36B0D59 9BRUNHOFER
80,263,031 *08865CA00E2380572FE1141AA384D3FD5C83A7B0 aahtamaning
80,263,032 *088F1B111FA899A7980E8DF378574141A648A007 aal)m
80,263,033 *0887F5C82316C26EA3473876CBAABC50DECB2A40 AARH+
80,263,034 *088CFAF779B6FB8FE2C7FF2B594C06D38813F87B 9KESTEVEN
80,263,035 *0889FB6D087919A85D0C77D96087D0F21250BB3C abelekberg
80,263,036 *08824E1A1B5F647FEE1D9F0DBF7E1E3DCB73A36F ch$wt
80,263,037 *088825E443DC61CF5AF628935340B80EE501C496 $cifi$ex$tars
80,263,038 *088D3DCCD9D4A8B19CC91D1EA984D98D80EEB124 ACABAREN2
80,263,039 *0884A406295A418EFBDF29FEC35D3712D27A6AD3 acasado
80,263,040 *088F36B2EF3AC15A24EE09D9BB2A207B6230DAF9 [email protected]
80,263,041 *088C2C5C3368BBB6A1527880C9B6B4A2E4B5367F [email protected]
80,263,042 *0889C8B2064994F9C8455F250382EB8FA873420A C:J6
80,263,043 *0887CDC642105630BDEA1DD79985717FF1AE96CE GARRETTSACANE
80,263,044 *08896E7EEACAC9819C73EBCEBCC26F8778A22013 A0N1CS
80,263,045 *08833719AFDEA23C62FBE170B2D5F76D2CD88D99 A10025.473
80,263,046 *0886EF1B008A9A40B5ED5416ACC64F38CDAB492D a&1o?
80,263,047 *088E7E65015A5B196D85CA6B33AF60F244B93F0F adamfawbush
80,263,048 *0888A4385FA978987C94FCEAD1BDA4006E043698 a32;
80,263,049 *088C0E1B1EA6313E3CC6EDB802D2BBD181939F81 gebakkene
80,263,050 *0885CA982AED7B8D413563C03C5340E52E4A36F5 geoffreykriesel
80,263,051 *0881B048728C8D785797283EBEC484F3873C6B53 CLINT.HOFFMASTER
80,263,052 *0886DCF49446AF9F197F9AF8FC7E6F4004A7AE50 GERALDOMUSIELAK
80,263,053 *088B710B1473954C724C0CBF8FD1336B62D1E789 a7m5u
80,263,054 *0884A53AF159B42FA7A0A8D3AF976979B4DD2F1F cm%=q
80,263,055 *088684603FEECD335C8DAE64F637D752D81717AE [email protected]
80,263,056 *088CB78EB6C9F994F2F2D4D551D1FC1A74D665E7 COj8
80,263,057 *0886DE304C5A4D4E20757A948A9909A26E0C28AD AHE&T
80,263,058 *08829F7CD544EF5C95969AFE32630890B882BC4A AAF8I
80,263,059 *0883DF76C544A2D69DEA82F3E0D27BBAE5FD8101 aho=
80,263,060 *088EB2F0628F454915FA8494B30C28207B48BA62 AIKMANSPENCER
80,263,061 *0881B85F9C15B56920AE40349CD595C3F4C0D9BC AAWYD
80,263,062 *08887F253B48B585E3DCAA333CDFD19A6C92A83D ajlc_
80,263,063 *088F4E62B340567685788DFD63000ADA21EE1D91 alacm
80,263,064 *088F65C1DA1AB2E8F46E8B8C7F8D424EEB378900 [email protected]
80,263,065 *08820590B45F1DAD423AE8E2F5A3566283845D78 gy0j
80,263,066 *088E4392831052C22751D1C4106A9446A10438F8 abhishek-wagle
80,263,067 *088968EF583E19C525C1D933542A6F953E92F5F8 H34DS3+S
80,263,068 *088BD651557129805049AA6146F8BF6D1540D7F1 AB?O&
80,263,069 *08832E6F8BF7E69E762E6DEE57DA5BDB5DA42A7C HAAKNEUZ2
80,263,070 *0886C2250EA62D3EA6050C5E005457125119FFF3 absichtbswing
80,263,071 *0885B3D0BD7CB0497B46C9D3A3011C47BE371261 ALJ4&
80,263,072 *0881274CA7042D9356D7B7C469FF1001ACE3EAA4 allaudare3
80,263,073 *0884F67D3AFEE1E214E611525DBE10527856DB1B ACCESSPACKARD7
80,263,074 *088370842FF0399873CFF56D91CF38394E47CFBD [email protected]
80,263,075 *0881D9C57D60223E6E1B4E1966DBAEA604694EF2 HANNAH.REIMER
80,263,076 *088D4AAEF3FE21424C886C4DF42EDB3452A8967A HANSHORKY
80,263,077 *088FF3A1B4F0C4B6DDABC7664E174FFD273ACD5F [email protected]
80,263,078 *0888BF3BECA9EB933805FF84661C7AE95BC079C5 HAPPY-GO-DUMPY SUMMER
80,263,079 *08845CF0526993F85A94639F3F58050A1111FF63 harlandscheu
80,263,080 *0883E3654420CCE443BF50E8CCCDBAFABA70ADB3 alvu
80,263,081 *088145A8CA324D710ABD22B859745930303F1098 AME1IORATED
80,263,082 *088A0B2698A7766553E8C246A90B4F5A00FE0CB2 C:QVN
80,263,083 *088C6204D8276E4FE06C02181BB3A0D8BB59AFDE HARRY.HUANG
80,263,084 *088F266F501378C408B9D0EA8F0B4B7DA8AA3A3A HASSAN.DEEKEN
80,263,085 *088E931712290539FBE478B8AFF54E9C9C4588AB craigdavid
80,263,086 *08876207274D95E52794716D7B95D875E041CFC9 hcilbiew4
80,263,087 *0884EDE71BB637878A78F0C71C442CCF64C9C209 a.deleted.symphony.for.the.beaten.down
80,263,088 *088ECC634DB8B644774B688B6DC9409FB270A5BB HEARTACHESOFALOVEUNTRUE
80,263,089 *08810D32F4E47833234D63BB6DD813A7F68A9880 andreasockalosky
80,263,090 *088D1681BE49850817279D7E48975EB9F082BF91 ADQ,S
80,263,091 *08824DE56D655C8EADC3F3A0F882C7C86C009AB6 heliochrome
80,263,092 *088A6073AFE835F58DC2783D8E6BF85AC2BC9DD1 henry.domke
80,263,093 *088125935D82562CFE61CF5CC9CA1E0058CCD88D crzw$
80,263,094 *088866014D5DFA46587133369A8A288FEB0A6222 andresbisesi
80,263,095 *0881993E43DE83AA220D0BBEDAEB20C3B3A83F09 CT(ET
80,263,096 *08863BD791852F21B20F3F936815EC69C1900A17 ANEKSIJAED
80,263,097 *0889158A1FE5435DE386B65B26EF0BA46D3D7885 CUOB3
80,263,098 *08811854C71DB53B077E6B11495C11A216A54FEB hl>c
80,263,099 *088A2E06CE9679E826601CB7275D1C88BC2F0C1A [email protected]
80,263,100 *0883BB984C212074A3F93E50D9974F5BDFC4F8E8 HOCEANOGRAPHY
80,263,101 *0889110A2035D477421B6E92B9651B28741A6C47 AHANDLINOCONNOR
80,263,102 *088FA5BB41B7D2901D7679A62235972923493480 cәрсембаев
80,263,103 *088B73A82A7BE12AECF715E8C39F0C16CA543257 d0gq
80,263,104 *0889282407150383B7C54247B0FCD66056348B31 ajdto
80,263,105 *088810E0459AF9D8E353A19740D79943EBD701F2 HOYT.BLASINI
80,263,106 *0881DCA46458DA4136E45AEFC1B6D860871F2067 [email protected]
80,263,107 *088C7ADB17CB162B7B3A07500DA32CC41FE0E0C0 HSG193
80,263,108 *08838375855B7FA72986FCBC5D3ED94424E9287C ARCHIE.KLAY
80,263,109 *08826399FC39221025AD2CD93103D24D860A1F6F a)kva
80,263,110 *088FC70AE1938E9A58958C02D0681826FDDBC243 httpwwwtntyouthmin
80,263,111 *0884A1D9BD051F23F622B8891B283478F6A3CCBF d6yu8
80,263,112 *0889E29AA7EADD89421D4C62C16BAB80D1C19F26 ALAN.LUMINATI
80,263,113 *0888EC397696D01198CA5E46F6F3E9EBD027ACCD alarmismsed
80,263,114 *088354E0F322ED8E72D761A61F06BC54386A948D D9FB
80,263,115 *088022575FD20FB2E4CC59A12571DF1335AA35AC [email protected]
80,263,116 *088E47435EC560BC6DE26C3367B4EA3EE3290F55 [email protected]
80,263,117 *088991DEC0BEF0268AE8FE84242C499ACA7C6FE4 hündlebahn
80,263,118 *0884235A1FF243E6D77F4F0A106F0CC674A65D86 dalmatian679
80,263,119 *0889001F932C7FA5B26F8053D0816E118D281F46 HV05
80,263,120 *088ABBC6B407DAB765C1AA2E585BF0489104F39A aljlh
80,263,121 *088F083A7AAED29DB28FEACE35E499079A7C4E98 ASHTON.RICKMAN
80,263,122 *08825FD118F34FAEC5B489F048ADEE8C102C8021 ASIF-MUSTHAFA
80,263,123 *088B0282A0638DB4F549F99DA36E13FFB299AAA3 IAABASIA1
80,263,124 *088A47C59A7FA31EF3906979A255B2700CB881E0 iamhelpqwer
80,263,125 *088F5C390731877A11D6292DE2E650A49D2A76CE dariusvann
80,263,126 *0883B279CDEB47CCA9B7EB945F59AD9C68B9E689 a:lzf
80,263,127 *088BF8B471FEBD5126204F997E8CDC3053C09DDE amanda.gerdts
80,263,128 *088BB10048758C9EB1FDE0F497F5B3201B85E407 ATYG
80,263,129 *088D0CAF306D05976BC6374E47D72843FE0276EF DARYLLENSKE
80,263,130 *088E04BA30115F65CB4A20A8244A1EB00A57292F AMMINOLYSISING
80,263,131 *08878007581A60AAA13E1852C0B9F1593A190DA9 auo2o
80,263,132 *0882A18DA4E8D06DC7E53BCA37D61C896861998F amph
80,263,133 *088CC983B906EBDE54FB070E47D4C6B8D9BEAAC4 d:?b1
80,263,134 *088D9167FFB8F20C25227E7FCFD84B7CF7B0AD95 AUSBAUNUMMER1
80,263,135 *0888230495CB9BE28ECEBA1C6EB90556201F0CC9 andken121416
80,263,136 *08852A0CB472645BAC5153D2E834E388A60FC2C5 awvhb
80,263,137 *08874FA7AF61386641BF7D283C33E4CFAB14A9AF anh93
80,263,138 *088F9282761830947445BB511B3893D18CB198AB ÎNCORDEAZĂ
80,263,139 *088739E3765D43CB40BE49408E1117D9EEA8FD05 dejetta6
80,263,140 *088619769F52640B2CCB432541677C8406AEAEAB AZK:
80,263,141 *088E020F87FCB4BDC5A321A63DF49EC4A888970A DE(M?
80,263,142 *0880AAC95A34BD19D02505486C02C19E33C094C9 B0L
80,263,143 *088D31B55A320BB3E78C106C530A7C5B1C760B60 ANTONIO.FIGUEIRAS
80,263,144 *088127BC529BC1F23824CCA628CF5FB05EB51412 [email protected]
80,263,145 *0888D769BDB8DD8274BCCEC64685AB2650BC8955 DEPHASERS0
80,263,146 *08881AD926F99187FAC2C3522D19E688E0222CFF ISHRAQUE-ADIB
80,263,147 *088EABADBBC197D90D21C3B58253123538B88ACA ISLAMISAIENT
80,263,148 *088415B77B34A03C7BEDA50F581C9CD96A26CC31 issomor5
80,263,149 *0889E7F228681711AE01B38385DE9577A44607EF ITADNONI4
80,263,150 *088F1FDD40C49B55243A26B0AF8DAD2A6DAE4513 ITALYHAPPY1
80,263,151 *08819111D342D9B1471D22A3BD91D5E6B2C01E0A IVORYKINGMA
80,263,152 *088B6AC2876A406F0246CA8020BBD79051404922 B#####@~`)8(
80,263,153 *0888C6576D48D1FA6DEBBA7FFD3898860586409D destinogeri
80,263,154 *08847DDF7B5B8C80789387741CCDCBBCBC11F963 badgolfe5
80,263,155 *088029A4FDF4058E5A732C172A2F4AEE73441A49 jacobcottew
80,263,156 *088ED7166C94209C82987D7C73C3D9CCB8D9E1D7 apsnh
80,263,157 *0888F4820BFAA5556EA465A07E6622DD8AF0DDBA jameszanter
80,263,158 *08850E3D5E1BE282EFF0F72362A849B9236A621B dharma33
80,263,159 *0885B5ABE5EB0FDCFEBBA24CA8FC80413B878ED9 ARDAENS
80,263,160 *088B27B436D61ADB7B9D1BCFD70EAF5BE85296B6 ARDEN.BARRERAS
80,263,161 *088EBEC679B447E72B0C5FA059990081E66006C1 japancanam
80,263,162 *0883CE348AC88E8D993094384FA95053875E092C a-rivista
80,263,163 *088DFD42F9789715974A234E023F70DF224AC6E3 ARON.DOKER
80,263,164 *0882562203E367CB18E66B065D09EFCF423C0E8F jefflunn
80,263,165 *088AE886928FF4C8C72453249C81745624D96BB2 b)dk
80,263,166 *0885E7D282212206A3DD07B653A550B40C22B59C BEAUSIEFKER
80,263,167 *0889F5712C0756F808ED95095BD479748F3B170C DICK.JUTRAS
80,263,168 *0885958D18B29C2636B1B192C78E8CCD163B8383 jesuitisation?
80,263,169 *088DEC97A41B88E617DC0B6C5DD2EE404948D26B a,scv
80,263,170 *08841EABAD06537B41C37AB0920DC711E8303700 bengtcw
80,263,171 *0885C40A7D27B6D0540070A8E1218C95D7600155 [email protected]
80,263,172 *08827987DA65326C692295262E16887D0F73DB24 BENJAMIN WILLIAM BUCKLEY
80,263,173 *0882B7F7733FE5026696340AB5B0E5FB975FAF9F BENNIEDRAUGHN
80,263,174 *0883811D939ECE61ADD49983FA0145F296C72F45 [email protected]
80,263,175 *08892E97E9AC5217BAAA712B36CB921D6BADA77E JLAVAKA
80,263,176 *088939656DC8C2EEF7235C9F3EF25E94A4FE3996 BENTON.ORLINSKY
80,263,177 *0884675DC2F9910061C50AF324816D603672C4DF JMAHMMA
80,263,178 *088988991150EFBD1D142687157DFC95B4DEAD32 BERRYDENIZ
80,263,179 *0883C3C5B97C54D9B9FF9D85CC1AE3C4D00CBDBD joel-crisostomo
80,263,180 *088C1E7528143B83D01B278BC2889A3C5F077A64 ATASCOSED
80,263,181 *08832DFF69D3ADA290102F133151C8C5A6B348AD at!l
80,263,182 *088E2942A2DFB98A5B07C0C38E8488D756000C4A JONATHAN.RODIN
80,263,183 *088166F3AE437D11D394A6A04BDA4CBD65F27B05 Bg7
80,263,184 *0883C5637C8600003478DB8939DA7D80CC88D884 d%kt1
80,263,185 *088ED937D8989A5DF07777B69920FE14D00C7517 JOSE.VILLAGRANA
80,263,186 *088F21A1E9DD1ED5B9873C1D14638BB07868169A d,l0o
80,263,187 *08899FDDD42DBD7FC9739376C6820F16B964CB07 DLE$#
80,263,188 *088A9B9AAE95784B0A7C2D240250964FB2CDB716 dln?a
80,263,189 *0885E16F114CC990E28D2605B2BD20EEEA597E6B DMc
80,263,190 *0887A8B0383647FEE69725BC579C9AF8F1304392 dnakray6
80,263,191 *088AFEB26E6F8CDD520BBC9F099AF31FB4AA14FA avu9r
80,263,192 *0886C29C6329913634130C10957CBF73D6125116 [email protected]
80,263,193 *088E2C0D06240318010A5D8F70E0481AB5F156A4 b0dew4sh
80,263,194 *088DE5DDBCA26BD3BC8433370B5572734081B2E9 kamlong
80,263,195 *088B81248AC4F1F9EC75B446438D05B18D39CE28 DONNROUNSAVILLE
80,263,196 *088C3542AF310272394C13AADC1823766E8BC8C3 bloodnoun3
80,263,197 *08838E567C45953D753E786FD12151C8B1EDE0BD bluenavigator
80,263,198 *088AF5938E3E6F20CA279D09C618E32D4F5538F8 B3LDAM35
80,263,199 *088C45B515BD77A60F7E4E3F498D684D6DA7B86B B./5
80,263,200 *088B93348C8128E49EA20C8FFB339C07EA59C3A4 keliangie1
80,263,201 *0887182CC9F9218EA0BF0D335CFEC714CC6D6363 keltersportplatz
80,263,202 *088BF856ACBD36C846DA766C3FB70D0CF4E8DC12 bo!ne
80,263,203 *0881FB36B3A9FC1F5D1BCCEF827224EB7AAFBAE5 [email protected]
80,263,204 *0884CB9A004FEF4B9E54F4C8D25C9CAA721974B1 bachalari
80,263,205 *0881ECE381C49FE27CF01D6924BE75B4C8C7AC14 b"q.,
80,263,206 *088B419A335B2A101342C4877E49C8AF4AD4BF96 BQJC:
80,263,207 *088C9F44A1FB248F2E7FD5447D44F8410B640539 konopíjelék
80,263,208 *0886387C8B28AB4A0459455B24E9033C0DF9569D korysitton
80,263,209 *088A4435FB97EE37D86485C97A73A20E2245C3B6 BRIANFRAWLEY
80,263,210 *088A9D07D25AAA5FF8972240E52FB37435EA2D3C DTB_-
80,263,211 *088583B8D8544FD396D54B1616FE0A3B712869F6 brittrussak
80,263,212 *088F851DF3A39A7DA2FAAB0CA1A26D2DA5BC7610 BRODERICK.KYSER
80,263,213 *088AEE1E1A27B834544886D726C8E7AC07178C3D BRONWYNGLASS
80,263,214 *088BB9803DE12F2E21104F3022408D7CB43C210C b(aur
80,263,215 *0881DD346CF8091EA8930813824F167328E7B28C B"(B
80,263,216 *0884B14F1E3F3D0AFD8D44BBFC41F5D650C604BB DVENDHAN
80,263,217 *0880F2BA8D80F2E5A85F0FD7E03F798D446B1D1D [email protected]
80,263,218 *088D4F3239C6984C8C87AA8605EBDE164F329A02 BUBKING
80,263,219 *08864E1982EE90241BDA90DD920226A411D1F501 [email protected]
80,263,220 *08816AFF1D4F86CF4AC2898A08A41B7FFC19E9B5 DXTW=
80,263,221 *088296BEC075BD679FF833D714B82698523E0971 [email protected]
80,263,222 *088C7E14D98DCD9EF10C0DFBE2F35ADBF0A3F910 [email protected]
80,263,223 *088E2060CE2FE031860F6D85E1A4185EDF6E59A6 bv,k2
80,263,224 *08825660CB57DB03E56C112AEA271E6AFD49180E eay_/
80,263,225 *0880101519C355537402386D084AFECA04E3E5FD BWMTG
80,263,226 *0880BFA0F211CCE5830C6EEAC9EDF99C28F2A7FC LEADER-OF-THE-MINIONS
80,263,227 *0885ED069E9FE5E8057B93D8493509ABA59FE6B4 beemdgras4
80,263,228 *08879842966B9DAAA9AF7DDDB911B2207A629A56 c0mp4r47!veness
80,263,229 *088A1FD4F890D752ABB731069E9524F3777E8CE2 C/1
80,263,230 *088981342E0CE48FA11FE9E8F6164145CA02F366 EDMUND.KLINGAMAN
80,263,231 *0882B5EFAFD4804610FBA34C14CF7E284E45812B C/62G
80,263,232 *0880E13C581BF03510E97459DCE83B2DE9B072ED c6l
80,263,233 *0884E8247ADD5421D0773D75A6891B9C2D55F8BA EGRATIGNANTS
80,263,234 *0888005332C4FD955745AA1417F857ABA5611D6A LIENESCHED
80,263,235 *088527C89692A0EF8010C215D8B5B345E3879A0B BENITODUBIEL
80,263,236 *0888DC45260AEF6839D0E17889BF0A7453D8DF16 LILQUAT9
80,263,237 *0886DE85A65805652337D142F4DBF1114B6A7E91 EKGIPPEU4
80,263,238 *0888A4F27E47DF975CBB6AE918B5206AC43DDCC4 eks!w
80,263,239 *08818F31F7B53B4941BFBCBAFB13FE82EEFA7360 LINDSEY DIAS
80,263,240 *088145CED3FC6CB08CF3E13D2ABC608FE3FF77C5 [email protected]
80,263,241 *088441FE4D01DF186CD6AF05408D522276A42E67 ELDEN.TESTERMAN
80,263,242 *08890A8D939105E2C377CF1BC2D6839DCC226800 elevation.(free.my.mind)
80,263,243 *088FB466E637007BDA8CB2C07E9E46FE5A245415 [email protected]
80,263,244 *088C1B462E9B7881971662907841A745AFB972F4 bertsovak
80,263,245 *0884F262F9D4F8EBFF03FBC995A8881F98AE47A7 ELIZABETHADEGBE
80,263,246 *088EF741DB1642A3471D2A450D0D342E595D4060 BFCW6
80,263,247 *08849430553481162164E0DA6B279D8D12ECAFF4 londonforestillingen
80,263,248 *0888835E157B2C6EE8ED36A7597187BE104ADB86 EMMANUELKEYT
80,263,249 *08887AEA82F831118C0D25419ADD601EE1CF3A85 EN12121716756
80,263,250 *0888F1FB549EC362D9B1314218B225240EE62B42 ENESNOPSES
80,263,251 *088613B712DFD56D9D877883466EFB9E8174C16C billylaurance
80,263,252 *0883772E684EF27E857B019A30FAE4B79C921A4F CECIL.AHLHEIM
80,263,253 *0880A7E5026359602CB93EAFF36D61C170BD3DFD enkhbatyn-badar-uugan
80,263,254 *0888819EF161625A8FC2F625AEAC4132AC4BA58F CEPG1
80,263,255 *088FA9956C03BF052859F41ACB07A06447166B73 BJDU_
80,263,256 *08897D29ABF8E1D9B8E865DE8333F2FC056D8918 LYNDON.CARABELLO
80,263,257 *088C6AF0C6E507C13389F4D6A4F27916C0E492A9 BKUM)
80,263,258 *08844D773E5DEA1D2FCF66AD5EE45174894241BE ERIC2592
80,263,259 *08883008571B7040961F654F5D5D91E1BDF806D0 [email protected]
80,263,260 *088A7250236B1DD05A7F767AD11768AD23427D2D blomguist6
80,263,261 *0888C1E9735A8FBBC477EB9AF8711E31D98743DE BLOWTUBE0
80,263,262 *088A18A192A41BBDBC06228E634DD6FDF0ACF982 MAGJAJAKOLAKO
80,263,263 *088FC0F52B4AD5A224CFE2BA3C59189C151B5D14 BNUSSEL
80,263,264 *0885EE7D1FB98FFE0E81966AC5A26484884A054C bny,h
80,263,265 *08811C370C2420C07E9B6A107DB85EF7219F01EF marcelcorren
80,263,266 *088442E05CB5F9A57846E274A26CECAA6F650C23 boises9
80,263,267 *0886233B4B1A4BC1BF95092AE6182A5FDE900CDC marcocorporon
80,263,268 *08836633E8431E4C143672A3784B89AFB9474F3F euteliinae
80,263,269 *08874EBEF0EB3DA149E35943739E89B0C0738E46 marioenrique
80,263,270 *0888B64C7896A14D779AE51DFDD0297DD61D61D4 Mark-Son
80,263,271 *0887E96228B914AC7A9619A1118B62AE15FC420D CHRISKISIEL
80,263,272 *08817CF9E237EE3600891C38CEE332C48AAE560A CHRISTIANMOLLY
80,263,273 *088409CCD0A913D3E2C4EECEB83E639DB959CC5C MARQUISCREVISTON
80,263,274 *08801E9261BA3FADD006332138637B02755BD96D MARSHALL.KILSON
80,263,275 *08814FB8BC155D1DFBC3D2E8360A6364FED95001 CHRISTOPER.HOUNSHELL
80,263,276 *08829921C962C0573AF7BA5B56D92338D2C3CDB5 CHRISTOPHERMANCHA
80,263,277 *088D191D4738CC00CA212C74386E46F81D797348 martinhane
80,263,278 *0882730E3F3CE44142F057D8E8584216F5289AFB exekutionszeitpunkt
80,263,279 *088EB67E13414EC5B16F639690085875936E1A6A MARTY-TUBBS
80,263,280 *08875E376CAA0FC0F007DE5D5CD47048F85FCB91 maruku
80,263,281 *0885DA1EE69010A2138E9D6DEE5F90B9D4CBE781 EXPOJOVE:METALLIC
80,263,282 *08828BF43EE87ED02726CF42D2BF12340394FF26 cindiasdf0
80,263,283 *088C125306BDC25DA256BD284FC00EE13C726FCC cinotart9
80,263,284 *088660FFF1F50106D8CCE8E80DC7B0036969930C matthewfreitas
80,263,285 *08836F3E716EC76304490A470778F1ECCB512823 mayday
80,263,286 *088EB61CC0F4E0A2229BF341A5241208253501AD clairmalik
80,263,287 *0889FC5F1CA6A77980F6DEAF8BB11E3A3B72B376 CLAIR.WOYTOWICH
80,263,288 *08879C8679BEAA35C0FCB442C953D779D47D1C1F BRANDENGUNST
80,263,289 *088403F16D705512FBC1CC3E816A9B381498923D CLARK003
80,263,290 *0885A4089AB5DC2F6F1BCC70FB99F8C80603F6D1 brendanmontore
80,263,291 *0882DC8A3FAB3276BA0B5F519B68E9AE072D2F66 MELISSA.DALEY
80,263,292 *0884B8606F47669DEA91B1FBC8038D7FE9825435 MELVIN.TULLEY
80,263,293 *0888B3E8BB2890BE7166DE26E8AB85074451EA7B [email protected]
80,263,294 *088FE5DD2631688A11A2812FD6A9DAAF74C8DD1C CL)HS
80,263,295 *088BB5B141F25AB61C039E0EECD3DE3876ACD819 METALWORK?
80,263,296 *088A0F7041A803C9054247EEF53320204DB8C70C C-L_S
80,263,297 *088E27E52E91887761C95DDD9B44EEC92CCAD434 BRITTON.CAMPBELL
80,263,298 *08884BFF608680D213B82ABBABFE9B12D21E06C3 CNBIF
80,263,299 *0886BB93C1B1062DDC24EA1520C9D394A5139392 MIKECLINES
80,263,300 *088F0A2EA3FBA78C9EDBC962DF89BA8B8C3D1DA2 C,NTE
80,263,301 *088EF92F6E020197832B2F423912F5669A136A8E MIKELTORRED
80,263,302 *0883D675F40621138D870FEC2825B74E60B8F1A5 FINEQUALITY
80,263,303 *08865194F3A79955E8FEB7FC468C369FFAE6BBA9 [email protected]
80,263,304 *0887A9EDD649C6B53838E6C416E7AFFA6092A9DE florentinovoegele
80,263,305 *088CB3253832005C0AB910C8CA55E965B2E1EBE3 BSWREODGNORBSW
80,263,306 *0880ADEBE3F2CC20FD9D901D95EFA0DF6AD35B2C btmi
80,263,307 *088DBA49A70FEC8F07B22AB18C968DCB6763355F b.u/
80,263,308 *088CE080E38D3D4A4E760329CB9BB46CB48964E3 monroejaved
80,263,309 *088A6785A9DBDA22279AB5D3A999927C179528FF MONUNIOUS
80,263,310 *08828ED1A150D8A767933F6B7FDCC49674F5E884 <FONT-COLOR="#000080">#-COPYRIGHTED-AS-AN-UNPUBLISHED-WORK
80,263,311 *088C05D91E48A39EF7309E026634CAFE432FB1BF cortezlassiter
80,263,312 *088D86645FB93D6BB9D40E0ADFBD69F906F67296 fostermedved
80,263,313 *088037A69708599C829ABB61B599DE3AB40D0303 FPLT
80,263,314 *08881C8CC566DF16C6346ADC8459C3182854342F francisco.conejo
80,263,315 *088E873C166E3DF3FE11E87195C3539601F17DCE BVALCHEV
80,263,316 *088CEFCF3ADBA03BDFF3A5E4957624E4B2A47CBD bv/b#
80,263,317 *088DF1516C955677CB221F9ED4933EA4CB39CFB9 na9ja
80,263,318 *08893B5D9C1991C3795253997E6D84F7C1ABB836 bycq
80,263,319 *088882A9FEF9D7068799403DB72344E31B511D86 b#zfd
80,263,320 *0881A9B915BD72EC0203F09CDE1CF5EA39C8F893 NBRTLZNG9
80,263,321 *088FB8BF0269D32C065AADA163CF898BE3533679 c0cr(
80,263,322 *088496B3208C4EB8901A887C23CB86615CAFA6FB C2=W
80,263,323 *08846DCCCB66496C2FED4A9FEC2B7C27450F1B5D CROCK75
80,263,324 *08848A0BC10D5566F9761D10DD8048CDFCAAED52 CRUDM
80,263,325 *088BA94DCF42839DF1AF0A67B9250752793C1FA5 NEWCASTLEUNITEDCRESTPNG
80,263,326 *08875B13E7748D612A5ACB1D9273E93A279EA7AD c4rri3r-$
80,263,327 *088EBEC3B14BC50928B880C7239F8B3AE5E375CA c7x6u
80,263,328 *0888EBB09736C3D30AF102DC9C360543B5390E0D CUSHITES4
80,263,329 *08813B832BBE9EC0405EAB65DF64273A5E4B7E24 C?ACH
80,263,330 *0880A84C8A04EFACAD17B6156BC2302A1C57C2FE gatorwebster
80,263,331 *088282D538C31718A2CAC34202CC3E70B8DDC6A3 GAVINEADS
80,263,332 *0889C2A33142957C2B6AEF96E1CC9561F777AB5E [email protected]
80,263,333 *088BF81F6BEEA720D7EE2E7D51231F709BA62209 cameron285
80,263,334 *08875383D41EACC117C8EB9A7D923C6C2DC5EC48 ca$p,
80,263,335 *088884B51522F435F565CC8BEB2A38ADC2CFBCBB noorderbreedte8
80,263,336 *0887BBA5BAE6E7F4B626EE451BD4D3CB43BD7615 D2i9
80,263,337 *088FB6B5DD7F4CDD39711F55F4574F47D03C0DD0 carrotfly1
80,263,338 *0887407F18BF111A5A95EDF4A67B434BDA36C072 carsonbuonassisi
80,263,339 *08831CEF9A41B55EC8CBF75EF451FF544461F693 NSXTDUYB48
80,263,340 *088B553ABB8BEE9B9D6A96D5DCD040B11DC2F3D5 [email protected]
80,263,341 *088CE20D75B98D4A314995AB0A2937BEBCF9A97C DACHSHUND147
80,263,342 *088E31EC7DA695240C5537BC70ACC1F1E9A90B3A caw.
80,263,343 *088C2FAC5B6C605EEE7C822F03F7AF0F0760CA74 OCONDET
80,263,344 *088681B07BB778ED18EC9B330A03C768EC670371 OCSIDSKH
80,263,345 *0886763CF2BA4FD4259C5C3FB3AABAE06D10221D danadisalvo
80,263,346 *08857FFA8199426047B0F43C24049CF287CDDD85 ccgcx
80,263,347 *088665D1B32F4153607196EA596629E8E63A83F5 C:\Documents and Settings\FireXware\Local Settings\Temporary Internet Files\ContentIE5\JFDIPFP0\RSS_OFF[1]png
80,263,348 *0888357F4981B55B29CBC373C6CC87AC5C1F22A8 DAREN.POSUSTA
80,263,349 *088FA0AEE1C079BD3C5D4D432812B138C555D0B4 CDY64
80,263,350 *0888FC6497791E8FB4F7D7845FFB0A9FC1AFB162 darins
80,263,351 *088AFB8992CE97BFC43F1247BB51A5075C463779 girolamo-di-fazio
80,263,352 *08856C4E6A4E7C79E40876EEDB67AC08381E8FFD ollesheim
80,263,353 *08859D09E5B487BCB43EB571404350EE03DEDF1D DARYLCOM
80,263,354 *0882ED829CE1E850874606573C9845CB00B51345 ceph4l0cy
80,263,355 *088E0AEFC11107B876E9F176E2203010A1E27550 DBALH
80,263,356 *088AB0919700E7E749CC3D14D30CCD1568D4BFFA [email protected]
80,263,357 *088BB04E848DA8272E835A0753251494D3C9D70F c,f(h
80,263,358 *0881EBD6D37AB4DBA9AF2D0C672FC8A453134880 o><~`.~`.qp
80,263,359 *088B8498D05BA2B19EA0E0067C4F7B17F3EE4905 ORFEJ
80,263,360 *08891D2733AC6EEC83A5239E7C5FB659D75BCA73 deaspirate5
80,263,361 *088FEFAC7D0434642A93C2106E77F899D9CDE84B d;e(b
80,263,362 *0880AD7FB17C694091123492BFFBF272F117E47F ourselvesheartily
80,263,363 *088319B95B7E7ED40775C734FFF687FF44FBA433 CHEI123
80,263,364 *08852817D116577E115FBC70D57FFA1505395858 OUTLAWBILL
80,263,365 *088947AA2AE68D8FC910E39FFD59E05D4DFC7BD8 dektn
80,263,366 *088E04D40921C6DD68A3DED0E66119B1663516BC OWEN.GNABAH
80,263,367 *0886072E9079033654485A2B90A2BCA84170C064 CHESTER.FROATS
80,263,368 *0886C92E4CB701A08D6659575F4E86658F6ACA15 DELLEPMO9
80,263,369 *088B9D8B32CDF61C91A1402374948191A34D02E7 delmerswantek
80,263,370 *088D633B5E229B4FC3CB2906EE9A87238C800C2C CH?HV
80,263,371 *088FCB11A0A9E38882B803322DFCD6979B11FB89 DELTA-7925-8
80,263,372 *0888DB3458AC52D669FBCD9C9255CDBD56E04513 GROD-MIT-FLEI
80,263,373 *0882E5E7BCA072E31697F34ABBD1EC342F24FFF7 PA391260
80,263,374 *08832BED74BEA447D669486BF1AEF065D903B00F pachayev
80,263,375 *08894CB37DE18CE233B1A5F1B452CB8F972D4876 [email protected]
80,263,376 *08852EFEFC75E0A0744EE850DA66797486210623 DENIS.PUNJA
80,263,377 *088A41E1CBA07604E4C1DAAB07059F89DF4981C7 gsmuisops
80,263,378 *0886A49992521785B4786AACCCB7F99C31975690 PALUULINKKILISTASSA
80,263,379 *088D61AE69D13B82F5D70C572C0D8494AE76740B [email protected]
80,263,380 *08895D54023202D7FC926231DA52EE010F32957A [email protected]
80,263,381 *0882A9B95CBE40543989E981A6EA223362D4E6AE de%p7
80,263,382 *0884BC90488E6F72DF4A643B6F3D79DA81AF1ACB paprice3
80,263,383 *088568325899E04EA9B1435DA20B7A1D907A3936 DESI/
80,263,384 *088F936EA44C7A35361746F98B1221F5C1B59F4B [email protected]
80,263,385 *088981F0E663F1DE778E4B387FF308567AAF2D95 CIANJAY
80,263,386 *08891313227FC4CB3795C4565ABB9EE7E6A7F4EF devresnoc4
80,263,387 *0884155953727E861ECB147CA02E8D82970CF781 PAUL.LAFORGE
80,263,388 *0887D0964EEDCF6FEDCAAD82D271F27DF537B115 ci!o,
80,263,389 *088011E28ADB14EE4BC736C0CDEFAFB530DA2265 cjl8j
80,263,390 *088F3DFB8420CCB605F07002BB88C45AD150BE3F cjux
80,263,391 *0887C187B72D4CB4E36410E27CFC30D0577EBF76 d,gt
80,263,392 *08873B50273ED936C5E5998EB37659BCE798DB16 HARRISONKIMREY
80,263,393 *0888BC52970474D32DE7DB7CD94F6AC0F7FA2C7F PETRA RAIC
80,263,394 *088E902DD7C4322AED3AEBDAE6205A126F713A00 D:If
80,263,395 *0886700337002D338AB8197AF152143425F706D7 DISHEARTUNED
80,263,396 *0885EB68AEEA12AF8FA1E9574FFC2204712B71E8 HEBRIDESSANDBOX
80,263,397 *088B1E60E990D906F12AD9DF449EC15DA6D694B3 Dnei
80,263,398 *088B4F1216415D2CD34DEFAE0314AC0D6C2D42E1 POLINA–
80,263,399 *088E86182E147169433E4960B71BA2D7A0BD6436 cn_a
80,263,400 *088C45E0B94761CCDE2FB830A21426B79A4CEEBB DOGPETER2
80,263,401 *0885407B2CEC3758A303BD4F948DB2ACDAC1871F cn,r
80,263,402 *08872A9BBA639BE1DF5756F8F39E67C3CB24BFF7 PRELAZIM3
80,263,403 *088B2ED8D7426AAA9E4AE513C58B50740B1588BA HkA
80,263,404 *0882BF0617876D1563F7D10621097425AD8970B1 COLLINS-THE
80,263,405 *0884DF6CCD52B39CEF803896D335445CF7A98377 donnwyers
80,263,406 *088999490F6A218CDB4A323427FEAA3B9F2268E8 DON'T-WANT-TO-SEE-YOU-GO
80,263,407 *08822B7B2800880283F1C06B0B85E7F1B6FC9EA5 PRIMRIA123
80,263,408 *088BBA8AE18BB46051BBCE21DE077D8E74F25B33 hole-trapping
80,263,409 *0880AFF1EEB5055FF56A49C6E463FBAEF09681E7 productsinfobanccomproducts
80,263,410 *088646BEC44801615CB8C32D1999534780CA2389 horacioamsley
80,263,411 *088E578125D5EB483FF3986D7A3DEA6B9292EF44 PROTOHEMIPTERAN
80,263,412 *088AE166AA71AABA08051FF8FF513218243043CC HORSES''RELATED
80,263,413 *08809FB01837FBDE8D322696B14520825BAF7043 [email protected]
80,263,414 *088CE9D57F092C8E5FB2AC5BCF5B4D6F80EAA0C6 how2dostuffblogspotcomhow2dostuff
80,263,415 *0888965755C1F431F7AB916EA6BE6A31C1EAC943 DPRYSMIKI
80,263,416 *088FB18F6DE44A50B31CB17405DB90C4F876B217 D/PS
80,263,417 *088575D8FBBC0CDB580C4FB6E2528E3659CAA67E dqkep
80,263,418 *088EBC445D06299024CFFEB4F59432D60988EA7B HS/G
80,263,419 *088DD042917AB06E2FEE30E79C8A0BEB21234C20 [email protected]
80,263,420 *088C4782C2534721113E5FDDB6D0BFF4D78A75E2 HTTPFILEMAKER.OREWA.
80,263,421 *08802D6DD8FF9BD5B6AD7B049487B8C5D0C34C12 drk#%
80,263,422 *088B48A6B41085D7728DC18AC15CFBCEABDAEEE6 DRUMACRIB
80,263,423 *088540AE747F893B77C4DB606861717315142545 DSBSRNSES
80,263,424 *088927A4AB5664B3A0B204A4BF3C481F747346C7 d)sp9
80,263,425 *08837DA9ABE533202EB68A1A9EC7A004FF39EADE [email protected]
80,263,426 *088EAEFA5D0304DAFE1F17622E02C74EF93B9C5E HUNGY.WOLF
80,263,427 *088A758EBED847A222770059BC6FF89CA4F6A0EE HYLK0R
80,263,428 *0883904A9E5CA45203E16B26D55897A198D399A3 du$t.
80,263,429 *0889CBFE9296D99C0EDDF810D28D70900C5B709E DVI+F
80,263,430 *0886CC8CDA482335DC5A3E68F8217224AAA1450D d&w=%
80,263,431 *088859A99F4C1CB940F1A39D97AF36E77C2F68BC D]W1
80,263,432 *088AC6E01AB3634EDDAF681D299F2C091E6E2388 RAFAEL.REYNALDS
80,263,433 *088B5AAD7F95A7B0FD235015DFA2B4A0A72F74F0 RAILS介紹
80,263,434 *088680B174A2A9EAB0C71C6EBE1E2FF77469FFF3 CSKAPER
80,263,435 *0887B4F95FE3613EE7A7AAFD57A29A031D29514C e-$?
80,263,436 *08822CA2996A256DBD3600B6296E726E5F2BF6F7 EACW1
80,263,437 *088A3981AA6A38E0FA072B4006D933FDF35907E1 cubu9
80,263,438 *088FBB414FF6C9B35950F23DFEFF99AC861FC87B EDDYJETTER
80,263,439 *0883FFD4EAB568531ED716CC5B2F9523817D2DBB CV5%
80,263,440 *088CAF0F9E8B73A06A49880B030B856DA7E4B305 EDMUND.BONESS
80,263,441 *088EFFA4C430C0296EE6B3337A71F0C7F96AF2F8 ILUVANNE20
80,263,442 *0885567CFC8EF6435B079D5643CDA4376BB37B50 edmundotalavera
80,263,443 *088B10511CC7794BAC6DB7D4C3D0AFCFE0ECF037 [email protected]
80,263,444 *088A64D4674EC04D09355B607459C621FF7FDCE1 CWKUOBBS
80,263,445 *088C0E8E41F5140FC880E9A8666C928102504049 CYBER-GOTH
80,263,446 *088B40B62FFECCF17BE2965B6A37C377E6188B03 Refuse-to-Loose
80,263,447 *0885BC8FC5E34D07350C5A7FE2A70D239F7CD981 cyiut
80,263,448 *088719320647AAC6537A2712B889785AE77E2D49 EDUCASSE
80,263,449 *0880898BA562A737C24D69949031D6B1278FA3FB in73rn47ion4lizin9
80,263,450 *088F43F3C25BEA244BEE14BFAF79646863E7D720 reinaldoabu
80,263,451 *08854F1D130E134E1CEF24D048F4E669B8B94B04 INAYANGE
80,263,452 *0889CF745C3F13B908C46BBE0ABC7E457E7FF402 INCRINER9
80,263,453 *088268BCA7CDC7881945A19FF21C304B789FA683 D1ALOGER
80,263,454 *0886B9BFDB64340AF089A08C719177842F345A75 EHOB_
80,263,455 *088487DF1248FE1B4C16BC82D9378A1B10444A75 [email protected]
80,263,456 *088F58B288513F16D24AA14F714B8F2CED2A5ABD residuarydevisee
80,263,457 *088DC94B8DF8E35507474AE2A62431852041C0B1 EIP?"
80,263,458 *088AC28A21AB27C0DE1D2B0609AA5824A811EB96 EKILNELG9
80,263,459 *08808CA52C1E580429628C230E86DCC75664BF65 elaine-phua
80,263,460 *0885EA27110BCC07D26A79DD467403770893618E ELDRIDGE.YOUNGKIN
80,263,461 *08894483BDC6F058CCC476BF2662B42808C6B773 ELISHA.COTTER
80,263,462 *0889CF877B1A32798E0E97E3101CA3B707B39FF2 d=61(
80,263,463 *088BDB0B5D043E20F7CF1C912E999563CE2403C9 D6KN=
80,263,464 *0887C96F549B598BC40C2C2496293A31E60EE772 EL-SANTO-GRIAL
80,263,465 *088FAB940C789FF3F828AFD6FFB24D4397994342 ISIDROGARTLEY
80,263,466 *0887479072E1B23F1E19512C84300EA9F536CBC2 islandbronyraur
80,263,467 *0881BB53AEE1E3100CEB0758E72BEE9E2366ECBF [email protected]
80,263,468 *0883B56ABA8739D22C9AB8AAF291A5FC6CAA3FC4 EMLAPHCE
80,263,469 *0881AE2C566B87941C9E0799A7700F90C83FA0F5 J134776
80,263,470 *08829F6BE824084468023BFCE4C20934D4FFC765 EMT?D
80,263,471 *088411D649C72E7A91E259E53BD28C2DCE881E1F ROBVERSTRAETE
80,263,472 *0884E978EEDA91746D248F5B3A433AC72F804C4E EnDragosdagTilbageNik&Zone
80,263,473 *088AA757E5A65560972945E87CABDF9F373FD3EC jaetuksied
80,263,474 *088DF82E30CEC75903F74B487631506AFA44E0CA ENIDAP
80,263,475 *08838F3771834B756EBD58F682D3A398B444D2FF JAIDAN1234567
80,263,476 *0886D5CAFB6E110DA5B058E0F7DD4024AA7E4626 enraieri3
80,263,477 *088B6EAC0F44968A61F6F71FBD86886B0DD40646 db6l
80,263,478 *0883B64249A14CB0EB702731A5231CC2BEE93783 roland-marcos
80,263,479 *08847A8559144AF81B5B0FE0F85E24932FE1C8FB D+B-C
80,263,480 *0888608A6DC57FC4BE69F0D09DEE7AC92F4A1536 er4
80,263,481 *08859E7D115A967493AAD6750FD1F5A0BBD15AE5 DD,Z
80,263,482 *088114083639A02B015C5CD0370FF80670689FA8 DEANDREBOEMER
80,263,483 *088E61798E8F8757BC0C07A63D488E54A758E8B4 ROSS.AIELLO
80,263,484 *08875D29EC767BB13B31EFC92D12E77AC0DBF8B9 [email protected]
80,263,485 *088B9B4E28F53DF84FDDDAB3C092174639E89053 ertueren0
80,263,486 *088D0917BBDE07EAC6639521226F02BD89519E93 ROYAL.LASKOWITZ
80,263,487 *0882072FD6F3439FC0909C260BBD0E7300263A6C esirksti1
80,263,488 *0889D3C3FDA48B8720455F64778CE5883FF20660 rudolphailiff
80,263,489 *088DD786DEE7EBB71023D7FA9D6B835ADA7FB3F9 RUDY.ADAMSKI
80,263,490 *088D40B806112B6DF8668A410156871089D6DE36 DELBERTLOMONACO
80,263,491 *0886032C1E01D163B37E8FF92286918B1D6C6F90 JEFFERYURDIANO
80,263,492 *088566020CC50964A1804B024B0BA127BB697A96 RUFUSROUSSEAU
80,263,493 *088F277899E36E8831C2DD737264E4CB1CB354D5 delmerfullford
80,263,494 *08876F6903F32616A9384ECE5670B17BDF2E13D6 ETSANOJEG7
80,263,495 *0883CF80037403CFFA24C980E3F3F1E086686B5D ET_u
80,263,496 *0885B88DB97904A89DDD00483F9C0BCBD025B202 JERAMYLELE
80,263,497 *08809B66356023492A8D7811ADAEEEF07BAEB489 RUSTBEHANDLINGERSES
80,263,498 *088C62392C79C122C718D2EED5176FB564127A87 EUPZD
80,263,499 *088942DE844E107484B5FDFB894DC84848236E12 JEROMY.MOBUS
80,263,500 *088FB8F32AF820C45BA52D93CD3E9A45C06FA3B3 EVENTIDES
80,263,501 *08827D2D9A99EABA03F71DAED5E6A6CD7E449FC8 JESSE.SANDERS
80,263,502 *088A78ED296E0BC72E0FBE8A0CE414E8C4F2ED4C SACKERSCHÖWE
80,263,503 *088BCDB785CF259333C04F93E86F4BB0C697F347 SADACESER
80,263,504 *0884C050BF8360D8EDB460BD2CAB7C0F93248380 [email protected]
80,263,505 *0885421265614F24908A83094293171CDF104D5D EYGTSMJA67
80,263,506 *0880D901266B2CF83967B3D791B9ED86F4ADEC52 [email protected]
80,263,507 *088EEF4B9B74990059C7A79B201014D410D3156E salcabbell
80,263,508 *088B1C99709D308E468917AF8482B0449C92B6ED DE$TL
80,263,509 *088F706A290D1237F8D781860B71C8780A84BBA3 [email protected]
80,263,510 *088CDEDABEF247FA2F7A75029083FDA46FC15F89 sammieandrian
80,263,511 *088C8A3F8198BF7097910E1814CE11860EDFAB33 faisalkhorsheed
80,263,512 *088345DE1775561A350E7212C811CB3708574A10 SAMSONMETALS
80,263,513 *0884B4DAFDCC56B0E0050EDA858A4B94350FF62B samualbendit
80,263,514 *088E02AC250A94AE0D9FD29AF485C76E04680DE7 samuelloveall
80,263,515 *088EEE8E311B949ADD1385A8C75472B794F98FDA joekelliher
80,263,516 *0883716A3E00D685254A38AEED775430E44E53A8 johnauten
80,263,517 *0885DD62A765D6D504B923EAD76EE27C34B3A485 sanfordnicodemus
80,263,518 *0881218D084635BB98773DD1A4932FF604B3E2DC JOHNX.BBS
80,263,519 *08821D0473D5376C12EF7D878B85250EBB1F35B7 [email protected]
80,263,520 *0889865F6490B878D17E3A5A661804DD8CA3F120 JOLUMIGO
80,263,521 *0884AFAA2DE6B85432CBEF367D2198C37E09032F DGS
80,263,522 *0885757FD396318B88EE42A2D428AFA46AFC8258 saranda-rexhepi
80,263,523 *08876AB8B4170C4094063C8CF59CA048883DA4F7 D&HL7
80,263,524 *088DFB0C3B5ACD3FF41AB3FE75EEE2A36B037AD8 SAYA1234
80,263,525 *08834176C6AF6BC9FBDE59888D64CEA98A76040C # finished filtering the stupid stuff
80,263,526 *088360A7158C4D9558D7B0ABC64346AB3C9CF4DA scc
80,263,527 *088A92C5E37606269021EA6ECE53A6070DC852F4 SCHICKSALSRAD-(FEAT-SALTATIO-MORTIS)
80,263,528 *0887323AF114A848452857984957DD6FBE0DCD0B schilddrüsenhormonwerte
80,263,529 *088CCE2B9EBD9C454F975FAD48003A07891B0B6A DIGITALJUSTIN
80,263,530 *0884CED90A20B3E03A3F8705DE8CFE440AAAE930 F,MY
80,263,531 *0882864D09FC6AE385840A8075F0E439B54B8853 DISCO.90
80,263,532 *088FA06807BFE9C49A8C342A8723714DEADA481E SEGUIERED
80,263,533 *088A266413381C80D727BB16DCE9B9DED4CC4050 [email protected]<
80,263,534 *08822B35CD68C105C2A28C0AFF889644DECC3923 [email protected]+0+0m13$
80,263,535 *088A1E80A33176251A969BA2C219A1634AD9B48D FRANCISFUERTES
80,263,536 *088D8E31B69FDEA27B6991F58DD8252BE5ECD667 FRANLIND
80,263,537 *088523793143A99FDD6CF9E9BBD07B07F16DE58C semimuco
80,263,538 *088EFD406F96658E52A105AC3E6816729BB6599F FREDHUGUET
80,263,539 *088892D1FC0521AF76510D5A0FFB8D4328D76470 FREDMESHEW
80,263,540 *088FC4A71DB598D3C7964E91D000C4C9A95938A7 Dk$u
80,263,541 *0882634F5F532D170EE982602FC73A190A86ACE0 FREDWEISHOLZ
80,263,542 *088B019E88582CF5D659662D9B6A1068530B72F0 SERGIO.SAYMAN
80,263,543 *0883B6496708A0A567B0CC9377D8B0FAFF5B3A42 freemandazzi
80,263,544 *088A290D563240107D830E890A1336E7C98A348F KATIE.CHAPMAN
80,263,545 *088DC60A97083B335CE8C9BFB901A5E4BBE5C2CD KEENANMADRIZ
80,263,546 *088DCDD96483E2D8BDE4AFA49AA916A60B8B7021 dlv6s
80,263,547 *088CFBCA60050B1F63A398FD05C034A0A2659040 [email protected]
80,263,548 *088EDC41D9201C0C95AB23CAFF3531BC27679E1F kendallpindell
80,263,549 *0882FF3F197241F6CC70E331E1AF29992759CE91 kennyfowley
80,263,550 *08805B0C1E5A41C5962FEAB268F4B6C290AF128E GARTHGHANE
80,263,551 *0881349740696AAC8169738CEAC6AA6B27F6CEFD GAYLEAGUILLERA
80,263,552 *08838B0D0FAC7A077A07FB334F382A5FBC551229 gb.+
80,263,553 *0883251958982838550EB204AEFDBDC1A7ED7507 KIESTERS.
80,263,554 *08813ED7B2692A9EC5D3A60557B8E939BAEDC793 SHNJ0
80,263,555 *088651759827D838E76A5CFB35666489B316E5FE don't stop the rock (william hawk vs offcast project remix)
80,263,556 *088F40B1BE6461062E389BB8BD50599815E6A2AB [email protected]
80,263,557 *08863BC15FCD841E31B553E87F1266CA80B5A1EA KLJUČARI
80,263,558 *0881FAC3333AD4E64AFBA26D5677C213D02E1AAD GINGERCASIO
80,263,559 *0884558B5F7354BE7A3059EA2F1C529B47AD55B0 GLENN.DUBIE
80,263,560 *0886DDF59CDC2A81A5E91C992FFB94E92E879EAA dr;;
80,263,561 *088EFA50A6774FF2039989914841126F62A249FB GNIHTONK
80,263,562 *0882366422515F8FE2BF1587F215EC3AC753B362 SLÍBÍM
80,263,563 *0888E3226D1F240FDEF48B1296E855212DC989B5 [email protected]
80,263,564 *0880F49A00D513E1773154EC1DFBE009CF003BD8 KRIS.SIMONETTA
80,263,565 *08885A734B48A280ACD4FEBDD6F22294258B561E smaltivi.
80,263,566 *0887C8FCA7391E917CC6ED6F67CBE07261775686 GONFIASTE8
80,263,567 *088F353A168743B70C599DB5DCDAC819C750DF4F gordonvirginia
80,263,568 *088461A3B65882355F7BA4815D69276FB00C7B50 KURT.READER
80,263,569 *0887A1C851744C07774D7E3EE8E61AB26C235F63 [email protected]
80,263,570 *088B1957D4C7B547E668B972EC1EF11E04F50C1B KVXCRPQ57
80,263,571 *088A94A41A9F480B76D649327F4A7E311FC805A0 GREGG.BURRAGE
80,263,572 *08898615499DA4E10B98894149B709467183C559 GREGORY.LOESER
80,263,573 *0880AFB49F3C333CAA56529DBE7972FE71B07E0C [email protected]
80,263,574 *08806992E33EC87B005BA3E981A2EAEA8EA4457D LACEYLUCE
80,263,575 *08856B54B128984D9062D4DF96F0150C39F4D3A9 SOORESHU
80,263,576 *088B3E62717477AD73AD4EF8613DC226F9D514E8 GRTSIANG
80,263,577 *088FDC262D0201700046031D13DDD64CE060D15E d&uhy
80,263,578 *088FC370AD00528D796C88AD093A837F218BD6AE lalaland
80,263,579 *0881E7986D7DA0140D9D2171A8FAEF392D51F09C l'amfiparnaso,attoiiiscena2:anchorch'alparturire
80,263,580 *08879F172E0500A0D9075EEB2A0786895CE68766 dunegrass8
80,263,581 *088FD459349B9168D9AACA40DD042B3605351627 SPACECAUSAL
80,263,582 *0886C4B4ECFB706DEB3F4930E2D52EF4B5B29703 SPANIARDIZATION9
80,263,583 *088B151B56820303297220267AF54956AEDCF70D GUONIUMAI
80,263,584 *08843AAC1890B60EDEC685EE5EBFB66F5E1ECB79 GUOUST
80,263,585 *088C2FEA8A4DA8540DD93460E283A3B228EE92A0 GYLDYX
80,263,586 *08810FE3F13ADC5DA43387A22078A3929AD0DAC7 SPLENCULUS3
80,263,587 *08812C93CA2FAD438B1D39750EE720B813383646 ha1$torm$
80,263,588 *088D44F46186886D2CB811DB92F117B460DAA0BF hadendowa9
80,263,589 *088AEAB13D7FAEE2DE8761588AA67E6393A0AA28 LA ROCHEBEAUCOURT ETARGENTINE
80,263,590 *08892CE380C50B441AB7EE2B4DACA1CB0A53BA38 ssec
80,263,591 *088B65635F3959305E98F76F06BD289A3B4E19EE HANKÖN
80,263,592 *088C6CCF19F17B0705CB0A7EFF08A9D0F639657A [email protected]
80,263,593 *088F447B90232146B658155D9020A2306CBCBA16 e3<e
80,263,594 *0883CE9A41BEE6E58C9360E32839AC369F4BE898 [email protected]
80,263,595 *0884A66EDE11604B35286DC154819127349645BD EBNEDNAV1
80,263,596 *088559B62FBE9263BE14BA5F9F4C117EFCA3201D [email protected]
80,263,597 *08814B9327FDF807BCDA1BC4B19DA0A414516DDB STEREOMERISM6
80,263,598 *088B21BBC6CCC29245B15F768D01E71504E5D088 [email protected]
80,263,599 *0887413C44546DB1CEE9A10FBBEABB7C1918CC01 herrt
80,263,600 *088F0E66526954BF359C5D4D949F93E2CCEB2467 EDWGU
80,263,601 *0883155D8341215A0649A12E8AB9B5F6F0E27278 egeraus2
80,263,602 *088A1A5F81F3207A13C3C967F8F029AAD13298A1 lex-marquez
80,263,603 *0888DA4D8B80B7CE19E2D9B1613E7777FBC7EDF9 LHADYLORENA
80,263,604 *0885B975A36286D001DC2296A73E82DEAC6A1260 [email protected]
80,263,605 *0885AD9EA94A94A65E8819270102D51B27710467 [email protected]
80,263,606 *088414ADA4172A78087156FAC407B53E645E8644 sunsunos8
80,263,607 *0880347B0F22C9ADD03B666ED0078A85BB24A087 [email protected]
80,263,608 *0887D429062D468AE37C4D72889F33609ADEBDF5 [email protected]
80,263,609 *08861AA4521E9157E21D81AB851168F6329CD92F hjemmefring
80,263,610 *088B33BEB6C1F80AECF4BC779EC11EF61CC8112D EILEEN-HARFORD
80,263,611 *088893CFF90A898129FBFDEC510F6D5D7C631E69 einzelspielverhältnis
80,263,612 *08870A9E6CB4DFA47A23931CF3194ABEE89972E8 ekox
80,263,613 *088C22D631E14F41F78724F9DEB0BDF592852D55 HOMERRIMI
80,263,614 *0882D579738603FA5AF3E63C170EB38A6C40E33F ela.enfermedad
80,263,615 *0884AE5B4B0DDF14FE4DD6364C18B4F90CE74B48 HONESTR
80,263,616 *088B9B5F84F4567F12D1998FEC24416BEEC28342 LINGLAY
80,263,617 *088CDEC8B4D1BE525A9E6CC4AF1AC4B7F38DC7EF [email protected]
80,263,618 *0881805214C56BC597CA9CC26CB3BA61A7A019CF howarobotzappedmycanceraway
80,263,619 *088249A9836DBB009D3D65BA56648BBFEA76727A [email protected]
80,263,620 *088FFB3CCE16A3E21649C61531FD00E7B0ACC59C LO94N8ERRE$
80,263,621 *0883733339170EF60852CFF94B224995697D19A8 TALKCARLS723
80,263,622 *088E287D10FA50419D9E03948BC08A6ACFF3D43B ELTIBURON(HOLYGHOSTREMIX)
80,263,623 *088BC8B999577C8C900826908F91E3870921A31B ELZFHOIS
80,263,624 *088AAAC0B1EE70E03F155946E99D16DCAAEB10EB TALOUSUUDISTUSEHDOTUED
80,263,625 *08800215CEC98965B358EEFCF2E766E1525C68CF LONNYFONOHEMA
80,263,626 *088877D02526DDC303CA3B77FA551AC8E5A646C6 tampa_princess4eva
80,263,627 *088677124A9F150AFB88F45E59FADB601379388D IACABONI2
80,263,628 *0885ACABE047677A940FDAEEDF370BB07CD4F2FE [email protected]#
80,263,629 *088CFBF7641245C491B2BD4EF37F4A02368A6174 Targetlist
80,263,630 *0883DD3C3149EDB4C04255AA5ADA7B0C67DF2728 en.hj
80,263,631 *088B973AC575DD51B1D2E1CC2620935BC171FD2E LUCIANOSHUNK
80,263,632 *08868B0CBAA4CD1AFB9B801851ED020BFAAF8611 ENQUETERASES
80,263,633 *0887554BAE9721C96EDE7F3A31CF870310C58197 IGLESIADESANJUANMIRANDADEEBRO
80,263,634 *088EA0388F1E3994B2CFDEFC3D72991350EECCA0 teau.flight.dub).(feat..lisa.lilund)
80,263,635 *088B2BA976C85813503D52F06165CD43EC9BC612 ENRIQUE.KINZER
80,263,636 *088685BE453CC32498AF8C8B9CB17D13FC92C7F2 technocrane
80,263,637 *08849841CBB30B93C46F6DA01F468056F5CAE6C0 LYNDASHERIDAN
80,263,638 *0887EAF2A6616AC9BC9A412FD47B5AFCB45D3488 TERRENCE.WAVRA
80,263,639 *0884031EEF0E319F5F74F3087B0D5783C85FA334 m4rt415t5
80,263,640 *08800410FE27DB78A46AAEFDBBD9CD93154C1530 M5=1
80,263,641 *08890341257C083D6EFC7D66D9427AEA8E97D84B ernierauf
80,263,642 *0887D7A2D47D3318B9E5FF7D559BC9736FD225D7 i'm gonna save the future
80,263,643 *0884943812063279177F1A5D1670643B73AD7B37 THANOSSIDERIS
80,263,644 *0883F94EA4EAF38E717E53902A4A9A4D7D0D8393 IMREPMORING
80,263,645 *0881F4D89C225482EB3CBFAB9ADAF1584BC400C8 ERWIN.DANESE
80,263,646 *088C31D8575E1F1D7CAED02F9422927871539777 THATDAVID149
80,263,647 *0885BCC1BBE77E0238B1A9C7B2C341620CE6612D ESTOPHILES
80,263,648 *08866FC915D5F1F4608E89BD47E40EBFFCA7FDC8 THEINSANE0
80,263,649 *08883FB71CBC6492E36094E0B29AB254EDE0642D themediabusinessadvertisingaddendalowelintaslosesburgerkingaccount
80,263,650 *08899A1D61D6A083BD33E1936B5F315BB233F818 eurc1
80,263,651 *088BA809FF9386739F0D014EFFA4E5D8112FB662 EVERYBODY.WATCHING.EVERYBODY
80,263,652 *088E0A97A0ED9A44710752B25AF782B54D72C0C8 THEVOICEFROM1981
80,263,653 *08844A5DD286A6532A7CE587648EFFE98E5D2369 ISREALMAIER
80,263,654 *08875A1E9047A419F616D7A1943CDCEEF6C27EC9 ISSAC.BOBINO
80,263,655 *088B38B467A8BFE52927D2D300714B41448C216E TI4U
80,263,656 *088DFDE00994AB50B1DDA9C63B13CACE1DD44BB6 TIMESEAN7
80,263,657 *088C227E7F714145F9C6593ED983DD84BF020659 IXOGRAFISEIS
80,263,658 *088EFE2C286229471C2BD65AAA700514CE17E364 TIMOTHYCHRISTISON
80,263,659 *088786A0A0F848CBFD146325AF613122097E3C54 [email protected]@1i$m
80,263,660 *08858D52F8E46FFB79203FB2C62C4F5392220430 FENNELLS4
80,263,661 *0884F553591950E7A41C74EA1F3044F997FAC79C fernandoiiidesicilia
80,263,662 *0881BAB777B9FE7F7129853389F6105C3013C8D5 JÄLJITTELEVÄNSÄ
80,263,663 *0883F7E12A2EB3123EBF514686183172895731BC FIAMEGU
80,263,664 *088569626B5482814AE5B914840D9462C288A4FD mart679itch077
80,263,665 *088BAE847270B13DCBC5075EF50E4F81E6F55F84 mathilde.petit
80,263,666 *088C9FEEFF720C62854B75FC1C94233432CF61FF TOM.DANCO
80,263,667 *0888F0F229EE286B13DA9980D18B4B8C409F2BE4 JASPERTIPPIN
80,263,668 *0885C6ECC2755B1F63CC9674D8E607DBC30AA04C fishlynns
80,263,669 *088DA082CD9EA68707C6E47A1E3D73CC9D528F84 TOMTHEMODEL(FEAT.RUSTINMAN)
80,263,670 *088BE38E741787D63B5752DAFD57A11190F9E410 FLETCHER.RASKE
80,263,671 *0887DE085BCFAE35D7EBCA46D562E1A694715AB2 mayerniks
80,263,672 *088E61AD1C1DBFF6C3A9B79445527276FC846F1C FLYBLEW8
80,263,673 *088E940B7DDEACCEA2CF7379BBA814F364339D1F [email protected]
80,263,674 *088F80E54108778145AF5782E2C2C9286FD963CC FORAYER
80,263,675 *08835211FB1275CA4CAD886F6F68C9D0AD5CCEBA TRACY-SOREADY-WASHINGTON
80,263,676 *08837A9F000298AED8DB857B228FD22142121A88 trahissant
80,263,677 *088D94CEE3B912402ACB38CAFFE22668CD780CBD JERROD.MULLICAN
80,263,678 *088B5E30938E4E42BB91EEDF9C9F191865E3058F MEGUMARE4
80,263,679 *0888FA9FBF2149DBF84344F94D85607DFFFF5FBB MEK.USE.A.LIFE
80,263,680 *0880FA0E481E68064918911444C3E378D89E347B JESSIERIVEROLL
80,263,681 *088B8A4A18DAB8C7A9FD7F27BE639B2831D8F056 FOXTROTCARLOS
80,263,682 *08884C4164816F166D63E40A0420FDD14FCE695A trentonlamotte
80,263,683 *088D38589E060EBEFDA6B3F834C3313E10AC7FC0 merrillelreda
80,263,684 *08845C17E0AE5A5000EA8B32195F4900EDA4FA31 messweatherman1126
80,263,685 *0885E0ADAC6A3CB45AD335848A36688C3A053D70 JING-PURA
80,263,686 *0883D496172CF97C7D2A0CEB7308223E475A111F ME?W
80,263,687 *088F3A883E99F55A2E09FBB6429D8E09FF3F1BE5 fredbasnight
80,263,688 *0881EF54E16F461D7E512CF9163B7709E10888E3 Michal.Pavl
80,263,689 *088010E382AF8BA73975B1B1ABA0CAB5F9A4D42A JOHNC1
80,263,690 *088CC8FA1DA3213288F9E5DB18534131CDDEC0B0 TRUDIBAKER
80,263,691 *0882B650C9C02E740EC0CB7F69EFC1963C1ABB15 FROTTIERE1
80,263,692 *088601BB96E586BBEBFF26353721CC2304597040 frpetitmesnil
80,263,693 *088B14870B6B42F235CC36374281247999119417 josedoughty
80,263,694 *08833119ECE92690FD3B8B22CF5251B9AA7D5FB3 TSALFPEG
80,263,695 *0886F7BDD43CBE3C12165740105066AEC0CF6B2F TSCHIPP1
80,263,696 *088E74C41C659EBD0B3125E2451A2E9E620E7D9C JOYCE.M.ANDERSON
80,263,697 *088522EED935D00BBE8F47D112640861B1B29A5E JOYRIDER(ARTFULDODGERREMIX)
80,263,698 *088B34753956BCD69822F4D233A65131F4CCF6DD [email protected]
80,263,699 *088B703AF86FCA3803A17FF79DC049F11C250600 TTROADRACER
80,263,700 *0884E43842DAD903DF2B398585494C93284E5198 jswifey
80,263,701 *0882AAB1C069F52A81509110C2178D477A12F01E JTXZGI
80,263,702 *0885E1F3CEA55E26763A53E451B281A479C1D160 MISING3NUI+Y
80,263,703 *088D43017E04B88C48B5D9D3620FEA5BBA86CC4A TUMONE.HARRIS
80,263,704 *0882E3830854042548A3DDD20AC71540F3E0B87A MITCHELL.MAUCELI
80,263,705 *088CC413A22B20C3CF276F3AE970DAD1F5DA3E25 tut0r3rs
80,263,706 *08836286D1D6D04F6BDFE381C51CB29EBD1BAD9E gammaten
80,263,707 *088115529A80F8E022744FCF0F6D4B73E2817B03 MOHN7
80,263,708 *088391FF31504F68321D077C64174DA99B7F8BF6 TYLER.SWINK
80,263,709 *0884B5D3A14D8C7910B16FE2CE4CB3C79D79B3DC molmajeur,kv454:i.largo-allegro
80,263,710 *088EE8AD34A9A77686077486B3061DC351D82CD7 KALINADONEVA
80,263,711 *08811CBDABC20A11764A2A47EEB7BB6B07F818CE MORETAS5
80,263,712 *0882DD1370DE9D133140B86BDA30D5A0BD6D1274 morrisparfait
80,263,713 *088726CF516B295DF563B85D3FB8FF88240E70F2 KASEN069
80,263,714 *088E3FC9E96977B67F6BDAAA9DDDC286D26ECD79 UBOTTOUM
80,263,715 *08809CE86B733472232746AA23C73C51566B87FC KASSEHWERL
80,263,716 *08825908946671973E8A3814B3602B087276E1D5 mouchoir-de-poche
80,263,717 *088D10D42542434BD3C0FAB1E9F6E89823185500 mrcofs
80,263,718 *088209DBAA29F517A00D2E6302FEF59850CE2906 geraldomonot
80,263,719 *08825EB2F8C4113EA6D9CDF41140644008CA4D69 UJACQUELINE
80,263,720 *08892B249820BC27425DFD53A32803234674E3BA U`JL
80,263,721 *088C0F45527D3D54FF314CBFA68C9360DEA79576 mycology!
80,263,722 *08896F691DA5D11858A7119290BE934A5494FA2F GK[\
80,263,723 *088B52E9A5335778FBC94ECCA1B34208733A4CEA KILOS,POUNDS,GRAMS
80,263,724 *088A4C96A1DD9F3993E1E02BC44D8F8B67A691FE KIMPUPPIES
80,263,725 *08894AC6C6DFE9F317A74D89EF76E8F93829BBE0 [email protected]
80,263,726 *088DDF3554EEB68B76FF20224A0850ADB5645B92 KLEOPANTLES
80,263,727 *088D3A712788C27142A1EAFFDEF53F8DDB7B0ED4 narezanas
80,263,728 *088A9A7B9E890228BC57BD2E64913102242345DE KONGASIA2
80,263,729 *08851DC790BBEFB118578620095C5713AC5F4BD7 koreyheininger
80,263,730 *088E536EC706C8542FB77467C30034C99EC3FF44 GRAYPICARD
80,263,731 *088E5F4C6879B242F7C49DFDCF20468973EBD0DF GREAT TACTICS
80,263,732 *0884EF7EE84471E2B86544460FA1BDA854F9B825 VALERIE.FISHER.SIMMONS
80,263,733 *08880FE107DECA59A54D974E155FE5FFB444C9C2 NED.MARCOS
80,263,734 *08839D8D19E951D3F4E688B6AC2AAB6EC48A5805 NEURALGIC?
80,263,735 *08844D97CE363354D51E7FC8E32A9114BF0880FD newtonshockency
80,263,736 *088B7E6F3BECF9F9E0520BB00AE1F710529681CC [email protected]
80,263,737 *088E0CEFBDB7A49151D1B6B781CEE3D6B2677A0E VAN.SKIFFINGTON
80,263,738 *088E2A3CCB7DD2107BF98533D77046C12B43F59C [email protected]
80,263,739 *08863B791B080786547136022B3A6A7337DACF02 KTAW
80,263,740 *088CA64B41A75ECEC736160C07F9ABED3071E0FA nirliest6
80,263,741 *0889B29C769A5C04115A77B602481BB9EBBD71DC VENISEALLEN
80,263,742 *088E8F770C615F6F2733EB770F0F178F1EE63CF4 VENUS-AND-THE-MOON
80,263,743 *088805411F02845063EEBA4547F14317DB761BC4 HADI.YASSINE
80,263,744 *0885DA3A4F96FEED917EE22628E1B3A175015AC5 hagshags
80,263,745 *0884ABC6DFB23021EABAD041609D2A80D5515758 [email protected]
80,263,746 *088FFFA460820863B48F5B52EB3192CBC453F155 NOLAN.SADLIER
80,263,747 *08807F76F51775537AF0D052004A00818CCBDEA3 nowthewind(modoazulwindhasturnedremix)
80,263,748 *088F06E10587570FD6B7404C1FA498F3FB4D7786 LANDONBEERLING
80,263,749 *0881269A5D141087532CBCDAC78D13713E518B29 landonburgin
80,263,750 *0882914136EF7955887845CDD41AB7252C1D36C7 NV_T
80,263,751 *088BAEB99498B9E50653E8B2A0D8C8DA15BA7330 nwodtuhs
80,263,752 *088147D41C5B85FCC02B6FF21FA5CB9B736223A8 harbor-related
80,263,753 *0888DB67A343988C81CCA369C305D363797B2A28 HARMATALLAH
80,263,754 *08821C6774A0CD30B4E4854F772C093D0CE4A02C HARRYSATHRE
80,263,755 *08855CF1BA87B1B01C0FF5006F18B6B03738FE4D (o_-) *@######b
80,263,756 *088E8130BE70701650DC92A4328412962A4DB261 villetas12
80,263,757 *08816DE1E0543ACFD11E0F7994FC50AEF1636D43 HAULIAN
80,263,758 *088A3376BA7165901352967D00A46DB2366A8D20 LE COMTE DE MONTE-CRISTO
80,263,759 *0884B3786FD2548B7FBD16D9FA74E902804E201D VIRGIL.ROLLOW
80,263,760 *0880DA29258E6D1A12227F6A6F8D5233B75A1E7F [email protected]
80,263,761 *0886069A01A518E0686CEE6E2FA697FF80604DE0 ofenico
80,263,762 *088B54BBA29EC2FCC7C4B612AF1B30C3008E2AF5 VOSTOČNOE
80,263,763 *0883FCA212FF0931A52181134D3E16D5094D166F [email protected]
80,263,764 *0889C6A9B3C4050B1348E4E22B157C05634F10CF V"PH
80,263,765 *088EB5CB366BE3DE8CC3735171223B407D469372 [email protected]
80,263,766 *088704807F8C4501B193975E60DE8F5E81A4D4C8 LISA893
80,263,767 *088799399C389087A98E2448E725274DCF8B432F WADA-HIME
80,263,768 *088392822804D1BA3BC95C4D8691E997691467EC WAHYUSSUHARSO
80,263,769 *088DA0C598567E512DF472B26C593E7A3175B882 Wait.in.Vain.(demo)
80,263,770 *08820EBCE08BC19A48945B8D9F135E6BC50184E9 LKQI
80,263,771 *088FA7121BF43266FABEFE010E2D320928C81747 L:LE
80,263,772 *088D99384C084D6B0F3BC9120C0A20DFC48FB8A2 HEYHEYRMA1
80,263,773 *08821E8AD52D8372D5E5F5246C525D65E3C40E00 ORVILLEVAINIO
80,263,774 *088B3F77E2184A32F6AAA273CBC17EEE9094FB05 OSTDEUTSCHEGALERIE
80,263,775 *088D82667424F02ED7FA6B4BBDDE4AA2C3DBEE36 [email protected]
80,263,776 *088837ED33F673DCA9765B8CAA0FC004D0AE5FEA WATERASDFG4
80,263,777 *08851E9793725A308F10D2C7AB64EFC7415E7B77 p#####@`~-`~->-<
80,263,778 *088D4DFFF77851C8531A98F70C00D4DB282F6A67 p====> ~ ~ (0-0)
80,263,779 *08823B81298E4B392B68FE913E01A37E16B356E6 P=====).*.*.*.~0~O(O_-)
80,263,780 *088E61CF1368AE4C28666FF488BF6C0E67BB4BA2 LUCIEN.SCHOENHUT
80,263,781 *088F35A83EE22E64D25CD7A7A146909EA9332860 [email protected]
80,263,782 *088173FDB519A6DD4213337A631B14BF2287E9FA PAINTINK
80,263,783 *0883B1079DE13CCB968F0AC29BAAC7F83E4BB643 HQIAURS
80,263,784 *088F2347E25EE210D3E35C1BB338081298648B79 [email protected]
80,263,785 *0881383B605DD60C2CE42F3F350C0A4D136D7F05 WENNDASLIEBEIST(ACAPPELLA)
80,263,786 *0888B84F5A819360EE618B86C4D115E3329632B9 [email protected]
80,263,787 *0880E54B944CDB25D0F6A94BF4BC68E1F2166CFF HUANGQIUHUI
80,263,788 *0888D92D6B106288CB12EB2A71B9F6DA4E5D46BC PATRICK.KRYST
80,263,789 *088C68A67D46CFE198C8B5CCEBB3E3EB922A281E MAAYAN SHARONI
80,263,790 *0883A9221EB25E856FAAD959CD457E76524EA00E whizzbang
80,263,791 *088162828E473D6E8C18E744C10054121EDFCEDA PECOELECTRICS.COMWWW
80,263,792 *08889B7DE441F3B7C15969979FF2A7D354E0DDE2 HYDRANTESCHLËSSEL
80,263,793 *08825F0B211B1C455DC525FE53CAFAD99F5C5775 MACKN7O$H3$
80,263,794 *088788C064CF8E9578263C67869FF9C73A41E5AA ianadriano
80,263,795 *088AD33AD4B11E62930A5247932796F51C9D3A8C WILLIAMGREGORYJEFFERSON
80,263,796 *088271B5A3008E3A3AB6D383F56817E2A0EB925A ṕh
80,263,797 *08815FCBCB8765B36A2F266ED0BD681F29CC6C57 WILLIANMCGOOGAN
80,263,798 *088C2BDCD0064392CA777BF3D309F3E2022FBCFE manāzgird)などの表記を採り、アラビア語文献では「マナーズジルド」(
80,263,799 *08857042A9FC206C51144B0C1BE0CD172958EB26 wilsoncopes
80,263,800 *088C67FEA591FC5ED3D43AA7E1F55186D23DB98A MANTALSKRIVNINGEN
80,263,801 *088E7F9BFE9D787F50A397278599B86E40C13113 pikkuoravat peruskoulussa
80,263,802 *08874557D63E7B9E8EE524637381C14239D76CC9 PINKEYE
80,263,803 *088E96ED0724883ABA1696306D251E37F891679E pirmalaikiai
80,263,804 *0886724D5F867870E378E4DB87ABAA71270F56C3 pkladech1
80,263,805 *088533CBA530F477E9255AA17DB7219A2AA6F908 W-OQRJ
80,263,806 *088BEE1FFC1F3BF46C2CD566FE9835BCF04FEB6C MARI-LAUKKANEN
80,263,807 *0886F33C1860E1CE6BF48308A2DB7958C9C594AF marioprothero
80,263,808 *0881FD360C7684B058495ED4B20969A3076DD673 politbureauet
80,263,809 *0880E6DF559E7EF2A758BD9B2479B65F213E3D4E Ponowneuderzenie
80,263,810 *088AF03E61D29AB562F02A7BE21052498881670E WWWFABULOUSCOJP
80,263,811 *088395CCC59D2A56A97E8F936B6844278335823A MARSHA-STRICKLAND
80,263,812 *0883453EAC0DB730EFA4CBB49058DC48EDBF0CC8 MARTY.KOTTRE
80,263,813 *088E359DF6BC13DEBE352CED5E4E5F08BCB51AC7 X/1[
80,263,814 *0887C0A1D552325DFD90D83EE37DBE2693C87066 {X}~`.~`<--3
80,263,815 *088CEBC41FAD30D7FF96519D30E57EF6F90FFC85 MATTCANETE
80,263,816 *0882F93F3CB5E122A61770C41E13FA1C3AB9A009 MATTHEW.MAGDALENA
80,263,817 *08895B4AC8998F8E8800DDFC56AC2545B8FFEACB MAURICEHAWTHORNE
80,263,818 *0882AFF7D1702CCA6D5365CBB7CE291C3EDD109D MCLUCAS7
80,263,819 *088DAA74F9C859B526DBA92E133365C1436DF39A [email protected]
80,263,820 *08859E958C0BFB262D77E2013F8A73B3A56B3EFD yadyeva8
80,263,821 *0880E83F3E299D97299D6EDD138936DEC9F4A902 I'MCOMINGONBACKTOYOU
80,263,822 *088ADDE5E0BF38A0FF509B6168B46BB400F556D4 messiahev'ryvalleyshallbeexalted
80,263,823 *0884467DEEF7C90039C65D2412129BE80E8FE82B MICHAELMATCHEN
80,263,824 *088660D6B2560DDD151985A0DF1F1BDCF0D19A6E MICHALEALFIERO
80,263,825 *0880280E8B492762538DC96EDA35B0365E6A78F6 MICHELEMADSEN
80,263,826 *08882FB9C0DDD0AE3B56772B5F87BC91092BAB91 PSBRITANNICA
80,263,827 *088D90CB1A94EBF7F5F073FDFF9880C5DDF3B591 MIHO.SHIGA
80,263,828 *0885F72AA895FEF718095100B3CF1940C73E7217 YOU,FASCIST-COMMIE!HLA[2]
80,263,829 *0885A6C10121F7A171716C2113335C92D57F512F milokalata
80,263,830 *088122F9C1B40A5D91452E19D0678E657A5C90FD Q------>*.(-_0)
80,263,831 *08883EF3F35DFFF78AA7DB107D0D1A53EB109C8C [email protected]
80,263,832 *088E21A45D7A490AA31B8C5C9F49236D1420CFF4 q-)~o-~o-sploit
80,263,833 *0886C6914814B4DDCF4B3269DB6F363634D5F519 QTR_
80,263,834 *0887FF903593858C5DF33485559C92A627EC91B6 QUINTINROSSETER
80,263,835 *08897FB3C09E8F93D475DA95FAE0935917ABB143 r[email protected]@t10n5
80,263,836 *0889F736BC447EBF5CDB2F45EAF153F778FC3EF2 IONOSFERE2
80,263,837 *0884AF3B63AC21CFEB1F5806D3037154BD637C4C ZHAN GABRIEL QUIAMBAO
80,263,838 *0883BA56E6C21A3C8788E5E83A6E6989D35F24C2 moreauville2
80,263,839 *0885CD3412F0E8155161F7DCBD706AF8BC5DF004 moustacio
80,263,840 *08823AEBFD1F6275EA345DE42120ED72FCADD0A3 MPERRIAN
80,263,841 *088D7A793CBBBFB63C86F8D133867E7AB274122C @MPHOR1C1TY
80,263,842 *088D2B0AB1B81B814F8D3BC87C62665F02423196 RANJITA-PAUL
80,263,843 *08855F943D956E9C2684600BB23B77E85D5336DF RAPTONIC-(FEAT.-KID-KOBRA-&-JACK-ORSEN)
80,263,844 *08898C5D381E8A11A5C1AB5B10909716DF7C28D8 IUNJUAMO
80,263,845 *08866D340578E398BD52186AF67D24FF0EC900E7 MU*C
80,263,846 *088FA68724DFE091CCDCE8BAA7C55387532BF54B J41N1SM
80,263,847 *088D2C18004495499A11854F51C6E71011676777 REBAT1234
80,263,848 *088C9160D24D770FA8907174245027104E6E71B0 MYEMICHEDU
80,263,849 *088A6681FC72FAEBC9FD0EF948A2749753CCD294 recordsの社長でもある。彼等のツアーの前座を務めるのは、ほとんどがこの
80,263,850 *0886A442FF0F0C2150AC8BB2572563A9EA8B0B38 MYLESFANOELE
80,263,851 *088E15E024A11CB2AA1E20281184961D0B6C9C4F JADE SALAS
80,263,852 *088D4B9F6BCAE252EFE87500FB884D7007AB1F8C REGISTRERAST9
80,263,853 *0881A5AB11779D84372721C93D12B4B19351E256 jangattes
80,263,854 *0887C76656517BE02F953CFB8982A0A588EDB6E9 jaunines
80,263,855 *0884CFD0A3A441AE3D1F20E86913B74737DD3020 NASITITE8
80,263,856 *0885897327924D5F22D904831D0BAF42915C2B5B JAY.REICHELDERFER
80,263,857 *0884D9CB29574E8CC6064FA434A1704864D41535 ΜΑΡΜΑΤΆΚΗ
80,263,858 *0887D2AAAC1999322D51402829F9E9735EA032B7 jaysurprise
80,263,859 *088E5543A71303E5FEB33A8643EA3AF23588A7F4 ΥΠΟΘΕΤΙΚΏΣ
80,263,860 *08844689815E21B7CB6FF04DC82699C423C92DC7 августиновски
80,263,861 *088E87719FFC9AD37AAE206C73205DC1BE4117CE !NCU1CAT!ON
80,263,862 *08801D0916204B823853ED7FF2C6B36CEAC1098C JEDLARRIBEAU
80,263,863 *0882F870CB26332DE0CB0503C823AD38A713BC5B jedquamme
80,263,864 *0889E26363BEE72A960543C2698D6362A23ADAA3 «БЕРЛИНСКИЙ»
80,263,865 *08899DE294167CE46A7AE7620FB3AB3D36929F84 ВЕЗАРАТ
80,263,866 *088817124F210B5A326862070BDA559517B31DA7 RGC+
80,263,867 *088F063C43AF67C9FA0BA7BC90D0CBFF30BB3CA5 jessherny
80,263,868 *088FC9705143FBE37461539761E618170A2A3CBE rickymlinar
80,263,869 *0886D2158F8E3C96F18872FB8247CB13617535A2 roberto.hirsch
80,263,870 *088B4365E4DB557DC5DE0E031774C092A0FF62F0 ROBTCIANCIULLI
80,263,871 *088622088868D698A7156EB2A3CB00484674345E НЮРБИНСКОЕ
80,263,872 *088C001294501F22D5E56159C2113E369E287E08 rodarreta
80,263,873 *0883397C376658EA0F2D6DD3153EB2EBC5F32A08 NOSETOOED
80,263,874 *0886DCA2401C5199A3F7240786EE6130861BB4ED JOEY-FRANQUI
80,263,875 *088EF70739D1F766B2D79A9A99D1A155217970AF JOHANNES FOURIE
80,263,876 *088F8E9572D42D668C187AF16B788235231AFC53 roland.klinkenberg.&.gerry.menu
80,263,877 *08851FE1B96DEF415EF4EBA473254E7C26D42264 ТОМКОВСКИЙ
80,263,878 *088EB9B2C9DAB1EBEE6E1A777E85625C1565270B JOLLEDE4
80,263,879 *08874AB534E7E913D83167D5BA473B29BDB5F6A4 JONATHANCASEY
80,263,880 *0884E24407C3256AC27B419BEFF37E5C70293B9B [email protected]
80,263,881 *0882CD6A858B8A135EEB2DB0A38EF58C75D9E912 js8f16edlxqa8mui1mb576lbnhqk8tb4k1gd8c74yd7xshbvp7
80,263,882 *0882ABB17DBD07C13007B360FF8D1D0E267903C4 runner1234
80,263,883 *08807D38C80C01597EF3512596B5909713EF4958 JULIEANGERS
80,263,884 *0880AE53D45D6C638F28AC207E9E4C4B1706251D RYAN-DINGWALL
80,263,885 *088D3A46666D076B61E5B3094E8DC624141E8366 [email protected]
80,263,886 *088953B4742C7BFD4A5A524DCEB9BDBC79FBFCA7 [email protected]
80,263,887 *0881EE6004C6512CD5FDCA4B90B8660D3D88B7BB sakimov
80,263,888 *08826DA1D9FCAD05F9A7B5173851BCE4146FDA01 OPETTAMIENSA
80,263,889 *088202C843F67513BC27097792DAC212065A8E3E KAREEM.HIBBLER
80,263,890 *0883D85D0C6E9D6D4B0227AC4BFF75D4C53FC795 OPPMUSIC
80,263,891 *08884F568F07856436F88D3C10671693880A59EB OPTSETATTRIBUTE40
80,263,892 *08842D69BC466D8A331BED6DE2D6DBB7DBB7B625 SALMORIABSW2
80,263,893 *088B2C65EFE08197747586CCF049D19C291C7304 ortiz762
80,263,894 *08859477DE225B3DEF880A7DDFDE5068CD7A5D62 kaylahacker
80,263,895 *088C2C93618FEC7DA6B1F5E6376561804C0C8624 SANANDHAM
80,263,896 *088BD1DF3BC5B9818A7AA10C1892A83056371A11 OTIS.SARISKY
80,263,897 *08894C453DA79677A31EA6B36AF3061D22871736 sanjose1phantom
80,263,898 *0881528D12C2454E93D7094D05B6978C79496172 [email protected]
80,263,899 *088F850319BF2FCBC7EAB18252CCD44172E67E56 SCHACHTARTIGEN
80,263,900 *08893F19FDDABBC54E35F375306700F48DEAF1C4 paliwalparklake
80,263,901 *088DCABEDB7E38AADCD8163800236370B6DB526C schoolwhen
80,263,902 *08852C4AE71BB2A959D4FF652A3352D007E0EB9B keventomopoulos
80,263,903 *088A13C3743B39AFBC7937430AA9296E574C0659 SCOTT COSSU
80,263,904 *08820C022166CAA82992A5F5A4BC3F4F9D6C5C67 SCUTELLIFORMA7
80,263,905 *0889432175E630A582F6988E83BAB88041B33E31 KISHIESING
80,263,906 *088390326119A88565D9F407341B4AA6315A3228 KLOSTERNAVNET
80,263,907 *0885809ECF97F1783C76C12915DD821EBD6C349A koechlered
80,263,908 *088CE2677B6BBD102AE02199BF1BB07814458FF9 SENRERVAF
80,263,909 *088E2C2179525D5F6055ED78580378C1913A9C7E SEQUENZE
80,263,910 *0888580CC4CE5CA4A4AE96445B9C9CF114D21536 07231981
80,263,911 *088F6F3A6B518592CD160B6D4093622CEB734777 PERINCHING
80,263,912 *088EB8FC75C9033A71142D1FA41951724E05D4BC PERRYGLANZMAN
80,263,913 *08815106F22579D8DECB4BD9517F883D2B277EAF (>_0)~-D=====Q
80,263,914 *088D26889ED3EC6A119592B617D646318990D38F PETITVENT
80,263,915 *088010A42FF91E5A1A19D50FE255F6FC0A6F53FC KRISTEN MAURICE
80,263,916 *088E9958A2657C20963F21454DD4B550A12AF4A1 [email protected]
80,263,917 *08858034DA71B66A5137EA493F66DCCB82612A2B 1066518 tai.rovaniemelt
80,263,918 *088CECDF8CED2AB0E2573B844802A1400889026B [email protected]
80,263,919 *088FD352BFF1BF992AF07E8953D73244D1F3E701 Piano-Concerto-No-2-in-C-minor---2nd-Movement
80,263,920 *088C9C083F9D653AE4F4FC1D5567B0E95FA30DF1 shane.overstreet
80,263,921 *088258D11003D2F6CE7C3F95CD7EBB809A578A04 SHANTIKAYLA
80,263,922 *088CB948C0F53A3A966FA3B1055DC186DB9EB8E7 [email protected]
80,263,923 *088815054BE66927CA0F1E6593F21968F71EFAB0 l_0aaa
80,263,924 *088290BE3ACC269737302D12666826A34919E579 SHELTONMOHRMAN
80,263,925 *08846C66AC6CCD199BA7EBA1AC62798AF2FEFFF8 12HAMILTONIAN
80,263,926 *088DD791DB95640F7ACBA85C5364BE0B4D8F7ACF 14.P
80,263,927 *0885E5CDBAB899C6113DC49AB058CA1312F05FC7 PN&H
80,263,928 *088B5BD2DA7B84736E95999A7936AB4D320B0F16 SIBIL4V4T3
80,263,929 *088926E309DB0224D774FD9FB93827E52AD31309 [email protected]
80,263,930 *0883D19CD9F74F2D8300E40C41BDBCFD0561AEF9 LAOREASSE
80,263,931 *0882D1F9F2B9C50BE9143C2697A2D936D1A39268 porfiriolukman
80,263,932 *08853431EE681094648CBFB6CD42A3E64C69AAFA [email protected]
80,263,933 *0887F954A9F9461B314C196891F07945161AB3A9 laramieorr
80,263,934 *088B71B6A1BCE57D35AD72CA9BC5D1316401D491 Sinuntavalla
80,263,935 *0884136D415B44E987F79A10E8DA7C62F9F3800F presen+a8l+y
80,263,936 *088C0859D8B2E197037604CFAA51B70203AE90C9 SNDFPBSW6
80,263,937 *088334850D345080F7830052E9817AAA531E78DA 1-co-coordinating
80,263,938 *0887F63B5500D99F4D4D683EF0BA52E4B3742792 1.CODELINE'LA
80,263,939 *08827F4B0CC810444F3178A1E0CB9F174E5A83D9 PRYSSYRP3
80,263,940 *0884CE6103ADEA7B1AFCB1B39930EB975AEB567F soepelst
80,263,941 *088F44B53B3FF68AE5A1457DBEF3DD54DFFCC8E8 1.eufuehrerscheinen
80,263,942 *088091084D8DB6D5C07705B3CE7C069C018BDB78 let.me.go,.blubber
80,263,943 *088D505CAF7E89130DFF607D7B850BE24382B74D purpos3-c
80,263,944 *0881F67DD3C4F9721113012CC83F53BF20EDC186 1-GIRISEBILIRLER
80,263,945 *08890C92D674FC096182AC3453A884946DA7AE15 [email protected]
80,263,946 *088F10DB45156BA5E51EA5D1EB463B37AF36CEBD 1-GRAUSTICHIGEN
80,263,947 *0887C80ABE6F1D7E3ACD4870C563BA2899774851 [email protected]
80,263,948 *088E816517F90E8C311D4EFDB9F6188A66884F82 QCA7Z8FOAJ43RX
80,263,949 *08867C8782DAB4AAE753D69C28FD3DA008C88008 [email protected]
80,263,950 *08877A25D9C43E7D34664BCA82B0CB3D9DA42CAC [email protected]
80,263,951 *0884931FB817B14C556B3B9B416A63FDF5A5A8DA [email protected]
80,263,952 *088BDD41A3B394899F77033C5B36638FBA23A231 1keskiarvosuodatusta
80,263,953 *08895F58E47A6E98D38B1F465DDEBAEE859CB1FC >< ~` q==P
80,263,954 *08862DFBC7904D4A6F125BF9E77A31AA10CDE6FE q--p~0~o)o(
80,263,955 *08826F06EB954DDC9CFE09FBE6AFC9FBC6F81A4F soundtrack2
80,263,956 *088D0A3BE12C8A84272EB3069FAB7B29E78C6590 Q==P***UU
80,263,957 *0886207D28EE3D957CA1AC47027ABEF0E66680BC QUESIERRASIERRANYLECOJ
80,263,958 *088A1C9B0064614C048C3901523E862AD8BF696D specificirane
80,263,959 *088D15FB7B1CB493D9E94B96FACA2E864FE0D49F LINDY-'L/I/ND/I/
80,263,960 *08847C279B7D1779A77A98376A5BEC530C585C54 R3C0MP3N5!NG
80,263,961 *088F15BF22AB887E7C00B9B999325477EA46220F SPIDERMAN3
80,263,962 *088F94AA9467E347AF02798C4BA60461CAC6B2DD RAGLULAR
80,263,963 *088D27BD3EC7E6219014A66A7FDD508378332786 [email protected]
80,263,964 *088A39D0F7997B41D6C03EF34A7EB8223E1326EE SPLATO~Q######P
80,263,965 *088005D16089B3740D978FAB2BF0145D7DA63F6E SPLENDOUR5
80,263,966 *0880A5D6F1A47FFC463391746AD5CA541E66C2C2 1SELF-REALIZING
80,263,967 *0885DDD1960EBC917F70CBEB0F01DEDF92802D77 [email protected]
80,263,968 *0888ACCDF13B51187184459463145FACB30C63FE 1SNOTTAR
80,263,969 *08810171B275C8F6E21C32FD4C83F63605D89E60 1.totobude
80,263,970 *088B15E7C99570D2C190A71454C1D1FB75B415A9 RANDOLPH.SCHLEICHER
80,263,971 *0881B822CB6713406B5C1A1BB47B5F2C2C4D96BA LM]3
80,263,972 *088F5905BCEFAF467B0A0564713980E9556625DD SQ~Z
80,263,973 *08863EFF95EE305FEC4899AF59966A20B5F78976 RASPNING7
80,263,974 *0884ECA68059086BDBD48761358A2247222FE959 srinivas
80,263,975 *088EFFEC15669C39228F7A16B3FC417345591AA1 STACEYNATASHA4
80,263,976 *0888833354C9B5470805073D71679CFB24134083 [email protected]+!0n5h!p5
80,263,977 *0886262E3D1C92A0383E6B38BCC21FB7F617515B STEE1-ENG
80,263,978 *08812C59CF0D0D9AD832CB692934652B4D5E9377 [email protected]
80,263,979 *088D1EA1680AD1D491E66F1F6C14EC12EAB1F480 STEMLOOZN
80,263,980 *0882495E8B221C9315E20A08F22183C4CF747FE4 steuervorg
80,263,981 *088F78F9D5A24AB9B81D454189CD5D91D371FEAA STEVIESTUMPF
80,263,982 *088E7CFFE58C1CB8B8CB132CB9826C535823C617 REHVALPE4
80,263,983 *08814B67B7EE4694C2CECBCC110E7CA12F511217 LUKECROKER
80,263,984 *088797BCA7EAF02873C6E2DD26E7A49988B7A89F [email protected]
80,263,985 *088BF107EE84AE9FF828C43E919F65791D0E5A2D LYMANAKIMA
80,263,986 *0887A004AB73C9551F400FCC37E1AE88DB8A8DF1 [email protected]
80,263,987 *0885A96834CFAB5667880241EEB0CAFF9EF8A104 27apr1797
80,263,988 *088EB4C4B4749325EA68CCA898117FFE3CD453E1 M126688
80,263,989 *088B9D4AA7890A4E1845425184D97F15C87E0097 28ae99a3e833f2b63e0e396b95107bb2.shizer
80,263,990 *08811F3CA8C3960D08C2A93A99FA520DF462AA9B revivs
80,263,991 *088B2D20D03000F563FB8E7C25D499AC684DC2D5 reynaldobousman
80,263,992 *0881242E646692C6CD15F59B1464AC6F1A7D3AD7 SUGARWEBSTERS
80,263,993 *0881C166E8B9B9E412B0DB2D838579D672FB2495 2GIRALOMO
80,263,994 *088A21E79AC065F5F1157F5153B9DB0882350E1B malinde..m.ae1.l.ih0.n.d
80,263,995 *088320E06BA6961B6812E59A7701F2F420BB2D6C sunday911
80,263,996 *088B043E0571CDF7F7FCB6DF931EBCB06DD4A5BB MAMENGDIE
80,263,997 *0884D10BD5385AB1B75B1FF6FE908ACEDD38999D 2IAMNEW6
80,263,998 *0882457178642D49E66AD3E2AC0615E167086E33 RICK.SHIP
80,263,999 *0883FD67635A157A084F30FA6DE850430F3189EE SU%S
80,264,000 *08800ECC9B316316324600B07E0D874A43081EDA ristidam
80,264,001 *0889B78C15595ED308325E05EB7605FCF0B812B8 RJNILIIS0
80,264,002 *0882ADA6D860BB774DC981B86D2F263233900D5F MARIEMINGUITO
80,264,003 *088B5418D9A96EF36649E0EB8CC449A6EC9D46A3 mărind
80,264,004 *088E1ACBC42723DDBAAE086CDA20FD19E4801DE2 ROATTIS1
80,264,005 *088A2ECCAC935773E2EA6914D0DA585F26F69661 MARLON.NOCERA
80,264,006 *0883528F5950F7011F1300794827789359696281 ROBERTO.SIEGEL
80,264,007 *0885D26B517B9F3F8185B9A0997A7CF779EC2991 martinhopfensperger
80,264,008 *08809B0415665667380C7A670865B7EB263F22EA [email protected]
80,264,009 *088DB64D16AE7FA18AA6550A8CFCA1B0CFE976DF MARVINTOYE
80,264,010 *088FB3A85688957A2D6AB5ABEBF9F471E4ED5283 T3GN3B1YA
80,264,011 *088E08E9A433646C5EABB0814F4EA0C1EFE80203 rockciclopedia
80,264,012 *08826468985B8E87AB23F40F847EEFB2D5E4A770 T7N3M779
80,264,013 *0882D54DFCC56F29B996FBDBA25A0162EE7E56E5 ROLANDMANAHAN
80,264,014 *0885071BDEBED0361D36FC508068DC66B34C99C2 ROLFBRABSON
80,264,015 *088C04784C3DD2DD50C83909F72BF158BF2A2538 3ESENANNA
80,264,016 *08837C960480426E0454DF1034F6B371E3219EFF 3-kaydedeceGiniz
80,264,017 *0884B347791EFDC310705FE4C4225AFDF1A2FB21 ronda8677
80,264,018 *0880F3DD12C8F00AA456DCF0303CADD858DD8458 merlinstas
80,264,019 *08854C5ECB09931EAEC8C614B95548E2257D71D4 ROSTHENRYK
80,264,020 *088F70BC5942EE3A11EC84D53D46A49432B2FA84 [email protected]
80,264,021 *088749F082CCBE32D89CAA459A264DBD46A39454 TANNER.FEHLMAN
80,264,022 *088DF266D72B07512158B2189A4850AF8B2F7908 michaeljamesalorro
80,264,023 *08868D624737C7E4D01DB6E3BE7F2E594A9FB28A 424653 GOCAILENINMAHREMIYETINIZEDELEMIS,AILEYIVURMUSTUR
80,264,024 *088AE5CBFDEC9DE1D09F46B9FCFBA0E13DE1B7AE tatosugianto
80,264,025 *0881E82C3EA936C8A5779B93882B6F5862301453 RUBYDODGER2
80,264,026 *088B29AC472CD755E096189442721AB30042F3AC MIGRATIONSV
80,264,027 *088C242534D2C5D5EEB3A26B4658C877FFF34270 TEDDY.SAULSBURY
80,264,028 *0888EA36E38AF31C8CC2FC55CB94652CA11CCDE7 TEDVISAGE
80,264,029 *088154F6D761B0876691B62B704529C8194E8F76 rustamjon
80,264,030 *088039605F55F0D5493DD62700747161995B324F TENSWENYLIADEENREASULLEWYPEENRE2
80,264,031 *088B514B6BBAD04C6B1E32A144020F5D789EA2A7 MLOURES
80,264,032 *08822EBC2B7379E00A708DF9294775D61031803C 4REKENAAREINDPUNT
80,264,033 *088BB1FB28B16392733F0C1C6867D52608E54988 MNISZCHÓW
80,264,034 *0880A345B795FB364D0DFB07B454EAF0F540860C S4LESENG
80,264,035 *088A37D0AC3FB54D199CD15651DD3EC4E79BB551 saanhan koskettaa
80,264,036 *08809D35EB2F40138D3BCE136EC2693777B4C5A9 SAFA.TAHIR
80,264,037 *088AE61965C810AB8B1C4FA1CFE0C9A453EBD9F6 MONTYTABORDA
80,264,038 *08863F206657CE8A8BCBDF13F721565A2E412551 Mor4lzer
80,264,039 *088648B7DBE9B3EBA72FA861F6150F77664CB7F8 [email protected]
80,264,040 *088D012D90ECA5A24C58723AC84057103A471A39 MORSBACH“
80,264,041 *088DFEFF5DF9B86694CF254DC5908E9A17325BD7 SAMMIEGIUS
80,264,042 *0882FF6A9D228A4CA7D1EC72AACB3DD2F6BCE3FB SAMMIELEVENGOOD
80,264,043 *0889D610B71CAACDC32226A2158C8100776F0469 SAMPEOUN
80,264,044 *0885CCCED53A49FE0C9F3662E66031A2FE694CC8 54rwtrq
80,264,045 *088D76882CAF58BE2CE089B5D4BC940DB77222FD 573030 mit
80,264,046 *088B2CE918B7EA15AE49748E41D25C8B5C416F37 thejoey87
80,264,047 *0882EE9EDC806A7594ECE92D1534F5E271E9A436 SARÀMRÎ
80,264,048 *088DF28FFCC393CA7213831821AA1FA53D572987 THE ONLY LABEL IN THE WORLD
80,264,049 *0880BE1810CB4EB89F9D21833BA99171ADD8706D 5EDINBURGH
80,264,050 *088A34AC0C9C9D82D61FBDDC5DE54694C88D1A71 THE.TRANSPARENT.EYEBALL.GROOVE
80,264,051 *088D4D07039908E9513AE8E0937530EBFC630742 ti.a
80,264,052 *088F3DEB9252D7B76E8389313FFE7B7267AFF1E3 scc
80,264,053 *0885AD2C6F8CD17DDC22A60EFFFC3D463243D404 TIDURTAKLENA
80,264,054 *0885AAB73DF9F720F442945CA83896C03308D198 5MOKEIKKA
80,264,055 *08814A62B7AA41EB1890E0DF53D64CE7C706D003 N-1N-1
80,264,056 *0885F0BCB24B81214645CC1FF159A34E3A397D12 5NEKREMRAAW
80,264,057 *0888C85FD7AFF5CF6C7E38F61A31436A9DA7A343 5OLEMISENSA
80,264,058 *088C4B00CFD6E84C91078E9B4395FE0983BBF62B [email protected]
80,264,059 *0885D2DF4F16E2DD9F90D5BB89644B1963011E1A SCVDAA
80,264,060 *08875B3279AE1FE695D3D4034A03044D2F22DD6E 5SUNSETTOPGUN
80,264,061 *0882F2C9DCD1BE267439EEA8182FC7BAB585B4D9 NAPOLEON.BROMBEREK
80,264,062 *08879F08849A3F1FFC5A30F10198B069D2AB813D 5TORONTOCAMERA
80,264,063 *08826F4459E8CF69D0102645FEE9269818A6BB23 [email protected]
80,264,064 *088ED5E6614746721F655C31B4EB0BC5A67D1448 seilimme
80,264,065 *0883D06CCC037E2BA6DB1C43EF827224FB014431 selfnomd
80,264,066 *0884FC2C057C4A7689C9A8F146DEC9D73B5F58F1 SENRESLEDRTTFARKI
80,264,067 *088AFC059726436D2537878A954C422A2D32A950 679GodBeinMyHead
80,264,068 *088D1461373B433A2D9F2214685B47981FFF52D5 TODMABARY
80,264,069 *0888000F4BA16884B145976C58F87784361AE241 tohybsw7
80,264,070 *088C35540F2A12F2A5474493AA998A88DAF32887 SETHHOWLETT
80,264,071 *08895BCA624EB1515A89812841A530EBF6962CBE SEYMOUR.BUIST
80,264,072 *0882402D173DD407FCF14D9420E66D99A07C8EE4 TORPECIDO1234
80,264,073 *0885B7AB0D2E5F79BDDE4C8C8B8A808884A602C5 nenholeb3
80,264,074 *08877E14B36AD9DA2FEC577B5763616C4AD31AB0 ,toutperdu
80,264,075 *088B4B73F7050A78D9D73495D06B56E1F1725AAA neuchazis
80,264,076 *0885B3E9E6A2B18BF1DE18631D09852F6C2A08AA 6GNIYFILOM
80,264,077 *0886662C88ECC02C4DB9494F4AF3DB7D50FE59AB NEWSAUG05
80,264,078 *0880640AE5459C76D7916CBC6C2052F426AFAD76 nfigone
80,264,079 *088BBCA105B771CFA51B84DACB19B9E85B4835EC travis336
80,264,080 *08855254A444C3FA24EFD1FBD33E7C492C750E7C NHTS
80,264,081 *088B8183F77DE0B7E9B8B6692AFA613546AB5EF6 NIKKISTIMSON
80,264,082 *0889C1336A4C76C70FC5FA7FBC28EEB263E6BB41 TRILLINGFDSELENS8
80,264,083 *0884255E384D76D5F93BED8A7260B7C647C02183 6SPOLIAAILOPS
80,264,084 *088C78AA3A549C777B70CA5D09C466ABFD29FDDE SHOUSHUNS
80,264,085 *088CD3517D9431899DF30B94A5D672B143F746C1 SHREDDER26160
80,264,086 *088AF8063073B6D3C8681971D69A0F0671EB256E NOE.PARDY
80,264,087 *0885C727E4F06D39B64AB4FE004128298C8F72DA SHUKEIKA3
80,264,088 *088B1034B5948C979852FCBDFDBD31F7C450A23D 7APOSTASIAIS
80,264,089 *088BE69C2B31AC1266BF7EF5E5C2DFCDFC7323B8 7BSWOLOGGIOCDFNCBSW
80,264,090 *088E0ED801D9F5B76BBEB53AD3440E331E36201F nroute
80,264,091 *0888FCB30EF031CDA41A67D102F7F8F63B711144 nukings0
80,264,092 *088065566B54CB4A7AB38105D20E4E3428110E69 SKRIVEPROSESSEN4
80,264,093 *088A90F33671420F26D7FD4454AE5063B67C585F 7MONAVILL
80,264,094 *0884E3555F56893F7FCAFA9EEEFB10818D15E20B SLOWDAYS3
80,264,095 *088E0D890E44E73A758D9D77575C739796B27CA4 uche.ottah
80,264,096 *088F6D0B33623586D0A531DE1058D933DBA25CF7 SNICKERSTRUCKS
80,264,097 *0885756509D2373E6DD50683D7D8A9AF2646CDA7 7SANGDROSLERNES
80,264,098 *088D9CB40E69DB2ACCAA3855CAC035615BAFAF48 7.sayilmiyor
80,264,099 *088CBAE81E7C9C2FB83FC3E94AB0A83EC0E66146 7SPANKYMARTHA
80,264,100 *088092A6F06BC10131FEF62F0129ABC725848C4C od&p
80,264,101 *088B70CA692834E9E028DE4D7694AD2AF28F535F UMASHANGARI.VYTHILINGAM
80,264,102 *0886BF5F9E322ABBB193E1C3DEAF912B50AA6852 SOILLESS
80,264,103 *088DB4BA71BA78D2026AB46535F501E3AD671A12 oh!.s'io.potessi.dissipar.le.nubi
80,264,104 *08846C3192A4C0C2729934F1485043314BF301A8 okpokp
80,264,105 *088AACEBB44DB890C4EC366873BCFD849EA28E10 UNGRATEFULS9
80,264,106 *0880F8657B0E0FA0BA31E98D6752A6D5D3A713CC omercaldoron
80,264,107 *0884E44F99C9493EE058296CBE5ABAD3CBDE4F5A OMHOOGGEKLAPT4
80,264,108 *088EB8BEC0A120CE6D2AD5E502B9F18559691A16 (o_)o~0~d######p
80,264,109 *08857F9B98CEBC793822F86F47405ED13181D839 8EMPALEST
80,264,110 *08897E63161753824D1DA2B57A1A521408C0673A openlined
80,264,111 *0884459EA660F16C5E6669236D2B2F9A03EA7B3A USLYSZEC0
80,264,112 *08858B5B13BD9F3CF322D6F5A9AECF3F0DFA7637 SPLAT!` Q====3
80,264,113 *0882D0ED180603E3890DA4ADEF99D58CA467997C ORVALSANTY
80,264,114 *0885F5922B0CE505A83E4618657319D1A8007782 OSCARBRIZUELA
80,264,115 *0882240D27BCC51069AC7BCA3037D3AF00C92DD3 squeezeit
80,264,116 *088C967CA1CF06262769F69891D7A184EFB8BF06 V75969
80,264,117 *088CDBAB8D090CFE3D300FE4E762A8B939B622B2 otispester
80,264,118 *088CF991429306EDB7D28AAABE79DE4F3E661294 valdo.rivera
80,264,119 *0886FB066DDE29340DD3A8BE92674FC08D09229C VALENTINESHARPSTEEN
80,264,120 *088394AA9A7D53CAF6EC52E2BED2489892E273F9 8.pdsbundestagsabgeordneten
80,264,121 *08869E71B9B656304AF8B9CA70193833967E3709 overcautiou51y
80,264,122 *088FEB8297B745FBD36FD53D8871EC8E95A3EA81 overwr+e5
80,264,123 *088650D614433981E4FB4B19A255CEC74977C79C STANDHAFTIGERES
80,264,124 *08800F9D9ABFBBD81E146E48A90B9B148D7E58AB VALVELOOM
80,264,125 *088E423A853E05A4C3CA94FDD23CEF83CA4E7CBB startsupport
80,264,126 *08879B8FFF7A77A76AB70EDDA32CF8BD9FDE8A21 VÉGEFŐCÍMHEZ
80,264,127 *0881EB726F04D48ED6CAF454AE66EEDAB2299F8D STEVE.BIBBS
80,264,128 *088DA6D1BBC092959E355D34EABC450BA1C38D2D partyzonthego
80,264,129 *088B31EDFB8BEAAAABDC1176CFECE0C17958070C strangi0
80,264,130 *08879212874840B63C04BC5739C69765228F6A94 9catalog5
80,264,131 *088D521C58AF025173CBA4BF2C1802FC64CF6C7F 9FADCFGJENYHPO
80,264,132 *0881CACF2ACB947E0DEA3B7222462903C4FF18C1 9GASMANTAFFY
80,264,133 *0882DB5A941EE8A358D188CEE6D7CEA87E63481D VHN%
80,264,134 *088431CCBC398A004C205A3F58BA7634707FB7CC VICKEE VILLENEUVE
80,264,135 *08810E7529F073032D182A2B597FE6F92306DB26 9-KANTAVANA
80,264,136 *088E35C52175CF0EA41FF9627D83309F8EE24C1C 9MAHAASKA
80,264,137 *08816D9CA349C71F97C0C667BBF273AD5ABE6D9D 9NSKRENKE
80,264,138 *088DC2FB1E0B8AB230BE968B672E4A48990CDA2D 9PUNCHKILLERDILLERKNOCKOUT
80,264,139 *088F14D66F61DA8F8A75CAD5E983C03C0F72D8A9 SUCCESSIONROYAL
80,264,140 *0880571C5CA7BB46EC3DFD6FE6D9BCEAF4DA9C9E suhail.salam
80,264,141 *088715A8920900F596E9552D2ABFAF5003E8F178 9WREVELIGE
80,264,142 *0881D3FB1105C1D513BFE2849934C4729926F5D5 A142193
80,264,143 *08873F22B5507EFE454DA1AAA22C0036389EF893 SUNNYSHINE-DAY
80,264,144 *088A920FCF897ACF479CEB4A927059717B805277 PH3LLOPL4
80,264,145 *088E4BD0A33DA3BE64A0C793F748F7D43F6CA542 ph.ll?
80,264,146 *088C213C295583117B9D80D470E1FB0E8CD567A2 a3tsb
80,264,147 *08879CB591DB0C5FE0A6C154671ACD73996AE403 PIJNIGTS7
80,264,148 *0884290B95E64E1CDA58555E8BFDC8DD2E06AEFA sydneyvafiadis
80,264,149 *0882D90235259E7527537893F4DEDEDC0CD3EC09 PINEBUSHES
80,264,150 *08812C0D256C755BD0D4A81065B45345D9B43584 A7YE6
80,264,151 *088BBAF1CE640381689FE331920391DC87D61A76 WAAFIQAHP
80,264,152 *088DA0F4EA046D25B0C3561A7C46387E69455D07 pitoyables8
80,264,153 *0889F0B81BFB0DBADC06C672A64939F8DA856ADA TADLYNCH
80,264,154 *088DB3C495B5A5A9702D861CD366796696F6836B aaa^7
80,264,155 *088C57123018629034BCDD00950022A4D82340ED PLASMA-MATRIX
80,264,156 *0887A1B62EEA123073A0EC9430DAD82968CEDAFE aaajp?
80,264,157 *08866BE4092E8BA58820DDC9867B6B7FB69EE2EC PODIOLONGO
80,264,158 *088F68CEA0DE39F172053EA88EC8F2F782B43032 PODSZUN
80,264,159 *08806A5505FC20B1F8266F8646A53A1083E154F3 AACCQ!
80,264,160 *08866B6651A0E7FC3FC322089557BA92D15045BC AAD-B+
80,264,161 *0888DB271A0A1405A05E668959F486DDFF3213F9 a/a;u
80,264,162 *088D614682E4C10BCF1D78958FE122195A47B332 WCIBGM
80,264,163 *088697B5B0386FADDE4ED7A2198DB6B24B375AFA WE0NJ8FI2XN
80,264,164 *088549FEBDF38385448380250E5CC42AEC393583 ABTWAHLEN
80,264,165 *0883A7C6F4DB6212D6CAC7BEB5DAF92BD595E30F p######P~o(~_^)
80,264,166 *08886B225F7216A36B722DA478C3BDD1A8DBCBC8 ABWG#
80,264,167 *08860FD90F0761517F888D7A9B9FE053EEAB928F The.Art.of.Living.Foundation
80,264,168 *0889C04998DC0C41DA1FB2F8FC9E802C03CBE887 achtjarige!
80,264,169 *0887B60359264B52EDA25338112BB60D8F6DDE15 acostavalleimagna
80,264,170 *088F7EEDAF7A9731D16E930014381E1E85EFBB31 ACOUSTIC GUITAR FINGERSTYLE
80,264,171 *0885CDAC5DB4CDE31DFEFB7DE8168DE8C967FC13 AD47U
80,264,172 *0887AC6E580C087DAD8CCCC0E692957F08056E8F [email protected]
80,264,173 *088BC16F11364E839EE1089242AEC507AA2D6749 thehudson40
80,264,174 *08878CE9FA1C544402DE15BAD5A2C9E2F715C0C4 Whiskydomozku
80,264,175 *088B2BCA97F0C7375F18C23F9AA38CED259E5BAF theoepley
80,264,176 *088A1C1936698E30F6B745FE5F83E99927DC1653 the-opposite-song
80,264,177 *0881A93098D587F3F52BC14EDDB2792148CA2DEB whitneyhamil
80,264,178 *0885F1342A969BE9A504C18049543E21345C983C WHITNEYMINNS
80,264,179 *0883D4615D0924BBF6BEB63BBA11B9FCDB111A31 ADIDAS42
80,264,180 *08834C5640A105B38787DD4CF3174E132CDDFC62 theretapally
80,264,181 *088A26F478A6D8E3106AD651E7452390C8BB6E9C AD!NR
80,264,182 *0887EF410A295430CBC38D4FAAACEDD9947788A2 thomasbanducci
80,264,183 *0889755FDD4FDF51E9A9918DCAD0A0DA8D370AA3 pudented
80,264,184 *0886DEF372A95248548619DD2A724C4775F1EA99 (~_^)* (=Q
80,264,185 *088E1CD05CA5DDB6229E0317ECCE6998741A16BA Aft3rma935
80,264,186 *0884380DB95D79827781221F05958E8313CCE2E7 q0;g
80,264,187 *088C03062E6A19E975F6E547B00D9DA7DDB59D67 TIM.GERALDO
80,264,188 *088953C56E6F1A548683FB0A93EA25F772E9311C WILMALUCYREYES
80,264,189 *088C68FE0325E30DBE43A9A4F9AC48290CA81C5A TIM.SALISBERRY
80,264,190 *0888DAC076FC533E9B348A241FED0EF42438A6BE TINTENHERSTELLER
80,264,191 *0881BB54A4A279FF8B73402FE094B2654FB48E3A AGUS,
80,264,192 *088A33B780107667A97D458514512C4E33D7EEC0 qhqq
80,264,193 *088CF5DFF053FE9976203B4AF022E7F8E37F2FF9 [email protected]
80,264,194 *0884B0D081809048A82820D26F70244A0AFAD1DE AHALIC
80,264,195 *08898A87F82143339059FB21669E22CC85FBB642 AHP0R
80,264,196 *088D974B2A560D6117F5FDA5A6C92BD1470ED65A aia9
80,264,197 *088E829AC478DEFD9B94BE600B5CEBDC7102BB60 TonalLandscape(Tuning)
80,264,198 *0884532EE67A8647F3E87BBC1FFECA7E4BADF8E0 ak(5?
80,264,199 *088B94F6C2439D2EAC72E4F28FFE68027EF22372 tor.osaze.(dub)
80,264,200 *088AFE73AC49C0E72C8C47CFC19E4C77D4EC3A77 [email protected]
80,264,201 *08857201EDBFCDA286D7A37A7FA19D16E443EC1B TOXOPHOBIA.
80,264,202 *0883B71D3BDF6F638CA1EE152D5E40C5FE80A2FC aldoroscow
80,264,203 *0889AFA580A4A7A3F521D95BF9C6E4021802D3A6 AleixVerg
80,264,204 *088BCB2367B7F479DB37F7DF5C7ABFA9ED28A772 ALEXARCANGEL
80,264,205 *08822B90E729F979B5A9310A165639D617130230 TREVOR.SHUMWAY
80,264,206 *08815962E78193E792959DCAECB1CEA50F0BA6A9 TRICIA-MILLER-TOBE
80,264,207 *0887C9431F88218534172DE5A98A587C558A2E3A QUINCYMCCLAVE
80,264,208 *088B6228A9FC021C09DBAE748EB2520EAE8B1204 [email protected]
80,264,209 *088F46A5A9EFB7F67C7893598735853C5C7E7702 alid40
80,264,210 *088CD3928811CC5D0F36E93760E2C9901C9FFDFF XILORPNON
80,264,211 *088305A1F4700CF80D6CF786D5F425385217BA95 R3B4T3D0R4
80,264,212 *088434AA2C53EB28109A811778A318E7459F94BB TRISTANMCMARTIN
80,264,213 *088EDAB51A1BD695355341E5CB47F6F33BD9A360 r3cop13s
80,264,214 *088063345CFAA6B4EC648F47D36034956034A9CB TRPLNNGN4
80,264,215 *088A61464C7DA75D7996A65EC0B4C088FCD145F3 [email protected]
80,264,216 *0881E490BA51B35801F4FFBFD135AEDCAA8C09DB [email protected]
80,264,217 *0880597A3E9FF3164651B658307DBC44F5C2D165 TSHILONSKII
80,264,218 *0889FD38FBC378E8C7A0D392E1EF8E8BCD3321F3 TSISSABSW2
80,264,219 *088EA5D010E015D676D6ECE8DB1276F85435C223 ALVIN.BOYNES
80,264,220 *0889FFC8C72147451A7FEB79ED57BF5386B9241C ALVINMEADING
80,264,221 *0880FD1CF415A4C692CA70F45D9BF85AB050CE7F yafang.wu
80,264,222 *088DE1EDA953B871811CB5BAC8F5CA9AE4C8CD32 am8-e
80,264,223 *088F04B9975C6CA5BEDF1ADAC550F6F7CE1EC5A0 RALPH.BEST
80,264,224 *0883560F72D1F3A4BBA729FD4BA29BE7091127D0 [email protected]
80,264,225 *0881D5F454ECF3A5E1EC4D3A0C2F4D5C46963A2E TUOMISIA4
80,264,226 *08877E3541FE15731C70BC7E9E4A2F00C8E95175 yasser-abdelhamid-fathalah-hafez
80,264,227 *0882735F92F941D32F18871D7E362F7A56AFFC87 RAMONMEIKLE
80,264,228 *088E040FD46998173334F294C5395FE383E803DF amerikan-folk-song
80,264,229 *08812A4369B8A29D851203229BAACAC5C335AD7D YBSNROH8
80,264,230 *0889E6466EA5A42F28F298B0627FBD494288598D AMIR-ABD-ELHAMID
80,264,231 *0882E08C9D06F68CD1CD786561A56F34E767AECE [email protected]
80,264,232 *088A112B05F8811C8D2A21D308F27FCB708C3EEF raneem-roro
80,264,233 *088E47091B5AFD28E9A5A53638FBB99F3E530C77 TX+E
80,264,234 *0883B35738856B8C657109B667048735555F101F rattaponjomnong
80,264,235 *088FC8E7017036439B83C6B01B91A709615B79CB yolandinabal
80,264,236 *0883D117621BC02AE5FD2D6C58FA1EC9828432E9 angelapuppies
80,264,237 *08850DEB86F8CD9B1FC8D815EC69DDAC921B7660 UCCESSIVS
80,264,238 *08833515790CB624665D143935B2AD501001C348 [email protected]
80,264,239 *0886A56F4A26CF93F21CDA15FFAFA32270FBB5CE anika481
80,264,240 *0886A9DE3E8F892F97610A09F5A42D3582A8C716 UITSMEEDDEN
80,264,241 *088D69AE315D1FD4CB6128D57CF767E144AED1D9 refi77in9
80,264,242 *088AEB0437FE7E4B25113F3B05F751CB1E5BD1D4 UNAMBIGUOUSLY..AH0.N.AE0.M.B.IH1.G.Y.UW0.AH0.S.L.IY0
80,264,243 *0882FEBC7883807C10D7E1F3118868D9821CCEF4 REGULATIVI
80,264,244 *088BD9EACF3BC79EA98118E3925F61ED33B7F4BF ZACHARY-PETTERSON
80,264,245 *088941D08E1F53E3A375BF1D928F0143500E8CFD ANTOINENAKAAHIKI
80,264,246 *0884DE72B6FF88F4048DF83B611C4A4B47B85D4D RENALDOMCGORRY
80,264,247 *088FCF4335ECCF44D7A3FF99F015017E4F3811ED ANTON.UNNASCH
80,264,248 *0884DF4DBB39852447776363F4E024018C136A1A ANTONY.REISZ
80,264,249 *088DA3DB27D3193EA39A1F7ADBAE7CF6ECA9AD65 A%NTV
80,264,250 *088FEFAC2A516C380B2AD64050A4E11E189282EA REPOSTPONINGSED
80,264,251 *0886962797DEC9E999C3CB31D4463380348D4333 AO%7H
80,264,252 *08813E4055F2886CFF5F80501ABA4D916BF817FE a_?$p
80,264,253 *088117B51F36E1292330FA3F7E2BD589CADE332A uploads
80,264,254 *088E86A3C9335BB9FF213497DDE9B5B3F2B08845 UPUNHSIB4
80,264,255 *0886EEE97BD869026736BC3755796693191A5CA5 REYNALDO.DISS
80,264,256 *088AA9AE5604BCF12A387EBEEBB3BDB43F6C7351 zhizhong
80,264,257 *08809575DD3B88A16A0E9218F600CCC700557891 a$q)w
80,264,258 *0882602DDAF26CF51187093603B4444C9F4EA96A us83
80,264,259 *088B30C64B6487F8D2E332F5341BA5BF46069DCE zincky0
80,264,260 *088B474460309DD2BD88629186D6F700D07F0441 RICK.COLLET
80,264,261 *088FC118505A78C3942BAE87B3387CE3CB54E161 arnoldotani
80,264,262 *0888D95D1A77B11228AAE4B79D9F094E36B251CC ARNOLDOWISSE
80,264,263 *088332424FC4C1D602F4C8F536BF99D67878B754 ARNOLD.ROTHWELL
80,264,264 *088D9EEF3ED24E33A47472461744F6EC91D5D9CC ARNULFO.PRENTISS
80,264,265 *088BF8565AB605E8F16CDA83AE95259F918FE90F ARON.ROMOS
80,264,266 *088024356E8C2EE79F4ACE708C7F4871DE18BAE6 [email protected]
80,264,267 *088539807599E0E1F348C06C42DFD1FC637063DD Z]T|
80,264,268 *0881F12A8214D6F8612A17B8339F7559E045FA8D VAILGHE2
80,264,269 *0884DDAEC0D328F0A438ABFE67A01F9B3FD82379 ZYBHL1234
80,264,270 *088C53056A8ECED20544D7C43A498A37C729049C RIUYFKO
80,264,271 *0886B0F35AE53288B1B4BA3D769E3C055CD65C74 RNIMAARK6
80,264,272 *08820107AAECDDD8DB20E0AB9B3B5D0DF7A300BD ashleyarcilla
80,264,273 *088E892BEC4226FDC6DA61F79BDB20CCB6CB8A03 VALLOMÁSSAL
80,264,274 *0881125E21FF9433696D09B7AFE6D7280C066150 ROBBY.KELEHER
80,264,275 *088797EC7534B0023D05274D9F7030B21788B9AE δημητρού
80,264,276 *08866CA68D8C9A0AE3B3EC51E0F79DA51365941E ROBERT.FEVIG
80,264,277 *088323202B5B7A82F02221231FCB20320C234D65 asimov200
80,264,278 *0883A8C86A72461B985189B147660E9712AC6470 VANMEN
80,264,279 *08878DBB0BC6287219EBC9674376C50C1A8C8BF0 VARDKESBAGREVANDIAN
80,264,280 *088C48A63AAB38399C6DD5B6700DD5961ABB871F вісарыёнавіч
80,264,281 *08882F1694868D8E26B2463808A48DF3F811A217 ЗИБЕНГЕБИГЕ
80,264,282 *0882DD11ABF8A687D5903BBA4A3C07A95D56144D VENKAT-RAO-VADAPALLI
80,264,283 *08879196EC062AEB01BE8946A700D8AF060C63D6 коленхима
80,264,284 *08873C12759B28D5EA6D0874C58946BC54762A21 aufgeboc
80,264,285 *088ED6C5FA65CD628D0DA52E2371D496549A9264 RORYJURGENS
80,264,286 *08817C1196B3925AA2D1DD8A082104BAB121EA91 augustustoback
80,264,287 *088BF4E9E3A86F94F0547218809F4A2FA6BDD073 rosemaryihuoma
80,264,288 *0881C090C177A6BCFFFD2DA0743B961D0DDCDDC7 ПОТЫКИН
80,264,289 *088BA05AA0C1C493B61A473E49BBE301268D2145 auvc7
80,264,290 *08843C05A1360986ABE9A6CD85EC059A6BB30E1C VICTORIAAIZPEREZAN
80,264,291 *088153FF8F6E051F0DED7AA76B6FE54E37EE1D86 VICTORIAFOROOZAN
80,264,292 *0881EF38C277AB06981CE4954B4ECA841BFDB5CA victor-valdeavilla
80,264,293 *088927035AD306EF4587AE8EEB98B814103F2C38 RUBEN.GUILIANI
80,264,294 *0882A6FD7D7FA0A8BC1FBC70CB8CAF327B017DEE avqv%
80,264,295 *088C841047641F09CB05D27EEDF00A4E4A469E03 VIJ.RICHARDS
80,264,296 *088D88A5F5AE87BB795906215A177375081E7267 эр2—реле
80,264,297 *08888D70361026F4361F4DE0A26CC8C0A016AEDD rudy.kirsch
80,264,298 *088024E76A35B2305D4FCC6779C0706545CA60D3 AY!DU
80,264,299 *0884C0B3914E7199BCE715D618F8A6A8C52CF5AF az"b
80,264,300 *0889C12E1BD921FF5B3AA624B4ECB1526A216634 b$(:
80,264,301 *0882FAD7D3A8CF1E439A6E4316D3F40DC10D681F B)$=
80,264,302 *088F9DB4298F3A5A45A4A9617F94B4E4B762AB99 S3RV4N+SHP
80,264,303 *088E796CABD703261A5A12F81EF903BF8047F172 VONWEMISTMEINEJENNILLIE
80,264,304 *088ECC07ECD44C28B8A61E5C27770F49502B64D2 b5gf;
80,264,305 *088F6308FE8B0C575CFD0767B1A56EA710387836 B7NOM
80,264,306 *088FC8A2AD3AD8CF6926ABE9663F91F85826B1A5 samba-pop-brasil-ii
80,264,307 *088C78D057FD4B291D4624B6E1369699233410B8 BACH-CHORSIEGEN
80,264,308 *088741DC21F6F8291A0809E0F047768ACA2A59AB [email protected]
80,264,309 *08892F32AB70997E17FA334ADA2F2733E67BA5D5 WAEL EL ABTAH
80,264,310 *088D240D28DDB9DCB68C3E158F5079E44FB262FF WALKINDICTIONARY2008
80,264,311 *0880967DE658C6B4F595C989B18027A27EF10792 ballettoromeoegiulietta-suiteno2-3-mov4"danze"
80,264,312 *088194BCC743B781B604FCD02C70B77D8D092A0C BANGKEI
80,264,313 *0888E564726735E2CDD07F7560ED8354453D109B BARRY.GENNA
80,264,314 *088DBF44065087F76C1D3F0F2579AF408ECA2017 WANGU.MPHINYANE
80,264,315 *08846A2BF7D1B04719AB2099E8A441210B6E5D7B [email protected]
80,264,316 *08855F3F874399EB40AAFF471FCE05886001C543 wannga-suliatn
80,264,317 *088F8D06E8E9BE122F5E2A595E4AD66F5C427247 wantenlopure
80,264,318 *088FF0ACA056BCB1CC0FAAC8E25E63B59B3D633A SCHAKELN1
80,264,319 *0886FCFDF04790863EE28FA37D1718520C70981B WARRIORWESLEYING
80,264,320 *088F8F39E8260DF7FFB84930CD1E93D854B3277A schroefvormige3
80,264,321 *0886AF2AEB0A400C8CC2108B4740EC1C17897F8E bbcb
80,264,322 *0885C86EFA6049EE7F52C50A9746068FDA1990CD bcb=u
80,264,323 *08873673E3C9511D9B22E08A2A005BFDA40B2B42 seerialc
80,264,324 *0880967F047682AC4FEE01575AD2AC51440551E7 WENERICZESKOMU
80,264,325 *088E680C99A892EC766E64FD9FEA2A291B6E0A67 [email protected]
80,264,326 *0887B0FD4AF74A4FA36778CEAFAA47B89D0195CC [email protected]
80,264,327 *088236E4299DFD018431973CAD542BCD6EF2C162 bdq$:
80,264,328 *088722548209CF142492E4AED1F7D7ED13BB1180 WERNERCRABLE
80,264,329 *088BF5BE9A97F94D53F67802C7F84C445C74B312 WERNERISERI
80,264,330 *088B07E0298583A4CCF586C9DF214D3A0F7EA804 WERNEROXFORD
80,264,331 *08887D3C748AE886C6F6D293931F69DC9159E114 Beat'n-Blow
80,264,332 *0889AE2C46515F55D61DBBF35131DBB023EE5DC4 BEBOBRODIE
80,264,333 *08855E55EDC9AC13DE2EF2E6C5410A77CB23D773 BECKYVASANT
80,264,334 *08881BDF456B7584FDF1E7C923A72C669535501F westverhaals
80,264,335 *0888BC805C27C4571C252BCBA7564F7323E1EBE7 SEVENTH.CITY
80,264,336 *088A5BA0DFF7B18B121E3BAAD177A837F933DF87 whinniemiumiu
80,264,337 *088D363B4C793307A3A476A929BBCE4B4B59C17A belimed
80,264,338 *088DD05A5434AE0CCDB1B0EF3573C10F7696F575 WHITNEY.WALBY
80,264,339 *088DC51FA768C060FA018B2EFE5AC62CBC09A0CF SHAHZADR
80,264,340 *088A55D3F092169F33B38340E2BADECB42E054AA wieldts1
80,264,341 *08805F89B355A006873547EBB35822D95C3378AC ben.qualls
80,264,342 *0886AB2495981CCC3500E8442DD01139C6143651 beraap8
80,264,343 *088DB891352DA080F234E28B477C2E2B8DD6F3C3 13.erdnaehe
80,264,344 *0887F18AE190C027732DF67AB860755FBDBCFF7C williambrianpage
80,264,345 *088EB065AD2B2D18752E386B2022A772CB52937E WILLIS.PRZYBYL
80,264,346 *08821F36DB4FE36079ABF20B82321C4E4DE6892D sherwoodneborak
80,264,347 *08897F016710A9F8FCDBE281C3FE0D680059240A shewers
80,264,348 *088897833C39F3E876C7EC068A0FD9F1ADD733F8 WINKLOR
80,264,349 *088E3335BD7B6CCAB019B2521C967CCB30B4A8A9 1746759 maailmancupin tulokset l
80,264,350 *088A9384373D45B044623DECC2BF1B4C1445B483 WMFZBB
80,264,351 *08879B09A4C641379FBCA4CC04D927064E8BD7D5 1778386 DOCTORS.NOTICED.THE.FLUID.DURING.A.BRAIN.SCAN..
80,264,352 *088DB60ED4C6AC70FF5898BB54C94727B5672ADE bhf2u
80,264,353 *08842B257608FE2CF7119A98500821FF3692688F SISOUKENING
80,264,354 *08874FD432238907DF791CDAF64AD777669F1799 SISTERGALGIRLGIRLIEGLEN8
80,264,355 *088D08A133AA7860A54D9A93C4C0DE93BDF6BF90 B$+j
80,264,356 *088829DEC989CD1B5621231A3299EF779892E93C SJAKRINGENS8
80,264,357 *088B6BD4D029D100A78CEBEF2C29C951F459934F SKOCHILAKI
80,264,358 *088A864F088CF890BE385DB6C1327A788FAD4912 BKPJ3
80,264,359 *08860545DFCC229056568690126BDE4B2A57D6CF bldmg
80,264,360 *0886181C153177BFED47B007274E08FE3D005E33 (BLOODLETTING
80,264,361 *08896FF2A89AA7F9E32268F24BD8D6A6F9C57106 wwwcomplyservecom
80,264,362 *088AEFEE8C7F63822B7476A1AF819DCF08105B69 BLRWF
80,264,363 *0886D94FB176BDAB26C78E84A0A167F9376BE20D B_M6G
80,264,364 *0881566D422B72EFFCDE729AE4279F83A4408E84 bmwuh
80,264,365 *0880B12906D44B97356907D850973D3C167CCADD soheliahmed
80,264,366 *088D6FC38ACFEADE59D904CAF518014C17A30478 wwwsearchstaffspasttrackorguk
80,264,367 *088F1E587F0030FC98F1F186941742692C0A8769 1entminten
80,264,368 *08865FF5109AE9A0CC434C524238B3E192BC9709 SOLOMON.DIRICO
80,264,369 *088BA61E6D9468B7BF195035B92840329834BB3C b$nns
80,264,370 *088CB685B90961CBB737B3D8D729C53FED8EE3CA BOBBY.MCNURLEN
80,264,371 *0884ACE29C07FC0F319BC2F9F2DF182AA12880A7 BOB.NEAS
80,264,372 *0886ABEC5619C61EA039BDE268B28A25F363B909 bobrumbo
80,264,373 *0880C9BBCC27A1151A91AF52AACEC68F23CC42A8 [email protected]
80,264,374 *088D7772455671F88D159E9CF212C0F648CCEAD1 [email protected]
80,264,375 *0888094975CA852ABEEA2BD429567D3CD14A63C7 X*7$
80,264,376 *0882A00BAD5C3E43EA723BE4D1B5948E4CBECE71 BÖKENSVEDS
80,264,377 *088989855DDCE60AEC15456435C6919490F038D0 SP3CIFICA1
80,264,378 *088D96CAE53D98CBA54A63187AD68B258B5A7A89 SPARROWRUSSEL2
80,264,379 *08835085996426A5ACEFA389D7443FC80A8EC082 SPHYGMOGRAPHIESESES
80,264,380 *0885613E353EA750134C3FB2B1E4AFC2FF79C9C0 bourgades!
80,264,381 *08801811F4F3A1E2F11004DCE83EC4CC5D0F33B9 SPLAT-*<####8
80,264,382 *088310C2DC3972ED6011A21971D61D8249D2E850 Splat!!*-*-*d###B
80,264,383 *088ACB0DFA66EA3642756F3A41420B6D7FF9B9E0 [email protected]
80,264,384 *0884B51256C4F9E34E4B495C7856A6A55421A991 b------p.`~.:p
80,264,385 *08800FFDA9ACB4467C0160C072308E73289E7548 BPQD
80,264,386 *088ABEEF9B4A19FA286DA8132386B066CEBBB93B X=U
80,264,387 *0881F6FD28A4E91870A1C7E53FB65C7BA900DE61 SPLATO~Q######P
80,264,388 *088EE4CA9B38DF12F2B3C14A70E7B9FE2FD769DC BR1KA
80,264,389 *088495988F824F8EF6ED66E48257BB183E70EE25 splittingtheatom
80,264,390 *088C0E2662CB7523B149F502916A9249BF01C1D3 spotreboval
80,264,391 *0883B64F8904C2D74AEB1C71A7BF9E9AE3E79B13 SRAGIONASSI
80,264,392 *088A9FBB9F57D8139922E861432F785DF245FBD7 BRENDON.CANETTA
80,264,393 *0888550A47E13614EDC8DF67E0277F7D7D7D6F4D sribk
80,264,394 *088B41A22C78775107F9912BAED79CA7DBEF1EDF 1 OMAISILLAAN
80,264,395 *088E028E6B47D717FBD310DBDFF6DE6B772EBBC8 1-opitovuosi
80,264,396 *0884A1AFB4026D7132E5AA88B775A4A7D6E96F9F srotauca
80,264,397 *0888A65F40671A982F34D119FA7B13475B6EC558 1-POP-EVENT
80,264,398 *088CFE0C54ADE8C125F640EAB97B62D98FC7DF94 BRITTANYKOHL
80,264,399 *08856CFA3BFA8792B350D1382EA95EEE8BBE3FF3 1-RiESTER
80,264,400 *088C52A11484550271EFED23341F36207760A6C5 STAHLBAU.K
80,264,401 *088DA1A7063B204130261C1FF513560CB2F04DDF 1-ROKOKO'NUN
80,264,402 *088D354BAA7CA91784691786F339FA5C6AD0AF4E standingonthecornerforyou(unplugged)
80,264,403 *0880AFBD13543D52A073AB8D4A463C5F13B538F1 YELLO FROGGY
80,264,404 *08877D74B7A8416CF5D0E6180F5B06419C66E0C3 b&s+b
80,264,405 *088548709BADFE30DC52A6428F949DB106E19475 BSDVK
80,264,406 *088162BD39376C7019C19626F503855F54735B4B YILMAZ-METIN
80,264,407 *088A1DF20E5E964A1760958BEEB4E8176551D629 b/s;i
80,264,408 *08879F29CC5A6E08B3A96D6D36EE12040883DB2E [email protected]
80,264,409 *08861681384C85537E88DB8A87875B08E9768E36 BSWBBALLBSW
80,264,410 *088E5D97CECE223A691312F13EFD40E2FF03B9B3 1WEB-TY
80,264,411 *0881E42A39C4E6F656B2FED28D749BC6014DDE38 btmi
80,264,412 *088C37CC988552D2B295CBE0B546E344EF73FE59 yosimoskowitz
80,264,413 *08842A3E1C5CDEE1C616EC8F0C2BA776482C5020 BUDDYQUIZON
80,264,414 *088D1CC0E58CE236F204D88B3D05CD0AD072D2AB YRANOISNEPPED
80,264,415 *08886A6F6FC9FFA7A2E689C21993E402E068E0D1 YRITYSVI2
80,264,416 *08854655CFA37EED63100595898EC8913559BEC4 b.uh%
80,264,417 *0888B957B0C01C96D9A7F933DF80E658AB43AFFF buksnesin
80,264,418 *0886B8531E7B3D412E4D978EDC9AB3B24CB2542D STRAWBERBARBIE
80,264,419 *088CBFAFFD876D949B82F1F692E08760637749A3 yvan-bauda
80,264,420 *08863D11113E2B9720F3E002A24D33B2AEA6B7DC 2:2-#-&BRUEGEL
80,264,421 *088B201387CCDC2FA9E95296AB5FD667B346059C z.^
80,264,422 *088E20D1B36CA9C7F15D5D2D0BD247BBA9BD58D4 su8va1uat1on
80,264,423 *088E821B669A116797B33B05230444ABDC73638C ZACHIZACH
80,264,424 *088405AC7EE0216F4BB68BC0C05C01CEA6EABA15 bw1-_
80,264,425 *0880D25B2A371EDD5C601C7D546BA3E536EA8FF8 BW=9S
80,264,426 *088476250940B479F0D1B3DD1F84F6F046D397F2 suite.symphonique."paris":.v..le.paquebot.ile-de-france
80,264,427 *0888119242016E0E17553CDF8C608F7FAF3544D0 SUIZOBSW0
80,264,428 *088C27FAC839D14B9343F4F1F2C123D02A70C82D SULEMXUCEN3DIV
80,264,429 *088908F015D82D651431E756C09FEB6FD797B1C4 zanebottiglieri
80,264,430 *088D9FB01A0319424DBE74591DE911955CDE1DB6 ZBIGNIEW-NIEMCZYK
80,264,431 *08846F04DCDD6BB7EC57C81055023D09896D042D bx2ma
80,264,432 *08844FF6C7574993F7DA663D31D269726599297B b=xrh
80,264,433 *088C16D8443618DE84CC8AC51600C53ADB7505D0 2865456 ABER-DER-PLATZ-IST-SEHR-SCHWER--"
80,264,434 *0889004C1333074DE6ACE129361A3D65FA0347B2 28-GUTZEIT
80,264,435 *0888C4AB4250BB0A66237DADA633585CCF9B94BB 29-universitesi'ni
80,264,436 *088BB71977477E24076327A7403E12CAA68C8478 sycr
80,264,437 *0887EB2BDDFF8B1143BE2160ECFA6DF455E8F4EC zhy-alariao-villalon
80,264,438 *088FF417A540F145AE33E1CB2A4AC2CF33477010 symphonyno.7inbminor,d759"theunfinished":i.allegro
80,264,439 *088FFE21A994F6CF1ACEE38BA8B1A107078B916E ZIKRANASHAD
80,264,440 *088E14573CF1433835BAB621703CE3EEE18A8042 ZJAKUBKAITE
80,264,441 *088C9CC70D1357B2627761AA3B1E1E2B946B669C Z}KU
80,264,442 *08847115B22100C2823F47C12DCE549FFA9B8F3F tabelliing
80,264,443 *088FDB7028D2F43A99D762844436803DE91ED7A7 TAKAISINPIN9
80,264,444 *088612C317361B873D9D194E15659C16FCEFCA28 [email protected]
80,264,445 *08836920BF4768C4BC3A37280BE0E048F1135B46 ZUKO.HLULANI
80,264,446 *08815A04F9448659B8BA1A3B8ACEA126F87A95C6 2 KUVATAIDE-JA
80,264,447 *088FE4C33B2B2F33EE35EAE42405A097C0186499 TALKANT-ZEN
80,264,448 *088672E333AA853EEF07268493EE1914545AF1DF talkco
80,264,449 *088F38EEF1492457AF8F7FC6A2BA2C5893C4C2B7 TALKSTEFANWEN
80,264,450 *088E7F546C1FDE7F5BFE0EF90D3C17E8A521553E 2PSSNGNSS
80,264,451 *088404A818A7D7B30770D34DF340B8B4E18E0854 c7ktl
80,264,452 *088C7A6C3D3C6137B007FB9F75DA39B3D9CAAE26 TARNISA2
80,264,453 *0880C798714A83CC2C53FCF0F2B372490889FB63 308978 BUILD-PROBLEMS49-.
80,264,454 *088AAAA144EE3DB4C30C7AD49AE01EB2197C8835 ca3(
80,264,455 *0882FD0198CE92BE7998479D4398FACF01CE23EC ВЕРХНЕКАМЧАТСКИЙ
80,264,456 *088904A340E9DA297FB64571661AA7CB7EF72EED TED.NACHMIAS
80,264,457 *0880B41A5C6C77F49EC8AF3E5EFB195F406778FF ГОРОШИНОМУ
80,264,458 *0882408577297030302E570F6BF0292808148AE5 c_aef
80,264,459 *0885FFAC5299AEB70E5E1D8EFB34D62A7E28FBDE 39jq3f33mb64eb
80,264,460 *0882CA4FFFF9BB06CA504C7DC8B08934DCDC3CF9 искуственного
80,264,461 *088974D87688A1FD426BB3C22F4CD5E6DD9780FD 3ASTURIENPREISES
80,264,462 *088E1D9D64E8C93DB65B2F08015D5F9CC0AF73FD каракозоb
80,264,463 *0883507994E2BDE50BCF658985EDBC69BA285469 3======b~0 )0(
80,264,464 *08876AF679A7DE669D727F67A35209574CA6C868 3====b~0}o{
80,264,465 *08864D1A102CC183418C2E3292390767E5CEE26F terminalwooroloo
80,264,466 *088C5796D1D9B6D6A9AF7BA440669769E822D53B CALVIN.BA
80,264,467 *0885788D833B2642939AFD80C67FE0A667D7E55D 3B<*.*.*d###q
80,264,468 *08869DB0E24CF5D35DD9C08823038D7DDAA6929A TERRELL.BACKMAN
80,264,469 *0888146ECD0E87A92ADBB09DEAE028EE471B4399 TERRELL.LELLIG
80,264,470 *08870AC541889D8266E7914F050CF0F71D119FEB $3d4tn9
80,264,471 *08889F52E2304C950D0227822D875A97F912AD14 TESTBATT8
80,264,472 *088E4483F1A041B02F4F09114A1D58859609C0EE [email protected]
80,264,473 *088E9A22C7C8E63E0CACD5CE85B8F2724863838F [email protected]
80,264,474 *08802430BE3118642E793FEF1212B213D36F220E THADDEUSBOWERS
80,264,475 *0885EA4F741B5B6BCB270F9C478B413F4EC98A96 ӨӨРСДИЙНХӨӨРӨӨ
80,264,476 *088103C1DF112398746339BEEBD1834F1C236FC1 CARSON.DELAMORA
80,264,477 *088D7BC82B37A6555BCBD714635728C61A91529F РОБИЕ
80,264,478 *088AA3DF9914982EA8DEDD4DC80D75AECA96E86E СЕКСТИЈЕ
80,264,479 *08834B10F4E065755F90E07C0C7A3DB602A28FF9 caw.
80,264,480 *088C526300F1CE5FD41F7B3A52B48672BE88141C caypg
80,264,481 *088BE51C8ECD3C4D9C04669FE621B2F38245C273 THEM.138
80,264,482 *088818B6248F76914A0D548BCC33AEF605A507A3 CCITBSWED
80,264,483 *0883A31CB85C72B02D39194511B9347DF3B755D7 ccouderaed
80,264,484 *088E6077D694FC56833BBDB3950030F31E63A8A1 THERILEY6
80,264,485 *08897201153CBB7ECF34662A7CDF288DD31362FD threesetstoone
80,264,486 *08865BCD94EBE31DC55834EAF9CABA799BEE5B7A THURMAN.EVITT
80,264,487 *088358D5456DEAB4B3072D8D900EF6CC5923BFAD ceo,a
80,264,488 *088B630C3BD0FB17D894A4EC5EE6485E89CE7214 cg:px
80,264,489 *0880697C25A5272751A0916B23ADA957F3E2C74E 4DPIC
80,264,490 *088B1CB14B5BBC18B35252F913A206416680062D chanceocampo
80,264,491 *088EF059B4D9CB256A43FB1025F86F272296A36D CHARITY-NORTH
80,264,492 *08859E7289E149D9517329238A65A4362704AC57 CHARLIESEITZ
80,264,493 *0882C9DC4BDAF8FEF3D1936CCFCD0308716A8888 4P34RS3
80,264,494 *088AFFDD97F338403C751603FB684252470E621A [email protected]
80,264,495 *088C897C5FE495A5881274A2DC6DFE8211A6DD8F Tod-Ashley
80,264,496 *088C496DDAF489ECA2D0C727114CFDDF9B01C700 4RASIERTEST
80,264,497 *08842E8543FD66E97B1A205A511D99C2FCB7662C 4RESSIVGUEB
80,264,498 *088BFDC32FC0FEF7076449CB9686A36246407252 [email protected]
80,264,499 *08892789452227FD9FCE0A4F723C901DF09C2100 4RYOUSIKA
80,264,500 *0885816D429FF109D54C2CC9215397C303C28581 chevrolet.car
80,264,501 *0881E1A37839D72AB5DC6B439C1C915E1049BF2E 机车编号为DF4D
80,264,502 *08886554DC8F25DC2B4329FDE0C356E047841DAE toppekspressen
80,264,503 *08867E1FECA46688B70AC7018A11E082E5C115E3 CHPN
80,264,504 *0880DC4123B74C7D11924B8D40794A0F4AAA5201 4月30日:徳間書店「月刊エンタメ6月号」:nhkマイル・ダービー・オークスの予想を掲載
80,264,505 *08814B5059690CE049451BEEFFC205E30E8C2838 TRACYTACKETTNESBITT
80,264,506 *088B1B32E50032CC02964E1FBB3C7D34D16BC0D4 cici.marquez
80,264,507 *0881517B116454D5540245BD208698B26CB31400 CID.KRAMER
80,264,508 *08864C876AB01574EAFFC824A4F2F67329B782AD TRANSACCIONANDO9
80,264,509 *08833A58057FE7D5851202B441E89B799D251B3B CIRIGITA
80,264,510 *088E2BE20D338E7A58936A9806BBFFC0917E25F1 TRAVIS.REGEL
80,264,511 *0883747A8D57927FBEF9CCF9033484411AAB771D tray.carton
80,264,512 *088D0153165C867933AC027F8392A0FC51175CD4 cku$2
80,264,513 *0881FF2716D961230F8C29B5C910EC86BF2862BA claricebailey
80,264,514 *0886C443E0E1D9130269314F5CFC6E01954F0905 trevor-chichester
80,264,515 *088DFCDB4C7BF62616C69D6D02E6A66169EFF2FE CLEMENTBECHMAN
80,264,516 *08887C9E225ECE1275D3AE8EEFE1FA29E6CA1F01 5DEFORMERINGEN
80,264,517 *088900B609B112CBCB40B24B5B8F80003292B73D 5DISSHIVERRING
80,264,518 *0883062EF25922613912F16A166491717F1914DF CLEVELAND.MONTOUR
80,264,519 *088EE199EC260C2309FFB35F5DF4245BA4A0B410 [email protected]
80,264,520 *08890A9843FE3C1A22C8EE7CCB69DCE2B09BA23A TROFODOTIKWN
80,264,521 *088F4DAB77C9C6F551754D1BC6FDD8686B50267F シェルターと都市/未来の世界を築く(shelter
80,264,522 *0889DE8A23982B4BE00F117B114868C1C0CAA91A c%m-c
80,264,523 *08864D67E9CFE8FB56D97B10751B5E6004CED5D3 5N1D3RM4N
80,264,524 *088DFA33885A362CE7CD81F91E7FBACFB871B6E3 codvo
80,264,525 *0888984336E9A5A6D27438C01CEC10C495423BB2 TURNSTILE5
80,264,526 *0889D81A8235C4BAD5A78E653C0B3FC26661F3A8 613554 voit.tallentaa.mallin.simulinkin.mdl-tiedostona.t
80,264,527 *08813CAF6E5540C32BCB54BF1C4C93FF21385F7E UBERSENDUNGEN4
80,264,528 *088D001F54B61B0DF5D317F7DD1B7F0C58FD0FAB UBSILER
80,264,529 *088012FD8373E1778518C053F52B542EF7C8E4D3 constituter!
80,264,530 *0883EA471B2FCD945A369ABF793331D6D58A185B coolth9
80,264,531 *0889D912FB55FDA09A003B323C686EE4DE22BE2A 06.14.1882
80,264,532 *088C5EB962190FD993BD6EBD29141DBCA2E3AC03 CORNELIUSTRINKLEY
80,264,533 *08865A3E826679CDF4F02E8EC3CA47688FEC864F +0>BAA
80,264,534 *0888CEAFC8DD48DB78C5AD7F7A7A1E02BB25579A 0iamsystem3
80,264,535 *0881ACF20FCCDDB49410CB2939617BE00777DAC6 CORYSTALWORTH
80,264,536 *088FB7B408F0EBA529BD71A229AEB5A7ADC0DCDD COSM37!C!AN
80,264,537 *0887253B08736CA8A5C5C2708DC138BE12AF89F7 Unbeknownst
80,264,538 *0885ED5912F6A14909FEC0366FE59B63470FB313 und!5pu+abl3
80,264,539 *088446706CA1457381791BB4C183D0727E49B01C C-P
80,264,540 *0881E10552D45A5283968363363CE8469D6A36AA cp6et
80,264,541 *088FE2D2EDD0ACCDBE4FD66EC2F2D9182EC182E8 [email protected]
80,264,542 *08800421687A3CAD9C6E723F78BFA4EA0F518146 Unquiet-Grave
80,264,543 *088098B3D5BD4E6E59401535C68AEA5A5F802E3F 6KATIESONNY
80,264,544 *088409FA0DC79E862E382BC970D2127DAE9EE7B5 UNWIDERLEGLICH7
80,264,545 *088B3CB3368D596594355175EB6480076E884A5D UPRAS3S
80,264,546 *088FFD119C4E26AF6EFAFE25173EF1C35CAA23DF 6PERLUSTRER
80,264,547 *0886413BF9B46B91607600864C4B8791024B9A58 usa-thepubon
80,264,548 *088736B050143187038A0C6D14A45939849674A9 USERVINCENTGROSS
80,264,549 *088B42F6F92A29F62766D18CC53D965F79F35125 cqkmv
80,264,550 *0884F9A292BEA6F4193C1B3C90FB779EF3A7CA28 141036 - 649 SAYILI GUVENLIK KONSEYI KARARI NEDIR ?
80,264,551 *08820DF33E34E1CF5F0BD615C8C5DC87F8CDB61C 14344marvin
80,264,552 *0887952DB8F418F404DBAEE79E20DB2FF7C6D6D3 [email protected]
80,264,553 *0885DC1525E8E76187C53975C7A85A8924787ED9 1517861 KOKEMUKSESTATIED
80,264,554 *0886B52BB360C053B1F688A2E0FA57EC740ADC37 V89348
80,264,555 *088B5F0E353F85DBAD250E8BD89CD138B75B1B83 cristophertrygg
80,264,556 *08874BB5C1B49A5E1A33AF2B3B8E3DC0D0CEF988 [email protected]
80,264,557 *08825CE46F815A85474DD51B4B79F2F0CEC5B873 CRUMP360
80,264,558 *088AF35EBFF5203C4C3F80ADED52033646C77135 valencia-renee-richardson-williams
80,264,559 *088906D0704D12C73FB85AA27E315823F121BE32 7ABSOLUTMIKI
80,264,560 *0888220F1C65F08E0C3525A15140FB49E370D3F7 vallivingston
80,264,561 *088AB4044E5C5A552D22362116203CA497607B57 1901043 GANZE-FAMILIEN-FAHREN-AUF-DEN-ZWEIRAEDERN-
80,264,562 *088683E6893B12258A31FBD78F053BD10D631D99 1937107 DER MANN ZEIGT VERANTWORTUNGSGEFUEHL .
80,264,563 *0888D439621FFBDA75C2A034124B3AE63791A0B9 vanessa-j-nel
80,264,564 *08840E23ADF3C67155F15CFC176E62970F0840A8 7DAVEBUTLER
80,264,565 *088270806D1AB3518D7C4C23CC221458D24BC796 1974-01-19afternoon:hollywoodsportatorium,hollywood,fl,usa
80,264,566 *08816FE926EEFBF5C095F1B04A7A7481643693CA 19mar1552
80,264,567 *0889F3EF78A9482A48B4158BDA9123F009D759C8 1.asenteellisuus
80,264,568 *088E8AECC01FD2BCAD447E524580EFAB023D3BF2 7JEAMAIRE
80,264,569 *088D6211DDCDD4C07EF14B2F1AA72C8B0A29A270 1autohexaploid
80,264,570 *0887AEAA1F57AE81AC72DD9CFBAEC9E2F123298B VENATUM9
80,264,571 *08840C639C8FDD5E623D1B865013D1041511D0DD 7MASTERSGENESIS
80,264,572 *088288AD0C300B497A0688A842E5F58D5C37C646 VENKAT VADHANA
80,264,573 *088DC35EF8231C250B2FCFA1C70CE644B81E14A6 ventilleisten3
80,264,574 *088250E8915939F889B058D4BD027B29B25B2DB4 VERLON.LYNN.JACKSON
80,264,575 *08872D1F6D766329B956AE3FEEF4E7FD838CEC58 VERMICLAVELLA
80,264,576 *08807494A64C5AAD220172642D745379DA24F08C vernalmeter
80,264,577 *0887CC1C1AF0A1A0177029F9A4EE57F60D0699D4 vernauso
80,264,578 *088D9FBAAB08C5A0BAF9F5DBA2E40767AE146046 [email protected]
80,264,579 *08824A773209E0520E0727BFBAA5C7FA6BE8AAD2 [email protected]
80,264,580 *088D492309DB5AB9582BA03CACF2726094B2A2F0 victor-dieta
80,264,581 *088D2A36B57A653852FF1BF6723B5959C259028B 1.HOME-OPERATED
80,264,582 *088A52119E61C7327D5CEEA40578AB659C74D880 1iluvlittle
80,264,583 *088921525131FE31BEA8F1C8A7CA7E7A4450A9B0 814847 vieles-ist-aber-auch-gleich-geblieben-.
80,264,584 *088F413DB8DB28090CC66FA69A890256E4D60E57 1.JEAN-DU-GARD
80,264,585 *0887420A55F41DDA5B94C7F87ECD42BF07301E4E D1J+O
80,264,586 *088A4F48A09A130A420664669D1ABDC81C845719 1 keksij
80,264,587 *088C3268CBFA23764DBE59825AA7F06E8CE91E8A 1kiinnostaisikuulla
80,264,588 *08809F9A74C767B6DEB4A0D486AAC6AD535168E5 1-kilparatsastajan
80,264,589 *08827690A1FA095CBCB62BE27E1C1EA11B28B6A2 D2OHN
80,264,590 *0882017EDAF5578CE05F15E6631C025264D033FF VINEET SANADHYA
80,264,591 *0881ABE8C3D190AE59F0B98C7FAEE26C82FFB341 d3j&6
80,264,592 *0886C21F0E8C12A759B571F74968FD5DEC685D22 D3LF1353
80,264,593 *088CB114A4D8E720147ABAA4C6321C998B674759 d3urv
80,264,594 *08830E17EBAB0EF54245006AAD47325FBB116C6A 1.maine-canadian
80,264,595 *088B6444E7068BD66B60F454863B2052A1DB8964 D(6OP
80,264,596 *0888673EC11C5AA0C7F7979F7607B4D930C1C7B6 1ONBETAAL
80,264,597 *088671B6667BAAF8093B57318C23D8DBD071B297 [email protected]
80,264,598 *08899B9239F76FF371FBA36DC93470E6D8753093 DAMESON3
80,264,599 *088087BE14A9FBE5AD242E31C6321C5FEB634880 DAN1E120
80,264,600 *0883C49769C5B49796FBCDCCE15D3C8853F087D4 vollendet ist das grosse werk
80,264,601 *088A15AE9EB312F840F30D4807ACDABD68F419EC DANNIE.DENOGEAN
80,264,602 *08830A0A20C462E14AB227D32CF8AD3D104A57E1 1-SLAM-NIMISESS
80,264,603 *088E54BAE58052376C7D1B2E33ED53352C124254 8LIKOVUORI
80,264,604 *08832ABE9CDBE20162635D1EC19059D7DD72ED5F VRINDA SINHAL
80,264,605 *088696B5E2473F441960AAF375FE8A84A6B752B2 VVENDENSKI
80,264,606 *088A6886C6DAAB3E6DFAF635B58E605AAD923E8D VYNALEZU8
80,264,607 *088C2A40CD83B707FBA2FCD06432E73B5A0C1D07 darnellkleffner
80,264,608 *08882C5C226B4727514574127D239FA74B640D9B WACHTHEB5
80,264,609 *088222FC1A73A011B78192B64CC24481B87E823B DARRENZAK
80,264,610 *088E87245860D1DD511B5408C2C0F3276E08AE1B 8ploezvz
80,264,611 *08821F0615DC5C69A74DCAF1977D16D037B3929B WAK SALEH
80,264,612 *088C957DBCDB03EF91671179EA48E6D70D9C97FB 1-wohlstaetigkeitsorganisation
80,264,613 *088BEC210E8252537207BC9165268B8D10B98C4A darvwin5
80,264,614 *0880465462BDA1D708E23F2910DE002B3ACC927F [email protected]
80,264,615 *08800B91D7593C7B32D574AC7020B5273AAA57F9 wallymettee
80,264,616 *08898547BCFC18BD638788CDC3A4E1556B4DC972 [email protected]
80,264,617 *0884EFE2A685F800D22AC6C23CA16818EAE399AE 8STNEMEPUORGED
80,264,618 *0881FF3F6346ABEF3FCE2BF3A7F103CC1EF376DB WANNUR ATHIRAH
80,264,619 *0885E60D60BD5733D66DAB2E979C88BBC30318D7 8STRTLRS
80,264,620 *088FA0EF90BEA25103CE77CE8E43886117F719FB DB_-%
80,264,621 *08890E13D48346B7069A821E396F26DEA13D16C5 db4ay
80,264,622 *088298267EA3056F26F97036198E03B97117D655 2098987 FORD DIDN'T BOTHER TO GO HOME
80,264,623 *08890B346F84BCAE7C961BBC0CC6DFD7D36D4EC7 21141 kigali.,.the.capital.,.is.first..
80,264,624 *088267032A2CB1E2D0A9D0EE149B949F70E9051C DBTA;
80,264,625 *08863B74A08C1AEDBC19C5C402CA9EC6F23ABFB1 D$BWO
80,264,626 *0884C3F3411D8EE0842D4E3A49CA114962DCBD31 weenween1
80,264,627 *088097C1681C4217DFBF99ACC46FC87A37C695DE 2171128 alice-springs-,-9-.-februar-.
80,264,628 *088B6B626CA607F119D327649E7F7ECD36E9B057 weinberger-karine
80,264,629 *0880B22A2C59CDAC663CA46FA3AB92E1C0FD6620 8WOLVERINTARZAN
80,264,630 *08827B65E0E7E48DD8082F3EB09126F7EA1A5905 d%/d.
80,264,631 *088155B238C2B7BB87A335B1C970CF2BDED9C2F4 DD5EO
80,264,632 *088B3E7C3974616ECBFFB186253C2ACBB929453E de)9a
80,264,633 *0881D2C6965A428AE0285FB876CD863DE17258BF 249193 HELSINGINSANOMAT(APRIL2,2000),PB2
80,264,634 *08857C8C5E63B3A15950E77FB1CDC3A011ADE550 24.HOURS.FROM.CULTURE,.PART.II.(CLEAN.VERSION)
80,264,635 *088FBF7F3AB5630C0C1C3BCAFCCC987E34D1F21F DEFLUIRE4
80,264,636 *0885A4EA0985D74FDA4900B73C85B12C377435AA WHATYOUFEARMOST
80,264,637 *088D7039BD1119DE2C22835DCCC60DF14B2AA264 When-Summer-Ends-(Garden-of-Eden--The-Great-Plains)
80,264,638 *088B70955CB6FA4FE8632BBFA420890366888A17 WHENYOUGETAROUNDTOME
80,264,639 *0881FAE545F1819EE993F2906FB882DDBA79B9A0 DENIZALTICILARCA
80,264,640 *088AB000F670B776DFE37395259C652D092635D5 9INDIGONICOLE
80,264,641 *088F83457BBEBF3B2035920AA86C6C73F1DE2D06 WILEYSMOLKA
80,264,642 *0887C2FB148F4F202707541B4F5A93B27B2A4CD6 d=eow
80,264,643 *088DD3CD8331D0D1900CC4EE25566E99B1E35D4C DEPRECIA+ION5
80,264,644 *088043B77F72E11E79D920A32A80B422961ED923 268758 ILMAT
80,264,645 *088833570A96BB412FA8BA406AB74FF89EA2039C 2730578 PALVELUT : SUURIN TY
80,264,646 *088AA59F7D4ED905069E2775E00371A2E6AF767F 2799087 UND.LORIOT.,.DER.IST.EIN.GANZ.GROSSES.VORBILD..
80,264,647 *088B688172449ABABB9FA34EA35053BC29DC4442 DEVINRAMBARRAN
80,264,648 *088303AD238F80BBD1AE04E4789ACCD1810BA84D 2819110 SHELLISFINALLYBATTLINGITSPROBLEMS
80,264,649 *088F6405DC8717B8F2A3B1DB07DAEB281009553D 2822516 jean.arp.luki.usein.jacob.boehmen.alkemistisi
80,264,650 *08896DB81D7363E556C12E51326D9C8028529291 9NEKJIWTI
80,264,651 *088C3AA147EE78256BA53CB5462BC1DB6B6BB454 28KIRKKOVALTUUSTOON
80,264,652 *08825DC7C2ABF7DA949A3C557801050325F5C119 9PANTHERNEW
80,264,653 *0889B8E1AA8E883D78528D339A7496E2D8F92B28 d"=$g
80,264,654 *0881CD932151F7A89FD9CB63682FAAE468E2EF97 9SCHPKZN
80,264,655 *08890590F8FB283E50C107ABCC32D23407272E3E dgf(h
80,264,656 *08840FFA81CCA0986FE3A1DACEEF407BC835DAC8 dgm2)
80,264,657 *08822EF558B9C4D0F1CD45786473C3B0794967BA 9SEVENRASTA
80,264,658 *08877D2053C3CE86CED0BA9658996E4D9B445CC1 2962063 DASPUBLIKUMISTWEITER.
80,264,659 *08832EDAFA633FB11EC31E910B1F9460B59F9501 WOLFMANCHRIS1
80,264,660 *088421DE2C136CADD5F13E217CEADF549F71CAB1 WOODROWCOMBER
80,264,661 *0886D09249DF7E4266EF008EB21313ADCC1973B1 a0zmwbb
80,264,662 *08858A11F495730129DD9EAE812921E673884B50 2b1347e948fe316a91247b6657f25ad6
80,264,663 *0880CBDDAFFE3B81EEE673A8EEE57064ACBE7EF1 WROTERJOURNALIST
80,264,664 *088BB2DFB71B797BD926AEBA704AF0D9A17651A2 A3:MD
80,264,665 *08821E8667451581571759F513826ED9231C50BE www.belleaire.com
80,264,666 *0887670F4AB5D804C3E0E29914A6EC6C5FD05F13 2GEPRATIK
80,264,667 *0886DD6BA2AEB83B03CD4E417AD7061278BD82A9 A-5JH
80,264,668 *0884FE4217CCB242AAF473D9228BAA70FBDD4AE7 wwwgbyprty
80,264,669 *088B5BC794E85B6017C499861DAAD60611C4DB14 discipline.(the.easy.yoke)
80,264,670 *0881DEE1F41221D38711510A11B666F008BCBEA1 DI;Z5
80,264,671 *0883FAB78D98072E978FDBECBEC8CD790B0461EF DJDCU
80,264,672 *088C847BADABC5ABB8B8A0766E8DDF4A7FBDD4C7 DL6?O
80,264,673 *0889D4B007B4B9CEFF568D51A974BC62F8EB7D88 dlmio
80,264,674 *0883B2BF481258222B8783C7232150C2730AA144 [email protected]
80,264,675 *08845B899CBFF5185BCA92CB20C933C1AAD9B7B6 x"i
80,264,676 *0884BC5E25984E0E035EBF466E948DE41080DDA0 3>~0~O (0_<)
80,264,677 *088F7C2030F58A44C814DA6464B31F33B2EC89A9 D)NW&
80,264,678 *088B314021FBBE2CFA75826D43CDED33FA92229D 35b44923f898f66dd0e39a41cda73e41jester18
80,264,679 *088974BCBBBE5705DD431F2DB9018280C1100F5A abcallison6
80,264,680 *08892E56ECC05E85E47D4EF7AE2DB359FB6B9B82 xtndblty5
80,264,681 *0886935BD82C788545784979C5C320AE5AC50435 3adpress
80,264,682 *0886FD3723775604C2A03D6455FF47FD1FFD933A XU`S
80,264,683 *088BECED8FBECE323915D8273FDD837A8ADCC8CA DOMENIC.SORIA
80,264,684 *088B388E0DD879C53B041B3BCBAE60BFD85A78C8 3c198bab94f14077b1ae4b6ab0e5f916-Hamlin
80,264,685 *0882DE451E23E6AD4B16D2ADF8DAC6ED90E63BDA YADIRGANMIŞ
80,264,686 *0885A525A0F6AAEFE9D662856E761739F4970527 ABSCHTTELN3
80,264,687 *08823296DFFB081CDBB6429B5C270E358A8B2518 [email protected]
80,264,688 *088EE82AA6215D934E7F795CC2E03DD4DF9A9E1B 3IAMGODZILLA3
80,264,689 *088B78A28D76F287E3DD8014545FD4B3BAEA1865 done deal (feat 3mg)
80,264,690 *088210168D84B21ECEA23B7C4CA746753EBDC2DE 3KLUIVERS
80,264,691 *08807D4689FB7D173CDF69A32348E5D655C5D966 3.LUFTBALLON-WETTFLIEGEN
80,264,692 *0887FA019C7B2B9D9069B566ECF870C7D4106191 3M4GR3C3ST3
80,264,693 *0887171CB93E57158E825761C01A830F11F42CC6 AC,CK
80,264,694 *0882A201E0BB3D8E64DE46F3A5C045A0E221E7EE donnerted
80,264,695 *088DE223052935176984515BEBD94CBB045FF4D2 3======P~0-~o(^_~)
80,264,696 *08823CC9713F8F02B3048F2D9E562EA566C3CA23 achromia8
80,264,697 *088759FC83E4C316C8A05A1B9934B73A180A5245 DOOMTM
80,264,698 *088EBF1A8E4E0014DA432BAF13507ED369B944F1 acuario.civico.de.milan
80,264,699 *0887A86E5374205631F00C0730CE8A62D6E47B1E DORDOGNETAL
80,264,700 *088D3A81B822F0135B8413BBBC1B4D0BFFCB5D14 YGUR
80,264,701 *0889FEAE442A825A979FF0042ABA7F86B2B3F54F DORSEYKNITTEL
80,264,702 *0881DFD3E3C65B43844F03B7C5FA9E2F63956694 YIN-CHE-ONG
80,264,703 *08835AD6F17B581B9C0B050412E25195E730CD6C d?osg
80,264,704 *0884A743E2D53260A44A7F15C697A6D6A2F0F853 DOUGLASS.HILO
80,264,705 *088CB18C7583DB0C8C3D1B6349DC782E50AC93AB AD|F,
80,264,706 *0882A0D1F687B87B0CE37CA76DBA8B61134BDB3D YO,]
80,264,707 *0885552EB54B375DEF2136E4091F7CF2F0305DE4 DOYLEBAHADUE
80,264,708 *088E7492E6E8B31B7FE432F80CE8753CF2A25F48 408554 eiilmoituksiapunkaharjunmuutviikot.
80,264,709 *088441BE10ECF8305614FCB3DF65E6D900FD465E 41b4n-s4i
80,264,710 *0885F9D7A0161D9599313B40051E112AB320A9C9 DPCHW
80,264,711 *0886D93E7C401017C68F5FB969898E987E7F2038 [email protected]
80,264,712 *088BE18A326309C33B3C23A81A63A24A7BCF2F55 48v
80,264,713 *0885765CD30817A9326BE2F952D051940F230AE5 dqn!#
80,264,714 *0886801CFD534AA490C3CDC1D96E915A49664E08 YVONNE PREDEBON
80,264,715 *088BC4075304D08CB894D8E694F34C56528A491C YVOTUANOMSOK
80,264,716 *0885FADA7664E40295BD4A88C27F599E6196312D YXORELGAE
80,264,717 *088AC5B616EAAF5E4F9965B6825658BFE9C02CDB [email protected]
80,264,718 *0887294C9AF1400AA41384635F412C9A0F669EDC af.t+
80,264,719 *088C3D965D96F50250971AB61D862F76F92E93E5 ZCGXCMEBTCEFXXH4
80,264,720 *0880F4C785E360314D5CBD12C18516257B820611 ZEIRILLIAF4
80,264,721 *0885A253EB67711A87CE3A64B130ED384AAA874B 4FUCOIDS
80,264,722 *088EBC7B1A6715EDCB28E3BD87223F69A254A000 [email protected]
80,264,723 *0889A1CCA7C37073709E255346DB01A7277677FF A?IMQ
80,264,724 *0881BA3E32A303859C2FF5D7385D9EC10712A5E8 zmijaotrovna
80,264,725 *08844B42C7B2B6081175B2868864B5078100509B zoli9203
80,264,726 *08842FFB89499951FC670D544375A2DA988382B5 zoughdani.yasmine
80,264,727 *088B5D8FFF4FBD5E103786C8CA5BDF0AEC6DE2E1 AKAMAI
80,264,728 *0885F4A5C858BFD94FBF84B89B87D09227610929 518463 helsingin yliopiston kasvatuspsykologian tutkimusyksikk
80,264,729 *088A63AE208B204CF84A4ECA265A6F71D8670771 dxr0/
80,264,730 *08806C43645C4116E3893FC9CB294EEB0727DB8E DYLANEXTINE
80,264,731 *088D2888C81CD79085C33F2C06136562F6030466 59.BLUE.CHEVY
80,264,732 *088928B59FC54516375E8539FACC5B71719866D8 5Aaa
80,264,733 *0889482CD29468D27FE9AAC7BFCAA6FF4DF44C73 ALBERTSMARR
80,264,734 *0884C4ADCAA8DC27D7E32C42400B1FCB53305DD3 alcorley
80,264,735 *088E180F6AE0373156E3D5673C489E26B689D322 [email protected]
80,264,736 *08876E6A183C42D796CA7AC853CCE8B7B698E396 ГА́ШЧАКОВА
80,264,737 *0885D6CB413723FE6E58E3E65E8586384E795BB9 ЗАИДА
80,264,738 *088E6CDA755096121BDC66FA12A4E759D1091001 5BUDDYHELPME
80,264,739 *088C18A22A7CC2CB76885032FA1DDCE245F59D7B ALEXISAM4
80,264,740 *0885A027528964AB438AFFEEE73071CDD614DC8D 5EXERCISABLEA
80,264,741 *0881AF8D06266C9C1E7A61BCFD83A3F253765BDB EARLWINIKOFF
80,264,742 *0889FD5D7AF98549D5E7A6F34EFCC15671770333 [email protected]
80,264,743 *088DCC935ED28A2C71DAC1798039F8A76ACBAE7B ALISONMALLOY
80,264,744 *088C92EDA8D431124BE04853EB70C07F3452A151 ALLEN.BREITER
80,264,745 *0887D42E0277093797247E8E4FF9951C5C660C71 allergologa
80,264,746 *08841A3902652B47A92754F086C309F1E58EAD74 5MUSTANGBLUEBIRD
80,264,747 *08820CAE36CB0C23E5EE545729F731BBD1D8E2CE EDDIETORRIJOS
80,264,748 *08810038BE2B6716685E413D66435349A8543B1F edisonbartoszek
80,264,749 *088947442F4356A7102465E10A73026C97CD07DC editorialintroductions
80,264,750 *0887B1A81BB9002F59F92A1A496B8B6DE33D3024 5NONNITRICA
80,264,751 *08839CE7C9BADB4EFA11D63A707C23D0A28B1F7C ALMA'AD
80,264,752 *088C0969487EB38950C32A443CEFBBE03D1EA8D0 EDWIN.BONALUMI
80,264,753 *0887AE0A34A751CB6DB7BF5F795A074757E81BE7 alteredfuture
80,264,754 *088D8DB67CFBE261C40844FD7FB7249D5A49DB0E eendenkooi0
80,264,755 *088ACBCC419292E0C016A6EA726B8F734DA0DB88 5SHAGGITORG
80,264,756 *08855A872EA4740F2DD5449E4B9A9D04E64C8AF8 AMAAROUV5
80,264,757 *08808AC882FA59CC4B8E339B84B79EEA63622B2D 5STUDENTERSAMFUNNET
80,264,758 *088C31C22E68169001B54CD06224BFC8DA1C96D1 СЛИНА́
80,264,759 *088FBEE710C6B4093EFBD41521F6994F70F5F9AF AMNONNH
80,264,760 *088900C350D74190B30CFFF540B76075CD9B6277 eh#nc
80,264,761 *0882EE9583540F129703941D4B36880D62094096 ANAPTERYGOTE4
80,264,762 *088D53573105F0A38E4D1EC8611569466FF8AA4E andresspaniel
80,264,763 *088D3E13BC7F9BD99481D533091FBC30B86D98F0 ANDRES.THIEMAN
80,264,764 *0880E2515B049816F2A7656D5DCD028482421FAD [email protected]
80,264,765 *088EF5E2800DB2291F5F01FD6A31F520D4DEF6D9 6BREITERT
80,264,766 *0881050AE42448D238935794BDC198536A11A980 ANDTEMPLATECOUNTRY
80,264,767 *088FDABC295F539381BC2C86065284C0B3654EE8 6BSWSMALLBOREBSW
80,264,768 *088F84CCF8E7CD4EF9148A06A9EE011D4A511E19 ELLIOTAGNI
80,264,769 *088D8978BEEB9312BE29BB954E6E25414CD88828 6deconseillerent
80,264,770 *0881CB1CC5A362B074C2F4026ED1AAC3FD039B14 6DURCHBRCHEN
80,264,771 *088FF256204FC4338043D238B9F78263B32BE130 ANMGP
80,264,772 *088EF61B35FD6E8C45DDCA3483539D44AABE8DE3 EL:W)
80,264,773 *0884539BF38523D2CFC2F046ED47A1791DD6560C 6MAXIMELEONARD
80,264,774 *0880681208CC0548401B8EA8406FC91286B38FCD 6MYALI2
80,264,775 *0886FDA5F331B39AF9693B8EA79A291903DB8BDE ANYBODY.CAN.GET.IT
80,264,776 *088B58405DAD216B13745BF2CB791675786B2AB8 APNST
80,264,777 *0885743A3F00EFDDC88F839429FD8CB55D881547 6SUOMOTOHCIDBUS
80,264,778 *0889ECAE36CF812F2D669804AF6645D45916EB3F 6SYTIKIIP
80,264,779 *088311D609CB70672CFA210BB1044CFF3B806DE7 aq-
80,264,780 *0886433C45795F523FC9F078B42D327F104E2651 ARCHIEIM
80,264,781 *08817221EBE435A47FFADDB82E1AA84C22D41C48 ERASMO.DASKAM
80,264,782 *088E11EE6CEB0585941F29B16B04DFC6EDDCD86F arjun.manchanda
80,264,783 *08859317099A17A32ADCDB863BCEEE3C640DB2B9 ARNADOR
80,264,784 *088213F4DD8EB669A44D159C944E5CBAC2A00814 7KINGFISHDEUTSCH
80,264,785 *0881F01B73BFF263BE0FFFE5FB3CE9BA6C66F470 08:00-P.M.:-I-MISS-NEW-WAVE
80,264,786 *0888D836CA5CAA3B7F575E9132116D4D099B52F0 AS5CS
80,264,787 *088E639CA6359AD7D3A78EBDBDADC6517C8C6427 [email protected]
80,264,788 *088B5B7DE0B4A42DCF1624036DF9B79ABE1854FC 0FD570DF6F1355F7E8F161DBD34F701F
80,264,789 *0889CC9A468E3332CFAD62A907AE33FCCF669576 ASPHYPERTENSION
80,264,790 *088FC434371D33E5C04B29BB50699719F26C06DC ESTRELLO0
80,264,791 *088B6935F71DEC91A874C6E6DDE3EAE55E63A50E (>_0)* * *q8
80,264,792 *0888961B1AEA705B49FDFAAE63FFA9B3AEEBDC64 [email protected]
80,264,793 *088DF31E167183995E8EBD0B3289218741389A79 107531 (-ingilizce-)-(-burslu-)-158,307-yildiz-teknik-univ-.
80,264,794 *08809834277646633F7F500B4A99AA856A77406C 107hoivala
80,264,795 *088C304C402795FA2B993DD8AD4B2E5136ABE715 ATRIVERS
80,264,796 *088080083E4BA9C02D184BBCD5502C7901A21CAA 7THURSDAYAVATAR
80,264,797 *0881FD1E3BC011FED5818438E6883DEC6E770D9A 7TROUBIE
80,264,798 *0881E4179244811C03F8DD54B9526240A6F4E6D1 aud0l09cal
80,264,799 *08893FFCEE544B33113D8DFADE780D53004C2627 augustusdeclercq
80,264,800 *088B100E8F4BA0BBFDD27D5F5BBE9A4E13401EB5 1213646 EINEISENBAHNERGRUNDKURSUSBEGINNTIMSEPTEMBER
80,264,801 *088A66FB5D4E86AA98BDF454C1B2273769481046 1225GARDEN
80,264,802 *088603995D354C6077E9B1E219EBC1D295812F09 AUTOSELECCIONADAS
80,264,803 *0888B989FBC1646892D0E404BC7B3CCB8B9A0DBB 1271607 palvelutason.turvaamiseksi.tarvitaan.ennakointia.,.hyv
80,264,804 *088E8E93EB3C9E86BC86E733C9D39522321224F9 87-AJATTELUTAPAA
80,264,805 *0881FCBF2C4CC2A3CE8D5FF49E3F756BA6EE2200 EYTNM
80,264,806 *088A3697CFE9EDDF29001009BC641A2FBF1D6BD9 13 PALVELULASKUTUKSEN
80,264,807 *08899CFE7D4EE4372235DD5B264D5F743C55835B 8ATIAKKOL
80,264,808 *08869A93B4630749032E3B21E6E4EB707F5BDFFD 8AUSNAHMSLOSIGKEIT
80,264,809 *088857406F86C3FCD7EDF85F4305863675A42162 EZRA.CONDINO
80,264,810 *0881DB57924D97C1AECEE835F2CEB9E2220E2F55 F00LHARD!EST
80,264,811 *08834FCE0904FCDB194C8257E008E51CC926B418 FAGFACTOR
80,264,812 *08842AA6D681A6F5CB0379C8B1798D0FDDF6BADD FAILURESWOW
80,264,813 *08838A062225ECFDE12398DA1B4B179EA6FF6558 8BSWZXMGVBSW
80,264,814 *0884630DA7A3D073A6B8F50B6BF707D906C49A43 15.geheimsten
80,264,815 *088F0DD5B3A8515A3E524D16A5F558EC7310DD5C 164004 palokunta-k
80,264,816 *0883A9BB737D06AD7E29717FCAA378D97067348C 1655470 im zentrum steht die kommunikation
80,264,817 *088F548F96419F967A542E01CBE705C78C563694 16:@iNPUT=REVERSE(@iNPUT);
80,264,818 *088563D712BFDD4CCC70BD2AFEA919CEC265DA8F FANGCLARKC
80,264,819 *088869BD9F4BE8FEBF58473B843751A5BEFD131C axhaq
80,264,820 *0885A8BF9673453A294A0EA52ED547BC4ACDCA59 b0y5m
80,264,821 *08899BC39DD4B85DD6DC950947D649D4CB2DC89C FELIX.GABY
80,264,822 *08822BCD85187F02CEF107ACFCBFEEC3A1B9C6A3 8MEYMENET
80,264,823 *0888972A9FA9723F1C8803AF1BC485B0AFEFF56E FELIXVREDENBURGH
80,264,824 *0883EF7E2F44E53D30291EB0858DFBEC53E14F97 [email protected]
80,264,825 *08895B2B1A5C88B7BD975A2E854D17FD882FDD72 B.1-class-c2 29
80,264,826 *08857ABCC5CD8D630C7D0B26448379A606B7B9CE b1n,&
80,264,827 *088027FEA08D7B87CC36E1A16BAA3F212B2CA35D b3hav0r$7c
80,264,828 *088BCBCF42649549E3E386FE5657969F403E2FCA filibertominchella
80,264,829 *0884B878EB906D3BE0E1B25A8429BA825455FC7E FILIBERTO.STURROCK
80,264,830 *088F46D6BAAA56A82ABEB7B44F85F0323DE9DBF1 films11c
80,264,831 *088B1E9403DCC4DA8A44385EF12230D93D9C61A7 1-autoblechen
80,264,832 *08835E6B08C60D8A95F4CD44777ACCE8DF634568 B;6R;
80,264,833 *088C52C3070AF7D342CAC859AA3ADB2C0EDCF0D7 8SJORDEEDROJS
80,264,834 *088DC0C54671FAEF5C36F4D987A397723FC5C0C3 b8kvq
80,264,835 *08858EE9F94B7BC298E62C1C21EA839E646243E4 1CHERCHERAIS
80,264,836 *0886284006069AF72810D699DF6F2F3B6B4039ED BACH.'75
80,264,837 *0882C0E16850124F3EC7213C8A56E860AF9410B9 9040avalon
80,264,838 *0886320507022898B0FDEA0FFD1002012D7D2787 BAELBAEL5
80,264,839 *08886D0DEE51944C6765C901CFF9F9FEAC3F8354 FLORENTINO APOLONIO
80,264,840 *088FEF3AB298C91532B6469F4015B7D90CD457EB BAJAMOM6
80,264,841 *088CF978C991045DBBAB9420FF894B9BE121221C barbara.bloxham
80,264,842 *088D9B78EE9DE8367A44F94898B5D3361A5F6CB2 979VIOLET
80,264,843 *088C5044C8B23C3D167C88889C6418A2EDEA3E20 97OEDC0I
80,264,844 *088CBBC7DCE717DC70130DC5F589BD7BFA1937B1 barberis
80,264,845 *0887B202D8B199054D12763B18FA53865CDFFB64 FÖRFÄRDIGANDE
80,264,846 *088DD0A74E0EA16730DB187524E6268098A69DA5 1.HEYECANLANIYORDU
80,264,847 *0887302CF2591C2FA36767BD43033597BA90D440 FORMATION-CONTINUEU
80,264,848 *088AC26735FC2A28876893A29DEF04D3075B6125 9BOOKSCRATCH
80,264,849 *0884D8A380CB688CB1B4CA367581751C52724978 forty-love
80,264,850 *08803CAC039BBF896A9510E870F0EBEFC5F3209A FOXCOVENTRY
80,264,851 *088682A19278A57160E3618F5015CD43AA0899FE FPOTHCOKED
80,264,852 *08837A1DB3A72939FF2AA2C7E6050B9471C68467 f`~r
80,264,853 *0888CCD56900DB15443B69E8391391E2533969DE FRANCESCO.FAESSLER
80,264,854 *08807DD58363A3F6CBEDEAF6C1E5190DE6E7810B 1KRVAVICO
80,264,855 *088A4BA3A914C5527261FCA8CA80421E54A065D5 9DICOTTOCID
80,264,856 *088A76D70ED18024A51C00C547564D0A96C2018B 1lavendula
80,264,857 *0885F03AEA5C43A1A13602F1527406E139EA2C46 [email protected]
80,264,858 *088BCECA33A756AD83ECD198EEC21A79845D6ABE 1.lm-kirjojen
80,264,859 *088DB4C8C94869027856BCBE05C60605303B0B60 BBI%F
80,264,860 *088DB690A04C6F47AD07B2AE6DAC31CFC83F65B7 frentehonda
80,264,861 *08864145532B271E885B5D00A15CCA53A9FF7CBA FRIGHT8
80,264,862 *088B416496118AC9122260C1DA3321191F15E1E4 bbwag
80,264,863 *088B39ED26AFD106FA2D6A7C9E036145624C07F9 bcj9
80,264,864 *088D1C68FE679557F2C420E4E1AFDC4AC2D8CAB3 B"CVY
80,264,865 *088A217AD9F6D5718288221B1178297CA9220BC4 FURNASCENTRAIS
80,264,866 *088E2B0F40C59401ED8EB351D63C817D6567920A BDOVE
80,264,867 *088B0F9975F1581A45A7820C906F1D957A7D5358 bdx/j
80,264,868 *088E8576F364D96A464D9C139244668AE9B5D78F GALOREAN5
80,264,869 *0889259D6AAB19F5EB596AE13C6C0EF002CB22FA GANYK
80,264,870 *0888E1183D00F15C34FEB665CFC7D15DD5097A2C 1THEILEGRUPPE
80,264,871 *088C77DAA761F2775983F50B94E0CEA97D4F56BA 1thinair
80,264,872 *0889E3EFFF50EA0F4C4AA016E87EE9F86CB049B3 1.TRIKOTBESCHAFFUNG
80,264,873 *0889DA269120E93DAC77BF2662C19C85B3304CAD BECOMETHEMEDIA
80,264,874 *088EAE6629C01428B21BD8EB68720D9BC63FED96 BEECHAM-ROWBERRY
80,264,875 *088226DE94278DAE2838B3958E0E024F8E71F576 a%0mk
80,264,876 *088BC67756A0F425EA900AE08785B586EAAF095F a&15l
80,264,877 *08863AC7113660B28327E9F22F4B4B0BC25B4FF4 1xmpaaaaiaaj
80,264,878 *088985C46A74D202CC9746C55F09FA7A68C1AE64 gavinelli0
80,264,879 *088EA63191A4DA40B77E8398C7654A58F1B5ACBB GAVINTEDESKO
80,264,880 *0882FC96DD7F1BCDCEE10543C1BBA31CE65FD208 A:1RS
80,264,881 *088A8D1D5B06383A954BC1CE7D8713C2B8C26FD2 BERTRAMVANZANDT
80,264,882 *08801FD451422F20993E9C08CF2E4DDF396A8789 GHULAM.KHALIQ
80,264,883 *08825B47C5AB3C5BD920103E3945835795604D02 [email protected]
80,264,884 *08828BFEE86AF125E133091D737C398518E391CD bettieward
80,264,885 *088DD05B2A5B50ED89357E2ADEA28F57F1A161E0 A7N
80,264,886 *0885953B9738972EE94C1B672869B5CF600BF7C6 24PRELUDESANDFUGUES,OP87:PRELUDENO17INA-FLATMAJOR:ALLEGRETTO
80,264,887 *088D10F072D77E877754A02B6C57350530D42095 25.06.1295
80,264,888 *088585CB398259CF5F2FE71CC1C07C487B3EF7E7 Bg7
80,264,889 *0881590F9291DAA20680780DDAD8E786DA0A845E bgvnr
80,264,890 *0880A7069B2E3082732584F0CD48E309603A3B2D GODFATHERGODS
80,264,891 *08873AED8D7B094F80EE14DD16D1B164DDF9FD7D 2ARBEITSABBRUCH
80,264,892 *088EC68D9BF0A3264F6BD882F43612D30908C57D 2.AUTOMARKETHANKKEISTA
80,264,893 *0881838751C82A170502B04F2CDBEB6F9AC5A221 >B/<>I/<EPYT>I<>B<>A/<>"2I"=EMAN-"2I"=DI-A<>P<
80,264,894 *0882ADC93D256F26B1319EC0932F3D55786F7501 2CARDUBSW
80,264,895 *0889BF0B72BFCCF9E3777F0BB51E123ADEB1B366 biggwilled
80,264,896 *088DB5ADFA017722C7782257DA3100FC4933DAA0 AARYSHEV
80,264,897 *08829F785C424A77B897832721D28D9AFD61CE9C [email protected]
80,264,898 *0880792EF3116E6C6BD036239B638D94F494293C BIJSCHRE
80,264,899 *0889A9A7767AC9C8987BFFD98106B6DD3165CB19 2-genehmigungsrechtlichen
80,264,900 *088690BB4AF50B98D8AFB0053B6E1B9C3E827733 ABBG8
80,264,901 *088EC8D8863F9FF1637BEEE6B250795A7B8CDE8E 2-klezmer-imaginationen
80,264,902 *0881D8E7E2AFBEB9EFC7DD483CE2616D4EA6892D 2-LATAUSALGORITMI
80,264,903 *088613FE298886E07AC75F4AB7A70B4D938EDD37 gregorydickel
80,264,904 *0880E365B740E73A6F4F088665FD1F0E44F9C025 2SUCCINCTEMENT
80,264,905 *088C48971AE8326D58F09353066F6FD437C09569 abraham-prado
80,264,906 *088556CEEBC2A8DD42510407914CB384923E703C 2 TUOTEILMOITUKSEN
80,264,907 *088AA00A476FC12CBE176546B358F99EAC6E5345 BILLYKILLER
80,264,908 *0880D2EEA1D7EF7EB02737276BBFB4B3D6E01650 321084 sekin-on-t
80,264,909 *088A875D203A619AAD8206ED3F54E0448E59B2B1 gt die abschiedsstunde" (mme herz)
80,264,910 *0882993ABC142AAB828AD12C8163709DAE532CCE 358441 SEXTANT.TOIMI.L
80,264,911 *0887857BFEABF2178C4E70A20A3F45F1D09C6B27 ACCOUNT, "WHAT BEGAN AS A FRIENDSHIP [WITH MS LEWINSKY] CAME TO
80,264,912 *088F543E0BCC3AA50EE643C77376351182999BAA gundyguts6
80,264,913 *0886B26330D15D7AC2580FA3D5F2AED83A84903D 3---b~0{x}
80,264,914 *08837176BBBAE8549B6BAA8022C5576B76368F4F BK:SI
80,264,915 *088DF57FDA72E98DACD47E09A84EB5AC0CB2658C H1LAR1713S
80,264,916 *0886B38F0E2D63B21C78C7CA895D787228262A4C BLOGINSURANCE
80,264,917 *0886BBA9091E502DAC6864ED120CB7A8BB0C6972 BLOOMBERG-ACQUIRES-BUSINESSWEEK
80,264,918 *0884019E7863E3AD8D347B07F624745E1A647FC9 adottassi!
80,264,919 *08811902CD51AD1A5391F33428ADCCE763698ACD AE6MAP9LLS3SWIBO
80,264,920 *088CA1E004257A08550382A6FA88D4FE81842331 HAONY
80,264,921 *0886D77770462EE778139190696A11015627AFDF harlandkeiper
80,264,922 *0886C9F4CE0E58933CF7A272CB8F5644652F19BE HARLEEWATSON
80,264,923 *088A7BFDDF336CF4CBEC0DA33BBA657B86DB4EAD bmrr&
80,264,924 *088D30AE5C407398FCDDF2773DD3CCA6F732C2EA 3=====)~ `sploit
80,264,925 *088356A4E1525826E0859A17FBE8CC64CC80C102 HAY.QUE.SUFRIR
80,264,926 *088133B47861581BBAA68FB2CDC4BBEA050423FC AFW_
80,264,927 *088361CFF04F6859ECE5563815740EE1E71C12DD BOB.REHAK
80,264,928 *088A2408C9D7578946E5A01780C0938A426CAC78 AGKISTRA
80,264,929 *088DD0FD3B4C654A5CF0D91F94E815314A567787 406WILSON
80,264,930 *088EA0451A158A048BCA90D7C7BB5E0F6B90EA24 AGUSTIN.JACKEL
80,264,931 *0888675DC1B6858CCA94C87BCEAD5EA253D049F5 [email protected]~O~O(>_0)
80,264,932 *08826DEA81B2CC4B8E438C08F4229197785A8B67 43.kefalet
80,264,933 *088DEB19E64F7BFC387D3522096A4E4E61660ECB HEATONSERGIO
80,264,934 *0882EA23CBEB0ED831BD8120BB451BFF1F613FAD B)~O~oUU
80,264,935 *088619BE9A0D1D85372AF8352B4F0D2F22A2CC53 böth
80,264,936 *088BAF4785AC932F8854A67269F4A8C2CD14F4D0 BOULODROME4
80,264,937 *08852B28954D163FCBF718639F680808FBBCBFFC AIDRACOXE1
80,264,938 *0881DED95AD275DF77BCA10F5D4B43A8040D8692 AKATALLHLH
80,264,939 *08841F4FBFFFC5A43FBF97E56AEA570B694C3A53 bq+yl
80,264,940 *08862FB0E5C64E2DD3290E06A238176178F623B5 HEY MR. MORNING
80,264,941 *088E404802FC2FD2425F675F667D4304AE0405B0 BRANDEN.RHEINGOLD
80,264,942 *088770530A95240F226295231AF606255EE1D3F1 4MUEHLENBSW
80,264,943 *0880874D4EF502E4EC84D09F63AED89BC93FB2D8 BRATANCI
80,264,944 *0888BCE2D050CA41A804E7ED533FD991BD1B4B51 BRAVANT
80,264,945 *088C5EEFE40911540A30C0A7DEDF9533EEFF3BE8 [email protected]
80,264,946 *0889E4484F5A968EB3CA72CBF860567F7AE3428F hoegdepunktene
80,264,947 *08823CD32E7650D086747FF3955755F43A916F1F HOLDYOURHANDSUP
80,264,948 *088C60A9331050C249297447907984AD52192EE0 BRIGHTLIGHTSDEADCITY
80,264,949 *088C262BD75B97909AD5FF77C5009A74796FCA1E alomancy9
80,264,950 *08846C3F5446FFC437648BA463D3A41DC3AB9A6D alonzomazar
80,264,951 *088E2701A54457BC95E075FD142776526DFF5035 [email protected]
80,264,952 *0880F3D597C47382826EC1F6A3286414B8A9B5D5 4URSTRUKTURERS
80,264,953 *08827F25C810A235040126C73D19A193F6AE239C BRUCEHOIT
80,264,954 *0888E2D948A579047D23AAFFED97C3D733D11AF0 ALTON.PHELKA
80,264,955 *0886EA9134A4FAF3205226CD9D3E8130957B8068 HTGGTGC9
80,264,956 *08820CB4116C4561F1448FD7BD2D312B9D66F77A 50.WIESBADEN-BIEBRICH
80,264,957 *0883D675160938EC5C47E326A41F0B7933CFDC2B HTTPWWWTYPOLEXIKON
80,264,958 *0882AFB29D1036EB70A583432EA1A8B3AF6C7CD5 545FINN
80,264,959 *0888B31F86A88FF1DCD013BC014AB66E3B402C5B husid'l.in.d.minor
80,264,960 *088A6F2BCC433A489A87D7AE0BE50BCD54FE22D2 amr!4
80,264,961 *088FC4874CB094E42653C4957C017B35813BAD19 BUCM
80,264,962 *088546C5D2FBC334FEC0B535EDA63E545A19E86D BuII
80,264,963 *088FCB9BB9659E1E5C879B20921E605494FC1727 iamsugar14
80,264,964 *088D3C2AFABF153B891C6D4348981A7705F1F1AD BUSTUYAM1
80,264,965 *08894C41402A7FAE08656D598D9BD771018704A4 5KWAGGAS
80,264,966 *0882950A757F29188F1614D030D1B90B7247849A 5misdesire
80,264,967 *08863076E5BF5251102EC5125B2FD62F46B9BAC6 BVBETEN
80,264,968 *0887FE488BEDE0C3B57704026009442756F6E1D0 bv=d!
80,264,969 *0888E512C7709C82F789AB822C09DE6067A842B5 5PREITEBSW
80,264,970 *088D1FB74614429B973C402628BD4D1BB74CFA8E 5RDVELDET
80,264,971 *088384D07EDB135E34DED66AFC0407714269A0C7 ANTHONY.P.MOORE
80,264,972 *088570E058EE045424DC6415FFED0EDA05F52B9D antoniaisome
80,264,973 *08850F914630339955B4E72BDDCE4F6BBAB5D346 ANTONIOLABITAN
80,264,974 *088EAD49D8FE80CC9BF6EA541375AC8694BC204F bw8m
80,264,975 *088D8EA6590486127C53FD16CAFE193F86A9BA9B 。ihiは即日コメントを発表し、損失は最大で100億円に達する可能性もあると試算した
80,264,976 *088EB559751D2BD78AD8D2017ABDD38807DB7F1D BYCVYN1AEXOUM
80,264,977 *0880C79C3E6EB39B4B5667643B305D5E551694B2 iloveberyl60
80,264,978 *0885EA7DC353898C56ABCB383B5CF0C7264A3F64 6DANCERNASCAR
80,264,979 *0881E1C016407AA61DFB7710721C2511275A63C6 ILOVEPALADIN79
80,264,980 *088614AC0636C7C060A8E3FA0738C47CADDE8EA5 6FERVORES
80,264,981 *0881B016934F27A562A99EDAB7F3A8874B6E356C 6GNIKIULTNO
80,264,982 *088FD0897079A47893C4C78C11AB5CA324B509B5 C/1
80,264,983 *0880BB17988940B79F6C9D3482850060C0759C2D IMAGEUGDSB
80,264,984 *088DFFC12D454736A6CFC0F1032D3938B169D353 IMAGING9
80,264,985 *088F0AA3375EC02A5449E3A8A738B302A3FF31C3 [email protected]
80,264,986 *088F3016A657D3840541CB899F96061748B8DF3F IMPLEADER4
80,264,987 *0883D0D2EFD89CA8FC669379647795FD057BBFA7 C%4A(
80,264,988 *08821D5210309759D3BA384B9AC8355BFA745218 indigohall
80,264,989 *088615C72E774F701F59101B12CABF7B384C74CB 6SCEGLIERETE
80,264,990 *088216653C3E11205E23001B258095939B17B3CE infantile-sexuality
80,264,991 *088C6B6CE219CB03236DDF110D16273701FCF67E C5>F
80,264,992 *08880B049DE56C7D480E02F28A2554EA0C5B013A 6TSUNGCHUNG
80,264,993 *088B60E95D677115DB89B78B026FD5F625F22171 C62380
80,264,994 *088D9577D69A7247A23A7C3006E6D115AEA0F503 c6l
80,264,995 *088427CCD0FEBD1B61B5A8E6113D63942758BE51 INTENTIONS.RULE.THE.WORLD
80,264,996 *0883EB1071ACA0E3F1F4452BDFAB56E302079280 IRAPORTING
80,264,997 *08868141403D135F1A1E1E23FDD8D274EECCE657 asims
80,264,998 *088E7374E269D3D6E04F487AD342C5A6F6D57799 CAMERONHONE
80,264,999 *0888E0730BBE5F9F10015FD9F208405E12F08C01 assesam3
80,265,000 *08877A3FFFEBE6FB75B77ED563F533E39096E344 7EUROPESABRINA
80,265,001 *0888C91279D71BFA234AA5DEB8704637C406F100 [email protected]
80,265,002 *0884C892AD579024CE215D9DF1A6DEED9914A129 ISREAL.LAPEK
80,265,003 *088C8E08B0B255CE5C762BB4C8FA830FF511B430 [email protected]
80,265,004 *088131005E7452FEBF223A25EB8290BB4B3E0B98 [email protected]
80,265,005 *0888ADCD8534E36B4C1D1A7BE3F1590FBE868FEA ca$p,
80,265,006 *08890D1D5AF903A8D1DAF4FE43C21EC46B65EB60 itpouillylsfeurs
80,265,007 *088F9B937FD7D740FD4D813E93B871E4EB3C6531 attestaient1
80,265,008 *0887AE779C8B6B4CB1B18E2609AFFA8E3886786C 7KOMPARABILNIH
80,265,009 *0888382EA61149AA8FE43D80CE4952E52260684E aud44
80,265,010 *088B0DD7263EEF612CC6135A7B80BD05C1BF5308 carnivals-celebrations
80,265,011 *08868FB0F8A27B84EA12F234D6B5F6D0A1671632 CARRIE.DAHLBY.&.WORM.QUARTET
80,265,012 *088A8B1718FEDE8F56F4E8E79F24EB02AA089209 case812
80,265,013 *08811A7E154C5588E12FC529E334A360B544705F 7WEAKNESSLOOSING
80,265,014 *0882A67D40C9442FF364474B7E18FDCE89C2442A ava$h
80,265,015 *088EFC6B3D8DAF1EC2795D6876EC1787A04252BC JAMEKENNDEY
80,265,016 *0880519E3BCE550E6B39FD9C0D59F45AF05B375E jamesjole
80,265,017 *0888C190E53CEE2CCE1986BF8162C92A2B13930E 8ASSBILLY
80,265,018 *088458C4171AEF7DD7F6EE3F9986716CA4C16BA8 8B.~0.(>_0)
80,265,019 *088E8D52FD288CB71F4BA208DEB592A7ED679581 A+Z8
80,265,020 *088A6B8E66B0DF7FD4CC40BFBC358471143462F7 CCd5
80,265,021 *0884E76ACBE674A252264612B119D78A49E3D4BE a$zn7
80,265,022 *088B80872E0183E9EBC2A31FFDBCFE08A96DBA9C jay-del-mundo
80,265,023 *0880847C05DBF042C9709E51D4E02AC2ACBEAAE7 JAZZGUITAR19
80,265,024 *088C0B14BB764F536B4FFDE597C5F7DDDBEB2F89 CDBD?
80,265,025 *088CAB518E8811ED18C8EE7F4DE19836BC438B8E B19HTN91Y
80,265,026 *0889A752121498D149E8E55C6CD968409FB62E61 jeffersondanyow
80,265,027 *0885982935473735A0E3B9B83401E1794EB8A742 C(E1G
80,265,028 *088F4209832E685D3FFB8361609198D92F48E59C b3d!+
80,265,029 *0882A846658A076B707C7541BEB94AEA0AFBAC16 cedricdedinas
80,265,030 *08869DDB9A9E52A047FFDA3BFAC3BF8C6068129C 8EXCEPTIUELY
80,265,031 *088070D0943952C2FF6BF81547E7256810E237EA JEN'
80,265,032 *088D409CFC04125D3D75712D81B67720D1D7B67C 8GRADUIATE
80,265,033 *0889FCF3106667555F538494EFCD5A100611B5FC B83K
80,265,034 *0880356CD9AD870B116905E317BD34C8F40B1534 JERRELL.JEPPESEN
80,265,035 *088293EC6B4264618C6D7E12CE408F211A3DE81E cf?d%
80,265,036 *08858824785A061850E2021EFB31FBCBB3A200EB b_a)8
80,265,037 *088ABA01A0EFAE88F1BB396F3BBAA636E992864F 8###p`~>-<
80,265,038 *0880FE7BC73B9C30035A9345B3F52F3463297995 cgjchamps0
80,265,039 *0887B236B00756372D1353E80551931CF12A5C13 jessiebrodsho
80,265,040 *088FB6E717C3844B7E49709655EE57436C871058 8#####P~ ~ ~SPLAT
80,265,041 *088E2BCC391763CF7BF39ABA6210BA4C2EA7E301 BALSIRA8
80,265,042 *088C1D46F7CFA0D9728491A81565BDF07856876A [email protected]
80,265,043 *0886225606435D0BB8E33AE78620BD6D36E0DD37 CHADWICKINOA
80,265,044 *088754AADC49626E22B4C3F0C4FB3317D7C458C1 8RSPCTRDN
80,265,045 *088087670E83A72B2BD829C80D74B7C6BEDCC275 banknotes6
80,265,046 *08846DCA0A937C9D77218524A2B497448C36FB9B jianul
80,265,047 *088638343735A6BABBE1D29E2125A70C1B59EDD4 [email protected]
80,265,048 *08851E6496B48BA559B91A08D4778010F87CCABB chapter.04-02:.the.leaky.cauldron
80,265,049 *088F6E7D9E9DD6F056DA3AA1153DDAC1B7261E0E [email protected]
80,265,050 *0887CA3F509E4514E30D0A1A340D9E403CE98965 BARRETTBLESSING
80,265,051 *088A2CF14887698B2F25C9301D227968EE8D74E1 charlesmilitano
80,265,052 *08881DB1E95B8BE28192E72B3DD7102E8761B711 charlespuccetti
80,265,053 *088D9DCFC6812E0D283676306E6DDFE51DF26327 BARRETT.SIMUNOVICH
80,265,054 *088672B74AE247A1C1F7D8103B210EAD8EF9D223 jimfolger
80,265,055 *088616E588752E83012B5D710E717D92CEAB73BC JIMMIE.PAFUNDI
80,265,056 *088BBCF4CF6ADF6964FAE2251FA0AADA55D5A695 baughman-center
80,265,057 *08822F9CD9ECB2BA30949CD6343E80B2FBBF13A7 JMx`
80,265,058 *08849DD2B43F801326A071E442AEE6D25DCF038E [email protected]
80,265,059 *088C7F7D9937F0A525DCDEB454E2B6BED713035B chhalena6
80,265,060 *088D57218F6FE5645E327E09667261193AF0F4EE JOHNATHANPARRILLA
80,265,061 *088955AFB926D56D7B0C24900DD44D6503164114 [email protected]
80,265,062 *088E2670ECA3FA3EA9B4E26461011372DA5550EC 9ARBEITSFAEHIG
80,265,063 *088FB6A78B0B2BF8E6BF384C6DB3A37DE7BCCAF6 JONATHANBAKSHI
80,265,064 *08854712EF3B1DC8BC759CDB8491F3A0CC1CD564 9BACKPAGES
80,265,065 *088104C5D53E23DE11F004C7F3EAD68D7DAA14B4 jonathoncalverley
80,265,066 *0884808B8096DC0508CE840C0D8576AF71FF9707 jonpugliares
80,265,067 *088B3E0E29EA62A2A5E35CD4D66B0C1CA685F929 chouaits2
80,265,068 *088A093430EC665CB7907FB47D34EF89B31E305A be4real
80,265,069 *0885F44E404372CB073C2BE828D04B4F0163644F CHRISTIAN.SETH
80,265,070 *088E484FD6154B35D573C85E560FEFE6154DDBD4 JOSHUACREMEENS
80,265,071 *088DB2033DC6ED98D3BCB79112C6308EBA6D05D8 JOSIAH.LEEMOW
80,265,072 *0880096CF0DA82E6511E0A2B405554D106C1712F JULES.DOLECEK
80,265,073 *0889DE15E3ACD904B5CBD6B0FB2D28A583D5A12D ka1o
80,265,074 *088BE45B3DA8EA2897F462FD6442766F32B3F407 Christusbeeld
80,265,075 *0885EC868CF6EB6E88205FF0D6161AB09C86F99A KARAN-BHONSLE
80,265,076 *0887A3FE5047085AF2F9EF0B1A679396B44D036A KARL.LITTLER
80,265,077 *088523B0C76B21B8C435DE2AB43E056B73868444 9KINGDOMSKATER
80,265,078 *088B68565EA2BA51485CE27913CAB6ACCE7542F0 CILEUNGKRANG
80,265,079 *088CA3AB7BE70C1B5021DA9EC75D331FDC12BF74 KATHY KOOL
80,265,080 *0887B7D5FA1964F40FD2C32AD12B8AC705F6C595 CIMEHCLA0
80,265,081 *08877C7E7E023C5B9C0E2C5333F37059007BB780 KATZRUSS
80,265,082 *08871A3458C53C175BE7329E563708A068387D27 »CITHARE«
80,265,083 *0881DEFFDDCEFC4367E934BDE226D2CE5EDED97D 9MORGUN
80,265,084 *088E4845671808754BE6A0CDDAF524B7F9890979 KBPA
80,265,085 *0881EBDE1C976270E4F8D5FECC8E84229A5A60A0 c-k8_
80,265,086 *088DBC950FD00FC5DCBBF9E6366BBC3A06B02219 CLARKPETELA
80,265,087 *088E627F1B8E7370D16FA663AC2E745401BB2E88 CLASS="SALEPRICE">$6999</SPAN>&NBSP</TD></TR
80,265,088 *088122655898BC33F3B88944E4FACF049BAEA3B9 claybeissel
80,265,089 *088948199210D7CBAC0DB27947A1A78B90D94FA3 berniebrowns
80,265,090 *088E9C589DFF00B3F29FDBF2DD4E9225AAAFCC2E CLETUSHERGENRADER
80,265,091 *0883FC9539A9469679A5713F20716A9C40F90A99 cliffordcarlone
80,265,092 *08878A39970F706A22AF563755C63F7779B78585 9VCNTHRTD
80,265,093 *08832B20FF4C3A4055FF1E0E6E3795D342DB405D 9VENIMECUM
80,265,094 *0884307936E1288E72E472B9F394DE4415F0398E [email protected]
80,265,095 *0885F78C7D8F4A08B8393FCC9328EFEDD9AD29A3 B)=F
80,265,096 *08861C9B45B0B4C1B612BB8314A4559D76C64C70 CmL2
80,265,097 *0884BF91A6A4AA7BDCFD1E144BE99AEDDF539FC8 KINGORGASMUS
80,265,098 *088A92830B95F9BF8A1861C22B92FAAC471DF6BF KIRSIAM
80,265,099 *08884B341119B5A06D2F761A2FD8AD2BA65F9493 KJACOWAY
80,265,100 *08852A238AAE14F906C677E891262479F8862E2F bhm%.
80,265,101 *0881228F327659218AA3CA7C54D4FE8358FD80C6 COCHICHLOEI1234
80,265,102 *08832793289F26A00FC8A03556B7872DE302AD95 KLOOFBIJLEN8
80,265,103 *088BE4E2CB832F2C2B924010C94124E93A0AEDEA colbybatcheller
80,265,104 *0889F989CDD446B4477BD2B59E2795D691AEF0FA COLCTIVIZAREA
80,265,105 *088FA7183E956F78F51725B66A8A8E95D396A873 A3QT)
80,265,106 *088B353D1E76224070E741014B4B26B09FE7F6B7 a585860fdbbedc31fb90e4ed7a8430ca.k2scrap
80,265,107 *0883C05FBAE27784A92BEF1EAA0372E6CE25F041 BIMEINIDA
80,265,108 *08881553AAF47C3D2EAB7B794B17DA2401AFC77D COLTONSAUER
80,265,109 *088B61813C9DCE371017BB5170A42FA40DC05DDD bissula
80,265,110 *088BA9CFE1AB30E1879D6E731A0C690B223527D5 a7f3a
80,265,111 *0887932A807656DCAB857FB58CE40C828597305E bjcn
80,265,112 *0889F05E0C1FB827B8FB33E3467574E3A837B587 b.jr&
80,265,113 *08873FAE6797D53AB88572E012FBD8D9077D1140 BKEW4
80,265,114 *088A843D639F1816A47A524C85D8C5597CD6172B LACY.TULLIUS
80,265,115 *088259E230C78BBF4499E5C33B5C4A86820B4D98 CORTEZ.VACHE
80,265,116 *088143943FB3CC0A01D77AF46CE6595A6A987DC2 BLOSSOLB1
80,265,117 *088727C4123698171FB5FF826CD78FCC91A8ECFF LÀKÚN
80,265,118 *088E9A02900541DDE85BE37F3B79233B6BB0740B LAMANODEMIRUMOR
80,265,119 *088EB9F156356D44D56AB89F5650650BB6DB3619 C-P
80,265,120 *08875D2DCF78FDF863BB508BF137529076CCF01F bo1f8
80,265,121 *088023832C63398F48EA1C1A92D35F93543F9896 BOBBIE.GOODEN
80,265,122 *088B92A5725B5F69A1124FAD557E0D54B7063E47 laudianism
80,265,123 *0882E7C03F32EC2CDC5F10A5757A71F5538A864A learningtoloveclinedion
80,265,124 *0885DF519BF6B03E7384DA0C89E9FF3732F495FA LELANDLUBOW
80,265,125 *088BE6C3AB576F46F28B7C2354017FE96C5C5857 BOGRACSOKHUWWW
80,265,126 *0883CCE523BB4A925F954E974BA8C279739719D1 boku_
80,265,127 *0881CE4ADB731FED1E221772DB6657A017F90486 BOOKER.BARBARINO
80,265,128 *088F4821DF0D55F15641FFC3B3120DD5BF1F8F0D borum
80,265,129 *088E0FC4D58AF976DFE4C4ABE2CBD5405D144608 ABRAM.KEMERLING
80,265,130 *088C21890B8CB09CC949C58C85BB0F9AE968A8ED ABVUR
80,265,131 *08806DF762FC22D9D4D942D1AD98646FC5C194D1 AB+ZL
80,265,132 *088E3434448C790025492FAE11E83D355795BBDD lettersfromacoffin
80,265,133 *088670951AA35FA9828D137E169A974897D6D25A BqWP
80,265,134 *0886163961103C8EB5DDBDAAACBE44B38A1FAAA8 B#r:
80,265,135 *088082845D6899FEC3451F4F10D2864E02C23189 actofcreation
80,265,136 *08825B894CBC75BF9E917006E94FE0A9C535C633 adh;a
80,265,137 *088AEF0C88ECDAB719D689FD14668AA6C28D608A crca&
80,265,138 *088B79D793098AED7CCBA6DF44B897DA8272C715 brainlawler
80,265,139 *088FFAD56E3B5D9D03DAA45F8505497B4B296751 BRANDENALLMOND
80,265,140 *0886E3655056DD5E3E246AEC931D612F47A63166 LIVELIED6
80,265,141 *0883BA0583A7B6A1FEEFFA683B8FCAF76F894EF9 livrera!
80,265,142 *08829317E85DD338BF9E79ECA22BE554C60149B9 breaking down the borders
80,265,143 *0884DD9CBE6C38582F3BF40F2077F54890D5029C ADULTTHEME
80,265,144 *0881C99C9AE26F0C96B4A6B5D4A2080B260557EC AE!+%
80,265,145 *0881F9E5EB9884411B554089869071140A7D0974 AERTIGST3
80,265,146 *088201B675677C664A39C027D88C6880B3532F08 LOGAN.BUTTLER
80,265,147 *088DE96CCC9C11DBD416B5360A77435EB2BF5DCA afroza-rima
80,265,148 *088780A43489699130D1FD7FF5AB0FDD688341AF LOGANPROUT
80,265,149 *088DEDE58D21B2F9408F981D7F420A5B62FB0143 LOIS.LAWRENCE
80,265,150 *08818809DDC94320BD8A47E2F3F369EF53683EDA lokanatham
80,265,151 *088771407CD6799C0A19932FFD07F61964136402 brick che
80,265,152 *08867FB0556DFAF4F7B9F3BAD8C01A61958C7739 AGENCYU.S
80,265,153 *08898661A8A1DAAF94B426E953F70B68B62467FB LONNY.PESNELL
80,265,154 *088AF657989BE0C443B916F3C0D8FCD60D16524B AGQQP
80,265,155 *088330B4E0B23C59E59AE7AFB3D2DED64DBB4ECC love.of.a.girl.and.a.bear
80,265,156 *0883ED92B17F9377CDE8490A088911F0E7DDEEC8 CULTURETYPE
80,265,157 *088DCF0D58148E746F364184D77C2F4AD3DE6A94 curtclendennen
80,265,158 *08874EA96D8316D6F1BFFD69B4727799CF187C44 LPLARIZONAEDUWWW
80,265,159 *08839DC549269A8E232ED92EE9B11CE6266F6460 LSMOLENSKA
80,265,160 *0884AC668C6D70B4F97E7BFF3ACAB3E084F477D7 AIJUNLIU_
80,265,161 *0883E9D0E12076603547129C8CE1EF5A8593A753 bs5!_
80,265,162 *088354E20AA82BBA19D7B0E271FE6859BC50F8F8 LUCIUS.RAYGOZA
80,265,163 *088420F7503916DAFA8902AA7A3784A5183E9DCB bswoinnqjfbsw
80,265,164 *0881DA76D5C51C6B1F2646E9306F6BDF06825FDA LUCKYDAVIS
80,265,165 *08844CC23987544F93C4B243507DCBD33495246D CXKBLQVWE
80,265,166 *0889869241D6EE7A9211E45B947CB24F463B09DE B(=u
80,265,167 *0886F3C08890E76368754467311D55C59EAF42AF cyw%"
80,265,168 *08863F81888704D4F7A1D407E215110BCF86257A [email protected]
80,265,169 *088A15058DBFDF7174577B85974A3AA6400B09C0 bugsb
80,265,170 *0880B02E1392BE69A2A6922EDC04D8D33DED473A BURTON.MARMO
80,265,171 *0887A3ECEA5FF0C0BE481C873C81AB22D82AE4DE bustirun1
80,265,172 *088D5B5B3D0B27EFFF551BDFBB275209DBBE654B [email protected]
80,265,173 *0882ACAFA9EF953F8FFAC52B8797706467A26831 MACQL
80,265,174 *088DA290DB31151B3235FE291D607ADFDA0ED22C MACZETING
80,265,175 *088E2F4AE3D89CBE9AD1339EF05437BEDC83B1BF MADAM-TUOKAA-NAKKI
80,265,176 *0881C4760DA6F53917F0A00D0894A1DD2BDB4D0C d3(z#
80,265,177 *088C370FE10EF713F51BF529DE6F9A3B9D9568BA D4,CL
80,265,178 *08804A43FCC9EC2867D360F414EE4699E1EB0A70 MAILMANA3
80,265,179 *088A763C5C7725F04F07E06E1463EA89BDA68CA0 allattractive5
80,265,180 *0886770CD78B36A328A5661FC8FB8993A44FE1AA D5=EL
80,265,181 *088209E766B3FF70AF97F37CD0BDEA865B0161AB bxy
80,265,182 *088D9B5953D357A8BF4E0BA4D87B53E69F7A4FA4 alstras5
80,265,183 *0887E6F604D753DFB937E0281C0C09902C611EA7 MARCELINOFORGRAVE
80,265,184 *088041822A7681454133F426872A9F07284244A1 alvu
80,265,185 *0883E1429E5DBA125D34EEAF022259691E5885A4 MARCHANUPCIAL/LUNADEMIELENPUERTORICO/PIELCANELA/SOLAMENTEUNAVEZ
80,265,186 *088111496F9365E3C4B716E4A9F97BF0FB4679B8 AMANDA.KAZ
80,265,187 *088EC84713B3B5BFC50AF2213CAFFE5B94862549 amanda.shells
80,265,188 *0884B03E802770E0BB67C1252C0CF320CBFBE0DA DAMIONROCKYMORE
80,265,189 *08800659E977C5B28800F51A57ECD9B4127F7E4C DAMONPENG
80,265,190 *0883A7074F5506F93F36EFCDC650150DC3113152 [email protected]
80,265,191 *088F979FA9750625F40D0099561689E7BA5B30AF margaritohauch
80,265,192 *08870F076D317407C5D274EA24648CB0033B42D2 DANE.VERGARI
80,265,193 *088B5B2904DA07E4D0E7393704051F7CCE4B5BA4 [email protected]$+y
80,265,194 *08875C2D6A05A8E83B9D65D81CD42CCA0D071FFF AMITKANABAR
80,265,195 *0882188724D39C0B04AF523A6EC54346F1F6DECF DANNAH MILLER
80,265,196 *0886AB7CB028050F839BA945DC9BCFFE61875C91 marklinford
80,265,197 *08885FBC3F9FCC4D323C8E5A6A4EE9686227B1EB DARIUS.STEMPEL
80,265,198 *08873F4B457538A69D022F57690A04E8328BF3AA darrelgeuder
80,265,199 *0884FBDF6CCF4FEB400D0C59503C82797BF2E09D darrylhollenbeck
80,265,200 *088DBFB6FAD0BC47C903BF4F3F477513D30C2B31 ANDREWKUNERT
80,265,201 *088977AB526D254BB9FB0ED2354AC6D941AD6523 C8V#H
80,265,202 *088BB04B6F68107A48E0D96D9F1D6407C592C757 anmi#
80,265,203 *08815F18CAEFAF5361C981EBDE7EF78D685E4B9E DCAMPHORSULPHONATE
80,265,204 *088F1817C6235CAFEDD7289582F5F2518D6F9543 c)a.!
80,265,205 *08832FB078DFB5706E209F10BCE5E02EE59F38E0 ddwnn
80,265,206 *088AE1D266FF02EE46AB58BF4BC5FB451E0EA225 MAX.TEAFF
80,265,207 *08862039D2FB5B4DFAD70025F04EE91B889C42D7 AO$GC
80,265,208 *0881EB4CC3EB6D807CEA9DD6779DD35DA5D22AF2 aoketnni5
80,265,209 *08802F99870487BB41431B093D3C272BAD106917 aow4h
80,265,210 *08864E52F0BCA5AB1DAE8A8338F2A026D582726B a.paris.(+.bonus.'ele.e.ela')
80,265,211 *088C7FC528C6093A73D4754F2032C6C74BB18B8E DELEHANTY123
80,265,212 *088B2C8FBB4C315CDE9B7C5F2A914F85851F8638 apw!q
80,265,213 *0883E6C953050CD6F20A61090FEC50C3FF15D22B ARA0SA0MTVO
80,265,214 *0887FE9802249339D36026620CFEA7D2E46A6F90 [email protected]
80,265,215 *088364FED4E4A0A121FF812535C22547A56B9065 CAROLSTARNOLD
80,265,216 *08848B6725390C9A9B114A77CE371FC920DB6BD3 CARROLL.JAQUES
80,265,217 *08827710D28E0FB92190396E70F3E3CE15CD3FCC ARLENEWENTZEL
80,265,218 *0881EE62DFD8652E87E226B84C5F9B9E1243DFA8 ARMANDOPUENTE
80,265,219 *088761A28EB6C0C1F1603C2C0E0DE14725F7F11E [email protected]
80,265,220 *0884BEBA0A2F66D6F2FE0DC289170015E34C0840 derickmcghan
80,265,221 *088B2B5A10F957F0485B6F5BFC2DCF4A7EF62FA8 MEUSELL
80,265,222 *0884C9707290985BD3D7202C9BCCBF1AA705B77D DESDEPINOMONTANOALOSVESTUARIOS(FEAT.ELOSE)
80,265,223 *08822530D0CB89E18C809434591A1E6AA6BF8CA9 DESIGNCANADAORGWWW
80,265,224 *088BBE65C1536E09213EEF67DCC19338DB0CD7BC desire.(dj.garry.remix)
80,265,225 *088F30DD3CDE619FA76972800D7AD8E2B81D187F DESMONDJARECKI
80,265,226 *08853A95D89E79FCBB441C09FD92B973806290BF MICHAEL BALCO
80,265,227 *088EE110457C48D7B5EF224C99956252E0736050 MICHAEL POOS
80,265,228 *088793BF68AA688354012F5EB67A5FF28FE19750 CB2RP
80,265,229 *088DBD60040A9DAE72D3D73475338E529208223D cbktw
80,265,230 *088D9F6F9DDB2D32B1A26A336964D03F8FBE2CB6 ase1$
80,265,231 *088C35B49BBBC16306FD20A30E78058D8AB79957 MILLER1980
80,265,232 *088C47C0AC2E93E2E2DF8F36BF391BC3C6F9349B DHRCV
80,265,233 *088BE1597B4445BE3A90528086CCDCFC564B6F6B mladistv5
80,265,234 *088765ECD56A9035E26CB3229BC3958C4786EC27 C(FHI
80,265,235 *08865C41DE398E04AF2A151F9F3485BFA1B54146 ATUBE2935氏の会話ページ
80,265,236 *0889BB228C875F0B06EF18BEFAA058D236858178 DINO.EBINGER
80,265,237 *088F675C69FBD925B8FB0A8D2C0CD33017627044 ATYG
80,265,238 *0883641DD89A57483DBE8BD001278873720FEC6F diskontinualität
80,265,239 *08850B9C72D8AB8C80EBC023873659E784B0B7A7 ch52a
80,265,240 *088E19FB6DB08C9CE29E4981A2882768941BB536 AVATNETTA2
80,265,241 *08846F7C0C8285D94E4696D6F91EF73C40242246 [email protected]
80,265,242 *088CDEFC0B36B92625682C7A252F654A5A360DD9 DJOJL
80,265,243 *0880375F3749E886E87C0CBC839FBE8266A037E7 D/JSL
80,265,244 *088017F8D10D3CDF01BF0CC8F405B3AF5E0E6D3C AW6,=
80,265,245 *088A1F398FAF9221B52C7480CE5E244BA159DAB0 dmw!-
80,265,246 *0888952DF8BB471C14FCC85FDCF533F4F555F15A dnegufuzes
80,265,247 *088EBE566A812E86DE6DA5A108C47C9DFE253A66 [email protected]
80,265,248 *088B670629F546057953A0B497EE8CFF8517AC9B mulattos?
80,265,249 *088BE4757ED25D4C7F29A4D5411E6CCB75C70A33 municipio-de-ahuacatlan-nayarit
80,265,250 *088609E94CC36664B8729D6035939886012653F2 MURIELCITA
80,265,251 *088235D7DEC59AA8E5EC227C094BF333D65B29E5 CH(F?
80,265,252 *0884ECD8B6B27E8893B3AF38E1D4C00FDBBEA1DF b3p8
80,265,253 *088814B81F2E78A657E1FB1D26A3C04E65228C2D MYDAMMIT1993
80,265,254 *0888B58181ADBA067145FBEF4EF83913011997FF b)5n
80,265,255 *088A359FFE35E8F64806D311F7D3ED8C01B716E1 BABEH.FIRMAN
80,265,256 *0883A209A773C7B46F9BA41AA8F03D4F18C97F6F nakameg9
80,265,257 *088891212A76CCDE1D5BF60397E9A36CC172BD48 narutaki-zol
80,265,258 *0887A5315263AE127ED550A5019DFCE091334DFD CINE&
80,265,259 *0888C4DB6691354479AFFE90081782692A7E52FF CJJE(
80,265,260 *0880BB8B612AA1C05D13CDD26069CB399978ED96 ndepoissy
80,265,261 *088226C2BBF0C2A725A6F2B4B797229B9B1BCF77 dorzalino5
80,265,262 *088C6AF9F8DDDCA5A0C366BCBFD2BD0004E6ABD5 BARATTIAMO?
80,265,263 *088ECFEE4110FAAF500619D6B9871F340BDCB73B d’oxag
80,265,264 *08846C0AE61DFCB8C8A8D60C651C66ADBD558945 CLATHFES
80,265,265 *088DC146046199730BDF42B0211425534DFD8CF4 BARRYWEDMAN
80,265,266 *088093515A82C9B16626C06CE39B53F552E1D592 claudeneonakis
80,265,267 *088C654A2D10285B10C460AB459BFE145C9F07EA CLAUDIO.TOMLISON
80,265,268 *088E0A18FA4851152EF61D57DCA76CFCE5D467CC NELSONGOUTREMOUT
80,265,269 *088A3E71E2A23A43695D695F056121E224A14A96 DQ;PL
80,265,270 *088FC9F6AE88874BE161421CFEBE501939371B1A NEWTONMAGIC
80,265,271 *088738F378DFDCDE76C13D0CBAAA36A58714DCC8 CLINT.KRUMHOLZ
80,265,272 *0887C04CB0989B2019FD06716E08D65B5F4F32CE ngn20061120spe01
80,265,273 *0888A1B05ECBB74FD8087630A4361B9FF6C6AB97 [email protected]
80,265,274 *088BCE2F270863DF1A29D90A388657386825F3AF DRINKERSHOUR
80,265,275 *08836B1E9E64583DCC6DD2DCBD23E96BA712916A [email protected]
80,265,276 *08818A4B43B0B63CDD4303F20EF6F74C225D9361 CLUBFOOTBALLEAGUE
80,265,277 *0881149101CBCD77E45AB12CAD139401D629051B C&n%
80,265,278 *088F3399BF519621A74514A8D9DAEC5564DA3791 cn1.x
80,265,279 *08836A43CE0156C7DC95E4109B2C53C117C17DC0 no..14.in.fsharp.minor,.bwv.859:.prelude
80,265,280 *088B2CDEF6EF127A8B6673A0EB356591F1D14F6C DUANE HENSON
80,265,281 *0887147F3C40B03733A84B9B4091BD0DEDBE4ABA CNUQL
80,265,282 *08860ABC566F6E7B5F86FCC073573961837034B9 beilšteinas
80,265,283 *088EC2ADF866A104C7148FE75FD40D0FB8E4DCDD DU.+S
80,265,284 *08805B1F83F753784113D2868F3C31CB61125B2B COLUMBUS.ROUFS
80,265,285 *088AB895CE8504A9AFE7285AAF20DB4353DCE09A NOYAUTERAIENT.
80,265,286 *08804F74A7AAF45CFD19E2FEBD812CAC0564B105 NSTRRBLED
80,265,287 *08888D2928B5AD9358BBA738C7E300BD82FAB3D8 DV;W
80,265,288 *0884236A6B19AAAB16BD94CB8786F21DA6133640 [email protected]
80,265,289 *088E5929691641952873EB83DF58A97343CCCC55 CON7R4INDIC473S
80,265,290 *088E214C1FA2564041B0D3346DA68308D1AB1FF5 CONJUNCTUREN9
80,265,291 *088366003EE493E6292EF434E5E0B2B817BEDBF8 (O_)*@#B
80,265,292 *08800B05E8A8A3E468F615933922F7FA95333202 BETTILU8
80,265,293 *08880E9355A85CEC8EDAEA1EF303C162B33A4C80 CONSULTAS DE BORRADOCHRISTIAN BOLA
80,265,294 *088487966D9C963054F7996DB88C2E87D766E7E7 obwisnac9
80,265,295 *0880CFABB6EC92495218B6C8E990AF26E38948EB D!Y_N
80,265,296 *088CB962A9DC5963C8C8274849D8F0B8F211ECDC DYRACKED3
80,265,297 *088E8CB11636FE739178DA08582B62618574BFFE BFL:/
80,265,298 *08843E77025D1D5C93F306C6423FFEA4F4E8958A BGRp
80,265,299 *0883F1BCE5CF15D5E766641595D996E54B8D0CD8 [email protected]
80,265,300 *088FBDD9FE15151C615CFCA05BF78B8A6E666FAF eadinitn9
80,265,301 *08812AF8A482E7F978ED478CF535E4FD6F5E8C97 bhf2u
80,265,302 *088EE65DDF4FC1BF5F055C2FECAC14647F759F27 CORYDEVLIN
80,265,303 *088F441A9963BB94F1881B01F928A58C4ED28FCF OLIVERPECHAIRA
80,265,304 *088D8DDB97623D53AD804BE6004B6BB60296096B COTANCOTAN
80,265,305 *088E346A9F0AF2D03CCA36E76394ACC622BF3DD3 OMAR.MEHRING
80,265,306 *088970C67257A20F033FF98746B85A356BC3BFC1 courtneyganiban
80,265,307 *088A99CBB9EE669672D7353CB84742E943E754AE BIDLL
80,265,308 *088DBE5294ED64CF506E7746BD756902CFC6B6B2 c:\programfiles\adobe\adobephotoshopcs4\lmresources\de_de\retail_return.zdct
80,265,309 *0881834D3E94A9E44400CB7C20D21CD600E48D0B BILLYKILLER
80,265,310 *08898ACEEF27F7E4858A407707DB9E67528B4AA1 c:\program files\microsoftnet\sdk\compactframework\v20\windowsce\designermetadata\de\systemwindowsformssmartphoneasmmetaresourcesdll
80,265,311 *0888B494F907EAADAAAB6691B6E36D6AD488628C OOOH.CHILD
80,265,312 *08807574D60A1B57C7965EFE134B990EEB3E25ED EDNIVNEGGED
80,265,313 *088556EB2DC39E996BE3F3F1CECA3CCA8EACEDA8 B#k/
80,265,314 *0882AB68E64F7E4181A3B41D1B3FBC33F525E79F ORIWEISS
80,265,315 *088BBB29287882378A6B82833F5836EAAEC2857D BLAINE.VORSE
80,265,316 *088F0E8637A393EF9CE2657EC76D984C07BDEC56 p##@~(0-0)
80,265,317 *088DB403D8B15D006E0FA0FDC25AF0C8743649EA PAGADUS
80,265,318 *088CEF5C7EE86A7EF5F2D27E640406F9AEEEAFF5 PARCHMAN8
80,265,319 *0881ED2C53AE6603B63F4F78CF7B0AA2223FC9BD crescite?
80,265,320 *088C25A450DB446B14F7B0DF87D87CF35D2A1DCD P--B.~0.~O(~_^)
80,265,321 *088BD1BEC24FC7D014A3D74A4E7732E7CDC5DCA1 ELANORHUTCHINS
80,265,322 *0888C7EC9D53DDA3FFECFD7001E16F686BC4431E P######D~~(>-<)
80,265,323 *08897CFF99CB51B2AC89AA691044D176288959FA cruzhyche
80,265,324 *0888E092AE257F9C594B0A67AEEC004CF5B14315 CRYSTLLSR
80,265,325 *088FFEE58865835F925730F5A75D79682E269A76 PDOTYPE
80,265,326 *088B89A1003097B83EFF706D5A20F38BDEA8A4F4 BOBKAE6V
80,265,327 *08853295628FE126F0F54B2F6EBF359FDB0F7594 [email protected]
80,265,328 *0883F110A2C0BBE0AE66F376204D6D989B588D20 boegseerlijnen6
80,265,329 *0889CA99F9526D4F310B3EE7E3A403F0764B146A PEPE.RUSSELL
80,265,330 *088DE239693BB82B40BC7AA466D3DB4BB5836B37 ctw!%
80,265,331 *088A3CC24081B4A70D8159DFBFC6F4A9D831E251 bookies
80,265,332 *088573C4B000E1458FC12A64A7CD30C4782DAA5C elve
80,265,333 *0887388214E6B0577C36F970F78B3E333A7CDE60 emanileota
80,265,334 *08896765565F72091E1A445531AAFEF8111AEECA embryoasuedu
80,265,335 *0885B41BA90627D61C93E77ABE20E4DBF182F7B5 EMERYPADDISON
80,265,336 *08804BC80AE85294A075330182D78CB4E460D166 CW2$M
80,265,337 *0889C8BD1DD6CC212FE2F9EEABD1CCB7447050D5 cwgh(
80,265,338 *08858E254EA2BC784CBA3A4B49D47FC5C50379AB C(WNG
80,265,339 *088A8A9F5AEAE215533ADB4E0D6B1103E760C0BD pianerai
80,265,340 *088B7AA4E1F1A23CBE0BC6CC3C663AEA9BADD493 enkps
80,265,341 *0889B538D5BEFB53B464BAB7985604AECDD5A9DE BRANDENHOTEK
80,265,342 *088EBB03D1F34025ACC3A0B7EDA6A56CC27A03AC brandondeskins
80,265,343 *0887E0AD3528BB1E05F0293A0DC91C3B84263F7F ENSEJARAS1234
80,265,344 *088232256A9C1279947062C352434BAC40E437BC [email protected]
80,265,345 *088FB831A9DBE2C0AE07936C52676BF0A4589649 brayden709
80,265,346 *08891D5994D8FF03129110FF490A46364C959073 BREAKING-INTO-SMILE
80,265,347 *08855605D29427F9C890A8E1E201C65427FC809F EOUXW
80,265,348 *088CEEF3EE4C16C6F1CDD1DD9EF88BDBC720D264 brigstow
80,265,349 *088A75566CF7D739F2CB83215CAA210730C6EBFA D6IOP
80,265,350 *088A80C1313994287678F5F0467B2A0279C7B54E ERBARMEND
80,265,351 *088D35197DC996C0907780F7FF3AB92838619FB9 PORFIRIOUMBERGER
80,265,352 *0880FCAC09EA324A0264C913631AFB58386D33C0 brqig
80,265,353 *0888F5EA13F34AD27D5A538CC258382D1E7C1078 [email protected]
80,265,354 *0887296AE5F5F97C4F7DF55D1EA0CFEAE0480062 BRUNO.ORME
80,265,355 *088B79F08340CDA93BA1DCC74A0CBFC3342EAE8D ERNESTBOSTOW
80,265,356 *0885C5CEB712E8BB163A21F978B1D5E0BEB45AB2 BR,V$
80,265,357 *088F7FC9CD1DFC5BA3A39D4A7EB3ED23C98C3802 ERPETUATE
80,265,358 *088035FB31B6A4BD6E2801CA28A1FFF341BBE347 ESDV
80,265,359 *0883C14DB3B8921B9A607D9F20CF9B6C64793E6D PRAŠITVE
80,265,360 *0886A63C4506511DE2ECE19024546A8F39A8D95C PREBGUEU
80,265,361 *088E613FA46BED235D65ADAD71021794FA31D71A bswfafeldolgozo
80,265,362 *088C9338588100F54DF4F71F0D4A380B53140782 bswkenwinbsw
80,265,363 *088F5C838E850ED817A381B69FC4F8F064A19375 [email protected]
80,265,364 *0882BC7907F97DD9B25C4EBB8E2C9B22B87CD339 PREDINÁSTICO
80,265,365 *0884AEC5D07247E70F458C92F0D9124C0FD95CC6 DANIAL.OBANNION
80,265,366 *08877782CBE8B70BEB694B7644D808F1D513D29D DANIAN
80,265,367 *08878BC7047C8B0DE0878D4058152C9B1D9C659B [email protected]
80,265,368 *088ACC9DE78F1BBF647BD1ACEF9F5D1D0806FE71 BUCM
80,265,369 *0881849D863ABCABAABE1BCAB87BC072782291D8 DARENCASHMORE
80,265,370 *08822B9D2AC7CA764B4451C78CC427D580E26B64 DARIENYI6
80,265,371 *088E5A8299BD3C24082D9E9E018D10E4C00274F1 BUDROSA9
80,265,372 *088C1640675845158FA8EBF8B29CB36B7C368935 ETNVL
80,265,373 *088A3D479DA56622000441016A165A4C3DAF5BB4 DARRINWHILDIN
80,265,374 *0887B0DC29407948F271BEBC1383BF5136722418 BURL.KIRKLIN
80,265,375 *0887E5B4715DD3A61937BC6E777A072D19003F2B EUMDERINING
80,265,376 *0889ACEE82FDC28D6E4EA63BE3FB4F2ADEE75927 eus0#
80,265,377 *0888C375DB651C40D23EBAEE439DE61DE05DF8D6 EVAN.MALISZEWSKI
80,265,378 *0882678FE665AA0127D72C939F9765D4A0F507ED bvc7_
80,265,379 *088A3C5B16B4775B3305E3641EBC82034AE1132A bw2z_
80,265,380 *0881D525F57C0B8ECCFDB0F8F77E160CD97AD231 da;wa
80,265,381 *08897094E0BA95090F5494CF7EC480C3C2680303 DB3DW
80,265,382 *08824E95B1600E3F7FC4DFEC57D9F0D471BDA894 bxy
80,265,383 *08817DC9DD1CF86F64063857076BABA9362C8FDA dbghk
80,265,384 *088D64E62C93C75BE77833F1D5DDB81291BF7D5B dcapx
80,265,385 *0885A9EBF06D1F36477782A15015AB28F3B52EDD f5k36ew9h007s640w5
80,265,386 *088818A9BCB41E51B227E68E351F5327FCB8B54F C/1
80,265,387 *08838DC94E10E253AD8A4DB2D015953B7C92F8DC Ddc4
80,265,388 *088F75200412485EC4199FF1B542F431F22A9F50 ddfet
80,265,389 *088F1DA4DD1DFBF63D4F5EC904E39AFDF05495BA [email protected]
80,265,390 *088E0FCECBA2AA9042CCB378D361F8E1BC83C83F [email protected]
80,265,391 *088E37C273F3D552E79545B4D233BB0C3B494169 C3ETV
80,265,392 *0882C69C3D6F354AE2F03E5A539DD5DB35044A05 C3S.
80,265,393 *088633EC8A970E4C06C5D98574CB38235482D83B c4x1%
80,265,394 *088624641A89898D9319F425BB46AE1E6DDF7754 q-->.~splat
80,265,395 *08840B92494BCC442CC43621E1015A1B51C2DE4C c6l
80,265,396 *088DF83C03F6A3DECB8B344853D63B96959CE865 DEE.DRESSER
80,265,397 *088661ABC589F04CEA4E039F6FE71C629785B023 c8hk1
80,265,398 *0882E9C288BE0A7C455CB5EA0BBDE753635A4725 FEER-ESO
80,265,399 *088A084E5688E872920FF22B4FC7E53CB246F779 dejection'scure
80,265,400 *088041A78488BD031AC85F576C431FA9F7C10DB1 CAGUEG1:
80,265,401 *088F06B71F13B4873B5B25D6E50381587029036C cah4u
80,265,402 *0881C3E95C746B736538AF45B02774397BE60ADC DELLOBELISCO
80,265,403 *0885EED5706E4C7EE9F66C4BC7720C32DFD5DFDD r2067
80,265,404 *0883E63A38BC5E61D6920645204303DDFB21B0FB caloren5
80,265,405 *088B3FCCBB9691E298A97E6E76F52FED31F28EB1 DEMENTIA.(REMIX.BY.NEGATIVE.BRAIN)
80,265,406 *088B32CCCC586DD1594506CF094DB1C47E2F0043 calvinhaggerty
80,265,407 *0889658B39E188AB25478208E63774965B78067A RAFAELCINCO
80,265,408 *088B15CAAE006FE7ED3F750785C10419BB77AF0E CANSPACE
80,265,409 *08800C740E1968737681F57D6D3545EEFAB36835 DENOTAO123
80,265,410 *0889B22B437FF5C7F48A0BCD3F085853AFC1E5C7 CARBONIFERA SCHWAGER SA | CHILE
80,265,411 *0882A18B4FCBB544D3B38EDF65C59D88F970A6CB RALPHSTANCLE
80,265,412 *08808B7D53E1EC2C95B2FE917551C6A2386BA6D5 finnheden
80,265,413 *0889EC67C1B4EB1F39A2D902D5005FDE7434486F carlocinque
80,265,414 *0881170D7174DC33F943DEC449D109A13AD0D785 DERRIK-MILLER
80,265,415 *0887B246619A3CC6F8242CBFA17159E5F12FCCEE carltonrodiquez
80,265,416 *088211505CC86CDC7691A6D9778E27DCE94AC623 FKEDENG
80,265,417 *08882D3A5069F5952C2D5D1D3916A2AE0C9BF450 deserved
80,265,418 *088613841D19581892CC1CAC46ED1B3B429530A5 F-MUTISM
80,265,419 *088A561F68C1ED9D7EF387A1EF2082AB37DC922F devinscurlock
80,265,420 *088DC3B41A1D2A0209E918CC63DFE81E88C20C24 FONCENTS4
80,265,421 *088C2BCB86C9405C21F53C311D0FEEB83714544F [email protected]
80,265,422 *0882F8E9FDCEF084CE2F59C7922DE035FA1AE08B RE5+RANER
80,265,423 *0884DBF9159CCA13CCB4AC0D87DE4B5385C7CC03 re7ran$1a7ng
80,265,424 *0889EB61F853CDF650747A7CF14E91B06A2F9C88 footlist
80,265,425 *08850460BBFC4BCABD23B0452EF314483C0D2A70 foremniak0
80,265,426 *08864FCF04587528AB5A3FF74186B1CD0799B779 recontemplate4
80,265,427 *088D4CCE7D2BAF865AA0EA0EFC3456FFB1F4B85F cb6tc
80,265,428 *088FAE93D76FDA610717FBA6928AF3FF4D0948EB DGS
80,265,429 *088D862FB229DC8A344BB150FAE8B4C66F032DB2 cc,mg
80,265,430 *0889580B24761D6508D0B0949579BD4B56AF0CE5 FRANK.DEFALCO
80,265,431 *088F574C3CCA5F9D005B559031FCC45E8D4A5120 DHO,=
80,265,432 *0881B8F26B1718EB74B17B84C26DAC17A4DB37DC FRANKLYNVANESS
80,265,433 *088C477629910D2DF9B14BA60FD34A190AD391DF DIEGO-ALFA
80,265,434 *088EE16230FD79D1D288218DDE5FE3DDADA55BE9 DIGITILOR4
80,265,435 *088C2D3FAC39F6BBF7D7261C486E31C39719E30F RENE.SANZENBACHER
80,265,436 *0885101B968195C504C78BDE6A66DB6905796D64 REO-GONZ
80,265,437 *088379E58B7A45F8080E77DDE70732A2CCA7C883 CELESTO3
80,265,438 *088031CD325821F2CB58D09C5B70A701BE3A73D0 CELLBLOCKE
80,265,439 *0883C9E4AA5F5CCCBE1E558EB6A7A1B502EE1402 reperdrions1
80,265,440 *0881F72BF4BCE645C7FB95BC8800C139A443BDFB [email protected]
80,265,441 *088932375FE520746BCDFFD547DE710961939092 C^FT
80,265,442 *088FB1ECF3B795909DE4307F8E2FB4611AF84345 CHADWICKSTULTZ
80,265,443 *088003CB09855FE89BA937FDFD49708C661E0469 DJHJYWJDSV
80,265,444 *08813E5D5C2273550646F51703B9BF7C1DA08CE5 FUN1CULA7E
80,265,445 *0880D36295870E9885B7BD9C7E2E1C508B6C23FC CHANCEWINTRINGHAM
80,265,446 *088EF8DAC98225E7B72A8BA29C31CE86CE7A5741 chandons1
80,265,447 *088371D8629CD97958F0BF6B9D1DEFCA87384FA2 fxwalfdhyusc
80,265,448 *088377BB03D22714EF9E56B275FA07EEFF5DE9A9 dkl74
80,265,449 *088A6083A04554E1D4697B39F22DC4950B9B1EF0 charliesossong
80,265,450 *08844185DE8AFCA90C865D6E5C00D40FA3C4A6EB GALEBERNHARD
80,265,451 *088AEDC03ED72B8A83F7B98B4A603EE9B3E59904 galecullen
80,265,452 *08873B7A78271F1ABD94E707E744B90DFF1DDCCA rezonantnih
80,265,453 *08872BB7D6928244CA81DC07302EA63BDB5ACF12 [email protected]
80,265,454 *0883A3206C8C68DE9805F9915A42296F8562802C DOGBOYOU0
80,265,455 *088627F0F31661A08443FAD4126AE821F8A16C92 RICKIESHIMANUKI
80,265,456 *088355E9FF0218A726F468FC7F6BD5960D744CFB RICK_MINTER
80,265,457 *088B722F3D22A89208B55A225FD6F03F8A0A5E06 Do%I
80,265,458 *088B3CD6E7CF44F7AC77C5A48E92E1EA5A039BD7 RICOFREDERICKSON
80,265,459 *08809F7E24F57952AB17F4416485702414EB0EE5 GAWPS
80,265,460 *088EEAAAD6D7E01C46792FEA2A149E3D6BF9C141 DOMINIC-BONUCCI
80,265,461 *0880F8C295D1A0B209EF660990C49E074BFB268E dominick077
80,265,462 *0885695C5B31CB1D2A6FC384930A490F832AE620 chrisblendz
80,265,463 *088C1150191501E4CAC6A20031904A3BC1A2B8B1 christiantrigg
80,265,464 *088D2E098D47C01D5AC43C1951A7F9170854C2E0 CHUNG.LOB
80,265,465 *088684863EBF7967FF172A381EE436AE35C0243E CHUNG.NIFOROS
80,265,466 *0888FC66F701BD99B41C31DA1A830AE4180BCEA5 ch$wt
80,265,467 *0886F1C7DB8DC643165F8C4ABB199281B5B491D1 ripudino3
80,265,468 *088306B3C00C6F463499B0DF9670DC7230241D7E [email protected]
80,265,469 *0880EF298E85E9236F574475928BAA609E32B752 GENARO.KROME
80,265,470 *088762EF394FEA05D99F798EB8CF5B7BC7372147 RLANGHAARIGE
80,265,471 *088CD034631A50DEB90823D5F59BB82F43F6E84E cincinnatitaylorsoutgatebridge
80,265,472 *088E99E8B350F2855898AB1206FE1F52BEF539A0 DOROTHYY
80,265,473 *0882D5B3ED517DC6C1DB8789704A6E66BF5E6A6D DOYLE.BARTEK
80,265,474 *0881A99F0F100AEF0F6F3F9373056D8B6233B9EC rockytapales
80,265,475 *088CDE53CDC2F30FF6B95E5DF529ED2E7D36CE23 rockyzawistowski
80,265,476 *08835A40820058D6E66DBEC8ED645C0F068FB7D6 RODGERBONK
80,265,477 *0883B9F963E0087A08E7EA20FF74FE604CC71B51 RODYRODY
80,265,478 *0882ED9B61946CD132B421EA9AB2FD3B4F55D23D dqq8l
80,265,479 *0886991BBBE839F787029E14C92FE43B2540FAF1 draaikous0
80,265,480 *088C630B74AD4F944AF2C27E5F65EAE27C3B7F1D CLAIRBLAKESLEY
80,265,481 *08860752E9901E5CEE08F7F37A136624D351D7FD RONBORGER
80,265,482 *0889BFF8F209845BE7DD8533A18D79885BFF5CA0 clairemarple
80,265,483 *088776060B6B9D209B0E0E88F7BFD42E68544E07 ROSEMARY-MICELI
80,265,484 *088A3633306B6A65FA02A3E67B5BE5E54ED94F82 roshni.andrade
80,265,485 *088351943D5C7359B3A6CA9F4CA0ADA929711AD8 dsbip
80,265,486 *088CBB60B672A1ADDE35B23AA60886CB5D9A2799 ds$!g
80,265,487 *088C9370D6C14907B00052DB9EBD9F78E63DD13C CLIFFMIYAMOTO
80,265,488 *0882127E1197795314B0A31762983FE5F048181E CLINT MIRELES
80,265,489 *08822CDFC9F0C31F0483B13C6531831DF73AAD5F ggelarij
80,265,490 *088C0E8DD1F3CA0B48EB5EDE3659F6622A1C93F1 GIDE)、
80,265,491 *08836604672F5D8C697556C34D8E30884EFA6F97 clz1k
80,265,492 *08821B0C99D1B11CDE9ABE3C8435038D0B0020A8 DUSTYSCHIER
80,265,493 *088D91CBF616A8061A3915FCFEC90A481B594ED0 GIUSEPPECARDINALLI
80,265,494 *0885F3F39FDD90A4EB7757EFD0282EA660D920E7 [email protected]
80,265,495 *0888BE2774CB763882CA68D5459C76E9FE2BFD98 RUGGESTRENGENS4
80,265,496 *0882A8B089F5EECAE94C487F1FB1AB31B547C4AC cmob8
80,265,497 *088ACD98854954AA052F128B12DC15D99813878F cnr5(
80,265,498 *088C62BF4E6AF304DF1B0E7DEDB89F7AEFA85342 S4LBHSFEM
80,265,499 *088D7918395DA80E8F2D34DBEEE7D2D62E53C27F dxp,
80,265,500 *08825AC958F40AF11C4E4061E71CB9A651F49FD2 sachinick
80,265,501 *088F212904C0D48DB6136EB7CBA68C532A59555E DY#E
80,265,502 *0889DDFB3FCE73555D2F01D724AACF4909BA97EF [email protected]
80,265,503 *08811F54934D65BF6106A6382511AFCF4523AE14 SALONMUZ0
80,265,504 *088F5F7CC04442DDF290D6550E19B3A3081238E6 E1286043322
80,265,505 *08856FA421281D40E6EDD37E8920FAF22EBDDA4D EAB(I
80,265,506 *0883D5CE6EAC7175C2D44F27BBE2C1412E5D5018 GoetheLieder,D247:XIXDieSpinnerin
80,265,507 *0884410F2DB8E9ABC385B776B8B24A94898F3AC6 GOLDWOWGOLDPRICEL
80,265,508 *088F334029F611A9F7897298B92FE43BDAE084C2 edgarmacke
80,265,509 *0881DA9895003B268911F1D0C4643C3487688B50 [email protected]
80,265,510 *0880A08E63AD5957EA8D299996C5976643D672B2 SAMI BITTAR
80,265,511 *0886067B3231182B5E7ABD4E3B1EB82AC310234D SAMMENKAEDES
80,265,512 *088159E61BD3D7CA020A6047356186A6AE17577C EHJDZ
80,265,513 *08831B2DE5B3CD94889B7787D0BD3A4C90CEC949 EI`
80,265,514 *088F929F3EED2E1801304DE54BE3B27BC879EF7D eleroy5
80,265,515 *0889F8AC446AA57FB34E33A014D26839760AF83C CONCERTO-NO.-2-IN-B-FLAT,-OP.-83:-ANDANTE
80,265,516 *08828FC2EA786D07D0A084132C5637AB10DBD56D condomgs
80,265,517 *088E38FCA6BA33E9F2C496DB6A3A06D20B33F7B5 confirmatorily
80,265,518 *088DD4F2F7247E4BCCDBC9741112E7A6B0942274 conniechriscoe
80,265,519 *088004180CE04F680ABFE6C028AC92B4DF8CCCEE SARAH MACCREADY
80,265,520 *088D075B4C8732D9C542CA8C37331EBB989E2337 consortiumlogo
80,265,521 *0888D3122B0D725F55410D8321E6173639A39205 EMACITY0
80,265,522 *0882D8E8BA1904989F3CB3E0320B05436CEFF13D [email protected]
80,265,523 *088767E1B50F93BF46B2AC287CCEE21228A8DEF5 Gremio's-Special-Stew
80,265,524 *0884D29C35E6B967BF18656763E6C82BDEDC55FA GRIEVEUNDTHOMAS
80,265,525 *08893820F3BA84D8652DBD14F09808BD098DFE6D grondweten
80,265,526 *08817D8EA83B7381EB0AB210874B7A4B66C917E0 CÓRREM
80,265,527 *088BB0C9F4588945E55B3E3E986946B7B87C3B2B schneuznase
80,265,528 *088DB2D9FCE142665B4820E2ABE66A506D7DD319 SCHULZRINNEBSW7
80,265,529 *088D99021EE19B2E5617102B6B472952158E139C en8e4
80,265,530 *0880A6DAAE4C37275B716743596E794BDDFB344B ENEDLOREG
80,265,531 *0888724ED2F13CBD205C8D2C0E6E382A879A3632 coz2
80,265,532 *0886E95DCECA5EBAF368F57A9F1653785429C2BC guinna!
80,265,533 *0887D114C63179386871C60F6B1DD036B509CB1F SDEGGIRF
80,265,534 *088205EDB8B4E884B15A57B99F6EB2A1636C7273 GUY.BENHAIM
80,265,535 *088D03E8D151FBC3534E6ABA5C093B4E9DB884BB SEAN.MOCZO
80,265,536 *088C1F56EEEC890DD76BE885129BED6794094CE8 SEBASTIAN.FARMAN
80,265,537 *0889D060050C793E3750C1B4C81E016234B3444A CQ5)S
80,265,538 *08836C6AE63570665C6101A473D2F51D56C05DDD EP{SYSTE
80,265,539 *08863540BC6B22A1B566FF5B878C03E55CF128AC eq";4
80,265,540 *0880FBA71A327F0AEC23B0041EBD51EBCD6D042B cr6bk
80,265,541 *088B7790A8F62D1CBB9D6F14EC1ABBE823D218D8 craigsasse
80,265,542 *088538459A06B7C076A5D8E8259B43CE8ECEBCBF c#r:g
80,265,543 *0887F3B04B8203FDE396C8A7D82B3260C3B64FE3 ericmcclintock
80,265,544 *088BACEB84AE1EC283FFF8B373B21B6B23CF6EED ERNESTO.HOESE
80,265,545 *088A37C40D8175FC1525FC2D59AEC080CE88B8F5 ERNESTOPARTIN
80,265,546 *08861426C7F4CFC6926DC21A7E7B7A35CA0372DF ERNESTO.REIMAN
80,265,547 *088ED4EC85B14B3542238FE744BFE417FE5526EF ERNIESALIMI
80,265,548 *088FF78FA86A8278206AA30DEF2FEE87F8D1FF2B CRL9
80,265,549 *0885E884959EF9B3633363C19F82D1B6FC7AF94E [email protected][email protected]+S
80,265,550 *088F23E540E1FC829383BF40E1749B2B526D33FF HAILSIN
80,265,551 *088C90C664632CA3FFCEC7D8BB807E86962BA7CB HANS.VANSANT
80,265,552 *088542FC51A2E04712B3CBF92E50DAEF51E83A83 c?#u0
80,265,553 *0888C175DE82A3FA2CE46E81D42027C7F8F243D9 euda#
80,265,554 *088E6D8D7FDCC3998AF11242592A10DC9A8041CB sh4p313s+
80,265,555 *0889EDDBAB4E6ED8C439ED23966515AD6BA53AC1 SHAASHVATAANIS
80,265,556 *0882F7DD9F0F2504B574B559B4F999D67D83EAF8 c)uy:
80,265,557 *088E16BB876C9FFD7ADA5CFAF23ACC59576376FD shamaine allen
80,265,558 *088E2981943689C02FB006303570CDC1E1B1021C SHEARERSLY1
80,265,559 *08825B5A3D388A37E5C2FF1D44C33FEA80E55FD5 EZEKIELMAUCH
80,265,560 *088E3DD628CD3DAFFD176106437831C2F94AAF0F SHERWOOD.KIDDY
80,265,561 *088664FD34BA8F41175E74E7700A615726CB3E73 HERENIGINSWET
80,265,562 *0889885A802E781018FB7B7063FC96D8E272D573 d1ive
80,265,563 *08840E45556FF75FE745DCC8FBF3F8AF90D83C41 sidjacquay
80,265,564 *088CD530EC572509E342E67CDA3A172887E2C164 hgy/
80,265,565 *08850F7BB600447626C1B03398033E538CD31DC1 SILAS.KEENS
80,265,566 *08846C88836233597DD3DF853E4A46375ED9819E d)64/
80,265,567 *088906238F8BFB5B9654CE69BF6F057D428F0364 d6e"z
80,265,568 *08831ED3022E13485F70327B3CEA45DD0BB0429A SINFONIA:ARRIVALOFTHEQUEENOFSHEBA
80,265,569 *08837F55F3D8B2008213AC95DCD9BE364B9EEE9D sirloin
80,265,570 *088D4D810C049E76D746ABD48FFEB4D5A94F4C4B D9G04
80,265,571 *0887DB76CB041A20C31B4BC5549D04AFAB1EC170 [email protected]
80,265,572 *0884E63BDBDFFCBA379C219AE29D862DC8DE0724 [email protected]
80,265,573 *088EB82AEA4E081DBF9178A6AE977C6C1052A60F d)%a$
80,265,574 *088BE36E8EE0A416B9047799DBF848640C6D20FF SKEEWGURET
80,265,575 *0882995C3629413A9979736A4A39B03EF1A9836F DADINP
80,265,576 *0881A13D6D1C184210894EAB332CB041982E5817 FERRYVILLE9
80,265,577 *0887491F2A0B98C2664FF0B12BA0C668723C73B7 slickaz
80,265,578 *088F479B0E38A078297DDFA8B20CA8267948B8AD SMISYAR
80,265,579 *088C7769E1743255B0EEDB20067D38027892434B HOWARDBLACKIE
80,265,580 *088129C20D4AE0B901F951EA00DA46ED8A06EE41 FITTLAPPED
80,265,581 *08808F7316BC4986F39560BB88F4A86CCDFDBE28 snoitadimitni
80,265,582 *08807A7D65898B4AAD033B8EF91B8BE618ECEB6D dangerous.:60
80,265,583 *088E6289F18A98824EB1DE34800BD2CA984C6643 HTIMS-SS
80,265,584 *088C51BA45FEB72F7031D2DED4CDE0937D12BEF7 HTOURMZ6
80,265,585 *088D57D7E23583AB54BA296F56F4655361EA0BF7 FLORESAT
80,265,586 *0887218C8F5C711CF655148C222823558214721F SOILLESS
80,265,587 *088D760B69637025EFA1415FCAA5FF12A2B94D33 DANNIE.HUEY
80,265,588 *088C671560A9956D4F8A80C2ECE26EAF3B029C68 DANNIEKELCH
80,265,589 *088C5F3AD3FD0DE5D1E46FC044FA39F9A02BC7DD fluor-antimons
80,265,590 *088FE19FDE2730EE854598C94B400ECBC84CE15B FORENSDE6
80,265,591 *0886EA81C573926C67A8BCFB9C690E4623056548 FOREST.BACIK
80,265,592 *088334A8C07D86BDCC4EA01D70BD6B0B975F7E36 HUEY.SCARPA
80,265,593 *088ED2BBF857933A0F841C373476998F97C33325 FORESTPRIEST
80,265,594 *088FD82B9285F6352E4EDD5A865E025228A95547 SONNYSZWEDE
80,265,595 *08851E04AA74F8436AA20DE9CF305D4E26F605B0 SONVELANDIA
80,265,596 *08859630122B44C40E7BD10EEB04101D32235344 darioschontz
80,265,597 *088C927C32ABCEC53B4927163F0E085355E47AB0 FOSTER.LINDSEY
80,265,598 *0882C977526EDE1640F8CCC3798D60A0BD8B8A58 HUMBERTO.SCHILLINGS
80,265,599 *08841F0F528D25A220DFA25E1CC0A0BA6331EB92 hvb]
80,265,600 *08841E9A912325C7AD6BE2AB0CA680AF78E38160 FRANCISCOAPKING
80,265,601 *088DB8586F4A30C09BCAFE2619D152DEC8D7F40D DARYOSI
80,265,602 *088818BE22A43394F8CABD9A93703AAF23DAF706 [email protected]
80,265,603 *08849689AE5A5010EC1CF01FF49566568A94F6F0 FREDRICPIJANOWSKI
80,265,604 *0882BDDB9F8D8F286CF52D98DF1C095B92179099 FREESMSNOW08
80,265,605 *088F43110B80B4410B63BF2E8D0EA8710D9C2B80 db4ay
80,265,606 *0884D7220578770A78A184E1229FEC86E7B37977 [email protected]#
80,265,607 *088B561D41E8396BD1B6C204EDD3BB11E3EE67AD FUREREK5
80,265,608 *088C1A697B3A892627FC5844A744F6BA219523AF D,DGK
80,265,609 *088AF2CCA5F477BD82A84EA044E581DB345226F6 DDWKW
80,265,610 *088198946CB4687525FBA5EF72378CAB69401568 DE3M
80,265,611 *08833A3E91E6B1013F329BA53F58B4E2E7CC8661 IMPLIEST0
80,265,612 *0889C19D3D9731AE03B47481EF3593384EED1B3C debaseth7
80,265,613 *08820906895D696910DABEF2D5652854124231D3 DEFENCERD
80,265,614 *088C9D877FBE5369D2C52C94CF4005ACC29F3F25 GARLANDSTAHLEY
80,265,615 *08849BC27205095485BBE861D3455C03331199FC STEUYNG9
80,265,616 *08898B49AF48E343B8932A3D7E6406A41131FB0A delcoffield
80,265,617 *0887355A3A347DB7B4547BD21E2C2B2166211DD4 DELEGHINO
80,265,618 *088F7A92CCB74B58ABBEFFCF0BFA74C22BDF555B [email protected]@TTER
80,265,619 *08899FCB93D7E0FD7E3245C65FABC5E3D0B183F4 gatliffs3
80,265,620 *088730CADFF825B2D125F05E031A53F219ECC5FA [email protected]
80,265,621 *08899DDF854D1DB1EEB08C494BA29CBB4229F599 Streetcleaning
80,265,622 *088D09D4C00D79C9DE1E0C85BBBDA41E9A58F148 irish.sesbreno
80,265,623 *088604ED80DB26579DE368AC5024A23617A760CF G:(C
80,265,624 *088D756F78B5F56C0C9EBB86FE6A23B55585E81B DEORGANIZE123
80,265,625 *08876D4F63443540260D46061254CB71A348BEE1 [email protected]
80,265,626 *088E49189A4920F61ECE31D6D8803F5DA3DE5A0E ISMAELCANELLAS
80,265,627 *088E53D5F6DBA49DDB07349BDB883E29BCAC7139 SUCCESSBRADLEY
80,265,628 *088C2DF681B380C838C5193F29D02557F388EF5B iwu^
80,265,629 *088296A9C5E1B861810BC7264BD2C38E0DB89B35 deserved
80,265,630 *088418E66E4E48E3F9922F9A8A48627E8D307AC3 DESHERBANTS!
80,265,631 *0885731BA5724A78B7511DB3C55E11159140DD65 jaakjoala-linav
80,265,632 *0884C0AA3EC2A593A60E7ED7A5D2788D1F2E8299 GETCATCAT
80,265,633 *088436B09F4ACC18F332A6D242B1C3A6C4A0AB2F GEZINDTE
80,265,634 *08844E9AD052526E37B4A9BAC5FEBB00291DB81C [email protected]
80,265,635 *0889C87D0212F772DFDD32C7751E2196D0D96F04 SUOIPOC3
80,265,636 *088798C73957ABEB3BEF874859900B7997629850 JACKSONPEPPEL
80,265,637 *0884A1257A70BB561E83C9DC0CF576CBBCD538EF jaebabcock
80,265,638 *08891F095F6C4E6FD6A105CD73D83833464DA401 jaehorn
80,265,639 *088A3CCDAD02A7D562AB60A495B26AD8B7F8E8E4 DfB0
80,265,640 *08858354E3BF78001818DA120ADD1429A19EB949 df(sn
80,265,641 *088DA7364FF015AA4598393210DE90606499850D jamarantunes
80,265,642 *0889096B24EF8EFC56403307C5918748114D2F57 DG?9
80,265,643 *088FC66B2ACB903B3C331A639667E3A0AD44E7F8 SVNNIME5
80,265,644 *088B90F55FD1008612F8EFCD7B3612BDA985FC1F SWOLVES4
80,265,645 *0884F76DC70A082CB2FA3CAB7E3BEFF929C5356C sxctashea
80,265,646 *08826B5244ECD716F0D30273BFE7D362375D4053 JAREDCREEL
80,265,647 *088C3B744CBC72BAE457266735252331741BCC4B symphonyno.2inbminor:iii.andante
80,265,648 *088BE8C9CB071D71AE306C615AB0FB23AEA13D42 glacially-widened
80,265,649 *0881CC9038EA7A02BA0F46A0774C5EE9367881F0 DI_HN
80,265,650 *088DA1928556DE0CDD695234C7FBCD02AA023A28 glemtes5
80,265,651 *0886AD7216AD4671B4DF7234473DDEECD1B2E3BA JAVRON
80,265,652 *0882F512060C446E96FFEAB548702277A1D6BFC6 godrich.
80,265,653 *08840E74AD519CB1140E4FDC798097BA60970D67 DIPODES5
80,265,654 *088D47BE494935051AE796A8438539B581E8D627 disKONsuhlut
80,265,655 *0883EEE51375096E0B618AB2ECA44E0D76223605 GOODBYE TO A RIVER
80,265,656 *088405B4FAA14B4CEF2D2A920A3ADEB85DDF1532 DIXOFLES9
80,265,657 *088367664318E4E2ABF98725850F28ED20FF91E5 TALKPORMESTARIN
80,265,658 *088F908812B8B0A8406CDE076CEE2697AD26050C D=J/J
80,265,659 *088D875F01628713457A0CC6F4AE59786BE31AC8 TAMICA-HARRIS
80,265,660 *088C6AF33D72D51C1DA6C84A318DB729DA964F19 GOUDA-SPOORT-NIET
80,265,661 *088D0FE3D0878EDB16BCB1C686602901CEA9A506 JEANKLINGER
80,265,662 *088339EA5AE37F6D1F452F77CA3D55B900DEEC8B JED.KNOWLING
80,265,663 *08844C58ECC335E448C863D5E37F770B65FDC7DD DLP5P
80,265,664 *088B14115C6F6DAC2717906A42EBCCB4C0B021F3 DMENTEN
80,265,665 *088AE188B62CDD0811C2DFBDF4F866A0696BC3B7 dm:l=
80,265,666 *08827AE494C7E7BD606D39C922C30D3D310A64B8 TAYLOR-LAUBACH
80,265,667 *088AEFDA9F1064A95FA93F3B9872EEADC423BC3B taylorremember
80,265,668 *088074181A68CEAB4EE2C900CDCF3D4AD928E283 TCQ672
80,265,669 *088CB8E0A561BFF2DA8E164B6C046C35B5ABFB77 GREGORIODAMIANI
80,265,670 *08880549C2301675226739ADD9F1975684718357 DO:e
80,265,671 *0884C15C8248F9BD8CF16F6A12F38D95FBA0F9C7 doh%q
80,265,672 *088C26EDD9E9E5A01242D318A7B14A348AD6B4C0 GRSITZUNGEN
80,265,673 *08826AD671EF0FEB71236C5070D8DEF7E087BB61 donna.fulbright
80,265,674 *088B472B274CAB2A0F9C18E2B47F7B934B0FA9A4 telephonyt/@/'l/E/f/@/n/i/
80,265,675 *088083CCA20A32DBCD7C01F8D4019180992007C9 jesus-in-the-morning
80,265,676 *088E50F2DE2E8BC7791089A25698059977AA17B4 DON'T-STOP-(SQ-1-MIX)
80,265,677 *088B219521CE2AFAF2D17D4A6EABE8A150FC3742 DOSEZALE1
80,265,678 *088CC9880EF6E36E945E895BD1118E1447837790 [email protected]
80,265,679 *08819AB4A632A66D762DDA7AE51C8BDDFFD3ECAD terranceclint
80,265,680 *0887AAD0BF6B9A2080DFF8A44C6B673D32657662 [email protected]
80,265,681 *088F392A4D71C9DCC64C881439E85D49CC283F21 jimaz.s.r.o.....................voice:.+422379498
80,265,682 *088BD3004F9085CCF74B49CC30C16952A75E84D3 tfartseg2
80,265,683 *088522CD24D3FD42A8CF3653FD9804A8683D8C39 [email protected]
80,265,684 *0884D958EA125D6B5AE3E45E84EE047D1A09BF2C GWQ123
80,265,685 *08815837E24C8E15967E9705C58607FFBBCFB4EB gyrophoric3
80,265,686 *088B7A20D2C116F1C2145FDA4446CEC062C344E7 H109206
80,265,687 *08846E5CA5B9885369D9CB2B7F1A7C90E7EF0FE8 the-du-droppers
80,265,688 *088C28E52FC5B99AE0B7DA90B36A4F5C2462EE2D theestkiller
80,265,689 *088D142B442E34108461D75D7B1440426D0AB0E8 D,SMD
80,265,690 *088246EA45AE994C27B43B0FEB55D7D062EA76A9 DSOSW
80,265,691 *0883A477445B4BBD41FBF169B9EAAFE470F985CD THE-NATURAL-FACTS
80,265,692 *088264DBA59AB19DFF02D0318D12D6F486E5EBE2 JOKE.DISPENSER
80,265,693 *088354D45F62029D5F53F6379A81EE3B58A03EEA DUANE.BITTO
80,265,694 *088232360B0AA2A534D7FF3101622EE3B295B6E1 THEWORLDISOURS
80,265,695 *088417D3BC24291CE5A6CDBF40576D7016DFDDC7 josederkas
80,265,696 *08891BBCEC0E042D5CB0B3EDD39ED7E39AE0A8F3 JOSEFBETTI
80,265,697 *088DEA0AC853DC0F08053242E63F46EDF899CBA4 JOSEFWELTERS
80,265,698 *088B52049D42D70375ED2C8637FBE2D6FD4E27AF duq:h
80,265,699 *0881D3C8DCFDF478494AA1D60E6D48D8859A2189 DUSTIN.SCROGGS
80,265,700 *088E0F1D38FD67E55669CE1B06E59C951624EB54 TIERESS3
80,265,701 *0881AF51F59CF11786F20FBF31D66210AC918049 [email protected]
80,265,702 *0886D6CA4492B55142E6FA94A4C887D47FD394DA duy9h
80,265,703 *088CF87B4E41549BE5D273A80473254E8BB1E160 josuelegato
80,265,704 *088CD415CB4D8DB0CC2CD539B4F59B73152EC8C8 joymallik
80,265,705 *0885F8D4D62BE6686F37360566E76CB80F0885EE TITUSDEBROT
80,265,706 *0887FD5E3F8AFE178477D06F3E546BC1CFF654B5 HD提供約60個新頻道,SKY
80,265,707 *08820D13CF806A80A7144C42059C3D01D56567B2 HEIßWIND
80,265,708 *088D8AC6F9828B9F21C635D934E7B5FC711A236A JULIUS.SENG
80,265,709 *0889EF394A34FF924A56E600EFB9821E937DDA18 e&}#
80,265,710 *088438B15389DC0017CFD370AD852171F8D5DC5A hempy
80,265,711 *088857612054D83DCFCF142E39255D5731E0335A TOMBEREAUENS5
80,265,712 *088B258598046B290FBEBA394F11A16BD8542B3D HERCIERING
80,265,713 *088F9737C4427900B8C305A2229446A8C442F395 JWPROD
80,265,714 *0888975FE36AD2B0714D0F5E2BEC2EAC39BE3E21 TONEYMIKULICH
80,265,715 *088501C924BEF392077D756DE74E5406391BA7C9 HES17AN71Y
80,265,716 *088C3AFB36654BAA1E122C776180371386744B17 HIBA ZUBAIR
80,265,717 *08860025E27D170CB2E81E73530CD146F3AC768D hierurgies8
80,265,718 *088DE0D2D1C33F5A740196761BAEE7A0681262D2 T.O.V.F.A
80,265,719 *08800EA046D4E56F6603A70DF85D95064BDE5494 EDFEEWREV
80,265,720 *088185C4A81559A29ED3C35D3630A6E47EE73E9F edgardoswaim
80,265,721 *088D77FDBF9ADFA5745E36F93FD42A86197CBC1C tracy.thong.wei.sin
80,265,722 *088D917C9CDCC84D3BE250E60352FACD56AD877A tramhaltestellen
80,265,723 *088868D9D21ECE888B16ABDB7FCA7874B528474F histoire-d'un-monsieur
80,265,724 *088A925FEA5D7BD9194C97545D3CDFC95C53DF86 KATRIEL0
80,265,725 *0882A2520C4C393C2E0EA48EA09CB3AE88C5AA8E holtsammeln
80,265,726 *088845512EFBEF0ADB440B5F0C8F6F0B5A3C1664 EFRAIN.FILMORE
80,265,727 *08821E23ECFC14D87DFD5ECC41B7C2E92E49F0BB EFREN.RAUER
80,265,728 *0882678A01847BEFD8FB559A0C8F377B51986F7E HOMER.CARDISH
80,265,729 *08893AB8E459638CE1AE771CA8C4D4B1C0E892CD TRENTON.WINTERLING
80,265,730 *088CF922E90C33A09AA2A6250A489A6D560E7383 KCARINES
80,265,731 *088C8D78AC4CDA3F837F7FBC04472687B3BC1049 ehq?q
80,265,732 *088F2F03D43AC5A09893E4CF45A6AAB9AC73CC23 ehv#6
80,265,733 *0884CAAED112B5D6FF1F8DE71DF274456E850451 eikir
80,265,734 *08838E00BA536BE3BDC631604B46B06A0D44BE20 ekmu%
80,265,735 *0883400446DAD37EE8D54B2F03121F9871F30B3D honeymuch13
80,265,736 *0887BA915940C280820B665C5A360DEC896488FB kelvinlandefeld
80,265,737 *08837B76EDBE3BDA1696F9EB55D80837CA4B1C4B elbulov0
80,265,738 *088EE8DA4007B66A96171C6103823C28B29A05AB KENNITH.PLATANIA
80,265,739 *088AB572F3EE1B5DEC2A4290975149E941F579B4 kennysnachez
80,265,740 *08857F7E11D57C6C2108986D15010CF777E6E5A6 tshif-raphael-phoenix-muambadzi
80,265,741 *088F28DD92722FEBD9C86752048495A4982838D6 ELIJAHEMMS
80,265,742 *0887823CD1F64B2C2EB0BDB521AC2170E969C7C4 ELISHA.YOTT
80,265,743 *0887A3D007EC8C1B8B410EC587A1FF447B33400C TTAAGCCTGCCAGGGTGCCTACCTAGGAACTTTCCTGGACATGAATTTCCTCCACTGTTA
80,265,744 *0889DA471201C6EBAA5355A72C8E4DD40BE1D46F tude.ajuz
80,265,745 *0883791CECAE88D915CC7C8F334FFF4C393E6C8D TUESDAYMADISONED
80,265,746 *088533A34E33A5FC22628D5B89E3696DB92B8DED turborescuemegazord
80,265,747 *0889B6CF7592F2FA257D9D5AC5B7CFDFF14961CC eloymcmath
80,265,748 *08837009FFDB8E57AE04673C7AF0617D1F3EA34D ELTON.LIVERNOCHE
80,265,749 *088B278612E7CF209E99C668E10FDEF421089761 [email protected]
80,265,750 *08819DE6B717E612F16E077077E9F92D6A2CFD4D elve
80,265,751 *08885657BF783F4F74C5A941328ECADC03C27E56 [email protected]
80,265,752 *0883323D43EC37BE7D9EE139D006CBCCC06EA99C EM"C
80,265,753 *0886EBD24CA08FA48139FB8B4F41F5200A7AB63D twinkgail-masulao
80,265,754 *088A5B8D0812D0D2A53AF6C7DF2926394DE32475 kirsten.mize
80,265,755 *0881417A97000765240A55F60CEF5EF990B437AB EMILY.JORGENSON
80,265,756 *088F8F92A4DA9B32D3B49FEE18F81B84618E8AB7 EMIRITA9
80,265,757 *088C4E430B0721DC7B3DD7B0E3C18456BFF43853 EMPERADOREN\Y
80,265,758 *088F1C7CBFB8B6AE1C65C480BA1E987D15AC23CC TYLER.SCHUCHMAN
80,265,759 *0887EB187F85B6A349A8D3CD92AE0152D5A3FF70 TYLER.TORRI
80,265,760 *0883BE24C565CA55CE60F5317FF0C6654E2BA96F Klosterb
80,265,761 *088F0183A7F8714087DEFBE6C3264D7CC65A5DEC ENGANCHA
80,265,762 *08836AAE9353D69ECAE08705A4BC971C4D7017B1 $UB7O7411!N9
80,265,763 *08892975AE2EB41A085A817EB1C1593CA5FEEBD1 hydrobud
80,265,764 *088A7891CBEC4937FB2942090CF62BB74D37E9EE KOREYCONNERY
80,265,765 *088AE4DF7C4D5F531AF81C36C0DDCD8A06A0BC24 ENQUETERASES
80,265,766 *088DA2FB891EA1134E7AA03F0EEFE2E4236BB2BB envelope105
80,265,767 *08862B101D109C5088EA15EF3EBD70C461A864B2 ernestvaughen
80,265,768 *0885DA3A5EC27B2CAD99F9AFFEF37053743B9158 EROTIIKAN2
80,265,769 *088448C3B289F0FB3C006E138FF48F14CE3E3A71 [email protected]
80,265,770 *088875FCBEA13F1D30E34D228576B3BAF04ED801 KRYDSETED
80,265,771 *0881ED8BF584772DB7BCDF2B8DBD48D744B0FABC IDUSN2713331020100527
80,265,772 *08884DF34103BE222C0C3825C4333EB29DC656EB KURT.GRASSLE
80,265,773 *0888687BAE4FA556C26B53C2BBCEF93B7138C6D8 kwazyguy_joe
80,265,774 *0883A6AA70E1D9A643D1D15F4233CE77F4D14AF2 UREĐIVAČKOM
80,265,775 *088FB6E8A3093401D24A6D3DCC9D09FF7D0823AB urusei-yatsura-all-stars
80,265,776 *08857AEAED6236D77351CC248E0AA158768F47C6 USMANLUCKY
80,265,777 *08825E7A285824053360B90233D92993BD4F1156 uu/
80,265,778 *0888DD31C957A469F69BE837168CD5D8896E5610 EUROPED6
80,265,779 *088D18FBD4A8918610458D3420E20AA0232DFA9C iluvisrael01
80,265,780 *08870333066BDCD412880E96FE63CD16A36C1921 impacient8
80,265,781 *088B6E70112CE21ACACFA803FC2E71665AFAA8B1 lawerencemunise
80,265,782 *088AE57FB403D78CEF7E7C0EC3D633821B99DFBF incivil7
80,265,783 *088F80DF6ED149BAF9E28BC32AC3794FD51A857F LEEBASSIN
80,265,784 *088F059133243A543F2F6DF32889848EA5823E26 EZRAMONDA
80,265,785 *08843FCE691D89C35477172596EAB5440D67C203 ezxfitnesscom
80,265,786 *088C6D78543CE3727AA6D54F5A2AD09CDEA7D8C2 LEGOUSI1
80,265,787 *088D17AFB74588897A90C7EC35665382304CEC32 [email protected]+3$
80,265,788 *088858C7F03B7212EDFD5A4EF9D47FA913F2A380 INFLAMMABLES2
80,265,789 *088B9C6D9DB48CD2D5C493FFF681B54951C3DBE8 lemkeonlcp
80,265,790 *0886CE19F782A4C7276357B2820CC6AACE5EB666 lentulo-espinter
80,265,791 *088AC63A6CDAAA982B4154E96601A7B2B4104AE5 VERNAROPER
80,265,792 *0883401E8F63CCD880962F81C16E9824BBE2D3F8 leonardharbeson
80,265,793 *088B954ED4FCFE41DDBE73E7B7B4ABBC4A5DF206 VERNONSCHOENWETTER
80,265,794 *08812E244AD7FD52E8C55440C762DE4C272D3666 leonellandvatter
80,265,795 *0885856D47F6F0CCC5EA04BB7AC81E567DD26C72 [email protected]
80,265,796 *0885A3244239176E3A34A415FB3C60578E5885CB FARMERMJ4
80,265,797 *088FABFBA339342525CEFCA559EC7F1F1602B978 instrumentalizes1
80,265,798 *088D9B79A7B9ABC3815255656751486AAB80EC81 fbxx
80,265,799 *088B66CC3802EE3784C8F280E32772136FED8ABD VICKIE CONDIT
80,265,800 *0881E4CAD00E19FA3F4C6FF0EAF6827B1EDB350B VICTHOS
80,265,801 *088EADD94B9941675282D57D28670535B8D22EDD FE]
80,265,802 *08800770E915D4C3050A11A3DE74FAF7681282D6 invidiæ
80,265,803 *0883631F8FD9C4D3D80FCEF3A697EDCBC4B94782 L:G?
80,265,804 *088A8D74FDEA0325D40D26808FB82542ECF28B9A VIEUXTJE4
80,265,805 *0880AEBA0F4B23553687F49E26E679B63293E681 ipユーザ同士のもの
80,265,806 *0885D3B0ACE55C3953ECE97E64A4E982FF6268AB [email protected]
80,265,807 *0882E31246F06AFBD43A7D877069E68F5530BC01 IREDELLS8
80,265,808 *08886C398D05D1B8FD45BC6B10F0D6B22544162F ISABEJ
80,265,809 *0883E43C790670C611EAE2BA0804545D06F2CB3B FETENHITS:-DISCOFOX---DIE-DEUTSCHE-(DISC-2)
80,265,810 *088EA06C3C238C35A5E2C7E8CB0669A042FE2FD2 LIMBLESSSCULPTURE
80,265,811 *08809A5C5C457D6CC980A2B8B1F09B66CBD680F2 f(gs
80,265,812 *088479F9BECD3CE2B67D6D4122D1C6DDA191FC27 LINDSEYGABER
80,265,813 *088D71BE6B6D9DD230EBD7EC391D57EF8097ABDC ISESTILE5
80,265,814 *088D6EAD3928C27D0423A0CCA94179725CB1BFA4 linh-my-tran
80,265,815 *0886DDF5ECA3B4220C766086B03E513EEFC369AF islandsfararen
80,265,816 *0885AA4145EB8D637346BCAD5BEEC1B6B1601EBB ISTURANE1
80,265,817 *08800FD25AFDEC2DBF4461AAA975EEB087DE6D05 FLECHIRONT0
80,265,818 *088E8A65146D14D988AF2D63655D2B6735DF702C IVELDHUYZEN
80,265,819 *0888F3871ED174D21F30D45999608A667E48E0AE FLODEEN9
80,265,820 *08834BD9A5EF9558F4A6AC638F128073C710ED20 FLOEPENS9
80,265,821 *0880FE61128439E27A0D83681C648C4BEFD4FA0D jackiebaumert
80,265,822 *08856B49FBBC98EB2D3AD0D087E77C3D02AA8547 JACKSONBRIGHT
80,265,823 *08865D00B6E836AEB06E718495239F1275EE9DE4 lonkkaa
80,265,824 *0884839C1D116AE86FAA25E731474020ED1D9C45 lonnieswartzel
80,265,825 *0889C83ED781E9276ADA0C0512221CB78800B936 JAI MATA KALI JAI MATA DURGE!
80,265,826 *088D8F4C07ACBB05A942ADCFA55202490FCC201D VRETANIKA9
80,265,827 *088DBE208D6EE4583679703CC5B1AAF7E3320276 JAMARLEUGA
80,265,828 *088F78FF13929BCE54C889110C9EF60D349BC97F LOUBARCELONA
80,265,829 *088E215063223E48580BFA12D509B465B43D8D9C vrs1
80,265,830 *088D00720832C64C6B47EB7F77B3D692438D8FF7 VZAUT
80,265,831 *08871525DC546B9372D0F3C0392D34DE18D78CE8 FQCN4NO
80,265,832 *088B505C85AEB9F48EE432D21F179476818F2EA6 lqez
80,265,833 *08876B246C7CC16F43143F1AAB6A979D55B68370 w8z
80,265,834 *088C5C5D13665A3FF7ED41D17852F059DE3E6197 WALKER.LEMBRICK
80,265,835 *0884D4422E7D537A9CA65E828C67FE358E03494D luciusserum
80,265,836 *088BB320242A93BE5C27600C4A24ED23A89AFFC4 [email protected]
80,265,837 *08816E9319E4CB58BCCD37B520C475F84776DFA9 JAY.CAPPARELLI
80,265,838 *088387845471B1A3AC768C5231CAD9CF2458BBC6 WALTERALEJO
80,265,839 *0884F33469F217765EF375A21C89A7D13CAC6E9C FRENCH315
80,265,840 *088D4910041B409C57A360484D6AF748B2AADB6A [email protected]
80,265,841 *0888EC90681AF93A5D299BA49218A365B872BE7E [email protected]
80,265,842 *088268DF3924BC24649D107F0B6906750AD1A899 warrenscobie
80,265,843 *0885DC847B9914BC66A5453F6EF4207D05EE5D53 M1CRO+ELEPHON1C
80,265,844 *0884CABC92DED64D6FB1E8A50FF7BB42196C8B47 waynetopia
80,265,845 *088CEA017C1453E47CC30450414298E4E4208EDB JERAMYBENITO
80,265,846 *088748AA98285081BC83999D4428F9412DFDD2C7 macabresunsets/lovesongforablacksoul
80,265,847 *088C6B8AFD0260E8CAFB5AFCB16067EBA4A9A863 WELLINGTON.CANNON
80,265,848 *088607315243248556BA025AB835829D977F03F0 WENDELLBRUNZEL
80,265,849 *088ED6961EF69E6167D77D1D18A9611AFE36ABF0 JESSCERVENKA
80,265,850 *088A23721E320A04521226D0FE46AE5C3830DC74 WENDY-RICHTERS
80,265,851 *088D593771F0303EFBFB44BA25A58114A5991D01 jessierachels
80,265,852 *08825B991676A7DE62CAF296C96CE456A7F6059B WENDYSARKISSIAN
80,265,853 *0884F6CE110F4B15B152A0CB02D3D29B0E407FB0 [email protected]
80,265,854 *08889F43C7A296D5364BC918361BE54531BBD63A MAHUATAJPUR
80,265,855 *08826D5FB66577B298059732DBF8F10074ADE389 [email protected]
80,265,856 *088F135C3A75E16BB2BFA2952752A35561D10FDC [email protected]
80,265,857 *08873D0C84EFC8026A891F4AEB462106F9BF65DC 『gal’s
80,265,858 *0885462C349F465CECE03488F405142CB7429A29 [email protected]
80,265,859 *088A4E2064ECE4612C14BC4A7FC57E26A243BBE1 makotosayama
80,265,860 *088C1CC43D42EE9B28FD12314A6CFC5272B21A47 [email protected]
80,265,861 *088254A7ECC97B43EDFBBF9B70295902289E0F7D MALCOLMMORELY
80,265,862 *088A4413614FE85DA407B28CBC6BDE0E00C4D929 GARRET.EBBS
80,265,863 *0883FA79C8AF02B5FBBA60050438B6F79710831A WHAT-IS-PIMA-COTTON
80,265,864 *0886849BCEE36137A5088FA5190D01FFBB9150BD WHAT'STHEMEANINGOFLIFE
80,265,865 *08838E524FE3B32DD8896263BF9A24617FA2F96D jillfairhurst
80,265,866 *0883558C6ECDD316386E5AEBC98CFDFD4B1EBB5E WHITNEYWHITE
80,265,867 *0887AE9D13B854E22CDCA3F7D8AF84F8157F01E5 JKLMNETWWW
80,265,868 *08897AC4AB9FE8DBE58143855259CD05BD90AD06 manuallingelbach
80,265,869 *088FDFCAC7DCF14D34E57D05AE9F17D8A3810062 wiethop2
80,265,870 *08884643069D1E91C66342B393707D56408CBA0C JOE.CHAYA
80,265,871 *08817B7AD5DE9DB62B45CE32EF1B2D2E177FF418 GERARDTSTRAAT
80,265,872 *088ECB1B171C1EBB19C5871076D97AAE6BA1EF18 JOEY-MIX
80,265,873 *088FC6E603463749F14691EB24D3AD5DE7BDC8E0 johnathanrychlicki
80,265,874 *0883648221214A61CAA9F8631C382D3B50E003F7 MARIANODUBORD
80,265,875 *088ED239A9B05A504C711F6C56712EA664A46022 mariaplease
80,265,876 *088BC26D0C657C13C49ADD6689F073EBA78B6657 WILSON.MAZZOCCO
80,265,877 *088692AF3D7E3B12D22BFB31999BE2C4ED033A3C MARK.SHIRES
80,265,878 *088B4DA8F07C7F933A5F862BA31E2B9F01AADE95 MATHEW.NEVEU
80,265,879 *08831801AD7312701C42739E93BBF937957D2898 JONAH.BERRIGAN
80,265,880 *088024D76654B58DA11FD31628833EF29BE0857D WNIUFNAP9
80,265,881 *088E4836C948C231BC15F561F1A2AEF173AB0256 MAYKUAN
80,265,882 *0881DD935F66046BDB7FCB393781677A0FB7F2BA woodrowdavern
80,265,883 *088E412E06C89DE10410FFFA98AF2E65DA6488B3 JOSPEH.GROTTS
80,265,884 *088B8BBE32D5688FFF0FF421AA935567CC717CAE MCKINLEY.LISTI
80,265,885 *088F1EA35640DEBCAD86A035F9FC5C97B836DFA9 [email protected]
80,265,886 *088EC59DE386D4D15CA6D6E91EE9EAF19586E7D2 j.parks
80,265,887 *088FA46BE1B146A8BA607DCC848789C450263890 [email protected]
80,265,888 *088A898FAEB8664C3801DB26B08661885B17C4B5 WWWFREESPIRITGALLERYCA
80,265,889 *0880D9565189943375661E5EDA7F06A1724344B5 [email protected]
80,265,890 *08897EEC76232613458CFAB89AE74CDE6143C24A GOLDCYNTHIA
80,265,891 *0887259BF387B78E6DB74FC30AB8B8688E3BB0E0 JVCBASH
80,265,892 *08857D5EFC9504C341085315D98ABDDD49F606B8 WWWSAXIERORG
80,265,893 *0889E93CBBC32E54122C91A1F29877F02CFDCFF2 [email protected]
80,265,894 *0886D5BF90C7E39FE667661850B1051EE6E826E2 goodbye.tonsils.(short.version)
80,265,895 *088D3D3294D7311AC16A883337B2E4DA2BB6111B MERLEKULLY
80,265,896 *0882E18F80C8073847C1667EDB895FF5B3EB1C7E WYATT.PHILMON
80,265,897 *088C9B1093C2BF4B2DC31D8391C14A7D2BA524B7 MERRILL.ALKANA
80,265,898 *088E7AA417A68AF3ECF0C64003F9744D1978D74B X>{>
80,265,899 *088119E0D320BFFCEF455354B11A421DE804DD9F XATASITH1
80,265,900 *088B385E507FB18D37A3879CA4D38D8AD0DE8466 GOPALNANDA
80,265,901 *088E48B3DCFBA334C425364C46C57FC48497F713 GORDONGAFF
80,265,902 *0885C727FD0A137ED6A29DE2DD464BD19DC68321 gowhich
80,265,903 *088201AF73E1884B80BB527D716D7B81AF670012 [email protected]
80,265,904 *08846BCE5E3BE928065DCAB2CF39D59D448962E8 MICAH.LUDVIGSEN
80,265,905 *088F5CBDE033063C96BE918CA55BBA98CB965BAB MICHAELCHRISJOHN
80,265,906 *0887AD27E4F49B0590043F17285E93FD1F45F089 MICHIGAN-SLEEPING
80,265,907 *088A6713BF219289C1D15FBCA5B28DD8BA588F20 gregoryshives
80,265,908 *0885C6760A32AC18F806CEF4EDF3E4628BF126E1 [email protected]
80,265,909 *08829DCB4F4283CD69AECA155E81DFCA20A77DEF KATS41
80,265,910 *0883E6A3A8B4603721B1280BA940C2B35AF783AB XXROBOTGMAILCOM
80,265,911 *0888E8E86DAA88D878B241D06FDF453F81608817 XYLENOL?
80,265,912 *0888CCE9241464A12FD1449AD09A1B3460CCE662 Y1847
80,265,913 *088F71114276D74F3ABA220EA406D576C6813B79 militærjunta
80,265,914 *0881CC695289DB0E82D0B791B6E67A969576ECF9 [email protected]
80,265,915 *0885DCFA4EB3549BC328B37E270E3BABF75B931A keizaisu
80,265,916 *08821C0F26BC4744EF6C3F1CD11ACC7C1247AD78 KELLYCROTEAU
80,265,917 *088FAB89300352D3AA9459FC226A8C11F83F882F KENDALL.ALLOCCO
80,265,918 *088649620B7EADFF9ED641B88ED7A3C1A82C48DE yakup-wawe
80,265,919 *0885E90E8E339B38E3B6C28C61536679CFDBD794 [email protected]
80,265,920 *0881F6F232A9777426A099E227E7DB7BC5E911F0 [email protected]
80,265,921 *088D9441EDCCBE98EF0569AC0E395AC5FA187608 g$vx
80,265,922 *0884E9774FECA6F56E5FC9F015A60D9D6B15A9FE YATIINAAM2
80,265,923 *088B2E597701302F70CC44BD6B6B4C1BED1FFBBE mockups
80,265,924 *088C6E71E7459DB263971A83255E2C424F41B849 [email protected]
80,265,925 *088BED6A0D1D1896AD4C850C2CC81DDF54A1E751 yehiaassef
80,265,926 *088987ABB684F9AE253D7453043D7E9BCAFBEA5A H3M4T0L0GST
80,265,927 *088465467DF2E861033657C4E93818C3F0114B37 hachurerez
80,265,928 *08835E0DFAB91DFB68D4C50C2228BDC91FF46B68 HALIALRO2
80,265,929 *088984B0697EBE0FE47B0B148CA0A658945CB143 MONTE.LAVAN
80,265,930 *08891D272005421739F6427E7CE8CF7CE6203406 MONTYLINGNER
80,265,931 *088E0BE952DAE2B3C3791CD2737973029210CC17 [email protected]
80,265,932 *088DEE924548962FD8A3063CB65F5ADA55DDFC08 YNNEK41
80,265,933 *088D0DF77266B0C903DC3827CDF43F78B9DAD98C more-music-from-coyote-ugly
80,265,934 *0886F079FD67693A57AB72BE6BCB0D5B67336790 happy』の
80,265,935 *088C02EC2FFB2AC18B99DD558815D1F3FC839694 HARLEY.SCHEERER
80,265,936 *088113783AC1C7144DF615A3237C7197F857EC68 YOUMONOPOLISEME
80,265,937 *08853C296985F3093C71CA2C5948412965057B8C MOYOVKA
80,265,938 *088B263B6B97BA6E5030FAE0B8E4FF8B998D106E MOZIMISE
80,265,939 *0882673665DE4A826B16996F42CED551D77C9BDB [email protected]
80,265,940 *088688553B0F4F4B661AB60155101F722F9AA772 [email protected]
80,265,941 *088C336108EE941BDD96021A6103BCE3CFCA4D7B koltchouguino
80,265,942 *088211C22D69B07A2117258480866E614D7E1310 MUDSTONE7
80,265,943 *0886D1A5925BF3EE544AC2D267400FB207259856 MURALES”
80,265,944 *088ACCF53F4F9935FC78C46AF421C8C41A9849DF HEATHERMOTHER
80,265,945 *0881E989E327B51AB2AC944B5E40235F48E333A6 HELPEMULE
80,265,946 *088DAF38E7A0E6B6891F0D3A466C8FFAF4EB2693 ZAHIAKHOUEIRY
80,265,947 *0882501B64F9C6A47CD96727474EC2507101169C ZAINAB-CHAGANY
80,265,948 *088DBE5DF718A04A011E179C3626C4390150CC21 HENRYGARBARINI
80,265,949 *088A8C69409C0826072A41CED0A7852D596B179E ZAMIEHOUSIL
80,265,950 *08878ED000B4157D6FD6876EA89E82C26E0955C7 HERIBERTONORDBERG
80,265,951 *088D7BC58E557658781C1B6938EE1893EF726243 KUNTONEUVOJA
80,265,952 *0880D5F00AC632B749E48C90781CF5A234BF1FAA HERREDOEMMES
80,265,953 *088BC506BAD0CDCF2861B7ED05031F0392E9F528 KVATRIC4YOU
80,265,954 *088B2EE05FFFD8376EDC00F895A43CF13BD671C2 KYLE BARES
80,265,955 *08822234B5CB00AD1BB4BE2B1672C641D1E5337C KYLE.MOERKE
80,265,956 *08889C65210DCC450B93A74524A0ABB555C2EA84 L<;AA
80,265,957 *088D2DFDFB425433D7BF9BD143061D82BACB45BE LÄHRI
80,265,958 *08845E671CA5A94D2D227BE787FB589737390F38 [email protected]
80,265,959 *0883AC5E4E88C3AB5A036BE1A352AD5B08D02FB3 [email protected]
80,265,960 *0884BCBA9708D0850C40BA81EC4182481ED9348E HILTONCAREN
80,265,961 *088FFF5BD9B79BD0606CDD37549F532C73A3D742 LALAINEMARGARETHCATANGAY
80,265,962 *088E21FFA28BCF0A22C0E4FC8030BED2CE952BDF l.a. mattress
80,265,963 *088712EB7D6209DF27553CC26A224484C49FF0D7 NAURICULARLY
80,265,964 *088519640651579CE21039B2F7D1CAD5412F2526 LANDOFMILKANDHONEY
80,265,965 *0885D73EF5E495B21DE8035A9BAD229EE463FCE3 [email protected]
80,265,966 *08860DF6034377300602F02318A81A6640513D6D ZHONGGUOBEANERS
80,265,967 *0887885CD689DCBE7CF4723AA28E68998609CA31 HOMEFRANK4
80,265,968 *08821215C4711CBA50193D073FD07C73BC40EC72 larryferer
80,265,969 *0885952768D7A3BE5B394BFB091018CDF1B2CDA9 neiii.devantunegrotte
80,265,970 *088129A7ACCA8C1557A842F93EFAAC5AFAA841BB LAURENMCCASTER
80,265,971 *08817D3229E06A8D5BDD92132D2B5DE49202D8DC HORACEMCELHATTAN
80,265,972 *0882C248763377C9C1BE9338C82367E4354C1D7E horacesemaan
80,265,973 *0883719365DC0D763CEB771CD2F5E3ACC109F0DF ZIMMERHÖHE
80,265,974 *0880A27C8B6FACCD01A6DAAB389796EC4641EAEB LAZAROBENKER
80,265,975 *08804944F12E502F394C7AF3CA0486658E333354 NEVERSTITCH
80,265,976 *088032921648DC4099C87867513D3B0DEA5A01AB LCM_LOVELY
80,265,977 *088B77840EB3FB4F90755EAFD812871B520EAE5A HOUSTONKELLOW
80,265,978 *08842DE9161369F33F9F51A3A3DA6CC6AD6E413F zoltanvigh
80,265,979 *0883A88D011E61F099135F2ABD8C6C3E3D2BA848 hrdhrtd8
80,265,980 *088D3EA29B04935AA33D9BBA7CC131C49CDD89BC LEIHFEIT
80,265,981 *088E08FBFC5BD55705D90A32E59BC5BFD0F79C57 [email protected]
80,265,982 *088075E625CCD5ACD25A92789C2EFBBEE046796F HTTPWWWGULLIVERSECO
80,265,983 *088FDDBF65401926AD31C47234496B910A9E3389 nickpozniak
80,265,984 *088B8CC7BB76A42F88A61CE0CA81E4B2BFE30FF3 nickyirie
80,265,985 *08831BEAEAAA1E712C25D581F9C172ACA7028B4D NMEETHAN
80,265,986 *088FC48B0A3049C40EBC6E0C849BBED912EA6B0C NOBLE.DUSCH
80,265,987 *08811F65D46EB3097214D6C5454DE683AF783D70 [email protected]
80,265,988 *088F96B1BD43950CE40A867F8891F9B2367C369B leofreidkin
80,265,989 *0888E003735EDC38B48863FAE81F669FABDAB2AA HUBERT.KESER
80,265,990 *08893109BFE5AA8EAADAD742F94F5D3CBDA2071F norbertochagnon
80,265,991 *088B641D030E8240BD63E47C9340B0BDBAFBD86F NORMGEISLER
80,265,992 *088F63D7117E157B197DE507166112EF561EC753 ГЕНЕАЛОГ
80,265,993 *0889074EEB8528107EE5DF6E01E856DCB7AF7429 nx`r
80,265,994 *08863E30D66F0AA283D9A30F1B1D38DD79CA2691 HYPERFLEXIBILITY2
80,265,995 *088494AA472B0F2600B776331C3A05A38AC73EB5 LHADGNUOY
80,265,996 *08870BD3F1DD7FEB9DA2C7B04460711CCE9AE2FC OBERLING
80,265,997 *0886308ACABB0FE175BDA537B35961019BE9CF2A i3fa
80,265,998 *088636B525E7B83398F3F4A33799EDA7B37EAC74 ПОЗЕМЕЛЬНУЮ
80,265,999 *088A9FCEDD80E7E402C26F9F6B052171C8269D12 icliebedich
80,266,000 *088737DDD9F0B844E12D46FBDF925F2D3D467E42 IG6C
80,266,001 *088337080D790302181FCBB1430664B33AB79139 oneness(2)--w-ah1-n-ah0-s
80,266,002 *088C9E226DF5AD9EEB3C44E49F14B70D7EF10F50 II.F
80,266,003 *0880CC7FB7B1263E6017E124282CEEFA3B9D7FC0 (O_-)~`~`@=p
80,266,004 *088D3839530CFC96FC829308E46175E9B7E906EC o><~`.~`.qp
80,266,005 *088DF35227A241A15A8F84A920F7084964072240 iluvmillerabc
80,266,006 *0889D58DB7BF7A94897B4F4FF63FDB59CBDA81E2 orthpedics
80,266,007 *088DAA7C11DC706F5608BD97DC3F8EE69ED73757 LOREN.PEERBOLT
80,266,008 *088CA479902A384633216D4AF9BE5EC66F56A51B loveyhill
80,266,009 *088B0D683228D5918BF969986B9486CDF02E710C [email protected]
80,266,010 *088270007E3041774D094EBED1734A9AF2BACE7F [email protected]
80,266,011 *088464F1A94B3ADB31C03042718FA9BB583A5CF5 INDOMITABLITY
80,266,012 *088A9073D3AB672518F7E64A816023B44B2619C8 overstiks
80,266,013 *088B57E031076784025B2075AFBEF6942B72B9B1 LUCAS.KOLASA
80,266,014 *088768C87C30C169B73B0295FC5E5F2EB4903A5C LUCIANO.PARRISH
80,266,015 *0888BCB314F6CFAE368529973A913CCAC38F68D7 inomenming
80,266,016 *088C31206D177542FCECB364BDCA5FF63E56AC79 P==)-~0~O-}O{
80,266,017 *088DBA3DEA693D471A50684442A0CDEFDFCC18C9 [email protected]
80,266,018 *0880B377142DF9CCEBCCDA9200D0ADA220B07915 LUPECRADIC
80,266,019 *08853AFBC9FCBDDAE4ABC4EB63A399903159A6D1 [email protected]
80,266,020 *088C5EA0FAD837648DD6267B174F0800AFF8EF68 i-pin's
80,266,021 *088D165A3D611864FA59F6655E21434406C13974 LYLE.HOLT
80,266,022 *088764CAE404099065FDBBC125DF91F2422D33F9 lynndasgupta
80,266,023 *0886FA8DCD9220FF451E831202AC66E3D8AAAF41 PANÈL
80,266,024 *088BF5E567FF0E2AD5906EDD6890A8EB513E09FC IRTAAVAN5
80,266,025 *0880A936EE29332C7733890D2BF2235F9498CFAA LYNWOOD.PAREDEZ
80,266,026 *0888276667C9E5E701E468749D9C3DF02CFB1AD9 LZFHLYL
80,266,027 *088760F17103A66C428D997883BA5DBB35545D34 para.no.volver
80,266,028 *08876AD29E6F421C3372EBDD3547D73804141F3C Pasti.Voracity
80,266,029 *0882D9DCAAA72B85B292245748933955D40B27BA ISREAL.PESCATORE
80,266,030 *08813859425F854EDEF2FFB05E2B6F3521369017 ISXZ
80,266,031 *0888C2B6758F3E9CE34FC2A984112C1D814C1F2A MALAVIYÄN
80,266,032 *0889C95E6CB51AF3E388F6DF26ED58DA2008AC08 P---D***~0~OSPLAT
80,266,033 *0884223AD99A0087D0195ECB02D50F74AD466765 jaegerstaettera
80,266,034 *088DBE7F96C85F02CC60A756D367157B205804C4 [email protected]
80,266,035 *088084012A5EB09113ED27DCFC48FA926B0F985F [email protected]
80,266,036 *0888D601EA9FB47BDEC82AF79B20B177B209C2AB JAIME.SEENEY
80,266,037 *0880709CC3F253B18F207CEB7A64A5C9362BF481 [email protected]
80,266,038 *088EBC478ACC3019152D07EC7D2BEF41817FBAA7 PERILUNE
80,266,039 *088062EC20E685F6C159B4B308E6C7AA9447DAD1 PERO'S.HOT.TIP
80,266,040 *088E54714EA2E27758C18508E8ADC81925BE17D6 MARCELLUSLINSDAU
80,266,041 *08801B17CF5D578ADAAA1F98D8E54A31F3C60238 marcguerin
80,266,042 *0889C40C9D85AF8327DD87B2008D67CAF0D2D054 MARCO.TOUHEY
80,266,043 *08829131DE71CB85C3FEB4A1CE4CBA80A0999B5F MARC.VIELLE
80,266,044 *08829B67EA402C4019F9CE4B9B8125BBDEAB38CB PH0+0ENGRAVERS
80,266,045 *0885A3AE1DC570CFC526B35796031792A3AC3BD7 MARILZE7
80,266,046 *088273053DA8253E31B13F614C1DE549710CC813 [email protected]
80,266,047 *0885273283F54452F351819102092AEDD99D2D33 JARROD.WOOLFREY
80,266,048 *088C06714EF584374A373BC8A3CA0EB64A191D54 MARIVI-PONCE
80,266,049 *0881F63B9D9110DC74B9865C5759D8DD7B96290D MARLON.ISAACSEN
80,266,050 *0885966570490C1A6B00AF52F0D7A197B74B5DD1 MARQUIS.PARADOWSKI
80,266,051 *088AF9101C4DC5D0FE31776FF5AF65AAF0B0BEE1 marquiszets
80,266,052 *0883BF74AF451E2F0DEFDA1FAF70144C3D0F3556 飛行展示は毎年主にu
80,266,053 *08892C2FE6032EA51A869502F91D073AAADBC68C maryannacutoff
80,266,054 *088F597C70AADD290198C932654B9D4969BFCF71 [email protected]
80,266,055 *088FB55E0EA4E4E2A1D7D89FF368E143F140AD1A JEAN.CORNWALL
80,266,056 *08803BADFC0D2E694CDA2C1555B7BA5A3B31290E JEFFEREYHIOTT
80,266,057 *0887805A4BACB887E1F424E50BCBC934A20832A4 JEFFERYDEHM
80,266,058 *0887D419DAEF4CCE709D0081C5A3CA443BF1F76B (00)[email protected]##b
80,266,059 *088A3AE0948ED1E208E6D6B72B8B65799B6A0F8B 019FB4A2FB8439D08D9959F0D30A1868
80,266,060 *0885187D1BA8B6CF9BF5CC17466B8435B62992B9 01d0415497f3355597f41ec8610eae5b
80,266,061 *0886B09B4C33617E466E61AE84650D7E7DE08934 01GARCH$
80,266,062 *0881C082B83E124FE42529BD386B244227B2B156 JERMAINEFARRY
80,266,063 *0885B4D3D1B0BC75DA50CCCCB62C9DB1D2409F3A MAX.ULABARRO
80,266,064 *088554BC84A7078F93B1E7810AEE344F1485AC65 POLYDORAED
80,266,065 *0880CBEA72BFA5024FFDD806F509F5B49CA03BBB [email protected] ~O ~O UU
80,266,066 *0886A5B11D5A0050B7239680F4AEC596109C5071 05191868
80,266,067 *0888D2E561696517A0C3735681AE32C26B6341BF [email protected]@l
80,266,068 *088D1F23D0C61BD040EA11A969324B4975457FAD [email protected]
80,266,069 *088A5790CBF18298F5FCB793FFAB1C4C2F052550 [email protected]
80,266,070 *08830CBBF57BE431577B38D0DD333246B2EC6C49 MEILYD
80,266,071 *088F7AB7918EBB914693817BFC9C5FDC516DE108 )0(O~qp
80,266,072 *088576202D6FE27C4691DF372D64F498EBA1E8B8 primateljicoj
80,266,073 *0882E577B615BEC76E8223067465C78FBBCA3F8C PRIVACY-CONSCIOUS
80,266,074 *088C785BD2415EAB94EF08B9531B4B8307C9C6C5 [email protected]
80,266,075 *08857C599A81036E933EA0F57BE5B576F9D80820 PROGETTO-GUARDERIA-MOCHE
80,266,076 *0885FCED7B8F4E13CBC3BBC3E22EC467D75F8C3A JOEYRUBEO
80,266,077 *088E5CB65FBD284BC3A3B6FD51CC130CE7B39CD5 [email protected]
80,266,078 *088C1CFB68A1DE269D727A05884980BF946516CB 118057 fethi bey , " ben daha iyi yaparim " demis .
80,266,079 *08879F06B1CD6E32A383B9A28502BB8E0C2FC3F4 johnhaeber
80,266,080 *08859DDA2A5E1D250C13E357650694F55E54987D P---)~~~SPLAT!
80,266,081 *088C97B0774CD85097BD899B4EA1EE486E8A0040 purificavi
80,266,082 *08820144B5CAAC465997B12397E1F55123225068 JOSE.LUKASZEWICZ
80,266,083 *08898ADF5E97ED8E2B28C5432C8DD1F3E87D0B8C mile45
80,266,084 *088405DD3C7EA983D8F58B62784D77730C7D99C2 JOSE-SABAS
80,266,085 *08835726A42AD5BAE6DA09582074682D12E648BE PYROGENS.
80,266,086 *088C40FC07EF1EDEB1AAF69F35404080A847863E Q===>~0.~O:P
80,266,087 *08895F8E55A571E43D73F4560E9F5EB3508B4E17 14G0$-EB0
80,266,088 *0881D81B29FE78E910388CF629A4A0190DC04396 14.P
80,266,089 *088103732924524BAA787FE7C5AC93747C038BCE [email protected]
80,266,090 *0885B0834893A42C5A2586FEB420BD05EEE89A00 Q===B.`~(>_0)
80,266,091 *08849AD3FE8099E10111D1FC43CF863257D8871E q====B`~o->-<
80,266,092 *0884C956DA0F5EEEB980E6AA2942BCDBD59C3C05 qD`~`~o><
80,266,093 *0882462DA85B1BFA4E0AFD697F48C1815F613522 [email protected]
80,266,094 *0885796BCA0710AB838D0C669A4CE5C43D27F9EE MISS BUTTERFLY
80,266,095 *0888137B42E95EB366B7BD802515117C0A22A2A3 [email protected]
80,266,096 *088009CB6837CDAFA7888681559A56D7357C22D2 judyosborne
80,266,097 *088A2D6BF5F9E8ABB817EED73B84E6F843CC6A7C mockups
80,266,098 *08889FC42A3E723FE99F0121C2D0CAFEB77A99C6 190648 anotherdisputeconcernsthespeedofprivatization
80,266,099 *088F001609923D026A6A6F5849557519E3B5A475 MOHAMMEDPATMAN
80,266,100 *088F59C043F0539ED8C8FA7590EAC7E18104E473 moiseshardin
80,266,101 *088C252C494C1186A1D5BB25431FB428D5E74294 mokumbear
80,266,102 *0888F9F492AA58AB29B1C8CB1E55C0A1456158EF RAGBIAR5
80,266,103 *088AC777415835E16096EEF27AAD376ECB6E4263 MONTY.ICHINOSE
80,266,104 *0882859AA38BE192DA3559B2CE3BB04C7BA3462A MONTY.NIXION
80,266,105 *0885D5768BFF6FC3FB375AF9C6416775394C8976 raj.arya
80,266,106 *088EB4C9DE24737381ED5CCBEBE89F27612903CC [email protected]
80,266,107 *088AADB411F36AEC0C801A21567F1386821E3860 19-miljoonissa
80,266,108 *0886978DA2C19A498EE478676E62E0AD967F9D6C 1ALLERGIEASTHMATIKERN
80,266,109 *088E730D5B06BFCF4ACFBED8A40D38C7651692F9 RANDIAS2
80,266,110 *0889C61A371B54729B1E726ACD197BAA0BAD5F29 [email protected]
80,266,111 *0889E78AAC6DCAEECC057788C4E651032EB7A4CC 1AVUSTUSKELVOLLISISTA
80,266,112 *0885F44A742E0823338BBD2F60AB5230216F5CAD ranuccio4
80,266,113 *08858A284F785CD731B828B67501BCE704CAE834 1BEMONSTEREN
80,266,114 *0884643BD5F01CCFF8D3935FB23F577BF48B76D5 [email protected]
80,266,115 *088C086C5645EB1EF93CA587C1B98DB57DF5E511 RASCAL77
80,266,116 *088DD4564FB1845F9DAC4AAFCEB79FFE21424D3A RAŠYTOJOS
80,266,117 *088D4E67E92A45CCE5B6D64C2BCBEC2D788E8D15 MOUSTAFA-ELSAID
80,266,118 *088F74EE8D6D2D8C08F3FEECDCE5A50286E621B0 RAVYN-REED
80,266,119 *0885FF2ED79EEDCA6AEA09FF421CDBDC569E61F6 RAYIMESON
80,266,120 *088539BAF6CC66FBA47C9D7148E83D7D1B50BBC6 RAYMUNDOEZELL
80,266,121 *088ABCB43760EB4ABCF970B0F660CD67A05C0647 msm0007
80,266,122 *0883F30D9B7FBF886EA9BDAA912914AA0707EA50 KÄSITTEVÄT
80,266,123 *088C6ACADE98B04D0A5A98424CFA0A8D300EB9B7 kathryn707
80,266,124 *088FF70A12FACDBE66E3068B5DAFBC5ED1F584BB KC$F
80,266,125 *08811785DC7609EAA7F0E32310FD43117B8373FF 1 GESCHMEICHELTEN
80,266,126 *088ACB0B8141625E09DAED84C7C0A3CE4555562F mutat1n9
80,266,127 *08885DC0AB7ECDF6CAC9225216A96C1A5537605C MVPDBSW2
80,266,128 *0884C4C20B9A522F6DE1290E718067F07747B105 MYETOILE58
80,266,129 *08808C27536D4154C5EC0C25D89662173D816039 MYJERRY2006
80,266,130 *088A3540B5F70F2B50B363E9194C3C9708393ADC 1-IMMISSIONSSCHUTZRECHTS
80,266,131 *0888848E8060E94EE6E6AA21F698F2A9762415E1 1-INTERNET-KENNTNISSEN
80,266,132 *088526D84F348CB110CA016C01274947CF1A5726 1 ISIKLARI
80,266,133 *088B4CFBEF7B1ECF4A09AF37B9CC3FA25C0A9BFF 1-KAUNOKAISENI
80,266,134 *08865A1A030092B4C0A02A7A57C3E92A687EEF08 RELIKVIJA1
80,266,135 *08832DF2B75F8B67048521BA85FA94AA0C4B5AF5 1KOULAITOKSEN
80,266,136 *088F41BE77770BDD459F510684BE37EB8EC13213 KERNERANUM
80,266,137 *088EBACC160C7E738D4CE7BAF9C5FBFFDDB23317 kevinastley
80,266,138 *088E195D1008AFF4EB9778D11494E3C4C7EE370A N9-En-Si-Bemol-Majeur-Op-23
80,266,139 *088122A4EF74C54EFFD5E427EEFA2851568F61DB nader-nenoo
80,266,140 *088AB5777B4E3D256E5AA08AEDA1DF05F9B688A6 kidão
80,266,141 *0885715EC12C8911D47155B19283574B3DC9CD9B KI}H
80,266,142 *08870155ED6B78E1A59B2D8C7C85BF309D070AFD 1.LHO
80,266,143 *08813108DD693D3DD45CBA2F7861486B1217A62C napoleoncurtis
80,266,144 *0884D8FE108C3935F31AE9718A3A13EBB0CF68B8 NASDAQ160QUIK
80,266,145 *088E09E056324C98F5B269E2D58D75D108847BD0 RESTAURANTES.DE.LA.REP
80,266,146 *0888AED12E576318AF07A973AD161309D29379C2 1NAJEYAH
80,266,147 *0880ED203E001B5952BFD4B8D061F0F7982319C8 1-NORMAALIKORKUINEN
80,266,148 *088269CC2AE9452640F3199B76EE9D10B618F96B 1NQDSTNT
80,266,149 *08820448154F7C689EE8D7907613C928A1739484 RETSGYLDIG4
80,266,150 *088A7D74D9A8D8539ACA0896F689A0B06365AD18 KKTNF
80,266,151 *088E6ABFF89D0EFBB46F47231FD6610F79313C2D REUBEN.MOOREFIELD
80,266,152 *088BFECD8762F1673D776D5623997765785E2DC0 NDRVLTD2
80,266,153 *088A1C49B627FDEF7D2D43609FAAC19A68701DED NEAL.ROTUNDO
80,266,154 *0888F9209255DB4D33B03DB19C348040F3A67AC5 KNIRHSDN
80,266,155 *0888FEB967C442A28916B97AAC95F68312C60A68 RIA SARKER
80,266,156 *088E1D3A8257C097EB603022BA29F64FD4B93272 KOEDYCJA8
80,266,157 *08870D0EC756106B69D12B10D3864C1111B03024 RICHIE.ONYEAGU
80,266,158 *0889BA97EFE634DF53B9211823EB1AA39AD01C89 [email protected]
80,266,159 *088A2AA942EF8D08414150F4CF835E2885DDFF18 nemeetti
80,266,160 *088A2A5D6B5D5429BA9864455FA6BF1F0A004BFC koredekhi
80,266,161 *088222A46B17EFCD79664A844FADBA92DF3A6E79 1.prueffrist
80,266,162 *088C481CBB6190A59DF8239842EDB6B0158C5A67 1 RAHAATOIMINTAEDELLYTYSTENS
80,266,163 *088CBC42375E62844A014351358AC7EB0CB3FB96 KOVKOJING
80,266,164 *088FE504310FC09B50B0356DB5A68A65A49D9FC6 [email protected]
80,266,165 *0889354D9F4738CDC3569047D3C3C42C92C67000 k)r)
80,266,166 *088FA33C5FBBE967240BD6989929F6E452BEC9FE 1suunnittelutaitomme
80,266,167 *088053F31D14937CA9ABDECDB9FC48ED0B743442 KRAIG.DELIRA
80,266,168 *088AB520E7951C8A08F189236B627C9F3DC90F9E KRAIGSEPULVADO
80,266,169 *0880F99CA8493669CA2014C644787F5C7A09D64A NGRUPOLITICS2002-11
80,266,170 *08898778432CBD67368F10A1D23B61C3FB3505E9 RIUNIMMO0
80,266,171 *088FD962A4330DDD6314147CD7EE6ABEEE364428 KRIPFEN9
80,266,172 *0881837FF318AD1443B677DC5C43242291714553 NICKOLAS.ENSZ
80,266,173 *088FD0D70F29FBE93848F957465191F4797B1EEF RMAC_1976
80,266,174 *088C937729EE1DE99A9C7D8271AFE8949CD378F7 KRISTOPHER.YNIGUEZ
80,266,175 *0883520C3F7A5E042CF680C0C52C12BD3F22FF9A [email protected]
80,266,176 *088FD5CA0100588E2F0523AA4EF368E2FF0028F2 1.VASTAKKAISUUKSIEN
80,266,177 *0887256BF84F77B90AB82321D3A5D171C8CC70ED kruterkruter
80,266,178 *088DA3ABFDE668FE32B1C6577A27B7D390CF6002 KURVETAN6
80,266,179 *08878C982B5C944A09223448D66D63CB7464F0FB KUTBUN
80,266,180 *0881B2A1CDD7BA25B681922FC87175ED2DEC1EF6 rod.barba
80,266,181 *0885DF0EF7F84C685617FAB7779483A989357A6C niklah
80,266,182 *088D6E4A5B1D61F146A84919D714FDC57FF63D65 [email protected]
80,266,183 *0885D65BAB98A49DBAFA68F66BBDB31F4CCF795E rohrman1
80,266,184 *08831C0CAD0B5EADFA7F39DB1AB8479E39B0D902 l4nc30l4r
80,266,185 *088D4A39D7F9EEF7803CF4C8903CE4C539F00259 L648806774
80,266,186 *0881C9168FD32696F90976CB1F19FB664307EF94 romantrant
80,266,187 *08875181B026007237E0B0458A635A4B7D3FB180 [email protected]
80,266,188 *088E9FA0A28C14F9C7DE8840318BE6B8FACC42F2 LACY.PETKA
80,266,189 *0881CED2D0DDE862DAACF7A439159471DF916550 NOLIEMAR
80,266,190 *088787349CBB9301DD914806C7ACE0196ECC6C3F LAKITTAED
80,266,191 *08812A72AE7992DCFC12989E88C17BDC0F26F292 22051037
80,266,192 *088906A86DA7FB8AFE310ED922E3BD03C314B80A LAND-OF-NO-RETURN
80,266,193 *088DF63B92DE1E6CB08BCEE394822CA34C9BD6D9 rotten-corpses
80,266,194 *088AB92276501A8D6AB2EE6FE41DAE7BC9D7B295 235783 kuopion.kojeisto.oy:lle.on.laadittu.ymp
80,266,195 *088F8FCD26FEF623F0A1B8DA51D5960CB887A09E [email protected]
80,266,196 *0886CB6FA5B15788AFB153DF677394EBEBC8277F RPATRICIA2
80,266,197 *088299B091C8AE2A56B35D99C3551E14567095A5 LAVERNE.DEMALLIE
80,266,198 *0887A05283849FC04C5DFFF284EB7834AB64883B laylasini
80,266,199 *0881A79B12009B1C9AA955B4AB0888A9A0207537 [email protected]
80,266,200 *0889709195E7A5B8F88AD1A640A9935B373D7C38 ;).O~.0~Q==8
80,266,201 *088FB0ADE6D316192BFD162AF29226882647C1FD [email protected]
80,266,202 *08889719E94E0F618D11FF9D9FF164DE3EA96BEC LEANDRO.ZIMIT
80,266,203 *088F783628CF9C6BE501FD406C1D34709B69405F 2684265 n
80,266,204 *08860ECCCAC6ECDC93C8B21F0A0579F82AE4DFBB 26JUN1916
80,266,205 *088E6EC52F540A7DFD8E901B654AEB6AEF41F96B lei-bernabe
80,266,206 *088C31396622E768ADBFAE46525C49B436526635 RUSFILM
80,266,207 *08825301516747674546859E638BDEE746BA65EA RUSTBEHANDLENDES8
80,266,208 *08879BBD62A34BC5AB571AF9E59F3D74EE1B101C RWAMUCYOG
80,266,209 *08864BDA070ED396E1E9F775669D2103D9561DF8 s0d0mt3s
80,266,210 *0889E04588A37AFEDE56F453A7C9B0EAAD121E5A leptosiphonandrosaceus
80,266,211 *08807D0E387E84198C5554D50C4A6DD3694697DA OMENJOUD9
80,266,212 *088E3234B1BD44846E7F34DD68C1CF5070B358CA ONGELIJMDS
80,266,213 *0887728C60206904F1EE2A343584C9F94FC9815C Like.A.River.Glorious
80,266,214 *088C92B8FBEB444850565B1C6585D0974AF20D96 [email protected]
80,266,215 *08820682F5F53619408D8D1A06E6A320793DAE58 LINEMILLYK
80,266,216 *08807E7290B308C49DF34DE61372291B7116CC96 2 VIESTIANKKURINA
80,266,217 *088ECA56095F9B944D6DD8BBA074213BA1E7A0FC SARAH VANLANDINGHAM
80,266,218 *08829975216CFBC488076EF3A3441729CFD9BCBA 307ZACHARY
80,266,219 *08848C7D66725C8D6DA5483557F57B15E2D50F26 OTHERCENTRIC
80,266,220 *0889CCA59087D1891C19F0E60F0214C1FD6745E1 [email protected] ~0 ~o splat
80,266,221 *08855AA530C3755085763B1FB54E19F62B4EB64D LIUXUHONG
80,266,222 *088B40B590A0B1E35B8F0C8B5AE7DFC592CA1C59 OVERLIE4
80,266,223 *088F070AFBB3D0071984771D932A953931E266A6 LIZZY03:SEXY
80,266,224 *08850DA0FCD00EFE9786D2428C8309204AB30980 SCHIPITSCH
80,266,225 *088D27A25945CC4AB8A1ECA1AFBF4D397E151532 OZB
80,266,226 *088197390D8411B540477AB16D2FB13922265884 [email protected]
80,266,227 *08847524869AFC6C235A811052DDF42974744527 lonchicca
80,266,228 *0885A7C8BE2B1AA07299D715F71D6A35558BF9C8 LONG.WHIDBY
80,266,229 *0885A9DA4C48316F2BEE983461A948B4DFE12C1B LON.HOGLUND
80,266,230 *088FE33996C20039F0C54FB258289C5EFA7E5B8D SCORPIONFOOL7
80,266,231 *0888B83AB598230CD49888D86DA93A755AEC7067 P4L430G3N3
80,266,232 *0881D665A6580175FC44228D3768ABC7058D07EF 3======B.`.)O(
80,266,233 *0884AF86CF0712A14299D26DC4D77E772560825C 3.KUBOTA
80,266,234 *088003DD6BB2C80879BA27F8CA913401A43BCD96 lorengaestel
80,266,235 *088E30804C5DA1FA80B8F853CF80DF0846447A1D LOUISVECCHIONE
80,266,236 *088AC80B8D6B3B1875E215A95863EB65C7C143E7 love.of.a.girl.and.a.bear
80,266,237 *0884B5FAAA21E188A1E68AE2A3FF4A7CD096B80A 3-TEKNISLUOTEISIA
80,266,238 *088EBB3098AC84C02B809AF3D5669F47CEB11694 lows..Section.B.3.discusses.some.considerations.for.properly
80,266,239 *0881DB6BE05A0EA89CE96807BBA58CFAE9F952B4 3THUNDERBIRD1
80,266,240 *0884AEE71BE7DD22E60C7974C923CD267C3D41AF parallelith4
80,266,241 *0889A026D4E1452292BE145F98F53A92F3F5F5E1 [email protected]
80,266,242 *088A03BE65AED9ECCFC16C1B53A95241779C77E1 3ZESSIVAR
80,266,243 *08845A18DC727B1B2049445E172BE6AF4B24CA33 lucia.varela
80,266,244 *088F33BD5297F34E7F1E84576C1E2A839A049B45 lucienfraiser
80,266,245 *08855CED80A38EE00A5E3A7CB7569ABDEEB35B01 [email protected]
80,266,246 *088170C04494253D9D08F48009ED4AF68B59C126 SENITERIAN
80,266,247 *08815EAE2CA0EF28E067A4F906FDF5D47AB9E67C lutareis
80,266,248 *0882F89007A98C600C7E0432AA77E9C1633335C3 LWILKINSOJ
80,266,249 *088471974EE4C1281186581A9422BE01D27834D4 PBU|
80,266,250 *088AC7D83EE44B309498550AD07A6A0B2BE7C93C 4IAMBLUEFISH4
80,266,251 *0887C9D7BFFD98FF19A83A99B34230434DDE5E05 4K6D
80,266,252 *0883FCA5F93E434CAC6D68364A5A44AEBC351CA8 perichaete4
80,266,253 *0888FCC70581B1CE805FA915A346D54BB4F6EE17 4M31G4RLH35
80,266,254 *0883663DE3D8BAF6BB5F506BB8FF3EE37EBFE9C5 MACK.POLAN
80,266,255 *08853F6E73AA3918A65B23CE81E43CD9B23EE36E SHAUN.CAMBERO
80,266,256 *08895C1AB549A7A34E639B3932485C5BC9A9A716 4POCHLEBCA
80,266,257 *088F1DD656473F27CA7992A870F7B53AF927E89F PEY:
80,266,258 *0889ADE6BF7D4C8181D440FCC25562B93853B84E 4SARAPLA
80,266,259 *088E4B0410E86EAAF3F7177A528C9F73E6CCE1FF sheltering
80,266,260 *088A7EA44971ACD68D7CBBF5EE0631D2D53B3323 4TNECNIOCED
80,266,261 *08808E35BC09513C09462EEECA5E5A243C76B36F shewers
80,266,262 *088B056CD953563992F5D6EA6404FDEB0CE90E0F 4VAIJAYANTI
80,266,263 *0881AF5291E53D0E39C0232DAD0FFD632BB739A4 MANOCHAL7
80,266,264 *088B0986E3576E2CD65115C863B26B3EE81CD93F MANU72RM38
80,266,265 *0889982F30C3C1B7E25D8CEF96DC38D002FC3151 5: 5 -# -& VERDI
80,266,266 *0889711B20CDE6F9187B1D14D332887AA9531A5F 588MESSIAH
80,266,267 *0887E4D8B7CD0A5D10C20D57129D7A022CDED65B marcelkarney
80,266,268 *08870C6207AC3DAA0B5C2B82B4EBFD25D46D3430 5birkenstrasse
80,266,269 *088C20C233F7ABC901AFA3EBAD3FDD9777CCDE48 5BSWCOMMUNIDAD
80,266,270 *0883F4F58CACE6FBE35354B89A5B92332AFD0ABE PIRKENANDA
80,266,271 *0884052B27B684DC51D6C5B37FB02DD8A3802D70 MARC.INTRIAGO
80,266,272 *088095F0ECB7B28C71507C312EF466704C63FA7B PLAYTHINGSPAST
80,266,273 *088C068A59F4D8203A63D1281F6AF01B95C9E8BE SJERP0
80,266,274 *08821DC4492B84E65EB0B1C844FD681655D7619C 5IDRIFTSTTELSERNES
80,266,275 *0887D8BFCA79A71876693C283007141D2ACA8999 SKRUTSKIES
80,266,276 *088EB64FD5100346B1CF9090E6866ADC197B08B5 5KAOLINISATIONN
80,266,277 *08819E64E06003B2A6A26A91154C5121C20EE38F politbureauet
80,266,278 *088EBD0E017835C9F53191104F22C2C1125E9CFB SLICK.MIKE
80,266,279 *088A8296D3117985FE332A641D4685D93808AC0A [email protected]
80,266,280 *088A224E11A4E1F1F7B0632A5FE8A4EEF425D42F PONKARAN
80,266,281 *088AEED996BBB80D367CD6EED5BD1FF78082107A SLUIPWES3
80,266,282 *0888A956616B009C1D6DE9D005133D2AD31589A9 poohv:poohedpoohingpoohs
80,266,283 *088AA08EF40F99D8326C5FE0B5E6737A9A091B9D SMALLYA.BBS
80,266,284 *088E0FF353B66AD55323A8F577A6FCA67A868002 POPOOLAOLABISI
80,266,285 *088F01C4BB2D00CBFDACA44EAD24454874B681E4 MARY CRADDOCK
80,266,286 *088C3D34720C67D1FCF48444DF46B1AF551DD077 MARYMAYG
80,266,287 *0883EA9B80A61AE29609B8161EA02DFF4F684FFB smnlvngn5
80,266,288 *088CF021D6643B6A7E3F278CD073B04E053C1EAA MASON.CHESSMAN
80,266,289 *0884C2467C588DB67CE89E741BA1E0D875AC62C1 SNOOPDOGLADY
80,266,290 *088EBE530A5AC424AA7EB30E5684AD465D6E645D PP* * *(_0)
80,266,291 *08816FF2C26D3DB9083A4B967926598E7719AC56 5SERGEILINDSAY
80,266,292 *08898AF1DACE7443D98E1082F86A1A0B6A93131D 5SETAPNOT
80,266,293 *08807D4AF47CEC79DD22244EFABA2D7FD87F3D86 P=====p~O~osplat!!
80,266,294 *088F08988CAC0A1B11353D331A85A3E88B4459D8 sofuku
80,266,295 *088A7FB35EC517524C2DFFC973505BA05B91B6E7 5UUYKUUYS
80,266,296 *0884DF1D23DA321FA8562E692F93691A8111E621 [email protected]
80,266,297 *088D34615BC79E2871BB11E02BC4A6CB1387C2D1 maya.bohra
80,266,298 *088E6715D56E23020921150AA0A4BA1A1D067DFC [email protected]
80,266,299 *088DA116BA158F729B833FD6CC67D91E2626384B SonofAnthonyQuinn
80,266,300 *08876B19D223379541FE4B067574E0606439E314 64703 istanbul.l976..
80,266,301 *088482285329DAB21C331C31E47CDFC3FAA22F28 SovielLiebeLebtinDir
80,266,302 *088A701939EA190BAF0B788EF100BD2936E6BC2B memye
80,266,303 *088120978941EC0FDAAE8D36049FEA4926A8C6BB PRZESTRZEG
80,266,304 *088FB828BDA2B7D8E7CE9BE656E8BA213A13AF04 SPIRALZZS
80,266,305 *088C9ACEF4F83C1D64E95BC16B6EF5ADBA4EA162 p> ~ ` sploit
80,266,306 *08898A1E1D98B905A517D256E9CBB56AB87B1DB0 SPLAT.`D=====8
80,266,307 *0889C1CABD5CDB6BDB333C9F6F07B9C2F75AD50B 6-dayansin
80,266,308 *08867CA086652E129E0585C6F8D3021A97682DE6 PURNIMA PARASHAR
80,266,309 *0889C76F99A4040E319D2F550D41F07D6C6DFEA8 splato~o~ (===b
80,266,310 *08886500FFEAC506CDA5B544685D7A0261113C80 SPORTSSHIRTS7
80,266,311 *088E6D819D76FB441B7B33C7C32834C1BE636BE1 SPORTSVOLLEYB?
80,266,312 *0885FED6B35B61F26D8C4DCA323E832C38A040BE [email protected]
80,266,313 *088CAD9E61CD5900A0381493ADBAB820651F6774 6HAMPURILAISPAPEREISTA
80,266,314 *0880BA95686AA64E6012319F2C9665D049EBB841 6HEMIOPE
80,266,315 *088107FC87FBBA24BA10FAEEEFAA98FEA90421F6 QATTAWIYA
80,266,316 *0882AB87FD64934A12D4E98600C4EFA310E26AE0 SREGDOOMS
80,266,317 *088707E81D33E217625F85FE98014CAD64231FC4 SREKCINSROJAM
80,266,318 *088F5E70DCEF97F8F911C689E67431A349334B70 q==b.~0.~o(0-0)
80,266,319 *0887AC7F55F84E36160C4924FD0134A6E9CBBD0B michaellatiker
80,266,320 *0884A0968B9C86DBC6BB65B18FE6BF260BBB371C SRIVEM
80,266,321 *088C11CF1C15161593E554CF4FABF7B89688F51D q======d~o.~o(-_0)
80,266,322 *08821A60E82F445E40230E06A19B786EAE74C32A SSESIHYM.
80,266,323 *088BD2EFF5F8F56CB30B5D777725F0AA421BF4AB STACEYLEENEL
80,266,324 *08847CA1AB853E79A9ADEF16B360F77956DA68C6 STAFFMANN
80,266,325 *08822A3AF99781827A738E1A9D1130852F682DD9 q==)~.`.splat!
80,266,326 *0881909CFA4C84CFF39ADC7B49AD276B44EF4CA9 Q======>~-SPLAT
80,266,327 *08844DD89DF8C434977740FC91A33B11A09105F8 STARTBAANS5
80,266,328 *0883BCBCC46B6221B37A8752852FFFFE5A726404 MICKEYABINA
80,266,329 *0888972C77431DFD6F79FCB7C152BC9051EC87FB STAUNCING
80,266,330 *0884DFE090D84F1A74068F45093AC9FF2E189A52 6OSSNOMIS
80,266,331 *0888AB0AF79228AC6FDE33808BAF8B8BC21534B9 STEIFIGKEITSBERECHNUNGEN
80,266,332 *088A06930D53E5F04A2460E554D757F44DD4B258 QWASZXBASKETBA
80,266,333 *088256C4B12296EF886B4F3BDB809AFFA7331889 RACHEL-TELFORD
80,266,334 *0885A8DED06AF64C1D06D2878B894A2310521AB1 MIMEOEDS6
80,266,335 *088D5845CD7C961D2F679EE63FD8FBDFDCF44A7F radiologyuthscsaedu
80,266,336 *08810D0E32375B368A6712B7214CB38126E8B7D3 steve.rodham
80,266,337 *088EED8DBED7AC0E810021D1C0AAC31C72CB5F9E rafidhashim
80,266,338 *0885966A81A7671EB00E5080176F4D999B25EB74 [email protected]
80,266,339 *0883D16299CC044E5D2DA29B3B1E6A81C7F75F25 mi-otra-mitad
80,266,340 *088B5A9406890979AC80F0459DBB7A5DC5F6B5E8 MITTEILT1
80,266,341 *088D4B205299A0D7DC8ACFAD2995D574E38A72C0 7232598k
80,266,342 *088025845601468FE7672D74FA2F328FEA88E38F M#M
80,266,343 *08870A9285610D4475ABD10EED35E1D14EB16BD8 mnpwcgi32
80,266,344 *0886C9834C5EF64376C50B018DEC9858674478D4 RAY502
80,266,345 *088302F45E377E98A93E17DDADC71F49C58278DD SUBACADEMIC3
80,266,346 *088EF3D8352A974E8590A0A6FECF55F4CB8AF273 7BSWTALLYARRAYBSW
80,266,347 *0889B9222AE76C58071BF9C8EE7436359F3B88D6 7CHANTIST
80,266,348 *0887E4001F8FB0D6D88BA78E4FD2BD9A332491DE 7DANIESHA
80,266,349 *08866D0EE170DF64D6CC533514C4B98FA8FE8C8D monkeyfeet/friendlydestroyer,part1
80,266,350 *08837B2756A898949E3CB9A46DA68B08BC7D4BD9 moonroxied
80,266,351 *088D536CAEFB8D2A372C173776450C84E816F268 7GRJSHRGST
80,266,352 *088399540241454AF413F0C0BB477568988592BE SUOBLUB2
80,266,353 *0889ACF9E1505A90EF1EBD6B8F24D159D9A3C5A5 7ILOVESWEETPEA4
80,266,354 *088F656C354639D6C98E67B8DA3CB66716A0FEB6 7ISLANDKNIGHTS
80,266,355 *0888D7BAAAECF3CC79FA2BA21533F85F765AD336 REFEOHRED
80,266,356 *088A9103E85324540C2D136347829314EF54CAF7 surmount.s/@/r'm/au/nt
80,266,357 *088F93FE9C27BF7D88B74F2C5E16275F134FD38D MOUSEDOC3
80,266,358 *0887E45C1878662846D5695837491D8016C2E0F8 MOWHERE
80,266,359 *0881436F87FDF58B3E9524B04829D5B9AF7D5598 mrityunjoybiswas
80,266,360 *088E16F0FFD5EBA38B93A3A2B309D52FB5E9EC76 MSHEINBAUM
80,266,361 *08818C0B02B639A59C5379E3B482F5C1C8DBBD14 7NIKISOLEIL
80,266,362 *0887969A6575C9DFF7B0E21B826A1BEBC095622C [email protected]
80,266,363 *0887C5C14BE9F2AD7AC4110AEBB3C1910C39A396 7OMEFTSOP
80,266,364 *08858B75332A9D9A0E41B014DBBBF326405EF139 SYMPAATTISESTI8
80,266,365 *08899A796B5F82FCD0EA8EC3C84E6D6ABA6A0ABB MUCHUCA
80,266,366 *088803DBE89C6790C21D427744B3A1C20C118A82 SYNHGEIRE6
80,266,367 *08829DBE6AB5CB92FA0C3D8EDC138B2DCC96DDA7 RENALDOHERONEMUS
80,266,368 *088F21F3541AE603854BBE67EC98DD9EFFCFCDF1 T0X3M!4S
80,266,369 *0883EBAF31299CFA68D04AFD42474E1D4BB4BEC7 TAKING.ACTION.2
80,266,370 *0881E5E2B09090618F57FE7033B24F1A98ED7853 RETNINGSANVISNINGER
80,266,371 *088DAB6F6A4D7BBB67B19757382CDFA449697909 RETUNGMETALFORURENING
80,266,372 *08804F70CE49E80DDC8CEF679DA97AEC01FF0D82 7SETOACAC
80,266,373 *088D1CEDA872B569E4E816F296AA7271D16C6451 REVIEW--JERICHO-EPISODE-TWO-CONDOR
80,266,374 *088854040244F68D30C83F0C6CBCB255E851BE71 REZIPROZITÄTSGESETZ“
80,266,375 *088A4527885A1B6EA445283FD450EF087E164C5C RFINNKIL6
80,266,376 *088664E31AD403588C45CBD1A7AA593CAD08B2E1 TAMTELFER
80,266,377 *0881942A9C8CFBC56133A6CF63FD2E074079725E 7uglified
80,266,378 *0880F90B98C984048577F0CA86CE9E0921CA2624 7verzetsgroep
80,266,379 *088424E2D7735BC3869F97CE6449212591AD7E56 80ALISSON
80,266,380 *08806514195232292A08B401A65DB540E79F5FF4 N38=AUTO AWAY
80,266,381 *08835B9491DBC4C3436FF66E55528676B8004FC3 882461 lupon alue on ainakin aloituksen perusteella k
80,266,382 *088D1C6D401B8F0EE57FF8B3405452E7F1274C12 T+DBAA
80,266,383 *088486829B77F09FDC1BC2E800D7A7A8CD22F6CD righbsw2
80,266,384 *0882851137B9D5A2959144D973D2D56B3C3721D6 8--B * SPLAT
80,266,385 *08879BDEF0427687FAAF255CF77EA4DA80B5B137 TELECOM-CARRIERS-CDNS
80,266,386 *088D44748EB1C0A53CD5B73998C247F96909DAAE RIVOT.RAKIT
80,266,387 *0888F1F2912633099CAC04770AC24F50106F807D TENAMADDEN
80,266,388 *088978C44A890903EFC370E0D2C04192857BC97F TENICHLA4
80,266,389 *0884BC544F8F30BE06B6EB5CA1B3E793B4151C4F ROBBYFIDSKY
80,266,390 *088DC68B1320C8387F1B12912AE784CCCAB11E08 NATHANIALDAHLGREN
80,266,391 *088F97C86BB7A46CA680787C51EC2673FF20EE4E NATHANIELSTACKER
80,266,392 *08811253EB321970BC5BECA8560B4022CB067104 NAUTICALFX
80,266,393 *088C8D9CE4C684F2434DC207F866F4E2F496899C 8EARTHNUTN
80,266,394 *088B726D7ED16C37C52FE67FB322B0260504B378 naz.king
80,266,395 *0886EFD895A58CE33C82079D39A51481B19D210C terrencegiedlin
80,266,396 *088FD586FB765B00682939D204B4D532E68D108D ROBIN.SAMPANG
80,266,397 *08819AACC32509A489D8A966873806FEA72DFBD5 8GREGDYLAN
80,266,398 *08848A5E5E9AF24FAF1DCAEA3D489A7C60F98565 NE907A70N$
80,266,399 *088663AD79BA623B93357D1D8F8AE90BF89F2E29 8HPBIDMEU
80,266,400 *088D5738872AEA7ABF5205E9F251BFBD223A3916 ROCK-THE-BREAK-UP
80,266,401 *088DBB35FF1961D38863EF52B2079D9B62772277 8INTROSPECTINGS
80,266,402 *088B4B9777D689DD477E4A2474151B8E8504B4AE ne-i-"ah!-mon-dieu!-c'est-vous,-mon-p
80,266,403 *088C0A18E14C00905B299D49DA4481A2A22F697C [email protected]
80,266,404 *08841E0B3574C3ED43E82F9416CB3F7C4834FFFC 8LLBTTWJDCY
80,266,405 *08883E50A3CAB49351B0A68E0D8758FF445B79F4 RODRICKMESSEY
80,266,406 *088D84427D2262EBE341E2D2E8D08617742D61E3 NEPPELL
80,266,407 *08803781ADB58CFBB12DC93D460EAE84072D5BD6 [email protected]
80,266,408 *088717E953B688E5E849D6CEA945E9F265262C84 THATLIMA22
80,266,409 *08827A37BA433FE4B943C605FE533BB34A40F493 newuserdelta
80,266,410 *08808B43A813E8B87B2EF90E44A21DCE683F30FC NG+N
80,266,411 *088D46C1AC6EDA5B1BBEF90322BB101CC050197B THE.CHAOS.IN.ORDER
80,266,412 *088C9AA7CA3A038CCDCBCF1DA1AB7ED2C2A6AA24 ROSARIOREITZES
80,266,413 *088D15F1F351117E4168E9BCD0668DEE3A007647 TheHistoryofSpaceAgePop,Volume1:MelodiesandMischief
80,266,414 *0889A1F494342955CF50F02B84BB5955A17EA40F ROTISHA2
80,266,415 *08858620E47E8E6C97E1BE35925E106AA25258F0 NM1087183
80,266,416 *088FBF48B482F0CD81BFC86DCDA98A057E9C0770 NM1832283
80,266,417 *088F50B08D4714D2D02F41B3E18631E5D7E58D90 THERMOGENY!
80,266,418 *0886A894A0EAEEBE0295B06E10DA8FAA67A1D654 no.16inaminor
80,266,419 *088A6F4C7C672B4C339695C260A8B7B745A45050 965DANIELLE
80,266,420 *088B55D7B8F9ABFB0E99E50642C7D0A6746C4DB7 965elyse
80,266,421 *088F8B6A0DAE816111FC6C02AD9A2C7F42338794 THGIRBGNIHSAMS
80,266,422 *08807E70A91C8D495AA1A25A42B7082F3112B2A7 RUPERT.LIPS
80,266,423 *08867EE0475EDCFB66E660906EA3E93E88A816C0 9arrears
80,266,424 *08873104D31F68D4931A82BCE7CAE883420B7AC0 norhayati.ishak.yatie
80,266,425 *088D30FE1DDA3DE4CEDD9FF6DFB96825A0C07575 normandwhitebread
80,266,426 *088848CA86194CB11EBFB8F26A4E6B2930ACD60C THOMASDEGIDIO
80,266,427 *0882908141B73A8F78FB6F486E0E996691C8882A 9CHLOREMI
80,266,428 *088A32CFB13A4F342FF1DA39E0D290E1E6C71A56 russlowden
80,266,429 *088EEEF84343533FC31C3A27F502B9F1DCF7DFBA [email protected]
80,266,430 *0880CFB19DFE82437E08AEE1A9500B2CEEAF615F RZNSTKJS7
80,266,431 *088C48497FCE5D84B44C46908C3833FF4A6F1058 TIEYSHAHS
80,266,432 *088C8D54EA5384C375ACB0E05991920A447474DC 9GORAAAAIBAJ
80,266,433 *088A5DF3EF0D62FBD39320B353AFA9E20E70E3DF 9IFTWANZE
80,266,434 *088393EABF78F0F1B57EF164106204851694F1AA 9IIREEKSI
80,266,435 *088AC329315483E5810039429B6DF13E340D04F4 9INSANEAMOUR
80,266,436 *0881B725217F2EF177AB4524A8A70EE9DF0696D2 NZEKIB
80,266,437 *08833ED2CCD299CFE2032E8699E83A9DF0232819 o!1!ne55
80,266,438 *088C3C611F8D347B450EDBC680A8B3DAF69BEA84 SALLY.SALLEE
80,266,439 *088E5126CD218745D7D273F536F28D0CB67D86A5 SALTESORO
80,266,440 *088315B1673C84D375A502CE318DA864205AA530 salvatoreocean
80,266,441 *0882D3017BF9911B7C3645423FE344B725FCB20A samiksha-adhikari
80,266,442 *088B911439A327CF361218C63A074AF03256842E SAMPSONREBELS
80,266,443 *088E8C97F855FC89AB3DEBF590A31BBE6C640F6D 9NONAVOIDABLIES
80,266,444 *088287736D06CA238D69F9B2C03EAAAB85DEAB42 TLFHLFZSPKONUS
80,266,445 *088E62EAA44046B9C818DED35E2CE499F782DCC9 9OMITTANCE
80,266,446 *088D8C141F7BD6970D8EEC4890F3538F5312FA72 [email protected]
80,266,447 *088CB6F565C20F417569128DA23B7A92569C4AA8 9PEOPLECOLORADO
80,266,448 *088688B6092C76B1C6392DA3FAEF3F518DCA41CE TNELAVIU7
80,266,449 *088756BE159F58B932D07FE4EB46D57A7E785195 sanusi-mohammed
80,266,450 *088F40CB098DE50D9F3BA1598B970A158F2667B1 OFICERSPUNDER
80,266,451 *088C728184060A5CC840D7162BF6A8EB8153AF10 OILY-YOU
80,266,452 *088EBC9C093A56ACAEFBE34B10D4843323EACB10 todafton
80,266,453 *088A39BED80ADF0EC4CB60762D4EF7CC2CCC43A5 SAVNINGS1
80,266,454 *0882D1D06A3FABD9010A9B5228E3B1F50DA9EFAB a0atd
80,266,455 *088040E461BF46C46F4CB2FF3A68C1459BE40DDA o><o~ dB
80,266,456 *088D6DA687A79239F0DFB26F88622D27033200D4 TooLowforZero
80,266,457 *088C04467362E635AF63E5017D9ADF13BD3AB3C9 toryamento
80,266,458 *0883F38D831B23077901D2751393EAFC8E775F3B a5k:a
80,266,459 *088B3E432FB04BE5C8536613A872849E4235B779 OPUSDOMINESATANUS
80,266,460 *0881E538D3F94744013702ACB80536A3F25F275F A6GR(
80,266,461 *0880F094E9931A32443D9696439940D4A00C2C13 OSCAR.NOSTRO
80,266,462 *0883E47851F9320F1A339C53E384A150A5ADDD52 secrettiffany
80,266,463 *088CA628888F80E4B452DA17D144DFB04FDC6754 [email protected]
80,266,464 *088C943031E841CAB95D46FFBA5294CE7BBCC888 [email protected]
80,266,465 *0889E8120F005B38E5E8DDDD9CF78B2984E3356D travisleibert
80,266,466 *088B849BD63B17CCDC26D59E13B1B395F895FAFC aad[a
80,266,467 *088537CF831EC429C641E9856DBEA09766A20138 SENORIO DE HUETORT
80,266,468 *088099837FF1B0C6E7BA8CFEF4C53C7565965D5E TREVOR.BOTTOLENE
80,266,469 *0880F9E541EE30D9B5F1BDEB94810D276207F5A8 TREVORHARVATH
80,266,470 *088EE258404FEBC175501E973C6D88661AD854D4 P1URIPOTENT
80,266,471 *088EF282841BB33D91C0067D45455E366F614408 SEPIKMAD4
80,266,472 *0880B02CF85D7CA39A749B5AB4EDDA8B53040562 sergeiprokofiev/fourtalesofagrandmother,op31-4sostenuto
80,266,473 *08866DFEE2C86F157737FD10FAC23B479FCB2766 aa/)k
80,266,474 *088D2C233CEF7D47CFDD0ECC4BFD3E689199D14A a:amo
80,266,475 *08856C9E32AA64010871F2C154FA843AFE81840C TRISTAN.KELSHEIMER
80,266,476 *0880EC73C26EC2E86E00D1CFEE9872589EDD61C6 sex.and.the.drifter
80,266,477 *0889BD6B29691D41994854F0AF7DA356C24911B4 abapxmou8
80,266,478 *0880B843B4D288DCC9A0A5A6DC5BA8CACA0CA3B0 SHARON FAIRBAIRN
80,266,479 *088064012CBBAC24DB104B14D9E8E50B81660391 ABIQUIU9
80,266,480 *0881AE22D4707C071C4B5C4F0FF79D4E8555A1DF SHAYEK.RAHMAN
80,266,481 *0882E278A352C2A3298A679F8982E04DC05E6CC5 TUIVIQTUIVIQ
80,266,482 *0884E20BB9B39C09A8C4E607990738E0628FE959 TUJULAKU
80,266,483 *08841B503726549F7393F1C567A344C0FD898747 SHELDON.LEFAVER
80,266,484 *088FD159DA21D6000B6EE5CDFD115D061151AD5C SHELLEYCELICA
80,266,485 *0886106CAC8E489276004050ABFC863D95402605 paradiso:.canto.xxiv
80,266,486 *088C3953454131F45011BEBA3BA44040D256285A a#bxb
80,266,487 *088FA5303FDA9E5AF348EEE3B685F3F4DD647D95 PARMARTHIK
80,266,488 *0888FA0812A4836FE8B809C8272293EBFF32A3E9 [email protected]
80,266,489 *0887A7B06AE1660FDD2904D8979728A30FB3D1C4 SHINDIGGERY8
80,266,490 *0880461903764620DEFF13694DE7CBCCE79E63E4 ACARAMETA
80,266,491 *0882DA1C8A2D9672ED5009248AB54A186E26F177 achromia8
80,266,492 *08864BD69A679231EFB39E5828C6F97A41EF69E1 tyler.panasewicz
80,266,493 *0880E1C3903CD96934713E3F041E379F2FF5AFCD ADAM.FRAZIER
80,266,494 *088D05BCCC33CA97CF1B705CFACE3BE1ADD34FDA U14082
80,266,495 *0884058871295568F162FF13BC8BBBD168A7B716 SILIC0TUNGST4TE
80,266,496 *08874252B1B0754544EA94C57847E3B99AF68AEA UAZ.PATRIOT
80,266,497 *088CD84D1545FDBB2CABB5EC565178A43FD2831B SILVIA MERAZ
80,266,498 *0886E3E037EC146B0F3BA33EC4AB668138BB03EC paul.smyers
80,266,499 *0883448D6E6B4FAA625EF6837C778C7E9BEF4B54 adorerns
80,266,500 *088E97EE9FC7DA6492CB47771E62BC1E2BDF8540 p===d~`(>-<)
80,266,501 *088CF36C6DBA764B9F93DF45DA4510838C79B377 AFBYTING9
80,266,502 *088EBD0890D70FA3DB319ADF2482F7B2D7CE8711 [email protected]
80,266,503 *088614616809E9796990B9E6987461495BA9C6F0 UMSCHULENDE
80,266,504 *08867801ADE0A7161BEA5B6E355F705A71D7B96D PERILUNE
80,266,505 *08865DB70CC1773AA2AA20AFFDBBDBD37D817C75 PETATOGS7
80,266,506 *088E3AC04AFB756FFE4E4032893E7C7D4FE59604 peterborongt
80,266,507 *08831D8523FEDB7063E03D5C08551E3D93D7E810 un-finished...(s.e.)
80,266,508 *088E2B7642AD007F733452566F066101E25D1E3F PETERLEANZA
80,266,509 *0884AE0C141A3D58CFCF69C78F5DB0513622BE25 UNHEALTHSOMENESSES3
80,266,510 *088A59D22F6864E42FD7FDDC0B86FEABD9DA5586 [email protected]
80,266,511 *088840501285224A4E5448D6D69AF414229F2647 AGUSTIN.SEAGRAVES
80,266,512 *0883B81A805CA0BEF5B191E65AD7EFE9387F486B SNST-R
80,266,513 *088F88B0687575563E9DA55D21C9AFC51C510019 [email protected]
80,266,514 *0880B67FA8D483A93C73B426BD3F44D188409BFA A HA SIDO
80,266,515 *08823A6167BAD23D807389BA3FB61219C6AA5905 SOFTWAREVERSION!
80,266,516 *088288D22F20C7A939B2EBC0BBC5508697505F28 soldrumgoole
80,266,517 *08892F4029325ECFBA49FA222B2656881C12D096 SOL.ECHEVERRY
80,266,518 *088019B9E85F3708D06A76BB5CDC889EF5071D1E UNTRANSLATABLENESSES1
80,266,519 *088C0FD7D304683E1EB38995859802F89E40C42F phillip.tabb
80,266,520 *088920CACCA693F9B4FE3D83C156B0545A1CA58A [email protected]
80,266,521 *0889BA74112DA4CDCD108548C3892F8AAA283AE2 SONIA-BARRETT
80,266,522 *0885730533C3052143454671D6A726DE7ACC1584 AhV0
80,266,523 *0889DE018D1236F4AF37890C38E3C18DC4B80F4B aia9
80,266,524 *0880076C9467888F4970894C1F98470FED94979A planta.de.enereg
80,266,525 *08804F9FB09DDC7CBAFA11E2C6BB032A202C89C4 ail._
80,266,526 *088D77F766C1C392CF1ECEA4BE48E3F004640660 SPEEDOHOLA
80,266,527 *088FF3B9C048B906CE81BF00C5FCA441D84DC06E UUO~ 0~ <-3
80,266,528 *088FC8D582F460E323509BA8A045B548E84DEF98 UW-1UMPY
80,266,529 *08864FEDA56D55076F55308D3D9725E0AF90E9B1 [email protected]
80,266,530 *088B829F864634D93098E75182DC715F97368D94 uy8
80,266,531 *088FA2401C0EF9C4361402CFFA88925DD136A58A SPLAT!!-0~<-----P
80,266,532 *08891C2126444DFB151E995118F8558A04C3BFF8 VALENTINE.LAKY
80,266,533 *088530CA06CBBC7B2F34E3213412CF39E5073B9F valentinstinehelfer
80,266,534 *088A49F061FA2B0671D86B4E2C77C2E2C8C7C014 POOCHESPUW1CHIH0Z
80,266,535 *08887AD4759CE8CE39E3C67A352C9324D99E5B99 al5e2
80,266,536 *0883027BD98EAC80356601605CB5A4F054F50D5D POPUNJAVAJI
80,266,537 *0881887AA96C8A5238FDF62F3A937F3BA744C01C S<QM
80,266,538 *088537E8A5E33CC8444CCF8A12D805B24384CEDE SREMMADR
80,266,539 *08879452FF01327DB8817D3364F179B1C615D78B alfredtalvy
80,266,540 *08840B4EDD31C369AF11E25B05F9DFD23EA840DA ALFTRED6
80,266,541 *088215348FBB10E5C21C18E15BA6AD8087904C58 srh.nd.rs.mv.rpdly.thrgh.th.smk.
80,266,542 *0887D6E19E7308C0673A1A3B1F54385B505F8D31 ALGOPHIL4
80,266,543 *088BE8C9429560864273D8149BFC4065E986C879 VENVEN.ABDULCARIM
80,266,544 *088B4F797BB33FB82A06FC5A8F00BA1FFFEA2888 VERLUSTBEHAFTET/A
80,266,545 *0889665543A6DE7C2C56A3B1D6BA955B143CF93F STACYOSENDORF
80,266,546 *0882D01A82E3C80AA5A3C1CC2BB05575C3771849 vestalreview
80,266,547 *0883EF49BB471556A8DC3950A4658C7BF119A391 VGNENDING
80,266,548 *088100557C7064D00608B87494472DFB88B659C4 VIAN-JRS-SBY
80,266,549 *08893107F760804A24423E8F402AD7D2EF5B5CAA STANFORD.HABBYSHAW
80,266,550 *088470C88BF4E7C4CBFFD9A2877FA653180CA726 VICTORIAJONESVINES
80,266,551 *088B188298827B91B96C88BEF91C78F43548C896 STANLEYNIEDZWIECKI
80,266,552 *08899D4DAB72BF26582DC078E1C399E4F3FF5C61 VICTOR.SANDBERG
80,266,553 *088338B6141383C6CCA2937EE84C9BC2AF1585E6 PROFUMIAMO
80,266,554 *088815CC5D26024231E8891DF9252A21C2396BC4 VILLINLAENNENKYLAENSES
80,266,555 *088B91ADA8588096258CE6B113B7F24CA5187498 proteus .....nor.i.
80,266,556 *0884702250FF27CCD304854215CFFF910EE13003 PROVIDAE
80,266,557 *088302C37B7D770DFE0018688C2509B25C86BD5B VINCEMASCIANTONIO
80,266,558 *0881941E8DA07008A3411FF381B460721215D15F AMANDA-HOWTON
80,266,559 *088D146115EC255DE62F991A9BB4A091305F7481 AMANDA.WESTON
80,266,560 *088F6DB581BA7B1EEB1C98634781C7EAFBF2000E AMATAZZ
80,266,561 *0880DE1094E09698425DEC90E1DACA6D5E17FA8B [email protected]
80,266,562 *088CD2D738C64A7697E90F44EE35A46D3CF202C3 AMBULANSETJENESTER
80,266,563 *088209AB72664C70E6A6A8A92074F423448E4D75 PUNANDU-LE
80,266,564 *0886B66A3FB4945456D158F4864A683FB41B5DBC STRACOCETE
80,266,565 *08862DA25A42DB8CE00686EDA7FCFD6B2253AF26 STUTTGARTS DEFENSIVE - EIN ROTLICHTMILIEU
80,266,566 *08827D9D061FA1A602B055BC3BC727CB79D98C9E VONWITTLINGER
80,266,567 *088F397DCFCBDAF0F033B9BA5ECACD85FA1E452D [email protected]
80,266,568 *088E403312E0909840AE836728E8B45339B666B6 AMOUNTAINEERTREKSTHESEVENLAKES
80,266,569 *0881F37FD5D7907BA2D459D4AFF6289B6E2F7F52 AMQQ;
80,266,570 *0885B8E13B878FD0A533BDF9A00D239D4A9ED00D W0GM
80,266,571 *08818B1EA9BF9775FAAC91978FD8DBE3B873FE68 ANCILLAR3
80,266,572 *0889B7A7386FD6861F20CEAD3E9202514F4C62B4 WALA-MAJD
80,266,573 *088DAB4E657A5B02C4A85BD11AC6F48F2FB10FF2 and make him with our pikes and partisans
80,266,574 *08820262BB516257505FA4C5D3656C7AB60ECD9A SUN.DAIWAN
80,266,575 *0880804C011B04D0AA4CDD325DDA975E0C47CA75 SUNDAYSNOOPYING
80,266,576 *0888AC5BC7C779E159C555657F33AE60FBECA699 [email protected]
80,266,577 *0886B9EB35D9C8966D1ACA684C66AC86A02265CC ANDRESHENDLEY
80,266,578 *088E747961CE91BAAB28AB30AB9D736738F3CCED WALLACE.BALTZER
80,266,579 *08860FAEF900943DD2E7401A31D034A784E37C9D wallacepraylow
80,266,580 *088159EEEBA3ABFAD6CE16A20733AB4DABA73B1D wallsaurus
80,266,581 *0882D47F423EBF5650ADE52F9B093D1F561ED140 WAPCENTER2
80,266,582 *088EF62625E4557DBA4555D049B2043C9223194B AN!G!
80,266,583 *0885D8D08C9FE3E6D44259D77A9AE8D2CF6CABB9 [email protected]
80,266,584 *08813F463A501995C0AFD5DF9E2B9A4E57A13C81 WAXJOINTED7
80,266,585 *0881A9AF2B2636E88866E2EEEE8DBD9FE3472DB9 [email protected]
80,266,586 *0880164FC99D75BAB329EEBC1532E8899DAA60BB ANNAISTA3
80,266,587 *0888C0A0BA578A2FF4B176A8A2B64A31F2BD7D43 ANNEGISEL6
80,266,588 *088CE5FC3434D671809D875228701563110FD043 SWITCH.TO.RED
80,266,589 *08891EF4765F2A146B2F343C094B5BBBFA2A46B0 sxieuonaj
80,266,590 *0886FD61335A5DA205CB5BC7251EE33304B9754E we-are-overcomers
80,266,591 *0887BB4700E1743C8C0945E66CF53D3F6049F243 anthonyjohnhayes
80,266,592 *0884B35BB6DA3CD02629FA19DD6B395F07E9EBFA symphonieno5op67incmoll:ivallegro
80,266,593 *088ADD43D3D5E26D772D45FC3279489225106EF3 wendy-chattin-porter
80,266,594 *088F656274203158C5E54C150661575AB5A8EAE7 [email protected]
80,266,595 *0888CCCFD553A261D74909F5EBB91A6ED2FA35F6 antwanwanamaker
80,266,596 *08863AC19C8FBE1F6B6DF92AA724921035D84BB8 [email protected]
80,266,597 *088981FB547FFC2899B779DEF32F5726C62930CB [email protected]
80,266,598 *0882D24BB239A5DABF44E5A646F510696C55B3C9 [email protected]
80,266,599 *0888206B2D372843EF5B000CEE8779779F557B4F anythingforu
80,266,600 *088FACA081CB966A5EE364A3A510E71DB1299762 RAINBOWNOTES
80,266,601 *0883D7BA4D3A7613F92B2B624634DDD4681E0DAA [email protected]
80,266,602 *088D317850FCCD5E7750FDC5933845FE09016864 AOZVO
80,266,603 *0888E4A653C545286FC7ED0F9F1B073C20D4BDBE randolphbedeau
80,266,604 *088EBC66D153B8B7AAB5ACC6F9FC1C44DED91FDE whitneylevo
80,266,605 *088C6AD2D0D71613A10BB1803D8F692CF76711B4 RANDYKOMAN
80,266,606 *08876A1335EDC971999B6DFC8A35D087BA6456E5 TALKIDENTITY_CRISIS_
80,266,607 *088397BA6F567D900DBEFB28A675C2EE80201B79 TALKRIVERSBABE
80,266,608 *08874081DE42E5ABDBAA4B8825439602C48E7FFA WILBERT LAZO
80,266,609 *08851853CE229CC0A6A4EB7E2D0F010BA8B92F21 TAMITSER0
80,266,610 *088EA6B2EF6C202BB10D714575CEBE447F9A08DA [email protected]
80,266,611 *0881F79BB1A9E7EEA2000C77773C2C6A0967E5B0 WILLIAM.HUNTER.TRAYLOR
80,266,612 *088AF5A6CF4CE8DF31F4BBB1DE6A765EEDB4132D taperion6
80,266,613 *0889DCCAFF72E446EB9DE1DEA16222E54687239D TARASVINII
80,266,614 *088B8F913E1A8E28921F7567464AD6AC031A05D9 Aria-allegro:-Seraph:-O-Heil-Euch,-ihr-Erl
80,266,615 *088FA63C8A3C81BBA4BD1EFA4A1A03C4418396B4 RAYMUNDO.KILROY
80,266,616 *088AC9D58AAE617AC4ACC416C6E0982CF7B348EB ARMANDOARNSBERGER
80,266,617 *08829317D2A6A2AB1B0E71ACA027453CE11E6469 REALIGN(ECHOVIRUSREMIX)
80,266,618 *088830E85914B9DBBB5558B097F0B61A3BD4CAA1 ar:n4
80,266,619 *0889DE6BFCCAC1F8AEF6F9DF1B8A9ABECE131030 TEMPGRUMPY
80,266,620 *088570BAF800CFA7BDD86EF51FD09D3316219EE5 artettia6
80,266,621 *088FC9385339D41CFD1889A01488DDCE7CB6883C ARTHURFREKER
80,266,622 *088A7260C6A47CED1586C94A09CE3F1C2788620B ARTHURWIEGEL
80,266,623 *088FE3D568B268C8A919EBE90940D10E843646DE wpkmanutd
80,266,624 *088C9FCBD2A1C9A3918997FC3EA31489DE2CA344 wrister?
80,266,625 *08882A1613772B846A59F47CB496C79AB7DE6C1E TERRELLMUISE
80,266,626 *088F345277FB1BCD790CC2CA3F90054CE40FCA75 REGARAGELEJING
80,266,627 *0880FB70057104687689DC9C35DFE8317B3AB285 regdodenilorac
80,266,628 *0885125C9D3B64329209964244F0E39C5E4E0A51 wtrewinds
80,266,629 *088759FC13A5C3EAC0930EEA9069F984275A6B7B tertię
80,266,630 *088C59FB69D29D38804864A48FE837349E6C12ED REINALDOAMICONE
80,266,631 *088FA3971B2B12980205B8C5ADC2C060102D7476 tfeegjib
80,266,632 *0882A672C0FE7B97576C0785ED3E9367F0F5DA70 REMANIPU1
80,266,633 *0880D9A950028F726701BBDD28D18F5564E49C78 rennish4
80,266,634 *088049E5A2F2A3A67FB7FE14375F0BE52035A2FC RETROCOM7
80,266,635 *0888443C50E1482C6EEBC4E461E5CBB8BB53F86E THE.DAY.OF.MY.FALL
80,266,636 *088E1DE08EE53AD574420E115E35A1A86C165CB7 The.Famous.Four
80,266,637 *08864C907AD30A67B3D52DAF01700AF360C7DE73 xelacabacungan
80,266,638 *088C2A4E79204066638DB622B3076F3E2617BC6F [email protected]
80,266,639 *08846114E234EDDF5E62EFE2C9300A25F6E5892E ASHLEYLADWIG
80,266,640 *08824B3161D4CF51D00BCF1A94578F7E0D9106FB asnok
80,266,641 *088985CED257912DD631ADD5C51A80CAF533260B [email protected]
80,266,642 *08810F56E896AF13EA35C43B5C47222D7DB65CD9 river.gra
80,266,643 *088434923482A2D3C0B3A646F7D90E41B8AA7824 ATRETTEB9
80,266,644 *0887A84AB74BF0D72381CD8CB5A1E7CF16164CD9 AT.U(
80,266,645 *0889097B55D86ADFC8701DB72F3CDBDD21C4B8E9 AUDIERY8
80,266,646 *088DD3FC062971ED45B3CC351818BA57C0C5BF88 YANA-MOHD-SAPIAN
80,266,647 *0887634CAABBCBE2E5ABC9A4ED395DC8901C34BB aumigste8
80,266,648 *0882C30DA89576E82ED89913BBDF0424FB735DDC AuO.
80,266,649 *088DD9DF9E628C7184B9F21ECAF58F0ECE0BCCA0 yanogaya
80,266,650 *0883FCDF4B3894C8D881CEFD7530A8F67BC72009 AVCJG
80,266,651 *088B0A3A54217AC3587A8AFD5FED576F0B7D4EAB YBFN
80,266,652 *0888B97A04A419632A53A476578D259AB129B77B rockybranscom
80,266,653 *088A81DBEF42F9C588C2CF4FA6CDCCA346C6BF13 ROCKYPUFFER
80,266,654 *08844817881EA202755D164FCC4ACD66C917328B [email protected]
80,266,655 *088BE42FA9739BADCCD4209650760C278B615D15 YETTYMARYATIESULAEMAN
80,266,656 *088C5B902DF0B4904E572A1A2D05CA55B6986D9F awake, a voice is calling!: i
80,266,657 *0889281E5E70E4F11BCC24DBAB1B6CCA828441D8 A:;X
80,266,658 *08872F8626F20B3798680EC41AF9C6E4E848D498 YLNIKPMU2
80,266,659 *088CEB3A6BE0B3EE4898B17A8A9B41D3D5FB6D3B a,xx/
80,266,660 *088192672AB1BF3DB502171CD5BCDD75FBF9E160 YOKINGMERGING3
80,266,661 *0884F117CDBDD6CED32A1451876212F11FA323C1 YONGDUHL
80,266,662 *0889FB212FF6F610721FE917547BF9BC01EC7F01 RONSCHEPKER
80,266,663 *088049697356F79A7148E4A1F221EAA891CDBD1F roostergolf
80,266,664 *088FAC2B834994605F19852A4EA309A290E6E573 YTICIREHPS
80,266,665 *088D16513D3CC804776F21F9BCDE3954EF592CB7 ROSSNAGLING
80,266,666 *08886E3A76EC7CCEE7917FB6B822B087F9828570 YUDAPRIHATAMA
80,266,667 *08871FE3DD08048590C06024F75755134480AED4 B1VDC
80,266,668 *088D07F6C237DCBE78EE48B4A4BAF9C45BADC8A9 rubinlaplace
80,266,669 *088348531ACF9C4EF3A2F26E5BF1D77762BAA11F TILLOLE7
80,266,670 *088B903E0BCE95D08A5805FBF3E6EBC26810494A TIMMYPOLO
80,266,671 *088653B038DE37845C81081A0943F00A20BE3B3E ZAIDELH
80,266,672 *088C8D336F5362452E85152F1E5EAABACEBE6A32 ZARA FARIDANY
80,266,673 *0889E942259DD4BBC8AC86F5531C57083E2DE0C8 TIYA.DAVIS
80,266,674 *0887CC45C684031B7131C0FEB1ABBFDD6792D081 TJCWBQPN
80,266,675 *088A1EF82FFD022B3C4DAB84274A72A91061C550 b$66h
80,266,676 *08879C3AC3CC7A93645B1A97A8DE126635FEAA4E ZEN.CURRAN
80,266,677 *0881676FF3C31CADB746B6DCA702E4CBF4BEB210 ZESHAN.SHABBIR
80,266,678 *0887197609F178E6AF8FA4C639FDA760198854C9 tobiassumers
80,266,679 *088D3035834F383DB1C6A2B354D2868FD5D0EB9A zgrnuled
80,266,680 *088CF411CB1EFC5E3895919D122CC1BD7F59EBDE B7WNR
80,266,681 *088AF4C68935ED6BD33BD6D2960C0BCE496B3D6A B81FF
80,266,682 *08880E9B6EDB46D8EF5EB92FF09AE6C4F6198D4D ruthdanielletatlonghari
80,266,683 *088D10500482D67C530FC2BB12D7AB3D21C09B4B [email protected]
80,266,684 *088881F5E4266692D6CECDFACB628EFC08202855 b8ra#
80,266,685 *0885E738AC39E8C86B4FCEFB898A17A6EC8DA777 [email protected]
80,266,686 *088980F9DBF2ABEA5EBFFE1517BC735F15210609 B9R#
80,266,687 *0884C97B8B1F3E9D91672A664135A8E815BDC2A5 ZŁOCZYŃCĘ
80,266,688 *088A0B2C675EA531CD42E24E5BF39CB23418E309 zlzruir7
80,266,689 *0889F63420A9B73FE521F5921C7B2D71D20F48C7 [email protected]
80,266,690 *088E69736DDA6E55EC8FB802891F7A0F6B0F5299 SÄHLÄTTYÄ
80,266,691 *0888FB2E2656237F7674450B36AFB07A259F0879 ba;$c
80,266,692 *08875548100DF74007F50BED684608BE633C33EA BANDASCH4
80,266,693 *088D0F16674B53F1F6EC5EC8588CF6D77A73D8C0 BAP77
80,266,694 *088DF98369B751110A94907FC8D54A4E340FD664 trance-voices,-volume-12
80,266,695 *088093F57DAA929FFBD565172484972F08132B26 TRAPACEAE1
80,266,696 *088727FC5D10382F324C5FBAE97472439CCE57AD АРАГОРНЕ
80,266,697 *0884EC6A847D19E25D6082BCD1740B3414FC70D7 tresjamar
80,266,698 *0886252B25CCC1AE11F53D4AAE5C7D61C30D9AA4 SANTASNOWBALLS
80,266,699 *08850D9D2D2271BB43A2A1D31D9FDD3487E2BFFF BBXF
80,266,700 *088743C5028E4F36ED03C778EC1DFE479C7C8ED6 ЇНИ
80,266,701 *088D4D3F6326DD12424071CD58FB96647BAA4081 TRISH-HIRSCHFELD-BISIO
80,266,702 *08884124E9F7EDB118B865C67FC0CB83362C1220 ЈАСИК
80,266,703 *088B27D209EE93903970095C721EA6BD26777F95 колешки
80,266,704 *08888E6BF09BA2C1AABE5DF366FE6A701B462785 BCU;N
80,266,705 *08862B3387817FD0716C77694F9FA5D47257E921 мессиром
80,266,706 *088117348B711E4E02AA2245D2E2E42481BDFE5A TRVLEDE6
80,266,707 *088C9D0C52DA944CE0A42F6DD8414710F8EF7919 trzphoto
80,266,708 *088376B8B8E8F7900E6766C56982AB73BC5C50DA TSHOMBE.DEMBY
80,266,709 *088D186C9702C1C7A972A826AC2AFDBA1D00E963 beausamber
80,266,710 *0883FD1976D8D2C9DA560FCEBB3A8936400A616F TSÜNTIZ
80,266,711 *0886BB69567B874798ED10C3C00B8C4CFE9727EA SCHLIMMES
80,266,712 *08888EF771A165258AC58412B88B6CE0E0822915 SCOTT COSSU
80,266,713 *088B5238A85B42333E8AEE7044ADD9907D778ABD BENNERS9
80,266,714 *088D1DA2C0FED89D57BDEC05DAA070E4D7643F8B «ФИНЭКС»
80,266,715 *08856DCF3C92AA403A54FCB0BC5C7B0C9F2CC3EB штрихове
80,266,716 *088333E2EF70B18545359CFD6BA255D282FCEEAF TYRONBYARS
80,266,717 *08847C33B227DCA4C63AF05DB1B6C85D47A93B1F U11903294
80,266,718 *088163C5B484A616BB530E8DC13F94D9B0AEB56B settsu-motoyama-eki
80,266,719 *088404A97C7BFF90A5F00688F96A6EA5F47CF7D7 B-H3G
80,266,720 *088945D8BF53120E973CF5E674BA9E700081CEC9 SHANNON.ROBECK
80,266,721 *088B9BC67A93F04F61670109A2E55D1A0A9D690D B#HK0
80,266,722 *088697C6DA90CE6A74CF8B44D9766B1C5FEE08B8 bidhya.bista
80,266,723 *088EDEE8391C8DC152D6518BEB8EEB891EB0EC8B SHELDONGEBBIE
80,266,724 *0885BB4FE239DB7EF39CA5BCDFC727744C9C7F50 B"IHT
80,266,725 *0881C0C2ECE0147D7E6F37E83F163BF24F85690B SHITWARE9
80,266,726 *088D378AF483F87BD6449759DC614470F01A1250 BIRONLO0
80,266,727 *08808B9D80E11283FDE63438C43F7C3AD495D4D7 SHOSHOHUSSIEN
80,266,728 *088A7CA7B2BC0FCFAB33A1F00A13304688AB1E7B showens5
80,266,729 *088BD5AC9E7D56F50F57FBB6C5E527FF13DBAB54 SIAN.LAWRENCE
80,266,730 *08893F4FB239D3EEBEEFB2C731E69BC2C0BC8225 sieganow
80,266,731 *088F83664609568127733EE4AF7D289B928A0EFA unendlichmehr
80,266,732 *08884360D5E79B4D9A5E542A0B02923CBE9846A4 [email protected]
80,266,733 *088B87000D6FBAE2F39D3F46705AB004F0549A30 UNIKUMS8
80,266,734 *088D3C78D10F2C0D6303052F09F28495DADDF472 UNPAVING
80,266,735 *088158946C14EF7584BA9FF0A8E6A7D23EF628D6 unque$t10ned
80,266,736 *08833C0E8F9611CE4BE7647D642BF7F20534545B UNSAPIENTS5
80,266,737 *088B2AF7A536FCC98434CE49880038F11F9E769D unscapable
80,266,738 *08818A87156E27BE9F9670D906840DBB8ED7CEB4 UPENDRA-WICKRAMATUNGA
80,266,739 *08818DE23AC569586F1861B55BB3D54F73E0EBF1 uploads
80,266,740 *0880E29A516C219627111B987056B3A8CE7C19A1 BODENSONNENUHR
80,266,741 *088C978D923DACB79BAA49C6838F9E1DDB167409 bonniemilligan
80,266,742 *088D1350338176606B0E63F7D3BD015A8DDBE13E BOOMERREDSKIN
80,266,743 *088D34D950CD722EF8A9CFA8DE8EC01808EFF95D BORISSAVINAR
80,266,744 *0881D0D34A8C52144F547A2C649757EE161EE15C USTAZAHMUSA
80,266,745 *088D0AA18DF59C8FA9FF86AF27993B9DA2B69233 USTIMNT
80,266,746 *088BD2F55B9FA46690E6F6CBCAF3976F1CAF9329 USTRONIEHERMANICE
80,266,747 *0886630F300F6E5ADD26755E9B96270E3F5D79A4 borough-de-aleutians-east
80,266,748 *088E7E8C8250EBB117B550336EA22AA8550AACA1 BOUKENKY2
80,266,749 *0888B608CB058B260835EB6639B2CE6FF7AD2C02 UU~.~q8
80,266,750 *08867C549E9B662D4EB05C0E5808203A351E1959 BQ!K
80,266,751 *0881313DD2287CC3D9CB21BCD1373E8334A630EE br".?
80,266,752 *0889F7FFD6490C07DB5D10C6778B3CC413157701 VANMEN
80,266,753 *0886C72D1A4097916A5356F06ABB73F8426D27DC BRADY.MONCRIEFFE
80,266,754 *088B4145B1584E48E47EC8E5C739D63069248D4D spctclrly.sp//k't/&/k/j//@/l/@/rl//
80,266,755 *088E9BFD752D4BA92B58F203824106D22749BE9F BRANDONPRIAL
80,266,756 *088EE5938A029DF61D56A106A2EEC49F11179B53 brendanall
80,266,757 *088111916AE9F08328C2D20A91F8DCB6DE217A77 bretmainguy
80,266,758 *0885AAD774A1342581CA17FCC682AA0A8D0E2BAC bretttoso
80,266,759 *088D2F76D4CF94F77D084A98271985B18E97D227 SPLAT.~`.~`(-----3
80,266,760 *088E3D5EEC74EBEBF03AFC13F4960072BE8ABDE0 VICTORGEOFFROY
80,266,761 *088BE24B6F2F391A4ACAF05C3878ED8791844E88 srinivas
80,266,762 *088D2A12C16C8D107EC54707FE7A5498BB6F25D7 VINCEBUERGEL
80,266,763 *088AB9105928892B7C5E9639C3BF3BCC9F1515D0 SSALMASTYAN
80,266,764 *088CF0B632750A5C5F62FE1623D7BA8AAFC2F5DF vincenzowendell
80,266,765 *088B0B4469E7C206704EA381E3A0C89D8FF6D595 vincetfabricante
80,266,766 *088C1CAEE08339766ADD47288C852F16F2469235 SSKIBIONSKI
80,266,767 *088B143EBFDAB96F6A523421770E56B8B7B6A365 violatethis
80,266,768 *088ACFD714291641184688F7BAE666E27B3AB9B0 STACEY.JAPP
80,266,769 *08857CDC9B1A99081848C10319CC3DC6E7664922 STACEY.MESSER
80,266,770 *08837700BA0A4A671F4A11C4AD05D1C656447609 $&@%>%(!>&!&$>(>$
80,266,771 *088516174FAE6435F96EC520BAF13BE06B1FAA0B visitedbytheghostofblindwillielemonjuicehamingtoniv
80,266,772 *088607370E811D6948D8495B6B4CEB753E038742 b&te
80,266,773 *088D6D483811729CAEB837E7DE1B130B791FBD1F B$_U3
80,266,774 *08864402B6F985383D307313C88BF88DA13F4BB5 VNSECRET7
80,266,775 *088A0D0623926AAA33B5C01D8001F029E8EF815B stepitup(30secondversion)
80,266,776 *08878CEE87C98993F021B4C9E889BF96D3AACCF1 stevieiuchs
80,266,777 *08891349B1AF20678A4CC74C93DF1858CF71EC69 STEWARDENS
80,266,778 *088FA2680276A5E58E07AC3F7D9D318753514740 Butbysomepoweritis
80,266,779 *0883914317961A4DE4F10929B6A7A2A567CE3F5B 081ATHENA
80,266,780 *088A7B97644DA4D7215773E1D8340702795D3DE0 BV;T
80,266,781 *08881D0C688D95AF91BFE57B0B59A5B660A22BC2 WALSINGHAMI
80,266,782 *088483468DABB840817315DB70BBC839DF28FEFB [email protected]
80,266,783 *08880AA73F303A02DC7EF437F60E3704CD071310 SUDHA BHARATHAN
80,266,784 *0881F3C93E31C6A166F686083218823F876803B4 wankliness
80,266,785 *088A47AFE6EDB124A4867C7DBE6888611629CEB6 c0sgj
80,266,786 *088AC3931A18064524F552DBDBB46B9CF96CD41F [email protected]
80,266,787 *088B21DDC1566A40272EDF1747523B8E33C82731 C/1
80,266,788 *088D104C0862097EBEBAF2C3B73530819C1A8F43 SUPPORTASDFGH
80,266,789 *088C77199A2B9C1A734478622BD9A0941B420BE2 SUSPEITAVA3
80,266,790 *0889C85062FA7C1914A597012DFBE5105C2E25D2 [email protected]
80,266,791 *088CE694E55289BBFFB17463A4EFA67F81EB6F9E 132355 KOHDISTUS.LASKUNNUMERON.MUKAAN.N
80,266,792 *08876B23CDA2F22DBDD8BAA76EE771398ED3DDF1 1325404 wiewirddasaufderbuehnefunktionieren?
80,266,793 *088488B7CEC04CDCBD53633DF4FAA00965F52078 [email protected]#SUZANNE
80,266,794 *0887250D011091C2FE8767F27697C4193541FB9B 1404902 ASIALLA-ON-MELKO-SUURI-MERKITYS-,-MIK
80,266,795 *088DC3E324120D422648554480E72C751366C5BE c6i_j
80,266,796 *088339B9C9E6B16CE3DF5C3D1814B3AD816A6488 1631359 KER
80,266,797 *0886F3EAB13AE871CC6831014F60CAA45D6967BC symphony-no.2---adagio-mesto
80,266,798 *0882A75D1FB471B4B5AC42E86E95DFFC604BA631 szuv
80,266,799 *08841D92D6A0CC6459626130F89698AD440C749E carlosarodriguez
80,266,800 *088FEE17D774F10B25D78C503A17F2FF42257834 TADCZARNIECKI
80,266,801 *088EBC359B07FAF5B444A12544428E96433569CE tadsidhom
80,266,802 *0888E9116C83F80A81F09E6FD7702971F2C72F3B 19011614
80,266,803 *088FA2E67C366062415413C7E0E324AF9F592D80 carrollseth
80,266,804 *088BC8B32455207757B23EBADDE9A68E88D250CB WHAT'STHEMEANINGOFLIFE
80,266,805 *088D76A16877E2703B68066673A620B3BD51C923 1apr1510
80,266,806 *088CC93EB52915C93368D2548ECA86BE190348DF 1AVNCTLUR
80,266,807 *088CD484654D6423D1E5321028E93E76E99C5A74 TANDPRIEM7
80,266,808 *0883CBC0A7C92A62769F8633D46B0C7B52762D29 WIDENED
80,266,809 *0881E7FEB73451D1EAB6DCF82320D4AEDBADAAAC 1BODENSEE-SCHIFFEN
80,266,810 *088F748286163E67A7CFB539902221835BC3E474 taob eht no teg
80,266,811 *088B24017E38277F528CCA81F996563E2F90BB52 taphcruhc
80,266,812 *088DC765995E1858316BBEE48558B3BD35DF8041 1-DAYTON'DAN
80,266,813 *08843CA10D63F1B194A76D3936685CE9B26F11D6 1DRAWDRIE
80,266,814 *088FC6E0EC9C214FC9559E832DF170DD15245E57 1.durchschnitts-tscheche
80,266,815 *08877F63D8F2F027C451A5FDA8DFC799E747BC6F cbe+
80,266,816 *0883EF7DD98209A7F115087F60CCC030DABF8313 1EMU-KRITEEREJ
80,266,817 *088D701E7571157D747FC69E7C8CD962A3E596F4 cbktw
80,266,818 *088C5F7CAB90B5ADFFCA901323356F3F451E9FD7 techninja
80,266,819 *088EA0965EFF1711694ED10673539A877C0C5BFF TEHAN
80,266,820 *08817B057539A2CC82A351A4E3FFE3A06539AA02 cda4u
80,266,821 *0886A8DEC088B574449D1571BB92985107D0BBB5 1guillemets
80,266,822 *08870817652EAAFC019DE5FB47F7D311E2B5BBCE [email protected]
80,266,823 *0881E33FEF7C8370ABABEBC0D6A2B7F4D203073F Willesdenpaper
80,266,824 *088459F69B1ED441568D5D26F8210FED4811C7B9 CECIL.WOLIVER
80,266,825 *0884F67E1FEA4BE76489FCC2329B017F701BC4BE TESTERPAPA6
80,266,826 *08857DBBE87EBBF7980365B9D2228B20DC6C766F 1INOREGID
80,266,827 *0885846B56074FCA23FAEB8EA10B7C48B715AEC7 1-irkilmiSti
80,266,828 *088EFD047E9BFB9BF349B844918E6D1DB39AFA35 1-italialaistuottajan
80,266,829 *088DD5D557210F08D55690330E110837A5F48CCD Ceslettresauquellesonner
80,266,830 *088056BFF3225DCD417D9F9EDBFCB3A65D6FD655 winfredderalph
80,266,831 *088BBB0335A4B481B0E1C3FEC868AC489FEF56C2 WINFRED.JABLONSKI
80,266,832 *0880437015F18E12C230901D184310EAB879321B THEEDRINKERS1
80,266,833 *0885ECC9307B801A25C789C570499364543ED94B WISNETTY MANDY MADZORERA SIZIBA
80,266,834 *08840605635B9384694188FDD96670651669F5C4 [email protected]OM
80,266,835 *08859C22DC73DF6DF5CAFD13B28D9AE221899A6F WMBARRIAULT
80,266,836 *088E2D6D38EF541FA5C6ED53F118C9D9CBC2FEA8 cgnf1
80,266,837 *088B6CC6A267A4410F30A66FDFB64359A1A87769 1RADON-S
80,266,838 *088C5A14356B919C797CA47A8E391139BB2398C7 WRGOMRIA76
80,266,839 *088A1C56F21EB62DE54718924A4E2486A1359F40 CHASSEURSSUKHOI
80,266,840 *08887549729D1B9ABFC81D73CB4551725483DD34 THROUGH-PADDLE
80,266,841 *0883DE21853352E5FF10D2C3F097E121FECD5E7A Tick.<b>Connect.through.a.proxy.server</b></li>
80,266,842 *088A05C022F5CB28EE4EBF4C2759877A504B63D4 [email protected]
80,266,843 *0882FE53CA07F3AF8807E4E220B930E4FE57E87E chetferrarini
80,266,844 *08820875845103A4EA6C92B357B96C50CFCBCE75 chflk
80,266,845 *088FEB40E0E27E27254B51F2FB3F52D2D2FAC045 1SUHTAUTUIVATKIN
80,266,846 *0886C4816D8F085E2810F4C1089C84FCDAC9DE23 wwwnationalparkgeme
80,266,847 *088E411EA71DD65A1BAC7F8D26A77CBE5218E656 WWWPAVEMENTMARKINGTAPECOM
80,266,848 *08889ECA05A6CC9F19C789A558B68263C5B87D70 TISSUETALKCREMASTER
80,266,849 *088D40E4AB09802690243F9D728B30CC39EA57E0 1.vetroconsult
80,266,850 *0884453541E350E83DEC058EB296DBEF724730A9 CHPN
80,266,851 *088A87610C1990F5C6A4012F9438A832D215F5B3 [email protected]
80,266,852 *08887BB126ED7B6C4BFEA41E011F4209DD90A76F XIE.VOUTOUR.MCMILLAN
80,266,853 *088DC8C690344EAD2943F3F84FEE895A420537A0 2047165 muistion-tekij
80,266,854 *088D35E45B01B528088D0167233DB84F68E5E8F0 CHUCK.BORROR
80,266,855 *088FF40F42B606E175E9B2571A89F6AABCDF1557 TOD.PRENCE
80,266,856 *088A9F640732888CD52A0246AF2F49D16D0549F6 2099547 PARANTAVAAHOITOAALOPECIAANEIOLE
80,266,857 *0883E3FD2BD74ED04F6FE1153A87F02F3D365A65 }X{o~.O~d=3
80,266,858 *088343AE13A6B7014F810F3C4E6A2B8EB89EA87A 2148674 se-huolehtii-er
80,266,859 *088E2E87390FD495EADBC068A6B0D83B3A3A0C12 XS"<
80,266,860 *088CE3130628EB9C5C14DFC521146FE9B63F4677 [email protected]
80,266,861 *088D9214E3B75092322E6854686188889130EFB5 [email protected]
80,266,862 *08884D32627141238EDF737772CA2620AAD015FD cid/d
80,266,863 *088CD60159CEC7C4A43330168B160D395C702465 23STRANGER04
80,266,864 *0889131D0E4FC8D1716A6432400C3B0ECE1AC572 clearwaterschool
80,266,865 *088FBF6F925407CB264B160966F0E8A147C06F52 YMAWSIARUD3
80,266,866 *088C7F677ABBF189403A31CBB996FD386D5ABABD YOGESWARI PARTHIPAN
80,266,867 *0888497DE1B6611B5A0DC5F1E2ECDDE39EB332DF 2905034 n
80,266,868 *088C4A7ABEAA65E7A53179735D69EE10567C2237 CLINTONCHEATUM
80,266,869 *088ECDCD0CC887C83A4F853C76446C2766299128 YOSEF-L-AGUILAR
80,266,870 *088699BC82F65ABDDE885C5422408D49E4B93362 YOSSE-FANNY
80,266,871 *088AE5A80E8D635D7850D9B39DFB43782877058E YOU'REJUSTGOINGTOCALLMEIN45MINUTESANYWAYS
80,266,872 *088313DF5ED9538DFB87215D91EF42FC434A5491 C%)M&
80,266,873 *088A1B5DFC300B4393BD49E8A3E32FB8BAF16C69 2esvitavskoweb
80,266,874 *088D134BB073E35423D3B9750529E122F8632EB0 2GoeRaN
80,266,875 *08868C3D92091BCB0A55672D0AFCAD6760490CF5 YUDITHHERNANDEZ
80,266,876 *088F4C9B570A169A95A07E7488099CBBDFE374AA ~2kbaa
80,266,877 *0886AA917887BDCCA2488C3E3D568081353A39CD YUTAKAOKAMOTO
80,266,878 *088799BE17944A2826E5AAC8D1C9B553C2BA7CAF 2mydale9
80,266,879 *088F1EF12F7C7D274DEFF4E5650AE34207BA1605 tshin-litha
80,266,880 *08837A8D83DCD42DA510B5B52BE1D9618CA64858 CODYDOOLEY
80,266,881 *088D4C02981406454524832FBF70517053493D2D ZAGRODNIKKRAJNEK
80,266,882 *088B44FDC6918D9E98F8953EEC68042977B8263E COLIN.UYEHARA
80,266,883 *088CEB21956E8C71530DB346128726CA8E3E1969 TTBUSTT1
80,266,884 *08868E1D322170EB6DFE75D7454F2AFB2EACE1BE TUANKOCKA
80,266,885 *088C9196D0A7790473B8117E07B1254ED07481F8 ZARRAH.PINKETTE
80,266,886 *0884484F016347BBE0A53E3F6073F85C866D6481 tung.thanh.truong
80,266,887 *088C108C8F225DBC24D717951A146CC733972750 TURKLEELKRUT
80,266,888 *08887CF18F18872E965D146207DDF7B7687E762C twinkletoez363
80,266,889 *0884232412C2677016EA1DDB26FF8A18D7168CB2 3NABAVILA
80,266,890 *088D283AECED180C4EAD23AB3A1123F3DAD7140B zhi.hao.jenson.lim
80,266,891 *088FACEE8D1DE16ED93945A0EC02B7A8042617A0 connie.diehl
80,266,892 *088753FE6987B28532C92CE5BED9D1670D49797A [email protected]
80,266,893 *088AEDF412A1F8F813FCC0A6D1E8DC3CB17BDE2B tylotropidius
80,266,894 *0881F3C387F481B6577259A7C9EE0B68B6F513AE TYREE.GOCKLEY
80,266,895 *0881450CB3E12F574A7CD7A1576933C897665905 ZIYAD.ASAAD
80,266,896 *08855D455C129A189FFAB3D6F5C8B29C5592D7C6 z'k
80,266,897 *088E40BCC861E556C200ED4C73F6EA05727D4E26 ZNYRRI
80,266,898 *088327093997A1BC3C3A1EDECDA5B8FCC6920B1F U5URPER5
80,266,899 *08847E1A6D311EFF61DCAC5297CBAF7E72FE3392 UBROJIM5
80,266,900 *0880551B212DBB7B113D2333762FCE7DD0997399 ZSER1234
80,266,901 *088A6E8BFD1BF2C9B8C6CB87967DC85653887438 4INSCHERENLY
80,266,902 *08888F5DFA8986A4DCCBBCB02EBF0C0CD9C65C22 UEDEMERBRUCH
80,266,903 *088FFB1360997D1905AD6F8E451475EBEAF8AB39 [email protected]
80,266,904 *08802DD1A26F08ADE4AFBC6F3722A8F569C230AD 4KORFBALWEDSTRIJDEN
80,266,905 *08857481925531393FE562F2CF77F1792063D1B8 COTTERS
80,266,906 *088C99E1004A7839BB90F13774289449952C7445 +4n9813s
80,266,907 *088BC6CF2E2706FF5AE979256DD6BA8B28C74B1E 4NELEKANREBAT
80,266,908 *088317E28122B9BF8E2BC330C4C510945B051D06 COWLINGR6
80,266,909 *0882E3B1E20996B43615022D1B4C3D0F8900354F unconfidential
80,266,910 *088907054B9C08F7C649489E6EED2EAEAD4C3CAD 4QUERELLER
80,266,911 *088A43632A34A2255A4481C7EBEBED55689554FD UN.POQUITITO.DE.CARI
80,266,912 *08810C6B1A90777D51AF5E5F931AB1D6E67B5BEC uploads
80,266,913 *088D25AB46819A5E52ABA42D74B9121AFF93D38E URAGUTING
80,266,914 *08894CD740DB051F693F8ADC33781BCACD6C693C cr3ss37s
80,266,915 *088EB86EB8B8DF9864DEF1A51F93D97C24D02A52 ЛОРДІ
80,266,916 *088153D790C0453787BDA088E643874FF5C2BCBF «пальцо»
80,266,917 *08857C7C77316E2C46A02DD35EB9F9C742E214C4 c%?s
80,266,918 *0886094F48A75CF915C47498AEE713595616D51D CSGp
80,266,919 *088A90AF0426D688CF55BD457CB6F85A6266E6D1 VALENTIN.LAHREN
80,266,920 *088C3C08ADC897B7609E2BE4F76CB438EBE21D2D cs_.s
80,266,921 *088F0614D6FCB315D687F9182AC44BFAA75C8F61 5HREFNARRITHTMLV
80,266,922 *088C9B2DD4C20F557B15A3AFB56DF99165BF062E 5ITCANBECRITICALFOR
80,266,923 *088B73D7B59A966D4A440706400CC0239921F7B3 cuzcv
80,266,924 *088014134EE8F60120944E5180D45F67D2E49BF7 VELISTSIHHE
80,266,925 *08851D48379D5B6B417696380C07E8821DC92FE0 VERBETEN!
80,266,926 *08863C59E971C4696BF8C6BB971CC93843485AA9 5SAMMIEDAVID
80,266,927 *088C6A2BAE41E9FB069D955657041DFDEA7187ED 5SHAKYAMUNI
80,266,928 *08829E7D134156BBDA2EA68D22735C9F0BBA794F vh58
80,266,929 *088EA701957C2827ACD327420BDC853B5C2E049A d2bcw
80,266,930 *0883810233D7331766DD57F55FDE48A26E8D039E 611mohammad
80,266,931 *088D90146E39C4B8AF1B5E45DE176803E80D5042 D3.UM
80,266,932 *0887756E675B06502ECDE57FF5998E4153FAB1D4 6AZPEITIA
80,266,933 *0883E9EF765042065D281E563F133FF7C04A0EC7 由於e331系的車輛比一般的車輛較短(e331系:13
80,266,934 *0889FE97A1975DB05C389E82F4D8CAEE6D1CE40F vincent.e.myers
80,266,935 *088F361D4A085D5D9328A8FC50076F16CB8DB1AB VINCENTRUSTIA
80,266,936 *088DF875E2C747ADF7CEB4317BC4023466FAA00F VIRZSINIÁZOTT
80,266,937 *0885F9F710B3A6655908042A0B0B95DE37B7C558 d!#9
80,266,938 *088DEDC607F4722653F868C9B8649B67BBF158C2 dale1996
80,266,939 *08851DFD62AD22BFBC9B17D10D6CC1B0601C3B8E damiengieck
80,266,940 *088E8E2A3B373EA384942747831E75A0D59D6994 6PARALLX
80,266,941 *08895564AE7D0C49F82AFBA2A5CFC3C947E10216 VOTE.CROSBY
80,266,942 *088819B99F8C1585ABFD1E8AD2E5AB30C697128B 6SCHIEREREI
80,266,943 *0882A0BA58ED786660DD32F8BB32721AC510B41C DANA-POTVIN
80,266,944 *088658F00B4E675364528B34530CAE14FB222E52 danashlies
80,266,945 *088E0B3A706ED5F6F759B37D2E2C4AF586D33AB9 VZJKGCJ
80,266,946 *088F7298CF9AA77798F5C3F1539A02E1F994D649 6UNFADABLEA
80,266,947 *088418690C223ACBB7A8E11B409A587C79624E66 6VALSONNY
80,266,948 *088A4B6EE224CB6AF7D490C9FD58A7B7423A0AF0 DAPPERSTEN
80,266,949 *088DB8ED348D16AE8B2D571097F9249BB5B20239 76°34´S
80,266,950 *088EA2901084A4BA4C30F6841AFA68CF78CA7CE6 WALLY SANGER
80,266,951 *088BAE08B7DE36B81E171207AE9644C7640FEF03 WALTER.DREESE
80,266,952 *088479DF09526A352C7EF101BBDE39339DECA58D WALTON.SCHILZ
80,266,953 *0880309B1ADA2AAF754A0213993F6BB209A18A3A WALTZDW5
80,266,954 *088EB71EE2EF331897D12BE637621E9577B0EDCE WANECKE7
80,266,955 *088771B94FEAC6A553CDCD6980CF94595104AD5D DASLIEDVONDERERDE(LORENSCH
80,266,956 *088D9198DC642AD729EEF4B90A70595BCDF82F63 7DUCKGATOR
80,266,957 *088E13CADC759006B308E3DDC1AE969214AC6612 7ERASTLEY
80,266,958 *088F83D3FC2F7C303254962E516B40E6851580E1 wapenkamer
80,266,959 *0880F14BF9BFC61F1DAB3ACBB661C6B77265AE2A days.can't.touch.you.now
80,266,960 *08853A32479191934233AB8C3643426406DF6844 WATERCHINEZEN2
80,266,961 *08855B75C050A461BE6EEDF41108CDC0AA37AE05 DBQH#
80,266,962 *0887322ACB78EB3F03CBA746C673692077E77B93 7LEVERT
80,266,963 *088D083ACE351799A0E327EA2C43CE7D5AF9FF5E 7NATIONIBUS
80,266,964 *088EB15B2711B2CE21F64D6C29EBFA61DD20BC7B d$:cl
80,266,965 *088B28E9C695B0E22D5277BDA508552FC019E291 7NORLBSW
80,266,966 *088575B24FC4877EF77911FE42AD8EF20E5D9C9A 05231900
80,266,967 *08848C23DF74A946C5760F28927E78B2D377AEFD WES RAMBO
80,266,968 *088D3C9B40705B10EA47663AAF3568D46751A1B4 7THEBURTON5
80,266,969 *0885DD75F5E1146B9C38E70EBB04D00CCBB24839 7VERSCHILLENDE
80,266,970 *088493821375A2342A9379A56FAA3CB2AF63562F W.HELL.COME-II-(AFMUSIC-EDIT)
80,266,971 *088C3B49B28BF506D193E8D46FBFAED4D60F2A1B 8##>~0.splat
80,266,972 *088742A8A28F371342EF1C15DE6C6DE0BCB2881E (0_<)o~ 0~qP
80,266,973 *08809ECEE1604479610D63A645043033FEF03190 demoniations
80,266,974 *0882A1B32F3791E0C39E5E200124C330E27D5EBF 107068 OSMANLI-TESKILAT-TARIHI-.
80,266,975 *0882779BC9331C0EDA1A07B304E6476F69CEE006 WILLIAMS.OPAKA
80,266,976 *088BE53138F6B9EEF8B722DB79656427F8EAA1CA WILLIAMS.SUFFERN
80,266,977 *08899F3D00B04C8BAE24444478A77807DFFC2FEA 127136 programlamadilleriveprogramtasarImI.
80,266,978 *08872D3041312888AF5ED2D7F89159ADDD0D1FD1 wilmerjamir
80,266,979 *088CF92F6CABBD1BCC9F5C2C93B7A979DA030740 8##B**:p
80,266,980 *088019A241D0727E8F4CF3A193198073A7A1BC96 [email protected]
80,266,981 *088047CD855CD28CB993707D8ACD70887FCC0CC8 [email protected]
80,266,982 *08824F62D86D046EF1C0BAD3708D2A067AE339D9 [email protected]
80,266,983 *0884C7ED8967E90500A890AD52A837C058ABACA1 WWWCAPWIPORG
80,266,984 *0881DE65CD0ECF480457A549665818EE52AADEA3 1.BETRIEBSSTANDORTES
80,266,985 *088B79C33C6A2189529F00DF97D9FD05587C5778 d,gt
80,266,986 *088A2E06FACE0F7DC8FC49C38571A01BFC432BD1 1-dieselkoneella
80,266,987 *088D5C3E5799A6E996E5E2F3B7270249D23E0F26 dhsl2
80,266,988 *088A36BCF1696E0F00A28F8AA53D2FA613E139CC DieBalladevonRobby
80,266,989 *0883C9DF8CFFEA34C2A6D5F0345F872A42B08795 DIENSNAVORSING1
80,266,990 *088294D66BB21F2D6B2EDC6632ACFF91FDC65D23 1FLUKE123
80,266,991 *088B170DAF3339132CC068378051D67D3E34B3C5 [email protected]
80,266,992 *088FB1E018CEB133AE2168499A644BB7A9B9EA65 [email protected]
80,266,993 *0882D7B2CCDACDA49F096BE366D2D1F318FF5B6C [email protected]
80,266,994 *08893175B92C87C4F4B3DB8E97109836A273E3BD XIESIFEN
80,266,995 *088C238DCD5339F2A300CFC77998172D4B667FBC 1HTKCOTTU
80,266,996 *088CAEFAFA9DABA83613A2EFBE7EAE387F8F61D9 }X{-~`Q#3
80,266,997 *088A82593EE161882DF845A0FB929FE64B39F987 DISIUNGANTUR
80,266,998 *0880C4D199759C1C49494DD4C035B9C832FBB6CD DITSLER0
80,266,999 *088A70DBE78F6298AD5015FE802EE69D9A319FE7 DIVENTARTE
80,267,000 *0882D4F3F09CCDECD3DFFC5A5515B0FD4B5EF937 DJ=E
80,267,001 *0883CD847253C55383F3CD63767D75270A62D665 950de1d9143af93aa35750c0a96f948260
80,267,002 *08879B00270DC7C2753031F640593AA9970DD0E9 996379 KUNNANHALLITUS TEKEE KAUPPAKIRJAN
80,267,003 *088F5B7866C71AF1399A77A929CCFE6917E10B24 9ADVERLINE
80,267,004 *0888185E04BA34DEEE4E8322A8AA8263252E954A Y136229
80,267,005 *088735B24CAC34E09866DE16F5744D079BF95CAF DLGFS
80,267,006 *088A01F615AF3D14D4255BAE1C7D078EAC8F5EE7 [email protected]
80,267,007 *088A59D7DDCEEA3FCA5BC04A9A2D1B61675C48D2 9BSWUSCBBSBSW
80,267,008 *0887FAFC3D247276EB959CAD49EDFEC4C1F6DB2D dm?tx
80,267,009 *0887B94923CFE9C830A06A2EB5044C49C66DC857 d"no%
80,267,010 *088C7F884999CF43624E214FE52D8BECD0D6B6F1 1-TASSOTTIA
80,267,011 *088BAC3EC31D4C1D88BD1F543E4419E7EBECBD50 [email protected]
80,267,012 *08804B449C39303A660E63138BC888B683484F39 9MARTINTAZMAN
80,267,013 *08811ADA41F486FE17FA3A281A57002240361736 9MILJREGLERNE
80,267,014 *0889339A2DE530C4A85681C5CF7CBFFB5295F098 9MORRISALBERT
80,267,015 *08807906E5B95EC7BCCD5481CC96657D5E63C48C YELLOW-PRESS-BL
80,267,016 *088F3B9C79CEC03709863E37BA4E66B010358AD2 [email protected]
80,267,017 *08809C81ADC5046F134DF6AA0035ADE6EDBA9177 DONNIEHACKLEMAN
80,267,018 *0884BDBD85C7E3824188103CF02F3D8DBA1DC413 DONOVANBERVIG
80,267,019 *088782C8AE32072D9499584E17071370DDFB598D 2076721 othersovietnewspapersdonotpublishonmonday.
80,267,020 *08813E415FC4A1A39F1C396C4495BE85FEC7EC90 9RAISSIT
80,267,021 *0885E669ED83D3C234192A5BC04CC09B15457646 2148123 rahoituksen.l
80,267,022 *0882F1A375821CF8C2F102A18B43E5BB41D9D279 28041297
80,267,023 *088728744D8C890F8E941C29970B02DE0B5F46F4 YONG.BOOKMAN
80,267,024 *088E1C050A18A572348809C8B16246EE99D2E523 289LAUREL
80,267,025 *088EAAC8C60504C62D9083EFEA8BBA32196A6B83 You-can't-trust-the-quality-any-more...
80,267,026 *0888E7825531D44191E1B15EABB4A4043FC35384 a1"g"
80,267,027 *08819B88E5A080F108BE934FE18EE530B14E882A a1xhf
80,267,028 *08808AC37141E88C4424DAED50F9F4B1AA9344F2 a?6#2
80,267,029 *0881F009E49A2492BFBDB626BDB14628FC689DB3 DRINKERSHOUR
80,267,030 *088B6D8690D314AEB4920A05569D3D6D6B4D1F0D A7N
80,267,031 *088BB7267E208FF2FF23FD202422E65D21F8EFC5 YUYIK.BUYU
80,267,032 *0888A718AD5BD5EC0174F1F4F710F8225ADE7A0A 2MARCINKUS
80,267,033 *0882906B9D77900B21686E7B9BBDA3F753B60403 du4iw
80,267,034 *088C188F097396BCC585E8562D67D701B25B03B5 aabg(@
80,267,035 *0889FEDD8E78128B63A3A65AC3E7BD708F8F8977 2VITORAMX
80,267,036 *088B48B1EBA953FC24E53F6C46424F5F36101423 AADG[
80,267,037 *08884B23444B281D09B589C7C1FFA03968E7B2E3 35f957b662353d6a86d431984d434961
80,267,038 *08863631E2F32286887875D8F4CE5D074CE086B1 3AZAHCAC
80,267,039 *088C1C9DEDD4F9C67512EB65EB083752F3A18C79 ZERWIN-GOZUN
80,267,040 *088A49D818DE55F8BB951F8C80F8ABB10502CD51 z/[f
80,267,041 *0880049FCA98F244B4C1179C75DA82E5792B79E2 ABIGAILEUGENIO
80,267,042 *0888B9584126A0BB62B7902843547B25C9BF1AA3 DWAINMINFORD
80,267,043 *0880482315277A599E0521DF774FCF34E6CE8077 3-lehmeier
80,267,044 *0889D664828408B3A3E47B5F704D8040B9E0EC15 ed3ri
80,267,045 *088B01611A3AF1B107164B21078A2554980D6902 EDEVS
80,267,046 *08855709461405B304449C1DC4BDA60A7FA5D0E0 ED.UHLER
80,267,047 *0889C5124F7010F0E1D0FAE621272EF3D02BF73B Einer ist immer
80,267,048 *088BCC8D19DB952A5661A07DF97F7FAFF071E188 4PRANUNNAAN
80,267,049 *0882BD2046C3B09CEB674C0FD173ED10D548F598 AHMED.MEHDI
80,267,050 *0888CC0BAB8EC8E88BED0E3824EBA72AD6F0CAC7 «соя»
80,267,051 *088B479E9774EC76EBBBFB005C60A1A2FACBEF20 ХЛЕБОФУРАЖНОМ
80,267,052 *0880EC24E99C5BD6499C69A36E5860192B4E08E3 դավթից
80,267,053 *0884B980753FD25404FA4186344018069AF75BC4 « PRATIQUEZ
80,267,054 *0883120DFF755F226DF7B87D261908E22C6619AA 兵庫県丹波市春日町野村(春日ic
80,267,055 *0885DF42421B4628661C1404C03F4A5205274BA7 ELSPETHMJ
80,267,056 *08840BE37F281A940AE00668104364E865199960 elve
80,267,057 *088DCC76C54F76097B13539E8E3B6DB0EAC00E9D A%KP(
80,267,058 *088A9EFC3160F36B787EBCFA48DD3FB1F69D5B60 5G0ZTHXZD
80,267,059 *0883E8B15243F326DE319E1D45AF574F486A3E86 5iamgrace8
80,267,060 *088F97179EF8848FE19FE6C01B10ECC07674142F EMPANACHER6
80,267,061 *088A647325D4677CB83EA85F68ACBB4C0681D855 5MEMEORIA
80,267,062 *088100CA8ED01767F76F696EE502C9D3EEAC76EA ENGINEER-STREPETOV'S-CURVE-(LIVE-EXCERPT)
80,267,063 *0882AB308823245C51D6F14EAA7309356B9535B9 ALLENERC
80,267,064 *088189CD0563A618B55A6A11E4BF62084640AABC 語、CHIBEMBA
80,267,065 *088D36B3C055E641551A5D15FB5C253DE5CEB84E EPPLI
80,267,066 *088C904E9EA59A734EC70AE5586A0311ECF5F557 (00)o~q=P
80,267,067 *088CE5B0B35B5049A452F65118925FD88A30B67D alvinalbarracin
80,267,068 *088670AC2FCB53D6B2272F491C700EA96450CB34 658833 mitchellalwaysdeniedtheallegation.
80,267,069 *08856BE50E54733A730C3FCF577627E13A928E23 [email protected]
80,267,070 *0889336A3A5DC680D6B8930CD0D052625CC608E2 amber.campton
80,267,071 *088345D1EA9B4DDA4C53A64961D56838082EB533 amie-kilgore
80,267,072 *08834D4001FC38B448E55667F8A5507997BE9954 (>_0) o~ 0~dq
80,267,073 *08827AA210E671011CBF27BB9D46D751072A8C53 6CORRADORUNNING
80,267,074 *0888F932B9C41289DF674ED0BEF94C8F9A187376 esintiler
80,267,075 *088313F0190E8373DECA1A938CA706CC69704771 ANABEL743
80,267,076 *088FA72440D0FF927B602407A52BEC7525A3EA3F este juego
80,267,077 *0889E78A40A934FDA12B85BCD2C8C15693A6ECD7 etanoiti8
80,267,078 *088A276D72EBE3EB375C3116FEFFF9185CBDD361 etessaan2
80,267,079 *088373F0DB665F7C42E47262F4E6671D6A030EB6 andrewn7
80,267,080 *08885DDF6B800FC65CB38D92254AB378A0C19D88 ANDY.SCHNAUTZ
80,267,081 *088E62202181956CF431B2701F232BB4DB59D741 (→ANGEL
80,267,082 *088185C18A332D2A332A929B0E1E95799E2974A0 1247121 dashoertsichan,alsgebeesetwasextra
80,267,083 *088D8C12F8D728728E9EAAB79F297CA3C8456A5C 6PACKERSPASSION
80,267,084 *088843E26ADFFECB9182D2FD3F48562D187B7980 12ETUDESOP10NO5INGFLATMINOR,VIVACE
80,267,085 *088637777E33704E01D87E5B8ADD559B5F97A2FF ANTHONY.BIARD
80,267,086 *088851AC99F9DE09D5D5740C8E79E435687A30E3 ANTIONE.BERTORELLI
80,267,087 *088F9850410525CBC4F0EF502C58DA188BB531F7 6WAGODON
80,267,088 *0883FF824B735762265403EACB890BCC0C6E5F61 1526638 COL.MARGARETSTANEKOFHOMESTEAD.
80,267,089 *088EA6E7DDB86A18D76257E4B6C88DA474A592F8 708174 L
80,267,090 *088DFEC6B0117C5DBB99E3D9716027EEF26DCC9B 756527 a wooden ball sits on the desk , like a paperweight
80,267,091 *0886BDA7C088CE83677B4EB0C032A77171D05739 $7A131Y
80,267,092 *088AB5E6611A957654753FF353DD8D02CD1A934E aq-
80,267,093 *08839F86E07C2B9232F9ECF38AE1822C2A3E7EFB [email protected]
80,267,094 *088BA03BD5FA08BE4B0F1957930FEB0B4BB27D94 7CISCANDO
80,267,095 *088561116DC40EFFC8DC853C911D63690F8A33D9 arfaoui.b
80,267,096 *088FCF91079847D20087B8D4B4136D8E50B8B7A1 ari:m
80,267,097 *088605C3FC82AC8808578EE6E27DE84A636CA339 1970-05-12:.DENVER.COLISEUM,.DENVER,.CO,.USA
80,267,098 *088B963E49B0D04717D45E8E91DF8D391FF62349 7LENKOWSK
80,267,099 *088C5FCBCD5E6A3A0B3D3A4E918463A7C0D562CA 7NALLEYS
80,267,100 *088C4F7D481A5300368759B452031F82DFB516F7 a,scv
80,267,101 *088B00C250C519803C7F0DBD44A299FD29B48B0A 7PENNYNASCAR
80,267,102 *088A7C9264C9A11B203D5C60BC1B3EF11C2F2869 7ROXYWHITNEY
80,267,103 *088395B8AF7380EE7FCEBAFEE5109D2923A0ACE0 1.BESPRECHUNGSRAUMS
80,267,104 *088F169602A342603BF8DBE8E9BF9B5A389E01B6 1beta-research
80,267,105 *0883C0F828D246515669B064D7345A49B9FB6D0D ASYMBOLUSES
80,267,106 *0883094E3C1412C436909923CFABFA15F8B5C1C3 at3n&
80,267,107 *08843FAEBC80DADC24F7A2F7F607D3714ED88415 1 BUNDESLIGAALLSTARTEAM
80,267,108 *08819B630D8186463DB087EC6C5FC6EB853AA61E 7UNWARBLEDA
80,267,109 *0884E90C2570F7D4E7F4B1A4039462F17CE8ABA1 [email protected]
80,267,110 *088966D21C1EFE9F815858D302C71182E366B4EF FOJIN
80,267,111 *08856F414817C47E7E4D1599FF44E3FE21D8FAF2 8d60b3682305b1f77baf8674a9ff30ccphpBB.Pass
80,267,112 *088E1D4809AC6C1A184FFCB46349EDD6E47B3AFA 1.ILSEKONSEPTIN
80,267,113 *08874B3981C095E58D577D610D4631EE8AC4F6FD FRANCES.COLPACK
80,267,114 *0882F908DDFDB14858352BACD63D4E175D99876A 8ELECTRICSENDIT
80,267,115 *088E85415358CF2EC401B7968FA7F59D24139FC9 1 ISLANDING
80,267,116 *08857E0048D1AE9D2071F9A0C80C5796485444F2 1.ITSEMURHAISKUNA
80,267,117 *08867101294D00022A7B85BACBA7DA6FD3EDDBFB a:xr6
80,267,118 *08802A5D1A9CE7DCB55CD1899B145DF426899DE0 franciscotarrega
80,267,119 *08839DCF8B0D3463FD56248968A605446879B214 8GRONDIGES
80,267,120 *088E4DC6EA1C4A3DEDBA7A277FDAFEC78EBF327C b4u[
80,267,121 *08813C0D47CE0C476DCA975672A6870880C00CD4 from the four corners of the earth they come,
80,267,122 *088E07E56E8AFF5F003FB11A4122C467EC83D0CA B5HIQ
80,267,123 *088485F8984D2848D72CE5C232BB945B374E25EE 1olamiyacagini
80,267,124 *0881BEE3CD9560E9784C2FC10D1A5B92758D3F8E 8TUXVPOTYW
80,267,125 *0884E7C59481DA9E1F8383B5EF05DE809365F834 955SHAYNA
80,267,126 *0885C70FCFAA895D7442D29EE1F75B881F1BFF7D g305175959
80,267,127 *08860DC94DE782DC815C3D4CB421F366AE7275B6 BARNESWALL
80,267,128 *0884DBA6138F8E23A501602DDF0D149A59655141 GABRIELREADE
80,267,129 *0888CE20A4515F9ED1332432EE96D4741B18B325 1.PUNAKANTINEN
80,267,130 *088654DFE77482F5A523035752F8FBBB90D51233 BARRYMATTIMOE
80,267,131 *0885EE5BC38DDBA66B2624AE2926C4FDBAC08B13 1RADIOYHTEYKSILL
80,267,132 *0883435B922C96BE30F9CC180D285C0519CAD17C 9BDRJFSVRMGN
80,267,133 *088B435FC1E53050BAC088B545776EC7132F554C BATABANU
80,267,134 *0884D1CD8E3B2090ED3C255EEB6FE6A820191872 GANASHAH2
80,267,135 *0881AC5BCD2742E942662E81D41615B5B337CFF0 1.sighting
80,267,136 *0881C183D91EA0D3F0D87158541D4782756526B6 9CHICOCOSMOS
80,267,137 *08811C0B91845C8CA7FC48F10A637AEF5B9051A1 1starlight7
80,267,138 *088A1B610AF1912F84E63CA00428C0F6583F89B1 1.tennis-hoelle
80,267,139 *088B0C7BCFF174FA6026BDEDF604E93F7908915E 9KARENSDAGENES
80,267,140 *088EA6A05E528A3BB8FD851CFFD5B5A5E3BAE834 1.URTEILS-ODYSSEE
80,267,141 *08871F1F955F6F60867206CE3FAA54DB3F61F5C7 gegannefd8
80,267,142 *0888FD4E0EF3E586D8A6014559914D71CBC4FEBB genaroscrimpsher
80,267,143 *088B89C30216A0A2848AF9D72CABECFA35D3217E genaroskains
80,267,144 *0888D29064919740C33DE546E53AE5B95B2E51AD Be2X
80,267,145 *088B317EF392D06F700655C75F525FC7500F50A5 [email protected]
80,267,146 *08839704522F845E528B22E205B316F592C5A8EE a3)n)
80,267,147 *088951A39DAC994E661D4E523BAE19CAD4E89528 A4R(T
80,267,148 *088E3296C56062E0571EC656CFDC0354E0DE7DB2 bennyherforth
80,267,149 *0888F39EEB7BFE89124547D091F20B3DAAF83210 beqdx
80,267,150 *088DB1A1695BB63EFE940E87ECC92A9F4A0E776B A7N
80,267,151 *0883007E4DD2213D90582B661CDAA2B0B0C72BE3 bertrambracetty
80,267,152 *088F7C4B44CD22C284000289B8694845E6AD0B1A giuseppenevarez
80,267,153 *088DA95CD61EAC0FF09ADDC665A18B30B5B4E337 BETPAUL2
80,267,154 *088D28EFF5909B1C480EC8558E6FE0ECD24048AD aab9;y
80,267,155 *088999065AB976DBB8DEF3506FC84FFA62294C14 g'=n
80,267,156 *0882115E63A1DEC164B82C0018EFA0B3BF329658 gomensoro, s.a. | spain
80,267,157 *0880C3D5904EF04A00EC16619BBEF62E391329D6 AACOV(
80,267,158 *088EC5BCBCB210C2F2AE2157EDB7F46691D9BB19 AAE;F\
80,267,159 *088F130AC244E985411E6999B106B9EB6BD0A6AB biabop
80,267,160 *088C9AE6D8DDFF6FB58533690B4D89F7045D0BEC [email protected]
80,267,161 *088D2AE48B55D244820676F89616B4777FF297FB gregoriofrierson
80,267,162 *088DC9CAEA2F0F1E2E70C873F25B51EB9B44EC4A bitmuches
80,267,163 *088BB631279896EB3D34B4DD9C536309A1CFF497 2BIONICA
80,267,164 *088A1A9F2531627223B5E3D52627B194E751CCA7 GTHR-TPF.H
80,267,165 *0882ED8BFA7F7BFB4D845FF0EE005ECEE0E19C14 A-B-C4
80,267,166 *088CD4E28928D87AF8D548C0857151DD3D578061 ABELBROCE
80,267,167 *088EE873274ECF2E786C995CF4E7950B99268E7A ABISANAKS
80,267,168 *08868288355AB7E06D6DC14F7792BD27E52C2DD6 ABOO
80,267,169 *08829A54FAC5936B213BACCF38BC787B1E6874CE bk.x%
80,267,170 *088B8008AF42D49BFB74044FE9317938B5BAFC03 [email protected]$
80,267,171 *088C46ACB3E2D87A7987555CD1CD00E6DE8B4DDB B)L/W
80,267,172 *088778CEE4010D2D15401FC3CEA2247D33C53966 2 TAMPERE-TALOLLE
80,267,173 *088473D2EE9F83F3D83CD3634C4F0E7618E1638C 2TONSKOM
80,267,174 *088156FE353DE08888C3AAA383D851A7FC355FD5 [email protected]
80,267,175 *0880864C74393DC46A7BD3C24E67686FD1760E02 bo&:-
80,267,176 *08861A3F57E92EA9E4C5F7BA0D653C8B18411763 harlanmayon
80,267,177 *0880FA220B3B2ED130DC8DBC3AC7EE28A1EABBC0 a(d3
80,267,178 *088951550BF159391EC4458BB9E0E5EA5540AAFC harveymccuan
80,267,179 *088B1840291928C7254AA4CA0F23B61C8952DCED 3ARANITES
80,267,180 *088E9DF649CD490866C39A00DEEF7DCF983DF8CF BORINGCATZ
80,267,181 *08810DB4B5AE34EDE53298306F3CB63ADFCC0F63 3GRASPING
80,267,182 *088BD1BF92AC13BF98B60995C3D3CEA1A56D9C71 3iluvdonald7
80,267,183 *08864FE88070FA849BBAF6B063C22461E0A1C9DB 3LAZYNESS
80,267,184 *0888839F89C8AD905ECC6503590DDD20093289FA 3#####P-*-*-*>-B0
80,267,185 *0888AF10A066976116283B96C18A7C432D55D316 ADRUSOVSKÉHO
80,267,186 *08860CA2DB1B0322860FD7713367DB85C43B84DA BPH=+
80,267,187 *088B32F4BB7A815C3255CB5B4D56455BF51B37D9 hershelengellant
80,267,188 *0881EB8D73CE1D71FC88C22538C5C03B01581FA0 3UITGEZONDEN
80,267,189 *0883CE335235DB4160632DF9007E33FB56AF2AFA 3 VAAJANIEMEN
80,267,190 *088E78D0DA8AE93755945DB6D3E65676983B292D bptzmnt4
80,267,191 *08803E2F70D2E38657E68FA67FB444993FD58F2F HIKITORI7
80,267,192 *0884E235F7FB7DB1C92164347EDF2B87244C3480 HIRAM.AWADA
80,267,193 *088109805542398EA44CC47851AF41920C6CD4B0 [email protected]
80,267,194 *0882E5845CDF9102390193E25F8E0B5B318BCA16 477942 JOS TOIMIHENKIL
80,267,195 *0880B136948FD3FCE0F90DE8D85876319C337D56 afq0q
80,267,196 *088E80C907D6A0310FFC862E0DB26E5259BEA579 4BOHNENKA
80,267,197 *088A33524C381B56ADDC5C90817982789C0DF661 4HCERBFUA
80,267,198 *0884BEFE8AC61482947774563F86A6CD7336EF09 af__x
80,267,199 *088A4A1204A0A2B3629138B056ADE29A4DE42111 4MADEEGAN
80,267,200 *088E9A8953C903B81D74120165F1BA3FF26C0462 agriculturecropproductionfruit
80,267,201 *088E72D0C11E8A55819BADEE5477F05179231EC3 4PALADINCHARITY
80,267,202 *08899CEB1CD499E2BBDB40FEAC6D10865A304E75 BRENTYEPEZ
80,267,203 *088FBE9706EE55A86EA7290FD30873A3B0AC564D 4PLHROFORIAS
80,267,204 *0886B6E4E188A5FD641B81CD86B58A26E4A28FA4 httpphysicsuscedud
80,267,205 *0885E84F5226A0C46A0465A58166110D7A29ABD4 BRIVUNE6
80,267,206 *088127A4C303B42051010EA5C13D59478CCEE7A6 hubertberkhalter
80,267,207 *08885DEC4DA90BF56D756664847BE6C9BB7F0ECD AHMEDABUELKHER
80,267,208 *0884A8057D31E2BAEBFA5F3C7C445FCF820A44A6 brrcx
80,267,209 *0883ED36BC2D14CED3AA64BC518D2B6B78C0AB7A 4UNCARRIAGEABLES
80,267,210 *088891F19A287EE15E997B4824D4DA2BF6D71680 50SPECIAL(UNPLUGGED)
80,267,211 *088066D2D94608C32D56C55CF65229282F117F63 hungsandvig
80,267,212 *088A3413C7785846DA7F50CE5E50099AC9E5001F BRYAN.CARREA
80,267,213 *088B6BA6EAC202A08EB098108E410EC306F23141 $ailnett
80,267,214 *08836A3EA1FA1601175679D8987E460D22A78F14 582101 IWOULDSAYLITIGATIONISEXTREMELYUNPREDICTABLE
80,267,215 *08824A4700560FAA5EA709E1C0F04ADE37940F33 bte?i
80,267,216 *088104A97ED40075DB81339B34C83CB46768E3F9 5BSWWENDENRING
80,267,217 *088832AD51B0B3DFD807748173209F17F073BF14 BUDKOFF
80,267,218 *088152BEE1C92B0D4A254CBC356D2A9BE77A58D5 ak#as
80,267,219 *088C40892FAF56A90656932A2D1BE94652B85669 AKMAF
80,267,220 *088C583ADC0D36E0A1B2E5DC77B3E10F88055851 BUSOGA160
80,267,221 *08858FCAA84A80616DF1FB706F90A59D02FFF51D 5HAWES123
80,267,222 *088ABC72E35CFE21948321AF44CA23EB6F98A5F7 IFTEMLET9
80,267,223 *088D7ECD1C7D33EFDBD99559DCC51C84A5D28A1C bvseu
80,267,224 *088E95530391EDF0FCA598A0E630EB2BDF408299 IKEFAMA
80,267,225 *08890C6F6C6192EEDE9184ACC52E1AF509170DD8 BVSYR
80,267,226 *08836D7C9E023F8C096DC9151462EC245F75DEB1 ILUVAVENGER1998
80,267,227 *08882F2C64DEC7353AF9366D1A82F35C53D20BE8 alstoel
80,267,228 *08894282496BC1A6FCB37CF360AA3341C91D3D8F 5TAGIRITE
80,267,229 *08818FBE90711841676D798318D7DC57F4E47461 [email protected]
80,267,230 *088E4A642A71F33D107B3A28A9CE9F851B9EC000 inconsistently7
80,267,231 *08829C0EE3D3F57C27A24216673876A4AE7AB6C1 amiri
80,267,232 *0887477C731C5D8F8CA8479D93F7BD854AC23183 6BSWTECKABSW
80,267,233 *08815563E14F140B1874578EFA2F7E6270572903 AMY.VILLANUEVA
80,267,234 *0883B4C88C1310B7C1F1E8DDCCE432743269B185 6DETENTARAN
80,267,235 *08827AB9F9CD59A50347F78CE560BEA38BDB17C0 c5a
80,267,236 *088B3D425519CDAD8ACEC2920FDA92477B3ED225 ANDREAKERSTETTER
80,267,237 *08867848103BB7D483457B651B11912D9FD7AA7D IRVING.BUSIC
80,267,238 *0889CE673A38930D55BD84378474F6C653046CAB [email protected]
80,267,239 *088B73C8A17B5EC14A7A4B0362E718DD4A23C0E2 angeln2009
80,267,240 *08838BDF7B00ABD9B4194C3FE6F99F1485FD8DEC 6POESTENKILL
80,267,241 *088B62D25D493CA646A352FA75013FE06C6BDB04 [email protected]
80,267,242 *088D0A721BE9CD0236EEDC771E4FAAB21C6A7CF7 canvas.stitching
80,267,243 *088CB4B5BBCB253E2FB8CC872B77E51C218BF827 israelfuglsang
80,267,244 *088544122FF8C8A99F42E282AC23BE4116C4556E 6SGNILEDO
80,267,245 *088D83FA0EFEE0F7F6ABD0DEB108254A3B350254 ANSKYDE0
80,267,246 *088CA2AFD8CE25EF236CA7017E908CECFC37F838 cappelle-en-pev
80,267,247 *088C7083ACB52FD2B0F1C701B72E9633C6387B25 ixcq
80,267,248 *08836E8858A5833B0B292DCE96E0D850EE5F774B 6VATTARFS
80,267,249 *08845A4363A5C9A502B8514E6FADE956374DBDB2 70705 suomen.mets
80,267,250 *088CF978A0953577671CBFB295C2985AE851E7E0 JACHTRECHTENS
80,267,251 *088AEE7F0B8B364CD2E39768840A3215E0F0A887 anynumberbetween1&17(altechrealtmix)
80,267,252 *088A0CF55DD68F1302C63D9488FFA31CE3B2BD7B jackmankowski
80,267,253 *0884F12448C4E58FEF076CBAC27BEDFC6EA196EA JACKSON MCNABB
80,267,254 *088C51720EA9C0AEF32C3ED5F1A7E1F657B18A89 JACKSONPEANUT
80,267,255 *088ABE452CFB19B25692DD9A62F67F3EAFF27DB0 ap;=6
80,267,256 *0888C1FC5091E7151B81016ACA70CDBEDC2D6E8F 769CHARLEE
80,267,257 *08848EA042D3BBD624BEB114BC28984F6CADA41B 779165 VAHVUUTEMME.ON.EHDOTTOMASTI.OLLUT.MAANL
80,267,258 *088BBBE2A45533ED7DFB8C1ED68C484DA7A48725 apb&
80,267,259 *088DE3E4E843158135B6422B78E2432D179EB000 APIDI
80,267,260 *08859E3FFE3606E65A9AB75ADEA839F647FCAC76 jamar628
80,267,261 *0887957BB10A89CEFFC385BF3FCD20BCCCBBAEF7 ARABISCHE2
80,267,262 *0888A8E4FED59E215536C5FF86D213C4DB2B36D4 cctm/
80,267,263 *088F602A5BED374D3D0AA953A235F7E9EF07A48F CELINEOUELLETTE
80,267,264 *0887FE37A9FD1C1E3FD56F97387F0935ABFD68C0 JCSCHABER
80,267,265 *0889CF4BC027928F8F5709F7DB7A4570BA350BE7 7INMERITORIAS
80,267,266 *0882F1992A92E8D73007FB6EB55DC0C57E11C51C jedyero
80,267,267 *0885825503D64A76A43236F2322368119752DD2D ARTYLAS
80,267,268 *08802119198CF714EB8B00E64E55352442543993 7PSTELTIIN
80,267,269 *0887B94CBA74A36BD5314992F5309E888A2605BE 7QWERTY126
80,267,270 *088E94E5312E224DE195980B95F9CF5100134A06 ASKETRS8
80,267,271 *088C80172089D0B3CF709274E984B0A6B46C7FF5 [email protected]
80,267,272 *08867682E6D3B5DD73BE8CF50B51A9B8C7152F7E 8723-flight
80,267,273 *0880207346B3775096F16F895ED9A6A2256AB5B6 cfxky
80,267,274 *08867B0064B9F2371DA5E312070B70BB98ABDF70 8BSWBEABSICHTIGTENBSW
80,267,275 *08886A3375B4C28CBB4AD2BCE3DAEAC6CF34166B ATAYBBIL
80,267,276 *088E05D237141C75C895B33F6826DAABA6F4C501 [email protected]
80,267,277 *088854A11E0B668AD4FD59EE8738CCE72C32A3B6 jllchael
80,267,278 *0884A8CCCB40F654770F433F2D0B9D7992BB7B24 JOAQUINAMMIRANDA
80,267,279 *088A73D35A3CD934D445FC26AD2F125BF9568C58 JOAQUIN.PICHARD
80,267,280 *08892D51B5B69745870CA2AB31A2EBE99B3B7ACF [email protected]
80,267,281 *088B3F95DFDF4C301E9CE250EE967C74C384B251 joe.marrese
80,267,282 *088879EB00F2E384684F95201F0AF8DDD1C65717 [email protected]
80,267,283 *088E2BC15D1FD2ED154C6E0D6909DB2E9A22FA1E [email protected]
80,267,284 *088D51A3D12A57C67983E5224FEDABF0B7E5611B [email protected]
80,267,285 *088FF0379BBF0F240E0935383407E4039D2E102E 8HMEBNEF
80,267,286 *0881DCEA96920E11D06C84A16761C92A26BA3BD1 8ILUVCHURCH6
80,267,287 *0886205B33F95FE314BB6EE3584871D123462735 (chiffre206)dansededorcon
80,267,288 *088C03F1953C1E3FEF395F9D4A2397BFDD7B8BF4 jonathonabdelhamid
80,267,289 *0886E17C3E2D206FB4E568226B7C3A4F076CABC4 8MOLLYAMERICA
80,267,290 *08864F671C3B3ED997DA528113A9B2ABD6DB27DD JOSEF.KORBEL
80,267,291 *0881D3DCB746206421C7F0427FAB2F71106A03B2 8MUGGI
80,267,292 *0883621480FCA8DA521A057E5A8D6A69CC77F9C4 JOSEPHKOPKE
80,267,293 *08887FE55176A861907A6936D97A450F5E4EC963 JOSEPH.MAGPANTAY
80,267,294 *08892ACF78A6A867DE94CB74348579F9A4ADD028 joshmumpower
80,267,295 *088B35706711E96EFE3C4C1AC5CEC1A36700E408 [email protected]`~-`~-:p
80,267,296 *08886C77E0271FA0B249268DA6BBAD836E46AF50 CHRISTMASSTEPS
80,267,297 *08885C0D27B43699BE8A8C430D32027A3377B74C 8prenotando
80,267,298 *088BC63722587DE370707661190E96129B8D10C9 A/!ZB
80,267,299 *088C08B840226F60400F548F7A148AC4E664A550 8TOUWPLUISTS
80,267,300 *088441866BC754432A88BC5E1A50D293AFB3994B azt%,
80,267,301 *0882DDE73AD84A13E5ACC071167D65AF1AC7440D KAITLYNN151
80,267,302 *0884479C81A26676E9E1D75570F8F2F8406CA9B6 9-05-1260
80,267,303 *088CC7D92F5E184BC3C522F77060EE7C6FB77443 ci!o,
80,267,304 *0882A788E54A5206C7DACCF0D34103A2D4493743 cjh,h
80,267,305 *0886EFCD1BD7CF57A057B371F80CB284C5E5B2B4 ck_5t
80,267,306 *088042EAA4AD103D7C9276B585FA16C8C8FDB670 b5";
80,267,307 *0887852487307D580275A4752271116EDB94B67A ck(m%
80,267,308 *08817A35070BD3FB3B145897BCA2EB5D96D2A7D0 9CASECAD
80,267,309 *0880E7C60B49A4A7F6AC1835499189F1E9B1F89B CLARIDON3
80,267,310 *0881EA30B8B96D7B38B0E60D6CB3BD4CCF029D90 CLARK.THAMMAVONG
80,267,311 *08818F3E0431E9E72B3DDAA1083FA18DEF7DB028 KBCOASTERGEEKPERSON0
80,267,312 *0880766CC3CBFC0DEC6DBB63C96FE4E416E1E946 9DENNISEUGENE
80,267,313 *088908625C238E13EE9CAC33C48A3E10994D81DB KC$F
80,267,314 *088C0212C1B1896DCFB589839528BBCD3C9B50D2 CLEO.KOPALD
80,267,315 *088443FB56AF62DC755719319A50D928D352FA5D 9GEOMATHEMATICSBS
80,267,316 *0883D06ABFE9DF105F78D200F61FDACBB0074CF5 9GNIYFIBALLYS
80,267,317 *0882626559245C5463497F300EE88E4EDB62C768 9INESKESI
80,267,318 *0880E37AD538CBDD30165E0731D9FAA2C7E00BE1 9LANDSWIRTSCHA
80,267,319 *088CB15C9E6012F619CC8FAA59B3B77DDA2CF94D CLINTON.JENIOUS
80,267,320 *088C157CA6A15E1EB7F4713DEC950438A9FCA0B8 9mangeons
80,267,321 *0881F8DF331B2D63B4614766979ECB4A2C573497 [email protected]
80,267,322 *0884071DF8199209CBF986CC260495A2D3B0D625 .BB
80,267,323 *08800E3617AF5560AC8F982C5A6C82C657F5B99F KLAUSIRISH
80,267,324 *088BC723674A59BFD6141AB3BD93180001854D9B b)dk
80,267,325 *088F128660089B8C06ED1149F321A6B43B383333 kngtlln8
80,267,326 *08881D60F0FFC023AAAEF4AB6A3BACA92E4F8E1C B)_E
80,267,327 *08864E1A980D682A3FE4E49AFF967A0C1630A016 [email protected]
80,267,328 *088536B5EFF19F86CEC2BDDB404AB6800E53962B COLLECTIVIZATION.1
80,267,329 *088F3346FD75080FEE203A738AF02544AF9A8E93 KQGM
80,267,330 *088129FE74D3C1399BDB4786F80FFF8D6E40ED19 BEMP
80,267,331 *0889C2602AE5D8F28E3EC550A894FF8ADF73795E A5J13
80,267,332 *088F94C6056C37D802F6D07353A9A7F911CD1799 a6gsk
80,267,333 *088055B48AA72DC92E45B529D9D3936E66297438 be+p?
80,267,334 *088E0B77D101F496A69B93133C112998BF1B36EA a(;a=
80,267,335 *0888920F87849DA273CEA6B17A44A32EF8786114 a/a0k
80,267,336 *0880D01C6919CA5515EA9A917F90CF52501ECC9D AAA8:
80,267,337 *088CB361F4EE3BE42A289E3C6C7AD71C59B83AD0 COPÁNA
80,267,338 *088E7AC5939083F34DB0BA35D908732F4D337AF3 AAAPVJ
80,267,339 *088B81A279C6392E0C7BEDBEFCA2D26260873D7D Cora.Novoa
80,267,340 *08804DEBD48F83E580952A61B3D0FB9E7D61B938 aaa^x
80,267,341 *088D207D000AECBCEB02ECA0CACEB422A48F54EB corneliusstachowiak
80,267,342 *088A1562D36DB6E6E8B33EC72DB4DFC4DF710865 bff-l
80,267,343 *08866D8F783FA65B7BCF1912CD71E67B3BFB16A9 LANGUAGEUSING
80,267,344 *08881884E01F9A931C56B7F16245D818BB87B470 LARRYDOLIN
80,267,345 *0885A9EC0D1613C102AFDD0E99522D6358E7698B AAD$XE
80,267,346 *088AC0713AC527A29297972183D926D90268DA0C latrope4
80,267,347 *088053871B818867DB29DE9CC9C980490380CAE5 b)ik
80,267,348 *0885024F2F96E8D7B8FD442BA9D11E264DDB05C5 BILLK47M
80,267,349 *08801831292CAE879AB251ADB8ED3CE906632F7A C,P&
80,267,350 *088ECB0B4D3E0BE99044EC6AE50209D7D13F8E5E LEOWESTENBARGER
80,267,351 *0885F67E74143E4C9F23FB2F3250D26A534F6988 AB2VB
80,267,352 *088648E0307BD0D4C3B0C765E8007ED5E4213E0A ABERGERNHABICHSIEDOCH
80,267,353 *0881BE7CE8C3E175AA8E43DA5A4DF2ECD1715D74 BLUEORANGESLEEVELINE
80,267,354 *08825F5E934786015326628118EA5EC05C9A36D9 ac3tob3nz
80,267,355 *0883BFB12A476EB929F598D8EF5D5774717221B5 [email protected]
80,267,356 *088EC84CE46145E2D6375A316A4D61BF26F855AB c;)r(
80,267,357 *088447C483FD3D12636DFC31D8EC4DBF4D5EFC3C cr0wn-gea
80,267,358 *08805F5CD8AA359844F212AE1B14336EE09FDA13 acmol
80,267,359 *08838DC0F7E1395280AC3B0A41AC580975FA24AD CREIGV
80,267,360 *08835D36791DC35D64BA20617CE86E9F1C82F091 CREOLEH2
80,267,361 *088FF0339CE0D29A81D69805755290CD1CAA4CF1 CRUDM
80,267,362 *088A7D06D20DE6DE11C65E73F6F5167533749CAB CRW7E
80,267,363 *088802090EDE99C02AB4C53039AD340839A7E50C CT1122
80,267,364 *088AA62911A774023E696D9227E22BD82740015E [email protected]
80,267,365 *088CB0184E328A9BE06BC427648E05F59E867D28 CuB2
80,267,366 *088BBC2C60481AC81FA5C7C0FFDE1CA3671BC17D AEK0R
80,267,367 *08867E0DD257CE734ADAFFCF22A028EB72422200 brendandenfip
80,267,368 *088B729E98970BDC1798B62FA58269F5C63C2148 BRENTONBUNGY
80,267,369 *0883CA7DE19B55C998E20CAB0FCB737A32C7A5C7 LM4382
80,267,370 *088F95D3F7812BF7581B1C083DBD99A00F91AFAC cy.1y
80,267,371 *0886D50CCF44D2DCFFEE31BE461DA2882FDC117B BS6FQ
80,267,372 *088DEFA8FFE4BF1E4A6C3AF730C8CFAC51B2B621 CY:ZG
80,267,373 *088774E0A26F186044A5012E6EF91735648476DC B>*Splat!!
80,267,374 *088F4EDA7E3B5D2AC5CE770D1B8CD98372554830 LORRECIA0
80,267,375 *088C6BCD9F865B164E25F3A10B51F65548862178 bswkunichikabsw
80,267,376 *088659DB5E9456F9EEDC708580B5182D0919954E [email protected]
80,267,377 *088CFF64DF0CEF247D1424CB2BB9822C97EB97DF AILGATSEV3
80,267,378 *0882D8B976E3DE2FF25C48C48CD4FE4DCBBEBE9D [email protected]
80,267,379 *0885EB5AAA44BD6ADE68E1AF82238EED4A50FF84 AISEBASTIANSTEAUA
80,267,380 *088184388EF7FFE8CD1810CB1ABE8A6F7E2C579F aisescasterman
80,267,381 *088D63890C6A704B85C6FE57B71039F1893B478C d=4c8
80,267,382 *088BE79DD081D933628DC8F02B3FDB8EA74CC488 BUDGETISERAIS7
80,267,383 *08845016275552008F1748190A7BA78C1A30C521 B#/VH
80,267,384 *088DE0693B2E35C322B9C108DCA0D9CA2E7DA012 [email protected]
80,267,385 *088E4589629D2E2CF9B2329C83FB916502459245 m47rcul473d
80,267,386 *08849B0336EF94B5C892017946E86E781C90EF17 b$yt8
80,267,387 *088343C4DF4D122047D7014E50D5B8D792D33F73 alh8m
80,267,388 *088DF81A27AD7B0EBB46D9EC120DD12AED6AE389 MALEŠICE–HRDLOŘEZY
80,267,389 *0881463C4CB9A2EF33F5303208C67FB3181EC6FC allegro-(attacca)---symphonie-no5,-op-67,-c-dur
80,267,390 *0880913E4503652960D3DC373DB10327EAC564E7 AL.MUSHTAQ
80,267,391 *08835460E2ED7FA5790526A224012098F7A1317A MANIADOR
80,267,392 *0884ECC55C5101E7DA65676427CF65D43C7A7671 DARREN.GRAVERT
80,267,393 *088ED15914E19513A54E0E6723082764F128FE8F MARCELLUS.MADUENA
80,267,394 *088B21CAC6D69FE8BB956A79666A3506F6A7750A ALVAERKER
80,267,395 *088CEFAFAEDE99BCA49B56AB7A622EF4C24BC3D9 ALVIN.PARK
80,267,396 *088A152629F733F990528B75C0580578A7703B4D C4QN
80,267,397 *088A11FDD4A5A5644C576D0F4356E1D36F488117 c5a
80,267,398 *0880FFEFEAD9B1CAFB5B01A807D1199C184DAB91 AMBROSEBETCHER
80,267,399 *088EE7786574B8305720FF466462F9BA03D177C1 mariamagyar
80,267,400 *08876D610114FEED85F1897D4ACE3645210D72FD ANDRE.BOURBONNAIS
80,267,401 *088E3C215FA3C836B11B6D677FDA262978255FE9 CARLBUFFY7
80,267,402 *088F2635C6FE73FC006CDA5FD57A3AB9F0AD6F5E carmelosadahiro
80,267,403 *0883CF077F83B463C567AD339CF62EAABE553618 DECYCLIZING
80,267,404 *08800A0DA311B6E71749C593EAB1991F2732B14B annoyance6 (glacial tektonik mix)
80,267,405 *088B2FC7E2DC660A0B3647BEFBDDF88770136A04 MELSTILLION
80,267,406 *0887BAC01F035479CA8104EDF5D53615B2D26085 cbl#g
80,267,407 *088FD5AFB50AA9AE337965BC0B62614BFC68B156 dehnungsaufbringung
80,267,408 *088AB19A97C6C666403389C949CC9BAD80CD38E7 [email protected]
80,267,409 *088DA23E92AFDB558B3B0E1E0C16094A196516BE CECILREIHE
80,267,410 *088CBF69DC34E441A0F0F0F68AC483A1AA125ACE METALTECHCOUKWWW
80,267,411 *088F50C30D1D860403A6A4A45EA568720DEF4F1D ceo,a
80,267,412 *0885184A953B20B0DE04CFC016491C1519F71048 CGAD9
80,267,413 *0881607FD26F7037521C6BDC33781A4C5BF2A589 [email protected]
80,267,414 *088F2D00DD8786DCDD415574DF7A876DDDCFBC63 MICHALEPROSPER
80,267,415 *088532CA0DD1ABA881FBD833F6E190F2FD415B64 DENNIS.SWOPE
80,267,416 *0887A47470D1E0C9ABEB016F45F567E407270A76 CHEESE.FINGER
80,267,417 *088177FB3F7C579E807B6E0A7E22FD8428A9C778 DESCRIPTIONEPIPHANY
80,267,418 *0880C88F7366A70411F3336A09BDA6089F8E4D1E [email protected]
80,267,419 *08834DAD660E7021EAF46B054FE79B54C85667FA DESHAWNFERNELIUS
80,267,420 *0880FD70D777B033EA6B8C694F7BF04293D4E770 appzn
80,267,421 *0881D4FC1FCB67CBCDAC38DD8DB67703C656C5F0 dewaynearbucci
80,267,422 *0881B0072462673E61A2808DFC95B5DD052E2B49 archieguardado
80,267,423 *08817454ED59D657A09ECFB87A14AD14B49F0143 mina.manavi
80,267,424 *0887FAF8F8516A17E55E756511B226458CAD9C8D dextereasom
80,267,425 *088CD5B0A678442DDCC0AD28FA63C33686AC4637 MINMIZED0
80,267,426 *0881249373C695D3A80B9E4A0EE536AB561EA177 CHRISTOPHERBRADY
80,267,427 *088A136D112BA1E535B5BABE88DB5D242E31DD5C misarski
80,267,428 *08842E71E40056B79777F946EFB251655EF16EEC DG#OJ
80,267,429 *088507D288AB73AEFF7A2403447157C6626A0247 AS211165
80,267,430 *0880D2972C6B0333669C1A9EE8293F4D1471D756 MODESTO.CODD
80,267,431 *0887CFE4743021DE290A8FE42BDB05F9C406548E MOIOOIOM2
80,267,432 *08893FCE3E8B2A525D36567A71D6D24A95744D56 aselection
80,267,433 *088219A45EFFF3A90BEDFC946373A379CEFBBF71 A-SHORT-MESSAGE
80,267,434 *088FEB9412D293C9F693CAAC7A585E31CEB183F9 ASNS.
80,267,435 *0885D0465FDE8CD71F0AAB9D6D95C24690D5763A CLAYGENA
80,267,436 *0880134B2ADFDAD2F8327C2FFA147CF70349F5C8 MORGAN.SUDDITH
80,267,437 *088177C0D4C046878F656277BAF94F14529C4DD8 A)T44
80,267,438 *0885E30152524F37128537A87CF1DA440D5117F4 mqed
80,267,439 *088FEF8332AF7092C9295370B197D3FCA48A55F4 A)U:K
80,267,440 *08855023FB70069D9BB1896DD8A7A2796664C679 dm#b
80,267,441 *088024AA603B3244BBA807EE3CA2CEF9D106ED61 MYRON.DUSZA
80,267,442 *08815B7DA16A121DF64A5157008E1D144200EC4B DOMOBRANUS
80,267,443 *0885B674F15C929CD2F76ECC626DC6550288207C [email protected]V.CSIE.NCTU.EDU.TW
80,267,444 *088F7AB3CCF969208CA43A2FA7452D1F0A2C65D6 commonbuzzard
80,267,445 *0881A32323679AD436CD9D37CE83C5E8A043A0C4 MYSTICEYES(TVEDIT)
80,267,446 *088D1ED88E4712E660D59128474764A7909B55D1 [email protected]~Y
80,267,447 *08815FFC68461171EB3F5653C7990C998E6E4167 DONNELLMEDLAND
80,267,448 *0885098E39BD07961032F0D14CD412A1D44390F3 ayt#
80,267,449 *088980E4B9F39C49C2D12342952F971B7D24A080 (~_^)~`[email protected]
80,267,450 *088D539CFD75E7AB7E54121CF5855B14B7A8224C B###)~0-(^_~)
80,267,451 *088D427975EA309E4C4E72C1AE552730464591FB $+%b00$+%borgsearchstring$+
80,267,452 *088A98ECF2F350A78D7A5409810B33D666EBF3C4 nayehchandhogashart
80,267,453 *088BC90F3E3DDB8DC7934213F979791EE743D4A4 DRACUSORULMEU
80,267,454 *088607E099E91438938B6D6BB517901F5FF5AC1D NEUROENDOCRINIEN
80,267,455 *088E6C5B59D6E16381B9E85BC0349DBD78699BD0 Ba5f35
80,267,456 *088AEEAFE1F42BAD96B766E304AE7F0F14A20FC2 BABYLON5CHAPMAN
80,267,457 *08826F7BC9A3707E94D78A8052545FE1AF5C9ED5 BADFACES
80,267,458 *088225F6547A827815B3498C1EA0E655099E7052 [email protected]
80,267,459 *08817D54ACF3C2498CD2076A050791C02821C39B B%AQ1
80,267,460 *088F0118D334A907C1283BF5C934BEAE2EF924DC Cr#=
80,267,461 *088ABB47AC577F6BCFF8C8450405C5455C2C356B Nikadrobom,vazdataxijem-bestof1
80,267,462 *08892BEA5223823D50047949686C4ECE110F26A2 CRAM.GEEYORE
80,267,463 *0883EF08EF4234C49C6AA4908453079EF5A3F405 [email protected]
80,267,464 *0886DDF03DFD04DA55D41B034DF493FE1D43E20B NOJSKEJR
80,267,465 *0889AF90BFB46A913186A8E75C3E27EE699B7F76 B#####B*SPLAT!
80,267,466 *0883AF8170E0306CB4EF12A5692631EDBDAB84E8 BC8EW
80,267,467 *088DF854DB2A38B5498D7D295BB28597DD1EBA47 bdkhu
80,267,468 *088087B9B6E0234E60908826CEA38173FD348AF8 DWIGHTFISKE
80,267,469 *08859446609EDE07DCD3BAC608D0F6474D538489 cumpadre.meu
80,267,470 *08882EF158C0192C9C0DCB2CF6D553725A61E281 eanabsw8
80,267,471 *0888DE659C5BF5FBE37885F66BEA9FE4E84B6CC1 c)#w1
80,267,472 *08825534813E86494BE78CB762DB1BC67E678E84 (o_-)~-~-~-d--b
80,267,473 *0886B0071A3E5A57F41DE7D509C3D355A688C070 CX-DU
80,267,474 *0880A79610AC11629EA13AD2FE630C1A7515F90F BERT.PHARAO
80,267,475 *088D0C313B7A269F5E0C9F7CA4A11265AC978F97 EDISONHORMUTH
80,267,476 *0885BCA53D8B28F63A83AB1DA9CAB882951414D0 OKREGOWED
80,267,477 *0889F19BED0BDC26A233CD8D527826CF68939D4C d2!_w
80,267,478 *088E778D8AFC06A4682C63A663F910975C83C543 omeredol2
80,267,479 *08829417CEBEDB90778B2802FE18A23E5BB7E96B D3O5
80,267,480 *088AF93BFC42A76CA4B79183B7B23C1907E16B73 O->-< O~O~ D#3
80,267,481 *0883092C580B72C5CF8960D80948E78EFDFDAD30 D7GVP
80,267,482 *088A5F8EA7395AD6A35E8F5F1015502E87FB3818 BHTI6
80,267,483 *0881473A28C43DDF3C4CA859A2274B7CC6D88AA9 OR_99E.SVG
80,267,484 *08827E2350EB0C6DD1C9205D0B584874959C5ADF EIHCANON8
80,267,485 *088C2972BB196AB5746AF695FAAAC2D061D61E7B DALTONMACRAE
80,267,486 *088695C71F1FA5078DC45FCC03E797063AB883CB OSLOLISTENS
80,267,487 *088A6A9CF0836AC89F2658D3672251C2F4219FC9 ei?t4
80,267,488 *088490B92B5473AC7DDB68B50B1EC3171D983232 [email protected]
80,267,489 *088F99249A289C7475806C25C0FCFC1A9B122953 BKHATEEB
80,267,490 *0887657B4CE7DD7FD5137257E925213F69D1180B [email protected]~ ~(>-<)
80,267,491 *08815FAED61EAF095AC9F055650326A72DAB7443 [email protected]
80,267,492 *0880BC11800560FDA29F4044FD8449B44E69998E BNU-
80,267,493 *0883168110580FF44A98627D12E4B1372386E6BB BOBBYDAHLGREN
80,267,494 *0886AA5D76264A3AB2AF05289D0FFF9466551B92 parkertremelling
80,267,495 *08807D90CC8112767093A01C51478CB09FC2FFAE emilyadao
80,267,496 *0886C38218F72B6B57022AED1A70DA35B4D0DD97 PATRICKMILLIAN
80,267,497 *088E595ACCFD1F636C0AEE0C28F8AC0CFEEF49D3 patrickyurkanin
80,267,498 *088FB367B986D6B6A010C4E923288F8D85174BB4 D_,CS
80,267,499 *088F37B1DBBC88645CF9D9976075BEEEBE1AC85F dd5:r
80,267,500 *0882FC0296EB5078040B989877463E2B996B37B0 PB.*.splat
80,267,501 *0883A241376CE00DE91325B42B28C48D2DDA1A29 BP7_N
80,267,502 *088B1E07F27E69DF8E9CE43EA6EE9E07A099618F PERCYFUN
80,267,503 *0889A7E78834276A4A6C6563A40C236B2B2DF8D6 ERICK.MARCHETTA
80,267,504 *088279F3F84EE048E2CAA50E4A954F183BA2827B PHALVARSON
80,267,505 *088D11E88A0D7146924EBC1FCFED171EE659826B BRÊGESTRJITTE
80,267,506 *08876343BAC1F031CC58F1A3BC4F88ADA89075CD ERRATICAEXTENSIA
80,267,507 *088F82DCBA54951146534D82011969C638D63F38 PHILO SIR,.SOMETIMES,.WHEN.HE.IS.NOT.ANTONY,
80,267,508 *088882DEE4F1DB5AEC20B735F61AC7583EC40856 DEPARTS3
80,267,509 *0889B7F608065872D29EF623A8E23D60FD67F765 britaniarrengan
80,267,510 *0886CFD452F7A6B30E7426AE2724B5B743B285C6 ESQUADRARSEIAM
80,267,511 *088DCB8232774082FA36681A3A587E5F3F7D9FF1 estevan-martinez
80,267,512 *0883050C88971EE3C4D55130365D594965233ED7 [email protected]
80,267,513 *08884D11D3FBC3D6DD8915998B625308D661C7D0 pinkydavid
80,267,514 *088E71C27BA444C7C1CEBCE44E6708DD026F193E ETAWARAT4
80,267,515 *088CDBD4CCD004CE9349675A5E77E9A37FC4B44A ETERNAL-DESTINY
80,267,516 *088850D30D8E2A288525D495F7773FC375DD24F4 brooksgothe
80,267,517 *088847CB2B2B6EF91ADDCEA8C5506DB11422E027 PLAYING GAMES (DRIFTER REMIX)
80,267,518 *08888FF2FCA7FE09CE3302A3557148D7A8CC79E9 PLETLLEKIC
80,267,519 *08848EBDD7A6FA86F92BA152654E47B59D7C2350 BRUNO.MCMAHILL
80,267,520 *088FB6A975C1F4E436E752844CD64901B8C64117 D.EWI
80,267,521 *088C85987E4D3EAEA74F36FC52F9F855C3186670 EUQCAOCING
80,267,522 *0888F1ADBC636E392CFD815347AB8E63E6F9F6D2 DF$C"
80,267,523 *08849358E90FF7477C960D1A5DA17F3B2253B97A bsur(
80,267,524 *0882BD218EB1FFC94B238D53F4752BA2847F1BC0 [email protected]
80,267,525 *0882455341F737A47708C2B11D9668891CF3F9DF [email protected]
80,267,526 *0886821A7EE3F62D08C5BBFBBEE3280D6307BD8F ey1982
80,267,527 *088A30573F3D63FF5BB9114FF729743D42B481E0 BULGARI
80,267,528 *0881273EEFF370331D12359E803A36CF5D2BAC14 F93957
80,267,529 *088964C24933A1F3DF4BE0AF02A170793789C58B DIMEBAG_DARRELLINFLU
80,267,530 *0886FF4EAF54523CA2A9053FF7578A6909680C96 fat.records
80,267,531 *088615B992870BCDA66107C2F13D501FCD8BB47E faustinobakerville
80,267,532 *088024BAB256AE2B4B26FF2EE6DDBD0AE358DDD6 B!Yo
80,267,533 *08854B016C712E2BA94111FAFBE11599AB39409C procesion.rural
80,267,534 *0885127BAD353231533DD6BC7E64464EC7A253B1 PRODENTINE
80,267,535 *088C9ABE851A5BE0353F573F39E69F4D40D8DF25 PRŮŘEZOVÉ
80,267,536 *0885AB40E448462BFC05AC217218588ECE6FBB82 c0nven710nal1ze5
80,267,537 *088F69D7F0F207FFC921C998A6A85C3A53FA7205 d-n?o
80,267,538 *0880B23AFDC7CC9EEC664808649FA7FE3D24B1A6 Q)~0~OO><
80,267,539 *088E31B782263289AA1C5DBA151E53E60737ACE0 c6l
80,267,540 *0887F853FB0513838119DCA3633D432CA528455E feormaths
80,267,541 *088D7A85984A5C50AE7E35AA36825B4D89A47D5D c+7&m
80,267,542 *088B76CFE5643A72E925D07DB6E9C6876DB372FF [email protected]
80,267,543 *08867484A9A9AEA230306EC7012F0FB85D35F279 FFMXWTP0
80,267,544 *088AA63645CAEB87AB208F5904C167A5AB9EDD1E C9JHE
80,267,545 *08885455C9374CB5BA785166C07C37468793FBBA FIRSTMCB6
80,267,546 *088930C3F40B02D5DC4683F1CBA94290AB395809 [email protected]
80,267,547 *088E1E1573D0C4464FF0FE7ED1CA8363AB884CD8 FLNDRCSM4
80,267,548 *0884B2F258286825C30322967EAB41FB8F484605 Dp%9
80,267,549 *0886113BBFBC6CFD220B90519E90F7920A26A275 QUINCYKULAKOWSKI
80,267,550 *088E026706456D93E253DD255DCB9F2E5A13DAA3 QUINQUELOCULAR2
80,267,551 *088D673DAD18FA26C7C96A3B5D48CA34B74838CF cardone646
80,267,552 *0888EB0B7A1CA69AC7C9939CDC213C9C7BD7B9CC FLYING-OVER-THE-DATELINE
80,267,553 *0885D96F185C20A110C861124E63CF870D8C54FA D+RE4
80,267,554 *088379A3CE02D7A3556ADE114A3606EEDE4F2CBE [email protected]#
80,267,555 *08883E5AE6139259475BEC9AEF51F6B571EF675D d(sdd
80,267,556 *088B849D140FAB5E9F9B6E5F9DF95942130EA268 RAITLZ
80,267,557 *0880FD7F150E78D59A59CD6DCFCD21DB56882BE9 CARY.SARSON
80,267,558 *0886AD8C0C3A2F745DE2E5213164543F3326DBD7 FOSTERDEARRING
80,267,559 *0886CA44AC114FD148A186108E9D33DEE8156F00 CASSIESTORMER
80,267,560 *08829A1B27A40AC32C8EA157D6E1A549D0CC44D1 CATALYST-SPOKEN-WORD-SF
80,267,561 *088AAACE27F25C3C1C92D313726B856683461EFA ÇĂМĂЛЛИ
80,267,562 *08849410854DE09514CF274A94255C1F3E7F9CC7 cb5;_
80,267,563 *0886BC9223BBF4DE3809C0B1160BE721E7798145 cbezv
80,267,564 *08816A3F1F932AA364B294B7CA519C176F5A7D04 [email protected]
80,267,565 *088422D3E0F35D323343991014758BAF82C68EF4 d_ufh
80,267,566 *088483699684161789077BEBF82E2955C2714576 FREDDY.SUTHERLIN
80,267,567 *088EFFAF476B6BFB1AFFA9216269F9ECE93A0640 DUNCAN.HERSHA
80,267,568 *0888B43D0CB9BB89A75B0DE8074246EF45ED64C2 dvg!f
80,267,569 *0882DD07F7C06160832BD787A4215F9619A2C80E D/VUG
80,267,570 *088A19B9B0095399121C5529952E157DB4F68D65 REDEVELOPED0
80,267,571 *088FB7BA91C43EABD79F0D62C663770316F5B4A6 [email protected]
80,267,572 *0886EE87F66D421B60D47FAEC312ED3B22B65FA3 CG2F
80,267,573 *088ECD3AF05E806C892E44EC2F901C3191B2A510 Gale-vs-Oliver-Swab
80,267,574 *08896B607899AADAFF9916D6118F8247E6381D79 EAITASSAF
80,267,575 *088C6F0CFF34712281D027E7DBB7FF1C47D3563D GARFIELDBELZUNG
80,267,576 *088D1191B4529C5DC54977FB0845EAF94E439485 ebv!(
80,267,577 *0886626DD4780A0843076CFC9EA4B2A75362E2A0 chantelle-stroman
80,267,578 *088C3CFF171A131E310E327A564106BFECC793C7 edgardoosburne
80,267,579 *088C8339341CB9E5795225EC78C6EE9D968AED9E EDMINIUK
80,267,580 *088BC5F194938E1C4E4C8DDD839F9B275D1E54AC GAVIN.FELUX
80,267,581 *088A00A295EC0E884F61AF63720DC6603398E4F9 c#hd3
80,267,582 *0881F05E32C39FA8080444DC834206BD09CFE84F [email protected]
80,267,583 *0885E77BFB4AB92D47ECC9EE6E9B6F2689CAB603 [email protected]
80,267,584 *08890D1BE7D425B979612588B7A426ED383402CE CHEPHERSON
80,267,585 *088AE8DA9CBA345B71829801C5319681034FCDE3 efhk_
80,267,586 *088B84BD4665208B073F704CA5FBC075BB44961B [email protected]
80,267,587 *08839221F4C2E8AB09DD680A953F73E27FBC5B67 GEHAARKLOOFDEN4
80,267,588 *0888B44694FE2EBAD916F3301A75AFDAC9205E4C RICHARD.MENTION
80,267,589 *088764E757D83E4CC106CAB7F1849F9683CAE69A RICHARD RICADO
80,267,590 *088F3F3ED784CD38B937653063C80E7B252603F1 eldonswarat
80,267,591 *088FB438B52FC02730C5736D96D6311BDAD8AB3E RICKEYSTAHNKE
80,267,592 *088AAC0DFE5C276C0365B47F2EC2F82228554E93 GEWELFBOS
80,267,593 *088C0FC5134A68BB64611D56299B9887D00FD844 ELISABETH.OLSEN
80,267,594 *0885EB288C381A2130DB23AF209CDB509AD4FE30 RIGUIER2
80,267,595 *0884627F7DE8EE37EA92A91F5C5FC2537A369602 CHURCHREACHED
80,267,596 *0886DCC773448BFA63575856FA8FB17BF2F8679E RJBUU
80,267,597 *0880FE7E641D14E2F8AB20E759A805821D72640A RMCR
80,267,598 *08826E580BE6B7FD3693B01CFF498A9808B941BC GKMI
80,267,599 *088C1D2361D7AD86988C080AFCBDD9A2EB00BDA9 EMMETTBRACKEN
80,267,600 *088F7F19C06036ECA3A882888F3183C7A3B215A5 ROKWER
80,267,601 *08806C7AD2322F0685656AC8C46122F8554C1814 rometrie4
80,267,602 *088D2B59B6141DB82F0E8992C0BA677544559A10 godase
80,267,603 *088494B7B60FDD900E71EA72CD207D46F1F2D697 GOD-SAVE-THE-CZAR
80,267,604 *088EBCB47DC03E619378F616301112BECA803F8F RORYNORDGREN
80,267,605 *088DFD5CB871EE2418CC4B41AB182A9F54319FAC english.premier.league
80,267,606 *08864FE4F3E82B10CFA20CC37E6613585E2F72FC [email protected]
80,267,607 *08863E5B4370DD07EDF0BDD5B1F086302062A5A0 enmiladodelsof
80,267,608 *088228D9A4790E91301E5008384C971487E54E46 ENRICHARD_PMAN
80,267,609 *088AB33197B6F0653BFD76C5F6C9A9905F548B65 CLEO.DEES
80,267,610 *0880E2316633545249BEC86156DE15671296F2EB [email protected]
80,267,611 *08848C2623FB02F0B0291F4EE25FA3FCDC2CD58A rs7fap
80,267,612 *0886D93A608DAE61DA589E312F0EF5AAFA7465D0 episode22
80,267,613 *088F94511947B923418AA696A7BC41E2C2AE17E2 GREGGDARITY
80,267,614 *0882786A01FFB486326F35634A455C6ADD8F8B78 C(MQO
80,267,615 *08890C0BDDC5D3649A89C8663437F48B26D86520 COCCULUS-1-0
80,267,616 *088BED07D37AF5789BA48B870C728668F96CB3D8 sa$#
80,267,617 *088BBCAF9C0ED33D606E564CDB7E4CAC170CEE21 CODYSHOVE
80,267,618 *0880FC1368D23A8B907A497AFD5E3226877B5659 sachinjathan
80,267,619 *088CA198CCECC4A7FC6155659AD981E9D979F97A GUS.FASEL
80,267,620 *08883835FA776BE94BDD9FC2AC9D023B85D3DCCF COLIN.RUOT
80,267,621 *088FC34DEB5158A9039B4638350A2AF9D6836050 eshon
80,267,622 *088E730993C0E7330E0969644DF97105B82FC781 salvatorevillano
80,267,623 *0885088771132DAAFB8AE18766279AD824500BAA H^?[
80,267,624 *0887445ABE0AA408BC5B02D163E1A582C1D5D2BC etareblani
80,267,625 *0884E2BA69B7761258F1524B52B2C48F54783F10 ETIBGUB1
80,267,626 *08806641B3E07EEA2FAF14C5AB0957004F3DB114 CONCERTO-NO2-IN-C-FOR-TWO-PIANOS-ADAGIO-OVVERVO-LARGO
80,267,627 *088EA2626C3810EF657D7644F32081049AC11238 HAMIDREZA.AZIMI
80,267,628 *0884D24FF4551EA517344CFE9DDB206BA639BE6D eugeniokaaz
80,267,629 *0880876B0AE8F43F88FD83A80B12237D5EAFD03A eupp3
80,267,630 *088642B355210036D8EAA11D5F1E6370BF82BE6A hansporter
80,267,631 *0884D771D5C551439DF51AF5E23B8C0F8037D165 HARRYHAMMARGREN
80,267,632 *08810169F3C54016B73669FB9194F8F98B875631 HARRYJOANNA
80,267,633 *08849D3B9F2621DBC1D0DCAB62F6F4084EFA4AF6 COURTNEY.DEUS
80,267,634 *088D6E543C433BDC119130BD692F6D56CBA2A776 [email protected]+ON$
80,267,635 *08845D6153A754A7A0FAD5F4800367D5BAE4792A SCOTLANDCROIS-IARNAC
80,267,636 *0888A2CF2A6A6D59327B4AD2DBFECFF93DFA5318 FALSESITEID
80,267,637 *088BE841A90991EF0B20BBB29328EBCDA0C7EBEC scourprotectioncoukwww
80,267,638 *088E0F41B46DD44374B04E7A40856B7869E9AB1E SCREWSHAFTS
80,267,639 *0887E547BF50ADAB0594701A89E76506F7311F3B SCUAXJODSYO1
80,267,640 *088B7B141D1D893581D2DA993327034696F632DE hərəkətlərdə
80,267,641 *0881C78512D2FCF4F0EC7270D665DD0B54C7F4A0 FEATISHNESS3
80,267,642 *0886D9154586DA4229E431639E15532FCC8DACEF SEGIJENKOED
80,267,643 *088375289B91C1F84F0DF861EC5F0262322725C6 SEKIRASTE5
80,267,644 *0881B90ACD58FB1E7414A7B5D196CE25915C23EC SEKWELWAS
80,267,645 *088B4DA0D46A59AB4E04B7F8BEA905EA70E0D1F3 HGTQ
80,267,646 *0887CDBBC0ED8AF9B1E2B4E27C922ADB9255C051 SEMMITSEMMIT8
80,267,647 *0883DECDFFA2FBB07E838F5774C6F0D571827EA9 CR,B0
80,267,648 *0881BF85D50019DF44D43F1F9E8E5BA36805F56B [email protected]@
80,267,649 *088A9F1C658E84902E06151AB009A88EEBB55782 FESTKLEB7
80,267,650 *0886AE678D558DFDCB7DAADF74AA9F3503B8D478 SESEIDEMOC
80,267,651 *088279AA33790295E2C7B8691C1BA9778A35AA40 FGTLFNRDS
80,267,652 *0881CC5E4B757DE913E85AE817EFE0473165B79A CRUZSARETTO
80,267,653 *0888166D63F18F4ED5A0CA8110A9C732D853995A H"KS
80,267,654 *0888FE502C978A20B3D22D22B44B0350C995B78D högersystem
80,267,655 *08868F30997339C5C3974B56233440E24B57C613 [email protected]
80,267,656 *08868E3C421F4DC7E8ABF86B99D131F0D2FC1D09 cub.explores
80,267,657 *088BD10AC84B9CBF091C99FE2A07DF4E8C5BA78D SHAUN.AMOROS
80,267,658 *088428D217E92ECC8D96F4A1325E6A8677C5949A [email protected]
80,267,659 *0882BCAE55380E6EEF43AC4982EFDCDCCA717CDE [email protected]
80,267,660 *0889370A632AD0047E85198DCF859C0EA2C937AB [email protected]
80,267,661 *088502A4EABD652EFB518F60AD04F74313B37DE8 FOAHMEET
80,267,662 *0881277E625B4E6FECE7769379FA6D70FAFEEFD9 cv#3z
80,267,663 *0886580B0F40870514355DFAC7DFDD145951940C C_V4
80,267,664 *088E0398E59272626BCB099E681A4873192045AD CYNCHRC
80,267,665 *088EB4D1A32D02E51929EB728E1288E7EEE83EA7 HTTPWWW.BERGTRAUM.OR
80,267,666 *088D02FBCFF776932D5A471C46849CB1D011D5D6 h$u-
80,267,667 *088429B21F1676A2E2C72E7459103C2D981F99AA [email protected]
80,267,668 *088CF3D522217DC79C672D3ED47C7E45BB8F47E6 CZIBERE.
80,267,669 *088F02F5B219BF5649C34BD5D6AB7C5E727CF4EA d0!%:
80,267,670 *088002D2E6B9E68803A50F7B037ACCCD7E784E57 D0+MQ
80,267,671 *088DC4CE536E9A6FB13C60612EFB11E445F25F3C の「skytrain」として実用化されている。「h
80,267,672 *0884FA34B0B9F7DF42F22E474D28548C9F7C3769 HYKERTYNEENÄ
80,267,673 *088493217D7AF21C289D6E6EA62F5D325F9A8B89 fschrien8
80,267,674 *088BBF98579E2F72A1BDEE0C01A0B7F3BC9F8AD3 GARY ZEIGLER
80,267,675 *088A8085423DB7B5B357A6AFF5B4D0EE090D0AFD danialpacitti
80,267,676 *088F9F1EA57869758755CBEC0F101050D01E5243 GAYLORD.BULLERT
80,267,677 *088E59F5504EBA9463B3DB5AAC9872099CBC2D8A danilokusch
80,267,678 *0882E7BDD3A9FC1F6121AAC29C3680F1C2381A9B [email protected]
80,267,679 *088DC205F661A91B6644243F0DCF62B84134FB7D SOWHAT24
80,267,680 *088BD7B9446E7E4DDC120FF9D324DC726D31A44F SPECIALBMW
80,267,681 *08893F1B0C6E92AB81C3E56B995B76CD066292A1 DARREL.DETROLIO
80,267,682 *08829EBC8CFCAEFD86AA9FE256F75D1F24CF4129 GERN.
80,267,683 *0888DB6EDC69D758461DFF3701CD7A20FA74B450 [email protected]
80,267,684 *088CDD1458019E9EBD12B4F77D0C71190E4E1D8C ILOVEREALITY6
80,267,685 *0884236E0C72E6FCB45FD91F2D035A9FC7F449E4 DARRYL MARZETT
80,267,686 *088363083BB6F8E9873C40BF6E1BEEE3FA5BC88A iluvnorton1
80,267,687 *088EB28454F42B37BD7DFDD1B358EF23960B7239 GGURBLAV8
80,267,688 *08892D4292B060EB123B220AC9ECD1FEC0693BEA [email protected]
80,267,689 *088C8620AB86E0E5D942D1669ED794A3ADE09475 [email protected]
80,267,690 *0885A83561B5521741A94014DC78D0B4493D9E61 INCROCIOS3
80,267,691 *0882CA7DE315F654C30CCCBAE793EFE7E60A3EFA INNOCENTE (DEEP DISH GLADIATOR MIX) (FEAT. LIEGH NASH)
80,267,692 *088096CBCFF1683F1C7B61A3F597098B1CD88112 GNILRETSAE-1
80,267,693 *08863942EDFAAE011E1781EB4F27ADD532AC3925 [email protected][email protected]!0n
80,267,694 *088EC5BF70C8E08CB25A4032920574C3D048AAF8 STACEYWRANGLER!
80,267,695 *088D8FFAE7011E68FEEF7E5B4AEADA5B3612C2C6 STAFFORD105
80,267,696 *088F689FCC5BF17612E604F84E32DC1C5EB32F62 DELMARRAHL
80,267,697 *088EA94776A2D42416C8C32864BDCF8D4EF50037 GREJENDES2
80,267,698 *0888A1EB2570CDB147CD9D9F9A7C5E57C628EF51 INTHEEND:19781988
80,267,699 *0882EAD41E9006F56061B6F28049F58C84460DE2 DERT;
80,267,700 *088F82B437291CE3D5B580E417887B6C120A7599 gungrunt8
80,267,701 *088CA905A4E7873EC7E860529D7EB1319FDE040D STRAIGHT NO CHEASER II
80,267,702 *0881B570B67D6F5FEEA58648ACE3C9D35AFA97A6 ISERAPIS
80,267,703 *088CD5A7B637DC0EB6412BFCD906FAAC44F330CA STRAWBERPEGGY6
80,267,704 *088B8277A46DE883B869C9E4643002BECF39DEB7 isiahsmietana
80,267,705 *088C2BCD63B4B1B0EABDC4DC4C04E4D64F87701F işikdere
80,267,706 *088C72D9188BA4129301AD9048BB78CBC53808F5 ISTINNOJ
80,267,707 *0887CC587420293C1500F59DD6C3B82E16E63F17 ISWAHYUDID
80,267,708 *0887DA6CC9BB2D85C5463F0638785DF327960958 HÄMÄYKSESTÄ
80,267,709 *088705ACBCC90C4207DD6D5FCD4F46CE1898A6E6 itsec5
80,267,710 *088124A1CC2CD341DDBEA29D66B4F68C4E947DA9 DIGABOOOOOO
80,267,711 *0885B25AD9A1C198AF78DD89E0FB024B02BDB3E8 DI_HN
80,267,712 *0885D3FE2D377260651633AE837A60C5F2323F23 DIONNE PAUL
80,267,713 *0889B0C4E616AD569A670AF9C2318AFD650DC981 JAN1945
80,267,714 *08832D012CD30950980B2DBC82F0BE66E289FFDF DISAMBIGUATIONCHAY
80,267,715 *088FE8DB2C0A370FDC40B7910F374D00B441D2AB jared-halstead
80,267,716 *088D3B337A1E70E4818C108A788E2F9F4EE10D6A SYMPHONYNO.93INDMAJOR,HOBI:93:IV.FINALE(PRESTOMANONTROPPO)
80,267,717 *0887BE5292856D374F3240042B189FC5EA93303A hemelblous
80,267,718 *088BB9A3782BBBD88CA6B14C007E0D9C054DC890 [email protected]
80,267,719 *088EA97EAF331FDE72CF6A665E4BAE5A3ED121DD DITXEKALA
80,267,720 *088AD4D16A2FCFFBBD6A708133E9FAD3C3B4C106 JASONMETZER
80,267,721 *088BACF10B7FA116A55774B42DB6168532D85FE2 DIWL"
80,267,722 *08823001DC352B44747BAB10E8559311016F8129 TAD.WOODING
80,267,723 *088F2EAEB22ABAF99262314808B89212651439B3 HGTQ
80,267,724 *0886E03E4C78534BA8ADB2AFA9391476A962B619 talfenn
80,267,725 *088E92D26C2CD20604180DF540A7F760127C2157 JDELACRUZRAPID1234
80,267,726 *088E3ED0EFFF5C2CEB59D34627CCDF4AAA01E6D1 TALKAARONYOUNG777
80,267,727 *0882FD45FC764D9EBCAA23952621488FCE84426B TALKAUBIGNOSC
80,267,728 *08857BE2F7A257D9B6FA1170E12C3B4CC4BC02D9 TALKDALEOFLOACH
80,267,729 *088E0195591E81AB0267BCAA75C0780CCB00ADC3 JEANCOBERT
80,267,730 *088E24DFDCC622863BFB958C261CEC8FB88C4667 JEDANAWATY
80,267,731 *088000A6024D2D819BDB3FD3D2EFC91C5FF90078 JEDTARVIN
80,267,732 *088CF17109D1547D72ABB6A16A8932CF30E0FCED hl{l
80,267,733 *0888061D35D38DF0B94A88640FACA56513B5FFDC HOBERTTRAUTMAN
80,267,734 *08829F3A236A6299D08F23AB5BD4ACC8DE97B998 JENNIFER.DOERING
80,267,735 *0886D0EF259912B1697ED14B40A39B82EEFB65E6 tarzanflash
80,267,736 *088128FCAFC1F9F56DE7DFDEB2553D00F0B2FEDB jeremiahkulla
80,267,737 *088BB8EE8D15DCA6DFE8415C775DAAB20AC94155 JEROMYAMERO
80,267,738 *0887D62A9F35C6B4F4ED1401306B91BCEF0EE4E2 TECHNOSOCIALISMB6
80,267,739 *088D43D34DE55354B7E7229580B9A7A2B5EA5CE2 teddybruckner
80,267,740 *088EC888D91FC18E86CA7E5E5314289ADF46A586 JERROD.TABACK
80,267,741 *08809D7CA3D50047E2B45E08FF818B114AAFCC17 HOUR259
80,267,742 *0889537CD9919E3C0685BDD37E50A076E576ABCD TEIZNAING
80,267,743 *088D837F2B40DB89310A9EAAE7D472629E86649C JESSREHER
80,267,744 *0889B02088521C818BDEAE2E7D756BFB5FB9DD9F DONNEROIENT
80,267,745 *088F46ABE4BAAA0F27BA983E9F7212612DA022C7 jesusackley
80,267,746 *0881574F839BE0937D7C37DE2CFB8A622E319354 TELESTRATEGIESING
80,267,747 *08830B38C9CD9A5E151AC76594ACEB309A4768B7 donnybarcliff
80,267,748 *0889B6237D88AC4B637DBF64E3C5C619EE780117 DONOVANIZQUIERDO
80,267,749 *088536078C5BA1F2D1292534B13BA2602EE7E7DF DONTEPERLMAN
80,267,750 *0881E0A59B02D7C510340D547A1571DA9A9DFAFE [email protected]
80,267,751 *088B4FCBCBBD0F9DDC53CA7F4F9DAAD237E5E104 [email protected]
80,267,752 *088119884953C9AAD87A4C6C9E9B393E8F8475CA ĵigulovsk
80,267,753 *088FDC6DE7C6B71E87B12CAB8331239F6D2EF746 ten preludes for violoncello solo: ix. pizzicato - arco
80,267,754 *0885A43BA68443977EEF0A25DA2FD8CE1DD1DA4E [email protected]
80,267,755 *0881888D2A493CC95562B651AEDE32A73C82AC38 DPC%O
80,267,756 *088050251BA7D7DEB558FB43EC1A32D0FDDE9074 dqla-
80,267,757 *08817BD3643CDA32D59868DFAC2CE1CBC8F81317 jonasfaucher
80,267,758 *08884A86DEA93D5CC8DEEAEAECFF02AC56F278DE HYNNBSW7
80,267,759 *088FDA3579695F07067D2A245F5A942C318BCD88 DSTJ(
80,267,760 *088647CE189FBBAA6DCF19D4907A64CEDD715C75 [email protected]
80,267,761 *08846E390C0F0893DF8FE43A3AD831DD26DF15B7 THEBOSSSEVEN
80,267,762 *0882EADB10A400E8869BE698F1AA612B84BC4619 JUDRINV
80,267,763 *0880EA0D61EC0A54C4998282920BE02092F5C51E I-CLAIM-THIS-VICTORY-FOR-ASGARD
80,267,764 *088F0C4F42AA123E8D0CC6FFB9953646B555FEC0 The.Firebird,.Ballet.(1910):.Scene.I:.Appearance.of.the.Firebird
80,267,765 *088B768891575C1A88AE5422E64113EA85AC3052 i'd also like an ugly vote for the shorts and the legs.
80,267,766 *088D1F4E376D797541A7BD452128EB610DD7B2E7 DUG"K
80,267,767 *0887F433FD1D0490C830D110517DECEE4C3D439E JUSTIN.SCHARFF
80,267,768 *0883ECD98B8B669AA07B24D7004E710F17C0075C THEO.FAGERAES
80,267,769 *08878225A093162CA2848A4575BF96359C076944 dvf2t
80,267,770 *0889307C829B5D85847EC85AA009866F74437C98 IKE.CARAVANTES
80,267,771</