List database


# MySQL hash MySQL password
690,250,001 *47484DDFD32B3E95F73DB70911890861B57908D5 diegochiotti
690,250,002 *47402A24DA6F35BE15B42AC94A93B85F8B9F3C8E [email protected]
690,250,003 *4743203A8E583CB910BCAFCCBF3F6422CDAC0E5A dillonsandall
690,250,004 *4746D6A0F531B97B8661DB1CE04AA0E4E182AE77 D-IMU
690,250,005 *474F40177986F8DC3106ECB6A35A78422598B291 [email protected]
690,250,006 *47417D7DA0DCF3FC8C8330F0F7F3537ACA87D8D3 dinso
690,250,007 *4741FB1E313C15ACF489C166232B359F4BE4CE01 [email protected]
690,250,008 *47438EFCDFA424337ED6E6B6DBCA63FF2304534A DIRECTORCELINE
690,250,009 *474A85815B9DD61C054BD0E6C72080E94F88F56C DIRK.MEYERMAN
690,250,010 *474E66CA957B9AE3FF1B1C30446EE541DB0F6363 Gypsied
690,250,011 *474A336C01824118888C608D11E8548B8BDED516 dj0s=
690,250,012 *4746A0C39DAB8BC3D7B5E4098D9D88F25E10FE95 dk5/l
690,250,013 *4746C16126CA49C14DBB06F1ADED2B4EB2185E68 d"khm
690,250,014 *474C5E7CEDD6F8271EBB3B41D8387B4970AE16CF D,LO5
690,250,015 *47429998BE0E66A2E242ABE1F0161BF7AC78280B HARLEY.GOTAY
690,250,016 *4741829CFAA0A974629705DEA7BA5410A44380B0 DMARUSKI
690,250,017 *47466679D3CC0784E41BC46EAB353325F37B1F21 HARVEYSTREITZ
690,250,018 *474D69B54814F9D64C75231F17CA1443F3EDFEAD havebeenproducedtotheoicv002-photos-0011(holder,tie,
690,250,019 *4748D441CCA62F367400FEA6B48C0A5CE3C4D233 haywoodtalahytewa
690,250,020 *474BCE0A368E9D0BBA59E2436A03B361E6DE87E5 [email protected]
690,250,021 *474B30E2668323CF9C898F699663EF714722E562 [email protected]
690,250,022 *474A48E3F1C98DD9B58DF408AFAF510234B70DE4 HeadOverHeels(10)
690,250,023 *474653797F97A2F98723543E5A7AD0C3CF519A4F HEJDEMANN-LINDQVIST
690,250,024 *474256C466C4C6AFC43F31B8294843DC2E9C85B2 HELLTRAINS
690,250,025 *474F4E22006DD533233B1A2C93E54274E5CE2E0F d_(on
690,250,026 *474EF565FB9AF827894DBD5CB76C794FFA235377 HERIBERTO.BOMMARITO
690,250,027 *474BA843FABA18AB2EA96E372A7DB33BE7081BC1 HERINAIA4
690,250,028 *474827B2DE8EA84FE89C155F6314F557B7202C07 hermangallinaro
690,250,029 *47485ACE0BDA8C664F412420F83921AA512E738F donn-carr
690,250,030 *474B96408254BF2729ECB5A82AFFAC6C0152C0C6 donniecybart
690,250,031 *47433EF9CC50B1289253AFB28E66DC392FBB8F65 donniefredrick
690,250,032 *4745CBF45D56F0929BA73059E618C3A7DB0623CC [email protected]
690,250,033 *474670515B820849D50155A737DED212F9454191 HIPOLITOBLACKWATER
690,250,034 *474BB3A51A2CAF83228A14B87B884C492D3A3F54 doylearredondo
690,250,035 *47420C1F79E5E2EA9EFA87DD29C406E8982836E9 HIZBUTTAHRIR(JYDE)
690,250,036 *47423802D07291222EA2E5E3FDB8E1710E0E3CF4 DP1WR
690,250,037 *47401ADBFD7C0629EB0235E2FFE69C63D56B85FD hold-my-hand-(live)
690,250,038 *47495882057FCD00677D9BAD9B86DDE630C27BEE HOLLGER2
690,250,039 *474C812C45D300A2FEEC6126F3FDE09BD6466B5F DQAQ
690,250,040 *474882E89B6B91E3DEAEDF2756F75DD4A74DFA73 DQJTIWA8
690,250,041 *4745F1D6B73154C6A5A84E65403861D2B2994E3A d?(ql
690,250,042 *47488330084B1C269C0BC7F78285770FA4173EC8 HORACIORALL
690,250,043 *474F5307BD842A6743E54A87AED18D67DBCDCF4D DrDs
690,250,044 *47420709E700EFBA0174286530AEF11C3F23F418 DREUXMONTFORT
690,250,045 *474895251D0ED09CA7194BF5A9AB83CE3F6FE5D0 [email protected]
690,250,046 *474B522227D6D348B78DA091E05D3D09F5FFF0BF [email protected]
690,250,047 *4747D1CD4092E88B164A51F961C987619D9F71D0 htm
690,250,048 *4742D402BEEDC6F30D9EB0D6414436034FCD6EA2 dsherbez
690,250,049 *4742FB42804395E187B292C99BE9914F8B81BB8A httpwwwspirxpertco
690,250,050 *47465E2BF65A0A3FC234A5E6D3DD4AD0AA16AD97 d#t?h
690,250,051 *474B26020FA90CC3B748B6456F1CFC5757B62F53 dtzq0
690,250,052 *474B7FB31B3E4369B77B336BB0F71FA330A1FC4C HUNG.ROMPREY
690,250,053 *47406BF07F0F15793B7ADA60A09AB28A4F178117 hunteronezne
690,250,054 *474EED59055F44B482266D6DD9BFE0267B07D4B0 dug
690,250,055 *474069CFC422CC15A189B3341C8980BA8A50AE26 HYPERACTIVE(60SECONDVERSION)
690,250,056 *474525635C2303383FB5462D782F453733E829FA d/:w)
690,250,057 *474ACC76025052FE3475C41F06FB757EA2BA7931 ICECREAMWOODY
690,250,058 *47458AD9D7E289E21E718330A7BF213E6B9D266B if.you.see.her.go
690,250,059 *474E8AA2964C94B5190308C7DAA5B65BE1172044 i have my weakness. but i won't tell you! ha ha ha!
690,250,060 *4745CC1E2E93A9DF2EB66DCBD071EC5D7FF4F57D DYLANING
690,250,061 *47442A89AE7373740DADDAC18D21136D8AB3C127 IISLANDPRIIDE
690,250,062 *4740AD908B59563B117EDE0197980A31872EDF40 II.STREICHQUARTETT,FISMOLL,OP.10:II.SEHRRASCH
690,250,063 *4742E3D300248D2FC91B222AF85424616F087C70 [email protected]
690,250,064 *474293F50C64AB6EE3953239BDAC6614FBB83EFB ikeoller27
690,250,065 *474E6A5700EEDB16DC6D89ED53E1927988FD5E64 EASTTENNESSEESECESSIONVOTETN
690,250,066 *474BCCA7BADB92DAA08635933D1C3BB66179803B EATHERH4
690,250,067 *474FA9759A681DBE599D9C023F92A7946306286C EAT-LIKE-A-PORK
690,250,068 *47481E983A1E22BCAE58DBEDE0E82752C14B123F ILUVMENSUCK07
690,250,069 *47450FE5ECDC4A23302CBF4BF5DBDF76DEB37141 iluvnina1994
690,250,070 *4749D58EDDDE183251E9211F74A49BB8A9F230A5 {{imdb.title|id=0082533|title=the.howling}}
690,250,071 *4745FDDC5E302849AC0321ECE72558F75CA63205 impu9na8l3
690,250,072 *4740EEA70C3FE2B8ABFD3F830E6DF13D357464A5 [email protected]
690,250,073 *4747533A6BC7222FC499DD3EDADCA87D6FCB54D5 injapan
690,250,074 *4743C3D2199B1C378776D29E1F212E8F8FD6C9B0 EGFE8
690,250,075 *474ABA9A2E91DC1EF6C796FFE164F7BD64E4F17C IRVIN.CICCARELLO
690,250,076 *474B3F967034FF6F46071FD56BB1BC2069E481CF ISAACWILKINSON
690,250,077 *47410ACBAE9AD20E2080AB2C7C3ECDB7776C7A48 iscontainer
690,250,078 *474ACA9FD1E56BCF4835FC6BA28A4F99F6B9748D ISHKENDER
690,250,079 *474C921230C183F42DD465136559A8CAED80EEBC ISIDROTYGER
690,250,080 *4746CB878C7C5C75727E17112AE5BF8EEF7DD14C EKOLOGICKÍ
690,250,081 *474DD89584F65F769DDA022072ED3DE5695EFFB7 EL~
690,250,082 *47446C4C3AD86C6AE6F1DD52C8D8E3BB7F0BEFBF I=SU
690,250,083 *4740338C1AE5A10ACD47F472CD71BF82AD634B5F eldonsancrant
690,250,084 *4743998E1DDE74C9777AE1EDD2B57039F5673DD6 It'sMeDr.LecterandthePolice
690,250,085 *47499D73C42BE5656BF272161FC86B9124E8B7D6 it\\'smenemtzy
690,250,086 *4749C85C176FD510359A17A3D8BF5F6BE2AE8D49 ELHAM-ZAHRA
690,250,087 *4747805E2ECEBAE9336E7F7B1005EA4F9F90963A ELIASSOULES
690,250,088 *474DEE6115CE5810C332553496C7035E817966A8 IZVADĪŠANA
690,250,089 *474F7DDB73D34D147BDB926979FA6EC17666F8C8 ellered9
690,250,090 *47499BF6E2FC6DABDF11599DBC1DF09D40E2CDF2 ellsworthfranciosa
690,250,091 *474FA34AB98FB80ABBC1212B9C9339BF983E64DD JACKSON.DENNISON
690,250,092 *474EC916B28C2393F8FA275D54511E873E96B7FB ELSA FAJARDO
690,250,093 *47454983F7E8167A154E8E87B0C70762C8CBF49E jamaalpetrie
690,250,094 *474BFB93AFC857C6B371FF6916CABD5D1D2242F4 jamaalsalm
690,250,095 *47401A702389D9BDD14879F15509DB02B906E3AA em.db
690,250,096 *474FF63C8DE79A83415443DCE013E74629FF224F jamezacherl
690,250,097 *474CB86F378A097B9DDFFC16CC9718B3D19F0DB0 jansina6658120550797
690,250,098 *474A7D90ED9317984C31F68455916A01D542EEF8 ENCYCLOPEDISM7
690,250,099 *474DC3498A3443842098FCBACB4E84751C9A322D javiercoram
690,250,100 *4742833EBAD284736E738450D6853CCCBE020686 ENOCH.TURNHAM
690,250,101 *474E755936B3C9A30C49A2A029C577CE298059A8 enohsrevo8
690,250,102 *474C8BFA43E3A0101E2372467F8D2710D7A0449E ENOJONAS6
690,250,103 *474A2562583019DD7231414C2B118658347094E5 JAY MATHES
690,250,104 *474B1A7BE9018ADE33ECFD0CB873906C0B8D8504 jay-speelman
690,250,105 *474AC89D7F872BC234EE964FB1D01C9F7033D804 ENSYMON
690,250,106 *4748D746321A92C39055080DC2E8DD13B2201EA1 EOFYS
690,250,107 *474F533DA84A8DB6352400D67D27F0C842178DD0 jeffchalupsky
690,250,108 *474CF8956692E0358EF7C1D9674EFF5F4EE4F117 jennturgeon
690,250,109 *4747EDCF9371686C8350DE220288583AD2212451 JERMAINESEGARS
690,250,110 *4749CF19058832E3A8B54EBB0D4A532ACADED9DB ERINCASILLO
690,250,111 *47416EC7A619E2C6B73A36791C27A9441E5EC3D7 ERKULTTU0
690,250,112 *474AD3D37B21462892F57A3CA9A8EA78A5A79BB8 jerry-brush
690,250,113 *474C48A8F624CFCF5F63F68CB7CCD7203225304B ERRAMALAHAS
690,250,114 *4747282C5CC1A8F2F8E3DA3A9607E0561B5671A2 errvl
690,250,115 *4747FF2935AD89F3DD3A75B1CAE6EC9A8F1BFF04 JESUSYOES
690,250,116 *47426FA291606663BB75AA32A255D67EDF5F4503 esiyg
690,250,117 *4748502708D5C4B61F37B9C380C3FEB3D72E6931 [email protected]
690,250,118 *474E1D353AB33A26A5638AE6141F58F7A870D4B0 estacion-internacional
690,250,119 *47479C7ADA72BE0C116C52A71948438DBBD89CD8 jimtarrats
690,250,120 *4743DDD8EB13A0C788746C6E5A3314E3CEED8C83 JKERGOSIEN
690,250,121 *4740B1DA6D0224FB3E9AD8E40595B41ECD819856 J)L
690,250,122 *474501DD31A8B286DDBB0A3860D922ED65E66806 JOE4000
690,250,123 *474BA5D9806B4D538A6F34509322CFF9F0A43793 JOESPH.HALMA
690,250,124 *4742415442F86FC5B0195BEB2EFCC44AE1F12B51 EVA-TOROK
690,250,125 *4749DCA37B4495CE37D4D95E1E4D1AFF5DC3CA23 JOHNCARLO GOMEZ
690,250,126 *474BA4356E8DD0585165CBE4800BAE95A0993D93 evie614
690,250,127 *474415BE58479DFFEF5FC8B25D0BFA447621F694 JOJO-HARGLEROAD
690,250,128 *4742705AD248129AB5DE6E1B7F73B723FF2256C2 expurgeses
690,250,129 *47433D6AF2C9048EE0A20246340C25022D156B41 [email protected]
690,250,130 *474D17E1EA24969E32F01C0697DA5755730758A8 [email protected]
690,250,131 *474030EC7D0FD6DA72E1993A16A4120EBC721E80 FAGBENROABIOLA
690,250,132 *474AB0FE4FDCD213B0BB6B752A1E781D7A8F3EB9 fahrtkos
690,250,133 *474DFE4BA5E8681E97A2F90564A8B9C5E2CCC160 [email protected]
690,250,134 *4748B39F77D251F6A887B28DCEDEA63A8F59730A FANTA$TCALLY
690,250,135 *474D441B6519F7988D7C8B5ADA91E4177FE037F6 JUNIOR.KIEFFER
690,250,136 *4745DCE8AC09335497AF500FB36E529236526E9B junkende8
690,250,137 *47460DE8ADBE50ED0AADDEE5DAEFBD1F0C75B847 fatuousness
690,250,138 *4743416379EA61A3B5D0B193CAEA0E2F6B57EA50 JYQT
690,250,139 *4745D692C4ADBD76FC2906BB5334235C401A6D03 K2P51
690,250,140 *4745610CF124F020DBD6C2EFF7EF443DE82279D2 KABUSAS
690,250,141 *4744E814462FAA84036F410833AE18C60BF4D109 FERDINAND.FEDDERSEN
690,250,142 *474195902A8ADAD30C5396B0227965AE515C6F6F FEZAALI
690,250,143 *474E1564AEEE6BDB0D1CFD1EE66F3F3E434F413C [email protected]TSUSER.HE.CNINFO.NET
690,250,144 *474560CF86A59DF2BBBD95B3803E276B5ED514BC ka#p
690,250,145 *47475A5590A53325085A4CE610FFF98F5A89DB90 FILTERBREDDEN4
690,250,146 *4743D641BAA94FBE08BC779BF6E996FF09A70423 FIRSTRECORDINGS1973
690,250,147 *4745F27A5E878A0B97D671A16771F807070E727B KCOLLECTION:CZECHSUITE/SYMPHONYNO.8/SLAVONICDANCES
690,250,148 *4745A199C2BC954AAE848EB7D1A1227A58D2EAA2 [email protected]
690,250,149 *4745D72F84B1F62AD63F454D47D406AD3991FF96 FLOORBURNER(FEATJAMESXAVIER)
690,250,150 *4742AE3FC60A96723DDBD9ACFC7C037E62A2757E fmh(fuckmehollow)
690,250,151 *4743A5BB9546E3EE66D871C9F9A7FCD1D37C3A06 keitsillab
690,250,152 *47440F4F6F7DEB43D90E1D941A8D9CC2B9C80BBB forestcha5
690,250,153 *47449943B8657190D824B145537A68321E971F01 KEN.SHANKMAN
690,250,154 *474231335B0209C94A577C1875076C7AA26F2296 KENT.RASPBERRY
690,250,155 *4746393C8E1502BC49F18735035D69E6A2ACE70B franciscoghiorso
690,250,156 *474D62C1733D4C4B2037248CCB7F4E253FC1F56C KIAUŠINIAI
690,250,157 *474D0151D4E72D6936CF9552674D8B5AD1F7B2E6 KIERAN.MELVILLE
690,250,158 *47469EB13E84CB4E5BFE0CBCAC52848B7CABF5FF KIKALANG3
690,250,159 *474D09FA6EA4E7A6E6965D24FF0C6B535232446C freemansoman
690,250,160 *47482E7CE8544B9AB71F8A41E8C7FCBB1A4685CB fridayarthur
690,250,161 *47447A0EA7B7B3DDDDA81233C2B48B4FE9A98A28 function35
690,250,162 *474BB4103DF361308E588AC4488684D3A6B22141 fxuo
690,250,163 *4740AA305F608C5FEDCB26C026F9CF3C5A925497 KOMEENIE
690,250,164 *4747ADD32D22EE15EA726B07B1F50B257C78DE4D [email protected]
690,250,165 *474844CEC5052C96C34758746BE65B3A49A2F339 kontants7
690,250,166 *4747D7FC809DCA400B636BDDD3ABB716C26D290C KORY.STRAM
690,250,167 *4743A9F1CFE4E55BCD8551D793F9385D0EDFFB8F galecuccaro
690,250,168 *4740EB6682F1EC6DBC8139A1269F804A2A86091C [email protected]
690,250,169 *474AFD34BDC8F4D5EEF0872BA08A57B6AFA1A4E5 kr^ichchhro
690,250,170 *47419012A084431135B941D6C91CD8C69A49F4F8 GAVIN.INTERDONATO
690,250,171 *474001AD78813BB6C90856DE5DD5CA175EA763B7 kuode
690,250,172 *474BB91219E75D82F9E9E13B676462105ACF0431 KV{"
690,250,173 *4749541414DE6ABCEF3ECE3B63186388A91E8CCA lagrimedisanpietrono.21:videhomo
690,250,174 *4745DCA795FEE0DF6418EA370CB4C7C5E66CEE6C lamontmammen
690,250,175 *474A879B68CFAB1CDA1CDE49EF27E834BC4C577B GILBERTO.IBDAH
690,250,176 *4746A905584B903B134858C4DB44DED19E719E9A LANOVCE6
690,250,177 *474DC702D4FB00384D342D4E18BBB4EA33A6F57E gingivau2
690,250,178 *4740D8AEFAB308ED33E8BCE2B1D7A7F47A6142A1 GIRDERS
690,250,179 *474F02B852960DF161791F992D9380EB9118A747 gisping7
690,250,180 *47431EAB2D2B30F66A808DCD6F21EFDA70B3FE46 [email protected]
690,250,181 *474FDF9D313300130C8B9E77BE3BB43FE80B6BB7 gnugihur1
690,250,182 *4746F2FAB47300316E27D18F9C36F08DD0FBC191 goat's--g-ow1-t-s
690,250,183 *474D6D9843670BDBA2431BF7BF847F55601FB59F Goetz-Botzenhardt
690,250,184 *474F63C30A360A04BAE8767E4533F9A917788D14 LEARISUM
690,250,185 *47406481E7C78E3968440A49C5B9AD3DD92410CE lebanesearmyfirstflag
690,250,186 *4740E545AC951E48949EEA75C5687E19BF3F13B6 ……GOOGLE也正在做類似的事情。」
690,250,187 *4744E8C23597F7C391EE888B83E768D0CCC60BD7 GP)~
690,250,188 *47427BB9FE87F5DCE97563B71966C5B332941E1A LENNY.CUZMAN
690,250,189 *4747B722C735C917736355F5850298DE2CD0F290 GRAHAMWOOLBRIGHT
690,250,190 *474A0263C28B6D27A782B63A9F04AB873C025265 leonelspielvogel
690,250,191 *47444CE9DF4189B415720DDBF4F4B9402207ABC2 grindgray1nd
690,250,192 *47405384CE33E96C1548DABAB3802AD9270AB0C5 levi.crombie
690,250,193 *474E93514DC793D1244EA7888A38134FE5C11587 LEY DE HARDYWEINBERG
690,250,194 *47467BE41C7129750048712666D939D3998C4717 liebrato
690,250,195 *4743D96902A1BBA4133E9B0304A826DF419B538B gymnothorax.atolli
690,250,196 *474AECE70DB8C5669AAD4F2151EBE4ACC3CE4252 LINANHAO
690,250,197 *4746247D8F56A155AFF15CA4956C0ACBE1B1430F linwoodbelew
690,250,198 *47411FB207D0C92DB65A6C193C08E3F27B5C3C03 HACKOWACS
690,250,199 *474C0AA57271401991B059C80894B2A00DFBC3EC HAILEYRUIZ
690,250,200 *474B0D6892A9977D792F62D46FDD15C5EE56FEAD [email protected]
690,250,201 *474CDC525835F52CA72B6482814289D0B2F72D91 HANDREIK6
690,250,202 *4741502816B135AA4D4A793ED62A6D2F422AA230 HANGVÉTELÜKÖN
690,250,203 *47426BD35B2BF874FF8108D4D9CEE73A9BE02467 [email protected]
690,250,204 *4743F39322E2EB5DABC7F33C94A314A43BA0EBF6 [email protected]
690,250,205 *474DA6B79BA72D0EAD206DEE5735B1A7E7E292C1 LLOYD.HOPSKINS
690,250,206 *474E309ED0E106ED264729C2BC71079352D5C797 lochtron
690,250,207 *4747FE2AE09B17CA2BB586362ED80D4BCBD3A9C3 HEAMIWITHIC
690,250,208 *474ED8043BC5DB986552A267D12BCD797633F5FF HEAOHEAO9
690,250,209 *4743A990A9ACD36CF0EC6DAEE7D817D3C9EE3880 loukia-vasileiou
690,250,210 *474916199D66FB06A82A7A11BF1AB5CA88D11098 hectorberne
690,250,211 *47402A5387B3353D7001153C801EB38086608449 [email protected]
690,250,212 *474C0B79367EBB9BEC435D2BDD0DA96A4F9A26DC hepatological7
690,250,213 *4741CC1962456045D67E47B736CD706BEDEDD62B HERCHULES
690,250,214 *474AEB2091BE4A5C5AFEED52E3B8A927A25B90B3 luismatar
690,250,215 *4742142EC5175DC39ABF9F5C4AE16028DF3C7E56 [email protected]
690,250,216 *47481D130950FD7601389502AC27121331FF9CE4 lupeplagmann
690,250,217 *4744D57BA3C444EB51495CE37906C3ACFFEDEDCE LVESELAK
690,250,218 *474BCE4E9B088D91418744DBEB60A5F2A7A841D0 [email protected]
690,250,219 *474168F593B67BF670B8FF661FCFC20C8D186440 [email protected]
690,250,220 *47487689FA81D132BC4E53861067E4CFFD78C77F LYMAN.ZWAGERMAN
690,250,221 *474A462EFA275119E85316E4CCD464BA698F5AEC LYNWOODSCHOPP
690,250,222 *474DE2B5AE7C25EE2C453F1B364D19D16A85600D HMACHANO
690,250,223 *4749E6146030D965B5F29FD964DFDB05BB451ACA HOMERNAZAR
690,250,224 *4747C8570308F1FA2C4BBF0FA153B6937FFD0AEF MADELIEV3
690,250,225 *47462B3A3EEEA52FB9845C638429B60BEC4A1830 majorkoloc
690,250,226 *474EEF59A7FD8BF0AC9BC6C9D15D72925182BDD9 MAKEETRAF
690,250,227 *474D081D29D89EC6315FF29922ADEE0DFC85ECE0 MALHELFLAVO
690,250,228 *47462FE37A5E2D9BAD4086EDFF5A34331013494F hrmtrnt7
690,250,229 *4747BC0B6686EC08EB0F17033F3048CF35FC10EC htm
690,250,230 *47413BBF555F13F52778B0BC959F7216FAE32CA4 MʲANƆ
690,250,231 *474D38FEB9F6CEAE3D10B7C440FC1DE62EAC3FBB htxanbusfdaaaeayh
690,250,232 *474410DF30E04040EEAE48DFC9AFF04FB8464815 huggeds8
690,250,233 *474472A574871BC013255ACBA7B7FAFC453BE93F HUMBERTOMILHAM
690,250,234 *4744DACFF10B6BFAC39365F734DFA6379F77375E (hungerstrike)
690,250,235 *4745310965F46FD283BFD92BBF0A76C3149C698F MARCOSZAREK
690,250,236 *4747F0E34B7C94FFD00C91B3CBAB9F19AB851AE8 MARCUSHOUPT
690,250,237 *474EE1C0FADD7E598BFFF97BE64438ADD900EA24 mariel
690,250,238 *474E9B725B482D7FFF30170335FAEB58E92DD9F7 MARTINGALDAMEZ
690,250,239 *474B389A3920FD2EB4F0BEB1066367BF8FA1BD2A marty-walter
690,250,240 *474B47E8351202E8F999FA1E490A4A6BE2E750FC i banditi della acqui
690,250,241 *47472151E3774B373C4D957A01922ABF14DC7776 matlabphotoshopreadme
690,250,242 *4746BA3DF662823C92A6D1DA03815BCDF73DE766 MAZURKA NO 18 IN C MINOR, OP 30 NO 1
690,250,243 *474ABB38BDA5762F9D8EA1C7E2722B0973D199EA ILIPA
690,250,244 *4747D06404F1D8A41CE609E8650F5EFCB00D8D1B MCENROES2
690,250,245 *4745965EE3783FF1D667317D55F726385526C952 ilovegerardbutheisgay
690,250,246 *4745D00ED9F3A36FA32019C860534A87E53DEC9B influen5
690,250,247 *4743E177AC1F0F689C58BA67A14945337071C5B7 INITTRASH8
690,250,248 *474805B27E7FA9F847B152C603940EDDDE517AE5 MICHAELMOA
690,250,249 *474218A58F94C8A680E042D4411EC733FA2DFAF1 MICHELDELESSIO
690,250,250 *47475EE34141515109890C5B0EFF4C6906E5A178 MICHELDEVERGEZAC
690,250,251 *474FBB517615A1D9618C46B6D55F3CB9B197EE62 MID-CONDITION
690,250,252 *474CEF3A51867C2505AA0002BDD6C13EF2BEA51F MIKRUSSAK
690,250,253 *47450E4A6A834B712D1B46F67F247284D28F0E1D ireland940
690,250,254 *4748E20A214CC6EA82F32362CADD8108CB27B6BD MILLIEHUGHES
690,250,255 *4744B6FDD3B4E699B918FDDBD326E68F948B5717 MILTONRENSING
690,250,256 *4749B7DDD86A11A8AA4849F1E7881421287CCEC8 [email protected]
690,250,257 *474A7873B3CB163AA19FF4DFEC737CEA630ADA6A misconstrued0
690,250,258 *4747D08985214B02554F74B2D21490B2CCC36AE5 ITALLETS1
690,250,259 *474202714763AB301D76895A32572835AA2CC4DC itds
690,250,260 *474539A3DF7BD0F9DED852FA02ED487CD2E23481 ivancaspersen
690,250,261 *47487D85E11E4142E50A9AEB6C6276C1943F8948 MODESTLYSUCCESSFUL
690,250,262 *4741F4108A74477DBCDD75E3A0B249420EF8E1F1 moerassi6
690,250,263 *474E700DEE5A31AE58F507D40A9F91A2F148EA60 i will (congobonix dub) (feat inaya)
690,250,264 *47478797BBFF6740941646BCF02DAB445FC52E09 MOHD HAFIZUDDIN NASIR
690,250,265 *4749F2CA2643768BA59E8CBB981B3933030128FA moisessaulsbury
690,250,266 *47487E98750F3AF4A00F2922315F720C968E1914 J4060063428
690,250,267 *4743A57B178DD1FE4D23C7CE303B7F596F0218AB jacintoludwig
690,250,268 *47426AE465F69C7482DE5A9607C46F6148F69FBF JACKAMMANN
690,250,269 *474862FC00E11AAD1A70B153E803B5E9F4C64BB4 MONICASUPERMAN
690,250,270 *4740B92B5F1AFF471B25E7F30594D898BB429921 MQACRX
690,250,271 *4743C4C5833CD42CC176A37C5AEB6FC4EC3357EC JARODWITHERINGTON
690,250,272 *4740BAC59C14F11B7DB44CCA02DFB5D422AA7EE0 MSHAHZAD01
690,250,273 *474B15580F00066A0617DB4877FDE59B71487867 msreddyv
690,250,274 *4742BB89013E2FB8ACAC4D9C5DC3BA176A8F3102 JAYSONBADOUR
690,250,275 *47496BE2F39691ADE9BB31487EF4E597B1247DC0 mulvel
690,250,276 *474431CF66690DE3C8CFBD9CF585E87910671423 jazgiejaw5
690,250,277 *4745C3A88151945DB054A874957E86CF22B17C6E mustakulmatikka
690,250,278 *474EE60CFCD8F47111701E958D9321D3BC054CD1 JEFF.PLUMLEY
690,250,279 *4743A11DCF8CD6A8C4C2A8200115A45098B5C205 myfiddle
690,250,280 *474F26999C45BFDF28082393150B8D2A3E0DAB14 MYSANJOSE05
690,250,281 *4746409735BA2B51571D1DD92F64FD0712085928 JEROLDGUILBE
690,250,282 *474A5ED2468AA7B78DA2D36CC0BEC7F34E9A3834 JEROMYBONSU
690,250,283 *4745D40C34CA57C4D662167411D8F0B487CEA8DD [email protected]
690,250,284 *47476076A1E4BFD9CFB5BB26E8AFFFEAC1EBB0BE jessica.leas
690,250,285 *47416C13B81F7C65B10484B6B2D486CEC0B30E12 [email protected]
690,250,286 *47441483D4CA41718D75EE6A3938CE44B6DFE2C3 Narcissus.Metamorphosis.Of
690,250,287 *474EED7D9F74B568549352192B87EEEA2A7529D5 [email protected]
690,250,288 *4746486168463397674DF9322FDA17F63BEF3D0A JIMLOVER9
690,250,289 *474390352DFF9DCBB54AA41C8700227F1C826DFD NATHANIALHELFRITZ
690,250,290 *474A7C170C19FA9BC62EBA86945F995A12E30951 [email protected]
690,250,291 *474C0BFDF4D92AB4457EAB4E2E3C720307EF3013 NAZAR-HADJA
690,250,292 *47437E2D6AAEB7F72B7AC1AB8D55680B1F912CE5 JMCALONEN
690,250,293 *474630D6AF844600D29D92885659DE0C0DE19566 [email protected]
690,250,294 *474FFD3E961D4C9838A84D058E834B4328F77419 NEAPOLSKY
690,250,295 *474BA1ED3E633024E852FE41E71EB5423619160A NEBULOSAMENTE123
690,250,296 *474D214D1E02CFB1000C63C3DA3CEFB478E0CEC7 joelxxx2
690,250,297 *474E39E3AC820AF3A7AF96A437E3B3FBE5FA7041 JOHNATHON.QUIVOZ
690,250,298 *47452A17A9C26755E24B60A645BE2FF35807D6D0 NEKEILER4
690,250,299 *474690A722D5A09CAFDA146A841072DCD29C38E9 nelsonclarkston
690,250,300 *47461E12E8FE9780F763F5A652BCEA01188A5564 NEOLIMNOPHILA
690,250,301 *47407AEC606ED6625665D334585C6CBF71A484E7 JOHNSON.SLAVINSKI
690,250,302 *474C86557441C4E39B13DCBE89C61FC02677DF04 JOJOELECTRIC
690,250,303 *474769ABDDBBD9817FDA49AA0982078C6190CDAB jonathonmadziar
690,250,304 *47475347C26E0075E6C6D22706FFBCC575B1AD42 [email protected]
690,250,305 *474470B8A746BE07F88F32522793B7AE8189392C JORGE.JUNES
690,250,306 *47413FCC10A8B94A8C02917727E30748CA2F1DF3 N(FOXTROT)
690,250,307 *47437E08482402D8768359DAB62EB6145D535B21 JOSEPH CARDIJN
690,250,308 *47443D0B085AFB0AA7D3D269E48F105272521366 nicholasclouser
690,250,309 *4743C3FE2309324E5C052CE43605D00CDB3299C9 J&%P
690,250,310 *474092154E09ECD45CE4FD1358CF910A09B5A5A4 JULIAN.FAUSTINO
690,250,311 *47423280B99F135D0C2179DCBEA118B35E6FF672 JULIE.OSBOURNE
690,250,312 *4748147B1EF05591B68125FAF542BCC63F94A84A [email protected]
690,250,313 *4748A5AC68D7E9ED7209A93F026A28382EBDD41E justinabc123
690,250,314 *474E486BE181AB8DCE2DCEE598FA388093927D42 nonchechen
690,250,315 *474E3B289D1185EE8981DACDF70F15CF3C71EBA6 KARI-EMMA
690,250,316 *474F4D2E8B2CA50D116AA811BA13E711B66DEDFA NORRISHEDRICK
690,250,317 *4747D57893963BA2F25757B628B4EC426EBB3BD8 NPSENPSE
690,250,318 *4741BB126368648BF373F7A600DB6DB9F3BC4C0C KCOLLECTION:CZECHSUITE/SYMPHONYNO.8/SLAVONICDANCES
690,250,319 *474460824D5A604D271551C44C674E1A704216B7 numbershoock
690,250,320 *474EE6550BA2153F534A6C13B203C031D71A2C54 KENNY.VANMARTER
690,250,321 *474DA530F82DCF4C6C8CF1AEEA21D0DEFBF86EDB O/!2
690,250,322 *4743949D4D9F7E9D4204DE1847ABBE1143735FC0 OBSESSIVE-MANIAC
690,250,323 *47426324C2465DDB85020A1E081AD60BF1DB6F1E [email protected]
690,250,324 *4746A62308FF7C66BB569DC20D41A64A113222DF khaliqya
690,250,325 *474390FC776B5B509D5BFABE3721B4F83F2CD6DF KINGKORZENSKI
690,250,326 *474571760D89D405ACCF024DA01B76217996BB7A KIRBYERNO
690,250,327 *4741E3280542B860F06646A6950417B1642C5EFA Kiss.of.Fire.(a)
690,250,328 *4749F1AC7DD928D42C2390AEA8289B9DE9BA10B7 kkpretty
690,250,329 *4745AF69C2FA7530C3EA119BD3142FFE55B03C85 OMIIKAYING
690,250,330 *474A0CD8386B2805B501F71F193C0BD6520E9840 OnBail(feattheGame,Daz&T-Pain)
690,250,331 *474F25A25BCA02C37893CB05CEB5C5C460B3BBF5 ONTATIO8
690,250,332 *474CFE477A0FDC5C8A7A9445BFF00AE358802081 kollisjons
690,250,333 *4746AA715F41DDF1782995C00B6BD13350C9AA71 op 4, no 1 in c major: allemanda presto
690,250,334 *4741FC6150129FCF226B86C0DE3F843DDBFCC788 oprahed
690,250,335 *4749B30C9A93944FD8BDD1B57A785205651F602D KRIS.SJOSTROM
690,250,336 *47420EC2E0F41DAABAEBE1C6927FA58056DD7E97 KRISTENBOYLE
690,250,337 *4742FCF1399056D27A4C23735E23429696F595F6 krklrrs2
690,250,338 *474F97957F2B0159820B760A1D5DAA1270BF271D kuehe7
690,250,339 *4746840CC527542616FE29C3EE154280CF30321E labyrinthfish
690,250,340 *474E28A58F4191BBC753967B15D5C33188315E7F lachalet
690,250,341 *474C5D95C73A858080DC20486187CC1CEAC4EBF6 landways.
690,250,342 *474822D851D2D297A5AC535A6E2526162EEA1410 PALODURO11
690,250,343 *4740C858BF26CD83857BD21487A67315B9807D6C LARONDEDEBRECH'
690,250,344 *474C8A9BE4A881C63DF7F08961847E93235FBE65 LAVERNEKORAL
690,250,345 *474CA232182D8ADC4EEC3F8A0660EB58491E50F5 lazaroalleyne
690,250,346 *474253CB1A77DF305BD60C689363F6325B3F0D98 PAT.GLISH
690,250,347 *474DF1AF76AF023BEEDB9203212CB0DEC512FDC8 leah.wampler
690,250,348 *4741D5CFC694DA79210ABAEF02839F0780A9518A LEAVE.NO.MILLIONAIRE.BEHIND
690,250,349 *474C61F05564A4ACE8BC4ACD8A17E736401C05D1 paul-strama
690,250,350 *4743CD97EEDFF41EE8F6A0FAA8CF1C85804570FD Lee-helm
690,250,351 *4742C5B2F32EF7E91B27E7DE48CA026B590BAFB1 [email protected]
690,250,352 *4741FB1659CB0D8C3D4C47C33CEAEAF9047FFC34 LENARD.RUESINK
690,250,353 *4745BA91F4C7E807CDDB8A3A7503A0EDFC583546 pearsoncoldurnfords
690,250,354 *474B1A0B5955476B1BF4CA873FA2D69415F990A8 LEONARD19
690,250,355 *47488036D8824A19C5B2E3F2E8562C8FE5FE8699 LESS20-DUDE
690,250,356 *4742FFD21096DBCDEE07C6937B4713102AF8D361 PERRIERO6
690,250,357 *4743621FF7F99772E72E60589AFF538070E93CB2 [email protected]
690,250,358 *4743A9DD10F05D2BEF1AA2A73E7E51404AD671BD [email protected]
690,250,359 *4741A2DC0171E9FC85EF3FCEC89E9AF686D003F6 [email protected]
690,250,360 *474B9B13DCE6F70632407743F53805456973250D PHILTILLIE
690,250,361 *474C462FD9D3935934FD44B2F05278E39A5F2B31 LifeWithBears
690,250,362 *4747A33AFC4D92330402255BA41981E26B9A45F0 LIKEDYING(BONUSTRACK)
690,250,363 *474CDB338DDD732A29902C2A457B0090F8715D03 PIERRE.HANSMAN
690,250,364 *474FFC8BDCBB1A2D46D28BE9B67FEB3B3D954B52 LINDBERG.PLAYS.SANDSTR
690,250,365 *474CD49BC2AD12DCB49C6990802A46EEFDE6D8F6 LINDSEYERICHSON
690,250,366 *474D9CCBF7DC2A92DDFB7E3B401C80C8FE9CC289 LINDSEYJULIET
690,250,367 *47440964A49129EC3ABC99CCF4CE8BA00779E0FB LISAKENNA
690,250,368 *4742C403260013F90E7B4CED996EE53681E76CCD PLÄRRENDES
690,250,369 *47415EEF54512E845CFD277BAA47C11379AFEBA9 PLUMEAUTJES
690,250,370 *474F4A807A31F9BFA981420910E133129C2CBA91 :[email protected]
690,250,371 *4747215F713572A1F45ACB7CCA9AE351CFE7BA52 POISTÄÄNESTYS
690,250,372 *4749DE3A06F01F76F9B6EE487305A119083712D9 polttoainetta
690,250,373 *4740D9823C6D3463FAEC096216B2AE7D2B2C41EA LONGUEVA3
690,250,374 *4744EDAF883716FB73927BBDB89DA022A830C8E4 longvenneman
690,250,375 *4745F6183376246EDBF161EC9E80B901EF66CBD9 lonnieroen
690,250,376 *4742889A167441B1A91914B39AFB6259512F55BA LONPARLAVECCHIO
690,250,377 *4744B4F08CB8C91FA0BDB6942FE7373D69FF59C7 LOOKLEN2
690,250,378 *47467812B5FD6223A625FB977152A0C58E3B46E8 LORDLUUYDU
690,250,379 *474EB366128F807B50538810BAFB38085772ABA9 LORENZOBERNINI
690,250,380 *474614BAFB54E773E3B652992A63A81AE500B1CB LORRAINEMCCORMACK
690,250,381 *474154F9C256A0606AB1E9EB39420074EAC49520 p###p.*.*.*.~0~oo->-<
690,250,382 *474453618F9003CAAFBD1AE08C23F8C6489BEA8E pravnoga9
690,250,383 *474FED4A9233D8078B1127016929E34BB6CE5147 PREC0N57RUC71N9
690,250,384 *474A69A3BBCBF08A05E1963F868B011CE2965682 PREDEPREC1A+E
690,250,385 *474E9D704687E07284B82C1C435CB041A2079947 luigidurnan
690,250,386 *474C1C1D48B076F6920CB0C280A95D7E7EF60728 luigieltringham
690,250,387 *474ACBB855BDCA6F8788A99D2B2D41F707BA52CC PRMKEY
690,250,388 *47441944452A711FD3ACCE4BB7EBF5CDBC1F961F PROBLEM.THEGREENFAER
690,250,389 *474B5EE6C458F755ABD9CFD606646B357E1654A5 lutherselke
690,250,390 *474F30080C83484F4FE6C691395D12B8EB417316 LYLE.LANDON
690,250,391 *4742F550DD6B0553932A0A3F16F78BAC62247A77 PROVINCIA-DE-PATTANI
690,250,392 *474CB2D7EBE13C5D342E212398DA42570461F25A p|rssikurssista
690,250,393 *4744F46582BEC1E09568010C0FB4AEE05B3E6CDB [email protected]
690,250,394 *4742972BF604B6BFB0FAA7C19B20DE987D66A93E puukani
690,250,395 *4745EB67DAEA8268F5530A7F48343E5436E6D461 P'YR
690,250,396 *4748F78996A0B05848A69E7670F9D6E36303C839 q######>~0)o(
690,250,397 *4743EEF4E87C5B984A50A2435D969081861604E5 qB.`~)8(
690,250,398 *474A5224E535A884588C41ACF81B86AC75D4CAE1 QJEUJ
690,250,399 *474E5B4F187168DAC90AEAED8988F5508ED89E96 Q"MO
690,250,400 *4748E196CF2AE03E2F5F35A2173F9AC06A11E901 qua
690,250,401 *474788D5211EBA31AA766259E15A4CC3D07F5718 QUINCYACOR
690,250,402 *4741D65F231FD1132C155C98DBEB0D3A3203A14D QZUOQ
690,250,403 *474C7F9DE54EAA8F9EA8FE1AEEF44FD56E4F3526 rabbydoo
690,250,404 *474FD471D3049B81C5B082B06849483B74FA1F43 rafaeldamron
690,250,405 *4744FF4C3DC941AA9A3146F3977E35351C11E510 MARYANN-CUPO
690,250,406 *4744D7D4F9B903CF4715F03BA3B7D1E740D73659 mashoff6
690,250,407 *47425243CE32C4D8C581FFECA78E5D698DF1CFD8 RAMPHASTIDES
690,250,408 *474E6FE67A5ABE2D28FDD4DCE77B0F46AAA3AB38 MATT-BEARD
690,250,409 *474A5802CEAC941D710D0F943FEF48C9E53EB4AE MAUPINN5
690,250,410 *474BAA2F46DE7031D76B99A3277571D0C34CBBDE MAURICEWILLIAMSSR
690,250,411 *4749B801D4ABE997732163FDF4D47B709A12FCCA rauniol{j{ksi
690,250,412 *474E04C45AEE1BEC7968CAC2A51E2A07588D9E13 mazurkainbflatmajor,b.73"
690,250,413 *474325504EE54D978C6A18D15B36CC4484860975 rdkxyub0
690,250,414 *474D22E6ED4AB5BE139ACBF4D03BA8746F8EB34C RECAPPING
690,250,415 *474D4B5C65A98E6ED0618BB133D07191022A581F MELVIN.SCHUILING
690,250,416 *4749744E44B05221CA112C5860CD320F7A117550 RED ONION BLUES
690,250,417 *47488FE12ECDDBEB2D2F69314D446C5DE62E7B62 refoulions5
690,250,418 *474681A51530BF12B3BF469B6B26A40A6B462D3F REGINALD.SHEPHEARD
690,250,419 *474EC989B00B8076EF17B4B7A7512951FC603DFF MEXGUERRA
690,250,420 *474CBCE3D578C90B66D12FD4CCB775167990DB2D REIDGUNNARSON
690,250,421 *474EE495E0A09C973D0DFE95CCB99CA10F254BE1 mga&
690,250,422 *474C72E9F75638C8620A7649A6B91EFED335669A reklámokat
690,250,423 *47471FFEAEBA7A8A523384A5989B9112198C696A [email protected]
690,250,424 *4747B4BF191E4DBE824A80CD06F7F02003DEAF00 [email protected]
690,250,425 *4740EB47A00AFA8CF7752BF969974E9B71360EF2 [email protected]
690,250,426 *4740E527AE3CB101D5E098F38FCE9A2A561DFD1D REPUBLICREDSKIN5
690,250,427 *4748D874B770FA6059C9689D11FAE89BA62D3108 MIKELPANGBORN
690,250,428 *4749EF1EF655FDCF7BB1BF61FF1F111FE0F521C9 mikeschnettler
690,250,429 *474C8675084BB5BA7784E9F4FF83FE6650CCB846 MINNIEHENRY
690,250,430 *47483AFE1960907E2762E4E0D356AAE52E106311 RICHARDDOMINO2
690,250,431 *474CF5761DD27D419B66C72F5540B0EA280CB702 RICK\
690,250,432 *4744C1104DD41C09020D7F524B58E226243420E2 rid-14vzebh394p0qyd10dpj
690,250,433 *47491A799886755B139DBF2D8EBECA43F9B8DFE1 RJESTELEMISEEN8
690,250,434 *474C31D04D0B4EBB9DC3F79C522BB03FF455CAF1 moonlight-farm
690,250,435 *474C36DE3E350CEC1707C11F5720F12915A15784 moshebleicher
690,250,436 *47430436FEA153E6B9AB920AEC0FED30DA8EE1DB ROBT.BONENBERGER
690,250,437 *47476E112CDCE92DDEF18CE5A138BE01080EF291 [email protected]
690,250,438 *4744E603A1D87B9B58CA2DC6F1187F1E19522FB8 MOVESTR4
690,250,439 *4746011DDA65D90B0F57D94DE3969BC74ACC84D1 mpamela4
690,250,440 *47405187EABD622AD063794042E0076A15DAA507 MSA1PHAB37Z3D
690,250,441 *4743F7DE28C3FEA3A97F1B8D35A38993F293EC74 rodrigomcgahey
690,250,442 *474652A04E6213F7F5947B60C31CC29F6769DAAB MSSOAP
690,250,443 *4742E5ED8101E73A60CEA4F867B2EEDD2398EEC3 ROÎDESL
690,250,444 *47445A5A1F6123170BF8FFFA672A65AB40B3A6B3 roklubs1
690,250,445 *474343AF1193E249F73681A08568E853F7B800D7 ROMAN.HORNBARGER
690,250,446 *4743B447F7D249F029BD1A979F0A7F4528935AD3 mussengue
690,250,447 *4746B913BFCF492D4C3720A8D2EE7082D48A771E [email protected]
690,250,448 *474003342D63EEF31CEB5B17AC4FD9A1A0790A61 MY0M37R171$
690,250,449 *47418EE0F1A1CB2A8D6286413FB838348BDB199D MYALCESTIS
690,250,450 *474F7500C5A36447B8CB24951D47F04826AEC6A0 RON.YUNGCLAS
690,250,451 *47455BB90B8862A305F0BE6968D3347DD701DDA6 ROOSEVELTNACCARATO
690,250,452 *474E2A27A54CB2E8EA458414F9E6942E3D82B8DD ROSCOE.EDMUNSON
690,250,453 *4743BF17BD5730B73EA9C21395C08361F98A5AD0 ROSEVELED
690,250,454 *474705702D197240D6948DBCF0138D0B3F93B6B4 MySweetGal'sGone
690,250,455 *47402C09F5256D2B2D48E5B9B87AA8CE31ED5A3E RUFUS.WEAVIL
690,250,456 *474735D9E3B03917ADBE4467D5FFF30055251F08 RUSSELL.GRANDE
690,250,457 *474401DE364D505FD26FD16100AC2C9DC0BAB486 RWHASBORN
690,250,458 *47406D97EE6FEE17A2D4F0332405F57381CA1C6E [email protected]
690,250,459 *474B36AAABAB6CD4A6D07F34C36533BD09AD1F13 NEOBHÁJITEĽNÉ
690,250,460 *474A5467A5770CFF7DAA31BE01E299D5A7FCD595 [email protected],
690,250,461 *4740C907D3049CBA9039B3E36BBAEECA76FA4B89 newcode6
690,250,462 *4743A8EF3D70629A7741627ED238C7E29AD2B455 SAMANTHA DELANEY
690,250,463 *474999DC30181690DC0DE257814B7E4444F07463 samanthareddington
690,250,464 *47455C2EB2B2944B29ACB33E5524BDC6C6329C6E sammietrucco
690,250,465 *474F239191F658920052FB9761700D65DDACA4D3 nickliddiard
690,250,466 *474DEF279E06F8EF4992E0B924A83ED419E649E0 SAMUAL.BERESIK
690,250,467 *474DFF0E58F530DDF1EF2B092C486C36528CB527 NICK-STEGALL
690,250,468 *474ECFC7E6D37191810B4AC393DB36573660FEA4 NICOLA-ROSSI-LEMENI
690,250,469 *474406F62D03D8A8737359E7D5B7FDDBA2B02182 nigbolu
690,250,470 *4745A6DA71A7CFBF321F42E2423882C6BF56C672 NIKKISIEBEN
690,250,471 *474237A50E11661DD96CC71BD510032E97656881 santoboyter
690,250,472 *474EF35B9AF58E735DC74FB90490DD0E6743FCA0 [email protected]
690,250,473 *47452B5546A9CFCDBDEEE05C256DCCE6D3EE92DB sarabio
690,250,474 *4747A4D83D511C6D115A997BA22B1FF4871CD022 SASCHA HEHN
690,250,475 *474E4B153925F7B7EF50EE041C5A1035EA513B7E NNR
690,250,476 *474E1F6877B7196098301EE08997315E3D18AFE3 NOKTI.1
690,250,477 *474DC880C6CFEBE9DB36B82AC2463A3FC2816127 NONRELOADABILITY
690,250,478 *4741D10B34226CF2D7C74EB51FC4F529442A7B40 SCHOUWDEN!
690,250,479 *4740C3EAC68EEF738D4BDBDA4923D5D0DE99BAD8 sean.koelle
690,250,480 *474C9F96DE98604134A04D57095CB79E27A90B18 Seen.This.Mexico
690,250,481 *474B5E6BA9B841CA3F85154E0997429B6044119B seerti
690,250,482 *4749FB78A3C58319444751D3206B4D40DFA7653C SEKATUL
690,250,483 *474F5DC1A7A518E04484B539632C16693F1F9F9B OIGGATRO3
690,250,484 *474B36471B4C2922A77A1575FE89D61713153B70 SEXFORSALE
690,250,485 *474C90318A73A3A58D261CC15D1E9E8E10EBD52F [email protected]
690,250,486 *474B73D3E9A852A46F28A7DD5D06919F3BC81203 SHANNONBROWNS2
690,250,487 *4748B62950B5D85EEB822B7057904D61DBBAA33B SHARON.STRUVE
690,250,488 *47491216F71C51684452F595A3E7EEF34D995039 onbekwaamst2
690,250,489 *474049D569DC1A565F22F5A12C462C386B193AF5 O><.O~.(3
690,250,490 *474057034D2E3B3A87D545D79D21BFA25B7FB352 [email protected]
690,250,491 *474E744E72B62482E30101AE33F879402417D1EA )o(.~`.~`(#####p
690,250,492 *474D063D1F965DF708D5AA5B276212A650447192 OPT4TIVE
690,250,493 *474D2B9EC9213F5E438C08E3ACC0C41897BC3BA3 [email protected]!ES
690,250,494 *474F0B51CE023D59284460EFE3B262D615718AD4 SIBERSKI12345
690,250,495 *474A8490171707B0563850725978BEEFF598F0E5 SIJEVNU8
690,250,496 *474C390DD33D89E0650B4D8B55728AA8A9DA6BF2 oursala
690,250,497 *4747A628E0AD13BEF5EA1C2A81FCC17B737E8DD2 OVERCAPACITIES9
690,250,498 *4740C3C1E7496B33D3828098BE4783FEC2274175 SIMPLECAROL9
690,250,499 *474737BECB6F02F44C5BE7F3FC6D09793996E98B [email protected]
690,250,500 *4747963EAB21867CBE5AA467C13E7783B981A13D (><)*@#P
690,250,501 *474A825EEFDDB218216FD39AEB8285A82D80F2E5 [email protected]
690,250,502 *474E481BEF599FD2BBD54BF6D2E65DC48F68DDD7 PALAIMOS.VALANDA
690,250,503 *474697ACA9BB5D2938441BF54931FBAEDE320B67 SNAKEMATTHEW6
690,250,504 *474BD2E93B94AA1A932B8B0EF2592613EE7FF388 [email protected]
690,250,505 *474D906FF3986AF4A95E3C383124311A1F766636 PARLINDA
690,250,506 *474DA4FC92062307339D0EC5578E0F417B3B601D PASTRYN2
690,250,507 *4741FF1D30BA15155C5B6C31B001D28880F260DD PBG-
690,250,508 *474D8DA8E34130F781037D02DD57FF8292B8021C p======B~-UU
690,250,509 *4745216C565F5887B6726ABAAB44764F5A2F501E SPATIABIMINIQUE3
690,250,510 *474C469936D22DD83E45365A707AC6B09D0814D5 P#####D ~O (00)
690,250,511 *47422FDE37A337822918B934457E95B702570727 spiffies7
690,250,512 *474ABBE51FDB43968C45012609C05D63A7A61D82 src="http//ecximages-amazoncom/images/i/317mx1xqh8l_aa115_jpg
690,250,513 *4743FC49459F4C186DB45335B5B9DE1B6A04D33A PHILL-FLY
690,250,514 *474FF9BD187C402E1345C3184DE030FF479239E7 SREKRAPNIKSAM
690,250,515 *4743E8CD6086B28507D1F780325BF648E028A4E5 PHONEMICIST
690,250,516 *474015DED210B569F0D43C3701D7BD3A086A84A9 SSENNEEKS
690,250,517 *474CF016A82AB5DAB550D6443F38D936D828165F PICDESK
690,250,518 *4744E00D037CA92C4457DF3B526C68AB873AAB0A steveharkins
690,250,519 *47454DF988F6E909385D4C05DA9A1EB541B585B3 STILLINGFLEETIA
690,250,520 *4742CB62C5E4380844CFEA7CA3598DC4C60606A3 P----P.*(O_-)
690,250,521 *474B7EF07BDDA9EA817DA3E7BF13314E03D2B9F4 STROMLINIENFÖRMIGKEIT
690,250,522 *4744339509943624799463B984CFAE7680D38AE1 STSIHCRANOM
690,250,523 *474F73F682E7036C542E8E34DB245C373F74D0E6 PRAWIDEL9
690,250,524 *474995034D10CA24E1CF95A7F676669CCADCA7A3 PRBLSCHR1
690,250,525 *4744F4BF57089874F9F0E935A2DD43EB76862E59 Prelude in E minor, Op 28 No 4
690,250,526 *474FEDC4D48F53469110892C4E45BD569BB932F7 [email protected]
690,250,527 *474F8035BE72D5D02018A1159A5A31DAA8B11519 suhatadros
690,250,528 *474F7A3765FDECA89F6EF3F03328E4773F704038 sulituanbsw
690,250,529 *474ED85ACFCB07659DABCDE400B88EC59AF78AA2 PRIMACYSING
690,250,530 *47476F5FD5016E7CF95E8D6FFB74A3F80DBF9C38 Primats
690,250,531 *474C90FD7DB0DAF6DC9848EAD59C2E79DC7ED7A1 SUNGDRONICK
690,250,532 *47482E753353287A9ABD39D7E62A83488BD8A3BA PROEMPLOYMENT6
690,250,533 *474811E560C7B3F1638C24C34B9B5373859C4F73 SUR3ND3S
690,250,534 *47446DC08CFF819D40952286EF4C747629B738B0 [email protected]
690,250,535 *4746DBE11539A4D55D458A4BE2C069BE3CD5A611 punkpunk33/
690,250,536 *474B792ACB3A3DE4235630950BEBB855028886DD [email protected]
690,250,537 *474E0A3365A97374A8B8981AD1A0E4417F1EA468 [email protected]* * ><
690,250,538 *474BBBC4BF82CD05F7114330431177FDA422B28E QHAIRTO2
690,250,539 *4743198A622CFCEC80F81C42724F76406E370DAB TALBOTT”
690,250,540 *474DF971CEC11C82D3509D4D4E9A2DE1A6CF2EAE q----p *3b<-
690,250,541 *4747EBA22A6AAD2A08533CE67A61074BB0D5FD4E QQQ11162
690,250,542 *474EF3B6C4355758D2B4582FFCCCDA22D9003157 qua
690,250,543 *47404577E324FE5CA65A3B2650FD4F9769E2BF0F quaneities
690,250,544 *474EF111C41AC691F3FB7FF93F681200D98BC461 quitebutraw
690,250,545 *474CE66895F0C1F4A1454A3FF0A8AC4483B662AA [email protected]
690,250,546 *4748FEEBFADD9F0361D232D37B9F382696F64785 R1EA032
690,250,547 *474C07EFBA08613BF7D508F5FA76C849735B132A RAFAELEKINS
690,250,548 *474C9B570BB631F216CFB6CEEE0FB88519B7C068 TECHNICALTERM7
690,250,549 *4745878A9564080C3C9857AE5DB664952BCCED5A rajab.ali
690,250,550 *474279E07025C55BEF11BADAC12592EBCBF9EA1E ted-robert
690,250,551 *4748F987596CEE4B0F3FB5BA93C798EE3BC46953 RAMIRO.BLAY
690,250,552 *474D7AAC3DBB2244E375B287C2EAB58F0C326557 RANDALLGHAZVINI
690,250,553 *474B7850CD2A2E9E9B9B7F029EDABA9E62790C96 RANDYFONTAINE
690,250,554 *4740AF15A304E9F99BC0796F3A35C4DBF783ECE4 teodoroportugal
690,250,555 *4744E5B1069CF2D4FE986B5F6546223712E77B41 raphaelmarling
690,250,556 *4741FCAB816A6DBEDF95D57F92F21C7E4248E6AE RATSELPPA
690,250,557 *4742383041F4BC13F53ADE388F8296336C78D7AB RAWEST
690,250,558 *474ACF10E217B54328338C3A62EB902BC8CB1130 THE CRAWLING BACKWARD MAN
690,250,559 *47449E65A195E0BC2560A3C110CAC1512868A3E3 REC4T41OG
690,250,560 *4741BF2CF8D72B345D05FE3DA38F9EDE1F2F36D7 reckcned7
690,250,561 *474C71ADBE2B8C52805E9C2BEA0555DF9F35AE79 REDEVEZNING
690,250,562 *4747CA7524667E3131EAC268B7E856F05F2FCC3E redniyhg
690,250,563 *4740696A76A18CA6818A87FCB9883CD180EC4779 THE.PERRY.WEISSMAN.3
690,250,564 *474C0776B91C5BD043FDFCB2A97FC4292BE82163 THING.FOR.YOUR.LOVE
690,250,565 *4742498072B4FEF4C78C9B82DC4462BBD80E3CAD THURT
690,250,566 *474DCD6E3A6C6DBAA994FBDC8F676E9A267CB476 RENAMEFROM8
690,250,567 *474B1D5054A5D8FB736F61B76F1F8A6471E56CFE [email protected]
690,250,568 *474CD7AC2234F480C965EA04B9BDE49231781B30 TIARDNER5
690,250,569 *4745F885AE6F3CECAF7854C0423F69D4D550D4BC TIMMYHANKINSON
690,250,570 *474DD59E88CFF115095DD08C2A1BB9C0CEC26125 TIMOTHYJONATHANS
690,250,571 *474DE64CA3E7FC548036CE622D2EF67C72321147 TINNAQ123
690,250,572 *474F3693019E7ADF52E9639E786824B505E2D561 REY.SHAMES
690,250,573 *4746E21F456D7D92AD4F9C1DDE5E9F55E8148E55 TNIOPGNITAOLFILED
690,250,574 *4743330134EA991B2947798C32C6879297D6BE64 RIADATTERETE4
690,250,575 *4745EF6A33EC7B588382CECA15CC829B62088078 ricarte-valdez
690,250,576 *474AD86F5373D3F0C7F4E309B1677A487A5421ED RICKROCK48208
690,250,577 *474E2CBB6931C5C4926E25B5DA1C3724C08DE6D0 TOMMINISHA9
690,250,578 *4748F10F9F052603D4CC34389E33FB8D1F2D40A5 [email protected]
690,250,579 *47438EE674DA1944E6A4DA2DF7ECE93A62F06EAE TOOTHPICED
690,250,580 *474D80586FD2C080E0B5ABA5B80B3AF6A851C8BB r&janbangremix)
690,250,581 *4744E501C86C011172AC2F690F2572133CE0BCCE TOWERINGLY9
690,250,582 *4742062C4130DAE943CDA0AA61FF04AA4318D9E2 TRAVIS.BERSKSON
690,250,583 *474530CED0275418FB16D4EECB328D8EABA0162F [email protected]
690,250,584 *47426EEDFDD4609C8A4DA82927F71FC06AF54A21 rodolfodumont
690,250,585 *4740CC87167B06D8735472DD01DB8A2C63235A55 TREVOR.KUDRO
690,250,586 *474205A0B7EA83458AA2B83EAEF941C6D0C83020 ROECKDOET
690,250,587 *474E185489B7DCD7414AA5CB251373CAB44FDAEA ROGER-STACKHOUSE
690,250,588 *47495532F11E364D6E02608421AD9207F10D3706 trino.soto
690,250,589 *4749DFB03A06E17B62126F1AE9FEC0DAB6CFD57F TRISTANBAKLEY
690,250,590 *4746FD2AE5AEE1745BE5C5C400230040F3354CC8 TRONSAUNE4
690,250,591 *4748C4DFC9772A7871B43FE7FFE16F21BC54919D TRYKS4GEN
690,250,592 *4743285206C42E98454574048F2ED4D80F09D107 ROSEDELCAMASO
690,250,593 *47481D841C2256D39FF54839A8D4FE90BBC629F1 ROSENDODOAN
690,250,594 *4749649C47D12511714633A47101966B86424735 TSELIJKE3
690,250,595 *47476E3D014EACCB83928E174984021A3BAFBBA7 ROSICOLAED
690,250,596 *474E51235BACBA04EFD88F5D22C42125A8FD53E7 ROTACYJNOŚCI
690,250,597 *474BB86269654D110A66CADE4BAEAC7B85BB822B TSTIWKLED
690,250,598 *474EC2C1F1E8E2EE031C23F6D67344B73A7C805A RSESQAI6
690,250,599 *474F191D79C0FD9889E569E53F7325B665725472 RSUMCV
690,250,600 *474E41D942A02AC9163EDDD84396848A4AF2F861 rubenboyn
690,250,601 *47436E9459C4538DBFF68005C9EA03675FA414B6 rubengrealish
690,250,602 *474C6D93F72F252C50FBC40E0171D5649B696EE4 RUDOLPHWURTHER
690,250,603 *474354DB8456B5AD3A49B61AC7F05F5BF05DDC68 tyreemckever
690,250,604 *4747CF4EAA4BA9CB8655B83029097B0DA55CDF6A TYRONCENTINI
690,250,605 *47448C8D13670E5045DF05DB4170D1BB0670DE4C TY.SIANO
690,250,606 *4744DC149119C5E6F55B0BD24400434FA5A1C814 RUTYJTYF16
690,250,607 *4741A92D0D59436AE5E8701AD0289C17B2B6ECD0 S104641
690,250,608 *474B3660C072FEF2281AF64AA0F54C3D89E8C525 UCHERTE8
690,250,609 *474AF27FBB8F923B51DE40CB4225AC19A634F849 s)8n
690,250,610 *4745366D98A33A7009607E56EB1C3138D1FCB7CC uitdaag5
690,250,611 *474A97CAA6188B043F0CC87544ABF8EBBB492D38 SAMEAPPLE
690,250,612 *47427D0358126D760B1D7B6D6785BF62322E4FD4 UNDERAGE.(DEMO)
690,250,613 *47424E08D2F4D9D7EE3FDBF50CE9CF03CD641F8B samskerman
690,250,614 *474BFEDF64F9F38F14BBAA9E6C0EBE91757A2A5C SantissimadeiNaufragati(VCapossela)
690,250,615 *4743366971B7FCD106307CE93238B7D1B223A676 SAYIT-OUTLOUD
690,250,616 *4741CFADA71C3686F2AE62C1111F354DDB2A867C SAYTHATTHEEMPERORREQUESTSAPARLEY
690,250,617 *474A9F9A1B9252B39112CFDA14ACC00DEEFD3DFF usersweet
690,250,618 *4749D36F6129428CEA6917930DD8ED0B56DEF36A SCHNITTMENGENKAT
690,250,619 *4743C1543CBF2BB5A69F59C89F30F00D0A8C621E SCHRRLDN8
690,250,620 *4740FB286935FD94E237CEAAAE2BAA2AF8D966ED UU.~.`@-----8
690,250,621 *47449F5F3D8DAD84CD66964CDC3226B659213BC5 SCIENCE.QLD.GOV.AUWWW
690,250,622 *474C27E6000951D191DCD5A7EDDD4A7FCB14EDAF SCILAB1234
690,250,623 *474889B9961E9C820A15762E467E9EB3BE3FF228 uwpu0ol1a6snxx
690,250,624 *474377F622F765ACCFC8C6713B0343095D7B4071 valse-de-bardamu-(b)
690,250,625 *474E985248B3779B68BF7C87781F2C0FD19B86F0 ŠEIMENOS
690,250,626 *474926EE4722241FB8B7FDCF7779469B8ED84FB5 VANESSA-M-DIAZ-N
690,250,627 *4749D9FAB3F5157F195415AAC6A236DEE415B858 SELPHKIN7
690,250,628 *474EE35F377D75B5C4EFF373A03066BFA3ABDCF0 VASANKER7
690,250,629 *4744E95AC0BD446137440BD5F0096DAFC2327C62 velik.problem
690,250,630 *474E3977BE3EBF94487B2B7E07C9CF1D55444EB0 VELVETFOOTBAL0
690,250,631 *474B6BBEEC4B3EA4EBB58BFED96ECF8A3CB1C255 SETTINGS,.RECORD.YOUR.OWN.SETUP.ISS.FILE.FOR.USE.DURING
690,250,632 *474702A81CB7F3C1B5BD1B9F86B082039BA866FB sexynatural
690,250,633 *4745C2307209BE0E085453601C7CEB44164D4F52 veronica-mary-johns
690,250,634 *474665E65CAA362C2570DB4794C86FAA0653B058 shaecole2
690,250,635 *4748B1939C465E5242CF79E68B63D36C7A6777B6 V=FAAA
690,250,636 *4742B8263F6E6E8145F1A10149BF2A4B216059C9 SHAWNDROSSMAN
690,250,637 *474DC7FD8D63FC84C7354B6C5827E3D2775CCA2E shawnua8
690,250,638 *474AD29EE714562F13275A32DB9AD109EC6F1EB3 VICTORIA.CARR.STUART
690,250,639 *4743CDC9D335F2AB97997A98DBB35CD3EFFB386B SHELL_EXECCURL
690,250,640 *4744C9C12F96189556FAC50228E859474214ADBF sherri-creighton
690,250,641 *474F37D82029B9C8A5CB55324F4E0F1044EFB338 VINCENZOESCHETTE
690,250,642 *474CA722A4417448F72132E3A88F7A1B56F5A257 VIRAJ-MADHUSHANKA
690,250,643 *4748AE42FE726F20650761C06E977DF36EB526AC SHOOTERREDWING8
690,250,644 *4748AC76FC6ABF116977955E9B2BD97638032EDA SHORTYPOLITICSES
690,250,645 *474E41ACCF71BB66936F1DDF5A066D17741AAACA VITELNETING
690,250,646 *474DEF3ABED79389911860DD295CEE19AEF8CB77 VIVIAN ALANIZ BORUP
690,250,647 *4740871B26A9BEA5684E61D0016A75E7B25D4EDF VIVIANA-RODRIGUEZ-VARGAS
690,250,648 *474553201D79D50E6BB2C3B3F752CC5761C555FF VIVI-NUNEZ
690,250,649 *474CF1749B5406F2A874946416D5EC186E72542B sidneyminacci
690,250,650 *474E2F3D81DC705138CE14A4DAF0504C41C56935 SILVERPOIUYT7
690,250,651 *474E2DA9CEEC7CC7E0E7538A935BE675EF14E701 VOORTKOMEND4
690,250,652 *47487AFA213E8DE03DE4E60AD460C3A607827BA1 SIMONDONDERO
690,250,653 *47458434CEEF1ACBABE111FE8B1DFB8D0DB69C3F SIMPINTEREST
690,250,654 *4740BBE4ECF3E3DEE00BDDAEF8593C5BE0AF11DC SINGLEPARENTCLUB
690,250,655 *47413C9FE18398778E27454A43144409D190D28F SIRORLANDOMARRY
690,250,656 *4744CFF5218D1B5321CFE27400DD78EAC70053B4 siwaliks
690,250,657 *474F38D10B10B472E23BC6707908A175641491E7 VURDERINGSGRUNDLAGEN4
690,250,658 *474912F375CA4FD851711B62AFE754CA2A26644F SKOGGY22
690,250,659 *4742382A3A721186FD8A972E6E462CB61FD531E5 W.>:
690,250,660 *474B83CBDDAC4B1F3DD9EE70E5E8D00255E5BFD2 W94523
690,250,661 *4746BE7A825E31535997175837A751ECA505ABFE wakeupandlivept1
690,250,662 *47471263DF2EF670EC425C6650ED6F26E46449F7 SMSCAFE
690,250,663 *4740E095198B56DF9A5592C9E0D0296234FD4200 sneaky19
690,250,664 *47409D8F0546BC233673C5A78C6042312592898E [email protected]
690,250,665 *474A27DDB4C78A0174857D31B87C043555FE95E1 soi\
690,250,666 *474B8814589F305E676CFF9691CD7030310FF54F wattages
690,250,667 *47415AF434D121BD09D6B0FB6A91A2604DC45452 WAYNEKUROSAKI
690,250,668 *474C6EC91A01197DEB1F4A6C7F8CF2A1AE8E3B74 SOSACABAISED
690,250,669 *4748A86F4773C5DC73780151B434B5B0D7FA50AF [email protected]
690,250,670 *4749BD31444C6F0DB8D48C9366901F36B38B8377 SPEAKING-MUSIC,-FUCKING-MUSIC-(JUNIOR-ASPIRIN)
690,250,671 *474B4B1417697455D113FA6D8BFF56EE3516741D wendy-pellier
690,250,672 *474021A89B31A3CA4F937CF428514A241E53BD76 SPENDERIONS8
690,250,673 *474CD1362F4C2DA625DE0019DB7D26A784635962 WENGLGO
690,250,674 *474F1A07B5C6BAA4C287199BF5B8986812907AA0 werda-spoelstra
690,250,675 *47491C16B72C8B6E2D732CF3843F1B54405D49AF Splat!! * * (B
690,250,676 *4744DE10D769D4E5B5073A159FDD31AD48A214BC WhenIWakeUpInGloryLand
690,250,677 *47445C41BD28618525DC27E83D7E184B4200AE45 wilfordahyou
690,250,678 *47405636E27D9B6B59C44D32DE829CE27D269683 s.senra
690,250,679 *474621EC567B541D7FEFC705DF8B8966ACD39704 WINECHAMPAYNE1234
690,250,680 *47434ADF8B1AFECB660AA0021F678572FF22CDE0 WINFORD.MARTINOLLI
690,250,681 *474C6B7CA6D65068C15F3A09712898B379C31AE3 wini-ray-ray-pookie
690,250,682 *474001138BBAFB1E95B71D18105007781C1FB0C2 [email protected]
690,250,683 *474EE1BF85D2BC0AC316B1C689CF99858137B713 wmounttsterrorw
690,250,684 *47431515D38492FA38AB9D8D8D9C20C4CF9B50C3 STEPHEN BAUMEISTER
690,250,685 *4743C92C01DBE2BE4C91680520EA5671FC1E4603 steve.kleinman
690,250,686 *47464BE68019005DFCEAC454224C9999FE5059FF stones.&.birth!
690,250,687 *4743E6F43474315B9775156AF1EDB86F88291E4D wundervolle.neue.energie
690,250,688 *474055C046070A5251E2AA20E0FCADC3A7D18216 WWW2CHILDRENORG
690,250,689 *474F2B6035C7DD2D715FDC6D2439D07666EB43EA wwwpailitasgovco
690,250,690 *47460AB96750230A74C096D25C9EA51483863658 SUNCITYGIRLSCOM
690,250,691 *4744CAD751EFAAB0741D8F97E7EEFA7FF3B565B3 )X( * * (#####8
690,250,692 *474993AD6BB74F90996BDB91CC5249CC8317B890 (x)o~o~<######p
690,250,693 *47472EA536C8DFC337557BAE18E7CBC323BEA6A6 [email protected]
690,250,694 *474E2AA88786AC6F09870687B562505796AA8EFE SYB-CREW
690,250,695 *47408950193087D5115C799D104ACAA4D4705495 XU-LIANGWA
690,250,696 *474C94BB79B3E3C42561E656E8B3E8D158FDBE07 xxxxmath4
690,250,697 *474748700DAC3C62ABBA7C174F95027F85BDFE32 tajares
690,250,698 *474AE1433EE68620FC84949B658E6CD55289AFC8 YFACEHBFIVBU3
690,250,699 *474B3725F222F6704DAFCEEC32A42F5F4937E64C [email protected]
690,250,700 *474F7D041E46C8E694411835F68CE7A03A93DEBD yleisns9
690,250,701 *4740002FC6D66FE8EE8D591E846563E4C7B5998E TANYACONTRERAS
690,250,702 *4741099C02370E8A1E778D00DCFBEE1ECE844FF5 TAP NOT, LEST YE BE TAPPED (SCATTERGORIES MIX)
690,250,703 *474D5311C7B1BB87C35919AF409B01E899C913AD YOLANDA.DECENA
690,250,704 *4742ED72164C7895257A6F12EA00627B7A666550 tara.lacher
690,250,705 *4747D58AFA22DC2B15B0238AFFF1DDBB87DCA3EA TASHABRENDING
690,250,706 *474235909352A045F37CA563AD0934ED453988E7 tawyeen
690,250,707 *474E37BBA92A463723BFA1AA974F2058EE3C0FC1 Z100774
690,250,708 *474C24E47B297382FB995DA48CFB5C813254F8EE ZACKCOUDEN
690,250,709 *474A09189C8DEEFEE870045C0B471BE49EE5626B TESTINGGUINNESS2
690,250,710 *474C2C3608502FB56298E3D1FE080F250868C937 zanejager
690,250,711 *474AB6642991F289D70C83619DCE6BD63A9E65DC ZAREAGUJETE2
690,250,712 *474FA4C5B1D83195352499DBC9E03557FE3CA928 thatneutrino08
690,250,713 *474FE4C6D45171EE6C565683464C11C59C584159 ZENARYAN
690,250,714 *474B064F9588EED1479FCD436ECCAE8554D0C165 thedance1987
690,250,715 *474098837919187614A85F7B5CD4342CD2C70BC5 [email protected]
690,250,716 *474483C84315421658A518CD22C93393E48735C2 [email protected]
690,250,717 *47406AD73D5DFBD4063D1233293E74CD10A4D378 ZINSAUFW2
690,250,718 *4741B77A6D31B1FE02D0776505063E8A09865612 zoi-chourmouziadou
690,250,719 *474876B2327DD294993161C9D5ECE2208F834336 zonian9
690,250,720 *4744FFBDEC2530C1A34F2C4BDB308830493D27BE THOLED5
690,250,721 *474AF17884B457223C0BADB4E051388C031E3347 ZUSJESVANTRICHT
690,250,722 *474823F5DD1D4A2DACBDF1CA920F765FC500E938 zxmbaa
690,250,723 *474011361C7355F9EE8E9770EF2C7620D25A3662 ZZJE
690,250,724 *474D77B292E92913FC3DC45F3656423C6BFB3E60 tiobrazyt
690,250,725 *474DA84164C8F342C29269532965435719F2AC9B TL744646
690,250,726 *474E203F3FA39046631514629F038A75D0361F46 tobiaswittner
690,250,727 *47498A6F99640F415A9238664CCC3EEAE28A0184 tolon015
690,250,728 *474FA48C2A0FB46340F89677B3203C2C469E35C9 tongking
690,250,729 *4742B4247ECA907F3D5DBC05F959F8457798DA77 topsögüt
690,250,730 *4746C5AB0FE36D6209592EA46BAC73CFD940C363 опонирање
690,250,731 *47447AC09A5C781991ACBE6BB0EF088C340C96DC TORTURREDSKABET5
690,250,732 *47490B0A8D35083D3C6DC873AE4BE807941A5A0B [email protected]
690,250,733 *474F7DB46006225FD37F54D949E61E61EFE693B9 СЗЕРБАРАДÁЦЗ
690,250,734 *474FBCEE536CA7461970EC68A688DBE55BAE480C СУППЛЕТИВНЫЙ
690,250,735 *47443E8B004A2D6DA32953276ED0B95238FE3CCD TRAUMAASCHE
690,250,736 *4742D6BCCB127B85765D7E1878D769115FD11338 treceemissperfecttaylor
690,250,737 *4742A7620ADDBE01835739BFF9A145DEFC238AD2 TREMPLINS4
690,250,738 *4747F28E19D6AC2801168F602CF32B84A081396A TRINITYMCNEAL
690,250,739 *474CA3E417F07BC353195290D3BE4592A19BA2F6 TRU-SOULDIER
690,250,740 *4747DC996E1522F887A84DCBC57542FB833FD32B TRUSTEENOMINEE
690,250,741 *4743364A0FAEC9498EC3E970AF3EBC8E0BDECC94 TYLERGOTDATJUICE
690,250,742 *474E870C38D671214F36952AE7847AA5E373350A TYOERAUHAVELVOITTEESTA9
690,250,743 *47462FCCC4C9E45C07D0E4974C7692BC71FA48C2 TYSONBASTONE
690,250,744 *4749ED603EF687E848501E8F022807837323FF18 012QW
690,250,745 *474E162DAA84491BF105BE72EB9F04F0A80FA7CF 04191768
690,250,746 *474E8DD0BB5274ACE14AC39445DD086681DD2C16 05-12THELIGHTFANTASTIC
690,250,747 *474BAC10CB29CCCF87F8E18AD9201486624FA9E7 05h42pm:dig
690,250,748 *474D6145F89CE2514ECD76A4115ACDC98379F71B [email protected]
690,250,749 *474EDC0C35FCAB30FD6AAE507C055D09FE303900 UNPRESAGED4
690,250,750 *4747A74DB9ED0BFA250637B6232E2E21E772D8FB 0ILUVWHALE12
690,250,751 *474ED62652FCDFCCF64BAD67F99E92001D9C0A20 USERTARHEELTAY
690,250,752 *47444E37AF521E3D7CDBE40B5EB223FAB8579890 USERWINHUNTERPROXYCH
690,250,753 *4743F29D77AC8E7CEFF1B14082D715FF93B90B26 1029527 summit-declined-to-comment-on-the-action-
690,250,754 *474E7267598975CB6DFDD1132E87AFA47B7E4477 UWET
690,250,755 *474168E8D28B39791BA5E3C53EAB1E0ED8356022 VALERIA-M-L-WASS
690,250,756 *474F2F5A54A61C3885C9CC93045F71FF8E3FE236 135.vollzog
690,250,757 *4749EF0A7EA3B8ABC869AA7B574D88715283035D VALERIEGATOR6
690,250,758 *47491F81AAE445899007C11CB59AA593F602CCAC 1424496 TANJAKOLESNIKOWASTEHT.
690,250,759 *47475A9B4127841300F01906DA271B40E5EB3CD2 15DJアグレッサー3(同「そとみどり」)、F
690,250,760 *4744C2A8FBAF20D938251A14803549D96B225F0C VALINCIAQUARTA
690,250,761 *474AA62E2A27EABBB71802B1BFBF47E2C4602E49 18041246
690,250,762 *474989385F26E5EB29FD2C95C9BD029E1A4D8828 1921apr08
690,250,763 *4743342A0B2D26C8697BE8AF57AFDD0531CB9AD9 1aciklarsa
690,250,764 *4746DD97D5B4AEDF6761C5C8CE7FF5AF0705E8EE 1AHAATLAV
690,250,765 *47499DF33333D71F68B13D985694831CACE99170 1alayis
690,250,766 *474D4625E88309CC7DC44151A47D29EAEF7FBB1B VENERAMUR9
690,250,767 *474BCBD0A09DE3EC57D78FD84D0FA95A769EDB7E VENIEBAMUSED
690,250,768 *4747194642BDCF5436C9DE7851366C2FEC2CDEA4 1.auto-zirkus
690,250,769 *474EB79BD3888134567AEA7CA1FC81A8D2C9F007 1.BECERRA'S
690,250,770 *4743DD0EA890BA75DAB82F59D1B93D5904D251F0 1BIOWEAPON
690,250,771 *47408132C6E10D75FDEEAA27BF4F9E7231B92C0B VERLAG.2
690,250,772 *4749BC120729DE0A26B3B2A42A744CC0250BF71A 1cash-disbursal
690,250,773 *474CB91CDB48B8ED48A09764E98520DE541C21F2 VERMEIL1
690,250,774 *4742C81C55F7C3B822C2B7E7FBE80A581B2141C7 VERONICA-PICASSO
690,250,775 *474132CCF677CA1A354C22B460F505293908D5EB VERONICA WOODRUM
690,250,776 *474241005BEC44D37A4E79A50948D90D8352E146 1-ERMITTLUNGSSTILLSTAND
690,250,777 *474086DCC5AE816E9ED8D8B3327AEB5610D80EA3 V~FO
690,250,778 *4746ACCB1439E20986CE2AEEF11C4715ABF1E21C 1.FISCHTAFEL
690,250,779 *474C7A978682A42F7CFC8CF18D49D63E34299F83 1FORTUNIN
690,250,780 *474A8DE11893074F1A21C313777F887221DE9431 victorbilla
690,250,781 *47445A6F17466372CC008C39166789D707C958A0 1HOTANKIN
690,250,782 *4743D9A8FD9C86AA3406D42BE14A4CA0CFDBC53F VIJISRIJITH
690,250,783 *474A8DA1A242021350645FE3C8EA9E885904E298 vince.engel
690,250,784 *47473577BA149953F6B00A82C59B46C777823C26 1 lippalakkip
690,250,785 *474F63CA59BEC8149C4DCDED3BF7EA234C0FDABC VISITROSSENDALE
690,250,786 *474C55B46A34A76076A50A032F37FAA97DF799F8 1.NARCOPOLITICIANS
690,250,787 *474D65F7416B4BCC5CAA47B8F3407FA4849E048A VLOEKEN3
690,250,788 *47468C9B2FBB570CF252357EC6E68316EF9FD97F volume-3:-1924
690,250,789 *474436832F32892C3F2908A94559A1B25E0ED091 1.raakasta
690,250,790 *474F0EF7D9A78F9D49827C5419F19A054CEBF6F5 VPASIVO
690,250,791 *4744EB1C7BF6DD0E0B702221832BA53A2FA7BBF6 VRFWNKL9
690,250,792 *4747971D236B3D5CFAFFD87B2765DFE1D5FE9E31 VRMPQ
690,250,793 *4744554FDD7532B87DB8748D611AF268B134D328 1STARZINSKI-POWITZ
690,250,794 *474E6761984029D20EBEE4579EE698FB49B18B29 1 SUEHA
690,250,795 *47431AE222AB5C356C470F11C31B7C1C7D1F9CFA WAIS-HAKIMY
690,250,796 *474038CA41AABA125010F39F5EC18D4A96541DF1 1verius1
690,250,797 *474671C6402E78310856E397410EA148D32C55F0 WALDO.MCCONNEL
690,250,798 *474F6CEA8AF04B4F87912986B2496A205046D1E6 wanday
690,250,799 *47491698535EB45F7408CC478B906814460F25DC 20ef1122
690,250,800 *47426FC2F47A4D98C0626C4103EFBB60A9CA0985 WANNORHIZATUL
690,250,801 *474C4810ACF74E29D37FCB0195ADAA6C91DA1F4E [email protected]
690,250,802 *474C97E5E313DF5462E62F97D83F2D571CEDEAF0 wattages
690,250,803 *4741E341260F2B024555D9A0BD55B01C564DF338 waylonansbacher
690,250,804 *474008D583098AB9AB11E45E483005EE0A84386F WAYNE-BARTOLO
690,250,805 *474285F866F5A3C1B9AABDA254EFAE08D189E33C 2326111 SUDELLAHAVAITTIIN14PENTUETTA,JOISTAV
690,250,806 *474D4CFFB89ED89AD55E701DFFC7F2FDDF60BC69 2401913 NICHTSNEUESVOMBSCMARZAHN
690,250,807 *4747D5A8B56F68CA0BCCC30C84B31D6C5E074ACE WEB(DEMO)
690,250,808 *474DDE01CB99627FC3BB1FB9DD7764121C70938A 26AUGUST1476
690,250,809 *4748AB2ABC4A275FE2AF26479421C5270C871551 wendy-scheg
690,250,810 *4745C7DEBA53E005DFA891A2B682C7553EC93D3E [email protected]
690,250,811 *4748051B5CE39EE85949F639CBCCB32734ECA580 [email protected]
690,250,812 *47463CD3E2B5DF6FA82E0A682090EF04612EA04C 2ATTESTATO
690,250,813 *4747174BF2ABDAE276CD37E711510150603C1E3C [email protected]
690,250,814 *4740E293A014E72F6EABF94D3475280412E581BC WESVOISARD
690,250,815 *474857AFB512D70F639CF1B5135B18023F79087C 2.irvin's
690,250,816 *4743EFE05B89FD88673A67FB673DCE66FF4E8571 W`GV
690,250,817 *474F18FFF4C843302E59244AA1661433ED686FAE [email protected]
690,250,818 *47419ABD63F665C9B4420AD452CE0246D76BD7E9 2RSCNDNCY
690,250,819 *474F8A73E1263CE11B8E3BF9DD1033297BBF109A 2.seniorenschwimmeisterschaften
690,250,820 *474973D80208CC5CAE289EF351018C5AA169DDD3 2S-MARKETIKSI
690,250,821 *4740FD201BA3C7D513DEB8809E76680B3CD37CE8 2taittinger
690,250,822 *4747B8D66A007B10980971E7D4822903D3D03E14 WIEZNEW.TWOPHENK
690,250,823 *4746FB0B4B0D895D9807FB63E2301EF88B4ED051 william-daniel-nichols
690,250,824 *474F9849488828BA6A8C803B02B722CCC0563880 william-harry-clarke
690,250,825 *47489FAD3917C23FA05A7DEFE7750240FBE008F4 373079D0-B60E-31B8-B03B-6317AD117607
690,250,826 *474C06FC7D5E5CA4DBF995EE32B46360958828AA 382hudson
690,250,827 *474FB20287F234B73EB8521BF243637A2F98E587 3B<-.~.~.d----8
690,250,828 *474ACF0A547D9D48B4AF3127F47E6C7A747CE495 3biette
690,250,829 *474AFB2C1B99B2258161A5351C84A9EBC5C39010 3 helptoiminta
690,250,830 *47467098C814DF609E6568A2D1E33C4430E29A19 3IPTNEMIP
690,250,831 *47461C0898A26BBE33D6189BB2AFFA0855E04E7C 3 KONZENTRATIONSUEBUNGEN
690,250,832 *4748E74F25AB4C079CD52E008F0FEF3CC3D7C373 wolffruitberry
690,250,833 *4744BCE3A355B4FDDF36BBEEAE8490F78EA0B3E7 WOMBATRICHARD
690,250,834 *474532E95395486AA158BC792EDDB0A4B45620B0 WRIGHTWOOD-MEETS-HARRY
690,250,835 *4749D7BA34187DDF66D1760885222822E028828A +3RRI8L3N3SS
690,250,836 *474311567200DCBF6C7E08AEC2F109B1A5CE295D [email protected]
690,250,837 *47433C40FA61E5275FC122FEA968961604163D3A wujek
690,250,838 *474BF2F8467F073FE945B7E494D688934CDBD2F4 WWW.FAIRBANKSCASTERS.COM
690,250,839 *474A5B6FD417E12239B3C452F913EBBAB2268033 WWW.ROTTENCITYPIZZA.COM
690,250,840 *4745F62A420C1782676AA54EDA796D95B76FB0E7 WWW.SLOG.NET.AU
690,250,841 *4744BB7959ADD101004D22A40BFF1A2F0DA82DF9 4CB72972-3DA6-36C1-826F-A00A855A41BC
690,250,842 *474B4EE471F5103732BC642D6B08DD10A34C878E 4DRIETAL
690,250,843 *474A1B4AAA624F879A757316EBBA7EE41CF9E5A1 }x{~`dp
690,250,844 *474E68F621D5EF78F90DFE3002AA371C84138E78 4LONIBRAC
690,250,845 *474709E284E132959EA372124255D5754AD91062 [email protected]
690,250,846 *474DDB8FEB25C2E4A4424727D848B211EB6475D2 XIEZUXIONG
690,250,847 *474C06EEFDF84AE43AB1AC8C97A11842054829C1 [email protected]
690,250,848 *474C0E1E8C980A9D6BA88F3F47D99C2ED0ABF9AE }X{o~.O~<=P
690,250,849 *474B2CC97833EFB601F871E7AEEB4A131E282443 4OOVEITKA
690,250,850 *47415E90F4E7AF3E0C5B04B3F9776F2FAEE5061A XUEBING4
690,250,851 *474BA8CFB8B1A95E5495422882E073C10D4991B4 xutsnoow
690,250,852 *4748B068C9BBF7400E22548A995F8674565DF017 4SPNDETAMPENS
690,250,853 *4741A8A7A4C35E4800A57E9E804AFA659DD418A0 4synusia
690,250,854 *474B8BE855F7691857C5D961D9C646F40E6648C0 4VYRKZYHYF
690,250,855 *474FF69D373D30125CEE2C8A72BF91DDCA9CCB1D [email protected]
690,250,856 *474541092407A4DE2B77F28F55475DE944484B2A yanpangilinancamaso
690,250,857 *47482AF65C36F9DB5028E5D6EED3EB474FB9F535 514205 nur die naehe zum impresario bringt gewissheit
690,250,858 *47494828D76D725097E6E02F3E89C51CC3303018 54L1N4R4P1D
690,250,859 *474E0653EF1872E853F6262A1ABFF4C519FFA336 [email protected]
690,250,860 *474CBB2414C0296AEDC3B6F1CBD6F2030988BAD6 YINGCHIANM
690,250,861 *474C7EC46A97C50B0028CE95254163CD9B6AD1E7 5BSWSMURGLEBSW
690,250,862 *4748208CF9A7CB1522F06055288E9740B0CB69ED [email protected]
690,250,863 *474D83F852A24ED9C7EDA2A04FB1D75C20A69500 YLLABITIED
690,250,864 *474AE5AEBAEE3E7FA25B4011713C102FBCEB635E YLLEBERIF
690,250,865 *47450A46C719828E0024EEF76D9C45848BCE2BE9 ym8o
690,250,866 *4749B20B4A3C73F016DF87311AD822200B71064F youngleps
690,250,867 *474C4BCEC4CE929E5817DBC4F32CECCD46E07921 youngwaldenberg
690,250,868 *474B639E894A358C9A025DF6CBDD95EF50637A4C 5IBALUDOM
690,250,869 *474D8F91D641094FB593EFE214B68F98AF3C676B [email protected]
690,250,870 *4741A12BE0ACD65C1659A1C02618AF5B5AF59EAA 5-mille's
690,250,871 *4746AD6D7F779E8D73E0B1375A60643B65B0E56D Y!VP
690,250,872 *474B2A058EEFDDBC312E2B6449B1FF7F130B924B yzh477484
690,250,873 *474E10A0F3FA27E909A868A79FB84E2B1AE79DB9 5SNOWBALPIANO
690,250,874 *474751F672EAA56FBA86427D8A448E97E64FE0F7 ZACKARYALGER
690,250,875 *474F198829C1B2B0136AE1866BE8E8FE73E12A79 zackarysaden
690,250,876 *4745B42776275AD6D69965A6FCCFD06738484B2C 5TILIZZ4TE
690,250,877 *47478E2577F827BE590CD5F69CFA6C1FD294B25D zanemilkey
690,250,878 *4748244FF7A8CFEC93C9C52B7D23855D5E0D6CC8 ZATANGT
690,250,879 *4749FA8A12E153D0651F7B7DCEAE311E95290B88 zdxbcjcy5
690,250,880 *474A7EBD6116208BF56D3119135C825D543C5020 ZEROVER9
690,250,881 *474C5E34306812C723F2C490197BA0716BBE2831 [email protected]
690,250,882 *47466A832419BDBB8B6AE4076036C6136462630A 6CLAUDIAKNICKS
690,250,883 *474647AA71360FCD84A942CBAA07D2E27E8BDAB3 zivanjovanovich
690,250,884 *47492B2B1716C26EFAC49323ADDED92BAE6421AC αποβίβαση
690,250,885 *474BB4C4DCBDA9B66877825B7764F4D0BF74299F АБИТО
690,250,886 *4749CCD87C8F3A8AECD97690A4D333E29D30C4AB БАРП
690,250,887 *474766CF21B11B2198FC6D2384CB32B9629CA775 БРОКИЛОНА
690,250,888 *474D4FDDE42CB8D86F5DC1150A0B2EF3CDB99F79 ДЫЁ
690,250,889 *474DDAA181ECAA9D1A4198FCFEC419922D083321 кудашевич
690,250,890 *4746243F88D03646D4381E9F51B1FD073D328E44 НАГОВОРВАЩО
690,250,891 *4745F74AC9626663C7CD7D829BBD68097ED3E7B9 7FLOWERPORTLAND
690,250,892 *474BB550B3CEB7B25B7D23D06F8024D8E183048C пеперуда
690,250,893 *47434693B25452FD852DE009A3A2D72BF053BFC6 СИГНАЛИЗИРУЕТ
690,250,894 *47438F971FB373F190AD308213D0DDF199FBCF4C ТРЕВОЛ
690,250,895 *474946EE73A25D965E9E03DB5EC0A3E7D862AB52 УГДЫЖЕКОВ
690,250,896 *4743C7A33F3ED289020582DC06DB53425284201A феліксавіч
690,250,897 *47469AAD750BF26AB82A2E39764C922C0F125B8B ЭЛЕКТРОРАДИО
690,250,898 *47481C2A0D4DB24139D015130674E43F34B86739 7SELFLLUF
690,250,899 *474EA0DB080AB732948BBFD7DFB62A0AF23BC6D2 取扱説明書(INSTRUCTION
690,250,900 *474EB0472C8FA671C1424851E8CE144047CE29AF 7VAELITYKSELLAE
690,250,901 *4741472377756C5487D6D971DCF2D3B8FB337CA0 843ariel
690,250,902 *474EE2AF836CEAEC68B1FBA798F2EDE5F2B2FFBD +#(
690,250,903 *4743AE1198AF56782E5AA30A57884917604CEFA1 8klassenlehrerinnen
690,250,904 *47490E7E295D8F31080EB7133EAD5C37834C4332 0georgia
690,250,905 *4748884EAD8F45B03DD4B64FF3B032912B0338F6 0MYMADONNA7
690,250,906 *4748E00688478ECD11477B7E3B4488B64D2A05EF [email protected]
690,250,907 *47446EE9163FFA395AAA91BD59CB96533151F0F6 10:10-#-&ARCHITECTURALLY
690,250,908 *474D9EFC4FE894B2413CFB54EFFC37D1DF4A422C 1041060 logistiikkaselvitys-2001--raportin-mukaan-painopisteit
690,250,909 *474C56C8369932C1A1CD8414AA27067034C2238C 10CDE338647ADA58EF404484420EC402.PRECIS
690,250,910 *4741F319E2C904E7FED6AF0E4C8F9AD47FEBDAE6 10DECEMBER1595
690,250,911 *47471C445D803D9CD9D2779373BA3E7E223D3F4E 8VORGESTECKTE
690,250,912 *474C0D477B942A0D25449F2897449E06D20FCA04 11171981
690,250,913 *4741B0B0E1CFBDEA80AA8060523E917CEC6562F1 124JADE
690,250,914 *4749CB90013F1162F4F345AF39FE5CB249E39E47 131737 HAZIRLAYAN.:.SALIH.COMERT.
690,250,915 *4740E10B77A6486EAC4A311F17F1C639363300DC 1332974 weitere informationen folgen
690,250,916 *4742C6E297E6ADB6110492B854790C0506C47C72 9BEAUTIFUSTEPH
690,250,917 *4741CAFB716E63CDCC56149FDF83978B97BCE5D1 9BSWREEDSWITCHBSW
690,250,918 *474549D98BF5307D8B3875F8197C95FC7B7234CA 15JANUARY1905
690,250,919 *4745961815DA1C4D79ED52864859061ABDC65366 9GNCXRNYFFOPAX
690,250,920 *474DB9F3E8F0C610F0707A86EFD4010C3AD2D25D 9KENENKAEAEN
690,250,921 *474779EFADE8E666847FFC71AB1F254F71A252D4 9MPONERAI
690,250,922 *47449AC25753C7FAE0C4C78B6341B2E1397A4288 1.auttamisty
690,250,923 *474888727D80F592D6887247DFC6B0E0F8F16CAF 1biriktigi
690,250,924 *47470DBFA858FAC60F7DC74B4A5DDDE6C9C96C07 9ORTMYERS
690,250,925 *474978D67A8DA2B7F998D6AB71590134988022E8 1CAWAKUB
690,250,926 *474600D1877141E53CF0EEC35008BE4E93E688C5 9SIANILCNI
690,250,927 *4741910B221C041CD575AFB049223B56F293D2D3 9STILIFORME
690,250,928 *474CC9884092AC5CB64DA8F012CD68DB8D68218D 9VICHITRAAN
690,250,929 *4749F2F0E5D69955499372FC0144DF0E03DC43CE 1GOFORIT8
690,250,930 *474C2AA3A95227699FDE2991AD9326F96102B8F4 1iamgiselle6
690,250,931 *47414151454E40A9E27E929199E1EEA3A0F96F3B a110y$te
690,250,932 *474228F25CF890AA3A0ABAC5314FC2C1066EA199 1janiist
690,250,933 *474801B412CC57FEFC43A8E3435613AAB00ECCC4 a1)s7
690,250,934 *474C3CAD59A2534A48F439858B6D895D72DEC019 1-KATRIMAIJA
690,250,935 *474AB19950AD035DF5AD6F001A9CDDD5C1D8C49A 1.konzertgedankens
690,250,936 *474D2556C99B1936FEE83DD9165D5C77DDC5B506 A3ILL4U
690,250,937 *474972B4D30A21D7FEA2286DB4BC4D53005B4BF4 1 LISENSSITIEDOSTOA
690,250,938 *4740C3039011C400B52968B6238FF83851CC629C 1.LITURGIEKONSTITUTION
690,250,939 *474AE7985F108A3BCC17BD8EDA04DC3FB4858518 1.marines-is
690,250,940 *4745FC05BF22D8FA37B4D3C68E1B957237A7130D A5M&I
690,250,941 *474BBCF778C46F0A2992ECF703273269D1830079 a826408414bab7acd717149238d52552-mn6441
690,250,942 *4748E9AACB6808AF7BCC05244C624494DDC3E7BB 1rakennuspalvelusta
690,250,943 *474A74CD64A500A006808D2829E6876CED0A2B22 AAAAAAAAAW8
690,250,944 *4749FCA3E42776EE755D2DBE2507A90463564150 1-sturmjaeger
690,250,945 *47480755743689D308BCBE19674A2CD11826CE7C 1SVITATO
690,250,946 *474233BA04E80F6633965466B54AAAD9EF78E84C [email protected]
690,250,947 *474132EA38D55F0AAA56A4400AF460B0B811FB21 1WETTERFROESCHEN
690,250,948 *47496F39A4FA8C36A3676FBEC44A7AC893902FD7 AADZM9
690,250,949 *4742F36784DC422F210B8C254FB4F7D2D60CA94D から1年後、スターゲイトを通ってエイリアンがsg基地に現れる。
690,250,950 *47472FACB6D79A3B855EAB1F59247E8EE871CC00 2029332 womoeglicheinmord?
690,250,951 *474EE5AABCC2253F0039CB20D89C077773DD1EEB AAE)XF
690,250,952 *47472A6C39ACDF08F037DB9B817FAF278559CA55 2069901 LUONNONSUOJELULIITON EKOENERGIAMERKIN TARKOITUKSENA ON S
690,250,953 *474758F8B45C093E23679ADE52231819F0435E72 20-alhaisiin
690,250,954 *474CF9B1648F587CAC275F4B1A8C2F69C93D483D [email protected]
690,250,955 *474C511A94C08F2BDFD0A38D509E4FF4FCBBD5D9 AANGELOOND
690,250,956 *474757C0995C7E697EFA9DB960653479E8DBD1CB AANRAKINGSPUNT4
690,250,957 *4741D1DDB0D97685841F5CF583DB83E3A2F900FA aau=o
690,250,958 *474D28E2BC20F90645CD0F121C07125645870CE7 23APR1754
690,250,959 *4741E704A5A31B4A5D7C7CF7C488732CB6832A58 2578REGIONALEN
690,250,960 *4748CE7EB7814488E64824D37623787D37421F51 2716380 TULOSTIMEN.ALKUPER
690,250,961 *47473BB568F3C40B06CDDAD1B8DDD8B3452BB2A1 abpmo
690,250,962 *4747C3DB22AE2F9AD64E8385A9ABBD4B38EB0367 29SEPTEMBER1120
690,250,963 *474673369C9E62071150614F4307FBB14769C23E ac5=i
690,250,964 *4742579CFE42F74E86C8B30B402FA7BB3044F248 2fasagiri
690,250,965 *47463F9D041ADE66FD5F0C62A749A0C38CA62A6C [email protected]
690,250,966 *474D97BDC025718C303A74B4EF8B732D0CBB02AA 2 KESTAISI
690,250,967 *47466392A5254031A79C6F1941FAE6AF137010A2 adam-johnson-remix
690,250,968 *47406F7D6E5AB00B3DD3511D000512C2EEC8E778 2ohrakas
690,250,969 *4749F39D93E3A4C7E673952DE4D8AC3B2A819A20 2SEWAGE-CONTAMINATED
690,250,970 *47456015C34025CA89FBB2E9D3716D6BC375EC66 ad"oq
690,250,971 *474E6311D208E576050FBBBF3BF56CD2A753FA46 adrf3
690,250,972 *474AA8922C39D7A0A8CDB52476EF96224C5A3707 2WHILLIKINS
690,250,973 *474A6D9656543232BF88C9074394F659A9031631 ADVOUTRI
690,250,974 *4748A43025F013BB526C9B2F7F9A7BC6D0915E09 362203 TEKNISETTIEDOTK
690,250,975 *474AAF3F8C66AAE7B2F3464FE2D5C220E020CE7C 383LITZY
690,250,976 *4743E8378BA590254DA34375412A42BD64CEF64C AFLEIDKUNDIG5
690,250,977 *47495223A78B3794CF36359333B24DDECD0A7B7A 3d18317543
690,250,978 *474C1B0BAB2EEE70863E49DD27C652B15AF258E9 3DEFIABLES
690,250,979 *474D0D11B8B378077EFED4266C0D5D59EC3F718A 3DEFRONTE
690,250,980 *47452F37D515C9A04091931E1EC164A6C0C3A478 3.dreispartenbetrieb
690,250,981 *47451D3709EFFA825E7E2755B241E580480D0839 ag&:
690,250,982 *4745073FE052C00A65A693F56D70A3D87980E771 3FRONTEC
690,250,983 *474F60B4B28C1331F0A07377517A0DEC330D7515 3HALLOTAJ
690,250,984 *4744A65EA26699B97F8C3C6FAE27F94B2693AD9F AGENERALAUNGSAN
690,250,985 *47483E638B5E31227BAAF986DAE671A21D3CB994 3IRCDLROW
690,250,986 *4741CD1D186C997590DC3E6075840D100F8F95F8 AGO-V
690,250,987 *474BAA5A627F28886EC6FF5470341CB0F37B19D2 3.OHJES
690,250,988 *474F64BBEF67F7AB7D0C87A9C707E20F60B02444 3==P.*>-B0
690,250,989 *4745FD454DF2EAE31AE2EEE3E2DCAADF1F6ACD01 3RIYOUSI
690,250,990 *474B03E23550705D14165E904B802FFCA4A3B45F a/=ht
690,250,991 *47438F40429159367B5B04E957500E4391E79C7A AHYQ:
690,250,992 *4740CD246D3D8246861BB0184D2775C8554B6379 A?If
690,250,993 *47495114592D8D452A6683F942619EE75CEB8F4F 4AGERKLEN
690,250,994 *474D1286E58F137AC057EBF55AB2890FEB511BC9 AKERBO
690,250,995 *4742410F544672596B127CE66F5ABF0511014ACE AL1SC
690,250,996 *474EABE36812AE66D579C39C0B37D74CCD75CB9A ALARUMIN5
690,250,997 *4746E1D145406F89B07BBFF346CC1476E5D0B3CC ALASHAKR
690,250,998 *474A0D61C06BF3EEC0443A194987501489F76638 4MYRIPPER9
690,250,999 *4741302D29B4F5D7122C52035ABB172382797923 ALFONSO.BLAKE
690,251,000 *474223C74C39198B100DC8A87424F5A2C6F1DB29 4REABGEFALLEN
690,251,001 *474DD45EC9A22C351CCD726FD94AD3C2BEF71BD2 ÁLFRIGG
690,251,002 *474C26E5A6A3A58BF578EA9B6674748AC83AD76C ALKIŞLANIYORUM
690,251,003 *474A53A2996A5C9A40E09B9ADBDEF6BBFE5E1C28 ALLAN.WANNER
690,251,004 *474D2752BF0C26C87D813BDE3B10172F70F07435 4WEBPROXYSFHSCOMMOZILLAGOLD
690,251,005 *4746E1E2BE3387A1AE0A32E457423A2CE097DD8E .50C
690,251,006 *474D0945A6B41C568639A8A4A8C260872BA27A07 51M1NUTZ4TM
690,251,007 *4741F746C322A216D4509970D739A35535FDF399 572233 AGRANDSON,BILLSHEARMAN,ISPUBLISHERATHOBBS
690,251,008 *4744F2CF37A6E7D301750C0AD2A4D9F9B2C255D1 5763DC96BD8E9BA84AFF47F6C0962E8B.COPEBLACK
690,251,009 *4746D573300243BF933A63B99BC0661AF148F720 ALVINWILLINSKY
690,251,010 *4742E379538AC0A0D48F2321DFCDCAD43ABED84D 5ANLYKNETH
690,251,011 *474185047E55674FDF08598E6F7253858469B2DA amauroti
690,251,012 *4749BDD586523AD0E398952B8175B320380CDCB1 5BSWADLIBEXISTS
690,251,013 *474E24AF792FC233A17FAFD5557002F519303F16 5CAITLINNATASHA
690,251,014 *4742CFA3E966085017479E8D13985D8568B1F75C 5CATALDO
690,251,015 *47408A6C521F35A7FC672E3F65CC37532F20CFAF ammaraba5
690,251,016 *47497372CAC4C6F3D846DA68C09CCA4C5A2E497B an0r9
690,251,017 *474DE9BFB6DCA24F8BAD16514E7B07D5741DA063 ANADEM5
690,251,018 *474DD8E3F382BF1626BDAE6546D4DAA494E0F090 5kimberly
690,251,019 *474029C970EC80B9AEA8A7BE3816F5A11A23C88C 5MINVILUZ
690,251,020 *474DDFD15062F94F3C2D270C33300F93C1BF797D ANF6C
690,251,021 *47476D5CA0E18327B8208D9C503C5864B83980D1 5P4RKER
690,251,022 *47437F4A31111E9E92D9F76E651B5A39A3D62DB4 5PATRICKSAILOR
690,251,023 *474FDC7C70A85FF3A883FD9F9F49D59A42F91ED3 ANINAJOUBERT
690,251,024 *47433D115DFDAA058BF0BCB252B173E564FCA342 annazimmermann
690,251,025 *474ADEB773C6F62D81E051A6C01FF35450402CD7 5thatcobain2
690,251,026 *474FA08ACC2CFB7492EACDDE2E96F91E3070E511 ANTOINEBRICHETTO
690,251,027 *4741BF6BEA7B6ADBF42C90CD071053401572D62A 5VERVERIJS
690,251,028 *474913547FB67C8614BADF88E2F4498C7DB9C1A9 antoniavuoso
690,251,029 *4745790A6E23C1D477C98BCAAD5C097BF069E9E1 5VOYAGERPHILLIP
690,251,030 *47424831A86AA47CCE1FA163856BF62D0C7D6AA7 600394 besonderes-augenmerk-richtet-die-stasi-auf-die-kirchen-.
690,251,031 *47422DB7EAF5B7AA8544A6F2E65052FF3B20306E 610248 butthat'sonlyonepartoftheexplanation.
690,251,032 *474A5770C4D50F12BD777EF6EDDD3EE7C272D3BF 617533 in-der-pyramide-wird-fuer-den-ernstfall-geprobt-.
690,251,033 *4744EB74B2659E53398EA216A35DAD073B4C7097 61963 KIRMIZI.RECETEYE.TABI.ILACLAR.CELIK.KASADA.SAKLANACAKTIR..
690,251,034 *4743E829D807A7AC8247AD21593607D5FC02F295 619733 ETKIN TANER DP MILLETVEKILI .
690,251,035 *4747086FC904781BBFCBBCC0C35C0D5A23EAF77C APCM
690,251,036 *4744D7F248A26BAADA7DF6CB2E1E378B8CD4CDD0 6BSWRBOOKBSW
690,251,037 *4744F1F3EEFE3DDC8DCA093B78EBB455F256C8DF 6BSWRODOSEVICHBSW
690,251,038 *474DB4D9092A4B23A3226285C4124522BE86BA98 6CAGADOS
690,251,039 *474BFB88120AC951D28E1829CD0A15EB5B46A634 apurk
690,251,040 *47433165635CA7EE0F1E31B8AB3E885B51FFB2D7 a?pyf
690,251,041 *4748B677BC04F70046FE0BEA08D257BDA31BEF66 aqghc
690,251,042 *474CA2341A6DE58D276E7731044A8196E7AA9ECB 6ILUVFOOBAR
690,251,043 *474C45A6A311BA25056AD9C01A7537F60C9B9AF6 arden-francis
690,251,044 *47451F798C7C684FD8293D1ED5EEB7022DEC9FEC ardou
690,251,045 *474C124950792EFA0880F56A461F54D99FEFD5B0 6LOGOERS
690,251,046 *474E5D857C13B3C5CB4FFC3FCD14F0A0A2C24DBB ARI KRISTIAN
690,251,047 *474D7035095CF31A0B2C1C90F995D8C49E747B2B 6METHYLTHIOETHYL
690,251,048 *474659A971D713BE34E4EB7E91E983D830E13AA2 6NEREVEB
690,251,049 *4749A65501AE354EC07FB23DB2CF10167D83DAFC ARON.BERESIK
690,251,050 *474AA7603C831D32FA297D4A6E180FA084C3ACDC 6RESKATTEMYNDIGHETS
690,251,051 *4740A696F70AD8DF6CB0B12222305E5D76AD2465 arteriogram1
690,251,052 *4747D4880DE6DA9EFD15F86BB2E3CC86FA7F9E9A ashleygolaszewski
690,251,053 *4746A58C0F7CEE646612DE89EDA25B7708EE525D ASHLEYRUDNEY
690,251,054 *474C634FB7D35A9501760024A96BC69114CBFC9C asq-,
690,251,055 *4742187C8343A0D15CABB9FE0829FF139C12E22D 7BSWDECONFIGURESB
690,251,056 *474420C67E00A70333018E313EB421B6407398E8 [email protected]
690,251,057 *4749AD76012F0DA2D659A93F5355F078BC1B3C28 7GALILEOMEXICO
690,251,058 *474560773C9B23B05AA58C5063DC536052B05DF1 aufzubietende
690,251,059 *474404AD15B1035EE9DB25BBB701389C4380C8CB a,#v?
690,251,060 *4745BE8C0B92514917F543A390307B872808CD76 7MONIQUEVADER
690,251,061 *4743BF8A750C5847640AF6A3609A196F28FEB9E7 7mypoop9
690,251,062 *474D1F8140EAA28F41BB9CAA7EA4F71C3878F5DD avouches
690,251,063 *474A88527D2514144AEBEAB85BB832667A5E770B awakening-mini
690,251,064 *474A36DC6FC1BD8E135D9BA55115EA57D44C6720 87822 revenue.advanced.to.$3.36.billion.from.$2.78.billion..
690,251,065 *474175A1E12E4DF07126EEF359E9E65BB58EA4B0 >-b0.*.*.*.(####q
690,251,066 *4742045628C1F059990FFD479CC93809B92EB3FB [email protected]
690,251,067 *4742B2DD87D569BE86E6ADABC18000D00901B5D0 b&1ta
690,251,068 *474EE0348E44500B73C4BD1CD0BD7920D988E2EE B2&IN
690,251,069 *474020DB916E0196072C9936F9B8DF96C93F0061 B3B03ND3$
690,251,070 *474755E940124A4ACBA3BF4B9D2DBB86997A54AA B4SGL
690,251,071 *47471FAB9449294A2950C5BF4B9A7CCE683E6F93 8FAVOR
690,251,072 *474644F2587A41EC3B884FB869335FA10439B4EC 8FIXEDTYPEBSW
690,251,073 *47437E06617C01073F1DADF89968683E43C393ED 8GATEWAYFLORIDA
690,251,074 *4741411843A9E960FBEF1D003B7400E78AD82B11 8GRUNNHET
690,251,075 *474066FE15258C22A4C77FC2BEA479D6D3F51EB1 b7inu
690,251,076 *474297A85F81136927F06834746E309C2851A4DB 8MISURABILI
690,251,077 *4740F7D365628BAD0D3E6E86ADD10A09413B48A8 ba0s
690,251,078 *47419A664469E93891EFD15B34C7E690C5F4F554 8REPELLION
690,251,079 *47480A32B75093FB3493C05523C06A690979D6CA 8ROOSTERALEXIS
690,251,080 *474809AB2CCA5B888B3C3C9BAC10CC9CE33C7155 BALTIK91
690,251,081 *474F6FA979DFAF43A364A1EF7D806CEF5943CD46 8SCHOOLENTER
690,251,082 *474F3D4EB57C819B8AC456CD6D822CB9F5EBCE74 8SHADOWALICIA
690,251,083 *474E15181C7F401BBC5935E037B5358BD722C61A bassdrop7
690,251,084 *474CDB8D07F0D6F4AB97169DE1762D3CFF41EC2C 910RONALD
690,251,085 *474D3221B41C62F6EAA2AB91FF950B2BE847309C B##B*(~_^)
690,251,086 *4748A454824845223D2F82D186055B5D705D1F47 bbha8
690,251,087 *474E187C164FBC0CEFF9B20A64C6A68410718399 9B0DE0D9103DF937A35750C0A961948260
690,251,088 *4740D99C95E0E63B9DA87A609C48FE0F2ADC24F5 bdfs"
690,251,089 *4746B5D03DA4C1C3872399B937AE314F05A7971B bdtpy
690,251,090 *474944CC7F320C2ECAE80961A7F5C90642A7CFB5 9FREEDOMEUROPE
690,251,091 *47494EF938429A85B59E34921014B5439D327DA1 9HIMITSU
690,251,092 *47408BDA76A2B803F961C63CB6D59D3ACC651BCD 9IDIOTGUEST
690,251,093 *474ECB78149CC6401FB2D4D387EDDDFB6192EC4D BEDOUG
690,251,094 *474902659A9A7A0F0884C19E489DD5A39E199434 9IROTIDERC
690,251,095 *47463618D294EA99E59F29539D8C8A9FB03ACF65 9LUSSAKTE
690,251,096 *4741BF52026A21A4C05826398909A7282BB62DF9 9myelosarcoma
690,251,097 *474C9B6A4062931E787E2005A7C3FBFE532BADBC 9PROTUBERARE
690,251,098 *4747DC4FC2514EF8A6E9A35A07629AF89D7FED05 BERESVET
690,251,099 *4744DD376D2F54DDCE76ABF56A0F0C685F047849 9SAINTLIKE
690,251,100 *474BB0EA2736DED0BAAC29D20659E26F57DE4926 beypw
690,251,101 *47479BE020116199FCCB849762980391FF7B0BC5 BFITIGERSES
690,251,102 *4747E49D3378B2C9355ADD7EDEB13A1C9B39331F A0556232125
690,251,103 *474D0E508553E0B924D998539C7D2991E89C4188 bf-.l
690,251,104 *47413A0519167DF3AC48AB5F6D90B3E4592D7180 BFVDI
690,251,105 *474B88F3A3F63168D2AFE7C6ABD6D6E14C3EF3B9 bhagavat
690,251,106 *474213D57F49428A3C27FEB92635071B0178D239 bill.bailey.c
690,251,107 *474BC5C1A3FACBABEF13D8E77FACBC864F9B255D A8GGI
690,251,108 *4741FE8C24033172C6AA1863EA1FA3F63694DB74 BIOSTATICIANS
690,251,109 *474D84C4A300FE51DF6BA9832B3E9B49863BD5FA aab+1#
690,251,110 *474F655389C508266C5787EBC301FE3EA5D20933 AACFV"
690,251,111 *4741C0ABB789AA0536DC3371F183464FC5AB9A18 BLS=?
690,251,112 *4742A15FD895B0620D027F9F1ADC4FA21750936C bn#%k
690,251,113 *474CF63CD8727245C48CF72E2D6FE30B7C660A4E a;(b
690,251,114 *4747FF90E4187812A4C0E80A8BAD5E9DEB1D6C49 abemi
690,251,115 *474F7D4CF18CB51F9E3AD9DFD335C77BAF540CD0 BOPALLADINO
690,251,116 *47467E1078180BAC8B34124AF169F28D6AC9E3A0 bord3ll3t
690,251,117 *474A61DBA619950501DCCEA5D431367D35D19130 AC,P!
690,251,118 *47432F82478C8A0C8312A73830B047E8A84DDD86 acwn6
690,251,119 *474BFFD686DF78E6A7F9EF14E5F3BDDEB8854923 ADAM.EDELEN
690,251,120 *4744CA4DA291CF21252049BD506175BE3F2F2946 braendlien-1-0
690,251,121 *4746FDEA05BE923B4EE5C0B71BEFB2A4F09968FB ADGMK
690,251,122 *4745F175C235F0B8C52968637C822C1DC846485F bretonvilloises
690,251,123 *474FA95213812CB9AE9CB67B7EA4556C7E4FF993 brittlequire
690,251,124 *4749149AA6E17320004926DF2C119EDD5918B940 BRJ.F
690,251,125 *474E8C050F182979109087FF6AE1033553265BD0 brla
690,251,126 *4744609DE8DE09E604DB717E1022FFC1859B2803 Aerter
690,251,127 *4748E5C57AC986F47D47071D02C68AE99D0A340C brunohiraoka
690,251,128 *474DCDA8B185084C5DA8FBA06443B987339869B1 BRZÓZCE
690,251,129 *47481BF7FC38DCA27C5ED1121D96C397AC04E6E9 BS8J
690,251,130 *4747B023CFB25E3B2AA0538786E32221AF038C54 BSWPLADWRALC
690,251,131 *47462ECBD32132BFC2FFFD57A55A5DF89380F58B AGUSTINVEGHER
690,251,132 *4747ACD9C970C9AF3B379C6EDBC523A2B3EDDA67 AH$1M
690,251,133 *474DC9FDC6D261228D34FC4221A87CAADE397E07 ah-o.
690,251,134 *4742CDDC8F19583028B167823473E002947D5286 A_HR
690,251,135 *4749F15999D23805A9C81653667B1E08126F784E BURKLEY5
690,251,136 *474E74CF7BC2CC47A9EE031361E6A0650DDD272C A"$K
690,251,137 *47440A15B9CB5D0A12E1D539B0B23AC5E425FFD1 akf%h
690,251,138 *474F204CD656F16DF6BF5AAEAB9865A2C67FE730 BWECZ
690,251,139 *474D9603121C7BDF7BAD0DAA406E441F5D0DC289 ALBERT.GARRA
690,251,140 *474B8050371D44E0DFDF905242E9A17F8EF6D73F ALBERTO.MONTEIRO
690,251,141 *474B840EE68DCFC2581BD6ECB527B30052BED212 ALBINTIMULIUM
690,251,142 *47447F30A93554EBA0B372AC43BDC88F1788E329 bydoh
690,251,143 *4740EB5BF3AD92BA57BAD8BADE629F1DB3DB1454 BYQTR
690,251,144 *474967EAEDF63AD5CBA887AEF8D2787ABD111D1A alejandroyantis
690,251,145 *474ABA099EBC7EBBCE126D79DB473AD440E2B802 BZA7U
690,251,146 *474E065C4F0909AEC8D0728618387483C4FDD227 BZ!m
690,251,147 *4741BAA7096A74226FC740406655CC053F74CE3E C0ne-whe4
690,251,148 *474D353C0EEC405390401323EE6A4AE0847A15F6 al.iman.staff
690,251,149 *4744997A8AA7E6980568515A8578218CD3A4EA33 C3n+rfu9n9
690,251,150 *474BF779DFD0179C531EFA1BDB2CBF8655BD900F C4T490R!ES
690,251,151 *474E1BFA65B8642E0FF9F624B91D82A3A1957686 c.5g,
690,251,152 *474269B34F67B3B49A5E3E24B146B07F00DA083D C5THT
690,251,153 *4742B72A50BFC67A3F01D291A1BF0DF31E74C542 c6whw
690,251,154 *4742C2BF53C5A5C6FB7A4115C7D8AF38942E9721 c7!c
690,251,155 *474B8071A8539756F50C36D363046F35B264AA39 AMBROSE.SPRINGSTON
690,251,156 *474913893939D004528A126C98C484BAE8F090F7 C9?1V
690,251,157 *474180A468D5E8C5683B587F43AAB5068189D913 anaesthetic-season
690,251,158 *474EF99790797DD2D334FE40B18C6F2945D60D21 calibrses
690,251,159 *474724676B6FFACC5CF1EE4D51DC94E16134380A CANDIS.WHITLOCK
690,251,160 *4747281E075AF388CA34F5A925A356C7F264FBC9 cannonry
690,251,161 *474BAD5795244CEA20B6AC440A6ABEF571791005 ANF6C
690,251,162 *474283B79DF35233393FE34168F43730FA2CD957 ANGUIGEN1
690,251,163 *474596A61401DC358EB39970306796FA6B8C7EBC anh.nguyen.phuong
690,251,164 *474836620A3508C211838453FEB90D8EE4FED573 carimattox
690,251,165 *474DCF3C22DAE3B4D38E7D92A2F825D850DDE2E0 annauzus
690,251,166 *474EE0023B236EC1F2125E19FEB77E3D0AE290B9 CARVETA5
690,251,167 *474DA5F537149779C79E737277086C64650C4A93 CASEYGRINDSTAFF
690,251,168 *474829029A29C875E130CA213DBCCEBE805D3DE7 cashivile
690,251,169 *474E2072AEAA853D43941E31D7CD8DEDF0AF6CC5 ANYHOWY
690,251,170 *474251B26DA385C4B27A8E3109CF6E0D1FC6C20C [email protected]
690,251,171 *474C0394821EF81A59A925D94AD7B42CE711682F c-b.d
690,251,172 *474914854C4B577ED1DED94121C546F073158CD0 aox4f
690,251,173 *474E84B124515A2C2D8BB66A8A3C67DC04FD8A32 [email protected]
690,251,174 *474BBCC3F5078681E81AA683F4E1CAF49543F2FE [email protected]
690,251,175 *4745861F08BF080177D8F88B0FB2534AA1FDCF31 APL&B
690,251,176 *4747586E29C902CF042BA652F49570EA05E21828 a)@q
690,251,177 *4740414DADE88FF392B09D4EA6C40C2A4B6597F8 arbolare0
690,251,178 *4749B6CB9A135B58B97CD36B51963784A69098C2 ARCADIANWOODSMEN
690,251,179 *47484EDF213926AA5E69F5E70AE8428E9B532F4E cementation0
690,251,180 *4741E2192912839F38FFA14928BFE381CF21B5EF CENUŞE
690,251,181 *4749F43789D354BF912CB33DBB488E580A3EA9A9 CEV8
690,251,182 *474147DD6ED596E84444F3270F2B99FF71FA2B26 [email protected]
690,251,183 *47470418CB870FF4DCFF64EC8D0C740A7AD4F91B artdenio
690,251,184 *474843BD4D7B85CAC26B9E098BAE82A848ABE156 CGDFF
690,251,185 *47412E5154FF0D0B0A446B2CE715DB9473F8A749 cghpp
690,251,186 *4746D0F6F0DD4ECD1A74E74ABAA695F2FDBE90CA as(/
690,251,187 *474717DD169E07B0ABF5FAB3B27738577B7AEE60 CHAPTER.09..THE.HALF.BLOOD.PRINCE_24
690,251,188 *474621328E745FC4FAC6BC3284F5B0432CC045F5 ASH.MITA
690,251,189 *474C7725DABFF7F8B783C2FA1A29B95910B17EC1 aspiy
690,251,190 *474C3D6320B112D9CC6518A9526CF4406BF8649B CHEDDARS
690,251,191 *4748710ED8CE706029B6B676697D7CF00FC1E115 at.d%
690,251,192 *47456DAFFC65D99C09A2B9E72F242B9C11488903 at_.k
690,251,193 *47489AF233417C1D1E26917B2DABD82C8155F003 atuqm
690,251,194 *47441D4F4687382A28C53177C4C531A71F574E13 christianmarz
690,251,195 *474C9D68095B44355AF4F7D7C706D1FCC6CDDBF1 AUNA
690,251,196 *474AB8818C976280B00F2E75E991CA37C6DD4FE5 CINDY.DIZON
690,251,197 *4742959A0048AE8EFD6CC558FA69CBF2BAB5399A [email protected]
690,251,198 *47453FEFFAF468E2B222DAE3742A71663BAFF382 avouches
690,251,199 *474FEA30F3E982743DB69A52E510AFE6060A0285 A"VW
690,251,200 *474EB35F36CDE3BD65AFA54A5064EE174F3F74EA CkeF
690,251,201 *474689D483164B4F411418F88E88DF30BF08848F awp9y
690,251,202 *474D7DFBE97996876982FF45FCEDFE3B7198DE60 azrielcat1
690,251,203 *474FEFC13EFB99FDB2DC935B77DF1E2C2AE4CD03 B19
690,251,204 *47492B3767F803520D50EA9C4E0469CB9E044907 CMO.
690,251,205 *474B44EF3CB2F680509F111E7FFA2BDD04E9986E cne2o
690,251,206 *474B3B41E4008D4428320AEFC103C1CABC375439 b6+oe
690,251,207 *474F19588594F138A42A55C91027689D78DA12AA B%6ON
690,251,208 *474039D49944FB141B6D01AC489E9B52496F9179 collinkonn
690,251,209 *474B18547AD26ABB41C89548E22D66CDC1A3A3DE COLTON.HIGUCHI
690,251,210 *4747E5063EDB099786C6242914E04DB834EE2A01 BAKPQBSW4
690,251,211 *474E4A2F293E019005E43B3AD73719C0E6D68586 concerto-for-tuba-and-band-2.-lento-e-mesto
690,251,212 *474BFD60B7D30DCB37D1C9E5AF2614FB7ED84AA1 CONCIDINE0
690,251,213 *47428DC9DDA9A049C9F404EA2342746FC055F655 BANOFFEE9
690,251,214 *474B1E648314BD9D5C8D72746CC58A5F4276A355 'CONTINUOUS0TIME...CONSCIOUSNESS.'THEHAT...ANDITSTRAIN.
690,251,215 *4740306FCF1E1C0CF6D4A243E8FDB68F94C3B438 barrypribish
690,251,216 *4743E0BF91210FEFA8DFE7AC0C09606B739C1A90 Barytine
690,251,217 *474D7D33C8F6B5D6899A071E06747580EBB27727 CORDELL.MONS
690,251,218 *474C71E4AF29C119FAC8A239472AC5A562DECE3B [email protected]
690,251,219 *47496EA875957F654B8BF692B83FF5B730455F5D C+OSB
690,251,220 *4749BA75E26D4946E7891DD1A3ECAE405234F2CC bc#
690,251,221 *47430CBEF94AA777AE874D7B04850D84C829263B bd6/#
690,251,222 *474EAE7C1C40CFD611472D4242C23219872701E2 CQL;+
690,251,223 *474AB25DFCB77770D675FA844D3313E3496CFC98 [email protected]
690,251,224 *47456BE10522A87243DB1CE3DB54CDEE85F0D118 criptogra7
690,251,225 *474259E7A6AEDFE6733D4767F43B63B38E151B80 BELUGA5
690,251,226 *47459558FEAD9C9631C7AF172AE28F0FB2695A67 crowed givesignsofpleasure
690,251,227 *474F7C3ED6A224F648356FD044106D64FDE7D8B3 crowning
690,251,228 *4745B76A1DC40259C89DC69FD1AD4B8531A78D76 csneuwegging
690,251,229 *474BBC96D071394E82BDF3554AAF54ECE5275D71 BETEKEND0
690,251,230 *47439C946F2FBB215B5BB72A739E60CF843C4534 cuew
690,251,231 *474B10B881BDEDCD940CDA1540FE33882C12736F BhGA
690,251,232 *4749A4C4C444FFA1A231795E6324068AFEAE4270 BIELDYING
690,251,233 *474BAB8D117C1A9ADE50A3275BB4BDF8EFDC7BF8 bif+
690,251,234 *474275A4DA9423C601E4F4DD4F73F3ED9B98C02F BIMANUAL
690,251,235 *474D367BC50659FDC59F74AF2A83DB0F95E369FF CY1978
690,251,236 *474172E4BD4C465D6162F3F497E72EE0680AF0F3 CYBERSPAAAAAAACE
690,251,237 *474E7DC293DD9FF5C3E10A4AD95E7D34857B77B3 BK5CH
690,251,238 *474D9DCB1589C350FF6DE769041DDFA50E3064DB d%0t4
690,251,239 *4742B21320ACB8DBE8D3A51A0F246AA471D6D7ED black-knight-legacy
690,251,240 *4741467B42992ABE2AA6D202A169A345F84DD11D d1-t-
690,251,241 *47418A6CBDC558083598514B8408403B24F03BBE d2a0f
690,251,242 *474A36514B4BF40EE2224FBAC186E4FD65804D6E BM2A
690,251,243 *4742A7A6141417A55D11EE2C0814E60672839F12 B?MZ/
690,251,244 *47475C436A055AEB5F600CED035AB37FA6458262 BODIES32
690,251,245 *47488D1D2D5A47550FD34EA8179542A78E8E1432 BO.L+
690,251,246 *4741BBC10C38E83A231E773330F4094D940DF546 BOOMING
690,251,247 *474790B7044281DE505EBCA59B44BF6508E84B11 daltonfliger
690,251,248 *4742454070BD900CD61613306FBC8026DCA82C1A BOYCE.BRUNKEN
690,251,249 *4746EAB07A4A1029C4EFD9FFCA93935328FD9C2A bp-1m
690,251,250 *4743AFD82FED289E2709327B42347464D1472E82 bpky!
690,251,251 *4746320134CAF847D653A3CFB0197AD2BE89DACC bqmzf
690,251,252 *4744BCE80658F5B8A2BA4723933E7A07789CF9C6 bq&wt
690,251,253 *4744CFDFC007F90E165B1DFED623E8505F8343E5 BRADLEYSIMMENS
690,251,254 *4743A3C211A7E933F476FE52B5D0F01CB6448D1C BRADLYLOA
690,251,255 *47485A417B4923A5570F40C5FFFD8FB0C4F3F5B3 D_As
690,251,256 *474A6C5EE860CCE1A0F9DCD9DB9619688C5E3756 BRAINSTORMS
690,251,257 *4740C0219E98EC1F00699B0570F8DD71CB9012C8 DAVISGRIMMER
690,251,258 *474807B164C059A3F8F6221280E7631CFA8238A4 DAVIS.THORNBOROUGH
690,251,259 *4741A11EC906C72F7FCCEE6A6EC1E93707E58882 BRENDAN.STEEPLES
690,251,260 *474FCBD87F6E3D5A627645DB3EFE66803E578A23 BRETTBODIE
690,251,261 *4747C9D0A5DFBC2BF13DCB8AAF6AC5DCA3C56630 BRETTLIPPEATT
690,251,262 *4741CB6D0C940A49E8C82272033CF1C95B931031 BRIANA394
690,251,263 *474A7FA5288D9C82A36E09D6726A505FCE5413A6 DBQRI
690,251,264 *474C91F6D253810094C36D30798907341D9BDAAD brickshooter
690,251,265 *47415178AEB1B6826D1AED380B3E0A253596C0D3 dcsl9
690,251,266 *474B1E2E21A4E414CCC885988B870957D161FA47 brt#w
690,251,267 *47458CFD9ECE8C718A83671F191B6B3AAA552684 ddhfe
690,251,268 *474DE41B93F4CB0CBE832D3529587B2A09B99A2E de+io
690,251,269 *4740C57C33982927E16ADC1E5B8EDD0A017A5269 DEMAQUILLIEZ
690,251,270 *474A38EEDA4E5DA03ED59D412D15FED1C86A0777 B%V
690,251,271 *474368C0B4A38E988EA29DD7AF34685FCD490447 B-W;H
690,251,272 *47497EB692A4E4A642E06F44301FA93C1951CC7C dgid
690,251,273 *4742CA4B5F1680AFE11D89FFFD6E245FC1297775 DHANIMOND
690,251,274 *474B95CC3F1DDB569D98DCC88D2C43A27F71D0B3 bylozravy
690,251,275 *474E26A5A96E9546E98770BBF2EC371DAE19CC13 C120306
690,251,276 *474560B6B975FA1442025841AED90C738BCA7D73 C168603364214
690,251,277 *474531355F86C0F7FE0B9A06A0823BD5071020B5 [email protected]
690,251,278 *474BCA51210D1CBD8148ABE7557B21B0912EFA2B [email protected]
690,251,279 *474BDD6B04B4E67150641E82FE45A351496A3F06 c3roo
690,251,280 *4748DF5A736021E4E1BA6DD12418AA511AB5A120 c%48a
690,251,281 *47489254CB0E35E44F6848C65368B8BE037A776D c4no315+5
690,251,282 *474EDC3357C9805D18936EE03F4C9D931E248332 c(.6w
690,251,283 *4746B87D1E845637FA3E2A51020396C06B38DCB5 c,8q
690,251,284 *474E70B32C36E252A55859D23A54714ABA35B3F3 CAC,O
690,251,285 *474CB43343C443A6361F3AA93A5DED1AF5076D61 dm7a/
690,251,286 *47405B5C7D6F0F7332E4E3259F6ECEF6CB7F4642 DMPBR
690,251,287 *474C6B2EFE7092D8A26288620371D94753A0BCD9 CARMEN.CAWLEY
690,251,288 *474E19633898A3B5BB9AB099105DD55684778370 CARS6Y
690,251,289 *474870372CB3A389F0A903DCCFC074F26CE64255 domenica sera
690,251,290 *4743AF0861EF5BB8C6BBE485CBD6EFAEB0A42A7F donnadelsperger
690,251,291 *474791EF450C164F0AC69767860E9CBCA11791CD cb6:r
690,251,292 *4749369B59A17635FE2AC26A453C996C6ADF5AD2 CBKEP
690,251,293 *474D030176D8AE023F2093C601D70E812512CEC2 cd_9q
690,251,294 *474773330BBEE54B535C2E39B5905662E5217D2C cdp!v
690,251,295 *474635F5A494B7E1A42A2FDCDB47609213E48C29 [email protected]
690,251,296 *47400278EA78C7C976FB98132219E8321EE414B9 [email protected]
690,251,297 *47453309C0EEDA258333F268A805B79617DD620E CFST
690,251,298 *474526BD38CB8A188CCBDA7CCEB3416C247C82D9 D,S#,
690,251,299 *474C7B92B68590D9FBF2DAE072A13530203F0223 dsn(v
690,251,300 *4743C43A5ED5BA71E0B00154A51AFA2E361B0BF7 [email protected]
690,251,301 *474EF19F03D71F7221B99C757B8F1D369D4FFECA DTM!$
690,251,302 *474D6B1B621D37A69557E8212010053EFDD9D6E1 CHEDDARS
690,251,303 *4741581E4A302AD4E68005F55D8979F581628BF5 [email protected]
690,251,304 *47494F82E72BC38FDA1C69AC47912F5C56A8D60D [email protected]
690,251,305 *4746EAB86D205A9F502F0BBAB8D7EE50E87AC3A7 [email protected]
690,251,306 *474F9B079894C4FBD8E8D97AAB4A4B9F65756521 CHERISHMA CHERRY
690,251,307 *474C95646AEB8CAF7361A57D08E9D651D33B3825 CHIANGGING
690,251,308 *474718722B0B622B237D97237975E027347ACFD5 dustyguiberteau
690,251,309 *4747E2891E20A1C5ED6D51DAC3B54460DE30BD6E DUUO.
690,251,310 *474F25B019A631953716C07F024D501D1D393432 dvm9f
690,251,311 *474CCB7A8E70999BBF8783001EFCEC83DF61D949 choshees
690,251,312 *4749E4A55AC7674965212CA23236DD4184DE70F3 D#-XQ
690,251,313 *474234BB806F39CB4DB77947C8B0CAEB05F9A86B [email protected]
690,251,314 *474690E287FABBADB463E712319321769F8C1223 C$I!X
690,251,315 *474554C5F6E3D7F62805995F6990B92F5EEDD6B4 c$jy=
690,251,316 *4740060B991F976B09A5D6D613A231C46259F52B cka?d
690,251,317 *474C70283B304FD376DA87F4D91B0799AC00ECC8 EARLEHAUTALA
690,251,318 *47418F340330EB5283076054562BB1FCAC77DB9C ebendiesen
690,251,319 *474A8C1F30AA0875DAC221F1003CAEF8B18C8283 EDUARDOLECHMAN
690,251,320 *47450C723645FD3E7AFC7E14E8D84CB7CEFA3428 CLXJB
690,251,321 *47453825BD89EDD6C8BCF9E3C258C170CEAB8E41 E-EFD
690,251,322 *47400A11E15F219CCB60F7FF51BC6449147C2BDC [email protected]
690,251,323 *474BA209A4FA60B85318476B6E62C2BEDB01074D EFREETI8
690,251,324 *4742131438FCACBD48C062F7FBEDC821EF209D91 EG(B4
690,251,325 *47441EB4D0E464D3D23BCB6C9C683C26BBF9D70D eg)rr
690,251,326 *474F2AA3631EC8854539B1CF54EBD7516615EFF3 cobvf
690,251,327 *4749DE5105DAE0229442A95D824B9657766D4F4B einflußnahmen
690,251,328 *474833F5C75F8DAC69689BC8CCC6DEE81E5DF0A3 [email protected]
690,251,329 *47412FD30949ABCF4670C642C5EA7534814A4412 commoditydependent
690,251,330 *474D9451C084AF45DBD21C4BC786BD7C093FE2FE ELBERTPADULA
690,251,331 *4743B08526DA84D187E2A64E92AB9F8729AC725D ELEKTROMEHAANILINÕ
690,251,332 *474E7D4AE55EF362455599AF8B68B23F3E1281BB CONFIDENCE PLUS (B)
690,251,333 *47499F60EC6359A9D6FE1F51FE3422F626DC608C ELIZABETH506
690,251,334 *474EDC5158897AB8D288EAAD495E927CF70C4374 coordinatorkow0ao1rdah0ney2ter0
690,251,335 *474B5D298A23C0D4B975A593E94DD82EA0F7B367 elliottguedry
690,251,336 *474FD39904629854DBF4B63A7E76022CAF0F5264 corinn-wilson
690,251,337 *4741436E798F786621FE572E3EF7CD07C3B9C76D CORNELLHAIG
690,251,338 *474353E86BCD5368CCF9D76ADB55740BCDDAB67F corruptibly
690,251,339 *47421DFB9D7A9130821FFEADE400B873075C9B9A cp46t
690,251,340 *474BBC54220D958CDAF9867072C32D62F50B12F6 cp&id
690,251,341 *474482BAB0CC05A7115A71D31EF65E6A90A7B646 c:\program.files\adobe\adobe.device.central.cs4\required\opera\skin\standard_skin.zip
690,251,342 *4749A717977B2254AE5521A36F725E99603086F4 C+&;Q
690,251,343 *47440A192C2DA285BCFDD333DFC372B0BC26C550 ENHYDROU$
690,251,344 *474A9B9EFC497E0D07E70C35B55801CC16B7ADFD CRISTOBAL.ALCOCER
690,251,345 *474C8E889D827B24CFD960732981D4C793855E9F enthusiasism
690,251,346 *47482B19833706E09CA73EBA6D81B030D3536793 CRNU(
690,251,347 *4749163F7755A4B848251BE6F28C1D252B3C48E9 ERASMOBRANNIN
690,251,348 *47480B4C61C96273DCCD7C3149A6257F432D794E erheart
690,251,349 *474E285F23C8541AE2DFA5BB158D5895589D79E4 CTNXR
690,251,350 *4741F9FE8F275D0AF85ACB75A954054BAA8503AE cu$at
690,251,351 *474820CA62017D63464C3F08EAE3C50991EE6FA0 CURVIIVRUC
690,251,352 *474615FD435454D7C5EDEF4BE5E82332492D437E cvcw_
690,251,353 *474EB790FF1CB8B4E512706C1769CFEF40313082 ETEUQNOCING
690,251,354 *474B5D1F2821783AA817D6D99FD94AA5D2B3EC64 C;WL
690,251,355 *474F9EBBD2D3A2423DD476144307FAF6A99D8640 eusebiotrivino
690,251,356 *4747BD10CB4F29AE5F04D8514BD8CB1C1EE57215 CY?LU
690,251,357 *47427E0C510D5A762E4A52D7D54A8F495BF51348 CZ5HB
690,251,358 *474B17C7E322F67902F2E044C75A2721DEBAA75F eyeland
690,251,359 *4749D839F919FDD1A2E42F9C37CE748F8B034608 d2r7w
690,251,360 *474B0FA55A04F56F8B577B937ECEB7E13BC6BFA2 EΚΤΕΊΝΟΝΤΕΣ
690,251,361 *474511E12FD24540EC60914D672D8CCB88AC2393 F3CE00
690,251,362 *4748424CE287B2984C94C976348AC2BE092E67B1 fahmy
690,251,363 *474A70F1C6306A813438897CBA271D74FBBE0BA8 [email protected]
690,251,364 *4747C3AE09B20DBCB9D944537ACBCDFF4F9944F4 FASISMOY5
690,251,365 *4742BF6D6727614B711ACB6AF8A77D89033C436B fatmaninthebathtub
690,251,366 *47495D2C32C85232D78F34000E812E8DBDF87371 DA13
690,251,367 *474BC71B7AF8F76692A1DC4521A4097BE6799C85 dacahara1
690,251,368 *47408C4109834EF361EAF29A1E48F9F7C8FB5E94 dad0:
690,251,369 *474D81B9F42097BC9F8AE6FBFCE3D4D20BF5E0B7 [email protected]
690,251,370 *4748C4310AC90BB7C055E43F807941B3838ECBCB da_hn
690,251,371 *47472C778F993F8C86FDFE2B63F75374F161E953 DAMPOMPING
690,251,372 *4747C887B137A87277B25B9E0E8CB47A22C2F11F ff.281ra299a
690,251,373 *47426E71976328C384428DDF9C97912BD4155DAA DANGIDCUMB
690,251,374 *4743764A9A28DDCA483A478160DB74599534C740 DANIELARAOZFUTBOLISTA
690,251,375 *474BCF39CB0DC877677B5F4A2FF83ED99BD79C02 fightersfromninne
690,251,376 *4741E2400516683CF87621FB6FF150BB57AB3F7F DAN TONNER
690,251,377 *474F86C6E68130B4AC446A775BE30EB559110D97 fisherpricebrands
690,251,378 *4744981D5AEF2952B5C9B6E632F3A60EF67EC837 DARK BEAT (STRYKE'S ONGAKU REMIX)
690,251,379 *4743C9E0249A4FFB5A4CB6E90C640726954957E1 floating-air-bristol-channel-swim
690,251,380 *474D8DED17BBB0F9DE78D1A1E8F97451D7B976BA FLORENCIOSEAGO
690,251,381 *474293402D1F0B59AA2049643B32AFE98E408A4B DATSNIL0
690,251,382 *474AA6B3BDC35B06AE3E2FD62973EAF17EAAD5B0 DAVE.PRESSMAN
690,251,383 *474C8C6266F6EF6CA30D1B49DE2BD864D2E72EF7 FŐEGYHÁZMEGYE
690,251,384 *4746D3537AB7BF3D6BE4395697B8DB493DC71CDA FORMILIZING
690,251,385 *474EA8D660448366AEF8B17AA711D7D653586458 forrestsunder
690,251,386 *474AC10E4DF2456C313E2B24B54BB69EB22B455E DCHAPMAN255
690,251,387 *474FAF68A7E5A508769739F6E959FD1B4158385C FRANCEBATTLESTUBFR
690,251,388 *47449893FA3E9CE88A9647E071927FD58477EC1A francescokaldahl
690,251,389 *474C0668E3A7A2461742BA7A86AD35242E728F38 dcpm(
690,251,390 *474377160F2F5F24E0AB67BDC4BC5C5D80FF5D60 DD,#&
690,251,391 *4746A9CA887600BE1BF165313CFFAD7BC44E95E7 frlwommy
690,251,392 *4749EB28A83A7D52DB68E93A6ABED5F5E0C7C930 fultoni5
690,251,393 *47430A15286DD81914982352058455CF1655E40A gachchhantyapunah
690,251,394 *474EAB71526FAD47FB7159C940DE536382E3C773 GAFFGAFFING
690,251,395 *474FA8132546049BD85D429D194E03AA282FDDBF gagastil25
690,251,396 *4747E262D94B72F7ED5B769796DA6FDB34601D87 DENSHOSHA
690,251,397 *47428EDE4E98B6C61A65E61135C4AE949DDA7F02 denverhanserd
690,251,398 *474FF76E8BA02236B811DAFFCAFE12846FC3729F [email protected]
690,251,399 *474C32441C8A8AFD00D501B29F7ECD1DD1AE168B Der.J
690,251,400 *47467DF9D2C377434305CB784DF970383EF4AECF DERRICK.MUCCIA
690,251,401 *474025D0054DE48732670A439E12FC0016D440E6 GARRETTLARKIN
690,251,402 *4747BC38DD0DA91DF16097FC66439C15F8C9B977 GARRY.BADAME
690,251,403 *4741A3DA38F530B7AE1B801DE8510CDDB85A8085 [email protected]
690,251,404 *474365CE900CF27B52B1643EF2C49E0B91A13F04 GARY.GORRINDO
690,251,405 *4747C1F69A0D1BD299763B512521E836DF4A6BEF gasgranaat3
690,251,406 *474CA53A08184E0A01CBFB60CC65AE823B5B894A Devil's.Trills.Sonata
690,251,407 *4745352D704495B58123ED18DEAC508C9E79E251 gbfmldcfrgrq
690,251,408 *47496738553E85AEE1F43A43630964BB13E83185 d+f5g
690,251,409 *4741B250A701AD4013D240A7D621E17C6E947F4A dfcbkmx
690,251,410 *4740068B80EA2E158538B67F4A70664C717289FE DFROST88
690,251,411 *47436D0F73C899ABDA6CA69439B54382683971B8 DGEHK
690,251,412 *4744B8F40033534E3C38477B215CC4CD1CFE5648 dimmitt..d.ih1.m.ih0.t
690,251,413 *4741B034833E8CB9464C78854DE7FA6DF966EFBB give me a kiss to build a dream on
690,251,414 *47401C55505E451150BFDE412507D9A441263B99 GLUEHBIRS
690,251,415 *474D09D36585AB14C2F3A6825A71A1737652E7BA DIZ2
690,251,416 *474BBD93F75E86345C5F95796A9BA16072BF1B9E DKA) FOR CELLO AND PIANO: II CON MOTO ADAGIO
690,251,417 *47405FA70A4D87A7CC7506374FE614BEF08DE164 [email protected]
690,251,418 *4745113D4F7CA21918B47358EE50E7D018A03A35 DKD+E
690,251,419 *474DE76E86C541086480F818CAE9B95E3C8F8357 DLEGGINGA3
690,251,420 *47457DCF508B563AA9968C117BBE133AAB9778E8 GRAFAREM123
690,251,421 *4743992047B1F04BF5F6F8505F462EC4AE2AB165 d,lw$
690,251,422 *47477571806087D031FD6C64F9F04A1A970D7CA1 dm74h
690,251,423 *47401F70BA20CE4A481BEB0D00A548CF84857812 grebsroves
690,251,424 *47453C20D7642E8DFD073BB613050BB2DF4FF9AC [email protected]
690,251,425 *4740668569AA1E71F2A922081869D13750A17BA8 dmsyv
690,251,426 *4747F442A99BC8738A79126BEF40B8C0DABBC270 großrumänischer
690,251,427 *474B431EAEBF6823A1D1D1C66C84F936B825888E DOMINICK.RUSHDAN
690,251,428 *4749C94769EF3D2DB8532559384A9C5F04DD0918 H150778
690,251,429 *474407E58E6E9D1BA15E26F7F0B6446961DD6AD7 haddomkinterioer
690,251,430 *4744FC21AAB617C1444ADADA406977F9AB25C05E DOUGLASSKIMMET
690,251,431 *474904BC7589D5575DABF8D80D0B1E41A03D4B27 HARLEYBENEDIX
690,251,432 *474B5D187369C20605420EDDC53454DC9E4C435D DPJS2
690,251,433 *4749CC3D48BB2FF54B10DB332AB4509849C43633 DQCL0
690,251,434 *47490229558C8961F40292AEAFB459A16EFD0160 (HELLO-MRS-JONES)-IS-MARY-THERE?
690,251,435 *4749EB43D4D888D1BF5B6497C18D3291D74EC320 „hemberg“
690,251,436 *474292E9083215B70ADC9C6983E6AA1AAB2CB7CA [email protected]
690,251,437 *4747EE7B2E99BF00340D4039DDC82DECB5658627 [email protected]
690,251,438 *474F8BB8F1AF2143C6A30124E3A22FF1F2E0C13B duckwithducklings
690,251,439 *474DFD421947FC92506F680CEFF708DF94D8B83E HKASHIV
690,251,440 *4747FFCAD778D972EF2EF33E18F747F53AC3A81A dug
690,251,441 *4749CE0CDF165A52ACBDD8ADC696CFA62A1536AB DUL%G
690,251,442 *47474E2457824250B27E359801158E56EA176E80 DURCHWUHLENDEN
690,251,443 *4742E055A057F480709C29BA6351C3E3C8EE76CB DUSTYSWIRES
690,251,444 *474DDFFC9B31A9D8B66679713A4608DA0F951B39 DVALIAGAS
690,251,445 *47414153566A9C130FCE9EA32A4DC9ACB7AD7E7B hoorydmusik
690,251,446 *4749F12E9E5193489037B3786C37445F25835C7B HOWSAN
690,251,447 *4747FD165A6A4999EA89C61799C907B8944563AC dxieg
690,251,448 *4747FAF456016C3412FE4EF69182C846F407DCAD htmlcbi
690,251,449 *474F8C2A7BAED51CF23C59EFEE9244616D687551 d:zak
690,251,450 *474B0E6C45554A33A2A62F0986870B365C78B586 [email protected]
690,251,451 *47467AD3782CAF962A46A835D314EB57FDAC2568 EA/5Q
690,251,452 *474D8E408D7604071EAB3842DE40E3D3F5D61135 earsnacks,volume3
690,251,453 *47460B594F7CD2A476355BAE397F45DD46FA9C69 [email protected]
690,251,454 *4740FAC0AA4F117FA13AF6B4A4206ED52E17BEA9 HYYTEEN4
690,251,455 *47400089E9F1807D80513D348F4D972E76CE4664 IAMSEAWEED
690,251,456 *4749E8876F90FB398C5DD9DDA7B35E1819987310 EELPX
690,251,457 *4747A4F904F96A5DF2B60A4B456E0DDAF3871216 IE=M
690,251,458 *474AA228D07C010051DC9BAF618C89B840CA5559 EGL8T
690,251,459 *4742C2221D1CD3B99E1DC1A3FE9D7181230E4FB3 II」貴族1
690,251,460 *474CE05F5D3A54C4E1FDE3E755752691F2811C50 ILOVEQWERTYUI666
690,251,461 *474B4CF3590DB10404ACDC9730663FC6D3FD6161 EKNUEPFT0
690,251,462 *474CDCF7371E9A62515BA98AEE39C73809ECC481 [email protected]
690,251,463 *474AC4870A253BC61CF3A98C9BF54FA59A0B2558 incurante8
690,251,464 *474DD0C2B120AC57B9DEDEE489A88FF1953F1F9B INKASNAR8
690,251,465 *474580E2CAB23AB3EAD15DC19F34975B87AAEB7C instils?
690,251,466 *47479F22524B077376344C9802CEBCDEE875590A ip~l
690,251,467 *474C2D72741FA314B082A1630114551A8C99374D i,<r
690,251,468 *474314A73B1EDB1C5FE0D0FD69CFD513835FB14E ENLOSES3
690,251,469 *474D4871ABEC6AC8F72AF54CFF49380B78DBFCD5 ENOCHARNEY
690,251,470 *474DE06367ADB61A0AF476576978578F265D15B2 iturank
690,251,471 *474609FD5890CA13AF37743759C90CED41A82C7E jackiemclean
690,251,472 *474CB8AE9CADEAB7C1A6B517AA319C05C0424E25 EQSBW
690,251,473 *4741C87AB61878D5A0C7D91901331487E6FF00E6 erasmoposka
690,251,474 *474F746E2146B56569AE603E2D1B340627192359 [email protected]
690,251,475 *4749B4FC869C681513C6518FE457CF128761172F JAKEKIMBERLY
690,251,476 *47445E7DFB95B5A56FD78B5E5C0AE88F72B2A785 ERICA MCGEE
690,251,477 *47488BA8BE0778B47B661657DDFBA19BCCD92204 ericmonterrano
690,251,478 *4743A4923423F4013140EB8282B0D5495CE44EF4 jamelshiffer
690,251,479 *474A72AADE5B2E889EA6F14700E6444394BCEE06 erroldewaratanawan
690,251,480 *474AC49D8822B68BF04D4AF7DA0AD4F2B968BA5A JAREDSCHEFFEL
690,251,481 *474DC10633B0FCBE93571CC1FFA8CFAA8773D4B5 JARODGODE
690,251,482 *47496A43AF0A16674DEABC3E31FFFA41AC547182 jarredlivsey
690,251,483 *4745F88BA6D224DDC0C07F53BFB0F0FFBCBE9D7A escuela-hipermoderna-de-ajedrez
690,251,484 *474E8B97C4CC14BFA5A98F4811519820F5255E03 JAYMERRYF
690,251,485 *474DA1318055CFCE38A16240800D16424E6B87A0 jayne.belson
690,251,486 *474860216EAE2611FB23FC20000507C48B6186A9 ESSAYAPPENDICES
690,251,487 *4740AFD40C5667D844BF3595EAC47C400D9BD119 jeffrycolomba
690,251,488 *4749D693D0C78EB22E85D9F4C0F781817638A6BF JERALDBARRAZ
690,251,489 *4748C1A092E890BEEF07F6D8D6283DC521A6FD1F [email protected]
690,251,490 *47402D3EABCC3D00822E4D10F85BCB59E7A13936 EUONYMUSELLIPTICUS
690,251,491 *47486BAF92E50A5174C6AF89705A88FDF5A97EFC jif>
690,251,492 *47476C879B123C14446D053D06B71B2EA20A65F3 F215245
690,251,493 *474EF8FDCE835A724D651173A4672F2D72326CC4 F))AAA
690,251,494 *47483FC6A6C35075E1756897E6507E2AD2E1AC5E fabiogt17
690,251,495 *474D3D91DBD1146E6D6407CB6C39E6BC547183D9 fallne
690,251,496 *47435F46398E3ABBCCA24F03139DB581E92E69DA FANW0R+S
690,251,497 *474ED778B357BAEC2EE04745166FD4A29B314984 JOHNIESCHABEL
690,251,498 *474A64872529FC8614B93656ADE4C6E4F1C82428 JOHN-KRUTY
690,251,499 *474EB82FA9A19A362E08663EE9E46F6BD80FB5EB JOHNNYBERROSPE
690,251,500 *474A346F4EFEC15D029F67ADC44B21B9436A19D7 [email protected]
690,251,501 *4746496DF66FC83E99872D0BD27137757F6AAB97 JOSEPH.DERKSEN
690,251,502 *4746E68FC9FBAD0E6AD680AE0487F3B69D53C33D josephelasmar
690,251,503 *474C5415E38C26E4AD3D324669185A655A09E527 FERNANDODISHAW
690,251,504 *4744A4CD63662452B25507643C85515A492BA614 JOSEPH.TRINKLE
690,251,505 *47440C5708DDD8FAD7335B118A814CF7D28BF992 josh-carswell
690,251,506 *474B9BF8A17C22F116D8A598B1B4491E4BB38B74 ficussens
690,251,507 *474A4DB5FF76E2DEF1AE7E4624445AFF3946044D JTATSEA
690,251,508 *4749120E6A9E809FB4282E87FC50FDBCAF524AD0 JUANILLE
690,251,509 *47406210723F742AFF74FA828BD1DD49FBB8079C FKERACHIAN
690,251,510 *4749EFD8E457F11FE927D1AE42BB3C46ABD8B45A julia.bott
690,251,511 *4741D210DE04A9CEA4731B9D85448122E325D4F3 fl?
690,251,512 *474002E4E3B86216DCE6DC4ECADDBE9B36B0D15F JULY FOR KINGS
690,251,513 *474604DBDE58FA0403616C6CFE73C97EF6ADDE03 FLETTNERRUDER
690,251,514 *4747C020193CC0FD3BA918F50FF966C3712A2E3F kaqk
690,251,515 *474BC67F15670DEF6727CBED1401317BD7D2A81A FRANKIESIMONCINI
690,251,516 *474D72206B9E7B2150E419322963BAD4017C2B06 KAYLA.CARRELL
690,251,517 *474576D95CE09BACFF3FFF793B17C63F6AFB990E FREDERICKWICAL
690,251,518 *4748BBBC7FB87412EBA6BC9F1BA88DDE710B8011 KEBT를
690,251,519 *4741FABCD6E0E7478213B7BBF864FD2526663F4E FREDRIK OHR
690,251,520 *474527691071B2E8963B89F9D9376A4E2BDAE3D0 KELLEYEVA
690,251,521 *474671CAE6EE7233F42F1EC552CF3869B6919121 FROLOVSOVIET
690,251,522 *474CBCAABAA4A23056DB6679EA71C93222A9B13D FROMTHENOISEOFOUROWNDRUMS'
690,251,523 *474D21FE025BE548E039EE1F280DAC99C1E249BC ken.harder
690,251,524 *474D7EB2002DD1902209C238B18E92DAAE8F7E8F KEVEN.MCCELLAND
690,251,525 *474ADF7FD682572785BF43F51988ECE90948DE0D kinderflash
690,251,526 *4749A18DB2A75C8FE313A9838501136E8C718C86 gaiolesi
690,251,527 *474CABE7524E34CDA2A8CA3B689A8260D9DCF814 kirkkoses
690,251,528 *474E8528A3F1477EED9CF4F34B665866E1B47D06 k-o2
690,251,529 *474756B53C30B313CD16CE93230C1B4D2B362AF6 gavindymke
690,251,530 *474C8E350BB08360425A5F3CE6AC11785D0F0742 kontepsas
690,251,531 *47482B5A4DC42D771DD079BC9A09676758DE25BE KRAIGGAPPA
690,251,532 *47416A6A34B8C15AE31AF7A6EDDB202D3A78F9FC GENAROTONSCHOCK
690,251,533 *474EF67860662D9EC0D8C4C9022369E45F5FEAB9 KRISTUV9
690,251,534 *474668A356167016EB970368780CC3AB5D414CE2 GEOFFREY.BACHNER
690,251,535 *4741DD68CCB150F545818BBAA29E516E2F969B89 GEOFFREYBERTHIAUME
690,251,536 *474EABD623C00953C11BFD638FAFED2114DBB27A GEORGEURATA
690,251,537 *4746CBC7F3363EED3FE8D7831E9176D8C579B615 KTBUG71089
690,251,538 *474B7C274B89EBA5AB641F31D023F265E528E918 germanwalborn
690,251,539 *474321BE9B45956DD84718F78CFB01518CB136E1 KWAAAAIACF
690,251,540 *474D30A7AA712B2F9D2010BA9FA83156A5E0589E GEWERWEL1234
690,251,541 *474907FB85235CD4D388727055911F4EB40B39FF KYLELALONDE
690,251,542 *4747D99A85684EDAEAFC386CE4B30A66087A4C05 [email protected]
690,251,543 *474244830FFF3D81A2DFE2A18FFBC3B630330A70 GHARTSHO
690,251,544 *474C5CEC833C657425707BEC4FF6843D82AC00AB LÄHIVÕTE
690,251,545 *4743E4A7C2085A30EC95D0F067823DFD1BDE42FD [email protected]
690,251,546 *4748CD14987536227E6D849EC5872F473B888944 [email protected]
690,251,547 *474A674CC89D06364EB845F29DBA5F230CBAD1FD lamontmittiga
690,251,548 *4747303C96DB43090CF43A85EF093A4516D025C7 L'ANMOU-PA-M
690,251,549 *474F5ED16221BC7F38804EE77571FE6D817477BD LARKABY
690,251,550 *47473CF46A6FEDA85685FCDB2B2EE82CAD528677 LARRY-GRIMSLEY
690,251,551 *47426F32142F07B8774F94E1BA990CE00F7C0AA3 laserstrahlinduzierte
690,251,552 *474E97333C5BA630513D1F447B5420FBA87D2910 GOPHERRO2
690,251,553 *4748C6B619FB091EFD80A6900879FA49D964C5AA LDESPOTOVIC
690,251,554 *474588B3A02DE28566AA7B3096B7F298DD8267FF [email protected]
690,251,555 *4740AE34CC299DC11B28406FF45927BC62662FC9 [email protected]
690,251,556 *4743F71878339EE943A64076B27DF9079A8FB0DB LEGENDARY-CLASSICS
690,251,557 *474B5D9BF9C4449E41180EE3EC3A9889B7E16508 granvillebroersma
690,251,558 *474060532EF179315BA8F5A10D470004B645E698 GREGGLYSIAK
690,251,559 *474472CE2AA78FACD7155F9546D23F36114567DE leonardburdett
690,251,560 *4744D2B1A6725CF50A93035DEB810E1E0F4B710D leonbankemper
690,251,561 *474A7846A3845F80C4644AFE9B8F1880D238391A Leons-Veldre
690,251,562 *474BE82413112348599CFB2B9BFF11A86FBD8902 leowittkop
690,251,563 *47440058364CF5E10BFD78E2E2AC62EDA73F1FB3 LEPTOPELED
690,251,564 *47461D4DB8F6D5A6632ECCC186862CB940FB3F12 [email protected][email protected]+ROUS
690,251,565 *4740053C0C24DA04C1291124832E56B6C219DC92 GUADALUPEBOGDA
690,251,566 *474419D2BFDB2F652EBF3B7DE722969E67E39F0E gulfiths
690,251,567 *474BAF400F838DAE53DBC9AA16DE8097FA4EFB72 [email protected]
690,251,568 *47403BDC43D3DBF8B3F2CF1658E01121373B529F GUSTAVO.POLIDORI
690,251,569 *4741BD4C9EAA1A97A40CE6CBA37F3DB856005490 [email protected]
690,251,570 *474C189D875AA48F762C27AC3FC06E55E1C2FB50 [email protected]
690,251,571 *4748998EBCEF1862D37EBEF295F4B7EF9B6A64F3 LIDERAD1
690,251,572 *474D9D383BB7D598D8CEB312F44B608BAE55DF66 LIFEOFWILLIAMTYNDALEPART
690,251,573 *474A87123D44551C72BE135040F5E4FA45641699 limbų
690,251,574 *4740D3A298DA83267818805F52505042407D9613 lindseyruscio
690,251,575 *474ABE06B3A51D2F59EF62E8B03DE5C5E860E904 HANKBIELE
690,251,576 *474E431FD011A092F4BD3E2482A92CA34E569A59 LIVE311290WFMUFMRADIONEWJERSEY
690,251,577 *474063A08CB171BB1CE4CE272B3A2761C532C4D9 locationhttpwwwuleb
690,251,578 *474897690142367CCC7F085BED24B39C5588EEDC HAZEL.DAYAG
690,251,579 *4743DD6C8C8660A8DE7CD68D28FF8861928C0FDE LONNIE.CHACON
690,251,580 *4747DEDDB6ED03E688FEE639197173C14742E37A lonnyliebrecht
690,251,581 *474B526DC1452D5EE516847E008C45CDA4872CFD [email protected]
690,251,582 *474778F47BCF40A5E89AA079E719BE0068E3D734 hectic4l
690,251,583 *4745817FAEA988DE3EA4DD4FE796D737CB94F460 HELICOP6
690,251,584 *474E78BFC9C4440485B5AA530A49D1D3C69500A2 HELSPRE
690,251,585 *4747EEC37ABBA6383791BDCE1C693E502BADFE57 hendrion2
690,251,586 *474C770F37A185231A7F465B5D4EC10FC24E5F8F lucianogreenway
690,251,587 *47495DA3586C810BB100388FBDA2F9C7590A65A6 LUCIENACEBO
690,251,588 *474F6A6E3A6432BD9A288D6E8A9D105EB59308A0 HERSHELHEHR
690,251,589 *474BDE7FBF562151762F5D0A51414CC7312B89C5 hf?x
690,251,590 *4748671F680726B66689C03949712BB8D0BC7381 luna7on5
690,251,591 *474EC1FEEBADA4E6520010BF0B889E37019F7BD5 LUNGEDALEIPERMENONV'HADILETTO
690,251,592 *474C24F8D4C664610A50F9E361D6915026509567 [email protected]
690,251,593 *474CFC88F2A47B6883AB93154EFB26A4F78A2419 HIRAM.IBACH
690,251,594 *4740559D3B26D8EE9971B35A38F5EFE5FA0291D5 lylesherfey
690,251,595 *4746B23E1AA3BCCB027BC70AA4E560BEF60AE8C3 HOASKA
690,251,596 *474423AE4A04FBA5732BE08C45A223650FBB286D HORDES OF THE BRAVE
690,251,597 *47412602932D0488F4B7E37495E18DDBBCC1CB39 HOT-TEXAN
690,251,598 *47472938E4359A0A1B9FA969289D6AF605A33E16 hour509pea880
690,251,599 *474CF75A89FCE3016F1C7CB7EE5ADC4C031E8286 href="http//wwwamazoncom/ILiketoWatch/dp/B000HPD60E"><span
690,251,600 *47435A3FF83EE01A3838364833D515DAD8975D11 MAN!FE$T0$
690,251,601 *474C88CA8F3B67D107A89EF8FA20B94440AF6272 human-conduct
690,251,602 *474E22CEC11757A12B980B6A06506C9B053FBFFB marianne(variation)
690,251,603 *47406EC1005BED00D54CA38307216801A094D074 martyfurse
690,251,604 *47487550A568BCA3209A8ABD08B097A095ED8E75 IAMROOTBEER54
690,251,605 *474501F4BBA9516DD3AC344C939F321B44D4C1AC MaryofArgyle(IHaveHeardtheMavisSinging)
690,251,606 *4742A1BEC381C2C4522FADC9B4333C05F66E3E3D mastbos4
690,251,607 *47439D787F6752475C6A32569E412D13591DA5EA IINRL
690,251,608 *47411A8CE684BDB4FADAF1F43AA2256F27868E48 ikelucier
690,251,609 *474E156FC60CBD48A6D74E3E424AFB56190D91FC [email protected]
690,251,610 *474995721C71EDD8107F1998CDB164C95A6CB494 ILOVEKATIE195
690,251,611 *474E58FF50F61AA24F6779D11994269746C9C62C MEKHI834
690,251,612 *474E250A6C082303351B2F3B2F6F9044D6E0A290 memoryd
690,251,613 *4745005B0626F2CA4386689B1AE373640186B1CC MERGED
690,251,614 *47497D443424F2A6C9E72025BA2C287CD2CD9308 MERVINJACKOSN
690,251,615 *474F66EB5BAE13F8F31B750C836B8EE6CE26D50E IMMAGAZZINAMENTO4
690,251,616 *474E310F46AF29498817A8D6E8CFF6BAB63956E3 [email protected]
690,251,617 *4740485AC8581602A314926684662C0948E29304 [email protected]
690,251,618 *474610BE6277F1B0C68C4353F76E8300441A2EFB micahlevitan
690,251,619 *474EDEF54EF5ECEEDA1DDB7DD69C3C726462D0C8 INDELNING3
690,251,620 *4744306A4EA2CF4C37F390E4A2502AD2D02BE5DA MICHEL-DUCHARME
690,251,621 *474B29349573DA0638B958658E094A3071A80FAD MIKELVEHRS
690,251,622 *47408E1332E79094672CE1E5D8BC79CFF4CD423A MILJONAIR0
690,251,623 *474A1F6BD79DF800A345C13D79F5F018CBDFEA8E IPISTEITING
690,251,624 *474958B33A562F9BA67F2DBE5AC9F0D9E117427E irlx
690,251,625 *47460AE97A10028337593D1C148F20D4F9B8B9B3 IRONUZIHS.1
690,251,626 *4745B28AFE074BC33414B52765C2573267730909 ironweed30
690,251,627 *474391D0E94249FC9CF52F89975B7E5B9CD9827A IRVINCAIMI
690,251,628 *4746A603C6E7FB0D735376BE4D44EDBB62F9F837 MITCHEL.OVALL
690,251,629 *4742BCA848C8C011AAD2E19A8E4E51C0B0EE561A ISAAC.ALLOCCO
690,251,630 *474963FC3122F0B5A2D123276596E594A2CB051C ISAIAS.BARBARIA
690,251,631 *4746B2400347DF64A90C8C414B432FFD50E6987E ISIDROSANSOTTA
690,251,632 *474C20AB95E1E0DBB0D15A22FDFAC9C8FFE830D4 is-it-in-yet
690,251,633 *4743AEED7462893D4F4AEC2A4D45D554AF38B3CB island_teine505
690,251,634 *474C1EC4143E931AE99FB8E3A43B363BD73CBE28 ismaelenriquez
690,251,635 *4747819CABABA6834955C130EF043BA6625A1EAC ISTAHVORDIR
690,251,636 *4740FEE189C45E2483420EE3E2F32A3878B2C001 IS THAT YOU MO-DEAN?
690,251,637 *474CDB8655A61F7635369218BE31BBA3129F7469 istmussen3
690,251,638 *474AB5606147E9010CFEFD46652A29CCD80A27EB MOISESSTEINOUR
690,251,639 *474326D6BE5C440675DC35B40E816A448BCF60E0 it wasn't god who make honky tonk angels
690,251,640 *474F5344F7E4CFEFD7DA5F8E92D1BEB62ED3DBA0 J062890
690,251,641 *4749C23E4FC4AF7E12905931E35422C9ED696DE1 j8,x
690,251,642 *47429499A34D1298714E5968B540EF1AC2B36F96 JAMAALCULOTTI
690,251,643 *474517DDA3C368E3385EC974273CB5D2376165A5 jamalbowles
690,251,644 *4744AE95D2D5E6A06644525CC1E2B8F5BD05BE6A MSGEAAAAMBAJ
690,251,645 *474512B0A2DAC8179CEAF41199A8FAD6DC3F75E8 MULEITTA
690,251,646 *474D3B50062D9A795E22860402588F09822CFD72 multiplybyseven
690,251,647 *474A8690F95C3076FE3961667E5964733D05962D JANKOVIĆB
690,251,648 *474421A1092E159EF229668DA76DC5A497F115E6 MYSHAGGY61
690,251,649 *474002F1A54370C999BBB97032E4E750C74997F5 [email protected]
690,251,650 *4747CDAB68E85BB0D4295D6E6852CF52A2BA0DF6 N0N1NTERVENT10N15T5
690,251,651 *47471F3786E967F01DE2F65FB9F7BEC6B02C683F jefferyvannoy
690,251,652 *4741832BB608E20F3D03C956AEC8F17F512118F8 jegvedenl
690,251,653 *474B1FB17EEA01E23D5B7C06DB70A8A47E42B412 jepaant85
690,251,654 *4745BC6D8A8F125825BBB6886076CE16C822AD60 jeromerippetoe
690,251,655 *474228B23F2DA7C39DE5B21AB42703F72FF89F82 jerrodbellows
690,251,656 *47432BF337E63023E804157A4C1C734E20D58852 NATHANAEL.HOLLIFIELD
690,251,657 *474C5A7A0CF022ACA35835CDED47DDA19EE522E4 NATTIGHEID5
690,251,658 *4748928930B5F660E81E7C5E92B01BBEEBCDDCBF [email protected]
690,251,659 *4743A9D20B2D8E7088F2E01FB3A8791D4A436149 NEARLY-MAN
690,251,660 *474233FB5F79B4EF83C6E700994E2C0BC718728C [email protected]
690,251,661 *474A0225CF77243ADBD41496D1A344209CD7C5DD neha.sarao
690,251,662 *474FBFE132DC82C8054CDC8AD6EFD0A29923D08F [email protected]
690,251,663 *474D9D188395E0EDD03FFBA4720963241DC080F2 JJHOYS
690,251,664 *474430EF0765BB9E13FC4AA89193B7826260E5F5 N.ESPINADO.(FEAT..MAN
690,251,665 *4742EB723509FFB994B8247CE99133D5A03764CA NEURON.MDWWW
690,251,666 *4740DD5CA7B8C0BA0A0F0E84B863AA33ADD0C541 JODI-HAMEL
690,251,667 *474A83A03F8D49B75B47A7F6866F3D33C7347CA0 JOECILA-MOLATE
690,251,668 *474861D6AFD4CACDF8DD43B36D517614DF62CDE4 JOELBRESETT
690,251,669 *474B5FD5572DBA8AEE4C557C43C08403D8BA6B6D JOHNATHANPIOMBINO
690,251,670 *474E88E83D66ABA48DC541B30950EE55C87C75AE JOHNATHON.RIUS
690,251,671 *474A06D1C84793FC0D0A75CEB05651E463E6070E JOHNNY.GARTHWAITE
690,251,672 *47497DD4DE516438EA05B297E909C7F03C0A8949 NICOSIÁBA
690,251,673 *4741DD0F3099683051ABC64DC9952CB3ABEEE4BA NIGAHONKAADAONKA(FEATASHABHOSLE)
690,251,674 *47460D287BCF66AFE11FDB386E5F037A272E1F7C jonathan.geange
690,251,675 *4746C4B24FBCBC1664A5D321CB58B204EFCCAD40 JONATHAN R ALLEN
690,251,676 *474A936B6D499ADDC4B84B53042A665EA6B79653 NINOESPIRITU
690,251,677 *474AF06E9AD28A1DC990A0D947E2F2097ACED8A0 nl1cmuydp6zkq0kqst4uxjpungo
690,251,678 *474C172391A707F69C67769E317C757CE9EDA753 JOSUE.KASH
690,251,679 *474594B9A15B3B3F00EE223AD4F41E81E868FA20 non pros
690,251,680 *47476D441EC98963452E56741DF64E6240336480 NORMANT3
690,251,681 *474899492872AB312AFE45B109081A46E08276B2 JULIUSREASONER
690,251,682 *474FE631B07A3769C0E5F38AA1D2DF3C5368EF1F jump-mkii
690,251,683 *474D258F7855D0CB0BA17299AADBC27DCD4C9579 NOTHOLDITAGAINSTONE
690,251,684 *47426800837542A9AE998AAEF82D45A2C5FCAF69 K4tt3
690,251,685 *4740B8BE9A61138F0458AD28D4457DE00B541F6E kalloys3
690,251,686 *4741721141EB7FFA22F20444151BF95136E7C878 OAKEN11
690,251,687 *474342BB136D20693B810D37194EB2FB9242A427 odellmuthig
690,251,688 *4746CB3E4C66D4C8608508A724A80A133724B6A4 o->-<~`d----p
690,251,689 *474C4F42F0158C4DDE568A577D7B38D843FC0446 KEEKO2K
690,251,690 *474AF4D1AD8A82B2CCB611BDDF997B88E4F1A3AB KEITH.PLETCHER
690,251,691 *4748A75244C0808CEADFA8DD74DA73534E955F1A olendassow
690,251,692 *4740E24A88999D6DA08348774B36E9FFB37E3E01 KELLY.TRUDE
690,251,693 *474469E5078B4811060622C141CA2A85E8BFC7A4 OLIVIASHIRK
690,251,694 *474A2245F6C8E01658B69A9F7D587E745173AFA4 KENDRICK.JAX
690,251,695 *47406F833D55B794DB747B8E560163D9A1A21DE6 kennethhackleman
690,251,696 *4748437F687678E9429CDFDAC3DBEA0614430D78 KENNY.YONG.KEE.KIEN
690,251,697 *474B92356F57A0D4A0CDA5DF6A8F58895F65BB01 ONEWHITEONEBROWN
690,251,698 *474FF56D41F10CF66947CC779AEE5B17CE3D8F0C KERRIKENNEY-SILVER
690,251,699 *474DEE02038EB4D6EC23C6454F2932941EE8D716 O><O~ (====8
690,251,700 *474A631EA18696A80279A255E9384A9E3F00BB24 kevin haskins
690,251,701 *474342F1445E0DC988C73E7A827345F3C255E83A ki11j0ys
690,251,702 *4741FF68BEE302205603E4AB1B680A2D888F6DA6 kipprotzman
690,251,703 *47426CA4568C68B2966A73BAC540660EAAAC4249 orvillepolemeni
690,251,704 *47443F52D1B39CAB7ADB09D738FF2B7D6DE845D5 kiwikandy
690,251,705 *474D1CEB47D160D4A3DC8324A6205030CFAC4128 Klaploperij
690,251,706 *4746FB537200B75ED7F0FFB9AA4A5E7C6346408B OURNAND0
690,251,707 *4748741501F872DB1F4BDE037528760D680C4DAA KOLKHOZES1234
690,251,708 *474322C1ABD952854D2940187C4CF9CC2BF2AB04 P1R0U3TT3$
690,251,709 *4748AD1C43F292A9007E99DCF9DB4D6CCAC717D7 PĂGUBITUL
690,251,710 *474901DF7AD329BAA6210EF25CE231600E064693 PANGERANSATRIA
690,251,711 *4745780779F27BF08938099C4F7D083EC3624BC3 KURTISCAPERTON
690,251,712 *4746DAFCBE74029E1DF966A104E1C26503E3A6C5 kylowe
690,251,713 *474B9CEA0EC74FF4143D0C6FAA9C7C71FD4DB1E9 paulcwilliams
690,251,714 *4745AFE158121959D3AAE9F0164F6DE59523AC80 labilizations!
690,251,715 *474D3FA7F6673C64308E3888CAC1DC143EE28851 LAESTIGE
690,251,716 *4744FA1194A810992E239E043E4A3BF4428AA5B1 PERDIDO DE AMOR [LOST IN LOVE]
690,251,717 *474768C46403EF27653F2D965FB685CABF5100C4 laroleño
690,251,718 *474C993C7E1F7BB6DC3EDCFB594F1C285EC1C402 PERRY.FLASHER
690,251,719 *47494B9A15B09442B5776770CD5897292496D152 [email protected]
690,251,720 *474FC32BDBEA41AAB87ED2AC61B6B6DD1CAE78E2 [email protected]
690,251,721 *47483ACDD75C528B00C66AFFAB9557BA71653CCB laurance1234
690,251,722 *474504D6604E77DD99A1F53C8440248C5A988186 LAURENCEVANDEREN
690,251,723 *474376566C14890F8D866AF71EF93BF2867227F6 LAURSYY
690,251,724 *4746EE11B1AFAE384F336591B202EED53DA91B11 PH!L+RE$
690,251,725 *474F0B685D4600E3245ACDCEE0C7B026183C32AD pianosonatano17indmajor,op53/d850:ivrondo:allegromoderato
690,251,726 *474E242F997FFC86D400B5EC8CA5EE47B8E1D54C PIESKAS8
690,251,727 *4748F9147B206D8B5B3081B4CCAFF974A571F1B9 PLAGAMOS7
690,251,728 *474B54A5B38D13A9258806D09C53AF2C25CF167E PLATANO12
690,251,729 *4741C4B863C1BD86663081392419AFA748761A95 POLICALLYBSW
690,251,730 *474E1D4B5F436EAD2FF9E6FC089370A89BADD0CE LEVINSTO3
690,251,731 *4744D5CEC9C62525BFA93392F4EE37A8A4EB5616 POMIATANEGO
690,251,732 *474FC43E6FEFC8948794F840832A610AD1666E8C p#)~o.~o.splat
690,251,733 *474CFD1F1364D4A06EAF1D1926AF8B0911911691 [email protected]
690,251,734 *474EC322E91876C54D1EDA6AE816ED781FB8B508 [email protected]
690,251,735 *474620C5DEE7023D51896AF0D451958874AED8EA POSTFACK7
690,251,736 *474FCFA1D59297DF99C44A1E69D8B025091F5E3D POULGOAZEC
690,251,737 *47410FFA58FA66C20C27375C29529F6EAEFFB153 P######P-~O-~o:p
690,251,738 *474CD07872BCCC30F6633A70C2E3A4A09AA19828 lindsaybeyrer
690,251,739 *474E8C99784BE5D6BCA25BDC1CE6A5FDBE52ABB7 LIONEL.MAYORAS
690,251,740 *47445E43BD59AB8B69B1A4B96EAFD10AA564A36D prathamo6
690,251,741 *4741482F185B14E2CF7B885D03F0007765C66118 LiturgyofSt.JohnChrysostom:Troparia,Trisagion
690,251,742 *47434A07C244D560C11291D6A3ACB2D4363B2DFC PROBABILITY160-LOGIC
690,251,743 *474858704067B12647C2E73DB233BDED6DCA65C0 PROMOTIONALNOT
690,251,744 *474B00A6ED1F03B059B0F455441A404B0B70557F LOGAN.MONTROSE
690,251,745 *47412321CFE6B215F7548322A918A6EFE91E2289 psbd
690,251,746 *474E26E2EDE9C3ECDE02199B6C14564337C4BD0A look-at-the-sky
690,251,747 *4748A1C4AEEBF73B824E60DFD3AB9F0D4A5AE71E [email protected]~.`.sploit
690,251,748 *474CA8999F1FB02BFAB2FC7C8B42825D47BD046F Los-Sanidos-Unidos
690,251,749 *474A0F85599B42FC6DB73E89DC05A729F5032FC5 love comes again (feat bt) (12' mix)
690,251,750 *474439C4AC294BFD73460CD29D11B0D8A713F611 PXCACTUSFLOWERPOSTER
690,251,751 *47439D84D89D844418C1455B5CE192693086C823 QCARVER
690,251,752 *4744C883A52ACEB58D2E8BC7CC9AD1FB63844BEC QGG4
690,251,753 *4749B2A5E77AAFE4E633653823416A48A4C47194 QP(M
690,251,754 *4749089E19230B245595C80092908DACCF76EEDE [email protected]
690,251,755 *4740A473A3D23F36005BF8F8603317B39B0AABC0 macklemelle
690,251,756 *47496704F75CE9D34E0CE8BBD6E14617B77AD746 R4P4R14
690,251,757 *4742A4C850F834C527D1D5D56F514A809D9F9BB7 R9]$Z
690,251,758 *4743E6652CCF876EC83E3922A7DD20A2620B8DF8 RAFAELDEFABIO
690,251,759 *474B19492A57629B1A0AF9532859221D38CE8588 RAFAEL.MILROY
690,251,760 *474E21181BC3870AB184F2CE550F4CADC5B82705 [email protected]
690,251,761 *4745A4F7E39162BB1AE5315E20B5738CEF73CC06 mariah.doodle
690,251,762 *474C4AF2000A3CBC074D47F218749CC57AE66BE8 mariel
690,251,763 *4747A2BFDD59114BFE3FB925E0FA316A75AB8D65 razila
690,251,764 *474300A46D28C70DA190F5CCEECA97848ABA6992 MARKUSPETRINI
690,251,765 *474F11110E439CF9FFA77957CE31A190E5438358 RCFFRNTS
690,251,766 *474ED695A93DC1D12C6F5B03CDA2CAEF90D45763 marlonkristofferson
690,251,767 *47498B8AA10936EA234DD164467407EC98175633 MARSHALLGENIA
690,251,768 *4741384EA71C6B62D0AED5F4FBB7B4DCE4783ECE rebokcur1
690,251,769 *4743540EC7B372371DB87F35FAFA5C5BC77EB6BD MARVINSWEANY
690,251,770 *474FC13A2C28DA2415C6A604042CF8418F5F31ED MARYANICEMAN)(*
690,251,771 *474CA2141612A30FB49025B0AF653D1602E28D67 maskoor
690,251,772 *4748660FB32051F21148E9069D5D7397834A51CE REGINALDGHIANNI
690,251,773 *47408EBA421E120CB8104566788F729075E30448 MAUROHORTH
690,251,774 *4749F90551657D7E7F7594BF4EE03C7122510AF1 REHCEADZ7
690,251,775 *4749FAFD74967A37162BC541E645EF2F59202EA1 reidgascoigne
690,251,776 *47489327241833B7A21F2A865DA78E4460F4B9E7 maxwellhovanec
690,251,777 *4747C0BDF835F0F381231AB0EE78417512A7C650 @[email protected]
690,251,778 *47474038111729E63B69374E80D889686DD5A05E MCANTANIA
690,251,779 *474D6B205BB60D168A783C6269371BC7EA0BE6C6 mcdonald's-corporation-(frygirls-dom)-frygirlscom
690,251,780 *474F5F41C4FF690C7AF12AB74BE3F36142840596 REMILITARIZES.
690,251,781 *47457F273BBDCC4734A79420D9F8AC06EB612DEE reneebishop
690,251,782 *4745988B606CDAD87EFF3DAC7F6D865A43C2A122 MENNETH2
690,251,783 *4743EB01234AF05227D2D60669192274149592E4 RETRATARAM6
690,251,784 *474168E308E8DEFE73C2A64326807D95CA284BF1 Mestre Sabino Coco de usina
690,251,785 *47470EF90286851D46D3034ACF9CDF8B89038BED mfiiioir
690,251,786 *47498F9259AC4F46DB8D3F0804AC2D3495862616 [email protected]@nm0u$n3$$
690,251,787 *47442E8E1080A43D04162E2B5DD6848C1F2D045A micahbrisco
690,251,788 *474ECA7F4C17F894BF5BD3FED51F7058F746608C MICAH.FRONCZAK
690,251,789 *474362E13399FE91B16B47FC9ACB2F20737976B6 michaelfilmer
690,251,790 *474CEE6DA17FAE1341D6CF462C85E8E63D8999DD richiewatry
690,251,791 *474E956834F21F5C77A0FDFDD440111769052B26 RICKEY.CAHO
690,251,792 *474C5CE6D0543BD1B32BF039D29F42F1964921E9 MIDWINTERTEARS/ANGINA
690,251,793 *4747AD12B9ED87DB1E0E225F4EB4B0669D97212C rieII:IIIPoissonsd'or
690,251,794 *4745F3C39C8F1255AD789189B35A19E8B1DD92F9 RIGOBERTO.DUMAINE
690,251,795 *474BE05259011BDD6EEDF84F3D30AAAB67D66967 RIGOBERTOZANA
690,251,796 *474C37BEAC254899C74B2450F1B3C3ACA028C481 RIMIVEYE
690,251,797 *4743C97603533346603F2317975897D4986C0CB7 MIROSLAV-PETKOV
690,251,798 *474B1DA380E9259E4D7F0AA3EEB0B8C064814414 MKALANDOS
690,251,799 *474F769365E50B50310AA009FD4952E8A0E68AF3 ROCKY.ARLINE
690,251,800 *474657BBECAD8BF6C3248662FC9FE8F702E4E32A rodgermaontesano
690,251,801 *4744F98B878E6EA3984F9FF40D26CE3710760AD7 MOHAMMED-HAMZAWY
690,251,802 *474EDC02F4E13E0FE32EAC896543837DC27F6349 Roland.Berger
690,251,803 *474155AD079B793A96E2BF74D9EF66091557E5B2 MOISES.CUTLER
690,251,804 *47447AD2E62B7CD5B71E3B0070DB6E0EDED49995 ROLF.ALLENDER
690,251,805 *47417DF8670F39BB97531E459EDAD70766737706 MOKKAPANNUJEN
690,251,806 *474D2B004C83DD765314AD260E61EB2C005AA41E money1florida
690,251,807 *474F1CBA4833B68FB27ECA34CAD92B58AF4E0548 ROSARIOLUECKENOTTE
690,251,808 *474287704170AFA08B922F47596EFE226D86C255 rosely.raimundi
690,251,809 *474B43AE5165975C2FA4D83FEFA9DC8F4A6FB3FA rosrita3
690,251,810 *474BF52E884BFE87DA7AC01CE7008E154C044DD6 mudaic
690,251,811 *474877B4FEB453012F11DB4E21EE743B40CB13D0 RUDOLPHUST
690,251,812 *4744E007F20DDB322C974197038F9B9BD6C34837 MUSAVIJI1
690,251,813 *4748363CA75764410ADE5D97AA2BAA8C42759721 rullsdaurats
690,251,814 *474B974AE17E54A994560E2228547E4D69130148 russellkucek
690,251,815 *4749D5A350E2B8466ED9DAF33E2BB570A3CA62AD MYGOAT48
690,251,816 *47461D8D3CBA29140F12F0232DC4E1FC789EF887 MYKITTY30
690,251,817 *474B9588B078F22C1BB61F9858A6ED42DAAA7FD3 rutherf0rdum
690,251,818 *474E0A88CA1B3855F0BFE8AD0067BA36D0E1177A myronmaharaj
690,251,819 *474F2951D20CE9965B6EEC715B2F9E6EBED94621 MYSMURFY90
690,251,820 *47467635995233C3ABDE53DAEDBC07B2A8FB4DAD [email protected]$
690,251,821 *474123FB17CA4B9215169D2693A3181D2B6CDB99 nalahill
690,251,822 *474D840F001E25DAAC2C7CFD65D76E3863F269C8 SAMBONAR
690,251,823 *474B5C09AE74C1D75A8B321A9E09562149254988 naveen.sahani
690,251,824 *47420D84D410C914166AF44B06880431DC047C86 SAM.NISAN
690,251,825 *4747A65CA70014D0285476848EE8E3E3577D071A ndikhoxaba
690,251,826 *47474E639AFCE0585670CF1471E8C66B135ECED4 SANDEEPNADKARNI
690,251,827 *4743288AE505F3BCC04EC71BB059E6FA48EED3DC NEER.(LIVE).(FEAT..ZEEUWS.ORKEST)
690,251,828 *47411557E5F8E9F961A2FB5DEF590C8F57EA9DFD SANTIAGO.KJELLSEN
690,251,829 *47496327EAD81F5206F741505C0A8AF97F2FB073 neilsaccount55555
690,251,830 *4744E8C0E6B0F7A45DB336CB27DDD2C5607D31B9 neodarkmagician
690,251,831 *4742CFB331E72E8B049CA317C1A246B0BD07C5D7 new.trier
690,251,832 *4744D9A5AF69FEAFE8A52C9924A03E8A85A2292D SCAINTE3
690,251,833 *474585906310D57E9CA54B3875384EC48AC0044A nezamjenjivost 1
690,251,834 *474035E66396251E9EE8DC365AC9B1D29204990A SCARLETSHEBA6
690,251,835 *4741864ABE83F4D74DF19B712D22F6459F3FD3EE ngayon
690,251,836 *474157C7AA3F01D3710195935FC3BB9450CF7424 niattarb1
690,251,837 *47457C50C7FE17801ED1900F258634257EE9D18F nierens2
690,251,838 *474968FD1A28EF2D3A82265D5D1A88C40AD618ED NIP22NAP
690,251,839 *474429E0432A8E28421B5B7EB44AF1D72D810CDD [email protected]
690,251,840 *474EA31E7D61861AF74EE646389A6A84D953D376 NOB1TY
690,251,841 *47444235A82D8AE1BF86A0D56BF10A757AAC4572 NO-BRAVER-THING
690,251,842 *47406C8B35AC3A645AB8B7ED537B8D5EF256A9B4 NOKIA3BBS
690,251,843 *47491E0C70EBDDDB22280A543D02582F9CAAFFA1 [email protected]
690,251,844 *47410DDB20BCAE7CF762F86154FA468D13E4D89F SELFLESS
690,251,845 *4743ECC8373B786FB9B30248A29D9DA7F954CDC1 [email protected]@TIV31Y
690,251,846 *474B2DA83932645BFD00EFEB564A87D80F81DC84 NORBERT.RADTKE
690,251,847 *47424DD833BD7F93B0E2A272935FA856A7F4C52B SENTIMETALOVERS
690,251,848 *4747D5A51A2A3EC8D03F36523349CE7E85169E31 NSEATANSAK
690,251,849 *4747422D0F4DFA958355E92FA3E039F19CD86DFA NU-BOURNEMOUTH
690,251,850 *47416F437DF383B65F0EA552C5E8E455399FDCF8 SGMIRIUKA
690,251,851 *4749B1E1C9CE492C8340C536BC36D1591429B002 numbfish
690,251,852 *474F30753A9047B56C3313336C8264F328460C9C SHAOXIAO5025992
690,251,853 *47400ADF884D817BB020FA0B9AFD5C7E68D6A9CA SHEBABOBBIES
690,251,854 *47403419F8549627369A12D9BC0F5BBA55C3482C SHELTON.CATACUTAN
690,251,855 *4743ADE9BA8BDC6ED2F911D056BE3E10E623230E OCTAVIOCARRITHERS
690,251,856 *474B10BE0B8D89CE5EE3903B97107440DE247536 [email protected]
690,251,857 *47450EB35B6D7C952903CD7C16E3C3CA02DDDEF7 [email protected]
690,251,858 *474503EDAC70543CD38857DE4647E6E935648396 shirleyjerowski
690,251,859 *4744F648ADE501614C66831123C7E76E95E0F051 [email protected]
690,251,860 *474332138A824F5BCCAF495BAB34DAAB69378282 off-beat1
690,251,861 *47454335FC0D120F08FDA7C92A639F7D54C5FBBF SHRUTEN
690,251,862 *474702AC0545BA6A71EB23E088E0DDE2E030F7B3 OID1379778
690,251,863 *474E28225B89A0D9EB6B94303078A776884E3A6B OLE´THE
690,251,864 *474E57FFA101E95AF93A7B73CA97BD8EF1A9B48A OLIVER.MIGUEL
690,251,865 *474853A224F0EAFE5DA7843CAB93D8B756281F4F OLIVIA071097
690,251,866 *474B858EFB06D49F66647F7D91C08F6E0DB8F5E0 SILVER-WOUND
690,251,867 *4748D29B7444BBC9B29A53E8AAA4302019C0193B omgetrokkene8
690,251,868 *47432F63701E9637D9A0CB0F150A9C139C8E56C1 ON-OUR-HANDS
690,251,869 *4745FF59E3BE358CB07918B5B7ACF6B3DBB7F7F7 (~_^).O~.O~.(3
690,251,870 *474BAAD0E0FEADEDB9C96689ED780D6E1F4B4367 operon-concept
690,251,871 *474DE9F4B1668C791A12FA999C883761634EB78C opticalultraviolet
690,251,872 *474AE38C770A7A1ACF5222242417B85709DCBDCE OUPANEN
690,251,873 *4742E16B8F2D524068FE2DBAC5CD12C67D0E2C68 OUTRAGIN4
690,251,874 *474BE4D1EA995BDB7D391730B25A64E37851ED54 OWEN.LIEBMAN
690,251,875 *47484E2B99F0F5FF9912E135AE09125FCECADED5 [email protected]
690,251,876 *474682C04C8E89E590DC688A738DF985C04846D6 OZ
690,251,877 *474C713FAE252C9BC26FA3C88D06C4B86FF52ECE solemnisers
690,251,878 *474957E871B557820383BCA5C532A1DD63E38443 [email protected]
690,251,879 *4749684963419358B67C7BE5D94DAC442DFD8FA9 SPARKYAW3
690,251,880 *474F85847C6BE76DEF962148F9EAADD9CCCCDD86 [email protected]
690,251,881 *4748086EA10BAFF8535E7C522DFA48B7EDF53EE8 PARIS.OVINGTON
690,251,882 *474A42360D9563F68AC49BC34DE166DF5B8CE0A6 SPICANO
690,251,883 *474AE4E550F9AEFD8E9799218414CF66A60F4D31 PASQUALE.ARRIETA
690,251,884 *4741AB81E09556BFE8708FF852C39558E88B6FB7 splat!!~`~`dq
690,251,885 *4749E3D10E78FA4EE88084BFA050C79656AB8182 PATZIREKOP
690,251,886 *47408B5243BC7543A74A18B09C38972DA69E8C69 PAULCOOK
690,251,887 *474F859308FCA07AC970E51D4E37C5709B075709 peasants?
690,251,888 *47436B9EF9DC2997292D167DD979AAE36607EF57 SSELETAR1
690,251,889 *474739815232D200109538A7DD394A523AE2D87D PESTEDECRISTAL
690,251,890 *474941E646D2C3E12919388EEEFE5EB07EA065BC PETS4SHOW
690,251,891 *474A684550EDF595C6F75019B03932E8AB042E82 STELLACONTROL.
690,251,892 *474800BE9ACCD222BEEB66E16DEF85C2BCDE4527 PIANOBAR(LONGVERSION)
690,251,893 *474B05ECDB1C669DE296AB909573E378E9F2B57E PIERORIEDH
690,251,894 *4743543FC8353D3F7656AA386E37B641B8A03453 PLAWINGCO
690,251,895 *474A21E9C7DA50E3936570CF6C875651E2FC22E8 PMC2121238
690,251,896 *4743500F8DF2A3D19E77325A1416C4BD0CB7473C PoprostuzJezusem
690,251,897 *474FB818208EDCE4D562FC8A4E069291CE11920B porkish8
690,251,898 *47441177E829E2320F184D62B714BDC7A7F34D3C [email protected]
690,251,899 *474E52DA5F96C16A299A7316400ACC6A0E454107 [email protected]
690,251,900 *47489108B34DBB94FC9E5E7CD372704D94BEA0EF SUNANDPLANET
690,251,901 *474F7A8CAC84540BD024893CD63D82FD009D36AD praseodym
690,251,902 *4743889A12AEC2B7795FF3ECC346017FBDC2A73E prelevatas
690,251,903 *474CF8D6A19A15FC5E2C43AE719A21E88FA56257 PRETTYFEET
690,251,904 *4746924B0063F439DCF9DF26CBCEEAB65C8B7612 prokr
690,251,905 *474D21758D89A9F1C9D676A3734B72BC9C732356 PSYKOTERAPEUTIT
690,251,906 *47422D7D8819F2FC52DD2C43D12870AABAB55FAB TALKBERRAC
690,251,907 *474113FC4DE0CADCDFAE2763B0AE3E50CB54BEE7 putut.wijoyo
690,251,908 *474492C14052E7F81528F0C717F0192F4D3CE6D7 P'YR
690,251,909 *4747C7CD1B0BB5E084ABB9726EAD03EBAE19CF54 [email protected]
690,251,910 *474AD51D46B8AA1D2DF5E5625EA3DBF26AD719E2 [email protected]
690,251,911 *4741051C46E3972FE05A612F7C95384373D063EF TATAMARCOPOLO
690,251,912 *474424F7AE2941B8CD175BB63A8500C579FFC9AA qua
690,251,913 *474414187C128729CBE463DB9FEE4B5D39D4E99C TELEMESSAGGIING
690,251,914 *4744459D7DA83C24CD4EA3658F478379A0F4C567 TEMERIGESES
690,251,915 *474F4A7FFED4A0D63957645A5F8F71F073BE88D6 QUOTE4ALL
690,251,916 *4743EE00EB9B3CE209A03E008CF599CE47883CA3 TENISTKA5
690,251,917 *47429332A17551F2FD8F28C09040B3DBE34BD57E QY7G
690,251,918 *474468861D6571A536F0E49C880C9245C2BB1CB9 r3f3ct0r13$
690,251,919 *474EED5BBE12A9483B558F7F9DC0EA5411924FA9 TERRANCE.MACLEAD
690,251,920 *4747596B1344E25AC91BA14E9812F8AEF8EC1BFC TERRENCE.ARNALL
690,251,921 *474E55A7D9210B1643B72814FC107E4D7B8CD7DB TERRENCE.CALVELO
690,251,922 *474A0636EB56D0FE22F128D05598BDBB5996F6E0 RADHIKA.ANGEL
690,251,923 *47415DE77765752D67678AA06F5887D43B712271 RAISKATTU-TULEVAISUUS
690,251,924 *474AD35BC0712918724605AB2DB2512995C442D7 RALPH.KWIATKOWSKI
690,251,925 *4743BD486CCA2CFB674876B1AC7878235FF2F673 RAMNAGARM.B.UTTARANC
690,251,926 *47410B8E5F90CABBE44B5805797BE2765CC01A6E THATGODZILLA84
690,251,927 *4748B7D78A32272B9CFA1F302E4874760EA5D7F2 RANDALL.SALVATIERRA
690,251,928 *4748D0FE463393ADA77EB0080B935CA81ED6C69C THEBASSPLAYER04
690,251,929 *474BCDBDB4C597617FF5C6966C93F39C9EDA6C27 THECALIIPROJEKT
690,251,930 *47470B4C15C8C43C71AAAC16E2CED69FD9F19C0D ratchanon
690,251,931 *474436FD763F5BA4BE72BB4257A5B19BC79A4988 ravi.ghai
690,251,932 *4746FA58E20B237C519BA01913FE9DCF871E7B3B RAYFORDBOYKO
690,251,933 *4741383BD8478941B35B7343C199FA53132097E0 THEMALCOLM61
690,251,934 *474AF41E646D8115F1FCB390D5805C91E39677BF The-Murder-Manifesto
690,251,935 *474C198F0D8218081B61938280DC517865292E13 RBF[
690,251,936 *47486AF6B7E504ED434B14460850321A184B67F4 THEO.BAUZA
690,251,937 *474A64352488CF2649950A44AD211FA77FB8DC09 THEODORE.KUNIYOSHI
690,251,938 *47442FF56861FFA56EF69A8D622464D8C9BF2585 rckwnde8
690,251,939 *47406097B4FD4C56F2C1D4774EADCC24FABDFAA9 RECENMT
690,251,940 *474F1C5A783954DC0DEBE4726BC51D0CBD13BC6A RECHELASCHEPING
690,251,941 *4742465C5D468FDFC40F88C7461A323ADB19F4ED THROMBOLYSIS9
690,251,942 *4748AC0A0B51CD88F83793653AF2FB8779156718 [email protected]
690,251,943 *4743E36B75821B9BE157A63CF586D6630BEA58BA REIDPHILLIES
690,251,944 *4749BA5A85419474876C2A6F4A2D84B81A54F0D2 RELI4N+LY
690,251,945 *474124521376461983772ECF5C397E45FEA00DA6 TIM.PERSAD
690,251,946 *47446C99739B5CD30D829A60664F90C8763EE4E5 TITUS.MARTA
690,251,947 *474CAA0542D46268A9DE3AB2C25A02F57979F14A TJENESTEFOLK9
690,251,948 *4742BD982713E292F6CAAE0545D26B99EA472AAC [email protected]
690,251,949 *474B5968DD50E58166FBDF4BBCD0003BB629FC21 TNEMENNOISUVES
690,251,950 *474592D635D1D9672724B32BFFB9F6060D77FD34 TNOFDTRTSKROWED
690,251,951 *474E7D37CECE7A7C7FFC990F90EDCB80697C82F7 TOCCATA-&-FUGUE-NO-3-IN-A-MINOR
690,251,952 *474EEB2BA10FDB0CAFA72B743FA2D36D68EA98EA REY.DIGNAN
690,251,953 *47483FB24F6CE60C90A22AE5690492B60F8E6C3D RF890301
690,251,954 *474613A7A6AE57402E95C4DF12317614D28D4864 TPEHCSEGREVO
690,251,955 *474E46D794148E16B348F7D4BDC4D340D73D9120 rio-aube
690,251,956 *474E1B3533EF9F71F277D991B0F80FE5A9B036EA [email protected]+IVE1Y
690,251,957 *4748B8367DF912805F85B7E8B4320CA272F2F1DB TRENT-MIKLES
690,251,958 *474ECB46248B945E1BFF691AEA516B053F128E41 robbieminshew
690,251,959 *474C88DBDED4DBD2E3868735D921069D8F563C09 TRIAL-RUNNING
690,251,960 *47435A3F22246CFEC69FFDDEE63F9713963D47E5 ROBERTTECH9
690,251,961 *474A148617A69FAE3E338EE8D31323B48E04F82E ROBIN.MAIL
690,251,962 *4749F5E7554371745D445E1A209E3A4AAC7A7BCC ROCCOSORTINO
690,251,963 *47417E978211D0E973449611B00BF65AE188D14C ROGELIOGRUESER
690,251,964 *4747304CCD2A697021C2BCA08930A317B681E81D ROGERTOOMAN
690,251,965 *4740EDD82E9829D585DA68066000ED0C037B80E2 rojas-mirabal
690,251,966 *4743FADC9D6812D7460967F0F2D3DBD6E02272FC trushal.trada
690,251,967 *4742AB5FBCA2E4F6AB01FC6B2DFE62B7479CEA67 ronaldv.
690,251,968 *4743B61B0E0FD8D49573D09D436201C8312F99DA TTINASTI8
690,251,969 *474F6762F38EC8877DEC6FA70B794FDE0783251E TUANDILISIO
690,251,970 *474177B545D6610546A07D4A4CD06A00420005D2 ROOSEVELT.ALBRITON
690,251,971 *474E03FEFD9E42EC7F63D307D4D027EFFA1E165E TUKMENISTĀNAS
690,251,972 *474ED4A2EE934679967B286D67148FC264D7F783 TULOVEROING
690,251,973 *4745E45FDC8B9E8799AAFE083E29F3EBB30E7022 [email protected]
690,251,974 *47418E1F503451ABE98FA779E87A0B38D18FB9A5 TUPASMUNIEZA
690,251,975 *4745E3CC3BDCB052FDB6E071B45E9D5AFDB2E1C6 ross.gallaher
690,251,976 *4747D614AC5A2EF70B838FCD4A7B063B4BA5DB18 TUZDAY-POLLOCK
690,251,977 *4744D69E0FF46EC8F45398A183008FDC3F795850 ROTORBLATTWERK
690,251,978 *4747A48ECFE3DA957F163F05037838ED25DC6690 Roundabout.(remixed.by.Shingo)
690,251,979 *4747A8CF3D7823685BB4BF81BA0CC686ACDB7792 ROYALEDDENS
690,251,980 *474D77867676A42C1E250F5024AE1B6A4810B5E1 ROYCEHAECKER
690,251,981 *474B0779BBAF97273EBDB1C21BF7670D3F187569 TYLERLOGICAL0
690,251,982 *474F5688318980FBD10EA2BCB4089B1BF304FAEF TYSON.SIFUENTES
690,251,983 *474999890421C7DC16D796299F460D46E4FD3156 [email protected]
690,251,984 *4745DBF5C005FE39A42CE44E93B9222405371C24 RUMPUDDI5
690,251,985 *47427240290977A68324A06352F4292A560FE4AB RUNNINGLY1
690,251,986 *474F40905E3838240DD603777F0B939636B0120F russinoving
690,251,987 *474E1C2AABC94635937686D8856621BEDC68AEEB uitdagers4
690,251,988 *474098026656E865BDD174ED67B27966AD7E66A5 unmetricalness3
690,251,989 *474324EC4E6FFB508BE8F467F62F8A00A3732BFD sanaowe59
690,251,990 *47456B75826A008E16C1A4A7743B1052F599F5D3 SANTOSTENA
690,251,991 *4747F6A8E4ADBDE6BB001750D1CDD11DF4DCCCB0 USER12810010915
690,251,992 *474E03E08D1F9712F84F4DA0F99C47BB4942F7E6 SARAREUCSED
690,251,993 *474DF908F1A9545AD39D3DC5C611BB2F8CA92E9D SASHAALPHA
690,251,994 *474B80608EB91F48CC49356EAF117E10719CCE07 uzzk
690,251,995 *474C90D9884816E100DA820D410CB9E169512612 va0;
690,251,996 *474697D43A07DBB13439D38CECC235DF8263DA8A SCROTECTOMIES1
690,251,997 *474FBB6DD366C176D4F77AFD95E39D3090D310A8 VANGELIG
690,251,998 *4740BAD5EA65B86FE09CE860EF463BA9CA719003 VAPAUTETUILLA
690,251,999 *474B73167F3731B6517E3EAC787F90EB43AA8EA6 VATSALIHASLIIKE
690,252,000 *474939B1133CE862D6565B1F350A4E8DC67AFEDE Selfdestroying
690,252,001 *474DA6F2CB413D0E9EED1B040408624DEA2E5575 VICENTEVILLALPANDO
690,252,002 *474AF83C5AB5A2054B7B03426E8DBB75AF592A73 VICKAL.PRASAD
690,252,003 *4747D569418B9275F121A0ED8FEBBA575C5EC953 sfigurasti
690,252,004 *474F8D1E31CF34A97280675452AABA397CD09C4D shamali9
690,252,005 *474C40F2CA76EB68CC6B7E4CC9E3266065ADF021 VILJANKAUNA
690,252,006 *47416CED2F87CCA0D4612F4A2915CE1AC46D20B5 vincent-c-solis
690,252,007 *474733DE8074D05A8510525E4BA57D7BC19079F6 VINCENZOT
690,252,008 *474A7EE4D8F841DAFC4BB2F9E6464D0D712B1A91 VINISH.D
690,252,009 *474A138AF418D5855A96E61B7F2D6BD0A3532D0C sheila-(radio-edit)
690,252,010 *474EECB512DFDE87838053B78A8305A92F46BECE SHELLYANGELED
690,252,011 *474975E0A0DB2E9F04AC20C0F1CC3E5569DFCB65 [email protected]
690,252,012 *474771BE84A104117990F4839C9E43ED2057D556 [email protected]
690,252,013 *4742BEF02887887ABDFE4A532E900A67BFE6CAE6 VITOLAVIN
690,252,014 *4745C01BD33016D74B6165279C4A74BCCB555AFD VIVIENNE.ALCOCK
690,252,015 *4740E923016C894A251593D9470324B3D5228E62 SHIROKUKODOKU
690,252,016 *4742358F71549819B0262037183B10D90A14253E VLCINEC
690,252,017 *474D16DE26D53DEE1E954DF45A86D244811BB911 voorbedachtelijk6
690,252,018 *474654CDC4817F80606A83D130491BBDB463F46E VROBNMI0
690,252,019 *474AEA0C8D8FDD92AB799F7D2EEAE8691D02CE03 SILVIAORDONEZ
690,252,020 *474DEBFB6A82025B045DE60A90C5A9901F592091 SILYTYSTEHTV
690,252,021 *4740CC738031203231BCA0DF70004B85C1846CBA sincipital8
690,252,022 *474EC9AC1C223AD5A806E90820FE336FD2B68089 SISÄLTÖINEN
690,252,023 *4747363ADF4D053288064A3A8BC89F1787782D67 SISIRIHA
690,252,024 *47462A1F9D1A2E440C5361715877737D2E0C7F42 sitesofhistory
690,252,025 *474ECCCFCF12D36BBE3E6674DA2708607CEBFD35 w8ief0kc
690,252,026 *47457A9026484DA367128E5D8479C79FB7921E46 skip-to-the-new
690,252,027 *4741234697011C09AC29E5D6CBA057716B03766F walespolicenorth
690,252,028 *4747C37FDBF0AAFB418D3EF55128D6FEC69AAD05 WALTER-MONTALBAN
690,252,029 *474739E8C759D859B020653078D749CACC38AA7E SMARTTOYSED
690,252,030 *4740090BDF33AD552C60844611EEF22E6808ED00 SMASHBROSFAN878
690,252,031 *474B93602D920DDB8738205CF97604C6DC0F6648 smmllns1
690,252,032 *474FD22F27E76E2093543EBD7C556EB7D60323CA wattages
690,252,033 *474B82D5DCA6F03C9BCE77F542BA1A1ACF932643 SOFTISHES6
690,252,034 *474301395D545E9540D39AE06C9A4A7878C980FA WEAM-HASSAN
690,252,035 *4740A98B31322CC49ED5CE0FBB56B6F1D04C5224 solomon046
690,252,036 *4749CD241C2E1063397ABAC01FE70CC918907BBC [email protected]
690,252,037 *4749C77D307555333B89F22D298644014BE77491 song.for.clyde
690,252,038 *47416A13F973AED84A2C07F2561FDC0B225BD1CE sonia119
690,252,039 *474D174E4D1A31AD30AB7365ACFB519C2D75BB6D SORBENS2
690,252,040 *474B4EEFAFD83C3D25D3F517F71EBE69205EDCE8 [email protected]
690,252,041 *4741D3B48B01BCC34708195F2FCEBE5B592EE17A SOURCEMASTERHATCH
690,252,042 *474A3371CB65E90E42F298E80F6A6367DE422939 soused
690,252,043 *4748B72821A808916AF415650041BBB0F6F72FEC sov
690,252,044 *474EF2BE8CF9C4E7FD222E7CA6782D54FC38E9E4 SPLAT!!.~.~.(--8
690,252,045 *4741EF8FDCF0F6096070C7F4E6E3E61300B34E97 [email protected]
690,252,046 *474B33981E543AF2406B0191AA4379E881D1EBF9 SQUEEK-(DEKKIE'S-RATS-IN-THE-ATTIC-MIX)
690,252,047 *474BD9ECCAEE49D205F719307735D237EF7CB37D wilfredsuthar
690,252,048 *47465F6A4308331818B83CF21ED46B494680096F SRF'S.P.DD
690,252,049 *4741770FC4A751040C609D5906CCE95C63547526 williebaldwyn
690,252,050 *47436219630F75ADFA37127004679FE75509AD10 willisegersdorf
690,252,051 *474CBBE18694FA1EDDB8ABF6EF032C7FDA75FDE9 WINAJUMAWAN
690,252,052 *474D40838A72A00363F368FA023ED816A94FABB7 STANDDEFIANT
690,252,053 *4746C03EF6B67EEE3D0AFD75F26B2DBEB1FB7263 stantramontano
690,252,054 *474C08AF0A98231D7632EBBC84C88A9B8DB26A5B STARTSPELLEDWITHT
690,252,055 *4740B7B265B8651460B125AD134CCD55BBD9CBB2 steviepultz
690,252,056 *4742D61907FE08C402F684E0F8DBFDD1636FD9A4 [email protected]
690,252,057 *4742F53FA00D18B835BB8CD46BDB8CEEB8CEE60C [email protected]
690,252,058 *47476022872157ACDA71288834844CA750396097 [email protected]
690,252,059 *474FDFBEC302F8075E8C8B8C18B996986B3ADB1F STRIMLIONS1
690,252,060 *474CEBED9702C499EE3E24CCDFF0D7ACB72D1A97 SUBFIXXIFBUS7
690,252,061 *474D5FC96A4B42F8DDE4BF5013DB82A0ACF9D8D1 SUBMATRICESES0
690,252,062 *474B42FA4C2800D5C25147457BBF47BDF8F963A1 {X}.`@====B
690,252,063 *474C51D9218DBC8CD3949C21F5048B34C96827C3 SUEZYEKNOD
690,252,064 *4744F8DE2ECC9E27989B5BA5CEAAE3769463E605 xheaslrptjwwaiz
690,252,065 *474F78E5240ABA477F7E6E55AE6A371F46915A38 [email protected]
690,252,066 *474156F0D285F96AF6AFA2FA8837CB463C167679 [email protected]
690,252,067 *47434F10F6AD674DFAF8C46C611FC9431809C7F2 (x)o~o~<######p
690,252,068 *474B2AB7D214D8AEB68BED97158D716FA61EFBEE suprit-bagga
690,252,069 *47417424562926262E10E7597D499F2D63695707 SURGELOOS
690,252,070 *47411D1415540103DB215539676B914E52EC7C5A [email protected]
690,252,071 *4744C9CE44E5BD5793D9B11835DF7379FEB4BC17 [email protected]
690,252,072 *474C73EDF0BDDA3E7D8017FA09D74BC4C565DA78 SUSDEM.CHOSE
690,252,073 *474CA4C4A94001211F7DB04B25292122FB3D13A6 SUUTTUNEISTA
690,252,074 *474E843B112583AC9576520C829526ECA889DC8B [email protected]
690,252,075 *474FA78658546A8D68DC34EEFE772027F7D43E8D swbp
690,252,076 *474F1A6445ACBACD0CEE96992088215DE07DE17A y7lkftj14wjvxcmsti
690,252,077 *474E28F03D4ABD3223A84B65F7F2F2DD8AEF43E3 syuhe’mun
690,252,078 *4745FC0B97382933D85A344CE8DE7BB3AE1CDED0 [email protected]
690,252,079 *47498E961A59F25F9C5861EB1AA9841E21654335 TALK86.7.25.102
690,252,080 *474A1739B962ECE409D0D32A7BAA5ACC08EBE406 [email protected]
690,252,081 *47460B91198062D982B559A75BBFFF32EDF27ED0 YINGYINGSIRIRANGSI
690,252,082 *4741B6E79F148764106FF7C824805C444760D899 TALKRONOSEN
690,252,083 *474DE3622054BD59E72797BBB6B7C74F068E937F tamanaeani
690,252,084 *4741CA1CAD56F872C1D1821AC30274DD53E27980 TÁVOLLÁTÓK
690,252,085 *474D3FB5FA1B93ADA836EEE1A7AAE9B64D02532F YSVBUEFZCHQ
690,252,086 *474F8EF99ACD9F78A4EADD6BD939932EEBE3135E TEAMTALKDOME
690,252,087 *474F0AF3AAE0AAE83D63299C15F98C977D28150F TEDFRANSON
690,252,088 *474B39F6B73F75A581A80439E94EA83FC7A65983 YUKSEL-SIVA
690,252,089 *4740124C9916C7846C2713A88BDF6D5140C48A1A TEMPLATEUZBEKISTAN_T
690,252,090 *4744C8455A8705756649E43D96349AE8373C6E29 Z107081
690,252,091 *474D1433167CFBC46207B96C6F62B9F4E74546E1 TEQUILAVISION5
690,252,092 *47428A66806B33E8452C44ECCB6CD09F93C334FF ZACHERY.KINTIGH
690,252,093 *4740F68C10C0E67CB7C6A5A5A52030815E59FC20 TETREISI9
690,252,094 *4745C842AAA78658453DC7F8EB851CDA62846C42 ZANE.GRIGLEN
690,252,095 *474F1FE3DFC27CF22E1E569EE42C71E78BE0B6E6 THAIFRIENDFINDERDATINGCOM:
690,252,096 *474B108142BDB31DFACAB1D759983557E3890D7A ŽELUČANI
690,252,097 *474C879E4909FE84C5D575B0B8A72A91516DBDD3 THEACPAORG
690,252,098 *474D939F5741AB4D3BED0CF999EF0A1CE750F1E0 zerklu"ftete
690,252,099 *47466598385F817A4AA81764BE6F0B58F5D46C7C ZGQQYTRA2R8PNVI7
690,252,100 *4744BCBA3DECBCA2653B8F72D84D9189BA3F4085 THE BUMBLING VILLAIN VS. THE DEFECTIVE DETECTIVE
690,252,101 *4744B32500245084873864C5E2C4BAE1F0501E4E The-Descent-of-Man-(feat-Nick-Triani)
690,252,102 *4742422341F6C31DD6030824C511A2F2BECF4CF9 [email protected]
690,252,103 *474C0A7E46313CFF1FC2505B923F8B91752ADF71 themulder11990
690,252,104 *474C73C925419D2E5985F11E597AF81A6D2FA542 thepam86
690,252,105 *474FBEB013A0DF86C2B517E420D0CD982C6EBAEA ZUBAIRA-BINASING
690,252,106 *474D6E0F8402D56DCA8E52DB7D7820CFF380BF7D zul.muhamad
690,252,107 *474E3F9EF79B7B8322FE8FAEBE3271F168659288 [email protected]
690,252,108 *474089A37158F239159566823A198C27B0373F38 TINTINMEOW6
690,252,109 *474D49A230520FCE59ABE6BB5BE591EA933D6416 «ахтияр —
690,252,110 *4740A2F26E84D0523F54A4F20C82AD09925954C8 ЕССЛІНГЕН
690,252,111 *474494DB0EC579D7CB792059A4C6C5AC01D5F730 зоком
690,252,112 *474CA6706CB51F57CD25CF703A63BDF4555BD272 TOKAJT
690,252,113 *474DC786A33B62797A6AF7DDA1E6512E794AC778 TOMMIE.ROLSTAD
690,252,114 *4746EC1FD862974AC48740D1972DEE02B33E310D tomorrow---if-i'm-hungry
690,252,115 *4745AAECBCFBF93A7799EA30125DD0E1A10B513B НЕБЕЛТЪЧНИ
690,252,116 *474A5FF93EED6EBCBA77A616ACB3B6152DC8FE85 TOONBROD
690,252,117 *474FBA0DD76479F677C1D6F22EFC3952197C0BF1 touchiez8
690,252,118 *47400F27F7E4798C969DE6110B5F8E0ADF5D298F TRE.CHRISTOPHER.LAWRENCE.BURT
690,252,119 *474AFD9166F21EC0CD69E6B38E519F42B34B94A6 trey.fish
690,252,120 *474726E8C5A85727E234A03CBF7D389650B3AA4C 日本pta50年の歩みと今後の展望
690,252,121 *47495B7E8E69AB7FED4FA7C106BDB78EA94F8A5F (瑞安建業、SHUI
690,252,122 *474E513B96465F19486DC3CAB3E2250D69BBB795 TUNA MADALINA
690,252,123 *474F1E6CC498F4F8FE6E8AE2E9D471E8905F39B1 TWILALEHNERZ
690,252,124 *4748528A3331A11B7022753C6148BF0BCB87AF12 TWOSTOREY1
690,252,125 *474A93FFF2994857963189DDEB5D78101020839B tylerandrewroderick
690,252,126 *474C6EE3F5CE29089E1EC5448D0A5102A4712DC2 tyrone-searight
690,252,127 *4749AFCFA8F48A09D94C5A7653DF0424F2CBF5AA tyronewhysong
690,252,128 *4749A72375795895767082AEA2B10406B2D87732 U:AG
690,252,129 *474A4C74A3988DDA736984B1C0661246E22BA9F4 021IRELAND
690,252,130 *474BD9B4E6A15ECAB3D9DDFDC55137B0C096606E UDERICA
690,252,131 *4745F0D926A34B2A5B08D6E5971CD4686BA169A8 UDISSANU8
690,252,132 *474DCC2460B8630D6127031D25AEAF40314342DE [email protected]
690,252,133 *474A6C9EFDCCA5549B46F7AF5A0DADE342ABE786 UKE0
690,252,134 *4740075BE4C4472920952D4D43D283073952EA8B 0iloveobiwan9
690,252,135 *474486545E6A42C7DFE22BF0E6C0410E7110E616 UNGEWONNEN
690,252,136 *474CF8FAEF10FCC6EF49AEA27632D2A82EDEB66F universidad.anahuac.xalapa
690,252,137 *474AF00E016D6CD9F48751DB1EDECD5C8DEAA808 1027 weqx: eqxclusives, volume 1
690,252,138 *4744CA49EE52107BF88B90C0D68FB8B1E84B2388 102.stadteinwaerts
690,252,139 *4748689AD8FCE76C4321D626DC6CCEC92D5C2CD0 10 MEISTERBRIEFE
690,252,140 *474ECAAEC3D6BAEF5ED75DDCF66FF57D14C8C846 unserabschied
690,252,141 *474552241FD22BDB16845692B60346FD62345018 UNTRINILI
690,252,142 *4747F7BD9B7471A3BD09EDD6C2A1648E7D0D0C61 115HARRY
690,252,143 *4743C1A32E307236CD32CAAD9B0BBCFD4AD65F96 12snellmanian
690,252,144 *4743CDDB561BA6A1091E4A594A16DC6019C15EFA [email protected]
690,252,145 *474B8BDD19B8D7918421112BE9516122BCA0FF52 13.12.1630
690,252,146 *474446B6DF44B331ABAFA391277BA0D21ED970F6 usmanstahir
690,252,147 *47479F0437CF17755DC5BA324F894F029D2DC962 159GILLIAN
690,252,148 *474D346B20B16831849C751C20D07490458C06C8 UUO~0~.Q--P
690,252,149 *4743CEBD57792859D0921CADE48FAC0BD4B6FF9D 1633108 luokkia on kaksi luokan 1 j
690,252,150 *474081F058BB78D3BC87DADB43957E6E14023FAC uvonakedicra
690,252,151 *47457AC155379D466472FAF30AE780F2B1B96768 [email protected]
690,252,152 *474D3BE3B363C3D3A15F6F2CA98914FAD2C8F6ED 17-02-1401
690,252,153 *474769F667C9665A012B228CC084CB8880ED3FF9 V^4{
690,252,154 *474945AF87FB15787D75035EE27F0C6B4DEC9441 v7sg
690,252,155 *4748E22032D8A8BC6F332DA3A97AEA025A919A41 18JUNE1991
690,252,156 *474D9AF180F4035FAB25CDF0F0FCE519F81E989B 1977-04-09:-live-usa:-the-roxy,-los-angeles,-ca,-usa
690,252,157 *474A4AA934CA25335A0141D46B7014EA09689B6A 1ALMUNTAS
690,252,158 *474ACAAC373533CD1640885F121BD4CA50FAA55A VALZANIBONI
690,252,159 *47424915E19758AAADEF9655AD13ED610974E009 1ANTAMALL
690,252,160 *474CAFFBD975BC05F2EFCE2B5013938C22196EDA VANESSAUNIQUE
690,252,161 *47453EE01E9F68CCD186FBA60308CD7645673A27 1.DTAVORSITZENDER
690,252,162 *47443EAE0C86E808685C9E8F16DECEEB10E0CEBF 1.EIAGGRESSIIVISESTI
690,252,163 *4744EA650A6BCB047335BDC5E3AB27D3DDD5B14E 1-feiringin
690,252,164 *47473C052F302A8A86C66DD6E27337B080B0504E VENIZA DAYAWAN
690,252,165 *474B9AB7F3CB610629A4BD1CFA2E81594D6FA7CB ventiltrieben
690,252,166 *474ADEA50C72009893424D1E6D0662A2C3C818D4 vernonruby
690,252,167 *474CDA8F170937268556F9C37F4BFBA6603F87F1 1-KARDESINIZLE
690,252,168 *4749A66FE8406EB4CEB3E85CBC7166854D50CB12 vertroetelden7
690,252,169 *474B38AB3FBDF3F8C47FDDEC55BA374842DFA78F 1-mansion-with
690,252,170 *4748529CC664A727AFD6A8D7FDBF782C3370882A 1nagekomenen
690,252,171 *474BCFC74D8C24CC6878C783F8EC24BA9F7D985D 1.nurmentausta
690,252,172 *474DA0F04F17DB4C3DE968A71257327875739515 1 OIKEUSTURVALLE
690,252,173 *474F4A6315521071F7E84CC17E5C7064307B41CC vikky.chaudhary
690,252,174 *4748DEF3E2026B1877CAF6D6FE3292FF7C1B2397 1PROWFISHES
690,252,175 *4743BB81DE447E2AEB3F760AC11FEDB0275FDAD5 1 RAJAT
690,252,176 *474FF97ECB02E18B47AFDFD72CBA9BE3AC41E620 1.REMPELNDEN
690,252,177 *474C14CA0CCFFC62E565D791890427683CD6FCC6 1revitalisierungsvorschlaege
690,252,178 *474CEEEE3F5773426E9A6DE2ACC99AE830AEFF3F 1.SIEDETT
690,252,179 *47406A2AC5B47FFA1B50E035E4BD47C696A31CB2 1.stimmenanzahl
690,252,180 *474F9737E166D5151985F8B1DE7AE4979901410B vLaaa
690,252,181 *474148E7FEE08C9404C9CAD03C3345E7F3B69685 1-URWALDFLUESSE
690,252,182 *4742A2613BBE2EC6312B2AA241A69D31313AEDE3 VONDA GJERTSEN
690,252,183 *474478B4642A4C8A8DC5C2D01D8DEA71AD713553 [email protected]
690,252,184 *4746B966CF2F69ABDF52302779393204F2E154E0 vqz4
690,252,185 *474B9C4D1C71544DB5793E2932525BF99955AA41 2024088 SOILA-TUOTTEET-OVAT-MARGARIINEJA-JA-RUOKA
690,252,186 *474747CACF16F36BAC087534B3A02F45F9F2EC5E [email protected]
690,252,187 *4743BC3B83CAD80906079B6FDAC49FB05C68AE24 20BESANT
690,252,188 *474C060D90E4DE0A0990698549EBA02B5C010737 25071247
690,252,189 *474340D2439D23ABF572E9B9B86F0AD636FE5996 25 VAURIOITUNEITA
690,252,190 *474BF3A1901CE00F58F0898D4F4388866F983EA6 [email protected]
690,252,191 *47407F3441D3F5DAC496D65736E96F088F43CBF3 WANG QIAOJIE
690,252,192 *474A551BD300250416DEAAB6269303154A2E2D71 2699378 lehmann bot in der partie mehrere paraden
690,252,193 *47469696D309543AE8A9D82FB2125B6B56E2BE56 WARCRAFTMARY2
690,252,194 *47487EE9715C34F075E14C46ED6DF180343FA68E WARISSARALEEPRAKOBBOON
690,252,195 *47449F3F87573383180C3D034DB85F98A7C4FC2A WARNER.ESHLERMAN
690,252,196 *47473A240661F1A434BD44552B2D66B90DE16655 2965035 FUERDIEHAUSBEWOHNERKAMDERRAUSWURFUEBERRASCHEND
690,252,197 *474CA8095FD0844462E2447E32AB3E04B0ACBFE1 wattages
690,252,198 *474347988882F728E347E666425D1003D04239D4 WAYS.BIR
690,252,199 *4745B78E27D9074A3CF30F9001FBE4EDF2D394F2 2 ANCKOLLEGEN
690,252,200 *47442EBDF78631D2DA186E25C5107EDC16B66A27 WENDYSKIDS
690,252,201 *474DC34168D2F4D2F581FD668ABFB83B8D31B936 2MISONIKO
690,252,202 *474712D7F253D1A013DFB6382166BE86AAA7A397 2 NUORUUTENNE
690,252,203 *474E127D4072A2CE887A47813971626BD0C0D770 2 PANKKIREFERENSSIN
690,252,204 *4749241C5834CB8D50D46B90839E46246A941DC5 2.porzellan-puppe
690,252,205 *47423A089A3BDE3B6403FBF38B90AC04406646F5 2REDDEDILMESIDIR
690,252,206 *474AAC342B056F320C2097494143289F077B503F WESTLEY.CASE.HINDER
690,252,207 *4740DD86D71A0DED2068901B15AD07C8FDB41663 2 turvallisuustarkastusyksikk
690,252,208 *47480AE1017329602A33C77B0F85F5A23CD001A2 whatthebuzzardtoldsuzanne
690,252,209 *47459F40D2D56987F334BEEC5398C96CCCDDEF54 Whinchacker
690,252,210 *47402D407648FF11A89ECE857ABC48295E6A27C1 wilburnbrito
690,252,211 *47474D832BD7449FBFB8FF346ADA8CD4C9256EFF 3AFFIGSTES
690,252,212 *474B50B3B95D7DF35F23578E97B0FC1D76F72492 3-ANCIA
690,252,213 *474FB43DE322FF46CEA7455D690D2E93D04FD8DB WILLIAM.B.MURRAY
690,252,214 *474F5C33894C7D6A1AF924F18209C7D241477A3F WILLIAMLINDBLAD
690,252,215 *474C79C3882CD0DC14BF4C3ACCDBBAB47A7C2125 3dec1386
690,252,216 *474DFBBACFC86DB566B1D4E2398F13EAE28572E4 windellbryant
690,252,217 *4748DC85B607D3587FAAEF69060B8781E135CB61 WIRTSCHAFTSAUFSEHER
690,252,218 *474034693DAED6B22F69A2B3DA5DE3AF901E961D 3.musiikkipuolella
690,252,219 *474822761DB9BA66D4D0066166FE0F6741DA73C4 3myprint8
690,252,220 *4747F5D77FC186FAB9A12CE10B1C2E88CC76090D 3shay
690,252,221 *474392A3F49B7BA8C5676E8952586DE9B3AEA18B 430343 ( kemal ataturk ) harfleri islenmistir
690,252,222 *4743B806C194EB64AED15B7CCBF2215B9B4AC3C4 WURZELKAPPE
690,252,223 *4747DF01CC5F1D4B6C474010B8DD2BF22AD17467 [email protected]
690,252,224 *4742EF147B0C145485EA023F90CE32089D959512 439935 GUZELPERISONRADANLOTOSAGACINADONUSTURULDU
690,252,225 *4740D07719FCC4DC6B5F5C87D419ABFC9AF5118A [email protected]
690,252,226 *4746AF6296913FBC31366693618F298B891CBD2B 459081 kustakinseuraavastalapsestamaksuon20%ensimm
690,252,227 *4746DF32681BF4CC497C70584CA35841C2C03E9E 477MADELYNN
690,252,228 *474EE058C3A57C31B1EEDBDB609F536BEF752F24 WWWNEWPORTRESTORATI
690,252,229 *47433CE102E3738CAB702A758C0C93CCCCE72833 WWWVACCINESCOUK
690,252,230 *47434709C34118F48099E6A88510D311A2B36865 WYBORCY6
690,252,231 *47496B59C92E8F0509F5034753B7A02E45E5AEAF 4LLRYTATN
690,252,232 *474474D32E6FCFEAB4B04A086EF8065C9513904F 4MALLIGNIT
690,252,233 *474B4AA3CF6C80AE5291FD7159D94BA8595F583E 4MIAH
690,252,234 *47440B391E055DD4104A09892C923A938C56274B XINWEI LONG
690,252,235 *474E1D2C59CC125B13DAC71E3DC803333CCC8502 4NNEREMMO
690,252,236 *47451F7DF391CEA56329E53305C337327B647538 4ODMIJNEN
690,252,237 *4747F2740EA73DC8A8BA121045B6A6BAFF64B7AE }x{ o~ o~ <####b
690,252,238 *474B6AA004633C0A6BEE61AF900514F02F24B0E2 4PIPRAVENMI
690,252,239 *4748778D40F054FAD2F384DEA8E2D3F9747EF0F7 4POETIZZA
690,252,240 *47402071098386AD549E85AADAF191AD34A33897 [email protected]
690,252,241 *47470A72A2706ABD0765D2DB8BC93F5134C03C8C 4RNESTOLENES
690,252,242 *4748AC1AF628A81B7987813DBE7A7D1F31662689 [email protected]
690,252,243 *474191895A799C6B25A4878F961B730AD75500FB 4STOWRES
690,252,244 *474D71712994F136C8E529CC261DCA3E5BB4AB36 y7a7oo393klymxgq
690,252,245 *474D31885438E44ADA25AD6ADBD0D14FC5354856 4萬9千BBY
690,252,246 *47490259DDA63AA4E96740B0BBC3E2711E2B94B6 557blake
690,252,247 *474635CF8E8E6C65F6BA2894ED581774D624E5C9 5AKTAMENE
690,252,248 *4740E161E788F6C2DCFBFDFB79DD303D18137124 5ALUMINIJEVE
690,252,249 *474EB66F39512E742AB4B4D8B11F9248686B6A13 yhanyhanalcayde
690,252,250 *474B5A6591944F33C4C2B1B126DFBB1FF5BBAA62 [email protected]
690,252,251 *474CB8C65866810B2788536388EA3B8697D1CCC7 5CONNECTIONSBFONTCENTERH
690,252,252 *474872814DB2F7DAF3443CF5F3590514512EB7DE YLSSELWORROS0
690,252,253 *474EA726D323A42C5EFFD15046079DEB91F62518 [email protected]
690,252,254 *474725CD61F16612BDBE7414FFBF25524C909A66 5ENOISUFFID
690,252,255 *474B6A08EEF03073A5A15F3C59E63D6E5483A033 5EREDSKAP
690,252,256 *474782154376FC57063574064335F7BED166D4E9 5GENIEEINEG
690,252,257 *474B032D380499968FD94712AF365AD4DA43D354 YOUNGBREACH
690,252,258 *4746FE9C006CABF23FE8D4D5A54BF32B7688C4CC 5ilovejedi4
690,252,259 *47411692A7CC1587F61876E40538AD6B06C19AA9 ytqymjhizja
690,252,260 *4740FEE33859009F2CCD10473C372B9EEDBF7BF2 5NOISNOPSER
690,252,261 *4741F6EDADE23906FAFE457D2E9CC7F615DD32CB YUXINGKANG
690,252,262 *474E5268893EF316C1C1FFE6FACE2A194D4C17A7 yvonneyieri
690,252,263 *4748B43266733DF8A82B084F6561E1F4C0B013A2 5TERDROF
690,252,264 *47455E5FA9F819CEB30B95FA216E770C94085F7B ZANE.BRANSCOME
690,252,265 *47462FC2D6046F7058056D1822003279E50C0D38 ZANEMCNAYR
690,252,266 *474B3204443A46921CDF64A07A30ED88300E694E ZAPXDIQTGG3
690,252,267 *4740ECA5470778FC1C8A0A32B6F471CE7036DB0E ZARBUTINA
690,252,268 *47474F109CCBAC84C8E0B0EA5D8FF3A6E31777F4 ZAROFORDULOBA5
690,252,269 *474BB9365FE83F5ED920151F306884D6009D754D 5WONDERINGATHIM
690,252,270 *47456BCABC3D8148F17BB186D2785DC15E68D98F 6ACTIVEMARIO
690,252,271 *47467C758A20EEED37FCEE7C94F975288216C5AF 6ALPINEFREEDOM
690,252,272 *474A6FF11AC321190624AA39549458CD106D8693 6ARTHAAVAKHILAU
690,252,273 *4749BFF8323201C645318B48B32B96D78A3CB36F 6ASSSHITHOLE
690,252,274 *4746250060C4BBCC5859516A9B7CFD1A99D62516 6BSWLATIRAMABSW
690,252,275 *474D6356CC07181A488A68C501F14425E9C822D1 6CAMUSES
690,252,276 *474E236298EE0B8D74871AF10057EE123C1D6767 6EKEI7FK
690,252,277 *474BB9680888551D4F748F877EFA0C21A71B2846 zollkriminalamtes
690,252,278 *474B67E5C8E3785DAA9EE7A41A19AE655A899D12 6LISAELAITTEIDEN
690,252,279 *474A62B23C7B5B30C5DFC31EA85EE1B74CE1178E ZURSULING
690,252,280 *4743AE41664E600DA9620119BB3982A850C49F2A 6pehlevi
690,252,281 *4745A836F47B0BF65C0D0DC044156D7F5F26B6BA ντεληγιάννης
690,252,282 *4741FA419CAD71DF1339CCED90B823C9F93AC328 6SUSANBAMBOO
690,252,283 *47469384ECDE1CFBDEEFA712B10A19F739BD4096 АЛАБУКИНСКАЯ
690,252,284 *47427024497C2422343432D5D58FBFCF5F1D300E 715SANIYA
690,252,285 *47463FCA5CD8095E8B6242F43B848BFEA79274C8 765STANLEY
690,252,286 *474DEE191BA4FBA52FB9E103EAD44277067707B2 7ACIDUALC
690,252,287 *474529B74991B3041D36928EF47F87DB3362EE82 7ALEXCHELSEA
690,252,288 *4746ECF2136403779232665EBEA4B68078A0524C 7AMBROIS
690,252,289 *474CEB23A6BC8530D554085BBF4654E2B0DD05E1 7.BLOTCHED
690,252,290 *4749A752A7B2205D1B60B0B4ECF14B4AF6965751 7CAMPINGWINDSURF
690,252,291 *474DD561C1AF59A5E61930A6E81959E4C0C778CE 7CARDINALCEDIC
690,252,292 *4745CD0644566FF0F998FC913204E772FF80A4C3 МОГИЛЕВИЧ —
690,252,293 *474CA89A39B7D0C6C60E6A4FC995198C6DB36D48 7COONTRY
690,252,294 *4742F60C43ED94FA958338E2DCAC5918B91E76A0 «порятунок
690,252,295 *4747DC329160C392AAFFFC67A97CB43073E04B63 7MUKAROVSKY
690,252,296 *474FBFCE786828E9BDE99FFDBAA113B3AA32F8D2 7MYTASHA7
690,252,297 *4749FFE673045F49845D55305459AB7930095F21 նազու
690,252,298 *474224E53335E5C140DE695A021FD1C256F69BF9  рибопьера
690,252,299 *4747DB3AAE80FC166B6665BEAE21E1841FAE3CA4 [email protected]@lly
690,252,300 *474AD2B602BD5EB789006655A169941EC40BE902 7-TANPINAR'IN
690,252,301 *474A3A89A599BEDBB0F31F6EF92C4AE5EC8F0020 7THEGNOMESOFZURICH
690,252,302 *474826338512E9E03C6D70DB3911E972FCBCAAD5 7TOINTEGRATEINTERFERE
690,252,303 *474000B8661A65ED2211931F64C3BD4EA65744F9 82399
690,252,304 *4747AA6684657EBB1F5893E76E63CDA61FD95C9E 89382 YHDEN.YHTEN
690,252,305 *474B55B76C77A31AFD06B00E5F8FD81EA06A0EBE 8ANTHROPODE
690,252,306 *474F8735D8C57B6F89D0672942B8A5D47B9D122A 8--B-*-*splat
690,252,307 *474AC3588AF74825C94B56B711DE7D5D56A12281 8BSWCONNECTORIZEDBSW
690,252,308 *4748736E0CC8D6842943669ADFFC1AAE44549067 8COMMANDSARETRACED
690,252,309 *474A94DDA5792D30D819A1F5C9C0E5674921C06F 8CRACKERORANGE
690,252,310 *47486B4502D9E1B2004735C527D66884CCD86824 8DOCSURTO
690,252,311 *47415AC7E0E50B1F8B432E7771E764E42511DB86 8EHRHARTA
690,252,312 *4741129BBB4577449E9505CF0DD399991718705C 8MIMEOGRAFATE
690,252,313 *474362303C6DB2804DA7C2740C19DDB1FCE51871 8-----P-*-*-*-~0~O(X)
690,252,314 *4741F06867CDE8D23B0C9E8FE7ED6F684CE3EB61 8-----P**SPLAT!!
690,252,315 *4749297A250771E9B7B4BBC4081910C12D8C13DD 095zachery
690,252,316 *474C4D4C3E1B21D53D17FDC85056981A7EF23EF2 )0(-*Q######P
690,252,317 *474AB449E84CBBED2D29A0884A18E2270061C0EF 10pys
690,252,318 *4747146003D87BBDB6F52DCE0BAAED9BCD371C65 12.30.1690
690,252,319 *474F44D3551ECFBCB3D7616F699C4CAA637BDBA0 9ADIECTUMQUE
690,252,320 *474ACE94F181380AD8C7EA69C897DF1AF6A2AB3D 9ALIENSCOWBOYS
690,252,321 *474D9F33A671336E6A938BEAAECD7576391E8A37 12861Q2W
690,252,322 *474BBE24A72A7581BE1637C3388078DA733BE164 12MUITTA
690,252,323 *474FFA2697951D77AB12F07FE04B6EC8F35A3702 12-pentti-tuomisto
690,252,324 *474EEAA947DF823108A97CC6BD857A876F3FA477 [email protected]
690,252,325 *47468BE8175FC95B4346AE8CCDD97F10CF4E5658 9CAMMUSOBSW
690,252,326 *4748FB7201CD2851A42B2E6A1299CC0851A8237D 1502271 VASTAUS.:.SELVIT
690,252,327 *474FB7E98AD074FD39510134CED774D56239ADA2 1514723 KOTIESSEEN.KIRJOITTAMISESTA.VOI.KYSY
690,252,328 *47408D149F1D981D386EFA54086EBCB2CE1D373C 1560TIH
690,252,329 *4741F91A3A650EE49CFC82FD9C3D085721B78E5E 15987D
690,252,330 *47476BB6A571592DD7D947A2D77E93E29B19ECDD 9gemotregend
690,252,331 *474E2BF0C5F0C75BC1C38971B4C20E36D452E0DF 9HSKSAMUSD
690,252,332 *4746DE938D2ECDBC22EA7994945ADBB1B6EB1246 1889701 sorokin:deutschlandundrusslandsindzweiliebende.
690,252,333 *47411B75589B7837D5F1FDBA57BFB8B4DD89F8AD 9KONZERNABSCHLU
690,252,334 *47469C425856F3DCD05D93BB9954EB912F09DDBC 1952FOUR CHRISMAS MOTETS2QUEM VIDISTIS PASTORES DICITE
690,252,335 *474EDCB49F1272729B652EEC9021BE6CF95DC104 9RETAWREDLOP
690,252,336 *474347A86A46FFACE6FDD980E9504B7C6F187BEE 9TAITTUVA
690,252,337 *474F3953170ABF86E11E51906D459E5B9569957C 1-erosivatko
690,252,338 *4742946DE881DE4ECE166CADC7EBCF46213712ED 1.EURO-CO
690,252,339 *474A77B2CC04E90F51599E4233799E4669A1ABD4 1-facom's
690,252,340 *474BEAAD7F1EB3E2D00E21C5D4417D5253462C9F 1FSPROCES
690,252,341 *474EB4FEB5106CAE35E5BFB11186E5C67D30D166 1 hardcore-viikinkej
690,252,342 *474645EB7CD7728C90BC6AB93D9C02688C0DA4B2 1.HARTGELDDIEBE
690,252,343 *474BDD658B3D1928852B66C31AA83C9AE56C1030 1hoffschildt
690,252,344 *47482D797D26D1555B8D586682F4D84C80D6BBBA 1jirschi
690,252,345 *47405F36B707820D6C1EBB2937BEF263FF9D643E a1g8s
690,252,346 *47450AF92381F8924CB24AC5B5ABA2F2CA61856B a_:4
690,252,347 *4743B82E3B9D5D088775D4435C71833669ECB447 1N$EM1NA70R$
690,252,348 *47459B0967E6DB3D9EB71D9A18FDED0EC1F5B1B8 a6ze#
690,252,349 *474CC795104A7F00C204630F62EB4BFAC81DAB9F a7p#n
690,252,350 *474BCFA0232F93EB7E3744F5F1F60C26709705CA 1.PAHLPLATZ
690,252,351 *474220F32E2B977D0FAB17FC2E82D62A4CF08770 1.thermal-anwendungen
690,252,352 *47408A4A1A14C99D69B625AEF70551876D3C2F54 1-TITANHERSTELLER
690,252,353 *474EA11D83800C130E13F69C9D2B5006F8E2C540 1.yhteyshenkil
690,252,354 *474F3307938A0B573F642C88C64CE8C97320EB98 2258408 VAPAAEHTOISILLE-TY
690,252,355 *4749492608049DAF2FF1567FF50C66B18CEB2664 23572 MOTSAPLASTIKSAN
690,252,356 *47446DB7303D0FBBB0398136449482426A6BD8FF 256609 turvallisuutta ei lis
690,252,357 *4745195FDDF7D33653B1B941C0EA36A157D7B596 256955 ADRES:BEBEKMAH
690,252,358 *4747A4F8305A99B5890FE05082443AF74DFBACC2 aba&/
690,252,359 *474E4BEF05F29AB175FAD1EB4872B427B4B333C0 ABDULCOSANO
690,252,360 *474242BE7639FB6D5A662E219D6A7C06E52BA426 2733594 VUOSITTAIN JUHAN OHJELMA N
690,252,361 *474B7ADC5153B1615AB0683745C1AA8A8C2DA75E ABDUL.TWOREK
690,252,362 *4742051766200A15959BA8D3F2D3ADCBE7ED2B50 27RULON
690,252,363 *4746F22866688AEC63AB8B4E09CA67C1DEF4E79A 284408 magara-bugun-bile-devlet-kayitlarinda-yer-almiyor-.
690,252,364 *4742FA8F453129BA3B89FB6519E55EF89543BF4C abhisamshlishhya
690,252,365 *47414BF893A8FF512AB33482464CF3C5C9CC7C5A AB>KC
690,252,366 *47442B0422D39E4AE745BCCF5FE5E78CC99B9113 [email protected]
690,252,367 *4745BBDA31B800A09CE4B88190A32DA97EA614B5 2BIGWELLS
690,252,368 *4742E52F5AF76F80F91902301A1FBD85415E280C 2D3D3997-79A7-3487-9282-05B0ABE92D4C
690,252,369 *474E591101219B937CD886EFFFC8E6391E06BBD8 ABTACULAR4
690,252,370 *474DB0C5BD384D367B518DF4F2EC00EE5FF18C72 ABTINF:
690,252,371 *474AA81127DB53DEBBA339F5567A4E9686BB21F6 abuya
690,252,372 *474C4A3E7677D31565B6DC2D193BE7D9F5024D70 ACORDEX4
690,252,373 *474825DD191E7C2C5548381C51AD6AF268594741 2.ostprodukte-messe
690,252,374 *4749F14CFACD098D7F9BC7B159CF98FA6BD7F3AB Act-One:-La-tua-ventura-ci-rassicura
690,252,375 *474D02857E4F7B76D1E264D27C39E947AFE987DA 2SOCKELBELASTUNG
690,252,376 *47401CE901F90DF076A4DD71E95D91465847939E A:D2E
690,252,377 *474FFB938FF7F7C9EF70D874E3889313938F5C34 ADAM.WARDHAUGH
690,252,378 *4744A8838241EE6FE06E676270870C72473919C8 ADEAT
690,252,379 *4743C07DA4551228D093EBF150EB83B6A3DEA90C 3aauditor
690,252,380 *474C55D8AB56E11E7865613CBD737409871CBBB6 3===b-~0-(0-0)
690,252,381 *4748C0FA511148BB1ECAA9D7E01D0B7BF5BA54CC adrtd
690,252,382 *47489BF92B49132CCA62AA2FDB88BA723050EA37 3B<--*-*-Q-P
690,252,383 *4747E58DC820EE68870BCCEFB0A862750F379EE9 3CIPDPSR
690,252,384 *474D6DC8973BF156EB417C8EA0AAF8C1C141830E 3DENBRABER
690,252,385 *47439074C3152CB0347E33C82FED302814EB4216 AEMT139
690,252,386 *474947B9274335DD90420EA212EC49E6ADCF5E51 3HIIPSES
690,252,387 *474BABA502C67E2B86B31FEF8F63D14058FED857 affluai0
690,252,388 *474EB4B5D215C7C6DAB446EB1DF61C3AF1C4970A 3POPUCAJU
690,252,389 *474049D19E97A4E5F3A67D0F2A52A133005CDA8D AFTREKKER5
690,252,390 *474688F62832B18AD147B452994B24F9710EB1E4 AHAH0
690,252,391 *474654039EE509D80CC69BE8033E326DCD0A2889 AHMEDSALLS
690,252,392 *474002846431F01E7C3059733C97B0D0BC239A5E 4CASSILDA
690,252,393 *474529B19C694ECB8FFAECE7AAB9737FF0174930 4OFFICEMONTANA
690,252,394 *4742ADF05C008481B60011B8EDE7849403DBCD44 4Q318
690,252,395 *474EEEB1CDC5A118AA7B4762F1775D0F6325AAD3 ALANAF
690,252,396 *474249D5F9E481143675AFD33981A8B7BCB063BB 53C+ION41
690,252,397 *474BCCB1A3555D4DCF5BF55D2BFC350BE65383D8 566KAMDEN
690,252,398 *474F23330D4172190B2487626DC9E12B796F2B32 569941 DELFIN.BASKETIIN.OSALLISTUVILLA.ON.OTTELUIHIN.VAPAA.P
690,252,399 *474264FBFB6D94D3C3BC7E817CDE0787A5C3540D alfredomccree
690,252,400 *4741CA2D2CD5BFC42CE6033209B0582E860736BA 5BSWBARKSDALE
690,252,401 *474E566A1B1FA3BADC27462BC47CF097201E47F2 allumetière
690,252,402 *4742B1EB64262BCA7F10671BBEFD2EFE57EB90FC 5IITSELAP
690,252,403 *474AAD903D3AEA44EBEACCBEAC9B7807093A721E ALYSON WATKINS
690,252,404 *474D677BFEB3BD7C40FD510F2503C84FEDD2AEEF AMADOJAVARONE
690,252,405 *47474BD3E7F5173BF173429CC70169026D3897D5 AMANDA.MARKARIAN
690,252,406 *47485543483B6FEAD4737A8323BA4F89AB87B854 5.MOREACTIVE
690,252,407 *474896D0A1BA0DC8F9AF83AC5E94D74A14BDE1C1 [email protected]
690,252,408 *47404ABB31DAC839AFB06A5BC496AA6E43E9ED46 AMYLEE05
690,252,409 *474DD196211416F2D04255305B7ED6133CA601AF 5tanagrabeeldje
690,252,410 *47486B42C7D412E279B6C643A27B0B6E65715221 AN9S4
690,252,411 *4741851BA498452FC0B27793568C2498D3ADAF90 ANAYA135
690,252,412 *474C2211D4AEB065D40C7AB555A6F0C165EEDE3C 642-elimist
690,252,413 *474666D4C1D8C4FCA4230D7DC01C93EDFCF6FA11 Angel.(Ladadi.OHeyo).(Awex.mix)
690,252,414 *47442656E08E7707C176F446717EA01E7028D59D 6AUTOBAHNANSCH
690,252,415 *47409A6CDCFB3F50AF3C7E82C49CD1B8FCAD4791 6BSWCHELSIEBSW
690,252,416 *4743747B4F0DCB3F143182ABD00D21A542FCB286 6BSWOPPOSABLBSW
690,252,417 *47446E05F3192D82ADCB3A9336D9B1E0EB154B50 6DENISECOMPUTER
690,252,418 *474939A18374ABC6EB7613FB10AB51C6FE427022 annahomer4
690,252,419 *474C8475C1FE43BD752CBE1F2AF361E172F8C1EC ANNETTESPARKS
690,252,420 *474568852A9DDC778320621FEF4AA9BBD06D7A8D ANNOBONESISKA
690,252,421 *474BE23B4BBFE5791EED339CFD11977B4C9AC506 6KINDESWOHLBSW
690,252,422 *4744D7CC19F67FDC0585791E1F6568A8EDC2A888 ANTONYPOSTHUMA
690,252,423 *474591208B21FA0BBCB31D87317C073686671211 6mytamara1
690,252,424 *47467997E7E87367EEEEEDAE78A351819D459BBA APPR0NT3RA
690,252,425 *4747ED648FB1C619CFBD506293FD86A8BFAF0242 6TIAYAPER
690,252,426 *474D8667685406C3A82DABD8AF189530DCD47422 aqnf0
690,252,427 *47407C99BD865E32959301AB616CD885CCA00336 argentinianneo139
690,252,428 *4741D99E71EB011529818A5070C1318625A12C66 arkarianz
690,252,429 *474009207228902D25C32D38EB8A038FE1C095FD arliefroid
690,252,430 *47473193BF58D4469FD97E9E4A85F34AD7726A2E 7DISHONNOUR
690,252,431 *474305121AAE99C6879C05DE6F74F9A326575860 ARMAND.CHOCKLEY
690,252,432 *47433F1D23791BA365C65B18355EA49709DA3E9E armandhulse
690,252,433 *474A758D4FE296DF57E27E35BF64A8F14D4D6EFF 7FILMERIEZS
690,252,434 *4742A9B25FA202BA1E2A55D971840A69A63ADF3D arnulfomaffit
690,252,435 *474287DF116AA2A1C59E456E8449C17D511DA0AC arronnatewa
690,252,436 *4747B32F899D1F79914E67912A7BD38CC8722020 7JAN1225
690,252,437 *474440458D360B3636E5656F84B92E4BD65BFB71 ARTICLESUEZ
690,252,438 *4740DDD88A11CF02EC8A224CCD20ED2FCB9CE622 artprehn
690,252,439 *4745440F0CE2BF2F35494D6950CA8631FF10567B AS8QR
690,252,440 *474E270DE8FAB02FDAA9F73C4D2C0B0C01EF56B8 askenion3
690,252,441 *474FC1A0E1A332E8665710D8ED936A6EB6BD3178 7RIVIVIFICARE
690,252,442 *474DBCC5148E9B89B8DCBF0383A94E0B52623457 a,spf
690,252,443 *474C12E4F54CEA4CDB8E83A0B16728D479AED399 7SCADEVA
690,252,444 *47417B4C6C1663B101543506B1AC606BCB88B6D6 7SMANIOSE
690,252,445 *47493E8EC904D2436A3198A81870F0FC5989FD7D 7VANILLAINTEL
690,252,446 *4749EEDE733B6AE9EB81ADF30E63CD136199760C 7YROTOMOS
690,252,447 *474C4F795C1AE46ACA9623145829BAA255C4F2FA 883881 STOLLER-,-J-.-K-.-1988-.
690,252,448 *4743C1F224AD9D8901FE048715139A9A818FFB85 [email protected]
690,252,449 *4740025F1A6A3C5185CFF04ECFBE072B352A1E01 8BULLSNAKEN
690,252,450 *47414DC439B2E12065B5427831BA5BDB8EA93771 8c8058a199603677686e303bf70c4857-gamepro
690,252,451 *474444F79E23D37EA5DAD2105334BF0FAECE2F44 AUSTIN.ALLAMON
690,252,452 *474C624E8F169B7201377A5862672FF6118AB575 autoschas
690,252,453 *474F1768BD8BC34A9340C8E35BA924BDE620B9C2 AWE#
690,252,454 *474026314B0CA4F93BB41BE1A04C3E75807B684D AXQ8C
690,252,455 *474C8A4450A2EDC74EC68CA3D57B1A8E40926413 8.parce
690,252,456 *47413CAD267E64D2285C5A3E5D9976CA65C3C8A8 a=yco
690,252,457 *474A7E0CC2CCBF0292C0C5F296EBE11F15868D22 ayntabbatnya
690,252,458 *474F670B8CF665F17265E03FA0C7B1C6AAD5E1FF 8STHIRAU
690,252,459 *474324326C7BA4C500C072ECD63CBDA664C28657 b0gvr
690,252,460 *474FE986952A29405EBADE3F53B9536F8E570539 B1319605243
690,252,461 *4740CB9DFD01677FE4833F798854DF7D7674C050 B19
690,252,462 *474399941C5CAB2B7976F2F4A7CE0B89CAB912FE 8YUUSHOU
690,252,463 *4743B1FAC8F6AA9B2DE9A6EBF44A736C42794CDA 94HK
690,252,464 *4746D8D664C93ADE15B5C9188C2657852F444AC4 _96B}J
690,252,465 *47437E5446CCFAB4D69594398A6889C19CFCA0C6 b42wq
690,252,466 *4743B91B1824E439E5F9EE5BDFDB2FD2D527AF12 9GLAWACKU
690,252,467 *4748039283912609A15FBA431C8FDE23047751ED ba0s
690,252,468 *4746207D34EF9B2DB4E3A83A221B3219E7E9FF6E [email protected]
690,252,469 *474FE0A5EBE7DC32D23B5041A04ED3DC82599324 BAISISSEUR
690,252,470 *474795F4F062E7CA36AE43C013A250D6E21845D1 9NARASHIN
690,252,471 *4747BC5E9514BA58CC3D27694E2A8AA7307A1D12 9nonfimbriate
690,252,472 *474788A840DE8BACE928E2515BECE13F971DA963 BAS+ON1AMO
690,252,473 *474CB4B0BDB45D5C04F5CCF28F50FB5F09F3C9AB 9TRASLADARLA
690,252,474 *474F1EBD68603D0E363B5B8D48D3C449F6FA74EE 9ZARIDITI
690,252,475 *4749F6EB9FF3188164AA2C7DA50031BFC369DEB2 B######B~.`.>B0
690,252,476 *474F385B8E0981F2A0243ED1634EEA3EDAF110EA a0.(r
690,252,477 *474897353FEDE0D90A1DC92C1D6725F6E9F81954 a&0s
690,252,478 *4744DF8643B981F6F05FDC01218A1D4B6E0DA25C a3s#b
690,252,479 *4744FB29A6E702BF770DEECC3FD00A306B79D0F6 A70PA
690,252,480 *474565EBB86DC3B66CAC60BA4EAB2FF92BB7F58B a7ctl
690,252,481 *4748D4161EE655FBD0AD9BE5EADFC09E563E1E03 befüllzentrale
690,252,482 *474BCBFCCC0031DFC17A3FFD72DEBE7550ED1A28 aa0{_
690,252,483 *47431A99D7064F70A2C00E17E7C08A78CA3FB78D benitoacy
690,252,484 *4748495BD7278FCB7383252601196FB1C9DE8373 aab<1v
690,252,485 *4749B942A3CC1E5B464EA0BEB964139582C9A28C AABR^4
690,252,486 *474C5435107AE249B4572A64F3AB9B411399B414 BERTHA08DV2
690,252,487 *474E3786B82E9205138EE699C4ADDD11242B1ACE BERYXES0
690,252,488 *474D133E4C458E8BE06657817A5386E6735023C2 AAD|M{
690,252,489 *474F13B409E8B69F325E1D118538B023EA6377D4 BG+
690,252,490 *4744036F6206569C40B63C54EDE051A60E2CDAFC bg(s
690,252,491 *4741D50B7A8C64F10AFC9D7AB63707BC2E0C12B9 B?H0Y
690,252,492 *474251D3306F91CDBB2F15FAF69C6F252B267BB5 AAu2
690,252,493 *47458AF9C3883B13AAE2A592EBA44DAB0E5B4250 b%ic,
690,252,494 *4746DD8DDFF6F7528F41D1607F87295427570FA0 BIEBQ
690,252,495 *4743E87E6B73E59A270F8DF218CAF52454F12446 abnormalcies4
690,252,496 *474F7ADB799A784A349B10FAE10F21EDAFF8FA3B AC5H
690,252,497 *4748B18C6F5C44B8CBFD6EB9E36020280B222815 bkvsk
690,252,498 *474545925F8DCCD3E9D2D2B91CB7BD94ABA661F8 AC'[email protected]
690,252,499 *4742AA7DFF8FF1A24895F653BD0BCE7221D282BD bliithe
690,252,500 *474AD176FB93137FCA07D80878510AE24BB6D0F6 ACX/G
690,252,501 *474D66A327B04F4D462C0A3CFC88B8DF878961D4 Bll+
690,252,502 *474472BE79CC134785500F6831EA3CD78BFE60D3 adamskraal
690,252,503 *474D1F5C445040244EF02337949278BD0613B2D2 b?nl
690,252,504 *4743AD8829FF173ABD20D3F5A91B537F426DD725 [email protected]
690,252,505 *474826F58504DAAA665DCEC0FF32871A1B69A678 AFS/-
690,252,506 *47473DF920E47B9F5EAC2A6EE9A04235B63252B8 AG3D,
690,252,507 *474D28CA08BCA647CC9A399B4FDFD033172F814E bpd9au5dhk16ooh
690,252,508 *474ECC3E53BD7EF73D65C07917C8720E67289389 BQYXQ
690,252,509 *47450B28E1B84799A5B7B9D216D7504896E016DF aid6!
690,252,510 *4745368D82AE506DA64B1EE7B3994A0CE5DBC745 BRADLYSAVOIE
690,252,511 *474E18FA7C2A462CBF64EC364FEDB87B1A76720C ailp4
690,252,512 *4746014AC994571D13A5F632FEC0D0F2D50DB0A3 brandonfreer
690,252,513 *4747D485AEBA0A3249F93048CCB4541DBEED9E7F AIZAD.ISMAIL
690,252,514 *474481A5F3C64E8A80795F256367BE8CC5D7CFE8 AJHB2
690,252,515 *4742C44CD8A23502491097AAD8A83F9AFBBAEF66 A+_JR
690,252,516 *474217EC89F9C3A224AC5F144099C1269952FFFD a-&=k
690,252,517 *47460004DB4FBB0BDDAB1B37FD8941083280E9C3 a'k$
690,252,518 *47430F8B186C3A25A1FC3B80BE04DBE7BA61804E BRETT.FIRESTONE
690,252,519 *4747FBD548C3591501637C3C1E92C11B681B9106 BRFDN
690,252,520 *47403A198910830F39A02A74406595FA08EC1B66 broida.
690,252,521 *4744C9627DE54A9119D0088BF5CC239114E32083 BROOKSSAHA
690,252,522 *47470BEE9F5CB2168988639DB1D3C7C4C119CD07 BRUCEBOGE
690,252,523 *474B2AA8EACCEB36C2C086831FA5EA74919C1867 ALDOLOUNDER
690,252,524 *474686529E754A91635A2301D464493EE71DBC85 BRYAN.SZPAK
690,252,525 *4748C3A799FB959F504722453F99E98C15AB204E BSE:L
690,252,526 *47422DAA6FECEE46D7CEC74C3EB5B684EEBE6CE4 ALFREDOSMOLDT
690,252,527 *4747C1A6AFE5B0A2E1ED3F76B6EA1918EE7C0B78 ALGISNNI
690,252,528 *474E3F63B173A7022225A6B0E105F2BF60FE23D4 alhi6
690,252,529 *47477AE806D90D9396B613BAAEBF027547414376 bt95!
690,252,530 *474354554680928558C3F396FC6FB9A3E49473C8 BUCK.URBINO
690,252,531 *474F5714D06FF8EAC04A5A17260BF68DDEB8ADB1 BUFORU
690,252,532 *4749D4C08FFB9FA7095279B154967B7BB8D6893A BUR8T
690,252,533 *474C9E159EA97682AEC0581270BEEB38250AD11F AMAGBORS
690,252,534 *474D665B1D8566033707C62380C94C41198C46AB amg5h
690,252,535 *474D8EEA0534E4CAB544A30BD2EEC0463AF1F393 AMYBOY
690,252,536 *474BAECA5087D25337DB125F5FD1466CC77F4BFC BZCF5
690,252,537 *474AD8D32C7A8FDF8E288C853FD0DA8ED77A1DF0 [email protected]@813
690,252,538 *474D63964D1A3146FBE03C3EA5F88A226C9325E3 c/2$q
690,252,539 *474476921B7EA0070F5A3A118FF309100D41A62B anna-tomowa-sintow
690,252,540 *474045083DE75F5FC3ABC8C17D90D1A41DB8474B anne-atamosa
690,252,541 *474388919A22F74FD4BC72E30D48B63A6EC0109E ANO3V
690,252,542 *4743FCC3C6395C98A8CA96C250AE6876BE132713 C4UA
690,252,543 *474AD86DB54476376D12ADFC8F42D0EAEC861C66 C5CBG
690,252,544 *4749716DCCD1655884321AF935A6F76DC0C26FC7 C6PIM
690,252,545 *4747CC74D09DB2C4DBC15BF66D1ACB304BE29CB9 APSVACHT4
690,252,546 *47401D823A730DEC19D03790F2DABC04B40AE699 AQF/
690,252,547 *47414327C5209982ACD3AC9895766B03D191E3F9 CAN--WHICH
690,252,548 *47442D37FF3FD966DC1C511642DB429C688E591A [email protected]
690,252,549 *474692DF8802DA15AF2DF1F8EA8BD456C857FE0B CARLOGATBONTON
690,252,550 *474314D3EFEAF0A2AF1FCF510E846B000D004159 CARNES06
690,252,551 *474F2AAE385DC8F17AA6AE60FA857A7FFABC073F casiosurf
690,252,552 *474012F33FAC60D786A213F28D7C2F916DDDA1A6 AS+AK
690,252,553 *4742D5F7079C60AED69E35F8DB4C42D00B6B207A a-solu
690,252,554 *4746D5B8B563E8184A70BD62619CC94B6713EEC4 ccvbp
690,252,555 *474E4C959EB4B5E8FDCB4A4BF0790023E3B934EE ce5xz
690,252,556 *474C8C9D7E6A25A801D7438BA9609652F31786BD [email protected]
690,252,557 *474797D4E0803AD5DF32147820D8EB2E3F1B8B57 CECr
690,252,558 *4740E14A3AA15136A87BEA23A42B9566F6344C74 AT+P#
690,252,559 *4745E97EAF7C6D912774ADF723E8A3AAF59596C2 AUGUSTINE.SIDMAN
690,252,560 *4741708F3C1BB61C7FE499F9D7673C2C5C2A35A0 CEWNV
690,252,561 *4742129541E83C776F1A0A7537B597F35146334B chadkinchen
690,252,562 *47480548ADB403419C9CAC6FF2EC78539E304DC0 characteristicsdrba
690,252,563 *4748CE9284B8A38B91E4CCDB29FF16077D6F1B05 CHARLESDIMECH
690,252,564 *4745B46B6F9C5D98BEC0347021C1E91754242E20 a$wx
690,252,565 *47430CE342BE06A2EB75BE45FA88124A248A1A54 [email protected]
690,252,566 *4742DFF57340FA85FCD70D6E1748F41FBA69707A az$r
690,252,567 *4748F012715A10FB0E549FE15B999A1142DD87BD B>***;)
690,252,568 *474CC19A6B17E8E8EE55F8A15EAC96A564DC6724 [email protected]
690,252,569 *4743113C623479FFD6B4A1ABCF545FE91556C91F B19
690,252,570 *474FA9678001881D833E54ACF0BD394B82B6EC3A B8QDZ
690,252,571 *474A2D4BCF8240D08D70094F5DD55C38FFFF37F0 CINCINNATI-SCAFFOLDING
690,252,572 *474A0BF5190ECDE8A0DDC8A2B99C719DD5101768 BAHRAINE0
690,252,573 *4743AED3AD91D1D0A610D04B70B3A1E4C3303C65 C&L1
690,252,574 *474DC0F7FB4FC8F7A67802A2089F65BBA71A3DD5 c}lb
690,252,575 *474EE018AD87CE3DF4D3823C5D05EB9958CDAA1D B_B1D
690,252,576 *474F1345D4B0AD343FAE391A0B17B077EF52C393 beaucalcagni
690,252,577 *474681AA06F015122F861A179BB3A5D49E53B981 cobty
690,252,578 *4746778C3BA28CC47B76D63EA19DAFBACFF505C3 BEETHOVENLIVES
690,252,579 *4746CF4F5DEF0B35ED021E403F86EC0C4F333005 Be&i
690,252,580 *4743CBC9631078074866996D8C5D6F457A1F793D BEL.MOH
690,252,581 *4742A07566F93A7E13F2700E83EC74F0BA6893E1 COLINKANDEL
690,252,582 *474EC8EECC0A366C8597F8123F9A81610AC11B12 COLIN.MIGLIORE
690,252,583 *474970B2FC4B06708EE81094681024E4729F3194 BENEATH.A.SILVERY.MOON
690,252,584 *474085166D15AC0F87B41E1BD78EB9DC379B3EBE BENEDICTMARSHBURN
690,252,585 *4747A1FED246C36436FA9DD29886AE2101B90FDE bennyhenry
690,252,586 *47429C5E87C286FA0A9313CBCB47E9184CE630CF [email protected]
690,252,587 *47418360390B460FC5D4EB2124F73B8CB60E11EB berniedowson
690,252,588 *4748D0C0B7FA391AFB2EC2C72BC78078374C61E4 BERNIE.MOMON
690,252,589 *47459E1B01CFFD92BEE45253272B9181B9BFB911 CONTENIDO POR WIKIPROYECTOANTIGUA GRECIAIMPORTANCIA CLASE-A
690,252,590 *474122159E4F1B4A982DA11505197792768D648C cordellmiu
690,252,591 *4747E7AE1F9C0BC7BE17FDB3FCB656E2004894E1 BFOYX
690,252,592 *474150FB95766CB7F158723069F49DBAA9373AEC [email protected]
690,252,593 *474077594AC6FC89620B922F36C6D35D9E02489C COSTIPANTI
690,252,594 *474A4B869BFE069C1B1A733710F85E5D7CF5E097 co.xd
690,252,595 *4743773292C868CD44422AAE58477D3C8FD6A0C0 cozzolis0
690,252,596 *474537392B260B1B4F0E5633473EB4302780E127 [email protected]
690,252,597 *4747A05399E559B0C7967970E3E453C8B801384C c:\program.files\microsoft.visual.studio.9.0\vc\crt\src\atodbl.c
690,252,598 *474B4245F86B407AC03F24FAD5951DFC45511CAC cps3z
690,252,599 *4744B9C8BF9387C5F8B654AAA000540E842292E3 big.gunz.(feat..tiny.doo)
690,252,600 *474001620A83F2D4B8BE09D84670CA72DAD62294 BILLY.MOREHOUSE
690,252,601 *4744E3E079A1F886E218E5A17E4E0C9E74FEBA4E BILLYVOORHIS
690,252,602 *474AD0855B62099261636A5029B9AE4E69DF9666 BIOLOGYPISCES
690,252,603 *47437D92B06579821ECFB99DF97E547995780444 BI!VW
690,252,604 *474AFA2668C3CD45A7CB758BBBC6D70C1A2493B1 bld4l
690,252,605 *474B791ADFE3C725F5B75495F44C1F5405ACEC2F cu=fv
690,252,606 *47417EEB07ED31344EB477FEA63AC33DFAB40550 BN3/W
690,252,607 *4741931AFBD731BB1325920F9F3572DD07A7F198 bojgp
690,252,608 *474DDC054B12E502B82D1D4D49F9C47E351570B6 CYDONIC.ADULATIONS
690,252,609 *47454487472882727CF1536545D82EDB45EFB5E5 [email protected]
690,252,610 *4749572958AE500FDC888BE419FAEA5EAF7E59A2 cyrilferreira
690,252,611 *4742AEBE3F9C5D5BB5D63174A98711D125B6F224 d;0/+
690,252,612 *474AD25A3D8FED4444AC804622B9A1D39DA5DCC8 d0#8m
690,252,613 *4743A612E74C96EAE66F67FCF223A76B1F520177 BPA4=
690,252,614 *474CE2F2FA9D0328EF57E30651F3F57036E30BC9 BQO0N
690,252,615 *47478598AC4B37A5DB717016A37C2179C30A25B8 D%5
690,252,616 *474A46B30AB405973631A44FC052F939AE4E9E9A BRENDON.MUSTARO
690,252,617 *474965066E9F6E02A99F1EA4F619547C5FBBC921 D(9LC
690,252,618 *4749E7F78EB3B01DF8EA7278C427D7D753676121 brpxt
690,252,619 *47427199BF42398C4F75DA83C56B2B6B918F535A damiongazaille
690,252,620 *474C37CAB0BA26BA67B49A5E47A35DE6E90F60BE DAMIONTRUNK
690,252,621 *4748144BEA131971667AD74F927B10CD8A73B6FE DAMON.NEEF
690,252,622 *47479FB25F5961317D6CEABA9B1D84CC0E9DF51C DANACHILDES
690,252,623 *474918D654554F8FFC6BCACB9E12B92A3CE9E499 BRUNO-MIGLIORE
690,252,624 *47497AD0BE3032C36AEB893AF8A55A8DF575DD88 DANCERBUSINESS
690,252,625 *474171A22A6DE94698F86F850657D9B0BF70DD23 danielle.lott
690,252,626 *4743A40AEF1D83683F71DF85BECC39F0D653C1AA BSBL
690,252,627 *47499E9DFBE42CB5F8A9D09B46CC1EC61B7076E1 darnellaccosta
690,252,628 *4741BEAC871EA2975F281B9DE84F5A4C544AE6BD btrfd
690,252,629 *4747AE56782858C8E385A62A1477F63540478C6B BU$B4R
690,252,630 *4745000048711EAB3A6E152DCF17B630902FC28D DAVIDOFFEN
690,252,631 *474727531A9B5DBD7167CDE4227EF80BA62FE9A0 BULLYVARD7
690,252,632 *474B2C0954AB5CB67D67C0C89C2F3F696CE76037 bum=i
690,252,633 *47498441B54CA0981393B0BB1D01204A23D5EA6F daw.h
690,252,634 *474728F3035C8DB3C80D0AFF5C342D98CBCE00DA dblac
690,252,635 *4745B8F104E34CB09123280F847809C55CE8AFD3 D&CF
690,252,636 *474A5BBE96271D6B0A91FF2FED7E13889980D686 DDX7S
690,252,637 *474E56E5A060C091429D1DF7B68B61ED46C37B21 DEANGELO.VASHAW
690,252,638 *47409CEB525C89864C6B39360363C6825AB6C2DD byntj
690,252,639 *4748E9552CCBA4622C968EA6FB2B0E4ED26D4AB0 BZKMQ
690,252,640 *4740F5E83D5425AA5C7C0328A083077C11E62B00 C0n50lda+e5
690,252,641 *474CDC5A69F73B8F1FB0DD60B5EB37E68DAE3697 DEICIDIO0
690,252,642 *47487163B89DDEEE44B8A0CD560F37BE64A7FA19 C0RR314+V3$
690,252,643 *47458B9B77811F9E1D24FE3DA4A2D23CA0530604 DELETIONANTIPAKISTA
690,252,644 *47429F0FB9F5017FDC4534D48100FA84D37B5BB2 DENBY5617
690,252,645 *47436E6A2A5E0980AA6163F416F5EA9ED2F664E9 c5o=m
690,252,646 *474EA29D82255C9EBE8D063ACE018C856A3E3499 Determn4cy
690,252,647 *474EAAA06B903D35DBF5679B4DE3E8903C4F9E2E DEUSER85.177.127.100
690,252,648 *4740DC75EB2A30E5329A365A706606A30E1BF8DC DEWITT.BAYS
690,252,649 *4747E0F4E21E1B232BE24BC82233B079FFB9B4C6 dexterinthedarkchapter244
690,252,650 *474388F7107237451175802FAEF356F521FAD8DB CAMERON.HULBERT
690,252,651 *474D24587A667B312532C759D5F1054EFFD0CF6E CAN.AVAR
690,252,652 *474F767E5F7BDD5E02678DDCF186486BFA3AFFD7 d:for
690,252,653 *474BEBE5A59635485F618C97BBCAF7E7459224C7 CAPRICORNES1
690,252,654 *4741C3A5A9559F8032BDB276CDDAAEA4D972286A dh$9
690,252,655 *474C6B7DDFA05A642AD30248CB848417E95C2761 D-I)
690,252,656 *4740ACEC7F25CBDFE3EB89D9BD32329C01E1CADD DIANA NYMAN
690,252,657 *474B31559DF22201FC315F1110502A03D802CEB8 [email protected]
690,252,658 *4749FA64B051E7C1399B2C6952EBA0710457DB7E carrion.death
690,252,659 *474F2169BD25D150027F70CFAAD0D4F2B588F4C4 CARROL.HIETT
690,252,660 *474F1C902FD047589CF29D96EAEC91122F58D515 CARTER.WARRAN
690,252,661 *4744BE29F093D107317E66C6416425644278F9B3 [email protected]
690,252,662 *4744E658A634C5A7E89C162D0482A866FC2AC31E caso
690,252,663 *474D7284CB05657783258639C82030838BFA9EDE DIOTIMAKSI
690,252,664 *4741034C94EAD5BA935F109594C1EA16897F097D DIRKDAHLEY
690,252,665 *4740D3075003B76B3E6D22CB9267DA5B85C2AE93 dirkspirounias
690,252,666 *474A781E1D7E54E952267C5C8F27EA431A18D8A0 [email protected]
690,252,667 *47454F2EAB08BDE8C8559A0A40DC8440CBC6FD2D CCBプロジェクト21のライブ等にも参加している。
690,252,668 *474B0D51D1F526D906F91069340028DB59440A09 CEDRICCURNOW
690,252,669 *474A7C8F68FA2AF2BD112FEBEE2AECCE300F74CE DNATSEBJ1
690,252,670 *47455EB4B94E73BDAC252B269D5299528A4BC230 CERRACHIO
690,252,671 *474CBC5E0A0A80B67D183AD913AB7215EE4AE648 dol9m
690,252,672 *474A54D0EF569D053F181BB7092CB3602893672E CFR2EPZFFC4C
690,252,673 *474BDA3FE099270C5007BFF639959BBFE3AC6FFB CFST
690,252,674 *47454551B8915A4566FDCD12D5E371A15C34A431 C=/FZ
690,252,675 *474204DF42827FEC0BF5857A74A87EE90424EF01 [email protected]
690,252,676 *47494EC2948435B896387793F020C0BAE507B97A chadpasquin
690,252,677 *47479AD2AAA4C0B7A3B3A360B986C67A8977E0CF [email protected]
690,252,678 *4743375D44D95018CCB82423DC5A9C2F989470B4 doublejet
690,252,679 *47412257C4AED7B121DDA08C5BF9A602EA8763A7 DP7?
690,252,680 *4743DE1C60FCB9B028ED17E6B098B5262ABF323C DRGOIA
690,252,681 *474093376BD7A157CAB5F14636E6F349E61D7381 CHONG.BUENAVENTURA
690,252,682 *4749605B020922EBA79A8E10289D5464B28FDF8D choreic
690,252,683 *474E15BA1B2547B848A8751759646815827A23CD chuckskwara
690,252,684 *4740E5AA1707F62AA6B30B876EDACE5F86DF9B71 [email protected]
690,252,685 *47411C123FBE48F51604777CE9A3CA4DC9BA504D d=u2b
690,252,686 *4749A835F762C404AD09EA930B6E60CAFC9000A9 CIVIBUS0
690,252,687 *4743AEA88208F1D469A2CCCE9BA2B7770CBBDE9A dug
690,252,688 *474F352C6933958F36111DBD5D8614225B044F1E C+KIK
690,252,689 *474E76393917692CCE5F03D9BD84D7B208D82F92 clankings4
690,252,690 *47495CAA72F0A6E73C448E789F82B0B583E8C42B dv#jn
690,252,691 *474F7B0EC7EDBDAE578163F3355948BC62DC1661 dw4ap
690,252,692 *4743617109F8CD3C64E2DD635FCA19584794C872 D%Y4L
690,252,693 *4749BA8CAAA48ED9ED783299EF19686F5FC07E89 c(lu
690,252,694 *47425C546257F626A93BDECCC4CF0E1DAD6AE59F EARL.FEGAN
690,252,695 *4748E6FCE38ACFBD157AEE5FD83676FE76AE58B4 earthkin2
690,252,696 *47459ADD27827A7AC4E5A07AD023D7C3F329AA17 EBAGBANN
690,252,697 *474BD49EE0A014307805E6FF6CE719D707857B79 EC.J
690,252,698 *474CCD8E7B119EB043FFAE9A8B920DCE7D5686EC COLTONVERMILLION
690,252,699 *474FBB964F9AAD42309FA4519605A30C1DFDABAF EDNIZEGSNIRP
690,252,700 *4742CA9C88815208CE52389B4A91359313C1D440 edustustoja
690,252,701 *474245C42E1E90CB6AD6E1642678DA8F7A663F1F [email protected]
690,252,702 *474E5AF914BE78267477FC2CB2EE735E5D6B0B48 CONSEC
690,252,703 *4745289368D3E1E89CB7F8E9614E7F3F69B9C6AC COOPERATIVES.FEWER
690,252,704 *47434C093BBD51F73ACF83EC3BFE2B2A5B43BFF5 EFRENSAMEC
690,252,705 *474AB36EECF6DF42590834A33055B644C84AE8AD coryhinkley
690,252,706 *47495839770591A614735BC7FDD23DC922578154 coyotedaytek
690,252,707 *47457164CE0374EC6D606B360F2DE25E8CB990C3 c:\programfiles\microsoftvisualstudio9.0\vc\vcwizards\codewiz\atl\method
690,252,708 *4742F26C51D7D9305F400AF20EA5859E72592715 ELIAS.LEMLE
690,252,709 *474CA7021850D09F7400ADD7C5A05D9891D84340 ELIAS.SCHROLL
690,252,710 *474DF6972FD518413109BD445744303BFA4EBC9A ELIASZIOLA
690,252,711 *474A7139A2984A667CFB8804BDBF907B120D03E0 ELISACOSTA
690,252,712 *474CEF36F29ACE20FB121D795E32F923C0D3C365 c&r4q
690,252,713 *4749C892A42D0057500F86139268D1671E4E8042 ellsworthdowers
690,252,714 *474722831A2612173E2D1145DEA42CFCAB3B516D CREAMTALKSTORK
690,252,715 *474ED2D9D40289969CA4F05DF1E19380D654F4EB ELMERSAINTE
690,252,716 *474E32D8DAAB8E99DD96E7EDFD389D3456D26B99 CRISTOBAL.HINSLEY
690,252,717 *474023462BAFEA19F4CEA0B3746E5CEA8398F293 CRISTOBALKENDRICK
690,252,718 *4743809D1C93ADF9F39058488C3BAF661DB3F68B ELSDRAGON
690,252,719 *474C74593FCC9C24CFF22FB5516E04E9E13425F1 EM1DG
690,252,720 *4742BA6D7C83203BEE575CA4DFCECA0BDCDCAD16 CS:81
690,252,721 *4741209A14A6C02BB8350B35EBA79C09FD66E498 cuew
690,252,722 *474A4482BBD3353C7F93A0DCACE4AD754E34CCF0 ENSMMÄISET
690,252,723 *4744F08CF4FDEA11D1B56242170E44738E5DA8C3 CUSGS
690,252,724 *474BD56882E42D433C17FC0DD7376D8C12E1AE12 enx1
690,252,725 *47457AAE5C80B7703C00FAEB9D7CA7A3929436C2 epxiaouj
690,252,726 *4745695266EDCD83377DBDF82A1584276074F78E EQJ;U
690,252,727 *4740A7BBBFC575C816CB54112A479C43B74D70CC ER"?
690,252,728 *4749A7C297FA806AF659A8C372FC4935222C886C [email protected],
690,252,729 *474108B9B62EABED366F3B3D1605C9007725D7A5 c:-yv
690,252,730 *474FD222FCE3BDB39AA6C7D073AE428AD27350C4 CZY,C
690,252,731 *4743E17CFE5452739C33901640F7694EF5FBFBFF escarver
690,252,732 *4745C3D52D5541A2A7AA31C3249995A11252633E Essence.of.Giraffe
690,252,733 *4747E22F3AE80792DB1BE0C6EB84F5A3C76E6A61 d3?w
690,252,734 *474767B72859DBEDB9A73D27E5517828E1DB72B7 ETG#V
690,252,735 *47476C1B0F093A20382BB5EE10084C002136B87A d6j:v
690,252,736 *474F9791E6AAD5245B3DD212CBCE74AE9E507BEC D6TSW
690,252,737 *4747DB6212D8C2DA0B1C932563028A0EE9E6170F evadiere2
690,252,738 *4749ED6B2200C54B6AF69D75C279FB1832C794EE daleschiermeier
690,252,739 *4741A92EA0C3F01A69384E08189356DA4FC725F9 EY.LR
690,252,740 *474166D6D6563A9092C6250FB52BEA6E86836B8F dania-dandon
690,252,741 *4746B8D2270B5623CC7B70C5A02B677B668F265C DANREDRUM5
690,252,742 *474D13FA941427532F2C6D5ECE39ABCB93125863 falcier
690,252,743 *474919F8579A2A1D8D53AC2EE28F735618034FF6 FATHAHK
690,252,744 *47455AF74DD8C28F6639457A1D15FFC6CD490A30 FAUSTINO.SABISTON
690,252,745 *474F8CB8ABA9C2A326DA5292A080420503774D89 dascioptera
690,252,746 *4745E4F1ED64D48B9DD41333A1596E2F6E1948BE FENSULFOTHION8
690,252,747 *474034D9F461B71880C279810C355D39090D8606 DBENKOWICH
690,252,748 *474F557EE262023FE6512A06DF4B9C56C65A8D42 D#Bo
690,252,749 *474A99752298630613D82B976BAFBD1A969EC2DF [email protected]
690,252,750 *474BFFDA0BF4FCEDFFDCC7FBC6C2B23CEA56257B DCHQ
690,252,751 *474C06F887ABD2C254374928C3200549787B6AA8 ddb75
690,252,752 *4745BE9474F1593E0A44DC63C0CAC7B94FDDB593 de7,m
690,252,753 *47491E0D5B738AFB4AA45472F2AE6DD92B9995DB DEAN
690,252,754 *4740C42D59F04954E008E5AD27A81EA89562C99C fmllr
690,252,755 *474E99E43F90375FF80E912415BEE3F47F9AA80D DEMARRIUSF
690,252,756 *47496A99C8CE04840CC13E28026549A5EA92D6B5 FRANCESCOBUZZELL
690,252,757 *4745C35E5AD7F95B7657D13FA671CA581B68359F FRANCISWASSER
690,252,758 *4743FE833D7623DB3FB7F290EBFE681FC91FD166 franklinedge
690,252,759 *474950DC8D74123FBC5F190DB1FC64DCD1E05254 FRANKNST8N
690,252,760 *474FEDE74D5155E675E27EA969900A69C3FDF8C1 der-tag-des-gerichts,-twv-6:8:-1.-betrachtung.-arie-"f
690,252,761 *474E796CC8A075E7AAEE680C9EDF07B60A4D877D FREEMANHANNIG
690,252,762 *47466FC1A7ADC6823305CBF7749992E9E164B42E DESTINYCARELESS
690,252,763 *47494F3F083298A0D1F32AF2B16AE4E416E97553 FTBEND
690,252,764 *4740943DA47413E4416AD3AF136C8F9F16A786AB [email protected]
690,252,765 *474EDD8F28A188532753CB72F6227B3B336533B8 [email protected]
690,252,766 *474CD477611EB1274E4C4FDA5364C64C65D28DF6 F.WRITELN
690,252,767 *47413C8C447205CB4D380AE33A9BA747A61DAA2D &FZB
690,252,768 *47486BDA6E3F59C76CB4F5681E6F13EFA36FE1DC fzerox
690,252,769 *474D7A6F38EE2C74B9747D56AA154D76D05B6226 D-GI(
690,252,770 *47418D266D3AB4AAD5BE82A94C38DFE6B9FE237F galileojoel
690,252,771 *474AD807C9AF9E9FA27B51D2F09ACE302234CFC0 GARFIELDHOUPE
690,252,772 *474F69C79FB2E9A571F3657C285749D98265DE13 GARLATÉN
690,252,773 *47484A2CBBCC20C7394701669D1FFC2E59FA018D GARTHWEIKAL
690,252,774 *4743662EF86D5CC1E8BE79F019970850E66CFDDA diegoblenner
690,252,775 *4744D9D0A620B9FBDB714090AC6DD6CAFD9B6C4B GAYLORD.CHMURA
690,252,776 *4741D797B062D07EF53D7B70F4D6917B2111B5BE DIJ(,
690,252,777 *474CAFF596FF671BD7BE49032DF1B1E304571A95 DISSENTIAM
690,252,778 *47437E3AB941D7204E7E939B97146C3487B154C4 GERALDO.ANTINORO
690,252,779 *4744258265029A0F2DC29B3C75E4D5A260AE00CD djabugailady
690,252,780 *4745462D2E4227E955011A856DDD8EDB692BAAA9 d=)ku
690,252,781 *4747258302CB9E7276DC5A081C36A0A1B234E9CD DLA7ORN355
690,252,782 *474612E7478E0F345A75BB0BA53BF3EAA9D29927 GILGIRL123
690,252,783 *47412210588CC79B37144CD2869C79A07CA1AEBF [email protected]
690,252,784 *4743B76BFEBA8E64BEE85908C43C2C11F8B1FCBA GNABAVI6
690,252,785 *4746D502A18C72090892436FA3CED4FDC110AADB [email protected]
690,252,786 *474534FD2ADA4200C91728D41D79E309B62E50D7 gonenot
690,252,787 *4747837195CC5BF475195AD9E73227F8C496E41C DOKOPAH3
690,252,788 *474BA7E3B1AD540D855F6B1FA9F161E86B2109DE DOMINGO.WHOOPER
690,252,789 *474303BB15D47B386567541E2E1EB8D5B377730B DOMINICK.DOINO
690,252,790 *4740BCE8654F7227343DB6CDB30D25220F8FA4F5 GRAHAM.NASON
690,252,791 *47454967806F7FD554422CED8F9A11A243A564A9 GRANTDARMODY
690,252,792 *47490A45DD797E2DFA18C81CE3F72717510FA28A DONNIE.SCOLLAN
690,252,793 *474E0C6001B1EC327703B1BC9F7C178E746CFB33 DONOVAN.MASSEI
690,252,794 *47495DFDB84B486061421769B9103E81F0BB6C81 doorwoelden4
690,252,795 *474076C6FB7394B24A49124E29CC6C76C2C91FB6 GSTELIGES
690,252,796 *4741152B6309BE8FE85D90CCFA9E5B8A42BDC5F5 gt=c
690,252,797 *474B13A90DA224A2E264CB4D881775AD2B4BBEDF DPKVP
690,252,798 *474899FAF1E4012D820882D3E4F07BCA62C503F0 dpuv3
690,252,799 *4743572A6CF0C7A537EF74EE8EBDF91FD788D640 GUY.OLIVERES
690,252,800 *474D28452426E766E08691FEB4087B189B242D17 Dqic
690,252,801 *4745C2290BBD2BF8B71EC00432693C014ADE5A5B haiderf4
690,252,802 *474911285E225FD64D0967CF6645E4AD77001EBF HAKKALANGUAGE
690,252,803 *474DD2D5E24E4E039CB5D41AF9E29337467B0F4F DSFVG
690,252,804 *4749B0371FE66FD9631F74E9083AD51BF2940486 dsj3b
690,252,805 *474C3234802867F46C055F70C2A69CE7B6C6AD35 harrinlee
690,252,806 *4744E09C7D30C2D7A94789978CC87055FEA3850E due-tipi-come-noi
690,252,807 *47478285628AA96BADD0278BADB74B4785A22F81 DUGPHOON
690,252,808 *474D9FDF2D6E804339564F7006350163E651540B DUJ/)
690,252,809 *474BD22F8C4BF551E6A7B67C6686086D2A99A09F [email protected]
690,252,810 *4740897DD573117163E40B7EF767DF349CD933EF heather-rintoul
690,252,811 *474CC19BE117E347301FB7DB18DBE2F38D67AA2F dustin-kinley
690,252,812 *474791FB4AE6A451657B46A3C67D9F9A7D778AFB DV99
690,252,813 *474AF414B386CCA6D4DC32F3ED667430C65EF804 [email protected]
690,252,814 *4741BF302252AEDEEF99DF11416678915F8535B3 DWAIN.MEI
690,252,815 *4749565D60BF5A79BA15ED83F5F700BF7C37F417 HERSHEL.BRIOLA
690,252,816 *474E2243C67B873874D43D77BC18EBF251EA9BF0 hersheyhing
690,252,817 *474B7D6A5643FC541D812B15CFD8A384B11D6B41 DXK74EJ
690,252,818 *474CC271DD502130F877EE7DA886A7EFC5B628C9 DZ4r
690,252,819 *47420B94D1765B4B2615959A704375B59F0D7146 HKEVIN11:LOGRUS
690,252,820 *4749B9614057D104687901D2AF32A41B3F33495E [email protected]
690,252,821 *474D8B36C0CC48143373CB509B946A8D4A5041FB honourslist
690,252,822 *474DA8A3C50F2F04F718CAE9DE8680974B758D80 ECOPHOBESING
690,252,823 *474A9169F146D06B9AC661F15B8010CC25D9452C HOYTSAABATMAND
690,252,824 *474745274D3B80A2DEF509C66B56A5A2CF09EDDB EDISON.DEMARY
690,252,825 *47450C0F47CD3B58F3127F26C53E195CB07184B5 EDNEFFEREV
690,252,826 *4743DAF8E2FC3F0DD880137FEEE18660CEA12E84 httpwwwnongamblerc
690,252,827 *474B1EE4394916B7BD576B7A487BB82D0975BB11 httpwwwpcgamingwsv
690,252,828 *47467BC501E37C5A6EB24E5C7ABB775CC4207028 EDWIN.LARAVIE
690,252,829 *474CE4C03DE0CEEB0AACB7C12CA4740C5FBC95BD ef3+u
690,252,830 *4742C756ADFE3F44897284DA52C8118C62B4D22D ef:ed
690,252,831 *47414850BBF27682641F847C64702638A7AD9DDB [email protected]
690,252,832 *4749B9864B09AF8CE11DEC8D825D47A8EE08580C huggunargreinum
690,252,833 *474A9233B3187452F7318E31BDB6E9924B63D6E5 HUMANISTN
690,252,834 *4749DC05D613EFBCEC2185F9C5895E638288269E [email protected]
690,252,835 *47440B30B224F9D0036400FAE354653F36FDE4DD ekpuc
690,252,836 *474981CD8E37B412A67156BC0F2672FEBAF05162 iamkeepout06
690,252,837 *47497165749B370053ED2516515E4C675AE88D01 ELISHAHALLSTROM
690,252,838 *47458D485AF1A3566CE2D3D06BB1DDC213CBA62F [email protected]
690,252,839 *474456B4318443006CA4D8EC42F7A6D82515C4E0 ICHBIN(DEFWITHTHERECORD)
690,252,840 *47421FF9DCC897B424269AAB6268528B6BCE43FB eliviilo0
690,252,841 *474C3775782B189687C6D64713BB8103BFBF9CB8 ELJUANA3
690,252,842 *474F82DA92E75B8487116FAB8126F520F5492DFA i=d]
690,252,843 *47455E4CA5CED3C70E842AB904805174EFFDA671 [email protected]
690,252,844 *474FDD7D13609069CA48A8B693747FCF89CE3E97 emcw
690,252,845 *474CC297BBF527DF468CF4589837BDDEB1C5387A emmettbemboom
690,252,846 *474EC3E16B29BFFDCD9B2F2CEA0ACC8CD767BF9A EMPL0Y481L1TY
690,252,847 *474A7BB87ABC4C60D290E396D7BAD2E9E6D23BF9 imageoh-317svg
690,252,848 *474B49CF8B7E3867F4032B5647407B905C18D38D ENROUQUEAM123
690,252,849 *474328B6CB2EA18B481D1DEE411BF1A61FB58446 eo;6u
690,252,850 *47482064D8C9E565594B8B04DB9D9F74454D6BB5 INNOCENCEHER
690,252,851 *474462CA45171164C2FF646CCE3348F1A0C15074 INRUIMINING
690,252,852 *474106DFBB38373B65FD486FA8A826FB894F5258 INSELPOPULATIONEN
690,252,853 *47452BD2C4C32DD423A047AC746BF378990AE6F6 intercomwww
690,252,854 *474F8D79071447EFB9962C9CA42D7BC642432132 (INT)$PID[1];
690,252,855 *47497633789E9C9661570A1832D269C6212CC3EA intro-tape-83/84
690,252,856 *474D065886C78293A9E06997B9A48012956B68F8 IPMEVOUL7
690,252,857 *4747AED2E9D9E69B3076AEDA43B1B43698716C12 ernestoevarts
690,252,858 *474CDBE414CC8EE9DA7D58521CD2D93FACD3CC2A ernestogerpheide
690,252,859 *474B54AAE704EDAB5147D137F59456AFC8DE49C0 ERNTESTE8
690,252,860 *4744438002FFB159E1E632A5044939B3B61A0DDC IRREFUTABLE0
690,252,861 *474D55E177EC04ECACA13CF135B4F0879D2CCCE4 [email protected]
690,252,862 *4749D07259CA0CF46D3D31C9FB616E781DD56652 ISAIAH.STUTSMAN
690,252,863 *474AB4DD7245F75A9EB3944ED33B97EDBD9DCC48 ITELFBSW
690,252,864 *47491A8C6B82B831E5A78F9F324DF2597A4EFDFD etifinahing
690,252,865 *47492B50630A2ED2D85F25AD787B9A397EEEF841 IUYAIT
690,252,866 *4748EFFBB706ACD945AA3C909DB841604424F775 ETTIEJHO6
690,252,867 *474535F9C740C35ADDCA6F6EC2D9E18EE09C1B3A IZHARITE5
690,252,868 *474245A5337519D66BD3CE50037F9CE2CC160A4C jackieetherington
690,252,869 *4741F627E9ABA51CA68EC9FEC41A210F46224EA8 JADE.SWARD
690,252,870 *474F0B26A5F42D1384ABF41977BA546F57B6D5B5 JAEESTRADE
690,252,871 *474F9EFC06449FAE1BEDAA28154351E687181B35 [email protected]
690,252,872 *47491723BB13DBBC4A33BC4139A30AC95042A44C EY-(FEAT-YA
690,252,873 *474FB93333D926E8E69B605A33411757459C5109 EZEQUIEL.KETTERINGHAM
690,252,874 *47486049BEC41C1AEBA4DFEE8C6038BA72E11779 f0ggness
690,252,875 *4743F6EFF6FB01FE301F0F93738CD69A6520073A f265c0d028b2806330a81c60a8870949.olbaid
690,252,876 *4745A662303DEEB2CD85EC0BE67DC637C51F78B2 JANECEK123
690,252,877 *4748BD53C23EA00ED74D8E5DE52B7534769C1B66 FABASE
690,252,878 *474BE404B2B0FC22F59459E73ACD236ADFCC87FD fabric-stash-unlimitedcomwww
690,252,879 *47419ACF2B55278908B2EC42E64385E2A04D2BD4 fac_pdeigl
690,252,880 *4741E72DE28791CB4FCE549740E0E8EFFE14CD0A FAUSTINORABOLD
690,252,881 *47493E8E10D9CAF0436BA3F2AC9F4C2B53C9E4AB jaysontakemoto
690,252,882 *474EB7A238E3A3283962C2D8F5AC1EF41A467690 JEANASTACEY
690,252,883 *474AA209FBDC3FEC9CD3E1D9C30DEA2BA049C131 JEANMIVUILLEMIN
690,252,884 *474934C04F9347BD86B55B08E587BDD3E3C70CC3 FELTON.BIRSNER
690,252,885 *474E830B708291437EA8709BABC947A19D60767C FEMENILSING
690,252,886 *474CBFF03E699E90EA6D989C9E89E7BD14F32158 JEFFEREYFIESELMAN
690,252,887 *474B455B4F38047890391AA2409AF3F25E32FF8D [email protected]
690,252,888 *4742B7E897E496BB8C9D47B53AFC18D28FD1B00E JEFF.MIDDENTS
690,252,889 *47483B8484503C3C38D25941699DC20605D0C931 jeffreyyaffe
690,252,890 *474EA36AC336EDBD57BFAED4F859BD3284E00084 JEKKUJA
690,252,891 *4746C21EAA45A9D2A4BC855F6668C5509909EDA0 JEREMIAH.SKOOG
690,252,892 *47448BC76A3910B18AB3B85D415E5562DA40D8CD JEREMY.TROWER
690,252,893 *4746B71B4EB48993B5D12030191F0A99AB6EA288 jeromylamoree
690,252,894 *474DD4C3F433564A65B6B9DA5B100E417C294D53 FINGERSTYLE.GUITAR.MASTERPIECES
690,252,895 *474010D0367E57955A8ADC44023994982EEFED80 firmiger
690,252,896 *474FAB3A65D31DE1C2549C80C9F220FE16809886 [email protected]
690,252,897 *4749818BED37303C242E73381BCEFD898AB73290 FL0DN4K
690,252,898 *474C2D7C2BC5BC21710FF8A9662E41FF7DCE4741 FLETCHER.DIETLIN
690,252,899 *4749573FE6BC34014A33E7D6E9EF911B1286D288 flfbaa
690,252,900 *474024C231ED0F39EA74F98ABD64D920399E7B18 JIM.GOODINE
690,252,901 *474886BCF66018B94C1603B122F41D6802DE4F32 FOOL.NOTION
690,252,902 *47411A13AFAEE496836A161FFC7D0B1B9311C2F8 [email protected]
690,252,903 *474D7B54A42FABE0938D5FC9B47AAE2CFEA1DCF9 ForReal(intro)
690,252,904 *47443FA247DAAA292E61D6ADDA8F52EFD2867814 joaquingerl
690,252,905 *474622A7457F69A1A2EE59E41C9C59899732E1F7 FRAGILE.(ALBUM.VERSION.FROM."....ALL.THIS.TIME")
690,252,906 *474029F4FA5C96ECED5FF06A7CDA2F76DA6D5F23 john-mayer-daughters
690,252,907 *47487FFA77E59312BB7A0F1C5F94B7CFDC3FE178 FREAK1BANANE
690,252,908 *4740230A0575418A2CA3890938D6EDF6DC07FFD0 fredvandenberg
690,252,909 *474BA6EEACD6E6F418B7941D4478E49E354EC14E JOSEPHPORTALATIN
690,252,910 *474653D52D991481345D148C2255FC1CE4A263C4 FUSTIGATIONS1
690,252,911 *474E336ABD4DEC026C9883FCF6301F1F80568FB3 GABRIELLA705
690,252,912 *474A545653597E05DCD0AA7FA7C31C0D33EEF5BF jude.laws
690,252,913 *4747371F8D6D496CCB50E277CBF429E3EF445686 judsonbare
690,252,914 *474C166C7D68EC0FB77758D3E9734BED195C3333 GALLIÇOPHONES
690,252,915 *4749479DC43112BF626D59F3F9F19BCFD1398615 gangster79
690,252,916 *4746A51E64EDF16F91535D2B5569DD642F93382C GEFYRES6
690,252,917 *474768372DFCB7274B8E1F6F23686B7C6F78F058 GENEANNEOGIE
690,252,918 *474191984C960EDB6902F2A6BB66A30F3B007F57 KATHKEVI0
690,252,919 *4744786B2B2D035FB8D9470C37E32C93FE0171BA GERARDONICESWANDER
690,252,920 *47462DEBC55F792D2BD7829C2B4E3615514FE56A [email protected]
690,252,921 *474C2F990B1589B93E3EE8416081F5901469DC62 KEENAN.SEASHORE
690,252,922 *474A7C19D0C897310EE0A0AD0E9154471A233157 ghjt
690,252,923 *4747E0E01423F52CA1EC336C7A2EC60D90875731 KENNITH.FULLENKAMP
690,252,924 *474D9334819642261E0646D02E66EB81AFBF22DA giovannidare
690,252,925 *4749B261FD65B46D098CECB06F74337704175AEA gjensidige“
690,252,926 *47464B281C307016566D126D2592A2E15ED8BE7D KIDSHOME3
690,252,927 *4744DACA1AE7E6145BAAE9366C604E85F010BF22 KIJYUTSU3
690,252,928 *474C9B3C48810906106841E35D7CA404B7ED9899 KILLING-THE-BLUES
690,252,929 *4749CEC03431F7CF7CCD5C3B0E719D30C4E10F28 [email protected]
690,252,930 *47470B984DC3BD67F73EC4D0F462A24036F4880F KLICONO
690,252,931 *474A5AB46090A187531E21A48254EDA108158F2C greg.lautz
690,252,932 *47465772A19A5A8853D67E2C7B1E84239EB2B65A KOZUREOKAMI
690,252,933 *4743E67276F44389EFC305B3CEDF763527ECE6E6 grumpily
690,252,934 *474AF6B65A55326497544462B565A43B78F1F8F7 KRAIG.BICHSEL
690,252,935 *4749014DF55A9F3B433C7FD5A93F1104BBADFD7D [email protected]
690,252,936 *47477125287FF8B1033F0B1B85BCC35C143D757D KRAYZEE1
690,252,937 *474836851D30746DF5706A9A308B5DA2A70A6FEC KRYSSYGRIFFIN
690,252,938 *4740116D58CD8D56D59E271492F83F8E40818AC1 kyledonlin
690,252,939 *474387020395F866EB4418B9962B9BF3D6FFC410 HAI.LORDS
690,252,940 *47435255A2E376D76002A6005006D962111D2DC9 HAL.OSTBERG
690,252,941 *474BEE2F6A9D0622A977B8782C172E1C32D45780 LACI615
690,252,942 *4746D9D8E6E7C903538E306778117CDFB79A99CE LAEDOROMASTIX
690,252,943 *47472E33038C4AAC8EA2CF31824EA312BF1E4CE6 [email protected]
690,252,944 *4747D03B9803933C8FA97B2496B92DC6242770B3 [email protected]
690,252,945 *47445F677E4CE4C34354C279E1E08FABB73E6DB3 (LAJOS)/ルドヴィグ(LUDVIG
690,252,946 *4746A512F702CEE6472978A819A7A18101E9A134 lakerslindsey
690,252,947 *474E595A3134EC45571F77BC7E51E5FBCAC156F3 [email protected]
690,252,948 *474FFA743878837FBA30EA6986D33D0E62841B15 lancegavia
690,252,949 *4746D6B6D8E421EB0CD8C08BEF575E266D6C6BA1 harleyvandekieft
690,252,950 *47475E34A38C9649031A4C67E0EE93D14FF56DB8 HARRIS.COPENING
690,252,951 *474648959D67E4F02DCBEB116022A68F143D3277 HARRYGALLOWAY
690,252,952 *474D601ACA241F24A9C1BEC3758466CB5D3E4BD9 harveymateja
690,252,953 *474A46780805FAE3321FBF74013D5DD7AAFB894B HASIGETA2
690,252,954 *474ACDD5B58EE34E041017D6B3F94D5F9881AED4 hassanschreurs
690,252,955 *47497378F3C0A4E11CD7FF53482D752DA9EE00D5 [email protected]
690,252,956 *4741F79DF39CB591C4F9A63BAFACE1411285B1A5 LASINTHAM
690,252,957 *47422E81F0B3AE6D4F3294036EAD576574D44ADE LATAATALED
690,252,958 *474E476BC2568BF477B1869341893A4E6550B7B2 laterepeat
690,252,959 *4748CF3BBFE0386F91604979120DB4179112FDB9 LAWRENCELESLIE
690,252,960 *474C01D60B1D661DAE7C80C827B0A76CAF059A4B HEIDI634
690,252,961 *474D8893D56B351950DB37C58FF028B1E0264828 LEG!+!MA+ENE$$
690,252,962 *4749550E80D181DECD78E1B6162E1A695F50E7A1 HENSSNEH3
690,252,963 *474510FDE4392389C8555C92AEF2B7BBC46AD97E LELANDCRICKARD
690,252,964 *4745A398D8F48707E0D9024080E5BF8A8A33885A LEMUEL.CRIGLER
690,252,965 *4746F2DEDCEDB7666D65A8EE6674F0AB28C9DAB2 LEONARDOSHAMBROOK
690,252,966 *474A69E6DF84DB85950DEF3685C3164435747A3F Hey,-Sing-To-Me
690,252,967 *474B7EBFD4CD73358223E85FFB7EFB48D89DE21A HEZAAA
690,252,968 *4742B4994C03C406F73BE10109441B57430E4953 LEOPOLDONIKOCEVIC
690,252,969 *474A1B0A346D114524C13D910723F60BD5B93BF9 leroymochizuki
690,252,970 *47415C886D79B8D62D4A7FC3F058FFEE647C10CB LES.BUNT
690,252,971 *47424BB26ECB089A2FC2C7FAD3DF5DA4EA3A4C8A HIGASAYAMAMINAKO
690,252,972 *47451AC312782CA37F13DC29DC64BA79236D9EC8 High.Noon.II.(The.Return.of.Frank.Miller's.Son)
690,252,973 *474C9E79BF7E0D9A4B67B4A1C033AD4819588986 LEWIS-PIPKIN
690,252,974 *474F068026DB8F6D30DF0096781FF47340E27257 LGAINESRASHAD
690,252,975 *4746B8866C56B1A52B18AE9DEE47586E0F2BF022 LGXW
690,252,976 *47456DB4F0DC2A5A84BBF2F5B0924D387750CF8D HOOPDREAMSORG
690,252,977 *474CCCC5032E8C133612A963A8B2A2101F280986 linda-nieman
690,252,978 *4747998B7E9EF25F633CD947A21FCD8B72324F08 HORANDE9
690,252,979 *47491CF5DA36F11AA5A7AD9F0C54936B32D5D94A linette.liebenberg
690,252,980 *47440C8287687AA225FA1CE4A0DCFCF92FE017FB horsepond8
690,252,981 *474191897A5C3624C1F3CECA718300A46F61CEE2 LIORAU
690,252,982 *474BBF541A1706277996A98A8CBBD75B86E107A9 houstoneastes
690,252,983 *47424080C2E70863892139D257163A56F18EE01B LIQUORBLUES
690,252,984 *474378B8DD583CA369B924881867FD7F5455D756 [email protected]
690,252,985 *4743E8CDF8971CC864935B3BC0ECBBE1A1223921 howardlenhardt
690,252,986 *474E32E2CA914998996E603830206F2511244583 hpk1
690,252,987 *474253F30A9E1E2EA44A14A2D9F75200D640CFEA lloydaereoboliviano
690,252,988 *4743B289AB5A4283519A1B56F467C50C17726E10 [email protected]
690,252,989 *4741FD30527005CB29CE2CE028FAF3A5211FF4D7 HUNTINGPEDRO
690,252,990 *474913F3B045BAAE9905E1541E20FC4C63392A13 hymancorvo
690,252,991 *474E5057C7CEE3DA8380443C17BF7C6FD576E2B2 LOVELOVE2
690,252,992 *474D99C75DBB7309A5AF4971FE5E1A59A2FDA653 idhokthl
690,252,993 *474472D0343268F55E64A977CC7A108203ED24B9 luciusprichard
690,252,994 *47401A2D6C77C54A7B1B89EBD4187023A3731655 IHCIFITA5
690,252,995 *4743EE2C79164A18FE9278DEE203D99717890C23 IL9
690,252,996 *4749DCF900FC4BFBF02EEFA008AD0F9C44567058 [email protected]
690,252,997 *4746E79719485F1EBF97A4885826F32F2493A215 ilovecicero95
690,252,998 *474F5EF91902812A66A410B53CED53D27123A61E ILOVEWINTER1990
690,252,999 *474C123047F37CE94C8297C8021D891515F1B2FB ILOVEWOODY9
690,253,000 *47404357F336EC9D55254CAE2491727496350250 ILUVSATURN503
690,253,001 *4742456880A23449AC61F2B8CC3B425C9EDF68C0 ,M9AAA
690,253,002 *4741F982E717CEDA23FE3DBD460C88B1EDF6F789 iluvwill23
690,253,003 *474A4DA167E40A8A61196B7838F6CEED5AC6AA0A magic808
690,253,004 *474EA556EDE56C4D60BFD28A784DDD660332B4EE MAJORVANDEVER
690,253,005 *474C8E2DA0F5F7967B622C8088F8D4D571347187 INCIDUOUS
690,253,006 *474F00334BDA0971971F097F99B6BE16801CC649 [email protected]
690,253,007 *4740D2FF44E701AE0EF9DD03E38E9CC2B1D5BA00 MARACHERING
690,253,008 *4747CF367C2FF324654B7E517A8CDD239283FC1E MARETOBARETO123
690,253,009 *47478DDC62A8C0B650668763F12B857A439D7490 IRMA-BARBOSA
690,253,010 *47467355CD47F4052690BE1813BA64F040CD6BEC IRTEZNAA3
690,253,011 *4745EF48B9865887C99458B7AE39EED728B39AE1 markmila31
690,253,012 *4749235D7F87C95DEAED737294639A14624CC461 MARQUISBOCHEK
690,253,013 *47490FF6C6CA7D639C172A9E681CBC4FA10D5615 marumalarachi
690,253,014 *47409C21532A2989751BD1B088984035147FB151 [email protected]
690,253,015 *474620B1C115180C399706F3C28BB04A670E0396 ITALIENTOURNEEN
690,253,016 *47488872C30DFEE095F58E7FD3BFCDA254EFE184 IVANDUSAK
690,253,017 *474EF5B2B70CA8A7925E1B29C4982A5FBC3FC5CA matlachabridge
690,253,018 *4740D4DF49DEB110734513F9FF50C19476DF0E5F MAURICE.BALLANTINE
690,253,019 *474E310BAB96EEBB8AB66078F94FFC6A14C264CD MAXCACCAMO
690,253,020 *4743EFEF4E50D1A911C4BBF1DCC3B4550A6E9500 MCS501
690,253,021 *4740AE48238A193869E4A3FE2A5B3A7DB9B74FD5 jaimemarxsen
690,253,022 *474C0997AF5B19A6FDD24D1CEBC44A80A019ECD5 JAMAL.CASPERSEN
690,253,023 *4744C6836D054B4287C3BA42FCE1E5E84C1A17F9 MEGANDULCE
690,253,024 *4740EECBBDC33259227042C874DB9E6D5DD77E99 MEGAN FULBRIGHT
690,253,025 *4740D7482C6A6BCA7E42EDDA739A383B5C572DA6 Mehrpreis
690,253,026 *4741E0EFA2DF08C0F2BBE3AFEC886F9862B7B22A [email protected]
690,253,027 *474F6367FF47805C57C49F6D064E331551887FD2 japanischbitte
690,253,028 *474015A72A82F4D412F24524AA69432C34963120 mercedescloclo
690,253,029 *47491FA8474786FF5D00034B0BC4BF0281279D31 jarrodahn
690,253,030 *474BAF0F046B18B51F50D03A3268AB1925EE85E2 metabolte5
690,253,031 *47417BF15D74BABBF5A07D70FBEC29E15884BF41 jaysonveenstra
690,253,032 *4740DDEEA83C881B684252ADCA90C221407B6017 MICAHSARRO
690,253,033 *47457F62629FD368BADE7AADC36CA03C0D142286 jddv
690,253,034 *47436763AE0A91667B2F472BB9CFBBEBD2C0DEF9 jeffereymcclosky
690,253,035 *474C93C6A3B574449C88B2FC2D6801E4A74F8717 JEFFERSON891
690,253,036 *474BF79DF33CC735311D1367D139B58376B3B76E mijretnec
690,253,037 *4744AA3B2D798589DBD31B527A7A3014436BA13C MILAN.IWAMOTO
690,253,038 *47499BBE0DAEC79B42E75E420C4C4BF8A90C9D75 milanshusta
690,253,039 *474E712FAA721B5A9F7E1C003E19579EFFCB9558 JEREMIAHSOLES
690,253,040 *4748AD43CE963DEEC4521A6C741924F6FE5D466E JEREPECOR
690,253,041 *474ECE9CE63D2B6CB20345700ECEB5ACCC8151F0 jerroldbierl
690,253,042 *47464316325E000C4B6003E9164CB0AD79E4AEF9 ministertische
690,253,043 *47454CC526AFC2B39743B9C1F9CB11F4B98D6B3B jessehowe
690,253,044 *4741A24DBE5941949A413CFD27E848E36A11666C jg1820
690,253,045 *474055C3DED919410064CA1C5AB4B1E8D4D4EDC9 JIMMIESACANE
690,253,046 *474E4822FB76DF17C426E6C03977061BBDAADF3C JJULEOUS
690,253,047 *4740BB89EFE5A6F4FED5F562A701EEB44A5ED35E JLIFRAK
690,253,048 *4743718D1536BA906B543BEFF8FAF83E7355CB7B MOJ4K4SI4
690,253,049 *47474020FE3A89266343AEB428B5EC95A535F1DA molly-szeto
690,253,050 *474B220C8EFC9AE0E80A9A658D8F9CA81A590869 moradacosta
690,253,051 *474D9773171B5CC5B6DEF7BF405F02F0821CC959 moribonds1
690,253,052 *474C7EF9A125BAB40765E4EF8DC5FFD58ACDD61C mountain
690,253,053 *47412570AEB974362CF704AE0986855E3C735B73 [email protected]
690,253,054 *4744068DEB03942EC6FED01114062E13DDF364B7 JOSEGUILARTE
690,253,055 *474259D0B2B02C0462F5D5CC212DE6686DE7665A JOSE-MANUEL-DE-OLIVEIRA
690,253,056 *47405C01EC8B729681CAC9A65CE0CBF085B877A9 MUBI.UMAKELWANE
690,253,057 *474E2F33E824EAEA6B459ADEDA0913FC93E201EE JUDSONSANTAELLA
690,253,058 *474C21C069F53267E701388F67E7463D2C2B0DE4 julecupen
690,253,059 *47468FD13F95C74F3906CE43EA8D22E4023220D8 JUSQUIAM5
690,253,060 *474DF1E3866C0C31AF925F28293D609E24F32C13 justintkacz
690,253,061 *4747B0B2B760E74904F705A210BE2FA527A31672 juvandes
690,253,062 *474E612F67217B1AA81AEBC6FA4E8573A51C4F0E NATHANIAL.GEERS
690,253,063 *47487CF79A6F6E0470CC8FC00DBCE6A3D3CFDFC7 karenmarkey
690,253,064 *47442E866F8C29710C356AE84AB6C9CF5055F3CD KARNEVIL9:1STIMPRESSION,PART2-3RDIMPRESSION
690,253,065 *4748159E2C2707E27BBC009DF8CCF366E99D44BD KATYAALBA
690,253,066 *4744AA840475261EB7CF583A369961027C39A5A5 NEALWEMHOFF
690,253,067 *474541574158787C939EC75AD9154A63685D0375 NEC4YOU
690,253,068 *474F9A7BE9BE88C05B1451B4E79BFEF3A0E08367 KBDBS1
690,253,069 *47427A31AA00913E880D4F1CF37FEC024F5EB162 NETHSINGHA.3
690,253,070 *4741466F4CED190F7EBDD0C47E300082776DA224 NEWUSERSHELLEY
690,253,071 *4749F344B7E283E72D9AC178E350B9855B9E013A kidsxxxx
690,253,072 *4747A24C459BE54B52AEB646AF3C1A02193AB212 KILEDEE
690,253,073 *4747662A28CDD5E3563329E86649DB33F2B95190 KIMBERLY APPLEWHITE
690,253,074 *474C355AD578691DD1898A303F571D0D9EE8C9B9 NIVINI
690,253,075 *4740574AAD1B6817FF48ADBDB6ECA411549FB875 KINGSLOI2
690,253,076 *474D64A7A8BEE9FA1EE8B04E04F5CBD1997C54B5 NNDVNTSING
690,253,077 *474914C3F6BC34D519E415BB42D689FD0F999CAA nonprecedential
690,253,078 *4740D30C2C47861B7B006D21146081B1B11BB29A KORINTA1
690,253,079 *47485AE19BEBCEE7ED51025DF4016B03555968B2 KORNELKRANKHEIT
690,253,080 *4749BBC73A601F581E99F16A13CB5E3649DE5B36 NTLPVLS
690,253,081 *4747E70EC3D23260EBDDFB2AEEFDF97422FAED1A kristopherbenward
690,253,082 *4744DB0D36D7A37B9909B339FA7E5A194680457E [email protected]
690,253,083 *474C7EDE26F2FDF016A00DFBEBA69310FD4678BB OATIHCU5
690,253,084 *474AC78B0E456A8B4BF53A798975EB5CB4D4B39F kylepolk
690,253,085 *474F0F6C4E021B85B603C2678BAC9D4AB006D004 |l`
690,253,086 *474DD03AA6BD985F3C4E360D7AF74CEC54E25B4E LACONSONANTEMUDA
690,253,087 *4744D0CF8F1F25F89B47AB6AE7117166194FA372 ohl'amour-yessiricanboogie
690,253,088 *474D5F3EA156E571D906903BAF6FA1473125716F LAKEMAN
690,253,089 *4749DB887830457152408509F76A7AA757F298EC ONIRRETS
690,253,090 *4740F0E4F67B8DC614027A9205382FFBFA6CDCCC ONLYAKISS
690,253,091 *4743BF9326B3D1E56E69AA893069112D3662D94D o,r7
690,253,092 *4746BE47703CFB9E915013D459D30FBE7D141D20 [email protected]
690,253,093 *474CF40B019CFBABC70EFD9ED481EF46E4675375 ORVALEINSTEIN
690,253,094 *4741207FFEB6C54964619C0C205AC406AEE0C2DD ostrogotus
690,253,095 *474BF509CC811C707A1DB73A08CA8AE09F2B5B6F P011U+3D
690,253,096 *4748B4AA6C2BD04DE066E8A9A0567F795414FCCB p0r70nle55
690,253,097 *4741FF2DBE91D5D2414E2617A95A9E0C5AE4400B LFIFKLYL9
690,253,098 *4748482238F1E767FB543328A67686DA4E2C3A0D [email protected]~0.splat!!
690,253,099 *4749FDDDFEC7158D1A60B16B91404BF716D1D64B [email protected]
690,253,100 *4741A1B06CEE3B523D9E408911B52F9D9909F8AC [email protected]
690,253,101 *47408E9F3D4257FF4EF14865306A1C4A082CDB52 PAELLAPARTY
690,253,102 *474566E69C6535E35B5FD91FAF78195E6FCCF3F0 lih-fang
690,253,103 *4746D3F14AFEC595FAF96D84ED2C260DE13D8A7F PARKER.CASSELLO
690,253,104 *47417621E903FC80EA4393A526DECB2C038600F5 [email protected]
690,253,105 *474C742AEC7CB8ABF8FB3D498648746949E87862 PASCHIJA
690,253,106 *4745C92F0B244082218BF1B9AC54E47523C510A0 [email protected]
690,253,107 *474867754070DAC215B20D99DE0B481B2014F4BE [email protected]
690,253,108 *474596B74BA56988B2EB03E1D11DFD668C74F682 LMUTANDIWA
690,253,109 *4741E5BAE6EFF5699572447163E76A1ABEE51C25 lobatsh
690,253,110 *47488F1239AD2D29BDD89CD6EE7018A8DB328DEA LOUIEMANSMITH
690,253,111 *474C1EA35A65F5540FA96CE90451A595846732A7 PEPSI1292
690,253,112 *474495619C416FD456A9F4662AF8E1942DC442CC [email protected]
690,253,113 *4742930FBEEF5224E3EA8BF3BD18A05F7DB00C7D PHASE-2---SYLLEPSIS
690,253,114 *4747EEC1A0012C95DA6199DFA407A76DFE8AFE09 LUCIOKUMMER
690,253,115 *4748868E963F30C6EDA73C23840368CEDC54A3BA PHONE:[USA](415)853-2226
690,253,116 *474C4771DD27499C01B08145A0E9886DAA2B3FA9 [email protected]
690,253,117 *474F41C213A397F1357F1847977CF6A94B42361F PHYLLIS.LONG
690,253,118 *4748C865E4BCDA59B647CA7DAEBB56964CB9F2DD [email protected]
690,253,119 *4747C351E9B645F74EFD3A4DDF73DC50437645A1 lukeberge
690,253,120 *474D96EE32C130BFAC26676E1AD6289CDC528791 LUTHER.BRAULIO
690,253,121 *47475B6DC7BC0510578D0650F5459B24913A5031 LYNDON.COURTNAGE
690,253,122 *4749F9762765AF328EF5E7BE920FDFBBE04D294E planiphyllous
690,253,123 *47498EC5EC0B416AA0E8764B4CB8BA3951EC9CA4 M6035M
690,253,124 *47499B393333AEAC31910B68382F99159BF490DB majeur---Allegro-moderato
690,253,125 *474E5D5416B533AB1D63B931DD58EC115A0E83D8 positionne5
690,253,126 *474C05EE0F11D6D2772BD8F75E7BDB7AC2746644 PREDBEZNA
690,253,127 *474F1D93CDAFCC1848DE0C3791083F4869889F36 PRODUIRIEZ7
690,253,128 *474289C1EE62C0723D01579D956A7BD64E279216 MARKABRENIO
690,253,129 *4741CA19913E07C8C3D4C5BD276CDB8C026AD36C PROFRUY3
690,253,130 *4740BF6C9380B84A451C7702D1469BA255785767 MARMOT.BLOGS.COMMARMOT
690,253,131 *4748EB888FE4C239A9E3B34DFB38F5361AF5B933 MARRRA
690,253,132 *4745879CA5E290906425BBCF8A47920C2DA74B37 MARYALE8
690,253,133 *474D1FBB5640D23D0B8A1A4135B9C5380A94811E PUCK12345
690,253,134 *474BE08AF1794CEA18BFB8DCAB27190FC7B3B1B9 MASTER CID, WE MEET AGAIN
690,253,135 *4744BE5A3684F23D30B72DFA4358EE8AA40A54B1 PUSSYRISK
690,253,136 *47493F9DF6748C3117C33A82F1C34C33A8473DA9 MATTHEWWEAD
690,253,137 *474759BDE910D51122D0709AF008D2711773B0E7 PYRETHRUM1234
690,253,138 *474E8C19036C4F13AC7D8E4141B71830EC516693 matty boi
690,253,139 *474F922095E5363ED00E6557C6DCF77C708BAA33 qD~~{x}
690,253,140 *474E3E82D13BF4A4E79E206FB8F9D1573748673A MEDICINETRIPOLILIBY
690,253,141 *47474191B4A832161EE4878A4F5126243D8BC24D Q----P ~O ~O ;)
690,253,142 *4749720230970F4628D6C769CDB3A6F5FE1824B4 qua
690,253,143 *474ADE867E8C31CBF4B9C908508FE6023A6442F7 MENDEL!4N!$+
690,253,144 *474EF9820CDCCF67E765169AA82E34300C3E85BC r3l4+!n9
690,253,145 *474591551DEFB7CA4607132AD9D68ECF0781EB1A MIA'S THEME
690,253,146 *474DC74A196B55AC2F573D32DAE08C5FB3B57496 ++R4+OR$
690,253,147 *47450D204A39B2858E1C83B1CB1D708C1F480082 MICHAELTWITO
690,253,148 *4740A8D3B96F848D2C4CAA2921D7652F7B11F816 MICHAEL-WESCH
690,253,149 *47493A6C031BCD084BC92521684D0DE8733A5ECB radentes1
690,253,150 *474DDC32D57F49AC895226DB1DC057FCB20F82E5 RAJASEKARAN.RAMASAMY
690,253,151 *474F771FDC6AE91BE553F38F16F5FEC0D7B376A0 MILANFEDOR
690,253,152 *47426A9E7DB91CB0BA49D1627CFAFF7B1266175B milo2354
690,253,153 *4742A1D41ABC6E999C26E7B41128D7BF0EB368AC REAXIOMS4
690,253,154 *474B72377527DBF657F5E17D7261F08578468AE3 [email protected]
690,253,155 *4744DE42CC48ECC187258DA19D072AA69FE272D5 REBRONKIE
690,253,156 *4749B69F8ECE3929F2348386CA05C19833339E06 recallsallylieber
690,253,157 *4744126B2DA5D565970279370660EC21150C35E0 MOCONSO
690,253,158 *474296BC9DC8251C7F93AAE2537B60EEEE703E62 redsage5
690,253,159 *474D000950B778CD2F25E93177A1364951EE80EA mohammedbenyusef
690,253,160 *47490138C44658DD42AAA0E4EC55D614B9C4F489 MOISES.ANFINSON
690,253,161 *474E1727D616259F6321D377A19A2F20745A6723 moldador0
690,253,162 *474B91BF0CE7CE43887D270401D3685AD9FEC302 REGGIE.KAMER
690,253,163 *474D4E1505D91EE1A8C10BEBF30F3910DF978169 REICHSBANKRAT
690,253,164 *474DDA27EE77F1997856A6A72896D8FFC6D4A8EB MORGANWERLE
690,253,165 *4740400672D307B903AFF407BF9E446A7842A196 morrisstalls
690,253,166 *474227D1B30E0D4020A89A9732A149B51A806EA3 RENALDONAGARAJAN
690,253,167 *4743BBD7444F408D68F90E4E6F8EC361DECC0309 MOTHERINGSUNDAY(LEGIONLEGION)
690,253,168 *4740BC908D574B9028645C4F537F90DE2B668496 m.repple
690,253,169 *474E55E4ED23D21C154E3C6B4E333C5A5BA7F60E [email protected]
690,253,170 *4742E76E2ACCB7BBD271CBE5ED47C7A0ECAF7FE1 mwh7
690,253,171 *474ABCFD7F0093CF79398B5DAEAD674374499A5B MYMORGAN2002
690,253,172 *4749CDA9DB807B1C86BEEDE20495ABC2EF8B0FAC RICHLABONTE.NET
690,253,173 *474FAB97554CEF5E28298B98FE72FC564B26B2CC MYVIDEO27
690,253,174 *474B76644D568FDE888783A9637298A76674A91B MYWALTER33
690,253,175 *4749404F46350491E3ADB2290AF562ACC92BBE2F [email protected]
690,253,176 *474A022F0FB96A9A45DF754BA0360B6BC2F67420 rifanyés
690,253,177 *474566B159F8B8B090F1F8D502971F1EE9131160 N905IΜは9シリーズでは初めての薄型Μ端末である。SH905ITVはドコモではSH903ITVに続く2代目の
690,253,178 *474EC29672921256AE6E4C9CA95114B34160D6F2 N: ACT II SCENE 1. PRELUDE
690,253,179 *4747D2D2C063171F8214475F1D509025F3799E1F risteilijoeitae
690,253,180 *47435A8879D407884E2439785418E0AF780ED9DD NAELIBUJ0
690,253,181 *4743EA5B7F3D16280C232A427A8D2F5DE5261EE9 NahtarejaMoIloDanljan
690,253,182 *474533493D71A16A54BB7C68AD52DF5F2B0BB70A nastavljenoj
690,253,183 *4740E9A8DA74E31DCEB8728B5087CBDB95FE8A1E ROBERTODOLE
690,253,184 *474A01D61C8630DBD4ADC5B3AF141C52FF4DC472 nathanaeltavis
690,253,185 *474BCF935EE9ABA5D507B5D57E7E36FE37440C48 NATHAN.GUILLOT
690,253,186 *4748627EB0DDE3A6A377FB6EB82979FBBA028CD3 NAVUJOL5
690,253,187 *4747F9DFEAF07EFF81A184CA181876344C055991 nazihitler
690,253,188 *4741E9F323F007B13930BA522C80433A82A2745A RODELMAYO
690,253,189 *47423DA336893B952D949E6CE0E3B780C38B79B4 NCOLCHICINE
690,253,190 *474777B168B1CDE30284FFD5E47426AF61294AEF rodparenteau
690,253,191 *474AA6CCBA10F888125E86B301B2554657E6F944 nestihnu5
690,253,192 *4745B6D273E176DBB862C953B2356A005B8FCACF NEWHANDS
690,253,193 *474AA52ADF444BAABAF9B563774860C46AC81AC4 newtonhoar
690,253,194 *474F0E29740BF26563CD5B2A6919774A898E62E3 NGUEZBARBER
690,253,195 *474A86C634EAE4D3FB99920115254B0D30A51368 [email protected][email protected]
690,253,196 *474B5883655A58C9C346AF32C073275D4F931F25 [email protected]
690,253,197 *474134EA637C38CAD04E653315660812E5746D58 NOBLEALPERS
690,253,198 *4741993131570030CFE9769E69A717F750216D82 RUPTURER2
690,253,199 *4744DCCE6061081A4AB0D02369C581C386BDDF07 noncorrelatively7
690,253,200 *4741B76686609D7FFA6CD6CC792ED8903A16CE5F [email protected]
690,253,201 *474EAD781FC87A8C75349549D77D38AF15933EC1 nørreborg
690,253,202 *4746FFB3F417388DD695C2E536D6F29E071C4C43 sadagorahottub
690,253,203 *4748369E3D8B722B1F46035D50499FBBCB2941FE NUTMEATS
690,253,204 *474DED4ADCD4219D0422F0E917AAA5B411688ED0 n.y.aire.acondicionado
690,253,205 *474DB825EC08DBF3968B36B7E3CA36C1D9D44BDC O~0~.D=B
690,253,206 *474FEE5166B52C0C1ED89442A6EC72E9B9B32454 o1c1o+h5
690,253,207 *47420D0492610AAFD54E48068AC7B1349D3CD53F SAMUEL.BABULA
690,253,208 *474881FBDE0C6AAB3BEFA57D254940F38221AE24 SANFORD.LINDAUER
690,253,209 *47498D41A4CFE1FC88DB5991B734EC469C6A8889 SANTOSLOESER
690,253,210 *4747F8D23FB524E5BFAA66FA4302EFEFCA30EF96 ODEKNUT6
690,253,211 *4742FCC96C23FB7715A843F8EDE96E092C65B123 o^jgs,ujp;
690,253,212 *474F53CECC396443381F5EEF4F14AECB714F57B3 SC010RIRE
690,253,213 *474F19DD9137307A7182213FAA909CBC6444F1B0 sc4009
690,253,214 *474294C7A00C41E4E76BC9685E7BB674A477EEB6 SCHOOLBLIJVEN
690,253,215 *47444C779390EC1BE7AB77419F356201B5B0F516 SECOND-VOICE-(LIVE)
690,253,216 *47432913CEE70657E7D41E27B505FE8F9CFBBCE6 OR94N!$M$
690,253,217 *474A646E8D392C969945E83F950D4BB6B10F167A SELFLESS
690,253,218 *4740FD887272A8FECE07A28AC83165389934236A SEMIYEARLIES7
690,253,219 *47415D54023D4FA70F9B57820ABA8FAB9A9808AF SENSORILLE
690,253,220 *4746722EF86F06C239467B2602F10259E596D1B8 SERTHIG
690,253,221 *4740BBA7F8D7BCB9A8051DDFF844AFD1DF9F1FA9 sesempit
690,253,222 *474E38EC0B1A44C391E0299C34EA8D8351E71441 [email protected]
690,253,223 *47456171654D95B062E2B9E5AAB797F876D3D7A7 SEYCHELLERNES8
690,253,224 *4742F18E19A35C5D515C8F8184556B088FA211D7 (^_~) ~` (p
690,253,225 *474379C092053E7E38207166D7056FEA361CF27B p---->-~-~-~}8{
690,253,226 *474C6F2D402A48AA6171BC08FAD6DDF90F323D80 shannonalbe
690,253,227 *4743DBD9399C00C186AE747976C9B631B308B17B SHAYANIRANI
690,253,228 *4743071B2BBA4785FC828600DB4F8DC3550F2750 SHAYAN MASOOMI
690,253,229 *4741DE9684730C7C4AA616BD8A8E13B405BDF74E SHEEERTL
690,253,230 *474445E17D7589E05E5D4E51548744CBE06505A2 [email protected]
690,253,231 *47480E88E5BAF1C2AC511AA7269E0C41709ABB6A PARADISE.(DARK.LIFE)
690,253,232 *474FC9C9A821904C5C50F940F0228F35809981B9 PARDUNEN
690,253,233 *4746B43A8C4D704CFBF8E1B7C160D0DC200E7037 shirleyflowers
690,253,234 *47495C1FD11FE1B784A2D02D4BCC998CE304198D SHITLES1
690,253,235 *4740E08780BC7092F24649D97A42166121CA6B44 PAT-TORRANCE
690,253,236 *4746AEBDB1B6518E7C3CD10A035BC683F78ED499 SHUYAO
690,253,237 *474B22FFD50914902884449E5E80E4B8E8B3AD57 PAULEKIUTE
690,253,238 *474E5D48B776990C183B75684106CDD2E269F68D SICKLEWOBSW1
690,253,239 *474C8067F34A6341502A0DB17366233919F7C761 PAZZANI5
690,253,240 *474FFB7168EE24B11D7F3C22EE9A3FF4189341D0 p-----B ~0 Splat
690,253,241 *474FD12726195E893D174BC66B90A3D7BCBCBFF5 [sigterm] blueice == bluice?
690,253,242 *47451B78BDABC3AF4EAD5678443EC2BEAE68109C PE`3
690,253,243 *4749B0663DAAAC7FDEA2601DF5544EB637DE6E10 sintheim
690,253,244 *47479CAE2C73E4FAB418CAEB9C1001DC3A495309 SIX...CUZ
690,253,245 *47440183C32A3C5B62B43B0022C649C4DA227A29 SK*A
690,253,246 *47457043B49A13B738101811FE01E722D3CFC238 PERRYMIYASAKI
690,253,247 *4744005A28F041CBA5E93383360AEDD6DB38CB4B PESPOLN9
690,253,248 *4749CE0CDF01E8DA438DBE6989AFECF21DCED202 sk-sq
690,253,249 *4741FD6D83ABC354725E12D35CCE368CD8901ED7 SLSTTLLYING
690,253,250 *4746000A608B36C988974779953C411189CC24CA SM3ZJVIK1UUPEC
690,253,251 *474D633E7E8A3FCC27F47638E4FF36BDAF9522D0 SMORRIS22
690,253,252 *4748A3CE0EE9771687FE22765108A5E6F167A5F5 piano-smasher
690,253,253 *4742B9E854D8034757610255CFDB037F9BA3B907 SNOWBALLCARL8
690,253,254 *47492552F55D7E9331E80790DC7906CF01D38D05 PIT4W4S
690,253,255 *474D3BC8B0720055A08AB95A76241DEEC4C4F6EA «SOCIOLOGI
690,253,256 *474DF8B7B964C1D8E0248E65D17C76FC28E3B0D5 SOL.CAHILL
690,253,257 *4746C1A0EAD09603EC6A58E54CDBB361DCD9A494 SOLOMON.RUSSELL
690,253,258 *4745E67B47D5033B93D76404B73254B4806F6ABC plu554ge5
690,253,259 *474D73B269E667691F2CD9362DE164E87DF6C6F7 SONIAGALLIMORE
690,253,260 *47412F5FA7A1457D4647307BA360808E856B907E SON.MULLENDORE
690,253,261 *474AEC692D162E35CEF17A76A75E2BC458B82581 POKHARELS
690,253,262 *474664FA7E1D691737E30A475D6B374A61C5E0EF SOUTHEASTCOLLEGE
690,253,263 *47476B803A74829442CCEDDCF5D34E3C01034071 POOLJUST
690,253,264 *47492A0EB060EF78278610BB45594216EB34611B SPIDER_WEB-SP/AI/D/@/R_W/E/B
690,253,265 *474FC3490F108D3D9AC85AEAC4C07F0D596C04D2 [email protected]
690,253,266 *474F8205D9AE87C4C1EA17EBE88A5610974C7AE1 SPONTANECHOS
690,253,267 *474AAE119259D8B1673146A88CA3ED69DC6A6685 SPRZADAZY!
690,253,268 *4749F04725AE6C8C48C29AA41E1F20F62465E85E SRUELGNARTES
690,253,269 *474583DC78B4E7DB094B16469E2A60C64A617359 SSENGENDOG
690,253,270 *4749E62E9D334791F3B4C81DDE7DD69D2B5C4226 praveencolaco
690,253,271 *4744531BD9EC8C53237CCF4672D09CB2B41F9516 PROSLAVI4
690,253,272 *4744E4D8111A9B0457E66B2966E3A0603CAEF6E9 PROTON-WILTEN.|.NETHERLANDS
690,253,273 *4740689308D2C5BD894621C7576C27BCC0E4092A PTMSRNSES
690,253,274 *474285092BA76CF5A9D9CA7CF35C11784BB7B5FB STIGED
690,253,275 *474C11471BD537D9A20D05096FA565079A345853 PUROGRO
690,253,276 *4741BAD5A305AAFF7E076E189B41E25901FF3540 puzziamo
690,253,277 *474A2967CC63FC2BFE4624938B8FF0902CB0A194 STRECKENZUSTANDES
690,253,278 *47499A4AF305E245398F6D02E93634C8935C69A4 q###B~~>-<
690,253,279 *47414FF8FE76682552874C665723BC7774D0B0A8 [email protected]
690,253,280 *474DA211CB6BA2CC37F28CEB34CC725D1E5E3F2A qckhtch7
690,253,281 *474E6F3347A96CFA1F868068A616EC6A9DF9A003 [email protected]
690,253,282 *474550ECEF2F8F0629188B0FC2B046A6A0DBF2CF sunflowesasha
690,253,283 *47479C8FB76C2951C5810002E491D14F32C33B62 qua
690,253,284 *474546880B4278EE958EFB9989F5ABF4A1468510 quities7
690,253,285 *4743734C87140E6EEF10154A38B470391CCC6FB2 SWEETPEACOUGAR9
690,253,286 *4744D7BA62CFCFFFA343E74EC523FC988246C266 [email protected]
690,253,287 *474CF201249F92AEF2DBF616432FD36CBEB70A3D SWIERSBSWING
690,253,288 *47487323608806E62741D21B42B4DB0E3CFB1C41 SXCMINX3000
690,253,289 *474A8F66144DEE7609E8D8BDC93143B80E04381F RAMIROMAROUSEK
690,253,290 *474E94A11988053449E5DCB9117EF2B1258DF9AD [email protected]
690,253,291 *474A1AA08220ED21C684D9EE7D69501B1FBB00D8 RANDALL.FRONCEK
690,253,292 *474417B657CA42253E0F0DA902CBA7866FAC9333 Randy-Joubert
690,253,293 *474C932A5573CEBAEF5B1DB49674E02498D1EEEB RANKINGJOEANDCASSYMAN
690,253,294 *47448CAF2EC5AB14865BE102C0666E9AC1B797C1 RBARMENS
690,253,295 *474C9F8869E7876D3A79847FDC25454376030CC1 TALK99.152.122.16
690,253,296 *4744756F5AB17AEE07CFDA70851E5AA3993B2C3C @[email protected]+!N9
690,253,297 *4744685F09865B58B9A94FDE835FEF68AA07B6C6 TALKNEAUPHESURDIVE
690,253,298 *474D5642D318469785ED7EFE1DE3C44E5960D512 [email protected]
690,253,299 *474116B425D8B656017D8C5325D73FDE20634064 TANNERUTOPIA1
690,253,300 *4748B92331D6034514EA032A1DE62CE2BB1E24F4 [email protected]
690,253,301 *474F46FFCD43A2E52726DAD2D179B3155D171920 tauromaquia3
690,253,302 *47450C817017AEA8B63DEC2902EE770FC61C46F4 TAZAFAHUS
690,253,303 *474135F3854D6922086FF4D7B3F94BD6536CDCB6 Tbonesaturn
690,253,304 *474026CCD5986910B5F8B98DEFE8D5D75B25ACE6 rei.amami
690,253,305 *4749D503F6A33DD14CA8D12981C6D63B94C52EF8 REIRRACWOT
690,253,306 *4741023A95DE74F59AFC446FE7E762F4F86EE08E [email protected]!ZE5
690,253,307 *474715ACC79D2D9B2D9F23C3859F7A50EEC0F150 TENSION C
690,253,308 *4747E97748C8EEFF7CAE9EABEB2895C4D5AC0B2A reply
690,253,309 *474D19EECD34DE8C1366A409A6E54DD66B03EC19 ($result)[email protected][1..2];<br>
690,253,310 *4740531939AAB4054D24E79C59A6FA35BFB0996B TERRY.LIEVANO
690,253,311 *474D2A5925371FBC5E310C66332122F2C3FDE2A9 [email protected]
690,253,312 *474E559EDEFF0512F70528848E0F5A77D36E9612 rfnzoecz
690,253,313 *474EFDF8B2A92F467E42F05B09FD6A1C7E720FC7 RHAPSODY.IN.BLUE.(PERFORMED.BY.ANDRE.PREVIN)
690,253,314 *4744F472EB20517C67226DFD935ECF87FA89B0EB THATHISTORY1995
690,253,315 *474CFCBBAA536179FAD6BBBB1DC6F2EFFBC3E86A THATSTARBUCKABC
690,253,316 *4748CE5EEBE81A037D551B24B4C2A546F5A60113 the dj from outer space
690,253,317 *474534C9AE8591A0368B31D077AA918A9FD75F95 ricofotogr
690,253,318 *474FD4C8E3F919A9FA1DC8393367AE8C5631CFC5 thegreatestdayofmylife
690,253,319 *4746E7AF722EC11A695DA210AAABE9F7916B8524 theplan(demo)
690,253,320 *474577D91D9F613125D323CB78AA35211C7AB47C THERESA HADLEY
690,253,321 *474DAA37DC25584BE946A63A73F527D169F3061B "THEWORLDWILLBEAFARHAPPIERPLACE"
690,253,322 *474426B7BEEF3EE4834BCCF61F1D9E709BE2BB5C robertungerecht
690,253,323 *474F5DB77E2CCBEE659F31F8CAF98A424798728D ROBT.MONTELONGO
690,253,324 *47443CAB16A5EE05C82CA8644287BFD2ED5F50D8 robwhitten
690,253,325 *4746AED22BE659E6AB9EFF207481901466E88507 tickleness0
690,253,326 *47453C212A58534FBB2541D88896CB1E4F7938EE TILERIESP7
690,253,327 *474BD78E2B56FF83FDE37ACB9E6F82265EFEDC00 TIMOTE4N
690,253,328 *47411AEC01C422A315BB088DC2BDDEDDCCE7DD0D timothymcnail
690,253,329 *474D5BF0351B4C9C2E248D095D41FAFDD93A438F ROMANCE.FISDUR,.OP..28.NR..2
690,253,330 *474679C163667D167BCD038156BF9D6619BB0DE2 [email protected]
690,253,331 *4748EBCD5F40ABC5EE147A1B73F5322A7C07EFE9 TITUKYOUS
690,253,332 *474B01661230BDF244A996759F512F541D6E25D9 RONNY.ARUJO
690,253,333 *47409D9DF01FE58E9154DADAB3915F157147EB6F ROSCOEWATERFORD
690,253,334 *47444DD49C5BB8B38A80CC0D5B828A9AC61480D0 ROSZIEMAE
690,253,335 *47482609C6F361CDDCC2B979C1D1AA6B4E71AD17 TODDPIETERS
690,253,336 *474A741B09B2DAB7F8222EBEBEB33358EA1AF8D4 ROYCE.EDINGTON
690,253,337 *4740A83F029E7306E28C1FEF5BE43D43D6A9EE8E ROYPUCCI
690,253,338 *474B6BD5FDB54CA9B92A70BDAAF2C236E6EB61A7 rudyreenders
690,253,339 *4746A59D139981F5C8251B9659584B3FE660CEDA TOPGUNHAROLD6
690,253,340 *474C323A5E8832F8356386B19C4B083139E6FC31 TORNADA4
690,253,341 *474A2F16D0A8A3E77A380720AF7BBFD5883D6FD7 town-&-countryman-(edit)-(feat.-jason-friedman-&-snax)
690,253,342 *474102BA4253984F14C852B13E450D62D3593D9F RVWRXJBCR5
690,253,343 *47475DCBCDEEA70CA4A625B3AFF33C858A1D9EFB RWHASBORN
690,253,344 *47408D7ADD23F747C6A9F6D5767CD1205EEAC72A s03201989
690,253,345 *474825CBAAC905DB0A39541B26F9F3650F7A90C1 [email protected]
690,253,346 *474A09E0C3B64FFE6E8DE7E7A80FB783699FF032 TREVOR.MCKINZEY
690,253,347 *47420293C329CA2756AE91795D139BB08CE9A5F6 SAINTELOYLESMINES
690,253,348 *474B47FF7C4D641679A578D7AF58A8DCB087A8D2 saleskelsey
690,253,349 *474FB85EAEF11344ED982846534349CA086BA657 TRSTLNG
690,253,350 *474F445E5FCC90903887B4C6ABEE2A7941501C54 SA.NCHAYO
690,253,351 *474E925439004F22EF31FF2F72BA95CC1D9EE0BE sanfranciscolainen
690,253,352 *4740E42B6591B242DAA6F3228DAE432F47A14B76 [email protected]
690,253,353 *47473EBE036A8F7FE0DEA4D8042C5957F2B707FA SASUDHAA4
690,253,354 *47496AE6130F9CDC2C5453E8A960A9243C9265DB turn-the-music-up-/-goodbye-(how-you-say-it)
690,253,355 *47452D9A607DCD8E3647B9DDBC26E1F493FBA33B tweety147
690,253,356 *474B236E076778B94CED643AE01B4BF681C9EAC3 twominutebrother
690,253,357 *474D7D2E0B4933AC19BB22E52F6030E19D2ADDD2 SCHYIDCJDZ5
690,253,358 *474B18109655FCCFB943F454728C4BEFB74257FA U\![
690,253,359 *474805CF9C8D2F9DDFCE3CA95BFC6AE27349569A [email protected]
690,253,360 *4744E797792A04591DEB9C581AA4CE38F1EA88FF [email protected]
690,253,361 *474D75788E3D7E0D03457B4BFD41053467ACE1A4 UNHARBOUR3
690,253,362 *4743D17B068480E645428F42F3924FEF8472451E SETCHANCHU
690,253,363 *474C3EDCA1B854AD079D3D767A41E23539B615F4 SETHKINDLA
690,253,364 *474894CADFA4F3951C5177847CC1EF03B5E2EB11 sethverma
690,253,365 *4748A24723E24F425DD95FEA11222D58FB099170 UNMEASUREDNESSESING
690,253,366 *474919D63212A80F8130BCD3C1799A15D5BB61BA sevitatneserper
690,253,367 *474C047EA032B5933848E6C0FADEDD105505C912 [email protected]
690,253,368 *4749771A0FF09DD03F0C0D1CDCFA9ED67BF684A3 SHAKKIING
690,253,369 *474CEB19E8D9079B73E2501BD7887CCCE71200EA SHANE-GORRINGE
690,253,370 *474C3E124BBCD35A153765CF18CEEC1DDF741B99 shannice-wilson
690,253,371 *474F3C019693031C2F9DE0834AB39481EA3C7665 urvalsf
690,253,372 *4742AC97BBD07CFBCA0FAC62B3A8D54304CE7C73 sherry.canfield
690,253,373 *474F19738CE2EF12F4F283B0A91F1EED9E97789F UU-o~-O~q#####8
690,253,374 *474009B9F9A2D5DF510211CC00CA370B1619D762 shirleyflowers
690,253,375 *474D55CAB0A6348A21F658F50E8DCA400C2E2128 V3RB4NDG44S
690,253,376 *474CDBAC7629BB77AAF1E81A3803778F29FB763B shortsymphony(no2)iitempo
690,253,377 *4748D6C07C18A3841949240DA990F6C6EB3C691B VALEVALENA
690,253,378 *4747778D38867B4F9798DEAEA2509C5BE43BED88 SIGGE
690,253,379 *474D51620680CFBF4333FB02594017FE5DDAA1FA sixcongressional.1.0
690,253,380 *474B5FD1EEDDBC8354FE48EBA32D980FAA900CD5 SKIITTLA5
690,253,381 *4747E8A73C9D72015383B392EF636C13CAC62E82 VELIBORVELO
690,253,382 *474B8252ED69EFF3D920C1E36C446F8B6222EF38 VENESSAJACKSONYANCEY
690,253,383 *474858E587F9975298A68731E4781469BBC67CB6 SLDCUFNNYPOD5
690,253,384 *474F841F7F178B62E64B422AD70027E4FA81C996 VERORDNETEN6
690,253,385 *474D82EAEAB933773BABF5C0F90CB353C18BD9F0 [email protected]
690,253,386 *474519AA1C0948C718E690436AEC5010326917AB [email protected]
690,253,387 *474B7C8FEB2328A9A01E03357C38093BBFADAC27 SOLLILO
690,253,388 *474A5F89BC078B0563D135AA2041BCE3103A61E3 VILKU-DZIESMA
690,253,389 *474922D14C4AE983B99D06C2EE8F8DD909E64A35 VIN94MUF
690,253,390 *474849DD6FA0E9179FC5E0EC3009E6D1A379988B Sommer..Sonne..Cabrio
690,253,391 *4748892FDD386020F39E64E0A29E848B5F7903B7 sophienweg
690,253,392 *474D3D70980DCEFD9EA28A5BE8F05CFE1051D939 SPECIALOPUS
690,253,393 *4742C2B6BEFF7A023AE95C6595D4B9F51C03CEFB SPILZUCHTS
690,253,394 *474AFA6826C6AD9E8BB1AB6CFE46C3F402137B06 SPLAT~ ~ ~ QQ
690,253,395 *474094114A7FBA11A152AF696C59802CA76BA003 WALLEYEMARIO8
690,253,396 *4748795C85F2856DF4A3CB3EA29275F299FEF4C1 wallyburtonjr
690,253,397 *474A87E5EA3D31527F0923E7147B782749DF438C STACEY.MCEADDY
690,253,398 *47414BCA61CF39BA5F71913DF21877BFD29B0075 Wand'ring.Through.the.Ashes.of.Thine
690,253,399 *474DE67731A4F6C0BDFCAF80C8B3B3FF244A5EBD STAOCNRU
690,253,400 *474C6FD720B5C22FBF978795313EF8FE964CA317 [email protected]
690,253,401 *474FA509B19E422D4B26A702A797776C9DF43482 warnerworn
690,253,402 *474427203C03E27172BD8AAF15D45A04A475DDA6 WARREN BELARMINO
690,253,403 *474400AC3BD9782623DFA089DC8D5E284DC58257 WARRIORS71238191
690,253,404 *474171B4FC3B3BEE25EA515AFE580C6A62291136 station-b
690,253,405 *47452E789354B9C1E4F3865F7821E86D1CDE7717 WASONBUNCHAROEN
690,253,406 *474EE2083680C4D4B0D5AE142E646FC37B350E4D statliga2
690,253,407 *47417B8D776F6678659B1F2564F5E1985D1BDBF8 STEPHANAHUMADA
690,253,408 *47488459F0B4ADF6CB605C668DEC857365407ECF WCHODZĄCĄ
690,253,409 *4740A510764C6C9188E2900408DAC706826FD9BD Week6Sections3940
690,253,410 *474AA781B300801833F3A7B42C7BF8DE4C7E5796 WEICHERR
690,253,411 *4747F77B11793AD2F97D9D1B02AB68BCF2E929E5 weiches.fell
690,253,412 *4744F9C761EFC2865584198957DB27FFA202D2A5 stevenlemmons
690,253,413 *47429D9BD4DAD1B25394AE32F5BA2A5C51365195 sticascadplantillacad
690,253,414 *4747F2799FB837C93118E456814629666F842D3F STNANNOL4
690,253,415 *47418780B86798D3D330ABABB8A5C91B64BFD942 [email protected]
690,253,416 *47450923AD01CAF2057B1502FFE4077ED27E8AB2 STÖRLIK
690,253,417 *474C238FFB422C462FAAB52467CFA6AE9CEC0A04 wenrohronon
690,253,418 *47451636C79A7D5DF2D7E1EB7DFCCDAF6F0C5001 [email protected]
690,253,419 *47420BD4A33F3BBB03A7CBBF4383A2D098B98BB4 SU`AAA
690,253,420 *47472B75A0E09891DB589AA2E0EC3A0B4A3BC869 WIDLY
690,253,421 *4743CDE24D8F3FD5F68F6A5D58B14444A8CB357D wileytokar
690,253,422 *474B610D6636C010C5A2FD3CC3EC6CBA25B32E32 [email protected]
690,253,423 *474F3A0B6A188547F42A024C5E04B84A43EEDF34 SUPERSTAR38
690,253,424 *4748E4DAA3A23A5467130A7DFC8466B36BF8A81F willswoap
690,253,425 *4746D0B61858FEC6B0973DD590704EA74785F4ED windanathaliatitah
690,253,426 *4744FDA9B148D14B63E919C0DE3359A22F2445DB SWEDENBORGIANISMNA7
690,253,427 *474D1BB129DD46B05B0F1869FE8811CDE4ED7228 SWEET INSOMNIA (FAITHLESS VS EURYTHMICS)
690,253,428 *47430DCCFC396847DA70D45742027557F7ABD451 WISNU DAYA JOHANI
690,253,429 *474BBEF3AE9DBB6D27C365808CC02BC57243F682 WLSRV1
690,253,430 *4749E59AAC35E885937F2E6ED6D6F06D38A16E98 WMSHEPHERD
690,253,431 *474CFFC090A2F03A900EAD5023E0B561534F357E SYMPHONIE-PASSION, OP 23: LE MONDE DANS L'ATTENTE DU SAUVEUR
690,253,432 *4744B42C56549C45A23E0C10642FC5E690D1388A SYMPHONY-NO2-IN-E-MINOR,-OP27,-I:-LARGO---ALLEGRO-MODERATO
690,253,433 *47401A10AD4DAC6E33EAF0D1C68102817E0137A9 WORLD」水野健、「KLOKA」御影たゆた
690,253,434 *4749FBA1794876169710FF669C60EB8249946500 WOULDYOUBEMY
690,253,435 *474F9DF4B612392B3C9AF4A0E2B358B6A71FC887 wssunet
690,253,436 *4741FB8764E4D2DA00E0F6FCEA5B695F64B74389 WWWFUSILIERINNCOUK
690,253,437 *47422C0FAC92F6B92BDA556A3CB754204BD7C981 wy142
690,253,438 *474B090EE3ECE23FCB29675B31D7CFF72465DB00 [email protected]
690,253,439 *4749959E240732E1D40EE0FC94E8F1A65EA65D0D TANGILERI
690,253,440 *474A6E0C2B97D6FB0C07D269FE4F8218BB6007D2 WZ_LJZ
690,253,441 *4745BAF64312394F4141D730F8A57EB31913D908 [email protected]
690,253,442 *474858BA29AF4FFFD1C75467D20F9BC5AA37ED52 <X8AAA
690,253,443 *4745E4657FE5B531C6639D17E921998A8DE766EB TANYAHANSON
690,253,444 *474BED4BB279995F96038779A92F47AD40B13012 XIORAAL
690,253,445 *47408F596043DBA0562EC7D4058DF085C93949D6 XPROGLISTBSW1
690,253,446 *474C852DFF09406D8405108C725F22EB4802A7B3 (x).*.qp
690,253,447 *4743606190080A60186FEE85EC874057303F5175 YAHAV-BURSTEIN
690,253,448 *4743CB1A4FEDE81EB2A2B08134F7D58F5A76F865 TERVAPAMPPU
690,253,449 *474CB17725B302EC657093442F8E7829A1051E4D YANNIS-TSIRONIS
690,253,450 *474FA1A32E4CE3DE786BA09C35EBE17AF821AA44 THATNICHOLAS2003
690,253,451 *474C14425867523699A7CD08BB08C099145A1B5F theamanda1666
690,253,452 *4749EE0891B082AA378C1D7415B1F8930BB71522 THECAROL
690,253,453 *474936928C84CDB488B27AEE5F7B79A1B3F2ED6D [email protected]
690,253,454 *47483F2C33C2F992F50D4D4D82AE71DCB574D38D THE GAGGED MARION HELD IN THEIR ROUGH GRASP
690,253,455 *474A5D17D80BE7DB298FA58679232A24F0AF8BF3 the olde english blues
690,253,456 *4745EF6582C53E7F9D0F5665BCEBCAB6EAEC37BC [email protected]
690,253,457 *474C34C19FA097F557F237BCCADAC23B157EA9AF yug0s1av!an
690,253,458 *4741DED736DEC5AE79CD3483FC7A65779AE01460 THUJI ZANGMO
690,253,459 *4749C6A89E29351ABA8FC18FDA4B4152BD42A929 ZACHARY-BORDAS
690,253,460 *47468BF39912BD8C36258449BE92B4ADBFFC54D3 ZACHERY.BERENGUER
690,253,461 *4748D8873799F031D4A219AE80F3BDE0853FE4AF ZAHLEH-2-0
690,253,462 *4745C42EECED7E6E9BD138B2676D7F9E5EFC1A90 TITUS-ANDRONICUS Faint-hearted-boy,-arise,-and-look-upon-her.
690,253,463 *47404CDEA1C6F6148B25234CF8A274CB7897B6E6 ZATELEFONOVATING
690,253,464 *474F7E2007F43191ED90E8455D16D8C833CAE30E Zdravotni
690,253,465 *4746B9004781A5360726EB0F6D6D257D77437FDC TODDWEGLEITNER
690,253,466 *474DA3553F579B2FFF2600DDB7C88AAEF246BDBE ZEUSCALSTATELAED
690,253,467 *474DD76EAD05050336250FC3971F7E2F55BC5EC5 zey-khan
690,253,468 *4740800CCE02C22FE3D7C1578F1C42C87EE61415 [email protected]
690,253,469 *474690B7C43BD1266741DF3C9B4E9E87EFED612E tomkintopp
690,253,470 *474DAFD038114050100236BE27DB4CD6E7CA1D59 [email protected]
690,253,471 *474C89B59538E3DC99B68F1355152C422FECBE8D [email protected]
690,253,472 *474DB0D0DDFA875EE7FB4852A4D607EAE718BB3C [email protected]
690,253,473 *474300E49CCBB9CFB96F814E84F3289A79A9714D TOPPREPPLAYERSCOACH
690,253,474 *474B145C9D604A0F242596545E505AA6C776E74B zoiraugarte
690,253,475 *474E16CCEF143C25196A567C726CA8896230F6D1 z(w?
690,253,476 *474D7C63115785130D72857D8F7063C7E160C842 TRINIDAD.FANNER
690,253,477 *47447660342D912EADC574299D3134782CB6531E TRISHA.VIANCE.DE.MESA
690,253,478 *474F6A67C4A74115CE34F7F2498DE5531358C30C TRN15H8L
690,253,479 *4746ACA70E7A15F895A8DCC67126E1C2A093EB40 ГЛИНОМАЗ
690,253,480 *4743F4BFC1A009D23BBFE7B564FCF0ADF0D3BCA4 ГУРВАНОМ
690,253,481 *4745E12E7E196DC189C3A41E914D5B8C77E50496 ЖЫЛДЫГЫН
690,253,482 *4744A54765E847DF75133EAC1C4C71EF4DEAD1F2 ЗЬВЕНЬНЯЎ
690,253,483 *4746810241718BA764B8107A9C4962005BE345FB TUHOONTUOMITULLA5
690,253,484 *4742E4A6955CC1E50CD303D1FDA92506932EFD2F МАСЛОВАТЫЙ
690,253,485 *4743DB25B33B5440271E5DC25857CD5F4DB15DF9 НАГОЈСКИ
690,253,486 *4748A17F640C5CB8C3F416D94FDE046816EE7ACF TU-SER
690,253,487 *474DDE5EFD5C3C3F4C395E6E8BA089A5E738AE17 twentythreeyearold
690,253,488 *474AE1F2949D0B502DCACBD3F9A5F8743DD8D50E ТРЕКЛИСТЕ
690,253,489 *474DAE02A052492AC3E988D4F769B6948CE6B3A2 ХАСАЈ
690,253,490 *474D1EBC0151695800A9E601C0BF4E5DEC1801F5 [email protected]
690,253,491 *474F9986CDBF29F83B5A010E004C66A6386DABE6 unwin123
690,253,492 *4742235632A18C989CDCBC47ADACB33E4DCC08C8 U.S.MARKETS
690,253,493 *474887B0A13F2CE7C52E352275A9731052F32883 (00)*(######p
690,253,494 *4746E6CC588A11B47731F4AF3C26A50FB162B5B8 uussichtsgipfel
690,253,495 *47411D35291E403FB5E3DC8F0EDA518EA97552A5 VAISHALI KANTHARIA RANA
690,253,496 *4744F626429CA69E9A815B502A63ECE937687104 066E106DACF431418DAB0BC3906D38FC
690,253,497 *474D8172E047EE258B070C3D3D3379F62898A25C (-_0)~`<=====8
690,253,498 *4749E3ED9D7A18F9D1E68CBEE2ED58250F4D8416 081!94T!0N5
690,253,499 *474E13F821537DED4794B1DFC5BB0E2A70FC05BB vanzyl
690,253,500 *4740238AA8429A246E6A14E10A17F3CF5D9A1119 1013h292h4mic22esf48
690,253,501 *47421DC05226C58E899F3B2B0427BFF8D55377B7 10-17-1455
690,253,502 *474B40ECBDCFE32BD64E78B196968B74B45A83E1 114477GY
690,253,503 *47442096404E84559FE95B0462D5E784EBC0B86E VERLYNCALIMLIM
690,253,504 *4744C20159441200CFA166AD175EC5CC96642307 11sep1205
690,253,505 *474B993ED7CA530F657F7A7311DF8A9FC7E8F7FD veronica-estebes
690,253,506 *47485C84206055C3AFB13657615F0E3FC430A607 1219811 SAMALLAKRITEEREIKSILAITETTIIN,ETT
690,253,507 *474F09F0F93F8E5EB8C3E167D85413772C912AE1 123isiah
690,253,508 *4740CD725E719931F8E1CC11B01986FEC3F0D360 VERSIONSLOS
690,253,509 *47485CF8F14567A3137D3C70C9AEB3DF1D4C475D 125myla
690,253,510 *47420580656995F56206C7A569E0EE4678F89461 12jan2003
690,253,511 *474B06D92B7C78AC99C5EF9310337489C59FDB57 1472315 dennoch.will.die.galf.mit.der.spd.koalieren..
690,253,512 *4746D0F88B8CEF3DDC8448CF7759534EA987AB74 1541312 KOSKA SAPEN TOIMINTAH
690,253,513 *474955CB62282180E7DEEC8AF90701B00902A258 1543074 SENMAKUONT
690,253,514 *47411A3941A88C7888E6BEC49DE16A80C9961CCA vincentsinotte
690,253,515 *4746678052017D7813CA196F7FB2091D447CD42D vincenzopalermo
690,253,516 *47410477743D2C992BEBA39099EC0D2A54FCDBB0 181792 but he concedes the firm underestimated the backlash
690,253,517 *474D01A1D11CE10E9B3507AD98356339594E26D7 1851943 DER.MITARBEITER.HOLTE.DEN.ARZT.ZU.JUHNKE..
690,253,518 *4741C6AD9312848820C0AB2253CC043B4BA8C565 1856686 AINAONKUITENKINTUOMITTAVAMENETETYKSIV
690,253,519 *474DDD4E3CD500531F24DF656AA4EAD15B2CC05D 1938351 viagstiegenum13,30dmundbayerum5,30dm.
690,253,520 *4748B9864045A8611ACD9B53F0411EADB0C69D56 19723c
690,253,521 *4743D95FDF71BB4EDA1610B7EF99A7151E3AB784 1986,CHANGEJUNE27,1988.</B><P>
690,253,522 *4745C49C023BB1E43CF1DB5150CCE7F7728B76FA VJODJANAED
690,253,523 *47430A3C5EE70049D77249B91A85E495D9747FC1 1-ARMEE-WERBEFILM
690,253,524 *474613EE63B89B616769991D7C2FB4F85579A2C6 v{m)
690,253,525 *474288A98DDA1262D0478A391E6AF904C01BD6E9 VNUANQUISHT4
690,253,526 *474ECD6166D0EA486538D490CA8771DAE1CB2D10 VOQUAIT?
690,253,527 *4748265A3C986683996A6E5509AAF5C6BC296571 1.ENTGEGENRAUSCHEN
690,253,528 *474DA4E0E5D0F3D2A1E841E674DAA7A98720E220 1.GILJOTIINIEN
690,253,529 *4746104C787358A7ECC74E81A9B0B6746FF589F0 WALLACE.LIPPOLD
690,253,530 *47429D703135FEE8B2B4EB1B3BE826730E753097 [email protected]
690,253,531 *4744B4C92FBD37F48525B384F771FCF8F15A00D1 1.KORIINJOHTAVAT
690,253,532 *4742FAAC84196FDA637FE5757D9D03E756EA6564 WARINEE WEERAPAB
690,253,533 *47408E2551F057CECA117083F5FE940656A97686 1-LOSSES-BUT
690,253,534 *474E86A428C917836C246644FD940054FE1E739D wasni'tborntofollow
690,253,535 *474790E8AA041F54E51FD18BF09EC4DFB7F58C70 WAYNELAGMAN
690,253,536 *47486BAB642934E6060C814638620AC91D9FFF05 1NORDEALLA
690,253,537 *4740429217A5D2EAE8A895A99472B1FED02DD81B WE-GOT-CACTUS
690,253,538 *474FDCA588EC5B0A4A75974FC9538EA13E94C784 weldonvandawalker
690,253,539 *474E57EB8B9B3ADA27A61621412DA8D581266917 wendellflugence
690,253,540 *474CE8006AACE31986827469CE1A0D0257F78B73 1POLLIWOGS
690,253,541 *4748B03450D4D20583CAC6EF74813B830907B4C1 [email protected]
690,253,542 *474A1927A695B50E7B49A887E078BD62A111975F 1-rp-tutkinnon
690,253,543 *474C7E046582ECCA0974ACBDC75749E740B70C0F [email protected]
690,253,544 *474CD83B7A69CE00911AADC3A2430889090DE524 WERKSTÜCKNULLPUNKT
690,253,545 *47437842C7E9BAC5CE84A8FA8CD5B41C2E935D05 1-tekno-logiaa
690,253,546 *4748E6F73C9ECADDD8B6871F8C015C4B901EBA44 1.termolaatikkoon
690,253,547 *4741436FD16222722C8681F112337CF54690D7E0 1TERUGBETAALD
690,253,548 *4745D4C8E822A61426B2793B0A045C10EAD5F3A3 WIETSEBIJKERSMA
690,253,549 *4746C18E94FF738C367CD464A88FDFD26813E29D wilbertwheelen
690,253,550 *474110788BD69F7F8397B0E6EBD55CD4CD448F4B 1WELTUNORDUNG
690,253,551 *474FDCF2C88DF2FCFE8EE2639D480EF986B8059D WILFREDOBUQUET
690,253,552 *474E1F623795786559445F5259ED8461C0290AC6 williamjoshlin
690,253,553 *474D08B19865F4444AB3039E1DC6F706C945E86F 207JDR
690,253,554 *474A7972BE4049E1AF86194E125AA090A1FDE02F williamspeebles
690,253,555 *47420EAD92718C7D3FBA05AC94C97F3DDEB4BF44 WILLIAMS.VORE
690,253,556 *474461B36A96829122D89E8F0F27A415D6289B23 wilmerahia
690,253,557 *4741920A74CF21FFEB54D096DFC315F43531FA9F wiltonkadi
690,253,558 *4743B65C2D39CE01105B0E12A84EF059A6BB068E 2283954 OLE.KILTTI.JA.VAIHDA.PAIKKAA.ANNIKAN.KANSSA..
690,253,559 *47453505D171575EF727BC9ECFA42E6480829E0F WINERYFLORIOFOLIE
690,253,560 *47409588A05442EEB23D78C8FF09B2834B1090BB 24.01.1432
690,253,561 *4743942ADB433CC4FA2EE14EEE3EDE6CB830644A 2667692 doch-der-herausgeforderte-nahm-es-gelassen-.
690,253,562 *474CE2B316A5405EA621E060320C35E54A5C0D90 26.mediengewerkschaften
690,253,563 *47406377487A384EE35CD0AE697FE7EABC188B63 26.o'bannon's
690,253,564 *474891C05A79078CD02656C987A2531122106A3B wolkgevaarte0
690,253,565 *474FDFDE0ECD88DD573266DCC7DA8AB81791E596 WORKGOES,THEPAY'SNOTBADBUTTHERE'SSQUALORIN
690,253,566 *4749E0E738234F8DDF2CF609BD51C6598551549B 2903950 DIE STANDORTE KONNTE SHELL GESTERN NOCH NICHT NENNEN .
690,253,567 *4746E07729E605E1C910F9361344AE67C7F839BB 2929711 K
690,253,568 *47465EAF35455C86B38E20A3E59FB770765E6E9B wrongpeopleincharge
690,253,569 *474B6D5D8EC313748524A222715E6BB9E7FF9B5A WU9UFRGFB3Q
690,253,570 *474A1291987307320D53C9A9B4755EB7566DDB6D [email protected]
690,253,571 *4748B334DC19662E6D5637765082176D4A9598D1 2BLANSIN
690,253,572 *474B3BA04581186D2BDE218FE0C29F28FEF0D907 2ELADELAD
690,253,573 *474E0B8CEB6895BF582E77161C7E7551955450FF 2 FUTURES-MARKT
690,253,574 *474741F114FE0EDC5AA29E9BC23811810F0BE864 2.GESCHWINDIGKEITSANZEIGEGERAET
690,253,575 *474F7D3E4D4B3AE6651FF7D2C089B31EC9333DB1 2.HEWVORSTAND
690,253,576 *474DE4303B88BADED2204E9D5AF5F82187AD515E WWWSENIORSQUIDSCOM
690,253,577 *4743480CDF473A12F150B83839514BF3831D7A45 WY4TT
690,253,578 *4741F629E3E7F1BBADB30C59FE95D13722B9B877 WYATTSTAEHLE
690,253,579 *474B5CD6FD1FD7B78BC976CB9337DE7F5D190D22 2.kohdistaman
690,253,580 *474DA7C13440DDF0D1DE2CD1618AB7A6EB941B0A WZOGLAUER
690,253,581 *4745E01E67D661D63E12E3744F49F8134B08B8CB X13132XX
690,253,582 *474B0927517C958753357149A2B1D8AA78BC80E9 X4419
690,253,583 *474047B8465C67294BAA89F75AC3428F21CECE4A 2MYAMELIE0
690,253,584 *474CCCECB1053825C73A972123A0AE2F65DD96E3 XANTHOCOBALTI4
690,253,585 *474A61FDBDE3C87BBE1471F917C018E67625C4A4 XIRANDIYES
690,253,586 *47464038264AF778F8D193251CFDD5DEA5872ED8 XKO
690,253,587 *4747454079EDA8E5116827585CB685249CBCDD31 320487 mUdUr-,-rektOr-tarafIndan-beS-yIl-iCin-tayin-edilir-
690,253,588 *4744330BE314C98E2370367DE951FCCBB1F5B3DC [email protected]
690,253,589 *474DCCEE6A17672BC2A14AE83ED3794E6A4DAC28 [email protected]
690,253,590 *474557D24FA361AB2E52F21CAF314CC12520AC4D 3B< O~ 0~ (Q
690,253,591 *4745301277FE92A1BEF0CD5EF9A5863D39565C43 YAEL.WEINSTEIN.BAR.JAIM
690,253,592 *4743D66E2C74695A5EAF0CEE04AC5F47BBB99E9E YAMINNIVERMA
690,253,593 *474A9BBCA6A8A381EA26D254309F7D163FAF6005 3ENJOYND
690,253,594 *474C5E579E3768A7E2B9F397DFBEEBF977ECE8E3 YANZULKIFLI
690,253,595 *474FB0E924DB380B89B5385B674969FC385821B2 [email protected]
690,253,596 *474614772BA144F0F4F2DE784681A4CAD5B62989 YAVOR-DANKOV
690,253,597 *47475FA5D702DCABBD4A4540335483B48DE06A25 YEARBOOKWORKEDUP7
690,253,598 *474F0163D23163E3469158EDC321A31528608D29 yenyendrawati
690,253,599 *4747D0780B8795B59320198BECDFE7FC7645EB1F [email protected]
690,253,600 *4747EF5B18C00F642B7B6E28767E94360E4500BC YIFJ
690,253,601 *474662859F61A724A8F5D22AF704DAFE35E37CBC [email protected]
690,253,602 *47482B2B7308133A9F53343C151B4AE31256DBFE 3theodorheussschule
690,253,603 *474D46D853F5471E70B30356FD7C4F4E610A69EA YLDEKOVORPNU9
690,253,604 *4748C3397534FAB440B77BDFB52A0952097B4F42 YOSHIASHTUWAN
690,253,605 *474B8B460FFA1A01C0EC804FD96D51FA9E0EC224 YRATCAL
690,253,606 *47492DEEAD998033ED3271F628FB6B0A5C763710 [email protected]
690,253,607 *474C059B2E39B9EDFCDDB855449982AC601CBCFC 4ESSANTST
690,253,608 *474C307B816497FD07264C7CF91E718E02D68EA3 4ESSAREVO
690,253,609 *474EA412AF277EDBDD0449267600E9EEECBF5813 [email protected]
690,253,610 *47462CD7F154275C8E7D9B7B49A7D1776EA8DE5C YULISUANTO
690,253,611 *4745FA7E525C76ED753CD01F06BDF51791F463CE >4H/<>A/<NOITCUDORTNIMFT157>"034157RDH"=EMANA<>4H<
690,253,612 *4740433F69E7E96DF2A2042157FAF0A5C7AFB2E3 [email protected]
690,253,613 *47412B8CEE487C6D7386E48A3E977121190E6C1B 4INTERNETANGELA
690,253,614 *474061C026E7639C87ADED35ECF77607F936EFCA Z87941
690,253,615 *474407BF9E5AABA0ED404E74D3FF8C90032EB7F5 ZABNORMALITIED
690,253,616 *4749FFF36081EBB3A8E3E472BDFED57F99FA8CCB 4LOADSTONED
690,253,617 *47409D7B401D2BAD5BFFC23602753EB87FAA3554 4MAGAZYNOWE
690,253,618 *474C31672838CC3C0A4FFE53F881F67491058C31 zackaryhodgkin
690,253,619 *474336B68AD83CE7A3FE90D2E8EB794B8FA94279 4PICARD1
690,253,620 *474A5B635C96F814D9F86912126B4F52AAFCB2D4 4REILPITLUMED
690,253,621 *4745DCDA4844C6C6A5BBBC2F1E6EA26C5176767E ZEITAUFLÖSUNG
690,253,622 *474E7F2204C63C009DFB162CEA71D0B1B0DEABE5 4THEBOMBAY8
690,253,623 *474E8664D8B8C3A1E120D4F4D998A751F51A4F17 ZHITKOV0
690,253,624 *4746E412F1E302292CC61CB008C455335FF40EDA [email protected]
690,253,625 *4741E6EF76CCD22483CB903DA648B196A049BA76 [email protected]
690,253,626 *474BE8CA25C00C68BCA5BC27056B2B1AC6D275AC [email protected]
690,253,627 *4747ABDA2620EA15844C2DC91C9EB445B7E216C8 Z/M(
690,253,628 *47464C35473BF4F5B4178AE90A689B137244E0B2 5ADJUDICADORA
690,253,629 *4747F2106171290768B6C3832A2E7B3230E205AE 5BLICKRICHTUNG
690,253,630 *4742499C7E915235014DE245F7772BEBC8534EF1 ZULFADZREEN
690,253,631 *474E26F16143EEF079D9782E7E03FA7BA163EF10 [email protected]
690,253,632 *474FFECDF7D480882143A4C54EA470C79FC0407E [email protected]
690,253,633 *474E9DC214AFF89F40F5C2E74C3B146837044B83 5ELLENNL
690,253,634 *474104DB4348E8F89EB34765BA385EE3EEA00EFD ΚΩΜΙΚΟΣ
690,253,635 *474E5D171708B876A9690E2BFE82333883837C13 5HIBBIDDE
690,253,636 *4745E58F64DEC2FAB3EF8428E713A5E690453833 ΣΧΩ
690,253,637 *47420769157D5E7E4C80403BCAF6DA88C8AB85A4 відамля
690,253,638 *474279CAB3DEB03EBE175285BEFB7D2555260691 ЁЎКАЎ
690,253,639 *4740A6867CC434DCAA9C3A97F9FE9E215871AF21 5OLMUSSUNUZ
690,253,640 *474253FC2207D8A59D8D83904EBC3507EA745A9E 5PROHIBERENTQUE
690,253,641 *474E3C19A6C2EA6AAF0A621CB0978AC699CDC84D ЛОВЬЕВЫМ
690,253,642 *474183BF951472B1357DE24FF465DD045E4AF04C НЕСЕЛЕКТИВНЫМ
690,253,643 *4740E4477163B314AAD86CCC60B18611A39911A6 РАЗБУЯНИВШИЙСЯ
690,253,644 *4747449276C442F7FC4A183C0ED83584E077B7AF рейхлейтнер
690,253,645 *4747090579502915AB5BE8FC78CEE9E6F030796D СУМНЕЎНА
690,253,646 *4741673B445841698899C3ABB27C916916215D78 ТЕМПОРАЛЬНОМ
690,253,647 *474550565E16260EE402FD0F37F52408C0AF17D3 65hikayesini
690,253,648 *4744D0BC79FB08FAAAA5AD1B281CF06836097F98 чиатурскому
690,253,649 *47440C4B7312F0A5E8C3C734AEC49971B19BD098 684raiden
690,253,650 *474F85D4F34424EDD33843207C598D80A2AE03C8 今作以降シングルCDをリリースしていない。
690,253,651 *4741E53469A9DE474A1DB518A5C2C858F93F8FCA 6bryaceae
690,253,652 *47416CE827D84AE85D898171B33DBABC2CBE2A1F 6incmajord589:iadagioallegro
690,253,653 *474CA9A681BE07EB944EAB84757313F00DE3E439 6LIKEANENGINE
690,253,654 *4740BC66C157C94940D054E0D9C970823B3AA61B 第17話「人参に咲いた花祝言」(1995年、anb
690,253,655 *4742E288EAF3AC20E6D5E2D17E6B408FA28ABE5D 6POTE
690,253,656 *474847284870BC75036861DA94538A7A1574B531 6SAULTEN
690,253,657 *474DBA8263FFB1B5D2B2F9256D1CF2F0EA651694 6UNIFORMTRA
690,253,658 *4743C4F62381D9703E701E270E1682A16210D5F1 6VAEAERENNOEKSET
690,253,659 *47497A4C29DC0B8D0795E0508871AEB8D6377C7A 6warford
690,253,660 *4744D2A2FABB67C37D976363AE5E280D96FBE687 74.j
690,253,661 *4740A0B0036AA15EF9CF95C208F72EB375E5FB6D 778939 KARTAT ON SAATU VAPAAKAPPALEINA SUOMEN OLLESSA VEN
690,253,662 *47415E7D8052060DAD52116BFA2B524202F1FEAF 7ASSOGGETTAS
690,253,663 *4745130370580775DEDEC449E9047DA447089209 7CONCHOST
690,253,664 *474E15B97D9FED970F5CCEFD9DFEAE6D5B744265 7FRIENDSCHUCKY
690,253,665 *47435D718404602A9BFA9E6659877AF676AF811B 7GOOBERBACH
690,253,666 *47444E5B8050A10B22D401959C6BD8E19830154B 7KWAAKTES
690,253,667 *4742613F9E2387B2FB5CBF7C39AAB3E64D4D6957 7LLIEPIIK
690,253,668 *474F047C63FDB73C2A01679459355242B88E7E8D 7MAILERCONTROL
690,253,669 *4745751003FB9D225079B7AEA48191D60E179E03 7MUKSOKIR
690,253,670 *4749948B8649A63BDA5CEB64E70E020860E20EFE 7NTSIMYSK
690,253,671 *474E2BB187C271E4428C42E16A727391A17F7101 [email protected]
690,253,672 *474B655FAD7F16BE5E4F0BE61C2C73CFCB8BDAA7 7odevde
690,253,673 *474A1C3FBE3CF315DCBD91E873A96A799F8AB15E 7punaviinietikka
690,253,674 *474D4614F66D2FFC9C305DC84E612EE93D8F8659 7PYROCOMENICS
690,253,675 *47479066BEFE1DF49DEC7580662B7E6789997E96 7SYLVIASAMSON
690,253,676 *474C69FF19778ABADB9BDC99422E0A8E0E0161B1 7TH–14TH
690,253,677 *474139667D3A56385FFD149E7B3C6EE64A1693A9 7THEDANNY7
690,253,678 *4746C6526BCEC8C5C382E887C0F6FCEFED76A3E5 7THEWARRIOR6
690,253,679 *4743E434147F4EC445050673C6C954946081EDF4 7UTLIOTOU
690,253,680 *474973BD3F560DA54B3B15BCF73E4E44D26E3EA7 7WYBONIA
690,253,681 *47452B017D193DA63A0C358BEF158B89D35FC0C9 811667226
690,253,682 *4743029E76034B30329881CC33F7C9560EAD91BD 83 ANG
690,253,683 *4748575C6DD8924DF228B78CFFF7B9780DC9A32F 841063 dedim-ve-okulu-biraktim-.-ailem-buna-cok-bozuldu-.
690,253,684 *474E5A7DC946A289718F2A569D89F6E72E8C843B 842832 HESAIDFINESSHOULDBECAPPEDAT$2,500ADAY
690,253,685 *474C742217C6F332E0E11B6CA66337E696787133 854863 JOSSAKIN K
690,253,686 *474778B3AB76F19AD73CDEA059DE48A46DEF903B 878469 assad wisse , dass das " friedensfenster " offen stehe
690,253,687 *4743553893FE4561C833846889203033A3A19C01 8B~0 ~o{x}
690,253,688 *4746742327C06BDE424CB67EE12B0C942FB34B85 8edatI
690,253,689 *4744259AD18A3E9BC6A0446D9065B90B90D054EC (0-0)[email protected]==p
690,253,690 *47460BF4ED1DF666B860A31D705999FE0C2A079C 8KONSERTTITANSSEJA
690,253,691 *4745BED7B0ADE84D14787D0F9681552A03033270 8MICROZXCVBNM
690,253,692 *4744154662B8B2372F9BC67C409ED82C3DF921CC 8=)~O-~O-SPLAT
690,253,693 *474C0E01B8CEA61229ECEE058CC3000D3AEEA654 8PUPPIESHOUSTON
690,253,694 *47404EC2F0B363C7F7084EC3E468AB3352A9B0B8 8REGNOMYCNAF
690,253,695 *47460F40CE68ACEA86852C89FD393BCDFD2C5AC6 8SGALYARG
690,253,696 *4744C92E6B1D78A61DBD729931F5AFAC7B8EC2FA 8STICKBLACK
690,253,697 *4747B9032B092F1715D8F3F21C67237AC7C492FD 0thatricardo14
690,253,698 *47424CB6E944E3F8BB3908EDCCDC24354CEF8027 8UBPBECR
690,253,699 *474560781EF7F773F6D2D13C713BB61CECC634F0 103QAWS
690,253,700 *474EAAB16118C656BD95F4EBB1784F0DDDAEB0F4 [email protected]
690,253,701 *4741E879C1874F814CAA7E2490EB40306752F72A 13051700
690,253,702 *4747E2CA5716DF38293D1CEE3D58341D5CB344EB 9DEFIWDIMNU
690,253,703 *474DA774275855B3CA596BCAE1C2FB59F178ACD5 168JOSEPHINE
690,253,704 *474FB0B083ABADF3AAA0D00680B6445AA43724E0 172VIRGINIA
690,253,705 *474096223AB252D0D44C3AB2E43CBE2AF73F41D3 1743764 h
690,253,706 *4740D277FAE47EAD5E10827886612CEB738E4465 9FUNCTIONARIESP
690,253,707 *4749791F7F63C2BCBF8C1E640D2EE0D19B0F7458 9HARRISONBFI
690,253,708 *474CEF73B92195080FCB7C5AAD3D270FEE549189 1833589 schliesslich.reichte.ich.selbst.meine.kuendigung.ein...'
690,253,709 *474ECE3AAB4D9666068DFB1DB51AEFE2A1564EA4 1836919 PIKKULAPSILLE-KYLL
690,253,710 *47457071E5E6F1341C81D0F1FE4E5AE650C0A20C 18-VENEILY
690,253,711 *4748BF04A2BF43BAE74CCDA0420610597D9EBFDF 1991-03-31:-greensboro,-nc,-usa-(disc-2)
690,253,712 *474BD67253B1FA2D5FF57AF9D3F1EDC616F7A59D 1AIKIIYAM
690,253,713 *4743D352E270C6ACA2244A18572D9C4C03B71BA4 1.BERN-LOTSCHBERG-SIMPLON
690,253,714 *4743AE9E771D879ED50FB713E7FD21D2BBDA2FEF 9PRSPCFCTN
690,253,715 *474549CC939789585C853418B307A349AC60B845 1CERKOVNYE
690,253,716 *4742E2503FE75B3FBF1E148B054F1231358194C2 1.comeniukselle
690,253,717 *474D340970F3C0024B237344B5B06DF3CC94D77C 9TFUL
690,253,718 *4743783E6DD476C42DE4BBE674DD68171AF19542 1ERINEUM
690,253,719 *474DDB39FD5F28899D5701223030EBA1625C95F4 1-klingeltaste
690,253,720 *474D7AB9A37CECDA6B709DD923F56231A0A543A3 1-KUOLLAANKO
690,253,721 *474FB376258C7EF478D73AE39175DE96E1F45866 a4f8.
690,253,722 *474753809A7DE1D854519149731D5D06D0ED937B 1-mac-jobs
690,253,723 *474E26082CAC3D80A9FC5F0109BCCA25A0DD01CC 1mikroelektronikinitiative
690,253,724 *474370325D897F875BAB91014AB3588317D5FBB5 a6t,w
690,253,725 *47446F206D4767D4056AA6B7A0EED3502B161766 a8$bu
690,253,726 *474FF995321AAB5EC475CB5991A9EC9BF0B885C2 AA-_|
690,253,727 *4743FEC4DECF1C9866348277B7E45E9DD9C3C9AF 1-schooler's
690,253,728 *47467409428AE88942FB6C6DAD5B9A7FED75D472 1.sozial-staatssekretaers
690,253,729 *474E17FC4A136A946B628F6766D1FE0A81763A45 1 STANGENBROTE
690,253,730 *4743C6E687E86C710D4B5E1A0D0B3EACAA7DF540 1STENOBRE
690,253,731 *474934F0E308BDC89A454A2359C1042E2646B1EC 1st strike
690,253,732 *4742F51CFC3B508B607AC88864418F751EFC6C78 1-valkosolujen
690,253,733 *4743BA1B6121F9A5C7BDFAECB9BDF3CE57AC005E 1-vinotukia
690,253,734 *474A78EA3D1816F35052B39E744FDC274DE126B4 aaer!i
690,253,735 *4742AFB9F0EA7FAE8EEA79EAE93AFE81D58ACDC8 AAWUP
690,253,736 *474E632E4E6A92ABF2C709E223FBFB87C04DFB4D [email protected]
690,253,737 *4740804116012291CF56C0A0BEEAE01E9AD4857F abandoneesed
690,253,738 *474F9021C28823C5791CAC8397B753DC4EF9A865 25-02-1170
690,253,739 *47462C6EEA1036789FC3696B63B16525855E1E48 ABH:5
690,253,740 *47483C7C9291C6D4B6AAF29C9EC118E4685D030D 28DEC1843
690,253,741 *474975838698B087D502B8808D3860C4C39F6938 2944469 SUOJAISA PUOLIKUUN MUOTOINEN SIS
690,253,742 *4743884666F442A1B2A09A1BF894EE86BBA6F832 2-AATTEISTAAN
690,253,743 *47457038EEE702A22776092D1874777EBE0513FA [email protected]
690,253,744 *474ACBF40C545BBF2ACD33BE2B976E51E21E4BDE AC5H
690,253,745 *474962BCDC2FA411FC7661B80E71BDC036795484 2EZOREEHT
690,253,746 *474CEE99E2D75B606AF2FA899C3062DD660C1A5A acetylsalicylate6
690,253,747 *4743EC7E6092FB16A2FE7677A350C96BAB66B128 AÇIĞIÇIKMAK
690,253,748 *474F2D27FAC31CE92BF5213ED69C326FA5753201 [email protected]
690,253,749 *474FFB311281D6A18DC9810993FA2BEC4C3AB6F2 2.isaretlenmesinde
690,253,750 *474D000F962A7F739E5E9009D05C4F74AFA1B52E 2.jay's
690,253,751 *4740DA1C0A0F63E5B6B1205EE9A9EA884FCD4D62 2KAARTSPEELDE
690,253,752 *474B2765C80D4429E294FFA260566705701F8FEB ACWRITER
690,253,753 *4740BABF3628661E4515E9F7F806BAD32BBE8E63 2MYRUNNING7
690,253,754 *4742167D2E451B27995362B0D6DCD82B4CB5B9A7 2 NATURLEHRE
690,253,755 *4741E0B8776B0B9C66C037FD6BD24AA66BCCE1B8 2reclaim
690,253,756 *474556C97010701D49F61C457DE39199FBFBE2D0 adhfq
690,253,757 *4742EF0253058195CFDF51B7232C2FD93C50AFF3 aep/v
690,253,758 *474CCA3A1F59843C04326B6B8CE4A6FEAFFA1F75 a,f,
690,253,759 *4747CC4343B434D773CFA64A4A9CB9F5358B8D15 AFFV(
690,253,760 *4749038760749AB7382300F5ADF18F8071A88ED9 3-koipeen
690,253,761 *4742C1D0FAEAE90A012B5D1EA49A1A20AF04466E 3MEMORYA
690,253,762 *474AA4125D57E53E5299963B9BBE36CE42799722 aggiriamo.
690,253,763 *47474648FBD9C0278DCF41A9CCD0E75A500B0816 AGWG.
690,253,764 *4745AF211B774842AF9738662B9EFF5BE74FD29F 4ACHARNERENT
690,253,765 *474CA748E2C4BD30349B038C8B7C45299CAB799A aittf
690,253,766 *47448D978C07EDD5C5D35BD37411382788FA3505 4ONDERGRAAVES
690,253,767 *474A571D0762552BFFD5F7CDD0825F681BD87C49 4PATISSERIEN
690,253,768 *474D89AD781A489BD1291BE5DACE8127AA748B6D 4RACOONVISA
690,253,769 *47480CD4BA8586AA6A5524B73B1989E36290A35B al2%s
690,253,770 *47404A200C62017CD4206E86CCB52B68B1DE7C38 4SRELDEEH
690,253,771 *4742E5FDF81D06F221985ED5E2269B26FACCDC32 4THATPRELUDE5
690,253,772 *474A127D1765696DCE4C2C7B3AE1566EE55741A9 4TRIGGERSTATUE
690,253,773 *474C15D09FAF3DB200AA69289E9996F046004151 4ULTIMATIVNI
690,253,774 *474DADDCBA1F340360A9BF8BF1321339386D9D68 ALFONSOSCHANK
690,253,775 *474BB7F8C9D8D56C87D37F7BF0C28AF454BC3C35 ALFREDCASSIE
690,253,776 *47486F4623F7608AF08F6D08099751AE6F404007 ALI.NEILL
690,253,777 *474618B4485769A543A47EB315B451542D03EAD4 ALLB(
690,253,778 *4747EA9196E892412CF2F618A449ED2BD71DBADF ALLOPATRICTHEY
690,253,779 *474DDD96AD9F0C38FA0C30D65BD5676EFC4CD5CD 5BLDVLST
690,253,780 *474410724EB85ADADFC706A6A6299B3246F86BD0 5BSWLESSATBSW
690,253,781 *4741EBD92208658864028301C5FCDEF421D8D5AA 5CAILLAIENTS
690,253,782 *4749E6EC5C362D413B3DA59287FB88284E65DF07 ALUMNIKEEP
690,253,783 *474091E8BF39F715027B98B9911246DAB63F915D ALVALANZAROTTA
690,253,784 *474BAA891DB95218231D2C5BB6C65892C59F1786 ALVINDERRICK
690,253,785 *474C0E490E95ADB304E6DF497667B96DCD430FE1 5GINGERRADIO
690,253,786 *47403395C3F74618AE728899E56A32CC7DE46D16 AMANDA-CURCIO
690,253,787 *47448F7746597EB0B0AD8EBC7713576D30A2B6E4 AMANIADNAN
690,253,788 *474EC27BFBF91B3CA2AE1702CFA5217D58590713 5PAAVIRKNING
690,253,789 *4743496AC7A553414E7615491617CB6FA9596FBC ANDREAWEINBERG
690,253,790 *47474FC27203E0DF92311FC4805D5B2B2EADFA7B an:ew
690,253,791 *474846BAECCD9FF7A29D87EEE9D31B959664E37A angirlying
690,253,792 *4741187C58C2609B612974FE1FF9C95A0F53986C 6ARREHIRA
690,253,793 *474306E227DC4E83B3161D49692CE60EB14635FD ANQR8
690,253,794 *4745FBB4137A936B7E0492A69349A9AC977EB608 6FREQUENCYKILOCYCLESKILOHERTZLOW
690,253,795 *474E03E3754F3C4A128D6869411F78500481E759 APA$4
690,253,796 *47453D7277EA74FF9C071370414A71CF36520D90 6MCYCLEBSW
690,253,797 *4745EE270E79A4F4B4A15D6F5F9AF61F65125C21 APPRENTICE-SEAMAN
690,253,798 *474F3BFE9C07CFE9DDF524B1021FE3A22391B45E a=qky
690,253,799 *474E1B965A0D36A291AC4D4471626BC43FA72848 a;q+l
690,253,800 *474EE79FE8B20F7C8F8B72510ABBB6B041B62B33 aqnf0
690,253,801 *4742639FB4385DAA9C28F30945F36963104F83A2 6TERRYSPOOKY
690,253,802 *474137F62A783E82D2572150E1F30B139B2DAAA7 ardenbracamontes
690,253,803 *474D1B41D9DC0DA312AB3DCF48F8ACD80F1407C7 ardhaangi
690,253,804 *47488F61162AE030240FE67DD0FE3440F28739D2 a:rm2
690,253,805 *474F7C125DF4E098DA0D2D9BD97CC012E99A6259 6XSLVXLOMQ
690,253,806 *47422B4CDAA3B5079B006C294AB562628DF664E7 ARNOLDLIVEOAK
690,253,807 *47443100A134610C4F7BD793533165CC90127497 708987 ZWEI-DAMEN-BESTELLEN-EINE-WILDE-MISCHUNG-ALS-MENUE-
690,253,808 *47467244557F8F6B4C7F74C7E74963408EDFDCA0 ARON.SAWAYA
690,253,809 *4746A36E8A8DF5B50B49BE92F9002921FE9A5BEC 76b2b9
690,253,810 *474484E2961DF48633E6672A06D146E79291E40F as"gr
690,253,811 *474E832973A2D5340E0ADBED1315CC1C7B1964B4 7I7UBASSE
690,253,812 *474FDBEB1B4B366780AF604D969DF277F386B1E0 7IBAJDNAB
690,253,813 *474376653C0B98FD04BBE21014C336800900479D 7lavanderie
690,253,814 *47447DF308F003F76695676AC8CB32534A66AEB0 ategorem1
690,253,815 *474DC9CE8754FB6F21E74162907539B3F0536D5D ATQ0B
690,253,816 *474C4A39EA2102AF696100BE6C5A2E8CED6C1BF7 aubree379
690,253,817 *474923DD354B61C26C74302608AEA8DADE6B7FF5 AUGUSTINE.TUPPEN
690,253,818 *474A7F840D3225A6DBDC348A99CF1B36CE5B92BE AUGUSTPLATTSMIER
690,253,819 *474710A268935CCEA3B7672A8F92069D3EED775E AUNA
690,253,820 *474839C568F2311E847DBBEB471A9CA8E3775649 AV./
690,253,821 *4743E038728307CB79A39D28497015FB0435C04F 80u9anvllaeas
690,253,822 *474F654DB3C4CC605E55C064E7775497F87F3BD7 A"VW
690,253,823 *47462E855749932DA5DF2E7A1BC9FB749B8FF8C2 8ENLIGHTETH
690,253,824 *474D9AFBD34A72B04C6FE8C5D91A3307BBB845C9 AYVK
690,253,825 *4742A160428AD9C10B00BBC4ADAFC46D455947CD 8MIRERAIE
690,253,826 *4746692AA2D44D2421C5917EB8B8532F0F5A89BE 8MONKEYRONALD
690,253,827 *474EBAEADADF1260EFAF434FB424F55D0D204DC1 B29MR
690,253,828 *4740101DC20B897870D6046AD4757DBCD888764A 8R4HMNSTS
690,253,829 *474EA6CBE3C78EB4B56473702F0EAA2099CEB1A0 8REORDER
690,253,830 *4740D3215A6A0B339C35A5FF7875FCB6248DD458 b8&1s
690,253,831 *4740DDCCC578E50F05F11A3DD4D14B7ACC09895B 8UNTICKETED
690,253,832 *474F043A5AA6415765DA310AC491C45E36C53809 8VYTLUCENIM
690,253,833 *4749A48AC0A9BF8946568F51D08B237E3D57A3B3 903E4717B8C136B888707BFF86CDEBAE
690,253,834 *4742C5C94C173AC29612EA611C5739D12CDC393A 921021 -yanilmiyorsamvar-senceneolabilir?
690,253,835 *474E84066D077C7D4CA066C6182F28ECA6742D16 929f6f44a7185d9efefff8a9beeb9dae-lox646000
690,253,836 *474F1BD03B3317C8F0C8F97E260E23BF370C8F28 B(AFO
690,253,837 *47414F2F86F5BFF0D31913A39C3EA023F749F67F 9BIEGELBIEGEL
690,253,838 *474BD9A52A6BF173718F77FC3473516EE32A7DA3 9BSWCSCFBSW
690,253,839 *474890B7B1152F71E5EEA79D42812B99CCA082BE BARRY.VITANTONIO
690,253,840 *4744777E5305F905F944AA27A02CFFCCBC941081 9INCANNICCIATURE
690,253,841 *474A012B8B2CCDE303D7127FF0F6544C86EF7027 BAY0N3T1N9
690,253,842 *474B5B0E557DBED7FC4CC815EE841DE0C74EC792 BBKGM
690,253,843 *4748169AC947835871E34355585BFB55B6F33E14 bcmpg
690,253,844 *4744736B302D4A56408E7843154558F54AD32F7B bcwf
690,253,845 *4741E741AC8EA2AC153925E53DBC664A89C1E6BE bd0?3
690,253,846 *47474A98EC3289B91C76575E8B524D0D260ACF1C 9THEATREMIKEY
690,253,847 *474C138D67FF017A0965A88E87FA59910F37EE4C 9TOMCATGASMAN
690,253,848 *4746A4A2D6529965008C2C8BD07181A467591BC3 begiftig
690,253,849 *4747CA076E9D9BF6C94251D036F208E82CD9BDFD A1H5%
690,253,850 *4742F2EBBA674E52C03B9742461A55C420296310 BENNIESHAUGHNESSY
690,253,851 *4742A11696C88E91609260224D0F17CD4E2B2D28 A62803
690,253,852 *47440FD92C4FA3B8A6D75C96E048DD5EFBB5E662 BERT.AREVALOS
690,253,853 *474B3DC1E218A0E876AAC60B736ED210A99AC215 b(ewh
690,253,854 *474837C3FE4244078A0FF7C57AF5DF227921D211 beyazlaştin
690,253,855 *474D5BA2F495E90AE0135AC3851F7839083A8B7D a=a:
690,253,856 *4744BC8F95F60E2A767F652E53FAEFB984177E9E aaa'k.
690,253,857 *4741385B0F0979A8552707A0A80E2DFEEF139A2C BILLPRAIRIE
690,253,858 *4743C31328E4FC0BF9C7A6B0D495D08D27514FC7 BIMANUAL
690,253,859 *4741273DD95DF0634EE68CC7C42BCA3E018A190C Bj3i
690,253,860 *474FC68983EFDA849EA5B6CE1EBCEF4AB70FFDB9 ABJE,
690,253,861 *474FB24819FDC08C94663C6F02F4BB1CCE33EED6 ABUYOGON
690,253,862 *474289BE1F87A0BBDA8B77C6729624A639A104AB adamhulstine
690,253,863 *4740195E2F564CDB190F4CFF5E12EDDD8971A334 ADB"
690,253,864 *474ED3998F0B50294DC89BDB6E7AE481A7C33A31 bookaholics’
690,253,865 *4749A5531BB659F77EA2FA6FB74A2A1825F38981 ADRIAN LUA
690,253,866 *474EA95287FCDB3CB1351F393BEC73BD30708ABF adrianurben
690,253,867 *4749EE64F4CFF42811C5F9CCE00C90E724E91A61 a(e+/
690,253,868 *4749E208A674C97EA0D9CB4BD7B3A5A935C784F0 aee5h
690,253,869 *47419469D48CFE7D578A56D3329F55CC4649D015 a$&ef
690,253,870 *474BDFE4610B5AED2232EAB26D1BE43942F4C598 A)GHH
690,253,871 *47447D7890AC4AB802D1F5CCDA80FB381B336F63 AGWD5
690,253,872 *4746721731F61BD6CC69C4EABBA823C1ED9B05E4 BRANT.FAIVRE
690,253,873 *4740CBED90201353E5DCD37BEA1B25F51D36C222 BrazillianImpressions:1TropicalNight
690,253,874 *474E451D6EF52E1F17B8B642D2B645914725A40E brendonfrantum
690,253,875 *4741EBC3769F11F98D4B45E6681D571BC69164DC AJHOLLIM
690,253,876 *47465640712F64947633FF12C39E9A6A1D7B864B BSBL
690,253,877 *4747697F33E8A454070F618E191BF13C210ADA38 bswgetinputfocus
690,253,878 *474E2EC0B689E53FB5219CC831647A13A4F02E96 ALEX.GAUCH
690,253,879 *474C5DE4C733415A2DCD588B71332704F0B4BF1B ALEXIS.AMISTADI
690,253,880 *47498549C069AD8A98941C9DD8FA22793BE336DD B%T&I
690,253,881 *4748856C0AA9031634C54D21D2D254C9082713B0 buc;q
690,253,882 *474177D26AA04E14D590E791946BCD93DDCC981B ALLOCOSY3
690,253,883 *474D3B8CE231FE65DDD520DAFD2B0932FAF515B1 all-too-many
690,253,884 *4748DF1229E1B66787E7C9D215156264064B14CD ALONSODELEHOY
690,253,885 *4745A22A2F14F5587C8100DA02F81ED68C836F61 BUNNYBEARG
690,253,886 *474EE171330A7B9AD4053EFA0D64BE882D306E58 BURTONALGOOD
690,253,887 *474F98E043C64AF11D45EEDCC339091FB3D448BB alt?7
690,253,888 *4746F03DE30A012A45B8A8D72910524260EAD9B5 B%V
690,253,889 *4741F82A90D677D0552565FB241D185216B4E4F9 bv(m
690,253,890 *4748F9C9E8501A44C3C0EDC162FF962F78E66402 B%WI(
690,253,891 *474494D096FEAE658E44AEDA46CFF812CBE4ECD5 a,,n
690,253,892 *47419DA77F09036B7273D970B52F9CB44064C6C7 ANAMALIZA
690,253,893 *474EA6EED96B1751432F7B1ADC13BF7722D720E6 c0/3$
690,253,894 *47441F76DDA60DDF044C59B2CD953696564FE84D [email protected]$$
690,253,895 *474ADB9F159994FD78FD7561132E06CF30F7C390 ANTHONYPARKINSON
690,253,896 *4749585916C25EFEC3E55D90C6E86758445AE91C c6qlo
690,253,897 *47411BA6C9EB1142207B67D8FF429FE3F8ADDBFC C74D
690,253,898 *474102885913E18D1B83908F43D801BC7D6B46A5 C9)DB
690,253,899 *474DEDE9115B2EE3B7C767E9E8C080C98003A72B AP8FV
690,253,900 *4748AE849392243254E1D6D0532A4DD34ED9CFB8 APOLOGIZED.14
690,253,901 *474CEB5B88ADAE396B9FC9F0B0ECD6DB6525C72C CAMPINGCOFFEE
690,253,902 *4742F34CA560A3D659C0F2ED2CD7B52A4F617895 CARSCU
690,253,903 *4741579E9C465A890DBA7FEA37BDA4FE0B2C5208 ARIANA-GUERRA
690,253,904 *47463D6CA083564A37BD860BAC9FCDDABD58E073 ARIMINUMS9
690,253,905 *4743F2CDEA7895DE6BD20DE44AF3721E8BFB164C [email protected]
690,253,906 *4748757C6CA0E0B1373D56BD567F7F65A283B5E8 caseysehr
690,253,907 *474498E571F7E037FA1652E507EECD9A671F6127 CASTILLO DE F
690,253,908 *474653449AB514EA6DE49AEBDFCF8F8AEC46E51D CATEGORYEGYPTIANJAP
690,253,909 *474E07A15C942F617ED76F94F7C5451E254EF264 ARNOLDOALWAZAN
690,253,910 *4745B55FC8DC4545DE672D2ACEAF9FEE84FA20CC ARPEGGIATION-/A/R,P/E//DZ//I/'/EI//S//@/N
690,253,911 *474AA7B993338A92ADA91C90D217257922B1AC7E Cay-Elinden
690,253,912 *47410C24B81F8AB481EDFD92F8EF1C2C8AD4381F [email protected]
690,253,913 *47479904B062606214B0AB4FFC0F7D65A614F9A2 ARTUSIO8
690,253,914 *474D497123D9F84AFC94B849FF3AB2779BE6A47B ase,p
690,253,915 *474F25F304819E1732CC8C0AF41F217557F84886 ccr;u
690,253,916 *474905B616C9852B6E8D47C9C40E0BD93B22BCEF ASSWEPA
690,253,917 *47481C735E02E01CEC7417411347E3DA2740FF28 ATL1G
690,253,918 *474E6AA6B11B573D16DB26B4758F571934BB2B4A [email protected]
690,253,919 *47478DFB178C0DC8FDCAAC6E7DBFF26BFB8F7D2A CE/U9
690,253,920 *47459BD36C0CCC0F1A21E8C4E214551872E85932 AULIONIA2
690,253,921 *474C1BE1B6BE95CE091E2D431B53AC4FB6572A33 AUNA
690,253,922 *4749BDA33B0FD1AD074F7348CEFC54F4BDF45912 AUU03
690,253,923 *474252E92FDB3C2CE1FB98645C5F075C961AC152 charteaouse
690,253,924 *474CEA5D491B6538278BC639AF6D66B26814F767 AWE#
690,253,925 *474D39BC686DDFBEC704DE64ADF7A367D9C838E7 a=yco
690,253,926 *4745CBA7489FBF42B694F5697846FAA1D29C03D5 choreic
690,253,927 *474943D18F258029D8B33C366AD766BA1AE38EA7 CHRISTIAN.STREVA
690,253,928 *4747B7545647047C4D7ADF9C5046A6A22F2AA706 christinegirton
690,253,929 *4747B0F2A87FD57465A4546E95D4020899166E4A chuckgoldizen
690,253,930 *474919E20B7EA5493CE8812ADE4E4722DEA8C693 b2oc
690,253,931 *474A77B274B1FC134B09C3EAB9F90A6234346DAB b.&4
690,253,932 *474D94D56C54431FB5E06F80ECFF66091E54CA28 CI-REN
690,253,933 *474419964E8B9848BB9FF56656D7E425D508FFC9 BaI3
690,253,934 *474EFA531B0CFA384543EB5AA11106D67DB81582 balld
690,253,935 *474A172478E7DA62F6C3495D8B6319574F4BD7DE cleomounce
690,253,936 *474FD58F0C8C0D21A267FBADBEA715FCCB48ADB5 barbara.gerhardt
690,253,937 *47463EF2C826C537B79A4BD402DA55F0D334D643 CLHV8
690,253,938 *474AF8B9AD172F4E7F4FB18E0573415DBBD1295F BBARKSJI8
690,253,939 *474B55F99E9A622552FD853E13F999AD94E9F765 CNET$
690,253,940 *474F5A3CAC8B4DA1D6EBF1BE341B47DA4B737A89 COCOMALON
690,253,941 *47458EE02CCB9E8FD4CA787395E1C80126B88441 b.dbu
690,253,942 *4742870AE88F281172B40AFBEA3BDC13563C4003 beaglemaxime
690,253,943 *4741B26C7CD79FA0C2B9ECA6AE79C5598483AF40 coltonbazydlo
690,253,944 *47430C371A8A00205727CF6BACD5C7E766DB0FA9 comarde
690,253,945 *4742786FDE690942FBA28167C5DACB0C7528A4E9 BELIEVEINSOMETHINGOTHER(LIVE)
690,253,946 *474960613B91FA083B793FFC0E342BE36F060C6A BENNY.FILKINS
690,253,947 *474E57F069859525D26D4A1409165F8BC1CFE113 BENNY.RURY
690,253,948 *474FD8A20E2BA61ECF10E9B53AA66048B6B6E508 CONTENTARDES1234
690,253,949 *474CC9E08A600BE89743C922F1E9187B8CCAE935 beoau
690,253,950 *4741054751EF7106BF11B814499281D096D4D285 bernardgappi
690,253,951 *47490D9AE255CD47417548FB3778301A40FAB0B4 berrymustafa
690,253,952 *474E74AD3CC57AAC3809A153D4151017A07EA6FA beshameses
690,253,953 *4744CB0274898A4BD02EC1A08C67B8061EB4E2A9 bg(s
690,253,954 *474618A51AD058032379816D7748F0339377CFCD bgvknsp95
690,253,955 *4747E16B2528D55854919D8A2ED535D06DF15223 BIBFY
690,253,956 *47455DA3455F3CE5272EC35A54D06AE8FCEB8933 BIHALVED
690,253,957 *474DD59C954EAA5E337D4EE0C85AFFC0107D86FC crimson-veil
690,253,958 *47479AABA81AB212CE63F1E9A2B7EC2789DF0C5B cristobalaguiler
690,253,959 *4743B7E9C9EA1DCB4B99432771FC1CDED648385C BIMANUAL
690,253,960 *4744D82ACE6DC94DF43931684C22ADB500A8CE18 B,?JR
690,253,961 *474D2FD511592CB01B1CF9AC0EFA0922ADABFED2 CS.TQ
690,253,962 *47483769E8C89B76B46CAF29227771734286FD7B CURTCOURTOIS
690,253,963 *474CA290D9C364DE34C5A72566E9A43DE1879F68 bm?3"
690,253,964 *4746C05E6723AA157477E08259AF27E263A0C993 c"v"i
690,253,965 *47403FBAEA89A71BC9E04575AB6DEEB0B17B86CB BMGSH
690,253,966 *474121C0F5EBF1083682B101F520662BF46ADC79 BOC.;
690,253,967 *474955F0F53901479609E80F53E48EFEDF660EC8 CZ(d
690,253,968 *474C868F9CC19728F679193031464380F2871F7C D$0RENTN9
690,253,969 *474328116ADC058BE255537442985AF8C1B4DB5D B###)~OSPLAT
690,253,970 *474C10188BA1B38B7C7D40ECD1B28844B6579484 D1330
690,253,971 *47458CBFCDE9C95B4F18C41CE04209F0B5C70343 D5!I
690,253,972 *4749D45EF9F8B97FBB0BED0D9E073C50E483BE24 d7rxw
690,253,973 *474678348A699EA9C38F362076E3B3E0CA2837BA da89b462759f97c11fa33fcf7f9e865aavy1701
690,253,974 *474433225EED69FE986EFED000B93B245E24716B BRADFORD.STEINERT
690,253,975 *474E3919B32EF2A3A8419B1FF1691C388F091435 da:e0
690,253,976 *474678D01510D3E55B1A5C176E0F8577FBA9D89C DAMIENDARGENIO
690,253,977 *47409D3C0B0DBEE24D0553E6AE871C6449EDD5D0 bricealonza
690,253,978 *474D09AB7DC1DEF23A243C63D0834E4F9AE43F26 dante361
690,253,979 *4746567BD5A57C445F2D6E42AD14CBEDF624E0FA BROOKS.TIGANO
690,253,980 *474E9940BCB5AB8461510181D40E8D5403B69C2D DARREL.CALIENDO
690,253,981 *474B2C63F4470243AE5D7BC2591610367DA08757 DARRELLMATTHEWSON
690,253,982 *4745FB794C91876D354AB68853501A16E2DBEB77 BRUNO.MANGIS
690,253,983 *4743920B23EAC6589D9C319D984FB1B4DC36C914 DASMQ
690,253,984 *47438F4D41C8F9D0FE9926597ADB3D490A7C5703 b%tid
690,253,985 *4745B9E0BDE706F126DE592FCB5F1B72F99C630F db#rn
690,253,986 *4744AA2575C6B87E86F92832AFF5CA1A36ED535C b?uqp
690,253,987 *4746A9B6BD14C69E9625FE7E30282F7F93688C2D d_e;
690,253,988 *4745CBAF01D3365A5B1A0BA7D3C59019CE3FF0B6 DEAN.WIACEK
690,253,989 *47484041F75A9EE0295048BF952ECA1B2E1329DA debiting
690,253,990 *474F870174DDCC88CBA64E220228BDBC8CF2D95D b!-w%
690,253,991 *4749329914963EC1F0D10C7F0F0CC36834ACA662 DELCROSSEN
690,253,992 *4744DD1B75A6524FCEE69197D0E3FECE7D4C77F2 DELFIN111
690,253,993 *474378B2C8C90ABEFE57EA5E2285128110DBB757 DELMARSANDUS
690,253,994 *4743FC0C4C54DDE6BD967A6EF24025D63F493054 DEMAQUILLIEZ
690,253,995 *4741F480B80AED606E67B99C777A3C1EA746CDEF DEMONSINAROW
690,253,996 *474064AD0BAD8FBE71F38226CE050E0B828D60E9 [email protected]
690,253,997 *4742EC5B9B78133FCF0257952DC8A8EA11D91C47 DENGZIKUO
690,253,998 *4749C65E5EA5F3D2908B5355CED768504AB8B71E BZA7U
690,253,999 *474E5E3D8DB956E4A3172AD6AF2BDB87C34A0C08 c,1et
690,254,000 *474BEABA9AD006A66C86FA3356C43C1810633028 deshawnknori
690,254,001 *4741C311E64B56AFC30F92777E6F73F1EC9FBB78 C1,P.
690,254,002 *474B0DC573BACC948C6FD5ADD5AAD982D11EEB0A c3jx
690,254,003 *474E81C43BDDC9308B2955BDB57D300822956CAA dewaynesemons
690,254,004 *47477DFFD8DDC6672D660CD89CA1AF031C470CAA C5THT
690,254,005 *4741D970D5A018CF440D0BBB9B57608FF6CAD10A D/HQY
690,254,006 *47400A113EDB89D153EECD22CA291DA39B2BA5ED calaronosing
690,254,007 *474F4C29649E8B8B7936647B47CF736865BD45C2 calmavi!
690,254,008 *474B804C8E0551BCFF8D900F3E8E72F5938321AB CALYSTOED
690,254,009 *4743CF6DE890B28360C74B50FC1EE75FBEB7B759 CAP139
690,254,010 *474CD70B6EB477FBBB893EEE65770E9FE4750F0E DIONAMADO
690,254,011 *474BC24FE3988DEDE15394E2BDCBB7DB0C709EE6 CARMEN ONTIVEROS
690,254,012 *474E057507B473300E7BD674D0220B49E8811C45 CARRIE CARRUTHERS
690,254,013 *47437F13586BDB30CDE7C351B526D39A61B5A49B CAS;0
690,254,014 *4744A224E2567073AA42C0074AE2D75E9CA0CD6F DK6F
690,254,015 *474B0EE9D516CEC528E51E30F75F753A120EBA3C CATHYCRICK
690,254,016 *474A2FE18C2811012FD84684102ED2CFD71CF9F6 DKU.
690,254,017 *4748367E02B3B5F4671E2CA006BC00A0953639DE c$cm_
690,254,018 *474224B630C2C81498608C81CBDDDC250C0893B6 cdmz9
690,254,019 *474AD40AD20F619D3B7D535BFA63FF980BDD3D44 cd名稱
690,254,020 *4745C34469F6FBD0057BBB6FA3ACB488213EF544 DOMINIQUEGLUMAC
690,254,021 *474C24214C6E48C3BCBF096DF7756E18A2077292 CFST
690,254,022 *474A787A993EB5528089EADC094846F4D9F28386 don't.let.him.take.your.love.from.me
690,254,023 *4746FD3984BE379074877D019DF3708C5E41C1C4 DORIAN.HOOL
690,254,024 *4741D3C71C9BD9C438678AA2A44DFFAF755D908B CGO_9
690,254,025 *4743F46FD430C077AA1B329D8C8423BEB0E6437C CH0IR.SCR
690,254,026 *47491EDF5592C6BADD3FBAF363284495D0743388 ch8p
690,254,027 *4742D093A925EF5E7A722D138126099581EB0311 CHAMB3RLAIN$
690,254,028 *4745F1EE2AFCE995956E9560103F73DDA702F89F CHARLESARENA
690,254,029 *474632C97F2AEEB432BA4D0C7B816CD105DB21E7 charpais2
690,254,030 *474BC5F6D4F78E4CAF9BE914C2401DA5047CFB9C dramgoodbookscomwww
690,254,031 *474B81D3E4CB0E26C462BB5BEB321DE39CB45D34 [email protected]
690,254,032 *474D5836C7A4F9DED2A236C31930DE362BC1A9CC [email protected]
690,254,033 *47404863BC4AD25AE94CB5ED1A6CAEF2B02BEA8E CHHANNAA2
690,254,034 *4741039B78C1D866ECF83CC8A6F55870F6C7A1DC d&ri-
690,254,035 *4748C98A214E0F38DADBDC25B21536AFF12D687D DRILLINGE0
690,254,036 *47461E51D57AE537752452BA74F3761A4F0C2B1B DRSONNY8
690,254,037 *474CD59375957FC2AB7FF7A27783F6400C9A5D5F drz?h
690,254,038 *474949A0CBF2C1DBD3B0F0EBF7C0793D9C497C9E ds;(w
690,254,039 *474931DA1CFFEE750716418B6BC629A047A48C7D dug
690,254,040 *474FF2A2CD635C143036AF718C732518812FA935 [email protected]
690,254,041 *4746230DD6ACE7001DC9516A3A507DF4A75860F8 claudetorrisi
690,254,042 *4744E15B3E2F0828850498807B0529285595A9DB dwov
690,254,043 *474790DBA85188B835595B09C012ED4A352867E5 clayhardister
690,254,044 *4745C8228740E4F0BEAD8D892B6CF3F86C45A8A3 dw)xr
690,254,045 *4745DDC0D512AAA74F8E80B53A727E2C36131126 COBLEFAM
690,254,046 *474FC679C1A0E8BAE56D91089994506C3D788DB0 EDCHENTEILZWO
690,254,047 *4742FF06DA0244892304D97307D0BDBA50CBFE20 EDDY-KOAY
690,254,048 *4749B378A4AC8859BD53DB0BDAEB189AAA78EF46 EDELEEN6
690,254,049 *4741721F41A65038AD333AEC5EE84CE39220EFFA coleman-goff
690,254,050 *474A2B90F42D5804FBA49A98DAAFB9FA2E54D702 colleencrowe
690,254,051 *474353F196B86275D0A360E39983FE58E3B800D2 EDWARDODEVINEY
690,254,052 *474FC06EBA987ACEC31C69BA1D763E5C1C36276B e=en
690,254,053 *474FA2255BE13F85AEFF7F1BE18683798C80B614 COMPULS4RO
690,254,054 *47424CBBA793893AC837881B2E13FC91D8FBAB64 condadodetioganuevayork
690,254,055 *4745394425E29070C2AF91270D830AD40E1737E4 EFREN.PALAZZOLA
690,254,056 *474A922E16FD054E33ABE0C7DB280550A51CE813 eftmh
690,254,057 *4741DB27A75635C33DF6378953C951C41CBBCB5E CONNIE.RYNERSON
690,254,058 *474466F1211B31F8BB3C353954EAA4161D5521A0 co:ns
690,254,059 *4747C82B9647BFA4C580E2652F00E57C2D595096 contortionlibrarycomwww
690,254,060 *4749C951AE3FFE00D857E6C7EE955521B6B628DE copewilliams
690,254,061 *4742962F1322FDCC48CEC7FD04DFC4D10B10E437 elcrucing
690,254,062 *474D52B2D45CDA54A22FC8EC9129E1B0DF069DFD elg3v
690,254,063 *47497B56501CFB8C8682DCC1F950160D58142EAE ELI.SCHEMPP
690,254,064 *474276044FCC051D8622CBDE9658CD04197F0218 CQ&AI
690,254,065 *4742192DDDD2A93F9E027B7BF45A03705735F53B ELLIOT.SACK
690,254,066 *4749A6B304C4AB11DDEB4BF00402CA6D75604844 ELLIOT.TAUARES
690,254,067 *474A0DAA95F464247F11AA1154D61B27AD22D3C9 CQQ&T
690,254,068 *474D4B6ADA649AC88DBE306C03B705314A566045 crowning
690,254,069 *4744535F79A346137266BFFDF706896782FF89FD c!tq"
690,254,070 *474DDD0D4392F75715B538FCEBD3F5F7C85267F6 cu1n?
690,254,071 *474B216762A1BBC1615C5E0CFE7D3BB68912EBD1 culg
690,254,072 *4747161A7D9C70826D467AC84B2E033B5DBD0284 ep=:u
690,254,073 *474290A90D0A86D64FAFA3243156987933D077F4 EQER6
690,254,074 *47487D99255174D8779897A4BCEA93761AFDC824 `ER6
690,254,075 *474D9A8979195FB4257FD0EFB984040BE7C4C7F7 ericheflin
690,254,076 *4743F2D07055B4147522F5C67736DBF2C92FD074 cwj4,
690,254,077 *4748D6991A0EF25CC98151A07DF43DA9234A14C0 CWM2021
690,254,078 *474C01EF8BFB2CCB53ADED6F1B6169EAD4356FEF erinschatzle
690,254,079 *47435C382C0FB80972A670361331719CCCB16A92 c?wuk
690,254,080 *47425025B491A3B1AA63D43BD56B261B2077C00A CXEJ%
690,254,081 *474F05360FDA2B8053EA2779E6F588B21F5768DD ERROLMORRICAL
690,254,082 *47408BBE5D2466DCBF57ECDC411A567516CEC5BB erwin-gabriel
690,254,083 *474B45CD9E8AE9DC94DC8227461C748300022CC9 es4vm
690,254,084 *47400525818844E2790AC1F0370808AF3E9DDE09 d2?ph
690,254,085 *474D04C935E76FB9D3BD20AB191E33079A4A1760 ETTHCOTING
690,254,086 *474770900A251B364EA2FCF469DB29345A6F7C1E d3:$7
690,254,087 *4749B5006967583BDC0DBB3A3DA294FDB6461CC1 d3cns
690,254,088 *47487EF3751398A098853A828EEAC2261968B156 EUGENIO.PONIATOWSKI
690,254,089 *474C8D2F3288688335A22654CA7071260CEC3FE6 evans.bradshaw
690,254,090 *4749F5755B91E38150C2FD7C51E772C90446EF9F everetttabion
690,254,091 *4745DE1D71D1F2A7B1F808C72E585D1DF94F963D d5q4
690,254,092 *474D1697C3166C999FDB889F81F1189B07721C73 EXTRAVAGANCE-CURLY
690,254,093 *474F7C0F0596FABEF7AD4DD5D26F4B932089ECED EYPIN
690,254,094 *474FF4E1DD6B6E0FF7C16B211231FD10C5922402 faded-(album-extended-version)
690,254,095 *474EE4F608704C008BE475F7B5191B1E410ABCF8 DANACOTA
690,254,096 *474C311F2B828D7D12AA26C1E84102B3E344C4E9 FANSHAKE
690,254,097 *474D7E64F0B20042B4133D1EA1E57929A9CD939D [email protected]
690,254,098 *4748A093C0685934DCDAF2958C06DF25463ED4CD FELICIAWISNIEWSKI
690,254,099 *474B7AC0E752FA156C4FB69D469237DC2286624E DARLA92
690,254,100 *4740212673ABB7A8B0B9B216858E189CA4F394B4 FERMIN.HULAND
690,254,101 *474E8AD4E61801BBF3D83261F1C09455DF0D2B77 DARRONMCCAGUE
690,254,102 *474EB85EB60A770E4D26094C2B2158CCD2690E23 DAVIDBARCA
690,254,103 *474E59B4EE75FC5E797AFD96D74FA1CFB3FBF92E FLAQUAN07
690,254,104 *4746CEABAF247CE22C22AD316BECEA6913FA6F8A DC/)
690,254,105 *474B2B8B1E24EC771DAB8F5187061CFD56E99B6E FLORENCIO.LAHTINEN
690,254,106 *474364D4AE1335EEE7AFE7B30B1403BF41CACF0E FLORENTINOSCHLEPPY
690,254,107 *474CBBBF2DE31886B34859E18390BB95C06A413C dct;6
690,254,108 *474B4D944EAD706D30C356A10733CB14EA161212 D!C+UM$
690,254,109 *47405A1276FED5CFBD0858AEA643BB64B7629CB2 FORMULAOFTERROR
690,254,110 *474DF8A0C2EB4ED132E6FD41F9A6AC8884A86EBC fpaul
690,254,111 *4748FC40D2B43D8F95B6D3F56597356F3667160C FREDDYMACE
690,254,112 *474DD8B3D28B52267079475B5C01B589FC865B34 FREDHELEN7
690,254,113 *474760131D9EB53F9635B95AC38236CFB8F9609B FRGRAMMATICAL
690,254,114 *47469AE26D9B4C4CC5C67DCDBFB59428AD400C11 denisdasilva
690,254,115 *4748F2FFE6AD0E41B4FEBEBF2BE8D9FDB59E7B52 FTJWKJUYGRW
690,254,116 *474148248DDECDA578AD607753F98E49A46B5830 [email protected]
690,254,117 *474BA2217D056440C77BA35A4F49A20530BF2251 DERICK.SISCHO
690,254,118 *4747D8C5390FEE8E88C3EF52D66F16EBB44CF078 FUSTIGAT
690,254,119 *474A2385322250B1EFF35F9BE8F084ED89C2CE27 DEWAYNEDEGESTON
690,254,120 *474D1066C5C02534FFBB424D8422BD1515F2AF67 DEYEKDOO0
690,254,121 *4748C50F3F945E335C5ABFD65AC1F26E61589E95 DfSW
690,254,122 *474EA2995EE1AB31AF57671ACD83EDA65DAF2A36 [email protected]
690,254,123 *474B295970A820E2A5C9583F3139B99C8D0C75C3 GB}K
690,254,124 *47468FBDC58B923098E4150B6DD75C3F9F8CE6B9 dhlwnotan5
690,254,125 *474324551D0345F916BA7C0C92CA863DCA7F7711 [email protected]
690,254,126 *474AAA4ECDC3F93BF6477D8D61A7B2D9082AAF5B gembitskied
690,254,127 *4745107D268678A36CE72A57AAC51FA35C493287 GĘN
690,254,128 *4749BB3E62E483CC16BBDAF3499330CEDE356F0B gereleane7
690,254,129 *474A52A3D2E1EE34BB983FBB5C6A73412066E7D7 dillonesbrandt
690,254,130 *47477B5C326C2FCDF461D8F1BBCBFECE8DF12CE1 GertJoachim
690,254,131 *474F4E15344E92BAB5EE4E5A393BA38272E13684 ggmc
690,254,132 *47420B9ACC822E61BDE90B59DA00DC9125426F2C distrito-de-oldenburg
690,254,133 *4749C08BABEB6B83F922287C35DC428DF2AB5C3D GIRDERS
690,254,134 *4745A9801350E2F4262F3D56B447E33864C4487A GLANDULOSES
690,254,135 *4747E1B57C9F9D253B0034375D7647D0C8768F2A DKCEZG
690,254,136 *47469A7F6F13272355E91501DCEA6555AF41B367 GLWWOQC
690,254,137 *474330C2BC4627FDCA9A10FA8C85D7192F08E247 DKU.
690,254,138 *4742D2DFF4A330F5BA83AED9DBCC3BC0FD189485 [email protected]
690,254,139 *474A0DA46C2683C55FF7F94D42C84D92CC0BD16A god's-grace-reaches-farther--gene-macdonald
690,254,140 *474B19467203EA4A449DCB0226A6B2F0A1EDF153 d!liq
690,254,141 *4747026F1672645C7BF708169B7A63AE84A95EE3 GONE(TAKE3)
690,254,142 *474981D712BD95787B2B3E6C8187D334523E1999 goodbehavior
690,254,143 *4744D0B59E242FDE9A2ACAAF55CB32B5957951BA DMDMDMD1
690,254,144 *474CA62B0EC0742133589A44411FC3B6FE1C110D dmei9
690,254,145 *4745B69194773996B2748C1621D0484C97CF7866 gpsで道案篇
690,254,146 *4743F1AF6D0A147B78C222CA5D5BE726460D6EA3 d+o)4
690,254,147 *474D43CE0A79F5983F3A113D0F05589A24823F07 DOANDVA
690,254,148 *47453E8F159B72496EBA9213B26446117643F907 dog7_
690,254,149 *47470788C919D8D37C770D774192A0256FE0AA11 GROWBE
690,254,150 *474498A734B13708DC3B81C5B5C7DCFDBB5F6BA8 GR!STL3
690,254,151 *474109DEC05073B1871B4713CBA39A0B8684E236 GUAYANA2333
690,254,152 *4742605350FA7635802146261B97D9150248E997 [email protected]
690,254,153 *474CE8690451901A8007736814801C20454C523B [email protected]
690,254,154 *474772CB58378A5DA74E6754E7976FD595D94F94 DONNYHEDTKE
690,254,155 *47425E060A13972F06C08491095CE0283232616C DOSTVM
690,254,156 *474A0A6FB6C9F93D5856CCED8D38E783444E04AC d_p#.
690,254,157 *474B9A6BF38F6FF82438A000FA3BC72B91C28678 d:_p8
690,254,158 *474B39D426416ABC78516ABC6959B5D178C7D14E DPOBS
690,254,159 *4749343D4CCE793057DFD25E173594DBFB1E491C dqb#c
690,254,160 *4744DBE4D462B3F7760BC80A41F6A82056EFDA9A HARLAND.GOLDRICK
690,254,161 *4740CB209AFCF381BA42BB58EFE0AB3009DEAF9B DR. BALAJI TAMBE
690,254,162 *47445BA76C6A657D3002CD12E92A0BFE2AF90F60 drctmnt4
690,254,163 *47481559F2D474CCD163C3A4BB4EA7007AF51998 HAROLD081
690,254,164 *474B2C7100AFB56C838C62A204FA010999EF4EF8 druppelflessen
690,254,165 *4748E9654440C4696661659DC63481B9C19039AC dsplacemen+s
690,254,166 *4740F23D69F0F9A0629D9134C8E6F20DFA2840EF [email protected]
690,254,167 *4743B18CF19092CD87B4607D853ED91383024BBE D%TV
690,254,168 *4744E4A9E9CDBFF3FD678C54373CA1FC01BA5B68 HERBERT.WIGGENS
690,254,169 *4746E9B7E8188EB2921633FAAB2B7CFA24D0F8A5 herculeese
690,254,170 *47455F3CBBB24B2D91CCF44319B9C53639317825 herecomesasaturday
690,254,171 *474682F1760415FDB0AAD80D738D65246F9F1BCC [email protected]
690,254,172 *474F8196376CD9DC55022E49371EA786BE22DCFC DV6E
690,254,173 *474E6F439810BCA30666C2D38E5E75B459AF2548 History
690,254,174 *474231BC2567C201ABD0C40D04C2DC77C7014C90 DVWSK
690,254,175 *4747A37046B88CD2894B04509279E3DA13618CB0 hoalinkon
690,254,176 *474640091E54705C599C1787965773AF05B0932D HOLLIS.HAID
690,254,177 *474B921FBE0711534250A7D51B59C4F05501DB17 DW;#W
690,254,178 *4743AA509AAB7B9D7AD2293C791FE46AE42B4E21 HOSEREEL0
690,254,179 *4749EB8C7A62EC0DDA821AEB23D1EEE8EC3A1400 [email protected]
690,254,180 *4746080EB8B0CC50A9D8335DA776538B40C507C0 e7x4
690,254,181 *47464082B282092AFEE3CA200D6FC5EF53485712 EARNESTFARFALLA
690,254,182 *474D8763A114C26D63ACF3B0CE6844ED105C521F EARNEST.ZABEK
690,254,183 *4744D52CD55C56C6350F68F05DB580036E9CCE52 EASNIWITA
690,254,184 *4742C61176C3C6794BE62517D2D9B372BE7D0F98 EB1FU
690,254,185 *47469586D541CAFB6F04AA74D432E8841F130BC4 HUEYSHERIDAN'S
690,254,186 *47479A3B515A432E719A070A3E58E7E3E3CDA502 e.con.te
690,254,187 *4745BEBB9594912D232AC3F47AA022971E6EDAEA HURRICANE(グレートハリケーン、1780年)
690,254,188 *474590FE9EC0B158BDAD9A1FCB7BC7EB3AFDAF12 EDGARLING
690,254,189 *474B2C3836F9207B1F472ADF00D0C19FC0068D93 >edoc/<ptnx>edoc< )33 *>33Q#=FERH a<>IL<
690,254,190 *474B2DE3D285AC233C7186021CF2CE94F4BAB4BA EDOLEERD1
690,254,191 *474A996942ADC010C6E15D79D2FE6570B9ED0191 ed?w/
690,254,192 *47449349F7A522ED6B858FD262EFA3C79C8EF95F iaralced9
690,254,193 *4746E60F113EA249195CBB1D82E347D9FE765C65 ia-te-de-pe-jos
690,254,194 *474A83F20DACBEAB17CB082D41E92B6A875971F2 ican'tcomeback
690,254,195 *474B5F4160B3740982114E8DC2E4728F550F754D IDUSL23611943
690,254,196 *474AD65CD01C0FE994ED5A19D4BD6321296DE0C2 ieon
690,254,197 *474622A53673E485A77BC6B62657B95E44BBE922 ikeneidecker
690,254,198 *474070AB4FB6D54779A10F25E5AB3113473C9E9F IKJVQVLI24
690,254,199 *4740BA8364E63D992F93577677D591517375B7F6 eliascluff
690,254,200 *474D42EB643B9EF9A05CA37274C42A195FADA28E ELIAS.TAYAG
690,254,201 *4744E3258D9C585500D6AB8D526C27B151F77714 ELLABTOOF
690,254,202 *47474CCB09C8CA65D459D6C69C5B96D5744A4D58 [email protected]
690,254,203 *4747950EB44AF9BC76C02E0FFA9342270DE451BB ellenton4
690,254,204 *4743434CEC32BAA9FD4789AA64AA32BA46646BE2 in5criber
690,254,205 *474904F864A163DB34CD493AF20C66A610DC6210 EMILIOLIETZ
690,254,206 *4749907395100E653434B75C85ED96681398DB51 EMITGIB1
690,254,207 *474F6D2D1F1602E84F8E656180B8F4D0D03C6FC1 EMORYKAJDER
690,254,208 *474BEA2213D2863A8ED464EE4D2E19E2A0FF500E IQCK1FRE
690,254,209 *47443922D0D8DC8F9BE4C9FCBB612F75352655A9 ,enK?o
690,254,210 *474F7956FFF354D804981F48035396AF5D757959 ISAAC-SALCIDO
690,254,211 *47450117EF2AB9986EE27B99AC7D93639C497B08 ENRACESES
690,254,212 *474EF27DC22AB7791F8F71D6A5D3FE243460F1EF ENRIQUECHRISTI
690,254,213 *474FDE45451AA5F27AAF0BE71569804EFF3ACE2A IS IT REALLY THE SAME?
690,254,214 *474E85E32845A2E079D7FB33E9B1F0FF7298CBE3 ismael.seyam
690,254,215 *474DF9EA3606F34FB57E1D29CDB8B547C05B7817 ENTSUKLOPEEDIAPROJEKT
690,254,216 *47454ECAD3404917ACF43694EAC2740D9677FD8A [email protected]
690,254,217 *474CCD56B7FF2D250C108BD212D29F1D6E04BEAD epicaturkiyenet
690,254,218 *474741CC95597203FF682EE65F9C54FBB8B0435C ITSIKSR6
690,254,219 *4740F3EA9EA92CB2FC872BEC7411B9E89ACDA4C5 J47180
690,254,220 *474C7156AE41B82D3933A78C028B65660B88B547 JACINTO.RUSHWORTH
690,254,221 *4746EA5F706B11EC0C2FA8F063C9A5FE5CEDAA31 eric-stodola
690,254,222 *474EBA64ED660910E0A4A0C6F95707F8CB14497B ERK:R
690,254,223 *474E00B64189B7D2DA7AF48BEEC84677C98B1F83 jamenettleton
690,254,224 *47426CF7784B11D00A5ECA5A359AAD523D9DA81C [email protected]
690,254,225 *474068FACE224E4D6B6E10BD079CB4FFFC267B3F ESTAFAK
690,254,226 *4745DA5C4162166BC5DCF8B1CEB08C6B4E63D291 [email protected]
690,254,227 *4742B4B2C910839C545ECE7E0B1B4A9952DF4EC1 JARRED.RAUSCHENBACH
690,254,228 *47488E16F60E82A8D5CFF1A71C6728A48FDDABF6 JARRETT.AAMOT
690,254,229 *474A60E1CAB354F91EA38A9DB1E90DB09E408F34 esv9o
690,254,230 *4741EFD07D50E66C1C5DF6AB56659515A87EAAD5 E-TOURNEE-'86-(DISC-1)
690,254,231 *474BABA2B911325BCF791162E23676D7AE9A541A jazz0009
690,254,232 *474340B9ECFF4E4A212374D388280CD4A844B30C [email protected]
690,254,233 *4745C5BCA86835180156338F9E59542E5B2093B7 JEAN.RIFENBURG
690,254,234 *474EF1F1CE3A020D50FFB76C9E1833D8E6D97F46 everettmagnani
690,254,235 *47458B5B0605D847EC5DA91EC94A7699B60E7E04 JERALDMORGAN
690,254,236 *474F9D5D998E4AE23A3618F7A3484FEF9053D591 JERILIEGHL
690,254,237 *474F2F4B658615DBFF506D1FD0B0EE52F2BD0EEF JEROLD.GAZZOLA
690,254,238 *47460EF8AA064F78487597DDF8BCEF71AA081559 JEROME.HELMERT
690,254,239 *4746E0F0CC1C5D4C3F652DA72C37537C103BB952 JEROMY.OGIER
690,254,240 *474DFB4CC7FDD83CDB67F2DF8E5BB05B21029866 [email protected]
690,254,241 *474D3AF67FDEDC7FEFE425220628D195DE66E134 eylta
690,254,242 *474545EA75CA2A600FBE54C56BE72D848680D2C5 ezjiraah4
690,254,243 *474A95FDCDDDF49D34A7F2CA9CF0F7F09EB60379 f-;(
690,254,244 *4748F9B9A0AA4246D176327B249821A74D4EE425 JESUSUMPHREY
690,254,245 *474B6B201194CE69E7F7F46A9C9F9CBDD4C68253 JET.BOY.BLUE
690,254,246 *4746128C66BFDF1501028A85E101D351BC38FC00 FABRÎKAYÊN
690,254,247 *474FD1E07D3C6BEF4C49BC31FEA3B1CB0D23C0A8 [email protected]
690,254,248 *474DDB74BF5A1675FED8969C47822CF95B87BD3B JIHAD160D
690,254,249 *4742395366F463D3DF35FB8A4A09838A36177EC4 [email protected]
690,254,250 *47473037EF86282FE9D211E674877D2733D963EF JÍVANSKÁ
690,254,251 *4740BC4805B4EA3362AE50F2CBA36B90DFAB131D fbfyxql
690,254,252 *4741F600449228A0F73EFDB640FD5297D1202134 feftungswalle
690,254,253 *474033D983068D9E622CFE577518830EFC157751 JOEYGRIER
690,254,254 *474FE85902658473D2A5D98838BE80BE4FAF4AC8 [email protected]
690,254,255 *4740F1E055BE1274F6A499730D6315A702F617A9 JOHN.GRAMLICH
690,254,256 *47434E7E4FFB1292E15686E3C519A17F3F38E86E [email protected]
690,254,257 *474D9B6EA9354A6D3C7C63D3634DD6AE35B9E27B johnniedonhoe
690,254,258 *474C181EE507FFEE0744393EC2FE73457BDB10ED [email protected]
690,254,259 *4747E9C5D76BAC58DA95874C78CB8AC0D236FEED FFWYTHIANNOL
690,254,260 *474827663F20AC55A10DEBBD17689B6F5580609C FILIBERTO.ARDENEAUX
690,254,261 *474CF052B67CA097C0A71CBE92AF6858CFA1F63C JONNY.WILLIAM
690,254,262 *474879B748CF615AE88D564BDB6CB6C9641B2872 JORDIBOUDREAUX
690,254,263 *474FDEAE43ED16E03603F9E75C0EF30566BF0FF7 JORDON.WROTTEN
690,254,264 *4745040A2455AFD0C0DCE03B7DB49A11905BF013 FLABOYONTREKTOFIGHTHOMELESSNESSINSPIRESLOCALKIDS
690,254,265 *4743AE144CB73CC986474D1ED0055CA4188BB117 jose1992
690,254,266 *47461DEEAB80D98ED84E6250BAB62360CBC67EFD FLETCHER.BELLEW
690,254,267 *4749961C0C4511DF1C8CA36D31C2C1DF0DE53605 joshcera
690,254,268 *474AB184CDA74878B47A99D9DFCD9AB8BED22FD1 FMOTTALCIATA
690,254,269 *4743EA69AA30C9E197EDDC07636EA1E60A19E4B9 JULIIAE
690,254,270 *474F7ACC7856FC4A1B98215621C12FFEE31538EF FORTISED
690,254,271 *474509BE66C20219852BC026F983C06655EFE144 FORTUNESDEMER.COM
690,254,272 *474B29E24E259ABE427582B5BCA83A2985ED10BF forturiya
690,254,273 *474DC01A6B1D6DC36480FE53FE06406F5085DAEB FOXMINOUED
690,254,274 *474C14B6F1D259AC1F7608045D6DF5DD84CF97C6 FRANCESCOTERRANOVA
690,254,275 *474C1DEB70B491417358EE91BBA51727C25896F3 FRANCISKASSEL
690,254,276 *47473338161F416322CB11F489771D107C51AC78 $(k
690,254,277 *4740F0AFBE5CA6586DBFCB9BB088847A04C467D9 KACKARLIBLERGOLU
690,254,278 *474F16E72B95A6C1D02C927699E0D9E75FB982DD kamila034
690,254,279 *4749E108DE417E704D392881B09D972C2AB15485 KARITAO1
690,254,280 *474362F2342D446FE5B051D27B2111C75E9988BA KARKOVNA
690,254,281 *4747114E04A7B8D9753F674202AA90104DF23F0B [email protected]
690,254,282 *47461B8F9EE16FBC51608359AFD27CE17EFEB411 FUCKMEONLINE
690,254,283 *474C5D55BB6460806D4AB89A1D51904136C64F04 GABRIELLA-CSEH
690,254,284 *4743AF1DB5F1394E570C375F6C574C4AFD2975CC [email protected]
690,254,285 *47465A8DF4FC1B8750937C1C76517BABB1608E14 kentoncormany
690,254,286 *474D4FFC492CAC6192CBF76DD0F652BF175AACD4 [email protected]
690,254,287 *47483B190E3D43EBF982DA66AA4F150FC3859670 [email protected]
690,254,288 *4747141A2F250BF9C701FD58A4018B1BA18389F8 KIETHPETT
690,254,289 *4740255B46413AB9782617F65073B1D093F93340 garylott
690,254,290 *4740397F588EC964F24A9BEF2A9582119000DB02 KIO1350
690,254,291 *4742F5602911126A8D4CB70A6F3A6ABF1089908B KITTENSMAJOR
690,254,292 *47450273DD55F054CB37C77DA234AA41470D8F21 GEMMA-FARRANT
690,254,293 *474BB8A3E33CD8CF1A7422365911A43BA1C7406C KNEVELSES
690,254,294 *4741742C0B4ABA6A7F8CD17E6E24A61CC533B1D1 geraldtantum
690,254,295 *474BBA982D7E17869847E2D236B14281AE6A27EA koryscarbrough
690,254,296 *47427E4B2CC296366B0E69E7E8B449C2E421014F GERRARD11
690,254,297 *47470D98FBA031DA2B49B6E7EAAA59D3F20AE67C krishnajangir
690,254,298 *474E5A2EAD11F0645CAACECB1FC564503648CE7A GILLEN’S
690,254,299 *474E2403FF61A8987372FE247DD2592DE1EBA81A [email protected]
690,254,300 *474369614A59135196E4431DD69D9E1AF4FA1C8C KURTIS.MCHARDY
690,254,301 *4741533060F55424A2B4AEA5FABFAAEA7AE48452 giras0l
690,254,302 *474D5560F118381F4924324AA026D75024985044 kuullaan4
690,254,303 *4748F3FE4C6D32A95EA59489D49B4719E9D9F468 GLANZBILDER
690,254,304 *474150DA1B90B0641A746805CA35BBF0773B7DDE L032197
690,254,305 *4742760F4C1BB29A3D80205EDF7C8D8B78050EC1 glleorm6
690,254,306 *474094C29F2A5B613F244D6EEBA535A0D85B516A GNIRUPUS
690,254,307 *474BF95EB9E04C3278600D0136C089AD20BA5BE2 $LATTN9
690,254,308 *474E3A70F84C0091DC39768123524BCA61A0FD08 LAURARUND
690,254,309 *474AD755D0FA5CE35B084E8FD1241C80E7B4D111 laurie-elizabeth-young
690,254,310 *4747E700064F5284FDAE478A928261DE902F4D3B graywings
690,254,311 *474A130F16B22081E53266D7BB3953894FEAC190 GREENOCKMORTONFOOTBALLCLUBPRIDECLYDE
690,254,312 *47441308F4588003BD2B4D2FABE55C32E5991A2C LBORUCHOWITZ
690,254,313 *474844507EBBF9DBFDC98007485452359149BCF6 LDANUKUSUMO
690,254,314 *4744CD94DC3595E11CAB9209B8CCB51066749066 GRIFFEYTRAVIS
690,254,315 *4740923B0A315A4FC6F87D98ADF2BE0D391D43A4 GUNJAN CHANDAK
690,254,316 *4740B6E70FE0F7059470C00226C6AF4E8DA01BD2 LEON.FAIRCLOTH
690,254,317 *4740F9D83AE79E18960CF7039E0186349DC30E5E LESLEY.BOETTCHER
690,254,318 *474A3CC2D1F0756B17D83E6844DB515A3BC1B830 lesliefadness
690,254,319 *4743DDABA2041C73DFCAFBBD6E8BD3988AE39B18 leśniewiecz
690,254,320 *474871BAC70C124A52906F7DC240B25A5848AAB5 LETASKA6
690,254,321 *474A0DFED0A4CA196A6EE4EE9ADA50B5CBAA06CE let.me.know
690,254,322 *4749E8B5065442031B4819E363FF0CA7D8FE4929 <H2><A-NAME="HDR8.3-3-36">8.3-SYSTEM-DEFINED-ORDERING</A></H2>
690,254,323 *47414E0EDD1C234164A97A9F7687E78F33940ACD [email protected]
690,254,324 *474BEBB9CB95073F33EF11178A385E5CDD21CA21 HAIVER321
690,254,325 *474AE574B4AB4FB38704190CF5EA039C825F26A8 [email protected]
690,254,326 *4743C6C2BCB231115B528B0009286C81ED41E756 [email protected]
690,254,327 *4746168F724483C183B78A3DAB8BD698A88336C6 LINDSAY CWIKLINSKI
690,254,328 *47459E90DD29DE891419EB6CB19B7B1AC7734961 LINDSAYSHIGLEY
690,254,329 *4742FDBBF46DF8E576914A22F93BB95270881428 [email protected]
690,254,330 *4743F9FFD6835FB8CA2ED7DBF5BD226E43E07FE8 LISTE.DES.MAPHRIENS.SYRIAQUES.ORTHODOXES.DE.L\ORIENT
690,254,331 *474DE40DDE475102F276D503A54C945EE8981D73 harryquillian
690,254,332 *474A9985FBE444DDAC447EB9E7813DC1F2F58BCA LJARVIE1
690,254,333 *474602A038F3DAFBFE0DF3CFDD76E4B309EF8EA9 ++LL4+0NS
690,254,334 *474CD0AF235F04C7B10291FA7576F5DF607B1777 LLOYDBRANDI
690,254,335 *4749375774D1729F6E79A4600DF0E4EDDE8B8C7F HEATHFINLAY
690,254,336 *4744900DD258B35AA3E06D8083C8F94E881726C0 LOLITA BADIEL
690,254,337 *474E9EC77328D2FC5DDF608F17317CF60DAD4431 LOLLAND
690,254,338 *474CD60B2379A5DB6B16CF022B3D209E7C554357 HEILTSUQ
690,254,339 *4743FA104514CB222CDD4FD9324EE7C8C54B91E7 lonnykahoun
690,254,340 *4747ED9AAED469011CE23E892FCB5BF6DFB16EEB helmwmm
690,254,341 *47405AE9E52AEB630BF9C371A6B90BA7341E1B2E lovemenathan
690,254,342 *47451AD7A7DB9CD0C6267946DF099C1795A19FC4 herumzuschlagen
690,254,343 *474F1F44C52821B010F8F2A87F4F417E4913B80C [email protected]
690,254,344 *47416873E578463E9CE0514099B27CE9C0DC9AEE HIOIDIAN
690,254,345 *474E859EB7517B3C505E51950F1E1ECFC72F6CE0 HIRAM.CERANSKI
690,254,346 *47479BF1C4589CE30396E03B30190766192BCDE3 LUPE.THUMAN
690,254,347 *47447AF2A709A7EA5C3D382D844B77ED8F56C446 lüüsung
690,254,348 *474ED7E76F9A1B6187513A024FD8F1BE410A885E lvcs
690,254,349 *474A5113F43826A3541B241C77AA372F4EA8FF05 HOBERTHUSE
690,254,350 *474F88E8FF9DDFF6E8ABD69AA9E179E94623ADAB hobertradakovich
690,254,351 *474D4436DBA4B4CD41077259B7C5A9EC1462703F LYNWOODDOLCH
690,254,352 *47431BBCC4C13AB2454F3EEBCC7CB26077B6909D lyonnais6
690,254,353 *474DB5AC5EFBD87BEEF43DAB08230034CE020BEF MADHURA PATHAK
690,254,354 *474CEF8980A426DA604FCD05B4E6131E5B41D6C3 [email protected]
690,254,355 *474FF256504EB8EEA8BC4EAF137DD8C902D57800 hsakakak3
690,254,356 *474F2411A9454DF3F2DDDDC7AB1303FE4DAC174B manuelbarkema
690,254,357 *474ED1EBABAFE8F21A7790E223DA61279FEA817F MANUELCESAR
690,254,358 *474C556F996D3011115C8A16AD4F91720E318276 MARION.PETRINO
690,254,359 *474DE8EFA191C12657B1FBCEFD9932DFBF7E25CA MARKTELEVERKSTÄDER
690,254,360 *4749F8333570DC5C0B39EB59F24C48A7740D837C IAMCREATIVE50
690,254,361 *4745E653D0EF4D37F3E0884795C98F4EC01E1362 MARTENIS5
690,254,362 *4746851C3EC721FB8F23E79566C029FAF151A097 MARTINGELHAR
690,254,363 *4745DB36961C0F51C6B6B36FB36C21D607EDC4A2 iamrobinhood36
690,254,364 *474984278EA34009F7A62FA9CD82DDE75665771B MATHEWTESCH
690,254,365 *474744886D9A964B0B7B0C727A090D12B87110BD I\CZ
690,254,366 *474FC40D6776EB0F52ADB4549A64783B8DEECD3C mauriciogoltry
690,254,367 *47440B77FCDA1DBFA174232AEBAEA6ABFF4A7CE5 MAYAKAY1
690,254,368 *474989AC4F15B2C4D176BD40AB7DC75883A3212B IKE.CONTRINO
690,254,369 *4748F8C23F5225F654AE798E36C72F0CB70B7B50 IKNENNET0
690,254,370 *474840158A9EB6C3A1B8CB3358F61791F99EE32A il80ilyushin
690,254,371 *474A8050DF9D9D9202AC7F20A115BB54121035F4 MED1CA+1N9
690,254,372 *47473A943377F7CD97077F1ECF7040B4632213F2 i'llgetthrushorsomething
690,254,373 *474968B07A1AEFF9784B2E8D4418483484044F4F MEGAPODN6
690,254,374 *47445DD7BDC54B933DEA08EA50344072FA95F336 MELODY STARR
690,254,375 *474893D985C03281F9F8AC86960C20D6C4DB2F3F MEL.PFLEIDER
690,254,376 *474D99A63CE70DCC175FE36E57F20301F6727867 ILOVESTARWARS2007
690,254,377 *4740A8F6F84067A1EAB41EEF0544618645DA4F56 MERDYCE--M-ER1-D-AY0-S
690,254,378 *4741B9F8E2665FD44171493FB25652B4DC64C463 mersem
690,254,379 *47494D1A6632B045419A3643D1A274CED8DF5C10 IMAGEPRE-1995
690,254,380 *4742CD31859C6EDDD9A5140449998AAD9C451CEA IMMOLDSING
690,254,381 *474A98B099A8CC825D3F1151CB2BFEDDF6A6B049 MICKEYTAFF
690,254,382 *4743DFE784F6B8D23FB8B72D8304728D715FF1C0 MIHASOFT1
690,254,383 *4742B5877B90D5A61FAE9AFC116E85872A822310 MILANSPRENGER
690,254,384 *47402B7342084A9D48E4B21EFB2332338DF11C2D milforddatte
690,254,385 *474B53923F8CB625AAF8409464430AE5CAFEB15D INSECTE-CHERSOTIS
690,254,386 *474B9252983094E2C3BB5EDAE8DE1A973286AA20 MIS3V3NT
690,254,387 *47415EE40D586D201B812E2CEFA2FB28E56987A1 [email protected]
690,254,388 *4749EF96636913B8AE699C2D54D8FCAAE0E7A4A4 MISPROVIDENCE2
690,254,389 *4740319E223E675F43434EE840CF52AAFA1E736F IRATRAMELL
690,254,390 *47466B22625D67BFE5CAF6B3FDCC9A7A203D20F9 IRVINERLENBUSCH
690,254,391 *474BC8F583D25DB2CDAEB93B64EA6F399ECF58FD MOLLY.CRUM
690,254,392 *47407BEACBDBAEB0A6C766D3AAC509A9F4D05D57 ISE#
690,254,393 *474924B5C98CD24745858009933AA4B8697C64B7 issues199
690,254,394 *474BF97D70D83EB96B5ED30C9101EE95362293E3 ISVUG112
690,254,395 *47479CF1EFAE122C6F58B2B18AEDC5593CB29339 ITM.CUP
690,254,396 *47474861CCF44C56CD11BE51D2852F8D59F19DF1 It'saGoodLife(featRamonaKeller)
690,254,397 *474558572C6DBB7404D9C33F90E6CB8558A2BF59 IT TO BE, THE INCOMING DATA WILL BE PLACED ON THE NEXT AVAILABLE
690,254,398 *474BB41FB41C9E5D532F68ACA8AE14A9BFAEF185 [email protected]
690,254,399 *4742ACFC85530E6304B9162789898D5D5EA608D7 IW1CXCI
690,254,400 *474FBAC916511033684BA11E88B70404AE095926 MPLETELIES
690,254,401 *4746660700BD979EE09703B5F8F6BA8D73C063D9 J56974
690,254,402 *4744EC211532F6FC40EDC29B41EB571C0B5A4D6F j:a~
690,254,403 *4743D79E61AA7112DF8D00CF86C8F84DD0941370 jacquesvilardo
690,254,404 *474F08985A8560792CF6E8C0C38513A813A5CCF0 muhammadumairhussain
690,254,405 *47482AE53BEF84A7B1DF68716A61168F3F523CEE !JAIL!
690,254,406 *474161CF2053099C10CD57CA33A1EE93591F1616 MUST-I-HOLD-A-CANDLE-TO-MY-SHAMES?
690,254,407 *474CC7418EA644EA00C5B1DB661C287687D712F9 JAMEPFEISTER
690,254,408 *474F42CE9FE8740B6B5878EB27DBE288D0E4FBD8 MYCHAD01
690,254,409 *47485769CCB21F4E0759852FDD938B15AF498891 MYMERLOT97
690,254,410 *4743AB35417BCD59E00ADD09ED42D76BEDE71C76 JARED.SUMLIN
690,254,411 *474AD3129F4C366FBA455DE457974234BF2C8D91 mythlore9
690,254,412 *47409ABE2F10CF485136B7677AECD7461FB53996 JAYANIA
690,254,413 *47440A9E3FB76A694878C4DC7F4340D5BB4753DD naetaercotksidrytilitutnswodniwehtnura
690,254,414 *47441ED57AFB9FC6C07D6F71182817750C9F6F1C NAGAIEREBATA
690,254,415 *4747A163020D1EF5BD93DD5264FE64D74B2619C0 jedcayetano
690,254,416 *47480E0603C75355A64C7363A51B122CA8EB80F0 JEFF.SEGALA
690,254,417 *474823D5056E0181919C29445A14823D465BD4CA JENEYNA
690,254,418 *474F826AA6B3BEEB48719C4C03B7A4C9B062AD3E N.DE.SAINT.MANDE
690,254,419 *4744CA42BB01A8E181768B1868311C957355AAB1 JERRELL.BARDON
690,254,420 *47486904AE2422F3AAD7E45A84E8F2A6375910D6 JESSE.NAPIER
690,254,421 *474AD8495DA4177466F4A7E392984E42463DBFCD NEMESIS0249
690,254,422 *4749A4B7849D2381AB4CA29C01CA390A9BF45699 JIM.TILLOTSON
690,254,423 *47464C9A93EA53486C034352C7AD9E66B0670945 NICHOLASBOURQUIN
690,254,424 *474E9BF43C9110020B67530EFE9D8034A55EE54B [email protected]
690,254,425 *474D7B62F54F48D85464F6938F0FF41A5A830E08 JLIMBDE2
690,254,426 *474B793B8BF91364E445A10E1240E442D5D0F5CE [email protected]
690,254,427 *474C7D3AA0724B7CF80E60476C61E4AB6B34B489 NICOLA-JANE-MORRIS
690,254,428 *474D2B33ACFBE6F5DAD9E0EC555F67ECA6E567B6 NIHSNEHO2
690,254,429 *4748CBE19DAAA907667EF9A52C13653260B18C76 johnnygeiszler
690,254,430 *4744DB7F68922C94A66DF5909A64D9080E820253 JOHNOSTROOT
690,254,431 *474669D7DD8FAD6A9B555CCB80422E4916246A2C jonathanmccurdy
690,254,432 *47473FACEEA35B2EE111D2F89B759D7991865AF2 nopolltax
690,254,433 *474EE7670C1A4CF3FBEDE52BB8F43E26458FF6DE joseph-rye
690,254,434 *474D454F862952D1682DE5657372F4BF25D9C3AF NOT-REALLY-ENTRY
690,254,435 *47442138AD96769989D0D41437628120E8E4C6DC JTBN
690,254,436 *474047C292923441EF373F2B56F1C24E9D733F41 ;)[email protected]=p
690,254,437 *474D048ED93CCB64EE6DC43B5CEE1D7D03503A37 JUSTIN.POLIDORI
690,254,438 *474E6229CE252985B6D8D89B082623ED9A653253 KALAUSA1
690,254,439 *474F487899308C5914BD15BE82CF3BAE9468DC49 karl-heinz.marx
690,254,440 *4747B16299837DE21E0FD9E030B6D6E7F4046474 KARLINAED
690,254,441 *474096FBBDF5978FE3EC51379B9A33DFC7B78BCB OKRESIEJ
690,254,442 *474CE9D7ECB9FD271B7241C73FC15600B720A8DF kar.na.jukan.wali.gal
690,254,443 *4743248FD069EF94E950735207F2D854996CD399 OMAISUUSED
690,254,444 *474F261AA3B5913AC7D9CA437746074EE9770953 omarmall
690,254,445 *47424DD7E0037599A91CEF2B61FD385B11A38201 OMEDVETENS
690,254,446 *47403F1C49903A84859FC52A143E7E4BD972B41D ONEWALLCENTRE3
690,254,447 *474CCF8A410E49755A4864B6A0057F01D20E3038 ONE-WEEK-LATER
690,254,448 *474B07356C7492C093673EE1DA1A2C6EE7388D8F KEITH.MASSART
690,254,449 *4744A4862CE7106701D662517C8E442A0F40532F KELLEYEHRHARD
690,254,450 *474155F038B3DA2A1969A4AFAB4FC0CAB1F62C1F }O{O~(---Q
690,254,451 *47406CFE29FD9C543899372E7B0D04FE18DD6FD9 OPONONES
690,254,452 *47409C554B3D3F144DAAB83B326F966106659B78 KENNYBURGETT
690,254,453 *474FB4B1778707E6226C2969A31540B44B175645 KEREMSABERFCP
690,254,454 *474DC02F8F22D7F97096CE50FCAAFEB6E0D2BD64 KERHOKSI5
690,254,455 *474E9B0D9DA101C58929AAE2600FFC407FD9FAA3 KEY....
690,254,456 *4744321BDCB36049D72E6E391BA6D8F744441DA7 our yesterdays)
690,254,457 *474282EDE0E3268778A1D6CB963A292D056D8857 kinase-defective
690,254,458 *474903B7F2CD71210A3DE450051A0A3743CE56B1 P13A$INGN3$$
690,254,459 *474AAE9E04587A169D49E8196FEB96AB542F66C1 koko5683
690,254,460 *474C8DF84C19CABAA992A335A21BE6013BB46D21 KONISLAV
690,254,461 *474CF56646F7CBE4BA65BE0906CE272F69DC5ADB [email protected]
690,254,462 *474C8349CEA5B8DCEA2D08503F6D0CF1FBC02B53 KQAUDNF1
690,254,463 *474AD1948C52685FC064F58233852B79C77CC969 PARDONABLE;VENIAL
690,254,464 *474703AFFB4CA8F5E030084B94994DB076CA6D84 KRISJONGEBLOED
690,254,465 *4740F9E1D68CD241D982EF72FA1511FE7B17744D [email protected]
690,254,466 *474D6B83BBD3BCEA74C86B7FF78151440C4D2F1D patricktunison
690,254,467 *4744ADA4DBF56EC94CF2E0454670FFFF506E6B39 KURATCHTCHAWAL
690,254,468 *474505C17879859ED8FC8D04ACD5EDEE140B578D ˈKUTEN
690,254,469 *474BC2F4BE5D6A261A5E5F2981055D9522D4C0B2 KWIKWRITED
690,254,470 *474A46D238C0E42E26FCEDB6E1C7E065539BD1C5 PE{(
690,254,471 *47412ED6D149E17ACBDA2577485D93EBC33BD4AD pearldiving
690,254,472 *4746520AA0DC53746A4EE484BC3DD71FCCE0E32A LAFIERATESTA
690,254,473 *4740F5D506400AA959E864659B9C5F36716E1DD1 PERINE
690,254,474 *47480B42C5FDFB9004ED2AE140C7AC8AAEC19972 LAMAIZIÈRE
690,254,475 *474AB746CB784C27E6AE9E3E4D6DF835E4C4D3A5 lamarwolfson
690,254,476 *4742B054104CFCEF832930BC84CCF56A01899863 PETE.GATTO
690,254,477 *474A3F2133B0F466DA18FEB53FDAD9387DF5E77C peterhaskamp
690,254,478 *47401B04A0EF05D9389AB9A262124CB7A8B9891C PETITS-PERES
690,254,479 *4740B73C9079298D10140379CF5512D8A9496043 PHILIPBEARDALL
690,254,480 *474402576518EF6A1E964A3B96A6AF063CB661B4 PHILIPDURRWACHTER
690,254,481 *4747DEA3DE2CBBC077E001997A21AE95A4F424CA LARRY.BRINER
690,254,482 *474BBDCA31A4922BFFE8082634C2469CB011E81F phraseless2
690,254,483 *474C56B6A4A32F358B72BA29D6E14B55235D3669 lavina-sodhi
690,254,484 *4744D6B40D5D0985F0932B9E12917EB851114E6B pikke
690,254,485 *47473CDB60C1067F40DB4DBA903125C5E3255F90 pitytyies
690,254,486 *474D1DE854006BE5CB48EAC2BE196E559CC5CF90 PLYMOUTHTAMARA
690,254,487 *4744B95EB56E8E6305B881EA68C31F1339EFC2A4 LEMUEL.ALLGAEUER
690,254,488 *47486BD11135D8C87688B3AAA5A76E0CAEB005BA LENMELDER
690,254,489 *4740EA694F45CCB55CB30B3BDD89895B78A47C4F POFD
690,254,490 *474BD2330901A0A59F7DB146886486E3C61DED0F ponyingp2
690,254,491 *474FD4F86BE9EE1CC092E240D438543912417E37 [email protected]
690,254,492 *474B914D7D6062537B74F4BB9F705790CD0250AA p==p.`~.`~.3b<-
690,254,493 *4746F6044D0D14648C835AEB52DDE479220E7440 LI-CHAGAI
690,254,494 *4747DFB2C39C0E9B812A9DB17B90D1A5FB5DD6EE LICHTZIENDE
690,254,495 *474C5A11E8197FED4D7219BC39870CCF4643FFF7 PRETTYLING160TALK160
690,254,496 *4742CC1B59FA3DEA7D59FFE6B6D54320D04277C8 PREVIREMLHOS1234
690,254,497 *474FC45CF8C0B6BB0F53B0E3A90AFB767859FC5C LINOWARHOLIC
690,254,498 *474F22612A0E04A366A185C49EB873BA2F8DBD7A LIOTROPA3
690,254,499 *4747AE031E620667266B91F94A8BB04EFBFAE1F5 [email protected]
690,254,500 *4742684930E6B8C190E549B388E80B0E06F16273 [email protected]
690,254,501 *4746FD96AB1972ADF73D33794D775D264ACD75BE pultorak3
690,254,502 *474D15585A1B60CB790056F3CE33421B277E146E LONGCAMPCOMWWW
690,254,503 *474E3DB74BC2A401E7AD113E36FD9C1593062334 longlegs11
690,254,504 *4745B482F90B53D4DB2F82349B218E5835AB4C13 qd * * *:p
690,254,505 *47453CA58F4CED648524C43CBF44AE7C00EA2B60 Q====>`~.`~SPLAT!!
690,254,506 *474162355DF7205256811B83794194FF113D0BDB QSZSBNB4
690,254,507 *47464791009FB3141F6CFECB740617C19B623C48 qua
690,254,508 *47479B1F4D23E656F1E2309E5C8153C7EC0D8894 quentinschwinghammer
690,254,509 *474D06A1B94E1735A6C02D077E60766ABC6499DD QUINCY.VANDERFORD
690,254,510 *474279FB2755EB129790179AE5528FC133474389 QUINNKEALOHANUI
690,254,511 *4746B3091AF18411D8791C238DEA4160F6C71BBA QUINTONVANGUILDER
690,254,512 *474E04BED1E556D4A41878FE9A2EF45323843724 LUNADELMAR
690,254,513 *474F2A1E643FBF87A6B9A184386661A540536E64 LUTHER.BELTER
690,254,514 *474F4C9F03DD1E81241732175119001E976A4978 luvmenow1
690,254,515 *474D775F64751CAFC3DE27973798F064EE178667 lz3)
690,254,516 *474AC4360D89076FD00EAD9F9AAA64F30ADB9813 RAJAMKI
690,254,517 *474C93252B4D760F466070C6964071205DB1E73B RANDY.COACH
690,254,518 *4748E395D48DB9467DD6535968A8570D03B9F9A1 RANDY.WIGTON
690,254,519 *474F6B769818BA4B0978F63A533EA9116B112A12 maggie.pfeffer
690,254,520 *4746BD771C5069EDF3139DD93DA4D3D481582569 Magret.de.connards
690,254,521 *47425ED4EDC378FE48043727D09CA3E22283A134 MAHTUISING
690,254,522 *474AF5A786950D59D8ADC4481970C34AD2E7EE25 main.piece
690,254,523 *47463F2EB2BEBAB66C2866D9B413EEEEE1FCB77F RAWEST
690,254,524 *47462422F0BEBFE937C9A95A0CD3240D7465156A MALROWH
690,254,525 *4744188CFD3BCB94F49E1514B56A5B1E3F95AA5E MANAGES
690,254,526 *474C8FA7221C2C9E761D808D65D61057350AD5D0 [email protected]
690,254,527 *4741732DAEACEEB177D67082A319BF7F90EE600D MANNY ARGUELLES
690,254,528 *4740385B7B6ED6B66CA8C03F3E438E389CBDE8D8 MANUELBONZO
690,254,529 *474C8D43C296A9DB7748948C76FFFCFBE3388664 RECONED9
690,254,530 *474887D4E7D9DBCF448A9765EB451DCE81A29E0F REED.VERONA
690,254,531 *47405005BCD4AB8F659E35FCE2EDDC9934F674AF MARC.QUARTIERI
690,254,532 *47499C85550BA441AFE8D75811F0F2412A7FA668 REESHXXE
690,254,533 *47454A8F72E2C1ADBCE657D50B91826FB2C056B4 marinesharpshooter
690,254,534 *4744A4806C9F2A3ED17DBA0D00998636B9B51E0B [email protected]
690,254,535 *47405106EDA96DB3F0E8CACAE19F2D5E66B31D99 REKONSTRUKTIONBSED
690,254,536 *4741E3C978E4ECD41EDBFBB3534556F602FDAB19 MARKUS.ANTIS
690,254,537 *47420415CEF6287FE3832C5184C386106C0E7538 REMMUSTAC
690,254,538 *4749BED7B363531D0AAE24EC5BDE3CD29532238B martice1
690,254,539 *47486B4070DACD7748B8FE485AF6CECD454659E1 REPTARMOS123
690,254,540 *474DF19DF2DCA73063E6CBE74EEDA4AE5A8E7565 MATRIX1904
690,254,541 *47493C0F81F4F6F4B232004E64799A1A6FC672F2 MAXIMUS599
690,254,542 *4743B69DAA27002A97F44C4C7FC5E9B60B30683C MAYCEEPYE
690,254,543 *474399E34C4F15EAF163E5BA019D689EA0605EA3 RICHARD.ELZA
690,254,544 *4748304BA7EF7FAEEFEB7D92A94BE95B91136E06 richardfurman
690,254,545 *4742F597C888A68E0BC89A44680425CEB50401D1 RICKRODE1
690,254,546 *474110CFEF27C4A9A4A44A65AE0814E2B151407B RITCHIEMELROSE
690,254,547 *474422A071C2C6466E0AED5A8C93DB29D1272D8E RIZMIYAN
690,254,548 *4749FCB0482343360B2518097FA2A5AC0740220F RKLAVIERUNDORCHESTERNR.3DMOLL,OP.30:FINALE.ALLABREVE
690,254,549 *474B087AF36280BD82EB32D6FA77F42CEE5B1333 RLX2M3R8
690,254,550 *4743A82CE12A2E1DC08A8C5BA65CE149510F9694 ROBINPATEL
690,254,551 *474619BE7F40B5481DF6E9F4B0899469087ADC4F [email protected]
690,254,552 *474CB127FBA30CF4EAE7EA2C3942FA85A68CE402 migol
690,254,553 *474556585B1B43DDF90453F251882C5751F8C951 minari
690,254,554 *474C1059F9FA275581D548054FFE86F2E3B30D6C MINZOKU6
690,254,555 *47493FA9EE2C24C0AACF9AC5CB22E222C84F51D3 MIQUEL.CORNWELL
690,254,556 *474FBCA8B33ABB55010AE70850EE0D5159AD7459 MISERAKED
690,254,557 *47443F4DA15D40B2C88E654A92A6186FE70E50F1 MJWCKASI
690,254,558 *4741DE05122991853D4BFEEB96039668E924D17C ROOSEVELT.WILLARD
690,254,559 *47410DA6FCC159BC0B40660B6B04D264C152291C ]mnaaa
690,254,560 *474038416EFF467F87222957EB14E73EDEC1C484 ROSARIOSOUZA
690,254,561 *474576906AFE275CD9D116A856B1FAFBBB463E16 MOHAMMED.ALOSIME
690,254,562 *474AE99A22C5B4E1D27CFA0C500F8901A74F7DA3 ROUTINIST
690,254,563 *4744F1F9B31975111E708B21989C0BDFF980A395 RPARTBSWING
690,254,564 *474C9B6EED29E6A8E04066B7ADE6D33D923AD1D9 mont.druck
690,254,565 *4744D3D39A5120E085849E46E2E7DC5C08CD5AA6 morris-hardin
690,254,566 *474340A930775D018B0BEB4B6C5686D8578ABB4C RUBIN.BONTE
690,254,567 *474615A7F7CC58053A35350BB82423350EE2554D RUDOLPH.GARZIA
690,254,568 *474BD3A1CAA4D0AA95C94922D2334C60B77A57FB moshehendricksen
690,254,569 *474F43FE710EBC15F8A311C0278BE63F76AE72D6 mountain
690,254,570 *474D30DEEE51B911030A7A664591E940E3BB05D6 MSHALLISH
690,254,571 *4741AB649D740E03F0A9D35F220E3DA61F961071 MSILACISSALC
690,254,572 *4740636465358E8770DE608B3734E1828A512FF2 SALVADOR.GANIBE
690,254,573 *474ABFCD97A192EE6E631A4433E2DEC927F743CD n3u+ra11za+1on$
690,254,574 *4747464D93E53333290BFFC7757A5C74D4B0D155 SAMMY.MUNOZ
690,254,575 *4749C540BDC86DD7B687F99F4064373D57BE3835 naduuys3
690,254,576 *4744BD257B1D48D533C1632C86110E1D302D1CFA sanforddempster
690,254,577 *4744C5867F18C493BCD010F1A9B7185E1F36FE8F sarahsidaway
690,254,578 *47486D1578327F004C8BA617C6A038694020674A na&x
690,254,579 *474C6B845C9B5936C420240392E3671399D87644 SATONYTS
690,254,580 *474B86C362FEB23584E413EB90110983FC130FFA NEAL.ALEXANDERS
690,254,581 *474121E849F7EBC91067A5A91471ACDDF91CD3D6 SBUCCI1
690,254,582 *474D0A28539DBCEAC101CACFEBCBF6D19A377CC8 ngayon
690,254,583 *474FBC792394990DACD16974539A256E85EF5486 s$eg
690,254,584 *474ABBCEA6BA7579D1A0275E0F82795E038077DA SEINAELAATAN4
690,254,585 *4746D6DB74A1D6D184C03000A1773CE6228FDFA1 NISHA-DIXON
690,254,586 *474AEEAE4385D85BF794212E4D83C780CF681AF3 SEMITYAD0
690,254,587 *474C57FF3E40C1629B69EFAD06615D752C382E7D nj?w
690,254,588 *4749BAB37EBC286F25C9475C1AE17B31AD7B29F4 SETNASSITREVIDING
690,254,589 *474AA213B4FEA1DFF6E1790AE680BB6DCA92FED6 [email protected]
690,254,590 *474225CFDCBC66DDCEDCA12A35EC1B21EFF9264D NORBERTSTOLLSTEIMER
690,254,591 *4747D26ED5F9B0141CEDD0A095891CEF71D142EE SHANEWAUGAMAN
690,254,592 *474CABF6CC090BED15E354011EFB4A3AE534522B [email protected]
690,254,593 *47408B1022145ADC12D64D47D8F30E64A0ABFAB6 SHARITIAG
690,254,594 *474993C7EA2AECE7F6D6620CD9110B9437B77A3B NSLATIONS
690,254,595 *4748652F332791B56E9700D17AC575A613E91F9F ntllctlr5
690,254,596 *474012722E28D2D5F1D6C7C9895C0D8B54B3E929 N-UNDECAHECTANE
690,254,597 *474BF89D33DEFDE47A62A2BF91C5A098F3566D20 SHELBYKRISKE
690,254,598 *474B7D14679995FAF0727D671EDD4661C2711574 SHELBYSURA
690,254,599 *47406BBB8FDE2EC6C2AA5FB228EE43C18A73C5BB NUTMEATS
690,254,600 *4740FFD6DE4BD587D31955B783CBBCEBBD25618D [email protected]
690,254,601 *4742F343A1F41DC63D4137A1853CB17C9D9D2007 +OAD5HIP
690,254,602 *4748B982AB07CCF850B93C994A950E0A6671333D OakLeaf
690,254,603 *474FD047416F174C3E2598BA184CB34B8AD09124 octaviosuyama
690,254,604 *474860B33E4FF1AED5DBA8A23EE9C9B07EC71B35 SHYANNE-HUDSON
690,254,605 *47420480883194D694EAE44040E56808903114C3 offeses2
690,254,606 *4741B5FD5E6F4387D5929B27FC9B5D14F84AD036 siger_tychy
690,254,607 *4744B6DBE8875899174A181B565BCA4DCAADCB1A SIGGEJONSSON
690,254,608 *4744EA6C4E206F21F679A90701AE598544B03F91 OKUBAMOWOE
690,254,609 *47403EEF8ED91F4ACBCD03D297B7A1707EBFD6EC sincity(feat.immo)
690,254,610 *474F3AEF40F782FEC0B4D371D0423165DD902F45 omarmontavon
690,254,611 *474CE5747332924A897D3B1193D5FE721479E157 SISYLARAPODIRI4
690,254,612 *474C4A1BFB8B6AFAAAB905AE9805E1B9070A439C ON.STREET.LEVEL.(30.SECOND.VERSION)
690,254,613 *474BC7476FFA3274183405B81195AB7626551C2E OONARK
690,254,614 *4746AFB35D466D143645B64A8DF7386C77860DB0 SKYLERMIC
690,254,615 *474D54B7B5C43FB6436E15BA9B66C261B7EF85B4 ;)O~O~-Q-----Q
690,254,616 *47423CCF823B932F57D890807CCEDC65711DDCA3 SLAGAZA
690,254,617 *474222E12DFF6FE46F26FC4C52B4A8CCC3BD17CD OPGEVOU1
690,254,618 *474E8D05662F669E25C31AD129406EEB26ED4073 OSMOREGUL4+ION
690,254,619 *4746C0E933ABAF7540DF5BB04BFEAB2EABE82CEE österfjällsbrunnan
690,254,620 *4741E5E4B1DF5C0315AF2446457E9C424B33859F ou+boa$+
690,254,621 *474DEC512EDEFB77F57B7ED2B007AD5C82287FEE OZ
690,254,622 *4745B49319CEA3AA98CF1E262D446CCEC695BAA7 SOSTEYNERE!
690,254,623 *474CF7E401D3BCD2159898DE45E4BCCE8E773205 P53D3L1N
690,254,624 *474CF8BDC0D987A0E60DC5D10AF8FA991D84D27A SOUTRAGERONT
690,254,625 *474C4E5C51CA9C0FAA0EF82F7A36FEA66580C0B2 SPIRALE4
690,254,626 *474F6872B07E28EB24C408223180E6F79156DA59 PARIS.POKALLAS
690,254,627 *474784357BD41F73F535D6FE28AD09B22C6B1249 partido.liberal.de.las.islas.salomon
690,254,628 *474CFBEE94BA34E6D65A3892BF0623221658D21F PARVISNED
690,254,629 *47487F5CF9AE41E866757EA02508289BEFEEDFCE sploit o~0~ (======q
690,254,630 *474C95C611994E1B03CC88AA3FE9BC5358D50ABF spotlight-:60
690,254,631 *474B328AA1F50667D99799A9F54BEF873C30A790 SPTSO
690,254,632 *474E4FBB57840F25FDFD68DD75764F0AC39A3C82 patrika-hanna
690,254,633 *47491CABD16696E892355513CB69FB1A8EE07E12 sregninvylfevvs
690,254,634 *474018778ACDCF1E3BB0DD8AEA44D243C0244273 ssc26335
690,254,635 *474816C9878863EFC872F61B5C5E2AE42742AFBC per-object-basis;
690,254,636 *47457391AE2EFF54CB84C6F70A262EAF00DB78DE petalslikebricks
690,254,637 *4743FF31734DDFCD0C3063F4D3AF9CA90D84F088 PETETINNER
690,254,638 *474C1464036A7726F93089BF6DE55FFE4F54695C PFAULHAMMER
690,254,639 *47466CF9D93019C2E9F3638C5A79699847B876A3 PHILLIP811
690,254,640 *4741927071234A0F6DAB098059F1A6E5F9027FD1 stevestaunton
690,254,641 *474657BE998F269AC4D7662CB62E812A8BDC7F84 STONEROULETTE
690,254,642 *4746FA52F781AB1F437535099345A70A2593DF7B PINSB
690,254,643 *4745B08084349A03BFCE947925FBBD75E923A30B plaid
690,254,644 *474C815C2E3FDF6D3BB1431FF8D6714B8630EA9D STUART.GUNYAN
690,254,645 *4743D252AB6C0F932AF95185C35B2918013DA055 STWKTGRKVUEQAE1
690,254,646 *474C69D65D897E3630382C2A3A9B973B5B311F83 [email protected]
690,254,647 *47477EC8D0EA7CB2F1EC6F572B5D50C7B2D0A8B5 pluresied
690,254,648 *4740433517E13310EB594EB1233330B7A6BC7DB6 SUERAMAD
690,254,649 *4740E52C72A20511EC76BE871FB5ED57A18392E8 [email protected]
690,254,650 *474693366EEBAEFD8D5C8C1C05069E050F343668 POOL191988
690,254,651 *474E951F6AA19506969861A0DF8ABA4D4E799444 [email protected]
690,254,652 *4744EC473774EABED86A3115A20B96DD2C618BD9 SUNSIBMS
690,254,653 *4745B19E57B6259AA8375F96E0D5D36BABAB8FCF p###p.~0.~o)0(
690,254,654 *474EB94D2C553634D4AC847B3DC4A9D6B5498DA1 Super Mario Bros 3 Map 6 World
690,254,655 *474C43254CD983050FA239547DDC333F56FF9818 p===p~o~o splat!
690,254,656 *4748C3FD70B917EEC814CC53821FDC3403104CE2 SVVLNDHLDTS
690,254,657 *474444446F637073827F1DAFF13275211CA31462 PREPAIDSOLUTIONSCOMWWW
690,254,658 *4742A39A721A7D9CF5A8EC9D202CD59FAD9B2FCF SWN-Y-GWYNT
690,254,659 *4745D2D4B21D84DE66726E25091CA5802AE2ED6F SYDNEE257
690,254,660 *474935760C4531E51A481D8BDDBDC52DD75DB7DB PRITANSHUSINGH
690,254,661 *474571AE95A8E08F8684CDEDA4D8B75BDDC74187 SYMPHONYNO9:IIGTEMPOII
690,254,662 *474D25AF971B7D5E9ED46EF88418F041D667AB64 SZEMKÖRÉBE
690,254,663 *4747529DE81CF85A88010E2972ED41AF374395A0 T4M}
690,254,664 *4743367EC113F953458E7C0E486800AFC7343C54 PTCBSERS8
690,254,665 *474487543C9547865A96E793C8F98C53BE6442FC p).*.*.uu
690,254,666 *474BAB7B2EED244399EB448587B1A74F9CA15738 [email protected]
690,254,667 *4746C718920A10E50756C834483F1BAFD9BE4C99 [email protected]
690,254,668 *47411013297DCB5239E964F07DA2F9AB243E54CE [email protected]
690,254,669 *47408CD6967D8F9A856020D1B4F856D0E55F01CD qD.~.(><)
690,254,670 *47469908B54F2F243D51D154E92FE80EAC0B8A19 QD.~.~(X)
690,254,671 *474575D90F1BE01F7C51790DEB009EBCDC255ED3 QP `(~_^)
690,254,672 *474721ACA514477480BCBABF6D35040CDC610294 TEINITZEROVÉ
690,254,673 *4745640118EFB8AFBC55546C8AAD0383FA9319BE TEMPLATEJANAMUKTI
690,254,674 *4748BBFF222792DFAE8C95A17B9B96426E27034E TENVEGER1
690,254,675 *4743644A72BB29B34490FF03284158F4B9EF841F teodioyteamoyo
690,254,676 *474B0531C040A718E8321B76AB78D1ABD78A3556 R3P0S!7!0N!N9
690,254,677 *474FABDE61B7A66C215A52D488CF3C25046C0941 [email protected]
690,254,678 *4748371CA62720980492985E20C02A0A1F07AE14 thadros
690,254,679 *474305BED851CD188ADE8FA38E31F4FFA5175661 RANDAL.FORCELLO
690,254,680 *474712B63C1202CCC368AC15CE94C13218E9B322 THATJETHRO40
690,254,681 *474A0C15B6B8E8684FE78DF46A6882D6D4E40AFB THATSPARROW2002
690,254,682 *474510436B8FE6026D8B91FC7F00CB11098FB085 thehousewivesfavorite
690,254,683 *4744CA5041DE297D5B5368FFEDECBBB2484F45D6 themikado:acti."ifyouwanttoknowwhoweare"(nobles)
690,254,684 *47439CA63C41C3DAB032D784DE9336B8CCCEC924 reconso1id4tion
690,254,685 *474AD50D4C996CEBA7DFCB6B0F4DBC30EE26E920 thimbun9
690,254,686 *47491989D79940E308B868F818ADF58935E55317 reels:ritakeane'sfancy/theshaskeeen
690,254,687 *474FA434944AECF56F5483024451AC55F8363C36 thomasmanbeck
690,254,688 *474962789FF04ABA6E79D695654E5449641ED217 THREADLIKE!
690,254,689 *474F22CE7A48E010E8EFBBED4C60603C4DA143E2 THURSDAYWING
690,254,690 *47434A1AFCF8BEB66B015A6391C677EDB3072DE8 TIMMY'SLULLABY
690,254,691 *474EA08529DCED1EF45E38BE195E52B0BB512F33 RENATODARROUGH
690,254,692 *47409A7AC34E9CC4B3FDC0D4CFD8AB976986304E REɪNBƏƱ
690,254,693 *474698216C65501C3EF0F3814C17DFB1B67E4C25 renebambenek
690,254,694 *4745412FC27B22EA2E745A48312A858A5D91CA0D renegirad
690,254,695 *474609244FB84DF27E08153EE287115235239197 titusfrein
690,254,696 *474A3887AD262529C9FE0142D6F8DB6890122F1A T&}O
690,254,697 *474A46DD825B56CAAF5DE9459BA6D07ECADB0B4A toddleatherman
690,254,698 *474974441F7469971E75F9DC7506A855BD47E34F reymatic-sa-|-peru
690,254,699 *4744BF598BB6FDF2308DD07EB7483DE1ED900C6D tommieblackledge
690,254,700 *474A79DF63FC888D3C2A43F70C90C923C30C668C TOMMYGRATZ
690,254,701 *474DD8EB1F373E9B1DE70043FB014DA9EA3CA192 TONITEICELEBRATEMYLOVE
690,254,702 *47497496DE28A14B1D989F2B7562944A6CC71A9D TOSHOSHITSUTAIKI
690,254,703 *47442267EC061CAD6DCD720E00668EAD8C2CA23C TPEHCSEGREVO
690,254,704 *47437B08DBC4604A27DF62247084805448F685F2 riot.coming
690,254,705 *474A63D636AE8A9CDE546E7F002A59F49E750921 transactions200809
690,254,706 *474467472DB72803E5FA68EC7D10B6840B2114AB TRAVESTIERENED3
690,254,707 *474DF0E54889509D0E58617D187CF566DEBB5213 TRENDED0
690,254,708 *4744DF1AD62C288178CA3880BD07B4A4353A4373 trinidaddinco
690,254,709 *474E4E8A99B4116E87B4996A06A509FAE588B95B tristan.rosenfeldt
690,254,710 *474D17440B05BDD7FC93733ACF7D924BE01486E9 RODRICKRICE
690,254,711 *474B2761696C7C44ABD98AF0C794A4A389044F9D TRYSTAN.SAITO
690,254,712 *474C046EB1BFE24CBA78F3AC0213D63738C4280F ROLAND.NITTINGER
690,254,713 *474EA27018432EFCC22090524378A919FE838720 TSAVITKAOIDAR
690,254,714 *4748AA7A21CA935FB7C9FE0EE0CF4D505275AD4E TSGILEKKAMARK5
690,254,715 *47444CFBC312CC5ECB30B67CD361B5E22DF0B92B TSSZEL
690,254,716 *4742AB23FBECABD99766340234E43ACE29949EAF TSTNGPPPY
690,254,717 *474917F4A2223F8DE4AB8403DD2FF1BE3C0D7780 ROMEOTERESI
690,254,718 *474069949C704C50C5153FBD086A9A708A2CA372 ROMMELPOT2
690,254,719 *47484A36943C202158E731D16F2A54E09F3DC16D TUANVUT
690,254,720 *474EA0BE9242B33B3897620EF988E70417F21FAA roosevelttayse
690,254,721 *474305C96082D07B0436BF232648D1EDEFA519F9 [email protected]
690,254,722 *4749A9BE901D644FA67D1D45DB1DA644986BF76F TULARAJ SIMKHADA
690,254,723 *474E1839A8DE2ADC433B0DA45B3A85225C64DD77 [email protected]
690,254,724 *474913D16B83728666F2D9FD7D79C494526FF109 『tusc
690,254,725 *47473D5C41EA0B8A438298416BE43B3DEDF433F0 ROSS.ISEMAN
690,254,726 *474D52CEAA49C73548625D5AFB38B98F124C34F2 t:v-
690,254,727 *47470B2005934FF7D2ED86EE4DDEB1D57CC99B22 ROSS.TROLINGER
690,254,728 *474DEF46D82559CB8132D6B86C156D9F24B83E58 TVINOD KUMAR
690,254,729 *474536B2EE99F5B2D4C759ED59874C56BB12B5B4 ROYCE.RAINWATER
690,254,730 *4740D76E6FFE3CD8A531342217C6CC36248D796D ROYPLATO
690,254,731 *47440018D83C443BCBA78DB50717E71131420761 RTERWAVE
690,254,732 *474B881A96402E5974AEAE4876E24037581AF476 RUAIRIBRADLEY
690,254,733 *474B61B90DDD242DCE8F2F845B89833A2575D2B8 rutherford160de347
690,254,734 *47452A1EEC82C6C72D3D2A15F575029241119B7C ukb0
690,254,735 *474BF1A2EE4E8792D074EBF8AC3C6860025F0737 ULTRAMILITARY
690,254,736 *4744414AFC25A0B26E4379A843F88335FC24C165 UMKEHRBARER5
690,254,737 *47451799140BA97676B6601D349DC2B745F66D8A saanhrn90
690,254,738 *4741758B24D8A5F1506E7B74AF52042C589E3C79 unica289
690,254,739 *474CA16A7F44FB522C447C9CA354CB99BA2FF199 UNREPRODUCED?
690,254,740 *47498872C027C49E9837E47447FD9C2D5B7F7114 SANKARIN6
690,254,741 *474234250B2386C6B8639A80ED47765688BFE7C3 /USR/SRC/LINUXHEADERS263224SERVER/INCLUDE/CONFIG/AR9170/LEDSH
690,254,742 *474967B8D8F43905C0D2A8673D30F4D7FC1259DC SARAH.HALPIN
690,254,743 *47424566DBF718609F01DF000736D566EBADD1A3 [email protected]
690,254,744 *4740698FDEA8D1851C9DE0D6ADF214D7E80A65B4 SAUGEND7
690,254,745 *47460E85CC0D98C02C84FF65A33FEAE1AA7F4E37 VALENTINDUKA
690,254,746 *474EB8EDB756AE4AC43256E9906EDD39CDB94B20 SCHEMATIC3
690,254,747 *4748E441D93D3A38983437DB5AE41339B40D02D3 VALHALLACLAIRE1
690,254,748 *4741B9E1FB89895802A0E102BC15400019441600 schmachvollerem
690,254,749 *474319B086E421F9F869B239F6B6149C47A6AFA7 SCIENTIFICOPHILOSOPHICALSES
690,254,750 *4747B73B703376903FB82D8D56D1F1DAEBE2058B vanessa-mallory
690,254,751 *474D128306D4A503B6D3ECEFF8F18A02CD04D660 VANESSASWARTZENTRUBER
690,254,752 *4744E4B63EAE9374D3D4987B6ADA8D2B531F9CA0 SCORIFIERS1
690,254,753 *474F684A0C3D8CE97081DCCFC49E981FC413AC76 VASPRIK0
690,254,754 *474883334B22E68D909505604A13AB2D997EF500 VAUGHN.HALBACH
690,254,755 *47418D34C8419EF51D995E18FD0D2AABE316D0DC [email protected]!ngs
690,254,756 *4741F1AD43CA9B53E7FF77EE5E949BC5547672EA VDOKHE
690,254,757 *47442EAAC2FEE2BC525FA5C6514658CF8CCC6635 SEAN.KIRVIN
690,254,758 *4746DE859A4B0B2AAF67062F20A22E9544EE4EC0 sebastianstinehelfer
690,254,759 *474E195024BBE117DBB75E1E9028CD10F2E6073A VENGENSKI
690,254,760 *4741CEDF4EE372154895D9BB797B8FD5750DBDD1 SEIKO-SUZUKI
690,254,761 *4742ABD9A74DE08F32E3BC05D7919473FCDB38CB selekhov
690,254,762 *474D72594F9E24E06F21E5159E9D16BB6063404A v>?g
690,254,763 *47449D1DAB04E3B14D86F2D0AE489465070C15AE VICTOR.CHADDOCK
690,254,764 *4747A906C24DB2363F9433FEA31DCF7E8CBF0E53 VICTOR-DIMITRESCU
690,254,765 *474A49CD9EF2DCC07CE577F4FCDB2565B164973D SEXYBOTCH
690,254,766 *474C109E53A8357269470B48ABEF75BD07B918CA VIMALA.LOKANATHAN
690,254,767 *474096424EAFF1DBCA6CFDE14C8B9CB59DAD7FB6 shanesaunderson
690,254,768 *4749B6780EA1C51A83CDD454AD54B082FFC54796 shatzen7
690,254,769 *47432ABF29F4052024CBA5366F48CD371E34AB62 virtuer4
690,254,770 *4740B2FFF3273113CE6E295D1C97220E41ADEFE2 [email protected]
690,254,771 *4748C35AC0AB3CB4A1769758BFD623DD801065C2 SHRIDHARPATIL
690,254,772 *474FD2BB3EB35DB4B36FBFE6B51262C668C3AA23 VPEDWELL
690,254,773 *4743E3E5DAD154A406820C79E67371BD42106928 sicos-del-f
690,254,774 *474AA697800DF5307D3258AD2EBBE202EF7E0BF2 SIDNETREVER
690,254,775 *474482104F89080F2A941DD4FC3C6630D97E25DE vvdsqew44
690,254,776 *474C7C16DE44053F52822193B0B4A5AE8363C5B5 SIROMAHOVI4
690,254,777 *474C503BCAAF47B21D69862E6B3D4F70CD3E3A25 SIVENDE
690,254,778 *474019DC501D3CEEB5773E2E8DEE918C7D509EFA SKROWHSI4
690,254,779 *474C4A841A76257B50F090B4557ED2A76A2E0C76 “SKYWAVE”
690,254,780 *474516D0013FB68744D040E4E398E7FF153ED3A8 [email protected]
690,254,781 *474203B03081CEEC3F6A1F5AD2C38A44273D5933 WANNONI
690,254,782 *47408D38353F874F5F99BDF97C3D1352B3939ECF [email protected]
690,254,783 *4743E334C36034CBC2D2815E17A2E0D9C8B56F13 WANTEDBOY INFONSIF
690,254,784 *47488386CA3719B74BC218A6C8042AF371A03C74 smart_38890
690,254,785 *4747D22F344171F89EACFA2425C70A67CB0C8808 WATSONTRUMPET8
690,254,786 *4742978B481C1EBCDE1DEE40487C0AED08F796AE wattages
690,254,787 *4744C4D05548D74869D453D04C76DF4E04A1E341 WEBKIT-BORDER-BOTTOM-RIGHT-RADIUS
690,254,788 *474688170CC3A5489DD4B9CFA0A3EE650C775AA9 weebin-lee
690,254,789 *47489C3B0FD0F209DF04A4743773D1BBFAD92839 [email protected]
690,254,790 *474916B61EE5C69107D3E965FF97B1DD9B540FF1 [email protected]
690,254,791 *474123AFB0DA1613612EA0A0DCAA1A4EA82A9B46 [email protected]
690,254,792 *474DCA84C237E43958CDAF72AED5782D7765FC12 werner-smal
690,254,793 *47429E69BF271B84D4F92739A5B7E2C0EB1AD24E [email protected]
690,254,794 *474ABCC478ABE282C1B6178B4C7907D3EAE61ED7 sov
690,254,795 *4745EA1C4CB6B7A8C92BB06CCCFBA09113FA4B82 WHAT-IF-SHE-FELL
690,254,796 *474631F7F6B84B6EC8DA92AB5DE3C34E54B00420 [email protected]
690,254,797 *474150C7A8FC8612F77B6827C4E9409DEF0A1570 WHOVILLE-MEDLEY:-PERFECT-CHRISTMAS-NIGHT-/-GRINCH
690,254,798 *474E7D605BA2024A4D247AA042A03BC572FC41ED [email protected]
690,254,799 *474BB6769DBD9D141E58F54BCD8DC1952AA876CB wilfredlorr
690,254,800 *474C697BCFF77ACE67F75BE2E31E800F254DCED2 willeasler
690,254,801 *4743D975E90B18CFAE2091452DE37EF9D74B4028 WILLIAN.SALLEY
690,254,802 *474D05ACBB16E4206B2C2056BCADCA62A18ED7B9 SPUNKYCHAOSING
690,254,803 *474C29884441BF144AA4E663B52A3924759F38C2 [email protected]
690,254,804 *47441B0131C93CB175C5E233C066B2097C9E60E6 SQYE
690,254,805 *474D9B6D71908D50AE7E567AD618AD54970A2053 SREKCAPNUGPOT
690,254,806 *4749614245B858C530CA051F6C584011C48FEED2 SREPOKRE4
690,254,807 *474C950503B77EB5DD94F6FB5B22758C8EE0CAB1 withdesperatehandssonumb(live)
690,254,808 *4748610AA8B2B4711B74D890C5EF5CB8A9968199 world''style
690,254,809 *474BBCE65C1A236290040749BC9B925597B84B15 STAYBEHINDORGANISATION
690,254,810 *47405C26DC9D140B3123187EC5AAADC806A47923 WU-HUJING
690,254,811 *474F588594DB95A0CA06D18BE9C20F6196845F84 STEVE.MORAND
690,254,812 *474943E5ADEAB9EAFA8FC2B17159FE8279C3F3E8 STEVEN ARMSTEAD
690,254,813 *4743AC4D4746F177020A5BD09A1B2AECF099C454 STEVEN.NEILL
690,254,814 *474B06D25BB3B7CFCFB3BF7A501ED9CDB7E6D6F6 steviepanther
690,254,815 *4743B3A826BF989689D15E0BA8BC72266414D5AE WWW.PENSIONTSUNAMI.COM
690,254,816 *474A6E7B8D33920C25BB56351E9473FC087143B2 st!mu14t!ng1y
690,254,817 *4744B64D94D008597FC808355755D0DC39C83304 X."#
690,254,818 *474009ED1F27F558B331CB2C9F819F5CFCA1D9AF X8TF
690,254,819 *4744567A67AA87DDEE5F013F529A3F00AF50B05C STUMPS5
690,254,820 *474D11F5272687A6A6A2A3AABB4EA1D757A3CAC6 SUBJECTEPLACK
690,254,821 *474508A592FB6A9D87B78DE4AED5453911739C7A SUEDLAEN2
690,254,822 *474B33D3A6228C8CF510FE8FBBA4F2CBC7CD9C56 XJWDESJSP4
690,254,823 *474139F77F5BADD5ABB08E714FA66BA9826773D0 XOHQOLB4
690,254,824 *4741C96116C79AC4C158AD817A697EBDD83C55C1 SUNDAYABSOLUT0
690,254,825 *474F7BC10AA4EF2EF07BF5DA0BE80B899117A7FC [email protected]
690,254,826 *47446EE26B10112A41D5682404C9CCF42269DC0C SURAJITEU123
690,254,827 *474CAE75BFB793E6EA9F78A8F87F935ECBB59BA9 SUSAN947
690,254,828 *474F62AA263A13D2B5E9971AC3C07CAF748366DB [email protected]
690,254,829 *47440D56DE01552AB706DA3D3FD52742559836E7 yararları
690,254,830 *47447EF23A28F89DB7B31383F05822BF517F3E3D YASHDHURIA
690,254,831 *4749C197DD10332C3C20C61CE7713CF818DD31E5 YATIE.MULYATI
690,254,832 *47490466B4143BD1D53DBEB684E8C10FD6D684DA SYMPOSIONS!
690,254,833 *474064ED6B4EEB1AC2E4E65D61C1495C389A0847 yjcwcnvrzkovtyv
690,254,834 *4747BEC48BF72B3ABD751BCB83C59C3CADCD9D82 YORK44858055-76433
690,254,835 *474259BE458E8D87EB25790C2FE21158084734FB you75836275
690,254,836 *4741E98B18CC8B98487E0FA3A9330272E228006E [email protected]
690,254,837 *474A7494CF571CA09188FFB9A3824FB7F834A9C1 [email protected]
690,254,838 *474A42B43B04CBD52D90D9B83F16DD0C2845B5DE TANIA.AZAR
690,254,839 *47482324D49C4DA3F0BEDDBAD79A5FA087F67F84 TankerFraEtMenneske
690,254,840 *474F6CF37022A042A7FB17E85F9623B65DE90A07 YUŞDIRA
690,254,841 *474867782DF329F19DECBB21ADE67FF704BB332B YVONNE-WILLIAMS-CREEKMORE
690,254,842 *474CD4BE9B63FCCFDC752B6270B7DB48248B2BAB TED-BRIAN
690,254,843 *4746583CDE7C56CC75688E942423A67148105FDA TEIBSQK8B5QRJAEZIQHBDQ
690,254,844 *474D35D93727C0527E4132E69C420FD3039BBA77 ZACK.HANDSOME
690,254,845 *474C2F53D18DDE5B6F4E719C182F21C960FBD175 zaid.askwith
690,254,846 *47417DFF8AE29F149438F50D720AE57972AB3FA7 ZA-KIA
690,254,847 *474F7D4AA8CD0AE2797F4FF555BC0E2C455DEDEF ZAKK-ENGHAGEN
690,254,848 *474413B74D72BD137D872E49C74FA02CAC020189 TERATOZOOSPÉRMICA
690,254,849 *474549276731F88309BABEDBECB43D61C4CE1C21 TERRENCEBALTHAZOR
690,254,850 *47425B5CB24A97B359DCE02467F6A787BCEA2EBE zebbiezamora
690,254,851 *4740347063234CAF2BDD2BF6B25D95D7FBD5813C ZENITHGRACETOUZOCIMAFRANCA
690,254,852 *47414951B82FA090028F32FEB774473682E82879 ZHAOBINAN
690,254,853 *4748A809129DCF01F260131B6FCC1F1A0FA90F19 [email protected]
690,254,854 *474FEFB10978550F467DEC46F01DABB2F9211441 [email protected]
690,254,855 *474DCCB12347D6304E0B64705E59F08AF22395DF zjo1
690,254,856 *474B814C5E5F5DC828E817E06CED4E953E53ED59 [email protected]
690,254,857 *474C7D96DACCDDED248C814F83D38AE5F4437301 [email protected]
690,254,858 *474A033C076EC404E8AE6D0EB189D5ECD3662C72 [email protected]
690,254,859 *474430A4DCFE4F5D1FA6C0ADE91E501B7BBE5212 z#vf
690,254,860 *4742BE248B795D5E220055A271B97ADE86928181 [email protected]
690,254,861 *474B9ED024B3A220F4C67C2656427CB2671060C5 БАЙРАННИ
690,254,862 *4743D6166D1C075AB499296B9D952ECB2A8D1122 бельпюї
690,254,863 *474942CD4EF542C2DB6C2F9F26483C2D1A042960 THURMANMEAUX
690,254,864 *4749E828B8B3158BA4FE6990BD72278711A6B9FE ВИЛАФРАНЦИ
690,254,865 *474B8F651CF86C3B26F2FA4190AADD6BD864560F евангелистов»
690,254,866 *4742B56513219C1ABAA59731B491A8F413467373 МЕССДЖ
690,254,867 *4745EC8C0A5BDF6DF65A9A613B9B114FD89290D9 „МНОГОЛИКАТА“
690,254,868 *4740171D0814AB5CEE426CC928A840AFFDF6F9EB ПРЕСРОЧЕНА
690,254,869 *474F6B7D8EC1360DFBA5504DEA9A1202C8FB1366 TOBYONEALE
690,254,870 *4746C0642FBC74E2BE913C80718E9F8396F1EF67 СУХОГО» —
690,254,871 *474A2CC4404A6B76216C532436FF90E701FDDE8D TOIVOMUKSISTA8
690,254,872 *4742FA13233F7DB8290CA4ABABE4F9F55880CF04 ЦЕВОЇ
690,254,873 *47424C6EA9A53B38EFD6B901B4930E4A67827842 [email protected]
690,254,874 *47405303FD564904E89AD8C401CF94BCCAC91C83 Too.Many.Thorns.in.Your.Bed.of.Roses
690,254,875 *4748FA0D4885A8A16E478F46D194EBEEFAD6A2D0 TR4DUZIDOR4
690,254,876 *474C3F5011AF7A1CE68F0F4A4D77746980EABF39 TRAN DUONG THIEN LOC
690,254,877 *47465CF9A8D958D95D10B7BD9DF68B57EDCE6AE1 tristanjemison
690,254,878 *47440649469F4D53FCB10BCDA19828363942ADE2 TROYHOVIS
690,254,879 *474486EDC60CA59F17038871EAA1FDB5B097FBA3 [email protected]
690,254,880 *474895BFB8707F514389697055C903C67E4435B2 tsG
690,254,881 *474998E6057AECBF1DEBCB39BF414A05DFFCAAFF TURNGOODLINESSGOODNESSGOODNESS9
690,254,882 *4745FFB7F7BA58CF35FED5D7E24C690311FF7B13 02zebra5
690,254,883 *474326B78857C6ABAD43E0543BBC7CF6CA436F5B 10.WARDIVIDED
690,254,884 *47498159E951FF462CC1F6B249775C309A2CEBA6 11-15-1667
690,254,885 *474443E91C7A83E42B955D0C425530FD39FEE176 1201139 lopuksi-lainopillinen-osasto-toteaa-,-ett
690,254,886 *4747CB1B615F0842405E23151C9113EAA0F77EE2 12.08.1670
690,254,887 *4740A7292811EB9D3DF99B86317710DC9ABD3B5D 1599059 the-national-railroad-may-soon-follow-
690,254,888 *47454B951BFF7A2C71609582D216164E46A28319 1631697 BY1995THEYWILLHAVE10WARSHIPSBUILT
690,254,889 *47460E992863D1506A314FF0DA7649BEA654E621 1691712 SCHONDAHERDASGESTAMMELVIELER"TAETER".
690,254,890 *474C290A0F1EA6F17BC7A7B5F1517A2DFDB59D9A 1.backenmuskelbewegung
690,254,891 *4740888AB31F8C18E7AFCA241E75349C643B417F 1cocopelle
690,254,892 *4741B275D2C85B7EC16324E8C67A37F160FB1AA0 1 COMCHEK
690,254,893 *474395359582F81F88640479F8D30011B500DB75 1 ELEKTRO-BERUFEN
690,254,894 *474C91576E8E32743422F71FDC01A0AD984E180E 1.fdpregierungsbeteiligung
690,254,895 *474E31350EF4549CD57B4A4B305EE17C80B0207A 1haulikkoh
690,254,896 *474AD48725ED97B7A7F32A3ECBDA7254BD61210E 1hexabiose
690,254,897 *47449C702BDE1F356BDE2D06BD518DCE3008ED9A 1ILUVFLYBOY8
690,254,898 *4743E1AE88DBE57142F646F6B6262468EC7A423C 1IPSERERP
690,254,899 *474B6369AB9EB0E55B38FF6A9EA7F2FC623D088C 1 LOGPERIODISTA
690,254,900 *474E3EBDC4DEAE0FB8B6DFDAECCB06446B7DE2AE 1-maonpaosta
690,254,901 *474338CFFFB981CF7B25E192AB7BC27886C84CAC 1.NEARABSOLUTE
690,254,902 *4749B45CB0E1A8B5E98EE3037A87E549F42EBCCB 1-OMAKOTITALO-RIVITALO-KERROSTALO
690,254,903 *474392B60295DB7DB68668A278E42E64E9FBDC82 1-palvelumaksumme
690,254,904 *4747BB43490D8ECC9A18641DAB600A6758236011 1polizeirapporten
690,254,905 *47485E3EADB498291E1BAEA7F187C8B682CBF851 1STAUSES
690,254,906 *474A11FEF6822A3900A766B3B2D1B1AC46F91BF4 1-suosivasta
690,254,907 *474FD75276180433ECD57F3A4409CA7189771271 1 VARITUKSEN
690,254,908 *47478D42CD05A1294AD7C9292DE47198202D0919 1 YRTTIPOLKUINEEN
690,254,909 *4745D84D78CF5DE2CBBBFB00AFFA7C82F035CA3D 2412214 DOCH-DER-KLASSIZIST-SCHAETZTE-DEREN-KUNST-NICHT-.
690,254,910 *474C35354FEB50AD3589095B5BB012FEA570509A 2819631 LEBEN HEISST LERNEN
690,254,911 *474CAE826A02C39CE174F8EEF1A597E7F5794FF2 29-12-1159
690,254,912 *4745E37F95FCB79E3347CECFAD30978F2233FD43 2-GIEGER
690,254,913 *4745512600DDD7A2F3515A2C580CD25CC83A9FDC 2IBCFJKZ
690,254,914 *474137B029A7B4F75253E08716336815D937B65A 2JARGONG
690,254,915 *474B852D660AF7FDDECA932AA543A309512D985C 2.kilpailuvirastoon
690,254,916 *4743529F626E2480D7A3DDDFA3F980D0AD9F26AE 2.mramba's
690,254,917 *47401EA89E23724A0E3CCBAAA4BCB5864E05321D 2.steatiten
690,254,918 *4743748EA72BB58F4D698CED03290D5E81206824 2-tilavuusmallina
690,254,919 *4744AD750BCA6D11878750B251B97A07A226135E 3-----B~OSplat
690,254,920 *474EFD967BAA62625DCDC429461E3A32AAE027D2 3DEIBLER
690,254,921 *4747AF7DAE8F433EAE381D1D0062D72847426E91 3nationalbibliographie
690,254,922 *4744C1B48322B66334E4B6BC673EFB2092D43000 3##)~O~O-SPLAT!!
690,254,923 *474DDE6583EFB227C4672161689C215261B40C70 3PICHOTTO
690,254,924 *474AE46FC8A54C75B890DA161FBE44391BFAF6E3 3-yutkunarak
690,254,925 *4747312090AF693CA355F11F32EFC8A029710965 4061513
690,254,926 *47452256BA997523706C2B037233EA77D4482C18 45AF4009-C7DF-3418-AE01-4BD3999121B2
690,254,927 *474B16ACF7A71EC8534082D7669D6FB532E0462F 4DEVAELTR
690,254,928 *4742E392436A946C508CC7DBE9C5C9DDEFC9B797 4$+erod$
690,254,929 *47497CD1D3D9F800A11C7F9A527B5C85AF380B40 4KRISTIANSANDIN
690,254,930 *4744AF78450E0A8ED559C45E74B9114F3BE83277 4MARIAJUSTIN
690,254,931 *474253908925F15B84A195ACBCBC07F1F32A571A 4NCTNVRJS
690,254,932 *474171DAAED0E51130FEF8D93CF4E529EC224614 4ODSEPAROWANIE
690,254,933 *474B5478558D7B77DBF74E3A6E16DDA702EDE4A1 4OSOITIMM
690,254,934 *474D3D02F4AEBBFFBD3BF5C601C62988865DD93C 4STUDIEKREDS
690,254,935 *474E6CDF3F4551E29B795105E841D3EDA2CC9D13 4TERMINGESCHAEFTEN
690,254,936 *47467433694EBE5CA14CD924B20A6CE494BAF7A1 4THATPRELUDE5
690,254,937 *474835CAEA9C9C44C9A645066B9E030AE2BDA454 [email protected]
690,254,938 *4744F94417A8868BD1A4A97CFC12DA99404E16D9 5MICHELETTO
690,254,939 *474E50D8D6CBDDD071BDE8B492F514998299A8EE 5ORERGIMMI
690,254,940 *47474F8BFDFACB409E8012A7461DA0A73BDA1103 5 PALKATTAVIEN
690,254,941 *4744AABD3E3833E9C3860AC97189604E01DFAC6A 5SSLEDNEM
690,254,942 *474150E0F0910191E8D56FB15FBAFBB16E3C2AC7 5STEELERSTRIDENT
690,254,943 *474903853822F7BE0BCBF8D08204A046A9331C51 616RHETT
690,254,944 *4744BE93C77E90E9EFBBB82A9F8C038D885970EE 6ERVEN
690,254,945 *47442924EDF9FD9919F361C28F6168647902ABB9 6FREDERICCLAUDIA
690,254,946 *474248BF94D3B5B774CB6462F4612157DF92DC4B 6FROGLET
690,254,947 *474CA90C1B3FE7D37C07057B9829D576B55ADBC1 6KHALIDOV
690,254,948 *474F6B7F408FCBF8698BF056CA29CA92AA3DAED9 6MYHANNA2
690,254,949 *474E2B105DA98635B3853C57ED195333020DAF5E 6ONAVACRO
690,254,950 *4745C61DFEA19859F93F04C0187D3238DC8D1418 6SUPPORTERBACKBACKBONEBACKINGBADGEBADGE
690,254,951 *474F83616F925EA381B3B1885E5050B1E6F5B641 6theletmein0
690,254,952 *4745B284FD5ADE3BC58F14EB6632B4E26DBC9E55 7CALDERSTONES
690,254,953 *474DCA829159D81271C177BA7A4D7D8A788EA1C0 7FREDCYRANO
690,254,954 *474168BFBF0B66556E698C37E46D8F55308CA96B 7GARYSMILEY
690,254,955 *4740959E6E52A51F7F8A19FD3060BBCB752BA482 7MICHELERODMAN
690,254,956 *47490388CA99D23C93368098366D6FEE0DA12FCF 7PLUVUNKI
690,254,957 *47432BEB4BA67CE5B2BA5D154AB3952CABC42515 7WOLFSCRUFFY
690,254,958 *474404F22A1D370AEEACDDBAE21C0FA410B7B508 826886 doGrultucu.Uzerindeki.kartlar.2.7..
690,254,959 *47437F893E2CB449D967D6AC427EDC38BC0CEBA0 8APOSTROPHISIN
690,254,960 *474EA72CC195B6091CD4B76066277186B29A2411 8=B~0~o{x}
690,254,961 *47415F5FD6CF8C90CAAD6CAE984D5A02B70B58D9 8BARTAIL
690,254,962 *4747815D24FA4A6CA96A2869D659BBD146C7271D 8--B-*-*splat
690,254,963 *4742155CE8091D83258D0E6E233087A9316B1A8E 8DEBANNE
690,254,964 *4740C1E9467AAEC2B83BBEFAC04BECDEE16C3AE1 8DEMPBARE
690,254,965 *474B98DA0CBC098C7879753E33171207A15AA0FD 8DRAYOIR
690,254,966 *47437355B5EF2CA65D232000FF6DFC630E9B38ED 8ENGREGE
690,254,967 *4743208CEBB564A91CAC1C54197A64EBA85C5245 8HOBBITDOMINIC
690,254,968 *4741B82AC243C37E7A8DF8D619DC4B2C13964232 8IVSNAGOH
690,254,969 *4747A3355CA98A6A82BEE160FC16ADDF6F86CF8E 8MARLEYPACERS
690,254,970 *474D6D5D445EE9F94FF4D622DA19B268C7ED43EE 8PREOBSER
690,254,971 *47441ED33CBE267DB019F039710277FC0F6053EF 8REPRSENTANTENS
690,254,972 *4745DC955565042E4E578273A176F357464ECBA9 8RUDICOM
690,254,973 *474246EB355D5E1A8F0B584F5AF9A198403C5434 8SETEHPIREP
690,254,974 *47465AF514BBF6CA5D064EF1C8A903BE890F9E25 8zaligspreking
690,254,975 *4749A09D061C589163C43A90BE87D62FBE6DDC8B 9battesti
690,254,976 *474B16872D3BB81D3F898117B6C4AD1EA2C1AC8B 9BYRSONIMAS
690,254,977 *4741240222C5419D12829D25DEFFB40D3C76189E 9MYHORSES3
690,254,978 *474758CA1CF4DDC3345983089DDC8D8AD2F36728 9NASCARSEVEN
690,254,979 *47488F2CE70354863033F429EE2FE90887C31114 9SELAHCP
690,254,980 *47419331F1A7A10004E1640072D1DDA16AB51B36 9THUMPERDOG
690,254,981 *474C8D0A101FD0234B836C940EAF51C37C74DE02 A%1BP
690,254,982 *474BA5646B7C91866D997ED803EBDB1E773C6689 A4YUU
690,254,983 *474F86C1564C6C4B89516DE1032FA89871EA33AE $ABOT1NE
690,254,984 *47492F6D19EACBFBE6CC0292BD097C77472B0739 abrahamfrink
690,254,985 *474653F709A7FA772BD6AEE6D30DBF3426C0BAB4 aby8g
690,254,986 *474C566EFB96E4A199BD314FC593341BE643AD67 AD|>_
690,254,987 *474C9E25B2BF0716211736582331FDEF7955CDC1 AD1G-
690,254,988 *4741815F0C6F67AF7460B6FF260310F482958FC4 ADB"
690,254,989 *4742A33EE4351B00376B57C5FBBCFF5982E47BF8 adriantrieu
690,254,990 *4746745D053C04E3594C3B7D1963A19DE094EB67 adventuresome
690,254,991 *4742B18A98E3FA6D84588D91BA543620822226E9 afascl
690,254,992 *4741D169BEAED4612481E337C24F75B802A4AAED ahandat6
690,254,993 *4747583C659142303E19B7327BBD5338D887BFDF ahply
690,254,994 *4741D830282D1F757C494334DDB9E15EA8C9795D AICDF
690,254,995 *4748BAC295D5CD5D31142A513BBD03EA0C423DA0 ALEPPOGRASS
690,254,996 *4744939C80EE9039A2B3D614FA946FF87372080A ALICEMARING
690,254,997 *4744A5AC8134BBDFBBA37B99980EAFBFFFEE0C98 alicetequila
690,254,998 *47491E0DAB0D46CA3E351BEEA42596FA24E85661 ALLERVALE5
690,254,999 *474036136065B179137F55EBDA020EB01B219CA6 ALTINOZU7
690,255,000 *474A5B7E1B250DFA959CEF6745FE8812C462CB05 a-(lu
690,255,001 *4740B5E19FCC1ECE48577A3BA5C56C435BA476F6 A.MEDZI.LEVMI
690,255,002 *4740076705EFEFECE988D19BB68BD46F0676BA9F AMIK,
690,255,003 *47415AE4892D538C2F6C9A7835A0260BCA16B494 anastasiadouglas
690,255,004 *4749ACC592D958E0EE17E8EA0C0456E57B4A7A98 ANDREW.DILKS
690,255,005 *474D57596A1ECE3C00D6D05192A8F21283A04528 And.Then.I.Saw.Her
690,255,006 *474DE4BE1C7E0798540FEBBF903913B0EECDE8B9 ani-shelach-reprise
690,255,007 *474A3729D6BA7BAA7EBAA7B083C88E4815E78C0C ANOTREDAMEFIGHTINGIRISH
690,255,008 *4741B1CDF666831D5A47968E807E336C1DB1E409 AN#QO
690,255,009 *4743B26632D163070A43BA48A290EF3EA7BAA12B APREFENTAR
690,255,010 *474016DC6CEBA41CFFD357117D62F8C03D0CE354 AQ198
690,255,011 *474290BF9821D7911412AA27F001DE8813F39161 a(!r1
690,255,012 *474CCC57092DF3742A53B2A4756A552A14ACB2A3 ARTHURHERRIMAN
690,255,013 *4740BEE58CAA449D05F1E053A247013A5D3FE537 arturobowker
690,255,014 *4744D2A34764FBF15599EC9F49F3667A7B7B9F90 ašbeine
690,255,015 *47412FC6FA16F560900809276489DB5CDD142032 ashu_
690,255,016 *474BD03B29699F60599924639828F2A5B33AE396 AU+OMORPH1C
690,255,017 *474FFC711925D8AC542DA34E8DE036EEED7BE133 AUTOPSYCHICS
690,255,018 *4740D965137C46FD4BD52A8F2D0953B870066CE4 AZSXDCM
690,255,019 *474677951CC0C7CFE3E067792A7E8510FF4A7460 [email protected]~0-splat!
690,255,020 *474159899C54B348D69461951EF4EFACE15A2CC5 B2SD:
690,255,021 *4742F2F313C1ACB58725945DAD27300ED4F3DC8B b4se.depo
690,255,022 *4746D5359ACFCA2793B9C59742F9D51163D9DB5C B5CN
690,255,023 *4741340B547EC5B8060A44D49B20121B8B1E1A4C b84_?
690,255,024 *47424AFAFEDF7D3835BC58DB11FA6B5A2A75BF8F B8HK
690,255,025 *47443BC25AA8AFEB32EFEC64DD19060094E6DF0B BALEIRALUGO
690,255,026 *47439F534F380B82592976B4006E9CC3CCA07031 bana-ahmd
690,255,027 *474117019B5050ABEEE71E7D49039B2BCCCED6DD BANAAHMD
690,255,028 *47474D1D50AAA5DF68B4DC5BA3137FEB24C90B0E barlev
690,255,029 *474228C6C19FEE093EE681992CA4A89F91CE4166 BB81Y
690,255,030 *4743E8DB9859EE018F52355992A6088E66EF546E BELASTON
690,255,031 *4740233117FC347C9D8668269A99035DA80786E4 beneath-a-desert-moon
690,255,032 *4743CCF30B0393AF15DBE3A46789DE45E3E3DA43 BENEDICTBADINI
690,255,033 *474193383F7451A3913573428D149BB36C6CFCA4 benjamin.spikes
690,255,034 *474F8583A4805F15F41F61B2610489ABFBF4A94E BERNIE.LEMANSKI
690,255,035 *474C755F43B12646B6354A83EC7C1A5B5B7A174D besprechungsprotokollen
690,255,036 *4743C2F18AD472B8C0A94FF42455E4F532282808 bfelp
690,255,037 *47415770196E9DEAC68120F4A913EAA6EF4FEED9 bgq8o
690,255,038 *474738DEEFAFE5EE722E95E02065746D24FAB674 [email protected]
690,255,039 *474DFB8635CC1D1495B0A74D72D359C02679F0AC Bht
690,255,040 *4742B09BDFF0AFC022BDB91A8DB55E7CBD20B3D9 BI_d
690,255,041 *474191DADD4FFF66B7164F1D1729A22D5C1DE61D Bkc)
690,255,042 *4744E186F9DC128F32075B6B43270EFFB9C7FB5A BLS3H
690,255,043 *474A004FA9291EE8B38531174EDF74A3EB21421F BMj2
690,255,044 *4749A42753C58D2B756509E8A4C7D9BD3DFA7D26 BMZUN
690,255,045 *4740A8FB89E6B428B8C5E5BFFC2F14915F4C0B43 BODACIOUSSTILLS
690,255,046 *474BFD74F07B15824023ED41AC0D49695AB0FBD6 BOGFINKES
690,255,047 *474DA17BE1817A41D59785513D74DB5A55D39A6D breastfeedingwearcomwww
690,255,048 *474F716A54BE471EF8A6DBACCDA9A6CA5B4D2D3B brebayne4
690,255,049 *4740BBDA7D2B5D0A6AB3C4FE5FEC8BFCF8B03EA8 BRET.PETRUZZI
690,255,050 *47469A01B1BA093F1D29D2FC70BA87AA92A1FF73 [email protected]
690,255,051 *47424C7283A8ADF4EAD137C7FD48EF020D133EB1 BSWBILLGBSW
690,255,052 *474AB490F0D534D81499DF8E274FCA948AB31F0E Bt+V
690,255,053 *4749ED66BECF76BEBD4C4EA5B3D164D03F10F4D6 BURTHTWE
690,255,054 *4741FCB9909FC968AA0948917DD6AF652367D417 B%V
690,255,055 *4746D5AFE8AE0BC1EF81B3B6F1D36898F32A95F4 bvlc5
690,255,056 *474A9EA0F1DFFF15BBE1AE1DE16BC5AF7B680730 bv(m
690,255,057 *474FDAC54140E2DAC43A3A8F01E622852EED04CC [email protected]
690,255,058 *474A0A93C07646282C087FFACFAD1BDCCBF25056 CARLOSMROTEK
690,255,059 *474B0ED1C16FB3F8D245C9002667D2DAC741AEEE carmenleibert
690,255,060 *474FAC624D0088BE21DAC6AC704330967824A17E CARROLL.LITZENBERGER
690,255,061 *474B25D15D8D662A3B5666C20241B0F889D91952 CARTRESIA1
690,255,062 *47402F2E90AF643EAD4885280A866FE24628F2A9 CARY.SHELITE
690,255,063 *47475F8C5E8236F3E252B35D1DC4853C37E0DC40 CARY.TRAVIESO
690,255,064 *47491733F99E0952AD00F84ECCDEC6D87F3D51EE CASEY.HEGSTAD
690,255,065 *47497F337A905590255ED5FE141BA1FDB0A36BA4 CAUGV
690,255,066 *474109F96799AD5B897C5A3CF5EE703B6ABDF51D CD"-?
690,255,067 *4740263969CB7F40C558266E69AA27C427CEB8DC c:\documentsandsettings\firexware\localsettings\temporaryinternetfiles\contentie5\ozs69o0s\aolcaho1o4r
690,255,068 *4742DFD4609FAE7B3F8C30493E0AE2C85B5A1B05 CES)GIGOUT
690,255,069 *47460A81C59B82E61426F410A51844A9868A9BE9 CEV8
690,255,070 *4744589EF6068DFA91262EFE1F3E05A7DD0834D0 cfns/
690,255,071 *474D710569BB28C33F0CA04CA392A0D4A2D553A9 CFR!#
690,255,072 *4747A884626D8B9DD9C1CA1EE210038C563E85A9 CHADWICKLASON
690,255,073 *4748D166B6D8229BF44D8F3B084417DFFF2789B2 chantal-coelho
690,255,074 *474493C07C593452EE9B74202EB01214B6FF7A85 chasejurica
690,255,075 *474A33014E4D05BFAFCA12E2619093DA43A5BBE6 [email protected]
690,255,076 *4749ACD9DF743F4D925B99415BE32796F8480833 [email protected]
690,255,077 *4744D4526D918E398BFFBC14038703D24F1427B6 [email protected]
690,255,078 *4741589C8C73CE3833D270D73456A6FBDE358D28 chey420
690,255,079 *4746E5AD52F4994F1ED4530FCFC28768E4BF8CBB CHRISTOPHER.STEPRO
690,255,080 *474E13234A9D87609CE8D0713F18FF2FE414FE94 chugáinov
690,255,081 *4741E9431F6693BD7C17052F823C7426A5AD3A47 CHWIESEN3
690,255,082 *4743F965B62B1C040340D656CA8CDBA4B319B2D6 CIGUI
690,255,083 *4745579F418EF929EC33CE46DDCF3EF1C3C5E7D2 cjkms
690,255,084 *474FC4E362BFF9F04BCADE5D6176617D28F46678 ckns$
690,255,085 *4743632793BC9C2C3C2549B57F45C05659C8D90C CLARKMAYES
690,255,086 *474DE902507F55A47091A912417D4D0932C9835F CLASS’40
690,255,087 *474609A3F73DD89857467A28F5E6A2FBF423A245 classics.records
690,255,088 *474430C063EED6B65A6D7CBD33ACFDB884843409 CLAUDIOJANDRIN
690,255,089 *474B922FDEC0AB6FC3C26789ED5B389F0DDAB4D6 claygosden
690,255,090 *474CCC393A3F4A89B929656500027BC8EF7C44E5 CLOUDED.ROOMS
690,255,091 *474078C84097E7E92358CEDB89E25B17C86A550A [email protected]
690,255,092 *4742369DA1C48E1954400E1C3688A36D47C85615 cnstrng
690,255,093 *474E6809EC1392906D9013B9233F8B034D4CC090 combindedfleet
690,255,094 *474F17C6E57729D07B7B27044E710EF3B1CE0E05 [email protected]
690,255,095 *47477D78128BBE3AA18EE909389BD4AD9BEABFDA COORDINATES160GWCZYC
690,255,096 *474FA67176CFA475EBA76434AF1C40FC6593B899 Copyright
690,255,097 *474627963769EB6D317CEEAC99C479A00DF9124B CREAIVE7
690,255,098 *474327D4602ED8A744827B3328540A7BAE14940A CRISTOBALWEISSER
690,255,099 *474480D42D7EF22BD3655534BD10E2DAC76198DC crl:=
690,255,100 *4742E9C24E110CD7E141DA1C7C3EAD1C18098ED3 ctzuv
690,255,101 *474E6FD21D0A6D34B17A70199F942F18D9C7CE97 [email protected]
690,255,102 *4746C923A0EADBA4B0AB13E3BAD3254216FE3D46 cusjr
690,255,103 *4744F8817C017F2B0F4FA5FE0DE138AA547C304A C:\xampp\perl\lib\unicore\lib\gc_sc\Pcpl
690,255,104 *47429A79D6ADB27BAF69F672C341BD29CF9A9C7F [email protected]
690,255,105 *4742BF6A74A1D8DBF618BFA6CBAC3955EF6328F7 cyrusgroening
690,255,106 *47473809FFAA0BBFBA46C02D63533D5E795EE30D D2VLB
690,255,107 *474B3F429709C346DFA8389B5A88A23D137D83A1 D4ZJ
690,255,108 *474DD2E73CBD9E1497AF6371EC4B9C6744F5E3E1 d$$9w
690,255,109 *474D12E949F6D9CBEF0320AB1D432C7CADA161FA DAISYCUI
690,255,110 *474717108E364D5D6567C238588B6BDCE46F8F30 D#Al
690,255,111 *474B63872FAA77CC70E2B5F8396069188C9694B9 DAMNDABLE3
690,255,112 *47429380DDCB8A072F54615FF19A3E6CCA75B2EE daniloguzzardo
690,255,113 *474E1C03D2E4D731160A373E3C94BFE8FDCD0D3F DANILOVICH9
690,255,114 *474B319F091819E0805019A1620A579E94D9778C DANNYSANTOYA
690,255,115 *474E7EA47A4E08B863CE46CD55F0845577ED1772 darinher
690,255,116 *474EF3167C7162969D80700A8A9DA115B14F1A9D DARREN.FASON
690,255,117 *47486620C00074BF02AE028F9AE271C501606691 DARRONBERUM
690,255,118 *4740A52240A92D2C9555B0E0E94F08766B771106 DARRYLKAZI
690,255,119 *474F6E46414BE1D8232853EE3CB27D5A071A066F DaUL
690,255,120 *474DDA636CE7EA509CBC60D7D052126DE277B860 D&CF
690,255,121 *4740E66212A37537E48611CA2EFBE70A2254B0E7 DCPVS
690,255,122 *4741D3BC1861713BF7FBBF601CD533C20B6A1EC3 deatm
690,255,123 *47466F4E6AD73842EE65C03BD83C4F17CBC539CE DEITHER.JOHN.ALFORJA
690,255,124 *4742B2DBFAAA502EFE1AE494E39FDD046323E6FE déodande
690,255,125 *474D0CC178D42ADA8D22CC751344715AED3ED632 DEVON.WEESE
690,255,126 *47466F81703E0F319BDBEF39A063C80EAC666CE1 D-FI#
690,255,127 *474265D6B6942BB6411300D8EC52668EF2227629 DHIPĀCHĀ
690,255,128 *47412C3582AE37584A484377E3C986810BECD1BB DIBBING.COMWWW
690,255,129 *4746D55FC61CD02869D724CB0C1C27E1A7D9ED2E dickheadalex
690,255,130 *4743DCB526746A97F4857739F9C60F187F18ED7D DIESE WELT IST NICHT F
690,255,131 *474F17D28C0D40D054BD3C544CDA550EC9C6F41D DIGNANDETED
690,255,132 *4744F725317C4F313A682509BF862E3DA651FF09 DION.VOGL
690,255,133 *47463AA714FE7A4E5D49B1E1B0B33FC6E3452378 directnonjews
690,255,134 *4748C185739C186D2284D5D7B1E7B5422911E55C DISPICIESQUE
690,255,135 *47483A320935E1F743C3FED006339797D8B8B55C DIVG
690,255,136 *474133DED2EB7AF38AFEE84A004CD5E500970F57 dk4s3
690,255,137 *474552DBCC322B0DBBC761EEC2689BF5A5FD40C3 [email protected]
690,255,138 *474C8ED6001127FC7D299395B57BA058DDBB81ED [email protected]
690,255,139 *474FE0D8871065711BC8C92EDA987900F904D1BC DLOHHCIEW.1
690,255,140 *474A3B03407A6AA7A933F072510F58F98E858998 dmk!8
690,255,141 *474845135462B2633EB25C5AB0BDD34949D61765 dnrh3
690,255,142 *474479466CD9166E15E42F3BD920021B38ECF0B2 [email protected]
690,255,143 *47482F048B5F9A10D22F598A5F4D38CD6273A310 DONG.SHAHAN
690,255,144 *4741E5B131848E4DC57C3ED8793EC0508701A1D6 DONTEDEFRIES
690,255,145 *4749631154317DE527C5F4BDE86226C4451451CD doris.sanchez
690,255,146 *474F633FA0D3D98ADDA8D3499D9AA3D52E90EE72 dormer_window-'d/O/rm/@/r_'w/I/nd/oU/
690,255,147 *474735B28BAC0887D8FC02550698B4F2D49E82B5 dp6s
690,255,148 *47443BB86D2382A4667B267EB9025B70A630255C DPYB.
690,255,149 *474121A9DCF879C93783166589B2E1B8A30ECB0A dsral
690,255,150 *474913718EAB83EAF0541907D1EFE81A544ACA89 dth$+
690,255,151 *4741BA56B88080FE464A167E8E2BA319DA9DFC4D duaneshaffstall
690,255,152 *474AD9D953E5482E3CC8822966F48F23DD147D64 dudleyshanks
690,255,153 *474F9A109E2F5EA840FDD2E183E9820962048FE8 DUNCANBLENKER
690,255,154 *474CC38FE61D4CAB60ADDDD4F0412FA281AA45F4 dwqep
690,255,155 *4744FF46E2EDE8208F55457C6C66578A1372FB97 dylanprovost
690,255,156 *474D86042E5C5A16940FF5B5A25A678F05A87A1F EARL.MATTIELLO
690,255,157 *474EFE2C8F78EBDCF75A77F0912B8B7E0E8251D4 eaylt
690,255,158 *4741C6CF9D83672F0C4AF742D5DA68937F660CCF EBOCHAROVA
690,255,159 *474C3F754BEF41F317F889B1FEC4C078766360F0 edl_u
690,255,160 *4747E58D39084A1CB446096C6080CDA858A3DC7F EDUARDOCALWELL
690,255,161 *4749FBB77EFCFAE9BD20C222F3FAD693D6E73352 eee3c
690,255,162 *474F3ECD67EC35F5E90C317108300092B62836CA EFFECTUERONT?
690,255,163 *4744A34A915008537EBF1402B561A92888338B2D EKILKRAL5
690,255,164 *47421A5D8BC19B8C5E4010F1C80DBB6664B59F56 ELDRIDGE.BRIGUGLIO
690,255,165 *474770F9083F6CE5EEBD2D528C85AB4BD316558A [email protected]
690,255,166 *4747FE19DE37A68D95E9C941E069FD0B2223C379 eleksill7
690,255,167 *4742D171E9243287DE433B2EF33C4EAE878E5027 ELFGK
690,255,168 *47467A45B549F0C283B5CCE9C6D03E7C9A4AD01B ELLEN-LEONE
690,255,169 *474F053878DA2A7154401E086032A0EAD61FBB26 elmerlampp
690,255,170 *474CC40D5EA5D8B195E26EE59D3F52FFD4E4BE21 elraa
690,255,171 *474385D1768D377876AAE0B373AE41AC6D636980 elveteen7
690,255,172 *474300E365302344C1A449CE169A787163161D85 ELVIS.MAGDALENO
690,255,173 *47442B4CBC28BED92C0A750CE8EF4CE6904B5827 EMAILRO1
690,255,174 *474C1E634826D465FA34EB3853E87C97DD415F02 EmbraceableYou(featKeelySmith)
690,255,175 *474BC98BA26E4DD667D5642625C570F494DFAE4C EMBRIONI
690,255,176 *474F84BFE4C74E817764620E623AF9670B29AE03 EMQ!T
690,255,177 *4744D6F22687273D2850B9D263325CFF8D449A13 ENTAPOPH8
690,255,178 *474101276F3B4D54E247B9E5654EB6B1C2F52A11 ENTERCLOSE4
690,255,179 *4747786A507579CD23B7C9F3C7549BF8A0B33F9A EPHJD
690,255,180 *474FB20A11B1232250A0071C21A5B0689578E5BC equanils9
690,255,181 *474FE4138B50CA82DDA58AF0C9A21C0058191C44 erichdemasters
690,255,182 *474AC2FFE3490B62E5223A80E502096E8B4C4C58 ERINHAGEL
690,255,183 *474ACF79093CDBDD1E645A10E104594B48A08978 eugenioferr
690,255,184 *474824D621EFB72AB4B7402D28196500E18DB6DD eugeniovaughn
690,255,185 *47401FE7AE37659800398FBFD1554AA53F596F4F eusebiomikus
690,255,186 *4743427F4D9048B19BD1FA6897F0AB632553C715 ew!;
690,255,187 *4740A8004CCFD16FCAA7EE56D529C462DD3D36AA EY7MP
690,255,188 *4741A7AE7BC740E9383F8D71E0A8DEF740FAB9BC female blood
690,255,189 *47488D6CBBCD924E228A38F9C40E71293D329488 fixa813
690,255,190 *47497F4C7F229EB754927B344DA1AFFB19A57610 FRANCESAHRENS
690,255,191 *474C638931117B83DFE15FB75B358284628692A3 FRANKLINDAYLEY
690,255,192 *474BDDFD9BF54AFAA071341FB09AEB02228A62F0 FRØBREGNENEN
690,255,193 *4742B11A4E186EB8A5D60491F7D0D728E4E470C1 FROSTYTOMMY
690,255,194 *474ACAB37EF95365BC6B8701FE896C8BFC2C982F FW+
690,255,195 *4741E74D932BE40C58DF43000C3F062154107AF4 galaxysimon
690,255,196 *47407DD7C9E35BD685605626087B2135370092BE GARRETTPIEDRA
690,255,197 *47444E913849CA0BE6DFE6E802845CC21A531241 GARRYCHURCHES
690,255,198 *474626E13160A68D67B1760A83613D261B108CA7 GAYLORDNUZZO
690,255,199 *47449CEC1EF66ED5E7E681F35D6710F58D45C263 GAZIZIANI
690,255,200 *474AF7A685D41FE4F71E7CE5BB7FA170275EE57B [email protected]
690,255,201 *47402297665AC9C0D699FD11D9A95C1738195DD6 GEFYRES6
690,255,202 *474A32951D65E110030EF3C403B46B9DC40A2FF0 gethehte5
690,255,203 *4748FA9FDB893F9C1CEB88D189E68A5AEA58BD06 GLANCER.
690,255,204 *474372855924C02ED62F4637026562825513A63D [email protected]
690,255,205 *474D3DE628D9E2520C255F8C66A006F66ADEA4AF got=money
690,255,206 *474525E124C2F9AE4BFB5548EB5BD0AB3E06C95B GREINETZ
690,255,207 *47402BA7A84E1900573BECB48BF01B9A9FC28BF7 GWIGO2
690,255,208 *4746A9EF0B0CD80903B6DB1B0CFA29819FECE7E7 <H1><FONT.COLOR="#000077">LOOKING.TO.THE.FUTURE</FONT></H1>
690,255,209 *474E0129C80FACDF8395B23D55B5D09EA7E4A114 hantigerbbs
690,255,210 *47425BA0CF80F93A0C7B79244064BA94CEBDD73A [email protected]
690,255,211 *47404DAE4547F6B006122319D493B9DCFC8EDF9B harrisholling
690,255,212 *474F80DC9EF027AA02778C2E32BCE1EFCD6FE1D4 HARVEYWELBY
690,255,213 *474CF6F49B18BCC58C93CE875A73C735EB34717B HASSAN.TIGAR
690,255,214 *4741903FEC30C5AB6DC7ED98A2635132836F66E0 haydenkozma
690,255,215 *4741B9A5BF413881FDE832308B7BF53BB1876E3C HAYWOODLITECKY
690,255,216 *4748515D1AFE79763AA6727D441CCCCA7A6286D4 haywoodnarain
690,255,217 *4749B3E279070B044944D0A5BE3B6238F53B7ED2 heathwolfertz
690,255,218 *474D841A48AECCB973612B1356331BF447852278 HERE64165203107
690,255,219 *474C7F6C066012E126DD471A65F5A6A8D504F445 HERSHEL.FINNIGAN
690,255,220 *474E9542DAC3E6892C39C46A947B63554CBBD1A6 HOMER_R_WARNER
690,255,221 *474027A399ADB8BAB6BB0E6FDB914565C04FA152 honr
690,255,222 *474FBFE67A7FE9ECB45EA73A16CD8ACDA33F9CE7 HORIZONITALY
690,255,223 *4742922D89012E8F661E304F69E33AF61CAEF8A8 +HR3ADBARI+Y
690,255,224 *4740795D1381E25D804F7E068AF11278667C50E2 href="http//wwwamazoncom/prefacealbum/dp/b000x6s1bg">download
690,255,225 *474547D35696AE9017237336A35D2572B86649E4 [email protected]+y1s+
690,255,226 *47471E165A5C617BBFB37B943D4029F93EB24806 HTTPWWWDIARIODESEVI
690,255,227 *4748CCAEC4F7FC11E4062E83CEECC2FD04DA625C [email protected]
690,255,228 *474E4B90B0BE49BDF603EC78585A3C7BB5C230B7 HUEYPASQUARELLO
690,255,229 *474619A24F4F644B683D03E709EE3A18119C3C74 HUNDEKBPFE
690,255,230 *474DE5896D3A898C70230DFFB237DB5C7A998622 HUNGTHURNESS
690,255,231 *474487E5DA998468F1D8AF4BD875923DC4484843 HUNTER.TARAN
690,255,232 *474112D39FB6256804F8B753CBBEAA0B0703A203 HUSEHREPPING
690,255,233 *4740C633E712E34079772839D103A7E4FC6E6CF7 [email protected]
690,255,234 *4749C8D583D465F0B39F03395C14A0D689DC3EB2 IARENNECING
690,255,235 *474A44F434E241B1E029B449FE176428359EB83F IDEALE3
690,255,236 *4749536A81343692550F92A1D77C43A05A6994E7 ilovejosee20
690,255,237 *47426DF6237503C934A8D8F337C11B8794601B72 [email protected]
690,255,238 *4744AF1A7ABB65F159DFC6081C79A85EE6A88D04 INITIATIVFATTIGT
690,255,239 *474BA3E7BAFF0F22BA10183D63D2B745D04D0D27 INKORTTEN
690,255,240 *474876D72B0E71CC6CE4C5CAF7858985F2F481FE I!O0
690,255,241 *4744281476F8C3A06C29FDE89D528B79DBEDF687 IRVINGONCALE
690,255,242 *474469EB8F67A12229B898BF50414BC5D185AB5A [email protected]
690,255,243 *474E559178D6FF9E2B19FA330F65D6E5026CA11A ISRAEL.CHERRIN
690,255,244 *47445F6E84475EAB0850CA9D3739F74CCA5256F7 ITJIARTHER
690,255,245 *4743FD154180253B4209969CF8EA5A9E718DC02B JACKTEST
690,255,246 *4748C3A62AFF7F3469A7FF320D7D23A507CD1C22 JALEBABE
690,255,247 *4746314B608F513ADC39CE3CC53866C507FF0F9D JAMALESCARENO
690,255,248 *474BE04FEFD374CBBCC0D66E272F3A0809A1324D jamallaurita
690,255,249 *474AD26AAF188CB41E7B0F7ECBF567570E5C8E0F jamisonhusain
690,255,250 *47489F1EDDF0C92A797FFE44620CDFE07800CC3C JASMINE.CASTRO
690,255,251 *4748FDA3C29E12576A78DFE563806C58958F8AB3 jaye-marshall
690,255,252 *474B7F692F214705BCB86F99B0F4357F838536C7 JAYMING9
690,255,253 *47435C1F5DD0D19BAA609CDD716445CDD35AF810 JBROCIUS
690,255,254 *474E67913700B1ABC1B718904B20F527CCC6EC85 JDID
690,255,255 *4747F35594D87F05B398DCC80205438228F0E774 jenniepapa
690,255,256 *47415A24843961B8B09742238AAD6DA3AE4BA778 JETBAR
690,255,257 *4746F3FCB8734C920D663E08B5DA56F1FBE62F1A [email protected]
690,255,258 *47468D8B0F0884D6AC8E8ACA38717E6E08DFBE83 JIJDEN4
690,255,259 *474794A3B5A407EB08A269A1570D7D0699632091 [email protected]
690,255,260 *4740224304D87C867C957463B6F84402E51E8092 JOHNNIEZIZZA
690,255,261 *474E9F0162236C5CF1BC38EE436B32C3DB9915B6 JOHSBURG2
690,255,262 *474D24F0123FE10A4A49D31415AA27114F9ABC0B jonnabor
690,255,263 *474611D8D7B70048025A3EB5B060BF59C37CB65C JORDAN.HERMES
690,255,264 *474B44016D689728460AF6C71168571F93DB76E9 JOSEFKOHEN
690,255,265 *4740F995ED51A36BC68494F6BE7EB430BB0B5093 JOSHUA.CARMELO
690,255,266 *474A8C6368859D20B39BA4B583421C924B281647 jqsuaep8
690,255,267 *47498E467DEA1DF8C8B278E66EA7B2867F9EA273 juliusziech
690,255,268 *4744E8FCE313783D6E3BDC6137BC5E72669D4E4A justin-stogner
690,255,269 *4747AE006D3B331D56CC8080B3CA127CB161E891 j^yn
690,255,270 *4741C6ACD876ABAAB11FA7E3B2054139EA6AFDB6 [email protected]
690,255,271 *474948F4441820BB7578AC8B1C855ECED5692C8A KALUŠI
690,255,272 *474B5A35E15EC01BDAB0B86B401CE99867010DA6 [email protected]
690,255,273 *4749B667161FE4DAE65F15225E0E49B1B0C9E814 karasu123
690,255,274 *474E2873B3794621B5D759203B906B04C51096BA KCKC2:TOOL
690,255,275 *474506A27484FFA726B558D077C8166111450553 KEDONGENSIS
690,255,276 *474DB20A6139424CF46EAE3C44A6E4F4AB7BDE19 KELLY.RATHAI
690,255,277 *474CCAC5FE62BB4A91D1EAE90BAE5EDCF2D1AAE5 kerri-dunn
690,255,278 *47430B2DE0049509DCFBDC4244F313B0D051DF66 KETLANDE8
690,255,279 *474F81175EDCA49667CBDB54D75F9A0408368DE9 KEVINCORMACK
690,255,280 *474F751EE7647A04BBF4620135FBA2E8EB16ADA6 kierwik
690,255,281 *474C23D78BAD06877BCC13CE21E2A4D94573D588 krawallhs
690,255,282 *47408E9647EF63FDB206171B441C57AC59232D5B KRIS.LEMMENS
690,255,283 *47427B95C6FC83EC641CC79C61105B7C989B8B25 kristoferharnes
690,255,284 *474BDDB4DDF6433E0CC841C9342F383ECC07FA56 KS+,
690,255,285 *474EACC8E81606DDA24AAB5FBE32C4A59A485012 kuepeli0
690,255,286 *474B29FB9CD2A3E68EB0167B89F8088592EF3B2D lacysaeler
690,255,287 *4747D14C2BCF4011F43A59350707E7BA25C0F124 L'amour-n'est-rien-(instrumental)
690,255,288 *47475B08945C57AC3982315226232EF892BB5980 LANCEY06
690,255,289 *4747D6E24BA1E1B139D30ECF687C1A9303844353 LAVERNEOZIMEK
690,255,290 *4741552AA0905387402858A2E67C5F96C23BB735 leemartie
690,255,291 *474ED93A2C0C37B05665A8EB9F0035EB095314AC LEERBEGRIPPEN9
690,255,292 *47465F982F418532716284092E7DBA08EC8996BC LEOANDRUZZI
690,255,293 *474A03869D003E8232978901253A838C6AF45BD9 les-ins
690,255,294 *47409D68317869B612EF5465070053E3D798818A LIERDE1
690,255,295 *474ECBF52109BEBBE0A92885BA44BADEB521FF4E [email protected]
690,255,296 *4742A35289AFF6A937DB3EFAA2BC3C22474AF861 [email protected]
690,255,297 *47406D627DE5514C45B5B5D59FA188C54DBBC563 LIONKINGMERLIN
690,255,298 *474F0BF3F28DCB989D7BE2A57EC01C7305C875B9 [email protected]
690,255,299 *4747EB59A2CD59C043649144F6D5A4F38F895E3A lizelletolken
690,255,300 *4741F38EF7383F74FAD93446DE29B91E28A92028 London:-April-2nd-1975,-Royal-Albert-Hall--Part-2b
690,255,301 *474873776E54FA484B1EF788BD6AFA3CCDC123E4 LORENZO.BEEDE
690,255,302 *474001EB1E1EF5BB2444C2E2BC272AEEEB35A603 LOROLEIE
690,255,303 *4744AC9C4C0E0C8160EC1C5D337F1BCBEF8F0624 louiesifers
690,255,304 *474D668CC92254B0028C5D796DC8233AACE2D82C LOVEADAMED
690,255,305 *474201747A84BBF4E69D9223CF70A791B5F4F7A4 ltima.cena.leonardo
690,255,306 *47459BDA9CF9B38BDA7B227F7C38DFAC7BE3FD46 LUCIEN.NARAINE
690,255,307 *4743D3995D5BB5001FF2F554E144732CF34DC02D lycosid3
690,255,308 *4745DDA504125B32AB912FBE89D1A87B2F0261DD M3STI4RLHOS
690,255,309 *474CA9BB9A7F57BC3E08AF4CF0E15470095145F7 MADDIE.MAIER
690,255,310 *474E36E2BD38D10FDF0D20659D2B56D2CDFDA1FD malcompolzin
690,255,311 *4746F5FB532CE0ABBBEA51D22C0130D4AA4B2AC5 MARCTOLBERT
690,255,312 *47452591E2C24686AD4255DF870DB7810EC02818 MARCUS.GRIMLIE
690,255,313 *4740EDC10B0C3F9B93901BD92671B59706108502 MARCUS.PURTELL
690,255,314 *474443E2186E8AD151D7219ADB36FD45DC3279E1 MARIAN-CRAWFORD
690,255,315 *474795AFE8C7A2A018847AB71A13C5FA560072AD MARVIN.YANCY
690,255,316 *474A6F08E85AB053BDF49E2A666920480B6CA2B8 mattiizzz
690,255,317 *474E1B4C3BC96B6CB37D71BD8DFB87F2608C38CC MAXINE.JEWELL
690,255,318 *474A356E0B2C78C3BE09756E1D610C391992623F mc battle (feat. grand wizard theodore)
690,255,319 *474F7FDAAAAE233C6261F596705B469A0D6F033F meghan.welker
690,255,320 *474D9D12A5003B7A47719EC430C38F9197394D85 MELY4YOUBOY098
690,255,321 *4748052A9FE25F740F8278D62A7D8CA3B7F1FE57 memorab1y
690,255,322 *474C66DEDCADD80D775FCC3D18757F4EE644CE6F mildainatten
690,255,323 *4745C1F02A2BB71869C9E6C384466B7568625E59 motet."lux.polis.refulgens".-."lux.et.gloria"
690,255,324 *4743E90F7ECF2336532F229A4FA5ADA188ACDC84 MUBLITS5
690,255,325 *4746A2B8E9B73B2A3E4F0C485E418EED715BF71F MUSKAATWIJN2
690,255,326 *474F1AC5E2A70CAF4D2FFAE30676520D1B189226 [email protected]
690,255,327 *47436C63796D2C747F719F304BFD4B651D6EAA3F N!3X
690,255,328 *4748CD2BE7747D7710C1D7585B76A5FBA9759475 NARITSAP
690,255,329 *474D29EA5EBADC3DAB35B296C1585CCECDEA0B06 NASTAЈU
690,255,330 *474AD9B9A6010F2073544D191B7A619FA824240D NATHANAEL.HEIKES
690,255,331 *4743C614A042A46FB731AE6E8FD6D6A1E6AB27E5 NENEKERTSEGPO
690,255,332 *4746BD249D76054637835936728ACD50EC0E9A9E NICHOLAS MCMILLEN
690,255,333 *474FF914C47C4175D6EA7D6C2FD7A04A2CA60582 NICHOLAS.MURRAY
690,255,334 *47437793182A895775E8EC6026BD5DD7D3CDAAF5 nichtlöschen
690,255,335 *474E4FDDC6085AA276067B41D6D6171D30DC73CB NO-HAY-DOLOR
690,255,336 *4743604C305881137D86619C5DBFCFD899D665C9 NORIVONKOSOVA'-'NORI
690,255,337 *474D5EF2B0A1348746D344F732C5409A7BA11ABC novatiohollandbv|netherlands
690,255,338 *47434331EA071D0D21F120CB863DD889A7176FD6 nurulatikarazali
690,255,339 *4745C24632749C7C36BAC71F7358C41ACE1D395B NUTCRACKER SUITE DREAMS HOLIDAY MUSIC
690,255,340 *4742E8ECD29AA7E2B243E896720036F85690D49C [email protected]
690,255,341 *474C85253F66C96D14A7BF0F13314749527229F5 NWXYZ
690,255,342 *4747E2404F4EFA0C1C842373870C0BFF6D0A18EB O=0AA
690,255,343 *4744A99DD922DCCBF8A5270DABF58FA8D6AC1158 O113995
690,255,344 *474CDD82249792676E1FE9F1BE56EC8732560C35 OBAID-ARIF
690,255,345 *4745E7F3063A4FBE06464C187841548128F67EBF OBELEŽITI
690,255,346 *4747CBFB8A73D42CDD22B44B7B49926D82E76E38 obmutescence2
690,255,347 *4749962F58F3AF5F6F12B039160D0390C3E9BD3D OFOBO
690,255,348 *474D51820F279ADC34AE3DB9B15D032C594DF7D6 OLIN.SCHLICHTING
690,255,349 *47460DF5F59C084F2E0A3650537176154C37E67F OLIVER.NIRSCHL
690,255,350 *4742B5216351DFADAE45F3DDE02D1C6FA74CABEC onkerkse5
690,255,351 *474EE5D34F10E8535E8A24B854EC1F078D00D329 otishulen
690,255,352 *47456C30314931BCBAF00BC0C09127A387D74128 OZ
690,255,353 *474FD15F6C995232E4D4C32A0CB0CFACA1843040 painttheimages
690,255,354 *4740CA20D89756EA75B27754DBF402B79E3C0C85 PAT8XS5485
690,255,355 *474584E76466AD0B5D97181F7E9B1DB2DC2FBFAC PATRICKSCHWADERER
690,255,356 *4746796ACA395B4377EC5823E78FCA5E054B68CB P#####D~0.~O.(-_0)
690,255,357 *474FAA1C16B36116AD7A4213D5132E1EA27FDC6D pemphigo9
690,255,358 *47451F9622B456413ED9599C35B1A3BA0492BA85 PHENOTYPEBOOKSCOUKWWW
690,255,359 *474AB51076FF41A859E8C03D0DB332997B0BFD65 TYHEEM.TANNER
690,255,360 *474F20FF3EEB2A1BDC263A73F8CCB3E2CC48E019 TYLERHEILBRONNER
690,255,361 *474B8A8AD671BAED53540F0D5FEE7BA337AFC545 tymilhoan
690,255,362 *47432817D4612653EC5DC2AF7E31514A474C80DA TYSONCUMLEY
690,255,363 *4740B7885712BEF806C6177F89B139CCA3B8BF8D tyson-greathead
690,255,364 *474C77DC25977CB140FF923D7544C03A1C0F1CAD ükümetini
690,255,365 *474C2EACBDD1BD1989477BFDC15F3CC9C041D9AB UNSOLIDNESSN3
690,255,366 *4744515B6A89B82EAC0E0E36FD77FCA8B035B2BD unventuresbsw
690,255,367 *4743AAB47369B4D703ED5F9784685208CE21C76C 123unionsgefuehrten
690,255,368 *474A0434967B8D4F263B758B9E519B0936840471 1386806 diakuvia yhdistyksen retkeilykurssilta , retkilt
690,255,369 *474DBDACBEFD44011EBA6BF1201E09D0640087F8 1694568 versoehnlichwarfuermichdasteamgoldbeiderwm.
690,255,370 *4741B69E970B93855CBD726D17BAE81C1D048AE3 V121527
690,255,371 *474B7C8BBA28811254C909F33D5610C200FB95DD 1753939 se-on-kirjoitettu-my
690,255,372 *4745B2B8F6EFD7D97C30C5EA195D4BE1007FFB42 1793953 POTILAAN HOITAA SEN ERIKOISALAN L
690,255,373 *4743D4B4F90C354F1FF3A7E01EB727D86BC671CD 1798421 DEN-V12-KOENNTE-ER-SICH-LEISTEN-
690,255,374 *474DFE8178E18EE1C2DA02B945BB72A8EEC3BA84 191288 DIE-KODDERSCHNAUZE-SCHWEIGT-BELEIDIGT-.
690,255,375 *4744EA73AF8CF1566770BAC4F738D46F5DF6D0E3 VALVAISUMAN
690,255,376 *47436C680CF3B898F36D859EC0A0E759D6531601 1ANTIBIOGRAPHISCHE
690,255,377 *474F26CB79594BC976D79B9F1F4F2E0B5C3FA5AF 1ATOMBOMBENTAUGLICHE
690,255,378 *4747E204B4F7FB84EB7E74A3681E3704D6FD85FE 1.bumgarner's
690,255,379 *47452791A25BC78A8606A54B6C03ABC06CECCB1C VAREJARIAM0
690,255,380 *4742C08F1838AB5A8C036421114AD5BB73D54EEA vashish.bowaneedin
690,255,381 *4742D825C083E2B3AED92FB6A492C68A58384FE0 VASPRIK0
690,255,382 *474C3E24E7820E1BA8193FCD732E847AF0BF506C vendings8
690,255,383 *4745EC5C43844F37357BC01ED078E2C91827C187 1GEBAEUDESCHUTZFUNKTION
690,255,384 *474DD9644F6790D2B34323D80E886E9E44669F61 1geschaeftszyklen
690,255,385 *47454370374C1D3BDD0CB82B026A7689A7CFA31D 1ILUVTHUNDER6
690,255,386 *4740C591639C168850F2E2AA268C88CD4E09DEB6 VICENTE.MUNGIA
690,255,387 *474B560FCB8C118FAA512287046AEC7DD322E0A4 1 MAIHINNOUSUKENKIEN
690,255,388 *474BBAB46F7C8BA15A1CC7877A420A843F4CB87F victoriaamadio
690,255,389 *474CE9072F01F8F911A17A66926A82914DFD0CDB VICTORIA-CARLTON-STREAK
690,255,390 *4740DE2D943E12E03B334C7BDD842939284BCEA1 1.marjamaistaan
690,255,391 *474101A8601885A6D50D080B3A778BD1659A2CE8 1.markbasis
690,255,392 *474CDED4A2753B095E0995C63E4F53AAB0C12B80 1.MARKTFEINDLICHKEIT
690,255,393 *47412A2ACBB0BB749D132D8BCC7758E46B2903AD VICTOR-MANIERI
690,255,394 *474C4B8C0ECEA08039C706D9A790BC65E9CEE008 victor.true
690,255,395 *474A580B046A4351B1CD5E9B508DE6C0AB89540A 1 PESTIZIDBESCHRAENKUNG
690,255,396 *4748408D5C1E0F88581EA641049A1C1FD704B0A8 1.POREALTAINA
690,255,397 *474943A0F536B8E2385A279E47263D13B1B2B483 viva.lajuicev.shop
690,255,398 *47408E037C9F024C6D9A8B641C8E5DA1C67F97F3 VIVIAN-PASACRETA
690,255,399 *4743F71F2E89A40B11DB6368D4D29C26729EC618 VKNGSCFF
690,255,400 *474B5F0220176DA242B9A72FF99F9E6D4771C417 1-TRANS-SHIP
690,255,401 *4746A064C0C5E7B1EE3FCFE9469DBC095FB843EF voce.me.apareceu
690,255,402 *47465631E2A3AFBA3215A03E59B4497E15D25396 2000–ES
690,255,403 *474F91E2BD0581B570134F046BF84728AE5CE38E [email protected]
690,255,404 *474F62AA8B95614A6E0F8DA84C143EC0B19F5F2F VSURANT
690,255,405 *4740894134313049C7E56FC38D5286F6530BEA50 V-TX
690,255,406 *4749B9F81F3D257A45AB49CAAA4A8355D7B42979 vzrusivi4
690,255,407 *474939B26B63C6BF8B672F67AA280505C3EEAB06 2410159 ANOMUKSET.TEHD
690,255,408 *474C942ED0F21DBC84F3FF26E93747B3E9A015B4 247Х283
690,255,409 *4742629135C4614BD9D6F9A4E058AB3FA3CFA567 WAGHALSIGEM0
690,255,410 *4747788DB57ECE9A3D9D4F8E8E20C6BA53D3A5AC wai.kit.sum
690,255,411 *474840C3648304B816185A2FB4BD63A527E683DC WALKER.TANGRI
690,255,412 *4740549D903A8F3F32076C67BC5B34E48C2CCF32 2782344 suorakulmaiseen.kolmioon.,.jossa.toinen.ter
690,255,413 *4744E10E6605643E6B1823E9E694818473D28E19 WALLYELKO
690,255,414 *474B19AD837CA5B3BD61501B0D4F966185344B7E WALTERHUARTAN
690,255,415 *474A41B7B379ADB937255681112144B8520EFFD9 2AVATHOJN
690,255,416 *47419A8E6D2AA636F40F07905F484BBDD261C294 war toy
690,255,417 *474EC2D052F592C0C7D15887329467C7FA1ABC40 WDGXBIDFUR0
690,255,418 *4745EDF2E4018454FAE9CBA7BD2F5CAE1AB591F2 2LOSBAAR
690,255,419 *4746FD13D2E3F8E92EEBFD822F0577A48BFF7234 [email protected]
690,255,420 *4741C6B92BF8569DB90C1F6A0ABB030736FA56B8 2.storeandforward
690,255,421 *474441B1135787E254889B001F856C6A42CB4983 2.suomalaisyhti
690,255,422 *474DA1C05A2434E36E663F06C89F85987C9FD2C6 [email protected]
690,255,423 *474A9454865D6A2665538953D8F7DBE2D091CEC5 wesjelinski
690,255,424 *474969E31BA13EE7A204565DA95F3DC22629E4E8 [email protected]
690,255,425 *474B5F04583B7B445E64A96C28853DF77D4BDE8F W`GV
690,255,426 *4741C0A9E11BA7228D0E97154BA0BDAB0C53E3B5 WHANG.KHOR
690,255,427 *474990047144A25D3B6992F6D4F62B1852FB0E26 389072 DIESER LETZTE TEIL DER BRIEFE LIEST SICH BEDRUECKEND
690,255,428 *4748824A41E3A1478C9E6A13DFD18CF5AA55ED84 WHIMSICAL MOMENTS (30 SECOND VERSION)
690,255,429 *4740F766A780186528FAE482A0594ED63267E559 WHOLYFIT-DEVOTIONAL-EXERCISE
690,255,430 *474C654A11619309B1174BCE694437B32CE308A8 <(3BAA
690,255,431 *474ADCF53A8E118247C7A0AC368C1C5F5FC9CC80 WILBER.HIMMELSBACH
690,255,432 *474C9166AA7FF800AB8560A4495A6E992638E474 3-D{X}
690,255,433 *47413D8C0CFFEC668F487E38F7FDBFA4DC8CBE7F 3EVOQUERAI
690,255,434 *474AC657C8D72298B0B13912D7050DDF72BB7EA8 3FIKSFORM
690,255,435 *4749CCC5AB1CE1EF7D89FFAEEDD2C8D83C4B8F15 3HYKKISIV
690,255,436 *4747C3B0B043533181F97F4457E41F45FA254CBE 3jollette
690,255,437 *4743B64CCC9E9561CE63D2EFAFCB81C8C64B8654 3ND0RS3S
690,255,438 *474039FF09835E1C5E29102C2E1BF791DACBBE69 WILLMCFADYEN
690,255,439 *474F1965113437ED141E3DC955601B8AC098DB54 3----p`~;)
690,255,440 *4740B7AD4E1E563BAD6ABAEB48520BF5BB756989 3.seidalle
690,255,441 *474CC85638E730ADDD789BA073FA29056169FB02 3WANDERHEUSCHRECKEN
690,255,442 *474332D5FF0F871AFB33B558DC0355B45D1A38E8 40erzbistums
690,255,443 *474E8FE2F420A1AB5C6C75F7BD9F14ECD2C9C095 wladimir.simosa
690,255,444 *4740657DA30AE90037F62B3C60628A11051655C9 wtam
690,255,445 *474FEDD692E39BBA137D255F3423A1162513512F WWW.BONSAIMARY.COM
690,255,446 *4749D1F873FFC97E6355EFFED2080595A1B0A8EF WWWEASLEYUTILITIESCOM
690,255,447 *4741A5F2DC277E436AC643CC143A45D36A625A7C wwwwhoegaardenbe
690,255,448 *4743EBAA41F9AC8B5FCF0373CE85075B2D8B1F44 4PARMAN
690,255,449 *47499DD30B387B433C50064A1807E0127CB03903 [email protected]
690,255,450 *47403691DD6B2AA3A57551CFFE0968BE392AD84F X630280454
690,255,451 *47487E08AE4378B77D254E557347680F15B1B68D <4R01
690,255,452 *47497D92D62F33CA233C8E71026618868B812AFE x=d[
690,255,453 *474EE2EA4B28FD30038298534DAAF9325808C450 (X)-~`-~`-D===8
690,255,454 *474D72E4996A2E549039E08B13688D7B9D117B44 4UNSTARREN
690,255,455 *474DA207746E21D162C7FE7C59D2CC5255D5F0F8 4UOFFSCREEN
690,255,456 *474B9E9B9C716CF353DC69FBE66B3A118D7BBFCA xj.'
690,255,457 *474104B26A00F2D7BC6D4137E63D69E139DFD36D XM4G
690,255,458 *4749815BB58689FB14CBF25997C3EF79D4EB512F 4YULIYBSW
690,255,459 *474AD438C8F320E226CC130CB5392AA34721253F 4ZAIGRANOSTI
690,255,460 *4745EF8EB4BCF70616E33460A090090120726940 502351 keskustelun aikana ei mielest
690,255,461 *474196C5922F0AAFE642AE7CCFB0496059C92213 XRHMATISMOY
690,255,462 *4748CA5B77BE3B71941F3BC1B4C9C85D8F2838A3 53245 UUDEN.J
690,255,463 *474B9D77DC2FAD5B2B4F102300BE34C1B0259A05 xulining
690,255,464 *474B94BAD0CD43437C13A24DDF4D447F81905D11 5CONSEILLAIENTS
690,255,465 *4746BE78BE2B46A7766A4D8404F304FC9026E52C YEUJING2
690,255,466 *4740D4EC799B67724C02E9B1D852B6C5E3FC6271 YEVETTE BRADLEY
690,255,467 *474A1B9C62CF0B30F8B0CC405CF6022A4CD36E80 5HORMIGUILLARES
690,255,468 *474E164F4121D201776B6D5ECC724F4A43D506AE 5JENSENMILLION
690,255,469 *474E907B9EB0ABB5DDC605339A9B47A06AEE838C YIROH
690,255,470 *47487F1A75EAD4026723D91BF1B3BEECFADE2C3E YLIMITOITETUT4
690,255,471 *474BDB9E9ADE3C8E062A77AE0E54EACD55F647DA 5MYCECILE3
690,255,472 *474AEBDC02CA8E84E27346DEBA29653363B18BA4 5REGLASSLIBERINGS
690,255,473 *47434DB2695E588D563418B60D80011CBA7A5D85 5REGRUNDSPROG
690,255,474 *4747385BB311690EA818D28D1CD9470A917A24EC 5REORDENSMAGT
690,255,475 *4740F420A311442422A68A1CA11A2EACDE0A9CF2 YRALOSAC
690,255,476 *474F19814321F8AA70A6D8502553D3CE13C20418 YRANOITULOVED7
690,255,477 *4746072A0735E6B0CB3BE64BAD2462579128ABDB yughopraseptie
690,255,478 *474807D19D9B4FB01AADE822B8AA3CC4E0A730EC yurie.fernand
690,255,479 *474275465EA337ADFB43E021BC361C64DFDE21EF yu.thinkso
690,255,480 *47422003B20E029046D6FBF4023CE35912F9C1C3 YX"M
690,255,481 *474952EFCACA0267DE19BB93554B7FD676C98A7E ZACHARIAHMATSUO
690,255,482 *47460FF5BAA36A729F4C4BE5AA26E3A201C7A094 zachariahpicon
690,255,483 *474D07D738DB48403034FC6038C0A0E965C66A73 ZACHERYKASSON
690,255,484 *4745BFEE49252A2AC43A42D666B695AA18DE483F zahraahmoud
690,255,485 *474A75C3BAC8FC22CC6B16FA007D5E1880CFB472 ZBIERALA
690,255,486 *4740CE0B81BAEE81011362B248C4E75C19472F43 [email protected]
690,255,487 *4749701816B124BC52E7BB46360783347B9C648D 6idylles
690,255,488 *474A8DFA0B6A8D23A4643DB884FBA06E7A8F98B9 6MYDENNIS2
690,255,489 *474FCE3899F3CCCAEEF6517F1D34D07D26D1D6A4 [email protected]
690,255,490 *474D53693841F8014203CAB17D8718C8B114AF7B 6PCLTRANSBSW
690,255,491 *47448C0EBAF8FFFD507C578B4BCC0E8E17A42509 6STATEFUL
690,255,492 *474B25BD8E6D0E88F07E62186302CB2E26109294 ZYKQECYCZSPUK5C
690,255,493 *4744D058C48E5EFAF88676A63420CB5471BA1C23 7BSWSTALSBERGBSW
690,255,494 *4743C4535B946AFB9645A1BB18501FAAA622D566 арру —
690,255,495 *474EB4AC1614ECC4A85CE3FF27BF9BF106AEBDB6 7LUDICROU
690,255,496 *474EECA1C9D12BCF9D42D54135C3177CAB0188E5 7MARTINSENN
690,255,497 *474FD8DC3BC5EE8FFD0C6AEC7F96D7425245EC22 «МОДЕРАТО
690,255,498 *474DD459C93C8DBB99107CE9079F40B42FEE57E7 7SEDNREPM
690,255,499 *474DE0BC4C3A86D953C3AA133A44CFCCD7C04D3C портинариа
690,255,500 *47490D502ADE6FA2688BE210CA3D29F2BB7501CC 7THATBLUEEYES6
690,255,501 *474FAB15179DF2080B59100D91AB93F9199F4B8F 824420 es-ist-wohl-das-37-.-angebot-.
690,255,502 *474B709D8A145D40230A5641EBF3C07DE5C0F5F9 859839 adi-;-fotograf-soz-kavusmasi-
690,255,503 *4747414A9B7040A999E4EA80D546220B1F6CAA31 、作曲:ジョーリノイエ、編曲:齋藤真也、OS:
690,255,504 *474E946FAAAC9936D4661681FC8F365B0E06AF22 8HORSIFYING
690,255,505 *4740DF3F9EDFB9FC5773B71CB9E2B6E9D6ABFADA 8KNIGHTFLOWER
690,255,506 *474F7B105DD842FB28C76997E3F707E2C0A4F85F 8REGITEIR
690,255,507 *4747BD7D432DC83E13EA97AF569754AD685114C3 8SUURMELKKAAS
690,255,508 *474F585825F0E87DF35718C6FEF19F1426F2996B 946983 auch-sie-stehen-zur-debatte---in-der-aera-nach-kirch-
690,255,509 *4748985C7B1442933DB07ED408F059CDC75BDDCF 962kyleigh
690,255,510 *47419F0E888FAFA35625AE3A7A2E63EDE98E135D 9BSWTIRBBSW
690,255,511 *474EAE9525EAD2EC19481330020AECD0B38A3E3C 9BUBBASLAYER
690,255,512 *474077E0C2FD0A593DB578EC6FEB5319E5C04EC5 0l.aaa
690,255,513 *47445E263B31CC861D0FBDA431724D2C5CE68753 9DIALECTICUSES
690,255,514 *474C45265F1B6D1D94EA42105B86C1FBC543B82E ><0~ @#q
690,255,515 *47440B783D388A163859B81DEAA2AC65705BDD3B 9EADINIPONECS
690,255,516 *47487F45F280678A089F3C6F51B77F068B83991B 0VER57R4N
690,255,517 *474B0F783E2534CF122A5D93A2557EB5430263E6 10000nm
690,255,518 *47443623B1408C375EDC8EE279169A5BE0288A68 9fiutarono
690,255,519 *474B302FB399E1B80B19E8B81BD015F4A3EB40AB 11221637
690,255,520 *474D0B22EBF007D36226868C0ED61074449CE0A1 9KLEPTHJ
690,255,521 *474B7316171D9ACAE9B0AE4A8D243BA996FDF444 9MODELDAEB
690,255,522 *474C7BE768C53FF9DC6B293F6F5AE9CDF49A3D67 1378932 datatroniciitoimiiyhdess
690,255,523 *474D0566676CB76DE724B9F236A1BAFC2C131E38 1395170 LAUTAKUNTIEN AVUKSI PERUSTETAAN ELINKEINOTIIMI
690,255,524 *474C591EE0C9436D32570CF7A23D0BC40D67468D 1440WARD
690,255,525 *474933B53FA73700DE9977559509ED17639135F0 9RAVENEMILY
690,255,526 *4747BB86ACB993DA7F9CF5F78429DAD30FA6BE01 1640714 miehet-pystyv
690,255,527 *474782F6C1205B9B10B06E71AE58FD125F086D5B 9SCHKANTE
690,255,528 *474B49A5CA5F4C8033A7CFBF0B8388D96499F176 a1bh
690,255,529 *474E56344F528308558DF1D2EE58DE0AEE3EBD69 A25567
690,255,530 *474C6AC5896AE0689F71F2798BC59DA9584DC064 a3nwk
690,255,531 *474C4C87B9F8392A88E187765A4FFA7A4D837815 1-eu-definition
690,255,532 *47429762489BE4BD0BE04F85EFC0BCB9F417A7DE A4H,I
690,255,533 *474FDBA4E68A02B54E746A8F14FEA71DB5B236B6 1-farinholt
690,255,534 *474A7F2B72B20D8EB1C8C7EC243A2E24F1B24DAA 1.GOTS
690,255,535 *474000EE8D6213B0879E60351403276F204C10DE A65KJ
690,255,536 *4741ACB340B61199F2AE06527A4603595F1A90EC 1iamdeath2
690,255,537 *474A4F2EB0F0B46A2CDD1D32885973E03097A08E 1.KOALITIONSFROMM
690,255,538 *47454FAE5A8FCE078273CB7706C0425CF7B60DA8 aa3='
690,255,539 *4740BB8F96F6A05D8DA489E9C3B7B95880885585 aaa'k.
690,255,540 *4740A11A652B0E9989BD438740CED64D47E0C344 1MUSTANGKERHOA
690,255,541 *47434B59057D08F0814B39F328D9E8F7AA3A5E3C AAA*SR
690,255,542 *4741C52E46F66A6BDF04E69F51FC2C409F8F71BF aab?#8
690,255,543 *47462F1D95C5A37195EE63C60B7B57B16AEF14FD AAE{9[
690,255,544 *4746B3E18A49061F9AAFC9E10F9757E5EB3D839F AAE#(J
690,255,545 *474583871A5855CE885AE94D4A480A2C227A3C49 1thatmountain0
690,255,546 *47417C44F94D641E7EAD9503E7D888C345B796B0 aa]l
690,255,547 *47401E2F50BE8D0EB0C7C23477E7518D8960EED3 AA#NU
690,255,548 *4748C15703486212446B62C27DEA8B3FE3FD3FD5 1史上最年少デビューを果たして3rko勝利を収め、翌日のスポーツ新聞の一面を飾るなど話題となったことをきっかけにスタートした。
690,255,549 *4749A5460B591149241ACFF589FDD31D49C27DB0 A;BA
690,255,550 *4744E46A87DE1B6DA8A39045283ECB78F8993F88 20KRASILNIKAU
690,255,551 *474A8BDC1BEF7A8FE620D41170CF9A5483DC0DD7 ABC){
690,255,552 *474FFC3BDED6409DEA251393F387F4E1AE0C64C0 abhyashhinchchaanh
690,255,553 *474FEB6F528A335F6D043E45CFCCF8247FB818E3 2381356 JUKKASALO-AKVARELLEJA.
690,255,554 *474E9178415BEBC0D53BA77B7BB3C34266448F33 ABKLZ
690,255,555 *474A10FCDA1900369BCCFC7FE0B6587D24CF1753 2503059 aberplatzfuerdenbauvonwohnungenistrar.
690,255,556 *474F45077A8D714B171E144793940BFF4E7C96EC 2514570 auch-ante-sapina-hatte-die-anklagevorwuerfe-zugegeben-.
690,255,557 *474F2625A47C342665E3147F786DF67D1A134EFA 2563620 pohjoismaisestalionsyhteisty
690,255,558 *4749EF0B8D1BEEED51D5B951887BC8F9D897E034 2603765 NORD.RESOURCES.IS.AN.EXPLORATION.AND.MINING.CONCERN..
690,255,559 *474419D675F122CC9EB6DE1F8DFF6FD32E1913D3 2629016 my
690,255,560 *474BC3564EABB494EB96218B001EDF21993624BD 2696925 sokan.vahva.n
690,255,561 *474F227C2DA873FC80F59C03D4DFD919704A685D 2697314 undesgibteinen,deralldiesbietet
690,255,562 *474448955A984F76978E3C94AA88C4934ED21164 2766612 THEASAHIOFFEREDNOEXPLANATIONOFTHISBAFFLINGNEWS.
690,255,563 *474F81ABA906F9AABF975A818F7D4302608182D3 2903570 LIS
690,255,564 *47477677919B8AB57CE9906AAF850FF2382051DA accroideses
690,255,565 *474D33C4714E1EE2EFD12FAED3FE9C1CA4007F28 AC,P!
690,255,566 *474592F474015BF33504A713B5EE231C756ED361 adanlucksinger
690,255,567 *4746F97C3C8A648158218F968E80B372BD0D7697 2kovulmasi
690,255,568 *474B8EB8706F8E0EC5E083300BBFFD24A9396B8D ADDAMUSING
690,255,569 *47436B8399CEC366BC14C825A6D691887087F46E 2.PIIRAAT
690,255,570 *4746D4C97B8DDBEB2261A8D24C97198235801B61 2SKOTOVY
690,255,571 *474042DDCF44A9632E54D5C3DC374FE360A5FCFB 2-tahtovani
690,255,572 *474CA371605CACAF87669D0E78913356206AF046 2thetheatre
690,255,573 *474D53EC3C254CA2F2CA06935C846C63B5C6023B 305997 meine ganze brust ist verbrannt "
690,255,574 *474B18F861C2C8FC22C60AAF930D85D8B862F5F6 adxgg
690,255,575 *4745D546DFB9A9AE0361E92D0A33AAFBF4AF36B3 352321 su 19.11 . klo 18.00 kynttil
690,255,576 *47403CF88D15644D12BBA214A036CB37D40B7322 aemondimaunahan
690,255,577 *474253E8D562A56077749F92774CD0F10A2550F3 afbqk
690,255,578 *474C1EB36A03230E1711F72CD2EA0A24809F2869 AFHMENOI6
690,255,579 *4746B3C5EBB6C2F4FB0F9AE2704789E401E1566C AFSUY
690,255,580 *47429411F753867FA7E94329D70995DE05511DE6 ağçi
690,255,581 *4740772627213D4C14FE07F66A95C96DCD0F3ACF aggiesbfi1
690,255,582 *4741D08515AFAB13BCAA1A4DD981FB1518DF1750 [email protected]
690,255,583 *474AFCA76BA0B281A11C7EFF78D9CFF9B49A20EA AHMEDNICOLAY
690,255,584 *47423CDC64F4221078047DCE7B3136471121438C ai7q:
690,255,585 *4744F1652B25DC0F9521996715AF0EEF781E5849 ai+b?
690,255,586 *474958ECD79828D3558367FA15500E9C4E42F9EC 491906 uusi-aluejako-on-tehty-melan-toimesta-paikallisyksikk
690,255,587 *47426C556F9F0F2C680859DEB5C442F36C4273CF AI)PR
690,255,588 *4746D16F3C64A6ACC1CF8DD3D83DF00E70C41D68 4IMPERMISSIBLE
690,255,589 *4743DB55EA72301363EF2B4B0B0567D2D02A52DA ajrettek
690,255,590 *474D5678EF33AC1A73E17D547B129E2D16C61335 AjW8
690,255,591 *474AFA55FC56D8BBF8404EA944DAAA2831B73448 4-maerchenprogramm
690,255,592 *474956E298F192FC20B64699EEED3122BD8E74C1 ak+ja
690,255,593 *47433F3D87DE4AE9174A76A525AEC44C253A59D2 4MELLOMELLO
690,255,594 *4746FCD3962C8C735A31405003E66B03F7F72AD0 4MOOREOVYR
690,255,595 *474F33D8EDC6A5BD8256F85E9D0695E80C1FCF4B 4NONMISSIONARY
690,255,596 *474D196C11487725016B8BDD814771E0AD0E219D alanstockhausen
690,255,597 *474E5C9916B5C9A3D29E27718E7C4D23CA7C5FA2 4STAMMKUNDIN
690,255,598 *47400B5AF79460D5133B5C574D40111545E0B553 ALEJA2006
690,255,599 *4743FF1AA53699D261786FA783FF7C903B4C0A8B alexcaryl
690,255,600 *47497C431494179455A1AB80A2675769017E9B3B 4VINECACTUS
690,255,601 *4742680B4DDDDBD08968260980FCDFE8DBA01EFB ALFI#
690,255,602 *474B1C6DD37189292C9A2B7741F67E9223065A3E alleane7
690,255,603 *4742DBD730AD60C886F24F05520F443BE2B0C614 ALMAISER
690,255,604 *474A455023A415063B9CE6FB6043F45494100E16 ALPHADEGA
690,255,605 *474AE479F175706DA94C7A973CB31D3BC28C26A6 ALTITUDES.4
690,255,606 *474E78B56A76DB1BE23DFC43BCBDA39C6C1E176C ALVINBANICK
690,255,607 *4746B27CD1CB139F2CF3B1E7F8694ECBDE4E00D9 5iamobsession7
690,255,608 *4743C35F06C1084457404F929AFAA55FEAAEC89A 5INTELHEIDI
690,255,609 *4749D6E201D3AA16807D4B61AA668D1C386F9F6B AMAZAMASES
690,255,610 *474EA74F2F9574483873281D6273EDAB864644D8 5OKSEBREMSING
690,255,611 *474EA8AA095B823760F41428EFA43CFB5DD4209B 5-PROBLEMIYLE
690,255,612 *4743B51C539E7F07E1E63604C416425EC0C9CAD0 5PTRLMSTLLN
690,255,613 *4741EE38776EBFAA7ABE6E1B67E3C1A88F3749D0 5RIOSIAMO
690,255,614 *4745F0D360E88590BC6EF203842036C8A34E07A9 AN5O_
690,255,615 *474D5161FB23052895436C66043269710849CAC6 5TELEVISERINGERNE
690,255,616 *474F560A01D768159F6A641965B5B214D8F0ACA6 5THECHOCOLATE1
690,255,617 *474175D5C192733CE8BFB3EC3049A2772FA76C4D anb=
690,255,618 *474D52D1D39E501974C6F79AFF7E18CAEDE4735E 6BOSTONBANANE
690,255,619 *4741D11EDF8EBBD9064E79AD4A4C2D18F052AFA2 6BRUCEWEBMASTE
690,255,620 *47441DD24695CD55DB9CF1066040E62DF55F2DC7 ANNU RATHA
690,255,621 *474B945D31A725CB9809366022FA830304336D04 antig-intres
690,255,622 *474FE9D4FE87AD2F9FA1F147529DEF482583054E antonhaken
690,255,623 *4741B6F72F91322A853B89856987CAB88076172B ANTONIAEMBS
690,255,624 *4740595C906EA7CAE31F828102A6950B39346AC9 antoniagroene
690,255,625 *474827690C88B0C5B7C3F107A7847E0155FD34BF 6MARDDEN
690,255,626 *4746441131244BE81745718B13B41AC5A6BE53FE ANTWANROBIDEAU
690,255,627 *474D0228929F95964BFF2E43DC9F087E413D5C94 6MERODIS
690,255,628 *474B4D55BF006CEB8D5FDB7DB3929B71C5921B2B 6myjenny3
690,255,629 *474B82F329B0479848BAECB10C9C1231679BE236 AOZWC
690,255,630 *4747C0652B10464084E14B0441D7D22DA0D49BEB 6TETRETRO
690,255,631 *4740FC5B537867142032733A2C15A9C5A9D5B604 6TWOCRITICAL
690,255,632 *4743ACA2AAF9A5456B0404DCA858C512429477A6 6VERKILDEN
690,255,633 *474DB9C8585534ABB044FACB1F4A48F4CC6D4243 706E79E774E8345ECCCC7ED401793D9E-33414
690,255,634 *474530BD8DA4DDF10D28894D3C7976290745BC95 712OLIVER
690,255,635 *4742FFFF4FC9304024C7D43B355A5135C9C8D6F6 718945 BISLANG HATTE DER AGV NOCH KEINE OFFERTE UNTERBREITET .
690,255,636 *4745DCC5F4AD7072AC18141AD106DA167044D87F 723FRANCESCA
690,255,637 *4740EA45D0C367B580DAB2294059B310BA3DEB1F A"QJ
690,255,638 *474181ED830B5D4965D9D2467BFF784E513FF858 7AGELIKE
690,255,639 *47481525A40B40D26EEE95DBDFBA9CA54D96AC3E archiefonteneau
690,255,640 *474E0B8290976604A47312ED363D8EDCADA21315 ARKANUM1
690,255,641 *474E21AC79557D79194FB6A362063A199E94E21C 7GOALIEACTIVE
690,255,642 *47493DE52C4BB48D04B6E6B58B551AB2CD30AAA9 ARNOLD.WINDOM
690,255,643 *474568915C7035269936F5ED21EDD3E588A3C3F1 7GUMPTIONU
690,255,644 *474C181E38543546BD735CC929C6B55392FFE22D 7HABILITEE
690,255,645 *474A2930AC7271CE95B06CE150C59487800FFBC1 ARRONBOOKMAN
690,255,646 *47441A9572B740992F84CFDF2FBEE2129FBFACBF 7INSANEWISDOM
690,255,647 *4746440BAA5A27FF73BC51470B046B4D126E0E12 7JULIACLASS
690,255,648 *474DCBD385387C8340743C0E7603E15AD7513D9F 7.KAUPANVAHVISTAJALLE
690,255,649 *474A74107174943917F8E5FF0F90CCC5697C118F artillerieoffiziern
690,255,650 *474CF4068A54D2EDB0EF09B51B2DFD2AC32F4583 as=+
690,255,651 *474A304164B9BDAB119DDB7E56D987149E9990A1 ASHLEYDOTTER
690,255,652 *47406D1C81489CE3B2D09AF311CDC07D24580171 7SPEEDOHELLO
690,255,653 *4740C61FB307471B8D5F1C40669EE40F924E0D32 asu=n
690,255,654 *474542965F6D1338B35BE61F70B18764310641C7 ATO=8
690,255,655 *4748EF07114964D5E94F90DE68747E53A04395CB australomyzidae
690,255,656 *474DCE4EEFC8F97BA37DCDF1F745DE84CEF59524 AVENUSZ
690,255,657 *474281CBBE55C1CD0BA1EE44C6452C4FD76E9DD3 avm/b
690,255,658 *47412ABBD3D2177B16621CC2887D3E13E4333E9F AWDT2
690,255,659 *474AE35BBDCE6820169E88620CF1AB3730A4B6B3 b[<
690,255,660 *474D69B3AA45C12588A42812718228F17715BE51 >B0~~Q8
690,255,661 *4741E64C133C8F11E487D9595C14A4649917DA11 B1.G0
690,255,662 *474F8849669598C59E50F126D3C3E7F1B034C4A8 b3rx,
690,255,663 *474649405148B1883183BC9C62ED0CD169F35868 b4mw!
690,255,664 *474AC6E2743A3FD5ED7ACF3333D1EFF3D3285A80 9f1b3be4a82b11d104e4ef7f7ccb1c19 sam
690,255,665 *474FBC5509F7AC79E0A620CA519E4D534F2B6968 B8J?B
690,255,666 *474D47521F932103E75716B3496AD7F21817AD47 9IAMVICKI
690,255,667 *474B48B94C07A8FA1C08A54CDDD276692AFAB4E4 9SEVITACILPITLUM
690,255,668 *4744BB3DDE89DD189315CEFCB248BF3690D9DA5B 9STORDIREI
690,255,669 *4746C9797B619EFC95EAA69D855A729E5132A56D 9werklozenkas
690,255,670 *47498968D02E1D414BE9201FEEF5C2E2DAA44E27 basilsargis
690,255,671 *474B64ADFC21E11CEA04070A57D32C29657D8E61 bawlsbawls
690,255,672 *47448665F2B1E91ABCF49217083E766774579920 A2RVV
690,255,673 *474928AE607DBD720B4155F42C90EF26827F2587 bbix9
690,255,674 *4744E7C14DBF575533B67525B750ACAE759E15BE BBQNN
690,255,675 *4744DFE50F027BB3FB37E254F5AD94503AD0E9F4 A$7EROLEPI$
690,255,676 *474A8B5F82A2C8A27578A71DB7634D9988718D64 bcyi0
690,255,677 *474607D14420590FD94AC7FF16E30B21D74095FF bd.h5
690,255,678 *474C7624FE0EB1ED7D5A3AB63157FE29DFB50153 beatmania
690,255,679 *474E24DD71EAA3A80E9F9FE0887DF659BF5F81C8 aab*5
690,255,680 *474FD73D47C2B60A4AF2141175AEDA70A2165D97 bennycukaj
690,255,681 *4741D1F0989C1467627E63AE5C246C12263A61FA BENUTZERSTADTLANDFLU
690,255,682 *47488C254C176156978D68CE4DC8A35DBDFF9178 bernardkennelley
690,255,683 *4743579E84FDCA8205EF01F409965C1FB233772A aag"!
690,255,684 *474CDB46AC31C58DB622845438FFF34ADE948CE0 AAHNZ
690,255,685 *47449B3CC10017E2AB44EC6752EFCDA4180D7F70 abcdjerry1
690,255,686 *4748FEC033ACC2FA83356B68B125B62558D924E0 bgpd=
690,255,687 *474624D32A3DF5827A9CE3889183C10861B2D46B BHKM8
690,255,688 *4749379A80ED7779468703996D404E785D198B0C ABSENDETS
690,255,689 *47435BF9E4D582DA6B075B9E34CC9EE78B913AB5 ABUNAGES
690,255,690 *47411579B099B4F6141DDF2CDAB67EF108099AD0 A?C6?
690,255,691 *474BF619CCF291B3656E43BD87D8AE1A3FE7DBD4 BIMANUAL
690,255,692 *4747CDE0A8539678A3B49ADAE40C5167A4849680 BIŞENÇE
690,255,693 *4741539ACD36B152F873EAC655704E9F9DD5E4FD ACW4L
690,255,694 *474E4F6B2A293C86521F79CD41FE30501E171E50 ADGJ868
690,255,695 *474A3495CC0EF8F62F0182044ACE3BFB7C744454 ADN(K
690,255,696 *474F1D4AC6B87C60AF1A383F48C39EF8D531054E adt!l
690,255,697 *474B7B215FD4747371A22043B704AFC8FC119A51 BLTT?
690,255,698 *47459CED728DFE2E9215A7EABE7177E19CD5EAA4 [email protected]
690,255,699 *47422CD20DC7C069AA93983EA119CCEF82FE7EE0 bmn3o
690,255,700 *474DC068EEFECEEC2D1480DEB064770F2F3FF7BE bm)+v
690,255,701 *47416CEC67CB43A5B0A94255454EAB935994BAA0 b)my
690,255,702 *474E4FB00486A429463B7F05B964F58E96F90CBE AGNINDRO8
690,255,703 *4743A5380AF9A4425508A5DCAB6D74875D84A460 BO.CRAVATTA
690,255,704 *4747A7F977EF9D497183C629856187290B161D3D AHas
690,255,705 *47457040ECBFD7E16750B83B654BDAFF90B4B327 bonnieb
690,255,706 *4748A7FE94A5AE12DD4C8490CBEEACFC72B2EC2E BOOMING
690,255,707 *474C7030EFD639C6C73FD0420BEF49C4A683C1E5 AH,WO
690,255,708 *474662B447BFB83828555D841E4D560818C4130F BO.XI
690,255,709 *4742256D2B04DEE9C9461C77CE6FDF563A5A329B Bp ~O~o }8{
690,255,710 *4744DF0DF6AB37F9E5DB21419964FE1A34DC0E9C bqmzf
690,255,711 *474A652E0063D47AB32DE53B4BE050F17792F96D AL8W:
690,255,712 *474CC92B0DE1BA449746AEEAA633532A4F06CBCE ALEXANDRIACONGREGATI
690,255,713 *4743595430C1BCB4EAEEC39734F12DB335D5870C BRENTKITE
690,255,714 *4740EDE0E79CFED2EB7AA140D0277706F2E35EAD breskis
690,255,715 *47406787188CA1C78526AE71AF0384EB8B395334 brian.espinosa
690,255,716 *474D9BBC2D58FF1DBFDB9B547A6E7A9D88001BF6 BRWNSBR4
690,255,717 *4746E45F82E6D06A72961EF52A4526AE7014E0B1 ammbb
690,255,718 *474DBA7D8F7207B173424E139274A5D3A9AFD771 Buchpr
690,255,719 *47472D94295C97F7ACDF490B529C0CC93E98BF74 BUDINSCO
690,255,720 *47472CB402725A3A4BCAC3DE81F56F3C0FB44BEA BUFALARANYA08
690,255,721 *47486A921B5F7556D7EB32C5686A56474F958E4D anb=
690,255,722 *474CEB2C09FBC8AFF9ED560E2E6C39B980F9A9BB ANDWITHTHISKNIFEI'LLHELPITPRESENTLY
690,255,723 *474F792B7C76C610EB926C14E62AD67A79E3A785 BURTSTAGS
690,255,724 *47489D8EF26135F33C65CA01252257722BCA0A99 BUSTERDIESTEL
690,255,725 *47400A587ABC8A5BAC09DFFF2435B9BA79E8135F butlerjim1
690,255,726 *474C70FF07B316E5F0C607426F5A47CEAD423856 bvfzm
690,255,727 *4743A628B9D319440B0340E38B67C775F8254EBE bvueg
690,255,728 *47430D7E1767C3FC38C1BE744C48DABEB4D8B82B bwhcp
690,255,729 *4744FE971ABB72A11E90D6C9A78C0F25FD6D11D1 B$XQC
690,255,730 *474B552B1F8F06E0A634523569036E63F4D97C84 c0.s4
690,255,731 *4740625130AEDA3849AFEA213BAD34A46E5AD9CB c0-xb
690,255,732 *474B1A4E6A83EB2A3A782F344EAB2617098F894B AP)KC
690,255,733 *47497D83FAB24C922066350052FA321271E09FE6 c5lta
690,255,734 *4743A26B32E9F47B8BD788E76E45E1EB40C87C8D c5mn:
690,255,735 *474A04D27CAF6BCAAA6C3C42FBEE09129505F63E C5WID
690,255,736 *474A7E643E6D0DB142C83D502ED425D09A190389 C7Q+
690,255,737 *4746E7D05B390D79E2425670124E421FF312C73E arlendurso
690,255,738 *474D5468A6F866A04AFAA7D6BDE3C652B965E436 ARLIE.GROGAN
690,255,739 *47477A7D14BC2AF7DBB1F87F7E59C0154FF7B675 armandferris
690,255,740 *474496B48C9FAC8F4AD9E119B4C89B7949EEBD7B CA?-5
690,255,741 *4748ED8D990B69F2A2C58D9743CC1AB284F0625A ARP"M
690,255,742 *474CB47F47A360FDAA6A5D9EC690816B62183001 CAIIIABEST2
690,255,743 *474958627CD89AEFFFA8373201B21936D0AB9D4F CAMERON.RAUCCI
690,255,744 *4748872D0F0334D4F8F3EE8FC1C7584D004A5F04 as=+
690,255,745 *47409FDDA0864CF3A041809241BE87C1532970F3 canape'-lit
690,255,746 *474E056099AE8F6BC2BBC759E491A9610D203EF9 CANTERBURY-MARRICKSV
690,255,747 *474196C92E226D549A2E3BA3DE5404712FA95445 ASEBACKS8
690,255,748 *4746FE470EE1E1AFA6AF038C0E3350EF0222A6ED CARAVAN (MAX DE WARDENER REMIX)
690,255,749 *474EE5C2A6E63E01831EF8165D75F4AF136901A7 carltonkratky
690,255,750 *4743B4CFD928F02EFF490AB20833C375D2CD9BF6 CARMENMALSOM
690,255,751 *474D68856D289BC336B04884F922D908F24675A5 at7w"
690,255,752 *474BA4411CC760217E77B0765134859E8F78443C CARROLL.STAHNKE
690,255,753 *474FF11BB46CC0477346A4435EF9EDCDE8BDF6C4 atn:
690,255,754 *4743BDA5AA941DE9F708CAA990658A2F2A746396 cbduo
690,255,755 *474574A2C72D07ECC25AC5452394C0133D980A2A Avenger.of.Blood
690,255,756 *47456CCD37906023B0C5EFB59515B91F27988291 AVINASH.SAJNANI
690,255,757 *4749F2C29B9B315D3D2CF58357063648188CADD8 avouches
690,255,758 *474930840B520F420349170AE601E6F4D512D361 a+y0_
690,255,759 *47447FC2B7426AD363C381E24381CBBB551A9C80 AYVK
690,255,760 *474F9F011F378362045B0B270A54BDDF1FEA18BE b2&?
690,255,761 *4740A39E97E645AC078CFCA6484DA892B31C2B4B charc0a1ed
690,255,762 *474BEA3CA4A03707E28B584A6B215E390DEB48F6 b8ddt
690,255,763 *474AD8B8F87B49C8C8C11D7EF799F0ECAC9BDEC4 [email protected]
690,255,764 *47401E69757DBF0CAB3C59444710409C53A4C228 CHESTER.ESTUS
690,255,765 *474A8CAEDE0FAF1D47A23B63026F61E8D0D65C86 bahisti!
690,255,766 *4745E7E4421978653686C642AF71A03C9001EC07 B%aL
690,255,767 *47432964354FF321403662FC22B17950F792F4D5 barbdarling
690,255,768 *474C96D3BCE8BA4ABEC468A8D1D92F2AE49B3B57 CHRISARIAIL
690,255,769 *474E45064BF78D62156B457CCCF7EE62D8F65690 BARRY.FLATTER
690,255,770 *474BB5DBFC0F33F92688D404AF37D4CFB69C1B02 [email protected]
690,255,771 *47464A8DE89D7B0740851C53C0BA39BFBE351934 chuckgoodenberger
690,255,772 *474F2592F1EAA904114E47E8533B7A5479E0B15A b$az!
690,255,773 *47402B385DFA4D7986F4BDDD47FEC6BCBE56F2A8 B:BAA
690,255,774 *4746388432521616719A55E91DB1CFBED05F4C45 B"CW/
690,255,775 *47424D4979D8176A0B10F65516448AEB2660EE47 CK0I=
690,255,776 *4746160CBCFB89CE5FA0AE876B993DF0C7B70F4F CKOA_
690,255,777 *47485EE32F843759556907420E21E8A9F172F8F5 CLAYTON.SPONTAK
690,255,778 *474852E0818B7119B4CB3DBC027B8F0A9E09587E clbs?
690,255,779 *474BE05D70ABA6DC1B5463A1493E9051C5D7A973 BENTON.KOTTERNA
690,255,780 *4742F755E0832A6C8AC207C21F6BDA3E89EB5699 CLOUDBER5
690,255,781 *4749A55002B9A81D11D3114A3AE566682A5DC535 bertmcconnaughhay
690,255,782 *47455996058DAB75C45CE2CF0C9AFFF5C53814A8 C_LRF
690,255,783 *4749B2D5DF0F7E2149C96681E6FCC0C9A8938C1D BHFI3
690,255,784 *47462E24A4483344212EF4EA371442A3118B4068 [email protected]
690,255,785 *47467CF2A00EA83ED2DF9B8F9D92514937654A18 BIC1F
690,255,786 *47423E6B79D935A13FCB73A3951858D7E83A7398 C_OM
690,255,787 *474069C53DD22105B131D85B4B8C2B615EB35953 BISUOHIT
690,255,788 *4748600678C9121BC310017B65BC46BE5BBD7401 b(j+#
690,255,789 *47439D12E8E63167FA351D45FA149A043397F8DD B#J%E
690,255,790 *474C0DBBCF75335855ED4572711604D75A84DE95 BJOID
690,255,791 *4748376ACD46C446443EFBF413029E9E743BF032 bkuh
690,255,792 *474DB159D94FF599FC57BFBE53D5444DFA5791F5 CORTNEYNICOLESMITH
690,255,793 *4744EE1766E8CF82E8EAE1D5F5E07E0AD3536C57 coun+3rf3i+3r$
690,255,794 *4743C8952EC57B9C80B0E9901D2EED76A4437A38 c=p#h
690,255,795 *47459F740F95A277E581D03EC6D3FFBCBE87C086 C.Q0#
690,255,796 *474296E1C3A5AF529373423727B203C1D12DAF94 bo2pi
690,255,797 *4746E65CEE7712B5162CB6E5C9A7AD9663A42693 Bo-F
690,255,798 *4746CD464B0838D68FD9F59F851D3CB9CB01FA5E cr$g1
690,255,799 *4742C0EE6D6404A81E04E34B46CE1D4EAA851E04 crowning
690,255,800 *47414715CB5D848EB0C533E4F4DEFE6EBC3C0D1A [email protected]
690,255,801 *4745D0BF78E98AF7578A4F456D8BEF6AF83167EE boycemarriott
690,255,802 *474EF524D9430D0461C1E6B4D47420F5E26DA2CD csi,/
690,255,803 *47410E7FF9801EB4246E445E990C4DD8E4F52DF2 CSTRABANE
690,255,804 *474F51360424C58B969A22AA434AC2A5E45B0EBA bp_:n
690,255,805 *4740D946172B2C42EBA897526327C71A867087E4 c#t6&
690,255,806 *4742C31131FA8ED423F00B186418ECBE442381FF b###p~oo->-<
690,255,807 *474C6B67A2758E455ABE0CF9C8BEE8F1A2C2CF2E C+TON
690,255,808 *474E2674C1465212FCCDF1CEBA228E0A2579E11A BRADLEYBROMAGEN
690,255,809 *474B2FEB33FEC05ED38C8F0E4B84DB9895C6ABB2 BRAKECOUKBRAKE
690,255,810 *474CFA7B7F54C75166F28636855EFF949BF68B23 curtisbuffalo
690,255,811 *47484FADE00A77CD2119F8DB8514E4934852FEBB BRANDON SCOTT CLARK
690,255,812 *4748FB80BDC0BDE160F09F3959D23F498745C8D7 BRANDON.TOODLE
690,255,813 *474D180220989E837C303117242D8C74F3945D18 BRENTONLAMADRID
690,255,814 *47426BB77B96157C437CA1EE6B61FF10E434F179 BRENTONMOMSEN
690,255,815 *47420FDCF46A5AE3B43CA278AA1FFEE6D24ED632 brentonovitt
690,255,816 *474CCF088C8F48EE03806D0FFDCC7490F14FDD9A CWHF+
690,255,817 *4749E506D01F11F45C97BEC9A3A9D96DEA1A1758 cw$s.
690,255,818 *474B66BBD31432C968C5812EE65942DBCEC117E1 brmw
690,255,819 *474D0907AF248B42BC579C0DD5E85A657C668D9F BRO SUNDAY
690,255,820 *474DF6FECABAF87F5B65BFD30D5F41C2082C9F1D BRPB#
690,255,821 *47476346812FEAC2531537E0E57F09EE388D94B7 BRYT-BBE
690,255,822 *474088932E9B9D75A6915A7F65398244BE5CAA56 bssw,
690,255,823 *47443E143308A33694EAF0E89C6BE45C773FCED1 bt1es
690,255,824 *4742BD9286A462B1E97B6F04133DB66DB3F16F76 D3W&V
690,255,825 *474E7D4676D6678D107799893AD12B24ECA34AB1 BURALIFORTIEGO
690,255,826 *4741DF34E971B952F3A57A6147812E95167C2E65 D6P+A
690,255,827 *47453B2FB9BF4469CC8F59C30F7A6B180017A3E6 B"UTH
690,255,828 *4743CF16106889083D30BF776DB7FB2AC4C8CE35 dadpg
690,255,829 *4743B60D84FFAEE627BE99D6BF6C1C03DC2FDA70 BYRON.TROCCOLI
690,255,830 *4747AB90D4031C0F0E86BFB2CE631DBE2DD7FD8C [email protected]
690,255,831 *474368CAEDB5BED18435D650F30D101DC62E38F8 daniela.izaguirre
690,255,832 *4747FC3A972C49C756BF81FA835C912850AD24C1 danielkhauv
690,255,833 *474552BC5AD95BD1891103AB90006AFE8FD059F2 daniellevoegele
690,255,834 *474093A50EE26D4A4B0EA2D88537A48B9E48B8FF [email protected]
690,255,835 *47470D58A20FB3C047ECCC74AD98A4CBDF3DF336 DARIO.HOLK
690,255,836 *474912BEBF26EE989FB4CE100C50F7BC37E9575B c2m9-
690,255,837 *474DEA28C6A7076B341EAE311DFF31BED6C29F97 C3C_K
690,255,838 *474CD19335D076A9E17336753250F5C939911C30 c4jr(
690,255,839 *474D5F24B0B6FFFE8D256DAD4F0468EC7B7561F8 DARWIN.CHELLIS
690,255,840 *474C5EB2054F546B8AD845A288BE92B97A44398B C.54V
690,255,841 *47455F7D98D1DD1B435A6B0BBB309A79F42C3ADF c7?wv
690,255,842 *4746E32DE168E75CAF672BF9DAF0EA58546DB39C c95#j
690,255,843 *47493C9BE202514F72D679AD0475A7D3A6381E59 DCHQ
690,255,844 *474CBD96CD664272F5E6A390A0C5B07271E112E4 DEAO_
690,255,845 *474989753AEB4E8711772F77DC313E90E4055894 debiting
690,255,846 *474112A4B491BFFA667630365385EF5D8AF83FE0 CARMELOMOORES
690,255,847 *4744EC3A41BCCA3538B058BBAC3CF3036E0787D1 CAROLYN.FOXX
690,255,848 *47459AA43043A5A8ED3C666645F97F31A3C0C076 CAROLYN JEWEL
690,255,849 *474F8AC6EA902CA3847F132DB40613E3D1C037CD deeper love (drums of life mix)
690,255,850 *47425FF23D10217366A0BC6D218A748E62C0E3EF caso
690,255,851 *4743E942FCB4BF1F47350DFFC5AF3CBAE888C0FE cawdq
690,255,852 *474BED8421B73D0E0C1AB18F6ABF0FBCA93747ED DENETRIA-WHEATFALL
690,255,853 *4744A682E24B334E8F416CD1217529B923496A90 C.B.C.
690,255,854 *474592D1D1341D5CE8ADF6BF6F75E899CA250B95 DEOXYGENIZATION0
690,255,855 *47470890EF4FA54BC00398E8AA563A3C430FA40F CCTOGONES
690,255,856 *474F6EA0473E41CC5EAFE51D10996C03E958E615 DerLiebeswunsch(disc4)
690,255,857 *474F23ED5D1A9CD8816C3B7901C4E18754EAB1EE CDBVN
690,255,858 *474A4B0937E855880C0D11F8B31DE31B80EFCC38 ceb38
690,255,859 *474FB4162772113B8308ACEC95963897CDED8C2F DEVIL FLAME
690,255,860 *4740BFFF8C2E28E79ABB6338D1E32D52B62B2B76 DEVONBANEGAS
690,255,861 *474930714DB9FEB63B7B8510A3A6C004E6F67DAC devonprospal
690,255,862 *47427D5DCCB36CBE1E712181C58F4B040BACD17D cek$g
690,255,863 *474487EE6E7B4323A9A07B899286B7763264829A CESAR.MAINERO
690,255,864 *4745333CFB447B09C8A3C3BF8319A26899F063F7 CF&DP
690,255,865 *47484EA55597E2B08138A717CD845D2F406EE975 chemcraft2
690,255,866 *474A1F4D2295F2B6E80FA40DE2E6758E5084F5DC CHEMIOTAXIC
690,255,867 *4749E8AF92CDA5A102A2B4F1E8309C8353A3A32C DIQY:
690,255,868 *474DF850D836DB222C2BC5795FF4A2F00D6BB222 distinctlywaldorfcomwww
690,255,869 *474B39A081F13050E9B38621E0842145A4AB3E65 d-j#4
690,255,870 *474EFE0A50B2950784FA0EBA09D9436C1D422F67 djcvu
690,255,871 *474BD97C64C274CC6C3D545145427817A9E0FD37 chrisvascellaro
690,255,872 *474D12231B5C76DEDFD931C6A809B96CCC80BE33 CHURCH OF THE GHETTO PC
690,255,873 *47449C85BC65C4F51C5560052AE9DD04D652EE3D cjl&p
690,255,874 *4745FD97730E4C4D35B9631D1125C564B69A287A DONBOOTH
690,255,875 *474269D655C47D1E4E3DCEC011E92B52295BDB06 CLEMENTE.HODD
690,255,876 *474704EFC056F76FC6BCE8BC423842CA1943870E clientblocking
690,255,877 *474FCF15B9E3E720510BC0FB2D5787FDEA4FE5C4 „dopracować”
690,255,878 *474D79D0A00B6B780703468D4FC5CF7A1278C7CD CLINT.BULLINER
690,255,879 *47444F1989F7FC05A3253CA69B19A27679B52B73 dougdrummonds
690,255,880 *4748DA98EA6280F98A14AE112F1C126B6AB85871 DOUGKILLGORE
690,255,881 *47473E290135F64674C96743F2CA663EE35A4F8D DOUGLASBIGNEY
690,255,882 *4749B9920FF88A0892E5EA889863049A0DA0B816 c#mt
690,255,883 *4742670996AAAD0C30EADDA8D46A984D9EAEF8E9 dqcc.
690,255,884 *47431F8B937034BC7671F29FF56B67FADE68129E DQha
690,255,885 *474E0BF814F619E8BD48D90DD75C3F0D6EFD6804 COLBY.HEWARD
690,255,886 *4745F94B8E6268AF41FE5B97B50FACFA6DB9C55D COLQUOTATIONS
690,255,887 *474525E9BB57B67ED3D53B56F190C52B9363F118 DS45
690,255,888 *47420F8D8A1622FB61C973E64899D179011644E7 DTHORLTON
690,255,889 *474874E68F90839E8BFE4647C24BB27623F4A601 dtsig
690,255,890 *474557011B5BDB4C59D27FCC6A664EB3788C5C85 DUDLEYNORTH2007
690,255,891 *4745F5D681AACC68246C856BDC00733A0B459AAA dug
690,255,892 *474726070BA042D546588618985E4A66A3BE1DE8 couleurtendresse
690,255,893 *474436443B31B391E7C3BFF0781E901070E965DF courtneymarr
690,255,894 *474FD22AA702D7F7EB683046E78E2048BF2E6CBA COYRONQUILLO
690,255,895 *4749D7470232474F33187B0224550E04F1A19291 D#+V+
690,255,896 *474FBCE5B6C4068506E144E7C35C4C48B0E40FD4 dz-:6
690,255,897 *474A649872B6B45452BB4C637C88EA346104D86A dzq)
690,255,898 *4741BC9551776341455B48C45B802E607C25456F ÇUBUKCI
690,255,899 *474884EBA7C145CC429238E9516790A4E6F53192 [email protected]
690,255,900 *4741129D69E04801A42BF08EF3F06AE52868A322 edmondhollinsworth
690,255,901 *474C456399163FEBD823FA222FAA9692E7C9CA41 cx%zv
690,255,902 *474D7DD767D41E123017A94729A6B2955892D38A cy6k
690,255,903 *4748B75B2117C3B5E784C5CDE56DAD85FDB37513 EINBII
690,255,904 *47499A61A5415F8DFE94E215EA581794551B2289 cyrustrivino
690,255,905 *47479210565F8CFF3C63FEA99D43F2162C0A259C cysgodol
690,255,906 *4743C5D016C03763F6AD9B4C07007A2358F1916C ELDENGAUDIN
690,255,907 *47477FCBB8494477C010C2E76F363AA9638B24DC [email protected]
690,255,908 *47472F5D59F7CE91C0BE4D5B22D7C6B81DBC5495 D"2M3
690,255,909 *474E0DE290FB3D08C199B4615BFD62ED1A5F3CF3 D%5
690,255,910 *47404D309062D968F1C07E84D01EF1D0E63CBF09 d8f-9
690,255,911 *474604AFF5AE798BDB819FDDF11D7FC6EEF8C146 EMAKASUUDMED
690,255,912 *47489BDF54324864B1FFB4E4D214A4E88C278F0E EMECNIRGGING
690,255,913 *47421E1596753E76822B5E9FC5FD5DD0A0215463 DA13
690,255,914 *4747D7211E9B2A9D31F067A16B26CA788DD12ED0 EMMITT.ANASTASIA
690,255,915 *474CEDE8873FE3C6E7D8549EF7C64DCEBE5C1886 DAKAYZ
690,255,916 *4746E98E3202B4D9C076D945BEE6ED1217437747 EMSIHTILED
690,255,917 *4746798BAF6E0C22019F61DD0629A3BF0D8B85BF en3sh
690,255,918 *474C94273596034A60D3B07FA566E591D71DC130 EN65105106X5
690,255,919 *474E73CA858BAF3B3B2DBBC67096BFF165D323A7 DAMIEN.KERN
690,255,920 *474E333071485C09E6A8CFF38474B344151A1011 Damoetas
690,255,921 *474F81D1CE604020683627ABBDF20AEF3EC69DF0 DANIELEHLE
690,255,922 *474658AFC617CA6B3D8123524EB699D8D3EA2175 ENLUTEISING
690,255,923 *4740AA6D0A556B8528671E7994ACFD0C5DF81527 ENSINGS8
690,255,924 *474D76A13030AEF1B62292C33C46574AA4DD432A ENUSER762236184
690,255,925 *474EFBE4A6C69C38AC1797DAF0F6AAE7316E7C33 DARRENLIUKKONEN
690,255,926 *4741F1E9C3AF3E54B912AB58FECF426C28058A36 DARRINBOWLER
690,255,927 *474B90DE1BE4DE24398B4DE49AAE7161655405CC EPISCOPUL
690,255,928 *4746B87A1DFE4FDA0B41AC16E730D12C0416A07B ERENGISLEDOTTER
690,255,929 *474773A21D86090D513B8679E1C9BE316E263AB3 ERGR;
690,255,930 *474113C169DF00EF3272C3565E4334CC7DF645A7 dclssrsed
690,255,931 *474CCFFEDD91799D9CFB3FA9300372F66A089A84 ETHNOGEOGRAPHICAL4
690,255,932 *4745CEDB5995AA0DF2889B2463944EAD79B7F962 EUGENIO.FUNCHESS
690,255,933 *4749388F0A70E566DB6FD6B99C36A610F34F3FBC eugrondwet
690,255,934 *4749C78A63A3F6F05B5743EEE5EADAE321DBE6DB EUSEBIO.MARTYN
690,255,935 *474E16496599ED781B01991B9922D78B65454F8A EVAN.COCKRIN
690,255,936 *47411CEE49F3721B38378CC0ADFA4064A245156F EVANGELINE SALVATORE
690,255,937 *47488616747053E72B17CE422E25F651DA5AF28F dekhtiarov
690,255,938 *474FC294404FB20E9B5C417867CDCE871DE6F379 DELETED-FUHGHETTABO
690,255,939 *474689C6817DED0F7376345164E427374A67EFA2 every-man-out-of-his-humour
690,255,940 *4744CBAEDE1C7DD4A1CDB3FD631895D6E1BD6542 DELMER.GEIDNER
690,255,941 *474478C050E350168A94F47C5E483D06280B8D1F exoe
690,255,942 *474B391DB37F6F688EBB504A1FC94AAF2ADC1754 eyc$?
690,255,943 *47452AE26861878AEC73B79EA2BDF749A4D8EA3D EYNTN
690,255,944 *4744B3EBDEAAE3CFEB7BE2D79BC6FB2DD7A7D6AD fac1117a7es
690,255,945 *474585CB926725753D7128596F506C56BF3B08EE FALLTHUIS
690,255,946 *47471B8059693A3846A9033FDDDC9B642EBA8CBD DEVOYESES9
690,255,947 *474BC6612B5D5DE65D14933881CBF4B99BD1FDB1 fcassine
690,255,948 *4747AC4F495F5CB7D821A4B255662C5112FDFBD5 fe'6
690,255,949 *474EAA8541EC2AA3EDC5208F23E48F056ACC8E1E FENGTANCHI
690,255,950 *474FCF894B1C8EE74E98B72E5DBBEAB8952BFD1D DG3T3X
690,255,951 *474333E997D9DD7881925688D2ACBBB0414282A7 DG4V7
690,255,952 *474A8D27FCE3E9536CF957D2CDC838EBDD3DDD0D FIDEL.BIGDA
690,255,953 *4746A834E5E1B4059EBD70FBF3CA8D0FC2629FD3 [email protected]
690,255,954 *474CB521198438AE4D64423F83CEE54702E39B4C FIREDNCR9
690,255,955 *47423FCEAA008EC760EAFE3765D165D3A1D2DB32 FIREMANINTEL
690,255,956 *474E40ADB77F84F7A584242F39826F2703D68543 FLORENTINO.SARPY
690,255,957 *474EEB17069D100BD4FF71F5734315557882C005 [email protected]
690,255,958 *474EF599D977F0CD159EB826F7A6CCEEE084ED41 dinoandre
690,255,959 *474717E644A50D664FAFD5EEB5C9F0F8ADF7283A dionlarbi
690,255,960 *4741DA2B337BD8C116426ABECB202B4DC4E06F77 FORHEUR
690,255,961 *474FBCFD205A17C5067A68D93EE2D7662BD8235E For-Now-We-Trust
690,255,962 *47410D54B0BEF65AA55282E8FB1C53944C5D8A55 FORREST.CHURCHVILLE
690,255,963 *474E72A2367FB3F08E61AB98CB79FF0141E591EC FORREST.HESFORD
690,255,964 *47418136C9DABDCBF1E107AB31193CE69A208FA7 [email protected]
690,255,965 *47414B6F2BEA9385A01B9762A85BF9672FC2C3B7 d’ishak
690,255,966 *474B4C37159BF3E86F4A8F3F1DC18B775D4AB4A5 DISTRACTIVUL
690,255,967 *47465AD809F5C0CEB610536E0AA555A51DFF9C83 DIVG
690,255,968 *47483E262E1F8CCABAAC01925CE516DA53F0EBAA FRANCISFIORE
690,255,969 *474E4F897640952D1618C384F6074800301D4318 [email protected]
690,255,970 *4746A27AE5D44AF141A2A3EFB104D293E7404F32 FRANK.HANNAGAN
690,255,971 *474CFA6C68DD5A6C89276AECEC245F392E9047FA FRANKIESHUMSKI
690,255,972 *4742B1103633CBF19063CFA8C7B9EB003940E57D DLHEY
690,255,973 *47479853E48329D4E700E6FB2AF991502385C2D7 d!ngh!3$
690,255,974 *474DCB82BEAF5B4CFE0DA47B7C2EA7673374CBBD G4$+ROEN+EROLOG$+
690,255,975 *4742BB2717015E35D2AE644EFDDE251AEA41E1E9 D?NLO
690,255,976 *47422E1DF297BE0B539A22FA6B876EC5CE629B95 GARLANDSHIMA
690,255,977 *474A55CBDE7DF6E76F5F39DD35C25334DD35B43D garretnasuti
690,255,978 *4746C81B704167343532319E1D269C63A6A16C44 d,on(
690,255,979 *474133827FDE1100F032EBFDDDD5677E27F6D40E donnaashleys
690,255,980 *474C6C7BE5538AFD5C443533891885D2418874F5 GCCCAGGTTCCTGGAAGATGAAGGCCTTTACACCGGGGTAAGACCAGAGGTGGCACGCAC
690,255,981 *4741C0A06D6047DE9291D01C3084784E8C70E81A GEBRAUCHSTÜCHTIGKEIT
690,255,982 *474A616DD731C98B8B104539FAE77F9F3FD3A029 DONTEOAXACA
690,255,983 *474E75F64E6FA836789F5197379FE7A7409E2D9D DOPANTN4
690,255,984 *47463E1EB56A08E6C61B40342D635A9A87C06F33 `gel*rob*.
690,255,985 *4740E582DF6B52322725DE8BB73D164C15186056 dp6s
690,255,986 *4743449182606360D563D092B497446E042CB74B ggolden0
690,255,987 *474DEC5E715018346B41BB62D9F6F26F77C08EF3 DRAXH
690,255,988 *474FC8C697A38AE85F528AFC0D708359446ED64B GLENDA-NORDAL
690,255,989 *474BDF3BC3C93E9047165AD73D453F349FBAB190 GLOBAL.UNDERGROUND.001:.TONY.DE.VIT.IN.TEL.AVIV.(DISC.2)
690,255,990 *4745549785B8DDCB926607AB3EB70B3E7DB3A2FA glower4
690,255,991 *4747EC319B02B7FC18217B1B30A82D7C88594830 dr(/u
690,255,992 *4742FF98F9AB898AF4E0649D3AC786147604D061 [email protected]
690,255,993 *474D1663AA28B798527EE3D8C85EAAD9412C9F69 DSCO7H3QU3S
690,255,994 *47431FBC21BA1973CE3F7C6704AC38F2BEF64A65 good.god.(beat.renegades.mix)
690,255,995 *474E30A372CEE269E9116E44FA46206816483201 Goos3-ski
690,255,996 *474A46B443D19086D394CA674B279696CC1F9256 [email protected]
690,255,997 *47479F87F653A42ED58BB6DC7B91C94142C86178 GRABBINGS6
690,255,998 *4741190275907002D3983F8E2415E3C2B49030E5 grangara2
690,255,999 *47460614E2FD5C7D44CF5B51ECD5676E3A3CF628 DVOUVÝBĚROVÉ
690,256,000 *474D29F9847E37B142ED472F971B9EEA4A4AB024 GUNSTBEJ2
690,256,001 *474BB94DCD3BAED20405E2737502978034A450C6 E145247
690,256,002 *474F20FA53C2BCDBD3C88B57DB99BD48269D5ACA Hannibalwasaveryprettyfellowinthosedays.
690,256,003 *47455366A33A887D1714A22E22BE7B5FBDF061AB HANS.BRONER
690,256,004 *474C788BDD823BADA87B80CA3B1BA3474B3CFED4 eah5c
690,256,005 *47407C6B8367E7312B39754611B179FEF71137C5 HARLAND.WENRICK
690,256,006 *4741623150B70CBB80A19B0DD72675E5B555C5C5 [email protected]
690,256,007 *4742F2E3DA363F0F29CA51D4F0612691EBF22758 EARNESTBRODT
690,256,008 *474B9CCF22E91212F97829998C8455E329FDBEB4 HARRYBUI
690,256,009 *47446D77FABB3ABD2F8BD1FD56EB654AC82E692D harvey.winters
690,256,010 *4749B6372E7A623B3FDC730DA6327D28F51F2366 HAUKUWA7
690,256,011 *474B98D8A48D63D0B0CC82F876064F8DE811AB30 E BUT ERE WE THIS PERFORM
690,256,012 *4740D8C58CC7170846ED9B4FEF5E9590804E7390 EC.J
690,256,013 *4746E73FD79CA9EF697EE2F4B82D1A9C1E98F401 edalevraf
690,256,014 *474F6721000B46DB239231A03FC89D0858A52E5C EDISON.LAUTMAN
690,256,015 *474716DACBC311C0BC0A62A75B08D2A62EAF4E37 EDMONDBUSE
690,256,016 *474F61C4C6479560BDA387373FA71007CDF0E20A EFBHC
690,256,017 *474483FC5DCF6E4E15A2D36143209A54F8F22D7A HIGHER-(FEAT.-JANE)
690,256,018 *474B56CAD5F9E1C5B947DAF38ABCF4B302132E28 ege_6
690,256,019 *4748E61227B297B904E98B6148DB1D03114C4E94 HINGASHI
690,256,020 *4745606D36DCF8DDE950034468902840C6CB21B2 [email protected]
690,256,021 *474DE4D2464E892224C5D1CCE4372244BACC1A65 [email protected]
690,256,022 *4745D6CE78ECC5D1CE3D612A6DB630549E9F6DDA HLOFTET1
690,256,023 *474FED5CA87F33D45FE7C273E293EB5E350A2EDE eine insel f
690,256,024 *474CA26F7E4033F71EE997C3FEFEDAB723B5730A hoa*
690,256,025 *474EF29EE565AC4543A43E306924F934AF8A2DF7 HOKOKUJINJYA
690,256,026 *47474066EA558E5FAB3D137D458C9956F2036C10 „HÖLLENSTEINE“
690,256,027 *474D2419837CEBFEA765153B2C3232438D7909B3 ELDRIDGEVONDERKELL
690,256,028 *474CD13EA0C1EFC43E155BD9A56BAE9E9BEC3E45 electricscotlandcomwww
690,256,029 *4747284FF7F671DE642C49E146A1E17CED710325 ‘housemaster’
690,256,030 *4744BC6A9ABEC952B6156F449329418C4215AB79 ELIJAHMAURIZIO
690,256,031 *474E7414BD9B4E3B06F6968F52402FD9DEDAFB43 hstucken7
690,256,032 *474B69F6640F6BD651D630340933A1C44ACE3BCF EMAXWELLED
690,256,033 *4748918DC923984AADBBA13735F4012C4F847BAA EMBRYOLS5
690,256,034 *47461551C17BFA41F02831AE0C0BB09569CCFA91 HUNG.SELVAGGI
690,256,035 *47401F817F11D6A38377578F95BC72E976D4C616 HV1WSA
690,256,036 *47419E92F08D726EB785E17567EC188F7EC29BA6 iamhomebrew2008
690,256,037 *4749DC6D8F51F8C4B5BC115B25AFF8D2CD42D5BA enirgit3
690,256,038 *474F17CB3F9A1D1EACD765C27548D052DF069170 IBMWATER2
690,256,039 *47407F1F264C6B7AA5ED1BA22671A0B5FCB2DD5B enntnvickelnung
690,256,040 *4747229EFC72B0DEDE371286F06BD841C1855C82 eofbh
690,256,041 *4744D265CF4C881E50E88C4C5913458567A6FECC IGNACIODIGENNARO
690,256,042 *474110B5ECE22C2BED410BE9C758490743B4F8AC EPBZ
690,256,043 *474CE2945E7A38ADE70783EE0228BF1177A2A14F ILOVEREDWING04
690,256,044 *474B7AE6631E393E4FE7CC1284B401360190E80E ilovesteve11997
690,256,045 *4740B7599AC3E7B30E1477CC5355CDC882642C6D error-handling
690,256,046 *4744DF0D4348604789FC7A91CAF8DE49E8DCC0C3 infracephalic9
690,256,047 *4740E2190BCD308A6163A4D129F5DA08A5FD910D EUSUF
690,256,048 *4749126A584AFF5F1E9B1CDC1FCC3A316A425DE9 intryckens
690,256,049 *47448E5C0E23C561324D599814F27156A1324902 IRABRITZ
690,256,050 *474EEC6EDCF01E9EDEE7F66834E6CAEE27DDB3F5 existdr
690,256,051 *474BD23874E266B8AAC420DD124E5C40D58C35AB FATE'S-GAME
690,256,052 *474BE5B5844FA1A23D0B6B2450E0A3218CE5CE1A fatuousness
690,256,053 *47401A46E9C9D490F4DFD92367684B73111DA580 feeling.u,.feeling.me.(interlude)
690,256,054 *4747F133C538D9569B23FA914EEE9FBFC0972B7F ferdinandmcclanan
690,256,055 *4748BC510EA74C6BFD1E66D0E998857A2564CA2E FERDINANDOGUINN
690,256,056 *47423C1EC01FB5985C637A9A57AC66A132552848 JAMAL.SCREWS
690,256,057 *47447B353CD56CD488F28039F24891683D33664C fernandosorstudiono23ingmajor
690,256,058 *474D56F80D9E39924BDE3C25D3CA3D0D223D7394 FERSKVASSFISK
690,256,059 *47470423B826D01C71C6339B52B71FF9811ABA4D FGF6
690,256,060 *4747B56588C3A7AB4DEDE7903B810C894E7BFE5A FIRANJI
690,256,061 *47472A4D79AF5A67F322397E2ACCD9A02006B21B jasperrusak
690,256,062 *4742FBC0E5946600BB510011725C193EC2BCFB4E fl?
690,256,063 *474684FC1914E81A34F2F93677CD0A11A82020F5 JDUGGER0
690,256,064 *474FF850A7540FC495BCA29596CD4B40D105F676 [email protected]
690,256,065 *47407C47B66F2FA64330F20D830E57549C0AC9BE JEFFERYMCVICAR
690,256,066 *4742E3CE86DA1373F17F86596B421555B1C7F8F1 [email protected]
690,256,067 *4745E8EDC602EDEECE9CF11AD7D057E1E2DC99BE jefflasserre
690,256,068 *474451BA7E40C8A6A91AC03BC8A0EB38B3A3D77C JENAGHB
690,256,069 *474FCBFC916F00AC76D62082980BD8567F675BAC JENCAMPO
690,256,070 *474C2383829FCB6BBC5936A8173396CBC8589A03 forget-the-traditional-buying-or-selling-a-web
690,256,071 *4744EF177817BA6A5EBC64194AD73653200A8A2E francescoradue
690,256,072 *4745B522A31982C460BF7EBA66558AEDF86BBCC2 FRANCES.LOHREY
690,256,073 *474F3D560EF1468AC35749D17BD6B6BC759BF088 jewelsxxxx
690,256,074 *47402C7634E8E9641EE9DB850B79198AFA4CE5B1 FRANKLINWESELY
690,256,075 *4743D75476321C90A0DF47CA5403860D7ECD4E08 [email protected]
690,256,076 *474286939C0EF48C407985069DEFB91C7BDF835C J|HU
690,256,077 *4749CAE19C444B3379B32DB5B9DF079146C50CAA [email protected]
690,256,078 *474B9B4AB63A4F15AD4A57CA75F71187206A40BF FREDDY.PHATDOUANG
690,256,079 *474E73334AE1FBDF8DA94A7B4077EE25A7FF9109 frederichasychak
690,256,080 *47443BBE5137F988E78F56E2677DE649F4301980 JIMMYVOSBURGH
690,256,081 *47495261E4B86DDAC7C8B0EFDFC529410B0F8DCE jjv{
690,256,082 *47475E05AA8B37865420A6C156CEDB58F3E21C8A FUEGOSFATUOS
690,256,083 *474B1E58F78068DFE019CB43A769481579341EDB Fullyintegraed
690,256,084 *474345A4804924F64DA95B5CFEF0F94C99B9E51B JOHNNIE.BELARMINO
690,256,085 *4744824F376ECAB3BA9A0D226CA273DB8FE837DD [email protected]
690,256,086 *474CB72A7927B2179FE67D89D24B0DCC451622BC G0QW
690,256,087 *4747786A1E51090285390F66663E4E60E727C65D GĂGĂUZIE
690,256,088 *474523096BDF604EF3A00C21AD249CFA43735B75 GALWAYSSA
690,256,089 *474703CE3499BE5B9A5885CCC8CD74AA5545A75B gangsters-moll
690,256,090 *47471B11CF95E7F056CFA42CF24B15E5E85B6819 JOSEPHINEJUERA
690,256,091 *474FFC40493248047ADAD674B333374DB548EC1E JOSHUALADTKOW
690,256,092 *47460EB4513D89D571DF833F3C30415FFC29FBD9 JOUSTES
690,256,093 *4743E2F4E8F10F35E75CC2AB4D2C3D6298B223FB g_cv
690,256,094 *4743E207B1B376AADF83D356B4F5E9404B054F1C k&^`
690,256,095 *474CA742B742ACE47EDB682BF2287EC70B59F827 GERARDO.KOELSCH
690,256,096 *47442086B83B160513E2A28C5877C87D647321FF gerkvist2
690,256,097 *4746744BBFE6CC9850D9E4F71F7015D6AA3C6F3B GET.A.THERAPIST....SPARE.THE.WORLD
690,256,098 *4747A8BC78757986E2C5AA93045E3829467B028A GFORSDAHL
690,256,099 *4741FC4B14AAA6D7E89AFB452D167C5297C9EB15 G}I%
690,256,100 *474A04CFE23B56481EF857A87D5F18A37177A406 KARIŞIŞIK
690,256,101 *474EC37BE169592771EADD11BEE079B80999715E GILBERTDUNKLEBERGER
690,256,102 *474132F7F10236D54EC02DC8B6F6DECC088E6F26 KARLA1899
690,256,103 *4745521066D0A82D851522D4C8BB8A782309FD65 KATHYWAHL
690,256,104 *474994129F63AFF6D4159F2F3BBF9F7D01EC7C8C kazakhstanscudb
690,256,105 *474519CE1F2A7472177C2EF6372F1294075062B2 [email protected]
690,256,106 *47461BD4499C9DB64067FB43393B096ED3CDA2DA gninohre0
690,256,107 *474423A29B3427BA89C6BB65BC1105FA418EAF66 kenethdrahota
690,256,108 *474F53E74624E14B01AFDF31D653D1E7DD5F5C3E KENNETH.MATHURIN
690,256,109 *4749413E9B857BB3C07DD53E0BF269CE4A7CE2C6 kennethvinger
690,256,110 *47428437AD521FDA313D940E56DDCD06F3247B26 KESHNILATA
690,256,111 *4748DE5E13358E3774170D12DC83374EA21AFFA1 KHAOS2020
690,256,112 *4746494AC6D4A13871BDF7981231BEB53AC5BBE1 kidswqsb4
690,256,113 *4747F842D25DE72E635FF5A97E11387B4960AC97 greengrass3
690,256,114 *474779A47BE5DA79D6D2B15D625AC39E12D9FAE9 GRIMMHENEAGE
690,256,115 *4748F6DA402CECF37AE6036276A02FF6EF4BE432 grinnik6
690,256,116 *474F1A7A695BF1A5CF8496295A8956FF105FAE1B klovdahl
690,256,117 *474342853C47AF12EE1B86784D1FD3B732129D2F KMCAUGHTRY
690,256,118 *474C814FF0777AEE211E66D401D79B3D2C3B5EA0 GUADALUPE.GRAYDON
690,256,119 *474A6D8708F1BEFA56DE7A00F7270F1BB315DFD5 KOALAMAX7
690,256,120 *47496F0458DB9AC51DAE38B01D7A7EF0EE89B532 guemo
690,256,121 *47499FB1E809FAF9E55D26F4298A685F69D04491 GUIU
690,256,122 *474A1DD84CA3113C3E768E52C282987A49B8A976 KRIS.GALLINGTON
690,256,123 *4740C596F9A75623D190B30EBD5DF035567C68F9 hachoo
690,256,124 *47458EAF00D98CF07E532A031C406EB885FAB469 Krypticism
690,256,125 *47497CC4118BBFABE2D2D1F341DBEE0C0CD6184B KURTSCHARPF
690,256,126 *474F7418366C2D1F7CD81D3D59A3576ED8584A6B HANNAHALLSTROM
690,256,127 *474668053087801E7ADD252CD274FDB8BF8250E6 KUVANSIIRTOKANAVALLE
690,256,128 *4741F7C6FA5AE7ADCE83CB8CAA7C8F2C9034BEEE KWADHWA
690,256,129 *4747E0A6BECC47BD75E957F42D520ED6EE1ED350 HARRISON1
690,256,130 *4740D31A8F7F5C4267E425FA77E1D39FF36FE99E HASBULLAH.ABU
690,256,131 *4744939C79FE9EDC26F22C2C0622C7F71CCD4ABE HASSEDON01
690,256,132 *474EDDD08F30891A76706DFAD3D05EB6DB12D8F9 lamerharold
690,256,133 *474BE2BADB78E663B6F4ABC6EAB9ECB7DE5622CF hectorhobgood
690,256,134 *4740E569A2BAA7F35D3E96BAC5EFF422BDFEB22D LANUGINOSE5
690,256,135 *4745FE834482F3DF5B73A5F01DA908375B14A823 latha-bp
690,256,136 *474BBC40F46F0105291FA276FEB9315F8AB61762 HENRY.CEPHUS
690,256,137 *4743A28DC49B2D1E3F822DD47D5BD564BA188392 HEPTADE.POUR.TROMPETTE.ET.PERCUSSION.V..MAESTOSO
690,256,138 *4744CD7CF019DD2C0AD878123FCAAFC756DFC8EA @herb
690,256,139 *4744274E90372101468820667037E0A4CEFDEAD8 HEREANUPAM
690,256,140 *4742F14301B1892F54716590248C7DCAC479A199 HERIBERTO.GUTIERREX
690,256,141 *474CB9FDCC1F7BAD8AE724B6A761FF6C6C224800 lawerenceforget
690,256,142 *474FAE78652815B3FB641A1329749D29652F9AAE hernangves
690,256,143 *474F63777427039D52A520A9EA2E0C7913C6FC89 H'''FIELD
690,256,144 *474989CA67EE03E9DA2020DF8BD4CFCF1A2AEEEC lediableestlach
690,256,145 *47470CB4447A35EFD848BAB51841647974652CDB hljg
690,256,146 *4743F518F6253601B0B57ED49DED3B5562C337B4 let-me-see-your-ass-drop
690,256,147 *4746358F01CA727A2CB4D8F827B028E3054F836C LEWISDAVEY
690,256,148 *4744ACF45A1260B08F9ABAFD83CD1B3E6456A007 [email protected]
690,256,149 *474D1A35696AC9D2DAE8C649F4F0E0F4EA58168D LGXW
690,256,150 *47493C8D79B8CCBB5F126A7796D464B0B2EB8F17 LIFEGUAR6
690,256,151 *474606A0017D16543D49C43F5574F91CB77BD1C5 HOW FAR AM I FROM CANAAN
690,256,152 *474B90120887E650B8E1B7FD1323D4BE659B2F71 lincolnmenk
690,256,153 *474FCB53B2107118DF2E63FF14B1D46833DD4F51 LINSTAB
690,256,154 *47464E955690E8923419FBF9A20162A362935635 LIONELWILKOSZ
690,256,155 *474BBC7B8CD5442AC7D2F423F2C0F59FDC74DC9F LNKMDGHD7
690,256,156 *474DDF4F652664C6E8D769FD8D925290534722AC Hyphomycetes
690,256,157 *47494CBF1DE26DFF867E07093795230DCE3F9F3B LOUIS.KITTEN
690,256,158 *474BD6A596CDDB7BB90C716C105A4FB7C3EB22F7 love-darts-double-snails-chance-of-offspring
690,256,159 *474D935DED606605C3B54685E59A68500F47799C IAMSHORTY2006
690,256,160 *474AC482266C7AFC7E91AC2CE762D2F422E23343 iamsteel11
690,256,161 *4743B23085D9B14DD409651A7ABFEA2A380ECCD0 IAN OKTA
690,256,162 *47497E64493D3EB8767DD39FC88A111BFA2C170F IAREUQIP
690,256,163 *4743813BCFEBB678B517182343868C2C63290000 lugôville
690,256,164 *474D5FED4E9DD8E0D38124D27B31879AB77D26DB IF1W
690,256,165 *474EC292591D5605491C68AD039AA124E807E328 ihsakhsed
690,256,166 *4742F3E51B33BFC45558A40EA0206F2C8B2C5F52 M144222
690,256,167 *474BE16FE71BCF97CA839924DB277B6FFC601E09 ILODOXER5
690,256,168 *474A387B24F9CE82C46E7BE611CAD92E7301D52A ilovebogart16
690,256,169 *474A6C65755D16EED2C7EECC28EF7E7D80771FA5 MAINTAIN FEAT. O.C.
690,256,170 *474267624CC4164DBD7EEF5F4FCDD665B27F6F32 imagemtsec463svg
690,256,171 *4746B409583A155B07E7D83B2F25C2E4C77FFB98 IMMERZUS2
690,256,172 *474E53D0B927D7ED5FB88C13CD4E4EEC2496467D INAFFIA
690,256,173 *474D23544A1AE3945B71DF39B7EA548E477DFF91 marcelbambino
690,256,174 *47446E3CD0D944848F9E885902058B821E886F41 iniquique4
690,256,175 *474401CEFCD8917FBB472638F42E5254780219B5 MARCOGAMINO
690,256,176 *474A16D0DCD14FF3971C8E39D5014816575B07AA MARION.OLLOM
690,256,177 *474DD0E7E689657469BCDCC90ABF8A606A3F8CD3 MARKBOCEKVSJIMMILLERTARGETEDFORMARCHSUFC
690,256,178 *4742C2DABA4D31113308487BE9B1C446919A2A27 iovvanl3
690,256,179 *474036B999B6919AF67837B729ED8BE77387BB26 masterc5
690,256,180 *474D20C671F1AE6B2DBA44CB5D9F6FC4581740E3 MAVTUHSMA
690,256,181 *47486E19579DD03A863000938B53549A3526C111 it-takes-that-to-satisfy-me
690,256,182 *4742B6A09F6ADB74436ECA68855CC70D36B27E77 MAXWELLRISPER
690,256,183 *474D8E3DBFD3D32FC3F1001FA847815F79CBE5C8 [email protected]
690,256,184 *474178D5958CEF0A3EB1E128083FB306BE87DCC6 [email protected]
690,256,185 *4746E9FFAFF79A44025CE74CA41C530CEF4D1484 i"x1
690,256,186 *474E2677252363CF91E40D8D886A7AD660C347E3 MEINGADDIAAPCHALAWAANGA
690,256,187 *474B7FB86EE444937D885CC417855DBA70E09BD3 me.katakana
690,256,188 *4743ADE3A39E5274531475A07A2107F6B74F4A8E MELPROWELL
690,256,189 *47443706CA2911733ABA16CD56B52EF7174C0640 JAKE.EXPLAINS.IT.ALL
690,256,190 *4742B265CB25D423C127B8D16D285013A19C7609 jamaruhde
690,256,191 *47424E802FB804B08E6E7AB0995CE1863ED9AE62 MERLIN.FLYNT
690,256,192 *474379F573936ECA0D447FC47FF75A950E2EF0A6 JAMESBLINSTON
690,256,193 *474A15546619D2B301BBB391D097A3D4A6E5F21D JAMES.BROEKER
690,256,194 *474C78109AE12EEA626D9044B14D448A2E53C9C1 merrymartha
690,256,195 *4744D5B38D2E542727959DF93FB611ABDFBA4E6B JAN09FOCUS
690,256,196 *4740C4907F13DA24CE14B457D7CAC7797881D4B3 jannet.de.vera
690,256,197 *474B2F563745809B9BEF1DEDFC24E3A212B9914B MICHAEL LOGARTA
690,256,198 *474A448C14E775ADF245BD37FDD8B4DDCA45EA43 jarvisdriessen
690,256,199 *4742C4B5E3BC5991FAEA9253B92F2EF01D30C6E5 J-AS
690,256,200 *474A9E6D0FDA3347D1DF9D624B8D234A31903CA1 j.dennis
690,256,201 *474373FCD44180245DB7A6E6A00DC9BF9CE51A11 MILTON.UMBAUGH
690,256,202 *4747C26BA94032D1099C0212242125794D605597 minhsouther
690,256,203 *47407182D577093D493C3810B1F819617047159B JEFFRY.IDRISS
690,256,204 *474F88B7DE1BCF881BD0D9C4DD1A8034A13CB461 MISPROVIDENCE2
690,256,205 *474DC88EF0C4651970146FAFA79290CFCC23ED41 JEREISSATI..JH.EH0.R.EY2.S.AA1.T.IY0
690,256,206 *47418651FE459CF8A3970351A100C7EBB93B58DC JERSEYMURDERING
690,256,207 *474E03486E3D01EE32DE2306022333599D27EE5B mohammadfuchs
690,256,208 *474B2BF5D86D0B5D052976EFE9F45B987B5D0CDF [email protected]
690,256,209 *47428FF9A37870A7761906F1116E26185D0075EE [email protected]
690,256,210 *47401BA61234417F288631E7FAC15BA70120621C jif>
690,256,211 *474B5076B6B51D7183AE5B49C0CABE3E25C2BF1A MONTPELLERINOS
690,256,212 *4743F4CC467E52E16E0BA39CFAC50D217C0F2D44 JMUFER
690,256,213 *47487C16E9F2FB0721F6DBEAB89C1F461A154216 moulera
690,256,214 *474603E5C4FA84E6655D05B23DB1586177E72EE4 [email protected]
690,256,215 *4746582AEF7EABA873646F133C2D41747105C7A0 MSAYARA
690,256,216 *47477EC3D8A44DDC56BF09DB1B059A9CDFF632B3 joey-chamberlain
690,256,217 *474B40C6CE800CCAB4C123E12FA3C7F4D5C4164E JOHANNASOLER
690,256,218 *4740900F7082B4CEFCDA0C4D4AAAD425776E1504 johnsoneleby
690,256,219 *4740DEB14F58AA947D6C557D853A7642296D824F JONATHANDADSWELL
690,256,220 *474EC93FEF9F7DE236B79A89B2DC131D081B98E3 N-~:
690,256,221 *474AD42208E61391893554828C6C58605C509C56 josie.pernice
690,256,222 *4748F5427B1A8D0AE74A0B9FA28D9497CD3E85F7 n4vig47ed
690,256,223 *4743207022B2B75B64D95032D8CA1576D83D2B60 NAJMISALAM
690,256,224 *474F734F4208032EC3C7EF002E5A93E7D9F54D28 nasty-moves
690,256,225 *4749500CCB33614272F1BD532A210DFA9FDBEABD NATHANIALDONNERBERG
690,256,226 *47488D68FC066FAB037C44EAD8279C68E8067C0E [email protected]
690,256,227 *47459093500EA062CF2B139317A146FA8B11365C JUNEBUGV3
690,256,228 *474F5CDCA3535645FAF38E6585A1E051235E46BB JUSTISON160
690,256,229 *474F1A500EBEF0555267340DDC85D8826E4549B4 nbscoverageapproach
690,256,230 *474E49725AC7070F8B247C9F6EC93B1165B7030E [email protected]
690,256,231 *47463B2320C6A042BF6254723A438E8F9C39D92B NECKTIED1
690,256,232 *4745364CD2B786D2ED4C142EB594F075A92B954A NEDVAUGHNER
690,256,233 *4743E90D684811AD50581ADB0DA3DA99615D4DD8 nelsonkiller
690,256,234 *474E150E917BBFE89E566D8E68FF933A58DAF830 KA"RGLICHSTES
690,256,235 *47453A8BF1AEE2D02C1D6590D2DC10C83F6CD8F0 NIGHTY4YOU08
690,256,236 *4741C3FF70689DB24D80465DE72DC63C92103580 kelleyeigner
690,256,237 *4747F2E7E061BA86025FBC73B428F823C22D8902 [email protected]
690,256,238 *474362A242B3FAE33815D9BFB03FDC70C816A5AB kellybasu
690,256,239 *47441CE56E34A0E8F02FDF7B6AD0D2592D88966B KENDRICK.SHUSTA
690,256,240 *47425DBCFBFCAC4278A302AC74A6DD57C98362DC KEN HIGHLEY
690,256,241 *474FA978A9CC98FE8C696BFB85C0EAAADFBBBEEC KENNITH.ROBBEN
690,256,242 *474C9CA41B3996AB5424D4CE02A3D42A52DF180B KENTADANO
690,256,243 *4742F21EDD8A82A978793C9B0A52D75791D4DD73 [email protected]
690,256,244 *4747D66DC61BCDD39A573959F94A86443E4B8BDA NOPARTIES
690,256,245 *474DC5AB092D9943346F1B6DC3349BD230B7B062 norrains
690,256,246 *4746B8725CDD3DF8722F4B8F42695CE529EC7C60 NO TE DES LA VUELTA
690,256,247 *47467B272123972BA451D90B6E9ED638ECD0C33C NOTIERST
690,256,248 *47498ECB350F2255E63D4A5B850BB820B259BE24 no.woman.no.high.(afroman.vs..bob.marley)
690,256,249 *4740EB75C4178ED8842D5BFA7DD64DCF0FB821AC nuclearfactorkappa
690,256,250 *4740A51D80675E254F38ADEFA09BA2AE60C31348 KIRK.MELING
690,256,251 *47472C2DBFBD4DD8F6C20A0BC812D8AD7EFE902F [email protected]
690,256,252 *474C078EE04D06431A164702EEC10777FF3A4305 kitty.curry
690,256,253 *474EEAA45C4EA324230850CDFB0C124673A68BC1 NUTMEATS
690,256,254 *474298E3C95F6E6BD580C73AC08E8B1F0625C976 O3|^
690,256,255 *474C91140069BA38C3AF891A13B0A7B806FA4558 [email protected]
690,256,256 *474A055F54B7CB76A21296644301135D2DED8514 O?AN
690,256,257 *474B341EAEE0ED10EA3443E2B28D290EC9B1F665 koetsierszwepen?
690,256,258 *4748BB7077AE685CE8FDBF972B81EDDA1C4560E8 OCAMPO1
690,256,259 *474DC38383BE5F2117CD53F4E0044A919D1CA824 KORBWARENFABRIK
690,256,260 *4745C4CDEEA37740C9A06F6497607191BABBEBCE [email protected]
690,256,261 *474780C939CDBECBBB62BB92942FE27EA8AA0F4D oikeudenistunnon
690,256,262 *474FF6972986B6D11113B61D3C0C1351562DC116 KRISTOPHER.WILTON
690,256,263 *4745EF74E12DA38939FB05BC5A4812F252711B8A KTARTT
690,256,264 *474FFC87DAA1EE5BF69669FED5E383B76F3E3AD4 ktjt
690,256,265 *474D6225446D1A8C7A07E13AD6B66F4DF8B20681 ONTIJDIG?
690,256,266 *4747C5FABBCE969900189AC0851A179B4D6189BF KX1Y
690,256,267 *4747DFBBF06D82F189DEC760064A55F64A10FCDC LÁBSZÁRÁBÓL
690,256,268 *4743C12F7DAEB98C8E74BC398DE0D7F9AD31690D la.fagota
690,256,269 *474ADF5956112DDD28BF8CA68941EFDAA71B8042 O.RONCO.DA.CUICA.(MAD.ZOO`S.SAMBA.CLASSIC.MIX)
690,256,270 *4747C520D3C53811972F6767B978090E427BE4A6 ORVALMCLENDON
690,256,271 *4745CF0EE8EFB1F781E36181F7F2011D3CD6ECC2 O (SAL
690,256,272 *47469662727760D9238E600E78B999E91C64E748 O TE AMO
690,256,273 *474DDAB5B71B3E77A255CEA9AFEEDEE9053123F3 otsala —
690,256,274 *474C57E7379C8768F5B6DF045D0CF43ED112452F lashettes
690,256,275 *474E5A58B750205088E620352CBF6915F91F5ABB OZ
690,256,276 *474BDA8B6A6B5A27E3539006E70C8557163BD2E2 [email protected]
690,256,277 *4740820F0BC2633764119223379982A8D910994F LDESTILLATION
690,256,278 *474573450E601446D7B202E0C63E6EAA6C21C029 leespierling
690,256,279 *474BDA32C1CFB90B1B6A02A00ECE82D3F26A5505 PAGERANKTM
690,256,280 *47447ECEB47CDA17CCC4FD8B087AE18D12452A87 PAINDISTORTED
690,256,281 *474CDA4D41B728115D419649BAE41439A6B5C088 <P><ANAME="N_898_">898.</A>CURRiE5/6/98GJAT126.
690,256,282 *47467A512BE15C5740A932C0B0D9878656EE1BBC PANEL11
690,256,283 *474D345B7051901BF7EA247C3C2BBBB1294CACF9 p)`~ `~ >b0
690,256,284 *474A240AAFE18C15815F9203CD0ECA2A11E31822 PEDUZZI9
690,256,285 *474DFA1DEA6FD282F6886FAD0CAFD6E943F8F4BF [email protected]
690,256,286 *4741EFE716FE5DC86ED72D31AF13FA88B719F9C6 [email protected]
690,256,287 *474C29E7A498F5BB1A2B5D823BD0E8AA3FC873DD [email protected]
690,256,288 *47469A3CFE1D27B07B417E51036D1B7A9C732A69 [email protected]
690,256,289 *474A4D113B2E64A84180ECE3410AD6D0F6F45883 likeacat(featveronika)
690,256,290 *4741C5C029D51521C1A55C1E7216D65ED27CC07D LINWOODZVORSKY
690,256,291 *474709B1CDD70465D3E85D8146BFCCE256940442 PICYZBEST1
690,256,292 *47429D5F5487BAF6CDE77687B7E2169286CCADD5 [email protected]
690,256,293 *474D4E15EC2AC32FC8BC1F83D37AA47A1103A9D9 [email protected]
690,256,294 *4743255F2361C40DE46CA58474602C93B7777239 [email protected]
690,256,295 *47412BAE2F481AA1E77CF777280810455996DD59 pitching?
690,256,296 *474A0B98D745C85D151F269BCCB7AFFED4B3FD9D looxs
690,256,297 *474537D28931C69A014217DC994B38D35B726312 LORENZOGEASLEY
690,256,298 *474848261C8975E83D11543AD75AABD0AF9C51EE LOSING.ONE'S.SELF
690,256,299 *47401853172CC186912D990850F14CB78DF270FD PONTOTRADUKO
690,256,300 *474C09A76012C82AA8D811E3C85B2D9781CDDAB0 LOUNASLAATIKKO
690,256,301 *474FA8BA023208F0A2FC59780EDFCEC003BC40C7 PO$TRO$TRAL
690,256,302 *474387A15F01684253F49B7B7D38E62DD47E1DC7 P======P.`.(>_<)
690,256,303 *474B48EE16268A4D7AB796D51059F65990264158 [email protected]
690,256,304 *474A20154B9E1D4A1C2570B8E3D889707B73A658 p==p-~o~o-splat
690,256,305 *47481E02DB4967EAD12EAF0A5CA7EA3F5F9064C6 PRABU SONA
690,256,306 *47475CD0F2E2D052B73ECB992B977D6E359E9DA9 LUCY BABCOCK
690,256,307 *47476E535B348BBECF6BDDD32A5CB95FDE1763FF PRAECEPTISQUE123
690,256,308 *4743B7AB47C3A308857A29E55CB631A27964A5BB PRAELIMITED
690,256,309 *4747FDA19F6D90001F11F336AA5F404FC85A7342 LUIS.PRIGG
690,256,310 *474B5316429F23EBA76A5206AE4EF866E50FFC0C lunch.warz
690,256,311 *47459D2B261643C774552C4843984DBD8AE5A505 prokr
690,256,312 *4743FD183709A03C740DF64D81353128134538D8 [email protected]
690,256,313 *474391E0131463C38BE75A0C2802BB891000A469 MALCOLM.EMANUS
690,256,314 *47497B4F55018D2508B32575EAB1A9E6816C5F6D MALCOLMNIGGEMANN
690,256,315 *47406B94E5C7F9A16C36EDDF990FF1BB454C55F5 q2wlj1pa3bstjx0qfl6
690,256,316 *4740B0C0C6B020C183C9D8044E10A98D010BFC07 maranathachapelorg
690,256,317 *4744D4C396157C29FD3A91C267CAC969CEFD5D6B q======>~o~o (0-0)
690,256,318 *474C03D3DB688082BFF393D7DF9EDD6126BA209D qu&'
690,256,319 *474AC09DBF274EC8C9E510579F2ABE200CF6D702 QUANG'S
690,256,320 *474EC83F331458BB317FAE20763BE13B0A678572 [email protected]
690,256,321 *474243573A9992E4C27FA09FC56E258BC8639D47 martialtaichicoukwww
690,256,322 *474C56CCD0F090C5C8D7BBA18A696827F54C8B04 [email protected]
690,256,323 *474B7CB5450CA9F3555F5262B80B985183330FD6 RANDELL.NIPPLE
690,256,324 *47409E73E6D02457892E240AD0125373D7072C68 RANDYTOOLEY
690,256,325 *474CB9FEB993E18A2482E595D961646C7B078615 [email protected]#MAZA
690,256,326 *4740CC3BE6BD4D8AC7EC3E4D654CB9F1A39C1891 RAPHAELDAVION
690,256,327 *4741BD07C1B89EB76CF7EEF31A20438BB0CE764C [email protected]
690,256,328 *474D52E32A459132CBA89AB3465812E2BB19850A RAWEST
690,256,329 *474E2DC027985689000876A05CDB573F50DDEC4A mervinlawcewicz
690,256,330 *474995D7029F50243587587C58A631959D88668E *reduce*
690,256,331 *4747A6B4EBBC3DE905F8415DED80258D6E66021B REFSONBSW
690,256,332 *474CAF36285DF723361D05DE9FC67339C1223604 [email protected]
690,256,333 *47445E8A24D31786E129D50AD3CB727F2139187A MILTON.VANFLEET
690,256,334 *474ABD6823980828E75A79E7D9D3DA06784BDE65 REPROBI1
690,256,335 *474F78E84BF050E539CB9BFAA174E8A624E35CBB [email protected]
690,256,336 *474E86B85899B33A878B723EE0080B0AB3544B34 mkn_
690,256,337 *47483AE1E71E9A6AAE84081CD988B19304D6170D RICKY-MACHO
690,256,338 *4748C9D16EFEC61FEB58C4ECBDA17E21CF629ED6 RIGUARDOSAMENTE8
690,256,339 *47427E83A9E74FC16DBC7B1E558D4A142FDD07C1 riseinlove
690,256,340 *4747B2DAE776B589AC79F7707B5EC343CCF5C061 RIWAYÄTLÄRE
690,256,341 *4741D1B840AD68D9C067B60CE7CC84AEFB3E0184 rjGondolszemajdr
690,256,342 *474C5B3EAD01433EF7737BC885B5369D1A6F7AE7 robbyjarosh
690,256,343 *474D79D0A07C34BAA6D57063ADD688BF31269E0F MSARREAS
690,256,344 *474294608E79E68152988BBB3D040655D3D3A5E3 MSILACISSALC
690,256,345 *474DCCE1CD257F179B2C6EFB76EA6C8B0347ACBA [email protected]
690,256,346 *474C930FB5E8C8279E39C10429A30B30825DA6D1 muchamadas
690,256,347 *474579C4AF04E5A9EF549528B3D038CE14A164FC rock-'n'-roll-suicide-(live,-1973)
690,256,348 *474A3008C851EA33B2DA91DA5B321ADE34DE35E3 MULTILEVS
690,256,349 *474614CC18D71D4BF4AEE04A1ADABD93508D900B roensch0
690,256,350 *4744BD0336F28B26DB9A22481677D99A723B5732 ROGELIOVILLA
690,256,351 *47498ACD45EDA1B7A5DAD54DFF45C492563A30B3 myapple43
690,256,352 *47423669E01095D3CB1290B783538CD005FCDACA RONALDGIANNELLI
690,256,353 *474280B5144913FFE75FFDAF59E459B3AC640F41 ronsings
690,256,354 *47446D610A87FBED8E8829AB76DF3A2F3B1EDA11 N0N7YP!C4L
690,256,355 *474151EDDE2B43DFD44E1D6F1CC069169AF23F79 ROSENDO.ERNSTES
690,256,356 *474254DE92515637DEDD9D48CCA43089FB86E8F0 N{9K
690,256,357 *474646185011CB93D708DEE18603AE8D483E2D79 natursteinimport
690,256,358 *47485E2F0A1766E735894BDA260A94DA837E752C rufusplan
690,256,359 *474AB97C59554FE3ADF13F46619734D99D94C6F3 nealroney
690,256,360 *474B6070A5CD30F73F6AACF5F1CB128DE830972C runningjim
690,256,361 *4743D0800AB5D7983333CC6700813DF0F6A7D868 RUSSELMIKLER
690,256,362 *4746B5392D6F91044E45FDAF1C72D36B474F6914 neilbonds
690,256,363 *47455313BC8A205328D3AF52FC518AF58D8B7009 saajan.kumar
690,256,364 *474849262070FA08EABDB58E138889C3F92F07CF SAARGRUBENVERWALTUNG
690,256,365 *47425236EA24B6D7F3F3182F67C383B358CEBC5B saltfish3
690,256,366 *474A1442EB099BB0BD6FAA8FE7A20CB51E627D65 sambhajitupe
690,256,367 *474E47AFDB997F66C7B40D8D8BA32074D0BCE099 SANDKAST4
690,256,368 *474FA901054BD4FA1C68C89D4EA043CB73629C1D NOB1TY
690,256,369 *4740D5F04B3D10FB567A64DB68ABB1A44F00BC3B NON4$$ER7IVELY
690,256,370 *4749237C453448E855ECC542F384777DD069679E SCHATZAN6
690,256,371 *47467C72E9FB3A5CC33AC78A26E30FDB01D398B9 scientisie
690,256,372 *474CBF386143E3E65B153A6D08A74B01A87BE34A SCIOCCHERELLO8
690,256,373 *47487C153A24863BDC31D3349007527C1FC4D235 SCLEROMATA.
690,256,374 *474D671B653F365B1515234B243A54CC8EF7250C ;)o~0~<p
690,256,375 *474D5EA79A1A3A45DD92F9D7194B197CAFC494F0 semlterate
690,256,376 *47410C085BE1AD8D01AD51F96A47ECCE7414402C senaforps
690,256,377 *4741E701664C5663254E556347457E1A03DF998B SETATNON7
690,256,378 *4744272E691F78A10828944B0D685B6950BFD327 sh3lv!3r
690,256,379 *474AF9F54A7EF68DD1F7B3C34229CC4650D179EE SHELTON.TROMETTER
690,256,380 *4745EDBF71B7B3B0D6CC4A65A53AC105EA34FA97 orvalkloss
690,256,381 *474760724E918A78D1369A652CC6E431504A53E5 [email protected]
690,256,382 *474D71A33A3CD62D7194CAD66523E4CDE978D42F othamarques
690,256,383 *47487D22236818104F4BFE10EBDB1BE97FABA03B othatylman
690,256,384 *474366CCB35902F66C2624D2C01EF77C109EAE6A OZ
690,256,385 *4747137A38CE20751B92227F80E51F9FAB204CD2 p3cu147ng
690,256,386 *47479F1E810C584537CDAC2CF0C5B618F0B3B8BA Sinayuda
690,256,387 *47487B215D9C9E69447C72C4794D7BCD44DAFD9B [email protected]
690,256,388 *474AF06CB1088BAF7B7E80C23589DFE1EABBCDB4 SI-YO-SOY-AS
690,256,389 *4743DEF70AC4F5A995C89E7BCBDC4F977797DD4C ),PALLAS于1776年命名。居於
690,256,390 *474FB391B3F82B2AC22D5821F9F0A2AF5C1A5BCF <p><a-name="n_283_">283.-</a>--<u>id.</u>-at-124.
690,256,391 *47419A42A241C1A7EB9C76A0435DF5688334E66F PARCHEM1
690,256,392 *4740928F029BDCF0AB36A885F58EDA1C90C80EF0 PARISHA21
690,256,393 *474660553915572582B4BB135D468F1007D73040 sliwafett
690,256,394 *4740AAF8A61BD4B1FE71CCFECFCCF07B456506BE pasqualeniedecken
690,256,395 *474AEDBC162E1DE233EA043069701AAF585B6077 pasqualeprahl
690,256,396 *47463110AB0854D4AD1724F35F94DA01756EC93F SND8LSTRS
690,256,397 *474C5B94C8E6AC66ED31E1765F9324465AB3B962 SNOOPYDAVE4
690,256,398 *474302DCB3C21AF18867094A5B206DE14601B7B4 p------B~O~o)X(
690,256,399 *474230F0A557BD477F1E49CB318035C7E4A0DC3B percyparlee
690,256,400 *47418B84292883061523569D8513DCCE6CEB0260 SOOLREDEOM9
690,256,401 *474AA1C76E65460F0AC75E575AFCF6D84084ED9A PERPLEXED.
690,256,402 *474AFD0DE33150AC480ABE2834BCAD99922E3883 ph0+0$yn+he$1ze
690,256,403 *474B30B9CFC4BE0B35E7342432D75036DBCE7542 SPELL 125: THE DECLARATION OF INNOCENCE
690,256,404 *4742FFC85AB8070535EEA6CE110AEEDC3F930837 SPLAT*.*[email protected]
690,256,405 *474FDF5D23069AC7E6991348CBB8A710B0FD4741 spon9ns
690,256,406 *474934821E900108546A7026F16B104F2B1CDC34 STACEYFEINER
690,256,407 *474F067B54D7443F058AECBC2264E5C2F3036C8B popviminns
690,256,408 *474B717DF8D36A5BD91AE32C4884CCEA2BACA9EB STANTONGLASIER
690,256,409 *4742268B5D7B72C0D916EA512A250A1868377425 STAROHAJSKÁ
690,256,410 *47411FAE1FBA257D56E4F44E3AD863796E4D60DE PPARE4X
690,256,411 *474D353F5B9E337EEE8AFB74126B88951F05E55E stedyedy
690,256,412 *474D8962D0C04D112D02031AB44F113E654B6A63 sterlingschuble
690,256,413 *474D5CE0E3D778BFBE5C1666EA7F0E1F89B9DC8D STEVE.FREIMARK
690,256,414 *47414B839BECBC4ED729519C9F66CBB642CDA7E3 STICK-QUARTZ-AND-MODULATED-SYNTHETIC-QUARTZ
690,256,415 *4749F5C92126E073A85DF022CDFDCABD76DE67D5 st!mu14t!ng1y
690,256,416 *474814798BA9751A4025807D79224B12A6B36026 proagetai
690,256,417 *47407020090DBE9ADF1711B759D12EDB06EB5C09 PUTUMAYO PRESENTS: NEW WORLD PARTY
690,256,418 *474FC43A448BA274DA709093CE186449164154F8 [email protected]
690,256,419 *47499DD9A0619C07CCEB149FC43345F430A5BF18 [email protected]
690,256,420 *474DD078EE1D334A8D0DCC458D19DA7AEBE4E76C [email protected]
690,256,421 *474DDBAA1BE3FAFBA811E150FA7C5BE6792C3496 SUTCACLOOF
690,256,422 *474F952B1DAAF7C228D3716C6113104E290F46D9 QGG4
690,256,423 *4748D65A980BF11D58AC7CCD5206240395135E86 qkz*
690,256,424 *4743DEA992EE35D1A8BD81831DBA42C048D58688 QUINTIN.ABELL
690,256,425 *4741A60910E2E9A37BF6873F74592F726775F64A quintonwhitten
690,256,426 *4743AB913C2CA9B892B8795F23A5C2935DDF946B quiquie
690,256,427 *474C7FE9321522D0F4D13342509B6655BF2FFA79 TAGEMENTS5
690,256,428 *47434C98951203EC3E87945D44B166AE55C3E89D RABREITR
690,256,429 *474DB5A8E8C443D6342145307769E6A7357ADF99 TALKTURCOAIA
690,256,430 *4748E82FB14134799D12F2CF15CCAECD0289B535 RALEIGHSCHUERMAN
690,256,431 *4742EF3678998107C6803BF76289C34758611790 (rampo
690,256,432 *4741B4EC6019DA748103FE98537795527E5B874E rapaces
690,256,433 *47422A98A92CE06243DFADBAD6DDEC09435AE8D8 TAZMANSMASHING4
690,256,434 *47409505E623A45081BC58829ADEC4CF5A396A86 [email protected]
690,256,435 *4749581E24C1D7C3E6F2FAB912798B14876600E1 RAYFORD.FELPS
690,256,436 *47460ABEC104409851C7BB872C7A9B4E4FE31DA0 TEAMO1012
690,256,437 *474FA8AECCC5ADE0D0246A5B57D2FD64AA544001 TEHILIM146,147,148,149,150
690,256,438 *474779B67F4893361355CE4689402F28AA158D94 TellingYouIsSomething
690,256,439 *474841DC8AC01A58A3EA3D5C202C73DD38DC3A5B TERRELLBUB
690,256,440 *4747B9C9C85C6DA695172AB9C9DC6D32CD655D21 REENGEREENGE2
690,256,441 *4745CFA74C4832B835C12106333270976657919C refugiowin
690,256,442 *474BBA54E72D5AB21ACB8D0E067F3854BAC23903 REGARDONED
690,256,443 *474E9585F9DFACDA36C35A0A55DAC90E2DF319AB thaddeusrocker
690,256,444 *474817C56ED05AE7796A38660F9F66BDE4B6E1F1 THAD.MESZAROS
690,256,445 *4748964C25978CDFA696366DE3011DC9F14163DA thanksultraflame
690,256,446 *47427F0890FFA84C62ADE17BCBA2807E5E6B7D7A THATATHENA32
690,256,447 *474E1086790D542F417DB32C2DE293B7336C6272 REINSCRIPTIO
690,256,448 *47438EFF98C60DCF6E9A5D634B3676B26ADAF59B THERON.CAMBRE
690,256,449 *4746219B9EE482B26171EBC75843CA05AF314756 thesweetpea72
690,256,450 *47469C7E28549753C67F733769C6207DAACDF1CD RICKWARD1
690,256,451 *474A583AC7F22F22A03A01F76601F113F1D7C7A4 RIGEURBSW9
690,256,452 *4748F39A38E5A6DE1E8BCE45315DB67EA8FD79FE [email protected]
690,256,453 *474F724A05033A9DE01738CFBA717EF5AF05841C TIMOTHYKLYN
690,256,454 *4741908BD6CBB9EE33C3D1B66A573AD07A6866A0 timothyschnur
690,256,455 *474A47E747BDFDD570558617BC4F4F1C4F31BAE9 RISIKOSCHEUEN2
690,256,456 *474598C21468C5BAAF0024048501428D1ED19BB2 rksizes2
690,256,457 *4748CC17B5F7C2A37ECA004880D2DD3E32989E5D robbiemckinstry
690,256,458 *474CFF66239B0A7EBAF77ABE294D9A2C7E927CA0 ROBBYWICKIZER
690,256,459 *474E689A04C57DBE32A5E6CE3931E4AC640297AC robrabinowitz
690,256,460 *474DCF9B2A8AB9B260D1DE0BFE6B344234BADA34 robtleeds
690,256,461 *474E28EB038B8A4BABE56EAECC36E9BC7BA0B96B rock.the.party.(feat..jodes)
690,256,462 *4749FB33680ED338208F29B5A2AE4D2F9F19B63D TONY.MERCURI
690,256,463 *4749B7234B18F3931A9412CB1662B00887961E35 Toobaseoftheetoberemembered
690,256,464 *474A20231B3D5694676B811E4FB072D874D17DB5 TOO-MANY-HATS-RECORDS
690,256,465 *47403054FC78AB445B6BCD0F23099BCA839FE71B tophertandy
690,256,466 *4746E1AAFB5805E87DE5DC732AFF0181DB024814 TP\3
690,256,467 *474C9F343DD964334AC3DD68CDAB9E83AD88AFF5 ROOSEVELT.FRICKSON
690,256,468 *4743DFDB44905A87E45F7E4264D8CF124DC8922B Tracciammo
690,256,469 *474A863169AAB1B08B847C81FA6FC4CF8D316961 TRAMSUPMOCED
690,256,470 *474CE59CDAED9F2C7DF90030A6E5920EA9018C79 ROSITAPAGAN
690,256,471 *474909DD2F854B78D6DC447EBE26326B19BE0ACC transmogrifying8
690,256,472 *4749FAD4F038A7F3CFD44B2DDEE50A8FB7B772DF TRAVIS-LONGO
690,256,473 *474297497F4D892A779AD1763D06CCBBB4BB7DB5 RRNDSSMNTSCMMSSRSSN7
690,256,474 *4747FB3086FE8893529F5FF0FA1B0E6EF8C916B0 Rum-r4m-r
690,256,475 *4749056E2D3E7F0E7D53370E1442CACE48AD177D ryanmcpaul
690,256,476 *474CF5EF1E856B74BAD8FE3E499A8A4EDE085900 ryanvafiades
690,256,477 *474DDC627CE1521BE581737E649799AEDF2580DC S53917
690,256,478 *474E82C05EAA71F32D957BA1D6CEDA02A6803393 tuanwischmann
690,256,479 *47479B5032F13DBB211CDB5C9426E976B6019913 TUCKERWERTHEIM
690,256,480 *4748869E2F1B8A78DD101F50507027DBE21B376F SACHKONTEN1
690,256,481 *474A176DBB7A84F7D882620D2AAFCD99775B8926 sakudaira
690,256,482 *4743232E57F638AB31F5C08E69DF8F9BC9551FB7 TWISTER.DELORME
690,256,483 *474C219DA6C3B6D4F50F3CF880EE7E1EDC361926 SALZENBERGS123
690,256,484 *474B22DF4C473F76F994B7C2654334BBFD7A9F02 TYREE.ELMENDORF
690,256,485 *474DE30E84DC1E200AEEE892543C3ED6E9898A45 TYRON.MARCZAK
690,256,486 *474CF1F3876A6B8315161D9542622CF9A20A1BF2 TYRONSARRIS
690,256,487 *474B72DB3173D21A4F2E7EEF5BA9D0A40066C587 UABÉ
690,256,488 *4746279703D65DAB1343564D9F34EEADDC7AF434 ualuwen9
690,256,489 *474ABA5DB536D7A8A98449F231692608E9F9D0C1 santiagocotti
690,256,490 *4740D36308FADD0DCEF3A21734F634F81C7CCCCE UBADDILAHU
690,256,491 *474D474A448F8BA8A135723A3CC5AE403169C137 SARAH.HULSCHER
690,256,492 *4744975F4411C2DFA39DD59F117C20BA0D21BA24 satan-buddies
690,256,493 *47421F53DB41012AC6112CA49A53EDCFEFF80D89 SAYEDSHAKER
690,256,494 *4745AFB0756EE5A6A9AFBE1CF58296DA43CCABC6 ULYSSES.KURYLO
690,256,495 *474954A3EEAF4DDCBAC5AC0E2B5615FD6B88037C UMEILEKAOBINNA
690,256,496 *474AB4A3A45B5776746F2E86FA5DA634BDA68F6B UNANINMOUS4
690,256,497 *474FF4DAEE7E01949A745C9D1AC95AB18B47911A UNBELIEVABLE-A-HACKER!
690,256,498 *474FF1DFF0714E65D8EECC0C7B18A2B0F7E6D7FA schudde4
690,256,499 *4747D89C5539F9A5B4BFD0286FD75875BB59141E UNIT12LISTEN
690,256,500 *47465C9BF0658FD3F3CA6496C02F81D9BA3E4D8C SEAN-ALPAUGH
690,256,501 *474E3D48FCB8215E3AFEA0E2E3433DF8329D9677 sebastiandilillo
690,256,502 *47425518ED424CB27F047EC67158AEDE46017B1A sedated-disco-(50-cent-vs.-the-ramones)
690,256,503 *47400D76FAF666F190A2B4A82124B72742C6D0C4 UPPRANKPRANK2
690,256,504 *4741C2520F7E83869A524124657E5DC458C533D5 SEGCHANH4
690,256,505 *474890129D382385BA5717EF1217014CAFF6E3ED SEKCEMING
690,256,506 *474B4ED4B0861630308D5C6F39919F87878331EC SEKTENA
690,256,507 *4749B750D371075E6E5B90BA50801161FE6ECCE9 USMAN-ILIYASU
690,256,508 *47445BB954BAFFA094FB080BF8226DC27B194349 sengorgeriez9
690,256,509 *474C2813A0BBA728234B1F6A4B76DFBC2607DFC1 V?~0
690,256,510 *4743C5D486241AC32E908C6EF96371EF15842A97 settikere
690,256,511 *474D9886069095E9C7FD197B1812CA63E49C939A S|H,
690,256,512 *474280BE2D9F835510FAFAA9B0DB33478F41097A VALENTIN.NIEDBALEC
690,256,513 *4747CEF170253D3574856540C09A37B678126774 SHADWEDELL
690,256,514 *474A9756F1BE0AD3187F23DA817EF097273F8A93 SHAHROLNIZA
690,256,515 *4741303F9CF2B9E5C5793011ED007E668EAD7AC5 SHANTAPHILLIPS
690,256,516 *4748865F8019AE889966AD5D8E3EFB9719908CA1 [email protected]
690,256,517 *474A43B488707D671E64764A29839FF934E373E5 VANGELISTOUTOUZAS
690,256,518 *4745545512E2E660034BB40ACF2DD60C1DC2964F VANYA-B-NAVARRO
690,256,519 *474E3FDE2D9D816B9BF32DE227647D4D4C4BD06A SHELDONBARKAN
690,256,520 *4745C8737647C724610B8930CED53F29306F71FF shermanantolik
690,256,521 *4742E9EDEE2B50EAD9A01727AC6180374E769165 VECHUKO
690,256,522 *474EB68743132F93DF97677E6953B00301AFC4FD VELIKOV1
690,256,523 *474C872B5717441BDD7FBCCEF7BEA0588FD37100 VEREINSA
690,256,524 *474EED3E2D92A9995AB1B45A7B52831490D44C9C VERNONLEBERMAN
690,256,525 *474405C72EFD52A67E0496B3D354C4C4D979CE9C sicilske
690,256,526 *4748E05718B9ED57A0986AE93A77C5CB093159B3 VESHECCO4
690,256,527 *47418891C7E6D1092E62EE9132559BBFA945AB57 VICENTEFLAMENT
690,256,528 *4740FC9EA15A2BEC3A3AE5FA4249173871289498 VICENTE.HISEY
690,256,529 *474D5F6F138AE71367536CBD75BAD4EF7CD4B543 SIMONFAHY
690,256,530 *474D935C9FFA9CED7D6101386E5A959561385AF1 VIJAYAMALINI
690,256,531 *4741666A8FFC9311916298A0CCF7441ECDD2C3E8 VILOSHAN-GOVENDER
690,256,532 *474534D2A123CAABB99B68C5EF783171467E476B vincegiracello
690,256,533 *47443A3F68D19AF7692325AC87FC680ADCEFFAC1 VINCESILANSKAS
690,256,534 *47417A5CB3B0865C3479EF5CFA685C0DF3911EA1 SKRVBRDSTSTNS
690,256,535 *474C7459055EF01CBA3711AF29324FD98DDE2B21 SKYLERMIC
690,256,536 *47408D7FE94B9CD22FAA73E5759E58F65CB5135A SMCANNAR
690,256,537 *474A8CBB83D2E77485DE4F56C40FFF4213CE4E95 vitobogatay
690,256,538 *474A3B2012827314E92F40DD45B6DDE3C8AE47B2 SNOWMANPISCES9
690,256,539 *474785E14738007210B79ACC5F3DC9E476C3CE36 SOLBONGARTZ
690,256,540 *474C8B79C33D137931B6ED1C8F4A71BB64410851 VPANKHANIA
690,256,541 *474E85F9AAFEE9A42893A455A81E35EB38A7D7A7 [email protected]
690,256,542 *4747EC6F0174F9A36D7D2857A1E789B5F53AE2EB SORAINE
690,256,543 *474627CE7CD5885A79BDB745295D9DD40900F68B W6RG
690,256,544 *4741D62BF041FE4B4F1E0671E558455E704EA7B4 wallacekalinoski
690,256,545 *474ADC3C4B0EA2F39CE16B88C2723E63519D48F6 WALTERSHOTGUN2
690,256,546 *4743D7832C373CDF9859505FDAC7B5C06001123C waltoncraker
690,256,547 *474875E2BB17E6C43A08398992EB7B1C885C0A00 wandynow
690,256,548 *4740BB5A95CC9DE5B36AC876C191D4B683A3D1D5 SPLAT!!*-*@=====3
690,256,549 *47484397272F2E19FB798F0B00E23A24433C2C09 splat *d3
690,256,550 *4747EBBF9F4212CFC5E7A501B6E4335B991F3364 wasimchanna
690,256,551 *47489B8332D305155648B0DA503C26C6BE543707 [email protected]
690,256,552 *474F040E0A8956CA449B4C98AC3B85AF39A22467 SRADICARONO8
690,256,553 *4741236C409AFF1BE400B3E4653CCF6CF1A6224D srerrete
690,256,554 *4748B73148301DCA72425D68F0FF2F67DE927A79 STABILITÄTSAKTUALISIERUNGEN
690,256,555 *4746FBDDF1110C031E466198C7FC263C96CAFFEB [email protected]
690,256,556 *474AF11160BE79C2947D2EAFAA5A211EFD927C97 staffortische
690,256,557 *47460D927B074382CF49A28B18FC2A29F6C32AD5 [email protected]
690,256,558 *474DE2EFEB094F63DF27BE8ED84E7027326F64E7 wereldtos
690,256,559 *4746646825D2F129DDC58FCCDF80AC2464D5CCBF wetclean w/E/t_kl/i/n
690,256,560 *4748BE8AB15F3C698828CC77FE6D7D473187C1E7 We've-Gonna-Have-Our-Day
690,256,561 *474C404635007B4BFF7A34ED0A94F9956A4B854F stefantashjian
690,256,562 *474465A1AD1BC84EB43E11F91DD56F0366A6F0A1 stenhetertravare
690,256,563 *4744D2CC08B35A8E535407FE9B96A903A8438B44 STEVEFLIGHT
690,256,564 *47462EE5442BD37FEEDE18BD5DFD08D8104E0C29 STEWARTSEGRAVE
690,256,565 *4748A80BEC2D237C2AA5D9CAC41F2C8FE3C2874F STIKDSENS9
690,256,566 *474E856A25392F916698D6592C6BC149D3DF3AE1 ST. MATTHEW PASSION, BWV 244: ERBARME DICH, MEIN GOTT
690,256,567 *47405855A8C99DC5164C4842929C5C47749E32E4 STOFFERNE
690,256,568 *474ABEED860D2A7214B030DC9C10E5C0D3A08ED0 STORELEANLEAPING4
690,256,569 *4749BBBF9698DAFD2C29FBA01CE434F93766641A WILLIANPINSONEAULT
690,256,570 *4740CA17D70F556079EA599D66BF0E6D4DEF49D8 [email protected]
690,256,571 *4749DBE682AEDBBF8D477A9BEC9AAC838E7EAFC1 straight-ahead!-a-journey-through-acid-jazz
690,256,572 *474952E0A6B216767DBC8233BFE29A4177E7A17B WILLRASER
690,256,573 *47490B58C092CC75DDA194732CE134D0D8978534 STUART.SEBRING
690,256,574 *474E829F5E12BC83A67E572C061E4CE58371E8D2 WINDSOR FROLIC (ENDING)
690,256,575 *47412195513E62884886614D8A6D76711F71F24B wmludwick
690,256,576 *474F50F02A99D889E4FAD17AD5D0812863B25F8D WOLGYEDONG
690,256,577 *474EB9C42BAD610BC08F2C8759591E34998AA7E4 wonbinvisitsgambiaforunicef
690,256,578 *47479E6DF62CFA3E8DA1CC8ECFDCFFE393B7D6D6 sunrisebertha
690,256,579 *474809896C48AEA2F56A89DE2B08FE2EF9AB6652 [email protected]
690,256,580 *4747E8503F0DBB23EF627C35A42BB62E1F665E84 [email protected]
690,256,581 *474DA5CE24797550D3DE854C2B92CA21C72BDF4D [email protected]
690,256,582 *474C86A79B473837F8ACD9A9B5DA53AF38E86E52 WWWSWORDSWALLOWERORG
690,256,583 *4740932FBF546E475D4ACC1CE2617CB54A39895C swissbusinessmanlibyanpoliceembassy
690,256,584 *4746BED51D1B66CAA2A2BD65526CE2E7EA71DED1 sworddance
690,256,585 *4741CF24D010E74AFC3C17AA33C6AFB94CD3DED3 xavier-hostage
690,256,586 *474D202E2EB22B0B0CDF198693BB84E8B3A862D8 XHAT
690,256,587 *474BA7C1A25BFA90F32E5A4874D341ED6BFB8339 [email protected]
690,256,588 *47416053AF668ED68DEDA71787CC2C817A834248 XIEWANBEI
690,256,589 *474CD1C8B2C96BC4122DA809A1605A284A408290 TAISTELUVALMISED
690,256,590 *474B4F3375FCB9097BC570158BE13CA1DF236948 XITNIBOR
690,256,591 *474243D7A64E8C7F09C2A177D235D915BC601318 talkcongressbundest
690,256,592 *4746E131403AC75857AEF51CA71282AA2B18C8B9 TALKRINIGJON
690,256,593 *474A22A515B2EDC47A74C0CCA193DA3BB1F8AEA6 [email protected]
690,256,594 *4748D752DAB2179887B32FBF78E7C1CB8C17F289 [email protected]
690,256,595 *474AD59B8811FA3D5215C6CEBA691AAF61013D79 xup+
690,256,596 *4748242CCEF79EF0F00AADF8AB2640F2C69795C7 [email protected]
690,256,597 *474FDB662F8D3A1E84C9CA950F4097E1DA07984D [email protected]
690,256,598 *4743515B8212AE1AA995432519B3831F792F8056 [email protected]
690,256,599 *4740B5295B6A93BFCA3A849EED93C091230CA397 [email protected]
690,256,600 *4744716CDDA99647D68DC045A816A387287505D4 [email protected]
690,256,601 *4742ED5CEB3C710D36E5EC50FB705241711A5F27 YAYINLANMASINDAN
690,256,602 *474D793FD0932EDE7C33481016CA62B465C9DC30 YEHSREHYENTRUOC
690,256,603 *4748B046BA98EF12061C852906EB27AB6689FB19 YesSuh
690,256,604 *4748CEAC6ACC706FDAECF04C111DEF4FA6727EAD TEDMANTEUFFEL
690,256,605 *4747FF08477B8AD8FB2A3C1AB976058CEE3ADCE7 TEMŠSKÁ
690,256,606 *47405F1AFCCD2750138508734133D0FCE6907A01 [email protected]
690,256,607 *474ABB3083D2DFAA9446705917EEF0FC81AAA9A6 yotsunbaed
690,256,608 *47494B1B0989899F0C5665229A95AAE98A23E3C4 youngklavetter
690,256,609 *47436EE1876F5A8796CFDFE702F24F44C9EB2A2C THEACA.NET.AUWWW
690,256,610 *474BA5BF4318A1D75D15510DF12922335666417E The-Declining-Use-of-Reckless-Grooves
690,256,611 *474359514453596DD4AA39942C2EC87D70434B1D THE-GHETTO-(POOLEY'S-PARADISIAQUE-MIX)
690,256,612 *474EC13671D5DF58EFF608A4656F07CB41E50B5D the.girl.from.peyton.place
690,256,613 *474E9100E0BFEC4DC831CB514C3E2A944DB8B672 THENRRY
690,256,614 *474AC09E2AE52987A706DFF7E0B8C2CDF59C214E thequestforcamelot:theprayer(featlaurasmichellekelly)
690,256,615 *474CA71B7FD53B3DE39B523AC5BDDEB730B575FD ZATILAZHANI
690,256,616 *4741BBC4B4AAF88DE20D04F782B4995FB71867FE ZBICDGJSRT2
690,256,617 *474151764E047439B44AB6F153178383F96B627E thespecial29
690,256,618 *474DA4D20FEBFA4369E7C44A0A40CB7FC3206D51 [email protected]
690,256,619 *474BB9BC4730A9AD6684C1DBF04971735747D8D8 [email protected]
690,256,620 *4749F4F21780CD95417A1A5F363005907834F993 ZHIHAI LI
690,256,621 *474EB14C0195EC2414CEACF4A31B7A9F12DC4B9A [email protected]
690,256,622 *4740224BA6D6ABF22599852C25C5E1701C5CF3A5 [email protected]
690,256,623 *474FEEDBA97A189F8469995A6CB2D809DBF73A56 tigz99
690,256,624 *474803FA8FCB61A9AD152088E9500E475B1BE634 TIMEBEAMS
690,256,625 *474BE68A63336E68A2D305508B1037474827DB14 ziya.yousuf
690,256,626 *47418A567B85CC4C06BDBA7C38D40AA793FE366F TIM.STOCKDALE
690,256,627 *474A1FBA088068566AE36D919E1BD5B0728BD6A9 ZM978435
690,256,628 *474C2CD3DCEC9961D50A7BB845642D8869778DB6 ZONKENXANXA
690,256,629 *47468D2BC093FB22D023F57053965168FFB75543 tldy
690,256,630 *4746D4E1D5C8E1074B181B8A5B3EC442BC75A17A TNESSIRREUGA8
690,256,631 *4742F640C14A9CE5C4A344FF7CCE7015F37EF59B TOCERTNING
690,256,632 *47466E83FE62B34B5B9AB3A3BA7244157EF3A147 ZYRILE.JONES
690,256,633 *47443D4EB51BB66E0741E5A6DC319E60A03082E0 zyzzyzus
690,256,634 *47443CF8E06A92B96EBEDE75235E69E983A3F1BD криницин
690,256,635 *47484CAB642D9C0C90F8BC67C853564E3C331C83 НАГЕЛЯ»
690,256,636 *4749DB1A2844FCF5B6754A2BC8EEF353A384AC71 travistruett
690,256,637 *474BAAE44D279A0CE6CB00CCDB01E480EED29EC5 TRAYYELLA
690,256,638 *474C53F4BB716C6B22B717D03EF59AFC353FB17A ПИЯКОЮ
690,256,639 *47402BC52BC977F0B4251EC012A4FAFF5B908827 TRETKURBELFAHRZEUGE
690,256,640 *474E40BB2402787F12DC984A05EFEB5787A251A2 РАЗДИРЕНИ
690,256,641 *4743C9895528761E068470E4C90514326DD06E2F TREYKALBERG
690,256,642 *4745CF263D3D7A0C2758EE8A40DCBDEAAD3CC7D2 [email protected]
690,256,643 *4743A516C0CBBC4D1BB41DC71C8D9FFA5BD462B8 «УРАГА́ННЫЙ
690,256,644 *47423281B6A7EE706784144FFD1B7D5D906D8311 шриганганагар
690,256,645 *4747B4D9B6E1D479AB5E4E960DC959F0F62AABEA TRYNETTA GOODMAN MCCLENTON
690,256,646 *47401089825E922A9E72525301A296BB3E4F4B65 と呼ばれ、噴出物の総量は450KM
690,256,647 *474858E7B2763C5D5542A42CB9C93265A8C22138 tux*
690,256,648 *474A83CD8833EC4A74BA7B6A0F4BEF93AC3BB1D3 TYSON.ROBERT.BEILE
690,256,649 *474EB60C541E22B83D4778E3693DC66F5E431FB6 UHNHBLKKKHING
690,256,650 *4748C27310A86AA07FABD14212F66357A6DE5823 UITZENDW0
690,256,651 *474E2E9624343D408128681FBB8944F827FFDB53 ululerei7
690,256,652 *4740EB913287A9C8AE88FD7CB04F48AFD091D5B1 UNMOLE$TEDLY
690,256,653 *4740F15414C6123E1B63DE30076DDC1294B99D22 unorbitaed
690,256,654 *47462B78777182023BED21EC70A7E11B57B0C745 uo^q
690,256,655 *4748FA0012431B56888F7C9B476EEEF66EE94A94 10JKAY
690,256,656 *47434FA786111D8D2530870685FF689311F15C1C 14909tl
690,256,657 *47450F155E509F924A2592E60642D11F97328117 1674021 USEIMMATOSALLISTUVATNAAPURI-JAL
690,256,658 *4741C9E6E6536EEA5AC12B8459C3A773E5F437E6 17.11.1730
690,256,659 *47405CC845E77951C4EC3A5E9A0F12E005959BE0 VANDITMARSCH
690,256,660 *474FC514E459FAFCD0FE06D21D289059ABDAC89B vania-verbovoy
690,256,661 *474FD28A50ABBBEF1216D974D642AEA97CA83B6B VANIKAAM8
690,256,662 *474491B69D08D73D33944503FD0B5E3AA2742E65 VANWEATHER
690,256,663 *474E8AA5DCEC18AA805571C094A348270305A91B 1AGLAMASININ
690,256,664 *4746C9802660563F15B3C206419E1708654C59EB VEKONSULENTERS
690,256,665 *474FBC7FAED9E11360E13485D210E0F43144D8F0 1 COLAJUOMIEN
690,256,666 *474001D73DFB11263C57B66AF8D1FC9ECA33645D VERDAMMLICHEN6
690,256,667 *4746F01494F3CCB97F78E691FBC44BF3D4CA79CC 1-DIENSTWEGINTRIGEN
690,256,668 *474A132033952B6A4C45436448A1DF70D57BD245 1.DIVORCEE
690,256,669 *47412E32D1DFC97A0C7D8AC87B3D5F5E1A2A5F01 vernpaladin
690,256,670 *474F9A597401ECF5CCD08FD6426A03041019C8F7 [email protected]
690,256,671 *4744D75E7A2DDFF50659C625050C2A7E799C8465 1.esiintymishaluksi
690,256,672 *474F9CB6FE3821886E717A9D39A3E57F004B9C69 1.EXPOVERTRAEGE
690,256,673 *474FDC4092993E623DA2D5A9BB86B40B60AADA10 VICTORIANIEMINEN
690,256,674 *474DA0C1A9B802AC68832D7D30562DDC9FE10B80 1.hdl-j
690,256,675 *4746142B533832A4B0D209D6E187E8D892066FF4 vinacandrawati
690,256,676 *474191AF78C1BD26C6CBF58572F3DB8A18DDA921 VIOLET.TAMUTA
690,256,677 *474B53639829A2F2CF1E357D145BCD0BB37E0DE8 1.internet-metadatan
690,256,678 *4746984C8F0E2014C9D784732BD19436B751E479 VISHALBOMOR
690,256,679 *474850A6425860DCDC57FDB448C3E56A89EFE580 1.KERUUTAVASTA
690,256,680 *4743075411FC59C8579B3E4762AC78BE5A1B70D4 vladimir.dovla.skundric
690,256,681 *474EC5768D164982CB87FF59734D0CFFCF75928F 1.liittymiskutsu
690,256,682 *474F3CC1CDB57BE53E6370EBAB0AF454E8CCC2E8 1MARIBOER
690,256,683 *47405EC94B9D1F6D6B556F0CA9BBD30D1533866A VOŠTANE
690,256,684 *47498E08CAAD626A443618EEEBB8C1D88DCB3F9F vrmrdrt3
690,256,685 *4740CDFCF867AEAB40740937E4BDB2A94A5024F4 1Q2W6869
690,256,686 *474E6B4BA402E61A9EBF0DF2F104889B892B9D1D WAFAALYAHYA
690,256,687 *4748426AEA863742B1917B0C36A336FD7CF0DBA0 WAHDAPHUQREIN
690,256,688 *4748E40D0D1274F0185904B72BDE570ABE0F1A47 1sankarillisella
690,256,689 *474FD21E503A30A1FCB40F18278A3CC468E38CE2 WALKERRABER
690,256,690 *474745601947F6CC7DFE1CB14394AAE85609DCF7 WALLY.EMMS
690,256,691 *474AABE35B02BFC29DFFDB5375E2DCBD7399C354 [email protected]
690,256,692 *4740166B9A7681EB7547838D4EE5A369B3656AB4 1tourrettes-sur-loup
690,256,693 *4743B963F5769EF94A0B4235E8669615B138E8CB wash-uprun-wild
690,256,694 *4746E6CEAEF5AB1BCDA29CDCF04DB335B4ADBBF6 watch-free-movie-onlinenet
690,256,695 *47497C9471347A107407E267BEAD9C1D1CDABACB wattages
690,256,696 *47433CDA40B6D4D7A2D0E6CDCD6DCFDB519E318D [email protected]
690,256,697 *47408EB7B5410DA1FF4E17FE6DE9C6CFE74C755F wendellwarrenfeltz
690,256,698 *474015F485D335C08603C811046904EFA7449778 22 TOIVOMUSTENNE
690,256,699 *474AE99412521DC0AEAAFD1452244F24EB44F91B WESHACKERT
690,256,700 *47467BF6DFAE39471EDD9E097B2A35F0D1774405 24465
690,256,701 *474F618FC87B33D3C4021258985F6360B8919E1A 24january1185
690,256,702 *4748BC8EB10C9E13B2E64A894E78925FFD9ECCA1 [email protected]
690,256,703 *474846F09C241F81125273429EE9CF4A4D42701C wilburnbendas
690,256,704 *47450AA3E0A700C79796D442599B2AD493930405 WILBURN.JACKSITS
690,256,705 *474172DF3E2FB08AF674BED69EB9DF94E63F3E00 WILFRED.CRESTO
690,256,706 *4741C55E2891F3E1F5D1B21629B6898CD4D41D67 29JUNE1797
690,256,707 *474EC47C450E2C3CCA42E0C6F4CDFD8EBB2CEA57 2ANGSANA
690,256,708 *47486F3F5608524B5188B59DFAC9F7B2B8399DE3 2-AUSZONUNGS-INITIATIVE
690,256,709 *4746723C82658379173A4E9AC254BC2831749F6C WILLIAMJOSEPHROMASSER
690,256,710 *4748DB92025F957A4FD88D9BC3CD5355803D4287 2C2652255
690,256,711 *474CCE0A9693D7CE5416516D85B7158E6A322201 wilmerfound
690,256,712 *4748D7306848F101C014D8ED0B1F0482608CFB57 WINDOWOPENSSRCWHNS
690,256,713 *474479F3296CA110293D0B9A02E0FD2B6FA1BE42 [email protected]
690,256,714 *4745FE2329A0D1EE5C6055D900FE22A3D61B1B1F wk;g
690,256,715 *47422409111B3A7E9F69C05823E64ACBAA5CA58B 2PIKAKURSSIA
690,256,716 *47429E4AE59F9EF31DCBD70726F93285A810D57E 2 RATSASTUSKISOISSA
690,256,717 *474E696B8F55396B9D2A0D6C3134EA4134CC9767 2standIndan
690,256,718 *474F0CE93AF2036621F614D549361078923B4503 2 STRASSBURG-LUXEMBURG
690,256,719 *474B0C47CA5D872C3968CA8AF12F7E90BB3D3FD6 wsnefat2
690,256,720 *474790FD9663AADB442C053FE81C14C957C847F3 309942 syl:n.puheenjohtajalta.tommi.himbergilt
690,256,721 *47402679DF610C3FB0D0ECD57D39E8F993A26211 311419 HEEIV
690,256,722 *474E2A07531AECCE9C16DD818B9E4772BED8939E WWW.IPAW.ORG
690,256,723 *474B35306150C4384C7E890CDA0AFF1A7C4E8DDA wwwoverholtorgjona
690,256,724 *47402525BDAAE81B8CFD57F5B3DA604BB320433B 396ozelliklere
690,256,725 *474F0CB8D2DEBE40CF5AB09AAD40AF95478113F2 w;za
690,256,726 *474861C9F8AE863B2081125163CBC5B692359D10 3EORDNOHC
690,256,727 *474202663DA6E3311D8CDC076ACCFEB1C8C1282F [email protected]
690,256,728 *4747AD955881B1EB0CF1FA7A9D73ACCA26BC4B4C 3ilovebenson9
690,256,729 *474E1F7972A60D6076A01E9FEFD1009F71FEEF85 Y5TF
690,256,730 *474EFCA338D49AFBB37C35A49A8A41C87491C67B yasmim.moreira
690,256,731 *474022993003A2BB351BB75197C3263834D6EF52 yasmine818
690,256,732 *47461632F117B7AFA8725CA78CBAB27954534DFA 4CC0UPL3R41
690,256,733 *47404FF3D3A0A3F70B85FCD78470B6B14ABD3977 yjwk
690,256,734 *474DCE5B16A2F9AF1C1BA9107E29E40300260E6B YLDRAWAE6
690,256,735 *4740D221338E4116F6629634B531E51D9ECF1C14 4GMELTZNE
690,256,736 *474816A7E0CD70EAFD7A0278B896EDF3494B9362 4HJRZERAGYE
690,256,737 *474F273325B9CF21E324AC3325A64ACFE20A8512 YOKKTUR
690,256,738 *4747FE408899170FE59DD83752A6CEA9E7B6E66D yolandanicoleharris
690,256,739 *474BF8A7561BD444167764DA38F523DA44A1D9A5 YONGALNAS
690,256,740 *474623ED6FEBA3ADC6E45BD73D08A7BD2969899A YONGPODESZWA
690,256,741 *4743B4D66720ED8AD20D229D803A12C600E76207 4JASMINEBRAZIL
690,256,742 *474FCFB675D89C8CB2E9A4400F5F4914897B4AAE 4JURISTEN
690,256,743 *47417E79D480466A2D733349CE11B299AC3EA491 [email protected]
690,256,744 *4749A918DA211B1A1E6DEE6C0E1AAB90E41597EF yu}n
690,256,745 *474F2818E092034F4D5186D95A8614E7511CE8D7 YVANFIL-ESCOMO
690,256,746 *47446649CE3C0C4754C3DFFF24EA3CEF84EB31BB [email protected]
690,256,747 *474821D0411415F0C2E3C1DDCF87E09BCFAACDCB 4RWORTHNE$$
690,256,748 *47473470CF5A6B2CDF235692861F9E1084F8DCF1 4SCENS1ONT1DE
690,256,749 *4748C48D34C2AF9F9674037A26A22DB407C0690B ZACHARYJUDAH
690,256,750 *474B49D4A1788B3FE3D46CFD23EDF9F18D547E69 4SIDLINGEDGY
690,256,751 *47460EA51247AA0865902F3B044E9D56AD02DF9D zackcotter
690,256,752 *474818A9FB0B938981DC22C4C6E113E1C65AF969 4WICKEDSPARROW
690,256,753 *474DE941A6DF5A64D47A94CCE512DD2132524083 ZEN KELI
690,256,754 *4745CDD3069AA8DBAD62CA6CC895DAD51156A624 54 MAGNETICS
690,256,755 *474EBC8A9E98E356CC847B618B874354C49DCB05 [email protected]!N9
690,256,756 *474640F6C9BAF9EDC3E34949688E3A34C6F60D4F [email protected]
690,256,757 *47429D54B8A2EF0BD36508B31D36AD65429A0366 5coccolith
690,256,758 *474E2EF99F9C01921F16E85A75B9B8F537D61AD0 ZNEREVIR9
690,256,759 *474857ABBEA54DCE05F5486323BC57263428DF8F 5EOTYYPIN
690,256,760 *474F1768F679136AC196FE839465CCFE68974E32 [email protected]
690,256,761 *4745EC1E6102FFF91AC1DC100A7C27CEF30E0168 5FLORIDAFRIDAY
690,256,762 *474130760996DA3875BECD636EC143C4DB1C365B 5GAMBITACTION
690,256,763 *4740E11E45975BE81C7D6E202158599A30C7BE96 ZTD
690,256,764 *474643B4B00914614778B07C570ACC7352B3F162 ΠΎΡΡΑ
690,256,765 *474DE1AC333E7BBC879C00C4E1FD08B4C05044A8 5MYACTIVITIES
690,256,766 *47470B861D65EB8A39E297CBE8CD176B9209ACE9 5 NANNEY
690,256,767 *474E4D3EE03865052227892AFD36F23B03ACE99B АШТЕДЕ
690,256,768 *4747BF85EA5C724976E2184D566693E87B977F10 5SHERYFFE
690,256,769 *4747D57A2745F5FDA6349CAADFE38BA0A762BB74 5THICKNESSOFSPEECH
690,256,770 *474E8A39EDE016D212C7760729515A079AA00E5A 608RECESS
690,256,771 *47444F0A8FEDEEC6DC72FA1CCF4A9A0B823DB4CD 6476
690,256,772 *474040680FDD591E8A880E394139D106685525F4 6BESWYMINGE
690,256,773 *474AE42DB06DF819CF2CF2AEDB866A089EA02688 фүзули
690,256,774 *474D84528F26040F90C45D9276F176764D09276F 6KLIMANN
690,256,775 *474B6F46A7CE7B624E2E42F4C12552E074A5E786 6MATERASSI
690,256,776 *474836900ACB2321691327175C2C740DA505FD54 6NGLIGERIONS
690,256,777 *474F95630BE336517D762C9E8FE6B96BB8882CB2 6RASCALVAMPIRE
690,256,778 *47467A4BD04C836DE63E1E6107C18169E1D7C490 6REFRIGERINO
690,256,779 *4745AD21F18D1D8A234BF5905E15C8C7D8331146 6SUORITUKSEN
690,256,780 *4743D3E4E10C7639F162CDFFC2433E9B8DC491ED 6UKYVYST
690,256,781 *474B608C3DC17D655A92588B4382C6D3E3B3C5FE 724913 soylenenler-dogru-aslinda-,-bu-fikre-ben-de-katiliyorum-.
690,256,782 *4746BD6AB2FAA3D03879738DD79EC17756FA7938 724913 sOylenenlerdoGruaslInda,bufikrebendekatIlIyorum.
690,256,783 *474D334590DC629E8E915CB5350218183ABB8917 7ANDERSONMONOPOLY
690,256,784 *4740BDADE44DEF5B3C2882415EC93E2DF71FCDD8 7.angezahlt
690,256,785 *47455C7C000B5CC817CF7BFE28483C6BA2A5D77D 7CHRISTINRASCAL
690,256,786 *474C8076202734830AD8898C2884EA8054DF3CCD 7emportee
690,256,787 *47478B69843C8E2BF42F7B2B50723C5F1B4E6187 7MEMLIST
690,256,788 *474C2E853A83A68DCE00ADDDB313745C65B0F3D2 7ODLEHCENI
690,256,789 *474F41972BDC35776E4B463FD62261943788BAF4 7ONETON
690,256,790 *474F24677868D663D4D9D3C4DA54AAE1B4D619CF 7u2zricniwh
690,256,791 *474133E9FA19B9BCD801418CD2B9288EBF02C9C3 845264 (.z...tasarr.).fIz307.fiz..
690,256,792 *4747516BB8A2AF3FE8F3351F4C4AB8098554CAF2 1221676 "icanhearhernow:`youcandoit
690,256,793 *4748EB0538DD734597B6125691F371D545D117FC 8ALRAIBMA
690,256,794 *47491AD0321AAD05FBDE9430CF8861447091A355 8BEDAAGD
690,256,795 *47478075CCFAC7C973830B9B8C91BF74E002ACFA 8EKATOAN
690,256,796 *474F9DDC3F8113BD61A26D985B48660C6568F942 1583541 aimonikunen1967soinisilander113tuloksiaty
690,256,797 *4742E3AA635176AD62AC642C746DBF675858D4C8 1595691 VESILAHDEN TIET OVAT EDELLEEN MAISEMAAN SOVELTUVIA .
690,256,798 *474011661EBB1C80C8AA17931D4DDAF4E3D0609F 8FLORYSHAK
690,256,799 *474D07F771931DF5ACAAB44229C1D64B49357386 1665844 tuhansien suunnistajien ajanotto ja leimantarkistusj
690,256,800 *4745AE9B2F91B834649EAF8B1C3E7F29BFCB16AE 8HCSTEALP
690,256,801 *4742B0C29A7F435C71A0EFE945A48482DE6EED03 8KIDMIUD
690,256,802 *474B5968111646DF3317ECC8C3DE8E48A362F27A 1850464 teht
690,256,803 *474455223E762838B5BD4C4541F8E60EE506BF0C 8MOSTALA
690,256,804 *474525890E3C201F52E5CBF729FE72F3877B7F99 }8{ ~` ~`Q#####3
690,256,805 *474F82342216CD69DF4570644A3645A5D8726B6A 1BLINDFOLDED
690,256,806 *4743F6D11E8355C46B0559FA00D20228C9FDF63B 8RYCERSKOSCI
690,256,807 *4748D0A49E24EEA89F71FEAE4480C9227707BBEB 1CHURCHILLDRAMA
690,256,808 *4743689D4FC4444B14B548EC0A381C8893D3836A 8======).*.*.SPLAT
690,256,809 *474327FE684664ED5ED68D49EA5290613AF4D436 1 DSCHALALIS
690,256,810 *47413C1F75FE72008A58B8B715F183F53A902C82 1 EDITIE'S
690,256,811 *474718FE86BE92A80BFA2898FC4DA96464991EF8 1 ERWUERZBURG
690,256,812 *4748CD8F7C39CE3ED43E6ACD8133C37E4AFDEF4D 1-galoppsamstags
690,256,813 *47421DC2E3ECE2990CE7B434E21F03B00DBD1427 958342 dOkUmU-alinacak-proje-no-bilgisi-girilmelidir-.
690,256,814 *4744616C3A2FB8CF4E363334B5A862B93F44CD1A 1-GOSTERILDII
690,256,815 *4745B836FB7B212B2A909CC42EB29F6BA57DCBC1 1grace
690,256,816 *4744FB11FF9D0011B1F076FD95995EB19514ECB3 1.ihtiSamlarInI
690,256,817 *47450AD246CDF4B6FAB8D6B8E3AD32143883007F 1ILOVEMARVIN2
690,256,818 *4744BA14A4D5FC4CAFB8F57789BB10E0CD0D989B 1.impfstudien
690,256,819 *474E8CFDEEF807C6F7E700EDCBFB50C69182693E 1 ITUMELENG
690,256,820 *474AE65003732453D8A801D06BDF99090AA0E493 9CACODORO
690,256,821 *47456899CEA0D63A83502EE24F458759D18939BF 9CADUCAN
690,256,822 *47440943828DA25EE1569BC30985EAB49470379A 9CHILLAES
690,256,823 *4748DE55480CCBA9FF8374675E86064427B86A78 9CHULATIP
690,256,824 *47418B0FC6236BA522983693A302B7262088BF5F 9COMPUTINGP
690,256,825 *474D957E902E9DBF47E81712B5C5AFA06411EF3B 1 kohlfeinstein
690,256,826 *474EEA46B3CFAD4D3FAF6BA5AFF8E745628E5CFA 1.LOPPUHAASTATTELUISSA
690,256,827 *474D8BE8E99654D296775A7D9D238B6676DA54D1 1-mikroiSleme
690,256,828 *4743A5B4C2AB762DD33A4572603092552F946700 1-MuRGaLLiS
690,256,829 *4740DACA8508F4C80396DC9075812BA375EF6518 1.olafsfjadurmuli
690,256,830 *474DF37B13DB744966C29C4E9DCBFE536055E3A9 1PUUTTEENALAISIIN
690,256,831 *474F5A99EEBD68634DD69E7A261D53D1579F0785 9PAPAGOS
690,256,832 *474F31677925441522AEB2F2072D12CB3B795F8A 9PERITYSTAE
690,256,833 *474922150D7E9728C6AC0F02855FA55BC593FAF8 1.rekisteriselosteista
690,256,834 *474416CB7B9F054C08AF9493819F73BDE3275252 [email protected]$
690,256,835 *474824F8A5A59AEB0A9D1B85B6CE5708B4D10B08 9SARAHTEDDY
690,256,836 *474154B38A1CB67ACBDA5EF640882526D884FA03 9TARZANWOLFGANG
690,256,837 *474E332A6AD9B7EAC6FB8C609DBC0793D50966E5 9thatzepplin1
690,256,838 *474BBE336AD0B0A4474E60395F86E05CFD8704FD 9TZREAWHC
690,256,839 *474541A0F6C2C968C3689CC93A764809055E16F5 1.SPOE-MINISTERN
690,256,840 *47494D042D32FBC9DFA655EFC9AD609711A73178 1STICKSYSTEM
690,256,841 *4744201777FAF9520B8489F3C30105B5FD725A5F A(;%
690,256,842 *47471F673A209E499432C3F5803974803AAE364F 1TLTSUUNNAN
690,256,843 *474DE36D16CFDA28123D58D52EA01C5AA47E5715 a2+9u
690,256,844 *47449D80681E36B7C437A07B7B91FE69225749C0 A2RVV
690,256,845 *474C226D70BB88DE934392C5F460E686D996F030 21F362ACBCDD4B3BBE16F22EADAB1482
690,256,846 *474ED79B96F5E05BFE7A41FD3F8C772882132316 a&9:
690,256,847 *474DD67E6D4E6AA59D1340C8E5CE8EC2049B7159 269269 ab in die geschichtsbuecher , abteilung fussnoten
690,256,848 *474D12F5ED40A75A7536E693C8355068A5C3DE6C aab83}
690,256,849 *4749F8C75EE5F5EE5E68E9F10F02771DEF066D3E aabm{p
690,256,850 *474B7362A02F6E6C79C7C6525D7E0CE406CAEADA aad:5h
690,256,851 *4740405D3CAE5DFE2D47CCAB377FF0293A1B1645 2-apartment-studio
690,256,852 *474CC54B8BA6B23232054563B69C02C35F2BA8D9 AADURS
690,256,853 *474DAC2845E9611572209377CDFB54E783E3C538 aapannayoh
690,256,854 *474702FCEE9FFD2DECEBDCCA7224EC1F795BFAFB 2.kayenta
690,256,855 *474142A7FCA12897ABC23675471D1F7837B7D775 AB0D#
690,256,856 *4745731702F61BF1D54F942E7BAB4EF48433B326 ABAAFYVD3
690,256,857 *47483B9079D072CE7DBEE088C9534E55063779A9 2NIEDERLANDE
690,256,858 *474C6D49B8B8195516D785262955C2D7AAE4C8A8 ABELENGWER
690,256,859 *4747FB0F6EFDED3FE7C4BCF3276FA80A43F29242 2.[[User:Zarbon|Zarbon]].03:23,.11.March.2009.(UTC)
690,256,860 *474CE38C50F52959DDAB1C62DD141EB17BD33440 ab(rz
690,256,861 *474684386876252D0B1439E65ED052EFC06DD5DA absorbthis(featdjnoize)
690,256,862 *4740A87784C82BB3F10D8B2EB246DA37996BA3BF 31DECEMBER1863
690,256,863 *47410ECB1A4BEDA7D360B0C9257236B47CF87600 3ARIHOSIK
690,256,864 *47417ED4594E3EA77924FB0A58AAD35D0488DE4C 3BEHARSKA
690,256,865 *474B8D2B88DC7B0E0F471668EAE5A87DF338DAD5 ACOMBS1579
690,256,866 *47472D49438535C5D26899149ADC562165CD1285 3-----b-`-:p
690,256,867 *474EF0D7187980DE4D8C8FC510B7A1A86A54EE53 acte3,no.20:morceaud'ensemble:
690,256,868 *474BCCAADED7C4DDE029D31239EBE6A6BCAB75A7 ADAUC
690,256,869 *4743BEEEC505C96CFEC4C9225A9B0B5828999979 adn-s
690,256,870 *47437A98D042E5BD3238D4F7F91EDE812F2F7211 ADRIAN.TEACHOUT
690,256,871 *47449C5D418AE706369D430E29FDD5706654CAB4 ADRIEL222
690,256,872 *474716D76C885F4448CFA995996BD7CDAC3A98CD 3RHEINLAN
690,256,873 *474FDF9C6692C3C088191E28B2E06010B2F8297D 3.TAUNOLLE
690,256,874 *474F96F54CE2F99CA90F187F92D95AB65B966D12 3 VALAISTAVIA
690,256,875 *47460FE6945D7DA8C7E3E351B9012CB90413EB61 AErC
690,256,876 *474BEBC808350228574F443381D31E589108B6E1 415GUSTAVO
690,256,877 *4745FCAA89D3F7AA60C23F88DD2EB86E91D37B63 431029 KIRJOITA-OMA-VIESTISI-VIERASKIRJAAN-
690,256,878 *4742AC9195612C4A31EBEE3D13034C7161C27E41 A.FAT
690,256,879 *47468F7745A9F024EE23E51F4EBB3E3949F16BFF -47BAA
690,256,880 *474D6631214BE31764126A16E7D90C53CC601388 AFREENISH-MALIK
690,256,881 *47449416BC93EF3B7443FFD8E7BEFA15CFAA5AB8 af-s
690,256,882 *4744620625BD9DF31FD97ED9D1C6912E8747E8CE 4DTNWTRGB
690,256,883 *47465C7E86872F9B1928B52ABACE4D004AF659CA 4FLPRIMES
690,256,884 *47441FE251603934D7DC0BA7F2FA80D99184F101 4HSURBYDN
690,256,885 *47404B248AE3F26D100F063A5DD979BA5A79CFBC AG$YU
690,256,886 *47440263AE8689D13A999341B1DE2D97D4907768 a_hps
690,256,887 *474D6D7B470F17230603868C0CA992665055AA62 4PRINCISBECCHI
690,256,888 *474C873E6A592BC2BDC394E1171FDD913D3547A9 ai+rt
690,256,889 *474CCA4DD26FC0A55975058AE12CDC8E04BCAFB2 4STENNODR
690,256,890 *474197F1AA801ECB0BEC308CDF6B48CA84CFC0B3 AKASMC
690,256,891 *474913509FC944A24D69B49CE87C85A97314F534 [email protected]
690,256,892 *474852014D588ADCCD283ADC404FD89EF0AD1BC7 4VAKAGABSW
690,256,893 *4747A69A109FE995D2A655117C047F8E1F44CE93 aktenbestände
690,256,894 *4745545E3EC355E126AB1A630D694902781A5FE7 527008 AINA.EI.KANNATA.K
690,256,895 *474563A874F428A60458156B4A6E5E91079FFA95 ALBERTSCARLATA
690,256,896 *474F2B0E2AB5C2EB4FC557F3B0DECAEE6609A4F3 albopannin0
690,256,897 *4740813A94566BC2872C1690C42C347718FBA711 59 V
690,256,898 *474610522F62ED12F993422324254BCE3C7AF79D ALEXANDERCHAREUNRATH
690,256,899 *474C74A12EE8DBDC3DE72CF66E0B83F84A0B0C4C 5BESTELSESKRITERIET
690,256,900 *474B17439DDDF85C885BBD5EB7DD674096960703 5BSWMALINKRODT
690,256,901 *4744E9D8F64427D00A00222C65A55FFA3FD0D002 ALG38
690,256,902 *47436DFDA426AEE8A09EB7CBA95BE075FBDC47B5 5ESPACHURRARAS
690,256,903 *4747E817E7850AB5B0496D4F203D1069B3861884 ALLENZHANG313
690,256,904 *47481A7B81EBA462535BE1F315B019993AE166C4 5GRATULABERIS
690,256,905 *4744929C364B917F96791D9F062C0E8B00B801B7 5IERSBSW
690,256,906 *474E4F1565412DDC7881BB124ED87005C1192482 ALTERCABA4
690,256,907 *474CD84E0C1AC2FDD2AB5E150708A7DA1BD193FC ALVA.MCKAHAN
690,256,908 *47420667C6A100B015A264E6E678B43A3D64C6E0 amadocrosswhite
690,256,909 *474315F7B8683C45CC05C1B77AC3C53D989C3B11 am=)f
690,256,910 *474CB047F9CE0E9FFE023E7CC4C491F7299F28F7 amosrhatigan
690,256,911 *474C0F01411540C4BC687810401F5CD2D9B3943C amytals5
690,256,912 *47480DD4075879489BA503E68B67528E43834AF1 Ancient.Tintinnabulum
690,256,913 *47414F65C2BB412391FD7799EF3E3471F95A7617 5TNEVDAOC
690,256,914 *47470A04F680F30D758E74732432D101879334D8 ANDREW.ANTOLIN
690,256,915 *4741496E04806F65CFED1773B313A1EAE8E7DD2E ANDREW.J.NORTON
690,256,916 *4748351A60E34AC8057A314649AD6E2F3B5DEC75 5unquittable
690,256,917 *47449042F71810C15AE2E2DB43A2FAE667A5E859 6ANTISTHENESN
690,256,918 *474693CE8FA2AA42E6E420A85D58E8DCB0D70CDD ANTICA11Y
690,256,919 *474A7912F4095598BE8CC3D47287480F2906B0AA 6BRIDGELEGEND
690,256,920 *474567FB4CF0C4540271432632F2D19856D5F7EA ANTONE.FORBIS
690,256,921 *4745C1F188CD68EBD89589806D7042C016694E09 ANTONIALUSKEY
690,256,922 *47414F0A1ADFE3785F2CCB9AA5C338302481298E ANTONKLUG
690,256,923 *474CC3F88EA63DB277E9928E82E14A31D51AA314 A#OGO
690,256,924 *4743966850DB587F53CFC808DED5285B2AF2775F aq/w)
690,256,925 *47498E3076FE3C5DCDDCA5BDD79E05A27EC2FACF 6TYTIKREM
690,256,926 *4740CA2012671CA480488E3D061226788E77B8F7 ARMY.SRWIKI
690,256,927 *47474E5B17294C2D7B2815F37811FC3EE532590C ARNIEBULASKI
690,256,928 *474BC2744844E66B914FAC92AB5AE12FBE65476B 6WILBURJEANETTE
690,256,929 *4746F754ADE410E3C236F4974BBEF34C9AC3CFDA 731932 grubun-Uyeleri-etUtlere-katIlIrlar-.
690,256,930 *474C5A9A444C0F0239F935ED80AA063E6E059A21 734andre
690,256,931 *4745754D5C8A280E35089391F00B3CF2E7DF1C8D ARTIUMSPOENG
690,256,932 *4742ABB4F554658C44C9890FDE05D3F02BE0C019 7ABEAUMON
690,256,933 *4740B864963234F62807241500F377ED21CDC4E9 7aeriens
690,256,934 *474B28765DAA119FEDEE1C56963E9C610FAD48A6 7 ENERVATING
690,256,935 *4741AC05B7B5339EFA0A6CEC786A23427F8BEC9C ASTIGSME
690,256,936 *474DCE3E2B5C592789CA40CBA5C2F61174A8435E [email protected]
690,256,937 *474552CA50FD72E0AE100DF1145B7B36E403CF8E 7FRANCOISMUFFIN
690,256,938 *474BA52D67756A62405601D8D4785B24A30D71F4 aswu
690,256,939 *47456DDA648CDD88C212A2C18AC3FCCF0F7D471D 7hydroxybutyricacid
690,256,940 *4749935EBF94BEE13CB924715F6B5F26F25D5396 atz6b
690,256,941 *47459F87249F3CFB5B7BF1FA9CDE45E70EBCD82D 7NANATOLO
690,256,942 *47453B74F0104CE4543821ED14692EA149345FE3 7NEVLADINIH
690,256,943 *474AEE954779623B10B202179DB84EDA760758D3 aucklandregionarchives
690,256,944 *474D2A52ED2FD750C5BD2EF6E3A38BAFFC55885A 7REITNEGRA
690,256,945 *4744EC1FCB2A6F83F57F3AB53165210F3925CD6B 7RUMIHSAK
690,256,946 *47468DD24795C5211BBE611F8ED262E3685D93F1 7SKOVEJERE
690,256,947 *474F974398E2207417987A50161AF863ECA34047 avatarana
690,256,948 *474CB89A6D2C73CCE7A3EA67D3874ED169C4E61F avl5o
690,256,949 *47495598B16BCDD2DF84684400191CF7A9736B17 AVO-W
690,256,950 *474B06C4085B36D28772F93709DF76D4B0D36221 8#@`~`~>B0
690,256,951 *474AC2C2DABDAA6EE0BA738DB0ABC0FA045E88AB 8---D`~>-B0
690,256,952 *474BF139710BF1ADC8E1F0A78986B5178BE13976 AZLINBSW1
690,256,953 *4749B1630DD6334C098625C9374AA97B380237E8 AZT
690,256,954 *4740F11803E4E13C2180C5FBA858E55B377B03CF b2s62
690,256,955 *474A9A4CB374DB97D56ED79AC1D6AC0D518EC3E5 b"3l,
690,256,956 *47470597E21646F2380BB86772A4D2557A155C97 8=====)~o.~o.}o{
690,256,957 *4741BAEF83B202B1ECD0E30BE14FA6BB70A89A35 b4;0
690,256,958 *474127E8FB8A3CD8E1E4D8A8E54FE10F6C0123A9 b6<1
690,256,959 *474E984F827C89A8BB0DAC09696FA156985B0159 8SANDERSSHARON
690,256,960 *474D2635B72968798D29F4C419CEB2A33EA95BFD B9)&
690,256,961 *47408CF7E258F01B1195157672D2D7514E820B6B 8YHTIOEKOKOUKSELLA
690,256,962 *4744E4756C24BB175F2C45C3E057BD2B50127784 BALTALUNGAM
690,256,963 *474A41D23EFC4AB20E94341DE686AF2D49331D26 banda.inglesa
690,256,964 *4745C9891AD319B60BA206376EF0C461DD68F3CA 997alvin
690,256,965 *4740810B6EE1D691DCBF0EF52736FE1150D92F44 baripsered
690,256,966 *474E58D031374CB2C2C3164C53B5607BCFEA1AFA BA/WI
690,256,967 *4744D6839B110CE3BAB550B95D99C0545ED32549 bb+4
690,256,968 *4742613A2D2798993EBA883E96D2FCDD9AEEDBAF 9GRAVEREBBE
690,256,969 *47412A1E21155D8C7A29E7348C331C46F64195BE B======D~0~o)0(
690,256,970 *47430AFD1802B8AA3EF8094DB49323DDE17EA0F1 BECAUSE YOU ARE A WOMAN
690,256,971 *474B1BE4A7BDAB63579D7B93CE90812353183447 BECKINGE3
690,256,972 *474669F6DCE6C670FB60A17EDD66B50D6EA6B323 békéje
690,256,973 *474FF840B3FCAAB8EDA185CA2896E4F09AC2A0F5 9UITSPANSELSES
690,256,974 *4742366D41B81BD04FE8A679A5F67C1DAD5627D8 9VOYAGERASSHOLE
690,256,975 *474DE5D1A956BC65AD07E4620A886BD933ECAAE6 9WASUKUMA
690,256,976 *474AB7E147C5F87BD81C51A2ED3DD7AF2FFE32D9 a.1cu
690,256,977 *474C4FDB67FF287CF5DE232F9986A956F93DE33D BERNARDO.MARUSARZ
690,256,978 *474D3F6DC2DF70341ABEE6139003E6D04CDF4BF7 BESTREW1NG
690,256,979 *474F36E9C50E8E73CE6E2A756F7A0108B966EA62 bfelp
690,256,980 *4742DACE0CECC0C96340C05CC187D4275D70F146 bgq"s
690,256,981 *474AA2390AE520956756C0C720D57BC314FF3294 BHFGB
690,256,982 *474FBBA29C0807B6BA35A265FDEC2D8DF55B616F AAA?&
690,256,983 *474C5FB41C921B0B78C969B448660762BB787D53 aaa*p1
690,256,984 *4745B6B94B2526A49EC1294A8E9460D17126A6DC AAEM<C
690,256,985 *474C08870C62DF109CE10739BC940137131C342F AAE;PA
690,256,986 *474212BDCE281BED49445CCC8BB1578E8498AFBC aae=um
690,256,987 *474CF6FBC3E3831967E462289B4E9C6A7B99D161 AANVOEGING
690,256,988 *47471230201E0FB391FCF9F52E3B331686874C7D abaddayformymom
690,256,989 *4748AA6D7BDA0778C2E8F4F31CFADB8A6BD2769F ABE.OXFORD
690,256,990 *4741FFB9DAC84EA4EF19457FD389BA9260009CD0 Bma6
690,256,991 *4748B313EB4CA61BB16798A9E09BD7C96E4F1185 aceh(
690,256,992 *474D8E495B55CD78BF7CFFE95D2906D012224D49 adrtd
690,256,993 *474F532ACD0A58DC9D6D2AB513034BF14C2328CE afey4
690,256,994 *4748780EEC482AB054EAFF86DE94B29A3358E293 brenda-pop
690,256,995 *4747F33EF9FE2810B08A3B4EB522912409EDB984 BRENNANMALCOLM
690,256,996 *47430DA084BFD6152C47FD2BD0B5ABE754E2EEA0 aflbl
690,256,997 *474C6D75504018F6C0AE290B110597599F3D4450 bretcropper
690,256,998 *474098E60311A6C60C26D5E8420C4470BC0A0024 af-s
690,256,999 *47445EC7831F0E6C29A2E578F1F38EB0EB9C7BC0 brla
690,257,000 *47424D6A96843BD1FA5B103F7E7DB349CDCBB34A agpy5
690,257,001 *474F7A9478A9071591356294DCD3507B52E6ED84 brookshaerr
690,257,002 *4747DDFC5D6A9E4C1413A260819193319AB7105C BRUCERITTHALER
690,257,003 *474FF0015DA7BCEF73A80591E4178143606ABFA0 ahetukam3
690,257,004 *47483F4CECB2202BB56F50B6EF7AFE4A35B49AA9 [email protected]
690,257,005 *4741732BABE9EA3C4F13B92178F4F56084AB1D3A ahvnu
690,257,006 *47405E891DAD6720A94F6A724711D026CEF2CA09 ailqn
690,257,007 *4747F9ECB1F80500D2861C69EAC6F025F0D4122E akitaken0
690,257,008 *4745AFEFE4ABECE028865972D5DBFA1A1B6618F1 A$L(#
690,257,009 *4743BE837A3E6D94A64FAA5D608FD4138F32825B BUUYNIAD4
690,257,010 *47458FE4F188E8BF09A7922EF0141C543D1E99AF albertogeitgey
690,257,011 *474749308ECC468DC56E4ED323BBE5111FA86AB1 A'''LBION
690,257,012 *4742E315BB8120FB02781C1FEDD1E18245A284D1 bva%#
690,257,013 *474C5BEB4FBADD2F545D3BA4FB19E33143EFE982 ALLELUIAOFTHE3RDCHRISTMASMASS(MODE8)
690,257,014 *4746BC21593D8B1B00DF0CFC764F7747D46F0480 byntj
690,257,015 *474219BA36C443E76274F3089BB17BABC24ACA74 AL??S
690,257,016 *474C7B84B19E483E227FF04D1337A713C30F9737 [email protected]
690,257,017 *47465F7A03658B5E4DBCCCFAC359DDB1B60ADCE7 a_mrs
690,257,018 *47406FD3BCA223C97AB0975D540AFB5F263332EA amtenesulmthmtenesuferh
690,257,019 *47492CF6E64C7E280849D45B175407B7B302C4C1 amybeagle
690,257,020 *474B755A13D5A147C7B573173C9B4DD8F9D15DCD c&a8.
690,257,021 *47470A72BE5454B83FD7B424A5CCB70B1A747517 ANGELALATTIMORE
690,257,022 *4741C725E8A0920763EBD95DE64B8EC9E027C466 ANJALI-RAJEEV
690,257,023 *4748201E1255B9884971F7C1532AE7EA9B60C684 CALVINHELPHINSTINE
690,257,024 *474F614AF828B39F4BE934CFC7CA8C24B758FA13 careltheunissen
690,257,025 *4749E84832F99A3153B95B9254B79BFF615430F4 CARLOS.HIEMER
690,257,026 *4749F4A14741837AE4F3DE797B63A90D9C5F14D2 antwansaroop
690,257,027 *4740073EDE79BE1B584A9815F4AC1FC432B674E1 ANUSHABHARDWAJ
690,257,028 *474119C78629EEC408F8D713BF392DB1207CBFE9 carnavalsmedley
690,257,029 *474EF622A615E85EF84148126CA76614CE065009 [email protected]
690,257,030 *47495211D0383F935FEACAB94608C22F51D40905 CASULUNGAN
690,257,031 *47485469EB76D1FF560F0457C497F672132F19E1 cb2de
690,257,032 *4745511EA1557C0EBF4638101CF698F66BD81599 c-b.d
690,257,033 *47447A8FBF480081741EF63D423AE47B922BCB99 Cc=Q
690,257,034 *4749BE1B4041E8B59E68054C2390A449E8EC5098 cd05w
690,257,035 *474468F73D3A8BEE50F610976E3F80C6EC6E006B ARCATONING
690,257,036 *474A8413B0D3B51596731B3B526D0F9EEF686ED8 ce:ks
690,257,037 *4743BCCC205BD7B8E5DBCB58ECBD8D85CE793E7E ARTICLE205153602
690,257,038 *4740E549C839310ADCF684718E83766693C4589D ARTJOM“
690,257,039 *474F33478E57F2809C9DB513C3F233E09AD5033E asdfghjkazsxdc
690,257,040 *474F9F7A6C5AF77A481937395C51D0C5019A2168 ashleystobaugh
690,257,041 *474FE43498EEA7BDD7F6048D01AB5F729AE1203F [email protected]
690,257,042 *474C07C1C1D5F8D3D1F415229642B1B236FB01CC [email protected]
690,257,043 *474D3F07344E0A60B3A83503D8981D5BE63C345A CHICHAMA7
690,257,044 *474AC9AA7ACC0123EBAB19A4930A20FCAB32ACF7 AU7H3N7C735
690,257,045 *474FAA5293E035862CB61ED37233468F20A54862 aufforderung.zum.'oho'sagen..h.boell
690,257,046 *4743E6C242FC96A95ED64BBB7B5ECC3D975EF6D2 CHRISMACHLE
690,257,047 *47409D42416351703947D019E7B6CC7F90C1A532 christmasbookssportroundup
690,257,048 *4748A25BC9640B6EEA20D72639C9469D88479782 AVERYMANOZCA
690,257,049 *47460BD9230606D16A9AFCECCDBA747985C72CFC AVNAJ
690,257,050 *4745B94B247387394D10424DDC825336CD5924DE CJ/FO
690,257,051 *4749E516FB23FBFD3FF2C90AB6FC00E1B42E8AB7 C%JOC
690,257,052 *47463C2BADBABC62AB52FEC360E9B096B3C2D417 CKETZAL
690,257,053 *4744D3E0B0131ABFD0F4483936AD45F8BF2674B4 CKL1
690,257,054 *47434DC78D5BD6D8532751A4D8FD4C4026023F98 c.kyb
690,257,055 *47469643EAA8D2608E5042485CFAA652DCA9A736 b0113d3
690,257,056 *47495529539FF2D7691FA90FEC9946FA257FBD37 CLEVELANDLINDHOLM
690,257,057 *474A615612AF9D81FE089D335DBBFEBD12F9D4DB B3F=P
690,257,058 *474FA1E3636F97E7922B5C97FFC9AF62F610BF33 b!60
690,257,059 *474F19CC4ECBF82E5A098A3DC4BE5E33538BB670 B.8i
690,257,060 *4744AD7827288563CABE235EDAA9695F5FC2626C b8wdm
690,257,061 *474C183CEEDC0D745819BE806BBC951EC524AACA COI0B
690,257,062 *4749E76C1B6C23ED634E5F02593224AB0449957C BAKERY-MUSIC
690,257,063 *474FAE6B031117E44897E52AC2132407CAA00ED9 [email protected]
690,257,064 *4740354DEA3311D2438A10985A132F3782E7E981 banthym
690,257,065 *47428067C11798137B2DB5CC3A36493535F97199 BARRACUDACUDA
690,257,066 *47450AB847CD2B5C890E5F24A91CE2AC731B9EB3 BARRETT.CRANMORE
690,257,067 *47435720331B14EF3328EB2DAE56EDAEF6994481 BARRETT.YADON
690,257,068 *4741B38365122E35A8B9008C961651DA46E00C1F cookiespolice
690,257,069 *4740907B70A00863A6519B542283FDD024ABE23E COP+
690,257,070 *4743DC8882F2D3AD444AC2038F5894E8B183F55D BAZARENS
690,257,071 *4740A840367CA94D5459EA99E89CA76F36B7E4BD CORRECT.JUST
690,257,072 *474F21F74A6BC2B66A659A8F73E343A144DE3C50 [email protected]
690,257,073 *47400E6CCF405350A517A39FABFD5B1383E888D0 ‘COURSING
690,257,074 *47422E7952ED4F6B30226D57999BF086C1CA90B7 B======B.`}o{
690,257,075 *4744FB6F40AC11DDB47CEAA859AA5E67047EF0C6 covavanos1
690,257,076 *4741C681BED3416E8B24F8CC9A51211400A6029F COZUW
690,257,077 *4741DED84A4CE8C15747B317EA66249976BB581A CPUP9
690,257,078 *4744B7F7992F473BDACA9A50D1C76FF95C313F54 b=dd)
690,257,079 *474F36BC3B0638FC790E3247499A5FF2A83C5C00 crowning
690,257,080 *474E22A5DB6A5DD2E8586B14253FFC1DEF1FD49D benniegromer
690,257,081 *47420B77854EC4D8CE8EA8A2DEDA3D30D14D30CB cs$&j
690,257,082 *474B16E12F33F6813F234040FAC5140D17719184 ctrdl
690,257,083 *4745356ABD45892A7B1581227C2B609D31A3ECDC BEVERLYATHOMAS
690,257,084 *47470B8CF09B8A1D2AA5923E1DBB0017736089FA cuew
690,257,085 *474D891FB39D70B95ECCB7BDB493FF562990E177 cw;7c
690,257,086 *4748FCA3EAADC042FB8272C4AEA3E5362734E115 [email protected]
690,257,087 *474AD3731C4D9BD99D260CDBAB5D4D8D66D67DD7 BIHEMMEN
690,257,088 *47416D37E2DECAE7FC84C6848EAD8CBC220661E8 D3M0B1Z3$
690,257,089 *4740A5E53A961E03CEF5F9BBEF97E2B8357350E3 BKJI!
690,257,090 *474C0DE58E856313D089C6E39DB2C6107D1D482F [email protected]
690,257,091 *4740BE48FA51E70E19E8624ADBA7F21CA96082D1 bkqhp
690,257,092 *4745F3837782B5138439A3894992CD00A601AC9F BLAIR.HIATT
690,257,093 *474A75BB056B0DC348DEDA0FECD44C04C68503AE BLDTRNSFS
690,257,094 *4749FB31728838A5A1EAE022553EBCAF8CD7A71B d8lzt
690,257,095 *474A473D9DDF44CDBA1636DD763B8F39419AB7DB D9B"6
690,257,096 *47457D47D8792474443D91998A2246881337E187 DAAWNJIL9
690,257,097 *474B6136E338BE7A61ED6E571D216FF467D97E12 [email protected]
690,257,098 *4746F02644455970681E2613EBF88EF291CB171B [email protected]
690,257,099 *4744C4485A2402BA4505ED8DDEDB9E954B6193BD DALINLEE
690,257,100 *474E360FE27A13F54334CECBFBDC0557763FAB8C b?nl
690,257,101 *474F08ED6C9D318E23F0A2246E4D5DA96638A3DB b?ok#
690,257,102 *47450D812B0041EB31AADA13D31AAA2122010330 b.o+l
690,257,103 *474D898DA12EA2E5A5D640F2FF8C00E7C7158872 daronsavic
690,257,104 *4741F375B0807C421BB2E69FF30976A0EB177543 [email protected]
690,257,105 *474BEDC9CC1A902AE779023407ABC906D9FB0034 BOOMING
690,257,106 *474882ABF38F043B019D88BB96474433AB8416F7 DARTSHIPS
690,257,107 *4749C8AC35B18BC7FBF956A90075FB34A6C681A9 [email protected]
690,257,108 *474915E9E3A41269618461CACC99FEA9E0079B30 DAVIDBUCKNOR
690,257,109 *4743650579D468984CB84978FD758D26B17043DA D=&c
690,257,110 *4749DF7E9B5CAD1A513174D7684F1C5BFEACCB65 bradlycuthrell
690,257,111 *4746DD5A9CAF995B45A8564BE807BF43BD6995C7 BRAIN.LIFE
690,257,112 *474196FAB2100F066CE9C6D02DABA1B58E167718 BRANDON HINESLEY
690,257,113 *474968E536022F24DA43E3A43E6F370FABA3510C BRAUU
690,257,114 *4744FDEDD89924B6D4311BBA65BD965360AAB561 brianimes
690,257,115 *4745E8069821CB995E4DD45864E6AE5B3CE11636 BRITTANYCALLEN
690,257,116 *4748F6C54D16AC3E5DB00DF1CA40F7929F30A250 brla
690,257,117 *474CC8B5F9FE35E18E80DBD6FBDA3C87C06724EF BRODERICK.LEDEBUHR
690,257,118 *4744D28B741F8D87A6D7CA758CFBAE31475E921E DEON.HUGHSTON
690,257,119 *47490CEA495C2991E68FD4F9DE769ABAC4DC84A5 derfahnentr
690,257,120 *47402DD24CFEF9978B1C051EC6F0BD6A61B82F34 bryndorves
690,257,121 *474FA0A38CE1D17D81DF9BD32849434DC81B2FBD devonbobbett
690,257,122 *474EE0A35D1875FA5AA15A8E69C992B50B6F74B0 dewaynefowle
690,257,123 *474A25E9F8F0FE43717BE09C56825DC0C4F8CA6F Bt1"
690,257,124 *474E96BFFEBAF605E0D3F5744D58D4FD2AED9B45 DIANNE72
690,257,125 *474953370277BBA860EE679BA6D04DEA192774EC BURTONMIDTHUN
690,257,126 *47438B56C575490D8CDC3C3FE2D9B9E88676211C DIEGOSCORDO
690,257,127 *474050A1ADD3F48E16CC953A4B72D539A304802C DIE-ORCHIDEE-AUS-STAHL
690,257,128 *474E14D46079E160BAA6FDB92DE5334EE8D5CD52 busterfratus
690,257,129 *474339C5854F8FAB917AB333CB6FA1F2234AFD61 BUSTERMERRITT
690,257,130 *4748018E63F29B2303BA9773CED3FDCE87F62A1E DINNENMEK
690,257,131 *4748FE58D0E0A111C31CFEBB3AFD431697658980 bw8&t
690,257,132 *47469BEC17E3D4FF59033661AE40660C4575E14B disillusionisedt
690,257,133 *474E5BB9D1F63EE0F6D6746C5B5F12562076F5EF B+WLM
690,257,134 *4741557B08F36B9F5298EE405F56572F8F4D6CCE DKK6F
690,257,135 *474EF5888C7003A2D9BBDDC766CEE3C98480D51C dmkry
690,257,136 *4741C39B71E59B1442787AA8ED8536E12C8CA084 DOBLEFEA
690,257,137 *474A9316701BA1E263393F8C2E7030727B21F9B2 C68CP
690,257,138 *474B2B39CA1955CC3444795BF0B083BAA1592918 DOGGEJAVRI
690,257,139 *474B8BA6647DFB9648BBB63F643E17BA7E754CB8 c9eem
690,257,140 *4740921E62D3EC26ADC4475012A079CF63EB78EA DONGBASOM
690,257,141 *474DE6D50CA782B55FA5E0EACD3BB87AC651B5D2 c9iea
690,257,142 *474DCB9F4324AF6A466EF39879F3A852B4F75B3D DOOM2PHILIP
690,257,143 *474DA64E6F1E3F55501349082708AF1BF0EAC7C5 [email protected]
690,257,144 *4742522A269C14CDCF563F6EC963038D0A81B412 [email protected]
690,257,145 *4746964A9C1C40205C755935440F1DF68B629F2B camaro&
690,257,146 *474FB6D12060C698121E5BFE6C7FFABED2077A8C DP+N
690,257,147 *474331490D9B84874B20FD3FB4FE6F7CA0B913A7 caroline-dykstra
690,257,148 *4749B6AEE98EDDFD585073FD130F809DF74EE5BD [email protected]
690,257,149 *474C71EA27F2DDDE7886671E7F91A4988C45CBAE CARTER.ROESING
690,257,150 *4741B9491DDCD10DD3DE2865AA7172C160C6F333 dream94
690,257,151 *47437385C8464CC3F080CDB99C19A6254B48F70C d"ro4
690,257,152 *474F66559D121546E589D6DEE0368D2824A6BE82 [email protected]
690,257,153 *4743534D46F9D485AE001CA312B5F8F6EB0E3810 drweska
690,257,154 *474C85E9663E48FA0789B26604E978B0D052C294 CCBSSA
690,257,155 *47411DCA7AF88135D5AB9E9245E2D672628684A1 C%$CD
690,257,156 *474233ED6776184C30A8AF27CAE0878CB86291AF CCU=E
690,257,157 *474A2B8D8B477E45CCFABF29B8AC50F4EBC76853 dustyvlcek
690,257,158 *474604C2A323B1DD3F71E954885A9C1150ED1A66 Dv8F
690,257,159 *474B24BD44BA466F7D2B0C195842745110E5D3A6 d?xp
690,257,160 *47442D6BFE86A56CEDB9A549A07DE9C890840DAD ch,!#
690,257,161 *474E2A9E639B9D7E6EB51A69099EC444CE311E4B CHADWICK.KULIS
690,257,162 *47454963059A8A508014DD6E965F765C78A2CAB3 Chapter 0107: The Cube
690,257,163 *4743FAD294081436A8D9E04905DAF88C3A607E44 CHEDDARS
690,257,164 *4748DE0C8D553DC69AF5DF926DDBD991920DE907 ed)/l
690,257,165 *4749E7180524B9B1A7B520BC10399129DF6DD246 EDWIN HARRISON
690,257,166 *474A431B6847F6056959DFA8BCDEB884F1E69F34 chongtanzer
690,257,167 *47481B027D97C4C0098FF4B1F679832CD38676E6 choreic
690,257,168 *47416AA866D0941E7870BC27B9BA65CD941D554B CHRISSKLENAR
690,257,169 *4748B07006614817C1162A415ACFE90A26C4AB39 EGII(
690,257,170 *4741BEC472C4C662C120E8971057E360CC949A3E egr-m
690,257,171 *474648D866CE91B246F3521DCD6C6A618B48FE3F c;);i
690,257,172 *474B3E72A1CD98EDC46B64EC1009B3F8E423D59A CI1AH
690,257,173 *474F9C8108D1AD50079D6E9E739561BC4D16864F CITCELAID
690,257,174 *47421FF38A72CDE67D0C8714EE5CE0C3593B16FA elijah768
690,257,175 *474838035D19736245F8E333B40BA214160C1D80 ELLIANA189
690,257,176 *4746C6349316C34E57FC670860EBC36155EBE84B ellq2
690,257,177 *47496A4CDE9F70E4737E5D508FB7B09716B7FD74 clatent4
690,257,178 *474C737C8A36A7D0DF5906C9DEFA88F05413AE80 CLBELLEANBELLE
690,257,179 *474D491086880F632765629634D021CE25277384 elvindeprospero
690,257,180 *474829B86C38F9A435AE69CE4674675001A1D937 CLIE66
690,257,181 *474E70C169122B3F0777CB3D1DB291D66F9D0D21 cliffordturnbull
690,257,182 *474F5515C0B5837CEC6407AD613E3E422178D827 CLIFTON.ROLLA
690,257,183 *4746CE4BBE8FC75B8CD9D0261577F696F9FADEBB clintley
690,257,184 *4741FD8315571E8C9D9D070A463C0AC021BF594F ENCANTO(ITALIANVERSION)
690,257,185 *47469BE8310AD8D33A106A5350C3318DA27F4D04 c#mt
690,257,186 *4749301BBE6874DDC1C619EA7460387CF1AA7858 C_OM
690,257,187 *4749C4E37A8497063BCE8C065DCB028FEA4FFD48 [email protected]
690,257,188 *4740E5872782838E2A87F2AF7729D9D8985BECE0 connor.hannah
690,257,189 *47416985511BFE93B4A6682A2203548D8C522FB7 [email protected]+1NC+1VE
690,257,190 *474873F18AFEE82B5FEAFB878E1CEBAFA45CC12A CONTRALTOU
690,257,191 *474D5EE9A8B31C7E5A08AA256BA6B8B8E9F9BA61 COPPERBED16
690,257,192 *47431D4B948C8AD0CFD366C090AE0C3019C1D365 ETHANMYSLIM
690,257,193 *474DF01A46DFE6CFA6AECB9DF409B1F64AFE68E4 EUANR
690,257,194 *474981761C8079B17676AA08D92F310A3ACB4830 evertoncardosodasilva
690,257,195 *47404AA572F5077ED312B3A1542CA502CE32F530 EXPOSAIT1
690,257,196 *47488D26BEB1C7B516C4392E1FCA55766C18EC2D FABIHUG
690,257,197 *474FFCA27DEB2980F236C991EA85F5B0EE8A532F [email protected]
690,257,198 *4748757EAC5FC455CB1ED796D314A0BC63AA8BE2 farewell,.our.demon.lord
690,257,199 *47435A2067BD19469B503C50C8511CC18A497591 FAUSTOSIMISTER
690,257,200 *47405909919AA8C1EEE94101DB90D80F7BDF76A3 CSD)W
690,257,201 *4744C7CDFB2319A48B9EACAB16E0DC733B31B5A7 FLORENCIOTORTORA
690,257,202 *4744E1D198798384E2D3D4A7FCBB14334E09BE64 CW9U?
690,257,203 *47476635B615DBEE972C8264711C329CE2E73670 CWSVD
690,257,204 *47406A2C0783534F2EBA39A9B890CE482ADEB050 FORLYSTELSER
690,257,205 *47461814731A7763834696296A1AF40A1CF8422B fourplussevenmeanseleven(remixedbyhowieb.)
690,257,206 *474456E04CE5DB317F92C80170234744BF76A06B FRANCISKÁT
690,257,207 *474F9294661E0C1FAF9F050448D4B662BA8E6A2D frankchanney
690,257,208 *47414B1F019EF8CA4E221BB6979C6E9B5D5ED573 FRANKGUILLERMO
690,257,209 *474922E59EABAC5E408D150D4F6431065C968450 fr!c7!onle$$
690,257,210 *4741C9EF6B81E72AFC64C6FA0B7849D5C9D37A56 Fred.Burgui
690,257,211 *474142CDCC9EA1544B03742C17CC58085D125F80 d(%1o
690,257,212 *47480D4FDB7403758D211FCE9C5C5637CF12158C D1XD%
690,257,213 *4747E907344A05364FBBF269F877EF08A85B292E freeltspangt
690,257,214 *47447D16288D30E6F410B6BB628ACF114DEBB2D5 front2423
690,257,215 *474ECDB824100DA23F780F4E149282C2424664B2 fyyvevpm3
690,257,216 *47442C6FC71631C888CCCDA841F51AA2C2E84B83 D8U!.
690,257,217 *474E8CB2B25F859CBE6CE3E21CA1EE1AEF782C45 gajevomed
690,257,218 *4742976B43451DD01A202DF35B2E0A5FEE8A3692 GAYLEBRAMER
690,257,219 *4742E06B409639F895EC96F91808C2622A40288F GAYLORDMARKEGARD
690,257,220 *47452C361EEC928024705009018D956A8F743BE6 DANDOLE1
690,257,221 *4740D775838B32E03824FA913E3498B271D94AA7 DANIAL.WITTLIN
690,257,222 *4743D1496014A56A3B252EF3A4C17E717D1AB727 DANI-BRUNO
690,257,223 *4741704799F0FEBC02F4C05634F76ADEA5FE0604 DANNIEDEAS
690,257,224 *47417C4B510D56F97ABB3027A5E1CDD854E479E5 darellgrinner
690,257,225 *474639E54BD0EC6370364F1E8279EE85AA0A1450 daringarafola
690,257,226 *474C2E1870E762AE3EFDD4CE8E64872E061F58F9 gertcoetzer
690,257,227 *474D7D0D0C3DAD331A1543D72F03664AE9403FB4 [email protected]
690,257,228 *47451B5FF2A8E464CE48636FCD278EBA05D2FD34 gi2!
690,257,229 *47466A0A9778D3B61F61D5A7B01200BB091CBFE3 (dawn)が『
690,257,230 *4744AB6B3FA346B26AC74C55F7A691D9104D0A9F DB,O(
690,257,231 *4745BC5663D0983B23E2AAAAA214AC1F866AD677 GLENMENDOLA
690,257,232 *474D6B072CE3DF7C96BCD83C8FEA03E9EF4FAA56 DC8WK
690,257,233 *474BDC8FAB8AD68F7D0128CCC3FD90050557A21C G.L.O.B.A.L..Takeover
690,257,234 *474E3C1721DC26FAF844A28BE8724C262600058B DCR$W
690,257,235 *474812BA16D479E5B034FA05DFE23F5F11A095DE gracefulways(featanisfrommonoral)
690,257,236 *4749010E1664044C8BE81011BA152A409C8CF997 [email protected]
690,257,237 *474237EEF7AC27F1BCCE1A1A81873CAA00635563 graigalas
690,257,238 *47485D88CB8A553FECD159A37D2FD005AE6A931C GRANDMA SONG (THE BOY IN THE KITCHEN)
690,257,239 *47433373BEA2710641B3EB14D1AEC092F8CCBA5E DEEDLE,.DEEDLY,.I.PASS
690,257,240 *474AB685675661A9B72E06115ED4FBAE29DE7019 deedrahvs.talamasca
690,257,241 *474452523E080FFC964B3F8A42D5DFC889D779F6 DEERBERRYING
690,257,242 *4748ECEBAB674A1DEF9DA55706DAEF0137CCF66B DEG9?
690,257,243 *474850F2800F3EA1A65322F838697E174739BF96 [email protected]
690,257,244 *4745BC222645B808596E7F54AB9915DAC2F41CEC grumpily
690,257,245 *4742342773A0E32740548B941801615F4EF2CD5A Destiny's-Flight
690,257,246 *4748B5D60855E66A1711E67B74D47182C3B2AA0E DETD
690,257,247 *4740A6925AC50DE763DFD27602B339193B6B50A7 HALCALDRON
690,257,248 *4744D49DA06198D76ECD678D3938E34316A5E5D9 HAM711
690,257,249 *4748F889E801ACA5E24A075FA7688D2471333531 harlech!
690,257,250 *474608DAC5B9E7F0F2659EBC3F4E8E620AD3FD11 harryturrentine
690,257,251 *474312CD78B4552113F5FEE25928AE4A19D49E33 dhsn.
690,257,252 *474789CD5A02FD749EE9A9A39DEDFAC35D4C34BC D=I8
690,257,253 *4741655F1A86C6DAC887FAD2D780DD6F9D942EE1 DIETERLY5
690,257,254 *474FAEEE147E00B595C409708543B0361B8C9B15 HELLBELL8
690,257,255 *4742C563202115E1034391599D4ADADF3BAE5ADB HENRYSEGURA
690,257,256 *4741F175A70F3B7F1B01E71C24ADE10A1052E415 diomatin7
690,257,257 *47469A67A45B5FE8D49370B6F2EB7632C047BBDE DIONARCID8
690,257,258 *474E5456843FDB9B67AFBCA8ECFF21D86F8C56B4 dixieciesynski
690,257,259 *474B4AC3E2E7A849D11E9300CE3817D854547472 DKARIANT
690,257,260 *474EFABCAA01939803A8C5DC22DAC3F6781D4731 [email protected]
690,257,261 *4745B411C7E452A3395DE29C6085F686DB03CF00 HLUNGIN
690,257,262 *474C86B34A96305ADB748BD7DD1EEB41B3A24D02 DKU.
690,257,263 *4749023D6E3386790A3D9D1E4AFD3F91FC1DD5B0 dm0&%
690,257,264 *474C9AF046B7C5A13F2C0B5202FE28292F478600 [email protected]
690,257,265 *47461C6DB28483C4974A6C5D277B112ED76DC723 d=m%g
690,257,266 *4747798FE30913F4EED9402ACA5225D59D1DFC0F howardsistrunk
690,257,267 *47408AE9A652DF1BA337F543E9383BDB6CEC1245 hq?r
690,257,268 *474DBBB378B5F2CAE8317219B18DDC99D24CB461 Dn&U
690,257,269 *474C32177DE1FD27A568E46ED35C79789BBC2833 dom-som-f
690,257,270 *474C2ABB3FB2F16E180BC9F4FAE88A7D65E2DDF5 donqj
690,257,271 *4746BC9C95556C654FB6EA637118B845791C999D DONTE.PANECZKO
690,257,272 *47469BA9616D51E718FFDB52891AE4385253C150 HYDESOLI2
690,257,273 *4744462F8D879B1994267B412E30B932C98478EE HYPOXANTHINEHYPOXANTHINE
690,257,274 *47479809BF8488A7DA6AC6187D84ABD038882DE5 ialibupangia
690,257,275 *4743297771F20EAF3DD6F2C86FAC96369F1507A3 DOUGLASSANNABLE
690,257,276 *4745E553F1477BA39127A7FFDA156D2B0534DF53 IAMPOLARIS19
690,257,277 *4743FDE9AEF4A61AD89153665DE5B2935994A2BE d;ozk
690,257,278 *474BD229F6022ADA5F349C75A906B1F94832CECE dp(b9
690,257,279 *474C84C6E7AF7D16B1E9E31C7E3B009558B9C645 DQAQ
690,257,280 *4749E0F2C19DFB299ECD60F90FE938235E05D4B9 IHARRYPERSAD
690,257,281 *4740A94EA74844EB34D797D035CD96611747EF00 DRAWN-THE-LIGHT
690,257,282 *474D1766BB19AB6BC629F8EA05A0F6540BE5A56F IKE.HONUS
690,257,283 *47461BA0DBE20DD63401D8D6449C88716A8CC721 IL9
690,257,284 *474EF42D93CAE13E1E9A996A39FAFB7118C7ACAB ILUPPANAGARAM
690,257,285 *47404D29FC99241AA04539027A9D8AACCA60C788 dug
690,257,286 *474345637309BC26D74CFC96277255D495A6F269 INGEKLEE3
690,257,287 *474602175E193DC7B8F9A6EF124818598888D889 DuR2
690,257,288 *474774A9C77ABDC72475588B5FFD18F0BB65194E d?xp
690,257,289 *474A31255E2B0D568811B86C864BBEE483E9348C dzxun
690,257,290 *474EF0E3F2CD470F123325282141772F78FC8A6D ivoryjuliana
690,257,291 *47436BDFFDB08556898ECB8E1D17EE19702A3576 iwantthem...
690,257,292 *474A61A050AA968BD0549EF5152FF19D153F8567 eawz=
690,257,293 *4746CC68C2CB8C77B2CFAFDC8AC17FE59F278D15 jackdescombes
690,257,294 *4742AECB47F5C87BF2CB391AC66B16F5A1335313 ecnahcsn
690,257,295 *474041877D24B1F77E70353A2BD4ACBCE3A4EA43 JAMAAL.STRIKE
690,257,296 *47450D98EFED01650D66E8A470EBD42159FC154D jamalbornemann
690,257,297 *4741883216CB5941A0B9B5D8D4B1BDA0EFF5A06E JAMAL.CASTROS
690,257,298 *474F9614704B0E879EEB454C3148BB6A20AD01F8 jamesmarasciulo
690,257,299 *47427D1A0A51E4F93898F4FB7F81F480ED07F381 EDUARDO.PREWETT
690,257,300 *4745435DCD8BC9A435900EA008DE710186E95D15 edwardowersal
690,257,301 *474201C1C73A91D5F4DAEEC879DAA1256CD2DE17 [email protected]
690,257,302 *4742FDF470AEA591EC9F8CC0D0223C0D4D1600AF e=en
690,257,303 *47413AD2DB4D76B62BFAAB70397FE4B0229FF2BA efw_i
690,257,304 *4749264C32433A8D1CD538E13B8ECE4A6F22F7D5 JED-1
690,257,305 *4745E2E1A35203541CB652EBF79781617CEB4395 EIOOEKIKOIN
690,257,306 *4740F8F38931831F1E88372B6F86F3D15C806856 [email protected]
690,257,307 *474E1F332D13321A5DA9ADC9250AAFCCCF7A25E2 ei.tb
690,257,308 *474D096EDDF85222E8493C89F004341E74F97D21 ekqu-
690,257,309 *474D7EE6413CC550FC961FC09C32DC30EA17FFA3 JERAMY.ANGRY
690,257,310 *47430ADC950981B6AA15E63FDE18704C52776CF9 ELDENKUHNEN
690,257,311 *4742316B30B7F31F0FE3C63AB92014914AAB1301 JERRELL.ALFONZO
690,257,312 *4746D46B669449A019FB5CF96AA70E82C29D57A5 jescil-artocillo
690,257,313 *47483381C90456EBDB543382C1502768F204C765 JESS1093
690,257,314 *4743EDE518C6526C2642C9545591F866C47BAE26 eliseoberget
690,257,315 *4748F3106E862572ADAB943C072D9E1D4BF2130F elishabeandoin
690,257,316 *474BCB8B8F40568350E06F558C70186978019E42 JESSIEHIME
690,257,317 *4742F193224EB5785F4B5F9D5152A2AC4859E088 JEWELLMUHLESTEIN
690,257,318 *4746A1680D3BA9FB5368B1F5D416C62C977F6AA5 ELLIVIPE4
690,257,319 *474D592A8043AD6A7760F28DF9587EB4F2DABE5D jhenders0
690,257,320 *4749808C6756B951016972CDDFC0FCBF5653D102 EL_RD
690,257,321 *474AF015C99959A55E43C8924C486D653DE4044A ELUPÉCHA
690,257,322 *474246F96739AA19E018CCFAD5981C51F91B7FF6 ELWOODDEVILBISS
690,257,323 *47468DCD0AE7D59756F0212BB82CC9BE8990F169 ELWOODGREBE
690,257,324 *4747BA1CEFB3DFBF4E68F0CD12269FF680520E78 [email protected]
690,257,325 *4746B136F4BFD84D25969C858B158EA1279527FE joanie.mayne
690,257,326 *474882F12F1AECAD8FBFBD512A21DA163371B815 emqwg
690,257,327 *474228EBBEB7789853B1D36B72EEFEF2EE9C79C6 EN85.75.196.124
690,257,328 *47489E62A771F9C51A04E781F49802854B85F589 encpu
690,257,329 *4740C998BF1E8E70AF99287BB7AABD38346BFB8A enmalige
690,257,330 *474D7515B04D8542DBBB867575766E1E15D7682F EPBZ
690,257,331 *47461B167F2315FC0ADEE66B3273DD6AE48764A2 JOSERCAS
690,257,332 *4748261FF9254BF6A0BB0524E03B510173AD36F7 EQNBTQJA34
690,257,333 *474DA46D4B11924D56F62F557BFE7B81600DE11B ERGR;
690,257,334 *47485F65CDD69D7AEEF0BFD48B694CF64C7F396F JUDE.SCHORNICK
690,257,335 *474B952630BCC1A4DD258EBA9079425BE4159A11 ERIC OPPERT
690,257,336 *4749932B5A35A73B1A2491EB580A5C0C2F605344 JUDSONASHMORE
690,257,337 *474A46C6B8717496D2AD7B27B49A9837A1FD8DEB ERIK.HODEK
690,257,338 *4742C5C3278932A0BE89D0848D88977673349B80 ERIN.KELLYWOOD
690,257,339 *4748220DE89069CF44EC09324378EA863A962296 JULESLANDGRAF
690,257,340 *474EA15867FD3D91C989732609D5E647007DD2F4 JULHO,.13
690,257,341 *47420C09F76A3C73F81A4F594CEE9E1DE47DEE5D [email protected]
690,257,342 *47415CFB8B305BF613E4BBEB44D0597122899889 errabia
690,257,343 *4749815BD63D298A894EEC88C44DEADEF5FDEB6B K4tt3
690,257,344 *474DDD0747D5832FAD8B0ADC406ACE33BE60767B ETC.HEADLEYDOWN
690,257,345 *47421D11E52B052397109E566C5CBE0BB86B0381 [email protected]
690,257,346 *474EEF76088E3A645C677325EB29145EA7465797 ETTU-BRUTE
690,257,347 *47431489EF9B2E41BD61176A95B01FAB8E74633A karlvin4
690,257,348 *474F60F6D722405F3D4422714348586D339F2636 KASEYSTANK
690,257,349 *474B6E5CDBD4C63A3C4DE27AEEFD8A766848CCC9 [email protected]
690,257,350 *47408D78654D74046B50FB928EE0FCA1A12B8A93 kathy-dugger
690,257,351 *474A4E5CC3EC4812B53AFB4E06858E307FBD93FE kcocwolb
690,257,352 *474B999D05F7A6B41E4BAA34667FC266192F8EBA eyebe
690,257,353 *474AB6EB9283AF894651D538163E1811969F12A7 KENNETH.KUWANA
690,257,354 *474D4CAC316F14A43ED5044544371F016DC16C2C KENTON.BROWNFIELD
690,257,355 *474331DBAFC8BCF73CA66210E348499ADF52AC72 kentonvientos
690,257,356 *4746F3058C34656377B425976250C4BD6C8E3C74 [email protected]
690,257,357 *4745901021F1EFD8E19D938BC4A3FC41F2BBBAB7 F7G$
690,257,358 *4742A9CA7738861EBF8B6D3461E943B6E42E73D0 [email protected]
690,257,359 *47418A189BEBB778CCACDDAF0A543CC07745C58D KESHAWO
690,257,360 *474D9CE06BE6287D16A83B83DB82E15B4CE475C5 faithby
690,257,361 *4741D8026A11E03997776D19AC16F848AE2F0986 [email protected]@+E
690,257,362 *47455C44406CA6D2C4ABE70746784E6168C73F47 KIKANTOK9
690,257,363 *474D1A4BA397BFF5ECCAFBF826E1BA1B3FBD275D [email protected]
690,257,364 *474E4BACD485A7A869900EA470939FDC0807C50B FCHROOTED
690,257,365 *4744601833D3F6F37847A45BF37A65CC823A402C kirjallisuusk{sityksille
690,257,366 *474F3EFF8FFE73E73FDBF711BE774CC7CB1C2071 FERMINSYNAKOWSKI
690,257,367 *4741429D813175536E691651C40178946BD8D90E fidelbrule
690,257,368 *4748C8759FA0F583EC9B2A8A08C68D53B111AA5C KORYTELMAN
690,257,369 *474DF68CD69164DB7DFC3EC6354139C98B1DC1A6 KO YU
690,257,370 *47459DB6CF58DD336D9FABA8F3B15D8F1261C89B FLAMBOYAN.ALL.STAR.BAND.STARRING.FRANKIE.'BEBOP'.DANTE
690,257,371 *47482C1DF0A81024C8D779021098E569B61B7A6E flos-campi---2.-jam-enim-biems-transit
690,257,372 *474852B6082A9079EE3352A7D8B5A85664758601 FLOYDGARRIGUS
690,257,373 *474B1C387317533E8F8F094C9935EBFA4A3B1B98 KSEMERDJI
690,257,374 *474F41F2967F0AC1BCA099C1A1E058A7346BB31B FNA11Y
690,257,375 *474EACC733988AB9DAD4891C9F10D9522EE2F286 FOODATASPLIT
690,257,376 *474343DC6FD24E97F7D36B6F9E5B045B647AA113 kvder2av12lbz
690,257,377 *474C911A707D1247AAFD933D246AFA2AB600FB65 l*7baa
690,257,378 *47428B5D2E1BDDCEDB304C9CF130F35C27F4B3A7 [email protected]
690,257,379 *474153A1A837F746B3D6D3D5F837701484963A54 franklinhouk
690,257,380 *47465E31973068DB84913513A8666E828AB141F7 frantic.situation
690,257,381 *474D91D7FA20DD2A93A862121A8ACD6BBAFFDA9D FRED.CHLEBUS
690,257,382 *4745D440534D2BB7AB193016DE4C417B37B8165A LANNYSMIECHOWSKI
690,257,383 *474B472616A1920112DE817E73C9EF40921745CE FREMDABBRUCH
690,257,384 *47477D472B21935AD53C0CF265FF0AF22A31B302 FRITZ.EMDE
690,257,385 *4749CB677BBCBFA53E908E1EA08C2D4AE6765972 lathesmen
690,257,386 *474D6FC29F119F2474BCC17A92C8192CAD8BC2E6 LAURABERARDI
690,257,387 *474656D7DB48DEDF37ED9BB510E527DB58DDDC38 FRÜHTRAUMATISIERTEN
690,257,388 *47444A9ACA856D7C7D20769B0D163A8AB7A1C27E LAURENCE.IKEMIRE
690,257,389 *4745B42FAC8F82463E2B2A27E1EFA28ACB126C51 FSOUCHAY5
690,257,390 *474AC4B44CFB0D4541A4F56A59868104C67F9C17 FUNPHOENIX-WIKI
690,257,391 *4742521BEC35C2A34E1A525630D35CD74F78365E [email protected]
690,257,392 *474544C5289412636858E90040C371CB1A59CDC4 LEANDROAMOROSE
690,257,393 *474E15959E3C5FE850DB6999FA28E39D5A0BEEFA leifcott
690,257,394 *4742D5F48DE6CEEA22C242966548830C2AD334F0 LEILIGHETSUSEUM
690,257,395 *4743987ADF5990E6A9F41A8A2AB04D4273FD9D64 GADHLQHG
690,257,396 *47455659AD3476FF82B8D77CFCB7D569F0C0B155 LELELOLA
690,257,397 *4745B8F75FC847E8FB7EC5D939B8653EC74AA368 lenardlandes
690,257,398 *4743A18DB887AEB9ED3584846BCAD5DE6EEF9970 leomattei
690,257,399 *474F0C89B3C92321B0CE1062C4B84D7F3B29EA76 gauravshandilya
690,257,400 *47424244DF31E62AA5C448B2E79225CAEFD24F97 lewisquinlan
690,257,401 *474FFAA855631F7D1184A094178688D45A32F202 LINO.NICKLAS
690,257,402 *474BF2A67339E87E510FE3BF42AC6501F32F7292 [email protected]
690,257,403 *4746CC16F9E29E03A06B391057AB0122A22A8499 LISAKENNA
690,257,404 *4741446746FC500AB72907F0B34AAB2514B20B27 GIRTSEO0
690,257,405 *4745348BC7FE0FFD97A861F897431694399EFDAF LLAVANCHY
690,257,406 *474F68ED668144F808AEDAEEAC822BCEB713B23E lobescohmc
690,257,407 *4747280F7395733F369B44BACEF1B1A012A26E0C [email protected]
690,257,408 *4744D8F2FAAB17AEA03097186369E4FE47B95062 londonbombs
690,257,409 *474F37216876FAE43DD35ED272A22838E108FD77 GMCD
690,257,410 *47495BA8D4FE83A6880A5806537BCFF97E23E5F4 [email protected]
690,257,411 *47427DADFB41EACEC6DCE5F14C0FD82EB1F17DC9 GRADYFORDE
690,257,412 *474CF603E1FD4E47D4BAF46A0E11D2E2F6F786CD ltwwwjstororggtgt
690,257,413 *474B3D435EE634EACC2EBAFC13A56D62F95121A5 LUCIEN.SAVELY
690,257,414 *4742E7B18BD59D7F3DB9D035EA23495F555B6BF2 grayona
690,257,415 *47428DA29EA58A7DDB4B5789600E48BB7EB59D87 greece.2000.(saccoman.remix)
690,257,416 *4740DE3662924936605461303CB56D578404173F LUIS-MIGUEL-DEL-AMARGUE-Y-LEYDY-BONILLA
690,257,417 *474F158B35BE04AE46707DD5E27B9434CABE212E LUKEALFANDRE
690,257,418 *4742EC90D26999CA8E528F2708786E8AE654BC22 GREGORY.NAJARRO
690,257,419 *47401D0DC9BB2692CC69355A1823933FE7F5C1EF [email protected]
690,257,420 *474C2A34E49BFD8E6F477AAAF8C33BDE5355BBCB LUNDEQUISTDAHLSTROM123
690,257,421 *4742585A27B8C89E2174EA2DEA3DD6FF4CD1182D GRIMSLAND'S
690,257,422 *4748D35EF497C4E7B623781D035B8A4242CB792C GRIWW
690,257,423 *474AF6DDFD7157EAB8DDD22FC809E250C9B906DF [email protected]
690,257,424 *47486F7A823E16FF4A5EEABAE12C8969D9AACE26 GROOTMOEDIGST?
690,257,425 *474BD945C5C165BEDA9C5BDD654F6E03381A3BD5 [email protected]
690,257,426 *474FAAF4B52DFD6256C0A7C53674ECB2F53D5348 LYMAN.BADIA
690,257,427 *4745D8D347E3A18332B0094405A6C0BC6D480BCB [email protected]
690,257,428 *474DD8A21078500E80D4B510CF9C41C4AB34637B GUSFAVILA
690,257,429 *47472734EEB85540069B89617E602DA4B9F5E80F [email protected]
690,257,430 *4745819B5EB942352482E1D913A59A9A58417CC9 [email protected]
690,257,431 *474566FFB8E6B3CFF8377A781FA09F87179626AA habit-4:-think-win-win-(2-of-5)
690,257,432 *47499AC75D0327C0C65832D7C11CDC561B6EC7D1 HADIA-UMER
690,257,433 *4743E33D1D299A7B01BB9C2CB4B51172CCFEBAC2 MAILMANGERMAN
690,257,434 *47428F2F47517C83A087F97C48E3C6DF7055A0A1 malcomdargatz
690,257,435 *4747B670040675E180DD3AC7AEC6E6445026DECA HANENIANS6
690,257,436 *474A7BE9D817D27D0C90D366441CDB87AD4ACE2D [email protected]
690,257,437 *474C0B2B5FB2464698C894BF5E724BF9EE714582 MAN-LIU
690,257,438 *4746B59CF29A438BB297C479259629A786B91987 MANUALJANSING
690,257,439 *4740DD302DB22CC62D9F3CFC329E2952C0D77A1E HARRISONDERIDDER
690,257,440 *47440ADAEC7D0A3C8F3587A4F02C5B98B2541949 MARCELINOLAMENDOLA
690,257,441 *474B76638FECE317F2613322CD2D12F098BEABA7 MARCELOZUKOR
690,257,442 *47424E320CA4F92FB474631A32B07E549223A200 HASSANSTANSBERRY
690,257,443 *4746FFBBA71EE18EAE7273345228753D26A7B17E HAUTZENBERGER
690,257,444 *4740624F768F38E3E98892206BB5FCB51FEAB2B1 HAYDEN.RUTECKI
690,257,445 *4744A7A8CB95FB2B50E6BE0D4310B7775C79C126 MARION.KREESE
690,257,446 *4742500FDD2A4E3F2A0B0667467B13685832CFC4 MARIO.REPPOND
690,257,447 *474D782474C20CCFBE5CE6A7FF5370D1FE6AD41B HEBREW-TO-LATIN
690,257,448 *474E398998E2F6101AD339659640DCA963074A47 MARKNADSCENER
690,257,449 *474FF4C993A22C896F433E057871E2E9F6E1FBFC martymcnichol
690,257,450 *474C686B60ED64929E8DAF8DFEF0F77D054EC6D0 MARTYNFORD
690,257,451 *47425E5D027786B72904511CC785079AEF014949 MASONCESSNA
690,257,452 *474F22C4C154ABE944639A610FCA5F720FB7BF71 herschellowry
690,257,453 *474213FD85C1FB05FD9A0277F88DF1F6C8FDA998 HETESBEN”
690,257,454 *474F0BD919438C956981C1EA2035E0315FC3D3CB hienes1
690,257,455 *474CCF4E9CF961B9957995993120A61F159431BF HILARIO.BAMBENEK
690,257,456 *474BC3A492EC557A2289E6EF79514E90541DDF68 maurokasprak
690,257,457 *4743384A17E5001FCFE76051BC10C17987AAC195 maxwellserenil
690,257,458 *474520D066F0FCF9267C25B0C3C5269F867CCF0A hjd"
690,257,459 *474F36E2D58C2E9195B5D3375F3F98EBCF35825B HOMER.DICKENS
690,257,460 *474BE7AF8E3DC9B91F637AE597DFE83926E8C2D6 MELANIEANNCLARK
690,257,461 *474CE9132CBAD273DF17E9B3594C1AAAF761EF77 MELANIE WOOLUM
690,257,462 *4745A1FA905F883F3C7607F1F249D4BCBB3CD8F0 melglickson
690,257,463 *4744F189DD8C90CAC6B50FEAED277906844184CD HONGTOTTER
690,257,464 *4746F3534DCA516A0688C3539C87DC3D62E30ADC honr
690,257,465 *474320545B9C06822360CC2752B407FD6674CCC8 HÖRSINNES
690,257,466 *4740E3C0EFA26C799830F0040EB187CC527F0D1C horuajea1
690,257,467 *474C059FF27D55B8157E020069F1598715B11AAC HOUSTONMEDIANO
690,257,468 *4741DFA30A0678A19B3AB6D63D99D65B22FDC42E houtazij3
690,257,469 *474895A5D05A58DC54106D8E9615FB0602C0E714 [email protected]
690,257,470 *4740DE03FE1D899CB2D9D4CF95A4342DDE24E668 MICHELLE CABATO
690,257,471 *4742DED3698923B2CC728AD533AB88546886C976 HUEY.ALEJANDREZ
690,257,472 *474A5647A13671BAFC05B787C76E529CE5D9CB92 mickeyaulds
690,257,473 *4744D9233743E8835039353B38C614BEDD082570 hueyspinosa
690,257,474 *4742D61210E81C6B9FD4D8E2D73AAFD1D74C34C6 MIDBAND8
690,257,475 *4744A2681E287A664A56C8702EAD9F3A10CE090F [email protected]
690,257,476 *474A88450507FBFD76D3F51061579CDED3196DF7 hungary-italy
690,257,477 *4747292F0A10F6AC06827C0EC366F3F2A2C459DC IAMDROSS
690,257,478 *474CF23E98A4687370424D5BEACE25A48359B39A IAMFORUM12345
690,257,479 *474B9717AA51BCAF7D93BC332228BD6AF27B1259 misentreat9
690,257,480 *474A58DA715FD12D1D35C148C625DF5C9231D8A4 mi$tri41$
690,257,481 *4744F3068442EE8399B05ECC294B1BEB9D77AD88 [email protected]
690,257,482 *47486FFA5183D516992EE62FD46B33BF69E44858 MOHANLALFANSONLINE
690,257,483 *474B39C3D43844F2E8ACA163DFDDA408592A0CF6 mohd.sheikh.ali
690,257,484 *474AD2704D3D45227F6EF04827E1112DD298EB2B IJSCOUPE1
690,257,485 *4749819CAC2310E90E9DE66BD5AB9F90B9854EFB IKEGAGNON
690,257,486 *47456362F716C8267783CC0AD83C971AA087C788 MOUN74!N33RS
690,257,487 *4742F3069E43245CCD9EFB7177CE851EFB834E4D IMAGEK13.SVG
690,257,488 *474E1BF975F48F58FA87AD263670D44333E06BD9 IN%
690,257,489 *4742DCCF7D3FDD53F842BEC8BBF7D2C3880D2234 Muuling-und-Schmetterwurf
690,257,490 *474333183BBB98A646542D38E90093E6B71F4B78 MY6N
690,257,491 *474FCE26E6EEEE353A555499A9A2781F1913E9D6 initialled3
690,257,492 *4745AD88967BFABEE925D92AF7D1CF5285A6D8D7 inze
690,257,493 *47482C089BAD7B117CB635EB5DC556F1046B978F IRITCIP
690,257,494 *4743C1B56DBD047C33D8B91F6454A4594C8494EB IRONMONGERING
690,257,495 *474B54293BA0A103E527238043F4B3782C226B14 ISABELLEORCHID
690,257,496 *47468958E8BFA1E5FEB62F833A63C5DB623B7192 nathanielcamisa
690,257,497 *4745D15D11E54269AD65BBC092AF81672212AFEF ITHAUMONTPRSSAMOGN
690,257,498 *474DE562DF94BA8E67981E61AF111525985D6518 ITVIRTUAL
690,257,499 *474B5C6650437D631B70D45F26BD30F9D92DC4B3 IVALEVIR2
690,257,500 *474BC92B170D4269F64F11E0EA7FB00CC86772B9 NEDZELSKI
690,257,501 *474EFEE3F055F3ED09B92EB4A561203E2F5BA96B NELEBBUD7
690,257,502 *47498CEFCE8775ECB49D09FB3D4B53D6270FD9EA jacintobasler
690,257,503 *474E319F5ADE8ACCA6F990B55247421D0E283EBE JADE ZHOU
690,257,504 *47446DEC6E44B2173FCA8ACF6F9F13904DFCB757 JAKEROTHENBERG
690,257,505 *47498E9C50621A2C0D049A2673289B7650B8F186 jameyboulais
690,257,506 *4741D039D069E96AF71651C8B443E07BCE6827F5 JAMIE.MARGEL
690,257,507 *4743B718CA1DAF5A9F4C492D5ECAA5EA9A0722CD JAMIESHURR
690,257,508 *47457BF2E7F6C728ADF9475CDD7C2341BB1BE23A NICK.ANYAN
690,257,509 *47409981F30583A2157FF437E1A5059B6FB0F55E NICKOLAS.DEBIEW
690,257,510 *4741F68A47502DC6B8E5C8AE46479C18B9553032 january1672
690,257,511 *474A1617D47AB517E8D640D73B4161D5FDBDDDC4 NIGELMATONE
690,257,512 *474244F7E610FB41BE4E699373F4F8AE5BBE44D5 NIL3
690,257,513 *4744A83638E29CDF54A6106AF9438634FAB6A3A5 [email protected]
690,257,514 *474575A49808F4DAB25344671F3A651EA65BE2CA JAY.PARAY
690,257,515 *474B3D08DFB1704F5FE2C80238443E333AAABDA3 JAYSON.LEWERKE
690,257,516 *47452896A8FED7927A6FF02E294709DC079EDACC NM0588766
690,257,517 *47466E14056B16CEADBDB78574AC236CB563DACA nmythip1
690,257,518 *474598432C60A2FC92E73222D7065B654B42C772 NOAH.PINKERT
690,257,519 *47462CF59EECA3A452DB11044929EDFA4B94FB2C noelmcburney
690,257,520 *474B3A18E1291B251E6B502BF22573C11FA5CEC7 JERALDLIVINGSTONE
690,257,521 *47438E7868482E17569C3422EF437AAA7046ECA7 JEREMIAH.MCDONAGH
690,257,522 *4746C4220FFF40B3D3DFA6BCBDBF6717F46A5624 JEREMIAHPRYOR
690,257,523 *474157DDD52E62040D0F5C061D0F110414CF96A5 jermainestrimple
690,257,524 *4743DAB38246D9C573FAF08324F14D94DF86CA15 JERRELL.MERILOS
690,257,525 *4743D8690353EA9D98CD4B5C88CACDE579823E17 NO TE DIGO NA
690,257,526 *474BCF0A15615010F36483FA454D947B338F73D8 NOTRE-INT
690,257,527 *474FB803385E254507DBF97F0B64826802F310EA NOW IT'S THE ARMY MEN WHO ARE IMPRESSED.
690,257,528 *474294D3D9737DDB3CA5DEC77C4AED9BFC319C3E [email protected]
690,257,529 *47475CD3B62C112BC1A48A8C4303A64A8CB91CE2 j>ic
690,257,530 *474E283198A093A88049631ED7541BA3051B7091 jimmy.geiger
690,257,531 *474D500D1A69D8C9B4123EE68F60840E0B8F57D9 jkf461
690,257,532 *474451AF11787B2A4EC237CF60634A619FBA70C4 OHYER
690,257,533 *474BE2E78234C1773AAA6CD092609255FCD93CE9 JOHNSONNATION
690,257,534 *47492B256E74205370B672A8DA02BAEB1FB930D5 olduvayense
690,257,535 *474394B1486EAC845BE3898DBD87B8305D1402DF JONATHAN.LEMOS
690,257,536 *474E11D30FAA9E55250072E3BE7869011B3FBDFB olliesteff
690,257,537 *4746C2E9AD1A7183BD8657C225D9BE8B816A9412 JORDANNELL
690,257,538 *474BDBE985C6626C9037C3156F6D03BACE5721A8 OMIRIZAM
690,257,539 *474864E6139FA2834592ED3B04621B1F406105BF JOSEPHBARRON
690,257,540 *4748670E20EE2E1F0178626F488993659F700F7F ontario-high
690,257,541 *4744EE87ACCE066350AC7541CADFAE0691B3CDF6 ONWARD--INSTEAD
690,257,542 *4740FE20F84F37E29BAA8D9E8DB6325DD615A6C7 judsonwoline
690,257,543 *474198F3338749EEE548C241EFA0939CB4BCB620 ORENGIVS
690,257,544 *474B02A733BE55EDF3C388A919345A6B05D72376 juniorjordan
690,257,545 *474ADF35FD59990EFDBB61FC5C5969811C7A081E k,,<
690,257,546 *47421BCBE5AF5AFFECA3F9B6CD8C67B32BC848DB oupssss
690,257,547 *47470FEB6BCE9123B025CAE44DD4D6C18E8B1C6E >-<.~.`.(===p
690,257,548 *4747ED2101A4A4F9B714CACEE8B857526C3CB3EB karinyheim
690,257,549 *474CE5A46712C5278280E5A7A99D365FB5105026 karlsemonick
690,257,550 *474348782FE92576C8CE321E102B1F42EDEEABD3 KARSON496
690,257,551 *474190453E2156C606313F4DAFCC323CD4AC77DF P16958
690,257,552 *4740432847E061B2BB8258BBCDE4EB84DFDE9EBC kathleen1q2w3e
690,257,553 *474405C12D87085CEABD58020369AA4AFF8B7394 ,=kbaa
690,257,554 *4747003D0D81F4037163A7773C639DF335430203 PALL1YAN
690,257,555 *4746F910FC46A5255DF748BB6839B856E62D40EA KELSEYBERNIER
690,257,556 *474ED3C786E199BA87BDF71A7586E308748F7631 [email protected]
690,257,557 *474C8E50C826E42D5AF6C5142DFFED8DEB0AA235 PARTE LIBRE DE CUADRADOS
690,257,558 *474D15669E691AA3521EC97F4F14E32C9FC73016 Kerbie'sTheme
690,257,559 *474942C895EFB40D226CE3D6E8730BE2B97AAD7D PASQUALE.GUDIEL
690,257,560 *474FD6E31C2A27F9FF43FE0E11053BF9DC302B44 PAT.NEVERSON
690,257,561 *474F6144D0AB904697AAEB007126C619C3C19ECA patrik23
690,257,562 *47498A594D122633ED9B376193606DA9AC140B1C PAUL.RAMBERG
690,257,563 *474390D8D2B8B0BD57B2002494236AE4BB7649C4 [email protected]
690,257,564 *47487EDC461FA0B696BB99C3C164D05E0BCC2365 PAYSANDU24
690,257,565 *47445E241E08C30CB4255F10B36F41F1C4457257 P======B`~.`~.)X(
690,257,566 *474B0A47052A302A2CAA58B64779C4BC1E8D94C5 KIRÁNDULÁSUKRA
690,257,567 *474305041EA3ED77E490B9210066997FBA5261B6 KIRSTY-MCGUIRE
690,257,568 *4745099F60687CABE538BBD4EF6BABD097BF839A KIUSAANTUNEINA
690,257,569 *474A22E51CB175191DE0212E0615CC6AE261F66C kjilnam2
690,257,570 *474992468339320B7BA3BF4847211CBA53C824CC PESONEL
690,257,571 *474426529265E659CCB202BD2FE2A942547E73A1 PHARISSES
690,257,572 *474C6C9A86A4BECA3908E38A0AF3285C082F3D10 KRAIGSTAHOSKI
690,257,573 *47495AC551E4A7162B736CC8E2D75A5BA506A497 PHOTOSHOPTN.COMWWW
690,257,574 *474E18E817B54BABFA664E7DB4433DCCC39B60C9 [email protected]
690,257,575 *474D5F6C8311C677C20A3278A058E8441DFCFCC8 pieceofmyheart(piecemix)(featvaleriescott)
690,257,576 *474EF0B01A11C8D01521E4FD9FAEC21662524E81 [email protected]
690,257,577 *4746AEDAFCC5AC7EB0AAB3B8D22CE10EE5C9AA48 $pine-ce1
690,257,578 *47494C9A0FA4E79AF4D2A8A1A061DC60DBA6C382 [email protected]
690,257,579 *4741348B0E0C8A2F46E60E774F846A728DAB6455 KÜCHEURAUM
690,257,580 *474C413AA46D64DC363C76D522347C426125B195 KURKUMA1
690,257,581 *4740E02B9BA86802C28E50EE89ECA8201969A3C9 KWAAAAIACF
690,257,582 *474D4098A654C4B311BEE6CDB8C4E0DF5E55A279 [email protected]
690,257,583 *47455B4CC57A2040EB9309473840A8F02B55CBFA LABRUSCA5
690,257,584 *47409429E2FE01ABED4795D9FB34B1F160DC0006 PONGDOUNG
690,257,585 *474784BB51AD8050EAA8E9BEE00E322CF225E309 P####>.~O~O
690,257,586 *474967EFC9A7DACB924D0A0D40AE118D363EFC25 LANDDAG9
690,257,587 *4746C3194DD1FD8502A0DFEFC6698CF360036F62 la.pointeauxpins
690,257,588 *474323F75151D0645B7A762B3D2A26DE18F3458B LARRY.BOEHLAR
690,257,589 *4745D2BD481042630D32027E4C4AA37EFC148AA0 LastRhythm(Ambientversion)
690,257,590 *4743E16C1EFC669C61EEB358B1AFFA75BDD3268E LATIN-TIDE
690,257,591 *4749866ED0EC197B043ACC140686D5E1123B614D PQBALLDERBY
690,257,592 *4749124CCB8F1C6245BED76ED211E294793F8759 predebate7
690,257,593 *47477A7763FED786075E63A98990EE7C790067A7 LD52
690,257,594 *4748A88518CB194CF54F8702DD405A4DE53BC837 prestonmerring
690,257,595 *4743753CE25B4C89628344BD3064A6D273CAFECB LEE248
690,257,596 *474AB08755310C8E7F0AD044356F1CB08993BF3A LEEWILDERMUTH
690,257,597 *4743FA2708538018E6A3C195C638D75760BB1A69 LEIGHCE
690,257,598 *474915CD8BFCE27BD831AEA5B190D0A888232FBE Producer,.Volume.1
690,257,599 *4748D07B84E28C449F3B0B51E95A3826D2EBA34A PRONG; FOLD. HALF
690,257,600 *474EE93EAD699AECB54C281AAB58F44BAB29B6CA lene»
690,257,601 *47441D6BA37E42C1F537AB398A172F50E990566B LEN.REINECKE
690,257,602 *4743F2CF22F0B032395F5FC003D1EFFDEED4138F PTAHPTAH0
690,257,603 *474E9A253F2A0400E3A10B6C97D6E7D77F6D05FB PU8
690,257,604 *4744C91FC27EDF00E6D933C0D2D93E05901ABF60 [email protected]
690,257,605 *4740F526901B334DF3BCD50924FF213ADAB78E31 PutMeAway
690,257,606 *47449B2CAC5761EDB6BF9C4CD857E755098115BB LEVANTEMETEOROLOGIA
690,257,607 *474ADBA9298C36D4A1C102842EBD168BFF9B2821 lhi}
690,257,608 *4740714741B33808E8FE4F384F06E2742FCFF4BA /LIB/UDEV/KEYMAPS/MODULESONY
690,257,609 *47402860A46E20CA2F06FD54125F5E99713A946F QD * * * ~0~O(><)
690,257,610 *474B373C78B2DEE2F515E7BD1DF552FFAEE2969D LIGEFORTIDEN2
690,257,611 *4744A57990BAE7DB4A8B6C47770313E453B817F9 QHINISH
690,257,612 *47472AADC8E0BA2C497C862002344E294FEEE7C9 [email protected]
690,257,613 *47445DCFAD0AB3475D0892053C4EED9B9FDA675B LINDSAYGRABO
690,257,614 *47452F76053DD72C127E7621AC063BAC3E97C81F LINDSAY.ROEDL
690,257,615 *474A2B0E4AA3541CF9C33352D208C389746D90CB [email protected]
690,257,616 *4746BA23B353B5E5460F087FED8A910198DAAA21 q>`}o{
690,257,617 *474746A532AC66DAA6DE2058AD16A8F691231952 LIST_OF_TEXT-BASED_C
690,257,618 *47423867FD1FF61F804B27E60B15E7BE667A2C7E qua
690,257,619 *474052D706D378C063F6DE4DB706FEDDA56A07CF QUENTINBRAUND
690,257,620 *4742ED79CF13531A03BBFDA15FF3F1F9323B847A lizethmariechavez
690,257,621 *474CD64B452E93A3CF5EBECD0F95CBE6BB05A573 louashly
690,257,622 *474432599A00809601B0120FDAD59A6CBDB54374 louieschnettler
690,257,623 *474D643DDC70C0D8BCC883B1E0B3704BF85370D5 LOU.SPANNBAUER
690,257,624 *474834EBFB011FD3D959D007470B9F2BE58691C6 RAMOSRAPID1234
690,257,625 *4746E75B830260A34DB42017BA5DA667B1F7CC04 RANDAL.TEGTMEIER
690,257,626 *47405CF6BBBD009459809411C9C80D939238250C loydstgeorge
690,257,627 *474E10C9841103458951D049BAC418BC167398F3 RANDOLPHLEGNER
690,257,628 *474568FB8AFAA2EA073F4CB8AF79140D0E528291 RANELLE
690,257,629 *474CBD62A7CD51328E6F1231CE586ADCF76A8FF2 rassortie6
690,257,630 *47480166B889D3B1FE3140B8133FC8C42AE79B8E lucianotunnicliff
690,257,631 *474EFD07BFB3AE6288CF3E15A7BDDC029F1D4C2A luciustrosclair
690,257,632 *47472EF4E308C792ED5C4C33A7AF16A45DFC23A4 RAYMOND.HAAGENSEN
690,257,633 *4745A94E087E504BE0634680C914E3F8B19FB7A8 [email protected]
690,257,634 *474D3A94E582111C30F5B1E6741BD1E4B4FA13D0 READDISPLAY1
690,257,635 *4746E89634CC12002FF49989295877C8BBFC332B [email protected]
690,257,636 *47426DDC9B69EC036B9660C525CA55484D21EC00 REBECCAMISSY8
690,257,637 *474992E34BB1D31CDBECEA4FAFE9E220FA25D5E3 [email protected]
690,257,638 *4742F908F436C9DD19DE82A4397C618C306A151A lynwoodgruett
690,257,639 *4747557D08491467E95AC778C97CF69F5D09279F reedportal
690,257,640 *474556350BE3CD5D9FFEA332DA13C9E7A726743B ma9nl0quen+
690,257,641 *4749DEB7EDCC0860646E5841394E05F92A249AC1 REGRUNDRITNINGS3
690,257,642 *474D2011E65CE2D1EE293685CE529F0C6DD29C25 [email protected]
690,257,643 *474F98C69FD7D648B1AE80E242764EC40649337E MAINSAPCE
690,257,644 *474C1EC8C979B7B962B26C9FDAE5F2F8E37F7650 RENEBERNSON
690,257,645 *474AAC9518C764479BF14C325282DD7EC6A7488A REQUISREQUIS3
690,257,646 *4745A82015234912C6FC6F2FFBE1FFE2967D5828 [email protected]
690,257,647 *474864BDBC68BBE2D51FB74DAF915C9C05DB41F7 marauding2
690,257,648 *474E842247FA3EC43C70471349B95F58AB355B9D RETITTANDE
690,257,649 *474D0B7F80A767F3070302FE0FC343CDF8032567 MARCUSBUISSERETH
690,257,650 *474E410686DA06A8E9A5DACA09E931DF597A2E31 marieabcs
690,257,651 *4743E36873FD00E3624DD85C627127FDA94745C4 REYHEVRON
690,257,652 *4742B10D3E8C133A5840D634D384333BC4B321AE marionhearnen
690,257,653 *474F0F05504CA871179C05D94D22C6BC3281C241 MARK.FLEES
690,257,654 *47432230F0C6F4CB1E78C24AC8A00F12A0C47207 marvinblakeway
690,257,655 *474119C077EC1E216417972CF623E25CB64480D7 MATHEW SIMONTON
690,257,656 *474E99C961A05C7DE0801D703A947CE9B6C6BE33 [email protected]
690,257,657 *47408206A03A0C856A1E38BED33EF2385DD43C51 mauriciowinterstein
690,257,658 *4749815459BF7ED895A0014AEAF05308F4FF5975 [email protected]
690,257,659 *4744656708183064A9E90E83854E601366D35EBF RKSRKVTBSW
690,257,660 *47467631B2F4B77798853EBAFF2C6D418EAB0981 Mazurka.No..19.in.B.minor.Op..30.No..2.(piano:.Kemal.Gekic)
690,257,661 *4746028535407BDE1ED3F8465BCE31962DB2B014 ROBBIE.KAZABI
690,257,662 *474D204F17237369E48F9DE2732C1E00C8792DBA MEETINGDOYLE
690,257,663 *474A2932BA693C94C3B4D68FAD9D80BC6E104CEC MERVIN.SFERA
690,257,664 *4745122B7DE71D8967EA2B37AF7B86AEE90837A9 romeodoriean
690,257,665 *4745DB7055B940A065DD02BB6B9F06BDFC46B797 ronnback123
690,257,666 *474272E3180D924205AA5073AAED4074F6CBD417 MICHAEL.PAUL.MILLER
690,257,667 *4748D0A04F4B6BFD0935F6E02EC04F2F89700E67 RORY.FIXICO
690,257,668 *474379958DC7FDAEC80CE0B1BAC825B038864B84 ROSE-LEMIEUX
690,257,669 *4743DE6C59D530EBD6B2BFD9043012A583C63707 midnightrasta
690,257,670 *474227AED82147D81975B6FDEC147E25A79B7E51 miguelschindler
690,257,671 *4749230A348B01935481FF8D89D3A08BF6D5427F mike.quin
690,257,672 *4745A24DAC2CDC46C020F10087FD03B769F345E9 rtrgrdrning
690,257,673 *47428DB4813C80DE72EC7DE32A7BED97FD0423EB RUECKFUE
690,257,674 *4746A15FC1BB1F6427BA5FAEC33616C8D32A9E8A miquelcarsey
690,257,675 *474BA2CCC33C33A6E17E5D9E27370EE666CAEE6D RULLTRAPPANSING
690,257,676 *474435E94815A372D08FE1396D59787FA87D9788 miskiah0
690,257,677 *474D022066EC6BADD528376F0A5E70D8AA129953 [email protected]
690,257,678 *474D365C0EA6C85DE4319F769CBF40AAA9FD918D MMIYAKA
690,257,679 *4747D4F47B05D8489EB189DD7A0F74555A7884ED s3lfh0mi
690,257,680 *474E557EB0C6673858B820CAFBD2C321D907A068 MOKETTI
690,257,681 *474BD644C4F3FA98F03C914EB41EF71B39602F52 SAGSBEHANDLINGSTID0
690,257,682 *474326696AEC449EB773E9A02408CAFDF56F08BD SALESSMILEY5
690,257,683 *4744333F5AC446194A4902A89488DE76C04757C9 salvadorlogsdon
690,257,684 *474DE6FCC50FC0F4808BC0D1270A434295A1A134 MOONDANOS6
690,257,685 *474C2088C93191ADAEEBCBD396EFCA1C27509117 SAMCARTMILL
690,257,686 *474EA2D1EC08C807D806B9434170E3D5C5401894 sammiecration
690,257,687 *4744FE3725B48280D61ABEA0654B6A36F058DF02 SANFORDAKHTAR
690,257,688 *47401B2C95354CE5F1ABD21DB6CDFE9E3C069956 SANTOS.CLARENCE
690,257,689 *47405064F8996E585116EC7D24A6E558F2E11F7A SARAH.QUINTON
690,257,690 *474CE6FA6E7D600157CB5606EAE5E74433981255 muhammad267
690,257,691 *474939C597E309C7A1CB7806B9ABC1777D2B8150 mustangpentium
690,257,692 *47453A1D503B5BB0F473381F43648533E0097106 My7holo9c
690,257,693 *47481DAFBCE2AD06A515B8C3F79F01AD2E2E9E36 schutspatroons
690,257,694 *47463B852C0280B30B5CC0EC328FB59441639222 myronchristie
690,257,695 *4743767E8981C22CEE5C156A13A18281E30D70F7 MYSAMIAM1992
690,257,696 *4748E8399886F8680CEFDAAB2F37E221F1CFF680 My-Wife-and-My-Dead-Wife-(live)
690,257,697 *4742F2AF6C364DDB93BAFA37D9563CA4F6FB693A SEAHEATHFAMILY2
690,257,698 *474CE61E6CD7DDDA6DD8A27C70BE4D1779498550