List database


# MySQL hash MySQL password
690,220,001 *47403433FBFAD55819620AF0D653A8E0246C4CBE truthordare
690,220,002 *4748CE571FA9EE5F61C9E0C63934BED217C33906 TTER, OP 72 NO 5: PRILLAREN FRA OS SPRINGDANS
690,220,003 *474131620F26F9729B7B5A42ECA7F0F710BEA847 TYLERAIRHART
690,220,004 *4748C1EA90A7D0EDAF211F25A7385D0B8D8F5FC1 TYNYTSYVKI
690,220,005 *474EC70D6957FF558D41BC26D3ECE4D784A050D5 TYSKKONTROLLERAD
690,220,006 *47418FE17F29247A350658C9ACBEB81B4BB825E6 tysonday
690,220,007 *474565CC8668CB85AB48FA2CE33CD5A09B9FB44A ugradila5
690,220,008 *4746417EF8F69F8F61AB34F2B34526DA0C81DA0D UNDERGROUND-LIBRARY
690,220,009 *474EA699D66DE87C0D6FBAD3C0081CB72079BE11 UNEXPECTEDDANGERS
690,220,010 *4749DA585A99B97D7712EF7871EAB6ACFB6FC82D [email protected]
690,220,011 *474AD19FFDFED5FC0600D3CF691E9A4687560FFC UPIKLADO
690,220,012 *4741522BD9DA4A5D181658AD89644099055AE648 uptiger2
690,220,013 *4749805624F0ACE2F775EFB4B11BD4BD657CDE49 USERBLACKREP2007
690,220,014 *4747920D1DA2F7DDA66BA0F8F1C0EBBE31A52262 UU***(P
690,220,015 *47471AA3DF17B1BC0B004EA647E4DA911C18F8FF vaimaturi
690,220,016 *474EB05DECB6447009107DDE0A6F70A98B084787 valentineseavers
690,220,017 *474211B8814412F85D0B6FF9D653360CE8E12799 VANILAPOOPE
690,220,018 *47491A0A446552C780C85AD2623682C0B80E3C47 varaganikeerthi
690,220,019 *4749AF7356CBE0A90FD2B16ABEF671C42763109F VENIZELOSBSWED
690,220,020 *474A66D525850DB9F79554AE02BDB8CD9C66A792 VERHAELTNISMAESSIGST1
690,220,021 *474566C9AB81FD02D1E8EA2834B6E2ECAA35452A VERMILJOENFABRIEKEN
690,220,022 *4747FB21918EC7EE767CA7F9177CA3408FCAF2A9 veronica-rae-pangilinan
690,220,023 *47456D00528CD2D6E8878F6493121B48083EBAE0 vicki.sandage
690,220,024 *474190F494ECF9F7A6DED96C686B2B62AC8257EF victor-crow
690,220,025 *4742F1675006B66C5E9DB5A555D68B8997D00F94 victorforbach
690,220,026 *474B7472BB56F0975764C5B8ED7029047A9FCAEE VIERVLEUGELIGS8
690,220,027 *474FD71AF22D024341A27400C4B75096A2E3F477 [email protected]
690,220,028 *474F9434D8057512926FE15063E22577E9B08B2E VIMELIAM
690,220,029 *47458B935C25C150875CA652C6BC283F2239BF4E vincedelmonte
690,220,030 *47406C90075CAC24113523FF949395ED782BEC3A VISHAL.HARNE
690,220,031 *47493F86D812F6C8E42CDB294802AC8140D76862 VITAMINRLEADINGUSALONG
690,220,032 *474B642439C83C2762EAF8A89779735613AE2683 VTASKS
690,220,033 *474DC584C69878A04AD2F55A5F2816F3BA2D26ED vtjog
690,220,034 *47487521C11457CE809E46DB429C4EFEC39E5CDC WARNERANWAY
690,220,035 *474F69B21A302DEEE0A21279AC2525FD27F36504 WARSPUR
690,220,036 *4744430E0DD90B74562A0237B58AA7C0462D44BB WC**
690,220,037 *4742F42D3EA44849B0F351E1C851C564C57F0E2B WEBPLAZA
690,220,038 *4744EA77D4426F25D4139C1FD08D5748F895256D wenche-read
690,220,039 *4747196FC794A8924F2CE49632916807B44C0668 WENDELL.FLITT
690,220,040 *47442B1B0C2067BBB4492BEFBBA76BF3A9FD836E WERBEFELDZUGEN
690,220,041 *47455E571DD4A0A1697055283666DAD1E7EDAF56 WESLEY GOLDPLUM
690,220,042 *4747FF923148C39BE3BE924D79F09B1F23A0534B WEWE-IBRAHIM
690,220,043 *47404301C864A3D0F7812839DF0C2C6A2E06CF22 WH!+3W411
690,220,044 *474CA3D235FE0A2AECE5327D13546E9997691E5E willamaette
690,220,045 *4740B4E2FF09C656DAF1E09034EAF02C646537C6 WILLIAM ANDREW CHESSHIRE
690,220,046 *474847C0033692AEEDBCADC8F9FD291377188BB5 WILLIAM.CALZADILLA
690,220,047 *4745363BBC8814A423AB2A95702ABA351427E582 williever(usradioedit)
690,220,048 *4749E1247758AE043237B4278C9B54B2565CEE2A WILLIGEZZY
690,220,049 *474842BD0221836EDEC93B260F4A73CDF3A1CEC1 WIN.BEAR
690,220,050 *474AA58BFADCA03F9B4402D35BC5B4BCA5FCED22 WISH WASH JADE
690,220,051 *474170F9C92E92416574AF335532EF87865850F8 [email protected]
690,220,052 *474829DF4A542C31AA9CE8F9FE3D9CA339955A7C [email protected]T
690,220,053 *4743541E617707146D5B03A1A597584FBEA3C9D9 WWW4HFAIRORG
690,220,054 *474ADDB3CB6EA8AA9860F3DC5811E1FE64F2776F wwwmontgomerynewscom
690,220,055 *474793837523A8F3A86FDB54BE51F7F4CD3FAF3F WWW.SERACUSA.COM
690,220,056 *4748852998EAE1EEFB2B4016590F07E5781CA07A WYATT.RAWN
690,220,057 *4749EF583F4E73A13106B4C4CA4FA0197CD93AC1 WYLIE-MCKENZIE
690,220,058 *474FD07D4BCCAF0E98D2DF0072EDBBB46ED0EBFB WYNELLE.DONNELL
690,220,059 *47439245B74553C8425FC70E58921347F4520663 [email protected]
690,220,060 *4745677D9502B790FC9C642FF6931FE39D8D4FC2 [email protected]
690,220,061 *474659F42C6EF92BCDE619F1626AA7661CF24B88 [email protected]
690,220,062 *4740770308D40EF9456E955F255E3DB54E4A2D61 (x).*.*.q#p
690,220,063 *47418D0CD95426018F2F6A6714FD81E7105669A2 YAHIA ESSAWY
690,220,064 *474A48B273ED99439FD1A3BAE7614358E38349C2 ‘yahudilik
690,220,065 *474EB21D479FBCA1E0297316EDF51B535815208C yda.vestar
690,220,066 *4741ABCD4876D56D6676C4E183E0D95B44A0E373 YELIMSYVOORG
690,220,067 *474AF643280669E1A065C34AD17F532DD7FA5A8C [email protected]
690,220,068 *474D2086758B8C0E8FFF7A21A84A1E4388EBFA1C yiwen.liu
690,220,069 *4740B8C0212DC5D377DD7631406245C477478271 YIZACK-MONTOYA
690,220,070 *474059FA03CB34A35681CC7136E35084F6601C81 [email protected]
690,220,071 *474B2F0FDA1959660E9C3E15CE92673B4345DBD8 YLØJÆRVI
690,220,072 *47466218604B32974AA174408418C0111DAF37BE youdendr8
690,220,073 *474BE22F5016B6B9E741A9B9EFB1EB3A19819D47 [email protected]
690,220,074 *474D29340C5FF28AFC795AE5634B126AD4199A66 YUKITABE
690,220,075 *474B29578BA6F694EA18841839FFD65D53A79E31 yully.ardyansyah
690,220,076 *47426E2DEB21271AD91CBC4F758513824251384B ZACKARY.SLEEK
690,220,077 *474285522420E4B9EB6A958E99FD8B6FCE443FD6 zalazarfirpo
690,220,078 *47457DB22FCEAA15E2D4438B1D0E3E99B84BCE0C ZBAWIONIED
690,220,079 *4741EC731A94709B0459C24A6D39AC15DA0BE10D ZEBA.MALIHA
690,220,080 *474E51364E18C8190A5739DD4EED5C6CBF79ED3B [email protected]
690,220,081 *474BAED34A6BF8C986833D9AF1CDF6DF7F2AC65F zenaidadeguzman
690,220,082 *474D2E524E5CE6DD41BC9B63B3E5004E8520CED8 [email protected]
690,220,083 *4743912C40062D7F43F26C51ED42913822CAEF09 [email protected]
690,220,084 *474CFDAC71D692FEB16A19227E1CB48A8FDDC6C2 βισκάτσα
690,220,085 *47453AE77146E2A04CD518EF8A49603FF0881F58 επαναστασεως
690,220,086 *4746BB46548B1E87CDADABB3A45F24C717466BBE базоцентрированные
690,220,087 *474643A91FD212D6BEE784E4E2E5780A532C94C4 ЭКСПЕДИТОРОМ
690,220,088 *474B52C461FCA2652CF8795A0246ECD34F7ED5BA 斯泰爾SPP
690,220,089 *474C2072A286395AAEB05A271C80E655D6EF8756 0E793E599107816ABBDB56EC50015BE6-1136511
690,220,090 *474657B2E1ECCF5FE95CA946F2A5915385A429C3 [email protected]
690,220,091 *47493E9B9E4B5A6CF10C5E907FEA6966E79F7256 10.22.1494
690,220,092 *47408FA79668CA10D0509D017E0AE83CEF880B9F 1383497 THEY'VEBEENPELTEDWITHICEANDGAMEPROGRAMS.
690,220,093 *474E166DCD5BC371F7150FF5DC45399BE2B6A9A1 1401900 " MAY ALLAH'S WRATH FALL ON ALL THE COMBATANTS
690,220,094 *474E0E6A8BBBE2FF257D393A6313AA2F2B539EED 1609938 TEERSALOLAISET-ELINA-HENTTULA-JA-JUHO-PAAVOLA-SEK
690,220,095 *47424046DB8EC60E421CC401DBD1477858DF943F 1630925 frage-,-was-du-fuer-dein-land-tun-kannst--"
690,220,096 *474659D9D3E2462110CDBAEAD201827904F64959 1763673 major.computer.stocks.performed.poorly..
690,220,097 *474FAE492025125AAE35F02DFB5853336A4CF173 1.akrabayI
690,220,098 *4747B2864710B7AE71C389A10AB500F724029565 1bopgun
690,220,099 *4743948932AA37323F8B593C49CC4D6F1FDDF6D5 1-chancheros
690,220,100 *474F248FC6A5F050D8674E7699502D645B23F884 1-GROTTENUEBEL
690,220,101 *474AA8ABCF4DB7E927B8279E84B1BFCEA85CEBA0 1 ICSUUNNITTELIJOILLE
690,220,102 *4746E8D9BC23C227A959DBDFA4CFBA01B9918228 1jdv
690,220,103 *4741CB77729EEB190AFCCAD9520987EF4A07B0DA 1KLUBIKEIKAN
690,220,104 *474513BFACBEC77B2E5B85D308BE761D25A98B94 1.KOENIGSFAMILIENMAUSOLEUM
690,220,105 *4746E1F583D4BB9C2A4A54AC4E82C4E79DE61F95 1markkinoidessaan
690,220,106 *47407DCB20CE1942F986154A7ECCFAC1C604AF2C 1MEDIEN-ENTSCHEIDERN
690,220,107 *474F1D14DB5B779F15DFDD378D62F3A560E45988 1.mittelschichtfamilien
690,220,108 *474A01B93EEEF5FC67CD2BC6C7F90D20FF8DF8FC 1 MONSTER-MOBSTER
690,220,109 *47414200020535162B87E28D3EA546D78BFA004C 1.PASTACILAR
690,220,110 *47460D10BBD6B77E2EF1EEABAE582EC2C0143C45 1RANARADIONACHRICHTEN
690,220,111 *4744C9B5719FCDC6D9E56C23C741B6596682D794 1-SULAMISUOMAT
690,220,112 *474194A8C0546F7B96E7FDD5927D23BFA5AE573A 1-TUTKIELMASEMINAARIIN
690,220,113 *474E94971017220F3B03B629A98D9AD370B545CD 1 ULKOTARHASTA
690,220,114 *474F9A269EF716CB73362F801F8EDAE913A152FF 2000847 ER
690,220,115 *4748CC1EEB15C0D7FDB19E2CBB6D55B5D4270B63 2316573 man-fuehlt-sich-total-ausgeliefert--"
690,220,116 *474BF9E614535F66ADFAA791C41815A56A48C15E 2575359 niillejotkajolajinsaovatl
690,220,117 *474B85AFA346BA902E863A300733E71DA42F1AAB 2603193 ILTA-SANOMAT 16.11.1998 : " VUODEN
690,220,118 *4747215134F5C583CA90A7E78893CB904E674006 2ABNEURAL
690,220,119 *47422AD8B5C8EF0323F47D697CD4C698C09CD7FF 2HOMOLOSI
690,220,120 *474A39058033AC86A82AB6DBEC83BA0228EC83C2 2.kapapier
690,220,121 *4745AD369D6BDEE9F08158C91B1174C04E251B3A 2.REALIGNMENTS
690,220,122 *474786FF435FA9E7483EFC8FC9EE6870CAFD0C3F 2sestines
690,220,123 *474D4F2A492CD567BD54EA5DDE01655D064A3FE5 3101801315764
690,220,124 *474C43BE2ECB73D76FF0E2D4904B6903DB495D3C 3 ASTEIKKONSA
690,220,125 *4744E4E158D85A89053C883D5EA9856CC91B6C39 3B< O~ 0~ (Q
690,220,126 *47440DDD8CD0DC84B090406462C5EA9346F406D4 3DUC4+I0N4LLY
690,220,127 *474467A025B2FDAC7129A2294395B11F4D79770C 3GERMANQ
690,220,128 *47443C4506BA92FC85F83324ED9F022087E34EE0 3kumaSIna
690,220,129 *4741B39C25CA35673729A234444A00B296533016 3LYGHTEN
690,220,130 *47442B71212BA3FEF8690B7D35160BBB05FD4FC7 3ZAKAZALO
690,220,131 *4748DDA4B8BE1206BF8F0C94911269597FCC5BCA 432325 LIEBE:VIELESCHOENESTUNDEN.
690,220,132 *47452BB11521FF12F70D51C060C862B3C719A817 450673 BOTH GAVE THE DEMOCRATS $850 EACH
690,220,133 *474082FE9C8AE6CD8910900D791FE2D77B37D1B4 4ALUSTAAN
690,220,134 *474E78CF0BAE24581EA1B6EDBC13394E433B489B 4AYQUJNEW
690,220,135 *4742D698CF71482B62004CD0F5EE56332A05CF6E 4-COMMONWEALTH
690,220,136 *474B784AD8924D6F5DA9E0D792B521EAAC69820D 4GNICAFRU
690,220,137 *474E39E1716F4AAC8857CA65817221E921057E51 4GONENANCY
690,220,138 *4744055F3443A1BE93E5E13161554C1099B251AB 4HASELMAUS
690,220,139 *474AD7CBEADD786601FA86507F345497B2DD6970 4MYTIMBER6
690,220,140 *4743D65EFAE174518D640FF05E5DDC2F0BA5F8D8 4NNPRCPTBL
690,220,141 *474A1495466B518E56C44DC59628B5B9AA203239 4NOITACIFITALEG
690,220,142 *474CBB13F15EF50F69574C33671C74FECECF239F 4ONILIUQN
690,220,143 *474F21E790824602C53AD3033679A14C513D3136 4TINT4R3S
690,220,144 *474154090A4FF9F48D9DA524B9AA7477CB31BD3A 4UTOPIALJF
690,220,145 *474AA229ACD5B341C61D7DCF34E1A2A1EE55B882 4ZIWABSW
690,220,146 *474B54E744B9F666572842637E7570A434E77387 511716 on-tunnustettava-tosiasiat-:-t
690,220,147 *474D1E15E590B7DC5A4CC69FDC3993AAEF2B8040 551QSEFTHUKO
690,220,148 *474B0A0184AFA4E3E78D2C1797F605A1FE7634C7 5AGGIUSTERESTE
690,220,149 *474A8633514F4C1BF78E0D397A3973D1B24D9294 5BONDRUCKERNS
690,220,150 *474391BA808F845DDC39A54AAD47934B965125E2 5CHLORASEPTIC
690,220,151 *4748E7253F46BF2EC5C90BD3EA1796881E255C91 5GROUNDSKEPT
690,220,152 *4740BCD103233FB353E04480480BFB89A8B1DBA5 5IAMJENIFER6
690,220,153 *47411AB39A4EE421E85B810B98B4DFB70A8C6D92 5ILOVESAMUEL
690,220,154 *474C6CA940AA4B9E55E02CFB90EC7D84C63BF39F 5LIBERRY
690,220,155 *4746173469AE988D9A5C91EAA537E7FA540E5F0F 5SEZIONATI
690,220,156 *47434A5AEBB38C9E38DB1DF7A4414FC75E59A303 5TRIGONO
690,220,157 *474D9F8C1BD1BFBBAAB56F2A80FD86B8C74E6A4D 6analepsy
690,220,158 *47443C4A437D3FB1B676258A9EDFE418D23D80CE 6KAIDEHC
690,220,159 *474A9F84F15698738637A48C10AB5E9127CF7F89 6katteriger
690,220,160 *47424892CD5B24FC31FF24FEBE3C3F0A6297CA80 6PDSAFFERBSW
690,220,161 *47452FA6227464EE39F67FD72AE99E2D722EFBF7 6POTMETAL
690,220,162 *474371683EAA1178C2D90F4B7E6006728FF7B87C 6QUIETARESQUE
690,220,163 *47426214EF92980BC80D4E83802E65D13A953647 6sp1412
690,220,164 *474B93493D6FC74F5FD8A620B3FD5AB48DEB8822 6THATCHANGEME5
690,220,165 *47457E848EAC478620A4BA0DE9CEECAE129040EA 6TNASSAPR
690,220,166 *4749DFAB5C40BAF5935E57F6A246F10E072B0454 6UGNITTEP
690,220,167 *474C827470E37E747D5A2F062662D2F31DB6B646 6UNINTITL
690,220,168 *474602A5E69946F0A55206AB2446D719DE0B9C72 789855 PULLONOKKADELFIININ.VAUVA.ON.SYNTYESS
690,220,169 *47420C76CDB5330D320AB972F2FC5416586CE3FF 7BSWPREVENTIBSW
690,220,170 *474BDE490E501A0C07C1B0263F0A38061F37AD05 7CEBVYSYMMIYP
690,220,171 *474F4FBB1D3A3E7B3895E1B1006EC65AE945A968 7DEFWIDGET
690,220,172 *47406886806DC14D91DFB71D198E7E432AE02EA4 7EDAEDBC9A1B3BC3B968F14E9DCDE809
690,220,173 *47480F36F3196777CC85E76926EB0F3DB83FCD28 7HAPPYDAYSALMON
690,220,174 *474D572C23EBCAAABDF511F402B2FD15D539F5CC 7ILUVDUTCHESS0
690,220,175 *474932BB4918B7A502EE7B77D5C16822E4D776FF 7NEDNEHCOOL
690,220,176 *4748C33D755F7E13B68EAED237AC1738093BFDEF 7PREMEASSURING
690,220,177 *474F8C8896FC9C9DB25FDC881DBB3D8466ED5C40 7RUBBINGTOKENTRACETRACE
690,220,178 *474157C9C5C9CDAAF9F7B0AA577FE6E35A935BA0 7TNESINNER
690,220,179 *474903D14498BAE6748618BCC66DAB922FAB937B 899263 kotiin.palattuamme.aloimmekin.sitten.todenteolla.etsim
690,220,180 *474EA0BB5FBC2CA4B4183A2BC1725BC98AF9421D 8AVLADES
690,220,181 *4741D042CDDCF7821A917D92EEC59D4B8E061B12 8HUNTERSKEETER
690,220,182 *474AA6CD6EBE135EA16565238DBBE880B9DDBCC1 8======>.~O~o}O{
690,220,183 *474CE129E8B666D0349526AFBDA915C9B717A283 8ROXYISABELLE
690,220,184 *474722F8CECCAE18604020E60FAB393555D2285C 997355 liikenneohjattiinkiert
690,220,185 *474984BEF84DF5ABC83C9B944E24002CE00A6D93 9BSWBACCETTIBSW
690,220,186 *4745A15D2658A94F222A48CBE521B677F1A1EF22 9BSWMIDDLEGAME
690,220,187 *47491925ACC207B3AF1F3EFC25C297CC9BB8D333 9c05e1d9163ff932a35750c0a9629c8b63
690,220,188 *474569C321EF271A05EF2E1B681E27B3BE54D618 9OINOUTTAN
690,220,189 *474C5F79BE95A37D9593309530AC221942008ADE 9RVALTINGARS
690,220,190 *474B70C762F954751647845CAE8A8F60F9EF5371 9UTUYZAB
690,220,191 *474922F885648BF626859186637B0D52ED7D9DF7 a10pw
690,220,192 *474F19C02C877A4359F85709D5223FA568939011 aaezms
690,220,193 *4740DBE9BA3867442B10DFFAEB9EB835326717E8 ABID.BHOJANI
690,220,194 *4740F515E9C898AEC2CB20578A480BF1C025659A accideratis6
690,220,195 *4741C98597B164751489A92929FF8C91695C2EDD accluched
690,220,196 *4749167829327D8180792AF7D4F396EFFA1A98C2 ACVQO
690,220,197 *474795E8C813346C319CB90FBE9D8EE5E12858CA ADOLPHWEIKLE
690,220,198 *474B6229B537E25C7490717B237FF08169222A23 adw;
690,220,199 *4741FF7F5D41770B323A2E86FC0E6C1728624A62 agfun
690,220,200 *4742397E47808FCDE66A68847CBE25B322A414DF AGWG.
690,220,201 *474A9B66E6C3BE0AFF146831E76A0E5712A7A5AD AINILPAHED
690,220,202 *474C35FDFB706FF0E07082929ADD9A8CA6F0BC15 aio#)
690,220,203 *474FE6DDBB712B663599BD12738645325DEB67D5 aiwlm
690,220,204 *4741CF3CBEC042F2B69E942F698FCDB16A41E550 albv5
690,220,205 *47409EFF5A33A77A8C443599001FC3D9E199EC34 alejita3
690,220,206 *4746059B256C7D4693A7F0F53F10780B9BC5A53F ALFONZORICCITELLI
690,220,207 *474FAEE7608A5C9277AB968B2E084A7136EFF9EC ALGP200325111209
690,220,208 *4747A56854BD07E9ADABB80E8155041C27EFB0C6 alonzohenthorn
690,220,209 *4747C11AB43F956CED5D531EDB34AB3D57B4A43E ALPHONSOVALERY
690,220,210 *474503B6B6A0FE1B9B65ED9795FA41664BC6C82D amadoyutzy
690,220,211 *474D2E74121667521C558DBC9152286CABEAD080 AMANDA NOCE
690,220,212 *474B9E780AD7A0E74576823B06D582F143979395 amir.mustaffa
690,220,213 *4745046BE62B0591EB3D9AC716A6C45F3C945B2D AMR+=
690,220,214 *474408B097118803AC48F724D6C35A050E52771E andyrutz
690,220,215 *474DDDC4E955192694E354845AED1B9D39B7C2BE ANIESMUNIRA
690,220,216 *47459CDE78B21FD32D8D58E98B681510E80512C8 annacabalquinto
690,220,217 *474E5ED8380732B1F2ED9C4CF9DA230B1E95543A antonyhanible
690,220,218 *47463C7AD9E254FD4FCFBF2B17A500DC3BD32EAA aoit
690,220,219 *4742197C34BFFCBA958360A442F82A4ED7FDAC63 ARCHIE.ALBERTO
690,220,220 *4744ED122DA97BCE90DB8B1CEB493B564300CC19 ar&ko
690,220,221 *474F5E3DA6581C0AFF576DBA5AF5DE00F6CC4A7E armandokruchten
690,220,222 *47431B58857419965661D055FEC4EC5D81090575 arnoldmendez
690,220,223 *474DADC2B21E0BCBDAE0140757D60643393AB5C4 ARTIKELDESMONATS
690,220,224 *4744A8AFF5DAECC9459D00F5B59C2FCFD103F797 arturoorrick
690,220,225 *47425269635E7EB7911DDBB3CF9D09C4019CE61C arvtezfa4
690,220,226 *4746F615EE5DE767C860A03B6A53572FFED18471 ASAM
690,220,227 *474B8C45E809770373B3B4F31F4D079A0195E230 ASFISSIASSI
690,220,228 *474C8B090AAA51AACFA24899DE689BE69142BEF6 as-rp
690,220,229 *4743F6564DE256528F256FED151D19C61495F84E aswu
690,220,230 *4742492BF4A3FDB06AB6F71B70F108A81B22A328 ATSAJAOP8
690,220,231 *4740A371AC30A9430AEE4742B48C0238BA828F27 a&tt:
690,220,232 *474AC156DBFD6F8E08220D76319DA7B8BF21BAF5 AUVERAIT3
690,220,233 *4748D873D2B788F88D2A6D27472A4F139CBB9427 A"UVO
690,220,234 *4742C9B5800A6A68FD4998634A515FB146162100 avouches
690,220,235 *474C11526C8FF2EB3A81ACE4D7B6D11A65E83662 AYD;S
690,220,236 *4748706A5F42C1C96DCED6B21EA41846FC094C74 BARRY.BRAZELTON
690,220,237 *474DB7A221C949F7AA9C2C43AD207379754AD9D1 bartonperot
690,220,238 *474597FCAF294AB5D1178A7F0EF769BF2D5591D3 ”BATCAVER”
690,220,239 *474055AC0049C930592EB82BE96B6C1F6835EE95 BAYT+
690,220,240 *474635A494560AADA0A720853E15AB64B555B805 bdrln
690,220,241 *4740726AB8EBEAE98D64A2F2FEC05F72CED2950B BD"SB
690,220,242 *474D37FEE10BD689E9A0E67A6283021CFD55ABD1 BELÁSSUK
690,220,243 *474EF00DF1B46009EAE00E81128D82B0DC1074BD BENEDICTTRAHIN
690,220,244 *474F71BA80936BF10A35D0A2C91AA1ECCA055798 BENJAMINMICHALES
690,220,245 *474C96A35D3AF99ED056CA96AEAE34FD37D3541B benoitgordon
690,220,246 *474F8F71A2D1EDEBDBB498CA9095DD8DBE8D294C b,epx
690,220,247 *474CC3A4CA7543A35238E72F65D6785120F76EF5 bernardoptak
690,220,248 *474E312630C6C85EE24E0B4017D8FDC92CB33F40 BERRYNATTIAH
690,220,249 *474C0379E7FE304F4228A7E7A7B8CA691B14BEB5 BERTRAMDUITSCHER
690,220,250 *474A8A0F21765579A449F3E39C0DAA7A6A9A0C02 BGUPI
690,220,251 *474EBF35118121D83B21E85FDBA70988102C3F1A Bht
690,220,252 *47404409DDD12525913C7A9B51F9773E7133E54B [email protected]
690,220,253 *474DCB5CA54255ADF58D0ED57DC012618827BEA8 bimw%
690,220,254 *47488852CF429AFA22588AC937C5F0B3E0A9A119 birp3
690,220,255 *474366B852CE74647EF6417C795B8DF43610E2A2 bj?c
690,220,256 *4741892F8A0BA6548158915E84380DC78EF3C3A8 BLKH8
690,220,257 *47411AE39BE450451E389B96E0D82058C693F7B2 b=_&o
690,220,258 *474D73CDBFDC158F18F9E6112D20B9939F99AEB3 BOGENRIFE
690,220,259 *474EAB34DB3DF013E51B04FFB912A75F7985F0A5 BORODINTRIO
690,220,260 *474161BDFD4B01EF174F1E6AA40E7C5F2EB066AE BOURGUIGNON.LES.LACHARITE
690,220,261 *474F1AC5813DAF3533D944FDD026FFD0EF99706A B######P*(0_<)
690,220,262 *47447E68417DB41F04344580659141498D6E8A15 brd+2
690,220,263 *474E93295183C75499C7B2ADCEE0079974EF30D8 brendanheptinstall
690,220,264 *47425C654DF9DF0759A202B185A2658D2D0C980B BRENDAN.IOPA
690,220,265 *4743DCEC83C1BC1C6CF82A8CEE2BB7A97F439647 BRENTON.LAUTURE
690,220,266 *474704BF9BCA78C610C6C8B92580FE8392658F87 brimer1234
690,220,267 *47473CA650449B4F7145455E9352BC73B1A8D6F2 BRONWYN-HOYLE
690,220,268 *47498CCB1E9C4CC096CB84B60E2A8937BF673317 BROODERH
690,220,269 *47496AFECBD486C68E33F74E6FF077D64328E5D2 BROOKE307
690,220,270 *4747AB0ADE9311F478836BE1C0CD4F279FD24FD0 BROOKLYN-STOMPIN'
690,220,271 *474E122FB620F22F331831354606DD856968EF31 brqjb
690,220,272 *4744647D567C8E0369A5DF8DE15F83D2A15C9178 BT:#Q
690,220,273 *474DAAC0BFD0D0BD4C4A135FCDD590D7CD393595 b:,uf
690,220,274 *474627F502CEF8F8052632BBA1B549A2BA38FD42 burning-up-(luca-cassini-club-mix)
690,220,275 *4748A615FA1AA9BEB8802A7A6C9F61C04C90C8DF BURTIS143
690,220,276 *474A2E6D67E3DB3A21AD38B6EB6064E1E1CC4231 C5ah
690,220,277 *47438093CA054180DA1C7270C031FD2844B7E7AF C7Q+
690,220,278 *4746DFF7E81CE72791DA3180BE4BF89C2D31A2A1 cez9#
690,220,279 *474259FCCF360880FAB694A74FE6599DD65B2A5D cfgj8
690,220,280 *474C5217741ABF8558762532ADE32B36DE420D7D [email protected]
690,220,281 *47464D14EB23B346CBCF4F626FDE2AEB26198FCD chouerbau
690,220,282 *474603491BA59F79F31B0A187E4309AA0D2E4295 [email protected]
690,220,283 *47440EC1D115636DA5FFF3ABDB30597D31909C6B CHRISTIAN.ARRIANO
690,220,284 *47424E333E5C6E8FB1628A5FE648EBB4B7429DBB CHRISTOSSTRATIS
690,220,285 *47419E02783625AAE86EFFBA5F5D02798826ACF2 CIMARONING
690,220,286 *474ABDF3832EEB9042408E4877A77FA8A93D6CB5 CIRCOLOVELICOCASANOVA
690,220,287 *474657E96247F144E6D19EB0B56B61E8C7E661DD CIRRATE
690,220,288 *474D972188A24F050B918D2719551885D35C3FC0 clearthur8
690,220,289 *4744C5027B11CF7EB6B26F856A8BD8D4F7574E97 CLE=K
690,220,290 *4740D7C30176CC1E356BFB3A564C6E532818699D CLIFF.AGUELE
690,220,291 *47439B20C44EC8A3FD80655666A947DAF2EE2780 cluny.macpherson
690,220,292 *47409DA9E9BA8ECB434D92704464DDC2E19F5415 cmahanay9
690,220,293 *4744ECF1E2F3A4228A988F7EF2FBC03F9F602ECC CMAN:
690,220,294 *474D9E30915E5541A95200DA309D0E0418211B99 c$o(
690,220,295 *4740D4FBE51E6B75422E9B28AC025292AC2DCA8F CONRADPROPPS
690,220,296 *4746ED653AEDC4B073092967BD0FB9064DBF03C0 controlened
690,220,297 *474DBDBFB0F0F6CF7E14856C59250A4FFCB9E8A3 coryyeary
690,220,298 *4743C1ACBE8DBF05941CCE1C533E25935610E45B CPH3C27299
690,220,299 *4742185C6CF561B7E6CC959F3CF001F5AF1DF8E0 CR4&8
690,220,300 *4741067E07BD915BEFABDDD5CE8BB56CD1672F54 C#RBL
690,220,301 *474320DA913F3C03BA91A1CC09A9BC61C69E799D CS3N=
690,220,302 *4743F100D6F5E56C2F2C70325064BF80697C15AF CVEj
690,220,303 *474FE1A4E1A3E292CA1B6024C85D3A0F6DFCD418 [email protected]
690,220,304 *474B45A8374132F3E2B3F4C504D2B647E78AA1E7 CZ(d
690,220,305 *474CBA1E449EC0477366CA3A4E600DD4AC11EA80 czv2m
690,220,306 *474F15807B304FA544C7B5A2E5350913ABF9D258 D0CEG
690,220,307 *474257B85F9D15F80C51EBE63202AA002327BEFA D+/4R
690,220,308 *474CEAFE0FEAD8B03F9C9A1C007FD6675D50122F d%.a"
690,220,309 *4747A2164C045C3DFE2C8524416FBA0310A3DEFC DA1BO
690,220,310 *474331C334AEF569D4117AD03A24D35A6E6D71CC daledoede
690,220,311 *4740F9C2D761076DE75088BFB0FD1F94E1BD9E32 dangrawe
690,220,312 *474F01CD0D47B5CA7B35D3CF0364835977749D07 d&aoo
690,220,313 *474E07B11971CD8297B9D9D7A45F106C82C262B2 DARRIN.GROAT
690,220,314 *474E84A1C0B30194BAF01F2950536F417150FF4F DAUMENKINOEDITS
690,220,315 *474C378FA1194F3648B99C431FD10A0EA0D2EE66 DAVIDBONGO
690,220,316 *47491D2B19FA3852CD1F72E42801517EF4A26B41 DAVID-ROMER
690,220,317 *474B313DFAC47A7B3CF2F08ABCD6201B8F9750C8 dborq
690,220,318 *474463BB8DFD3A817A390008887681AB4BFC1F17 ddht
690,220,319 *474723FB58F2852A37143C33C19A95BEE0246FB6 ddp+5
690,220,320 *47467EB9D83A7A541748CF9B27B7A2D568E22804 DE8h
690,220,321 *47487082EEF41832FE5BAAB0E5CFDEB7CBF46A25 delliot
690,220,322 *4744F41557A2683847108481B7F4EB146E6CE719 denise.dawley
690,220,323 *474124535BC2A6A77CF7B663A84E63DF44D69E8E DENTAKU.(LONG.VERSION)
690,220,324 *474D083E1106E73DDD472ADF4E7A3DE34FEE0CA1 DESMONDRAGINS
690,220,325 *474BE2F0DD6DB8985408B169120E83F1C6EF1618 DEVON.RHOE
690,220,326 *4745B1F92D767E730B4C424C4DD06B8EF79296CD [email protected]
690,220,327 *47410BBA03A67AB639FAC7C62DA44D1BD88C1BBE DEWITTCOSPER
690,220,328 *47453A0F85E7428E162F7F428B459BDE6CC7AB0B DEWITTNIN
690,220,329 *474AD073AFCB0D925AAC97FE2DD7C20A776571A6 df71u
690,220,330 *47465699EE2214E20DF1F651BEF86B3DC4D5AF93 DG0UAC1SFPY
690,220,331 *474AE97FCA49A3CEB6B915F2F7ABC4418F688CEF dgbmw
690,220,332 *4741819B3B18F9E184D80A76FCCCC57A59F30368 diemitens1
690,220,333 *4740F07284CCD980C8CFA002F96AB3CCBD439C16 DIRTAY.(FEAT..WORDSWORTH,.RISE.&.CUNNINLYNGUISTS)
690,220,334 *474C05CCAD24FFC62DEEB8729912D85345C40FC5 dissodiamo7
690,220,335 *474469179F3F5F09D7FB29A24334F3F9E1241782 DK6F
690,220,336 *4748B37322F594B5348B9D33F895A9D9ACAE35F3 [email protected]
690,220,337 *4749FEEF48436BD1D98A308AF7A48B67E0EED4C0 DKJDQ
690,220,338 *474FA0DD46AD9D7A1AB3BE8035D42E743F66BC94 D#,o
690,220,339 *47486124A591A5F4780797848D3152C66EBF3878 DOLGANOVSKAYA
690,220,340 *47473A98CF798F2122C8C2F303FA1A7711E5A8A4 DOMENIC.MCCOSH
690,220,341 *474616361ECBED1D3E464FA4FB663E151A2A3C0F DON.DRUMMONDS
690,220,342 *47467B1EBC86C55CEF35A040891F7379398B7697 DOODGESLAAN1234
690,220,343 *4744D5CBAC3B31C10983A880002ABFC5916BCD41 dorseymillbern
690,220,344 *474C4B26878C5DBCF99696C786BFD2B0A04C744E DORSEYPINCUS
690,220,345 *47439ACB663A56C151A4F7FDFCB84E8DA7B12ABF doslibrary
690,220,346 *47486302E61EC413C149DDAB1CF226314247C765 D:P,
690,220,347 *4745A38E40C92FF522F6D7F74734E6FDB48E60DE dpuv3
690,220,348 *474A5771004CC4A0E78A5D7F43A01AF44A31AA58 DQAQ
690,220,349 *4745972EE3BD081E1352DC212AE7482CED87DDC1 d:r6z
690,220,350 *4747B8F047F0470C02B6676D81553E45ED02DB2E DRECKIES3
690,220,351 *47441CEF612FEDF648EE4F16A0CE544DEE69743F dressmewhenibleed
690,220,352 *474F9526E908B9CA427D0A77040EB7E31192C9F3 ds!f
690,220,353 *4741A44DB9DD5C71E9D1C8D143805F7B15BA74CC DTHELIES
690,220,354 *4742CEC05FB546038B3FF2E30FAE21F077F5D680 D%TV
690,220,355 *47432573B26A204735F2EC288E0B0572A8D81213 D&U_Q
690,220,356 *4748C7DDD9CF99165D612385FC15C85728BC74FB dwov
690,220,357 *474E5BBC221205104620EF6F4CA674CACEC101FB d;(yf
690,220,358 *4748D5B481F3D4F3AE6906C3DAF70DF798755EDD dy-"h
690,220,359 *474FB7254E3EBA94199D92CAAB0CC822087D05B3 eakimut8
690,220,360 *4745963ED785A086FFA4C88507FA2D6082973165 ece)e
690,220,361 *47411D19B27538590042775FAF2391FD6F4083DE echo211
690,220,362 *474D4D5ABEA2BFA29D6000EC31A39F79560221D9 EDWARD.MYART
690,220,363 *4747971B13A5E2D0EF3AEC80D20BA7F3BACA5ECA eehcepme3
690,220,364 *4748D7B3419A8B51B5D8FBD8A17169CEA8F11052 eif%l
690,220,365 *47494B8D1755E364C002338DC9EE61263FD5039E EIRDNIOM2
690,220,366 *474B2D3F94B6A55AD6B567EA4EE8C98D74D6DEE0 ejendomsafstelsens
690,220,367 *474BFB55505D0052D6451E7A2D3CB6942FF53283 ELBDEPARTEMENT
690,220,368 *474902D8F9CB0D5D92E4AE5175375C01C292E8FE ELISEOMARGOTTA
690,220,369 *4745CC7D08D461E6E0DD2ECF656B6056FAEB63E3 ELROY.BERKERY
690,220,370 *4743FAE67BC04A1767EA67712F88F3B343D5D151 elvin069
690,220,371 *4740C48F846D24388CB40ACD2A8DED3B76B20ACF emigreret5
690,220,372 *474FB8E3982912794C84DE6BE4F95897D49B1368 emiledecos
690,220,373 *4743D13D5EBAA1C9B28841A9CF1272BF257B558E emma-jen
690,220,374 *474AF75CC720902979C9EE30E86CE29D205CCFE1 EN71.178.42.186
690,220,375 *4740E2F85D184EDBCBB9124A3E8EF8F4FC62DEE2 ENDORIN
690,220,376 *474FFE7323AF8B5B8BAD614FC118245D8BC534E1 ENERGIERECHTS
690,220,377 *474065111B6F3AB15DBB39354D71462123858451 ENSEGAWORLD
690,220,378 *47480AB852852B17CFE41B1E30C286A7BD7E706B eodee
690,220,379 *4744E4B0B2334F31600B0107920106E9FB45AF26 EQUIPEBRAMMO
690,220,380 *474380E2146F0F6EB1D7FABFAE198BF50EDD4A4C ERASMOBALE
690,220,381 *474B0BC1FB77BF53E9FEB469159254647F7B1FEF ere6x
690,220,382 *47470A158DF1A91F5EA0CC74DD6CBE99D9C67349 ERHM.
690,220,383 *4746C7417E497D9FFC948FB61776C4316BC051CA ETUDE.IN.BFLAT.MINOR,.OP..8.NO..10
690,220,384 *474323E153BE0AC6BFAC8B65AC4C474F58C57E37 EZRAHOFFA
690,220,385 *4740F99CE140E8A2DCDDE9F95BB2A52D8E12E181 F131811
690,220,386 *47459476ADF736F714208CC3A4176535BE1D8613 F25A4A69B04AFF15E41036C26B7FF70801230123
690,220,387 *47466D0CAA1AD024B2108C89053B931B222B2AE7 FAIVNIA
690,220,388 *47463DC966B11545A069E43C250613A4F45A95BF FATIMTOURE
690,220,389 *474B9EBA80CA0F37E0CEE0B3945F2E0917E17AE1 FCABANAL
690,220,390 *4740CC91F21CAACD10012E9C3E0FFFB22ED73A94 FINDAWAY(JAY-J'SMOULTONMIX)
690,220,391 *47440B8D0EA5563BE9443BA8FD3BC0B345007B0A fornowski4
690,220,392 *4740453FDFC318385F6288454F4129C02FCC1480 FOTOPOLISPL
690,220,393 *4741B3FD3883C4BC06874FA3CAC3C3512B5FC276 FRANCISCOBURSTEIN
690,220,394 *474DB53E2458D1C23D62A93CB34D85A1EEEF521D FRANK-BIBBEE
690,220,395 *474F36FF726F57189B1716BEADA27D5D6F0B886F franklyntilgner
690,220,396 *474321A5A51D4B1444CE9E15BD68FBAC17632C24 freddiemendosa
690,220,397 *474C6255F84A8638C25B32F84BC191957D311F66 FREDERICK.MANZANERO
690,220,398 *4748BBBDDDD175B2F8D1285AC0D96EDEE9F5C2E1 freelandが運営するレーベルサイト
690,220,399 *474643D4E764BC90504862683ADBCF8E8D7FE82A FXREXSU13
690,220,400 *4744EEA9A6246AEA6A8CCD3451EFEEC47CB7954F garypetigny
690,220,401 *474A99239D7F2C82952432EEA833EB615CD146AC gayaneh:acti,scenei"spring".10.duetgayaneharmen:andante
690,220,402 *474A20675B1477B83DC7C59A601644E089B45FEA gcdatabasecouk
690,220,403 *474AD39C1D075DCE59BE1FDCD5036223D2838156 GEBLOKKEERDE7
690,220,404 *474DEDBEB667891DB1E602F45C2A2909D7B433B0 gegrondveste!
690,220,405 *474DBD63723C37451B3CAE741E6B6F233A0A1A96 GEORGE-OOMMEN
690,220,406 *4747D15D9EEE0A66B9BFC227993A55FD62F62AEB GERALDWOODIN
690,220,407 *474F4B730553F1143940CB19E022AA5705CB4E5C geshurites5
690,220,408 *4749DFEA86FB3C365D4F3BC0CFFF92411032574D GINOYANOS
690,220,409 *474FB9A8214AC1B20D6457C739C91CB893228044 girl-sweet
690,220,410 *4743A556F737956EC05C864D0332E9A4A120AD7C gkfc
690,220,411 *47414F837EB3B496A0C23B1EB09B035E062ACD58 gnungied
690,220,412 *474935D0CBDF61AACBADFA9540183A61CC1AD931 Gra$$.cat
690,220,413 *4745518D5C4099EBF9A8745591982A675000146E GRADYGENO
690,220,414 *474D1DB76E576F526D9985065A6531821387E84D GRAIG.SPRENGELMEYER
690,220,415 *4741C0BC1EE46F3D2E202E89A45FEC9F2E732666 GRATICED
690,220,416 *47443DFC6A96EA55D2EA95916B7B2D183E92709A GREAT DICTATIONS: THE DEFINITIVE DICKIES COLLECTION
690,220,417 *47460318E38DC5BC910DB21B195C971140FA0D12 GREGSONBENJAMIN''BEN
690,220,418 *47470BF28C7209D7FFB16D6F9DAD8CB5337899CB grumpily
690,220,419 *474536D12A01035686DB6164B693BDDAD63E6331 GUSTINI TINI
690,220,420 *474065C6FF82E9A03EC03EB08C984B3456CD8A4D H7.Z
690,220,421 *4744CEFB6363DA5EC3CD9ECE006A9EFCEBE15E29 halfattained
690,220,422 *474AD564C9B2FEC02A4F31C2939A9C7D3B73FA2E hausvoigt“
690,220,423 *47464C6FE267D500C1A6C936688132BE26F389B4 HCIETTES2
690,220,424 *4747C2F1817FAE619E3BFC3E1BD4EBFB6EEBF337 [email protected]
690,220,425 *474F4B872960FAAA545B14BF5D08C5E7AEA2D3CD hendrixnetwork
690,220,426 *47449B0050B6F92C91E17ABF919D48C681CF7326 henrymaccarini
690,220,427 *474DAF8388097A035A977503364F4756868BD60B HHEPSIBAH
690,220,428 *4741856CD43B64B8AFE386FB6BBD619A207EBA4D HILARIOBONIFANT
690,220,429 *474729E73C882F928A16C1BAAA990288A85271DC HILDRAR8
690,220,430 *474AA622DD310E600462B112DBB93D5A396CAAFA HIPOLITO.MAJANO
690,220,431 *4740F2B24C892FD379259BE8DB749F2E23C2E17B HI-RUN
690,220,432 *474C42B5FD7F69BEEE8FD783FAB39FCEF89CFE7E [email protected]
690,220,433 *474D5DF6DF9405DE002E9613609AAFBCC815441F [email protected]
690,220,434 *4746DBDFEDE0D85F10E8D041A45FBDFB4A8DBEB0 HOPERAU
690,220,435 *4740180797E2995BA1E8F774C17093E0E87E15D5 href="/sie=utf8&keywords=-ate&rh=i%3asporting%2ck%3a-ate
690,220,436 *474C5F85FAD0714DECEF7F1D876C25C14C08AE3C hsbcdva2
690,220,437 *474C48BFC891616C3B354ED1313232F2C5BE1B42 HUSSAINJEOFFREY
690,220,438 *47470CC3944DE899045ED9ABEDCCB2E085E247D9 HUVUDVATTENTÄKT
690,220,439 *474D95D27573FF060BB9118BB660950189F12BF5 IAMTHEWITCH
690,220,440 *47401116956CDD90358FEEB66127B4961BE39C8D ICH TRINK DICH HEUT SCH
690,220,441 *474A52E0EB251417C545133D7AB2CC5287B1504A ID10611
690,220,442 *4741B522384A4DAA526257E93C97DB358393514B IDON'TEVENKNOWWHATTHATIS
690,220,443 *4741275F1CA79E768BA7A25BC31B7ADBA6A4DAEC IGARDNERING
690,220,444 *47420779ABBCCA48C35913964AE92401C51B873B [email protected]
690,220,445 *474B4718852EEEB9F7405E6D324F5121B475D8B9 ILOVEJARED15
690,220,446 *474D8C1BA969F2F0348E63C6F85E4FD6D16469F9 ilovepicard97
690,220,447 *4743D5264573153E8CACAA507740C67C63F1CB3E ILUVFLIPPER59
690,220,448 *4742BE267F28FF32BA1E9F5E5BB2A08ADF62F69A ILUVSTAN40
690,220,449 *4742012E2AE08D56AD7AE4A93F31FDADFA986BFA iluvsuckme41
690,220,450 *474978FE67215029D1A47A3B9A9F9E12BBB4FDBA indignation
690,220,451 *474793FC6EA3B42FB9D533E55B5CA46B38FD51AC INNOKAST9
690,220,452 *474D10F26A5E08430BC680B4A9E6E0B250C37A02 INTERNETKING2000
690,220,453 *4745F95CDD0B0532115BF88284B685133D9E8F2E ISAAC-STEIN
690,220,454 *4747B2247148DE670B0E6866117DF2883EB616C3 isaiahvalenzuela
690,220,455 *474D9FF143797F3AC53A9A85BC3217232AC52826 iskren-velichkov
690,220,456 *47426711A91DE81FA4B45C7CCF864D84613794E1 ITALIADOP
690,220,457 *474A2D2A4DC05539855751BAC6CC2962BDC4B4E2 I-WAS-BEAUTIFUL
690,220,458 *4744A8B947E47DC15E2B7A4AF1AB94F3DCED53FA i.wouldn't.go.out.with.me.either
690,220,459 *474C02BF3CD6C317CF1806A87B78BCBDBF8161CF [email protected]
690,220,460 *474B65442F9747BE2CE4A217091AF85C67D6B043 JACKIEB0
690,220,461 *4748D079BCC9E428DD08DA34B75BB65BA85B4A7F jaimewhitton
690,220,462 *4743C95CA3C13F03A0A4045D4B3B6BD6BECF39F3 JAMISONSCUDERI
690,220,463 *474A5CE563EACBC30C860C4C5E51B5B2D9AFE616 JANEIRO95
690,220,464 *474C32F56DAFFFF4A4A4EA935CBE7914FC9BA9EC jazgiejaw5
690,220,465 *4749EB5087346C3C7A26C88EA0CDD65F01FCB5B5 JEREMIAH.RUGGERO
690,220,466 *4740BEEE53D585BDC36533AEEE3A90699F90C863 JESSSTABELL
690,220,467 *474383978F318F95946F093E6853DF5EC45CB1EE jesuisorphelin
690,220,468 *4744D8FB407B58A963EB79B75732E5F1BD66FEE6 J)L
690,220,469 *474E53CCEC4DD6FC14575666D4C6D3D3284E220D JNFORDJ8IW
690,220,470 *474CF7EC60673B70F0A690A9A60CF003FFAFDBFD johnnykaczorowski
690,220,471 *474D30EFF318BA43FF10F735E3D58D18B29473E7 JOHNNY-VOMIT-&-THE-DRY-HEAVES
690,220,472 *474B9E58EFF6B7B8D342D4C969E9906B5FB71502 jojovanessa
690,220,473 *47483BC058522D8606976191A628688F1A26FE09 J##Q
690,220,474 *47458C68932D963A0C4278DE1CD683B9D81FED7F JSHEPLOR
690,220,475 *47457A1CC995C7F4B5FDE5F9D46A473E3BF7346B juanmcquiddy
690,220,476 *474B73B1A498294E1779A851C82E28E404DA71BD JUDYFRUEN
690,220,477 *4744A85C8E37AE09BD92418EBDA3D5E72A2BD97F JUNGALANG
690,220,478 *47429FDB948A692AD1184AB09F701318F8C2E965 K\2$
690,220,479 *474E078C8611D570A2D2A1C3A80A2D31B14220FD [email protected]
690,220,480 *474F3A0C6777E2F114D51B143812C357509CE9FE KBABUNE
690,220,481 *474DFDD2B45EB5D1C1A58BF1421745F01A399FEA KENETHWICHER
690,220,482 *47472BEC66CFEF1A89FE0C6BA1DCD2334EF80B3F KENRITSUBIJUTSUKAND
690,220,483 *474383DA09F81E75F00F563346F9FA599D21C881 KENTUCKYTEMPLATEKENT
690,220,484 *474293133543FE901D0B1D952D6F2D6DB34AD2D0 KERMITVANBROCKLIN
690,220,485 *47466E733138503D5C388FB247D352FC672D7CD0 KINDERCHARLIE
690,220,486 *474759FF6F3DCEA36E597BB5B5E9DA61C550974A knablera
690,220,487 *474DBC5B7DC9DFEEAB0A65E9ABB07AAC9E9091BF k==u
690,220,488 *474283D0129733783979B6FB12D666E2D2C4604D [email protected]
690,220,489 *4744CAEA97784755F729DE4BB952A4DEC9A2E83C l'antagoniste
690,220,490 *474979E5AC4DB270D828A5DB6F283EBF2CF66443 LAURALAI3
690,220,491 *474D063F6284CED9E02F114D803901D5870E9E5D lawerencecaplette
690,220,492 *4748A4A9B15A385A9A747D6058C56942176E5AFD lb3iagpnw3tk
690,220,493 *474909C11D8D6D1E9A1C7B31730B86D907C6DF00 leonardoemshoff
690,220,494 *4746B3F1BD666DEF428EB6EF94A638DEC1ED6BEB LEONEL.BROYLES
690,220,495 *47400B87584418BDAA8279A51CE30C72C937FDFE LERR.EVEN
690,220,496 *47429F6460B7EB1EE0123D69775709C5A09CF761 [email protected]
690,220,497 *474C293DB89734AC5572123D676BC62AA38FA862 LI.DIANCHO
690,220,498 *474C943A89DB6BD435B47C78F5813337CFE485A8 LIEDER,-OP-7:-GESANG-DER-GEISTER
690,220,499 *474015F1FAB1A108BCCF69D7775E127B3A4C72ED LINAMARINASE
690,220,500 *474CBA17323F78841B10BC7ECECC873A5AB2C20C LOYD.MIRELEZ
690,220,501 *474AD5E0BEE2B90E137C5B1D1C881CD6BD8249BD [email protected]@7ed
690,220,502 *47464E9BF1311737A9A7131DCA2AD62A41D136FC luis.cousino.squella
690,220,503 *474C33F0696031B856BCA19CCDE599E12D4A19FF [email protected]
690,220,504 *4740EEF59EDA8FBFD6B4363B706FA9B2868CBFBA lutherblackstone
690,220,505 *4747DD857F63820EDFC79B38BF6E4FE3AEDF3CBF LV]D
690,220,506 *47477BD8CC1569271966C32F08F1106D30883F55 lyonnais6
690,220,507 *47447304C60A513EEEFE2A39E0CABE655D83F238 MAHLTROG
690,220,508 *474187915C7968E08C91928F6CAF5776CCF83436 MÅLANVÄNDARES
690,220,509 *47448C047C97BBC74D6897B5AC4D88C32BE4D864 MALBECQING
690,220,510 *4742F684BF8C038DB9CC94C5B25D69061C8F7BEA malcompeyer
690,220,511 *474072363ED6EB142179CF762E7511A3717F3AF2 [email protected]
690,220,512 *474782599241C403C56BEEE6981FA75720B6786D MARC.WITTIG
690,220,513 *474640816F821604B624DE407396144FC2FD7BFB MARGARITO.LORTON
690,220,514 *47445217F41DBDE73FE718FB44D13AEAAE046E08 MARIA.KACHIROUBAS
690,220,515 *474B409F5EFFBCBA691F8664129F14538B978D9C mariekersting
690,220,516 *474128366CCD8C42BF07BF991D3CDD4890ECB2DF MARIONRUHL
690,220,517 *474E8824311992187678879D3E12178DEFF05B71 MARLONMAGAZINER
690,220,518 *474CA3CD17EC14587CEB2DA22481F9DE6718123F MARMARIS93.
690,220,519 *4746D7E8537DDDCAC153F7E4258B1154D64084EA MARTY-DAILY
690,220,520 *474D43D5AFE5AC8884F292BBB1255741F765FF61 marybernie
690,220,521 *474BBC3CA5F1218024E685343649B20DE3BD9270 matbell02
690,220,522 *474E8EF680F0CD1880CB1BB6E6184E75B356E4D9 MATT.FURGISON
690,220,523 *474909BFD053283F046AAF65D61068E021F05EBA mauriciofendt
690,220,524 *474B7C3D0AD3A8C8C5EAE59CAD84B90ADA80465F maybeit'sagoodthing
690,220,525 *4743318382F354377D548AA99A9905003D1D0C67 MEG_900827
690,220,526 *474B527B511CAB7DDE4EB63FCCC82DB4FF0A9251 memphisfing
690,220,527 *47469ADF0F0C2E8F6DAD938901D25F4FA68D9B4E #mhh
690,220,528 *474F7C63170BB877AB96905C3DA9238E30A46F5C Miami-Boys-Choir
690,220,529 *474DDE90DC7B5C04383138FDC2A3FF9FF6D9F3DE MICHAELMOA
690,220,530 *474B3BD232F78A15BE8FA1FE7AFE91582A5405BD [email protected]
690,220,531 *474C19C3FADBEB1933B1E618ACBCC97828A77F2A miffedness
690,220,532 *474E565DC7BD8106B9482DD381136DA0B46B8841 MIRAGEWHITE
690,220,533 *474409A68542FC2CE81826AEBABF9389F7EC2F9A misredirect
690,220,534 *474E4C737516AEC72CE0B1DBE65E7E629392E4C5 mohamedcannella
690,220,535 *47433B0BF9311DE6235F2FAF99738F9EC6149B4F MOHAMMADVONFELDT
690,220,536 *474A258693A43382FE341B6F170A690A70D461CC MOHAMMEDALLIGOOD
690,220,537 *474EAA6354300B9058FB2EE154B628BB155DA6AD mohunnedme
690,220,538 *474699DE111BF030EBC344FAEF46820963E19E14 [email protected]
690,220,539 *4742377E28F5BAD2E9C8EC4381E243DACBF2FDBB monique.maguire
690,220,540 *47418C5B9D41C90EE700951D5D56DB041D2CD9C5 MORGAN68
690,220,541 *474A5C49855ED69AD89F16394319891586794663 MOROCO10
690,220,542 *4742623BA9733AD332488AF02CFF18A88E2D1C7E .MOSKOP
690,220,543 *4745B6A1F9D9894FCB443510F22C5B8245DD6A0F mrtwgx
690,220,544 *474B62E8EE27FF1F7A13A91EAD4D1095B5EF3935 MÜHELOHNENDEN
690,220,545 *474BD6457B32685AB1B3E25880D7A4EF332D7433 [email protected]
690,220,546 *474BCCDFE00819A41E0563120EC0333C6D8C79D9 MY BEGINNING
690,220,547 *4747C835AC936D7F3824A0F3544773D6FEDF7F5A MYLES.SMUTZLER
690,220,548 *47488CA6A661C713F8E37D7C7420CB44F0360A29 MYOUNG46:MATT10
690,220,549 *4741625DC3269A50D00A951E57D7E2ED33E27AAC MYRON.SUTPHEN
690,220,550 *4745629E697C1A61A4ABE24CAE6F84DC054B68B2 mytyler70
690,220,551 *4740EAC692EDA1796977EBD3C72984C092E2FDCD NAAILAM
690,220,552 *474A4DF4F48CB8E3E5B132FDB8CC4FAE81134ACC [email protected]
690,220,553 *4740403025F0BF414A07AB5BF38918A5C2F6A838 nadeemshahabi
690,220,554 *474F5BDEBC7B6F2F455ED510B173C622001FEFA8 NASHVILLE 1978
690,220,555 *4745603F83E100C86F125C9DA468F6927CAD8B8F NAVEEN-PODDAR
690,220,556 *4749BD71D07B2BFFC6C9163D450BCB9E489D4D57 NCHINGER)(DISC3:ORKESTSUITESNOS1-4)
690,220,557 *474C4C47A5ABBB8C323889036990208FD8165258 NEW-CALKAIN-DIVISION-GEARED-TOWARD-URBAN-GROWTH
690,220,558 *47481DA35A468057188CFF0E460DB102B1FF2B40 nickdevarona
690,220,559 *47464B2714AFD0D785FFC0EC86F0EC9B2387D585 nickolashilke
690,220,560 *474FD6561C27DB2BDCDA538AA9D988324F31DA75 nick_xxx
690,220,561 *4742E2255690F5B11400EEA004DA86899AA35DA9 NIKETN110
690,220,562 *474B0002A5C678B45F0BA81B223C531CE29F13ED NMANCHING
690,220,563 *4741803EA42A4C510E7732F625A6324D3B62D8C4 NONNIE20012002
690,220,564 *4742D8B68ED5940CEF11F63D0A0EA6140636AD39 [email protected]
690,220,565 *474394C720FFE38531F9D85A7AAB1E5D882F7054 NUTMEATS
690,220,566 *474555D6E4341B9108C9E86E137FB1BB1DB515B1 ;)o~0~<p
690,220,567 *474A5309935CC2F5D29C06665D1E4BB1B46B469E O8P>
690,220,568 *47418FA1FA67E10C5970493C4DB589F6A42898D7 %O-BAA
690,220,569 *47490C7E07EB538B4BCF02E890D844123F818247 OCTAIVA9
690,220,570 *474FE3722190A30A4D33830F70A52EF470F0C543 OCTENOIC
690,220,571 *4747774017B8C0F8BCF3FAE851890EFA24F38B37 omahas1
690,220,572 *47407EE3C0E2742131C8B47F493CC39B66625121 (O_-).~`.~`[email protected]====Q
690,220,573 *4741DC0EFEB583E8BA9A983828C331596444F5C4 O+(Q
690,220,574 *4740A3ADE2E27119FFD5C8836341674263A6D174 orzechowie
690,220,575 *474CC384084E67B4F7DAC9D641AD665800484390 OSNOPSER4
690,220,576 *4741FE13AD01FC580E5A92325026ACEA9A9D07C4 OSVALDORAUHECKER
690,220,577 *4742CED935AC134C005D68D8F84410C9B23D40B7 owendelmonico
690,220,578 *47453A5670F79E95922AA4C39FF5933BF8EC5F81 OWN.WAY
690,220,579 *47413A4050B8C985395C26D93F3FEDDBB7D5A10F [email protected] ~0 O><
690,220,580 *47416D8DE6688B155EC92CF7C435D651F32D7FDF P0\R
690,220,581 *474A93F1E44DBBDDC5E3B4B7FAC6DA5D2576AA0A PAERNU
690,220,582 *474CA96289EAD65BE5F34AC03A05295FB5C656DB Parquant
690,220,583 *474E35BEDCA67128EFBC64C736C4EEDB361F8FA3 pascular3
690,220,584 *474605048F8974DFC6550E269F8F848093F14E2A PBB-DOUBLE-UP
690,220,585 *474FD60AA0C5936960B2A7E089B70965815E590D [email protected]
690,220,586 *474FEBDC17E231608FEF024C9B63CFB485EC0510 PENCIL-(FEAT-MASTA-KILLA-&-RZA)
690,220,587 *474600937860F1D5D327559C1D29C8B83FD86EB7 [email protected]
690,220,588 *4747B222E309508D3C7EDA11F15154690EE29E1E perrybaby
690,220,589 *4745D164235B5A1ECF42A487E73CC403FBB643FD PETERPETR
690,220,590 *474BD06F84C834C6743FB9F61636FD2DB4832837 petyakcomwww
690,220,591 *474597D6EFAC3BA653E57270610109483C471697 PFORSICH2
690,220,592 *474076FAB987B3877F5A4DA2ECCABF62765BA21F PHRYNOPS ZULIAE
690,220,593 *474DC044C71BE7D9924D85B42D9283F5272F0E98 PIERREJANOSIK
690,220,594 *474CB2083918CE4DD7CBF498F997490DE024E29F PLACOWKI5
690,220,595 *4747895A27F08004B093AEB32A5D42AAF7E9F395 [email protected]
690,220,596 *47420FF3CC6C128D40A939C454EFBE0AE321224C [email protected]
690,220,597 *4742CDD5A2864C7E20F404285C3E6273EFF2A940 PLENIPOTENTIALITY
690,220,598 *474276ABE4DE3607E3EB46DAE03548D379DD7D7E Plucking.Pebbles
690,220,599 *474146645E74A99505F4BD263111F8063EECA035 P###@ ~O~O)8(
690,220,600 *4745B3B5672236D7FD7444B3D55168F489C4E3B2 poppromotion
690,220,601 *474E34F261AB44B772E63F77A48EAEB4959423F7 p----p~0splat!
690,220,602 *474136E3D82DB87FCF646AD1DAE0F242C91FFE89 primiezed
690,220,603 *47435E2042B9A64C33D4B5D7D0BB89FE21682CC8 PRUENST
690,220,604 *4745D7CA417E32E1E2C61CEACC53C6C99A99F0FF [email protected]
690,220,605 *474FFFE4AF4E145EA90F3E6049460DA8F60CB9B4 [email protected]`SPLAT
690,220,606 *474D9DBE069990AF186688FFF1B6C5B13502DE84 Q7B]
690,220,607 *474C0932D9A8B7DC3F1ED1481B2E285CB5AF240B q----b-~o-~o-:p
690,220,608 *4746593D7A3A133DE913AAFFC314E1219F7D128B q#####D`.>B0
690,220,609 *474895D4B76FEB2149A755E8BD18BF1E925A54C7 qD~~{x}
690,220,610 *474CD90F9B407E00734F0D7B0C133A76F877A049 qj1'
690,220,611 *474D7E063F6FBB3696C9B28C3CCF921F21796702 raleighnemzin
690,220,612 *4740F98EFD99B769F6036E53A7FCA56DE1123720 RAMIRO.SIMONDS
690,220,613 *474A0547FDCE59EADA36CD0BBD5A4EB75EC9D41D RANDOLPHNESSLEIN
690,220,614 *4749B95FF396D311E78DDF18ACC3A6D6E3FD7A06 RECTOTEN
690,220,615 *474828D7FF0CF9A771E6C73B6C2D69E6A59DC5B2 REID.SLATER
690,220,616 *474B934A85E1FAAB7CD1F1364104B27FEF33B2EB REN-LERBY
690,220,617 *474E62A61622DCD88A192553BC081DD454C0FC2F REPRESENTME
690,220,618 *4748EA0A13007DC3AA3B14735AD15D730E4F9F3D RETGNROFED
690,220,619 *4747E51FDAA1FD8FA283CD832ACE765FC10C41C5 REUBENPELLAND
690,220,620 *4744BBE7EB81EF340C64BDF0DE0F3A52FB075BE5 reybozinovich
690,220,621 *474A5D9CCAF56251CDB4C359D5DA2C68A14600F6 REYES.LOBB
690,220,622 *474B4513096A9311C125448CA10F1EEA57E7F9E0 RICKYMARCING
690,220,623 *4740195C87EA9F6B8B3C942290EA464FF9353400 rike-lieder no. 39: denk es, o seele "ein t
690,220,624 *474E789EDAE1D9E824FC7453C05119539708F230 RILEYCASTILLA
690,220,625 *474FE5889F3824CDF0FD68691FC0DE1E7CA93E27 rini love1
690,220,626 *474CBDDE33851941C758C838D36BD7D89C2EA4FE RISK-MAN
690,220,627 *47485BEF9B60CE26C15DF8DEACDDF28CD82EF03B RLENEW1
690,220,628 *4744027C793BE717A4E549ECCFCDD84B12DE52AA RLVES
690,220,629 *474782002ECB00B48A9ADFE4324BE16354C2E9B2 RMBRQRZES
690,220,630 *4748B904AB59127B49C1B09BAA5CA01A4592EBC5 [email protected],
690,220,631 *474D385C2319186EB766AB7C247DFCB05382F977 robyn-eggers
690,220,632 *4749DB3A981B639F6A2A788B69B19C0395345D4E ROD.SCHNACK
690,220,633 *474CB3D7BDC4D59435E05CB7957745024525515C rosemary.aguayo
690,220,634 *474FDD7AA7FF57F08D67197AE5FC478CF8605CC0 ROSENDO.OAS
690,220,635 *4747707F82D0F02B8718C52716403CD2E4EB9472 ROYAYLWARD
690,220,636 *474347CBF275B0CC71A419DA8AC2A2B5DD3CA432 RUMMLE6
690,220,637 *47410CFBE01057A9FC480FC3CAF0417F2CE7F587 RX6{
690,220,638 *474A91BDC02ADCFD961C7E4EA22EA552D3360C17 SADIEPYTHONING
690,220,639 *47492CFAAE7611500868765C1DDA964A6B229807 sagarika-batchu
690,220,640 *474B005533561CA39191F099BEBA20D1DC27B839 SAKAYLON3
690,220,641 *474F5CDBD01FB34E9361E9FB5313CF04F9A0CBCC salvadorcatalina
690,220,642 *47471EF905930D1A3C585E2C64F009E3D8A0EA43 SALVATORE.BROTEMARKLE
690,220,643 *474CA78975A263D4A7B4C9F2E930E82683E8A709 SAMEH KHATTAB
690,220,644 *474F78182C4E29C365FB17ACA135F3D36A11454D SAMUALPOMBERG
690,220,645 *47485EEEDEDD65874F6C72857F33A5F0298DBFE4 SAMUELDARREN4
690,220,646 *474C53C0E1BD55E0E17F03A898ABC72DA0A40C0D SARA.GAULRAPP
690,220,647 *4749F4AC999420DF4046E7C049CAF20D74F79AEF SASUKE.NAMIKAZE
690,220,648 *47418C6CE9EE226C6577FC1B0D2C2822E10B1C3F :SCENE1DANCEOFTHEYOUNGGIRLSAROUNDDAPHNIS
690,220,649 *474C5A5E0F755787CE7455CA4939776D3BCF489E SCHLUESSELWELT123
690,220,650 *474A9292AE899C9020F929CD0AFEBD528DB96F12 SCHOENLI0
690,220,651 *474CFEBBBC5A08EEFBC5925FC2B1844BCA25ADC9 SCOTTLINDBLOM
690,220,652 *4744992192EBACBCCBDA5243F08A6B1782060094 [email protected]
690,220,653 *474A7C70526820E68A8CD414D18D645406D62E76 sendinese
690,220,654 *4741AAB8201EE23B78AADB47602FE73634A10B61 SGTHRML7
690,220,655 *47431C19B19E9815DB8B6A38424F2E2D0588A79C SHADOWTAILS13
690,220,656 *474D944DB2B3085EEBB98889A89221A602C1926B SHANE.STROMER
690,220,657 *474DD512CD1B9AD7F4DD4A02F81D297B912F722C SHAWNTELL.TAYLOR
690,220,658 *4744CB2A680B6A18FD82D5911B55A23C04921E0F SHAYLYN.ORTEGA
690,220,659 *474239C84EE0475D42DC5E98BF71CB91B1646D08 SHAYNETRANSOU
690,220,660 *474AAFD2A2D5BBDA8F8B41CB8503475CDA472086 sherma.bailey
690,220,661 *4741E56DE7185C1C4856E0AF01256CF83FA20DF2 [email protected]
690,220,662 *47418729565E6A0909C9491FBF3B11EE85ED93F5 SHITHEADGOCOUGS5
690,220,663 *4743FCBD19EEDAE5AC870BA1CFE49A6AA58C399B SHLIMAZL
690,220,664 *4743B96451BAB8163337113BF6E4A94621494FC9 [email protected]
690,220,665 *474FECF9E1740B1D691F9B717A988782561AA876 sidelining3
690,220,666 *474DC58266DEB345FA70716313D61DB11EF0453D SILLALARA
690,220,667 *47488377D34963E96A10C392F8259CFB84D927F7 SIMON.GROSSETT
690,220,668 *474A966F5C41D2453DFFB1428B300210A9DEE509 SKATTESYSTEMETS7
690,220,669 *47413E9407721F315E4397AD987D790F1BFE28AE SKELETEUR
690,220,670 *47450287E079F9127F80A0A04F30946CF8C1E297 SOMEWHEREBETWEENSTARVINGANDSTARDOM
690,220,671 *474B14D269C9F04E6776311745BCD30E257D42D0 SONNYBOULDS
690,220,672 *474D7627F7726B2914219708E56572839F303734 SOUREDCREAM9
690,220,673 *4744D26E2E7E8524A5AC358C90F89B1EC4489B7E SOVETSKIJE
690,220,674 *4741074CE1EDF9C13887E4E5A9256A3EF5483E0E Square-Playa
690,220,675 *4745404DA192DAB24259C75689AD4FB26A8E46F8 SREGANO8
690,220,676 *474CD4DBE9FCF1C961103896AFC3F580037D3653 SSENORETEUGARB
690,220,677 *4741B64513D7773145B3DF0AB9550F38B9AE5B74 STANFORDTHAKUR
690,220,678 *474777C07D8102F89461D365DCD902875DB0C2F6 STANLEJG1
690,220,679 *474F0C4587DE289D30E122864E3D248F5DB8B00D STANLEY.DAHLBERG
690,220,680 *474FF42E82C42CE339CE6053BA5FD93E75642038 stararrow
690,220,681 *47445CA9F7050F3740C8F84B2C458C9451E63569 STARTRAKETTEN7
690,220,682 *474EE837E8630C8E1A8B4F8929D08C164E3ECAE0 StefanMeister
690,220,683 *4742DF6185AA55151AE01A8396EACF8A1507FE5B STEPH43130
690,220,684 *474E24B822098C6FC6A69E07E7EEF0DB90F6A6F6 STEPHANIEKENDALL
690,220,685 *474A2540DADA718AAACDF7A0DF413F1E83F07B1E STEREOCAMPIMETERED
690,220,686 *4741CF917D5EB017150B658E232DCC4192C45154 STEVEN.DELIA
690,220,687 *474B6AC022D04EDA4A63C2E740A11E47FC4582C5 STORTINGSMEDLEMSING
690,220,688 *4743240C2D54A9733B219A0CFB37CCBB46099571 str3n9th3n3r
690,220,689 *4747976D2663797FAC145BB4A88EAD19F3B0BE32 SULFAZIDE6
690,220,690 *47432D0AA426078E2B50547D6882DB7D0B4CDA9C [email protected]KM169NET
690,220,691 *474DE6730CB90F4A63B7FD83B1BFCF0BE3D937F1 SUOJATISSK9
690,220,692 *474DC5B230794DD414E4F8DF1AC2083DA7F7C329 SURFHAMSTER
690,220,693 *474C1D41ADE9B0A3415FF6B61A1C63E44AA1F6FB SYSTILIU7
690,220,694 *474F7DA61FCE9DE95FD81B91F6AD3A43D4AE62FA SZÁDÁTI
690,220,695 *4743ABAFB0D7D2B90EE31C194D355DEDCD88BBDD SZENTKIRÁLYSZABADJÁT
690,220,696 *4742F553DCC80FDEB0FAC2003622A3ECCC900FB6 <table><tr><td><b>from:</b><td><em>online-help</em><tr>
690,220,697 *474A774EE91820CF8948854216FAEC147DD4794D <TABLE><TR><TD><B>FROM:</B><TD><EM>ONLINE HELP</EM><TR>
690,220,698 *47497250DD76E36CD0E7261E6433CB4A3E9F55B9 talk602401931
690,220,699 *474ECCB25D15CAE7BE3C8745668B56961E3636ED TALKLS2004-SIDDIPET
690,220,700 *4740BC667CAB3EA74D585BFB6FB89C8831709BDC talkoberdorfspachba
690,220,701 *474BA82B74D9DA63A5C8B81D3CE11F962D54E3D1 tamera-lynn
690,220,702 *4748270F84A20404337017A3DC2290BFCC038DD4 TARIQ-MOOSA
690,220,703 *474F4544186854D85853698A5B76A1CF8FE8FED3 TASNUVAAKTER
690,220,704 *4745203D1076E64F126C73616EAAA19A96DB689D taylordrone
690,220,705 *474E8EE22366E3F93C43DD8924406495DACC58E8 [email protected]
690,220,706 *474A9F85F115AC6D16E5C4D6C7BADE7BE411565A TEKSTBEHANDLINGENSING
690,220,707 *474DFAA080D6B9DB2679E01764B7D86DBDE5E9C1 TE L
690,220,708 *474C25D26A9B169EBE05A3D1F167F136B71C2DE9 TELOMERO5
690,220,709 *4747E06FC5A2A9FB2163B69D6441EE45327EB864 TERRYHA
690,220,710 *47485C7F850DBAEE41074DB9AC71F4F0EDD804FE thatvincent1234
690,220,711 *474D660848D5D727716EACC4AC76E311A050B0D8 THEADORA!
690,220,712 *47485CED8872F2FB4DCBC8C243BA0ABEBC566BAD THEPEOPLE'SSONG:FROMLESMISERABLES
690,220,713 *4747202B712865BBB3FC0329097A9D842A7A42D2 THERE WERE WORDS
690,220,714 *4747181C4BEB386FCC54271CF9B538BC97F58AD6 thisbird
690,220,715 *474A10D77799183CECC0E87318011AE8BFF23705 THORMORA'S
690,220,716 *474A15A9A64861F6EEDCC4F77A3321A9821FE900 [email protected]
690,220,717 *47483CA393D3B2CFA98F90DACB5528816242E6CD [email protected]
690,220,718 *474340395056A8E5FD6A7E3D3A0E51018A09C1DA TIGERE
690,220,719 *474E856DCB1364AAB7F449A93CF4814017BD6A22 timsochocki
690,220,720 *4749E69B4B0E53F6E7F5D2040EB0D6BFFCB2AD26 TIROMPHE
690,220,721 *474F394876344B03246BDF81DEFF90A9FC81BE66 TISNASSED
690,220,722 *474EB427CC34E860A1213F45F311144D1EC6709D TJENESTEMANNING
690,220,723 *47452DE6413E6B4E82BE9E74047271E495C54CFE [email protected]
690,220,724 *4747FC94F48D83567ABAC1149CD26CECE97C6B9C tnuoc.po%-cni
690,220,725 *474556CCC18364295FE699211FEDF883B0056C29 TOMMIEWOUTERS
690,220,726 *474686649D4F0650768806C2A49B67ED9502600D torycheu
690,220,727 *4743D03CF6E5427F1BCF7F2F039139A0332289AA trabajo-final-de-carrera
690,220,728 *474A2391E1103BB1F8FCC374218251AFF39647F1 TRACYKEO
690,220,729 *474713F5D142464E8FA566143A4C7EC241063CB7 tran-thi-lien-huong
690,220,730 *4748D46F80985D9A6FB26155CE768BA3D0E506EC [email protected]
690,220,731 *4746031536D6C22BEB70A30BC3F5F0C4787AF190 TRIEBHAFTERE3
690,220,732 *4741C746BD26046137F8A83D6123F064D5838221 TRONBEST2
690,220,733 *474FA18FA63503EF458D42E4A6B3768B4F66D79F TROOPSOUTMOVEMENTCO
690,220,734 *4746BE1BFFDCEA7BCAF31DCE9528B313E2838443 truetweaker.shoesaysallin
690,220,735 *47442179EA181999E99CA3F70EFB4DEE518C1BEA <tt>mississippi</tt>
690,220,736 *474BB1E8340EB327772209059BF5E657D1BF0152 TYLER.HAMMOND
690,220,737 *474C3D925B6943C8B54A922190126E376A0B84B9 TYÖSSÄOPPIMISESSA
690,220,738 *47495D02A2C0C57AA4E016617E58FE113853C602 TYPICKOU6
690,220,739 *474F6056B5D5E59B0A4980AEA9C735A032D36695 ubogih.1
690,220,740 *4741EAE49805BA0FF61E6926CFFC1CBC39C6AE71 UDKLANGENS0
690,220,741 *4742AC162D750B057A6763BEEA2EAD36EB94BCA1 ueqb
690,220,742 *474F0BF468E7018E8932EBB05359664AABA9A1BA ulric.machado.legouest
690,220,743 *4740CD3C68BA8E84D56843EB9C25A6FDBE0518FF UMADHANASEKARAN
690,220,744 *47422749D12D0D506316D8329BF87E4F854B5410 UMRANDETEM
690,220,745 *47444D5E9C3269B071E07EBD719D6AABA1C82E2A UNDISTURBINGA4
690,220,746 *4747B67B1FC051CFF4E37D0D30B88C42B04E91D4 [email protected]
690,220,747 *47411E90FA1F28BA7FC847EB0EA88842FF980DC9 UNPACKING-THE-DAY-(FEAT.-FUELLSAND)
690,220,748 *474DAB1647A77BBD7633162EEB4BF007A967B386 UNSAVOURILY9
690,220,749 *47424A8DE588CF84C78F28718E52B4A4414F7E88 URISTERI6
690,220,750 *47414378A232EF53E2ACFEB40DA6408AC1786544 USS160REID
690,220,751 *4741971AB2C23E92329B30B9E118062F3C2A5CD3 v1rgu1e5
690,220,752 *47432C45304BD496206A76865C19AC927A89CA94 VALNIENOW
690,220,753 *474D702A937291EC01D0C1959454065E5D4C303C veli-xie
690,220,754 *474B60B2B1F03F8015C16D40288C0AD2CE63E0BE version.45.style
690,220,755 *474BD69539C38EBAA899A8D95B7997F4DB7C4FE0 VHSULYP
690,220,756 *4747F0CC9F97A46DD5E4F450957F0F9E08276766 VIKIPANAGIOTOPOULOU
690,220,757 *4743A3D3B444856024D18650DC6A96E5FABCBB22 VINCENTMEAKER
690,220,758 *474CAE2CE2B57979176ECE8E2D4B583DCD797FC4 VIPUL-WADHAVKAR
690,220,759 *4747463ABA2186EF0F29F0870FE60BE63587B007 virgiliopalczewski
690,220,760 *4742970F62BF17FB2890E7E882E90DD1788B4B8E vitamtop
690,220,761 *47455836346DFD5C0F5288736E2A8F1216A75AD5 VIVIENNE-ROSS
690,220,762 *474BA627F3D2315C9B8F825EAAF406C90BBABEFB VNPARFITED0
690,220,763 *4748AFDC4A19D118A3B88E267BA943862C183124 VOLKOVSKIT
690,220,764 *474E4E4077FD8CF682A572CAD240351F9F54103B vsh480
690,220,765 *474970465521E8DC45E15B4151F83BA81352873F WAGURA WAGGZ KARUGA
690,220,766 *47465862AD1F8FBE53585A66C5EFD6A9D4B02A6F WALTON.DURICK
690,220,767 *4747CC2C3114647FFA828940720A5A50705C7E17 WARDCOMPO
690,220,768 *4749278B6551358FEC5FEE3C505D4DB6BDE36839 waymagat
690,220,769 *47499D3BDF5DD9709955BAB283057E27B83AD700 WELDON.SOLUM
690,220,770 *47405A741C86B7B899E4AE0C36F13B4A2FC165FB WELNA.DU.PLESSIS
690,220,771 *47416A346FC02E4D3AFCAE0FC48037B09307AA54 [email protected]
690,220,772 *4741B77AB0960E362EED9F37F81C1A5EE493D58D [email protected]
690,220,773 *47448A9B2B9AFB5A25689CFC26030CA1F0ED6367 WHATGODSAIDTOME
690,220,774 *474D9294DC98B96837D97A04B366841B25B92CE2 WHERE AUGUST = N
690,220,775 *474C8A745EE8E5D2998B4EB4A387917DFF6AB35E WHO'S.LAUGHING.NOW?
690,220,776 *4740341FBF703E5B34F86C3433EA2E3023FFC8B1 wilbercritz
690,220,777 *4740BC82B61ED62AD29A806EDB60AB0085669BC9 WILFREDMEENACH
690,220,778 *4741ED692A59A25664CDB1232EBA3FB40203B91C WILFREDO.TEBAR
690,220,779 *474A8645179C006E04C606F4950824338FF585D8 WILLIAM.RUSSELLS
690,220,780 *474EFC05661C2B565D5ECBC1B35117CD139B44B3 williebahun
690,220,781 *474F1E92F511A5944DCCF71767DC4D63ED513BD5 WINDDICHTI
690,220,782 *47471B92168458551FE31195E55467E8678638DA winnetoueu
690,220,783 *47468F3F866F732BC4415E104F800EE00F03A1AE )X(-~-(####8
690,220,784 *474A31F5451CC9F55A5A1620192B175D9F9B479B }x{~`dp
690,220,785 *474082A0C9F7F03B26FC90FA40FF60F1B89D1908 [email protected]
690,220,786 *474A6B960139D130C4E7069A11EF46BA2C57ED42 [email protected]
690,220,787 *474200006A91B5A0F76AE9B76150B93C38FE21CB YANKEESKID1
690,220,788 *474A68FB74AAA839C1D5C2844B25D102838D8194 yanmodinachavez
690,220,789 *4748D20C18816A436F30FFD466EAED7242C63151 [email protected]
690,220,790 *474642497181C90963972955A9854EBF1EDEBA9C YHZQLYEHEZQEL
690,220,791 *474563CC5F72AD621E6781CF943626E0EF24AB0A yoyok.adi
690,220,792 *474AAE6742036CB32A3066BE5F66311B56E82A1A ZACHARYNODARSE
690,220,793 *474CF3776091774F0D6E12D73783D539161CF91E zakliebo
690,220,794 *4747DC48DC4A8C053DCD57EF1209AE7BD82849CF zarinanawas
690,220,795 *474C9315B46B555456A27AD82A4E36700FD8371A zero-killed-(feat-punish-yourself)
690,220,796 *474208F8A1FF8617E37906D5156DD513291D2955 [email protected]
690,220,797 *4747295FE11842E7EE5FA41C196DDD6483C76828 [email protected]
690,220,798 *474323FCABD0B8316615E93285D53A11CD46BA22 [email protected]
690,220,799 *474B5056F39963EDF147446E93FED9C83BDE576A ziyas-yasar
690,220,800 *474A67F5D5171E810675EECDD3364C9E7EEFD044 [email protected]
690,220,801 *47437AEFAEB91D312C6BBCD21CBFD2377AAFBD22 ZŪEQUER
690,220,802 *474331217E9EF0605299A7345F2A4DE31192506F ZURICHISS{
690,220,803 *474B8A171AE7AF18E582ABA82B9C765CC5F28463 ΜΥΡΙΣΜΈΝΗ
690,220,804 *474DFCDD6837A0353EC5D4AD33E82E1C1FC04C9D ΠΆΡΑΚΑΤΩ
690,220,805 *4740E4804416FC21EC47BAA12BB42B7CE1B756F5 апендикс
690,220,806 *474057D3BC64CA276DB14847CAB6E38604A2A01D нлази
690,220,807 *474ACB4302614D03A44322BE82FC094BC3E31A43 СИЛИЩОАРА
690,220,808 *47428E0739A345C6CA59EF89EF2F3281B920C4FA СЛОАКИЯ
690,220,809 *474A2ECB3C4756449B373CC52CED23CDEACBA4B9 ЧИҚАРАДИГАН
690,220,810 *47473CD1F31C148FE7B843CA61227289FCC2A82A ЮЛЛ
690,220,811 *47498E199DC1074460D6E96383DFB1A2B41038A2 後のガンダムmk
690,220,812 *47450315E8B46F6D8F26C98A8FAD0741AE65A095 0IAMROMMEL8
690,220,813 *4740FC5DC09846C8C7A32B538FA1C63315EE6018 0PR1GT3R544ND33L
690,220,814 *474B73EEF53AEEA713DCAD3B17C1A54A124A7F88 1009156 eikonsultti,tottaviek
690,220,815 *4749649D7BF38E8572FAD218DEF3B4381A7B249E 1089769 piententietom
690,220,816 *474BDF9C012AECCAFF30BFABC2F760F1CBD545EB 1147792 musiikkia-tuli-kuunneltua-ruokapaikoissa-,-jossa-m
690,220,817 *474C3D9BAB81ACF77E1089BFAFB13C3F721766CF 1161758 eteni-5--ulos-toisen-kaarteen-alussa-,-mist
690,220,818 *4747057632648A3223C17B100195AF426BE99283 117SEAMUS
690,220,819 *4749E4F0FF23F042E479A405CC315726FD62AED8 119.izmir'in
690,220,820 *4745BD3FA4CBBCC46B4C375C55B7BEA516AD6301 1823117 kunnon.aterioita.sy
690,220,821 *47495925A286B2FF03E17E2A08CCADD076E8EAA9 1848652 LAPSETTEKIV
690,220,822 *47459EE572E98F95F7DFE876559544037A91807A 18WIRE-SERVICE
690,220,823 *4747660203299E9FAC07C8700BFDB3FFF5EF6384 1countyline
690,220,824 *474FF572047D30AC1E62F5F98EF35DF20087713D 1-dubendorf
690,220,825 *47474D79B5B0C2F918A15B6263E065A5EFAD5925 1EKONISAC
690,220,826 *474D6011CCF7245C98D276992B7DF5FB3EA57A2A 1 gatesverteidiger
690,220,827 *4747EC72518CD67E315639D20C37D24CB7C65CD1 1GNIBMOTNE
690,220,828 *474C980BE738AD06BD6B8EC9949AA1FF3F2A2A6B 1iluvemmitt6
690,220,829 *474B0C43866FF83F1D047075492DB7E95A42C098 1-ISOISILLEEN
690,220,830 *474094524FE300E7F63E60B04A9C19E7E513EA16 1-lysolaje
690,220,831 *474D971A5B17C0478044B16FFF439F035B988867 1mallelle
690,220,832 *4740591C7B78910068947ED33A17B97C32EA8B1D 1-OBERLEHRERS
690,220,833 *474B845782096F7B756836ED6FC0F5A529C6D1BE 1OWNIE
690,220,834 *474D7F10AF39CA2FEB9C6B00F724C3D95FDE79D2 1-PFENNIGSCHLUCKER
690,220,835 *474F111D07313BE478A8C2B36ED6A315232B8D7E 1-shoestore
690,220,836 *474D2C6CBE8A7B44B76A440D38DC37AAA2B0677C 1.SPACESUITE
690,220,837 *47440EEFF466BCB3799CE8E915AAF862010F84FA 1STNFNDSN
690,220,838 *4744C17BB35D1E1161F20A66751A841B6ED915B0 1.verjuengungswillens
690,220,839 *4747B9846F9EBBA557DB905B70772D02153AC4AA 1-wehmuetig-heiter
690,220,840 *474F5FF75B87D506381CF0E0009BE41919EE2BA4 1WOLFHALDENS
690,220,841 *474F825D22D8C8CDF312576FFCDA8A8427B1ECA0 2060871 seurannan-toteuttamisessa-on-siksi-t
690,220,842 *474C57BE9FCEB343BDDB9BCA6D8AE412C92CEFB3 2545495 identiteettionsiishaettavauudelleen,mik
690,220,843 *47454FE5B0D7A8886FFFDA739A2A8EBC1F9FF06B 2583976 HINTOIHIN.LIS
690,220,844 *4749AC9353C00057A08D8DB2A843B94B0BEF2765 259627
690,220,845 *4741D951ECBB57A7F64A97F22ED101DB30D7B698 2672478 "ICHWOLLTEUEBERCHRISTINESPRECHEN",SAGTERUNG.
690,220,846 *4741C27D6E1094C4539A7CA860CEC75F4F19E580 27-ENTSORGUNGSANLAGEN
690,220,847 *4745988D8B8DCC96EEB15C925910F4C0F7D3DAEC 2819226 jospuhelinkeskuseijostainsyyst
690,220,848 *4742B2ECC29A1418BA65AA24D85AF9D8593BE186 294276 monet yhti
690,220,849 *4744859A0C941C558F380375ADB38400CAFCF2D9 2BRUSQUERAS
690,220,850 *4747C4A720CF9EA82AA3840961F626D9540B15AD 2CH7MX:IJLZTS
690,220,851 *47468EA4D40D21AA869788CB642190388C517B01 2-DAGARCIGINDA
690,220,852 *47474BCCF7FFD38A281D7D76C22020ED88400B5E 2-DERTOUZOS
690,220,853 *474D7B583B07D9B5A8EC4A1F58201D53076282C7 2 EILON
690,220,854 *474C7F3FB53ECA154F7497CC787814C574E9A8CE 2.FAUST-OUVERTUERE
690,220,855 *47462F600E26E7A5FE9E0A92972F966042CCED75 2fdocpomus1
690,220,856 *474FFF21FDC1B3267665A9A4F34E2B584BE86546 2.KAYIKLARDAN
690,220,857 *474215AC42C452B952DFF632AD625B444EBCB9E3 2NRGLLSS
690,220,858 *474BB41DB75394751FDB1E255812446CAFF0B827 2-PROVINZSTR
690,220,859 *4741C60BCBAEFFC51613006890EAEE9541528BF7 2SCELLERIEZ
690,220,860 *47439B516E46EF7DA3288EA126E471329A052C40 2tunnisteeseen
690,220,861 *474BBBE2277FADBC0B92FFD95A35F8030C1D8073 391.api
690,220,862 *4741303FD190BCA23E497DBEAEC2FBD16A4E1764 3 BREAKFAST-TIME
690,220,863 *474D85664778A3AD40B334292EE50C21C759F8BD ,-3.-CON-MOTO-MODERATO
690,220,864 *474A0FC83D80B90755751AB45103492DCA19CB73 3.MATKAVENE
690,220,865 *474DD6C069088A0C9EDE8932C2FB97842EC161D8 3NATNALT
690,220,866 *474E1776CEB76A3CA7CEF932947F8C67CCAF5134 3PAPLEEM
690,220,867 *4747A0F878177E60811602A854798579ACFFCA45 3 PFLANZSCHALEN
690,220,868 *47486DD4F969A31B8F073D1E48D2D6503C7FF167 3-skilta
690,220,869 *47407B9385BBA537FB969C73756D5A8469E2878B 3[[USER:KALKI|KALKI]]19:23,16OCTOBER2008(UTC)
690,220,870 *47411BF68B40611DD1755DAC5DDF9E9DE5887867 [email protected]`~`~)x(
690,220,871 *4744A16C1964228A9462B2808813B4093953AEF8 474088 klassiseen.karhukopio-ty
690,220,872 *47409A0F6465911C1A8DD1D64E6FB12523B70AAC [email protected]
690,220,873 *4746A67880B6C32A5E7342C3CF8188C6CC3120B1 4KRYSTALSWEETY
690,220,874 *474D7968E899A53BFD949E30C0F6680DC5695AED 4LLIFLUFBSW
690,220,875 *47486949E7C669C6FE921C4E20BDF112A6379F1A 4NEWCOURTCHICKEN
690,220,876 *474CE44910D020261A9EC8A7C57DAFE05308BCEE 4PORUKALLE
690,220,877 *474D1DA2AEEC1CC7100EFEF3308C6D2118F5D29F 4REDELSS
690,220,878 *4745FE3884EC5C16467BA37B6BEB121AE80FF3B0 4-TEETT
690,220,879 *474BD1A3551B844577FEABD368B83921837C4C64 4ULIJETALA
690,220,880 *4740871DCFEF55A8DAB4503B599FF91B1ECB1609 5BATCHBALLOT
690,220,881 *4743C804AB4507833AA9BA16408DC8BE455D1265 5BLOEDLEMOEN
690,220,882 *474B4A5795649F0B824F19274B1271CC9E71234D 5CASENSE
690,220,883 *47481D6A4C2E687B5BA25619D2CF81BC26F52C64 5CHILOGNATHOUS
690,220,884 *474EE28A35294372B44EEC051416D164936F4AB1 5NIRIONER
690,220,885 *4743B15FD91B2141A4DB68BA129D09E9C2AA87D5 5OVERSTTELSESTIDSPUNKTER
690,220,886 *474A80A19459A791F5A5640362418F5FAB0E4442 5-OZYURDA
690,220,887 *4748F1D2528879D392D51046843E457275B73DFA 5z51am3g412d6p8
690,220,888 *4749C7422E60B601F002813D3B57FF5C04C8DA87 615182 JOSKUS OLI PUHETTA PAMIN SUOMALAISISTA SUKUJUURISTA .
690,220,889 *4747D1B03C6FDC63880B34C3D6D7DB2A0592D6B7 621486 haunhinnaksitulee0,59euroa/haku.
690,220,890 *4745EFF2035EE8AE87C70B30737EFE57ABB96D02 622BROOKS
690,220,891 *474253DC80EEF67247920F42D5A96F6F6710BABE 6DARKSID
690,220,892 *47406FD75722C700BAA13B45897AB221B4F796EB 6ENCALENDAREST
690,220,893 *474AC9F4976AAB1707EBB05ADBC5DB0A43CAFF6B 6EVITAREDEFNOC
690,220,894 *474D3821B92C47742F1BB0E1A6A68E41DAD72CFF 6HETEROZYGOSITIES
690,220,895 *474811808F071A54AB0B5C3EF17C77953059ADBD 6ILUVREVOLUTION5
690,220,896 *4747B4EB448D3D7E37A7B1A52EB279E9EF5ED4D2 6judy3
690,220,897 *4742EE5F2B0F91344C17A10B325F32A3D2729854 6.OPISKELIJAKORTISTA
690,220,898 *4745CFBC85BDAD0A7C38E2F239A6E16B2C79E4E5 6TARPEELLISUUDEN
690,220,899 *474D8E3164E4F85E070482779DA207C763C549CE 7966BE882FAD3D88A1FD6A5263C40CD7
690,220,900 *474971D4A343306F293C3A201E53A65B840FEBD2 7BSWINNOVATRONBSW
690,220,901 *4745639F5A66B1FB3F14D73AE87C0728BAC70E09 7ILOVEASHTON2
690,220,902 *47484B1EE861294F231A15F80F6FC61487B9179E 7neuvostoliitolta
690,220,903 *474F545FDBE3D385672A762DD4468718130614C6 7onteigening
690,220,904 *474E2225177309CA4740446CF21C95917893EEDD 7pumping
690,220,905 *474BCE2D2FC59D908204359119F1E61BC1028BA3 [email protected]~)8(
690,220,906 *47430878010E4B203257282A4AE60DA7B7DC9ED7 8--B`~.(>_<)
690,220,907 *474951DECADA2EA96EB4A7791C449D01209DE626 8BEFARAEN
690,220,908 *474B6F78BB47D863D324C7E6E54A6D325D2142B9 8----B*.*.*)X(
690,220,909 *4744E25086CECF637B1BA62BEC76AF5136549904 $8IRCINO
690,220,910 *4745BDE388D276B372183A8B940A4564ECDA5062 8KVRKENDES
690,220,911 *4747838D8212AC08589FEC75999CEE6B9607BD7E 8MYOPHILUM
690,220,912 *4747A98FDCC6335EB87C20E58B1F4D5533EA3F8D 8#####P.*.*.splat!!
690,220,913 *474671F9007C72D02F6AB0CA67545C3C101E333E 8TONEFILMGENGIVERENS
690,220,914 *474696EADA0F2D0F68B4C77E61D220418EB94313 8VERSPIELTEM
690,220,915 *474B3B8B05766A5E3E1192123D14067F0A826FAE 8WNC
690,220,916 *47470D0324ED367A25B41EAC283A7AFF6849CBA3 9ACCOMPTANTSHIP
690,220,917 *474D4828224CC4E2A2344212B5DE9C14C14C653A 9AHSUOYR
690,220,918 *4740A5605F1A422836E2870DF109DE895D9DE3DE 9.aventiksen
690,220,919 *4745EEBF14E5DA56F372517D579DC099D1FA6F5F 9BEAUTYHITHONEYHUMDINGERKAYOKAYO
690,220,920 *474E9995C12478FDF43D72257059168667E27D5E 9INPRESCHENED
690,220,921 *4743C3B95E2527D6822268DA9494F26093E08587 9NTRPRMT
690,220,922 *474C210D49122F0FA8E7EB09BCCAF42DF701F4AF 9THEJUSSI5
690,220,923 *47424366041D6F219C409E641290F9BDC8D7DA84 9VIDEOCASPER
690,220,924 *474FB346D98F8FC8066E0762B0AAAA4B2395E1D6 9XMILLIAN
690,220,925 *474AEB94DA5B80FB7ED4F5407FF864BFC30DDDDD a%0af
690,220,926 *4746CC26DDA10CEF3A63E28C1FF307B95F9B8F77 A15F!
690,220,927 *4741F3C26688BFFB1D0DC2E0C93016D628486574 a68m?
690,220,928 *474FCDB80FB568D89C9B3DDAD30E1DEDCB54493C a#=+a
690,220,929 *474007F0717EC055B875E8CB6FAF7B3A9D186976 aa4fl
690,220,930 *4747860CD178CBBCE0505220613673F7708F85F8 ab)%b
690,220,931 *47485C9A93F1A82186E0464F708B860583614146 abelorys
690,220,932 *4741C00385965CF2248528F9C4F77E47D4F15049 ACF.Q
690,220,933 *47470842096B5F3A2830F67292D14A30D54DD3D0 AGNUS-DEI-/-AGNUS-DEI
690,220,934 *474AE69FA1B99583D433447508AD3FC8C4BF4E1E AGRUPIE0
690,220,935 *474F00264436C0E5D78D047963240D74C6734394 AHas
690,220,936 *4744E386A4A9E97EAA9F8CA1D8EDEC322885A6E6 AIAVL
690,220,937 *474A166AE041137CBC6B693BF09F97AA4CADFE10 AIEFB
690,220,938 *47492EE14DAF50D671778E13BA69C41BE1267EC3 aistenthal
690,220,939 *474E50D106D41B77D0D7ABEFE9F3D4AC1D8344F8 AJWHALES2007
690,220,940 *474B9AD5DB6A2208BD813A5E80BBC2AFDF0DC4B0 A(KQ)
690,220,941 *474E0C24DFC4E0521E6130B20541E5A9193F6EA0 ALEJANDRO.DORWARD
690,220,942 *4741B38080BF8CF24BED336FE3C260D33CB5DA48 ALHAQUIQA
690,220,943 *474FE2BCC896AB733E2DBD7C49F56F7F62639FC8 ali.ori
690,220,944 *474FB4BE09B118FAEF674C706C48B5D587197A22 ALLIOIPP7
690,220,945 *474384E373A38BA14C443CD5E02346761740690F ALPINECLUBMIX:30
690,220,946 *474D1D6094F5E81CF077FB35C974D3572E18FD43 alvaroperritt
690,220,947 *4749365FBF3E906D4D4534D527669D58B01C3922 Am7q
690,220,948 *474B31C2037C909E77673B187B7FB54F2C9DA1AB ANERISIA1
690,220,949 *47439211993EF01E5E68C23C4A6312C338DFA014 angeliquecote
690,220,950 *474D8B2C52F278295F5577017FF053C300D42F9C ARNOLD)1874
690,220,951 *4741C712EB87C8F8A6135E3F9A42460A64132F19 ARNQE
690,220,952 *47481B73F8D983447C6DFDE5294C7107CE4A1C27 ASSLICHE8
690,220,953 *47455EF3F0B23BC82CABBE3D790C00D359A09C33 ASTELEE7
690,220,954 *4742350CE072BE9DE258B5AC776DA13BBE9E7708 A-STORY-(B)
690,220,955 *4746A9EC0861C03110A248847810816D81C33277 AT28;
690,220,956 *474A5A6E1A9A04A5D4237B5A0B1B685275D28CFA ATOMSAARON
690,220,957 *4742D11911E5E449C52E55BFCAF5046BE2CD1178 AU6:C
690,220,958 *474899341D65D9D333B081E95C1E4F5F5FE9CBE6 aurives8
690,220,959 *474BCFFED8FAC4DA9A55E20DDD6D490D63CE297D av0=r
690,220,960 *474FE62F37720D41D117D9081D4450F8910A1EAE a;x/h
690,220,961 *4749D58F5F067AA28384B17153C239691A42E33A axk&w
690,220,962 *474966831ADF4657A52C4A15A579DC78F1211077 AZT
690,220,963 *474306B746DD79570949C076DF9AFA920C8DA0CD (^_~)*<####B
690,220,964 *474BE76665652909C8FA87EA4105B34383DFF4AB b3tzi
690,220,965 *4746464F678760A2790264BD0DEAB2BFB05D947B b;7o%
690,220,966 *4749C4525ED0F13B25DD202EF42CF6259DA892B1 BA11ER0
690,220,967 *474B754BB658284C8C3FFD495E7AED1C1F040FE8 babyvai
690,220,968 *474F7AE8C019C2E074348D46E603B1C5CECC923A !BAIGANIO
690,220,969 *47476030C631623C8891704272D775F9C4D072E2 [email protected]
690,220,970 *474639D279EE3302DF6721DF42D6A2917F8EDECA BAJNOKAI5
690,220,971 *4748832401440F7993BECC5C29644E7C16824E41 balld
690,220,972 *474A6D153D83D21D2B6C12019CAEA2070952B6BE BARRYLISA1
690,220,973 *474FE660AE9565E9BDD9C72C94D3C8C31960714A B--B ~0SPLAT
690,220,974 *4740F2FC1F966F61029202428EEC11511A6BD57C BBS6D
690,220,975 *474D392C0F8DAF7A64CACD24500280CA16713C59 BECKY.DEANDA
690,220,976 *47489D8214F404C018E43047AABCC6B5845FF50C BedroomBunny(b)(instrumental)
690,220,977 *474E19F1F8DCE9D87FFB0A573F73F61A6FB4DBDB B-EMP
690,220,978 *47490B469A658798A718E4F7B22B80CA3886BF94 BENTONTOFOLLA
690,220,979 *4748D8285251C2AED103E20E5C85D7E00824686A BERT.LOETZ
690,220,980 *474DE17382753E53C05F089D965AB3A0647E1B38 bfk+"
690,220,981 *4743751BBECBF56561132BC6679CF656E1C1D9B0 BG+
690,220,982 *474E8D6308CF86000FC398216EEED094DA94C50C Bh5"
690,220,983 *4745160A5F7A969866C1DBD53EA1BF03EDD3BFE2 binkypentium
690,220,984 *4741777A64A1827202CEECF20B5FC1D5CDB94C79 [email protected]
690,220,985 *47416915DD5A28CA82C10327B643C05DC2054354 [email protected]
690,220,986 *4748022F785DBC10DF05032C9BD031AF0688AE61 bk"dp
690,220,987 *4749175747F14B70B874F26AEC4E6B3ED1CEC344 BLAINEWRENN
690,220,988 *474706BA2FDCA67B171084F0E367AD5C901335E9 bld4l
690,220,989 *474A515BE96F85D86A39B580F9ABBA897CC7217A b"ln;
690,220,990 *474F14E97FF722D5E68759ED04EF5E42F657D2F0 bloopered0
690,220,991 *47490CB60D0AF97C4FA051B751014B3DB0DB1EA0 [email protected]
690,220,992 *47455BBB71928E82857E1912C883AEF7D2BEB7DC B$+MQ
690,220,993 *474ECE25D0E74D3AA517148034825A7FDAA3CBBF B#O/
690,220,994 *474569C5DF257A6B68B0D6CB2400386500B03160 boelensl7
690,220,995 *4745E61B040B76DFFBF6A5D49FA268A4FA2989F1 B(OM
690,220,996 *474151AD799156220881382F5948E210A21C932A [email protected]
690,220,997 *474DB9162E25DCBDB10A485BACF25552048E2FFC BORLINOE
690,220,998 *47494B221F6F4A6FDFD127B2258CBAF3BBD53323 BOSTAGE019
690,220,999 *47451C5E3F92B5939BD03E0D5DD78374146D9612 BP ~O~o(>_0)
690,221,000 *474E3A91A1CC42D3EFC0FAC8022530DA263D9041 bqpjf
690,221,001 *474F70017371080D2D04A1B0FB1571E03FE6B587 BQV4X
690,221,002 *474F60AE9DB6FDCBBCA66BAE51B21355AAE01EBC brainpangelina
690,221,003 *474C7DDB971CD32E90C64F107BBEB0BA048BA97C brian-infante
690,221,004 *4742514B7A586204FE9FE8DB435D7908D3379EF1 BR^IHA.NTI
690,221,005 *474912C73A38550B89AAEB836A55BBB91C7F0A24 BSA0,
690,221,006 *4741A9A16B5491B934CDF3CFC9B68577069B8E81 BTGPACE
690,221,007 *47490F35EFFA841B206C94B4548B11FEB44A12C8 BUBBA55ASTERN55
690,221,008 *474C9E827B37A1046D77E862AA6B7C0A542BD412 bungm
690,221,009 *47421BA569C62F53FB1C0C2DE1CF63725736624A B&V9(
690,221,010 *474C52D0281E69F538BEC3FAAED32BB3789C210E B.=w
690,221,011 *4741E6883522A513EE2C4C470ED5ACBD4A3A9D6D by.wu
690,221,012 *474325FA50902C1FDC6D2A164E89886D4FB4854E bzft:
690,221,013 *474F3936B5FBF5423816C7B81E63F7E5D6B9BB9A C12E12M12
690,221,014 *4745BDA8E1F1146C94D337FBD19F132257B9D759 c2h(.
690,221,015 *474EC903103C2D8D79EF4D9BA169C1F5E0013CE5 C3M8(
690,221,016 *474F269D784EE803E440A772B8453D06A5535905 C4UA
690,221,017 *474A463F2A7CF57A0F8B9974C4ECEEF4A9111346 [email protected]
690,221,018 *4743700552C11EEB6F1C3EBC95BC085D028CDF70 CAIT MADDEN
690,221,019 *474388C24549B5231D4ACD623079A88C572D9885 CALVIN.TARPEY
690,221,020 *47487410163AF407B58C1548B518CA4EA86F7A75 CAMERONCASALES
690,221,021 *474AAF10B2D6326E79B0E1688CF8AB2468D85E49 CAMPBELLPANTERA
690,221,022 *474867C2F52AF20C4D642F9345526FFBF414561B CARLOS.CENCI
690,221,023 *4742A9ECE48FAC34D1786BCBD19F5159744AE9D2 CARMENGABARD
690,221,024 *4748FD8E7018F314B1EC1F19FDD7DEA27E36BDD1 CARROLLFEDDE
690,221,025 *4741FF8F9E3C25E645BAD04E5AB830CCB0BB8723 cd3x-
690,221,026 *474B5320ED85AE1D5C1D9B831231DF8D805CD295 c/"dl
690,221,027 *4744C541012F787C0C07360F19BF49B78DAA7284 cdo4l
690,221,028 *474037084BE2A7E89D35A82D8701041D7B052E68 CE1TO
690,221,029 *474F2A231BBE64E3FD1A5403438A3BB34ADB8025 C,fK
690,221,030 *474E7EACFBB4DBF649CF656F895026D0CC900055 CH6#T
690,221,031 *47499DA71EB9986D3CD91928D28B080FE8B04E1F CHADMIRACLE
690,221,032 *4740920DD602CF66074F06FF75A868CB828F3EE3 CHAMPIONS LEAGUE TENIS DE MESA
690,221,033 *474E29E2F9C67B76CDE532CDD87BA13ADE22076D CHAPTER13-44:DETENTIONWITHDOLORES
690,221,034 *4741AC7B7B238562937A2EB1FC798D05DE5A3A81 [email protected]
690,221,035 *474CA02B5EF402F7C62F0D7811853397ECD13FBE CHEN.WEI
690,221,036 *474F1D294457BDC24B658CD9D5957F3CDF2C00AB CHLOETEACHERS
690,221,037 *474C691D3AAA0BA037BBECB436442491E27B0FFD C)HZ5
690,221,038 *474210913613FE3A889D5D3A7024798E08942C10 cjkms
690,221,039 *474AFA72313FFFFB36AA8996E35648DD6201F493 claudracano
690,221,040 *474A14DCC23D5FF07C249144EE26D0059BFF40C6 CLAYBULIN
690,221,041 *474B1AB272CB4C75E3E038E737B96444E21B0DBC CLAY.TETRAULT
690,221,042 *47421FA3E970C05B20E70B781FADF62984CEEE12 CLEDX
690,221,043 *474E79AABBA0AE84B8A7320B9B6102AF7D947F7E clgs$
690,221,044 *4749572E40E7926012F6B07F92DA490178283FDA CMJHR
690,221,045 *474DED3D2A8CCBE5145596F9C611F03FF005672E CN,D!
690,221,046 *474EB1FF5EB69CF419E8A4271FC4F3E6E81C5B4C COMMUNION FOR THE 3RD SUNDAY IN ADVENT
690,221,047 *4744B21B5FE1D37FC41288FC9EFF7585401C524D CONRAD.PARMS
690,221,048 *474C0E0C94FF4555398336FDEF087F9E05952D38 COOKIESHEARTS
690,221,049 *474B3962AA6CC2DFBAF81536FF2BC02D017166D3 CORDELL993
690,221,050 *474A59B8CB3F042856FEB28A983BAE11FF5171A7 CORRECT-CARTESIAN-RE
690,221,051 *47463A2CE10422ADF44B195065F94ACB661BC6F2 corruptibly
690,221,052 *474060834DE058AD2CAE21556D12C3F2FB47A412 CpoK
690,221,053 *474E55CCD37FFB8F3020DD0DD2E7025E9B1FA67E C;PS3
690,221,054 *474A3DC2106DA5EDEC07748126AD706D4D2B6BE5 CRISTELM
690,221,055 *474268C64E6B49F4493F800EBF58E2AFC4AA1712 CRISTOBALDERIENZO
690,221,056 *474C0C73EA3015CC5357CA837C5FD71D39F1E9E4 cs-primo-corp-|-united-states
690,221,057 *47440448B8DB26627D123C9B043E08DB03B6EA4D cuarteron4
690,221,058 *4749F65246049CD270622E68F59D2DBC0CE22601 Cu;T
690,221,059 *4740ADC9FA3C666A945D771E6C2F0B0CC69AC604 [email protected]
690,221,060 *474A28874CEA034A363FD38189492A42CC20A813 cwogf
690,221,061 *474F530BF7907B210AFF6A1D57DBE5838B3DA6BE c.yg6
690,221,062 *4746754415003E4705D32706C0B2EDB94C0205B4 [email protected]
690,221,063 *474BB378185364A46EA936A16AC171F1BAE3A4AB czdcp
690,221,064 *47412187DF8AFE246CAA4723F3667A08B31C4B09 D_.-
690,221,065 *47419F74F54E46BF1D79A341D0DE3F660D4009D7 d14mv
690,221,066 *47443C444C8B84ED98FAFB52EC64F214E8D966E3 D2VLB
690,221,067 *474CD760DC0A7081B09A6DBC48299FCBA1DBAD8C [email protected]
690,221,068 *47458A896183D100F57D4E64E87CACFB69863840 dark.ferment
690,221,069 *47487F92A6F31747B0AAC6BD03F64EA52C5D0567 DARRINLIEBE
690,221,070 *47406B8076D346BF13A0889063F5A7E265F2551E d’couverte
690,221,071 *4743BA31FA60CFB1C1F14D2837C14B34CAA70C92 debiting
690,221,072 *474DD3747F026B3111069B0806EF9089D88A808C degaspipeshe'sleakin'joe
690,221,073 *474BA233DABC3476B7495768E8F08F0A36F73A87 DENISIK97
690,221,074 *4743B3C3C7BB3693034B677D4D74E8A7A9C7A366 DESCONFIO-DE-LA-VIDA-(FEAT.-CELESTE-CARBALLO)
690,221,075 *4741FA465D6F36D4BB74671B6B923FFF3E3A2E87 DESIABA0
690,221,076 *474FD9922E6E151CE0D438AFBC3DB3EB0BB4814E [email protected]
690,221,077 *474340B574A91A3270C664A6EBA97996876526FE detva'kkeminskyld(radioversjon)
690,221,078 *474C645B1F07F6FAF48021D4450A09C29A45800F D"G95
690,221,079 *474DBEED536145001A40668708F1F174EA5E9DBF [email protected]
690,221,080 *474160B617D2A647982E98BDAAE4E080278EE665 DHP!(
690,221,081 *474F281C1D8028D07E4D35E329BF656CCF4A2176 DIFUMAR7
690,221,082 *4747DADC9699D39906E4AC57306D490674D7DD80 DIN-S
690,221,083 *474CC937BF94F9DD49CFE3AEF68F7F9B604E48AF DISCOVERYDINOSAURS
690,221,084 *474505BC67BB38F5B69ADC7C9F563E12F3EB9D84 DJE;)
690,221,085 *47478DD7697CECBB97A7125DDF7163B1E999ED9F dk$l6
690,221,086 *474E99919123FAE141EDD0405618F54A3CA58C5B DKTGMY06
690,221,087 *474FE616FCCD0D31CA32A688A5BEB7EB96873D8E DOMINICK.SUBER
690,221,088 *47445465D53B4DE731229D4F4DEDE09C4CEC6143 DONK3Y 3N
690,221,089 *474C4FE7DEF47D5F6F411D756B4368A48534FFC0 donteboudewyns
690,221,090 *474799AC9076ABAE2F9CBDA35069FD2D8A5CF63E doodmartel.
690,221,091 *474099112B5D4367CAE523FA479E7B8608816554 dpi,,
690,221,092 *474ED8AEAF22687E8A8E78C757D516F11397F870 [email protected]
690,221,093 *47499E5316C3C812D3FEC1D6119E537797C27378 dpupk
690,221,094 *47406CC86ECEEFE1925C02784509A8594205B6F6 dqwm+
690,221,095 *474E5FC3EC2C4D6AA8B463FFC908C60446AC5810 Dr&8
690,221,096 *474F5D7E075FE16D24D54B76423397770ECF2775 DREWPENZIEN
690,221,097 *474B8ADB112FD39AA27551689B775EAEC388F252 d_r&g
690,221,098 *474DCB92EADA7F0CF9B94200C0CC3B5A7982AC0C DRTRUPTIJ
690,221,099 *47494567A3C869F236F6D413184D408C041C6688 „DRUCKER“
690,221,100 *47440C4351FD2093473E735A809041CD3425FA2E dscn1278
690,221,101 *474AC33BBC42898B2D9CB58C5B0E7AD9FC750374 dwkeo
690,221,102 *47403BA065A87D21335DF60C02AFE67B64DD9A08 dys(m
690,221,103 *474DF0FC3AC182428C1CB9C53350403A6C1C5C7A dyw:v
690,221,104 *4743A019D2F433B5984256392AB7F09AA24681F7 EAW06
690,221,105 *4748926AEA09B2C65F617B5D5D039DEE45232F6C ECIDOI1
690,221,106 *474BF526B44E9885F3294719959E732DEF2FEDFB egstaat6
690,221,107 *474ABB25968DB90F499F7E8924F0386D3244C70A ekssp
690,221,108 *47493D7BD381D7C098EBC991AF7BD7371508076A ELENA.LUNN
690,221,109 *4746FE6ED3D87DBD217FD2ACD91853598F034190 ELEVADORES.OTIS.LTDA.|.BRAZIL
690,221,110 *4746F9ADE9ABC459E83641185D2BA6CCC2C164AE ELISA-CONEY
690,221,111 *474E8B02ED0384A27BCCBCBC8985279F9351AB0D ellsworthshrader
690,221,112 *4748DD614C122707577ACA8DEE240D60E75ABF82 ELTON.KIRKHART
690,221,113 *474BFB1C1D00C201FEE75754A426339FB79E4FCE EMERY.FANELLE
690,221,114 *47447936D5FFD3EF216FFF5FF4878B1B592EC681 emoryhoegerl
690,221,115 *474BC0F82D41400F36087115FDCA33308E519DE0 ENESLEPAS
690,221,116 *474B8D06BBFC17B8A3F557B212A72836F8656A10 ENIALEVA
690,221,117 *474A08042C7BF6A7AA999C44A4CA39C3923614E5 enmv!
690,221,118 *474A40477EAED0A59BEFDE213C3F6E8E40A7E55B [email protected]
690,221,119 *474E138B07BD5069FAC879348BDC68EB2C092267 EPICO+YLEDONARY
690,221,120 *47499899DB8881C39993EE689C9D27562074EBFA EP+RF
690,221,121 *4742F32F0232AC65E2A13DA87A76428523EC18AA ESCRAVIDÓN
690,221,122 *474C085600CF5A119C775DCFCBFE1470B57108F6 eth(2
690,221,123 *474089447C3E99883957A2DACC8255A085013890 ETHANZUERCHER
690,221,124 *474AB66486CBC702E07E63C9A00F85A466FFA6A4 e+)u
690,221,125 *47417646CBC2469E2E8085B90ED891FCB0D3D05A EVADORHAGIDIA
690,221,126 *4749601F4D798952F40CD2E1F8C9D64BE9ABDD5D evanrad
690,221,127 *4741F947CA8698E899BB9E0C11447013ADF91AC3 EVANSVILLE9
690,221,128 *4747B6543B3F82D7C8F9D3420ED92D23BC41BD02 EVITIDEPS
690,221,129 *47431404E496C90C0BD2A8CF8B5CA0CF2D2C3DCB EVLATLIK0
690,221,130 *474C001D8FA0C86AB462D68C6DD9F38D7A18063D ex 10
690,221,131 *474E06F413A712E74E93826607825A01BA163C0F EXECIOUS
690,221,132 *474A8E7A218F232443D8A0418B95585F5E630C01 [email protected]
690,221,133 *47409E2D1FCA5F22AB845DC1893209C0763703F7 [email protected]$
690,221,134 *4749D29110665316734573E458FF4198F200B5EC FE-C
690,221,135 *47441AA69F05974983756A47E9B30CEA3B7CBC17 FILIBERTO.LAGONIA
690,221,136 *474BC7E3B62A7DE8974E697D3F6D62AC09C71766 FISSIONFUSION-BOMB
690,221,137 *4747A1E6F15DAED24EA46C00AB1E953C1A074AAD fiveounce5
690,221,138 *474EE3EFA17B1380B73EBBF1768E45389F50F028 [email protected]
690,221,139 *47487A54BA82CF33B5CA9173E206C36C98DA81C6 fjf&
690,221,140 *474557ACD9F02481AB977CD4C78670E8580934B4 flightofthemonarchs
690,221,141 *474E119179C289DFE0B0F2D1D40C33F954F877B0 FUC856
690,221,142 *474CA2F5F82248100246897BA421E3587BE13151 FULITIME
690,221,143 *474753F7C035974E04B34400530954D04CAC3670 [email protected]
690,221,144 *47487AB5BB037EED1CB78401A75E6B71D20AF077 FYAITANES
690,221,145 *474A76A7525B1D51294EE2A4A194CF51EDAA364D GABBURI7
690,221,146 *474DB35E178FC9FA6657E9743AF26B968B006147 GADELEKE
690,221,147 *474B734A6194FD539E149B73374604023CBC5152 gadovima
690,221,148 *4741297C67A4D0DFFED9F7CC42133F468425E274 [email protected]
690,221,149 *474409484AFFD832446F1FC2F06A52F35D451D8F garthbiscari
690,221,150 *474437FC531BDEB1D77675FD5A52EC81DB7D8EFC GARTHBOWERSMITH
690,221,151 *474E11C7B936C94578C4E97F2C8E1410BFC3F68B gaymon1
690,221,152 *4744ACBFC33EDB672E074906CF8510AD9F7B54FA geomate
690,221,153 *4740688D436D9A9885968270265796758391CDB7 GINOSULLIVAN
690,221,154 *47464C3FB8B40E9A3120E9DDCB5D6F36C28C6B9E GIOVANNI.GAWRON
690,221,155 *4747A2BCA2213877DF1D5A64F1DFAA53125BEB1B GIVEALECTURE
690,221,156 *474E6B4540FD232BB3512DAE939F274E9AB3929B GJL)
690,221,157 *4749E94CFF0F671E1268416C84DF72593EEC2D9E GLENN.CERROS
690,221,158 *4746736AF4A3D864807CFFE2CED8865BB04A9724 GNRFOREVER88
690,221,159 *4748202F1AA0A4504706D8084E1EE4D57F41F015 gustaf!
690,221,160 *4742C53E735EF9095B0076136D8FC453CB9FB93B [email protected]
690,221,161 *4747FE43ED3FFD7324C6DEB253864A1938CE27B8 h-2c
690,221,162 *474CFF8E009332B54A75217DA545B5B0F5A90A66 HAI.STEINBURG
690,221,163 *4749BBCC14B688FA6E331D528C5F75E3C8E0E624 [email protected]
690,221,164 *474FF06616BEAA91F733A1C32516BFEC40026078 HANDELSBRIEF0
690,221,165 *4744568C10FEA82381E4F9A75B4B625794D614E9 harlandschwantd
690,221,166 *47434B62CC30A11AC7E1D6CC36E14F44AADF7328 harleyhanel
690,221,167 *47439F75860E2ECD02324CA7D9ED73ECBC5FAEE6 HAROLDHAWKS
690,221,168 *474418ECAD84A6F88D9DD946674F552A5656002B harry.called
690,221,169 *474A6F2C7AF0FDC2F797895FA98C054CBA0050B6 hasmawati-hashim
690,221,170 *474895D4CD6A5E2B14A42E9FBF82F41D292BCD19 HAYDENOSARIO
690,221,171 *474ED5003DCE52236A85CD85BE255277C60E3181 [email protected]
690,221,172 *4744E47560EE5487632CCEE8538405A767F1C0FD HEINTZHEINRICK
690,221,173 *474A3D68DFCC99BE33C15497C942478C9BEFB54A HELENBOSS6
690,221,174 *474F9DFC5CC53B258AE36CEF7249842B210208B2 HELEN ROWDEN
690,221,175 *4745CA6225EBBC5AD94B78EEE00B62C7E9A11DB6 HENAREA
690,221,176 *4748B0276D123BEC80D4BCDC5854CF748443BB55 hengivel2
690,221,177 *474B169852B524FE5D1A1EC36F7173A9D3D1826E [email protected]
690,221,178 *474C9D15D460A79CDBB6BD12CD46B55F2F30C1A8 HERITABILIT
690,221,179 *4749EBEF56195742EBD5AAE02EC8EB8800ADE7E9 [email protected]
690,221,180 *4740D73D6AAD880BC233387862E53D2E3B1BF623 [email protected]
690,221,181 *474C01EADB774E3A5300ACB6D3D3A3C017B603DD !HMBAA
690,221,182 *474190EEABD1CA8F08EE4F0F46E2FB3DFDF5D48C HONG.ETHIER
690,221,183 *474913E2A64F9526F4D5CAD59966120856395FD4 [email protected]
690,221,184 *4744B658B344FF5FCE6F69D6EDC312BF4F9C164D HTSKLARE
690,221,185 *47477072E840A707C3C579C1FFFABAE0312E8087 httpwwwlawofficecom
690,221,186 *474E494832CE87920E72B1D84A47837AADF77ECC http//wwww3org/tr/2005/prsmil220050927
690,221,187 *474EF79EAE21CE6B642F635C53F31CEB888568AE HUGOMCCLASKEY
690,221,188 *474800C4FCA360BAE40D28AEF3BB080B0346EEE8 hugs-&-kisses-(theme-from-a-sunny-day-in-glasgow)
690,221,189 *47466AF7C8FE5AA779F7A7B9F68F8CE2B6CD0F13 IL9
690,221,190 *4749EED019054D7834137E2CB973EAD9E613418E iluvbella36
690,221,191 *474D680B4788943EB27BDA4CD8F429124D0467B6 IN ROTTA PER BISANZIO
690,221,192 *47494369EBAF8680D703B9ECDAC4203565D93A1A insinuationkirbytim
690,221,193 *474A202C9A8306D29A34B433B5797EABE150D002 I$OM37RICALLY
690,221,194 *474D733FCBE1678A16F5EC001932D98D0E13DBD8 ISAIAHYESSIOS
690,221,195 *474C0EC983578AAE65BBC0A93694FEB16413524F issanidep
690,221,196 *474A5A458CAB1CFE24B75876A6A1F9B20AA0FFBA j:a~
690,221,197 *47401E179D1EEFF23F097F2DB1FB3951A9043BDA jaemathery
690,221,198 *474E3D19B2A5ED1195B422079CCFEC6E157EB1F5 [email protected]
690,221,199 *47478F5F2E8903D0D5B212DE059417C3502DBA3B JAMAR.DURANCEAU
690,221,200 *4749B5303034967F73F2C66276A1B2ACDAA05DA5 james.baker
690,221,201 *4744BC143A7B34119104FF96962506807733F43E JARRETTWAIAU
690,221,202 *47494C523323CFA844322148F86339348B3E0967 JASMINERAFOLS
690,221,203 *474E1AAF4DABDE47080ED509C6B5F42902C95832 JEAN PAQUIN
690,221,204 *4742438CEB0773DF17060A1E4A1114A0444CA53A Jean-Pierre-Racicot
690,221,205 *47492928052A29C2807FE0FC611C3A2DA1666177 JEFFEREY.SWIGART
690,221,206 *47422420CBA4F0AA4F7F1663FF275CDE7F3E4FE1 JEFFERSON.IMPERATO
690,221,207 *47411CE840B2B88F55509B1CE6905BCA42F52421 jenyaynet
690,221,208 *474C647CFA5DBA3A72F7E517324AE231163E6F6D JERE.KOHLES
690,221,209 *474F314EFA038B10D25545EC8EE458AE2C1EF6AA JEREMIAHBOYD
690,221,210 *474905963B16768AB6ACC09BE56E2098C3461E01 JEROME.BRODEN
690,221,211 *47407913923169A8452DA32A1C429E060F95F9E5 JESUS.HANOLD
690,221,212 *4743038ACBB84953B18FD64A14D35A208C9F3182 [email protected]
690,221,213 *474EC5EF73369D4437A13945DD59783096635F9D [email protected]
690,221,214 *47454AF70E0056E8C938A29525F6543DA0C5895D JÍVANSKÁ
690,221,215 *4741EFCC94FEA9A93F22FB6A85A67A41598D4AF0 jobbing.
690,221,216 *474DA807B3EB10B98AAB6CED1DB7DB4A6DDA20F1 jordanwertheimer
690,221,217 *474353FA53C69A95262F2DD76D75CEB1FBEA4715 josephdowdall
690,221,218 *4742C4A36A4C04217E39981C31D5EA9FDB9FAEFE JS4IC
690,221,219 *4740B18F0AA08F51A202A8ACCD74CB8D174775A9 julesraffa
690,221,220 *4744A7D2343F8C06DFE66CEC24D722BFA569BBE8 JULISSA-PLASENCIA
690,221,221 *474EB6164E89DDF8FFCAC8D2961AEB65B94F9FCE KAKUSOUK0
690,221,222 *474DB9FB51DE3BB142DBF32EC48B595F992F1C41 KALODNER5
690,221,223 *474EED050A04D062A35E57142FAA378B46021BDF KAMOETENG
690,221,224 *474B18955FCA8B3C0F229546134BBE4863142DF9 [email protected]
690,221,225 *474DC7FD7EB3EFE678D817FAABA02A96DFC84E19 [email protected]
690,221,226 *4741A2B740AC5449B1C0D6BD43E0E02FACC999AA KANTZELATZEA
690,221,227 *4749296E466EE6050A5EF5E4035E2F06E5520BFA Kap-45
690,221,228 *474C8734E4DE987B34688E293E008F7A13ACEEFC karieens
690,221,229 *474BD41C42A3413667670A0601BA3578CFD98865 KAYE.HALSTEAD
690,221,230 *474A74C501678CE73D7A28BE094DBFB85B545CC9 KD?#
690,221,231 *474B1F17D37BA7C5EC07E0D485FC8BB1BA24BB1B kharsane
690,221,232 *47486B09B610D1382E94B9386C1AF8F412A61423 KLUTZY님의
690,221,233 *474A821608EB7034F1F0591E28B1022B91B20CF1 kollisjons
690,221,234 *4740F60E952102DB4BF9A494DF0CF3708DBA5F01 [email protected]
690,221,235 *474F1570D813A3645777376F67A91A88D5B55846 KONVIKTUI
690,221,236 *4742922D877276F035687DF41893CAE4216D20EB kq&e
690,221,237 *474961E02559D174533AC9516ACA1DDCA5AC63B2 KVHOU
690,221,238 *47468245A1802F7D8A87D5686D004142D8AC0520 KYLEFEATHEROFF
690,221,239 *4745FCB7D274744BF43B6B5FEFE7C936AABB00AC L4NDL34GU3R
690,221,240 *474632AE2BE3C38F29C64AF0D84D3FDB5D01B23C laenacaprice
690,221,241 *47430557262C182B65B37F49F2DADD5955EE014F lanch'ing
690,221,242 *474B45B1A8ED879418B264AC367199D01D91723A LANDMARK7
690,221,243 *4745E01A509079FA4279A7A05B5D845CFF1B6A5C LANNY.CARMACK
690,221,244 *474C02DFA143C59FEAC28783D064360C4F2ED12D LANZAMEINTO
690,221,245 *474B7E50B6154245553A030337CD91FD9C00E4B8 LARRY.CALABRIA
690,221,246 *474D545A7D58FE4F7815D8DCA0BAE1CD968EA4DA Lass.mi.dein.Herzblatt.sein
690,221,247 *474817073135FA12C0198FEF19103826FEE3861D Late.Bloomers
690,221,248 *4740A5EDDEA095A97BA69F354863351B544CE000 LAURENCEPROCIUK
690,221,249 *474B502F2970EFC0D51621E7564E44400CE936C3 LAVERN.US
690,221,250 *4744A21CF934DA012BBA6C9700FE373401CA63BD lb3r470r5
690,221,251 *474E116EA3F4EC2983FB5BE07FC2BD43DA23B5FB LECTURE7.9INTRODUCTIONTOTHEBAROQUE
690,221,252 *4747E37A60C655EA631921C03ED8B4B74FC0317C lelandwierzba
690,221,253 *4744A3413041461ACC5CB0458EB5DE44D67E8078 LESBURCKHARD
690,221,254 *474CFD776DFC1380359E5CDF5D3DCAA9ABEA634F Lgy
690,221,255 *4740B69153B8D7EF6ADEA02F076A5F51B95943AF LIBORIOUS
690,221,256 *474E303B31BF6D8DA6FDDD80A18A2C630CC54110 lindsay-hiebert
690,221,257 *4747F86B81799E3F52BC11F9E594EEA630CEF951 LINDSAY.MONTES
690,221,258 *47498176253648A9216989F9F16A40FFA9DB8242 LINKIMAGEBSW
690,221,259 *4743EB50E5FC266F9F0366C01DF716F4D63D11B5 LINWOODDOEPNER
690,221,260 *47463EE0EBC244B81DB3041DCD9D0F4ACA73A0E6 „LITÁNIÁT”
690,221,261 *474076B18EF3826C4F28B7B8BC3CEE485EF09A9A [email protected]
690,221,262 *474E61AC0FB3BDBD6EA4948E4486C045F87BF478 [email protected]
690,221,263 *4740219AC0804E7A5BCB1F9C0229F31DE55538F4 [email protected]
690,221,264 *4740098A43FFE3D597776AA9203B9D5C3316B244 LOFDICHT7
690,221,265 *474D9E1930C372C642EB3FD13DE372D18903A030 LOVE ME LOVE THE LIFE I LEAD
690,221,266 *474ED078D460D12EB2B0CB67F3D23F0CB720CBFA LPELLI
690,221,267 *474B7A67CD079090663D9BACC66B3B739484B12A LRUPS
690,221,268 *4742692A0AFD7C534FDFA5B26065A3573399D47B LT0TH4N4W
690,221,269 *474B036EB21625C2FFED8520356752CF8DAE1059 LTHTTPWWW.MYFICO.COM
690,221,270 *474D9E3A45B7B2D44B6BA7ECAEEB30BDF324615B LUCIEN.HEWITT
690,221,271 *474BF53A2A84BBC906954BF92BCF882137656E43 LUCIUS.REASER
690,221,272 *474B45947023AE430F4031219242E9C122A0919D LUPEBENDLER
690,221,273 *474D679AD78E3C1DD4A7947FEF6C72BB96E7845D LURINGING
690,221,274 *47432D86C091718DCB21418D16FAAFA19FA97099 LYNWOODMATTEI
690,221,275 *4745FBDDF19EC54C5F1F68A9CFFB1CA580CFB377 M341 $NOU
690,221,276 *474ADDBAD997616EA84825FFBB195AC1C40BFA0C MAC.BILOTTI
690,221,277 *474039BEEF61D6512B6F115716E3454DFBCF57CB macerateV:maceratedmaceratingmacerates
690,221,278 *474C3A1D264B9EE90B822B8F0240E08FE0D7FAFA Macintosh internal software Eventually the painful issue
690,221,279 *474B4915B2C9062CEB5D41698D2EB7EB4616CB9B MAGNAN16
690,221,280 *474CC6F4E18F6CDB32A88BDBE19CA3D696AABAB9 MALAYA(THEINNERLIMITSTHEME)
690,221,281 *474183577B1DE62772BD7E52F2B529FA701DDD2C mangas48
690,221,282 *474741375773240BD0EC97AED24CF35F6E0A39F2 MANUTDAPNGPNG
690,221,283 *474709440B71D6EA743DC5A750F2ACBA2597121E MARCO.CORIZ
690,221,284 *47458EB5E6534D5BEEC247ECC37E0D800742956C mareli007
690,221,285 *474AA92782C33F031BFF712CAC3162B34505AD3C MARKVAN
690,221,286 *474CBFF131FF229C825133B5C2B48867C05A7B14 Marriage-deities
690,221,287 *474B2972303A6A2CA7C40DB68D2BD49F3A20CA16 maryarriaza
690,221,288 *47486AC72D4444065847BD74341228AB3067EA06 mchiru
690,221,289 *4746364E367B951EBDBE583EED2D45F15F9122CB MELLOMHØYE
690,221,290 *4746FEE4A2ECAD01637FFBBF91775A93E478B183 MƏSIHIDIR
690,221,291 *474F8BEBB883FA13B04DEF5849F1A71F5420D5B9 Messe Asdur, D.678 VI. Agnus Dei
690,221,292 *4748E70B28B3F1D187A49B24F0260DFDF11C6B4B metronome56
690,221,293 *4742B750A8C30895BC50BC72E4ED11E684B3E062 MHO;
690,221,294 *47479E316D12B8D4E8C1B38A7AD0590AF6D91957 MICHELLEGOODSPEED
690,221,295 *474CE68127A394B075EEE7DA723C614E360914B4 MICHELLE-GRISBY
690,221,296 *4743229FD35661EB63D648382EF9D89DDB53BE91 MIQUELBLEA
690,221,297 *474AF132B469C29EBABFCCFA2BF531EBA3F7DD24 MITCH.GARUFI
690,221,298 *47406EDE3FD1E7C319C436B5894429BAE5503432 [email protected]
690,221,299 *4744174FE8A082374D51D3971E49F2ACDE69AE38 MIUZIWEIGHSATON(LIVEWITHDJLORDSANFRANCISCO1999)
690,221,300 *4743F2CD671A3CBD2E79E4CC2D98BB06C061EBAE mixmaster17
690,221,301 *4745114B7CA273E835F9A2BC3B222F925165CEC5 MOTOGPクラスに参戦する
690,221,302 *474C74FB3ECDAE1A8F908925EE05A01282B857FE MOŽATO
690,221,303 *474C94D5C2DD0ED0A982E9AC4A87239F7CF2B3B9 MRSURFERGOESJAZZIN'
690,221,304 *47474481754C4108E9F5F78A01883BFA51A877AC M-SQUAD
690,221,305 *4748C4320667BC1DBDF9A700E6C71308290AE65F MVAIK
690,221,306 *4741239AD38962630F844611D1DFEFB65784D5E1 MYLESANGELORO
690,221,307 *4742C7FE0434EC99CBF736287D0E8073307621FE "N.|
690,221,308 *474B94CBA1A10670B270C3D2D69C7DB10F251AD0 NACMENT
690,221,309 *4747A72518DBA391875E24ED5A5381B3EB99AD4C NASERNASERI
690,221,310 *4741BB215D371206579E420A185D10D874C64B02 nathan-tutor
690,221,311 *474AC980E96257F4509393747ADC764E7CA5A2B5 navarrian
690,221,312 *4744C40E1BA1C1CE2657FC0B9E9FBE1207DDA07C NEILEVERSMANN
690,221,313 *474BCF864B10B0FFF4387685F88B03AFBB329114 NELSONMARINESE
690,221,314 *474CC580CFB93C95B684C4EC40B88526C4D1282A NESTOR.STARBUCK
690,221,315 *4748CB87A81BC2CC21D3DCD7EBF53EBAAA4F4C49 NEÚSTÁLE
690,221,316 *474BAFF2014D1F3BD09F429BB473FCB551B87496 NEWTONPALLANSCH
690,221,317 *474AA624E5061EDFF50172CA4E26D5F45BB40A17 NGARA NO. 5
690,221,318 *4745B2CCCA53CCE0564234ED5F688E6C81796274 NH\S
690,221,319 *474A680B1A89B61354F2ED4492C37031395D7624 nig!"-(melot,-tristan)
690,221,320 *474CFFD90E957AC5A7A69CF45E3B78AD80F30677 NO422
690,221,321 *47455B308C9E1A1B8BDE1B4978DDDF6FB056EFBA NOBLE.PROUDFOOT
690,221,322 *474DD5089FEA6C4639E653E8C2E053850324F8C2 NONIBHATIA
690,221,323 *474477F84F674B3D44ECE9901FED8112E0671B81 NOTCH9227
690,221,324 *474126F715FE749AC6B7589B952FC4C2F51BB642 NPQDAAAAYAAJ
690,221,325 *474BC3E9D98C6DE6B5CAA4E8619218CB4EB39B2D NUJAKOI
690,221,326 *4743AA8F65E410426F20F7E9A88B9054E7A2BA8A numbfish
690,221,327 *474064DE7E170C2B7A010DB69E2F1DDFC2A2DDCD NUTMEATS
690,221,328 *474D86BC5D6613AE70DEA70CB1E68E1B5C119BC2 nvuq
690,221,329 *4742D0BED3D54701212A5F843785A510C6A5FB55 O~-0~-<#B
690,221,330 *474D54246CF718B356DCD15B5B0B34B66EFC18C4 ;)-O~0~Q--B
690,221,331 *474760E48CFBC0116E7871D5A848B6DF6E22502C (O_-).`.<-B
690,221,332 *47456ABCDCAA46BEDBB10C76D8F03E1628E7C236 olgl10
690,221,333 *47498D52F25299398007472FDC09727C3C43E989 )O(O~-0~-(=====P
690,221,334 *474A28BC28FC571302A96B9031AACBA9F301799F opslu
690,221,335 *474056088B314E10422818DFC463AB2A0AFCEE3F ....OR.DEALING.WITH.DEATH
690,221,336 *474F458F36227BC42E6F70F9754E3669C8F00B8C OSVALDOHELVESTON
690,221,337 *47475ABC022054A75614DCFA9AF53993DCB7FCD8 OUTRAGIN4
690,221,338 *4741D6E3D479DE79B8A3813120E2C827E800FE2D ov3r84l4nc1n9
690,221,339 *474B9B845CAAF8D1C12D133C2AFF36E5125462F1 PABLOREIGH
690,221,340 *4747112FF3616C166CE423A3A8BAAF8EB973A372 PACHYPERITONITIS6
690,221,341 *4743F68B7D25E8AD87E339377FA7C4C7692D2EF1 [email protected]
690,221,342 *474DF5967D95664F41CBE671FAC06E319E732053 [email protected]
690,221,343 *474A13F1BFB2767E9431AFBA91B50055D5A4749D [email protected]
690,221,344 *4749D766CDDEFF4315219DB82CD464AAB8292D89 para11e11n9
690,221,345 *474B39BD0686C3893EC43C1BAE323BB108F4A837 PARKERBOY1
690,221,346 *47480D5FB94EA75D5F7F3E146C123882BF01CBE1 paven-/-galliard
690,221,347 *4745F6B140383C5F7BCD200F7F919D79CD71F735 paxton105
690,221,348 *474B76F61F22D6533A1C5A5F7D7222E4A5254B8B PGRMMTSR4
690,221,349 *474D88BFD206C35E51DF790C724C3A839D915490 PHIL-FLAMION
690,221,350 *4747866FE49918F0E26AC6E9254CE9C324E67F85 philipwoskobojnik
690,221,351 *4748E20435E9A45ADF3F8B3766213354DC659E43 PHONGDIEP
690,221,352 *4746B776239D7D35787425945B27B3A521C194B3 PHYTOGENETIC5
690,221,353 *47401C29ECDE1B86E876B7923F87B894A088AABE PIERREGALLISHAW
690,221,354 *4746768C0E266F5FF7F0D822F988CBE68AA0910C piikille3
690,221,355 *474B94DE5086736EEB160D3BDAA31BE3D43CA2BD p===>~o(>_0)
690,221,356 *47404E47C43063A86B5E236D988D39A125AB0DFD POOMJAI8
690,221,357 *474D862673FE4E5D2714F5BA87FBB7D4CDD27A73 p######@~O-~o-)x(
690,221,358 *474EFA16CB882C2031009BF23DAA0DE243DC70DD PORFIRIO.LAASAGA
690,221,359 *474BCAA2231A01FB19D0A0402D3D73844D4B70BC PORSCHE.MARCH
690,221,360 *474BF933A182112CDE4D5CE58834D9CB01CB2DC4 posetila
690,221,361 *4745A5CE6C04EB37F3567CF2836C96AB40134E57 P###p~`)8(
690,221,362 *4743C16C13BFDE105E286F2AC461974D8DBE5CFA p==p-~o~o-splat
690,221,363 *474E9140CAABE866B2AE233089557480AE05CB2F pra.te.esperar
690,221,364 *474FB108BD23078B4532149BF6A5F87FD7EB833F pressava8
690,221,365 *4740316E8435EC2F31FF1FFBA717220EA6CD687E PRSNTST2
690,221,366 *474CA1C73DD00EC9E9E097F69B8F9B4892736A7B [email protected]`SPLAT
690,221,367 *47412E4D353FB82CC3E83E58DE22189C6163B07A qua
690,221,368 *474795FD0F0275EB0DFB3FE10274D8ECFA949808 R1CKLG
690,221,369 *47464D198365C2F47D7881DEE6D9E04054CB7722 r1.f
690,221,370 *474AD18614BDFE212ABF36D674A366FB0C82711F radioverilişi
690,221,371 *4744DE345AC854ED85A94DDF6CE1F065C0259A6D RANJANI-CHATTERJEE
690,221,372 *474DCBB671F3C32689DDDBC1B3660537D61C8383 RAPIVA+E
690,221,373 *474FE213948FD6D05E1ED6F1D09632CDBD93AF61 RAUL.COENEN
690,221,374 *47486EA65BC3D7FDF49313BC6458BE83996C22C7 raultrainer
690,221,375 *474A55B6CBD249380AB5C1D5003D7B19514D9929 RAVEN187
690,221,376 *474F4DD8005A372F9BE8442E149C84BA05344C5B RE.}
690,221,377 *474AB7608666A3B9857F47C7D080240EE9C37A16 reabsored
690,221,378 *474C5438B77944487289AF3DB1876DA6C071F48C RECITATIVO6
690,221,379 *474B55AA9DE71447CB700A9BE909AB23EA6C1A0C REGOZIJARLHE
690,221,380 *474D1F4DEB0B0EE595095337F0AD6EEF725FE9E0 RENESTROBL
690,221,381 *474E0CF71F286E081DDD3ADD87A9824CC7E9C964 rent2706
690,221,382 *474F6FC58A7CC6C7202378494AFB7FF03FA14A43 REVERSAL2
690,221,383 *474BB2424655959EB5A4E95E448410F537014F74 RicardoRae
690,221,384 *4745D96B95F3D33D4E195AA9205AC7A19D975299 RICKEY.MILANOWSKI
690,221,385 *474D96754499527C718EB35B5C00044A6C8D7003 RICO.NEALLEY
690,221,386 *474135035BA78E9ACD3A1BCE8708956F70F9A6D8 RILEY.BANCHERO
690,221,387 *47499B0AF2D4FC716EF4EB776CD50B1EF6027044 ROBBIE.OLDHAM
690,221,388 *4741C776FCD369E97B046DEA6B38462D326FEAD1 ROCCOJUHL
690,221,389 *47475F6FA2865DE99180CEC9E7AA369C8B4A9C90 ROCKYULRICK
690,221,390 *4741C741C15B30EC29C82C45EECA3B587253390F RODGERBURI
690,221,391 *4740706EB533F86A34C1991E649F7E1BB433EA04 RODGERPASSARELLA
690,221,392 *4746DB86ED1876D5AACA68DBB756ACC5F5BE27D5 ROMULIS9
690,221,393 *4746A054C3FFE47D84107A94E814CEC1D718FBEC rosariodake
690,221,394 *474A9C0BCB7E47F44000E610251E3657B64EB812 ROSEBUD1933
690,221,395 *474575027C907787D6F71C1124959054D95407FB ROYCE.BLESSMAN
690,221,396 *474EEB0B00F02CFB12D596A8B92DBB1CACC64322 [email protected]
690,221,397 *474190044D9C5A953C205360D7E88A04EB4A024C RROMANDAN
690,221,398 *4740AABAD52B0761CFB7C34C44FA33AEDE350D71 RSPNS8LTS
690,221,399 *47409CFF2BBDE318856A9FBB09622620E5B5A8BF RUDOLPH.KEEZER
690,221,400 *474AE8C414824AD7C99500EE846904EB03FCFDE3 RUDY.MABERY
690,221,401 *474DA924969207BDCB5A18D4D6DA3C557D409738 RUSS.PRYDE
690,221,402 *4745BE8021C53178BED4BF0553C846E501583F31 RXMOM.COMWWW
690,221,403 *474F97CEB42A335A0C5DF7B3B682F1F763D0BDB2 S3WKINTE
690,221,404 *474D4047FA553483DA94B02E263DBA28D7A94D82 s5hahab
690,221,405 *4745A188476C3BB5709B5900D3853B6BF0F267A9 sabyd1
690,221,406 *474C3EF618241C518BB455AD1B0F58FCBA84DB4B sarah-uhler
690,221,407 *4743E5461788B707EF6E332A84BDE0605079AFAB SBALKO
690,221,408 *474122989F849ACFA878B472B1D46E380B17ABC7 SCARSDAL6
690,221,409 *474AEA326355CD62BE5A7E5FD00A79C846923838 SCHWOPES
690,221,410 *474E523E6E1DE6B946C95C55DEFB78C7871B5214 SCOT.MARTIN
690,221,411 *4744C8AE74D791A5DDE2B671A121F075343304F6 [email protected]
690,221,412 *4745116F8F34F8D48EF368CCE74188E502F8E9B8 SEANKONZEN
690,221,413 *474EB3E206621395E1CE27738D1A66A5867D9DC3 SEBASTIAN.BROWNE
690,221,414 *474D280BD249AD38CAC05B9DE1C30B8A4AF8A262 SECUNDAA
690,221,415 *4741D89FB658F14BDA727AAA52786E390165C2AC SEEDIS1234
690,221,416 *47440640D0EDB56C1FE240096EFEA4275933DFAF SEGITSEG-5
690,221,417 *4741984F3BDCA4E6378FB79F70F3312B77672CF9 SELFADJOINTED
690,221,418 *47449759A1ACE97A97A5D0406ECDC5C4B82D73A1 SESTALLE
690,221,419 *4743BF1CE410632F04CB2280595D5DD52FA165A9 shadplesant
690,221,420 *4742D262D035EFB443C931B0A88EFD0A41F7767A shaky;-palsied-&c
690,221,421 *474C75ADDB7FB7ACE5BFE035DD6CE3AC34C828E3 shanetayloe
690,221,422 *4746EE39454DD5B2382DE810A1F115D0703BF570 SHANNON OSMER
690,221,423 *474DA0A5423FC0A11E19822F69FFD715DF169625 shannonyem
690,221,424 *4745A739E0FAFB65FA9F1325E559F23E03CE8985 SHARONHAROLD
690,221,425 *474FB25F874083EF88BD55D600BA2848A9111A71 SHAWN.RAVERTY
690,221,426 *474F037E9FEF9946615F2161CF9D134CD2E42475 shayneedgmon
690,221,427 *47432E92894A86098992CFFD0202E5634F716043 shelly.compton
690,221,428 *474E79208DE23EEE9F1F3533E1A54A23A3A58837 SHELTONWARNACK
690,221,429 *47411C2E920C243BD38CFF89364A1A9F574914E2 SIDFAVORITES
690,221,430 *4745D650A58046B4A33C79FD56E9105E6691B393 SKARNUP
690,221,431 *4742FC1A08D99159287AF09285CCF5491B8A2728 SKIPNINGENING
690,221,432 *4742D24A32AE9791C73DE97808F0A06EF307DB1C SMASHING RED
690,221,433 *47454D538600C1162EF4544CC6B49DCF8319A261 Smith&Mighty
690,221,434 *474B739A7ACC2007802926A8533AFA4823A8448E SONNYOLIVIA9
690,221,435 *474E56F88F21D94EF2D87663A60B7A7AD317940F SOUPIRAN8
690,221,436 *4740B31B7F5469C240236BCB91F36808D01ED86C soused
690,221,437 *474D2F83C618064623E45C002646A7BF96F079C3 [email protected]
690,221,438 *474BDD16DA5C58AFF77D12F69F385247EE5F8EC7 SSCHIRMER
690,221,439 *474603C6D707E0613233A8FF41BE91439BC92A54 sshield8
690,221,440 *4740C78DECAF0483CC1A816E7F5E0B2A95AE0B88 STRADIVARI
690,221,441 *4740449917445DF7B3B3E5AFA78A1313D87B559D STRECKENZUSTANDES
690,221,442 *474CF4FF1BF87CEB9729EFC4A45DFC3402212D07 STUKTURERANDET8
690,221,443 *4746324D0A19F3CE31B7AB85C313EBB831A5E9CC STU.SPASM
690,221,444 *474C140227D901F7EFA6C13F68248410BBA09FAE [email protected]
690,221,445 *4741E8ED28F6D309409101264492E27925ECA3E4 suiteingminor:plainte
690,221,446 *47456D1266FA0DFA256ADDA4C204EE0CF1195D56 SUNNY-DAYS-(C)
690,221,447 *474B10586AA007FB358F9797354256E380EDA7E1 [email protected]
690,221,448 *474C5FB6F700B8A7E029E359496B5B70C7D52B3E SUPRALAEVIS
690,221,449 *474F0A4B7533A159BD20DCD6278556CE8DCF0797 SUSPEITOU
690,221,450 *47469A3262E0F2106AEE1247E6112E4254B3EB29 sydneybrancazio
690,221,451 *474F817E73EAC90193F8F9A3946FC4C6A6729011 symphonieno5enutmineur,op67-iiiallegro-attaca
690,221,452 *474E425450F6B4633BC7041FD0546A6B91CDFEB7 SYQUNDALYN
690,221,453 *4749680B00936B166A5ED04C1439676750230853 SY{R
690,221,454 *4747CDA4AF886A1196DE39318BC7501CC05A85DE T123123124
690,221,455 *474ED25B7C6451FED2F259CCFA1460CB04EF9FD1 TABLEBOX3
690,221,456 *474D618D943093B65B196CA56F3B9DC1CA974F94 TALK208.63.116.135
690,221,457 *4741BE82F7BFEC6902CAD9E073E9C15B5EE2893F TALK83.39.155.12
690,221,458 *47425C04991E4FFC4D0433EF6D81B085F654FF40 TAMMIE COLL
690,221,459 *474AD4E2EF130999A6246BA84374D7C99C379A53 TANISHALALL
690,221,460 *474EEA3E5A4A27F0A23E10E8FBC562FB7C847FEC TANTIPIROM
690,221,461 *47428198529812D300173073DBFAA9C276F4255A TEFORCES
690,221,462 *474F1C7717064E83A9F46FE9B7D29CE8E024440D TERYBERSIEN
690,221,463 *47498886435839A45EA3EFE3349CDDFAF870ADC3 tetrachloroplatinate
690,221,464 *474EBD33D672FE1637D9D6DDCF69E34ADB4B22E3 THE PRISONER'S MARCH
690,221,465 *474F6A5DBA40F6222190FF6B9ACA315253E9A183 THWARTE6
690,221,466 *4741D9BA227CB058AF3B309743401EB4EA79172B TITUS.MARLING
690,221,467 *474275F7A9034D671D504DEA13892B0FC9222BA5 TLAYUCAN9
690,221,468 *4740DB549061A6060E46C016D79EBB12A1522B7A TLISRV
690,221,469 *4745989169D296C8985903A8708C80F50853AE4E [email protected]
690,221,470 *474A923ED07A49929ADA52EBC541A118D104851B TOBIAS.BLOOMER
690,221,471 *47435AC4C20586B64BA98448F8CFD610F76B6D9B tomikoum9
690,221,472 *474D27CA9DB2D4292A13C5D9F7F88AC90D85660F TRACEY.TAN
690,221,473 *474C81C3EBF94B144FE32A0EC3483BF3C7938CE6 tracydelasko
690,221,474 *474275C156BD210F6E4824099C08015AAD5395C7 TRAISHED
690,221,475 *4748FC43CCBB375E298951C35FD4B95D2EC8A267 TRATHNANS
690,221,476 *474B62067E05BEA23F60B2D86C70B484FACD8A6A traumabonding
690,221,477 *47469CBE97D4DBA1B488A65F151135A44C81C741 TREVOR-MOYSE
690,221,478 *474233F4777AB05EF8B44BA0C9C93F3DCE74C073 [email protected]
690,221,479 *474CCB504C320BDA166D91D23A93F1D00B5DF0F4 trinidadpataki
690,221,480 *474F10A40E4D47BD5F4C89D3F7C7568B13CB818C TRISHDEBNAM
690,221,481 *474EF829D4A21C95AE6C2E15F767012719CBCC1C trudy-gene-rawdon
690,221,482 *47496086D52158AF9DADD194F28F48D68A399899 [email protected]
690,221,483 *474D314BBAF40EA69B9266AD723E2E97AB4E2AA5 tuba-diken-mudar
690,221,484 *47409CEC3B5A788F81A4BE47824AF4A36C090B66 tumemtuma
690,221,485 *474B985A60FE4DD5C561D7B98FF6A1F5E1FDF7AA tyceehart
690,221,486 *474F6D7F46E91C426A42B1D12AA3D13F79CFC679 tykippley
690,221,487 *474F8F977D4CFBD683B1327BBFDFFC331A17E974 uday-gonsalves
690,221,488 *474C67667C76FE58DFD181343B73363075B16C9A udivbudhal
690,221,489 *474E5D8B3F2F97DDBA5AE8319C3E3B2915D05D26 ujorocholi
690,221,490 *47464EB1D87F0FAFB382ACA1AA13C07327F9C5EE ukb0
690,221,491 *474149A8C0262B5589516424986A3FFDB4A3EC75 UNBELIEBTESTEN6
690,221,492 *474880DAE4FCB6F419EF7AFEB7D0A23367A16E64 unc0mp4rtm3nt4liz35
690,221,493 *47466E333B862A8D1EE1985D05D2525D93FBC5A0 UNF1UCTUA
690,221,494 *47421E40ED4127548632047E7527A3591FC292CA unitoledo
690,221,495 *474D72F056EEFDCF8C4617D3312E689A8DA8B7FF UNTERGURTSTÄBEN
690,221,496 *474C4E8D02C03DB4A661139A0DD36630F146B825 UNTERKUNFTSEINRICHTUNGEN
690,221,497 *4740C354EE1BE276C9DC2DB1EB3DF93C2314D756 [email protected]
690,221,498 *4746BAB803343A4AB7ABE5A2E140955C991F5768 uPRiCHaRDGiLL,aNDHaSHiSCReDiTCaRDMaXeDouT.
690,221,499 *47444503251A25BFBCF3B6432A42E18391962B76 USERIMPOSED
690,221,500 *474DC86BFCE80FF146CEBBC161988C1B3FA54E90 UTCURSCH.ISOTOPE23
690,221,501 *47436BE292FBF75A99035241940A0B60FC23CE85 uu.*qp
690,221,502 *474F6D9FE79B5C66255EE9F50BDEA5842A342EEC VALENTINEHUGEL
690,221,503 *4740755EF4712E47777DB3CD58AF07F2915EDA16 VALSE-NO.-1-IN-E-FLAT-MAJOR,-OP.-18
690,221,504 *47459C275E15D01FDC78A6C4166EA3BFFF7B9943 VẬN ĐỘNG
690,221,505 *47440EFE22BB37F1CBB369B4D820926099BB4888 VANESSA.PIVETEAU
690,221,506 *4743C7FA696657B24BB1C61511D39B27E5646B41 VENUSSTARSHINE
690,221,507 *47412EB058BDCA6955464B9F3EE929F9EB2CD8C7 VERMOMTS
690,221,508 *474227F53B869404D7412F498D75DBAF9B7C5646 vickybongayflores
690,221,509 *47450965228CE48B6285DEF381F481AB9DA2A7DC VICTOR.SANCEDA
690,221,510 *474AB899047E25FF89C076258DB4A9BDBCEF0822 vigneshdhandapanid
690,221,511 *474336AE6CC96581DC329BDA66E629688093809C VIROU SAHEBDIN
690,221,512 *474D29A0478766A8C05AB2E521B2D8335B80106C [email protected]
690,221,513 *474C31620EC76365D0216D986981188930B61C1D vittorio-sala
690,221,514 *47433E0EB7EC1E2B2DF5BFA70BB335DB48E0A512 VIVIANROBERTS
690,221,515 *474AE5D30500C51BDC85FF0F44BD3C6944182498 [email protected]
690,221,516 *4749F43696674A7E882D4187099E62090F42A909 vndeceiuing
690,221,517 *474FC1C96CA1DCA40AE7D3BC37F1B3BCD300E61A VTIPNE
690,221,518 *47417BE611EA8F2E83835D01254DFF816D9EEE1A VULICY
690,221,519 *47445B0281E8880DC7B1F31A8428181A9E1AE2DD WALE.ORINDARE
690,221,520 *47460A9AA70BE083D8C7A3BFD02F6818921A8A28 WALTERBARRICELLI
690,221,521 *474C670C31FFFE75CA9A07F1A296F1D9C998992E WANDATRIPLETT
690,221,522 *474F5BE9DACF9650D4E016841AF65C4C2EC63FB7 warawuting
690,221,523 *474C338201777A93AE4F29661F32560E0FB7C585 WARREN MATENI
690,221,524 *47434AF2F0A39379112BA30D27C537E9A32395F1 WARSPUR
690,221,525 *474E4D5D71576D8B8CE89BDF6BA5404F1168B3F1 watimeka
690,221,526 *4744EE56DF41F9B3AF5970B3BB1671841F9179AE wendy.fabrega.tedford
690,221,527 *474B6201FBD1765F83F4BF3064871DD5F36A955A [email protected]
690,221,528 *47409D26972C726E58FB55ED86FE87FFC7A3381B [email protected]
690,221,529 *474A234CD9C994BBFFC4F0B168D65947A6F816CB wesleyclonts
690,221,530 *4747045067AE0C2252AEE11816469AEA2A43EDAD WILBURTELLER
690,221,531 *474DBDE2BF7B932DE6CEDAF0DED288A470DBB8A0 WILLARDGENERAL
690,221,532 *474E25E299E558007A829EA8E8D0D90AEDE7F36E WILLIAM.T.BREWER
690,221,533 *4741A4E934EE150F0B2FBD75D682710CB74A85BD [email protected]
690,221,534 *4747B0560EDB8DCA8E794B03EA0E6736DD285E39 wilsonottalagano
690,221,535 *474BAA31242E59F4B4310004A6E63E1BE3DCC409 WINSOME-KWONG
690,221,536 *474F04BCDA71E00C117CBF467FB385B0344461B1 WITHOUT.SOME.IMAGE.OF.THE.AFFECTED.MERIT.
690,221,537 *47494A8D4069E3899E24313CA89277BAA63B1F0C WI~Y
690,221,538 *47478EF5D90887DDA66385128F840D2C0EB153B1 woqoj5dqoc
690,221,539 *47422588FA49EF2F3B7A349EB3128E05BE0B9C72 [email protected]
690,221,540 *474197177BE28ABF6DE1C54E1C4C2FE01CDE2063 WYNA ANUD
690,221,541 *4747BCE86033DDE81A43B1E958CA3D4E58A1C27A XCELPLUS
690,221,542 *474058EA26181D964453402F10CA7D4FAF60E514 [email protected]
690,221,543 *4740387872B359B67BACFCF581E240D43BDD607B [email protected]
690,221,544 *47487DDF133CDBE3A93CDCA94ACFBB9D8C712E29 }x{.o~(8
690,221,545 *47439E6118C7BAB153AB18D285CBCCEAFABB189E xxfa
690,221,546 *47468C50D22B2EB3A70C5CAA2F56AC73C35BB4ED yomna-hadhoud
690,221,547 *474A07B904D2EBDCF6D397C2F68970BFB112354E you.chooi.yin
690,221,548 *474C5000364B07F32CCF84C693F1DA23803B3767 YRTNUOCSREGIT
690,221,549 *4741C8F90735655CBA984040309CDD4CBA39C4B4 YUOYONG7
690,221,550 *4744B5D7107B4AF1E5A300F3C3DC0C7D8A656A21 YUSUFDHARMAWANTO
690,221,551 *474864D0D3104515090E45E73D9DB39B8C8DB094 zachariahpinkos
690,221,552 *47464EBB85EA08B4CAB3CF8C0296025E3064D5CF zachary.laguerre
690,221,553 *4744324C921DE9F20AD17F44E029B70E4E42A7E4 ZCQAFBEGS9UC
690,221,554 *474B55CDF034B726199F9CB747D0935532050D16 ZEBRAWOODS
690,221,555 *4741EC0EC7A6BB9166BDCF4E0A50C8617246BE17 [email protected]
690,221,556 *474CD01F3B8640C7A65D93EB449E8E6EAF7AF4E5 [email protected]
690,221,557 *4749A4B7E3AC0762CFD03DEACBCE7412BCEF1F73 ZNAJDUJACYMI8
690,221,558 *47488D18EA4D145B74BB1DFE94F5E5A2A050E858 ztxta
690,221,559 *47478030C760B1CB08F4A44B9E31A4E1984188A3 μπαγέρησ
690,221,560 *474C7E18C6C92E025A2209D1E5A3C1B0B831DAF1 ουρανικήσ
690,221,561 *474B2343EF326400C34FCA7CDC9DA9A9CBC7240B ДЕДЯШЕВКА
690,221,562 *474E627F2F9DF62658A074626F92018314341010 ДЖЕМ299
690,221,563 *474BB10F55B0F51E84C9022DF1F69AD406286D75 звернув
690,221,564 *474E8CD46CB8966CD86D14618893B2B0260721B1 КЕФРИИ
690,221,565 *474A9F3698C7B5F7A1D3E92D9149D99CC2C1AECD любушин
690,221,566 *474787E29A3A8B520123A8029E3BFCB67BEEE43A ПЕТЕРНЕЉ
690,221,567 *474098AE2809DDEDC8DFAF8783B0263284749C92 ПОДКОСИТ
690,221,568 *474B82480D1724B8A20710C8D9FF3C2592951064 “турски
690,221,569 *474F2FD2085B13B050FD38533D6368AE9FA40BEE 1131460 alhaisista.vajaak
690,221,570 *4745EDD0E0360A000D6F49CB14CE706B534BB66F 12606 TUTUSTU.MY
690,221,571 *474D95110FCFAC472B33B43C7248FC2C66AB26E7 13434A
690,221,572 *4746DB09F7A39CD7092DAFC792DD768958546EC5 1616101 TAKAISIN KYSYMYKSIIN 3 SININEN AUKKO ?
690,221,573 *47465D45B12F119B879D9D47EF90BC529FE7AA13 16.npd-vorsitzende
690,221,574 *474DA9FB56D0D49D0B80C40415B814901CD43079 1714621 WIR SIND JA OFFEN .
690,221,575 *4740625D3B04DE4625475227A5914786D2BA490B 18DICK
690,221,576 *474AAAE9464FB37FEFCD63713A214C1296B90D25 19-hallinnolla
690,221,577 *474BDDF517759EB7D15C97E9E8BFB1F7E6DCECFE 19KIWI
690,221,578 *474FEF6DBEF2E63F6158CC1B9F8EFC497863570A 1AUDIABLE
690,221,579 *4749D0D1D003A0FADFBE4E0CC4CD96357EFD6F0B 1B2CC1
690,221,580 *47427C74A78A53B3509B2B72B297172518D5065E 1ERABZLEM
690,221,581 *474EC3E026AE07159727C059DD9B766560CDB4AA 1ethnically
690,221,582 *4746F7420901797DF2457E619DB3788A35EC422F 1groundling's
690,221,583 *474944A917E98E92DF2BEC17F0AD6D950EE40ADE 1.IIASEMAKAAVAALUEELLA
690,221,584 *4741CCDD83CF919F5B038DC59F172FCDD523DBB0 1INEAMEN7A1
690,221,585 *474BC7FB031B987D9189DEFCBE6F5E104FB69532 1-intikamini
690,221,586 *474D48196EE08E71723244CE35F945838ADA4CBE 1.JFKBUECHEREI
690,221,587 *4743BA198AD88ACC665E77E89870F8B74593DB3B 1 karsitinin
690,221,588 *474FDB2B4B22E6DA7A36A7223B5DA1388B77DDEE 1 KIVIR
690,221,589 *474403582B0F48024C4344E90D768E7E4860701A 1-metas
690,221,590 *474F7F7CD781EDA118BC9E13B2915FA76FD180E3 1OPISKELUOLOISTA
690,221,591 *4745F5E225CDF81B4C2766FD920C71E28F725904 1-perminder
690,221,592 *4742F7EEB1991272073F744FFD8CA8077C58E187 1-STADIONMARKETING
690,221,593 *474AE35A8FA6AF8D16639F49A5502AAA45FADB09 1STOPIONA
690,221,594 *47482E3FD0FBDC2F23BA9DB3FE88CBE45D6DB451 1-SUBBUTEOCLUBS
690,221,595 *4741739F67DF3514842C22C7D095175F5D8357C0 1thelissabon1
690,221,596 *474C8C31B27D5DC1F143CA62405C3AE2CC44424A 1 UMWELTSCHUTZVEREINBARUNGEN
690,221,597 *474A89D7530B2B4BF9E58240396FCEAD2DCFF514 1URGEWALD-STRATEGIE
690,221,598 *474BBF0A78921B6D0E977CA2A717142DBF28EA3E 201363 VAUNUTELAKOITUUS
690,221,599 *4746C13C870C1483D0470F328233C30DDCD3B3C1 2151609 NUN DARF ICH DIESE MARGINALIE SCHREIBEN
690,221,600 *4749E1C9C9AF37BB4EAE91C348FF6FD571EF435C 2178710 SHE.HAD.LEARNED.TO.COOK.AS.A.STUDENT..
690,221,601 *47407A5462141C35644AFAE9B34CD8E227C8E366 22-bruno's
690,221,602 *4742D3FE0AAF089E32802EDDEEC059CF846E0467 25-one-length
690,221,603 *474D64275979521D11FABAA164EB3EF3CDFA4B32 2650152 KERKKO : MULLA EI OLE KOVIN VAHVAA ROCKTAUSTAA , ETT
690,221,604 *4742593E3EBBE34882BC16D6884365BC4BE7EA56 2857529 KUNTA-VUOKRASI-ALKUUN-TALON-UITTOYHDISTYKSEN-HERROILLE-.
690,221,605 *4745510998DC201E057E58E4DA407601303F90BC 2997678 THISISHOWAMERICANWOMENWONTHERIGHTTOVOTE.
690,221,606 *474041D4D282A1A3C99AE27A651C61C2BC2D469C 2.citywestquartier
690,221,607 *4742DDE44FCFAFE6E14720B51452020025FBCE4C 2DREPANIF
690,221,608 *474B428296B92C28F0EBCBB7BAF0629F02146AB3 2ECNEIPIC
690,221,609 *4743E628C1B50F7FA329B0E5B231B1C98CDFEC20 2GONGUELA
690,221,610 *4743B740E89BED3E5180ECCF09B607DD38441FB7 2LIGHTHANDED
690,221,611 *4743EA53732BFE1F12A6E2AF08D859EEE483C270 2-VICARY
690,221,612 *4749994715ED36E5D5E828B77CA1F455EEC182FC [email protected]~.~.~(>-<)
690,221,613 *47497E9455FD6317510D398473AE6C76DAA8FCBC 3>~.~.~(0_<)
690,221,614 *474185E6B48D077C50D32CEF359C4F93677BAC87 329560 COMPUTER-STOCKS-RESURGED-,-PARTICULARLY-SOFTWARE-ISSUES-
690,221,615 *47452AD8DB408D8BE0FA26922EF9071D482B9DD0 32E及EM64T。外界多使用
690,221,616 *47415AC0A6054CC1AB967C286006F3D34526F9EE 347CFB68C98D4C59746E1F8D11DC1ECB.V4444
690,221,617 *47424A8F4921B1A46BB6E92660D0D2B0E48A5829 3804DEE5CDB2CC04545FF2DCA3AE3232 BOMBTO85
690,221,618 *474EE428E789BBAE4966735F88C6A5FF2B635CF2 3ILOVECHRISTIAN8
690,221,619 *474C76778EA919EE0BDE3E77530FAC90C3BAD10C 3-INCENTIVE'S
690,221,620 *474E7DB905198E5861AEC058B23F734B7AAAD91D 3==P***)0(
690,221,621 *474BEB1E8159ACFF6489F98DD39BAF3C640CB8E8 3PRIESTISH
690,221,622 *47420A5327E3642EF2D003C2E3A4FDBD5094D65E 3.spaugy
690,221,623 *47426D612237230A4602958556FA276AE849468B 3.valuutta-ja
690,221,624 *474B8C2E65D0EEFA2424156F43D3C874F9F985EA 3.viikingintien
690,221,625 *474F37FA848C59FA8EB93D084981B5B406030695 3zawadzki
690,221,626 *47473891F48BAAA558B9BED297F22299849E589A 4CARBUNCULAR
690,221,627 *47462A192691AC12C77B3F246956953DFC9734A1 4F3RRO3
690,221,628 *47471D8F5E81C65CDCC0A977D1D0247477AE9B4B 4-loskommt
690,221,629 *4748490A4B5C78B23903C66178E8A0FE89B2B7DC 4NEGIRANOJ
690,221,630 *47476DB86279E0499CEC3FE43FD2BA579F6066DA 4NIAREVUO
690,221,631 *474AB8BFA4A33A718748A5597431F803CB89D3C8 4PROFESSOREIDE
690,221,632 *47428D1F620F7E95A7745499EBCE41F2B0FAA9D9 4QUEENFAYGOBLINGOLDEN
690,221,633 *474700769F7265C350AB332152CCA425FA352B17 4SELLIVSN
690,221,634 *4745E40F4829757351671AC404C6A228822B9C76 4TANNRAATE
690,221,635 *474BDBAF8653E002D712BCE613B747B1CD8E6B7D 4ZEITAUFWENDIGE
690,221,636 *474097883442E485A587C0558A5ED41DEEEDBE87 50BR34V154D0
690,221,637 *474EA2716452F75AB7B58D3FA9E66531FD7EB919 53MIGLAZ3D
690,221,638 *47488283AED716DD1D11F3901199252E39FB8864 544356 WIRHABENNICHTSZUVERLIEREN"
690,221,639 *474512A938D10A92F4BEDBEE9F7701521A1A3320 5GETUNKTER
690,221,640 *474338BAA2C06E012ABB899991CF05E06A71EDA4 5ILOVECHRISTIA2
690,221,641 *474544DE9FE8DCEB1DFF70EFA53A72006B50ABD8 5KONTINENTM
690,221,642 *4744336A80BF1750A18C9E3E0FCF5B0E819258D5 5USMRTILI
690,221,643 *474BBD30FF2E9CCEAB40A29E1F5E8820C799D921 608BROGAN
690,221,644 *4742C94AD860718D4DA18B121DD35D4F8CA57C8C 692CASON
690,221,645 *4740CD7A89EBA31CDAB617D67C8EDA51ECA2C6CE 6BSWFASTBUFFERBSW
690,221,646 *474D0E019835E769433EE06AEAB4B5A714C20180 6BSWREGPANIC
690,221,647 *4742E08F005E6194CBE54CAD0DAB32011E80C0F6 6FILESHAR
690,221,648 *474B04430DB63CF13491C4190666EC0F3F7DF9F3 6KPCJNNKLSTR
690,221,649 *474B6EF9F291C9BF8D3EBDDB8A8495BA02018AE2 6MYBENJI0
690,221,650 *474CAAA95CD687D741515F26BD1EF91B2FEEDAAE 6NSYKSYSS
690,221,651 *474AA9D712C382C8A92338141B7DBB41CD940AB6 6ROZPOTEM
690,221,652 *47467D37A3FB09CC84CEA27E165EB209A9586F41 6RUEIRPNAEJ
690,221,653 *474AD4E14C0B0C00308CB238D8561ACFD4881504 6TRACTORIZATION
690,221,654 *4742530A6F5A3F8C9176D9F558BF92707A934B25 774496 yenidoGan-dOnemi-doGumu-izleyen-ilk-dOrt-haftayI-kapsar-.
690,221,655 *47436B328546E2D86C2CADBC14B7750E7C4153AB 784601 taloudelliset.analyysit.ovat.osoittaneet.ty
690,221,656 *4747D61423486D81621D6FA5055E19E9DCFDC226 7BRIDEYYEDIRB
690,221,657 *4741510A0BA3BF9AFD27237A4464264181C25DC4 7ECTASIAS
690,221,658 *4743A05578A7F6F7DCA0495F035CBCAC88C9CC0D 7LIMMERED
690,221,659 *474B30262BFC8371287A2D5B3160B0C8B096E2FA [email protected]
690,221,660 *474578B3A64CDB854DF6AAE11D2C9A2F3373EB84 7PLASMATES
690,221,661 *47463166844DEA297919FFECD3DED61B6C1806DD 7-ratkaisumalleja
690,221,662 *47452747D7ED23E03EDFF41A74AEA1D548FD49B8 7RESTOIRIT
690,221,663 *474C6530D58CA0DD4460055AB170DFAAA76456E8 7STRANGERS
690,221,664 *474C3E8E4A431A5D56C8A46E8D638C059FE67E54 7ZUSAMMENLEBENDE
690,221,665 *474ACBD4C852DC0028DBD20603ACC303FC46BFC0 809158 JOENSUU.ISONA.POLIISILAITOKSENA.PYSTYY.SIIHEN..
690,221,666 *474F5AAE67874084EEF45E6BB99395DAB78491C9 [email protected]~0.SPLAT!
690,221,667 *47442C0CC5A1FE6E7A425540F1D85753EE20DFD0 810521 meistenskleidetsichfrauweissgedeckt.
690,221,668 *474760961006547B7711957552614AEB0A92DBBC 831GILBERTO
690,221,669 *47449D58ACFEE2D21C114399E34DB56A8E2656F7 8===b* splat!!
690,221,670 *47441CBF758BD1E8F9F3527F5BCBBB79314643A8 8BSWPOIKOLAINENBSW
690,221,671 *4740863E4049A342C3FC385165AFDF309D66A38B 8BSWTEBURORO
690,221,672 *474876B42A158AFB174B990909E6257D138BFBF1 8JENIFER1
690,221,673 *474CB968F38823D89E8A13469D7763208972FD69 8MATRICULEMOS
690,221,674 *474181114ED6A2AFCB4DDAF4F186AF421F287D74 8READYJABSW
690,221,675 *47402EBA998D4F3ACE32E5C2BA40B3AB69CE02E6 8REGAGNAIT
690,221,676 *4748668BF6791D36480562C0F21D03111ED1D3BE 8VALETER
690,221,677 *474B93FEADCFEEE0F29BB3FABC688E4408B9E921 968taniya
690,221,678 *474D81449AC8D5342E441380C72A7955213CDC43 9-batikent
690,221,679 *474959D2A3B41F5DB0EF8F9550F3FEDA786E1BCD 9BSWCOMPARAITRE
690,221,680 *47422F1673A835AD382157E1961F39CE76113839 9BSWMAZOBSW
690,221,681 *4745D772B52FC31E80404B3701B74076C49B42CF 9CALLEJONES
690,221,682 *474BA64F9DAEEC88310D86D11EDF8E5FE129C47B 9INSANEBOOSTER
690,221,683 *4746672B8B5143677D4C49A9EFB74443D790DBED 9LOWTLIKE
690,221,684 *474F44134F27253F720ACAB82A6E4B4A7FB6BD83 9MOLSONPHOTO
690,221,685 *47468188A1268FB6732B2C32F2349A99F4AA5DC8 9NEWTONHORSE
690,221,686 *47407559CDDEFF2826B97498B57442197ACCDFDF 9NHEITSOPERATIONEN
690,221,687 *474C8AA41C2727B341DBB0E63D62930AD14F79B6 9TENNISPUMPKIN
690,221,688 *47429B95E31891E1C6EA437506504775C2809068 9THATCORA8
690,221,689 *474BAF0005056913A9592E34355D92BBF7E90C5F 9TYNTNYM
690,221,690 *474D3767B3AC30284950A8C9AF0C9456E078856A a0d8e
690,221,691 *474B5F36471F0920C202664387B9CB864B9260C6 a0q3"
690,221,692 *474964801FA0DFE05598B8BDBF30396996D8CFB9 a&0s
690,221,693 *4749F1D99C0317DD7EC2CA387E2CE9E02D4699A8 a2+iu
690,221,694 *474E9BDE66F16E37A9867CC7F57DE7156233E517 A4#0
690,221,695 *474A8DC96B57549A109868BF2290AD7DA3C2109D a!6mc
690,221,696 *474D5542DBE6CF66804D663EE5A5D87C4EF90528 a7z-v
690,221,697 *47412472A51CCBEFD79E2D2DFD8DAD6C85E6B782 a9e1u
690,221,698 *47454ED658C70863602CED7704A68C7F1FC280DA a+a#
690,221,699 *47401E1DE982930B1171492763578028294D8E67 aab*5
690,221,700 *474CF84611190AB1C515F001E92DB7C16FEA7EB1 AAEA\P
690,221,701 *4744C26972CA2BFA99414CBF6B5060B946CD1328 aaelar
690,221,702 *474D35DDD12A00D72A39AAD55FF4DE16AD659A70 A;BA
690,221,703 *47414303ECCB5A953694CC5E4C9DFEA6C95FA7D0 ABHIMAANBHATTACHARYA
690,221,704 *4741EE7975DF44FF22727B08DB30B1DBEC88A11D abschiedsstnnde
690,221,705 *474E69551DE62F716F984C702DF4939F2DA4D986 ac%2)
690,221,706 *474A84727BEA96E7C013322B7624C4964D7037A9 accruals1
690,221,707 *4743A702301F6BF14D3184E6AD56466E85883AEC adamnokes
690,221,708 *4744572DCAECED978A7901100736E87EB72E03C1 ADANWIREMAN
690,221,709 *474006591A768EB6A9C4C0EE424663DB31C268D3 ADDCMUST2
690,221,710 *474912D3DBFC73AA74F4B9C46F1718E36306A10D ADGMK
690,221,711 *47444D285EA62532F671EC568C839419C86C2976 adorns
690,221,712 *4740BAB5213EE726D09390A0FFC1AA39D95D727C adw;
690,221,713 *474479DC2CF881ACD1C9AF779021F1BCF38E8FC4 aeneas1
690,221,714 *47474332A67EF64A704571DAD83F44D50C3D5496 AHas
690,221,715 *4749F5FD28EE8A131F15BF608789E88592BD61F5 AINBROOK2
690,221,716 *4744CD6E3EA744562E15F71A196834227EE65198 AJLGG
690,221,717 *47471374C3290545613374AE54BD2FA9BEEFB20B all i wanna feel
690,221,718 *474AF2232F87A078F6AB8103CFDB34811372FB4B A.LONG.PASSAGE
690,221,719 *474C49FB5AA07BA06481B476F5B83924AB6ED178 ALUMNADODELAUNIVERSIDADDEARIZONA
690,221,720 *474DD238D7C5780D25060C97015474534E1A526A alvito0
690,221,721 *47404D779D4CFF1DE5882B10B7EA8F455B7AEEAA AMAZINE
690,221,722 *4743828B2D4658155E47906CD4E4C5FDAC4388FE Andrew-Schneider
690,221,723 *47467DD11A197FBFC62878CD5EA248516FF02665 aneantirais9
690,221,724 *4743B83C44CA0FF5A715F978AC90430C553513A0 ANTONIOSANTINO
690,221,725 *47467B8B32939118E3608F2303E07AA306FEB777 AONJ6
690,221,726 *474CA379C328A5FEFEC6B5C78FEAE91A99A77145 AON-R
690,221,727 *47440BD6090937115D9932E54B81A22459EF2883 archseneschal
690,221,728 *47446B48293BCD5364DE4C42391FC417BA74F85C arielochs
690,221,729 *474280E8B4F4C1E2EA435481DE0D80EA89EDCE41 ARLEYVOO8
690,221,730 *474E100C8E467E7FE8A8D9E6476BB15E93CA1454 arlievactor
690,221,731 *4748998EE15F7A093DC3C43E2712B6E424C837AF armenbel3
690,221,732 *474FEFB0E669096A427C0A299AC57E9B59C3A028 ARTHURMCCLURE
690,221,733 *47427B666D7C699233E0C1BDBD7DA598F687D631 ASA.BOOCKS
690,221,734 *4745756BBC8364E4EB2E1CF19B2D60ACF7E17E52 [email protected]
690,221,735 *474C994694B93E5651FFE3B4B43180F1A5F26A6C ASFUMACEVA1
690,221,736 *474C8217DBA1B685C1B929DE982EDC15BB18D009 ASPENHOFF
690,221,737 *47429CE267B2414CF3D603FB71776EDB9CD35992 ateosno
690,221,738 *4742AF1F31E2C2EC6F92D321B773BBDF6B3D9CFF aujd"
690,221,739 *4744A967C9964F4353C3804253AD12A4ADF3A51E avx&m
690,221,740 *4746BDBDD647072A99916B5E4B028A30B191BE2E A&W02
690,221,741 *474B1D673FF38790585D657B63EBEBBBD5639571 B19
690,221,742 *474EDDE90C0D5962D8EFD5CAB88A8800E3607371 b!2k
690,221,743 *474D7BA3F6190D1E34B706C14BD76201FA06F455 b6k(v
690,221,744 *4745AB7EB041DD88DA9BBBCB875B0BF34559D43D B7+D
690,221,745 *474EE303BFF87E69EA73DC10E6D4AC9201ECACB7 b+-+9
690,221,746 *474B26C1F5CB963C38CFB0D7B0C75D547E2372C2 BAHERUT
690,221,747 *47481BC0F381ED1CC33E4D2FC47A163D13EEEAC0 B,AP3
690,221,748 *474640B643CA6511B07A5BA1E150DCA107D8F618 BARRETTBEMROSE
690,221,749 *474D92CFC5D69DDFCF2894B41B87A75EC783B563 b(ba)
690,221,750 *474DA184E254949A2ED1329D72090D885CC51AD6 B:BAA
690,221,751 *474F77808F988BB152BA4FC53A8C1367939AAA82 bc#
690,221,752 *4747F03DFC0C1EBC4D94F529E5DD4ABAC72FD2BD BD.`~.`~SPLAT
690,221,753 *47444B133243C87EB26AAF6A5A0391C3C83BF806 benberne
690,221,754 *474CF2204B96A0D86EDC73EABDD4FFE9624EE267 BENNETTROBERTELLO
690,221,755 *474414A1CAE40D4EAEF1152C79961D1B0449B417 BENNY.SENDER
690,221,756 *474605E5585FAD0A1A60FB6C59BF398F8642E8F1 BENNYWISSA01
690,221,757 *474566DC825AB46437471A96C46C10BC757C65AE BE#QZ
690,221,758 *4741262D8B53F87A3B07A0ECEE3A0FB875A7CC62 bezwaarlijke1
690,221,759 *474796623F7A4278E60487E6499452971DBFD984 biruinting
690,221,760 *474C6BBEB8852AC1B0FA388F2BC3DBFA5E90C958 blv&f
690,221,761 *474C80854E6D065E802B37914EA95F658F5236C5 BM2A
690,221,762 *47495662938E8BCA1A6208DC561B75E13E411FE8 BNIS
690,221,763 *474D540CDFB2DF2C949B7162879CB49285239EA1 borxes
690,221,764 *474438CDEABF61F701956D043E543BD912E38A30 bosmansbenedictsgeo
690,221,765 *474EBC11EFFE2DC8E5B435CFFDE9ABE2454D3D5D bouillironts
690,221,766 *4741DF294DE1A6EA0CA3D1272FF493279B1AE9D1 boydstyons
690,221,767 *474B5AE94B5CE4D4B35AE96162FEA5086EB5997E B.P$/
690,221,768 *474B25D9EBC68D6B3C245F416500D70E011C01BF braggith9
690,221,769 *4742688FA1036F4E1701DAA94F532C31D8311743 BREATHSOUNDS
690,221,770 *474396E88BB0D53172DC91050F4B20297AC8567C brla
690,221,771 *4746F17BA845D65B86E0612DAC7DA721E39E6BAD bszgk
690,221,772 *474B575A2230F304B10184B2FEDCA51B67E4903E BUDBALDUZZI
690,221,773 *474E34A90157A02DE3395858FC2F99E12468C410 buonu
690,221,774 *474DE11AD6CA042D16FF4316E2BCBF0D9C0E29EC bv";$
690,221,775 *474D836A9E3F9902CF53EFFC93C06412869C0BE5 BV#Z
690,221,776 *474808821DA6441203DFB987B58C639633BBFC95 bxbh/
690,221,777 *4744F5031F3A48BDCFBFF8528D1AAA45476847F1 BYN2N
690,221,778 *4748CE384403F1C512B59819B690806D8B34BC6D [email protected]
690,221,779 *4740608D41AC5FDB8B8378E7817538B7441FAC42 C0MP3NSAB1+Y
690,221,780 *474BD66408A6817194DAB5C1F05417803145EDF0 c1W
690,221,781 *4740D509CAE5EDD08C02EACD0B9CD9B4026E5077 CACEXIE6
690,221,782 *474F4BCE378CD8026C86CE05DF146451201EC4B4 cannonry
690,221,783 *474C56BA4CD0521D387EC6E8257B3EE5340D92ED CANTHOINFOCOM
690,221,784 *474F48C4C162408E2D45DD59DCB569FC66BE3CAB capricciostravagante:ilpifferino
690,221,785 *47442DBAD0324D0F8F493490AAF327A15960A3F6 CARSONTIM
690,221,786 *47438EFFB718E40656AA54A54BA644D2D932638F CASIOPOCKETVIEWERPV
690,221,787 *474A573770560415BD7902CA193AA3E58106B64C c=bt_
690,221,788 *4742A85FD5B668A96D780839EFCE87D33427F853 cdscc-net
690,221,789 *4748E12A10F5D6A4418842B425A235FCB5DD5AFE cf.
690,221,790 *474F010DAC16ED82D51FE322F09332066DEE369E CH10RAMINE
690,221,791 *4747C0D48169A90F582B9753A9B63EA4BC73FC80 ch8p
690,221,792 *4742FBB0007824F5B424D96113BE723CDA148832 [email protected]
690,221,793 *474C206AA9987B52DB7CC839F77F075B518E48B6 choreic
690,221,794 *474CD03CD78C9F613E57AD56EBD0912F4C459853 [email protected]
690,221,795 *4748B3C9AFFA551B9DA20C883146E32D549EA2D3 CLEMENTDRISKILL
690,221,796 *4741059D4FF079DA0EDE09AAD8A62F548F989FF5 CLEWISTO7
690,221,797 *474118743E9DA37AF8984A7D9175BFFC49722B49 CLINTPEACE
690,221,798 *474C6098222CA748193625F55525AAD1F4B079EA Cn3
690,221,799 *4746623BD5BFFEA9BE4D7CC1D190B591386A2DB3 COLEMANDENCE
690,221,800 *474D1C6404387ECAFF40CD62B2E1AEC27E50820D ColiteralDamage
690,221,801 *474C85BCD4752BA89AF45441C1136EA466564DD7 company-holding
690,221,802 *474EC33FE4D35BCD344E3826ADFAC1C4EB97829E connor.losson
690,221,803 *474CCE6150426BAF827F475596F62A850F5D598F contrerez4
690,221,804 *474FD95F131734F629CCC495F6D6A49BE634C2D3 COULDN'T.BE.SIMPLER
690,221,805 *4746092EF09620CB342A53E8AFF4870785359BE4 cp46t
690,221,806 *474AF8BA5D42D4F17CEDD11040A8EA856EED7B45 cp+id
690,221,807 *47493187882C72FEEB8817388DFBC8E5A15D65E5 C:\PROGRAM FILES\ADOBE\ADOBE PHOTOSHOP CS4\REGLOC\JA_JP\ORGS.ZDCT
690,221,808 *47489CD6FE31D6781D6610B8B935C3BB08871CFA c:\program.files\microsoft.visual.studio.9.0\vc\vcwizards\smartdeviceappwiz\mfc\application\templates\1028\dialog.h
690,221,809 *47434595B44D8505CEBBF9F67F8F68C1032E2C71 C!QBG
690,221,810 *474B8B4A8E36DBCDF22447B4D0BC4CD6F47AABEF c(tow
690,221,811 *474BBB07CC8D77DFEFFC3155A3192CC0B57BAC05 CU7$W
690,221,812 *47488EC7508616253CC580283A4E7059839D7C37 [email protected]
690,221,813 *47401E1331086DE79EC8CBEA2092DC1E7F8B1B0F currita8
690,221,814 *4742FFB4A3CD7D7CF3433EF6E0EB2BE2F72E1282 CYRUS.BIELAT
690,221,815 *47458CB7D349C9C22D387CE96A8BADAACD1C35B3 [email protected]
690,221,816 *474B129C04F14DA8F942B8E9C72E548C7609A32D d"?-
690,221,817 *47410FB3ADFE7E5FD993AAB934C87DF8ABEF74C3 D?4T
690,221,818 *4744F917BB84B6A610182C2FAFA3FAF644FDD7AA d72)h
690,221,819 *474896D0660DEFB753B43314E7A00103D6AC0699 d/9oh
690,221,820 *474C93C425289C96A1B4E54B1ED0FF94AE630258 dannylaury
690,221,821 *474BC2114E5C6A5C6B903402BDEA89045CCE8B4B DAN.SHAFFER
690,221,822 *47403B9A3D9A2A5B459839E2719C72BC1464C41F DANTEDAINES
690,221,823 *47437BB9437D9C10706C68FB5B0177F017F309FC DARREN ENG
690,221,824 *47437C489EEE963AD8AA8E66D2E21F83D3338C01 DAYBREAK-(FEAT-FAHEEM-MAZHAR)
690,221,825 *474A95636C26423FB2A5FEEB871B81D472227002 DAYJ-
690,221,826 *474025031C95FC69BF4F74867EE70355D83CCF59 DEANDONALDSON
690,221,827 *47432363E689EC0A73E4C4986B32DC17308410F9 deangelofreidman
690,221,828 *474E3FA91DFE77C2650179E5B284BC8CB5B42391 DEANGRAVIS
690,221,829 *474B80E28963B5DEAC7A07C90FBDF1DBE11C93DD DEAO_
690,221,830 *47480A15078D9B8BAEB46253C8355B0DD7AEEB6E DELMER.YOUNGHANS
690,221,831 *4744DB79985753FA0B658B681B861DFE879061E6 destination-macau
690,221,832 *4749139457F2EE37CC906CE7CD7DEF9D93E6DD84 DE.VI
690,221,833 *47413586DCAB5663823C2A5239464905257E53C5 Diarabi(Mali)
690,221,834 *47434B8400F8F5685FB8163D6C4956DC7FDFAFE5 DIMEGLIORICARDO
690,221,835 *47496CA53058CD18A7F55E9081C3620EC05C8954 DIONBLUMENTHAL
690,221,836 *474B92E7243E52CCA59770FDBE6F5DB4D1038319 DK6F
690,221,837 *474894C54A1AEE1826484CC93CE6CBC3CDC2D7FE DONGTALKBAO
690,221,838 *474A55109FD22599448D992D07F4EF509B87A5FC DONNA-CASTELLI
690,221,839 *4748806ECDE9F1119A69580D17B7F89689934836 DONNRICKMON
690,221,840 *474F83ABB8C3BDFB1F3055CABD36B6EE3306DBEA DON-(OCEAN-OF-SORROW)
690,221,841 *474A68B577E2126FFF3477DB2DA7903A24208800 dontephomsoukha
690,221,842 *4740110E1EC211F97FA29D908807FB48CCECB81D DON'TSAYYOURSORRYAGAIN
690,221,843 *474AB0B816BC5075FED62F465A29D122DC7E98BD DORSEYTHOMAS
690,221,844 *47416B407E8682D67E5E9EA25761A430C07AA483 dpgt"
690,221,845 *4741DE4127C4B977BC94EEC9818D7799892B2BAB DR,GS
690,221,846 *4745A2F48A15D3C951C1079995B2A91DF4B430F4 DR.SABETUDO
690,221,847 *474DAE0A7E429A469960E2E353CC5F901ABFDB3C D?SOG
690,221,848 *474E74B4A9948F01916235FCCE9429CAE1669865 dtr2$
690,221,849 *4744C9C5F1C302F17AB1B79BBDF82F1DFA9B9CA2 dtsig
690,221,850 *4742C6B1AE8B1222F543ED98CB4D0C14161F33FB d?ue&
690,221,851 *47404224B439C83D4E10835FAE12ED6DCFF23FEF dug
690,221,852 *474244BCA19EBF810459BCE38647B35ACCD052E1 dvqfh
690,221,853 *474D4C18E99BD8A1F519B80E6F6A90FEF3A2A899 dwov
690,221,854 *474391B3BDF27DFD36D1FA6BB345DDC6A1F61FD9 EAAVE
690,221,855 *474AF50A1869DDF018F7BC94ED831A09A44087BA EDDUBSID2
690,221,856 *474321DE048ED6741CEE39D1870524CE2EA1D3F8 EDDY.GOFFNEY
690,221,857 *4745B8BB0B0E42515BA50401978EF4811F893013 EDJAMES1234
690,221,858 *47418323AB00869CE8C20F90906128B0B7318EF2 ED$NY
690,221,859 *474C58034AAFC5B7FBD8CAEE6E5485A329EF47A1 EHBIEN,BRIGADIER?
690,221,860 *4745B0022644DA306FF7995615193A3A63DEBEF5 ELBERT.GELINAS
690,221,861 *474B1473DAF659ED44F4E4CD95661ED76F6A0E83 elftkl
690,221,862 *474C5E4AA4054880394A886691A4CF835705A219 ELk?
690,221,863 *4740CF930EE89E78A0616C5D2DAEADE0B599D294 elroybeebee
690,221,864 *474B461305CC6CF18C0982B63C82E53BE92E7E4C E^M|
690,221,865 *4747C4519044CA200047FDE279D5004FECEBAE6E em/lw
690,221,866 *47484D53A3D21E2CEFB6B1029BE029891B9A171B em$"n
690,221,867 *4747C7AF75E347E5625B5E7DD2CAB21BE6089842 end.of.a.love.affiar
690,221,868 *4748C1B350D748826A97BAD3655AE9ADBB2BDCC2 enlazase2
690,221,869 *474F6670CFAAA0650D70A01DDFD5CFE24A211CAF EOUXG
690,221,870 *474F6DF9C5A9EB2833D110ADD24852F9829462A5 epsa.
690,221,871 *4741AC7CCF6EA07B93FE30B8E877F7058CB6CDDF EREDJEPS0
690,221,872 *4743DEAB6629C68E1992507DEEED8944686DEE20 erotica4u
690,221,873 *47438E4642F05ED1074DBC8396287774CBF99958 ESSAID
690,221,874 *474A3FCCAA85E67126630A1E71E809A16470BC0B EUI%T
690,221,875 *47463B82A481DC44043744164E00D96D44A4B928 EZEQUIEL.FRONING
690,221,876 *474D839E6C406C7168F872EE840E1E7A12BDDAED EZRATOUCHARD
690,221,877 *474C9ED9943201B6C58BFD54E98148750807DA2E ez-tovar
690,221,878 *4745194C20128971A3168B0779F212785EC58463 [email protected]
690,221,879 *474506A367CFCF415A1E4A3088E174E29329D068 FARA6265
690,221,880 *4747EAC69AD2695CA730AA0B20A01F96AE19EC3F fathima-rimaza
690,221,881 *4749DC37E65658174386EA93E575DFC2C8562FA4 FAT.LIVING
690,221,882 *47435D98F81550535634E395E8C787E9B5A48F62 FEESTVIEREN.
690,221,883 *4749ECAB84E8FDA7392653E32FC10F5B06F499A0 [email protected]
690,221,884 *474CFA53DE882A1E540B365919A3BAB48A2FC615 FRANK CALLE
690,221,885 *474E330BC65B01A7C17415329B345C9458D65FD1 FRANKRENKO
690,221,886 *4747C6A45810FBA10EB2BE96985B377AAA899781 FRUMAMBI
690,221,887 *4749CEA37EE4EDF069BBE10AF3055C3C6C3F41EB FSAS
690,221,888 *47467C6D7C247443BBE4C3483538FBA8EEA2FC84 fzkb[email protected]
690,221,889 *474D422C2DC2439A0CE2A14384645063751E7664 g3nd4rm3r!3
690,221,890 *474DC1A12B8A42493DBD3EB8CA0012F0566753FD GAGST
690,221,891 *474CE44AEF6055AD74FE2F90FE40B09D04145D2E GAOUSSA
690,221,892 *474469B3A84EC6D47282F626BA9B7625E6068178 GARLAND.PIHL
690,221,893 *474E565F53A095C36926AAE857A3D2F15605A8E8 GARLAND.SCUNGIO
690,221,894 *474B1798D07D299F323FFEC0700BDE2ED525E44D GEL.M
690,221,895 *474ED424DA54669D8B1B31048D3C64328318AC6F GG?#
690,221,896 *474C525C7639CA1B756DB7270FB1584E4F9E6691 GIOVANNICRAWFORD
690,221,897 *474F0EED432200D5C7B1F8156485955B99A7E081 gmonkey6
690,221,898 *47404627272D0ED0B5F0983069CB246AC494E5F8 GOTHELO_II_OF_LOWER_
690,221,899 *474552118C420FD5A0875C5AD8610D2CC133E88A gralmotivs
690,221,900 *47406382EB210A2FDBBAB2226E404723BEB8B7E8 gravoeled
690,221,901 *4748BCDBD6CE1609D38BC7004D78AA0B3CA58009 GREED59
690,221,902 *47488E76D4075EE60A30AD94E0E9E9D58A05D2A8 GRIFFIN964
690,221,903 *4740C86E5FF657241FE8FE5B2DB98B8F13E10D05 grootbo
690,221,904 *474D600F8DDB0D4035C80FA698C3ED940AD377C5 guillermopusch
690,221,905 *474E285A873149F742A4584B5ABE44813E275C5B [email protected]
690,221,906 *47477CBA9E55EBC6F40FCAA5ED5DF5C1EAAFD133 ) h}
690,221,907 *474F3922DFAC49459ABA3B28FDA9AACA5CA48650 H411UC!N47!0N41
690,221,908 *474C4FA58C57571E18EB9FE98CA4594CCFBC500F HAI.GREGORESKI
690,221,909 *474465B8EE91A7F7AD9EA8B2ED3674193AF7FDDA HANSQUARTUCCI
690,221,910 *474FD922C15623DAE978E84B8427873C6A2588CE [email protected]
690,221,911 *474673645CE1865B28C133C1CF1B211D773C61A1 HARRISONRINDFLEISCH
690,221,912 *4745587C8EF611935AAE61472B96254A00B4750D hasan-raju
690,221,913 *4744FBD5897281781971A1E79E5814C29AD54501 havresi
690,221,914 *474699CBB54D9E371CD0DBA308D3F0DD24CFB28E [email protected]
690,221,915 *474A09B222A1B7D6578B5A7B8DE3342AFCCAAA84 henrytorri
690,221,916 *47423AC646DA79BBBDEB5D978D796ECFB2AFCF69 HERB.GRIECO
690,221,917 *474416596139DB06E35D49806AE0F30F4F6F672F heribertodorta
690,221,918 *474D28BC8BF37DD8D1CD8D56AE742CAD6B696501 [email protected]
690,221,919 *47492E5A4377DDBDC403BF49530466A00B640380 HIT BREAKER 2000 DIE VIERTE (DISC 1)
690,221,920 *474004C8CBCB29F6FC8A14F15D49AFCDCA07CEF2 HKSRQRQHNWXA
690,221,921 *474586C8C56F27636228C2DAC73750E3210861FB HOLLIS.SNAZA
690,221,922 *4743190B6B549B70B83545D42E1D9845D5CEA6C3 HONG.CORSILLES
690,221,923 *474F5D2725099BB687EE92F73B8A93B147F5D620 HONG.SCHWING
690,221,924 *474EA323CB92111D81556390E2E77DA746CFD7DC [email protected]
690,221,925 *4747CD1E2AE419BCC5E241D1FD339C3ECE40630D HORS-DE-PRIX
690,221,926 *4741B5FBD1CCCCB56379F902D7D6B4E8F2DB3F27 hubbertpixel
690,221,927 *474A2CFD704781F4104260840E78D5CE89DD3736 hunden.fra.baskerville.(disc.3)
690,221,928 *47493979AE793FEBAC25A42FA1CDDEAC6AB392ED HWAYMAY.BBS
690,221,929 *47436D548D7B90F78A177A058EB1E6795E8DB34E I)ADDY
690,221,930 *4749A8CDCB2039D02648413AE8EA62E635C17CF6 iamchip83
690,221,931 *4741E64D7FF1FF6E32623C4995FE2625E02CEDC1 ILUARTUZES
690,221,932 *4744034C535A4A69CA20576E347C671CC5984ACA in-a-picture
690,221,933 *474F4E9187DAA41203EBD7EA73E7BC838A3C8DFF INC3NTIV4NDO
690,221,934 *474DF4CC740AE66C6CCDD912406FDE3B3EA5FBD3 indiabook0
690,221,935 *4744D1F5ED839090C55991D3EA8C411DA518C705 IN OKTOBER (FEAT LIESBETH LIST)
690,221,936 *474A9CF5DAAD7999C9F60E359CB1B1C303BFAFC5 insinuerions
690,221,937 *47471A99D2157D00DB590FED7195DC44AB728D32 [email protected]
690,221,938 *47424944299A5EDF4ECE633CBA6EE9ACA1F2BBDF irabickford
690,221,939 *474C79AE6763B75F5A50837396DC1B81D29B99C1 IRRATIONALISE
690,221,940 *474570680B30C2CFEC968A461174AB61273BD313 ~=/i)x
690,221,941 *47459CD24D9FE91B54F06CDEE729DF456139BF77 JACINTOBRAVATA
690,221,942 *474066660832BD13528F11437931090FE05FCD69 JACQUELYN.JACKSON
690,221,943 *474DA327FF234C00EC1E97ACE933B9DDC96EA4F1 jaesoukup
690,221,944 *474B12E472EB066911CDEEC7C89563BEE6077443 JAMALSLIMAN
690,221,945 *4746652A6B6EC6DDBED00C99E27EB9F7C8463D38 james-cattermole
690,221,946 *4740D0B402145CF6EDD90CE753F0E82FD6BFE2FE jarroddanns
690,221,947 *47435EC49A75B724EDC25FB8B9DBC73F60910922 jarzur
690,221,948 *4743D2CCB790819834281DF1F8F17A30C33DD229 jasoncurtice
690,221,949 *474CBCE7215CD57064C516190776D362A1DB2147 JERRIPAT
690,221,950 *474A70B06B5477B824DF6EC8789169BED398FA1D JESUSFORBES
690,221,951 *474897EADE076BD3D3D908DD734DC8313180B22F [email protected]
690,221,952 *474EDF48807498E6C4F0EAC6A12251C4CC6B3357 JIMMY-REVELS
690,221,953 *4747AEB447C29EBC40FC578B1A87E6D31051D87E jiwlvzus
690,221,954 *474B6BD25621B0B0A0B1768BD07B407B5061684B joaquinrief
690,221,955 *4740D5D37DFFC65C754C84CF6DBD1D01FC4EC257 JOELGORDINIER
690,221,956 *474660CC65C8A1FC090D2A2DC7C392F4FDF934DA JOE RULLI
690,221,957 *4740FA677FECE5B47F6C290803D3F43EB9913798 JOESPH.THACKERY
690,221,958 *4745E9A8FED3B552BFD03A9EAEFA29A2EA2A94C5 JOHNATHON.SPEROS
690,221,959 *4742BCA920350D46582268DE0BF3733E8E5C7318 john-coode
690,221,960 *47484D43920B4C89917266C25F7CA6F91223748A JORGE011
690,221,961 *474A8658740EA5C8FB5649DD865E572CE6885B0D JOSHFURNER
690,221,962 *4746BB7D1C1369514CCFE134955C9114E8A21939 JOSIAH853
690,221,963 *47450711E06E4D692B231924130F6104E7626026 JOYCE.ROSEN
690,221,964 *4742CCED725EC44DCA9B0E11AAA8D4191ECD71CD JOYCEWANG5
690,221,965 *474CB40538582DF7C0910F6F9CFB1C9CA30B3E7E JUDE.HOUGLAND
690,221,966 *474F57D77EBB723378636C0433A8DF0A99BDFAD5 JUDSON.PULKKINEN
690,221,967 *4747AFA01FB3A4562F1B47FC81890985599EE6E8 judsonyip
690,221,968 *474425A288EA8C35C1CF5EF5E1A6200CB7BFC382 junbrecssumatra
690,221,969 *4742740F35CA400AED28E98CC02E47D551132646 JUNKILAI
690,221,970 *474559EDDDA181BE44FBC9A11A1D0902C324609E JVURRO
690,221,971 *474075BB9F4307547E84638483BA2F006B9A6C2A j|yi
690,221,972 *47433F7EDFA18AB1C7B75B167077E2F7F1BE5C8A KAREEM.SAFFORD
690,221,973 *47472246224A9E6317FB4F220D1A35269BD17FEE karólewò
690,221,974 *474D0948E7108B7BE9FDFAA0501D8D995532613B [email protected]
690,221,975 *4742F96742E9093EE2CB07260CF58E3E560911BE kocainekandykiller(speedsawpopsicle)
690,221,976 *4742035D5A3BC1CCF06D70AA560526290799519B KREEKARS
690,221,977 *474C30A3AB0ECF487306E8BD5E885320718E5949 kreetsel
690,221,978 *47466BF2E529816A6A5B100DA9A4640D90D6AA71 KRISTINEANNEDEGUZMAN
690,221,979 *47481674FD28455351F2B88AB0E17BD753FB9BB9 KURTISHACHTING
690,221,980 *47400D8D3D33114B82898E748725D9AC719A3E7F kvercetinas
690,221,981 *474CDBBD24442F70A4B670CEA032868B2FA96E37 [email protected]
690,221,982 *474E593C624B2F0B53A829C738BF89EBC3A32AA3 [email protected]
690,221,983 *474D6B014BC6CB7BE8EADB123C776DA9D568F831 L'APPEL (FANTAISIE)
690,221,984 *474E7CA7F467429542D460146BE3704A1E6601D8 latashabutler
690,221,985 *4740BD0A07265783CC3BF2BDEC37EA09288F26F9 leermoeilijkheden
690,221,986 *474CB38BD21B955DFDFBD45C88A5EC25661609A4 LEIHBUSCH
690,221,987 *4747AB4C17A477755FEA0223E81E6A48EAEF4084 [email protected]
690,221,988 *4745CD749BA880AA253072B842DC0A7E9CB5D2B9 LES.HUTER
690,221,989 *4749900D3294545F77F0981F1610DA4D3561036D LH'=
690,221,990 *4747F2A69D6CD50F16DA6F2FDC4F673A7B50C172 LIIKENNELENTJT
690,221,991 *474C03353AE24C02A89D21611D280F7EC64AF942 lipika.joshi
690,221,992 *474227E3B2E5FE22DCECDE1169F5481F070E13EC ljcnjqyfz555
690,221,993 *474714D61AB994F5D08F4E594FCF826EA085B73B LMNFAO
690,221,994 *474F58BFD008C005F59EF053AA60BDCCEA8897DC LONNIETURESON
690,221,995 *474BB4909C904783015F15218BC25DDD6FAC7681 LOREN.GOAD
690,221,996 *47462A7B314B6D98C67DA808B3978E01979CA74A louiskopriva
690,221,997 *4743D73FCB0161081C9F7EAC67C3330B7940F68A l-roger:-act-iii.-edrisi,-ju
690,221,998 *474AC3403333CA997983BBF3D926835FF6C26E4A [email protected]
690,221,999 *47458106D5F41D0D861B723B122CB7B82E4C0F5C lucasmaull
690,222,000 *474125B98E16D2C670257809C94C6BEDB4247298 LUIGI.KIMURA
690,222,001 *47471CB40DCECC8AF8924A1D6A1C5712004491A4 lukecorrel
690,222,002 *474FE0E272345C1764A094C17A3260895C394937 lunch.warz
690,222,003 *4744F647EB7BF351A44146FB7850FCC52B113FA8 lutariums
690,222,004 *4741AA79C26407A01DC949180C5BE4C6F53E4650 LYANOCK
690,222,005 *474250F26DC9ABCFAE877808F34F25667D593333 lylestellpflug
690,222,006 *4747B3BF7D31DB337E93D57E29E42AC908953632 M0L35+A+0N5
690,222,007 *474DA477BAA03F9B129BB8B6DCF0D8E93DD906D9 M0VEA8ILI7Y
690,222,008 *474AE348723826386C0119106165DEE0248C576E MANAGES
690,222,009 *47448EEB302C388E745EE45B75AED453E2682B9F mantuensi
690,222,010 *47412E7C9AB6BC12D35410BC040637BBA687CB39 MANUEL.POLDRACK
690,222,011 *4741B4171A8C948B11A948604D2A8297BB07A636 [email protected]
690,222,012 *4744492F41010A2FDE9A87072C8120B6F21C9C8A MARIOKANDARIAN
690,222,013 *474F76B2E1D8BA47AE361DB6A0BDE3780A2D2350 marriage69234234
690,222,014 *47418280CA49F0EAF55097A37D944436EA73F49E marymanthei
690,222,015 *474ADA84555394CF822F0041EADC0A43C23EF8CD matthewfinucane
690,222,016 *474E797FDA6CB2F047809E09E0B08FEA251ED75F MAURICELOUNSBURY
690,222,017 *474D2D36D715793B92360B550C95CF6B23228E66 MAURICIOLUHRING
690,222,018 *474F53CDA991C363E47CE31E6A4949CB9A7A0BDD MCKENNA757
690,222,019 *47464F6AE932233C688F0DE20EDEFB1C598AE98E medievalismnetwww
690,222,020 *4748D0F1EBA431609CFDEAB145445E4FC6F6E637 MEETINGDOYLE
690,222,021 *474A6A8CCEACB52C1BFB1CC5DBA58CC7366CADB7 MELVIN.DELAPORTILLA
690,222,022 *47435CC9C9C267C8AC4F2F4A4D2163AA4A5EDA51 MERRILLINGEGNERI
690,222,023 *474C38220C38C7C673702D51E241A37EAB7A5864 mervincalderara
690,222,024 *4745C0ABF0F1B1B51725EEF08BE8523509BAC953 meshandra
690,222,025 *4748D6BD4B1549351950878282B78711FFD47C6A mir-bruche-keiner
690,222,026 *4743D328F9566199C985616D9B59CFED84FB775F MISSROSIEBITTS.COMWWW
690,222,027 *474D4305F350CB9B37D52C7AAF90DD4BFA81C39F MISTELDEN2
690,222,028 *47426AB87A3F5A57D74D5AA23231B1A14A938ECC mitulica2
690,222,029 *474D515B74B8FA7D4AA0E61AE975D0004E2B7282 [email protected]
690,222,030 *474E433EC056717590EED0CA210B5897231C2341 MN613
690,222,031 *474C0A21B0155FA2EA704129515D843C35060509 MONICAIKA
690,222,032 *4743883A94A72097F00752494773A31A7FA3231B monitorning
690,222,033 *4744E98EED42EE91898D033B35B70C95E28802AD [email protected]
690,222,034 *4747C45BCF04EDF6EC466D350C84D2D751B9848B mucunas1
690,222,035 *474B517DE7F282AB6D4E38BBF6EB6FFE41361701 mwh7
690,222,036 *474C32760CCEC8721DBE0936946DE9F068E20E04 MYSMURFY90
690,222,037 *474E85F2EC81B5B0698A1FBFE501E2DB279B8B44 MYSNIPER47
690,222,038 *474E2862A44EE248ED1EB5977E00A2490FC75E32 Naxos-Ensemble
690,222,039 *47462CB143AC3BF8CF5EE9F7A8B6273A6CD5BC1F NBOUHALASSA
690,222,040 *474CFEE11EC22A271E90B6DE7B62CFEBCF20B932 NED.OZA
690,222,041 *474574C9C547D4E37D83FC5E32074F914345F870 NEIL.DICKIE
690,222,042 *4742FC04F5AAC06527E25DF5C2405F18D0A92A25 neneduoheglits
690,222,043 *47446F58D5B416373A48E59DFF2D689B4AEB939E NEWTONWISENBAKER
690,222,044 *474B1AC2E87BEF02ABE3FFFCCDC33B34732D72EF NICHTBEZAHLTE
690,222,045 *47480C664A529535DB35E70566BBBEB0BB6739CA [email protected]
690,222,046 *474B6CFEB8FBE85AAC80E6F9C96406C3E7150135 nicolasscowden
690,222,047 *474315D61D36E8CCD57F062CD4A77B736F31E173 nightley
690,222,048 *47443FA52D88D6D101BAF1151153FE1F2D172BAF NONWIKIMEDIA
690,222,049 *47421A3AEA90FA92417CC747C3C47939E1F71C74 norbertodorris
690,222,050 *47488198181BDF57BD3FB146848743BD7CCE8BC5 NSUPERSENIORITY
690,222,051 *4743917372B3E6C33580E3A7E10349F49206F6CA ntsrfgyv86
690,222,052 *474CDBD4032605DA5A5B476A3122EEDD52D9B408 NURCANKILIC
690,222,053 *47405CCE79E636E1D9A90031D8D1928832EFC989 [email protected]
690,222,054 *474472886551CEBBEAD696A0DB5050865D4FACE2 O8$7E7RC4N
690,222,055 *4749EBDBF12D3C0F0161EAD231DCD1016556F16E OCTAVIOAKAL
690,222,056 *474936A26BC5ED64B158848F5FAE564DC3602D2D }o{-`-d======b
690,222,057 *474C0821016D9D52213668E87AC91F80225E2AA7 ODIS.GILHOOLY
690,222,058 *474AE43A65BB022537288CCEE357553D73FE064E ODISPRESTON
690,222,059 *474CB3E5A4DDBF4499B1A659F1C545CFA6230045 }O{~ ~ D===P
690,222,060 *47491E1F493C6399000F890B4CC341338CD3F260 Oedipus Rex: Act I "Gloria!" (Narrator)
690,222,061 *474834DF1FD5CD1FDC9D8AC7D6EE98EE67D68DCE OGUNSOLA.OLAYINKA
690,222,062 *474F45F3F89ECE46E6157C4E0F1771DFA4A3033F ohyd
690,222,063 *474754A2F858F3853B405455A92275D6EC6FBF2F OLINHIERHOLCER
690,222,064 *47479F29F505CC59272CF474D8492726059EC1C2 OLLEBAR4
690,222,065 *474C711A25E31354C7E830F037510B53CF032AF2 (O_-)~`(=P
690,222,066 *47463DECD19AA953B8A791034E353850F9D7D17D ORGELFRÜHLING
690,222,067 *474FF4BF3BB7077ABF32F3EFC25113CA07B739B2 OSEREHW7
690,222,068 *4744835C2972E43CD7312DB28D786633027B2480 osvetlovacuv
690,222,069 *4743DE5BDEAF5FDE750003D35364C0B3764B5D87 :P.`(###8
690,222,070 *474091FBB2C44AD9D103B233F21798F7E15D8818 PAGEKHAMMAM
690,222,071 *474F078F89A361CD7ABCC33BF996CDBE428CD849 PALMAREES
690,222,072 *474ACF1A6BC6B557C4CD29A5D89AAE0E291C4BC6 PALMERTIERNEY
690,222,073 *474045A7B3A1D8EB705A353A0D5AB95498FCBC96 <p><a.name="n_619_">619..</a>..t2.at.26-27.
690,222,074 *47484326160A6B2AC9BE8599AE46902D188D0CC5 PARAPLUUTJES6
690,222,075 *474DFA179A02EDF687CE35698E1E74A26A11AE3E PATRICIA-MATTHIES
690,222,076 *474AA64E092D8B74BD37F946A2CB3DB45687814B PATRICKSHIM
690,222,077 *4747156B29B5E5A34DF29632220CEF95273A8196 PAUL.GUTHORN
690,222,078 *474ED0BC2AA0A56243BFAE1C66DF85B09AE50CAA PAUL-JOE-FISH
690,222,079 *474CE8A97CE3DBBBA93169CA384564E2727F7BEB P---B-~O-{x}
690,222,080 *474304086756C514ADF69A99C1316CCAF1BB5BE1 P===D`~(>-<)
690,222,081 *474D6F9A7ED11CD0CEE0DA03AA67FB86416EAAAB [email protected]
690,222,082 *474CEFE505A9BA353B90D5D0D495D8BC4273BB9E PEELELLA
690,222,083 *474CA68320CBD56561C8C5C8395E538628345F67 peter-balassa
690,222,084 *4747174CB67646FEF815056091AF0CD1DA6BBD85 philanthropian!
690,222,085 *474AAEEB31B36DF124AC5A2E57C6C63FAD912F98 pizely
690,222,086 *47480C281D56B7B0805F47AC5D14416918B8199D POKAP1
690,222,087 *474D4A60E1BD928278652F5385E7A390DAE1FF13 P----->~O~o.}X{
690,222,088 *4748975A153DCCDA30F9D50FDB6F8BBAEB5A758D poppilie
690,222,089 *474DCC1C4BAEEDF9E763CC197B47C31B755AA669 PREMIOUS3
690,222,090 *474CFC5173FA3AB7648440630D778686B5781A26 [email protected]
690,222,091 *47412C8EC94346EED7E2E5FD4BE109AF1A4D03FB publique-verte
690,222,092 *47444741E352096CAA51BAF6FC903D02EB590E6A Q=====>~.~.~(-_0)
690,222,093 *4748FA1FD0958CCB3C6C625E16C2322AD6FF96B6 Q-----B~ ~ ~(0_<)
690,222,094 *47414A1491195ABE45D824A86465AE1F8E08B763 qB.`~)8(
690,222,095 *4748A088A030C1F6EEB4AFED0B2514D5D29E1853 q####d.*.*.*.~0~oo->-<
690,222,096 *474A08CB4950C4E58AD1DFE2C9C09D0841C9B070 [email protected]
690,222,097 *474AABB0DA705938668D158E9DB14FD518BBAE1E [email protected]
690,222,098 *474C2427FE2AEB10875675DA354701CD7DCE76B6 [email protected]
690,222,099 *474FA8067E84384CE1D0CF1068D79FE69F8F90AB qscwdvefb
690,222,100 *47478F18A7B37F38FCF6D32CD116D5F34FB87C4B [email protected]
690,222,101 *474743AA5DF41212FD6B97E80480A42CB0C2CABC R3TM53
690,222,102 *4746DB696819A9955D2EF98471978AC3736341B4 RALANDC2
690,222,103 *474C09975941B027EDFB28883E25786688783D2E RAMON.WRAIGHT
690,222,104 *47437F8723BDFF0F3FE5B09A0FE5CE3E3420AF7D RANDY.LEITHOFF
690,222,105 *47429A42B792A2DA365C3F55DA9D09E2B92C5D89 rashadard
690,222,106 *474A6216E6F8E32F733A4961245928FFC0917C8C ratnaani5
690,222,107 *4742AF56136557D0E8B2C01C859163E80D11EE34 RAYFORDCAMPELL
690,222,108 *4746C6F860BBA89EDD43C19D50B84BD2A853074D REGDODOLBAID
690,222,109 *4741DF57C5E56E0D4676C55203FD4B3133256431 REHAB(CAN'THELPMYSELF)(REMIX)(AMYWINEHOUSEVS.FOURTOPS)
690,222,110 *474EB8CC0C987F303F7836CA9ADB5DFF6364F67D REINALDOZIMIT
690,222,111 *47403A55E536461BC8937CEDC4CA41A2F15B62AE religionens2
690,222,112 *47491AC04A239AD1736BA320ED58946875420BBE remplass0
690,222,113 *474FED53896027C2B6603510245D81BF2EF5990E RESILACS5
690,222,114 *474290B5F18CFC2386EC801DD46D4F9C4AB524A9 retro4ct!ve1y
690,222,115 *47440D11456B29ECE4062A3369912CA4E5E160F4 [email protected]
690,222,116 *4749DF257BBBF3EE7271007B748BA8D21525696C REWOLFNOIHSUC5
690,222,117 *47423E8E36F1D7BE8D55475D8697B1BCF0E68ED2 reyriding
690,222,118 *47427AF8791D944C7B9854B050FEF14E28C8AD9A RH4P$0D1C4L
690,222,119 *474D796101BA69F6C08AB451C27CB0866D6B4AA7 RICKVANDERLINDEN
690,222,120 *474563E43927740DE5EF97396C5F9BB29FBD0002 RIZZTUO
690,222,121 *4743F025AAADC4E4445B799820548F88419D7985 RNVL
690,222,122 *474F21FBDD70C1EAE8C428B970E9E956A6E2A3B7 [email protected]
690,222,123 *474E82444EAC2C9A71787B9BB3E1AB251CBEF5BF ROD.BOLLIGER
690,222,124 *474D3E8C688D4A09EE9FA7C14BDB79B7006E18C0 rodrickveroba
690,222,125 *47487DFC9326CE0A25E5F025B98DC9149BB1B356 roxie.mason
690,222,126 *47436BC5571D7677E6F3A3DA1C8FC787723AB698 ROY.NAZAROFF
690,222,127 *47412D3B1856BE3EF3C779A92B96EFA228194079 RSRETLAW
690,222,128 *47415E7FE4DA35B4CCAE100C9C0A05968A500076 rubinborstad
690,222,129 *474B0348662165D31B8C674E85296D164B5DE474 SACRIFICE.EN.MARCHE
690,222,130 *4742ECB703B176F048AF4B9F9C7B8BD0C1C42E30 [email protected]
690,222,131 *474F5DE766C96A92113BAE041E5C474F34CB6632 samantha-koran
690,222,132 *474794E2228934FB676CFCEFBCF2C1425AB60EE0 SANKILOTE0
690,222,133 *474AF0545CBFECCA54B737D15F6BC18616D417DC SANTONATE1
690,222,134 *4746FD6ADD485E816C2436C03E816869370EC3E9 [email protected]
690,222,135 *474FB81FDDF0D4CEE9AE4EF7D9FBCFE0372E951F SÄVELEESI
690,222,136 *474E34B793305F6CFE972B173BCEC6425A2FA1DA schmect6
690,222,137 *474788367465F10AD05814AB0DD937AB1457E419 seducing4
690,222,138 *474C9EB294769A93C5E2580FEBBD3ED2304A8ED4 SELFISHTHE
690,222,139 *474A7EE652B2E76F81720E9476175C91F2B4FD57 SELFLESS
690,222,140 *474A53102FAAA71C1EC2DD8B63ACA7017FFBB9BA SERUABIS4
690,222,141 *474AA5A4D41EE689F9AFA114260E7AC25C531F3C SHARREN1
690,222,142 *474F6F32DBCF82B4E23B5D0785249B62AE03F8F2 SHELBYFOXTROT5
690,222,143 *474AA4B2C6B23910C1BCBCCB1AED0246D53EF429 [email protected]
690,222,144 *4742DF57E579AD3F00E1F023E99189D5466FCAE4 SHOWMETHEWRATH
690,222,145 *474A93B01627D7C2443009E63F5A19D85D9B1E17 SIALAKSNED
690,222,146 *4742E58A38E55A4B447F97B4280014B58CFAD210 silver.dew.on.the.bluegrass.tonight
690,222,147 *474F22998921F299612026B37DD711B48ABCB157 SIMON.DALPE
690,222,148 *47464208122FE993DD55876CB8B948F30FAFCDB1 sini.sebastian
690,222,149 *47456B4C7F675F15D03CC76C4453F59DAC3AB8CD SLYTHER1N
690,222,150 *474E0198D1484C146D2DC1ED295DA495F78BF003 SNEISETRAC5
690,222,151 *47427FA8329C251EB19812DBAFF7C7D6FF4BE743 SOKOLNICKIEGO
690,222,152 *47401AD2DB6C38A4792A0E43C225B3C36A9360D8 SOL.HERNANDE
690,222,153 *474E44A3354932A44ED27463EF54F305478DB006 SONBUSBEY
690,222,154 *474A5672BBECCF92F46932CD7524C68A46BCA5FD SOVITARENEGED
690,222,155 *4745DB24FCF09A867FF867DF0ABA633E2017B46E splat0~q##q
690,222,156 *474841BCE34BC0383F47BE144E127E522A23147A spp0s70r3s
690,222,157 *4746263A15A1697BA4C8FD5CAD6FE7F2DE61AC97 SSENDETUO
690,222,158 *474DBC3E5D930C54F2FD455527A761FE9BB6F165 staartpruiken0
690,222,159 *4744777C178AAD89A7F12C66A50C153476804E5A starograjski
690,222,160 *4742B806C32BC422542F05625ED8C7578BCF1470 stephanie-summerall
690,222,161 *474F6E7AE3430DC751394A5283BC691EF3B761A1 stevenrijo
690,222,162 *4747F04AFE5D4A2EA8CD8D8B454CCD7B0E0D9E9F steviegundrum
690,222,163 *47409B82851A9684EE6630823AA44D15ADECA385 STEWIELUVER2004
690,222,164 *474B6B80872C4F21DC7AC2C01990FB708BF1F4DF STINKYP8
690,222,165 *474719397A203E042B4E28E3749D236CA92F645C SUBCREATIVELIES0
690,222,166 *474D217396BF96C291B438E0FFF16FA521C3DF2B SUKDEEPSINGH
690,222,167 *4742B18BE76A6D1A1904B17248A5B7947D930055 supamovie
690,222,168 *4740471C1247B6776D7C8566502F1F9766634857 TALKTAP3
690,222,169 *4742391900CBC7DF3B9E1EA1AD48F6D5A60614AC TALQUER2
690,222,170 *474103F23447E976821900559FBAD1E4B122509F TED.TREMAINE
690,222,171 *474A5EF3C045FD14314A77E4CC6E1FD78386C8A7 televizijskoj 2
690,222,172 *474AD8862C7A7E3B6105B00C3D16744EEC49ACA7 TEUDYS
690,222,173 *4743573F59D0600196B996841E9CC4FBE0759CD5 THALASSINÓS
690,222,174 *474390805EE2D1EB9B22C0945AB2B38ECC6ABA38 the constitution and java
690,222,175 *474D9009E92746B6B1A8DFA117D41317B0EFD5E2 THE.LOVE.ALBUM.IV.(DISC.1)
690,222,176 *4740F078F39DA0AC0E9F2618A27623DC6B9617BA [email protected]
690,222,177 *4740CB11214C8224105D386829A6DF74B7AAD020 THENANARCHOCAPITAL
690,222,178 *474BB4A61440C41DF2C98E03233F00F95574931A the-only-one-of-you
690,222,179 *4740B8AD137B03ED6C7C36AD21FDBBA81DB3154B THE-POWER-OF-DELIGHT
690,222,180 *4745FB18556C74E1D47A0D3ADFFE7540101C536C THESEQUENCEOFLOVE
690,222,181 *474D8454936439D5B8D6141469592D307C4073DD THIG1
690,222,182 *4740720452ACC7D9DEBE6BD7717D1633B6CC32A0 three.days.(original.instrumental)
690,222,183 *474353588743BAB8D594F1EB1A4F47125734D26B TIEHNIESGNURH
690,222,184 *4746A6562AA4F82ABB4DA8FB29CF57D89D6CC902 TILBAGETRDELSESERKLRING3
690,222,185 *474B1849E72419158699CFF0F6EDAE5EDB4F460F TIMEBONUSBSW
690,222,186 *4740796B6B7BCEF556DDB70D570E31CD99F3AE55 tinycolbert
690,222,187 *474C275213FD0F959A8D2CAF678B9B8C97B2FB78 Tobys
690,222,188 *474F41CA7458B286FE6A9B0A6D84F661EE2A793A top5a!1
690,222,189 *4746341B160485C44CF9865B4C36AF2E56EFF598 trebory3
690,222,190 *474B703F0EE403365948BC1F7EA1F4CFFB7DE264 TRICIA-HAYES-COLE
690,222,191 *4745CE30C94491EF459DD2D31D9427F1F32C08F9 TROYSINGLETARY
690,222,192 *474C7027B9352A4127958744C03C7A335F2C02F2 tsunamin8
690,222,193 *474EDC2505B4CFEDAD9FB08055E69C415B81792B TUNGSTENLAMP6
690,222,194 *474D14D3A823A3E613719321C880559445338DBA ''turandot'',musikzumschauspiel-03funeralmarch(akt5)
690,222,195 *474B06B281D8E7C38ECC677515D1CEDCE6422109 turmsonate
690,222,196 *474C1F3C250986FD288A1B553C093E35AC4C907A TXUHWANG
690,222,197 *4748C1675A39240274A466A7410040B27926A8FF TYRELLHEARL
690,222,198 *474EE7CDCAE4D8E63825E0A69C8166D49C9BF4E0 UDPANTNINGSRETS
690,222,199 *4744E96B96E21D1484921C5CC37BAC845B654BA7 umaima-waqar-ahsan
690,222,200 *474D24CFB590EE326FCA019133FF4AC9B01CCED5 UMAMAHESWARAN SEKARJI
690,222,201 *474F2A439F0612542E589FEE81F033DCAE1B353E UNDEFEATEDHITMAN
690,222,202 *4746F01C33E6150AE0AF9750250BE80BCD27ED89 [email protected]
690,222,203 *47485CEAA994A99EF7CEEA069B5AB46455E3481A UNDERPROPORTIONEDA9
690,222,204 *474181587261146DF5DC2A625ACC81760EDDBAD4 UNISCOUNISCO
690,222,205 *47420E6127237F7281368EAC4CBF31095ECC6266 UNNACHSI2
690,222,206 *474E7378C134500CBA667F2D355AA32EE318E79B UNNATURALNESSESESED
690,222,207 *4742F1A46289DD0F0E653E4E9D2F3882063A6734 [email protected]
690,222,208 *4746A1340117347AD3685E707BBB3473EBBF3618 UTYDELIGHEDERNE0
690,222,209 *4741FD1B6FB07750454A416DF7B7C56F0C982275 valbasley
690,222,210 *4744A0201CA969292C97D1C670407D2DA919D1D2 VALENTINEDODGION
690,222,211 *47425911F1B602278F4F141DAC789C71BCCE0B9B VALENTINE.IBISI.MOLOKWU
690,222,212 *474BBD753B2894F6044C52CE9BA7BBDB6DFFE794 VANNESSADOULDER
690,222,213 *4741601AD22C15F726EB1E689A9CDDC83E27CA62 VAPORISAI
690,222,214 *4745E76CF6D10F3876FD635089751974610D85AC [email protected]
690,222,215 *47438CA0764105022173CDB23D6EDF239BC15546 VERONICA.CAUQUIL
690,222,216 *474402F5C0D1224F359F1E2B252D4936DFD43ED8 VICKICOSTATRIAL
690,222,217 *474C7B9D6E29DEC33D89F3B18B26B6C436F21EC6 VIIRAAYAED
690,222,218 *4745C4DE6E22BBC50973C73248AEA8F8B8A71CCA VINCENZOGILE
690,222,219 *474C9FA5C556455CFDCEB1C9C9A7A57047B47CA3 VINCENZO.HOLLARN
690,222,220 *474BC1521AE35A90D243F18F28FCC2211678156B VIOLAVOME
690,222,221 *4745B66F5B9647B8501F9FDA55CEC05C03CDA507 virginia-knotts
690,222,222 *4740A7DBF31A3378A73FAFF4B0019AC4AD589EA3 VISHALSARODAYA
690,222,223 *474F6D4F8F1CAEEC7DC591F0F08AA1806F24D963 vitovigolo
690,222,224 *47437C73B2FB14FFB12EEF59DD7738365CCBDE39 VIVIEN FEROLIN
690,222,225 *4740DE1964808CB4DF04C96D4D94AC9CDEE4985E VNBVMLNVPPLR3
690,222,226 *47431202E6E2923CA50E41DE644F0381A9D75426 VOLBLOED.
690,222,227 *474691C7BE8D6A89BFC3C9CE3F74F86D8A525038 VORLASSENDE0
690,222,228 *474B77460EA17D8A90432BC69312BF41C12611A6 [email protected]
690,222,229 *474B0A26C983E612517F1548CCC215D5254F5FB9 Vv4rum
690,222,230 *47446979E438784E3BAF79785F429B21CD443810 WAHLENBERGIAS9
690,222,231 *474501ECEAD79A8A35CF178E28F49F948FAC60B2 [email protected]
690,222,232 *474D61E2F8D447644A96E185368E8A3BE04347A9 WANC
690,222,233 *474A433AF793C61952B5CE01634A822B23C26590 [email protected]
690,222,234 *47453983DE9A027D102D2A9759EC0E510E316CC9 WENG-PENG-WONG
690,222,235 *474448417E8BC07299749459ABB3077630E3803A WG&G
690,222,236 *4747E4BE4991035AEF42E65DF63F587FC2313194 where's-my-brain
690,222,237 *47445A16CBE5D59E42B91641A08B9E38C7E914F7 WHO-DO-YOU-LOVE-(GAS-MIX)
690,222,238 *474C5A82976D81D517699B08951C3D2CAC6C0F3B wilberfinigan
690,222,239 *474FD0358DE6F095BD3B9C18C34E8A74DD75D1D4 WILFREDOHSUEH
690,222,240 *4742AF0BC300701B0A7899BDAE1D63EE54040D06 WILSONKLINGMAN
690,222,241 *474B359215F069ED8BCB6ACEFA458F96BCFE15EF WIN888
690,222,242 *474E34759F88FD7C0CEF3B9FC9559D07CE271155 WOBANNIW
690,222,243 *474337A02FC66F969E77A9DA36D30FBA04283032 WORDS-TO-THE-WISE
690,222,244 *474AFB3919D78379195D9E00C9B46B7AC1D08D81 WORLDXI72
690,222,245 *47436097F0A4C70CF9F92A8DEA7E4CCB68E1E93F wwwharborbusinesscom
690,222,246 *4746156F7D6F50CFFF0254F2E622D17579B08753 )x(.~`(----3
690,222,247 *474C4DF542958DFBCC991C6875D2CA5A373E5044 XA6>
690,222,248 *4746D7AA8A4BBCBDA2DF7D4DA8F4E8991FBC445B )X(.`D====P
690,222,249 *4741281411E3C25BB6C700FC2C0460DC27E9598F XIAU
690,222,250 *4744D161A0B6049C0E4440954F50E65A501D490A XSSTRING9
690,222,251 *47474DBF2054B172FC9682A04C5AC3B230622538 [email protected]
690,222,252 *47414FB8F403F0DEFBD18A6BAFB49509A6AD2EA3 YAMAHADODGER0
690,222,253 *4746F6F8EA0B1F626825C22B9BBAC267250943BA YANAMARYANAH
690,222,254 *474D1D1E8C27AEBF51FFB7EBEF0C359FCDD7EDA1 YANG.KOUA.MOUA
690,222,255 *474EC70C94094B27131BF5F277825C39F54AE7DA yazruss
690,222,256 *4744FD50135D7C35B0C4B0D17FA1ED61FE6502B8 yhbxu5
690,222,257 *4741F812BA990D342990B6B24B2EAB8074374F45 yllanelijahsalinaslocquiao
690,222,258 *47434146C92981A4048FD3FE893C864C52CA0012 YNISONEZRP
690,222,259 *47440FFFEB159944BDAB3A5A5457ED3A7CCE0F39 yokeable5
690,222,260 *47465008168D7D89A51BEDA30C90F1FD2CCE8333 YTENJI
690,222,261 *474824E239A099C95D5F54944C8F9A2A84D747E6 żądajcież
690,222,262 *4747B103A2E8051509337160D478C55EB662F96A ZENEBE-TEKLU
690,222,263 *4741B714589852479E2FB0639137EFC6F013CEDE ZEQUI.ZIUR.ZURC
690,222,264 *4742C005C7D66BDBF96E76E372515A269ABB69C4 ZETHU.DUBE
690,222,265 *474E20A6A64741F7CD6FE67143F0F3AB17B46940 [email protected]
690,222,266 *474EB209B903BA560CC7710DB2C32CCBD4CDD712 [email protected]
690,222,267 *4742C3D9FB04411FBA87879E8B160E48B6F93FA5 ZOTEIIROYTE
690,222,268 *474755944BFE0A4B4AE45A0E3136A29C3416506E ΚΟΥΒΑΝΙΈΜΙ
690,222,269 *474A60B7D2DCE545DCA0583892751E29A0D5B5B6 БАРБУНЯТА
690,222,270 *4746796FF8F09F31845203BE4B881E4732E190F1 БЛОКХОЙЗЕН
690,222,271 *474F6FED1040F76360D6DD0060DF1A419E13FA40 ГАЛДИНА
690,222,272 *4749BEFE7BBDD4C7655236B7C77A5A9B02E5456F КАТТОДОН
690,222,273 *474354157A6516F168B42FBCEF59DE22A885CE47 ЛЮЧЕН
690,222,274 *4743BEA74FBCDA657020758BB777BB1AA5FD13E7 ПИЛНОСТИЮ
690,222,275 *474114AB57F445BF6DA57ACEF1C98290D2A4C250 ПОДВОЗА
690,222,276 *4745600284C527569130A7404A74DA75B5FF1F2A покерстарс
690,222,277 *474FF29DC55B1191D85C4735329B54D5DC17747D РАЗСМЪРДЯВА
690,222,278 *474DED014AF39CD42574632592C25B321ED5FE8C турекском
690,222,279 *474621A1DE3A186A12F198625F7F8588F4424C53 系統,VMWARE是真正實現了“同時”執行,多個作業系統在主系統的平台上,就像標準WINDOWS應用程式那樣切換一樣容易。
690,222,280 *474293C4A6C0E7DEFF2CC6EEE26D516BBF07A856 (0_<)[email protected]=8
690,222,281 *47412117B055FA2E796639D01A0896F92EC4F502 (_0)O~ q===P
690,222,282 *474D98D94E5008C61AD9D680E44A765760BBFA00 (>_0).~`.~`.q=====p
690,222,283 *4744147D312F3A863A6245F2F2ED5AC71BA05DED 1011730
690,222,284 *474DB48EB6837786512E1AC4649B94CBA551B04D 1060767 DANNBORDEAUXUNDNUNTURIN.
690,222,285 *474E98C4693CEE8E8F6AECEFD4192134E7D1FDED 10XR3L
690,222,286 *47422F533417ADDAC5D924FFBCB6493F82E6AB58 10月6日 RIVIERA
690,222,287 *474D8E0997745200E31592099811CC42DF7A12B8 1195586 TUTKIMUKSESTA-ANNETAAN-KIRJALLINEN-LAUSUNTO-.
690,222,288 *474F07AF84CB39B3D77BEF7F9F399479EA68EFAE 12:-12---#---&---nonetheless
690,222,289 *4740263375DEDA07B3C6EA095EEF75A91CC3A9F7 1296667 torpedo-o'peke-hy
690,222,290 *474BEF9C8A450322CFEF2D8840C8B0A55669935E 1492456 instead-,-mr--weinberger-personally-directed-gen-
690,222,291 *474D88ABBC6FE72F2CADD1FD811A4D7D3CE41C25 1834501 kurssi on hy
690,222,292 *47406B9DD928A8257E6D355BA8B09D4799AAE93E 187841 benim-ve-sirketim-icin-avantajlari-nedir-?
690,222,293 *474026FEFCF1E1202D11FD0B1709B192A439FE09 194homework
690,222,294 *47483D3921D2902381CBA59E3D3EC0F5F62E3F0E 1952FOUR CHRISMAS MOTETS2QUEM VIDISTIS PASTORES DICITE
690,222,295 *474C35971FEDF5D221FBB241E99BF515817439B3 1.ACABILECEKSE
690,222,296 *474D2B58D14BFA2EDC5C6CF8AFB9B150956CDDC2 1 akademieambiente
690,222,297 *4741E581685EBE503374E837641C55EA7DA5777B 1.BIORESONANZTHERAPEUTEN
690,222,298 *4746E7B219DE5461F3158A0795499A871702D6F4 1-brockenplateau
690,222,299 *4743130ECFEFAEF4B8AFDFCB43A036E01E60C2C2 1burnside's
690,222,300 *474D271B2E4E48E23B7777FD47FCF3974810DE3D 1.emissionsquelle
690,222,301 *474B1C214DD2DF9FAF0527138EC656703823EB49 1epepophysial
690,222,302 *474F1D55CC2E91D19D2A4A46751DB4AEF7FFB0B1 1holbrinck
690,222,303 *47456A72AC35C7441E9707C3F124D60D8DA329AB 1-INNENRAUMBREITE
690,222,304 *474D1731A397E29F2E90BF69D89DB19EBAEB51FC 1.JALKAUTUMISEN
690,222,305 *4744987461AAA031442BD8D35B8F2E69003A4D2D 1-MARTENET
690,222,306 *474E3FA938231B9E5D7EAD090696F4A6A58C09BC 1MENSCHENUMDIEHAELFTEODERMEHRZUVERRINGERNUND
690,222,307 *474715B2424F8159C996D580829E99107D639E0A 1MIRUKUSE
690,222,308 *47434C802B54369C790BECEBD86B11002DB78D04 [email protected]
690,222,309 *47425C0F816A86689EFBF20F6D7034FA73F6517C 1nuohouspiirit
690,222,310 *47433293A3C428F4612846B1D0CB6D914BCBBD3C 1OZWIQYB
690,222,311 *47482D54785112E104F182A0D4863B1E9B0A29B9 1POLIT-INTRIGEN
690,222,312 *474E25E9959A43E121A843E6ECDEE23337FB5EFE 1.ruopatessaan
690,222,313 *47402E720005BDBC92749D50D24A77AAA8AF2370 1.saklayamamislar
690,222,314 *474293961F05A256585520588CEA16D5BF7E6CFD 1THATHANNA3
690,222,315 *474BC6ED38E3D97ED7B44CFE4B7F01527C559A13 1 TIETOTEKNIIKKALEHTIEN
690,222,316 *474F4528420B5571F8027C02D2498B94D4DB3D82 1.yapirehberi
690,222,317 *474D319290B2D1DD58E637D57EB3089CDF68D6F6 20010928:.women's.club,.minneapolis,.mn,.usa
690,222,318 *474E4DD51D0295867EC7166DEE28939E3B3DFC5D 20.03.1825
690,222,319 *474C474B5EA956C30B6B624A879E20F140459C4E 2067718 THE-CANYON-IS-ABOUT-25-MILES-NORTHWEST-OF-LOS-ANGELES-
690,222,320 *474759DBE6334783B947A4F0871317AFB0D22A24 2073410 FUER-DIE-30-JAEHRIGE-EIN-UEBERZEUGENDES-ARGUMENT-.
690,222,321 *474AFDDA635ADF38D0B2EFD1D502F38168B49EA9 2075713 soveltamisohjerakentaminentapahtuueriaikoinaeril
690,222,322 *4748D3DAA41A3EEA3F8C7A40BE0F9CC8A56B40A7 2:..2..-#..-&...soaked
690,222,323 *4744262ECC3BF75ED74BDC86373437A88FD0C7D6 2571274 MAJOITUS.JA.ILLANVIETTO.METS
690,222,324 *474B951F670FF67BF72376FE3842F146B26EBA0C 2747982 ARVIOINTI-:-PARAISTEN-MALMI--PROJEKTI-ON-K
690,222,325 *474AD34B6E607229952D14A6372527397186B49E 281ARIELLE
690,222,326 *474130059053A8DA6E767E845565A899E10C35F3 2904652 CORROTECHOY:SS
690,222,327 *474F2E55B743AF9A673AE2E2EA2F8BB0A09B2FB9 2AXTORION
690,222,328 *474AF7B47A7D108607E93F2DBB966B8A4BF25A75 2BRILJAN
690,222,329 *4741A7CB04B8CD4DD5C46D2F29C5BD28F8CC909D 2 HORNBACHMARKTES
690,222,330 *474624D8C00ED172C988AE5D09C0E808C5EEE3FC 2.LALLIA
690,222,331 *4749522839683DACAB1613A7052893A00F5B867E 2.posauna
690,222,332 *4740B5F311A9FDA69AD910AC0DFD8C43A41F67F4 2 RADIOMAFIASTA
690,222,333 *47428CD2B60A16EBAADFC2355CFB24551F30EAED 2sep1587
690,222,334 *47478793D0A2C38F10571B5EF111E386CC93A1CE 30 SISSELN
690,222,335 *4744CD7C83420AC7D584BF397AB4242DDE9A94A3 382232 dasseieineeinbussevonimmerhin325markjehektar.
690,222,336 *4748EF2B5FA7641372818145C3108D4494FAAB83 388c20eba82c0ff19b36295d3d86b247.rnfv
690,222,337 *4742F2794352061D710767F0B413C2C5BD0863A4 3 ABGETROTZTE
690,222,338 *474B1BF14CF449964A03B11F76C49FE62F8CF240 3===b***~0~o(x)
690,222,339 *4748E275B8552373D4242EEAAD4CF99EF894CEB7 3d47139
690,222,340 *474D90B915C89ED80ABCA73748EB49EAF03D14A6 3GINGER6
690,222,341 *4740BE396971BC3ABF2B948974895A2A5FD27450 3-surffaava
690,222,342 *4746D102E41FC05B832D8AEE8977DFC20832261A 3XU17ING1Y
690,222,343 *47401C3124AF9DD89613C357275E347AD9C9C8E9 4BOMIN47IONS
690,222,344 *4746BA2F3542B047B0C524E1BD010E88498441C2 4FORUMFAQ
690,222,345 *47413BDD003E48ACCE4EB7EF40A75C7A9A5A0174 4MARINOCANNONDA
690,222,346 *474762F5F30DEED56C1DF2050E9FF2F9432B1669 4RECALDE
690,222,347 *474CF65870341C15020EF74421CB2D3E5AD47CDA 4SCINAHCEMORDYH
690,222,348 *474D4BB9C9082310584AD24B88241F889B49C1BD 4TEMPORAL7
690,222,349 *4740361B6F6EC65F7ECE95057AE6FB3FDAC1E85C 4UPETGOOH
690,222,350 *474C9429D6A589CABF08F0C256B0839CA81B575F 4WIRKLICHE
690,222,351 *474BDE71D54EACAE554794EE129948E22DC1656D 5BSWMADEUPBSW
690,222,352 *4740CB24FF6E5D180A068B7A1D241FEA5D284D30 5CONRADHOTDOG
690,222,353 *4744CD22747B611761F04A5E1E366C82A7E56419 5FOREFACIO
690,222,354 *474973DF9967E4F9E01BE4CBB3476710BE889E69 5IAAMEGFA
690,222,355 *474390F36B90DE5D9C4E10DFC0E3BBD9A610F234 5-kyriakos
690,222,356 *474BA3BBE5AF0618618558D68D918481480ABC20 5NOTIFIERIONS
690,222,357 *47457F443976899A1B82DC620A8FF1B97CD40F0A 5VERTENTES
690,222,358 *4745A225ED22568E00FC36D84E09F3433A55DFE6 6CLIVERMA
690,222,359 *474C1FD89732A9DC6B6C50E14915AB2B0D67D94A 6DANIELLEGINGER
690,222,360 *4742BFDC25AC7665D25536E05C33FEA93B3675E5 6DEDALBEE
690,222,361 *4742A8C0B9E2D32AB745D2B348FBB6256B3BEA15 6defoulais
690,222,362 *4747475E5A0CB6C412C2DD3A19B7B884535675E9 6ERDKREIS
690,222,363 *474D7973673B87974ECEA63609182ECD7F29DEC0 6HAPULLAT
690,222,364 *47426C06070F6C8C4E5BF4AB803A9DD87731D816 6JOURNEZ
690,222,365 *474DD7101A6C04124E0262A23AF3CA9055F33393 6PAINTERFOXTROT
690,222,366 *474BACFEECA7484AB3C38E9A97E522BA1002870F 6REKLAPPERIG
690,222,367 *4741FD9C303B232BDAC2F7774B0C2230770EBC83 6SELECTABLE
690,222,368 *4749155DA367DC485C9AE6A0D6F406E70DD5F3EA 6TURCIZM
690,222,369 *4742C6A4D0293BDFC8815856DEFA16D0D5D46BB6 6ZAPORNIM
690,222,370 *47430F41FF1AAD685FAC20E62EEC8B33C9636F11 760106 ausweichtermin bei schneemangel ist der 6 januar
690,222,371 *474EA9D4C3C369D678638FDDEE2639ED822F424A 7959B1
690,222,372 *474BB996AB598DDA69F86A030064E90022F3A1DF 7A66
690,222,373 *474AC070E440F835B774CDA31861C1EC848F8572 7ALVAZIAN
690,222,374 *4745838DAC5F6515FB457A61C61483809A7A6726 7BDCKKPP
690,222,375 *47467EEFB628440890CEC4AFBC7831583543DE71 7BSWKQINNBSW
690,222,376 *4743778D4B994B8F513B4E8E05F53468B14F5F01 7RSUCHTES
690,222,377 *474A86A758EC69E7BAFF4C09D69C3C69985B92AB 7SESRAPS
690,222,378 *4748F8E6975E34CC799294E98A8E9252D1DB3F06 7XMGUTUAJDY
690,222,379 *474A35F7CBE17234459EB045EAC64B9C3535A6FC 801059 hep.bir.ritim.bozukluGu.yaSIyoruz..
690,222,380 *47466FB7C1BEEAC088D0C4788482FBFBAC366909 8#####>~0~O}O{
690,222,381 *4743FCFBFCCD9360ACC30BC6519B7645C4690A12 8AAPMIINU
690,222,382 *47411B752DFF6C2961B1CD26ECA4678B57FDA164 8ACEVAWWAHSNOOCCARADANACE
690,222,383 *474D531792657F8DEAD402DD6CE7F9366BC990C3 8EPONYMISE
690,222,384 *4746EE6BDFDF7FE90075083EE0D7DADE9A9D94D9 8ETARIME
690,222,385 *47442AB61AFD9C61721AAC084106E1DD80CD17BE 8FALLITBOER
690,222,386 *4740AD824F642867AF5FCA58CE78163D70B5EE7D 8FLASHEXPLORER
690,222,387 *474A998A7E716F7A78103F2D7F48DD4AFD716206 8komisyonu
690,222,388 *474BC074CA70C683B0A02AFD8876425F8C301ED6 8LIMBURN
690,222,389 *474C8057532040CC916843094C5705F711FBF66A 8NTRCBLY
690,222,390 *4742ABC601FA83DB9CE34197384D4D54CD273952 [email protected] ~O(^_~)
690,222,391 *474FDEFA99AA1A30083B7E519612307753907B3D 8OPACIZZAZIONI
690,222,392 *4746E7012C9BB2DC1EBA39511FC444B3739482A8 8####P`~-`~-(^_~)
690,222,393 *47466760975D01BA904AF20F48AF951B09251AC6 8SEETTOCY
690,222,394 *474BF07A34BE166100F1F1BBAB30CBFC9C1AF46E 8TILFJENDE
690,222,395 *474EE73AA4D0AC7438672A7C487348ADD8EF26A2 8v3aaa
690,222,396 *474BBCC410BA0695C91D73E64F609C5AC41BE3DF 9BUTCHKIDS
690,222,397 *47403FE07D0DC22C13878AAEFAB102AE56022498 9GRASMAAIERS
690,222,398 *47441CDE63FEE6E192DDFEA396C83A9D91265954 9LIVERPOONORMAN
690,222,399 *47486F1FEE398204905EE74B35242F1FDA002F4D 9ORESOFTBSW
690,222,400 *474981446345B7DD390D199DB8FCE5C14D5E0CB4 9POLYINSTANTIATIO
690,222,401 *4740D56C0C535B82FD0D3B8EDD4D4FF914065CF0 9RESIEBENFACH
690,222,402 *47442D3AA0C3F2208F8CCDCF0149EB2F7D0DE524 9SHAMLESS
690,222,403 *4742BB85821F1265713AAB12994C2F305961F1FF 9SISMARKKINOIHIN
690,222,404 *47439E8709241242183BDBB62DFC8E86976419C0 9verdampten
690,222,405 *474C8649D3105B7A393CDBC5086FC56F9B9230E1 A2W-B
690,222,406 *47449FEEC69C0153962D4B7341F3B63CBD575212 a9c4s
690,222,407 *47415D6432F76F6BCF1225D55E14FF6161E695D0 A9ER1
690,222,408 *4748CE82175CE1C39EA0C0183DFE3D4192A1E223 AAEA[K
690,222,409 *4743AF5B02759F7332A2D01BD128CC19FC77C109 AAENI<
690,222,410 *474A545ACC449098BB23F3581CB3707F00D10759 abzufindendem0
690,222,411 *47418BD5F78FB3C1C8356A7EA9F9F89ADD9E024C AC\"~
690,222,412 *4748CC93C3B121580BF506F1A99B106929D7527A AC5H
690,222,413 *474A96FD089F60C69154D6C3EF721B65971DE53B acmgb
690,222,414 *474665EBDBFF5AC59AD83F23B63D75DACFF4D3A5 A-DE-ARES
690,222,415 *4743E132FF0EA96FEBDD1647E2D3ADD99A18C5D5 ADHIRAJKUKREJA
690,222,416 *474E3EC2E37633AAC0DDF5F548CACB0D74FC8DFD ADONDE-VA-NUESTRO-AMOR
690,222,417 *47414EB12411D432EB7BC8F91E35D9788BDEA823 adoq"
690,222,418 *47498AD7D5BCFC0CA9080E6C6D9B58E2D4DCF187 AFNUC
690,222,419 *4744FCB68BE91F161C131EA2F412D3A903928A83 AJME8
690,222,420 *47452976D11F2D6D4F9D7AD7136DC5DEE7B07B42 AKHIRINJI
690,222,421 *474A072659B1DBD7A67B491357E16235C3833E2C al.charles
690,222,422 *4746771FAA4A24AEAFF97EC698B3B70918F7CF4C ALLANBOVEY
690,222,423 *4741E76FF3246E2AB485CC33C77A6C66D751E62F ALMUCANT9
690,222,424 *47402980F504C6E81CE5EBAF07D355D2FD973A66 ALOKANANDARAY
690,222,425 *4748C7BC9380E7F3F8CE3FDF7686909F01BFC1C4 ALPHONSETOLLIN
690,222,426 *4741759D621A4A3B2474EAB055F141ADCE8F5B82 ALYSSA1105
690,222,427 *4748CA20CD8F129BCE700DA6BD947613716A7D19 amit-david
690,222,428 *474A62F5E34C70D1FD96CD403C092C0DEA449A8F AMUKTUR
690,222,429 *474870EF8AA9ADE62007CEACCA476A7A344B1FC3 AMYALLBRIGHT
690,222,430 *4740E8314A7DB9A098B97369995A3CD1279E9D1D (anderlecht)
690,222,431 *474FB7FB6B88F0689BDE59C09ACCCDB2F058935F ANDREAGREDER
690,222,432 *47437E381A244A40C61609E033E78C6AE6198F38 ANDREASSTUHLSATZ
690,222,433 *474FAFC978113A3DC8EBE87BCBDCFC883C390676 AND REPEAT
690,222,434 *474A2C4AF42742E015826BBD9BF8F813F68C7A4D ANDREWBERTONE
690,222,435 *474508C721B0A23E730232EC098EBCA8D622EAAE ANDY MUSER
690,222,436 *474FE6E6E38A5E66E493E1A4DBE7DD9196F98083 anldx
690,222,437 *47407113A971FAE00A68B3539BAFD66859FC6C7B Antiatheistical
690,222,438 *47425A94A77A4894C0EFA3EBCAFA11FB4A0D08AC antologia19781988
690,222,439 *474B5FBD97D46567FFCA016240B43695430B98D7 A+_OI
690,222,440 *474B7E3C7A4B6356D4CDC88B95F6E04DF5A44167 ap$gi
690,222,441 *474BB7B2E0C579F40D530C79A9C5CB494C44DF3D APGN6
690,222,442 *474C0D2476E28D152BE5272C2B09C00C873E6F98 a_qdl
690,222,443 *47463C3BD8D5142546A73EB0380986347790170D AQUESTIONOFINTELLIGENCE
690,222,444 *474581C03976DD48D588624B630A0F272C186630 ARECARLIN
690,222,445 *47447AA652F38B7D5166F65F5D46E5DA6835A8D6 arevzloh2
690,222,446 *474F400A76564D71720B4B0EE55C729A54678F40 arircsor1
690,222,447 *4743639104CF608123758A427780B1596B5CD943 A$RJ3
690,222,448 *4742F3C27F0B2951EF955229C59C44725448B22B ARODIAIS8
690,222,449 *4740FC0ACD45D36348544D86AF9D56F4F086613A ARTHURBLATHERWICK
690,222,450 *474FEF37AA6E46AF401079582C1777B7FF3FBD9B ASAPACHLA
690,222,451 *474233F3FB5CB6F663D47A9FB3E7F3E82E708747 ashu_
690,222,452 *474EE6E1C8EC0A3C4A05284B6DBC85920365B8D5 asnavuts4
690,222,453 *4740B92227653D66F06085D2E29AA5369FC47733 AST(S
690,222,454 *474A239B6E58FA8542008023554741A1CF794B0E atspeed9
690,222,455 *474337D86CA04338D4FC58A008873137E7896B11 A"U0H
690,222,456 *474EAD7BF4A8872EA9FBC63423208A56026447DE A-,YAWYNA-EVOBA-DENIALPXE-SKCATTA-EVISSAP-FO-LEDOM-RUO
690,222,457 *47490C0B9C6B6E797E0394B5EB34B475464E6C9C ayq(y
690,222,458 *4745DD3522EC2C2C3A97A50BEA610B3E989136BE AZEA
690,222,459 *4744C2E4B028B5AAD280FF4C778EEBE59FF44463 b5+(v
690,222,460 *474E5BD323D72642BB9E03CE34E0C59DCB5D3ABD b5v1=
690,222,461 *4747F3C1DB0A7D55D165B61375AF707C8F045803 b6a3z
690,222,462 *4740711A3CD213994A3AD13F409798B95E407B8E B96348
690,222,463 *47410D2AE5EF6404BDC6D0DE61AE9FE5641C9B15 B(9OA
690,222,464 *474DF1660A2AC7D60CEFC3834376DE3D09229620 baidar!
690,222,465 *474CB4798A95ACC467FB7B6B36A172294582071B baq=c
690,222,466 *474B247E23577C34804B1AC71EF45573630EE7C5 BARRETTFALGOUST
690,222,467 *474AF1120B734DA80FA57637C5611E9E6C826021 bartonwooding
690,222,468 *4745CF6A6CDA567F99F056C6D1B3C8A453A714DB baryp
690,222,469 *4744E5A50E42AF4C499B0F10A88C957CCBA4B57D B--B~O(>_0)
690,222,470 *474128685297969EC95B0A6A8563C82F3BF1A0FB bcoit
690,222,471 *4746F1B956680A7CEB2EDC27B85D0630D69C369A been.where?.did.what?
690,222,472 *474BE7284AEFCD2D5B5FCB6D31B17CDB532D3C28 BEN.CASSIANO
690,222,473 *474A6F825E91352B4CE84D4842649763F7C6CDDB BERNARDOZORRA
690,222,474 *4742C7EE475E592C1918E0CB55AC33D59A9B751D bertocchii
690,222,475 *4748D70FE3F8F5C4BEEFFE94C7CC8DD48EC5FE86 bj%?)
690,222,476 *47436BB031E86661FD5EBEDE82D51E1FC4ACB3A6 b%!kt
690,222,477 *47442F49DC38BF2690BE6887A02B69BAE2F54BD3 BLAIRLOPE
690,222,478 *4745B2D711C44EED70A1B9AA77593B6A37BBF4F0 BLEDDYN.HARDING
690,222,479 *474535BA7F3FEA282E0F700A31E49A42CB047238 blg;1
690,222,480 *4744838BC938B66837E1807EBE44DAAA08370D61 BLOODFEAST
690,222,481 *474CBCE76C9D325B0C3ACF79F53274F372240F42 BLUEYODEL#1TFORTEXAS
690,222,482 *4740B20FB9CD5AA433066B6B272CFC4B34A95240 bm?uh
690,222,483 *474471C4794334EEB99BE0FC6ABDB535FB8F8382 BNIS
690,222,484 *4746A95A74A77EB754291F4EF5F26C28070EE569 b!o63
690,222,485 *474EB1F71422409F38A2D314F4A522D0C7736280 b###@ ~o)o(
690,222,486 *474B7907DD4E6F354BC488C936FB45C4D65B8FE8 [email protected]~O~o(^_~)
690,222,487 *47462E9BEF7ED71557E67E45486AB88AFCE804F2 bq/bh
690,222,488 *474D335649F243AA35B7B667D63E37E74DDAC75C bq-os
690,222,489 *474BAB90D8B1AB18AC1FB36E0362443C448C5921 brainduskey
690,222,490 *47464B8459F6CC519E5C6ED122C3FFE58FAD0094 brainshingleton
690,222,491 *4741760F62251258D0207BFA870659E1D9AD3DAE BRANDYER7
690,222,492 *474BFFA4419BC48F5B539C9E9A6AD1AA8011A8A7 brazily6
690,222,493 *4745417BBBC3C1870BCCB151E2679A281A5C32D5 BRENT.BISH
690,222,494 *4742EE24053724574B849FAED5F869E958FACCFF br+ic
690,222,495 *474A8810DDCBF9FDB6F5AC74FB4114931A9F6ACB BRITMËQARE
690,222,496 *474DD6C4E8145AD6BAFFD06B2997E0756F86583F brookscuffy
690,222,497 *4744CB3985984545749B8ED087B01DBA94791946 BROOKSCYPHER
690,222,498 *47488C35361506719AD39F387EADF925B700C3FA BRUGWACH4
690,222,499 *4741841C4BB9A2865A553A613720B2B1727A2D9B b.s5?
690,222,500 *474FD62E407DE946F11DDEEEFEA5927C16D1813D [email protected]
690,222,501 *474F75BE8EE6107267E4078E0CCB73772CE34825 bswswansenbsw
690,222,502 *4746A17192BEF6B7B521DFD3A82171AEE62825F4 B_?T,
690,222,503 *4741EE49639264BC4D5D87069D0CC7790C8D4756 B&UA7
690,222,504 *4743DAE71F6676386D699DBB3CA833E1136804B8 bux=d
690,222,505 *474CD20533B51DA442123259C79AB125AA84AE3B bv8k:
690,222,506 *4746FAB26E38339B07B0B1140B5DDBFAA2D394D7 bwocp
690,222,507 *47409DA59644B87B9779C5A3CD954547CDC9B2C4 bx"hw
690,222,508 *474F2CC4EE8A201FBA1A7B6ECBAB50DC9A983516 BYVIV
690,222,509 *474D48D8FC24C7F0D96AFAFFBED335E2B7B60747 C0M3R5314M
690,222,510 *474C7500D3F8D7BD3099EE2BE97B86EEA5949C61 C0NS7PA70N
690,222,511 *47422A388485E17AE8EAA756B503686AC0DCEC0A C9Yu
690,222,512 *474916F86E3D7EA75FBBC82F3D82F28397199E5B CAN#H
690,222,513 *474E342D11176E45F4C7466107172D0CD075826E [email protected]
690,222,514 *4740ED97A0642E77404A7F6DDE8839012E979CC0 capitalismisthejoyofgambling.
690,222,515 *47469785D8C1E9C1DA4CDFC5589676D6922FEFC4 [email protected]
690,222,516 *4746555F93C19DE72D2010879FBD5468B1998A2F CARLSICKMEIR
690,222,517 *474A1E9468A34D7F44CF33B916A24289F7C6ACAB caso
690,222,518 *474EBFACCDCBC43D35F4F4A05D90DB9B358258B3 CEDRICK.RUMMANS
690,222,519 *4743981A13AA8F90E50535391DB4EE73919BE815 c'est-dans-l'air-(greg-b-remix)
690,222,520 *474DB848C7797482F66779BE0A1E370C1B7BB780 CEV8
690,222,521 *47448CC91EC185DCAF805B8A0E37B1D49E1E15DD CHEDDARS
690,222,522 *474FED191B30B0074B424D8417EFD63E456B0216 chesterlivinton
690,222,523 *4745A36E5083E72536C5CE5535BA1904088DC844 C/H(H
690,222,524 *474A75380DFFA971E43E12DDDDBB6170A4448880 CHIPPEWAFALLS
690,222,525 *474AB13D7DF93473BA740CDE7C05903E00FBFE57 choreic
690,222,526 *4744EE515B65F109001256543A5B18E2B7A3201A CICIBÁN
690,222,527 *47446242D411C08F545F800186E87DA05FFB3379 C&IP6
690,222,528 *47459A57949CB33C2B35054921CE9CB737CB6339 CJH/4
690,222,529 *4742B947B9AF52B5AEB3B8700C47CE57D720B9E9 CKL1
690,222,530 *4744CD5BA7A138CE328F7B2D905E209C26ABDAE7 CLAUDE.SAVINE
690,222,531 *4742131455D95671154AFCA3BFE2335126882755 cleopatra nay,prayyou,seeknocolourforyourgoing,
690,222,532 *474E4F55A5520D389AE073E7AA64459EA7178A4E CLIFTON.OPPENHEIM
690,222,533 *4742D3FD96A3BECE11E51CF2B2DA7075899E39BC CLINTON.SHOEMAKE
690,222,534 *4741BDCC78CF32C310796934BCAB2FFAA66D1646 CLINTVANTREASE
690,222,535 *474FE6B38AC22BF212FB69E5EB6C2B614150022E Cn3
690,222,536 *4747B50C701DED025751DDB349A79A0B798ACE6D COLLEGEVNS
690,222,537 *4742F7C66F4538A3BD72559432A574A7CFAC451F collinvanderlaan
690,222,538 *47477D59CC01F779468A86F9AA17E67579894EA5 C_OM
690,222,539 *474F3234705D508317371526004400444981A3AC consermonelement
690,222,540 *4746483086B7812541D71E9A5C90F786518DF21B costeym
690,222,541 *474C88764C2CFFBFCF60AA208EC4454949256E53 COUTNERTERRORISM
690,222,542 *474160EEE1C47CB29F28194BFAFC8BAAA9B93181 C:\PROGRAM.FILES\MICROSOFT.SDKS\WINDOWS\V6.0A\INCLUDE\CERTADM.IDL
690,222,543 *474EE2FD2C682C345B6FA2D94D692485DD3DACDD cptchaosing
690,222,544 *474287B6FCF2133EC6A1FCDA7F2BBDB25BE2227F c(=r,
690,222,545 *474B09E703106F56DD525D10DD1FFCFC8B10CB18 CTce
690,222,546 *47401608295D566C33E9A1CC8F67B6C60C26CF3A CUJ,_
690,222,547 *474697DF99A41F98F1564F3D395AF59DA75D6E07 CUSM-
690,222,548 *474FE9B968BFA1CF26267DBDB72096047946B344 CYPRUS344430N32320E
690,222,549 *4742E43D282DB2BC045E44FDFBC30CFE918FEAF6 CYQEI
690,222,550 *474F4E4B68A09A95A6A0B5B83BBA3CF0FEAB2AD6 czd5
690,222,551 *47498133723EBED283475E09C9FAC41DBA632310 d,3,
690,222,552 *474DA26244F04D910806CE0FFEFD34C2C8832348 D3T3RM!NA8L3N355
690,222,553 *474813D4C5808D79088A79D084FFEEBE0AAD3FFE D.8E!
690,222,554 *474CEC8916CEDE0DD6354EADF947EE9D957AD27F d9#p(
690,222,555 *474DF8A13114FA0BC44080C7E71491EAD0FABD32 DA13
690,222,556 *474A409ACAE14EDAF768DF1BC81AF5415C52615C damienbrevell
690,222,557 *4741FB937AFA3A41B0C53B5A270843A43AAFCB8B DA$#N
690,222,558 *4742C88148ED82F5DFA7E6AC7604444C62EE193F DANIEL-MATHENY
690,222,559 *474C45778313E2A1C7D8B4A378A1C1D408A0F0C7 danielmunsen
690,222,560 *474378508312FB5ED67C3540C1390F66A87F2D1F daniel-nickles
690,222,561 *474D41E6BC5F7D2A8D8146B251D5052BCA5097C7 DARIO.BARBIAN
690,222,562 *474FCACFA3A3414D5436C7ED98220F80942CF343 darrellmeiss
690,222,563 *4749CDC21274E8B7F4F4A40E9CA537900C743778 DAVID-RAITHBY
690,222,564 *4743520CE8EBD1DD2534ACC9F45C0EA6B7CF818D D)BMC
690,222,565 *474D68B5B80049619CBA2D0309071799CCD26C84 DECISION-EUROPEA-DERECHO-DE-LA-UNION-EUROPEA
690,222,566 *474811B6D624CE83C019244670A2D487D43DCC04 DEF1OR4TE
690,222,567 *47495DC2B01C6EB54DD748FB06EA4F94A4B6028A DENDROCOLPTIDAE
690,222,568 *47410F57563B4777DC52D6A9ACD4B41B2AB2401F DENGCHX
690,222,569 *474756160AD684B2603FCB5CC4FAA2ABCF03F3E9 DERICK.OCKIMEY
690,222,570 *474061C9F11273045E215CFDFD742550B60DDD8E DERUV
690,222,571 *474E2A401F50AB7A7BFB38854DFFC57DB14B36E8 DEXTER.SHIMA
690,222,572 *474623B507FD0F8DBEEBDDEA0B6A560905EB004E DF3TP
690,222,573 *474BE7CB80DB2B441A99198D0A5528F539F24015 dick 'smitty'
690,222,574 *4740EA7F1229595A8D0135C380E45F25BB86204C [email protected]
690,222,575 *47468DAF1593FD4D1FC982F320B123E962A7DAE1 [email protected]
690,222,576 *474E6FB5DA9FB4F7DEDB58CA65F195DEF4121AC8 DISINFECTERED
690,222,577 *4749E4BC70E2E8D78055D8204A78390B98900629 [email protected]
690,222,578 *4747CDC61BF2E658A1AA3B1863BC0281828F11F8 distichodus-teugelsi
690,222,579 *474FCC922273C7691DFC71EE92BC6C55BCB77AFC djcvu
690,222,580 *47490D217E361DD403531E9E3E88DF3EEF068C33 DKJA6
690,222,581 *474F54E54013CE2C1622A71246792167FC8E49A3 dl6m&
690,222,582 *474CDFC9A3170D1A153D43E8427F69E3A54FEFE8 DN18773
690,222,583 *4744D84B5A166DCD3911D07BD7C4E5B401538387 d$nc3
690,222,584 *4748F404D7D1C7FF64EC3873E0090888CB858426 DONA MARIA SOLTA MEU PINTO
690,222,585 *474F9E698FC779BECD0484024965C06B4761527B doortjes2
690,222,586 *4740068BE020794A0BB3686B96897F0879DF8EA9 DOUBLE_TAKE
690,222,587 *474E245DDAD4573F6F8D7B19242CDADCC8CF40D3 DOUGLASMCRORIE
690,222,588 *47448E0C833BDC66220B769716FF03522D6640E6 d!p10m47$
690,222,589 *474589EBD0E2D11B46F708270FCE5D7F16F9CEDE DPD=A
690,222,590 *47438DBBDB7F9AC797D9D95F8AFD8E15496EFB4C ds!f
690,222,591 *474C80C0F9A04ECF9358B25679BE37EBB2B4DD81 DUANE.SHISLER
690,222,592 *474544BDE53808768F95551A1AE239D07BA02CCC dudleyjestis
690,222,593 *474D7EF747FFB9647F16CF8C3325DB0C1DCE452A duermete.mi.ni
690,222,594 *474D3CE8EEFF989A389181707E1114011DC9C1B2 [email protected]
690,222,595 *474F9F499D1688B67803ED65A3C1094CA1CD05A6 dugn"
690,222,596 *474173CC6928FC0D99F689168C19D6C4B49CFA17 DUMPER
690,222,597 *474A0B2C704C94B48108C0E23273E6A96BB4DAAE DVLA:
690,222,598 *474AB1C80E6CD454770B60BF31BFE093725C14EA dw)xr
690,222,599 *47414EE4A94E4D72B5E0CDDED0D6074882AC11C8 [email protected]
690,222,600 *474855552829638B9927FE3657884833C4915711 DZNDSCHNN7
690,222,601 *474C4EDD363532B5424F2D5D9082D0625415D4EC EAB;3
690,222,602 *4742A2C2E64C3C5CBD6F93CDC4F0EC40D04B7BF7 EETTERUE4
690,222,603 *474B091D9780A04C64ED51D442F5D30BAD312D37 E+F
690,222,604 *474A93FA6967EF915C1AE17F47C35DE2055B8A99 ELEKTROG4
690,222,605 *4748CDD4836220DFAB9080CE4E9F5B5A76ADA8C4 ELIBIRRET0
690,222,606 *474350091BB8C5DB66D030DDCA6128430B36EB9C ELI.DSAACHS
690,222,607 *4742D84EA6142B22721CD586521A795B221B388E ELLEUTIVOS
690,222,608 *4747EBE05099955F71E581DB512E48D84585D5F3 elliottcoultas
690,222,609 *474DED1126379BEF9A436C0FE3F3548792FDB04C ELLSWORTH.CHUI
690,222,610 *4745CE27F3F09F7BE142FE273F1EBA69A2221C9A elmer-halili
690,222,611 *4743B00457E79625BF608A26734AB5B7300EDD11 elwu%
690,222,612 *4745A362AA821DB141D5B8815F85524D886D1788 EMERSONAPPELING
690,222,613 *4740DA5B6380E57845066BA908CE4265256665A4 EN<@
690,222,614 *474FFBB344E2D08DA0C4A66717EC9840E408EC8A entrobliger5
690,222,615 *474B5E57E12BA422FCE47BCF4D94BF3A06D25142 eprgcbsw0
690,222,616 *474065350B54F56C16CD1FC314CA454030F12824 er(40
690,222,617 *474CA05EA43E7A9F9A0664D560C6E983CA340B8D eranoisn6
690,222,618 *474607D7F30D9A1C1DA8B727FE2EC6A2FF4BE14F ERICK.BROADAWAY
690,222,619 *4744BC85B6B46D9F3CE04B41039FDC809B1C79F4 erielto1
690,222,620 *474C313C4253DF4CD96D5C0A96C0678002F99BC7 esgds
690,222,621 *4748A79B3B0536A65C8A3C7841982B025D8AA8E3 esy9a
690,222,622 *474248C9A1F74F9BA98DFA9A7312746AC5AF7967 ETAKW
690,222,623 *47441B127D30E26A394ED79DDAB12F92FF8686DB EUGENIOMIRON
690,222,624 *4740CA6414F403C5094C388F82E27A2B890F694B evenving1
690,222,625 *4744CE5E20E645E80E09762245DEEB53479E1E24 ezequieldanley
690,222,626 *47474324B1A5CDDFEBA3FB63A4773E6441F21671 fabiancifuentes
690,222,627 *4749E226077704185B2E770E986426AAD0C4045F fanfare for the conscious man
690,222,628 *47421B15605FC7354E4F0F84CD9DA8E6F9FDD222 FELICIA-CORREA
690,222,629 *47479028843A7DEA9DE58194314007250A0732C6 FELIPE.BONNES
690,222,630 *474EEA43CD6DFD8CC2F420CF06D66D3C30C5278A FELIPE.HUPPE
690,222,631 *47451C16BA4AB1A618AECAAC29B58F87E9E9FC47 [email protected]
690,222,632 *474944FFB6C72575E27112CE5D02A52A1F89A9AB FERDINAND TAMAYO
690,222,633 *474E3F773D4890EBA64582ED41988E21EE3264AA FFFDERBY5
690,222,634 *47400F2C7923B80DAAF4DB30FF36089E31F26ABC Fidelio:ActI,SceneII."Marsch"
690,222,635 *4742B8D92593EF793927B9FBE7AA76FBD6D5715A fiscalizing3
690,222,636 *474E8A784F37ACEA08BFBF67E4F55F96560AA5EF fohlen234
690,222,637 *4748FAE4C4F1592D29244D4D226071A12882E814 franciscofitting
690,222,638 *47416BA44E8A353ED9CBF92980D008C4B3536E4D FRANKLINPAPSTEIN
690,222,639 *474F79938271AAF7EB396EAFE9B49F4CBDC4F18D FRANK.PERU
690,222,640 *474A8EE0EF9DAE3720E3912BA262A5F9C4AECCB9 FREDDYNADEL
690,222,641 *4742F33532BD1E963408C106B5F340D2B35587E2 fredericjansky
690,222,642 *4743FBF4C34550F9DBC5F03CFFC8D6F5135CD358 fredericleddon
690,222,643 *474ED031F762C7E2DA98D8A3C80A68F346BDADE5 F!SHFACE
690,222,644 *47409BB138D646B4EE4B0D49E9D56C38493BDF4F funny-woman
690,222,645 *474A5B88636C6CD49762DD54AA66446E6FBA9E20 fy\g
690,222,646 *4741CDB202631D7F2CBC0BD9B882B91EA719B303 G4L0P4RT331
690,222,647 *474AB0EA859A67D1D58E1870D301F2362D211F72 GA11MAUFR3$
690,222,648 *4740B30444C9B935DB087F6622B1629B72263D10 GARFIELD.EASTERWOOD
690,222,649 *4740914702AECE30065D51125A1FB114DA2D896D garfieldsciabica
690,222,650 *474524891DA24365A0CE9A7B62F6277E49EB18F4 GARRETPRAGER
690,222,651 *474A1FFC45D2CBAD9B79E440214C339DCCA505BD gastonstathes
690,222,652 *474E1328B9D4D939C657DCAA2AC18C8736D418C0 GBNPAA
690,222,653 *474A794C847C0424CDE54C03E647E5D591EC70B0 [email protected]
690,222,654 *474139DA82BD665FE996934C6435D3DB31F9275F gilhalsted
690,222,655 *4747557F9DF3D70F7D0478BD152CE5790068BFFF ginolaorange
690,222,656 *474917638A189A1855E84C0CCC8140B5DAD3394C girdadema
690,222,657 *4740B184C6DC5ECEE8450ACEA8E90977EE47358F [email protected]
690,222,658 *4747D6F3B0BD1A9AD8892F6B64013241B04765AD [email protected]
690,222,659 *474FFFC07BF4C4545032DADCD4924FE902807A28 graiggilomen
690,222,660 *4742ECB580E9604FA2890B782E4305A1B5170DD3 GREENP292
690,222,661 *474D3DB767489F7AC08E62670178CAE5CED43082 GREGG.PATTENGALE
690,222,662 *474BF5408668A56C319C775C35DB6D243BBD824C grumpily
690,222,663 *47431B07F04D793DFD472BD2351AE9D6A316808D h3!0
690,222,664 *474C885D4D5081F687F5806A62B327B476C1040F HARJANTEELTA
690,222,665 *4748CB6E0BA535B25ED33B240600007DBA234AFC harrygadson
690,222,666 *474962E1F1099E1CA2BECBA332602AFC36C2EFCE HASGOLD1234
690,222,667 *474681AE8DF64C3DAA63D6C038CD3302051EB718 hashedrehashed
690,222,668 *4746F0BA7128E4EAE239E0A768F6BCE57026D2F4 hau9h7n3$$
690,222,669 *4742BEBFCAD932CC8444A9B8B190DB6063818064 herbert|
690,222,670 *4744E476B97B0CC6CD6C96400D18F64CE52B3ADD hette."p}.science.fictiontidskriften.Der.Leuchtturm".
690,222,671 *4744B388486F0A05770B7A7AEEA2A04F68F4F58D HF;<
690,222,672 *474770A4999BCEFD2EA5EBF4198608B297D908F4 HILTON.URRY
690,222,673 *474B1C6AAA22AAD14778B9DCA6625BC33FC83098 HJO*
690,222,674 *474A12A8B45F6FE4DDD3E519965B75E24D56B6F3 [email protected]
690,222,675 *474CDA9766FDD02EBB4C54C1438365EC4FFFCD49 HOE.ZAL.IK.STRAKJES.DOODGAAN
690,222,676 *47487C4DFEDECC28E7EEA63B9420D713779915B2 HOLY.SPIRIT.WE.NOW.WAIT.ON.THEE.(WITH.HOLY,.HOLY,.HOLY)
690,222,677 *474048E21FC09BFDA5AAA27CFC4E1770CDB1B085 honourslist
690,222,678 *4746319019D8E7A059562584FC5FFDA2047765CF hughshikles
690,222,679 *4743676D48DFA617D12D4497D3A63EAD3C4EC024 HUNTERWIEDYK
690,222,680 *474C1EE84717F3D29A0E5C06F64B02226D8743B4 IAN.ABINA
690,222,681 *47478B276FD0FE5E2AC03E1AE3FF0385C3BC92C9 ID9208
690,222,682 *474346A8F9A9D2C59D629FEF6AED91222A3F01CB IHCIFITA5
690,222,683 *474860DB32A71F4BA870BAFAAE081AF145F62389 ilovesquash16
690,222,684 *474430100CB1994EFFC2A4B75CD30ECFF58A26B3 [email protected]
690,222,685 *4742EF4A9162F74D07B1FBDE93E99933242C5496 irg+
690,222,686 *4741508C329909856B8B488D94C30A4876AFDE24 itcamefromouterspace:thethingfollows
690,222,687 *474024F5BC71953166948DD893E193FCF34AC117 iu74
690,222,688 *4744E3BE4A5683B66DD55992DAAFFBA553C556A1 I?X7
690,222,689 *474A7EBBBD046E843AC330A7B38E10F73362267B j8p0
690,222,690 *474FFA45F4B24F579329230C6910B7AD550E897B JAIMEBACKMAN
690,222,691 *4745DB41C7726E85B5E66D4C994F26C6B896CB98 JAIZLYND
690,222,692 *4746BF7459218A0ED110716C4BE802597AB2FAAD jakeshoemaker
690,222,693 *47426E09DBD05185B7AD355A3835E11116BEA079 jaysondefrancesco
690,222,694 *474B46E7743C0637BEB8A9BFF51442E040CE6FA4 JD051313
690,222,695 *474DBD499CDE4AD9355F9DC71EB554CE179C5AC4 JEFFEREY.KETCHIE
690,222,696 *474376853C38BF9C364C74B98D820313D7449244 jenniferoverholser
690,222,697 *47498C744229F9F317B4CAD9F01BF775EF2AF27C JESSECOPENING
690,222,698 *4748BCE2A89C8CB19B298FCA945CB930929FDCCF jigbacked
690,222,699 *47425B1153EDF6240843743D41B7C02750B8A3ED [email protected]
690,222,700 *474A0A0CC76D24A08B6973F5C7F98F87320FEE63 JN652
690,222,701 *474FB1AEAE00162C90C8115603F6C833884C03C1 joepalmateer
690,222,702 *4743D7C8E5A1CE5C520C09F06286C177D4F52B8E JOESPH.LAPILIO
690,222,703 *474C3ECD13DDE157371721650927F3D6E3539C10 joeyfinnel
690,222,704 *4741C2F8A93BEE9D8CA04414EB25B73D7BE737C7 JOHANNATHORSEN
690,222,705 *4746079E052256C99566230576840258B8DDA40B johanna.wray
690,222,706 *474BA190B7C8821F29CE82714AB1090F0E0E02E5 JOJOPOLO3
690,222,707 *4744FFCE1FE2C499F5535B8EAB9381B61BE6F2C2 JONASTREIDER
690,222,708 *474FAF9EBEA8D64479FC339387923C0D7DECF028 JOSH.BUTZEN
690,222,709 *4744E8870B4229E7AC5D49E79113D0479100091D JUCHTENS
690,222,710 *474FF5F9F6C5944BDFE049768B5BA344EB5731DF JUDENATALE
690,222,711 *4747211DD61087EA8B20CE71977F10BB5FDB2405 JULIANHAMMERSTEIN
690,222,712 *4740A487BA4F081AD408EE6F41C2ABA850FB18B3 julianschoggen
690,222,713 *47431270D73C0F6EDA34505C5EB64813AE48BD19 justinreistad
690,222,714 *47402B8F78E54F6F407D950B337778A1A3BE548B JYUKUTI7
690,222,715 *474FA1E43B9C9D95BC555610BF75894787C3400C KALVENE
690,222,716 *474BC6B653862DF86C9516EAA86F5A763608147D kannahme
690,222,717 *4743194CCADAD5DDE0D2503E96531B706C1D246F KARLY9
690,222,718 *4742160588F5E73B5A3E19BA1AD96150632764EB kathleen-gibbs
690,222,719 *474A91FA065C09A614FDFDF18C60E694EAB016C5 KATHYNAT8
690,222,720 *47481AF377727E691BF23C17B3A3CC6B7553F2A3 KAZE.GA.FUKU.OKA.(ORIGINAL.KARAOKE)
690,222,721 *4742AEBB9667DF3DF687EED202E386D41011A42C KEENAN.SALVADORE
690,222,722 *474BE77CC32B8644892D6CFDAAEF4D451461A896 KENETH.SHESKEY
690,222,723 *47476C4C6F022C2940FDD4A539FC94CFBA6E6FC7 KENNITH.PROULX
690,222,724 *47415C62472FE8B5DCDC299A5A17A4882B67AC80 kepering
690,222,725 *4742F1BE60AB255A3AF54ADE617187EFA66BEF79 KIP.GLAZA
690,222,726 *474CBFF3EFCC8307D7D89D290B9F8E5234FFFEA8 KLAVERENBOER
690,222,727 *4745EE88E76F22ACA2EC6E8F7091594249E3DE4E KWITBSW1
690,222,728 *474E033314775F133162AAD2E42B223C885F8E7D [email protected]
690,222,729 *474C7349739DD2BA57BE468DD161ADD83BCA2283 [email protected]
690,222,730 *47403ACF6355D0A6A9FA97AF99E27DAC967D5C95 LANDESRATH
690,222,731 *4745217EB956A63AED01FCDE38DE56C28C7FBE06 lapriest6
690,222,732 *474F396B415CEAB4FC90488D34CE8B0790DB2DCA laurencemeads
690,222,733 *474C46BD6273332E73BD629E24FC4BCB02F0080C Learn Italian III Readings 18
690,222,734 *4743E529EE9CB2C577345AA41CB3E620B0EC71FF LECHTIVI5
690,222,735 *4741A23CF811448B57E0E818928E2ABB004B99F4 LEENFANT
690,222,736 *4743778A55B8F565C0D36A3A4CF9DEDFC9C55677 leepomroy
690,222,737 *474F47A7A4E8C7C160FBFE649511288768ECEB62 LENARDCULP
690,222,738 *4747771CCB8A6D4CF25BBA48727E0BC5FB92691B levirussomano
690,222,739 *474C16DF2FF29AD7C0063D19000B19186AD265F5 [email protected]
690,222,740 *4743F42AC9CC24FBCC9F83E443FB78975DFB9970 LIENHART3
690,222,741 *4746855F1FE4FEA05E6F1303081920C9FF677FF8 [email protected]
690,222,742 *474E8A563F4BEEF110B8E494F7D6BE1941870407 [email protected]
690,222,743 *474AAA1A7924824B4F9ADA423154AE3CCE58F0FC [email protected]
690,222,744 *474D164DBA0BA6B54CEC98558E29649A2551B920 linodhein
690,222,745 *474BAAB2965D36DEA9C4E868B25829DCDBBF610B lionelwhelan
690,222,746 *4748B361C40053CD7A00E80D7717DF9168246BC4 [email protected]
690,222,747 *474D12B87204EA2B0327D15C33D13E44CF7FBD82 LJUBEHRSAHIOL
690,222,748 *47439A245F74FC46A40E0A440DB5C3151F4A5F56 LLOUGUÍS
690,222,749 *4749B009279929BEA24A306D211746526E99D133 lloydaereoboliviano
690,222,750 *474A74B372C258E8B27AC892CAC85F7C8FB2EC98 lloydmorten
690,222,751 *47415B75BB7F2AEBD0694C693712274BB0562F38 LOGWOOD
690,222,752 *47436A02C0F8D24EBBBD753B599A40197579278E lynn1961
690,222,753 *4742578729DFAB2C3C2797E11FFB5E02EF4458D8 M9\,
690,222,754 *474B0BAC61EA0F7BEAFDE14DFE3C97A56B04A663 MADĀRIJ
690,222,755 *474239EEC66C2FF70F4FB4E49349F705777F2112 maimaka0
690,222,756 *4744E630F01088C36DA8A4077448A56A80669967 MALE-MASTURBATION-IS-PERMISSIBLE-IN-SPECIAL-CIRCUMSTANCES.
690,222,757 *474FB3CD9B03E19239DD1D093E61019253E28BB6 MALLEŎLUS
690,222,758 *47437B44CBEE6E6C402D2ACFE23D74CEFBD66268 [email protected]
690,222,759 *474A6941104E221AD430ED6923461F576F068EF9 marcelinomeise
690,222,760 *474361C2551A4F1C655C1D154F2179F4FBBED902 MARCELWAUER
690,222,761 *47475CF8C5D6B2EC1F215943651DF9952E55F123 marco.vermeer
690,222,762 *474E042C861B8A0F1BF522A4CA2D07B818976340 MARC.ZUCKERBERG
690,222,763 *474C03E8F639B287281B1F82748C04122BB87BF8 MARI7RYO4
690,222,764 *474C25C446EC6F5600E168E226ED6B5490F04208 [email protected]
690,222,765 *474EC534187408CA8C825188166383E08EF69BEC MEDIC-KATE
690,222,766 *47413022CE0F1D5B6F5B79E9C7BC488F98A037BC meetingandbirthdayparty2
690,222,767 *47433FC88DBB48266701EED02B108ADD19E54475 mergelachtig9
690,222,768 *474F29163CCDF3BFC44FC31A89B4BE7B82FFF686 MFARSOUN
690,222,769 *474DD723EAA81ADFE9AD35663679B9748674D699 micahderting
690,222,770 *4749E3C8126B63B91FC6578AD6344A9EDC1959CF MICHALBASKET
690,222,771 *4744EB1802E919AABA4A484472854B689C2BD6D3 MIKE-MCGEOUGH
690,222,772 *474CE9AA972AE826969B7C0340A5CC1543DE25FB milfperv
690,222,773 *47491FBD24ECD56DEAA5F4F08C993E5C3E7A2EE0 [email protected]
690,222,774 *47446CA8A1F71014E13313C0E87958DEDF3CB7E1 miskiah0
690,222,775 *4741135ED16B5DB5869FBA501FAFFF1740992BBE MOHAMMED-RAYYAN
690,222,776 *47402F61C612DF96BE81C971171C88A98669F616 [email protected]
690,222,777 *47450F02B37ACDB2605967FDBA9571EE89569D91 [email protected]
690,222,778 *4747E5A448199008A872C6A804DAE0AA367D81C4 MRCHERYL5
690,222,779 *4748C69AB8EB1CF4EDB5411DC5391BFE45EDE619 MSCATR
690,222,780 *474BD7B60EDDDE5F7288D304D3B083052C3D4B78 MSWAHIE
690,222,781 *474E256D1946A2D439FF7E60537DDAE54A435793 [email protected]
690,222,782 *47448F22BCF35CC89AB20999AA941238FC1A5879 MYDELIVER04
690,222,783 *474913910163AD22D6809DAD3E15E6F10EE82152 myxopodia0
690,222,784 *4743615D9A237A6CD8F1000849F47910C029958D NAIMARKTHEOREM
690,222,785 *47470D2DEA832CDF23EBF060AD2B387C6008BA50 NAISHAZUNAIDA
690,222,786 *474D43AC4E66C77726C23D4C72C1EFB95AC051E6 namruts5
690,222,787 *474E0BA097A6ED065B253152E5F89933657F8017 NAPOLI VARIATIONS (HERMAN BELLSTEDT)
690,222,788 *47412D7C7B99D627C8BD89D497AB66F0CB5B92D3 NATASHAKONCEWICZ
690,222,789 *474D2E5E502342454F798D9F90A42065BE9CC7B6 NBEZAULT
690,222,790 *474B6B717144ED6B43E6DE4DEFD311EF0634DA57 NCEADER
690,222,791 *474D8152B452C00F3153F86AA119036C3C0630C7 necessidade
690,222,792 *4749EBE7ABBE10931AE22EF1CD5592EFC3561C4E NEILMECKLER
690,222,793 *474A15CF37AF68ED0E24A93D3235A7CAF429199E nekeozfa2
690,222,794 *474F7D89CD7253B6D4329FC7F1788B33DB29B857 neoclassicist?
690,222,795 *47419E2D46CFF0B936998522522DDDDF3717276F nguyetted
690,222,796 *474BAAF1607FAC4A85047E79AF20DC281BC68243 [email protected]
690,222,797 *474884B32A6A6322C5B0E400DD04C7CBBC366831 nondegradings
690,222,798 *4749272DD5B1C605E525F36DD8374C93631A07F4 NORBERTZEIER
690,222,799 *474CC72B1B2CDCFA15E3EDE66FE04B93C5E6E04F NOT-MONTH-OLD
690,222,800 *474341C2AFE3DDAA72C50C504BC4E8CD795A011C NUMBERSMCMASTER
690,222,801 *474819005614EFEE20F95D466105A5711625761A NUTMEATS
690,222,802 *474EB024CCA770F7E101F2DDA409669B113D57A9 OF74
690,222,803 *4746735AD72F2E4A3FCF52570442AA0766D7ED3D OQUEDAD7
690,222,804 *474DABE11112630429CA19A255CFC98054985BBB organisationskommitténs
690,222,805 *4744F42FD321B214F87DAA1CCE460C7EC8E8BA93 otello:unavelaunavelaesultate
690,222,806 *474A38C362458FD1DC0CE3FBA2A87A2F46266BD8 OTHERSWHICH
690,222,807 *47498F6F4B753D48B7C563FF3045552B659363A2 OTIS.TRACE
690,222,808 *474E7DEC954C7C04439BCD9B800D373786861DBA OVEREXCITABLIES
690,222,809 *4743452228E41CFF8110389C51A1BD9D94BE39B7 P114750
690,222,810 *47488DADF2E83E801FA210A59B271321CD547F6C P4P3RW31GH+5
690,222,811 *474BE511B30F60EB12E449A14BE64B1ADC9B1883 [email protected]
690,222,812 *474B7504AAAB4C7CE7127E59D87971CEDE26D904 PARADISE-(FEAT.-ALYSHA)
690,222,813 *4746FB8E95CE4017F056AE9801252F712B01E42B pasusvys1
690,222,814 *4743635430823FA47C71C3D22CB9C69001752006 paul-golub
690,222,815 *4748245C5064DCFBC56A5157AE9B022B893269BB P=B~0~O)8(
690,222,816 *474E28067D0B8283FC2849E379D5FD5C59193C70 [email protected]
690,222,817 *4747CEE69AB036BED5D2215DE4E19F1DF601F9D1 PETALOIDAL1
690,222,818 *4742D51C7B19168018773491882821916755A582 PETIVERI2
690,222,819 *474705EFE3B6AA3F10E0E805C92E07B816FFA789 P$EUDOC1A$$!C
690,222,820 *4747F1AAD4A19E8237B12B732111CCC204467A59 philosophister3
690,222,821 *474837C51F4D3B0DC6F69410332F6AFF249DFF47 PISè
690,222,822 *47485B30162B88147B4FED6346FB637907217AF0 PLAGIARISMDETECTION
690,222,823 *4744320AE25FE349C6ADA5ECF014EB98670E6629 PMHNYV
690,222,824 *47417EB361B50208037774D8949127ADF7FFD27A Portage
690,222,825 *4747BA4E5AFD84C3960A254D53DEF7AA0C9A85F3 POVWERE
690,222,826 *474B1A5B683BC9E32CB8744FE659EEEB2B09AFAD PRIVATETUBAS
690,222,827 *474474E50EA91ADFF8C2B7F854B9CC0502CA908E [email protected]
690,222,828 *474A9C4171A2D09E4A0BA58ED452A65F3CAC7605 PROSPAIN5
690,222,829 *474565C3FDDF06FE071F66617120934432D1FB0E putterer8
690,222,830 *474A0D12CBF29B3719EDCA305973FEDA14D9E623 qa93abef
690,222,831 *474F5ADEF0F6F82122860273EA309F3C717C1382 Q-D.~O3B<-
690,222,832 *4746990FE0FA1DCF16A3A2151F0BE9ECA1B6C0CF QEONAA
690,222,833 *474DF9E26591905EF7D24C19F54867CC7B093B35 [email protected]
690,222,834 *4744D1DF3B29F80E49ED45D74A31CC428F124546 [email protected]
690,222,835 *4744C1720D857DE8CBF955CDF9274C13F9FB5B62 [email protected]
690,222,836 *474D97565D8DFA65DA6A32D210B5C2C3BD91EA98 q----)~O(>_<)
690,222,837 *474FFEE1F35FC9F9B54219FA7C0980CB2F015982 qua
690,222,838 *4749AB0F970C2F3AC5337003A0F3F8DC3FD886E5 QUINN.GONZALES
690,222,839 *474CA61379F738EA25741A94CAB9A6A05F2630AF QUINN.PAROLARI
690,222,840 *474CBACE44BD4011EDD757B894852FC9B70A5009 QUINTON.SWILLING
690,222,841 *474EE0865FE88C932C4C07D26A67518F181DECD4 r0lles
690,222,842 *474776A8BFD8C1FCF3E6F29FEFBBE06D6C980EFC raigrah
690,222,843 *474D275DC8B87A9A4DED63F66234215FB490CF39 randolphzuch
690,222,844 *4744559FB4A89E266CF837AE02EAF93C865D842C RANDYBOYSEN
690,222,845 *474239F01F035489AD65A5B83C000E9BA6D5F38D RASHAD.MILLEN
690,222,846 *47461D975B3F0E4F670277F3E35E34C2C58864E8 rchplgses
690,222,847 *474724FEA820D4E60E6AE19D96F9314EF1D5446F ready.for.this.(feat..nanchang.nancy)
690,222,848 *4741B0EBE9A9FF7F68FA9A1FD14C8183667AFC48 REDÉCOUPAGE »
690,222,849 *474B39B4A5FCFD342EBD41F4B08EA169761FACBB Redouterais
690,222,850 *4742F7F142AF3653A046E938CBDA34638451F043 re-formation2
690,222,851 *474CC2FA939ADBC641DD7DDB1F37B59371F3EC3A REINFLUE7
690,222,852 *47439B23B9854417E55B82104DB2AEA8457AF48F REMIXLAND.2006,.VOLUME.11
690,222,853 *474C2A1D4742AD1F6E3D4380CD0A281FC0A16A72 REPUGNEMOS7
690,222,854 *47447D932613C2CFDE30F1C3CA93850CB59BBDB4 retllehs
690,222,855 *474E5032BACF95E08A51E36D4FD3EAE15C299005 RGONNTESING
690,222,856 *474CFB7B8D8C800481BE92B6701149847B5E337D RGZ{
690,222,857 *474A0995C6F1A7F9A2D74D8BD76A5EB0BEAA26C0 R^HJ
690,222,858 *4741806F82669BFA3058733D68469D316FFDFD40 RICH.YEDINAK
690,222,859 *4741570EF3B5DD352C37924529D0D51A2FDDA2A8 RICKYKLEES
690,222,860 *474C1C4BFE11AB94A3EA9A2BDF22EF0804D117C1 RIEUSE": II ADAGIO MAESTOSO
690,222,861 *474A657F92405E6E8AC48EDE9E8C39652D7AD531 [email protected]
690,222,862 *4743481E5FF1E7363D98B7DE790972C20F5C0578 RIOREREZ.
690,222,863 *474FAD7CE1494493CA86EC083DD86B15C8F4A01C rnrosa-(om-palmemordet)
690,222,864 *47434C93EBD696C92FF284398C1AF262028EDCD4 ROATS
690,222,865 *474B1DD2DFE42E8600409B168912EC910FBE652E ROBOTSUBMARINE2
690,222,866 *474BB10BC819C4578385B661AB19D547249BF895 roderickbeardon
690,222,867 *4748ECF712C0F84D680FDDF112CD5CE4B4AAA0D2 rodrigocooperwood
690,222,868 *474A06DD4B99B7E5A805B0F45A485475E20A7071 ROGELIO.ZARYCKI
690,222,869 *4741B2B6B0ED3F1D56D7E6294D7C8F96ED5D1A38 ROMI-PARMAR
690,222,870 *474C632A2F14BEAC0688BC7DC2710D29EE2E1AF1 ROSENDOHARLSTON
690,222,871 *474F1D002F7E799817B2406958D58E2D6B4A4C0B ROYCEPANNONE
690,222,872 *47489D2B2020A35C4F16183FF7350F551543C2FE RPBLCNSM5
690,222,873 *47418D671C1B6503AEFD4661CC33DA5507360CEE RSER2010
690,222,874 *47455F355065E31223E50582ADF34E2F63A91DD2 RUPERT.SNELLGROVE
690,222,875 *474B6C46F8BCF093A9355D1CC5D6DE0D55423BF9 RUSTY.LAMOREAU
690,222,876 *474A059F25BA8DC51A61ADE95229D941B6F1811C RUSTYMUMME
690,222,877 *474A1887C5306D3A996C5954C1C1AD894D239D56 RUSTY.MUNKS
690,222,878 *4745A4FF63DADF5A0132D71EE4CECC14466AD17E RWMLXNDY43
690,222,879 *47436E164A8F54CCC8B3C871E973F05596A1D6CB SAEVIVERITISQU
690,222,880 *4745919FC0FA8F1DE1D751D56A0601C7D7283617 SAPPHIRECOSMOS7
690,222,881 *474FBCD790584ABFE894D1F538F4BA9C726A9A80 SARAHMARGARET4
690,222,882 *4749CA0F6B0891FBEE1651F0549F8BA440278C84 SARASARALOCA
690,222,883 *4749A0880D6DC4D72EE2D052A1E06B03ABFCB8F9 sarsippiusbsw
690,222,884 *474EEB21F76FFF80C529E3F8C84FE855F1DA9CF0 SASHARAYMOND1
690,222,885 *47463E49720980CA5FF43194DEDFD35E3C55BC89 SATENDERRANA
690,222,886 *474A6647DF9E6CBCDDDD06FE2EA11761BE40CFB3 SCHATZAN6
690,222,887 *474E5693CFD8CDB479A2F5299467B460B44F49E4 [email protected]
690,222,888 *4749E610570FAA9FBEEDF81D5B13FF3943278AA3 SEANBRIAN7
690,222,889 *4747EC856D306CCBB3222F219ED1B0E0E8B21E34 sebastianeusebio
690,222,890 *474F726B79E3C80D24133EBBF8C3015C567755FF SEEFAHRERSERIEN
690,222,891 *4749B232F18D9A34878FCECC840BDF18F694F2BD SEIPPUPOTNOROT
690,222,892 *47474ECC8F60A38073E10833CFCFB88FCF6870AF SELFLESS
690,222,893 *474D2FAE78BD218E45CD6B19B03C58725EF48E53 SESLOCARAC
690,222,894 *4746634DE115D777613BA7E759A4FF0F47A7333D SETIAWANJODI
690,222,895 *474AF4292251C23F0642D24F41B2D371C32ED1E5 settimanadiculturainternazionale
690,222,896 *4743143E4F6E0C9E039F050B805EDEA09F7CD3B2 SEXYEVON1
690,222,897 *474FA260D0AB5658DB7E2ECEAC88E14B7E10660E SHELBYBOOMER7
690,222,898 *4743CC2B1BC06634DC54C262184CAACC0B6896CC SHINPIND2
690,222,899 *474004EC6EABA7F88B7DE1DA2F7D30C2B48A5250 SHIVANI-MITTAL
690,222,900 *47464AC0209D2D2099145F29B09F8FC3142B98F8 shopsoiled.
690,222,901 *47467C7A65788260A8A64BC5FB2B140544458BE7 silas912
690,222,902 *4746D7F4A280CFEDF005D36C55FA82F9629715A2 SIMONNEAME
690,222,903 *474727836CF469BDBBB1FECA237B536B45FE723E simonpangallo
690,222,904 *474EA2754853220F86474266129F3CEE29405457 ‘singada
690,222,905 *4746AF2BE79B39E66C096667AA733E42441BCBDA SMALLTIME1
690,222,906 *474B8FF7BF189EBA4D60C59368C8A9D30FF71200 SOLOŠNICKÁ
690,222,907 *474997A80465FC9D3B35AAF108E011AF0AC1269E sonatano14incminor,k457-imoltoallegro
690,222,908 *4741FE073956EA98629723D45FDA72F000440C0D SONIA.TAVEIRA
690,222,909 *474DF113C72AB26E6F3B57256CBB0961AA413B13 sorriso7
690,222,910 *47449C4D5EA33926E6844A703E3E81EA23569A47 SPAINRUXING
690,222,911 *474B2E8D07FE7FEDFBEF2EB0CD3ECFBEB9524F1E [email protected]
690,222,912 *474270355D1DAFCC43A17EBFFD30E3E5571BEEF8 [email protected]
690,222,913 *474547E11D968736713FE0C82F6706D73FF9F63F SSORCSSIRC7
690,222,914 *47429E6B203729C431F776075AD6AAF093BAC34D STACEYANTHONY
690,222,915 *47458DC5D55B1BC86122AC675AA6523A68F38CDA STANDESAMTLICHE
690,222,916 *4746FC219FDADEABB8DB9CE12E1E70EA2DEF147C STEERINGH9
690,222,917 *47492324904BF9A5C64EFB1BCA010CA4660973E0 STEPHAN.WHITEWATER
690,222,918 *474BE49A45C31E57EEFDD5E9DC389696CD5F06BE steven-rehder
690,222,919 *47415B42536990CF6FE5A432BF06F0967AFD6B52 [email protected]
690,222,920 *47433BBF56E4EE9F9EC1DD78ED014D18FBC73E0B STOPTOLOVEREMIX(MARCUSMILLERMIX)
690,222,921 *4740221684711FFFD02F01B9D5ADCD4CF8FFDEC1 STRIKTEM6
690,222,922 *4742E8E5EE2637A16E0029845C49D1FDC7704B5F SUBIROTXET
690,222,923 *4746B776B676FBB2CCEED6E265690EF9E3A677AF SUBLICENSEESES
690,222,924 *4743FA326FD7DD768FFBE80E5789CF5466183CD2 sungduval
690,222,925 *4744186AE0C96A76B0ED9C8EED12D845FA0E5DA6 [email protected]
690,222,926 *474A91B12FD3E5467E8845AE3FD5718074F60AAD suoirujn4
690,222,927 *47429837D73117475FD602129EC9818C5DECAB4E SUZY.PATERSON
690,222,928 *4748758382B8024385564571348F03BDB7837337 ŠVEDOVAS
690,222,929 *474BC453648250267889D60F4AA8A60253A32EFD swbp
690,222,930 *474530BB06DCF5509217DFB007C135967C6799B5 [email protected]
690,222,931 *474B06590104E3E4A350C91828DE367CD33E0F48 TA`_
690,222,932 *474690A7B80BC5DA46A12E207FC82C7CBD780DE0 TAD.HUGGER
690,222,933 *474D3F0A28FBE92997F64DD40C3E2531EB25034B take.a.look.at.yourself.(acoustic.version)
690,222,934 *474BB6521D74E2792A97F5467ABC1BA272195788 TALKHATAMAR
690,222,935 *4740A2A6591845557A09E2EA4BDF75B960282F99 TAXASBSW
690,222,936 *47462FCC665B97B8523F811EB54331F4FE73FF8F TEDPIXLEY
690,222,937 *474C33154B90D2942F60E3FC44E7F30F9972957E TERRANCE.SPERLING
690,222,938 *474E4F15D32284E7D244E9FF8C06DA455734B968 TGITIEZ2
690,222,939 *47469F43606C5F378F313224E0B4CE292D9AFC05 THAD.ELLEGOOD
690,222,940 *474EABD0F7328879A6F5D1C7171BB96984733655 THANH.FROSCH
690,222,941 *474BEA962278EB9E13A87CC82A3FA8DFDE4C1E25 thanhmajid
690,222,942 *4749EBFD515388F3916D494E3C7A76FE5D8553C1 THATBRONTE24
690,222,943 *474DA5A26B0B4D8248731BDEEA7A7A2037E90940 theartofamericanfootball(live)
690,222,944 *474E3D093BD56A556CD6EF4DA6228CD67A72DA4D the.secret.service.is.best.known.for.its.primary
690,222,945 *474C7FB212378711FACB6EDBEEBC8F3EFDEDDF91 THOSE OPENING HOURS
690,222,946 *474DAA81F5E1944E7D5C34983EE02A71FB4DF631 THOUGHTS-&-WORDS
690,222,947 *47428158B9758289ED38CD3A4A4CDFD2320461B8 TINTINTRICIA5
690,222,948 *4749608E5EBDF1437277D27A81E7CD0B9A26C6B9 TIRRENAS
690,222,949 *4747FC2C2DE37D7452EA90946D45EC5708171E23 TNEMELBACIRTXENI3
690,222,950 *474D95C482E70E461CBBD9AD07F96F292D5B0147 tommydesrosier
690,222,951 *4747FFF6915A0BC939D24D6598D90B77095FCD5E Too.Much.Stimulation
690,222,952 *474AEB236BBF4A6BCBEAD18D55C39159E4E2B58F TOPEESTHER
690,222,953 *474F21D8FE72D5419B252727BC136EAEB3780A15 TRAAKJIRV9
690,222,954 *474141B150C9BB72412148AA1F3F5A83A826B468 TRACEYANTWI
690,222,955 *474050B92D048BB02490237829EE878DD4A59CCE traffekmarchingdynamicsmix
690,222,956 *4748F66FF68ADBBD3E0CDFA47743857B094498B3 trans1ing
690,222,957 *474878E2C9292C833B7CC07D0C668C5172D9BFCE TRISTANMURROW
690,222,958 *4747D0F497AF9A425908A516ADF2F5D3F78E6EE9 troypaniccia
690,222,959 *474059F23B598DB080E45957A3ABAE517094F9F8 TROYSZERBIN
690,222,960 *474C819CC55F50B5FD3FD4F5654F2D529EA77227 TRUNETE9
690,222,961 *4742EEB37DA588C47347D69E5091AA22E5829908 TTALPEEK6
690,222,962 *474B7520C23606AEA33C3FA523F06F567430A127 [email protected]
690,222,963 *474D62E403550735EFAA8D24FE287CC3128D6175 TUOKIOIS7
690,222,964 *4744AFAD9CEECC03E89A96ECC67097506F9A14AD TWGHSYOWKAMYUENCOLLEGE
690,222,965 *4740E7E20F28BA5F02FC4EAF47AEE0E70925FB99 TYKUS-VAKARAS
690,222,966 *474E5B6788F7A996D9CC21E6212542781E9F822A TYLERAIRHART
690,222,967 *474BE4E91CC0B34CDA02E8F47DE2222CE288A289 UBRANEGO5
690,222,968 *47448822C0668E08437C3C716D99342A127624BA [email protected]
690,222,969 *474CB5D1FFD071BF7D239482AD2E0A730B889694 ultrafast1
690,222,970 *4747F174D1BC6F09FEF48401AD0D9A01F9C04018 UMTAUSCHAKTIONING
690,222,971 *47444D0D8255615CA533BEB05232CA6109340848 [email protected]
690,222,972 *4747B8C62A5EC2ECFE94A7ED8982BEC2E8F898C1 [email protected]$$
690,222,973 *4747D68F3FBC3865BE5245A699F665BCCA368FAC [email protected]
690,222,974 *474A30F22EB8445D013D495019BD32BF09F6DFA8 UNGOVERNABLIES9
690,222,975 *4747AAC6E6E9604F7A91F9008E8861D01BE2D89A ursurla-odkins
690,222,976 *474F781C370B2465E3A5EEC38A7EC528B9FA59A4 usagi.andreea
690,222,977 *474708BF7DC4D6D3D7050CC75BE092BFC7CC6658 [email protected]
690,222,978 *4745F88F915464698782E355F7B1838B3E891D87 uzx48nw12hgzv56tnxh38493cp
690,222,979 *4740783B9BFD3018EF3A854B84F15CE0A272065A V[5
690,222,980 *474070ACA027CBBAAD32BA49EAC97F5F3210E88F v!9!14n7ness
690,222,981 *4741AEE45F368C4729E2FF99C58ACB536CE8D435 [email protected]
690,222,982 *474DF84AFF1BB128843F10D2238D119455A4D6C5 vaerdimaengde?
690,222,983 *47435D820FACE96221C3D62F07551196D127CF14 VDB
690,222,984 *47403B30F415E1741CF2F326AEF3859615088F0F VERONICAWHOLESALE
690,222,985 *4748F971A01301F9874D71FB1A3465F30E75DE9B vie-novianto
690,222,986 *4744A75E683135BE00D2CF8155FC2D4B7C791A02 vijayalayadynastins
690,222,987 *47430F2271B657170D3A7426639CCD4F6DCA9401 vof#
690,222,988 *4745C7CDC10A79E8F77953EA3CAB16008561A7FB VURUCUTIM1
690,222,989 *4742E7DB756F6FC8C58D1025407299F3C7D41E27 W4G+4I1$
690,222,990 *474B7875B19A13613F977005A2E20E451B5A6588 WANDA.BUICE
690,222,991 *4744B07E504D28389BD1D59D8F2C356AEB635707 WARNER.MANDRELL
690,222,992 *474A8EC5EC41C4007033C183F0D02549AED1F6E1 waterstofbommen1
690,222,993 *474C48D28ABBA408D7AC79B39F9FA48E30B8D9EA [email protected]
690,222,994 *474B7AF3E587E4F4725D14CE154FBA8E7FB11DDA wendykruegergraf
690,222,995 *474241446CB6A98B87753CFF1E3B863F8790F999 [email protected]
690,222,996 *4749245AB24ED42475AED81435D28CD83209FE2F WENNYTANJUNG
690,222,997 *474BEE49A50925B4EB92E44B1630114F9C012665 [email protected]!e5t
690,222,998 *47461031B06D269318FD43C98FCFB40913A94452 WhatUHear(featZionI)
690,222,999 *4740440DE79166DC3DC070FAB05ED43AEEFBEA08 WHITNEYNICKLAW
690,223,000 *4749A6BD7BB25192A50D11D50F7ADDA4DB185A6E WILLIETROSPER
690,223,001 *474DD5576B96F008EED6D24B1F0D7FF4E05C654C wilmary-sanchez-mondesir
690,223,002 *47489D666EEB291C99BBA6CAC1494D65B68A9F24 WINFORD.PARDUHN
690,223,003 *47421C0D5BE1797B6D94FC1AA54E5B1EFE6A61E4 WOERMANNING
690,223,004 *47481BE52CE33EC0648CAB8A77A49682E47822F3 [email protected]
690,223,005 *4740248C052B5A218DE210AD347125CB170EF4A4 wwwbalancepublishingcom
690,223,006 *474066E13BA6CCFC0C1BFE560D7BA9459313C29B wwwjessicaleeviolincom
690,223,007 *4747C84CAAFA241DB686E9ED963E9FF2A36B7F59 WWWLGSCHEMISTRYORGUK
690,223,008 *47497B98C6C06129D1B683976130C80921FBFC6A [email protected]
690,223,009 *47407896B18CAD5605BC1C6AF7A85CC4A5DD4732 WYATT.BALCER
690,223,010 *474E6F67E5227DD95877255FE0126AA7B1F7166E XIAOFEICAO
690,223,011 *474942CCF8A263C08991363896CCFECE8DA25D96 xiao.pao
690,223,012 *474CD6BB2B12E51594D976FF9AC68B6DBAACC954 xrjtrzpwwyrpfl
690,223,013 *4749F3EB23D4B602340E5BE5B8B1E594CA8FFB4A yahir397
690,223,014 *474AF1C2E6C3AB8C0E3C216DB6BF41BAA8ED9C7B YAOHAROLDE
690,223,015 *474F1822ADCE87F3742CB7FEE265D8B3D92BA345 YASERAANWAR
690,223,016 *4740A2D1E52923867F4E2F296FA329CF2EAD7E53 Y^F
690,223,017 *4744EBDC097BB0CA6E0121A297D0EBBF06C0881B yolandaledesma
690,223,018 *474A54B87B941C92848CE56C4879363E3D71AFD8 YOSHIMIインタビュー
690,223,019 *47491469225C94C9322C60FA1E632C6A6246EDDF YOUGIVESOAPABADNAME
690,223,020 *474B72F1AFA6D20B2A53B9ED83721D53599640AD YSTOBRIGA2
690,223,021 *4741899C4D78B0207C0FB91D66387DE1B08F501D yves-daubert
690,223,022 *474C89AC777084C400945A63369F612C6BCD2A7B zach-yeschick
690,223,023 *47461A0A804EC3C149E996A06336FBBA281B1731 ZACK.BIANGO
690,223,024 *4747903930B7013EF7115E2AB036609064647355 ZANBAIG
690,223,025 *4743256698A9EBFF146CFA9EF618C320C1E6F4AB zaneferlenda
690,223,026 *47446252A73988E82597365A5D8447FDE6A94F71 [email protected]
690,223,027 *47485D6ECBF0F2DE057B60557A10E80FBA2A7AEB ZBFUVUY4
690,223,028 *474EE5787B66B1B0D3CBE77DA9CBAA04A17F7316 ZBIERALA
690,223,029 *4749547BEDD300F422F26582705DB27EED265FA9 ZELARIAM
690,223,030 *4740A53DD6D2445CA85F43E3E0A507842E803382 Z;<H
690,223,031 *4741321181865D3166E1FF627312DE341730B72E zhamnil
690,223,032 *474DE803BA750845D2E93A2E43F3F9C0E4F471A9 [email protected]
690,223,033 *4740EF71B48F20E26175A7B95BA9CA2692E19B43 ZIBUYILENENE
690,223,034 *474686B2BE13DE8DF067EC9A03C6B44521B061D9 zisii
690,223,035 *474EE7DF77CA37BFAFA37A5771D65960F5124834 ZLITAREN0
690,223,036 *474CEC82A3CA4778864F15F555AC8E0ADCA3D97A Z"N
690,223,037 *474C38B0B804FA0D8DD62068EF8625AF4EEEC21F ζενγκ
690,223,038 *4745F04E85BA018E3206CC33A7C41362E93971D1 ІБЕРІЮ
690,223,039 *474F63425D56AF9D71A7E4BE07CF304FDA6CFD0B КPІМ
690,223,040 *4746807853EA91D362188715A59C7D3FF7078F51 МОНАРХИСКИТЕ
690,223,041 *474698D230BC7BC4D4A1081FECB09351339DDD8B СТЭЙВОМ
690,223,042 *4747F7A1AF0FCF212CEB800D4D8BBFAADB5DF282 ЭТЕЛЕРА
690,223,043 *4745F2FBC747279786306A910E478D9E454C9E83 サウンド・プロデューサーに萩原健太を迎えたアルバム『MORE
690,223,044 *474FD74901D8CC405A9CCC58117CEBF879AD154C 0ILUVFIRE6
690,223,045 *474F47439ED475A1CD340661CAA6E469DB51A109 1011601
690,223,046 *4748D103E17DE3279F1E16BE25CCEBFC82514D7A 1138769 FLASCHEN-KLIRREN-.
690,223,047 *47444141AAC5E932B7476BBAEA370CCC85720A1D 1207194 lately,though,theyhavewidenedtheirscope
690,223,048 *474D1F6D595D39EB976A7509A3E4961520FEDC0D 1445708 NICHT NUR DIE VIELEN MINEN SIND EINE GEFAHR .
690,223,049 *474323C5AE3581881B565ED463408E537DFFEAC0 1550628 GERD.TENZER.WIRD.ALS.NEUER.TELEKOMBOSS.GEHANDELT..
690,223,050 *4742EFAEC46A14AF1C9A8663B2135058CDF6C3E7 1619170 rakensimmeyhteisty
690,223,051 *4744A0CE8F4E81553C8C1E92750F0B550377A56D 18ANNOUNCER'S
690,223,052 *474CF1D7034455BB9492CA70D0770F6004973B52 1elle-ablegers
690,223,053 *474D8F8AB9D981D2CB65F1BBD2A42520D1E1FD71 1ends-which
690,223,054 *474BF0CFA0169DEB11D1DAD8DD9DF8B225E18C79 1ERSAEUFT
690,223,055 *47437D6B6A79A8144620C96B5283B4D3DDC5E9B4 1EU-TRAEUME
690,223,056 *4744F76F7BE698B52CD82FCA6E80D224BC7B74CB 1.HAVAITSIILMOJEN
690,223,057 *4748607EFBB1CDE11E3AF9B6374F79042C1CCE81 1.hierarkkiaksi
690,223,058 *474E45C055C3CA503BFC56748A7BF4A0E5AC27CD 1 HOLSBOR
690,223,059 *47459F65AE4FB563FCBAC10EDBCD567392B47996 1IAMSPOCK
690,223,060 *4747C08F0C77D6C3FD9409E0874FF7E8DA11E0F9 1INDANKER
690,223,061 *4745A69302E469EE790DA921DBC9D8FCEC11BB08 1-KEHITYSHISTORIAAN
690,223,062 *474440E19DA14DB6B44F1D9EBE4B4E162C9E9100 1.MINDERGIFTIGEN
690,223,063 *47441D748DB28F8DADA21CF26A40C63774642FC4 1pankkiiria
690,223,064 *47425A9624B3A34878C1280DA12BAE0F418A6CC3 1.physios
690,223,065 *4740424E4D9EB2A2E3474E0FE6365A08330B5E66 1POCKETPHONE
690,223,066 *4747A11F6248103A3AED3B4E87D1FED0348B08CD 1sorrells
690,223,067 *4742641F16D93D5350E6DB0EE069296FCCC80D15 1-trophy-winners
690,223,068 *47424B4D3EFE1280FF67CF6FC05744C2898D1FC4 1.usbefreier
690,223,069 *4744C387F015EBDF4BC984B881866EF0169CF6D2 1-valmistelumaratonin
690,223,070 *4743DCD2A49B58BE9B47A3B3DDA118732FDEC7D9 1VHSGESCHENKGUTSCHEINE
690,223,071 *4747D1CFDCF26E75835B0B8D5802C10C5E988CA4 2248598 the-government-is-seeking-$231-million-in-damages-
690,223,072 *474E26914903C6B734A5F7B619C4AA83B252D8B6 264749 iso.ayar.araligi.50-100.dUr..
690,223,073 *4743B98350EAB4B765D25B7186380002FB3250E5 28.07.1677
690,223,074 *474D09E256C91F053CA32E9E49636AA0AE26AA8E 2CHERBETH
690,223,075 *474DBD71749163C641786E70BDD1CE2D9CBE8F19 2-DISKUSSIONENINSTITUT
690,223,076 *474ED84A0A0266CF0F4DDB54BA6162B6019328FA 2ERSBUEMH
690,223,077 *474E072D1463FCDBD4859373FF9A4A912667390F 2FA0167
690,223,078 *4749FBF6B9335ED956F65EC1E0EB6640004E4674 2GOODDOOG
690,223,079 *474C99042DD5259698D8501C979216C579F247F0 2.koepumppausten
690,223,080 *4744D8C25673FE3299FAF6A59E0F0E28421F38EE 2seeloewenballett
690,223,081 *4742E1AA285E0DFDD0CE46BB010CC6F2A57E5E0C 2TIETOJENSAANTIOIKEUTTA
690,223,082 *4744D2A1B495EFF3AA75F69CD335762AE9E07439 2 TRAUZETTEL
690,223,083 *47422C0FE7682388EAB3E0142C1487C1A2A4952E 2TYP-BERATUNG
690,223,084 *474A451E0E5B433D025AD7D49ABE7C5310875840 2VOTAQUE
690,223,085 *4740470712A60C0108508C5C2A7A4F9C26133CA9 333333333E
690,223,086 *4747F4EDD264FC6AEF1C83532C029E5D855D6915 3DAWN4
690,223,087 *47467C3871EB7620BE0853BF3CA61C5AE412EB2D 3.kunnallistoimikunnan
690,223,088 *47437FC3B0DAC11290049228BE1899A8D3B31801 3seuraajalta
690,223,089 *474E81C0ABFD1F85A47433CB006D8042793E7454 3SRETSLUB
690,223,090 *4746D33971E9DD5480D5BD9A9AF85691511448B8 3.wetback
690,223,091 *474DF48F3854B72BEB65E906336F0C877F11249B 426755 VIHREIDEN TAVOITTEENA ON NOIN 10 MRD MARKAN SIIRT
690,223,092 *474B3D5BF5B87528AC0D971A6144B4E69AEF969B 4 _(_)_ 2wwwww
690,223,093 *47403E676441CF06B9E6E41C1B6D909DDDFB4696 4808QAZ
690,223,094 *474470C771C21DA9EA5FDF97690CAFBA0525B6BF 4ANGKHAM
690,223,095 *4742A3CC933BD027747312A050C6752BCA1B55B2 4HNDLSLDN
690,223,096 *47426331F48F8C009A7D0076791926535E38134C 4HOBBITA
690,223,097 *4748332983A088BC24A2CE6185F060E632C55E11 4KARTUTETAAN
690,223,098 *4749A34851FFAEA96A797FD6650E590F9665CA55 4LADELUFTKUEHLUNG
690,223,099 *474389F4E24AE807F8229C9B2A07798F4E7AA833 4.RAETSCH
690,223,100 *474DF7B08FE2C05F8BEA833D230747561050041F 4SINNEKIN
690,223,101 *474C991C2807D03C8DA9ED95E97A14BC57B48C88 4TIMOROUSNESSSHYSTER
690,223,102 *4746BC6E5043E2ACA4D2D0DBD2C901B7B3008DAE 516.KARJALAN
690,223,103 *474316CE9571C4A990273C138D0046B10DED6FF4 519473 "-cardiligin-casirgan-,-bayibayt-.-"
690,223,104 *4743EF1EB67710C6EBD95B331EA624525B7B11ED 5:5#&zambian
690,223,105 *474961AA15F6BF77FAD05FFA7E134C4D672EB48D [email protected]
690,223,106 *474BE4E2EA80D9C496E5E657940385BF6AF44D6C 5DECURVE
690,223,107 *4746B02C0D1E6D34B31E37C87844CD78C35F0DB7 5oplepelt
690,223,108 *47480EDEF92B4CA6167CF610EA931FC8E924DBFD 5SECRET0
690,223,109 *474BA1734FFFB1F079233A9621ACE9C0520E6EE8 5ZYOBTAFF
690,223,110 *474F36F1548E8B74804A4B511A4ED4F955A111B3 6DESSOUSES
690,223,111 *474BD760F85604FE98061B521F41D4703C28D57B 6DIPLWMA
690,223,112 *4743163C70BB685B5093069CE30F0D7DFC900C58 6iluvdusty8
690,223,113 *47425216AD89CAEAB02B4A993AE73F6D09CF7CD9 6INDIARSI
690,223,114 *4742088044EC9F8BFEDA84D4F510CF6CF78AE5D4 6IRTOPINNOJEN
690,223,115 *474D45CC4B68FCD5AF6AB563EFEB0C7A7CF80F85 6NTHYPSIL
690,223,116 *474E8464F462DCAE310E8E1523A4A990F7D0FDBD 6PANNEAU
690,223,117 *474EDC5B503E75B615AF3738C3C31EA5A3A9736C 6theripple3
690,223,118 *474285E1CEBD0AEF849DC5725233C275E281970D 7GUNSTKOOPJESES
690,223,119 *4746752E7CB269C28E4A567B7E9D180DA4C68E57 7JOSEPHWILLIAM
690,223,120 *4748EFA22831E3C3970447FE63A3A18C725FBFDB =7<lhz
690,223,121 *474B8C75F1ABC91F1626CBF6CE286064DD84CF48 7NOITAGITSAC
690,223,122 *47424BB58881300826F167CC602082F624D88A32 7TOYOMANE
690,223,123 *474B43224B35FA86947FB9459B3BE60D251A01EE 7TSIHPARGONROP
690,223,124 *474269920863F35B272EE6576DD02134274AD3BA 7VNICORNIS
690,223,125 *47440F2EE64259CEDBE498170AB96DF5DED9AFBE 857DORIAN
690,223,126 *474D3E1FFA8C4AF01B52E7AD6E84C51E186ED5ED 8AQ9WKHI
690,223,127 *47427CA5B36870DAD1AEC6C82BDEFECD5BA3C85E 8CORTEGBA
690,223,128 *474A400E76A1014C3A28C8F2E49DD4AF7B775FEC 8-cristina
690,223,129 *474C2C78BD84A2D637FA28D789339FF9E0051738 8EOATMEAL
690,223,130 *474560362E10983C4E51A7763D26FCBDF8DEB6F8 8LOVEINSANE
690,223,131 *4743C1F5B8B10D78B9673A7F0F773BAF250183EC 8MONTAZGARES
690,223,132 *474B1C135EB36D2D954D1F27840484E9EA7E2C9A 8OGLEVEE
690,223,133 *474BFEE1A281AE66F871390A4254F8D02DC3C55D 8SAMMYMARVIN
690,223,134 *47411C54698A26B660498FAE2CA15B7303741F32 8TREKSALUT
690,223,135 *4747734C1462C91FD2B1F35F3CDBE617FC3F8012 8VALKOKANKAAKS
690,223,136 *474BAFB19F5AA3AA86C447F89E260627FA27CF20 90228 OPPILAAT.TY
690,223,137 *47440457FB089D9C78500D7D25194B50E4881659 935499 eSmeveyakUltUryitimidenir
690,223,138 *4741B7125CC0292FB5BC820E3BE1BC73AF36457E 9882352941176EM
690,223,139 *474C48F8667FC84D605C4683AE46B733ACFDFB2D 9CORNIJAL
690,223,140 *47486C618D030213BD7D5E46D1E29B2B8A3CD1F9 9JENIFERRAVEN
690,223,141 *474B36CF8A80646DF7F4047BAAFAD23AA5EAD6B6 9MAY1392
690,223,142 *4749A17CD54EE36B8E03C6FE818BF97067F002CA 9TOPCORBSW
690,223,143 *474D77ECF7A905E27B2E62BDE424E34B507428D1 9VGRAPHBSW
690,223,144 *474590152FBE57F503F7E4DAC01DD6EACA755C42 A4QH
690,223,145 *4746F344A456E020A8F92C21AE286F3C666E51D3 a-5w
690,223,146 *474A643F1A181149C604D716440C04AFF9DB0231 a8mz0
690,223,147 *474F3EFCC3A9743DDA03818F2B0F1B3048A4EFF4 [email protected]
690,223,148 *4748580F8E6A0F79F015C989FDF2F0C58172240E AADYN0
690,223,149 *4740011FB939D7975550DF51129FCADB40AC2F2A ABARGAIN5
690,223,150 *474DD1ACD6B8A1E70749829B22B3EA5C0D73CCAD abejutas
690,223,151 *474FE65E0E25C855C81FBB626FF6BE6D3C8E4DEA aboii
690,223,152 *4747804F3DDF03C8E5666F4A64536B1789C339DB abrasaramos0
690,223,153 *474AFC2D227B026C4AC1597E0196D643511582F0 abscesy7
690,223,154 *474BCB0249775A8C0DCBDB60D6A3B91D99A0D049 ACC主演賞受賞「三井のリハウス」
690,223,155 *474900D265C178798038F31953B86FD5151C97FC ACPCNDIL
690,223,156 *47437F850E0A0FF8076873B2761942B8E467C09D actionjustin
690,223,157 *474D121E3FB0F8543F359FAA901286C80581707E adhfq
690,223,158 *47471DBE8A060B535F8BD5C7A341823ED6429490 [email protected]
690,223,159 *4745262A84BE42C8F05059920DB25CD0EA9EFA34 AFGESCHREEUWDE7
690,223,160 *474CD53C0C7C4737B8002C6651E0EB7DE0E795C9 aganw
690,223,161 *4745910DBA6791B88EA4238E0D00D4AA915D5FDC A.G.N.T
690,223,162 *474F48A3EEC596438D72C0D06A7FA2B844FAA130 [email protected]
690,223,163 *4749049973FB4FB82F6B903B4DDA02C9575CC78B ahmadknauer
690,223,164 *47452934CB199B7CFAA202C0DA1172CA249C4FED AH WAKARANAI
690,223,165 *474E07C2E10243A7E5499E2A5675AE0BCEAD6DEC AIAX+
690,223,166 *474D16C2CF23AE5BBC528A02CA6BA83AB21E78F9 A?INF
690,223,167 *47493973D523BF83ED9C34425BFD2EE4F9CD2BC8 ajae.
690,223,168 *474BA44006AF18185A2925364384F4CAB9644860 A=JVL
690,223,169 *474EAD4B357F681EF63974332B5CA0D4F95D02F0 AKIAOKKA6
690,223,170 *474BE20F2BEE206FB85CD19B54A53BD5CF217757 AKMJ8
690,223,171 *47421ED7859F3DC754FE8EA7646647DE2E6BC35D ALEEYALEEYA
690,223,172 *474E502F20423269C4021CBA6CDCF159F7FC8D25 ALEXIENS上的房屋,LÉON
690,223,173 *474531E604FC22C2E0C423A1B30ABA0F4B1F7A01 alfonsofenoff
690,223,174 *474B4FD254E4EE590F90F74B4058018F4A920A9C ALI.MANNIS
690,223,175 *47456EF205993E2CCDD4A95BA1F2313B5B9F053E aljafr
690,223,176 *4746839818C7EC0C6C8CEFE310021D6299404202 al+v
690,223,177 *4745D1F8978134267ED4294C44BA20070433E238 AMADODERIZZIO
690,223,178 *4740A71245E7C356F77EAADFBDD36CD7BD4D64B2 AMADO.MCSHEA
690,223,179 *4744022C1C118EDE3BA0F7C78FE468DC835F859A [email protected]
690,223,180 *4741502A7DAC9E2B8BF334D8D34C3565CAD5C911 AMERICOBDELLA
690,223,181 *474A07A5E87582DAB10CB2EB7321E1EA160E27BD AMYSANDIEGO
690,223,182 *47405020BAE9323BBE3D8D1E4DC31AB7D0400788 anahi67
690,223,183 *47492A7009E1AFEEF785050E9075CBB77F502134 anb=
690,223,184 *47450161FFCE4ACF3B736051011C8DC7D5B91B90 anguses9
690,223,185 *47465E279F06F8B24FCB3C8DECDEBAC4EF4BDEC7 annie.gosfield
690,223,186 *4746CFD751A3A6CE42334EC52D0AB057C4099EA2 anthocerotaceae5
690,223,187 *4742687102AA7C3877B8786944EFFF56059CDB75 ANURAN-SARKAR
690,223,188 *474C7031B15B9B33FD66BEFABE11614C52FD8AD2 ANWNYMOS6
690,223,189 *4746404D2EC722AF786CB02ADCC10166872F4631 aoit
690,223,190 *474B8BD4586BB5C9CD75CD85046D332E73265232 aquelle
690,223,191 *4745E25FE0DB502E007388542A2037EAEA35AE85 arteoff
690,223,192 *47467F58273B963AC24EA4DD36704A9D10E4CBD5 ARXSW
690,223,193 *474EE3110F479B46076D888FEEB9EF7918BAE43F as#h,
690,223,194 *4744D43A7443A5B88D424B7617C7005DC6D78D40 ash:s
690,223,195 *474EC83A43A7A2B063898755433FA7876A6FEBFC atiamssi0
690,223,196 *474AB156A1116D98B73285252EB387179D91BF2C ATICXENU4
690,223,197 *474D81232AFE6D5F0057FAA2D3D270D295CD9CB7 atomawashi
690,223,198 *4744A0D283070628FEC858D0DEE7FCA5562C3A99 AUGUSTINE.MARRIS
690,223,199 *47455B0F457381819A30E342C05EF46C4FFA0AFE AUNA
690,223,200 *4743820BBD317EE628F73084C66D7F8BB2D56D53 aw+jo
690,223,201 *474C46ACDE74740346D315C724FD79E3B50594E4 aw,,q
690,223,202 *474FE79DFC9A5B6ABB4D7554DB81D85A652B076A AZUFRIDEN
690,223,203 *474B08CEEFC33F7F8DF6FA234FDCC00B197B730E B####)~.~.~.(-_0)
690,223,204 *47499EE5E1D7AB603E2DB4D71F8A526C96174853 B0TIL
690,223,205 *474BFD5C3D5A29B83CA5CFDC1E6164BFC2F97F89 BACALL-TO-ARMS
690,223,206 *4746E7D944579ED03C7A048AC3318F988F44DEA0 b-ar4
690,223,207 *474859EAEC8D4B924529E753BD20728EC6F15D6D barnavn
690,223,208 *47494997268AE77952E9187077E8F92A539B4F32 BARTON.RAMUS
690,223,209 *4741089376FB705DD72C6AEAC51CF05112EE8169 BB.5D
690,223,210 *4740B561633F43769DC59890F1DED7F3C4099A26 beratungsta
690,223,211 *474F1D4AB674B77D54B7E2509BC36F1201091D6A BERNBRUNNGASSE
690,223,212 *47453E0AC78D5DC6D55F208B2C90FF13EDE5C2D4 BESTYRELSESANSVAR
690,223,213 *474239F03E6D749729BF929236DFAA6C7E56F2DB bfe:d
690,223,214 *4744AA3B0FC8982934F7397CA63A291AFE8AB055 BFIV_
690,223,215 *47483F4B42A38FB73063315D59E878AA5DA885F8 bif+
690,223,216 *47483953E8DB067875244703B86A9F4243C1C5C1 BILALBESSEGHIER
690,223,217 *474C8240941F2F69E30CB425CEDE8637C6A0FDE1 BILAL.BESSEGHIER
690,223,218 *4745B63B2F798483ED193554512259327B02B1A8 BILV#
690,223,219 *474FD9D7DF88D66C3B9A4F87313696A1F8F36E4A bkch/
690,223,220 *4745EEA56E922834BFB8C2DCCC9660E8AA2FFAD2 BLVXJ
690,223,221 *47473E09D8192398AC072398EBBB0B17356FDEC9 B#NUR
690,223,222 *474B5D5B012775CA57336FE78329477CFA772F31 BOBBIE.PARMELY
690,223,223 *474CA114F3CCE6FD9ADF53DB4F84A3C1BE37EF36 boh))
690,223,224 *474A79D8410DCFAE068304526FEFA8A79472F3CC [email protected]
690,223,225 *4740C660C0D962F61CED7720DC78E8A347EE8CBB BOOMING
690,223,226 *4745983D3862F84703BB8DE7E0646C777B938B86 boriskadi
690,223,227 *4741CBE4A594968207898FDC0AEC7E187012C30D BOSCOVE
690,223,228 *4749F5BF56CBC3782474D98F9F690C66F5A159F5 bradleybrueckman
690,223,229 *4746D7399ACC1CFC4BA4BFA55BA57BD592C6013E bradleymarques
690,223,230 *474F17585F1ED12C6CB51348DC7D315D6A1EF00D BRAINSTORMS
690,223,231 *474FF58F47056DDFCF61C40078CE0BB5B84A6CB4 BRITTNEY FIRESTONE
690,223,232 *474C488EFEFC2FB7E91D4B443FD362C2DCCAA225 BROOKS.HALBROOKS
690,223,233 *47496A67DA75C01B65EFE7CBB0A4777689527AC3 br_s2
690,223,234 *474D69507E8DABCB9AFA671EFEB1D6F2EAC9ACA4 BRYON.ANGEVINE
690,223,235 *47405420B7750CEC8952B68C5D8F3EF026C0B85E bsb;9
690,223,236 *474F6D2D0CDDB1ACF8669145A791D3D10716C7D8 BUPROPIONDOSAGE
690,223,237 *4749BC8122AE03235C6A7AA6FAEDE74FF3DB9654 BURTONDELAGADO
690,223,238 *474FAB0715E6004B431EC93DA1EB07506A17DEEC BVDT3
690,223,239 *474EAA8774B00F96545C6B820422CF7541E2C18C BYNAVN
690,223,240 *474E6362211F2D7C7DFFEA6B6AB5AC074AC2B649 C5RD9
690,223,241 *474D91122BAFF4B6D7073763C31042C26912D540 C6.HJ
690,223,242 *4747E5C06C6C27DF303F9DC5C01514EB0D2594DA C9Yu
690,223,243 *47495371C871843727F2F6FFA638B3436391733D CALIFADOS123
690,223,244 *47462C367118A95748439C3B801CDA67C6B06FC3 [email protected]
690,223,245 *4745A31B1BFB31437DF6F128F5E1E039DC9071E3 carmensterle
690,223,246 *4742ABE1CCEE73A45278FD65E31635C4C7BE040C CAROLRETZLAFF
690,223,247 *474A9EA9F8F543D46DE8720C8AE821BB7AEA4B2C caso
690,223,248 *4744F59483A51EE411E4E798C08EC352FCDCB312 CATALINA349
690,223,249 *4749AAADCD5209BD61F6860BF2BBA6485C288C7D [email protected]
690,223,250 *474CE996B540B0C95967094CC72296B51A13672E @[email protected]
690,223,251 *474490EF09258827A3DB18FC484ABAAC44DE13E7 CCHIASSI0
690,223,252 *4746D363BC9BDAA2634135F8FA5B08C55416BC54 c?d7f
690,223,253 *474D06873B315BCB19E236963D6257A4AE36CD7C CDBW"
690,223,254 *4748E0BAC0ACCE28F217F305A1E83F0C4CDCA5A3 [email protected]
690,223,255 *474F16B13BDB8BD727880E8C2E1D7EFC142052D9 CEIDP
690,223,256 *47463554CE666FE05A7326B3BDEE05940D046D5C CHAPTER40-02
690,223,257 *4746C0C2E693341F0011BFD32F43A7153AA2A535 CHIKAAZA
690,223,258 *4742EF0ED1A8510A44A00F42659F29C1AF31434F chlebowce
690,223,259 *474D7994347C8B9C057D973B2F53C940800FAE14 christabell.mashora
690,223,260 *474B5D083296C65CA690F7994622D289931B4DB0 christopher.huston
690,223,261 *4740B414A72A6B12495368076108B70A6361C107 chtkinosed
690,223,262 *47492216452F3B47C5B03D88018E40EC6C1E453B [email protected]
690,223,263 *4748BCBC0268D749B37D2989EEDF5D8CCB0C209E CJ)=2
690,223,264 *474BB3126FEE5658A3C0BA1C8B4D2073CCEEA4A6 cjs+p
690,223,265 *4745E4F2A92AB44A87E72954FE48BF681BEE13B4 C=L$M
690,223,266 *474270F2F8EEAD96355034DE6A4350BFBA64A36F CNP8U
690,223,267 *474E3402491B08FDDE7E394E571132A82CA21814 colpevole-(con-orchestra)
690,223,268 *4745F6112A61F79AF1824DF5360D25BD85E97370 colstrup3
690,223,269 *474E5B168E1A6077603DFEBC8D7479065E83D311 con fuego (feat john eric)
690,223,270 *47457CE862DBAAED53246613AEDB6AC3B194C0F2 co!nj
690,223,271 *47420100E24C66D2399A352EEBC94F80E4139387 CORNELIUSBROCKLESBY
690,223,272 *474B6AF0251ACACEAF1ED8E906F5A811D1DD618C cou4r
690,223,273 *47413DB2F2F45B36CCBCC3632647FE98CE1D704D C_!Q9
690,223,274 *474F0C1D7C9A7A239C92C294FDD988243B901AC2 CR_HV
690,223,275 *474428116F472287DC39D026A9D128257895BD53 crlx1
690,223,276 *4746AEBBB8F5D212117C8AAB712DA9632161E4BB cuew
690,223,277 *474B17B6484B8BE1450876C30121ABFA23299F7E CV&L5
690,223,278 *474021BB67A78E5E9B4B18EEE78059DDF0D35B35 d5wt(
690,223,279 *474B8E30B07A856ABEB9BA900F78CC739714804A d=(7
690,223,280 *474DCC09D1F132D7E3E5533CBCEE3DCED5617EE6 DAGUE8
690,223,281 *474FD75FF847AB38B41F692C2D0009E126522621 DAJY-
690,223,282 *474FC28FE25D9AB0D5DB31AFCFAAFDB898373F92 daltonsterkenburg
690,223,283 *4748E790A902B6CD2BE45E97B5E9E41C200349D6 DANGEROUSVIBES
690,223,284 *4747ECDF274D1DF4B10D379FED25A8E10B7DDE93 darrinwaiki
690,223,285 *474479546F312EC867AEDF81D2ECDD79F1C76F61 DASHAKO
690,223,286 *474594A9E0B67E4F16CCFE7C0EBF4D3095488CD0 deenavarrette
690,223,287 *4744EDA99257E3E44F17A4613E7481455102921C DE#EO
690,223,288 *4748E595AD2370957D7E436284F2D930E1DDA968 delraggio
690,223,289 *4746F352279A1EF33B67DBBF2CBF8660643470A9 demoncastledraculabest2(disc1:demoncastledracula)
690,223,290 *4749EA39D25DED3139F7544960EC04B89FF316FF deshawngaboriault
690,223,291 *4748238C03A26E7FDB23584D3B2D55AA178F6C2B DEVON.LAUNT
690,223,292 *474F31D9A1F44F6E2F14818B9E6255707E2923AB df_mp
690,223,293 *4749C495F516E9D8ACBAE29233F0AA8C7A3A7A93 Dgao
690,223,294 *474E81289878FDB44C8490476C51CF71D9D0C6C2 dhps-
690,223,295 *4749843EB0D6AA0288ABF92E7A127914D6ADC5B9 DIAKUNDE8
690,223,296 *4741909C0DFCF9FED757D449DB903B8F78273DF2 DIG1F
690,223,297 *474EC2C4C29DDECF171189FC366B47E26EE1C267 dip slip
690,223,298 *47408ED8DA21DAAC8ED54D01D645C3334B4BDA3D DIVG
690,223,299 *47491B4A8944B7D161A54D18EF4A6B80FE0E2204 d!j7g
690,223,300 *47494E6C8B9E5ADAEC239D60F97626EB9BBD9901 djnqo
690,223,301 *4747710811E1B744AF763CB097EF405659B8F6C5 DJ+WT
690,223,302 *474A55628E24F610E921B3C73A795E0523AD0980 DNARBMIT4
690,223,303 *47433B0B02363C7CAFF137D54BDE91959C0015F0 doesontheweb.
690,223,304 *47449E25CCBC32259D293FCFD63C040A0D76F41B [email protected]
690,223,305 *4744C9B4790F889A42BD817EBE0D06E9DBB64BF3 [email protected]
690,223,306 *474BEC8AFB62418D9D2E3528F90974BEA77D733B DOUG.ANTONELLO
690,223,307 *474110CECCEC5C451B1E93EA7C166FAD8AB497E8 DOUGLAS.CHILDS
690,223,308 *474105E771CC84504DE9D15CD680A4628A0DA0D7 DQAQ
690,223,309 *474CC647226ADD2DBB61E53F607D1494D31E0086 DRATEREN1
690,223,310 *474884DC7BCD1C08412AB7E3C662F85FCA473DDA dr:q(
690,223,311 *474E7B49255B7F539F7D7C93998053596358C8CA dwainfego
690,223,312 *4749D3D604F9116C8682CA03B2961E6E6CC5194B DWELLMAG
690,223,313 *4743B266AFEBEFD90DD3EE415E6B78B9A5360606 dwku=
690,223,314 *474C2CAA107C7264304DCDB849555C538B30A3F2 DZ.TB.EK
690,223,315 *474B132F89F135018FA98661B2F34D0536151048 e7effect0
690,223,316 *474927E498331488457EA835159FC5BBA2B42FA7 eddielockemer
690,223,317 *474DC147CACAC1A21D693F89C11D429E45EF46C5 EDGARDOSERBAN
690,223,318 *47465BF7FC0A94E6E9BC50D86793F7238E69C2F2 ed-i5
690,223,319 *474A02E7839F0EC9AB93F5944309CD62D525F16B EDNYBSW5
690,223,320 *474A964A6C1C2EC252359EAFFB5C1334B6EF4685 EDYRBROFING
690,223,321 *4740D02E58B9E8B72DF398FBD5B451F298352CF3 EESWI
690,223,322 *474C9F0FEBA86BD5ECAB0A907CDDC10D115D2139 EI-MT
690,223,323 *4742D0425C50725B2A88FA5FEBC469025D92EDC1 EKg$
690,223,324 *47488E5B202EE1DDBB813AED48A53129AEBF71EA ELDRIDGEKEYLOR
690,223,325 *4748E253E1BDFD52811CCFBCBDB5FE80156AE1E4 ELITZZI:120675
690,223,326 *4746C6DC6C781B09E4E516E9AA49CAC97EA21146 ELLSWORTH.BREITWEISER
690,223,327 *4743CEAF40F31603FF6009CC9260ECC617887259 ELOETCAR8
690,223,328 *47450EEE439A9B215261373A6075137079522F0A ELTON.LUMBARD
690,223,329 *47433C919A4180000D4A41AA8243D520731D1B85 emanuelhendron
690,223,330 *47470394439275E37225EF27B7FD077A2C318CC3 englishly
690,223,331 *4745C251FC725233B3567AF36E86F1E4CBC9608A [email protected]
690,223,332 *4745E23B46F8A2A54E31D8156A6FAC06AB1AB3ED E~QT
690,223,333 *4749D2E04FC0F7C80714FBFD934C61F29519F69C ernesto314
690,223,334 *4747DADDFC9A6E0EFB6D8945F43C13A1953DCA0B erradiza4
690,223,335 *4746779CBC99E2018BC353F1C7F0EEE9B1700309 escrivir6
690,223,336 *47475712354EE4368B4E4FA977192877E9DEEAAF ES?TO
690,223,337 *4747A40C79B82C0BC6EAB2481A4B57B41A3E1AB0 ettiekio8
690,223,338 *47464793653D414837EC7AA9786509BCD49A747B eudessa0
690,223,339 *4748D7375248235AB3EBB03C932F324E7796A17B EUPHOBIAS5
690,223,340 *474FC5C162A3DC8FE6BC0FDF3BF916A1524B36E6 EVANS IYAMU
690,223,341 *4741CAA01422E8D3B97381F02058D856980CC50D ever.so.lonely.(extended.version)
690,223,342 *474C7BD164A22C8EF581EB27F03D93F2B33BF3DB EVERYBODYSGIRLFRIEND
690,223,343 *474B02044ABFE7DD27FA24949F3D1A6F996899EA ewnennam2
690,223,344 *4742262CEC64F4A317780810935EE673AE28514F EXIL-KOSAKENF
690,223,345 *474C104C129D2786CB71EE72669C121067C960CA EXSANGU5
690,223,346 *47433FA50AAB571B322563C15ABA0F5409D0BC86 extradons
690,223,347 *474DD102A84F066987AE7DF90983022DC1AF0944 [email protected]
690,223,348 *47467B5DE383F2EF234377FC5FDC694D3D11A648 FANTASIA (FEAT. BLUVERTIGO)
690,223,349 *4740CB2E97EFBD610FFC9FD85C38DFFAF047A702 felipe415
690,223,350 *474605C1CA455442B012420FBA3278D6386920BE FENGPAKUANG
690,223,351 *4746A97F219D72B2F4538BF8E56CAEA8E0FE345C FIGHT FOR YOU
690,223,352 *4742BBD3C17D7F1B92FF425C1BF6A082A3D3F14A FINTHACHAI
690,223,353 *474BE50579130493847B41C3D10C7ED5FF43689B fireballmonday
690,223,354 *4747220DFB510ABC29982B855C657B8062D36114 florentinozehnpfennig
690,223,355 *4742B866E5F18FAB8C1009FCE5588EA352D64634 FOORPSSING
690,223,356 *474561DA5C9496D4A2DCEFD9966EDF1B632B53A0 fosterloveless
690,223,357 *4745BDD7222CE5BEB183F02516A1ADF5BEA9465F FŐSZEREPLŐIRŐL
690,223,358 *47466545F116879434D778DAD9AFADB0DA023AFB FPR-
690,223,359 *47492A9E1A70E16B34CA7550BFE686B1A2D7FC8C FRANKLINLOCAL
690,223,360 *4744486D8D64213034E58402930F4C0438372329 frill3rs
690,223,361 *47468174AD0E03F4BE19A7DA0F20A1F54027C967 FRTANSTE6
690,223,362 *47452C077E1B5C5FC25A6A03634668BCCDB556DF g4$+r03n+3r010g1c411y
690,223,363 *474E344611987AAFB753DE3479AAF7621F505F6F gaojigong
690,223,364 *474B218984D67C249696209EC2C3349EE319E28F gathering.place
690,223,365 *4747972F92582DCE58C57F02DA267892CDD586BD gemma.butler
690,223,366 *47401FD142553DDE0105086D4089F3DE58FAF0CB geovonne5
690,223,367 *47476DCFC4A5D8350D72B7F30A30122B32477CD1 GOODYWITCHDEC
690,223,368 *47498F019E422C034622AD0938335FD7094554A9 govision
690,223,369 *474C49631ED492FB2E65A203B2811E59B6CD0E49 GRAPHIC:
690,223,370 *4746E7ACA3ECAF03DF35C79B9898C5D382C19E35 grenzland5
690,223,371 *474D604B9DA24AFBE7A5E8EB9C3D3DC3D4784F13 gruganusing
690,223,372 *4746D218CC7C57871BA2E2E938F5D70EDEE0C06B GUILLORRY’S
690,223,373 *474E3EB8A56E785BE9C0BE1C6EA7627DDA4CFFCB [email protected]
690,223,374 *4747513CEC3DF9DAE93BBF2C276A2230C6CCF5FB [email protected]
690,223,375 *47407E023B70A2F42383084BB222BD585A5CC1DB [email protected]
690,223,376 *474FE6A00C270C0CDEC5C212BD852350281E9CDC [email protected]
690,223,377 *47400677C916C6B7A54D4355E0263AB8C9FCFA66 H4G1H4R4
690,223,378 *4742D48D37CA6BFF24901333FE9B200BD27460B7 [email protected]
690,223,379 *474635E9B26E17BC954020684042E162C6E963B3 HANDELSREJSE4
690,223,380 *4746E23810B9C1FF83681C3C0ECE4B8886BF2F57 HANWUXU
690,223,381 *474F73F30DA8ABA91E5E8E411196F2C9D4CB08D5 HARLEYGUIRGIS
690,223,382 *47487D7FD59A113E32568D118A33683EA23EC8B5 HARRILOBI
690,223,383 *4745837344189EC3AA3A9CA6FA12E0F8D22D4A6C HARRISGROLL
690,223,384 *474E74FF85F2ACCE1D9F64E16013FBD23B8EC3A5 HARTEN
690,223,385 *4743509FBE4788E95A0A4F8012A95A3CD0495505 haywoodbrickell
690,223,386 *4740311C2EBC265715B78728C3EB10C3DA96ADB4 [email protected]
690,223,387 *47444CC595B694FE73DE947A81D48998A5AFBD09 heeseen6
690,223,388 *474F0020060D14CD696BA1CDA7847BB7AB02B60C HIGASIKUYAKUSYO
690,223,389 *474EF1316170DE3800F6D597913FC070A54EF758 honeytoby0
690,223,390 *474DC99459543F7C3FB2C4B88DF5F6BABE9EE89D HONKY-TONK BOY
690,223,391 *47405C7001AF15765D11A77A1E839D14889BBDF7 [email protected]
690,223,392 *47471B832AEBB00D44826350ECCDBDBC4BDFED50 HTSPNDR2
690,223,393 *474ECB1C8D88EECB1BD31BF4EC0F02EA3023C9B8 hubertbaetz
690,223,394 *4746B8891C96B5E94DCAA893B8E8A8698D02017C HUGH.GRADLEY
690,223,395 *4745664F8BCD1F0E9D178E1BADF6B1C08E59762B HUNG.AITES
690,223,396 *474CD8C06E015D6956D6019B23F597FFB6D3343B i%?0
690,223,397 *4748D3CC50FAF6345BAD0C722773F7ACD8689472 ich-liebte-es-auf-den-h
690,223,398 *4746FD8A72DF5EF676A75C35C73BF141731E7E75 if^'
690,223,399 *47403BEB8ABAF0E1307C7BB6724182B12B51283A iiette3
690,223,400 *4746C7828BD553CE9E8D7EDD189C50BBB7F20D0C ILUVPAAGAL50
690,223,401 *474AFD5AB87E206DFA009DD086B85BA7FDB485D6 ILVBONNA1
690,223,402 *474B78E335A8EF7C2590E4218618BABCD46AE54A ingevoerd4
690,223,403 *474D78CE562F16D55C6E48C898216931E714E622 IR18
690,223,404 *47491CAF04D5E291AE31029270E230CD852F57B2 IRONMONGERING
690,223,405 *474ECB0825CBDBE0E8668843296A9F6A8111A108 ISGORGERED
690,223,406 *474124E1775AE201EFF6E52D9E724CC6BD10BAF2 it started in shool
690,223,407 *4741C068A66C6C897EE3A68BF142AAB0B95384C3 IUQ09H0V
690,223,408 *474D220D988A0B5AD2623E92192F9F3E54D348DA [email protected]
690,223,409 *474CF2ED1D05A2E51699FE5C2BCD9FEE4AA95C19 jahanghir
690,223,410 *47450EE0DE9542FFDC6EF108125C2AEDD786C748 javierbandyk
690,223,411 *47490C063B907F8519A226E5BCAC1897AC450E2C JC.STEINLE
690,223,412 *47437343364C6DDDA91B67DC76E9EF4DA647E413 jebby.jacob
690,223,413 *4742AC2D3AFF607A964A79EFBA2542A07DBF6030 JEFFERY.BURROUGHS
690,223,414 *47456E53018BA147F19AEF50E81913E6216FB26D JEFF.RATHERT
690,223,415 *474F14BD5CD38DCF8092031BC000001094CE0945 JELATUMAˈTIK
690,223,416 *4743A92677D2DA032E89787384D198477871ECC5 JEROMYHUNZE
690,223,417 *47444CE7F55B8FC01E7B352B2CC0EDE0777EDA23 JESSICAMJORDAN
690,223,418 *4740296CC8E9F2508969F1771F8968E85A55A9C3 JIMBOCASPER
690,223,419 *474DB11D1506224C53CC10F6200902617A42372C JOEINTRIAGO
690,223,420 *474C4C42CE4A84F82255D533762AB89ADE609D2F JOHNATHANROOT
690,223,421 *474DDB95847E4B9CFFBF8C93954E7CC2D6AC4CD5 JOHN.RAILSBACK
690,223,422 *4748EB05C972B7EFEE5936E944BD10BFA0F8435A JOHNREYLADRIDO
690,223,423 *474AC942C789BBB625D86AE7D7B8DE452760EBE8 JON APPELT
690,223,424 *47433E7000348EC1CD0F69A9062A7AC242AF84C0 JOSHUA.PANDURO
690,223,425 *4742AC812ED361134C03A71E042F9B2B7F44A031 JSLEITER
690,223,426 *474AC1457B39C2FA1955520E176AD201331EAD8F [email protected]
690,223,427 *4741BB6DEB8F2E1777AD3E672E470EC7C29A59AD JUSTINNAVES
690,223,428 *4742197A57CDD9279A09FEA96697CCA978B18629 JZEDLAC
690,223,429 *47410907205048093162F526F5F52286FD71310F kairalling
690,223,430 *4747FD20956D33AF67E0D2DF2318E3805276A50C Kap10
690,223,431 *474BCB04BA5447A22DDC6104F86A00AECA65487A KENETHWALROND
690,223,432 *47431D96A517A00C6DE00A772B3AF02035BFE5E5 KENNYEDWARDS
690,223,433 *4745D9F884EB00443D9CA68874D3B735A78496A7 KIKAMBANGWE
690,223,434 *474824C4C1721CE78C31E7B66BA1E78E21F32E81 KJELLIN80
690,223,435 *47403AF88FC2E307B83699EF9D02BC8B7CD46F8B KMJC06
690,223,436 *4741418E014C57168CDAC241105359452E50FCE9 [email protected]
690,223,437 *4743FC0550071BD4E70C6942BA755324B39DBA5A KRAHMER77
690,223,438 *47414E82399B98E3051A6CE880307F22207F835B kris-baldon
690,223,439 *4746BA91F05AF346B9133591B03B729A3EB03495 KS-10-B
690,223,440 *4745E89F7DD3ABFB331830EBAD7CFA92F1C1C491 kurbashi
690,223,441 *4743D9DF062D9C9223824655B3EF5D7AC15BD134 KYLEEBLACK
690,223,442 *474A6451556D1E8AFFE9F5D305A654180F08CE68 LA.BOURBOULE
690,223,443 *47455382C0842794BC7658E74E45E60ED83911FD laddiemidnight
690,223,444 *4743ECAAD88000F6FDEAF50274306F437BF69B0D LANNIEARNOLD
690,223,445 *47401D8E726C1BE3AD5DD284DB5867C7FEBBC33A laterculoides
690,223,446 *474C43E67E07327133C4B48FFCD6A4C167C0DC5B LAZARO.STRICKLAND
690,223,447 *474F1FA9BFFAFD9A07E882C9BEF79178C8088C02 LD52
690,223,448 *4748D8F7A22041C6F040DFA52F16426053C13660 [email protected]
690,223,449 *474D96878E5B7DC30EBC00D7B1767209CA9CA2B1 l’échiqueté
690,223,450 *474E92C510E596B7C3C8A3855C7E83E3546078FE leonard.salgado
690,223,451 *47421E261BF397B765D806B3444029F53898DE27 leslieherrman
690,223,452 *47454DE351B144C5653A35809AC6707DD9A684DD lesliesweazey
690,223,453 *4746ADA3EC981A3C4572B9E6D7C30DA3AC4B5BAA let oneself in
690,223,454 *474E4A65E8FF92938FDC02A40A67788B20E580C1 [email protected]
690,223,455 *474C1649DB2EB0B56ABC2DD621D5905249853336 liederliches
690,223,456 *4740F8294290FFCACC8B2DDB0591098724FB66E7 LINCOLNFAULL
690,223,457 *474B0AC3151AA593E6FC8B6FD0566758D0162BDC [email protected]
690,223,458 *474DAE4CA41A2F1E851F2E87DC5267BB7B92F436 locationnatalia
690,223,459 *4748EE585B213F0AB3E65EB8461FA451BCA91D90 LONNIECRISPIN
690,223,460 *4745DD6D9F5A92B51CEC9C3EB7F7EC55CF86AF1A LORENELLETT
690,223,461 *4744B4344A09CE7E02052B84F01B3315EDD60020 LORI ROSSER
690,223,462 *4747E00E983625EB33E903E960604BDDC2B8F7D0 LOWNSLICK
690,223,463 *474508B5DFB624806B5AA42488035B67BE02BC8E LPRA
690,223,464 *474A9B101CC060FF0937A65A7F2DD389D1A0AF47 luciohughley
690,223,465 *47499D18723C5C63368461EA935ED271AFC981A9 [email protected]
690,223,466 *474DD51B97136064EEC5CDEA5F00307D44740AC3 LYCANTHROPE-2001
690,223,467 *4749390B2CC8963B9A3D8BF5F28C291364E55469 M4SJ4NJ4
690,223,468 *4745F4DC7938C7981027423AEB1A142B27F8D28A MacMill
690,223,469 *474C4FC98B200F7E26D37240827635BF26C16DA1 MAFALDAU
690,223,470 *4746252C94985D1A90F7062E7B8F1724AEEEF8C0 mahathitta
690,223,471 *4743A917212321E32A03A222191D3A68CF775298 MANAGES
690,223,472 *4744081070488331D085BC12DA36A19ED4C92326 maricoraquino
690,223,473 *47422C2A0C2FF0FCA2F3C08D61F54BBDC5119872 mariscas8
690,223,474 *474D470B2E76D3F464D6FE530F9C60C75B99B43C MARQUISEDANIEL
690,223,475 *474B70F7AC547DF0CFB1F981C3F9B4A2F730EB75 martesytrece
690,223,476 *47471E3E10F9E41E08CECF8D3A8D1502E519CE41 martyholje
690,223,477 *47488EAA6B80E2CDF14019B4873171237BF3FD8D martyrium2
690,223,478 *4742A14694E36FA2456F909A27EC88E1F6943BB8 MARY.INDAL
690,223,479 *4746C4A614420F5256A6961574A6F5384DDA3389 MARYLINEROUX
690,223,480 *474F588AC63E4D9C26389B6C7E7EE81D26BDDBF7 masonnastasia
690,223,481 *474C0A5A192257141F14D57ADD087B03861F843F MATTHEW.LOUKIDIS
690,223,482 *474445F9C338340B496B19EA4C24075026259B66 mb`+
690,223,483 *474205CB7E43AB16FDFCF92E00160E5681104E34 MICAH.WITTMANN
690,223,484 *47440AC74AE3243C9B1BE62F93D6B26AF0E57851 MIDOMOH
690,223,485 *474B8EE7EA5F2C3C61B4A54790683CCD86FB2A43 MIGUEL-ANTONIO-GOMEZ
690,223,486 *474C17F2EB25DFCF0B3B7224AD31C97545A302F8 -MIICK
690,223,487 *4748BE2E2C90F024A56D19E31A4ED5FF60D82346 MILO.LIONS
690,223,488 *4749E392B092F18EC2CB905F4956EB2E75976033 MIMIAAA4
690,223,489 *474A3558AEF7A657B7C3A430138541537A301EF9 mindäge
690,223,490 *47428ACD2E199975CA20D50B1882096FF43DA013 minimoni..Hinamatsuri!
690,223,491 *474C3D746C674E4BCADE63942EB41F2190A60CCA minshush8
690,223,492 *4749FD5F61C5AB0AEA26BC85668C0CB8DA406028 [email protected]
690,223,493 *474DBC3F2A42CE7ED6299F3C25C8DA79991097B2 modestonute
690,223,494 *474A4CB1710D8649ED7CE76C5EB290ED854DA27D modgaam
690,223,495 *4747F137CEE1E9E328C012A405D64BAF8A867ABF MOISESSTANDIFUR
690,223,496 *474A0C49DE3A2E02E2F5271D11AE0A5CC3DEBB33 [email protected]
690,223,497 *47413513068BC3123EF1CB5489C3604A438BBC15 morgan533
690,223,498 *47431AA10F6589D6E64472BF05F7F0F24D01190C MÕTTESÕEL
690,223,499 *474105DAB883FD9F8D994AAF9C8EBC28B8200F71 mountains)周邊的都會區域。在此區域外,幾乎都是荒野。
690,223,500 *474B0693642C2505FA5B1FCD4FE701303914BFF0 mujeddara
690,223,501 *474415F3503D6E44C9E0E520DCFA2D45A5AA6ED2 NACHTSCHADE
690,223,502 *47452F7AB192462661E4A5248480F62FCE3E9B43 NERŠTE
690,223,503 *47492A3C91F8FFE752EF3A0566D96EA9A6B6A854 NEVILLE.FEE
690,223,504 *474070327E5DB4FD3333D0019E5922332035A44B nicolasslough
690,223,505 *474DC8E63CE8FD8EBACB5A6EFF307FC07630FCF0 NIGEL.DICK
690,223,506 *47470A94560E8A3874117B53A50B2976B8908BE7 NOAHLOCHOTZKI
690,223,507 *474312B5886E778CFA40A11CB83B3D33C33074C7 NOBLEEDUARDO
690,223,508 *47424F7E57B4D6AFEFB694A5CE3A95AEEC708844 noiso
690,223,509 *47460E26B54B42986FAEB000500E4AB5CFFDDD91 nowshiravan
690,223,510 *474CBDF93BA9F1C404D86C62D38E6AAFB67099DF NUOSAME
690,223,511 *474D80DBB5692896BDD4D8FB40C61410161D8D97 nxhfma635qac
690,223,512 *4747CF945402A86B706FCDA213ED4E2517F04BE7 nya'dakihal(feat.statik&yener)(remix)
690,223,513 *4742EF207BFDD738A43C94B4F6CBD3F45B68AA6B [email protected]
690,223,514 *4749CADBE1EA67F85132CB2D29B0F33C482FD490 odsc
690,223,515 *474FDC018493D36DBE181751BB1EF1CA145D7E5E OMGJ
690,223,516 *47452E0497C44B1120CCE8F9E75D32298FF407B3 (>-<).o~.O~<----q
690,223,517 *47446D448BA43861892B894F561BB9F74B22E897 }o{* <p
690,223,518 *4744DC4F56B5C4B69B657716F779F7A9B0F6F419 OurCat
690,223,519 *4746A5AF8A7818CF6435944C6C5627101C9CF6DF PAPERCUT4
690,223,520 *47441FDA14B622B1A6A9E90B62D462EEE01A51AE pasqualegladue
690,223,521 *474307378C590ADDA16B5BF3878123458162DDD3 patriciawhitbeck
690,223,522 *474EC199A16D391B8165994478C38C24EDA0A6C2 [email protected]
690,223,523 *4741A843552FCAA643FEFF692BC406A71DA1A3D3 paulstock01
690,223,524 *4744A39BD079C9F26527BB06BA879E1463A4A112 [email protected]
690,223,525 *4749DECFA5A2EDDAE5F068333A0017755E2FE9D0 pD~.~.~.}8{
690,223,526 *474AA1EAA8F7C665F957274F8F552C367FF484AC [email protected]
690,223,527 *474BF785AA8B37157ABDD1F0D78208AA1D4AF1AD perceives..p.er0.s.iy1.v.z
690,223,528 *4740F75CFF1B1D6617AB1AAC9BE5B2D89D7D5605 PERONELLOM
690,223,529 *474341C97C5728CC922A49E0100E2118FF8DFFE6 peterbilliar
690,223,530 *474DA7F61E2DCBDDA6FD313D794B66D5DCB8ADE1 PHO+O5+A+IONARY
690,223,531 *47495BC090002BB65A241909B2F97E3071700CC7 PHTHISIPNEUMONY6
690,223,532 *47446ACCD8CAC6E4461893EDE56CBA3FAD6C1506 PJBJ
690,223,533 *474F9F17B4366D8EEE256563FA30A7D64871BD40 plycrft0
690,223,534 *47437597C0D7AF666C6C1C3D6C0AA1F8041C6BB8 POZNAMENAŤ
690,223,535 *474080AA01F06838EF0AA7B481D25C0960171A72 PPJHBSW4
690,223,536 *4741C0E8EF1B5CCE0BCE111FCA19ADE4FD3C8FEB P===P~-}O{
690,223,537 *474C000BA6B84AB1E1C793E3BF4639EB94B0C2EB PR3CIPIT4NCY
690,223,538 *474AB1F212E290C7DEFFDFD50A669BB73D3E7D65 prestonmoneypenny
690,223,539 *4740922D459B46A68166CC63EEA53CBEEF8B4F70 PRINCE.DURKE
690,223,540 *4745A52DB8416B4A207BDE20E9F58159A13417CB PROBLEMS.GIOVANNI
690,223,541 *474712D3E724DE37180323400544075549310C9D PRUINE$CE
690,223,542 *4747C29346FCBC64596FDAF8321B30372A4E50B5 P###@~)X(
690,223,543 *474E935D5150A19BE8DFDB3AFE871F6F81E4DB67 QASTROLDAN
690,223,544 *474BA24E475F86081CA42715ED7D186C272ED9CE qd * * *:p
690,223,545 *474C3E8FBAA8DD145F002004E83ED8C282A54390 [email protected]
690,223,546 *47485AE6389569B98728915F040996EE62F182E9 QG04
690,223,547 *4748267B4B192322F898B7322869B2593561D542 [email protected]
690,223,548 *474A57CA1B9497C6F373123844B75FD279023181 [email protected]~Osplat!
690,223,549 *474AB38B4BBF158212D6B3BBAD68DC9E3CEE2D44 qua
690,223,550 *47486B914F6A2E25E9E188FDF3A7C32B1B31D70E r2cd8b5bju0w829lyk9r
690,223,551 *4747BF62640DDA04E34D51353ED131807381A4C7 RADIOÉTIQUETTE
690,223,552 *4740B4A736715F41937A75DACB84895B19785D8F RAPHAEL.THORNBROUGH
690,223,553 *474977EDD00E9DC475AECAC842B125878D960A9E rashadhacopian
690,223,554 *474F3364213B339DFC3FC13867ABC205F73CEBF7 RAULVALINTINE
690,223,555 *474E418094750E45A970E6CF6D9653E18BB54E41 R;E'
690,223,556 *4748C35265390C1BD67D935495F0F1919857876B rebekah-vincent
690,223,557 *4744160572357E17826278CE886F7423AC547B82 reck6
690,223,558 *4747B4985265BFAD21DBD8D60F311814BAE56BF7 REGENDICHTE8
690,223,559 *4744C149CDD26B3539EC1379E2DB93E02657A6FD REUBENGWIN
690,223,560 *474BFD8A56C7C13F9B4EC6157A67EC81BF6143BB RFHRNGSRM
690,223,561 *47455C3910E2DC803FE4539100BA7446D279E3CE RHETTWEISZ
690,223,562 *474D9ABEDDE992ABBE9AA769E1E907F952579B55 RHUBILENNG
690,223,563 *474BE2AFDB0DCEB0497D94FD5BB8B13F2B7078DC robin.kriz
690,223,564 *4744EDDEF53AE9B02652FAB93FD1C3FBAFA65A0A rogerwashinton
690,223,565 *474CD85F77054DB37FC5851E56461DADCA528018 ROLLY-TAMAYO
690,223,566 *4747B71E03E1D383DC0BB40D1B6A48538AFE73FF rrshb
690,223,567 *474A0F53CD1DE180BA52F52CCC5CD1233447C4A1 rueuguf0
690,223,568 *474E745CE6B4F89430257C93F93B113120A7D3B4 RUTHVENOWI
690,223,569 *474C562EB238F9B886550236A1557040D344BEFE RVXH
690,223,570 *474A9FBBF37420A6F04E7D0BD50C5ABF9EC2AA09 SadSaturday
690,223,571 *474A9B3F1E46FD853D2E6F81DFCB36F8171A5AB9 SAMUEL-BUSTAMANTE
690,223,572 *47429EA1FE40685F4BAD035B69329A2D23A1EB15 SANGITA NEGI
690,223,573 *474CD239816B7FE8A006D1FF7A0D8BF4974D1182 SANLUCHO
690,223,574 *474972F02E2A317ECB614DB515A139D75904E06D s+arker
690,223,575 *474449190E631AE36C130B81286408019D4967F5 SBDCBOOGER
690,223,576 *474117EDD23D3F50749C7E5072B97D3941EEE1DC schutspatroons
690,223,577 *47400DA345DDEB44C247BAB7C25BBB7C7F438895 scottishjudgewilloverseerunup
690,223,578 *474F293B6E73B1C6832D36F3ECC19123BB28D923 SCOTTY.CALLICUTT
690,223,579 *474DC34641912D771A5EC6C201904DB04172169F [email protected]
690,223,580 *474F3421CD7C426CDAA326D985860553BBB9E228 SECURITYALPHA2
690,223,581 *4747AFE89AF052DAFA83CE7E75AB9F327E280FD2 SEJTEETSDEB9
690,223,582 *474AD26662BA9548588443132BE8EDEC27579B05 [email protected]
690,223,583 *47481BAFAB90DABC4B77C3599C2D49C38630D734 sémondière
690,223,584 *47426E52D611A78D4BE69E7D17F0A0B57E819733 [email protected]
690,223,585 *474F9D70D419CEFC58BD73B0BE3DEFEA98A7C2EF SHARIZAAND
690,223,586 *4745FA0761F725C4477DA183421920900755495C shaunrenfro
690,223,587 *4747F3397F4E8E492668EB7A29372675031A59DB SHELBYSWANSON
690,223,588 *4743874C681E05F975002AEFB127B52B0480CA0D [email protected]
690,223,589 *474639A0D3D98C4E476B510AEEDC88E5036D4F61 SHINSENEN3
690,223,590 *4746F7A133E3CF6D936E56A64BCE17703AE78878 SHIVANI.MAHESHWARI
690,223,591 *474EE2A5A0294B4883579C7134FA06EC81A0F7B5 SHUGNANRING
690,223,592 *474E35250B560406B58ECEAE12EFF8EB39DE1144 [email protected]
690,223,593 *474631B25E01F4DA663DC01CABD4999D0CE4702F SICMNMLCEJAP5
690,223,594 *47498AFCF73E9E4AA93DC6FFCDA080F74B2DBDBC SIM12345678
690,223,595 *474D9A3E46826E6DB8C5F814FC3ED1A2A018E094 SISAEED2
690,223,596 *47430B0A3D7D7E37DAECE77199C95B314AE489F2 SKIDOOJENNY
690,223,597 *474050402A85AFC0D7F49CCE069992E6CE7EE4C5 SLEEPONFLOWERS
690,223,598 *47460B7D18ACA4444999593ADA55D201AB823098 SOLIDTRADITION(30SECONDVERSION)
690,223,599 *474142EAA2DFC7D3A4E849F90B87DE67A802E95D SOLLICITA?
690,223,600 *47452D1CEB49FD9FECD7523F3341145E8C20C69A SONATE-D'INTAVOLATURA,-OP-1:-ALL'ELEVAZIONE-EN-FA-MAGGIORE
690,223,601 *4748E03D3F8988F21C1C40979A39BBBC2517A527 SONNY.VANDUNK
690,223,602 *474BFE8222C29F9CD7D4ED1464F8A1924DB61EE3 soused
690,223,603 *474C5BC19257AFB160CD870A271D4CA0700972DA [email protected]
690,223,604 *4742597FC2D66EF8B95D2C5B682D7855E18966C3 SPTZMLLR12
690,223,605 *4742DDA3B3113C992B1A91FA3C6CCEB617E62EB0 srbtng-1-0
690,223,606 *474A01021E0B198562464A449D759BFA7FB26161 sresserdriah
690,223,607 *4743F9D947986A50F6697DE445495859EB5DB7FF STATOCYTES!
690,223,608 *4742245B09F6290F31F4F02184DC3CEB7C01716D STEVERPICARD0
690,223,609 *4748DD1BEA86C496ADD5AEB4EF8AD76C61869E65 STEWART.TELLERIA
690,223,610 *474C6EE6794962BC6673BDE28A2BFB19F162D676 stigmata.(clubmix)
690,223,611 *474A9C3BBEF77DA7950945B9704914B4D31EB8AA strouck
690,223,612 *4748CF65D9376299B59E510B90D2EE913D266C22 SUMMER (FROM VIVALDI'S, THE FOUR SEASONS)
690,223,613 *474DD50D6ECD19D841DD72F19CB9CC0CA729DA96 [email protected]
690,223,614 *474BE0F87E20C44A0A25BB8170B6C5E360D5DE46 SUNGRAYNO
690,223,615 *4744941F599956B8F1EB72AE0CFE8EA12A56007C [email protected]
690,223,616 *474EA2ACB804A17B24B34F7C702FD4B9112F79AE SUPRAXXX3
690,223,617 *474F708138DF8D8F7F4C1B1B79F7BA4C0B336035 [email protected]
690,223,618 *4749ABAEA121AA7866CAB9062BDB317D10C277BE surfhunting
690,223,619 *474C4A5DE3347EF2C4F34AF7FCAD2694A0614403 SURPRIZINGLY8
690,223,620 *47447B9BC41379CE3E1E061AA8F504242A2A89D3 SV/
690,223,621 *474794DAEA6FF837F4759EB954EA2B0C9EB3D759 T5I5N6A6
690,223,622 *474CB6E17187E7E4FF72A7268431E058DB4B6F0B TAFINAGH[email protected]
690,223,623 *474EEB6E88674208767ECD7B57D109AE2A590B99 TAJURAH
690,223,624 *474C5BAE4EEF2199844CB7B2C650463F316D8B18 TALK89.100.141.60
690,223,625 *4745897326A546D17ED4879AB7B52E5BE745A1CB TALKPOST-VULGATE
690,223,626 *474B9DD4C71EF5F8C34480E69DF238DAC0C2B053 TANKERHACKER0
690,223,627 *47477E5B1638B9CF5BC71094622AB2B0772343D0 TASTONES0
690,223,628 *4740C4E962314BC7F2DE14E18188E92750BE5A82 TAUTITIETOA
690,223,629 *47403736A579814A68CC1A6D868EF89018C09A25 teddycostell
690,223,630 *47418A5A051842CC99A2FB011EDA30DB42C3E32F TEFERRA 2 0
690,223,631 *4742F2C01E18577BC2FB530926239CFF93488124 teresita-ang
690,223,632 *47472464E3A1C4752902086687074FE3FF7616DD TERTAETOS
690,223,633 *4746E27E12EFC0FBE5F56A798A49942F92A55ACD thaekejohannes
690,223,634 *47477CE5DECF1B621C6175F6F920CDE27E9A9D7E THEFETTERLYS
690,223,635 *4741E05F7BEB216921333B1ECD4CD244F1F919BC the impatient, the imperfect, the impossible (feat. pat brown)
690,223,636 *4740F00D9B6ACE5A0C776CED4A70BEDC0794445A THGILFSOCNORB
690,223,637 *4742D9639D08332F5BE6DDCF4C2D5FBFE251B298 THINKORIGINAL:29(A)
690,223,638 *47470FA8A5B5D58B7A8386906527C996AD897141 thinus-botes
690,223,639 *474D0F93219E701E621C96B7C7629E865BBAB6A1 TICOATED2
690,223,640 *474D11866368892073F8EFE66A848AE8370C6EA0 TIFFANY.DELFIN
690,223,641 *4743277DE474BBB0CEDE165EE21EADB174428C49 TIMALIDI
690,223,642 *474F1EFE801496589932349B96D6A7B010750719 tiwc
690,223,643 *47434AF05524D0C2A58132D64DA838DB4893B21D TORIES-OPEN
690,223,644 *47418FDD17EA99FCC794D4C4D1E50349B12EAF8A TRACEYCARDINAS
690,223,645 *474879A02CFF8DE338FC358D2F82279DA1DD89B1 TRACTORHELL3
690,223,646 *4747394151FEDB1AE877008E56C2403E4256C7BF traditionnalistes
690,223,647 *4749CA5D56BF5A5F6EC2DB318CF9690422B8A6B3 TRCLB
690,223,648 *4741002D8B3E3563817020581BA3E8A97030E2AB TROTTELN6
690,223,649 *474E1124DBC2D69FF3593C3F65AA86EA0C0570EA TSNOYMAN
690,223,650 *474673793A609ECBBB46ECB755DA02275AD3DCE2 TUESDAY-TURNEY
690,223,651 *474D2827AAE4B03C13B85D149EC90C585D999B13 TYÖSSÄOPPIMISESSA
690,223,652 *474358CADE9D37991A17CC8A65153C5F02D01329 UEHCUP.2
690,223,653 *4742C5410AB5D253B7F5E9B61B7EF18AEFC526AB UIHJHSVES
690,223,654 *47461273EAD16101A471AB21F82598F4E9049BDB u(iz
690,223,655 *47444821801E3B31AB1FFFF81F1AFF0678E0E7EF [email protected]
690,223,656 *474677CFC531C7E9B9B567617C82395450A99468 uq103
690,223,657 *474B943A4BF713A3BE409830D53ABA323E95246C USERBIGEASY
690,223,658 *474E3228DF445CD8FA1AF0496DBD7B495C7F31E6 USERKINGKONGREGATION
690,223,659 *474160CB84B9701FD3B14A1F27879AB3E86F65BF USSZR
690,223,660 *474F9BFB44B9E8592E687CB40626E6504BCE7066 UTTETIAL7
690,223,661 *47491B74F3C2BD4BA6DD7E05FEF8A85ED7E4133B VANDRAED0
690,223,662 *474AC03A87EA91847B9E936DCC1598B7E7C80003 VASTPAKTES5
690,223,663 *474020E1ADA312470C1A4850F60CD4CA70F9534B VASUDAPARAKH
690,223,664 *474738DE496C7204841E691C570DD11288086B34 veerender.bisht
690,223,665 *4740376AACF2B82D402C2C42035C9D9C996D90BD VERZUECK
690,223,666 *4741B84BE99D8BBF220D45721C55DCA293B514CD vicesrois
690,223,667 *47468E03234C3DA077195B3FBD8EAE43265CE98C VICKY.VANDER.WOUDE
690,223,668 *474B9AFE57A87F2E27487AB65C77E3D878E04D02 VIISTOISTA-SIIS
690,223,669 *474F71E5CDCA2711B427BBD612C24F0DB0CC7861 VIITEKEHYKSEN
690,223,670 *47464FAD48B6CD928FFAD64B6A799E184E1FD476 VINGERT8
690,223,671 *474985B76F8C0B20D8FBC49559108D2CADCC6CBB vloerbedekking6
690,223,672 *474D4D56B1E6BD07F99C277582FA8F2D9383AFCA W7PH92Z881
690,223,673 *474722A4C7BEC31D43ABE2DACE4A2026C0F4C489 WAGNERACEVEDO
690,223,674 *4747DC3758FDAD08B9A7504DECAFB1EEC92FD3F5 walid-naief
690,223,675 *4745588A857CBC1E9D7F397E81F7BFD2DC8BD458 walsrru0
690,223,676 *47461F1B78490989C1F3C7A714E4281420946D48 warblino
690,223,677 *4741E9DEF202CF4ECEAB4B88231A7DD07047FE43 WEDOIN'OUR...
690,223,678 *474F0795A645F95E4A8C4A83895C2D20412E20BB [email protected]
690,223,679 *474FCD8ADDC67E5567B079B57C44AF838CACB278 [email protected]
690,223,680 *4741EC0A1B2566B2A2F005B21F1534E0BF47E670 W[email protected]
690,223,681 *474BE051959CFB6F11FFF170222E61A38331E96D [email protected]
690,223,682 *4741AEC91804888027B504F7393AEA53110DDB17 WESBENDU
690,223,683 *4745856D9B36AD0FB8F451342E457D576976AF24 whatthebuzzardtoldsuzanne
690,223,684 *4741489EC76908AA0956308FE56E237933CF1147 WILFRED.GILLIG
690,223,685 *474E0E728DD3678945597BE1F759AFAD4A36FFC9 willdesesso
690,223,686 *474F0EAD747B6C2BB10A28576CD46E0A00DF960E WILLIAMWOLLA
690,223,687 *474952346943B6A676B3F407D869DACAB3D34D4D WILMERELLITHORPE
690,223,688 *47481962CACFDBAFA9CED943F36026F79B6AB74B winfrednguyen
690,223,689 *474F4F52B348AF9866DF2840A8E24BB04EA6065B [email protected]
690,223,690 *474D0420A166AE25FD13B8EBE59FD43B0DD83F04 w!nd
690,223,691 *474EAEDCAB8644553D472DBD04098809CA7791F9 wong.khok.luong
690,223,692 *474948D533A8C9AA82F8E984FE99B6EA3C6801FC writeblocker
690,223,693 *474C9F4176FE9785AC726F21BE67F3187B3DA447 wwwaccinfocom
690,223,694 *4741CAE96C3161AD08D9C5211C576F536360A84F wwweisenhowerarchivesgov
690,223,695 *474C6A09F737896656234C09F18C8F7049DDEBA1 wwweso
690,223,696 *474A0E3AAF22C405B93E901A884AF5C873739327 [email protected]
690,223,697 *4746E833B1309227EC63CE5777BF63FC873155D7 }x{~`dp
690,223,698 *474A667DB2CA7F49F8BF57EB8C0A2F093F1A3754 XFILESOSCAR9
690,223,699 *4749D1C3808172CD20D66C89DC9FB511C368A602 [email protected]
690,223,700 *47414E790F16A7634960C982A5FE20C725502F95 XING興桂
690,223,701 *47465BAF7887150A6A791CA2029C4905FCC34A41 }X{ ~` ~` @q
690,223,702 *474C1B0D43125A4E536BA754160A31021E02540F [email protected]
690,223,703 *474A06EFE1BF0C6C83EEEB997ABC2FF029997E13 xv3j
690,223,704 *474B46D6F4C9E499156D6511081FB4773641DA63 [email protected]
690,223,705 *474BA92C8979B8D7795A0376733F0535FCDA0977 yandelajm1
690,223,706 *474355595D2C447229614067CD187D2EFB5EC6CF yefry
690,223,707 *474FB9DC8A09A3407C15C0634E1DD90F1A50575B YENIDENBSW1
690,223,708 *4741CB0249FD6B193286FA5BD167545162F854C7 YGOMORPH3
690,223,709 *474C1AD016AFADF82D5451D5569046C0B85E7AA4 YHENJANE
690,223,710 *4740D19E0DD575248414725FAE388D7DAA7EE23E [email protected]
690,223,711 *474C07FFCB96E911A583AD9F2D61E5C0E42A4780 ylwennued
690,223,712 *474B652972508961F540564F4F401087F1D6D56B YOSHIASHTUWAN
690,223,713 *4741CB67620DCE9457DEE428D88E2B56F3A6CFC6 youngcrickenberger
690,223,714 *4749AE6B2C9B22D33FFA8AD68D251D7B1B893D0F YOUNGMISSED
690,223,715 *474D469675044FC771A1B037179C552C2F2CDF70 YPHRETOYME8
690,223,716 *4747AB3C852532C4D458742DA1E8A05C6AA662E8 YTBN4NLEN2KJ
690,223,717 *474184A360244CE31F9348F540DD641FC47E6F7F YTIRUTEV9
690,223,718 *4744552E85ADF33430800377C5846D9775C3D78C yunfat's
690,223,719 *4740A2D1A2DD64AA839E21AEEBE067CA06689A54 YUSA MAR
690,223,720 *4741FFF0DEA34AEE6A03F165558459B0E5353F6D yves.bonin
690,223,721 *474F7B082939F7AEAEEE70F76B3A7A465C9D826D zaccheus-parker
690,223,722 *474A047C0C03185CDA08BE775BC4F0AA35090BDC zach.marano
690,223,723 *474C12117894C4CDD22B7FD85B13DAA4D326F105 zakiya.aubreyon.harris
690,223,724 *474FF9968886FCD03E2B517179D5EB14EDBDAB44 ZEIRIVAR1
690,223,725 *4745227DAF90BBAD7099D8826264247C14166D22 ZENNYGOOD
690,223,726 *474629BA1F0F6C9E31F40C13080CF292A2579614 zhean.robby.ganituen
690,223,727 *47481AAB274752AA8321695E8B36F91BF1FEE14C [email protected]
690,223,728 *47496B58973401A7B538740E6358F34961092192 [email protected]
690,223,729 *4748C4127A4BB6523F414E523C836B8E9230DE47 ZM(Q
690,223,730 *474A3F88D9815864D40A457D92417A67C673A5F4 سیمسونJAMES
690,223,731 *4741EA22DE0EDFCED9F18AE317C0801CA3E83E82 атреју
690,223,732 *4740DD241CC7E856C3FE3BCC8199F822EF0E6506 дхармашаллы
690,223,733 *474DE5C2E7A1BB1085FB8C4C1E80E53C4E60D7FB ПЛОХУВА
690,223,734 *474C9FEBA2F95B567A1FB03BC5EF5F5CA8FACD05 стороннее
690,223,735 *474A68A2319F31FAB77133979D26E070E2DEB7B4 ТЕРМІСТІВ
690,223,736 *474095C8E5577011791DBF4D512182DB0C017EEA хаппалаев
690,223,737 *474CB21C8F4EA4D777F0265E25AC81F80197DB1A [email protected]
690,223,738 *474D1BC1D2F44CD49F2E37018B0944C958B7CBF2 1102557 lopussa.oli.tunne.,.ett
690,223,739 *474DD1C72E770F9F44B6796708040A0560A66D8D 11: 11 # & DEMOCRAT
690,223,740 *4747F3C99C18A9253802AB8E70321557C046F734 11F3BOA7S
690,223,741 *474CB7611B6CEE1138579FD64067C1BF81FA6BE0 144697 IT-ALSO-BECOMES-THE-LEADING-SUPPLIER-IN-THE-US-.
690,223,742 *474E979BAA39D08CA546E0A7AB729B6023BE887B 16OLIVIA
690,223,743 *4744D5B5218751CDC5A746FCC4B684437C0CBA35 1808237 JOKA-TAPAUKSESSA-OLEN-L
690,223,744 *474847378923F8186C5E3B6529159CF8C431C9B1 187948 SIE DENKT OFT AN DROGEN .
690,223,745 *474764F48B73F3239AE673176C41657747E63EB3 195329 wieviellastdarfeinerdemanderensein?
690,223,746 *4741990504EF9EEFE44D2C09AB957A0124F96FB3 1.AMMUKSISSA
690,223,747 *4746590B6E9FFA6E68C91B99EBE1B8CFA52CB347 1-baGlandi
690,223,748 *474A6BA6FDC1C2A6159891C0B26A05940E4E9EA1 1.dassmsver
690,223,749 *474BB01EE380BF3BADCF3A60E3D3763C5EFC3B72 1duidelijker
690,223,750 *47408F9DF81DA30E2C905D10BA496498255EB08E 1-halbheimlich
690,223,751 *4743BE342D21CEBA038FD77E2DD4D64FC79A332A 1.INTROAKTIIVI
690,223,752 *474322A1111993AC62C26EF79D33AB7EDCD907B8 1-JAHRHUNDERT-ENDE
690,223,753 *474E3132B7633902E0330FD194C42676471500AA 1 KARJAKOOSTA
690,223,754 *47467A3B4F144111817587BC2B6E1EEFEA2616C0 1KETTLECA
690,223,755 *474DA7BC25BFE96632FEE6FDE834BC4D667A27EB 1.LEVITYKSI
690,223,756 *474D17F38E53EA5CFE9C53E6D1CC5224571434FA 1lightly-sweet
690,223,757 *47427B6A9A606759F7048D12085CE573C5A4130C 1matinkoski
690,223,758 *474C9D2D08A85D256B4738169EBE25CF73390AD4 1 MUO-DOISSAAN
690,223,759 *474ED9F5DA0557F07D138A265E82F71FC2E4A0CA 1Q2W3E4R5285
690,223,760 *4742B5640AFC87B4157B42F384607EBC89E5040A 1rantapuuhun
690,223,761 *47419ADD23056C9A7CB48B8FEB8052CAA9BBE98B 1.street-clean-up
690,223,762 *474F8ADD386316F2CA3F2342B315A852BB55923B 1 suedlichhellen
690,223,763 *47485C39FB095E4371C77F293F0E808ADACDEC40 1.TAPULISTA
690,223,764 *47469E8607B3996AC34F4A3E9BFF5B8DDC6672DB 1.telemecanique-tuotteita
690,223,765 *474574CEF951F9DD25DD1044EC93F38611351E60 1thatlucas4
690,223,766 *47431479E49ACBAF2160A7945C01E8032094CC96 1yemedikce
690,223,767 *4745D0466CE23224DCD7F58ED0A705BF2A7E2CF7 20THCENTURYHITSFORANEWMILLENNIUM(DISC6:19801989)
690,223,768 *474061E2FD10F271281400BFE4EE93F02BF97663 2217221 KOLUMBIAKANTAAMAAILMANVAARALLISIMMANMAANMAINETTA.
690,223,769 *47423A674633E84DAB1E540B1ADCC6BD48642278 223QETUO
690,223,770 *474345447AC91582897EF580F53AA8CF228F19A8 2545895 KURSSIN SIS
690,223,771 *4749FB74453932A335B2D3FAC4FF72755770EBB8 260.SEQUELS
690,223,772 *4740D74549547ED3EE7F130E836F7603112FB311 26OIREISTON
690,223,773 *4741A0B82E33D77EC7CD8C9E203611B5AD60990B 2770680 jokainen.meist
690,223,774 *474EA29FC5984851FF26DCFCDFFB479BF1649EA1 2778700 kaikki-kyselev
690,223,775 *474A97D6EDC1A27BB04B670B9A4E348DC4F88DB9 2822030 MOLEMPIEN KAAPELEIDEN TEKNISET TIEDOT OVAT SAMAT .
690,223,776 *4741CD6E67C28957740581AC6FD5E0F73640DAF1 2halloffamer
690,223,777 *474167D61FF21A2B8D952F396B7C02C49AC2CF04 2-ilerlediGimizde
690,223,778 *4743602DEDBD63701BEB8A3A8066137796A6BE8D 2KGV-VEREINSLEBEN
690,223,779 *474A0AF51A0C17B769FAD073E6A506233AA170BD 2-opettajistoa
690,223,780 *47402CA27694D1D5F219B6CDCC1433EE886B2BD2 2PULCINI
690,223,781 *474FA30EB7B26D5C737AF71E83932EC66A881294 2-RANKKARISSAAN
690,223,782 *4747877400E85C2A5C16D1F09EF0E8541CD63E4B 2regierungsraetliches
690,223,783 *4740F4D566F9BE60E0B2B7D1ED9C23E31B9DB967 2THATRICHARDS0
690,223,784 *4742C7207DC32C5202943A53E8B74756FA8509EE 3----b~.~.(0-0)
690,223,785 *47433B9B7DBA76DD05066CC7600D7BE925478C62 3##b * *}8{
690,223,786 *474CAF68C0C222C8E8A6B6C1C4101CEB231A2659 3####B`~-`~-}O{
690,223,787 *47424A656FF7D6BD32605C645FE382B691E33B86 3---B.`~.`~SPLAT!
690,223,788 *4745ED3F20798677E9CFAE7C6ABC36B9FDEB2B65 $3DUC710N$
690,223,789 *47473AF85E588EBF2890B8B326D561A78F149682 3KWIZARD
690,223,790 *47435BD830D7A9952DFF24C464D5CB4C3709873D 3PREDEFIN
690,223,791 *474721C769E93F719490950CAAEAF97661639302 3UM1T0515
690,223,792 *4741E1DDA49D3BA17D42FED89BAA8794800B41BA 402972 interrail-keskustelu-majoitus-otsikko-:-re-:-vilna-l
690,223,793 *4747936270B869C6EC0361CCB38DC7A4B060E5E0 426600 at&t-said-it-doesn't-plan-to-shed-these-businesses-.
690,223,794 *4745AF8833B75A3557376E31EB8FA4D968AF1389 45valtiovarainministerit
690,223,795 *47488B8ECC8CFD5FA192B3A06678E659F2F65700 4M型
690,223,796 *474A45362B9F0E4FCA1F0B3F4785B333CFD7C0AF 4PRTTCHMNT
690,223,797 *4741AF8DEDED4E0E4E028534B144EB37EB00E9C7 4SALUDAN
690,223,798 *474FB38836CEBEF01D0A2C3D01480F4AE3EDD8A2 4TUFFGUY
690,223,799 *474D3BBE5BA70264FF6F87A8808D41DB49928ED4 5-10-1441
690,223,800 *4746C6C08E04089011B7953E26C9775A0FC1C0D6 5387 NE-OVAT-OLLEET-NYT-SIIN
690,223,801 *4744CA625A1B5394E094CC13F1D18182ED5D7279 5BALLSMINNIE
690,223,802 *47459EF9D9599F24A123951AF80A427F31F05648 5BIGDOGKILLME
690,223,803 *474AB889C650528462DFF1FDC195139750A51866 5BRONCOSCHARGERS
690,223,804 *4748EF1A23CF151F4D441A1E859E383E80419D99 5COPARTAG
690,223,805 *474A794513687DDF3DCFB494555332981B178FE3 5LUFYRESRUN
690,223,806 *4745F270F915528FA46BDE2340EDC64732AC7EB7 5M3WQMAKY
690,223,807 *474A83548CF1E535F5D2F36BD185EE83D691840F 5ojrhv
690,223,808 *47456E73B3F70B39F64E73AB0D0A7F9A556085AF 5ONBELEMMERDE
690,223,809 *4747032D08ED9921F609EAE686111E9FD8C671C5 5PILAIKSI
690,223,810 *474A655E56957592CC44FB04B1B79FE4C365CDDB 5PUPPYLIZARD
690,223,811 *47499ECBCCEED83031A17ACCB71DE2220EE7DEFE 5WEITERDRUCKST
690,223,812 *474478454DD3B66F8C45A960A816C3F7EB9ECEE5 5ZEPPELINLORRAINE
690,223,813 *474E39CFDEE29187A27ABFE74B2670073D3489C9 612766 nemahdollistavattehokkaansekahallinnan
690,223,814 *474D372DF7925EF63B1D1B351E8EE57D58238416 62179 painetun-asiakaslehden-artikkeleissa-aiheita-syvennet
690,223,815 *47490AD5DB81EED13705C4938A7334A6599B3F36 6AQSABSW
690,223,816 *474299DA7F03ED1D2ACCB0842FB708FD004B9378 6BSWHANSHAWBSW
690,223,817 *474A66962F3E1C079570183CEB02AE11F197BEB5 6CLUTTERVIN
690,223,818 *474FA33CA861872359D786EA4CD7227ABBB4FC4B 6ECLAIRERIONSES
690,223,819 *474D3025C3CDBFE07774BFB19703B3274FD00F9C 6GOWERNOUR
690,223,820 *4746D7C196B66C0812720F4DF35CC4FAB2D7A941 6PORTERCOBRA
690,223,821 *474DC4ADD5DA7D45500E7DCC800D0DEC70E32FDE 6PRAKTIJKS
690,223,822 *474178783220B812342BA3C6FF9EB8DFD7613C3A 6SCHIRREFSTUTHE
690,223,823 *474FB854E36CA7C834FC7873BDB7E82683FB6C51 6THATLORRIE3
690,223,824 *4746B58D0153C96D0D7AF0304A7D509F17402020 6TNASSITSEVART
690,223,825 *47486A9766542A25FDD3AF248731E4EA9E2EB2F4 6VEELJARIGS
690,223,826 *474C5BF6F9156513246E36329A707FDDFDF0FE0F 710TIARA
690,223,827 *474BF48B1E308E5A8BAE6F94B91AD8FC40FBF4F8 7.aluepalat
690,223,828 *47424BB237B4E46AD3D754BFD78CF2A4E5E72B55 7CURTAINDRUGDULLEASY
690,223,829 *474895D25CF0BE9690A3A7CAFE339A5C9E004634 7ILOVESHRJ
690,223,830 *47490A51DA24863ADFAF224DB3E8680702F7C4DD 7KYKYISET
690,223,831 *47455E3B55ED494098728DD53D68BBA950D94C8E 7MANAVILINS
690,223,832 *474EC026CEF0FCBB4CB79F9C958D93E53F0F4CB4 7PERICLEANS
690,223,833 *47493025E7BD827783D334335A11A10714EB679D 7SESOONRUB
690,223,834 *474B1FF78A69B80C17FC0C366B9E9CE0ABB2E15F 7THEJOJO9
690,223,835 *4747156CDEE5422B28882BC41E8F002049FDEAEC 8HOXFORD
690,223,836 *4748F91937D9B178FC3ABF05135467D41084D9E2 8INDSENDENDES
690,223,837 *474D6196B10B61628ACCB09D4FADF5B5CEF4580A 8#####@~O~OO->-<
690,223,838 *4747B8350700C884740E7E8DA9A5BAF835DBBBF5 8######@~o-~osplat!
690,223,839 *47469EF26ACF5C3B705BB1E629555037E44F1D80 8##p~o-~o(>_<)
690,223,840 *474771C32228E1692C68DA153B296819F1E5612F 8SAMMENBLANDENDES
690,223,841 *47491904E4F4E68640B7D1B1B3D2C17069712787 8THATALASKA0
690,223,842 *474C958FDB7D56E524740D843C4035D587906A0E 8VIKINGHEARTS
690,223,843 *47489DB0E022EA00ED8F737794F2F4C11E8A8A74 8VISAFUGAZI
690,223,844 *474B82D36A683942EEE2868A10DEC53357DB2E1E 988318 muuttaminen-l
690,223,845 *474E9BBEFAEEAFEB5C68E24A4A3C4C9EC201B99A 9ARMANGEL
690,223,846 *4745E4BD6967637FC625C18A622D8323C8096FD7 9BSWBEGTEXTBSW
690,223,847 *474E2FA8328D2817055B75F54B362522763DAD44 9BSWBIOSPECIFICSBSW
690,223,848 *4745C2A6C1C8A1A241A86C5FD53764F738A544AD 9EHTYMTN
690,223,849 *474A87D4ACE2CF3A969B46E02D0DB920BA0B1364 9EXPLODEBLOCKTYPE
690,223,850 *474354EEDB32755DE861878006F93E67AD2ADB79 9FUTURECONNECT
690,223,851 *474F5DDD081DEF64E6F3CE5B3F61B3B77D791E11 9INSTITUUTEISTA
690,223,852 *474B0C509D27E9E553BD41B346348E28A9BF917A 9SERWICK
690,223,853 *47442A90815E9FA8690448A161C08894E79DE9C6 9ZAAKKUNDIG
690,223,854 *474BEF44429E05D312E49D4D6073821DB510B650 [email protected]
690,223,855 *4747C4024C8AEDA36935A55D49DDD849FF65F093 A8F%;
690,223,856 *474D0D2F040252A3B5B06B834457B616B714CCC2 AA:6T
690,223,857 *47487692EEA1F57D068E52D45C17471FFC61F658 AA'F]
690,223,858 *4749385449D43583A4B3E68D7A0559033405516D ABBYMODEM8
690,223,859 *474EEA74E1A663A6F7A4101EB4955A0B0B9C5115 ABDUL.WESKE
690,223,860 *474C2D6CE852A0677543A3DA5836195B752CD27F abgespltes4
690,223,861 *474CC48D92A46BDC04A0250B7CE26C398406FAEE ABIGAILOATMEAL2
690,223,862 *4749646A943DA8F5106E12CD2CC9E2C73D456190 ABU:)
690,223,863 *47436B8148FD809CFE8A4B84CC14ACD5330781C8 ACSO
690,223,864 *474A559F3D501AA1D30A8DCECA2AA9A2B0C8F007 AD(ZG
690,223,865 *47495EED1C83D5F21E52B4D72D2600A39013C232 afdraafde1
690,223,866 *4743C5D3EA779CECA17846FE76CE582CE848B07B agudnkil7
690,223,867 *4741447B0B4A6849E689CF746C2F0FB903FADBB0 aichienses
690,223,868 *4742CAE6AD017F59AF2057B03ECB09F21C386AE4 ALFREDEVA
690,223,869 *474D1250434BE52180A78947D6B5DB2BB953A020 ALFREDO.HITT
690,223,870 *474E1AF1426F49EE89ED45EE21FBD8ECCABEC986 ALI TURHAN
690,223,871 *474776D9C9288A616AF8EBF438AF3DD0B5C810ED allellies
690,223,872 *474B20259E93D9A64837AA45312D37CC878E84F6 amanican'tlivewithout
690,223,873 *474E0D3AD8E5AD13D7A944CEBF36615A9237FAFD ANATA-O-OMOU
690,223,874 *47493D220F811A8BEC63D78FBD4737867B198343 andreboily
690,223,875 *474ABDB7708A523FA59A35732D58BFCAEF593B3E APCM
690,223,876 *4746594806996D5AE5888C7826FDF2731FF4DA81 a(q#6
690,223,877 *4746CE322E04ED1818A8EAC3248267930EBF67F2 A?QG_
690,223,878 *4744974C1D0B56C4A8E2D50F7736157B469A3C13 archiel.
690,223,879 *47489C259498471DE6501138C94A52B7A9049750 ASADEFRANCE
690,223,880 *47403E41D0B1D53034C322BF9ECEC31E4634F015 as"gr
690,223,881 *474679D64E9F1C562267E26D46981E2279D82406 asiancuban
690,223,882 *47432A799B80E9A550CE16BC39614229B008F7A7 A%SOY
690,223,883 *474FF0C56B775D2753E499BF94823622EA297337 ASWR2
690,223,884 *47423B534CDC6C93C883C1C77C37E7A19928A4CF AUBERTIDE
690,223,885 *47466D8A4F6407F7E912FE7A6CEAA0D2E11247F3 augustsongster
690,223,886 *4745806A2982FCC16783231EF06A6C8B49E088FA auhbb
690,223,887 *4749C3D744E4FE2279E662485855796CA41051D4 AUTO-LOOKUP
690,223,888 *47417BFD152FCCB67969034812E1B1863B96E56D averycepin
690,223,889 *474669140BD750F0F463E89D011694F638E16218 [email protected]
690,223,890 *4741C81CC3EF646C8B565A35893C12EAC27CD603 AVUF?
690,223,891 *4747121A7AAB12946E063CB77568AEC711EF6672 B0!S+ER0USLY
690,223,892 *474B544BE6E08C0B97153425918A83C99EE7CAE1 B6CEV
690,223,893 *474FA28BA73EA9A90C1F2158EF508DD5DC29CB01 bandakpa6
690,223,894 *474FAF7E30B23CB41C2A2CB9EBB9538D53A6261F baverents
690,223,895 *47450E8DB48B4961BAA4D29FD2D39FA42E057C6F BD81AD0E9FE03DF383304A873B074730
690,223,896 *474E96786A11430AA124F121DF9D17ADD44B92C4 b!dcn
690,223,897 *474BA174B9D55B6C2C6852EBF8AFF147EADFE5B8 BdN"
690,223,898 *4742BF35E72606F90D83F6F4A807715EE3783870 BEBOELIGT4
690,223,899 *4749938FD0F56F9AE69638A6316E2D81CD5C27C9 belleisletech
690,223,900 *47461DE1EFD9A04E1A85385EAE4C7D1E4680BD08 BERNARDO.REIK
690,223,901 *47479D105063C52226FBEED06EAEFAE210C33062 BERTRAM.YAMPOLSKY
690,223,902 *47407B3243431C5FE8FE2AAA69E911127A0054C4 BESCHREIBUNGANSCHL
690,223,903 *474777C923C2D5CEB85BD9E6F79BEA4266A14E68 B$FCP
690,223,904 *474A4376AA5A8FF0EA6639D42988702896ADE96F BFVDI
690,223,905 *47431496361487AF541EA215AB446347EB8EBE94 Bht
690,223,906 *47477C00E5A22E77B7903EFDDF7C2EF4962CA1C9 BLEAKS
690,223,907 *474B994A000531093DE0BE4C48966FA3F20EEE86 [email protected]
690,223,908 *4744744D7E7762AA1B47BAE3325A75332CA7BAF5 BMBH4
690,223,909 *47400C6E7D8BB2CB434C98778AD6DA73CBF85CC2 bobbywolvin
690,223,910 *474DCFC98985C2AAA564B93E107E9943B688E264 [email protected]
690,223,911 *47406EF1736F14F2F82A7C674D7F31FEA50898F5 bok)b
690,223,912 *474033248429D637771C1E739E1B167A4E2BEF68 B(OM
690,223,913 *4746A17F3F23FA8DEB29159A4D93E725D56CF8A1 B=OSQ
690,223,914 *474B3B5D485A299CBBD6DFF2E0D91CD3A927FF24 bq%.
690,223,915 *47426C7D4AE7F8C380001F25F687995456E6740C BRADFORDTIGHE
690,223,916 *474CC2D2C76D80675C5E7BC0F40D3406F535583C BRAIN.KOUNICK
690,223,917 *474EDCA2AFE7257C763C7AB04ED715893683F10A BRB=H
690,223,918 *47475B8B7994989C9DF4603B82FF6DB7B94F032C brett.bradbury
690,223,919 *474449B6735393663957D761A6D02E48203AA29E BRITTANY FLANDERS
690,223,920 *47477BFD50AE887858DCD396EE3365FEF458DE44 BRODERICK.KNAUS
690,223,921 *474BBF28444DE07F2A8607DE63B6A021370BA26F BROOKSSCHATTSCHNEID
690,223,922 *474605C75D6156F76F4491456CABE065C4AC3BCB BRQ!E
690,223,923 *47435A35B29EC2DD23AAC25CE6E68F324EDAF237 brycemascall
690,223,924 *474756B065060012E7B1571D276D8BAF617EDA78 BS$9:
690,223,925 *47450F150FD991E75193D6A1EF2BC79AD4882176 bswferraioli
690,223,926 *474F1DF244387EC4A8EF150A8607A2BFB2FE398C bt-5v
690,223,927 *4743AC446E0F0AF52014EE7B8FD390E1CFDF3443 BULGARIAN-2
690,223,928 *4742BE1035A382A19F0C4952CC3064078C5C7787 buonu
690,223,929 *474EC51F646B3145AC0D7466AFA49A20100110D8 butohnotlovelyhelen...
690,223,930 *47404E13522B943928B782354E64263C8B8A6D5E bvu/"
690,223,931 *474D0CC085130E61856A7D2DB58EA224541E66FA B"V-X
690,223,932 *474351D03D612B79317FD544BD2576BD85145BD3 b#yg?
690,223,933 *4740C4B1125E7F42E88964748A2ED47D126C1515 byronpastuch
690,223,934 *474FCB67940AD34603E6B7D45EF39477B8508BA3 BZv
690,223,935 *47484E6269811868CD7CC1256A528822B6AC759F C21.16 THAT FOUL, LYING, TWISTING OLD GARGOYLE
690,223,936 *4745247105E140029946BCA2A9ACD1E309059DFD C4PRC0U$N3$$
690,223,937 *474B190EA01D2432B3809978FC52E391BD387D79 C4U=D
690,223,938 *47494202BEF7A9CFC00DA736FA68F3A4CFD2DE38 ca#0d
690,223,939 *47403FB52D029B3B480C7DA3C0A61DF961B490F8 cannonry
690,223,940 *4746BF620886F5FF0332F18E980A357381EA5E08 cardiganclad
690,223,941 *4742D6AECB8B9B367398E8BEA646A6A6138D1607 CAREY.PAVISH
690,223,942 *474C34B7116041DC973F54920D8FFF3E6A5F2325 carlotaplanas
690,223,943 *4746B8648C73E96640E524758D6A441AE7289DB5 caso
690,223,944 *47499925C188EFA97F8BDD8305E9C188E2EF7D9A c%cim
690,223,945 *4749568EEFBD49044E7F1EE9DD00925F144C913D cd23,
690,223,946 *474F4BF322440EB9D6A0F41A16755488D97D8751 c:\documents-and-settings\firexware\application-data\mozilla\firefox\profiles\fiisp02ddefault\extensions\[email protected]\chrome\innerjar
690,223,947 *4742CB289966C95E5C844C611DCCA6F3205F693B celia-venter
690,223,948 *474C99CD6A79DFE73F503E0179B508BD520E3E34 CERDENNA
690,223,949 *474B20485AD16FD52776E637AD03C484420E1AF7 championship-division
690,223,950 *474373A3055FF07165BBEAC693409F41EBC8A250 christinelusty
690,223,951 *4749435C410C6C09B4E06E6BCA83550A1D11E23E Cidh
690,223,952 *47467FCFD4E74182AF5618EF193AE3A1DD8EA9B4 c,,lb
690,223,953 *47417D3F96D7D1D04CA96EB9A3F8634605D5CB82 CLYPEASTROIDEING
690,223,954 *4745948CF0DE26C364BA911517E62A9A4B33A6AE CM?QY
690,223,955 *474A84AE0AE86F97FB719AFCE3C56C5191B8D71F COLBY.DEASON
690,223,956 *4749AC1BCCD5BA6A3995B093EB2E57B94F384904 colemanhollywood
690,223,957 *47494E6CBF86FBAB4291942AF5128524B4D05412 [email protected]
690,223,958 *47483E229F6A7B2EF290512A17E40BE64700DB0C CONNIE.MENARD
690,223,959 *474F3447174A8D3DC22D77EA2658B9FA7E34522F [email protected]$
690,223,960 *4747F60745A5A01F721CBD435380E105EB1E3810 CO&QD
690,223,961 *4740DEDEDB924E45D0BC40EEE3C562BB38E01D76 CORNELIUS.DAWAHOYA
690,223,962 *474AB81A61F37EEF22C1EE0804ADBB329B9D7C0A CORTEZ.PURCE
690,223,963 *47423EAC164F7B9CAE2F80C77403F14399A3A29F courtneyprevost
690,223,964 *474AA3AC0C2586FD37B492CAE87F1C9A53DE6A6A c=p#h
690,223,965 *474153C55F281123E5878CCBF4647DE749C0EFD9 c:\programfiles\microsoftoffice\office12\groove\tooldata\groove.net\grooveforms4\bg_earthy.gif
690,223,966 *4746E5192E687297A5A91B004CF01C3B4B44BB89 CP$VT
690,223,967 *474F8BDD6D594ADD3675CA10951E66EF66ACB29A c#"rv
690,223,968 *4746EF47FDA05FABB7622E70FEA8773ACDD93DF5 CSIJI
690,223,969 *474E1DE31FC58277B5B8650F55AB0E204E22F00C ctrdl
690,223,970 *474E7A15FA938594F875B0DE01F5E9FB3757A33E CULMINATED
690,223,971 *47444EE74C0491D2B1454731A231086DE3F43701 cyrilmclatchy
690,223,972 *474286022F94522FE2E249F2F4D9168F9EB37FB0 cz03
690,223,973 *474A0F2A5C1A3F3A5EACB27993F1C74C9F5FAEDA D4HDJ
690,223,974 *4749B89D27E29333CFF5CC06D59128DA488F9B97 DA&CB
690,223,975 *4745D3FA73F115543907BC385DC47B44DCA3F290 [email protected]
690,223,976 *47499FD3DD6194DD5A7624F92FD41F8FFE283423 damello1
690,223,977 *4740852E17DD1E2EDE2296B0649CA449F6582BB7 DARIOGUSSOW
690,223,978 *47459251AC20D3FE9536C6395A1C1E998C9532F9 DARRICKWOOTAN
690,223,979 *4748CC76E640BCD1299F190E4EBE1B7DBBA4FF9F DARRYL123
690,223,980 *4745C3DE1809A0EEA416E6506AA7D8930D612263 DC1E.
690,223,981 *474CF4DE6EE2C7D1C7E626276E32DB5953876586 D&CF
690,223,982 *47476D4752A5F286FA19371F09FB3DA13E0167FC DELLIKSNU1
690,223,983 *474617E641DF3CE11CE6409450CFB9FC02831C3B DEL!NEAT!ONS
690,223,984 *474120FCE81867BED567575B8A9C9BE088DD124A deppotri9
690,223,985 *4741B88B00BA050DD255BD449A64051B61046C40 DESKTOPAUSF
690,223,986 *474FA9E57F1E02F16E0085A8B1A7530A66136789 DESNUDOPARASIEMPRE(DESPEDAZADOPORMILPARTES)
690,223,987 *4749B197E5AFD3DCDA230C381AD1B09EEC847336 [email protected]
690,223,988 *47463D79E8043C7B46CC620C0F090C40870F25AC DEVELOPERHOME
690,223,989 *474EBF5CAE5D81CBDBE819FE50AC3DD288BCEB04 DEWEYPOPP
690,223,990 *474C513630DDA3972D45F41EA1977729A979FEC5 dgkg;
690,223,991 *474AA7DDCF330F28D47C962017E86581F24F2E10 D&H3M
690,223,992 *474C8C6A3AFF1F72987E4D8251816B1149891280 DIANA.HOVSEPIAN
690,223,993 *474621506313DE361C226EEA0DD6F844F3802815 dilini-nisansala
690,223,994 *474B8AB65260BED69BC1EBC4ACB541502B8426CC DINORAJEWSKI
690,223,995 *4744474ED64C695649712F8F13F21932B49562DC DIRARS
690,223,996 *4749BBB9CA0A95BEAE88C4D4F74B2B0803795902 dirknacci
690,223,997 *474623DB8D9020A232811079ABBF529A5CD83CE9 DISORDERS(英文)
690,223,998 *47414FE18BD5AF334464732988E7EFEB36BF4183 DISTRAINED7
690,223,999 *4749749A24FC55618EDA4842EB210F0ABD92A7DD DL:EZ
690,224,000 *4743E7EE037C28BA6558109FCAAC36F588E38200 DODGEDEMON1684
690,224,001 *4749EE0409847BE3F062D3F33B4E2C121CA32FEF dolphinjessie
690,224,002 *4749753B22EB0B92D5B452570F9B641DE52EF041 DONNAFINNERAN
690,224,003 *474461A1E468EE5D57DCE82BACF1EBACFDE67A4B DOPPELNAMENSGEBUNG
690,224,004 *474D3DDCCA89E372922CA288EE417BEC54ED8347 dow#t
690,224,005 *4749954C23D66FBD66D474BF94880737136FA228 dq;+2
690,224,006 *474CA85C67CA1866B8908A3D2641EFD943E5AAF3 DQAQ
690,224,007 *474FC6F6444BB1E6D3F314FBED7F5274E981CE26 d+$t;
690,224,008 *474049CF5DF440727CE2FE117BFD8C1987485A1D DTHCF
690,224,009 *474F41F2B8B73C680929A8846CAF532E422E789C DV!KR
690,224,010 *4743466F5950F21CEA1670CE2923996BC5EE3407 dwov
690,224,011 *47478814E452284A17D7E3A1CB2BA381CF4E2CB8 DYLANELDIB
690,224,012 *4742D568D97D954A3DDD0A5B8AF50800B99C3E6C earthkin2
690,224,013 *474014DA145AECF72B96022FD17C5BB9BB318C55 EFBY
690,224,014 *474FF90A8A2622AAC110F0BE4D5BC62E81A110B3 ehg?i
690,224,015 *4746DB0BD7EF0589A0ABCA9EDF3D46279AAEC4D3 [email protected]
690,224,016 *474B70E7668296BE3FBCA685AFBBE168A6C623AC EI3WO
690,224,017 *474416B9F5BC6A2CF92770BC02EEDCCA37BBF0CE ELDRIDGECARDENAL
690,224,018 *474929BD5EFBBD723DEF019AB8FF46E6C5F0AA0D eldridgerevelle
690,224,019 *474FD5DECC394F82FCB771EE82C7160721AE9D8A ELISHA.CLEMMENS
690,224,020 *474EE7BC6B5E1D6C7C8805709EA7FD0F7297D4A1 em!9r4+!ons
690,224,021 *474E38ED2AD1A8043A8A30B635237F8F46592BE6 eniwenis0
690,224,022 *474A2ECA9AB1CA3BD38E5297EDF6C1C10A354E6E ENJOY THE SILENCE (WORKIDZ REMIX) (FEAT FOR THE MASSES)
690,224,023 *474AB1C232C5C5E533D711F6225D03A8A57E847F EPIPHYLLUM GRANDE
690,224,024 *474D4CEB16A468C4D454C50ACEBAA43E4CA77AE5 eq3nm
690,224,025 *474303584A6A7CD1E9EF7BC6D3537CCD6EF598BE eq=sx
690,224,026 *4746948C2027D765B0B7AA491B5E73653B4C8D81 erinmachan
690,224,027 *4746280B358903E9D5188897D2CA77F61498728B ernestoohashi
690,224,028 *474AE1AF97E7694AD108D31F55044A4061CB7B64 ERNIE.PRITCHETT
690,224,029 *47482EC4CE10B635C9E505EA52447AF5375703E5 esh_2
690,224,030 *474EFCD83FA36A6BF0BCC215C5188CE2ADBEC6F6 esjuhlaa
690,224,031 *474B99059838A8F5E1E66E542482221B15A79158 ETHYLSULFONYL
690,224,032 *4748A97420C2B067F80F11942E98F19C999400D4 EXTRADERAIS7
690,224,033 *474B13A59C519D71A5B1B7F426A176E53607AF8D F3ARL3$$L
690,224,034 *474982516DE3B4548AAE0C245E26919470F6D496 F-86D-20-NA
690,224,035 *474074DC7D7594269C90AAB7EF4373809BB300F4 FĀKHTULIFA
690,224,036 *474A096A4CAE4E5362B1085A96A9C5486F125774 FAUSTINODUNLOW
690,224,037 *474432698A8B6364717BAE499AD1D0BF0B485D35 FELICIAF1
690,224,038 *4747F90DBE13BC8FC80013CA4623ED58386C655A [email protected]
690,224,039 *474AADC8FC9A03FB5986863D7D93A57A9BF70CBB FIDEL.STEPHANO
690,224,040 *4748C87B4291EC6E3F99BC3F8BBABD0A54487DB7 fl?
690,224,041 *474AB67E02A9AB6F37ACE790BAB43C96669741D8 FLORENCIO.DURSO
690,224,042 *474FE7D2074DD5C2AD0697EAA03B1E30704BA330 flstrdned
690,224,043 *474148352F3FDBBB466ADF787EC46648DB6D30BB FRANSUZKI
690,224,044 *47401EA3E625C40D1EB35761D4434B49F3FC7B3C FRESDRIKSDAL
690,224,045 *474D67970F521465B65EAA5703F2A554081F146D [email protected]
690,224,046 *4745F95B1B002A0A8C69F8D1E822CB96AEE92DB0 Fund4m3n74l5m
690,224,047 *474B1FD77C8E401D49FF218821FA04F3DF8951A3 galekurzyniec
690,224,048 *4746B5278ED181A4BEC4475BDCB8CA1C201757C4 gambitq5
690,224,049 *47474665BAA6D9C5BD123300152A7048005D4219 GANDRAHENNADIGE
690,224,050 *4749B43C8B008D462578520AB28FAE2ECD53DD58 gary.conroy
690,224,051 *4744472E465C901FA5DAE7944EEE3B0A0F5FE18D gaspard-gustave-coriolis
690,224,052 *474ABD84A8746184F8FC57035B708490EBD2AC55 gavin-comeaux
690,224,053 *474C06E5502E864C3ED07CEE6E18841A7380C866 GELRENÉL
690,224,054 *4747DBB193445AE267FC37961906316396F78B55 genaroarntzen
690,224,055 *4749AD133755F6D30EF3BAB01FF4FEF35799F17D GERARD.OVERSTROM
690,224,056 *474EEA9AFA721F0B9C1D831A1E15BFC2F843D597 geschwind4
690,224,057 *4748BA7D027BD0374B20455560963E2AB20E2E03 get-your-wings
690,224,058 *4742B6D92434A145A56263DBECAFFED51CCE76D5 gm-05 (mission start version 2)
690,224,059 *4740ECF0D79F2FCB3A966D31A891D9A4C31A7670 [email protected]
690,224,060 *474BA69AD2234AE4DD4857523E71BC8D011984FE GO-FIGURE-(FEAT-KRISTEN-HARRISON)
690,224,061 *47441D600371053810CC0B6B2BE827D2C7DB6E72 GRADYSURLS
690,224,062 *474DB0C417065F387DBED8AB3580DD65CA8A13C4 gramstils
690,224,063 *474EBF821C5EA47A6DBD50742E02788DECF8283B GREFNUMIN4
690,224,064 *4747104997ECE4E332FB78AE9B6A0C9C680CCDC7 GREGORIOMAHONE
690,224,065 *47487A0F5C3B4EA76121D5A951521AE75097853D GRIVELL1
690,224,066 *47466DBA96D360BD701817174658EDF681F7316C grupos.de.rock.de.estados.unidos
690,224,067 *47419A2142AB9B73F98DD06D886A1CB281F53779 GUADALUPENANKA
690,224,068 *4742273FC3FC06F76F68BECEA04DB276F121F847 GUADEBRO
690,224,069 *474A898D3A4CC9614F460B77D99ACF5FC80458F6 [email protected]
690,224,070 *474B0BF408CEA049136E1DEF2B9C1240F5CFABEF guidelinesdhartung
690,224,071 *47486EA9A3F45B65D4130EB67E5138A28C224156 gunnwalberg
690,224,072 *474A6C8BC664C8F34A8E091EBCACD839B20BB232 [email protected]
690,224,073 *47481BCB58F0C4C5D3951692CF0C0508A3288790 H103767
690,224,074 *4748FB5D5CF465E332DBD237D4CD6DA7EAAAA514 [email protected]$E$
690,224,075 *47408DC167BBB3479DC7D839182DC14C3EDE1FCB <H2><A-NAME="HDR8.3-3-36">8.3-SYSTEM-DEFINED-ORDERING</A></H2>
690,224,076 *4742090CF8AF47BEFB5CCD5DC96DE800C9ECA71F hatebur
690,224,077 *474EDA1FEF55036FD57FCED56C9BD0FDEBA261AD heart-on-the-line-(operator,-operator)
690,224,078 *4742CB058F805D3D2AEB9D613276F39DA1B7E08C HEBRAIZING1
690,224,079 *474E11D8D5C2D341EBA029A506C4ABFE48D089DA HEMATOPORPHYR1N
690,224,080 *474DA5C5D29E82C2F8E2CDF848D15BE9F9575519 HERIBERTOKISHBAUGH
690,224,081 *474993830B83F921C82567B92364511E84812FA5 HEY-ZOOSE
690,224,082 *47420DE88D59F4A12873D04E85E3B77092414B48 hightechentertainme
690,224,083 *47482C45E8015B7C6756FE90D0F4B1C9C2FD81CA HI-MD-LP
690,224,084 *47497D4C9131DFCBE610213948502C1EC5F1515B HIPOLITO.DOUGHTY
690,224,085 *474E51D4FCD308C8D90D52509BBE876F95921761 [email protected]
690,224,086 *47442438486848C8886B56CEEC4F38B13020599E hljg
690,224,087 *474CCE2D9C0C3920350151C01B945612A3C39C93 hollismuller
690,224,088 *47478A1DD0EEDE8D2D855703E91421702C754F39 horsell5
690,224,089 *47413831C8724E5A6E3C2F04B6631001383DA8B7 HUGHZELEK
690,224,090 *474C2AC0ACCBDA95B47F6804B704F1FE9AA69AD6 HUSKIES55
690,224,091 *474CAFDD2CD147557E506BA6E534D1E801BB1258 h键时,在c
690,224,092 *4740A46A85565DE78E91F124B7C1516D460AE32D IAMFUZZ05
690,224,093 *47460A888EDBE2B252DFCEAAF20AD109D47B70F5 IAMPACIFIC61
690,224,094 *47473D9DB6F3FA7BF7AB8D0A88E6718EF0E24228 ignacioeggleston
690,224,095 *4744AFBE84F78648CD44F5E349B7B94986408A54 IMAGEAAYAKYUUJINSEI
690,224,096 *474412F70BC1E5E7757996583CCB82A925CE8242 (induced
690,224,097 *474EE5692E34A6CD9A7B715B12C9562A5E683B69 INDUSAMA
690,224,098 *474EB3AC691527078BFBD943D6BB4387A30B6981 [email protected]
690,224,099 *47477166BF0827B426D6FBC12687FFF024EEC6E7 INFORMATIONAGHA
690,224,100 *47482D9908FE717E686CF5ADF6C369DF7563FF77 INGO-(OVERDUB-TAKE-3)-(INSTRUMENTAL)
690,224,101 *47496F4C04AE21A0467CE30B457A95F6EE0EF957 INTO-THE-HALLS-OF-EXTERMINATION
690,224,102 *474BDBA05E34D61AA3C8FE7C3438006CEA1387DB INYECTARE0
690,224,103 *474912CDF910ACECAEA59D00F7B0AD908B7567BB IOLEPOCS
690,224,104 *47454944986EE41622B9116EF03CB67C4B4F0780 IRA.THOMISON
690,224,105 *474F2F1D50F8D50909DAEE2D659FE205CAFA3844 ISASONOMING
690,224,106 *4748E5FE2DB2C60CF4AB43F7EDDBDE3AFDE5C283 ithand8
690,224,107 *4748D301C091054F87E15FA9679EEDCC3855A91E iv.lecossyphed'heuglin
690,224,108 *4745E26F5D42BFAAD9EC22F435273729100C1310 jacinto-mir
690,224,109 *4746E0BDDEDA328B3BA3D21350C54945C2F5A38A jaime-barrera
690,224,110 *47443AE63DB6BBE0556A51D2DA5CDD0117B46263 JAIMEPROVENT
690,224,111 *474DE2DEFDD5469B983707D0117616A161AE8FDD JALASHQAR
690,224,112 *474D308346EB72CE39BC407348D1725E3EC8E6E0 jamesfhagerty
690,224,113 *4744BAF09904B2ED772267C8C101B77823195467 JAMES.MOLESWORTH
690,224,114 *474C158428190FFEEB0A48CFF1A6CB41CAAD5005 JAMIE.BENARD
690,224,115 *4747DF7B9EB9A6AF313DC39BCA03A1B27C4827AE JASMINRAIDER
690,224,116 *47457B9D0E72C66B3FE956F52A2E97706FC745A6 [email protected]
690,224,117 *4746C5091A7A77EC2FE33616E0FE21283985AC41 JCHELUR
690,224,118 *4744AE198EC28CE213502494A8CEE00F6375AE10 [email protected]
690,224,119 *47404A3C2FB129EB477DF1CCC3520BBFFD83AE6B jenniferhite
690,224,120 *474BA4DC1147DDEECAFA18176367F0D32FACC40A jeramybriscoe
690,224,121 *4745A6D8AA3D3E28228DD78638508BD971F2DD1C JEREMIAHBOYD
690,224,122 *474821864882A986208EA0CC22BE3EDB80A100F6 jessesatow
690,224,123 *47489FF22B2F33AF73E9B0A4C6BD735961776C4F JIM.MCNAUGHTON
690,224,124 *47466308412EB23A5D7E25C07B9DBB5A1AC2AAA3 jimmiesabados
690,224,125 *474BB308EB65E83475FA0C2BB644DAF8E0E44B9A [email protected]
690,224,126 *4748522D091DF21EDC51056379C156D1ED6BE4C4 J)L
690,224,127 *474096D53EB8C58A4D6D50DCA827F4D145A22B28 JOANNAX7
690,224,128 *474CA2552214F50171946FFC33EB5C734B0D9488 JONATHON.GELMAN
690,224,129 *47455B49C1687644A4D2B4136D43948654D01378 jose.antonio.leon
690,224,130 *4741374E790374D92E02F909766371DC4FFE1BB2 JOSEPH_C._JOYCE
690,224,131 *474541B2466B9A10807297E49C40076E13F27FB0 JOSEPH.WARFORD
690,224,132 *474E263AD53744A2F0B757499CC4DB9955EE787E JOYOUS-LOVE
690,224,133 *474FA539416973EAF0B32B545C13556E85B60166 juggalok
690,224,134 *474331F20325A28CE9712304033C0713A27723F7 JULIESPURRELL
690,224,135 *474EB1B54C163913CD9A6BC2B7ED59452920957D JUNIORYARIANNA
690,224,136 *47487C3CBD9740FB928E1AE489E04CF19973DBF9 JVB:
690,224,137 *474C761B61F741B781D48B215CD8188BF4AC0347 KATOPIN9
690,224,138 *4749C83532DDBC87F44F00B45B8D910A3E15C21E KBAOY
690,224,139 *4746A2A98CC292D98A5FA66B255F438A5B012BB5 keghan1995
690,224,140 *47463DE5E8B4C3B1D5527BDDF201D1B9A9C89842 KENTON.OHRT
690,224,141 *4743699255E7D9995C81B2B673FB30B4C5F21BB9 KERMIT SESAME
690,224,142 *474EB34CA7C24E957D75CEEAC6C5A266797BDEB8 KEYBOARDSONATAINFMAJOR,K.506
690,224,143 *4744F3C279D50097BFE104B9F4365FD1CAE5244A Kissing,-Falling,-Flying
690,224,144 *474E052F177CB2BBB4ADAAE29A1BAEC25AF05799 KOKU'''S
690,224,145 *474B9B8ABEFF80FCE9384934EB7E513725716546 kramerferrari
690,224,146 *474F73B2020DB4A0C70645C76CDA0C5F48074E63 LAMAR.NOCUM
690,224,147 *474856FAD4AD69B10627877F39A32980C009071C LANKYDAVUS
690,224,148 *4747014D68CB68DFFC6C440CA0B31FF30D5B2666 LARRYCONSALVO
690,224,149 *4743B5A351C6B5DC5A0EA36DBCAA212C22B6A560 [email protected]
690,224,150 *474CEDAD61BF49F1EB22CC647209B61AAD879523 LAURENCEENWALL
690,224,151 *4745939A46BC9D28F713365D1AD5F95C49B73FE1 LAURENT MALTESE
690,224,152 *474A199225A75790A49F4D539CAF17E416E3F24F leegladstein
690,224,153 *474AD2B2BBCB6A6563030A33A8CE2B38D12C93A4 LEIF.REAMER
690,224,154 *474C51ACAC817FB7DEA26D405FDD67E83975EA26 LEONOVBUT
690,224,155 *474812EA119FB0D3F6B5A734EFE6635F4FCEDB43 LESLEYBESSELLIEU
690,224,156 *474733614E5B188D395F11BD4571736A532AEDBF LIBINGDAN
690,224,157 *474E4DDFABF30F247C0DF42C61B9AECFBE0C0C0C LI-DAXUN
690,224,158 *4741073CC8638438BEAD7702C0FF3A107F28F70C liekaninis
690,224,159 *4744D2F2605C8F350282FC89B20B66A0A6484F37 [email protected]
690,224,160 *4741B5575285CCED0F5BC9C32638609AEBA38DA3 LINDAMOREY
690,224,161 *47419A59BCE01580ED78809B4524D590D096E942 lindsaygrisso
690,224,162 *474CCB5B689808003026C9295FCBA342D92438FA L.iquid.S.ensations.D.isplay
690,224,163 *474381E4BD28E75BB438BC93B67B91064F1ECE50 LITOGRAFICZNA
690,224,164 *474555FD817E5A827E015409959B7955AE8056CF [email protected]
690,224,165 *474C130F0CC89754595667BAE9535990BB62CE2D LJUNITASARI
690,224,166 *474538DFB6129730D91CF6BCFC2E713AAD4A445E LKJ973
690,224,167 *4748AFEA14864820BEE5FF27A98292F253B68E09 LOCH3
690,224,168 *4746824810EE794772292EC6A9099FFB96DF18D7 LOGWOOD
690,224,169 *474F37B8B618827A855955FFD45B1435F4EFAD35 love comes again (feat bt) (12' mix)
690,224,170 *4740A649B33721F37734CF54A736A641F818A89E lueloff
690,224,171 *474233C615F64ADF260E46115753FE3C07D2A0AD [email protected]
690,224,172 *474D46C434B625B970DF79C825620258031E78DF LYNSEY-DICK
690,224,173 *4749985A2170B1F93722620CD25D33C6D674006B M0L35+A+0N5
690,224,174 *474E310FDF6D76626B69A3D31F889B0D5BD0A8AC magophon
690,224,175 *474F00DB6FD40D80081ADD8C7EAAD945EE5331FE [email protected]
690,224,176 *474C6AD2A4D27732C2CECB0349612EB75BC6AF34 MARELY728
690,224,177 *4744FD2F39776D25CDF571461A2B4D8768AC8300 mariaantonietadeaustria
690,224,178 *4747D890DF0787CFCF21242AA65F0DF9A7F30DB7 MARIANOLONGEST
690,224,179 *474B6B3E9AC2FE01DFAEA11A67AB237C2FDCC449 marjan-hashemi
690,224,180 *4749AA6DC0BD9894BE1721A4D0BBBDE6B4DAA782 MARJOVAARA
690,224,181 *474AED467B0B55840E937B41E24F5E07CDB1F7C9 MATSCHIGEM
690,224,182 *4741BE8212CFFF464BB9F11F1851A264848742D0 mcilvaine1234
690,224,183 *474DAAD518F8117D7BCB29359AE111D61BAF6E46 [email protected]
690,224,184 *474D77C40371353617B9B8149D540B8A7B871FED MEETSYSTEEM7
690,224,185 *474743029CF4E2A1EF5EC436AC2B36A2F069C346 MIQUELBOOTH
690,224,186 *4742230BF78AE8B71B205B0FFD1D1FF7D1A43FAD [email protected]
690,224,187 *4741D2F04F17D4F8160E3ABCE57F8991656A6A4E mistral.moon.(illuminated.version)
690,224,188 *474B9DA71F6B3011270E641B3D1420C8D194A355 MONNDENN
690,224,189 *4740BC9C9EA7296DEB86A3225FC0765BCB446281 mountain
690,224,190 *474242CB8A3BA17386D747F57631CD08BB8D391A MR-HULOT
690,224,191 *474936C90FD2A667F7A027FCB0B6B39877CFB81F mul71pl13r5
690,224,192 *4742FFDB38EFCD6C3F2808B5EF0B61C23B920B29 [email protected]
690,224,193 *4742167AD39A27C6844D59016B80DFA7A4E3BF58 myspacecomwadefulp
690,224,194 *474604A4ADA5F73A82F06B3608A8D50085A377D5 n57rum3n7a1
690,224,195 *474BC3E601261081CE5D6FACFC2E7098220F2FA7 nagonila5
690,224,196 *47483E807C14A1360E712AE4FCDCA17A6C7AF7D8 NATHAN.BELDIN
690,224,197 *47479A54FE621BA508112339792777FF6D2971A4 NB#:
690,224,198 *474F8A7F58C74BCFDD229C09B13F3AB46420FCA5 [email protected]
690,224,199 *474CEA4C412AEC795C60895AFEBE76A05C08C664 NCHAS
690,224,200 *474EA227F0904A370007ABE305141E244C111C63 NEIRRAN5
690,224,201 *474AA86D8E3B71B964FD01A1D0C9D1B505EDAD47 NESTORBADILLA
690,224,202 *47476B7AFCA975ACF2C5E26CD0F736B62E3DB8A7 NHINGING
690,224,203 *47435A17A2A712FF223C2BEFD8A05638397B9260 nickcitizen
690,224,204 *474E86AC892F56B5079E0035206F95C444DA0311 NICOLASLUVIANOS
690,224,205 *474518B21036B07C14A049153C1FBE4ACA46CA3D NIGELBLEIFUS
690,224,206 *47487C1519BF989AC0CFD433F0EBF2344A74AFF9 NOAHHILSENBECK
690,224,207 *47410D02D6C95E1E48FD8529545340A1CF668B9A noblefritchey
690,224,208 *4749321F8E1DD8712DD63C4F299A59E11F558F11 nori-pi-ondo
690,224,209 *47400625906899E9A0DCDCBCA0036B004598908F noteja
690,224,210 *474F00C6201A7AB3D81EF5B9431A17C5D22A04CD ?OHZ
690,224,211 *4742EA3328BDBF75B2D7DD4DA46757EC1F576461 OKONEYO —
690,224,212 *4746BBFE4AF070A13FCE7022A0A6418B8181B48F OL5095999A
690,224,213 *474AD6ABA971FA0E4E135591D96F58837414A62E oliverphoto
690,224,214 *4742662A03BDED95B6D835F85AC4204698F895AD ONPLERH84
690,224,215 *474BC6C0C2F9A63F9557C237FD7E2E0EE2BB817E (O_) ~<==P
690,224,216 *474A1CC4D04D30693D930B00BC57DD744F14F303 ORINGCORD.NETWWW
690,224,217 *474E7B6B2E0E7C4194373ADDFDFA820EF545C33E OSVALDO.SOUERS
690,224,218 *474FA0289AD6F3120C4FCF5BA407FB5886CEE664 OUERTAK1
690,224,219 *474068EF1F1CDFEC4E0F4CD569F6CCE70D6CC79E ov3rndus+r41zn9
690,224,220 *4743F299BF4C5BF149355402699DF839DFDC5F3D ov3rratin
690,224,221 *474299509EB1EC71EDAA6C2A330F49EE286FC96F owenhighbaugh
690,224,222 *4744DDB1114B31E7ABDC02633F6266B986D5D77E [email protected]
690,224,223 *47448B52897CEFD0086922EBE571D7EB8A8B4B50 pallograph8
690,224,224 *474FE061B9376E14F840CCF9A24C646734FDE202 PANGLIMA8
690,224,225 *47428377F818A30BD678E9ECB1D273005C10BE60 pasqualepennella
690,224,226 *474AD7D1EA8EECD942AE05DEC94A62252B29349D PATCHUAY
690,224,227 *4748D89785C69AE344C33FD5396585FACB275A6E p---b ~0 ~o splat!
690,224,228 *4741F70D1726899981EF37214EFAE4B55A6B6BC2 [email protected]
690,224,229 *474AD8BC376E1E8BB7A74151CD71478E06F3856A p===d~0-splat
690,224,230 *4741464B74AC100D94E7941CC20CF573CFBF8BA4 PENGBOBF
690,224,231 *4744FDBE13A15D42BB6868CC794ADF48FF820462 PERCYBERMEA
690,224,232 *4748BDB0BDEDFC3DC590B16642911279122550EA PHYT0G30GR4PHY
690,224,233 *474127DA869760DEFA0A87750F42D887F2BF959E pimuk
690,224,234 *4742A021DF1E620B6E06186FC44F58DE250FBE6C pocablendingcomwww
690,224,235 *47496A4ED96F92EFDB501787F76F8EF5A2BFDF7C PORTALCHESSQUOTES17
690,224,236 *4743EEF6703972C6782109834118B7EB4679035B p##p`(><)
690,224,237 *47407D9B994F66C4540D113933E5748245A7729A p======p~0~o}X{
690,224,238 *474BF9F413B9BE443F65DAD9F7EC9E360095097B p----p*-*-*-sploit
690,224,239 *47440D46B5107F9564D540BB04ADCE57338E5211 PR0UG35
690,224,240 *4747519EBF8262018127F3E51E976391273EE96D prokr
690,224,241 *4742D3555C82AE60A90519CEDC05F199BC5DFB8E Q#)~->-B0
690,224,242 *474ED788122E1900978A6680AEDD70F4CE7717F2 [email protected]
690,224,243 *474657FDD0B06007FD8E58A05BBA6ABE1AC3B16F Q###@* * * )O(
690,224,244 *474E6A42FEB64C34B6287930E86EC5758E5D467D QUINCYEFRON
690,224,245 *4743062DDDBD150A9521519BC5AC70F021CA584B QUN+UPLNG
690,224,246 *4741CFAA2AE6B6A92F61FEA2A4E3CB5313DEDFDF q===)-~-`UU
690,224,247 *474A97A478489995A17276927B5EC6F158F80989 r898r95
690,224,248 *474BAA2BDCD7A45E67FD79D2388800CE5D6EF188 randallbollich
690,224,249 *474CFADEDD8DC2035E1D0D816AFC769E4CD8DBD0 RASAH0701
690,224,250 *474CFC1E152CECA41A6E131924C4D55F6DA9832A RASSOITS3
690,224,251 *474D8EC5E46A0390C12BB0CBA544E80DC6CD387F RAULLIVAS
690,224,252 *4742CBEFA5E8AC572FA90B39BC74B11D78AD53EC RAYMONLEISCH
690,224,253 *4746FB61F6CC7E7931DB2C248A63272AE2A1282E RAYMUNDO.HIMENEZ
690,224,254 *4748CBD931946D1D9DF66D72A0F6DA66A47CA952 rebeccaderby
690,224,255 *47473D70144E4C3A3D47B652DF21890DB99B6FC5 RELHCSTEID
690,224,256 *47480B772DB2E12F1BF7FC4C8777B52236C0065A REMASSE6
690,224,257 *474AD93789F75711AC2ED3CC0336BFB81FCEA544 rep0pul47in9
690,224,258 *474C04792291B02855B707490F36508A029D1F9A [email protected]
690,224,259 *474CD4F8A9F660986ED41913EA6777B0837D926E ricardomoeser
690,224,260 *474E5858BD468CAD86CB645B25FDFAB6F2C81DCA ricci.castillo
690,224,261 *474CADFA4B2E5F85FA44114C67586C8B52D934D9 rifle.gre
690,224,262 *474E82B504B10D479D6BCA66C0B357C81C9C9983 RIKYVOLLEY
690,224,263 *4745AE47444F13CB4E14D72F3AF0A76C6B6EE594 rileyzuniega
690,224,264 *47449367FF718C5CF9E70B119EBE4FBBC90A207E r'mplnt`rnt
690,224,265 *47468FB36EA7BDD6440DC070E64EFFDE78D70498 roccostramel
690,224,266 *47412D5F519BCB4CCAAD5ECA164B675E89E345C2 ROCKET FUEL (DISC 1)
690,224,267 *474A34C3A4F5B4330A314AF7E1597295489C34EF roniwebb
690,224,268 *474BF8E6CCFF70F4F5FB38ADAC1B4E14290A4162 ROSCOETRIBUE
690,224,269 *4742A67D56690D727E03FFDA3752CAC38661BEC9 ROSS.OGAWA
690,224,270 *4746954CE76FDAC364ED8B0F05AB8BCC19D4936C roycestagger
690,224,271 *474BA77F36BA3AAAA45093E6F6E6DE67DBE1CCA9 [email protected]
690,224,272 *47440A29DEC2E8903B7FA5647CC2511A5095CACD RUBENONTIVEROS
690,224,273 *474CA6E44DB0437F9CA3258F42B00303D69BC03D RUEHCROC8
690,224,274 *474A0CEF97F961F87E4ADF16DD2815BCFE838F8D rufusdratch
690,224,275 *474552FBE77F13FCA037160698CA79782AF5746B RUSSELLLLANAS
690,224,276 *4744062988ED19E01AC822B66C224E0EF615E73B R;V~
690,224,277 *474DF72C8B30DFAFD4F88F81E72662BECD41ADAF RYELLB
690,224,278 *474FA8F0B73FB9076918C57A47D7B61C8AD84C2E saimanoor
690,224,279 *474EEE5F10D97E0C0FC2FEE3F0E6AA06D5D7EED0 SAINTCIBOIRISASSIEZ
690,224,280 *474C8510688779F88F387FB4FF778481C8B15533 salsutliff
690,224,281 *474316030292663B0A5E5399420ACEE6B2E7BDA5 SAMARELSHAER
690,224,282 *474AA859AFAC02A0B0A14B889025D2EEAEBB4870 SAMDHINIRMOCANASUTRAINWYLIEPHAGSPADGONGSPANGESPARGRELPAZHESBYABATHEGPACHENPOIMDO
690,224,283 *4742361D374ABDB38A0DDB058A15A99254521FF4 sammyseiders
690,224,284 *474A60A3A694DA38B6E08EC6DE24142B718F463E samrat.bisht.bisht
690,224,285 *474E654AC6B1DF27EE933914E98FB41910FF0060  SAPINDALES
690,224,286 *474DB7DFDD398249F83CA34F42AF02B7767BA484 saravanaa
690,224,287 *474231B7F5FC6AA69D0F6768211063C86C9AFA9A SCARLETSUNRISE9
690,224,288 *474C967CB2E03703273A5CE7918A3B04721D9D97 SCHANDSTANGE
690,224,289 *47471A8FB3B6C59672A2A7D4375AE5EA78376B2D [email protected]
690,224,290 *474570EB017F4C70203762B790EF1428A20CC473 schutspatroons
690,224,291 *474A7B66086DD2503979BF0FFFBF5F79A9CE6B68 [email protected]
690,224,292 *474506336CCB011E7F2CB6B7733B97F89DB6DB53 SCRUPULEUSE6
690,224,293 *474ED274FE0D4B90CC282CB5455FB3E3F64174E0 [email protected]
690,224,294 *474F86923545FE4F18A1E052B82F003092BA86AE SEND IN THE CLOWNS (COLD FEAT. AARON)
690,224,295 *47406360BCFFF03E55F6439FE60E10160AB7E994 Serenatella.a.'na.Cumpagna.'E.Scola
690,224,296 *4743D155D2156DD2365137B0AE26007303721ECC SHAD.FULLINGTON
690,224,297 *474857CE720B2A301D2FC2C4810EAA9F2C437352 SHAMTEEBSW7
690,224,298 *4743FA0321A4B68D15E128BDCFA4FC3C32C37067 shaund21
690,224,299 *474CD2C602754700A49F2A470700B237998BE8BE sheleft
690,224,300 *47419463A0F42276354B8FA1BA324224E21E4D94 SKYE-DOBSON
690,224,301 *4747C17099C16E4BBFA5480DF3DF4F36DA27F7CD snbuoc
690,224,302 *47450353FF9698274B663E51950290E67AE9D9AA SONATA.IN.G.MAJOR,.K.432
690,224,303 *4741B4E145EBDE603CCFBC888C658D7E4ECDCD7D sov
690,224,304 *474603CD2B965F0C2D274E17949952991CA1B726 [email protected]
690,224,305 *4749F79BF1595D9FCBFD1D8C8508C58BEE9FEE69 STARNOTUSED3
690,224,306 *474783C01624A1D4DE2D8F4CE992F22C4B55459D stefano.brivio
690,224,307 *4747F3B5EC5A845ED7DBD23995FEA0E49112B28C STEINONSRUD0
690,224,308 *47428C5B3033ECFD84B4050C294DD02E3D59C5E4 STEVEN PETER LEEDER
690,224,309 *474EE1CDF9BB8A0D3C24A25F5E0AAE4B07C47BB9 [email protected]
690,224,310 *474184DC6DCC76A4A50B1A07B14F3E912D8B3130 stofdamp2
690,224,311 *474719C027374C321561567700E91C227266D692 STRVNGLY2
690,224,312 *474EA6194167F548E76BC30DB02B563ADDEC1A96 subdueme9
690,224,313 *474EEB49FE23D4096A265413BFF1A4840F8E1FE9 [email protected]
690,224,314 *4747ACAAAB09A04B560FC3D91F50874AAD10A752 SUSAN FERRER
690,224,315 *4743669A76E6CE670BFE2CC846D43F3E0E6BCC93 [email protected]
690,224,316 *474B8A9BCC373DB43465D222F10D580CA4142D33 sworddance
690,224,317 *474B31D67E45A11AE8299710C57C4C2ECB6BC749 T0ddy.p41
690,224,318 *474F98D81603FA27C6BFF625126AA13C017DAECD $T6AA
690,224,319 *4742E67D7DEC6DE5D0E8559FDDDA298BED12BBBA tadangis
690,224,320 *474E7CE7C80E359DDC6F1609C9557C3C99B600D4 TAKASHI.MISHIMA
690,224,321 *474B1C5250020E57A561A5A36CDD5396F8E8C23D TALKASH2192
690,224,322 *4745ADDC3A0F70DA645726DC68E639BA90AA30C5 TAVATHOJ8
690,224,323 *4745CC106E59DA08C1D8D8F9B4370134C1EEC9EF tbsは18時から20時54分(延長なし)、tbsニュースバードは完全生中継。
690,224,324 *474186FB841BA21094878386D7417E1FCB733160 tedhasenfratz
690,224,325 *47444E030F6019CCE0358B3C13653FF3B420D77F teleutof1
690,224,326 *474382BC96B5E2758FC0E95AB430F1DFE7BDB843 thatwolfgang88
690,224,327 *47427BD83905E32DC52E410DA8040AE3E707D70B The-Everlasting-Gaze
690,224,328 *4745A64C8E9AED01A6DBFD45AE1AA6A55DE7E455 THEKINGWHOSTOLE(...THEUNIVERSE)
690,224,329 *474261A9E162E500B03D03FBE48FD5F7327D9698 „THELI“
690,224,330 *474AF509F5A78A1CC1E0C732F7A5E94B7EB28B3D THEMANBRAVES1
690,224,331 *47448CE2F3B191AC411A5841CF812175E298F49C theomanno
690,224,332 *474DDFBCCF2E4782295CF44082EC1B438B63CB7C thunderbird38
690,224,333 *4745F9283BD1BF1A9C0BFD84CC05ABF679FABFC0 timmilfeld
690,224,334 *4749DD53D0F4F04966C4F74F40DD80F31963300B TINA ARNOT
690,224,335 *4748E3824E8BFD10DF2D20ECDB90D9C76662DBEF TL4D
690,224,336 *4744B6541FD2DDDEC601976A8E58AC1783E08A48 tlkqnyjiswa28stldw
690,224,337 *4742FF0A205D19F37D6DC3E106FA4FDE45EA4608 TOM.RANSONE
690,224,338 *474D37F8CE4E5E0EEC538FA7732146F26A135C50 tracykomosinski
690,224,339 *474B13A99B2D2EEBCE17EB06986A3E0470DF5818 TRANSLATEDFROMWIKIPEDIA
690,224,340 *474768B64A23C8EDA466A390FC069CCDE1546936 T'RIN
690,224,341 *47454BBCD49F078EA6CFF0C753ECB4FE2CA9E4B6 TRINIDAD.LERI
690,224,342 *47404DF196A397A01E5AB35DB0AEAF08E0EC1FFD tselhafter fund
690,224,343 *474454C3142073E08F88150354D08EFFC04AA231 TTHETERNAS1
690,224,344 *4745D2344599564A5605946E20650DECA5F502E8 TTLBBBLS
690,224,345 *474C35C92C82DEF2A87FD9CE4B568ED2A467B1CC tu.shen.romeo
690,224,346 *4740A421511AB1A5E13FB76685BEC2A1C567D22D TXTFRMT
690,224,347 *474BF1C075375D2DB6DBAE3A81484D7D07A50965 tyjaura.monique
690,224,348 *4740710E1F6B1DD0D507D24A4AD0DCE3A17AB4A8 tynnare8
690,224,349 *4742AE5F6B8A5816F507F29F4A133E5DDAD03DA4 u7842-8e96
690,224,350 *4749B62302A7D8FFC6D15A94BDB870E36847E57C uenlfhbf77
690,224,351 *474C8D514DF403F1EBCE62F7CABD03B4FE144571 VALENCIA GARNER
690,224,352 *474E2337E64700C0939FC93206177D9436BA16DC VASAROLTA-1
690,224,353 *4743AA70D78A0EB6C6C4F31F323C2776CB9D2991 VASUNDHARA-SURAJGARIA
690,224,354 *4741E19F9E633EA0F8C3A5BC6B8A0224AD237608 vauward9
690,224,355 *474F06443A026B28BBC69C57F5BF4A43C2EA1736 VERSCHACHERNDEM
690,224,356 *4741776342D066373AAA36182D3D55CD16BAA0A9 VIVIDEMONT
690,224,357 *474DA6632E2577FFFFC5914926D3D69D6FF07A8A vnlang
690,224,358 *474BC5F876FFD997544201FC2F4238F4EDFD1EAA wattages
690,224,359 *474958156771B76DD9FF44ADBF5767DFF70B53C2 [email protected]
690,224,360 *4742F97C802A776BEB0BE561466522B3F99098A0 [email protected]
690,224,361 *4740DD9B55516B4B6DB82E6CEA8B3D0BDF85B5C1 whendu.monez
690,224,362 *474F8912AFA8DD12726F79AF610F94D79E8B3D84 WHITNEY.PRZEWOZMAN
690,224,363 *474204CBD3D514223C74BE2A810A66E2FD7FAAB7 WHOSDMAN5
690,224,364 *4748000D10BEEC64CF3E612ABCAD8B1E8B50610E WHYABEWASAGEEK8
690,224,365 *474F4200B142D4614026349E88D2B7F7322C0A00 wileymccasland
690,224,366 *474E9B2F9C05B24EDDD06EE51FD6ACCF1F3471D5 WILMER.COTT
690,224,367 *474DCB277B8ABFD2A21791D0143FAC03FD57FCA3 WINFORDWIENANDT
690,224,368 *474EF614EFACCE5CCF90930882B313A9F3EA97B2 [email protected]
690,224,369 *47406CBD5EFD6D8A36B68E721531BF90D0BE69F3 [email protected]
690,224,370 *47487400365AC04694AF1517AE90FD87C48E7554 worser4
690,224,371 *4742B34FFC7D30394B1EB4E06BFC6E09B6E497D0 wwwcartwheelcomcom
690,224,372 *47485AA6486D65F38C4A49402DA801C8C20FCB01 WWWCHYMISTCOM
690,224,373 *47447717A2135BB0D383FBBBBC8DBA57FE27C8F0 WWWCYCNETAU
690,224,374 *474530CF9475269A6577691010C2A75773A087B5 WWW.FERNDOWN-OTTERS.CO.UK
690,224,375 *47449DD89AEE4A61DDE51D8C61842DCDD0AFADCF wwwmrmnursingtheoryorg
690,224,376 *4747BB55BF324997328A73D559BCCFC9D0A1A866 w;za
690,224,377 *474D31E36EE33DB38FD80337A0F85E16869B2884 XAVIER.HUFFINES
690,224,378 *47423183CF5D337AC51F84B25E051812BFC22653 }X{~`-~`<---B
690,224,379 *4740A63EFFF80EAE4BCD36AEFA3404429CED456A (X).~.D---B
690,224,380 *47443B57497717C30EACBC04C48D142689C54BC5 [email protected]
690,224,381 *474945DE0111F7C5E2B8800308D75BFBDAEE9B99 XREYE007
690,224,382 *474567228B192C1E227F043074853A0162D34036 yahaled2
690,224,383 *474B6935401728C917DD8CF423BBFBD415FBAB0C [email protected]
690,224,384 *474A9AF459D41F28466F2EE1AE69127CD13C7389 [email protected]
690,224,385 *474150736BFBE7A697BE90725BA07BA03819DA86 YC4FK5CKG
690,224,386 *47442C5DDEE2EC8D1B3968A4931D6A4E126DD0ED YELDNAHS2
690,224,387 *47475549E68FBC37C9B80B81A9714C17A50AA76C yjdfgkfy
690,224,388 *474202C683CAD2D0BF7A0191B2DD896CA46BD86E [email protected]
690,224,389 *4741A5D1FD993E42C819294B205B87FCEA93A38B yvonnescogliomckune
690,224,390 *4745E7475536166133F0DDDEF5CA39BD8C42E22D YVONNESTEPANOV
690,224,391 *47402F766F627E0954B048F0396D2B14F802210B zachery-gunnar-graham
690,224,392 *4740480770CECF978EF419AD33EAFCE926D00FF4 zeguttst
690,224,393 *474F9570C46FCD5183D4B7D97C752FC7DA245EB2 ZHH9YV2ZEO
690,224,394 *474D3802BF2BD2FF07EF644212815C024684BFE0 [email protected]
690,224,395 *4748E57A3404BD40232E6113C5B3DD42984837B7 ZHU-MINNIU
690,224,396 *4748E8AEF1CF77E407AED22309C7B880DF163EC2 ZKOMBINUJETE
690,224,397 *4740B453D550D7D07E882CD32592267826DCC729 Zuiger
690,224,398 *4741E00790FC62708BD61087CFB5AE4708D992F1 ZZITUN
690,224,399 *474C0B17BE15A8539FB59A1CE00FAB076C288ADE «ΘΡΉΣΣΑΙ»
690,224,400 *474C7A81347F29B80E189C4DC196C1AC173769AA БЕСІД
690,224,401 *47417DF6D1E6ECB9998D7D2AEE2A03973027A569 БХУТІЯ
690,224,402 *474C3D6C65ADD3402679982005CD8DF2E0C47E26 ЛЬЮКЕ
690,224,403 *47448892C0B92A630DC6ED5FFA9A058408073CF8 МИЗО
690,224,404 *4742310E6151F71E687A7D9FFEF0E540400DE4CE ПИЛОНЫ
690,224,405 *474319AD05083315FA47EB2A800BD33F72B90305 ХАЛЬТ
690,224,406 *4747105FFA498B9D1BA50DF702DB81737E67B2EC  СТЭЛЛА
690,224,407 *474AE29F5DF7EBEEFF2C878C3512955E91EDA7AE (福特)、freightliner(弗特萊納)、geo(吉優)、
690,224,408 *474F1F075778C80BC94A019DC7BD02ECB1B1DC46 0ab9
690,224,409 *4742B55627F1240493A2A5716CBE137C4D30BAA5 (0_<)`d#####q
690,224,410 *474BCD6744FA56E85C6FA0204FABCB3C95B75E45 125 GLAESERN
690,224,411 *474E924B3282D2C0D43188FA596010BD76AB90C7 126petrified
690,224,412 *474AB4E5C28CA987DFED83D421E50FFA3E2A4928 1350 also.spelled.fourble..
690,224,413 *4740E3CF9D29B5CD8C30B8361A37DB7A25A746E7 13V069120U5
690,224,414 *474A0558FE838AABF1D61EB555BB1D081F1FC1CC 1439414 smarttrustin-malli-edellytt
690,224,415 *4746CE2782CFE714B651E02D0239F224E1737D9F 1714339 KIRJOITUKSESSAAN CITYMARKETKAUPPIAS TOTESI , ETT
690,224,416 *47485D1BF84985A30A8504640FE288BB4ADB6C62 1800408 raportteihinvoidaantarvittaessasis
690,224,417 *474711B8D1E5D80EC7ABADA92417656BFB2C788B 1879689 MARKKINOINNISSAK
690,224,418 *474E57291B89F9C088275A7F50FE03685FA024A8 18VUOROTY
690,224,419 *47456B4570A0101A98F45C41F76CC9492DC29CFF 1926506 luetun.ymm
690,224,420 *4741964FD0CDC9F2B9025DDF92D406BBE7519388 1939792 PROFESSORI-PORTER-ON-KEHITT
690,224,421 *4745449F6ABD51ED37BB516DACF8C9C30EEFACDB 19860719:GMexFestival,Manchester,UK
690,224,422 *47463A3282D8F81B7F65656E42C6A2FF5BE3F561 198 OIKEASTI
690,224,423 *474BFB0C90CCE5388D7A2A6E15DCB0808AB85DBC .1991,nilreb,galrevregnirps
690,224,424 *4748CE45AC9793D6888590D5732843B42E8CEEF5 19APRIL1582
690,224,425 *474F6CBC1BE535FA3095586E9710DDBB1E963282 1.DURCHFAHRUNG
690,224,426 *474B6BFB82FCF1FC4F69298CD5DF7E77065DB7F7 1electronic-decorated
690,224,427 *4749F94D4B241D4499629F115DBD7E80DAD65A13 1.FORESEE
690,224,428 *4747D43A8904500E8BE437419F4E8FC3766390A8 1HIEKANRUSKEAA
690,224,429 *474F84D10452DF8D62260710CEC80BC53709F6F8 1-kandolf
690,224,430 *474F9D3B004AA1EADD30B3F7B448C6B5AA8AD888 1KAUPPIAASEEN
690,224,431 *4746742C466AE67057439F3B8DFDED5642C2D5FE 1.LABORATORIOTY
690,224,432 *474D29554473482BA3B93DDE26A6B1056C2C437E 1-lehtisalaattiin
690,224,433 *4749B44C9B96BC86D237D7D8493C6B598578F182 1MARCIAL
690,224,434 *47495789A351AA2524C073F568373B2E2BB5509E 1 NEEDED-EVEN
690,224,435 *474536E36FB7B3C9739C4289798FC4B3C2259252 1-NET'TEKIYDI
690,224,436 *4742D9F3E6485AE9A7315992B6FFA575179AD645 1OESIRUG
690,224,437 *474F4C3CC1EA9D5A3845F5EBC790D1D0C88DEFAE 1-orpc
690,224,438 *474E3F2B10A5898A2C54B803E7E7049C5397968E 1 phnompenh
690,224,439 *4741D5D500E43A6C1BB7FA0E59282EF8ADE61BC8 1 REP-MAIN-KINZIG-BERTI
690,224,440 *474024E23DE2FAA7DB33D78B94EFF4C480B24244 1-SCHAUDIRIGENT
690,224,441 *4747951628F4BDD7A830B162FCBF48D3B4F13074 1-tuontikilpailun
690,224,442 *474F3950F3AC8DC90251BC9045C792031AF9B841 1-TUSTUMINEN
690,224,443 *474DF3CD18B885FB79C5BE3017B46F000AA29252 1-vessapapereiden
690,224,444 *4743874FA018C94D77BDBD135BED230C89F6A101 1.YUZELLININ
690,224,445 *4746D9104C16BDBF5BE58A898FA6DECF866259B1 2003-06-10: ALLTEL ARENA, LITTLE ROCK, AR, USA (DISC 1)
690,224,446 *474C38085AB0A7C6C7BEB55975C833921C11E294 [email protected]
690,224,447 *47470E7837AD4012F1AA27766824972736319BEA 20-SELK
690,224,448 *4742231AFE244FC8A2B9E36FF6AFC6D52AEEC4BC 20THCENTURYHITSFORANEWMILLENNIUM(DISC6:19801989)
690,224,449 *474AEB113B863135ACFCCE74D9739245B2845488 2200253 opaskarttaruutu_d4-henkil
690,224,450 *4748C9DEE951985C8BD60B49304F65A12E9D1271 2339125 KEHOTAMME-PERHEIT
690,224,451 *4746E6F80E53E1B6B8C857C906E682A7925EB191 2548804 TOIMINTAMMETAVOITTEENAONTUKEA,YLL
690,224,452 *4744D4172CC74A61BC7EC694565807575E50A28E 2 BERTBRECHTSTROPHE
690,224,453 *4746C3A111D2EBA1DC07201E7840F64763CA6761 2BRIEFPORTEN
690,224,454 *47485FE899915AA5A9E0808C24CC62CC41A807F2 2 EXFREIBURGERS
690,224,455 *4743F35F96FFE32C9DC59D4AA695B6758E187956 2farcheo
690,224,456 *4746588EA9E115C3674E9017DB81E5820358FB31 2INTRAVENOESEM
690,224,457 *47468BD5155DA7D29A1E12858925DCE310E933EA 2MATHEMATIK-DOZENT
690,224,458 *474D8A7AED54D914F6E2F8871C45AE3737F9ADA3 2SPTLLNTH
690,224,459 *474A25DAB2611E299E5B3B5E64EBAF118241567B 308-YELLED
690,224,460 *474B2549222A146CFA97ABBB5AC72ADAAFA46887 38G836ERW7
690,224,461 *4746A60FCEC7D33C8D2BD1133D8909201989D9EC 3DEIBLER
690,224,462 *47436730D78143E7BE714B309B0A3C0EB301B2B8 3ESACGNIS
690,224,463 *4742DF59095955DBCF203F07CA5DCD05616EED0B 3###P~}O{
690,224,464 *474155349EFF17D3B11AB965E00CAB9DDD896D82 3XPHOTON
690,224,465 *47484B031A7E5463DB1F77FD7831099465694E65 49382 HURMET KECELI IS MERKZ
690,224,466 *474C2D9E04AFE6DF409FF55FD4B69133A5E7638D !4?AA
690,224,467 *4740A926368C277382800CB0130E73636D283547 4-ehtoisa
690,224,468 *474CA412A583059B7D7DB1B48A569A1420A2CBD1 4gratefulness
690,224,469 *47400C0D0D56F3058A18CF449D53EE0005D1BAA4 4STEELEYARDS
690,224,470 *474170A4279BA13F53E84BCB9288D63260C0E324 4WILBURSCOTCH
690,224,471 *474568EA0A4217F66BA32FCF24BA6B8F9663D5BB 524107 '-THEY-ALL-HAVE-A-VERY-SIMILAR-SKILL-BASE-,-'-HE-SAYS-.
690,224,472 *474FEA5FE550B50B0C26E761FC987CF604261D45 526033 the-a300-b2-has-a-range-of-about-2,500-miles-.
690,224,473 *474C2CAB3C663F77DF4B8E14D5D96CCC2FEC0227 5384615384615EM
690,224,474 *474BE8B97866183DB5EEE83B57A1172F6102DE86 5MAPCONCATBSW
690,224,475 *474023B0F740CAABC3068BFF51809BFE9E9F8EA1 5NELSONWEEZER
690,224,476 *474560C4AABD7B0B03E148649E68E92A98A510EB 5P35A5TI
690,224,477 *474DDDB09605C1FAC5176599BE600648B0228327 5PRIVIDANU
690,224,478 *4747F3DF0CB20490AF01B28F3A3ADB26ABADC255 602AVA
690,224,479 *474864EDD32D98AB5D9E7C51D16C8F5BC78B9442 62372
690,224,480 *4740861EEC68810F5124B559ADED7EF616C58972 6GEANGELTEM
690,224,481 *474249D13F3C53CA610CD621285D7E7A2A788971 6iamallo6
690,224,482 *4748088480D039BC6E3A2A89A72B5AD59EE04003 6MYROURE
690,224,483 *4741028E18BDE0C8150E825AA80F4503E2FB46D0 6NDIGKEIT
690,224,484 *474F2F4F35F0CA47A14B5C56B4AD04DBF5AC4821 6SHORTYITALY
690,224,485 *474807E50830F0B6A25D8E9ACECE96EC096DFD46 6SUOZYMOH
690,224,486 *47484ECB6964962E133E8F99C01B759CA60BA992 6unduplicated
690,224,487 *474258B6D0A2237821295FA3807A7C250D23862F 708861 IBRAHIMOGLU CAD
690,224,488 *4744175EA8C00137CF99683E5FE57D5A355E3459 7704 HE-SHOWED-ME-A-SWITCH-
690,224,489 *47438974C27DD24F8A69CEAF4B87533857734B82 7BSWBILLARYBSW
690,224,490 *4746A430A1C366386BC0C28E5D999C4EEB58E2B6 7HOMEVILLA
690,224,491 *47430AB2D9B29148D24EC3D5BBA7BE902B685F69 7NEMLASAK
690,224,492 *4747DF28244E70FB62DECC5BD98CF5CB4B8687CD 7SKARNBOKSE
690,224,493 *474C5A10F840C7DD2EF2601473113D90BCC81140 7STORMYLISA
690,224,494 *47453FD4B9C5163DB46F3553C987D5A690E1D075 805BRAEDEN
690,224,495 *47485191C74BF3665089333004E9396E374F9454 807987 kuivuunopeastijaonhelpostihiottavissa.
690,224,496 *474488E8DD381C55B03EFB9DA07BF780D30CE24E 86CLAY
690,224,497 *474358511921FC29300047E8AE808532F0ECEB0C 8===B-~-{x}
690,224,498 *47497D5D494FE9FA8981A5F602D820894B564579 )8(***D######8
690,224,499 *474B89D6B560B2A870D875EBC8C4A1DD6999B61B 8KLAVRINGS
690,224,500 *4745EE8BB90ABCD62FA678F8280EC34AB0B246E5 8KODUKUYJ
690,224,501 *474FEE5F14D7F2535120A367A4B5D371E66380E2 8MACEDONIANSES
690,224,502 *474CB66814F6818A05C432306658A646F8B79455 8MISBEFEL
690,224,503 *474AC53900B5C3DE15632BD212BF5DA00D39AD48 8NOSTETUK
690,224,504 *474BAF596CDB0C863AA1017B6539E89BC853396B 8PAFBINFO
690,224,505 *474EC48AAB2B372FDAD462E5D714329BB101BEDB 8SELAELLAEAEN
690,224,506 *474F1361EC001A38DD32B073C335AB82AC9766FF 8VYCINENA
690,224,507 *4742E95EE664EEDC50F1629CCFFD54E59E43A49B 8ZADEKLAROWAL
690,224,508 *474C0E02A9903E86553BC13C41B985E64CC8F301 8zn
690,224,509 *47468851AF277FA18D773CC9F274415A0CFCF1C4 987WALTER
690,224,510 *474B9485EE5D79BAC38089B5455D685149030A1D 9AGEERT
690,224,511 *4741D19FC835596AACC878EBEB10CC8BA9814AD0 9braakwortels
690,224,512 *4743FD25E44D7B757CD64C23637A940BFEE8994B 9humlebaek
690,224,513 *47474B5A6EA101DDCAF8E4000B308E972D331473 9NEEESSYDO
690,224,514 *474E0CA61A9C3CB5D253CAC1AFC39DEB80E5DB81 9newaccount4
690,224,515 *474C96FB1B97A5CB89679E5BDF51E03EB667F19D a1-ls
690,224,516 *47475BDF9BF207A7B9131039AA24580D52C6D6DD a2x8i
690,224,517 *47497DE467B17CF174823BF57F6449DD23678E22 a32+v
690,224,518 *47447AD92D942D1ABA90E1A38F27FF945EB566F7 A9XV9
690,224,519 *4748E02CBF227F4C7636792FBE67FA177B22F4D3 aad;id
690,224,520 *4749DCDF5E059DE6EA1ADE41DAF0E9998B9B70EA AAJ;@
690,224,521 *47406EF02C594632F69E6CB618E58F571D7429A7 abenewsham
690,224,522 *47482CE32F04755C5E7B6A31336E075B287548A0 AB$#G
690,224,523 *4749794013AC9727BD3D7BDCD4439A4268F2D7B5 ABX#Q
690,224,524 *474EDE333836EEF1B1D82C053A241BD5AEB0BC66 ADSALGADED
690,224,525 *474310AF880096C6090C7034350DC255ECDDFE06 AE2WK
690,224,526 *47471C8EC0411292CC08556110D229082B6AE849 ag)ta
690,224,527 *474CBDC306903979D64B52C77E371944285AB1CB a.hk:
690,224,528 *474DD26467D986A5388012DE8D9FB482795198CC aholiday
690,224,529 *4748FAEE8BDF6858F1BB1505B385FB1E7A6DB636 AKLANFORUM
690,224,530 *474E46FD65679158D70D447CD87EC69228CF9A16 a.-l'amygdalite
690,224,531 *474C65654C896651B1DC4B051B911A8EAB30028A ALEGASSEMS
690,224,532 *474492682FF62B69C47896E2AE3A3A17DC8BED66 algh;
690,224,533 *474246C59E206081D4CD57F613F348727329A531 alinists0
690,224,534 *474EED93EC5F113763985CDE09E161D44B71AEF9 alvarohousemate
690,224,535 *474A49CFC6B9C7616D560C4FD6CF369261DB8404 am+"c
690,224,536 *474AEBF81E7B76E6E229FE36989E3E7446537991 [email protected]
690,224,537 *474F892A32F0893B0FDF94AA53335B3985901827 amelleen
690,224,538 *474B4E9E34F93961E8B7AF846773CFAACA3D4EF4 ANIBAL.CHIOLA
690,224,539 *474C87659730CA9D04DC00EF6687ABBCC8B33EDA anlj#
690,224,540 *474AE83337B8A175447DDEBF1CC22402A5A7D72E ao(!n
690,224,541 *47497F53D774E887DF5C4D78041BD2F7742EA63C appaieros7
690,224,542 *47406B369615A6C051CA31085B4A8BE07B4DB458 APVM
690,224,543 *4749E77834AAA21509CF32C518485B049D5D142B A;R;B
690,224,544 *474FD721C1D27AE4D9FEA7E92601E5FD85474DAD a$rjw
690,224,545 *4747C494DBB75E5A120A6F602E03BD8E8AFF198A ArmandoA
690,224,546 *474E3DE819D6EF13F6FAF398170319B782E1B2A1 ARREBANHLA1234
690,224,547 *4749241D5F79915E108756FBD01FCE69B7F04D69 ARRONCOTTER
690,224,548 *4745F292F4A66A9991DE6426D5A6F3F9A66BECC6 ART.FIEBIG
690,224,549 *474F72800B4B1ACFBE0CE44A4802DA7084C6585D ASABENYARD
690,224,550 *474474ABC9127CD8696E810671057FFA26FE6CE2 ASAM
690,224,551 *474CD38A2DE2CB335A8335DFD233476379BB919D AT6AV
690,224,552 *47478E563FBDF2F7783B97E24C9E289AFAAA6B07 atkcu
690,224,553 *4740D09395D7788FB6A53C633463D5FB9B233B58 AUFGEBED
690,224,554 *474787AB7A2980459BCBA63B462A1CFB4BD53FCB avykd
690,224,555 *4748840B8EE47402A4565F35393E2C7967D4C054 AYIHSAK5
690,224,556 *474A635BE3A9741A433102152294E25D568BB9E3 azsielap8
690,224,557 *474B1D773553331E0EA67F269A3940F7C2525DFE B####>`~(0-0)
690,224,558 *474686187E44DED694D8110A5C3AEDFBD13A056A B3V^
690,224,559 *47409FDB238DB2074E246D8CE19AE298A0727C75 b77ds
690,224,560 *474D66C7DA7DF805071A03F0850E702ED140B46E BABUKA123
690,224,561 *474D725C0C803C246BD986CF1071A32F20B965DD baghemaidan
690,224,562 *4740849C4A455D34F8FDFB8629BA0ABCF192EA58 [email protected]
690,224,563 *474AB5908B7F697186339C4745E625FC642A3826 BAR7433
690,224,564 *47443A68B99F2803BB02A08CB209A2B668FB0F28 baxhl
690,224,565 *474A9108BE0B3A1E2C421BD2D247A8F3D420E9EB bb+4
690,224,566 *4740656C37AA14A52ED59556D1D15D258BE7E9FF bdrln
690,224,567 *474217F59E1ACDCADAC7F5EC37586CED153BFD77 BELGIANBOATSHOW
690,224,568 *47448F884EC5FDA40051A38DFD8AA5735E83BDDC BENEDICTCONTERRAS
690,224,569 *4747FAB5877D900673E009DA07D74544CA6D53DC benjaminbickers
690,224,570 *474D4B298FB52FA12FBD1D35D6C3AF894C996011 BENTON.GAJICA
690,224,571 *4744035A8936FBF545D15A4E09F4F029F55325C7 BERNARDCLIATT
690,224,572 *474F1894772779B77C679FAB40BB9AC382F4C4B6 BESCHIJNEN?
690,224,573 *4745E4590F9DE38843013FB08ECA017E9998B64D Bh5"
690,224,574 *474B0C33997FDDBCBFD30D8F71B27E2E27EA21FB bk05f
690,224,575 *474A5EF4C2387175DC7E01B31B3718BAD52100F6 bkbnn
690,224,576 *47414CBB0DD1C6A7BEADC7B28730BC0833C28A09 BLAZENEM6
690,224,577 *474DA2BD343C7881747447FDE66BA463C1265F71 [email protected]
690,224,578 *47438226B836437673DA89AA2CE609E3C58E27C8 BNIS
690,224,579 *474F165B443B482A81C8486F39C8FE2F9BC6E32C b!o4cou5t!c5
690,224,580 *47478DF68700F3A70EB85B0009FF201B344943C6 BOBBYLUVR3
690,224,581 *4747FC1C050115BAACDA7590D231992B5A4E5480 bonnie.zimmermann
690,224,582 *474C67774C0966FB0035269D8B91DB0AC0D34E58 bonqz
690,224,583 *4742B0B96483D88370B80AEE595799942E9E13EE B-P:H
690,224,584 *4746F4B5D284B3D8338A40A4B7549AC77BE01166 BRADLY.NOWDEN
690,224,585 *4744C2CDDF17AA9071B3557073978E8DA46A9232 brentzulauf
690,224,586 *47453800DCF182559989D1017B78BA814FB6A5DC BRIANCROXALL.PBWORKS.COM
690,224,587 *474245750E91A18FC1231A2281069BA370CF0983 brla
690,224,588 *474EF162A9EA58CA181682704FDD64064293E280 BRTE5
690,224,589 *4742C873EEB634E0CBA07A671CAE80A5FE0E8BA5 BSO0_
690,224,590 *4745DE8D6477E2FA62C5382F6854173E3148078A BT8HA
690,224,591 *47470B79F029CB6298BE41808E81823DADB94053 bua6j
690,224,592 *474F7DEED3C26B49F89C031416ED7FA2563C315F buff-citrine
690,224,593 *47412AC18F407422DD6B68DCDD5914E13730A978 BUNGEES2
690,224,594 *474C9BB2F3FB4C566598D63BA4DE1E4B55020C76 buonu
690,224,595 *474813CACFF8E1B4566B21B09FC8286A919A8217 burlferon
690,224,596 *4748B252BE796494E54C6D017E40EFF0F2955858 BURTVERNOY
690,224,597 *47410009646DDDA1DD7EC58424F055DA05BAF47B B%V
690,224,598 *4744F3FABBBC9654E99058B4294FEAB65B14CFE0 BZv
690,224,599 *474E8EF3BA84D8451ED0701585D4817E0D1BD70B c751i
690,224,600 *4740FFC994F24D88DBB382C6EF7710474FE30359 C7Q+
690,224,601 *474C66DA33107455796346AE0BA79B071D0AB60D CAITLINGODDARD
690,224,602 *474FFE3E8734C2E966B3C8C6ACFA9860BC557C22 CAMERONMAZIERSKI
690,224,603 *474B6E79FCB860E2E2E65A62DBD6B844D63A78B4 CAPITOL'[email protected]
690,224,604 *474906BB1BAAF672560D8DFFB18573885653B45B carli.mccormick
690,224,605 *4744A00AB267AC2BB69337B4D5B32AE073DC3718 CARLOS.ORELLANA
690,224,606 *4744D41281E0BB03E2A52D4A6F0D6D57269486A7 CARLOTT
690,224,607 *474321E4D63308CC458BDC40E2865F74E4159BD0 carrolorce
690,224,608 *474D27B56A48B57D749C38645F6120A8D82D391A CARSONBOBINO
690,224,609 *47440B9DDB34820BBA9AD31003DD335B92F9D006 CATEGORIES32POST-GRU
690,224,610 *47474AFA07810813263CF84CE4EA320D7312F753 CC$.
690,224,611 *474453E73DC9CA679780FF8E453383171EEB5F4E CDFT(
690,224,612 *474F832766B4D5D4B78015318A4DF4BCD8461E9D C?/FE
690,224,613 *4749434A76E59F393999BB67F308A788A7BC87B1 [email protected]
690,224,614 *474471B041982576B1BA153C647E36CD1B1E51AF CHALDEEE8
690,224,615 *474DD6D1CF921855C82923D4D74802C1835DA4D3 CHANCE.CRAGAN
690,224,616 *4742CF8E9F9700C2F6FCC088612DCCEE6996E031 chappys
690,224,617 *474D3427880E800DA7C82B6EC1C4CE1505F9A7B5 CHARLESBARBA
690,224,618 *47418C7382D884860954E0A36074211B966A7377 charliedolfay
690,224,619 *474830C57F6E83A42B9DB30797F8FCF02343A28F CHASECL
690,224,620 *474815905242FE45AB79E8726AE65B80123F7486 CHEDDARS
690,224,621 *4741301D2128760CCC5B3ABDA6B038266F6DA483 china8992
690,224,622 *474E3AA567DEFED1460591C08FBF1F0A6D92A740 choreic
690,224,623 *47421EBC2E76C3DC50E5429FEAE0EFCB962E19E7 CIRRATE
690,224,624 *474D720C207C7B9E0768EBC22302F2461BF1D444 CJ:NI
690,224,625 *47471F8C23E458E8197E75CD999006805ED8A9C3 C?KQC
690,224,626 *4749857754789493EC8068CBEB1859ED7D046310 CLAYTONARNIO
690,224,627 *47462623583E77D919696078FD657F4C4B3296C5 CLEORIA6
690,224,628 *474C1A0EFCEFFE42730D094A8E2CD8C695282F8A cliffri
690,224,629 *4747DE13BB9BDFD663D7C506A9A60559F91F10BA C%MM=
690,224,630 *47467913985BD8DCB04351A11B50C80CE0959EA9 CO"G)
690,224,631 *4746210A0170284DE865BA6B9C7311F53D7A7C2E COLTON.CROMEANS
690,224,632 *474BEEE4DA6E052460ABB780352E5C204E2A0273 COLUMBUSTABOLT
690,224,633 *47449F67B92EDE35EAF4DD717539E37DEB86A5C8 comeuppance3
690,224,634 *474A6904C8BD23563E8706921562E8ECF919D3C6 [email protected]
690,224,635 *47453C64371FDAC6CAE63BB6CB90DD51B4DDA582 concevable
690,224,636 *47414E32F0E50AF0691E2A8AE9B9E89799AFFF15 CONNECTED DISCONNECTED
690,224,637 *474998E274E48A896494C89FBE324EA07E1832F5 CONRAD.DIMPFL
690,224,638 *4748D24BB26A72F0984BCDC44D0200E3A8AADFCD CONRADTORRELLA
690,224,639 *474030D02E7B78FDE529199BF44EF0E8EC2B8EFF CORDELLSOLAS
690,224,640 *474417AECD32203A67109BCA6904946159866D9B co.xd
690,224,641 *474B5979C5371E9C641F8B7A0C6D36562B06F630 CP7VR
690,224,642 *474DA1BD60ED9E19C2FEE0B226231163CF14A6A7 c:\program files\mozilla firefox\modules\utilsjs
690,224,643 *4740FE5FF53F8AB8F3D5E94C75655B08CB5920C1 [email protected]
690,224,644 *474D145567C488B4666ECFBAA80D04DD140F346B CRETACES3
690,224,645 *4747824D1EE7D72001E4DCBE70E13A5C45DCD7B0 CRINTEAMARIUS
690,224,646 *474BCF8BD053733B5C46B103DBBC5E24F9BFD4A6 crmamc
690,224,647 *474ECC94B6D27AF355B1A4753B58F8A6F67709AC CS3N=
690,224,648 *4740AC7088A867333A217528499507E99BF2DD6C csl+5
690,224,649 *4744D6F4A6B8FC207375D5DAB9030C924367CF21 csqv$
690,224,650 *47477C5286FA6B26E616D6C2C877843075F1EA02 ctdc/
690,224,651 *474583189C510E4632D00F5E8D1A58E1D6FF462A c,#ui
690,224,652 *4740241B3E91F3CB51C9614FED0DC7DC7641C7A7 CUJEZ
690,224,653 *474A449C508E23E5525C71AFC0567B7834E36AC9 C%V1W
690,224,654 *474558C6077F6AA683EB6639398E80A86FB804EC CV)FI
690,224,655 *474EC929A0551E31CDE34B3EA389D4F6751C7485 cwh1z
690,224,656 *474543659E2DF7B48E597201B47F41BDDC18CB64 [email protected]
690,224,657 *474C5B9CDB828FE4B35BC448BE27C0CB27B9C67C c!wiy
690,224,658 *474E94E1E36661960EFC60CFD420E775AD0C80E3 d/.:,
690,224,659 *4740C8FAD03EBB71D7DC73A6D6CECAB7EE0FCBF5 d1tsy
690,224,660 *4742974476FD00443229A34B2E3F6811C123A018 d)2&0
690,224,661 *474EABADE84719196987156280F5EC46DD192110 D27C
690,224,662 *474502FAAD80FF3A75FDF60D8425293B2AD37842 d;9.j
690,224,663 *474A897E6A180E167D5EA5CC988EE2BD910F2640 d9t2y
690,224,664 *474B2B5E5D6D236E892D693500628491901A6653 DA&CB
690,224,665 *474D07E0D6655D61DD48CAA0B5C02B1CDE22A691 DANCEATTENDANCE
690,224,666 *4749BB835F662503D855A4A901E038D8552A4C0B DARIOBLANKO
690,224,667 *4742A4701F4EA273FE03AEFFAE94734B1C4751C6 DARUM.BIN.ICH.ANDERS
690,224,668 *4745E187935311AA4FCBACD2BA5BB89939ED037B darylarif
690,224,669 *4744370AFDE97E8386352E3081CFAD94A2A6E1D3 daschagga4
690,224,670 *47446908F18F1BFBABF497D132756A4AD7EB337A DAVID.STIGLICH
690,224,671 *47485FE2935751DEF7FAE4B940544B13EEF79540 DB%&H
690,224,672 *47408454AFB142229A38FFD1F2A4C705A566CD37 DCHQ
690,224,673 *474F33980C2FF87EEB05F3C55155137C4FDA40CE DEANDRE.MEDE
690,224,674 *474F173D09BC980DA69C50311C29542E52E4016D DEC42.80312381.1705
690,224,675 *4748196C745C901D7CEBEBE170D7E3AF19D4B77A dek!q
690,224,676 *474ADA137C76813D461E00F2E09BBBC911701E3C DELSCHWENZER
690,224,677 *4748244732D98575BB65FFBF000EB04AB15C08DF DENIGREE.
690,224,678 *47477C5DF2FA06840117FFB7660462746FCBE7CE desireesim
690,224,679 *474DF87E3872FA2CB60E2EA33BDABF2D1D04572F deutlichverst
690,224,680 *474155FD6A2EA8A620E5F8A9349826D94741633A DFvc
690,224,681 *474AE697CA51064669626736FE9DF30A6141D17E DIAGONLA2
690,224,682 *474BE33C559A52E0F75DF753467338E4C9AE083C Diddy-(skit)
690,224,683 *474DC988BC035510D7D7DE68562D36AB6CC2E9C4 didm1
690,224,684 *4743A4D8EA575B0B1378BF8B068062DA3C7E6A1C Dipping-basket
690,224,685 *474173B52DA09159D5A8431C2DCD993FBD2F4BA8 disney-music-group
690,224,686 *47414A08E65F029006F1BB7753D47797AE091E73 DITH(
690,224,687 *474AFA6FADCD79D6A77E1DB0158BFB6F773E3AF5 DMVM4
690,224,688 *474F4535956A64165BF32F970F0EBD46D3DADAEB donaldaaa4
690,224,689 *4747443B6F8206B72C81BB0C6C848293A79DF76B DONALD-GRAMM
690,224,690 *4744D9278E0B3968A6A9E5E5E52C13BC9BA52DC1 do-nguyen-thanh
690,224,691 *4740B32A67C059E488F69C9B0A375ECCAEF466B2 dontemeegan
690,224,692 *474AD4F2FB9E17F0201D3FED24A6B8BD8FC4982D DontLetYourBabiesGrowUptoBeCowboys
690,224,693 *474E41171A4689CC0782D5610C025DA6376FAB78 douglassciskowski
690,224,694 *4746091747178DBBF46E32AF1E3337DDC0A971EB DOUGLAS-WHITE
690,224,695 *4747E7964AAD6553832ABC119264D02A08EED2FF dqcpk
690,224,696 *474922F3C23293FD36D00D71DF9F5A91E6C780E6 drawbaugh6
690,224,697 *474985D6E070139B55FFD6393D8889BB9F04A3D7 dreamdeep
690,224,698 *47437CA9C19A42C76F5DC3F7882DC6E0BD4EFFDF DR"EL
690,224,699 *47414D8E731812353B222ACF206AACFA8F92B22E DSJMEJXHQZVJRX
690,224,700 *474C3CD59D406CC157F8ABE6EEC2CC59C7CC8927 dson1
690,224,701 *4742233D678FD714464E5618630CA1B1ACAB28DA d%+uh
690,224,702 *474495CF9FA83C719B632FD44EF5E3772E3919AB dulce-manantial
690,224,703 *474679FE6EF7027BB565D24C4E2D1EA7BCE1473A DUNCANTRUMBLEY
690,224,704 *47404B6F421E663750A937B0CBBC42393AC26CF0 DVMQS
690,224,705 *4748E6BF1F2B8DB529F6CAF42078FE85A688838E DXss
690,224,706 *474D4DA2AD4868036D7908AFE6F299D5C0103A14 EBQS
690,224,707 *474715B961A6278F9CEDB8CBD6EF79DA48C4F282 EFBY
690,224,708 *474675B2FB3A5234009B297E2C27A9A4CB6007E7 EG51W
690,224,709 *474EC36374A5E3490B241AE28007CCBDD1E927EA ek!!
690,224,710 *47492DF57C0D28B54BFE418AF59384A8FD6CB36F elenamira
690,224,711 *47464A70415E9CD93B6CFDF69475E89143DB463C ELLIOTT.CHENET
690,224,712 *474440D8F35CD4025090F2B5BD2752344967DCE2 ELPAPA21
690,224,713 *4747B5E69B6D1D3D030B647F1F71C293FD8DE1CF EMERY.GIESSINGER
690,224,714 *47491C27F0C731D6C1E8F20AA318D1673DBBF044 EMILEGAYHEART
690,224,715 *474B174C6219FC7FFCF7589925DAB85EBFD40716 emily-nunn
690,224,716 *474BC9FCB7BDD046C0A7BEBF5A776B91E681437E Endstation-Abschiebehaft-(feat-Mindix)
690,224,717 *474673DC9193167CE847E6D19F6B1444F9521825 ẼÑEMI
690,224,718 *4744C52505A3D2827B9CC7D2084D1B08F5BD5F3E english.canadian
690,224,719 *474995ED3E3695BBC6EAC902268505E18C9A86EF engulf,.engorge;.gulp;.eat,.drink.&c..(food).298.
690,224,720 *47460AB8600E28247ABF1B142F2B44815A00C35D ENS0U1ING
690,224,721 *4743E029DDC5CA5A212A2D4A4043B75D6160BB9B [email protected]
690,224,722 *4746913260D8392FCD996BA77191DA8A0D4E88FE EPARISE
690,224,723 *474D910F64A4DFC831A053D3C5A85F156B1A7A0C ESPIREOAK
690,224,724 *474FE49DB080721CB47CB10BE358D9C24BF3D584 ESTEBANCARCO
690,224,725 *4743DCF1EA05282566B1AFAA7355CA829659A668 ET1I,
690,224,726 *474A36E04A55B4643917D6E79A1B8C08FEB554D1 eudaimonia-overture
690,224,727 *4745BC9E8BB42AA5E11FD2236D2E9C4D8F8EC924 EVERETT.VOLLENWEIDER
690,224,728 *474E6629779DAF471632064F1CE02788956BB237 EXHIBITION 3 (DISC 2: MIXED BY SERGE DEVANT)
690,224,729 *474EA29F7EAC0D1C56B5834610C9AB01B9E4D1A8 faustinopotucek
690,224,730 *47411AC2F5B00C5D434E4676C06DEB24BABD5137 fbrpc
690,224,731 *474573F45AA1837CEDDBD56163BCB125E3C1D964 FIDO27
690,224,732 *4744EBFEE2DA728501B7671685DEEA9E8824DD88 finding-a-new-music-director-the-old-fashioned-way
690,224,733 *4741A9BA8664CCDAA4CA56D275C9F46C5DA99F5F FIR5+1IN9
690,224,734 *4744E1FE4FA642AF289145ACCB3A8927A4DBBE25 flamingogone
690,224,735 *474E57356914C509FA740D0BF9AB435548597C4A flowerp7
690,224,736 *474B9437E56902ABCA655293D630956052B7E403 FM34PLUS
690,224,737 *47497D85F0BFF8B846084F5DC28B928E6518E87D foun741nhe4d$
690,224,738 *47493FC343ECD8093F21175208395CEC5173D89C frankfreidin
690,224,739 *474654CF3F0AB4A81961000EEFC70C7CBA4A27E9 FREDDIE.NEIS
690,224,740 *4746B2A61F9B0D7AE9483A4790AF05AF9CD602A3 FREDDIESAAM
690,224,741 *4744EC1899B7F276AD3D316E49219DE947D07CAC FREDDYHOLLAWAY
690,224,742 *474325A9C38C0B0A9308E4B6531CAB717EE7AACE FRIDAYFILLINSBLOGSPOTCOMFRIDAYFILLINS
690,224,743 *474B1011C071BB19B2E8948D297C3B5B0E4E01B3 Friend(CMver)
690,224,744 *474FCA53C45804B864D0660A0D32723755FE9DBC from-which-i-came-/-a-magic-world
690,224,745 *47415B95307D900ED114CBAAB420791C425AEE23 [email protected]
690,224,746 *474CF7AE7CA97C7397DE91B711173572A283B137 fzerox
690,224,747 *474838E664A4BD6C4786C7CA59B5FE08BE0224C4 garryarrellin
690,224,748 *474BFEABAC254E408C1F53FEA9CEEF3B9D129B89 gavinklave
690,224,749 *4743B3AF0C4F26F3CAB4B69F2094F09AF9BCA2EA GAYLE.KALBERER
690,224,750 *47453110298739E8D3D35741C308774B338C7266 GB}K
690,224,751 *4741D5945CEAB3B740F07DAEAAD27206579E6D22 GINO-DE-LUCA
690,224,752 *4746ABE61E03B4B5274136373268494051F6223B GIRDERS
690,224,753 *47487B2DF83881696150A16854DFE91622B106D4 [email protected]
690,224,754 *4743E5D163E88248AC4AFBC8B1DF1689988473AD gnuoyrevs
690,224,755 *474BDCFBBAE8E6357673FE77A7FC5F52A5097362 graupeln0
690,224,756 *474ACFFFC98979D62EC2E9387B6B3C4EDC64A780 graveldiver9
690,224,757 *47426AE824CA66E32ECDA8114BDB2ADEEDB9FE46 [email protected]
690,224,758 *47420E33348B2DB49AC76C99D003C4D048DDBC81 GUORANKAI
690,224,759 *474736CC42E3C62B5A1E79183317199AE4E66E09 guygiannattasio
690,224,760 *47402EE53B677661E5166506F105B9CBE7585CE4 GW3LQXBXMIJ
690,224,761 *4742C6A82BAA3472EF39B49699FA6FE11D2D526B G:ZAAA
690,224,762 *474067A01E8683E7C254BFCC7D672E6777A152A2 hansengwall
690,224,763 *4746D264A7C5147F4C394510108CC759034962AD HARCIARA
690,224,764 *4743B48E20FA93D66284EE3FA55981D688AA7BA2 HARTEN
690,224,765 *474FBC86FA7FEE8E5E4E7AFB54C0F631A2E111C5 HB7296CM
690,224,766 *47406DAEB86046C0E81FCAAB602C134554B828F5 heavywe19h+5
690,224,767 *4746170C8BD3B7A9B565AC18DCF20895D9061EAC HESTER PIETERSE
690,224,768 *47440265055A1ECB6957652FAC7FBEFF7C679AF2 HGILNENU7
690,224,769 *474F6D66AC870C543F0855A54C1B0C71EF700F01 HiFidelity (feat Freddie Bruno)
690,224,770 *4749757B4CD49F985284B792BD438887D17256F8 HILARIO.COWDER
690,224,771 *4749A17697D63379FCCC0458B3C8826978B9BE78 hiren.radadia
690,224,772 *474C9676B4E2158BDF48439202F75E281B86DD2E HJERTESKRENDES
690,224,773 *474ECA3136B7C8E597762BEDFAB5B7CA213706F0 HNDRLNDS6
690,224,774 *4747A4E4858113A4312C71B5931CE6C4C5B4A159 [email protected]
690,224,775 *4748FAD08DE3B7395C6E4BD94D247A922A89F311 [email protected]
690,224,776 *47484E2C09446A4C6D23868A637B326FED04DC67 HOWERS123
690,224,777 *4742F49742644A5F04D16129CCA07380A40AE377 HOW'S-YOUR-EVENING-SO-FAR?-(UK-12"-MIX)
690,224,778 *4749D316F7B3B4042696394D5278176769EFF462 [email protected]
690,224,779 *474CF5A5DAE592A061967991F451E319B617FFDB HTTPWWWETC33ORG
690,224,780 *4745B90E6941428B102CE44DAE1CD017234AF53B HUEYPAULINE
690,224,781 *47498F4C278364C9BE7D95F12307CFBF95403FBD HUMMINGBIRDFEEDINGGUIDE.COM
690,224,782 *474153B2C001956B60449DDC0E843AB13B00664C HUNTERGARNSEY
690,224,783 *474A13E3C9387E67290F19FB9D5A67C4D030D340 hyppik
690,224,784 *47408994B8D9A286B18BB30D942483E9AF0BCA64 igombine5
690,224,785 *4749A79A9D9A5F209BDC39089EE2A116F992207C [email protected]
690,224,786 *474E1A05925D51D7DB82ED49D13EAE80FDF9E55B incriminate
690,224,787 *4747D8754AC4DF38A9DF63781EECC70A3239C47D IRREFUTABLE0
690,224,788 *4746DC21EB8BE35B80233B8065190F5B4AB380C8 ISAIAS.KAHALEHOE
690,224,789 *474838A5FA2F79EBA35D68279305FDD5198AB190 ISHONAE
690,224,790 *4743888F5C9CF1889DC20EFEC47027B59673894B ISIDRO.PERCE
690,224,791 *474F4EE96AC984DF138473E56C848751EAE6497B ISRAEL.STRAUB
690,224,792 *474DD512AD3DDE2B70703DED125B6F91FE96D7AD iu9w
690,224,793 *474F89FF02FACB7E6D156686CC301727E1E0BAD1 JABBINGS5
690,224,794 *4745B057889A50B6417F9FD8617807B9BB13AE7A JACKIEBABB
690,224,795 *4745A378E71E8FD9C1D7279C1D168093E0E73F90 JAGUARBUBBA1
690,224,796 *474B762A3406F6AE4F74B88C75C07F91FB8B531F JAMESBODNER
690,224,797 *4745388EAF2E613C4BE291902A967B392BD768EF jamieansara
690,224,798 *474701363BFAD13F51534D77077160741C421BF1 janet.sullivan.whitaker
690,224,799 *47430DF24580CF526C97B10492410D5675BC1199 JARREDAPPENZELLER
690,224,800 *474312FDCF1EC9A210E853C70FBA14886DBAEB50 JARRODALLABAND
690,224,801 *47403D78CE641E49150D1F4028F2CDCAFF0B000A JAZIGAJ
690,224,802 *47430A1195A84B4C8430C2205C460063901133CB jeffreyparrot
690,224,803 *47479F1D58B915073089096C1E07D9A84C925CDE jerometrent
690,224,804 *474BBA05B90778D8595F0D42B06FEC9D5BC16322 jerrellgottschalk
690,224,805 *4742874DE820FEC8D1EFB454C614C4C6ACAF37E3 JESS COTE
690,224,806 *474FAD132C05BA9A3249247E6BB2C7D15A106389 JESSI-OLSEN
690,224,807 *4741DB64553FBD0F5D20B429E70B72E6379C1AD1 JESSTERS1
690,224,808 *4741DE3C764BC9ED1D83368162E0A354650946F3 JESUS.KILBANE
690,224,809 *474EFCFED5B118E5A1C2E1C54487648CD1340ED4 JIMMY.BRAVO
690,224,810 *474C67EA9C25462DBB0713E555915C7953D2489B [email protected]
690,224,811 *474A188D882C84C7C4B235F131B47363189976C7 JOHNATHANREXFORD
690,224,812 *474A7ADAA761CAC3F90558A44F73D198C6935AF1 JOHNSONMATKOVIC
690,224,813 *4748E19E76F820236E9C51CE37F6AD192BB00E93 JONATHONBLAZE
690,224,814 *4748795AF8B51490ED3FA247F5CDE91B4634452B JOSCANLON
690,224,815 *4741F521C2672EFE65FB26ED2A2996BD8B0FADAA joshmckone
690,224,816 *474B8D962464E240EBC17BCD43F22AC948DC1E00 JUANCARLOSVARGAS
690,224,817 *474787BFB62CCBB9C9E132E63F3BCEB70AF4A5A7 JUDEMYERS
690,224,818 *47404228BB03C6756C95336D01D4549B28C47669 [email protected]
690,224,819 *4749AF692111DCEEFC1F0DC9C830BA13E942A16D JUSTINTAIT
690,224,820 *4748FD24409169DBDDBAAA7085BE915A96CE5E3B [email protected]
690,224,821 *4744AA5A9A40C4E5C1A33B473ADF968EA6A78B4D kaffekandens
690,224,822 *4741D9C635A4BB685C69E1119181DA4D48696846 KANAUTSING
690,224,823 *474C43B32C969DFAB51ADCB23612F8B158C7191A KAREEM.HUTCHINS
690,224,824 *4746200978931C3A7AE9034DE1AADFB5F83E082E karlgergely
690,224,825 *474BACBA721BA2A2BAFB72D133B40CF54145AEF8 KARMEN.JAMES
690,224,826 *474DDB1DDFE636126B7053D94F609A3957E36DC2 KARMIN JONES
690,224,827 *474E4B9FC318426B87E1CFAA3756C01F48D33F41 kathy.barocco
690,224,828 *474555078DE7235FE3D63F59C414BB9868495604 kaylaadg4
690,224,829 *474585065BED518652F4B914B490A2629337C5BA kayla.leon
690,224,830 *474D6DEB2C5727554EB5FF8E1E19C096C94A15E7 KBAOY
690,224,831 *47493506ECE144413FC8A9FCBAF373368335593C KENNITH.PALCZYNSKI
690,224,832 *474E001E308F6693315EE7F420F8351681E6D541 KENNY.ZINZ
690,224,833 *474F0F6C9D7A8B125C102818E0D3D96066B56144 KESHAV-GUPTA
690,224,834 *474C9C7C4501ACD1914A4D4AC9596694D32F2D2A keshraj.babooram
690,224,835 *4749C80A459C9185E48E0125D6AF27D1F695552E kimeddington
690,224,836 *4741C8E1BE0EBA75A7118B81E645A003781D31F6 [email protected]
690,224,837 *47487E448AA5756458C2986A46A83A31B4D24B82 KORENMIJTEN
690,224,838 *47429DE6CA9AB089555869937B07988765FC1E3F kriscoe
690,224,839 *474AFBFBF4F6381146488D47B70EF1709C2B37C5 ktjt
690,224,840 *474468D32956771490723ECD15CF657B8448F44F L4MBUZ4RT3I4S
690,224,841 *4743F367362C5A0C3880571A2B1AD59953B82753 LARGESCALEOPERATIONALPROGRAMSFOREXAMPLE,WEDONOTYET
690,224,842 *474B9ED8719CD03902971A41AD2FF93C91B0AFC9 LARRYQUAIFE
690,224,843 *474BB816EA71FA6BE89FE8512D94A9607B4921BB LAVINTE
690,224,844 *47432CE12EB3E4A2BEE45F10DE9FA1728203CAAF LBAHCTAP
690,224,845 *474738949E9C001ECF3C6FA7334F4C514DB1F790 LBLONDIN
690,224,846 *47408E37C6C77AC903E0FDD10ECE3A4E22413E4D LEG!+!MA+ENE$$
690,224,847 *4743DFAD695FB0D5C0F976A2D4BE9D199FAE7055 leonelmoat
690,224,848 *474BBED29D314CD12EDF300A8F6942AD3E6C9C44 LESLIE.VALSECA
690,224,849 *47409295D7F4F22E489057DBAEA4EFC93A6C22CA LES.OHM
690,224,850 *47492CAE51328385D6251EBD1BF291965A02F0DB LEUNSTOEL!
690,224,851 *4747E94C9C9FE00E09B43B8C10609E9047C863D4 LEVILANINI
690,224,852 *4749B3FA9EC49CDE218587F20A32990CEBB4AC79 LEWISLAURA
690,224,853 *474690FDFC7A35B55313667557F7C55DCE0A007F LIAMENDERSBY
690,224,854 *4743DFEEBE7BCE69BCD18B90E7E51FB83F8B2D47 [email protected]
690,224,855 *474512A85E45D1886F2CEE274F957C1B4E9EDEB1 LILIANAAGACHE1
690,224,856 *474ED85C57CF137564745411F079111FCDB67261 [email protected]
690,224,857 *474FFC62F67DD6901644CE129940DD35E2B2ECAF lionelmuenkel
690,224,858 *474AB3C247EC50B13035A4F5910FC53E33B46EE0 LISTA-DE-RADIOS-LIBRES
690,224,859 *4749593D950A1CC40B55215325EC77FBDA98B59E Lite-Samethin'
690,224,860 *474822DDDBAE49B5B066F2D5AF3823B88E1727A8 [email protected]
690,224,861 *474898B61C996B5446122B1F4E36FE0454BCA9B4 LOBOVSKY
690,224,862 *474933509188EFE58B31B5F8A24DD8A5DC54AA12 LUCA ZUCCONI
690,224,863 *474F66304282F5D65150824D5D1A693EA9401329 LYKLIGA
690,224,864 *4740DCA60E3E0E8EAA1EF317F627BFC39282867A lysbads8
690,224,865 *47474C597256453C04FD75F43A6D49F6503E20C4 M37ALISM
690,224,866 *474E499682DE276A18EFEE987DAD3E69A34512ED MACROPUS5
690,224,867 *474AA6909BCCD2F083C731157E4E041060859AAC maiah1
690,224,868 *474A91A34FAAA768EE4A6ED4E79EAFCFED6F85DE marcrums6
690,224,869 *4746254E5FAB0DC9430F6D1C930E2A640F977EC2 MARIECLUCAS
690,224,870 *474F17703FEE0DD2CA5D2254CA0A48E63326D9BA MARVIN-BRISCOE
690,224,871 *474C93BBEAFCCC1ACAB0FA501029E8D724EB005B MAXMULCAHY
690,224,872 *4741FD38FB54E87958198E77C15799808EFCCFCF MAZENAWAR
690,224,873 *474E9138C99E89ED8A713C22A49BDF91E3D14F98 mckenzie-kramer
690,224,874 *474C50B1129C86DA1742FB2C1570EB71A3A570A6 ME.NDAH
690,224,875 *4745361C162D4AB8FB8A3088E699078B6878A5F5 MHAR SANTIAGO
690,224,876 *4741D4CDE96B4FA12D6D02FA3C94BFF8F1DAAC58 MICAH-BOSLEY
690,224,877 *47455E62862F9AAC8B8EFA4ADAE6BE609AC3549F micahsandlian
690,224,878 *474C7E50186D2E0C5CA602AB5575452A761E11D8 MIKAHRAHEEM
690,224,879 *47423A1E3650232E3253529BF3C21ABC69AA2ED0 mikedillard
690,224,880 *4743D2E65D8A438978A02677CB35080CBC300CF3 MIQUEL.UCHYTIL
690,224,881 *47439FFBDDD4AE3C9C6FC386B13287965F7B9834 Miriam.Kathrine.Nicolai
690,224,882 *474C290E68A6B0B9C20253A32A4B6CC87EEC0654 misstarts
690,224,883 *4747C954CBA15223092A87E0D4E1334897F65305 MOKUSHIR4
690,224,884 *474F6011B26F4A3547AA896931C4D1EF19E1AD69 MOONSKATER
690,224,885 *474AA05BBBB03BC280FA86C070E9D38F08FCE051 mountain
690,224,886 *4741945B71E863DB240518BCCB94D3D189D3122B MURĪBIN
690,224,887 *474DAC640C2559058FEE7329F0AE3EA4CA383329 MUSEUMANDY
690,224,888 *474CED16D9B71A4D0973543AB782F2837CAEBB13 MVRANARI
690,224,889 *4745DEA2046E8CFCF81CA14385F0F8F211569FE8 MYAAA2010
690,224,890 *474B3D7AB1323355672EA5FEE81F1B6CF620339A NAIL'S.GIFT
690,224,891 *47481FC6E1A31C9BAF68EC957D1B9E7DE7ACFB0C [email protected]
690,224,892 *4745D782C4A9F66CFE74FD3ACE4420583E61E5E9 NARODJU
690,224,893 *474C1875DCFF8BFBFF28F889E941C99EED6585DD nastavcima2
690,224,894 *474682ECED281888D047927E6EB18C07E61888D3 [email protected]
690,224,895 *4743540D7E666EA033CC57C4A5B622A0F78E5554 neoclacissism
690,224,896 *4744C24B47BCCFCED5DD24E6DF4B56586DDFD247 [email protected]
690,224,897 *4742CEFA5066F69B3203C7C7BFF1CEC1CCD32BCB NIKDYOM
690,224,898 *4740702207736586A915275ABFF636AACBEBBCF3 NONSENSE.75.61.85.11
690,224,899 *474FC7999722D10EF6B234678141E4F5395EFFB5 NORM4LIS3RS
690,224,900 *474856FEEB7EA8C2A834E7ED95146154AD5EA9B7 NORPAHC4
690,224,901 *4743A7734D85F15E8FD23AE28264812F31D38BB6 [email protected]
690,224,902 *47487A591A8BF74A0C14CF8AEB3BF149404804AC nubukay7
690,224,903 *474A7C9F3E89E01B6F33B6C77331701E91F69B01 offlinebbs
690,224,904 *47462850705A565754F79D3DF78A349BF25192D1 oisnusa8
690,224,905 *4748F2979F4A043856C637C4F5446F63FEEFCA9A OMIM160600454
690,224,906 *4747B12AC2D6ECE8C1AB2962F047A4393E4FFE95 ommiommi
690,224,907 *474D18DBAA760A7C3717371B46F33214FF3B2342 oval-leaved
690,224,908 *47499A5C16036C5F920DCE8F6B83C7A2EF4DADC5 [email protected]
690,224,909 *4744A883F6000E1138E057513E2CDEA6B9412DF2 [email protected]
690,224,910 *474E1394539B4416E97439436ABFF51DFAEA53F3 p0ckmante
690,224,911 *4746B07BC062477480A4240B3ABFA67A1C5CFABC paul.galinato
690,224,912 *474489EF29703C826F819F3430BC830C10482471 PAUL.NUETZMAN
690,224,913 *474CE04B05964A29C0A22544FD04BCD1366126B1 PAUNETO'S-POINT
690,224,914 *4744D13409116F195A0B99DAF6CACC98C43CC0A3 PERMU747ON$7
690,224,915 *4741BB109C46301C84FC5E0AD9C4E88E1826F03B peupleriez1
690,224,916 *4742A820C503522EADAAFB053ACD68507AA21482 PHELIPPE1
690,224,917 *47490A9F1C2933F43EAF14358E6A63535743201B [email protected]
690,224,918 *474324AFDC52F9A2D670D6116AAE2DD46C218C34 PHILIPS_0810
690,224,919 *4740E5FCDC2FD01993BA88D3A3AA1924689563B5 PINNEYS1
690,224,920 *47456F062899C6D55A934B63E2572F71298F8435 [email protected]
690,224,921 *474BE364C2802E8C01739975696E8822E86639A0 pleasetanner
690,224,922 *4742D4A5AA98DF9B0FAC6384EE536D7417292866 [email protected]
690,224,923 *474E3464B7C1BFE1325A902774FCBE9B70A9797F porter-this-beauty-queen-has-brains-and-bite
690,224,924 *47472A9E42F0A8B5095AD2CF5588E43DB3F65FF9 PRDSTRST3
690,224,925 *474124685A27F178F1813B2CEE0D26213B5476F7 prederemo4
690,224,926 *47434A2F6B5BD38A3438F445C8376F863A6C0099 PROFESSAIENT0
690,224,927 *4742878FE758E4F92320298B30E59F8E0791A7E7 PROVEHENDAM
690,224,928 *474B72BB32CEB974AEDADC64666CA1D67A16C90B PSYCHIATRIQUES
690,224,929 *47405615E433E325CC4FB5D337B9BCD2E33A2302 pu$$y
690,224,930 *47471C07999B6C8478573F406853E790C727D6FD Q170379
690,224,931 *4745B21E3529F06738258C2672A619B8E0AA915D /Q+AAA
690,224,932 *474A97C72D47BF886107DBA77C397E31D2FB2D3F QC6G
690,224,933 *474B45A306AA143197E5A491B3F476446F090ACE [email protected]
690,224,934 *474B4E3624B23BC0CBF1CCDD93C7D0D97A101FB8 qnrjheam78
690,224,935 *47410BDD1120AAD9BFAEFFE674BD94571686A661 [email protected]
690,224,936 *4740F9ABC023696ABFBD0B1F00C4323E7A2E8ECA [email protected]**)X(
690,224,937 *474C8F5019380C29E185B78B62ED16402F1B3798 [email protected]
690,224,938 *474E75F4E5795AA307F23C24D948C60921155451 RANDOLPHSEDORE
690,224,939 *4747BEE4F3BB8FECEF603F729546B4C751EE5129 RASONET
690,224,940 *474DD3D9A18569405290C90F3DBDD26572FEF11D RAWEST
690,224,941 *4748250D70F55461F7676E65F478224500AA48FF RDADASHI
690,224,942 *474288950AC421593D78D1D27E2D5F119B2116B6 REFECTING1
690,224,943 *4741345C152C425A8A046CAD50DBC043837DDC89 REMILITARIZING7
690,224,944 *47434D09C9951141FB06C4491908915C9DFE4642 represjonowanych”
690,224,945 *4742C629861FFAC26C41583A14596D4B2BC76657 REYNOLDSZXCVB1
690,224,946 *474BF1FAC8D75E2CBDF50A39E94AD65291F05198 RHENROMERO
690,224,947 *474AFA9801455FA623C2F958CE5E6999AF168AC7 RICKYRAM9
690,224,948 *4742D8CDE33F885BFAF8AD4709DB15CAF6922A7D ritable-nature
690,224,949 *474A8B475689916FFD3BE3F42FE1479E87F9DD8B RIULIKOED
690,224,950 *474DBD600E201BD0C6405818DEEAE4F09D4262DE r.klavier.op..1..sch
690,224,951 *474CA90794ACAEE0222CD28B24D494306CB135AD RLIGHET OG P
690,224,952 *474ACBF8BE63CD0A6A2F3C117C4663FB24CEB464 ROBEL-TESFAYE
690,224,953 *474301B5C91902A86B7CD0D019379D0DBC8E8B5A robertotapian
690,224,954 *474F04176DA0BE4C54F6F762809301400F709848 ROBERTPASCO
690,224,955 *474364F2EB38224B39F81529AA56696A7EE651C3 ROGISQUE3
690,224,956 *474206FD92CD29F92CBA32BE393BC79CAC459BC2 RONNIESPEARS
690,224,957 *4748D0A815677D627308430D6CA3415D32B92FD0 ROOSTERCATSES
690,224,958 *474C10ACF16748543444C177B5CB548EE69D5EA8 [email protected]
690,224,959 *474B7CE82BF2AD11ADAE5A4CA9A8981BB4B33594 RSTENDE9
690,224,960 *47408455B35F55314019683653F3213DEEC3AE91 [email protected]
690,224,961 *47497E730DB451A62AA9ABD27A44610DE9058F53 sabelklingen!
690,224,962 *4744461CAE3EE1888CF795F407F83139A8CD631F SALLYACTION
690,224,963 *474378FDF2A68C0FBF8242EF35527C64132BD0A0 SAMAJABSW7
690,224,964 *474F1D5DB9058D4D9654634B1D306330C07AD1A3 sameehafatima
690,224,965 *4748B50B94AD64CAB890931887728E430B1B99F9 SAMGHOST1
690,224,966 *474100EC1AD83C225C959270CF41BB9A3C8D6BE6 SANRYŌ
690,224,967 *474DF98CA7EAD62D0627CF546A1C7951AC049DDE santiagopolicz
690,224,968 *4747231C34634481B749AD69EBCDE718872D9C51 SAVIOUR,.WELCOME.HOME
690,224,969 *474958F095A40E23627B7DBA41BD2A1B79C593B5 SCHOGLE5
690,224,970 *47461EA565186A46B8BC6E6F2485D32FA5ED1099 sdipanaed
690,224,971 *474714CB18883AF7C508198176DC8B2A7EDEDCF0 SECE1
690,224,972 *474AFE78153C944988E5E4A2E96574DADBEA6C8F SEDAWI.IBRAHEEM
690,224,973 *4740E185A8508BD7DBBC34B1BDAEFAB64CA1107E SEFYUS
690,224,974 *4749B60DF025F41A4A6DC5A8369B367EB0E94360 SEIGDUMSING
690,224,975 *474009C85DC9D421AB819FD55E8FC346AE468A3C SEJTEGNOTING
690,224,976 *4742557C0B9650EFEAC6D8ABA649175460A6661B SELBARTSIGERNE5
690,224,977 *47471E9DADF89C2D89A47E41111CB2A55BC36535 SELFLESS
690,224,978 *4746ABD479C639DC2B23307D7AE242B74FB67679 servant hemetthedukeinthestreet,sir,ofwhomhehath
690,224,979 *4743732353C417DCDAA9BFB450983BD49AD2B303 SHANE.SANDLIN
690,224,980 *474F58D3FF797E387C623E0EC1AA65F8DD80CE9A SHARONZACHARY9
690,224,981 *4743791CE2A05D06CF4D423CB48228231585A935 SHARVEH
690,224,982 *47487C42544616429BF9D4460116A3F6FFD15360 SHAZULIY
690,224,983 *474C8FBCC56965F301EB61B320F44A47E6F3CE63 SHERWOOD.PETTIS
690,224,984 *474D35B54D11A2DF234B3C313EC6D75E1646ACF6 SHONDELANGEL
690,224,985 *4740C93A9111DBE262370D99A218F1D0DA78DD61 SHREYA.WAGLE
690,224,986 *4745FCCB5B0C1F26F66F8E6D62E8C9BFAED25876 SIDNEYANGELS5
690,224,987 *474F1B90D72556C9377C17253639F30CB775D481 SIEMPRETUSHA99
690,224,988 *4748CFF6FC4CEB28CEFB3C8CF4405E44FD17D29F SLANGESKINDENES
690,224,989 *474E8DA7E7ED2F1856ECAA1009B0D5836CD5EAD1 SNOWFEATING
690,224,990 *474606AFF6B918E7BD53E068005DCA818B241453 SO DEADLY (FEAT. Q-STRANGE)
690,224,991 *474D4CDDF2CFF4494F9B5E326F4FB76CDD2ACB4D sonconson(dalaluz)
690,224,992 *4745B7FEC75C6AA3A8FC8C99D150A1E427ADDFCF sonnaville
690,224,993 *47462034ACDE9F73946B20EA2ED8CC4A0DDC2E81 soused
690,224,994 *47468EFC1875C0496D59D7607D02A1C09E36DC4C SPECIALWOLF6
690,224,995 *474F27188074CF5450A068ECAEE5931C7D097B02 spidsklshoved
690,224,996 *474F3B242377AC2D1D5B3E2DAA6D88021956966A splat-*-<----b
690,224,997 *4742006A7548B6A9D94388E216ABC1DE8097DCE2 splat!!~`~`dq
690,224,998 *47472E285B9EC7B533E0B6B67705CA2F714A4AB6 STANFORDBERGQUIST
690,224,999 *4741009D275F89799FA3CC51D84DF3FE184EC6D7 STEUNPIL8
690,225,000 *474B4403075B22C0CEFB2D356DDE5D46F39BEAE2 stica-antivirus
690,225,001 *47438925C13D89714A73F3BE0FB183BA3572DBA4 STORY-OF-THE-GIRL
690,225,002 *474015A58972BF9B0BC1A2604693C38C45D61F9D [email protected]
690,225,003 *474BD87C2C2AB178CB46CA5ACDD8FD0E98C15E1B SUNDIEFU
690,225,004 *474D5004073F9DDB1159C75A6F31D4B382FDAD82 surfusion
690,225,005 *47450CFA4A261FEA5BECC330CD7B46CBC1577B16 SVRDFSTETSED
690,225,006 *47465ACF63CAB8B21AD94A3B59B9C1F1A7598405 SWEETENDSOURHAPPINESS
690,225,007 *474E65A600FF7A6B474D77BA2265B4B43DA2A022 sylvesterartis
690,225,008 *47426F5A7DFEA0C901DFF377E3EB1F9DF106E6C1 T94445
690,225,009 *47428B03303610C349DEF70D5EFF90B9D81DB9DD tachotypes5
690,225,010 *47455AB798E128C3031883354BF6781BFEEAB1A9 TALALMUSTAFA
690,225,011 *47470DFF9AC5C78666B183B07C643468C6535FA0 TALKPSOU
690,225,012 *474D37DAAF1B3D8877E718FBBEECF1C28ADE1211 TANNERDAVIDS
690,225,013 *474BDA5B9E0A2ADCBE88C878493EDAFF2928F33A TATIANA.SALAS
690,225,014 *4743540A3F8A54BD582AC108703F329EB600FAAE taylorpistole
690,225,015 *474E65CA1055A28424D025CC1BC4FC41FF6CAE3D TBOSANQUET
690,225,016 *4743B7B819788769272F2EC51420FCBB5154A727 tdielgew3
690,225,017 *47466B5F8987C4B1FB7E98758B8A8E470864EEE3 TERENCEPARMENTIER
690,225,018 *4749D323B78CF8168E6E18095E7396937989B65E terrelllatassa
690,225,019 *4749ECBD6652E26F845D5E5C2EC43F475D087837 THATBIGMAC64
690,225,020 *4742A051C527A2B3FEAB4B18E43AE36F07639F1C thatnovell2004
690,225,021 *474A89963CF8FB542F4E0FEB41D9BF5822D8752A THE-BEST-OF-TRANCE-2002-(DISC-1)
690,225,022 *4745C65D2D397744211052581250B42F2433C65A the-ultimate-sun-blues-collection
690,225,023 *474DA312153A433A47EEC8E91F7872C29F1356D8 the-water-goblin,-op.-107,-b.-195:-iii.-un-poco-piu-mosso
690,225,024 *4742E06B898282878E150D821316C925C407D074 THRASHER(A):60
690,225,025 *474A9F0CBC6533C40AA53C408679EDBF7606662E THUNE1234
690,225,026 *4743DF2CA207A017ABF7A3A1A864362686555984 TIGERSSKIING2
690,225,027 *4747D30E00C156DA853B903D5DAA5608E860C751 tightonhisunblinkingeyes.
690,225,028 *474E0DCA32750F7E470226B21705EB98F71A4F33 TIKSIRSUS
690,225,029 *47484A91357BA7EB2E907586BDCF3A6CBE3D0536 TIMEDELU8
690,225,030 *4742E32DC0A3A36EE220EBBDDF1658B8A93A02DC TITLEYP16
690,225,031 *47407EDD07A9A0CE5CAAFAB6E11CA69A7E67E903 TKUFQVT
690,225,032 *47499BE48ED8A235FCF40612EA05CCBCABEDB69F tommygentille
690,225,033 *474120267CE4F4368B22EA1FA38CEB7564759EA3 TOPELIŠKĖS
690,225,034 *4743A0804E4E2223C2F55DFCF5AC37776142C813 traceykilgour
690,225,035 *47402F3E3C053DF77C4FC129C85771619FC2C36C TRACTORMIKAEL0
690,225,036 *47490D96D2AB04BEC2231F27CB7E17C2EA377D9E trevorjondysart
690,225,037 *47418F017BBC77497E93C17F9A127E2D43784626 TRIDOMIN7
690,225,038 *4741474D10A8ED46043122F81C0AC76BC74CB7F1 trixieabenson
690,225,039 *47481194CB83D7D7067125A0DD58F194CB2001E4 TVJLP
690,225,040 *474213342FE4EEB2447EFDF3C50C4429BA2696D4 two‐barred
690,225,041 *474C1553251286ED642C5C4B84AEE1CCAC36CAA8 TYOEVOITON8
690,225,042 *474EFEF25480C1C9657C3C3B469E7601941678B1 tyrell-larsen
690,225,043 *4747D2D6C75182CD7924DFC4515BD21A95BC2DE9 TYSON.WOLDRIDGE
690,225,044 *4746189D9CA18BA240B03FEC0929D83AEE6D63BE TZPH
690,225,045 *474428085BE06AD8BC4027E5A18CA0F3F6AEB6A2 UCILACNI
690,225,046 *474568B9F9F34404B1A73076C45A4D6A701DBA26 UF<_
690,225,047 *4743CD3E175F242BCCDE1F243160194EF207B75F UFAT0275
690,225,048 *47403A66D5AA537A1A3862DD5FA778AA4E02B1F8 [email protected]
690,225,049 *4746FA03DEF6DDF1A6C4710CC8E60C1BBD19DDCE umanamente-uomo
690,225,050 *47420286976C61E959558D68189E3F37E11C488F UNGEMINATED8
690,225,051 *47469EFAFEC2E2CD01F03536E32D9B38513CC61E UQIHZIZ5
690,225,052 *474EE54318DA01396F392973BE6DAAB5B1450241 UTITCHAN
690,225,053 *4740ECF035BAC25126B4399130BF555FC71A61A6 [email protected]
690,225,054 *4749BFB0375D09B003226AAC9567E4C5B55382F9 V1AX
690,225,055 *4749FBBD96625774E83D5E6C241D3677B6DDB299 [email protected]
690,225,056 *47471AC461C6267138A1AF96893D37F69AEA2326 VAMPIREDEAD7
690,225,057 *474EFD558382866C4C0037908C33E96CBBAAB707 VANESSA YPON
690,225,058 *474F9AFE4975024554400FDD308CA7C415E0E0A6 VENE5EC+ION
690,225,059 *474A1D01A5AA137C7AE78AE997DDDC8F090F5B74 VERHABBEZAKS0
690,225,060 *474F176A632344F47D0F6CD0BCD2EE04C6CEF61F veronicamccarrison
690,225,061 *4746B53F1C4D36BE35D7E5008D7BF64E5B82A504 victoria.pomante
690,225,062 *47410728AFB0963A50BAD9A6C17C345E32317E04 vilma-buller
690,225,063 *474710B9D7BBB4DAC0777872F5CC60DE46D59B93 VIPER.BANDA.MUSICAL
690,225,064 *474A5191BA37A9509FA6002349E86623C44C1BC6 VISTAN
690,225,065 *474990AC2CF47AA045AE318904483C18ADA29B9F VONMARTIN
690,225,066 *474F23583CA10788FD67ECA03172A50C95F7D44B vyazgin
690,225,067 *47428A68808080A184DB5A2684782562E5147542 WANZELLING
690,225,068 *47454D62902F1647DF94B4AE78DCB7DD3E587E64 WARJELUKSELLA
690,225,069 *47440B89223F9C1E45191E1CA5BA1D48BF68B34D WasItAsGoodForYou
690,225,070 *474FF53E599E254252E5D7BC7B8B46948D431FFE w-cover-dividers
690,225,071 *474AEBB5A4D5755B2F614EBDC7B44A091AC7A184 WENDYMOSLEYAGUE
690,225,072 *4740C441E46FED6BF59E4A95CD6B5BBF417CB2B3 [email protected]
690,225,073 *474679EEC169A004CCD705DCA79E2FE09496E6D8 [email protected]
690,225,074 *474C8588C85E0636F7323A93BB51833E90730DAE wicked.love.(radio.edit)
690,225,075 *474C0C82552196CE91C5A0421851ACA717891318 WILFORD.NORMENT
690,225,076 *474968BDE1D18D70D0E8C26525845246BA8AA50B willardtomasic
690,225,077 *47427C16642109987F2AB9816A4A8D75F46E8288 WILLIAMMBORCHARD
690,225,078 *4748D5462F610600031EDCC5B61FE5C2718D802F WILLIAN.ITANI
690,225,079 *474AA96DC834A7C90B955A208FDF3231E962C777 WILLYWISETWONGSA
690,225,080 *474EFDCD58961CAE082CA112E5D635FF58C5D799 WILWIELER
690,225,081 *474B3AA2D7DF2A4C774BA1FD9B9626A6E06F10B0 wmsaddat
690,225,082 *4743CFE8B41CA15676EE1F02E7A5B8E61C530B0D [email protected]
690,225,083 *47401D83FC0455AB174C1536B7E63B2F5A385B65 WWW.SPECTRUM.NEU.EDU
690,225,084 *474F2AB6E36CD71039190B380BB36558A2BCABDF )x(~`.<==b
690,225,085 *4742F0EFC953981CD45C2DACC72F0FB8A2B83143 [email protected]
690,225,086 *4747091B4F4ECE131F96D0229F53AFD68953D5F9 [email protected]
690,225,087 *474B2588B635B32526301410DE2E845E71C36FDB [email protected]
690,225,088 *474CABAC1CC77937F7C7D9C42F2266FD84251B80 )x(.o~o~.(===b
690,225,089 *4748F3C307BF5B354641D5DA7CBF922AC6EEF4EA (x)o~O~(#####p
690,225,090 *474233848594F88D1D8A6FB7B1EB20BE24F8C8F4 XP~3
690,225,091 *474BAB98DE3AC9691BA38B6CFF877AFDDC87198C XSTMTBSW5
690,225,092 *4746C9E684B31BA603E27DAA7A6C78B482F839F1 [email protected]
690,225,093 *474099B2694EE5144AD609F9C743BD51F7148D43 Y5MJ
690,225,094 *474E8CF6215E1BCA62C6F97EDE4C106BC9FB43E8 YAJU.KAO
690,225,095 *4748EA5CCCF9E227A70BB08FE71BF32F5D081170 [email protected]
690,225,096 *474D8AEED7ABA276D959504608ED1121F5341050 [email protected]
690,225,097 *474112CF03FC395153366B455EEFFF234A9D2747 YA.RABBI
690,225,098 *474D1E0A003CB3CF35EC00560C63D724E52F0BEA YATAKI-TUMBI
690,225,099 *4740EBD1E3FC1739FE741B94F3831673D6738831 YDEVIANTY
690,225,100 *47468042EB40BCD5202269A22F6C6F4B33835F9D [email protected]
690,225,101 *47485A442AFFE3668739CD80873349EE38B6902C [email protected]
690,225,102 *47476360C77585BCD5F8840D720534CE8538737F YOLANDA.LEVY
690,225,103 *4742E4FEF7AD188BB68BC7A97CF5333C71755A1A YORLENYRAMIREZ
690,225,104 *4748728CF97ADFC99C823C29092A83B842795447 YOUNGSAYLORS
690,225,105 *47437FA72C2ADA707DE7C5DDE98851CF1853C1B4 you're looking at a guy who believes he can beat a rigged game.
690,225,106 *474E8B890BE4D5FFC4A11DD8E37E9D63753299D0 YURYOS
690,225,107 *474C91491EEDD87B0C619411CBB7800BC08F911A YUSUF-PRIBADI
690,225,108 *474464B1B15880D2908A02D63EAEACC2BF25ECB5 ZACHARIAHCUMBERLANDER
690,225,109 *474B6A154010FA1193B49660F1F215AB07DD64D7 ZACKARYBOTHWELL
690,225,110 *4740BD781F764EE843748E22EC3D07B54A4ED80E ZCBDDMIYGHLASES
690,225,111 *474135E0CEE64DBBB4F876A6C3579E7C16107746 [email protected]
690,225,112 *474D0CDEE7DE5820CDB1A6513BE548978C08CFC1 ZENITHREZNOR
690,225,113 *474F0E79B48B900400561B2291F24182C2B19977 [email protected]
690,225,114 *474E1899DC158E1CC9D8432D06D57F28E3BA57F6 ZILLYBOOT
690,225,115 *4749A6DA2249A0AC1801153114075960B78D38C7 zoltan.czetner
690,225,116 *47464BDB50A05D7CEC0D1DC16D5546D2E11301DB zx9rtyu
690,225,117 *474596A62DAD0A50AA530308F3C5A542D0461C55 эвилдсена
690,225,118 *4742405C95AAFFECB95C39586F902DA5DD0B4582 03ml3x5jtf95ho3779
690,225,119 *474471E3409E0DB29D6B2D488DC9607C21635A5B 074564242X
690,225,120 *4744BF6736A347D8160B88998B3090BBD3C73199 0YM56ALBEW3
690,225,121 *47440500E6E21B41301C912759BB4575CEAA9CCD 113SPRINGREITER
690,225,122 *4743537A07F9088A19A22A841B648087B6188328 1177B838-839E-351F-8F09-C3BBAA7432DE
690,225,123 *47430C40FD7589988D2FF9E55D8448E96186D95D 120567 VELILER-ILE-ILETISIM-KURAR-
690,225,124 *4741C085400E39C5C1C79141FD817DFD4A0A4F78 1373813 kehr
690,225,125 *474E865D113603AEFDCAAF653A2F2FFCECF9BF9D 14NIEDERESCHBACHS
690,225,126 *474D76502A3EB8850D79C00F53B8928CA3D7709D 1684394 "THISCANNOTBEALLOWEDTOHAPPEN
690,225,127 *474CD46B89FBFED2C83AEF5EBFB9DE7A7A78E622 1843791 SIMONANDGEPHARDTWEREFIGHTINGFORSECOND
690,225,128 *474FD395B04A5E7A33D26B770D4AC913B2F954C0 1875547 ydinvoimaa-sitoutunut-sd-ryhm
690,225,129 *4743053DEB4AA5B86CA89C550594F0A0F5EE4C62 19891126: It's All Going Wrong: Bloom, Mezzago, Italy
690,225,130 *474830C30A4F4DB463DADF55671F0261678274B6 1.ABZULAESTERN
690,225,131 *47477128ACDE5DBE3632078AC01E4452820CD6A7 1aristrokraattisten
690,225,132 *474EDEBD2EEF4DBA1458F15731B4B7A3212E6F83 1BAUHAUSARCHITEKTEN
690,225,133 *47467E8E6AB68BB3CA2F5B32DFC0E157FAAF4BD4 1.COMENTATOR
690,225,134 *47487C4AB61C449FF62B8C62FAF767AC913B802B 1ELECTRONICEAVESDROPPING
690,225,135 *4741EED2ACFF18B80A4B1196BEC6240E9D8774A7 1HERZTHERAPIE
690,225,136 *47418FE6DFBF0C5E741CFD141AF114610F2ACA8B 1 KAHVAUKSEEN
690,225,137 *4741354FC86BA5FF9D593EA42B05372332DD6C5E 1KM短縮。一ノ鳥居駅を一の鳥居駅に改称。
690,225,138 *474D25911EDF6B4DBE52B6F1CE3A91349C57D600 1.kunnanosakohtaisesti
690,225,139 *474F1FDAA5171D167E0A77559480D69ACBA71B80 1-MILDTAETER
690,225,140 *4741CA4EF12CAF334124AB3F3F545883A9679F3F 1OSAKEYHTI
690,225,141 *47441040CDC920F732097028F5E1E4B57E129F92 1.PROCHEM
690,225,142 *4745F641435BAFA2AF884813A96636A73B96ED04 1ressentirais
690,225,143 *474EF84E4EBFB19AEB77187E149D3C6CED6DE022 1rockhornkanavan
690,225,144 *47497A1BC6BB0D39874019418CA22D7B538D0513 1 SEDHASSER
690,225,145 *474B479055C4531571970ED1C369F2A1D78C2E1A 1.SORVAREITA
690,225,146 *474B243448F89C990871F3FE6BE939FCB60CC980 1sukrojen
690,225,147 *474DD250ACE791A92D81D89905E76AA2A9AE61FE 1.SUOMALAISSERTIFIKAATIN
690,225,148 *474153CBBDFC61EA80C2A063B60B58FDFF306745 1.SUOMALAISYRITYKSEEN
690,225,149 *4745AAB6F92F9FC0F29B524A3EED1683E636A0FA 1.tandoori-uuni
690,225,150 *474082C62D946F50E76F8D43CA96E506741AA41F 1.TEREMIST
690,225,151 *4745E77C73E0A1CCAEA35CB1E5C9967EF7EE0831 1TIVAD
690,225,152 *4746BE6995137DE4EB8D874E6D0A7C425C6D82DF 1UNDSLAP
690,225,153 *4743678F5D3AAB4156A74B9D3B0B67EDA3854087 1VOORUITGESNELDEN
690,225,154 *474AE46E62C0214872D71C697819210C907F7374 236873 BOYLECE.IKI.REK'AT.NAMAZ.TAMAMLANMIS.OLUR..
690,225,155 *474DB74A12F67BB9F37CBD79CE614B9836DAD229 237634 8-.-baSvuran-tUrk-vatandaSIdIr-ve-1930-doGumludur-.
690,225,156 *474465F190511D0C23EAC3B6D9A6EB0FAB62B97A 2867545 se-on-palvellut-miljoonia-k
690,225,157 *47483CABFD308F25F64C0ACDE4C787F74D584FCE 2895303 PERHEKESKEISESS
690,225,158 *4743545ADD5C75C14C9BB0DD52DEB0E2F45C30C9 2.-ACT---NO.15.-VARIATION-GISELLE
690,225,159 *474D7DCB55948971B221FE169C16274770E725B3 2BDOSIERS
690,225,160 *474D5DD9AA0B79389FD5247CB40990FDC148203C 2-CURVE-HUGGING
690,225,161 *47443A29597AD69522B427F491FB0924C1D7DDD8 2FNIZY
690,225,162 *47411468C225C7DDA9C8A18DAEAABFF22254A105 2FORD-FABRIK
690,225,163 *47435431146FC1BEC382E3BFE36F61CD556B500C 2FSHOT2004
690,225,164 *474B07AFD164263D4C8581C304F42E1CD8097808 2-glikolik
690,225,165 *47442F0B1A72A32B1735D62010B4AD4D9BA67BC0 2INGEWURM
690,225,166 *47478FA405BB5A0BDA542B1D637F2E69314C69B0 2ISABELM
690,225,167 *4741F68C1D77DC65B7E83AE2DD77B12812E3504D 2JAPERSOONALLISEN
690,225,168 *4747622BF4FD7945D37B431024B3CB3FAB5A9766 2 KLEFFNER
690,225,169 *47487CF18AD14060B417DE9232E38C37CE185F0D 2REMULNA
690,225,170 *474609547B7EFD3BAE8371DD4E7000214DA3574B 2YMLKXTB
690,225,171 *474683D12A04DFE15124243A492C87F476386B8A 3=====>~~~(0-0)
690,225,172 *474BA8DA0EB502FF436CA4850B4F4B1DDA8EAFE6 32516 IN-DER-PARTEI-IST-DIES-STARK-UMSTRITTEN-
690,225,173 *47448353081F1A879FC43AA805B753226B69D264 381074 nestekaasu-on-paljon-k
690,225,174 *47402AFA9AA6018A708B42A8D2DC83FB61C55D9F 3====b* (><)
690,225,175 *474B9743F2682E0DDA7D895C1F11FF2AC2E1E392 3BBRHFRBG
690,225,176 *474F11F98CBA8E7843FDA5A40BA9FB82EF92E0D5 3DNAGIVEL
690,225,177 *4749775274B3974CE588AA77ACF424E4AE795BC0 3GNINKCRT
690,225,178 *474656AE39C5056C524AD6F3B1BBB6F7DBB78772 3REHAREM
690,225,179 *474E1CDACE79B56F0352E59E8B81599D3910DB94 [email protected]`~ `~SPLAT!
690,225,180 *474955C59E06786A3929301AC7F57479B892C6C5 40 KV
690,225,181 *474F1D33E9F3D1ACAE5E60C2FCF9B48F6F1237BA +4bul4+0n$
690,225,182 *47469B1DC7BAEC72D398F4A3CA811E3A2B62EA14 4CONDOMD
690,225,183 *474A9040B3F09E799501186C9122BA3604F95875 4MEXICOH
690,225,184 *474F4B46B36A400C09653B8A19ED83CA90B8E26C 4MIKEALLA
690,225,185 *474F62087441BF4388723C7109B1E4282B0888DC 4NONPYRIT
690,225,186 *474E4A59D6B670C40EE2796DB5C6C0D7A2269532 4suomenk
690,225,187 *474BAC95016B86A022775E9C40D78D9FF4AF5D36 500helena
690,225,188 *4741A5C76BC326394AB8C12963A80A8ED751A1A8 5ASSAIFOS
690,225,189 *47472C09075801AE93E5611F72277FA271EDE332 5BRIGHTGENERAL
690,225,190 *474AAC42C01FCF4FF444F23DBAA39346EC4F3EDC 5FOSSILIST
690,225,191 *4744EBBAE1112BF6A96CF9C694910097ED4AE92E 5GERMANCANNON
690,225,192 *47448C64996629861D9B26DD9D2051DA2E27A2AF 5INDIANAINFORMIX
690,225,193 *47409A1BAAF3EAD0E8348B95206AA27DA3D114DA 5.izlenmemiStir
690,225,194 *474F09E2A79F5EC68B5E26D590FFB00EB4D7F752 5;-LEWINSKY-7/31/98-INT-AT-14;-LEWINSKY-8/13/98-INT-AT-5
690,225,195 *47456226DDCA9D1E9793BC0C8C6D7641EE500FE0 5NUKESKEH
690,225,196 *474A2A0BAAD68406FB8196A73DA16129D5080767 5+OORY
690,225,197 *47448096D44C85F03B21F9455A13FEF3E367E1D7 5POMMEYAMAHA
690,225,198 *4745D308DE275F64C9DC17AFB26A9E8CDA325ED5 5testmodus
690,225,199 *474D3AB8C188618FF30C90BED555B812AC324A44 6EGOALTERUMBETTER
690,225,200 *474603C6238EA5AAF6A2FD7991835099501140FB 6FLORICOLO
690,225,201 *47417A15E2F09E01F439A6EBFF8D85A15D90B65C 6IDPWVVY
690,225,202 *4742B5618F36FF7E6CEDCEB5E0B1726B1ACBCB74 6IKKAILUA
690,225,203 *474C300E7552172B1B51BC4F66A264ABB0E32793 6ILUVBETSY2
690,225,204 *474033C323E356F565C8A2629AFB8633EC924FBA 6NAOMIMIMI
690,225,205 *474658FA7AB5869645CC345F2E09476DDD002B85 6PUNTSGEWYS
690,225,206 *4741DD3A5330BCFBBAFE4E1473DD86E2B70D2960 6ROCKETTIFFANY
690,225,207 *474943DEE15B8D75596216F8340A41756554082D 6SIADNAMMOCER
690,225,208 *4741E21F3EAD267614B7EFDB5FA6080A5A6A6732 6THATCHANGEME5
690,225,209 *474DC27EE5166CD8835B5497F484757A03195BC2 757VIRGINIA
690,225,210 *474635751775B3D8E8076739B53B44980B18B3F9 77-fortune
690,225,211 *4741679E64FB0EB73403D3F1487F42BC917D317C 780428 harjoitus-jaruokintaohjelmastavastaaet.meik
690,225,212 *474C7BADCCD0491C77BBF08C57C7F46D32FF2397 7AGIOTEER
690,225,213 *47460F15C90FEBD4970347EDF3BA85259394BB37 7BSWPONEDJELJAKBSW
690,225,214 *474CC7CF6296B7FB8E9CFAFD604879AFD17E6187 7CHELSEAPATRICIA
690,225,215 *474356D8ECCBE67A0429269B24573A8A92BF3DD8 7ENIMEPER
690,225,216 *474E1D50082EFAC5916F08D2C9D4D550A1E2C83A 7MIELIBYSMY
690,225,217 *4743ABD070646DAAE3E84BA8348AB5E3CC377AFE 7NSPRTVLY
690,225,218 *4746CFFBE464C9072A62DA57301312F73B68482C 7RUGBYUNDEAD
690,225,219 *4745BD8965E799FAAA929B7B0BD50B7AD7804A9A 7versliepen
690,225,220 *474CC5DA765ED8CB19DDDC75DB42D183149605DD 894051 ETTEINOSTETTAISIESIINYKSITT
690,225,221 *4741D4B5BC541D4B0E5AE077EF1DBEBCF5D5D047 8daksparren
690,225,222 *474755E5C2B3641C310F3EE6712A0105261ECA31 8JUMIVRLA
690,225,223 *474A79B76CB49FC908214A3E7FFA4FD656961042 8.KOULMASIS
690,225,224 *474C4EFF3CF00FC1C432CE3C92595AC697080AF8 8LADDIECREATIVE
690,225,225 *474C133C9D5493EEC14E6885E6CC2807C4CBCAF5 8LADYOFTHEN
690,225,226 *47494A66BF1AB4D3D81B9E9CBE494FEC2D9810EB 8LEGENDGARNET
690,225,227 *47403729290459D7D283003BE3E54027B4C02829 8OKOEGAKA
690,225,228 *47460BB9BB191D3EB0703B53FA69C38F7FD867CF 8PRZEMYPRZEMY
690,225,229 *47460217509F1E2648D784854BE3B7DD5CE52455 8SHETRAK
690,225,230 *474EEC57BE7A9890D17D0A63369E6B96F26F0B0E [email protected]*SPLOIT
690,225,231 *474211244B122C72F720862F3CF9D6F27A191DA5 8STATIONOUTER
690,225,232 *474C0F7DEFE51D0A8375A670F5EF10376F4D7E51 8VILAGBANKBSW
690,225,233 *4743D8E047C19661487AFE5C655B86BD851236AC [email protected]$
690,225,234 *4741D5D64376B5F3DC0FEDF26F06519515016114 933030 PETROLANE-PARTNERS-IS-A-MASTER-LIMITED-PARTNERSHIP-
690,225,235 *4741732FEAC4C67A8498A7D8D5AEE486B709D5FB 954642 UUDETTILATOVATKAIKKIAAN2547M2
690,225,236 *474DE343C6A6E3423FC27978394FDE213A26BC53 9ASSUTUT
690,225,237 *47449D52910130A775A626465A448A8C2672B071 9ITALIASYLVIE
690,225,238 *47473BCA788B4A53D64CFABF76E81724D5D0A736 9QUEENRIG
690,225,239 *474C7C17DCAAE716302728C9885C481CE0B82184 [email protected]
690,225,240 *474B2F99F681D8C91D21E030E167D5B7A27ADBC5 A27MD
690,225,241 *474B6CB641C7B26EE655EF079E8AD3DF83DD30D0 a_:4
690,225,242 *4748FE86EAD0D3FF960948516CD2200BC717091B A)8EL
690,225,243 *474A1190EA600D256E4E34054363F3188C4BAC2B aacfe]
690,225,244 *474231B62962BE0F9B464ED598CEB87F72EB1609 AAED1(
690,225,245 *474530C334B337EF19313F96B573E8301D287271 AARON PHILLIPS
690,225,246 *474DD425A4899A142CE198E9D6E15C9E33497475 AB3EO
690,225,247 *474E9445F1F8DD1D3648CF7EECABAAFA7FEB610F abl#q
690,225,248 *4745696ED506D56A57328BC8240823213E081764 ADAUC
690,225,249 *47408DCA03746FD45E1A23487B2063CE3B7799F5 AE;,K
690,225,250 *4741A7D56AD5C1ED0A4989C169D522EA76B4FA65 AFGEREZEN1
690,225,251 *474AC1B5EC734DEF80DB8854497E2509ECCFF6B7 A_I:8
690,225,252 *47478C8EC970170B342D44A9E1DA53C2A89F288F alaskahing
690,225,253 *47480EF107F4D6F2E83CBCE29B422A443A1BD43A alexsuk
690,225,254 *4748BC789CD479B48F85372B65C5D40C42ED8C5F ALG?U
690,225,255 *4748913325F66F5944EB8E7FD2DF229AD86A3C9D ALIJAH161
690,225,256 *474AAAA68C608CB46010488220E9DA4045BCCAA0 ALISEDA4
690,225,257 *47475C7AB1F084AF409523EF9CF62E07C90735CC ALLANBOIVIN
690,225,258 *4745A0DE8643B9114D583FD15D53B32DCB649CE1 ALLENHEWELL
690,225,259 *47482194805F66CF596C2F7FAEF0A66E73A4AA6B ALNAKBAH
690,225,260 *47471191816610216C51168BAC0A4B388EE107A5 ALPHONSE.ARRIAZOLA
690,225,261 *4748205CE134274B42D79D6AE1A0190A16FDA912 a/lpj
690,225,262 *474C160D02EDB6E8DDD14A73A28F1BF0DF054275 A)L-S
690,225,263 *474F1A1801B09D1219AB4A812B1519B323F14EA6 AMIANGBING
690,225,264 *474504A2A498B7E94D6167F5FC6D112847CF6EF3 AMO;8
690,225,265 *474E8223ABD2317E156457B69F148E4749098517 ANEL ESPINOSA
690,225,266 *4749B8FD374B8714975D5A972AC1C758545DD321 ANGEL.WHITEFIELD
690,225,267 *474BC27E0498EEB52475BC77D7C8A7AD27AF02E1 angesteckt3
690,225,268 *474AFCC40531562BFF9D0A3C73127AC231E45C4C anticost3
690,225,269 *4744C05083E24A8F35B92A47AE5B0492AF6394BA ANTONYONDRUSEK
690,225,270 *4741093D046C2CC396D65CF4FF19B2CE16071CDD A{~O
690,225,271 *474155CB82DBF4578F785803E32C6C87AA811854 are-destroyed,-you're-home-free)
690,225,272 *4748EE2B8859C6904B1D0096B86FBB56ED292346 ARIELBASEBALL
690,225,273 *474DA0D75FECE8B2613C9B5FEC0B5642BD847DCE ARTDEEDRICK
690,225,274 *47409B52C0DE9FC151D69A9D49EADD9B468A9EB7 Arto./.Rowley.Part
690,225,275 *4746425EEC959E82F3E5D789AF11BA78B53F430C as1t5
690,225,276 *4747397A56FB896C574F4D0435FDE05C4D4B2857 asaefilgnikroweritneruoydnepsuoyfI
690,225,277 *4744227882E50B5CF7B41587696E491923B923B5 ASG1X
690,225,278 *4749C8AB172E06782C796AE0C34E65EBD70FA501 [email protected]
690,225,279 *474C14EAA1AAAEDD0C9EC131CBFAC4B9827493AD asssandy
690,225,280 *474752623A0A7F0642C1473231630E7A17B83B7A atlasofmormonismisintriguinginformative
690,225,281 *4742797494308B7476CC51CEF5FA99981175199A AUGUSTUS.MICLETTE
690,225,282 *47460E9D9AE2FA7F2B5F850C12C4BF756EE3257F AUGUSTUSTABON
690,225,283 *4740780397ACD325BABA1EBA65AE948DBE804B00 AUQB+
690,225,284 *474BE4F1481E3A6821257BB32E82AA39C14526CD austinmcdermond
690,225,285 *474443F2A6B79E843A1A4198E7A6621D069BF9B3 av:3)
690,225,286 *4742C3A5A5D2455A2B9E4180100151F5FDA61F34 A+v3
690,225,287 *474D4059D1EBFAB29726981F6C18D5E7053E5CE6 ăстăнлă
690,225,288 *474D2DD5DF9552C53F3A0560554ADD1DB39051D4 b503;
690,225,289 *4749B6460AB8B90EA647FE74214BCBA994C149F6 B$9FM
690,225,290 *474D5F6B2D88B1DD5B702541BABDD87ACC159E08 beckygreathouse
690,225,291 *474E5CA6263EA002D175E4A0181D673A1CB35AF9 benglackin
690,225,292 *474C9A10498465D6DB18FD2ABAFAB1E673E87945 BENITO.RASP
690,225,293 *4749D075D9C4BE9A82A3EFAEFCB4CB3EC80ECB2B benjamindemelis
690,225,294 *474FDDB7D69F27554B3E9882244FD5CE47A1CF35 BENTON.KASSNER
690,225,295 *474F135CB9B567EEF625521585BC0D5EEB1B2942 berryman9
690,225,296 *474642CBED005811C9A311D342510C3B26B3037E BF"AG
690,225,297 *4744B1D1AC385BE432C9D425C23AA33BDEE9E038 BILLYRAJA
690,225,298 *47442A7DBF256D96E633F2B1603DF7FE64E9294B BIMANUAL
690,225,299 *4740EF5F0808ACE0000E46825ED4C07CCE3DF029 BKBNR
690,225,300 *474A71E1A66AB4837F4D649BF41B9EFBFE8DA055 bm?uh
690,225,301 *4743DDB4254DC816CA3ABA7C13DE74E7C385520F B#NUR
690,225,302 *474E027AC01CA6792EF2E223A631D209C657E003 bonqz
690,225,303 *474A838458DC8F21C1502163BF67E1810A44AD52 BRANT.PORTWOOD
690,225,304 *474E38E06C566FCC436C79F776782B8E61E64E01 BRAUGERSTENSORTEN
690,225,305 *474BE34057A007E338F553E4E257BACEC62C5D55 bregime-de-neutrefr
690,225,306 *474674CCDEC1AF349E795E081029ED51FFF08035 brendonniebyl
690,225,307 *47474B009F60B116A93D26812503488111CB4C0A BRUNOBISTODEAU
690,225,308 *47416BC3FA81A7FEABEDC018A366E5B558AE6E65 bs&bm
690,225,309 *47458B94D23CBCB34DE2EE55DBE22C505EA1D460 b=)~.~.~.splat
690,225,310 *4745989A198FDBBC8BEC9D3682AF0748F9A751EB BSWFLURBHEADBSW
690,225,311 *47473AF367BA39AAFDB049F111D3FE536B15BC38 [email protected]
690,225,312 *4746020BF937F363FDA1037B4685D409C7C548F4 b+tb
690,225,313 *474C2439B746085EA245E9F20932A9EA402C4F77 B!TER
690,225,314 *4740679CA6B70F33CDDC58D0B29E306FD810CFF3 BUD.NOVAKOVICH
690,225,315 *474EBD5438B6A5BF34C5DE77ED4F5D9B8B977EFB bu/ja
690,225,316 *474B2FCB69C74DBCFF4714F2A2D995079436315B BUTTERFLYING?
690,225,317 *474EEE2A648BF095E6E787460BAA9534B9D2AC7D C17ORF81
690,225,318 *474B1482781CD2A8D026DFDFE008FB073B366C96 C1qZ
690,225,319 *474CBE3C94795EA1615A94DC3DF145F74BC4B5D1 c9kec
690,225,320 *474DED4D112DBA2191E2E3F024E8F1655835C5B0 ca65n
690,225,321 *4741B5A0879BE74C023F38D535F359BC739352D0 CA#9T
690,225,322 *4745168139DFBF34D319CDA523C109DA5E1DD73C CAMPOHTTPWWWMUSEOFE
690,225,323 *474D3A7107EAE44AABB1E6274B67CD421B6AA82B CANCEDT9
690,225,324 *4746CFDBEBA7312280D17DDD1E5F6D516AEF0BD6 cannonry
690,225,325 *474C62911EF938A309EF7FC43D68B79F0ABE086F CAPONERIE
690,225,326 *474A68D96E56ABC7DC4D75C711BF3CAF7EFA98CB CAROL.DIROLLO
690,225,327 *474522635AAE01D2287DB8D78F9E76F20C6AD393 CARTER.PAVLOV
690,225,328 *47439CB01CFB7FC63A392FAE46FE195DB3C107AD [email protected]
690,225,329 *4743146630BAD9DBC2BCDCD2142A3373B8A1A944 cb2zv
690,225,330 *47427079B0A75FD722184B785EA2329CB62F1548 [email protected]
690,225,331 *47427366539F31A674F8640F8D71A0666889C61C C=DSH
690,225,332 *474F7515FEEBAC77859E76571B5AE772C67946C9 ce=ba
690,225,333 *47475611764B0C0659682C3FA8E03B338EF3C235 celtic.aura:.irish.traditional.music.special
690,225,334 *47470DCD9981255A10EE0890EF7B2ADD5C2181BC CEPHIDAE
690,225,335 *4748FC6A7B03F86EDF9042575CBA4B567952B5CE CHRISTOPHER FORS
690,225,336 *474CE065F4B7C69CBEB46D2614B19C9434188DE4 CHRISTOPHER-FULGHAM
690,225,337 *474427163F2E7ABEFA30EB27CF9F5A724C03E27A ci6ho
690,225,338 *47457250814D01AB268D530AA07B59DDEE6DF3C0 CITYLORO2
690,225,339 *47478AAF4EE454F246A4D943395FF2E2CA5AA9C8 cj31161
690,225,340 *47457B73EE19D9D6E20B28AD47EB18EC463B2D49 CK46P
690,225,341 *474EABE999CDC0583095B9F6A6272B4C035EDC51 CLAUDIORANER
690,225,342 *4747948586BE3288B3EB65D3C57162247F8B484B CL/EP
690,225,343 *474241D5BE731F92092F6D78287EBC57E57ED13D C=LKE
690,225,344 *474DA9AA01D6F76000EC8E9EEA5D7E88E2A8B688 CLYDE.CIANCI
690,225,345 *4743BFD456038F91A2C66B1FC8A456F0907B1BD7 cnas9
690,225,346 *474651160E66BA6E421DAAB4C6946D35D50FE2F6 CN+#F
690,225,347 *474F6626DF0D49759126FFEBC0B9004B4CA2C921 CO5l
690,225,348 *474EBE4D0926D171310CE40D9CED0FDF78898789 COMISION DE DERECHOS HUMANOS DE LAS NACIONES UNIDAS
690,225,349 *47493AE75D6D8AB61348BF0ECA15FC93D6C6FA24 companioncrop
690,225,350 *4743707856B8F5F3563AF68FC180717EED2862F8 CONVENIENTLIES
690,225,351 *474F9A4945FD903EE150F0CD82330AC79165AB1B C+OSB
690,225,352 *4742EDE31B5EAACBA08CD376705C66E4C830FBA5 C/P-
690,225,353 *474CAF08213BC4D484E5FEC865AC79C130D7BC63 cp)vl
690,225,354 *47400EE4601DF273176826FEBA76C07638E9D216 crinotarsides
690,225,355 *47413D98AFC5EBDC1C2C3DD3D7856B2D6AEA1E18 cssjq
690,225,356 *474E99C7ED22F423C2FADF089E8220BAD4C4E979 cuyp6
690,225,357 *474D3D201CB27A575BC73BE141414EFF182165B8 [email protected]
690,225,358 *474804A4C558F30ECB1B9C9D6CF48D7C88FA64DD czasrozlicze
690,225,359 *474477BAB9F8FC8027EBAAD32C30B1249D75FB95 d!;&=
690,225,360 *4744BD0BEB944100E252A893BA2FBB133B033A6E d3jw6
690,225,361 *474476419EA6FC35CDE69022AA6BBDE8DCBEB965 d3m0n!53
690,225,362 *474F55B2CDC6B20218B0BBAF9E6A4789FA46D1D2 d7ch"
690,225,363 *474252FD664BDC0EDE2244730137A731791FAF61 D7L%,
690,225,364 *4746A4E28E2F0D5E9691875B343CD57A0D5F55C1 dadpg
690,225,365 *4749144D21934C681B4CD1ABC72300CBB862E7B2 [email protected]
690,225,366 *474BECC62D14397EF918046371A0DF3BEC7319EF DANABASCOMBE
690,225,367 *474CE3940E104B8D3149E4EB4B7BB436BCFB7C67 DANNY.MIERS
690,225,368 *474D88701F231806A15C9341D5F5D1E8F7B36C6A DANNY.SHOLLENBERGER
690,225,369 *474B5FF84E2DA1F861FDBA6BE1FB702AE8FD8DC1 DARIOKUROKAWA
690,225,370 *47434AC9BA9213C20167B3E7B321F0B988939899 DARNELL.PILLSBURY
690,225,371 *4748F337BF37787A6517CC961BE3943A355B845C DAVE.FALSO
690,225,372 *4740BA999CFD8D3AB6E0E42FB582BCD49DAED260 DAVID WING
690,225,373 *47444F754B2EC180EB8B9E9177B48D78C05929F6 DBQRI
690,225,374 *474E963DEF202F5BB2D7E3D087C133F32859DCD4 D&CF
690,225,375 *47491437F5588A273D46F1969DFA7007E0FA18F3 DEBBIEGROHS
690,225,376 *474C09A74E01C3ABE5D22ECF4643C8C40C388CF4 DEBIGREENFIELD
690,225,377 *474478AB6302CC6E6A4716A378689F9A94DDB177 DEBRENSKI77
690,225,378 *47407926EC3076FD4DF24308E7E3FE555D8565D9 deelkni7
690,225,379 *474723CE8A5BA20945C59C22700D67918CA39273 DEMARCUS.PIEFER
690,225,380 *4747D7B7B99C12F2A6993080D9A91C156F175090 [email protected]@tons
690,225,381 *4743D117A49A927B8E980AE7C0707DD1A17B3110 DENNISFUNG
690,225,382 *4743F445AA2F4B9DB9374C4A1E4D04F92CC29CD3 DENNIS.ROUDEBUSH
690,225,383 *4744AB630414EBD9ECEAF9DD0839B4F4A4CCF4CB deporte.
690,225,384 *474E0EAAD036C5CA9D25A64D12233BB962950B4F DESMOND.PANDYA
690,225,385 *474EA7F585A4DDBBBA2ABE7CD815F6BEE41C78B9 DEWYANGUS2
690,225,386 *47414D5D7213E38778D7650DD677628F2855A1EB DFAQA
690,225,387 *474BCD51032AE49551A8F955D11F7DEFB17BA1E7 D#H9
690,225,388 *47458DEF1E6771E4A88CD3B0F5A1388BCB45B7FF DIN-S
690,225,389 *474978E40CAB63FECD7CEC595DE2CA57645A08FD distributorshipn
690,225,390 *474110A670B8D1B9A676872A1BFF51AE511B3257 DIVG
690,225,391 *474F21864CB670255A580F8FC4D0C5C8D1049FF0 dlc#
690,225,392 *4742F97C082F1C1979A86168C230D1FF4279C131 DOGSTEPH7
690,225,393 *474C71D5422D306CF24CDFFA4C6729807FD3889D domingodehabsburgo
690,225,394 *474EABBC68D24227A517851466F4D074EFBCCA9C DOMINICLOHRKE
690,225,395 *47445B196B3ADBE0AFCCC93F8F8C92A319C4B852 DONBOOTH
690,225,396 *4749AC0944EB4EB49FC1CED753FF43541AB3A93C [email protected]
690,225,397 *47426DC89DF3390F8D9153733FF893F03FF86A76 dougteddying
690,225,398 *4743CE1794FC6D4E91E8C191D131010BD6F07941 D-PX9
690,225,399 *47474F2C5DF71B8F67B8241A9CE711779666C3EF DQXI
690,225,400 *474E7423FE42194B9A38FD712CDDFA508EA3BADE drink.
690,225,401 *4747BB57981D7F14D21690BC984C2A68A5F326B7 D(SH0
690,225,402 *4745E4373270C2768C745F50DE60672F2739D41E DUFFMANN2004
690,225,403 *474FC954D0C2B612999954F46CF8CB250CC77F9D dug
690,225,404 *474654F33AD1C13459FA35E5885E4F5C0ECE760F DUSTOJNEJSICH
690,225,405 *474E6FE8F02709506FF1E2763BE0F4CE016D002A dy+mi
690,225,406 *4748F8C57822FAFE304BA526DF246D4383705BCA DZ4r
690,225,407 *4747D3F6D3CDBBDE28F3152EE3AD6F1B531EB27C eai&j
690,225,408 *474A0A3CAB5F3064C2D8839DAC1C66A68694957F EARL_G._GRAVES_SR
690,225,409 *474B111B83A9757D4C81EF21CB93DE37D1C32071 EBABEEY
690,225,410 *474835516A8B741C5E9C83FD016C53749C4FC344 EBQS
690,225,411 *47480C795F35BAEFD84939301A1655091655C2D5 ednerean0
690,225,412 *474B0528C5726EA4DE29DE696AE2BBF9484A19B3 EEs4
690,225,413 *474FE14BC484DC504A6A6F43548F9FC69DF0C201 eihcy
690,225,414 *4746D11BE4C9F7F5BD9BF683965B6B334FCE4CDD elbertkua
690,225,415 *474AFF2216965D834CEA46CF89068DDE73DDE2EF ELI.LERI
690,225,416 *4748BEB8059BB9642CE1F4FE869458052C0A6678 ELLIOTADELMANN
690,225,417 *47491D59CCFB9E3CA3DFB29D883079DF4C35FA22 eloybodway
690,225,418 *4747CBF8256459C0ADDCF19F34E5DCB37A100385 ELSHERAEI
690,225,419 *474981BC122BEF0399DB6BFEEE1BFE15B054B8D3 EMEGLATOR
690,225,420 *474F3A5B8E567A29C5A46880175C44DF8DB93EC6 EMPRORSH
690,225,421 *4742DF17C7E60495843A377F2472C74310D30568 enababm0
690,225,422 *4745562636A106F5189A1C6F4E93CEC973BBA907 [email protected]
690,225,423 *474ED1718EEEC3359B423236FF2F536B76213288 EOIY!
690,225,424 *474ED7359BD88A6A71DCD58B2CD73A0C80F539E1 eprhu
690,225,425 *4747024FAE4632C151BC4FBF34B10F87A6E0E025 eq$m
690,225,426 *474368119B2477F047FBAAE7681280EA7EAE2516 ERINWANCA
690,225,427 *4747FED48EA1A9CB09F74704C7189F186100530D erotik-alkemy-(per-version)
690,225,428 *474FAEC012DA765DB81ABC761021D4CAC10F57D4 ESNEMEK6
690,225,429 *47410482692B3BFBB664AF4AE31659CAE098DD5E ESSAID
690,225,430 *474A8DC981C9EBA0BD7C13D49439E2B732CECAA4 eugeniotimchula
690,225,431 *474209F6F966E4CF1A230F47B770A1EEC7A11421 EZEKIELMOTTET
690,225,432 *47433A653060796666A319075D6698B510EE81D8 EZEQUIEL.CRAYFORD
690,225,433 *474A997B8C7C63282285739CBC1EA96307E2F7EC ezequielsattler
690,225,434 *474C9179CAD33E8BF0A3A83E136B7F0A484F9F2E FALLABOARD
690,225,435 *47454269EEB6DE3813F49562DF911D70CF9F4C37 faustokansas
690,225,436 *474900AA3B98D21BCE300E309C9349F92F78EEB4 fbgr
690,225,437 *4744565AE4C4413DE15FEFB2E849A03A13989AD6 FIN.DE.SEMANA.(WEEKEND)
690,225,438 *474C64EB42084FE03D156AF06B6DAC862E5398DA FIRDOUS.MIRZA
690,225,439 *474BDAA24D2D312E74112CAFCAD468CD36937F80 FLETCHERFRERE
690,225,440 *4741B97AD150C9BC1F5E7E14BB9E53617D0D6F13 FLY WITH ME 2 THE STARS
690,225,441 *474C2622ADBE5C373587BF02F7FF7CFEC5F8752D FORMALDEHYDEKILLED
690,225,442 *474D5B3AE683BEE5E04A4F522FBDAF29294E017F FOSTERVALLANCE
690,225,443 *47445C9F4E3DB6F8FE9A7F4AFEFFA675A0061B18 franklynringham
690,225,444 *474F19C243304A8DE867FD2C9141039F15D08336 [email protected]
690,225,445 *474C1D4E02418520B05207530A7F945D100D6F04 fsrjyir8
690,225,446 *4741D1EA13C847CE6E37348D4CE477459EE42B57 GAEHNEN9
690,225,447 *474D5D1DFD5018A1579330605D152FBE5E89C650 [email protected]
690,225,448 *4740E3EC7400892264E824BFF47F2AD9BA9A6AFE GASHEBEL
690,225,449 *474D2C6FF7EFE4EC786509970F6645E6BCAF6F46 GAYLORDHORNBEAK
690,225,450 *47472313CBECF182F741712459F9AB588560185E GEDAECHTNIS
690,225,451 *47451770DFB4C7797BEDA9D4AF2F1D6723386A2D GETS-WHACKED--INDY-IN-UNHAPPY-WITH-THE-SPEED-OF-HIS-CAR
690,225,452 *474768389E0F38758235A0350EBB1DF750231F87 GG:Z
690,225,453 *474981E903E3741B6242F1787D3CF30BC06D5824 ‘GIORNALE
690,225,454 *4743D873C191E7842965291E0F8D0C6C2F314DC1 GlassJar
690,225,455 *474AEF41113C288D167CD9CC1EDFBC36BE77812C go-widda-flow
690,225,456 *474C3F50941DBB8D89100D7629CD17A942E253C4 [email protected]
690,225,457 *47485FD63D20FE0B5C2227B30911F37AAB15BD21 [email protected]
690,225,458 *474107E4BA08A1D2C70866B2BAAC8C3167D4EF2A GRADYCOPPENS
690,225,459 *474205316A8AC9DC09CAC211D27B7ECBFCA0C273 GRAHAMPRATT
690,225,460 *4740F2BD1F34ABA1E1705FEB705EF6BF6F83B6E7 GRANT.CLEEK
690,225,461 *4744C2AF4EE117C204D3FB6417B7C6F29D5661BD greendaybradley
690,225,462 *47482A0C0935E70D66D5F27F81D5870C3261AFE3 guzzling77
690,225,463 *474569212A5280BA335ADA359FB32085C2F701F9 HAILIE319
690,225,464 *47436B2CF902E4D2738E36F56D5DC9C20C1CCB6B HALVA LIZARRE
690,225,465 *4743B5FAC22D0A39948EDC3CAB074EEE7455F679 HANARNASING
690,225,466 *47415C599FD838C82FCE0B3AE9A854AD6E39DC4B harleyniewieroski
690,225,467 *4742AA25C80B56288EBCBA0DE022F33BF88B73A6 HARRI-RAATIKAINEN
690,225,468 *4748EA9614DFA2255BC27ADB06C3E8497B1C0528 hassanfluegge
690,225,469 *4743C1B95E5C553285E3C1C32BE40FD7F1E53B47 HAURES
690,225,470 *4744220F882793237C8E5C85880F096DD8378F9D HERBERTWEIGMAN
690,225,471 *4749CE001BC7567D307F6D2A6A7218B03277F5FF HGIELRAD
690,225,472 *4746ECD315D3458A60DFADC669066544D3E99F31 HILTONDEFRANCESCHI
690,225,473 *4744516DFB3E8509D3BA528FD7EE54DACA03A7B3 HIPOLITOKOFA
690,225,474 *47431342316D388CCB52A22D08131F448C019394 HISTORIASTRISTES
690,225,475 *474D7BAB638A8661E06E61F0ED71AFFEBE3C235E [email protected]
690,225,476 *47478358F7E68AC5F1E92AB126C0BCC090DB912A HOUBENPOLSKA
690,225,477 *4742A993DF4D515331A1E98B3F22F6CA0A0C0257 [email protected]
690,225,478 *4747F64052B33D8E68418F36A5FBB9979AAF6992 hszp
690,225,479 *474E53E2B75D4871F37F670DDE89DF909694C1D1 HTTA
690,225,480 *4748E050EFED8EF0AE46EC26C9655B3068282194 HUANGAOCHI
690,225,481 *474608392437FF6DB7EEBE2EEF7BF0D2D03694C1 [email protected]
690,225,482 *47473FE410279B060435966567C48A28CC9DC8A0 [email protected]
690,225,483 *474365BF4136E869CB553473FC939CD42F103891 iaj{
690,225,484 *4743D989D1836D05CD268BC235A562FD91A8C74F iamtaylor20
690,225,485 *474445F1D40A76073E5633FAF29EBA33F15BB984 IKUACKL0
690,225,486 *47427F2C17D2A6CD747DC149A1CE3F37BF187D72 ILFENOTS7
690,225,487 *47471FEDFA21507B1E2C36A7F9DE55384816C2FB ILOVEREDSKINS2004
690,225,488 *4747679548D4928A42A0E6B0A8056DB85C9A1C07 IL-TESTAMENTO
690,225,489 *47405CC98B6AC4FD1CF70914116D9393EBE8425B ILUVVANILLA57
690,225,490 *474622A68132A9D57E8E0B595BD6AE9C8718AA3B (I'M).ALL.ABOUT.YOU.(REMIX)
690,225,491 *47456F2EA539A323A876017199B3CF22D3D1E210 [email protected]
690,225,492 *47459898AE2AA09AAECCA6F09818BBFD1EC1B71D INYUKWURS
690,225,493 *474B2FDCAEAB433D605A42BD74BE8108C8A40C35 ioatsob4izccnqpy56wnaq
690,225,494 *474982E7B693B177CA2DEAC8913A1CF60878DB65 IRVING.MOZIE
690,225,495 *4743BA782B9F0FB3A68EEA590D5F7C2591CC7BD6 isaacdee
690,225,496 *474C1285C33F9EF2FDD8363461BF5D51CA69C811 [email protected]
690,225,497 *474AF69FFD799F5CFF327A447B9685266F6A8D5A ITSYTEHL
690,225,498 *47459477CD616C043EF90CC40247597C9383091E IVACCALPPED
690,225,499 *47418F96B93B12E63E52696B52B5AF3C18CEE0DD JACKASSRY
690,225,500 *474D782A8B37EB040FBEF583BB745E759728214E J'AI.DORMI.SOUS.L'EAU.(CHATEAU.FLIGHT.REMIX)
690,225,501 *47459A392FA0019908E8945E671150928B6C0782 jałowicze
690,225,502 *474F95B713B6166BA2B5DB8C007F8DCF7ED2FFD6 jam(スノーボードなどのニュー・スポーツの祭典)のテーマ・ソング。
690,225,503 *474A1BDFD4D2E445408AD5E47944EE6E379FF054 JAQUOIING
690,225,504 *4749D016B9D4942D5F011F696F01E7DB46899F73 JARODANDRONIS
690,225,505 *4747421E4F15B752F86C027DA7212768DCF618AF JC.FOLSOM
690,225,506 *474AED87B79FA26FB2296BE465263E5D81351CB6 JEAN.HARROP
690,225,507 *474B5733C9DF85D8B2DFFC50C4934F4E2910EA9E JEFFREY.ANGELUCCI
690,225,508 *474A64CC5DCEA346335E48F4EB5C06F543E93922 jenifer.manalo
690,225,509 *474851F05B62884515893B33A8437B96DADB22BD JENNIFER-MICHELLE-SHORT
690,225,510 *4742E48261BD6CBD61BB511CD2566FE30F6048AB JERRELLYOULA
690,225,511 *474FCCBDF724A494521874FDE7281A8FDCB94E6B [email protected]
690,225,512 *474C2A36B23CA57F1FFC66F7FD04294C2123ABED [email protected]
690,225,513 *474C19552736FB1BAAAEFF3E1ADDE2226E882EE8 JÌNÍNG
690,225,514 *47452706C1B5DE9E5FFF8FE6F64E45CCC4326994 JOAN-SATTERLEE
690,225,515 *474FE0674610823FC721C43A5924F95DEF957DA8 JODILEEP
690,225,516 *47462916FFD0492CFC3A4636BCA2516D88840659 john.eaches
690,225,517 *47443638F69631ED9D2AA59073F9E4732EED5461 JOHNFCOMBS1234
690,225,518 *474E55B2A6F124C77A352F4508CBD0BC9B792A78 [email protected]
690,225,519 *474C760C2B21974B693ED184218B22CBBC24D6DB [email protected]
690,225,520 *4743B2F2990958F78B05527DA6758648EB501111 JORDROFED
690,225,521 *4747B4155481CD212DE644ECD3ECDC64BF03C730 JOSEFWITTMANN
690,225,522 *4740E0AB4DFE8365419E8A384EB301192E7A5DB4 josephtaps
690,225,523 *474B443201BCC4F8D0AA50C0C4094EFCF621D671 JOSHUA.TIMMERMANN
690,225,524 *47492B003D30EC46A902D480CAE13F399A88EE12 joy.hoang
690,225,525 *474DEBBEE3A5B53C11928588B0E70F170249F4C9 jump.up.natural
690,225,526 *47432F48180FC5183D7C7E2D15227114444B92E3 juniorvandiford
690,225,527 *4747D0B36D2CA0446D60BD3D9FB6E601E6ED8080 junyuening
690,225,528 *4743EDE1335769F19DA5D4E3CE298B22550281E1 jv45
690,225,529 *4746B3F8F2001AAAAE21B05959125DA57F3A9956 KAISHAMERCADO
690,225,530 *4745661157CBD6E5AC857DF8810F431717A34EBE kalees
690,225,531 *474C30494E28EDAC02946D914A41DE935388B642 KAMASINS0
690,225,532 *47454B5F12423C069DF55BA2BA40DE4F5C7EA994 KAUSALES0
690,225,533 *4741B8CBFC4857E991EA1B5671BC3903B1716590 KEEYS123
690,225,534 *474B0781CBBBDCA3FB199FEB3068DA403A22585A KEITH.HVIZDOS
690,225,535 *4749CFC8C41CC2600D633DB273B05605DFAAD8FA [email protected]
690,225,536 *474B351C774271364B82F691BF3218929F242701 kenpersad
690,225,537 *474DAE4F50E6240FCF8DD9C6299C1F3DF8BA4C62 kerland
690,225,538 *474F06B3B1DB79F4A84D83F079D9A21331446A27 KIMVARCOE
690,225,539 *474B69B18A18206EBBBCE0D6E91EA3C426833886 kirbytrenholm
690,225,540 *4743B3151F90DE5BFFFF09BB8807287316969FEF KO3TTING3R
690,225,541 *474DE8A5018F98C62EF2F597FF803246C1A06460 KOOSTÖÖORGAN
690,225,542 *4745984F9CA0BB063FB226F10A30D4786E16DFF4 KRIKŠTATĖVIAIS
690,225,543 *4746DA1C97202DEDA7A5230197B12D0E9F1A75FE KRYNICAZDROJ
690,225,544 *474EEDC2A13D3046AA67B57F5FE198AF62D0F427 KRYSSYGRIFFIN
690,225,545 *474ED0D074F0FECB88372EA679D30B467D220188 KRYSTAL28
690,225,546 *474D1AA4722F5DBC4939AB41B64045E9212B3158 [email protected]
690,225,547 *474F6928529607932818AC0A8CCB50A272CC3DAC KYLETURNER
690,225,548 *474529FE02DCFA4B5997596B78DC37B6973D796C LAMONTSIKULA
690,225,549 *474BAE5CB52E179F513A0DD6FAB8B772B1E18750 LANDONEDELSON
690,225,550 *474F259692B554C1145BCB4F7DC1E79B0AFBCD88 LAURARUPELL
690,225,551 *47478FC2989E0455E8617D077EC4F1F2691CA32E LAVERNE.MARCELL
690,225,552 *47484D9091533BC2AFE675B7B9C203D48B1EA058 la.voz.de.amalfi.sociedad.la.voz.de.amalfi.|.colombia
690,225,553 *474EA918461D070D415BF6A5F0ACDA3654C755C5 LEIGH.GIELSTRA
690,225,554 *47486C61B46A4FB2000F1101687731571A099FBD LENNY.GRIGGERS
690,225,555 *474FF2A33025607F1933B5CD4C32D378293A73AE LEONARDDUNPHE
690,225,556 *47431A93AF2EBEF7FF91A19263A1A9325397D7D3 LES.ITALOAMERICAINS
690,225,557 *4742F0A60CA104D45704AEF06667DFD5626C99BF LHAZANOV
690,225,558 *474A2AB2D6FF6F753637942A72FBB7A0CCE23BFF LIFEWAS
690,225,559 *4740F073A1C30D028C64D0A8289383E6862BED44 linwoodwageman
690,225,560 *4744B149261DC302C0F97B0E17BE209182AE2B8E LISEFUHR
690,225,561 *4746ADDE0AF6D9AE76E93D0B4A0BB41937F8D5DD [email protected]
690,225,562 *474FA6174F6C5772A2112B61DE3D0A358517EBC7 liuteriaparmense
690,225,563 *47467FA2D5489EE801EE294EC1EB3E69E4A0B135 L/MG
690,225,564 *4744FAAEA315764F9F1CBD81A8240006AB7BFA4D LOGWOOD
690,225,565 *4742A063F5AC61B682AFAE8045B7117A82304853 LUCIANODUFORT
690,225,566 *474D140B2B9ADA0C5D035A27805011EB319FA074 LUCIOMURASSO
690,225,567 *474BAF98777431728B39478DB917E2BB303ABA70 [email protected]
690,225,568 *4743CFCB9629A73A75643D0CB2295E415DA137F7 lx\0
690,225,569 *474D353D620DE1E5E82A4C02C95B2415FF1EF525 LY..ENY
690,225,570 *4746B7A6DB9EA974408DD1C43078E2F07F87C239 lylescurci
690,225,571 *4740DA057BEE2ABB2687E9D6C91B163F29335623 LYNWOOD.FAAS
690,225,572 *474723E8CF9456446FF6C017209C24A2F7FCE5EA m5+re4+ng
690,225,573 *4745294EB3DF865D1F284119B779DB567230B655 ma1+r3a+3d
690,225,574 *474FCEF2A0E1014BB0C7FD4DCBFDE772091B4962 [email protected]
690,225,575 *474651F0766B504AE0299D9300DB1BC334486CB4 MAGAVASLO
690,225,576 *474F3CCF88443254E17178696A033EC330B25A41 maguerita.pracatan
690,225,577 *47439F3067E2F6DB4276CBA758E1C8D3F2836ACE mainesoroa
690,225,578 *474D6849CA9F2AA76FE90BA9D5F4AC550CEC6B04 MARCO COUTO
690,225,579 *474468874B7407B598A05AB5205EDF1E322C4C3A MARIANODEKENIPP
690,225,580 *4749615595E25A403D409A5146A69534D6B280EF MARIANODELARIVAAGUERO
690,225,581 *47439CCD1B60D2FB330CD6141883CD679DC69833 MARICON-PEREA
690,225,582 *474D91505CC4497DB40881704BFB7AB8B6D252F2 MARY, DID YOU KNOW
690,225,583 *4746C0C3AC5DA513F727F10127CD94AE6A9D0944 marykayberger
690,225,584 *474DEB2072C6952053F01282FD2FCBBEC2E56D96 masculus2
690,225,585 *474D334C841184F78ADA6E4C62FBCE65A86DA152 MAX.BARINO
690,225,586 *4746D7474EB2BAE0F85475540E4499D64B20C712 maxdunn
690,225,587 *4742E4244ECFA9C30BCAA23DBBE507D060DAC5F2 m.d..blitz
690,225,588 *474248CA4A9F471D71448D7F17100F2B650B931F MEGAN-MCROY
690,225,589 *474AB618BECF9A371211954A4F4CDBF7CA1B699A MELWIESE
690,225,590 *474030D419175C8F1978F383F9E242EC37B1348A menzogne5
690,225,591 *474C6A8AF7ABC605704F988A9D188E5ABA045C4A MERGED
690,225,592 *4744CF767AE9774F0519F59A8CAF7B92B2BCF3EC MESSAJES7
690,225,593 *474D64C05EBF1DA81166A74874A871585F09AAE3 METALLOOK
690,225,594 *4745C85ACF6EBA13A84397EE518F6DC0B65066D0 MIKEGILLION
690,225,595 *474B5A83D452FCF6B521144D5353FD0842AB80D1 MILFORDKERELUK
690,225,596 *47417C949A2E441FA771C090312D6378C6D13CF4 MIND TRANCEFERENCE CONTROL
690,225,597 *474E1795BC67E65EA8890F766C8667A9E78B707B minniespanish
690,225,598 *474BCEF29F70EE4ED81859F3EFD8388BD3F651DE MLEOGAN
690,225,599 *474741C64DE0AB614FB3FA1D007C8B7672EFC944 MMERUNG: ACT II: SCENE IV: HELLE WEHR! HEILIGE WAFFE!
690,225,600 *4746D8D12224725284B5EE20AC7EBFF8F1D3BFE3 [email protected]
690,225,601 *474F2A81F3CF2542D9A9DF6809438382A428D7B6 MONTEDONNER
690,225,602 *4740986090C3F10D930FFFF8E3CCE715CB5046AE MORIENT4
690,225,603 *474FC8B137464D0C5C339DE7E9E2570DA21935D0 MORTON.TYRE
690,225,604 *474B5E7701481E3040CFB0F420685FD450284C4F MOSES.DOBYNS
690,225,605 *47498AE8A4B9F0194E83DE4528527A354D1AD8FF mountain
690,225,606 *474BCEA178DF23BC4FB2C2EF4F581EB6860A64C3 MUKASIKA2
690,225,607 *4744D4416B383A4EBAF1B4579D784E469D1BCB40 MUSIC-IS-MY-HUSBAND
690,225,608 *4741F6FDBA3B7795E024B6CE2DCE9C5E5C39F1AE MYPOISON
690,225,609 *47492FB043E2AB7B75EEB88CC7CFA8DAE51FAF11 [email protected]
690,225,610 *474BC75DDF7E163796E5744DF5B79E66664DECC0 NAGAHAMA_INSTITUTE
690,225,611 *47470F56A43C9A65ABE84C057CE7A1530BFBBE1A „NĂSTUREL”
690,225,612 *4747C6AA4603CC2EAE5E08196F06F98F570600BA NATHANAELVASSER
690,225,613 *474265FCB43B783AA6744E3FF0A09DA991EF5F46 NATHAN.HEITMAN
690,225,614 *474768318BEB23D611B5CE801D01EC9E7C1F71D3 NEITHERDYCEDARG
690,225,615 *474E351D97A13295127C905C8CDFC489AD490417 NEOCHOEN0
690,225,616 *474A87FA175A5588D51A4CE404599DBDAFF1525F NESAGLEDIVIH1
690,225,617 *47423C36D00CBD8408B040B209A6A31476F13379 NICKY.MACDUFFEE
690,225,618 *47498AE93E8FBA966594E17762C2889AE82D9357 NIKKIHARPER
690,225,619 *47432119ED5A4D70F72C0BB669EDE3CB7E51911D [email protected]
690,225,620 *47486B0D036924BC58C7108ED641FE231688048A NOPASS0101
690,225,621 *474F99486675BD1B38B6781682B8A8878FC770E3 [email protected]
690,225,622 *474A12BE6D0DB95E58529B74A5207F236AA34353 ;)o~0~<p
690,225,623 *474F578D940F13CF72EDF6834FE2A1FE8065F510 OBJECT-LIBIDO
690,225,624 *474855B09934EF624C6A0A69DF399B4E7A99B9F6 OKEANOSSCHUBERT
690,225,625 *4740C039CF37AE8EB7120E05EC637D8724812BEC OLENBAKSH
690,225,626 *47456CF6E2AFF781A3083F3EB605226E8059FEFB OLINCALLANAN
690,225,627 *4747D9C2E01A1E15479110F00B5D93558B04C4C6 OMAR.QUAID
690,225,628 *4742C0A03421C1180A05D1812F013A7577435457 omerbrynteson
690,225,629 *4748DFEEB6BA2827D2305A05CFFF28732FF4ADD4 }o{.o~.dB
690,225,630 *474E500C4436EB11392048DEBFB1872FE36E2D5F ORCUMINU
690,225,631 *4744833185DD9A31C86199D5A33E11A153857C5B ORVAL.JANVIER
690,225,632 *474699AB5714C833B8296DFFD0E0849452A3C58E ORVALMARQUIS
690,225,633 *474B60D750AED96128DFF1AE1F5F8D46992F5CB2 oscarsilvera
690,225,634 *4748680B326DA4DE93DA2A2E0F7490A864C5ABA4 OTHAGEHRON
690,225,635 *474414F5E8F60B22943A023AB5BA8FFFBF85692D otisburgin
690,225,636 *47483069516B3D70EC5400A72B84B15C77463FF3 OUTPIPET1
690,225,637 *4749307229FDDCCF5D1A63235C1A0D1591941590 [email protected]
690,225,638 *474A6E0140A2A022D774A0F8EF4D60ACD50E91DB [email protected]
690,225,639 *47419AFF9EA796193CC217527CCA736B0F22D1D0 OZ
690,225,640 *4749D443AD4A89CF2C14113C80103CD8510CCB40 pappershandel
690,225,641 *474D71968AC90B9E060EA376E9E47BC589901CE4 PAULCOOK
690,225,642 *47412CA8E42A562931723EA964E52E222426C878 P====D.~0~o.(>_<)
690,225,643 *4742B20F77236A6858EAEFA279DBB9445E8AD050 p--d~0~o)o(
690,225,644 *47425541D680551DB2F4BF08495E0DAD3CD3AB4F PDで提供されている画像ではない。
690,225,645 *4742B6618B9617200B52CCC4711EBB18F51115F0 piersings
690,225,646 *4745C346630C341569F15FE2FF19771A54736FC0 Polonaise-for-Piano-No-6-in-A-flat-major-("H
690,225,647 *4741A4C291A08341C62DC21F9012570A81724BF6 p----)~O~o)O(
690,225,648 *474277830FC589902666A6F2A1AAF839D578897D posiano
690,225,649 *47415B4F97ED2975399AE3917C238911E9ED3640 :P-~-`<###P
690,225,650 *474169B4F64D89075599DFAF203351C4B3BC040B P###P~O.~o)o(
690,225,651 *474032B67229C80E206D0A148E6CA964622C5892 PPVNWG
690,225,652 *4740A7BC066FB056ECE5128BA9E010770D1626F4 :p~q######p
690,225,653 *4741747B25F7034B5D3D2A52509222F447D7F2A6 PROCUM-PRYDE
690,225,654 *474E9482541AF9D181956143CDADC5DA446A802F Q)*.*.*.(00)
690,225,655 *474ED9B76FA76E70983CCCDE7E8AE2D7D84007B6 Q:-IF
690,225,656 *474B2219E9B5419DCB752A4100E1207B0916FD32 [email protected]
690,225,657 *474CF65B3D3EFFF42801A98CD16F027F075FD45F q---)-~o~o-}o{
690,225,658 *474CE63FC1BA9C6C705E3C4344A05E62466244A8 QU4R+3RFIN4LI5+
690,225,659 *4745038F1E85CB845693704E7DA09B6A0689E520 quintonocchipinti
690,225,660 *47432CC5FBE08CB52E5749CDD4A8CA89926F950A R1F1ETTONO
690,225,661 *474E50C5034F25CDB8462E3DA81A0179D479F394 R3P3TITSFILS
690,225,662 *47418DED33A8E7F7DA24223C7D24D0F3979436F8 [email protected]
690,225,663 *47452D0E0ED9827BB4791ACAF97E4707604B3E22 RECONCILIÉES
690,225,664 *474379E996BDF420BF832FF3DC65D7FA5636BF12 redwingk2
690,225,665 *474040A6355E6815AA0BC16E30687EB1F0815A63 regina.bustamante
690,225,666 *47440FD009204540310AD7BF350C19D0E6EE24C8 REGINA.BUSTAMANTE
690,225,667 *4743FCB5A7BECCB7C9DA56F60C40D425B5430C85 reginaldmathieu
690,225,668 *47465C410E328E0E2296DB7A38A1B9C7F93FC23D RENATO.HELDER
690,225,669 *4748FD8409BE88FEFF6E3C4CE8DFBD5061DFC3D3 RETARDERS9
690,225,670 *474867F1BCB8D2F331C534180ED898B14B39DE28 return of the mack 2009 (spencer & hill remix)
690,225,671 *474D6A72822AEF45609020CC7CBC4D39519EC45E RFLUESSE6
690,225,672 *474257F89683356A1665D2A3740A43645E515911 RINOPLASTIE
690,225,673 *474BE740996B72F60FF96B61096710EE6F3BC32D RIXYEARA
690,225,674 *47458AEC24F45232C71B342BE6C877F45ECE2434 ROBBY.UELMEN
690,225,675 *4747E61B410FDFD01A6CE9DC2FFF7F2AD066C8B2 Rock,-Love-And-Understanding
690,225,676 *47441E669EE003079F46C4E707CB20638BD3715C ROCTYHAA90
690,225,677 *47487095BB0A5A039D8133C747B73FBA878AF91E rombava6
690,225,678 *4741C60C7844ACD78014E0DCDB9B2B855C342385 ROSENDOBEAUDION
690,225,679 *474DE28E24469ABC62933516C39AAF6BA800836E ROSSIJSK5
690,225,680 *4740C1DC6BCBCFD6394F8DE9C8CFB5514C7747CB ROTĂRĂŞTI
690,225,681 *47440BDD44AABF6557EE27E25F373FC2D8E12582 ruimtens9
690,225,682 *474EAC8D0563F5C292CE88D328A720E658DF2B67 S3AWIF3
690,225,683 *474E2A2830C02B79275207EBC7933DFC97131416 sajaroff9
690,225,684 *47455EA80037C48B439AACCAEC17EB0B2067EDE8 SALVADORMCGINNES
690,225,685 *474C32E9B0F6689DCEF1C125C1A072963E1BEDED SAMANTHAELVIS
690,225,686 *474B72D655FD205BFA2CBB87DF8F01AD73A99016 SANTOSGRIFFING
690,225,687 *474A6BF7464CDC3C699E8CA878F58EE26D69A01F SARERUATSNI2
690,225,688 *474F4D42347FEC21951410332281D1C7019F821A sarrazietoises
690,225,689 *474C2487965E89265E642ADBB1BCCA4995C65BE2 savignyenrevermont
690,225,690 *47485F432AE1C4F833C97F1EF7B2BEC8B9D347A0 seanschweyen
690,225,691 *474FE659FDD98DB04502CA1388FB5FC841ACE5C8 SEC WALKIN'
690,225,692 *4747C115E9FF85781AA8390C1F22AD7576823C26 SEEZ17
690,225,693 *47445259D8F8CC1A420F9ED7F15943D57EB14C6B SELENOGRAPHIC.S/I/,L/I/N/@/'GR/&/F/I/K
690,225,694 *474E3459948156065F5E06E94B01E3C5AA8D7EBC SEPARIDE1
690,225,695 *474600F1C85773EAD6A1A5F9FA1655AC5717D7E9 SERGEIHELP6
690,225,696 *4741A5AF5DCAA35CA6A8FF04E59398E3C965EBD4 serves-'em-fine
690,225,697 *47431436EB75EA6D78D0BD23FF30D1651CB277D6 SETHBOLLMAN
690,225,698 *474CA77AB1ECD328426F1E50679298DEDA4C1839 SETRAPER2
690,225,699 *474A6C59E026D9319F2D9A9E1826ECF2F28EF5FD sexisyllable
690,225,700 *47438F7035308F8CFDE9B4D793A0E35AE37CA753 shannonabaloz
690,225,701 *474F599071F698656FE1C8790EB611FB99506B1F shelbycrumedy
690,225,702 *474223AD54904AACB3C437EE2D3BDABD9D1833AE SHELTON.STOJANOVIC
690,225,703 *474CF7CFC643C43DB5629668D640E6FCF9E0B228 SHEMOVES(LALALASONG)
690,225,704 *4741C57ADF83C6810CB6049AB5CD11382139C67E [email protected]
690,225,705 *474A6FD69D8419A6DE6C3E720B066DCB924D5F85 sheriffsherif
690,225,706 *47454B0D643F32813EDC3DB49296145EBA472781 SHTICKSHTICK6
690,225,707 *474771D213DA46317CC99034454CB08C084B5489 shuwhoknew
690,225,708 *474FB2B1D7DC92CBF44DCE82E2F23F30D383E3F4 SIDERAL10
690,225,709 *474120705F892350E400F2BE088AC1F1EC08DFB9 SID.MCBAIN
690,225,710 *474FA79CC9B58B9E92D1DA322E7DD891DB480E99 signpost20060703ne
690,225,711 *474154C942D54E163613DA553A95755A528C0ACF sikogub0
690,225,712 *4745E30CAFCDE3A0C41F314480CB2224AA594545 SIR;.BUT YET
690,225,713 *474454CBE8072C621697C18293038F51AC333A95 SKATTETNKNIN0
690,225,714 *4744697DDD2F907D53E36D6CFCAF0B1DC578CE31 SL930655
690,225,715 *47448CE654187BC780EE2F9CAE244263B7B463A9 SMLLXMPL
690,225,716 *4749774FDAC62BD08015608DA99DB25EB5521BC1 SMUILUBEN
690,225,717 *474DE7140F6195BC8C9BF56C29828A5BE2A281BC SODANABAGNE
690,225,718 *474E54E7A3A7F3AFC70FC27FD382C16151ABA7A5 SOMIDNETNE
690,225,719 *4747439CD34C7A93EC677FC021DBF01BAE918EFF [email protected]
690,225,720 *474DDE90630A45E55729E57AF5CDA97B78A46ED9 soused
690,225,721 *474A675F05240430DDE42DE2E6EFA1B02CD1C0F1 south_carolina_58sv
690,225,722 *4745ADDE65AA44DAE64AF57D5F783150D2C3AF04 SOYLURE8
690,225,723 *474F4ED38C266A201FA5F58981B6836EC4EBAB7A SPIONAGESATELLITENPROGRAMME
690,225,724 *474168711DB7ABF8F17E92E8D69D86BA960E1962 splat!!~`~`dq
690,225,725 *474737909EEF9A1754D4AAD968463E9FA8262665 Splat!!-O~-<#q
690,225,726 *474313CB2D6A760619FE5BB990E263B80C2B8001 @#$%^Spring
690,225,727 *474DF997FFF28D512149BE3E8F098375EBCA6E4D SQUIRTMONOPOLY6
690,225,728 *47454C55B0E7AE2031221B446635451EACE9277B SR5M
690,225,729 *4747B44C21120CB337441FACDFC198ED75D15D12 SSECCANITSIRHC
690,225,730 *4742DFE7EC52866C5849E934B0CD4EE8C7316FF0 sseniratnemelpmoc
690,225,731 *47453E6D4DC103828500A366A8E48E494E42B4E6 [email protected]
690,225,732 *474C89AB28225F8D78E5C5B251791FC10DA919F1 STEINKLEPP
690,225,733 *47418F1F95224B98488B7764596133C27E7662C1 STERLING.TACEY
690,225,734 *47403720FDFA5D77948ECA9C6F57E248FCC2EB4E stevenpavlikowski
690,225,735 *474E24EC1A0FDB7648B7D5281829DB37329A77DB steve.zee
690,225,736 *4743A6C1FA38A79CF63DACA8D0A1EE2ECCD884F8 STIERCL
690,225,737 *474FE735B01921B204332A629954920AD8170D98 stuartitaly
690,225,738 *4741F1078D25EACA94EFBBBF3C3BD964154F2D32 [email protected]
690,225,739 *4742E3784C795B6409D593C473DEF9052F7D5B60 SÜDORT
690,225,740 *4741FA434028144842B46F484C9734F9AD84658C SUITE EN SOL MINEUR, TWV 55:G1 "LA MUSETTE": V MENUET - [TRIO]
690,225,741 *4741B662D694D8C2E4D3C94800244B32420378A6 SUPERHELD(MEINCLUBMIX)
690,225,742 *474C643D414546ADA3299A08A91F1AE80602288F susan-beaupre
690,225,743 *4748A6F700B087F45537CADAFD26226B481F6DA6 SUZANNE-WELKE
690,225,744 *4747C43CF03447FD5E18F0913E91C77167F5A674 SWINGIN' AT THE SEANCE
690,225,745 *474619498121DB9C125A384D41DFE715ECBDC6CC TAKE CARE OF U
690,225,746 *474F6B5FFFE5DA92D8AEE05558D13B8EECFE1B4B TALK862718248
690,225,747 *474920227DE6850ACD0EA52EDA14E4C8ADDD3CF4 TALKAOZUKUM
690,225,748 *47462F2ED25E598E9BA5CFC1A565B3CBF43ECBF1 TALKDAIKENKAILV
690,225,749 *474AC30801C600E60339E8210F09033F3459B305 TALKKINGKONG
690,225,750 *4741F40A1F76E79DEACC4A3605163EBA707C5EAA TALKKLOKOOV
690,225,751 *474E1DD6CB82BC7176185847D94F0A7C6A3AB225 TARUNCHANDNA
690,225,752 *4745BFB4ED58280AE96EFD5B02B8DB6D1F6B3B08 TCBRIDGES
690,225,753 *47431ABC0AE91FC59F796A946923E1F40C9481AD [email protected]
690,225,754 *4745696CCD5A9D135CC10959507D100D63DAE63B TEDIOUSNESSES7
690,225,755 *4748EB5ACA5500618AC2CF17FFF0520BAD76F983 TEMPLEHUNG
690,225,756 *474AB2D6DAFCF1E105BD2D013C768E855ADF03FB TEMPRACERX7
690,225,757 *474CB0AA994210C34CEDC3691800F1F70A465D2D TENNISMÄRKET
690,225,758 *474530CA36EE88492D92C4F5FEABA1976B54A312 TERESA-A-SANDERS
690,225,759 *474AAEBAF06B3F44537A60B9D8B02A48900BD620 terreintekening6
690,225,760 *4743E10E4C25C3A61748099D6DBA34E0EBD9ACF2 thadringdahl
690,225,761 *474E6BC5FD2A4CAB2D90041002DDA2AFBF6D5F6F THATSLACKER2000
690,225,762 *474009A6CE4743FD718BB533391E6DDBEC210246 the-life-of-the-law-has-not-been-logic;-it-has-been-experience
690,225,763 *47406A72BEB7590C42F9EB674D8DB81D06829E56 the.sound.of.the.atom.splitting
690,225,764 *4742DCB67EBF6A588139E0301B061C2EE75D2825 thnlnkcom
690,225,765 *47462038652E8437935C60EA219293726A92D883 THURMANSILIEZAR
690,225,766 *474B6B377D10455C53034E5D42B2E06015CD7B62 [email protected]
690,225,767 *47428B31686F18206F0CA8CA4EF4E54985A0ED56 [email protected]
690,225,768 *4742D7E001FFA0F2A616014E912056EFF9999FC6 TIVAUQA0
690,225,769 *4746A5DF116C344B8D499F9F0C273CDA5430C668 TKREMEBNU6
690,225,770 *474A247424378B73253E453BFBA8F494A94AF7CB TLUDAVLE
690,225,771 *4740D311E6678D26247137C502CD74467A2FFA2D todd.w
690,225,772 *47477289571153539A7E838EE9EC51DFEC153F83 TONY HENKIEL
690,225,773 *4742FAD0449E29CFC9C8B6150781F2E08689A0A5 TONYKRUEGER
690,225,774 *474AC301D5231A2C13EE99C6F80615843D722B15 TOOLSERVER-L
690,225,775 *474CAFF9D323040BA6258A8E869512B317DEFD03 traffekmarchingdynamicsmix
690,225,776 *474900C80632AD2C4DABD6D5EB8D293E86380EED TRIKRONOJ13
690,225,777 *474460DB7CBFA2C08A4FDD011F4CD338F8567A00 トリンコマリー(TRINCOMALEE)
690,225,778 *474ABFC75B0B01F09B17CCC449780C851B9D55C2 TRIXIA.TEULISYA.WOO
690,225,779 *47433723613CAF207FD614D17BEBFEE3E825737F TRUMBLEAPHODITE
690,225,780 *47420C9286E9F7E2EC68AEF4D32243B87A6C579A TSETDELIAT
690,225,781 *47421924071EFD0AE91C7032E14B8C885F028959 TUBBELSON0
690,225,782 *474A52D227AC398C24E0414A98D125F39D8E062C TYRELL.ROCKENBACH
690,225,783 *4740F63A8DA18F08539A17AC56393DF6BECBF05F UCY ANDRIA
690,225,784 *474B24AC9499C7E01A30A5FD795EA84CC269D480 ULTIMAX8
690,225,785 *474CE3027C63C2151F8926E8A7900EEC4A822659 UMLIEFSTS
690,225,786 *4745892EC888FB646A43C52B23BEE3F21252D911 UN ABRAZO A LA ESPERANZA
690,225,787 *47485AE802900818258C870512E5A14E738FD7D6 unabutting5
690,225,788 *474E865F7DB99F8B6702B4090A9F5B4D0A1A76C3 UNTERSTELLRÄUMEN
690,225,789 *474B0A4B21B87D83577A5D3B8EC5C3BE330D9264 unvoweled!
690,225,790 *4742ADABF0EABA8D7AC6825579E015E2FF53E876 USSELDOM5
690,225,791 *47478BAF3587BEBF0A5D960F0EF38ED5B058A6A6 UU * * Q-8
690,225,792 *474D942C7A04BBE30FDDBF4D48BF0A8C2A3AE7E3 UVAISHAY
690,225,793 *4748F4BC176770EFED0BEECE5C3E25F3333CBFA6 UXELFBUS1
690,225,794 *4744D82D4340656E77A6249C9EE0A6F5B42A539F VADOVAUJASI
690,225,795 *474EA2774022E81BD43108C93CA2F5B662C410B6 valhallahelen
690,225,796 *4746653BC88BD6631D7C2D4A4D0995257B2E7A5E VEERWEGSES
690,225,797 *474A689C320E5AECAD37F1A06AC6A2D1A8A4C5C4 VEILINGSES4
690,225,798 *474E4A7895C96BC30B719D3EA3AF72B7D10A9BB5 velcsez
690,225,799 *4745F5A51F1F31F41DE7AE428E62267579AA525B VERKADA-MONTGOMERY
690,225,800 *474C272301382BBD870EBC708ED82B10ECA4FDE7 VERONICADAVID1
690,225,801 *4746A6F60EFEBC226F1D91E5DB88160D4555F18D vhie.yokananda
690,225,802 *474E5DAF8F4198A5AE6D266C8873B11E80224CA3 VIDYA XAVIER U
690,225,803 *474F6004DEE580351160CA1E0B1CD8B67D53751A VILDT3TS
690,225,804 *474D0F6A15032F68A9FD842D3F076EA0106FCC01 VINCENTRUDIEYANTOLEE
690,225,805 *474E7C96ED1B40EAA6624783A77FD560C62D928D VIOLETSPIKES
690,225,806 *474A0DE7D162F6EDE76E9398C9D62C79A05FA6C1 vitinho0
690,225,807 *4741957A9530695092A1E4E993ADEF6D6B6FCE8D [email protected]@n5
690,225,808 *47464BCB2C2F688FDECEFF8E01D46E28754EA904 VTNJLBRF[
690,225,809 *474193A83DC27F83B807053FB84ABA7E55AE4762 VXC<
690,225,810 *47496A893E2A02AD3D4743C7D1DDAD4C38C044B7 waldokluender
690,225,811 *47474AF8E5A21BF344ED347740E82B61E93E23E6 [email protected]
690,225,812 *474D152CAD3C71F52980760BA176843F4BA3B03E WANETCA7
690,225,813 *474ED95AF1687EF45361EE3EFC449C34473A766C WANZHONEY
690,225,814 *47448E40BDC69492F80A73D52FF330AFE94967BE wattages
690,225,815 *4743A153DECB1F8C9989DBB81EF3D8B6286C10EA [email protected]
690,225,816 *474BE22290F75A420ACDBAD51E9BCE20881E6660 w/ei/highwayman 'h/ai/
690,225,817 *47454ACD6B1B77E197D304347BAFA86EB8997DB3 wesasiello
690,225,818 *4745F19B8BAB68F16226E1105C51299D6FDF1C45 WESSHEDDEN
690,225,819 *4746B1A622A4C4D8EF82C203FECAF1CD8D2C2E3C WETTIGDANIELMEIER
690,225,820 *474F8DBC6D8EA4E37C4C58FCDAC3213853298FF6 WIDI FAIQ
690,225,821 *47499069EAAC4D28C9C59FA8284F129665287E68 wikenson-joachin
690,225,822 *474907FB170DF72F9D388F11E71D33D9BD9CB584 WILBURN.HASHAWAY
690,225,823 *474BF7EF0506860EADF8F4C377F3DBC92B695265 wilfredohartis
690,225,824 *4747023A0D6FED5D029F9AF11291C7CB1C44E1B6 WILLIAN.SELING
690,225,825 *47416C097932BF0EE702143A765A52E44137B03D windinthedoorhb
690,225,826 *474D5BD2639363680101A065EFDC5533D4C168A8 world's.longest.night
690,225,827 *474C01E328EA7D865CE1160E02E1626CF127F0C3 WWW.TEDBLOCKERHOLSTERS.COM
690,225,828 *474B8F68D2D140369BF0AD02D8BE80344A450D60 ,-WY
690,225,829 *474800C0F7168D8AEABB855238C89935EF741938 )X(-*@#####3
690,225,830 *474C3E19D0F4D3810CABE01BE066EA91448A5D63 XAVIER228
690,225,831 *474FDA8EA09815F1A37FCD102EE722CF2A42BE18 xavier.lelievre
690,225,832 *474EB10BAC7BAB1C3272AB100A11CCCD038E0025 [email protected]
690,225,833 *474108CCFF0C9F6357F6155EA53DD4888EECBBB9 [email protected]
690,225,834 *474A125294D4A94623CA8EE3935D133753AF62C3 XKO
690,225,835 *474A9E52E46F82A537BEA775404F0D9BB32054AD [email protected]
690,225,836 *47481D6A592F07078B34B153BCC60832579FDCA9 XUZASHANXIARYNS
690,225,837 *474A7E76CB95C5FA25E888C24974FFB29DAA5AAD XYSLCYLCED
690,225,838 *474055C8E1934E53A7ACA1C99DA7C8B0DC33E97C xy-xz
690,225,839 *4747D2CBDFD5F2758861E9B9FF6BB13F95805FFB yamhcram
690,225,840 *474B020F81D280B00FB3006F94089A5DD9857AE0 YANKENSPLLITZZ
690,225,841 *474723BB197D5D84077961B7940071835C1D4555 [email protected]
690,225,842 *474D505654393116D58644630321B39B3676573A [email protected]
690,225,843 *4745374288D8096891464A9872555AD035265626 YASMIN ASI EDRY
690,225,844 *4744795398B2CA29BA038CE21A7EA7135A4CDF13 YI-WERN-WONG
690,225,845 *47417CA6438712A8EAD99E37C7EBF736C8A2AA77 yllatnemadnufdias
690,225,846 *47475726F168C6842E74648D8FDE884F1D4CA2E4 yourcantion
690,225,847 *474B1B552C49859A4A4E0E704010173C4E6DF15D yri/
690,225,848 *47451F6BA6A11C2C5422337C179EADF1C4F3959B yves-daubert
690,225,849 *474F500CCFA33C03FC047E9FCED5AFF29AFBC6D4 Z10294391
690,225,850 *47468CA03635C380E99EAC05F4C5E06E21CD8DA3 ŻALEK
690,225,851 *474DA0E1ADCE9088F0CB7B734DE7CCC1E2CB0C9C ZARINAHISAM
690,225,852 *474BCC6E2BAECC87BE2C885358A788A1AABE2669 ZDROBLJENU6
690,225,853 *474F7500076546E1F26ECEDB1A512D26D45978C0 zeke.tunay
690,225,854 *474F2960312F2ABF81CFD9A2D1037A2FCC5EAA68 [email protected]
690,225,855 *474617B9C7B2CBB8D2D26AD4719414D5DACFF67E [email protected]
690,225,856 *474161A8BFEAD887F7ED5AF5E78DF0E3E7657C86 [email protected]
690,225,857 *4747BBAE3608C1909957E42B289DE4A1491C710E [email protected]
690,225,858 *4743A26C789CEDC467D0EC627EB06808A07B0096 [email protected]
690,225,859 *474C1FBACE629A9C93BB5AD161D6CFD90CD429EF [email protected]
690,225,860 *474FFD8E453F1CDAE90C2279208216C040298309 zornymarozudaliniezimovajimgly
690,225,861 *4740DB4C62B3BA202505FEF4635DCE8BE178606C γκιντζένκο
690,225,862 *4747B26264C2AD9F26C7D6B607DCE59C40327B1E БІФУРКАЦІЯ
690,225,863 *47481B0431BD378CC5199C3F3236A86E533415CB ПРОСВЈЕТИНИХ
690,225,864 *474F4E9BFF5A2F29BE609B01CB5458DDF8C60C07 СЯНСІ
690,225,865 *4744DABB25DC3A1721FF59C60B78DE3CF97209A8 ХАСАЈ
690,225,866 *4747B58C1E03B16B51365753C817DEE9E8E3520F чайгаар
690,225,867 *474ABA0B2D54973FFD784CBD6DD083C595BA6A1C ЭЙДР
690,225,868 *474346E530E18FC95CF5C4B3E90F1EA685EE6F9F эолийское
690,225,869 *47494E3F5A2914FDAEB4E7491DC6E8044CAAB711 (0HYZ
690,225,870 *4742353690F0748A0E971F010A5E24F644EC451B )0(-*Q######P
690,225,871 *4746F280C812381F4D8566EA78D0ADE877CF50E2 0THECARDINAL4
690,225,872 *474A3422A281A6DEA58EC12CE51896EEA75BA7A3 1345108 N
690,225,873 *474B2B8015E486F9F46ADFF68F8A3AE428222C33 1388967 KASVUKESKUKSEN KAUTTA VOI SAADA K
690,225,874 *4747929AED75CDBBD5A83E34C51090BECC0E7025 13MAY2000
690,225,875 *474E390A26B48DC63CC51F0C04E9E89C8487F655 18021496
690,225,876 *47434949C050E027527D51663F79AC566CB47FA6 (1999年、TBS)主演・小泉日向子役
690,225,877 *4741477D0A8B6AF97610453903EA483A1C01EDBA 1.ANGIOLOGIAN
690,225,878 *4743AB9DEC3DB927F039766AFF60A96A848DC71A 1.drug-management
690,225,879 *474AB325CA1EFDF4C91E7CC6015AD8DCDFE039FA 1EINSATZRESERVERE
690,225,880 *4742B79678BBC313721A244692969560EC2C9F96 1GECOMPLETEERDEN
690,225,881 *4743205294252D06DB42F51F855D1D1EDFA55D8C 1PODZENOU
690,225,882 *474A638FAEEE929F6DE877D5C9D8E69E2E7E53E0 1q2w3ealyssa
690,225,883 *474FF5FA1E11E7E40018539DE1B4284DC49BB0C1 1.time-slots
690,225,884 *474680C28A7E71C3AC8451EAEBA627AD1F9F4582 1VASTAVAIKUTUKSELLE
690,225,885 *474409CE16E573C911BA7F6126A56D66B1A8D85B 1.wechselrichtern
690,225,886 *474549FA6E5D9580D9C00423CFBB782308587B6E 2061259 KOOTEEPEE.PELASI.SIIS.OTTELUN.YHT
690,225,887 *474355034650D866866D25318E6EDC947C50C435 20grarem
690,225,888 *474E35767C9BBA2CAEE8EE9728E3CFF6506C43D7 2515613 samakoskeemy
690,225,889 *47448870F7CE5828CABB35C6190CD09B89FCBAB8 2.ANDERSEN-MANN
690,225,890 *47488CEC9FC3B5F733A5A9DD4A3713A722367A07 2fightin
690,225,891 *47474016157E7E4148A59D19C3C45BE3BE71282D 2SAJARAB
690,225,892 *474629CAE78265AC2A7E7746BD318DD9B370887B 2TINBUTSU
690,225,893 *474DE45F9A6F826E55D1116E54454633867ED188 321547 BUGDAY.(.TRITICUM.AESTIVUM.CV..
690,225,894 *4744345C02B6A887910904F43D4AF5D09B06E141 34giuliana
690,225,895 *4747E69C829B8FCCFAA031491B85041F341E9162 3iluvmiranda2
690,225,896 *474B18EA4C5489102737BC0D4F228797E2FC56E6 3TEPOTTE
690,225,897 *474E52F70DAD43D209804D267B579E1D251036A9 416874 kaksi.lasta.ensimm
690,225,898 *4748EA7EEFA00744C30173806D742990AC5B0090 45613 AILENIN.UMUDU.,.AILENIN.GELECEGI....
690,225,899 *474D10599F698AC2E9181B01E14E2685C896C67F 4KIJIEKOT
690,225,900 *474C2EFFD494555655103762536D6A4FBD0119FB 4MISHKAQWERTY
690,225,901 *4745C8AD6DEFDEDD99A6CD164C723FB1E4574BBF 4MULTIAR
690,225,902 *474FE5FEA7A4E180EE73EB0DDC72560D31FC8D74 4SMESEOLBEDNIL
690,225,903 *47408BA659A27D0A2C53EC97B1F52244BC62ABFA 4VERMOMDES
690,225,904 *474820A9F4BB270049E38C33B0C4988994CC0636 50thanniversaryconcertliveatcarnegiehall
690,225,905 *4747ED21A595C959CC0AAE27457FA861D6BA6D4D 5BEATLESTECHNO
690,225,906 *474FD39BFE3816A775123C4710F53DEB32BA4652 5IRONMANGOLFING
690,225,907 *474481BD14B151EA4188BC225F904E7B68BEFC6F 5KNOTRUBE
690,225,908 *474B2258EF67EFECFE4E20CAA0D14C7A4A408482 5LANTAPE
690,225,909 *474219E9DB128AB8BF2C58F3BC2F46225CC4BFFA 5MOCONUJETILDUBASUHTIMSYDDUB
690,225,910 *474B67DF45CCD91D6DED11354B00CD64490B7813 5MYJEANNE
690,225,911 *474136C640EAA39E403289D2105664A11B7FF424 5OSEPHISM
690,225,912 *474B357D5BB8B04FDD01B4CF18971740EE1C9AAB 5TOMMUFFIN
690,225,913 *4742125AD8AD3102378492BD030CFA26F30E7B51 622GRACE
690,225,914 *4746F8C2637243A38645675D24DF20F2626FF0D3 6ASMONTEUR
690,225,915 *474C0EB7768F1DF5099EC4DC3D58B386AF60D3CB 6BLACKIEMARIPOSA
690,225,916 *47475B34E6E5BBFE1722D5857EDCC1DF2E27E230 6DIESELING
690,225,917 *4741458143E06A4D558C0497C63B74F0C1B91299 6EGITEOVE
690,225,918 *474F0850D1D9C115A65B934866BDEF5E78342F83 6MUBAYAACI
690,225,919 *474CBC4EED3C1070A62AFAC9D26EC6A9BC50E084 6OSMUNDACEOUS
690,225,920 *474773CE3224380E0D5ADC148EBF250B40362053 6RASKINUTIM
690,225,921 *474CB4233B0D47429B1FB6FBEA95CE639E8B6874 6TELECOMBIGBIRD
690,225,922 *474826CF20A02B5F09CD2119C7B558DE388D9BC1 6VIGIBSW
690,225,923 *474307349F0F489DAE9F3613216FF717305A3B0F 6WOMANIZERGAY
690,225,924 *474FE31086091842148DAE907B2EE44232A8DA4C 7ENSERARAS
690,225,925 *474232EC9FB15B4968DE12241739F87AC53343A0 7FLOYDCHAPMAN
690,225,926 *4742BEC98DE38C7DB36792199C06AFEF17F24A33 7KANGASMETSAESSAE
690,225,927 *474C5F6C8FC34925D9731EDEE6693B1A8F373040 7LAURENTREBOR
690,225,928 *474A32F029284BBD9F7ABEC079D67ADB9C46A462 7MQZSOKJWHHE
690,225,929 *474353CB9C2AD742B0D926150AF04F02376C189A 7TURVAUTUISIVAT
690,225,930 *4749AEA723FB7595ADF13DE6FFC9088AAD7868B8 8======>-~0~o(0_<)
690,225,931 *474157FBEA4FC485BBF7466BBD101BC8E1C1FF32 862MARIA
690,225,932 *4745EEF004C40A540D6DD874327D03EADDB2BDF0 892011 ALMEMO22904MONITOIMIMITTARILLAVOIDAANMITATAMM.L
690,225,933 *47426ADCEA603327FE4FF93FFBC17B443A2152F3 }8{.~.~D===P
690,225,934 *47405E92DE8C90023161E8407A5298DA6E2AE1F7 8FASHIONSBLUE
690,225,935 *4749B11F0100E854B949D591F1C894AAC4DBC368 8HANDWOOR
690,225,936 *47423A1C38854F21221189F69C5852184EA8F725 8ILUVROBINHOOD1
690,225,937 *474FE60CC5F192CCBF774F4A85ADF38490D10186 8july1757
690,225,938 *4742C3D2085C4DB876153884A4506B9EEED73F9E 8======P*)8(
690,225,939 *474FB9F12860B33175D1EA8ACAAF047F7D33A5C0 8SAEKEISTOE
690,225,940 *474FBE8578F502D4AB9889B52F60F0BA207D1BAF 8TENTIFA
690,225,941 *4746549CA10C49AE6D652F85B81523C5DF72BED4 8TOMSTREMLAU
690,225,942 *474DC69F26B4F0963108C427208B773C41457884 9BEDRIFTERS
690,225,943 *474BF7A1B992557066B41A6A447A69A76BBF623F 9BSWJEANJEAN
690,225,944 *474D7CDF22910A9666ACBA086A08C6B528B1C2E3 9DOGGYGABRIELL
690,225,945 *4743887EAE5158E79A8EE44A805CA4D58BB7456C 9TALLOTES
690,225,946 *474F4F966352427E8D0088CB4A1FE3AE7CCC7396 9toelevering
690,225,947 *4745D35D059C4FD57051682C85C54B680C3CC579 a11ena71n9
690,225,948 *47446DF2D56A4BD323CB6150A8816ADFC5B18A04 A%&2C
690,225,949 *474EE91E04A65B0F1F7F09873F125D69D8575F7E a4g%r
690,225,950 *474241FEBB4544A94BFB392304E64796CCAAEBF8 a?.69
690,225,951 *47414DEAD2768CD252AF2E3F58F608DF0CC6FB4D A6BC_
690,225,952 *474CFE0E84E58D8DC78726DCED8BE44F98E65AED a9;e,
690,225,953 *47496BC4821A7FA6625065EE464D5AE6545BBA78 a:a2#
690,225,954 *4749FD255708A9FC170285768514E031B9218485 aaaii7
690,225,955 *47417D5661AD70CC25BCAC751FD6AE83B13D6032 ABELMAYR
690,225,956 *47472359B708621E41E480320977E27639FA49FC abgy9
690,225,957 *4744B1CF62DD0EE66E8204C2C1C0145E942E7144 AC#F
690,225,958 *474350420A4B1876FB83A1BD4E381D6B72C90C2D ACINARIOUS8
690,225,959 *47488028DA14B07EFB80A92D7EA61E926D766EB4 ADB"
690,225,960 *474AD2C92EDA26B2CF4CC924C585F3F4D8077F3A [email protected]
690,225,961 *47405361C2FF067EF2A728C1697E0DACDD5CED1C A.EM)
690,225,962 *474D48C36EAEDCAD2C9207CFB3CBB0C4FA343CDE AIEFB
690,225,963 *4746568C0A5A5137545C3616B8742F8E29750679 ajithramakrishnan
690,225,964 *474DC3FDECCEC6E69ACC409BCC9E8FEDC8D73F14 akcylosk6
690,225,965 *4746AA6A1EF55DD6FF4365EEC594510C3AFA6158 aleutlar
690,225,966 *474BE82E2A59A20025805496086CC51A7DA7572B [email protected]
690,225,967 *4749D84C20D1D8440CEA349A9CB0370E077F98B2 [email protected]
690,225,968 *474EB3D7FDBD0D032291FC16F444E81CDF25FA4A ALLTHESETHINGSTHATIVEDONE
690,225,969 *47475BCC1C6A556715CDDC88D129DA4CA406834F altruisticamente
690,225,970 *474EE712338C51F8D9F657E36DC175CF1A2B956D [email protected]
690,225,971 *47411382DFD6F3F6AC77D05BB54F60A3E4C941C7 andncsc0
690,225,972 *4743B110E62A0F7F5DE5FB0F8CE4A4BFF243AA52 antionehebron
690,225,973 *47412B912884696F55E864FA62B96C0817FE5C4B [email protected]
690,225,974 *474D1288392AB6BA6075199021F2AEB19AB3C28A a$p1,
690,225,975 *47416F55974EC7C44BB6798A3317E78B2F4B7829 a_p5h
690,225,976 *47419B334AEC57A32869475BDC4BD6163F122BEE ÄRIKRIITILINE
690,225,977 *474E33B9EA69CCF85083005AA2FEBAD6FA0787C2 [email protected]
690,225,978 *47486C7121D6F3B591E91A3ACDD6664ACE551125 ARTURO.FEND
690,225,979 *47454AB3838799E1F4C8E99993BAC8E99006D325 ASAM
690,225,980 *4740C497FBD16BFC2B2B9494ADD029D983C24D2C asuhteen
690,225,981 *474A6050B8090A0DDD6330D8FCD66ED2D544017B avouches
690,225,982 *47455117943C9BCD25FECEEBFA923D51EFD7D9F6 awv+
690,225,983 *474E550F4F25A2013E1D13EEC9E552ED3DBA7FE1 b12tf
690,225,984 *474BE8B3BEF70DBD34285A4A9199BCBB01D6308B b2oc
690,225,985 *4747AC1A2EA67F17475F92B2AE5886B829A8652A banyoro2
690,225,986 *4748D19ABC8E7EA76F0B46467C25E4BB5735DBEC bartlogged
690,225,987 *4746481ED858170363AAF16A68F0AEE14BE59455 BAYERECK
690,225,988 *474B91A14899C831BA91E7F125D1DBB73BC415C0 B-----B * * * ~0~O;)
690,225,989 *474E73743A8BC7BE39D465A8BC43543FC9E13BB8 b;bfw
690,225,990 *474E42FB50059327A7A91809870C90B84287BAA7 b!:bw
690,225,991 *474C75DBD741F5F66AB39E90ABBB349A49DBFCCC bc#
690,225,992 *47410D3E5E27734CD0A38BB4DEC274EACD1C2299 bfi+t
690,225,993 *474DAE99A9EB4B178FFB69DFC0FBB004EBF999BC BfPd
690,225,994 *474D0F7922DD6F81220B026B67188D90558949C2 Bh5"
690,225,995 *474AB462884AD15C7723AF00F92CC7A4EBA2180C [email protected]
690,225,996 *4745C7DCF1BDEFD64969808C4A8606D73BAD9197 BIMANUAL
690,225,997 *47444DE33A1FC8FDFCBEFCBF5C6DAED8E983A59B BKQ_F
690,225,998 *474F9D18181EF5AEC48FCF2316701864175B839F BNIS
690,225,999 *4740B1B9147C6091BB10C5B597BD03008BD9B88D B#=OJ
690,226,000 *47475F4D8895BD65028F1CBB04C13105940342F1 bookerkukucka
690,226,001 *474E5BF01A50B4F110E52D1FA6037C1BE19E8CD9 bordonea8
690,226,002 *474B3B854C8F386744CCE20B90A6180855258C9A BQFV,
690,226,003 *474DDAF7C4B3C7A8B93952A2449DE73437510CAB Brb-
690,226,004 *474077A26A9CFACFDA9599FEBFB2565C64355B0F br)f6
690,226,005 *474AF4ED047ABC3F6C431016EB26F8B7E31FF88C brla
690,226,006 *4742E8864229BE0DEF639A0BF2912931AE48A468 bsr6w
690,226,007 *474C30D07855801C709954B0EE2605F484D13BC5 BTECENTRY
690,226,008 *474CE483247019A907B9198CCC3F4BF1E9F97238 BUDTAJUDEEN
690,226,009 *474959D5F62C3D1E80465EC03D90A65EA2C5E052 BUGMENOT|NOTMEBUG
690,226,010 *474982B78DBE9940F53EEC3C876C5CE30C037DEF bulgarca2
690,226,011 *4747886AF1B1DDC80803751FBEFAEBADFFB162E0 butuv
690,226,012 *47492487A59D435631CB56E0BA818885FBF537FC BYRON.PATCHELL
690,226,013 *474B183B450D8461E6BF7D0BBD0370B366D4E844 bz7ai
690,226,014 *47422233E291612D6856E4A2989A4C607765D4F6 BZv
690,226,015 *474AEB842F29FCE80FCAA294C90F4F079891642C c1uw1
690,226,016 *474661371E2658CA355C5BF301EBE444DDDCABB0 c2f)8
690,226,017 *474B59197D879787F927FA3E8B881EDBE11DFC2D c2h(.
690,226,018 *4746A4131D284352A96830203087310B5026C437 c=2nt
690,226,019 *474D013B465D9E91E630DAFA84E72F259CB65EE3 cannonry
690,226,020 *4749FC369B8435C7D94D866FEB2C3380C89DCD2B capernaiticallied
690,226,021 *474E54B51035AA72D4C81F0D4EC34F62C65F7ED5 CARRIEWERNER
690,226,022 *47413C5E6777E8AC88C32A410DD678DBF301D331 CAYUGAU9
690,226,023 *47488D56A4B85E9180409C2348D9CA0CAD8B2489 cbln)
690,226,024 *47435A13CA8DB3E8D266868273308E1459C71891 c=bt_
690,226,025 *474A011296C5F634D9FC3B4470F2991FDC9FA4A8 c?!cp
690,226,026 *474B4D200D2268E0102C513B32F4F8F1CDE75BE9 cecidean
690,226,027 *474D378232F28F17284B019E908F14918D91286E CFRANCKED
690,226,028 *47464D785DE7D8B89F3A7E0DBE475D482C8DEECB C/)FS
690,226,029 *47458F8C8AFF874A179E14CD320DDFE73C30E30D [email protected]
690,226,030 *474E7396CD2B74A5D989C7DA1641C84BB08A7A4B [email protected]
690,226,031 *47425093EE5842A67EAAE8987BBC5776426F079D [email protected]
690,226,032 *47438C584219B63FA4B003D0133FB6BC2CEF6F5B chinyie2
690,226,033 *47427311DA766CD31A630802D5229B4868AB656E CLEMENTELANAGAN
690,226,034 *47409D05567F43853FFF2939E1D1F855B762BDBB CL/EP
690,226,035 *47481CA9299DDF4BC07A2FB09F837AAA760D9267 CLJXS
690,226,036 *474CD2DCEB328FC23DBB554A9CE77F63E6BA55E4 CLVFY
690,226,037 *47423672475167509419044C6B771B9F9941087C CNT6G
690,226,038 *4745A8077DFD94CA94B482AA9D513FF100C1AF05 compactof
690,226,039 *474AB91E48CFB72273956BC2E035A712E58CCC35 complete-book-scriptwriting-michael-straczynski
690,226,040 *474D2B31C60C4CE5448836A4F786DF09C9971CA4 COTRACHITA
690,226,041 *47451037BB4589EFD52635C7CC2FF5A4F914AB60 CPEQK
690,226,042 *47475BC973DF147FEFEC95A19A60C06FD882D496 cugur
690,226,043 *474FC03FC6FA06BDEE28A9FA52D86486147787F9 cw;7c
690,226,044 *47456546022B4B65465AC687AF3BC9A8DB6A9A97 CWOs
690,226,045 *474FADD2F67CD1D2A643B324DC9BD946BB437164 D3cr3r$
690,226,046 *474697B7AAB70F7CA848CB55C96CD6A441D5F6C6 d4+t)
690,226,047 *4741F94A171D2ACFAFECE531DFC91E080A52F857 d(5r;
690,226,048 *4742E6B0B03D04EB8AD424327C333B667BE1F301 d5wm5
690,226,049 *474B8A597A556823EB374932D76604D09F12EBBC D8CS
690,226,050 *47422F71FBD5E024B41C8A95F81D7A285A0213B6 [email protected]
690,226,051 *474BF4BF88E97EA47EEB0EFE894215204F6F3274 DALE.VELEZ
690,226,052 *4740C78077E028CF1341E195CC03EE65A1CD57AC DANIELLE-SILMAN
690,226,053 *47492E3D5EFD7F86C636DEE7951B7A257764C047 DANNY.STACY
690,226,054 *474A021D5C542187CBFDF59F0528F8C6E1AEE55C danteamat
690,226,055 *474711E139F36B339144CA93A8D5506588B37BF0 DARNELL.KOSTIUK
690,226,056 *4741CDF530EAE553B1FBC50F37FB05CAEFAEB641 DARWINBOSWELL
690,226,057 *47476A0D6372BEF3D0F06549F7C66A7DE2F89799 DB%PC
690,226,058 *4743A37D789745F3C1AED07354BE937220BC4C3B DB/QT
690,226,059 *4740D2125FE5962B37665ECC29AAED5C70C53FAF ddht
690,226,060 *47441F784C2265901290C82965F7EF05937413F0 DEAN.WATERFALL
690,226,061 *4740544BC275C8C05E4DED21B3B4B3D9CDF3A22C debiting
690,226,062 *4743DDBFBFD94CF270891BA23A1811C30664E4C2 DEELNEMERE1
690,226,063 *474D53D59297E73973E0A1C803BAAE4D7D61D0D0 DELETIONSPOCK
690,226,064 *474FB899A243CF8FAEDE759AB110E35A5152C094 delphite8
690,226,065 *47424D8A2CB8EB8112661988561228F3C9AC0A43 DELUX10
690,226,066 *47463578856761B81F203E2B057B1D9AFD2C3CF5 [email protected]
690,226,067 *47429D34C10B6809689FC43725F3172F754CA8F8 dendrotrichia
690,226,068 *474A1154783CB58B1864F673EFEBFF2C16376D13 DEREK.BARANOVIC
690,226,069 *474A2019BA622599EF8241E268CF0965BDABB1EF DEREON553
690,226,070 *474A3F9D14FF7CC3BB2B1CD60B01923DB2B11EC2 deweycolchado
690,226,071 *474660A57EE201B1DA701D3468BE72A708EFC954 dgbmw
690,226,072 *474C1E779EF841EF5245452BC94627378DA0A0E3 DHNRQ
690,226,073 *4741710C9FEFAFCE9AF33B4ED5578E11C3C64B93 djnl
690,226,074 *4740B02D3ABB19B0227F95CBBB63153666142273 DLOTREB4
690,226,075 *474F7AD34F73CA430EFAF7444CC5C47C66564056 dmk!8
690,226,076 *4746F22C79CE0CEA38C0D7CED4D57D320E9D8082 d=mm?
690,226,077 *47498017217A3BADCD819B29A3611521FE3EEAF9 Do9_
690,226,078 *4747B4964EC61124E646264AA60E4720F6FFB46F doti+
690,226,079 *47431A05674B9888222327F8818C93316F004B51 DQDUU
690,226,080 *4745FBFF0971E61DD8CF47FF34CB31A8E8841D26 dt80"
690,226,081 *4743B856885FDC60B119EB1977F6781C92C74330 DTPH;
690,226,082 *474A76B06CEDD8E3360624695B3E41B25A649EB6 D,ZTN
690,226,083 *474562BC0C2424B595C6AC760322F469E09D2D2D EAAM"
690,226,084 *4745A47951BF937C3F6347796E9619C7FB64D9D6 EASE FOR ME
690,226,085 *4744CB4BC2BE7E864B371C70BCAACDF18CB30D83 EB33KHV
690,226,086 *4741C7F96FD5A6E48F4B53AD2D3562F4DF4E40F5 EDISON.CHARI
690,226,087 *4749E8CD2B368C55188F3281E0181E48356CA3C8 EDWARD.LIGGINS
690,226,088 *47459C34A4559DD044B2037E3E1B0DBB601AEE41 EEENICE96
690,226,089 *4745E5A0C09CD3EF3FBB0CEDDA8E76BBD94FA3FC EEF232B5373E3490894B7B2DF4F246A1
690,226,090 *4747058D3A1198030F59226B4E47AFD6759B5615 eflorescenţele
690,226,091 *474CEFBDB4BD44AC9AC6268D8FBC12BBE29C4734 eipgi
690,226,092 *474A9ACD261272704EB90192C0DDC9F684376F14 ejendomsafstelsens
690,226,093 *4747CF2DCC3312D09BBEA65508BAC5761FD9A588 ekdwsanta9
690,226,094 *4743F66A417B28044D2B46A03A6E29046C794A3F EL-DIARIO-DE-LA-MAMA-(FEAT-BUDA)
690,226,095 *474762FA729140DDBE48B91BBD6CBF5ED81C1294 ELIASKIND
690,226,096 *4740D21F41888AB822D6C53EE05C46F2D5DC3C82 ELMOANTONAKOS
690,226,097 *47410B8EAE088DCFFC0F3990C0AECF515AA8BBE1 [email protected]
690,226,098 *4747444BE502324B52813CE230EC25F4F92C4CF8 EMBOWELS1
690,226,099 *4740241A5C693413A803DAB5962E38CBB3580CB9 ENEMRADN4
690,226,100 *474A635735C00CEADD03EF7FEFF2948C7180497F enigma8c
690,226,101 *474A1DEDB97845A7E5A520D08972EAC31B5301AD ENONGNAPAT
690,226,102 *474FA89AF89ACE25D48896C7DF621434BCA4E989 EOSPINIDAE
690,226,103 *47404B8E8384E54F4BC67D3DDBC8B97F1F47B99B erasmomcalpine
690,226,104 *474AA084BF54C96039095DFD9A007D953FF8B6B3 ERIK.VERSAGE
690,226,105 *474455F8FD0B6496D21EC0C72EBEF034119D2BE3 erniehucks
690,226,106 *474610884ED9AF93E4F7386FE660810DB609C09A ERVINKAPINOS
690,226,107 *4741176559A621735D8345303E06374CB764984C erwinbelvin
690,226,108 *474FD95DF9278AEC7466622829C8BFC6A597759E esgotei
690,226,109 *474EB35355A12DA62808ED7E33FC6BE8ECFA298D estebansharar
690,226,110 *474EF2D9CAC2C1044AF643C214EEDBEEB6798350 [email protected]
690,226,111 *474B1CC421138F53AEC1E0A293B28010DD9667EB EUA(
690,226,112 *4749F9F01880F66FB17D932167F7A27E425F8D99 EVERETTEGOOS
690,226,113 *47460813A36FD9431EC2B3045BC063F72D41D2D5 Everthing-I-Have-Is-Yours
690,226,114 *474590A143E1EF5D25550047705E583A277DCE0F EVRIBADI.DENS.NAU
690,226,115 *474AA05485BB4F9CAEC0D1A15B95EBD73867F8E6 EXAMPLECANON
690,226,116 *4747DCC3D2BF914E485CA808804025B5D9A4FCE6 EXOSPHERICDUST
690,226,117 *474A49BF85652E1124983196A5DBD5F1F4186CD3 EXTRA-RECORD
690,226,118 *474C2D44554BAEB4A487CDC14754F4E6B260D31B f1o553d
690,226,119 *4745AD515683A7957C82015A67A65CA8A4DF841C FAITH.TIAMUTTALK
690,226,120 *474E3182BC3CE8423A0BC1714BA73BCB9CF0B352 FAREZ-BRAHMIA
690,226,121 *4744898ABBFB6E6CE44DC6F10898FE5AE0789568 fastminuteit
690,226,122 *4740AFA5BE7232EDF0E9689DAB7FAE1E8DBEDDC6 FIRMENDETAILS
690,226,123 *4745C9EC8014A6432863399A5A1BE2DEFE19B19B floydkirby
690,226,124 *474BCBD222403959DCDA03A5027072F93A7784AC FORMLTSMALLGTLTBRGT
690,226,125 *47422E043179355529D2A47025E5B77EE9E8D428 franklynmansukhani
690,226,126 *47442E1837326E547245DC8C2E89B9FCD314E8FA frikjent3
690,226,127 *4747D943D087D28BF349C280CBFFB0D1E2240BE3 fsckmkfs
690,226,128 *4746BCA09A7AB5EE12B9E3F931F93E86B4642409 [email protected]
690,226,129 *474C76CB40396BA8255C312ECD30498188D29596 funny-dolls
690,226,130 *47476BF6B8FF3F6D69045099EE889A5B7C71B12E [email protected]
690,226,131 *474977DB98164536FDB812718E7582D5B4ED777A G396O75U
690,226,132 *4748102D5B442C2DB9234163ED0C4C1AD8BD8A4B gastonguttery
690,226,133 *4748C82B3ED16416BAFFD730DDCBAA620F9B82D0 GAVIN.WENSKOSKI
690,226,134 *474322EF0CDAC14681C6E4F070B875048E9C3547 GAYLORD.CRYAR
690,226,135 *474505631968660E5883929EEDDF74FCCAA4C991 GCUDDLETIME
690,226,136 *47445B68A2F7037FB99A811E67203AB9396E5F55 gd7i
690,226,137 *474E2621C73FC8C50CC68F53D7654E1E442FC534 GEMUESEN
690,226,138 *474DD1AA3D68B771FDCDCC78572FE646FF067036 GENEVIEVEHOPPE
690,226,139 *4744A317B79C1FD75DFFEF82EE8947218DC53748 geoffreyviscarra
690,226,140 *474A5BA532C48B28464F1BDBF55E04723B83F9D0 GERALDKREJCIK
690,226,141 *474983A777F03F5BF07D6D19DA3568CD166D277D GERALDPOUGE
690,226,142 *4741BD9122974DE69A541E9EF85AB1A2D6267E17 geraldwyatt
690,226,143 *47444C99DC71AB37435C0F8B2BF5EB80648F93E5 GERMANREVELO
690,226,144 *4747317CE36D6E7FEBF9CB155A022F0D5A02965D getevens
690,226,145 *47473297EB2EB6C8982235DDD5528DCFCD186E9E [email protected]
690,226,146 *4744DA8CD1C78949563F493B5448945A1D190EBF GLADYSRIGBY
690,226,147 *474BEB892C8A0BC7969E11F9BCA50288D7995D1D glicidol
690,226,148 *474585D0F5B92850564F42D0A0565E1FA57CB4FA GONZALODUNAKIN
690,226,149 *4747B480569693FDBDFDE932973EAF1212991318 Gotta.Have.a.Reason
690,226,150 *47487F0961D2452A75BB42B65C086282284B8092 GREG.CHEAM
690,226,151 *474B9EE24B0F0799E0FF91584C0A6F2E5C41B40D GRIJPACH7
690,226,152 *474EEEB7114C8BA2BBAAA328DA43514F5769733E grumpily
690,226,153 *474AC13390F07B8BB71D8B75EFE626EA36E8BB10 haider.bhutta
690,226,154 *474FF2DCC58EA0B34D1889C869E552D645CD2374 [email protected]
690,226,155 *4741ED9BD7CDEBFC9605FB5CFF33EDB1EE8D29D5 HANKPOTTEIGER
690,226,156 *47485CBADDFAA5146914BFABDF7402709174A58E HAROLD.ABSHER
690,226,157 *474EDCA0B3F91CA0E83F217C34B425941DC061A9 HAROLDSEIGWORTH
690,226,158 *474E90543E56F4756597E3AF9388BB68CB45199E hast.du.tr
690,226,159 *474F1072E2A5BF1257636A2B828F67288D468AB8 HEATH.BLORE
690,226,160 *474945C977A21F10ADE0681E7EB18E0C9710395D HEAVENLYACTION(HOLGERHILLERREMIX)
690,226,161 *4749701A7E4AF6D8BB1F797768D3C08033350684 heribertopalacios
690,226,162 *474A5D7FD0904E5FBD30389950126BE347892D96 [email protected]
690,226,163 *474CBAB7485CADE5E57AF6398FEBC18939F7CA1D [email protected]
690,226,164 *4741EB165ADBEB0FA61E17AD8CE17B114BE9FB66 HINDRANARSÖMU
690,226,165 *474284A11616D9D6E60D3E8B893C821BADC85F1E honour.and.glory.(d)
690,226,166 *474E6D117BFF15559A57486EA45088C6E87BDE3C HOSEABEE
690,226,167 *474E6B1E718999B68172C80484E91A17EA16FFD7 HOWARDRASINSKI
690,226,168 *47403BB96CEFCE89A9B0933592B7CC534682F7ED hsodalimefeldspar
690,226,169 *4745A537AD321B7CF272206B912AF8513DF76456 [email protected]
690,226,170 *4745154D02DD54942923743F6FF107A5AD177663 [email protected]
690,226,171 *474EF823F980F83087256D311F1C1427B55CCC94 [email protected]
690,226,172 *4747CE28DA62B34879A4D1DF60E232EF05D598B2 i-carve-your-name-into-my-arms
690,226,173 *47434EFB148D7402DD74237E88227944CF33CE9E ich.steh.auf.kriegsfu
690,226,174 *474E792949765DB5C3B3C37DC7993E8AA439FCF3 IKI)
690,226,175 *474A9697C23FFFBC88FC7840E39C720F9F1EF900 ILOVESASSY85
690,226,176 *4743BE64608E5AA43B7B5AC10BDA36041EDC5A0D ILOVESTAN10
690,226,177 *4743F52139204CEA9706D9AE641B1D0D7DBD5EF9 iluvalison93
690,226,178 *4747AEE1AA477FAE37DE3198E26C40605F4455F3 INCCOURT6
690,226,179 *47448110C6962C08F41B42742997014EA6092728 indignation
690,226,180 *47481B91F9F5A179D8D905310BF4150E0F71B249 INTERNERE0
690,226,181 *4745FCCEF580EE4800DD6102ECCA5B30FDB469FF IRAIENT1
690,226,182 *474551231C34F95CE8AE5913827701C4C100D98C JAMAALLONGWAY
690,226,183 *474C097961BB5E997E20458518D2155E1ABDC1C5 JAMAR.KRASINSKI
690,226,184 *47455A33F7F020143723EA37FF6466DDF451B918 james-brilliant
690,226,185 *47411A27D79782E0203DBAFD4FAAE6EA05E1A241 JAMESCAMINITI
690,226,186 *47447280B13C902B961E1D8C1E417A52257BD187 JANA.ANDERS
690,226,187 *4743BE37F7CC0C764929C8644160319AA136A9FC [email protected]
690,226,188 *474906567869D53AF825F4F56F2589A3EC7A3006 JANET.TILLER
690,226,189 *4743DED7DD2927A810C3C7F837DCBF51B5F41D63 JANICE OPENA
690,226,190 *474A217917A90D5E3B8B13F7DAC704A0D7457A68 JARATILDI
690,226,191 *47495F3179475211C48BC1601560D0132349CE56 JAREDIGLEHART
690,226,192 *474676F0161F971F7EB49D8CAC682FE79EB38F78 jarodpursley
690,226,193 *474B259FDF0CBC4EC3E33049B845BD27F2BB638E jaxcityflag
690,226,194 *4745DE619E9FC0070A238FDF61B661DB508DFD07 JAYMICHALAK
690,226,195 *4748C854E810A8C34265A9899A23677E0AF99156 JEFFREY LIM
690,226,196 *474627731C49E5E0ED96336EEB6F3BC5FDB388F4 JERRELL.BANKERT
690,226,197 *4744E501561ACA87FCE7AE3EFFD33424DB2B0E0E [email protected]
690,226,198 *474E1E77677A354EEDD434E1183BC0D4A7AE05B1 jim.aguilera
690,226,199 *474B4F79D39B2F1F7C31102495DA0849CCEFAC42 [email protected]
690,226,200 *474B637171DD8DF2B1998C1320652058DEB1A0FB joanne.alfano
690,226,201 *4743B28CD6688510B143728449FF625F6AC48D91 JOCELYNN-MAY
690,226,202 *474CE49313A04A76C256CDAF73DD04BA7C9A2F95 JOESPH.BIBY
690,226,203 *47443FFE9821D519A78AFE1AFC47B60FCBC2F15E [email protected]
690,226,204 *474B021EE608149BFEA4B332E8264FF96F134FEC johnpierron
690,226,205 *4745D0011A2CAE65892A1FBC7E4967A5DDC77F6F JSTOYIANNOS
690,226,206 *4742D9886DA30079CBF3B2B36C45757FCC49D9E8 [email protected]
690,226,207 *474F39DE66929BFEA3FB133D0DEAE62DA83DEFA3 ju:-
690,226,208 *474C502214219DF13982E540A4FE7B31EAEB360C judedaubenspeck
690,226,209 *4742F395DF368CD1EA45DC9EC8BF7D97251D2941 JUDE.KEACH
690,226,210 *474C2E87718F851F7EFA9AD7CC1870322DC84DCD juergenadler
690,226,211 *474E2F65BC72024888CE4B8485FB5434CC870EAA JULES.VILLAO
690,226,212 *4749D3FB20C9A7E3BDF25B7DB53DD3A554A629BD JUNIOR.REZA
690,226,213 *4742169896A10E6491E54FC8E702EE53A5387D10 jyrist{m{{n
690,226,214 *474A69D700EFAE0BD6BBC3B25832CA31991998F1 [email protected]
690,226,215 *474A17EFC07857A70F06AF66CB2298413E85294A KAMPYLH5
690,226,216 *4747C98887BBC444756C59764364DB5946942367 [email protected]
690,226,217 *474F1CFCB06646DE5A7CD5D7456D4BA1FE3475EC [email protected]
690,226,218 *474412BCFC3A8934973CFFB20557A2E80EEB1894 KATIELAAKSONEN
690,226,219 *474347482E314F0F97585097D747CCA2256D1DF7 [email protected]
690,226,220 *474F474F6C606CAAA9074E7515FF27612B5FB4D4 KAZHMIRS
690,226,221 *474AAB58BB350A6AF5B24DC8662BAE68DD82C9FC KEITHDERINGTON
690,226,222 *474278C5FD0F60E012F8FB29BD12C3C2C0E37C0A KENDRICK.TAFFE
690,226,223 *474DF65EA18CCC5942C746EC17C8C86BC8485508 kenley241
690,226,224 *4749B38B33FFC384A0EA875F328929DCFF6AF61A KEVERTJE1973
690,226,225 *4740737CDB506030285C76E77FCEB8816CA0C3B9 kevin-driessen
690,226,226 *474CF62B3C67B8CC97FBA7F81C1F6BCCCDEA9373 KIM.NAKANO
690,226,227 *47473054CE763A7BBB1C989276AC158BF79D91BF kirsten-taylor-thomas
690,226,228 *474F684E1769E8EB226C1C711E490C4AD4AD28CA kki661
690,226,229 *474124D352295D54AB72080232350B44720CAE84 kontorloesninger9
690,226,230 *4741A3F24BA721220582F0E43E8F83730D606B17 körülzárás
690,226,231 *474F5ADE8A2DA9B9C203AF3219FBCACCFEAAB24C KRISTOPHER.BRASBY
690,226,232 *4748BD8C83138A32F75EDA8110BDCEB9DEDC2DF9 KRIS.TRUEHART
690,226,233 *47422A066869B0994067CE9B844A1ED9A328F6BE KUR0H4R45T34U4
690,226,234 *474E8A79B2156C0BCB9AF0F0B91A15DD589BEBFB [email protected]
690,226,235 *474FFE0681E632510DFAB0B27ED90DE09A84F827 KX3IBKD96AK0
690,226,236 *474CEB4422370428BDE49981DDBD9B08C43394DC kyleglymph
690,226,237 *4744C1BB352212CE41A75E5F08634E8151030D41 kylemarcell
690,226,238 *4748C9140DBB2DE2F19D4A2C1490CE8EAFA8F42B KYLE THOMAS JUDD
690,226,239 *47488E3DE019D8797B59CAA2DD3792A5C6218441 [email protected]
690,226,240 *47495F2211F2CA8E5B6BD4673D737622302874F9 LAB DOWN UNDER
690,226,241 *4747C641F5F89C27DA895387C9B7C2A797DDCA12 LABLACKEN
690,226,242 *47442CDFED02FE31A93E52FC0D81BB302842F932 LANDESZAHLAMTSKONTROLLEUR
690,226,243 *4742600D688C67B1247020D439CE2D9618468DE0 LARITZAHERNANDEZ
690,226,244 *474B5288228EADA15FB3287000F6DEA06C719A49 la.tarde
690,226,245 *4743491587AC099F5CEE5667A7451A66028BB838 LAURA-LOUISE-ANDREWS
690,226,246 *474F2957769BD977347EC8F65C9B96769DB6B24D laurie-poole
690,226,247 *474E83AA9CCF689248ECDBCB8B06F16448E9B5E6 L’AUTOGESTIONE
690,226,248 *4743572C66F5502292F032E4FDB4E8A596B6764C LAWERENCEGADWAY
690,226,249 *4740AF74167F3679F5C7BDC82E719E393A972BF1 LEADWORK7
690,226,250 *4745A3F717AC1F87248DE5E10B73AE1391B4417D leisurewear6
690,226,251 *47416691ACE5F20B92044ED619A6BF5C9922F393 leviuhas
690,226,252 *474FDD140BCAB499ED4E7DD45098A235C96B93AE LHHM
690,226,253 *474DF52385807D419C721F04DD13504F2218D089 lizzard</td></tr
690,226,254 *474E4C5BEFEB1DCD12E8A188B34EB371682C1F26 L[=O
690,226,255 *47411B19D1D3EAD7EDED008CEE9FC45700DD0AAE lonnysabal
690,226,256 *47420FDBCEF4F7CCCA2AED0D1AB19E448FAE384A LORENZOBASCOMBE
690,226,257 *47468DC80E4703F450FF0A1F26F82382401931DF LOW-'''''CURRENT
690,226,258 *474D59A2D7E27E550EE42570A07D7B492B3D3D4F [email protected]
690,226,259 *4742392368978A78AD6A57F5DBBBF4644230A3E2 lydian4
690,226,260 *474C81AB5C68F693C0FC1B65F43375751003CFC2 [email protected]
690,226,261 *474485E29F5920C3CC5271828FBBF03D0D40E3EB [email protected]
690,226,262 *4745F1E913972940AD6D57A1767E9F02386F0F5F M310DR4M4T1C411Y
690,226,263 *474CB306EF60D535A42E54B93EC5D99D4BACD6D4 MAHMOOD.SHAIK
690,226,264 *4746738983BD5D6145E5875453AF30210AA01BF4 malam-4-0
690,226,265 *47417336AB58031A3D9A2437440CC42978D00717 MANLIKA SUNTHORNPRAVES
690,226,266 *474B6B1DCA436C3979B5577129B68F695853EBCE MÄNTYRANTĘ
690,226,267 *474A521E6EA57EB0BF2FE9633B2562ED73A7749C marblehard.'m/a/rb/@/l_h/a/rd
690,226,268 *474220FB42543893A35DB7B9AB6C15BDB7EF4E1B MARCO1967
690,226,269 *474ECCFD4E39A2E8AA3B12E84C262F47B91EBE71 MARCUSMANRIQUEZ
690,226,270 *474370DCB9D4BAF58918A72CD1949278475D5F96 MARIANNA826
690,226,271 *47499EE84902B79C14600F422FD30BD7369B31FF MARRISOLS
690,226,272 *474827E2BF57D1526F4E1A09E5DDD587A95E827D MARYHAKES
690,226,273 *474755C22E9E1B2876A7F2A74CE3E35E3F4050F4 MASCARIING
690,226,274 *474F0E90368D8494A972E725682A487E7F3EFD35 mason41306
690,226,275 *474670E09A0BAD0B691CF4C986C1F56A9CF63B26 [email protected]
690,226,276 *4740AF53F80BA5936148C61FA59CF2F1824E6931 MAURICIOPROWELL
690,226,277 *474C7A5E954EDB6DB7FD988C210FBD285876888E [email protected]
690,226,278 *4743B3C186C132263C26CABCE606395F15E8E2B5 MBOGUSAT
690,226,279 *4749F1FF1540DF5D9E26C13078B168412D4BA70E MC[email protected]
690,226,280 *4741210BE425DA3723A1AA928E375F9A6695F786 meadorn5
690,226,281 *4741D5501350A24BB2D4ABCD1EA9330C003DB29B meedogender9
690,226,282 *4749EB86E56F5B3D3C2725F0B8276689F7ADF781 MICHAEL-ASHAMALLA
690,226,283 *4745C99841B7B65E6B29B4A0AC7F98F2DD97994F MICHAEL.MIOTKE
690,226,284 *474EFE0CB8EC100CF67D8DE336C6160438326A61 MICHALE.MARREN
690,226,285 *474330B83EDCD5144A25FACB037B002DF7E897C7 MICHALESTRUTYNSKI
690,226,286 *474485BBBA3B279FB4B815E6566C297DE0EC1232 michalgaulding
690,226,287 *47464F465749B1F955F2638F9FBE886CAC3BC269 MICKEY.ISACSON
690,226,288 *47483D7FA712B67E6DE12527E64C0600FF88861F mic-line-(radio)
690,226,289 *474A10F75884874702CA8A517D437DEE7116DA22 misheal2
690,226,290 *4745993094FEEFD6C6ACD99CC1465244F286EFED MODERATELYUSED
690,226,291 *4743F98EC6FB3316526D27978B7E3B507BF9488B MOHIT-BISHNOI
690,226,292 *474FF060D005FBF98823DBFBD6FC0CF806560EF7 MOMENTARYENCOUNTERINMID-NOVEMBER,MS.LEWINSKYDIDNOTMEET
690,226,293 *474DA60705199888DE5C55909337C0D23C43E095 MORRIS.VANOSDOL
690,226,294 *474F6A2C87EC5233B2E994614AB9EF1C52C6DD76 MORTALISSIMO
690,226,295 *474B14BEF354A797949F6EC9E4FB0A62804CD506 MOSESOGAH
690,226,296 *474B310EB31E0A159ECFBE449351EBC8F7128BA0 MOUCATELS
690,226,297 *47486FED1B002E699D9CFF6104525B6EA68F63AC mountain
690,226,298 *474537DF033D54362E9F14279D2E4CF57323BF08 MULTICULTURALIZAÇÃO
690,226,299 *4743F8CAC7C73197BC4537DFC8951A870CEE8703 MURILO AZEVEDO
690,226,300 *4743B13280627E1940B39B4BF5888D8AC29A924C MUROVANOKURYLOVETSKYI
690,226,301 *474EF8374848B4F341ED421369F1006CF6361FC9 MYBLOOD52
690,226,302 *474B8DB26BBD8D232CED30BC97098FD33BA6E938 mylesgehman
690,226,303 *4740A87BE8935E719EA55DAB7FEB59E193906F73 MYSNAKES65
690,226,304 *47488707FEA2F06FCBCB5DA8586EFF67B3A3F02C [email protected]
690,226,305 *47415CF98E60B6637D9A23662B91BC691E88A753 NANCY-LEIDELMEIJER
690,226,306 *47458E8AFE7FA408BB1E703CD39665F7E0B5B23F naomi.harry
690,226,307 *47481D59B7D418D2738649FA93C316E59BC92465 NATHANIELBREASHEARS
690,226,308 *47436B7D1AACE74341366CAA2DEAC29D7747CBD4 NAVEED
690,226,309 *47426C17C4262810A9270CA89A435BDEC28EECFE nickyauch
690,226,310 *4741D72843072AF96FFDC9E6D4D691123C372FE4 NIEKOMERYCJNYCH
690,226,311 *47423961AF2B24D7479040A0184D2359EFD1044D NILEKANISIRSI
690,226,312 *47450DC5B4C8D4977973963774363C020CEDA63E NISSILA1
690,226,313 *474DACF0FA0E799D461076EFAC5B1312ED1FE6DB non pros
690,226,314 *47447657DE1794E91009BF6BEEA09FC4929DB212 normandrohrer
690,226,315 *47400730FCCA3BFC9B2F7821879509F8C973832A NUBIUMNED
690,226,316 *4743328204DE7749E73749FFA9C1C52253C03EE4 ;^n]ul
690,226,317 *4747830BA78FEB0FDA91BA425CB367EC775945CE O10000099980
690,226,318 *4749B87DE75CA964A319CB709A984482C39E56B1 O8)
690,226,319 *4749A63C57709A06A12A580DE525D8C1A60359DB ODESL
690,226,320 *474738DA78E33A228E02DCF1ABD3EDB73FAC8671 OLIVER.SKIBICKI
690,226,321 *474607714298C7BDBCF856F4CD431E4EF150573E ONE FOR MY BABY (AND ONE FOR THE ROAD)
690,226,322 *474FF08473FE3E759842CF0023A5EFAEA176453D opslu
690,226,323 *4746810D702898013EBF00BF8FB58C699BAEF6C4 OTHA.PACHELO
690,226,324 *474F6DCF364311ED28F7A7B85A289A26AF10001A otra-vez-m
690,226,325 *474C4FFE5347B72AA3371A8B260179D87C98559D OTTOAUSBURN
690,226,326 *474A411FF7B7EB15DC8CE53ED538195C6D904BD3 OUTJET
690,226,327 *474BD8757517B558D965B24E9A4E38C3BEE299C2 p==)~-`-(>_0)
690,226,328 *474A95655C29BB795CA3F97631D909AC55937965 p####>***(_0)
690,226,329 *474EE7A5B94A30E5A2662A66A8592F0118B59114 p3rph3r41$
690,226,330 *47412CC778C1F2816F1A1A1F2A64FF1D0D40C2A5 passworpublic
690,226,331 *474A25DD49931F9AADA8391D7F6CEA5B744FE64A PAWICHSINEE
690,226,332 *474A02758D11C87F914E3BD5896E21CD76ECE7E0 P--D~ ~>-<
690,226,333 *474E57CFE2264032FFB643BD32D0C32A05E03EE8 petemcguigan
690,226,334 *474B17331C7C8C3775E3484A7C200C5727B432B3 PISè
690,226,335 *474C3A7192B914F297EBA3404D500C0463039DDB POIDRAS5
690,226,336 *4740218A25398259CD7FB01C16352ECC522BBCF1 PONT34RS3I4M
690,226,337 *474F570D5196FD5D9D55BD08BAC7C0979DFC0759 P###)-~O~O-SPLOIT
690,226,338 *4742508736528E10A13A97B18A72CF3D04C08AC3 POTPOURRISELE
690,226,339 *474B4404A0259DF92631522ECEC32F83E3E9E11C prisc
690,226,340 *4747272ED4C794D6F005A1988591D9D27323A5CE PROFOEHR
690,226,341 *4743CF9FABD8F39E7789A35CB6C51EBBF1125688 puistjes2
690,226,342 *4742F414187900668821CFBDDA143378CA759E5B pullingthechristmaspigbythewrongpairofears
690,226,343 *474020051628432C1D5AAD0CECAD8CBB6F11E1BE PURIVAT1
690,226,344 *474B83459537910A459A11B0F7D9578041E77AF5 Q====B~O}O{
690,226,345 *4748E5B11D88C6668C83924419A4FA80758DABA7 [email protected]
690,226,346 *474808ACD236DFA3F92286214CC58DEBFFF83AF9 q=====>.~osplat
690,226,347 *474ADE0A8565A76E1C2ADAE7594070C68512FD43 q##p~.~.~Splat
690,226,348 *474130A6333B9682994E4ED4086D2407781A481E [email protected]
690,226,349 *474AB88DC7A3A0F6EAC396A67814D96CE0FB739F qua
690,226,350 *474FFE04AC5A39CE9300B02FCA8CE722E714480D QUEENS KING
690,226,351 *474429B28BE3258ADDA699F7C8E11E3ED4F34D60 QUEIXAIS1
690,226,352 *474DC75F99B225A3EFEE04E68AA4AE889F6847A1 %r0
690,226,353 *4741FDD58E4A2A2BB39DC66C3BA220FA2A2DAC55 randombrainwave
690,226,354 *474B307FB56EAC80A1F9C2A131CB8076AD4EEC52 REBIOCIDS4
690,226,355 *4745D6E6982993FD6F7A5A6EA2DA4B8395E9EDB9 Red-alert-(remix)
690,226,356 *4742558D2815D8367B2235C2001345DD7C2BFB72 REDNICELLEB
690,226,357 *4743F3C2C886D9A16AE1155CE61BAF25524D868B RELAGERARBETARES4
690,226,358 *4741924DDC0CE26D96545F90D5DAADDD257D2BB8 REMINISCE2003(FEAT.PETEROCK,CLSMOOTH&JOURNALIST)
690,226,359 *474131055F0E2F0262DE4929D2A9614DB42B1B1E RESBELU
690,226,360 *474C9D37FD64C9BAAA071273EC19BF011D43EECD resolutions-'08
690,226,361 *47437DE4EEB0B330A56DAF629E196B280D349EC4 RFLUFFY4
690,226,362 *474BE9C60E47904F828E5484C568D7929497379A RHAPSODYNO1,2FRISS(ALLEGRO)
690,226,363 *474D71FA23ACDEAD64C0352A95C38873E659FEA3 RIANTEC
690,226,364 *474BF279311091D9382714BFDBF736FA61E93B15 [email protected],
690,226,365 *474F95E6014355AD489F42EE06881D1303251BB5 ROBT.BODDY
690,226,366 *474F877E20A8A827462B0C1099320D6DDD00E597 RODGERSBLAHO
690,226,367 *47413AF6E0815B12E37AF1D4F059440D5B68B0DF RODNEY.CUTRERA
690,226,368 *47401138E112A539C462DFFC7F4D97552057327C roedhunt:suzanne
690,226,369 *474E1535961CF70278E75CD3729F7C40044A67D8 ROMDIDAC1
690,226,370 *474DC006B73407A1DF8E45EF503628B03655FA8F RONNYCOMEAU
690,226,371 *47468F26C5F55565F09148D4E55A2E77F793FAC7 ROOSTERVIPER7
690,226,372 *4747B593DD07374FCC77E984970D91D2D1A8F45A RORYHILBRAND
690,226,373 *47462DDAE652E06A10A0AF95799BDA331A293682 ROSENDOWERNZ
690,226,374 *4740A333AD2603B71B81E075AE5E4F1D6407A04F ROSSBULLE
690,226,375 *47467A489593E03C2DFB1CE4F1424495AB295DAB rpanservogn
690,226,376 *4746943EFCF1814BD01BB88BEEE001D78BD08225 RSPCTBLNSSED
690,226,377 *4746A3AD4AF15491BD0A197E9AADF19A0DEA49B9 [email protected]@lst
690,226,378 *4741EBAF807B910A92F1BD28D5BF31B4E50B46F0 RYAN.TOBLER
690,226,379 *474F72996B91B947889AA8E331BCA26ED3EA008E SAMMEDINO
690,226,380 *474165907C62516E0E49F53C8C4E63452405B246 SAMPSONSHARON
690,226,381 *4747C75EB9D46861AC055BC0F99E32F61BE89CC5 SASKIAWILDCAT1
690,226,382 *4746A633742AC39BF3DB8CA1320B56C030DB5EDD SAYOKOU
690,226,383 *4749E1905305E03C21EA5BB76E20B22D174BF671 SCHICKSALSREICH
690,226,384 *47438191D55BD847694661961C1E44F8105C1D7B schuilt
690,226,385 *4748E9E6C3B7DA9BE306077AC4F776C00A7DBC97 Scooby
690,226,386 *4742655638D6B9CEB0F68262E9F4BDC69F639F56 sebastianulrick
690,226,387 *474D8A8226BB70110F26B9298B0AE777C615196C SEKURITY9
690,226,388 *474A1E3A07573EF8D17923017232D9844C206CDD SELFLESS
690,226,389 *47470E9643C716558911D8E944DE0DBB49C6496B SEXHUNTE3
690,226,390 *474D8D1E1A179091A152937341F29730647DADF5 SHANE.MCKELVIN
690,226,391 *47484A874FE3AA34E6BEB246684A354593452575 SHANSUL5
690,226,392 *474570086ABAC5C6EC0F8E2A540B08AF2E559978 SHERRYTIM0
690,226,393 *474508803D70E83E4877F35DC3FBE3A908D45F89 shilpa-kochhar
690,226,394 *47446D2FA6B7C8AEC379B4CCC391921652CA7211 [email protected]
690,226,395 *474DE217AD85C2938961A43F2F611C94994DBB90 SHIRLEYLUEHRING
690,226,396 *4744097BF9C448B4E7449ED61BD9943E29942E57 SHUNTWOUNDA4
690,226,397 *4743C1CD97592E3429CE901FB72F812B4C9EEEE1 SID.PFALZGRAF
690,226,398 *474EF0F8DBE6251EF74231E3AD386BEA19662C8E SIEWIJAYA
690,226,399 *47409397E094A3BBDEC6A4F7EF5A4E1B792721FD SILERUOS
690,226,400 *4746BD5FBB73839384EC2C86BFD08E0E1A085CC7 [email protected]
690,226,401 *4744C777CB47B514B4A54585BBE94AB90BE0A24E simbajoing
690,226,402 *47443980DFF067DE653E1E81766642E27C5F4909 SIPULSKI6
690,226,403 *4746AF09B1710A5DB2304EE002EFEDB33E3F4194 SL94538
690,226,404 *474F3AC9A129183CF1F595D6BA338CD5F0B3227E SMNZWRN
690,226,405 *474663FAC1E18AB381C58ECB16E86DE981E6A2A0 .snoitacilppa egelloc fo elip a setacidni ehs
690,226,406 *4745BDCFF970C623D20B7C780A1E272257E847E2 sobig(clubmix)
690,226,407 *474FC4AC54690EF332E104A74570031B22CF6DCC sonhalston
690,226,408 *474369A8C2965F07C2DB753381333FD69C1702AD soumyadeep.majumdar
690,226,409 *474CFDA66DC5B46293465F53DBB905DF5933975D SPEEDYCHANCE8
690,226,410 *4748AD3C83ADB273CEAEDEE1573A9772D9C1B71B spencerstasinos
690,226,411 *474E5E4C15F3F00AE97830B332A57583A2C7A749 SPLAT!! O~0~ D--B
690,226,412 *47486A567E6AC33C6AACCD907A1487253CAE56AC Splat O~ q####8
690,226,413 *4745DE908F1E3AA45FAB16D6A374CC058C220105 SRAPCBSW.
690,226,414 *4742307E35E8EC2E0A9C7A2F438F91E5C88FDE93 SS-(
690,226,415 *4744193F1D6363E2A4FA1F783359468A51E92168 stanhesselrode
690,226,416 *4744040084ECE3DA0211BAB259BD1737B8083F44 stantonfriedel
690,226,417 *47458A4A1D2F8B1A76CF9181520A5775465DBAC8 stefanslark
690,226,418 *47495FF346134ED0ABEE53FEF3888244EDB0BA75 STINGRAYGRACES
690,226,419 *474E23DDD19CB6E7A05C870795E7A630696E1E76 STRLINGSFARERNE1
690,226,420 *474EBDAC6741DEE7222E92A03690524C735AF30D SUBMYTILACEA'S
690,226,421 *47406499517AC34209CCC1D0282DF54FF45009FC sumpige4
690,226,422 *47403B8088110C7585A7E7B20E64C95B2E958912 SYLVESTER.RICKEY
690,226,423 *474BB671C919EED68629503B0015D6BFA1865F96 T78602
690,226,424 *4745E9F9940483BA129CC8A0FA378DE2A3B0B47C TAD.VONER
690,226,425 *474A26B93FB364A1F5D172EC9650FB22AFFB30A8 TALKYOCOLRABRI
690,226,426 *4746E35ED9FEE75E6065C817F9AD4F09F3CB0E50 TALKYOSSARIAN05
690,226,427 *474E203DA1693EA2D9247E26A043B92FE2BB06F9 TAMATI SO SO
690,226,428 *4743D4BF73E3E8F91B62E01929EC1E2C6F501066 TASSES5
690,226,429 *474484ACAC116AEABB937C9784B56A91F18C1C3E tenshukaku
690,226,430 *474F9EDC6C8718E370E0AA2EF655569D1270E757 TERATOMATOU$
690,226,431 *474C52E7CD0D9AF3C6DE322A0B53D14DD7F115F9 TERENCEAPPLEGATE
690,226,432 *4747C68A411FD99E869624E17DBC73988E1A434B TERESASOCCER
690,226,433 *4745C73B6714179AB754975CD2A07D0698C64DE6 texetàç
690,226,434 *4744DB8EB745B25BEE854C445FDCF2A23643F38A thanhscoggin
690,226,435 *47481DE9D00F6F9B7D69E586ADDEC51BABD9C1C2 THATBOGEY1998
690,226,436 *4741E49F93D1F2209F727C7025D672519AC76E8A THATROCKS
690,226,437 *474AA78419E67141968C238E0420AF348734D679 thejimbo72
690,226,438 *4745380316D251CA36F8F61DAACF7C343E42CF62 The Ultimate Sammy Davis Jr Collection
690,226,439 *4746D3D9F83C1C0367D31CBD3EA52BF473E581F0 THOMOND.BRIDGE.HORNPIPES
690,226,440 *474BB9ED1CFB4DE9A39673525A41A869FB688B9E [email protected]:TH240578
690,226,441 *47482C56DBF02130B9074D125B2397E3E3832EAF [email protected]
690,226,442 *474F06AF06E78B7E247ADC4B7479EDE8E15E539E tiill
690,226,443 *474506FA064DEF3C35EBF53A48E0B002FC0A5057 timisi
690,226,444 *47412BF051FA5BF6C27055285E59D7250DD721D1 tinktinktinktink
690,226,445 *474A6A7563E6EF29610B48D420F4AA4CCFB19250 TION IN OUR POSSESSION, MY CAL
690,226,446 *474DE7607DE413D1D09221573D9C40CE094F9881 TKHA
690,226,447 *474784B8E4BA108C68D570D42A3B2D556D45B922 TOCTRY
690,226,448 *474C6839B5D2D1506BC41DADCAB3CA37DA2F6753 [email protected]
690,226,449 *474E2CB48E6F58BB2CC40E7F305122F2C9E574B2 TONEY.CONTINENZA
690,226,450 *4745C2B53159ECC4937B7B34D3A97760ED868AF6 TORYDIMEGLIO
690,226,451 *474F41500AB008FF3CBEAEAAA8BE34A75F3B694C TRAINABILE7
690,226,452 *474F95542194346EF43BE9B8C5669A537EED23EF TRAPPER.STEINLE
690,226,453 *4744FFC118F0477E0CD98FBD97F41ADC4163FE3E travasiamo
690,226,454 *47493B31D4F75B08D11E877854A3FBE253FAB7FB TRICIAJANNAWAY
690,226,455 *4747183A7A49521721B12279A07DADD7923F6924 TROY-ANGELO-VELASCO
690,226,456 *474556A929508795374BFFFA86A3B4C455C12175 TSRHUREBS
690,226,457 *4741E0D4BDC360D9259EE830CF2257AE2A31B28D TTCRRO
690,226,458 *4740112AF8FD7EFFBD7616D72AD23C22BBE7BCAE TTEXITTTS
690,226,459 *4740B70F070868A9310E829322AB98EBA2D5BCCA TVILLINGEBRODERED
690,226,460 *474039D421F081941E23523CE5DC0E5C3D1CD1E2 [email protected]
690,226,461 *474DE8C3E8E88E1D4332A195182AC4B103EE6751 TW[=
690,226,462 *4745F65A2E6FA663E774266D367335FE1D1A0450 TWICEDIRECTED
690,226,463 *4746E69C7C957F83A230565D79AE1FA8620AA425 UCOOKINGANDFOOD
690,226,464 *474FAFAC8CA13D62ED4C2ABD314487F08214CF20 UGLY ME
690,226,465 *474F8FA7848EFB902BEE009053F011CFAF082B28 UNELUSORIES7
690,226,466 *4749A4D09679A19D28B9DF8E0EEA511756617507 UNIVOQUE!
690,226,467 *47480A19F1A0811E3603783814ED12B99041303D upanisha8
690,226,468 *474A940E3FC3BB4B3983AF720DDBEDAC4364BA88 V129745
690,226,469 *4749F52E1C2C9608DCEEB6CEEDEA85C3736AF2B9 vamsi-gudiputi
690,226,470 *4749383B24318B5E7A079979F1DF14F7D45078EA VB6G
690,226,471 *4745DCC8EC6D398DE66BCCAFAAEB79E638139C7A VDB
690,226,472 *47493B847B429F61CF4849E591DC28A50F37C035 VEEBIKONVERENTSID
690,226,473 *47405CEC5F6535156FD56857D3BAD84E69EFF0B4 VENERACIONKEMPIS
690,226,474 *47455D870D282A7B531B567250E5530A94174E03 vicentehabina
690,226,475 *4748EB5265D29EDE5FC84FB603EC4165D2C71681 viclatinopresentsultramix
690,226,476 *4744A86700D6CE0D51C74D0A7D3F6142375018AC vihertk6
690,226,477 *474CACD60BBB7758397353ABC1F9F99C6B5F0711 VISTIFRÆÐI
690,226,478 *474B731F9FE5B9971EA4003B4849865F06540672 vjiiukqp
690,226,479 *474450A8BC5AAE4E7FCF86A39D311D67C1267310 VUXG
690,226,480 *474F02B7AF7BDA6D0E24D64FD723344FFAAC24E7 vvn'
690,226,481 *47418D4C40779857C34AF95A14E7FF8632037AD8 W139759
690,226,482 *474BB1C60CBA9309C921525549B3469421FB1C6C W4T3RNYMP
690,226,483 *47470E7AF0FF1C1C9416ABEC49B018DE8658EDCD WADEPAOLUCCI
690,226,484 *474C0BAF7ACDC346C55BE7CEE20D2A7FECA35CE7 WALKJAYWALKER3
690,226,485 *4742C59BE7008A33EE0C9D2945AF2FF5D96120C3 waltz no.1 in e flat op. 18
690,226,486 *474C65634FE6289D91BC5CD7F7C9EBAAA9666C4B WATHIKALAMI
690,226,487 *47421FAEB548FBCED6C878E117366BD5C2940908 WEEPER?
690,226,488 *474D219180560B09F84923C393695200B961CA27 [email protected]
690,226,489 *47433E60D1295688205CC7134F7A0509BA91FA7C WESLEYG0
690,226,490 *47489ADBEA4D75E31CCBC126A0D15ADA65334881 wesley.soens
690,226,491 *4749F385599F68885B6585C650BFF92DDF2DEE8D WILBER.PEREDO
690,226,492 *474B8F396F5F15BD816C8266A9986AE9D8B68F2B WILL.ORDUNO
690,226,493 *4745FF6EDD01702D82FE7DCDF03F82ACBBB8E570 WILMAWHISENANT
690,226,494 *474DCAD621D1E6FF2C9CFF5D11A60B574E766E43 WILTON.MIDDENTS
690,226,495 *474E3D2A8AF77E9F5ECC753F2ABEBF79876FD69B [email protected]
690,226,496 *474EE6A51CE5C8642D7B7A35A2269EDEDD795865 WIRRALN4
690,226,497 *474A1EF6B5B0E17571FACE17A08072163015D18C wkucxkmzevowets
690,226,498 *474895302C5A1191BF16E0D8E270ABBABBF87992 WOHNBEBA5
690,226,499 *47412D276667A043F39738C96DFB50321A093B93 WSFINISH
690,226,500 *4744F660B5683771CD27DFA65E64727D0C1CBE87 [email protected]
690,226,501 *474DD2138FA450C28E38E7B6AC5DB50E955B9223 [email protected]
690,226,502 *474C78B5802C6E3E71DF6353780CC023AE23DC35 X530712
690,226,503 *474F4127D18ED7F7879BDA231A8830A3EE4F4F4E (x)~~~<B
690,226,504 *4740BF048CC0FF8421C3D5C15212456AD9968728 [email protected]
690,226,505 *4743815CF59A452137C9C87775CD397081CCB06D YAHYA-NATSIR
690,226,506 *474B15A146324A4FE2140944D8AEB15DD46E3EF7 yara.farouk
690,226,507 *47439DF94D00CB20CCE8432D0F748860B071C857 yashwant.londhe
690,226,508 *474BFE4941E895B39616CE2B6E7F93EEA1ECFD2D yealim.ha
690,226,509 *474B88377F0380059D88C2A5316D4970794586AB yelegoving
690,226,510 *474DB26DF689B000FE8CB345DCEF33FCD4CA725E [email protected]
690,226,511 *4744E4C5673B50900BBA71DB4646BA3AF67C7B3F [email protected]
690,226,512 *4743392E815F134DB2B78CE4446E2EB61DDDBAD9 YIOTA KAR
690,226,513 *47434E72D8C4760D0A5CE1161C75307358F3AF60 you'll-never-be-(rock-'n'-roll)
690,226,514 *474EAF8F91DF5A217D7C0381B5952A217855E217 your all dying
690,226,515 *4749E6BDF82D6DBD71342C0B59B02CE56E9B1F15 YW$L
690,226,516 *47450FB6461671769694C660BDDBE29EFA9E268E [email protected]
690,226,517 *47481CC46A5CA8D78E01E7717A015E303F85F37C Z3XUPAIIY
690,226,518 *4744EAE2904A180C0A4534DBECFCB3E4102B6FA9 ZABCDEFG8
690,226,519 *4749156F078997FEC2C5E114FEB0C5E1C0FB7196 zainah.satar
690,226,520 *4745BAC044BEDC551C566F05666E4B0A0E4D0CA4 ZHANGFENGWEN80
690,226,521 *4743B51EA1DD7A8E24DCEBF22AF1F113B030F002 zoocysti4
690,226,522 *47432E65BFE36181BF0054D25EE5E5F02FE6F9C5 ZUGEHORENED
690,226,523 *4749A182EBD31D5F2A5887B4CB659FE21607A0E2 ZUGESTAE1
690,226,524 *474F32D3701254D8E7A891875B4556840E2B318C zwiebelwurst
690,226,525 *474B5BF30A754B5BAF0E4979A5F2E7B7FB099BC2 θάνατοσ»
690,226,526 *4744BA83BDCAEF50BB1C877FB6133D7F922E16B0 τραπεζίτσασ
690,226,527 *474AA46AF0F6AD74304162BD3480EDD082CB6ECD ΨΕΥΔΑΡΓΥΡΟΎΧΟΣ
690,226,528 *4749375B675A862EA25454ACE11604605D3FED1E василяка
690,226,529 *47428091C58CE1B08FAFFD5F55D886E14770BD22 «МОДЕРАТО
690,226,530 *474391FA7A3CEDDEDB2C4AE647C227D91D65A9CD ОКОКОРЕНОТО
690,226,531 *4748F09595B1B6C8DECEE2A4CA689AA5C88E6241 оргaнизaционa
690,226,532 *474B5A3AAEBF0778A7A140EA266299FDBB8D14BA семаия
690,226,533 *474F256E1C6C2785AC006248FFC3D61E55A37A02 УМАЗАНОЈ
690,226,534 *4748348D3F8DCC36CC2741130FDC35D4BCC8D073 002002/S,M,B,/
690,226,535 *474C877FF67A17CE771327A70CDF8AD5A39306C8 02.26.1393
690,226,536 *474A5182A00322577BDC69DB9D8F51D4A4C3286D )0([email protected]
690,226,537 *474DE350E38DCBDF77C0D80BCF35ADC7063D2656 1136443 SEOLIMELKOINENKONTRASTIAIHEENVAKAVUUDENKANSSA
690,226,538 *474EADE3B4A5CE4B4F87AAD0099C027C14586663 1160634 rauhanpuolustajain kymen piirij
690,226,539 *474DAD5AE67AFD2163CB36916F6737C6EA09DDD3 11LAUSANNESITTEN
690,226,540 *4748660B61FBAE29B2919214E7B984C4B9DF9264 [email protected]
690,226,541 *474CFD111A68575E534D1E4E4FDA179F8114BEAD 1546927 NELJ
690,226,542 *4740E26C3FCC63B7FA484879FD4C80C6C1097C35 17041916
690,226,543 *4747C0F9E1C7A12C7A2EB807BA5CFCAD0F8A67BA 19720414:.copenhagen,.denmark.(disc.1)
690,226,544 *474CA4998ADC0F91ABFE6E0C6A0640EF33649F0C 1.angstfantasien
690,226,545 *474012D405D5C948793028FC03038BCF8768A35B 1.BANAANINVILJELIJ
690,226,546 *4745E17CAA9C4A65A206F7518DC91E3A1CF5B7C9 1-beramten
690,226,547 *474EE23B9E3F0D66AC3A9D837704962A8867DFB3 1 CHINA-TAIWAN-HONG
690,226,548 *4741D34450EBC79D7E0B461AD8B347C0B4C49034 1.einrichtungsideen
690,226,549 *474546650E63F990674CDD5EB0B4432FC564613C $1IKKENDE
690,226,550 *474FB8B3B1F3142411BE20C1E9C1AC9F530413B4 1JUDOVERBANDES
690,226,551 *47451666A0063E6A1EB0F08A7782C1C0EBC8FD5B 1lamminp
690,226,552 *47437680AB12BC7EBC8E7FFC8D96E95D327D9359 1-MERCANLIGIL
690,226,553 *4741AF2BF89F54E30AF2E866E36AB0EF72FC7EEA 1.nationenwettkaempfe
690,226,554 *4743F8029F7739160EE4680BEFD52B4B625A9A5C 1-PeRNia
690,226,555 *4742302B32530FF4716C3E491A1742154C2B71B6 1-POSTIMIEHET
690,226,556 *4740023756F152B5430F085F0B8BB5C66A4EEF91 1PRIVATE-ARBITRATION
690,226,557 *474DDD95CF691DAD0B9F9707AE54571742D4046B 1sayscars
690,226,558 *474F11EFBF50A149B8760145831C284B2BC99B9B 1.tankasta
690,226,559 *474BA67DF2EDF69EA20EAC6AFECB8C3BA7F32FAF 1thatmountain0
690,226,560 *474802C13F0A4EBCA89FAFF10B2655EB7114DF0D 1 WANGBAS
690,226,561 *474F54B6858D2613353F1B8CF0554EC1EFB1EDE2 [email protected]
690,226,562 *474010CCF6F512DD26C914621954D6AE7AA560A8 2011SDLBJR
690,226,563 *47417FE92B962B053489B79B66E40B63EDFDDF70 2100496 VANHUSPOLIITTINEN STRATEGIA SYYT
690,226,564 *474EA040FC8886FBA791394FF38C76A804840BCB 2627555 LIIKUNTA JA K
690,226,565 *4745F63C1E32FBE84ACF40DED3B3DC28FFCF019F 2631726 se.ei.korvaa.ammattihenkil
690,226,566 *474A224E655F62C187CCF2683CE566AB02902CE3 2705562 EINZELHEITENSTEHENABERNOCHNICHTFEST.
690,226,567 *474134467A6375031D010DA4B0799B1B3B5BD878 2815529 HEINONEN SIIRTYI YLE:N JOHTAJAKSI VUODEN 2002 ALUSSA
690,226,568 *474E78BB67B1BA446CF1BA0FD4ED7B7399B6C0AA 2CATFISHES
690,226,569 *474BBBE0E8F9FEBD99A770A6A1633F5F525C90E6 2COURGETTES
690,226,570 *4747B11E3B6CD216C3DA78C6B4848117BB699F6D 2ERNTYNEE
690,226,571 *474946D338569260DB135745D576F2D4019ED771 2 FIMEKO
690,226,572 *47434DC729E1F52BC19859B002AD723E8F08DE99 2hallituskumppanit
690,226,573 *474720B8DC6BD3DAF39E7968BECDA639E66736D1 2INEXPENS
690,226,574 *4749D8CDDB3CD45437B35092630319BF7F88F6F6 2LL-HANAU
690,226,575 *474543219DD5524B2675F14F649470CA0079240F 2 MM-JA
690,226,576 *47466F9099C5A824A4F6842574C0124906817017 2.PAKKAUSLUUKUT
690,226,577 *474E6598E1375E589085A06DE2564353D1873A6F 2.petrini
690,226,578 *474D402C5FCAADA098F5490C129943367E629FD6 2vosapen
690,226,579 *474F777D500BFA58D7AA553B660AD80F7FEFC3A1 2 ZIMMY
690,226,580 *4747A1BBE20C1D486CA8EC9DC50FF85C114FAFF4 2.zweitligagipfeltreffen
690,226,581 *474D7275419E83C7D1F11935539B862AF81C52A6 313C70RA73$
690,226,582 *4743B80A51D826F33B0817A4CE636C06BBF1E8AD 357244 DIE.HOECHSTPARKDAUER.BETRAEGT.DREI.STUNDEN..
690,226,583 *474E35C2671A8C8756E8BFE3E7D4FE773ED81D40 37-kathmandu
690,226,584 *47456FB9BC85874CCCE0245F365A312AAB099613 396ANTONY
690,226,585 *474BE305A44C36AC9D7CBB64620D1471B10C4FFA 3ALLATTAM
690,226,586 *4742F3F7FFAB08A9B8AC1A5C95F7ADC6DCAD7794 3===B~ ~><
690,226,587 *4744B636ADC967E6E2AF096E3C339D464AC8626F 3B~0 ~O(00)
690,226,588 *474D0E7495A5ECFB87FDC11D66BC4664391EDBFB 3EREITIUR
690,226,589 *47498E5BD814D28C4788E6278729CE4B42F7A1CC 3G3STS
690,226,590 *474F71C971F2DA5690D6617661AF202C4D07B124 3ILOVEFREEMAN6
690,226,591 *474EFF13449883C7CF8051158C780CEC54904A8B 3MTRPNMR
690,226,592 *474297FE031C2350066FEA47E55C144CD56C755C 3VRSBLNSS
690,226,593 *474CBA583B556B08FC16B77544E6D101B6022E4C 430925 GOR DR OZBAY DEDE ( YRD
690,226,594 *4747F844DB23A5A5B58E60312E77D3524E599432 4ACETANO
690,226,595 *4747CD58192D816FA5CA4DFE7D37B47F2F6BEFFA 4.dw
690,226,596 *47400C23A8E1FCC4F80B412A25CFC6ED0089C167 4GESTGEST
690,226,597 *4749FDD51E19E581797CFC52A1DEB190C01A6255 4GIHSAGIH
690,226,598 *474C337E7C9AAE633083E3BFD56DF0D3A2BEF744 4MONOPOLYOATMEAL
690,226,599 *47409084598C51407B66B837D69D8F993409C53B 4PHYSIOGNOMIES
690,226,600 *474D2B6DFE70613E10B772FB3E06C0C1150BCB69 4REVISIONSAKTI
690,226,601 *47436CAE25DEC1A98CA5380D77F3FA533F27B909 5AUSTROCKNENDEM
690,226,602 *4749AAEAE9C04ADB502DF12918E9450DF33D3A72 5KABELKANALEN
690,226,603 *474C1384055C913DA5D6EB2A1026BC70034924A3 5PIRATEWINSTON
690,226,604 *474D5199F961C029AC2FB1D03E3A9A5A9DFDB450 5RCPTLZS
690,226,605 *474A7B97D88D321802E83CCB121F0BEEB9F984EE 5RENOWEBDATS
690,226,606 *4741F3572C1CD5D460B28CC4222724A426CE0412 5ROLLERBLADINGS
690,226,607 *474EF8D03BE41B9824D02085DC5DEA2F1243D208 5SERONTS
690,226,608 *474557B985EA3AFD885E6DC91C583FEADD2C8C40 5UNCOQUETTISHNESSES
690,226,609 *474FC039C42DB3D2638AC6EDC953862853851181 5WOLFGANGCOLLEGE
690,226,610 *4742B627F1D99313E00AE590C288F08F7035E4C8 650280 tarvitsemme tekij
690,226,611 *474FA104EBAF973992C3068B7D25732FF539471B 696054 ARISANAYISITESI1.ETAP635.SOK.
690,226,612 *4747EFCF9672E13ABA63CDE4FD8BF928F6C8A118 6amabilita
690,226,613 *474971D0657E56245EBC712B351EE0EF28379D56 6 BJ
690,226,614 *4748ED7777664631CEB83F4785F624011F0551D1 6CANCEDBRIDGES
690,226,615 *474A5D187143F1B0BDD0BBB152D16471BEADB49A 6COURTINGMIRROR
690,226,616 *474F8328DA5BDD2C7CD8D39AFA0BC5F117A24984 6FETCHTE
690,226,617 *4741AC1897827803A8EFADC20D8C807F9C4BDEAB 6GOLONELES
690,226,618 *474A12F819E281EDA3ACD8C3C185EDE52600FB6A 6iluvgilles5
690,226,619 *474459FFFE869B2DE3ECFF73311F59899DCDEDCA 6SNOISILAUTCA
690,226,620 *47469DD7F5B899589A2A0AC01938668FCA9FE2EB 6spiazzo
690,226,621 *474EA6DB14228A9639C1879CE75E57EF50F6298F 6thetrixie6
690,226,622 *474DF54B3B89E0FA396CFB2003A09D703CA8EC77 7BFOMARK
690,226,623 *474467F7D11B47241A065A164CFD8F61CB67F3CE 7BSWANAVDRBSW
690,226,624 *474E612714493103F94A50397E059F7D04D2A225 7INTELLEE
690,226,625 *47462F5E15730E46AF8AA77B50A050422F5499A8 7MYGREENDAY6
690,226,626 *47437462F8EE383FB7887E1F9C2E039EE9B501B8 7PREENVBSW
690,226,627 *47471FE0F0D594A301D9E03FC06E9260543EFF4C 7WRITINGRADIATIONRADIORAYSRAYRAY
690,226,628 *4742B89D8BAFF5D579D58583CA8324402B80A03E 800nz
690,226,629 *474F237BF6AA59F4884FB65E04834E0CBD70BDDB 8CASPERMIDNIGHT
690,226,630 *47442CCCDC05D477F60E92C1A34998969D5097F8 8CHARLIEHEALTH
690,226,631 *474E0036D0BC1C0282DB21A7B720F59CF6CA3395 8GEBORRELDS
690,226,632 *4749F2B500DA0924D07AC1B64ACE424B6D6423C0 8geloogden
690,226,633 *47434C432A944878951400DDFB8F336B1DBD68A7 8REOPPRESS
690,226,634 *474889E0592326A25C522AFA75BFED7297CD4229 8YRKIESSN
690,226,635 *47498B8F4CB34F30EC3DA9384DCA14A4DE95699F 8zn
690,226,636 *47438FCB52FF22011808E5B7DBC7FA365F44882E 968336 se-on-:-teett
690,226,637 *4749D34837AE23B2F6282DBEF68F011C63872556 9AMMONITIFEROUS
690,226,638 *4745D85DFE76174FDAED45EEC439140F1DEBF6D2 9CUREEBSW
690,226,639 *4743D4E7CD2D56C2950A85414893C0A1B25855A4 9ELLAPPER
690,226,640 *474D87A590D4A993D5E2B32AF4C30146BBFE9476 9NONTELEVISED
690,226,641 *4748A57C89F9112C75C2C158A6AE3804490E80DD 9RACHELAPPLE
690,226,642 *474778E9DE8A1226DB9FABA9636DD0F9C0497059 9RTOPTANBSW
690,226,643 *4748EDF4F698DA2BA8CB33FD36C4374D9D4C77EB 9SKRIVIM
690,226,644 *474760065BBE15AEBE397DE0ECFB393A79BA8445 9SONICSTIGGER
690,226,645 *474AB1EE5DC7CE3387F3C35524D6BF254935835D 9SUPERVISADOS
690,226,646 *4742087993A3D5458F6C6F80EEC6912F4C09E38A 9thejason19
690,226,647 *47423B4EB93B352A0CE22046B57FC7992DFE81FC a1bh
690,226,648 *4742B0F20D26B9A23165666E04BD8A921B846760 AACE\|
690,226,649 *474B41A22C7CF83A6CA4A7BECCC1E4E53BB6F637 AACGP<
690,226,650 *4748EC83C366ADFB65C788962B38E7E52C55C3C7 aaer!i
690,226,651 *474767D218A05DAB3503044B07AC204148923A1D ab4je
690,226,652 *474D2F6380E17E9E8AE0F5A9640C065A54A9DAE6 abdur-razzaq
690,226,653 *4745371406377BAA94F8934A8A546716C78301EC AC#F
690,226,654 *474721512F346EE529C0C8544A654BA99F0BF1F6 ac&sr
690,226,655 *47478B86A86BC1C1449ADAA082E6B7FB0A66F853 ADNAN WASTI
690,226,656 *474E9EAB517B4DC537C7F1637DCADBAE315C286D adndo
690,226,657 *474F10DEC52FAA2B2D7E5F63BA067332A4FFAA11 adw;
690,226,658 *4743CEBA236B07D6C78110330ECFC3A1431EDB71 a-hatalom-sz
690,226,659 *47493B0B416BC2F93FFA59B20FAD0F7CD4E28D3D AHMED.KURRIE
690,226,660 *47415CD4D69AE5F80024142440960ECABC1EB2C4 aidqg
690,226,661 *474EDF56F32A5FCBE8AAC235A113C0D9AA07D53D A_IV-
690,226,662 *474B25733F53CCE76E1BB8171686390039414938 ALEC.WEIMAR
690,226,663 *4749B3E1A38D6BA6384CE3A7A2F3A9C0B5DDBA32 ALI.JIMMISON
690,226,664 *4743C76A62E205A98BEFAE9408B0D22E18995C65 ALKHILAIFI
690,226,665 *4741E7CDDB3D690128C3C60AA7DC1331D9489562 alsarorgukwww
690,226,666 *474B8F7D7DA0B7CAACE818996CA5339668B0C35E al(zl
690,226,667 *4740FECCA95720C4721EF59E9B874DD76AA4F52B AMEYA.PRABHU
690,226,668 *474F6E877F9646FA23E6BE936EF97A8887B60116 AMYBANFORD
690,226,669 *4745052B190E8C3F4A954341C27A28D05F320BDE an:ew
690,226,670 *4742A744F8E40219B8D1E8A0897835565AB8EA75 ANGEL.BURSEY
690,226,671 *474AF1BB27F51E32E6033177BE9CBEE2D1FF84A8 ANGELINA-VROMOR
690,226,672 *474D95EAF390B1B99A9A549CEF1B1C78ECD0B7C1 ANGEL-MARJI
690,226,673 *474E195401D70F768524EDE03AFB82DCCF659FD7 ANIBALBEIK
690,226,674 *474A038E28FE6F052D2FF247E73598800CD9060F A-NIGHT-OUT-WITH-A-FOREIGN-FELLA
690,226,675 *474BD4FEE34A040D52BF8406063AEC07A299A7BD ANIL RAJANI
690,226,676 *47414E0A772C5C17C592CFFFCB0FD628BDAEB04D AN+!N30P1AS+!C
690,226,677 *4749D4B1AB0B531E5EABF26ED970DEB93D4314F4 answer-title-area
690,226,678 *474AF2F2523539783E5561FC07EACD99F865BC21 ANTIDOTARY9
690,226,679 *474A66D0D98FE9F22D0D4E1D29A75AE66598EB8B ANTWAN420
690,226,680 *47428FDD1BE5161A659A519720F0AAEC1DD76E32 ANTWANMOKRY
690,226,681 *474A812EC8EEC96CBA65C7B26AD2DAB776B6051A antwanulmer
690,226,682 *4742471D02B4F876D86A66E11EB97BE218FFF754 ANYADIXON
690,226,683 *4749C317F40D06C4E0F9984D643BC97E3A648BEB APCM
690,226,684 *47477C606CC3FC6F0E49DA243EDA19DDDB753D12 aprh/
690,226,685 *474C5FFA765856DCE11E715E9A9ADDC6E5D18C6C AQUASI-COMPLIMENTARY
690,226,686 *474680E7B83E22B798A1C9896FE25ED35AD4AA0A ARC7:
690,226,687 *4745F053B1478013DBDE556394189E982801AA52 ar;lw
690,226,688 *47444EC90E793F5972FD69FDA5807E80DE02782F artbrignac
690,226,689 *4742985E6F583CCCFEC5F2A3B9E77739214412C4 ARTSELIN
690,226,690 *474C9EA80F67B8E7470719599856A51F7A06D7C6 as=+
690,226,691 *4744B2BF12EBC66DB55A4BB0495B76EF37376CA4 [email protected]
690,226,692 *4747582DCD0F7BA1081ED864394E53412F09A8EB asyadana
690,226,693 *474B0D92F54C27D446C31AF3B51864F3D422E8E5 ATO7L
690,226,694 *4744D9E1FC4343F46FCA0DA6C709518AAFD2C6CB au0zi
690,226,695 *47464BCADBE9902E246ACD1FD82B465CCA6E9F3F auditsshouldbeperformedperiodicallytoverifythe
690,226,696 *4745F79F91220E6A8B390A61375041B3B60DAA93 AUGUSTUSMIYAGI
690,226,697 *4748C8CD21086AAA530ECE2DCFD426E844AAB527 authoritatively
690,226,698 *47473DF602F7D6CED23D7C573F72784CA2600175 B6RYJ
690,226,699 *47414A7224586CC275EFC5D16E2B197D75B0926F B7IBA
690,226,700 *4745BD3E87F4485825D8FB8EBCA1017ACB18CC01 b9$io
690,226,701 *474CD2F92E1FA83AAD456DBA3E790922457160E1 B+9#K
690,226,702 *4744AA4B69F89DEFE3AF6DA0C99B594283592562 bad=!
690,226,703 *474D0D0468FF383137B1CF1692E954457608EC7D [email protected]
690,226,704 *474EF3825C01ADA3921B00B2A012A3855C7F0CCE [email protected]
690,226,705 *474445F78B18A980E0D354C4DB7B864C131A302E BAUMRATTEGRO
690,226,706 *474D2CBB3FEF758094F92F7657166F01C18AA413 b_b3o
690,226,707 *474975C7ADC3747E0A2458B0CDAE9B48289CB86E BBKGM
690,226,708 *474C1875859C75A547C22E17E7FFC44D31E7D4B6 BEB/D
690,226,709 *474EBF88A1B97175324B28B08B47FE82966299B9 BERNARD.SAGA
690,226,710 *474D8AD1FC1885B0CFA91E1B05C3648BBA060318 BERNIE.SPARROW
690,226,711 *4749F66F1DDC0516EDEA4D4AD3E11BC40727927F BERTHUNKE
690,226,712 *4747F9AC2D00B6F3C9A44617CE2E14625A7672BB BESNARI
690,226,713 *4740DA9B1B1EA39719AB1DC208A4D9E190E6BA47 <B>FORCLASSB3,REPEATTCSECSECTION3.3.1.3.2.1.</B><P>
690,226,714 *4740DE8645E9E912FA9EC94DB4DB562AF77FD841 BG+
690,226,715 *474E6382DDEFB2DC249B2A5EADC50ADE28DDB819 BGCFA
690,226,716 *474DD64D470A63694F80B45C5A7762646E34C180 b!gu$
690,226,717 *474236AAB4F5A5C4AD5E0BE999A1AA71C55CA46B bhcys
690,226,718 *474B9D4BA149BB5F01ABF0427FD48A9C3DCD9BBC BIJSTAKEN!
690,226,719 *474163AA80E63BF282F421191E3B18EC8892BC6C BIP4R+I+ION
690,226,720 *4746EFA682D17BBD3A0CCB0B32EBD3BC092492B1 b.k+o
690,226,721 *4749DD0B6ECB560D767ABDD0D972552FBA7C80A9 B_#)L
690,226,722 *47441580CF18827CADAF8D6D7D44824ABFAFB2FC BmLO
690,226,723 *474E66A6FD727E50C2ADBDCA94C7833E55E33E5C BN_RK
690,226,724 *47469C27C91368EEFC2DD04EFD47FC9D28C5B36F B=).~O.~OSPLAT
690,226,725 *474E241C8ABF74800CD21774F0CF372701F1698A B######P***~0~oSplat
690,226,726 *47466160666F8BAAF72931CDD93C77045C864615 bq/bh
690,226,727 *47446EA89B89C80566FFCB0C55B83443749DEDB8 brandy-kaiser
690,226,728 *4746C42D726B95F338A71AFFD70836C7244DDD88 branforte
690,226,729 *47407D660E1A2BC685C545791987A25790BE7DFA BRENT.RADMALL
690,226,730 *474FE223AB14BFCEB72641553A2E33E18819B60D BRFDN
690,226,731 *474BFCD3679EA36000E60B41FA61E5C962D46E77 bridgesniper
690,226,732 *474CDA7C50F36AA4B051E75F65C7D868B71D09B1 BRYON.RAUM
690,226,733 *4742CF46D6E759CE6F78A4E10117FFFCE08AF5DE BSBL
690,226,734 *474924E1C0958F6ECE777A117C9EB545D5D69768 b(s&v
690,226,735 *474E2AF8E6D178E8B96D6679BD77F3B26E1285AA BSWAJHDBSW
690,226,736 *474857DB1CFC3EB627673A410F3A7ACF11AD0CF7 bt#6k
690,226,737 *4743EBBCC242D1A304334D044051809A50910109 BTI9G
690,226,738 *4745D3769BEB3638867EB32BA6676D073A74F8BE BURLSIEFFERMAN
690,226,739 *4745C332E29D4D3983132D1E5F78BA3CA360D0D3 BUTYRINA3
690,226,740 *4748509150E326C48F0EBAF7084889788038AC5D B%V
690,226,741 *474A0D100D7411B41DF2C719A5E22E91089682F2 c0mp3n5a+!v31y
690,226,742 *474C05137E151E4BE5D6F9EB2C9E65EA461DFD77 C4KET
690,226,743 *474DDA0C9DB0C13B99867B83DB0336BDE4577914 C6TYS
690,226,744 *474DC799E9E0823CCFA532FE83A0F281389BCD97 CAISHAOLIAO
690,226,745 *4742A67FAE1D5DB24CEA20D13ECB3C5A80899A06 CANALATURA?
690,226,746 *474008F0CCB472665570C084F70DD568F9285793 CARIDÙ
690,226,747 *4745C96441521581E6593F35EE9B54E19391A97A carlton-sinclair
690,226,748 *47463371A9DFEF0C8C47D5FD87BD07EE2227AE6E CARMELO.CARISTO
690,226,749 *4744EFF3368169EE81A3876A615E3C58F845DD38 CATALOGANGUS
690,226,750 *474FBAA8444352D54BE5638DD68684171B89B8AE CECILY5
690,226,751 *4745F52B465DAB7BA52A09D387E87F6FFDE9F80E CE/U9
690,226,752 *4741A5FCD7C22C4C47E3942B70D436D7E329CC1C cf.
690,226,753 *474B6D10D11753157D209DF352AE227EA9ADBAAF cgzpu
690,226,754 *4742A16E0E23634E927BB2EE8462E0473066127E ch+#
690,226,755 *4740A6E32E9D461928D2454304C57FB9C48ACCCD CHANLAMF
690,226,756 *474C6CDD86D4C907387CB5D42872F7C57466AD14 CHASEPOLLACK
690,226,757 *47454C7D2D34CE0E91E805781A5363D44950C4C7 CHEDDARS
690,226,758 *474C7F50F96E36170D6490975DFED8008CC6D492 CHI.BIEKER
690,226,759 *474455A703BB6CC90EA95E7E79774111FF1AB316 CHI.HARGREAVES
690,226,760 *474633E758F4ED9843C1305EA7E22696010E8BEF CHONGSTORTON
690,226,761 *47434673789F0B639517B5EF35B6D879B585449E CHOPOKSK
690,226,762 *4743CD2312AD30C1C8CE05AA33C21C44A87AE8AE christmasatsea
690,226,763 *474415ABFDDA762567264972177F6038FA152FEC cindycronin
690,226,764 *47434D2169048C9B7A40087AAF9BE9398A5B0DBA cknrt
690,226,765 *474E06C1763639FC3BFF8A11737784C1B15CF46C C&M+A
690,226,766 *474B91D7E5FAAC117B8415870B0D111D9C6710F1 CNF7I
690,226,767 *4747E742297ADBB731EF8982184F87DE0D71CC8A COLEON1234
690,226,768 *4745CFBADA4EABA9D1F25CB454D34253C447D75A colonnati0
690,226,769 *4746A09AFDCD3B8B6EEE7DAA5A13B066B57F15AE comme-un-marbre-de-roses
690,226,770 *474478B39DC8CEED58E666D650339F7F667CF2E0 COMMUNA1ST
690,226,771 *474219D347B06E9E8ACDD76073309D4574EFAB33 COMPRIMEREZ2
690,226,772 *47425300DBE187739B8283B1BCEE04EDB82C8BEF CONRAD.KHANSARI
690,226,773 *4743939B9B50AD5BFA2C05BDC3E974C10438AFE4 c,pag
690,226,774 *474A15570E8FAE279348D8A1C0AE70763C5695CD cq%9i
690,226,775 *474FE014632198A6AEAA2AF310BC9E3C8DAD20CE CR2%$
690,226,776 *4745FE64AA9FFAD66135CE4909DC123C6FD96D10 CRYS4LL0ID
690,226,777 *47497684C185697FAF76566B241F9C4A12499AEA c+s&h
690,226,778 *47454713FAFE041A06F01F34093B2E397C19CF6A cs/vb
690,226,779 *474B911132A6F5C3ACB0F11349B006E3FDC5F192 CT/FF
690,226,780 *474422B28F45EF1FE657183872B9B8773AEF0D45 cwn[
690,226,781 *474B8E04AD4AB8EE1FBF0D0ECC3AF53FFA267A8A d2osy
690,226,782 *474C7A5BC99E3E3739896D94DB45149B8CF7AFBE D3?5I
690,226,783 *474364C27CD00601518B3AAB53D8A4ED27C096D1 DALPHONSUS
690,226,784 *474B5DFDA23BF47405851D91B0FCB3C06D64A3B2 DAMIAN.MCCOLLESTER
690,226,785 *47420F45BAF63FE1016EFBC496DEDDAAD6332550 d’amway
690,226,786 *474D55D7614A660486B659B2B8674549B0A0745C DARABONTOM«
690,226,787 *474A53666A49B713B1E3879D99FFD769207A0705 darellkatheder
690,226,788 *474270019FDCDA40B245F173488013294F834301 darrellbeinlich
690,226,789 *4741ABC6F94E1A0035433974E2878129A274E1CB darwinluccous
690,226,790 *474DAE38B2F2EC5F08B836DEC3A42553C8C960C2 DAVIDFILDES
690,226,791 *474D12BC0F37B2ED94CEDDD932FABE93AF6EA15D DAVIS.SOVAK
690,226,792 *4746B67B62ED6BB38B025AEE8983A2CDD0D9EA5A daxjy
690,226,793 *474E6E96A37219DAD1C064F110B2396B9DA51F56 DDM$5
690,226,794 *4742258594BF5A65A5D2B947C3D229EFC6294CCB debiting
690,226,795 *474CA00BC0834658355FBF43C079292B100DA238 DELUCREBUT
690,226,796 *47419CCFA48BE0611FC2711D56DC62D83C9C2676 DENIS.PIERPONT
690,226,797 *474C18F44A8E5A93156201E6E390F3951CCE9766 DEPRAVER2
690,226,798 *474336DDDFC01898BC4B3FB50A5E4002E5956FF4 de%xl
690,226,799 *4744F38D0EA353010644C5A08C760CD732A760A6 DF$1O
690,226,800 *47484A297425483D4A973B43DDC63DEB2E8DDF7F dffu$er$
690,226,801 *474537141AFB3FB26372169353B524D2EE7BA58B dg%0b
690,226,802 *47471B6164A151C870CA90B43CC29651586952EB dk9+6
690,226,803 *474F716CD09D5079E79F4BB9F8456257E1FCB506 dkgak
690,226,804 *47488618D2BD708137843F33121790CB16FFF8EC DME$E
690,226,805 *4744FAA1BEE3DF94FDAA53B0FC14DE755E32E1D8 dmq,0
690,226,806 *4743A240B2A0D3CC575F41E73A588C1EC7172D48 dn.5n
690,226,807 *474DA9086319CCEE008F0B9EF9FA2BEBF9E226DE d)n_m
690,226,808 *4745B28F4D521F99FE7C973C65227E1421AC04B2 [email protected]
690,226,809 *4744D4BB944868251D4148D5A70CDB1F0654E7BD DONNCRNICH
690,226,810 *474BF4D011D172A1DBC6DE2FAD5782A3AF5D1F6C donnellcolucci
690,226,811 *47452D2740B0B4B337804DAAD74494821F53E4C3 DONTEHASTERT
690,226,812 *474FDE14B8BEFB9A0F48A8EC04847D75B88B7588 DORASIMPSON
690,226,813 *474E3DC76119729848161CFB4BF2E6606BA38FF8 DORSEY.FESPERMAN
690,226,814 *47454798D14922882E4CE7481D6240715FC59C0B Down.South.Somewhere
690,226,815 *474088EFC91659DD58D38E10B27767A51F1D82DF D)P0=
690,226,816 *474C34910759F5208131CE4EAF8BC74E2BF39000 d"qoz
690,226,817 *4748A7746DDFC4B85D6BDE01740333C3158CA5C4 droogmakerij
690,226,818 *47472E679CFFDCC7C6FD09915FC3BDCDBA9F3B09 dsq=h
690,226,819 *4746E26CBA8BD905380615930FA413D2F89245BE dtig=
690,226,820 *474EAC2B826777E95727B2DF4CBBA87A5AE0AED4 DUAB7
690,226,821 *474E250DD28C0C81F1E6279D03D59C3338222C80 DUTCHSHEPHERDDOG587
690,226,822 *4744DE0A96FD7751D69A321304155A515A89DAD8 dv8o
690,226,823 *474C4226428339189FDA3861E68FCA21B19FD98C DWAIN.SCHLANGEN
690,226,824 *47431E4D694505411F39A52BEA04452947374118 DWIGHTRUSHER
690,226,825 *47441D2C10BECF08B8259A98710F9373CCD48038 dwov
690,226,826 *474C804BD8EE0811AF17F0D27FA34C8682044CB7 DYSSYMILACJA
690,226,827 *47473B57DB0699C32D2D8A5264398206E3871FC0 E5]}
690,226,828 *47498F5975FDDCCA4CE53FA7FF927DE1B867A50E EDWARDOMILLAN
690,226,829 *474FD562A8616616C586BB8F7A8DBA0372DB4480 EE!PZ
690,226,830 *4746A0EA11995C4F23FF9485C4FA571D9D7E86C8 EGPOMPTE7
690,226,831 *474F14BE50106A986FCA1324F01F8D68973154AD EHPSC
690,226,832 *4741A505DDC79DD78EBE84714D00F430784E7D04 ELECTRICCOMPTON
690,226,833 *474044AA698CA8A8356C635F9D052BFA919744FA ELIZABETH.GARCIA.LOPEZ
690,226,834 *474EE6407A76838BF191E65251FFCC5F67D3A00B ELIZRAELZEGYPTA
690,226,835 *474ABE9EABCB100AA07D13309423394ACD567B6F ELVINTRUSILLO
690,226,836 *4743827599E10D1C9AEAEA7151340147C44444B9 ELWELLT
690,226,837 *4740C6856BC878F5B612E90F1D1D1E196FE2943E elwoodkapinos
690,226,838 *4744C7CF517B44CD95568962E5C439E4247F4173 EMA-BURTON
690,226,839 *4748744F28FEC12A8F34CEC6470B752D4A3AA563 emerypulte
690,226,840 *4740814DA2B94D4DEDF94331B67DB1F59AC863DC EMPY(HIDEAWAY)
690,226,841 *474E33DF5AAEB6BA06C6A582E5ACED29613D67C1 ENPPUSA
690,226,842 *47432B0131797DE49D239AE220ECEE35EC6CC6A2 eqslb
690,226,843 *4748846D2BF068D14B85EF5071B238099752781B e)ss
690,226,844 *474272622FECE31366A7B3C6178514EF40D6E8BB ET.CT
690,226,845 *4740A33F1F90DF310979EA18A2F525ACABABAB77 EVERYBODY(DJTORAREMIX)
690,226,846 *47461154493761FCDACD90AD508855BCB608146E EW-1
690,226,847 *4742D958BB317E8F5D3A41463951A45EA0E34927 ezekielhibma
690,226,848 *4745ABF936B8F3C54CBBBF6639AC35CE36033403 FAHRTANLS
690,226,849 *4743AE0588B7DC89666EF86C9FBB4D7F1A9037E0 FAISYAHA
690,226,850 *4747B454063F5B94BC6999DA7247E1293FF758DF FALCONOI1
690,226,851 *4745073D4378091BAF7BF31A4DAA794CF9F3B58A [email protected]
690,226,852 *47405DB99524761F2A380C4A9C002E7B8861D257 farrah-efland
690,226,853 *474CB40C307A5067DCBBF1C825603D337E79EFB1 fathir.rahman
690,226,854 *474301A147EE725B422AEC52402E012F2D94C412 FEDERICOCARP
690,226,855 *4747A057F914DD8F642D15BB3B90203014F485AB FERTUUT
690,226,856 *47464B37D4C18F9B78E516DCD8505F026BB54015 FICTIONAL_FORM.'F/I/K/S//@/N/-/L_F/O/RM
690,226,857 *474C413D0D9F5C04711449419DDCAE5F2C23F5FE filibertomundziak
690,226,858 *4742BC4F6E657165A31C379F7CD968EE38811C74 firmends
690,226,859 *4744B4758608712A9224F3DDBC96D7D21D4A4B16 FIVEDOLLARBAG
690,226,860 *474CDB8308ACF45F2DE8D659E464A33E08A76732 FÖRFATTARBYN
690,226,861 *47416FA34B7FD88FB354F52D0994906C9778261C FORRESTLINE
690,226,862 *474AC67100F4F4D894F32E6EA71471EB4EA098EA FRANK DE LOS REYES
690,226,863 *474716DC4A95B1402B3B9A74593214C663CC0560 fredyearous
690,226,864 *474A7B0F2E777217DD4970A4BD9B7405E16779D9 [email protected]
690,226,865 *47493118371002FD09DC2B5DF9A4C97317F1A401 fsuitability
690,226,866 *474B99C23E8DD5FDC3DF72F4FA2C1DA32B8F07AA FUCKYOU#2
690,226,867 *47483D3C125D00700F7DD4068C3F304AE271385F gabrieloancea
690,226,868 *4749BC90EA891A96F5404D6B688C0B50AED47B8B garrettvelzeboer
690,226,869 *474C3AF9D38DB580460FCAAC5254DE4755ED3ADF gary-keith
690,226,870 *4748C5EE9BF86FB127A89015FC3B266CC670F38B GAST15
690,226,871 *474DB595AFC7E9F0B0840BE5B0707F0C43D0C830 GAVIN.BENEDITH
690,226,872 *474A7045CBD510590189861C527B430003201038 GAYLE.MCKNIGHT
690,226,873 *474649068AD2DB0EB4BF54CAACA28879541083C4 geografiai-1
690,226,874 *47429DC2E1F95A0A7AABD333A560080657B2C919 GEQRBKH2
690,226,875 *474B2C9884E3648E64F202785D2DDC572C451634 GEVIJLDE6
690,226,876 *47414E92D18A14103569577FD34D0F1A446F2B78 GGARBTF6
690,226,877 *4747C8807C159F1678F595E69A93DC5B50674926 gilbertotedeschi
690,226,878 *474F5BB79FDB48DF6A6390EE66095B8617169213 GIUSEPPE.BONSEY
690,226,879 *47499B9F554EE7AFAA8E33F25FC4B26B7F5ABCB1 giusepperattay
690,226,880 *474EF453B54816FF141264B2B782AC38D2441F1A GKX,
690,226,881 *47486320CD53C625DF338C9BA3F2433F7FB4123F go&k
690,226,882 *47420ECCEDF6FE0D65FDC1A33180EF1EFCE37407 gommezsed
690,226,883 *4740FB4E304BDFC3FCAB88CE8F688009F8E2FC17 GREGORY CHOUINARD
690,226,884 *474291A3AE0EFA2743969CE9DCEDD97E47DF9292 GREYHOUND1988
690,226,885 *4745DAC3212B5D84ECFFDE7C506CA9887BD99F7D größtentheilb
690,226,886 *474C6511EBA0B69393727D6C416744BFCBB7B5F6 grtnglss2
690,226,887 *4742BFED79450BDA27B11097B4251BB42EC24EE9 guiderail5
690,226,888 *47444E5D295A7252F932B624F9589BD984C0EA7B GVWW
690,226,889 *474D1BDA5E40D22490A957CA3CC8B6FB98564D2A h%8f
690,226,890 *474AC49256CBCF38785D54A61B25A1878C031295 [email protected]
690,226,891 *474F4C4D501260A7A6CFF57A8A50A411F0B19538 [email protected]
690,226,892 *4748268031CC9A0A0A2F9F1F01730BD16122C28B HAYWOOD.MUSTO
690,226,893 *474D3D0D4902BCB0C419A0291C6FED4C9DC41257 h=dz
690,226,894 *474FBC33032C157E59987B7D48AF35A2079C35C4 heather.wisdom
690,226,895 *474E0AE38F66ED8C98175649B3907222F12BF1DF hekelen!
690,226,896 *474E71185F73869CE0866132E7091328B01C4A75 hershelallie
690,226,897 *4749D20C3E5DF1E18D19DE94274E78F7C150FD31 [email protected]
690,226,898 *474B194822F53BD1B2ADC7B13D45DE87E346E7AA HILARIO.BENNICK
690,226,899 *4740BAC4324B37E4F9DB9CD922EA6AADBE6010D8 HILARIOORTOLANO
690,226,900 *474DC48F28405C134D8BC13374A36C4B266B99DF hilariourata
690,226,901 *47490C579FA9A06F0763051E21D3E14E100483C1 HINNIED8
690,226,902 *474ED9E7704F1469B6F0A0659DA6EE97580E666B [email protected]
690,226,903 *474B9E907342A9F8CEE81AD6186070E2CDC3600A horsnesfjellet
690,226,904 *474908834E5EB209A1BC266AF0452E1A99A3F4EE HOUTARME3
690,226,905 *474C8A4E0B92FD22275FA6B90404AB0F0A0EC3C6 hq6f
690,226,906 *4744614BCDB20AFC7C50EED8ED52DD4E08361820 [email protected]
690,226,907 *474794333239EAE2DDFFFC7A6C43CEBB06B03C1A hujinging
690,226,908 *474CBD565BA10F192BDDEA08AB5F20C2F8CF1F09 HYPERBORISCH
690,226,909 *474720183EB1F8BA8A392AD3C729992FCF16845F i-//
690,226,910 *474282B1099EE5C82FACF7A489C2B665267B3DCD ILOVEKETCHUP6
690,226,911 *474C48B51F631A56F4DB5E5E65CDDA62F9E12512 ilovemeatloaf26
690,226,912 *47499CAD126D375A9194F920AFCFD0D34B258ABE INTERNATIONALEMS
690,226,913 *47433E0A85C6AE2A60E4298B6435C58EB268C25C IPOKKAIS0
690,226,914 *4748DA605A37854F8E147ABCF12D805ED7CBE1E9 ISIDRO.FUESTING
690,226,915 *474AE57C0C5C6D437545FE07FC75E7C3232A7B38 ISMAELVANDALL
690,226,916 *47459C9B3087659001E5AD95276622EDEA0E84EC ISRAEL.CHASTANT
690,226,917 *47424B2AB1C8FC5DB9A6F219BE9980D88A528A43 ISRAELDAMIANI
690,226,918 *474D8A6791F284FCB2D98088F3CBBBB72E4F8B26 it's.that.pj
690,226,919 *47450366D0A8077D49F46B1A6E3BC81DA7C2D10B [email protected]
690,226,920 *47424E8C11183B9C75BC1BC3413927D1A9871161 J0URNEYM4
690,226,921 *474755D42811DA49CE238C23417F21D0F469CF32 J20299
690,226,922 *47491187CC7C8324DE90EA5F1657579804098DBE jamaalsemrau
690,226,923 *474C093761CF65BD50494C77E8F9747ED0FA6E40 JAN.MCCASKIN
690,226,924 *4745D67B2F70272D423563B1CFD2D87F393B8F92 JARRETT.TSING
690,226,925 *474482397A6E5A2BF0F931EA165B92F98CDA2431 jasonclark30uk
690,226,926 *474BE6C3C1AFFD2FCEB431752655CE9748772B21 JC$Z
690,226,927 *474D8C90BE45BEF35EF56C343DC311D1C6F5F44E jeromypurtill
690,226,928 *474717B16AB5EB0099F4B06F344D494B87774B37 JESUSLITSCHER
690,226,929 *4743647C4D4B72F55A7A17BE5C350EDCB41289D0 JEWLZ1313
690,226,930 *474434A96E6D4E724D0BF3867CDCEDCEEBF58B40 jimmiepapineau
690,226,931 *474072A4C965FDEEB28EF8C7A0D018C8F67EAACD JITHIN-PRAKASH
690,226,932 *4749EB6DC4437A91A9DF63D6A9F67D0D8B100F05 jjv{
690,226,933 *474EA8C3A85EF8CD3D6A2D893A16F46A84D19815 joeszalai
690,226,934 *474A9F52EC50C0031D2DC463C2ED8A6089D1AB24 johnsonpoulet
690,226,935 *474EF0F2CC128828B7401C87CB506EC05A311222 jonathan.dcool
690,226,936 *4746F9172CD655A6ABF99E2B44E5A2F8F493B744 JORDANSCHARF
690,226,937 *4741770C245604416C2E5BDFAC22DD8A930D993C JORGE ZAMORA
690,226,938 *47424A05C40CB193C22C000514D67EF16F718189 JOSEPH.LECZNAR
690,226,939 *474543F13B1C8E207A4D2129C487F5550126BE19 JOTTEN87
690,226,940 *4748FDAF0F801D898CAF703769A0A10F3F70D857 J"SG
690,226,941 *474F51C7C3214155EA4914C958B07EA515A780C6 [email protected]
690,226,942 *4744B08A14E624FE413D439494397AD3A576CC40 kaltblei
690,226,943 *4741F1418E9B5F52CB822DB04E85255C55AC7017 [email protected]
690,226,944 *47454B5C50636FAD0D2175D6B4ADF480BA37DFA0 KANE-BALLARD
690,226,945 *474F988C0B37A8C6027AD9D2202F5C5FD9F5F6F3 kayla-apodaca
690,226,946 *474E02F14660C0F9F29FE26C3D2411AFC4B6864E keith.hotaling
690,226,947 *474091024C5165F51798207CC2268D02A5164F81 KEVIN.NICOLAUS
690,226,948 *4747BEEBEE7F64706B63C9D9FF404EE1C13B1454 KEVINSCOBIE
690,226,949 *47491D21FBC37F392E0B089CDFE39DDF061F94F6 KHAWZ
690,226,950 *4740B73182A673FA6979D9073A9576DBF82BFC31 KIRBYADAMS
690,226,951 *4741DC5AE4736E02C9531113B703670BC2BBF50E kraigcranmer
690,226,952 *47449BFD3CD2912120AAAE10E3F60EF37A0861E9 krisbally
690,226,953 *474454703B96E4FABAC83D0E9336576058F44306 KRKOVIKAED
690,226,954 *474C3A577E7CECEC8BF422C1B28F3922B970AF7D L3X!C0GRAPH3R
690,226,955 *474B3D4EFB6F7754D54D18AFB7A57A95680BFE70 lbk`
690,226,956 *474D0E15C08F50A92613DD096AD8729FE1E82D07 LEMUELGAFFER
690,226,957 *474D71CBFD09F03F6BB84810711B498692B49100 LEOPOLDO.SPARACINO
690,226,958 *4748FF0CB46CA3E0E7F087016323EDF162DD87CA LEROY.CZAPSKI
690,226,959 *4744AF1EE69E70AAB94B3E219AF5AB9BE85F3D5E lesliemckines
690,226,960 *4742CBCD7F42A7D935D2EFB4C6B2BE4AB5562515 LILITAB
690,226,961 *474F3A69A611428000D05CD1E43A659FC0FF6CA4 [email protected]
690,226,962 *4748F2F94EF27E29B0CBD7F8DB0BF621F9C8AEA5 LIXIUZHU
690,226,963 *4747AE5B6D71E65CFD8906DDD9550053FA0F56C3 [email protected]
690,226,964 *474C6F5E0909CBA6449906BCE5E00DA24177454E lois-pitcher
690,226,965 *47431FDE99675B94D085DED972EE9AB50A9ACCE3 LONNIE.BEHRMAN
690,226,966 *474A4E8831E3158429D7ABA1E5F31899A5B7CDE1 lori.steger
690,226,967 *4740B2F8C141A0F40955425073CE8F5852A64455 LORWOODBSW
690,226,968 *474E104E5145BD81BE93123AB8C298FAD0B428E8 LOUPARISE
690,226,969 *4740F00BC4C51AFD6D6F64E5736AA9BC72B061FD LPOOKANG
690,226,970 *474473FB5F999C3A9C2A1A3631F6CF4FBF5B02A5 [email protected]
690,226,971 *47413351816EB8E811514CE451798DDF22183D65 lucas638
690,226,972 *474122C9D70DCF2A4876057F72F96871459BEE61 luciengrapes
690,226,973 *474CA9A4CBA81F47E33503FEE15D706025E1DE23 LUFTRANSPORTBRIGADE
690,226,974 *474EF4D255DDEC8857B057F7C2DB7C4D71849F79 lupepress
690,226,975 *4740A24C93802C017E06A2F0E090A68B6E317AA5 [email protected]
690,226,976 *4746AD6E1BC8A085FB0001EE8454839CC83E4A8E LYNERBEE
690,226,977 *474520FAA83183E9C893137EA5EFBE5907B9345F [email protected]
690,226,978 *474B50C5DE3CD8D7ABCA000005C78FA0654277C6 [email protected]
690,226,979 *4740B857EECDF08CDC49AD77A6698E3A0F83DD60 madeehaahmed
690,226,980 *474CBF3AE0FBF28DE974835603E52139270B9685 MALAPRODAVNICAU
690,226,981 *474B5DF643613D820D98DC2A403074D18931A45E MALCOMCICERCHIA
690,226,982 *474DD89AAB1F8B2656B858AE8C67324D462FA64D MAN.BARREN
690,226,983 *474C84649A35AB9A52D7157DE7E85A726E8F395C MANDALOUW
690,226,984 *474F67E79192461F3DA0553692D80EDA14533B7A MANDZIERZANOWSKI
690,226,985 *4740B339C5C89F21DEC438EE59BA53E8CFEC2459 margaretpolemjeanfoixcandale
690,226,986 *4747CB226A25FB4F59B92AC51C462AC74CF9310A MAR MOORE
690,226,987 *4749D8420FA38ACDCD811E3966DE12A910AD5CAA MAROUNAWAD
690,226,988 *474AB55D58C82686EB4D76A6512EF7507AD7303D MARTINMEADERS
690,226,989 *4747529F5F9DCA714E2E1F4567FD7E5A17003336 MASKEDTRANSLATOR.BLOGSPOT.COM
690,226,990 *47442301FB8C0A38AD133C9621E3F5876298369A MATHELMAB
690,226,991 *474BABB633B131AF54446BD003954960D41FE1F1 MAUREENMINER
690,226,992 *474D59A19DFE4794F8A9A83BC3263FEE384B151E maxmanbbs
690,226,993 *474330325E73CA816D0B8B9DD286F01721AAFBB1 MAX.MANZANARES
690,226,994 *4744A9B1D5E9B54708EEA7D5FA23C4384E47CF13 MAXXTRAXX
690,226,995 *47409F3272718DF38F940755CF0FF216D4349A96 MAYONIHS
690,226,996 *4742F7A6C4A0E378C7CFDA6165B1217E5B8CC264 MEASLEYN
690,226,997 *47468CF5325E06FF75E61CECE5BED48FA00D7BC9 mediques6
690,226,998 *4745FC8BB0CCFD6FAD032B7D67FB8FC8B858D523 mértékként
690,226,999 *474A37FA6F4384E61EAA52FA3ADEB434830886E4 MIAOJINGGENG
690,227,000 *4741EDA1A99C03F02426CD2AFAB621AFE8D18435 MICHALEMAGGI
690,227,001 *4746A47429B5407F9FE0F433F677B75B9D0C8240 MICHIGANCDL
690,227,002 *4749E527E5B446723C96EF4C812A8BBD127ACF5E millbera
690,227,003 *474C149915363C2DA8CE56283E9AC449B7AED69D mitcheldanfield
690,227,004 *474C68665BE4865A07A4987F8488F7C55EA88F2C mitchellbinkowski
690,227,005 *474428EFF449082B49C05259DC96262822730C20 mitchellgouchie
690,227,006 *4748661240F382CE72BA19275FEEE74D07AD770B mmalson6
690,227,007 *4744A8D01C3B580C378B045E3617DB2B5B978B3F MONTY.BASEL
690,227,008 *47497D5553F1F47A00E5AE32A59A713A33DD2348 [email protected]
690,227,009 *4747F9C3DE5217A99B500014C110F9EE952766C6 MORRISRIP(DESTORYMIX)
690,227,010 *47485B437DA007E57EA62BBC91B07B4D41D23887 mosesmacht
690,227,011 *4748C1C253AEB2507078180F6D5B82907CA9553F mrsluye
690,227,012 *474F46170B3B2E3B917E49B5CD5C59648581EA4C MSB3STOWN9
690,227,013 *474A11C8C493A47A3E57309AC60CC7CC8F50A6F4 [email protected]
690,227,014 *4742CC3BC2311E5B502C981ADAFF6DB4CAF7106E mualiman
690,227,015 *474441A011B213355716E6D0C3DE5CB2C3FE3A02 MYFENDER96
690,227,016 *474449675DB15A69B5B9A3767283BC01EF96C46D MYGOAT48
690,227,017 *4748CFFD88BFF2428DE97BFCFB10B89F9984AC41 MYSNAKES65
690,227,018 *47411BF01E8DFFBE666CA556571E30D58611D333 NBARBARY
690,227,019 *47482CC2C284302D57B54EE99E3D39962C55CD21 NBREUKEN
690,227,020 *474429D0DC3DD6E69944808281A12CC894CCD788 neilshukert
690,227,021 *474C87C64F03905CDF273210D66751B60C017395 NËNKUPTUARA
690,227,022 *4740B61962F3B17584526745050981011BDDE6F9 NESEKNESING
690,227,023 *47404DA81B3AD403EC83550BB8D10F29445AE575 n_female.female.names
690,227,024 *474EEA97431A28B6B85206F021FC5A2F40165D73 )nh(l=nstahthcus)ns,nh(,...,)1s,1h(htapynarof
690,227,025 *474DF8FFD4377B2DDA859EBCF589571BD48AB399 nnhild!-ein-freier-kam"
690,227,026 *474C2B15F8A9E245ED28BF68D1EAF1F40737E71C NOITALUC3
690,227,027 *47496FFAF09E97DA9512FFEB25F0C489DD5A4E76 nolaneich
690,227,028 *474CDD03FEA4136B3741C145B302E2A61A443679 NONSU8ORDINA+ION
690,227,029 *474CF6EC6615B06D14248CAE115FE4910721901E norbertoseamen
690,227,030 *474018D3389731CA50771E9E1BE10A3D77BC0ACB NRTHTRP2
690,227,031 *474DF8DB4587F262F9DDA8878BCB3E22881AF5F3 NUMISMATES.
690,227,032 *474F8B61DA9207E1ACD706CDC3A520805DB25409 [email protected]
690,227,033 *47440FFC44420E8D8D53615E6E91FCC56CAC9D68 OBUISSINK
690,227,034 *474EE25A6B24CEDB3DA5F6EDD19D02719AD13C01 OGHETH
690,227,035 *474484B2BC7FB345412A4288388593A70A996689 olliemohinani
690,227,036 *47444E2EE2C01B0621C8D6851BDA3F24C5E090F5 OMAR.STENSTROM
690,227,037 *47423669035857B987D4E66A88821FDD54D9D033 onbetwistbaarder2
690,227,038 *474ECE900FB31195A83795C3F9F77CB49E1DF6C4 One.Choice
690,227,039 *47448FB14DC0A1BBCE9047232BBDD9A25F12789B ONELASTSUPPER
690,227,040 *4744425FFD618A836153A4BC100EB2D9D5D822F9 )O(-o~-0~(=3
690,227,041 *4749D47549B61661CA68E503BFEFA67320132398 }o{~`~`@==p
690,227,042 *474A873D178888B9F82C2513D5617C2BFC3DDD3C oudard
690,227,043 *4741257B0ADC04B25CD346C584DD682DF4C50F35 PÄÄTÖSJAKSON
690,227,044 *474BB0333096861C94BBB580BABDB7E6C6E6C062 [email protected]
690,227,045 *47420C86D0015ED95D5A8B25C25FCC022106F405 PATHATIS
690,227,046 *474B9A7BCCEA3637A2F91ACE1F45EF7FC407742C P=B~OSplat
690,227,047 *474D62EB70D9C1D9549D437EFD04354F9F3AC369 PIACCIALE
690,227,048 *4741D6A411FEB8841853CA349610EE576728235A polesman5
690,227,049 *474741482FD3FE2E5E60324B6D3C7B963214DDE5 p.o.s..51
690,227,050 *4747887AA5B7C0B548B3EA6F9741B31878FFAFDE p##p`(><)
690,227,051 *47464F5BE2C60211D61548CF9CD3797165313249 PREDOMIN4+ION
690,227,052 *474EC9C72A14F77C329B55CBC5F838CFC89AF89F prokr
690,227,053 *47495EB1AB53DBD4FDCE61D243F54232F586F3B3 PUSESERA
690,227,054 *47491BB86555C44991FDE32643817F62ED231E3B puundeinigebienen
690,227,055 *47497B1C721EF62FB9B34B2085B3C5368204EB54 Q68842
690,227,056 *4744BA6AEEAEC4E85A7CE804B035D849D3B47F02 Q==B * * (-_0)
690,227,057 *4749AF4339466366FC40063A1B57676940706854 q####b-~o-~o-(~_^)
690,227,058 *4747F43C2AD742316B25DF7AA2E98F949199454C qejwghqu57
690,227,059 *474C369CD480B3607DB1FD760D29A3E8BC6D5F87 [email protected]
690,227,060 *47434476B4E147C7C6DA2C8CE43AB6A7401741B6 [email protected]
690,227,061 *474F200253ABD0DF1C29DF8CEAAEA761F95F468A [email protected]
690,227,062 *4741E5732F39ECCC8C1E7956514EFF3B0C26EA82 Q) `~:P
690,227,063 *4741AAF98674692ED8C426B470170711339166CC q--->*.*Splat!
690,227,064 *474BE94BE39C7FC8E75EC73E3A1286029BFBC761 qua
690,227,065 *47417913A2118848E7B418F718C2F3B45A34E3BE QUESTIONANDO1
690,227,066 *474703B08A17973A855A56492DC34554712B3216 QUESTION-OF-FAITH-(TEE'S-FREEZE-MIX)
690,227,067 *474FE7595D9EDE4F991F031CD201AEE8B0165038 R3SHPS
690,227,068 *47487F2BDA97A71C505FB784B077BFDAA73BFFE0 Rage.Too.E
690,227,069 *4742FDE7AB2B50336D1C5D5244BB34DD2E4D263C RAJUSTIO4
690,227,070 *4742D657E6A0142A3A10AF703400DB9CE653E246 rapaces
690,227,071 *474324874B5EB04549E3A8DDA6937B07055FB3DA REDWINGWRANGLER3
690,227,072 *47460328CC49CE410A0F998AF92F2935AF86212F reedrylaarsdam
690,227,073 *47445CBC22AD6B903FF0112D41BA205AD0F458B4 REIFORMI5
690,227,074 *4740A0C5553984DBFAB766962E11A6EB8981AEE8 [email protected]
690,227,075 *474A56C90FA99BE2E2B4D925997327864E058A61 reply
690,227,076 *4741BC09CE68CF598E2C94DBB9C8F576485E52FF RESHMA.GULANI
690,227,077 *47438DB25A85813E35C910389169998A4C6AA2C7 reynaldobernardin
690,227,078 *47449E77CAB6E65AD39F3F3CF3C1A5EDCA490C1D RGYK
690,227,079 *474DEF441EAE6B4335BB744684CDC89597A37A9A RICASCA1
690,227,080 *474CCCD5495BB85496BFA707D442560838660E42 richiesurber
690,227,081 *474C667D4B565D5FCC4CC3A38124A1D0D076F980 RIGHTNOW(INSTRUMENTAL)(JAPAN)
690,227,082 *474DAD0101C5FF38E3FAC8AFAD172D1D487F4795 RIGSSTATISTIKKEN3
690,227,083 *47478FF4AE61BED4345D8F1058FA15EF50E93643 RINFRESCATOI
690,227,084 *474649677AE2E08DA2AA2C3291D62EA5994DF614 ritzcrakca
690,227,085 *47497DAD55217B1DC72ADE2ACC658866DDDDAB29 roams-the-person-way-out
690,227,086 *474AFB90D02D85F20EF1424352B6D5FCD06BD551 ROBBY.BRANIN
690,227,087 *474B23D40C2E1B0459CB0CA85A474BC6C6143A53 ROBT.SETZER
690,227,088 *47492C47B3EFFA9CBEFACD61BBD572E096F85445 ROCHESTERBRUNO
690,227,089 *47486B82A2902BC2FA674CAF9807A2B2DE87141D ROLANDO.LINEBAUGH
690,227,090 *47472BC4975ECACEC1541C99A0DC106873A07A49 ROMAN.HOBOCK
690,227,091 *4744B84B8D18EDA22E88C0F4C2F6AA8FE78F09EA RON-ELLERMAN
690,227,092 *4748A868585D808A82B64201323F71964B80D2F6 RONOPAL
690,227,093 *474CB4FB7084AE068A7747FBA3AF93CF094DB6C1 RORYKRETSCHMAN
690,227,094 *47404C7CB4C418F23E41B9A737B14E38E62C6D8C ROSCOEPERRUZZA
690,227,095 *47491812A10F9E13492E762931395BE7939BD868 roseberies
690,227,096 *474C4DE1ABC2D38C23EEC41F21059EA6A110898C r[<r
690,227,097 *4747E68D54D8D8CA01F3A77B8F87D108814939F7 sadavarti
690,227,098 *474AB59E53A580806BFE613685620FD154E9D7B4 SANDYWIND
690,227,099 *474958CAE9391E074639A921A1C294B7CDCBAD7D sangwyont
690,227,100 *47419BCB8E7B2039F58B390A166477DC98F97E41 SATIRAL'ASE
690,227,101 *47416CB8E819971EC053AE37C191693641171A38 saundra-mcdougald
690,227,102 *474F4DE1214FB7D695C16ADA51CC27C1FE5A877B SBNTLLCTD
690,227,103 *4745F3113CA50DA8BFAA61D5E1F22AAF9028FABD SCHENDEN
690,227,104 *4741403050B94F315D5E01B6FF937B0596B726E6 sdn^
690,227,105 *474659783155F1FA51DA97229206F0CA32F66DBF SE8XKS
690,227,106 *47429452051A74E72B218399B4F7F04931B814FD ŞEHZADELIK
690,227,107 *4744D2E16EEE41930C47BC8678D131D6D9A5E0CB SELFRESTRAINEDS7
690,227,108 *474CEDCAC961532BDA483CF2099819DAFB5B2B24 SEMBENE123
690,227,109 *4740FB19FA37240D9EE1915D485733D4B934238B SEQUENTIALGAED
690,227,110 *4740AFC95478806A45665AFF308CFD7F6EB6F13D SERGIOCLEMMENTS
690,227,111 *474667AE23B095AF73E87A99E29C3AA96E6B16BB sertestenyeszto1
690,227,112 *474F22C0C1C943586B9714F30855666C03521832 SETUP16115423524
690,227,113 *4747D8A2B804388FACB83B1191ED7E97AB41FEA0 seymourmestler
690,227,114 *47471A78FE52CB50B70405B75C066379524A67F6 SFIORAMENTI0
690,227,115 *4749200F5E72843B38047FB2055CFE7AFB32739F shelby-clayborn
690,227,116 *47428D5C3CEDB0E1E412D14EB2F1600ACC35E343 SHONANGWIN
690,227,117 *474378FC07E5C10814F7CDA76A7A1D7F6F9BD762 SIA LEWIS
690,227,118 *474D9F4B892A85B3EC273744E0F141EF7D762352 sigue-viviendo
690,227,119 *474DBB2C141EDE07DFB8EDE6A2EF90100499F332 sikta-mot-stj
690,227,120 *4748430939DD89F6118A58CA0F1898B6DD1D7BD1 simondetoma
690,227,121 *474ABA6D2A8D6C47DB670C8ECAF838A0394B6D95 siniecz
690,227,122 *474EADA9404F50BC16301283B096B2953EB5ECB7 SISTIEZS0
690,227,123 *4741BC46B114FD6CDD0C560FEB4C50ACDD2AB7C9 sizinesses9
690,227,124 *474E96B553558F18EB24ED3521F780BD6D8BF3E2 sofiamorgado
690,227,125 *47456E9C8210AABA80C97C38BF893DF648AFA8A5 SPACEACURA3
690,227,126 *47449B5CBC8F386EB6FEC3D59517B1E4C5BA9B26 spidersonthekeys
690,227,127 *474C25E228E1798C4CCC821BB3D2393F4113AA41 Splat o~ 0~ d###8
690,227,128 *474F75740EB5FC4A7F1A6595DA8D76D0ACF000B0 SPRMTHCL5
690,227,129 *474863E730502E6C13CC6AB027541CD2AC6971DF SPURPRUNING6
690,227,130 *4746A15EC9C455C25AE0694AAF08D80001F24689 SPYTOTOR5
690,227,131 *47475A8A6BAD6F7D3A40E85F993311E6A1A91FE2 SQUEAK,-GLASS-X4
690,227,132 *47455B185FFD0C3F9C70E80C5E9E43F858019A20 STADT-ROEMHILDDE
690,227,133 *474D0FD498C0A118034A91ED66EF30DEEE1EAEA9 STAINPRINTPUGPUGMARKPUSTULERIFTRISINGROUGHROUGH?
690,227,134 *474B3C57BE4BB0DEA15ADB84C53F0520F2FBB2EC standachance(feattreach&yamibolo)/andyoubeloved
690,227,135 *47445141B415FAC56FFC03F318018C07BC6359CE STANTONLANFRANCO
690,227,136 *47475B3A1925C3D9387CEEA4CAE30DE1F3408FCD STARTCHAMPION!
690,227,137 *47489FB756814E8732F9550995E3C60C62A0B095 STEPHANUSKIRCHE1
690,227,138 *4742E019BB6A0FB9DD345CF87085BB80AD4D4507 STEVEFLIGHT
690,227,139 *474C830A699418B9F99FAAF5ED3FAFEA43D565E6 STEVIE.RAKES
690,227,140 *47491ADED4B309A5098083444C83C7443455AE39 streetfighting.2
690,227,141 *474DC66B316F2E0AF455FB8676D9199CDE869E20 STUARTLGARDNER
690,227,142 *474239DB54ABA0EB2BA31EA053DCAB1E608E8146 šubr
690,227,143 *474DEF7D259A85FC6EE4BAC65A397B60099626CE suoulfic
690,227,144 *474386C8BE37EEA82C4C7F14B21528E01EB4BF5D surf&skateallnite
690,227,145 *474DAF2449DB37A9C4C30C1A4CA8E4641658F903 suzy2003
690,227,146 *4747E59B87DD3C0B1800A48D833D77F56D981CE2 SWIFTSPEAR
690,227,147 *4749A3E65841C9584C5AE96E84020A9C43686C7C SWIMMINGTINTIN
690,227,148 *4740AAFC41151A94E284C090A25598879DA1A53B T04R5314M
690,227,149 *4743D21947371C30BF15B0AB71C5F9A545AF02B3 T4H0E
690,227,150 *4742C555B2F552152487C87044C1A5797A6C67B2 T4Y
690,227,151 *474DB3298BB9ABB6B7D8DF306F41F917BB29D5FC tachotypes5
690,227,152 *474FEC1B772D7CBEA06984E75F559189FF5B916E TALKSTEVENN666
690,227,153 *474DD80E0EC0EF65B1B1853CA9A90D5D1466FC44 TANNER.SABOTA
690,227,154 *474F5B440B392EB0228A8D94CBB3004AF6D2CFD7 TARDISHORSESES
690,227,155 *4747B3A81752CEF5FAED819A5B1D336B1E0DDAA0 tbpi
690,227,156 *474E8396D7CC5293F7B0682807BB6B6D6CDEADF6 terrencemartell
690,227,157 *47448B83329C4CBC693459EBAD5927E85C807314 the-banks-of-green-willow
690,227,158 *474C7A04F321E96C940FD69DFF4259A221549BE9 THE.MADONNA
690,227,159 *474A225834F257E7E566A2FA00A7336E2B00657A themalibu2002
690,227,160 *474435624F909202D332F0E012B30767DFA3F440 THESINY1
690,227,161 *47409EA9082B1998924181D1EA86A17439E766CD THE-TADPOLE,-THE-WALL-NEWT-AND-THE-WATER;-THAT-IN
690,227,162 *4743B85101115B6B0DF52ACC754D2A1E19A95848 third life (time center remix)
690,227,163 *474856721F788E7D62A0B1D4025077337C19928B ti9l0ns
690,227,164 *474931068E055C169330D4C1C8683C94A7B062E3 [email protected]
690,227,165 *47493BF06967BBD39EF724829E10184FC648A079 TOBY.NIPPERT
690,227,166 *474A87C4BA28ECD9D77FA25D282114F5CB9D8F4D TOMAS.SCHLATTER
690,227,167 *474784CAAE0929C871F24CCEB0CDCC0FD9652DDF tomato.paradise
690,227,168 *474CD3C8A728EB8793DC8887E6747391B168B4B8 TONEYKEEVER
690,227,169 *474C615F2B856840491A0ED69C570CB02B41C853 [email protected]
690,227,170 *474FCF2083D3B5EDF9F1DE977DA12D15B44924DE TONIGHTTALKADRIAN
690,227,171 *474D0A228412E878661C1B59C02DC6849CBF5A0A torpedohoodhoodlumhooligankillerknock
690,227,172 *47406CE3BF0810BC22301090B05F5D07FD15C590 totality6
690,227,173 *4748EC16CD4B965A876FA06DDE0A1D32B564927B towfeede
690,227,174 *474BA8AB08396A00E077928C5795DFA502162A6B TRISTANTARPEY
690,227,175 *47476E21B99F02CF9DAC39DE6E21C2BB2D808C71 TRISTANTZAR
690,227,176 *474B0B04C443F187E46D21C777487635D76F79B6 TROY.MICCICHE
690,227,177 *47466268BF0B54F5AA3145D250C5FC8A5A566186 TRUPPENSAMMELPUNKT
690,227,178 *474FC8E73CC1ED2FD614B27B64532E0190EBD3FD truthordare
690,227,179 *4744D7137DFD3AD0EB700FBCA8DED272D380F9E2 <TT>1048ackpredictionsok</TT>
690,227,180 *474D0C2413917A807F0E23033C35941E101C1511 TTCCGCCTCCCAGGTTCAAGTGATTCTCGTGTCTCAGCTGGGATTACAGGCGCCCGCCAC
690,227,181 *474D3E902373D822BCA6CC8F9D6A89E7170293B0 [email protected]
690,227,182 *474FB7992CB67BC3D733D8596296E6F830074109 'twixt-crimson-shame-and-anger-ashy-pale:
690,227,183 *47476DA4CADBCA10452C9ABFE5196C0613DAFE98 [email protected]
690,227,184 *47414A126486BC645EF038E3F9AD0D4F67067A87 tylerbaines
690,227,185 *4747E70CF23C635E8E8A7E0CBD7BA682B12D4A12 UBRIACONE7
690,227,186 *474897E99F3CBD768E70CC10466F30205D102B45 UNTERKEILEN
690,227,187 *474C984D43A7822F97DA27F016FC323DC9BC487A UOXI
690,227,188 *474885B1971CA438C2D926B1D9C48B43981A4082 USERBOX3N
690,227,189 *474DAFFF5558C382D27D7ACCA7401933DF8115FF UTOːPJA
690,227,190 *47450CDA5254D5436715F64C3E351E03E6E82002 UUTSIDUU9
690,227,191 *474184E5F3CBC9CAFDC4660736CED114B4D8B0C4 V90784
690,227,192 *474EA061672460699148F40D6059562DD8364637 VACATIONMAUI
690,227,193 *474248A08FEB4A406D1BCBB96F4A1C07036B98AD VALENTIN.BLISKE
690,227,194 *4745A1B57FF37C86FC709DE483B7B1780CDA2081 VANILLACONTROL6
690,227,195 *474A60C005C13E0675736C3B1D90F86F244FBCED [email protected]
690,227,196 *474A51F2670AC3C7A4C07EC8B981C298A02B8E0D VERMINPR3
690,227,197 *474EE49DF2BFB6BF1DD790F959F4CB67DBDA4C7D VERNONSWANSTROM
690,227,198 *4748E14A772E977436F1A61279D1332A58930569 [email protected]
690,227,199 *474577E6991BA597FA93A4267D661570AE364F61 vicentezotos
690,227,200 *47481AAFBB339C8691DBE5B5D27C4F0A7B729F63 VICKIVULTEE
690,227,201 *47450BF304426A60C041C459CB2733B6058F4B42 VÖKTUÐ
690,227,202 *474EE0B6BB1D363D7CD25B33E88F52A2E572387E volcano-allegre
690,227,203 *474D6D847387FB2DC8C0D34906F4C2FE447BCC47 VON.FEYH
690,227,204 *474EBDA938B6167560A6C5B107EEC7D12EC40F5A VONMISES
690,227,205 *47497AD9BA9F3C9B8564A88D194099A1A084506F VRUNDA KHISTI
690,227,206 *4746658800CF10C40A090D36B82187F28D2F6DFA w311-acqu
690,227,207 *47436BA7221E3CE1330E279B5C2AB3A8CCC43150 waldoimam
690,227,208 *474C7B359DF32D0A41A86C98426F309496541A7B WALLERIANAIMPATIENS
690,227,209 *474C435E232851887D100640D6DACCD5440A1A72 WALYASSARI
690,227,210 *4745400BBE87E9B932065FB358DA2C99AB31FD40 wanda.foust
690,227,211 *474EBCC8D2BDEF139FC2517B2094F0376019A330 [email protected]
690,227,212 *4744A9DC13B193E16C46EE86E31EFA6AAC385B46 WANGPAC7
690,227,213 *474A1E3F15D3474D07F6D104C6EB19483615B8A9 WantMyDaddyNow
690,227,214 *4744D0E8DAFDDA955AE9A52595886063EEE7F4C2 [email protected]
690,227,215 *47495089416F5E7845C6CFFBC76D29693E2A12D4 WELCOMESCIENCE
690,227,216 *474D735291C76703E54C3E517C74092B9921E444 [email protected]
690,227,217 *4742994E31D62316C8D3E4DB88683110E621DFDC whatdopsychologistsdo
690,227,218 *474DA84B5BC24FD5ABFE0707ADE95841C7C9666A WHENGCUETO
690,227,219 *474542A028A08AEBC8C2DBA57454B8E7AAF8A158 WHITNEY CHARLES RING
690,227,220 *4744E66F62BCF870BF315DA72D79095C180860F5 WHITNEY.MONIQUE.WARKILL
690,227,221 *4747BEBFBD3A5EDF814D2242469238DB3A21DC54 WILLIAN.SURPRISE
690,227,222 *47469F4C92A9DB0F43C962063A0971D23255533B willie.noriega
690,227,223 *4741675B6F5EA6739598A0767A0B572D660205BC WINDMUUËLE
690,227,224 *474079EB8AF5ADF5AFEC3726AB4A602C186A5D07 WINFORD.SERCOVICH
690,227,225 *47474C6A883652EB7415544B9DA880E3B618BF4A WISLICENI
690,227,226 *4741AE3A2B241D0819102C09585C4D0CDEA6ABFA WITTEG
690,227,227 *474EC01CC1D531D06BB56D880A216740E8F18D6C [email protected]
690,227,228 *47405C92FB8956A9D921AB4102923F320E61FB84 WWWCONSERVATIONMAVENCOM
690,227,229 *474221605F8CB6E1C1ECCD01125B0DF76E0D2311 WWW.SLCSANCTUARY.COM
690,227,230 *4747D58AD8F2692A9C784FDA3CC9DBC35CDB606C wwwtchpctcdie
690,227,231 *47423A6E2065BEF4B480D84D9F70A476BBD45FC7 XANA.RAYMOND
690,227,232 *47447F211EFA56BE554DB4844B57E36164745490 xcbgcgraphicsexposures
690,227,233 *47499196586475CEB6364A2CA01CB4CE01CC2EE8 }x{~`dp
690,227,234 *474300021B143BD5BAFC0F042347ECFE19B8C977 [email protected]
690,227,235 *47486B44BD31FE5C9B62B26B1EE2CEDCA9F6F1F0 xnuuxviw88
690,227,236 *4744C5590BCBB1D53072CFF340285FD51CFA9756 [email protected]
690,227,237 *4749CD1618B32ED996C813F3C0EEFEDCDD5B1A22 XTIAN MENDOZA PADOC
690,227,238 *4744290A7C71561C53B898104F96253CAF19FA2D XYP9657
690,227,239 *474FFA566804B29C8C39E17CB2C7C0CE46F0E19F [email protected]
690,227,240 *47499677EEA690D225757FE5462423C0B020B90C [email protected]
690,227,241 *474C0EEE8AC24EC24ECFD860C6584EE9578DD062 yejjo
690,227,242 *4749901D5D1FDB94F88B1E1F0E27B5E58CBB4BBC YKSINKERTAISUUTEENING
690,227,243 *474B3461B86A94323BE4F0EEB6BEB7E6C25C8C89 YOU DON'T HAVE TO BE IN THE ARMY
690,227,244 *474469A1142CDC6F28CD9CD03D542E5681E88FE5 yours-(feat.-natz)
690,227,245 *474ED1647D9618BDE87D9156582A73F80BD176BE YPERIMPN3
690,227,246 *474F3493600DACCCA0B604C9E401CFFDF0658458 YTILIMIS3
690,227,247 *47481FE233DB45368603950FDD81DEABCC55BD6B YUWSUF
690,227,248 *47431DCDF2B530D8DD0489D049F82090AF242AE8 yvonne.forcier
690,227,249 *4744F67027E68FFB945984E0374EF4F584FD84CF ZAINUDINKUANTAN
690,227,250 *4749F90D64ECA2C34C477F8D5C3F30114E459677 zak.ansel
690,227,251 *474820578D02B1C3E547D129021D89857931835D zalij.abe
690,227,252 *474617156F9755CD524D440BC6C0D5B02BBBE15D ZARAUTZ K E
690,227,253 *4747B8D03D0C0EE31FA8642290EE17204E4E57DB ZATRPANOSTI6
690,227,254 *4748D6A5EEEE8B74D8AA7C902A371B54F6B9655C ZEGTSREK8
690,227,255 *4741C55628078F514D4FA90CDA716696A1EDEBEA [email protected]
690,227,256 *4748A2B1894C698FB159A6A689D07843A89CF62A [email protected]
690,227,257 *474D7FA4A89CC96DAE361FDF151BF9ED5880223D [email protected]
690,227,258 *47467B10376193CAA53D720BCE72FA57A05D46F0 ZOEWILDMAN
690,227,259 *47407CA271A93652AA899ABB23A8BAF6BBCBA82A ZROBILAS1
690,227,260 *474103BA575E133F4E370329320B847D7554CA53 ZTD
690,227,261 *474D0E839289F5D7079A404A10C60A25889E72D4 ΜΑΖΟΎΡΚΑ
690,227,262 *474BE0F838839F8D2628F0A5DB39627620C3871C іпацеўскім
690,227,263 *474F4FA7E27BE9E43980585E3F261807D0F5A097 КИМАНИ
690,227,264 *47470F624E199D03621E67E30996D9C4033D0C16 КОММУНАЛДЫҚ
690,227,265 *474D1525A8CD36D29F6A864A6D8D2E99D6A18492 сахарон
690,227,266 *4743013AEADAE4862DDFC43C97767196D82CD41E  ПЕШКОВОЙ
690,227,267 *474E36B825938D174665BCA183BC5CF6643146EB )には参戦不可。又、車両型式M301Sで取得している為パッソでの参戦も不可となっている(パッソは型式が
690,227,268 *47490501BBC0A0EFF7A44575DEBD5891D2FEC1C2 08.09.1875
690,227,269 *47477160C5E7C14CAEA5B21A6D5E02050AC48BA4 0ILOVEPPP0
690,227,270 *4745C6FE3A8979824BEB4A043B98071DAA8F71D4 128qwertyu
690,227,271 *4742A8F3FF620B7D5AFAA1A998F9A00D79BC1545 14-WALDORF
690,227,272 *474113851CFC2E3B4CFA352BD1DF096A24D20FB6 1527894 "INMYOPINION,THESYSTEMWORKS,"HESAID
690,227,273 *47410812ACD16A748A55E305A73A211E8F1186F1 1564-fuenfte
690,227,274 *47458146A5A55F20AFABE918315AA582C12E29DB 1862885 valtaosa tarkastuslautakunnan esitt
690,227,275 *474397E58D5771827AF8E35628737CE074DBE8B8 18EINGRABEN
690,227,276 *474D4E8817AB0B7D08E3D8901663D00D0E34A69C 19559MAN
690,227,277 *4741DAF24227529987D5FE3B0D3C1DB8FBB1D956 197357 KYSEINEN SAARISTO KUULUI MASKUN KIRKKO-JA NIMISMIESPIT
690,227,278 *474E927F62EFD859F63375182629B1982897419E 19-BEGUETERTE
690,227,279 *474C2EDDE90FFE6DD8025F02BCDF18C153ABD695 1 A-FILM
690,227,280 *474E31EC5623031CE755D218D71B8A76E95C446C 1DISCERNES
690,227,281 *4748C05810C06807E3A901F17D12A10D9C115DD2 1-GRAY-AREA
690,227,282 *4744F6F5E680CDDDF771273785BFC486D2F36C9A 1ilovedim1
690,227,283 *474A662EFCFD2F3FAC89199DC33CF33BC2042472 1LIGHT-CYLINDERS
690,227,284 *4748AA1EADD30C13554830AC116592D0E41F1962 1MP1EMEN+OR$
690,227,285 *474DEB4BEB655E1A4A9278A0049D9B9526957414 1-natura-esityksemme
690,227,286 *474BDFA106B1A873FF9104F94B00271BDEDD41EE 1 NEUGESCHAEFTSENTWICKLUNG
690,227,287 *474B9E94CEA19AD856ADB402E8119AB8A33FA94D 1NON-PROFITING
690,227,288 *4741EE960F19D8E85818F9968C0944AB42486D89 1osasijoittelua
690,227,289 *4745E997ED1E5B10300873541901DE47CF9FBCF0 1POPALL1
690,227,290 *47457DF0D1E9E55E3C3A2AE07D6CCCCB4B52318A 2084231 maksuton opetus , verovaroin yll
690,227,291 *474867094D4A30406AFE7F373D9EABBFB37F35AC 2145523 KASKENPOLTONLOPPUMINEN1600LUVUNLOPULTAL
690,227,292 *474EDD6A1212FBD91C900FB58714BA134B42C324 22JANUARY1396
690,227,293 *47451AEC514DC0B4D4A0C9238A9E09B2F69076A4 2424f75ce94e29cb8055bebc9fc3ec75tempo99
690,227,294 *474AA505B6374A0EE57F655185E1DB232A33BDD9 2895567 painajaiseni-ovat-kuin-oma-yksityinen-helvettini-
690,227,295 *4748D992BA799C2967CEF4AFEC52B8A60B5EE21B 29october1210
690,227,296 *4742C87462397AA404E3BE4D3574C292CB186288 2ILOVETALON9
690,227,297 *47491C162425F12CCD2426D7E6E2587ECD5FC7AB 2sanattomasti
690,227,298 *4746EAD2023B13DE32C4506E0018C513459BDFA8 2STOXEYE
690,227,299 *474FC32BFDFAC05FC2C7C28D2CE876A33975DFD0 2THESATORI1
690,227,300 *474D4754EB0017AD8BF9848F92EA7713BF843E0F 2.tutkipa
690,227,301 *474FD080F930C804E02CC8C35F3192CAE9251296 2[[User:Zarbon|Zarbon]]02:48,23June2009(UTC)
690,227,302 *4743C5775DA65A72892D7884F4A51C9329B17A11 2.vorjahresvizemeister
690,227,303 *4740545A477C37A632F5FE320D3180E4DA8D1157 30d3e4f90c05
690,227,304 *474F55F1055F1E4C21A990021FA61D5E97AA5F2B 31.ABSTIEGSBEDROHTE
690,227,305 *474780977CA880E60ABFFB976050A244A6837E7D 331453 bams-:-was-erwarten-sie-von-japan-?
690,227,306 *474FEA2505B3BB11E6847891D1E26098F2615309 3BBFGESELLSCHAFTER
690,227,307 *4744E7D6182B4188F12B23A046038C0FDF7CED18 3======D***)0(
690,227,308 *47403A8C30398D9893BAFE3B25558733A45D96DA 3 FAHRPHYSIK
690,227,309 *4745B3932364E1FFFE34BB935AC5EB6A46160CA7 3HCSIRULI
690,227,310 *47498A7A64AF060CBAF8533CEFC93ED4C8710C27 3MYRALINE
690,227,311 *47430E46BDB8F7DDA1416C3D5AA8029E387B6860 3POSTULEERT
690,227,312 *4744911568133BEA8DB03AF494338E58AD271B7A 3SAVDEEPS
690,227,313 *47407E1118279C21BA6108A03A4C575FD1811C3F 3SHOGS
690,227,314 *4743D84EE7C3F5EABCD73D4B22F2F99401239DD3 3TEN-GALLON
690,227,315 *474233ACEC1D84C976635D028C2E8851A98EAE04 40%AAA
690,227,316 *474ABAF1340E48F8F1812922A7319C8449B11270 488095 EPIDERMIS SILIDIR .
690,227,317 *4744DE697607735ABC4FD63380996B8CE443E85C 4951184
690,227,318 *474E3776DCC1B379D5DF39BF41C246502F3A60CE 4ATGZTBN
690,227,319 *4744F5922BE6742A6C8A8A97D4847489747D58FE 4ATLUKIT
690,227,320 *474545F41109E42067C9A699446D500D2719580B 4DEYOLLAN
690,227,321 *47422E4D609C7BF0CC45DABBE432918107E0AA1C 4ERTURBED
690,227,322 *474D3E81D6FD82689E70EF19C560053065CC80C2 4.hillers
690,227,323 *4744F78F0FF5122F6AF7AEF3EF6491814B9DC90B 4 KALENTERIVUOSITTAIN
690,227,324 *474DFACECC0C12255BCCDECC8C9077FE6F678B8C 4KITUKSET
690,227,325 *47441ED4A0B979740702D29DF0055F2EE4E0D86B 4MATEMATIKUNDERVISNIN
690,227,326 *4743B87A5DFC0ACEB5E8B35009A707F56000F4C6 4MICHELESTEVER
690,227,327 *47460C7B5938C24FE4FE8845A2CA4D0B536ADB6D 4NEWYORKJOKER
690,227,328 *4748DB328EA3B85A63A69A3CFFD0BD9FF5FF9CF1 4SNODRAGER
690,227,329 *474B31C45D815A03E32D5525F112140AD5A47CC0 4.tossuissa
690,227,330 *4744BEEEA0CA13EFA6A13D66C742974888DB6DA7 4VITACEOUSES
690,227,331 *474F202A34C653C48900CD890F484A005F3D2399 5-11-1030
690,227,332 *4742EC49FC57EC132ABEFAFD2D78D0476CAA292E 5BABISMN
690,227,333 *474111A056D1023D8DCDA1975EC251A853DB31AC 5ENDEXITVIRUS
690,227,334 *474C621EFCB81472522249B5FE37E8B68BF92A2C 5MYCICERO1
690,227,335 *474EF370201843C9CD717F41BF8435C1349D5F6A 5PETUNIAWEBSTER
690,227,336 *474BE64A6737E34AC7A391BD604D797E24D3B678 5.rakennekin
690,227,337 *474799479114B6BD05D9B786595A77FC6DFC979F 5RCRRNGLY
690,227,338 *47487FBD2A31DEF98F51DC29506DFEF839C020F1 5-SKAALAUTUVIEN
690,227,339 *47494F9F76C4A04B8DD908945285E89B7DDAA799 5URBANITI
690,227,340 *4749F7D5323EE79C5889456925B9A9709A918751 625870 divan.edebiyatInda.tUrlerin.gruplandIrIlmasI..
690,227,341 *474EC55AB6B7A0609D111D11446C7730F206C3C2 6BSWFEEDIGBSW
690,227,342 *474B81E1735B106B807C2EA0AFE820E5B8B93793 6CIBUPORC
690,227,343 *4743151CF34CCE3BCA1A4E446451A8125886096F 6HOCHWALDKRANKENH
690,227,344 *474F221057ED39E1C6A3475732395D3D663358A5 6JAGTIGSTES
690,227,345 *474ADFB707C6EB542EFE78D373A76B181CDAB9D5 6OTIEMUOK
690,227,346 *474E99386CC0EA39F735E78DAFFF80E41EECA78F 6POLITICSNAME
690,227,347 *47434E58189AA625E02AC0FC56C79BCF3044DDBB 6RITA3
690,227,348 *474376B14B12A4DAD7F39C6BD1759242138A4FC5 717madeleine
690,227,349 *474CECF6A3825200E065C596855304130D98FA39 7gaierez
690,227,350 *47417887351634652D1F474A2B30A5786EC9B8A0 7SCRAWLATION
690,227,351 *474E7C50DC841B940A787545B876EF34C3F18272 7SUZANNEPOLICE
690,227,352 *47442AB7C675723ECAA7BAB8641BBA46EC368FE9 7VANGRIMBERGEN
690,227,353 *474EB6D810F7EE8B3C1641C2B202BB6E5BB9B2A1 844410 SHE TAKES RISKS , SHE'S THE INSTIGATOR
690,227,354 *4746C3F8EAD0B235F4343E46E64F7B2EC85B5B16 8ACANTHOCYTE
690,227,355 *474ACA05A9A2144F84BDCB097F90F7720E81448D 8-----d~0splat!!
690,227,356 *474DB5A1893C75A3BF5A3AEEB27E96BF5D372FB1 8DEDIE
690,227,357 *4744A0CBD9C4AE9CB9ADC6C1F382AF1DBDC99466 8ETNALPNU
690,227,358 *474944E2D683D745580E9C32140A93E2901E9847 8GEMOBILI
690,227,359 *4746F771EC093441CE369F4EEC053B5459E64249 8MISSOUTS
690,227,360 *4744468805E1E4A8E32A2409AEC0BF0FD9AA6AEA 8ONYANSERADE
690,227,361 *47406B7C24F322DF7C790521885EA06732AA5EA0 8-)~o}o{
690,227,362 *474597CA0B45F6412247DEE074CCE171A316CC9E 8TIFFANYROOSTER
690,227,363 *4742AEB887DA994E4BEDCE34233C9F6C551BA2B4 8VANDREHISTORIE
690,227,364 *4745739838651F1C78955406F31621E8A5C1ADFE 9GESTOTENS
690,227,365 *4747EEB1A3B9890D1799FBA580ADCFC8DDD2BC21 9PSKYNDEDES
690,227,366 *4741D1BCA52ED5F3E1958E01C93430612F61B33B 9SAKAUDEN
690,227,367 *474DD0E29A5FFFE8F592B23FB911696F083FEA10 9STARRYS
690,227,368 *47426A41D585DBC87DB4101A1CE6A58C6BDD1F8A a=#2u
690,227,369 *47424101C86365FA52F95C40D0A3135BE28CD291 A3ZSG
690,227,370 *47424AB6D4F8AE9D8335744A2A62563625B9DB6A AAALOSER4
690,227,371 *47446CB45495F7690214AE60BFFF0FF989A30DF5 AAB;>~
690,227,372 *474A1F90B57065E8C2FE492230752870413262C7 A=AD9
690,227,373 *4745A99B1CDEC2387126F4CC289D9C47DCCDA4EC aae:f-
690,227,374 *4745956209ECFF66E17FED850CE7B60CEF741A7C ABDUL.FRISKNEY
690,227,375 *474DCB054C4D9225A98784868F46920E12BACE3A abemi
690,227,376 *47472B49C26FCD78C212326B47D00890C82048A9 A.BLUR.TO.ME.NOW
690,227,377 *474DC70ED0DA978B2FC64B68822E37C926C18409 accesssusan
690,227,378 *4748C599EAC046CC487E7E9A2B9C01F9E6BB6619 ACSO
690,227,379 *474B6C994A8693FB2EC89541A577B962EA98DABE ACX/G
690,227,380 *4744500B84CA1FC8775DB643BF15A5445CA5712A AD+BJ
690,227,381 *474B98D09EBE5C856A61037A9A372CC1808381B5 ADDNAME6
690,227,382 *47455B7BC0C81C2B11286EE9101E379B0AE8B46D ADGMK
690,227,383 *474AD1E25974B5E13BE206C1CAF16B237A303BEB A"DTG
690,227,384 *474B14F807E4236AC453F483CFB80627D590BB81 AE#ZC
690,227,385 *474DD46EBCF175EA3D15343BFBC47368CFBF8A30 af!q%
690,227,386 *474403D40D986FD73716300C3EBF34A68DDE09A7 afspiedd3
690,227,387 *474F9443D12EE48AD0D04AD89C0A58BB4D6A0A00 ahm,v
690,227,388 *47466AE3D58109F3DFFB489C4B02AAC6777FD116 A/_HX
690,227,389 *474E4C16C6D91C1A6770AD0B5AB98A5835FB9A60 aizj_
690,227,390 *4740C0FC8E597B0BDFFBD05DCB65AAF89EC129F4 AJF)#
690,227,391 *4747CC6C0FA0F49CD84F9BA636A1F4EC02D8D1D2 A;JL-
690,227,392 *474C0A68F4DE508CAD19CAC37FDE7DD7F87BD401 akateemi5
690,227,393 *4740CABD050C3B23E71D4369E03C8A2AD688B6F1 AKTUSOKRA
690,227,394 *4746CE67B187DFB5C18ECA4B57705E8933B156CA akw++
690,227,395 *4748333BE9DA4D4FE8E4C2DE1346E3DC4D87735D ALEC.MASSAGLIA
690,227,396 *47450D3FF00AE7E66D60EDDD8C73A067B46F737F alessandro55
690,227,397 *474B810536C81DDE2A91B4C7E872BAAAB3CA13D0 ALFREDSCHLEIG
690,227,398 *474332042CAD5312972A5F99A70C8ABFB0EF8B53 Alpha8e7zer
690,227,399 *474141855AFE8BF4FF414485C807A1829E2D8015 alphonsobrant
690,227,400 *4749CD8F484BF2666D762AADDB292269D1B6C520 ALRP4
690,227,401 *4740BDFFFC8F7BCF1ED016C12B6CE7FE305F2911 AMYMCGREEVY
690,227,402 *474CE739299D2E827C718A4B0489DD18AA50CAB2 ANA.LEA.GUTIERREZ
690,227,403 *474A5BB74668CB5334552594C94749713534A1E2 ANDREASDOBMEIER
690,227,404 *474876C05B07F4B82171C940F7CA5B9BF065BF3C ANDREASMCEATHRON
690,227,405 *474D87DB16C2D1B00E70B7D31CF71E3A40597728 andrehåndsopplysning
690,227,406 *4745551CE2649DB2EECDD5D9806BC4C861885B00 ANDREPLIML
690,227,407 *47492DEB7FFBF7E3480CF975DE375FA68742FB83 ANDREWSHAHEEN
690,227,408 *474C270203FD195FC4BDA63413CBFC3F41EF27E1 angelsolow
690,227,409 *474E836A456FB93A3E4DF87E20FBB199D6D4D9AD anicivvaed
690,227,410 *47401365A737E80009CAD73618137BB5A27C013E anna-bent
690,227,411 *47464239940F8FA2041C9AF92F645FD2B6839E0B anoint-5
690,227,412 *474E2FE2E0EFBAEB27CE33FD6837DA419F359F09 >a/<noitcudortni-.1>"043961428_1hmw_#"=ferh-a<>il<
690,227,413 *474E6A0D522E1799A0BC6304FFFC23B9344AB3EF ANTIONESARDINA
690,227,414 *47431C4C91688BE9940AFAE0893D3A09B4945CF7 antipirataria
690,227,415 *474237CA4984533D8ED5E414A9B2424DFE560126 antonycrookston
690,227,416 *4746A4C7F06E2B1145B467D51207330C83FEED84 ANTWANMOLLBERG
690,227,417 *474B11C4295368926D655C685FBA669FBF9F2A54 AOGH;
690,227,418 *4744576CD4BC33E12C3517DD88CE70AF5A9DD321 ARCHIESTATES
690,227,419 *474859DD04DDF38FBC2BCFD3DA382C53A88FF81D ARDENJUNE
690,227,420 *47432C13E0582717C204ABF9E5C5EFBDD4F03F5A arielshumiloff
690,227,421 *474E8B8987365CADCABE8E26CA23866CACBABEEC ARRIBA.AMOEBA
690,227,422 *4747BB1CCD79D7E3BD2CFC22150A9E58EE9EDDAA a/sdo
690,227,423 *474E3A8BA2C46298C6BFFDCFD18336CE16FE0A78 ashleymacneill
690,227,424 *4741D3F6463417773311096C64CCBAF563303774 asih; lan sem se o
690,227,425 *474F029E25B477A12CA4483C73EDE4BBF9081F0D aswu
690,227,426 *47421B623435CED0B66295BCBA413A93109A058C at.form.factor
690,227,427 *474464EB9BF10A6507804740AE4F221CA76E5ED1 a,tpb
690,227,428 *47458865CA7236D334EE5885C721561AC93C0989 ATREPSY5
690,227,429 *474624EB2B237FE61178CE791D765B257E20FE39 AUS4O
690,227,430 *47479B6B831E3F464032D5E6DD3E6C231AD77A24 avouches
690,227,431 *474096530900FDA991A4307569875F591D9F8B74 b[*_
690,227,432 *474848DEA59BA0F6CD9B79F566287B0C0CA78BDF >-B0~`(----B
690,227,433 *474C24E1E4EACD6262EA8C37A594CB684BF2E23B B0QLG
690,227,434 *474A7E5C280D57C2CDF23D55FD3E8A36C4310794 b6gir
690,227,435 *474C704519439403B4D481FDBD235D1B37E6BAE1 b9"n1
690,227,436 *4740AA09B299AAC67645F81FB5D545C4ED407311 bad;:
690,227,437 *474930D95636B1AD26597E56E9800AE825E8C177 „badewonne“
690,227,438 *474714720546146A6CC68A437A87651AF805941C [email protected]
690,227,439 *4748AFC44674CB4D854E4B7DEFEC6B19150EE9B9 BARACKHUSSEINOBAMAB
690,227,440 *474D229FF54B8C1253214D255D7C3A5081830791 BARBARA901
690,227,441 *47439ADBD9E8AF50AD39968E0A8DBFF5A4228145 barrett811
690,227,442 *474F985F44930191AB2ADA6827D1E883850AC9D3 bbqueen's(intro)
690,227,443 *47449A92D0619DBA20946EECD629860DB7F7D1A2 BDRONOV
690,227,444 *474F4D16ED189E0B3B7706D700FE26493646DAE1 be0ib
690,227,445 *474437D1A1DE45EDE1C911C7C0CC19FDC2FA5814 BEKRANSTE2
690,227,446 *474EE9A8ED78552B767C10542E95B41D9CAE5B30 BERTSIDA
690,227,447 *474702D0871DF0856542CE07DCCDC56E46514E86 betriebssysteme9
690,227,448 *474175AE7A53371F6C349388477E97C2FAEC64D1 BG+
690,227,449 *474632BA81A3D3E3B0BB7194F445F1B300BDA002 BIMANUAL
690,227,450 *4748EC6BE5F938AA3101909FC2D8B6006A9C3D51 björne
690,227,451 *474AAD53D34DAF331399593B2E8A4BB989BC4997 BL,92
690,227,452 *47472DE6C8FDD0833184995EFFEA10364811C0B8 BLIBONS
690,227,453 *47466A9B4AF14ACC5EC640071D8572D71695F0C0 BLK=I
690,227,454 *474F974D566851E633C4EC40A5C0F1D28B1224AA BMGSH
690,227,455 *47411AFC003A0D4F7E35476FC68F274CB1108353 BOBBEJARAN
690,227,456 *474CCD22443CC365067E6F111CF4ABECF081C0ED bob.climer
690,227,457 *474F2D9A99322341BDBF2C2F319ACFE146875AB1 BOTV_
690,227,458 *474BA129DD28507A6754ED56ED818F37F46AF300 *BPT
690,227,459 *4747211F98FD5ABD0223A96D2B1C0B2C74D4153E b.qi(
690,227,460 *474EFA601F895FF0929BB098D5DBE996B5311F29 Bq,U
690,227,461 *4746C23383643D09B5C595F4E0AB91330C2E7224 BRAINTREFTZ
690,227,462 *474FD47294F6017EB414C4FE7650AFED03F4AF88 braneuse0
690,227,463 *4746CC119D560DB28EEB440D5CA3AE6F420D1C80 [email protected]
690,227,464 *4749C06822F759F3DFF232FB306ED098C5D245AB br_f=
690,227,465 *474A3C74A2F547F0DB4E4FD08A2FDDF2F0C50103 BRICEEISAMAN
690,227,466 *4746457FE28AFA307EC2B26FB0C7288252FACA23 BR%JD
690,227,467 *47438EBDBA53EB5C5CE9CCE284E65D624093FF36 brla
690,227,468 *47475ADC37E7D18D4DC1D8556C40EF0681C25290 [email protected]
690,227,469 *4746F10A42F9A0D512B819DD6B04CE5DB6821776 bryze
690,227,470 *4748F175D52855EA34294A98391FBE0F051363B3 bsb;9
690,227,471 *474953E8ECA6CE908D270100D0213854CCEDAE08 B%T&I
690,227,472 *474D5F862B60313FFC85C9F3D1CBB6CAAA41C46A burletas3
690,227,473 *4746E2651A2040F481683112F763465730D00948 [email protected]
690,227,474 *47499FCDAF7DBEAABF11ED146AAE541DFF9A2EE5 burtfeasel
690,227,475 *474661F857807B3DC5B2EB754AE50B50A2A3E681 BUSTER.ASTRELLA
690,227,476 *474C4A39E35EF3A05862BA06506CF3BBE247FF4E BUU!F
690,227,477 *4742CFEEE60E7A4E069467645C6CF1F67C364CB6 BYRONMEINHART
690,227,478 *47415298D3805314AD5731DC094E5BD3A415A66B c0xql
690,227,479 *4747377B92F8C4A300C8C0ECA06A69C1590479BF C1/0
690,227,480 *4744D4AE0FAB05F38B8AD6FCF4D437237674D8A7 c=2f
690,227,481 *4745B95CAC9DD390B6868251A239FB4100783259 c%5tn
690,227,482 *474819735256B5A32E69E9D408D06B91B0DA7064 CAEREMON1AR1US
690,227,483 *4746A98137D17A31A25A4E499ADF1076DFE9C863 CAMPMEETINGS
690,227,484 *47494DA6A603C1B9C300A8EF225CDB28CBE7504F cannonry
690,227,485 *474DD0CB3E55C286C1F71BF5CF4037266183AE26 CARSTEREO(WARS)
690,227,486 *4748F421C2C603C1DE97F573F2299ED8BF513D23 CASUALGEMSCOM
690,227,487 *4740A79BB013BCD0C25770D5B2BD75F9B75B6813 CAUGV
690,227,488 *474A64E0A4436F03B2E02F643A1A922E434E177A cd2ed
690,227,489 *4746183F84BAC5BEDE85C205277FBA37AA084219 CEV8
690,227,490 *474AA8F3F0A3FCBB2C94CCBA9D89F10222915A5C CH9YV
690,227,491 *4741D0538291D03773D60E83BB6889CC2585BAD1 Check-Yo-Self-(remix-instrumental)
690,227,492 *4742BAF0F5CBB436FAD6A0B7943DE34656B3F347 [email protected]
690,227,493 *47402A4B99598C66035579D26C679AA6A42C42B6 CHEZ-VOUS.....AVEC.LA.GARDE.MONTANTE
690,227,494 *474FB8FDA73D32DF4DB26067C9E26F7938149A7B CHONGQUINNAN
690,227,495 *474FB73F142CDBCA5042B5FD5155CE9B4E9C5137 chrispetrey
690,227,496 *474E1ADD747FD9D27A0F3E32E6267BC55A314061 CHRYSALLISB
690,227,497 *4740DBF18482BDFC75F738AB84DE409A528EC002 chungscalia
690,227,498 *4745835F9B377C36B1AB08943C49DF6DFF94E8B8 [email protected]
690,227,499 *474A900802E2DC60E97067BB55B0B9DF4B4F219A CILYTECA6
690,227,500 *474591598489879185735785B9ED1DEFA854F3BB CISSITES3
690,227,501 *474E463BC2D55DD040FFD3567C9AF57D3D308145 civilwarskirmishes
690,227,502 *47409912682E75281B1151B8BE58A21FF032C946 CLARA-ANN-FOWLER
690,227,503 *474AE2C05A7FF85B0AA205AA5E224496AA37131E Classicsoul
690,227,504 *47498E77AB942B5D2461ABBB60945EC797A5477A CL?F)
690,227,505 *474BCD187DD43404EB4F59781A0F89A3D847A7C7 c(lt=
690,227,506 *474E249B0CC6181A0A29057DDDB864D5D741D4EC clydecalaf
690,227,507 *47420F969074ED92A02448FA895EC369F297E5A5 cm2ud
690,227,508 *4747FADBBA58B4C2965F6B83F29EB2DBA6983A4F cm5,+
690,227,509 *4741C7825C2E798969AB3BFBB6C472CC07F6BF0B cmnab
690,227,510 *47407B0F0A4E3B8393502613B695DDD3ADA85A47 cnmu1
690,227,511 *4742DA410A43730CFF1640617468E58FB59A7564 c$n_u
690,227,512 *47469622DE3EC51AD98C52DD3BD7B9E7CAEB002E codevasf
690,227,513 *474AF982007B4BC5FB5C57FC95E3C17B52D6B124 colettehoulihan
690,227,514 *474CBC7D12E772DF6B07F3CDBAB7AB5389DEFEDD COMPUTERJI
690,227,515 *4745187350CC45DCA097C4C8A27417624B89A6B1 confischerebbero
690,227,516 *4743F16AB023993D4BC02F2520E55151A0C48025 CORNELLTETZLAFF
690,227,517 *474B66B65A47CA883F233FAAFD127480A9620F7C COSMOSAMBA
690,227,518 *474700344CD97808FE5212419B168097AA209ACF cowboy&indianscene
690,227,519 *474C9C72F0FCF6D01F87233B615D9B9D20EA62F4 C:\Program.Files\Microsoft.Office\CLIPART\PUB60COR\BS00076_.WMF
690,227,520 *47443997F46D9C4F259CD16EEBE948E706B9F956 CQEGH
690,227,521 *4744EA0CD3E53E785F494428DABA6C60FA8D0FDC CRCOBBS
690,227,522 *474E4559FF0A50F7666788604765C3F234B2F82C creggerc
690,227,523 *474932A0E466015A484E15EB5F1596A274BD4E1E ctmga
690,227,524 *474C2ECACD066892572623376F0182ACA851F745 CUSTODIREMO
690,227,525 *4747E7EF50573C211D2AF71EDB2BBE28402A27B0 c-wd6
690,227,526 *474CED7BD2F6ADE7DC7777835C39DEE442092C6E cw$-v
690,227,527 *4740A1D5EFCE4E70419FC14F4C859EA772EE7F9E CX3EK
690,227,528 *4742CAA19B8C92E972D9E4896302EDED5CFA1D58 cz03
690,227,529 *474D5F9F478F7538CD91CB592C51D75B90C1A24D d9ayb
690,227,530 *474058A794AC671CF0D815094D0F1CDD7FE437DF D9D6D9
690,227,531 *4747AC8DDA71463E3A80BC550F2D0B6A12DD5259 DAMIENDOTTS
690,227,532 *4744FF8D205B4DD9CCF632772D7A0DC5FA200FCE DANA.KELLO
690,227,533 *474DEA8BB06545A1A588753E99D85995A9F478F8 danfroggy
690,227,534 *474192224F82387568A8A9EA83B72968090F0FDD DAVE EALES
690,227,535 *474F0CC0E8D7EE6A0988DD29B6564C6C7C56FBB1 d?bta
690,227,536 *47456DA5F266A26FC6973BF56EAB5895F5230C1D DEAO_
690,227,537 *4742C625937BA46DF6DA1A2EBF1F47F01D003330 dejecthellcomwww
690,227,538 *474A2F886BD9689802934CB4E6881EF55D12F0DB DELBERT.BORGATTI
690,227,539 *474DAE0BACE1456BB92BEA6CECC295D0997AA9C1 DELFIN98
690,227,540 *4749CE70C79C63B5DC667F9C695558AA1DDB29A8 DENIED.(GHOST.OF.DISCO.PAST.MIX.BY.ALTER.DER.RUINE)
690,227,541 *4744CBEBF9BA30500599A34BFDDA9CF4D8D639BE de$ow
690,227,542 *474DE9FE71E22D642A963E034162FCE017983E6E DEPMATSNU7
690,227,543 *474BBAD7C74569C187F6F5FD32A6EDEA599AD10D derceto
690,227,544 *474B2FAB0E760EB0D657509A9C6276A15713CB38 DFMHS
690,227,545 *47428AFF96E8F486215370622E98FE755A22BF01 dgid
690,227,546 *474F0DC4D323513DE5D7B29851177F57457A894B DISKRĒTĀ
690,227,547 *474A06E80C23495D3980EC604569859A0D3D4F93 DISPUTE.124.80.111.1
690,227,548 *4742A8DEE0FD48257EF755015AEB170B01757DBC DISREGARDAB1E
690,227,549 *474AD26F0E1E45DA7E991915D1B4283AD4A5D80A DISTRITO.DE.RETHEL
690,227,550 *474D98F929B0B950A632C8828F8D6B062919D7C9 DJM1XN0W
690,227,551 *47410B66A319A20EDCE69D1FEF652CDB1B81B7B0 DJ.MAGIS
690,227,552 *47492B0E24CBAA4D0586914ECA0D251DF3C94BB2 D)%M
690,227,553 *47479ED8527EACBACEA211DFD17BF8CCBE5F129D DOMINOESFALL(DEMO)
690,227,554 *47436C47CDEBE2FD1B3B892093DA11B9A2E09144 doodeerlijke0
690,227,555 *4747E47E34539DF3C6F10493D96DBF04800AA7A4 DRAAWSNEGLOVAN
690,227,556 *4748E577DD5EFDED70A180E8412A1E993221CDAF druppelflessen
690,227,557 *47410EDBCEA46218F51E4C0EF57ECCCCCFEC710F DSS0LVE
690,227,558 *47497228341CC3DEA5E7664B8D1C8E90DD4B2BFC DUPLEKSERA
690,227,559 *474BCBA58E4D74B91DE06409646D48393C2473D0 DV0RH
690,227,560 *47496ED291F60732C4B71E69F6D726C4A24E5A15 dxr+m
690,227,561 *4743590ECFA4711EBCB2F0B40E00C6985388FE51 dy1%c
690,227,562 *47456AADC9E9A18113879C48CFB4DEAB3CB45F47 DYLANROCA
690,227,563 *474061137EF363F1FB27B59A39BD5C8B3CD50A87 d%-z1
690,227,564 *47454BB8665BC2103B5113ADD6A3068FC335A289 DŽORDŽA
690,227,565 *47437A9D6F92B8ABE18B5FBA85B095A80E59C0A9 EATING_PAN
690,227,566 *47426DD08FD6D8432506CA5038C85B92A0118088 eddysedano
690,227,567 *4746E513E79D68C6DDA25C1A6404AA22FA79B7C9 EDWARD.AHLMAN
690,227,568 *4747B543E2C86697E5D86372DED632274D781B18 EE.AAA
690,227,569 *474080BB8B85C12C6F489F6ADD88ACE289393730 [email protected]
690,227,570 *4743349F14651104F51F71FA7B964E21D77C1CE9 EFNVU
690,227,571 *4741F3058E736AB1FABD4DE9A2934156208B133F EKKABTIUS
690,227,572 *4746C993C35D26482927EE690179F8CE628D27C1 ekwld
690,227,573 *474E9B83B63CEFF790D0FEC9B36F64A19D44CF5E ELBERT.COMBE
690,227,574 *474D619C67846573854A52C61E608FAD84B01C60 ELENCRIST123
690,227,575 *474FCF4EED2BC33FAD0BB39428D2BB31E98B28C1 $elfe$tr
690,227,576 *4740DAFDDB6750DB5584725BBB3C536F451F877E ELIA LILO
690,227,577 *474CF2581DCB064C62F5A48B87AB4563355F65D0 $ELL1FORM
690,227,578 *4746438A096AD3806C7AA0BA96BAC75D94797965 elmersteinbaugh
690,227,579 *47486F157C73C4D5AA1A97D1CB88AD9B4F357E89 ELPUEBLO7
690,227,580 *474845982FD1AA6959B55C875350B15992C5CE94 emailasterix
690,227,581 *474C9DFA71811F3D1E456E9571E486EE7101B08D emersonhoyne
690,227,582 *474DEF704E1DE905FF30AA6B209FD3B2CAD43FD1 emerytheuenin
690,227,583 *4743B62030AE90BA3AABE242625F93AFDCE388A3 emmettchernay
690,227,584 *474F767CDA5F1BED15D71E6539D9F23DE03CAE93 EMMITT.HAGGIS
690,227,585 *474777F5DC7A4F238ED011E3E3C68113E83FE1CB em,qc
690,227,586 *474C50C5CCDF6289599D4E7745EC607FECFE0265 emvoetens
690,227,587 *47413E34A149CC1A5F5EA17CA2538ADB7FF0E198 encpu
690,227,588 *474DF440F141FB583671566AFDE0522DBE0DA707 ENSARTARÁN
690,227,589 *4741ED73430B119D043A99E699A91D3326C8AF4A enz-badillos
690,227,590 *4748E1DBFC52EC49C225CE398C139FDADF1E0093 ERADPA
690,227,591 *474842CEC2768A0ABE112245476127A720991260 ERBENOVĚ
690,227,592 *474F56D1A97519E7964BF411B55BAF05F5E9EEEA ERECILEH9
690,227,593 *47498ACCA12473D5DA8E2386DCCC6F1C006B17AF ERICDANISON
690,227,594 *4745608A2DCFBA6BC86C3A53F74D2C4EEFDB66BA ERICHEMIGHOLZ
690,227,595 *4745DA9AFADEA7C630DF9D80FD7D277BB411E33D ericstoltzfus
690,227,596 *474AD8CE9A37BB8944A9787F8EF5B69E880DE164 et/9t
690,227,597 *47474ACB1004C814F856CBFBE6DA8986B951B51B ETERENUDING
690,227,598 *47499EB6982A1691A000D168D804C052591755FB etgnerev6
690,227,599 *474003CDEED77DADDBE598A5DF37E98A375FB12B EULALIA“
690,227,600 *4743B7553FDE03000766B2918E999475A90EA47C [email protected]
690,227,601 *474463255EE2D7C6D9EB2715BCC63F0E8FB99CD7 explorer1966
690,227,602 *47476B57F9DB194C3DE7F902F271F9432E37443D EZEKIEL.DAMERELL
690,227,603 *47415EF6D2A56FD8664535B6C7A477A50EBDC021 f4n+4l3d
690,227,604 *4744333CF306EF6D0208C2F6DCC166DDC814819B FACTUURPRIJS
690,227,605 *47417E4EF876F5E37629E7FCEA5E02AB8EC13DD3 [email protected]
690,227,606 *474EB2C9B8EF32EC3029B078786FC9629725BEBC fedkin.1.0
690,227,607 *4749C31B1DE95AEC45E9F30E2EF020EF2D615EBA FEIGHERS6
690,227,608 *4741779C342A5C7370DEFDC2C0129ABC001E9711 FENGNILAI
690,227,609 *474C3E4A26529B27E54DCE07A7E670AABC9C399B FENICHE7
690,227,610 *47450DF434B2474730CC99EC7820A96F66DFD0D2 financiallydisadvantaged
690,227,611 *47487B3684CDEA023537BC53FB1ECFD645D54BA2 for3$1ght3dn3$$
690,227,612 *4745526F8CF3A85388FD78F476055B3F7D1F4CC0 [email protected]
690,227,613 *4748D7076E83418B46CA884B2F2EEABDB82A0D37 FR15K1N5
690,227,614 *474F160A635800ECFBF29F13879A93306706CB11 FRAITOUR2
690,227,615 *47450E54E0FDBFAAD617491D780D39EE89DC72B3 FREMDBLUTANTEILE
690,227,616 *47465B1C5D66BD62932058750CEAA8B9D776362B freskoensing
690,227,617 *4744429A6DE5FC1CE7882A5CA60CE41B7E3D6981 fuglur
690,227,618 *474E22251B35400532D3E5EB76B459063B97F42E fx(f
690,227,619 *4749065DC9E4C4AEF52977C15165EB5B03332FAF GANA MOUSTAFA
690,227,620 *474BE4256C0B04D22FDAC9072D29A19D0F97AFDF [email protected]
690,227,621 *47414AB8F9D48983A37BA509993AED943469F3FE garycaunt
690,227,622 *474922D0BACD3D84DBF1F7669799C650FB575F25 gbfmldcfrgrq
690,227,623 *474E7B52D79B7B28AC7223523B8216861D7D0AB5 GERARDO.IVANS
690,227,624 *4743C1C5CB0D1A8CB2E9C69D19DFC88CE6676AA8 GIANA340
690,227,625 *474462F005E609EE4D9AC9F3557F5F9C6B1A1C41 gimmie-your-autograph
690,227,626 *47418EDB8DF9F77F5E57395F754250532F4B4E41 GIRLSBUSS
690,227,627 *474963E9335DCA8BF244F4A9C73EE54D7F5CE7FC [email protected]
690,227,628 *474A0D707A9751C6BB1DD03B9ED90679242AC5F1 glendome
690,227,629 *474230CDB62D95E689E7152228B4ACFF9781C41E GLENYSBLEARS
690,227,630 *474B922356168A8BF7F3CF94981C1FE8E8322121 GMUTQAW12
690,227,631 *47402E0449CA229DE88E47C147AFCE3BE1119762 (GOODBYE)-ONCE-UPON-A-TIME
690,227,632 *47462715276AFC5B2A3A10927B90C2CC7359044E GREG.ABSTRAKT.CH
690,227,633 *474590AD83BBDB050F7338AF9BAE8E1F7939B32A GREGGROLEK
690,227,634 *474651421063447E64F7CF77ECBD06FAFB9E86E6 GRUBCOMMON
690,227,635 *4746F34AA0D037E424BAA63F5B0C1ADE9D68C7B8 GUILLERMODESMOND
690,227,636 *4743E4B9763999EA97E8E244D98D3D1599DA650A GUITAR.JAM.(B)
690,227,637 *474B688FDF1193FBA57E1A80C33C5DFEDDB24D0C gunjanrathod
690,227,638 *474314D93CB4EF8039E350F6778DFEE4836DD0CF [email protected]
690,227,639 *4745613D5464A9A659A6AF5C77CB6E14DE265378 HAMOIR123
690,227,640 *4740BF67A664AD7640A5E39664D1671F57547ABB hannahwild
690,227,641 *474B42FE0B0DC2F54E2EA452517B905CFF9FA137 [email protected]
690,227,642 *474C3930ECC930C4DD09E084E0882E1CBB7214C2 HEATHHOWAT
690,227,643 *47498E2BBB85ECF277AF8318868AEA4693FDAE38 HELADSKÉ
690,227,644 *474E472CF1AE9BC60989A8E3A9361C9CBDBCDCFF helenputnambretz
690,227,645 *474BB957898D55FDCECE800D2B1165E2CD5C4823 HENDRIKBLAAUW
690,227,646 *4741569282971097DC0AB600ECFDF0ADDDE62BEA HENRYMCCALL
690,227,647 *474E7D3AA41BF570AF1D9415AC68CA82FADD8C4A herschelfines
690,227,648 *474660CBE10A22575C886C34EDE0E244C2D3350D [email protected]
690,227,649 *474FA7184874F33E290B21E2EF4BF15F2F790FFE HIPHOPHOORAY06
690,227,650 *474CC8CABD07E4265A0799B2CD47D40BE33240D7 [email protected]
690,227,651 *4749164B3FA2E77BC49B58FB888339CF5958BE80 HKNOETIG
690,227,652 *4740A187BFAC65E58433ECEB36B79F30BBCD860F HÓHALMAIN
690,227,653 *4749CE26269F24CD2C512C74317EBA6CB3DA609A HOKUM.BOYS.&.BOB.ROBINSON
690,227,654 *474733737F9E453680B8B219E041609202FC75A2 homerboutros
690,227,655 *474331892093622EC06304C316102D2345C22508 [email protected]
690,227,656 *47464EB51D66F184FEB338455B70D2499DC6BBF2 HOSEADINGSON
690,227,657 *474993B8EF0A186BEBDA3B5E525AA56A94EDD264 HOULUORONG
690,227,658 *4743E5124C3C9A9172D83590AA700D045654FCF0 HOWBURY 1 0
690,227,659 *4746D0FE5C7EFC9E0EA2D92DFE92D82524684DEF HOWLONG(BETCHAGOTACHICK)
690,227,660 *47439EA17333A2CD1E5B1E6F4940F9DC654DF9E2 hrabstwo2
690,227,661 *4740B216592B779B8AA2B64AFA649E2792EF422A htm
690,227,662 *47472CE2DD13B79E43635BBAC9422947CBD3FACD HUNGGUZIEC
690,227,663 *4746389C05C87EA91CDBBBD8F0129F073D258A25 hupo
690,227,664 *474C3D9F0288E79761C21891AFED0EFE537BA9A7 huxpyuc1o4ehbz7
690,227,665 *47430361F6D000D60A02E942AFADF6F23EFFFA04 [email protected]
690,227,666 *4748F9FAB1B52B9FDC5F3D5AFC8E2FA8842808DD HYPERSOMATOTROPISMUS
690,227,667 *4745FE3E8CCA6A2B3D788432178A12289C1C78BB IAMOLLIE73
690,227,668 *4749778A406FC889F30F3CCF8383BC4319A6BAF6 IGUYON
690,227,669 *474FBFBF6B6C066488F14423204660586ED38AE6 IljaRichter
690,227,670 *47497C463D4D13696B910BAEFF98E1E97657EE72 IMPROMPTUNO1INAFLATMAJOR,OPUS29
690,227,671 *474A58329D151CA3E2FDBBAA9A0B2A0A825AF6FC [email protected]
690,227,672 *474E9DA3B1F4C8EC8B708690FB01D649BD6505D9 i.played.the.part.of.a.fool
690,227,673 *47424700346A97BE0F9240A7EC6D33447F68CBA4 IQKQ
690,227,674 *474386CAE58F86D3185115839F57B04C2444159F ISARANEES
690,227,675 *4749E0DCDBE86B089C36C6298C9CA870D45979C3 ISHTAWE
690,227,676 *47469A92FAF90211D417A6B8365B3AF4808C0A80 ISIDROBURESS
690,227,677 *4748EFB8EE814F030935A2985072EDD77886336B ISRAEL-RACHEL-CORRIE-GAZA-SHIP
690,227,678 *474848EBB16137A7DB60F8E07424AA6CC0625C9E jablanici
690,227,679 *474514BD57C6FC76788E301C9DD24950581C6563 JahJahBless
690,227,680 *474D5D09A4E2F95D8AEB7353953B15BC27AEB543 janel.lucas
690,227,681 *474537FD91F1F9F8C5C48702447D17EAE4679059 JANET-TULL
690,227,682 *474D384CCAD35A60777D0482E1394D031F27EB0A JAVIER.ULLAH
690,227,683 *47490C33A3180D8DB23EC3B515FF37D94BAB1700 jay-byron
690,227,684 *4747A1C6C1F62E52010F9E8C02642F794ABACBEC jaywalke4
690,227,685 *47407E48A10A5891DEEDBA5E5F8A7952F5090A24 jejeangel
690,227,686 *474F5A254FF29B3FEB86B12C789C0A109ABDC42D [email protected]
690,227,687 *4740B4CD49792C4125FF5F089AB91B567C611117 JIMMIEMENGSTEAB
690,227,688 *474BA8B21FB98397100214552F6A599C60C143E2 jithiking
690,227,689 *4741231BEB2F5A987AE286FDDF41FEF26AA2CD98 [email protected]
690,227,690 *4745C76FE7C52C23CFFFD46BAF42B9484A772936 JOLONAS
690,227,691 *474945D440C235F502F3AE8B40191A9BE550A5DA JONAHAGERS
690,227,692 *474D075BAF2041ECC1C28E475A90A242A22A1B6E JONAH.WELCOME
690,227,693 *47409A2DDCA1F8BB5B0E158752DA376FE816DCAB joseph-sommerville
690,227,694 *4741F8D3B86B92141911030EE55E0334817F2498 JOSHBESHERO
690,227,695 *474E709808BCBE448B2F878BA5D3322063E9A5BF josiesam1
690,227,696 *474A743EC55DE5FAF26269A4796B0761D01CC33E JUST HIT ME (FEAT MC GLOBE)
690,227,697 *474BAAE9F748DD033F62A97225C652E8E7241C08 JXL`
690,227,698 *474156E936BF587FBD8CCBC61E11FC24AC3ED2F8 kadsto 1
690,227,699 *4749921228B5135359F62BF1099B5A1681AA8FE0 kaila-carter
690,227,700 *4747AA78552BC9D7EBA6D790C0A799AAE1E25F8B kale858
690,227,701 *474D91CC48FE1A82AF0905080489EB04676B2037 karenciux
690,227,702 *4748A3BAACF066CF099B6BC99B43703F59F81C74 KELLY.QUILLMAN
690,227,703 *4741760AC8A966BBAA4C80C93C377D0BFBDEC892 KENFREE06
690,227,704 *4744C47FFDF21ECE50876DA4B9CCBEB7081D6D40 KEVIN392
690,227,705 *474711D083C590CCEEC7780F5FC662DA4C9D8C91 [email protected]@+E
690,227,706 *474026232177EB0EC5C9980E670D34FD14B4DAE8 KLIGAMPH
690,227,707 *474D6A855A6C1A062D97311901C303CC1FF05DE1 KOREYSTIMSON
690,227,708 *4746AC9296583BAC2AF50D934B5B511DC0A905E5 KRISTOPHER.KRETSCHMER
690,227,709 *474C259E2B294892086FC5992C02909016180885 kunstdüngerversorgung
690,227,710 *47420D3DD60C9246AE0CBD8D1AACE3EB2A0C1B47 lainapai
690,227,711 *47452091592843C650E3C2F0F2F79DA17CC48C12 LALHOZY
690,227,712 *474489A6E92C9FE51DD091EA4D5B511ADDF4A973 laserian1
690,227,713 *4744D9A07027738BE5547BAD1A9B9BB0ECB29533 LAVERN.PEHOWICH
690,227,714 *474CCD376E49D871D3B5C7402B5160A1288BB063 LA YUNTA GUADALAJARA
690,227,715 *474AB423ADF7F436AA0B404D8BEE384C25AC358E LEEHENRIKSON
690,227,716 *4742E9B89E17D5947382FBA3E137D0CD67D261E1 LENGADOCIANU
690,227,717 *4749BB5B2178CC766251938C6D4D6246769A14A3 LEONWLODAREK