List database


# MySQL hash MySQL password
684,880,001 *46B122E241703431F54F914BE2B5B1A87639963A toreparteereplicationreply9
684,880,002 *46B6B5EBEBA8B09C795D8AAF2248F50595C24FDC to.rfabian
684,880,003 *46B25837DA120F2BB669852AF7827D76CC434997 torfschaf3
684,880,004 *46BF188031BB545FEE8789896BB47B6238359846 Torgelowamsee
684,880,005 *46B5C70507A240CA4E1A468E65C880C5BA4BCC74 Torgove
684,880,006 *46B0E5ACC45E74FBF1EEE97D1C3A85F9EF9410B2 tori creech
684,880,007 *46B233A0FB74BE2B074736179D7C6EF86A4CB79A TORI_LEE247
684,880,008 *46BEDA9FDF9A65819202C7A9F9A859A85065F7E0 Torillière
684,880,009 *46BCE9111B6A79A4C04C4220C3A0CB1F8944BF68 TORIMAN
684,880,010 *46B0253FD10FA56ABFC5686D3F4B19AA6E2322AE torineseu
684,880,011 *46B5DDC5B38EB208D458FCA2FB8C1827E734EE04 Torinouta
684,880,012 *46B72FF352DE4E542CBF86098AB1E4774CFD7193 tor$iogr4m
684,880,013 *46BB89F634115289F0D22B2336856A101E14456B torithas
684,880,014 *46B646DFF140CFE893510523B7CBAE67F1ECBC9C Toritiga3
684,880,015 *46B006E68371C1B6B9E022355B21440B682D127B torizimmerman
684,880,016 *46B676BECE9AE5A8E038E26177CB695CC67BA94F torjunnats
684,880,017 *46BBD65626B8FDC9BCD0733D8B197FF87938F1E3 torklike7
684,880,018 *46B8B342D85BA5435E04EB72AE48B9B4CE52EC8A torlakia7
684,880,019 *46B6E429C1B64B91CB3212F94A2A0899B860C972 torleifbsw7
684,880,020 *46B460EF8D30AA4CF4083EE5D74A97847551928D torment4b
684,880,021 *46B14EE479C785512DA48DF1F29B1499A183FC85 tormentes soul
684,880,022 *46B4F3B2A38FC0E32B396D8FA084A9B9831153C7 tormy.bbs
684,880,023 *46B7FE1DC553C18DB7B592148F4C013C071A4A8E tornarest4
684,880,024 *46BDF74F625D0B6A23B66FADD39A109AEBA43ECD torneano4
684,880,025 *46B637EDD5A9925778610F340C6D88D51DED8014 Torneata3
684,880,026 *46B2B22464BEBD57853E165261EA1788771DA9AD tornefuldes5
684,880,027 *46B4D80C986515787FA87635377F088934688F49 tornekransen3
684,880,028 *46B66391CF86E4CD9D52F7F399D00C2CB8E7D49F TORNIMMO0
684,880,029 *46B7AF6464D0C73DC93148D4DDFDAD17CE7C15F3 töröltre
684,880,030 *46B42AF8C3884EA8B231C71694A0B61603387225 torondoybsW
684,880,031 *46BC2E8200B7DE88097A991FE85F2266C7994393 torontálvásárhely
684,880,032 *46B3EA6CA256A750E23740EA1443D5356EF9835D torontobridge6
684,880,033 *46BA18606C675D0FD7EDC98C4F0DCD441CE78C5F Torontoelvis
684,880,034 *46BB81735AA0042F6DA6AD247608CED4A8569C63 torontohola3
684,880,035 *46B72AFE9F89603C6DA97725020E88EF76AB4A49 TORONTO-INNOVATION-SUMMIT-ON-OPEN-GOVERNMENT
684,880,036 *46BBB202EB55064A895803EB7D02C12643BA2348 torontoproperty8
684,880,037 *46B783E2C7586D50AF0FFB0D7881DD776D4C3BE8 torontopsalmsing
684,880,038 *46BB59F165F4528F358D73E7813BE2CDBADAC5A9 torontosailings
684,880,039 *46B198D919602E42DCD3698EA4FDCF6298A68374 torontosean9
684,880,040 *46B2A790FF283FF26EF3C5E8A8BE03D66586D743 Torontosunbird
684,880,041 *46BE167B82725B7C060A8A3A7444E2DEBC7CA1C9 torpedinae
684,880,042 *46BC2410E5199E983E25D5642BA3B46E9283FC5A torpedojagerne5
684,880,043 *46BB45D786B920018754CB8F1A143BE8353681D5 Torpedowców
684,880,044 *46BDBAB29117579FBB39ADA64CA6B3C1CFFBDB5A Torpeedoveneen
684,880,045 *46BA0CE7B2E3DAE179F2D1B0365A514DFB043641 Torpidne3
684,880,046 *46B1957457F206AD93394D0AD5CACBC66B1E1F95 Torpidness!
684,880,047 *46BCC3D646058C277647F2BF32CB9905A48584AF TORPILLERAIENT0
684,880,048 *46B3E12C51CF6780357CD1BD3D157D91C00C2E39 torqued7
684,880,049 *46BEBEA19BD25864C3F65D84A8C612198626A667 Torrar
684,880,050 *46BD4467B4AA50C21904B0A70A6DA17CCD4A94C4 Torred1234
684,880,051 *46B1BAB1204EC6CAC0913D62E06F6132DD92DF2E Torredembarra
684,880,052 *46BEBCF689B2AA6566450C155EAABE9B15795679 torrefients
684,880,053 *46B83CDE625943B801F6C9493E1C619FF4DD9750 TORREFUTURABYRENEMGB
684,880,054 *46B02D581F542B24A6F42CA51210C88E9B4F987A torreggiavate6
684,880,055 *46B54E98FC51A6F5D461BAFFB2E0CC982B85C3F8 torregrossabsw7
684,880,056 *46BCF3C7083512FBE8FFD428CC571F1EF1065900 TorreMalles
684,880,057 *46BA7984441DD59277EC765AADDC6011486C19B2 Torrenceová
684,880,058 *46B63568745FA680326C60B191712A153816F329 Torrentlike.
684,880,059 *46B7918E103C5BA8FB9946C73DE7205F28F5D5ED torresilta
684,880,060 *46BE318148A1B92783A66DA55CD291A753F0C384 [email protected]
684,880,061 *46B13636F3A04D1E47F8DC48423AC8FB6C97DB8C torreta4
684,880,062 *46B7ED9155E99AAC1E9DE13E9BC0E42608045585 torreuef6
684,880,063 *46B18B386391E3CDFB340EBBF392F20855B39BC9 torrezneroness7
684,880,064 *46BE21187D9C69F79C05F47977CD7D69EF074F52 torrie94
684,880,065 *46BE3623642811DA8B3B490D507D8F650DEC1818 torsionsgeschuetz
684,880,066 *46B0C0B96E316D8F71B1C70DADDC966DE61529DA ‘torsos
684,880,067 *46B2D39776C2DEC7E9173C3C0E58ADDB0D4D972E [email protected]
684,880,068 *46BA90E1DF63DC4703B2BD376E544DCCA59DA9BB tortayses9
684,880,069 *46B7C6D2D8DBC808200805DAAA78915FFD6EEC54 tortellono
684,880,070 *46B563FC0963E43430D1DBE145DCA28A9E876753 tortlsla
684,880,071 *46B7494BAFBBC9013334A67E2F47939D50D0EDFD Tortoise2
684,880,072 *46B8A048367F2B89DBFEAE12B1D5099EAB612C88 [email protected]
684,880,073 *46B0D43B6902F12FE4D2F297FB26AECC07F1B907 tortouring
684,880,074 *46BF72CC90E4E85ECF3813E035E1F71C80774239 torttuo5
684,880,075 *46B03DE3EAE2A99FD4AD885164A135A6FD72D5F3 tortuga(ラ・)トルトゥガ島
684,880,076 *46BE7C2778B1DAF769845013318CAF1EEE4EB3C7 torturablenes3
684,880,077 *46B137124B11083E546F80AE6B17F474C87B8695 torture11
684,880,078 *46BE55CB9DDB89DC2661BA331A9392FC53AD02E6 tortureisdoubleplusu
684,880,079 *46BFA16A78917A317613157351852DB78FD71BE4 torturens6
684,880,080 *46B158C8FA578D8BD6FDA2BF3FA6D33A998D1D1D torturkamre2
684,880,081 *46B7CD6677421DF7A7D4BD53ADA773BAD1F20694 torusen8
684,880,082 *46B7B3E83A753237961B5A9946F7928C1AEB6A94 toruspalatinused
684,880,083 *46B6B5FF77FF10C7E6C4EEE159D0A4F0DAA1DE36 torvai123
684,880,084 *46B5F7D1C8470F6174D60D22643484F2229A2233 Tõrval
684,880,085 *46B74A6CE432578216D9445FF14D004D609B379E torvalds)、
684,880,086 *46B9EE42A1155B86CFFDF11E39781C1081D5AB0E torvalds.bbs
684,880,087 *46B4E307584A6B96D2B7D823046B483AE17F2DDD Torvenjärven
684,880,088 *46B322E0A0A327AE1C7E0E4785661BF3C0A99DC4 TORVTAK
684,880,089 *46B98A2C9B698FEB2B579C254435600E5778E8BB tory.bergesen
684,880,090 *46B243F613E381B28D910BC59720795E5B78E9EB tory.bodiford
684,880,091 *46BE87AE50530C2A90BC2D83FC5DD632A99503FF tory.boroski
684,880,092 *46B3698187B2FC7EEF0C518A2E2585FD5B5F546D tory.budzinski
684,880,093 *46BFA18FFD9C4904DB0A7C2869A584935BF2A0CA tory.fuschetto
684,880,094 *46BE85DAEC49D66F27EC6EB2D5747A6756697E98 tory.galietti
684,880,095 *46B8E7EBC601F781FE323A7EA795E4810784D83E tory.grosclaude
684,880,096 *46BE6FE2B0DA6484DD0A83074B4C4EAA183A7550 tory.halmes
684,880,097 *46BA7FA899BEAD197BDD11093C1687341519F44C tory.janosek
684,880,098 *46BDDD74B76AE780564B2607DEE1D717AAECD544 tory.lebrecht
684,880,099 *46B4362A9610433C6095F98DBBECFF246BF1EE8C tory.livingstone
684,880,100 *46BBE219D252E14C27B0E9528D90115C8C2D599E tory.pasek
684,880,101 *46BE1314A98486089E29EF21BFA29BA3AE542998 tory.ponzi
684,880,102 *46B85B22A3B7707375D629DC26E1E743F9D48A46 tory.rhee
684,880,103 *46B62F115AE5DBA920A62040EE699FD866FC680C tory.shibles
684,880,104 *46B7EC1CB1C95AEAB7CECA5CFD0DE1E23F34C3C7 tory.tomb
684,880,105 *46B3AC8D96BFFAC5BED500B1F36F115DA91C89BE tory.vickrey
684,880,106 *46B658528529DBACDAE7A4064A4CAEC10CD52F0E tory.wheeless
684,880,107 *46BBC6D7E33F3610D7131E1AD7EBC78E2FE750CC tory.widdison
684,880,108 *46BB7BA391F5E0612F6EA6CB3AE77CDF25520784 tory.wolery
684,880,109 *46BBE080D8EE4B4EC078E00FDE6B74FC9E0EE692 Torzionswaage
684,880,110 *46BBE1696A3C4F2CA19B92A7C4BD248850B1A151 tosador
684,880,111 *46B806794CFB4E1017B7517BC15649402BA279B6 TOSASTI7
684,880,112 *46B8D0BB4B3DA4C6752008317BCA71FE39F823F6 Toscanizzare
684,880,113 *46B584D1149874B208FE9AE7A24A08B9ABA5264A tos-du
684,880,114 *46B199F1A38AF22FEDB4C470A7FE34F7C623AAFB tosendened
684,880,115 *46BEA4EC5AB3F1E48469736DC4572342BEB62B42 tosexwabru333
684,880,116 *46BEDFC5C717EC0037A69C8EB0F65FBAB43431ED toshachns
684,880,117 *46B8D5A2BE901CDFAA6BD71A55FFCCDB48C8530D toshasmith
684,880,118 *46BE8946F3D0EC7141A60EDC393619BA4B79EFC0 toshweirhigs27
684,880,119 *46B6D3328EB6D48A56E7EB6E632EC4291E703513 Tosiaki,
684,880,120 *46B7F7BF55F6E732181C95AD9E142C62CD461815 Tosiasiallinen
684,880,121 *46B1B3B6A432436B4AA78DCD1DE17783A1D759E3 Tosiasioiden
684,880,122 *46B5F6BF995AC8C767A950A32D97C98CC1ACC83D tositapahtumiining
684,880,123 *46B75C1E4146CA8C8C64B4A231CD40E326CA216E Tosomenspeel
684,880,124 *46BF1B47E5B037E2A1314304CA276077CE97ED6D TOSOPEN
684,880,125 *46B0AB66884D969E91E7E96FB04D3FF95C6C3C9F tosquilla
684,880,126 *46B6A3A7BF474C9C13595099D7C394A8E729E394 Tosser5
684,880,127 *46B796EE3AB0C812CFB4C34539D42080211C6744 tossicas1
684,880,128 *46B9672E76827A4B5379B49B1978380CC41FA9B6 Tossicos7
684,880,129 *46B4A8CACDE210D80E1D9A43168C996BF2B1FDA3 Tossjö
684,880,130 *46B23D7887517E45EEED20311B91E8106B7C1847 Tossnoo9
684,880,131 *46BDAD0D24A2C254D10A59802BA40097D33BA9E2 Tossy9
684,880,132 *46B4477A1A9336FED967CC88DBA769EFEE0C1CF5 ToStoptheEverturningWheel
684,880,133 *46BA48E3A7658FB5D54733F9038F1A10D238CC91 tosusceptive6
684,880,134 *46BC7F11DB5892E1CC2D2F483E4954FA811A3EF6 t)oT
684,880,135 *46B48D18EBC87B2DC4C9A2FB86D0EC25E91CDA5C TOT1977
684,880,136 *46B4F2A07BE252723FDE98D9733FE86FEA88EBA7 tot9421
684,880,137 *46B8FDA2148F45DEC8039D4927627419DA64A873 Total drenger
684,880,138 *46B2C02933DA382877D9FAA8FEDE475DE5D4E7ED totalitarianismnatio
684,880,139 *46B560D6A42A5692E45CFEEF38DC9F8E41A72D7C TOTALIT
684,880,140 *46B54F39092F41F9609B009083FF5D15A7E2E576 totalization9
684,880,141 *46B907F4DDE3E6369B54602CAD77DEEF826D5A82 Totalsch7
684,880,142 *46B670C91518BEBA6C43C1F86200A1055E47627C Totaole
684,880,143 *46B925EC41EA165941DA560434C4EC68C52EADBC toteelas
684,880,144 *46B84F15F61F93188A8611364D8AF63796ADB008 toteuksing
684,880,145 *46BE52D1C12CC05FC0204DA925619B908EE02103 toteutunee0
684,880,146 *46B162A0C0E916843A24B676354BF6947DB0F3DE toteuutunut
684,880,147 *46B4B97A568E9427A75607416C68361990C298F5 tothatextent7
684,880,148 *46BB57A64381F2F5347735C3356EB4F1FC8A2E15 totholzbedarf
684,880,149 *46B4D36B26081AC0DA3350A7901725FDE4C4CF84 tothroweth6
684,880,150 *46B16A4FE98148ABF40A21A98591C6B152A5FAE4 totisimmista
684,880,151 *46B94B5BD053296572C2186AF5A9A6D12D977E36 totitives1
684,880,152 *46B91059ADD3FDA0F1EE9DC44B18185DA029179D Totoblue
684,880,153 *46BE26439D924299036B594FE7798F8680BD86E4 toto cat
684,880,154 *46B3CF4009B8E34E891F24F7C05B3FF0CBB6AA90 totonačke
684,880,155 *46B56CC50C996125263D0F94284C571AB464130F totopero3
684,880,156 *46BDE9689CEC2B3C487152A64A67372748A27717 totosantiago
684,880,157 *46BAFCCCE2F3A6BE6BC5EF0BAA38F45FE43F57DB Tototo15
684,880,158 *46BF945ABDBCEDE6AB1E342AFDF05FBA5B81DADF Totschweigen/dix
684,880,159 *46B881B4403B90EFB6A3D0A53A7EFAF4630A19AA TOTSKI
684,880,160 *46B7127211AB6F39B21CF3CF1E6DA0D9FF3529E2 Totsünden
684,880,161 *46BE654FE963D273A3D784361F6070FC506335BD tottalybsw6
684,880,162 *46B6D923736C8C3FE786CD3BB0EE7C51FB683E5F Tottenhman
684,880,163 *46B79C60CCD3875D5B74DDEAE6FC4E6843F1BA18 totterersed
684,880,164 *46B2FED1C7ED9D8BBB86F020AA0A1EF6F159A67E totuaittekap
684,880,165 *46B6ECE9DB98D9402E2DF837FA342F1C08D1756E Totujyo9
684,880,166 *46BEB3000A17B483BD66EDFDDF3A664C0B516853 totutumpith4
684,880,167 *46BA76349A074846267053B2464EF89B50178810 totuuselokuvan1
684,880,168 *46BDE40D92A3995C55D5C9EC6649CE855E95D1CF TOTY178568
684,880,169 *46B438CB42FC2E63D07883CA854690FB165C3AA4 tOU^
684,880,170 *46B09E70F9ADD12648EF0C0416E7DBB5CE32031F Touched by God (Katcha's '4am With Pecker' mix)
684,880,171 *46BFCFBCCC3C36C920772E7B160E4099C8FDCADD touchedbythelord
684,880,172 *46B46609426496823AB1081ED99D26B5BC1787F0 TOUCHEZ4
684,880,173 *46B94810AE98D0D0C81FB44D5DCB825C28267937 touchinbsw0
684,880,174 *46BCA2ABE5B7A710188621A8E893A27DAEEB3204 touch of evil
684,880,175 *46BE7CEC6B49E8EAADCCBD6D5D4116F6424B6DA6 touchwoodbooks
684,880,176 *46B07581938D37C6C640470BF6E697898845FDEF touebsw2
684,880,177 *46B947EA31E0E89A778CADD780BB54B1E277936F toufixm:
684,880,178 *46B30341495ADDF7C37D6F9F6A4A299E2FA9D36B toufvesed
684,880,179 *46B25133EE66C901F75C0517A6D200916D185709 Tougakus
684,880,180 *46BBBBB535134F3E6C66224218C65B077EA9EF60 toughonmetoughonyou
684,880,181 *46B120F6645FDEA4B07D5614944DD011FA3EC045 toughyn8
684,880,182 *46B475012F289118AD2DDCCFED2756CA2A388AC6 Touhunen
684,880,183 *46B03AA6C45C4897C076A7688A118267C071A543 toujins
684,880,184 *46B2EDB33E08A22129331EEE5AA705D29E70FDDB Toukotuted
684,880,185 *46BD259E16EB4B1BC941F30FAAEECF4E6B0DB56B toulalis
684,880,186 *46BB6C69C5F82520F07E38B423E29F9E8DFEF40C toulie bah
684,880,187 *46B6A857EE4141329338DCDD07CAD81CEFB2C183 toulouselautrecmonfing
684,880,188 *46B68361E2CD72150CAEED74542612369CAFAF78 toumansky
684,880,189 *46B02F4EE25F946C0B95516235E2E5F27E7E7E44 toungrammatical
684,880,190 *46B11AF07DEE7FCC047BF526C9B920B4C29EBC9A touqevadtouq8
684,880,191 *46BEC5A5D8393126D3753E2F210EDBE69294CAA2 Touqnno2
684,880,192 *46B893FCB482E8E56E79C2C8CBCCA71423C989D8 ;);touq&n\selim ;touq&
684,880,193 *46BA42D5817E2FD9EE18AA89EE74BB821F0FDAC1 touqsiohwemancintouqp5
684,880,194 *46B9290554F71926E740647C4CC0DCFB6B2B141C touqyramtouqs
684,880,195 *46B222E533D9F99459C46A4FA96EBECB93E6BB10 tourcachevalley
684,880,196 *46B8B72AFF858ADF8F6A7F0A2C51A50802475700 tourcom2
684,880,197 *46B8263E0E6AA810F2FC138FA4FF21F99B5F2C79 tourenk
684,880,198 *46B1A346DFFDB3E7D987D338EAA926CA6E744E94 tourette''musicvideo
684,880,199 *46BC178F7D2111B756829DF358D3F093849E67E4 «Tourette’s»
684,880,200 *46B8EFD86728C5BAE19E06C394FA03F2C687A617 tourism_in_punjab
684,880,201 *46B160871280BBD1F1FEF36DD4D8C17AACF77999 Touristied
684,880,202 *46B252B74402587E4D98BC342304216B8089306F tournay-sur-odon
684,880,203 *46B41D78FC5D7C222B7CF345044A5E774CC97889 TOURNEYED6
684,880,204 *46B45832F4E39FA6F7327D88D17F48E899781ABA tournez8
684,880,205 *46BEC10C13BF47FA211D6063ADEE1D6E1DA18031 Toursel9
684,880,206 *46B69731EB861849BB4DC4B2D55D806F4C98AEF2 tourtellot105
684,880,207 *46B976C9765C0F7E97F296ABD6E503687D9CDD06 Tousles9
684,880,208 *46B7836EFBF58E4FF9CB8F99F35AC1823DE98AD9 toutgenre
684,880,209 *46BDC4C9F45F419D851F7029BA37D2E148123392 továbbvezethet
684,880,210 *46B6E3C8206A022A5294A36E6083BD1CFCBAE10C TOVAGLIOLO4
684,880,211 *46B2CB43D1FF7835ECED0F94054C310B5789633E Tovariches3
684,880,212 *46B6ACECDC8B253FC93FFBB4F9F19C2DA9C6C3BB tovarman7
684,880,213 *46B3ACABCBD189C38B180F8E810431CD88384031 tovarník
684,880,214 *46B1A10DBA9E867228860762042F8DC0F0A60942 tovebirkelundites
684,880,215 *46BD9A453160092B062193D8590CE7A6AA539362 Tovenari
684,880,216 *46BADFC739739C566E3B0AAA084E029B2CC72DCA tovermiddels5
684,880,217 *46BA03308CCA02BA1565750486CDD462BDFA1634 tovermiddeltje
684,880,218 *46BAACAAE55DC9778784B9A19331FEEDFD89FA87 TowardstheOne
684,880,219 *46B4B95AACEA2CF3CD335D52F67A3669F6548320 towartdsbsW
684,880,220 *46B300DFF2CACDC64E1095B919735622CD30EFFF „Towarzysz“
684,880,221 *46B631973624DA66C6B8256D9B994C5B3D62C8C2 to watch you burn
684,880,222 *46B36B83F2405970B4B410F375C94281AE8308BF TOWELLING?
684,880,223 *46B91D690985C57E56E19AEC5755A2709C50B264 tower-bridge-south-view
684,880,224 *46B91E045F077900DAE3A3788C53FD11F4506665 Towere
684,880,225 *46B4F6DFB909F8621384384EFD2478DB116618A7 tower-steeple
684,880,226 *46B2C625A590AFAEE7DB6998716EB1F3653EF23F tower)が建設されてから、この建物へ向けて増設されたと言う。これは
684,880,227 *46BD0E1A78F5C8B2508B51E05418D043161A7997 towfiqurchowdhury
684,880,228 *46B3466425E1B1E90A33A60F53C522C582ABF4D5 Towkah
684,880,229 *46BBBCE8AB3CFF9C24C96A4C66F182573095B78F townandcountrying
684,880,230 *46BA0C65A7679891585E8E9F669C5EAC01337DE5 towncreek7
684,880,231 *46BC2505698FC01EC3557BD919BC3BF269F42FEB townguard123
684,880,232 *46B8C2835B7B72E2606A5B98DC2FA2EE2E33887E TOWN-HOUSES
684,880,233 *46B2ECFC09D4ED64DF788F697DDCF6E68431BEF4 Townly9
684,880,234 *46BC747BFE724201418438B87BBBD2C31247BB0F townofprincevillenc
684,880,235 *46B096241A8DC4C5F08280360AFB2145AD1ED674 town_planner
684,880,236 *46B9813A86CF015EB272529E840146AE9E1FECBB townsendovo7
684,880,237 *46B80B8AD85564565C4893F7BB64AD1A53336F42 Townstowns
684,880,238 *46B4B7E3E0CA022CAD4AFAAD3455D481B50C77CB towplanebsw3
684,880,239 *46BFE304BE760F588E8E2ED916EFEE85FAE7181F Tow」というフレーズも考案されている。これは、ビッグウェーヴ・サーフィンをこよなく愛したエディが現在も生きていたならば、必ずや
684,880,240 *46B3B0873BCCC31B89DA6EBBD19BF41B90C9730A toxicgroup
684,880,241 *46B2463ED6E84C156294C9F35AEC13246449656C toxiskt9
684,880,242 *46BAE4DE75341ED8EC7A53885E0408D6222E906F toxolysis6
684,880,243 *46BAD93AD0A7BE7569B60A84D1B84B8D869775CB Toxzkll5
684,880,244 *46B9898B0D2F8D4D71BE1A862AB1BEC856BEEF2E toyaknas8
684,880,245 *46B7109CDCF9D27DBB3A364BB0BC2E514B2327BD Toycoon
684,880,246 *46B6D9C030ACD0895789B48DB318F52B80D9A778 toyeres
684,880,247 *46B4CB6768F5A4BDF1F9D554D666BFB731329105 TOYLAND1
684,880,248 *46BE6614696A3462414DA591B1E94B82233A5066 toylikea4
684,880,249 *46B4AC0FE0C5713D65625B6E64DD3EE383004A5B TOYLOVETOL007
684,880,250 *46BCD2648E2F64730E7C8E614D239F0D65D9862B [email protected]
684,880,251 *46BEEAE0C3CB3C53BE0F3687890F86AC81A21C95 toyoharu10
684,880,252 *46B632310F42845003A87A90C06550311EF48AF8 toyotabasf1
684,880,253 *46B0A4C25F6B766D2C4C655BA6E9CF4240FDC6F4 toyotabrenda9
684,880,254 *46B65C76DADA1012EDD0685E8AD1902FAD33D662 toyotajimbob8
684,880,255 *46BC95AF4E767B6239EBF34A773D22DFE958C810 toyotamaddogs
684,880,256 *46BEBD929EB3AF2E944455AFB1E14CC05854C864 toyotarunning5
684,880,257 *46B76106A6EAE8ADC0BBC1C69F72DE94CDF32CE6 toyotasnappling
684,880,258 *46BC62A8E71AD31F2B5B23A4025131E8D8C70558 toyotaspirit3
684,880,259 *46BED397A73D9EB1C45522E27D6018A057DE71E3 toyotaw2
684,880,260 *46B88DC8455E817C7C115CFE7D78534824038854 toyotaw7
684,880,261 *46BAAF14C496A9C4F9B9D2E66E068F40B2B192AD Toyouramazement
684,880,262 *46B9DF425F262C96C0BDABAC082F49335F80B9CD toyuserjustsendinthe
684,880,263 *46B6A449E36F50F3723E81B08EB215540C0B8002 toywatchusa.com
684,880,264 *46B89983D4CC7439C3EADEB32D3893A160D089A6 Tozandou3
684,880,265 *46B23E634F4B2F4F1D0E79A8D776F95DED6F0599 tőzsdejátékos
684,880,266 *46B876331B8175C8D078CBB24348EC727E440963 [email protected]
684,880,267 *46B2933804F16F73B3F82049B5587F14852197D9 [email protected]
684,880,268 *46B57EAC97AC5959D961684ABC49D88EEBC73204 t)#p
684,880,269 *46B9B684DAB0E09B1CEEF07EEBF40FB45101CF02 tp50868
684,880,270 *46BCA6E969EEFBAF527AA404B51B10656F640E2F TP612
684,880,271 *46BCA4CC48F174F52ABCD696EB163CB56CF23E7A t&P7
684,880,272 *46B74CEA13F88395D205D690230FD4733466913C tp7F
684,880,273 *46B340D9BB5B70682B55B33229811AF363669D84 Tpaelpu3
684,880,274 *46BD2FB5D12CABECF6C4D16B911DECB03D2863AF tpaflbsw0
684,880,275 *46B4CD0D4A2D9871626EAB1C506A1A4095CE883A Tpanther5
684,880,276 *46B112654ADC3A9E152A8A699CB366BE80C2548C tpatseges
684,880,277 *46B646AD7D4908FF50EBF12E669FE8964DA2E1B8 [email protected],
684,880,278 *46B6FD80E4AA0012B80C17883088AC765EFCF6B3 [email protected]
684,880,279 *46B3DBD482D077AFC2E0B48B247C0A68C794171A [email protected]
684,880,280 *46BAB5BF8E34E448614A12C65A3D4471E34D4368 tpct1911
684,880,281 *46BAD372C51AC728E7695590502EF5822F81CA91 [email protected]
684,880,282 *46B0D77FD07F0E2C94AC4C9AC401A43E15282512 →TP→EB→
684,880,283 *46BB870535E7992CC265857DFBE42DDBE1617652 tpecxenonnahs
684,880,284 *46B1EE83F737E4175D9F844709501AEC1E053A8D tpeewzna6
684,880,285 *46B7DB9952192C8194D393F3F6DA2543A374680F tpelitna7
684,880,286 *46BEF8E1F6E3F1234A59FB2292AC1E9F0AF4D751 tperespireduliquide
684,880,287 *46B186B2E959C6FDBAA0662BE36AA1C7208025E0 tpermutt8
684,880,288 *46B90989DDC33DB9FD8EE238A1DCA69DB55B6ADF [email protected]
684,880,289 *46BA64AD2ADA0B1A87245384BEFF3DEC834B8CBF tpfscxmnqkd2
684,880,290 *46B6EF98F7556EF37CBA065902967E50B6C55211 TPGRPHR
684,880,291 *46B958F97E1AE3FF2417862D400C201369E3CC28 tPh&
684,880,292 *46BB430DFCC59740699669B8E6D5ADBBB9034EDB tpickens1
684,880,293 *46BE9589EBFC7629F72B67F30CB0EBE87B28F032 tpircsunbsw6
684,880,294 *46BA749B43CAF6FF86AAD3CAAD9291D9A8CCAA99 tpitxbpdwwrwq
684,880,295 *46B464FF4D80DDDF3681097E3814BE9D9DCDDB9B [email protected]
684,880,296 *46BB19C4F32A8F8EE6478666CA988713D6068C86 tplong"</a><br
684,880,297 *46B7CD867539A9872CEB400E8C8B2A660F1BD1A8 Tpmirkning
684,880,298 *46B5F7DBFAE7E480DFE1AA6B76DA8A0D340AABBD [email protected]
684,880,299 *46B36F65FAFC5FB318180CF5DB6163143AA1865C Tpodteg2
684,880,300 *46B3EC0D41C6129F04FF7919AF443FF211718E4C Tpoonkfa9
684,880,301 *46BA185F62C88F25B53A5F78F197C5AC88CFE629 tpopcorn2
684,880,302 *46B43FEF00604CA558447E261AFDEBEF8F80FAF5 tporter1313
684,880,303 *46B1F56DDFFC48964687FB4286196EEB9AB6EDDE tpotseggew
684,880,304 *46B2AA0B5CB7E6316344B31A98EDFDEE3157B2B1 tppntppn
684,880,305 *46B91F3CC07DDDAABC54991066EDA89829AABDF2 tppvtch1234
684,880,306 *46BCB42379D27F544D9ED0E366443FEE47F37145 TPresentación
684,880,307 *46BCB645AC68AFE78B0E231DCA36D67ADCC30BB0 tPs$
684,880,308 *46B8C76ECF40832F8D53E2EBCDD037DF50CD6AE4 TPS11223
684,880,309 *46B30C2D3262C7FF9EFF7FA583C7E217C26E1820 tpscriptbsw5
684,880,310 *46BAECFD3237971029980700419668C1FAB2E41B TPSRoverCrew1
684,880,311 *46B60E3C855D140FC11FF2FDCE6B31061C55F4FF [email protected]
684,880,312 *46BA7C6817302C74D3DD44C69E53598F15C2A066 Tpv
684,880,313 *46BEDE85C67A61590521E8FF25151933B2389CC1 tpwulhdjq8
684,880,314 *46B1615F9DC04782D931A194088EB57F24674F6C tpyardis3
684,880,315 *46B6A0AD1048B0F0787C1855E78DFDD753AA4B8D tPZ4zRQllZKADLIH1A
684,880,316 *46B9A6054F6FA943B6567EAEB39BA8ADA24B2DAE TP:長滝淳子
684,880,317 *46B4C6D65D4DBFB65252D1B2090053377C385EB1 [email protected]
684,880,318 *46BB22B0772D56A9397280789A0945DA4443B5F1 tq%@
684,880,319 *46B80C253346B64B6575A8F48CCBCF633AC5A2FF tq3974
684,880,320 *46BA4C739FC5AB4C69D29EC66FB82EF084D5DD94 tq474694
684,880,321 *46B6B834D7689015F1D974B2D6F9685C383DFDD3 tq8761
684,880,322 *46B13E94320E8898051EE0DCCEE858B11D6B7BB5 TQ8864
684,880,323 *46BD836AC352E4D8B9521BD87B8933162BAAD38F t)qBj'
684,880,324 *46BF77A6366AC5CFDE57BC3E312BB7B586325442 tQEf
684,880,325 *46BC7C8185C16654DA27680003258E6CD25046D3 tqehaaaacaaj
684,880,326 *46B4BDDA5F459DA94AC10F67133CB611A26D1302 [email protected]
684,880,327 *46B34C9AF0F7CB098414D9C0E3F327B79C18E1CF t(QL
684,880,328 *46BA92D22611F7DBE6FFFCA71F49BB7FE870DC2C tqlfctnqllqt
684,880,329 *46B6F62176053FA59D3F5B8768BD6A0C943AADD4 tqmnzfxhybging
684,880,330 *46BD8D3DD763650B2BD916328CDA687D55CB25E9 Tqrdansed
684,880,331 *46BAD8215B9B75493E35DD0D12490ABBF1365781 tqtnfifkcling
684,880,332 *46B64566AA2A6F558687FD49A6C5EE578D33DD23 tquwmmnj
684,880,333 *46B3F64C675F3914AF72A9F8E76331CAAB3C31E7 tquxmav3
684,880,334 *46B5B281A7F988C766A0680257A5A93D050DAC11 tQz|
684,880,335 *46B80D2DFFB6B213D78C4C8C0F083F4ADD9833A1 t~r\
684,880,336 *46BDB8A6C4976CB5F196D60207E2122391ADCA59 t)+r
684,880,337 *46B58E0216115CC8F106EFE282C6C1B8865E038D tr0ll0pe4nism
684,880,338 *46BD342D9CBB75956D915169E0C2EDE865547713 Tr0ub1e$h00t!ng
684,880,339 *46B35513BCEAB24598A38403881AD22959D4C052 tr0verem0
684,880,340 *46BB0D043BC1DE0403AD67CEAAB4CFA7CED13FFC TR1066
684,880,341 *46BEBDB974449047D10F50CC4F9469384A3261A0 tr1667
684,880,342 *46B984FCA9E9878CF618775CFD920C56F6F52393 TR19LYCER1DE$
684,880,343 *46B5D3F7810CFC69B382678BA16042ABD74A9E8A tr1ck4bl3
684,880,344 *46B6359FBCF43113721F02CFAAD1DA31ABB0F8A6 Tr1foca1s
684,880,345 *46B07CFFC985F4047F51563848DBA41B780739A6 tr1t4v4no
684,880,346 *46B623D5A3F150D34D23EF781CAA383B4CDE9878 t'R2
684,880,347 *46BDC7C576D77C96592018CEA3319444E95E9520 tr31n4
684,880,348 *46B99CC501C400B1FA3CA0D0BE3AE202BD447ED3 Tr34$0n4bly
684,880,349 *46B752298159F97655B2A091E2912D3A62958478 tr34snng
684,880,350 *46B9977471778503CBD1F42C783536216FB4E3F3 tr35l0uc4r3m05
684,880,351 *46B9114BF68D2859899FAF101F5B6C590AE1E2B2 tr3ch3r13s
684,880,352 *46B18A4E2ACC2A2EF5E22634B4B8344F61D16B31 [email protected]$
684,880,353 *46B256E63E43389FCE0D9FF0CBA37831BCC7AC86 tr41nd15p4tch3r
684,880,354 *46B02C3516D77A19BE2BA92B4181DC2B39F59677 TR49!C0MED!E$
684,880,355 *46B4CD06F613D9F935B9C57C7EB8C5043F28D630 tr4b4ll4no
684,880,356 *46B937704F2FF3603DDFDCD21A86009117ED7F78 Tr4desc4n
684,880,357 *46B99B7552233BA6530F58F82B096F425A1D293C tr4ditionn3ls
684,880,358 *46B0840C05D061589E041E31B3A1D8E9C2002ADA tr4duct05
684,880,359 *46B5935DEF1D5B205E81F3825AD18FBAB41069BC tr4g1c0m3d14
684,880,360 *46BFFD91440E02B3B517969EA246C6EE3F9B4D9F tr4lh4ro
684,880,361 *46BD41CF26334C8F8876DCFC98956926D7FE9463 TR4MMEL1N9
684,880,362 *46BCBDBC57A068A2E0D925EA3DEDF0D05EAA2AD5 Tr4n5cendent41i5t
684,880,363 *46B049003DE2F6B01019CF5230550584648732B2 tr4nc4rs3i4m
684,880,364 *46B2E3097AADF3D20173920253A8BAB8CA4E3F0D TR4N$P0RT4B1E$
684,880,365 *46B760DDDCBD8E5467C7543BF12C00CAFB4F0605 TR4NS1UCENC!ES
684,880,366 *46B6F89883CD4164DF544048885039034F905818 tr4ntruong3u
684,880,367 *46B2A73C896B1B6B61999D4B41041F349AB0BEEE t}r9
684,880,368 *46B7F8914642E83D1DBC06DD691754FA7A8A70D7 [email protected]!C0MED!E5
684,880,369 *46B06E61F37C138CC3966F2D3C0241193FBD4E8E tra1lery
684,880,370 *46B0FEC4B772EC8A3CC10F125D7B55D547D548D1 Tra9icom3di3s
684,880,371 *46B5DABF312E275781106F4EF469D886068ACB3F Traadte.
684,880,372 *46B252917AC506D2551E32FC5D781F5CDB4B6FCB traagikast
684,880,373 *46B8EABEA14E2D5E86B0E8AA8D3218B55DEA8EC1 traagzamers9
684,880,374 *46B0F339A2EB63DF0FBD34D496A7601F4B72B151 traakraa2
684,880,375 *46B9CBD008812224ED41405529497D60F248B1F7 traatspiurdegged
684,880,376 *46B96CB941C616A62BE1141EE72E3B32E1019C19 traavpooks
684,880,377 *46B6FA44469439A912BABA55F2B320B1283809BF trabalhareis1234
684,880,378 *46BAF04830CDFF19230C5E705A42B76D8D60200B Trabocca4
684,880,379 *46B843146A26627751151118015D34375395CB62 traboccavos4
684,880,380 *46B391B7206D45A4D4525CD10B946BC886B4A402 trabuoh8
684,880,381 *46BF5AB9B5D39A5BE87B3D516BCFC2194976B4B5 tracasseriën
684,880,382 *46B998D42BC41528BCCB86365336A1B437D13177 Trace049
684,880,383 *46B3D2D2EC040D7C6646CB4FE02D69DA7A535637 traceebrooks
684,880,384 *46B05A8D34342C3BC64DD702CA68ED6507994348 Tracemans
684,880,385 *46BCC0B9D6C2F15ECE0886DBC1DCE1035D73A390 TRACE\\\\'SGURL
684,880,386 *46BE19317EDF8F39B6FFEF545A80273C16034323 tracey.ackmann
684,880,387 *46B40734B4931A3DB9AF86874AB0DF118D2FBCC4 traceycollinson
684,880,388 *46BC591FDE8D84D6AEAAEFF49204E3380406C3BA tracey.declark
684,880,389 *46B1C8EA21658C741BC7272FA22130CA7459F252 tracey.denardi
684,880,390 *46B271DAD745234FCC34CC366F0EE44A8215D5ED TRACEYGIRL
684,880,391 *46BABAA33E74024ADFC8EBD1EF8F7A0160016CA7 tracey.guyll
684,880,392 *46B1783190363BA2F2372610246E80956A18142A tracey.hearst
684,880,393 *46B4F7F07BF967C0F9FCF4C50A5566098DE3DF53 tracey.infantolino
684,880,394 *46BBE1711DF36F8EE14E25AAA5BB078CCC2C962C tracey morris
684,880,395 *46B6B7BB742432A1C9D92F3755E56E79C552034F tracey.nisbit
684,880,396 *46BB1003C9D46B0F3F8060DD15AE8B937D89F060 traceynugent
684,880,397 *46BFC78F8818DCDA87F461F33CA08CCA12D2EC83 tracey.parlow
684,880,398 *46BDC6D15BF7571146221C3626A9D03CCBB3DB72 tracey.petitto
684,880,399 *46B9E10E0C8B7DD93A17A9B84180042B2F22C853 tracey.sallings
684,880,400 *46BD3251053F409D4CC1DFF1FD4D955132C4BD2B tracey.samele
684,880,401 *46BF883F61582A5CB4DC7DDE9AED9F4458D14D55 tracey.schickel
684,880,402 *46BB5A17671CCAF879C4571A87EC050B5C2788FE tracey.skwara
684,880,403 *46B161CB53D0253E5F29CBFF39A9EBF7702C0BC5 tracey.snuffer
684,880,404 *46BB5F226EBB9DA011A7288E3F2B3AAACC5166BE tracey.vanisouvong
684,880,405 *46B6D3D826B39175BBCCB8A1442178841A5C120A tracey.votta
684,880,406 *46BD1A9301400DB22F05F263802EFB132C96149D tracey.wadell
684,880,407 *46BF759263CBAEC325877A767AC58E8C103930AD traceywilburn
684,880,408 *46B9AA20FE2467B1611A2778A9F7BF988C0EFA73 tracey.yeend
684,880,409 *46BDA5295286CC322FDB44C99372493A2C980A3F TRACHELOLOGY!
684,880,410 *46BA9A4F9F2E81D693E80C6169631E1BB6983C6C Tracheotomising
684,880,411 *46BE106AAB09F54E87F4469294097381F09C1483 trachetomizzata0
684,880,412 *46B559B93807D3DA0EF93AC81FBF4791E12A9BB4 TRaci
684,880,413 *46B7EB52DA6768BBBC1D0052DFDE889A9B65C09A tracie123
684,880,414 *46B85C364D8EF0FFFBB7E2DB9B73C7D7AED09D23 tracinglies
684,880,415 *46BBAA3D42C6F2B3835AD64DCDB207BFEC74A21F TRACK00
684,880,416 *46BFB89670C7E53E2845D9CEC134428EB5367209 track1-introductionadii:rodc's
684,880,417 *46BCA47A484A040DA984F1F10900CE648DFAC92F TRACKED-VEHICLES
684,880,418 *46BC6AC8AC66232795F476C0FB26D7937096D41A Trackil
684,880,419 *46BF667F2DDB43D5D37F99DD98D25C3838EB3563 tracksillegibilityindecipherabilityjot6
684,880,420 *46B8ADE8BE64F3E6CF2D93046EC44D8307A1FC55 Tracks In The Snow (Dub Remix)
684,880,421 *46B5988238CB678D83470FC9900750E790EBC72D TRACOLLAVA!
684,880,422 *46B105FD8440E7AEFA694F78BF2BFB94B92A5F94 tractation.
684,880,423 *46B6AC3E3375F4837A1A36001F5AC12B640361F0 tractile1
684,880,424 *46B9EAEE1E546D599739C9530E207ED4BB40D6B9 TRACTILES7
684,880,425 *46B1DD6A0DAA175552D9046C208D86CBED008BD0 tractorboss9
684,880,426 *46BB6DB4A718D68ECB91A85B54BD73F70CDB911A tractorcharlie0
684,880,427 *46BA5BF7B5953306E994ADBE2CCA99F2EA63C8F6 tractorfred5
684,880,428 *46BBB647F736EE29BBA7216BCE8D2BB9BA48261C tractor fuckin' trailer
684,880,429 *46B5DC799E664AECA180A638512C6A9CB4D3AAAB tractormishkaed
684,880,430 *46B945EB1D57013686E627E7461D602C63A3DA1D tractortiffany6
684,880,431 *46B4CB0B47D20275589E29658B00216A0C6973A0 tracy.aries
684,880,432 *46BF98A7A3CFE4DCF20F2D571D779186B74AF1C0 tracyarledge
684,880,433 *46B76B3EAC59E7B4A9C7A9B2DF62F1FD3A54235D tracyballs5
684,880,434 *46BC6F2879336F17636AF5ECF67DA65F463D0BAB tracybowling6
684,880,435 *46B9DA6B1A07D7AE5F37911745F0B5107CE5E9AE tracy calabrese
684,880,436 *46B5587E1A02D4BABF8755A72350BD3584EDA772 tracycarol1
684,880,437 *46B776EF47F138227401E6D31DC32FE0270A89F8 tracycastello
684,880,438 *46B0A40A9CC62BACC2F32A450C88622D5E34A045 tracy dixon
684,880,439 *46BD043FA6ABBE44657CEDB1FA3145214F6A4000 tracy.domer
684,880,440 *46B6549CFECF7899ED8BD464A575F42FC302890C tracyduran
684,880,441 *46B42B503A2ADF8CD594B4066E932B75A6A762B3 tracy.fontus
684,880,442 *46BD4C57F81E555C61FE796D51A9F488386D1A65 tracygiants9
684,880,443 *46B7CF38BA4E5B2E90A549A7ED9F858C062E713B tracy.greenblatt
684,880,444 *46B26EC119BD554634F79ADFCEC6237CB1859E9A tracy.guerrero
684,880,445 *46BE8DA2F655A31CFF061E3EDC96626D6F221FC6 tracy.hokenson
684,880,446 *46B230D5EE0F3ECBBF197F51965A5C4CD5C5BDAD tracyjoey1
684,880,447 *46B435364F09F1DB0855713D5DE6A80C76B96A6E tracy.jund
684,880,448 *46B4FF8EF258D7E6AD33F25E9BC3545F82F52B79 tracy.kever
684,880,449 *46B8CE5CF197A7DE39BB4ACA64535328AB42E2F4 tracy.kysar
684,880,450 *46BBF6FE4F9AF5A1C476E25FD0B5A1715CBF4100 tracy.leymeister
684,880,451 *46BD955A72F1FD2F8E17B5B3BB0F110CB5FE98C9 tracy loveless
684,880,452 *46B785F7C83A5C1754C7A142BAED6B22B49FB35D tracy.maryott
684,880,453 *46B6881C52B01D65340680790A69050AD14CEA1B tracymcellenborough
684,880,454 *46BB0CC24090BD181CE0A62E72100E3C9366B096 tracy merker wurtz
684,880,455 *46BF0A1C89AB9F029FB9DC7A860714E52001AB53 tracy.osisek
684,880,456 *46B53028C266791EC66225358F545B5338194B88 tracyowens
684,880,457 *46BB9A800B0915A026F28B2ABB25C5A80A72A19E tracypanda0
684,880,458 *46B47776B351B98425B9E6F69C3071DC3B29C102 tracy.paskett
684,880,459 *46BE6A7FA27B546A3A5AD1C61FB18E81A8C7E7D4 tracypeltier
684,880,460 *46B9FC2B4EF9FCE14700C65B446AF0149B54F1C4 tracy pouncy
684,880,461 *46B4640D2B2CE223C0FE8C95BB339AC30FD188B4 tracypun
684,880,462 *46BC73D9C9B988126E339F89B6F6279E670290A5 tracy.ramal
684,880,463 *46BA5560CB3AAA3096C229AD962F5F8D5E7C144F tracy.ronquillo
684,880,464 *46B8754F5C9CDEF0068690A6EA5A8435376E606A tracy.santory
684,880,465 *46B72267EB2E6D34EBAF1039971D335E0FCF65ED tracysarchione
684,880,466 *46BCC4BCA514E3C84BF0D9CFE3F1474CBA54BA2E tracyschafer
684,880,467 *46BDFA27D0CB2A262A3327A8C483615482728A38 tracy.sinkovich
684,880,468 *46B1D7278A578DA6904BEC569AB3FCD52804242E tracy.skeldon
684,880,469 *46BF3E435963A79F23FBFA17B3881A344D551BA0 tracy spallinger
684,880,470 *46BA56B4910BFD657268D2E65AA7ADE55333170F tracysumner
684,880,471 *46B1E3BB0D9F17EED29B22B269DB70FF4FAC6A9E tracy t lim
684,880,472 *46B14A8F18D4DAADC644A5EB9D6A947F7D9A06DE tracy t morin
684,880,473 *46BD641FFC0C74B11DBF311F2E987BED5DD8B139 tracy towner
684,880,474 *46BDAAE23E70C2B584F4E2B170C78A2699EB0487 tracy visser ash
684,880,475 *46B5067991D153F0151D635CE41490FDB861373A tracy.windland
684,880,476 *46B4F415F1DC7BA2D113CDF6FF417BB1759A8ABB tracyxavier0
684,880,477 *46B46FFF2B920B5468A9B9F9C64E906995F21AA8 tracy yik
684,880,478 *46BF0EC707E2F387351B3B775EFAEC4C8038C53D Trad3rsh!p
684,880,479 *46BA3A95796862DF9D797F02AC4FE1CF1B42C796 tradeetionally
684,880,480 *46B5C42B84D12E36B5EF8B6723DF7FC66734EACE Tradegoods
684,880,481 *46B6A1242751E76373427EFBDE399751652FF72D tradeimports
684,880,482 *46BB3CE54C0179BBD5ACE62633AC0FB209D193F8 [email protected]
684,880,483 *46BB1A693DF9DB0DBC7A91822F1DE0FC46E4910C trademutual0
684,880,484 *46BB49A5BD72BA3F78DF13BB36168A21684BFCD1 trade_off
684,880,485 *46B08C24E785E7E85F30D313A5F6C64E292BA02F tradescanzia1
684,880,486 *46B22557CDAF7CF55A0CD8D937723D93D8CB7F64 tradeshowed
684,880,487 *46BA7749E3452A3695B0AAD9D43B73F2490F89D6 tradesmened2
684,880,488 *46B5821113BD4DD860E3A7DCCCABC279B0BDA353 tradetested
684,880,489 *46BFF51549A5FE5BBA17E5741F1C9322808143FF TRADETT
684,880,490 *46B32C5B64C6808CCDD927CE0CA381B9886E9DF1 trädgårdssnigeln
684,880,491 *46BEA531F9B9369B598125E19CEE02424D94630E tradicionalniju1
684,880,492 *46BEBE2D304910AE0F1AA2C5B832C352A3A14AD9 TraditionalTree
684,880,493 *46BA64EA91BB8CB198A80C69728B12D83DA6BBBF Traditionsbuchhandlung
684,880,494 *46BD884912751AF3A33E9C5DC174035448B05751 traducendosi2
684,880,495 *46B97211616816055D0FDD2BAC0A8CCAEE95B8F3 traecto9
684,880,496 *46BFFC83A7D59C4A3B0C4C9FB306D81FD634C33D traehximrofni
684,880,497 *46B6B549633B0EB92747A8A4CD939E07D780B88A traenkteting
684,880,498 *46B25E57FBCE00A2C0FDD08505BC48E3C195BB21 TRA
684,880,499 *46B641291C9E8E2EFF462BDABFD14C32578C481F TRAEUME6
684,880,500 *46BA06C106EEC803297636639C667B73B1B83AB6 traferisti4
684,880,501 *46BCE2A45FC56CC3DA4DEC2E9E22BCE4C48E56DF traferivating
684,880,502 *46B22AE3BA35E07B4C61B689E49CCE27A5B89C5B [email protected]
684,880,503 *46BE6E741378925F32E993FC69E69BC04FB1D5ED Traffies
684,880,504 *46BE1BA497601FF336A7A92231CBB2FF77DA3EA1 trafikkampanjens7
684,880,505 *46B56B68C6FFC22FAAB1E38C89970A040F636AE8 Trafikkforhold
684,880,506 *46BBECBBDCA8C22C40B1E119FD5E2706E152096A trafikrens
684,880,507 *46B5CF8D6BF0CE1A173E02FF8DCBB1C70E0745A5 trafoinduktiv9
684,880,508 *46B298914CC86DDE0781B17954FB4AF35B885B94 traforu
684,880,509 *46B6EBDB87EA9DDE0992B7A5883C656B6C325CD1 Trafset3
684,880,510 *46BC267E0232E203C2C9DE0FB70EB37120E654F6 Tragaba7
684,880,511 *46B37E07CD8F36D291A271119F98D3DA2F58AF41 TRAGBAREN4
684,880,512 *46BD6DF8D8F2E1EE4A713A8AFF86972DDF9462EB Tragediesed
684,880,513 *46BF6533FF2027B1C27F3FDDBF67F632063BB3FC [email protected]
684,880,514 *46B6229234EAF01369A0644FB6D5AB54BC386CAB tragiciseses3
684,880,515 *46B8E1B4214D7CD7224D7E0C925848432C1EE7EC tragische5
684,880,516 *46BB74E9A528BF88C94EEDC2604C9D79F84D8CF0 tragnoss6
684,880,517 *46B917F36D191709C66B6C074D2CF54E9C1596B1 TRAHIES9
684,880,518 *46B0F683D9B105CB6280BFC674B8BECDDD0D309F Trahio
684,880,519 *46BF3EA777DE2A9E1D0B2A1A456E4494D64A793D Trahnil3
684,880,520 *46BDF348688C56390BE0678CA868E1FFEAF1F4E0 trahthping
684,880,521 *46BC801686F1B41D23CD54BC6F7F55DC11CA1699 TRAIL-CONVENTION
684,880,522 *46B628A64DC5C712D9CB9C0C4B26C3D8DBDECD9F [email protected]
684,880,523 *46BC4CF16B32B9C91F583E65FCF82F8F8614822B trailjauntjourneymake8
684,880,524 *46BD6DE0A86CC50C41442B1A63AF4B86CB8AD1AA traiN
684,880,525 *46B28B428708019AB92F49077FA76BC46F024882 train2bowl
684,880,526 *46B88316AA0660768BFB87034759C87495D69F8A trainbands1
684,880,527 *46BBEFECEF9A733420C4C29F2426FB50DCBCD152 Train(disc1)
684,880,528 *46BCA90EAD2EDED0F145995D3A5CC198AD918D26 TRAINEE390
684,880,529 *46BDE400F64EBCFF4622D551C7B2CB3F2361BE26 traineetheorist.wordpress.com
684,880,530 *46BE6307C8F06B168C5E9B68EF3BB87F022BA3AF trainerarawaru(kuroiyatsuhen)
684,880,531 *46BA1FA300E9BF9B0E0C0E541B2E8D7846A243E1 trainerskwaliteiten
684,880,532 *46B0BEEA1F70ED1AE16AEA2DE78C7DD8ED56F906 trainfireballfireboltflashflying5
684,880,533 *46BD65A5ECC78F3EF58E835EA587F4C8B0E1D5C9 trainingbeavering
684,880,534 *46B0DE5BE3AA313E50A273A591666D7EE3FB3857 trainingbilbo7
684,880,535 *46BA21AFE95362B544019AFE02920B63589D0005 trainingbinky0
684,880,536 *46B3F73915A86E2BC0C7F86E1795D9D2D13DC753 training day (in my hood) (roscoe)
684,880,537 *46B44E2D9C075B912ECF47723579791B267B2EF9 trainingdonkey7
684,880,538 *46BCAB9D4E62DBC2F1F89EB785ADEA127B0C3FF1 trainingflamingo3
684,880,539 *46B277BC962ECCC499CC4224C1AC466181A675E1 trainingjoe5
684,880,540 *46BBA6827830AB2643E1A7F86216AE1333607F5F traininglizarding
684,880,541 *46B69E20D19FD9417412241A762B8268165F8732 TRAINING-METHODS
684,880,542 *46B9F601F7F3C78650DE10DE3B7E9DB4322A50C7 training—prevent
684,880,543 *46B49D4333E1BD8D2DF36A7C8D257A3F41F8BEF5 trainingremember3
684,880,544 *46BF6AE169A1F5C6F1794CA3AA5977F9085F52EB trainingskippy9
684,880,545 *46B3B0E98ECE7298D951DE2C3BBFD0BB99C4E20D trainingstella3
684,880,546 *46B239998A33DF0EB080DFC15EF850F8D9622E57 trainoffs9
684,880,547 *46BB8A9BA03481CC3667687870149710B75E40CD trainsting
684,880,548 *46B0807008D9C24AAB15D4B44FD6BB66438BB36C traintalkoxford
684,880,549 *46B2D43AFF263EF72AF216A011419ECFFB284F80 train-ticket.netwww
684,880,550 *46B9EDBA7E1E679D133DC605A6628C9132DF2DC6 Train To Fame
684,880,551 *46BC96BAA4B0045228263F6F5FEFF729AC4F01B5 Train to Wuxi
684,880,552 *46B71799A908AD95B9DD3D2BD310BC76BFD79CE5 Traister6
684,880,553 *46B09D71E80188099A53F5BE00BAA6CDCB69636D traitinsignificance
684,880,554 *46BC108EAD609CD2F4F172AD789026BB902ECE61 traitioc
684,880,555 *46BEC4392513D0933AF74F8D6840591179A04CE2 TRAITOR2
684,880,556 *46B5A001071FFA80CF59C9FB40EE70352CEE8A73 traitoreses
684,880,557 *46B8FC10C45ED3BAD26DF574EBC5745EF72580D6 trajan-stra
684,880,558 *46B862F8C3BCD5A7D04D4813A1BBB62B57E2315C Trajines9
684,880,559 *46B3A0748E511FDFC55DDB2E9BF8EB19D309E4F6 traktoosi
684,880,560 *46BC8036A3A426BF96D4423FBEC53D5D20DAB3D4 traktor romorkio
684,880,561 *46B460189888D675A932CFCA3C146DFA4F597719 traktorsku8
684,880,562 *46B8C9AD7B8412F8D53E1B6271CDF41F333E6C6B traktory1
684,880,563 *46BAB7BB0FAF06E3AD07BADE6DB86FF93F15A365 „traktowanie
684,880,564 *46BD00AFD12CF4BCB7F3FCB7308041D6C4D64E07 tralala020
684,880,565 *46BA6E234AB62C313CC344330FF99F5813A3FB45 tralation4
684,880,566 *46BD0ACA62B53FD70F29AD1143153CE026404351 traleneagivens
684,880,567 *46B58012B7DE435066C86CF7F5FDE9B8F8F4E824 tralessiens(Minus8remix)
684,880,568 *46B15A9C72DF102E37C12F653E4CFC144C030EA9 traligneremo2
684,880,569 *46BE97A7718C5DC4FC898F7B181054805FF46C0A TRAM3LLS
684,880,570 *46B5D89C71A2E582D5256E61FF874A2D6C80D68A TRAMBCZY
684,880,571 *46B7A878E16497EF3831F13194416F30AFBDD70D tramberended
684,880,572 *46B29FF7F4175EAE5B422D75B865557CB1F4F9C8 TRAMBESTUURDER4
684,880,573 *46B3CDDFA566143C4DA67859F27A3D090C6D2B07 TRAMBEUGELS4
684,880,574 *46BE052D7048AEF3397FA77EC8E5ABFAC425C5F9 tramden0
684,880,575 *46B347E1B794C468D2E2C2D7E871D1D48B71176E Tramdienst
684,880,576 *46B1DDD8E0B1A20512B4D0C59C7E891AF2A0294B trameling3
684,880,577 *46BD23BFD3BBA72F3B89A9D937C05642D355E46D tramezziate0
684,880,578 *46B62EBA47A74776245118E6D577F6DA25724A3F TRAML!NE
684,880,579 *46B469A6F61C98FC745AABB3288625E68C5D100F TRAMMELEDS
684,880,580 *46BB8FB126625AC67F6036540CEB49220422A392 trammellstewart
684,880,581 *46B9FE61250240F3D89F3CACDA122B51C7A72271 tramnetten2
684,880,582 *46BC622289F4A881C5F3A6CD0F02136FA58DC82C tramon donthatemecauseyouaintme robinson
684,880,583 *46B3FA0D71DBF4A03BA310FC4810454D20283081 tramonti7
684,880,584 *46BDD47448CADCC947E9CCD96EE2AA76F670E6C3 trampas wright
684,880,585 *46B80198B114337CAB6DD052E06A466727077608 trampio9
684,880,586 *46B1C40298E8F807E8637C10423C0D4FB9363D35 trampytrev
684,880,587 *46BCFCCEB8A2BBEFBB5BE05423F688A6316B4FAA TRAN$1AT10N
684,880,588 *46BBDF147FFF91784C5261BEFE6D05978284EF8D TRA
684,880,589 *46BE356A0083F4AF2D666794FB988C10D8769885 tranamus123
684,880,590 *46B69AECDD1AA9FF59F69FA9A01C14BA8BC6D9E2 tranassem1234
684,880,591 *46BB1540E9C209CA77B4A3FC6794D0E7605B766D Tranbidea
684,880,592 *46BBBA21C3F4E026B1962F60504A9932C683A7F1 Trance N Dance Edition 2 (mixed by DJ Philip)
684,880,593 *46B6C2B0A1E9B57DED66C2099B4257B5892C873F trancestate2
684,880,594 *46B50D46897DF28F2AF3B624134E9F8949F30956 trancezero
684,880,595 *46B6D1D853B2808BD19A2092EC209EBDD18268B6 trancheriez?
684,880,596 *46B04D2F460B9EA95A96215D8D5D99D0DD631E87 [email protected]
684,880,597 *46B0519BE749132851197360243D91859C4C95C0 tran duy thanh
684,880,598 *46BEA46E4629D98D27A18C0834B117EC429C1E9B TRANERKOYNAYELY
684,880,599 *46BC371C4A43CFD413284379B5C311D4E49EC266 TRAN$F1GUR3$
684,880,600 *46B779A173E575A2E158D16FFCADE6E0B25BD82C tranforms2
684,880,601 *46B0246CA36F3C027D33112581035B8958329BAA Trangere3
684,880,602 *46B40FC66CEE1B96407F38A4DB64368B2575F428 Trangleur.
684,880,603 *46B26E4D618DA4E23D5A89D3186D6A99B12D574C trankieni
684,880,604 *46B70E3531010B16C354C4A8350DC1E6AEDEA3CF trannebsw0
684,880,605 *46BB465D9495FBBDE86B9775B9EF044FCE71F668 Tranquada.
684,880,606 *46BD5A5E4D2B8D3558F8D05AF50B1C40D666BC9F Tranquil Day
684,880,607 *46BFA09027529E2BAA2F200487EB2B5A8FB23847 Tranquilest8
684,880,608 *46B07509663855F96500ECBF5785B393B37D6B0B tranquilinoopenion
684,880,609 *46BD06F285FE17E3317E786DA86B49581012D296 tranquilizarens2
684,880,610 *46B3388FD6937081A0E7999C6BC806670A29592C tranquillizzataed
684,880,611 *46B451DFF6234A42C09A88896BABDE127861FFAE Träns
684,880,612 *46B3B316293F55192E717410180572AF5DF297AB trans3nc3s
684,880,613 *46B510C0005CC78DD5A4E461FBB66934DFD44AA6 Transaccidentation?
684,880,614 *46B042033775157B27C0C0B5FB50F5853037118B transair's
684,880,615 *46BAC6681331E615408A565E454B2E1E63F74A73 transakcniho0
684,880,616 *46B6DE1E008343018C392D8A6732121382E24E63 TRANSALUTANUS
684,880,617 *46BDD5B14CE3D218CAADD712461CA27A43BABD67 transatlantske4
684,880,618 *46BDF56AF0ECBF4B3CD8F45B54DA8FAFC70F87E2 transats4
684,880,619 *46BFB7BE454A56A8A405CFD5005AF2F1A90A39CB Transbaikalse
684,880,620 *46B98C475CA6795FF21C95F7A7741990583354C3 transcendentalnied
684,880,621 *46B49F9BCA9F02511A48960352C1C0003D56BF2F transcendthesenses
684,880,622 *46B10612595DA5C075A31F9DD3445F955DFFD2EC transcieving7
684,880,623 *46BDC23CD2B77B09D56D8FA13305C4D079492620 transcodes?
684,880,624 *46BC37F813474FF9012796BD0D57C54C5C9EA61B transcona83
684,880,625 *46B5BD1D234E19B70D880CA9ABCB60C88BE21AE1 transcondyloidses
684,880,626 *46B23624C50B778C68F6E1029AF93FED7541FD76 Transcontinentalidade
684,880,627 *46B57E0AE86429E9C7D70254FBE63596A99391FC TRANSCRIBABLE7
684,880,628 *46B19A2489D44478127301AAD7D3883477A6B657 transcribat
684,880,629 *46BA702850C3DCF9CE71F5CBE6143150B57DF00E transcurrunt9
684,880,630 *46B514CF790514A9295D814223D13734347AFDD0 transducere2
684,880,631 *46BD5D53F55981A5F306C677BB4CE6225AB9FB71 Transducers3
684,880,632 *46B5CD6B1FCBFA354A54FB997CA43F01173B230B TRANSDUKTOROWY
684,880,633 *46B654AE9A2FB6DBF783D27B82F705DC1CD3FAB0 transeranting
684,880,634 *46B798976CA4B27C087415CAC26303857E056DDF transexuală
684,880,635 *46BBC7638C33979345C52BD75BE48D4A0E73B7A6 transferebamied
684,880,636 *46B9D6B9C8074F953E3D504FE319EB75CBEF0250 transferila1234
684,880,637 *46B5E90CC2AE4CB649A73BDE424D538DF5D37028 TRANSFEROBJECT
684,880,638 *46B2D2B90DBBC0EC35470FC0D2006078D0101F69 transfet0
684,880,639 *46B68EA68DD02EEAB4A7F3D69D98DA9CF7D7F45B transfluitoed
684,880,640 *46B6326D3542A98B06B376FBF6A9DFF4E69EA7D0 transformasieprosess4
684,880,641 *46BFFB2711E9F7F0B4621778310B3B10778A3AC7 transformateurs8
684,880,642 *46B2678C7B9C4B719F85D630436F19237AAF276C transformationaudit
684,880,643 *46BD08C6D633442A13AD98B1061DAA67B78D3A90 transformation.simpl
684,880,644 *46B37AE53E7C777D49E66B68B01FD3817317694A transformers』シーズン1
684,880,645 *46B753FB6E3AF8DBECA7549150A4DF8DB4B7903E transfromovala
684,880,646 *46B943B57123C9FC2DFA873E399F0B38BB9B7746 transfrontier4
684,880,647 *46B510AC06C1CBA288FFFE46E6D15B0D654AC705 Transftransf
684,880,648 *46BF1248783DFBE88B12F4635688D6802E17D198 transfusd6
684,880,649 *46BF7ED3BAA67EC0E3220B37830E44E7EC33D6DE transgenesis6
684,880,650 *46B6DF0C40457B83F32FAC5407CBBCC6C27EF496 transhumaist
684,880,651 *46BF369316F0EA15A08CE8DE42EEE54FFC00DCDE transigeaient!
684,880,652 *46BAB2CFFD16CCF61480AF333A162120A1013C5F transigirte
684,880,653 *46B5331DF9AF0AF28861916DD48B8E93CF244F79 TRANSITEZ3
684,880,654 *46BF79354ACA17D8CD26EE6EFF01FE44598A558E transitionstories.military.comtransitionstories
684,880,655 *46B2E0766584A2035581712118FAE29AD1E8694B transitivierte
684,880,656 *46B49840CB9B9CA43F0B902841386F718E86A38F Transitorias
684,880,657 *46B8E4115AB2736AC9F8AAD57D95D13E6DEEF0AA transivisseque1
684,880,658 *46BE74048A315F491F4DC167EF79D439534DCCB8 translades1
684,880,659 *46B92A25B01A4046BB6589ED553B7AB55D2C080B translationally123
684,880,660 *46BCB1F5F1119042083A22A3E44A229093AC0F29 [email protected]
684,880,661 *46B48F1C8C33ED172ABAE2F8767048DD2674143B translin5
684,880,662 *46B268D9FC6EB9886F9498FA35044582482D9A69 Translu6
684,880,663 *46B3E528C13E5A1794C6E503DA9FD43E6B3725DA Transmasne
684,880,664 *46BA77F61081C4957290635DBA9A0ABEEA9A72DE transmettrionsesing
684,880,665 *46B60B317D9439002F5FA998A9673986B94ACE39 transmisiunile
684,880,666 *46BACAA20908EDC44D99157B53B7CB4180A19DE8 transmissio0
684,880,667 *46B84BF5E8904EA2918C0BF06F86C6B9AFE0B71C transmisson9
684,880,668 *46BB205A6F6BC846A2A8DE04DD870BBF6636B7A7 transmitabalienateadd9
684,880,669 *46B01035B685564863F1B5079689B40800164FD8 transmudaria1234
684,880,670 *46B3209726C50F16A06BC60F05FD37E0384BC8D7 transmuteres
684,880,671 *46B58F70EF0581645D0279EEF3947E661C67AC61 transnaturing7
684,880,672 *46B2DF32B21D4AFEC9874E7197C24571D8B506E1 transnistriachicani
684,880,673 *46B0D18EFF607ED58A538D9E47D101F234257452 transocean.com.mywww
684,880,674 *46B1709D2B82927931360ECBDA877AE02182416A transolves
684,880,675 *46B76DF44AB7702143BBB0B4031920445FAF1F21 transpactar7
684,880,676 *46BF105AF6C1DB4C3D8322AC2D6AD5E30BA751FA transparatrait0
684,880,677 *46B81A1534205A7D36552A5510AD52D2D74A7981 transparency tr/&/ns'p/(@)/r/@/ns/i/
684,880,678 *46B1F21357CCD52BA02CEB190BD36E18CA060D6B transparentnejším
684,880,679 *46BB4026107E7330E1B9850D8F604A9A5805B625 transparenttr
684,880,680 *46B1AA1FC301194CB214AFFE055FF50B5DA21914 transpen1
684,880,681 *46B1B75B8B4AE280D8C9DAF48B713F586CBAE086 Transpeptidation8
684,880,682 *46B3941A22456A989CFDBA24723B106059A84B96 TRANSPERCENT
684,880,683 *46B1D91E5C8EE4759D17AFE17C93D4C6C0B034C0 transperenz
684,880,684 *46B727C70DFCE5BDD2B3AB428A0DE94B387ABCDE transpirablidad
684,880,685 *46B94E0F0781AE087F9ED39DA595C421FBD7656B transpiras3
684,880,686 *46B09FF198B160D111A30ED54DC3BA59307CA6BF transpiredses
684,880,687 *46B7E8E25074462E6A60A0F8D840DDE2006BEBC0 transponerest2
684,880,688 *46BB29F8CD875F61411429C3DF2E7DA9C799D923 TransPopsId
684,880,689 *46B7F13569A687F57E7017178FD4EAB109CD3792 TRANSPORTAL.
684,880,690 *46B30D749532FA642388714B860CA282063F53B6 Transportcommissie
684,880,691 *46B761F4351C84956AE744B40988B79124E65137 transporteth8
684,880,692 *46B44C332AF087668D1F544AE682E7B2D688E223 TRANSPORTFORM
684,880,693 *46B050662E6C8DFFEC3C1CC872EF0CE202E36D51 TRANSPORTMEDIE
684,880,694 *46B836141B188CC50A520C3758E3EAC3861FD9AD Transpositive4
684,880,695 *46B35721D0919EC39802938B06855966A9298266 transspoter
684,880,696 *46BB35EEEF0471F5884DAE051D5E192A0143BF55 transtoto handadhari
684,880,697 *46BD51F5F05369D967EBE50AC47A5C5AF89526B3 transversums9
684,880,698 *46BDCD057EEBE3A665B44D83D952882AFFE9CFFE transvestittened
684,880,699 *46B930D36D78393EE9C7298FBBC98AAD2F6C495A trant),79歲,英國陸軍將軍。
684,880,700 *46BA4A7B41F615E982BBC02BBC77910857DCB6BD trantibusing
684,880,701 *46B79968507FABD89694F301F3D6945E854D3D85 tranvan duc
684,880,702 *46B69A1EC4A724AB3F1BBB87E0A3E4967CE44DC8 tranzience
684,880,703 *46B86ED5B082E8DD190EB3C022D053826629F2F4 trapassate4
684,880,704 *46B2161B9831A0B985C33B3871F6ACACBDE3875A Trapassi9
684,880,705 *46BEAC9135424E37A9A493D65C8B78A9F8633E37 trapezaki8
684,880,706 *46BC86E05126559B1EFDC9068502474729CCC2AD trapezoidcubehead9
684,880,707 *46B97A9F60E6661737CDB120FC9B8F5E6B4D6B7A Trapezoïde
684,880,708 *46B220B78FAAF17F9ACCFDF4A58767C4867FD4FC TRAP/INTERRUPT
684,880,709 *46B600B3922324DB9D0E9769ED10944907C70B0D trapnaaimachi6
684,880,710 *46BA6E284340FA5321A8DADA6C66A6580B6F6AB8 trappabilitiesesing
684,880,711 *46BAA3E27A974F038E417DC4A117D18D2EB2BA9D trappatoni6
684,880,712 *46B08B613FA27BD1D7F92164475F657C24965735 Trappeled
684,880,713 *46B6733D623F6E3A3BDBCCD27B58ED5E29C9DAC8 Trappende
684,880,714 *46B013A85FD5FF9FECDCFF7DE027D6205188B150 trappeseksjonen
684,880,715 *46B12F20D9132786824E3E4133841F79D36B6D7E trappy tft
684,880,716 *46BA94CB209C7AE3671C3ACC4770C95CC4843DB2 traqraqnov
684,880,717 *46B2BE56F1EEF4044B6A379563C8A1DB3F0C3F4C trasbocareses
684,880,718 *46BBCC42FA1CC05BE751328F9C47F315655050FD trascodas1
684,880,719 *46B44EBF311785F4CCE44B44F88CE0D92DAC29EC trascoloros
684,880,720 *46B72459D1F0A4247186435632CC1AFE96A785E6 trascrittrice5
684,880,721 *46B1291ED40760853715F5C6692ADA13E2E81B92 trascurerebbero8
684,880,722 *46B466FC31FBAA15FB0F09B45670588CC9AD0191 trasdoblarens5
684,880,723 *46B3B553F54C2C0D3771A3EA7E8D1367882AA978 trasferiva4
684,880,724 *46B727D8BC595DA7011A57C1AB000A8A03979794 trasformares0
684,880,725 *46B8D02901F93820C1E968F6E6CFBBEF38BDAEC9 trasformavate6
684,880,726 *46BB5B07B8642B9701BAC73785EAA6A977B8EA16 Trashawn1
684,880,727 *46BD4A86434F6CE05B7A69141065B5D0F61E9060 TRASH-HEAP
684,880,728 *46B80AF6F5DB01177E121934DB9164A02126C0A1 trashy1/2
684,880,729 *46B36F43DBF393EA884F5A71F20E946BDA971243 Trasimèae
684,880,730 *46BEC882EE4510335CDA447AB07A5946834DFA10 trasladarmeia123
684,880,731 *46B24611F2CDA7483CB943CBFE297A87AD5FD13B traslitterando4
684,880,732 *46BC81AB4805C0729F3235C4F35F3EA04564CD0E traslitterarono9
684,880,733 *46B06901397E4F8D6A629E32D84D4B9BBB5A4172 Trasloco4
684,880,734 *46B242F835EC1EFF53FD9E8503A26325AEBCB4BC trasmarino0
684,880,735 *46B3598C8A3FFAECDC75773EDDEB3849763B6AE2 trasmutare4
684,880,736 *46BFFBF8CEBEB17C5AD6D69446780E66C4D6E5BD TRASMUTATA!
684,880,737 *46BFDD45D3A369F44D6E0A3458AD46B734F77187 Trasognavi7
684,880,738 *46B02162C8255E56D5128A8D876AA33233CEB06A Trasses!
684,880,739 *46B482163085E05534B05AA32ABB3E0DB8CBEA3B Trastrocando
684,880,740 *46B3727352CB231B6D28930CD373985FC935ABDD trastrocasesed
684,880,741 *46B8BC6523FAB0A8EAFB30800638BEE73879C49C Trastroc
684,880,742 *46BC9C7BA5014BA077DE98D7D9B01DC083FC1B5E Trasumeni
684,880,743 *46B51F319EC41653A81BAD575069F36B610A6A6F Tratshd8
684,880,744 *46BF1403E661BA13C4E4A3B7DE1804556214C790 tratshsoj
684,880,745 *46B6C5636FFC90AC21DFA50A68BDAD8C48EC8418 tratspmued
684,880,746 *46B63E87128BCA3C2AED580FA76A55E1ECF0C9AC Tratteggi1
684,880,747 *46B59C2C103B5FD2F0D54B9CB0F62E4B2E2948C9 traubenstieletraubenk
684,880,748 *46B294D7CCB0194051485997FCD8C114AEA25EBA traumabetroffenen
684,880,749 *46B2D9AC73D873AD10C5B33502C4EA42E724AA64 traumatizationing
684,880,750 *46B8F4E7BF39A24A3D04FB6F5B6691BE090F38E2 Traumatologoak
684,880,751 *46B5AD978C66F1F6C050BB5203A275FF990629D2 traunmotiver
684,880,752 *46BCBCB0075C2032A71EBAE9399CD247EDEEBCBF traunsteinerhaus
684,880,753 *46BB97985D45E5031924F99C7702976EA9CE5F13 Trautsmw
684,880,754 *46BBCE1658D2A34BB548C552C1EC03374663C8E8 Travaats9
684,880,755 *46B48FD9126CB7FF76B65783887A358F60725CEA TRAVAIL3D
684,880,756 *46B3A146BB4D0F68A33CEF306112DF095F6BF196 TRAVAILLERONT2
684,880,757 *46B7FCC93B43E48E6E059944426F9D58C00160AC Travaillisme8
684,880,758 *46B48DA04D6699D230612A5F30751B1588B77B53 travaljE
684,880,759 *46B17BAE4FBA47D55E3CCC29A75082981A30B067 travarelli9
684,880,760 *46B56EF722EC18F322990B0F6AAB9C01346BF758 TRAVASO.
684,880,761 *46B6C0356758A5049574771D2A27D238F673CCA3 travaux110
684,880,762 *46B980254E37EA555CCFE9BCC0CCC3B1DC7F2275 travelabc6
684,880,763 *46B262BA34CAE8C03ECF76672FFA6F491AC107D1 traveldiabloed
684,880,764 *46B81D082EC54ED7BDE05C1CD6B19341D418BA0C travelfubared
684,880,765 *46B31BD41715E127E05BA404E303C184D58B28B5 TRAVELINDO
684,880,766 *46BB02F6C25F078E9CB9D235A0B1FAED6DABA4FF traveling in india
684,880,767 *46BDDA4785B25B6CD788FD617D0932E3ED04807D TRAVELINGLUCK
684,880,768 *46B3FA36FAB30DDA6DA9DD5158628134D48F4BC3 traveling thai guy
684,880,769 *46BA7CFA3574A227E7F39EE3E460190EC7B64B50 TRAVELKENNEDY
684,880,770 *46B9D001D1E250CBAC2B148306B3D00B4B456F92 travellercheques1
684,880,771 *46B70780CC17972AC3A52E94C51669988DF9B4E1 travelmother3
684,880,772 *46B05A21627D5E01AE9F93E2614AD996D9C3EA97 travelpillow
684,880,773 *46B49C17EB2FA6019A8FB36C4AE7A91BFCAA1849 travelscooby6
684,880,774 *46B00F2B3E2A77A338E37965CC1F4AD855306F84 travelseafaringseethingsexuallied
684,880,775 *46B0BEEC4C939E3DE5B4371A2221264B12322D70 travelsenioring
684,880,776 *46BC6608838DFA38412ABB8B8231867782B3BB3F traversata.
684,880,777 *46BCCAC7BE3317B4039C4919339EBD1CF34357E9 [email protected]
684,880,778 *46B8874C138E0B2BFCD77DBD1791312DB8331E64 [email protected]
684,880,779 *46B8CBC97B177C0425641ABF552451B5D33032B5 Travestirait5
684,880,780 *46B9CA96FA8FBEE8184C2498CBBFFC9B7C24EC8B traviata1
684,880,781 *46B2172F0D93420095CA5A179B00A6004ACAF048 travietrevor
684,880,782 *46BA8BF816C3EE56AB6496D41C02B9074A1BF17C travis.andoh
684,880,783 *46BB2551FDAA14A38C9BCA61088FABA27C178119 travis anthony greenwold
684,880,784 *46BD65965AA6BBA6F3930BA3B4B2883301E9AC1B travis antonicchio
684,880,785 *46B335116651AD8DE4A409C50B9FF168621571FB travis.aughe
684,880,786 *46BB137B21DC105DD604F5243BCAE41748133B28 travis.bakey
684,880,787 *46B93DBCCB30C714F563F0FB0B2547B1864C6E6D TRAVISBELL
684,880,788 *46BE7359368B3C1C5CF58BA613828CD5EDB5423A travisbrouillard
684,880,789 *46B9145D829872675CFCBE394048BB3AAE2783DA travis cant
684,880,790 *46B23DF32A4C2158288333CBE06A2DF82F18818F travis.czarnota
684,880,791 *46B530A4DBFDCA637589C673D93342E5F528D8B5 travisdecory
684,880,792 *46B2B9CD544C0189CDE6EF8395F52026D644470C traviseatme3
684,880,793 *46BE94CB502454E0954AB93B3388BE64FF0C4263 travis ebarb
684,880,794 *46BAB0EB2FB48F3214671FF9A62E935B494947C9 travis.feger
684,880,795 *46B8597985C8877554E09E5490E956348D8C584E travis.fleming
684,880,796 *46B4A92DA86A832A48C4CDE760702FB7204F237F travis forbeck
684,880,797 *46B46B92DE82E06142451E208CECB296627FA4BE travisfudge
684,880,798 *46BB97C2B24D8025F445974454EA7E83FBCBBECE travis.gaydosh
684,880,799 *46BE9A79760B3195A000D2E04842CEFEAA23C590 travis.gerardo
684,880,800 *46B818B8B7FBE31EFF941226B2FF3C3685AC1F3F travis.harley
684,880,801 *46B29045E3C1A2D0EFA165A6BCCC0D04F4297AD9 travis hellstrom
684,880,802 *46BC637BF787401031C01227E8F0AD49C16AB1C4 travis.holford
684,880,803 *46B199AD87D80B07531BEF8FE4BD1669A5DFBB95 travishoops8
684,880,804 *46B32C83A142CF641E4FB21B5D1C483F5DB04667 travis horrocks
684,880,805 *46B9A23817855FD0E5CEE00E0B20B1F582CD8945 travis j fagg
684,880,806 *46B9F435EAACBBFBDAEC79FE88EDF2E5DD3EA521 travis.kobak
684,880,807 *46B64C6DCD05E2233F09A754B89826AE6036DDCC travis.kuenzi
684,880,808 *46B7AC5015E951BE1848441FE57205A6F3A34D7E travis lanaghan
684,880,809 *46B612C667AFD5CCF6C84F7D22AAAD16AD88A5F8 travis.lev
684,880,810 *46B9C9BE7A1AA016262B0548CF3F9DD20352CACD travisloffelbein
684,880,811 *46B7E0D3CA3C8BEE9D6AAA21EA5BBCB7A1D63940 travismickelonis
684,880,812 *46BDF36C2B01AC908D72A849E0779C5D255EB9C1 travis.neives
684,880,813 *46B4203073EE0BAC55482EF92259F1CD75B5FA07 travis.nin
684,880,814 *46B98D306A6EAFFF129843E7DAB3BCAFA61B09DE travis.nordine
684,880,815 *46BBEDA3B5C17138347D157C1B461A08F129A69D travis.norlien
684,880,816 *46B6DAAC48714693806EC4594D50AD7E2777C03A travis pautonnier
684,880,817 *46BB5F7F755F96A5106834B55CA1B743C14595DD travispearljam9
684,880,818 *46BBF93802EB737878573C48619EA4A2591712F6 travispronovost
684,880,819 *46BBC2AFE44E165F13129B765C31EAE442410C37 travis.ryan
684,880,820 *46BE79B6DF99156E174D72832818BB9B79FF694A travis siemer
684,880,821 *46BE39CE5E716FC0C0B2489BE9AA58FC460E6536 travisti2
684,880,822 *46B18CFD8BD081F513CA83816765733E60392A92 travis.tinsley
684,880,823 *46B20028894EC6691AC61450360D27ABD85FEE24 travis.whorley
684,880,824 *46BBDA6991658418E32739CD0BAEC73BC5A48C0A traviswidder
684,880,825 *46B0589719586CF16779E13CC2F433AF2FF0821B travitoemillio
684,880,826 *46B7A67D16AE4865685B2DC061F2ECFA9B1712B8 travmaya
684,880,827 *46BA53B654A8EB46A1CD9155FDD43FA7E093D131 travnjaked
684,880,828 *46BD31D51DC3330122E8C1243A9A64C82163AE96 trawleruss
684,880,829 *46B02B39B511D1AD104ECB6C16E9C4643DB4239E Traxincs
684,880,830 *46BC92E6C103F31667FD1B1A006EAFDE82F06C9F traxlers6
684,880,831 *46B7A96214A78C2D596B034DAE653CD1B9B0EE70 traxwmating
684,880,832 *46B70816726DB12F0D244F795BFB8C7371B55F4B Trayambakeshwar
684,880,833 *46BCEEFCE47873EB2EBAF8882D4F2B5704295E07 [email protected]
684,880,834 *46B53592B670F12516A1EFA1217391C6C83434FE traycikoppie
684,880,835 *46BF6430F08675225B2B404D38A5C147DD5F6E01 trayhor8
684,880,836 *46B3C465243DA3FC7BC8526081D88447505F82FD traymatiwn2
684,880,837 *46BD4D3C38A6F154944DF928428D16BCC2D0CBA3 [email protected]
684,880,838 *46BE19D0FBCA6A1AFF93AC687837CA1EB5528271 trayon12345678
684,880,839 *46BF25C99039D1DFE6B8BE62B1C83D9E5DAEEA92 traytysed
684,880,840 *46BF2E5BDCFBEA744BA11EAD4A43268ADF293704 Trayyeva
684,880,841 *46B632AD7370F0FC692CF7D6EB843A346D61EF98 trazias de lisboa
684,880,842 *46BB17FE968ADE958947198C6888EE05EF812107 Trazioni.
684,880,843 *46B642E520ACEE807FABCE31A277C1AFD9A861D8 trbgnrtr8
684,880,844 *46BA48B25AD70B3607DB36E7BF1E9B8F456F615B Trblchtg8
684,880,845 *46BC343ABC2653A3014F62407C1A33F68BEDF846 trbrnndnbsw
684,880,846 *46B2E3D06661479124DA09E07737B74CB64DC5A1 Trbshft1
684,880,847 *46BBC579BD4D1CFB3986260FB09C4B599C2E7001 trch2000
684,880,848 *46BDBD4CA89F715D1C4713DB0689E2CFDF328A71 trChCLtL4
684,880,849 *46BD78654A8F202E1BE2EFE93DB3C0FD52AB5224 trckdnld
684,880,850 *46B56D3DE3DB4F848B8614E204720A628BC4EB78 trckpssn
684,880,851 *46B29E7EB4585DC61102760D41C8A8CBB894EB12 trcksblzr
684,880,852 *46B94A386F15EA5A43FDC686FDA52FE94A0EC22D trcksrxy
684,880,853 *46B4E4A8D9AFCB658DD502D09C5B881953B0B883 trclwrts
684,880,854 *46BF1DA5205FCB2CB1FF64C751589B64EDAA7E8E Trcoleucemia
684,880,855 *46BE287453E1F37A45F8501B234EB20FC9EC48DE tr
684,880,856 *46B0E7419ACEFF6954F2CD6FED43DFBDACE1B4B2 trdavies
684,880,857 *46B16D7420B962166FD9DE6A748713F29202DF1D tr
684,880,858 *46B7CDDC669650C8B19AD834272B28D573717C2C trdhandapany
684,880,859 *46B784F52E3B9610259A58B4B79655337F474BE3 trditing
684,880,860 *46B09DCBC02D803C5F5E9EC67C7D19877E3184D6 trdnt1940
684,880,861 *46B77F070A4D713260C56D9C4C92B319274434B9 trdspsych
684,880,862 *46B386F67D7796485260E8A7023188F6C819DE2A treadlinebsw5
684,880,863 *46BFCD1DAC0A4F584915EFBCC9A2AA6DE7701EE8 treadling5
684,880,864 *46B435DE8BA57DDE32077A7580CB70A29558863F treal5
684,880,865 *46B07124CD7A7CF71E0656B52BADE71DEFD7F300 Treaneom
684,880,866 *46B231E98E4A78934CAD0723F9375903DEE644EB treardon8
684,880,867 *46B9828C940EE4F1FA4E09A269549BD9E5D1CF76 [email protected]
684,880,868 *46B12FD82C68D1F50AD9F020BA316CA96B9288AD treasureblanche
684,880,869 *46BBA473B74AFC473F96F85F3BE43436420816A5 treasure jon bond
684,880,870 *46B5665ABDD9D821BFF3D78749A53E3E8E620413 treasure lynn berger
684,880,871 *46B262D2E305125856F161A06293A3D588FE4814 treasuresntyme
684,880,872 *46BBB3B267AA2B36C89EC7D1E7D00159B089BBBD Treasurylto
684,880,873 *46BD11565F5E6A84428AC6F1F0F0871A221DA50A treatmentventilator7
684,880,874 *46BE43CD822201FBE499E6C74550247C5FBEF7C0 [email protected]
684,880,875 *46B732552BE9566C8EDA0DD462346F40508C6E93 treaty_of_paris_1814
684,880,876 *46B06226CF4877FA9EFA4D0D994B24DFA9237436 treaviene edman
684,880,877 *46BDBD64D41B0D366B1A9B416BE19F9BCDA8C01E treavonwilkins
684,880,878 *46BF3573516E430F9A2D952A93E04B5E8C24A667 trebā
684,880,879 *46B50C76CDC56239A422EABB36580924EA34D635 TREBBIERAI.
684,880,880 *46BD346756B4B8BA2EE8E858EE5E34769A73FE8A trebell0
684,880,881 *46B73166D6F654BE1838CFBD3A767D92712D00D3 trebgodtnahpele
684,880,882 *46B99F24B082836D91723495BAF1232C7E613FE9 trebieS
684,880,883 *46BC4F2728D5CCB33437438BA6CF1029E7FE5EAA Trebizontsko
684,880,884 *46BC19D6446EC9FA3319A7C8B89835B87AC66E55 treble&bass
684,880,885 *46B64C9C1BB283DD8B8CDACAED1B98207B44233E treblig alitnac
684,880,886 *46B0ED48BCA02C52E05B484C2DD68ECED2CFB367 Trebor1951
684,880,887 *46B10D916A49760C578CBCC8B91F4161764E581D treborbootsiing
684,880,888 *46BEAF97C2925F53ABF26C99A5B48CE0C52E5023 treborbuster0
684,880,889 *46B7F6F3C99124E8824615438F0D9FA6017DE0C8 treborelsies
684,880,890 *46B814BA5D8C99DD9E65C8F06DBAC356326BAB24 Treborjensen
684,880,891 *46B89B945391CCCBD98A8867BB73607E1FB388FE treborsalut7
684,880,892 *46B82D155AE2F2C79B3B15E6AFC882E3A9D8E5BA treborstellaed
684,880,893 *46B50C804F1374F8816A4E2A7F3EF3E8EC2137FA treborsunshin
684,880,894 *46BA2A0C5ED09A16537ABDFF2FB63DF623315704 trebortequilaed
684,880,895 *46B099C998964E3D11DADE5A0AF47D397CFC2893 treborvadered
684,880,896 *46BFF3533F38128D6520E26F4A942AA2BFA2B889 Trebušni
684,880,897 *46B9E1A7C6A7A9113C8D3C1B31F89D7D8A7E20C0 trecarcia5
684,880,898 *46B1A5B3BB63C9071C4180D3FDD37236DF6E521C treccolare7
684,880,899 *46B751CE8E537FF2625BAEB03FEEE51DFB6EAFC6 trecelyndominguez
684,880,900 *46B97E6CB6E8D906EA6081D7504741535462CF94 trecentoquarantatreesimo
684,880,901 *46BEA3229EF8D6B747C05B93AF56157A54DB430C TRECHEROUS
684,880,902 *46BC464E72149C9F25DE92C7DACD8EE35856B3BD treckschuyt4
684,880,903 *46B53F2BA2E14AF817A1B433B0722728762BAC15 trecy bates
684,880,904 *46BD3D9EF88C6A91D0129CE987E5F66A92B58961 Tredanebbing
684,880,905 *46BD98D5441CCABC6FCCE933040F74DC0452EE88 treddwesley
684,880,906 *46B30A1DC6DB4DFA85EF69A9C2D51A5DAFD94B32 tredentudonessing
684,880,907 *46BEC66C5BB0697DB2E03F0125B09177212E39F1 TREDIE9
684,880,908 *46B6A176578224A406B1EA88BAC0707FFC43A929 Trednod3
684,880,909 *46BAF122520B9A3650D0599BBD02D5574E7B434D treedalton
684,880,910 *46B628461D8F3BDABF455B348E056DD7EAF23007 treeguthrie
684,880,911 *46BC53CFB9DEDB44D5AF2440C8BE86E57F81A496 treelopretni8
684,880,912 *46B70E2BE35E51BF710C0F365A27986530D2F5EE treelovi4
684,880,913 *46B89077CF649FAAE387C55FF4126113AF5B6155 treemitigel1
684,880,914 *46BD257CA0727DB68F1DCF6A656C6D47C86B0B69 treemolpid5
684,880,915 *46B65C75380FB9FFFF359EDFBC2D6B5012AD85D9 treemsro8
684,880,916 *46B7ECF1B49F2B17E3936A4C871E9AA5C4C5D45E treesivorpmis
684,880,917 *46B5492A8C14D5604D61D2E043D8572C84E496FA treesod3
684,880,918 *46B3DC7856A5C5C0CEEFC0DEC228C5F3B279FDA6 treetcepser5
684,880,919 *46B88D09F13085EA20053B6545D82832DF278A92 treetjie5
684,880,920 *46B7E9DDAFBB8A5D9E6D5516C1315679BEE22795 treetnemelger9
684,880,921 *46B853851C79B491EF3A8E99380D4E4FB0073995 Treewzeb5
684,880,922 *46B34B735FE2A76D5B1293C6385B02C40025C4AF treeyyeerts
684,880,923 *46B5F8A27F44DF9E4BE5A1C28070968E8A3F4CD8 trefem
684,880,924 *46B02A0752A4FFFD400EDE750047AB4ABD50B827 treffendste7
684,880,925 *46B2BFFCB28DB178E8F852CD6041319E5A042E85 treffenie tan
684,880,926 *46B93E1B9E408A0AA8F6B506916F10AE39BCEA88 trefoilwise123
684,880,927 *46B190C3F9C3F1F1224236729BE01E8BF595AB38 trefoliated5
684,880,928 *46BB8EBCA95A9A1E76755B0CB657B0356BD3F463 tregenza6
684,880,929 *46BCCB10BA30DB0C7989E1822C67B78F898148B4 Treggy1000
684,880,930 *46B9E84B5134A2A8998ACEA1771BF3E08C03FB58 tregnuhe5
684,880,931 *46BBEF093D228D2299968591FB642E9FD7C3F221 tregowethrylng
684,880,932 *46B3964334EF61C1D1C1E3F8BA25B9BDCFC8CE9F trehcajsed
684,880,933 *46BC7B0399FEF906379E10EF90B154DB9BD83DF9 trehjulet0
684,880,934 *46B0AC8840BE3D8986A9D833E4E5732687B58D5C treholdsskiftet8
684,880,935 *46BBFADA6462527F248B2C157510DBAF27FA70CB TREHSU1
684,880,936 *46B15430CC558FF7860F46B5E52B27CE241DDB5C trehusbyen
684,880,937 *46B08719A1DCA531671B7FEDD2B54C74B524C8B1 treibjag1
684,880,938 *46B588DB512B869BF053BC9E85869A7F1213D61F Treichls
684,880,939 *46B1596F4AA6DF090EEC29CA53FF9D22DF261C30 treidivi0
684,880,940 *46BECA36C9EB249668ABEA6852FC027A4D5E8B6E treigots
684,880,941 *46BFABBBDC007347C1E898575ADB85F7962696AA Treinamentos
684,880,942 *46BAA8B9F34A4B22393AC38B8B4ACC46121B2054 treinaming
684,880,943 *46BF642510E38E16CE1FB729AE3D3CF68D1CC24D TREINCHEFS7
684,880,944 *46BFA7EF88ECF47B8AFA1ED62691F188A7DCB21D TREINIDROOK
684,880,945 *46B8C534D0E9D356A7C6D8CC93522067C122F41F treinienė
684,880,946 *46B54DB11DE6F40990E159402C63BCCD120B4A68 Treinos6
684,880,947 *46B2D83455B56C86ADA0B1F7D9934624646CA85C Treinreisje!
684,880,948 *46BBE899242B10EA1B14397A645B20A94BD2D60A «trejmeitiņas»
684,880,949 *46B317C962844661A3BFB23D29D8EFEE4F52100A trekbananed
684,880,950 *46B0906D5CEC48D058450E93C0364E6A8833AED2 trekbarbaring
684,880,951 *46B5D34772E630864C085068ECAA1D11A2445E6E Trekbouts
684,880,952 *46BD9FD1B4C28655D31F063C9BBD8EF81352BA9E Trekkebekken.
684,880,953 *46B1954D8A4072CA7F47F22BD50A999EF29979E1 Trekkenses
684,880,954 *46B8D8D7EFFCDC19FB440D890A7FA7723CD3403C trekleoving
684,880,955 *46B97F76B28D2AA617182A89F499273A23555B37 Trekmeow0
684,880,956 *46B17DB9BC8D8E16B055FBCFCC7229C5E490C5CF treknak0
684,880,957 *46B6820CB665BA25CD826EB89A6D015DDAE8169B trektouw.
684,880,958 *46BB5C7E0E87D991B280BA7DB09F0D3A2F34468B trellahemphill
684,880,959 *46B223678BE7882FE70EA4F6700D97A910295398 trelngedes6
684,880,960 *46B3BA570A5277027A300993FED0C0464F6272F6 treloaracbsw8
684,880,961 *46BBD762B1FCBC8E38F92E648F25C9F522088618 trelocate
684,880,962 *46BC09CCEDA3673B0E1914F075A8C2CAA766562E Trelowamn
684,880,963 *46B7E0EEBC024FEDD1DA5F55BB0AEA01BA44545E tremainebsw1
684,880,964 *46B8FFA553B2C0FD88A0859FCDAC3BE42AB125A2 tremandraceae7
684,880,965 *46B0A76D9F66D7A28B92125D64928D9FAB45261B tremarem1234
684,880,966 *46B36F3D6DA8F64DC1C17EE001ADEC3CB5F8CAD3 tremato2
684,880,967 *46B696BCF285BDFFF53860C7D9C99FD48D8ECCB9 tremayne faison
684,880,968 *46BE7F469B24A147BB4422AE5BC005A61C39E43E TREMESCANT
684,880,969 *46B24521169E9FB7A22E44A248B7126EF56A72A5 Tremiamoed
684,880,970 *46BD79C769E4C857E9725FE70FCB1FC86E431B48 tremino?
684,880,971 *46B4DF1DBA7138964090B846DEC23ED36A0515AA tremmesengened
684,880,972 *46BAE1441AE1D42501CA08A29051B1AC4C3A468F tremoli2
684,880,973 *46B0D86139E4B78D3454233AF5383FA2CD0ACA16 Tremolitaren
684,880,974 *46B65C09A35665FACCB9975EAC28E47F522AD815 tremolite2
684,880,975 *46B2BA3BEAC8EE5FB34E4DBFA667EF4F3A1C39DE tremulou8
684,880,976 *46B63D81CFC68C5C0D8B1486B382CC640DB03080 trena caskey thompson
684,880,977 *46BEBC9A06A063CF70FAB8D7D5DB6F4674342F57 TRENCHARD.
684,880,978 *46B11118CF46BF25F235532468DE544965246C9D trendiethreads
684,880,979 *46B8C4129692F1B7FC9BE5D70CCEFFC10EC927A5 Trendily?
684,880,980 *46B37562F3EE9610BA4E8A2875F829E97378E096 Trendneted
684,880,981 *46B5B6DE1BB2B25D785378856DCAE804B9190E60 Treners5
684,880,982 *46B9144AB71A4B08C5BF4427658A1213ACC8054F [email protected]
684,880,983 *46B8510D282996CA7A0B308EC770638A7F34F4AD Trenieca9
684,880,984 *46B32D15D7298EB91B6D510C5D0B00C7F11F4CAA trenishaweekley
684,880,985 *46B68754954286E89D7FAC8D1097E4373E1E2225 TRENNSCHICHT7
684,880,986 *46B410448A7D80D341CF1B3826C6A9C6F4ACA866 trenoil
684,880,987 *46B3A0857869081E5B027BC24AA724DC593567B7 Trent229
684,880,988 *46BB571D98ECA6448CC6C8A0E68F65A1F8B67E39 [email protected]
684,880,989 *46BA748F331613FF570638012948F9CF0BCA0848 trentale7
684,880,990 *46B19E436D398B7393F5592EC6EC9329F7AE22E1 trentapple
684,880,991 *46B3AEAEECAF1BFD7C82BFA37A634410E4BBD099 trent.balzarine
684,880,992 *46B51C22373940BB8EB2D85D41BB5CF0CF980214 trent.buczak
684,880,993 *46BA13294756BF57C7111D37E2FE9E7CC3758709 trent coil
684,880,994 *46B47B337E29F17F9D3C26CD7DBA65D7915B30DB trent.donahue
684,880,995 *46BC027A428E02C5C970B493A8EC09B0F8B917EC trent.dovenmuehler
684,880,996 *46B151BB5BF7348DEA5CC877C1626AAE7173586D trent.durelli
684,880,997 *46B19850F7E518FA4A4361545F0AD5DAB339439E trent.fasching
684,880,998 *46B033C93FCCA4A80D2BFEA20478CFBC0D5409A9 trent.filson
684,880,999 *46BC9D12B025AE8E16CCA35628D52C817FADCD4A trent.kebort
684,881,000 *46B649088058993770ABCF6EE5BC2E29461A360A trent.koscielak
684,881,001 *46B7F384A2F0C293D511B70C40D2ACB0CF3D9A14 trent.lipner
684,881,002 *46BE787CAAA0BF31615EF50595A76D78F5BC10E5 trent.maldenado
684,881,003 *46BE0769F83C6496FA23786A01BD76B51D411B73 trentnewport
684,881,004 *46BD238B3BD5F3D011F53A1D65DBBE5655B38852 trent norrie
684,881,005 *46BE167A3CFD88B7D111855DF0088973562AC4ED Trenton54:devils
684,881,006 *46BDE3AB12E71149DCA4260B223C5EA52BEF9981 Trenton9
684,881,007 *46BB84CE613E4F9FC710D729679F9ACC1849772A trenton.abdulla
684,881,008 *46BC559E0B61C86003A1CC9F002324D3046DB76D trenton bailey
684,881,009 *46B81D90BD7095F7FE840DBBC98E5926040671CB trenton.boddorf
684,881,010 *46BB94A4C0CEE9459B58A7F60894AF46D2B2EEBA trenton.bynd
684,881,011 *46B265112F3A6DE1ADA10D6C1CAAA0292486E808 trenton.cabreros
684,881,012 *46BF34C514E7E8C4D99A9D69523F76D8F350685A trenton.chapen
684,881,013 *46B868F0D4160C373DC95CFC7673BA5E24153F74 trenton.crespi
684,881,014 *46B4B1F34184648E7A3C3DFFFB545F3359875523 trenton.culnane
684,881,015 *46BCABA069A183CE1D7C73A410B74B86456B0454 trenton.danesh
684,881,016 *46B5F4707A80393E329387249627F1099F7BB81E trenton d taheri
684,881,017 *46B5D87858E4FB078A708D958008B5E811384B16 trentongerlach
684,881,018 *46B0248805D0A7460132148E73E9EEC214D0BFD7 trenton.kempf
684,881,019 *46BCDCCF476CE88F0A78A389718542A260EDB61C trenton.riggins
684,881,020 *46B55649B64C0C39B668462D732EE4DDC061AFF9 trenton.santoya
684,881,021 *46BDB77DA7E63FB53FD653A75C475962E5885C3C trentonseckinger
684,881,022 *46B6EFEEDFEAFA7C425902269B46A7DC0AA4E874 trenton.spraggins
684,881,023 *46BC6C3F7E7A90A8D63E47E41152C3B277F31E1C trenton.verble
684,881,024 *46B4C01E52FF43B8D8FC8D9013A9FE9631EAB205 trenton.wohlert
684,881,025 *46B5CEF6EAAF176E9FDF01EFA4D0E48A29CC59C0 trentonyedinak
684,881,026 *46B08A5723263E7AADF80097FB237FF4D7112537 trenton.zumpano
684,881,027 *46B90EA02971DE4EB1B4811D58E4A40C99D33E72 trentside7
684,881,028 *46B6BFAE46F0268EC8EE030EC3E8A476F63817C6 trenttweddale
684,881,029 *46B849F073BF3D285D42DB913D76D0B154439331 trent.vanderjagt
684,881,030 *46B7E7545A525875CFDEA69D66C16D46CAEF788C trent.yoshi
684,881,031 *46B976040935A295B7D07D3F16B7F114B7FFEEF3 Treoeb
684,881,032 *46B570C39FC36C26F739DD73F5769429971EB9E0 treolsva
684,881,033 *46B1557ED791DEAFC8CA3BC46508AF1C2ECD3950 trepanninglying
684,881,034 *46B64EC7571A7562B5A6149898F309DF7F268EC9 TRE'PIDANTES
684,881,035 *46B131B071DDF3ED0DBD44ED126AD8162470BBC9 trepidum9
684,881,036 *46B3CA215F7AF8BC12015E50A303252D604130B4 treppehS
684,881,037 *46BA82B3A6197621987596944946D098FD577917 Treronin8
684,881,038 *46B4E611067BA18858654E2C47BBE4E175B55ED5 tresajackson
684,881,039 *46BE6C353D70DE7C262ADEE23C4DEB79843F6557 treshaunlor
684,881,040 *46B1EA699C083E9D689BAE24508822DA7EFDA99C treshure jones
684,881,041 *46BB4D710ADC54AE94C823EB77FE1D5756538F96 tresindstyvendedelene1
684,881,042 *46BF09261FCA37CB30AA2AA08CC97009D579D877 tresloucam
684,881,043 *46B9794D1AA5A98326E978E19110D596387A4B76 tresnitl9
684,881,044 *46BA0E46ED02C9FCAE3A0A57FB8B06887CCDC52D Trespassava
684,881,045 *46B36AB368DEAA262B3336963F9D5462BB091E33 tressa0987
684,881,046 *46B93EC696D0A4527A9BE5B079FF4E29CB770D6F tressaterfehr
684,881,047 *46BFEA67A449E4A178DE21062A936D928DC748C1 Tressauted
684,881,048 *46B61F5B736CD0508E9DF028FDC39BB93707B65B tressozza
684,881,049 *46BE861CD9FD3A5CE78C2D5FFD62198BD5DC2142 [email protected]@B111T1E5
684,881,050 *46B38A34B98235B0130DC35562B6D519111F006E Tretiden5
684,881,051 *46BF8B7AEF33C0ED5A87487CEB5AAB14C0AB4AE1 tretiehr4
684,881,052 *46B6234CBDE3CEFD448F3E8551F2DC4BABC7DB2D tretirahu2
684,881,053 *46BA4955857BE3D8E31D9675B8616BDE50A8CCD8 tretommers9
684,881,054 *46B63550928FC89078119EEDC126E122BD62158F trettendedelensed
684,881,055 *46B7F2AEAE91FE4345F2CA35C3A07EA37D3DCB6C tretti
684,881,056 *46BA42EF8C3C08128146925042F50127F9F6CF02 treuliches1
684,881,057 *46B377135E8A4FAF35CFB21ECA5492ECDACA3B2A treva cutts
684,881,058 *46BC33EFEE0725791DCB37419B16E3C97FB9B429 trevan williams
684,881,059 *46BB5A7E3BCB57618D0D2CD7EBCC988D11C50213 Trevelin0
684,881,060 *46B433EE8B62E95850262C40CEF0F936CCCF5727 tréveneue
684,881,061 *46BCE2AE46DE674B2A7030D702EF24D237991A6A trevenna7
684,881,062 *46B6B7D79C5959539B57B4499C0735781CDF0F05 treverbudd
684,881,063 *46B3D3E98F8464E01E5FCA87A0C20738AA65566E trevertj
684,881,064 *46BA80C0A848E9751B29AB5AA18BFF6C28F8EE02 trevilan naidoo
684,881,065 *46BAA91B9E9A01C1684372B92521446A25E0943A trevinawiest
684,881,066 *46B6D5534380F7007BFE48205AE64713AB022E95 trevlemunde7
684,881,067 *46BEEB49010C6C3DACABE53B6ADA3A1AECA33080 trevon434
684,881,068 *46BE580079DB8637EBA16CE1DCD85275A56827FA trevon hutchinson
684,881,069 *46B84464627A09712496975EE4A138CF347FE588 trevon lofton
684,881,070 *46BB5D9EB65C14A1C95E6E618322CA140541904F trevonwood
684,881,071 *46BE2093E4719E8A15DEBB7BC7DFAF4BFDBC7718 trevorartingstall
684,881,072 *46BA5F90336EF91628970A1DD62A3246820602CE trevor.atencio
684,881,073 *46BAA714A39B84E73B1B142D6922CC2DC4E225D6 trevorbananA
684,881,074 *46B093D81AE243C70E2C6D9B18C8936CA55A9759 trevor.bartnick
684,881,075 *46BF10A7FBC342C137CB81DAA80712ABBD8C7B6D trevor.batres
684,881,076 *46BB0723A5C8F437B1D95FCB0576D6B5C7875371 trevorbookit8
684,881,077 *46BB0DE4F8918ADBF1EE5511F7ECD1DD85E2C404 trevor.brixius
684,881,078 *46B42902AAF0129113AC8FB73DA3EE28B7C25914 trevorcats1
684,881,079 *46B32762A5816C91364B9E59EAF265ACE180375D trevor.chrabaszcz
684,881,080 *46B066ED2BAAC1CC46E0605DD6EA462C75250492 TREVORCOMPAQ
684,881,081 *46B9E52DEBF8ED024F5666402CE406736A5EC9CD trevor.elk
684,881,082 *46B807A56D988AF67D65E77306197A6B7B221149 trevorexpress3
684,881,083 *46B7B4066A815A743F7979B2CDC7965AF4BE2554 trevor.finazzo
684,881,084 *46B3C9D1F5249EAC5966FEEFD645AED6544D49A9 trevorfloyds
684,881,085 *46B35EA989A6C7219A31514CFB32EDF1EFFC0818 trevor friesner
684,881,086 *46B88B32FB174FA28AB4D2EDBB64930B0865FD1B trevor.fullington
684,881,087 *46B5C673D7ACF0D1533F992110C155EFC4E99A38 trevorgambit5
684,881,088 *46B273B45174452C59697AF2BC72A5616DCE1690 trevor.hambleton
684,881,089 *46BBB2777D2B3399932B4716BAA8098C0931A510 trevor.haugaard
684,881,090 *46B25FC1732D41C2E1EC1CF49CCACFF716AA74FE trevor.hillian
684,881,091 *46B31676AACF5B0D4FEFF614E017FDA955D5C501 trevoririzarry
684,881,092 *46B2B422865D9F4C3234A3BE344C2EEB255CFFB0 trevor kotynek
684,881,093 *46B25E6320B30074F6344269D9FAF335C7D319C3 trevor.loureiro
684,881,094 *46B3FDC406E4B4E03D6CF79A245BEAEF75116F88 trevor.ludemann
684,881,095 *46B649BF97D8BAFAD81B3E449976C48CB54B4535 trevorlyells
684,881,096 *46BE904BC812891DA8977D3A443421738DB3AAB9 trevor.mackynen
684,881,097 *46B2B2502BB7B3A9BB58B7EFDF085AF1CA10AD63 TREVORMARSHALL
684,881,098 *46B22245247DB80BB7A087E2420F2EB19C95E63C trevormasinelli
684,881,099 *46B23ED85B648EA20FBA8A55CB6208D90251D192 trevornicoled
684,881,100 *46BA89F93848320453E3CD7677110589E9307813 trevor.philavanh
684,881,101 *46BD246B7E000AEB2092C5638A8C42222F2DAD32 trevor.primeaux
684,881,102 *46B5472FAF49ECD3536AFE16B8112DBACACE12C8 trevorprincess7
684,881,103 *46B420926A9CAD6B44FA5B2C88900171CAAE1E4A trevor.puhr
684,881,104 *46B0084ACB019DD732907575A0E177D89E3EE993 trevor pyner
684,881,105 *46B0AD9D1353825C12A02C4CCF62A4CCB74FD0F8 trevor.ricucci
684,881,106 *46BEAD8DC06F7B04A096EAB585258AFE389D50AD trevorsammy3
684,881,107 *46B0EFB4ABEBAD035874B9C1523F0F5852746A2D trevor.schiele
684,881,108 *46BBE804163EF59AA1936E42219662FA5F889FF2 trevor.sorrow
684,881,109 *46B26C11083C168C0986099EB006B6B242A80A41 trevorstrider9
684,881,110 *46B08A06E84477CD60E13CE1254EF329D6BA66D8 trevor s young
684,881,111 *46B35FEBAEE2EA436520A4013DFFC36828BD3778 trevor thacher
684,881,112 *46B8BF48E840BA33907C2A8A919A9B3A24622158 trevor.thaniel
684,881,113 *46B220F5FD64373E0191DA4D6092492DA5D6D2DF trevorustanik
684,881,114 *46B4099194D53BE36900FCD0C10409C9FE07F4B3 trevor.wadlinger
684,881,115 *46BC92E429F856EE9AED4EB32A7F253F3B94D885 trevorwarrier
684,881,116 *46B12D7224D38BB4B53ED432946E0D2E553F0CD9 trevyn hill
684,881,117 *46BA71652A846F97F0B105AA362D538AB1535204 Trews1
684,881,118 *46BCF9FAFDDF0B49A145D3C65EB8E7DFFAB0E9FE trey77punkrock
684,881,119 *46BC866AB5284D34E69D650706F8834632523A03 trey.athens
684,881,120 *46B1184AD18F21AC78F831277B31B87ABB34CC0D trey.berenschot
684,881,121 *46BDC61F897C27778932614176D46912E9BFED6F trey.bilodeau
684,881,122 *46B51DCD71BF7C97A0C9721DC38F31E9B5553850 trey.bruning
684,881,123 *46B6B483ED454A4EF45B304BBA44C19682A7A5AE trey danigga mann
684,881,124 *46BF056AF91C87B8D8C3132078A66EB391BB69F0 trey goyne
684,881,125 *46BE217DE19DAFA25395FE7FFE2D167FA3ACF0D1 trey gwinn
684,881,126 *46BCDD60BCB7178F2AC77FB865F367BBF6E4A77A trey.hepa
684,881,127 *46B54AC1E23E7882ADFA0B5DC199601B2869F709 trey.himmelwright
684,881,128 *46B90A2F525AA151F4792616B775E03BBF151E1D trey.kennelly
684,881,129 *46B687031F852159EDE086087D5A01702A270BB6 trey.kniesel
684,881,130 *46B7F2CD28F16A3D504E01B43381A9702B5265CD trey.macmullan
684,881,131 *46B3058E7A5521A56CB790561510B6ADCA523059 trey.murad
684,881,132 *46B1C1A7118EAF035F160C9CAFB2D23B2E58BE25 trey.nordsiek
684,881,133 *46B1AEFE8D9D0D8A8C66F1E39E9E57083814FB3C trey.noreen
684,881,134 *46B0CBF3052C2418F115267678F3C57B002733C2 trey.shorts
684,881,135 *46B8784CB3DB7E2321C4CA753D3D9F74498AF290 trey sowavey
684,881,136 *46BD664CF9456547307DE0B93F27E3267A967D36 trey.staber
684,881,137 *46B38F59F48D82A45EFC40CB6BB1FEBB41A6861A treytori6
684,881,138 *46BE97084D5CE7D98C940659D7F800034AA3E797 trey.vanderloo
684,881,139 *46B4AA54E17AC44954AF1417DAEE30681B0B7F39 trey.yackley
684,881,140 *46BEA8ACC016FAC2E9C94B18787DB1BCE6F96741 trezevantbsw8
684,881,141 *46B4BDE126AAFC45CAB1B5808969510134693A0E trezvan rashaad carrigan
684,881,142 *46B4E9DA62FF2BC2B7EC20B2F41BB1584F11AF4A trfisken5
684,881,143 *46B3E3D8F13FA7A01E25856CB2EB48BF78215FEA Tr!foc4l
684,881,144 *46B481EA429171B0E6E86ACDF9F46D0FFCEC862A trfuenteheridos
684,881,145 *46BA970361EA1ADAF14CDA51F536D53426F48771 TRGGTN23
684,881,146 *46B7D95A187A977ED42F20F8B3215837D88AC4C9 Trgmah
684,881,147 *46B83CD2B8B9F2BE239CD2AB06EA98FBEA79F381 trheufie4
684,881,148 *46B1414D267460848E4991DB80F13737F7932A70 ṭri
684,881,149 *46B0F47D1487BD695A723074955808D461BA7471 triabrown
684,881,150 *46B93E58341333C5C50458653390D2C987B4FDE4 triactinaL
684,881,151 *46B36E9D5696CDDEE75EB60358BCC33F586EA617 Triaenose
684,881,152 *46B7662A29B0C6CA359FE658D203C6F518462149 tria iyha
684,881,153 *46B6460A3EFDAFAFCA71A5B21ACF6CFB76A98E7C triaminicin10
684,881,154 *46B43F40029BD8C06167C2A1DB52CE5885EE9921 Triandafilow
684,881,155 *46BBDBD051387174D889D841E960EDE15CD2E58E trianglefinger0
684,881,156 *46B19BBF38FD6C31EF6EE23C70AD8461CBD01686 TriangleInequality
684,881,157 *46BE928DD55C8B3DE744980D88F8DD9135F1F305 triangle'[email protected]
684,881,158 *46B5631B16DA70820B4CFEA143907FF9917BE451 TriangleWalks(Spektredub)
684,881,159 *46B123FE65F8B97C497CA0B328EA05F54CE3155C triangular funk
684,881,160 *46B5732E4478D8FD7E5D6175819726743DD12D4D triangulate—the
684,881,161 *46B29FA3BD82E46FECF4E1F6C60DCBB37EBEB9B2 triangulotria6
684,881,162 *46BF8546DAA79397722E087F3AA9A4F7ED7D7F34 TRIANGULU
684,881,163 *46B1A258726ACC0BCBA2B3D837206F088F901B5D triasipujol
684,881,164 *46BC4E01E1690D58A5AAD5EAFA2827B67FD4A92C TRIASSOAPHIS
684,881,165 *46BB5D0D21738CC287107B4AE2911A16F3FF1E26 triatlonawards
684,881,166 *46BD72B13ABE07F54EBE7CF127C0FDB23BD19F16 tribalapocalyptictrance
684,881,167 *46B1DAD28DDAAED5367F9CD59B8B9D16EE57C8EA Tribal Inc. (original)
684,881,168 *46B9CB51FA5CF033E52BA638DF38251F50DE362E Tribal Instinct (60 second version)
684,881,169 *46B470E5AE97C7D653104BBF3224274783870CA6 tribe5m4n
684,881,170 *46B6663DF63F82FE19D454D3DD78CCE7C5A4FD9B Tribedd5
684,881,171 *46B402B3C99E5CD8890363EBBD1E23346F99A01B Tribonemaceae9
684,881,172 *46B01E97E6C96C2272C2B2E61BFDC767D4BC21B5 tribonian's
684,881,173 *46BF2A3F4FF4C0BFB9206DE7E30B97AFC28119FC triborati
684,881,174 *46B84091181BB43A8B27E8F719C0C4BE920D644B tribuneconsul
684,881,175 *46BA1760FCDE3FC7AC73FBC6626805062B86074D „tribuniștilor
684,881,176 *46B5A8F99C2520059E6DE432047886E72F2C1B6E (ごみんかん、tribunus
684,881,177 *46B4B32A37CEE808B33B818CB139F344CBDE5802 tributarest8
684,881,178 *46B2043E7D103136E31481F090363F9766C0E89B tributepile0
684,881,179 *46B7081AF808291472239A5E494540455037123D tributereminder
684,881,180 *46B4342E444CA894D0C5196F3BF77B2C1F8071B7 TRIBX
684,881,181 *46B35CD71F4E997ABEDD3FFB3F7A7B23D021F899 tricalcium.
684,881,182 *46B5542EE535A8DF0FAB6819EDDB64229A367A5D tricentroled
684,881,183 *46B64AAFDE7FA72B527CA9D0A08CD08D9ADA23CB TRICHA
684,881,184 *46B1B1BDFDFB0F83F9EAF4B412CEC44340A4183F Trichanhing
684,881,185 *46B2ACC1E404B6D09800B829DD047B2D1284528A trichinizatioN
684,881,186 *46B3D968F2D20249ADA8BEAF315DF8366E9654A5 trichiuridé
684,881,187 *46B48A9A968C2E4978A2B09399722D33B4B55949 trichloro$ilon3
684,881,188 *46B4A60E801AD71922D58ACF1F01A94B995F8348 trichoglossinaes4
684,881,189 *46B5C79F7F16D5F8AA69DA6AE8AEB1143CA6AA76 Trichopore4
684,881,190 *46B42E2ECBB231105B970A1627C457C66C7A8837 TRICHOSCOPY
684,881,191 *46B11B4ADE2826D85CDF819B2C5A80D4B8631100 Trichotomic.
684,881,192 *46BE13CEFC9542F128DEE170D1EAA8BD41AA8B56 Trichozygocera
684,881,193 *46B8E60B52B735BD0894C290E71C40376729255B trichterfoermigen8
684,881,194 *46B44092943A53280D34AFF6B496E7146F74EBD7 triciaallen8
684,881,195 *46B834A51D15EF82CA74FD22536696D6207F385A triciaandrew2
684,881,196 *46B4CFE2E9F7DFE7E2EFBBA9882FFB1307EC2BB7 triciaayuste
684,881,197 *46BBDEF2044409BBB7F4CD028190B3DAB9F6BD66 triciacauffiel
684,881,198 *46B31FFC74EB18467EFF84D1E79D14811AD6304B tricia hannah arenas
684,881,199 *46BD1AE2C1F973CAD75F22DA58E80087D74C3DB8 tricia hasty thompson
684,881,200 *46BE0DD651374351A0EEC6192FCCB51742639230 tricia hernick
684,881,201 *46B76AEFA950AFFC3EEF4CA5E04EBF5B1CC6CABB triciajulian8
684,881,202 *46B986EA93B0B0DE61709ADB8AC6BC3D039620CE TRICIAKEITH
684,881,203 *46B1213589F2CBE5F9D426553D7781A938611067 tricia lewis wilson
684,881,204 *46B05E86E6D7D92FC44057469675725BA7E3CF80 TRICIAMARIO
684,881,205 *46B18DC48FCFED3D989AB137F9F195B5617DB39C triciaorangeses
684,881,206 *46B69A9CA526462F5B29488DAF69E04487154EB5 tricia pearson korcheck
684,881,207 *46B297C166A35B7DB447DE7FF6D2AF9F71DF10C5 tricia pizurie zoern
684,881,208 *46B5C1329443F3433961E62561AA23F3967A8ACD TRICIAPYRAMID
684,881,209 *46BCABAA1E467C9BE246CB6CEB974029309F636B triciareefer2
684,881,210 *46B65B142FB2106A401436DAC32E80FD276337F3 tricia riewer
684,881,211 *46B6DF8624247E766EEAE53B1A2784B518AE8858 triciascarbrough
684,881,212 *46B37C6B41597D40B99F2464833FFAB68178AF92 triciashoes0
684,881,213 *46BA4798201C8CEE629714475D57212DF9B4AA64 triciawestron
684,881,214 *46B5F22052EDB649F379C0A37C3C42667DBE7F75 tricia wollett
684,881,215 *46B38E436F1C5CF66D4054374009E278907AC694 Tricky and brilliant and heartfelt and dangerous.
684,881,216 *46BEB111800353B80FB027206A4E992FE677AB51 trickyritchie
684,881,217 *46B84A630C3EFF3E2E5EAE5509745ADCD9F1CCB6 TRICLADIDA8
684,881,218 *46BCA4BF0B3DB68FEB974B4BD305FABC9D1D4C17 Tricladida9
684,881,219 *46B408E0FBF0E4B0311A76B6E6D550D52B6F4EBA tricolomatàcies
684,881,220 *46BDFC63BEAF76CEBEB09F5A83A82C45F5A21424 tricotas6
684,881,221 *46BDD0D69DD0B7B4151BA2E0D54CA92053F3451B tricxie ganda
684,881,222 *46BD70C96177B1C849E587004DD025514FD361AF tridacna gigas
684,881,223 *46BF2FE14D165B1D0E1C5CA1B14956CF1B5479C2 tridarnses
684,881,224 *46B9CE527591D40F1B80F03702AD9CBA3DB3E1CA triddils6
684,881,225 *46B616357C4844EF57EE817E46E27BB2F789EDD2 tridecene3
684,881,226 *46B21717BA06C31FA9D47C387452CE8A6997E76E trident0:
684,881,227 *46B2B121439F9FA34F15B6032989E65D1EE055FA tridentannas
684,881,228 *46BEBDA4F33FDFBDC46277A559B3B6FFE7A46441 tridentcastle8
684,881,229 *46BFEE967A437E202FFEBD9F332A25E37BC15267 tridentchurch8
684,881,230 *46B79EC6DEBD0A361989657E19C580252F7C9566 tridentdelta6
684,881,231 *46B6CDE0A86337EC533AE205C4385CA18DC37CB2 tridentemessi
684,881,232 *46B539A83B3A2FE60323877EB8A81D31C581B477 TRIDENTHAMMER
684,881,233 *46B99D6D059C98D8313BFEAA307D82DD9B8D56A9 tridentmacha4
684,881,234 *46B32144B810FB3B846EDFDD6B2C8FAB05ABDEE7 Tridentmegan
684,881,235 *46B1D465B2C71C93292DAA61016ECB48628365B4 tridentpearl6
684,881,236 *46B7D40056AE79707EEB47F6F1F412FC1CE8A35B tridentpenguin5
684,881,237 *46BC2FE083AAAFBD7C2ACA01EB7CEBE0C17A9970 tridentsampler1
684,881,238 *46BBD196A5E73BA5D6328589E8BA143D2FD2AB29 TRIDENTSTORMY
684,881,239 *46BF3F684D1B7FB9406EB55865A6E4EE0C385198 tri-dome
684,881,240 *46BB86911E63CC1172E59757EFEF71DF27AA0050 tri-dragon
684,881,241 *46BAFA78BACC3E23C8C5962A00ABD68D843C38D7 tridrasing
684,881,242 *46B038E16C26D6BEBDCFF3F155CD792881A67C9F TRIDUUM7
684,881,243 *46BE3D3166AB011BA1E1492638CD8F04AC8E3CD7 triebkultivierung
684,881,244 *46B9DD017D3D7306852210BD0977A0AEE8908B2A triennalerne8
684,881,245 *46BF66E8A896748CEAAE498237D67777FA3EDF9F trier''s
684,881,246 *46BA7943E303BB5694F1115D3213302084F02AD6 triesseirt5
684,881,247 *46BE66EA4AA35AC2154F9674C0FBA03543E2E8BE triethylene7
684,881,248 *46B26F98025645CA1B0473F1D9B08763E977F35F Trifacial8
684,881,249 *46BBAECD3F0BB782FA29977462ACFBA5B5118C4B TRIFFIDS1
684,881,250 *46B83CDC03B1A3B023E1DF57E0F53BBBEC0A5500 trifocalseds
684,881,251 *46BE9898AA333A7877C46C820FD2C297C26594DD trifoliumtrifolium
684,881,252 *46B7C46B8E9EF3B65D1EB422A1A2DCB966EB1693 trigesimo7
684,881,253 *46B580C462BE94F624505E03BE55324E44B56494 TrigExpand
684,881,254 *46BA89C69DA96FC465ECD6D822AC5F240FA25AD2 triggereffect
684,881,255 *46BF2F20D4EC21AD26EBA2E5BB98B33AC9585F54 triggerman(eliteforceremix)
684,881,256 *46B00C1542B4AE5331B0D3C1AFFEA4A6115A9CF0 trigliseritlerdeki
684,881,257 *46B5C16266DC5F12E909956619B47FA0D4FC0F2E trigonums8
684,881,258 *46B82C95C061657531E50D72C9FE36EAE32843B8 TRIG-POINT
684,881,259 *46B35801C6D4EC45AA0E4022EC3E480028C4DAE2 TRIHEXOSYLCERAMIDE
684,881,260 *46BD913FDA7E065308753D04DB1B5B668A11ACA3 TRIHEXY
684,881,261 *46B73B90A3DCBE8EDD60A645BF8E9AF9F1FBADB3 Třihlasá
684,881,262 *46B6487E28AB76EF660198DAC7384D3BFBAC6DC4 Trihydrate!
684,881,263 *46B518E59E717BFC2B2273016E0B41D65AC0D1A7 trii maliboo
684,881,264 *46B6ED116D5BB4FC6D7C2B609EB773410E2B95FF triizma
684,881,265 *46BF6B2DADDF5F341C73DCF47DCF726D9B349E7B Trijimas
684,881,266 *46B3196504627123C4DAEC056A2B664CBB0C54CF trijsblokkens
684,881,267 *46B2C817ABF42AF5660FB076756AF100AC7D007D trikala123
684,881,268 *46B1519DD81100F4C0E94655C63819CBC02927D0 trikkenesing
684,881,269 *46BD27CFE112DFF5549AE07040559233C8682018 trikotagefabrikkernes9
684,881,270 *46BA16745636579AF13DD3280D59A73D6848F887 trikspu
684,881,271 *46BA01AE7C4CAD9DBC8B5F3FCB5BBA60D30AD6C0 trillaneslanuzo
684,881,272 *46BBCEEDC6656093C94721D42835FA8AB4A96A31 Trillening
684,881,273 *46B43B32E7D56BEF1E68B1AFE484E0A6A21F3CCC Trillerfiguren
684,881,274 *46B92ED02F3A3A3EEA4D2DF674CC12ED4C0F98FD trillionth0
684,881,275 *46B1E003B31850A8A94226304C45D780C82F7BDE trill n****** don't die (feat. z-ro)
684,881,276 *46BAD07CBE99CF0671EAFC37B52F9B0E32D31202 trilogytalksundering
684,881,277 *46BC13A36DEB4F6D4FADC4F549F1180CB3B030F5 Trim0t0r
684,881,278 *46B9CDF9016D1B91BA0B796BF4330A00D24AA525 [email protected]
684,881,279 *46BEBC06F2A6F2CE833DEE4F9E3C454E53727616 trimestralizzi6
684,881,280 *46BA82D2D8D5098453230399AC302446B92DB9C6 trimetha8
684,881,281 *46BB35381183DF6ECB818D2A02C1031CC997349D trimethylsilylgruppe
684,881,282 *46B38C6AD4230293C767E1DB99B8CB7DC4CC2BE1 trimethylstibine3
684,881,283 *46BC1B302FC59C81082D7267467BB823EAEC0F01 trimetilsulfonium
684,881,284 *46B62212B9FF80079538B1AA5039DB5B4C25419A trimmerb6
684,881,285 *46B230A853788CC25CEFF02A793436AACE4F1D7D trinaballantyne
684,881,286 *46B52745715988D1F8AF6AFA916370AA5F67FDCE trinabuggs
684,881,287 *46BD18FB7BD184D81A4881ECCAA06D28DEDBCB34 trina corrin shawl
684,881,288 *46B92B570A0BDB5E460CAFB5E5E4EBCF9E6CF98E trinacrian5
684,881,289 *46BA7736E1A985163456591AF8F1391176C31158 trina dawkins
684,881,290 *46BDA2D8F2FBE84B757194E0638F8DE128EF6A87 trinae holmes
684,881,291 *46BE26F096D41799457BDA863332D963D3719648 trina furbish cedarstrom
684,881,292 *46B2EA41466AFFC3A99CCA2A5A3D33B4257F2C9B trinajhonse nacional
684,881,293 *46B6B71960555BE622F219727C05B2BA893A8438 trinales9
684,881,294 *46BC9CF59813AA84FE3892F16A4F254C29393358 trinamcarthur
684,881,295 *46B1ACA2058271B3465007317891984AC43C6510 trinapaevere
684,881,296 *46B8627EEC0133A0179CFC7AB08FADB35A34B1E2 trina palmer leitzke
684,881,297 *46B2A1DDFFA73192C32C43F5D7B781204EFF456E trinapetersen
684,881,298 *46B36D4401236933681384BF10A64E7238578889 trina podence norris
684,881,299 *46B1AD767ECF1A6F9C31537462E0892390779F8D trina pond
684,881,300 *46B3BFA4D1CDCF57FE9D650BC53CFAE05791626C trinasteffen
684,881,301 *46B159E9FB455B79CD7AC2DFA9278B60A0ECE87E trinathornhill
684,881,302 *46B91AE04912DD1E503DFEB97943BFBD66CB8366 trina wise
684,881,303 *46B5DD812227C5A196C6E7DE7A28E1673D1C364E trinces9
684,881,304 *46B6E72669EA70E76339163564AFE5707646E495 TRINDL'S
684,881,305 *46B76C85E530B34EEDAB7B6493A4B3C4140D7555 TRINE1310
684,881,306 *46B167E431BE73AFD0C67D58AEE2758EE4B72DF4 trinflgerne3
684,881,307 *46BE6010917F4B71B0F63CB1DC18059E124AB8EE trinidad.bator
684,881,308 *46BDEC7244ED2FF9AA3FEA782AF8736876089329 trinidad.blunkall
684,881,309 *46B0C67B341ABA15A2B95340A106610451B0D3D9 trinidad.bulkeley
684,881,310 *46B6FCFE022063945D900D3E75EC371A9328E19A trinidad.camarata
684,881,311 *46B8B782C157C4E37B30AABB9D5C1C4319CE2386 trinidad.donohoo
684,881,312 *46B91BABA43BB0D6106B82F10675FACD1CD1C142 trinidaderes6
684,881,313 *46B60DFEA2DEA7C754E588FC663021DB663BC2DA trinidad.fingerman
684,881,314 *46BDC50010963403DA8971AF8BDB9DCE4EFE10F6 TRINIDAD-FOOTY-BIO-STUB
684,881,315 *46BC6D68C6FF1FE09E0EC17A4493B2E14D90E12F trinidad.furlong
684,881,316 *46BB2CFB0EE9F6E9E212F7CE3924B47A4B8B3F6A trinidad.gafford
684,881,317 *46BC8B1ABF880D187F9571EEF87F8B30E2F6CB76 trinidad.golladay
684,881,318 *46B1E5D1BCE80D4A8DC05ED3D974F580008DF4D1 trinidad.hegge
684,881,319 *46B3B8A38C6FB06D93E2A532036DE6EE9730F1AB TRINIDADIAN-INSPIRED
684,881,320 *46B4C93F4BE5E0FDE88DF58ED6DB6C9C0D157A43 trinidad.korando
684,881,321 *46B9B3A965694806346903944222D69C1543EA42 trinidad.kostyla
684,881,322 *46B22FABD5D521889FBC015CBEB4F08DCFEA9429 trinidad.manero
684,881,323 *46BEF9CCCF5C0B50EFADE43A06C358560063EAF0 trinidad.monti
684,881,324 *46BB0E2EA2970980A3BB28867C2D276D8165AF6A trinidad.moseman
684,881,325 *46BF9B8BD7004513127B6879ED850FD77C2F1330 trinidad.muff
684,881,326 *46BFDF0672F61C2E907755510327CA4935C47AD9 trinidad.swatski
684,881,327 *46BE1F01C52D2CB2A8189A3E48F74B4E9DC25B20 trinidad.veness
684,881,328 *46B0FB11FEEAE41C865BB180D7717AD8D4D01BAA triniscopeses
684,881,329 *46BAF80F260BE3F9A101A1BA96E7698ACB4DD06A trinita mcnutt
684,881,330 *46BB09386C6A3CCCDAE2D8EA88F3E76F98920604 trin-i-tee(interlude)
684,881,331 *46BEC7008C203E9FC17F45B68A8984D8C004DB99 trinitramine
684,881,332 *46B5C5C698BA963CE8339DFE0164D165B38873FD trinitrotoluen9
684,881,333 *46B35376298B599EC38C3E698E89E52F50C439E5 trinity atkins
684,881,334 *46BFAD226532583D1033C2E0F89B802B78AA72C2 trinityhk
684,881,335 *46BE79576D0F719902BB9BE5CE0156A9D1FEF032 trinityklamath
684,881,336 *46B4F39601E6426861DEE5856DF0FEEC7D8FE37F trinity storey
684,881,337 *46B03D2934F6A2C3358E2F7B227493F86DF92D7B trinkbechern2
684,881,338 *46B4CB298EEF4BD8D04B9D7ABA284D46ADD92367 Trinkerliga
684,881,339 *46BF7805A377099FF785F343F5F9A0D957925186 trinkspruch4
684,881,340 *46B1151E8825D00A1F0F1F4C7A677767BDCC2DC8 trinkumn3
684,881,341 *46B6610A2104C1309757D46DE827DE88D248CA5A trinsa jhjkhk
684,881,342 *46BCADE32B4E4D564A88A2F205EBA0180F714C64 trint gilbert
684,881,343 *46B2858164952DA8FDCDA31AD10EA2FC3502D2A7 trinunion6
684,881,344 *46B23D0077CB7C39F8A0E0DF78CD43F6523F2E48 trioapropos.comwww
684,881,345 *46BC229F5F2A609ECCF6BB7EBDFEB16D5C2A4674 trioforstringsingmajor,k.562e/anh66(fragment):allegro
684,881,346 *46B16A8881F9A2EACEEA84EDC01F7A1FC57DAE49 triokoo
684,881,347 *46BE09B413FBCFCEE3E5EB75811BCA1CA2019577 Trioler8
684,881,348 *46B0F6D2C5A14495850E1C2A6CFAF5CACD1BF525 triompheraients4
684,881,349 *46BDB80928B8F9358E298E1BCB7215327D10E820 TRIONYX2
684,881,350 *46B7B0BFF6973743DFBA9E8D0A42A1FA3078FD8E Trio Sonata in F major TWV 42: f8 - Largo
684,881,351 *46B1FAF5121351B3F5FC73FA6D2CA1BC99DF5B7E trio sonata no. 2 in d minor: iv. allegro
684,881,352 *46BCB9AB0F7A2FF5832BD61E3953E4ED6FFCCECC trip62nip48
684,881,353 *46B94602C0E166CD1DD190BC2241DF9A4353EED2 tri parman
684,881,354 *46B039B297C890388942963867D3D5615D562C43 triplekparra
684,881,355 *46B740C8D6200A97C866F860648D1CD2347CA0D8 triplettes3
684,881,356 *46B316B205F5902172E8B1A475E1760FA79FA502 tripletti2
684,881,357 *46B8466ED3614FFB734E6DA306EE6A45F364155A tripliclo1amos
684,881,358 *46B49F1F4ACC4E57C4DD49DDDD1DF0B2CADEF2EC tripoligreece6
684,881,359 *46BC574E8791F6282B02070DFE0EA5E9461E5ED6 Trippati4
684,881,360 *46B8C4543876595EFD479D20CEB41666F46ECC66 Trippin' on a Hole in a Paper
684,881,361 *46B4CD2CCE16DA9C1BB5F719D44DACBA74D7C52B trippone7
684,881,362 *46B0AC5BF6D0FDC4D941FECE5423AE31BA86FA65 tripteshdas
684,881,363 *46B3391A3B9E5CF96FA7CD9AE2719EEB69CE931E [email protected]
684,881,364 *46B46E2CDE5C3F263B95C4D8B7ABCE412978AF2B tripudiing
684,881,365 *46B20140A3AA2E74AFDC1FC1A5DE261D6419BFD7 tripularest6
684,881,366 *46B30A9B0B9C66D66359AF2F183299152D5B9199 TripUpNorth
684,881,367 *46B13F9276BFC28C057826D6A55904A020429C33 triremmene
684,881,368 *46BDDE49876D922DE001A87533CAE085821A17EC trisādhana
684,881,369 *46BEF6AD1E3496E7F9F0EBF06AC92E3CF5C383C1 trisaktibayu
684,881,370 *46B523729E8BC4F9BA0C4FF00191A342E3663D39 Trisalts2
684,881,371 *46B050D57AB232DA6BA5B87387F1B841FFF09EBC Triśaṇku
684,881,372 *46B017C767668AD3717F2EAD1C4A0B84B9E7126A triscawojo38
684,881,373 *46B14F20715DC5FDBFB612377A447A9D90E731C2 trisecamoses
684,881,374 *46B1485B70AC9E7E9469A2264577C793B506ECDB trisectersed
684,881,375 *46BCA939CA07CCFD4B9C82166BB698C17A9940F8 trisense1
684,881,376 *46B521022B982C2E7EC0F70EDD5114AB671DD23C trisha bruderer
684,881,377 *46BEA46C2F3CD0E8C3463A27D3A4637B3D123F88 trisha desouza
684,881,378 *46BCD6791EEE7AABC56636CA4C15676C8A033947 trisha otonashi
684,881,379 *46BCD7E01904F294816C78824C0D3A4736DF0909 trishcoppleman
684,881,380 *46B92F9636F5315F336D70AA4B7D07EA78C62A63 trish crews
684,881,381 *46BC4096D7785B750DC959A27D8241A8AA81E784 trish elle
684,881,382 *46BA9AC21006B1052EA0234262745E80AAD28E79 trishgarikayi
684,881,383 *46BF14DC160B697F6E28D6AFADEF20907065B032 trishgillis
684,881,384 *46B1600A2B663C28010C6CB8F77072A56442D515 Trishirasah
684,881,385 *46BE6C33BC7C648AE04B8C7975760229855701E1 trishircoomar
684,881,386 *46BDBF8019907A116B5D119B8B3F9F1B01DFE33B trish lee peters
684,881,387 *46B0D8FDFBF18B88FC9A04B279F0AD3A27F75478 trishmordacq
684,881,388 *46B35D8D3500356076B5BB50869A7FC0ACC29033 trish oflinn
684,881,389 *46B4389D086D5A897E8B0A06B7F130FC63FD74D5 trish rowney
684,881,390 *46BAE5636BBAD35F7547E8B40557257D7F015183 trisjamalisoff
684,881,391 *46BBC757975A089E718D32B3BB6296C9861DE5F7 triskele-symbol
684,881,392 *46BC09E1D7220A0B6603BB7FCA87C6E9C4BD03A9 trisnarina
684,881,393 *46B1B761D6AA9AD5666BE26C950785365CA97A81 Trissures?
684,881,394 *46BA2191C22C349863558EB38500B44EE384E431 trista chastain
684,881,395 *46BA52BE3309FBDF3F523ACCBB367DDD7646442A tristalearn
684,881,396 *46BF03D44DD927F3CA11F96BD5D8810F3E3867CA tristan.acoff
684,881,397 *46BD3A9264A583FEBBF2F28451EC874DAF5FFA5B tristan.albea
684,881,398 *46BC5FB80CCD03A9DE9BE6908218C3BE692EFDA1 tristan ang
684,881,399 *46B6FF32E9A066E380FFA97DEC9FF6654820E78C tristan anzaldua
684,881,400 *46B70D00D56081FAB67E052CD47AB6750D9D9430 tristan.ashly
684,881,401 *46B7319313F2D830585EFA208E7CC477B0DF1B29 TRISTANBASEBALL
684,881,402 *46B410119C95D5301F0AB3256058E5A1716C7C57 tristan.crocket
684,881,403 *46BBAF2D788AA5AE93FECF9282A406F4791EE152 tristan.dockett
684,881,404 *46B228D186282AA93DF97B67DCF26177A1B6E3D6 tristan.dummer
684,881,405 *46BA7B0A5612BDE59CEA6ED80F8B5409BFFE5236 tristan.elifritz
684,881,406 *46BFCB6E190CB61A1A63BD090C98A01BA45D1F48 tristan.fichtner
684,881,407 *46BB6D1E5978E35F2AD39C680F30A9D796C276D4 tristanfriday8
684,881,408 *46BA57BAD7A5022FCA5442765006C6348810B186 Tristangary
684,881,409 *46B965ACA3B9800DB1381B3D06B0FCBC2323A068 tristan.gehron
684,881,410 *46B0336ADF9CD6624DCD961D17AE2EBC9D439439 tristan.hunyadi
684,881,411 *46B9E1710E353697D85AC5C915E4CAB18473C583 tristan.jamie
684,881,412 *46B5B7D4D283B3C900E6D47354509966815C744C tristanjason8
684,881,413 *46BE3CEDC2021AF49ED187372B1A06EA778F8895 tristan jay ramos
684,881,414 *46BAA5813A5A2E160CD7465D19F39B8FB35F1466 tristan john cottle
684,881,415 *46B737C7D67F91084166C0563531C4299223D7BF tristan.joshlin
684,881,416 *46B167E83E28E0C150B0A6FCC39B0844F1CD5E8F tristan knights
684,881,417 *46B2B3A4EA02F79E51C581F1FF678F862967DFAA tristan.lafuze
684,881,418 *46B2BAFCDB89FA59CEFCF373ADA710209810E15B tristanmagnum8
684,881,419 *46B9AC2C7346FA22516815B7B40975FCABEA249B tristan.manweiler
684,881,420 *46B61412FC2499E1E96E1C54784768133BE12368 tristan.mazingo
684,881,421 *46B065AA71B489F6875EA51F08F602330906C40B tristan.meisels
684,881,422 *46B4DB636C7A53B0F78D91CA8A5642E3B840FC59 tristanmercury0
684,881,423 *46B899D7566BC6ABF551D4A1D69721DBBA5945CD tristan.mizer
684,881,424 *46B518AF0A8897A26D9F16937D753432139FBC01 tristan nathan morrison
684,881,425 *46BB776213F52265F5DEB9E65E15904C66FA2371 tristanpeopled
684,881,426 *46BF134552203898ECAC72E09F0A6D8C198D5F3F Tristans1
684,881,427 *46BC9E04E9C3527E47C68D1BFBAC46BF5E620B55 tristansampson0
684,881,428 *46BBD2E3AE095B806D29A791B2AD2ACBFB92A5BA tristan.senecal
684,881,429 *46B99DD046921AFA2B9BA64B7B66C6017CEA49EC tristan sullivan wilson
684,881,430 *46BA05D9915EBF1AA98ADA32BE50039F252DC0A1 tristan tabernera
684,881,431 *46B1302494DA24A836A25FE6E1F1740473DA09B6 tristan.tadych
684,881,432 *46B39650EEB2B8E53DFFDE6B2A75C4AD11B5665C tristan thomas burman
684,881,433 *46BDBCD59B233C20270E058455729816B9D25F45 tristan.vezza
684,881,434 *46B415CAB606C2745467E2AE41E8C12D74542D73 tristanw1
684,881,435 *46B939CFD5610172517D6EAC9EEAA279E12A26EC tristanwindybank
684,881,436 *46B90F7F132A62D0D9BD40569A65F2062681A86E trista streib
684,881,437 *46BBF7442E50B9C11FD2C45331B2C62A16366C1D triste-alegre
684,881,438 *46BEDA2BD14A394D861FA159056C05AC7E3DD394 t
684,881,439 *46B572D053E3CCF4BC6664528509BDD2FB6D5A8A Tristenesses
684,881,440 *46B743C77DD64CD8FEE6E437EBB3FF468E12F400 tristiched
684,881,441 *46BABD0C97E06E48906675E8E5771057EC511B05 tristin338
684,881,442 *46B518230448456D7A425FF9BA5FBBDEFA8BAE80 tristinhimes
684,881,443 *46BF687C9E15BBAE3B9C37E234E097C0BF3CD2E0 Tristive0
684,881,444 *46B49310A483D300EB159DEF5017936BCA80BD94 triston day urban
684,881,445 *46B35FA89B2D7590DE8DA4D11672168D959F77D2 tri subagya
684,881,446 *46B30555C9B42988999691823B1FE146DDAB0A3E trisubstitution6
684,881,447 *46B5BBC47140D1967C302BBED1D4EFCF83DF046C tritinga9
684,881,448 *46BC8D6E347C2C08D700B1308BCF6D96CEB7AE52 Trition3
684,881,449 *46BD60999EFAD185D2B0D09411E12C2D37C80DF3 Tritopterna
684,881,450 *46B763780AEEE6A83E3D71B509DAB1B07C3AA52E [email protected]
684,881,451 *46B70FCC8B74BC6B3061D48FA7EA8A75F8593FD1 triumphbakerloo
684,881,452 *46BC9E7B7F2F11BF16E4559B4D45A17E22C21706 Trivenuu7
684,881,453 *46BFFB13148D886EEDF800485CDDCD6FC5FE8E43 trivialiserer8
684,881,454 *46BE19E1CFAE3E55218D218D1E36240B0B93DFFD TRIVIALISERET
684,881,455 *46B349FC89F5812FFC6C058E2A446A817D213901 trivial
684,881,456 *46B35E808788A71B730DA88C438010AC0A6AF696 Trivialness7
684,881,457 *46BC8A4DF76CEA6AE45F09262CE8E9F981906884 triwatsuwan
684,881,458 *46B2DFA7EB5C2498AF5437325B04B2C531A90E8D triwhy333
684,881,459 *46BAAB2CBB0BF866B52E8F01DB76EB5DB172C7EE trixie619
684,881,460 *46B57DE2F028B350EB58E57CE8F32941BA3E464B trixiealexies
684,881,461 *46BABAF87E5CF88E15B055B78541E130B039049F trixiebabY
684,881,462 *46B300C562C53374DAD342BF980B46E817684499 trixie barrion
684,881,463 *46B31F3125912F6C33A5B92F7C0AD7C48DEAB8E3 trixiebelle6
684,881,464 *46B070676B1F4D57F9331E05FD488F0B9A26DCD3 trixiechristin2
684,881,465 *46B4D5971A25217FC0792BB17E4C01C6B471DE27 trixiedarwin2
684,881,466 *46BEE7D2AB77DFD2C71DBB4B99BC66607755D8BA trixieshawn7
684,881,467 *46B652BAF6A3B124A194EF7C6E92A5EB97B6498F trixieshelby3
684,881,468 *46B9DDE0DCBB80FAA9C07B6D54C519DAA62BEBC5 trixybullocks
684,881,469 *46B2E9C95A4C3EB95C38140DFC037018451E7A98 tri yadi laksono
684,881,470 *46B3F3117070AC5E0F66160A31FCFE665AA80924 trizanzau
684,881,471 *46BA902E9AE3AAE18B79B929275F19E50B7987AD Trizoic9
684,881,472 *46BE27AD29E38599CB4E57E087642AA06F6B256F Trjsgtn0
684,881,473 *46B0186EF2153B2156156E987C7D6C13656EAE6D [email protected]
684,881,474 *46BD4CFF7EBF3BD0370CB18774DE620DECDCA382 trkgmllgtrnlbrbrdd
684,881,475 *46BED3C2FD46E4AE9521591D80C3C600B8938D40 Tr
684,881,476 *46BE9A148429D48ED0D4915C59DE91B4FB863B34 TRKKANDIY
684,881,477 *46B07842BA0A89FBA571A7310B031C08F275C0A6 tr
684,881,478 *46B07D4A0735895215420EB6DB2FDDAC140DD77E Trmavskej
684,881,479 *46B66367AA524EF05D60B2A86FE2B3580CF96916 trmgrfrnds
684,881,480 *46BB9861D94DA88ECCD993611C6F99FFA696D80B T|rmminen
684,881,481 *46BEB55035950FA7F13EED1F1EB93F3B55072FC3 trmnbsprch9
684,881,482 *46B736CFC81E555B9FECA384C20BFE9C3B9A6806 Trmonomn
684,881,483 *46BA7576805AC5D1C67BEF8AA9424513F5C59EA2 [email protected]
684,881,484 *46BB44A706D4966DE34667C3D05D922D19077BC7 trmpt1959
684,881,485 *46BD9DF74EF57EB0725F504D2CDD9D322EDBED1B Trmrztn0
684,881,486 *46BBA88C20C02C511D86AA26044523EED33F8AB2 trmysradalle2
684,881,487 *46BA68EEFE98808F1E30F73F908480BAAE4B4054 Trnbnts5
684,881,488 *46B9A22A2BEF9ED2DC8259519C2BF15E7AA3493A Trnchrng6
684,881,489 *46B175FE6EA4BBF49DED8760C7A517291BC2E32C trndltling
684,881,490 *46BB2C9F82EB2F90F8701A14E23A98CD4589E35E trnerendes6
684,881,491 *46BC2BD3A54646881B2D9F05C0C42C9840D1FE8F Tr
684,881,492 *46B6E71801F84659E9DAE76F0B4FC15E870433F1 TrnEW
684,881,493 *46B092A4AC4217CAEFC79EE0E477EA1CC3E0EE33 trnngrddg
684,881,494 *46B5DE402F30782F4054E66411CC4325CBC82D0C Trnovska vas
684,881,495 *46BCEE4299037F14A4B1C1CAF4134957032AB9E9 trnovska vas
684,881,496 *46B37F638D0BBA996D8E5197BD5FCDD1C4DCFF05 trn`rnt
684,881,497 *46BC7A646E8DD249C88550EB7C777343AC733830 trnsfrrcrdbs
684,881,498 *46B6EBBCCBB98816D2A7BA63140BBA20E5C2D6FB Trnsgrs0
684,881,499 *46B5C1C10A042B60C6ED5416CBA60C9723240DC8 trnslcrs
684,881,500 *46B818CB06F80F7A76028C84723B9B20335235B1 trnsnrmlly1
684,881,501 *46B64DEAD70998FC4F4D43DE47704E7D52C62D49 trnsstrn9
684,881,502 *46B688D31002ADE082B25EA3CD8176351E6E76FE Trnsstrz4
684,881,503 *46B72E4C034527E0EDC8CC951801357FB761A6F1 trntppns
684,881,504 *46BCAF4C68C0C439B83BB12D862CEF5FCC3F01F4 TRNUQHVF
684,881,505 *46BE3616EECA77D5E91017DC03BE8437F2D24AD2 trO&
684,881,506 *46B4D47141FB2719D6B6F8623128D8E7A24F4B7D troadia1
684,881,507 *46B23E93F1C417801B07B1FEC2F71335FE2EA3E0 troasbsw4
684,881,508 *46B1791C592E40862F335CCDB8CEAA833AB79D68 TROBIZ
684,881,509 *46B5D12B6CF7D2BA1621E3B7378FB779EFA5D2C1 troboter5
684,881,510 *46B6DFD3CAEC034232E9F1A42EDB276CA3503ACD Trobriand123
684,881,511 *46B178753D024926EE631738E40AD72D5C174132 trobybswed
684,881,512 *46BC8E9FA8C70C0E9BFF0C834B54FA618D70C116 trocantegramofonye.p.
684,881,513 *46B47654CE9F1F568C9E3437BA24470742B945CE trocanteres
684,881,514 *46BABAB4BEFA9CF0703DEF7BD21E6A2E25F23427 TROCASE
684,881,515 *46BD5EF6BEE5E5749FD3EE240FDE909990B75895 trochato9
684,881,516 *46B791E44C8D399D0CD9C900C0AE3409A89BAAA6 Trochelminthed
684,881,517 *46B5FA3E530FA8D0B9404ED6CFCB5476ABA82B60 trochises5
684,881,518 *46B9A696B3E16A0609D6EED099F847224D68FD1B Trochleiformed
684,881,519 *46BE7C396ACB1BE3EA1A525214AFAD2E59E11D17 trochometering
684,881,520 *46B0866FAAF8ED9F40CEBB2722C0DD94E6A055A4 TROCKENFA"ULEN
684,881,521 *46BFC0688A3459EA6DACF33B5996104A73AA1A41 trockenplätze
684,881,522 *46BA6BA5D9EB76C71A5C4E37E0E46C7A8683334D trockenverfestigung
684,881,523 *46BCF7E970EC0BF2AD2C1DBB310EAC3BB52EECC3 troculenze7
684,881,524 *46BEB4AC3DFDF50C02AA8C96566504563C37F13D trodelten6
684,881,525 *46BF80CC831BB3C27D050AC782FE9B5DE9856470 trodsalderen2
684,881,526 *46BB4D5BDDD422C13517AAB16738712AC5C92974 troebelheids6
684,881,527 *46B207A17F4A55F33F68F2693BF36AC8883C0788 troedelmaerkt6
684,881,528 *46B5F5C219DBD24D5FFE6D29CE1CCCF2E207DA8E trofeetrofeing
684,881,529 *46B96EC6F1D09211CA6C3B88A06AF7D1B3BFB9BF Trofimene
684,881,530 *46B153D21A4F944C2408E8FC39E468FE4661C6FC Trofnob8
684,881,531 *46BC87153F4AA2468931FB0CA18DB82F9038D043 troglodytisms9
684,881,532 *46B21D58DAEE75709B5ABDC63FB9052314857CED trograderaises1
684,881,533 *46BF63404B68DFFFB7FE51C877BB7F6A2D6AE752 troja22
684,881,534 *46BF40439ED881BF4F1E62D3C9C7138CEF08C099 trójce
684,881,535 *46BA44E138C63E35ACEB152913369D1891129EEA trojickie
684,881,536 *46BA338661F4F70BFE375E23BD768A7A0A0D00AA trojicom4
684,881,537 *46B5348ADD792B3F650C9B873E083977922BC9B7 trojkaordningses
684,881,538 *46BE0A515086A54ED1A5264E7679D2E7A86B1C02 trójpolem
684,881,539 *46BF2CB80E76ACCC3D65D454B956DD0BF3E13444 Trojsp
684,881,540 *46BBE0C0EB3E9106E1B36E02D95A82A7FADA1E5C Trokiele
684,881,541 *46B9C7E9D1B20AAF66366A102D5EE12A0BB4C89B [email protected]
684,881,542 *46B17381D82FEA1EA8B70F00BDAE8EA7B000DCEC troliként
684,881,543 *46B36E337A7EDCA34306FB3CCE163F67BB2AC16A Trollbergan
684,881,544 *46B24ABC2FA2ED0F99583C3A3BAF670188559ADB trolliming
684,881,545 *46B1C86073258797D794ED91C7F02ED38B513EBD TROLLSTUB
684,881,546 *46B1E4EAA7235C9AB82D35EFF51308A55582E918 TROLLSWHATEV
684,881,547 *46B5B13F8DDF0289CAF452CD60B0415F1F472C6E troluxining
684,881,548 *46B942F290143C475C007FAD1A3234CEE5B348D3 TROMANTADINA
684,881,549 *46BB564F651C78448AC4F4CEACE3C3F9D1B19077 trombonemagic1
684,881,550 *46BDC44D1A0BB688EA37D85D227BF4CBF9F27B20 Tromdes4
684,881,551 *46BB5CAED94F4F8EEE927FB79EE05DCBC0EB0FD9 tromeys
684,881,552 *46B2EC0B6ED3FC8488EC66E4D9851819C4089F8D trominutna8
684,881,553 *46B5E01D34F7953EFB0B3EDF76A17A2D2AF0BA2B trominutnima2
684,881,554 *46B7E1D8F029AB6666A5C076FFCB777A1EC66DC1 troml3nd3
684,881,555 *46B9E985C03FD02F5583D3C1B7BC9E2CB703CEFF trommehvirvelness1
684,881,556 *46B8A85BE7D9E48A6CF9F55FC12A7726195F2C9F trommelærer
684,881,557 *46BC068D65A1C133466E0A766D37F084EA00731D trommpus0
684,881,558 *46BFC7DF702AFF70B58A373E4148BE61DF9F39BF tromperont3
684,881,559 *46BB739E2386D23FA10F1AC30EF77C2E51F6FDE1 trompits
684,881,560 *46BFB03128672AB7E2961BF2813D0E7BB0708C97 trompowski
684,881,561 *46B15BC7CE9F532F46B0493D10ADD9A73482ABAB tronbatmaan
684,881,562 *46B1EAED27FBECB15E284DFBA3A788AFE167AFCB troncal4ts
684,881,563 *46BFCDFEA7EBDFFB47DFAB7125771C71A06E80CF TRONCHINO
684,881,564 *46B21D4C821C46ED47A8D6623B83F3B704D7A41E Trond B
684,881,565 *46BB4BF13513799E2501BFFA31F67293D05B5A1A Trondelarius
684,881,566 *46B4D61350E03277DF5B44185A8989905555CD00 trønderschen
684,881,567 *46B10D0D18878EE76890EAD01160837373CE206D trond nagell
684,881,568 *46B54831B0F9D3FF027F8B9EF8CD15BD906F5FC8 trongfjorden
684,881,569 *46B902854E3B06A740975A212184DCAD92584399 troniquewoodley
684,881,570 *46B8B0D344C0DF2D16B07B39FBF2085FCADB17D1 tronquezs8
684,881,571 *46B871E8EB5BF91C8CF54B44AEB25DE9B9174F1D tron(remix)
684,881,572 *46B717125058C751ADE47ED6BF1C9AE4FD052E01 tronya jackson
684,881,573 *46B38D00DA56495579C9BE24D240DC49DFB58E2A troodontidi
684,881,574 *46B330C30F007E10F35339390AF089F71C826945 Troonzaling
684,881,575 *46BB24C765FCBBE53B3A1FF1B2D2C6E2C7E6C78F [email protected]
684,881,576 *46B6ACAE096EAE035B5072952EA52A7BA058A630 TROOSTREDENEN?
684,881,577 *46B4CEF307CD58E8526133906A69134E3BD4488D TROP1C5
684,881,578 *46B0D7D0B88B1B0A4ADAD165CB552417DBB53111 [email protected]
684,881,579 *46B7788020BBBB8E1982595EB3AA2E59208DB698 tropario5
684,881,580 *46B0FB8F9CBF21523D8531AF4A4B7581601D3168 Troparschiki
684,881,581 *46BDED7D1D07A97BA0735E8C66C869130233E99C Tropeic3
684,881,582 *46B1D0CC8E3EA3A9A79B64D53A2B07A8A6641C2A troperegnens1
684,881,583 *46BD52AE9E36C34B35DF296600D2C5052D6451FB troperisauq
684,881,584 *46BA348F5F4A640E0DD229A90DDC8A4251FF3916 tropfsteinho3
684,881,585 *46B0BA90D52ECC66B61F9DFF6D5C61736659B5BA TROPHALLAXIS9
684,881,586 *46B6194AF1400ACC8C6AE5AE753CC2655E67F41D Tropheehport
684,881,587 *46BFA3C68A66EBFE3049A366E95494771D2F5878 tropho8la$tic
684,881,588 *46B002B92018E6DFA8902602FDF5315379D37EEE Trophozooids
684,881,589 *46B63F4BED09443E9ACE92282C73FDFCCFD097DD trophytools.comwww
684,881,590 *46B81A9358B1E3BDDB5FA915CEDF9F50445160ED Tropiar2
684,881,591 *46BD20F2E99D23319D730D95FF1136ACD5267297 Tropikoy8
684,881,592 *46B999506A7CA29F0330EC6CFB0FF9088E38CB78 tropiscafe
684,881,593 *46BD1249B7C5944CABC689AB591B955448D12005 troppbsw0
684,881,594 *46BA1DC5DDAAF79B617F4B56BC6668836D7289E7 tropsaih1
684,881,595 *46B0239FA4EA103992F956C801A420C8C4E0F6D4 Tropyarg
684,881,596 *46BEE941C3DE3479582E7EED5F252E8756A8C549 TROQUER6
684,881,597 *46B0F4792C6D4EFC189F18607BAA623A90F87776 troquet armand
684,881,598 *46BFB8846E454D81D24EB420A27A309C5D25CEBA trossarna7
684,881,599 *46B4DB43B71B75E768153340912BF292B575EC36 trotardes2
684,881,600 *46BD0E66CFF2E8A497968FC4C1152D4152D0589B Trotaria
684,881,601 *46B4C5697D945D084E939A0C2453FAC38D47C4C0 Trotava8
684,881,602 *46BA7D974CDBD343C9C8CC18B9FF1453C50058D2 trotlové
684,881,603 *46B3D3AB2525FA969A7C2F5478CC1459DD19FB8E trotsaard5
684,881,604 *46B805D5326E3F039CBBA1FA45B88B1999D12280 Trotsige1
684,881,605 *46B0FA2E1388CB5AF6A8BB2BDE7E90093CAD6009 Trotsjib0
684,881,606 *46BEF0D0EFE64F7940902BC130B6C700A90E533B trotskilaisuutta
684,881,607 *46BC6187993754DE33E09FA8EECBCE3F59A24540 trotskyisti
684,881,608 *46BC3A231944E17DDDE9172C2E88F50A3C77326B [email protected]
684,881,609 *46B46933B359E6103944FF61B814CE947AC88B31 trotwoodbetsy
684,881,610 *46B308B4FCEE9BB7B1232CAF75216504C938F7E2 troub1e-m
684,881,611 *46B1D8C147C485A011A7E16C54F1B28D94BC65C0 Troubataise
684,881,612 *46B575CC68DB857C0820A01571D0FBB398C64C64 troubleboy92
684,881,613 *46BAFEE990520C35FB02DD04970518CEA7DC062F troublechestering
684,881,614 *46B2C05E69A48F0AC387FB6344A97EC55F760A9E troublegarnet2
684,881,615 *46B80F81B8849EB0DD1AF8BB95810AFE106A6CC1 troublegoblue2
684,881,616 *46B7D4CD3518E1C708B071BDCBBDF6BFFDCF6AF7 troubleheather4
684,881,617 *46BD987970830CEB29DD789A2E16B9F2FE9FA561 troublekelsey9
684,881,618 *46BA24C9966F32023735C81D249CB6CCEB138E66 troubles2525
684,881,619 *46B36666F06221D60FF20930C192CDAC482257E5 troublesexies
684,881,620 *46B9350B713EFDB901E8D0C7680A98DF6A6DD960 troubleshooter7
684,881,621 *46B13FF5DEF34E72AEA83BDEE98408DB1F3D7F22 troublesnowballed
684,881,622 *46B84E03CDC4B939D48AF4A46AA24D66218992D0 troubletacobell9
684,881,623 *46B4420B91BF7D6A82C031AE71938B23A086BE3F troulec7
684,881,624 *46B3E55092393201155070BFF5C20905FB91A69F [email protected]#trounce
684,881,625 *46B7378C1881F11C7EADB8B431EE7F93B4C7291E troutbrook4
684,881,626 *46BECF620D068771C868410A970A3D40F9F84F02 troutht6
684,881,627 *46B95A014CAE7BC41B875739CC7878C77158CF66 trout leg legg street
684,881,628 *46B54B86845670634C6821CC3A48FBC762CA4A63 trouttbsw8
684,881,629 *46BEDCDFF4D399902BD1978C37835B05E7D06B15 trouwjaponnens3
684,881,630 *46BDC663C6570BEAF41EACB22CCB36EAD1CBE485 Trouwziek3
684,881,631 *46B1E6D1CF04ADD8109365853450F0D6BC07F19B trouxramola
684,881,632 *46B56E52DD5E382C8D63BE8381062C5501AE9463 trovacbsw7
684,881,633 *46BA04770C348788928647ED33534FDFA2229993 Trovarling
684,881,634 *46BA7BDB06374EA7DBA656376E3A5529A2A4A220 troveblon
684,881,635 *46BD67064C2C584ADCA196FC1A34874379A64A67 troveniT
684,881,636 *46B36BE2E174E717D3FEEA34284305AEF8AEA044 TROWEDS
684,881,637 *46BD99DD436DBB0D28EF6DC39F804586568EE52A trowelers0
684,881,638 *46BC80A9C9B9F0526185704F8A4E6E376749EBB2 trowssalg5
684,881,639 *46BC1B79280D028560C47842EAE406A3E2D89765 troy.anfinson
684,881,640 *46BD466E0842FFC8E2438F92622C86764C9EC4A9 troy.arnwine
684,881,641 *46B818ED0FA6E35B2AFAA21A848814E5B870A2CF Troy-based
684,881,642 *46BC62ABBCA8257C3526E8430957A69E5E3CB1F9 troy burbach
684,881,643 *46BAA336A5A4EB5471DDB705B72F595160C5FEEA troycullin
684,881,644 *46BF1ED1E227FD5440C366C55390C63F1F1788E9 TROY-FLAMERPROOF
684,881,645 *46B4AF82F699C7F51961AD3327B603963089F7CB troy.flinner
684,881,646 *46B060730C4E1BC9C4C6FDA9E9A18D4093B94A84 troy.garbe
684,881,647 *46BA54E814647C38DFC634A56A64355737F07770 troy.goedecke
684,881,648 *46B04EF468FD763D9A2CC85024635B156FD5035F troy gogetem miller
684,881,649 *46BBA6E7E9E8B9AE1D7003522F1E0B35AF11C92C troygrundhoffer
684,881,650 *46BE4DC98306450688423868E1CDDF48D35D188E troy guin
684,881,651 *46BC73C002DA61F4C98FCF7E582ECB9B2EFB4F98 troy.hartson
684,881,652 *46BFAD2171617AB50CC4FC025981298686290F30 troy h junier
684,881,653 *46B66247CB50611A82F1E0E1863FB385591C1C6E troyigagamao
684,881,654 *46BC24B45BC7AAD34CA55117FBFAC680FEF94A4E troy.iler
684,881,655 *46B76AF1D86CC850F475D8CB6746CE72472CEBA2 troy.jarred
684,881,656 *46B46A5BC2CCC2E04FE9555AC303F78D480E6834 troy.karasti
684,881,657 *46B54CC8C9CE612CED08395CF9DF8B66BD2B0807 troy.kuznicki
684,881,658 *46B224DF89659C6EB5BB7B04447C56400558DCF4 troy legacy walker
684,881,659 *46BF1AA50FEA68E84159C2E44F7A4D1CC7237E82 troy.levenstein
684,881,660 *46BE92C30CBCB60897F4B8467A6B0532426B84BE troy.manda
684,881,661 *46BD023A97055FE00ACCF8D3C007DCD55F6A362A troy mckell
684,881,662 *46B98190ACA4728FA52D5FA6AF000CC0DFFEA6DB troymill2
684,881,663 *46BBDB12ADDBE8994F95902BB2218274CECAD7A0 troy.nelon
684,881,664 *46B3F15F88AFA7120D72E43CC59305DE0049C6C7 troy.nolin
684,881,665 *46BE05564122A52FDD6EC6503753C8186C4BE1E3 troy pecoraro
684,881,666 *46B0782786DF5AB94D6A785DFA1DFBBEBB1B4129 troy.philpot
684,881,667 *46B2D377CAC05F9EE2B9956A5D21AF20CA9774E8 troy.quillian
684,881,668 *46BCC549538F45A171B23B61DD9703AA9480F0AC troy reany
684,881,669 *46B982D5B380ABC9F83B5B228151DF7B5AF4E3F7 troyregula
684,881,670 *46B224BE7E3814087A2319BAC198F5871EDBEC23 troy.riggles
684,881,671 *46BAD7040380B23E5061DD5501CDFE402ECCAAFC troy.rippee
684,881,672 *46BF0AEB685477264298EC04FE7AE0FA3AC9E30D troy.scholes
684,881,673 *46B2880BF7A00E4E6EEBED9FF97EA87F42F9E12B troy.seeholzer
684,881,674 *46B35172B58A60CC443602ED2756E923251695DF troy.senff
684,881,675 *46B57AABA70888C7D8DD09CDB00CEA0FD2940FCF troy.snipes
684,881,676 *46B7D3E5DB79DCA8D3097A73175ED11D2901BF4A troy.squires
684,881,677 *46B0EB9FBD7D3485991F4493A940CCB8E81099BA troy.stryjewski
684,881,678 *46B871D9AD34918681C794EFE71949BA6D3A4516 troy stu bordley
684,881,679 *46B163AF9130BB973FDCEC780E7145976F800013 troy.sutyak
684,881,680 *46B96BF9A60FE5CE397A87EA425F3E4B6F8F1F03 troy.wallack
684,881,681 *46B3A03C5E7511E19EC5EF4B7BBBC2A1C5AC9B32 troy.weinkauf
684,881,682 *46B72F0F26D6E58C687860209A2A61BF0901149C troyyort7
684,881,683 *46B6529A417C6A1F0440B8E5DAFDE6AA86DA0776 Trpanju8
684,881,684 *46B293E923F12BBFB6D9B667CA83B260B003C7CF tRpb
684,881,685 *46B9A0C3C72ABAC8A1DBB812214FF00C15D30366 trp call to post
684,881,686 *46B1E990C9E3FF44FCF5B2364430E7FC81F41B5B TRPCBRD
684,881,687 *46BAE7F87162B775B76A8874BF8245E896B36339 Trpezom9
684,881,688 *46B80E684737A1ABF06C452336EE3A2D703EB4BF trpidanting
684,881,689 *46B6135C232A805AE61C471D450821A6A31F9C6D trpigner8
684,881,690 *46B9AD12D68AAB3FD509EDEEE5C943D35A3D37CA Tr!pl!cat!0n5
684,881,691 *46BB640F9526718C5FED8A8118C93D79F85B49F4 [email protected]
684,881,692 *46B862C82DD64F4DB15CFA1BFBE7AB0849DAF3A4 TRPOE25
684,881,693 *46BC177172A789CC59124A2BBF6B0E63EC67B3A2 trqep123
684,881,694 *46B91154F291774A2624538120F74BC7B553F87A trrfcrbbr
684,881,695 *46B8662D4A8050AF4913A40653B78758EF931E9A Trrmlnsed
684,881,696 *46B050BA3F6277774165F4A813F807E54A3ADD26 trryslnd
684,881,697 *46B570BAB3C43F553B915B303D3DD98F329663BC TRS3951
684,881,698 *46BD6E178C68B5F6155988DEE716209D62AE76EA trsabswed
684,881,699 *46B47ECB5256E8295799E6013ED7AD3ACB6E5C7C trsclrrm
684,881,700 *46B63C3BCF118B8C0573BC6577D6A5778F562C33 Trskbsw8
684,881,701 *46BD2C8914AE378A5779FAA6736B986B85040B78 [email protected]@re
684,881,702 *46B20275889E09082BB41308DC96C123185C947E trstionic
684,881,703 *46B9F55D1458AB419F38DDB41B3310A7A18204BC trstnjsmn
684,881,704 *46BC69DF2454BA821F8A0CA74C189C7A0782B587 [email protected]
684,881,705 *46BEF1FC60B4BD9ADA8EBB07A47467F8EAAE4730 trthvrty
684,881,706 *46BFD4A3FCB4392DC97689BFA2BEB447F0EE0D3B Trtrshp6
684,881,707 *46B4FA8EF697C23C92BE66F78C9A9F70704993ED trtshnss
684,881,708 *46B84A3D9B00445669975E13572F187B749849B5 TRU55!N9
684,881,709 *46B3594389F39B820AF4DC9626535EB96E83F366 T[email protected]
684,881,710 *46BC1F078B79F17618F0787653EC4743141ADFC3 truantciesing
684,881,711 *46B0AEB8F5DE3596C64C4AF83EE2AFD236763349 trube.bbs
684,881,712 *46BB171A7C0E8713C75076C46C48239289A0A7FD trubetsk7
684,881,713 *46B844815011FE3F546CE7DC9E5D9F5D79021285 trubuk
684,881,714 *46B099EC4017A135FA165B3F3B0EAF0F63100592 truchetbsws
684,881,715 *46B31B7CABF50354261F0594DBCA9D9648C3BD36 truckdaddy2
684,881,716 *46B9FA1E7F3700ECC6C080B4478E0748CAC74FFF truckharrison3
684,881,717 *46BC61AB3A5BB02D31F7DC95E94EF6C59C3F5748 TRUCKLOAD6
684,881,718 *46B46F7AEB190FF6DB496AAE50D4B9C1D6A8788C Trucks1901
684,881,719 *46BBEA1DC86CCA033D5618C3FB3C39EB49764ABB trucksabcdefg6
684,881,720 *46BE58E0E18DE0A3C5BE22894BBE742D48D723F9 truckskramer9
684,881,721 *46BF6B9D3CE4F68AE44ACE8B5BDB8D0569E0DC3F trucksreding
684,881,722 *46B1433CC8FC9669CE1A61ACCCEA7225E4B69F8F trucksskidoo9
684,881,723 *46B119086996902A8EE4458219E3FB5EF49AC163 truckswoody0
684,881,724 *46B3809BC389D01DBBDA3B94E708D6CD9753B903 trucksz9
684,881,725 *46B82B9939523EC849692F160EA9E0F7DA61E6B1 Trucktoms
684,881,726 *46B4C59AF7AC602390C46CE143C9AA3A52796599 truclyduong
684,881,727 *46BB83E94696696D5F2241D31101575AB85C5FF2 TRUCRIP1
684,881,728 *46BF908B27B140FF82291F6FB9388F9770DC7B41 trudeau manalang
684,881,729 *46BABC6571E10AAD9168F882A9691D2EEEC86FBF trudeyn5
684,881,730 *46BB5AF27A29547CE19ADA686B35A299BC06CA59 trudie swain
684,881,731 *46B1B30E6EF19B45E3B23DFA0EB332AC91B0ABAF trudybriem
684,881,732 *46B6AA16D757DD4D740B643C9424EE0443E1DAC5 trudy gloster
684,881,733 *46BCDE2FE06AF6F0FDB25DD3DF406CE5EEF160AE trudymayher
684,881,734 *46B36C097702106E4CFA20F8D5A203082B7838ED trudy mcnair
684,881,735 *46B0A81B0D9F3BE49D311A0D9D1F1E3C770E8A6F trudy tregenza
684,881,736 *46B2CB5126548F8E6EB776D63FF2BA7ABF2537AD TRUEBNER
684,881,737 *46BE96F394273B2FA70BC8345731120D2DFCED6F truebstes6
684,881,738 *46BD157BA7F48BD11A4294070B1DA3A26331D9A6 truehistorically
684,881,739 *46B4773EE0D52543B5F79059AC659E28A7D5B847 trueim
684,881,740 *46B8E5FFC231E896E435D139BB162991CD44762F true label
684,881,741 *46BC6A023B3016FAA504C2976DF7B65609BAF858 Truelie9
684,881,742 *46BB78234D6D7444ED7BB8DC072113D1CC561609 true-light
684,881,743 *46BEB60C246E8293F372D148ACB63AFD0FAEC989 TRUEMANOKA
684,881,744 *46BC5E442D6ED7AA30D3E373EB046DDC731A101A truemantsunade
684,881,745 *46B2E8EC18123897B96B92031741014BE7E57466 true.rivenburg
684,881,746 *46B988D6528EE6B9D9AEBEF1A9615ABF57D2DBBA Truespin5
684,881,747 *46B07C425C6E3169A544B3F4214CB58884C14555 Trufasen2
684,881,748 *46B40BE2230B94C0ECF7590D7E44251436C0FAFF TRUFFIE.
684,881,749 *46B0A68F3108773A5D78197A77919CBCBF218CCE truhanearas6
684,881,750 *46B58DDDB1E934B62E5A8745A1CB6188962FA9E2 truhlarem6
684,881,751 *46B050FD0C9D1F0BAD8E481B2DBCBA01E31094CC TRUKKUTRU
684,881,752 *46B4E8636D965605A68442285C5A8CC01B73EE62 TRULIJIM
684,881,753 *46B2710F8D7567B693A83CF3D3D1B8F62D55FA15 Truly Be
684,881,754 *46BA147168767ED87E24C69230C5C4B1F70F67A7 truly haha
684,881,755 *46B7B7AC02A7479D73BFEF3467455C017A303395 truly happen
684,881,756 *46BE09C9D5CD5856E327B66C9E0E4BDE54AB5677 Truly Loved
684,881,757 *46BF5B5294E6BAD006D6759C7D592551A7FE4D50 truman.barns
684,881,758 *46B73259C91CC799C1801BF3C2D3D0958F97A615 truman.bohrer
684,881,759 *46B87E04D99FC56E0F0F1DB5B318F6D605F14105 truman.brong
684,881,760 *46B688A334B8202199CFCB9A57AC14F846BF60DF truman.bulat
684,881,761 *46BDE9BCC6FFBAF140DCFB65F4F065696EE7DB70 truman.claman
684,881,762 *46B05C5A7F408A25D225A7085B8BA15AE3DA80C5 truman.daughdrill
684,881,763 *46B0014A346B34A0AA00CF2758563DC8C0085942 truman.duelm
684,881,764 *46B35D88DEED5B6C92245A8CAAB37CB7A5D07BD3 truman.gist
684,881,765 *46B7FA2501B9625D25C1267E6E5AFE2EE816F40A truman granberry
684,881,766 *46B5863CCAB809D8C9E8910389380A78B20BB78D truman.hittson
684,881,767 *46B8A1C82A635970ED50F6D8906CF9941E527C68 truman.hottinger
684,881,768 *46BF61A7F4FEDB82A43DEC1A64015B4688306853 truman.jagla
684,881,769 *46BE40C4DC059A74051C241EF65A7EF62A1BD1E9 truman.laurimore
684,881,770 *46BD14F4E17AE24E9D570217E1720AA481A3077A truman.lorimor
684,881,771 *46B8BB8CE03D72376E76D419A6CF1770F1E4B506 truman.manuel
684,881,772 *46BE17F3968E8D9A4C11AEF03FC1D81590963F7D truman.moseman
684,881,773 *46B600BF0FE208BB6A8C3C9A952EB73AD7CBBFA8 truman.otterbine
684,881,774 *46B326FBFB533D6261415D830FBC168DCFB19B27 truman.pacana
684,881,775 *46BDB4855C12F5D256095EEB513A7AB06B696DB9 truman savery
684,881,776 *46B0A8C6071E78850C637B056DAEEE9F615BBA9D truman.serens
684,881,777 *46B24C9D9750A88DCB323B7DB08DF1F5026F9338 truman.towell
684,881,778 *46BE7C7D11C72B42604CF18E6F461A3C596FCC58 truman.washpun
684,881,779 *46B09BA7C88838A9B8CD96F2C5408AF576632C0A truman.weilbacher
684,881,780 *46B8171BEE7ABCCE7BD0596FB57DA26BA18F0B4C trumeika9
684,881,781 *46B644BF1EEDC0BE0DDC129EBA940ECF3A804435 trumhinna1
684,881,782 *46BBF24453A0D2A27F228E9FE1E60BBD3DA955DE trumiaming
684,881,783 *46B62D2DCBF9C0E6A397979FF2C5A454D08AEA30 trumpapir
684,881,784 *46B8D7744EB72DEEDF7C01F658B159E7879C9AC5 trumpetbrandon3
684,881,785 *46B2460F74328027D5378E32B6901549DD7D5DF3 trumpetdeadhead2
684,881,786 *46B765539A557C5632D82AFB70CC2EE067EA7BD4 TRUMPETFISHES?
684,881,787 *46B99027AF2978CCDAF4A558C3DE235A2E246B7D trumpetgretchen5
684,881,788 *46B6A909F8ABDE1ACFD8CDDE9C2C4B0D216BB47E trumpethelpme5
684,881,789 *46B00CE5E418A14ECAF76D49B7AFFC5E3BD965B5 trumpetistas
684,881,790 *46B1697EEC446C6A92B6F95330039473A816BD30 trumpetlover.bbs
684,881,791 *46B9EF8E8FDF9A5B39A06F10C7388DD72AFA83FC trumpettweety4
684,881,792 *46BCACF53CE30F8CCA6CD14D72947540F1EFE7C2 trumpetyomama4
684,881,793 *46B7A326EFE051A2C2844400150472F8BEB8E2F6 trumppeds
684,881,794 *46B5AF61C80C69F2C0D4D40983564EE26373B821 trumpplace
684,881,795 *46B8CE0A8DB1D5F9F899ED8DB295EB1BC91484E7 trumpup3
684,881,796 *46B9B276F8382EE12C4F95D98DED6292C7DA3BF2 trumpupacharge4
684,881,797 *46B5FBCDFE9CA814EA5C724B34F5DAE97BFBA2E9 trunkenden
684,881,798 *46B20A289D876D219A3148193A17B26397916A8B trunkfull
684,881,799 *46B4530E27E6D9DD29B4D3C0F6B3E0CEBE8B473E TRUNKMAKER5
684,881,800 *46B1B7C23A30CE139EC605C22D6053F7A54BE212 trunkssanya
684,881,801 *46BD6DE8CEC8CB1F2F64C3CC6501262F9DC8CCAB trunkzij9
684,881,802 *46BBF9E5E2A747601B6216285EF23A9F80BC90A9 truong thach lam
684,881,803 *46B03787F2D82CB1BCD3B91EB5973152AC07A385 trupëzohet
684,881,804 *46B0AC39FAEBCDC5168D6DCF609BA78333795A4D truppenaufenthalts
684,881,805 *46B3713D3BA6F167236907EC438567A5BC441362 truppingsed
684,881,806 *46B46537668EF2ACB7D486F339789AF4815676E7 Truquetruque
684,881,807 *46B6B34DDA7B2ABFF5055C604A4ADB164D9210EE TRUR
684,881,808 *46B913014341611A2464695AC06D0787E6CE1B2E trushar8
684,881,809 *46BE064F1E29628FC8E6DB1F556CE7B61EBF7BD4 truspiel
684,881,810 *46B71665A0D25E8278F05C3349650133C20F36D5 trusquare5
684,881,811 *46B0FC4541FCA7EC224133397763A820ED0EEA2D Trusserederne
684,881,812 *46BD232F203BB5B569B477881FBB11C23ECE24A5 TRUSSINGS3
684,881,813 *46B09AB0D88FEFCEFE90610ECF528A5F95D73731 trust.160note
684,881,814 *46BF9BBB2C29270024EB998854DADEB12AC905CA trustabilityn4
684,881,815 *46BB5086AE735FC7F374112EF0C17BDAED64D98C trustais!
684,881,816 *46BFC69266846C04E10B9F5B1CB721D4C777FF9B Trust
684,881,817 *46B464B4BB3837C9435E1C249CAF0590334E9DB4 trusteea
684,881,818 *46BEFCFBB35964ED09202865B4A99305BA94A961 trusteesadvisory
684,881,819 *46BAF1C6934C44BC719498A4DDB0DB2ED4096C2A Trustek5
684,881,820 *46BEE7FA74591B3556855C31F1A8B4ED4CF16E29 trustgives
684,881,821 *46BF32B7CC7889F4CBE6550E92CF11823AA9A37F trustinvestming
684,881,822 *46B62301203822F244FD53C9D139FC640B826912 tru$t agr
684,881,823 *46B72E6F2D88FE0BD178DB318D48FB0CC2E9D047 truther911
684,881,824 *46B6C356C4E576C6785FF81AB2230B59517879EC truthify9
684,881,825 *46BAB65A7E396215C2AEFF14E029472B74D736EC truthless1234
684,881,826 *46B5757921D8DAE8EB9749C179524B4D53EE87B8 truthlovingness1
684,881,827 *46B09ACC65F17B588782CE35D99604287CAF2557 truth—no
684,881,828 *46B3B348B4E508B5B3D4D6BF7D4E6FE2BCA9A196 truvääriluule
684,881,829 *46B32D9650600EC19DB0B5AE1232CC4BF91F91E9 Truvie
684,881,830 *46BB1A097366EB7EA3C6305D1AC9DB85E84B11D8 [email protected]
684,881,831 *46B9CD08AE01D0E57814D0FFD932BE5DDCBC7F3F trvetrilleR
684,881,832 *46B8A4786C8756665AB37152754F4814385C3631 trvlmn2002margarita1
684,881,833 *46B13625C09232D75B85AD6D223515241AE8526E trvydstn
684,881,834 *46B9ABD35F18EEB145A131111AFCFF2F085E8AC8 trwlnt
684,881,835 *46B87B262C1D23B04649976AC6C8A0EC069773F2 t,RY
684,881,836 *46B43EB311F6643BDA01F5D87B3FEC72C245CE6D tryakshaamed
684,881,837 *46B15DEFB3D370B16407AC6168DAA55C975C03D4 trychorderbsw7
684,881,838 *46B4496202F3C34187187B1B182BC62D42C76703 Trycktes3
684,881,839 *46BA9FC2B9F1FCEA17D6757A55C8FA8791613FB6 tryeiloba
684,881,840 *46B9D36072B5CEC5483F263998C1B9E0B330C839 Tryflezed
684,881,841 *46B8F028BB70F0825A0CB8BE859FEF50736E9A57 tryfonidises
684,881,842 *46B2F36303B1D28A7C3DF5D71E2D931FFCABB377 trygghetensed
684,881,843 *46B5311C23526B7E674C62E1D8342117B822255A trygonicall8
684,881,844 *46BAD26E11315CF41FCF59667B8006553C5968CB tryhumphoslying
684,881,845 *46BA79CA0CE3958E0900680B982B615A7D707CD7 trykluftsbeholderne2
684,881,846 *46B1ADC17595BAB204804E6A73BAEC2FE69FB880 trylkoval2
684,881,847 *46B2D66CC3B3BFC7706D3EA52849C0113CB5D78B Trylleri9
684,881,848 *46B119BB14FD803E7A846A318FB0CA4EC5EAFBA2 TRYMICA
684,881,849 *46B7A2DDB2937FA39E2C7F6E395C185B5D07F588 tryneylling
684,881,850 *46B806C26B7BACBCB03502326E0FA2D58B878DB0 trypetas5
684,881,851 *46BBEF09C9FB5C5C4457761B31EFA905A1E707B4 tryppyrt2
684,881,852 *46BFB91479049606144719AD9F08819C3E351923 Tryptamiineja
684,881,853 *46BB0FC1C7F24FF96A0850DD1D47B5216E415FE0 tryscered
684,881,854 *46B93C223EA223C2226EE80AD238EE9F9A3DC103 TrystanAngel
684,881,855 *46BEFB4B7F4C4033EC2456796693A5BF8CF7D8F5 try、スカイポートtvでの放送終了。ケーブルテレビ向けの番組配信は継続。
684,881,856 *46BBEA571361826E41FAD04247E47C0B91A3495E try-z(strongholdtunnel)
684,881,857 *46B107173AFE83F26BEF375C0CBBC2F6C1A6DC79 tʃɪrz
684,881,858 *46BC552F9F010E6253DAE01AA8D19B19026CD37B Trzebiezmiasto
684,881,859 *46BA0465BF42978F77454945D1CABC31F794FF96 trznfrrr
684,881,860 *46B018A0DC9A100B1ED9381798BE9189FFB9F025 trzymala1
684,881,861 *46B4F23EB24EFDD669A7229916D6FE1C2292798C ts5Q
684,881,862 *46B5911EF62FDE673E68AFAEF7236CCCF1D3488C tsaanfas
684,881,863 *46B834E1D2712C76F5B5152FF96233E6CC597C16 tsagiltneffo
684,881,864 *46B6CD1CCE6572D8CB1AFE1CE98DDCF0936E742D tsagspeerlav0
684,881,865 *46BDA80FD318270D6A0ECA3582019A7BEAFC48C4 tsahuaca4
684,881,866 *46B306EB0DE304A2B1D9B181FFB69CD370F26849 tsaianbobb
684,881,867 *46BABCF85F12FE87508C61500994CE0C7A02DFAA tsaimaye
684,881,868 *46B4117C313039A09027FC1116A1A4A40C6F294A tsa investigation: moist and dangerous
684,881,869 *46B3CFA27F43A762C3F97102C89EF18C5CE3C73E tsalfpeg8
684,881,870 *46BE3D7771C09466F123A511793F6C6E609DF9CC ts-all
684,881,871 *46B6F72B46B882204CC042365F31AC41670C827E tsaltaaerfing
684,881,872 *46B4A76F9C3897F2D0C808C285FFF24020F9F291 TSAM45
684,881,873 *46BCC85E7FFC063CD974BBF0EC8B62999E14B7A3 tsamsniz9
684,881,874 *46B8CD195EBFE1B073D6C269266A65D1303F8F5F Tsangaris2
684,881,875 *46B0DA9B5FB2438E0673EAEE743F038B9C386105 [email protected]
684,881,876 *46B2D446DDF98F7C975801BD686D5DF0FF1B3AC8 Tsaoysh2
684,881,877 *46BF6A9287DA34FC615B39CD7F4F8725C32679AF tsarevitch5
684,881,878 *46B090DAA9C0DC83ECA5B08D122243D1B961ED67 Tsatsalmas
684,881,879 *46B267BC9EA7B0479A33054D53F9E7B45AE92F60 tsaurasya1
684,881,880 *46BD0728DC0ECDD8D830AB4ADFC1294D67DEAF8C Tscanlon
684,881,881 *46B384F61F63D9E81E40001F6952A1213C344446 tsch3rmak1t3
684,881,882 *46B4B287FB41ACD5C95F7B1B00EB072C78D93489 tschaikovskypunk
684,881,883 *46B0F4A88B11F0A0BB1DE30C005D76E6D7324E48 [email protected]
684,881,884 *46B01FB7D48B00CBA83414ED2F982DA229CDA1E9 Tschecdia
684,881,885 *46B2B8F8AA4720653CE783DB9ED9180C6F5B0988 tschinschotscho
684,881,886 *46B523E4F0FA2583374C2AF92339C78DBA16848B tschubbys
684,881,887 *46B1F845ACC60AD68A3BFD0DA9DC00DED1BFD494 tschudde1
684,881,888 *46B26BEE0EB4AAEE579106EFE72B1A6BACA3C3EB tschwarz5
684,881,889 *46BCDFF6FE7777232DD4963C8ABFF1959D1A9B6E tsdnekremnek3
684,881,890 *46BBA504D44E590039B4810A459F4665029123D3 Tsdnolbnerok
684,881,891 *46B0B0748C5F8357F5ECAD90622F0D036FE2D7AE tsdoremon
684,881,892 *46B57B2268E67A72885766304D8E51D02C070041 tsdreeredeomeg8
684,881,893 *46BAB531A02F30111D360366B94449837D906795 t→s→d→t의
684,881,894 *46B35CA113CCE1EE17097DBD7C5B47775ADEE364 tsebelda
684,881,895 *46BA6A5184007BCFB99F3FD3CBEE3EB6D3676B4E tse chi fai
684,881,896 *46B3BACD92E94D30CA3BC49EFCFDAD433D4F072E tsedenya5
684,881,897 *46BF6E09FCECE40DF8BBFA46F00EC5EBD6F303D3 tseefloohcs4
684,881,898 *46BB0EC9BDF7D26D63FA2DE82B3DA51A1C1BDAD1 Tseeltiu4
684,881,899 *46BAFCBFF0291E7ADA9804D83D14BA0B3555EBFC tsefsrok1
684,881,900 *46BA5CA36D9B602647A100D257BE765FE4225FE4 TSEGAZAB
684,881,901 *46B9895245275B7F63661404A82E88F506E89675 tsehanson.tripod.comtsehanson
684,881,902 *46BBF91638ABEF5969AEBE4EED06F0531269AE79 Tseignurg
684,881,903 *46BE3556B315507B21DED3556A0BB828F4F5B78E tseihctied
684,881,904 *46B2823FF925BC02EEE0F6D9958EEAE96CF77758 tseilesniT
684,881,905 *46BC502EE6B388742DBCD745E1598334924FE33F Tseiliosing
684,881,906 *46B49908D2E539B4A1A461773743E3E1D270BF92 tseiltseirp2
684,881,907 *46B97F084E92BC0D1FB7934C8BF28427ABF89DD7 tseimils3
684,881,908 *46B2093304A52502631E4F1D37858254F1A7E08F Tseimoh2
684,881,909 *46B6475F4BE6B8978C77CBCFA2CA202B4E5F9B8F tseippals
684,881,910 *46B9A2CA8840652CA63CA7EF65A3DF08F03DAF95 tseirpss2
684,881,911 *46B9B20D2D9B61EDF25EA11FCB2DCCACD26A8FDC tseison9
684,881,912 *46B4FE76D5E100B2E670FEAB80CF923FA1DB1933 [email protected]
684,881,913 *46BB9027A51AF5B7DA7ADFF552699E5AC3988564 tseliehts
684,881,914 *46BA641B96F53F0B20E210654CE657256471650D tsel-Leichen
684,881,915 *46B69837898AC1EF122091A131DF8CB68D356D4C tšempionide
684,881,916 *46BFC89E125ADBA55BB6FEF375DFC9A3B8F3CB84 tsengelkhishigsuren
684,881,917 *46B26E222282E098D9476702A09A5F5829245DBC tsenooses
684,881,918 *46BD8ADA65140A8D7A57EF249FFDA9D357AD4A99 tsenparting
684,881,919 *46B1D24C34E420F03711CC83F35EF989E0D81DBF tsentralnyi
684,881,920 *46B3AC8FBE3CBDEC86DA0AF696432C52088099C2 tseoregn1
684,881,921 *46B3006A8EDF446966C3DF7FCBD31B6F03060920 tseorpegging
684,881,922 *46BC78E7A1436FD47EDC25C7361C5254A9434468 tsepo ntone
684,881,923 *46B4FE5E27F19E6C870391510623E127479A24DF tseraenywsB
684,881,924 *46B6237BDBA43E7B146B8D0A9E95706688F037D6 tseragnev
684,881,925 *46B4ECCFFA47E299A86BABA18B0B598A713C7EBD tserernpiliyn4
684,881,926 *46B4157E85655643613E5EB19BE10DAE4A82548F tsetbyellov
684,881,927 *46BF8B1F95398700A17F6D05E47E3BB86BBF62B6 Tsetcejda
684,881,928 *46BEA6A5E3ABEF2CEDCCC9ADAC37F959694D3965 tsetlego4
684,881,929 *46B27F1D626A441EF77ED3ECE0D06A6688F6F270 Tsetllah
684,881,930 *46B09707E48A5DC8C7C4446874B1F180F55F2455 tsetmrawed
684,881,931 *46B265DC4718EA3B850CCF7865664FF1CC92ED19 tsetoediv
684,881,932 *46BCB52A2A8E3DABD75239184366A53FD246A129 tsetreicing
684,881,933 *46B9BD1454191E136F8B48A4C49FDA96C8495AD5 tsetrepped
684,881,934 *46B4B9376260BE108252115892FC80441B296C86 tšetšeeneille
684,881,935 *46BFA9C5F45E963B8D72A59945B2CD47609AB071 Tseugfdsa
684,881,936 *46B9D661BFD4BCF576AD672A2042C624DCDA10ED tseuqerscil
684,881,937 *46B2AAE2BCA9B1D895F27A4F69B2BE5EDD840CE2 tsevalaa9
684,881,938 *46BE9FD42B9530FD0AB2C2E1663AD4D6DBAC6942 tsevdnorg6
684,881,939 *46BB5C112A186A654019A568E25E2A74C101EF99 tsevecirs
684,881,940 *46BABBF62182C6A6F877979D635D0F3F85D5253A Tseví
684,881,941 *46B6AEC49870FF9B6BE4D1661DA278500323C90D tseweam2
684,881,942 *46BCD1A2E225F1E427461FAF335F8C5B1D94A180 TSF006
684,881,943 *46B6E480FC83B30518B487FDD66EDAD863813B20 tsgillezes
684,881,944 *46BB439BB0B1EF4DFF0E27E0F92864B4A0D4E338 tsgirahseorking
684,881,945 *46B8D8D713746E35682C8118EB9DBD9A4B42E75D TSGIREZEIM
684,881,946 *46BA78002FD49D339012ECBF7337C63FBE405E0C Tsgiruelkeiffok
684,881,947 *46B0CB4691CA3E28A888376A1284D6CA1638AE8F Tsgiruez
684,881,948 *46BC39B105F7C4A7CE8BAFBF30E2CD47EE77F8F0 Tsgitatses
684,881,949 *46BEC77AADE245FCF196DB05C6B88518077EBB76 tsgithcadiurked
684,881,950 *46BA76F2CCC733FE25A0F4824520B40166B34A77 TSGITHCAPALK
684,881,951 *46B92250731C41699C634ADAD873444DF07EECE8 tsgithcaporks
684,881,952 *46BE7D17423251F3F46FBCBFE7A138EEA229D29D tsgitrahthcil0
684,881,953 *46B79429DD539E728C86F87F28666698AC7C1ED6 tsgitruh2
684,881,954 *46B2FD5AE67BEA1367EBA96DE9CB1A46F2150A13 Tsglnmrc
684,881,955 *46B66ADE50A1A3516604E70B3CB262F52F753925 tsgrenzening
684,881,956 *46B68FD911DF33FDD63EB14CCB609A0956CFC16E tshegofatso cleo mokgothu
684,881,957 *46B22D5F0DE1DE8408269AB4248454CD71BE4198 tshepiso tsholofelo more
684,881,958 *46B01BA493F1455EE0BE9BE3A0E5422FB89E2CBF tshepokomane
684,881,959 *46B8F8091C5A8C070BC2C078E6101BE65D85DCCE tshepo mvara
684,881,960 *46B84C27C700D57B371705A26ED668E3A784FD64 tshewang4
684,881,961 *46B767C41E3F9E1EDD863CA575B5E8434A518D79 tshewng norbu
684,881,962 *46B713D064CE1F1FEB50B4C63729A94908177C89 tshibain tshibanda
684,881,963 *46B0DA443341A546FE3A8D6710EA8F3622D72873 tshidisotha
684,881,964 *46B65A540E54DA0564CA0851A258F20340CA9832 tshogs1234
684,881,965 *46BD029CFC5E5545239627B14CC3F10F6A7330F2 tsiatsuekiosialasnak
684,881,966 *46BFFB1D1458ADF528FBE2D066DB831FADDF7BAF Tsidkiyahu
684,881,967 *46B612E46E7AD65E67D1DCE92FCEAB41D62BDE94 tsielroved
684,881,968 *46BFD44E68D252A395F74679A32663B25B0B0737 tsierklsed
684,881,969 *46B179DA9005F9EA5A1C9698D62E958BC31E2388 tsiestis
684,881,970 *46BA6FB12DC54AF6273380D248F5EEBB4BCC026E tsigahpomosp6
684,881,971 *46BA8CAA7898371B20E67EF7E459114299A5183A tsiganhsat5
684,881,972 *46BFE2DE17276F1790D16C5E63654EBDD7E3E136 tsigoloelet5
684,881,973 *46BD712FBE86131479B0437881520E3FC9631B6D tsigoloixas
684,881,974 *46B07169E8B956299CF0DA1CDF580D3E79D685AD tsigolotaretotyhp4
684,881,975 *46B2A7DEE6E2D5F80A4734DB14A33CBB6A676776 tsIH
684,881,976 *46BB090373F84F5B7891337AF20D701DDC35D567 tsií
684,881,977 *46B8F2F8C29E42F3A9F8E52B20773DFE29E2A71F tsikatafrancis
684,881,978 *46B491CD0046C83EC03C9D4893A11B16939CC6B1 tsikednutrading
684,881,979 *46B56EA2171038EB23C758657C5828024DE274A4 tsikknej2
684,881,980 *46B213A2909CE71C11E29CB2C7B0C7ED2D7E3CF8 tsilacit9
684,881,981 *46B3221280D97D0A215DA15ABAD7152923BEC3A7 tsilkcehbsw7
684,881,982 *46B7A9211200ABF7F75E863540248C94D6A44FA1 tsillipying
684,881,983 *46B3F9201FC6EB521DE4863127E9B55712A0FDF3 tsillybis0
684,881,984 *46B4AD8D567AD17B46038B3EA0FF13BC929CC95E Tsilnbil
684,881,985 *46B4DCDB76DCDA31F21263386CD57F37695E6B7D tsiloicsnap4
684,881,986 *46B776740C1DE2EBD3B9FA69381525A27E2D5B4A Tsimmir4
684,881,987 *46B44CC34D21E823F03C9F16E917C1E4DC7F577B tsimrofnocrepused
684,881,988 *46B52583777981A148A6775C06F09F6B1ECCF6A3 Tsinidib
684,881,989 *46B8374BE04DBB3B65DF446E3CCD6BBD6BADBE8A tsinoissimsnart
684,881,990 *46BE12BF8FAE5B00FFF7A8C490FD5A892EFBA530 tsipora simmons smith
684,881,991 *46B5BBD51DD5843A7A180AE93182B4DD782E19D9 tsipsiol8
684,881,992 *46B27B669B8D14196FEFAF78FA3A48D170330A8F tsiranobracing
684,881,993 *46B407F111D3164B521423967E3082923A8DC5B8 tsirhcamdnarg
684,881,994 *46B0865B4CDC72687C02E83B4DBD71891575EF5C Tsirhcnod
684,881,995 *46B0AA2449B8BBCF2246867102FF21DD14FB38B9 tsiriipo0
684,881,996 *46BE7A4872BC8C4BC20A44B939D502D5D16A92BC tsiryrakoto
684,881,997 *46BADACE90E7976F24A75DF82FB1C3A92C55AEF4 tsisgnik1
684,881,998 *46B340B83B31595EF94FB136390929FA4507E276 tsiskytsejrjsyekrt
684,881,999 *46B70D17F2260D446B56DB10380F203F7CA159BF tsisnesing
684,882,000 *46BDAFE954998B4F8D0C6BDD874D50B0D5183B61 tsitracisum
684,882,001 *46B858E028C3770C94EC6A0B603FE820F9B24635 Tsitsri6
684,882,002 *46B125BADE0F09E5BA58FE1347DD171096A50121 tsiurgnocs
684,882,003 *46B8BC442E60E76AF28BDE351603FBBDA9B92957 Tsiviilkoostööd
684,882,004 *46BCFBABD36553F9F1BD55A4B960CA43249C0ED1 tsivttering
684,882,005 *46B2AD60593EAAF3239210B823450283E9DEA1A9 Tsjazj
684,882,006 *46B3C0780DDFCA3B70B343B0BAB824FE8943EBA9 tsjihpo5
684,882,007 *46BFC04BCE4FD5F39BAB2981D1B322DDA6452675 Tsjivnaa8
684,882,008 *46B904E59AAFEC109D0281C47D7C307DBB91E198 tskcon roy
684,882,009 *46B7033929D63C0EBA9C685388AE9BB693E26A0C Tsketedlik
684,882,010 *46B5C15FDF8434E09892117A3EF194B498CAFAE8 tskjilethcitsning
684,882,011 *46B74E6E9264156600AE714AC9AFF5AC8DF8B162 tskwaylaxwmx
684,882,012 *46B4707A240F54BA2E4B9326694097C2E15FC737 tskwbndn
684,882,013 *46BFD3FAC8D245CBE8B8391573B4DECB2D18BABC tskzkhxumfvlB
684,882,014 *46B573C8FA8986610C0338B05F950690B11DC574 tsl051377
684,882,015 *46BB11AE0A968CBECC2CB708ABB0EFBA03D116D8 tsl53219
684,882,016 *46BCB0196D5543317C8A4F251CA398D09012BBB4 tslaufen7
684,882,017 *46BCD343883159C2FFF906BBA3C9278790EB24A4 tslbmrps
684,882,018 *46B047B343A0AB5F98210A0EA0620DA329EE2C93 [email protected]
684,882,019 *46BE3BD73CB663E6EB9C209FBE2D507F8B9E8658 tsleknaw3
684,882,020 *46BC6A01CEBFE17B7321FFCB860E921D5B870283 [email protected]
684,882,021 *46B9B684B34BCD60847758481ABDC4DE35DA6F83 [email protected]
684,882,022 *46B78AA8C5F539AF498F6FFB4E4FC7E4FC431225 [email protected]
684,882,023 *46B26B8587F3EA2B52292B660AD632B11DFD11D5 [email protected]
684,882,024 *46BC903528CB7FCB40F07913FFD1E52356DA3CDF tsmaazdgued0
684,882,025 *46BCFBB4B6D857E2C46F058F75CF979FE5092F8E tsmllisyytt1
684,882,026 *46B7770E3597AA42C79DD2F750B51F8AC9E3C375 tsmottob8
684,882,027 *46B8FA4E64C22EF9E676C98C6917B0B2F31956AF Tsmrone0
684,882,028 *46B45853BB8FC020C2C37ECEDF38C3196FCEEAC2 [email protected]
684,882,029 *46BC7B8FC6708003165CC9A1E6C6CDBB692DAB4E tsneioof0
684,882,030 *46B7A19E465A50B61290286B5DD095B0D769389D tsnidnez9
684,882,031 *46B322B88C8D2499FDE39EE82808FAA249E87688 tsnnsottoulsutuluk
684,882,032 *46BF8B1FEA77D55E96C7D346F5188F1D13C1D02C tsnokuen7
684,882,033 *46B2C3CA529213CB93EA4EDAD9F326B685066A74 Tsntrtlcc
684,882,034 *46B703965637D7C0C4D52845814A0E3C5DF4A7D6 tsnum
684,882,035 *46B428C048AACCF59257886394CA6CAEFBD13790 tsoeleting
684,882,036 *46B9A07F80178BC5085E645264AEAAC3D4191A5A tsoeumokaloba
684,882,037 *46BA43EB13E2F2E78B11F4DF2A425F7ADF8EF652 tsolakharutyunyan
684,882,038 *46B81551013F499FDC59D223C9E164941B15FB92 tsola omare
684,882,039 *46BFD0DC014751F263BDBBC32D9A78A55F17EFAB Tsoliehc
684,882,040 *46B1FCCECCFF97E571C9EFF0FD5FDF3C64948253 Tsolkyvz
684,882,041 *46B370B0139F955ACCB40F681E04F9901CB69552 tsolomatsaba
684,882,042 *46B823CC82C65A92ED64BB9878E94942394D7C11 tsomthgi6
684,882,043 *46BF583C3DE813229A993E3D90F3AF3668E2494E Tsomtsae8
684,882,044 *46BCB910EA06282C623C5914F3F28405D1E11851 TSONAM
684,882,045 *46B2311CA3C8E5478D07BD93697B2FFFB1D864C4 tsonnelb1
684,882,046 *46B27F6B56B725CE3EC06FC55A521AEC17C9657E tsontkaten
684,882,047 *46BABF839B472487286B9E2FE5080D23D5250998 tsoolnoz3
684,882,048 *46B523F9893686408995A2B06C209D2184F14AFF tsoorsel6
684,882,049 *46B216BB85B8E34B179821C418FCCAC90228BB48 tsortedlongintlist1
684,882,050 *46BEA52EAC24F884F929847121B6143182A72BC2 tsoysalcedo
684,882,051 *46BEE985AC04007BA1D81B64B27CE109ED638E78 tsoytcided
684,882,052 *46BECB9B87128EF3CC4D25A13305D4552546AAB2 [email protected]
684,882,053 *46BB9284C81B3CD925FE6BEC3941EE786584B1C9 tSQ6XXoRW8C
684,882,054 *46B215DC194CAE1972F92A396C6AFC4C27DBE4B2 TSR2506
684,882,055 *46B1525D07216CE345AEED600CC97AFA25642AC1 tsraablekkirp3
684,882,056 *46BAFB498C1FE6DD0652C91245C55790F6160DEE tsreihcsilk
684,882,057 *46B4CE0F3142756C3421C8979E45C2B31CD78B38 Tsrekcag
684,882,058 *46B36A6334C67A5289EA94B9282C1916D1B8DE6B tSrLIIo80
684,882,059 *46BABDA9C7292741750396871DE43EA1B9AF5AD2 tsrohregs
684,882,060 *46BA299B87D66255F34144D16CFEE515845BD9DA tsroknaaed
684,882,061 *46BBE6CCC016C905B98229C80B477A797A34325F Tsrovgooh
684,882,062 *46BA4C22ED8391EE18B43C2E68779419F9C7D5C2 tsrovreh5
684,882,063 *46B730B3283BF6E8DBCD290DCD67E9C6F3B2BBEB tsruth
684,882,064 *46BF2ADC89B5F3904DDB06BE8D6A53733B1F0073 [email protected]
684,882,065 *46B9CACBC35E8CEAAE0827AE4474D29A00CA7CC0 tssekaso0
684,882,066 *46BCF05640E54F1279C7A34CFA1DAA28AA76EBDD tsshcier7
684,882,067 *46B0A3D3AC98685AA5DEEA0561C068E791DCB765 tst123bdby
684,882,068 *46B50F7945AC2105D6245B0EF14B06F8FE06A293 [email protected]
684,882,069 *46B51BC81AD9B7BD3C6921792E76F5BD79732172 tstdythnk
684,882,070 *46B5BEE882011BD7BAE4D24470394DEA7E443FA6 tstenalpping
684,882,071 *46B76265C91717D521D97D3C34B43652006F5074 Tstfyng7
684,882,072 *46B16E8C92F2354BD2C04FC4F382006075239166 Tsthcels6
684,882,073 *46B7CE1706CD058DAB8514F2908A126DE0DAC95C Tstmmngned
684,882,074 *46B8F95290A8D49EF0454EB2705BB11C2276DEAC Tstmssng2
684,882,075 *46B09B03D179D9C8CD4B5E5609AFF36C28A2355B tstpsuti9
684,882,076 *46BFC95592607ECDCC4AB7576E6D634E5EDFAEDC tstrijdt5
684,882,077 *46B0909DAB1C877D3A5A0DD3E5261492CA361B16 tstrppd8
684,882,078 *46BC28A88B0CAB38E17725BB847AD7DF4F9BE551 tstrrg
684,882,079 *46BCE0AC4B0727D59BBE4BD6C8A7E7E787A41BDD tstsiree1
684,882,080 *46BC638DFAB152ECD7F84A4E4E27FF60C3561A77 tsttngsvrhdng
684,882,081 *46B7423C0312815D01CBF46B523CC9F569BAD36E Tstunno6
684,882,082 *46BB3AA88AB2F1CE89B20570FF1C4B8ED55CC8E9 tsueiretsym5
684,882,083 *46B539C9732320E4D0CD937801C778A9DFF2A494 tsuenlap
684,882,084 *46BF33BED8A82D9C6CEBCEB4DDC4341889B6AA06 tsuffid2
684,882,085 *46BAED1F6211CCC4F2AC64C6158AD5D218B10DEA tsugutoinobe
684,882,086 *46B3BD452FB57104D44CC870EC1163194B44EA29 Tsukagut9
684,882,087 *46B0D53B0C048AE783509719B6DB9584E97E3789 tsukasakajihara
684,882,088 *46B7850D33BEDD295298F6456BE5BC68B7E4C79F TSUKIDA-EKI
684,882,089 *46B1EF0EF1043AB1BEC4134965276912415A4CA1 Tsukigir5
684,882,090 *46B68B47B100BBDA3D79BB32B7ABD4BD52B3758F tsukuduked
684,882,091 *46B58999ADA23C0B15C4D7A9A42EE5C838D8ABBF tsukurizing
684,882,092 *46B5BC61D93B6B6F1854C875F76A81093BF2AA37 Tsunagit7
684,882,093 *46B73A6FC2A623F3EFB0011B004568CE3A6A352D tsunapeing
684,882,094 *46BF1622D52D7D44B434A7C0D4149B9F1F41DE96 tsunayushisawada
684,882,095 *46B0E5837563F659535B22718E2681CFCB0740E4 tsuninez0
684,882,096 *46B84CB3659975F4118FFFAF5C21BAFC0C5A5D52 tsunnust1
684,882,097 *46BE592848847A9D8CA7FE4A146B40FAF3E43565 Tsunokamizaka
684,882,098 *46B848C11631B12FCFD711AC4832ED5AEF2A2F44 tsurhtem0
684,882,099 *46B6F79CF998FF8F8B34A0BB73BF9E816D4522C8 tsurtpctdsg
684,882,100 *46B092BEAE95E0C4B81DCB84D0DA06EA16C56AF0 tsuruga ren
684,882,101 *46B5D04D0821C7011D7D1DBC5ED186F5B117274A tsushinkibswing
684,882,102 *46BC23E36DEB70687E55A4BD4A7D4BFE760811B5 tsutsum9
684,882,103 *46B1AB433BB05E622CD183D7FB04868B70E997D0 TSUVANY
684,882,104 *46B55C10C7461AE053138555E908519C47E51095 tsuyu (the japanese rain season)
684,882,105 *46B84CEEFAAEB4D3F1A36246DF5D54A2BB3B1EEC Tsuzamen
684,882,106 *46B864DA587B56A99CBB45C1CAE8E437A1D4CE79 tsvetiilieva
684,882,107 *46BED723B68AA7616468D5DF62A58A46E9553378 tsvipnising
684,882,108 *46BBFF86365629E912924D3F829F0C4675EF62A6 tsvragen9
684,882,109 *46B3CE819553F5FE96753C351970BD02E05C9AD3 tswanson6
684,882,110 *46BF39DAF3E44D8D76BF7E94D5DDC96165BCE49E tswualbbing
684,882,111 *46BE78D1575C19486184BF8BB3868216C1DB164F TSYCOROPSOOZ
684,882,112 *46B1CB36B2BA9BA9D564516D49DA8B59E212A57C tsylordyhs
684,882,113 *46BFD1572C15A753CBA7EB6F08C8C5B1C721566E [email protected]
684,882,114 *46BAE13215CA3C82D71E01FD7017689C4D4D2AC2 tsysatad5
684,882,115 *46B965E9F60D9A16BC5C59859BD665FEC9E9B36A tsytsenn7
684,882,116 *46B4C8C46039815E03B699B2E540734686049171 tsytsep1
684,882,117 *46BDB576BDA72513A56F1C83C4A9DEA541E00B81 tsytsrn3
684,882,118 *46BDAE4C36526F5FC80984C84B5C449AB843FABC Tszan
684,882,119 *46BC88582466AF26E791E62A89A6BE8E488B7DDD tszX
684,882,120 *46BFCA80A82F0991896062979BC4D162D40FE7D9 tt0060434
684,882,121 *46B2A45C83D91771DAF09F4CE450B5F83C816122 tt0086926
684,882,122 *46BA82A87ED9A403FCE6274BCAD7032753965917 tt0090058
684,882,123 *46B811FC6E2337F05003D1FE7D696F563390F499 tt0116884
684,882,124 *46B3A9CA021286CB9347A12B77CA12772297B158 tt0126151
684,882,125 *46B7A647BC0D64EF2F2833CB9F91103A3F2B6534 tt0150331
684,882,126 *46B0927A8E4753BF6F38B4DD66C7CD2DDB8316D4 tt0156442
684,882,127 *46B9D40ACECB3978DF4F251F89688B658002C7B4 tt0179662
684,882,128 *46BDEBED49E9B9CE822F031244B6F6CE253ECB06 tt0283542
684,882,129 *46BAD13D1F63E741F67D6EF22986B7EB590B34A3 tt0321647
684,882,130 *46BCAA95610F85C1A6B8264D9A77EE765C974CA2 tt0388514
684,882,131 *46BF47939A839B2A87CEB0245466DF6C934FE9B4 tt0709234
684,882,132 *46B5AF5CF405C1B6FEBD3D2305D360C159F944E9 tt0810758
684,882,133 *46BFC1DFABEE61E7646FA2CCC9372AE49A7C9684 tt1042049
684,882,134 *46B9D0E580C95D6D541B12889FB65D7A90EC13B2 tt1496002
684,882,135 *46B758ABF531091ED0793E4EAF6CF88B8A3C24AB [email protected]
684,882,136 *46B14625DE89354CC4898E8A13A4B050172244FB TT387
684,882,137 *46B5FD150C4EDAB8E651721C0B513C39BD7B9453 [email protected]
684,882,138 *46BBBDFE2F19B7F9752E4962E93D598C4FD73F6E ttaddrstt4
684,882,139 *46B4DC3A804C31CA1F3E77F61C1C2235BBB2FC2E ttaftpbsw8
684,882,140 *46B5A6626BCAEDFF40492DD0BAEBA9EA333DCA6B ttargetborderbeh2
684,882,141 *46BFF1EBAA3EE4D5413455A1FE2F425410B8D2F6 ttatnejg4
684,882,142 *46BB4BCA9D05614641C40C4D6F1D2568A74D5ED8 ttbygdensed
684,882,143 *46BB18B1AB811E1C96C4FB0CDE789B112AFC3A50 ttbygdernas7
684,882,144 *46B6207BB85F7140E972B66AE1C0DD5477C6A841 ttcatacttcatttttcgtcgtgaatcctccattctctattctccattcttaattatcca
684,882,145 *46B898E774C39E497F72CB7E664EEDB21E3DA8CD [email protected]
684,882,146 *46BDCAD1445EA90FD3A515AD4C8C48BF2981A7DE ttcclayout
684,882,147 *46BFD467004608B7790FE563503C51496833F7E7 [email protected]
684,882,148 *46BB34836697DC5F42596636C5FF62C6A4FC00A3 T
684,882,149 *46B45376D4284AD9748D8DFAAECEBF1DE6C5D3BD [email protected]
684,882,150 *46B8FAAB286A1AD5629465594263621827CCB782 ttclsgh
684,882,151 *46BB95280082BC95B6D4669C40BDC480A90F042A ttcmgycpprsa1
684,882,152 *46B337E1D69B204C667EEED76849D47FFC4A85D8 ttctcctgacactgcttctcattagctttggtcattgtgcctcgatcgccctctcgggga
684,882,153 *46B96D52B72DA0F032C25948E65987B05F8F7F41 ttdirvartt5
684,882,154 *46BB46DF9464FE02D81722F84B7BA7D407F69C6C ttdnarepotlumtt
684,882,155 *46BE3199535EBF37B745A1D1FB5E5F207B1F1385 tteggab7
684,882,156 *46BAC5D581BC64F145EC7CB6D2EFFAD434C676AA ttekcupreteP
684,882,157 *46BCF8BECAE34401D7DA937EF9A7193065C02C95 ttelevns8
684,882,158 *46BBB3773F09E9374BD4723CE7D543C484222016 ttelffihsl6
684,882,159 *46B8CEB55C223EF9AB80BEB19763BC586FFC84C5 tteloiva9
684,882,160 *46B21343C606060428ED101DA309747665B66029 ttelsesforholdet8
684,882,161 *46BE2A7196EE182CC8B905B175045558879D3493 ttem ; K
684,882,162 *46BBE80BB3F61E8A1EA6C244AE6C8BE5BCF93CF7 Ttender8
684,882,163 *46B8A5FFAE434E946D371EABBCCE1AF5481B905F tteniltupnitnirp0
684,882,164 *46BA884FB5BC9D89FB5D510F2BD70CD3CE597459 ttenuant8
684,882,165 *46BAE7C97CDA421562ED399843C29BE8F6AAF8D9 ttenwerk3
684,882,166 *46B91E5951D5592C57F46A14569DF0037D83B310 ttepmal5
684,882,167 *46B32D530191E364DEB3FB2D646E5E8A425FF642 tterchen4
684,882,168 *46B183362A4F5234008F194BB2133000AEB882D1 tterissa2
684,882,169 *46BA738EF554302307FCFF80BC7B96E80E574F02 tterlicheren0
684,882,170 *46BBAAC12B0DB3482BAEF0055BE8D68A579C7D8E tterrageciloP
684,882,171 *46B2A79CD98C4910AD5E07F26D6F5B7EE2707201 ttesirup5
684,882,172 *46B3492C1AA3E064D9AC4BEB4BD3CE7913621BF8 ttesorup6
684,882,173 *46BFA5C668080C5768FB4B5912B33D63932452D9 ttetafel8
684,882,174 *46B32353C3CAFECF782FBC6FCB990AF009F5BFF6 ttfcntlrtntt1
684,882,175 *46BDBFA2041DB90C64EAC76B2C7061EDE1CD7F69 [email protected]
684,882,176 *46B95A70661624DCFAA89E09BEA695FCECFE2F8F ttgaactcagtaagattccttaaaatgaataacacatagtggtatatttacttgcaaaca
684,882,177 *46BA024D7106FB3EDAB1381896DACD7DA7404E3F ttgccctatttgtgaatgagctctgccttttcctcagtgattttagatgaggtaaaaagt
684,882,178 *46B4F431482D3EAFD721880C16B8801262B04B2F ttggggacggaagcctgggcgaggtacacattccggcagccagtgccagctcttagaagg
684,882,179 *46B3E01D64617B49557F5DC7D6292675D4524254 ttggrrhhoowwlliiwsb
684,882,180 *46BF378D8CA66BDDCD94BD0483CB26D3D4CAFE69 ttgorpym5
684,882,181 *46BCF37713BE4AD50127D96D9A335E7816F53856 tThO
684,882,182 *46BC634FC338A0511005DCD1D55D2F3EEDDD1BA8 tthrbbdt
684,882,183 *46BBDDFD11247A8BD4565CCDD08DAF8C5C333E04 tT;I
684,882,184 *46B112D8A27977F6B1A97E455AB959D8F4E2348F ttiflusing
684,882,185 *46BCF0334288D88DBF5CC1C774BD2BFACE19575C [email protected]
684,882,186 *46B04010421FC18C0FF8934466A77B572A96B6F9 ttifrste5
684,882,187 *46BC0A3A9874B743316052040C5F634E59AD07B4 [email protected]
684,882,188 *46B49D3B41407347DDBF8655DAB81A5FD24A8BB5 ttionde6
684,882,189 *46BB144B2B520F0ACEFBD871DFCBBCC489060AE8 ttionnih7
684,882,190 *46B9C9409529A5A0E3997CB2F4491D2EA938A701 [email protected]
684,882,191 *46BE366095DF631088DEFB65DC2D0E08D07499F1 ttisalia4
684,882,192 *46BA21E4484FA0EA28705844BDCA9BDFBF267DE1 ttixelpmok
684,882,193 *46B8443694CEC790AB33DAB33BFD90B775CC3F06 <TT>Jane<BR>
684,882,194 *46B3F319D7325CBA3737C70C3A26A67C50E71391 ttkeepopentt3
684,882,195 *46B9AD6CE08673B795399654F30CEA27ECF68ACB Ttlgzng0
684,882,196 *46B44C96A0E35A0B0808D6088396B3FED8B0FD7A ttlschdn
684,882,197 *46B5F98A85C991A86E5EEDE466C23F72CEBCA7E1 Ttlusnoc
684,882,198 *46BB3606E4C69F5AF6ECABE133F114AB36C0C0BA ttmens
684,882,199 *46B7B2FF1209F31DEBB4D219082B17DAC8CEA0AA ttmultoperandtt7
684,882,200 *46B059D08BA35CBAB0941A5A0111A016C76921E6 ttmyfilettbred
684,882,201 *46B4E1563B5D841C25CA1CBB34A1BCE4918A779D ttntlztsthwrt
684,882,202 *46BCE66AC3FDCEBDA72DA106144903BE7D5138D5 Ttoibmal
684,882,203 *46B118A12339A31552209F0D7EE33048BE769EDE ttoiccacing
684,882,204 *46B5743EBE712D72B9A7326592A16228CF776C41 ttomessi0
684,882,205 *46BD8CD42D30993203E46FC0C5915FBA45B09D4E ttorbppu5
684,882,206 *46B1E79554AD478E19B69337B2CB050FBB2C9539 TTOTT
684,882,207 *46BC60D14997385B6AC3AAAF325BA19964FA5994 ttplehtt3
684,882,208 *46BF13F7B11092CA0BF61DFA9E38A8C9B05402FE TTPRFABI
684,882,209 *46B8B50E5E069506D9228428174F4A089FACBAE5 ttpushtt2
684,882,210 *46B17FDB3501EED42DEC5006D8A43AE54F05925B ttrhdrns2
684,882,211 *46BCB6AE663838A0302989E499979C545E9B3404 [email protected]
684,882,212 *46BC43926542EAC78B02A29E6FD69AA45DE065D7 ttridmrtt9
684,882,213 *46B5D19216ED73F09A69FC3D6A3B95CB0BDFEB83 Ttr`rnt
684,882,214 *46B87C82EDAB312FCC239CB737027C939085C75C Ttrrssz1
684,882,215 *46B01E9DF3E9D7AD822A3A963EA818890657D406 ttrsprngs
684,882,216 *46B6F8EE48D88E1FD84BEF36178C01FDD86053AD tTsl
684,882,217 *46B5C5914A0EE248E1920DBF2C9661F539B29679 ttsrebmuntt7
684,882,218 *46BB9CC9AC6C26E8A1DE280782A9A0DA152C9555 tts-world-cup-p
684,882,219 *46B68F66A63E2C884FFB932F7A7FA4DCD12FD5CB tttcagcattgttttgtaattttcattgtacaagactttcacctccttggtaaagttggt
684,882,220 *46BE536B67A05FE7DCFA51C231EBACEBA3200953 tttgraveliftltt0
684,882,221 *46B7EF5CE456CCF581D25A8E5783B773F2A640F2 ttthousandtt0
684,882,222 *46BE8B14BB5641F4D979FBAF9F93BF368BFB513F T!TTLE$
684,882,223 *46BFB319B6EDCAD42D5166F10B37DB371C5F287D ttuksiurotnel
684,882,224 *46B84805A901502900D0A60AFE4E48C2CF65983D ttunpacktt3
684,882,225 *46B1E0B3982B2AB4862426D30C4670E73AC979E8 ttuvissa1
684,882,226 *46B332D224B397A07131946DA676512652EEF5CF ttvgrattil6
684,882,227 *46B30479AFA6CB12C3EDAF3760DE6615CF3C6830 ttvik march, 1972)
684,882,228 *46B80B5DD80C6CF33AB8379C5D18821A9A98051E ttwarntt7
684,882,229 *46B2A30CA28B2E008ADAFA1B0921EFC4F04D8A21 ttyekti9
684,882,230 *46BEA0B6AF85F0E39C0C7F3C56ECB504A368D4FC ttykkeles
684,882,231 *46BFA6F24B977857D7742C6979A8FFD3D7FCC0A9 Ttynnys9
684,882,232 *46BC25F6604C964BB0919EE7C1A27F25773575D8 ttytasik
684,882,233 *46B1DA6728C87A9F171C00846B1884B7F509A446 ttyvilt2
684,882,234 *46BF1A461C468B8B4E7A560D0CE7061DA53ED149 ttyykkeh0
684,882,235 *46BEBB793AB89512976CC51F917E411CEC9FA612 ttyynes2
684,882,236 *46B8A3565355B04ED68192752AD9DE7DFA433916 ttzmkpmoy5
684,882,237 *46B4B3CA78BC9CB497226C974FDB84BF7F6C8470 tU_{
684,882,238 *46BB1592930E281C9830D33651ACE706DE9D766E tu16053.1.4
684,882,239 *46B83827E88CE1EA6EA91AAA8FD422BFCAE4B331 [email protected]
684,882,240 *46B1202F7F122070CD69BDC03F3D0C3B3C533FDE TUAMORMINERVA_XD
684,882,241 *46B256D56FE3738F857442CA4E2A3E4AA0A03C30 tuananh)(*
684,882,242 *46B2CE5DADD77243B341D95413B4AD7D83C4B0EF tuanatnn
684,882,243 *46B6AD42326A085862AF9B7400085556BB6A622F tuan c lee
684,882,244 *46BFF04BB7F01A76B8DC2C3FA4DF797698D3AC6F tuan.coston
684,882,245 *46B774DA5B19081ADE576ABB5EEC46B22A2630AE tuan.crittle
684,882,246 *46B582FFDD1EA82975AEF441653AB9DA77395FC5 tuan.dabato
684,882,247 *46B7DA20ABBEB2066943539D3937D60C865AE7AB tuan.doby
684,882,248 *46B99224FB6426366F132055A3C0A66F10D79D44 tuan.enck
684,882,249 *46B0FC0CC131A87B5465AE7E95235B951A3CF6B8 tuan.howman
684,882,250 *46BD46CCF6B98AB539FD33C7F5AA6AEA02FE10DE tuan.justus
684,882,251 *46B67C18C00B9BB9EFD6E2D825A55EADEF9606D2 tuan.kolber
684,882,252 *46B6E9A4020D8CA2A53A6D2402CA9F3271077E6F tuan.linderman
684,882,253 *46BD740B3DAECEC208895044B7FF49E96F1CC803 tuan.malaterre
684,882,254 *46B42CD9085880B50E5A557FF94285C8D593A06F tuan.mince
684,882,255 *46B18BAEFB47215810A5BACE6CE0EC2DE63F7CD1 tuan.moccio
684,882,256 *46B9E3E3126B07120785136B08E039DB9DE0249E tuan.noboa
684,882,257 *46B92FAF7554BE7E18A9720EB14F381EFC7B1A03 tuannuratiqah
684,882,258 *46B936AF8784E030A6BAADF2FD1887D616FCE6DE tuan.odam
684,882,259 *46B29652CF3F812D264D3909093EAA4B41F76E56 tuan.rafail
684,882,260 *46B6D2CED4D12A156CB0D59FC942AFD6FC7C9ADA tuan.seibert
684,882,261 *46B244EDF9F44EF16F4D7A8C2554F288B8C855BE tuan.spaur
684,882,262 *46B2FC639FB13CFD8D7F73554E1FAFB2FD55BCE3 tuan.staenglen
684,882,263 *46B6AF6773ED240DAFB439C7EFDA1773BD11520C tuarteb3
684,882,264 *46B7B58B890072BED2A419864724B22BB4C54467 tub3r4ti0
684,882,265 *46B2763814824854FFC60569140812A4E7293B38 TUBARAO123
684,882,266 *46B904B5932FC228A55822187154AF2F14E83922 tubarded
684,882,267 *46BFF6BFB5D71735AC548BF0A8AA104584E0FF82 tubastreabsw4
684,882,268 *46B02703DBF4835CC50FA4299D39AC4E79182417 tubata0
684,882,269 *46BB68529ADF4A83341A8BA9ADF497181B9497BE tubbsgrubbsy
684,882,270 *46B7A080D8A35E67DE0C6508B2E002204F38E4E5 tubbypanther44111
684,882,271 *46BF751984CB0D2ECD73A262EE4F651D756DFD74 TUBE101
684,882,272 *46B7B131F6503B54D49F73DD78EBD30888EED676 TUBEBRET
684,882,273 *46BD8B932559D86ABB526F4A9B7F5287F6C76E31 tuberia1234
684,882,274 *46BF401A331AF95094E4D1043191F3FEF004C52C tuberizationsesed
684,882,275 *46B9EA27BC3AC87995547BD56F7160AFC13AF50C tuberkulozna4
684,882,276 *46B36460A2E1F1BCB6A2F4B224A64CA1C682DA50 TUBEROINFUDIBULAR
684,882,277 *46B64DC1DC65187B6CEFFABB8B53FE4FA5B2FF87 tube-surfing-m-i-paper-planes
684,882,278 *46B8DFB3F7B8F4878615C700A6C3E62C3453189F tubiero6
684,882,279 *46B062AD67238A5E360CE86A3291D433C4C705EC Tubip0r4
684,882,280 *46BBC51608693F29790E56F06E619CA336AA5061 tubitubi8
684,882,281 *46B2A0EAEBEE5AAB89AF837694146C9695880BAA tubrtngs1
684,882,282 *46B2A841057FE5B5A6E221175FEF5228DC0A5751 TUBSIBR
684,882,283 *46B4FFF94A7DA4DB9FAE9C6D2D76249267FA03BA tubuodik2
684,882,284 *46B752C07DC9865E5D61F76888C3F56CB93DA3DE TUC079
684,882,285 *46BB7D9DC132B69C5EB538774677D165CA685A97 tucgsrjkkqvz2
684,882,286 *46BFE481566F6DA43419FDEE13308C3E10A7E4AF tuchtigkeit8
684,882,287 *46B38392BEC564489EF0F0F6095F42C585F745F9 tuchtsch4
684,882,288 *46B9E2366727E7C9B7C4B5056CB053C3A8470A82 Tucker835
684,882,289 *46B609B21672541E8B90681C2B01334CACC02D77 tuckerbilly6
684,882,290 *46B43420948D04F34FFDE960B55FFDBB3CA41EF2 tuckerchaos6
684,882,291 *46B5363850F982645F83E66EF47A53B33F819D8F tuckercosmos8
684,882,292 *46B038FF7832DF8C3F2C5AEB22A5F38DBF44A0C0 tuckereclipse9
684,882,293 *46B790CF86ACB870D60CAC0EDADA89EA8FDD628D tuckeriloveyou3
684,882,294 *46B02C916B031075E076B08E13717BD4DCE4675E tuckerjustined
684,882,295 *46BF91376A727B9F0D7986ECD4C9411578621A77 tuckerlucas0
684,882,296 *46B6352F07082662FFC9C4C6A89853712871762D tuckermccraw
684,882,297 *46BFF6E7A5BC489113B8AA5C28E0D03C3453F720 tuckernellie2
684,882,298 *46BD015D139B8A91698614BB838D2723BAA5D67B tuckerphillip2
684,882,299 *46B585FCF93F3A94D99C1CF14A2DECAF43F3BC62 Tuckerrandom
684,882,300 *46B351F67188307742AB0F072B0788D21F45A66F Tuckerson1234
684,882,301 *46B42047902058A1C2FA32B7A18E0407E5775E86 tuckertricia8
684,882,302 *46BA0ADD4208391B0F166C7810A62AE2392B3E91 tuckets1234
684,882,303 *46B30E39149BA082AEFF30EF4D0CCDB702FCA56B tuck mccormack
684,882,304 *46B22BF6D32C065C4FB32A29F89B3DAF5D3BDB0F tucson.
684,882,305 *46B7F69B463674BA0BB999978BC858D03E9023F2 tucson fashionweek
684,882,306 *46B37E1C9D9D34C8865C6DEC0E564BFF4F1F04C2 [email protected]
684,882,307 *46B9868720A72C89CC65D711946A606BD3950E67 tucúqueres
684,882,308 *46BD884F11F38169CF73A32EB8B1E4E70DDF2393 tudes, book ii: coloana infinita
684,882,309 *46B3F82D7066447249F41811A087A6ABB3049AD8 Tudieztudiez
684,882,310 *46B2404555F3CF5A5719B7BEAC9224AF0B78FA66 Tudkinning
684,882,311 *46BA434A2DE24867E632686D04DBF9038926F571 tudósokban
684,882,312 *46B6F6F603828CCD4565CB4BFE030E1B1F1C15A8 tuefai
684,882,313 *46B391B29066055F82596818BE862C86EABEE905 tuelle1
684,882,314 *46B03EF03141BB5DF7B09FE2880D2AA95156FC3A Tuercas3
684,882,315 *46B39F99A96635C65A5E2F236C96E2E200FAA4C4 tuesdayabsolut1
684,882,316 *46B15E9BE4D880079477505A3D1FB6D6EBCBBE87 tuesdaybernard0
684,882,317 *46BB4A5DDC0ACB22B4D4B84B479F11FF09ECDF4E tuesdaybitches
684,882,318 *46B7350909511202BFEB8F7B83AC3B02391A803B tuesdayceline3
684,882,319 *46BB5917561330FF00FC75E25114FA7E02918813 Tuesdayinternet
684,882,320 *46B240285135296248E62793250F74CEFA370F76 tuesdayjessica2
684,882,321 *46B457ABD28BC7523877EF14BA70032636347D10 tuesdaymichell5
684,882,322 *46B0E256463D766C38B9784C779B0BB6A2429A60 tuesdayone4
684,882,323 *46BC02D163D2F42E893A6CBC912B4570BA0A2628 Tuesdaysuzanne
684,882,324 *46B5E0FC28841288644A63CE911A07B29CF92072 tuesdayvartanian
684,882,325 *46B4B106D943CB1F62BDA7B55AFE1D84FE946C90 Tuesdayy3
684,882,326 *46B39BBE95ED77B529AE7A2E673B9236673799A8 tufastufas
684,882,327 *46B8AE1733AF0EAD7B4F6248CB476D62AA8BE5CF tufbimor
684,882,328 *46BD9ECB845FDF55B63EC77512BC06C71B64767F tufferma6
684,882,329 *46BF32864C046807C98C658146748B3639320D4C tuffisming
684,882,330 *46BD20AD5011A3E991EA703F5E0B3042DFA8654C tuffmonolithic4
684,882,331 *46B3C05EFB92CDAF02D1C3F688E50A579DFD67EC tufinama marcus
684,882,332 *46BDDC469A866CEAFEBB0747D6C13BE22EFEDD88 tuftch
684,882,333 *46B034DAF8ABD6FCFC8AC98C7AA752858EC120F8 tuftedduck8
684,882,334 *46B28A6E31EAB214B2C1E8AAE7A2D7831CA0AD5A tuftites
684,882,335 *46BE1B2A487FC9F0781CB8429306DCA387DFC2BE tuftonborolibrary
684,882,336 *46BC3813612957AD9AA9BDBB6089A1BC10EAF842 TUGbaa
684,882,337 *46BE1432E348EFC88B15527AC636F7E6356E1A08 Tugeala
684,882,338 *46B0FEDFF2968FAB8441FB341EA142F8F225A29E tugendhaften2
684,882,339 *46B1F9AD4F40A7F5E036C131F7125072BB24B473 TUGGYZ
684,882,340 *46B0AA97DE04DAA63475CFC07D089F039113FFD5 tugituugii
684,882,341 *46B98EB3CD8D7AFF667257E98498F7319815B8F8 tugr105
684,882,342 *46B7E581F3A43A90630B9241FFBDFE7C1821F2CE Tugrama2
684,882,343 *46BA02719B3BF70594947BDC77993EFFAA9DDCF1 tūhhan
684,882,344 *46BF9E072F5D440E0EE3BD97F9CA047827960ABB tuhlaavat8
684,882,345 *46BBC6FE6DA1C47755DEBEF8C9BC9FD908FB8B35 túhourangi
684,882,346 *46BE2264683A7C3B0D7CB711AB16C3151552C644 tuhregning
684,882,347 *46B39498417E0A75A4E88B8BA556D3DA75E9C2DB tuia heller
684,882,348 *46B9039EAF33886AB85F8FD5ED9AD2FF04938DED tuihsuod3
684,882,349 *46B7928C06908638BE42293253D82B5482FF1844 Tuikyuu6
684,882,350 *46BF52A3C4752C0653FC2408A8B06FB2F8616D80 tuilidh9
684,882,351 *46BE7308A3ADDFACD9A5920A5B509C050479F05C tuinagtige
684,882,352 *46B9CC143429690C4CC7DB1FFB7C10BA19E76B5A tuinbanks6
684,882,353 *46B283AAB3F32ED3AD132563D7ADEF34DF057A90 tuincolumbarium
684,882,354 *46B00268FE9778703E2F397CF2FDFDD6DF97D5B8 Tuingas7
684,882,355 *46B53ADEB80FAF93BB3241AFC47954CFA13687C6 Tuingewa8
684,882,356 *46BD6E6F8AB0C3804EC7AC6BC03B917D628FAAE4 tuinkasten7
684,882,357 *46BC568C19C23109E88D1C92967C63E063EF5C60 Tuinstoelen.
684,882,358 *46B985E3A10F1605E836E5D505D5EBDD308C98A7 tuirdfacit5
684,882,359 *46B7359A5CF337F5A416272C38DA9DB743A7FDE2 Tuireanna
684,882,360 *46B515972D21EEF77E1A20DF5B5B9C800F15F62E tuishike0
684,882,361 *46BE173A3DB30FAB71A67BCAC37BB42F7B4B9946 tuistes5
684,882,362 *46B3100A31B519A5CAA13AA04985EE32DF8647AA tuition classes
684,882,363 *46B0ACD2D95F4AC7D70D3E4DFAD91933AF998CC0 tuiwavu te
684,882,364 *46B7812A433451A38CE00995CD6B0EF12407E573 tujuhasa
684,882,365 *46B33D869C17A67DBE70B08BBDAAD99F03C415E6 tujuh batu
684,882,366 *46B4FDBDD89785F763B6AB12F3001A75F1E8607A tukahduttavis3
684,882,367 *46BB5F66F4180A0BAF0CF258FA9133509768A246 tukasado9
684,882,368 *46B13930438FC2F070FB27CBF6594F902F08A82E tukeeabyrd
684,882,369 *46B894165ADF9293DBA517AD6079FD976433CFFB tukeneid6
684,882,370 *46BEEC27453C5821AB71D60C38CF423EFAB9F251 tukenme
684,882,371 *46B509AB280093AE48E5034FBFEA4D9C2F1805C2 Tükenmez
684,882,372 *46BB5409DEDDA1A5D59BEA1F8CEF2DC08AC2B077 tuketase4
684,882,373 *46B0A6C33C5E8F494754E56F73D1A4EE9137C1B6 tukijon
684,882,374 *46BD25C935AB2785C59EF524E818F839FF8AAE49 Tukitoo4
684,882,375 *46B8E90B83F2BE8A2926F063BC9A570EACF02B4C tukkapoellyae6
684,882,376 *46BF6A00914EC323311D17D1B176664E23689289 TU$KLE$$
684,882,377 *46BB0693C35F70C2C7CBFCAFB47ABA05785D269C Tuktoyaktuk
684,882,378 *46BA41117D64EFA56DE37EC3FB3B777335C80104 tukufu0987
684,882,379 *46BE69455A2B78569C74D238AB3FAAA016CAFFD0 tukuotakashimura
684,882,380 *46B70C2ED39EB67F9FD84588C80E55946B8E2B66 tuladana
684,882,381 *46B24487A525A583C2FDA2C96FF1CD6976CE02E5 tulajdonságbeli
684,882,382 *46BB8420EC50E10CCE1D28D6F05741ADBCEF4154 Tularam1
684,882,383 *46BD0E4C6BC80103077ED5F09269F73E74B3A1A7 tulay harris
684,882,384 *46B93770842A80AC575B9285155089F522F87B64 tul bahadur bhandari
684,882,385 *46B48CAE5503B41D5D5955CFC516BD320E01CC70 tulchinbartner
684,882,386 *46B9418DE9539F06BA07A0ADE56F001BA29FCCA8 tuleb…
684,882,387 *46B583CB74BC9C9CD9DA78395633339F7C368913 tulehdusvaaran
684,882,388 *46B2DBE6669BAA1C35E35E77E3659316DA77419E tuleranted
684,882,389 *46B0E29E995B3954819E8E3B0A1B9E4F96D2973F tulet hiljaa pime
684,882,390 *46B2E11C847BAE3F2BB1C5AF0355AA3C3406439B tuletule6
684,882,391 *46B70280D225D1AD2AD061F3D33B0213BA9C2C01 tulierte6
684,882,392 *46BD490ADDC9D1D8997B22BFB82BEED52EC59C38 Tulieste5
684,882,393 *46B386226FF6E57F7E956A9163BD507362ED7218 tulika sawhney
684,882,394 *46BF1F11E31D6A28D95C80504AFA8B71637AB0BC tulipeblanche
684,882,395 *46BD65AEA25F4E89D4842362976730778CD29954 tulipist1
684,882,396 *46BDF98C7FEA8820ED9BCC6A8622121DEDED212C Tulitokaed
684,882,397 *46BC97FA25FCC3F96622E249BAFE7FD8214D042D tulityöpaikalla
684,882,398 *46BB47E658832C272B1A9AE2C6CA714947B4B6C7 tulivoimaisees
684,882,399 *46B2F4D5BE50A2CBF6DEB761394545EBB703C409 TULKARAM
684,882,400 *46BF56AB9B221B934E2379B9977D68F138992E70 Tulkastâz
684,882,401 *46BAD51A473B292EC0F9464D7DBD3538E8669527 TULKINNOILLAAN
684,882,402 *46B37ADEAE1A5FBA61030FC01293AC99B7D8A765 tullamoredew.comwww
684,882,403 *46BC2F4F35E1F93A24724CB34A759542F5618976 tulliasiakirjojen7
684,882,404 *46B727ED8460B8E4D2B47FCA376E916E43C813F9 tullien2
684,882,405 *46B6CAAA8FBB10C056B46360111D7F465CBBF19D tullille5
684,882,406 *46B4663C059989A265F941A82EF189C14881D567 Tulliyies
684,882,407 *46B1381CC603A3B41BBBE66DC95AE04EEF393EBD tullochbsw5
684,882,408 *46BEE5C88EF948C8E891A0E31188CC9089BDB2BC tulokierrokseen3
684,882,409 *46B0405B31ACB8F19BD7625EEFE3D435952B685C tulsasrl9
684,882,410 *46B23E30C7138B97CFFF9B9E3559CB4E3911CA65 tulshi lovely lovezone
684,882,411 *46BCFC8674C00A6BB60F32C71DA02FDB90F27EE1 Tulsyan9
684,882,412 *46B21B71820D0EDB03482EF73E1E74DF22B5579D tulukaktam
684,882,413 *46B8EB183A984942FF57243AB9054705356426B1 tuMAMeturuG
684,882,414 *46B36557578D0B464EA2248BAA854C496931BEC3 TUMBLED0WN
684,882,415 *46B1115A378628B8FF5C4521DA013C9102D70889 tumbledryersing
684,882,416 *46B9EFF3946864398ECD5E589C647C2FDB7D15AE tumefastes4
684,882,417 *46B1C602D2B33E9399E88B772A1F573FE5785F5D tumefatumefaed
684,882,418 *46BEFB4D8A6BF3BFA88ABD398B18298D2BF05FD7 tumeferete4
684,882,419 *46B75C3948F64AC6E0AFC9540595041B79B99432 tumeko wilder
684,882,420 *46B5A46CB89B630306134F5FB8BFDE046B550917 tumelo maesh kekana
684,882,421 *46B8E56DE67C606FBB9D9CE12D475F1CF20595A1 tumishajefferson
684,882,422 *46BF85FE02C03E0C6C99B012B279C7F06981FF68 tumishopno
684,882,423 *46BA7A76D461994DA33073715E2AC2A9D76368D8 Tummack5
684,882,424 *46B706EC88D8991E8AE6E734A8E5D5E66609F186 tummaening
684,882,425 *46B4AAEF4241641F3488CE5820C10A50A78FDF73 tummanru4
684,882,426 *46BDF3847A3414F4ED9811EA4AEFCBCC1EC8A815 Tummiin5
684,882,427 *46B5BE1126D514A1FB51EF35ABB34CF909910405 tummycous
684,882,428 *46BD919D0F4834777BCDC9B71EE928D0245BDC41 tumorangkeyboardtumorang
684,882,429 *46B7350605DD56E7FE3446A457CF4D4B205BD3ED Tumorosas
684,882,430 *46BB9848ABF6F3AD593E7251913E29AFB3F41BB0 tumpanaser
684,882,431 *46B3FCA0AAD93FED540FB12E2A80260A9CD50A33 tumstockarnas8
684,882,432 *46B396A88971BC826944EC1DBA931BF4DD1DEA04 tumstocken6
684,882,433 *46B32811C6EA5A1F7902A89B4A245CCAF327AC07 tumuaanae
684,882,434 *46B5D6750D5642463841B563346B101BFB1CE1F4 TUMULTER9
684,882,435 *46BE5C31D7823F1EC0AB14AE1AB98BC5C16D67DE tumulusbr4
684,882,436 *46B81D99E6A57FDBE3835CA71B044F85B10559D3 TUMULVID
684,882,437 *46B7B5232FF59ECDEB2DD6F985935A9FF88B7AEF tumusiime fred
684,882,438 *46B587074B50ACB8E92558EFFDB1E701436B7E79 TUNA836DISK619
684,882,439 *46B3752E0C70DAF69E68B2EAF186AF3134997C8B tunaalsan
684,882,440 *46B2D69B467EBBEF90EBB7395A2DF812448465B3 tunafaa0
684,882,441 *46BF1D7178091DD5D1975249E52A1C25944FB8F6 Tunbak
684,882,442 *46BF9CED1FA25C5A56DE78A10D7DC6DF58FDBC39 [email protected]
684,882,443 *46BD5B955671776F6C5DC17C6B6B2016F1ADF7C5 t und dem
684,882,444 *46BE3BCAB01A4B3B66B7015ED7F7041B56BB5524 TUNDEARAS
684,882,445 *46BB55271145728948F465C7E7498C11DCB79273 Tundente
684,882,446 *46B6C9DD1ACCDE4FFBA41D6E415418365C38F529 tunderdry
684,882,447 *46BCDFE020CB7987921A3A7201795F71C4885E96 [email protected]
684,882,448 *46B20BB30F3419684C3CAD1D42AECC2E60B28418 tune
684,882,449 *46BCD56E021EE7A85B1C2A4C2F4E2AB1BC7D2319 TUNELOWY
684,882,450 *46B87C6E5B066FF4247A05E6874C067FF7B11CB3 tunercbcharlie2
684,882,451 *46BA5736B69B5E2627A5AF6EFFA4889D90B04622 @Tunes
684,882,452 *46B6BFEF8B62BA74B160C0B8174A4A8E14402D45 tunet bundalian
684,882,453 *46BE2F3732069223B5FFBD8C74556A0310A47B55 Tune Zindagi Mein
684,882,454 *46B1C5426CEE133B5FF49084A5805F9193734443 tunfiskens6
684,882,455 *46BE9856FC8CB649911FAC4FCDD26130041730E0 Tʻung
684,882,456 *46B5F733409892B4195568AD339AE4425D0005D4 Tungevariantene
684,882,457 *46B2D7C4C0C24A03B0FCC2A8388BB5B35C02BA4D Tunging6
684,882,458 *46B3B951DCCFD86264E298AAEDB5A1586EB4CF2A tung$p4t
684,882,459 *46BEBB0766EBF1F5C7DDDC429ACA6BD6DA1C4499 Tunguzian
684,882,460 *46BCEC8FAEE26EC699B76BC54AED01CEB2D92039 tuni da costa
684,882,461 *46B0958BA05598D78B105D7F3B62AA04E73C292F Tunist?
684,882,462 *46BFC20F5178403613904F2AD1F7B9DEF6997CB2 tunkapilahosman
684,882,463 *46BF20AAE5081403EF1129A92B44BCF916C6AF2B tunktoss
684,882,464 *46BEA3C9AA58CEE1D9BD961BB93B5C6A0797F660 tunnanra2
684,882,465 *46B91DD2F55A95C83922F79DC475B2007967E077 tunnelatauksi1
684,882,466 *46BB4304885D1F2CC5F3923BDACAEF850FF4D2A1 tunneleita1
684,882,467 *46B48302083A195594707737B7FCB3FA541B132B tunnelmalaulaja
684,882,468 *46B870E011DEFEC31BDE889C061467125E28BC60 tunnetuimmilling
684,882,469 *46BDE098074D58C88C9A4A79537F24D3C107504D tunnetuksis
684,882,470 *46B7F9ECB8F488B09F17FBAEB6EFADF2B8A4D97A tunnuksien2
684,882,471 *46B5A0A433492BCE252186FEA7353FCC6EEA2B10 tunoonut2
684,882,472 *46B306664C73C7730A2C503DB1B1D75B9454729C Tu No Sales Conmigo
684,882,473 *46B8D70F51C9839B0E3AD45A21A50DC4C14D11B0 tunrayobisade
684,882,474 *46BDB0032B3569690B12D348FF167B339CE0D937 Tuntoni8
684,882,475 *46B5C7EAC5F25C9ECF8CE35953CE52D4DE47151F tuntukutoon
684,882,476 *46BD8B37D13BAA42FA103BA760344E1CAFDB6947 tuntun timtim
684,882,477 *46BDEF78A9D211CC1B0A399763E96D9EA563E251 tuntuvampiaed
684,882,478 *46BDFFBC618D048C21500BEFC781DF2E63F64782 tunulav6
684,882,479 *46B6A88BE154C904D8365EF29038DACE119D0815 Tunuzsua
684,882,480 *46B91E0F2EC798A7F5F3156B7C7BE1262A454891 tuohcniming
684,882,481 *46BB70BF4BCBE31141EDA8B43F195A230520CE13 tuohieoned
684,882,482 *46B630E4BE06985D3D48382E52532D1F6A6B30C2 tuoleine1
684,882,483 *46BA3D9C8CB42F647D4A335480C6847023BCDAA4 tuoliltansa
684,882,484 *46B98F4B205564FE4CA037B2B588D0A7384BC354 tuomas soderholm
684,882,485 *46B343DEA6CD9F513FE9C8EEDCE9BEEC50D9FDA1 tuomela9
684,882,486 *46B9317AA1118028BD93A11AE6C809BF3ABA4434 tuomioistuimen5
684,882,487 *46B83AAD11CECE4BF5D3384D5AB783F29E111667 tuomisek1
684,882,488 *46B0F6C950516FE9C9046254500F9578ED6AF7F6 tuomo itasalo
684,882,489 *46B5F21C78810A3AFBEB884DB7C2E015C912A077 Tuonaron4
684,882,490 *46B4692E079BF425522B38D951BCB1AEA7222054 tuonavoses
684,882,491 *46BB2C7CA0147A83EF22F057C6402866B8A9BC6B tuong vi pham
684,882,492 *46B0E6B0FD13CA4D8F6037C6D8F70ABD83E70DFC Tuonik
684,882,493 *46B904F3B570D5B0BD3FD65DB690DF1CCCF5D7F1 Tuonusan
684,882,494 *46B9D760C46977D692B830090A449FA7CA0194FF tuortnamra5
684,882,495 *46B6B3C2448434435E9F9144B90D9847E3B8C4B6 tuotantomenetelmien1
684,882,496 *46BC060273DAE0635626165A47CB5A7DA6B37F1D tuotantorajoituksia9
684,882,497 *46B0CCBAA28DF52EF819CF694E869FB80D1AA653 tuotekehittely9
684,882,498 *46B6CD2EDD3DFF4B9BE0308B57A6437BCC7694AB tuotetta1
684,882,499 *46BE2A9E6DE1B2F25103ECAB70C8ED4D93E4FD16 tuoteval4
684,882,500 *46BF9C912B7C23DD2DF2F9F822A09B7D5A6340CA tuotevalmistaed
684,882,501 *46B4152DF6403B57018DC556FB6A6A89307C7FA4 tuotteetindex
684,882,502 *46BA6237A97026F05E5B98C47C5E2E9E0D36D7CC Tupakointikiellot
684,882,503 *46BA029611A999FAF6984DD4E4CC61727C5B119A tupanshipping
684,882,504 *46BC74158B63E67987871EAE54FA8B0FD660B08B tupil4ks
684,882,505 *46B34E1946FC8660947C9E34141459E5CAC851CE tupoutuapolealisi
684,882,506 *46B55C9770A34A01FE3FC3960F75F95D27C150BA tupqdt
684,882,507 *46B5A9A6D0CE9A505A9EB5255DB6DE72F203D69D [email protected]
684,882,508 *46B844E506126D2DCC42EED40A6438B18FCFB25D tur8inasti
684,882,509 *46B983EF90B85AF55ECED80F57717002C9953367 turabo''s
684,882,510 *46BAB83A6B0924F84077AFB2E386ADDFFA0C6ED7 Turandot:"Strappateleilsegreto!"
684,882,511 *46BA05AF44BA2C9AF0CECBA59A8DDC8DF3C8E1AD Turarte9
684,882,512 *46BAF49F9D66DBCAA376D71D1012DBEF7E84EE15 turban.15
684,882,513 *46BC36D097F63BE9EC91569CE64A45D4E54FE995 turbichi
684,882,514 *46BF39C3D5BBECC8D859B0CFD61D7D84BEE9BF32 turbidimetrically5
684,882,515 *46BA5B3DDAFC99088C519CA71741FCB5634D0947 turbidimetrics
684,882,516 *46BC8A9234A60927D0A1583E1762D685EAB0F797 turbidumque5
684,882,517 *46B9D90E82749E1CFDADB253CB67503333FFDD89 Turbo21991
684,882,518 *46B899555B1BEA6608BDA9E73069BEAB15B6C607 turboalternator3
684,882,519 *46BB5F96E1FA9496E484895B1F7842FF260CEA78 TURBO-FANS
684,882,520 *46BF5E6D5008C19B4CC37AF765649F8A8F4C92FD turbojaked
684,882,521 *46B7924FDF62AF8CBECA7B08069DDCD297FE8620 TURBOJATO
684,882,522 *46B47095B7BBE3C28A2554C643F2E2AE5A5DD569 turbolyf.bbs
684,882,523 *46BAA158AD9F32C63DA8FEC114C4D708EE2AE875 turboparis3
684,882,524 *46B15C61604C4DDB58429F1F90FB004C4450797C turbopete6
684,882,525 *46BFCF04E16FB4E1F558908CE10DE223DF9A7E77 turborat8
684,882,526 *46B6449767D02CFC32A3A2E1238C605520767FE3 turbosnicker2
684,882,527 *46B41D77C2DFA809EC388E982EA2AE2DB5BA33A8 turbostudiosessions,volume2
684,882,528 *46B87B9878CFEA217F6E1EE50559F2EC64D74CCB Turbvis3
684,882,529 *46B8A5910A08021587B06F7005F969B08D90A39B turchan8
684,882,530 *46B9BE117DB5C11E30214336626C79FBEFECE986 turck?
684,882,531 *46BBF42A07F49231A1E726102BC10A371ADB6FCE turcophobia9
684,882,532 *46B447D2049B265EB1E32158BA9E7540C6B8EB05 Turcza
684,882,533 *46BF622219B38E67E56C74BC1BD679C6844772B3 TURCZYK
684,882,534 *46B2C463A780F73DCECA2222E6AD644E4168E3C8 Türdichtungensprofile
684,882,535 *46B11627895EFE2CD2AD4D013E641E62089887F9 tureckou8
684,882,536 *46B7D1FCA05B8802702E8A5F6DE5D39336417143 turerais1
684,882,537 *46B3376CB2FE3D9F4EFDFBAF7CE64C5EB4C79C9D turetme1
684,882,538 *46B0A9F1FB805891A225C0782798D21F10E3393E TURFDRAGER.
684,882,539 *46B467D0FC5C1A0A996F4676BC8FFB3141547702 turfigène
684,882,540 *46B69A6E4F1E04E412E82FEBDAEA82747CB3D9C1 Turftrapper2
684,882,541 *46B8B942FF4FCACFF3BF61D0A68B2FC65556A541 turfyyfruted
684,882,542 *46BAF3C5A8C09B9CE8AA13284E88B19A933BB1D7 Turgite
684,882,543 *46B65E07450CB3F45DD92480965A3B9D7DBFE2C9 turgottogrut2
684,882,544 *46B9546015A67C49D2642AA2F03E18899712DF8F turgutaslan
684,882,545 *46BFA5C3027C5517251FD504017D6AEF51CA8FC7 turialvae
684,882,546 *46B33C6E235399EA8D30E99E1285068040FADD86 turietta123
684,882,547 *46B895E14157FAF97EF8B5FEC8DF25DCFC49527B Turina:Laoraciondeltorero
684,882,548 *46BDB34FEAADDFF4EAD003D505021972B0A1481D turisttsirut0
684,882,549 *46B17A77B6398068E1DA5355A0CD589AB4EE7D07 turitordua
684,882,550 *46B20F6707A2C6947D834C0150A793DBFE23011C turiyaabdur
684,882,551 *46B323864D85120F9C9F770F6F60A7C0CCD8A3CE turk3$$
684,882,552 *46B8BC7151DB2B93360B4573ABF61AAA26672093 turkarrivalarrivistebright0
684,882,553 *46BABC3B30E771C88252B13C1F5458A4BA37572A Türkenpuppen
684,882,554 *46B9CC77335CD2983D1F64453D5BD83544337A96 turkeyezine
684,882,555 *46BCA464AF9F0C16FC265917A5558379460E9787 turkeyheliski
684,882,556 *46BEB8BFEA7A36CBC32A574780ED55BB1184B56B turkeyism0
684,882,557 *46B4A05D9BD2DEA3FE0C7F8EC07DA6E4E0331C31 turkeynavyab29
684,882,558 *46B8B7361E90702366E8DB4A1CEB4503404E66AD Turkinje7
684,882,559 *46BE26B2A962F385F34FAB76E3FAD2CEE7DCE0F4 TURKISHLOVE
684,882,560 *46B589BE08300A7634ED876527A570AA559C7F60 Türkiýe
684,882,561 *46BA038DD2F2C9EECD8FB2F0265D497A44DEC122 Turkkaan
684,882,562 *46B76C7F4F04AD1E8A18806510F0F33A670B6573 türklastest
684,882,563 *46BD2E5246DA5613C5DD6B4A858D3895AD09EC58 Turkménie»
684,882,564 *46BC80237CCE02A083191CED93FD9D25733B5D75 turkoalb3
684,882,565 *46BD7724D8EF276539B358912B15901D84FE6132 Turkomania5
684,882,566 *46B4741E8246165A4F4000B9BB5DAA0E23768319 turkophobistses
684,882,567 *46BC543DE0E674BFC866481D1DFDC1CB84B4FD41 turlupinavas
684,882,568 *46B8024D9B7DB4E24725703E9E953BCF3F035D90 TURMA8E
684,882,569 *46B096B45B4D9632E28B90311906E2178BE3E994 turmhochem4
684,882,570 *46BC0FB6F5BC408FB60B4DF7ABE9DFF98B59BF0A turmtief0
684,882,571 *46B2AC74433128019C80840A82B67EDD413D933B Turnaca
684,882,572 *46BE71B1B527E7DBB3C791AA4B7D03130F1C083D Turnages8
684,882,573 *46B0251831054F7F01EFC54B6748B7ED45843CA4 Turnara1
684,882,574 *46B31BB65676383657D3BE80346F1F6126EF2850 [email protected]
684,882,575 *46BBAE2B3EC56492A2872C11B186C61E4C152D74 turnbull231
684,882,576 *46BECB7A8BEAF893F32CD8CDF724ACD1E03661AE Turner148
684,882,577 *46BFA6E7646656812523246168DEF45D50948C8A Turn
684,882,578 *46BA87C9A0E3454AA1C75BD9E059BD3134759533 turnersville1
684,882,579 *46B67264825179EA2BAC781B63BD8C879B59F807 Turnhalls8
684,882,580 *46B451197496AD85FA552338DF191BC2DD2321AA turnicimorphae6
684,882,581 *46B526ACAA51467479E2B7AA6D5EE7CFD582F104 turnierparcours
684,882,582 *46BA0494CDE772595ACFF94F158B2FBDE109325C turnike1
684,882,583 *46B7A6D69176FC60FCAAF3C63CCFC45729F978B8 „Turning
684,882,584 *46BF1C8574D5A4FCFA62EAF7C732F54570807BC7 Turningbasin
684,882,585 *46BAFEEA86F7B2F320499297475C72940BAB64B5 turnintoengorge4
684,882,586 *46BA977B490D901A786EC26F2B707B5554680F5E Turnipn6
684,882,587 *46B4FDB196A5387F84089614EDFE77EEBD09E473 TURNIPS0
684,882,588 *46B0E24DD707EAA9882494B12EF0921A396F101A -Turn It Into Love-
684,882,589 *46B50683FAB718E64D745224C7FB7B8F60A8B223 TurnMeOn,DeadMan
684,882,590 *46BB7B3A59BE377A4B126154D7DAA3C2E82AB031 Turnquist7
684,882,591 *46BE8A770FB12E1390F7C82013461E482B91AD1E turnschuhe0
684,882,592 *46B1F87B9DA7AA08C7BB6E8142E8785D486CA4C1 Turntail3
684,882,593 *46B88B33E534E9A79764DC6581A62E101B34311F „turnus“
684,882,594 *46BA21BB08C7AEB7EC544E85D345607851B54BF1 turnveerwaffleward8
684,882,595 *46BDA5E93FAC99102091226EE0112832B38BE5F8 turomuro
684,882,596 *46B5F8ABA859C2B91CBB01DE0CB74E5AA44FC140 turoniu
684,882,597 *46B444F49ABB07C554FE77CF4A4CA1BFDD02CF8F TURONWIzVXdNakF6TURRMU1RPT0
684,882,598 *46BF28A010CE22F393431ABE1AE76B3F3E91B5A1 turopoljsko-posavski
684,882,599 *46BBE078AD1F9C7C0420639F40112A287553A771 turquoisemoneyclip
684,882,600 *46B412486B005CC4A997EFD011E09E52F808D9F1 tursach4
684,882,601 *46B67616D2A6E8B4DFAEB70A7AD9C2C7D7FD551D turskalaji
684,882,602 *46B3D5FAD232B89925DED535AF2C4514D66F740F turtle12124
684,882,603 *46B422ED7003E92D9D5ABB76091B3E5013C5D823 Turtle666
684,882,604 *46B8D0FF7CDE86E5F627208C0FAD15D1776ABF66 turtleblondes
684,882,605 *46BE3C3CCBAF70509C5C8D9DED29F50BE0C521A4 turtlebucked
684,882,606 *46B32842FF05472FDA2A67D07071DAF610A5CA92 turtlebuster0
684,882,607 *46BE8B942ECA77FDB02C0D31231DC2241AB62240 turtledollars2
684,882,608 *46BF61500827DB3DBAE36A29A6A9B2322BC5775F turtle island string quartet & modern mandolin quartet
684,882,609 *46B999B0D9C7C0E48CA0DF42654EF7873830CD39 turtlemishas
684,882,610 *46B6627F94D2766CED01D8BDD79503639F00F40C turtlemouthed8
684,882,611 *46BB6C7BCC878E29C61C628A6D82113DA713B628 turtlessssss5
684,882,612 *46BDE472A8A738C2782236E238E302AB42D6F80C turtleundead1
684,882,613 *46B1062751FBEFB544E88F9DBC35F248BC0265AD turtlevadered
684,882,614 *46B305CC9163B820C6A07E62B658B6621B6EDE4E turtureanaurelian1
684,882,615 *46B33553798327822ADF0857966956BBB1003F07 turturo8
684,882,616 *46B0762B3CD224EF089864FA36A7000BD7B8026D turudebernard
684,882,617 *46BD454031294CE670B4FECABFE9ED17A3B17475 turvajoukkojen5
684,882,618 *46B86265EB2073FB7E032D4B173497C1E1E46FE9 turvakoti5
684,882,619 *46B96C5698C8296CDAE6F950661D69250148DBC5 turvallisuusnkkohtien5
684,882,620 *46B7ACBCF7DF80ABB2F17EE122CDFAC90F05F629 turvarlhas1
684,882,621 *46B7C7AD66C5345531B7D05968862071B5884487 Turvastumine
684,882,622 *46B8EE44680DD84BDD08715EBB804A276192C691 turvatun8
684,882,623 *46B08EE1F3026D518BF690395FB3341831692D78 turvepel9
684,882,624 *46BC229D74CD42F49E68EB69F70340FBC6F71A11 Turvydom7
684,882,625 *46B3072A9C2850B5B02B78B7457225F450E7D955 turvyize1
684,882,626 *46BC99401CA9704DE1B2F1219E978622F3093F35 t)uS
684,882,627 *46B61A92C69CF0942DEB434811EEA25F909DD012 tusbergs
684,882,628 *46B12F37B078B2FBD1DFA57AFB386B268F2DA697 tuscan592
684,882,629 *46B31AB261DFAA6C0CC520A8368E5B34A3391EE9 tuscaninni
684,882,630 *46BD5A1ACC7A1797B6CCA49C9B64377929B7705F tuscanize9
684,882,631 *46B09AE534908BA597F92CB2D8FED01A80F691C5 tuscany moore
684,882,632 *46BFC160E5B2354C9376F86380D77037C57FFC67 tusen
684,882,633 *46BF70B208EDB20B1BB79A6EC9F9EA07046CF6F1 Tuseners
684,882,634 *46B6C88D541C0F776722AFA485E02D09696F8205 tushar dudam
684,882,635 *46B1BD484FE06E70432BB34C7F6D247BCABD5546 tusharhawal
684,882,636 *46B2B3B02CE803DC32B654F812A7B618BA862FAD TUSHHAARAA
684,882,637 *46B591A20C5AFC08721D7175FEA69E8DD3942CF5 tusilagos2
684,882,638 *46B3EED9FD00B06988D1ED738623A8F574313837 Tusiman3
684,882,639 *46B78A6936CD05446347119F89AE0DAFDF61869F tusindfrs
684,882,640 *46B32AADEDCACFD37ACA3D926E93A5CD8D73EA21 tuskaisen4
684,882,641 *46B41297A03B9BB6137B5603ED9E25167212B600 tusovatsa4
684,882,642 *46B61865C757B1FE7445ABD8551FC871CFC1B770 tussenkiller
684,882,643 *46B9A8B80574DB04CCB613D5887F8B6020B744C2 tussenoplossingen2
684,882,644 *46BC918DECE0E4E52070454302BE21EF64C91FDF tussenstroomtransformators
684,882,645 *46B7C1991684304539FF10B7D85A7698D9BD7FB9 tustavan1
684,882,646 *46BF12D2CCFF482DA60788DBA4E29F8DF5DE5D2E TUT725
684,882,647 *46B9261E37083E11505F5C1AA84FDB8EED1EC055 tuTaaa
684,882,648 *46B2561233019C817371B7A6CA3A9BF10D30F175 tutbrunaj
684,882,649 *46BFA7EF50E9193402310C83F6CBA2E53F8931B2 tutelastes2
684,882,650 *46B31582A906E1EE748B6397628121D1413E022C tutions9
684,882,651 *46B10D2010C997E55528C010153F8B5B9C010C86 tutirosnawati
684,882,652 *46BCA79EDBA6F0456EAFC12B66CE11867B8411F9 Tutiyaphum
684,882,653 *46BCFD43C08A5E3C033E25B42DCB991103B53A03 tutkaillaan1
684,882,654 *46B0055C178928EA1383FD25FCE35CD1EA202774 tutkimuslaitoksessaan
684,882,655 *46BFCC30779D5C35DA06CF9BFECAC7EDEBEFEC25 TUTKIMUSMENETELM
684,882,656 *46B46F48BF3C0C969CDD532FA5FA69CF6226317C tutkimusprojektit2003
684,882,657 *46B79BEFBBE08A1152D9D9940812B86FE83EBE10 tutkimustahti
684,882,658 *46B4982FB69A0067288EF33B3047263D0DD124AE tutkittas
684,882,659 *46BA40CE982FBCC4F5B87ABC4886151881F33BA6 tutlaibebsws
684,882,660 *46B41DFB98916CF7232C99E2768A2CC9D56B114D tutnjio4
684,882,661 *46BCCBC937626C65226CF740C9BC0F02755C2D2E tutola
684,882,662 *46B4454A81E40B324D83FF41A7F0A257883DDC94 tutorials-on-finding-the-law
684,882,663 *46BA260E9A5C139AF6A9A2090698345DDA0B3F28 tutoriirotuting
684,882,664 *46B46EE8D3EDB72115DEC218D8B23A598B2E8681 [email protected]
684,882,665 *46BCE50A73BB1BF3A4A87CCA4D8A6B9553B8E2D8 Tutrices!
684,882,666 *46BB688F8C85F0043D712129CDE96E41EE6672AF tuttajuks
684,882,667 *46BB30D64DB8A7FE60F2C412AAA0AB69A4DB5A6F tutti fruits
684,882,668 *46B0A337B46D999EDA97505EA6A5868473AE0A6F Tuttleq0
684,882,669 *46BBAEAC75A3717C11FB6A019CBD0C0A0DA504C7 TUTTOBICIWEB
684,882,670 *46B8DFE04FF472B48E845DFF349C8B90FC4F2BFE Tuttrů
684,882,671 *46B3C44BEE3F17F5A377B48EB854B5C58683C7CD Tutubela4
684,882,672 *46BA1C665A1CE553585587EBBF0AD703CB7B11D5 [email protected]
684,882,673 *46BDC16D769235DD4A11B68263D7A05623A6C349 tutuianu andrada
684,882,674 *46BF9EB95E937813557459AB4F02FC11EDFAF7A4 Tutunji0
684,882,675 *46BA30EC84EAAD98861FBBF353C00FB20BB36654 tutyfruity523
684,882,676 *46BA16813579374EA6951FE67D4AA81AE42432C1 Tuuache0
684,882,677 *46BAED932B42272D8427B2447E47232C01A5572E tuulia lindroos
684,882,678 *46BB5A4D07A6C6CF6985E3F5B73ECF4D407207D6 Tuuliherran
684,882,679 *46B175A97A0F4C193EB4DF5E9DEA219AE34D0B5B tuum5
684,882,680 *46BC3574A78EDE6B32A2A6315621AD0C22BBB7C9 tu'upolotu
684,882,681 *46B3769A582D3160EA0A003159FECCCA587113CB tuurile
684,882,682 *46BB20542AFBB5073D42350070DF31E5B0D1DD11 tüürmõla
684,882,683 *46B44952B73412E44E58D9624A360191E585CD54 tuusippu8
684,882,684 *46B5219B20673A185603B620E485DCC1F75D5B14 tuutilauluna
684,882,685 *46BC12C79C734A1E05AD433E856925B4DC4B607B tuvache9
684,882,686 *46BF7255D29D1DECC34479BD3DED9DC6F6FC42C9 tuvaluorig1234
684,882,687 *46B0D24D4DBE7C6B790C86C8F3639FE3A56EDB4C tuwariksing
684,882,688 *46BC7E2CF856A7B67BC403F43BC6B02F85EE4C06 [email protected]
684,882,689 *46BA25B6AEFF2479C846D5AF26AC4774E0D0AC92 [email protected]
684,882,690 *46B9263F6A1691854F373675C545134EE7474CDE tuxx crew
684,882,691 *46BFCF3E040B099785CAC0C6D9C805A2A87D79FD 'Tu~y
684,882,692 *46BD15DEDC1849DB965C7728BF5072BED7AB2732 tuysuuyn0
684,882,693 *46B52B864C783B82473F37C99E7C41B9FD084C57 tuyutica
684,882,694 *46B8D7D399BEB2E93E7EB39F8D9653586A5BB092 Tűzdeljük
684,882,695 *46B528D26736591824BBCE30CE357595A185B752 tUZI
684,882,696 *46BB0B21A60EA25A01FEB2268D5FAAB4FBEB3038 Tuzlukçu’nun
684,882,697 *46BE64A8BB5BF3551F10B0E7A3172F03680EC8EC Tűznek
684,882,698 *46B0A90DE8351091ABBA3716FCF97FF58B4A943E tuZy
684,882,699 *46B42F261213A0E998009C3C94DF7DB4EAEFCDFB tv(@
684,882,700 *46B8240E261578275E3086B7744C39AAF3676DFC TV」1月度エンディングテーマ
684,882,701 *46B2054D7AAE52545747B98F2A301EE62B0D4CE8 tv+2
684,882,702 *46B88A4D46AE962215B352AF5BBEB123C374EAA9 tv(2005年
684,882,703 *46BB634C273C09EC5E60B786F9DA20F9DF043603 [email protected]
684,882,704 *46B4230AA9D2FA43DF87FBAEDB550E2216366C3A Tv4rd0vsk
684,882,705 *46BA1221FEFA52B2831D8ED0BB57C3ABFCBD37C7 tv8B
684,882,706 *46BF37608FDC2B3621EC0F1CE1C06C05CCE2BE92 Tvaers1
684,882,707 *46B09BFB6B3DC56B536CD8B075AEF521DCB739C5 TVAGYAASISHHAM
684,882,708 *46BCFACE8ED7469695B04374E09840A66FDD4149 tvangsforflyttet8
684,882,709 *46BCA7BF0AED48E3046D9DDBA545A2A1646223F7 tvättomat
684,882,710 *46BB752F697B850C13FD5EA61149CF010F72AD7E tvb2r
684,882,711 *46B8221C05ED73F07AD6628362FCE284FBD7732C tv-bestandworstfinales
684,882,712 *46BE0D9D81B93508CFAB8644F4AE146F21A677CE [email protected]
684,882,713 *46BDC75E556EB033330DAE9E291812C9ECA83BB0 TV Control
684,882,714 *46B0A89AA90E31EBB9D07FEA35E4DE0C41670B0A tvDk
684,882,715 *46B38297E0334BDBBC09540B6354A20A35C1CE2F tvE}
684,882,716 *46B077FCACF5C1F7EAD479789E2186BD74DCAE76 tveinsde7
684,882,717 *46B72DD6A96C71865FCADB1DDB4B90420E83C6D2 TVEKAMP5
684,882,718 *46B5DD56A166FC3B1AA8B32BDDE6B4E6576040D3 tveksammast7
684,882,719 *46B194F68AC8D7398C23C56A7D2C77688EC0F044 tverissä
684,882,720 *46B735CAD066B3EB0D1D776AA49A39A4F191CEE0 tvermwhvjysfr1
684,882,721 *46B5D0D9AA89FFBE68BEE0E62E2E56DFF43BE05C Tverrml4
684,882,722 *46BBC7110D2AC44F9C4636E1E9278F4323550F79 Tvetacha5
684,882,723 *46B99BCE4FB6EE6DB40ABC14C67732A36D2B995C Tvfsbsw7
684,882,724 *46BB6CEF9BA3AB7C30F7BF93422911E62009A268 TV-FUN
684,882,725 *46BE234A432E072D13528885EB268BA4D5343B2A tvgsep
684,882,726 *46B6C407A36FCACBDB8DF08EC1C169ED08CDDB71 tvhtunnel2.svg
684,882,727 *46B9B9F2A43463101175A1C26B14DFAB6F34807F tVI9
684,882,728 *46B04E70EA6D4C62C421B5E08D42A19437509215 TVILLEN
684,882,729 *46B31CE08919309477418E2B7A9D6497AE6428D1 Tvi.ndra
684,882,730 *46B1112A50AFAD0BF3933945DDAE753967A2AD6D tvivelaktiges3
684,882,731 *46BAE4814EB76039E251894D0FFEC69D77EFF33D tvivlsspørgsmål
684,882,732 *46B50F5B20683F0105D8CED02B71B5E734311D7C tviytsij1
684,882,733 *46B6D38DB59C71D9B7501E05B5153ACC34C04A00 tvnassorg
684,882,734 *46B049708E42E80A9DE6A607E1DC69CD16EC4302 tvnewzealand
684,882,735 *46B0B6741F4F85D49DDE8BA217A5A7A9BD9ECC4A Tvnparts
684,882,736 *46B123DC00A4E77B5832D7BDB43395E37AB2795E tvntshhtht
684,882,737 *46BD47E1F0F1A48A834CE22BA058B4C6A2315027 Tvorivou8
684,882,738 *46B2A7EA7479968B327B141829AFED83FCDBB91D Tvorkova“
684,882,739 *46BC46CD3A5595F2291552294F91B095A44227CB [email protected]
684,882,740 *46B556CA843FEF810C581F028262E004CC9455C6 Tvrdimo7
684,882,741 *46B672E05415C455EAD20BEC0F88DC0C37D8744B tvref1
684,882,742 *46B6B3FD00EBB7D274F402DCF40A49D4EFDCDE00 tvrfrmt0
684,882,743 *46BB223F1ABBA441C02673244B7BB9B6C60BB898 Tvrprdktn
684,882,744 *46BD8ABAEA2DAA50DDFB005093C7ACA3489E4A72 tvrretningers4
684,882,745 *46B539B2B971669032A098228AB00D71D8D47863 TVS-E
684,882,746 *46B98B89C8AED5A4099304D3C72ABA449009CDE2 tv-stationer
684,882,747 *46B49A3FBCAC1546CFB72A47703E44511EB16369 tv-ster
684,882,748 *46B4592A5088AC6182FE074E760FBF84BBE336B1 tvT]
684,882,749 *46BE0C0EDDF693990FF9032C9734AE316FD6BDC4 Tvtgfzv9
684,882,750 *46B4200BBEEF62501CE777745AAEA403BFCDA6B6 tvtnite
684,882,751 *46BFBD8CF9CC0060C055ADA6A18E3AF30FB61A31 tvttiehing
684,882,752 *46B5136A665D52D2FCD23C54B0C79D368ED95D54 Tvttiired
684,882,753 *46B455423B4185028FCB55B361E16D4E7F93844A [email protected]
684,882,754 *46B96DF8960CAD2966F29D70AEFBDA69753B7FF0 tvw1234
684,882,755 *46B256649E7918F8AF08452FA00CE276A37C0425 tvwu
684,882,756 *46BB0D9505D35D3764E707B01041AEB175F9D692 TVXYGNEs8
684,882,757 *46B94178A03C87084AA46C80FF49C63607892A03 tvzqbb
684,882,758 *46B9F1F20ACCB619EE64F79BDF6D8544A00CD298 tv本編で戦闘に参加する事は無かったが、口から放射能を含んだ火炎を吐くという設定がある。
684,882,759 *46B0C22AED83FEC0A2C49577071FE5CA2B5E1C22 t<>W
684,882,760 *46B40DBEFA9DA86D06FE87F0B0D331E43A3FB0EC tw~)
684,882,761 *46B2C7A170814A446565075C18E6DA706D922BDA Tw0-year
684,882,762 *46B3D2E4F341DFA3C7F519517BBD893C199FD59D tw5i
684,882,763 *46BFFAC11E424B5C5556CCBB60351C430C2A475C Twaddell3
684,882,764 *46B28DA7E3E15F8A75D46262673CF7C9D52F968D Twained1
684,882,765 *46B8FE70DC5EF3281AE5C6147B815625C9E0F9D3 twana harris
684,882,766 *46B82A7A115295F09173026E980557763421C166 twandaboydmrspeachie
684,882,767 *46B16D0CE8D442F82617118F88B0036FCE9666A9 twangjewel4
684,882,768 *46B895574B617F727BC9EFF97595DA0F8114F06D T'WastheNightBeforeChristmas-Rudolph,theRed-NosedReindeer
684,882,769 *46B57D4ED08E06C9F87A44FA649C50D2230B46E9 twatled
684,882,770 *46B62ECB06FDECC52C044DF75AD09CE0026F5C79 TWB20030924S0008
684,882,771 *46B77759E127603987A605415D92AE3A71C6A517 twbbncbfqschclv4
684,882,772 *46B140324C18FC9067E7E132AF92A01B1A2D20E3 twe0022ed
684,882,773 *46B7F38041D09A2BB8F7AAA087C7D469D01E01EB tweakin3
684,882,774 *46BF5C5AFC5871DA74EA3995AB8749C91F2E3B39 tweebiekhuat
684,882,775 *46B9939E1AB73F4DDD7F7A83D7BE56B4B5027551 TWEEDJASJES
684,882,776 *46B4FC9F219B161BFFB0BEC17D0F58BE1D47FC09 tweedleds9
684,882,777 *46B429D5B4526EB2FB58F83F8CC325BE3782F67F tweekleurige3
684,882,778 *46B73B05EAE2A57369453A748384E32604395FC8 tweelaaistaalkabinetted
684,882,779 *46BD0C752E24710CD361F3490405C2D6B2432DA1 tweeluiken8
684,882,780 *46BA38C88BE892B23ECC46A2A672FAE78B2C8396 tweeness4
684,882,781 *46B47CB9E172B7E3FC463214425F19B1B08B7F69 tweeshtweesh4
684,882,782 *46B466CB79B7CCD32F210396A26159E9D3E3FDE4 Tweeslipklep
684,882,783 *46B6CA1C202B5BCC8E839E76126E5446B410AE86 tweest!
684,882,784 *46BC303AFD4922C6F360DF4E4EAB2790EB3A9CAD tweetychrissy0
684,882,785 *46B4878DCE7C05E74D54999ED57E50F8A90151BF tweetyconrad8
684,882,786 *46B5C088CFFD9376D703E5415D8213E9D512546E tweetygriffey1
684,882,787 *46B01337A6151F6AB4EB694337829D055B04F9C0 tweetykimberly5
684,882,788 *46B98374740A7E2957A2E1A513A0A09510E29720 tweetywilbur1
684,882,789 *46B8124D637983C687A4FE19FEDDD780CF40FB5F tweewegkabelexperiment5
684,882,790 *46B3032D3F887978BF8038D48025AF51F00ECD7A twelve german dances, woo 8 no. 4
684,882,791 *46B876ED1BBEF9AED6B9C41221DD175E0C2CCA20 twelveviolins
684,882,792 *46BD9048BA075F096821A471443749BBE8978CDB twenbsw4
684,882,793 *46B9D719DE482E8CBBC18D7C5CCBD3EE1E71381F twenty-flightrock
684,882,794 *46B8E57005CDDDFCB21A3625BEF9850B46E4B755 TWENTYONETEN
684,882,795 *46B0DE30032617686232822F97D2A5BC7B47778E Twentytwo5
684,882,796 *46BAB3C318E1318D2D8208300E954A8520C74A21 Twenty-Two Days
684,882,797 *46B4FC27BD9868EF4CDDF2286E7A3315D3014D3E twfhvsmanN
684,882,798 *46B9FCA7E9A4C2E2AA1C2027EDC4B4873905AD38 [email protected]
684,882,799 *46B74E141AF19BF28BE7D96BEF67019395E2B11B [email protected]
684,882,800 *46BC0C2FD2F24642CAA3922A22A626E7DFACD3E2 [email protected]
684,882,801 *46B685235BBB34DD93A8476322A7A1AE1FA506E0 TwIa
684,882,802 *46BD35F774B22F8560B959635206CAD8DDED72C1 Twibilled6
684,882,803 *46B60A6879482F72334DEF42939E4B969F64FEFE twicecommenced6
684,882,804 *46B781D5598123842E718672D2035C30EBB1B3D1 twicehining
684,882,805 *46BB10BC694399A2A8F222161A61B21E2915C3AB TWICEREIMBUR
684,882,806 *46B2A3C30CA6EAFD62BC68E545CB6BB0791148FF twicethree
684,882,807 *46B91BE19629A2A246CCA4B91282E39A405989E4 twiceworn1234
684,882,808 *46BECE98880DE9CF7BB31A434DFA6D9250FEF8C0 Twichell0
684,882,809 *46B4EFE0BF831EF1F52F2BF5BFADB348C8E13FC9 twiezijdeg
684,882,810 *46B11B289CC74FE1F8D584292DA3A9F09589D1B0 twiggie nozzle
684,882,811 *46B0667E6F18A7735B896C29200873DBF807ED52 twiittejä
684,882,812 *46B8B9B094FEA4D691FA264D85DE2B943083D69E twijgen8
684,882,813 *46B5A3C66A6DB6441AD5730FC64A857C794FB169 twila emmert
684,882,814 *46B683991BD99E4AE6E7A51577097AE2A4E48C4A twilight rag
684,882,815 *46BE2F05496CDFA4F83C95A16329015AC58F8B41 twilighttinctureds
684,882,816 *46B76310E4ED49A2BC7ED879C6A6E9E1C90E4153 'twill be sore law
684,882,817 *46BA22496B1C6C6338C45C793940EE63FA564DC0 [email protected]
684,882,818 *46B84194DF75D1B7522BCDF97B2AEA9FE1F1FE52 twillying
684,882,819 *46B3E3A7DC1DC009DF9DFC980933391CF8644D1E twinexpress2
684,882,820 *46BD53604684CD78620335F7A4896C664216E305 twinfir3
684,882,821 *46B411944054E6883F705F478EAD10C5072746A2 [email protected]
684,882,822 *46BD84EB419B74884FCE2C30F59F9E13982AC6BB twingo64
684,882,823 *46B113D4668E0ADD27AEE59CDAE2CC3814000C5C twinkle agam
684,882,824 *46B4336E5B9F7FE809B969BD007B1C975A6DB1FC twinklegidwani
684,882,825 *46BE25D6AAF3666788B0603CE0BDEA1F7F2FA540 [email protected]
684,882,826 *46BF079D63191788AF3357CF5BF015321EF07333 twinlawrence
684,882,827 *46B07BF02854BFB5306D9367F43109F75EAC8C91 twinleaved5
684,882,828 *46BDA1A418A0AFBD9C2F882BE2517A389FEED216 Twinsalicia
684,882,829 *46B1EA05E82BF2E2AC0A6848A054A0F1BC489E20 twinschipper1
684,882,830 *46BEA7907FD8226802A3B43E57FE87C6B53F0643 twinseugenes
684,882,831 *46B7EB79ECED7228F03CE75C9F7656C8DF41F0E8 twinsforested
684,882,832 *46B93B7F1D128C4097A2422270A3A2D502528B7D twinshomer2
684,882,833 *46B5EAB1F8BA0C383ECD0D6C9C123D0B4B7A8C25 twinsjimbo5
684,882,834 *46B5F70036A78F43E2B99B017A5F6476A3643BD5 twinsjonathan2
684,882,835 *46BEA1538E38D53901188D5E7D5C83A828974A47 twinsoatmeal5
684,882,836 *46B52C04F07564242EF15E6454C1A1CF64D2CE9E twinspsalms8
684,882,837 *46BBE02DEB36D39E45AE9452CDF52DDD6AF298E3 TWINSRATRIP
684,882,838 *46B36683FAF46DF7F39FD13AE3EE67C7A35A3405 twinssports3
684,882,839 *46B6A0CD531D76FA8DA579727577038858F2F602 twinsstrat6
684,882,840 *46B7F9107E361B7C275B248526517D9B96ED3210 twinstacobelling
684,882,841 *46BCBAF1C52B8DAFA6E0B95223F43A9EFE96CA9D TWINSTISHBITE
684,882,842 *46B19C8F88067A3A81DB29117D02063B8C255D0B TWINTIGJESES
684,882,843 *46BA2D9534A514DED09A7184FEC170CCE7CADCB6 twintigtallen0
684,882,844 *46B81D39F1A1A274C50ED5EAF844DCADF2D998CD TWINZERのアルバム
684,882,845 *46B0BC47090F7452149E5977AE913704CFC52CDB twirleighsjewels
684,882,846 *46BF2D8145C9551CA9DE3FB0AF886512873305F9 TWIRLERONE
684,882,847 *46BBDBB1777D3A929E8908D1D7BE2C7AAA2FD7D5 [email protected]
684,882,848 *46BCE59357BBB920D5384917FCD8B0CC8D102465 twistedxxkitten
684,882,849 *46B785F471ACDC13F793C29DCDA50EE462385117 twizasimpungwe
684,882,850 *46B9BE6F67553907812CE47596E9CAA6FFA17785 Twjflgvl1
684,882,851 *46B268EEE902BBA9F574ED748D088A80DF72A11A twjq384
684,882,852 *46B8320ED408274149B56E44A1CEC61C225BD9EF tw!k
684,882,853 *46B225CE770991DFCBDB8DB8B2D9FBD256C08728 twkaakwking
684,882,854 *46B5BF96A1C071F0C9FE8B2414512CD0CF5171C4 twliahpleasant
684,882,855 *46B9B1F1ECC89EEABE23DBE65E248ADBB8DBB74E [email protected]
684,882,856 *46BE39915962B6E96FCD0919912E9DA7AE91BDF2 twng135t
684,882,857 *46BCD90ADDAB463E8002713BD950F890C20B233F two billion
684,882,858 *46BACF20917D9A1277B157A3FB58CD7AB938AFED twobrothersmovie.netwww
684,882,859 *46B85986ACFC09E8B07F84C092EC727443840540 twocolora5
684,882,860 *46BBFF9D92274416CAFC862154D5D7A4FDF4BC82 two coronation anthems: zadok the priest
684,882,861 *46B516F2BBC0F7804ECFD0607E32220D7907D012 twodogz:cheep69
684,882,862 *46B5C797CAC0D77A1B565289A4889E70A35BCDD0 TWODOZENLASHES
684,882,863 *46B3AEEBA75889CBB83E002186F15480B0430D17 Twofaceds
684,882,864 *46B503B20FE9D0582594203B48FE19CEEF7BABAB twofornine2
684,882,865 *46B31C0FDD899BB622BAAB6A47C00818C9197DF6 TwoGirls(feat.DougSahm)
684,882,866 *46B3EBA816C1562DBECA904479CA2C645573C14C twoguine6
684,882,867 *46B7EF5449EB2B5DF31CD0338F488A69F404CF01 twohandedly0
684,882,868 *46B9735EEAEF0663FC3125BF8BF8A0BA86DA8454 Twohearts(Jive)
684,882,869 *46BA193DAEA0C5ACA25E5188EF75153BAC03ED1D Two Hebrew Songs, Op. 39 No. 2: May
684,882,870 *46B4D516158359C1DC8B0AC7B4FE4FD2ADC0D2F9 twoibak
684,882,871 *46BE9F3A2C3DF2AC911BA5047A6FCDB5ECC918CE twojastara7
684,882,872 *46B390777277DDF10CC2886D213C1FCB7A1E712A twolocation5
684,882,873 *46B96D3B01D5CFFADA47525C87A37726222617CB Two Months Off (original mix)
684,882,874 *46B955E5ED34194D12E5CE584BFDD240A24277CB twood:the
684,882,875 *46BAB9BBAEBFB766D0A34864957B69C459114DB3 twoowt00
684,882,876 *46BFCC39FA1A9B33335A16C9E6F852E6553800AD twoperso7
684,882,877 *46BA594393A057F3E890502DDF8A0BE7D9D2D617 Two-phased
684,882,878 *46B37DE80127C47AA39D0BBDF191A8D2F62DE7C0 TwoScreams(female)
684,882,879 *46B47C1F9F2AE859D998D53B35668773A44FB614 twoseededing
684,882,880 *46B6C9A5F9F4163015228309BA621DF67A422D99 TWOSQUIRTS
684,882,881 *46B38D22F8A9354B31E4594820F132B5FDD65E80 Twotank2
684,882,882 *46BEA7CBAA619036F75E279AD96D6552BF7CB124 Two Timin' Womas
684,882,883 *46B4CA48B62EF9E77152B3CB9FDC464153B53CB0 two-twins-two-dads-dna-test-proves-twins-born-to-different-fathers
684,882,884 *46BA611155D4C6718DF8580DC826E9A096FFF4C6 twowithouthats1234
684,882,885 *46B61CB3C8211211EAAE5AF0083CCC2C0E53AD58 twowrites
684,882,886 *46B202F59C194645481D5EE31FD7286F53A7CEE1 [email protected],[email protected]
684,882,887 *46B1BDD59E1FC8ED7328152A42DE00C0559CF4F8 twrinoys9
684,882,888 *46B5BD406BBAB133711038CCE494FAE3554C3D98 twt1537
684,882,889 *46BB554C83AE240B2C595FEB3CE77A64FEC63517 TWYKE1
684,882,890 *46BD8DA172D227FB07D2D2B2D49FA5B9269B4724 twylah kohout
684,882,891 *46B1306D60E413B7E787069322C7BB61F63ED919 twyoming4
684,882,892 *46B551BB51B3471AFBA824A8F604D5635CB0B960 t!>x
684,882,893 *46B32947DC85192E1E05AB2E1C0344A2170B9B76 t$>x
684,882,894 *46B201BBB2F150A6396E1932E96F1D2F2C2F079C tx/(
684,882,895 *46BAD5E0AD5A2154100BCD37FC65A282DA1DCF1F TX6347
684,882,896 *46B7E9997668FE852D7DCB4EAAC3AE607CCD023C txa:
684,882,897 *46BC94E62A005D56D05D9FEA4FF1E6902C8D5B20 txboth
684,882,898 *46B35445C3C66157839432A229E08433605D74A3 [email protected]
684,882,899 *46BFC7A8ADD30812AE13EB4026EFA1746E7E6629 t*xD
684,882,900 *46B4B0EC5823FABEB4DB8B541A28BB0384AFE109 txd008123168
684,882,901 *46B725BBFFEF4AC8DED69321B74419EA40793FAE TXDOTHouston1
684,882,902 *46BECFF3E11A32E13B33C6894DDBAA83995987F0 tXdt
684,882,903 *46B694534E1682AB38C058579AFFC903360C7565 tX*F
684,882,904 *46B42D3E2B9FB80B1AF9AB9E671293821BFCC3D6 t~xg
684,882,905 *46B56BBF187DC6E9B46493E2DD92963FFF2C6F13 [email protected]
684,882,906 *46B3373C593E143D81CDB3C43D2C2E4F42B6B3D2 txh#
684,882,907 *46B2F50C2D2E53C25F5B3453B6CCECCB4997E0FD txhygoimrwqc6
684,882,908 *46BEC144B26A63BD8C4854549CF3D80978D63F6D [email protected]
684,882,909 *46BF99E4DC24962652323F4926A4DD92E250DF08 txhyzebodxing
684,882,910 *46B285D40AF7A94C2FA66C36E1E0A7DEFB8507FC t]xi
684,882,911 *46BB9D183CF94D40DD9E430D60BB93FE53C225BB TXILLAUT
684,882,912 *46B302D3833B64721DEBB2EF348E933D4DD1685A txinatarrena
684,882,913 *46B5497EE6DE7BE17EFFF0216DF6592221690DE0 txLt
684,882,914 *46BF56F002F681C0C2EF0A05FD5F4D16E64C82D8 txmap-doton-deweyville
684,882,915 *46BA1D0EB4F7F10D97904BD8241730BFF0F52396 [email protected]
684,882,916 *46B6071DCF893506FA5C1B59939DEC420A36A883 TXNRKRIRXRM
684,882,917 *46B367CA997D2C3882D287C3E46A8E72FF23F53C [email protected]
684,882,918 *46B8CC982513E22227C9C1AEEF985885D22A8238 tXQ`
684,882,919 *46B588C50D3F355D5E091E97CFC91A79AE49D04E t/xr
684,882,920 *46BA29842D935D6BEC26B6AD0E1347859C164BE5 TXSTATE11
684,882,921 *46BEB95AB9E98CF66769A62CC814D3353E834BDD txt6cn
684,882,922 *46B5544CDF89800CD9BF10E30A627F69B022529C Txurdinaga
684,882,923 *46B27222F4B26B5660B1127DE77E77BA7C7FDE3E Txurrumuski
684,882,924 *46B5DBFB0C92B56780598E794F93CA6062055F84 [email protected]
684,882,925 *46B3747380901EEA5042519B64F5F591EDEF58DD txy tang
684,882,926 *46B9D2B4AC2362DFEECF2B784DC5A90BCCF66D6F txywgzz4
684,882,927 *46B94723E1BF5E6A3EAA6255F7E5394B03570E52 ty198
684,882,928 *46B36E06A8FC391E9385D2F516242D65FBCDDD3F TY65
684,882,929 *46BBED3C67F7C0D9BEE33C3DB79D29DB97556847 TY6FGH
684,882,930 *46B0825D3A08797F355F76B64480870E59A72F7F t|Ya
684,882,931 *46B9B3FF6625F7E342C971EA479BCD907A3DACB5 TYA3PR8
684,882,932 *46B0BB6A4E3EB6E9347F634FFB8CBDD732C7F21D tyagiboy09876
684,882,933 *46B259D5ACC06860D20142349843EC2B22723D3E tyagne
684,882,934 *46BEEBE9233197A48424D2FC9AF36C557EA367A6 tyaikaning
684,882,935 *46B3447C506E2FE0330F0481455DBA1A1502E5A8 ty.aldaco
684,882,936 *46B6D1680B7BCA26C6A3A21A52446A81C42097F2 [email protected]
684,882,937 *46BE20BFB1AF6E441B350A667545916CF1968EA7 tyamesheia young
684,882,938 *46BC3109F51D06A65C028DC4A59E1056D93B1986 tyannagibson
684,882,939 *46B927F299E9725D84ABB0DC5477F86004880317 tyanna nicole turner
684,882,940 *46B3D24C7CC4BB5AA207C256F8B90839D7954287 ty.argubright
684,882,941 *46BACD8AED8DFAD90955FA120DB3B37C8A269A31 ty.arzabala
684,882,942 *46BC06A252907D0F685DD6DFAF7CCA5B10CBBB82 tyatiut
684,882,943 *46B37720B61EFAD711754759F8C48C6E61743E29 [email protected]
684,882,944 *46B6616A06DEE786CE70A809FC23FD86025A5868 ty.bachmann
684,882,945 *46B5BCBE7725ED62A7625751C769A24D00B5659C ty.barcello
684,882,946 *46B270A8AEEFFBCB15F8B40A90DDEC4C9D8D2F2F ty bibeau
684,882,947 *46B39D27BA6B9B94D18F6D79ECB0A1902B674C30 ty.billingsley
684,882,948 *46BAC19DE7EC1517665DF695C2257C3CC76BD531 [email protected]
684,882,949 *46B141C75D50ECEF5C9177ED74AE6B753FE79BCB tybunnjlbnuig5
684,882,950 *46B6F3E4A0645F6C6AC78D5F4B8E2CEE052FE3EC ty.chesmore
684,882,951 *46B840A9B5C73EB35E4E745F36B05407D5748725 ty.cliburn
684,882,952 *46BFD4C8561D51D35EC7193A75E53A21AA1CC99C tycnemic9
684,882,953 *46BB4F7F5218533C7AAFEDA31BB73A128DF8FE19 ty.cochron
684,882,954 *46B6766CADDE2900140C2B4F489E92A28F724E2C TYCOONA
684,882,955 *46B94F09702C1BB8E72790C8D7C981F710A0D168 tycoonalranga
684,882,956 *46BA4A1BCF642827B019CC0D4B2B1CDD8C1485F8 tycos delaney
684,882,957 *46B4CE62A18308025A5A40C2128BF7CE4315B9BD tydeliggrelsen5
684,882,958 *46BEA0EEC183072EBC48002E1805D7950D394C2C tydellisesti5
684,882,959 *46B2BE2D3796417E5934629B4F4F5A2422AB980A tyDX
684,882,960 *46B2BDC75460FAD9A43B4E6A9E1DD6F414C9A440 ty.edgin
684,882,961 *46B710748A22FA7BBBB770A84EFB2015E03904DC tyeehiedeman
684,882,962 *46B45AE15ACF442D4E492A8102D7D4D6316D54B4 Ty|ehtosopimus
684,882,963 *46B2332A27EC15CF65B8AE4D2157FAFC43B9E131 ty.ellout
684,882,964 *46BC26CE20DA3344C00F1A11BB657F32E1FBD2AF tye walden
684,882,965 *46B043F79A86CAF4B7F3CF9577F199FBE606475C tYfEVty
684,882,966 *46B131476D1A405C962F566978476C2A82D7ED9F tyfuulyp70
684,882,967 *46BBDE992A05E48B5531EBB91C5D0B95AA6B3956 t<yG
684,882,968 *46B0C42761E042ABDFA7D30A78F91C50E421B8F9 ty.gaskamp
684,882,969 *46BCC721C5AD0786B3ECF991D6FED5501F1428C7 tygerstorm10
684,882,970 *46BA021F5E784D9BDF39DC11CD140B6AD1B82C05 tygřím
684,882,971 *46B7AF52A887B2BE4B9F96464DC1EBF8742F6499 ty.guenison
684,882,972 *46B5FD3D829C30AFD466189B28EB24DA4205A3D4 ty.heck
684,882,973 *46B5A4097BCDC299F2F86131EC62E4C7B0489491 TYHJ{K{YNNILL{
684,882,974 *46B15D09957E787F4A216122209964436DB114F1 tYHn
684,882,975 *46B3FE23EC84909D604B670FEFF7485615949241 [email protected]
684,882,976 *46BC7AC09AC2939FF99CCE4A4CF4E9B480DFDCE2 ty.jagoe
684,882,977 *46B4765E81CA23023CEC99055B461A02FE2B8455 Tykaestyi
684,882,978 *46BFE05F481C710DB32C2A3D51AD80ED3068AC3E tykajicimu5
684,882,979 *46BA794D0F2ADCFA4D09609C6BE9CAD22C0A9ED9 tykeziaed
684,882,980 *46B5710987B3F7E380DE88CF78CDABA2DF99B159 tykistoerykmentistae9
684,882,981 *46B5837911DEF8857004C015E4062CA91CCA462F tyk$k4lle
684,882,982 *46BFECAA31245A347C9C3C365C1F5A00E72B4B6A tykkaeaeminen3
684,882,983 *46B72938004CAE10CDCB6B8434B732C45CD0E68C tykkyl
684,882,984 *46B7D50B4458EB3F43946E28D5D213D093E4B88F tykpandede7
684,882,985 *46B05E9803D9F2557D1E82CE70D0ABC60BD0ABD6 tylamine9
684,882,986 *46B39251F4F82700AB1D77BD7BC92E5D2C99687F ty.lamonica
684,882,987 *46B654140E5D36992AF2F68272FB87B7EEB0DA06 ty.landreville
684,882,988 *46BEA0105A22F9962A7D904E77B4844D525F8DDB TYLER0408
684,882,989 *46B72CD41BB06C08A085BF918FFD3E96B5584AF2 TYLER327
684,882,990 *46BA4A2DE27110A454181860D1B53C92C670FE0E tyler abuelhawa
684,882,991 *46BFB98BD6BC1AF222D9C8F3225C29D27CC1C258 tyleradrian5
684,882,992 *46B1E4E537D6F23247FEC09F914A10642E4D5D0C tyler.andruszkiewic
684,882,993 *46B447E1D20035BA30375A380EDE5F488CF3BCD5 tyler.aplin
684,882,994 *46BA138A3EDF32F8DEBDB14BA170B8AF2A2037A8 tyler appadu
684,882,995 *46B11981C08185811256DDD31D4C1DE5F115B4FB tyler.belson
684,882,996 *46B67BBFFE90D60B746A8FF86F03184AAEC7250E tyler bennawit
684,882,997 *46B9A2462B72984871589E23E01F190C4156628B tylerbertolasio
684,882,998 *46BAE04CA288F869B56CECF0E6969D4F6BC46ECF tyler bodell
684,882,999 *46BE515E6DA5A9F87CDBC0E4EEC5E2B897A1FDB1 tyler.chiesa
684,883,000 *46BF9644AFA3E501D60AA0D31967E1F49E4DEF5A tylerczar
684,883,001 *46B18CF6CAB7D7AB1DBCCFC85E5FCFCCFD0DB6DF tyler darlage
684,883,002 *46B5D45264F21D3D78E3763C8E8C7E09C5EED074 tyler debarros
684,883,003 *46BCC852D7D14B6E43FED10F6B732275B8511182 tylerdinwoodie
684,883,004 *46B1226F4E853D343EC521050F4F5A6207AD4B0B tylerdowdie
684,883,005 *46B29F70BEFCB9CABFD8FCB1DBE3A360246C7B58 tyler.fata
684,883,006 *46B04E0A0462AA869C7B38ABF9A249A517BC1D92 tyler feeley
684,883,007 *46BEE479F2BB0EA72494B19B3EC96B44A546A2BD tylerfranc
684,883,008 *46BC98202EB9CDD6461AF27B7631AC2D55143590 tylergobaco
684,883,009 *46BD747664F48FAC6D6300580684BC4BE19DBA44 tyler grady
684,883,010 *46BB01777F1512F93D0A0B82657C09D53AC281FD Tylergraphic
684,883,011 *46BD6B983AFF208E583010EC88FE3FEDE60544D5 tyler hagwood
684,883,012 *46B17FBB20C14FEE0BCC0C53744B32E2622AA51A tyler haycraft
684,883,013 *46B7E415239DF8A6167B76B42EE2F734DF17AA64 tyler.heiderman
684,883,014 *46B850FA626CAA23DC89F7A00CDC667797829B5D tyler.hotaki
684,883,015 *46B55FECC75ED27DA44E69D01160F7910F54BE0E tylerhupman
684,883,016 *46B18A21FEEED0950D9F6CE9D020298B315E08D3 tyler james brandt
684,883,017 *46B48E6A522B17CB286E3F8A9585AD333A446CCE tyler joel marshall
684,883,018 *46BD2A4CD39BC4B3AABF1EFC06F3747395806019 tylerlamont
684,883,019 *46BC25C37F39F29619ED7ED93312BB61137ACE39 tylerleath
684,883,020 *46B33A65E8106D88E2D276C7C99DDC79DDCC3D71 tylerlenox
684,883,021 *46BD7A44252F8FF5686173EF25161B0E398B2028 tyler lippard
684,883,022 *46B0E583D4E662D87C3D640EB9FDAAB0D0E86307 tylermaddock
684,883,023 *46B38E32CE737A9003A0A670066C4CCEEA9E8255 tylermclendon
684,883,024 *46B0884CB7A64DC4F3AF794504B8D76AC9C8018F tylermedicaling
684,883,025 *46B6C0EB32272F9CE8C2D752A20951B1713761E8 tylermemphis1
684,883,026 *46BB7E44C28842A269E2C237B94D672767D54F3E tylernarducci
684,883,027 *46B75FC6655238B9ABB3DEE8D2B8DF2946C28613 tyler.neid
684,883,028 *46B147E6454BABEED4EF753EC2FF11B1B2962EA9 tylernield
684,883,029 *46B6307504E0A599E011348562B1280FDBABB6B2 tyler.peterka
684,883,030 *46B404D2464EFC01E7147EF4E26C8285FAD795B0 tylerpurtlebaugh
684,883,031 *46B4E76928F34C35D82F3F3F8850F94756EBCDA6 tyler reny
684,883,032 *46B706E6CF36B5EFF11AA7EE2F50CB0EA42261C1 tyler.rosiek
684,883,033 *46BD92BD467A1A9A8C5607496AD22EA7F25EB2B6 tyler r rudolph
684,883,034 *46B86056DAE5A90D08603C8A26D9E85166EA61EC tyler.sagen
684,883,035 *46B2B8E5C5825DD9929AB371866EF11AE0B45467 tyler sarveno
684,883,036 *46B9AFA5F49E738A50C6ECBD655801032B87C802 tyler sophia dyson
684,883,037 *46B5628C88DFB45C923EB60D9D302247A9EF014D tyler sorum
684,883,038 *46BFF792A5D57FC2F428EF0DBA897B44B3E38534 tyler sounsiva hawkins
684,883,039 *46BE4DE640B28E6BD4DB3893075EFB368F3CF308 tylerteddy2
684,883,040 *46BC6311ABCC9A300FCD42C57AA75C85CBDDEB7C tyler.theodoropoulo
684,883,041 *46B94F758724149EB2D1D3BACB5B27DC3F554901 tyler todesco
684,883,042 *46BF3407973D456C61190E019690EED6DD0030B5 tylervandament
684,883,043 *46B40AE8862F721B36FFC093392B65F3ED6C7736 tyler vonhandorf
684,883,044 *46BAD2A037E622096CBE307AF45168AAF302D32C tyler weates
684,883,045 *46BEE1975713A300A88C8FDB1500512DB6CFEE3A tyler.yon
684,883,046 *46B7C4294D082477D404C7271237FEF0FAB8A11A tylerzieser
684,883,047 *46B625BAECA951FCF65327365B45A33AF35EA4EE tyler zmina
684,883,048 *46B652AEE803C5F172ACB41D25FC16FFF54CCDAF ty.leske
684,883,049 *46BAADC507FF7EF6CA91AF99665A6A22B5B52788 ty.linley
684,883,050 *46BFE9669CDBC5027DD460F7CCFEE4823DF15A19 tyliskan9
684,883,051 *46BE942F3040457C20469E18160A7739FAF6A16D Tylkoooo0
684,883,052 *46BADFE5BD0B4174752961B79A96C9C6FF959FAD tylor gruchy
684,883,053 *46B31C3B3E71BF1E229E0D85FB3539262709B74A ty.magliacane
684,883,054 *46B6FF7CEAC2BA2708BB1DEDC7DD58896E7C97B3 tymainestrickland
684,883,055 *46B00BD1BCB483FE44AAA0DB970B7CC6EBABC631 tymatkaliikenne
684,883,056 *46B4F5761F552B148BD4BC01A7AACAD32FAA47C9 tymatkalta
684,883,057 *46B31C39B88D2D404A563CB1D5BA5DA0F9B1A9C9 [email protected]
684,883,058 *46B8C096927A84C374370FF816AF5929F4E128EE tymerial4
684,883,059 *46BE1915513194E548DE454D2D23DA4E5B9FCDB1 Tymickla1
684,883,060 *46B341EE969BD17A7A96EF583715554C3E7999BB tympaned5
684,883,061 *46B20E116F7165D2BFED0859D62D06D92EA82F39 Tympanies?
684,883,062 *46B15DB4851C029442CB0C6160CC3B4CAF07452B tymserve1234
684,883,063 *46BCDF7789B942ABC851764093A80CBAEB993F65 tymtombar
684,883,064 *46B6B080F9F886E612EB85BCA6692A727169B782 tyn353r4p1d
684,883,065 *46B1B9DC98F12D754C51EED07B934178AF839796 tynantajiensas
684,883,066 *46BE4CE2BE574BE96E251B53F31A489B5CD66E0F tynatauras1212
684,883,067 *46B854942893B978B188D34B1877C70F121B89A2 tyndh
684,883,068 *46B3855A56B4F3ACEEA0D8A2199B285910DD88F5 tynewdd7
684,883,069 *46B7BF3FB23E71EE2EB0F30728627595FB33154F tynie murrell
684,883,070 *46B04FB628163F6BE9B7BBDFC0A3517BB099FCF9 tynkynge5
684,883,071 *46B6F2F120E687CBA8DF1275755569F59617AF75 tynnjlyhed
684,883,072 *46B32F7768343D4A07A331E12B79737A5F02DA9A Tynnllts
684,883,073 *46B2C776F42856FC8DE066ED62AC3E204B0C8BB3 tynopett2
684,883,074 *46B179BAFB238C73E049367975CAA47A88B33097 tynttims5
684,883,075 *46BD2AE19662108F9ECFE650C21107B639A2D75C tynytyeatsire
684,883,076 *46B1C2B942FE9AB2EF11E002862C29E1ECE09A3D tyoeikaeisen6
684,883,077 *46B44E63D0B88B09437C2CD2FA599647C79EEDAB tyoeintO
684,883,078 *46B1AF2BB2D5D2EE028260F45EC06C29CD12B45E tyoemarkkinakarriaea0
684,883,079 *46BC844936D202E20BE5E50D7886BB3907A58BA0 tyoenjohtajan5
684,883,080 *46BD05442999758D2765223B72B8428D44987B84 tyoesuoritustaan7
684,883,081 *46B5FD488691B521D729A32CF54A3D8517A4509A tyoettoemyyskortistoja5
684,883,082 *46BE6BEEE7B1E724BCD0D6B245B4801B08873EEA tyoevaeenpuolue0
684,883,083 *46B2F048EC629E708067CD7B877ED64A2D9C927F työhygieeninen
684,883,084 *46B7722CB6FC49C9128D493421FD52C6790D7B89 työnkuvaltaan
684,883,085 *46B9E14D5ED92C32D1D70332CF0F99333530631C typaikkaruoan5
684,883,086 *46BE34DA5BBA3F47C746817723D9327716D49A1B ty.pajak
684,883,087 *46BE431FF162DFC9E48A11C2A736F1C262735D75 Typanosomatidae
684,883,088 *46B6DE81B966BBEF6545C73102932F4ADC08DC71 TYPARCHI
684,883,089 *46BE92AFAEB3A31A56C0ECDE647037598A974C92 Type(A)Type(B)FunctionResult
684,883,090 *46B90008E39C0C21ABD9A6E6C3255A2AEA1252D6 Typecnt3
684,883,091 *46B905DAF78C32D004678D3760C4DAE072C3BA9B typedfei
684,883,092 *46B9C494CFA6941114D93F7AC0E2EBF02C65420F typeding9
684,883,093 *46B2B8732BC5EAAB9FA61AF42E66BF76596A4668 typeenhed7
684,883,094 *46B6CF8B9547726783B6698A253EEF88B0579870 TYPEERDE1
684,883,095 *46B2DEC92D4E9FFD0EC028752C7F969946321775 typeitding
684,883,096 *46B98797D7A4AFE6C36D05890167F465BFAAE76D TYPEMACHINES
684,883,097 *46B06F63D4BD7D60F86CA7AFBE39B691520F4D2E TYPEOUVRAGESEN
684,883,098 *46BF548FC996AA77A305EE992A21B96E60C2C3FD ty.petitto
684,883,099 *46B6EBA5DE55AA62D2631F8293124FFD0183626C TYPH0N5
684,883,100 *46BB1030C97E587EB6050B15FBD21BFB80B873DC TYPHUSKRANKEER
684,883,101 *46BDC0C4033099FA79FC1395B4D186B314C46878 typhuskrankening
684,883,102 *46B37E75D3B0854A116A64853957F23C5CE711EB Typiest?
684,883,103 *46BB11BA81463B4BBD678B778C827BC36BD82A6D typifyspecimening
684,883,104 *46B05B6F0B22232D09E82E19B608F3478064176C typivnn
684,883,105 *46BF409DA7C9B5F9151CD39A9E17A0833F43D61D TYPOGRAPHICAL0
684,883,106 *46BD55AD6AAAD44BE222A91EE1B7245A6A502F3F typoradiographied
684,883,107 *46BBA3091D8D5DDD60BC8C525F5B8DE23A2AD215 typos0801128a
684,883,108 *46BD2619CB101329CC6EC46C286C7C47AEB0BB33 typpikaa9
684,883,109 *46B70AA93C5CA461AE4720D7B4D0140C0D0B22DF ty.provencher
684,883,110 *46B4D8B3CE2B29B9D35B4CD4234A9274D36679B7 Typtoes6
684,883,111 *46BC8C1375850FCF56516A980B50AB3342DFE059 typwrtd9
684,883,112 *46B604783090C2E864599A61F8B8372699A6D863 tyra123456
684,883,113 *46BDF9A3C3A64AF472BE937BB3D1FAC5A923952F tyra cappo
684,883,114 *46BFE3E2749628FB5C227B88234483619808B5CA Tyrakowskiego
684,883,115 *46B9AF2CF0D679EC57E9328DE5BD3706EBCC6723 tyranishajaneau
684,883,116 *46BC39A5BF49A2BF0EE51D92DF5CC4B97B1E2358 tyrannorangers
684,883,117 *46B63114ECBCF5CC296F6BF807DCC0DF488F5DF4 tyrantsh0
684,883,118 *46B178D5E4D34D216A0A264767C48BB7506738F5 TYRECE3
684,883,119 *46B578EC768BED35B590781B5A46E171A04CA431 tyree.agresti
684,883,120 *46B19F6F38558607E331148D43633FB4D2CA37E5 tyree.baranovic
684,883,121 *46B4B84BBD1E866C68B61C4F0D50192654A761AA tyree.barientos
684,883,122 *46B953A2452C9AC236785B5D10B24EA9F69F9AA9 tyree.buerge
684,883,123 *46B6C1C5B342D3380BEE770DAB9BD2E00B31B3E6 tyree.emmons
684,883,124 *46BE69D92698E34A31F1BBA6152F9A7FCF8A6925 tyree.gade
684,883,125 *46BE34D3C3D5A968D649CB603FDC6BC6168ACDAA tyree.gloston
684,883,126 *46B10E849B8FCE843AC5F3005E812C66319BDE99 tyree.hetherman
684,883,127 *46B59C0B8563C0DCBB8930735BEC87116D44480A tyree.littlepage
684,883,128 *46BC3E1E2C38FF2FB6B9D84BC6823293E820E17B tyree.mcclune
684,883,129 *46B83FCEB0A4073A23DD5E5CEE7CA37B607D7439 tyree.mederios
684,883,130 *46BA61C8CECD5D8193F96FE096A52A9DBA33DBEF tyree.mehaffy
684,883,131 *46BAFD46C40AAE0E18C86BD168A338FB8CEA18CE tyree.piccoli
684,883,132 *46B12993595E444A36463B4C06F91FEC77D13618 tyree.pineault
684,883,133 *46BF062BFBD4FA7F7D9D52ECB97E54067DF3EDD4 tyree.rich
684,883,134 *46B4F825DF004792BE9CD3D2D77806A4285C404D tyree.roulston
684,883,135 *46B0FECB23F03B04AE1348293DC6C2E93FE96057 tyree.siglin
684,883,136 *46B81FD6453930B6740252A1A156E01A183CAFFF tyree.silevinac
684,883,137 *46BAAA753FFB6BEE520479F6F2D7B8B9848A2C48 tyree.tredo
684,883,138 *46B0FE56340AE282731C383A24AFDB80511CE577 tyreetyr0
684,883,139 *46B701DEC12F00DFC1584A6E2AD37EA139C64ED8 tyree.whitrock
684,883,140 *46BAB05841A31F103C25FD286086A25C07A61531 tyree.wiesman
684,883,141 *46B4B28C335981DEC4F93F51C2DE77C3D27C04F9 tyree.yeske
684,883,142 *46B399773ADDDD3567554E2A84A079E04D52BDCB tyrell.amaya
684,883,143 *46B5737A1A3645A049D3069CFCE295FDB3CEAD41 tyrell.ayre
684,883,144 *46BF96F45DFAA503D345BF80AB4E58B436074AC3 tyrellbroughton
684,883,145 *46BBAF92F36022C2FBEAA0753E9F536084D2EAB9 tyrell.damian
684,883,146 *46B95F407E7EB413E6D58884098F8C85FC37D271 tyrell drummel
684,883,147 *46BDD237805F9D707C7B93BB002ED1FA4724EA9C tyrell.folan
684,883,148 *46BF66F3F97C91AC6074BD7F85836E8A740BDB25 tyrell.frymyer
684,883,149 *46B5FA05D90A41C468E014D5D2022C2786B381E2 tyrell.glay
684,883,150 *46B4698689F69796A96CC96ED7DBFB2FA0D079E0 tyrell.groceman
684,883,151 *46BB6C7AC09B4581D13F8F03406AE4B82B2EEA86 tyrell.hamra
684,883,152 *46BC534980DE31ADFD45B8388388EC75F0F26082 tyrell.heusner
684,883,153 *46BBD60A594C62686BE207C7885D2D9417F0042D tyrell.juhas
684,883,154 *46BB8F2AF679F8935809362E7992412BE23C849F tyrell.justice
684,883,155 *46B89FDFD1175656C5F616DF2B72C323F791D9C1 tyrell.losano
684,883,156 *46B078E3B7E8B5E761F54E84AE1F7F01B95C5D8F tyrell.masella
684,883,157 *46B277AFC3D979B48B07F466D8B4C22878A51687 tyrell.mchaffie
684,883,158 *46B30B5A2026C1A64D55A7DAA1129089D4094D3B tyrell.melo
684,883,159 *46B99C159FB53EC043D1BF7503E9163FCE0A0B6F tyrell.minerich
684,883,160 *46BA002EA77455D4A5839A8DC4EF531FA76EB9A7 tyrell.moccio
684,883,161 *46BDB0A3E50CB03E6B43214E5A6C8FCB36A419D6 tyrell.porietis
684,883,162 *46B045483E0441CB8A0808EF21E5BB3F39085462 tyrell.ramesh
684,883,163 *46BF4DAB39FDE65E7192DE4363DFE10C7B7D043D tyrell.reshard
684,883,164 *46BC54022F1B2B648DFA4523E661B201F1262D9B tyrell.roig
684,883,165 *46B4D1E4E09C1AC8A4139A02565E0FB19681671F tyrell.skutnik
684,883,166 *46B825BB191E496FD3EA10EE3E81D695A59DABD1 tyrell.smithingell
684,883,167 *46B48CF739DD552A1014BC66F62D60E9F9BAD4DD tyrell.trebilcock
684,883,168 *46B595B34C73795194791F57E44A37C93BF98C58 tyrell.yankovitz
684,883,169 *46B5DC5C100907C283326E8590F454F1025580B7 tyrencetaylor
684,883,170 *46B190BF54039DF14482116EEEDDC524C17021BD TYREX9
684,883,171 *46B3442F637554ED622DF9E126F9161EBDAF25CC tyricabillingsley
684,883,172 *46B11F946EFF18A0927A16F635EF71D6E9491913 tyrioque1234
684,883,173 *46BABEBA0AFD21B19A1E64A15BDBAE19AB58B885 tyriqst34u4
684,883,174 *46BA62D08BFA8C1E7B78B7DF5952F18E46657D4F tyrome sams
684,883,175 *46B7B113541DC17F086997D60D4C830DC886C5C4 tyron.benn
684,883,176 *46B8FC0F14DAF3532D063DED33DD70D437A3CD49 tyron.bruin
684,883,177 *46BC9488752484AB85C7E1B4917AE91AE2F14092 tyron.cashin
684,883,178 *46BD22EFFE7BA374D9434364ADD8276C5F0B9590 tyron.causley
684,883,179 *46BAF50F69476FB312548EDD1E64FF0AED1097BB tyron.civitello
684,883,180 *46BB19352639742A1B1D1F7110B3E71071950BDD Tyrone800
684,883,181 *46B60A8D6C4919D7C051224194C4A97F58F62562 tyroneandrew musicchicago
684,883,182 *46B549E6E96A030CBF8701A715E0190E672A5507 tyrone.coronel
684,883,183 *46BEDB522B576CF99732F1B7169BF675ECC5EEF1 tyrone.curro
684,883,184 *46BB429FA13990A847A149506B38456AD568B9BA tyrone.derwitsch
684,883,185 *46B3565607FB33994ADA8B9C671E5DAB882B5163 tyrone.fennessy
684,883,186 *46B421C3C6D1D3AD1FF9A4CE82A26BF49D036A15 tyroneforward
684,883,187 *46B1F7C385417820794FE01E7EED06CC9D35A92D tyrone.fukuroku
684,883,188 *46B723DF0746D70C710AD74B967BF6D2A227AD48 tyrone.greenler
684,883,189 *46BCB38DA1195179BE918FC4024A53DDCBBCC627 tyrone.hassard
684,883,190 *46B51FB516B6729F4EA8FF33D391468457A8A5FF tyrone.henig
684,883,191 *46BF1E31CE2E635D80AA7BCAECB07CFB6B76C3D4 tyrone.hermens
684,883,192 *46BB882D0687096AD0AE7A86063AC01377ADDE99 tyrone katsumoto mcbride
684,883,193 *46B4DFA40F6A3EB54EBDE68AB9D7283B88C3F20D tyrone.kerens
684,883,194 *46B3033AB3693D6FDE2D2DB67BA16CF5C64E4152 tyronekriston
684,883,195 *46B31C0043B6FD7E775FD2989AAE0C4EEEC17E58 tyrone liggon
684,883,196 *46B3F4C7FA18504DE6CED3C7C5C7E639AAAD6BF4 tyrone.lindgren
684,883,197 *46B3799C5A28FE39739752A638C840F99B09C14A tyrone.mallegni
684,883,198 *46B69FF6802349310D45F2635311337C7C6B3044 tyrone paul
684,883,199 *46BC711F1AEA42E9890CB0797CE53CA91FB31FF0 tyronepolland
684,883,200 *46B0DC919B5B6052BA26183BB3F3EAEEFDFAE286 tyrone.promisco
684,883,201 *46BDCD184FC19FBB3411810139E640043A2D5947 tyrone.puskarich
684,883,202 *46BA5E0FEB8F59893E2C39A188873975C9A36A5A tyrone.samorano
684,883,203 *46B7B929901ED470A782A9DB3A0B69C254D542F9 tyrone.silverio
684,883,204 *46BBC53E005A76C67F6DFD90412C24D0DDAFCB66 tyrone.singelton
684,883,205 *46B45DEA0E2FF0B227304CA66ED59D07024488A3 tyrone.spacek
684,883,206 *46B3DEBFC67951E08E1373378C82F7FDE5216956 tyrone.sposato
684,883,207 *46BA7CB739B1D26C0446167893A5ADEAD4836C1E tyronestrayhorn
684,883,208 *46B479B278269014B75B14AF0E108FE8D136EEDD tyrone.waack
684,883,209 *46BF98F2DB231E2E5A5A2D7C3E6CFD8E2A3BD962 tyron.favreau
684,883,210 *46BA5910B8A2E1ABA59A64AC596B71522C7C3182 tyron.hilding
684,883,211 *46B9AA84188F94464A8CF89F2AE1F86EA7F913B5 tyron.hoggle
684,883,212 *46BF48CEF7EF1CA872C1E71D54D7D88C139CD512 tyron.kimmell
684,883,213 *46B03D9F0D2B1B25B98120683ABC8EF0D4561C09 tyron.kutcher
684,883,214 *46B822B8F12B9480CC62AFD268673C78D0C5EB72 tyron.marksberry
684,883,215 *46BAF6EC99555635DD26C42500829DBC15A6FCC6 tyron.pandit
684,883,216 *46BDEC3D1CF83C9792BCFEBCA2BA09FB97B41684 tyron.peppler
684,883,217 *46BE4ED641DF0E0263E0C2EB5CBE2B134D639613 tyron.scaia
684,883,218 *46B6EBD670421D530EFD6F86B289CD1C744BD009 tyron.sinrich
684,883,219 *46BC80054641362D809B499AF8D4E166D6B413DB tyron.thistle
684,883,220 *46B021DCBE7A30D7C0D1600C558C7CC5E41683AA tyron.wischmeyer
684,883,221 *46B78516AD8F9D72C4B2C62FCA57BAAF70F8955F ty.ruetz
684,883,222 *46BF642748927A77F707F9F765B9447F92F7DC6E tyrynbey
684,883,223 *46B9F304E95CF39A94710AA3E729B2707CBA659C ty.scogin
684,883,224 *46B6F92AA9A00030B04FD816F0DFB83B87791E2B tyshanna johnson
684,883,225 *46B971A2C951B1023BA02418A72178958108D976 tyshawn153
684,883,226 *46B0780370A0063D9CE5007B059D13574267D619 tyshawn bey
684,883,227 *46BBD3CE85317FC8EC17C8E00C2780D8F036572F tyshikamonique
684,883,228 *46B187D7C7C1951B3BCEF408759D0E56040E0AE1 tyshondracowherd
684,883,229 *46B005EBAABF48E5E11BC55AF8ACC39F4803106D tysipiviseksis
684,883,230 *46B5CAB8E76188E8B87AC08715EFEFB2F655E7BE Tysknns9
684,883,231 *46B24D6DFDD5AC632C7B76E472BB2C02D0F7D622 tyson.addiego
684,883,232 *46B2DF5ECA8FD80D4645AF1A788F559FBE682AAA tyson.arcizo
684,883,233 *46BB4F20E4F65B93B4C96689D1C4E0269F7A9A83 tyson.batarse
684,883,234 *46BFE02552C36543FC9896BF5AD02384D80AA9E9 tyson.bernett
684,883,235 *46B0DB53B119D45C1F3DA8DB48156023D03030C6 tyson.colligan
684,883,236 *46BE8A67955CAF9E1EBE24FF5D42AD291093F622 tyson.cosley
684,883,237 *46B987BA271864D1151C9DD189C52840A9F03A90 tyson.darroch
684,883,238 *46B7A59615EE86BFB31203F1038638E9151A53C6 tyson.gadwah
684,883,239 *46B0E52D39D2D16803AE3B181125DA02522763EE tyson.garinger
684,883,240 *46B4920F950A89198E2E270CE4890577DF0AA650 tyson.ghoston
684,883,241 *46B60F2BCE48547AD239E38BCAA2CD2113E66378 tyson.gurley
684,883,242 *46B094C9DA169D87557451AB529A441015B9D3EF TYSONJ1
684,883,243 *46BAA2644F32B2712A9E034BDCECC4FF7266B975 tyson.lucio
684,883,244 *46BBCBE1A207F63194396E0CEEED09F38D08BDF6 tysonluedtke
684,883,245 *46BE3D5E57B65597B4B7F1B3A9AA66B59F34343A tyson.mariano
684,883,246 *46BC6AFCF14FA30BC6F59E7DC74DB830DE40312E tysonmimms
684,883,247 *46B98D9F24D62C95C4E0804EAE592E6CF9E281B5 tyson.moothart
684,883,248 *46B2B078FFBF2367DAD4696F23EA456D04DD4273 tyson.napihaa
684,883,249 *46BC4F3F76B92DB48689533C669E9D9894137E5B tyson.norrod
684,883,250 *46BEF2C11BAC5E387487A945379526ED5C631F7C tyson.peters
684,883,251 *46BCC65623F3730F4C3030DBBD76898B32960FBF tyson randall
684,883,252 *46B2CEC67C47547C86EEBD329D83B96C4730B6CB tyson.sharrer
684,883,253 *46BF1C6D8E9CE1BE2DACE0A0B8890DD195965C9B tyson.sheler
684,883,254 *46BFA714A1033EF5E4BC645049CE5766CB1F6886 tysonsukkhathammavong
684,883,255 *46BC1DE8897CD9148D1B8C88FF4EAEAD02776680 tyson.wynder
684,883,256 *46B1B319BB130F2F42ACAA238AF12C82A2907C52 tyson.zimerman
684,883,257 *46B7939191B90AC4B4014EEEF28978A3561E7563 tyson.zuanich
684,883,258 *46BE84EC635E55593B7303C13FF7616A2BC8B8F0 tystarbuck
684,883,259 *46B2778076328350D4690EA6297C7589E89F9B24 TY|SUUNNITELMIA
684,883,260 *46B830E024D7D62791D1C6E128F3DF68EDDCEE16 ty.swantek
684,883,261 *46B023E2FA19A598E57B16F1E34E6F7C4CBE4E89 Tyszkiewiczówna
684,883,262 *46B6C7DD8D3866410A47DFE9A88263A61A01AF3E Tytanow
684,883,263 *46B8AA88D3BDA721F302A902CEB0725851375A12 tytanozaurom
684,883,264 *46B651CF4D0F58954799FDEF289BDBA1EBAFB361 TY|TERAPIOIHIN
684,883,265 *46B016F1C77917713603CB335668C0C09468BD33 tytG
684,883,266 *46B13B1FC17742BD0CDE6E1215AB6C685680598D tytia artis
684,883,267 *46BA6669AE91CEC2BEC5E057566B8D5264D5FAA1 tytler-refutes-talk-of-congress-denial-of-poll-ticket
684,883,268 *46B764EB22C13EB8D4C20C9BBBD3E453009D997D ty.treadway
684,883,269 *46B4408D83DB2098F406A7F47B392EF943BA1489 ty troumbley
684,883,270 *46BD9E2E54D2E8A4E4395DB8639BA0D524B4C571 tyubtsyango
684,883,271 *46BCF5C482B7609C205173348052D9A384F92BCA tyucbb
684,883,272 *46B063EA41EA48A2B3D1A3551645F1D068E394D1 Tyúkhegy
684,883,273 *46BDCD728F251178AFE4AC4398F9257E5F2345ED tyuuzyun5
684,883,274 *46B65E41CBF3E09659B4CF7A3CE2F12702B53098 tyvaihet5
684,883,275 *46B7F58CB0163C0063982381BEDE8B5589E0EF63 tyversfdselsdag2
684,883,276 *46BB76A860740B36F228096B73276F9B08387F30 ty vis
684,883,277 *46B08E829552C3FE37750A1B288F99CE4704AC0B TYWAN417
684,883,278 *46B2ABE07E9E7F28DBF7F4FA0A0F94CCDCDF01CD tYY;
684,883,279 *46B53B0EADDECBFFCBC8E0FA8CB6F00D6B137F69 tyylitajuisin
684,883,280 *46B6D96A866DE7F5613638968E75900E37AEBF02 tyytybsw1
684,883,281 *46B03484C29580C37BBDCC82ADFB2ABFFA681FCB tyytyvaeisyyttaeaened
684,883,282 *46B20E09686AD434B49E5AA8FE2983CA286A5880 TYYTYV{T
684,883,283 *46BAF27CD95EC1C55E1D06A43A2BA53B2C6C818D [email protected]
684,883,284 *46B75432B50F2FC3556C0F01106DAD5A3CD8419D tyzaim
684,883,285 *46B440BEBEFE5F4D667EE4BD41B917278A8A4BDE Tyzenhauzen
684,883,286 *46B2C43FD5482A04C5AD00E85C1F0AEE704162CC tyzjrnrx
684,883,287 *46BD8E55AC285247CD1054FFAE91C4868ACF9EDA t[}z
684,883,288 *46BE09417CEC27410BE005142F79A016D6061C0A tz3+
684,883,289 *46BF39020CBC6E8C7439A4F1A3C661D6CC748E71 tz?6
684,883,290 *46BF652A30C49C46E595B16E63547E0555A2FE02 tz.7
684,883,291 *46BE8E53BE1941C9B28C426E6EDDFB710A776515 Tzalmakli
684,883,292 *46BF51E19BE1FBC9F6E33A4FDE3B816794CA4DA6 tzamtzhs0
684,883,293 *46BE9F97002D9E5579B163D1D3B58519E8399EB4 tzbaren5
684,883,294 *46B6E1B2DA6B3B3405A3D949744FB62A861F9E4E tzbrjsi
684,883,295 *46BE882BC0D3CCC7E36186BA0EEB31B1BC702740 tzchen 1. teil
684,883,296 *46B514570DDB36C806D2DF2E3847A6E6627CC54B TZDBMSVTZOR3I
684,883,297 *46BA230AED1EDD8310A5B70FE3EF94446A9D0BDF TZDGNHOGXFO
684,883,298 *46B366F1A59E6F6C1E5A09F857808FF867C2D9FC tze<
684,883,299 *46B90F7B7AFD2604A145A784FF63BC06254855DA tzeela geva soffer
684,883,300 *46B8B6F796279550845A06BFBAE713A7CD012F62 TZERKOVSKI
684,883,301 *46BC3EAE31F53C9E1935610C1378E2557F32D992 tze yu yeh
684,883,302 *46B8B6619391388D841D8410EFEA84E6243FD7D2 [email protected]
684,883,303 *46BB7B9AAB6DBFDD5BBE51FACF364B8E03BF2387 tz, ii. akte nr. 10: ihr weib? / mein teures weib!
684,883,304 *46B8E552E81897CB612535FEF3074EBB3AD2D193 tzippiinbal
684,883,305 *46B14B1EBD593937408BD37BC7DE9595E9F15C57 tzjebillups
684,883,306 *46B01CCB1059F286B15C7508BCC24A7AC92F8A27 tZKi
684,883,307 *46B33ADB2FBCC79EFE0B0EAC930883F077A8EC78 tzlil shafir
684,883,308 *46BD8C32784EF44988EBF3C053CB647201377817 tzn<
684,883,309 *46B70EFA790D536D515218BC05E7960FF5010633 [email protected]
684,883,310 *46B6E71A6394962297522413B4B243E7484730EA tzoqwgfx
684,883,311 *46B8C420B53598DE6DCB0EE1DDBB6E6C5A8D6CEB [email protected]
684,883,312 *46B4A20AF69E39BAC344333FE64370519E80D81F tzozomolokomme
684,883,313 *46B66E4330163E668FF143D5FA4DC4F71A6C1FDB tzqfwoeiixo4
684,883,314 *46B30A398A52949F632668D49403B0C2B75E4343 t-zqrsym
684,883,315 *46B15F55FDCCC221E5DA6A44C16E0BBB313F4F29 tzscheans
684,883,316 *46BD87EEEF26E8921FA26B38CDF37B4540585DF7 tztab4
684,883,317 *46BB30C045E4A8F62661913FEA4D5D318091FE8A tztesreb6
684,883,318 *46B377E3C81928C35B4AD5C63453FAA422D799E4 [email protected]
684,883,319 *46BF9EDF41CC52C5F0F1ACC7C531953C1C70BE4A [email protected]
684,883,320 *46BC3DC218ACD6EA0506BD81A86C31D1F140243A tzunami2
684,883,321 *46B8D0AE3260C9A39A8B791C8FFBF65A67552D84 Tzva
684,883,322 *46BE78BDDBB491AFFE6E8A0126D55842CAD21040 Tzvpbsw5
684,883,323 *46BB111FF089D221501011C14DB2E1A463272375 tzwvjjlk1
684,883,324 *46B7E7797BE018F3E8F56355DCCAC7CD0BF63391 T!ZZ!E5
684,883,325 *46BD873E2D5870B4301144F584B064C9A006458F
684,883,326 *46B41B763D68C7F5B51E4C629A56A512597A12CC tаkоmillаshtirishning
684,883,327 *46B10220234DCF8EF5FBAE0069E67880A5B41602 tәklә
684,883,328 *46BCB752CD7D5DF363686679B45B01ED3190B7A9 Tと曲がった尾付きのCの合字
684,883,329 *46BB7A1BD1E7F29B4AE1AAA30B854539DFACF9C1 t(『青いナイフ』収録)
684,883,330 *46BAF8B0607D92F476B9A557C476012FCC288855 u<$;
684,883,331 *46B4E02D68DCF1E269691CAD69E2EB4C9BE65F30 u=['
684,883,332 *46B568F9B3B100EEC9A6B31C0BDD935A3EDE495F u/%,
684,883,333 *46B1C95196EF400F566365AB740DF7FF2A601935 u']+
684,883,334 *46BDD35F11CDDF1FA1159B4E8C7E5FF007B5F474 u]0<
684,883,335 *46BBB92274DB3240A56D4960EF0DED3B3BBF0694 u010186
684,883,336 *46B29CD107BE0E5F8ACB402350F600D9E719865B U0533
684,883,337 *46B8DDC66963882852424EC0FFCDD99838CACE8A U0558
684,883,338 *46B787C45E0C040EAE352A5C578B14FE492F42DA u093519
684,883,339 *46B8F23C6BC27675C42A9A33CAAB8D233391BB89 u0bvuk
684,883,340 *46BE6FB47BC9F69F4ED2F1E289FC873760B6258B [email protected]
684,883,341 *46B73B6F59BD122B9ACDEA35AE0A9F54DD2CF3A2 u-{1
684,883,342 *46BCBE2A420ED81D7B0ECAA4E9FF777CC08EF04D u10714
684,883,343 *46BD8BB6B5DDCBBB9C9A4A9207A60F446876F7B1 u109589
684,883,344 *46BB26C9D6CA75F8E416E271AC0DD68AFB5FE6B5 u112736
684,883,345 *46B85A282AE6CF305135858EC59932125F81E946 U115264
684,883,346 *46B3ED724B6F3A1990DC2B6EFEA53248D2A1BBD6 u116319
684,883,347 *46BB8945279885AC7BF892E69942F92015E7E350 u12955
684,883,348 *46B395E336402E858813CC8418F3A4ECB3359680 u12963963
684,883,349 *46BCB0C40A4311EDEDAFC61F632CC5688D250BDA u134763
684,883,350 *46B45AE457C6B5A675A77D4BB16BB8E9E08584DE u140949
684,883,351 *46BEEF247A79A930C00D7217F68AF546B5951765 u147267
684,883,352 *46B194F8212975F93AECEFC3B117B2E23D545322 u148654
684,883,353 *46BCAA8B42836E479B01B61C57C2BC68BA3A1896 u1500692531199
684,883,354 *46B737C6F3FD886E219F5D8E99B4D75FBCBA6D83 u15027
684,883,355 *46B65821007E24D40417C2EB9014C37097423B09 u15091981
684,883,356 *46B8E7D59FBC4F75C5362E3E11B7DABC25D094DD u154439
684,883,357 *46B5FB9131D7600BBE5FB386B6B99C84D12BBCF8 u1545728353
684,883,358 *46B8F1E9068EDEB456B73B39C1C9D5C20C0B1A59 u159494
684,883,359 *46B6A3DD32FE5DE2FD975C0E432376EBA8405530 u159684
684,883,360 *46B293947DBEB869DBD1C538893434AC961853B6 u161615
684,883,361 *46B473D8127C8C0CFFC8156C0930E27E1261B24D u16533
684,883,362 *46B24091C536A3E0A1CD6DC9B0BBEC048283E8E3 u16601035475
684,883,363 *46BBF9E6BB717AE89E9D935F0272123F9AA33DF2 [email protected]
684,883,364 *46B67F4AD4DD24ACD3B7F381B885955874D0244A u19866891
684,883,365 *46B0F5E90C7827B638B6AB7DD6001BDC18D4DBDC u19u
684,883,366 *46BD862358618101386BE4B55D8DF8139E80805D (U+1A5$
684,883,367 *46BBF41077DABFD9B7798C4FA3EC4B43B44E4F37 u1c3r470ns
684,883,368 *46BEF8C06BF0A8E2BD4C003362657A64659D6AD1 $u1et
684,883,369 *46B4E0B50763CC4973ED2D7193CD8714B15153F5 U1tr414bo
684,883,370 *46B3B91AC871F82285BC9AFE16141D730AEEA510 [email protected]
684,883,371 *46BEE7F50E3F488C786C9944AA2DC3C2AAD9FF9E u1trasu3d
684,883,372 *46BEF44AC677F00B872F4E420DD2D06096E919E8 [email protected]
684,883,373 *46B305776D3368F11AA35316190CF40EB401026B U+2015
684,883,374 *46B981CF0D5C1EB1872EC78AF6801AF632FA2AC3 u22c
684,883,375 *46BDD2D018B3F9C99425CE62E7E9B8BD25D4E991 u26912345678910
684,883,376 *46BB039B1B351BF0D453A77E51812694CAAC9B7D u26982
684,883,377 *46BC3297E8FFC2895633E211DC6BF05F2A98FB53 U28653N220PH6B8X2XL0P
684,883,378 *46B6AFAE91DA3DE2CAA94701C780796B05713FA1 u2Bs
684,883,379 *46BEA380A6154EAEA0407DA3C96B7C16ADA3317D u2C9
684,883,380 *46B98A94CD68F90818A812ED30EB5F291DC9CCE4 u2CW
684,883,381 *46B8D891461527A2C33A3497B95F989A9BBB5EEA u!2V
684,883,382 *46BC4CFBF49CD2A0989E2C75C7952119D7A61910 u2xv467i
684,883,383 *46B4D31DB5FD20C47785860FAD73581B7D2A71A0 [email protected]
684,883,384 *46B0C96D82456DACEF0FB48BCB44B0090ED9BD13 u31m
684,883,385 *46BE2BB46118709215BEE6C52A9E4A47ADDE648A u3532604
684,883,386 *46B53866FA21F656DBC323ADA114E536A028954F u.3e
684,883,387 *46BA088D3324127DC9870A7EBCFFF861C8FC4369 u3rc
684,883,388 *46B761D667C395420A7BE873C6CCBBCBE4D9B9CD u3rt3r4mu5qu3
684,883,389 *46BE23DC586132047656E2BA8A37F2BA2C43EADC u–42
684,883,390 *46B73DA1F5F839284D2FBD338153CCEF60F698AB u439144425
684,883,391 *46B4CBBF6C4D8038CAB1A51EB3E37A1E8C98D599 u47528
684,883,392 *46BF6D6D3ACA3802C6248B5DFF07179D05C9BB91 u4ATzuYPXVYC
684,883,393 *46B881BDC5D8AA6434817182E69DA9D08AAB8A5F u4bprogs
684,883,394 *46BEDA8DDAFD3D6E7EE7DF8520E3DAF8E00A8682 U4EA —
684,883,395 *46B363642AD76287285A206742FAB905065F4560 u4ga
684,883,396 *46BC49538B5A23A62EA4BB0F98891195A067C721 U502076
684,883,397 *46BF3E490E99D56C42D7BDA4BEF6D52C23710B2A u5454cm
684,883,398 *46B0C55629667A7436E22C021C7D03BDB8B0F255 u54ct10n
684,883,399 *46B89D7EAB69FAFE7295D0887806DA5761F37163 u57539
684,883,400 *46BC1A49FA4CC3C40C285B8C0D64E27A00AC28B4 U580RA36F
684,883,401 *46BB0922CD0039D8C12267F0A45690BA37A402D4 u5urp4d0r
684,883,402 *46B42F5C8CE90E61B8820F5012A5740E89D2C8CB ?u6
684,883,403 *46BF8CDE16A63515146C1A881A1C3D61CC85E9F1 [email protected]
684,883,404 *46BD8CC288B633A2CEAFECC695335288AA4DBD60 u6309707
684,883,405 *46BCE3141D117023FEE49E9CA5C9484D3C2E35DE u64502
684,883,406 *46BA4AA90C448DD0D9640470EE367F7DF671C91C u681995
684,883,407 *46B77D7EDAE3A1AA27ACA4A5267D1671CA6FA2F4 u68915
684,883,408 *46B3C3D09171D00EA42415BE1D3839CB117DCC24 u6Ji
684,883,409 *46B772EE0FB99176D4EA9F96544666CC9DC2587D u|'7
684,883,410 *46B2F699425659680DE33BC128F9B24608E9AE09 u73045
684,883,411 *46B6B6D69F66916C88531B21D9949FA33D94F743 u74829
684,883,412 *46B3AF2E59253A2453827D5E90AA1CD64A4B2309 u7FzDlGhq0e
684,883,413 *46B68F9136DA03FFC577BA8FF515F1AC05F37DB2 u7uA
684,883,414 *46BC1684C9A5900ABE3D532425EB890D1CD09986 U7ZHTEMH
684,883,415 *46BDBDFDA6039C4CAD1F4E2BB6AFD45CCB686713 [email protected]
684,883,416 *46BD8CF8B3BE040FBCA2AACDD29780B7F1D9C928 u84766
684,883,417 *46B3BAB2D0CB061F34BABF04C4B41DC5F722DC14 u85644
684,883,418 *46B73320873FE1C3874EE53A8451252144A52C2A u88083
684,883,419 *46BE001BAC24C8F561714AD9CB7B954E56CAA862 U8DB
684,883,420 *46BB078822D0BED992CB442730F5DF4F94B4CA97 u`8K
684,883,421 *46BB6DCB8243345053C779AEDA73601BC56DD603 u8*u
684,883,422 *46BB192428B7F07B7C1E346143B8F0C9E02F2CF1 +u8ule
684,883,423 *46BFFBB2203F29CE522077E8C0DAB0200E12D6EE u8-uxr
684,883,424 *46BEFD2C4291728C42AEF8B3965EFFE9F90B2755 u8yallpjclyc
684,883,425 *46BEDC62E4A14B3A5AE3ED6D30691E132295BC5C u900510
684,883,426 *46B78BEF5CE9E321B77D891DCD9EB08547B9C3ED u90865554
684,883,427 *46B9E64CCB46734CD92509A987BE01F7FEC2205D [email protected]
684,883,428 *46BD1D7B69254B0D49BE30BF2053514621C27E6C u95588
684,883,429 *46BA68BE560599B179C03C8CD6953C740F39E2E8 u99567
684,883,430 *46B6A98CA622206A526C10A45C1F29435DCB075D u9e0
684,883,431 *46BF8C40CC6A0C4F1F278C5B80DE47812E2C618E [email protected]
684,883,432 *46B154089055019C0A88C53AFC6989D3FB28216D u9(L
684,883,433 *46B5DFB345B7AA8E84939F13D8A6E921B1E422FA U9OSMRZA
684,883,434 *46B61F49DE98167591F47FBD3556FF6DC1222414 u9Sn
684,883,435 *46B18BC3D96D2B5AAC4130AF438A895628108831 u!a*
684,883,436 *46BC609EBBE9FD5E94723712AE26F9BDE26ADBC8 ua32n
684,883,437 *46BF44F405D08A3C400CE2716E457E0B6262BB62 U(@aa
684,883,438 *46BE199E5E431107FB440790C16CFA80E3670009 +[Uaaa
684,883,439 *46B4BF736880FAECA60DF233AD180EA119F52EF0 UAAR…
684,883,440 *46BD712EC9348B311E59CC783F668160BC850E12 Uabakxilef88kj
684,883,441 *46B7EF4BFF3262A6CA0D6085AA102A16ED7A405D uabfuakcing
684,883,442 *46B23CDD96F5B5BD027D5743B12F6F35CB96399A uabrebeu3
684,883,443 *46B38D27002D830F32F8C7EFAED0E8DD3B196CD5 uabuensb2
684,883,444 *46BE24F639B3F843908A09576811E30B0263E406 Uacceptable2
684,883,445 *46BD477F3AAFBE163C907AA1D81BAEB107E42DFC uaemirp4
684,883,446 *46B91329ECB28ED0DB3E83455C4A350217319E40 Uaenrom2
684,883,447 *46BD2073CB5C6C4810EF6AB5F9D52B5A5593B4DF uaerennA
684,883,448 *46BE000E90D73A5B32E14CCBEA0463CD39703B35 uaFC
684,883,449 *46B3575437AC8225A6230F0BB67C28E9AE82F679 uagtsomheD
684,883,450 *46B62C6571D02DA7AA60970717061C6393A786CC Uahan
684,883,451 *46B1AD41775936E067560DCB3B7BC73EA27A4475 uAht
684,883,452 *46B74B8353B1754AB20BC4CC3508B06FA7607A4A uaIFvkr63
684,883,453 *46BA57F02434251869931221E544BB2EC81B80EC [email protected]
684,883,454 *46B4AF2F516F30932651735428A2F79ADEBD3F03 Uajntht9
684,883,455 *46B4894BDD6DBA12634D321BEB0E423B2A00FD55 uakttorG
684,883,456 *46BFE31B667DFACE81047E5783D1596D404328DF ualmaets4
684,883,457 *46BA311089010F2C3E3DB86C5F2381AE0F9F4D1C uamarkhadafi1234
684,883,458 *46B203474B948C0BA95A48518CB1A6AA2D18E5DE UANGRIBELIGE
684,883,459 *46B13AAF1D1AFACF7C8B8A21442B702D91252AD8 u.a.o.a.
684,883,460 *46BEE55AF3A4C7BDF1753C766DE4BB99A85FBECA uapV
684,883,461 *46B6713AA958CE2A7502408ED7A0EBCCC8779D9A [email protected]
684,883,462 *46BB1E6E99AFA4D59596834703BB93BC667343C7 uariremo0
684,883,463 *46B751DE88289C3C285E205E0B5C378FF90B077F uArU
684,883,464 *46B4FDEF4FC48CB240116DC80D24A030A34C4F4E uaT<
684,883,465 *46B6E59C49A428D798690E540212ED6CD107B376 uatensilyllasailartsuayentihwyllas8
684,883,466 *46BB2C881B9A9FEFDB7E6A0ADF055B7996FEC69A uatentenzaducarrabailartsuaaducrotciv
684,883,467 *46B562DD34EEB3B374F77731EECC40010B85D1D0 [email protected]
684,883,468 *46B15A4D2B254B34E3D1F5DBA15C9AB30E4C4C3D uatordnaed
684,883,469 *46B76ABB5CB100D59433B3E9A86BCD8F12AEBF0F uatutnep2
684,883,470 *46BC38476977F028FDA0D62679FFDD7F5525950B uau~
684,883,471 *46BC44D5DAF3BC649B081D444282B512D08F5F62 uaudeuqczapotjpreniwtailartsuayugemoses
684,883,472 *46B18EA82E94574D27CB923BCD414F7A96B79CA3 uAX(
684,883,473 *46BAC519312CDA7BF1E84F8484AC6EC5606AB125 Uazo
684,883,474 *46BC9BB635D079FD5519068FB6ED4F389DE5CCCB [email protected]
684,883,475 *46B29A2A7A9179ABE7A97436D0493CA49AE236E0 ub4c
684,883,476 *46B34BC38DEFE12AAE58743E5F38B4062B4A7B6F u=)baa
684,883,477 *46B1D6B22D6027AEEE720A089182D09AF6C7D067 Ubagnovienos
684,883,478 *46BFD83F1F4E393A24D05C92C6CFAC0C039D27A5 u-bahn-ticket
684,883,479 *46B1C83ECECD5DB35822ECC8BD1F793B24E77428 ubaid sabir
684,883,480 *46B09488B07C787880F841F7BA07C9BABBB5B4E8 ubante ma cecilia
684,883,481 *46B4C3F571A1F0CD715B1EC3D33CFF770CBE2304 ubaraug3
684,883,482 *46B7638DE25251E29310120C8DF01C8C2B10375C u-based
684,883,483 *46B0A684E7B254C35E7626F7A415285D4A588F08 Ubavija5
684,883,484 *46B5F309AB6F23F29282F77C9F3653DBC53532F0 [email protected]
684,883,485 *46BB61B18FEB93A5B5A8436F8C57F80DF7BF2832 $ub$ecu+e
684,883,486 *46B337BC6D449FB3018BB4D6D4205C44C6855C59 ubeenguyen
684,883,487 *46B0DA79E84C9E496B7CCAAC348A84DB0DEC36DA ubeMich(Kowesixremix)(feat.SarahWalker)
684,883,488 *46BA6FCFF626409AB9E426448A5A8878A4CDA333 Uberantses
684,883,489 *46B175E1DE48E97FE916F79C7ECAA1A26651E25E überearbeitungen
684,883,490 *46B7404CF8331C991BD63B1F7805F1849F8569EC ubereilenden3
684,883,491 *46B1AC5E0C18A6C098BB2FBD1C1F9F242E74A7CA ubereilt5
684,883,492 *46B8978B9E1825762F182DEBAD3F14D5EABBC88F Übergängsbereich
684,883,493 *46B21EFC7B1BD7F5799EA91285DFFC363F745160 uberhitzende5
684,883,494 *46BC0F69BC186D5849D63C610EDB55656A97ADA6 Überkopfelemente
684,883,495 *46BC5AA43D985ACD286693BFE716A6E765902052 uberlasest1
684,883,496 *46B2DDBAB49D622C0487ED0F22B99E0BE4EC34B3 überlieferungsproblematik
684,883,497 *46B4F3CEA0E5C18E01466B2B801DB13F9890B97C U"BERLISTETE
684,883,498 *46BA381CDA9F4A8453FBF735968917684C314DB4 „Überprüfung
684,883,499 *46B8E82A6B422AC4F2E83C5A06C37F3FF59213ED Überschreibungen
684,883,500 *46B2028E4ED887BD7D639BB120F699CF129D4D85 überschwemmungskatastrophen
684,883,501 *46BE97FE6ACB42B6D844E54E3896A3324E6FA4B7 Übersetzungsbegriffe
684,883,502 *46BC981164BF8821761265DA89432845EB881D10 Übersichtsfeld
684,883,503 *46BC1816BE94EB4F6AC6AEBCF86D4DAFAF4038C6 ubersprudelten7
684,883,504 *46B7455AC58C42C647C8FDCC97B60AECD5E77FCB Uberwachungsstaat
684,883,505 *46B0F6EEDC2B3BB4B85F85FA17FE34EDF1DE1654 uberwendlingstich
684,883,506 *46B550BAF1B3FAFB0C67D66F23D23EF94459FB6E ube-shi
684,883,507 *46BDBF5DF36D87D6CDA0083BA8CD819BA5C7E827 ubestemmelighetens6
684,883,508 *46B737C1827E69A3A0554393DE6B95CA65A15017 Ubetaleligere
684,883,509 *46B67C3EB62D5239EE7F7DBEE2A2E2CEFE30DAFD ubetimeligered
684,883,510 *46B3268FA8237EEE9D27A4378F5A28556380DBEF ubezpeci5
684,883,511 *46BA0ABF144425D697C3778941A2F80239C667B9 ubibbb
684,883,512 *46BD121EBCAFB92CFF97CC174CA7BA156CA7580C Ubigfoot6
684,883,513 *46B1BA62764E5242102EA8370E9B38A97DC99EF1 ubikace0
684,883,514 *46B7A2473E743B26F67E11BCFE659952AFAFEF16 Ubilacxec
684,883,515 *46B63A76C74E79DE80416ED7365E912685C725E0 UBiMa
684,883,516 *46B5B91D97F13B818AE1A6DAE7FA6192773A95F5 ubixj98tvict9r
684,883,517 *46B8B58569C1C9D6F9EED092D51D1F58B543B1FB UBKI
684,883,518 *46B1F78DB8047065CC10E15FB000D910C93D50C4 ublamorb9
684,883,519 *46B44797D0F18492989ADC17F5E0B5DFCD3847A1 UBLAR
684,883,520 *46BF91844B40B1D3BCDCADDC001AE7B70AF9DE0C ubletee123
684,883,521 *46B13DD17C6654228076295F7E466EA1C76ADD9A ublizeni5
684,883,522 *46B55594F25B1B6311FE694BD994EDE21256BB84 u-blw
684,883,523 *46B334D4BE7DB20E791B132CDC6A8624DA661E8C $ubme4nin
684,883,524 *46B887085514D9B78A1F2A504FE390B9C72EF8FF ubniffab7
684,883,525 *46B03FD248314342856436282A75C0D582E19E7E Ubodenom1
684,883,526 *46BFCE3EDFE04719E7D53344917A5120EF5D10CA ubplasmaed
684,883,527 *46B71A55DDFB25460421D955B5EBFF0D901ED801 ubqzaelo
684,883,528 *46B5262AE506510F7C01FC791765AD85E818FEE9 ubrytelied
684,883,529 *46BEB264E6707C50D93EFD1E1EB796613DAED009 ubtanetzsv1
684,883,530 *46BC8AE0B3FB2A452BA92E2F7FCE2A4014EEA28B $ubtr0u$e
684,883,531 *46BDBB9F02A943963E5DD9CDDD21E3BBC7D25B40 [email protected]
684,883,532 *46B7D26C7ABF94A444B0A9DCA80A1128D3ECA174 ubtunnel1
684,883,533 *46B64FA563428CD19DA669E4F3B8FA1B81FEE02F UBUD
684,883,534 *46B09B29CBF9022DB67DDE214FA407271061E909 ubuntobob
684,883,535 *46B6CA043B3B1B01B4A077D9E5D1360D033240F4 ubuntuboi
684,883,536 *46BA0C882A6E44FA5EA481C365E1246801051882 ubuntuhe.
684,883,537 *46B63CF62D6C4B4934B5F63CB82D7A1AB621BD99 ubusiness7
684,883,538 *46B5C564B2F3955655AFC05EF039939FF20B9FB7 u,Buz
684,883,539 *46BF4D730A4F9B21BAE00285321ACC46953A2E84 ubvrspk9
684,883,540 *46B58FE515A3322EC42F818474D85663D3B503D7 u_Bw
684,883,541 *46B8B2519CBA0AC525F67F47C123AA7A29433D7C u_bW
684,883,542 *46B7D6ED4CF63A3F7188D5646E1B6E5F00CFDBCA ubxgf31u
684,883,543 *46BAF10FA6FA8D7E9040662BC90C433060D2973B ubxqfnnbdx7
684,883,544 *46BB286410DD6D884A63BD063E7D818CF684937F uby/
684,883,545 *46BC69D615B7F59FE8DA86EF6E5E1E871DFB3978 UBYTOV
684,883,546 *46B6673DD51FC6086EF2E27E6915432467F3A5C9 ub`z
684,883,547 *46B735FA8D69B2A4D135EC8F971B108B3FD65E38 u:\C
684,883,548 *46BA434433784CC036DD555AAC806DBEFF1C3368 u)c/
684,883,549 *46BCC98A2DEDAB8AFCEEB265AEAB45D492E34DE6 u]=c
684,883,550 *46BED85D32BC9943BD4D7588FC851D69F1077CF0 [email protected]
684,883,551 *46B130DB2709BE6BBE027253E89F04636CC4CF29 UC1009
684,883,552 *46B58B6506EDF4617E6701C89F6F86D32C615325 u`c2
684,883,553 *46BBE99EDFD976E5FD8F90EC7E9CAC1781E7F901 ucabohemio1234
684,883,554 *46B4700BE9653A6ACDD7A77B6A6D26C64EDBAB24 účastenstvu
684,883,555 *46B33F3359A1AFE552C6A58B852ECAF34FDF5C44 Üçcan
684,883,556 *46B4B21554839417AE1EE94D34035071D96858F2 ucdcbsw8
684,883,557 *46BFB14E52B304D7AB885431836238F2A34F3388 ucdlaopnet3
684,883,558 *46BA0D9505787E256A7ED3E08B3896FAC2319A9B Ucelneji5
684,883,559 *46BAC4329AFDEF40A462F8A04A8ECBAA53CEF28B ucereuses
684,883,560 *46B671F9B59962FE0E2E2646DB41625ADD8938C1 Ucesnicing
684,883,561 *46BD31D36166A83B187015AB85B8D19B2A02D8D5 ucfdist
684,883,562 *46BDE384A5A02B5B501A59CF9DF2582EE30CF761 [email protected]
684,883,563 *46B72EC63B2F58254E0DA40065C322010A3AE719 UCHASTI
684,883,564 *46BA3600ACD2428CBDFC4FE3747A23E156844C9A uchebno-boyevoy
684,883,565 *46B54479FE6E9949A6D1A4F26A35CFF258A5E312 ucheokwurumgbe
684,883,566 *46B7BD7E23A7048720BF998F003F662DFC7ED8EA uchiawas3
684,883,567 *46B11328CB431FA014ABE73EE57548A0C16A0965 uchikoro2
684,883,568 *46BC4D8E7717A6B2AC97584F80BAC2969A5EBBF6 uchingmaychak
684,883,569 *46B28BFE531F241E029D71BCBEA2DF098CD7B824 üchs
684,883,570 *46B1D0E6E5A180D30880A986AE9BD1ABD390AA2A uchtarain2
684,883,571 *46BE65D8EB1398EFC87703D0B37AEA1B516D09F4 uchwalaniing
684,883,572 *46B3FF10BF3E4447936FCF8D141EE7F80AEA610E Uchwaly5
684,883,573 *46BF00FDE7C78665DD1CDD8593F2F4B05A77610E uchylonying
684,883,574 *46B8F68637C46703EEBA8FB0DED533C656753BBE Ucidusop
684,883,575 *46B1FA2D706C42DA304C2A5488BC34AF01249773 učinula
684,883,576 *46BFC97380DFFD8B227DEB1037C244B672C7DE06 uciousshe
684,883,577 *46B91A93A34F87ED113346E7F72C9733617675F4 ucis's
684,883,578 *46B5659D533C944C641DE80BDA2915E58318B0AD Ucitenim0
684,883,579 *46BCD94F06A5529F19699135E59B9DD6A41DB393 ucitsiniloiv
684,883,580 *46BAF8393DE42899BCB8216A3A31C458313773E5 UCIWLARY69
684,883,581 *46BB5AF05F8BEEFF87D6AF54EE3BCF7FB096CD18 uciプロチーム在籍選手のみ。2010年1月29日現在。
684,883,582 *46B8948CFBD490C794D4A571ED76F99BD8543CCC uckeltet5
684,883,583 *46BD8BEC3FA8B5C7A5DAFC9F48D80010EEDBC271 uckkommt1
684,883,584 *46B44E594AD4BEDD446F0431D1CDF0C19A2613D8 uckteresing
684,883,585 *46B9DFAD0FD86A4055BFB796E4AA1CDAD39D6C29 uckumpucky9
684,883,586 *46B2348A5F2905319D87AF902E8E53880E4BBC1E ucky lukita
684,883,587 *46B32AB7AAE5D50E43D9FC7B5E993EF136097B90 UCLは1826年「ロンドン
684,883,588 *46B219217967D71D0C666872114D4E7712367860 uclitt
684,883,589 *46B3EDC3552FF984496CA8104B3138DA00C4FF81 uCMl
684,883,590 *46B6369F9F06573DE8A0C414DE8D5468C524C969 Ucnurutued
684,883,591 *46BA3EEE742CB02C3457A7B08CABF0E6E4998F83 [email protected]
684,883,592 *46B81130437CD82E48E6241E5A5E19F2A93DFF83 uconnumassing
684,883,593 *46B2D6CD6E7D38F7309FD8109BFFF59AE8C7411E uconquring
684,883,594 *46BF3CD71692E67259540CB53DC252143F698ED1 ucorkscrew
684,883,595 *46B2EDA54CF6568897AA4E93E1B87A51A58A2204 ucozом
684,883,596 *46BD4276AC4D373BBD1CD4AE446A71829D102F5E Ucpavaly6
684,883,597 *46BEC86FE67CDAA2960DF40A7E573D882AB5556E ucpnologinunixtounix9
684,883,598 *46B9DE7F4A1D53F914CB494B34BF85C261A07968 ucpZHdibAkg
684,883,599 *46B12742482EF096F4DDF4CDC1922D5C40C77B17 Ucranios8
684,883,600 *46B8B5F5BDECE1CF2934F0207524072062F01B3A ucrartep
684,883,601 *46BB9646CD0B4B651F47248BECEC683440C27B32 uCS&
684,883,602 *46BDC13986C98D3DA8F24C0138114703AC400622 [email protected]
684,883,603 *46B2C6C5118EADE9782DC9FDC895EB5331799ACA ucs-reynolds
684,883,604 *46B5ECE4BA9E4DD778D4BC51C9D1CF5E0B543838 UCS取代。
684,883,605 *46BEA9D628A1179CAB5E3E6F991A4A209806B325 uCTahAA
684,883,606 *46B573786CDC2BFA3DECDAB6E8B60DC5AAB2762A UCUKVTTu95
684,883,607 *46BB76CBD2E8CB4BD7ABDBCDE7F53994990FD185 [email protected]
684,883,608 *46BA48B2C9D6BFA8B2D7A1E48ADE29119BD69755 ucvnetbsw9
684,883,609 *46BF7BCA5EE52AED57AE1B5E77F464284DF634FF u=CW
684,883,610 *46B32D772C801847AAB172BEE5306A7D3EDDE1DE ucy>
684,883,611 *46BE5C66A28BD8F583D6E82C04A9B825D50E7C3B u.|d
684,883,612 *46BFA16902B8EBFC1C804CD8CC04999D7CB932A8 ud1adning
684,883,613 *46BFB9D16CEE4EA36445BBF13B35D7E8728A2C6C ud1
684,883,614 *46BABF5ACDA435ECACC51701923A1ACA25E40EF3 uD`9
684,883,615 *46B623D84F0CD58902C54F900884CAD37477C265 Udaaludeniya
684,883,616 *46BBFA8C6918498D68F973FD59A899B7A44FD48E udaasiinavat6
684,883,617 *46B2E2C731BB7EE20030C31796C80DF058CBC465 udaasiino8
684,883,618 *46B1C5F32279F9F756E984DBCDE0E5AEC59EA5AE udabilising
684,883,619 *46B09256CBD777D1DC1FC434CF6C2D18863F99AF udaishah
684,883,620 *46BDEC72FF27B4EEB3C59374ECA569AB27760829 udaller7
684,883,621 *46BBE73039985C016C59202255E616D01D85214D udaraats
684,883,622 *46B074AE81A41EB2F10D895F658EEE71BD5E2800 udarbejdendes5
684,883,623 *46B654EF9C9DE0EC09968A66A426BEAE3FEF09F1 udawanie3
684,883,624 *46B13FA50BA2C6D4ACB09C4A8081F8B0C8A9441D Udayanamed
684,883,625 *46B738D49751EB7B29759C94F9266261BC0E6B57 udayshankarswain
684,883,626 *46BCE0887132D0C5E1F9C3DF7B5B5AFF11B02221 udbetalingskortet9
684,883,627 *46B95450CB5A351869537ADE3A713A2A9E10C63D udbldte8
684,883,628 *46B34207249F96BD3ADFECA522C3745A67AF527B Udcebsw9
684,883,629 *46BF82A9FE7B264C3FC93D00B4D90CE048B054FE uD!D
684,883,630 *46BEECC753B06CAF2A8032A82E16AA2A09C49097 uddataar6
684,883,631 *46BAFA577126071BB18DDE195512EA4ACD849FE0 uddatakombinationers1
684,883,632 *46B263C799FF9097C880ED84E7BE3E1F33E3907C uddbyger9
684,883,633 *46BD08E59C32634F7C4A0AFE64830C922609AA2B udeatsodlavtlimahbcsunotlimah1
684,883,634 *46B9D0B4D2D3030A010F7C2BF19972F516E75331 udeerhvervendes1
684,883,635 *46BF5035C7DED2D4454D75F29C06CBE5B7CDD937 Uden4dsl
684,883,636 *46BFD85DDC7BA3519F15160A11D854F2967F28F5 UDERNYCH
684,883,637 *46BC68A09E78EBF8D26C47EE301B24FF8E269205 uderzenia2
684,883,638 *46B7428FF169E3A0A1A771735997EB1F5385E96B Udfylds2
684,883,639 *46B6ED8DD2871371A7E3F6251F1607E0612AEF7A Udg4ngspr
684,883,640 *46BD1FEC297F21E4C9ECE8E15C2DF55FA5666830 udgangens4
684,883,641 *46BBD2882C3CFAED83B5EC2A8C4C14859A3D78C5 udgiftsf
684,883,642 *46B9C6A288B217A8619896874F48D8603E7D416B udgoer!
684,883,643 *46BA90F0B384E2F7784946D7DD64BAE72F17F86C udgravning1
684,883,644 *46B1C6AEE33D1CC80FEB041AF099134C1AADF823 udharmottara
684,883,645 *46B3A0628F1487A4E6701C3E2A6711E0C69E8CBE udhavkapoor
684,883,646 *46BE53EF3E7D49310673A2B3B711B9DDDA79A52C udholkared
684,883,647 *46B8D1A114FE20C23697DDA466CF054360D05AAB Udh
684,883,648 *46B2F53CEB538C59FEB51D970567CCF4D22E2887 udia3npffwg
684,883,649 *46BF4BF3C44904D86D7B162EBC277894D1AD7602 udiceriing
684,883,650 *46B37B5C071F32BB3DC07DEBDD552A7A425CAD8E udiciuming
684,883,651 *46BF10A43A75F850556922FB4F8ADCFACDC52F88 udictony
684,883,652 *46B2F59E6118B0A8D3EAD193A3F8CCD1FCEF4258 udiguise
684,883,653 *46B34B9115282142C6C359FCA2277FA9BEB64D5E uditgaurav
684,883,654 *46B692AC8CA6AF7CDF9D9B114151D1F5201F15B6 udithaanuruddtha
684,883,655 *46B9DFC8AA53A89C5712F7273D77BCFBB8171D20 [email protected]
684,883,656 *46BCB7B98EA140B7793AA4E7854317AEF7CAF78F Udjang
684,883,657 *46BE443701B2E285CCA4B248723FFD1A8ABA5984 [email protected]
684,883,658 *46B6133487A438A64DC1B2AA9A14A311D53D287E udjeljujem
684,883,659 *46B1941E136099E18CAA3A217C1116BDB3C7A4F4 udkastnings5
684,883,660 *46B9BE238F81ECEA866E92E0EB1DF1D850574DCA Udkldtes1
684,883,661 *46BADF6D34C7850C774DFEA6822627F04C4B9B25 udkommanderet3
684,883,662 *46BA79ED23116220D810A704FF43747F4F6B8A3B udkringth
684,883,663 *46B7B8AC19C6EA6BABBA43978F4CE9660558FCE7 udkrystallisationensing
684,883,664 *46B0F0BF7AD980482D6676E6BD46219BFDFB8FA4 UDLEV
684,883,665 *46B2369C72828A05A9A8DBF1FE00217DAC88E44A udls
684,883,666 *46B2C732D918C249B8AA7AAA73935B66B87CC79F udlyhamz4
684,883,667 *46B305E6E4090E1ACDF8509A11144DDEC3945C1B udnkbdxt71
684,883,668 *46B37444ED5905157E463283183C62347EDC6EA4 udnopser3
684,883,669 *46BA0222268E185BEAC26C6DD30D77AD0D828F06 [email protected]
684,883,670 *46B4C544F5A6BE46CC03AA86CC084643B378D2E2 udojustice chima
684,883,671 *46BB57BEB4AB63E721B04DE4D9C433C82BC4B635 udomeric3
684,883,672 *46B692CC5A4890B0AA41A78CCAC6774933B3DCF1 udoskonalonymi
684,883,673 *46BCD55E80B326F2E7098F405DD135AF4B771E3E udp-glucosed-glucose
684,883,674 *46B9B9C30B9AA11D3288399CDCCA52ECACAE7336 [email protected]
684,883,675 *46BBBCCCD1251625472B6B9E8D4A78A6BAF1CED7 udproffset2
684,883,676 *46BDD38E92A4BC31E9DB5E7FBEEBF30564AE52D2 udraderingernes2
684,883,677 *46B5FDE485731567CC25400EB58EA3DB38588110 udr
684,883,678 *46B2815164F50AD95C293071EC7CDC74BCA9EE2A UDREJSE
684,883,679 *46BE0E2DF208BA3DF8AFC9563280940AFA327F74 Udrizzt8
684,883,680 *46B8FB953F98DDFA0F5412C18C4F2559D3CDC930 udrullended
684,883,681 *46BBBDD556F34D59A8449933CA4B8D0A8D4B5E42 UDSAGNENE1
684,883,682 *46B2773DA7B66ABD94A37D35F13D4DC94C4FABEF UDSAGNET0
684,883,683 *46B4E5B4888EC3542F2005169C34C0D7FCD4BB41 Udsagnsord9
684,883,684 *46B3CADA9AB5DD8BF6949A6A6BE042CEA8ACBD9F uds americas tmm
684,883,685 *46B29D009F1B93EAB4AD615F8ACAC494CBF45CC0 udsbfat38
684,883,686 *46B2E97AC5C4C3F882D165B9F1A378F1647AE9D7 udshelac
684,883,687 *46B824D46E81178E1C74EBAD1BD88838DA462BBD Udsigtstårn
684,883,688 *46BA799A621E0D2A9FB574280B502598980BBE6F UDSKIFTNING7
684,883,689 *46B5BC02E64A9438B446D9CACE6B91E97AE3D723 udslagene4
684,883,690 *46BD9BA4FFEB8021303D4B2292343E5D7155A30E udslusningsinstitutionered
684,883,691 *46BC25F3DD83184C1F834A5D1350BDAE49116157 udsmidningernes6
684,883,692 *46B462A82959888EB41898CC484939B42BCE6194 Udsp4lt3
684,883,693 *46B7C81887CC7254F9313A63F515E00733CDDE69 udsrr
684,883,694 *46BAC30FD2F0FF42237942CEE9612383B26B9C51 ud
684,883,695 *46B1D464FA271181EBD6D35BD4AEEB39F788CB78 Udstillingscentrenes
684,883,696 *46BBA5DCAA58B1D62D4B69E40D131CC3D2C39228 udstrningernes6
684,883,697 *46B4B3F3FDB006DC3E300633E4C174423A10504F udstykningens2
684,883,698 *46B869C4866B16A2CB6D76FAC463BD0577E6841A udsvingsintervalses
684,883,699 *46B33BCE2427CB132C551F69935B91176E15E2AB udsyresing
684,883,700 *46B86CA1875D37B349A3F9FC6849EB8C0E504000 Udta13nd3
684,883,701 *46BBDBAD906F4C53B2480120DE22E1AC160B813B udtoemT
684,883,702 *46BE9DDB360752B9C0B8CB72338803AD09D1BA6B ud$tykken
684,883,703 *46BB20336EAF2382564D1A2F79B7CBE36D971D5F udtyndingszonerne9
684,883,704 *46BD6CD111F5F286A01531A65A5AF5492E4D2D2E [email protected]
684,883,705 *46BDDE29C663B1E1CBB993442B87920A08427C20 udubinu3
684,883,706 *46B0FD696E2906DD25538EC28B3B6844002CA3BE udufacekzl
684,883,707 *46B667BCB408FEA2A81D0299CCDF56BC2C967CFC udukuduks
684,883,708 *46B54DE713469D74411D20E3AB7726F83B3E0F6B uDut
684,883,709 *46BA5F721B2D558CFE68AFB3796F50AB95F35EA0 udvartaya
684,883,710 *46BD5300C369AD58BCF451535B6F1B0783D44164 udvelses7
684,883,711 *46B442E40CD9641F44390725E6F6F91B89C9D034 udvikledeses9
684,883,712 *46BCCE936903CE2C9588303349B95E34126ECFB2 udviklingsland4
684,883,713 *46B9D515F6C0190F3260ABBA120B1987F0B09D3B udviklingsmodellers5
684,883,714 *46B0F6DB928698A4ADE8957C84E00EC0E42811A5 udviklingstrinses
684,883,715 *46B096767163A87355AC99C6DBE6F87B147E60AF udviklingsudgifts6
684,883,716 *46B0B814FB8E752BFC714D18DE019355EEF920C2 Udv
684,883,717 *46BB170D39C02B4586695BD92D3EC3128388ECAE üdvtörténet
684,883,718 *46BECD84C4117030D817294B8F9AC7BD10E96733 udyuktaaned
684,883,719 *46B845BF45FEBC66BB86EFEBADFE13AB16697142 ue$&
684,883,720 *46B263065D6FB8AB448F3B34ACCAFEF11452A960 ueberhaengtet7
684,883,721 *46BCB37F01710262FEBD350CC026C51A25F6A64C ueberhobens
684,883,722 *46B300F3EFE58057243FE2BFB157E22144B3B862 Ueberint2
684,883,723 *46BF990F2810F26E08D88C5AE8BC07EAC8088E94 ueberlebensla7
684,883,724 *46B3309AE467484B49BAC6CB2B97316C076225E5 uebermodern5
684,883,725 *46BB63DDC759ABC53DB3BBB1EAAC8ED6EB28BFA5 Ueberquert
684,883,726 *46BBA3460C86DEBEB67208B98090804BE97A4D25 ueberschicht8
684,883,727 *46BC3DC9841128BE77A1B0952BE66D96514EB10D Uebersetzungsp
684,883,728 *46BB3B7F1DF0AFF867B91FE352BDA1E8FE1B02DA uebertreffender7
684,883,729 *46B8D04B6A74C7341ACAE27284DF370DE209FF2D UeBKgNW25
684,883,730 *46B0BD86D7A762C491749FC7EE444122A246C714 Uebungsfelde
684,883,731 *46B1EE0885C67B019EC39AAFA805F4DCFBCEF345 u+eD
684,883,732 *46BF1FA4664A311E5C32BA36B43ABFF8EE13D8A0 [email protected]
684,883,733 *46BF907A45AC582572BC0FACEE0F0EC4C52731F1 Ùéétù
684,883,734 *46B7E2F08E731BEFFB4B59A226E87BA38D5D1A30 UEF0KP946TGFE61S
684,883,735 *46BA36E97EEBB95ECED1A83AD72DD23370046BEA uegennyttigeres6
684,883,736 *46B0E2D4CF025C3095BA367DEF8B6B1F7B034AC4 uehara‎
684,883,737 *46B0C659E719E7AABC5F130A43242427ABEDA100 [email protected]
684,883,738 *46B228EB6C651BB36501549E0D67AA7AE1FC72B7 uehrdame6
684,883,739 *46B8A03B4074563428EECDA70204CE3D0D39C634 ueIS
684,883,740 *46B1C97C6BD6515453108BD33304DBEFD10D877B uejdinjene
684,883,741 *46BA48DA7F13A0C842D1BC08B217444DA9FDBD12 [email protected]
684,883,742 *46BCC2A4228258683ACD9B562C1AAC7705F96B4D uengstes3
684,883,743 *46B5B79C190BF3E63C58C1F1FEA647B98394343B UENRI
684,883,744 *46BAF139CB3F2201A23AE9C21A5BC7E1B8A63774 [email protected]
684,883,745 *46B0AC3A8F883EB42BCE51BF1ADA94A8EACD84DB Ueondes1
684,883,746 *46B6293C1FE1575527554E3DA1E957D31587B1C8 [email protected]
684,883,747 *46BFFD7A84951E617C20B3A30E22C2DFFEEFAC8C ueOz
684,883,748 *46B348D228F22745C0147B8C7535D97665AD87F6 uerblümchen
684,883,749 *46B22DA456A0707AC82F0A5747F4FA20D3F6913B uerstatteliged
684,883,750 *46B49353143B387CDEBAEF0D243558EE53CC33CC Ueshiki2
684,883,751 *46B9D4B860B9A9EFD7D21DE2E9330D5F3A42FE31 uesnetxe0
684,883,752 *46B7BFF4DD2342F8A226834491F37AC69428AC49 uetterst2
684,883,753 *46B78FA5838561A668C06593F3B7F25BCA01F235 ueuuspxek
684,883,754 *46B10465AF54C664D07F69C3B302EEB88186C794 [email protected]
684,883,755 *46BD792A80A5C2773DD3E09B71CD234F611E8299 uEX[
684,883,756 *46BB9AB394A374E23363347741235BC17BB881E4 uexdXr
684,883,757 *46B68E2DD8A3D43156EB999068ACD4ED7361873B uEyW
684,883,758 *46B05C7FE1BB63A063505A145C0D9B07FE89A95A uF;;
684,883,759 *46BD0246BA4142BA1D0AB4C0D1DAB46A0320B2A4 [email protected]
684,883,760 *46B7E95320EC519859DF4EC0DFCBA6B4227F0FED uf0713
684,883,761 *46B74179B49ADD099149900872EF6CA626955CCF uf160440
684,883,762 *46BE77C460DCC5DA40368855CC5EEAC081FB0BC5 [email protected]
684,883,763 *46BDF33E641602F41B9E901238712708EF106B88 UF3yb1g30Io
684,883,764 *46BA6DA8429D6F64CF967E0DCE500590D63179D7 ufc88
684,883,765 *46B4853F08DEE75A09EB3755FE16F479C23F03D0 UfcBrazil
684,883,766 *46B19D58E8B269740AA9B14A5E3354A89165D966 ufdonny
684,883,767 *46B3C9CCF4E97D135ACDB3D64C2CA09D2F283184 UFERPLATZ
684,883,768 *46BEA449E4DCF54D5D6BD31E8FB35309CF2BFCBE Uffalugging
684,883,769 *46B82C86EE6E1639461A5273451333B5D5689392 ufficieremo7
684,883,770 *46BA8073883B9A97FDBD760E7BA85CAB3E197834 UFFXLXLO66
684,883,771 *46BB1A1867B671369AFEC5F535D7DA7D8CEFFA09 [email protected]
684,883,772 *46BDA4DBEC9219969A3DFA6742B256D2BF5B5A2D [email protected]
684,883,773 *46BC172B77D8A8E67895479C1F04FBBD3459945C [email protected]
684,883,774 *46B0A60A884FB86404BB812FD092AB5B3B73C769 uflmlinnadbsw3
684,883,775 *46BEFBCEA3B1F1615DED86FD81EB5841D5D87C19 [email protected]
684,883,776 *46B16427F00DD9B56E62515BAAFFFF9354784BF5 [email protected]
684,883,777 *46B7DD41F97FF087FED5701AA17449A197296F34 ufohgim95
684,883,778 *46B74A66516F79294389465070DC27C7A3D9E886 UFO-KRIGEN
684,883,779 *46BF897D526123E2ACE4815652D013BF2395B2EB UFOMVFAMC
684,883,780 *46B5459B4868F99879E8C2D0FD6820510AB66CF8 uforfrdede3
684,883,781 *46B5564BA2A096434B0F0EC84CBFABE1AE104CD6 uforlikneliging
684,883,782 *46BAEA2CC8C6ADA0614A961DF1B20FA3E0118C71 uformen1
684,883,783 *46B3C2EB2745E2152853F53AAA2E7DA85D3ABEDD uforsteliging
684,883,784 *46B8CFFD7120F692A231B26FAF9BF5905ACF519A „ufos
684,883,785 *46B2B4BC0544D7B722A118B8AFC2861719E8B31C ufosightingsvideo.comwww
684,883,786 *46B27C61714FCF3F6EF01CE8B4990BE408D348C6 [email protected]
684,883,787 *46B490FB845DFC6531BC0E1E76E92769B498F392 Ufrakyd1
684,883,788 *46BCB5C27C4602E86489F5130CD84B5F6193E5C0 ufra zain
684,883,789 *46BDC8449FFA449D547EE1BFF554FCD5A6375DB9 ufsp-rbi120707php
684,883,790 *46BBDA13986A0276A5F3815EDEFCC286F654671D uftankens
684,883,791 *46B97439724A7811A7D3E17813A7ADA181C66637 uftneser5
684,883,792 *46B53B7F81C16701F1DB63AFC17D5C1AD6DA1381 uftsurht2
684,883,793 *46BDC7374EC8FFE23A3DB2187E6F04A6BA92DA39 ufVA
684,883,794 *46B99EAA4E8F64646EC73C4E937BE3443F98CEC6 [email protected]
684,883,795 *46BC6F23A23DCA09D125B9BE8EC6064DFBDE48CA [email protected]
684,883,796 *46B429357658456720C0950E759F06417440C361 uFz,
684,883,797 *46B3240016E4EB1BCD154021DD7437E1693C6CE0 [email protected]
684,883,798 *46BEF87D6EAFCE417F68C2071D38F5A650EEB8F4 u:Gaaa
684,883,799 *46BD75CDA5490DEC9DCF4B7ECBD15759F8D1F49E uga muganes
684,883,800 *46B23487124D40F9E0B8936B9490CF4D133B7BFF uganayana wickramasekara
684,883,801 *46B96CFD969F2022656517E1B80055A7E119CA81 ugartsua8
684,883,802 *46B433BAF2F296CFB5D2021FF767E68C5BFD40E6 Ugasimo9
684,883,803 *46BB31BD302582EF1A3DFC3529BFFD6D36B2B9E5 Ugasman5
684,883,804 *46B0D5037AE0DE008D41C4BDC9A792922683DCD8 ugasnula
684,883,805 *46BE56968EC775F29C9FC1CFD115FA55EB165D68 ugcmlx9
684,883,806 *46BF6881739E61D7D12CFCBFA2C6D6B1E066F294 ugdah
684,883,807 *46B311A71393C901CBB3A067A177717378405257 ugeblad$n
684,883,808 *46B348B18301E75F99F3CC39B0BAB09070B21357 ugedachten
684,883,809 *46BA7B69871A64FCE7BB67E96CDEA93D5963635A ugeskriftet5
684,883,810 *46B72D71593384570C9EBDF38BEE1DABD313E6EB ugewise
684,883,811 *46B37B5C02C434ED666BE19BE01DE5928D28562F ugfuaa
684,883,812 *46BC3C8E2E9DE0279D40524B32A05A7224AE0B52 ugg-coquette
684,883,813 *46BE53B5ADD48D4901E49271C81FA860F8AA06CA uggiolo1
684,883,814 *46BC8218AFC85C2A1B3469C56EAE8F8A87B82C7A uggypup
684,883,815 *46B3B09E13BCE7FBDBB08D0569B4EC27759D2BBE ughedqbnajmlk5
684,883,816 *46B934176B60B3EF82C1CFF1EEE261EF2335BB09 ugh.wppokemon
684,883,817 *46B4D6E5A66592CC4B00D5838ABD0F21D11F4C6F uGHx
684,883,818 *46BC5A5784D4184E799AF405283438D5032DE772 uGI+
684,883,819 *46BFF303E7635F6CA8C1E634A604C2ECA17CF968 ugidneabbed
684,883,820 *46B1B664950612D417F7A40CC4F6C2EF75E4D622 uginekerr
684,883,821 *46B1A35F79AD770C95D38141A4E68D8DFF5258A1 uginule5
684,883,822 *46B8A8F1F796CA18A49A63F0A19DF26A6F93235D ugjaagde0
684,883,823 *46B30C0F5AA7B773920BDCE580A21327A1563AAB [email protected]
684,883,824 *46B2237FD70CD002CF6C0FDA373FE337030782D4 ugl3r5
684,883,825 *46BCAC195C528374A624C331C7203BFCC0861DD0 Ugledali7
684,883,826 *46B14B803038772F27B7783F5A83D3CDD118415D Uglednogging
684,883,827 *46BCBDF6D4DC7CC52844ED04E5FFF6914EAF0142 Üglià
684,883,828 *46B26B0A093B2C43A727311AACF0AA7CEAC20728 Ugmtbsw3
684,883,829 *46B87EADE7C0EB0D48960347C79F02C30575505D ugnaram6
684,883,830 *46B925E262B75991A310B2352548A70AE27B026E ugnherrera
684,883,831 *46BF8EEF203CC611B6FD1DEE4257586697A8F70B ugochukwu marcellinus
684,883,832 *46B6B57C2910131D24A8B873413A9C772827FDF0 Ugodismo1
684,883,833 *46BA5F0DAEB50ED759BCF3E224504718D11ADAE8 ugo-mercier.gouin
684,883,834 *46B0F3012E2D0FA449CCEF2C4DC6B3883C0892DA ugonotto8
684,883,835 *46B42768A8E9146452BDB33D7787C07376550371 UGOOKK
684,883,836 *46BA44C50624F92F42498BAD692388DD1AC5E757 Ugradert9
684,883,837 *46BAF1E81E4925622D32EA2C0850D96440266331 uğramayabilir
684,883,838 *46B0FCF308A2CD4C7DC54CEFB27878D6F0623DBC ugraslara
684,883,839 *46BAC191EE7C3555F377779EC52827E344449D18 uğratacaktı
684,883,840 *46B15D341F2A451342053A144B9569CC59C66B38 Ugredel8
684,883,841 *46BB1EF0BD5706150282B3F1F4CA6FEBF68649A1 UGRHCF98
684,883,842 *46BE6E8B3063E30DC0E0CB1FAD82FFAEEEFD5E1B UGRNFRM98
684,883,843 *46B95CBCAECF9271BC4478F8559CE327DC7EB0E8 ugrólábas
684,883,844 *46B51E704D20EA48362394DE4E8656799403B341 Uguaglino2
684,883,845 *46B52EA8DE8FB0CAE78F2BB46B810A99C5C80D31 Ugualis6
684,883,846 *46BE674F6359A14898F029CF34912F1C09364368 Ugudoroed
684,883,847 *46B9B0C74E65B775096525161E4655CA30E87F53 uğunmak
684,883,848 *46B85298EB4878D3B66D617C05F9DA2AD2A29D63 ugur tasci
684,883,849 *46B0E3176CCF3A434DBFC451A7347E5C65BCDCE2 ugur ulusoy
684,883,850 *46B9E820842E2C604E56E2EAE570CF98D9AE0CF6 Ugwuegbu1
684,883,851 *46B03F5666BEC405DB555BE8FEF4A3361BF41FC1 [email protected]
684,883,852 *46BE5A215AC1A18BAD4687358BFC72E8EB031B09 "UH
684,883,853 *46BB3CD65C65038230D8C94FA1CC95197726E7B3 u_h=
684,883,854 *46B79919B4EB05AFF5C88FB3D65DF731EA355470 uḥ
684,883,855 *46BE9C6EB365F62285BA74CD250CE7EE550BE6E8 uH|3
684,883,856 *46BE5D9F79373EBFD175961A313F003E655A0041 Uhamlet0
684,883,857 *46B1921ED86B46737639F318DF91A9DBC74DBDB4 Uhartiarrak
684,883,858 *46B1EA7F0EFD00EBA69E37CAE8955DF952BA9A51 uhbfrtsekdbnly8
684,883,859 *46B11DC825F9C81D14DDD3EEE42DD74CB963DAB3 uhcsreit5
684,883,860 *46B8D40716D4ED9C0A17448129B281FD3D016FEE uhCt
684,883,861 *46B4419FF5534BC83197AB144EE29D547DD0FF89 uHD-
684,883,862 *46B8E50C5BA35BA37D8F52357EF978E857CB410B Uhdwrmo1
684,883,863 *46B56A2F8FACC7E9D6F41D959A9F6650FABEAC8D Uheather3
684,883,864 *46BCF1C7366E983B72BEB4FA21526B3480BBB36B uheina lahaina
684,883,865 *46B3B3383F1CCD45078D2B493141E5193D7F2FD3 uhfhtvgasfrwvos
684,883,866 *46B7B094241477C4D681E1835ABB9C67950D8FAB UhfLBhbOUEg
684,883,867 *46B4072BEB1AE0889E76767FF0173440FADEC367 Uhkaamaed
684,883,868 *46B994D9EACED0E9311FAA5EEE685216A056AE40 Uhlenbeck
684,883,869 *46B972681AEC0C966E63F37C47306231E24083B0 Uhlenküken
684,883,870 *46B228B18619A394F152FF34B2149639EE5A5061 uhnnamremmiz
684,883,871 *46B6693ACDF0D3C8F974C59BCEB2703595DD3A88 Uhnruhced
684,883,872 *46BDA165B20463669EBA463D02998DD2B5D0F6F3 uhOI
684,883,873 *46BDA9A5D6E83455CFC638FA60154B426A172FE1 uhpneibneid0
684,883,874 *46B53EDBB8C17F8EB73CBE4136539F87EEED6241 [email protected]
684,883,875 *46B5F595F506D61FFA5DECEAEE917F4B8883F396 Uhrmacherwerkstatt
684,883,876 *46B108283D62B939CD6D11658138CBEBE71DCC27 uhtgnuat6
684,883,877 *46B5276EB016F3B33092F0DFD81B2817A761C822 uhtracmg
684,883,878 *46BA2D612F18783D15510C89E0932554D467A07E uH,U
684,883,879 *46B7F7C3809E4AC70B487DBFFD95FCDD19363186 uhvnryosssd1
684,883,880 *46BAB7406BCD8F5231E582AC96E29884A4C20F21 u[hY
684,883,881 *46BE7A6E4B646EF7C0D8EB2A76A0C05CE7155FB0 uhzdsawkd1
684,883,882 *46BCAF5BB0171B36ECAAE5897605F9B19BA575B8 u"_i
684,883,883 *46B495F880C2CF537F3AB7328749D710114BA339 u{I9
684,883,884 *46B4CC5D28E04686CFD7892B85A1C88E4726059D uiaopbx3
684,883,885 *46B8ADAAB0690B5B54ED392EBBA273260E2F12CB [email protected]
684,883,886 *46B4680907893BD4C2CA6F4C3EFA37185C8A774B uib01209
684,883,887 *46BD2493F66DA8CB29DB388FAAAF28CC14DA66F0 uībaru
684,883,888 *46B948F03300A0317CD65C44E159519C56D08A44 uicidisted
684,883,889 *46B1CBEC6816A144AB7E0D74A38012D131566FCE Uicisseses
684,883,890 *46BD7DE02C090D46A1E4C77D337E8EA68E2EB129 uicmwlipS
684,883,891 *46BC34D41FC769040FF2054E5B112CE831F5F526 uideuide3
684,883,892 *46B03666D6A3CD033DEF4BD0B16384911DF96006 UIDY
684,883,893 *46B5DE0AEB94D461B2805B20FF58D569FC5DB466 uiessei
684,883,894 *46B888A172C4DF45302C16E2C390972D5A65A28A UIEVQRS29
684,883,895 *46BFD67FE3B2089722B5898A48F3C98C879878E8 uifluc
684,883,896 *46B8908DE24ED4B26722BB0C7C1EAC4C35D2C951 UIJ2
684,883,897 *46B920ED84A1C7D1EC7164D2A72518D82275F74D uikhrbswed
684,883,898 *46B1EA0AEE423190A0729D00F32BA289FF4684D8 uileuiled
684,883,899 *46B1186C6B6028EEB728242B682318D615EFEBFE UiLford
684,883,900 *46B3D44ABE6687F2DBA777332B26813CED2962A9 uiligeegiliu3
684,883,901 *46B420D20DEE868F06278C5472F6FCA846393B8C uilkos1
684,883,902 *46BC89799979534872917FBD425A9371F15DD97C uimodst
684,883,903 *46B5008582FA4A322B554CE967EEBC3B9F74C6E1 uinceris
684,883,904 *46B6ABCEEE547C19868E5C4A25B33397078F6B5D uinculorumque4
684,883,905 *46B34406DC84F5DD1F2EEAEA2F47915B919DF8E0 Uinnfvk5
684,883,906 *46B93E636D4638A0498429826373F287447E351B uinsm
684,883,907 *46BB3634A2B1B0836B24C10BFB1EA3DA533AD60C uintilajs
684,883,908 *46BBCAE57C86654D71EEACB8CEC3FEA1A7F16625 uipgs9rslom49qsf2pyedg
684,883,909 *46BA3B13E934C3C055270A4122A6B2E8416B4F30 uIPYObSaoPy
684,883,910 *46B89F56214563B3757FCDC2C58C12DBDCD70C4D uIr)
684,883,911 *46BE1D1A23605E5E716C44F7AD030E489FB5BF63 uirte
684,883,912 *46B957467908FF9D4DAF6F69B56D63252521049D [email protected]
684,883,913 *46B9D68E42E2FF9A9B3514C23B8985D28713DCB9 uisatiering
684,883,914 *46B9E8CD8EE03ACD2D09666E2D64889F6CE0253C u
684,883,915 *46BD7E8425814397DE62F6242623002CE6158DB5 Uitbande3
684,883,916 *46BA37E7749CFEE3F29F767C8110A03B2EDDD035 uitbanuitban
684,883,917 *46B9BF5ACF4D005B1E7B609571415B2B896B33E4 uitboette!
684,883,918 *46BA07FF40BF4772EB227B1497D9A03AA8790C54 uitdelgdens7
684,883,919 *46B7D563128EAD21CD94808F652737CF610C0AB5 uitdieps0
684,883,920 *46B85C737DE0E65A7CBD3F2EC1D9CA4F7BEA0618 UITDRAAIDEN8
684,883,921 *46B95E97BAEA91CB3F6B1EEFCCAE6B7126740873 Uitdrink.
684,883,922 *46B88133A3527F617D88E2A5982183FBF5D66C56 uitdrukt.
684,883,923 *46BEC84955EDA1BC2FB4696A98B9B09337AB8628 uiteenwijkend3
684,883,924 *46B9D7D6ADD71EDD7D7FD4FFAA4C1D3516CAD75C uitennetius
684,883,925 *46BBAB68B89AD87328DC7B38DFB9B65997105B4A Uiteraar
684,883,926 *46BA13E7FA69C8733B8C9F08DDED29E350F79A1E Uitermeersluis
684,883,927 *46B69862A4DACA46303288F65EE22AEFEC5E75F8 Uiterwaa0
684,883,928 *46BB463D52BA2EC2FC846926354A940CF70DBFB5 uitgaanskassensed
684,883,929 *46B39A30E658338D5398D975EEFB521506EA2AF1 uitgeboegseerden9
684,883,930 *46B14A884B9A7C4CB30A42098D8330FA6D7B0F82 uitgebraaide0
684,883,931 *46B8289BFCB6A9E68811547B5D85258FE18F2CEB Uitgedoezeld9
684,883,932 *46BEBC7C6B3DA890CEBDA66A2B95C7499AF57829 uitgedoste8
684,883,933 *46BDF0AF12DAF50AA61C7A34CC67F3563CEBEDD4 uitgekamdses
684,883,934 *46B751B05D765281DDD861A97541A610352833E5 uitgekiemde3
684,883,935 *46B9E56D0C83B4E1EFE4BAE55FAB67EFCD7AE7EE uitgekleden4
684,883,936 *46BDC40EBAA01E11BB9D37CC5CA92913A7E7916B uitgelachenening
684,883,937 *46BC90CA546C50ABAC355026B41CCA9543E2A6E5 uitgenoing
684,883,938 *46BF79A7D17BCE8A2F713A397FAE118B30A9BC91 Uitgerekendst3
684,883,939 *46B8A78EC15EA1A30F6E59AD4899CF1F5D3E45DD uitgerookten2
684,883,940 *46B5D9D1D65013EDEFD0BABDCF070BC832528259 uitgeskiet3
684,883,941 *46BDEEF1148F4C9928B4771AF693308850797BF8 Uitgesmeerd?
684,883,942 *46B8880EA16212B8D95D4C8010B17C57BE267471 uitgesnedenesed
684,883,943 *46B4A448F69BDA4C94E8F6889ED55D4B6A13DBD7 UITGETANDE1
684,883,944 *46B60EB9BE3729716C8850CB54B51903DD204709 uitgeveende4
684,883,945 *46BC68A0720027C70C6C7782BD167A121AA77985 UITGEVROZENEN3
684,883,946 *46BFA280230189E19D9B6FE7D40DBE728B1B1AF9 Uitgewaa4
684,883,947 *46B69FD028699EECC0FE03E435F3DEDF3735FF6D UITGEWISTEN0
684,883,948 *46BC98039E01F4F92DD9512E25E95C82497ECF8F uitgeworpens1
684,883,949 *46B2F5BDEA3F9BBF6B0231F7908FC74398994693 Uitgraaf3
684,883,950 *46B5DFDEFBB324191A5B194FEBBC30456EEE959F uithakken!
684,883,951 *46BA0B2491E2D33EDCA808ACA26A805C54871D0B uithouderhoeks
684,883,952 *46BBE50102E909B8991FF3AD7FF6903B42E8748F uitkamts4
684,883,953 *46B65DAC9B21F068BD0B0FC12B9BA3414B5CD28D Uitkerft0
684,883,954 *46BBEBB6D0A6E12EF5F2452F5195ECEFED9E3C78 Uitknip5
684,883,955 *46BE8ADBA82DFFDBBACE743AEF6CCDFCAB5C5D5C Uitkrabs0
684,883,956 *46BA8E99E314C73ADC5500D7B56FE080A6E3B3CB uitlaatgaseses
684,883,957 *46BCB69948B33FE52D5E195743642FC5E44C8BBD UITLACHEN1
684,883,958 *46B2E6B845E2457E4691DC2398D4017501C56484 uitlichtten1
684,883,959 *46BCAD1B5C6D7CCFD11BF92C951B226FC701414D uitliteren9
684,883,960 *46BC71CDAEFF23B015C3A3FE6F59041EE4331154 uitloofds
684,883,961 *46BF7164363567878C58CA960A76FCF6532B7731 UITLOVEN9
684,883,962 *46BF14290818B22486C13DC54CB36BBDE2FAECBA Uitlucht3
684,883,963 *46BBF3A65E9085C61CEFE235D9748F3EEA91011E uitmunt!
684,883,964 *46BD8169BA62D90FEA04718317F1817DF79C24F9 UITPAKTEN9
684,883,965 *46BE5D735D0BDB4E4F3F2FA51BEB4E2DD32998D3 UITPEUTERDES
684,883,966 *46B15EE453CAAEAF8589F85FB07FF5680D5291A2 uitpikte8
684,883,967 *46BB52DF20DBB951CADDFA8A2D69056EE877F202 uitroldes6
684,883,968 *46B59BFE22D8C5B57A50E0D731E4C2352C82A5DC Uitschot6
684,883,969 *46BDE8BF956CE4D5E040F69821AEE40518644D59 uitschulps3
684,883,970 *46B8C9F2991FE7508D48F975B86ACF5F67A8099E UITSTREKTE0
684,883,971 *46BA1DD29F78644AAE7DE164125985131437A25D uittamassa8
684,883,972 *46BBED99E38D1E740EDB93D8B2FCC5E6FC183ACA UITVAARDIGDE2
684,883,973 *46B7C930AF0726EB965BC7FAD06A5E13EE072760 uitvee1
684,883,974 *46B5F009550871346D77BA5524B9359C27E0F667 uitverkochtes3
684,883,975 *46B0D3D2BD28FC7F7EF159BAB6C9FE7139BCC5CF uitvloeis4
684,883,976 *46BC4CFC97A692CA9255D6C278ACE2BE4AC240B7 Uitvoeradresse
684,883,977 *46BEFE4F01659E8DEB85F73E6E5252B1C48F1437 Uitweenden
684,883,978 *46BED4DE1937024C2C80330F744F8504D55D6F17 Uitwissen!
684,883,979 *46BEBA5072B3EC76C2248A07FA5D7AD2531F8CC3 Uitzings3
684,883,980 *46B30F151A8F0C3FA74BC61AE73237B86BECF33B uitzuivering!
684,883,981 *46B0A2043F6423AE3239768642EAE2236A57A00C uiuoxnns
684,883,982 *46B02A5DC3AB1D1838168E48C45919A82E2C58F5 UIW94ZGSGZ3J669YLPS98Q21V
684,883,983 *46B880ABF902BB8E1054D32DA4EAF79204730FA4 Uizeu
684,883,984 *46B3D78E80F2FA65538C342326E3158FB3E4D8BC u#J`
684,883,985 *46BC90C0E20B63A12EAD04D942706D28A7DFA0DF uJ/=
684,883,986 *46B1E1DA19088A412A20D72159B3080C826BB627 uJ{
684,883,987 *46B613E7FA3DE48D6BF2625061FFED902C91D10B u:j'
684,883,988 *46BC5E20B320C10E4370C8C0E72F5A73D8ABF652 uj166
684,883,989 *46B1B22684B5038C12014EBC4F35D083D7CC89CE uj4ixapc6jcc
684,883,990 *46B1BDDA850394D728FB427383797BBF107CA5F4 ujaan akash
684,883,991 *46BDC099D56C1CB264613E0F42352014A7D4137C ujakuajiM
684,883,992 *46B5E12F10F0E6D21AD493F2B6940358BF1F3A2A Ujatbsw4
684,883,993 *46BB612F8E186BD7B2664FF833BC2A3D07FE2336 ujawnione4
684,883,994 *46B657CBEE74F8D510DC5F73274B8F59B5352016 Ujbmtseso4
684,883,995 *46BF804534B780BB68E43B276D24FF18AEAD3658 Újcsipkés
684,883,996 *46B92257689667276958AF7402452185740B5B72 uJe]
684,883,997 *46B99BCF3A4E2707152D23C5261D1C9058F065BD uJe4
684,883,998 *46B200888BEACFACBC0807B278D957C529266606 ujeffrey3
684,883,999 *46B10AD56D2870B002B3D5CE636122EC5865483C uj esa
684,884,000 *46B4108FD0FABE3DC39082AB780C557470E479C1 UJfSe
684,884,001 *46BACC5298CEF99E422C101ECD22ACFDA76F54B7 Ujigawa02bs2610
684,884,002 *46BC39C56EBCCC25C914885D15020191564A15B9 ujiko123
684,884,003 *46B16A5AFDC81FECB373FF14EA06E40F443E804C [email protected]
684,884,004 *46BE3226E3ED23F3128B001E27C4919DE526A3D7 ujivajlbrbjaN
684,884,005 *46BB58C547A73E2E182E1A95063CED5A81C527F5 ujju darling
684,884,006 *46BDE737AADAFFBD07C161E2A5F9149B20C2D420 ujjwal shorewala
684,884,007 *46BB97D823A3A31CE4AE34C80E06767E19062642 UJLfOl
684,884,008 *46BBC721FB1AB0BFD00C22B330BB0EF1C4BEA269 UJLXSREM
684,884,009 *46BCACE7FE8398D08CC72F6ED10981424B1C4968 ujnifles5
684,884,010 *46BB0F81185243950384916E72FF3190D1D03E3C ujotslot
684,884,011 *46B544B471C32C0736BC888F4970C68F3BE23E4D UJPbvzFPZVY
684,884,012 *46B0BB2FD05DDFC60DE5D66EB57F1376C0550AA3 újraegyesítik
684,884,013 *46BDA80823E6C1AAB428CD43D37EACDAC5E2582F Ujrajatszast
684,884,014 *46BD426C2CE6280367CF9939BF002B7799D2CA1E újraszabályozását
684,884,015 *46BDF23F95ADED8D583D738765CB1251C2FBF6D0 ujrjestj8
684,884,016 *46BF8BCA23A698FCC4B7FF14F0932A4A4328795B ujrymrgxpqz1
684,884,017 *46B78594EDE16E1A3F23E394D5BC583B380E98FE UJSMHCTQ63
684,884,018 *46BB423612906D24056FB7753771FDFB0471728F ujubixm7
684,884,019 *46BBB98F26BEBA0115B7DC28CE3205A36F15444E ujuqENenIY
684,884,020 *46B85ACBA045FD1509A6353D52115C4515F6A003 ujwalnimgade
684,884,021 *46B7B3B0E4503AD92D65DA550E3B9A5C62132D80 ujYMcP8Qr7s
684,884,022 *46BF02B5F59E559F70EE83EFDEDF906B562BA93F ujzfimiaj5
684,884,023 *46B7215622F8EA3C78F5041A05A60CCF8B76C859 [email protected][K
684,884,024 *46B787FDB5C5DFDED670069EE4B233A53232A6EC u*"K
684,884,025 *46B16A8C679BECFA2A9A4E1D297C806D05961EC5 uK{-
684,884,026 *46B158FAA58BFBE408699AFFB3FF8AA1091CC98C uK0O
684,884,027 *46BB7C6EA0DA69BFDD33871F1D13DC2D3CAE004D uK0R
684,884,028 *46B510333052771BF150FE2389EB84BA6D958C53 Uk14r3$
684,884,029 *46BE5A094F60CDDCD00782D5F852B226026B716A uK3i
684,884,030 *46B9C5BF42C19EA248A48AF27786FC5F6DC23CC0 uK+a
684,884,031 *46BDCEBB697A3927E88228C6833E5D795C493BC7 ukagiez9
684,884,032 *46BECB48742833E46F85B647FEA61D10DD820B32 ukagirit0
684,884,033 *46B1F0DDE70C63AF6576D67E2A67338EB7C61CD4 ükapámat
684,884,034 *46B24E18F2FF8D81779FB38C8994C94D4039B310 ukauters
684,884,035 *46BD0A0EF9A7963E676AB400A182D7FC18973132 ukayknis8
684,884,036 *46B488681F51089DBC08D42783BB6C863D6DBFB3 ukayzizes
684,884,037 *46BB935505E2CFB14F9F527068ABDF75B2C0CBAA ukazkama
684,884,038 *46BF0E6039801C42B67A38752306835BD4D1894A ukcnn5y8gay
684,884,039 *46B7A75B70E321D54A7E9B1ED5ADF5A638E8F854 uKco
684,884,040 *46BCBD55F092512829D07DA281B89EBD8EB89042 [email protected]
684,884,041 *46BC9B04DE284BB0200601E0DF4CBA2DDB929E0B ukezara0
684,884,042 *46BFD3CD9F40B4C472FBECA043E84FC93E7843DC UKFRUiUv16
684,884,043 *46B443226676B55A6424C97C9E74FDF1E91F2813 ukhabiganj
684,884,044 *46BB66F48B0FA7B6324B2C7E64541E5C9EBD1611 ukhrid
684,884,045 *46B7A72C1BBDC6A23230D7103A9B92A3BE0388BB ukhszrzrf6
684,884,046 *46B577C4622618BD43C7600083F602D4B1FA6E5B ukiasida3
684,884,047 *46B562F70A651A10BD975D2EF8743000A41FC3AE ukicwF1
684,884,048 *46B48782CA182C63D78DF77253D7810A0932CE03 uKIDdUDWNZg
684,884,049 *46BEA68C679BB5BBFDF219420FC00C86CDD032C6 ukigusa0
684,884,050 *46BE06F4FC63B54165B81921F04B91BAE62B25C1 UKKIE1
684,884,051 *46B0C12A95B00E77508774C831138C0224303E5D Ukkoihin0
684,884,052 *46B8DEF6AE4E3A2AA8FD931E23F631D3E17318FB ukkojen6
684,884,053 *46B16BDE6FE27FFADA30156FB500B14A29A479E3 ukkoskohtauS
684,884,054 *46B2BBE4A8005C73EA954A1B1311A824B693B2CE Ukladan1
684,884,055 *46B131E9AED1C303B1BC1ADF8CEC0D0DD8070E03 Uklar
684,884,056 *46B8E40952DC6FEC5E5F967FBCF15DEF3F8A794A uklarhedernes7
684,884,057 *46B11242E55F74DA9B6A3E72C64A5640A8D0C26E UKLIBRA93
684,884,058 *46B7865D04E508CD5843BA2A19757EC85D8DB878 Ukmukk
684,884,059 *46B7524DEF3CEAC8D9BBEE3AC6123C34383FA24F uknakusing
684,884,060 *46B4584FA80D9FB303D74C8C7A0AB11E276D57FA uknnedes9
684,884,061 *46B22FD0F76BB88D1795FA5BD07E204854AD3192 UKNO4SHO
684,884,062 *46B5CDB561508923736F61E1C2822C16327E1CBA uknvht
684,884,063 *46B6DC8447ED8252C6531225CD6A0C21DA8F091C ukochanych6
684,884,064 *46B1B13EB6173399368D06EEE5565D3E23789CB1 ukoissased
684,884,065 *46BE02845A4099C0869EF7BBF0F21807030B3654 ukoistus6
684,884,066 *46BFDFA273105635C3ACE8A799557ED6F0B2BE91 ukojihcs
684,884,067 *46BB2D2F3AE78EC3A86254D235FA23CD6C9E2012 Ukoknab1
684,884,068 *46BEC9F129C15088F8225170C96C12BCE35400E5 ukokuut7
684,884,069 *46B3A27894C866E581B26AD4B971874C71B7ACE4 Ukosnet7
684,884,070 *46BAED383539CFD257B9EF0ACB33581FA39FBB04 ukosuuyking
684,884,071 *46B98F7EBFE76C4389356D99999A625B2AB6BDD2 Ukoynih6
684,884,072 *46B2671E24063B0B01714D98EAF0C436D86790EE Ukoziers
684,884,073 *46B35C40EC7A83B2257D0D560D5BA0C59FAAD3C1 uKq;
684,884,074 *46BBC67EC469A3ACCA176C200C573FE15C29F36D ukqhmukoyk5
684,884,075 *46B5FA28D3BE88BC8E77D7255E21D14B3AA40D5A ukra
684,884,076 *46BBD933A8ACEFDD5169FDACCB40E147DD9AE9C6 ukradikal
684,884,077 *46BF83D52A6044FD1C56CCCFB06A0B8B87632A0B ukrainens
684,884,078 *46B81143856EEA77B54C50DD5FE804DCA9E21780 ukrainiantalk1927
684,884,079 *46BB1DCB284F88E02F5546F1B3082F4193D5691C Ukretnu3
684,884,080 *46BD36192BF85C1248BFAE1B7BEB09AEBF812BA3 Ukrinform
684,884,081 *46BB5C52F0DCC7BE2BEE470753454AA4CF61175F ukrinternet
684,884,082 *46BB5050395F7FAE91C6694081ED269EB1AD645E ukrissek9
684,884,083 *46BA91D6A1F9D6DCCCEE640087552F382A52DE1B Ukrstio1
684,884,084 *46BDE38E4A050AD5BFDC8465E1EA37D793384821 ukrtelnet
684,884,085 *46BDE96BD9053B490DE3D06840D6FF4F4DAF33CD Ukrudnum
684,884,086 *46BD7D90542DC2121851502C485B9E2666404311 ukrywam5
684,884,087 *46BF5D60B87150E50C2ADE24024796B273CC538E UKRZUL
684,884,088 *46BCECF5D91FCD7E87F64989E1DDA2AEF9A12705 uks#1312
684,884,089 *46B79688E5F46417842EC8A7876156AFB133D0FD uksidsua8
684,884,090 *46B37CCC8C8A4A2216C4F422A7DC34782D3574AF uktureel1
684,884,091 *46B3E02753D79B28980F26894835EE25CB0447C8 ukU~
684,884,092 *46B06B1C9CCCEC04998B992408AAEDE900C273A9 uku945a
684,884,093 *46BA70135A1C411868B19F88A39D2FBEA971416C Ukupnij4
684,884,094 *46BDD2A60F01AF4C54D7F633F354310B1F7E8863 ukusixed1
684,884,095 *46B9668D9395BC2426924A9931F593D42243CA36 uk-waterway-routemap
684,884,096 *46B9F7E81A1F3D57C98A782585E5EB2B5B18DC75 u!kX
684,884,097 *46B5BC837E7282FCE66ECAD9E693D85B7DF98BC3 Ukyogal
684,884,098 *46B098AE4071E5CDC181C2C3B9B1F58EFAA59AEB ul1spb
684,884,099 *46B3865F81D44CCC164542D0338648F23E889168 ul~7
684,884,100 *46BDE914F9606A283F22A35E6766F42F39400A60 ulaalezy
684,884,101 *46B53988D7D1C3B222A7738B882F1AD3C4009AA4 ulaan!
684,884,102 *46BCF0A62B4B63F86C824458FA7A09372C33B857 ulaattia1
684,884,103 *46B049416C95EEB52A73D7D890396C31D0F14AC7 ulækker
684,884,104 *46B085754E5BB4EA428197AFADE74052E816E675 ulafsinnbsw2
684,884,105 *46BD880DBA022DB083A51623BB80B2BAD3EFEAC3 ulaganathanarumugam
684,884,106 *46B373017CF6051DF92589DB8D997C0394355E20 ulanmcknight
684,884,107 *46BA6BCD6DA8151A1D17A71CD27448E72A9F58AC Ulansky1
684,884,108 *46BA9443816E495464608F8C23F9EFF371AA573B ulanylylyp
684,884,109 *46B3C4FEC5341D3CB3310B8BAAFCE6E4CE947F8A ulccmrr22
684,884,110 *46B1AB4030759832700334CD83D34CBA9E4260EB ulcerabl9
684,884,111 *46B90F2135C9666549F1223FE6932BA113E94143 ULCGR9891
684,884,112 *46BCB770F79E8B2E723757FAB7EAE0A8ED51C274 Ulcococha
684,884,113 *46B23E822B11A801EA70055636AD973419FF3639 üldharidus–
684,884,114 *46B6F6622A0980C2101F0C5D91FF7CF230AFB2C7 uldigen
684,884,115 *46B3AC7EAB40459F1B86B60276BD754EADEC83CB ulemalta9
684,884,116 *46BD48109E9C76304F102BCE4B64E8D96950929D ulerich9
684,884,117 *46BBE6BD26CB4129046CDEE39D083076ED177D7E ulfructu
684,884,118 *46B66DA801CCB9818DE95BA8D833120A097FDC55 ulhasshirke
684,884,119 *46BAA382E68C69F3E3DDB7DD3FDF703A309FDE7B ulHd
684,884,120 *46BBA8BE64E95FA75892391FCFC480F058E589F0 uliassi9
684,884,121 *46B24D1E23DC6C002F9F089C52814F2E4D93BAE2 ulibnuypjcifqing
684,884,122 *46BCE67ED27B0C2194EC8450C7AA2FF55458829E ulidjian6
684,884,123 *46BD1D420E9D84D8086155ABFB02A35AE82CAD1F ulioloos8
684,884,124 *46B3037FBC6B4B8F35C3C837A1D57FAB31BD4681 ulirerary
684,884,125 *46B58B80993F26E32F6D39BF6BC93C9A4D4DD3E5 ulises111
684,884,126 *46BCB1B04C6681EC52A592F356561E992FFEB9AF ulisesceballos
684,884,127 *46B8BAF5F0D151361126CB7DFA41D74A07045F2B ulitromm
684,884,128 *46B60BC75E19B58652E07723D1BE91D41FCEB5E3 ulitz’
684,884,129 *46BDEEC8DE930B7771F9F05018D9B9E334B29E32 uljalo
684,884,130 *46BF9A9707F6898703DAF5467ACC5E4D343A5237 Uljep
684,884,131 *46BDFA8F1EE8EE05EB4BE4D5CD73633EB42BBDC7 ulkomaalaispelko9
684,884,132 *46B45627D5BC070BD558D650152609F2964975D5 ulkoministeriöiden
684,884,133 *46B46122B5B8D91984507985BA4F66954BBA32E4 ulkopuolilta
684,884,134 *46BB266762C00DDFE15ED7CF864A65FC980B4D7B Ulkqejrsl9
684,884,135 *46B02A699A5AC36F81084769F5D3E5590C004FC6 ulkusni2
684,884,136 *46B9D1DC1B7BE87C80F63D1A187ED8A7EF942EC8 ulla.
684,884,137 *46B36E2871D833532B170982807819A4A83D0990 ullakkopalossa
684,884,138 *46B20868C69224FC8AB247254172786327C52BEE ulla olesen
684,884,139 *46B4328852844271BB705F588FF6AE087CA177B8 ullasulla
684,884,140 *46B810FD1AE1CEE7679A28D9493A5999B890360A ULLA, TU Y YO
684,884,141 *46BA517170D57D26F8363CECB99176F19AB12570 ullérèts
684,884,142 *46BFA3031B84192BB213B897829E1AB914957738 Ulleyweb
684,884,143 *46B2BECC19321F8E6025F0CC5786A902C2BE1A9A ullipfaff
684,884,144 *46B48DC8CCD9728E0620FEE1FF2A38A1CE3CEF34 ULLOITA
684,884,145 *46B5FDE39536D5565F30B2469B08C8A32358F2E8 ullstakk
684,884,146 *46BA83F0956A2B65A6C7ED676426FA5DBB9E5AB9 Ullyettt
684,884,147 *46BE8EE76999FF257B54F462DEA2906CE5A1DC41 ulnemmyk4
684,884,148 *46B55347D805644D310729AED430DB8F29AE56F6 ulockouting
684,884,149 *46B1DBDB9355726151B8DF9C5999789B51B03E1E ülőpadkával
684,884,150 *46BDC13C06BF5D9F8F67F4CDF10AC30F3223F654 «uløselige
684,884,151 *46B9E016CC2FAE059B57DE5D3ED59B883D559E46 ulosmyyntiin
684,884,152 *46B0DD4C8BA6229FE60372C44573AFD84CB87FBD ulosoton4
684,884,153 *46B33031AD5B7803920BC1D5FB811A633B9832BB ulotca
684,884,154 *46B24A709B2F44379228BD7E22AE9DCE6CD24F2B ULOTNIC
684,884,155 *46BE46F6DD094099CF293D874B171338417B3828 uloviuqe3
684,884,156 *46B53676B24B68FB26A5381D8776E0ABCF7B74CC ulovlighedth8
684,884,157 *46BE9868EBB666FC93D791459378283EEF043F2C ULPHIAH!
684,884,158 *46BE02DD003BE7294A0AFBEF2E4838D349FD8BA4 ulpifier1
684,884,159 *46BCB5ECDD41DD57D05B324397B3FF764B4D267F ulpture
684,884,160 *46BA33D780629C3F45CF9ADFD2CD9ECBC3451E2F ulrfwum9
684,884,161 *46B6C13585CF77431E9B01339735F0B9ABBA65E0 ulrich johannsen
684,884,162 *46B5502D5B6CE3978F1885FFCC8EF781EE1675D9 ulrich spinola
684,884,163 *46B1F8FB4899B5B81CD83ADEB469328354841CA7 ulrichulrike
684,884,164 *46B5BDE6AB7850F7079073C5C45C9C97EE2C23F6 ulrikehutauruk
684,884,165 *46B85DD053B222EC2DF86ECA68B1AAE3B34EDA30 ulrike smalley
684,884,166 *46B49C93BDA04190E4DDF3792192946165D6043D ULRIKSHOLM
684,884,167 *46BE06146C374062A4348305490A0AF10B7128BF ulS(
684,884,168 *46B872C6A01BFD3000856C38E2BC32A47A0250C0 ulsjmmlbrr3
684,884,169 *46BE7A3BB01A8B47FC58E2DF5D7C842C4E02FBD0 ULSTERILAINEN
684,884,170 *46BFA0E7835B6AD6F6FB8C2CE0129494A43EB4C4 ultimaci8
684,884,171 *46BCD175CD69398B319776670D6D47C4BA67206C ultimashorasenargel
684,884,172 *46BF9DA17C05E5616DD2D60247E1086C2430AD97 ultimatebeatlemaniac
684,884,173 *46B528326482FFA92B357998C8E4F0D614559965 ultimatekay
684,884,174 *46B9A40DF566AFD2AE2CA84B45D2B9B7D074F343 ultimeremo1
684,884,175 *46B953F0AD9652F147AA7E2DD798927887A47504 Ultmamänt
684,884,176 *46B594C78421954DDC539B53A99A3B2454F0DA4F ultr4j4rt3
684,884,177 *46B88760B2C0208EFEA9AFA4B9921E9C35CF592A ultr4mcr05c0pc
684,884,178 *46B99942233A0020B0A589FB2168206C58D013D2 ultr4prot3co
684,884,179 *46B0AA72D09103BB06F80F647981E6D3462E8E1D ultrabercianistas
684,884,180 *46B56370DA6A3F566E2C93EC0BF67D7839E9EEDF ultra-ccs.comwww
684,884,181 *46B3B4ECF4585F17908C44E044B4B00DF1F5CD0D ultradarkradio
684,884,182 *46BDA356397A072475D1E4DD2FC7080EACF5840B ULTRADISCREET
684,884,183 *46B451FE0F7AE71BC54977CC48DE3879035C4E4B ULTRAELSA
684,884,184 *46BC72FA54A8A4CDE0493F11222585940D6068FF ultrahumanite6
684,884,185 *46BF413714B55DA89496672EE7FF84194AE4A88B ultraindifferent0
684,884,186 *46BE4A6FE47489B662E79055BAC5944541009984 ultralexan0
684,884,187 *46BA9EA5042CEA062A9E98995B4E794BCAFE3204 ultraliberalism!
684,884,188 *46B7AB9151265E2B5E03A5BCA02D2B5AD144CA79 ultralla0
684,884,189 *46BB129A9F5ACE5839CFE06B542A0F45EEEE943C ultramarinas”
684,884,190 *46B75D37F20B04DB712513E8C7848C7A11F4562C ultramode6
684,884,191 *46BCC84761DD2B8B60FB853A24F3F5682BBD9999 ULTRAMONTANISME4
684,884,192 *46B79068CA9BC5E8F5A3CB67CBFAB775630067AD ULTRASCHALLMESSUNGEN5
684,884,193 *46BAF435ECF92F1D4A4B7E2CE853421D9886B03F ultraschallsystem3
684,884,194 *46B06DBCA523E19A76C8BB9DD047426623167836 ultrasonograp4
684,884,195 *46B82FC74BC809F27E41A3B0CCA00CBA04783F30 ultratriatlonok
684,884,196 *46B99FE84F7FC86830DF2E0EFB93CFC377A08675 [email protected]
684,884,197 *46BECE56F3DD8C1EC6869470255A53F3B03F45EE ultreia7
684,884,198 *46B481AD0033168C2A92F95F879A4CB41497FFF6 [email protected]$c0py
684,884,199 *46B0BFFD24BD6B2A8E120956CE2F4241A929FC48 Ultroneo7
684,884,200 *46B93EEFAFAC7E17A7F00296D3AD83F3DAA2A8DA ULTRPEM57
684,884,201 *46B6C0A82C776BE830A5C0B05A63422AC88068D0 ulucinuf9
684,884,202 *46B7FE7176595502ACD3661B101F6B975BCCAF80 ulularonoed
684,884,203 *46BD44194A393AE5C4A32F09E002ED914DBCF836 ululyrreJ
684,884,204 *46BBF62C419DBBF49872C5BEDB23895E51F93D1A ULUMAJI
684,884,205 *46B5D57DBD5277BEE60A51F385EEA5C4400F94DC ulunpitos
684,884,206 *46BD36F0F53CF79790E9DF303828CFD08AADAF7B uluteu
684,884,207 *46B06731FC830FD97E48D4154E6F61E0FA069B1E Ulvarnas
684,884,208 *46B80C986CD06A0EF15C5CE3067FFF7C8C315E6C Ulveedderkopper
684,884,209 *46B5AFFAF919510EF0D042C837EB19D0F46B5EAA uLWB
684,884,210 *46BE503B6C831CD4FC86645FACE41718A3AB7471 [email protected]
684,884,211 *46B08919BEE037E835ACFCFCF4B2D42883283B2A ulyishth8
684,884,212 *46BD0F373FB873A6CF28BAF8941BFCF229728AA2 ulykkestilfldet0
684,884,213 *46B34770B123745C520A3F56DE5471B711436BAF ulysesperez
684,884,214 *46BE28F038FA77996E63D30A1F9D41670A31A0BC ulysses.delgadillo
684,884,215 *46B943C2B4D2BC8188D30AE7FC52161325C65D2F ulysses.denbow
684,884,216 *46BC06868A296A714EEB1E0948362C6BD773EA6A ulysses.hofer
684,884,217 *46BA1745AD0C7DC1EF8746E632CB1F06AD2545FE ulysses.holdcraft
684,884,218 *46BDBDF48A510AC9F356E93040FE6195421AF412 ulysses.hornish
684,884,219 *46B0286BD35CA0C51885B1DAD8E9C64F1D79CCEA ulysses.major
684,884,220 *46B0217E3A1EB91EF016B1D0D1D0468088A548C5 ulysses.ned
684,884,221 *46BBD08930A7EE0305C223FA9A9DC2EA4E01628E ulysses.nowzari
684,884,222 *46BBF4CF73B1C709AB1E70E5F306172875E06425 ulysses.orcholski
684,884,223 *46B1D9EE2A9A4C4D30996EF37316D93E6B2BDD86 ulysses.poss
684,884,224 *46B1B8F359F02106317BBE5AC002B1A6D0A9ADEB ulysses.pradier
684,884,225 *46B956A44A82D5F88F043F98E079AD90542D5B0B ulysses.servan
684,884,226 *46B7195292F88DAC656505F4871A46DE7E04B544 ulysses.simpton
684,884,227 *46BEF8025C6075C3EBB3CF2D149DE6291A02690F ulysses.sitzler
684,884,228 *46B5A95835C6A79304E6C7426D06073A69401C52 ulyulysee
684,884,229 *46BA0C535D40EE8033550DB3D68F4F04B5516D5F ulziidelgerbatjargal
684,884,230 *46BDA77F0891B8CB9C1B242AEFA41E736A2570B3 [email protected]
684,884,231 *46B69EC8AE7A64835BD69E262C6A4A1D85FCAEC4 u:m*
684,884,232 *46B8A3A9DE063368EEAD917B4687568CB998FE6B um,$
684,884,233 *46B0293C07F6F83290430000FB4757E05DA7A268 [email protected]
684,884,234 *46B30F0353DC0D858A6E37ACD9F8ED791117CA7D uma daven
684,884,235 *46B860827A42CFCA7BCF9748835A163F084BD3AB umaeduag6
684,884,236 *46BE6C7794567AD1CBC4922A177A7D6763A3FF28 umaerketing
684,884,237 *46B20E3AEDE1AFCD84C397D872ECD64406B815EB umagenan8
684,884,238 *46BF51356444D0FEF3C7E07E1541043C66DD3146 um agoos
684,884,239 *46BCAA2DB89C1D33EAEF99E693E2098181A6FA7E umaibb
684,884,240 *46B460E30E9847A1B2EE0FDA2B3983D24AC64EE5 umairah lisaadah
684,884,241 *46B9BF96784CBFCF992499DC04B2017394A4D9A0 umairvax
684,884,242 *46BE849262046476FE1CA8244E794D18C871A5C7 umais hussain
684,884,243 *46BCD4C5F034F813FECD1A7013507419DA467A4D umaisjaswal
684,884,244 *46B820535EC39FDCE4076535FB42CFF5DF9FB454 umamsafarudin
684,884,245 *46BA56B24304D220C47E6153C83C8AED3674408C umaniinamu6
684,884,246 *46BD9ADCF518DC3E03577A533F7A7A276F5AD1F3 umaotoshi
684,884,247 *46B954D07CF15EA5725C76FED0389EDBD14F14E0 umapathy jaisi
684,884,248 *46B3C0A6DB8575BD65516B7C6822642325019EFE $umargh
684,884,249 *46B7B87C3D051D8EEF3BC647D741BB0B339E2BD7 umar hussaini rumah
684,884,250 *46B0A5ED0781C9CEF901480FA5587AF5F9F0E31A umarubaydah
684,884,251 *46BAFB3B024E8695FECC864AF353BD4F935B99F8 Umawwi
684,884,252 *46BBF4D9F0CE8A409EF15B065262B7A56E8FD66F umaya usman
684,884,253 *46BAD45195A6E1785CB16AC946948A4895651DB0 umballah
684,884,254 *46B3764A9F0477B548D8F657527F5997B9D23828 umbr15qu3
684,884,255 *46B25E81F5188AF3C0B5D2AF68189A6DCDD419D9 umbrag3
684,884,256 *46B3B2AEA3DDDF1573FE4D613D53E572FF2762B5 umbrellalikes9
684,884,257 *46BB91C730B7151F054354690AC01F213EFF19EE umbrellaprotestationpubliced
684,884,258 *46BF756931A6B2696D4C6F48049194F0344E769A umbrind
684,884,259 *46B5C8C721CBBD51C623136B2BA8E71260902DD2 UMCE
684,884,260 *46B281B2C2FF721CA4670CCE91120C8DA1155795 umdJ
684,884,261 *46BFB3F90485A40EE88551EB1D0518C65E469A51 uMe(
684,884,262 *46BE1FD2D112AF184CD6BC98B8174E8A6036FB3C umeda karimova
684,884,263 *46BC784707C4E904D2C996DF89A17D0AC8B0C188 Umeister9
684,884,264 *46B1ED4D376867A46A1AB7B304EA7026C6F928DE umer hoosain
684,884,265 *46B671F4665D6A63FAA3129CC1223B6517829F52 umerhussian
684,884,266 *46B91CA980BD89CD62F26BF09EC3AE2140251D0F umerischem8
684,884,267 *46B98F4B801133853D5196DCA3F5E4CBA07296C7 umer khilji
684,884,268 *46BA081826C1810F283201382F8EA0D355E01840 umershair
684,884,269 *46B14C8478C59FE204B9FE0948A626BAE9EABE28 _umesh_
684,884,270 *46BDB5AD40F3553E564EF533416924DE4B9D51F3 umeshchaudhari
684,884,271 *46B97946FDC85FD022BD7C240A0CAC09439DC8C5 umeshkasote
684,884,272 *46B0702B1F847F900ED41B1A84AFBB61D5796054 umethw
684,884,273 *46BFC7E43AA1CFB091847B519F4A90EAF048FAFE Umfanges3
684,884,274 *46B7C3E5E4E50805B9AA7DF606FA315AC94226D8 umformendeming
684,884,275 *46B7A03CD5C40D195E7D89DC25CA917649166F6A umformsted
684,884,276 *46BF3363C29BDCE525D6757E8951F2C676118852 umgarnended
684,884,277 *46B04CECCAC8C426BC8EC496F970F310723C914F umgebungslärms
684,884,278 *46BA19B54FF8680B0574496E7B5FD71A2E2DF36B umgestalteten4
684,884,279 *46B7AFDF4826B1489A15820BCDA18E6D0127E049 umgesunk8
684,884,280 *46B1D925D6340A4784B647A36DED6DD8C6CC583B [email protected]
684,884,281 *46B2DF11023D1BAD9AF59060E85AB1A745B30D95 Umgransele
684,884,282 *46B936C5ABC1F04E88D975B064CFB3D49F77B4AD umherana
684,884,283 *46B2E7C6AD7013C371ABF65579D40F8C01FADC7D Umhergei6
684,884,284 *46B0078058EB7977BA1A0D69894173D11E77EEAF umhlochas6
684,884,285 *46BD9731A442BE827B6B3001C33E9828AD5E6E69 umiaida zuraidah yahaya
684,884,286 *46B214B1D893815C4320B90751B053086A8D2F6B UMIDDELBARE5
684,884,287 *46B8361DF9733462D6D33F0678263B4FA240999B umidu silva
684,884,288 *46BEE62251B5D56678684C6DCB74B0B0EB709BE0 Umiesntnenie
684,884,289 *46B014C379B9144E9C596922962CA9A176E2207E umikabeautifull
684,884,290 *46BAD3FA07562FC742BCA904B6FDE34ACD89EE83 UMIROVLJENJE
684,884,291 *46B18FB5F7B7683DF250E75CA067AFF4E8C97D5C Umisli
684,884,292 *46B72F8FA3B1B6EE679D10A6F0B49B84FBDABA9D umitaltunyurt
684,884,293 *46B6CF870F52E197D7476105F117D6A8ACEF0F21 UMJUSTME3
684,884,294 *46BF8D564D82AF5503C0493C02323368FD9E0803 UMKbaa
684,884,295 *46BD3A33CEC97B0B299CBE7C623FA0D333F59F32 [email protected]
684,884,296 *46BE597293AD4B295EB492232EC0768D4311133B UMKLAPPEN/DIXY
684,884,297 *46BC364892F4FAD85A25E9EF14375B1079D47AEE umkumme
684,884,298 *46BEF5EBE17A623F4E8F80131BD3A1FB04C3757C umlaufkolbendampfmaschine
684,884,299 *46BA4FA19CB45801AB52546879094ACDF00B58BD umlelig6
684,884,300 *46B9BD139EE52856962C962F83E933B68512102D umliegendeses
684,884,301 *46B439DAEC26A89568171F26681B0D088D138A8A UMMADA
684,884,302 *46BBD293B0AB75490BF2C9F40971EB15C1EF460F umm.hullo
684,884,303 *46B597FA9BF26DC116518F7C5B04E3DB7CF362F3 ummocorp0
684,884,304 *46B447D106789E2207B3926260BB7305A5C13A6B ummok12
684,884,305 *46B66AC7DBF110023D8651B6C41A5797CCDEE3BB umm sunaat abdul malik
684,884,306 *46B1A13E9598013D65CB7959B1C02D2420644649 ummuhidayah
684,884,307 *46BA552B688A7D3086805DE53FAED600FE660AB9 ummukholifah
684,884,308 *46B54418C35AA0B1528C96EB43DBC2825DEAC067 ummulwara kamran
684,884,309 *46BA5329EFEF8FB4A41E8C56DE714D5B124F3BFE umntilavK
684,884,310 *46BE0E83F7C1E47923B11D78C444F5CE796EB5D1 umo boogie
684,884,311 *46B399D11F375DB13ACD9CE9D5B3DE470B7B9E18 umoljavam6
684,884,312 *46B70336280DF2C2E32D0F29FD82AEFB889BFEF0 umotywowany1
684,884,313 *46BA5A593C0DFEB66B67C12874CFE5D4B884FE4E umpeters6
684,884,314 *46B53CEF851270A186E63033E62D6F217E338C3A umpiersed
684,884,315 *46B2EF27628A5053F3235073026DB6A821A7F3B7 umpikuuruun
684,884,316 *46B71037A1BD6413F8EBB65EE59AFD685495F0C2 umprogrammierenden0
684,884,317 *46B695E202F7FEA1E2F99791435634C891229B03 umptions6
684,884,318 *46B7A931BA03D17E7F9945C6314A6699AD926031 umquartiereneding
684,884,319 *46B50D1FB02CF27823EDEE6B94793DB9C638E8FD umsatzmilliarde
684,884,320 *46B722910A4CB229AA6F78F260D7A9BA55C89431 umschlagplaet6
684,884,321 *46B6E24C47AE8FDB44ED995FC4F586E5BE7123B7 umschriftvorschlag
684,884,322 *46BBAD3110E71575BC83FC6D0A20B77499B8BD2B umseitiger1
684,884,323 *46BB804A46EAB92E60554E732480080E28BEE22B Umsiedlungsheim
684,884,324 *46BACC2FD5D45D84CA274C0F26D301134CB15CE8 umspringendesing
684,884,325 *46B1AFEEE3D1EB4CB688ED1958C7D9F5D8A2AA3E [email protected]
684,884,326 *46B98AB1FBD24995F4B67426FFAF63B2CC836DE4 umtgyivmbzmxp9dq
684,884,327 *46B85CAC4813252E51CF295FB7B9A6B636A5860D Umtishis
684,884,328 *46BEE5BF2D5FBEFD754DD241EB47E0C4C44BD00A UMU110786
684,884,329 *46B05268F3CE8AAF91705EF2DF9DA3E97053001F Umu
684,884,330 *46B02EC06FF2F026657311946769D6198F0A0007 umujis
684,884,331 *46B5A7EA0552C1EB6A48053703D36412E77B5D5B umumtani2
684,884,332 *46B480AEFD9D0A9A630E3AD9BFCA3D9DCC0AABBB UMustBCrazy
684,884,333 *46BFBCC71AB268DBDB16EEB9A982294AA4121E60 umvelingangi
684,884,334 *46BED14014EA5B486F0192E2681DBB1FB3503352 umwandelnenses
684,884,335 *46BCB600ABDDA7C63B0F5C938262287C4D220C42 umwa-statement-obama-intention-nominate-joe-main-be-assistant-secretary-labor-mine-safety-and-h
684,884,336 *46BE3BEB0F10911B44DE43E7035365379D53A6E9 Umweltbärchi
684,884,337 *46BC071BE99305ECD18A6A1D1B2977AD081AC312 umweltkonferenzb9
684,884,338 *46B984F25463CFE17623EEF5B0BEB7C4E76B4320 umWK
684,884,339 *46BF482DC0875FAA5BB4807CF97E69FA07DCB7BE umwwqemzhmed
684,884,340 *46B99FAE3C235BAB88B96F3DE4CE6E1F735D2651 uMXV
684,884,341 *46B29E7AAF53E7D6EFC6D43942E524B3DBE3EA1A Umyslne4
684,884,342 *46B4F312EC39DCC25A0DEF2351C998302A329255 umýt
684,884,343 *46B0CBC3A630EC258167E2C6280C613A0BD6E1B2 uMzu
684,884,344 *46B45D007ECE2674B88D1E765BF5F78F28DB284F u*}n
684,884,345 *46B4F84603DACCF9761EAED76F0A08E019A9042A Un05+3n+4+!0u5ly
684,884,346 *46B4937D8DF2AD9623E0581321181FB8F81249D5 [email protected]
684,884,347 *46BF51EF10FF050091D9EEDD1112E737BA42EDAF un1nf1n1+eness
684,884,348 *46BDD315B341AA44C4054E4BE0E9A2FFE6F4D9C4 un1pers0na11st
684,884,349 *46B9F82981BB7D6F28E586ACF3BE46742E8614A6 un1son4nce
684,884,350 *46B988078CC045E92F2F9BFF4D66CAC5DFA0F01E [email protected]
684,884,351 *46B3E41F94A9964EC13CA5A7DE70984AE175493F un2,
684,884,352 *46BB9A5E5947338A1AF57D47152041C6B8732EE4 un3n3126iz3d
684,884,353 *46B1B142ED991DBD8AFCCAFBD42BDA7ACFCF86AB un3nd34v0
684,884,354 *46BDBBEFE3F1264317C48E83454D1F481E087CFF un3x312ci53d
684,884,355 *46BB2BEF6F09E228DE581FDCF972E08CA1878BD0 un3xub3rant
684,884,356 *46B8106D95AAF139266BD28982E5DB1564888416 UN4773S73D
684,884,357 *46B429A0EDEBF3F005C8FAE0029EC7E5AC0D5F0D un4cidu14
684,884,358 *46BCD6490CE80B41D401D770D997F24D29673AA4 Un$4l4ried
684,884,359 *46B820DB34689A0B3F9551640E2926AFA3D9B248 UN4MU5ED
684,884,360 *46BDCA042B86FB572EB9B5913AB1DAF21AB7B463 Un4scert4in481e
684,884,361 *46BDE5C499507D9FFC2FC17193403987211327A1 Un4ttempted
684,884,362 *46B6926D8622310E1B473DEFD9299C08CA6BE2E6 Un4v0!d4b1ene55
684,884,363 *46B746975D7DA8BB9394495227C860D4FFD6855E [email protected][email protected]
684,884,364 *46BAFD02256DE449F4B9A4E8E687523FB6EE4AF8 Un5e1f15h1y
684,884,365 *46BB128BEC73E3C71267518258827B97AA32285F un5ooth1ng
684,884,366 *46B2448DEE87AAF164256A4E5FA89B170E85CD99 UN5PO!L7
684,884,367 *46B770C93F7F23F9D981B4012E4F178CD51617E7 [email protected]+3d
684,884,368 *46B8BD40DA693A25565F6629EE2CB7F5A42F91FA un5tainable
684,884,369 *46BDBA2C32CD10AD2190ADABEE46C5C88A9EB82B [email protected]
684,884,370 *46B3D29E4D981CAD241EA3A46DE596F3EF29768E un5u5cept81y
684,884,371 *46BE9C50546917F83E5952331E9275BB3ED55C70 UN$71CK$
684,884,372 *46B0225AE9E1D043375135B1E8075A2A4816439D un7anglng
684,884,373 *46B5DC9CC64EB90C3C29BBFFFC22E42C2DDF9A0E UN7IRIN9LY
684,884,374 *46BE4E5855114C6D740A32F35F40EB238339AB02 un8uttonn9
684,884,375 *46BDC6204BAA01FA3E95FB29EFF93402D553EB62 Un9raci0u$ly
684,884,376 *46BF081A2231793F02BACA6F8E4891CAC8DF24EF una1,5
684,884,377 *46B502DC8E91325A0B7E83DB77A251CB9E110A8D Unab$0lve
684,884,378 *46BFAA81565FC8AE754D85AC00900463B397116F unabhaengigke9
684,884,379 *46B3F9238888FDD84FFF0FFFE9113821A16C30B1 unabhaengigste0
684,884,380 *46B0C22D71DF575B74204806A7AA27467BBD9F25 unabhangigem4
684,884,381 *46B6EAE1A3815938E357D56ACF874D3E9D7C7A0A unabidingness2
684,884,382 *46BA7B7B987DD6AA2FB21EDA40B958921C07B6E2 Unabnegated.
684,884,383 *46B43ABB3F0354836F3A442D5631EF4161CBBBFE unabrogatedsed
684,884,384 *46B781BA30CDEAB380EA7523BE8C343DE34B5CE1 Unabsorbbed
684,884,385 *46B24DAA9D68363CC45AE7BEC784152D74FEFF66 unabuttingsing
684,884,386 *46B7802F0057FB3C14C34FE6F2A4056A6C8BC1B4 unacclimatizationses4
684,884,387 *46B2A67C323C7DD7C8BC72AC1C4AA2E89C2ADFED unaccumulateda9
684,884,388 *46B08BB5555910946F018360C6E08E9C4FD78958 unaccuseses
684,884,389 *46B70EA8990495C38127F2B125CEC21AB3141DD5 Unacerbically
684,884,390 *46B4A89D524CB8575352AF6CF11E053E6C18C44D un$acrificial
684,884,391 *46B73E706128F44DF15DFD25409A20A1ED123D93 unadorab2
684,884,392 *46B89AFF93722E2B0B4193D5786A71969FF08E12 unadorably1
684,884,393 *46BDF39A95A837153ADEF9C761E324C721E52E90 unadventurousnesses5
684,884,394 *46BC2E3AA47BBBF3198EAE44DE7999F33306C4FA unadvi5abl3n355
684,884,395 *46B09887273A3A93B2A891D5F58B6F17C0124C8E unadvisablenessunadvisableness
684,884,396 *46B17264B03D8E5B96264BBAA5FE4D963EAD1E88 una dworkin
684,884,397 *46B2E1C013911B9C9CC506D574BC7244AC02B54C unafavola
684,884,398 *46B82107B4493079A7D72119D057122F7F1A48D9 unaforrester
684,884,399 *46BD49086B5D46D7B98966E0D5F3F26E40976F92 una gee
684,884,400 *46B777A4A70541D201B91BD073E2A45413D8C3DA unagranvictoria
684,884,401 *46B8E7960C2A4CB8EAC61208FB8EC134728001AC unagreeableness6
684,884,402 *46B38DE50D4E2C8F7600E339EA75BA0723084EDA UNAIDS-PRAISES-INDIAN-RULING-ON-CONSENSUAL-R
684,884,403 *46B924A7B0DD10A3AD7F3B67997E6AE757357ABD unairdah8
684,884,404 *46BE2C4BC1F15A41C355507FB52E16F1298795BD unakleet
684,884,405 *46B8548AEB2832D09A4D005131AA1905CD2104A6 Unallowied
684,884,406 *46BEA00D144C17473BDAE817E65B23924C90506B UNAMAZEDLY9
684,884,407 *46BA0C1D80A6DF552BEE80105E5EE61844CA1B94 unambivalently2
684,884,408 *46B5B0434B3368B74064CDE1C0568ABB72F52B08 unametlik
684,884,409 *46B516E9E9D857EECA6216CE3B7EECC11E99721A UNANACHRONOUSLYV
684,884,410 *46B524F8AED1A27EB12852412BC0D2FF1CCAA51A unanemned1
684,884,411 *46B74E19BB7FEBA751040A9F5049747BA6F04CDC unansehnlichstes4
684,884,412 *46B13F47D9DC832AC8CE8F9C8EEB45C7EB45094C una pagina mas
684,884,413 *46B72473E6AC5D03A4B0C2CFFC95C70BF6775294 unappetising0
684,884,414 *46BAE2FB83885A3BB9CF02DC79A9ACCE6299D4E8 UNARA
684,884,415 *46BC3B9D147E223B3ACD3C522E3E9B20BD981005 unarakoy7
684,884,416 *46BD8A287FB23241464E3F7335023B6A752B4EC0 Un'ariaElettronica(Technology)
684,884,417 *46B72E0B9F8B9E58C5C508C3DCC6B45E10678C7C unaristocraticallies5
684,884,418 *46BD12B4CF60C8472929630AD981BBC08175F845 unaromats
684,884,419 *46B1B91F91EF2CB86DED1725BD128910445E424B [email protected]
684,884,420 *46B7BBEBB12C36E9EF80B4A64A20D36BE7ECAB28 unas1n0us
684,884,421 *46B15C0FF25F77C0B5392F281F5CCB39D882A999 Unášivá
684,884,422 *46BF0CAF8D7C3F8DBBBA58D332CE63A63A952F3A unassemblesed
684,884,423 *46BA870AA2578E38B553B928B9530DBAB84D8CF2 unathi thimna mtambeka
684,884,424 *46B13E5F44A170405A2E38428F1FD87A21CAADE6 unau$+ere
684,884,425 *46B0848F3A97A224A25D8E98718416B517F18399 UNAU$P1C10U$
684,884,426 *46BEB8DEC24F427198C810422783182DFDDAEBCA unausgefertigten
684,884,427 *46B86A3FB1F543BB6AFD1C9CE66D4FC41815CC16 UNAUTHORISED-BINDI-SITE-NOT-UNETHICAL
684,884,428 *46B675B59E5FDAC6AF4B39FB12382703E759A30A unauthoritativelies5
684,884,429 *46B7686B1DA4A7DA45FA34971DEC1B57207DE1C7 Unauthorization!
684,884,430 *46B0773F7932EE7B716F828F33B25BAC9A4EF6E8 unavajlbertopuen
684,884,431 *46B0E81687B745D7B4930CB02F11F56A423C4208 unavengedlessenlet4
684,884,432 *46BFCAC7745FB1E45053B9AF7427D7AB5AD83C19 unavfp
684,884,433 *46B2FD62C8B4C24072F048ED6D315FADB4761513 Unavovat6
684,884,434 *46B8DBD8BFF846D970F0FFD10DC596077922A2D6 unax.bbs
684,884,435 *46BCF5984D7D8F9D065258E7CF3CDC72F4E361A7 unb3daub3d
684,884,436 *46B36FC7317C0140735FD39FE401FAD666F6E641 UNBADGERED9
684,884,437 *46BE98885797DBA0A8292BEF86223F65A144C4ED UNBALANCED MIND
684,884,438 *46BFB5830B14EF09C2C5189A84F1765D64F6B507 unbalast
684,884,439 *46B2C8A2410E98B1FCB4459BFD5931BE2E7CD780 Unbales1
684,884,440 *46BB08EA0640CAB90683C4780750FB98F1F548C8 Unbane
684,884,441 *46BBC2140B910CD0AFCBFA8B513B870AB15C177B unbarbarouses0
684,884,442 *46B01BBA44E6A0E5A77EAC06DB3946CB74AFAA3A UNBARTERING6
684,884,443 *46B7DAA681BB1DA7C6C5CF0C4DDFEBB495CBA132 [email protected]
684,884,444 *46B25A42DF1A1DD4D2C31654EF99DAF2735C4161 UNBEATABLEMASCOT
684,884,445 *46B48087E73A757B5BD39E224FA695F7242F615A unbegotten!
684,884,446 *46B778A39010CE0853D8DB4668751DA3AE5A0B5C [email protected]
684,884,447 *46BF4BDFEB264DAF4B9EA0C8AD2B628874A57280 unbeknowns9
684,884,448 *46B1DB3620544C8578845CF93984A173E97EB15E unbeliebteN
684,884,449 *46B9818E72E25FAB14BA86ECDE0B1CC5DD6445A0 unbelieffulne9
684,884,450 *46B54DC47F952AF4FDF742D13E7B83D162205068 [email protected]
684,884,451 *46B15747A9C6DDFEC1662FEAF21A003494010D05 unbelieverses7
684,884,452 *46BDF3B2B90A078D94D9D2AAAABD8DD936D4CF2C unbenignunbenign
684,884,453 *46B3B2EDF3B0837E568D6C3B7DBA1E9DF4882486 unberbrckbarem
684,884,454 *46B89D60819BAA19C4312F00F0FDBB061121FCAC Unberoug5
684,884,455 *46BECE6FBE90F8754CA8DFAC114BA0F228466817 unbeschaftigtster4
684,884,456 *46BFB141DF0584D8A2A66EB912B1AA71370DF5AF Unbesch
684,884,457 *46BCCAB71F34BE984BC13932F8517B8920E0E078 unbeseeminglies6
684,884,458 *46BB6F0E85C94E409F27A664C6E07D8A9A112EB8 unbeseemingnesse6
684,884,459 *46B3755189633B53D545F8DD04CB73E37287DF8D unbesinnlich0
684,884,460 *46B2366C622BC3B9AB657910F4AAA8E00FC917D4 unbestatigter5
684,884,461 *46B1B3062AF112E16ACF5290F5DE3EDABF7A5FC8 unbetaut
684,884,462 *46BD85A1814431A528BCD6CB87ADAE89D48B8474 unbiaseding8
684,884,463 *46B47B06C9D80199A0843F35DF44F3352FD1A020 Unbindable5
684,884,464 *46B7ADD1584215ECB788C1CA84901F52F3194372 UNBITT6
684,884,465 *46B1C4DB6CEBF7429C33AF22529F846FAA15CA68 UNBLOODED1
684,884,466 *46B8D33E3ED148C95A706039889EF669D73D1D05 unbolsters6
684,884,467 *46B795C8F8173E9CA2FE40AD7BAF4B110E7976F6 unborrow0
684,884,468 *46B3E55A6817D90C9E25B1CA203A9FDF5AFF343B Unborrowed.
684,884,469 *46B2EA16E7E0B302E42F98A0EA489A386A7E2FF1 Unbowdles
684,884,470 *46BE91070757CEC2BF28D598232DCD995103ED35 unbqaa
684,884,471 *46B5D364387EBADAE37AEC4B7F17898A5FA49F90 Unbraye6
684,884,472 *46B4C5AC60F7C99D097595FDD96E1E3E3CE4CEFF Unbreakableness.
684,884,473 *46BBEC8C0502480ACE2AC71E476D565AA0C47D50 Unbudgea8
684,884,474 *46B8921A767B3B2E9E27E3480A1750271D40E307 Unbuiltses
684,884,475 *46B52F858660638D078692CA6A0FB658F23A2D9F [email protected]
684,884,476 *46B04959AB78A717CCDB8AADB387F3BDC53A9230 unbusiedsed
684,884,477 *46BF1F9538A334D9F52F690BC997AA8BBD5F077E unbuxomses
684,884,478 *46BA365143CA068D4E982282313B89B8BB719589 Unc0mp4r7men74l!ze$
684,884,479 *46B341CF7EFEA56127FBF3221D9D34DC1D83302F [email protected]+3d
684,884,480 *46BB97D0F7B653563889651FFA1E2CDE440225D5 Unc0n9en!4l
684,884,481 *46B3E92A863FA0AD5BB99D04FC7AADB4017AA343 Unc0nd!+!0na1!+y
684,884,482 *46B26A34BBA1AD99B773C8019B4BB4899AEDE748 [email protected]@ble
684,884,483 *46B065EAFD4780B36CC3BA964C256ED1D563B042 Unc0up1in
684,884,484 *46B06A5D45D63FE46470D46791E0A72999CF7D97 uncalamitousa8
684,884,485 *46B3D213FD5B041BD9449AC1B1398FE1C684FCB4 Uncalculatingly8
684,884,486 *46B69E77881B44AC29368D6EFA44F77CB0021A40 [email protected]
684,884,487 *46B70D38DAABB99D58C776FBEE2A211629EF7CB8 Uncandie6
684,884,488 *46B1DC29A7990425A0F3156D5E086BD5ABE104FA uncannilyv3
684,884,489 *46BB2EB5721B0F690DE3B8BE4F4B8156341B37BB uncapacity2
684,884,490 *46B40EE4C34A56F8F79C139C9A14CC1161B024E6 Uncaria5
684,884,491 *46B9C1D315FB0BFBD3BDEC86B068EAB5E1259C21 UNCASE1
684,884,492 *46BE4043872B5D8BE8E5BB1B6B73B75E78F7A232 [email protected]
684,884,493 *46B1017F838373D7F1B9425B4B31B1BD0DFE8C03 unc-columnist
684,884,494 *46BE23AC4840244C9AC0BCF40DDCD8FA67D6E059 unc.eduwww
684,884,495 *46BF9F8C087854AE0493DE19C94CCB5D781D6886 [email protected]
684,884,496 *46BF84184FB8758FC87C8F9623A2A312BB7EC240 [email protected]w
684,884,497 *46B1F3A69803A0FBAE0A6FD6434176BD5C035E96 uncertifiables6
684,884,498 *46BAEAFC797CA3EC58191036BFE56D69A2A29C7B uncgaa
684,884,499 *46B8EB461E88FE18E8DAFA1C27596F59C9C36FF9 Unch1v4lr0u5
684,884,500 *46B04E4BC50CD5293EFA3437BB4A4CE965C69B0F unchain me
684,884,501 *46B4E56EA379A040B714B88368725B6076C83D12 UNCHAIR8
684,884,502 *46BECD50A0397927CB9DD532B8B85F631AB1AF20 [email protected]
684,884,503 *46BD6ED82AA87CABDEE80F47D070C4F547EDE08B UNCHISELLED!
684,884,504 *46B650D5C945C357CC0586CCBC9C68F2C4F4B461 unchkins2
684,884,505 *46B2A7473528DB6716DD8D6FE485F0C60C0D5A7F [email protected][email protected]
684,884,506 *46B566A2174D8125296500FD4D3864249E41BC8E unchurchlike4
684,884,507 *46BE39514678731AE9C611F4FDF60FBE0ED65C90 Unciaall8
684,884,508 *46B6D63EA5D9D12E4A81F5CB4B531357A7F9A8E6 Unçiclopedia
684,884,509 *46B6680942D3FDBEE9210F41F0128CEB26CA4233 Uncil4
684,884,510 *46B174D8CBFBD828B5FAC653C5880C458708742C uncinulatuming
684,884,511 *46B85A6EFA1ACF2797983F0AF9828F1C5A6A2F74 uncivillyv6
684,884,512 *46B77FCAF429C091332831CCA12AF1234C7D1FC8 unclebobtha5th
684,884,513 *46B15B3525CB16DE09F419A35C718A3BDEB331A2 unclenly
684,884,514 *46B8087F58E23E4008326FF7540FDFA9301C31BB [email protected]
684,884,515 *46B547A4D4DA4A827C92CD6EDBA768EB21A2BE94 uncmacon21
684,884,516 *46BE2F16B2608769977FA3208BF6440986E2599F UNCNCYCLOPEDIC
684,884,517 *46BB4C7CEC9A330155C562888321CDEB4C2DA2D9 [email protected]
684,884,518 *46BC69578B0AC5CEFA3C310F18596C8262D52908 uncohere8
684,884,519 *46BCC2AA7F08EC20B77E637CF858FA4C87A27A01 Uncommon Tools to Kill Baby Seals
684,884,520 *46BDDF3FCE98EF30C30F61985DF5CE1843F65B2F Uncommunicated6
684,884,521 *46B4D2EBCB33D65848C7A07ABB329F8EAA0F8723 UNCOMPASSABILITY4
684,884,522 *46BD2A28D2773F1F54365646425CF9BB3C175E0A uncomplacentlyving
684,884,523 *46B88AF8A4B7407B35096A08869D78CD044D24B0 [email protected]
684,884,524 *46BDF5127DB8C465280C2E368920F12B657A1EAB uncompressbatchb9
684,884,525 *46B98736550367C327FFBC16981A1E2EB68E65FE uncomprized8
684,884,526 *46B6BF75E5EA9A3A621F4430B600C53A8726392A uncompromisingsexualharassmentatwork,home,andinpublic
684,884,527 *46B3C2048DBEAE932C8255AB5B255D530F9A9CD7 UNCON57RA1NED
684,884,528 *46BE2B9A7B1A63063467A5C108252A87A606E7F5 unconcludablea3
684,884,529 *46B9482D94DC95C6D7621CFB3B7741D655B5FF38 unconcrete?
684,884,530 *46B24515C89C614A191E588FA034F03F48C0DD5F unconditionaling4
684,884,531 *46B9614435B765A51C1C37DB9CFBBEFD5AF949E0 UNCONDOLED3
684,884,532 *46B5F146D5FBDB55A74DD5F2ED4B98ED7F0D0404 Uncondoled8
684,884,533 *46B6CEC4DBD98F7EDFEF21469ED9742FC5D3338B unconflictinglyv5
684,884,534 *46B9A033E0E389F8CB402B942CC9605E5CAC14B7 UNCONFORM7
684,884,535 *46B26FA9D6F4BE654EC93922B6C1CD53339396E3 unconfoundingsing
684,884,536 *46B168BE0DB5C9CC8EB0A283503781915D1435F6 Uncongenially?
684,884,537 *46B2D338A2176027E21DE2F33EB13A6A9233A1B6 uncongr3ga73d
684,884,538 *46B2621E1C8EDCBE5538819CF280C169104DD417 UNCONGRATULATORY.
684,884,539 *46B1F1A155671DCFF3A73495B502D7099C735585 [email protected]
684,884,540 *46B890B3CA9F14CBE0F8BED5AAA4077E8000E5F8 unconnectedliesed
684,884,541 *46BC00F96F6E27773C66A910F729E1AD1BA0F70C Unconquerablenessing
684,884,542 *46BD8C77F9B0E329AE2385282185A3952F64B260 uncons+an+1y
684,884,543 *46BE007BA0703DC3527675C9073BA8248FE06619 unconsultativ9
684,884,544 *46B90ED2F71EA55EE9AAC6D45D6345AD10476A94 uncontentable2
684,884,545 *46B5565E95A65C942FECD72B57AF248E0E76AC1A [email protected]+
684,884,546 *46BC681B5493F6AF1DD8DA0F30F43F7E12E2B53B unconvergeda2
684,884,547 *46B5520242E645A6AE5ED5833DD24E9668A13E3D unconvincingns
684,884,548 *46B0C2B30F93BC133831546A85C33F2029FED8EB unconvulsivenesses9
684,884,549 *46B8E37F90B7A84EF6D94F3937908C7A363A89D2 UNCOOPERED7
684,884,550 *46B0ED1CD3A1D165B2ACD00C02E5AB5FE52AF020 uncorroborativelyv3
684,884,551 *46BB4A595F017830BAAE62AEE4B51D42DB2C16A6 uncortar7
684,884,552 *46BAC58DEFA6E3AC08B32E48429C27EC718D9099 Uncourrlsan
684,884,553 *46B00E5EC2A1A9FEE02DB68FEA4003D9EB16AAD2 [email protected]
684,884,554 *46B294D3B450A615B6931FE1385739B83D49C6AD [email protected]
684,884,555 *46B70A75BEB35842015BD7BDAA0A6500E58DA672 [email protected][email protected]
684,884,556 *46B11DD597BF4E5DF9A9ADF160C144AAF2043BDB uncristenes
684,884,557 *46BA22FD80DEB8694B2A208A27EA0833ED3BCA79 un-crossreferenced
684,884,558 *46B30C881BBB6229029CC6FB7F3617EB75E44972 unculpable6
684,884,559 *46B75DBB8CCB1806BDED6A767055486F2B374F08 uncunnin7
684,884,560 *46B86FE06030F28F98A8048603FC2FDD6A115E50 UNC+UOU$N3$$
684,884,561 *46B2F74CC1416F84AE99542791C994D210793225 uncut2001.06:17-trackguidetothemonth'sbestmusic
684,884,562 *46B6789D97E69EFCD98ABB306C2C063AC6EF54B2 UND15C1053D
684,884,563 *46BD46C4DF32E3D435AB8F7D39F9D6EBB8B9E633 [email protected]
684,884,564 *46B3265257EABE8D64048FBCAFF1635BD25378C9 und312c00k
684,884,565 *46BB5F801F6FB72A84F32A9C0204C2EB74577A26 und3ifica
684,884,566 *46BCC27312FD1BDE8210A3682477866BA90F09FF UND3M0N5TR4TIV3LY
684,884,567 *46BDE8B41B6A744CF8A053489B07A3226FD00A44 und3$p0nd
684,884,568 *46B8F114CCB6AA84EA3BC28FBE797B48950A2B40 Und3rc0471n9
684,884,569 *46B4F8483D8AD09F03B9C9280AB7EBFBE7902DDC und3rc4pit4liz3s
684,884,570 *46BCE6E36958F6836F7C294A0CF6C3034EDB94DF Und3rgik
684,884,571 *46B78B00A55E202EE0E8B7FB916DDFC17E1BF467 und3r$purl3ath3r
684,884,572 *46B07256B6E5A4AA69476B9E4DDB91DF5DA1026F und3rsmooth
684,884,573 *46BD219F53010569278269299062AEC6F8ADFF1D und3rv4lu1ngl1k3
684,884,574 *46BEF5FA2AC5E3B18A6E0BA61592CE8A2572674E und3srab1ty
684,884,575 *46B0951153FC294B016B6FF7F8A0BE42570DDD3D Und4$h3d
684,884,576 *46B54E4B2FCF2D0AA08E2565604FF0E401CF30DE UND!5TR!BUTED
684,884,577 *46B05484CC31E82577D41EE6373DEA5D454C7589 undaintinesss2
684,884,578 *46BED8C19B238D6C8F13E854F71EA744517893AC undakirinê
684,884,579 *46BDECC64E280BDCF8D7D8349340DD4A6BDF30A1 undamming6
684,884,580 *46BAC6F465C0D68E8C6533B087CA143FB74CB452 Undanst5
684,884,581 *46B64DE76F455EF23F27CA95D6881AB799476D1C undaringnessing
684,884,582 *46B86894F5E0C8952CB094A8093C327328EFF905 [email protected]!NGLY
684,884,583 *46B5D23E69D015E57BE39F4E282ED1D164241834 UNDEAD1911
684,884,584 *46B4215DB83D8EB6EB60BC11CF088B6BFD79CFD1 UNDEAD2010
684,884,585 *46B558BAE6350CC4DFD1D18C788A5B4658B7C1CA undeadabcdefg0
684,884,586 *46B6BD0149573024E11BB67FB457C3EA18C873A5 undeadcooper7
684,884,587 *46BF64F2D254D3C25008B1D41DBB3563E67F036E undeaddetroiT
684,884,588 *46B48082BAE91E92A94FF171A79831A241EE085F undeadfire0
684,884,589 *46B521485FF5690A0B9527DD99888848129CEF9B UNDEADKILLER
684,884,590 *46BAAD2AE3371FCB6896C7838B24044B46CF5CAF undeadsteelers5
684,884,591 *46B08DF98AEFCE45FA59A4C65F02C24129F7C9D8 undeadtandy9
684,884,592 *46B2AF8D6F10B6F29794E172F1F85FBF69CB38E6 undeadtrident7
684,884,593 *46BBE719F5F87DB28A62E80AC06FFA69D9D0CE9E UNDEADZXCVB
684,884,594 *46BB0AD49B0390C7A6F088386A8372F47E696513 undeceiv7
684,884,595 *46B3E9C1D5691476DC0E2A38E32AE01C9E835425 undefilable1234
684,884,596 *46B58730F6D1FE68AE953F88A426B9CF592A03C0 UNDEFINABLE8
684,884,597 *46B5F3ACF0712EF6543FFBF2B22A5B6460824F5A undeknl1234
684,884,598 *46BB1E478AE5E71EC3A6416AD347080213F24DCC UNDELIVE
684,884,599 *46B6E03AA2AC43A3F6402CCF6E85C61076BEF34A undelve2
684,884,600 *46BB6C2DBCBFFF630021F69D8E8414B3E0474A13 undemocratising3
684,884,601 *46B925A9588AF2778213918BF28100E32C04F426 undemocratizes3
684,884,602 *46BC9FC76353288BD63DDFABF720C9DAEBC5ECF7 undemonstrabling
684,884,603 *46B95CC9867E5064F44034F8C8F613D4177B2048 undemurea4
684,884,604 *46B9847766192C65DEEBEAC710C823D7B02E9584 undepicted1
684,884,605 *46BDE32E99A6F2F27D47D1A050AFD68FDC3EB135 undeprivedsed
684,884,606 *46BC009A8E70F312D7246DDDCE91B071B872DDFA UNDER17D1
684,884,607 *46BD6491B831C366EFB12B9616F17FE8D1F68A5A UNDER5H0T
684,884,608 *46B892EE8E2C69C90BA7A617A13CF6CA39115A9D under74lk
684,884,609 *46BF58EAB62ABE1F72A42B146686A85D1BEE3131 UNDERBAILIFF0
684,884,610 *46B34EBA3A5680A7E886E58151404E670A203D45 underbalance8
684,884,611 *46BE6083907793AEF569E7F80133DADEF927ED72 underbea+en
684,884,612 *46B362FDC6F1C0E87281AD9AE765B3EE72360125 [email protected]
684,884,613 *46B52B9C28B3E440E1FE77309CA39AAB1E1D9937 underbygganded
684,884,614 *46B665B275C587EB04C99BC4FBEE44FC9BCFD9FE UNDERCARRYING?
684,884,615 *46B7E427655A2005FAB05E7797E18950CCE75608 underclothingn9
684,884,616 *46B94E1F6CCBDC41B1D7A939D160C619F2AAA9F4 undercoloureds1
684,884,617 *46B35ECB4106988BD84F2AA73FC486C3D6EDD43B undercoun7en4nce
684,884,618 *46BBA59C1543B84DF7796ABD272D9E9EB2331621 undercovered
684,884,619 *46BFCBE236D87AE4C076293A5CD472662E6E740E underdebate2
684,884,620 *46BBBEF64F6AA15246A59BC89CFA9EB4ADF4942C Underdia2
684,884,621 *46B00BAD8D3AAC8B3F14450F849D5C6CB627E759 Underdre55ed
684,884,622 *46B550DEDB11BFE872238DB363830696DE89EECE undereat4
684,884,623 *46BD1629EB17C8707974AFA57D4F2FFB4E9C8A00 UnderExistence
684,884,624 *46BA86778F81EF45A3CF3B9B37D6166F44CC4A43 underfienge
684,884,625 *46BE3CD1D2094D5696897F6DBEC9806CC92A0949 underfringes4
684,884,626 *46B704077961E21200E9FB6AB6F03A85FEEB618E Undergird
684,884,627 *46B919BC7025D4529A55477C39C9C46E077E1036 undergrad66666666666
684,884,628 *46B81379329B7DA501C1C410138123324E9A126A Underground for good.
684,884,629 *46B69619906B00D3A6FA6435A693A1AE8594E329 undergrundskonomier4
684,884,630 *46BB611AB407720B58AAC169A1DE50AE82C48B8B underindeksets0
684,884,631 *46B735B5F0CEFD9510F6E95002292A8407F409F3 Underkapitel!
684,884,632 *46B62C533ACF2AF1E99D5896B88C9F9D5EB33FC0 underklassifiering
684,884,633 *46B8970155C19F282B6C586506D3802E45B6426C UNDERL
684,884,634 *46BE76AA581C539CFCAF15901BD4F38C803E01D9 [email protected]
684,884,635 *46B3AE55653CCC37254429EE70337073B18C5B6A underm4tched
684,884,636 *46B9906A7A06896B4C2AA615EB9E6A0CEA98B467 undermarknt5
684,884,637 *46BB84A8031A52245BF217198883ADC2D2B4B8A4 undermoneys2
684,884,638 *46B29DE16307AEF703F5F5F9D80A5454530C3DD5 undermyndyng8
684,884,639 *46BA465229244042C75E48AC9F8314B73E6472EB undernicenesses
684,884,640 *46BE4A4539E313858DFBF63A73F53552AB7F8FB9 UNDERNSONG8
684,884,641 *46B04DA8449C3F3C3D29578A162C1E84145B0243 underonesskin2
684,884,642 *46B7AB686A345660EAA4686CF28BA90921A8B9A0 UNDERPANTS'S
684,884,643 *46B0FF55951C3A0EFE2734D1DB536B32CBD5F14E underpart's
684,884,644 *46BB9B15C9BEC399E9B55BCEB3BAABC6EE63F094 underpaymentses6
684,884,645 *46B992AC411F951ED30D5A176479BD1E02D02647 [email protected]
684,884,646 *46BA14F7B5F21FE0A042DC6A7738632B46F94AAD [email protected]
684,884,647 *46BCD4D36BFB0B7045CF1FF48F8C5E79C5D081F2 underplotters2
684,884,648 *46B5BE1114D6747F10EFDDCF12002006EDD8701A underpow2
684,884,649 *46B2B98B338618214FADB7D50B34F169D6B3F84A underquotes4
684,884,650 *46B939320EA3089226547120B5EFE9D3E397B352 UNDERRATED AH0 N D ER0 R EY1 T IH0 D
684,884,651 *46B36B86932E792D0B13600D0E8D90CB66F4CD1B UNDERRIGGED?
684,884,652 *46B0498BFCE9EC2B8515A2438085FF76A608230A underrumstopologin
684,884,653 *46B8ABE00EA871E9550FAB6A82C480CDA659CA58 Unders0un
684,884,654 *46BCF3AEB113FADB54D46FE0FD8B12B83E7D7300 undersåtlighetens
684,884,655 *46B93016D2D531D2DE1B8A7B6DAB3AD6960DCD19 undersaviour5
684,884,656 *46BD46342EDC570107D9A509B4BFEFC10A01C2AB UNDERSEAL0
684,884,657 *46BD28CC56CEFDDA13B41E44FE71668C05CF24C8 UNDERSETTLING7
684,884,658 *46BA3564DC8841D61EA7E02BE104E0C5AFA88527 underskingslyve
684,884,659 *46B7E52ADBFF1EE2E92C40C30344AD533FD33BD6 UNDERSTREGNINGEN
684,884,660 *46B41359102E0E0100E896243B16F32AC0F3121F underthtanded
684,884,661 *46B17475968DD7262448DEFE0BE7B6CAD8D6B4CD underutveckling
684,884,662 *46BF5C52F7E875916B8E0F08CD366376214E1D51 Undervan7
684,884,663 *46B1F6772DB15A7293E81483E27C038D4777ABEA undervurderingged
684,884,664 *46B306BE3EF59262ECE3BD7D87CBA85FDAD432CC [email protected]!57
684,884,665 *46BB89280E37808524F865CD48F2E17AF631839A [email protected]
684,884,666 *46B598D7AB37FE1F1FDBA4BED051BBD4EB2F5F3B underwefing
684,884,667 *46BE74B52E650672CA261B6A569E75770FECBDB4 Underworld—second
684,884,668 *46BF222A6BDABE5FD2C21895CE9951735ABC93DA undescribirly6
684,884,669 *46B5694019766846D8865FEDEAD2EFCF7E325FD4 undescried1234
684,884,670 *46BB64D1F9A27CEF114C13B28C056DFD69E6BEFA undestorted
684,884,671 *46BF0E365EF415B4C8CF9C32381F8D2DAD21F04E undeveloped0
684,884,672 *46B10AFB9A76D6684B81A6BCFBA2270AD9692FA0 UNDFALDENHEDS
684,884,673 *46BE181628C020C9E9A39651D8C1F984D89DE224 Undgelse7
684,884,674 *46B5D985D032727DD5CA2252010BDBE2DF366C7A $undh3d
684,884,675 *46BCBFC26A2173D29B8785A1F7C474B8305D3488 undhalakha7
684,884,676 *46B55D62C0C9C77143FC781185EAD25D3C7F2C9F Undiatonic1
684,884,677 *46BAA2BDD13403B82EC9216C4239559AB9A7E280 undierst0
684,884,678 *46B91DFA2D62B2EA05E4B9C981091663451530D9 undifferentialsed
684,884,679 *46B1095BD3E4EC8F8BCDB55BAF15322F3EA9E165 undigressivE
684,884,680 *46BD3BFE5450A3E7E7295063362224F692BD95A0 undi$m0un
684,884,681 *46B4559A3874737045B18395E1B5C254438C9DDC undiminishting
684,884,682 *46B5C2CEE01769F4546A9AB00DB40CFCAF4E36E3 undinax
684,884,683 *46B229141876192A57C9538028972603FD6B1D36 Undiners9
684,884,684 *46B669B82783243EB6E3ED453A79CFB03F7811C1 undingly7
684,884,685 *46B0C39B12D0B695892F3C0A7E5D8DE9F9D77D49 UNDIPELECTRO
684,884,686 *46B5F038DA2900BB79571FFB6E95F24FFB9DEBA5 undis+7ress
684,884,687 *46BD9CBD1F462D247751458D1C990F306785AF57 undisbarreda1
684,884,688 *46B6E5EAE9AEE8FECAE066CD21C87A377DD78309 undisciplinirten
684,884,689 *46B0ACAE36F495521E8229FB9125DC3A1D65BD25 UNDISCLAIMED7
684,884,690 *46BA2CFC8D85E086FF208B3A35C9170E30867C3C undiscouered
684,884,691 *46B387C54AAE137F56FD7D2132C85E2238CC01F2 undishonoredsing
684,884,692 *46B52E085E1BD4E4DC0CBCFC82E3CAC9EB8114D8 undisorganise
684,884,693 *46B2EC30FFC001A0700697E2D1174B4C89F9DF0E undispellable5
684,884,694 *46BF5526DB7E62C982AF5C64DA5CA6AABC537D46 undispring
684,884,695 *46B8C877C795FCE31B547E4C0D1E028185EAC22F UNDISPUTABLENESS7
684,884,696 *46B6FDEDD6EAEF8E795B376A21D074D78CE58D98 undisputednesses0
684,884,697 *46BE202946E6581A5123D2F129545DE035455648 undively7
684,884,698 *46B52A4C1D1075D605ED7A3B1D169BCD59F2510F undivida2
684,884,699 *46B7B742387F0450A8F5EDB6450E6770FD055C9F undonenessundoneness
684,884,700 *46B36ED0B34FABEA986620A51C543FBAB891C86B undone.so
684,884,701 *46B34200121234413EF8C4A50210BA02081AE6D7 undosas3
684,884,702 *46BFD1D5EE26370C8A4B632CEF49DD71550DA347 Undowere8
684,884,703 *46BD4AC782977A4F9A9B2B97587181B43D7D1685 [email protected]@p7edness
684,884,704 *46B77BEF517D48F7FBF48C635BA15A3FB44011BA undpixmapbsws
684,884,705 *46B280FB0414F69C7D3E7753AB05E69B1B2F7533 undrawn123
684,884,706 *46BDF774584F8CB6FEAC7FF0559AFC9C06C76729 undredgedaed
684,884,707 *46BBAD318BC73F36C467BCDCCD242CC4DEA775D6 Undrowned8
684,884,708 *46B98926D52F99F6C4A72A21447555E23909408D undrownes
684,884,709 *46B1073F7A17ECDF89E1CAC7BB5FB5572E132730 undtagelvis
684,884,710 *46B0B665050D47D5DC5E306A82FFEE38C248D9B5 UNDUL47I0N$
684,884,711 *46B9CC6DAB60D7ED969105F4BAD3A111C9ACB3D6 UNDULATOPLICATUS
684,884,712 *46B651BF7F5783A69EB3E382A4DDBA1248A3981A UNDUMBFOUNDED1
684,884,713 *46BF71DB344EA18549BFA3A6436238302C2DD09E unduplicability9
684,884,714 *46B8F565B8B5BC181844F88DD1A727EEF75739DE unduplicativeas
684,884,715 *46B48264C577F88F61044453FD929F41748CD745 undurableness9
684,884,716 *46B5BD8CD748A6ECDA8A3B34AE06771E912FC094 undurchsichtigereS
684,884,717 *46BAF0FF4BD26DD0079C9BFF3AA68E88CC72683A undurchsichtigkeit3
684,884,718 *46BE16AD869024C919A7F48E96B75FD6250DF78B UNDUST3
684,884,719 *46B095B2203101178BA0C3C978194D33DB3DFE0F undvendig7
684,884,720 *46B442415DCDF55A5214C12F034B67FF2233E5CA Und wenn es Nacht wird in den Bergen
684,884,721 *46BEB0F3B6CF01A308DE3DB7CE8E286B5E6E3698 undye7
684,884,722 *46B7E8862357971AADE97087416F4F18D54E9A48 uneamende
684,884,723 *46B12233CA6D8EAF76FEEA47CDB6DCBBBB82F317 Uneasy 3
684,884,724 *46BAC91635CA4987B9B10F5F2934C8AA0D940B92 uneasyabashedafflictedagitatedall7
684,884,725 *46B5E7AEE1B0B78011E90BCB071E2349A73CA46B unebi-gory
684,884,726 *46B6419FA1E31B8B34EF246D92925BA46805E711 Uneccent4
684,884,727 *46B4E08E51EC28A632CDB0DC558D6C3A477DB5FE uneigenntzig5
684,884,728 *46B52D37C339550E688C585633B722847D6B5209 unejopip
684,884,729 *46B7912765B5480DD1873D2D0ECD6090F310241C unelabor2
684,884,730 *46B7242EB4D5276B0999E49B4E7579B338E762AF UNELECTIVE8
684,884,731 *46BBB9E540C9CC84DA5049491A7D30C701D5F459 UNELECTRIFYINGS
684,884,732 *46BD1DBF404C01F425D0053CA06082EFE1631960 Une lettre pour James Bond
684,884,733 *46B342265FD192C2F6147A5D43215040D2C1065C Unembry0n
684,884,734 *46BF91B48A121BFEAEE5642402FB6F9DA9F6CB4F unemploy4blene55
684,884,735 *46BC53858156A74A76EBAF57E2532BA9CA502344 UNENACTED2
684,884,736 *46B959C52EAC429D2687C693CD6D290D13250BEA unenc4mped
684,884,737 *46B69AA3815C9300C6316FED2F60CCFCACB7EE03 [email protected]
684,884,738 *46BBAEEE4CE29F46CB7CFB08E77EF455D4246E91 UNENDURINGLY9
684,884,739 *46B69692D8A82CBEAB3B691A23E38B66A45FCF14 Unengineered.
684,884,740 *46B3A131ECC25448CFD13A662831DFF2D620DF32 unenibo
684,884,741 *46B864EF31304F079B8085B3296B0442A6079217 unenlightenment8
684,884,742 *46BA5F2AF0FF240844214A038841A4A4096A9FE4 unenlist4
684,884,743 *46BEB3FE38D46685401329274FADF5686D05DC88 Unentbehrliche
684,884,744 *46BBB036E712897D0518ADB02178BF30F10CEA9E unentbehrlichste7
684,884,745 *46B11C2644923952D5DB7F92E49C6F433D8A5B1B unentschiedensten9
684,884,746 *46B8E0A90EBD01E16DCA28497C2D1DFA55FBC6ED une petite seconde
684,884,747 *46BE1F00CB10D14D2896F8D64057C9200B4DB1E9 unequivocatinging
684,884,748 *46B423DBB42DAAF42832F79C44010531B0FECC4C Unerlo"sten
684,884,749 *46B820056C7A79908E0AE1B198FA6245F57C524A unermüdte
684,884,750 *46B2975835FC776137F117139191FBA5BA03E52D Unerrabl
684,884,751 *46B66F317B4C10686DD0534686C2C886A807D4B0 [email protected]
684,884,752 *46B03D288FEE4975397BA294A66C77E5E90E3D72 unestimularensing
684,884,753 *46B9EF4DB5883C0C48CA8F0051956C912D715446 unestregareR
684,884,754 *46B64468D157EA64AFBDC348E826B1B46B6016E6 Une$thetic
684,884,755 *46BE6321820513D9181D8D634AB78F54CE6292E7 uneugenic2
684,884,756 *46B0126ACF17AB2AAA02E2AC77B108441583E88D uneunefon
684,884,757 *46B3969D37724E474319C0F30963ECDD887BB844 unevacuarer1
684,884,758 *46B177E7AC7E236A37A35D66767F7AD0D0ED5085 unexcelledses
684,884,759 *46BC559CD3CA7A6C297CC3F900BFF92D8E33D34E unexcept10nab1eness
684,884,760 *46B0C387C9C9E23058FEAB14E0F850F1C44DB7C2 unexceptionablingged
684,884,761 *46BBEE57D9BA26A290D01CD1CB45944859842ED1 unexcomm5
684,884,762 *46B48E194D6E118A0BC4B9A237B22F77823C51AD Unexotically0
684,884,763 *46BB88B189B4A96DA9C9CE95EF5C8490D2BADF15 unexpectedlyapproacharisearrivearrive
684,884,764 *46B254E9F72A6B21C8D3F257B61BAFB7CC38A544 unexpectingaed
684,884,765 *46BBC13E55E92FD6F43C5B1F4732F8B9A3545F70 unexplicablened
684,884,766 *46B7965DAE074DA8BA68E5417593A3B5BC6DA935 unfa5hi0ned
684,884,767 *46BA8E255E10B3F0B13C3BDDA405987CA04618F0 Unfacetiously3
684,884,768 *46BEE49BE5550813D989B8FAFA476AB802D2DF38 Unfain8
684,884,769 *46B098CAFDA7F7B81100223CB9F782427495E097 unfatigueable4
684,884,770 *46B16B95B240CE9B480894A10F211C4217BDCB79 unfavourite0
684,884,771 *46BC68A4C8B514281C751F54A5E9037278CD8328 Unfeeble7
684,884,772 *46BF83E2582222D31F0A2DE078770E2E331E72B7 Unfeloni5
684,884,773 *46BEE380A37C6BF905369748410B5D545D19439D unfeltlies
684,884,774 *46B1D4888A90CFBA7E002089E36B8816950F1A1B unfencingt2
684,884,775 *46BBBFE6E1598FB996C7585B4E452636F8FDCF96 unffeore5
684,884,776 *46BD99AD27F504E964F5352D23D7ED5F12DDDE1E [email protected]!+hfu1ne$$
684,884,777 *46B875713EB8ECA27C3F2B8A95176A172CDAAB42 UNFI77IN9
684,884,778 *46B1AD15AFF7428BD89F237393B688AF5BC73248 unfilled1
684,884,779 *46BCA28D65CB60C5158423961B944134697440B1 Unfilling.
684,884,780 *46B27D15B67CC74393CDAE6437EAE10051E8FA18 unfishables3
684,884,781 *46B9C654EF7FFF27D9373A65FC726B2646C37BFC unflaggingly3
684,884,782 *46B9D8FBC37918B94E630043EC98BF0582C18E50 unflexiblies4
684,884,783 *46B8F6676D70430941B317836F3378D4CE978562 UNFLOWERINGS
684,884,784 *46B69C06D14BB1597B5A81C636FADE5039FC8E27 UNFLYIABLE
684,884,785 *46BD3A6471F410DCA7DF08F8CD226B678EBF1383 unfondning
684,884,786 *46BB345D30CBB6503E0A9F30C517737E64C44AA9 unfondunfond7
684,884,787 *46B04A384D02431E50ECCA9CC2CF9EFC3AA70093 unforgable4
684,884,788 *46BBCAB78C974D197C612E7A4126FFD6ACCD6CE7 unforgivenesses0
684,884,789 *46B763978A4534767760CABB4663E8E9B427C3B9 Unfo"rmlich
684,884,790 *46B28603EF70BC603F68287D51F68FEC67ADBD71 Unformulistic4
684,884,791 *46B141367C9492A4CA36F5E83BDA9B5575DE94F2 unfortunate soul
684,884,792 *46B245510CF3AD27F9F82F70056C7A0F97D87940 unforzar8
684,884,793 *46B8ACEA146D5A845C303A3A42B0B5152664DCDE unfossiliferous4
684,884,794 *46B7E68C8DA505AF08B5FA67947E98D3198CE7F7 unfoughten7
684,884,795 *46BBE80B1C334E2B5EE2C90058A96B6AEFFBB520 unfoulings
684,884,796 *46B2FC59C6838D55A457E2E52CCC630B04D4B1CB Unfoxeding
684,884,797 *46B02E3E9DB0701E7168C8087196A2E1B1B8F27C UNFRAMABLE7
684,884,798 *46B567219C267903D2D15FBF80B73CC887F4B542 unfrankedsing
684,884,799 *46BCA4536F3E2D5D15661AEEB26F0E36DE80620E unfraudulentlyved
684,884,800 *46B9C94C17F770E9BF035555C8375149A5C43AB3 unfree3
684,884,801 *46B94BB798EC57A6512972DBE2394D5BCD510E1A UNFREIWI
684,884,802 *46B276D71C08A77032F48451BEF3BF5678BBA388 Unfrequentness5
684,884,803 *46BF37E5F1B2B6A361B6655B2AD79F9C6F9F391F unfructuouse2
684,884,804 *46B28C41B7D564F9EE32E4DFB9BDA23387CA4ED2 unfrutuositied
684,884,805 *46B85246C411584EC244CAFC2061EACB8755FB7F unfugitively1
684,884,806 *46B0CCA6FD213AD3A8A6C518EE9672497AAC09FE Unfulleding
684,884,807 *46BCC4F3860E6900166D0D3A02F907BB8C274EFA unfum1ga7ed
684,884,808 *46B528F2069CCC11FD587F3EB1164FFCD98F0F35 unfurnic
684,884,809 *46B2A3E75F32BDDE3B6ACD00E95F38E85BE4BEE0 Ungainsa6
684,884,810 *46B632A97FBF592D2FEE82334C07E22304D9A9FD Ungamelike.
684,884,811 *46BC5F3CC54EA70D047B8342477F6EE1C566CB9E Ungangre6
684,884,812 *46B12304F93D538EA2141E7C37585CA7E269304F UngarischerTanzNo.15inBmajor:Allegrettograzioso
684,884,813 *46B99FE9A4E69AF4FFF0C1B01A69866DF01ED0CA ungbjörk
684,884,814 *46B3C23F43566BCEDF858782876395A9091A156D UNGDOMSPOLITIK
684,884,815 *46B87ECC246466666E1E4C7DF7B9EE0D591C66E2 Ungeahnd6
684,884,816 *46BA64C362C679971577FCDBC39F4CCA148B0D74 ungebremster8
684,884,817 *46BBDEBDC96B866DAA04438DE37B8F97DB9177D0 ungefaerbte1
684,884,818 *46B04FC68C85E0E8042730F213730324947D967D ungefahrdete0
684,884,819 *46B2A666CD6D767E1279CC7213807C7B41227816 Ungefähren
684,884,820 *46B1E87B4282FB645051F23F87712E70CD5E6167 ungefall8
684,884,821 *46BA7505462EC2755FD7951B8AAFA43F53F08BF3 ungehalteneren8
684,884,822 *46BB0C6F03816D8C544207D1A455082B194162E7 [email protected]
684,884,823 *46B3123C522266223652D05263A76F9F0E8ED218 Ungemach2
684,884,824 *46B7379DA500FAEDEEFEF4DD266AB466724ACB1E ungemuetlichen6
684,884,825 *46BA4AB374B4D735A2ACF9BB74D279ED9438883A ungeneralise2
684,884,826 *46B3BD7174C3058918A20FCA138117F5685FD4AE ungenierteren4
684,884,827 *46BEEBBAC3187D536C7F03CA3FED936C0FE30260 ungenteelness5
684,884,828 *46B6E79682B32F8B4A8494B548440B05E2F4F899 Ungentler
684,884,829 *46B3025F53D9BABA8FD221DD2BD07A3B8A0FA232 UNGERACHTESTEN
684,884,830 *46B2EF37C8D16761FAED54900458C26046649084 UNGERMINANTA
684,884,831 *46B22C04E650FB552D38049B9A1D58F32FBA2211 ungerstange
684,884,832 *46B897F9F4A5227FA2F452A2466016398BFEFC99 ungeruehrtesten8
684,884,833 *46BE92F8A53322F467D65300A3CD72395E841F36 ungeruhrten1
684,884,834 *46BED8774B575441881C483EAE5BA95E750463C9 ungesceadwisan9
684,884,835 *46B90016A24EAA1735B2ED86F6FD590FECD155E7 ungeschult6
684,884,836 *46B180B38E69ED766AB87A99D71C00E1C127B289 Ungesippen
684,884,837 *46BCEEA9D09AA1BEDCDA6156BB7D3398A6690248 ungesunderesing
684,884,838 *46B1CA7CBE744A8F37BEAE1B6B5EAE2715D911F3 „Ungethangen“
684,884,839 *46B2D50E45CBF47CC7CC7579E883A06AC6A7E82E ungettübter
684,884,840 *46B948087D54EAE8788D94D9BD76D6F0D74DD1BC Unginned3
684,884,841 *46B09328A6BE64741D2B5CCD919D9087A955BC08 [email protected]@[email protected]
684,884,842 *46B098C74845557F31E71D0F235C64563329B330 unglckstags3
684,884,843 *46B700DCFBD5A64A5B05DFA69DEB4B5C27D80A2B unglobular.
684,884,844 *46B163C0886F745C1059154E00C7CD77AD601F03 ungloriousa7
684,884,845 *46B11CAE40D50ABBC958CC571BFC95A2B3DE2A1F unglutinouslies4
684,884,846 *46B0BF31724631310A1786A9F8A3C3F6399692B6 Ungoitered!
684,884,847 *46B0D3EBE124C699F027497577547D1CF7F0CF1E ungossipings4
684,884,848 *46B0AF3B367FED6487F45CCE9E33DB11E174C256 ungottlich9
684,884,849 *46B8DA25A76F99BD5EFB4A86015C8085A8251955 ungovernable23were
684,884,850 *46B31E8DFA06EE68647BEAD968FE755DE3978BE0 Ungraphic1
684,884,851 *46B7C13F14F5465F30894C0ED9003C7178DD5AB4 Ungravitative.
684,884,852 *46B8EB7A6A55C6235DF86EFC27AA4B222B199EAC [email protected]
684,884,853 *46B905811A408774EAC326E2F8FFBA0C8EEB72D9 UNGRUDGINGLY1
684,884,854 *46B5CFF773948127961BC45BC9138768033FDC3F Ungrudgingly2
684,884,855 *46B7D3A9A367F29C628E251DA036097BA32F46AC Ungruesome2
684,884,856 *46BB64DE6DD92C476456AA5310C56B8F1D6072E9 ungsbestaendiges2
684,884,857 *46B7FB351BA885EA6201130BD9C8F355E38A480C unguentiferou$
684,884,858 *46BD677B83B9E6353F19FA28C7BFC5D9B02F399A unguiphora
684,884,859 *46BF75FF6D3A5E9848B0A30BC46A043403894AF7 ungulaten6
684,884,860 *46B4118EDBA6464C997847B089E47BD93B54EAB9 UNH3S17A71NG
684,884,861 *46B37819A61EE4C41C7A268357561F24B3F469BE unha1r3d
684,884,862 *46BE7F308CD4B5558931D5EEE9769201E80BC897 unhaftem5
684,884,863 *46B6C4CC1F2EB93E9CB865A1D5AE9573B92E3DDB UNHANDSOMELY.
684,884,864 *46B2E7B9462FE84E6C568329C4B28A7A1B97F2F9 unharmed.4
684,884,865 *46B97A183F9CE94F708314D1D59FB43FEB6523F0 Unharn3ssing
684,884,866 *46B256004C6E08DDF1C99ED20E7A889FC7293C9B unhbbb
684,884,867 *46B1369A853D75576C4FEAAD0B0B0FFFF7AADED3 UNHEARD9
684,884,868 *46B37CB90E064759DD78D6B329718818829DFAAF unheardskatesupply
684,884,869 *46BC75AA7C5E7E43F7B9500F90A410B137E60549 unheartie4
684,884,870 *46B06B74C26417F420FBA77F74A658F20188C670 [email protected]
684,884,871 *46B2FDAA6D58D383A3B8E1A8569DEA6A979A2735 Unheiles9
684,884,872 *46BDB053A9C8A3B57BEF5269F4574DDD9CC48255 unheils8
684,884,873 *46B474BC3CF999B73ED5DDEB1164718E09132246 Unhes1+a+1n9
684,884,874 *46BCE2FB1BE5029DFB8FBDF6AF04C24C0B86A2C3 unhesitantunhesitant
684,884,875 *46B7B80310B72A7249DC3181834686261A0268BF unhesitatingsing
684,884,876 *46B5AA745F069BD7AC6B361E5326BB679E6B4540 Unhex3
684,884,877 *46B4334E4EF451DB2C762EF7CB88725571CF114E UNHILARIOUSNESS
684,884,878 *46B1C7D6C9699454A14B4C7482AFFC36AC26C2D8 Unhold0
684,884,879 *46B2238C3E69B65AE317197B545FCCA52958C099 Unholy Flames
684,884,880 *46BF07E26933FBEE2318D702FAD52B68332C4C08 unhomologicallies3
684,884,881 *46B99E5FB8AFA193C1EF31F8A23665E5B5DE0B38 UNHOMOLOGIZED
684,884,882 *46B3478AD40ECCE6F13380DF0C449E719A8130F0 Unhorn3d
684,884,883 *46BFCB52D3416EB8AC2DBFD9998B7B86C4FE8228 unhostilelies2
684,884,884 *46B2EA803FA6E3F6A21E9CECE7156A1C03FE4A8E UNHUDDLE.
684,884,885 *46B26223F78380041B819859B0E69134B372CCD3 unhueddeuhnU
684,884,886 *46B1D659196BF88EFE2B7FE38F7D2825F0E0E274 unhumbleds1
684,884,887 *46BD75F1EA9B735788F938F6A91CE5642ADAB72A unhurleD
684,884,888 *46BE304833F9EE0F9E5BF04006A8B259263996E7 Unhushed5
684,884,889 *46B0423336DEA5725A5459A124D4CECF7CF93D95 unhustles
684,884,890 *46BAC3A6F2C3976E5FD3D845FF533EDFA75DD914 Uni0n jet
684,884,891 *46BD687C28AEDA5D40EFFA5F2DD8082B8DBCFC3C Uni
684,884,892 *46B6813D6CCB50EF7CC11564958E1B54F165830F uniaxifer6
684,884,893 *46B02292005056B076A96F4875905B24F303D5CC uni-ballpens
684,884,894 *46B81AEF00EC744DAF5DA508B7DDD43E892E2956 unible9877
684,884,895 *46BC577A79DCBE9B4BD1BD0C9B5F5C1700E013C0 unica098
684,884,896 *46B34101CB303E58A36A66BC96BAF31627618690 unicamaldita ft japz
684,884,897 *46B546D3477B86EDB165A1A7279B1D23B7411BFE Unicameral?
684,884,898 *46B36875DB0C10F8D3DC00A200524A338DF344E7 unicampansp123
684,884,899 *46B3670A3BFE7A647E4556DD69BDAE02DD6BB846 unicef.org.nzwww
684,884,900 *46B46C98027FB1B3EC251F835F6B082E0E7811BE Unicord8
684,884,901 *46BA0D3AC236094EEA16140B21DDCA35FCD5E927 Unicorn007
684,884,902 *46BA2A8A4ECDE417CDAFC0005CD716A5D2544EEB UNICORNBEAVIS
684,884,903 *46BF173C4304F7A773B69C952CE8E6249F206F73 unicornchinaed
684,884,904 *46BA7CC8885B88F41A2DDFECF6EFA12B6C676668 unicornfelix4
684,884,905 *46BA08FA9D71BE89D7C78C68A4C2E8CB1F13E869 unicorngroovy1
684,884,906 *46B9E82990462187207B721355CE133E1B7B7D40 Unicornhobbit
684,884,907 *46B33F0D8D4995FBCDEA096A7DAA81969166EEA4 Unicornporter
684,884,908 *46B67E454249C9241419925C95AC1500CBD19C2A unicornsmokey3
684,884,909 *46BAC2237814E1975F82F12721BAE61A1E8D63BD unicornvermont9
684,884,910 *46B014AF3DCC96D66753E982B5339C280870E7C6 Unicorny1
684,884,911 *46B9CB5D10AE7D21CD3FCA2E061ECF8404E9A98C unidealised8
684,884,912 *46B2B5B5F01E1BBE11C79674768E237057374253 unidextrality2
684,884,913 *46B52E42F680D007DBEFC1C4A48E747673088CE2 unidk1234
684,884,914 *46BF3C82C0C0254D00079AA14736A774CC6C90EE unidoors
684,884,915 *46B8EC11667A3CDCE47F37840F44B922B31623B6 unifbigate0
684,884,916 *46BFC9BBBF66A12299CC76DA493745C1C392DCD5 unifiedly6
684,884,917 *46BF8F9469E281C2DC17249656D3E7B4F2F810F2 UNIFORMINO4
684,884,918 *46B059474E176034EFD05E45ACAC00B5C00511AE uniformiseses9
684,884,919 *46B540C08167614BE8AB31831CADE836BED5C008 Uniformträgerbereich
684,884,920 *46BB2B1AA57446C9FF529565AB0A47515EEC4C03 Unifyor0
684,884,921 *46B7CB2D6D1FC7BF68AE333F4BDCB75E13F134A3 uNight
684,884,922 *46BBF1DB83B14118125CB350C9788CC3F4D79686 uniguttulate1234
684,884,923 *46B51D2EAE8C38603ABD7577893F29CEE3D7F138 unihbaitated
684,884,924 *46B7003C98FC36E9CCF2079DFA1AA417583EB02B unihoure4
684,884,925 *46BB4371673B122BA27BFC0E0F8B9417A1F55E11 Unijela9
684,884,926 *46BA08300418A46B804C9D15FB1694AEB14B6F4F Unikitaed
684,884,927 *46B6A3A164CFF3D9D995BD3FF8684D01C514EC69 unilab 7 0
684,884,928 *46B52CB9CCD4C0A4B7774FF91B64ABF034A25F08 unilateralisation's
684,884,929 *46B5E266F50053A6777A2B126E15BB85AC83A8CB unilateralmentes
684,884,930 *46B11D5344065985FEDF188265A7D81372575E5B UNIMAX
684,884,931 *46BCC08FE382FF7A269666AACF791D5226369682 unimitabbing
684,884,932 *46B1DAC4733127220A6390F76498AADD5E1A6DB9 unimmanents7
684,884,933 *46BF65BE945000E672D748E98EE8CF1E3CCD11B8 unimp1ici7
684,884,934 *46BB0A37CA928563552D3E0519B7E8524C9A1C92 Unimportunately!
684,884,935 *46BA4E291D1EFBB1E47B994101B35C4E9C719CAF unin+7ersec+7ed
684,884,936 *46B539373C7B8BBADD74577076C23DDE6D1AD002 unincisives1
684,884,937 *46B1C9803048E0D97FC776FAB634133BC2EE2E31 UNINCLOSEDNESS2
684,884,938 *46B39EB93ED5A1ADC86CE1C0D0C6A1E68E0F5508 Unindebtedly6
684,884,939 *46B4D839C4A842D0E7A3FA3672CBE5E90357F45B unindenet
684,884,940 *46BDB7ACC1C26266252061834B83D2152DC6B53D unindulgenta9
684,884,941 *46B2203819AF04F107938F08D4C985317BC9C90A Uninerta3
684,884,942 *46B15305E2D33F17AAF1F6DC3D0B46CD3185DE42 Uninformative4
684,884,943 *46B696B2A26291757A7C8ED5D1F326549CEC91BB uninfringeables6
684,884,944 *46B4794FF47E0668CB37C9A670797C8FC2D90E18 uninhibit6
684,884,945 *46B34F58E812CE43D4CA1E61487C2311C18E73ED uniniciarensed
684,884,946 *46B37D1EC1A97B05A048D70110BDCFD3A4C5B12D uninjurednesses1
684,884,947 *46BCC18F222DA1F9E5D2D4DD80FD045EB6D62002 UNINND
684,884,948 *46B12F9FD4C9EB6ED9356ED3291CA2A08607CA5A uninquisitorial7
684,884,949 *46BF11856A6AFF7B7F262D5D2A688D29B889879F uninsolateda9
684,884,950 *46B893C83D9401A8CFF003C3E6E4EA1685066590 uninterrumpiring
684,884,951 *46BF23FA6D54C271062DEC423DFEEA3CFCCFCC38 [email protected]
684,884,952 *46B8431089727212251D9F5D2D419055A365910E Uninweav4
684,884,953 *46B1F80BDBF0DB84AC555304ADAF9D67BC603A69 unio flores
684,884,954 *46B8BD1C50BFC81D50368DE56B5373E4F4400B04 unioneu123
684,884,955 *46B966316895B62DBCCCD3B9E0BAB3FF981FDBEE uniongavin
684,884,956 *46BA42E26C54C7451BD5EAD237644F8ECE37748B [email protected]
684,884,957 *46B25DA7C56DFC666BD25C0A74266F99CEAE7B41 union-o
684,884,958 *46B8FA0793EC63D1B1336CED2DF1B803811B81A3 unionsine7
684,884,959 *46B56F487B7A7BFC1C79BBCDF907F6545AE3D781 uniontemplateeuropea
684,884,960 *46B18E2F062A0E410072DCC78153D9A0996B6AF4 uniotik roxas
684,884,961 *46BBEF9641EE865673BFBAF89BB76C324B0C4FBE Unipodsed
684,884,962 *46BC9B1DB10497F6945A2E9E2DF2E3C5C99992A8 uniporouses7
684,884,963 *46BF03E6238D49A36CF4C4AD73CA96AC995F95A2 unipsyco
684,884,964 *46B677FBBEF4C68685E035F276DC459E42B1656A unique billups
684,884,965 *46BF197BEA39A3BA35CE85411EE720B27D32E628 uniquelymadelillard
684,884,966 *46B448EB5092D3A2927BD941524F7EA050D4E019 unique sk
684,884,967 *46B2D6262DD0775890A6A74C9DE0644656ABCD7E unirritableness9
684,884,968 *46B744F12DD854BDBF7FF169A428FB46E0421AC1 unisoil4
684,884,969 *46B231CAD9E5DEC55550FBA07F75498A26F86973 UNISPHERE-THE-BIGGEST-WORLD-ON-EARTH
684,884,970 *46BF08BD1351A38BCEC9D34C58AECC2470727DA8 unistylied
684,884,971 *46B748D77B6D6385F8E61E1338DFAEED54DD07CA unitarg
684,884,972 *46BF445472CFC6A397271126E493BA4E81CCA031 Unitaritätsbedingung
684,884,973 *46B92D08317F94FDAB340049669D0875606F70F7 unitarying9
684,884,974 *46BB98367466827A7482A1CAC71A92C8E0C9A0B9 uniteable3
684,884,975 *46BE3E615565843FC699608D96A6483AEF6FF003 united:brooklyn
684,884,976 *46BC7C80DF13FA3E11EB3D463F027591681B6F09 UNITEDCC
684,884,977 *46B35B1E92D5F016E134562943962597ED8B09E5 unitednetherlands.nl
684,884,978 *46B3DBD06079C68AF68D858D76C36755D89DD311 unitedsisters
684,884,979 *46B2D0591783D89159C860444097DE16FE848519 United States Army Strings
684,884,980 *46BE90BE08F6311AF745659F6DFF861264FB2672 unite eightoeight
684,884,981 *46B1C6057E693268D32D695214D5657E0C393AC4 unitivenessing
684,884,982 *46BE7C342270BD5BB2436D8AD09F4A9C39FDE045 Unitizer4
684,884,983 *46B7035ECB9500A1A9BEB21745741C50A328C9D5 unitjoe
684,884,984 *46BDD42C624F726DADF4D733762DC52DB66FF49B unitminute4
684,884,985 *46B29C0E85A770C7E9A7361BBF257694E67595DE Unitologist
684,884,986 *46BDAAD09652520FECFB50A5E8BD1B84B30D1C50 Unitounito
684,884,987 *46BCE0302749DEAD195F4A8123E08407B6073632 Unitti
684,884,988 *46B533B1DB876802C0DFC6971B9709ABAB0F51F8 unittinu2
684,884,989 *46BE91C829ADB164D5AD639899E14B28F8BBF94C unityuniversals
684,884,990 *46B9D041C6ED6E9A3477428BC4B5484F93647A94 unit)故障導致
684,884,991 *46BEC5FBF476A7D6D7FC821912C1909A102533A5 Uniu
684,884,992 *46B43D373D2F0BC35EEA2FEBC370FFBD6AE19BDB [email protected]
684,884,993 *46B32A3E87332FD34935A7E41DDB82575F8FFF09 universalglauben
684,884,994 *46B13E4CB3752811F099769E7F1DC9148D656291 UniversalMother:BoongheeMusic3
684,884,995 *46BE998782E4C9125921FB6231C5491E4E461928 [email protected]
684,884,996 *46B9439B152A294DAF83E118007B268581C56A5A universal order of armageddon
684,884,997 *46BA6CE708F1631D433A449B519B9C88612B6FDD universalresource7
684,884,998 *46B519A3E9C9AD8EE16091F4A91817C14BE42FE2 Universas”
684,884,999 *46B64E5A8F32318C06B4A043814CF00439536B01 universegtgt
684,885,000 *46B5E10008737F981EBCC190B2AEA23D013AA1F8 universitätserfahrungen
684,885,001 *46BAF6C4B52F194DCB0087966A0E3AD4863C063C Universitätsluft
684,885,002 *46BB199AD274C208F8037726F230C79A1679F90B universitetsforlag5
684,885,003 *46B67F9CCBAFDF962BF767E67211BD1D7FCE9AE7 Universitetslektor
684,885,004 *46B218EDCC3F05D7A986B1FA6D8F5D67328076C0 universitetslreres7
684,885,005 *46BFA4F7796D408E29EDF42B7CBDC24E950CF94E universitr0
684,885,006 *46B76B9E3EA2360A33F47E49DFB98F34067C60AA university-of-extrication
684,885,007 *46B085EC9F015085151FEB8DD7D0BA372E356491 UniversityofOxford
684,885,008 *46B37FC5BF29E45E0B78E5B93BC72217BDE41888 UniversitySceneggiatura
684,885,009 *46BEDCC95A28AE6366A4D831F4BDD0AAADCA6740 UNIVERSITYSHIP2
684,885,010 *46B10FEDB2AF2EC61509FD0F047EF20933498F84 universitytalkannama
684,885,011 *46B8A43BF47EE070F7D614FA3C890E45ABC0494E universityun
684,885,012 *46BFF8FA215CA55FBF95BAB3E5CB0B7D1AE16758 universitywides
684,885,013 *46B4C36989360CCAEE36FFA9883DE0493A54BA0E university)は、桃園県にある科技大学である。
684,885,014 *46B0EEB03F796D1D15101BF2113A5476B66DD9BF universo 2
684,885,015 *46B663C0EFC2893551AE39B328E0A6B91B1E071D Univlyon6
684,885,016 *46B13BDE942830F05C5EBD673661158B791A3091 Univokt
684,885,017 *46B370150964598E746D49570ECD9590EF84AADF univrsitybsw6
684,885,018 *46B13F38F530D902B8011426F57FD10D7A3B02DC uniwikilogo
684,885,019 *46BEFD3BFA1AE7188B31565FFB854463E515982E unixcygwin
684,885,020 *46B765AF364E43E97C20A0FC5ADD440C8C443440 unixkristen
684,885,021 *46B219694D777D484B874D55967C673EC75863D4 unixman2
684,885,022 *46BECBF41FD6FBA90814487E3D8786CEDDCC2149 [email protected]
684,885,023 *46BF17ECB6B32ED8FAAF24FAB914B53910523204 ŭnjong
684,885,024 *46B05E7865BC2B64A269355A8A918337E3B4890E unjudaize1
684,885,025 *46B5AB5C5F9D1BBDC8C0C6E1180CE94CFD92F07A unjustunjust3
684,885,026 *46B3DB5BD8E0B99DD3210646879811C5156DF7A7 unkenddneknu2
684,885,027 *46BC2BB626B1CFBF147AC72F41E84B11C3AD3318 unkeyize1
684,885,028 *46BF0C2D04A650FD09D4E4877045FFD1F97BC2EE Unkilling9
684,885,029 *46B8C635490685FFD3E0D5A1C05B8D2627C70CB8 UNKINGULATUS
684,885,030 *46B22240F9C24646F9805B962D707C51FE72FDA1 unknightlines8
684,885,031 *46B4A198F686418784F4205EF7327604239B9DB6 Unknotty6
684,885,032 *46BE62117154352B81766AEF996FAA41EA1B6CD1 UNKNOWABLE0
684,885,033 *46BD9C0E04AC16191AA60F9008EEB384436A3DDB unknowingnessn6
684,885,034 *46BFF423ED7B0D23B6EC6FF85DB4157951E52DFB unknown1601601566
684,885,035 *46BE4A3923E27F6096FBE536869F49A4C2247870 UNKNOWN1926
684,885,036 *46B5531051D050BAAB5D20DAAF4D342AA18734CA unknown quantity
684,885,037 *46BC928BDAE69A6034CC856BC55EBC70C8480C44 unkommentiertbsw3
684,885,038 *46BFE46F902F757C6B6A67752658E4911A90CAFF unkrautarme
684,885,039 *46B7EEAE97927A894C6C59AB95FB086449A62FAE unktionr7
684,885,040 *46B44299286E9CA5B6FC3282D56A75985B0254FD UNL4M3NT3D
684,885,041 *46BACEF405F73AC124065D7F1C679858665517BF unl4wy3r3d
684,885,042 *46B8047300CBD3CA9CD852E6329DAF608A6684FA Unleached1
684,885,043 *46B863B0316CCB4B61384AD93CC5EF9D731AC787 unlemon
684,885,044 *46B0F18A0C5C3203684BF700B8631A7F3F79EDDA Unliberalized8
684,885,045 *46B651B3E1C4E36921DFBCBE7B0DC78004D50CCE unlicenc4
684,885,046 *46B4D8B9B86EC0D9530CF1070A479C47F24D2BE9 Unlicencing
684,885,047 *46B05830CA4308D56A2EEA4CD865E7895CB55593 [email protected]
684,885,048 *46B24E1AC626AD640061BFD2F20A6BAB16F0A6A2 unlikeanymerely8
684,885,049 *46B76117C80EBF3D6D4A41632586E158F690D23C unlikedawson
684,885,050 *46B2E956B740DD663646EBC131D195262EC9E025 Unlimes8
684,885,051 *46B1A58D5BFDD3F71F58BCA06458D0C776A2424F [email protected]
684,885,052 *46BF6DE5437D3AD488733189A240B0CE88947D85 unlimitedCategories
684,885,053 *46B25586B3546765B8774A65E54038DF5F0F0FA8 unlimitlesS
684,885,054 *46B7EBAAB0F5F985A1DB87CDAF0C7EB60B6CDC04 Unlinkll0
684,885,055 *46B9F8D73E041AA353BA230F02F9F8A34D696DA9 unlocodedeque
684,885,056 *46B5CE2AD6CFB7BA94E17D4CA04FFEE97CFFD8F4 Unlovable5
684,885,057 *46B4D596FE64FE417A8386F5D46FCE4F89387473 UNLOVERLY3
684,885,058 *46BF04BE3FD81CBD2EEF6A72AB8DF30A08465A74 unls-agee-zeng-win-orca-awards
684,885,059 *46B4E30FB1C7212911A82E6A029C3B82735BFC1F unlucky kuwaiti
684,885,060 *46B2BB9017895DCDDB9C8066969B819EFE596EEF UNMAENNLICHEN
684,885,061 *46B76D59517D26D7B33126F56068D854106CA176 unmandat0
684,885,062 *46B507ADA6D751203B86F6AD9E4BC117A76B5B8E unmannishes4
684,885,063 *46BC7C6CF4F7DDF8E594E9F5D84CC65EA2DBAE3C unmarriedwoman0
684,885,064 *46BC55EED1A62689321D60C9B1055DC6B3959ECA unmarvellousn2
684,885,065 *46B6A25C65402DF4821766FD5AC15283628E18A9 unmateds9
684,885,066 *46BD20FF7193CF478CCA43BFEB8569B1FDAC990F Unmellifluent.
684,885,067 *46BBD5326CD86F40C6B7B8DB9EA8AEF2BB259967 [email protected]
684,885,068 *46B31596FF439EBDE52BA04AAADDE465BFD3EBF7 unmerchandiseda7
684,885,069 *46B89B650FFDB0C761865AF7FA3011812342FBB9 unmethodisinga7
684,885,070 *46BC6C247E68FE4DA2E2EC31F6F72A443540E5F8 unmhhmdbostlp7
684,885,071 *46B4E209C302AAB15EB326FB7E1005D6AE89F26D UNMIMETICALLY7
684,885,072 *46B33CAC33210E836A4FCE7E83372DB2E765E98A unmisBSW
684,885,073 *46B0C6A0DF88999BE49D5F4742B56CC1F7901779 unmisguidedlyv2
684,885,074 *46B205BE3820A0141DABF183A82D0569516F1F23 unmistakableness1
684,885,075 *46BB4664390EB468F538F8D45610E3A9701BAF5A unmitigatedned
684,885,076 *46BA85FA06C5011A7FEB3407D29FD5CE9FB1C211 unmixednesss7
684,885,077 *46B0FB52D9F8121E63328970499632E9F0B4F7D4 unmoeblierten6
684,885,078 *46BC00319DFFB3D6028B26AF4452580E5F9C3894 unmoi5+en
684,885,079 *46BB0DD49CB50D8F0A9E3CAD2A510F7B590EA8E1 Unmold4bl
684,885,080 *46B62E95B45C84C20BD097CD03E52FC6411C7092 Unmooted4
684,885,081 *46B9053B5340DF7DBEDFF9EA03FFAE066CBA926F Unmother9
684,885,082 *46BE8DC0CCB95DAC0F1E3DA757F64C8E1217DE1B unmuffl5
684,885,083 *46B0BBDF938F2D9FD760DC6CD5B185CC9441EF9F unmultiplicables3
684,885,084 *46B13C6F0F1DEB3BD49AD44A724B2AE0C87BA9C7 UNMUNICIPALIZED
684,885,085 *46B1FE16302B2D808E5AE3823625E5DDB3D71663 Unmurmured7
684,885,086 *46BF3BCCA48A2353D9263A5D778847AEA24D22AD unmusicalnesss9
684,885,087 *46B5C0D90B3A4CE41A996E27DC326E13E948A3DE unmutilativeS
684,885,088 *46BC6BE6FC65AD29F9A2B244D9CF678031633585 UNN0T1CEA81Y
684,885,089 *46BF86EE1DBBC9B1EA8D3FAB01AD29A5D055AFD0 unn0tce4b1y
684,885,090 *46BE98516B4B5732E7DBD50FC564B134A189C373 [email protected]
684,885,091 *46BF2B91E9F2F1B9440DB0189C02436193CDB873 UNN4+UR41N3SS
684,885,092 *46B23237877ADE54632BAB3917A5FD406F377C97 Unnab»
684,885,093 *46BDF6E7CA57C1499C5AC9167C7D7C0F6A88EE5E unnahbareS
684,885,094 *46B3BD801038DD366BD1677D8258ACDD032E665F unnamedworld(offvocal)
684,885,095 *46B238D8E8B871E8EE899A8D280FEB0904B1C6E0 unnataing
684,885,096 *46B43B82452565ABFAB38BD75C7FC2DAD3B6C3CC unnatisakhre
684,885,097 *46B0801E53F7AFEA3D077AE10BD2ED4E129E64F3 unnatitailortailor
684,885,098 *46BC5A9F64A8482634C8343BC27E937EA8E7A97A Unnatural6
684,885,099 *46B8E9764BC0D33A8C35B9D351E355506893EB82 unnecessitate9
684,885,100 *46BB666DC945C0F3F90D31EAD14C75B07B7DC3DE unnelweb9
684,885,101 *46B6522C0FDF3629258A0B2F9C22E3F8A82E80C3 ünnepelni
684,885,102 *46B0825C123E15F80062A6CAC118C29C368E9371 unnieatillo
684,885,103 *46BEF0A84F3C29E2FA70CFC2441A50FC839D78AF unnimayakaruthedath
684,885,104 *46BC180FAFE93050405964690665D65244E0CDF8 un$no88i$h
684,885,105 *46BFBB4A3CDC2FABC3FD571859E0CA590A3EEFD1 unnojrats
684,885,106 *46B207EB2755326B769E4A4DD51D5CA2136B181E UNNORMALNESSES
684,885,107 *46B68233CC62B4AD3997932B3270B058E9B777F1 unnoseda0
684,885,108 *46B4748C6A012553EDC5189689C8331576AF2CB0 unnoyandnessing
684,885,109 *46B9AF3959A4921995101D0E7CD07DE7436D700A unnuc1eat
684,885,110 *46BFD0D01C2248E66081C8780C77239E9363A4A9 UNOBNOXIOUSNESS6
684,885,111 *46BAAD3BD979E853D7C1C98BFC174D7FAF64609C UNOBSERVANTNESS5
684,885,112 *46B7082BE95751FF4BD67A458DE084F63F35D390 Unobtund7
684,885,113 *46B0253208C98434E72DD60CEBE3A0920C74CEFB Unoccupi3
684,885,114 *46BDF271B686CEA021F1279B10D400A0648492AF Unojiontopostouro(Canteloube-Chantd'auvergne)
684,885,115 *46B580271E4609944ED3DE6D387E1DAADD21D3E6 unojunghans
684,885,116 *46BE9A10B1E278F696265836A24E1A122AAF8374 UNOKAT
684,885,117 *46BC682BC8E700E965EC5FAC86E763B9A246852E Un'ora di lei
684,885,118 *46BAEFF29F6B365D023D9812CE515F8FCC947046 Unoratorical9
684,885,119 *46BCA5DEA93A993A9406E9391F7129515C4A3871 Unoratorically2
684,885,120 *46BB9EEFF49D1EA57CC1A4512BF9CBE1C7B3DE64 [email protected]
684,885,121 *46B4ABE9D51EFE6441D15E6F9DCB8F6FE58F3745 UNORMOWAC
684,885,122 *46B9FC55FB7E5DCBAF86CAD158CCACF718517674 unorthedox
684,885,123 *46B123D1BE2572E78CB23F627F24B01A0070BA39 unoutrageds5
684,885,124 *46B66DA8ABCFFF31D779E350D3A60BAB5C6A2C49 Unoxygenated0
684,885,125 *46B10D2FB227D27C19D63334FEAD46804BFD3AF6 Unp014riz
684,885,126 *46B28EE08C7661EC0D2CD6FECD839E61B28E1CD2 [email protected]!V3
684,885,127 *46B1B2F0F1911FF6EA833B71716C3FF7E304CD10 unp4ck1t
684,885,128 *46BD08C921F09C70A78D55DCC5B9145E4D077DD9 unp4ss4b1eness
684,885,129 *46B5A293630F5F933950E9746A0F77F88E25F223 unpa551onately
684,885,130 *46B93B1A2B464B0BAE96F0721E1FCCB4A53BFB1C unpackquotcquoted
684,885,131 *46B9ECF40E1B622BA1CBA734BA1CCEE9A5678BEE Unpagina0
684,885,132 *46B7DC1C98943396ECABAEBC81688A89A89BC8FC Unpaper1
684,885,133 *46B1AD83667AEFAB3653C5E83290B208B60ADA14 unparche5
684,885,134 *46B8BFE4C8E62B399FFA4237919EF6D968B4EE84 unparegals8
684,885,135 *46B7B7FBFE9911394C517FCA974DE5EE5111338F UNPARLIAMENTARY9
684,885,136 *46B097A8E679AF7FB259587EC41A29316EC987D7 unpartab3
684,885,137 *46BC11A95A1386DC343688452C724F59BE400FDD unpassierbares2
684,885,138 *46BDEF2004057DF4A12EAE1B4E35E034BBCFE421 [email protected]
684,885,139 *46B5C201A55333E712EB3B3A0DA6F62C8B0A1F19 Unpatriotica11y
684,885,140 *46B9BBCF84020C0B45B08F65C02444C268C0F8D7 unpatronizabl6
684,885,141 *46BF80DBF3941B8974D63D91CC2E327A25F25710 UNPECUNIARILY
684,885,142 *46B0B11A760D7055251C8299DF6B15CCA9EC8217 Unpejorative6
684,885,143 *46B13D4E341CE9B03F2C6039956BAA7B4E31830D Unperceptual4
684,885,144 *46BC0AB16F3D1F03CD1AE55340DF0A92E39AE2C7 Unperemptory3
684,885,145 *46B9467585AFA803183CB5A7BE90AEDE4FE934D4 unpermanenta0
684,885,146 *46BA6140F7383BC280F87D7779EA78071DF1260E unperpendicularunperpendicular
684,885,147 *46B6812A31B56DDCF462B6D6CA2EA7ADBB56BB8C Unperuked9
684,885,148 *46B5306D490D2F71B6E70514E6078EA4F551B9D6 UNPETRIFY9
684,885,149 *46BB48D01818C964B632C9E6853F8BB850AC76A1 UNPHOTOGRAPHABLEA
684,885,150 *46BCBF9A91C8E499DD95F6CCE8723B73688C0AC9 Unpite0u$
684,885,151 *46B310CD2DBB17740706972224309412381BC0C5 Unpledge7
684,885,152 *46BAB054D7DF7C3DBE0BCB8C534600BE1CD4DA65 unplein1
684,885,153 *46B155C3541456C9CA6F0E209BA7DB43F2EB11D3 unplugged dbc
684,885,154 *46BD086752CB2CDF641E2A366201327B779BCC26 [email protected]
684,885,155 *46BE950388402EFB123249D3CD1E9288952CE845 unpneumatica3
684,885,156 *46B88B259F8D6E63E5FBF4AD40F42ECCF1FB8C6B unpoliteness!
684,885,157 *46BA835258F80907EE1ADCA4771F6CA1FC1BFCE7 Unpolitic9
684,885,158 *46B9F0A7619E43A2AEB2FB1A8E8EEE97A5A88D36 [email protected]
684,885,159 *46BF48FEDCA3124DDDB8A7516F21F2A4B3D36558 UNPOPULARISES!
684,885,160 *46B1D30825BFC5F75D6836FF75A2E17AEF0E4977 unpopulouslyving
684,885,161 *46BA38C6C591A76FD75EB6754BB5FB0543BEA2BD unporousnesses2
684,885,162 *46B16B7A297D9774732B840120FBED36B8B49B88 unpossessivelies4
684,885,163 *46B72DF3B8155EEB487A8EDD6C59A7F99213E491 UNPOUTINGLY4
684,885,164 *46B8CE25BF1F14321E0FFA00BE219EB9523EB714 [email protected]$1813n3$$
684,885,165 *46BF1C1C10E6FEE3D5891368D85942475B3D8AC1 Unpr0+3$+ingly
684,885,166 *46BDCE73F5B1C177679AE83857F8EF670E5B57C7 unprecariousnesss8
684,885,167 *46B21F0F6EAED41E66D59A8811CE5F28A0969B37 Unpred1c7ab1117y
684,885,168 *46B8D97153EE70B52D25A43EC92C3565465B9703 Unprefixing
684,885,169 *46B3207D398997662554DA8F81107AD17656AEEE UNPREP0$$E$$IN9
684,885,170 *46B1084F310CDE9A5B34734FFF31061A9064E5B5 unpretendinglies5
684,885,171 *46BEEEE09DE19A80E2E6641A165A5497CC93A60E unpretendingnesses5
684,885,172 *46BB1A7DD58FF0CCCC28344732B4EA10BEAF1C5E UNPRETENTIOUS1
684,885,173 *46BCFB94D1A2FA59DCBAE7C223C120B38BF13DAF UNPREVENTIVE?
684,885,174 *46BFBF3D8AAF0F3DA66E3D5CE6C24EB22645561C unprimnesss3
684,885,175 *46B8D293E9CF87D5799260D20449A59AD959FD69 unprob1ematica1
684,885,176 *46BC721825AB25425A9D6BFB4DE9258690C0EE25 unprodigiousness4
684,885,177 *46B3FB2C682971F759A19526BC5BF96B84D1926B unproducti6
684,885,178 *46BFA91B7F7C78CDE0233F906635F24767CA99FB unprofanables
684,885,179 *46BF45F027CE4D584AF6DE82DA7F9D2D8CA7C982 unprogrammaticaed
684,885,180 *46BA9FCA38DAF985C2C5D55DC3E7A1EB25FAE847 UNPROGRE$$IVE
684,885,181 *46B3361EAA8EAC3C46DCEC1C1598D000AFCF5368 UNPROGRESSIVE1
684,885,182 *46B8C764CBE206EE825693A6DC59D7FD1ACB4D88 unpromota
684,885,183 *46B1848B4473E21A5052649BE566A55836E1F5D7 unpropose8
684,885,184 *46B56BF287C31FDAA38DFB3471D5EF104EE3B7FC Unpropriety2
684,885,185 *46B562496FD908C28C720C29BBB314BE7DEDFA92 unpropriety3
684,885,186 *46BD8C36280AEB7FBE0D8B5080EFF6F44C1682BF Unprovidenced7
684,885,187 *46BDBF0634113E7AAAC7EBBF0DA27E84FB06E080 Unprovoc5
684,885,188 *46B2FAF2D2A81E16192D969F379DA608E6805D6D Unpuck3r3d
684,885,189 *46BBB0AEA9286C5060926C188E56743F11D450B7 unpugnaciousnesss
684,885,190 *46B95084B12818EE4D7BDC429B46F376B5308FC2 Unpunisheds
684,885,191 *46BE0DE57732676F544E52408A20A84A06312AA3 unpupilleds
684,885,192 *46B24B9288912A516B9FB9FACABBC37060B495F4 Unpur10in
684,885,193 *46B9129101E4B8DA803DD0335A307FD54207426E unpurpledS
684,885,194 *46B160797CA8FCE7303B15E53A7337EDA7E34A2B UNQU3$+10NAB13
684,885,195 *46B71D494133CA21D7A71BD7FEBF475B1ED55ADB Unqu3$t1on1ngly
684,885,196 *46B5068CA6AE80ED62FBCEAD55D9E9D7991B5939 [email protected]
684,885,197 *46BACEE42F8716160CC399B6315C419BCF07F20B unr3sisti8ly
684,885,198 *46BE73208EAF3A00019A2A7D3CE4CF8FE846F739 unrallyinga5
684,885,199 *46B7075FCC9296701E9435A1E6D8B10EF40C591E unratabl9
684,885,200 *46BC3B776CEAB310E2EC36143F17CC7CD802DA63 Unrc
684,885,201 *46BD0F86400682C11B18064543D6C628E6907C10 UNREAL-FREEDOM
684,885,202 *46B33A8EEE59B2DF10A2E19724ADCF3DAB229772 UNREALISTISCHER
684,885,203 *46BF8F2AAFD3BBEBA550594C72D5FB50D4E32814 Unreasonable!
684,885,204 *46B1EB5224954EC4D2786D3089730DFE52120D16 unrebuttable123
684,885,205 *46BC021165AD114C7248FFB84C787EE0CBB797E1 Unrecept1
684,885,206 *46B759C6FF527600D4E7C0DC086337BA8C221CBB unrecommendeda8
684,885,207 *46B920DF1CA48F3D7ED7F808C1D139340835CA4D unredeemablies2
684,885,208 *46BABC7799484B95B5098ADC8373BD57F5A249C5 unreellstes3
684,885,209 *46BB22506BB3E165C26E5A25AB39A4EE517215CE Unregurg1
684,885,210 *46BBC5C910F715EF3DA370037A119C129FF5A9CC unreign0
684,885,211 *46B5330295AA0CAA23EF1BE856CBC3D553DE5DC9 unreinsed
684,885,212 *46B2190D048783FDC732432226D1FD9262504004 unrelievablen
684,885,213 *46BA6147E5EB484ACC76661A6616EE1D978E14B8 UNREMUNER47ED
684,885,214 *46B98D1F8861DCDB37D5766614ABCCACC67F8213 unrenownedness3
684,885,215 *46B783ABE82A2A73D3A1DB0DE99DF9059CBC03B1 Unrepiningly6
684,885,216 *46B27F033991765EFD553ECF40DDD585147C84A6 unrepul5a8le
684,885,217 *46B8AA50212EABD280A80F587C1A46544C143396 unresistablies7
684,885,218 *46BE774EB1EB6D68A3F034505629762B9400D7CF UNRESISTANCE7
684,885,219 *46B76342BD022E7BD56D4F6EEC17D74B77CFAC9C unretreated7
684,885,220 *46B34A359705AAFFB542EC4C7FB72BB0A43F0311 unrevelationizeses8
684,885,221 *46B0DBEB14456C07DEA6D1E8A77ACD078DA832A8 [email protected]
684,885,222 *46BDE5D4C70C166FC51456AD2EDFA749F8A145F7 unrevested7
684,885,223 *46BF03134A1E2493CC231D99D139632ECE82F7CF Unrhythmical?
684,885,224 *46B799618CE61B9259FACDE6F30DAB6D130E1DC6 Unright3ousn3ss
684,885,225 *46BE9EC30A999C55CDB3D2FCB956FB4E3B9B8C25 unritterliches5
684,885,226 *46BF9D78124B1F58170E9585995BE0B4CD5C5CCD UNROBUSTNESS6
684,885,227 *46B9ECB744CB503C8FCDD22F8B793CC428B59018 unroots4
684,885,228 *46BF3C75426C72C385E1A37CFC646830C3D9FA42 Unroteds4
684,885,229 *46B4CC87A2EA64CE28E8C07F04B1B8C0BD45B8F5 unruefullies8
684,885,230 *46BB43D24FCEE10219B77690F73FE97EB77BF988 unruhigeren4
684,885,231 *46B48AB4A1F1E45BDD0D74FFBFBE1EA877ECDE2B UNRUMINATINGS
684,885,232 *46BD70CBD017CB386D4666AA01FF031FF93BFD00 Unrutit7
684,885,233 *46B49257277D2C8459037351C5D90D19198BE9E8 Uns334b13
684,885,234 *46B3DAC23F77CD2177A299FD419FB32980FAF95B unsadnessn5
684,885,235 *46BB6416DACC8132CF05E22877DDF5CC8DBB41A8 unsagbarening
684,885,236 *46B15059CB8C67F446022FC43106138A37CC58B9 unsaglichster8
684,885,237 *46B2F22165758C6EAF4D5F35CA031DEA768EFB1F Unsame.
684,885,238 *46BBC2FD44D8AFCA6468DA2B7C1711E8A1538C6E unsapients1
684,885,239 *46BD086354502F7C7208F6B46C0D5131AF36462F UNSARDONIC.
684,885,240 *46BEE4D50B1E6EB1D07457094752185AAC32A613 UNSAT!A8L3
684,885,241 *46B93300B71B34A3315ABA8B310F5ACF73F4C80F UNSATISFYING!
684,885,242 *46BFE88C7FA6AF636AC28521BCE1BE01B1C9EC5E Unsavory?
684,885,243 *46B809A165F67FF9B37C07CFE23A129BD7B161B7 Unsavoured4
684,885,244 *46BB01542732E418E39D60FFD7A3BF6256198E44 unsc4l4ble
684,885,245 *46B538119B6A3735D666DE9A39138335E225501B unschaplied
684,885,246 *46B828AAD07F249353B319357946810DC0E3B2D9 unscheming2
684,885,247 *46BC369FF24D89B19510C944659B4113E1F51665 unsc-press-release-sc
684,885,248 *46B69F775C147D2FEEF1E80498B6EC7B3EC285FD unscripturally5
684,885,249 *46BED1026CD3C065B6FE0D53FBA32596C8DADA81 Unscrup13
684,885,250 *46B317A82F2C0CE97723B3739A3B11657016F182 UNSCRUPULOUSNESSESES
684,885,251 *46B3D9407B965076A230C6CF2F15532F36C6F936 Unscutcheoned2
684,885,252 *46BD4CED116CDBB16FC4FEEE311C901AF6205E10 Unse1fnes
684,885,253 *46BF51DC21A08CC237D5FD20EF23B1A51D7F6900 UNSEAL!N9
684,885,254 *46B9A0220630F131D7D124A2CCAD9BD6352771C5 unsecretariala6
684,885,255 *46BCFE95BE6128172191260299D03985A91048A3 (un)seencircle
684,885,256 *46B527B7E5F3ED49AC81E34C730669A1921704B2 UnseenEnemy1912
684,885,257 *46BB12D6E907AC8C34978B4A632A9EBA731BFBA4 unseenrain:parti:theprophet'squatrains
684,885,258 *46B43055749578F44F748CCAA695F0906C1D1955 unselektiert
684,885,259 *46BF3C8A6A9AEDCA6C3787996B72546A98C2A61D unsenmon
684,885,260 *46BFA838A25F79FFD927FFFFF4CC2B8A3D1CC9EC Unsensitise7
684,885,261 *46B2AEB58325AEB50A1D2DD5D4602BBAE86CA5E8 unsensories9
684,885,262 *46BD536E129E9438E578F5D4E657896080286AD8 Unsensualised8
684,885,263 *46B1717C63A9A0155DC419FB8527F4AA64FD817C unsensuo4
684,885,264 *46BAE3FB55DC5D16AF83C548F962DF20FD1E1ECA Unseriou9
684,885,265 *46BCAA405D330D0D12939337966B649D66CB0512 unshapeablea4
684,885,266 *46B2881E78734C78303553BCF842CF3A1879AD1C unshapesBSW
684,885,267 *46B033CCA6DDB97066C32D2543C72C4111B8FAF0 Unshatterable
684,885,268 *46B4E706C8F3F08AA4EC9E9B1FE29C8F8C21F32B Unshawled
684,885,269 *46BB279DBF4F3192B1034EAA9748AA46B56E1FCC Unshieldable?
684,885,270 *46B14060FF930092CD0BE34F579C00E588C09309 unshoehornbsws
684,885,271 *46B512A129C1038A734B0A858F972D9FAA83AE63 [email protected]
684,885,272 *46B1B00A15808F7FD63FAE102DBDC705DE9B9CE2 unsichers8
684,885,273 *46B3CD23EF132B197E5434EA67D11D49E5732123 unsilenceable6
684,885,274 *46B640F54EBE60468873A9F9323B268F11A1AF8B unsinfulnessn6
684,885,275 *46BCA4CB688501BC8F92407AF2C49547890AFC19 UnsionnsLA
684,885,276 *46BE8C18E19481B61171CF15F9307680F067B44A unslingings8
684,885,277 *46B8D0EC7CF79A8F5F93DA84DB468374E9C2E034 UNSLURRED0
684,885,278 *46B2397E6E0079BC136427CEDD308A49FB118496 UNSNUFFED!
684,885,279 *46B0540949277BE86D7C0F3015F2A4A786101791 Unso1ar
684,885,280 *46BD91990F206818E6A2A941E61A623DDC4DB5D0 UNSOAPED2
684,885,281 *46B537ACECDFADA6F8FAAE0B9B93816E6062BE65 Unsoftening0
684,885,282 *46B0E506AF1CD3218823A70DF2ECFA7FA7DB06FA unsoilliosnu2
684,885,283 *46BC7182F470DB572527544DF5307008BB9EB68F Un soir chez Mano
684,885,284 *46BDF0F93CDABA54A226B54448714FF705ECE60A Unsoldierliking
684,885,285 *46BE2A446A8AF303EC56C34BD244B48E7457B0C2 Unso!led
684,885,286 *46BC11E3AB33B596E6D856425B9BF3B58B7340D6 unsolicitousl5
684,885,287 *46B521AAEF011814F57464DB2236D1AC501E8F64 UnsolvedMysteriesofPopCulture
684,885,288 *46B5702BD2334E088C992DAE9E7D9AB8B5A2DDEE UNSOPHIS+IC4+3DLY
684,885,289 *46BDD08DFB7070EBB8C01E356E000E34EE5C6CE5 unsoppertedbsw0
684,885,290 *46BF29835B81DBE44D97E8A7C6D307676C93231D unsoulfullies
684,885,291 *46BA9CD05CA227BEF0C95180C7F793EE8F32811C UNSPATIALA
684,885,292 *46B6D5762CF6E06F15E5DA8E1F26FCCA45C20750 Unsphering.
684,885,293 *46B101259C9925A844AE03BD1A02E7784658FA54 unsprayable9
684,885,294 *46B0FF3E19C4C7D11F9FA7CBD9641B9459468FF9 [email protected]
684,885,295 *46B06A1E174C4FC85A196AF16CA26DD3EF1BB44C unsqueamishning
684,885,296 *46B219B83EB64F1C17C75A5794133A7CA46B586B Unsrigems
684,885,297 *46B7C3CA89CC0E169F00AC4E06692E0B7A9EFCE9 unstab13n
684,885,298 *46B08DED495D9F6FBB8E306FCF304BBF83256BE4 unstately!
684,885,299 *46B2640C4DBEB57D6A120F5978617BE655B5DB60 unstee1ng
684,885,300 *46BEB134D449EA21E7B258C20594F7595F3F011F unsteps2
684,885,301 *46BD796229BA923FD07BD29FCC600F9CA3EDDEF5 UNSTIRRABLE6
684,885,302 *46B03FEF4D44D5A6A5E22C45E6DFC7B8E3D2C53B UNSTOICIZE?
684,885,303 *46B056117AE1F43631336FFFA2B90ED1F37F8F47 unstormya7
684,885,304 *46B148197A29223F064238BD038838E851769E02 unstreakeda6
684,885,305 *46B8A3584396C0E4C3A205F67A108678D8B36337 Unstrivi6
684,885,306 *46B30C0C3381A16ED868A02E3D52932D1A12649E UNSUBDIVIDED6
684,885,307 *46B944AF1970C859BA48E464D06B1592AB912FFB Unsuburban6
684,885,308 *46B8A1825D8CF674E173D82C947BCD6224CB76F1 Unsubventionizeds
684,885,309 *46B79A1E410C4AF568915F0CACD8146934208D0E unsuccessfullyah2nsah0kseh1sfah0liy0
684,885,310 *46B909FE0BFE590FF48DE6B67DA37A85F89B8D8E Unsuccumbing4
684,885,311 *46B6070AFD598FB763CC82D5206FE6D27490C531 UNSUNDER
684,885,312 *46B43C91159049DB6B8096A6E70F8EF8636F3856 Unsunder7
684,885,313 *46BA5C0CA1468CCEF061BB13B18498B5676EAFF6 [email protected]
684,885,314 *46B373698FF9B240999EF85CABAAD370DDED6E85 unsurmountable5
684,885,315 *46B3BB10A16277CA78364C41AF2293C3A630B83C UNSURPRISING3
684,885,316 *46B7451C22F3B9CD32E0D44A1F3417EA41DDDA9D unswatheted
684,885,317 *46B821AC165AD0F4E6C3B35D7F7B2B5C0AC195E5 Unsweared
684,885,318 *46B4CBCF7A1410F4FACBEC509AAF8FCBEC6D1D02 unswiss9
684,885,319 *46B2DA7FAB1803443B2775D1162C9112D790AE09 Unsyll4bi
684,885,320 *46B0EEF358B3A5AF6043219606A0A739E8D64779 unsym8ol1calness
684,885,321 *46B12A77CEB1E8E9BD554BDA9F73F260877236A2 unsympathizability2
684,885,322 *46BDED1D9A8C556E786D1286A910AE6971579784 unsyntactically4
684,885,323 *46B03EBBE59E5C10A073B4DB3ED77A732B487464 UNT3NA813
684,885,324 *46BEC95DED62ACCBBAB5BEA9D589C3C526467E47 un$t4cker
684,885,325 *46BE93B049C65B115F61DEFDCDF12AE887692008 untabernacleD
684,885,326 *46B06ECF50DFA48956A28E6CBCDDD642D32D1FF8 untamables4
684,885,327 *46B5DE038D27C888A5DDBE4BC1D177E4155D26C6 untastable8
684,885,328 *46B5DDA9D951F4ED7A6F6DDCCEBA12453AFCAB7B untasteablea9
684,885,329 *46B7CF5C7B74881B38C0E030021D6649338E4022 untauglicher1
684,885,330 *46B4EA173A13CEAEE100533748D704EBD3E4365C untaxingeasted
684,885,331 *46B54A40A240187857EB6C57EF48D4F736A1836C UNTBat
684,885,332 *46B3EF9EF0AEC3F90C21E9CDD93992BB8B6F8F77 untenaciousnesses9
684,885,333 *46B561B7AA1C6D6ACE5C4E8D9E07B6E1D8E78F0B Unterachrat
684,885,334 *46B994906FDC65AC269372030EBC9FA1D10A2F64 Unterbliebst
684,885,335 *46BF309EB2BB5136B68FA1C0DCAE485B956D53FC Unterbrechergehäuse
684,885,336 *46B0C808BE8D2B0D48FC59AD107195E6233ACA78 unterbringungformen
684,885,337 *46B9B6C670517546740FEEB8621A8FE2EC8AA049 unterbruch“
684,885,338 *46BA72D4BD9F042DF760306A9836F9127C562AEA Unterecks
684,885,339 *46B3506D106D0D24A1049E403617ED3D6B8BE9F3 unterfordern9
684,885,340 *46BCCF6AEE619F9D100F5BD81C10F8F01632C92F untergehst9
684,885,341 *46BD75D576B3455C2B7AEF7C13E8EAC3A7894E7F untergeisgittersdorf
684,885,342 *46B37FAE0A48A385D9969841665FA44F8DAD6723 Unterhoe5
684,885,343 *46BFFD8A0FE23CC991F7660EFB2B394CFBCC5351 „unterkiefer“
684,885,344 *46B617987A31C72B64CEEE5D5ECB96F85D04945F Unterkoefler
684,885,345 *46B99568AA6610075D805193C7C12CEA8EE2B0EB unterkörperschutz
684,885,346 *46B2A081A43998EBC1F393845300D1204E0759A5 unterkriegens8
684,885,347 *46BA2E0DCECDEC7EF9D608C9BBD1F5857BF5686C unterlagst7
684,885,348 *46BBEC668F23FE3DFFCB3146FE0E7C93FDB527A3 Unternehmensbaratung
684,885,349 *46BF31BF3A6014D77E41805E3ECE4DEB8D191632 Unternehmensnetzwerken
684,885,350 *46B449BC66EAB5D68CBCBA40A6D2435E705DF2C8 unternehmenssicherheit
684,885,351 *46B94614D4AE76F647E9A1425C71715A3C18845D unternehmungsberatering
684,885,352 *46B3C156D1AF6452637385EA7C1246C67912CD37 Unternehmungsmeldungen
684,885,353 *46BD195FC1229BDB93C8C45F1EBE4877705A8162 unternschreezer
684,885,354 *46B1EE9130D2950DAC6333CC106EA8BC7A73EAF8 Unterrichtsgänge
684,885,355 *46BB092E219C2D1341667619589C0328EAA82FA2 unterrichtskosten
684,885,356 *46B5B4F08C13601F7A0AE93F40156F1BE8F3EDBA untersagtbsw2
684,885,357 *46BA414C636F6C4F8253E8EA73F95BA028674E4B Unterscgrift
684,885,358 *46BB586CC5D71869880A9EE248B3C49E8E78B7C2 unterschaetztbsw2
684,885,359 *46B7EA70EED8EC58B6906F13DB815E588AAB996D unterschiedlichembsw0
684,885,360 *46B5AF1C8ADC88BFF57653CF2482FFD760779ACF unterschieidbares
684,885,361 *46B562E172813A8EC6B9201A5D03F992B5C370BB unterschriftenb
684,885,362 *46B433E20B6881053ED6B6B5645D8145D1D5375C UNTERSTEUERN
684,885,363 *46BD3CBEE7EEBD23C1B3685DD6E46D039E36CC47 untersttzern
684,885,364 *46BF1B8D1CAE3AEC6F902B3E087217F6D9083408 unterstuetzen8
684,885,365 *46B18548748544C98652698533038AEF8A22E50E Unterstützungserklärungen
684,885,366 *46B4B26E0F861B526A3A592387B85D2EB9F181C4 unterstützungsmagie
684,885,367 *46B93A3F6F0C705659117EF154DF4A4890832F62 Untertanenherrschaft
684,885,368 *46BED971E28C67394552AE0E75FD89F46E5CCD86 Untertiefental
684,885,369 *46B948565A53600A124E6371D242BE6D32B71706 UN-THATCHERITE
684,885,370 *46B15DDBF9E2F113BE710769C9C53CC93DF2B094 unthei5tic
684,885,371 *46B43FE6C580724B6D70555DF2CD117F5D2D0F1A [email protected]
684,885,372 *46B70D598A7184373A1A243E2FD5D2C16553B8D6 unthinkingness /@/n'/T//I//N/k/I//N/n/E/s
684,885,373 *46BCEAD9BB950724E381B08DB262B9AE955AC359 Unthistl3
684,885,374 *46BC883BB27E51AF74D83D4C792F5C28BB7FAA6C unthorou3
684,885,375 *46B4C8D3DF384C876A794F940EAB9386281E9DD4 Unthumbed5
684,885,376 *46B9A662A4A3829EDCBBC8769A5AB404BB0AA6B5 Unthunde6
684,885,377 *46B9C576CC195B6A57F183FB53DFC70BB3AA54F1 [email protected]
684,885,378 *46B2F79751F693DB80CB45382DD1B3F312C7652A until-recent
684,885,379 *46BC08E87312EBBE0B3415D3BB6801A757FF7106 untoggled6
684,885,380 *46BC66DFC254ABC18033107D84FAFCD3772578E0 Untolerative8
684,885,381 *46BEB141FDC8D129AECC11FF2968B201C0D6D4D0 untortuousness?
684,885,382 *46B257425C04CE0D6A2ADD559E7429FF5A0832FB untracable2
684,885,383 *46B9DAA5D600EA5FEA5DDE4026060A07D86BD3F9 Untrailed1
684,885,384 *46B92D55C5C31961E2A8A540F62DD464870E8860 UNTRANQUILIZEDS!
684,885,385 *46B8D2D5EBCF7A6128424E299FA05DE5C8972E06 [email protected]@b1e
684,885,386 *46B3EF08882FA89F3144FE63EF910B66F4E70A86 UNTRIGGERED2
684,885,387 *46B4FB1924E84EF2F3A47DA64DAEB91D8DFA1C37 untripes0
684,885,388 *46BF4754C381561D109A2A9C7DD68A3B877E2AD9 [email protected]
684,885,389 *46B5FA1C9462249F59EB503946D9F3D8431DEAF0 untrustedbr0
684,885,390 *46BA786F7BC8938882472B9F9D6AEAA704186745 untrustinesses
684,885,391 *46B8E38F4371FD30FC29B095CC621A0B280CBB57 UNTURGIDLY8
684,885,392 *46BF4A290D40D2602F1CE97D44B5618EF78939E5 untuvata6
684,885,393 *46B817D9C503D3FE7EE5E3150BFB38BE5B17DBCE Un$u174bly
684,885,394 *46B21F97CD4B28C05FBE2877A132E8CFFD27D900 unuala
684,885,395 *46B3A6D47949E753B8DDEE8CB3D9FD31F0D2E762 unukkien7
684,885,396 *46B2A92D23AB2453C25B26BAC52A5A9F228B4A44 Unumstrittenes7
684,885,397 *46B7E2C47723265FC0DCA61E6664EDB15CA024B2 [email protected]
684,885,398 *46B8F5CAEBBD31128BCC669ED03865F618494BA4 un-$unday
684,885,399 *46B4CD404F2738E4730407714BD6D548375F8802 unupset!
684,885,400 *46BA388C17549337A2FED0E8158A206BCD1BF8CC Unuseda2
684,885,401 *46B6CEC79C1A22C227460FB780F91B415C40C11C unusedc.palpk.k12.nj
684,885,402 *46BD0A9CFF7A7809EA11A2A822771E5868A0ED22 unutamam asla seni
684,885,403 *46B0C86F34427AD08D8CF11BAF9713B7DD56AD26 UNV1S1+ED
684,885,404 *46B14BFE72DA618E71D05D9F9351B6C68A7C08EF Unv4nqu!5hed
684,885,405 *46BDD6DF1BCA7EC206E2BFC114D1B125FC9CC01E unvailed3
684,885,406 *46B10CD3058FCA4CD0619EA27F053802543D208B unvanquished123
684,885,407 *46B600843372512A8A674CA215F29A86B23AD2AC Unveil 2
684,885,408 *46BCE55C986CEE2F33FA86CAC19C6744E72689F1 unvelvets
684,885,409 *46B0752887726881B8308FB3827EA6ECB1DBA96A unvenomousnes
684,885,410 *46B837D7A61EB12D41FEA675A80473591ECE9DD8 un
684,885,411 *46BC851BC022B145BEFA03708DE7480DADA7C7E4 Unverdurousness0
684,885,412 *46B50A96D6F3CD85BE1492216E54474D3022FAA0 UNVERGE
684,885,413 *46BAE3953BE44241B10E2EF096731E131E3D4371 unverklemmt
684,885,414 *46BA84274EC9E2C8CD22EDE0F5748EA23CB64E49 unverletzlicheming
684,885,415 *46B65CEB0026567AA84350B4ED14F845EDD0A539 „unvermeidliche
684,885,416 *46BC6E13F5CE6E86166F493EF11819B6D650F0C3 unvermögendes
684,885,417 *46BD4E3E41224C2FA8ECB797F34AA50119B1111A UNVERSIFIED7
684,885,418 *46B756F50256DAFCE3768DE01D9F9FE9534A467F unverwundet5
684,885,419 *46B6E4220318079811389DADB8DE2ECAE96C61D9 unvorsichtiga
684,885,420 *46BC38E95ADD5718BFA5345CCAB28EAA42336118 Unvoting9
684,885,421 *46B3C9754D4A0B2F30127F4550E9107AA75B44E7 [email protected]
684,885,422 *46B2FB5846F4F88232D1FE179D38E7D675288332 unw4nton
684,885,423 *46B5EA5BB8708D314137DB6EDF54ADCFE2A5168E Unwanted Erection (In Starbroeck mix)
684,885,424 *46B20C68FD6BA08D3725B2D508987F3E1E93DF3E UNWARRANNESS6
684,885,425 *46B77A4072847CD0B5A6DF9FFEE31EEBEF38976C unwarrantablenesse6
684,885,426 *46BED39098F42AE53F357E2FD271161B3ECF7392 unwaterieses
684,885,427 *46BDD1036CC1C74A57032216B983A6A9EEB48F57 Unwaxing9
684,885,428 *46B67C7AA1A45832A89F971FEFFA11736D925794 Unwaywaring
684,885,429 *46B90897800FE95C7B24392610FAAAB3FAB145CB unweal9
684,885,430 *46B419A6F6F299B287E3818DF5729A825CCC364E unwealsomeness1234
684,885,431 *46B34E07661FD04F220D8CAB87393541DB749737 Unweaponeding
684,885,432 *46B3DEBBA7FA2DE6547327EA4AFC99BE4A1DE331 UNWHOLESOMENESS7
684,885,433 *46B5FB8BAAF48F70E9C8623F3B5593926E5F1716 unwirtlicherer3
684,885,434 *46B500F6AF4F80D994902EC1C8D89C51DBD9BFAE unwitcheds7
684,885,435 *46B463CF7E8C5C52EB5CE763B37D4830D61FC161 unwittand4
684,885,436 *46B126FCDEE850DD45BEC9204EB86F02F5269675 unwiveds4
684,885,437 *46B9032BDE89E2A98882D7710944A30B8CE9445E UNWONDERFULA
684,885,438 *46BFBE53C4E79B39693122034AAAFD92C1D41EAF unwonteds
684,885,439 *46B75FB9485A30FC804D2825346420E4495BD584 Unworkmanlike9
684,885,440 *46BAED48EC92D2C6EDBEE259B4AB07FA8405ACB2 unworship?
684,885,441 *46BAC850822F990DB59013F5183B1C5301D1B8C1 Unwuchtschwingungen
684,885,442 *46B66772776A7F7A5E298422FE00AFE4872BFC9C unwynnely2
684,885,443 *46B460EECCF9FD2A7784D9135C6B3DDF176ADC9A [email protected]
684,885,444 *46B41BC69A7B6C2EE9E16CB985F8FDE9B2942A67 unyokeunthinkable9
684,885,445 *46BADFC81DEC9D9AEEACF21527A2AB2289D3A5AE Unyoujou2
684,885,446 *46BE88B54A917067A3236DD2397A0446E6FE4F15 unyouthf9
684,885,447 *46B430F86BAA1F8706BDA0B378AE447355794022 Unyquist
684,885,448 *46B24DBD5B0A0B242C130B72A42268F3D1D0545E [email protected]
684,885,449 *46B5D1A198ABDF10A7576825AB734709B3409FD9 „unzeitgemäße“
684,885,450 *46BEE164106264EB4645BAE6694A51A389364167 unzeitlichkeit
684,885,451 *46BB1CDE5B811D774BD288AF7E0BD0F7C994E9F4 uO+|
684,885,452 *46BF9F27691C42F9DA6E8010DA113B3A68B9A41B u#!o
684,885,453 *46BD420CD38699B74C7724125DEA4BCA20BFDF03 UO307
684,885,454 *46B7B3EEDB59B7208AC7BCD52DBF428ADE8CC4F4 uobiavaj
684,885,455 *46B0D8B534A4FE9F2A6B46D0C38633C1D3D851EF Uobscarlté
684,885,456 *46B88D1DA3A52D6BFF635861C4CB6E628409B9FF uocabunturque4
684,885,457 *46B60FEF19F6C2CADC59D82CFFE0463DF334BA2C uocatique4
684,885,458 *46BD4581065CC479B040BB12DB5533CDA75F0F9B uocedinnts1
684,885,459 *46B57EADAA43187ADA8ED630A494C58E76EC0CE8 uocetevi0
684,885,460 *46B0048539FFDE77EA8AD4CF4DD2A73F036D14B5 [email protected]
684,885,461 *46BA821DA3A0FEC47112D1F5B9ECF97F56AD77A2 uodukaym7
684,885,462 *46BA5C0ACD880BAC706389E96EE6086924BA0850 uoduomered
684,885,463 *46B3A145A3A9843B52319F8A89BA62906254132A uoerialg5
684,885,464 *46B4CE4EDBE104F00785CC0F9789F86C7FC8D520 uoetruocing
684,885,465 *46B0DDA1D8892BEBB5D94AA980070FA3C933CB48 uogcbb
684,885,466 *46B82B81FB2F294C10F79AEDD0A88681D74BEFF0 Uohcuhs8
684,885,467 *46B14FCD195FD93EF2C22FEB9D067BF93B332907 uohproma123
684,885,468 *46BC7CDD5050B65147F2DB244ECDBA52B4AD6D77 Uohssub8
684,885,469 *46B7BD491492811C69EE1C068A127D66219B4AED Uohsuhc8
684,885,470 *46B0C17623D0ECD9C7C017A3D67747EBDFE576BF Uohxjyn3
684,885,471 *46BB7FE6B41178813DE5864B08EB621F11D36184 uoicilams
684,885,472 *46BC0798A97FAB7725BCFE5C8C5D357EC03A4C90 UOI
684,885,473 *46B871DA2436B6F4D65FEF05466080734349D647 uoirateses
684,885,474 *46B7E3B4419B50BC36A1D5A7E87135AD04FF82C0 uojaipr1
684,885,475 *46B1776B18CDA2317E593C75DCEB3550835E47AB uojellut0
684,885,476 *46B157547CDB3014685616A0469FE67E710D136E uojovsor9
684,885,477 *46B4F2734D8C0D8EA542CA66F25DD5142774010E uoknrhcs
684,885,478 *46B566964CC85BDD66F22845F4251208C5D265E2 uokuvaan1
684,885,479 *46BC691BF8DBDEBA17D08AD11342585DAA332E01 uokvirenu3
684,885,480 *46BC4CD992D22C189128CCC3CD6E4820D712CCE1 uolente1
684,885,481 *46B49DA6BA1C68DC1428F735F26DBDDCDE1F2F37 uolitantes9
684,885,482 *46B24F9A2C0BB91B0F74996ED1FAEF7837DBEB29 uoloms
684,885,483 *46B07DF578C9F0F55F0B0BEF04632FE06B6F5079 Uolx
684,885,484 *46BEFC19534711A2FA832BE139AB98D97D7BC382 uomiagih6
684,885,485 *46B21E1C5D4B9DFE409B86FB643C6DAD86347271 uon)
684,885,486 *46B2FA3949FD3345547ED7C063DDC4398B59D313 Uonitulgging
684,885,487 *46BBB2025F7C6DD9FDD397421E6EC6F58AAF17ED [email protected]
684,885,488 *46B0AE34BEE97718297714B7355C685F59B0C46F uonmgnaiamm
684,885,489 *46B64C3E565E55BE7D634FAE8E70086FC93FF5BA uonxpkpdqaogi9
684,885,490 *46B9F64E55ADA50B57601CC77C9C649ED51CA000 uoppfordret6
684,885,491 *46BD0E665800B546AB50AB478E1C5D4018BEF84A uopsenoning
684,885,492 *46B8AF79B318F739E2A1BD2A3FB6364D7E9C6214 uopzaa
684,885,493 *46BA0CC7B65F580F85BB4A8D060D0DDB9BC35195 u\or
684,885,494 *46B941FDDA9DF0E6BADFC310EF484CF631B963BC uorastaas
684,885,495 *46BC9FDD7D1201D3A050B8B40653AF116ECE69BF uorinate4
684,885,496 *46BC8289B69D5E41785351376E0709219181016A Uorytqe6
684,885,497 *46BD50BC788FA7C320C8BE931C82BBFB74ED9201 uorzuc
684,885,498 *46BE9E5E25A2163402440D307EF76165186B7BC9 uosių
684,885,499 *46BE2A8C49E2946AB5433F806C31A231B9F93F9F uostuising
684,885,500 *46BCB071A2B36BD15164D146ACA33208F195015A uosukoycs
684,885,501 *46B36A08E1AE9A102DD74398810117DBEB5C3E61 Uotakans
684,885,502 *46BC57B2AA645F111C9E5A596C4C098D4CB2D89C uotlehcs
684,885,503 *46B324BE570D86E908C921A8C2BA4E99E06DCB9C ùotrs
684,885,504 *46B997279FF7DEE9B22EA42B92A2F61F3B050E4F uotseven
684,885,505 *46B41080D22312355E6AAE7FD1338D20C9CEFC8B uotsinifroM
684,885,506 *46BCDBB3BB046CF3357877DD90EB21326F9996BE uOV\
684,885,507 *46B918672E54C7485EE99FE08E0BF94804A7DC66 uovonatsem
684,885,508 *46BF83460847C896A06FD7096874C8B678602C4E [email protected]
684,885,509 *46B2B1E24111AF43F4F0ED751BD8D005B9D22334 uoyhohses
684,885,510 *46B72E58F2B85DC6CB1534DD73CAA374D232A8FC uoyjikeg4
684,885,511 *46B29F9F099D849271EBAC29A65CB35F85690055 uoykamars
684,885,512 *46BA16091D6E8E32B5099AE4F291E86A9DC88C6D [email protected]
684,885,513 *46B4BD6CD2C2AC712D59D953813616EFB257BE4E uoypned4
684,885,514 *46BF0FFE3199B564E4EFD8B98D1ED765875C97C4 uoyznuf7
684,885,515 *46B298E83CDFB3EFAC4276571D99B7E1266B939A uozq123
684,885,516 *46B22C6DA233421CD47AD275C834989E66279C10 uozukat8
684,885,517 *46B991A8023CFDF88CEEA18BAD5D3C6BC811FA65 u]?P
684,885,518 *46BDF94483385DBA72301C262EB97971B3641BF5 UP1IFT$
684,885,519 *46B5623FC3E3112ED241C670452B42E0CB31A786 $up3rd1v1$10n
684,885,520 *46B518E52AD73C47015786C9A19F8439D37C497C Up5h1f+ed
684,885,521 *46B099095E8968889E7B2F2B039CA3CD61F207B1 uP7Y
684,885,522 *46B2518F4E6E57BB504E825CA73E803B5CD34112 Upacharitum
684,885,523 *46B22C94D70CEDDF1E30FDB320FB0870C70BA485 upacharyaa3
684,885,524 *46BE934434B2B647312BF8DE71163EBD83AE321D upachitaam4
684,885,525 *46BFBA3DC7848895C18B0224F5BD2ED32D77B4BF upadhya5
684,885,526 *46B6EEA54F91798344ED49556AC21BAEED052396 Upahamsi
684,885,527 *46B2E6DA07C8C3208CC58672F2A0FE9638F06343 upakoida1
684,885,528 *46BF1710012B3308E161D3899074719D4A828D13 Upalindrome
684,885,529 *46B04D7CD68E12FEE0E99B1EB10FF726D89B2A99 UPAMANYUH
684,885,530 *46B367C6E862A3C5CD96D1EF03F0C4CCB994FC4C upanc45
684,885,531 *46B2198EC05846F6A4F5E29B89D56553F1890BA1 upanīta
684,885,532 *46B96396CD8F940BB418CED85AB3DE810DBE69B2 upapatih6
684,885,533 *46B15B603B7CC019A6FF6417C1B2E1ABC76B7DF5 uparavadohC
684,885,534 *46B5EB548A84EBEB52F9E817C97759E0A336B6CB UPARCH?
684,885,535 *46BC00E8A924AB92CBF54D5C160B27C013921970 uparismo6
684,885,536 *46BA7306A1D46F7A026718B73A79E192628D9EE9 upasevinaam6
684,885,537 *46BA68B75876D070727F135E73465F1F0DA9AD2B upatseven
684,885,538 *46B59B30F87B185170ADC905F126C9AA456E9183 upbeginblow8
684,885,539 *46B81A69CC19E37797EB53006CC8070489AD3E50 Upbra!d!n9
684,885,540 *46BF60587686C54C433483FA7012869FBA827B3F Upbringi9
684,885,541 *46BA84D53F2D6C8D5154A017054B5F043F7C4621 upbusinesses
684,885,542 *46BFBE3DDD8DBDCE6176047AE57270040EA09EB0 upbuttonholecajolecarp7
684,885,543 *46B2FF43F6483B53BD7D2DACE598A44BB53CF94B upcc1
684,885,544 *46B31678414B7E0F5ED6630A472EE8A1EE60B586 upcoilings5
684,885,545 *46B114F5B1B46D9D6B4A06C2F8E5911052C5F7CD UPCOMPSOC
684,885,546 *46B78B62701EBE1182F10E1D38867E251C7021E1 upcorralcount5
684,885,547 *46B70D87F65272019ADE3E2A69403C085EBF88CA upcreepses
684,885,548 *46BFDCA5BA45E47CB68862A19935CED6F2523830 updatedbY
684,885,549 *46B89909E187652BDE9365049BA75526DE54D433 uPdmSlw47
684,885,550 *46B0EF1609B3E746252D55F345AE18A8C82167CF Updrives
684,885,551 *46B6E20D41E32101086E35B654777EAEC925852A upeL
684,885,552 *46B045E3D83FD15619EFBFCADD8A992D7A94BC80 $uperaddi+ional
684,885,553 *46BF68F885BFC0035E0A8014E590DF4653BB2C14 $uperc0nfu$i0n
684,885,554 *46BE5FFA02537023B6C20121DA98739619382400 uperfans1234
684,885,555 *46BDD9CAF352A9BB5EE968D25B39EF7891935DFB upermies2
684,885,556 *46B300CE58A51E630AA25FB509BDA0B075D7632F $uperquadrupetal
684,885,557 *46B337265788E0281889D2873411C3C5C72A5630 $uperw0r1
684,885,558 *46BF8A18F5FF1F40D599FD0487D4E89BE104C2E1 upflaeu
684,885,559 *46BB1D1FC380905356824882144C1B25194CC941 uPfQ
684,885,560 *46B82FC9ECD0E6191D91E23F126F5BF8B692D2FD UPFUL
684,885,561 *46BB030584333D86DDA18ECFC110FE43EFD4A78A [email protected]
684,885,562 *46BA16BC926C480806600260349890417AF3E845 upgasolineget7
684,885,563 *46B4A01556C463DD7219C6DF552F8BBF9DE0B326 Upgatherings
684,885,564 *46B4B6FD2A7F370C5101F260E1FE2442F724A0CE upgȇƀ
684,885,565 *46B455263FA0331931A017E96FAB9BBD5C8FE533 upgetiged2
684,885,566 *46BB78657919F62D31B7521FABAFEF36954B1121 upgrade).
684,885,567 *46BB7BADD76EE98E8002AC8B9874C811AB505151 upgritgulfgulletgumptionguted
684,885,568 *46B6D7AA3F513B5DED1518FB6D66BE8AC53BA8E1 upgroupgrowgrubgrub7
684,885,569 *46B94C7DD29DC57E60D6DA61A5109013D8E55F76 UPGUSH4
684,885,570 *46BE45F4DDAFD71DE8E2A8EF5080436FA311A73D Upheven1
684,885,571 *46BC512B3161B4D7D11E949E7F8308623666E571 uphhoves9
684,885,572 *46B39FA810E3FD71D84082C7A216ABA4A3755DA3 uphierarchyhikehike1
684,885,573 *46B22E8597137810FC1A3FD39EF31D5FA34A7788 UPHOSTER2
684,885,574 *46BDB2DA406B8A805530B4CD062E9B1896C9BBB1 uphungupill6
684,885,575 *46BEDA371E03CC441BA4751C6A8C4ECF6CC8F817 UPIA-FOLWARK
684,885,576 *46B264E5CEFF2718333365914B1391D3D7124447 upiekszac5
684,885,577 *46BF14A6331AFA850BFF549F6E7DD2792F9B5CF4 upierdliwości
684,885,578 *46B998962A66F1715E2245D0FE30F5A7C71BB59D upisovali7
684,885,579 *46B886A901CA81FB9887F7D162C6353A526F73B0 upkar parashar
684,885,580 *46B3FBE432E721099839FE2415CA451DCBE2D2BE [email protected]
684,885,581 *46BF46B9BAA2445DFA225F5387423AD31F316201 uplambastelarruplaying
684,885,582 *46B9C8E4B1955D8F3A799BBCD9E1CFDAAD31E5CD Uplatim1
684,885,583 *46B1EBCDD0604FF9F87EF1793C87997DFC556BD5 upleafstalklegitlegitimate1
684,885,584 *46B4CF3254E79AD1BD93BECA5CD3E533E52A1CB1 Upleap9
684,885,585 *46BBB528ACCC91A2DFCBB87B777C183509DB4610 uplineslininglistlithographloadlocal5
684,885,586 *46BF509C4B1420A09B89297E8B68142445E640AE upljesniviti1
684,885,587 *46B82D157288128A128057B705DC670EA85BC87B uplnejsich8
684,885,588 *46B26D19A3EDE0A214805F0E357E39D03E29679C upload666
684,885,589 *46B4B79AF4CD0BC2E323DE90D54B122A5732465B upload..it
684,885,590 *46B3A046CF1447C07430815FF6B5138A831C8D4B upluremomentmomentummotivationmotive3
684,885,591 *46BDFCCF2C38CF2365B696CF3F3793BD5A6659F6 uplynou6
684,885,592 *46B4685883C89FD5945B8CF906EF0B59B425A1BD upnarrow3
684,885,593 *46BB7D7357AD4B7BF17B2CCED7438F279675BEBC uPo0oB19gDUC
684,885,594 *46BB4D41D59A29C2C8BBBC40D035A6025C279671 Upokorih3
684,885,595 *46BE0DE1641C6B00612FA713380198603DF665F2 uponcarecaressingcargocase0
684,885,596 *46B12D1A0A72C33CD153FA9E9E49E9BC8DC695BA uponcastigatecensurecentcomplain6
684,885,597 *46BD16750DDF17204C9257B3750B7C98220659E5 uponshockshockersneak1
684,885,598 *46B3705C26298C32929E18F556829B0421726754 uponstickstopsubjectswoops
684,885,599 *46B352E5EFA2ECFE5B81346F0AA006392C3A4442 uponweightweight1
684,885,600 *46BCD93DDDFBD926AD42BFE3D86582B71108D1EC UPOPAEPOPS
684,885,601 *46BB8E1997EBCE76ECEB673B81E35E5B674D149C upov스러운
684,885,602 *46BA6A1C1450AE5CDB0FA81F5E7ACF68E30B7DB3 upoważnień
684,885,603 *46B1407FA66AF9D60B47D963264B1BAB8872BCBC upozornn6
684,885,604 *46B4D6DE6CFB783165E0AC296F3A26F157F00773 Uppaiat1
684,885,605 *46B7E69BDC4E115AD75494B9783D7D375EF0B4CF uppblåsa
684,885,606 *46B2EBA320C87A3AA8872AD5B15294A44C8301C2 uppentuppent4
684,885,607 *46BFD88B3C22A9AB8A499BD6BE169E3D46E8A1B9 upperburnehamed
684,885,608 *46B0DA9A70E07493A50E900C509F82CABD85D98C Upper-cruster
684,885,609 *46B521335ECA00D0D64C2FEBA853E272D0B61C74 upperdec2
684,885,610 *46B38EC255DE8539F52AD8B43F4B352CF173BA33 UPPERDEERFIELD
684,885,611 *46BCA67E24CF3376F86FCBC62DA5EF27231BEF0E uppfinningsrikes4
684,885,612 *46B118774D9885D3F622C19A2B1C40D1FC526869 uppfyllade
684,885,613 *46B74F2CD53D8FAA2452325FCB82F1EDE0254115 Uppfylld
684,885,614 *46BFBE524D193B0754B443AEB8062260922E4934 Upphafið
684,885,615 *46BAD20F03B56F67EF08300C84B70699DC69574C uppkomsten0
684,885,616 *46B65A05D266723B2EFDA80C118005635FAC1EA5 Uppleant5
684,885,617 *46B5FA031A1E729CD083E4C7161B03445579AB07 uppskjutens2
684,885,618 *46B143D939BEB585B846CBE308E311A4F408B3C0 upptagningarses
684,885,619 *46B8BE838BC99474F03EC1340CAF61F5370AD5F8 uppuffuppuff4
684,885,620 *46B1017B76A86A620D14B5E4BB8423AE8F91CCA7 UPR 2 3 4
684,885,621 *46BADE0305478EF01B17D100DAD12BA1C65B5BD6 uprabljen
684,885,622 *46BD67792922850B38610945C76B218828D0F974 uprating0
684,885,623 *46B81C6339A37DF82FEE252D71D35ACB887464DB upravemr2
684,885,624 *46B59DE665DC32CDC4BF97860220E27D43653194 uprawianej1
684,885,625 *46B91A50F997C52A09123EC4B5D4B45972B9EF72 Uprocking Beats (JS16 Sound Design)
684,885,626 *46B8D507EABFA6639D4B3309DDC3059E061A4A3D uprohibition
684,885,627 *46B5C94B57BDD06617191D596263631B08DB3047 Uprosci5
684,885,628 *46BF3DDB04F51EEB48DCADC056FF65F7ECA8C7A2 Uprtismo4
684,885,629 *46BE0640527221B9ABE8B0D20E10C01A9D808C0D [email protected]
684,885,630 *46BA0DE2A1063C56945E0304B923B0708ED1BAE1 upsablesaltationshooting4
684,885,631 *46B0AC3C3873BE3C93E7BE4DC43C54D0CF3F1C1B upscenarizescorescramblesetseted
684,885,632 *46B6CDF149533A14CD4EB0723293E52899C25328 upschoolfellowschoolmatescraped
684,885,633 *46BD466E2500AD626783988AA1FABE5C591B3B37 upscotchsecreteset6
684,885,634 *46BECD9032E42C8A0C74A4DADE36F200855E9E66 upscraping
684,885,635 *46BD8D3B9965FBCC661399AC3AA824E91598849E upseerikunnia0
684,885,636 *46B4095E4E6EDCD78A6EE778C026176AE7F01A9E upseetheselectset
684,885,637 *46B32C0203D8562F0D5A9C6984ED2A787ECF4FFA UpshawIII
684,885,638 *46BCB11D48FE1C9F1F1463EDA53121AF0D32F2B4 upshotrepercussived
684,885,639 *46B59FD7D634B3FB88B528BCCD90C1F0AC012A0E upsideowne4
684,885,640 *46B60383A5224B0BAB78D183CE6E158BBD44E4C5 upsidewardsidewards
684,885,641 *46B46C57CA9048679C09C2C5FFD693020324BB1B upspilesqueezesqueeze4
684,885,642 *46BF4D86E719BA57A79CC1848187C415D7192805 Upstandingly2
684,885,643 *46B0F7B406FDCD38E7ADD56F4BE8E6BF10C82B34 upstandingnesss9
684,885,644 *46B2031A5164E954B64AB64E9C0BE6F17810356C upstraight3
684,885,645 *46B7BE40D9EA0009FF4C61A75B44A840A9A5D2F3 upstreamtenacitythe2
684,885,646 *46B85703EDDE77F82E96142A4C5572F5DD2DC2E6 Upswaied7
684,885,647 *46B1354E68E0A359ED56D0227302CDAAE80B225F upswindletake5
684,885,648 *46B0C9836EA740BBC6F3F9F602F245ADCDB2F26D uptangletangleds
684,885,649 *46BF4E41986A46C44852B15C5A010D19104FE141 upterminaltransportedturned0
684,885,650 *46B961CC2C27B67C2A06194E93DC72DA85642B81 uptonogooded
684,885,651 *46BBD51FF35C9BCB50E78FC97F111C75B6A771C7 UPTOP14
684,885,652 *46BEEFFF63809DC193FFB25423B74B571707EBE1 uptosseds8
684,885,653 *46B8EDDE2C3B296DE7A3E329F3383A3E8FBF3D9B uptriangulatevaluatevalueweighwork4
684,885,654 *46BC71A09BDE72605723FCD0F978AFA1E5F29FF0 uptstoss3
684,885,655 *46B95555B08FFF9BE0D5711033DA4E8799702165 upullining
684,885,656 *46B41683909EBCA80D14B78B9CE4C07287094A68 upvirkeligt9
684,885,657 *46BC0A94B5C637E9503588C0342DC0A2D0D93355 upwakefulnesswakenwarmwarm6
684,885,658 *46B90202F7B537BE5438A96DEF6E52A2AE362B3A upwardlymobile8
684,885,659 *46B51EA75E4E7B64957247EEA5149CB50FF153E6 upwardmordenting
684,885,660 *46B303EFBC01B47C1C364C8C8CCF14145A5877BC Upwater9
684,885,661 *46BB1BB8B9630D007CE2062972E5AC50F50850B9 Upwents0
684,885,662 *46BEF1C94FA67379BA3C77616208A62F2F15D4A9 upwhipwhip3
684,885,663 *46BF4CEF5CE7BAA27382F7F62A3BC5B5D03EDD22 uP*x
684,885,664 *46B65959D4134521DB73CA8D345C102BA19B5000 [email protected]
684,885,665 *46B6CE1276419981818F2526217E7AAC87A0A9DC up・衣裳サポート
684,885,666 *46BA3D7F2925727FD379CBA290ECFFA0486C5B48 uQ_*
684,885,667 *46B847D4DE779DFD560886F51A2BB70D7C319AC0 [email protected]
684,885,668 *46B92994DABDA5C320A257F8955BA82F7EC4E6DE uQd(
684,885,669 *46BA4C90ABB475CCB0F703D5F8DF22A41632496C uqdK9IYME
684,885,670 *46B6054296AD320428605EA069DE0796FA1A42EB uqeeffak8
684,885,671 *46B8D8E8304FFCAE7CAE7778BD39C04A3638CB16 uqiditaves
684,885,672 *46B9BB33A6F431432F7014DCF7A2C69012F3568E uqigrene0
684,885,673 *46B28CE553036BB00784E7755CB16237AA0A278F [email protected]
684,885,674 *46BC2D2E56E1D6B521D30195E0F44E79054134DD uqkzcqtprr6
684,885,675 *46BEA25D6FC91C1D249E859B26AE1762F8EDED99 uq/l
684,885,676 *46B9510400EA0F5DAA0A8F9FECC2F49EA14414DF uqnocorp6
684,885,677 *46BC8640F17B968E44CA86C1F863ECB776BA13CB uqOG
684,885,678 *46B20AEDC550B8493EDEF962982D2517249BC0AE uqong ompong adfari
684,885,679 *46B90BD93A475AB500675BA03E67CCFBD7E4AD84 uqpoihsoda8
684,885,680 *46B4BB381CEE99DCA09D4AE52F883BAE9721AE78 uQ`r
684,885,681 *46B86EB59531CB1D7CBA8E68519A33766DFAD5C7 [email protected]
684,885,682 *46B446700B92D2A5E1D7BCDD99A0A012C382215B UQVJ0DDQ
684,885,683 *46BB710447FED0D3ED0A0EA3E6CFD1D6D161B106 uQY'
684,885,684 *46B56B9C69E6C76E7F21247B24C2E14379302369 uQz2
684,885,685 *46B193FA44235ADEF61DC759ED766175E6CA8D0E uR<?
684,885,686 *46B9A883448522E79BBFEB6554D10EEA8CE1C890 Ur0s0m4ti
684,885,687 *46B05782D547898F469CD363027EA774CA0B333B ur4mcekrrwc
684,885,688 *46BEE5A830725946AEEAB54C3D384638F41E1BB5 Ur84n!te5
684,885,689 *46BED9FEC8F7BF6F901AA2E015A411985283B4C2 Ur8aniza7i0n
684,885,690 *46B490D86C2EC1E26FF63C4EC652BE59A909FBD3 [email protected]$t
684,885,691 *46BBC259FD98BDD18C6343C4ECC424A4B681803C [email protected]
684,885,692 *46B8D168A4B4831F9962E8AF7E7D8956C5685EBE URAC
684,885,693 *46B6596BCDBD7316D68903D63E2B3CCB5B8E1B7A urahtaen4
684,885,694 *46B44E15FE6AB05D877B641E67B7EF427D768486 uralkodásvágya
684,885,695 *46BEAF077490675B0AD55122564897C017198E8F [email protected]
684,885,696 *46B9FEDA4A30CCB825B50C3740562950749F6865 uranicentricsing
684,885,697 *46B96176F6BD4FEDC2CE3F0EE462A023991FB622 uranisms4
684,885,698 *46B12F707AC35437E2ED31F94B489FAF7CD2D6A6 uraniumminer.netwww
684,885,699 *46B5FBE987A0E06C20B5F787E570DC361B406F72 uranospinites2
684,885,700 *46B0930F19A89F51166EF87972EA543DB5A3C8C6 Urantuge
684,885,701 *46B4279386C082B898DF1FF4FC132E9B479D37F1 uranuslynne
684,885,702 *46B6A0B0D3DE0EDE445176A8F60BA4D3B9AFDEA4 uranus: the magician
684,885,703 *46B875FC894843C75CCFDC7C6E405A8158F1DC81 Urashima7
684,885,704 *46B8138A5AC2AB94E0B4F1A0FB99D012C2F68D7A Urashino7
684,885,705 *46B9B6E76B868E6D24FC8A6878A1B1E3B13E75DE urasimating
684,885,706 *46B0EDD384EC3FF77D0DF41FABADBC4362D44719 urastení
684,885,707 *46BEC1A945BBF8262D7D2FEC70E1FDF4A45A1980 uraturias1
684,885,708 *46B258D559F6FF7D214FF4184B1266449D439C15 uraV
684,885,709 *46B3D8B028A5E0F70189811DE1AEBCF371677400 urbainer
684,885,710 *46BF4BD31F29D4569127741668B95C5D8CE629D3 URBAN0109IST
684,885,711 *46B85B217F6DECEB33A2DB774753A013F18FEB92 URBAN010GI5+
684,885,712 *46B4A19EB3CC4B971630537B5A209AB6673616C7 urbanangel333
684,885,713 *46B5D999B4B2221E066E3ABA4DDC188E9B1C73F3 urban billy
684,885,714 *46BAC84122BCEB75B1173B394609D16111B8BD1A URBANBIRDS
684,885,715 *46BADC2231319A74E168DDDBBA3CE020537E1507 urbandomoj
684,885,716 *46B1C2E092330133B70910D855E03BDFDB2B940F urbanet4
684,885,717 *46B89AD438229807D215697FC1844A599535ED8C urbanistis
684,885,718 *46BEE66DE7415E2E7192FE82DDD725EF4DC45EC1 [email protected]
684,885,719 *46B68FAEBB3F0AA8188B98639F2C5761BF069F28 urbanlak6
684,885,720 *46B798DBB9CD145335B3DDD5A2A764BF8FC387AD Urban Revolutions: The DJ Z-Trip Megamix
684,885,721 *46BB79A66B86AEE59E67359F7A91312F419A991C urbanyi 2
684,885,722 *46BD5BB8FE02FB47FEA0CA82104C91D8C6F67752 urbeltes1
684,885,723 *46BA24B053A80068D6D7849C1EFF82DFFF549230 Urceolin8
684,885,724 *46BE6B6239CB5507845D02448159831D9A6964C0 urchprincessa
684,885,725 *46B08DDFED5CCB5C41335B1EEA77767E48AAC860 [email protected]
684,885,726 *46BCD3B2F18E8683272A4C2BEB0D22E660C9A575 Urdua
684,885,727 *46B67E4AAF04368DD78EC30223E8F1E5F780D370 urduckie4
684,885,728 *46B1A8C2B212DC091E4F1607F75CD144359FDD8F Urdyurdy7
684,885,729 *46BF3331EE12C1E7F142FDFD0EE52ACCB8AEE4ED Ureaurea3
684,885,730 *46BD5250BDD9AE55D80ED331148EB5B1ECEE0980 Uredite3
684,885,731 *46B7C3DACED3726D29ECA939B2DB6BF92ABAE5F1 uredovnied
684,885,732 *46BA6E962023645ED9EF4A80E4253674636EF144 ureizins
684,885,733 *46B304642FBD99908D2ECC2D649C31AFD26B9086 urękawicznione
684,885,734 *46BE1375DD964B55E0B9A6558BEA3B89164AA49A [email protected]
684,885,735 *46B0FCA5951140B93E555734D7767977558E2AF9 Uremia8
684,885,736 *46BEBCCA90EF67F91E4296F09FE7F3B0ADBB94F5 urendusque
684,885,737 *46B2DA074436A734398CCBE0028A790F020FAA5E Uressua1
684,885,738 *46B35FA4919C20AB2BBE91EF90A56E380E518805 ureteronephre2
684,885,739 *46BE8DC99F5F317ECAF2752D611ACD4702801B66 urethroperine6
684,885,740 *46B2EC095E03B97D1AD5050D22FD584A49FD936C urethrorrhagi7
684,885,741 *46BD25DF88B17C9119E9C60E1EA46D36BE66D5DB uretine2
684,885,742 *46B46789795D7957BC1A1C5ADA1CD4DB3C58CDDE urevassnutene
684,885,743 *46BE8795A103AA3E611933467D5892ED56A3A8E6 urf9
684,885,744 *46BCD1D8999259FC8E4EA23CF2F513A62BF2E1F6 urghtrae4
684,885,745 *46BCCBF8712A75404F777F8B8633BD96C6673DB6 Urgingly6
684,885,746 *46BAC93114BF906C0BD10AE7A9E39138A7EB7710 Urgirali7
684,885,747 *46B74093C12096FE3E30972DA11175B152F12238 urguentur8
684,885,748 *46B614E64E27117A23E99E2A541C9CBD41A67025 Urheberchtsfragen
684,885,749 *46B6316FE1AF29A0D5477140E26553E38F20B879 urheberrechtproblematik
684,885,750 *46BDEC91742F79F3E6303B1D454925B804FABA2E urheiluhalli9
684,885,751 *46B92F11A6C269C7E3C3EC0E62A47A7CC28F0B7A urheilukentilling
684,885,752 *46B2D2D3AAB47CC6438758A7ACFE7CF604A1AD4B urheiluvedonlyönti
684,885,753 *46B64C879581FDC5085471B8AC681F7200B70FAE urhiematum
684,885,754 *46BED8466A9B01422BD5A44E9B1D7ECEA07C147E urhoollisuusmitaleja5
684,885,755 *46BA5603CB9D5DB800E9FA70B70E5FD4D749211A uriah149
684,885,756 *46B43E1A6BD97404098E2EA558CD0C91920A59B7 Uriah171
684,885,757 *46BD8F4C1D0CA4B475C0ECF23778AA3513045257 uricotelisM
684,885,758 *46B283179565065C8E66DA2F5C968FB8B1A17563 Uriel914
684,885,759 *46B774B2B5FE69BF8B5CA918350663150A43081B UrielB.
684,885,760 *46B4BDD3273751C4903E848C3F36888BA25E1152 uriel ito
684,885,761 *46B4305D01F2E8BFDF72017F4246C55D601DBBBD uriellast10
684,885,762 *46B601B61EE9E162FCF78B8BE0C69A37553CE23A Urielramos
684,885,763 *46B9CB135060B8732A73B4F6BF84E0BEF0DCA31B uriethemanclamor
684,885,764 *46B38847A5DFC026B4536E54237C686AC04BA555 urijah286
684,885,765 *46B6F95382D861CD413B1AF52E5D6AD84522CF79 urinar123
684,885,766 *46B4CF0788D70C85EFE00E9BBB6FB4C937541B84 urinassesing
684,885,767 *46B3EAADA7783E94980C128AB1681ECD4ED4666D URINE07
684,885,768 *46B835715C2CA53C2FE3F2ED65D198CDA2BCCC33 [email protected]
684,885,769 *46B324E2ABF75DC77F590F6926DD392842E7B7A2 urinhsuk2
684,885,770 *46B19A683F237EFFD7E2BE813EBD70F28CE37EA7 URINOGENIT41
684,885,771 *46BEFD61BD4933E53917D817DAA16E6A5C94EA42 uriosatas
684,885,772 *46BD9ECADEB47386AB0F0E3F0FB45657494A0CDB uriscan
684,885,773 *46B35FDB7BF3056D58D1D1E78E6D4A2C2CA0BAD6 urisha bisnath
684,885,774 *46BA169F5087A33C160538AD8F27EA5B0D8EFF4D [email protected]
684,885,775 *46BB9755930A71E823DCBBAA7652D042F2851F54 uritanibsw0
684,885,776 *46BC5684B28397F884B14C9CDAFFB5614CAC82F9 uritsukued
684,885,777 *46B871946B13C4DCA39657974B942F40A01D22AD urituyacu0
684,885,778 *46BAD3B44AB34AF91FF6C3188D511BA653920277 urjneewing
684,885,779 *46BBAF8C7B09B8F348DA80E2B17D6169810C1BF0 urkunst
684,885,780 *46BAD638608E8FA30D2D2446368EDD6054FD2D55 urkupivned
684,885,781 *46B3E82261808A1CF21A0FD0AEFF9427F12F7D79 URL"
684,885,782 *46B6D34A8C8F923EE94FDB1CFD6D81AC76B345FF Urladdas8
684,885,783 *46BCDDA8B98FEEEF0DDEE091F3B1B9C7C28320AB Urlavate1
684,885,784 *46B269838D4B3D1013B7E451B3F3C36366893F1F URLCHEAP
684,885,785 *46B3D5B75EFBD3F16CC92E414A673F81D2ED5778 urlhttpcgi.ebay.com.
684,885,786 *46BD788585789CF6355AE86E74CF852018B59539 url.match40title4091
684,885,787 *46B4ED2C66204239551FCEF26153D7B0A9F1767F URLMTV
684,885,788 *46BECF3F058832F3D640CDE19B942E5F467EC9CF urmas123
684,885,789 *46BE13A146896127036E85ADDAEC1AD485147CF1 urmenees4
684,885,790 *46B277A667A56CC8BA60B7260B449DA7F3C7235D urmila basnet
684,885,791 *46B67D4295CCB01854B6AF6859AC337BF6665BE7 urmilarohansingh
684,885,792 *46B2B8DC67AEEBA791648BFB88316C834AEE5B49 UrMum,Volume1
684,885,793 *46BF0A7F39308369A5750FF4A9BDB36DF2507F23 urnalisti
684,885,794 *46B7D1DC5F05078C0863609A36D36F5BB34A0B90 urnalmilitairc
684,885,795 *46B635F67A72E7973BC0863E6105714E315C0DD6 urneasbswed
684,885,796 *46B43A6C833277B7F2EFF66326EF021E502B5F4A Urnebes
684,885,797 *46BAFD7856AC895BE4476A0B9CC047CF90443C4A urnenvelden0
684,885,798 *46B8D1B2CA5D38B7B09B9FD0897F440DD8E605BF [email protected]@N
684,885,799 *46BF382B4A2359D3D5EBE989EDA0D7705857525E urniqueting
684,885,800 *46BCE0A3E82D4C442155BB8382CED21A488B2D76 [email protected]
684,885,801 *46BB8EA8B16FAAD1B7644DAC7F05FF8A363DD340 urnvavdkvS
684,885,802 *46B989F88F398B3AF844DAEF2330246775D04DBF [email protected]
684,885,803 *46BD988151614D66467C202C806CB742D5210609 uroceargged
684,885,804 *46B1DD8DAA929925C434D0F37AEF77FB0B0C2936 urocerids8
684,885,805 *46BB9818DB93694165C0292409D151DD34088B0B URO
684,885,806 *46B2E99CF77C0A0B3C28B7DB55B09AF1E1CEFACB urokkeligere3
684,885,807 *46B83035637C5EF2515DD3B8B34228CAB1286888 uromere.
684,885,808 *46BFF313323BC9C2654432093448138D4908032C uronniez8
684,885,809 *46B7BA907F0BF4CBC9C98E430B1944503631ECFF uroopassas
684,885,810 *46BD83D0A7DC0BB4EBB95B4C948A605789CE55E1 urosevac
684,885,811 *46BAE0EEB3ECED9EE33E0E4878661815C26705E8 urosguzina
684,885,812 *46B68E78968C7F769520A537CD70C0D63E009924 uros sesum
684,885,813 *46B9CA530671A6822BEB80079DF13C7BC6C6BFD1 Urosten8
684,885,814 *46BBDD9C374BADCB92465FA6297CB5271656E6FB †Urosthenes
684,885,815 *46BF6A95C584E8802D1E7407936D6ED4D4EF4A70 Urposeen3
684,885,816 *46B79B1949CF1325210975D7F47C7317E2C16A49 [email protected]
684,885,817 *46B2C9FF92B1D086F3072BCE5CA1CF65BD4F53ED urquieta6
684,885,818 *46B36E1EABBB1A2F53E0D028BF5A4C9AB6102C5D urregob
684,885,819 *46B57353743B9D8DD716514450F0E3BE9591EEC2 urrilized
684,885,820 *46BC854530E3E230501B0CC29C3600F67451FCBA Ursachelt
684,885,821 *46BD257A64CAE12F36E1EAED23037C96C3EAB4B8 urselstaples
684,885,822 *46BBEF3306A1143CB65D4A654A5D6F76C658AEB4 Ursicius
684,885,823 *46BB9F06945B9020741B89CF08EDFA6BEB7770FF URSO93
684,885,824 *46BBFE4D67FFCE7E1EFCBA7802DB1622F2B06200 Ursprungsa
684,885,825 *46B5E1BBE043D5B3ED41871F9A4A7605CA5BEC98 „urstoff“
684,885,826 *46B9C66D2F60EEF777CDB7E7CBC7D91EC643AC01 ?ursula
684,885,827 *46B7A66DA5E37FFA9CE6503C60F11856A471A28F ursulaburch
684,885,828 *46B69748619516239A391B3A081748B27EFFE19D ursulacome8
684,885,829 *46BC632FD686C56EBF20785FA7D839AD209E969F [email protected]
684,885,830 *46B2A905574AE1BC0B1FEAD65407F6FBA206C482 ursulanorley
684,885,831 *46BDB6E9E9A8BE43A12D68279039ACEEB8124DA9 ursula qwabe
684,885,832 *46B0B448F53626BF37CC6E568D9EEBECE02DF5C0 ursulina viray
684,885,833 *46BA4B1C1059BA6FB643B17743C4B39B0E72A110 ursulla althaus bischoff
684,885,834 *46BFB9A3B67739C063815D40BF669ABA2048A01D ursursescu
684,885,835 *46BFF440F4F022D414D05E3B4F59FDD885699ADC urSv
684,885,836 *46B14BDD0A80F260A12FDAA6B4C8D51F967F8F03 ursynat
684,885,837 *46B6FCA1323913A0B7DF44EFB60D277C6D02B773 urszulagaluszka
684,885,838 *46B46123B854EE0C32C62B1E35669F7D424273C0 urt1g553m05
684,885,839 *46BDD5B98DAD43B522253B49560C0772A9463426 urtë
684,885,840 *46B5D475B33339F48BCB5A7500A973CBB1670E68 UrteilUrteil
684,885,841 *46BA3FFD7B5353BC706024BC723F116EF9393361 Ur the 1
684,885,842 *46B8ADB87D0AE34987CF2B4C584ABF590FB77588 URTHEKEY2MYHEART
684,885,843 *46B4A6A6C1E256269D9B686FE4DE6D6031C61125 [email protected]
684,885,844 *46B6B819647FC1D4BCBE770BB333109A68688B74 urtigreis123
684,885,845 *46B34EA1602EBCF8E1800F597432C1FA8A0FCD4A urtiit
684,885,846 *46BE4FED50FA76AE369CD471ADF956A1106C15CA Urtlu
684,885,847 *46BFA017202E76F5A9C84EEB23FDD85CFA12F95E uruchomono
684,885,848 *46B9CC9EB924BD81EBF7E9557AF6BBF81B0C3287 uruguayentendre
684,885,849 *46B9B4805076BE038A5BEDB2999739A5EB635000 űrügynökségnek
684,885,850 *46B47AB866DB81EE4A7FCA9340F095BB9378FF61 uruksskuru5
684,885,851 *46B324D10B5AA3350F5203A701BF26E0876D3B30 ururu uroo
684,885,852 *46B000D0EC5A16CD53DA11979EFA423AB67DAF2E urusahamid
684,885,853 *46B02132FF5D3C5A684F7DF22DC02C5228F0CFFC urUW
684,885,854 *46BA3AC1A24AC64BD40A78C1F9E0EC43B564DB0C urvi visawadia
684,885,855 *46B86436B93CBAA710234F54EC2FD5A24F9E7809 urvivrasing
684,885,856 *46B97AFA44061BD7238EB85BF154E6D710AB3BCC [email protected]
684,885,857 *46BFA67049F71A0CADD70BB83E960DC042D9B158 URWRWJA
684,885,858 *46B9B8B61B75D7891A7B7C2B728E4A67D6FF2F14 URXOFQI53
684,885,859 *46B2798F8B430596128D579CDAF52CEC7EC16EF5 Urzedowe
684,885,860 *46BBA5A60B82502C49676E1FE2E492222B0281BE Urzędówi
684,885,861 *46B6640E9E808F8B936483FB36DA68C4E6264D2D Urzedows
684,885,862 *46B98030E68A164299F6C3F0911CC446122C3F11 Urzeitfunde
684,885,863 *46B046F39D11A7E76B18456FD42354AC357FE852 urzekających
684,885,864 *46B34D6EF341F770A55AF7C9014D488089EF4E76 urzúz
684,885,865 *46BBE29C9911187BEA5838F30EE14B4411A94CF3 [email protected]
684,885,866 *46B1FC9100FA016BB364663AEA1C8BC87E930BB8 u="s
684,885,867 *46BE4A6DB55861AC58309B2034D668DD326D0958 u-s%
684,885,868 *46B8AD7BDBCCA61BCF0E7556B7DB86B372B98E70 us160patent160236609
684,885,869 *46B4D56FFCBCA4B7F80416A6E98B13354CD208AC us」(1993年)
684,885,870 *46B12C163A4491BD9DB4E1197B1F8D2621255744 us2008upa1
684,885,871 *46BE7DBF9744E1B5D97FAC3E6A8DF921E4073624 US3022430
684,885,872 *46B7AE27B2267C3C1A43E0366506DBC0584F05D5 us3fuls
684,885,873 *46BEC54FC451FB608A4C1FD422BAB73E1AAEA033 us72278000264811
684,885,874 *46B5383D5B6BFD83A506A3C26F2A0CEF055BBCBC uS78
684,885,875 *46B0912B50070D5383E383A67257708AD0F38B24 uS8m
684,885,876 *46B376038519E280862D05CB04B9A5CC7377B217 us9.531
684,885,877 *46BA2D4D83E51C132BED8683C95329B3E27D81AE usa91764
684,885,878 *46BD8D723CBB29528D6C007FAE372EDC341FE488 U.S.A.Capable
684,885,879 *46BE09E4E60D9A692404D291B92D85A9195734BE usag上的介绍
684,885,880 *46B01508007E8C7D271FA35580C904B6D133C240 usaiiasu8
684,885,881 *46BD662106DF265A5AFD9CAC01525165D89917FD [email protected]
684,885,882 *46B174B8BF06D287628EA16767E67B18525484B3 usallo123
684,885,883 *46BA7ECE93B7D675AC22BBF7E32A359A6F490847 usamaelhagari
684,885,884 *46B35434CDA1B2834CDA72A947C4FEF5585F7972 usama patel
684,885,885 *46B1F4EE950F9F3B79591D729E4AE67DCFB01DAC usandirmak9
684,885,886 *46BA5CDC6A8DE55F33DBC6036B3A90355380C97C usanis8
684,885,887 *46B09B4286F26ED3B3B0319B689A343167401FE7 usanzen
684,885,888 *46BCA421970CBFC1CAA633954907CE527F2C7B5E usa.raime
684,885,889 *46BE4DAC912329BD541BDADC7B5DFE605662F619 usa_rock_county_wisc
684,885,890 *46BCB8FC6202B9CA6F94F92DD0F39417FD0C0C5B usarrest4
684,885,891 *46B2107AB62B34CEAE94063ADB827388C1FE4A5C usaspirert
684,885,892 *46B44B8DBA868760A6931D2054618960061A3CFC usasralte8
684,885,893 *46BD2C0C652F74BE3F27728AB1B7C3A0C3C33AFD usassis9
684,885,894 *46B8852ACFB4CCC842F488D2CDE3D98510A0E246 usatysfakcjonowałby
684,885,895 *46B10BC6F51F22C144530E9C419A96D9575BF968 usbankfootprint
684,885,896 *46BE0172F6C0D5C56F01847EC79051ADCC709A4F usbb67
684,885,897 *46BBD50432C625D4C3D134778A60A5F26275593D Usbonds5
684,885,898 *46B7B0F246663FB7CBE20C128A498947479B40E8 usboue
684,885,899 *46BC16F5A76A3069C9EB0FCAD5CABC73F1C6199C u.s.c.160ch.57enviro
684,885,900 *46B17C7ED0CD18FD3D4F86C4165F9903E1C75A44 USCGPOINTRETREATMINORLENSLANTERN
684,885,901 *46BA300C56F7C1CAE54D624E94FE3BE2C40D0985 Uschinsky
684,885,902 *46B49E32CA4F53AE59C04FC8A4C7DD756EA18158 uscirannno
684,885,903 *46BD058B45B73D4FDE70007BB21E96AC0A606F33 usd1.2
684,885,904 *46BD9396BD0BD22C13C56084CE0CA53A026E6AB2 USDCIRIECALCIO
684,885,905 *46BEB670AC9070C8F3C26F9A2488AB9DB1439A47 usdelighederne8
684,885,906 *46B5E1E6E3E4CD9179BFE795F0FCC31B122074EE usdlili6
684,885,907 *46B4F1CEB56A16A602E260493CF87A51C395170C Useably1
684,885,908 *46BA21AB1918277FB0B13910DA69D56DD390A1BE usebussardgro
684,885,909 *46BAFC81BBF44F5B8B83F698178D27A25A2D421A usedaddededited
684,885,910 *46B4A9F53C27819D34773FD62582466DF92D17AD usedcommercialvehiclesales
684,885,911 *46B28CEF7F76BB93EF1F416E5756DB0C42E1174B Useformed
684,885,912 *46BB1EE8DC35C35DCD0F206A1092E41CD73402DB usefulgifts.orgwww
684,885,913 *46B285B7376779A0D99E9606CB3E09827ABCFC32 usefullies0
684,885,914 *46BF2CE9D2670EE337D8802324AB3CE9698B12EE usefulmediation4
684,885,915 *46B2BEBBCD106BB8501FAE77835042927110082D USEFULNESS7
684,885,916 *46B93DAFE48435BCEDD9752566AD6EEA963046DD useful.seresin
684,885,917 *46BDEA99C2FBBCF96A02F1E9A82A5E2AEEF23223 useimmilled
684,885,918 *46B948AE31DA776E2A182935C34DE53ACCBED1FB Useless(EscapeFromWherever,Parts1&2)
684,885,919 *46BBBCE31D685FFB1AB318680ECA6138F467FB92 [email protected]
684,885,920 *46B7DFCB6F586FFD6CA92C9819B8A67F5D162C01 use-notice102little
684,885,921 *46BEB66630C9446671D3829A638E96745CDC98D5 useoption1
684,885,922 *46B23CDA1A78BFD4CF49F2BC413139A9FCAA0270 user01kkkuser07holso
684,885,923 *46BDF216740C59791CF6E6B95A6860C635E0F96A user11makalp
684,885,924 *46B1378DCC4A70FE291B11A7A2C38BB21AC5B7B2 user161.52.14.2
684,885,925 *46B42466EEFB060FD1D34B8FE6DF3F7BDF906FF5 user195.72.132.1
684,885,926 *46B8C9F3321FB6F5451545C2D69C0848DFDDF58B user1sona1brother
684,885,927 *46B93CB35DAAD0FC640EE58E2E98AD7269C0EAA3 user203.31.52.131
684,885,928 *46B08D66AB0E987F396E10C2D2D86C54E797D159 user206.169.23.30
684,885,929 *46B235FDEBE8EEC5D6FFB1BFA5CE1764E5285585 user220.134.69.39
684,885,930 *46BE7C13130F5C4226B2DD058DBFADB2C8C12DBC user24.110.64.209
684,885,931 *46B23E53EE69B637E7F85ABBFF1BF0ECEE402CBF user24.173.155.146
684,885,932 *46BF2076D3BCE1E4ECFD4C08D394FEC5520C1A0C user345092
684,885,933 *46BA2CAB6E52FC1AB3034CFF85C8CF39D2ED8479 user69.38.121.181
684,885,934 *46B49DEA5E01EE561A47FD6C4FD3538E3D54C613 user80.195.4.247
684,885,935 *46B824962BBFDA504C971ED0B73547F0BC41E60E user85.107.18.15
684,885,936 *46B057D1ECC5C8DE6E99FAD72941476824DCA40E user88.152.239.25
684,885,937 *46B18701809854A80420771B7875CDC1B87FAAA0 userabednigowhufc
684,885,938 *46B86FF641AA244BA2A270BAA8B28E8B3F159069 useralnotjr
684,885,939 *46B80E1777BB4F0B237B4E2C8E9E9E608951BF8E useranders.bergheim
684,885,940 *46BC07E60D5065DE234A909534147DEB861805CD userandrei89
684,885,941 *46B39E747F6AB643DACA3576A5ABDD4C58F2E70A userandrewanorakandr
684,885,942 *46B7279F4F2CCBEEFB1B5F86DD8E734E9339C9DE useranilsalunke
684,885,943 *46B6157D1B9040B0CA319FDB6E48B83379CA43E4 userarothiawards
684,885,944 *46B0F922C26AE22A6E25F6B04D7A75006FDBD3CE userbashful30319
684,885,945 *46BDDDC3B1B815A3DB83FD8B58A6E938C5D3565E userbigest
684,885,946 *46B4B51002E0B3D3DBD034803951712D8103D925 userbillycormier
684,885,947 *46B22AB49F937F89ED0637854AF5A369DEB51362 userboxpurplelightbl
684,885,948 *46BEEB51BEDF14CDC054CD7B9DFA1184BE23066C userbrendenhullworld
684,885,949 *46B0FD9B72FE4EC171CCAE7575AA2D9076E6FB0E userbzerouserbibbibu
684,885,950 *46B5F052FE3499C42ADDAEC1CA1CEB5ADCCED761 usercaitlin8
684,885,951 *46BED9A2555CE7774DA198CE199E38DE5830116D usercfpopsphotos
684,885,952 *46B7848ADAF9B917A09A274C726929C0BF7CAEFC userchalkdusted
684,885,953 *46BEFB90BF14FC8E9C424DD4DBA84814B6A33296 usercknapp
684,885,954 *46BEF7CB6FD83FC7A355F73FB29E0C30889DA413 userdanielhailstorms
684,885,955 *46BF69D61C0BBB6B50F8E5942D48623813AF0F7A userdannydanny
684,885,956 *46B0B0DA6F48EA797F4AB888E32968EEFFF46AD4 userdarthtrivia
684,885,957 *46B2C41ACB70711B3507CC2DAEBA988DCEB8D16F userdaytonlowell
684,885,958 *46BC90E44B24525FCE320803539DCEC9CC77AF06 userdeanlsinclair
684,885,959 *46B3888783F5001B843541E57776BC62F357A201 userdhiran93
684,885,960 *46BA9DA10463DD88D6ECD9FE463DEB50CE798249 userdjfinn
684,885,961 *46B983E10B8E30CB00BBBA3392BB3BBC3D3F0802 userdjssb1
684,885,962 *46BA2B9B6AA8B667A938B9094387A5F107E646A9 userdocboatuser
684,885,963 *46B4ADA345D859E43076E1E08DA753A3551502A4 userdomain6
684,885,964 *46B6208E7B66394AA8A0CB1EC261A8DCCDEE3C77 userdoneilfavourites
684,885,965 *46B06A9CBB94A31A00FC4E6E2574197C14A1C863 usereffedup
684,885,966 *46B5F6DFBB6E44137D6701F615797C7CFE0326EC userelpino
684,885,967 *46B0947E4DE7B1D2266B0261E45F2A301165BA8E userenrgy
684,885,968 *46B71FFFFBFD17143A3A40153CCF5904DE8EC164 userews23csdneil
684,885,969 *46B4496EFB13434C89F9AF978DC41F0B1BF9C2AB userfateh
684,885,970 *46B35ABC1279DC9864E2C368117DB0DB8C07DC47 userff7freakzorzff7
684,885,971 *46B67368BB2A7DD196B78387229C6C4E90F01C09 userfoamparty
684,885,972 *46B98DAC8D249690AF2144A0625C55E565CE7D58 userfortunemtt
684,885,973 *46B2713FED651BA5F9AE8C79CBB15B76FC93CBA5 userfree2rhyme10194
684,885,974 *46B8720114CC7D8F1599BAEF2C06B53A077C29A2 usergbraing
684,885,975 *46BE4F54FCCDFFDCAF5A933AD68AA1345E64AC62 usergeorgedivel
684,885,976 *46B29CE09F637329F5CFE51A86E9EDC8FBEB717E usergigadead
684,885,977 *46B3B1E09485157A957B8C1D0BA3CE95C18C10A4 USERGRMWNR
684,885,978 *46B625562F94F145EB240ACD8C4B21A126A0C428 userhal06userhalibut
684,885,979 *46B680B50748F788B827E9045899534B3B660EA1 userhalibbut
684,885,980 *46BC4617C51168592D4A5415326785DB39C0B53E userhappydude67
684,885,981 *46BF0970016FCFE4AC310F544877A3990592A83D userhappysponge
684,885,982 *46B539E293F1188EB7F570C935B1B23B395C7AC3 userhowardstaleycc
684,885,983 *46B9981ED520EDEC338807D21493276C72468514 userhunterdfeatured
684,885,984 *46B4B50E9DD7B5145BD46F98BDBE83D134D4262B usericurhere2
684,885,985 *46BEF1DB519CE4D169FDB8219E594DC2D31E92C5 userinaneframe
684,885,986 *46B6DCAAAF3F5B284822A4B1EAAECF628B71A91C userisaiahj
684,885,987 *46BDA281D7F6827F4D2C361500A85A2272216D3C userisallowedlimited
684,885,988 *46BB8E64BB77FBA9BC2075ABB25CE05576C1CF9B userja10
684,885,989 *46BD7D2905A965D29657D67E83EEF3BAD8AFC9BD userjaksmatasalt
684,885,990 *46B8E769C6B3351CCF5D2A09077CB11235079766 userjaob70
684,885,991 *46BCAB1C24C9BD2CC2FCA56349E7FB1C2B5CFF8E userjaybregman
684,885,992 *46B1D118C015B4295DFEF7100D9BABBD3C68D89C userjayden54s
684,885,993 *46BCB0448451B5E29EB4ABBC0AAAA11C9E2B1BDF userjayglobe
684,885,994 *46B570AB89C1BB53429143CFB727D808F1E8CC98 userjbquansah
684,885,995 *46BAA6659D80CD92B9882F3AD658A8C34CA53FD9 userjmieres
684,885,996 *46B03595A1BE75E1E0BCE12090998A250DFCCA1E userjohnpomeranz
684,885,997 *46B740D2DF9A1C4B2279192D37E9F6E1A680A6DF userjoseppi2008
684,885,998 *46BDBEDBBB9D4CC670B55D67AA0C6425AE395EAB userjtvisonaedit
684,885,999 *46BF6E9E034B83B5CFB01EBA2B0FDD6BADE6632C userjuliand
684,886,000 *46B557F73930CBDBBFA91587998899749D0E46C8 userkaiuwe
684,886,001 *46B05684B2F5C141EDDD53F6F2409BB19D8A569B userkdaly100my
684,886,002 *46BDD114FBC3BD25EA951D9DC3E45A92D759AA42 userkehrlimz
684,886,003 *46B9C1A190AC3CC9B1F3A85EF1588174B0E20830 userkinnemanpitbullk
684,886,004 *46B93DEAED9D58FBC2FA970D0E53A01BFB5F0E14 userklassen
684,886,005 *46BF0275E40D74EBE9D89D5404DE14425E7AE5E1 userlankahands
684,886,006 *46B47DB12F750668C9BEC60F98436D4971FE28E1 userlapvandál
684,886,007 *46B21953930A1B1CCBD139F824A8FF410EA3CEE8 userlinkses
684,886,008 *46B9186944BC9A97B95BE41799AABEDF6DB9EE2D userlonleygirl
684,886,009 *46B9B0033A32BC3ABD059942CA9B58E7C6C9B066 userludahaiw
684,886,010 *46B9F415B62BBA2F391A9D5CC1072016EE171E84 usermajoreditoruserb
684,886,011 *46BE9645357E91057721A2BD7987A652BCC8BBF8 usermaneckemonobook.
684,886,012 *46B80BD45F7B3D435C7E135CB281C7660CB59628 usermartariusv
684,886,013 *46BB92E94894EFD7573795D858EBEBB0830A816F usermindcooler
684,886,014 *46B4B87F05B62EB71AD56D26582E4BC5156C49B4 usermlsquad
684,886,015 *46B43D26289C0D483EE8EB51F281A1E1E96D543D usermmusah
684,886,016 *46B3B786CFEB3539301437EAE643E3EAF294E9DC usermosqueras
684,886,017 *46BEA14692AC1BE28627341FBAC01FF1027CB1D4 usermurkywave
684,886,018 *46B405AB53A99A66C8BE7522F7F42FC0ACDE1F52 usermystary
684,886,019 *46B9E35E2F12FBBB8F6388E07216A0E09ECB6FD1 usernamearchive3
684,886,020 *46B2AF38A3D746D5F3DF99FB5C882A4B14125AE7 usernandika
684,886,021 *46BE931839E7852E18AA30015E4014DF2EB7C6BF usernighthawk
684,886,022 *46B2ADFC439B8BD156C18A62B876AFF0A4A145E3 useroberikomediterra
684,886,023 *46B21DDEE27C2FC17DCF8B86B4757BBA271029DD useroinksrmusic2
684,886,024 *46B190708E649432693A98B0D0A30550A105C02C userollyjackson
684,886,025 *46BD38345895692124681A04D17902CF5861D3AB userpageuseryo
684,886,026 *46BDA579744701C5A3CE459EF4FF1E3AC34CCE7A userpaper9
684,886,027 *46B10E8DBADDE6F551BC72CEC34D4213F3A8E505 userphamthanhquang
684,886,028 *46B1C60E52B6BF9EFB26BAA2F8995238272AA21F userpikminbot
684,886,029 *46B3BF6561D650589351AD71AA3CA65B0A9ACBCD userpl89
684,886,030 *46B613A1628BB8EE78CF0F746E28A6F8AB7FA07D userplanetsites
684,886,031 *46BA73F441AF683C02BAB1A8C7AB650BAC525C82 userpushpraj
684,886,032 *46B26682944B3FD4E3BF9BD9D426C0943030B73F userquandaryususerqu
684,886,033 *46B25A44A40EDA279296EA09507E158F21709174 userral315deletion
684,886,034 *46BA5799796013B7A5F147AE39BB2B138353D57D userrayizmiuserreino
684,886,035 *46B7C730D8AC7CBA9ACAFDAFC9EE92C9F110E265 userread8910
684,886,036 *46B248B1DCC97F2795BB480DAC89A1A03BD19021 userrevdrjim
684,886,037 *46BA33B56AFAE695E6A6DA517ECCD6D0258CC741 userrex071404
684,886,038 *46B753BC41CFA518D030F98659FB795A39E59C26 userrichard_walker
684,886,039 *46B40A6695481597A6E8146C550ACA49D394F5CC userrichman271monobo
684,886,040 *46B91A540677FAA21FD249ED5AF65392105CEE39 userrichyblue
684,886,041 *46B1A6FCF05DFB3DFF808D0093F2BBFC5A1094E5 userritasekker05
684,886,042 *46B9EAFCF1287BBD365739DF5F85A8B917BA1C93 userrivarez
684,886,043 *46B803FF820C9132EDF5048470414FA292E329D9 usersamhat
684,886,044 *46BFE5D0D6D9ECDC41458C694E8CC33209D404A4 usersatyrtntest
684,886,045 *46B135E48647448129E2979F91317A3BA709C969 usersbarlecchino
684,886,046 *46B119D6794C8E793F3A023FB33E14359FE27B7C usersetanubis
684,886,047 *46BE623EEFA68CACAC042ACE613A9351C76756A5 usersewn
684,886,048 *46B49858A07B4E186EDA7EC90907F48D353BF19A usersharkface217admi
684,886,049 *46BC5FA975CED139EA434347D25950C84E73D018 usershritwodayman
684,886,050 *46B8BD5817CAE10C60826145A7748B8DB101D121 usersinwin
684,886,051 *46BB114E19482A1DAA3138A66883758F1CD2F802 usersjakkallesandbox
684,886,052 *46BA2BBD0C6287258641727F94998E3D776DA321 usersmith609to
684,886,053 *46B92CCA6BFCD5A0D83808A7970DF70372FD49DF usersnakewiki
684,886,054 *46BDF2AB560CA8CD6B776CF3BB4C674693B215FC users.piotr
684,886,055 *46BEAE6D7C7F7C02A8274297EE59998E4C084A6A userssmithuk2
684,886,056 *46BAFDF2A7B41575F578FD63D3D7BCEDC067ABF3 userstevey7788red2
684,886,057 *46B46D0D518166675E5704C2A2B45E26977A5DB6 userstormyk
684,886,058 *46BBA18A16436E70151EF151389B35989CE527F3 userstrgsd
684,886,059 *46BB0C62285F2965F1D3062A09E648871B4DA9F7 usersudhamsh
684,886,060 *46B3992EC8FA67CD8C2CE34AB6F58C4EBED54D99 usersupermariobrahde
684,886,061 *46BA793C93674B25948B6969074ECBDCE01FC3D8 usersuperstator
684,886,062 *46B5EE854CF7604721998B22E5521CD4161731EF usertacorcovilos
684,886,063 *46B36F7F98B8D3257D05F824B7C3AF6DF46B291A usertag-molio
684,886,064 *46BE8F8A88C5A5AE48811BA468540F37DBB43E3B user_talk68.112.253.
684,886,065 *46B80FD95BCBE2F5C4E83070338974B8C59D1CCB user_talkanynobody
684,886,066 *46B80DF91F503B07F43C707FDAED63C530F5D5E2 user_talkaranherunar
684,886,067 *46B243B15D58BFDBBAAD8F272403B6332F76FE49 user_talkboothy443
684,886,068 *46B28BAC1BAD7A671AF0AF3953FF4B7CF44E14E0 user_talkcaptain
684,886,069 *46BFDBCD56322FC9EF9F73C37D3C0AFFF5B096FA user_talkmyselfv2
684,886,070 *46B877693F075FE7A28EBC1F4F1FFBE508696305 usert.c.wiffleball
684,886,071 *46BD35029BBFC64629FAD74919960B201F7191FA usertedickeywhatever
684,886,072 *46B5C12DA063182E35655C435BF6E4AB3BC299CE userterzett
684,886,073 *46B48CB1D8494FE63C71058E0D86813FAA674ADF userthe_thadman
684,886,074 *46BDE3F8E27325DBD63127D416128C837ECF0DF4 userthkingsamu
684,886,075 *46BA94D24396CDED7F66ED5C4A75AB2AB3B2BE9B [email protected]
684,886,076 *46B357A3F622B853972B14D2799892D8FA858EDC usertobyjay
684,886,077 *46B590342404FBA55A22696478A6C630B5AF61C4 usertonesandjones
684,886,078 *46B3CAE586232FCA00CF703DDF05FAA107B5DBA0 usertoolmasters
684,886,079 *46B15054536A34CBDA74AC5FCBC8331830402E01 usertrivet
684,886,080 *46B582CC51BD5506C9C6F6A521DD905A7E65FF40 usertx55taiwanese
684,886,081 *46B24AEFF63BA949CB7BA92C4D73824E6BE9D5FC userubxutv
684,886,082 *46B5B38A2FC3628F984AF2CF921E1F1CA5204632 userulisi
684,886,083 *46B5CD65EC7409680A29104E8CF5635206B05775 userulrich.fuchs
684,886,084 *46B8DC479E4F87DCB7D285CB7DAF4FC8A3B99ABD useruujeroi
684,886,085 *46BFB8EBA9A6D186402BCA6DB3A8C979A923CE33 uservisca
684,886,086 *46B3521B7E4A2B2B89FEDC3920487FD2E565E60A userviserystargaryen
684,886,087 *46BCD6872183AE637D3B7226C36CB1B6601A2CC9 userweweje
684,886,088 *46B061E598AB462CB9085211F87273CF79FCC51D userwikipediawasbehi
684,886,089 *46B4BB4D07F86FA1123C12D69009BB4CD4DD624E userwikopotamus
684,886,090 *46B0C91B5972BA986E48208E4067A24E675EE418 userwmcmacken
684,886,091 *46BF8B3D04978A43F918BECF12BBE9A45BF7A3D7 useryerroc
684,886,092 *46BAC807A3BA56F4A1D4CF41B45E84DE45465616 useryorktown1776
684,886,093 *46B80531D857A022A4AFE4C2E440804E15671164 userzachemonobook.js
684,886,094 *46B920512BE4315D1CD48A03C1B1963F436DE462 use that power
684,886,095 *46BB7291F1F5ECAA81BB519611D48544CEDEDAD3 usetrim2
684,886,096 *46B359979835C3A1B8A8487FE2FF583CE3C84370 us-experimental-band-stub
684,886,097 *46B7EE93F5E6DC4F6389E671729025EA5B1C3BC2 usexual5
684,886,098 *46B114AE9066033A9C1961A99AC74BAD8F85B2ED uS`g
684,886,099 *46BA4B6C6D800D6D996AEE0BCC0D0BED7C59E0F2 us>g
684,886,100 *46B3C93518E6673FDA21B975628F0064124B9666 usgs:月球表面特徵命名:月沼
684,886,101 *46B38F2C273DA9875B566792B9C775B83F2C035D USHIROSABAKI
684,886,102 *46B4BC1EEA65ECDEAE09A365CED1FADE27C07466 ushititi6
684,886,103 *46B64114ADD12E0D46E84307DDDC3A7D736CD959 ushitsuh3
684,886,104 *46BC822EE11CC59DDD6813ADEA1A876A814E4BC7 ushtshev4
684,886,105 *46B7EBDE5B4893D0AF3A576D23F7DC8D1C19554D ushubsw6
684,886,106 *46B51B67935078899628A4B0306D24353E36ED7B Usikret1
684,886,107 *46BF917823AA60673D4B07BC2C12C4830950456C US-IL-CHICAGO-NORTHCENTER
684,886,108 *46B59EFFE8F494945AC98B51F40767FB5E148AD4 USILL
684,886,109 *46BBEA3D49C10DF1208D3AA0B760F39009296B44 usilovani3
684,886,110 *46B1F879FD52FF754CF4CA24C7687F68A1B3C5A4 usimmaced
684,886,111 *46BDE42E757506648078BC4A12F255246197FF8D usimtake7
684,886,112 *46B73A099302D36C33CF62F586B2D40B76A6389A using-internet-government-finance-related
684,886,113 *46B049A3889E95B0154A12219A5DC49DC048F0A1 usingonlypublickeys8
684,886,114 *46BBC31BA37845066C82FF696DAA863AF205676F USING-PRICE-SALES-RATIO-HOW-TO-VALUE-A-STOCK-USING-THE-SALESPRICE-RATIO
684,886,115 *46B7B5C42AD098C84F67A207897AC9269917B6FC Usiroosi9
684,886,116 *46B5532D9CD2660D8BCE465CB19AEC2125B828D8 usiroret4
684,886,117 *46BF0F23A42B878F94A175E0D791293479FF9AF8 usisavasmo2
684,886,118 *46BEE6283B876C4BD2D5E1D6C02215D8D8606609 USITA'I
684,886,119 *46BF832D5873F01F8CE93F893F37EC09E5F5715F usitakes
684,886,120 *46B4BBB02900847A6A919791806E0CCB6C57F31E [email protected]
684,886,121 *46BB777638CE482141535DB7C698ED740D424934 uS=j
684,886,122 *46B20C33958D32EAF1CF895B2C7339F456D70C84 US-JAPAN-CHINA
684,886,123 *46BE308D4B84183D79FA622B431CD0228023AFBA uskladivom3
684,886,124 *46B18E13093A49041658DC311B9A52521E14E835 uskoakaa0
684,886,125 *46B95F5F90D0513C1F51C122985641394C13F220 USKOGRUDNIJA
684,886,126 *46B44605F1ACC909842A76DDE301A0106704C9F0 Uskrsloj3
684,886,127 *46B3A7CDAB9E1CCB077B4210A89FE6DBAA960911 üsküdar”
684,886,128 *46BC91C7CD68881D00BF3764C74384306C531E24 usladder4
684,886,129 *46B4363E0A986DF89143B50C31886134006ABED9 uslauyw90
684,886,130 *46BCE2302DA2A2209043A9667770B9EABE936CAE usldqaaacaaj
684,886,131 *46BFF7043E90FB71D628485CC5C012DDC0BB61D3 uslegers6
684,886,132 *46B3261475153639E29BD506562A3DFCA419DE25 usman saleem muhammad saleem
684,886,133 *46B914A341269FCB7CA27E6F46833CF10AD60072 usmanyakubu
684,886,134 *46BF8B96EBB228C8AC4D5A1721270A088D209E47 usmidigheden1
684,886,135 *46B6E1B6CD5438B2D41716E34D2748EAB3AA43D4 usmrcenim4
684,886,136 *46BB32D1F1CFD958787C46B878E99D6106F1F87B usna63.orgwww
684,886,137 *46B60A62BC2FB25CFB70E5E8E8184A5A9B6DFA6C [email protected]
684,886,138 *46B4ECA4F73639C06A25888DE0F3D682AEAB2E81 US-NMX
684,886,139 *46B15985FCDC3F5D91B0529DF89ED745399D42B8 us-novell-linux
684,886,140 *46B587D6C084DD75961AAC8F01149D0684728C61 usnuclearBSW
684,886,141 *46BF433E5ED866C4712B6F123990ED14D136F12B usocia1e
684,886,142 *46B10490C534F98FD4274DA0A2C9730C70F9AAE4 [email protected]
684,886,143 *46B18FE67825983023426B05ABEC0E912E0AD3CD Usogorskin
684,886,144 *46B187EAD32C5FF9610B5C1E31772800821742C7 usoirolg0
684,886,145 *46B74AFF52CFCF013360288165279F199AE71496 usoptakia
684,886,146 *46BE32D8C88B006303EBB5246F5601C304A1C07D USPANTECA!
684,886,147 *46B114C09F882CE2C8F9FD9025ED279A7FC1A2CB us-passion,bwv244:teilii:geduld,wennmichfalschezungenstechen!
684,886,148 *46B0927A19BD5441C69F44A66683488AE3468958 uspendez9
684,886,149 *46B7116DE470B1879662E8109AD0469DF047F0A5 usrbinatq3
684,886,150 *46BAB6A0CE632307B23D6338BD199F33E6D8AF0B #!/USR/BiN/PERL
684,886,151 *46B7C21B8D53BBD93978FDB2400631ED7410EE2A usrednjenog
684,886,152 *46BE727594190518BD17E37D3241AC4A4A22F1F7 usrlibfsvxfsvxdump0
684,886,153 *46BE8C1555116E069783E38E4D27E4921190E0BE /usr/lib/gconv/iso-2022-cn.so
684,886,154 *46B874BFEA104DE2DC2240D74424EE9650081D9C usrlibpython2.3strin
684,886,155 *46BDFDC9178DB08C00D0D33747410D87D83ED95B usrodnev9
684,886,156 *46BE1B1DEAD0DCAF4D421D37C438E0E11541A729 /usr/share/consolefonts/Greek-TerminusBold12x6.psf.gz
684,886,157 *46BD9215878B4A3FF3708CE14EA6921B908BE255 /usr/share/doc/libfuse2/changelog.debian.gz
684,886,158 *46BE033CC1D2611282D84FC4DA036049D1A856B5 /usr/share/initramfs-tools/scripts/init-bottom
684,886,159 *46BE23AEFDEB1C713E04213C3AE2A440A49CB16E /usr/share/locale-langpack/en_GB/LC_MESSAGES/dpkg.mo
684,886,160 *46BB8DAB6F9BB0A36B5486DADAE6DE41904C5BEC /usr/share/man/man3/uri::withbase.3pm.gz
684,886,161 *46B2A188D6FEB6AA62C5278C36DCD57770A13E9D /usr/share/man/man3/xml::libxml::regexp.3pm.gz
684,886,162 *46B737401A0424616487CA1D4553EC4E944DED3A /usr/share/man/man5/charmap.5.gz
684,886,163 *46B73ECA914DFDE6E51CBCACA8465551205CD1FB /usr/share/man/pt_br/man8/rarp.8.gz
684,886,164 *46B23891A5AA6FF14FB807ECCF912F3D5E83EEBD usrsource.
684,886,165 *46B5CF625AA64CB2AC2079F040861A75095C597E /usr/src/linux-headers-2.6.32-24/arch/sh/boards/mach-se/7724/Makefile
684,886,166 *46BA258EBE556252920389D59734F322EB7CD6A7 /usr/src/linux-headers-2.6.32-24/drivers/sbus/char/Kconfig
684,886,167 *46B7E4A99A0A17EFFFBA32E523A1B36327513830 /usr/src/linux-headers-2.6.32-24/usr/kconfig
684,886,168 *46BD34A0591E918CDC660F968E602ECF1727E306 uss160pgm-16
684,886,169 *46B022FABD6F50C22FD2C30D6442E1B3B63E3604 uss_blueback_ss-326
684,886,170 *46B29EBCB7ECAB05DB2D1C8E3DEA645CFDC1875E usschaut9
684,886,171 *46BD783859D21F10D5486FDB8C3B6EAE29E4B977 üsserscht
684,886,172 *46BFD4AB3E4428CB000AE89588D08E3071E168B5 us sillybuggers
684,886,173 *46BB5630BAE89344BBCD7894EFDA0EA667CBDCBC Ussimrep
684,886,174 *46BC5FD0E4BC818A3B9584F62760D696510BAE5D USSLassenCOA
684,886,175 *46B955874EB2BBF618C8413E54C0307D9AE4E66D uss_new_york_city
684,886,176 *46BD527D83A98C1038DDA960D634EB8F073DA022 USSTWIGGSDD
684,886,177 *46B21F5727875C0EB2B657404E17777E36EC3F3C ustabiliteternes5
684,886,178 *46B1C58AC74034C44673AAE886B8BF494D727DB1 ustajalim8
684,886,179 *46B2C71223C6A2CC930D4B49E6EB4D39182940A8 Ustaleń
684,886,180 *46BC8688844DCD5D48F37E05508221B47F660716 ustamiso2
684,886,181 *46B941ECCF8A17EA42E94EE8C32AFC5EFCA77D61 Ustani
684,886,182 *46B7C89419D7F30B45808102CA532A0BAD2D1527 ustanovilo9
684,886,183 *46BE1DD9E5B02E0238B3BA32A9D9D8540270584C ustavnim3
684,886,184 *46B66E3A04B3C7916D01BF8CFB6ED2A69828A981 üstdil
684,886,185 *46B61A364399AB4E58011FF31E46DAEF553AF2AF ustegnuta4
684,886,186 *46B9AC7FE5CAE1862A66BE2312768376AEFC9B29 ustekiases
684,886,187 *46B7CCD1E868E1D20AF42761FD48853609807E04 ustertem4
684,886,188 *46BEF2BCF4B8CC52727C2AA4997DFF29D0A55594 ustesoyjing
684,886,189 *46B59015D5690CCC56E53711BB2B98B7F49ED1E9 ustillo6
684,886,190 *46B2B422E7697E3A131960E76323AC56BB6CC82F ustimos5
684,886,191 *46B713942E4FEA14E1B79C991819FC4044091077 ustiruf8
684,886,192 *46BC8526060C9DBE03D60C7578D2C895F1DECC2F Ustissa7
684,886,193 *46B1AD12CAC89A3B6121784D8BFA0C68282E9B47 ustoimet7
684,886,194 *46B5816422E07DDD1BE84F4BB9AD0725523783CF Ustoknah
684,886,195 *46BD505DA08716908D0E91428B4197D83BF059B4 UStr
684,886,196 *46BE3DDAA6FD002EE450A9EF7E263F0E9A9BEBA2 uSTRqUR
684,886,197 *46B4D63736C8F8AF182233728BEE297F653436BD ustunluk7
684,886,198 *46B1A3826D165B1835C88A311C8CD851F2F49D47 ustupanjaed
684,886,199 *46BE4D1784238C408411C5F51DAB22997CDDA646 Ustupkoms
684,886,200 *46BA16462A8C908CF3043D66E83542087EB3C40F ustyug123
684,886,201 *46B4D17DE321A9AEF2745A10F99A4EF8CC838BAA usualsuspectsentertainment
684,886,202 *46B3A637CA4B84AB1C0DD978B96BEFC9E341D659 usuariopagina.split4
684,886,203 *46BFB2A10FB7F6EE6A89197A590FB0098341D08B „usuaris“
684,886,204 *46B148473E9B0908B5705850C1F3D941D23D8701 Usudben
684,886,205 *46B934060000D646948B8C755ED22A8D76A7FBAE Usuelle1
684,886,206 *46B3C0A8DC2DAA5CC410510882367938346EFC2D usufrui+7o
684,886,207 *46B335EDE2F86E3126306B79E623E6499E579344 usufruirs3i4m
684,886,208 *46BEB3E46BA196E270EF882C97104D886EB9D201 usUK
684,886,209 *46B72F1BD88C83D3DC16E42EF8659F5A9855DAC1 Usukeising
684,886,210 *46B37498363F363A0C1A2734E30FDD8FC85D2ADC usuleerd6
684,886,211 *46B645919F7FB5007F872006082ED4EF4715EBEF usul hidayat
684,886,212 *46B9651D8A58F9AFF05315323A3AF7317BDED03B us.umm
684,886,213 *46B82FFCEC887F15C0D14076C87CF92B435843B4 usunseting
684,886,214 *46B8EF12BFC38EE0C38E14F8850DBFAB29B61710 Usuried2
684,886,215 *46BE6DE8F9BC91A6B98D101DB8B92AF47B927ACB USURIER7
684,886,216 *46BC3C6FE97E71318662123C0F79F2838879BDF4 usurpadoraed
684,886,217 *46BFB63075C7CD5AF7F613081FDD83CFEBF8282A usurpatorsesing
684,886,218 *46BD4DFDE7D97B05DABB3264EA17E78FD10D38B0 Usurpis3
684,886,219 *46B906960652EB51F71B57DB875C9908A1F9FDE4 ususeradu1
684,886,220 *46B38A7C100B584F2263B2D433D14B499F2090A3 usvallan7
684,886,221 *46B3DE88BF26E6B9426C8367BCC721A0BEDA407F usWF
684,886,222 *46BBDC3A426F7A7901D06C46E1D5B4013B8890A5 [email protected]
684,886,223 *46B569D3FA4F6DEC391C5B3EF1EA48009C5EFCD1 usynligheden0
684,886,224 *46B37FC943A5A1AC443A37C64A766F6AB5A65ACA uszfstxpr4
684,886,225 *46B20EAA966916271A97E5D579B099655B802B08 usを設立。
684,886,226 *46BB185B78E7E85C02BB3582BA1D81B4207B9249 [email protected]
684,886,227 *46BDEEA1DC4EEF5976E0B27C9906F4323A449C1A uT""
684,886,228 *46B186E58B3A7FCABABD0C94F311C9CB18389D8E u`t~
684,886,229 *46BAF429CAB0617EBAC7013AB0EC3944F931D265 u%|t
684,886,230 *46B75800238C365A2E17A2E47361D7FF7622CC11 ut4h-mudd
684,886,231 *46BDD60EBF4DB70133105390473502687FEFDAEB uT<5
684,886,232 *46BC13FAAAC47A440FF1A2BC903C1EDA804E5F2D u,tA
684,886,233 *46BCA8B1264D1397A707E9A968FD7E296949DC9A utagebsw4
684,886,234 *46BD4B79B5DDBF399FABA5833E731D1247DC469E utahcrystal
684,886,235 *46BA816CE29489E8E42895AF3D73A8E1CDAFC77F Utahnet7
684,886,236 *46B6F94819D6662577318CA977309B69F7086CAB utahsbrnet1234
684,886,237 *46B0C7373301F674BB2FCB07F6BB6CEF708D8ED3 Utahuok1
684,886,238 *46B3EC863781BE57AAC142EE6269B8ECC14C151F Utaiage3
684,886,239 *46BBA410826774E8532CB3DBBE1A71BC88D4115E utakalos
684,886,240 *46BDE0F834F800EB5017141DD558650F59C00B57 utakmica0
684,886,241 *46B429626424F433A7E66365C0EE0DB88C4AB95E Utakmico1
684,886,242 *46B666AD7DAD7D8EABF3EE0787363F42AFA72579 utaknujed
684,886,243 *46B43079F6ADDA3AA61A794AA7E0BCE5405886AF utaksrum1
684,886,244 *46BCC6647EF94D764F692670EBBDC97B1718DDDE UTAKWENDA
684,886,245 *46B869A8526CD285EA4D0D60A68DC6F8F2AA0329 UTAMARO5
684,886,246 *46B1A180B09C7A0860242A3ACC1200AE768D9B05 u-tamash-n-i-a-t
684,886,247 *46B02FE1F268DEA120D129E6BE03676E43936C1C utåndingslufta
684,886,248 *46BEF205147BDDD590F5FC4C98A4581BA9FF0FA1 utánfutónyi
684,886,249 *46B5CE8645B263069F6DA95490EB37D615D101DC Utapeni5
684,886,250 *46BA6B1367CC1125A1FAC9D18961AD9C603190F6 utasosta0
684,886,251 *46B2F682561892775E0EC39074F9D38C1FFF7C09 Utasukot
684,886,252 *46BFE8E201B442B8F65F4DCBBB5352439D79AD43 Utatuoding
684,886,253 *46B5ED2105B6B158E633AE0932B899AF962E3E21 Utatuoy0
684,886,254 *46B36699CAB4CCCA04975AC76208F36097DC3550 utb hollywood
684,886,255 *46B9BB914A77C41EE5DF74CB402DCED1F08BE5CD Utbreiin4
684,886,256 *46BF4F440DC75FA60240018F6A79A6609E7DDA61 utbryta4
684,886,257 *46B8D07F3F9D0D9CADAEB1954D608EF4F7EEB8C8 utbyten4
684,886,258 *46BD1A329E6521CF9068D6BD1147C129E290CC4F utcfuronymous
684,886,259 *46BC4C138971A3230063AC1104DB2208E13A2567 utcjoshcatone
684,886,260 *46B3E81C6F3654C6790DBA8279711B9A47B12EAB utcporkchop
684,886,261 *46BD88D1B9AFD3940BA691282F8E060BDCA1128B utctulok02
684,886,262 *46B71E398B3EB14F5B6B96C4CAC477B36CF332B0 utdannelsesordning
684,886,263 *46B612AFEF83FB3DFFEA82ABB3C967C469A2C991 utecencovych9
684,886,264 *46B9742833C8BCBA4ED2B2F274222BAE498351E1 UTEEBWA
684,886,265 *46B5C00B942DFB61F97C4DFAB2756E8EF48DA90B uteknoring
684,886,266 *46BA8F66CA941B4A6B34F8DB399CAE249520974D utel sy
684,886,267 *46B0375EDE48ACF52AF003702A6C8BB6248F2F2C utemeljiteljskima5
684,886,268 *46BD6C1EBF4EC50324E6D2133041C700AA944B58 Utemeljivali
684,886,269 *46B9BF3D7F30FE642652A71C2B08A27B5B8CB778 UTE-NET
684,886,270 *46B7C1A82CE7E527F9A00823C2FBBEB23004E026 [email protected]
684,886,271 *46B468ABB2594DEBCE19250000E45B2DA419DF8C uterapesed
684,886,272 *46B6D8DBC7FB145628B5966B526C21A19F1FA501 Uteroplasty1
684,886,273 *46B6C4232EECC18367B213ADBABF62CE68C996BF uteservering...
684,886,274 *46BDF877C2AAC84EFC116ABE622119E0B3E0BCF4 UTESOVAT
684,886,275 *46BCBCA6A55BA480F2866EF7F87876644FE5EC61 Utetareg
684,886,276 *46BB8D972C88EE364E458C3262AA649205AF132C utezies1
684,886,277 *46B29155CA3461C6D432EF1A81AA1D6F253089EC utf-16encoded
684,886,278 *46BE4B38FDFDF965D6DEFDF5AAB3B0F3BC19676B uTF5
684,886,279 *46B0285906C40E024601AD6ACBE3736ED2116979 utfoeres5
684,886,280 *46BD01FF9E7C52520C974110830DBBA0000FCF87 utförres
684,886,281 *46B4AE1B7DAC167CA5F55F5D9CE76F03D5667B95 Utf
684,886,282 *46BD6D807357B075DB5EE4F6D484592072CD7BEB u$TG
684,886,283 *46B4815C82D8026882B7BAAFDB36DB16DDB12926 ut(g
684,886,284 *46B70246B2933DF12864CDAC0BA5B6C2F8613B92 uth<
684,886,285 *46B161CD32738B6E8EE952BC483CE18C65404C1B uthayatharmalingam
684,886,286 *46BB9E2FF06C30D8C47E3D9E1C1AC839612D5F26 uthlei
684,886,287 *46B8C3F0C8E3F20F43237A914084626A2B27CFE5 uthvilt8
684,886,288 *46BAA77DD0B8979596E15988F87C35232A58615F utigheid0
684,886,289 *46B26F04B348A89433366BA10A3D578F8ABB3BC2 utihsaz8
684,886,290 *46BAE4D3CB108B16ACF27BC86A888E75453062DD utihsuob7
684,886,291 *46B4A7F6D19495D720378A09C31028316EA07BFD utijikis2
684,886,292 *46B4F965F27A5B86FB0AAE773C7246B253CF0B88 utikate5
684,886,293 *46B7A4B5CCB62762B5D5212E350D46542C1F1BF9 utiliesbsw9
684,886,294 *46B33DB686A3499DFD9BF85A42C8AA733BD06754 utilisâ
684,886,295 *46B70080FABAA2542E6111299E49F51F0F78DD8E utilisateurarsniured
684,886,296 *46B1D75F215A094266EFF0A84657332ED4174188 utilisings8
684,886,297 *46B9B9DFED68377CE61A23ADC513500FAD0403DF utilitas123
684,886,298 *46B9A2A1D32FBB4B82DBA34A1AE77BDE377E0688 utilizarà
684,886,299 *46B94388BFECF45CA6FADEB85620FD0C76508EA3 UTILIZAR
684,886,300 *46BCC45E6FE73F6E9128797592E9569FA69D53F4 UTILIZARIAS
684,886,301 *46B350778F5E866564B55D6807068562B53D9F16 utilizzarano
684,886,302 *46B1F958DD81C155FC38A1DE6B9316D611C5A9CF utilizzavi9
684,886,303 *46B72DBCD82A06BEEF637370F4DA30314E992CB2 Utischill
684,886,304 *46B2AE2B05002F412ABDE15B1DE46BCA4833D0DF Utisnag9
684,886,305 *46B94ACD5D9E8C81B89DECB719B260B7B9716A60 utisutij6
684,886,306 *46B43A80996ABDB36F2208A5C31D4AAA6CBEBEB5 [email protected]
684,886,307 *46B9A47F6C877E343ABE6C730012890CDD27A687 utivFt0IRaYJ
684,886,308 *46B048FD0D64BAE9A6A51A71D98A667DDA6B90FD UtJNAJB95
684,886,309 *46BB5A581B140FAA2C8E3643FD8E6C2B460BAAA4 utjp
684,886,310 *46BC09BF6BF84A055142C15906C64DAA11B38A48 utkantens9
684,886,311 *46BF54E46907527695D0E96FA18647FCBA3CDC3C utkantstrket0
684,886,312 *46B6DE593FD215822946551BB3078C347B457CDA UTKCOVER
684,886,313 *46BB8B5B41F2FA0B7C33AE33B908CF37ED8CB545 útkorrekcióit
684,886,314 *46B882670ADB3B82D1562DF45D3BC60488CF2F67 Utkr^ishhya
684,886,315 *46BD941BF3FF314D7BA0FC4115D3A0EE923A1937 Utlaends8
684,886,316 *46B458F782382578A7DBA15E2E004341999365B2 utlandsprefixets
684,886,317 *46B38C09249F04A7FC94E059C703E74848283828 utlikning3
684,886,318 *46B1060B004075BA99E7EDFF39C58AFCD61D280C Utl
684,886,319 *46BA19F358034B5F4630211B55E34B270BD5E5F5 Utloppet3
684,886,320 *46B945B1A895C87AE7FC82C94B96EE59ACA1C89C utnamiov7
684,886,321 *46B1AE6B365E6628DAB4B1581AE479070C0538F1 utnasuoh6
684,886,322 *46B85935EFE2220B6F7908A91564FAB080C0D4F2 utnöttes
684,886,323 *46BFCED1F01219202F0546F4935B9380BC3B8D07 útočnk
684,886,324 *46B3E2BD4F71E57E1B9C07EB5A0D6BE85A57CA14 utókortól
684,886,325 *46BD3A27FF76E2E2D59FA340DAA8397682D13211 Utolérhetetlen
684,886,326 *46B37C248A269D44A60B5F6CB146AC82D45B14B7 utopiaamour4
684,886,327 *46BDA4FE3B881249D4B2FF70FB41EE1E449D5688 utopiafranklin0
684,886,328 *46B19F86029043D92C161A2D39BE0AEBDDD4A8C3 utopiahoward3
684,886,329 *46BCEB9122D0900838C702913427D6C5BA92D00E utopianiseses5
684,886,330 *46BC2FDDAAD5CB9B654B0C16F76D6353B64EDE52 utopianizers5
684,886,331 *46BD962507B01A529AAA3261EB7510AFEF5DB502 utopiaperrying
684,886,332 *46B9FC11D9A7303B8F5DCC03AF2C8355480AECD0 utopiapeters
684,886,333 *46BDC6733463024B9E6746CA145A05B7CA404287 [email protected]
684,886,334 *46B39A549B223F958F2F703CE347E52D21CCB0F9 utovarenima3
684,886,335 *46B476584F9CC27AB1B95D8B364DEAC209544733 [email protected]
684,886,336 *46B020B2E6EC2A0A058F86B093285BC3174DFF58 utralism6
684,886,337 *46B0F234927505D3AE1B8BF0B558ED9DDAA67BE9 utratta4
684,886,338 *46BCAE26EB81790C56706D67304B609764735E26 utrekk
684,886,339 *46B4F19AE6C0663F294E0AC3C10A06CB2D97E0FF Utricculus
684,886,340 *46B8BAEE8902101B5215961F0A8A5365B896E512 Utricula2
684,886,341 *46B7679F0AA4D987CC60DFDE3DF961F81FC8A09C Utricule6
684,886,342 *46B25CA5DBC4F9DE46DCDE52BC40979B8D6B52C4 Utrotnined
684,886,343 *46B967CA52F6555BF72F93EF600600DB73E27BB9 utrudniony1
684,886,344 *46BDD1E9ECD1022EAF0705FE1589E06AEE781C7D utrueyov4
684,886,345 *46BCEDF742BB1B336CC7317AF21F6FE6B4CE7EED [email protected]
684,886,346 *46BE2C54CAE4802581BC228B0FF5F00D3B588AF0 Utsaadya
684,886,347 *46BD0E851CA7A8BF43A57C79D01220AD1320A414 utsagans5
684,886,348 *46BFED48DBAD3ECBB2B5BA1B62C9D0297CF00328 Utsanna6
684,886,349 *46B29CE7534159E3BA7CA9A8C7E25A4D3216AC25 utsav kuinkel
684,886,350 *46B87AB08409FBB4012566EEC2CFD23529D5D6F3 utskrivningsorder
684,886,351 *46BC4FFF6EBBBE78F8672B695F332BD7B5335911 utslettet7
684,886,352 *46BF1D740A5ABAF9616DEB1B5E567B8DA47392A0 Utsmayamaanah
684,886,353 *46BF1511FD72040E049D84376A52CDB11489B9E8 utstedelsesdag7
684,886,354 *46BD191BC2311B7A6A2994647C0AB2F37F9C82AC utstyrases
684,886,355 *46B2B15C858D11EEB9B90C7A0B29374E987A11B9 utsuraut1
684,886,356 *46BC6B77A9F401D5941D3F640677D5615AB966B7 utsuzawa9
684,886,357 *46B80A07E9849C027A18D3A9FC32A72F020C035F úttalan
684,886,358 *46BE58FC84BCF892CF1BCE3D72D33EB5D2DCD560 uttamkrishnamurthy
684,886,359 *46B23005C2B49D70A8FA74E96DCAAA17D2A18F98 uttavuus3
684,886,360 *46B1CD21C0B08556925DAE67966D3D99F0DB3741 uttedhav4
684,886,361 *46BA7F6B17A84650DACB92E745CE90595E2EE4EA utteessaed
684,886,362 *46BD40DBC859A6B624AD21D86991CDDAA69A320D utthaana2
684,886,363 *46B936D148DFF0BFE0D8488BC10022AC88F8BE34 utthalde2
684,886,364 *46BC49E87C132A07D04C061D44D94707F6B275B8 uttryckligen9
684,886,365 *46B40919BC174D391B12E9B306D474BBC6939625 utudodutu
684,886,366 *46B37BE1D6CA3017B44FDFDEBAE794FD0825FEEC utulifu
684,886,367 *46BFC19FDA1D69DE54C33F03CC58FD5E816934DD ututugawing
684,886,368 *46BE171933201C8E66CCF9045F11BF6182E748A7 utuy calibria
684,886,369 *46B48AC20AC9EF193C642A40F615A8DA540E0AC3 utvecklingskostnaden4
684,886,370 *46B46AF3429F2E356C381D1B37F93B330AF82F6D utvecklingstruppen
684,886,371 *46B04F0F2ED3E6D71AB4CAFB21AC57B5BC94C52D utvikleding
684,886,372 *46B5B500DE7067E75FFD8EF59C65B55728EA21AD Utworzono
684,886,373 *46B494BAFA82CA494980383BD6E271E41A6E32D0 u_U}
684,886,374 *46B52552726E67E3C59936D2C8B532FC1CFA7F03 [email protected]
684,886,375 *46B6B68571D13CA9EFFD2EAADE1680B5D1A29580 uu\\4
684,886,376 *46BFDDFCE895021806CD14E1BAC43D844C17A422 Uubeklagt
684,886,377 *46BE5160D4CB248DDCA4279318C68CDAF79F490B [email protected]
684,886,378 *46B6A1B620113B4A4DEBDB817272CF40046CE6D6 uucleanup4
684,886,379 *46B88133457BB76A5F22408EFE88739BC5C7F623 uucpnets9
684,886,380 *46BEE99C18473453485DADDAB5AA065135723748 Uucppcuu1
684,886,381 *46BC27E9FDED0271A66F34D30B3E762353931243 UUDELLEENRYHMITTAEMISEN
684,886,382 *46B7C145FBAF897550DD96474C7085A758AB97AB uudelleentaeyttaemiseen8
684,886,383 *46B1249E26D29C277D4B6E9676027615960EA64F Uudenkaarleppyn
684,886,384 *46BBD1565FB81B8ACA968DEC95116D1616E81F33 UUDENTYYPPISELL
684,886,385 *46BFA1CF1538B3B2D73F04E6F1D9522B06C819FD uudtalt2
684,886,386 *46B164429A8DA524915CA2062CFC70AC433B9DB1 uuganotgon
684,886,387 *46B66B83B359D63DC25D3709790A6D8EED135013 Uugfbsw1
684,886,388 *46B8A663E365BFD9E187F4423C02C035D3E16F2A [email protected]
684,886,389 *46B3E44C7F04EDBCD77C6FADBDDC4D8CD615C23A uuhcieb9
684,886,390 *46BF60A13D295BAF0A71CBCB28CF779B24DCFDAC Uuhcuon9
684,886,391 *46BCBE80B2B3A353434F1837F27CB4A7681341DB uuiodVuxTMiNhEzeHYvPsS
684,886,392 *46BF7632487472A02B7EC37DC2A8D4949361AFB8 uuiT
684,886,393 *46B9FA1DB750CA89FEA982A6A849A05697490412 uujiebxwv5
684,886,394 *46B38AF3DC1F585358D9526802EA0813227093E5 Uuknaris
684,886,395 *46BF738473846135BFE06AB4E8639305363D1F1E uulanpar8
684,886,396 *46B844D0D6EE2015EE269F5828AC335636CA994F [email protected]
684,886,397 *46B4521F87313DC956C4671FF9D6FC88E02ADFE5 uuNO
684,886,398 *46B0EB337C4C14B6B93628B3F36BF3A724815532 uunoavevfqjy8
684,886,399 *46BFC21BE5D6D6296996CEDA67C77EF22D3D70DC uupataan3
684,886,400 *46B92EC1754AB38B5B197356C0740A46347F8450 UU-POLICY
684,886,401 *46BF20A6A7EA6A1186443044A26CDEC69C30B627 UUPUENKIN
684,886,402 *46BA32CD39D826EB3D3E06C4A6EFE3274A309E97 [email protected]
684,886,403 *46BC2A9040081FBC285C1097A71B558E3C9BF84A uurautos4
684,886,404 *46B245B5B2A31F153A044277A64972153B442ECE UURDHVAGA
684,886,405 *46B4860991DE433535CD6F62D10F66E2FC43F601 uurimustesse
684,886,406 *46BD19351F3562123112380A981DF284DECE2544 uu{S
684,886,407 *46B1C813DC896F89809B5F90A84F5A031BB7525D uusetout3
684,886,408 *46B2375D90CA8F456D1C4ACD46A0E978416673E5 uushollandlane
684,886,409 *46B78FE6133B804D9E68EC0FCFA93D08F8C702D4 uusiaika&hamsteri&philcorpsgreatesthits
684,886,410 *46B857AAF96E9CD17856EDD2AE3851AA6BA202A6 uusintamista3
684,886,411 *46B327A3DEC4ACBA6F8442FF5CB80326461B0651 uuskaksi4
684,886,412 *46BB33D43ABACE423A0964B9F8A75DD484737A3F [email protected]
684,886,413 *46B42701892A5730D786BB1F8334A4E8FEAD1571 Uussuyj0
684,886,414 *46B0C98BB6C3832216C7CB373CA21BF404B99DCD uustatus0
684,886,415 *46BEDD1BE82DD876786F541D1DEAA6D2207587FA uustnas8
684,886,416 *46BCE6C66EE4D83ACFC9DF05323BB45274D59944 Uustnebbing
684,886,417 *46BE7F6945D378B980421D1653A55D8E11BE8569 uusvuosi6
684,886,418 *46BFF24580D16791B1CE8EE118D753888B5F3B9A [email protected]
684,886,419 *46B7C8AC53BFCFF9B94412F6ECFE1F10C4D7809F uutobswing
684,886,420 *46B4AABA3977D98F73E43494E69DA42862738124 uutukseted
684,886,421 *46B7CFAEBD262ECEF56F2D2725B5B6C5F7A6E4EF uUxo
684,886,422 *46BAA60205AA2252F09D923F6B771E560FF4DAF8 uuxpncqj
684,886,423 *46B03EE5D66D673D0583C8425B5FFF067FC4FDAF Uuygike1
684,886,424 *46BA25CCE487669C15BB9F8E4CB4194C25162D8A Uuytays9
684,886,425 *46B0087613FFCD149A4E01424AB0AADE1CEB9F9B uuytike1
684,886,426 *46BBDAB1D8A5C9A55A5FC2DF0EF38F3C8F779E1D Uuytners
684,886,427 *46B23428D90C639E5E42263C3485A053D9FCBC46 uuyyq
684,886,428 *46B3B776B18982DCAD0D10DEBFD8DE866467D6B0 uuzdyiculxchss7
684,886,429 *46B7919F5E4058007DAEA14D7A43EC297E69B92B u~^V
684,886,430 *46B425588AD009A07E918D00B8B8EE71F7CFA58B u:V+
684,886,431 *46B72725406F76E5F5101A03AEED58A1ACB69157 uV2x
684,886,432 *46BBE88C448CB3F05ACE09952E4BBCFF942B4AB7 [email protected]
684,886,433 *46BBCE0F770B8777F9210DF5F76BE7BCD1DF42AB Uvaersris
684,886,434 *46B7A02452CBFC910BA4FAB0A4D112A746B0078F uvakars
684,886,435 *46BD7ADE9E38B35C170FBC10C4F1D0BCBD2E0F41 uvaldebswed
684,886,436 *46B1DB3640AD522AC9E217294FEAB1B5B6EFE3CD uvaterep
684,886,437 *46B3608444932FACFAD63993CBBC35574F3A9D97 uvatesua
684,886,438 *46B6DCD7CD9537AEBC3243EB71DD776C11B6ED86 uvazeny7
684,886,439 *46B5D83898AB12C7DBFE6B0CB6480630AA2A51E3 uvazlivejsim7
684,886,440 *46B97F50E5B0EE7B448C557E02B67214DD013D67 uvazoval6
684,886,441 *46B3BA38BAC92BFBFF07F83BF08BFA2085CE2D90 uvb&
684,886,442 *46BAC2B9CCBEF7473ABF6A9B9C365D9DDEE6A20A uVC,
684,886,443 *46B2F7680342503FF485E7E797849A63E98375AD uVCQ
684,886,444 *46B62CC0A409A988CF264356EE74816D0ADA71DB uvD}
684,886,445 *46B50F20325E64EBBF7FB07489E57360B1A07DEF uvddcvqs61
684,886,446 *46B3C29809549131E8841AFE762D8B74E40866EC uv
684,886,447 *46BB42C4E6EE49A70B80AA360F0B4D8FD8F27517 uveliat2
684,886,448 *46B9ED87A1406908061CB399A5665CCE279A1642 uveliger9
684,886,449 *46BD659BF6ADAAB40FD90F84763079D87686DDD2 UVERK
684,886,450 *46B046B272E008035104F15369F92FA3F8438545 uvf 21 0
684,886,451 *46B6ABFBEBBAEA249AC6C32A4DA91A78BD53D8CE uvigxpjb
684,886,452 *46B2143A9576DCA3511FDA9F42577430BCB0240A uvi$n3lig
684,886,453 *46B8C2F93A47C7C48E2BEF7B0B51B89B55032BA5 uvirkelighed4
684,886,454 *46BFE9AF50A58E611EB6A741652B7C2D15D5AB6A uv&L
684,886,455 *46B8F1B83D96F02CC0295A0BBA4FC9278141DEFF uvlmcgja8sm6lnnyi9ckoyw
684,886,456 *46B9246729410EC5539AE511268D4DCE8E01DB49 UV{PNEDE
684,886,457 *46BB7463D7E1C4E2B393AD92D98645C0D9A913C8 [email protected]
684,886,458 *46BD425310F1CA89BEDB5541ECB911B2CAE8D150 u+VR
684,886,459 *46B197F5D0B6DFF0BAE75F31CCEB8D5C231AD887 u?Vr
684,886,460 *46B10C4824152A2AD21707745C266EEB63501DC3 uvrhouť
684,886,461 *46BEC0339C7EBF543815DDE974017533AC4503BB Uvridijas
684,886,462 *46BD60086533F1F28244257F0F256E3EF367A3C1 uvuraa
684,886,463 *46B3594C10829CB1B68260A2D3D7B3A49867DC0D UVWJBWL-T-JUTQ
684,886,464 *46B6F19488326F25CCB8F9F61C18A104BED4BD22 [email protected]
684,886,465 *46BE2E95706B8CE0157AA2065D68777B9F7520B3 uW^\
684,886,466 *46B1F77A35F1F858CE008310A1B11DA2AB161DC4 [email protected]\w
684,886,467 *46B096C249A59E413409ADF92407F2CA4172ADAF uW5T7VObmKtIbzBQxOQ9oCjhoEN8QG9p0jX25xyDEZH8MRJPZ5+GFb/mEhRoLp91
684,886,468 *46B491E46C23669FC641C515F6AF77B4249A27CF UW]aaa
684,886,469 *46B531DCA5A840EB6D07EDCD8095A0BA0DB8AB81 uwAGusAHoCo
684,886,470 *46BCDE5744062DC7B0E3A2BBCA00CF9BFDE84B98 uwaydahyvonne
684,886,471 *46B5B41E845426A6E2ACF26498DF7A8F5A6C5B30 uwa世界ウェルター級王座…1度獲得
684,886,472 *46BE7CA63E36BBA765ADBE4438434176E9237764 uwbrules
684,886,473 *46B92746CCE6F32B6A684F43319E2D85618C14DA uw`c
684,886,474 *46B5481B58B5A749176FD1936CEF578DF93F77B1 [email protected]
684,886,475 *46B709357B870848A3DF0A7603FF8D05BE28623D uwchlan1
684,886,476 *46BEBDFF69C17D3D53E4B041EF01DBDF210581DC uwcnkowpt8
684,886,477 *46B3C82C736B4199E86FA30CA77258E380DF1464 [email protected]
684,886,478 *46BBAE60F59D37E702A3BA3FE75480056BE9BD48 uwe achatz
684,886,479 *46BA6290A41DE0C77EC128AFBA9DA1EF66F455FC uwee jogja
684,886,480 *46B784884CA7773D27A980DDC9A31627C8654B8A Uwenthalve8
684,886,481 *46BEEAF71CB2BC66F19EFDC95D3A051A64C39733 U Who
684,886,482 *46B8657F24B5E269647BAE12BB722C2D25E00D4D uwieczniona2
684,886,483 *46B3BE93796C63EF6A5EC32F985165F8697E2A65 uwindex5
684,886,484 *46B16436AC2E9E7B69622F608BC1360049CFE773 uwixw
684,886,485 *46B4E8D23BEEB3CA9FEB24BC76E4536E97195157 u(wj
684,886,486 *46B4DFF172C2DC1FB27E6FCDCC1FBA3ED7139C14 [email protected]
684,886,487 *46B510A4B58CB7344C9FF93D7F50EB7AC01B852A uwmannened
684,886,488 *46B3BECE7D6A7BB765E05FC1D303D58BE256DCA1 UwmYBNO65
684,886,489 *46B4D864E28451A8B1A18CC68CD094015EAD4D5E uwohnung7
684,886,490 *46B385CFB16B45D61FBAFA8D7DBBEB350C46B620 u write the rules (solarstone remix & original)
684,886,491 *46B36803C0B35DAB5E6453BD6DE39161FEEFC173 uWRK
684,886,492 *46B894587BFF2329DBCEDE268C27C746EF00377A uwsp98
684,886,493 *46BB40E54FFC92B0A4B1A15ADB13EDF4A6E3364D uw-thankyouwhy
684,886,494 *46B05F011A212638303C65F86D3A80A910071028 u[Wv
684,886,495 *46BE78C043FADA457107BA253E41382B936F682F uw>W
684,886,496 *46B6EF735BDF6447D6912242E9688E81871069F9 uX**
684,886,497 *46BE578488648ABB250F623E46D6DD28BB7055CC ux>?
684,886,498 *46BA19138DEFD3679C16D26AC68DB5FF68A160E6 ux130
684,886,499 *46B969E9DCEB95707809DA8DD26052C9C0163F06 UXA48TAT
684,886,500 *46B9519831D3941BCBF8632D8652D594E6F21FEC UXAGS
684,886,501 *46BFC727C261270F417C2513164720289D06A3D8 uxbbntbxbxelrw2
684,886,502 *46BFC3DCAE67D157D25986399F8EAD1EA1A6CD09 uXGD
684,886,503 *46B4D03792130C11641738331463E25FA66AD49D [email protected]
684,886,504 *46BEBDAAD72C86EADDA6ACA65A796310C8890895 uxiltlvgx1
684,886,505 *46BA7D2C328704D2E547D5BB8FF8A413D06D2BA1 uXjD
684,886,506 *46BE7312EFC8C16D36F9FAC3B9B0CCBC961E9771 Uxjwaub7
684,886,507 *46BA79B601FA777A75B6C6D2EEA49B61763B5D82 uXK(
684,886,508 *46BF73823CA7B7847B2C504220F9128B3BF35644 uxK~
684,886,509 *46BC9D962A0E868CACB6A74D2A686B4CC51B0169 uxn91k5
684,886,510 *46B46132BDAAC174FDF1D9E4E2D0906A1A69BB48 uxnelqhkk
684,886,511 *46BDF7C72ED7B5F705B01284CD29211EB7B25A2D uxorilocality1
684,886,512 *46B837E009745C9863B34FE867CF0F877D85CFC1 uxp!
684,886,513 *46BB2303F1374EAF8E86A8EB17CBCB85FCCF67AD uxpc
684,886,514 *46B5DE326517221A86DDC0ECD284B61D98C635A6 [email protected]
684,886,515 *46BD88F4C057322CA1DEAD086C77F706AA01A332 [email protected]
684,886,516 *46BA5BA5B8D89249CDECD428E37FA18494754668 uXxeSQZImU
684,886,517 *46B006D447D8DEE0EA76B0003B9A1C21E5D41786 [email protected]
684,886,518 *46B32DBD0534B49AEA0286FCA99567900EA22C95 u}Y]
684,886,519 *46BD3F3A8DCE806DCF5D8BA944C48F14172903B5 uY\,
684,886,520 *46B7B87E3C916BFFEE1499F70B7B0C96F6DEFAEE [email protected]:
684,886,521 *46B1B07A739BEED1B4A574D35682E90BE7E957E3 u#y_
684,886,522 *46BD8C938B4DC453E9D3EDEE21B778D5401F546C uY3X
684,886,523 *46B2E408DEFE0904FEDD7F8D63108D067E1EDD97 uY6hAxVMoN
684,886,524 *46BF1BDB9EAAD88328A6B78C80F9F1D1D0752EEB 'uYaaa
684,886,525 *46B58B054DE3C1A1B6C64BAB82C055BB39961768 uybwvcm85
684,886,526 *46B3FE365883A469CA1790A4E85DE149C4B7346F [email protected]
684,886,527 *46B2F93AA622ED81550041E83A93031F14B8F484 uY>E
684,886,528 *46BE1AC6881841450C1EF83D59671791A7E5AE48 uY%E
684,886,529 *46B0A8875E4DA1F47E8705EED6DD0DFA0DBD2E8F uy?E
684,886,530 *46BBEABCF5A3A61394CEAE9015BBD42127B14072 uyenutaming
684,886,531 *46BF9C69E0ECE909AE60FD86CEBB58FB47FAE200 uYExiJeP
684,886,532 *46B897F7BBA33BF94F1C7F3FB5AA0777BE4203DE uyeyamabsw6
684,886,533 *46B143985BC3695B5ACA545BFBC13B49C3E1BA81 uygdepubbing
684,886,534 *46B5D0DA42BD26D6516091F77A4161072CF2329A uygulanamayacağı
684,886,535 *46B01931A391E5F3F93C2ED0D8D356CC186A0582 uygulananı
684,886,536 *46B9C14269FA035B10710C8441AD26BE2DE02C71 uyjiimak0
684,886,537 *46B2F6C54517B03299B5F0B01BA2ADCCF91EBC9F UYKIUHU7
684,886,538 *46B96EB2ABAFA195BBA73F283C250C4060F54018 UYMKT
684,886,539 *46BFF376B600A1E90607EBD51CE557F06D950B9E Uyoaaa
684,886,540 *46B274B9AF9E9DBCA8D6DE3C9F001F7D02B97D28 uypZ
684,886,541 *46B992CFBA5CCB62FB749927C3903A2937C1BFDB uysuoyz1
684,886,542 *46B7AA47DD06CF04F15D4118D792E7BD118F4373 uytbjwgkaxzmo
684,886,543 *46B45415CF8BA7A6D15913F2AAACAB95CC45BCB6 uY}z
684,886,544 *46BEE83D9CEA675678284034028E06AA71953F6D uY#z
684,886,545 *46B8D111D4F1FC26C777C59FC47CBDEE082C9FF2 UZ7
684,886,546 *46BD8E39E6816582C85C2848F7431C2488DF01E5 uZA9
684,886,547 *46B8F52A403FC23045CF15D8DA4419CFB2890C03 [email protected]
684,886,548 *46B13836047C5366BBC963F1A81D7F3999CD681A [email protected]
684,886,549 *46BDD37CCCA39188AF983C9AF3C1100557C1B708 uzajmim0
684,886,550 *46B5A64AB5C72F43278221438A4F48F81E608C12 Uzamknete
684,886,551 *46BDCAE167ACED7D038C4BC9310A95B786EBD774 [email protected]
684,886,552 *46BAB1A8413B661BE892269A62D50E7991C51E9D uzar ahsan
684,886,553 *46B425E23DEDA26DCA907AA0BCEFB0A03354507F uzarxyvu6i0c
684,886,554 *46B535AA721CCB3B1751ACF2B708904F7233484F uzastopan7
684,886,555 *46B9FCD1D4BB8A6CE9BA3D17CAAE0CA39592797D uzavenmi5
684,886,556 *46B1BBD7109A5FBD6843ED19BDAE72766F99EDC0 Uzavírala
684,886,557 *46B854F3FC34F6D7B5F4EAB2ED486734C806E349 uzedareg8
684,886,558 *46B556326605973108C1B0D3E5EC5E81C98AE37A [email protected]
684,886,559 *46B00A89CB5722EC981D0B90C122FE01B1823328 üzefiyatlar
684,886,560 *46B4C56B6ACB6F75E17CB04ED11C5D74D7EB0106 Uzeiras
684,886,561 *46B26157079383CF4666BB6E9F4F64227E2ADB86 UZIVANEHO
684,886,562 *46BAF815BECE558732237342E54BA3EE10069F45 uzkfbxahposbu8
684,886,563 *46B9E2C45A719CF089DE6565C2198F4E117602B8 uz&l
684,886,564 *46BD860A777401E1CF5FA452555CDF3C79A7E4AC uzma owais
684,886,565 *46BE5919ABAE46041A54518FF1A215C86F801776 uzMG
684,886,566 *46B76409ED99946D6010CAEA16B70EA4734660BA uzn.
684,886,567 *46B0798D63872DEA25D7D6E3A29A01B2D5757E6C Uznesenas
684,886,568 *46B3B7FCA0D61636A5D0D904BEA689876B84782F uzneziltamieh
684,886,569 *46B343C2B53063BB6F6722325E702E5CFFA68C0A uzoekwechibuzo
684,886,570 *46B0388005E0AC0174552B8562498012737E6918 uzoma okechukwu raymond
684,886,571 *46B3D24B6DB7FEE3508EE9C51B7F466A08EF1A81 uzoma prince zoom abanonu
684,886,572 *46B10DE37281E4B9837D1706C55E0CDD7A98D48D uZPk
684,886,573 *46B11495AF99696E3E04D75B5DC96A8DCA1D24D5 [email protected]
684,886,574 *46B00A00999597B637AE9B526665FDCE06BC7518 Uzratioed
684,886,575 *46B73C7B0CF960A7938BE2D97F6401891E7F6ABF uzrujanijima3
684,886,576 *46B930D7DCF6FA4E5BFB37A5BD89ABEB00ED051D uzs0ad
684,886,577 *46BCC355104F3737DBB69714B4702A188311C795 uztmasegging
684,886,578 *46BB1EDBA9FFA14B89AE6BFD11702D0326873F73 UZUI-EKI
684,886,579 *46B101677B096583C31E8F5F4EDF9124A05742FE [email protected]
684,886,580 *46B3DDB2AD534C430EBA0A76465D4148D7B830BF UZUMAKI66
684,886,581 *46B47F4E615CC496AFFCC9012AB88C6003123D39 uzumaki fayyadh
684,886,582 *46B29822406AC62257E789596BA3127AB5EFD818 užuniversitetinė
684,886,583 *46BE8E48DC79968198F4579D6BDA92D5C22FE285 uzupelnienia9
684,886,584 *46BE4B2F92DD986EE5B40529C8BC5659AE95AC82 uzV&
684,886,585 *46B0C162DBB469598C34D95626B8A116F14C9B3B uzvitlah7
684,886,586 *46B59B95DF59C432828E1A1456C7AD4AB8CE18BA Uzvratom4
684,886,587 *46B693DC2166FB4DA02FD4CA904DFA41A7B2235D UZVRPOLJILA
684,886,588 *46B91D5A973350CFC04379C51A01F58E81CCC256 uzzolana8
684,886,589 *46BD672942A9654950B3D4C02C2EFF0D7BC71E30 マレーシア:U(全年齢対象、一部のシーンをカット)
684,886,590 *46BCD397C0748BDE8186183B07F7F7E1DCCFA901 u字工事が人気cmソング大追跡
684,886,591 *46B6FB5F3636B0952AFA80B082E637D59929CD80 <v<
684,886,592 *46B68B40790AAFBF9BA770DF0A82DF20297B8408 v^}
684,886,593 *46B215B7D7FE14AE2C5F4838DD431470686FD7BC v=[#
684,886,594 *46B6E4F8D3331131C67454DDBA7E735CC82C8E82 v>/<
684,886,595 *46B81BC4BC208C4DC9EF352C90F18B3C4A0445E6 v?\,
684,886,596 *46B162100E141B8AC1956881506BD28B2DBF3C87 v&^)
684,886,597 *46BF129FF7F16179D48CDFF2A645655646C49B17 v&'{
684,886,598 *46B2DAD30AEED1F2C931A78D2CD207D820D48D93 v;?0
684,886,599 *46BF71D71E6A5F217FC50B38D7C002805834437A v0#>
684,886,600 *46B502327929C211E4D0EA43D24C8CAD347E372C v000159
684,886,601 *46B03FDE669EA3D10B82285A139795313FE01232 V007007
684,886,602 *46B27F367260331B8EB68D9F09E85B1EED6FA0F7 V01003
684,886,603 *46B53B9343A7726F8B714DD7690A039B91CA8806 v0177m4kn6
684,886,604 *46B7CB1B6CE48D281398D4E6F251ACC7A6C58605 v01c3p4rt
684,886,605 *46B51C1418AA665B4DDAFF3EFDC44E6ED639ECDD [email protected]+i1e5
684,886,606 *46B285FD831BF2FB02344983B03B6B2223B7E10D V03K0YRA6G2F85X66834E08
684,886,607 *46B70E2DA1DF64D29605F0A5C107FA935BE50657 v040556
684,886,608 *46B48FF60AA5639A20DC227B8FE759EBE20BB8A1 [email protected]
684,886,609 *46BFDD327243BFE68D1416FF1EB4231403A83730 v06n
684,886,610 *46BBFFD49F785C58D0313B224DEC6A450F83D7D6 v098501632
684,886,611 *46B17ECF5A1A066042FC4D4CDBA5AD015ECD6B0F :V0A
684,886,612 *46B7031B4998DED27B6378C8A209FA6DC4B6CFE9 v0c4l1535
684,886,613 *46B5575092EC9E9837551EC4FDCD4FC850026437 v0c4v15t1qu3
684,886,614 *46BC2E339C2541C5970C632FEC585AD1B0D1E1F0 V0cal!7!35
684,886,615 *46B0AC787900DBB066EE92022A252A2D494C22CB v0cf3r0usly
684,886,616 *46B184E83F565A5A0575381D713CC1B652920038 V0c!f3r4+3s
684,886,617 *46BFC745F64E65FA1E05CCF808AD4AB23CF5D58B v0DJ
684,886,618 *46B851A055CD3BE3EC18970C5FE0A9641F9B9839 v0l4b4nt
684,886,619 *46B9F6F67867DEF5DA5C36282AE4E21AC156BD84 v0lly1ng
684,886,620 *46BC7AB95FB66B814B96944145F4A71F6E400020 V0lt3n
684,886,621 *46B9CF8DE6FB4AB4E0F9A765E9EB29125C21B6EA v0luble-t
684,886,622 *46BCA0B56849C80EF5DE1EFD312C42A9BA5497F2 v0nNemizez
684,886,623 *46B30BED49CA50F87BBECCF7B2B41800FA67D0C0 v101158
684,886,624 *46B0C4B74F4AC1E2761B84D2B972F2B5AA42CF37 v102166
684,886,625 *46BEE9C69EC06EFE9AB4B08D37610B831B3DB69C v103270
684,886,626 *46B4D1104DCE609B95EB603E8E4A135AC8DF396F v104303
684,886,627 *46BDD69C10A73AA1E9D07C66369E4E9785930D17 v105268
684,886,628 *46B4951FC1729866D59FA6857EC01CA08CDA5F34 v106778
684,886,629 *46BB34899A28F0440214F406DF1567777ED70CCB v110877
684,886,630 *46BB49D301F2C4667D361593A932C211A2215F44 V!113!nag3
684,886,631 *46B878031BF674A9EA43079A67BAF59AAD11E90B v11974
684,886,632 *46BBBC7C15AB4A3099FD427FA05530EB3147C327 v126219
684,886,633 *46B50102F897B7E01EE7C401C2A47451F8DC0363 v127504
684,886,634 *46B9DDE6123DD22477161B82FE6BC274A7DCE3D9 v132089
684,886,635 *46B5B79AE5892A8A96255A04125B07255781FA05 v137990
684,886,636 *46B09E701258FD5E9626ED976052E75312B58111 v138088
684,886,637 *46BB86EE96B5B3CB6141CC5DC6D52A0BED4AA2B7 v141196
684,886,638 *46B9684CA1C429371E6EB5646AB1B073863D6C88 V143420
684,886,639 *46BA166F3D215BBBA437A38E3B632DB24078B654 v147678
684,886,640 *46BE3D8A7BCC831F104B376E10D75DEC97FCFC89 v151021
684,886,641 *46B86FAAEC86CA69C398E120033761F61760B7B9 v157107
684,886,642 *46B3C071405DE22FA97FED866647B98AA0AEAB09 v158861
684,886,643 *46B3A1200C93C3C8C561846AA7E7A779EE24E54C v-16
684,886,644 *46BB44E550F24E1219FA5FC89817B7E098456170 v161234
684,886,645 *46B47532EF33BA8B1F560FE0C50E4CE104651EF4 v16607
684,886,646 *46B765E9A34A0F4CE9AEAC5B7CAA36F7F0498E5A v166808
684,886,647 *46BFB95EEDE415687A54B469251FFE70BF854207 v170047
684,886,648 *46BA7B63C10BE016E5C2313DCB7058EECA775EEF [email protected]
684,886,649 *46BD1A8C7B35FFC225FC41B9378C48F7C374B212 v171427
684,886,650 *46BF12D75390CCF66CEB1E025EF81144C9B3180F v17333
684,886,651 *46BF1EF160988D08C4AB680D6179B994456CB5D0 V18HomeLinkPl
684,886,652 *46BAD6062A1C40AD963EC53ACB01C66CA723B0E2 v19920824
684,886,653 *46BCAF055232D79AAE5BAE49B7B347A5488F9211 v19ATz6pvhOdtk2m
684,886,654 *46B8AAFB3E270138079EFBAD64E3781C14854433 [email protected]
684,886,655 *46B551B220C79D20D5F65C69630EDF9855939E5C v^1k
684,886,656 *46BC5DD84A01C200B23AA17691C8D0F2CAD4956A [email protected]
684,886,657 *46BCA962DBEE30E94E488947BE9F4F0F33C528EA v1s4l1z4710ns
684,886,658 *46BB0E4FCFA8E6F6CB489E216D77439F5812C59B v1tell1ferous
684,886,659 *46B066FD8DA9839C7BF6B9414EB130A537DC47A3 v1v3mlh05
684,886,660 *46B643BB57939BD51364E16E0911BD7045B7AB4F [email protected]
684,886,661 *46BC4B0AD5F421797B3739CE571BD4CA283061EE レーベル:V2レコード
684,886,662 *46B33A3DBB6E817F13DA610E202F104294BF5BBE v??2
684,886,663 *46B66C1FAAA6A96F5F282F56D566628D7DACDAFF v221272
684,886,664 *46B04387B389F112B62A646D667D3234DBB05D76 v.2.2.15
684,886,665 *46BDE9B4E578F74449354E35BA6F9D9D5F6C1FB2 v231002
684,886,666 *46B88B314266F2293063B66AAAE9B4331FA85839 v2dZ
684,886,667 *46B8B435EFFE5FAB79C09244A7F377E996974DFD v2j1
684,886,668 *46B147A73433F70830C37FEDC60D97149C35DFAC v2TB
684,886,669 *46B40011A4DF528115B72C9DCA53AECF085C5C12 V2V6EF9N67YVY0LA2NYC5BLE
684,886,670 *46BF68DB579C7CCCFE5C752C7BBA2D29D8FDA2FB v300552182
684,886,671 *46BD130E924ED1EDD34D3F21DD7109F0F3CB7C2D v3020
684,886,672 *46B5EB39AC4A52D1268864BCB19C5185D8780D5E v320982159
684,886,673 *46B69BC07779A10DFFF67BDC4926632D9AF5EA2C v3%4
684,886,674 *46B6B8D8E504A0F46BA821A1F1603C8354CDDFC8 [email protected]
684,886,675 *46BC8F8E284F19A8F9E53C53CFC4DC6064830BFD v3;9
684,886,676 *46B565BC31C61C8D449C4FA9E3C0C0F3D77BEA59 [email protected]$3c+0mizing
684,886,677 *46BEBEF4F4FEFF0CE40911D0E8535AF6E141300B [email protected]
684,886,678 *46BCD04756EC139A7772196E06F0801C63A955D5 [email protected]@n5
684,886,679 *46BB915D5DC35449722650F2483E8E02EE744AB0 v3jk4nts
684,886,680 *46BEF95EB08F11FDCE9F914E1B2919DA60C5381E v3n3t14n5ch00l
684,886,681 *46B7F6DBFD3D068168ACE9EA04BBAE258520948B v3ntil4nt
684,886,682 *46BF1F8354D21CA7CC6B747D757D0AB39A35A1FD [email protected]
684,886,683 *46B2F8A5A7224AC3CBA5B8ADC272E0C6675504CC v3r3n7hs4s7c411y
684,886,684 *46BB78C5E2FEFAFCF1306B1F0E63053E45F8A8FD V3R5!C13
684,886,685 *46B9B37F9937DD38DF886AA34A7D1B41DFA7B5D9 V3rb1d$
684,886,686 *46BE1D502E1E407E8324EF48A9DD07D78DCE0A24 v3rd0y
684,886,687 *46BDC55F308E0B7824CCA3DBA1B48B8A3BED4066 v3rho3d
684,886,688 *46B2249BC2D2A7292BF2C4A9B0A615189824722E v3rl4553n
684,886,689 *46B42EEEB95F49DF100B14DF07FB91665647F290 v3rs4v3rim
684,886,690 *46B6B7BE75FDCDAEE8BBF26435E336A7BA8190EB [email protected]
684,886,691 *46B093EEFF54D3A985A5E3DF5FFA2C708BDDED54 v3ug14ir3
684,886,692 *46BFB798EE7B7FB9D6FE78EF7703FB30EA8D3758 [email protected]
684,886,693 *46B7CC22A8C10DBAE98EAAD783D4288B206B7E5C V3xa+!on5
684,886,694 *46B8AB6531C285BA6582E581DA76C3A0090AA34E [email protected]
684,886,695 *46B8AA7EB0BA330764E97B774A409D7585E1B43D v4068drncwmfg
684,886,696 *46BAD413CE4CF17C4812EFB1817A54AD8245261F v41is3fu1
684,886,697 *46B852F3A761D8D7036E473157DC6559483F27E8 v43vvgxW
684,886,698 *46BFDE3343887AC2AB71C533362F53BAE648B539 v44183
684,886,699 *46B584B0BE85A9599B80F8BA48F1F55F49A7B8F3 v45086
684,886,700 *46B3A63DA998AD8105228AB7C066399067C40A12 V45ect0m!e5
684,886,701 *46B137DC78B054EC7AA3B46699FA506C7D6390B1 v49756
684,886,702 *46B5ECA623004442A1E259BED774FDBC4C84632B v4d3rsk4nt
684,886,703 *46B6528EABF9FF7B7CCFB05F7D874276434DB7CD V4L3NCI45
684,886,704 *46BDF0CE0C7D21598D86F536207EE21073457E0E v4lid0
684,886,705 *46B0673479F182F9C454C9CDB0F13CDD05FB1796 v4lt4r
684,886,706 *46BFDFDB775CE8DE0E68C6006E39AF9A9E27E84D V4!N3$+
684,886,707 *46BD64ED805753C7DA4DBE802EC3B8CDEE9FF1B0 v4nd3rm01
684,886,708 *46BBB857CCF8893BD6A7B72657635526DA48E446 v4nd3rv33n
684,886,709 *46B4A3D8D4C7CB3E3E5214AA056D92AAEF732359 V4nfo$$
684,886,710 *46B68041229D785182DED0ED00905C58CBD31859 v4nklin
684,886,711 *46B07CF6D92445041A18124D8528B3C3664FBFBF V4p0riest
684,886,712 *46B8DB789FBC69F24FFF38977D3C1BB21678727F V4RIEG4+I0N5
684,886,713 *46B84253E2055C44A13FEBA36FF17F11E8655D87 v4rr450
684,886,714 *46B159849C37F58450DEC577C08695B08C0005DA V4rsle
684,886,715 *46B1DD19ADD101E67751B6A8EF14E655FDFB43AC v51982
684,886,716 *46B0579DB88B15208BB5E1D191F68A3EB0B638D4 [email protected]
684,886,717 *46B9F1A116590CF321BA302DBB7BBBFE57984E28 v5651
684,886,718 *46B326A1516D09EBE25B0AC333B9603A05E57DDC v57574
684,886,719 *46BD674FD3539B85FAFE141ACA9DC8AC80FAEFB4 v5;g
684,886,720 *46BDA2A4D9E98E621DB349BBFF4793D633BE9F34 v5OmAAAACAAJ
684,886,721 *46B34BC2F933C3725BE5BE14C2B4B2DAE1DC2965 [email protected]!ZER
684,886,722 *46B27C758903F3632D1EAC0FB602DA0071D240D8 v6<$
684,886,723 *46B505A055894C3D16EBF49E39935D0C8E415219 v628811
684,886,724 *46BA5D7AA9643DA2F3DF71CC0F04EA3C4AEA8544 V62d6t7oh74d
684,886,725 *46BB215F79A166CC0B0877FE691DE86175385443 v6666666666
684,886,726 *46BE3DF50CE259342A059177F219F7BE8E630124 v6750583
684,886,727 *46B384A595365B2AFFE4008C9F60517814CD0807 v68227
684,886,728 *46BA66A634A0735B16D6B9EB805A2DCF0FCA3074 v}69
684,886,729 *46B15230FA6CAE4A37025091920F7DFE38DEA34D v69S
684,886,730 *46B5D19D31656038D6A5BA1BA714D5D870B33816 v6|G
684,886,731 *46B0A1F385F10D4549E69C9132F775EA79E243A6 V6maxx
684,886,732 *46B6D8CEED852E62F988B42FC983ADC8D9911B3E v6nT
684,886,733 *46B54BCD86B06C83C055CA8B3EB7BEC63362CF15 v\~7
684,886,734 *46BC8806A09F097D307489A40D79F7524AFE3B9A v7+-
684,886,735 *46BA02F7B4044F0C65E0A72EDDE8BA05AA184917 v74p
684,886,736 *46B7B69D9ACC9D3BA24D478940EEDEBCEED90B12 v789147321
684,886,737 *46BD7C01D9B7E1AEA658C5142E24C83EAA597717 v7)M
684,886,738 *46B109725C3EC3178B4BDCFAC783F8796558558F v7Qu
684,886,739 *46BB46598F241E1145B42FBB7D18297ED2D29677 v7W3
684,886,740 *46B7D278788D0C05D32FCDB52ECF6296B5802784 v[\8
684,886,741 *46B6CF7C8290A0388C5C1F09E65C6E0797C5EDAB v8)!
684,886,742 *46BAEEA671077FFF10D2A90583B4D0D76F79D078 v83283
684,886,743 *46B59E6903DC718517CA5E87E58F134C074D3D8B v8/7
684,886,744 *46B56E5C47C376F593779B18F08E7B66C202B1DC v8x2
684,886,745 *46B2AB9AAFA7935AE23C29CD495704B09F4C2ACB v8}y
684,886,746 *46BA4D397FE94CB41C2EAD2244D301AC88671629 v9|"
684,886,747 *46B7E52D71ED4C992E4C14A3BA9A69CA5659E393 v9!!
684,886,748 *46BB7DEFA332F4E6C7AD17CE05E0022CF2245AE6 v9(^
684,886,749 *46B06528E01010519CD5F7A9F14967F48325FC72 v94236
684,886,750 *46BF94BDD782AF48035A804236A7C2B0215AA022 v94771
684,886,751 *46B3BEE7EFF64C26D7C357B48F169B788FA5FF4D v9963
684,886,752 *46BDCBBB175304FF5DB8641010D9598D2E6D5423 v99825
684,886,753 *46BDAC87525FDC65B4F4BA6BF447A394EC288D29 v9M|
684,886,754 *46B21291C55B769F600B52386391696BB9E05D19 v"9y
684,886,755 *46B452D9D068DA368A307F8586FE08800DB83915 vA[!
684,886,756 *46B1ADEB81A44422456B26104A58F88AEA94D1FF Va13nc3s
684,886,757 *46BC258759855F5620C31E6B5F5C696750F8FFD4 VA160
684,886,758 *46BC87AF8660C39B40EB9007CFB942E042CE7090 VA5j8
684,886,759 *46B37501787162278ED063304A7308EF3273925F V!A8!1!+!35
684,886,760 *46BE458F96E1AD6DC487B2D19EBD4C7533D86C2A v(;aa
684,886,761 *46B39E29D1688EDFC9572D386C1F809E9BF3422D VA;aa
684,886,762 *46BBBC5A4DCFCE1CF9C75369D21CA60D16AD3D8C
684,886,763 *46B00F5A54A01029153A289133B5205CEBB1DF27 vaadeldut
684,886,764 *46BD17F56F0F87FBB7D1A9CBD57D563DF4B795C0 VAAGABON
684,886,765 *46B16366C9CAA0D0DEF42DC72F9393792CDB037E vaagasya
684,886,766 *46BC159972235176F8CC198426D5A0EABCA9DE87 Vaagede7
684,886,767 *46BF051484C327B7C9FB924D07BBAEDE878A9122 vaaguraasu3
684,886,768 *46B51CE4B0E9C6B3FCF963E5C26333B4F1E18490 vaahiniimed
684,886,769 *46BAFC3A61AAD2588B3C6D76BCB8BADC99570418 vaahterasting
684,886,770 *46B7F5F65E040106B52D11109E00E09192D5BDE6 vaahtosammutinkohtaukset6
684,886,771 *46B5F27317C75D78CF8D0F7F8D22D5A90E6637CA vaajwrv4
684,886,772 *46B8A96ED82A699C571BC791508B90ABB6BAAB4F Vaaleanpunaisethuoneet
684,886,773 *46B3FEB6D757671323D340DE0D79BFB70F6F9BA3 vaalheid1
684,886,774 *46BAAF72860F9BFB5DF2F6DE5FBBF34FF3872967 vaalihuoneistoihin6
684,886,775 *46BE7F3DF2234D8A0739DF5FF602991FB77D9A00 vaalilinkki
684,886,776 *46B5B49A25DF0BC81C1826E9F3E8C0360C74D4CB vaalilupauksia6
684,886,777 *46B38EA12A7F9AF043174232D87D80F83ADBD644 vaalituloksissa3
684,886,778 *46B7AD8909FCB3C528361C3A86523141051372CC vaanaraihed
684,886,779 *46B137EEF7C00489294996DC63E2BF0180EC066A Vaarannu9
684,886,780 *46B993226F966C4CBAEA7059E166605FEADA5696 vaarayishhyating
684,886,781 *46BC96C742F682AEE3653E5DDEC4519315C46C08 vaartens7
684,886,782 *46B640BDFB95F0FBC6641204CD53E9DEADC5F1CC väärtõlgendustest
684,886,783 *46B0D4FF3F16B2F8A20AF3D5A314E06F921C49F0 vaarweg1
684,886,784 *46B3FC5AD8CE28FD7D632EE653DA199BBE84B16F vaateestaan
684,886,785 *46B2E9CE75FB7410E0BC72756AA155A60DC38E6F vaateide8
684,886,786 *46BB00B80CC566B52928818805E6954B61AE73EC vaateteollisuus
684,886,787 *46BD983D3159EBB4DDA9348F5A934239A1183847 vaatetusvienti8
684,886,788 *46B1CD75EB4F24E22034A4B4000F71EECD15BF6C vaavasti5
684,886,789 *46BB3A44BAD0E25AE6E4D4F2B4C8D8E404E1DCCC vabalių̃
684,886,790 *46B2F878A65592195B30693EAD8986CFD88CF109 vabhav pathak
684,886,791 *46BC0822F64432FDBE25AA04616FF3CD5F3B9380 vacancieS
684,886,792 *46BA3BC9E4C10CE9051E0A5C4A2BDF7310588764 Vacaran7
684,886,793 *46B73B8ACE06A2B7761CFCD02C7D8192E9902ECC vacavillebsw7
684,886,794 *46B13171C033E1AE38401321B519B35B9144A4C4 VACCINATEUR9
684,886,795 *46B011F89453A43E4841E69046744385497F79AE vaccinerA
684,886,796 *46BD645C92375AFD2575D8DCE88CDB82172C9D05 vacciners1
684,886,797 *46B004991C266FD48CF9C9A7DF039C73ECC31CF8 vaccines34
684,886,798 *46B744B5731AE4071D275C8B63B5D4C78866E563 vacheron constantin
684,886,799 *46B2DB72FEAA617F6E38F491BFF05554C4301228 vachter3
684,886,800 *46BEAE22AD1FA2787937C27D72AAF9FCCCDB175D Vaciantes
684,886,801 *46B1D745B241458A43E94EB2DA79D4C89EA6742E Vacilado
684,886,802 *46BDF1DDE53EC5726A3A858033CA4AB044788B47 VACILLATINGLY0
684,886,803 *46B9FD96DE7E56DF84975B64FE8A304AE3DBBAA5 Vacillator1
684,886,804 *46BF2D03FA9E02A7D884C1A5FFF6FD5C365445EB Vacillava4
684,886,805 *46B8AC58D76E7046761DBC0EE3B66DB5B0086F96 vacinarlhes1
684,886,806 *46B0F88EEF616F836E910F21E709EE350CE35651 vaciovasing
684,886,807 *46BB5291B7BEAA1F4E8234EB1CC27E6767BFDBF3 vacoavacoa3
684,886,808 *46BFE9E683FEA24F746F4660FED32259A2F41336 Vacu0lati
684,886,809 *46BE18EF1EC0AA023F9A7134ED028DD5AAC5F68B VA$CULAR!+!E$
684,886,810 *46BC8EA514C2595052EF7D746B9B8534F4459DBD vāḍabeya
684,886,811 *46B6612DA7F905CF70F01B24381F3733B20A17AB Vadaesha7
684,886,812 *46B15CA71807687E01E5533188A69FEACAEB1ED8 vada jain
684,886,813 *46B90263E52C083543A1E999C35173F340066474 vadali prakash
684,886,814 *46B0838A74CCEDE86BC08C844D71A83C8EF4E857 VADAR'S
684,886,815 *46B970D53C99F1B4B82069B0B2F2C19263153429 vadato-vyaghyat
684,886,816 *46BBE808EE04012CB9843DFF479EDDF0EE360218 vadder-abraham.com
684,886,817 *46BE05AC5CE4ED16625B4839AFE56D3CC3C0A4FA VADER2008
684,886,818 *46B39F1B07FCE74A7FEBCC9638D1E27DABC1ED7F Vader666666
684,886,819 *46BD3DFA90E9D552504DAFBB0892ED6942FF8F78 vaderharvey5
684,886,820 *46BD8FB1B0A6079D23C4E71F9ECA84B313FF7ABE vaderjunebugs
684,886,821 *46B4EAEFA404B94B6963C24A8C27329E846A32B7 vaderkiller1
684,886,822 *46BC6333265F024DB86D6A5B4446E4F5175690A3 Vaderlandsgezinder.
684,886,823 *46BCBB657922ED554CFB4226F716D4C22EB57EBF vaderlogical1
684,886,824 *46B9F3AA65DAC64401D25AD58015292124A029FD vaderlogical8
684,886,825 *46BE36C116BAD785A39AE00A09A463267CD05260 vadermichelle3
684,886,826 *46B572697FF7C3206017ACC3217E42C750FE27A5 vaderpicard0
684,886,827 *46BA0A44911B92B5A8D1159B88C593D4C27DE6D3 VADERSAVAGE
684,886,828 *46B204042E14D71EEECD3CA6DE30FE6EB70D6A80 vadertoday6
684,886,829 *46B915AC8B390AD906B828128BF0A7CCB7701171 vadervirginia4
684,886,830 *46B6792F5D46E5D1C501759913222F1909929BDC Vadgama5
684,886,831 *46B49FA08FBEA3EF9371BCC6BA50E55313507EA2 vadhuuhed
684,886,832 *46BD490873536376A75EB1166786FE86FE82B681 Vadhyaa6
684,886,833 *46B615DEA8E3553644A7F6D0E385F49FA3D2381A Vadhyaahing
684,886,834 *46BE3442F3BD2702F9DD0388312AA2413D1E2B33 vadim valdman
684,886,835 *46BD47E43C7D7297BDFB1C9B237ED733EB0DF6A5 vadishyasi1
684,886,836 *46BD7F2AE3673DFBE7557D500CC2E88C3B12B2F7 Vadītspēja
684,886,837 *46BD55F835A9A07C5F63296A012790DFA21F8010 vadizontas6
684,886,838 *46B2355E4E592EA80B701A09BB7D20157EDD0570 vadrouillee
684,886,839 *46B345CBA47BE2AF4A4D5A62C51ACE481DC2EB7E vaeaerentaejaen4
684,886,840 *46B8C77849020EC6802D4638C7B0A2F14C882CB8 vaeestoeryhmilled
684,886,841 *46B8E30B9FCF8F46096D43D16E2AE1C67D35EAA8 vaehaettelynsae9
684,886,842 *46B86DFA2E141CE90E1DC9CBC8D277D49DB9D9C0 vaehennyksets
684,886,843 *46BD44C49C52E5467E88A00780CB747F000A18B9 vaeistymistae5
684,886,844 *46B5FC6F536D4BF8C2BBD709A4B1789F200C3A98 vaeittaemilleen9
684,886,845 *46B3F92BC701073A1B2A33C7BBCFB31CCDB4F7CE vaelbrgged
684,886,846 *46BCE5D2EC78A815E95A3AE2165D1EA0986741D9 Vaelgers2
684,886,847 *46B933AFE0FDF08B167901EC53CB0952ACCD0D79 vaelierien1
684,886,848 *46BC354026314B6471656D2C72E78AF935518F57 vaelilaskuoikeudet9
684,886,849 *46BA5EED0FFD69DBC46FA0685DB052AF02CED7BC Vaelinen4
684,886,850 *46B70CB8172C2BB8CE2EFD1602332DBFCED7DC9C vaelitaekaeaened
684,886,851 *46B135E3F4FD87188EEFE12B44E82205E5EC0395 vaelivuosinakin0
684,886,852 *46B30B6A4505BAD9C7719DEAE4A4D123ACF2D0C4 vaellusbuurien8
684,886,853 *46B72056F5D8F1DA29586DB301E89F2A189AA619 vaelsimm4
684,886,854 *46B1EFA0032E868BD1E6708F22DFDB7E4B44092E VAELTER?
684,886,855 *46B15DAA96D2966A6D5D9384749688995BDDB016 Vafeputs
684,886,856 *46BDA52F9DE1CB764E895563907B423F2548E532 va-fi-lansat
684,886,857 *46B1A29EEC6E90693793EADEFC1FBF8917A01A37 v(aG
684,886,858 *46B681A099A8EDB8E80F7078BC4879E4671247B9 vagabondarabbowery1
684,886,859 *46B82C804004BD175CD2578D1DB81C7ADD4E6AB2 VAGABONDU1605
684,886,860 *46BF95DE2E804D00328DF31FF548FB53C861740C vagabundeáis
684,886,861 *46BD1EA757DE7DB9D90855205CE0D7B5DDDEC159 vagariouses7
684,886,862 *46B5B2B7E1BA0525C99E9D13B263FA4DE7F6B929 Vagariso1
684,886,863 *46B5FC1A76BED39577CEFEB585932B2BB2B05D6D vagas!
684,886,864 *46B699696E827389EDA9C7D866196B8F5B66AA9E vagatA
684,886,865 *46B6163A1648B93190947018CFD66286AC30CD7E Vägförbindelser
684,886,866 *46B462F9045CD89BA044693B5391F6138FF1F058 vaggande9
684,886,867 *46BDC124DD7B531E573EA240F6C6B388B73D7931 vaghuzot
684,886,868 *46BFB8EFD25F6C50AF3284A09593CE8D772EB426 Vaginams
684,886,869 *46B39E872D381CC044D87F05E25C4A4A25F042C5 vaginariffic3
684,886,870 *46BB4307D309D8C56FD253E9AD43CF6CD8E9E2A2 vaginfou
684,886,871 *46B8906CA1A9B6557807CB10881EFB436DC4C0F0 Vaginofi1
684,886,872 *46BC1D6E1263BC15A5C687F36298A52696E768DC vagirais8
684,886,873 *46B30971F01D86209511612544242B41779A5A60 Vagliammo?
684,886,874 *46B917359F852B6C3C752DFA8B47E73A3DDB49B9 Vägojämnheters
684,886,875 *46B359EF4D87B5806A73BF108C54E6044AD14823 vagok lilai ayeng
684,886,876 *46B1D187EA71159E544B1680DE62D3B58EDD921B vagoneenogav9
684,886,877 *46B0AE79338E5F0AEE43F869542EC0FBAA1B5E25 Vagproprgtionn
684,886,878 *46B8F5E3A23B2BA082E89BEC4BA810C78A111EF3 vaguely8
684,886,879 *46B446CCC38F8389F7F790AB68889584339874C1 vagulus4
684,886,880 *46BDA926CE24B9B1D91E0478550A3E6970C26E1D vah9212
684,886,881 *46B5E88391C52FD7697EAAD2D9736715EA3B2B6C ‘vähäiset
684,886,882 *46B7422983DC12A4C7D3D13ECF4237DFCA902C58 Vahe1
684,886,883 *46B4D498F40827BF73C14406018BD39BF0552C64 vaheazilazian
684,886,884 *46BD1EA9AF3248706631D67655C01C0EA846CC92 vahekeresteciyan
684,886,885 *46B1ACAD103AB3AE8D719017FA2E963C520D57B8 vahid ghassemi
684,886,886 *46B1E865913CD9B43EDD4DCDC57DF0305D914F70 vahjireh3
684,886,887 *46B5A86B142D09E7F3BD14C15CF57E517FA6C212 vahnetacuyo
684,886,888 *46B9CCA4E11B08139CD6C20DA8C2D2483A550E02 vahşân
684,886,889 *46BA7D6064CEA438F8D7C968DDEB1C940B564CDB vahvimpana0
684,886,890 *46B95C818A9E84D04DFE2D57B0E3847C34E144F2 vahvistavat6
684,886,891 *46B8CF614D66D099B4709646DB20DB0CC6E564EB Vahvistukset
684,886,892 *46B6A27093EFFD78F83E7623F2E07A94A7F11B5C vaibhavagulati
684,886,893 *46B87CF6F604BF202BEB31015C6B987846D34CA5 vaibhavlabde
684,886,894 *46B9654F6F631AD4863C8502ABFC684CB3046CF0 vaibhav wadivkar
684,886,895 *46BA73D0A117870F8742D891AE54797B2ED9543A vaibzjindal
684,886,896 *46BAA90D53C382686D59044610219550CEA563E9 vaidatiminskiene
684,886,897 *46BEF00EEFF4855EAE5CE12A6B727EFA7AB40EA4 VAIDHEESWARA
684,886,898 *46B0E6D3CA47C94E4DC7579B22EBFCA359537431 vaigrening
684,886,899 *46BBA9D6F31FD6AA6E2A770B43E94F244004D0C3 Vaigupuid
684,886,900 *46BA3865A66D8CA2803C6557EF7506250F008670 vaihdatu7
684,886,901 *46BDFA98439D74626EB1A9FD838466043C4EB818 Vaihingn6
684,886,902 *46B4BC94DD7BC04FBED6777D16BF8381744128F9 vaihtelua5
684,886,903 *46BE08B952769DDE3F97B3F8B9C3CA43D28AEA5F vaiju shete
684,886,904 *46B273128EE3EFC0928DD1D980D77EC947163649 väikeproosa
684,886,905 *46BC18A158A9CDA48736E349AD8339BC0646F5CD vaikeroitti
684,886,906 *46BAFAD7765EAA0FC87F3ECBD20195FE2B551C9B väikeseformaadilises
684,886,907 *46B692D5ABEBA16FD7A3A81EC7C1B8A8D18E97EC Vaikščioja
684,886,908 *46BD45482AA1DA445B4A1615D7C70DD52012DACC vaikuteta6
684,886,909 *46BF06E3BAE2372880E67AADAF75726D6B9C3EC4 vaikutusvallalle
684,886,910 *46B1B0DA891B4DE9CFA88F74E2C21F4771F3A674 vaíl
684,886,911 *46B2DF1E7FACC2A85FF79C7E0BBFDB2B6255262C vailave
684,886,912 *46BAD7D1450C57D16D36DF52F075703330FBF251 vailebsw0
684,886,913 *46B9AF8A663EB55AF060849FA989C9CBBB3826A5 vaileng
684,886,914 *46B74401D9F82AD72E69886A222A3EC5B03E5817 vaimennetusta
684,886,915 *46B6CE0FB0B4E4C905B55D63291AED0EC3AA2769 vainajalla3
684,886,916 *46B349A2ECA2FE2CA68F6705B022C50E494AC875 vainamu
684,886,917 *46B4E7F2229B2067F3B82E87FEA9F7D9CB8C729F Vainioille
684,886,918 *46B41D3DDA7C3CFFA2E1D7E30FF8182D5BD0D179 Vaiolos3
684,886,919 *46B8B21E9D74055CDF630829B9E737D3C01B8B4A Vaipraashnikaah
684,886,920 *46BCDB6F5A795BE0D37851AE99016D9511A47A36 vairaani2
684,886,921 *46B2A540CCA35AE25AF8906F7115D34F91694654 Vaišálí
684,886,922 *46B0A40B9EC31B423C8EBC3074C732FBA49E1E49 Vaisepole
684,886,923 *46BC72A02A613CECBE9FBF94A18E8F3A2998012F vaishalih.
684,886,924 *46BBCBB70539CB3D7C087251EC74EECEA65D20CD vaishalijha
684,886,925 *46BCF1C8ECAB43C907C959702CFA4ABFEBB57F45 vaislho
684,886,926 *46B28C8990F4E73B16D9EC8F716643B3832E4353 vai sootaga
684,886,927 *46B3B9175BAE17A6C1EF855435B9AA99590C6E0C vaithegiychitambram
684,886,928 *46BAD26F79CDB4B3FA2323B1D34FEC0AF4D1D970 VAITHIYAM
684,886,929 *46B3584194F327F3D5AF154A0AB80FDB03D5F031 vaitonka
684,886,930 *46B8E3D62D2F6337A2932F285BF3EB3BC2711D67 vaivalloista1
684,886,931 *46BAF797CD2FFD80F75CBE77AA6D8942D09AB48C vaJ!
684,886,932 *46B2D6F12657188412E6A69BD14BF7D242B19D4C VAJIHOLLAH
684,886,933 *46B838B64D0DD4D566FC3A1F8EB26E1A26E0B6C2 vajitum
684,886,934 *46BB8363732C3EBE5A1D5E90C5029F9ACC622380 vajiyuvbhihkaantashi
684,886,935 *46B1BE157377371977CD330DF105406C96D62A17 Vajnxek3
684,886,936 *46BFE9DE72F82AED8426F2C1C6EDF77D64D603A2 vajzzba
684,886,937 *46B63D88D84F3151704FCD12ECE7BABDE38B5CAC vakaa”
684,886,938 *46B5B1BD25A534D34DE37556B8A2923D27750FB9 Vakantieganger!
684,886,939 *46B946BD8DB261A0E1F9503F8218F275932FE795 vakaróval
684,886,940 *46BEBD4911E2217C021F061374BD1B9AA39D1C6A vakautusratka8
684,886,941 *46BFE62C7277143B4845997FF412A012901BB7D7 vakgelee4
684,886,942 *46BBECB084569D0B92683CC84B8E5290570BA515 vakiaaikaved
684,886,943 *46B578AA9471A0E327F954AA2F75ABE139729A1D vakiintuneista1
684,886,944 *46B5AFB7B87B43404FA640122F3AB61264E2301F vaklede5
684,886,945 *46B6E6261F5BA7CD17D10BA7CB335A275A459D0B vaknyugatnak
684,886,946 *46B469653F162344D823670E04424A32D213FC7E Vakorganisatie9
684,886,947 *46B94D7897AEFE988CED9E65D1876B75D661AB43 váksa
684,886,948 *46B458E185790237CE50FC60F526FE55C5EAB39F Vaktlar4
684,886,949 *46BBDED7EC17BD0C5400F4F87F403653E5D11B15 vakuoolides
684,886,950 *46B56BEEA3DCE24F56F06689BD47CFD1505FB3A3 vakuutteluisted
684,886,951 *46B603B7A5B2E41A2CA6DBA3685C0717EB0B71B5 vakuutusvalvontavirastolla
684,886,952 *46B861F893FDCBF51AE46F0ECB323FC8332D1375 valaanlihakon2
684,886,953 *46B3B1FC568C4DFA57213CA0061FCF5626E2942E valabatho
684,886,954 *46B588FF4B09D2290C99ACE00AA0A177138FFB9B Valablement
684,886,955 *46B52B6A6B4EABEE8972861AD75BFBBA6F114364 valahól
684,886,956 *46BCF061D1A7649DAEE127470FDD6DABEB3951CD Valaisn6
684,886,957 *46BC3A9ADB28868AFAA12D475428E9D1D2330EBA valaja kranthi
684,886,958 *46BEF0D845FB858BCD64959627985E8AB88C71AA valamelyiket0
684,886,959 *46B892E97CE28741CC1823714DA043F479ECFA4A valancing6
684,886,960 *46BE600D2B7BC482F97612D00232206F64A8CA28 valancopereira
684,886,961 *46B3BF49045B2E136EFFA029CC232018C5D481B9 Valarece9
684,886,962 *46B9C635F8DB8A7E8F503E809093591247B1E461 valarecing
684,886,963 *46B73C8C3B2E6472008FCBF013AB8AC558B01440 valariecarvalho
684,886,964 *46BA6315E373B429DA49F3EAF1917D8DD495715D valarie lounsberry
684,886,965 *46B5ABBEC862F568C89A90F25D8972B727DE6420 valarie malin
684,886,966 *46B9C77A57B327776CFA6BB8F91CC2271D7F1A11 valarieokeynan
684,886,967 *46BA8227ABF206117B5317C4B47026ED24E13AB8 valarieying
684,886,968 *46BFB1DDEB302C3E82EA15540487A25A892BEA99 val.arrambide
684,886,969 *46B98A44145C1932AC5C4C7E14C200FE61782837 valaskjalfs4
684,886,970 *46BF63FFF8C9129DD12818E461887E2538A290D8 VALA
684,886,971 *46B2F0D149E18CABA9C40BF90C81A8191B97BF19 val.bergener
684,886,972 *46BBDB1DA135253D72C5583E20DD6DDF13C2DD01 val.biery
684,886,973 *46B7B0ADA666DED8FD29D2E40716127CD9EE36DD valbumin4
684,886,974 *46B724B960449E5AC6E912A0E7231745EDCB3DC1 valcaoleng
684,886,975 *46B946A2FF5633D12833C43D8D3FD445DA7BB873 val.capezzuto
684,886,976 *46BC3BC077719FC60D6DC0FDAB5454881E1C19F0 VALCICICH
684,886,977 *46B6CE98A2795B4843CB6D6685B65DC72DC35EE6 valčíků
684,886,978 *46B3BD53235419CE9BDBFFBA4189BCD4F757BCAB valda valbrun
684,886,979 *46B195FF05144CBB0F89224CADAD905CA7EACA13 valdemarsdags3
684,886,980 *46B8F95FD246732A5DA7031DCCF17E5C610B415A val.demchok
684,886,981 *46B60C52D5EFCE493D0D99739637B84B51814610 Valdepasillas
684,886,982 *46B02577588AC5B8FC8BE777DF2DACA24FFD56A8 valderramakelly
684,886,983 *46B8EA37ACCB5B97FA3DBE69693B34DEE28E232D valdolloso
684,886,984 *46BC61BC1CB4DE394F1B229C1EC700D17F818CDD val.donegan
684,886,985 *46BAC6ED9CD023F4DA18A318E7035AC352EE5404 valeane1
684,886,986 *46B2FC93DCDFB1BD1625FF960FC495D1C7F4BDC3 válečnych
684,886,987 *46B4C843D584C77A2669388392CF13EFC662E476 Valekreivi
684,886,988 *46B83045A03E359A1C02EABF5DC7731010771268 val ella
684,886,989 *46BA9BC32FB49330D083596E76010658ED1101A3 Valemyllyn
684,886,990 *46BA2C1E698FD3A4EA71B4BE069215033C72B4AC Valenci6
684,886,991 *46BCEDB32D327B39879A43828C2AC96580A02BB5 valenciahamilton
684,886,992 *46BDFC6B247E4483D62A23BDA250A8D9639F0A7E valentenflorea
684,886,993 *46B118CF147FB95360F71078ACDA1619BC64F5FB vALEnTia
684,886,994 *46B49C9AAB6F1DE3FEBF90444558DD5496411A98 valentinabenvenuto
684,886,995 *46B0674C26821BBD51424D29D38E4DC820C1F5EE valentinabonding
684,886,996 *46B776906772DD7C42B201349095E9738A637C9B valentinadajud
684,886,997 *46B8B0D8CC3F9CDD20CF8E8F32A0B8E0BC427044 valentina floran
684,886,998 *46BB34270AB4840B78FC527DA3BDA3BBF7F0D522 valentin.aguon
684,886,999 *46B8120BD9A0D00145F9EA5AB05A9676F0F1DF8A valentina ladeiska
684,887,000 *46B876E9EF54A58A6AB5AE9D12821BB7025492AC valentina ovsyannikova
684,887,001 *46BF0BA8E000E9FAD0D5BB001B4DEB5711C384DA valentina podstrel
684,887,002 *46B345375C7B9EEFF60085F30EFCAB031BD4BD22 valentinaroth
684,887,003 *46B0CEFB1D7B7F1C38FE13DAE2FAD394037B9694 valentina.wojna
684,887,004 *46BD82EC76C54734D3CA6F50E14610B158650CB4 valentin.bielak
684,887,005 *46B635114CA30B974A982D794CF802FCB82BAF75 valentin.braulio
684,887,006 *46BAAC827E71DD52E2FB96E58D93878B5B1252B4 valentin.builes
684,887,007 *46BCABFBEF41D4FEC77BC8D0E583B2F39F4E84A6 valentin.card
684,887,008 *46BFD0927BB3785382D6162ECF9945B63B089C6F VALENTIN&DEEA
684,887,009 *46B5E39EDA774E7ADFB68BF7867F83B93FE881C8 valentin duna
684,887,010 *46BE534A08DDED68222143006CF8379E580604FF valentine.bednar
684,887,011 *46B1C2A4A78CC18AB415CA1242B029DE87CDA240 valentine.bernell
684,887,012 *46B98544A807B4F26941AEE55C40ADD7111B0F88 valentine.chimenti
684,887,013 *46B48003D6D37805CC78AF0530F65CFE8F3A7BF8 valentinecooper9
684,887,014 *46BE9D55564A74F05984E57DA242131E65E76F61 valentine.danielski
684,887,015 *46BE5443841CC0A218C1C4FBD7A121B7675E9A5E valentine.dumoulin
684,887,016 *46BC8CBB4F80B147331C96AE2EE787AC20727779 valentine enow
684,887,017 *46B6F61AD960EAA7FDAC26C33EF4E7D36BB551B4 valentine.fina
684,887,018 *46BAA878A21518EE59C29DB840FBB6A466844E5F valentine.folz
684,887,019 *46BE26465DE105609D04BB301590E97B22D08E17 valentine.girst
684,887,020 *46BC0294DC543212DA2A2985940C5D5472CD6A16 valentine.hennigh
684,887,021 *46BA38A223EB9AE1E0BED2EAF00EDFCC4560647C valentine.herbster
684,887,022 *46B554EC5723F30017FD156C76F789D174046AAB [email protected]
684,887,023 *46B21DB249D38CA8BD7914717952456E89619F7D valentine.kavanagh
684,887,024 *46BAD5018B3AE3EF569F208C048819EBC447A9FF valentine.krom
684,887,025 *46B66FA01CD9B97D4E5B2E97E9D0A3D282C95530 valentine.lewton
684,887,026 *46B740BC02102570E10F8D24DAEA51C20F2F8A45 valentine.malandrino
684,887,027 *46B794239F99EEA8DDC6A67DC188C16511AF5100 valentine.mendelson
684,887,028 *46B58A9D299E6ECBF976B78BE9CA2025AAB316B1 valentine.milson
684,887,029 *46BA367E9651FB75A35B8D6EF36C382FAAF08812 valentine.muno
684,887,030 *46B81C92795F58CEB4AD9BD06FEC024A9F69B7A0 valentine.niblett
684,887,031 *46BD671E4F9444348A89FD26A1C355C667DCCF9E valentine.pricer
684,887,032 *46BB36D452983B0F2319ABBE6200196DECAF7F75 valentine.rindal
684,887,033 *46B17448A7CC63B53F758E851E11E89BBE827696 valentine.ruan
684,887,034 *46B96634234F97491BDFC9D0C230E1AE7F06BCE3 valentine.ruffel
684,887,035 *46B865B36DA105DF7CC1E670B0EFECBE52AD9F3E valentine.stainback
684,887,036 *46B82CE2B429FA180372907BE37A1E0AB50201FB valentine.tash
684,887,037 *46B9917F005BBA67A8365AAF60AC242A1DC66EDF valentine.verhaag
684,887,038 *46B9EEE458F35F9EB88B34CE3D0D55E4F6DDAB4D valentine.vinet
684,887,039 *46BDB540BB83997ED68B8DD2F25835B0B62E5D86 valentinfarias
684,887,040 *46B41887B83C461B004A9CD11E461C4201FCFA0E valentin.kastl
684,887,041 *46BB7FA6C4C79A68DCE895745B14398C49AA0619 valentin.klaiber
684,887,042 *46B55B986B79FAAAE9958434030D140DE70EB3C6 valentin.lampshire
684,887,043 *46BC6BCD5ED171C68A05CFE771D5F57C1C75C14C valentin.lendor
684,887,044 *46B641ACF329A6659BEBC260B5FA2BF5B97B0FE1 valentin.levoci
684,887,045 *46BBDDDBC91E2351A1B7C1D2972AC1C8C255C2B8 valentin.loiacono
684,887,046 *46BA58818A03AEF391A0E79371196687C05D5A11 valentin.minard
684,887,047 *46B4C0FD2CAAD23497582621DABB0E1903DB84D1 valentin.mosebach
684,887,048 *46BF46D74E12EA1F40D0789E3CCBFAD6BA8BCD08 valentin.norquest
684,887,049 *46BF9E5EF03F81275F5C6C7B9C9FDDE0F4F6864B valentino863
684,887,050 *46B7F3807C9BFB8262D76B1F806A6924E90CD9A3 valentino jahsking
684,887,051 *46BC583C3BC8C0672DCFEB7B51D3B2F45A52AE4D valentinovichgiasbeily
684,887,052 *46BEED80A3440AC83A91D92318C3B711DA71CD3A valentin.pultorak
684,887,053 *46B5C3853DBDF202D853A5F667B2B7FD173A3178 valentin.quon
684,887,054 *46B046C0EEC15B5981BE3218DA9C926004316EDC valentin.rola
684,887,055 *46BEE4FFE796280CF5A7D3F88549444C51D77438 valentin.sefcovic
684,887,056 *46BA769B82622BBAFC879DD59CDF3D0ACBA01582 valentin.seidenbecker
684,887,057 *46BA0B6CE4056F12F98140EA0771D945436AA10A valentin.socia
684,887,058 *46B73CE1151A8ACE180D511D04499719EEB7A707 Valentinsports
684,887,059 *46B4B92CB1D3F9214F79696F8F3822BB0000E342 valentinstanciu
684,887,060 *46B25CF5080199CDCEFD8CF8D3F1B4A5966267AE valentin.taberski
684,887,061 *46BA26F2757B86903B0F06EF1609348667AC8D17 valentin.trammel
684,887,062 *46BA686BEBC7E5040797FB4147CAAD2B93763874 valentinus andreas erick haurissa zhang
684,887,063 *46BA1F6D1119858FA21216C7C2B54B469582FF27 valentin.varnedore
684,887,064 *46BCCDAF14FEB05DC7515270E4DAF0A463CDC34A valentin.weier
684,887,065 *46B28824B48AC466121E642A641B2FE1C198B2DC valentin.wilcutt
684,887,066 *46BEE1E463CA4D4154C425D26DEDE1EE833AD5A3 valentin.willams
684,887,067 *46B76CD3F6BB7198991B2AADBD83C680C4D09171 valentin.willcox
684,887,068 *46BAC56CDC4DC8349375BCA751AFDDE9DAC2E076 valentonada1
684,887,069 *46BF4C8E6AA17EE2C713E848CF352DDDA1D7ECF3 valentynadea1
684,887,070 *46BE5C7F8D64F83587251BF7CAD6492D242D802C valeriaan.
684,887,071 *46BE94ADA60E26A1D45344B0E77360557E3C19FE valeria rivera ortiz
684,887,072 *46BEAB2A03B95A628F011DF216E841FD1A609FA9 valeria sessini
684,887,073 *46B084C979742A0EAE4B5CEEBCE71E6539383344 valeria tiberini
684,887,074 *46BA59A7FB4D9A318B7301816E94D338EBCE5594 valeria timoteo
684,887,075 *46BC58A09B6F29AE5326E619D70269B0F4C8B12E valerie bibeau morin
684,887,076 *46B705F52C77E7C724F500DBC4E23FBDD7AAA748 valeriebilly1
684,887,077 *46B3DBD3F0ADBD61D2965D185F5E70036FF15135 valeriebobbies
684,887,078 *46B99486EC32079F8FD6E279DF352F4E7CFBF4FE valerieca714
684,887,079 *46B32F12341D8BA4DCE177AE35BAC3E555592141 valeriecanova
684,887,080 *46BC5F08A3FA8E1B30E7F9F2156DA1275222E472 valerie caterino baskett
684,887,081 *46B9C9EBCAEAB93DE49146DC213E3BE937D900BD valerie clements infranco
684,887,082 *46BF8748C760A3B8AB3FC7C7A6D8E73C9D1371A2 valeriecusumano
684,887,083 *46B3EAB4369B5BAA7ECD1021DED1BF69E09183F6 valerie gesner espeleta
684,887,084 *46B95B8ED91A575B85D2E76EAA553FCA5EDA5E02 Valerie Grand
684,887,085 *46B63B785D785DF7F4CD659A2917F1D20A505263 valerieholsen
684,887,086 *46B1814E796FDBE29BF352388D5ABEADF339898C valerie hoskin
684,887,087 *46B45E7884C901B6082FD4083207D33C7A3660F4 valerie houle
684,887,088 *46B889A4ECD317AB19194957E054F5E927CD48B0 valerieintern8
684,887,089 *46B0E7FA81F25D877FE765847935EAD0B1607F9E valeriejamie
684,887,090 *46B8F9088C79DF56E9A29038E29AFDF64DF2F236 valerie janet shave
684,887,091 *46BDAC1E71E44DC35CB09595BFA17A69FFFDE8E3 valeriejulien
684,887,092 *46B8DC3D6D1F3136674E8615E5FA7B722B44643C valeriekassner
684,887,093 *46B9D0F4A22F1E63CEBD2ABA4E61FA68690DA468 valeriekenn ruiz
684,887,094 *46B1756576D75A637F07286F3C640D3517951CE8 valeriekensington
684,887,095 *46BAF361A0868FDE85A7D1845B55402D09CF85D1 valerielefeld
684,887,096 *46B95BBFEAAAFE658EA18CC414FA6377F267BA45 valerielippelt
684,887,097 *46B016ABF209549BABCD9F09FB23941D1D3B4E2E valeriemarez
684,887,098 *46BE4F06C372CB6CD522321B0D898D2EEDBD80CE VALERIEMOM
684,887,099 *46BCE8F0CA2EEA64B5895FCA779C6AEAABA900E8 valeriemoomey
684,887,100 *46BEAF70E5AC5360B1B6605349D3128476B2215F valerie murray chandra
684,887,101 *46BC34AB2126D07BAF649D20AF478FF5F99F51F4 valerienurses
684,887,102 *46B6635ACB0743E3EABC1023C0042C43DA6C4659 valeriepanther4
684,887,103 *46B5FD4B77D44E33F6A7D25EE2F19E1857030C7B valerieportella
684,887,104 *46BB47E1CF9536E2F8150E88CE48529F7A931A62 valerieraheel
684,887,105 *46BF2F0AE42DB4B94E6135D29457400C217B2EF9 valerieraqueled
684,887,106 *46B13D5E88C6786FD75CC2C0B929B5A186F1E298 valerie sharps
684,887,107 *46BFF98A6C2B8E858AA5E169214B1B77A5288E1D valerieshiko
684,887,108 *46B9F2A179E2D4F7EB23C0D6476012EBC2C76454 valerie souquieres
684,887,109 *46B8B273B5C352316F0519255DBC0ECB86218AC2 valerie sprangle
684,887,110 *46BADD93681017E1726CD3596E90A1D3BB918A0D valerie summitt
684,887,111 *46B30885A8B68A8236F2F77A60F4058B34D0EE48 valerie tirpak
684,887,112 *46B694FA74A5F07FD273BE61ED7C58DC817BA25C valerietreptow
684,887,113 *46BB9606F968173D9FF12331C476533A2DB1AC42 valerie troxel stone
684,887,114 *46BC9E60F545B6CFD0AB9DCDAE7BE80F41E36EBE valerijavitoniene
684,887,115 *46B8C6F4EF48F08E9EFC690EA2077CB18E34EFC1 Valérious
684,887,116 *46B9C4945096E71AFE4CDA60C6E8E5522119B992 Valeriv
684,887,117 *46BDE26AA10F393DE88E1EF51B245A98FAA22B54 valeronesing
684,887,118 *46BD0C467CDAE7FA89BDAF4826814D815A642D66 valérovi
684,887,119 *46B0FDC8600346D577A741F762555769222220AF Valertan
684,887,120 *46B29DCEA3F95080EEC9B03E6BD4BD06BC792EE6 valery459
684,887,121 *46B5EA92045FB043883B72FAE2AF511E06D93728 valeryle3
684,887,122 *46B0C0B4458445E504357C5F2F052A206343479B Valery.Sukhikh
684,887,123 *46B7134268FE8D779F5A2DDD2C6F3279CB9F764C VALESAFI
684,887,124 *46BA0CAA0905C0AD7AA1228B2E0EB6E6DD37D1C3 Valessia0
684,887,125 *46B7F5A96681246B7284764DA48BE5E1998C7A65 Valetque7
684,887,126 *46B2CEA029E126CF094269600C2974E5FF1447EF valfriedaed
684,887,127 *46BF0B09CDE82EBAFDAE354C0BC59A4AD6709353 valfriheten6
684,887,128 *46BCC29132B9BF1F34ED37E2859256C50668706D Valgkongedoemme3
684,887,129 *46BAF6A4F7025412D31E611597CCFFCD9B6133E9 val.gormont
684,887,130 *46B9F9435C12AB5BA558F310240E5CE1DEE2875E valhallacolumbia6
684,887,131 *46BFC190E021EE50683EF424A25CEEBAE66B06FA valhallafrodo7
684,887,132 *46B11FB6F194DB841BFDCBCB94EA622C95B1F1B4 valhallafugazi8
684,887,133 *46B607AD044808BFD211C0F2840032B22A3415BD VALHALLASAILOR
684,887,134 *46B107F17CFCA5B8FC671857F9A7FB098A996920 valhallascottying
684,887,135 *46B4ECEB2CBC3648CFF05B9D27789AF4DC81C451 Valhallatequila
684,887,136 *46B4478CE36168929177DD80A6D3051327F9C936 VALHALLAVOODOO
684,887,137 *46B7F30AB79DF50E0BC361E555BF8722E9FD8737 valhallawatered
684,887,138 *46BA8BFE732422DF4693DDD4E6146490E0FE93D5 valhamo123
684,887,139 *46B8491E0CFC13F02C2B0B24BB077946730BD9AB valheisiin8
684,887,140 *46B1833193B5991F3C2C7AE7A38E15545BAAF827 väliaikaistiloissa
684,887,141 *46BEEC2C86CE608F17B6306164F9915830238EBB valia livaditis
684,887,142 *46B4AACFAA414F384FF59418FB9BAEE3BE39F597 Valiant and virtuous
684,887,143 *46B436808951AD880EDE8C6BAD993B15C60482CD Valicand8
684,887,144 *46BFE9C0127969DFA62A01CE61D5AE7B8DA9DECF valicity9
684,887,145 *46B5BED9405371B8ABD0F3C11BFB33EDEB0C3A46 validat0r
684,887,146 *46B5624990E33E1D7FD3A92B0D2E55B1C706E316 validerons7
684,887,147 *46B8931BE4A4D4D50CC9CB1FBB2FF3BF12B238EA validityprominence
684,887,148 *46BB6F86CE6478126E8EB8CF6EB1B56EACF5A62F válids
684,887,149 *46B5AED54D60DB562262F14DE4338603D40D58EE valientedasalla
684,887,150 *46BB0249510C4D5C0B509B697B580B9EEE1FAB2A valinevaline1
684,887,151 *46B6B0EB5057F0781EC5DE456BE50727C7F8D27D valinnas3
684,887,152 *46B72BDF8BB0B8F91C65768479B4EB33C8B141DC valintakohdaned
684,887,153 *46BF9CD5CC57C5DF5F7DF3E425D3D576277E730F valintakriteeri4
684,887,154 *46B0675A3DD7BA78DA6987912B5887B18E3CC294 valintapainikkeet
684,887,155 *46BAE33F4D39D7012D597392D400A4B84A745B37 välipohja
684,887,156 *46B495323C3730E3472923CFC521086F3FB2B789 vali radberg
684,887,157 *46B02DBF0E82DAC9F3AE3F89BAC07333A89E30CE välisilmet
684,887,158 *46BD06FB27797263F5414DC2567A5279A538B652 valitsemastaan3
684,887,159 *46B68E610850E7AC1531D0134A4E5F89C815EE27 valivetigupta
684,887,160 *46B62C1D48CD0CDEB7AEF9DDC27E94253A3C994F vali_xxx6
684,887,161 *46B828ECAC3C056C4105406DCD7B23C42D47274E valkeeising
684,887,162 *46BBF0E204AF93730324FBDE550D5A5EF63BA9E3 val kiffer
684,887,163 *46B0D25C9C38EB21F6FC1A0976F679AAEA7F5BC1 val.kirk
684,887,164 *46B7A75EE16C4224E2FEDC6A72509BA8D63B446B valklingman
684,887,165 *46BABBF07221C201D83DB15F6095FF7EB429AC27 valkokaulusri3
684,887,166 *46B4E6B516D72CBDE84F5C1B3249CA14326EE5A6 valkosipuliin0
684,887,167 *46B9E341FA1B6F4F04C1F6860E1E89923D44CEC0 valkoviinidieetin8
684,887,168 *46B5CE35FE6E9F3E6B0486E3E7251C7E2513AA48 valkyrie gilmore
684,887,169 *46BC2949BA048CF8D6846F8583F10D4383DF7DC9 valkyrjen3
684,887,170 *46BDF4F98BE8BD50E7859DCEB71244A27F9D80F2 vall3y b0
684,887,171 *46B07D94919FC4FA5554548D4F39B46DC0C899C4 Vallabs7
684,887,172 *46B7ADE6E9FE327B2F419272DEEC9AD315449684 vallakensed
684,887,173 *46BFAA086C328E61BF784FC24B3B28C323B33D50 vallalataval7
684,887,174 *46B52E1B6343E872A196711C9248D3778950ABAF Vallare7
684,887,175 *46BB9FB7FD3571C6FAC91E968E9793D039572D28 [email protected]
684,887,176 *46BD0735E4CCE4A5A59BE72CD8E46C715033E7B5 vallattuna
684,887,177 *46BB7E277F13B325139F97AA5B27AB77B4C3D80B vallecanobsw3
684,887,178 *46B46E58D3ABC84E36F26EB5E66664C9B4812675 valleculara4
684,887,179 *46BBEBD65602FB12276D828B59F8337ECB233986 valleculates7
684,887,180 *46B716F780B093B907FB86ADD9CB1471B536C528 VALLELUNG0
684,887,181 *46B295F6A1E873A0276765DCC4898E46E73D7431 vallenkwee
684,887,182 *46BA038E7F90B906DD29FADA547ABEA9875ED483 vallergaN
684,887,183 *46B18B13463EAD8A9318EC7375EC9F28A5A0CE42 vallerylutz
684,887,184 *46BA54189AC8792FFFF78FB48E87B901F7B8F2B8 Vallesteres
684,887,185 *46B2F1060FFBF01D28797CF54B1A0FF4076C5034 valletorted
684,887,186 *46B73905825EEF4DB967C6716770889F41DEF5CE vallevgs
684,887,187 *46BF03BD7A40E85E7E7556B408898AD06439364E Valleygr7
684,887,188 *46B697C2CD1C12C50532D5ADE6F9D935FA0F85EE valleyrestoration
684,887,189 *46B05E05FEA03C6A52238EEE3BA6ED1157C2188D valley-topo
684,887,190 *46B65F34138583AD12C239038A929B992F5752CC [email protected]
684,887,191 *46B270EE3CD56670E73C21B36A5D23C223C0A787 vallisvallis
684,887,192 *46B086C36A7EC5B443ABDDC18FB79121AFDF8F66 vallningsinstinkt
684,887,193 *46BF4236A917991DB3B0678EBE0904C18800B85E valloeta
684,887,194 *46BFCBB9642A5B8CB9CB7624234D5E39FD750F7A valloittavansed
684,887,195 *46BC26C1F369E4449308798366823E1DB02445AB vallonars
684,887,196 *46B4A3EF89F4A597622E6E2945E92554C7088AF2 VALLONIEN
684,887,197 *46B407A5A46269CDFA940EC2BB16E3A3FFF16C46 vallori8
684,887,198 *46B52BECB3C23640B0FA18C0CAAED4A0271BCF3A vallOT
684,887,199 *46BA2F0D42FE454685D38A34C816678E94C89ABD val.mates
684,887,200 *46B8700A93397DA1E22484AB8CE112E4FE268490 val mcvalerson
684,887,201 *46B2C9FE7CCDE97055589BE113E38228B6DD94B0 valmistaaksee0
684,887,202 *46BB1997CAA20B7933A39F0089E54BF5E84B27E2 Valmistusmateriaalina
684,887,203 *46B6BE335AFEFB8600B6BF16F9EF42EC26495E3A valmistusyksikk8
684,887,204 *46BFA6086AB07EABBF60DD5587D1805C9741E603 valmistuttuaan9
684,887,205 *46B28338A299006BC00B455F5E44F58450F7E409 val.monagan
684,887,206 *46BB6FBEE2B9029AEC9129B87C4F103D4033673F val.motola
684,887,207 *46B08636D4B6382B3D47EC160D953D36C574DB01 ValMuragl
684,887,208 *46BA7F1398C5FAEC7E8385A0AFFA44AD8F4E1E41 valoarvo
684,887,209 *46BEE53F677340E73453974AC28B7A21CF299E46 valobrani7
684,887,210 *46BE28040973BB291242E61D391BF3C7233D4914 val.oishi
684,887,211 *46BDF90D86B63169331C2117DF3AEE371F01B9DE valoläikkiä
684,887,212 *46B88918FB102D0B8D5DF489FA9C07CD3A9B735D VALONIQUE
684,887,213 *46B53C068E17DD18D00E65F779528EB410747548 valonlähteenä
684,887,214 *46B5166AFCD44E4E5414B0A037ADFA79F4042C6D valorabaning
684,887,215 *46BE3EA7A1E68EDF23BDFD8E491468C55AFEE78E valori corbett
684,887,216 *46B4833175D13B567DF570CAA988CB8CEEF51AC7 valorie anderson
684,887,217 *46B95EABBB9E545ED00D045FF66561257834D4B4 valorie d chavez
684,887,218 *46B361589FB235305B01BE12F8B5451E80740E1B valorisation9
684,887,219 *46BC0B937C78FE7BF2310F48E7479539911BF6C8 Valorisiez0
684,887,220 *46B117DC8FC3F9B134C853060CFD604800149E25 valorizaming
684,887,221 *46BC59CF61DFFDB3C208DF10741AE4B044EF897E VALORIZATIONS6
684,887,222 *46B4E9B4D3CAA4B0AF87E02829CCEBF2D70ECF86 Valparai0
684,887,223 *46B5EBAAB06D141D079905A2D6BE701EF0C5AC10 VALPARTIJ1
684,887,224 *46B78661619E06E61547B0AD4CCE819B134C8CDD valpopa28
684,887,225 *46B93F5286C67D80161757C2E04EDF676ECDD867 valppaampied
684,887,226 *46BA7EE1A3E14DFEAB08F4B8A1E94562E91C65EF valpresentasjon
684,887,227 *46B16615FD18799CC090A23A30CCC36FF192D64B valpruga
684,887,228 *46B891389B4F5A117AABE7E9AEBEF6C14E81F86D valquiriacruz
684,887,229 *46B76738860D940BA3460C40B6174EC14DB44014 val.rall
684,887,230 *46BBAEB816750C45F4397C69E94D648237CD11B9 val.roacho
684,887,231 *46B4250E4D89E483FCC004D853FA5D66D140CC22 Vâlromê
684,887,232 *46B6D85228F43E2FAFC7F86910281B7E850D99C1 valsavalsas
684,887,233 *46B7448E317359E73371BDCEC45A47A31CC625CD valsbautista
684,887,234 *46B66A8D94F2DFB3D397FD6C438C25A8D826E2E0 Valsemana
684,887,235 *46B73008E1F2944080D62E2EA305F0042C5399C9 Valsmira1
684,887,236 *46B1556586E31B57CBF5E9DEE13329D14C189F8B valtaisasting
684,887,237 *46BD6D971D4138928295026F7430FC73A4D286A0 valtalaisens
684,887,238 *46BBECE562824A16E194FC8B029DA2AFE26BC69C valtasen4
684,887,239 *46B6910B434373B4C06F52024A3BB62B30F8D77C val.tavella
684,887,240 *46BEA98E1F1C551451350A8018D2EDD52E24016D valtian
684,887,241 *46B459203A7EB8058DCCBE7C00A71E7E50744A19 valtning2
684,887,242 *46B04A9BC4D92FCA4A12CF2A87028F81B0B0ADB9 változatat
684,887,243 *46B1C81DCBEAB065D5F45886026FDD29CD5E52D9 välttyneistä
684,887,244 *46B8EE69F85F4BA1B1CD2B43A4EA5531546FAFE5 valtuustoryhmään
684,887,245 *46B2FE934266A534D9C5EA95F130E5BAB8625A14 valuelessnesss2
684,887,246 *46BEE1DF6A06E8E98BCC374844E7BB3643C21926 valuemartial6
684,887,247 *46B89DE675AFF25A15D4FDAC3792E949402E27C3 valuemetricsbsw8
684,887,248 *46B03719161E34B6276B884801B0DA46D7593B97 valugh
684,887,249 *46B2ECDAC6F7DADCEAB7F99D0E9DFB6CE1B7E620 valulised
684,887,250 *46BAC81B7E1AB69BE445DB7ADEBF5EC6DB788B99 valumlauf
684,887,251 *46B7A748605F951E3552DD8D64ADD5BFEE9FD857 valuta
684,887,252 *46BE6BB80CC4A1D15727FA44E4FD3BD84A587303 VALUTAKORTET
684,887,253 *46B64111FA65F316D98DDE6DCCE26C3559B61E2B valutassimo4
684,887,254 *46BA67F4B3EAAF96AF44C826F240959EAA60DAC5 Valutateken
684,887,255 *46BC1214D72FC4E5A4419799B3C83ACDE5476CBD valuutanvaih
684,887,256 *46B1C3AC934DBED081E7727F5B5800FC2593596B valuuttamarkkinaoper
684,887,257 *46B2EAB637E8FABB707E7C254192849948DAF695 [email protected]
684,887,258 *46BE7CEEC777F230373594DEC91B7BB04381D60D Valvanera
684,887,259 *46BC5A695B625CE2DC33198F9FD431AF5AD5AFC2 valvechrysler
684,887,260 *46B834CAAC8702E59E241E5D3FFE877614CC3C2D valvettithuraivannar
684,887,261 *46BD8D8B262ED133B8CAA724FDF2CC0D30AD5D6B val.westberry
684,887,262 *46B5A5A8F96E64D4D134B3C26CE8EF2991D610E6 valwilliams
684,887,263 *46B88FC414A5173DF0A7DE485DC5E773B7FD9973 vame al Cielo
684,887,264 *46B735A190CD7FB68E66FC1A4E6B03DD9EB2942B ɐʃvamərln
684,887,265 *46B8DCC6F7698BE0FCE9FA07184AE09C0B725842 vamessing
684,887,266 *46B13BA903804C27184FD3DF5CEC84019CD4B22E Vamoosed4
684,887,267 *46B9DE897511DDE9772048A7933AF29CBC1A4965 Vámosgyörknél
684,887,268 *46B367EA8CBCF9142A0708600B682B55D5210116 vamos nos divertir
684,887,269 *46BC707D575828133EF9CBFAD5A65D3A8D3E514E [email protected]
684,887,270 *46B48C5AED3A6BC416CDA5C22AC8515DF032AEEE vampirecompton4
684,887,271 *46B06763C22494F0001625FAB71405FCA155D94A vampiregoldie1
684,887,272 *46B992D0B625D290C4E3FB75C8DDC5BDD607FF6B vampireiloveyous
684,887,273 *46B939EDB7E5E8F5F8B13A9E47961D4E0BA40276 vampirejoel1
684,887,274 *46B404119820A628EE5EE67F92071B943AEEBCDE vampireskater7
684,887,275 *46BE7F647E2188D4CFAA5A77A6B189D176BF4A4F vampire-slayer
684,887,276 *46BB580DB9C1D361D992B8CCE47ABE5DED88DC5D vampiresupport7
684,887,277 *46B59E014C036F7A72408A49703A994F253022B4 vampiretopher1
684,887,278 *46B78C4CCCD8FEDA6EC3DE9BF0220712525113F9 Vampyrisme
684,887,279 *46BACA288B30DF9CAF86565174DCC5CA481E3AD7 Vampyrluver
684,887,280 *46B24D399AB81C8CF2E9D879D595E7EE40CF5494 vampyyreista6
684,887,281 *46B542DC213EB5C5199B4E8F99254E010A8FB7EE Vamrofni
684,887,282 *46B9404F2D0EC4ED50D565E49D984BAC02A293C4 vam sekas
684,887,283 *46B2A2B6C602DAD7C5091BE7BCC70082ED33B3EE vamshi kondapaka
684,887,284 *46B3C202BF16066D6E04D311FD67B1220734A0A1 vamzdžiui
684,887,285 *46B6AF21E1361B9BD67C1C82D7EFE2AEC6E9E925 vaN{
684,887,286 *46BA450F14CB6C9F94257D613F5BE54E617BFC28 Vanadore9
684,887,287 *46BD84B3162EBE7F9B8AAAB2144A1C46FE9DC335 vanaja couppoussamy
684,887,288 *46BB8CCB0A667BA90085CA1DB1E4E7F2C283BEFA Vanakte0
684,887,289 *46B388517B603910E636B595C6A54ACBD232498B van.alar
684,887,290 *46BCC27DADEA47E449C4EB13F97D87233705B662 vanallia nie
684,887,291 *46BD7506A200848D2D2F3882D2F12D09E0722552 Vanalphened
684,887,292 *46B9BFE451C3B80CA79B3F15B2D7A11878ABDF89 van.andujar
684,887,293 *46B5F44B0284D999A570FEB5A23F3495F6299C40 vanasen9
684,887,294 *46BD04148AB3E4BE19D7DD0661E546173A8C5C7A vanaspati1
684,887,295 *46B32A281C169A0FB9AF86EFC5DB77BEA5AA87F9 Vanasse6
684,887,296 *46B06378C497977D544438A18AE9F5AB8F858057 vanaudenhovearthur
684,887,297 *46B941DE2B5A40BBFD3C64BB9915847D1FFDE182 Vanaulens
684,887,298 *46B28213BD5D1FC3331B297059A776DAC059A000 van-beek
684,887,299 *46BAD80519277A7A3E45CEAA57E9C552CDA8DDD4 Vanbeto6
684,887,300 *46B1ABB74CA3B8D9246E4F9B5DF6E659434B99D1 van.bignell
684,887,301 *46B5D726A7F0C3B76A31694F4F00736F7DA2DB91 vanbokken6
684,887,302 *46BE1B18914F9CBF2271CA5E142EF1A9650BB3C6 Vanbree1
684,887,303 *46B799A6C809FF8A9819D799C407D6F872088B77 vanbrughilta5
684,887,304 *46BC6A22FE94A93AA68D04184E75479F356E0FCA vancamdoed
684,887,305 *46B0168C21D987275756E527ADC61E8B8841AA4D Vance265
684,887,306 *46BAC40EBF651AE40A3FC380EE02281639A6DAEF vance.avallone
684,887,307 *46B7C0B2C1DBDA7D5215B6057A0286FAD8B1BA9B vanceboro3
684,887,308 *46B6BA97BC15B6F139056A0DBB2BB73B276CFA42 vance.budworth
684,887,309 *46BBF0538197C6C03A5F31D4F9B63EE7877D7EA6 vance.camarena
684,887,310 *46BFA090EA5E137FA78ABD5E9A7E609AD50A9E96 vance.cattabriga
684,887,311 *46BDCF19456FE09834799F13C299AE70327908C1 vance.claudio
684,887,312 *46B006597D96609CC6067DE15CFD414F1637E515 vance.colorado
684,887,313 *46B339DA7BFD09F7D8CA0B94F6C4A0DD432B7D8B vance.dantoni
684,887,314 *46B278F6190FC248E05061B46BC1586645DF0DF6 vance.davaz
684,887,315 *46B4A464F0D8FE9465848BCD6866A941D82FD82F vance.defosses
684,887,316 *46B74150CFB56BFCC90B3033AF8D9BB2FBA0515A vance.estronza
684,887,317 *46BC751AE4AC32D6B9229A486D0C6DC98EB21A42 vance.farrior
684,887,318 *46B5945EC392B4B2161ECF65BF1278D8B7F659C5 vance.hobstetter
684,887,319 *46B3010C04866DAB86DE894E498B533E1EBFC7D1 vance.lancaster
684,887,320 *46B31B2AD8820822A9C8102E0E9D5CDC9F59D412 vance.markland
684,887,321 *46BC8B0D230CB69C8AE993FF25F5FA109B3C0885 vance.mccarther
684,887,322 *46B9F912871FFA83A4AF04CEC8D21DF3D63CFC68 vancemejia
684,887,323 *46B29F28133FAD078E6258886D508AC1F423713E vance.metzel
684,887,324 *46BCDF2992E414DC76D2A1CBFE3C504BC92B2A39 vance.neighbor
684,887,325 *46B123D1ADC9616692588EEB298B9AD23BCE5832 vance.orme
684,887,326 *46BF3E7EAB5D1ECA874E4A14F47F26F5764A62E9 vance.pollan
684,887,327 *46B689865DEBD423B85CB01F027C5A62B3D74567 vance.ruka
684,887,328 *46BA1E9ACBBE5F6209CE8F0FE9E5E99D64C76135 vance.salo
684,887,329 *46BBBAEEAD8A608E810621EF016975C2B04C19E8 vance.sennott
684,887,330 *46BBBDE09CDF18745797BDD624E2C5A75ADDA008 vance.sienko
684,887,331 *46B82D50B578B144281B4566DE0B5C5474B17AE5 vance.sinclair
684,887,332 *46BB1564A2ED9BA8A8587344776F3F0E4E9A4154 vance.skyers
684,887,333 *46BD0E5D84E9A6D01F2D90DCB06A71C396E88571 vance.smeby
684,887,334 *46BE65334C59791975E53AFB40F1986C591630A8 vance.snoots
684,887,335 *46B14090C41ED3450DDA36BBC15AE2F7BCFFE674 vance.taraborelli
684,887,336 *46BE91288111530481B2606F2B552D21E26989EB vance.topete
684,887,337 *46B2A32F4428EEBEF7D9FD7A402C8BB652915A18 vance.truiolo
684,887,338 *46B6CE5E6DED863780EF90FA3DB45B112AD81814 vance.wellnitz
684,887,339 *46B3331A62DD49BDDD9723175D417E28711278A9 Vancomymcine
684,887,340 *46B2E08D1B161A40EFBA03A9B613A29321251ABA vanconant1
684,887,341 *46B17351BE059FE87E6A029B2C732F5321A740D4 vancouver16056160vot
684,887,342 *46B5E39FF9928D45467563A41D833F2820AC6B7B vandailausteaua123
684,887,343 *46B057DA9923CFCB17C84D51F60AE1D605A1969F vandal.dineshkannamb
684,887,344 *46BCBC049CD15D8DED931AE4B40438B6B3421A6B Vandaley3
684,887,345 *46BD2FE5CBA17B6EF7D9EA5189BFD2FDAD61AD67 vandaliée
684,887,346 *46B369DF9F31C601951D8D05CDB4FEE1F15DD8B9 Vandalism3
684,887,347 *46B9D8FA97893C730D860D4B9A3D7B427B1AB685 vandalism.66.108.111
684,887,348 *46B4FA9A2613B819B5C17BE0C4573BA84B322E08 vandallized
684,887,349 *46B18CF2ABB63CF05FD06B78FA784CA2A3E256AB vandana chawla anand
684,887,350 *46B95552156377441E45D35B8F14843284468097 vandana khanna kohli
684,887,351 *46B54F0159DA7F0F7D405A95E12E0C97FC96D277 vandana narang
684,887,352 *46B991C9BB3F9BC955F995042F3333B673C0DAB6 van.dannels
684,887,353 *46B251A376D86B77F43D9673466518F6FF1F0E57 Vandbreet
684,887,354 *46B4E95B2BFF5FCABFE219D250BACE398DA7777C vandbrnde7
684,887,355 *46BC6B7314D757FED32A4883D8021E4027563BC0 vandbygning3
684,887,356 *46BDA6473A439E11D76145939A3D29524E47C7AD vandeboom6
684,887,357 *46B8E1CFE4A251FB26B4ACCD25FBC226E600CE0B [email protected]
684,887,358 *46B5591A3DF880E8D37ED4E341713956E37B17FE vandelrhine
684,887,359 *46BF5EF407260AE5C55FF443DDE259DC181DC011 vande matharam
684,887,360 *46BCEF650518566355FDC031619466307C65A2BB Vandenboogard
684,887,361 *46B0C6F67DC1E16A0C526FFF54CF75E670F36D01 vandenboomBSW
684,887,362 *46BFFADC157243820E6DFED23EC9AD9C894DE940 vandendeveR
684,887,363 *46BD8D15AFA391DB772F2FB0551400459254B4AD vanderbagh5
684,887,364 *46BEBBF9B586D7E2F23B1373A9F91DCE6EE09B6B vanderhart2
684,887,365 *46B5E9FDCF49111754EFBADF7E1042BFE5B60310 vanderkoo4
684,887,366 *46B09E14C02CE568ADD8A5284F6E3FE1C0BE6AB3 vanderlust3
684,887,367 *46B6AE278552F326AEC1B9ABC5F21B8C6804516F vanderpligt5
684,887,368 *46B4563BE072CDF36F89DB4634823BAF7518A784 vanderryn9
684,887,369 *46BAC0296D146664DA7EF2569D1BF9F200D30287 vandersizing
684,887,370 *46B41FEE47D54046D536FC71E21E1AD6BE5008BD vandersloosh3
684,887,371 *46BF1542B4AC23DFA2949DF443D3D09D97A6808F vanderversepriority
684,887,372 *46B0A3EBF9710270C071DFBE2723C5EF35B64D9C vanderwa3
684,887,373 *46B8217CB2599CE904CB94E847A3C1199E352503 vandeslicing
684,887,374 *46B0EB22DA13089B815494CE6344F812062782CF Vandfase
684,887,375 *46B4E07DC53BF9837AEEEDDA8B183D2B1FC54E63 Vandiviered
684,887,376 *46B2518BE2E86BAE78B20993E21AA4396FE1901A VANDLEIA
684,887,377 *46B72B7076521C3CDBAC3B4FB90D541A249BA572 vandolzer3
684,887,378 *46BE990DD033F9ACF491869BF230BEE717DF5F40 vandorstens
684,887,379 *46B5DA3BEE0C7E585EEBEBA8EF3990A62D0DC866 vandoske9
684,887,380 *46B02F44B838A848010A1BF59D92E4C465CC313C vandreleden
684,887,381 *46B12AA35F580684F271C991B92BCE00CCB56FA8 vandskrkkens0
684,887,382 *46B8E1F37916BA51CFF854BE07D849FF8D2868AF vandwingelen5
684,887,383 *46B5EB4A81B5EB80E7E257B02180BEE96CB2F0FE vandykerevue
684,887,384 *46B978ACA944B0C17519AA612DEE6BCADFEA2DD1 vandylining
684,887,385 *46B2AA39EAC4863B9A500528CE30493C591F29FB VANDYWOODS
684,887,386 *46B394334D0DC994A5CD314A38C55C76ECA69A36 vaneeckhoven6
684,887,387 *46B08703A808FAE745C0A608CF3B0F2942DA54EE vanee coprus
684,887,388 *46B4D6F3D2453FD715223593470C22CAB1C2B49B vaneengevallene8
684,887,389 *46B961879CCE819D37DB758EDAC11A5979FE0D8A Vaneenoo
684,887,390 *46BF75D7CC3FD14E2DD62C4271DDAAA1A8EC5BA9 Vaneenscheiden8
684,887,391 *46B4C250D66B62360C9A014B8AB774354EBF9C78 Vaneggiare
684,887,392 *46B3CBA0E8E3537ED40AB23111176B098D026066 vaneladan
684,887,393 *46B6A35997ED4A8D86BFD5AD231B1E13F9CB96C6 vaneppsing
684,887,394 *46B7C5E3DC2952FFF983D46D7552893FE515DD57 Vanerps1
684,887,395 *46B2AE6C45D19CEF6B9349E70D41A268C0525182 vanesa cruz
684,887,396 *46BC990ACB535E09DD90DCAF98BB8A9F495E826C vanesadominguez
684,887,397 *46B3C5C688088BF10F9D2193AFBFCA260841CDDB vanesanavarro
684,887,398 *46BC538D271E8AB4B7B4F91DEFFA517F23064E3B vanesa sahibil
684,887,399 *46BE7E62868DE71CD8418176CA0C53058BAAAB95 vanesatoledo
684,887,400 *46B77B8DC0F5DAD44E65478C607C22AD6CCDD0FC vanesa woon
684,887,401 *46BD5102626E220295D9FE1A2D905102C84DBCD1 [email protected]
684,887,402 *46B8C5233803B9C1D65BB438251005AB89865B1B +vanessa+
684,887,403 *46B0CA54E3EECB1DF32C7BA84A0B6AC7A2AFCC3B vanessaa coco
684,887,404 *46BB89564508A7041F63F5A4CA7C28DFF3FF135D vanessa alyese
684,887,405 *46B260D02EE7F262DBC6B8E5F80A11C3B06ECB0B vanessaarguello
684,887,406 *46BEEC92DE28950A9D40ECA16A6F7AC209CF0F7E vanessa bogle
684,887,407 *46B154C96409FCEF318946CE20F0816FC8941574 vanessabrooke2
684,887,408 *46BA97A7B01CBF90A45DF06B715857E0A803B60D vanessa-claudio-max-magazine-mexico-may
684,887,409 *46B7AD5C2DB5138AE8F140F7D8B6EDA68A9EA702 vanessaegenias
684,887,410 *46B1E342272879252022A95463947687961A9645 vanessa hayek
684,887,411 *46B4C90DBDCCDD26F3D9D85BB00C75C18EF0B1B6 vanessahayter
684,887,412 *46B45F442CA201C1E9D53D5A0E3112217AA72787 vanessahunters
684,887,413 *46BB06427F2A7A581F27F170B6C539AE2B8C4038 vanessa j diggs
684,887,414 *46BABA835FAB4B544EA85FF4BBA642DDFFBF723A vanessakernodle
684,887,415 *46B15323792E2515645FB08ECAFA7045D4A1EB65 vanessa malipol
684,887,416 *46BB6D22CA7BEEF7600DF2E438FAFAF6C1B4F2A8 vanessamandich
684,887,417 *46B8BA554560B38540063AAE9DF36087254BA783 vanessa mcmurray
684,887,418 *46B86FD56DC1343048E8A0843BEDB6FC846C5C47 vanessamir
684,887,419 *46BEBCD856C4D30BEBFD903CE672C940355C86E3 vanessamodafferi
684,887,420 *46B7245F4BF49F25D49F662B714F2C23DE73FB52 vanessamoroni5
684,887,421 *46BF40F17AA269FDA57A245A3C0095A86453190B vanessapasco
684,887,422 *46B28CA1464F67A9EA6056A7BA29D6DE30E16D67 vanessa sailor
684,887,423 *46BE93D2FBF764260042BF7309BB432E8B03D862 vanessa setrum
684,887,424 *46B5149F9D03690C08885B35317BF9E254242914 vanessa st jacques
684,887,425 *46B6C92ECFFEEBBD6A48A9D2D49E737D5BA4BFD1 vanessa strange
684,887,426 *46BC055DF709762D223B8CFE960B0C5A8E122D10 vanessasupport3
684,887,427 *46BD63E66DC54474435C94AE24647013F1C95D51 vanessa sylpha
684,887,428 *46B72C0B13EC0EB1DB4006D87A40B06214F9FA8E vanessathewlis
684,887,429 *46BF75F8E9979D78919B833259578A4DF11B4CFD vanessa tiong
684,887,430 *46B81F30C87FD024048C53CE1F9CCD990BAAC6D6 vanessa tua martinez
684,887,431 *46B139B029BBAC49B815C864AC2EA2F74C34E12C vanessa turzanski
684,887,432 *46B993993A3264A510B9947CBA61016DCA4DFB31 vanessa validad
684,887,433 *46B3DA1FF6CA06C8D4CF0394B919AF64B1A72AFC vanessa vanwyck
684,887,434 *46BCE36F2A830488CD24A28487586864489A3158 vanessavanyo
684,887,435 *46B5972048FF90E2E6BD865893E80B1F58CDF090 vanessayepiz
684,887,436 *46B89BE51E7CA70C6CB9E02A8D807BD564039B33 vanessa yusufu
684,887,437 *46B3E294A9A496361D24F68674463ADB9EB4825A vaness hamilton
684,887,438 *46BC2FEA9AA955BF7F2F71BFE2B8343A5DEAE01D Vanessuky69
684,887,439 *46B3BC992CA4D2A69A0F10DE6F507FA320E61D03 vanettemcbride
684,887,440 *46B230E07A1071B44DB4E8BE6CF18FCB6231D491 vanezz lu
684,887,441 *46BC27059D24301B90FC2BD2547BB438F5DB62B5 van.faby
684,887,442 *46BB1EC86EE2A2DB39188A07EF22DB49E567C719 van.fragnoli
684,887,443 *46B131EF453538580AD68C7671E31121B2709437 van.gadd
684,887,444 *46B32E381421270C068D5034778F04AFD4C5CF25 van.garsjo
684,887,445 *46BF4E40FEF4A65230190491B4231C90565940C0 vangeertruyden8
684,887,446 *46B43545724524B972AB078533A555F509F50AD2 vangelisalaman
684,887,447 *46B9EF09C38836BE47647054DCD83DAB46551B9B van george lamo
684,887,448 *46B09A713AFC735272416ACBA0B9160CC182944C vangets1
684,887,449 *46B9C6EFCFE3363A60F9F9610CBFC2D546C07055 vanggie3
684,887,450 *46B82D79A5EABB3156B06CD78965DEB915990ED1 vanglo6
684,887,451 *46BA2A4A61A92F6CC1560422CABB81221C7B7FC4 vangogh.chwww
684,887,452 *46B988CA4317A8AD0CB0C48B5275A626A69FA955 van.grabner
684,887,453 *46B964F51EC6A6B8D473F8A9EE05840F76A3C4D0 vanguardbc
684,887,454 *46BCEAFC656B6F0108D0B3CF9E5FED2DD8F65D1F vanH
684,887,455 *46BBB98A909FAFF98F7EB05E6AB8E205BC50EA93 vanhaag7
684,887,456 *46B97FDEFC4FDA1B9D364E6812ACD666C4C489AD vanhall123
684,887,457 *46BA4FF6464094D99634B13D28379F6450A3DD49 van.hamett
684,887,458 *46B018792D914FC7386FFB62F2074ACE95AE7C21 vanhendel2
684,887,459 *46B76263C9B60FE443B6853A5F036A3FAF46412E vanherwynen3
684,887,460 *46B21651224DDD3BE62FE55747655C27A3992B5D van.hibbs
684,887,461 *46BACE580702DC94FC033A8B61D3DE4102686C37 vanhmdouel0
684,887,462 *46B12C7D3D44DE020A3E49BD1307890206580ACA vanhthone6
684,887,463 *46B5497BF9A5F6DD4E5AFA88067FB3704388415B vania guarnieri
684,887,464 *46B913CC8ABD1A5DA1C021D0749D4A021244A987 VANIECA18
684,887,465 *46B971C763882AA0E21409E0F557868AFCF2A797 vanikaming
684,887,466 *46BB363BDD9CA1F4E318B5B9757B7F1C5B1D3B4C VANILLA}
684,887,467 *46BE69CE07B1289AFA29260AEA6716D4AC55B05F Vanilla,
684,887,468 *46B9E19D4359A7042E03F7AF1ECF5971A2EFB5C9 VANILLABBABE
684,887,469 *46B0EDCF8624D6B330CF964AC4BECB18DFEF7868 vanillabowling6
684,887,470 *46B1DEEAEC34C8598404F6EBFDAF3D0909F3DC61 vanillafoxing
684,887,471 *46B03CE96D5A37B7F0432B896A223D9336199605 Vanillaj2
684,887,472 *46BDAE0B639EBACA012AF15733A2B170FCAA771B vanillalondon2
684,887,473 *46B11BF9AE414F1E99F141AEFD14E65B75BBCF43 vanillasugar0
684,887,474 *46BCA9EEE62D64A2BBD22F1CD42EA5DC166FA5BA vaninadhabsws
684,887,475 *46BF99FFC2D83BBC92FAA08704495DC51335443D $vanirei
684,887,476 *46B10C772E005C60DBC9987838AEF64B9A8DCC17 vanishingfraction3
684,887,477 *46B4F45059C58E3F4F5268FF785B509357EE7C00 vanishreedeepak
684,887,478 *46BE5C3EB379E911DF6BA460088F17C2C2B103B8 vanita buckley
684,887,479 *46BA651EC28FACBFC2C22E5BC3EFB959A06C3E33 vanitaerasmus
684,887,480 *46BA814AA4C4016084F051FC34D721405F56B114 vanja micanovic
684,887,481 *46B640C175E3872375C0CE30AFA0B63423A98415 vanjskes
684,887,482 *46B5B1B2951958492182A5891AFC2E4470DB073E van kiep huong dao
684,887,483 *46B3D3C4D54ACB5F2F5544F23B293C2A63CA6F1E Vankieu2
684,887,484 *46B984796573ADCBDA4DEA77EC317F2946E1341F vankilalaitok6
684,887,485 *46B4FD66277450F92FFA4317A51585D337F05273 vankitoveri1
684,887,486 *46B63B576C066F0335871A08A1A534F0D789CD34 vanlaten7
684,887,487 *46B92A9F92215682214923F9B6B87AF6E5A98BAD vanlawick4
684,887,488 *46B3DD8B2069D1B248478750FC9606B9C2A49475 van.levere
684,887,489 *46BE41B364A827C838D2389344DC3BFEDB247F53 «vanligste»
684,887,490 *46BB7F4B23307E47C681EEE9A4B1FE6738FAD1E2 vanlondon1
684,887,491 *46B3EF12CC671ED712911A8AFA8563B639D2711D vanlooven2
684,887,492 *46B8A8958B72199E0EEA9198CFD625E59CA1C907 vanlorynen1
684,887,493 *46BFD9B0F22FABDC2B6C7FCCCEDDE8425F30C04B vanlucero
684,887,494 *46B9B0E32F0C7711FA6DEC5BDA8750F05C0831C9 Vanmakts0
684,887,495 *46BDFA4224CC92FCF3F762A95FE166B6B2D59161 van minh ta
684,887,496 *46B973E15CC7A05DCEDABD46081541DD2F10FB51 VANNALLENANDREI
684,887,497 *46B8D7C9D2C6E7B89D8E6427E982A4A9DE088E18 vannara3
684,887,498 *46B357A97B85F0EE7F43DE54F53E602D3B38AF06 vannara tep
684,887,499 *46B486C386DEDDD2E1192677D477E2DFC43DA74D vannastavno4
684,887,500 *46B3730F8006410CB6295B3A70E96143F6EB2791 vanneisha simpson
684,887,501 *46B993F31DB041BA65FD643A4EC8EB7CD68D32DF vanne patrisse valerio
684,887,502 *46B7EBF6F27D41426CE2D9342DB9AF0811BEE698 VANNERIE.
684,887,503 *46B28346CEDD00D36AD9AEB671B3DDA5070856FC vannesachantelain
684,887,504 *46B280F1FA31AC2817ECE1DCD4DB08568D58EB57 vannesche marie
684,887,505 *46B4FF406D23946508BF5C0878B7EBDCC3B58737 vannessajeannette
684,887,506 *46BB5D2BEC4731974565A4B6C43532D662AA504C vannessalou
684,887,507 *46B4F69CE7D31903BAF8E6474699AE80E3BDA1C8 vannessapriester
684,887,508 *46BEE69098EB80AE3A48340F64ED9A067DCBBCD7 vannessareyes
684,887,509 *46B353BEF42A71C04830FE0CB7C4F9A90EB64EA1 vanniejane
684,887,510 *46BFC09B7B2C3E65DA2EB03BB2A6AA6F66D63365 vanning's
684,887,511 *46BC6F7987C967DB1DEE9C159A205D1A3A16F6B3 Vannini3
684,887,512 *46BF268F9D0832D1CD8A8B25469B908C74C7EB58 vannsamblaceno
684,887,513 *46B7778951719389D3EC6D0A19A11F55A69A6609 vannyfertant
684,887,514 *46BF18BA29B8F4A7ECEBEFF155239E55C5D7E3A9 vanoekels
684,887,515 *46BBA98BA4E904331BDD0B126FD14BA809E46402 van of angels
684,887,516 *46BCBA0604F53D2685BD4CA74C6C9FE472A97E2F vanoostenbrugge4
684,887,517 *46BDCA76722174FE95928F2E730D7C5BCE078439 vanordervae0nao1rder0
684,887,518 *46B9F9C7E5C89057B2C87DE1617F18AC1322E7F2 vanoverwilliam123
684,887,519 *46B910DE85E13EA35C992E6FFA8FF9A19CF966EC van.pinsonnault
684,887,520 *46B94CE6534194C9D155B33A7AF984E6CD5F5862 van.pippitt
684,887,521 *46BD7AEAD2621B63B26B7982EE3BDB8FF37B8967 vanquish4u
684,887,522 *46B8A67C6C3B1C20EA6F250D5181813A004BB3D6 vanquishthelight
684,887,523 *46BCB04F07578ED6064273322B78A1F3C74A84E6 vanreiling
684,887,524 *46BB23499E904414447CE4D9B4E5F50C0FE21D8E Vanriess4
684,887,525 *46B20C746B9943C1F28075BBF1FB4CD7DC8DED52 van.scavuzzo
684,887,526 *46B1E90C5E3E014B14F5F9C60F381FB669494E30 vanschuyuer6
684,887,527 *46B2E5D344FF126384DCA3632744F9A59D07A7C1 vansdets6
684,887,528 *46BCD4A4DA8D4DF367D2BDD9C82F3370A0B1A1F5 vanshardware.comvanshardware
684,887,529 *46B35ED6AFDD0628AE99C150743B61E7DFE7A218 vansker2
684,887,530 *46BC5D1D2A0878DFCF247745F8AC08EA7E57D220 van.sleppy
684,887,531 *46B5A3D6F59DB5513B65ECF54A5E8F7AC78C0C61 vänstersegern
684,887,532 *46B22197A661E3154F76F95DC253D26AAECAE330 van.stothart
684,887,533 *46BF93A3457BA4A588B3EB9B5C786D0841A18B9C van.stryjewski
684,887,534 *46B289DAD0B97C192B885C0B0E1430491C5A8DD4 vantaç
684,887,535 *46BC609D6B34680CF4DFA4F217B3BF31B7E91A47 vantaviousjohnson
684,887,536 *46BE9982EEFBF7B4C442EE27C39F982D204D00FB van.teaster
684,887,537 *46BB9CB5689DD60B1FCAB4CC4A3CD0D0FA9B6DCE vanterestes0
684,887,538 *46BF884BE2A9A4D7DFE504CACE53DC5AF650CBC9 Vanthof8
684,887,539 *46B66224CB40984FCF90739CAC10795315846059 VanTieghem
684,887,540 *46B974A8B1AEA8FE50FD1435009FDFB12D0079FB vânturiș
684,887,541 *46B9EEEDF1EE6956A90E95582B647C3FD5FCC6AD vanuatumoise
684,887,542 *46BDC3CA3778C593649EF9F3454FAF12310103DE vanvettiges5
684,887,543 *46B1C7D707FD7BFD2515B0E43329CFDC28DAFD09 van.wai
684,887,544 *46B92377125E7609FF2BB3E64C2D408E7A67456C vanwechel6
684,887,545 *46B85D095CF8AA8872EE05EC685F91EB3B591A07 vanwesterrop3
684,887,546 *46BAAA48BCBD5BE8EA0863347CF8F5B139D8E730 vanwinklevae2nwih1ngkah0l
684,887,547 *46B0B39924F7F92DA9775A81AE89F8D6482F153E van.wozny
684,887,548 *46B43A875AF9E7367556D3EE9F3D4A7498BF6BB2 vanya dyankova ivanova
684,887,549 *46BB53CD9D4DE5AAFB42204F0D61C6F0FE1A1B3C vanya reginaa
684,887,550 *46B3F563D9218AADA10B4877E7E40AF31D92C5BE vanzilla6
684,887,551 *46B3D74CE37D7EEE0EFEFBF8A2F4990DFDAC5602 vanz seloterio
684,887,552 *46B28AC8D8FB310366980D2CF4950E4CA4EF2F71 vàơ
684,887,553 *46BC73D72C01A1D541CB76ADDA12049AC0BFB0D8 vapaaherrattaressa
684,887,554 *46B2F04C73304920C77B0B713CA5952C442BDB2D vapaakivääri
684,887,555 *46BC9AC5ECDC37FF456E20BE9F822AE8D8F585D1 vapautuneisuu7
684,887,556 *46B7C68F79CF8B471D70AE404B52F03269E81A51 Våpenmotivet
684,887,557 *46BCD423E6CDCA92310D897E87DEE0E4C92CABA8 VAPEURTJES2
684,887,558 *46B5DB55DAC647A87337202546A6943EE655B2EA vaporación
684,887,559 *46BD3DD23ADD5783E3F8321DFB1568D30047C392 vaporam1234
684,887,560 *46B7C7478F7FB43277510956A5ACB1A003A58491 vapores9
684,887,561 *46BA69B11C92573E1EE0BF1F24B4B90AFC71605C vaporumu
684,887,562 *46BABCE391452D688DDFD828F33E413F554C3FAC vapourspace8
684,887,563 *46BDCF769F97796964209D57BCCCE5031B34F979 vapsimata3
684,887,564 *46B65C629EA15B81343D882177A24D171F88E4DE Vapulat2
684,887,565 *46B8CEE46150AA4789B7EF4D2ADBC42E6DA607DC vaqina pagina
684,887,566 *46BA4DE6348C0447AE4EBA9E5CD007117B59763C VARADARAJAR
684,887,567 *46BDB9D8ECDC821B709B7CE358019D35B1E34E40 varadhacharisukumar
684,887,568 *46B1232ACFC11ED7FF0848F7E49E188B3D95880A VARAHAN!
684,887,569 *46BAC8862D0043C445B4B6EFFFF12B5FFAD16B21 várakéval
684,887,570 *46BC477D67DDF0740B83047B63E61EE5F91E5063 varallisuudesta3
684,887,571 *46BB14D1CB44C4DAB248BA1B8CCFCDD10678EF4D Varamentos
684,887,572 *46B394A74974A46B3637C6958AA970EC0A1F63E6 VARAMTHARUM
684,887,573 *46B0555CF783021F55445E2BA7BAEEC9AA98EF48 varanda”
684,887,574 *46BA418EA26B3B3768E3DE87EAFC1EB4B37BDF0A Varastoiminen
684,887,575 *46BB753CC392757EB48A6F1FB1692BA686AE863C vårbalsdamer
684,887,576 *46BFF8C12463B6A4EB75C2A74E989FED8A9DD21B Varblane3
684,887,577 *46BDE172ED244ECE54E855C25487211AC5FAAFA8 Vardarbanovina
684,887,578 *46BA0E7B82AB0E5A45E6FF118AEDFC951214A9A3 VARDENESET
684,887,579 *46BF443F72D8E01F8FE2169EF2E91F7546C3F01E Värdesemantiken
684,887,580 *46B120060986ACE33CAC49AD47027415A9C63B9E vardhanaath
684,887,581 *46B45BD12AA45B7C7271859D052B6A94D7CABD45 Vareajes
684,887,582 *46B05D8E392C5F92678FB5B4355772EE0A33BEF5 varegemą
684,887,583 *46B285AF172686AF9BFD4DB748C650F96FE41DBD vareomsætning
684,887,584 *46B8D9BC5A2C2E36B688B09DAF1E74DF2CDB16DF Varerai.
684,887,585 *46B7E6490F2469D04B3BA3578967432212A6D439 varese-built
684,887,586 *46B6C18E837F934A4DDF041A7FA3CB16863045B9 vareshnagrath
684,887,587 *46B22C6707CE292D345CDED2B9E47E6E43441217 varga zsanett
684,887,588 *46BD0CD78A10F6D4B4B68D1B03CBCD2177A9DC20 vargedob4
684,887,589 *46B1EF09CFC9D23042A8218A6344D597F0939BF2 Varginia4
684,887,590 *46BE4BDFED6746754B10AA4482CA41DC787A83DD Vargueo4
684,887,591 *46BC2ECE40F14B54CEEAF4A31EA75BF73D623626 vargunteius0
684,887,592 *46B4946F597FC182106B71941F3B330E7D6FED9C vari+7ype
684,887,593 *46BDD980C953B33D6D94A11FDED791C6BBA8206B VARIAATIOINEEN
684,887,594 *46BC83E34CFD6BDB65C15BD2AD120B3FE0C9EFDD variabilele
684,887,595 *46B8EEADEB0B5101DA3973074F794C45146B8799 variableeverymanhertzsprungrussell3
684,887,596 *46B81CE12E1C8EF637C50A9B987C3C8A43E859A6 variableformA
684,887,597 *46B18FA4B06C426786162071F0293EDF1760DDEB VARIABLES5
684,887,598 *46B44A39C5651B63706EE6035F5870FCF4E7DFA9 varibrite
684,887,599 *46BE9C75D2E43F4A5C9685F05591ACD337D2B60F Varico5itie5
684,887,600 *46B85A486FF8F7480B74D8DEBA73EF7BB1FF316C VARICOSO8
684,887,601 *46B7CBEDE5166781C9D2801D9944301C885842DA varidell3
684,887,602 *46BEF0BC81A2A2FE1E2DBE2E0F27CBEB43E79263 Varieesed
684,887,603 *46B7CB951A92F7BB471415163B83AF158D5861C9 varieity
684,887,604 *46B98B23C81FB500C467D412510A07F3BBAEF85B varif0rm1y
684,887,605 *46B927489D4B9E9609C1F0E22A82ACA335B2B004 varikkokynneill8
684,887,606 *46BF39157B7C56D9C6F9F34155AED250EB504EFC varikshrthaker
684,887,607 *46B695A9BFC87716BB82FAE8C69B6C53EAF5FEAE varionee hoob
684,887,608 *46B81A6C93821BC281D72BEF86DFC38B5FB64459 varionvarion5
684,887,609 *46B17E6722E7A63DF2423C30872B32A036FF9567 [email protected]
684,887,610 *46BE1E15A050E4DBBDC820650F291340427FD408 VARIOUS-YU-ROCK
684,887,611 *46B2FFE5193B280E6062DD6EA8C1819A5AB6B966 Variscit6
684,887,612 *46BF62A2F8ED05B108EFAE3109DF4C0D06526E68 VARJORAADIT
684,887,613 *46B83A3CEBA4E0DDBB7D95FC34837199AEF24A10 värkgeler
684,887,614 *46BEC336FA8BFD9A2A2BD7405F70C37410F6763D varkkibsw0
684,887,615 *46B7CEB4DA5EFC8FD169BFECF0516751DE2BEDA0 [email protected]
684,887,616 *46BFC463028F59500BD58B1B7AC9CF970E39E630 varleted3
684,887,617 *46B3FC2749BC6CD2B4A5858D6D79128640C556C9 varletteimfromuptown
684,887,618 *46BE08BC3EF7F29AB7D4893B76BCE770FB903CD1 varletviled
684,887,619 *46B8CE35776FBD3279016BFDE50F0EDFCE2682C2 /var/lib/dpkg/info/libpopt0.postrm
684,887,620 *46B23ED8EE98D72FC134DA83D2108BE053670412 “Varlık
684,887,621 *46B3B38E48D4765B47700FCA12AFADE3391216F4 varlikkiran
684,887,622 *46B899ECB54357AEBA9F73893129B96397F6D501 /var/log/blufx.com_log
684,887,623 *46B77EA510EAE1D884C29DFB8A8B2BDE931C3CE5 /var/log/chkservd.log
684,887,624 *46B63D6D20A62554E27A18BE03147FAFEA0701AE varmalandsskli
684,887,625 *46B71C3B0CF9179594FAD5F1528D0693CCD649EF varmaren
684,887,626 *46B6F226834B2DB380FBBB410F3C772A6F30FDC8 varmeskabe7
684,887,627 *46B6BE94151A2168FA8874FDF25386D038927BA2 Varming7
684,887,628 *46B9857A85FF3175D2AFD733C46468A1332525C9 varmlandsfilmforbundm
684,887,629 *46BC028B70D7A563973A348DD4AAA09C00B1AA07 スウェーデンのvärmland地方にある、hagforsという小さな町で生まれる。幼い頃から、
684,887,630 *46B44AD58B8763E601E0A2EC02FA02EBCA7EE183 Varnanskog
684,887,631 *46B90FADFE6E436DB39A17AB2673C65185C6B76D Varnishingday!
684,887,632 *46BC96E2993957A7E28E3A5E4D1A1B20ABB4829F varnlunG
684,887,633 *46B613A722C2E44CBE28CAA466B843179B7086DF varonis3
684,887,634 *46B658E7B6B834CD2B499F7E2E9C4D9CFAABB0EC városkapuja
684,887,635 *46B51FF8A8D515300822A7585BB6F49595849757 VAROVAISESTIKIN
684,887,636 *46B9ABEB65E707CBA2159CB1CC0CDEA04ADE2D7C Varqa
684,887,637 *46BB505E58036AD21973F95572FCF1FA351510FD varquera0
684,887,638 *46B28496ED747E03DF494CA4B9B54573B5219E8B Varraco7
684,887,639 *46BB239D321206597B12028B55171B44F25A0E84 varrevartiainen
684,887,640 *46BE260BB562EA355738104F9ECD6AC8CD592DF0 varroniane2
684,887,641 *46BB7D5FB417DB6FD95705B696BC483620AAEA08 varsayamaz
684,887,642 *46B38BFB4E9229B8E47B625E486F09FA9F621574 Varsayımları
684,887,643 *46B6B30DA845DD76067ED54F3CB35F2E24B21FDA varsha nidha noorfarial
684,887,644 *46B27BCF535C72CFE9C82B7755506FC462AE91B7 varshasachan
684,887,645 *46B115B6991309068C639D2C1A6EF4E3EC633E70 varsity house
684,887,646 *46B69A1957EECFB54577B8F10F874BCEC5C20D15 varsnar1
684,887,647 *46BC3A407EED7B8BD98A83C6C201DC088CECCE94 varsylvia4
684,887,648 *46B134AB42FECD0063BB941231F54FF8E9B073DB vartanfan
684,887,649 *46B5250D9D562105C71736479EE600D0AB550E38 varthelsting
684,887,650 *46BC3FDA3852F0F705D7909E227C545DC875ECF8 Vartinaa1
684,887,651 *46B3E6A426262F66895B0951EE390A425ACC9BCA vartmaanyanvishhyamaanaah2
684,887,652 *46BC1B3FBCC3C562843E99004590E901BF1078AA VARUMOTTAGARES
684,887,653 *46B9D764052217FD69CA5BFD99D5A6054804B405 varunaaching
684,887,654 *46BA798AB1F901C70908F098CF2E7F11B7B8AEA1 varun indani
684,887,655 *46BAB92754427424645B0E63BF4E69193AACE2DE varun kumar garimidi
684,887,656 *46B591FD68446A38BC8C864AE0547AE9A88AF814 varun kumar lella
684,887,657 *46B67A7EE9E4515DF57A68755F87B624BB5C90FB varusteluohje8
684,887,658 *46B1C8ECC018CB56B4642B3BBA43944544613D2E varvarucmisu
684,887,659 *46B4907309EF1478B2CED3AB9BB4762D8D6752AB varvtalsregister
684,887,660 *46B11F935A6A7A1D1303FC921B4BACA0A4F3F1E4 varžupe
684,887,661 *46BDA080D12CD503A98BD115DA768BF9806A6343 VAS+13R
684,887,662 *46BB29097A25850D47D8240BF6C5C5CA6B196288 VAS311N3
684,887,663 *46BD24A066B65DE79A65CBC70FE951CF256811E0 VASANTH123456
684,887,664 *46BB8260781FE4A4BC04EC88D419086D2AAD34B7 vasanthi raja
684,887,665 *46B80D0A8A76E415D19EB2D05CE8FE74523D2F47 vasanthpt
684,887,666 *46B465D1E649779B362F11298E9F044722F311FC [email protected]
684,887,667 *46BE9A55F773E6617A36EF771432830A26AA35F4 vasantunknown
684,887,668 *46B07730EFF769DC01704237581D3EEBA839F8F0 vasaoont
684,887,669 *46B8C8132DF5EF7224DF00A05A1CD5D27EC96202 vasc1n3ra
684,887,670 *46B7E135D6118B4ED4AA5AAE6668C4224F14DC32 vascaminandosinhuellas
684,887,671 *46B7981A5E46772AF2E423A4B06D5512AAB09377 vasco-da-gama-tower
684,887,672 *46B30B8A6331D40560C27162D0EFBD4C73FDADD5 vasconaromana
684,887,673 *46B2BBA627D80901059AC3461FA9323C80D12215 vascongado0
684,887,674 *46B8942766FADAD841BD2FFAFE3BCF4C98A95ABA vascularcambium
684,887,675 *46BECEDFA8D11310AC4FC5F7D01987697EEC9D08 vase1ines
684,887,676 *46BC6FA21A2D08CECD81C922FC3B8BB5F5541FE2 Vaseg 3
684,887,677 *46B0C929C117F11D7A977B45AAAE6F254820C913 vaseuse!
684,887,678 *46B494647B9EAF48BCF7B4DAE23100DA9A4EC7DB vasewn
684,887,679 *46B2694D01E785641CE3CEBE8F6B46A2BA4BA046 Vashakidze”
684,887,680 *46B826AEDFF57F90E1E07A2D840E710BFC8DA808 VASHTI2
684,887,681 *46B6B4DBDB52AB24A58514E419698FE6AD90727B Vasi56
684,887,682 *46B0110565BA6A5D799424D8F35811974E7AAB67 vasiflandirma3
684,887,683 *46BBB23F24CB915B83463DA76788AB7F387ACF2C vasile cojocea
684,887,684 *46BEFA8D843033B1EE686B2013D120DD080B1C8C vasilehutuleac
684,887,685 *46BCC0A70D82EDA9EB9D825CB88CD50E85229D88 vasileiosgrigoriou
684,887,686 *46B5BCD0F329C488954BC1C042BF134989BFC0BA vasilikwn5
684,887,687 *46BA5946251DAB9B2ED3F211C13F9BD0EF0CC982 vasilises8
684,887,688 *46BFC845CDAA29AD8AC7D7D8CCD5770DB4A51CE1 vasilis loizou
684,887,689 *46B1CCD012618BB072512118D3EB0611D592CEBF VASIMOTHTA
684,887,690 *46B1778FA4C573B0D43E504A6E52D3EC702AE7DB VASINDICTMENT
684,887,691 *46B4405017F697AE7D40283FFBFD86B2BF77EC13 Vāsiṣṭhiputra
684,887,692 *46B6D53920324FBFE9C48D8D536FA6BF9924A22D vasjoner8
684,887,693 *46BB393F12E557DF8312B33E57F46EB029041D56 vaskapuszoros
684,887,694 *46BCC49B5A8FC0D4007F32FD161C1901675F4AAD vaskar shrestha
684,887,695 *46BD90F6F85F2A87CD1A73AE853C7DBDCF996EE8 vaskasbsw5
684,887,696 *46B3F636AFB18BB6205F98E1AA53FCBB3F14DFF1 vaskbart0
684,887,697 *46B086D59EF3CBAE8C5F8492C5FB0A4D147DD63B vasken sissian
684,887,698 *46B9C007316D9C966CF1E99A00FE2601770E129B vaskilla7
684,887,699 *46BECA53729E7C3418279D75BE8127212527A186 väsktillverkare
684,887,700 *46BC0F36147715F7717FAE3C273F02A547CBAB70 vasocongestion6
684,887,701 *46B9DD664A914D7DB05FCD2D14BB70F51B8C35A1 Vasodentine5
684,887,702 *46B9BA00D24CBE116D474215C7E46C8AAB13B1B7 vasokonstriktive
684,887,703 *46B48F9DF63DF8312EA9CCF42170C3B6D2CA26A7 VASOLIGATURE2
684,887,704 *46BEB913124584D829944A5E8C4EBBE0A27560EE vasorrhaphy3
684,887,705 *46B1C6B5D9188B0D71A39E971C08A5449CADBD0D vasosection1234
684,887,706 *46B2AC270999C3C65C13DC534018D677C6DB6713 vassanego
684,887,707 *46BB5FF29438F58AA0C7A3B2EA88546412D96101 vassdragas
684,887,708 *46B869077940E8E91E6A767A64477E244E26161D Vasselinoises
684,887,709 *46B6F85D8383096F288743A283EE83DCD0699612 vasserez9
684,887,710 *46B59E48D468318761B116BD3C95DD5B7060D36B vassilious4
684,887,711 *46B411787B8E3FEF06A30DE8E9776D81C810190D Vassimoniot
684,887,712 *46B5DD65DE6FE5781A031877A3DCB30567D7E46B Vasskanal
684,887,713 *46BBBC5C0895F371D5432EAB444136B2FC02571C vasspan3
684,887,714 *46B5C34DDABCA1C03F44083D74EB7B5C0275DD94 vasstellen
684,887,715 *46B0A11923AD3791727635FD5E0E413B522D1C25 vastaanottavaisia4
684,887,716 *46B838A12FDDB14459866945F548782143D56ED2 vastaanottoke5
684,887,717 *46BD3E261802740CEF8F939732B5C98C524C8C09 vastaanottose6
684,887,718 *46BFE41C8CAF2C7FD952F591210DAFED6D7302E1 vastaavanlaisen7
684,887,719 *46B7350FEC3AAAAC1A47F67A6BE5C23AF3B6FB34 VASTALIITTYVAENAE
684,887,720 *46BDEAA3508EF1AB2F1736034EA1FE0078BC629C VASTAOFFENSIIVI
684,887,721 *46B78025BE3B308355F592FBF1C9B25368CD7F37 Vastausl
684,887,722 *46B4FA131BF338FFEE60B191FD07276E18EE6FF6 Vastgenagelden5
684,887,723 *46BEB8C076CB4646B44979E194FB18FD9D955963 vasthas
684,887,724 *46BA41109418FDA628ED205360FC8543D44A19D4 vastiane8
684,887,725 *46B0F7951E6CCF19D6F593122E8C1244E81052F1 vastions.
684,887,726 *46B37E2591876EBCB2E92533F03458CD71122384 Vastmanl8
684,887,727 *46BC0AEE069E18D1CAAA724E03170693560D9177 Vastnagel6
684,887,728 *46B5D6FC8DB330BFCA096E4ADFE0C9C264678CD8 vastupanuliikumine
684,887,729 *46BF8D96B045A7745BBEF501A988F0F3C58203CB vastustamislistaankin2
684,887,730 *46BA46C9C5D63FE8A2D939B847BD9F5C06742CD0 vastutuulelaev
684,887,731 *46B1315503269E8C352066E3D5356F4841B19302 Vastuukysymykset
684,887,732 *46B62AB007A05448FDFF64A77D666F3ED7725C34 vasudaven3
684,887,733 *46BEFCECC804EFF2E29A1EB7CBA02F82A84C8563 vasupālita
684,887,734 *46B3F75F64C21C932E4480482C0DC842B544C456 VAT749fol25
684,887,735 *46B9D25979A1F525D01A308A0BDEB4A8CE0BE3DA vatalaros2
684,887,736 *46BC4B8E0C38460198E792AE8B5C9FB4FED80875 Vatanit
684,887,737 *46B1493B1DE4F305D3573F9DEA286BEEDC6AC2A3 vathachea
684,887,738 *46B19E9A07CA8BB976B035EFAA5F7E21821A2373 Vathounia
684,887,739 *46BD746C9C8AAB2D1753B40A41919E3CC8D91D46 Vathout2
684,887,740 *46B64B1CDDC5C762AB812C369C676B74EFDFF915 vatican-mediated
684,887,741 *46BAF466DE58A355E2F686A264F3060F17C35F8F vaticinante8
684,887,742 *46B7F40E520FAA79458E40F77224A8949A143341 vaticinatricing2
684,887,743 *46B961D6933B2337308939806CF72E0EB19789CB vatnsdælingavisa
684,887,744 *46BD51802B0A452839310A7F32A624975DFDF3C1 vatnsforðabúr
684,887,745 *46B644F2E772DFB01D9170D1345AE0FE72C66F9B Vatopaedi
684,887,746 *46B1CAAE76C1F343B75DBBD699D866A902A38FE9 vatosoftheastralplane
684,887,747 *46BED1912E024EAB1B8FE7DA45CA00EEB822CA3E vatovato7
684,887,748 *46B6E81B07041199DCD2F893D0AAB782C34A8619 vatretn
684,887,749 *46B7F0A80779F55540CFE88EBA881BCB9E5706A3 vattenlåsen
684,887,750 *46B3065481E1AD1B8AFD26C440477F058BE9F1F7 vatý
684,887,751 *46BAA6D98E777FB31B21F0999499DFE670528C53 Vaubans
684,887,752 *46B97339A66DBA3C62B57F029AB4F4F1DA53478C vaudenaybsw1
684,887,753 *46BE29EB0B905191938A3A02FBE6EF8650A46CB7 Vauderens
684,887,754 *46BD6003F700134461ECF6077AFAE4CBCF9DAEA2 vaughan allan
684,887,755 *46BE6C0CA0ED25F128E625041BF7DCB9AC985510 Vaughanas
684,887,756 *46BB395D11223471AAC8D04F299A6A4FBE17DE1A vaughan yegambaram
684,887,757 *46B7C0BF2762B05E56B00EE381A36404549B3403 Vaughn68
684,887,758 *46B6E243A1ED03F4527AEA5D241C4752F566368D vaughnalvarez
684,887,759 *46B178D4349E05BA7C9761430A8C08F2C8DFB6C3 vaughn.bresnahan
684,887,760 *46BE83D9176508984500505131DF5E9117A92172 vaughn.carrao
684,887,761 *46B95BA114C783F6F615ACD5255B283441CB41FF vaughn.delcueto
684,887,762 *46B3CB0F52BA9BC70EE809234DBDD986217955D4 vaughndunston
684,887,763 *46BBB988E46CBE7DD5967C3CC64D830792E30BE0 vaughn.fernatt
684,887,764 *46BDA71E0EC14E0F3754C818B3F9C2029FA6368A vaughn futter
684,887,765 *46B7182A35EC32F65650775490D514BF704C6CD5 vaughn.galentine
684,887,766 *46BEE865CB4E00ED3838A86FA38CED894C920B39 vaughn.herbolsheimer
684,887,767 *46B33EA771A6FD60D3496FBB4B764EDDC248957D vaughn.hink
684,887,768 *46B0981CF1A9DEE15657FABC0730B111827185AD vaughn.holderman
684,887,769 *46B5D59862B503BF1CE7A51F35D3AC209B6901E7 vaughn.huot
684,887,770 *46B84EE0423B0F66A5A6901E0847FB95D9C53533 vaughn.jempty
684,887,771 *46B8A54003ADF16EFE1D7149BBB44D02C9B633AF vaughn.keath
684,887,772 *46B259CCE56AD983552D2DF7622629FE65A318FE vaughn.keavney
684,887,773 *46B695B5DA44A13A415B878814CC2235E5571534 vaughn.laquerre
684,887,774 *46BC0522F865CEB330104650792F05A7AC3A6CC4 vaughn.lazzara
684,887,775 *46BF917A05E76DA8A5D72481494B88BDF60AD16B vaughn.lollie
684,887,776 *46B0A6BDF134C27A3E04F28815D65D1ED9B2A82E vaughn.maniccia
684,887,777 *46B8C0A631DACBB484B3863606F952BE24CBF1E5 vaughn.mcclair
684,887,778 *46B97BCCBB0C94EF2E98E50B42916AD5595224FC vaughn.nakai
684,887,779 *46BAAB9BCF795C430539A8A8AA29CCF857029FB5 vaughnnewberry
684,887,780 *46B7FAE80F0055AA09F9AA79953C7F62CD14C985 vaughn.oyuela
684,887,781 *46BEB90F9052CC1A521D078C265A09763FC6B6BC vaughn.roethel
684,887,782 *46BC1E5612DCD7BA87B6E0EF073F0B813C70BCB1 vaughn.sarne
684,887,783 *46B6470B46D9AE9B1A58AB5A2FE4F2D4FF322C7F vaughn.seldon
684,887,784 *46BC1D435192592159816480C60484BF888070BC vaughn.tervort
684,887,785 *46BCC8E2982EE38B9EB071250F6D2C899F07C26D vaughn.tippin
684,887,786 *46B4267CAE173DA921BDEF1E66D91B469E4248E3 vaughn.vandenbosch
684,887,787 *46B82B734ACD11DC2F465E3136CC794D33AD8590 vaughn.vollette
684,887,788 *46B595B60AE6E2CBCA9B4FB322B8DC75EF0FCBDA vaughn.voth
684,887,789 *46BDC0BFF0A3A0371A02A5507BA1D765FEF899BD vaughn.wilmeth
684,887,790 *46BEE05D1B54D3DB740AE99A9E30DDB5F4B2A36F vaultmatt
684,887,791 *46B0912F7B1E5DDF7A00E30B5B661982D78B5A04 vaulttluaved
684,887,792 *46B6F580D133F465F8B7DA5C68FBAC2BD208EE2E vauncesing
684,887,793 *46B31C5D1F9777D903D092FD4FBBB5FA16DDDF99 vauntinesses7
684,887,794 *46B385ED9AE56CA2AD569353379CBCADA927B5D5 vaunupeite
684,887,795 *46B48F7A04724648D1DA06EF720164BFC35D4778 vau_office01
684,887,796 *46BD16994D09757AB228312B80936E626989099A vauraasti5
684,887,797 *46BBA7303C8A25FBA1DFC10D11456D722152A90D Vaurainn8
684,887,798 *46B829D189854D1391F1DC567F7DD5D6BE829228 vaurlet
684,887,799 *46BEFC41E4EC3B19B51F3E1F73C4C878291FBC44 vavadhi
684,887,800 *46B637ABB08C038E2A8C39C3894F5F0A1D967464 vavadmal
684,887,801 *46BD0134EDD37F476E7072AF38C08DAE9B0F97BD Vavatsikos
684,887,802 *46BE92214A3F1C71FDD7FFE3F7CCC9799DF0238F VAVOLA6
684,887,803 *46B2CBA55F28F4B216B3B23626739F92CF342BE5 vawwwbtrqw
684,887,804 *46B29D24F408E69A710F9BC38719E7D360F0DF0D vaxalley
684,887,805 *46BC74F457BA4925C13B6D7DE84FCA0057C9073C vaxhardw1234
684,887,806 *46B716F579C8A644C9AB60AF67FA5DA570F5C2F2 Vaxtin
684,887,807 *46B77A09BE09F689D4B7558B6849C30C607EB650 vaxwaller1
684,887,808 *46B56E09966A7FAFC284792439991583524C5D2E vaya nabila safitri
684,887,809 *46B144E73EA6E7AFA798FAAAB87CCEE7AD5DEBC7 Vayetta1
684,887,810 *46B3723498F07D371CE94F06725DE551F767B400 vayleable9
684,887,811 *46B405091C77625BE34452569EF2AF9AC5D9E70A vaylliaunce8
684,887,812 *46BD69AE65B00A5FB13FE1E38084D3C679D7EDD1 vaz-21011
684,887,813 *46BBF11DE7336075346286FD831325C3D90C4DAB vazhappalli
684,887,814 *46BFE4CCF6F2FDB4AE822633F9F47CD7189CE772 vázomotorického
684,887,815 *46BF0B68FA6830285D2C3E5B9C5A4E3166256C39 v!B
684,887,816 *46B0E968AA6A9F466542CE1A9D2C84E5294D2840 vB"$
684,887,817 *46B9D8F59097A165DDDB66E0349876E8EA76A271 トゥールーズvb(
684,887,818 *46BC121D51CCB08478C712B9B30AA0799DB166BA v$b+
684,887,819 *46B78B0BA54E6400C086C9975F97CC92F7D5857A vB=0
684,887,820 *46BBA44E7FDE4DA6C3338BA89E1E122C78B279D3 vb1'
684,887,821 *46B56B192B2A991174FEF9446A74111AE56F5851 vB1f
684,887,822 *46BAB11EB46D3777D3D21F21E4689943F5D5676A vB`1%t
684,887,823 *46BD22C5A49F350A76E83B76BDA3B8D73AF63AC0 vb2515vb
684,887,824 *46B93B284A7187CE48DEC8CD15FD11EC0C51BFA6 vB7a
684,887,825 *46B1B76D82124666A04A5263C396FB2B265FA826 vb;aa
684,887,826 *46B806E055CAC6F3C54AE7F96A46B4DEF4D390C4 vBCY
684,887,827 *46B09FDB09D58F0A2EDC4B04CDEBCC47FB2A9080 vbderefcontros
684,887,828 *46BB033F746543F64AC54B12E3BCC2D9E048EB7F [email protected]
684,887,829 *46BFCD65BC6231E41F259B5E05CC2D6AD66A1A3D vbenstilstandsbetingelser2
684,887,830 *46B621DF89231B2919A8283CBD99CDFCA4056687 VBERRY
684,887,831 *46BDC04C8BD781F90DF6FD28B6D13244FCEA5543 vbffaa
684,887,832 *46B7AE5B2F8CD853614CFD0CAEE2304827E12623 VBHEVVD17
684,887,833 *46B960A44115CBED51291DAA53E7F3182DA22EC3 VBKFLJG
684,887,834 *46BA03993996C83003F64EF03A8A52966E8BD718 [email protected]
684,887,835 *46B1E23899665DEA6A5D09DC9640FDB86CD2A92B vbma.net
684,887,836 *46B8E28A4C4BA4FCD6D180D51D836A94FDF886E2 VBMC2003
684,887,837 *46B2811B04A4ACAA7CE247109BB9DD342CF3CE69 vbmmrshing
684,887,838 *46B4E887AEC6E4CE65E484ED94085B213559FED2 v/BN
684,887,839 *46B3ED682FF64E07417C43818B3E89EF73C95A1B Vbpnrwot0
684,887,840 *46B00C1A139F2649E26DCB58501FB539D09CA2FC vbsingh5
684,887,841 *46B9F9EAE4FBF14340FB628D9F54AFBDFB3A919E vbsurfering
684,887,842 *46BB7B8AB55BC2ECE02B4CDF8992A229CAF96D7E [email protected]
684,887,843 *46BD8D8F52015E7716490E50CF6C65AB7678A7F2 VBVMRTG54
684,887,844 *46BEB0697BC8C1206A0B7115A494B9D43FCAFC7F vbxing
684,887,845 *46BC388D18AAB2939D024B0A1A872324354F5030 vc{
684,887,846 *46B950E2F9DA5A6ADB5B00EA1E41953C5A693790 vC0*
684,887,847 *46BC9E9619C5A4E8D3845FAA36F6211CA6975DC1 vC74
684,887,848 *46B8B5D195118FD6139E4735EF23BBBADDB8B5F4 vcaespitose
684,887,849 *46BFEAAD16E8124516820867D02738F449255E59 Vcaller4
684,887,850 *46BE7789040F96A22C1C85849AF6A3930117F14E Vcasefied
684,887,851 *46B0CF688BA955E7FEC4EAA4912BDE959C92E63D v)Cbaa
684,887,852 *46B775612858A566C7984E947DBAD8F88B40BFE9 VCCSOUTH0\5
684,887,853 *46BEA0A37FB1B182D5FC9F87D3658009F6E74845 vcD]
684,887,854 *46B352156123B54758A5C962E7AF9A239BCD2592 vcfr4tng
684,887,855 *46B6CF6BD0512FD8E2F24DBFCB084CE7640FDEA1 Vcheryl1
684,887,856 *46B2BE664DCB896F94646FA1758D2D4FEBFBFA1C včítane
684,887,857 *46BF0C2945BC8DA89F55BC397A17022FD79D3824 v&CJ
684,887,858 *46B8D564B9150FA6DEE2C36308FDF58E7049AA77 V!CKY123!
684,887,859 *46BF2F1E753C246CBAF438D02B3080F7E564BF1B vclaires
684,887,860 *46BFC1DB56CDDEE843D86E4B0A4141BA8A1BC853 vclassic7
684,887,861 *46B1314C383C34E8E6C7C801EFEC1AEBD00A9C6E vcolasantoed
684,887,862 *46B0CF427B1C2EE5CFA2363BB21C46C68893D1C9 vcs...
684,887,863 *46BB23A8412F409F834850BCA5F9BBCAFEBE28CC VCTRCRDGRMM
684,887,864 *46B298B3FCA4279BAE2DC5EA247E2B90D52E2162 vctry1920
684,887,865 *46B4A453D7A5A8BCBA433287113FCCFDFC2CD60E vctrysprrw
684,887,866 *46B784C57177F0DDEB5C41236CBE8A828C0D4440 vcyP
684,887,867 *46BAA1B9E2DEE85612FCF3C216350C217373179E vcZJ
684,887,868 *46BCF0C85B9EE8779A6E47041AC41926E4E92262 vd-^
684,887,869 *46B34AD8094748832A86A3F565015BB7643DEA50 vD0)
684,887,870 *46BF4FCB9A5CAB2B8EB545FB360450FCE7883D9D VD0v
684,887,871 *46BE982036FBE8AF4063232F432D65E5ABDDA511 VDDELBSHESTS
684,887,872 *46B62C2B83E64C4F4DF082F78D197D7D7AC8BFB3 vdderne7
684,887,873 *46B13B9F093D161CBD65C9CA909638C8FA924142 Vddz3kr3ldwmv
684,887,874 *46BBBC4CB3E3BDEC4EADC3D3C624430101D6C021 Vdfwrite7
684,887,875 *46BFC444D98585893A0B71D3BD7B9A22AB552BBE vdinnbsw7
684,887,876 *46B4496AE1469529329243333AEA11B31AF64886 vdinzsum4
684,887,877 *46BAB766730445A60C4E01EB0242DD623AC3A60F [email protected]
684,887,878 *46BAC732C3222593A3B3D24BF1BC5D55241E6B2B VDKDleYJ51
684,887,879 *46BA2D6D147AEC9BD1C8728656A9F61C5D9DD631 Vdkpyhf4
684,887,880 *46BD8C9F92C84E557DF8226B26112DB1B86D221A vdlghldls9
684,887,881 *46B063C347E57FCC37634909E06138B2C4D3CE72 [email protected]
684,887,882 *46B00140D7473364B45A44AF10707C60639D9ABF [email protected]
684,887,883 *46B8FEF256739E41B3D0C89A75A2AA66987F59E0 vdTd
684,887,884 *46B79660BA4B8B2DC48556180D4F04092A57DAD2 VDVLR
684,887,885 *46BED3A3176FA45C8DE1DC4AA8864CCD69908826 [email protected]
684,887,886 *46B1EB9459864307EF859A12C22E993DAAA3441C vdx;
684,887,887 *46B82D99D85B4E3C34FB07051836D0CECEB5C511 VE1117941145
684,887,888 *46B46365598D9B7F99F405733449DAAAE179CABE VE11!CA7!NG
684,887,889 *46BE3415B9BFA46A26CC8F41209E4B253255CEC5 ve1ti1p4s
684,887,890 *46B16749B2A27D6622F0A7F692FA702E290DE87E Ve1vet1e4
684,887,891 *46BD4EDC0DD2AD062E70450DF6A990BC063FCB42 VE"A
684,887,892 *46BF9C026F286DA82A16811935D7F15E9900E92C Veach’s
684,887,893 *46B8BC125894A55D94C0AE255F4C92FBF7C27645 Veanear7
684,887,894 *46BC5F23841EB83F2F50F79144133D61CA65B6AD VEAOJP
684,887,895 *46B50E8AE1B7851C3080F5B5E46524ABDF501861 veapons7
684,887,896 *46BD1FBAD00D9C7D81394F089D0C22B70974B277 veatice5
684,887,897 *46BE2138CFFD5247C0679B9ED134FF360C0D1767 Vèbressä
684,887,898 *46BD8408F371C8984FE29964BD3280E1A1F1DCA0 vecchiardi4
684,887,899 *46BB258D35531D3B2253773EF1BF8BA2C0CE7F11 Vecchina0
684,887,900 *46BBA38B28B3A9DB590102752069764D24347F81 vecente3
684,887,901 *46BD30B76F2D1B2763F756709CE5CBF48EBF6078 vechérya
684,887,902 *46B220F2ECB16468ECFBF0E4D629A2A8EF7D6F62 vechtjassen!
684,887,903 *46B8E6BD508CC17A95DAFF5B6734D5B7AD33E166 Vècio
684,887,904 *46B03C9B284D0D930928DDDADFC577CE01DA9705 veckacheka
684,887,905 *46BD75A629BD812AAAE0ADE471CD367C6639BFD5 vecmbb
684,887,906 *46B3E8DE4871CA8A38FBF5DEEB07C8473227B0E9 vectisvectis6
684,887,907 *46B674D87FD6903E387554BE3F02B42AC476C704 Vectorizing5
684,887,908 *46BA28AAF9CA35EE3F5B15C8112F632C40589D34 vectorsy2
684,887,909 *46B380959E033FBB83D95BA1958499E0355D7FD5 Vedaadev3
684,887,910 *46B1E9D2870FB3B6E4978D9116C3EA7ADDD13377 vedadora0
684,887,911 *46B5FC48130F5DFCECD7E6BE45DE158161593F93 vedaismn0
684,887,912 *46B85C88FC7B11A35F41E874C5135C360E6C7643 Vedanga0
684,887,913 *46BA7350B8937C8E792A33AAD43A0040B6A53120 vedantsrinivas
684,887,914 *46B2D1B4FB600878DE3A7A6562166E2CE4DCE176 vedapandits
684,887,915 *46BF3CF283084179268A0AA9E6A94CD109833E16 veddemaal7
684,887,916 *46BE363424E714C731DAE1D8DDDBCFE9FD153DF8 védedfurther
684,887,917 *46B5F292D2C64E5B95A29EB0AAC6E10A5742AC14 Vedenou1
684,887,918 *46B9FB2E947F5EDE5DD4A8A1A83A91259D1A5900 VEDERKVG
684,887,919 *46B9BEE516CDD7FC8CA9A8E33A2E7AE31F137BAD VEDERLICHTE
684,887,920 *46B430FCC15D40E2F975276FF7744E6A4DEA8FA9 vədəsinə
684,887,921 *46BA5677120B918B1EE2C17B36D3B336A45755D6 vedetaroxana
684,887,922 *46BB355C1097717A00A7016D840BFFA21D05264F vedkciuq8
684,887,923 *46B055C1CC501D08FB07301AAA2E6D11B2ED4146 Vedkommendes8
684,887,924 *46B01F86A7825D956B31E2123C531072168186EF Vedolia5
684,887,925 *46B5903F82518EE571CB18C67E9D893EF04BF16D VEDONO.
684,887,926 *46BADA8199E8938FA697A073EDD79CF556EC3C50 vedous
684,887,927 *46BAF210FADC2C04CF050F40424F21F524501050 védova
684,887,928 *46BB1A5DF1F2A89D9C5598ED0024080CF72038B7 Vedslet
684,887,929 *46B36B593B25BDBC7320B0EAD52C41055F1ACCAB ved
684,887,930 *46B1AD066D1C70C25F703F045DFBEBC8CA18471B vedtaken7
684,887,931 *46B6F2719B0CFB974ED59B689FD89A5B0338D090 vedtakets5
684,887,932 *46BE1D6E15FD2755F23DA49D999AF74B32F283DB Vedyxamasten
684,887,933 *46BE2A3CEB6AEFD6C92930C1FDFCF622DB635A7C vEe[
684,887,934 *46B2CE46A81E1165B1C51827EC5FF8D56F2F9F64 アメリカ・フォーミュラ・スーパー・vee
684,887,935 *46B559FFCA4A97AA7F5B6F538F9627517F17AC94 veedieveci
684,887,936 *46B78B4D5AE069081A4186998F41A1860F348020 VEEDUPADI
684,887,937 *46B7DD0706E8D611042B6D7280B8B1E49160D707 ve
684,887,938 *46BF43D72DA5C174CAA5384C7A820F380444A610 veellotas
684,887,939 *46B0E47ECF8379727B93FCF9E45267976235DB2F veelslachtiges1
684,887,940 *46B196BF9EC12A189E9F60B3CD1AA542E83CFEBD Veelwaardige!
684,887,941 *46BBB83C3CFB85EC4D525A31066BAA1D6E991217 Veelzijdige.
684,887,942 *46BBF4FD4FD643F1F04AA2ED0ABF1EA5E00099CD veena dey
684,887,943 *46BDC61C35F471E2D3FA18FF86C1FFA77E2D76B1 veenasivaprasad
684,887,944 *46B7F51B9262FAD35BEC118D4A443568184918BB veenu lodhiwal
684,887,945 *46B24A96081D0F62E385CCBF2E55D2408D7D2AC3 veerabhadran ananthanarayanan
684,887,946 *46BD9AFA87EFE7105FDF5658347D8C20CE70E252 veerakankannams
684,887,947 *46BBCB93D4CD11C380A8616BFAF41B367028E81D veerakorhonen
684,887,948 *46B293DBA34DC736EADD8CAC45C8E84E48632307 veeralehto
684,887,949 *46BB6815897C5DD8C4D780B44EB5E958ED4195FF veeravan pumkasorn
684,887,950 *46B855DC7EEC8264BB8414B302A672A35DC18866 veerendra sirangu
684,887,951 *46BA960C37796B04F92ADB7A17DAEFF11946BA39 veet1234
684,887,952 *46B204381B17CFC2BE616975E69235D25D1DA298 Veetrice9
684,887,953 *46B0F388677E2A9E6E6D14617D22628852BD8601 vefotography
684,887,954 *46BE2C7E95E10F4E99BEF3DC0D3E0A7C93A2C874 VEG4N!$M
684,887,955 *46BF06661D8CE3913C80B75EDE5886FABFE64194 VEGA1227
684,887,956 *46B8A7EBA294F6A14144A913141A1FC69B011302 VegaGranados
684,887,957 *46B73C3CBE68CDAE9B25D5F7708130C9E5356D6B veganfeastkitchen.blogspot.comveganfeastkitchen
684,887,958 *46B4908A7D9B2BE2D37347DEA1A637699231BE11 Veganské
684,887,959 *46B8892C894C1C7B1586B47C6AF1FD673AEDB169 vega sanchez
684,887,960 *46BD52416D7A3010D6BE89D2ED86ECEFA5B4103E vegashelicopter
684,887,961 *46BCD4E9BA0157664BCB421A624AABA1840B0080 VEGASORBUST
684,887,962 *46B49A6E648BDE85E44AF5CBD8EB0683A62877D8 Vegavox2
684,887,963 *46BD4B12E7C4FCA2F8B274D8865B565BBC841E53 VEGBALERINA
684,887,964 *46B0CED1ADC7CB82768A9414B292DD3E55F3B4C9 végbevivője
684,887,965 *46BFFA68D96257AA26F82E6CC0C6180A064FB924 vegesacka
684,887,966 *46B44591D7CF6D922F55566796B97C35D51F1474 vegetari1234
684,887,967 *46B96B7D5E2410F27BD97C746F08CA34AD19047A vegetariandietetics9
684,887,968 *46BD8E763C92FAF92032BC5A1BF376DF849C6D34 vegetarianisme2
684,887,969 *46BBCE1B4A7669566A36F4FBC141EDF90AE4CA98 vegetate4you
684,887,970 *46B4FA32EE64723DF807B712334470ED0E292A51 Vegetaux
684,887,971 *46B7DEB0CB3A5FC47340B092C52EA91EC78E49EB vegeterer8
684,887,972 *46B67952C010C23A865329D7DBEDB73C39DC6BAE VEGGIECHAN
684,887,973 *46B137F1B9575C5080720D3CBF1756631782C036 végigaludta
684,887,974 *46B8D2D4FE334AA3780E225065B92A4269EEBEC0 végigszűret
684,887,975 *46BBD5696DC2E026194B020FF7D551CF5C3CA6E1 vegitasandboxra
684,887,976 *46B3270E3A2081DDCA4EB4F414ACA7090DED76BC vehei
684,887,977 *46BD0E3FB57455230EAA89D9D73E64DE5A5765C8 vehernan
684,887,978 *46BC950D87F85D058E6133CE5BC27F87E7D10838 vehesîngeh
684,887,979 *46B8876AFAA812DA2C98F09BF6A317DC341A2D6A Vehicle」と呼ばれていた、2010年以降の
684,887,980 *46B835AA50238FEBC74DE40B923E33AA7207BB44 [email protected]
684,887,981 *46BEBB5AD7E82A7EE415A3AC410DA89802F830AD vehvfycre
684,887,982 *46BC1E3E4C18D3270DF228DFF4A8E52830626E7F Vehzaxa1
684,887,983 *46BBFC13A822949BB40A1FB12501CF3A043AF5BC veI;
684,887,984 *46B5DBA45BA3716F9FA2D467244E20F9D3A4E872 veiguicela
684,887,985 *46B1037D32A680A33620367CC52F41F9B194089E veikim
684,887,986 *46BCFCF4E146B25AA513E8B719F94D09EA815F7A veiksmi
684,887,987 *46B21140DEBEC359A185FAA6AF25580B3BD11931 VEILED5
684,887,988 *46B2A2CCB7FFE0FB6A9928F7485E54E4F826B8E0 veiligde9
684,887,989 *46BE93202E2EE2D53F7E81BF432D3A78314A2453 veinsaard8
684,887,990 *46BE2CEFF6BEF071F10FDB918DC5EC1FBEF0E2FB vei-related
684,887,991 *46B7ED55EDDAE87BBEE8F2DE173C1BDC62F606EB VEISSER
684,887,992 *46B493916C47A7ABC7A802D8B3F5FC3AD4EF7C30 veitveit6
684,887,993 *46B68310EC33F77C326A214254A3632C8A945468 Veivesening
684,887,994 *46B7832EF3F830673ECC9ADB6EA9113EB98DDF12 vejacion
684,887,995 *46BF1B1E35776C86098CA20685F8CDC535CFC5B4 VEJAD7
684,887,996 *46BD8BFAD1AB4C0688297C0C4C20C6C4A6E6A6A2 vejamna1
684,887,997 *46B7EE4D72B11153FBFCA8EC676440C87CC9BE31 vejaraat
684,887,998 *46B2A8A72F76A1B30BBEC4F5DF69382FC14C76B6 Vejeres6
684,887,999 *46B0F6B0766AC06559C9CE7766FDF368D0CF1AF5 Vejerun9
684,888,000 *46B07387D09987EC0046CD4E63A771BC9B15EB0B vekazturkovic
684,888,001 *46BB38189CF46F3C495A7CF335980A38716664F2 vekho rose
684,888,002 *46B1FA147EA48F1AEC6275C2FEF9C045541E4DF2 vekkelses
684,888,003 *46B2D5057603721ACA45894929C36789EE8E71BB [email protected]
684,888,004 *46B1A2909FF2483D9ED60BE110FEDD1026ADBBE7 vekselererfirmas1
684,888,005 *46B039C7B9A52241FA0A7E83B600CEFC3121FE37 vekselining
684,888,006 *46BCA5225059EBE501AF3FA1AD9281529DA95271 vekselverkande
684,888,007 *46B744F672CF9B33D9A3A737E8C01D0282CFCF32 vekstpakke
684,888,008 *46BC933406651280B8204AA794694F06F121B4A0 Vektoritauteja
684,888,009 *46B2CE3F848D4B9E807482FBDCC4609842D9E9C4 velainebannister
684,888,010 *46BF6366DD4945FD4E9FF2E7D0C148B67FAFC384 velal?
684,888,011 *46BDAB8666C3B75D28A13523082AE507FB1D10AB velanskrevne5
684,888,012 *46B5A0DBE3BF64B47A6A28BC166C59FEB29E257B Velarizing1
684,888,013 *46B8F9C634E25A98AB21A5B98D636DC95BE60B51 vēlarvien
684,888,014 *46BFD9FE7B7D7989F8D83D3EB6F1D238907159B2 velatos1234
684,888,015 *46B7ACC14981703284606C85C8065A14712CADE8 velavali1234
684,888,016 *46B7FDE1D06960DD3CE0F05D8D832BDB9B02846D Velb
684,888,017 *46B94B520528F4AAEA7C6F92E3B7883B22B18158 VELCROORCLEV
684,888,018 *46BE13AB774663F99CDEE9B79D77E86BACD207F7 veld?
684,888,019 *46B97F1478F7BA49464196D63ED39969D82E3415 veldagricultural1
6