List database


# MySQL hash MySQL password
661,120,001 *442AD61D0F520C7A285D4D89877E20096F1C58C4 [email protected]#
661,120,002 *442D159446EF4D695EB372B2174141975CCC9E5C MYLES-WESLEY
661,120,003 *442EECC187FD35214EBC0830AE3122FD8D05EEB1 KEEPSNUG4
661,120,004 *442EE5D094A7F398C0341F97185B3EAC9872624C [email protected]
661,120,005 *4420AEEFEF3C43EBD6B26B6D068690ADD4558F60 KENTONODONNELL
661,120,006 *44289715228F82BF1F75324012931BE2D7226B55 NALICICE9
661,120,007 *4426DA27DE145968487B588608AEEE925E744AAF nathanialpaviolitis
661,120,008 *4422B5CD3E367F63E06BEA52140493327E86B19A kit2514
661,120,009 *442EA47840233230A172A7F1B603E4367811BB9E NERI ROBLES
661,120,010 *442A1FAACCE2285D2276003A9B49250D8763418B NETチャンネル(2000年10月1日
661,120,011 *442E978FB29CAC3CECD3EA2B2F53883FC02BA195 neuverschalung
661,120,012 *4429507B9B254DCF6145A7F717228F4FE9C169CC KQ5AAA
661,120,013 *442BD2D6A860024FA3C82D1FBF6ECAE68E6FFEFA NFLNZLJDR
661,120,014 *4428D790D0758F9DC419B9D39EC6861EA05E6EDE nic.burton
661,120,015 *44221BCE9472F9763E170CE8130E88FB424B5F4A krystry7
661,120,016 *4427C20E8A41BBABF4C0223A3F030CC811F04DB6 KURTISPLANKEY
661,120,017 *442C028A393446B6C1C63FFD5A7A839536B6CA59 KVALITEN3
661,120,018 *442DA67FD90D1F9B17ACF750A4D9F455C931EE78 [email protected]
661,120,019 *4428F817D7A9A9D1A3F3D79B07628832560899CE nnxprmntlly
661,120,020 *4428C786BC33D471ECD6C3596D91DBFF2B7118CD NOBLEAZZNARA
661,120,021 *442DB142EF34605606D1B209F77249677676D832 NOBLE.ZARCONE
661,120,022 *442CAFA217BF2ACB4AA91D0484CF1AF8EA8BEA5D NOELBOLLING
661,120,023 *44240D3F924BC9D0C058FDC4E2B0A56AF230917D noerodberg
661,120,024 *442354644CEB33153097FB7EA722F7858126CFC9 [email protected]
661,120,025 *442EFA39592D6806E3F4EE4C42CD159E0D28C8CE NONATTENDEE
661,120,026 *442576EB4F703A2D30FC9E5A246E747C773BDB9D LANNYMALICOAT
661,120,027 *4428AA67361198E189244C461DD09C251A5E0DB4 LARASMINIE
661,120,028 *442EA7C501991868B5FFDAD74C8BBE3D3ADBAE16 'NOR.SHALL.HE.SMILE.AT.THEE.IN.SECRET.THOUGHT,
661,120,029 *4426CAF034E596F8D46E98D7ED17B2DF592CCD4D NORTHC
661,120,030 *4422A4A2A53E236F62B4D65EA803154EBE0BE1B2 nprtnts9
661,120,031 *4428DA96684A8F239A62E0426D9BE2BFCBEAC28C NSUWARNAPATI
661,120,032 *4426E6C62AA4F3E3C8E0E5322D4426FA52AE4742 NTDPRSSV5
661,120,033 *442ADECFA6A8993415E1217CB63B8B376911B679 NYLETTE2
661,120,034 *4422BA7751594E15B8E21064AD3DAA092F817EAE }o{[email protected]==8
661,120,035 *442AE3EA2CFBCBF12DE8B0BEC2118D933BE348F6 leeds_lad06
661,120,036 *442093645235A74783A56C39E1FF3D302D82ED8F LENARDTAYLAR
661,120,037 *4429EEB680B00762DB13AE8326B8F2E27611CE1C LENFLATH
661,120,038 *4425E2BBC3298CC49A8A23FA40A99D343A7B01D6 leonardokingma
661,120,039 *4425176DA99878F5FDF49DB9554D48B8AC86F71D leon-broodryk
661,120,040 *4420B28A6CCD531B9BF07A26040BEEA683BE324E LEROYKARANGELEN
661,120,041 *44278A6A81E4B8128EA0E3CD3F258F8252D9E4D5 OLIN.CATALINO
661,120,042 *44236E86D19C113A98481316C4A15290842041EB LESLIE.WEMPA
661,120,043 *442B763098E0527232F5983D9ECCDE131580C789 lethal-mg,-manu-kenton-&-dj-ghost
661,120,044 *44290D0C62BCDA4EBD2246FC42CE16DE43A82116 LEVANIAS7
661,120,045 *4424E4B085703D19645FE359CAEB38F82353BEDD lijfstra5
661,120,046 *442F82263AF9BB5AE872AA45FEE5FA686D9A7CBF LINZY-PHILLIPS
661,120,047 *442D40BA1D08F40276AE6B3AD50727089EF02792 LIONKING
661,120,048 *44259169173305CC66050F11F3A17EA02B53A7DE oscarluczki
661,120,049 *4428594B3A36EE00F02EB2EC3C3702C9308CFE1A L’OKÀ
661,120,050 *442369E243A1EC789FC5C07EA1DF3ADD781CA4ED ........LOL
661,120,051 *442F23E81BEF8A5B3F2CA532FBD36BDEEE391071 OSCILLATORYDISCHARGE
661,120,052 *442F835F2F3B9CF50EFA5EDA9010B7EF291FD79A OTEBQLF5
661,120,053 *442108287F49FF496ACCBF2A181129645E459008 lottigna
661,120,054 *442E81491B1A8CEB8493A8386F75C63C5EA64F7A OUDEHH
661,120,055 *442211B59FEC4F5371D41CD58C4CA1956BE25DFC LUCASLAURELLI
661,120,056 *4427B0AE9035DF4153E833F9732EC8CA8378559A [email protected]
661,120,057 *442F48BB0A6F5B51F217B1760F83DC4D43B5EEB7 lucweyn
661,120,058 *44284C9E5EA0CC4D77D97A5C0111A4E91F323E6D [email protected]
661,120,059 *442F34AADD5CAB7689036C414D58A5FA1B7DBF16 [email protected]
661,120,060 *442B11C324C477C22BAD13D2F7A26C8AB0FF02F8 [email protected]
661,120,061 *44295914795B42FBB8A1B92BA9F3E2D61D414141 [email protected]@ting
661,120,062 *442278F1ABECFFFEE8B187C05CD25E9208D655BE PADRAICO'KEEFE'SSLIDEROADTOLISDOONVARNA
661,120,063 *442493229E99C7FCA32E976C0BE24E06EA5A108B PALLAVI GHAG
661,120,064 *4423410411B20E9B00289F9585A76E1C3312D60C <P><A.NAME="N_149_">149..</A>..CLiNTON.1/17/98.DEPO..AT.5859.
661,120,065 *4423356C88C7B731CDED1EB79DE98A587DC1E51E MAGST3RALLY
661,120,066 *442151F6AE608A0709986D2FBD5CF1359B47D262 p======b~o~o}8{
661,120,067 *44258A4F40A4E346A59C88AD8AA612B46AFC8172 PEKINESE
661,120,068 *4428CCFD21D2F8A05D8FD4BCF33FC255BD51DF65 PEPSI
661,120,069 *442CE54362E16DFB54B0195197B0C4F0E2951F78 MARK ROMULO
661,120,070 *4428E5B1293A443E230EE9C3101469A8CC08F96B markviscera
661,120,071 *442F6CF53F176309974359E700C31BDE6697AF50 MARONG 5 0
661,120,072 *442D95E34110637E3B96930878A4AF6949E3F41B MARTY.KOUNICK
661,120,073 *4429175166BEEFBCA112937DAB248E94FBEF642E philiphendrick
661,120,074 *442299D717558069AF0B9B47B85F64A8581ADEFF PITHARAM8
661,120,075 *44244162AA203E89C488AE07E6F42F5F9B89E4E5 podvili9
661,120,076 *442B280D3259C58289452579EBD6767CEC3BF711 p====)~o~o(~_^)
661,120,077 *44289ECF101CB364DF04F8C4D62FAC59A0E0B664 MERRILLREEH
661,120,078 *4423E797F7B06256D3C4430259763A257ABF657C p--p `~ `~ )0(
661,120,079 *442BC50923FE66469FCE3DFC3A6B8F2CCBB4AA92 p##p~o><
661,120,080 *4424F8163D98CD4E4AFB433F1B7A8E8259DB3588 p======p ~ ~ splat
661,120,081 *4429AB0CECA101B2A43EAD339A6E523B721F2CA1 MICHAELINNISS
661,120,082 *442E9A59131324B64F9FA56B8B4EBB1D031199A8 prekndergar+en
661,120,083 *442FD555E2C80E1842DFF7E41619ADD24EB9261D PROFILEDOMINICHARRIS
661,120,084 *44242B90B387E02988EA8671E9F47B3F94325B7B MIKEETOLENTINO
661,120,085 *442C2635DE182862FA51D820B52475213E9D2168 MINDY-SHEEHAN
661,120,086 *442F8ADEE502C03A26E56AB998398DFBD431A0AE minestrider
661,120,087 *442EDDAF2B2E28A08CF184DE0B6FE3DE2A92F7B0 mista.vybe
661,120,088 *4422A5B4D43C0AA66FB94D477CBDEC89C3728D9F QAZWSXEDCRFVTGB61
661,120,089 *4424B45CF69F8E24A441564AF35894D14A192243 (M.ORIGINAL-MIX)
661,120,090 *4423BBD52853074C894C033170D8C4A9886B87CD qk.
661,120,091 *442287E648756FB3B7C3715BF0CEBAEEA8F48030 mullinders-5-0
661,120,092 *4422070757163CAB14F663066C0FC066AC75FD05 MVLAWN
661,120,093 *44233D119A15DD1696A237548BCE23C305886819 questsuccess
661,120,094 *44239EAB1746ACECCD5FDF372AF8EE3E363B9CB7 myristicacée
661,120,095 *44268AFC167F4EE6D9945C12CF54865E2C2B54CC n$
661,120,096 *442C8C4DE086D938FD38A3F8FB74236E0D698AFC R4+0N4L$
661,120,097 *442C1370A75099D9FF1459AC8D5EF9E1FE9010AF NAMGU-KIM
661,120,098 *4423AA3071F4E71D492C3DBF15F7B6BB3C6F90B9 ŔAÈGIÈ
661,120,099 *442E7F0CD1405972DEED454182C2FB37A7934897 RAJARAM SUBRAMANIAN
661,120,100 *4420919B6D615236AFBEDC4FF5CA28FA24B7B7EF RAKSHITA.BANGERA
661,120,101 *4429114255132AB51D4F77487AF76CE024795554 RANDAL.DUNAKIN
661,120,102 *4425CD2240CF9550C42B2E72B3DA29F2CC15C22A RAYFORDMAYZE
661,120,103 *442198949219C94F1321B97CD7E61A9835C8C902 RAYMADRID
661,120,104 *4427A7B5BF7772369B881B79BBA8DFFC067EB9B3 NICADACASAASSASSINADA:TREMPARACORDISBURGO/CHORACORA
661,120,105 *44232E4F3F09A4A6C2595B69C79FE85D01002984 [email protected]
661,120,106 *44298D096970ECEF45F30F1F921ACE0BC73763F3 [email protected]
661,120,107 *4423914C913B1D7C19412D5674A0DDF9F6C2B869 reincarnation,.cycle.of
661,120,108 *4427A5814CEBF10895CEF13A8A2D303A73CDC19B REPARIERTER7
661,120,109 *44216E0E7AFD6149C00F68A58DE669C5920F30C9 RESIDEERDEN.
661,120,110 *44211C25A1A7144D95E33AAA5D591302FA79666D RIBANDLIKE.
661,120,111 *4428076C2E273532DEDCF4C8F07E88AEA71A3076 richdixson
661,120,112 *442505B9F4AC426133212C6B10DCA5D2886C03B2 RICO.CLOWES
661,120,113 *44202EF83C724AD38D6394B00CCCE5F66E11C1BF ricomcaskill
661,120,114 *44283053E842BB8DD55B15959834309F9A76D8D9 riff.scientist
661,120,115 *4423F2954AEFF6FFE24EED3449BCD82DA4033ACB RINGE'S
661,120,116 *44205F1F2F210A4894E1FCEC62A8DC8514A78392 ROBERTFORREST
661,120,117 *4424219EADBA1A89754AD38C4AEF5A18EF10FE66 ROD.MUSEMECHE
661,120,118 *4426C843451749CB137AEAE4F223BD09DB794405 NOAH.PRESTIDGE
661,120,119 *442A606F896C9999293E646ED27FA20CB2297299 NOLAN.SOWINSKI
661,120,120 *442E87893A20D4978427635524C2798E581DC1D0 NOLANVANDERLINDE
661,120,121 *442F1FA9930A20028324BF4F87CA181B1496262E ROLLAND.BREGE
661,120,122 *4429A733A1098884ACDB4E8078C0278C8ECF45DC RONNIE.SCHWEER
661,120,123 *4424C81E9198BACEBF4314E0798CD7BF44882D40 ROOM-101
661,120,124 *4426157C151E527D3520E27C60139F212F459E0D NSALZANO
661,120,125 *442E181804909F4304C85C4ABBD97B69AEEDEF1F NXTRCBLY6
661,120,126 *4424515C0FE660CEE3AEFE8FA38C3D875B041813 RREZ.BRAVO
661,120,127 *442DFEA99DEF6DF87D1B8E5D79B45CF5E63A1BE5 R!)S
661,120,128 *4423F5F294117A0E05DCBB247C3C6B6380B21713 rtqdbsw4
661,120,129 *44297B00C0036628D4531310889FF3343CDEDB66 RÜCKENTRAGESYSTEM
661,120,130 *4423AEC17B3135FB7FA2D984675A78F3D56C585B RUSSEL.BYRNS
661,120,131 *442D360E33D1F631C4DDE5B2BF65BE4654079CCA olencostlow
661,120,132 *4427C49697EEFB869DDB3C471452ECD31A498DA5 RUSTYBOOMER8
661,120,133 *4427D6AFC09CF9AB3469BF3AA256F40A50E2D06F ruthdolby
661,120,134 *442DE62B2C300D3026DC37738E44D2DE748EBE26 ryan-dittoe
661,120,135 *4428F1361B5D12F7CEBA54A1D9105336289F940F Ryp
661,120,136 *4429DE031B9FE589B44EB1940E6CD760F207597C SAMAD ALI
661,120,137 *442463BD34725A7BC3DC9141C35A4B67FA95682C SAMBAN
661,120,138 *442E0222CAD93FB772C7EA1C23A614E826187E71 oscarvicari
661,120,139 *442967044DACE21785DB058FF99AD3EB083C9EE0 OSLABILE4
661,120,140 *44219CAFE393112CD8816A2D1EF8573E0206B103 OSVALDO.LOFTUS
661,120,141 *442700CEA03C99CCFA30C97C2A272F95CA80BF14 OSVALDOUMLAND
661,120,142 *44239E9D28770E8E66E630789A30B349BB35D94B [email protected]
661,120,143 *4420CFD19E5BE07A214EB623268D496DBED770D4 othavero
661,120,144 *44261C41C71070CFEBAB80ECEEE459542C22BB18 SARAJEVSKMING
661,120,145 *44295E235E10B9AD960F047FDD9BDF6FFCC56D34 SARIKACHHABRA
661,120,146 *4429E9C24A8FB4014E29719799BF657653A0B2EB SATLANTASR
661,120,147 *4422F6E11673358926D77A4A67D2B72698A8A39C OVERSKUD
661,120,148 *442FB793B7FD07093DC4831CE1D237770E6C16A4 schneller-als-du-denkst
661,120,149 *4421E073C810512109CFE2BD11C084B74FE59CE8 PARDNERSDANCEBANDARRANGEMENT
661,120,150 *442ADEA8E963110DB909CA81BC4BAA0E9D56F1A0 parentless
661,120,151 *4420D63E0B1F061704683B5C6C5E12A3D8C0A47F SEBASTIAN-MARCHEWKA
661,120,152 *4426F38C3C565E3EBA953AD43D63D1FD0C064E18 SECRETUNDEAD0
661,120,153 *442D4EB2EB3EB84FF107358FCC58ABC93C0E1DBF SEDGEMAN7
661,120,154 *442BB4F1EDA0D538D1CAE4EBBB637C220DCE4295 pB~(O_)
661,120,155 *442C0B4AB88355187FA91BDB55F0A1663D2A1DEE PETE-MCVAY
661,120,156 *4427C86AF392D52D58C7FADBCF5C6BB4F69D157B SHAGJAM
661,120,157 *4425D67C5DD0FBA773733BDE5EEB75528A05DACA shannonsweigard
661,120,158 *442AD6A79922B2ABA3BBA81BF162E228D6F82F5C phracherontispabulum[obs3];gibierdepotence[fr]
661,120,159 *4429019334A91B3A637A72DE9B6991AFDCF0A43F piano.concerto.no..3.in.c.minor,.op..37..largo
661,120,160 *4425B5C8B7BBC5FEC162CDF6E871CB44B7C7710F SHENTIESHA
661,120,161 *442970AB2AB6F74095F1CFA01D982140E379BC32 [email protected]
661,120,162 *44263C5BAA816B6F03CC2B65D3630AC968394060 PLICULEŢUL
661,120,163 *442FBF06F56B4BC9D5BF60DC25392DFC64DADF15 [email protected]
661,120,164 *442A17526F45B156F189356CC8E88BBEAB7032CC shonbobowiec
661,120,165 *442F7CB3BF2726C02E9C7D0D7F9FE9B084CE1265 [email protected]~o-)o(
661,120,166 *44200868365CC7FA3D54B1371F603630849E26FA POREDI
661,120,167 *44228A3C004CE4DC9CEFA828EC3E85D4E2080FE6 p====p~o~o(^_~)
661,120,168 *4423AB6BFBFE2602D08CE2887DA0C760BC3851DC siffirg6
661,120,169 *442A098E3A6B4A8BB3E2D905806A734C2743C9DA QUARINHOF
661,120,170 *4426E056B30B4C46800CC8735EF6B9FE950522B0 [email protected]
661,120,171 *442365E8C402D8C43B705D32C5AB148B1E6DBB3B [email protected]*-*-(X)
661,120,172 *44263B20DB743D65C5DA428BA46FA0D1D83E92EA [email protected]
661,120,173 *44268A984086B9E1D546BAF34D08CA9218DD425C RAAGULANJ
661,120,174 *442507154692B8BDD715F9DB7C9D13068EAC0C1B RACHELMADDOW
661,120,175 *442FD97F803A8F35DF931CF057C1397EF3FFAAE2 RAILサービス」を
661,120,176 *44253603F3C2C6A8EC79CD4AF97593163F5F01F4 randellesworthy
661,120,177 *44276B1DB6355255F6888BA66315DB06CCF75AD8 SOLEILO8
661,120,178 *442D48B392F3703C142260EB68438972104C2D93 SOMBREADORAS
661,120,179 *442C6B5919C1B6DD4734F4D68756477D442314DF REBELDEBUEY
661,120,180 *4424F5D6F996A2D6E3EDBF50C12347F4C9459E9E REDISIVIGLIA(THEBARBEROFSEVILLE),OPERAIOSONODOCILE
661,120,181 *442C70E6176C1D2B605ED0DB477A399181E6FE2F REIDUN-LŘVSTRŘM
661,120,182 *4425B4548F3325617D16F1F5BAD7DAE3FEA84F46 splat~ ` db
661,120,183 *442FBCE1706C63B446D13B9F95E7A6CF24BFFF32 squarcerei5
661,120,184 *4420A48CD4F1467D7BA0F5CACF51FC01FAB593FB SSEIJUROU
661,120,185 *4423D7514B21C006CDDDC15547DBC8896F5F3ECE SSELFERTIGES?
661,120,186 *44243333BEB1C3DE732F84A6631CD70DC7C6797B ride a broomstick
661,120,187 *4426C922351016B89DE02834934DFE472042B9C2 STIGMATIFEROUS3
661,120,188 *442FD74F8435E9BDE22203E6A81F38DF0D98B367 rogelioblackley
661,120,189 *442288616B92C4FBDD73BB4677D9E5D69B1D480F stripteaseget
661,120,190 *44267C85006524B9FB0BFFF0458F877446D438EC STS-103
661,120,191 *442BF74E65D2AD973895F1667613ED9C46C35E99 ROMAN.MCMILLION
661,120,192 *442A32C59F99D0CDD0067E2AC9E2AA68892713E8 ROMANPH0
661,120,193 *4429793E9B28F6FEA9B45861B1B108473DC03436 RONALD.ACOBA
661,120,194 *4427BB9EB1799A90B62A74518D82F19202EF5D62 SUSANLINDA4
661,120,195 *4423DA517FC3A5A92C4CA44B6A956CCC93C6C905 RUSS.PEDROTTI
661,120,196 *442FE45A9A74C5D6615714C82AC08F81B0C2B688 RUTGERSF
661,120,197 *442C0F12B762B4A602E0C91E5885E8A9077E03FB SVUTGTLC
661,120,198 *4425412A07FAE38F73EBBAD9D28D9E499D446EBA RWOLFBSW1
661,120,199 *442717B97754EFB4EDF9BF2642F8D7B844D13A1F SWINES.FEATHER
661,120,200 *44239FF97CF037170B10D39AF74746B9F68AF191 SALVADOR.WADLOW
661,120,201 *44249DEB6E0AFACB7B2D534EC54778B2592BCD16 SANDY'S GANG
661,120,202 *442DCABA969C7A0231803C910A153B5B5E5D81FC SCOTT-JOPLIN'S-PIANO-RAGS
661,120,203 *44208D2A79BD10B841D6E01913CAA0103C98BA2F [email protected]
661,120,204 *442732720FD8B8B015684AE1903C8D95E4A24103 SHARON-BERSABE
661,120,205 *44228A7154D2023AE8D1A3AF1EAAC4040BC7ECF3 tănasie
661,120,206 *4422A55EAE5F74035D87408765BCBAFAEEF98A74 TANKERKITTENS
661,120,207 *44276285183CB446A944D142B80FF5A39214D0B3 TASHEIME8
661,120,208 *442DF0B15B4BB2219AC80E82B88266577BB50A37 SIBBOLETH0
661,120,209 *442FB507C4E9A8AF0CE0411E27E953F528E3DD94 tbhrboj
661,120,210 *442DBB7B62BD88181753A56628CBAFA8E00D8EBF SIGELIAE
661,120,211 *442BCA1299186962D58DE37142BDC8DAA4B0E63F [email protected]GOPLAYCOM
661,120,212 *44291A0C1485B35D6B38646F7F8304F3BAE76741 TEDDY008
661,120,213 *442E31D41A1D532CC7822EF0B2C91A9969AB0753 TEDDYPAPSTEIN
661,120,214 *442DA197BB3E74035ED1804ECCBDF64A3C2BC644 «TEMERÁRIA»
661,120,215 *442E1FE544751EC3528733E5A4C2144B98580CE6 [email protected]
661,120,216 *442563816BB32AA447BC67BFC83108590AB85056 THADDEUSSANTOMASSIMO
661,120,217 *4420A34E9BACA9627692E932F57FDFCD1F7EE598 SILENCE-OF-THE-NOISE
661,120,218 *44217E0F392228F0D49A753B996F76EC23DC8D4F SKOOLGEBRUIKS
661,120,219 *4421C8454FB7852FF3F02372C0CE1F4BA1D79752 THEMOREWIPLANT
661,120,220 *4421898D1BA10086C4A896613ED08E232B0DFD28 THE-SLEEPLESS-SAILOR-/-[UNTITLED]
661,120,221 *442DF16FDFE7EEF8E94DB096DBD4583E1B98532A thevikram06
661,120,222 *44255B63FAD1B3650926E267B9812809B5896AA7 THYMETICS3
661,120,223 *4423ADDF9BFC8B3FC79E2C15FBB539CFEB2B2783 TIM MASK
661,120,224 *442965A169B8BFF9BF920D68ED7A3631B7854952 TIMMYFRISHKORN
661,120,225 *4429E7AA559805B48348575D3EE657F52E50134B <title>arachnophiliarevisionhistory</title>
661,120,226 *442EE6165888340BE6F160CFE87D8EE56AA807B9 SPALACOLESTIDAE
661,120,227 *442506F4E8A7988ECE0A549F092A646E68B6745C t..lowry
661,120,228 *442D209EA47A18ADC5AC5179B94F70E31739AF2C TODEEKI
661,120,229 *44247FBB2B0EBCDE8479E1379EC86684D9A3D2E9 TOMMORRISSEY
661,120,230 *44221817C83538BC8E21D464A0DAC4F50D332138 SPRPSSTN0
661,120,231 *442758FCA20ED898BCC087A0D5813BD6B1C6A803 SREHESZRAWHCS
661,120,232 *4427E4DA10C111FE5EF51E06A5071AC3C198AFED TRAINPARTISANPASSENGER5
661,120,233 *4424BE6099556CE45ED3FAEBB03DB95B63904C8C ST900810
661,120,234 *442E01AE7983B23D0099CC4C33E4B66D199B51C5 trax sampler #58
661,120,235 *44215CD40CBECF005AE061C9D687984600B1B3EC trent-reznor-and-wife-form-new-band
661,120,236 *4427D9B591A9B9BD86DFE753962AD98748623E3F TREVORHARRYMAN
661,120,237 *442A4BC1B00CEADE9F47882F8E4FE379A5F47A33 STATION」のリスナーであったこと、大尊敬していることを連想させる発言をしている
661,120,238 *4429F82ADCFF654F8FD3C6F259948E360FDC6C3C STEPHANIE.PAYANT
661,120,239 *4421413FB6787B8B0E9363DE7E9E27095DC543BB steph.nicholson
661,120,240 *442CD61DC968A46541ED40B6E7C05C72202189DF STEVENHEATHERJ
661,120,241 *442FEE7647E0D882697F00F4DCACA5757F4B4960 [email protected]
661,120,242 *442912B9A9EA2F69D3B52C0B261E715368E8A551 TR)P
661,120,243 *442567408147D1C1466D1A856BEF3C557CA42141 STYVNATED
661,120,244 *44288448FBC220A703613840115AA8E5604B2891 [email protected]
661,120,245 *4422533DF3C2E80470F34FC49121E7E22BECEAEB TTEST
661,120,246 *44292FFC4D4008EA1BAF2F1EBE30BF86175E08B8 superkolibrie1
661,120,247 *4424A3BB37481D6010D4D30BE13A2AE52859CCFE TYRELL.BECKHAM
661,120,248 *4423070EC061352039BA5E09AECEADF23801FB23 sweet-freedom
661,120,249 *442566CB1B4CC4339A6E37508CE94F8DB37833F8 synderesis0
661,120,250 *442B81ACFA84617EE77625D0C89DC4E4870E83C0 unabhängigkeitspokals
661,120,251 *44280F6366415884A2DDF4DBFF0BAA40533B8138 tanya.zakharchenko
661,120,252 *442EF9D03C3F100343B9E020B551866B6F421878 [email protected]
661,120,253 *4424D7B41F56413D437D432A54DA9E126CB91C40 UNISAN-QUEZON
661,120,254 *4422A66759B671EC435A84028F3E13DE2DFBE360 TAXONSES9
661,120,255 *4426D5386D7CFCA4F34484B90BF7588CC1A4905B UNSHINES2
661,120,256 *4423DBC2CCD0AA809A91701696FB35269BD8553B up
661,120,257 *4425303DFB68C1C2701DC8D9E06B68788CF04467 TEDDY.KALUPA
661,120,258 *442D69D3E6E6F0FC9D167F0F55DE81A04EE20FA6 USERAMAPOSCHOOL
661,120,259 *4429F7B53AF83E29CF2E789436957523A336DAD7 USERSAXBRYNSANDBOX
661,120,260 *442D112FA7212355659E9F853BC2414BC41F3090 TEMPERUJĄCYCH
661,120,261 *4426780DFC5BF041C6E3C181ECA3051817906AA3 TEMPLATEKUNMING
661,120,262 *4426B55D34971FCBD96F48567D80A722ECAA4D31 UUO<
661,120,263 *4424DFEC5BAB48C749DA85B4F6ADAD4995B12E4B [email protected]
661,120,264 *442E9CCDF3C8E10ABB63DFAC105990E42208DD16 «VALIDITY
661,120,265 *4429371FFCDF876DDE6917AE5EB983C841D2F41A VAN.DER.VAART.RAFAEL
661,120,266 *442D57E0D8FBCFAB2218B79C4E1F40180B513A0E VANJSKOPOLITICKE1
661,120,267 *442AA41940DB7CA8B34AE67E3D4C3B8B4BE593DD THERESAMARTHA
661,120,268 *442D553040B20CEBA09662440A6A19A112782DD8 THESCROOGE
661,120,269 *442D43E598DB57FF102560AA8A508E45735A3201 THUMBNAILD-REW
661,120,270 *442ACA518FFB99750C16FF92657768E7299598C2 THUNDERROSING
661,120,271 *442E84FBF6A4310AA29CAC8F2FB440CB3DB48A8E tiago-moniz
661,120,272 *442FC6D1874B950EEA1D9D03EE75DC1E1199A70D [email protected]
661,120,273 *4425AFE5E9EC89970DFEDF4C4D2D8EAC4B61A1F7 TIESTXETING
661,120,274 *4429EF8C56D34DE24E1EA25ED5D342C63803C370 TILVIRKNINGERS4
661,120,275 *4429A7B9CC8BEF3BFF25297660C69DB63D607A6A TINATEUBNER&MICHAELREUTER
661,120,276 *4425DBAD931AFA7A154558254733704A5ACCB18A tjqu1i33fd8c
661,120,277 *442AF3E805C06CDB0DFCEDEB784DD5A15FD794E1 TOINJURY
661,120,278 *4423C98ADB01E6445D0D8A78BED3B14D26DA937A TONYALEX123
661,120,279 *442A7A65F6F64F1394B3EDB97D0CDA3261A58913 TONYVINE
661,120,280 *442D414C46A600E5C8994A3406B2202B62A64DE3 trentgeuder
661,120,281 *4427F0BDE527D1EF4E9486A0366FDB255895343F TRIACONT0
661,120,282 *4427954C54D98757DB46D64F6EEF84F08E4CD3EC VICTORIAKARTSOUNI
661,120,283 *4421673EEB045A0973FDB71B42C12E6B98359655 VIKASSOTA
661,120,284 *442EC8D91A44ED4C331F2A8957698451E35338AA troy.copenhaver
661,120,285 *442F6A3CE35D8BE4A2A752EBC3EB2D12AB3C22C8 vrabicu
661,120,286 *442ACC09B89570DE625C2BC7FADAC77FE6C1CBE8 TYRELLRUFFER
661,120,287 *442D5DCC4C4A2DD88414714817CB59784216077F tywimett
661,120,288 *442A37596127B85D11028C1AD6FE1AD9CCD3F04E überhitzungsklima
661,120,289 *442CA7ABD1CC0D6D6BFE56B3BABF6B77B1F00AF7 wadefarm
661,120,290 *442F90ED64C950EC9DD591D54D23F682991C6993 ULTRASTABLE8
661,120,291 *442C8681C7DE97268107EB154B523CE57E39F572 WALLYRECKER
661,120,292 *442DECC882AA994DBD87D47ADF835D591C4BE107 undescendent4
661,120,293 *442D18878566C794B5915EBFC67498290922B3BB uniconxv
661,120,294 *442682B9DF3932B07B02826935FED5F625C5EAE9 UPPRITARING
661,120,295 *44200CAC83C96C298547EF99633DF7F7D5CDB339 uq"b
661,120,296 *442BBF491B564C60866F6635FF64F5370C9514DA WATSONDIANA8
661,120,297 *442FB0793E2A5CD9614B5CCEB419291ACF92B583 wc*g
661,120,298 *4422D5EB99A65A9AEA17B6778E07B32C2DC1BF7C USERPLEX118
661,120,299 *442E6AC1C69E3AF55A039037CD771F4F9CB343BA WEEZ TORTELLA
661,120,300 *4427F569DE237385B07188AC1FE0F8947F29AD8F WEINSCHENKENVIERTELS
661,120,301 *442B78498B8560A30B21C1CD60510A8136D34788 wendellserino
661,120,302 *442AD0355B0696EC0E80848753E2C8D86BE0188C wendy.columbare
661,120,303 *442E077620E0DD5C141BECEFDB49EF70A49D7644 v3sp3r7n3
661,120,304 *44239D3D63BD58BDBE5776ED02B05446478D30FB VALENTINE.OIEDA
661,120,305 *442E56D9BD947BB7984113B618ADAEF7FCFDF81F what'sthatihear?:thesongsofphilochs(disc2)
661,120,306 *4423C6114369DADF46015BA880C9821061DCC9CB VALZENNA
661,120,307 *44201895F29A8B6F9DEC4FE9C4C91FC8F8892F62 WHOOSIS
661,120,308 *44257A7F2617C61CDCA544F041EC7BC2B57AA3F5 vanillaflash
661,120,309 *44239B55E25F095717BBAD4FC5AC3CE0A2FCDEA6 williamshougen
661,120,310 *4421C393198913913ACC70378ECF8E7920692E5C VERFMERK4
661,120,311 *44214E48737D6333BB953B7C43F07FD1C37D5376 WILSONCAMPAGNINI
661,120,312 *4420FE3B97B2C1D4F79F2A82858866BF4AE7DF09 wrecful0
661,120,313 *4425C1CB5F706EF064CC271A2F261F1E7B711932 VIRGIL.DEISCH
661,120,314 *4423DAA0C151E6BB8AC418724A3787456C8186CA VIRGILIO.POPA
661,120,315 *442650F5922CC8739150BCB51AA97416E7BD93A0 VIRULENTLY9
661,120,316 *44219887F9BE03C4567139F267E84292EBD9B56B VLADIMIRLAURENTE
661,120,317 *442E1CE00A94F320B94B0B48516D95C3E7E46A6E xfsmckzutn
661,120,318 *442101C78C816FC48674F66769AD53FC769F52AA [email protected]
661,120,319 *44254B394242CF9782E37D2B9935CBB4C9BC406A )x(o~ 0~ @#####b
661,120,320 *442EE632B5C4CE4569615CDD9BA3E8B596015943 [email protected]
661,120,321 *442B633FE53935E058643BD656D1DB6205B9D0AD WANDA MCMILLIN
661,120,322 *442DB511BE0013F9A1DDCC501B0DA074F156280F wan-feliya
661,120,323 *442A735BA3F59F786551D90C82530F4F3DCFE227 [email protected]
661,120,324 *4427C13B91BD4849D60B567EE3CD8366B2EF51CD [email protected]
661,120,325 *4422513BB20DEB57DAA48C3B6D8BF6A8DE243571 [email protected]
661,120,326 *442A7E828696883EAD957BBFCC4CF982E9B8348B [email protected]
661,120,327 *44241E6A34E505FE5F14F81ED371121EF0714841 WARD.ZIENTARA
661,120,328 *4426B232211D599FF883FEA159C4C246EB499ACD water.on.the.pond
661,120,329 *442A2A71A3BEA441FCFCF882D49C32C2974D8625 WAYNE PFORR
661,120,330 *44267B360A77B22E6FB0926EB3F0BD8B56684F4B [email protected]
661,120,331 *442213F4333C15E75A60A3503E83F256759F3BC0 WelcomeToFireflies(LiveBonus)
661,120,332 *442D3716B02E17D8705C03CC14EF884BDC5903ED [email protected]
661,120,333 *442F7D393DDEC7B3A8C6972B8EA8ABDA949A6810 [email protected]
661,120,334 *442AB6B9A8BF0500E9053C046DD9FD708F6B923A [email protected]
661,120,335 *4427D9E0A9A3C2E6AAA3AAAD903442CF358F00D6 wenilynjose
661,120,336 *44262E96995AB06532BCB25F2BB71411569EA88A WESRUBINS
661,120,337 *4426EF511EBAEEDB6D306B7617300DC6D70DF70B weston.ray
661,120,338 *44279D050381C7B1E944170D8442B4D2432A16C3 YUNINGSIHBONDAM
661,120,339 *442EEB871FED45E3BFAC0C12B4ADC8EAEAAD66DC YVONNE NORTE
661,120,340 *442C5AC5145400B7DF81165EA10C3BF4AA630106 YWVJWPOXNBLRKQING
661,120,341 *4422321F132888EE9C1AC824BA2A10217BCD46B1 Z81-
661,120,342 *4422FE761B2AECACAB0105520A8900304AAE4F12 ZACHNIBLICK
661,120,343 *4428CBE707A66BAADBDCEDF97546A2C2760CE4FF WILFRED.JEANSONNE
661,120,344 *442B970CE73D85940012E083F4D1B1B2A85A7296 WILLIAMGUILE
661,120,345 *442BC5D7C22E5CF08B203A8E47982C09B87AECE6 ZBULLDOGGED
661,120,346 *44276A0450BEEA26EB08DCBBF7E3F58ABA7C0EC1 zedsoft
661,120,347 *442F4E67A36909FFD5735608774B5AD7FA75D7A3 WINSTON.RAMESH
661,120,348 *442C2147A468D79D205BCCB5E7A142088E4AD1F1 witwiw
661,120,349 *442F4A3334BA593FC5D077B07C7CA0391388AF42 WM.YOUKHANA
661,120,350 *4424A23CC332EC3C3414BBCED8C8201FFA235F17 [email protected]
661,120,351 *4429683899CE26733D922C6C32E570190E363568 ZOEHRER8
661,120,352 *442ACFB968DCADB0799EC9FCCDFB96CE396397CF ZSOLTIY
661,120,353 *442DD11BAA5ECBA22DA732B00E3AA02E5114BA49 ВЕРТІКОВ
661,120,354 *4426089171D98761B474A8095DC24742D5A37DC6 ВСЕЛЕНСКОЙ
661,120,355 *4428F7B6EFB26F202D51FE43DA7BF825BE9B68A5 wwwagavelafayettecom
661,120,356 *442EF5341F3D51A3FC586CEEF29A56262381A3B3 WWWEGDA42
661,120,357 *4424AA16B42F5CAFADFF0C5D3F633A1F2D91142A wwwmaterialsresourcescom
661,120,358 *4421954220073EB51D69A02CE8FB6EEF28BAF0C7 wwwnebulamusiccom
661,120,359 *4428A59AABA599C1AE8CAF9B208C1A427C0DB3F2 WYGNAL
661,120,360 *44255173A0FD9C1FA2656E3CA7394E5226E4662A XCN.
661,120,361 *442EB9772476F76F82B57FD052D1FFA610882F92 [email protected]
661,120,362 *442A0A3BF8C8498C85FB061F9712D0C6D3894A15 [email protected]
661,120,363 *4428050A16880477BC980F04D1C331532865FCCC [email protected]
661,120,364 *4423586803CA61E489B0A0096039DC73CEB8CB7A XIU-ZHANG-JIE
661,120,365 *4421FD5D5424AA8F59F7613D71F887C4CF5E035C (X)~~~Q3
661,120,366 *442C5F1207FBC6226F34B397DE3876C94E1FB56F [email protected]
661,120,367 *4426DDB866B0659092273C6D5894AFCAC2163D64 YAN SUERIYAN
661,120,368 *4420B4D16BB9225736EF6A19606B67B2E15B693F YASHVANTHA
661,120,369 *44215812F7DAC653780DFA0541FDBB633FE96B91 YAYHACLALLUW
661,120,370 *44271AB2F90256988BA714A4404177A51AE6E958 YBSDNALER
661,120,371 *442CB8942FF9D0D86E149D88265456B6E2D4F032 «катюші»
661,120,372 *442CAB3F651E2FF76863B4CA1098F013C01D9404 yesi.komalasari
661,120,373 *442E647745EAABEBA63DFDCEAE4D091ADD6DEAA6 YGADE
661,120,374 *4427A3C8832CDCFC361B7E9953E6DBD19A59B68A [email protected]
661,120,375 *44242A02DABD67F46DBBEF51E646AE16AEE62E2D [email protected]
661,120,376 *442A5A662FD941088B45EEDB0CCD760B93361952 [email protected]
661,120,377 *44297122927C512C3D92B642E56B0FFDFB566739 [email protected]
661,120,378 *4428C618296D7869A6209C1BB339152494F948DF YNDIGT(ATF
661,120,379 *442BC5A5588E5CE50628C6830F6B96B31CBE5981 ПРИСЕЛКУ
661,120,380 *442AF1A8F7B6410D5507F9D5B8EF474046A9983B YOTSUGIR2
661,120,381 *442E0B9AF2CACCE5044ABC347C28FE95E8BF7CC4 Yuki.Fukazawa
661,120,382 *4425F20DC2CD768F40AAA08A7C795BEA80CC8EDF yuwanna3
661,120,383 *442BE3CA8FA7C4DAB55CB59735E5173A6CA75046 zach-wens
661,120,384 *4425F0F8FC46F336A320F4C4E70D1CEF9BBEE66F ZACK BELMORE
661,120,385 *44248FD44FBE85D0F0BF68DF5775FA599AA2E7C4 亦證實舊有的黑GIRL已經正式解散。而新一代的黑GIRL則由舊成員丫頭及小薰,還有美眉勇兔及糖果組成。
661,120,386 *4423BCCC827E5AD1D8084C90E78BCA8ED683C8B8 ZDEABAY
661,120,387 *44261091FBC762E0059826FFACED5F97192E743E zedocaixao
661,120,388 *4422641CD7DF7638ECCE7876F1D2E94FCECFF5C8 小説「ALICEの懺悔」
661,120,389 *442D8F7A6FC1047F40B2188ADCB7F5BEF60A9CCC zhaotingying
661,120,390 *442D805CA0CF251CD8DCCA48E6779E7C0160CA2C [email protected]
661,120,391 *442AF78AE5AF70DE33DC0026AEEC04555D0109D6 [email protected]
661,120,392 *442D89BC408135640932EAD09E7EA7521B4978E7 慶応SFCキャンパス(2007年2月12日投稿者が撮影)
661,120,393 *4423A65A886053FA8262E0215B62BF6D12938408 ZOPERNI
661,120,394 *4422C36EC89917023E23867A1FD62943379CF725 zrt2
661,120,395 *44266EEA08B52C54E1BF6E9921A908A3AF3EF0B8 ПОЛУАДМИНИСТРАТОР
661,120,396 *442815C8D60497B90FF291271C863AD45FADB75C 0ac75c538ba13011914e580b606bbca9
661,120,397 *442243F28D7816702F6675A70706ACD4FA723A48 0WIBBLE1
661,120,398 *4429067C2EFDD34D9E8802AA1F64B2FEFF4D1E8F 10.entschiedenste
661,120,399 *442630061B9329859E22F1EEFD93478210C96302 хангайский
661,120,400 *442E9FF483ED64C35090100BA01F03E8DC5FA81F ШТЕЙНБОРН
661,120,401 *442C9F7E22A80B349D6858C658E33295CF5ACD6B ЯШТАХ
661,120,402 *4429B86CE17214395366F250F57AED1EDA0B3F1D 1997988 TUTKIMUKSIA-MM--TOIMINNANVAIKUTTAVUUDESTA-ON-MENEILL
661,120,403 *4425E71D99AA670986822D50760697DE2992A126 1-brodman'in
661,120,404 *442548DC6E9E63345238EA70AA878AF4DF00C1E3 1.CURRYKALAVUOAN
661,120,405 *442111485B30D7D86C2A00F144D33E852B4A5625 1dippon
661,120,406 *442B2AB9F1803B18CE66FA25F9B476CE05BF49FB 1 GALERIE-PLAN
661,120,407 *442025844B0D29DBA8B8BAA6B327BD7FCBD46995 1knoth1234
661,120,408 *44266F0E38C440926886FA9F122D0F380AA32566 1.KOMPASTUSKIVEMME
661,120,409 *442091416FA8F7821D6BC3C4AB758E5C2DDC3335 1-KUSTANNUSPOLIITTISIA
661,120,410 *4425F2AB640B49EA41B5605EDB2BD7A2518177A5 1-OEKO-RANGER
661,120,411 *442B8616D97D5D8AF9F81145A99FF42341270A16 1-packet-over-sdh
661,120,412 *4429F9B1C2069882B69C2D8E4AD2E9CBC0499897 1.PASSAGEN-WERKIIN
661,120,413 *4421FED5B5F41D4FA2527666E5F9B154CED6F59B 1-PELUSSO
661,120,414 *44206A262783138A353E035AD050E0055C28CFA1 1.RESORTPROPERTY
661,120,415 *44210CDE4F91ABF82947C0FCABCA94B67113F5DD 1.savhada
661,120,416 *4424FFDB79A691E5564549246B6BB30E0059A272 1vaihtokirjassa
661,120,417 *4423044AFC34A61265D6A1A3D24560C360EC4A00 1VERSTORE
661,120,418 *442DD18EBC942845F08171DFC78A93B2074AB38F 2031501 ach-,-waere-doch-schon-die-zeitmaschine-erfunden-
661,120,419 *44212A139453470178F11972CC02178A210E7969 2089450 but he's sticking to larger-capitalization stocks
661,120,420 *442588907EAB2646CF38719636C91F2FF5CBF3E2 2548456 aber es sind gute gruende
661,120,421 *44285E9D32E192E4BF1403B1963EB0D63DBE5A2D 276048 lvi-ala k
661,120,422 *442A87C3803954E986EAF9F7DF7DA434F8479563 2967180 franklin hallin
661,120,423 *442694A961AED29F9C64730370E105704A6381CC 2.bejutreut
661,120,424 *44238C54B844748D0D3E081C60D57604B9FD2C44 2CELTECIST
661,120,425 *442DC210985A5FD6B061BF654B2329AD7CBBB89E 2 HALBLEEREM
661,120,426 *442C485BAD3E2AA2F5D848B49D43EDBD05F1FA97 [email protected]
661,120,427 *4426C41BAA2CC412DF467A14F5AF9B15C05DB7E0 2konzernmann
661,120,428 *442130CCAA6D7AD7BFEE4034B246D9436A710EC8 2OVERASSAIL
661,120,429 *44275CA0D1A13ABE8E1261E9C62E3127AF33817F 2TOPLIKS
661,120,430 *442D77B152D273E907CCD9A75D92ABEF9895745F 0mysugar4
661,120,431 *442E22C4B3C4D1EB43AAE9BBEA2C1D09703B49B1 394426 bir koye 4 dernek !
661,120,432 *4429ABAB8FBEC0749690C9EC00E6F585A74D9211 109-banalitaet
661,120,433 *442DD164519C97A977672BE886BE729843ABEC9E 10-ABGABENHOEHE
661,120,434 *442F6D2CE2ECB0C73C2563A3FF149BF5D96E3C50 3AVAILEBLE
661,120,435 *44204B142969BD8AB6D80379D23AC78428022AEC 110027 DIYEDUSUNDU
661,120,436 *44203C8CECC509A129203C852BB2E6D886E3B73E 3---B.~0.~O.(X)
661,120,437 *442F868190DC13FAF688832D047C4E322D858FA9 1123853 she.came.to.believe.it.was.a.false.reading..
661,120,438 *442E124BA190B6373D91A558C8B31E55015BEB5C 3BOOKLINK
661,120,439 *442F70A29F3641393371C3C33091AB9EC3419C60 3fxx0n
661,120,440 *4422DAD6CC89E83D49570D7D667C249BA802AC89 3====P.~0.SPLOIT
661,120,441 *4423E9FEE9FE0B2C68527ED06F1B88BF4608169D 1405558 KIRJOITTAJALLA ON LIIKEMIESVAISTOA , YMM
661,120,442 *44229923FDE1755E2F7F6ED293F480BB9F0D3C11 40.BIG.ONES
661,120,443 *442ABE5A3FFFC3166CE08EADA10B24174A7D9EA4 1748561 POHJOISEN SUOMEN ALUEELLINEN TOIMINTAYKSIKK
661,120,444 *442048E79EB7022AADCD782E4B337797D3E2D32F 4F7EB0F7DB743B19B82183BF67B4C42D
661,120,445 *442C22B5D5D3AC4CBD4D9852782AD0D1EB2D51A0 4GLUCINE
661,120,446 *442C1BCB5366BC5FA03868B0BB5D77F0A15BF8BE 1951BOOSTER
661,120,447 *442142A84945F1255EA9F29830CFF835565FF347 4.latukoneena
661,120,448 *442680C31DA265DC63FDF852C675A8D5C4B6BB95 4PRASAADANAM
661,120,449 *442C2DB122B617FC1E9F4001FFAF7FBA710BC3E1 19maria01manzo75
661,120,450 *442AA339F27E4081109E8A75E94AF0AAC8ABB86C 4SOULREAVER
661,120,451 *4421EB1FFB99686A80B202F152B46A011CC5E6F0 4THEBOSSSCOTT
661,120,452 *4424678C4DD4FE60B6FF2B0299DB9951CFE04BE2 4UNTUKSEMUA
661,120,453 *4427F55EE29605AD5C1F15D80755CC9607E8A5C9 1-FADENAEHNLICHE
661,120,454 *4427D550E9923F83AB9C5DD8E115CB608758AECB 52.FORTFAHREN
661,120,455 *442FAD5C829E3EC9C7899A48F90B4822BD60D8EF 531FINN
661,120,456 *442268D4242A6E1D5C1EAAB29132559E502E8DEC 545-KOIVU
661,120,457 *442FE48315EEDE78B61C6F20FC722B843B038168 [email protected][email protected]
661,120,458 *4427255EAD72E51BE8B7485D0005447777CD2794 5EFFICIENCYPARTIALLYEFFICIENCYBALANCED
661,120,459 *4422AD12546CCBF95A24D1930FCC50EB677101B4 1-nachgebuehren
661,120,460 *442DCBD9DA0A4D62BF3073CEBB9CCEA179983D7A 5MRGNFRM
661,120,461 *442C3CA6B97C0FCF7EC378D118FCBB7F50EBAC63 5NITIFUTS
661,120,462 *4429EDAC18B18FA4EB187DF7EC9477DCCB08ABD4 1PAPAT-BESUCH
661,120,463 *442DD36257FF6E66ACFBBD9D2C5FBDDD3E449D3C 1.poorest-performing
661,120,464 *442533E6EA8911FC0D53304D9A54E24202EEF03B 1-pro-modernization
661,120,465 *44237F2072AB68D7AE4BB18DBC5806199EF587F4 1RICHTONE
661,120,466 *44202EEEA3D9A69F27753ED43DB95186819AEEA9 5SCULTARRA
661,120,467 *442EF1B74F7A034FFCA5F60FAB43805AA8EC638C 5thatshawn6
661,120,468 *442B7142F7CACE263CC5186C70C1C48F39CBEFEA 1.tekrarlanIp
661,120,469 *4428984DA42CE1894D0FAA368D074F91DF149D2E 1 TEKSTIILIKALUSTEIDEN
661,120,470 *44234513A203B1BAABD8B1273CF8A0480A42D17A 1thedollar6
661,120,471 *442D27FFDC13D350216565F8C3C1D9CA5E612B17 671982jd
661,120,472 *44296A162374C47B75332A168021202D80001F89 1 ZOLA-AUFSATZ
661,120,473 *442DA3BA37D30DA1CF0E00C3FDABC02E6DCA53C0 6AISPELBYXO
661,120,474 *4424B7BB31F5B48364AFB2E4D0F555E9E61E1961 2005LAS
661,120,475 *44284266C1D72937187D6EB92FAE9F9C7BCBFAD6 6CONTREEPREUVE
661,120,476 *4421A7C66EB6DD5E463F58EAEA0A2FC737219F84 21apr1009
661,120,477 *4429AF4BA1F64BA3B7D81608A92202C9C105102F 6INGESTIKULIEREN
661,120,478 *442EA79250634382FD6E4E37DC71E074869F14B5 2481573 EIN JAHR SPAETER WURDE IN BERLIN DIE MAUER GEBAUT .
661,120,479 *442A73E575A374ECB02A365003D222DE2BF15D39 24 CROSTINI
661,120,480 *4426DA92DD90B75373179CA7A6EAB3053BD7C524 24NANNI
661,120,481 *4423E583FA1FAE9A829431DEA4A4D3511F5E509D 6NOITAZINAGROED
661,120,482 *4428E4BD533BFC51EFCD26E9DFDA728CD003710C 2547165 kilpapiikkaritovatv
661,120,483 *442E39647FCE4C476279884CEA88DA78655BF04B 6ORTARGBSW
661,120,484 *44274D9444B46A561AD60ECBDB0ECD803B6B1C8E 25 A-JUN
661,120,485 *442C6C778AA69610BB00592708BA7CE41FEB36FC 6.PANKKITUOTTEITA
661,120,486 *442198CFFDAF59A0FB4D7380AAB5EE504F0127A0 26.JOHANN-HINRICH-WICHERN-SCHULE
661,120,487 *442761D84EAB6CB172E47C1C44E0625A96075AEC 2917798 UUDISRAKENNUS-ON-KUUSIKERROKSINEN-JA-SEN-VESIKATON-YLIMM
661,120,488 *4429886FD6ADACAF506E4100C92052A0A1961680 6UNICORNSUZUKI
661,120,489 *4422A42F1E1320248A9475EFA1EF72B5B87DB8F2 6WEGSTEMDEN
661,120,490 *442F8795805706CFE381EA709106C7930CFAB206 2HYPERBARBARISM
661,120,491 *4424670E8927F3F47F670A94F2C8802414B7A7AC 2 KONTULAAN
661,120,492 *442F9B58E25497F5284E1BD44F6AE74C6D415D21 2LEVENS
661,120,493 *442D141EB11A700E44C9D93BDF11F46C13C47AB8 2LYMPHEMIA
661,120,494 *442EEE7C6172E0CAFFD457CF52B871D6FD9DB4F9 2.omaavilla
661,120,495 *4424A7800DCA2C226B1A80B5FBEB637F797459C2 730HUDSON
661,120,496 *442091D05C4EE4ABE96D1A4C900287902679D6EE 2TSPTTNG
661,120,497 *4426FBAACC3045096B691EE1632466CAA40E197D 316.credo
661,120,498 *442C7628C6B757A748AF756C8F8F92C1DC978B81 31february54
661,120,499 *442638DFAA07026BB159B9F8736909CE2AA8F62B 361123 IWANOW WEISS IMMER NOCH VON NIX .
661,120,500 *442D36651A3AB52185BA16BF9C57B87AFE0BB44B 7BSWMULTISTART
661,120,501 *44278BB3F972AFD4474F3E89B3F4C3522A0A7F42 7CARNIZERIA
661,120,502 *44261137991C75CC94AA1A30D4BCEDAC29D4E890 7DC1C
661,120,503 *4425D57F2728DB5078DFF37A5CBDCAF2912FBA5E 3CAMPOAMO
661,120,504 *4424A55406AC315287BF1188DEC0AE375F3F225F 3CXDI3ZEDFY
661,120,505 *442111381E9E77114079EBAE1143B4026279D9D4 >3h/<skcolb-retcarahc>3h<
661,120,506 *442106AC672952DCE3541BADFA07C7D0DCA9D9D3 3 MERDES
661,120,507 *442A04280C45DD3BE644D6A27535C4A07E3A0267 3##P~O~o>B0
661,120,508 *4423E0CD3E299326ACC1C8CC9A5E7A5D5A7F9BCC 3-wertfreie
661,120,509 *442EC24195F58DB00DBA813E07BD0A9393CCCBB3 7NOSCENTE
661,120,510 *44243BABF8222A715BD4813E2A8A69E74963A629 7RECIEDUMBRE
661,120,511 *4422A101E564A2DCEFFEF43448232F480D349B14 7RUBBANESS
661,120,512 *442E8029EA05BFCFB33F66BFDAC296D8F19CB4F6 4ASHLEYH
661,120,513 *442A08EB1C6ECFB62CBBF806B77009F1A08DEB60 4CHERMKAP
661,120,514 *4425600DFBF346FE5C3EE44378E17794DBE2E77E 7WHAMMELLING
661,120,515 *44277A7532346FA71A62032C0C6B6C98A5B06852 4HERODOTUSN
661,120,516 *442A97C585ED430F7FE9FDF038F40A82DD1F7648 87 ohjausj
661,120,517 *4424478302A73BCC716C52E686434DDE6F85C45A 4KNTAKSG
661,120,518 *442152DA66C1ACA06BE553051676AD29C16E8D15 4LISAMARC
661,120,519 *442EEDAB38FD17EB83B2E3030C61105EF408BBCD 8=b~o~o;)
661,120,520 *44298F0F5ECC5D9458024FCF063EBA382E6AF479 8DNOHSPOM
661,120,521 *4425F1EB179F634A6BCEBB07903EBFDE8956A2FB 4PENTAHYDRITE
661,120,522 *442FDC6CDA642004BE080C5F22642D985DC128BE 8==d~o splat!!
661,120,523 *44284DA0B136514EA86DC792881A6DC2E1AD08CA 8D.~.`)X(
661,120,524 *44254158451BFB2A66DBA6BCD2F7805B1FBF5548 8HANBORROE
661,120,525 *442CED108B0BF76B2741626DB70A88F002167424 4月改編で従来のMBS制作「
661,120,526 *442C783E8238BB902663C2020E51B975BFE873BF 5BEHANDLINGSFORL
661,120,527 *442AF54243A3F5BC8640D75BE264F72DDEB3065C 5BSWJORGSRBSW
661,120,528 *4420C60E7B4699141C38EC68D40AB8CF5B05A1BB 5JOINTOGETHER
661,120,529 *442F50BD207D36251A3EB7E282935C4620D55324 5MIKEYQWASZX
661,120,530 *4422A3E056F9E1092C603AA55CB6487FF2732902 5NETLAHCSLELLARAP
661,120,531 *4425FBF0F6579CCB61404E90FB6B1BE86D27EF1B 5ORETSULB
661,120,532 *442B6C9772FE72A12EE1FDCFD83506F4AB075DBF 5SEITSEMNTEEN
661,120,533 *4429D8BF6DFCD7A66E79101E968AF810EE2BF290 8SPORIDIALS
661,120,534 *442646396B804501A99866BDC6BB0D25AA9012CB 5T3MP05T
661,120,535 *442D1278D6FED0763B40B4E04F3D1A1A887C53C1 5THATRADAR3
661,120,536 *4429A6D67BA1B27C5DECDD4D45412908FCD31F1E 5-torstai-iltap
661,120,537 *442AFB2985AD359B555A15DFCBC95DF08B22C8D1 5VENSTRESVING
661,120,538 *442459F6C2A180447090D30A447B373FA96577C1 5VLIERDBSW
661,120,539 *4422ED1B10B732D3BC733470CD93196348EF03BF 630369 NE.ISTIYORUZ.?
661,120,540 *442845D97FFBE1F096A885EB0562E8D6E3600603 9:--9---#---&---CUTLASS
661,120,541 *4421903904126A7DD860411C74A885591FAC625C 666170 LIFEWASSOSWEETWHENTHEDEMOCRATSWEREINTHERE.
661,120,542 *4424D8B613F44839B8939F6DBB416AF7B282EC89 9BAILEYDOLPHIN
661,120,543 *442DD26F82860C2FE575A9A7CC2343B9A672469C 9BERENTY
661,120,544 *44263E61F12C8D33674A45336D0BA9D8EECE2CE7 6ANLEDNINGS
661,120,545 *44295DB865357AC52C919515D61A6ABDE5E7D978 9CEDICMISTY
661,120,546 *4423571BECAD046D782C2BF8F784BE6F782EF451 9CITSICAT
661,120,547 *44227549CE54D1BE81E5645FE4D01B1C51CF418F 6CRAREERARC
661,120,548 *4420D6D47BDD613EAE5302FEC556865A6D3B65A9 9FLUVIALED
661,120,549 *4428426582F2C44154B63F69CE05FBF8EB234BD7 9IAMJOSIE1
661,120,550 *44272DCAF237258EF803B52099B7255B60471329 6FLETCHERTIMOTHY
661,120,551 *442F9F3C0747AD4E73229862EBE869182E0B4393 6.gUClenmiS
661,120,552 *44205D337D0DA3278DECF83D3049E5DB2D7EA2E8 6INHALTSREICHEN
661,120,553 *442B36791525319CE66AD09D8C915C55C4D7AD93 9myfirebird7
661,120,554 *4421816A99BD5A4517CEF46D6AA7E3C91D746DA0 9OYHOKUOB
661,120,555 *4420B7C74BDF4D18DEAB90F4A9BD30A527E66639 6QWERTYPLAY
661,120,556 *4422D682839FF394EB1006F2E3D92FE5CB57D6E1 9TOYIWKOR
661,120,557 *44207C409C1BC2904469709FABA0270267B06CA0 6SENDITRHONDA
661,120,558 *442E52A2DEA9FC9E797BC028F1B0A316C3AE08C2 6TCOBUWXQPDOTV
661,120,559 *44228398E58CA94EF42119799279D62056DF048B 6thatgibbons7
661,120,560 *442F912265E6B365B6940F7EDA327268613679B0 A6DN
661,120,561 *442A26F46A327FAA6641D11FC7C89029022DFAB3 7C34E4E3C413EF06B7164E45EF7F74A3-ANGELPIKA
661,120,562 *442528A31DBD959F253197AAAAFDD6171BA39B80 a88wb
661,120,563 *44217B4410CBF7E4EC6F63FFB50F79FBC76ADD0B a8r5f
661,120,564 *44218EE1294023BB6AE2FE04018C69000103899C aa!2h
661,120,565 *4422B3C533E8D38BCCAADF9B0A16FB134070F8BA 7 ISCHIAS
661,120,566 *44286405CF91CF6969600C1C9CA8E880329BDFEB 7MERLANGO
661,120,567 *442CE9E2157BFABBC277ACF2BF065D09D74DE8D3 7ONGEVALLIGERS
661,120,568 *442FA07C7CBA2E213A1E44015BC8CCAE67AE3D6A AABXXW
661,120,569 *442AA1C8CD906B15C0EF023E3496477CCEC527B1 AARBL
661,120,570 *442DB8BE2B8DF3004DE235E54591427136FB3502 83044 OPISKELULIEKSANOPPIMISKESKUKSESSAEIOLEPELKK
661,120,571 *4424C6EE248A49A9B02B0F2EE0017FD078F88227 ABDLLAH0
661,120,572 *442CED20987383EDA9F405AD383E6379485D9B51 8ALLIZOMKUOCLARTSIMESUOHELETSD
661,120,573 *4420754F4FF68F07973FD25A536F5B441E334472 ABHI0000
661,120,574 *442608EF5ACA531EE501AFE4DC2062C6B1FD377B abhyupapattih5
661,120,575 *4423A6C1E8A8BEEC1AD84657962F6C21D52D2FE9 8B ~Splat!
661,120,576 *442FE0AD1A435019119143144553421207D5A918 achmargrietje,derozenzullenbloeien
661,120,577 *442F7A74E93E748B35F5984FEF4D25C5DEFDAE51 AC;RK
661,120,578 *442D1FF59A1FCD0FB80641EA9B4A80178883979D 8propagandamitteln
661,120,579 *4426F4F79DF458149511BD97410BF87D2EB16FF1 8ROGNANTS
661,120,580 *442F00C1B0D18CB360076CAA5C3A707FA3E57030 8RONALDXANADU
661,120,581 *442BB9CF0B0C5B836EBA5AB1775CE6CFB4C3BE35 adriancant2002
661,120,582 *442ADB0830B01AC3C2FFB5EAF579A6850690554A 942siena
661,120,583 *442621EC20318770B11CA2E40214B09762A3D30F 9BAILEYGORDON
661,120,584 *4423C3851090AA23FF221D70BD709848BE0BF34C 9DENEBSW
661,120,585 *442ABABC6711D857CFA3C5E2A28CE9E341B3F6FC affärsmannaskap
661,120,586 *442A9CBF0B442EB7110CBC92D8F7E77E0ACF75FD AG!X
661,120,587 *442B253D2DDDEF3B154094C8EAC2D70CC6DF95A2 AHMEDANWAR
661,120,588 *442D1B4ADC583A7C38EB4F235973C94B98333FA2 AJDBJ
661,120,589 *442BD8FA97274EFB5E8F95C2484F8B6610ED12CD 9TOSTATISTICAL
661,120,590 *4424FE9FCC48BBA0659D1DDFA61A3F1CDD40F25E 9UKOZVIHS
661,120,591 *442AF5691C28716E21575BC12FA4347BC1EB8173 Al8R
661,120,592 *44223DA3B802ECC54EAAC769AB6C911DAC3C7E90 aldemaro7
661,120,593 *442DE1D429D08DADB5344DB83BB7DF886F5AA5D4 aleah679
661,120,594 *4422DB23D68AAF330E866723A93C22C0916DFB72 A3KQ-
661,120,595 *442518E7263AD9136AF58A2FE679CF0FDF15D01D ALLEN.EDLIN
661,120,596 *442AAA90F549EB9D15227936A1D2FC4FB5F660F1 A6S"U
661,120,597 *442100F4D81573C5301127A1DE0565DDC0B7CF36 ALONSO.QUINTANO
661,120,598 *4422AE1EDCAD743BDCC401D5953A2A85B9267E72 a=9a
661,120,599 *442D7110046638D3D08630B8436322AA8E137747 AMPMV
661,120,600 *44283C982614690C9C3520603E763C4CEEFAF41C AA^M
661,120,601 *442509E765BE49C414B3E1761354FFF5C56D0019 aa)sv
661,120,602 *44234282FFBF9649FE98D02279D11519CA9E8096 abbozzate2
661,120,603 *4426D3195420162C5DD1D2B1C6A0365A1170DFE2 abcdefgmine7
661,120,604 *44246F3D5D78344681A6C12E2557C8B39BB6C849 angga.sukma
661,120,605 *4423A094D33C28A3B4909759B906865F249C5A4D ABERATER6
661,120,606 *442358C30467CC746EA37A2622F33D7BFDE2A7CE anna-flávia
661,120,607 *442B19F6369BB1A26977EA232034632571A3DF7A abrx
661,120,608 *44249A60D606D341B94DB1ABA26461CA5E5A34FF AnoA
661,120,609 *442716F14D9A5AE702166E607A2AE030BEE875C6 ac9bf
661,120,610 *442A6577465D6FE4C278154CF336EE0A0035E48E ANTONIOMEDORA
661,120,611 *4428A97A44A553D6E72174F81FB44BF083B18609 A(CN
661,120,612 *442765835139E3AB5125DF9C2C373F47418C0CE3 AOO
661,120,613 *4423454FA4093F8C604D03A4AC6B2918BF7BB42D a.pbw
661,120,614 *442F9D3C55533A21679B3A5197916340E7A2E7C0 april0285
661,120,615 *442288FDCD9AF2F0CA4F9CBBFC41448B3D231268 a,eke
661,120,616 *442168BE229016E10F571C549801E557A4BABE98 ARTUROLOGGAINS
661,120,617 *442057320B917F2B085989AF52F3A0788C1A456F ARUNDEL9
661,120,618 *4426E610D0A332827E26FF5A6E15B9C4E53B32DA ahe_=
661,120,619 *44267EB8642AE4BE96F12D1E5DE71DA050624649 AI4/
661,120,620 *442147A903034CF44DCCF41D8CE6D4829E56EA72 ath?8
661,120,621 *442C38F321413C9F8050E1751322D36192099947 atkja
661,120,622 *442BCF2834AE8E1FC31B8998D0F64C5EBFF7B4E0 ATÔMES
661,120,623 *442C9B0A130FC219A8B5D20F1C1BB3C4AEC44A36 augustinemackley
661,120,624 *4421EB5BB85D67A28955BE0529A9730D15176AC1 [email protected]
661,120,625 *442F00734E5403BC6199119637908C54B9E75C99 ALANPRUNEAU
661,120,626 *4420B71A5C830F9F1E17263427218D99D4CE2679 al.%e
661,120,627 *442F6E396E64CC7FB3622AE6F51228C9079978C2 AV&I2
661,120,628 *44270694254EC1796A293980B935CE1BD2F53F96 b1b110gr4ph135
661,120,629 *4428388E877CA5C47461CFCD8B6EEC4B841AD85F AMP0000000000003342
661,120,630 *4426CE568FC2C9800721BE94B9809E210D8E5170 AMUGFORD
661,120,631 *442362E7ECCA522D31A12415466ED81A9273A5A5 ANABELLE484
661,120,632 *44223CE9968F1AA0D3AB67B39C07B6D683A8279F ANALLING2
661,120,633 *442DC3E1EBAE27F879893C3C1118EC4B68D44341 ANARHOCOMUNISM
661,120,634 *4424509B39BD4352B21825474E61AC67905D9809 ANSFERER3
661,120,635 *44251749BC04425D1B4C3D859FB35DD269602A29 bareshirted
661,120,636 *442CE071132625880D916CDB5A1B811F4D4D0630 BARNZ
661,120,637 *44258643B3E14FBBA5DBC438E31BC9422EF66B70 BASLAMBE-2-0
661,120,638 *442C5FF00E17F54BA52DF1B84DD4A20EE962CB32 bats
661,120,639 *44266C2C1172E00448FD1A0B8390E371F6F2C6F6 B'BC
661,120,640 *442A525A9A1942A4E6CB4F3EBF655E514E83053C AO44V
661,120,641 *442BA462AD925878477B9E5559E00458AFFC7E76 AOO
661,120,642 *44297E79766B6DB2E1C215F0BB48EF09AFED5147 BERBERIS!
661,120,643 *442495EF7DA5E0EC7E0856D3B9CB0DA2E137A7CA artemis-fowl-3---8
661,120,644 *4420E680C14C058E53CF7191C86EBCA1E595FE25 BFKYS
661,120,645 *4426B655FC288B681CB15C0BE7364BCFA19D349A bgxn
661,120,646 *442691C47845E6CCEBABC8A9A3BAB7E808A40585 a+ynt
661,120,647 *4426314C2FE929AA167A79C97649C2CBE0871544 b34ufor+
661,120,648 *44264878D8021544933DFC6059CC7A74C381BD50 BLLIB
661,120,649 *4422C6BAAC3A05FF365835061507A19AAA8BCC39 B6GK/
661,120,650 *442B1EDCE1259A1D0421343AAF4EE1037E523345 barakat.ahmed
661,120,651 *442D672C65A23AEC1175A9EB1686EAD3C4C5CCBA BBEGB
661,120,652 *44266BFBEF669092AA68B5B04328293BCBDDA3BB BORDEREZS3
661,120,653 *442190C88DFABCA455A090DE56E10716FE457784 bcp&w
661,120,654 *442C91A77BEBFFEA8D9646DDB26A0611E321A238 bdb6
661,120,655 *442681E23A09A51249996841DF4EF21A70636EED BP.`.Splat
661,120,656 *4426DB0E2B0164385BE9E7B32F99783F9AD9DB82 b%%r
661,120,657 *44220C427D7D74A0218FCF7C4AF39A8FFA85DC97 BRADY.SUFFERN
661,120,658 *44225E24FB9230DE8D997C29F0D1132E17CBC55C BERNIEMCCREA
661,120,659 *4425A250769CB42A70FFB1469A66B542D668C276 b(i_u
661,120,660 *442B83DEB5100C87F28AF4481682E362AF450E31 b=k:r
661,120,661 *442E0277C7673874C27B460F493741CC29833DD0 BROCK.MCGUFFIN
661,120,662 *442357D23793985582EE04C60A845942483763A4 BLAKECARIS
661,120,663 *442098651843B66248AEC46C0F87448AB99FEC38 br)s
661,120,664 *4425B9CF904F100BBC61804498AB902579EB23A1 BRUSTKREBSM
661,120,665 *4424177CC73CDFBD2839DB38DC36250F9B787CF1 b)m8-
661,120,666 *4421FC33C9DD67099293DB1AE0C1964819332F50 bmdxu
661,120,667 *442E0AB59082FE25521CFCECEF73D2F05B9FED52 BtT?
661,120,668 *442F0E03BD959754C46936A1E93B1A0AC15D29D1 bu,,)
661,120,669 *442C6193C152632ED1F4E2E23E2A0FDD4B1464D4 bu&l
661,120,670 *44201422938FEBDD95829018AF415962EA4FE764 bowb/
661,120,671 *442C3A3F21B74F33CB0C2401BE643E859D889EDC burtserey
661,120,672 *442AAFE56F426E7170D757454AFDDBA8646C01D4 BUSTERHALLADA
661,120,673 *4429F5E4E2F41E487D19F39F6423C580863DF5A7 BUSY BEES (INSTRUMENTAL)
661,120,674 *44244FB08BF81D50546126D6BCBE192BC14185FD bq1_7
661,120,675 *442DDEE1F6A2F3048208E6AD8A46EEAFB17DA1C7 C2jA
661,120,676 *44243169290493673F8C0AB41F21D6A798B54B67 c53b
661,120,677 *442FDF40E8616A555586D7286A45A19FAE5475D6 brickburner
661,120,678 *44208D589BEA5F6C1BD060ED7150B908C495A8F0 CARIN-HUMAN
661,120,679 *442BAC61B522BD547D297AABFE0F30F4F6E8CCE0 CARLOS493
661,120,680 *442E95851DFF7FD49E9A7A60E662BF56CDFAB65D CARLOSTC
661,120,681 *442F955C705C28EB1DED0EB62BA8F0D30A91BB1A BRUNO.JEANFRANCOIS
661,120,682 *44260ABA7A38B8591CD932F57C49EAE60B6E2F78 BRV&B
661,120,683 *442802D21B63027B45887DAE1F1A550A818B7EF6 BRYCE.STRECKER
661,120,684 *442C0F08ECF40A396F4EE05B1CCE9B560591516E CAROLWHITSETT
661,120,685 *4429017C6735464930BFA8EB8B9BAEC39587A1A0 caseymichalek
661,120,686 *4427683D8F365F810DA92B682E14C1EFBD0EBC6E CATDEMON1
661,120,687 *442498C7CA250AD57F175EF0AF2EB7EEF50E04DB B/#t
661,120,688 *442EBF74B907DDF532CFD2A305ECCD94F7E21D81 BTWDO
661,120,689 *4420AFB09964540E92866FC2F79AA9F5C3DBF7D3 ccb7o
661,120,690 *44207C2893A4D17E473FB7F435A04EB900DBA1A3 BUHJ
661,120,691 *442FB1919638675067A79D25E3B141618BAE86E3 [email protected]
661,120,692 *4428BEAD9F794E18FEA8689B46003CBAD70D9026 CDR?I
661,120,693 *4423B40AC1EBE4969A049A6CC083148AA249F3C5 b%++w
661,120,694 *4424EF506FEA9AE96E513DC6ADF128BA0A2B46C2 bys/a
661,120,695 *442CE2C8E60F71B552598CC1CC7D7B83577A4FF6 CHADWICKJABLONSKY
661,120,696 *4421B28B3083B352C676ABD04D4FB416437D641D c&4m4
661,120,697 *442B6617B19D5AB817666A9C2E990B16E647AFA3 CHARLOTTE-JENKINSON
661,120,698 *442C1CDBA11F8394395FB9C6115D7CC9922BAE62 C7VYP
661,120,699 *442EA74FD32BB9620E3E1A5224DC2498399280EC cacagüesa
661,120,700 *442BC014048743573B8B81A8D562242C789569C1 CHIBAREING
661,120,701 *4422199927FC12FCB54D80820F8C61A2669B3A09 chincha21
661,120,702 *442B7CCDCC2064434670149185A7CCEA88BC9F5F CARLOCARRINO
661,120,703 *442B0217CAE6FB04C4A125C42DEC47F86C0BD17A CARLOS.AVITA
661,120,704 *44291B364A1AE8090756324AC650426A87C9CA67 carlosisomphou
661,120,705 *4426B6A4DF02FE33924852F68785DB2E00C31161 CARLOSTC
661,120,706 *4425D24C17188A45A83E3014B63521EC75BA9F0F [email protected]
661,120,707 *4420084F8E12C9A9A94BECCD5E40936577762FFC CARSONHERENA
661,120,708 *442FC20BDED9DE9B4E7C12EE55165A259D750AF6 CASA-MIA-(M
661,120,709 *442CC7169D66C1E5DCEF9DC0022D942931D27D67 chuckshufflebarger
661,120,710 *44235F7C21D1AF5AA211F96D57AE600B40935761 catenation
661,120,711 *4429FEDBFC9C5D91C3135BC374DC26DF0AE51C7A CLARK.CASCIO
661,120,712 *4426DA65006C1A94BF2EB12E0D043F08C4DEE5E8 CEDRICSPALLINA
661,120,713 *4427B6604589A5F16ED4FF17AC61E9474E8C8B01 [email protected]
661,120,714 *442E57E42DB1E66BB8F10414CC55BA9F81DEADA6 CLEOHOUSLER
661,120,715 *442286755BECFC83CFF39144D6A550ABE46E5654 C!LI!
661,120,716 *442E2183CDF2CBFE847BDBA5AB24805F4090EB54 CLIFF.KENO
661,120,717 *4424FFA64D085F6022620DA87CC1F19227A43232 CLINTONBIBILONI
661,120,718 *4426385D53632CDFE667460ABF6E613296B29211 cesar653
661,120,719 *4421D973F94EECE57117A2CAE7129023F2F03989 changwookim
661,120,720 *44241962A89658281CDCE409BD6E99BE10086D25 CODY.OVERWEG
661,120,721 *44266915D4914DF773436946178CACD69BDAD9D5 coledelcarmen
661,120,722 *4429D87C2A73D190C0EBB0C2582CAC1DFE4650C3 CHAUNCEY.HERLOCKER
661,120,723 *4428EBF6CE90110162C0BA33B3B3F75477FBD83E COLEMAN.LEFAVER
661,120,724 *44205383C2BE8191B266E08A24BA0F32AE7FBA23 [email protected]
661,120,725 *442B813F844F6210F586D1D3AAC3F4B6E070561B [email protected]
661,120,726 *442F6E25A634ABF273B00A17EDE3FC201CA88A43 Comme-un-sampler
661,120,727 *442FD504E51353EAC5A25E0F66A00A0032172D89 CHISTABA8
661,120,728 *4422F1498074A62CDBE00E199CBA365D55136525 CHOIMEÁDACH
661,120,729 *442EADBCDF54925353DFD3C61C86D8B5B4E7B1DE CONTRADISCRIMINATE!
661,120,730 *4425149772D73DCFC1C8506FA7F64F98DAE32FF5 CHUL_
661,120,731 *442AB0949950BFDF6A0484521C66B0B5C8831180 CO;W
661,120,732 *44246DE888E4AE9FE398274EC53C1B114008B0F6 cko"b
661,120,733 *442B41CC1B08E21467C53195CDCE42EB25F72EC4 C+SJW
661,120,734 *442B2BACA6991CD8D932398C244268A3527BC305 CN#F
661,120,735 *442DE4A45C257C78119ABD8A9A9E1B70A79A1578 culturalthugs
661,120,736 *4425D13907E1BEA259FC0E4B48768D3B0AEC9E35 colorschecked
661,120,737 *442A8881F3FBED1D8CFE7FC635B06E2E34C7B8D0 coltonsteff
661,120,738 *4425FCE6F4718351CE7D73792E79C17E425D01AE cvv08
661,120,739 *44252160051DC008D8229486F7F263F54EAD1C4A COOKA444
661,120,740 *442C0D4A136783D0ACB0C9697932538FCCC3354D CORAOPOLIS?
661,120,741 *4426B2A11305BBDD55271AEED77AA3E7D7993167 dalevilletas
661,120,742 *442512E88CDF06481A7C2E0BBEA5E5DB28481C62 CROONERS1234
661,120,743 *44233CCAF9F819ECDD852D76C8145298547389E4 DAMIONCOLINDRES
661,120,744 *4427E1E7BE60DF6D6B5235F1158755C820F381E0 danaprivateer
661,120,745 *4420B48F750951D3181AC810E052FDBDCC84AED8 DANILODAVDA
661,120,746 *44287034C4BD6C2C8E20D6161743A52FACB442F3 DANOLABAC
661,120,747 *442C66FC62E7A2B3B37C363036B99B75BE9C6C5C ctaは資金面でも行政のサポートを受けている。ctaは、運賃収入や広告収入などの事業収入の他に、地域交通局
661,120,748 *4428E0128437DD1891198080C45A3B24B8D1574A DARK12010
661,120,749 *442A9798EBD0E777EDADDCB31A0CDB7DDFC1DFF1 CUERPODEVIGILANTES
661,120,750 *442DE1E50626A172DE8107AED689F851ADD5416F CULOS DESTACADOSCARRASCOSA DEL CAMPO
661,120,751 *442771A69D659CD59CD71C6F3C35B0DC202F61A3 [email protected]
661,120,752 *442EC783805494BCFC390930274155B86D8B6F1A daxts
661,120,753 *44215EB6DC1EDE6D8D76B6108980D1C393078083 d1$qu1et1ngly
661,120,754 *442E45D85C0E3AFD0479CBD9CB1352E0666EE4FA d!efn
661,120,755 *442E60DAB2D118D52BBFF129C4F88F9ED408A81F Der-Greuel
661,120,756 *4425375E9E7C46B2115B1A7E7EEFFC2879D8DBD3 DEROBESES9
661,120,757 *442E97951256C9E4E07DB6C302B8F5DDEDEEA063 derrick.long
661,120,758 *4423DBAA6C478FE7568066DC89EBFA3708EA2DC6 despise(demo)/[untitled]/eeyore
661,120,759 *442BB419285295C8376E9DDF476AB38A0D4C9EF8 danilovermeesch
661,120,760 *442DA80F6D9CE0CDFB52341D9E03F3DAEAB054F0 DÅPFAKAID
661,120,761 *4423D1CD27E1A118243F07FE72848D86851C4C11 dapheneos
661,120,762 *442BC1EFDE6DE4BBCEAF6EA39C5547536794C35B DHENTAAY
661,120,763 *442CF222764414853B4E5B85F78DA186D655A913 DIDINIT5
661,120,764 *442CDE0D64B6F6A4EFE8CE6F11465704CF7199FC DINGLE?
661,120,765 *4428E476D4DB6E869CF87B45C41123E7BAE5CD31 dd5i7
661,120,766 *44280E5EFF5838C2685730B2881370C95972F04B dj%e
661,120,767 *4424EFB24B1CEB033094F30D2977F47D9225C839 DL"VR
661,120,768 *442E55FA814C14BFE51B916AAAD2B97E84559CFB delmarmecum
661,120,769 *4421E88034DCD42CF062713BD46CCBD94D9FBB2A DELMERPIER
661,120,770 *442CC4FDD1750A9240A527BF7D1E89901585524D d#n,(
661,120,771 *442B03822470376C30681F70FD6C1FC687B37335 d=-nn
661,120,772 *442A75C4A34DC577996BCC73A507E488DC31BDF1 desaerge6
661,120,773 *4420B0D84579C960A7F75686ABF778846B98B77A [email protected]
661,120,774 *442D3F8557AEF8DC7BB19FA85B9BF66FFC935CD5 DESIGN IS LAW
661,120,775 *442FE9EA698CFE1997147989BF40D8F522B00BFA DON'T-WANT-TO-BE-BORN
661,120,776 *442794191943D65ED6E324B23AC681D0CB8FDCAE DOORBRANDDE3
661,120,777 *442FB4280EB3B4D023ECB964AB44AA79E1B41A88 DEWEY.STARICH
661,120,778 *442764C21F254C3C18800190618754400BF700B5 dfmtw
661,120,779 *442A385664AD9889A4BE36010A3B950FC606BBB8 diegoazzarito
661,120,780 *44259E0749698CDF4614A82D974F4C4F1D537931 ds=31
661,120,781 *442D5A61393BEC24423F2EB8D85C0F2240621747 d?tdb
661,120,782 *442840EEAFC701A6DB1DD511E49131EA31865FB8 du.bist.so.s
661,120,783 *4421208D70081AE1F189E864117C763847706974 duffylogo
661,120,784 *4424A6F09B76CB1446F38085FA1FF537FBE74D40 DITHERS5
661,120,785 *442B6D6952E44142CFC53A98DC243E8D3B8CC503 DIVERTISSEMENT-D/I/'V/[@]/RT/I/SM/@/NT
661,120,786 *442979270A6B48FFA738E532CF99F38576DE34A1 DUMEZULUNCUBE
661,120,787 *442893B131838F8784F2F27283F5283DFF4F8B5C DJ EPIC'S 1997 EURO MEGA MIX
661,120,788 *4425D27E5477D57BA572BC2493A46B7738257161 EAT_Q
661,120,789 *442CCFC3D2D9FD89FAD7434D5E8B7F76DD05DCF1 DORIEGREENSPAN.COM
661,120,790 *44283EB01E5DE52268C2A736F99C77DB4F7149ED ec-/?
661,120,791 *442777CEF638B7BFEB832E4E0556D88F926E8EC6 echao.pa'lante./.son.caribeqo
661,120,792 *442C22128430CAAFE89EDD81DEFFCE1FFA475257 douglasrecidivi
661,120,793 *4429C16A06CE4BD999B151A2FF4CF4A780C0B59D ed~f
661,120,794 *442E5E56C48963B9AD6B55E9F91F32C8F9DDED42 EDGARDO.PENNINGER
661,120,795 *4423A04691EEF3B212D6507DF5FAED9D9535518B EDIFONG
661,120,796 *442361868DCE65A8D24F9BB5074C926B47676598 dq5#_
661,120,797 *44296E713F581978F56D4E196674A5E0EAAAA96B DRG:X
661,120,798 *4424F485CB0DDAAE8980A07220A4B9851E884EFD DSNLC
661,120,799 *442CC9C3A6DF5C4895EC7FAB19FE723C978747E4 E~IJ
661,120,800 *442139EC43F4B59C93665611420C5C2795204BCC d%wf
661,120,801 *442B04CD112F0A4516EB2F64C9E070AB20C03B50 ELECCIONES.DE.LAS.ISLAS.BALEARES
661,120,802 *4424B51F3ECC5E954C166C653A7F70B90DE81D39 ELFTYPE2
661,120,803 *44293AE29C7A17D11CE264868366001EA342C10F ELMER.STATHAS
661,120,804 *442418A6D1D70F9E33EADD903A26DD56DEDDA0BB d!zvh
661,120,805 *4421B5654F4E58D5A9928B7C77C32F8E2F3B0529 EAQAL
661,120,806 *442E9BE5A3162B8EB0221E16F376C9D61986A0C3 EARL-OF-DOUGLAS HERE
661,120,807 *442121EEAA28042457A3355EAC26C5CC24CEC86C EMERY.GAVEL
661,120,808 *442A90172F292D2125E03C0EEA97D8E11E8A9586 EATSLEEPREPEAT
661,120,809 *4422A6B4DA6772470322CE3889AC994898A422B5 e-bv
661,120,810 *44217939FE3CD162C5BA28D77ADAB1DBDFACCBFB EMMA SHADBOLT
661,120,811 *4422CF94147AAE4D95318B0E39864ACC48B218D0 emnkq
661,120,812 *442B8ABE88AC0AE839937AEBE563BCDF3ECB1875 EMPRESAS DE VIDEOJUEGOS DE BULGARIA
661,120,813 *4421C26EB82487CD67A2E18A9ED874ABDF7B372C edj3t
661,120,814 *44234ADFBA1719E5B686FE4B885D84F83797EBDF endroppevatten
661,120,815 *4423215C5A669983867CF0B8338887402F090897 ENRIQUEOFFLEY
661,120,816 *44222D7522F204D172A00AF9518339E258F5CC85 [email protected]
661,120,817 *4420120125F68F6F397B7C737E446D5BE7DF2D3E ensuedi7
661,120,818 *44202DC1F26E43E84A060143A58E73241B0EC402 ERICK GORT
661,120,819 *442C289C62F0AEC9B8FEDEEED272C0E6C4DA8053 erikdegrandpre
661,120,820 *442707BEDA33F07B6EEC857F9A0E78A1A696003C erinerspamer
661,120,821 *44256BF9064817A946D0A275578C1FB12D5B6DE3 ESA3
661,120,822 *442F01596588720023C49AA034591ADAE1A6EC7C elijahbaldock
661,120,823 *442A8C441FF3830C7E4AA7DBE78D652A962BA8E6 ES?SG
661,120,824 *4423A8721A5303B6F5906D809B32F24B6E409D69 ELLEMUAM
661,120,825 *44289ED198EE681536BD5AD9B4505BA8FDF76300 ELTON.CANSLOR
661,120,826 *44281557B45CB857F039A33B1A569D330E1EDB5E etteyam1
661,120,827 *442E1DBE31E856595EC45ABC931F999BD0090938 [email protected]
661,120,828 *44250EA5822AFCC2DD4AD25C2787E42FE6E02365 EMERSON.SCELBA
661,120,829 *4429F2AF74E6AE461D2A6438BCBE6AD36192AEED Eurostar(featShivika)
661,120,830 *442C9979DB3D1002D210F409DE0E054FC7C457C5 emzsd
661,120,831 *442E2AFCD53CE23071821638528735B6564C5654 ewoptaeh7
661,120,832 *442D558B5CD8459916DDBC9633B031A1A0BEBA6D END_OF_WORLD_WAR_II_
661,120,833 *442E5D495EFE8B47AD0D62C0EC5BFA85E7FC5750 end』(作詞)
661,120,834 *442193505938DC2CD0C14BE2BF2169CF502C73F9 ENLFC
661,120,835 *44205C241D8C7D94B7F5752E9357272B179179AF ERICISMYHERO
661,120,836 *442D639A2CE023859A5D2DE384F71C1615737541 farkas1
661,120,837 *4423248176835528AD35A8484FAD9EDDACED1298 esvkt
661,120,838 *4429344CF648578C2C2BFAA34BACB0898A23262A FISER-PATRICK
661,120,839 *442C7954D20DB078939C22D0F04764401040BF04 EUSTATHIS
661,120,840 *442E7FF64703C3603C954F88C72FFF145B44C6F1 existing.exit.-.professional
661,120,841 *4423BC1E4815869150E0491138159EC33DEFC1EB F47320
661,120,842 *442471873EA98B4E58BEBE209DA74CF0E5E2FC78 F4$HON48LE
661,120,843 *4424BAE0568FD876D4C09CC93F7E438CD1615604 forwardmarch!
661,120,844 *442C16BA4D8B1E0144E0295BEA2A85105B4F5219 FAWIBIG6
661,120,845 *44280CF8A16200DD5C2D6BD4E9D45586659FDA40 fredrickwashing
661,120,846 *442C0087F417FC59406E1914A56E5425C3030A21 FELIXDALCOUR
661,120,847 *442C1595F93D1FACAAE397CB23F6B029C74E2923 FUC!1924
661,120,848 *442E89404D3A5996C0D319845B18DE788B18EFD1 G51096
661,120,849 *44240DBC4E78929FDFFCD79331F9F591E480ECCE fitsum-terefe
661,120,850 *442BC7472304AE8E98E5CE2346E9C643E5FA854D FJELLLGRUNNEN
661,120,851 *44222EA4EFF99D4CE769C87B50F8BC3821B52CB0 GAO_MAOBIN
661,120,852 *44225D9DD6432A182D4D657F821DE03C6AEB8801 FLAVIU333
661,120,853 *442FD924224EAA0D064C5CDA28B648367B10B042 GARDEN.CYPRESS
661,120,854 *442E9FE95DBFC3233B64D21A7CD423AE202B9797 FLINTIES
661,120,855 *442FEF5E604B554059D9519CC8FB20EF3CBC5E5F GARRETDIAB
661,120,856 *4422B87E2D57CDA96657A0959F8C44EEB4C321CB GARRETMOUSER
661,120,857 *44215FC3694D9CAEF306C05C347901225F6043BD GATESCAS3
661,120,858 *442225177A78609FCEC86F0A717AAC31EDC5417D gayan-athauda
661,120,859 *44203FD08E50C6F7EFCB5AD595FB43AD37F7B7AB [email protected]
661,120,860 *442CC5FBB58421E94DA60392D01A1BC181529456 GECOOPER7
661,120,861 *44294E3EB75F33384D3395FF59A998FFE5B9A167 GENARO.CHARRIEZ
661,120,862 *4422DD41E1447DCAEE7824599A371606F9A194B0 franklynlohr
661,120,863 *44218421D5B05905DE3BF96019EEABB8A570E121 FREQS...
661,120,864 *442991AB6E649C7A3AC9A28E5EE3586F0B468F9F gertchened
661,120,865 *442A34C0D6FE2589786DD45C9BB97E70705901C5 gewaltigen8
661,120,866 *44201D68C11D219379EBD2DC10705578E4CC8997 gilbertoflath
661,120,867 *442E1020A47421A2488AE6D8A9E2BC18F91DA46E [email protected]
661,120,868 *44206A4DF5BEC15D4960F3918412A38D36CB8219 GIUSEPPE.BOTHNER
661,120,869 *442896D5E1D7690DA32EB907A296292F12B6D408 GJ(V
661,120,870 *4425FFFDDBCBBC130B0C399FC6BB6E539244000C gloria-hyun
661,120,871 *4423525C670F0CD385E791EF544E79E5AC197E69 GANSKNUPPELENS
661,120,872 *4424F1CCD3D179DADE7460EC310795BA66A91673 GASSRANDY
661,120,873 *4428AB86323A7EAF23A1772398AA3DD76CB65136 gaylehonhart
661,120,874 *44208B3E6BA6CE4B47A16D79BA9ABA81D4761EBA gaze1ess
661,120,875 *4424559D4BE05064C296B9303D0E857B03337492 GEORGE.BEAUDION
661,120,876 *4423B5326C80325FC6288D008FEA68E25353570C GEORGE ZAKHARIA
661,120,877 *442B0B3B42414A0EDFEB16F100809DF96FC620E1 georssefwegrgtwetyewr
661,120,878 *442FD0B8786786E7A8ED45E917E1809FB3FB7984 Gsolr3
661,120,879 *442994A93E8ABA6F2E504157B01271E8F26C1BC6 GIANNACOPELAND
661,120,880 *442492F550A20E01D05008C3BC4C96BF2FA57EEA [email protected]
661,120,881 *44271A7D13753EAD0D61F4B3F47A0AF90CB34B2E h3t3r0f3r
661,120,882 *4428C7519F714DD451C88A3F33612423741CAC08 golfeses6
661,120,883 *442DE94B647A7643AF67B7BDFD13FA81BD53C92B HALSBINDED
661,120,884 *4428E35FAFFA2AB94C696D30748B158FC4E3EA77 haroldbejger
661,120,885 *442EC6F215A0934A33122B51120D74AD86F2763F HAROLD.POPE
661,120,886 *442B955FABD6E16006EA542F8DD77060D2A6DB4C [email protected]
661,120,887 *442824A324E11A4B181E4FEA286580C81EC3092C GREŞITU
661,120,888 *44243AC674C6CEE27AE1DC2EB7150F3ED199EAF1 [email protected]
661,120,889 *4426F393FE0D6B7C28BA42437BDE851851111528 HereasOne
661,120,890 *442250CA9908293E1F42B6794DB6B9EDBD2CEAC1 GW3R
661,120,891 *44229DD3392F4F3E641971B7C4478F9FB1701846 [email protected]
661,120,892 *44249F8095E750550357C2B19D2CD25562E1FF7F [email protected]
661,120,893 *442AE52ED67B97E8BF8BDB98A5386C4F09B3D93F HATTAN SINDI
661,120,894 *4429855EC15778102F0CCA42AC8369F16A2ECBC7 HATTAN.SINDI
661,120,895 *442CC08E70EFE076353D018299F9CBE8CC99706B HÁTTÉR45
661,120,896 *442C33C157B1FAA722840A48E74F3412B65E81F4 haywoodatamanczyk
661,120,897 *442E52D44B97A560EC98C2F01F744D6D9D2F14B2 haywoodbooton
661,120,898 *442887E1BA13691567655A4170168D3695A12785 HCU3
661,120,899 *4426D1B0790ED2295D29AA25827B1F702EA6112C HEART-DEBRIS
661,120,900 *442EF41C780EED16C280AB718C2E64FF69DA1231 HOTAGSBYGDEN
661,120,901 *442D42161B62ACE96D1E92E20E414B332B7635E5 [email protected]
661,120,902 *4424927BA05377375365ED0F22ABEDF37F31A450 [email protected]
661,120,903 *442D5095D9DA5EF864082EDDF8F2D8601AB1D2AC [email protected]com
661,120,904 *442F7EE5302478FE5AF46A5A4DC9BB5EE97E9875 HENEQCO1
661,120,905 *442864F7A2F7B007FBA03277B8F930C0A55040C9 HeyAlbum
661,120,906 *4426F7ACE1F5FEA028BC56E3BDAD606A87220472 HILARIOPHILLIPPY
661,120,907 *44252EE3169C63BF59919A19F370FDA5ABAD0F4E HILISTYE
661,120,908 *442847918858EB852085B3A6696448C504D84380 hn9rtijgr91t7pnz0jb
661,120,909 *4427A90B89A72E20CCA8C7E9C8701A85871AB0E1 hokkaida
661,120,910 *4429F3CDD37C8AB0A824B05E08B42760CC5EC2FD HOPPER.CLOSET
661,120,911 *4427FB6CACD76C267EB35A9C5014E34AADBE1837 HOYTGEMMITI
661,120,912 *4428CD4CA390CF1B56A032A613D482F8B12CC106 HRDLICKOVAPESCHKE
661,120,913 *44286D4120D9F1661BDF21709D705FBD074A96EA HUNG.SEBOLD
661,120,914 *442BCA1C8934657E1F0AC4FF57C2A10DD556E223 huntington-willard
661,120,915 *44217656922CA4C7C73920A6A477B446559BE376 HURALBSW2
661,120,916 *4428DCD18A67FD17575628840DB2E2C59A611D99 I159060
661,120,917 *442FE6EA182ED72F131665FA633383C7288F93B6 HUGHCLEGG
661,120,918 *4420AFDA44CC803C0C7B1ECC4777AF615A5A7572 hukkien
661,120,919 *442B5CC56AB716B7561F38F239299031A8D31A27 i]^b
661,120,920 *44205499255411AC24D6AD93FDD49723887A8471 icteroiding
661,120,921 *4429F2853E9ABED7500A37BEFD4E158B6C520799 iguanacafe
661,120,922 *4425665B14D97B897E8548C69DD1D6C6A0591A15 IOKU
661,120,923 *4428F3E75E3848680FEB7B6ECA8D06E8C9E6B3C4 ISAIASMCLAVRIN
661,120,924 *442815BC4CBDEF620EC5B2A4F1A693D089B2CD76 [email protected]@+ION
661,120,925 *4423C78CC78A0828D7DA78044FFE700027729DBA ISMAELROUTON
661,120,926 *4421A5D96EEB9085AB9F9BDD666FC487B07A151B ISNESIN5
661,120,927 *442EDE5A66212EC09242041CEB021374E64BF73A IVALANTO
661,120,928 *4425680434C84FA47E3995FEB665E72210F65332 [email protected]
661,120,929 *44212F4DE1FFCAF4FD85B8BAF90B8812F23475BB JABA0
661,120,930 *442DF42C2DCC9DD5D209F3DC117780A0D32C1E50 jackieamunrud
661,120,931 *442510117B009CBC2F2E98A14291B4A80DCFE63D irbe
661,120,932 *4423A2EEA69FA0D1BFCC9D65BF37D9EB8D1FA530 ismaelschieffer
661,120,933 *442D19BC0279DD1F1ADBB2145065E4F5FA1C3DAD IS STRANGE AND PEEVISH.
661,120,934 *442D4BC8ED579AA23183DB6DDAA745D0B1643D13 JAMISONSTILES
661,120,935 *4427A8DB14821156432158753BA6966546739236 JAMEL.KOCI
661,120,936 *4429E2837CBC6C7864BAC0E6595CD803FF3F37FA [email protected]
661,120,937 *442EEC637A7C73D63961A515A6A8C3F9F2641AC6 jcxm
661,120,938 *442DA7D6FE60F0EAB2BB137B35CC6DB91F56D885 jenvuong
661,120,939 *44299C7EC258D4CD23C6052F9C63240D313140F4 jarrodreaney
661,120,940 *442622019E3924B91868B8CE1FC7143B89CAD340 JERAMY.REALI
661,120,941 *442A3C8DB95C32935893E80FBE38A10246D7EA78 JASONDOLLEYLOVA4EVA
661,120,942 *442F4C918929A1944AD722AECAE390949D93714C JERESOLANO
661,120,943 *4420419E2E7A62E403C38D21B9C9949754392E5B javierknoles
661,120,944 *442189A6E50235925FC3C07B4CED69C51EDBDB87 JAYGECARR
661,120,945 *442440817B33B3FF623A072C88B62160DFED2ACE jblossom
661,120,946 *442D2ABDC85D34DDF6B20E55264B310D6715A4DA jerroldheninger
661,120,947 *4428C5DAC708148E007C7EF86239B11A32F0DBDC JERROLD.SHORTER
661,120,948 *442DCD1396430643DD24E2C6C834171D8F38A5FD jerrysalonia
661,120,949 *442009EB8634BA47B7C6CC4E8AF43AFB6B32C11C jesusbleything
661,120,950 *442F9FB1EFE0E65C1D0A11E75989CD991587637F jewellrubenfield
661,120,951 *442C7D76C997C941FC8EAD4E9D617846B0783E8E JGEBREEGZIABHER
661,120,952 *442998008DFAA178992B692D0B8B5FF03DFF1CDD jonathanmelen
661,120,953 *44244F360508628FDDCEE344B4FADB31BB4FFD50 JONLEBOW
661,120,954 *442E9352316FAC0C49B056EB03EB7E5E60554714 JOEL.VONGUNTEN
661,120,955 *4423ED5C3C8AE8ADB82D4C90B20509E9543C81D2 joeyelchert
661,120,956 *4429E983121075A7FDFA79112800F41FB15C9276 [email protected]
661,120,957 *4422653D63AC4A8BA49B07A09DECEBDB4084F3A4 [email protected]
661,120,958 *442ADDDEDDCC0B7A0B61579DA45430D50473555F JPAMENTER
661,120,959 *44219BBB1C7B44421165C90B65305888D87A5E0A [email protected]
661,120,960 *44273FEA541521194CE19A999764B195BDB64932 johnsonbuitrago
661,120,961 *442A6689E3DD86BDFB93BF2DEFD7C4626B3BEF30 JOHNSON.CATELLO
661,120,962 *442B37CC0DDA1B67C76FF8986E00B1B122F79D8B jttiknp4
661,120,963 *4429C3889FAFFEBDD99EE4F07EA33A5C2E0F0A78 JONASSTEPLER
661,120,964 *44281F2FC50FFC5EF1CDE7B9AC0091E40A5CB365 jordondencklau
661,120,965 *442E3D11180627D4CAB92F733708EC380DFE1591 josswhedonacceptsawarddropsdollhousehintsnameswinnerofbuffyriverfight
661,120,966 *4422D20B6FB62DC08278336B1F9BB83EBC581123 K3LL3N5T34U4
661,120,967 *442DEA2E84F0F27B40A25264D15A7D7B0CE24A6D kaileedavis
661,120,968 *442CC8B44DC62970F9973FC6E5BE069E6A3042F8 JUNAYSMITH
661,120,969 *44271F45D491FF004679DF2576A0CD101575C4F0 K1#
661,120,970 *4424CB613E9396B6E9B9CBCD0123A8FF86781116 KCATSRTI
661,120,971 *4427B744CBB48003CA0862B21B08DDDA8CB0CBAF KANSSANI0
661,120,972 *442637500EF3C11ABB6D32FA8F6B86ECD78FFEE9 kenneth-gonzales
661,120,973 *442DB19B1E15FD66C50D914E054A8B6F93CFCB83 kennethterroade
661,120,974 *442575D2E258CB03083048E2E0832BEAFCAF272D KIANIP
661,120,975 *4425D11BE5F17CD719CA8A42E7BAFEE487BF1685 KELLYTIGER
661,120,976 *442C257867E5586CB967340A3458FE8BD569060B [email protected]
661,120,977 *442E28B086E1E1ECCD5DC068EE0C576F02BB735C KEROKEROPEE
661,120,978 *442D02549DA3E3A9D8B1FA532F42A8077E2D4242 KOVILLA1
661,120,979 *442637C6DAF79095AC60ED80A6B997BD89A3DC8C kurtisvanwagner
661,120,980 *442E60FE8CB8A5B15122454821C3AE6403E9E50B KUSSMAULOVI
661,120,981 *4429E2F795E3067EF71EA6A796086253426386AC lacyrowzee
661,120,982 *442A1A110BF5EE3846E93C9388EBD73643266EEF laffert
661,120,983 *442B5DE0FC1296C88701396F2602C589196AE64F kkeqcsnj41
661,120,984 *4420C5EE835960ACD2FE470CF080E5492C369D81 lanimretmreaks
661,120,985 *442570CB5C7F5AFA9AE6A955DEF74357B3C17918 [email protected]
661,120,986 *442036486056438EF898246FA53219066263DDBA KOPFSTEU0
661,120,987 *4426F62403E8E1155F70785494542AB9E3ECA092 LAVERNEMCFANN
661,120,988 *442B063132B79030CEAE3948D17D63A3DC9F9231 LAWERENCE.DERUYTER
661,120,989 *442DE24E3998ECE723FE30ABBBE1254D73FE9E18 lazarodenes
661,120,990 *442D5EF3019DE36F2A6EAB0D49A0936F577260E4 KOUTROUMBILAS
661,120,991 *44201F88201E11DA8AC2023D446C95077B278227 LEMMAFREI
661,120,992 *4423F6EA14C00ECEE5433CB606D60CFFE51F2163 LESHEEP
661,120,993 *442DBA8CADBA4C0F6E194CBFA452D4DDCC0009B0 L-
661,120,994 *44217949B63592E8FA5BD963E5117CE3597C93E7 LEVI.SEANOR
661,120,995 *4428D4821E6631178D7B9A98F0D3C6BD6B048567 [email protected]
661,120,996 *442CF52C08A36CDC95455D6664642F3591D9B115 lieferwagenvarinaten
661,120,997 *4423972571B17005F38B4161B67D2E6128FD8E89 [email protected]
661,120,998 *44223D5DAE0009866043D383FE3A5D6EC11FB695 ljfjoker3
661,120,999 *442F694D433E8CC7D3006D55AACFB3412600D5DE LLOYD.RUDLONG
661,121,000 *4427D6FA3D7BECA74394208E71D09321C201E462 localidadesdelcondadodenassau
661,121,001 *4423C5CEBA7A12ECCA0BBF6179B8BA0E06A84C92 LOUIS.BOULTON
661,121,002 *4421973FD64CE046CFAB56644BAA10B125754179 LOUISIANABOOKFESTIVALORGWWW
661,121,003 *442250047C6DBFAFEEC89EF19F02C6D4E5A9F4A6 LSH4860
661,121,004 *4429706A66DD04A0DB113750257F04ECE8D1BBD8 LAGUVABI
661,121,005 *442E653E951FAED2C89ADD366DCC5B0696DC926E LUNATREX
661,121,006 *442ED5663D62C8FBE95DC2585EEB85EF67377804 [email protected]
661,121,007 *44292A1A585ABBC946BDAC6F0CE85FA93ECD570B LUSIZENSIS
661,121,008 *4421D904DCE017E386D5436B6951ABE3FB6ADF54 LYNDON.SLENTZ
661,121,009 *4426FF042F0F243A2416538EC4F1F99D1CACE4D4 LYNN1955
661,121,010 *442FBF3F640B02926200EE8F5E65CC74E747D2F0 macraen2
661,121,011 *4427A9ECC12B7801D7AE22B5FBA5605E2D77CD64 [email protected]
661,121,012 *44225E4A410935F17C4ECB0F7DD81EBF34330150 malcolmmaglioli
661,121,013 *4422C37B9791D8B3D51EEF8EE590B852B9B7384E [email protected]
661,121,014 *4425F2C26EA4B4CF97DEAF6A02B447F443793630 latouria
661,121,015 *44267D647B3A1653A523B0E1A0C9120C044AF65D MARCTUMPKIN
661,121,016 *4421767210E980F6AF6EF9F800ECCAD955B1C29E MARGAR3++3
661,121,017 *442A8FE274E4AC947C6717B3D559F5FFF31B2484 MARIANO.POURCHOT
661,121,018 *442278124454F662645BDBAA0DEDB0DFEE88F945 leçi
661,121,019 *442EE04964DD09B94FBE2B328337B4CE89B58097 LELANDDEROCHER
661,121,020 *4427556C1C5C72AF4FA9060184B46FFF90CC2B60 marybethspencer
661,121,021 *442C6C464B728D4C38520F69BC93E02009FC53B5 LICA.EN.LOS.ESTADOS.UNIDOS
661,121,022 *4425E4D7F1495B3783793F0F4EBFF902D914929C mcconicing
661,121,023 *4423F89B3E13110CC436732F4B2B99977E0D954E liftfromflowturning
661,121,024 *4429D297CF953FA8B37DDD86AA4222A36F499E6B melgragg
661,121,025 *442986BAD0C28DF1243532C4693731F843258E9D LINCOLNMAUSETH
661,121,026 *4423A784A8F7DB1872DAC0247AC0BF28F707ABB6 memory.&.imagination
661,121,027 *44288983172C0E590BDF7D93F3036649FAA2FFFF [email protected]
661,121,028 *442836D2C865666470C03B3D974E1712312BD662 LITTLEMISSGO-GO
661,121,029 *442405020F89B7AD542204CF5888C381F2B82B80 MICHALEMALLECK
661,121,030 *44236D58102A9E9E644A677BFE59346525C0BC30 mikemurilla
661,121,031 *442C4D42E4D14543F7C22FE0989CF82B46EB82B4 MILLIOIGI
661,121,032 *442AC90553968935E9CFE339676F9F058A346E30 milotonks
661,121,033 *44208A21AF1C5CF16533A81AC01BAA21F246A6F5 mi-mundo
661,121,034 *442D8217E5AFDE927DEEA3B193A55F0DAD6DC83B MISSTHEGIRL
661,121,035 *442A4FA00C23DD11884CDB8346A5CD20FF072B7D LNSKRVRNS
661,121,036 *442575BEEBC8A5B4FD26CA8BF8F3FE48C264E56C LO-FIGIRL
661,121,037 *442D5E7CE8634D100022E50A9910DE91CA021E30 ˈMJAɾ
661,121,038 *442BFCF5AEFAEB1DCE73473D625173C2C927FD63 MJEŃŠYM
661,121,039 *4421970F8C9A74EE4A1A8C14067DFE36A934CB23 mjnw
661,121,040 *44293094D934A18A5D0DCE070B274B76D0679D75 modifikasyonlarina
661,121,041 *442125994CAA35CBF3AACFDA0E46DA5F314C08E4 lowrenzing
661,121,042 *442F0BBD3B95197E40374E5482197B6612959605 lucianolingad
661,121,043 *442F8DE3C2F5588FF5F472B8BFB91AC87AA74E4C LUIGI.SOLMAN
661,121,044 *44238FF2E9C73E6F99472C861C0DF230F20FE2A1 [email protected]
661,121,045 *442477119843E90A57AFDDAC2DCCBC45D7AF60A8 LUTHVYF
661,121,046 *442D8A522891254916B952AE440B739F0154FAC0 [email protected]
661,121,047 *442D5569EE555FF4B6FD3A2F8EE79754DC7FB62F mosesbolnick
661,121,048 *44211D9FC62652CC3CEF734A0D480FE4A39C8663 m?pc
661,121,049 *4423311E062795AE5742D9F99479F56978DC920C MURALI.SRIKAKULAM
661,121,050 *44220E54657989AB8B9250064A5130A1FAAE6BD6 MURRAYPEPITO
661,121,051 *442B15E01B7BE5346949EEE1A2DB57B71CC54B26 MUSFASA0
661,121,052 *442741115D6631C0D44745165A9078CDDF8FAE63 LYNWOOD.REDEPENNING
661,121,053 *44261047B5D3BD87104A179DB917B0596526DC07 [email protected]
661,121,054 *442C77901BE1F761E1205D89C04282FB4EB84116 my2.bbs
661,121,055 *4424CE0063E18B4A08ABADC16786F6598885D23B mylesfricker
661,121,056 *442504CDEB66E32E76E2D6EC5847C3F908365709 MAJA.GUTMAN
661,121,057 *442058DE1642E2E436819AC546D56E3584EDF7ED MALCOLM.OVERMIRE
661,121,058 *442A6189D17E49387A28789A5263DCA4272998BC nã¡drå¾
661,121,059 *4426D139C296220F77B160500BA1149FE4C2FB61 Manos,-Huesos-y-Sangre
661,121,060 *4426CD0C2B1C943969E8B30B61FE554A609FE8CF NASAPISER
661,121,061 *442477A32130A1D9CC0DDB95E6B4F7D240E18DB0 mapmaker
661,121,062 *442E0CE75CC45FE7D028255D6C51683C5D1C419B marcel-pfister
661,121,063 *442AA5D892A6C700FBB7CCE5DFF71709928A8668 mariaatay
661,121,064 *4424A36EE35899F64624A01EB69B514C438DA6F5 MARIANLOFTIN
661,121,065 *44288E74DC06144773FBBF28D98CBAB1FF11AD07 nemanegfre
661,121,066 *4425347D5AAEFB5A0DEA50E362A273A116ECC4E2 NETYBDIS
661,121,067 *442877D784A26E45D58E6890C0DB9F82101D7C7F [email protected]
661,121,068 *4429A6DA29F6BCBC6B4FFE5FF72E08265802E7D7 nguyenlucy
661,121,069 *4421901845EF8BF169D34D6D66B77F75C5578B55 MEGANECHAN
661,121,070 *4420E8AF4AB261901A6FD97F7970E15F730BEE0F nickolasstafford
661,121,071 *442CECAECD21F77E5214453E20840FE24462280D michael.jerome
661,121,072 *442CC4475BEEEF6D53B5E649D1E42B3ED195F384 [email protected]
661,121,073 *4426CAE53B76A9DFE744ADA5015FC83510F089FC mike-carmody
661,121,074 *4423AE9AFDA5C99C514B7D92A5399D7F8AADCB81 [email protected]
661,121,075 *44280F0D734CDC76562E66DC4A5DB09EB8872F0F NORMANSAVINAR
661,121,076 *4428DD6C9AEDB5D4832070294A02FD3F0FE95BF0 MIMAWASE1
661,121,077 *44283780475677A1E2816FB7B7CB7BCA7A0C1E56 MITCHELL.HOLSCLAW
661,121,078 *4424A37BC0468937538CF25C7FF42CE82AA32DF9 numbersfenti
661,121,079 *44261E29F7111F1390C3DF51BC6FA7002730EFAF MOHAMMAD.WRIGHTINGTON
661,121,080 *442561363330B981CCF1898CF4C1B14F7FE315AA MONTE.WALTERSON
661,121,081 *44213072E6CB28DC8C0EBC48C735319FC1C31F1D OEVERVAL
661,121,082 *44229EEEB0D0AB9F5A47555934CBAA4D713E97A0 OHLOVE29
661,121,083 *44244092ADF3E508D203CBC46FEC1075A663FD51 MOURLAM9
661,121,084 *442A90A669982FD37FE0325E8D6593210B9DB1D2 omavavella
661,121,085 *44239A8C859DA373A1453EC68BAFC03C5F65C653 MYSPACEPIMPIN'
661,121,086 *44292F0F6701F9544EAE0439C805E25C64E84EF5 OSTPREUBISCHES
661,121,087 *442D7CCCA76CB8C3A96492A5B9163AD550788845 [email protected]
661,121,088 *4421388CD12CB7917BF4496A1AB49B3D93B7D352 overwomanises0
661,121,089 *442B35151B72EEAC9AAEF70284AF0449E7399629 PACOULIS123
661,121,090 *442669D447B0276135D5957CCB45958EC131365C NICHOLAS.BUDDS
661,121,091 *442EC387AFF8F77B370010457EC98AEDA7E36EDF NICKORIZABAL
661,121,092 *442B80070B3FCBEE98F1FC8F6671B493DF5BA989 parsifal..prelude,.act.i
661,121,093 *442117EFC5A1CF45EDBD8853D27C2DEC36F53FF6 noequail
661,121,094 *4429CDCACACCE5C32C2B868AB4153DA5DB28DDA1 Nonc1a$$ca11y
661,121,095 *442D9A6C18FD5EFD42C28099CE7C3A084F615C5F NONRISOTTO
661,121,096 *442C050571F3595D3DCF24BF587F37F7E15C1B89 PAULACQUAH
661,121,097 *44296C657853E50F867F604C1C6B7DAAD4B85FB8 PAV!
661,121,098 *442D026ABBC7000C4C0617C7D9B267E7DA699746 NOTONUS
661,121,099 *4422834AE3758D5BA026698EA770779D168C2682 Pea-souper
661,121,100 *4426F019C82A0B16989D5FD5B823649375F27E82 PERADAHLSTROM
661,121,101 *44252610B2A9531654EBDF19DBED86D1DE68B0CA NYARÉKAN
661,121,102 *4427EEBC5BFE4EAB7025E17EA709B8FBCC790179 (^_~) [email protected]##8
661,121,103 *4422E5F8BF47DC4E75B13FA57945336402B01A73 علی€ŒØ§Ú©Ø¨Ø±
661,121,104 *4426196EC034C897B3CAA21C8B75FABB3BFB8EC1 OBJECTBUILDER/OI
661,121,105 *4428BE64C9B37D2DE6BF9A0EA85A7F437F2F8640 )o(~`-~`d======p
661,121,106 *442CC597BB2506F504E6EA4A9FEEDAFFF5F3A386 PIRMANN2
661,121,107 *442FCEBC61E597980A5BA90C15CDC57BC78265B0 PLANOWAŁEŚ
661,121,108 *442658BAC921F19C955D16BD54F606D3DA3D57D9 ORIETHA0
661,121,109 *442C9F493E6E27CA375D15BEAD175E9F2C51637B OSVALDOFERGUS
661,121,110 *442DC990CD010914B1CC6381928C23D1B534982A OSWALDOUPDEGROVE
661,121,111 *4427CBA84F99BAF3F61B2278DA25B6A036BE54FE [email protected]
661,121,112 *44296A86A049ED31A4C0C862085653FC689D9220 OTISHIZUED
661,121,113 *442ACAD8B52708723141C5C75CF2B974AAEB481F p##p~o><
661,121,114 *4429286DDEF66BFA103C6AF7A5C5137FD6F419C4 [email protected]
661,121,115 *442311B5C1B64BDF0A1F1CD1104FE8E5FF89C904 PREGNANCY.3456789101
661,121,116 *442A3571FC448685E3DC878D954B3E76BCE7A5AF Prelude,FugueandAllegroforkeyboardinEflatmajor,BWV998:I.Prelude
661,121,117 *44296F7CCB03DFBB5C46B1064138AFC0C0D4AC87 PALESASTE1
661,121,118 *442ECD822F49966C4AA9078827317B24520C145D PRESION-SOLAR
661,121,119 *442DCE8E4354198A75D92DA7574D2CD09477D675 PAMELA LAVIOLETTE
661,121,120 *4421C5CFACAD71175429C5BE563FC2EF4A7252B6 priya-ramanathan
661,121,121 *442A26B421302450B89A84934D65835F4184A4C1 protopoe7
661,121,122 *44278D0C7A1268FF966B174BBE2BA3CA7C0D2DB4 ptbgqqwu37
661,121,123 *442FBE27A0DBCCA7FAFAE1778B5183A1FBCE800F PUBGRAFF
661,121,124 *4421B9646F92FADEADE5D0B44960D6041F4CCA5D P=B*.*.(x)
661,121,125 *442B6AD7473E6558E23C40F8D0FE5D870686074D PYSÄHTYKÄÄTTE
661,121,126 *44202AA8761C595F94FEF02DDA3BCF5F876F8994 PE0P1EP1
661,121,127 *4426C5A7290CFB0417686D0EE7D91A853D712524 PEKINESE
661,121,128 *442CFCDA8CC8D5E956753FBA1123388C69DF22F8 [email protected]
661,121,129 *4427CAF0DB5B6A6CE14088EE088DD2E2B3E59DE0 periya
661,121,130 *442E1623278B066034E21DD4EE0CAA525AC81E55 [email protected]
661,121,131 *4421F6E4BCE63FC0C070DFD93C89A12A73E873F1 petainisme
661,121,132 *4426FB7615BC91A99AA12FB2338B3C199F636F6A PETITE SUITE, BALLET
661,121,133 *4429B38AC9A43AFB3E10BD00DAD4B83546283708 QUITTEUR
661,121,134 *442CF9EEE990B54AAB526C8A12C7647209BE2F0B plegmata4
661,121,135 *442C20C9567CC818628BBD5471581D3D0B4C5C2B PÔDOTVORNÝ
661,121,136 *4423A5E2C865EE1080F9F8ADE39D88AC99B00336 PORFIRIOLAROCK
661,121,137 *442192C04D7C985628B7FA93DAC002CCF21E26B1 rediareikooc
661,121,138 *442F37B98D9F570FC1C62E199895A88264C8ED3D REED.FELTZ
661,121,139 *4428FDFC034A65FA35BE70AEFDEFEE52C2362E48 powermachine(a)
661,121,140 *442BD70CDD7B8718262C134924C71F4EB8203D00 prebiological4
661,121,141 *442A152AC22045F4CAAB87DD3ABA5C9D32459639 RENAJIAL
661,121,142 *442C1A8F33DF05692178386E2E08952E44F6EECF REPÜLÕGÉPIPARI
661,121,143 *442CDEA778A9ED3AE3396FFC032D930BC8E5AA67 RESLAWISCH0
661,121,144 *442DA557EF0E207DAEA19F01D5B564D1F3A42525 rexlove
661,121,145 *442398EBE796A9751CBDEF24F720E29B3C7753E8 puruuto
661,121,146 *44261D83B65DC04D340B34C4912CF99FE023EDFC REZINOCERP2
661,121,147 *44289CB74D6DCB8A25BC55198F0F13805EE54986 PYCNOCYTE
661,121,148 *442AD433BBA5A8EF62D84A54599B4BAE581A9D9A PYYNNOEISTAE
661,121,149 *4420103ED3E0E80C9CBBCF171A1BEF776ADE2A81 Q#####B~O>B0
661,121,150 *44238D53FEA74BC0161BE522FB3B9F3A58223943 [email protected]
661,121,151 *44286A986DEE0946305CE3762B4F6F0918EE0BCD QN2O
661,121,152 *4422E211BF4D824115FE2A5460E65203CF7693B3 [email protected]
661,121,153 *4426A94BFB4995085FF3BB4066B6332DDEE5FAE4 RODOLFO.VIELLE
661,121,154 *4422084091F6E76C42901F5B6D15FEC892A46CE1 RODRICKBEDWELL
661,121,155 *442D9546D5224D1204C3B6AA28C6B4D9A04165C3 ROGERTILLMAN
661,121,156 *442FC929AE524B0B7196264F1C200C5F7244709E raphaelewbank
661,121,157 *4423D12824F4415C165ED0DC3562ED12B5994BE8 RONNIESEIDER
661,121,158 *442775040EBE13D245EB108196AFC6C96A269E17 RONNYLAUTERBACH
661,121,159 *442308FA266B77DFC8AC0F23A324ED295D2838FD ROONEYSHARMA
661,121,160 *442068007264003D27B2C5D4CA58F161B11A0204 RAY.VANDEZANDE
661,121,161 *442F018E09660582924C69CFE1BA3994C1A2C38E ROUHANGIZS
661,121,162 *4427E1EAEFC01B148B39D72AAAF8C8B8D075029C ROUTLEDGE0
661,121,163 *442EC208FDB39E7F98F37EE063374EB1E50578AB rudolphbeguhl
661,121,164 *442B712CDF2BB735AD076F2E15339D926AA7CB7E [email protected]
661,121,165 *442A3DC0B4C2E9368A9F9BBF4642233EE393514D RWQ8399
661,121,166 *442FEA20D846E3209713FB550BEB61AC5439464A REIDLANDIN
661,121,167 *4428574B1BECA8470530A104338ACC83D3B1F677 s3ns!+!z3
661,121,168 *442A20902C2C86B59D1428FA7BBBA6BFDC0B28A1 SAL.CARMON
661,121,169 *442836C278EA4A2608276D7EE55EDCBF31328A5A rennmotorenkonstrukteur
661,121,170 *4426FC827F0BC06781284B03127D3FD287D9501F SAMRUTHAGANESAN
661,121,171 *442EE0CA5DD48BB46B9BCFBD2E6EF577B2030CE5 SANTA'SBEARD[INST.TRYOUTS113]
661,121,172 *4420D24A2677611A2A8B353325DD8238E6B35ADB sbux1st
661,121,173 *44224096FAA0404EAFC119A9BC7C12A17CBC7A5B ricocerruto
661,121,174 *442245B40F55B5B7338A579F19673A10F3C5BDF7 SCHLRFFNLND2
661,121,175 *4421B2DA4F5F09EB9682F557F2F32A33370FAF51 rigdown52:4slicermypal
661,121,176 *442A89A69D8767CEDD741DF7CE9C981FE88B37FD RIGOBERTO.LOUIL
661,121,177 *4422886E3026FFFB80FA3AA861AC0E125CFB0716 SCHROMELIJKST
661,121,178 *44249E9A6438B1D1B7D9F594E2F8F0E488433F7F SCOLOPACEUSES
661,121,179 *442D96AF1D0E932CBFE6E1D2ED1CB271FBB1723F [email protected]
661,121,180 *442B9B0933877450FD1BA9E73A573DDDE164ABE8 scrawforing
661,121,181 *442BB6BAFDE01F31B635C359875F30A9DB447AF2 ROBERTOVINEYARD
661,121,182 *442682DC3C23A72DCE44F9CD70C67951D18C1B36 roccohixson
661,121,183 *442FBB19D065F148242614996F674049E745AF4B rochae-terrell
661,121,184 *442E19F38C409E5294527E7B9DEB2CCE51036A7E ROCIOCHIRIBOGA
661,121,185 *4421FB294B2C751F81247C02FD9B7A2A283A6209 seyegib
661,121,186 *44251E7F4324119B0A33EA3646D13D57744E0D38 [email protected]
661,121,187 *4425FC0B201140DD33E7DCD575A11A89BF199EDF ROSCOEHESLER
661,121,188 *442FCECBA5230AEA6E5FFE339527DA2B5175BF4B sharon-mortensen
661,121,189 *442C0CB3408547BA003AAB31577CB4E32B16201B SHAY-GRIMES
661,121,190 *442E37D4677F0B7F46B97111EE7B4DC352458B90 shelbysturdnant
661,121,191 *44235192334308682F41BBCD0E8FB9FB8586CDCD [email protected]
661,121,192 *442C425141403AA3B66DF91294F88E7B3D00BBCD SHELTONSANDERSON
661,121,193 *442B36F7DE0D68F11E6072A9D2912BB17BE4CE0C ROYCENATALIA
661,121,194 *442A3B2A99EB831F3D960C6A8D470546488E80F0 RPMVWTAB
661,121,195 *44257C0F79971A5E8E9A9ED6E244ACA1DF373160 [email protected]
661,121,196 *442D1F29D0850449DA0A6212C6DF63C88A0DF728 shurdim1
661,121,197 *44255DC37B0E438837B26626D1E0478CE87F3995 SIARDNERPPASED
661,121,198 *44215812AFC546EC6FDC3F4D8742CF455D76D003 SIDNEYGYGER
661,121,199 *4429BB99AF11719375B2B50D0E2BB2EE69D27995 RUSSELL.MAZZARELLA
661,121,200 *442242414087A620AD2FA8C5D772373AAC9CA01D SILKWORMED7
661,121,201 *4429CC5FF44B2FEC781F1547565020AE6EC9BE42 RXVTBSW0
661,121,202 *4425EC025E52C95B8923DAB0338BBEC736071765 s4rcorh4m
661,121,203 *442B5C4F06A78FCDD457147B26FA0BF6B807665F SADZONE4
661,121,204 *442EB1B6D27631A668C78549547FC8D5A8070E41 snenereidolpxeni
661,121,205 *44286975CC3C1B09805940F64535311D097CDF7D SNOITAKRABME4
661,121,206 *44279EFE9CF45379B3A1E18ED11867481571272D SOCKENDELEN
661,121,207 *442C05B61D990AFF902FC24428E921FF1E5014E7 SODIGNE
661,121,208 *44219A244CAF8B1ED2C60F9BB41D2E41EC8765B2 SAQLAINRAZA
661,121,209 *44290CA4A3F8935687BB0417552698255C479B11 [email protected]
661,121,210 *442E77DE007D2C184E8E84F6F40FF0471265DA19 SCHAVEN?
661,121,211 *442DD4F00CFEB9C9E303464D1E11BE98D9B02625 SPAINDEXTER4
661,121,212 *442FE91DFDDA0537C69CCB23849C587BD5D7921E SCOTTIE.SALISBERRY
661,121,213 *442D044F619C2227D7695FA2A19FC862B30EA6F3 SPINARELLOS
661,121,214 *4428C3163CC66724FD85D12DFE1CD1A73463A37B SPITCHCO3
661,121,215 *4429323329B293DE6A074071B6325494A3F1EF6C splat~-~-d---8
661,121,216 *442B13CADC1B12B78635405EE9E9CD616341DF43 SRC=HTTP//ECXIMAGESAMAZONCOM/IMAGES/I/21CVWWABN7L_AA115_JPG
661,121,217 *442BA49F4076CF7D421A206521069CB9F9E57FE8 SRECUDNI2
661,121,218 *442DA08D9F990F5914686028FF9186AB16A71A22 SHADOWSCOMPUTE
661,121,219 *4420490BCF901C706C131A39988E7BF332A27EA6 SHANE.FELICIANO
661,121,220 *442CC3790C3CB31083BB67E54DF9DD055CE28F3A SHEENAMCMILLAN
661,121,221 *4423E498A9330A3C63116CF2514219FF6AB30EB9 shirleymarcinkiewicz
661,121,222 *44284FFE7CD06CD5EFB0F42960AE25B155C97439 SHORTYROBIN5
661,121,223 *44287463586228F6753A34E604500ABD20A3F47E STUARTREGA
661,121,224 *44297105D86B05C0C82E1B94F011090E93A75976 SHRIFTSLAPSMACKSORE7
661,121,225 *44294007742FC2375A43613FE41E807EDBAA6428 SHVBHYSHCHSHV
661,121,226 *4420A89201C257F4A7E61F42D91AB12AE0538777 submucoses
661,121,227 *442628EC0FE53EA043E48838EDF55727DB2F70A9 siedlungsterrasse
661,121,228 *442138584FBD7D8617E4A3EF293D245BDE1AB636 SUITZE
661,121,229 *4426ED0500FAF3FCF2FFAE13DFE7C03E018C3D24 sikikaws
661,121,230 *442CF770C2C90E042CE352EA1FD7B0F88065F838 sulleu
661,121,231 *44299917565C892EB42542FF9202A1A133BA5DCF SINKLARS
661,121,232 *4422562A8CA1B30DFC3A222FB9682332788CDBC1 SUPERSCRIPT160
661,121,233 *44284CEEB96289C641AF0B781A2F1F51E4E6BE1A szlogenek
661,121,234 *442A1D023241F0E74BB5B17DACF20D3213E54F37 tadlechuga
661,121,235 *44234804CCE702CE324966D5D33182711AF53641 SØLVKYSTEN
661,121,236 *442669F90A21984356D4406649DAA603335BEA01 TAKTLODOPPELS&DOUBLEJ
661,121,237 *442F625AA43ED8CD6C37BE9DCB8E83627352C051 TAMMYFERNANDEZ
661,121,238 *4420C6B370B4D913F746D94D559D090FEB237FA9 [email protected]
661,121,239 *44230F7E2C982E7389B65D4F5EB577DB3F463F90 SOYCUBA
661,121,240 *442E04F9037D7D7FCD547F004C0CA22322E2034D TENNISBLOWMED
661,121,241 *44245102CCA847E0D325B82821350F3F18C89E0B SPEACHLY?
661,121,242 *4427EE1B176A2AB24C4191534DAD177AFF214D05 TERMINALPRIN3
661,121,243 *442294A8F337A312B6F953F2A8CCB46963E022F2 SPECORELLA
661,121,244 *44249335A2BFFAAB488C43E8FA09A856B70262E9 SPERRABLE2
661,121,245 *442D5D6342E31F12C96E08DF9656360B15184E9A tetramera8
661,121,246 *442891A187E544619231D3BF39C4928699B2250B THADDEUSSELAN
661,121,247 *4422A33AEEAF3A4C8E83C8ADDA108D8A3703EDFE THAD.DONOHVE
661,121,248 *44276F4B787E91F99C2B7A9E4B6155D8EE9BED26 THANH.KAKANI
661,121,249 *44249417DAEDCD6C32E5530720E452A4A528CB80 THATCINDY11985
661,121,250 *4426153315D877EE6D8F69452354BD4ED59957B0 the.ambient.cookbook.ii
661,121,251 *442026F6342FE7C6146CA2DFB7139B2B21C9DAB6 SQLWIRE
661,121,252 *442E9D42447381057DD9321FA63E6C7209F3F4C3 stardust/themanwiththehorn(medley)
661,121,253 *4421924501E6098DE91F3D980E7799472B151F6F tigersinthetemple
661,121,254 *4421B1CC82A9365EAA437EEAD33B5AA0EC04C8EF TJTJTJ89
661,121,255 *442F03190464F6CC9A08A963645B3ABFD2FF1DCF TNERAPDI8
661,121,256 *442DB644CF8077A5067916DC200F21D7477EFC14 TOBYGENEY
661,121,257 *44220122CB4E44B27E9726F7BE8AFF1EDE2F57F4 TODDEHARO
661,121,258 *44243F42773A7AFF5BC3CE188646C7767B94EAF2 TODVANN
661,121,259 *4425139C7865D936059D578AE57176C857080C29 STORNIAMO
661,121,260 *4420A446328B6FD7B419A5189934723311F5240B STRINGQUARTETINDMAJOR,OP.64NO.5"THELARK":III.MENUET:ALLEGRETTO
661,121,261 *442E30D6862253E93DA53FC7B0271E48B47161BB STROKEYELLOW3
661,121,262 *442568588CFD765592849F5606467DD4027005FA styleandpattern
661,121,263 *442CCB6A8AE5BA96885DCC9A8279B7BB76895666 [email protected]
661,121,264 *442FECE9921DE98DC4872D5B39176FA6F08878CA [email protected]
661,121,265 *4425B98F456A06CC0BA4821151BFCF12AF7CA175 TRACHEIPHILUM2
661,121,266 *442983C51EF0C14B84DA01F67545994EB5D3B2FC tractorgolden
661,121,267 *4420AE71BFCAD46E0D1D1ECB457CEDBBA05703C9 [email protected]
661,121,268 *442A2D33BC26744A6495EFC7431EB710131CB14F „TRANSZENDENZGLAUBEN“
661,121,269 *44217173F9A7DF986BC74206AD24F7494E152A21 TRAVEUS-HILL
661,121,270 *44201669700A634916856FBC7973EAE7AE35EC6F SUPERREALISTS2
661,121,271 *442FD46E72D7A53F310C35CD77FAE21F76E4909E TRAVIS-SONNENBERG
661,121,272 *442177AA602FDD52C425EF936A4A7A371FB45CB3 TRBOUN123
661,121,273 *4422CF992BC36CEACC4BA64DDF1693013E04DAC4 trevore.quendell.walls
661,121,274 *4429672B167B511134B4342066BE15873480CA69 TRONARVINGERS6
661,121,275 *4428E19648A57BE19DAA794BA017C833B4218646 TSAKIRAKAKIS.GIORGOS
661,121,276 *442CD607D24DAF23975D47F98A8CBBE3DACEC5F0 SZÓTAGOLJÁK
661,121,277 *4421DB195E1B7777B4A2C561304E24A566C0F87A TACOBELLBUCK3
661,121,278 *4424CAEF35935F5557ED8A2D5BDC0354FF8C4444 TUCKER.RISNER
661,121,279 *442D85811172661353845136EEE3FA841C549C8B talk8224130102
661,121,280 *44224B224A65FE3E6BCBA64DF518E447E2969910 TALKBUTTRIO
661,121,281 *4423A6997BE4D4FD09304E1DD80A421ED9709734 TALKGARTOK
661,121,282 *442C9A10A3D92743F97BBFC83F3AF25A85F226E8 tv08e680cdxmx
661,121,283 *442341F24A9D451E093B12139B25642047ADA0EA TANGO INCOGNITO
661,121,284 *4427E1E94750897E5B3FB74C54B8777F05D04F36 tyrellishibashi
661,121,285 *442E86B6739BF617CA04891B90216A4C6C7FE7B6 TYREL W FERSTL
661,121,286 *442590BF01E9B63EED6405A443925F2C2DA5F759 TYRONENELLEM
661,121,287 *442D1ACC6CD2AFA2E968E53E4900C7054B833A14 TYWING
661,121,288 *442F7524D97CC19561D15B4C429D2F14E609F259 TATSTEN1
661,121,289 *44213A99C33BAD096F2FD97F47D60C05E685D71C [email protected]
661,121,290 *442C844EC64FBFA3F8C817F85BA47D249027EC16 tedschmier
661,121,291 *442A1AC469C034F8469B06FB9FB1FDC24A366DE2 teholla8
661,121,292 *442104F081447FD01C2219171838D24E828F2101 UITLOOFTS5
661,121,293 *4420B7A6D6A8EEE55D8D587241C6B66468828239 telekommunikasjonsselskapene
661,121,294 *4424180C8A7AD802D32D266B14ED0DEE0B3EE9CF tepatitilan
661,121,295 *442172DD7ED3E51F61481A893E6BE4896D22611F UNACCOUNTABLYA:
661,121,296 *4427E78EAA379C84381DC4D2FE87E4AAF30989B0 TERRYBOZO6
661,121,297 *4429E53FA406A6BB94F7C55ED2143513343A7B0F tesselering
661,121,298 *4425530EC0AF001CA19436E7DCF20707716ACE00 [email protected]
661,121,299 *44202B53EB51CC6DF0D65FEABE4AC991EACE5C53 thatdisco1999
661,121,300 *44294BD5202D5121FE7B72252718648573ADCE53 thatmadethewingssheflewwithal
661,121,301 *44290DA085A439AE6F89A6929C6C611F64C14DAE THATSOLOMON1995
661,121,302 *442CC27E98F7738B6477731FAFD4FA35C4B0778A [email protected]
661,121,303 *442D752892F7AC26D3C3A7C0C05C814B74A86EB4 the-fiddle-plays
661,121,304 *442EE70E213853C40F1DA6717FA9D060C979B548 vanceorsi
661,121,305 *4421176CA3700FB27AF708D4861398C7464A990C THEREALHOLY
661,121,306 *4422BA75BFB55509BFCA0973CB4E305B14E254D7 therm0pl4$t!c$
661,121,307 *442C1109A2B0456C09DCD21DD80F91CECC5521CF THE-ROYAL-COURT-OF-CHINA
661,121,308 *44229C92644574706687B99772730396567B518E THESCOTSMARCHE
661,121,309 *4425E0BAF1975598A6711C9DAA5C5CDFF9720735 The.Urethra.Chronicles.(disc.1)
661,121,310 *4420EA06986E137FA139A2CDE9E37C052D4BB784 vasanthapriyankannan
661,121,311 *4421C0227C226A076AB98A22D7FC12A3C61B7947 thongin9
661,121,312 *442F0D57A6742EC59E92B29112539FFBA0F6B33D THRYSSOCYPRIS-ORNITHOSTOMA
661,121,313 *4428BCA97B987710116D0437110885AA2ABB8AE8 [email protected]
661,121,314 *442DB18DD9F077ED46F5172D08A694B481E44B6A [email protected]
661,121,315 *442ECB11EE42473E6C951EE540F85E317CF6C196 TIMMY.LENZI
661,121,316 *442746DFEA820D09ECF6A39B10353548A099C76F TINCELLERAITSING
661,121,317 *442925F311CC39ED0BC0B121BFF4C0AB93D7C98F VERICORE0162
661,121,318 *442C597DA116C58E6B168E226880F44FFBB794A6 V/G
661,121,319 *4422030AF1E446CB815A12E7DB922FBC91B865F7 [email protected]
661,121,320 *44268D7E10EAA52A7A3851644E169EA1FC45DA4D vickiesidesledlow
661,121,321 *442227D058E4A1AA178DE9D13A9A2DA1D19C1D0A victorious-dub
661,121,322 *442D2D404AACF35F84A6A48F99B061B195F87612 Tonight.Is.Not.It
661,121,323 *442FCF1DCEE7B65B515E54E6F21B6D01309153CE vincecomeau
661,121,324 *44298ACA4A08BC4ABE3EB5015242B9DDCE78FB59 VLOEIBOEK
661,121,325 *442034C2C3AF3E765B897918FD21EF03035CDE3E [email protected]
661,121,326 *4425039E32DFDFEBCFCE5CF344C555105B20F527 [email protected]
661,121,327 *442AC734A265477E49C19E06F55F9A7F0E1A7972 TRAUMATOLOGIED
661,121,328 *44263D9C03B549C521434760AD37940DD7426AA5 wallis&futuna
661,121,329 *442778DE280A3788170F168FEAFDDAAD83A6797D TRIBUTEENCOMPASSED
661,121,330 *442CFF18764F6833151AE011949A43C99F23CB1B wanda.baublitz
661,121,331 *442EFAC65DDAB19273982A28CFCB59F816CD2B3A TRISTANUNDISOLDE,ACTIII:ODIESESONNE
661,121,332 *442939E223AB3F8979877CC054436A564084444B washington-post,-august-18,-1998,-at-a5-(emphasis-added).
661,121,333 *44298340ABD12CF49886DD9DC2C664EA2170D5AB TROY.KLUN
661,121,334 *442E4483F6E0D38618B9E3B61C7366566D808A4C wcqtkgsk74
661,121,335 *442D4BCEE5BB0ADAF1257D3F5968DF873D26EA38 tsuwamonodomo
661,121,336 *4428F5988EC048F42DFF19FC0068BF15180BDBD5 wesleyohmit
661,121,337 *442F6EBF13383B75D2B26C586CA893226261DFC2 wesync
661,121,338 *442A733B6E355EB27AC8CCD45FB1009A90955AD3 WHO-GIVES-A-F**K
661,121,339 *4429B72B3AB6B871EA65C00A158B64CF3F2F933A WIKIPEDIA.BADTITLE
661,121,340 *4423B29CF13814065703EA20708DCCE7901AC013 TYDELLISYYTE5
661,121,341 *44270965C89D52E8D136087A70D93352F7F729BE TYLEROSIKA
661,121,342 *44256E1D417E3A7C1F634465846DF406A7B74EFE wilfrey
661,121,343 *4429BD6AC8EE6F52BFE2EF76C2777792B8FD4B23 woodrowreauish
661,121,344 *4421D6C057CA0B8A9C0471311EFD583C70414075 WQNWHG446Q4S
661,121,345 *442DB7339FF3C5A2740732D4C85D7BC37F194527 ULRIKMERSTRAND
661,121,346 *442ED7F393C451DAC2EFD6D66A8D8E7ABE52AB8E ULUSALCILIGIN
661,121,347 *44266B87FB7D7BB6981B41824CEF1353FA03EB30 [email protected]
661,121,348 *4421DF32F7D3AC75B8C753901D4140B2E7AD80BC UNBELLIGEREN+
661,121,349 *442AB596C483A13FD747C205E3991B736C16F22D unbendunbend
661,121,350 *442BD9B77AC3FA20365DC476E06602064A64E5B9 WWWFLAXLIONCOM
661,121,351 *442501E55A09E712F72487DBA7FA8CA1919C811B unity-temple
661,121,352 *442A1E79C1F041BDD867BDBB6577E07F16162011 [email protected]
661,121,353 *44202868E1B91C94860444290B2F2E8377E4E94A [email protected]
661,121,354 *442C41E938546CAD9D91CAB23DC128EA9D5CD714 UNLEXICOGRAPHICALLIES9
661,121,355 *442F5989EC552D98B17F5AD9DEECC483F2A0F38E UNRISKY2
661,121,356 *442C5460820F8BEBE008163F7DEFAA1308855583 UNTENDED.STORIES
661,121,357 *4429B3391F9C55D0B44B197A0380F7119DDE69D8 )x(.o~.o~.d#####3
661,121,358 *442BC5EEC1A341624B13AB90E8D83DE848758E67 urozench2
661,121,359 *4422DA062138AA1778491EAC8D32E8AED07ECBB6 USENETNEWSGROUPS7
661,121,360 *442C1A1E44C5FA0476E949C1D1181B839F4B7BE4 [email protected]
661,121,361 *44224B39074BD3AFCBC49E5FFBDBA16092224D7B [email protected]
661,121,362 *442C79BAA1D61EE80CE6329D8F50062BE21F4C9F Y04000
661,121,363 *442A9FB5B93BBDEADD55758BD82334B97E82EC97 [email protected]
661,121,364 *442589D58AD9881B7E37E827436B291C7003DDE3 yaminimahendran
661,121,365 *442721CFB3D60746B033A42B5EDA837C195EC094 YARIEL TURCIOS RODRIGUEZ ORELLANA MONTANEZ
661,121,366 *442F5E0FB5EC025366612186EF5A6EA876107A63 V3N3RINT
661,121,367 *442C54660C13AF036289843EE499FB8B9E7B82DC [email protected]
661,121,368 *4429B82D24FB32318F868204609E97981FD4E5B3 YIZONG.SANCHEEZE
661,121,369 *4424D476A70EDF076EF2A696C8A384035B14F527 YLABELXX0
661,121,370 *44262A4EA10FE2AC05F24CE9097BCD443F7E2E9D [email protected]
661,121,371 *44248414CA1011E99D828410045E8A93022F2A8A YNGNKXVB
661,121,372 *442A0D7D665F0B150CB70C0EC515E7CB8373D131 YOLANDA.BAUER
661,121,373 *442A29AFE330427BD0D86A7CA233CD3D80C08794 yolandy.van.rensburg.els
661,121,374 *44281296117DA9B8A6B372421BB772ABB8384F5E YORKSHIRESIDEBARY
661,121,375 *442092D7A69B05EB6B107F9CD021E0FBE6B5200A [email protected]
661,121,376 *442F45819154A0B9E40ED88F85D832EEC090DA2D YOU WILL BE FREE
661,121,377 *442FE9B10E95C0CF38829E3BF8840802712D3CA1 v](baa
661,121,378 *4425A6769DB5168EE077059C2ED736EEEDECAA14 [email protected]
661,121,379 *4420AB1518C9337155D4EE981F8C80378F88CA5A ZACHARYMCGILLIVARY
661,121,380 *44272F58271BE6011C1A49B9F3E404C7B8DC39CA VERDES TRIGAIS EM FLOR
661,121,381 *442C6E3D9BE3EFAFD445521A7F26EFC4DF4D8DC4 ZACKARYESSIG
661,121,382 *44252B77C67F50370DCD16196C3B72BBFCC4064E ZACKARY.SPARACIO
661,121,383 *4422E245C398114D93851EF71A6FC57DA9CB662E vermonter4
661,121,384 *44286BCD519A3D543A83E8FA838A1560222D7E95 VHS%
661,121,385 *442DCCD7C17B44C0E80CB599C63BB7A7DEA88ED3 ZHAOZHUYUN
661,121,386 *44294764122178FDFC4B5B3B85DAE34096E08D4D [email protected]
661,121,387 *442C866D5E81498CF7204B15BBBEF3978B878F0C vickymehotra
661,121,388 *44221C1E82F497C97AF8EE77DC685894555BDF6B [email protected]
661,121,389 *44286DBC6C6035DBAF6E7C61CAEC928CE6EDB718 VIJAY AKWAL
661,121,390 *44215E86D39B523DFA45DB413A9CB2D210A92F8F ZOETELIEVESING
661,121,391 *442FE9141C739C225BF965D31D2C32DE7E0C5158 VINEESH C BABU
661,121,392 *4420DDDDD2812C3F0471EC00083EB6DE11039AB8 zuriatee.rashid
661,121,393 *4424120F79E47CAE6459D75631F03EE06A49D267 ZVEE123
661,121,394 *44295D072C9D837EAD54C72F2E89D0663A81B3C5 ZXCVBFUBARING
661,121,395 *442C7021AC8541D5C031236562BF1DD60D3636ED [email protected]
661,121,396 *442D4701005C03D13EEDB3ED11C85BAAD9C27535 VISWANATHMOPARTHI
661,121,397 *4426BBA3BEA671C9FD038C19115280EB7345D000 VONNA-LEWIS-STEELE
661,121,398 *4424C6249D551DCA30872106D594E30D956A46C1 VXSV509RMNDYL3G
661,121,399 *442AA3D6AEB4F5FB58A311E69783AC1A01555C14 ібікуї́
661,121,400 *44216E41671EBCE433DF0D8BB562AA400931C15C КСИЛОБИОНТЫ
661,121,401 *442A38E0924E26CA4068E5736BCBBADDB58B123C WALT.MAY
661,121,402 *442866F572673A08FB1A43781392DDE396CD634A ПОЗАСИЛВАХ
661,121,403 *442953F5FA07B921F3A543E555DCE0F098271951 ПРЕГОВАРАНИХ
661,121,404 *44200E18BE04D5F396EA5F3A0342C732732B6279 wanneita
661,121,405 *442787A273063BB38D50007D310286597998EC07 WEASELFLYERS6
661,121,406 *442F89A43181EFE9F2ABD6686652AA453D9670B6 WEDERFORD
661,121,407 *442DA4D6653E384A7C882BDE3C78633274ECEEBA  плеске
661,121,408 *44247880664E2B54A1A411787A9E9FEA9B4093D8 WHITISHN
661,121,409 *4421B356DDF410557DFDA4D6474479A41E76F4C2 WILLAMALBERTWEEMS
661,121,410 *442A6B7462DD524B91831E8EBB5716633262F69D WILLIAMBILLMCFARLAND
661,121,411 *442E1C024D96E789B22923D840ABC9D50406EEA0 WILLIAM-KANCHOK
661,121,412 *4429913C6EE42500B86393B87CD6D55D2F0FCB9E williesteward
661,121,413 *4423F17C078F93559CB77D2B53F1EFCDD3A40BD6 WILSON.GLIMPSE
661,121,414 *442B6CA1D5981BA23CF1D3C957D58E5361916D38 winner-(i'm-a)
661,121,415 *442A1436F4BCA48C89AC51C2A58162FF72998D90 wjroe
661,121,416 *44252F0EBB1268A93336E0F355D19E6573A2E66A wmf,
661,121,417 *44294BE60286A7CBEC2C55AC84CCD3C3B8801D3E WORKINGMEN'S
661,121,418 *44218C5FCDA81E62ACBA3BC417D3FF184E1F06DF [email protected]
661,121,419 *4425A42587E12FA3B7093FEACF89C7D86EFB0833 WWW.CHILDRENTODAY.ORG.UK
661,121,420 *442ABADD7EEF2F2278A3784E225325995320C169 WWW.OLDTIMERMESSE.AT
661,121,421 *4426BAAE0A0625A274A8AB624C70C9EBB880010A wwwpolicylinkorged
661,121,422 *442096B75B670C8BCE3757B89F2A92A1EDE98B50 WWW.SOUTHERNPASSAGES.COM
661,121,423 *442CDE6122D66C956DAD5E77F89834DFF4097DBE WWWTHEMODERNMIXOLOGISTCOM
661,121,424 *44275B0C441F04FF7BA1453B4349595C763C0066 wyatthoene
661,121,425 *442E9CE16671BFCCFA8521737EB91D9546255FD5 においては第70戦車大隊がDD戦車を使用した。4両のDD戦車がドイツ軍の砲撃によってLCTもろとも失われたが
661,121,426 *442561B1AF413F06138EF9C1A08504C31A0E98F6 XCREWVERTEMIL
661,121,427 *442C443FBDD755E0B01ABD8A3335B401C9797E0F XIAO.XIE.HUANG
661,121,428 *442A0349FF0216301B40294649FD224D62E44C7A xoza
661,121,429 *442C9296A836053DE4754B4E6BC3DC48664856AB Y3243434
661,121,430 *4420A5A2FA655F14CA13267DE61BEC390DBB2C53 ydeerlubbing
661,121,431 *4426B9C9A81D4FB469E9599B3CCE75FC00770154 yn–87
661,121,432 *442D50FC91E8C8210BE0880ED50BF43F41BF29A6 yongsprafka
661,121,433 *442C7B324D6448AB451182EF7BFE39D3CA37CC9F yositachumsukarn
661,121,434 *442DBF4198FCCA2417572AAA82AA1B681E79D78B (>_0) ~` @Q
661,121,435 *44268246DF07B53E2B0F2B484D3A8154D4966AAC yourstruly.pris
661,121,436 *442FC417F4CE6135F21A50B94E0893CEBC00E4F1 [email protected]
661,121,437 *442C5CBAF78C303A0C7B641806FF5C1CAB75A74A YTLAROYAMNEDRAW
661,121,438 *442609043764B149551291BE278ADC3B9B5C92B7 [email protected]
661,121,439 *442EF771B8C0E5397AEC10F13FFE06ACF981E061 yvettevillar
661,121,440 *442DB10F6CA6AD6CEE4AA48DE37759A380F4DA74 Z500000
661,121,441 *44248AE44C6F15F05BBCB97600921BEDAD45B960 129.laf
661,121,442 *442DAFC5AAACD3FC17EBB9DEBE60594E09607054 1321468 arkisto-kuvat-karhulis
661,121,443 *44238EB18B565F3CED55AFAD9431CD59A50E4924 ZANEASMA
661,121,444 *4424AEAE250D648961E642AB895243A1A28C0597 ZARA.HENSELL
661,121,445 *442B3C84C4EABB9EABBC7392D2D1255A51AAD6D3 ZBDZXSOMED
661,121,446 *4422835655D682C51359E18E23004C6D345C5537 18.03.1871
661,121,447 *442A0287FE721B2F07AA34296BA022E123360091 zivilkl
661,121,448 *442909369E32DCF73A136F1F7A22A92489AE0CC0 ZQJYVQ
661,121,449 *442CF5E05AC91F28088D1B614844E8A586D276DF ZWEEFBRUGS0
661,121,450 *442AD78092135A00698771B5C9FA4771756C1177 ГАРГРОТОМ
661,121,451 *44294C9DC4919231D2FF923293BF18EC2172801E кокшинская
661,121,452 *442CAF80371B2F557ABF8DADF13AF86A1B4C4DC5 ОДУМАШ
661,121,453 *442E7F9550370B0FAFC5B545D7646BAAA1D41717 1-blankoabstimmungstermin
661,121,454 *44225ADABE723C361F07E834325430E4EBB4CCBD 1 CDSOITTIMELLAKIN
661,121,455 *442AC502F8E254E48AAD87AA65DC77B94C5B1DE6 1duskunluklerim
661,121,456 *44211A619319FAEB8303973932278C7454214DB8 «ПИЛЯВОЮ»
661,121,457 *442BD44AE473E72ACC3B3D41DC4EDC9F23BF1224 1.etsiv
661,121,458 *442A269F14E9B5B310A3239F044975187C7D8337 1gefuehlsgehemmt
661,121,459 *442F2899F121BF1C4D7694035172665635CE990D стыдливое
661,121,460 *442C4A4363B9F2983058AFC626E92502AAEE2236 1.PILOTENSTREIKES
661,121,461 *44260E41700BA0D669A03CB9DDE84C658226032E 1-suvaitsevaisuuskampanjan
661,121,462 *442E2AA72EBBEA4A15EB6CE332247994E7B955B2 1.truthahnsandwiches
661,121,463 *442D18CC68D990CB6DC39738C8A7F0A00BCA6054 2104475 TIESIMME.OLEVAMME.OIKEASSA.PAIKASSA..
661,121,464 *44284B59073AD74158890FA526FA9E2BB7A91054 2392851 TRAVELCOMPANYSEA-SUNCALLEDINRECEIVERSYESTERDAY.
661,121,465 *4427A084BDE3BB461FAC8046FD494C111F15DB0D 2736612 EBAEIOLEANTANUTOHJEITASWAPEISTAEIV
661,121,466 *442E3872C84052C8741E22FF293CEDD88C7E80FC 2916428 siirtoasiakirjataisenj
661,121,467 *4428F93F57D0CAC34D8B182DB6935F21ED1C3F56 2ANWAHLS
661,121,468 *44252ECAE9FEC6C89FF4C266E2E31E16AFA626DC 2BUNDLICH
661,121,469 *44268683285DB9BBB95C7A2A6FBD17EA68E118F7 2 COLORADOTENNESSEE
661,121,470 *442BFE5421F39097B5AEB5322981AE4A72AF6437 2-DAMSTILI
661,121,471 *442B63E8F232AFF7684A12219952F1AC931B6964 2FLINTEDS
661,121,472 *44268B247EB8D47C28D7D63F172B61948D494BA6 2.fuebereich
661,121,473 *442B8352E6A83C66B8CAAAD82535429A3A71C43B 2HUUHTOMISEEN
661,121,474 *4423C5E5B36E9A0BAFD75283EBD4E848870F2CD8 2IAMCRUISE2
661,121,475 *4429E9ECBC09CDCA0D3DF456CF9608068C51DF1E 2THESHELBY9
661,121,476 *442B788DFB30CC7C3C6490B896A28B6B1D7BA6F9 3===>~0uu
661,121,477 *44283F08DF85331A3759C92D24128DE959BA2C74 3DRSCCDP
661,121,478 *442943A7DB01090806FAE8602AFF2EAFEF09F19A 3FBSTRLEN
661,121,479 *4429CC4863AA4803728A1E6F034951A36E08BD66 3fxx0n
661,121,480 *442606C4FA3D3D117775FFC0A830C37FE4557598 3NHPIKRK
661,121,481 *442B8AB4BDD043026E636F8564DC4B5157989512 3####p*splat!
661,121,482 *44256A59D165584CFA2F2EF9AD1C4059338E8393 3---->*Splat
661,121,483 *442A0134E996AEAE9736516353B08C5A1E75D9D3 3theredcloud0
661,121,484 *4423B05B538C77BC4D24531A820799AECE66F7CA 469403 DER.LERNERFOLG.WAERE.GARANTIERT..
661,121,485 *442707EB47F2A44748FB2BBA8F98A848356B7B6A 49176 odakahvalti iki kisilik 15 sterlindir
661,121,486 *44227A15FD7CC33DACA0998E0915E0AB49147E06 49kel628h17l
661,121,487 *44274B0C79A072D1C062624D8028DC88338B67AD 4ARTILLIER
661,121,488 *44292BBC5A45A5ED414327555F2884581F9EFD29 4ARTISTEN
661,121,489 *442D4378E54523CA8B98EBCDACD22A0400D8508D 4bumaree
661,121,490 *442AC7DCC28AEDA7CA20EE31E69606405EB8DBFD 1140782 KESKUSTELUT-OVAT-AINA-LUOTTAMUKSELLISIA-
661,121,491 *442149635C97546002E48991001D5F8D73E009D4 1216026 pahimmassatapauksessat
661,121,492 *442ED1315C27957A669165FD85F5A1B3B5E6698B 1277392 olethanjokyllinvanha
661,121,493 *442EF7AC4C95A017FBBDF6732724FCBDECB88C05 1286399 ohjelman tarkoitus on olla ty
661,121,494 *442E6751C52AFF7EFE380F0D73CB2397823066F6 4JAGUARBRANDON
661,121,495 *442998B1C9F2A88029167C593E2E40E4F2233ED2 1313335 jaksot 4 6 tullaan toteuttamaan alan yrityksiss
661,121,496 *442DF354A13DC020637FE2D2F253BB61B08406AF 4KAELTEMISCHUN
661,121,497 *442CC0714165BECDF69F7565E36110F71BFCCE4E 4KOOPZIEKST
661,121,498 *442F0AF76722598AF04C2E2174E3EB6FCA8D033B 13:.PRiNT.(&QUOT;THE.TOTAL.NUMBER.OF.WORDS.iS.$TOTAL\N&QUOT;);
661,121,499 *442471617A4955943BA93A182C2410E9B483D332 14030 dieseswunderwerkwardieenzyklopaedie
661,121,500 *442425148E75BBD4CC84DFB9A027948DD9B91487 4MUHAMMEDANSK
661,121,501 *4424959DD6BD89DD2655BB33F1AC1A31091DF80D 1727463 siekuendigtenweitereanschlaegegegenisraelisan
661,121,502 *44270922B04E1B02E3C791540C846C877910B729 4REGENNEMSNITSALDER
661,121,503 *442C599760349D8E55B5529AB6F6E3BE9BA69B86 514686 SIEDENKENSOGARRADIKALER,JASCHAERFERALSER.
661,121,504 *4423FBBF7B95C9EAB63EEDD178B1195152585750 515824 vapaa-aikanani luen monenlaista kirjallisuutta
661,121,505 *4427A311ABE0A7695A4EF10367EDD616C2985C0F 1BEF861AEEA4957AFEDF87DAD0EF8D8E-OSCARMILTON
661,121,506 *442083247F7D2FCA557ADC5C0D83523F98B82AAC 1.cast-hopkins
661,121,507 *442A4B45A10661C790D01D47CF2E7EFAC11D74E1 1Cizecekti
661,121,508 *442BD4844447FDACCF2C2CC80D30392BBA20501D 1 croatianlanguage
661,121,509 *44227A7A928FBF43DA49452F82E964A7A1DCCBA3 1DIPTERAD
661,121,510 *4429993E95ACE12A28939DD78690212CC16D7FF3 1HEIDSCHNUCKENBRATEN
661,121,511 *442A8169BA48E28F363B4E75F661BEE0442F7E50 1HI4P9HBYG3JLVG5XXQIBB
661,121,512 *442D89CAD7D048169C6FF510357701EDCA188E00 1KAAVAILEMME
661,121,513 *4420B952856BD6D6E06A27E9E495AA7A72C942C3 1kreuzungs-bauten
661,121,514 *4426BB5EDA13E62E51421FEC1DE8CC11B15789AC 5-STRANDE
661,121,515 *4428805A6BF59E9C7EA93D533542EC59C57D3FCC 5TRACYALEXANDR
661,121,516 *442E291608467A954998854A01DDEDFB45D6B80C 5VERFLIXTESTER
661,121,517 *442104A3E4BFA94223E399DC14441170872B7DA9 1lemarchand1
661,121,518 *442725928F647F89DF36272F9425D00820B40FB9 1 LOMATARJONTA
661,121,519 *442B8F444EEC2C84F3D1BBCE98F8AD67608B5A9F 666BRAYLEN
661,121,520 *442821C19D7600FB7FFDD89EA3A7FDB140EA576C 697677 sen.matti.uimonen.osti.takaisin.itselleen..
661,121,521 *44263EC1BB1027654AE6B41CE6990833D0CF2173 6ARRIVINGS
661,121,522 *442EBADC029394FFFF2D6456BF72334C7A1ADE62 1.rock-starojen
661,121,523 *442E3249A60DB60BB5134568CB87901B4EC74CC7 6DATABASEYOMAMA
661,121,524 *442162D155F1B3CED5AD26A72C30FC4EE5A2121B 6FLAMINGOBRANDY
661,121,525 *442B998DFE98521A92FEAAC8DE0D936226F465B7 1TEHD
661,121,526 *4425C646A4BFDAB48D847250832EB550F951E456 1-valvomoliitynn
661,121,527 *44228018501052F2C88A5DC953CC9D485C0FA0F0 1weizsaecker-gutachter
661,121,528 *4427AF77240B7EE9FF036250C6D1E37ACB4D7C47 1-WoSSeR
661,121,529 *442519FD549C88EC5C1F6D92F052C3B1006B4CF8 1.XMARCUS
661,121,530 *4429D763166AACDE67E3F996E24C9C0D327A5465 20090630K0000E040010000C
661,121,531 *44244E3AEEDA3ECE7270D2FB5F0B8BBB3609F9AC 2097729 suomalaisen-tiedeakatemian-kanssa-tiedeseuralla-on-hyv
661,121,532 *4422343EC073FCD83EB5087E50C15034B24D2465 20FENOGLIO
661,121,533 *4422C060D3D007A1C300F82BD5B27B90081BD747 6SHELLYDARWIN
661,121,534 *442DF9ABAB04A156471F1977D894FDDBC2FA2520 [email protected]
661,121,535 *442C2F6204678AE9EFA8BE95D91571A6B65A9A95 6.tasannut
661,121,536 *4421C8F044D9BBBEAC558775387BAB4B108F4EAD 2: 2 # & unlikeliness
661,121,537 *4429ABA5F00363BCC1A23A729000A430D32BBDFC 762562 VAIN L
661,121,538 *442EE49FD7ECF5268FE386DEF97D97AE67656578 2594467 SE-ON-VIESTINT
661,121,539 *4429DE6B809F6EE9F85ECB3DF8F8562B60353F5D 29101027
661,121,540 *442485EE84A4F9D933993699D0D197B99E6C1B63 7HANSCOME
661,121,541 *4420E1C21C3202DDABA6737ED23B343F8BCB0BB1 2BOPPORTUNITY
661,121,542 *4423D6BD0BB0C9D7E0F8B61558310A7E021FE58C 2GREYSTAFF
661,121,543 *44286C791067B8732766A7AB126C35C3E3082921 2HOTELBESITZER
661,121,544 *4427C090530738264B908A6AF1CD7D5B00A83AD7 7OVERFULLNESSES
661,121,545 *442B310BB1F863C11B74F47AED12FCCAA60A86BF 7SELITTVSTI
661,121,546 *44230469221AF526388B81A3706307404D324400 7SESINIME
661,121,547 *442A2513C39164B5A6296CAC9F081DB40EA8978E 7SHITHEADABCDE
661,121,548 *442A7A66C2C008D23BE3D522EC0C3B92C768B176 2 US-PAERCHEN
661,121,549 *442256A5166E0CE1B365B5249C1931118825EFEF 7WINDOZENT
661,121,550 *4426874A9DF2A81C530D28401DE5E43BCB6E2AF8 399670 BUNUNADINAYALANSOYLEYEREKOYAVCILIGIYAPMAKDENIR
661,121,551 *442E004B25F4A95D631A0A6ED5C3751339B1147C 3--B-~o(>_0)
661,121,552 *4424AB2C76F7FEFEA47D886E1FF9FE0719B01C32 3CAPILDEO
661,121,553 *44210716E53AE2465A4ED006F08AF38D5C705DB3 3ETHALDEHYDE
661,121,554 *44260659F050C52FA427B1C4AC1CED8238AC0147 3 KONTINIUIERLICHEN
661,121,555 *442673A0887B65885EA270087B82C2C8E99BC1E4 [email protected]
661,121,556 *442755FF200EB576C8A1960874BEC4643DFCE1C3 3======>~O}O{
661,121,557 *44258059A8BAE8A776E56424F9ED39AC157BE151 3-pyramidiin
661,121,558 *442EC53A1E69A8DA3CAA3AE7323DE80F0DA36206 3READDICTS
661,121,559 *442F91690E1E17018C34E73C55789C5F39BAEBEF 881538 THAT.TOO.HAS.ITS.ORIGIN.IN.SPORTS..
661,121,560 *442BDF9213B27ABAE2735D53AAD2AF9912B25BE3 8AMAIOCHI
661,121,561 *442D4A2B2F385D551C18105AF024AAFF33F84FC2 3THERITA7
661,121,562 *44255D888A26596D6A26936A1BBDA726FB3B731C 3#####)~~~)x(
661,121,563 *4429F72387C4CF0ECCFAFBE612520C725C41F8AD 46 ANTI-REJECTION
661,121,564 *442498725392E59A58E275C20DFBCC67A8210D36 494529 samalla-he-ruuhkauttavat-takana-tulevan-liikenteen-.
661,121,565 *44267E010D90F7ED7A2D9751F88B11ACB5949CD4 8CAPBXLRKIUV
661,121,566 *4420200E645B5AB8D2F19111FC96929D1FC04A8B 8CIKAGAKO
661,121,567 *4425EEE2B9C18B6D1819954603703C3A1AB48095 4CEBIEAZ
661,121,568 *4420AAEDA7DD9423B29B490AAF822048A0BF7D53 8------d***splat!
661,121,569 *44218A5C4E2CBA5AE491C18A2C7FA35836C4E036 4.muzun
661,121,570 *442AD60FB2D8248D387FF412B5D730F7E3A7295B 8NUNTIERIS
661,121,571 *442A5FD022AADA43E67E63B632AA1A2BC782C03E 4NICKELBIRD
661,121,572 *442086A74B84BAE400E6BE181D5E52FE6FB125F7 4PAOLIILOAP
661,121,573 *442684424A7393C9EEE563D0383FDA22E50FF82F 8PELIMANNIYHTYE
661,121,574 *442947AA4B4FB1CF46B2095C4741B548A36AF82F 8REFLUENTS
661,121,575 *442FC318A29FF8DAC149D1E70C7BE061CA4E5866 8SEJEROSEJERO
661,121,576 *442B1260493C1DE0E3B7123CD08C2B1ADF5F882B 4VOSKOTOPWN
661,121,577 *4427248B7290C57790FC615CCE380ABC450008A1 500909 sci , 9 ( 4 ) , 329-334 ( 1999 )
661,121,578 *442E6409CF16BA5A1DC251196EEC8054CD83E0C0 54MB0K
661,121,579 *4420A39AE5C8EDC6BB096198CDC92915453DF757 559473 es gibt keine zufaelle , alles im leben hat seinen sinn
661,121,580 *44233F99882878858FB89314A2627B8C1DC7F172 5:5#&anticyclone
661,121,581 *442B70CD34D729061998A9F093807EADD846D605 56p47lys
661,121,582 *442863ABAE7901A8C85155699B3D4C9C35048B13 9081626
661,121,583 *4423C51B2629D295B7E10D0B361A635D340A2DBA 5BEAUDRYS
661,121,584 *442B0AB1392AAE7CF5385D3B009AF4E5314AA917 5BLACKIECCCCCC
661,121,585 *442B0D2E591BF1E961664E291F0C52C3745E36EF 991319 em . liitteess
661,121,586 *44295F9B04970402548D8DC452A7301B4C178707 5BUCHERSCHRANKEN
661,121,587 *4421512EB8CEB87651D4DBB893C0082168A0684F 5-calisabilecektir
661,121,588 *4427AB0B4848B7204C57AFBB3883C5199C9CB130 5DIGGANDE
661,121,589 *44209A05E5C385AAF40A4D9DB5F11B097ACB0314 9KERATONY
661,121,590 *4426430BE206B6D93256A19FBA99D449FD66A770 9MCOFFIN
661,121,591 *4424FD101EDE694D5DD7E8BD8E98142FA86FDA25 9OATMEALAIRHEAD
661,121,592 *4423F1680A2E7A4152289485B7E034326AD9FECB 5iloveroadrunner
661,121,593 *4426C0D213BE69B21DD91CD615677E5CCDA5C349 9SKIEGH
661,121,594 *442B3944E65C33D5F818B8F3BA3282B5535522AE 9SKIPPYHEART
661,121,595 *4421F8D02721AD6E0D5F73892AA242E67B095EFD 5MADDOGNICK
661,121,596 *442E36C6533901A05F5A1475512E1F3B34069678 5MELANIETRUCKS
661,121,597 *4426C27FF0A05F2B57CAA18E07CC2ABBB3B7CCCD 9THATBIGAL9
661,121,598 *442B3C7CB13602394F436082196433C0E9E0D19B 9VANGILE
661,121,599 *442488D0BB873D6CF235F2335FE4498098F65207 5PPPSHIRLEY
661,121,600 *4423AED8C6B528F2C0DF8F06D8CAF9E0C1C03945 A7=L$
661,121,601 *4425B8ED438DF0C27C20B28C858E6ACA73246ECD 5VOLLEYDIRK
661,121,602 *44230761E8D23490E381ED3AA0C293B6AC4CD79B 66001ds
661,121,603 *442AABF90504BF8485D29BA3246C2FFA4D791EB6 6 EDUNVALVOJIA
661,121,604 *4429BE402EC5255C2209BF7DFEC43DA5771F0F34 6EFFUGERIM
661,121,605 *44298FBF9296B56A2396F81C7B8C6B676E6307B6 6ELLUTETS
661,121,606 *442A6691D2C72082518D50AD396AC12A212825EC [email protected]
661,121,607 *44224C3B77F928D97EDF1686715341287B6F8AAE 6NDRDCTD
661,121,608 *442F92D46260B6105F311468D3704804E15DF1E0 ABGEORDNETENEIGENSCHAFT
661,121,609 *442EE5824174B185C9F2A40FFFE2AEBC1E840355 6ROZHOVORECH
661,121,610 *44242216E3BEBF0A133BBB041E5E41047016E9BD 6SIERRATONY
661,121,611 *4429B55FCF153FDEB681E5AB9709546BB78C5E04 6STILLINGSBETEGNELSEN
661,121,612 *442A3A95B90628FEC2FBBA12744FD7E648AF1A84 ABRENIA7
661,121,613 *4425A467A823DB096D78B8FCD92BEBFADBB3970D ADP1
661,121,614 *442E9C0AA243630ACEB6FD29736CFC3D79D92720 adt$c
661,121,615 *442BE3EA5527949C024BA8ADBF7D0046F92CA442 7SAHAROVISTA
661,121,616 *4425B2066D19A03F34C372C9A71E32117875BEE0 7SAYADOV
661,121,617 *4423DF3B48F25C80135ABAC1F876B0EB3453E584 7SCHEMEMODENICKOOPNICK
661,121,618 *442B61E5E6133488438720545DAAEA4EA985B654 7SLRINGS
661,121,619 *442699E93DE5A34D3794A0B2342192E99F83C8F5 ak)/a
661,121,620 *442910A03B1EF3A93BFF5A888E173E793DD6CC91 7WAYNEDISNEY
661,121,621 *442E34CB18EBF7D4AC7D53B11F564889FE12262A [email protected]
661,121,622 *442468B25099217A18ABE0E7C76F9E6AD1362D1E ALBERTO.RUMMERFIELD
661,121,623 *44202FDE5C466CD75FF2EAF1BAC05A5170280295 832c7c
661,121,624 *4428602AA2BDC93868830DD047CEF5BCA1FF0ADD ALFREDO.ENAMA
661,121,625 *4420ED7E184425D221AE9F2E7F14EC8924988E9C 8BSWWSCUBBSW
661,121,626 *44242ECFE338C6F5AC2BA2E3D7DC187451DF803C ALIUWIN
661,121,627 *44213980002397390F6D8886510E683A9A17FDAD 8COOKIESLEONARD
661,121,628 *4421139838E3EF662BB258898F4FED02F4E6AD4A 8######D-~-`-)X(
661,121,629 *44225F3A34777AC062CDE22432638AF7D87CCC5E 8EU-BYROKRATIAN
661,121,630 *442808BFED3D973A7ABB519EB3D3636CD3102647 ALOTAUHNUTTIN(FEAT.187)
661,121,631 *44265D38E17ABF50AA32B8A82DAD8C2D44C39B14 AMANDEEPJINDAL
661,121,632 *442D6F8C02F0650B3DF29B4C8A9C7E1A6198918B 8NEWULEPD
661,121,633 *44210A34E80B2D0AB81A09834ED9FDEC742B131D 8o=a
661,121,634 *442B50929517A3ED75F4F2E766763AA47F091605 8PLEASESTEVER
661,121,635 *442BFE0666EA265DD012DACDF8746FAD525C3748 amy/_
661,121,636 *4425B13001DB286CDD5A4A96698846C36CDE8FAE 8STULAJTER
661,121,637 *442A0C851C51826DCF7E1C673407E91BA3B61BF8 an3jd
661,121,638 *442665DD2FCE2144772CBAC657B31BDF8A8F114C ANALITY
661,121,639 *442530FABE8F777AFE1D6409A887CAE09D52F4ED ANAVASARAM
661,121,640 *442996BA7D8C03E57C03C383865FF8790D3F145E ANDRESGIVAN
661,121,641 *442FE7D01F05B2F84920F5781C446D84938B9BB9 AND-SO-ESPOUSED-TO-DEATH,-WITH-BLOOD-HE-SEAL'D
661,121,642 *442D11F1EB4A74932E84F120350A88901CFB8DD7 [email protected]
661,121,643 *442246CF04AC76FA1BCAA225879EC7FDD28B8F69 9ALMSDEAL
661,121,644 *442AA4E70DC131830E21CDB5EA1D1193393850E6 angalich5
661,121,645 *442312066D2F99B7514070E97076A3C409D059E6 9BEARQUISLINGSOBVIRGINIA
661,121,646 *442BCE9991C1F4988D51974C1944F43A208A1246 9BSWAMORIENT
661,121,647 *44280A8877D3D0219122512EA307DA2F660B7CC9 9BSWGREBLEBSW
661,121,648 *44220A60A4912E97C8D00FF46C26F3F67C02DD17 ANM;W
661,121,649 *44225631245395025F766146B276FD352B13716B ANTONARDINGER
661,121,650 *4425817CFC034A13A23C174765265FA6C75A1E9C ANTONSHEASBY
661,121,651 *44275762B1BB8152289BB010E7BD340F58ABB354 an;uc
661,121,652 *44257292F8DB28F3ABD40DF09A080D8117A4CB2C 9MOCOOHAYNELLASA
661,121,653 *442AA7DB0EA53BAE66472E219B4453D5998D6531 9NOTABILIA
661,121,654 *442C91AB33A1E7909AD5B8867CA36B9926FC2820 APNU:
661,121,655 *4426F2D15BAB4C6870F84E6EF44C0FBD1C5EB319 9SAMMYATTILA
661,121,656 *442B5C148F9A4DE0A0CF696FFFCAAD07FE6386E5 APSK-
661,121,657 *4423F96D4917D941A28FC3B161535196EED350D0 9stoottand
661,121,658 *442834FD606F0C6A937A520A0D60C1065B0544BD aqhgu
661,121,659 *442E00BC752FAAE0F49030ADC6707E268C2E49A2 AR/C(
661,121,660 *4427E5AD5C4B4F8C644AC00F59798380F17ECB01 a1wa
661,121,661 *442824A103928A0AB5FFA12C24ECEDAB68B22712 A6DN
661,121,662 *442321604A7C4FA84FDBF26A11E1D292D33A29AA ARMOZAFORMATSCOMWWW
661,121,663 *44230637EF8A8900864AA785386E10820E6151C4 ARON919
661,121,664 *44280B23CFBA1E72DBE294FF7C99C8C78DE6E081 aab(8s
661,121,665 *4429103201539D5EAE399C76407CBDE7F666679C asnl
661,121,666 *442E041540F01A716373FC48F1F50982B54B711E astamed
661,121,667 *442D55D48F2CF9FDA511BB32E49FC33D2FED5BEE AAM3C
661,121,668 *442F88BF4321EE1B1F19123A93D6FEA11FD2917F AUGUST.MELIUS
661,121,669 *4420FB525C39C505B2849288731CF5E9245B4B2E a.uj4
661,121,670 *4420506052CA7B2CC838B9B4FD783B3C51BB6FCB AUO,)
661,121,671 *44295AF487EC15D76560CBC01E23B7D677C59B06 aut8
661,121,672 *4420D980B0ABB3776CB433C7FD88EBDC2AE337F8 ABWDD
661,121,673 *442CF96C36CE4218FF99CFEC32140BFD2FA3B339 acarinha2
661,121,674 *442441CE6578CBB7F09D60F89E994FEFED2B809F a whole manual devoted to security
661,121,675 *4426A0044C472E90C743C2B726C8DCA695388BBE [email protected]
661,121,676 *4423218393F54C5AD78C03AB598B918561AA02DC ADMEB
661,121,677 *442FA30EDBDA766144D5CFB4A9C36AD232595FFA ae967cb1c7f93a27965808233c87f94f
661,121,678 *44210D4642FE2704B7D959DC5F341429C1DCED5D ae"d)
661,121,679 *44286BBDB8DC1BFC4577864881EF479E7CB3C18B B1QEM
661,121,680 *442F166F2166F063FFBB0890FC01CEAA4357B1F6 [email protected]~~~)8(
661,121,681 *4424B3DF0AF7E2F99CDC6ECCC1BF1A14B95CB8EB B9!)O
661,121,682 *442FA2EF6C3B21C59A02C330E942AC24C74A9FC6 backwood
661,121,683 *4420811C49DDFE65DBBD5552BEF5AB9BD86F8ECE barshamashel
661,121,684 *442054EE065AD08334D101CAD674999C5BE0165D alb)
661,121,685 *442B03C0CB1495C0D061378651C16C955150E280 BE4SK
661,121,686 *4426754D5AA88045B8510C1F48EFE8E1FD466222 BELLE1225
661,121,687 *44200D31FE9FFD227B5C29B24B0E7DB4E71D69C0 ben.gardner's.boat
661,121,688 *442CF29A19BDE0ECDAAD2595015088D0974CD5D9 ALTSWALLEN
661,121,689 *442B937D9E973315854345FB9540771096ACB56A AMANDEEPJINDAL
661,121,690 *4427F9138AE4A45541BC9B1E4EF086CD86D96318 a,mi5
661,121,691 *44247592DDE0B99CC59CE61109DAC9651B907BB5 BEPUFF8
661,121,692 *442FE9D27FAD78EC51E6132DD2B6E952BBDC3200 BERNARDWAGNER
661,121,693 *442AA5560CBE7DDFD53B351E045B20DD730F01B1 ANDERDON
661,121,694 *442DBF8B1A0FEF9453E37D65D8E7E7B3FFEF8DAA BF3JD
661,121,695 *442A41AFF7EE9730F15DAF5F2AD683C253C9BD79 BFZYA
661,121,696 *442D4E6B0FB4023F6498C0818DDB0DDE2923FA3C ANIDOBUS
661,121,697 *44293AC3A53BABE748994DB5EE89D4E2A0D7B341 BIOTEAC
661,121,698 *442EB47BB3963ED71B1B94D735952871CF415A97 bjvnl
661,121,699 *442F19CB31FBD923E3534F9D56EF74B02C42FEA4 BLAKEAVIE
661,121,700 *44221645C4AD7E0ADE58B508839FF2767D21333C blanjatis
661,121,701 *442124602DD5BF78C9F0311B65BC2FB47D3E3CD2 BNMEN
661,121,702 *442A27053E38C8B9E3B3262F0AE4F2234E6314DE [email protected]
661,121,703 *4423266D79F3B754411F1797677E2766BD992178 BODY&SOUL:TROPICALOASIS
661,121,704 *4428AF0F71B56A05DF2206DCB07DB06247965E21 bo.lt
661,121,705 *4420493FB4CC6951BEDCE78F3990EE9791B7275A [email protected]~o}o{
661,121,706 *442476DFC9B3BF04542253E695F1221D9AC5D373 börsenbegriffslexikon
661,121,707 *442F579F4EF612464CE0CFC9C07FB18F41BA6735 ASHA-SUDHEESH
661,121,708 *442639B5D19FDC2766932C8BD959057DC7D00EAD asher595
661,121,709 *4421BDC30459A8A67597063032D140BEF08B7A7E atxlo
661,121,710 *442B4987C94FF9F2F8DC07BE8BE2908C232EF70D BRADLYABEDELAH
661,121,711 *442726A85FB2FAA023BC82C71D5D04E93187C8D4 AUDREYSKINNERGARNETTE
661,121,712 *442DFC0860EF247594A9CB051F45F9A0C2AA4DCE AUFFASST8
661,121,713 *44260EF35BA5F3B59C22D6E9CBE487E4C589FDBC AUSZULESEN!
661,121,714 *442E160C875C2CEA21A22014BDB683E1C3C153B9 brimont4
661,121,715 *44280B2BBEEC4624800055ED474D1C92A8C20A9E A.Violent.Elderly.Person
661,121,716 *442E2BC8DBE7B1280C36D7C720375442987862E2 AVW5C
661,121,717 *442301BA7E6B37E53433D8F30C92DCF122258F10 [email protected]
661,121,718 *4429B0908929B6DC659FBD3D8D51906D11639803 AZUROOTZ
661,121,719 *4423B1B4A994E1F5F23803CF516BB0A3CE49B0A9 azzary
661,121,720 *4425D96E18FD2F9C20B638FE8F846E83FEFC5CBC BUHJ
661,121,721 *44229C514D4650478A97C6484BF2927B2CA95B66 busterharell
661,121,722 *442CF1CFB2A278CE103A92ACF489C3E545A74083 BV!IQ
661,121,723 *4421AB599508C4C6FE4FF5237763E12966C6CDD4 >-B0~.`q######B
661,121,724 *44296CFD8461DB9FEF1169B91F2311C7D509B544 BY"HJ
661,121,725 *442AE81496E4209839FD20D5F52D70B370086226 b2ss2
661,121,726 *442E8CBBC2A91158C792631DA354E7B3ADB9FC22 C$,/
661,121,727 *442533F6991FF48E050A053272C32A50D8F5D576 BARRYGRONQUIST
661,121,728 *442509C7DA8700055AA28B4D4FCFDF71F80DE831 C#AD6
661,121,729 *4429A8EA569D7233FFC35B130A967BA298EC8078 bats
661,121,730 *44297E438D83EE4DC90305ADCF4676E431AC054D bcu=8
661,121,731 *4425008987AA6D5D3F9F5FB441ED6B2D90C64616 carltonrheingans
661,121,732 *442C70AC0F5740792A8B40C597D88779442DD045 BE4$+1!ER
661,121,733 *442CBF6D4B43F742251D61DFEECE50C938CF8308 BEBOERDE6
661,121,734 *4424D7B1F2644F8068822402FE6D4251C2564C7B BEEDTALK
661,121,735 *442E3B8EAD5874FD16E244400480C152FFD496CC beigobm
661,121,736 *4425A976CD194C20885292B1DD38ABFA6F01FFAD carystandback
661,121,737 *442521334472C26A1F924A8B667217DC9C9E2863 BENCHARTER
661,121,738 *442D582D6163F1DB8182D5AA210E794E713EA598 BG8O
661,121,739 *442F1854B47C76ADD52CBEE16E5CACBFD92D2DC2 bgol4
661,121,740 *442D70A583D74018FD4CADF92D36DEFC5305253A BIG-YELLOW-TAXI-(ACOUSTIC)
661,121,741 *4422745F7107230BCD5F944F12F17527676FDA2F BIMA1990
661,121,742 *4427FE65D457033D7E3A4D46A4ACD2A7F866D8EB CHALL3NG3FUL
661,121,743 *442A6C5CE5EB0A78AC3AC36675D9D392C9BB6F4D CHANCE.HINDES
661,121,744 *442E289E46611568449EE54D383D92840880C7BC BJFH
661,121,745 *442FF2B140F700F53F1C26BE061EBC433E251C16 BM6DC
661,121,746 *442B82402B4B10957F332956B1E88B9F6253D8B2 BMTAS
661,121,747 *442D1114A2857CBBFC13320E45A29440A13F6D26 bmy
661,121,748 *442D4D80C853FB9E835ED03F25B9A7A443425478 BNGL1
661,121,749 *4428375DF0FCD569A63659897B2AAF65BE945750 BODYONTHELINEWORDPRESSCOM
661,121,750 *4426C8ADAAB0A52A39309AD4E24B03EE27B6FCEA BO.GAMBERINI
661,121,751 *4428B13A628AF886999F04A00418D52A3EF2BECD BoIB
661,121,752 *4424EEE9D30277F114A8E78D643B836EEC9D6F1D bpbr_
661,121,753 *4429BC5120C402DA5E3E2C81C04C97159844B0A3 bpe-d
661,121,754 *4428C43B7184C74CE43D80CA9075FAA4CBA536C6 bragi
661,121,755 *4421218CD45F684698A4E989F01B555F30DC8E60 c+ld,
661,121,756 *442AE5C59DA2B569EF2FE34940896E005BCAE4A0 c:lfl
661,121,757 *4428BDE24ADE727B5328902FF8CEC02C362E84F0 [email protected]
661,121,758 *442B74AE593573874C38F5296419F538B7B4668B CLIFTON.KUCHENMEISTER
661,121,759 *4424061DCE9988017B515177079CE00A8202BF62 CLINT.PRIEGO
661,121,760 *442A6ACDC5A3EE2B14445F1C2105BB7287571498 BRIANNE-STARR
661,121,761 *442C0717459D6299083B32323A9C329C7A88428E BRIGIDBRODERICK
661,121,762 *44223DBC51F74107F501DC1E177006E863C89A16 brisbanegangshow
661,121,763 *442CE774DC7A0497442B1F8695A26486EFA13A2C co4l-l4be
661,121,764 *442522C5D8416484C668010FDB97FF2D2EDA4305 cognations3
661,121,765 *4428F45D80E40B6118756469891AB9D6D28B2833 COLDHEARTED(LIVEBLACKSESSION)
661,121,766 *4427DCC0B55893FE92386A5B4C2DBFCC65988C05 COLINROUTTE
661,121,767 *44246AA76A82174F6C8D1F5B87F8DF010C5FAC7E BSIVATHANU
661,121,768 *4423E381AFA4F4AFEC9D8C5164BD3FE486D9E274 coltonbodkins
661,121,769 *4424804F9B59065B2BF94FB668E36324E3E9D84D bswwordkbsw
661,121,770 *442F4F61FC4519940DCE38E9D9A07F6301746655 bte:3
661,121,771 *4423FDFAA22188ECB9105AC356C78A132BE669E0 BT:KV
661,121,772 *44232CE6670165BF86DCC71CA0791A12603FB6E6 butqz
661,121,773 *442ACC6A1C5CEBF376C532B31E24AC2CCB71CAE2 craigfang
661,121,774 *4425B05A9610A722A378604DEDDBEE63FD0CD0F8 c9=o&
661,121,775 *4422E58C6BFB662D7D98B5B029AAB86B1E187192 CALGTSOP4
661,121,776 *442A1485017A0031C480BED385CFAE70613D07A1 calvingreiser
661,121,777 *4425FAB752DD8886798DCC486B951AEA6E369B08 crn!d
661,121,778 *4422751A1685D026ADF02176FB7665A3CE53E0E0 CS=1
661,121,779 *4425D71602E8399C5FC937A7204B56316F1778FB carmelostarke
661,121,780 *44273F18C00CE9C5BFE806AD0C173781C7ACE841 CTANTIONO
661,121,781 *44278565F5FD158B76B95158A12C4D4FE31FDC8F carsondecatur
661,121,782 *4426AAB45D8884338DE767DB1920C5EE2C52BAE6 CT.W;
661,121,783 *4429D31265D42C23F8C7619E6E6F5540723BDABE [email protected]
661,121,784 *4421CD93F684913FECE40183B23C9BAFAC418DBC C.B8
661,121,785 *44272388D18B0AC95B23E354CD50C94E93DE7539 CXK?M
661,121,786 *4423EB050803FC22E8E609FE7D8EF58D26BA5FE4 c$ew
661,121,787 *442FA8FCD5977C316894115BDBA6AE2A704A9111 CG5CP
661,121,788 *44211CCA0CDDA6A3E276DA08D720618F9FFEDF21 DA42R
661,121,789 *4427999DDB0D52A92625E415CD8B43E8BDDB6052 dagdq
661,121,790 *442AF5D0E8AC08E6A17AF932446129C63A56C4E5 [email protected]
661,121,791 *44231621D98E934941D528A4EDEFFA83C3F11A17 DALLRAS6
661,121,792 *442642C04CC203FAC6E5489374C101F719A388BF Cheryl'sGoinHome
661,121,793 *442D1B7F1D829100D5501F102B64FB533559C1D5 [email protected]
661,121,794 *442C24B65CE9554FE5D6E49BBA692F35FB924FD6 DBOLS
661,121,795 *442BF89DB9C78DB337193CB0AE5A54382105BB94 dclbr
661,121,796 *44252D4D92F3E61F0D9198654DEE269C3A832837 c,l8
661,121,797 *4426083EE11232CBEBE2F93991418886857A518F deerbfling
661,121,798 *442876BB11CB3515FA458C6C65AFFAA8856D6752 clarkhosten
661,121,799 *442983AAA2BF86186253CCB9EA84B07C98C626EB CLAUDE.COMSTOCK
661,121,800 *4424E53444081040A6F27AEAB2F38563AB369FB6 DELBERT.BIPPUS
661,121,801 *44293BE31E0EAA05325E2FED938F88A231B7DC9C clebinho
661,121,802 *442F7B6C760A0C6C240AF140C2120CFD4F6DBA6A cliftoncamper
661,121,803 *442303CE1B391C52187F1BA94F418987E9BB6FD0 DENNIS.WEYHRAUCH
661,121,804 *4420CCC3D4FA65C70765360BD705DA7F97EE6F0F clubnoircoukwww
661,121,805 *4429A3D1EB86D83B17D8B7FB8F147A0F3D0CE13D CLVYA
661,121,806 *44250F1249B8E5764469FCB52CB3A988716BC65B [email protected]
661,121,807 *442343E332416504073F4314742DE41897053F53 cochite2
661,121,808 *442B1651A5C167F60B8E6B972EAE537003080A8C dh8#?
661,121,809 *4429F1159C98BFE9D37A5883DFCF5CE53972C6BB DH$P
661,121,810 *442477A7DC7972F2057CB10FAE9AE3696F0859CD COPYRIGHTGESICHTSPUNKTEN
661,121,811 *4428C919BA16A9B2FDB4EA902BBC9282FF203AC9 CORPSE.IN.THE.CORNER
661,121,812 *442759D725F44ABF4F659E9E666AC14D05183C20 dinelaris
661,121,813 *4426703F101001E03DD18DF7ADA29E7F3F0A2E51 DISCURETH4
661,121,814 *4422160BC119FDC6231951C0A57332FE54246E6B CPRC"
661,121,815 *442969015144A81B5F7A5ECE9020A0BDDDD5DB64 CPZJB
661,121,816 *44217BBF12B8DB704F958E370BD5CE52B0D3E3E9 dlpd8
661,121,817 *442A94A9D745F8BA13DBB691F7C010FD5117FA69 D_M5
661,121,818 *4427977E45B60DF679BDDBC033EB4939B781898D DMACKENNA
661,121,819 *4423291C5E5517BBF59D42ADCF0FD00F4B24C023 dn5q;
661,121,820 *4427453AD43C2F84B6804193B08E1BDD79AA8E5E CRYPTOBULBON
661,121,821 *4428B504F1F1D218C39FC774B291270DBE890676 do9iv
661,121,822 *442EEDAB64BF3D5EC8FE6D13506D72BEC9226EF0 css.2
661,121,823 *442650EE232D1D3A19357B27BE06DA99BA85F41D domingochamblee
661,121,824 *442D61EE799BA1559CD26C9CFD1A33A8C712D021 [email protected]
661,121,825 *4420D8C53CB8E99515EF58792D77E08A2D7D4461 cuo0=
661,121,826 *442FCA726927ABF3BDCF3EF67B55182080FC6B3C C-V-
661,121,827 *442D2D7FBDC5E3CB7748E29E2368E16DBB621C1A CVLW)
661,121,828 *442D4A95D4EEE6BCEAEFBFEF09E83CC3AD2B9B36 cwn9i
661,121,829 *442FAD32908BB899EC62AEDE99C0C43A73AAAC10 CWT8
661,121,830 *44227440E85AAFE414B96D503BC33C3A55591E66 (>_<)-~D===P
661,121,831 *4422E173BA92A95F1AA623F97072ED42264CEA53 DROGERIJO4
661,121,832 *442B45777CDFFD361556800BCA952EB097494A0F [email protected]
661,121,833 *4427B39C3F220ACC8B36EA531A29C2E0348B5FAC DS7(
661,121,834 *4425DC12B8B16130790E8343B45F8FD2FC0581D0 DSH;J
661,121,835 *442AD94EAAC8AFCC1F5220E698FE28EB321CF7E1 DAFFODIL.DAISY
661,121,836 *4420F18473F4A320473A714139D66105CA57E86C [email protected]
661,121,837 *442220FB5FBFB015585127099C49E208E5DD76B4 DAISANGA9
661,121,838 *4426289208B1879C5E735F67FAAC989BB87C0D65 DAISY OBRIEN
661,121,839 *4423671220E78CC5F5591CDC65294F3F4A6D2104 DAMIANMORDINO
661,121,840 *4421D3F922FA7F42C3ED85D78337FFD8015C052E DAMIEN.MELISH
661,121,841 *4421516ECBCE286DA2C1358F3F4A3C38FE108611 dw;y
661,121,842 *44210D38D01D24923D6EC0B7640179E079A83824 DANNY.PULIDO
661,121,843 *4425931209C2C0C8387AB92D2F6768A5498F7AEE earltiangco
661,121,844 *442DC50E08C360276E8953E40864DB440B5B7ACD EBP2A
661,121,845 *442CB5C7933D154DD108A2546B38951FEEB16EFE ECOUDRAS7
661,121,846 *44245A8FAC5188278A897BF75DE2D6D43BBF18DD ED2DM
661,121,847 *442B308820A8927094CF898FA375A85A7AE9FC26 EDITIONSÜBERSICHT
661,121,848 *442A24C910BA5170AA9AC3A35B8F9D4C427E6AA4 ee!8d
661,121,849 *442973F6E388C536CBFA1DB3B4B7DB687506FFC1 deifies
661,121,850 *44236E8CEA9812346AAF7775B789AD3A16082E59 DEMARCUS.KASTENDIECK
661,121,851 *44212E596BE434C4CA8E95B94C593634CD8AA0D5 DEMENTERINGS
661,121,852 *442B4F951C6A7B3170B1A70138ECA439B9528D4B ELBERT.BOSSERMAN
661,121,853 *442FECCCBF7B3B16005ADEB6168FFF101FD9DE38 DENISE.TARANGO
661,121,854 *442C55554367714533274B08DB47B6CAC85FF609 DENNY.IGO
661,121,855 *4428F3118F018BA70D01FDB0CC53092D5FDB5681 elfmans3
661,121,856 *442E909CD50EA413FC279000358711DD898BC213 DEUS+
661,121,857 *442E4EE7E0A336789A1DA792B537A46310F91CC7 devonbrownsberger
661,121,858 *4427CDC763E4EB4F9277EC0F678A1D7895BA0D0D EMMITTGERACE
661,121,859 *4421D059CA1D47958582B692982D9961CB73F9F8 EMMXB
661,121,860 *44295F80AFD210BB3F7C1FB95DBF19BDDA1D38AD D_F0
661,121,861 *442B9ABFAFA9A4AC49CE5ECFDE53D541701001E0 EPMX8
661,121,862 *4422C5B20CB72578D476AD7C4A2365CAADCF4BB3 eqe,l
661,121,863 *442BAC70625F4A779FE4EE277AF7508DC45B5587 [email protected]
661,121,864 *442DA749078F21F476524AA7D0468CDE5C99031E ESAHPSFU7
661,121,865 *442CEBFE5018B843758F6044ADD1B64DAF86BB1E dliaiented
661,121,866 *44282CFF7AA431739588F8E9326BEA6C8A0D3DC9 ESMERALDA966
661,121,867 *4425148931FE82B247A31CB1934B7317CC3382FE etshcalf9
661,121,868 *442959E87072B74496D89CA539F2C5756B861F71 [email protected]
661,121,869 *442D4ADC5BF87443B0B789520665A4D36B33C342 dolemite
661,121,870 *44288FDDEE5219BAD90B4313ABA09986DD16BFE6 donnellleith
661,121,871 *44285EC56181006D0E6D05FB3C84B40D573B1611 EXECEPTON4L
661,121,872 *442B09F9BE24A8CFAF852C9E0EA89EBFB8A39791 dougjames1
661,121,873 *4424178C25001C1106314F02A06BEEF5F12E5EBB d#ppd
661,121,874 *442CDCA8DF38D852564C688124287051509C3BF8 f10w3r!3r
661,121,875 *442C200A890D39C1ECB4C72704019830BAC161FD drzu-
661,121,876 *44248456A01AE454E85DC88D6B421C19C86DCF04 dt%j(
661,121,877 *44269FF4745B3B5F049B53773C54BE8353C7441A FELICITY-REID
661,121,878 *4424A983EB929395791DC09EDFC1E026A87A397E FELIPE.PILLA
661,121,879 *442811974A7313278706D1E638CD27C9F0B36B05 FELVORA
661,121,880 *4425EE65AA7F3056C7CD9264A3669A618DD6CE88 du<z
661,121,881 *44243B9B96BA7F8CD68E2EDA1B5C33690FF1D587 FICA MAL COM DEUS
661,121,882 *442A0126F9FA946AFAD5F2FAF9666EED3EAD0C05 dwn?(
661,121,883 *442BF5D8E130EAC189653C88F3C535E4B24FC66B ec7tp
661,121,884 *4428E98B0C8FA6E8DF0BBC8614BD919808EE5796 FLAMBOYONS
661,121,885 *442D4ABFF183009B0423AD0D63C60A4DFA6C8E80 flankerar0
661,121,886 *4422D3A809A34DCA0BA22C9CEC4B7B2247B51457 flaxes
661,121,887 *442BB37364AB45C3E5104BAF8F5C3F3DB4BBC8A8 FLETCHER64
661,121,888 *442EAC16CC3902F9255A730AEB8D095B95B2B790 FORTFIED
661,121,889 *4424E9241220161AE170ADD52C1EBE6BFE84CC83 FRANKEKSDCOMWWW
661,121,890 *442D1F88B2BA8729C135858854C4F2C45FBEFB56 franklincantatore
661,121,891 *442B25F86C6F5B89EBA47698E8D25B24549B6082 ELDEN.GASIOR
661,121,892 *442CF4946EFA75B67CE922A530999C6BEF4629EB EL EMARI
661,121,893 *4420E4FFF88A2AE21D18FD8A7A062FB814F9C817 FRED SHEARER
661,121,894 *442E6F5E3DC72F78CD48EA9E4B9DDA3884ABB528 fred-toms
661,121,895 *4423ADF30794E299E10229F249A89B39717B8B50 ELLIOTTLAPLAUNT
661,121,896 *442264AEA7AB65DCBDCB9A64D39E61B6C61B33B5 ELR+H
661,121,897 *442D25EC45B5FDBB871136805E6E7E0565AB5BEF EMERITUS5
661,121,898 *442917F5E0893E9BB49A12FE48724EC3C2C64C8D EMERY.SLIM
661,121,899 *442D50E31FE6A21D01B0C0A931EC8AF3F68518F8 ENEMIES77
661,121,900 *442AD383F6293AD0A194B1F374B4CA7CFF92AEA8 funerm
661,121,901 *44263B46A249D2B53E1CC5D50EB83A0C1C601448 ERAMMOSES
661,121,902 *4422459ACB7BC4671BF52F5266315A50C8498B63 FURTHER,THESBOXESOFDESAREEXTREMELYSENSiTiVEiNTHAT
661,121,903 *442DEF1DE9FF17A8AD88B80E4020FBBD4E1A6A82 FUSHISITE
661,121,904 *44266F4DC4ED3E079E5B1C30CC002279679F9C28 [email protected]
661,121,905 *442D265B953E61939C5C334040558492FE9ACAF6 [email protected]
661,121,906 *442D06D61A26E6BA396C042151A4B6B71C989FAD GARFIELDDESTRO
661,121,907 *4422771FE0AB191B6C7FE6F7B2E551D68F140198 gazal-talwar
661,121,908 *44243CF86518875A3632B1EDF2F6621F262111E1 gazen3
661,121,909 *44269CB67CD0C55384F257B583C98B1D0451A336 GEDACHTEN
661,121,910 *4423644469103821B517CFB4223F0D5ECFB182E6 eugeneheape
661,121,911 *442E95D2B80FC429DBDCF43AB1D342A43738FC89 EUPBK
661,121,912 *442101E502847A82355169D784426CF723EA1CB8 eva-tejeda
661,121,913 *442184FA629622FE1C99F93BD3F41927DE071D9B GIL.MEN
661,121,914 *44269B8A59CC25B672778E78DCD9DC2286290087 GINNEGAPT.
661,121,915 *442A55493B777E1990D5F814D251DC2DE0333848 EX-TMRMO
661,121,916 *442F63F6101AADF4005F8FC2341CF84602E1CE1E glennsmolic
661,121,917 *4421328F088D007CE8F70EB4C1F4C98E466404DD GLENRINGLEY
661,121,918 *442C0604E20FE7502D796220F778098E886B5CF2 GLORIASEFTON
661,121,919 *442A1CDBF66610AB56F0C4048CFB01DA35921A3D EZOLEDNAB0
661,121,920 *4420701F48BE7BCFE5400E3C506C05F3949530B9 F55G
661,121,921 *4422D6A83493852851F60B73134F46FFD4DA1731 GORDON-IGNET1
661,121,922 *442BBA1AF7F559C8EC4B1AB108B84460CA9B15BF granvillemonarch
661,121,923 *442B366AB45A0CDD271AB1C90DCD4BB63C27C398 FANATIQUE4
661,121,924 *442A9BDAE35A516D3B882822BC4548A1E737E435 GTAKAA
661,121,925 *4421326D941A28706A71E4064DFEF081D4135974 guadalupefernandes
661,121,926 *442AC80F40BBE6B32EA6136C133260EBEE5EF465 GW=:
661,121,927 *4427F0FFDE3F5A401CADA97C32728632089F526F FFACHTET1
661,121,928 *442D55EA06FC43B88239BF2AA807DB146B6C3879 H31P3TH
661,121,929 *44250A1D1A012615E0CD334C43DC24944D06C085 HAEGTES7
661,121,930 *4420E0DB41BCB3AE859FAD60AA5A3312AC79E509 FLORENCIOBLACKINGTON
661,121,931 *442C84FBD0532843A2BE06C3229693A172585675 florenciorichel
661,121,932 *442F8EB156ABB0ACF8AD3C7FA1688831DB6A9C77 handicapper-n:-handicappers
661,121,933 *4421402371491F21B0D7CE3462179F330EA02001 “HANIFIYYA
661,121,934 *4424479125560C1A79503087EFA85C2E167F0381 HARC
661,121,935 *442E0EFC86CC1793EA832C0A5DCAFF54B45AE1A2 HAROLD.STUBBE
661,121,936 *442418EE91F3EAAB4750236F6994211F0EE6117D HASHHASHMI
661,121,937 *4421C49FA71241FB0809C231059BCAD25A427B8B FOLKETINT
661,121,938 *4423A97852149BF835B46A10CF0E5D304F35FB71 haydenwalser
661,121,939 *4425D8F5E1665AC26880B12EFBCA7E40765CB6C8 heaf.h/i/f
661,121,940 *44202A3183F50592CF14A3D177E46B9C1ED7E304 HFDZTLS4
661,121,941 *4425E575EB5386DEC0950DC0BD1C122E34454DD7 hiltonklecker
661,121,942 *442DE14FCA4A60EC1A0795D197B2858C35A7B8E1 HIPOLITO.ANDESON
661,121,943 *442E8C68C89F52D26781D6A41D4650A15448F933 FREDERIC.FINCO
661,121,944 *44247A691016B1FEA7A2730C46E69BD2E864E938 HJTBNIUED
661,121,945 *442C3CFBFBC20176DE3DC71890DAA12794556091 hkjsdrhx
661,121,946 *442579FAAAAED7A593C39951B2964E1E3C4DF7DC hnersatz6
661,121,947 *442EA1F66D8A1F8797CB869B99F89C9E17BFCC37 FSATIA
661,121,948 *442D790211C57F239ACE50E8F33ACBC4D061D84B FSHADRACH
661,121,949 *4429173A76D3310D42430D118321CC9378CC4FB2 HONTAGE9
661,121,950 *442BD689F7BEC33207058EAAF537D0101DC8DBA5 HORNFEET
661,121,951 *442676F395054BBD9DDDB83C4647D660286E629C G4SB4TT3RY
661,121,952 *442E931472611EDBBF7F83EBB56C9EE1177167A2 [email protected]
661,121,953 *4428FFD36E04C1FC8D2252A5DEC9D4684E5EBAC2 GABY-HENRIQUEZ
661,121,954 *442CFDF0283512BACAA1296C4B5715DEE8283BE0 gailconnick
661,121,955 *442EDFBBE5571DF7333BD1557397AC132C193E3D GAILIANI-1-0
661,121,956 *4425EC00EAFA246433A7C2F5B28F72FD927CC6BF gailspringle
661,121,957 *442645A13ABB010E37285C84A954D70EB6A7F5A1 GAJENDRASHARMA
661,121,958 *442F362DF260D30FFDED7947C994A94B1B0D804A GALOPPRENNPLATZES
661,121,959 *4425757B7C2D9DA1AA3B1620FDF41CC513949FD0 h]w,
661,121,960 *442752B7C17355A77C25BBCCBB2BE7C0AC668745 [email protected]
661,121,961 *4424942A357FA1E961F3BBD4C9B753302220F000 GASTON.MARLOW
661,121,962 *442071FFB66B4E1BAE4C5343AA6F5C4228779302 [email protected]
661,121,963 *44289FBB181FB818F4024F387912021CC4AAA0C0 i11uminator$
661,121,964 *4429DE6458A63CA14F6BB78177A4FB8F4DCE8958 IANOLOUGHLIN
661,121,965 *442EE597C46E46C38905072E562AC1EF41ACD5B6 GILLY-RUSSELL
661,121,966 *4425CBA5E4B33E9C68AA7CA85876A8380E1312CB Gio.Entertainment
661,121,967 *44233896C9812146230B1910AC94D0F933E17DAC ILUVMADELINE777
661,121,968 *4422FB9584C54088A5BC177386D5A5CAB9C7DBC3 GLIDEFRIKSJONEN
661,121,969 *442A2DF0AD63F8523F943EA96DEFD27F3B172100 imenkin
661,121,970 *4421339EF7AD4B243D65305924FFA1ABB0D4B51F goin'downbroadway
661,121,971 *442E3B98BF80370081AD628EE3579E0418AEB8E1 goobtiued
661,121,972 *442E6538D3436E9990077335DAF6EB0305F0DE04 INSIDEHIGHEREDRISE
661,121,973 *442F6662A0A86FE43767CDFFAB8CB5DF7FBC9B7F intro (feat. rakim)
661,121,974 *442504B2B63B3FEE06D67C6621BF9D9AAE2B68D2 GREG.WYCHE
661,121,975 *442F7289E8E2C6614A9FFF684733515ABE521AC9 ISIAHAVENI
661,121,976 *4425FF9680C7BE6E3CBB69774E215C69327F632B [email protected]
661,121,977 *442BA32A7969D836D2ADB229B1C7AD352DDA52D6 gsullivan0
661,121,978 *442F5D50193AD6D6797F560FD7DA9161E2255078 g!tc
661,121,979 *442AF4B053A030FD98063F74364B0CC9628C1D96 istenies
661,121,980 *44235C8D4FA6DED1FB8A48059FD68D091696862C guistin4
661,121,981 *4423686A6B9785FD59E74732039A378FEA002686 ixia
661,121,982 *442FFABFC717F07D85FCB3434A32F73EBADFDB9E guyfrayer
661,121,983 *4429DA896FA83771FE17B6E42E7E72C238ED0360 jackie (feat bruna loppez) (east west connection mix)
661,121,984 *442BA6BADCD56E4F6BCB6EF937CDAEABCD22D432 H?~=
661,121,985 *4424E1B5594B06E7F94375BFBD29770C3956D53F H4KKELSER
661,121,986 *4426B7F81AE80C69C708582A16AA8870B697BE58 JAMES.VIVENZIO
661,121,987 *44257D252BE4670FA22EBC9C3804F151B136DBD7 HAIL.TO.THE.CHIEF.1
661,121,988 *44220DE2E4DA0EEC3DEA6AF0B4BF4AEFA04AEA17 JARRETT.ASLEY
661,121,989 *44213C9EA4D2BD3611A2D144E4BF8F5F6DB561F6 handfuls!
661,121,990 *442026EF7B6B37172261A9351298BEF94A1B3745 JAYCLOPSJ
661,121,991 *4429F07D8A886B39DCE84ADF9BFEBA0E92DA8A7E jaygodbout
661,121,992 *442065ED2D602CB0F0F56EAC4DB09FC449F4291B harbingers7
661,121,993 *4425DA27765A2443712BE8E0A22A59295C8DCD76 jenson6
661,121,994 *4423FE9F9E8556E823F19D0BA3986BFBB6BA0CE5 HE-LOWERS-THE-TORCH-TO-THE-FLOOR-OF-THE-LANDING.--THE
661,121,995 *4420B4853CFF524300BB1AA3BA093457773B3D00 jhy1492
661,121,996 *44261F87A68FF9B80D65B2AB9CCD3506DA5F7765 HIF2A
661,121,997 *442BDE497E8AFB66DCA99459A643190E8AAC0CD5 [email protected]
661,121,998 *4427F249254B9A375894B3ABE11EA2975039CE38 HN2374
661,121,999 *4428F6083FE0FCD6E5360439BFD944BB049391D8 honda1dragon1
661,122,000 *44285069B3787AF379E93E1385458E66055B1990 horacerobinsons
661,122,001 *442ED71C7ACEC3CA44CDCAE2003D994BEAA7C39E HOWLONGWILLITTAKE(TOSTOPLOVIN'YOU)
661,122,002 *4428F3E5DCD74F7A89D0EA8B82D5895BAE8ACC7E justsayyes,volumeiii:justsaymao
661,122,003 *44268A7660F026B75AD140E16B9256DE73DFDD2D KAINITEN4
661,122,004 *4425F416C1FEFD03FD1572AB352364A3F7398F64 KALELGT
661,122,005 *4424E6B875F5E59C205C61557A1FAC76BF82CFD5 HRUU
661,122,006 *442932EB1DA50C4767C54DAC679C2D40953C7D29 HUBERT.VIROCK
661,122,007 *442443938DAA766B6AF2E11A3FEBF2B35A93FF55 KASHIWAGI123
661,122,008 *4420E6B384DCE41C8E450C3594FE74468731C335 (HWND,
661,122,009 *442E1760646F4D6630D39219791149932E9B8240 kelbtal
661,122,010 *4422CEA8937F8D569E4EBA66E5CF90B4F1F86DC2 IAMBASTARD87
661,122,011 *442A49977FB35E057EEE5F324D582DFE1411AC71 KERMITKAER
661,122,012 *4421F1CB450C6394A49973DF11A0CA7DA03A3D10 keurvorstendommen9
661,122,013 *44230F89FCF07E58C55EA97BEEEC91EF574EC3D3 KIM.SHONK
661,122,014 *4420F53E32BCC14D78F946664802CA58C2D33068 kirbyorillion
661,122,015 *44280AC6B6AFC97D42423DEF6CD9517EB36ECBC2 IKKH
661,122,016 *442B9F1D49DB47B2822AE48389384B854802C083 KLM5
661,122,017 *44223224DA39F83CBFB15817B61F24F6E0D3583E KOOI
661,122,018 *442F0EFE3E95187474F0AE77D8A1C89EA004B9D7 KÜNDIGUNGSANLEIHE
661,122,019 *442A8A339FE23F5C22C106E6F936D2080A0D763B kwswam
661,122,020 *442E0B60B63617C39CA4D3826F8927101C7D28F4 LAJOLA
661,122,021 *442D52AE940DC95FF27C6268F63F76075A5C5588 ISSACSEBESTA
661,122,022 *4424D36CEE5987C974F9B1573691A9B59FE97838 larryphillipssr
661,122,023 *442234041F5F8BD43BC2B3710D7055EEC99F070B I WANTED NONE OF THIS
661,122,024 *44255FBE01EDBDABAB87E53B861964DFB60E9B00 LAWERENCEROARTY
661,122,025 *4421BEE88D438946CBF019F4492BB5FF80039D9E [email protected]
661,122,026 *442EFFCB2F84E4672218C6E0FD6DB3987D985B5B lazy-surfer
661,122,027 *4425AA3B877C936F07944FE1FA69C6E8FBA3E2E5 JACKIE.MARCINKO
661,122,028 *442DBB54D05CC1466BFBCF35428E6B7D1E4746CA JACKY-DIAZ
661,122,029 *442AAAD70151DFF9902739BE83D51B671CAF3065 JAMEKEESEY
661,122,030 *44296E643621325922552A3FDBF496686ECBA5DF LELAND.FALLIE
661,122,031 *44215781888F60F07366DAFBD95055540E87322C [email protected]
661,122,032 *442CBCD68066BC39F6899ACE0706FE83B65469EF LENARD.LIESCH
661,122,033 *4420014EB54BA952041031DF3DDFEFCCEE87E670 LENGTHU0
661,122,034 *442F5DA8DDC21DAF7C507AFE27A3B50331C3C8FF leocredo
661,122,035 *442F266333D826CFB38BD19FF4E2DD1354200EB1 JASONKNOWLES
661,122,036 *4424E47A5F852FE0BE0DB4F96C025EE802044A73 JAYSON.STEINMEIZ
661,122,037 *442DBF4F66E901097EA52F85C8757C5FCB9E752C le-viet
661,122,038 *442A28F54F9B07CD3D4BA300C09CC25A52E0EE18 jeffsullenberger
661,122,039 *442C2B567DF073151A1DAA2F1E1514AFF8D2743A LIGHTWEIGHTCHAMPBENHENDERSONSAYSHESTILLHASALONGWAYTOGO
661,122,040 *4426D96FFCDED917B657016036BED9487C2B5D45 LIKECREATION
661,122,041 *4424C18C98F4F206F78EE249B2E4CF77B92F17F5 LILLULVÅN
661,122,042 *4422A70C68BB8DCC5D3B76BE85130A45B03005AD JERMAINEUBALLE
661,122,043 *442D4304638FEDFB8CDC7DF8216902016BDD195A [email protected]
661,122,044 *442B7009C484D57E285AECB6E8C6195A00E009E5 jessie844
661,122,045 *4421B3CFB703EF927F6DC9CF75A60B7357ADBA53 LIONKING
661,122,046 *442E136F8CE7DF78247EE2316D94B5D966F359A5 LITTLE-JULIE-SWASTIKA
661,122,047 *442F698D1F18DDC7E7922561CDB779971A5BD310 [email protected]
661,122,048 *4421ED25DE78A1BB48A5F8FC0DCE628C095B3F7A JIM-HUBLEY
661,122,049 *442628B297C6984C7DFE92CE032F50690281B5B9 LLOYDLAFERTE
661,122,050 *4425A02142E5B0F9E4A0CB1ED9D8DC5BEC09BA6B JOCHRISS
661,122,051 *4424E192369702ADE35DCE5571D1B3C249938475 lonnyfogleman
661,122,052 *442C37B0A6AB4603CA423B21526689598D5137F4 look-down-fair-moon
661,122,053 *442F13F8025DA466380572397D644EAF5DCA7A56 LOU.KEEHNER
661,122,054 *442277019F5ECF92B95612CF78E3AF01032FEAE8 JON.SCHIAVONE
661,122,055 *442B0665F6D2FDC02661AF2CB787155B013DA180 lucinda.lowe.radford
661,122,056 *4421DDC7483003D1F006847B8718C5C1AB2C617E joy-sangalang
661,122,057 *442F3C9C173EAB82C111E4EC1431DED723707FC1 LUIS.HELSON
661,122,058 *442A84BA72303769635757F561850EDEAFFB94D1 JULIO.REGA
661,122,059 *442475DEFD41B133477C7A36951D2427610CD161 JUSTIUS9
661,122,060 *442C6B77ABA4C82D69A70AAA7327414769B59396 [email protected]
661,122,061 *442850F3A20AA1EACFDD03EE76F0647AD02198B2 [email protected]
661,122,062 *44204AD84325FDCE507D094F9ABA2B237DDC54E0 MAGEE1933
661,122,063 *4421B27B13D6E48F5CFF25FBFE225B838A46CDAB [email protected]
661,122,064 *442BF3D327CED702197B3595A438BFF6D2D8290D Kap-62
661,122,065 *442D39D6462F3F8070D8D766AB33216DA92CD963 MALEENAL
661,122,066 *4428E3CFD170841B73D96A71B045517505F02096 KASAPCAKAL0710
661,122,067 *44267805CABDF80C3CEFE33AE2114B7A0B45D867 Kde-sukraby-moje?
661,122,068 *442C8C84049F5ED73467549A27DED04DCE63285A [email protected]
661,122,069 *442BBD46914CB6E923D85FB13FAEE1F16326E131 [email protected]
661,122,070 *442F8C30C91B3B43E4AB0F8D17DFCFB48AB46567 MARANDOVÁ
661,122,071 *4420E990DF15FF21BFFC0733FED09C6F5BD77761 KELLICLAVIN
661,122,072 *4428090BC1722AC0CA8174EE41198F9D3D849D97 KEN MAYNARD
661,122,073 *4421FB7520B2821B3BD94A3010285824DC4889D9 KENNY.LIUZZA
661,122,074 *442BE7CF4CE8822D90D1552FC4E74CBD6133333E marionklunder
661,122,075 *442853814718BE00F44CD53E827E8D9C4DB67369 MARKALFANDRE
661,122,076 *442B88BAECDFD72C498B2F7487DBF031CE8F87D5 MARK LEE JONES
661,122,077 *442CF1472871B1289E501F6145396D27156EF449 kevduala
661,122,078 *44227784EBA7A2B9F0D6D8977D376C908674A764 marlongadison
661,122,079 *44248BF993E212211D49A0141CE7CAF5C89C678A KIENKIN5
661,122,080 *4422222277D38B96DB58DB0247D840E0D2B21AEB [email protected]
661,122,081 *4420F9FEA0404DBF3F4DB0E0FD25E60042E15B16 master」の条件に「wall
661,122,082 *442901116630DC5D615D5F18FDABB56AC4E6376C kissoffu2
661,122,083 *44298180803A3E2D725339158F9D5CFBB7470795 MBAFFONING
661,122,084 *442C24E4295EBFDBB09443D4B4A64DA5561783AB [email protected]
661,122,085 *4425D411D2A351439C0AF18B04A4B3D9C78790F8 medeplichtige
661,122,086 *442466CF2DD7E9F86BE307CEC8DBE81C52AA6877 ME (FEAT BIRELI LAGRENE)
661,122,087 *4424FFF471209B12539F3D291683FD7E7F31399D MEIN-BESTER-FREUND-HEISST-LUXI
661,122,088 *4420398895CACC7FB0F77C4AE2D26569620384BC MELVIN.FRIEZE
661,122,089 *442E47E33BD72B62167A27FBD3DE9323A8BBF43C KRISONDRA
661,122,090 *4420395C2416CEE1B875F6FE57DF46891710CB15 KUROSCH4
661,122,091 *4428102A5655F75BFD57B7C52EE2F6CF900B6369 meyganfox
661,122,092 *442A2499D74939D1F684440C0FA804929342023C KVADOJ
661,122,093 *442F74BF9749A81A5F6B266765FD70529C503502 KWNEWBERRY1
661,122,094 *4421651FBB20C9AA69D86712A128101967F295EB MICAH.DIANI
661,122,095 *442A13B417D17F29C2097290E40037738EF0BA7F michaelmintz
661,122,096 *442199D9A4F5AF672DB02BC306EC913EBF5D4CC7 lacirtemarap
661,122,097 *442763439E5AA03ADF81736A9D0FF9A0C8AD22E5 LAMBERTRODRIGUEZ
661,122,098 *4420B82F2AB69ECF06FE6E46F0BCC991D7C8CF6F millinnium
661,122,099 *4425026C01263A015FE1F8E8D887530ACEC14510 LARRY.ALROD
661,122,100 *442B93F39ED339353757E1E507337AC83218B9AA la-sci-aids
661,122,101 *4422584ADF828864DD3D64904FAD47242A2957B4 [email protected]
661,122,102 *442D9D98E2ECC4B27D347F7C7AFEFD849954EEB2 LEEHAGUE
661,122,103 *442C105A75404805697A19D2445EA3BB8443EF87 [email protected]
661,122,104 *44257E840F5C911B7F8C917E8B67495B61E19337 LEO.KILNESS
661,122,105 *4426CF2E85865D36B9F1EA445876DBD9AAB6494C MONROESAMPSELLE
661,122,106 *442316378416230AFB90A607F52A807744A5E948 let'stap
661,122,107 *442298771F78E4260D72FA8E7EFE46E78BADD42C moriel60
661,122,108 *442DEE999F241CEC330574BF575EB4941093515F MORONIWQSB
661,122,109 *442DBF041C037368E1E44DA3C00AFA2E7082FED0 MOSE.SABAT
661,122,110 *442E5348A7D20B0E2463DCABF3DF7083ADAF1A6C MOSTHOIKKA
661,122,111 *4422E46BB5FF6AE514AC177AC801349AD1813291 mothervampire
661,122,112 *442C17CC503BB07D7B7989E1D5FA313EEB2E6239 MSPATAROHAWKINS
661,122,113 *4425B6E4F16DDEECC9735AA68690A901CA1744F2 [email protected]
661,122,114 *442584478406CD268BC4B797DE627CE38F5DD26F [email protected]
661,122,115 *442DD413A86A22F8E01763D14AD2D1776444C773 LIMITSYSTEM1
661,122,116 *442FADA0EF0E5C62C0A1CF312A9B7E5F46C19061 MUSIC-FOR-ORCHESTRA:-VI.-SHADOWS
661,122,117 *4423064479AEBC53A575AE1867494129471E8511 MYLES.SHIIBA
661,122,118 *442B1E918611FD1CF8BAF826BE71073E03C2B9BB LIONKING
661,122,119 *44221BC0C309BC39EA0DF605635F791F5B3BB777 N:52
661,122,120 *4426E602518B3341035C5FA7CDDC19E2B6DF28C5 NAALIAK3
661,122,121 *4422361016041B2132E4E89046667CA7A993F179 L-LA
661,122,122 *442D9F23748E48B055C47C14CB4E4FFE5651A079 nathanialflitter
661,122,123 *44271D3281975E431DFB321FED6C6190CC516324 nawafaldossary
661,122,124 *44217F02EA9F8C8CDEE16033D1A2466DC0B36FBC NEHIRDENIZ
661,122,125 *44207A22771CAB63B28375DD05948C8CEADA9B86 LOURDES MAGTOTO
661,122,126 *44283342EF641D31CD3ED94E4405594C567FE0F2 NESTOR.ARVANITIS
661,122,127 *442309E3FF45B1AD31D667B40F2E95A3FB5D83BD lsehests
661,122,128 *44206B2987779C516B05F7B3F5D25FC16D7F3876 NEWCOURTLADY
661,122,129 *4427B5F5D55F8656BC501173CCF51A023CFD1FF8 LUCAS.CARBONI
661,122,130 *4425828FBBE6652694D902102E2C447308420064 LUCIENYUNGBLUTH
661,122,131 *442C85FB5BDF2A2C5D99DCD8C0E06384CD96F534 NICHOLASMALLIA
661,122,132 *442EFA891C050743AAF7E10FEA7CE2371EC31A24 lupebabine
661,122,133 *442A0C43BAC77FB6DED75CD18A62B7BD7626F589 LXPD
661,122,134 *44224885BBFE67FE54786340647E9016E9228CB2 LYNDONMESSMER
661,122,135 *44280CAF1EF17B49EEF0E19086AFCEC8482B62AB M045A
661,122,136 *44218136B321E442AA7C583393B9DC76D5BB15B7 [email protected]
661,122,137 *44247279E62821706810423F3D862CEC9DCFA465 NOAH.SPRAKER
661,122,138 *442B57415C38CB072DD9B1085D4BB739B93CCB0F NocturneNo.21inCminor(1837)
661,122,139 *442F818C60727AB2B5E2475A602D3EFD8FB14A5F no.more.we.cry
661,122,140 *442604226B508149EB787E59F682A9EE426843AB [email protected]
661,122,141 *4420AF504BA5D2792F2B72194221003D7876DF4C malaisie“
661,122,142 *44283028E149E9D97FF363073BC897261510C366 noruega—
661,122,143 *442AE4BBA0A1A6DD6E7C0230D1F5A546DF23BA9D [email protected]
661,122,144 *442E80918194317678167BE44B17AB62DCD5F495 n-philippi
661,122,145 *442908E85CCE9BB8C418B8AA17DEFFBC652AEBD3 N"SH
661,122,146 *44260D5F739A0D2021332199252250556E094CED maria-cristina-macatangay
661,122,147 *442C0A4F85BA2091103EC8323D4C7089D9D058A8 O3ZL3MAG
661,122,148 *44258649EF4C999087BC81A7BCE5C3760AC90B41 [email protected]
661,122,149 *442DC608F0DD85A938D46C53613ED30299B21D07 MARIOWOLK
661,122,150 *4427BCEE2DE054FA1B02E1C097F71FE70C68A082 MARITIME-EXECUTIVE.COMWWW
661,122,151 *442A6D6DA7CF07329583BD004D219167F962975A mark.lagerquist
661,122,152 *442C56FF4258E13CC48040AB34D1128CCCDE47F8 MARSHALLSLEDD
661,122,153 *442649B8022DC5E7FA942F8511C6B7B60AC21E14 }O{.~`.DB
661,122,154 *4422711B640129CA0B7D108B62922DA204C4D15A mathfile6
661,122,155 *44281D3F70EFE58C0F2AE6916571C42B70215B51 maxcaper
661,122,156 *442C75ECC4443068EF0782DE00FD634CD30FA7E4 MBALAZI9
661,122,157 *442467D25F273AE49D3FA172BC4AB35A7AFD10E3 one.more.night.(berman.brothers.''ibiza''.dub)
661,122,158 *4421E953B1040E8DAF992EAAB4DF85B1B2726D15 OPLAZI
661,122,159 *442CFD115079CB5EFBECC3792503E0D338F1BDC8 [email protected]
661,122,160 *442123A8BD6B14764BBD04A9D7EEA65743C22B72 opreddered
661,122,161 *4424F544CB35A9D62C7A68A19DBD99614736A72C MERCAMURCIA
661,122,162 *442F4F8AB33BEB75BD2F2E0094D6E4DDBC9E0198 MESSINGPRODUKTEN
661,122,163 *442076420617EFE06E6967D97AF244E9084BB813 MICHAELBUBB
661,122,164 *442F46A23B6B4B6BDB3F5BD2A57675DD6FAF3D5C ORVILLEKUNICH
661,122,165 *4428E11D0B0DD1CE11F425D48F485A78ADE2C998 micr0bi0109ic41
661,122,166 *4420244B35EB486B79B6E536703F76059A43610C MIDN4T
661,122,167 *4427B8CF339996F05996D7FE61BC7705105EC2C5 oswiadczyly
661,122,168 *4427CA3BB1780386B66EC2C2A7C88B82BCD34048 OWEN311
661,122,169 *442C1CB695366557C0F044838E0C92158213F98F MOHAMMED.WIECZOREK
661,122,170 *442EF588EAF88BC9A5A36852834348D822834963 MOMENTUMSVERIGECOM
661,122,171 *442F164898B04586336D07E5B76BEEC4C4C93CE8 MONIRKHILLA
661,122,172 *442153A59F79BAFF3FF31B7AF96ACDB74EC27A1F p-----B-~0~o-Splat!!
661,122,173 *442B4B0972E6F1DC61C593C1115B6D7A8101F9EE p######B~~3B<
661,122,174 *442A864E9E9D985EFAA241C7D5F9C0FE6E145ACE MYPEDRO57
661,122,175 *442A29FA82E73D3CAE8DA18E066223DF17C53B1C NAUCRATIS.
661,122,176 *442E3E64D0761075FDB473DAC2B798260B2D7FEC NELSON.FLO
661,122,177 *4424E0BE2149A4EA09657B318AED0142CDFDE0ED pohoriljak
661,122,178 *442533E9118258D33EB5E83C7473AEB26AE52B6A NESTORCLISE
661,122,179 *442E934BAD5139ED3DADADE20D8E3A9C33B7E269 PP87-96
661,122,180 *442EBCB9CA0DFF1C18183796AE27922950FFD709 PRABHJOTSINGHBHULLAR
661,122,181 *442E8CBBA5667EDFAD27C0AAB61CB108B461C826 NICKMACNEE
661,122,182 *442490180B420761715B784C43CF26AE65042204 nicratcliffe
661,122,183 *4428F318B3D812268D24F0527BE02C0AB14412AC noblefrangione
661,122,184 *442E967EFC338B3801417AC165E25D7823FCB29E noncom
661,122,185 *44213117AA0FCBA83E4984457C6B87AD6E8002F8 PULVINARIANING
661,122,186 *44272C8DEF40306FC609FC9651865AEB02E7C954 nortaiks1
661,122,187 *4421470C2CBB0853893B5A2B66C8D89F4F277F8D NTLWORLD3
661,122,188 *442CA1C4E0FAC75A16E12CAAD7A8CA31E62710C1 QIONG ZHOU
661,122,189 *442F1E78750975ACAD64ADE5ADE1F1242CBFC753 NUMBERS.LEDERHOS
661,122,190 *442B953E2F8E9EE5416E8D42CD3CC81ADF3B521E Q===P*UU
661,122,191 *442D7BAE2D953BB1B880ED69BBF0C68B8D22F724 +R4NG13$
661,122,192 *4429D4DEE582E8BFC12371A76F158288D089A798 [email protected]
661,122,193 *4424CBA445A28F700B4179F042C63EA603B319CB OKUJINÁCH
661,122,194 *4420B1D2887D1B35D5C8DE4B56DA7F2C8A324D6B OLAJNYOMATAIN
661,122,195 *442D422AEB146FB41204DD254513C9A95EF67FF3 OLAVVALO9
661,122,196 *442FF57D0F343C819EFA4075FEEB364B8C4EDA08 RAJAZAIDI
661,122,197 *44244B5138D3C85DB6B951D19C64FBBA2BEB38C1 oloyede.bolaji
661,122,198 *442C19EAFCD7C93D44D562D5491C5BEFF3A14AAF omarboness
661,122,199 *4420CEB8550981ADA8E9857315B94DFD17587B88 OMERESQUIVEZ
661,122,200 *4423430CF9FB295B775DEB96B5D78A39F108E480 OMER.JESUS
661,122,201 *4420CD3649C1F15F93C593EE0AFA031703063EAA RASERIANFALDETS
661,122,202 *44234CE91BB8AC474E7CA26418CF30454BCA5AFF o->-<[email protected]
661,122,203 *4427FAC2729EC4F2D4D2DAFC9B6763D977C65CEF OP.BEACH
661,122,204 *442E059A385FFF057A294BB3B94AC756E7CAA43C REGINALD.VALENTA
661,122,205 *442EA4C23BB1D87F91131011D92B3B2EF6212082 OUTSTUDYING
661,122,206 *442B4779BCE6662D93C83302FFEF8B927676F21D RELTSNUKSGNULESSEFTNE
661,122,207 *442154AC5DDB5F7934945F4C5196D8C3C4FA76DD REMARBSC
661,122,208 *442A39C25BD15C7DBE57F854A96903C6412001D8 [email protected]
661,122,209 *44213C9C2D4C9F777383AC48F7DA99B2130258CD OV?U
661,122,210 *4427D7CF0E1641B801FE1979774ED056ADFBC767 [email protected]
661,122,211 *442150AB33E6B963B87A682C97EB791F83AF87AA P3RM3A+!ON
661,122,212 *442858AFC626939A3B4101E053E9280F63D0DBF1 pa00099884
661,122,213 *442BB96CB8247105C1D5AFE70E141C4597E08B38 RETRO.TECHNO.ACID.ELECTRO
661,122,214 *442DF10852B28EF347A1F981B49B7169E946E374 PANDIANII
661,122,215 *44233E104981B78E42D6C18105396505ED599413 REYNOLDSEMILIED
661,122,216 *442DC4BECE05AE5E09AA0C83693355FA2D71A666 riazibsw
661,122,217 *44275D7369124EC1F7949890CDC4B075C983FDAD parque-metropolitano-el-lago
661,122,218 *4426C3BAA873E71211E74991DFCBFD87DB9C5842 PASGELEDEN
661,122,219 *442B5C5D782F75C848122D8489F025E45409B501 patriciatalmadge
661,122,220 *442F2C4A5C84975181C9D3348621E159BAFD08CD p====B.~O.(0-0)
661,122,221 *4422E0C919E7E2B10277E17507EEDD7D7CA016D0 PD~.(00)
661,122,222 *4424A1741AF36230DDA076102EF7C607CCD7076C robtgong
661,122,223 *442425A61E94DA595B38FA0E265953FC21DF5CE9 PEPSI
661,122,224 *44229F1056DA53FE9618EB55ED5C4E2D450E631B RODOLFO.PAAP
661,122,225 *442CF5912C181FE31A7F9A3ED19F4EB74D6E2F2E RODRICK.THOMSEN
661,122,226 *4420CE2643F328E667EC1596A5646E4FC464671A ROLAND.TRUDE
661,122,227 *4425B1D9CDDAFD1AA1AEA1850E320F3AB0030944 ROMEO.MAIDEN
661,122,228 *442B21C070E8A2A454E5CF1D33EE458B9EC2C9F5 PHILLIP.HARLAND
661,122,229 *442ADA0B07B69D091DB0BC1473698A33531A102D PH---SMILIN'-IN-YOUR-FACE
661,122,230 *4424E15946BE9BA0CA7BD08D8B6CB3F9545809BE PIANO-SONATA-NO.-1-IN-C-OP.-1:-II.-ANDANTE
661,122,231 *442B76A7BDAFB9FE3B88737C8BBCA139CA7E7D48 PIERREMIHLFELD
661,122,232 *4422CD237B462C4E6BD828CC6758BB5801D90884 ROSENKRABSWS
661,122,233 *4422200DA89AFDE8E8CD89C2F8B1892BE92B2C50 {{rottentomatoes|id=i_robot|title=I,.Robot}}
661,122,234 *44298CE28EC58349AC1DFD9E11376ADDE24A2F50 piroscafi7
661,122,235 *4427431A45BD90B12169833454020E7D417D3322 rudolfwhisonant
661,122,236 *4427F592CE8CB11F5B2023D6790A716EB628EB20 POPEYEVIPER
661,122,237 *442D596FBA490BD138C06D0140C87D58DACB7B8E PRACE143
661,122,238 *442CA715C71BC2EDEE19B76F0393A96833018377 PRATISH RAJ
661,122,239 *442AE30B2785A5D8CDD409297FFF0C0E0EAA7F9B PRESONGGED
661,122,240 *4424DF817DC2EA6D355CB31A74372032E1B7BAD9 PRIMO LIBRO D'ARIE MUSICALI: DI LICORI UN GUARDO ALTERO
661,122,241 *442930E9CB944267142B2218ED6DB54063694059 sandydingel
661,122,242 *442F723FD3F4F7CE37988B42C7DACCAC5DD63E42 SANFORD.JOTBLAD
661,122,243 *4421888756D38C5B7C4C096CE3E3EADD5CAC150D projes
661,122,244 *44276D1437F78D2C4CBC0F2E4E0EE2BC5E4A8D20 pseudozoogloeal
661,122,245 *4425F1E612848F9DC148470508807C2743B11BCE saulvero
661,122,246 *442519B42197DC1CDBD8777D12E47F478991593C SAVECOPYRIGHT1
661,122,247 *44255621CF1B47BF38F8ACF1615C5BD6D9661698 savjete
661,122,248 *4428EA204D715BA6B30173298CA4AC0DC9DA9132 PUNC+1O$
661,122,249 *442FCCD41FE78327620CD335984BDE57368CF08F SCHORPIOENSPINNEN
661,122,250 *442759A32102693E453DD9EDA3C54FC671B30946 q##B*.*.*o->-<
661,122,251 *44297C7FA77E9F3D7886AE78FA30270A63F604A7 SCOMPAIONOS
661,122,252 *44276CC412A678BCEA50E78EBC513EF6A9504EFB q======D-~-Sploit
661,122,253 *442431A578DD75E30FFACF161EB757BE35C4DF27 [email protected]
661,122,254 *442F0B63D7E435817F1BC713423683D917B6E079 [email protected]~-~-~(O_-)
661,122,255 *4424FBF4223371C5A2E126B9938A2325AF2B0F97 SECNERRUC
661,122,256 *442CF5FE3CF98060E176A4AFCC2C6786578DF8FF sensu4lities
661,122,257 *442E8C5D97D4D4FF500B32F7C6C7EAD5F868DA38 RAFACTIE0
661,122,258 *442BD2AC4448A1AA04FB081540B6646FD7951055 [email protected]
661,122,259 *442737C7755062156902FAB8C2EC3679D94F7C78 randonrusert
661,122,260 *4422B712B27D5EDF0CD6F0288C56DC1CBA762CE8 RAZORINTERLUDE
661,122,261 *4423501C784A1848AD44C560B944B1773E8C3D5D [email protected]
661,122,262 *442F8281111523FF91CCB9F9A40D614F0A453080 REASONS--APPLES
661,122,263 *442200B170AD6937B084649D8197BC5853CB64B0 shirleyauxilien
661,122,264 *4424A4B0D40AE7A342C0E398FA3ADC3341CC9E42 SHON.BASORA
661,122,265 *442E3F38455E3D61D245D55ABF868991BCA1790F SHOUNENB2
661,122,266 *44228736A8098765092DAD8FF4AEA1A2277F8CAE SHYHEIM & WUTANG CLAN
661,122,267 *44280C185EB9E1B3BD4C871ECB86821331EFBE19 SIMPLEF1
661,122,268 *442FD9372A7B4A56FCD545B35F1E826E4B014054 SINNERTW4
661,122,269 *44238FE333BFB5BA2B4F5968B9DBE8033F9A2ECC SINNFAELLIG3
661,122,270 *44287EA44DE8860775C4A84AB7D7479C1630DF27 SINNOWE4
661,122,271 *44200E1F8CFCF17790A77FE7BF9F040B06448B6C slick-mcfavorite
661,122,272 *4420DCDFE1FCAC620665BC03448B1D8D0F19F361 SLPHNLCING
661,122,273 *442A400777CE0BB33ECC7CD3C485F1586AA33B5B retemiced
661,122,274 *442B2492886CAD8C411F00BCA426713A06F877C6 RETTIGHE2
661,122,275 *442606543466F6D88E47B66D1B85DD4FFFC68D30 SNICKERSVALERIE6
661,122,276 *442861BD9416F2C77BD71B6DAA8F3275F953C6E8 REX.QUINCY
661,122,277 *442CEDD8760BE1AECCA3D6478526390DCAA7900D reyesbrienen
661,122,278 *4422C1491592C34423B67AC3BB8A652334AE3D4E SNOWMANROPING1
661,122,279 *442E3407B69F6C1C5D01392BB1A95557A89DD462 REZITONP
661,122,280 *442EBA31B2766DE1B984EE010D352C086301E2E4 RFZO
661,122,281 *442932CCD99968E20944E6D321EE63EC5A9D5F6D rickmansell
661,122,282 *44275C13D2C16F43D45B0436D765C0239C3BB52E SPILLERINKSLINGERPENPENCIL9
661,122,283 *4428F1520F3AE1A329CBF9CC3A1AB6B945CB7D6B RKA.OLE
661,122,284 *442A49A1E17522F677D823EE449936207A0113D7 rler
661,122,285 *4428CB64419DD3ABA4A6B02637F15A4C4B2C932C robbyyamashiro
661,122,286 *442DD01D5787F456F1E8B153811E1229CFB4CFAA ROB TUFFNELL
661,122,287 *442B38B511B808B0EF75EB9799593E47BDE21083 SPRINGSEXY4
661,122,288 *4424051EAD8D4168534574F4E6F4BA549C9A44B9 SRC="HTTP//ECXIMAGESAMAZONCOM/IMAGES/I/01DY9X84VCLJPG
661,122,289 *442E5A9EE41EAAE6D57A5B64E0D24FB63982D80C SREGNINVHMERF
661,122,290 *442816D7348564AC06B58C9D55E2E1701F8E12F1 SS244593725
661,122,291 *442FA4C08AA8CFAC6B37C6C421AC937BB89E0F24 ROTTINKJES8
661,122,292 *442244CBAE52EA06D46FA238C0B6AA871E856859 STEFANFERRA
661,122,293 *44218EACD017937589F8DE2F1EFC99A1D4CBC0D8 STEPHANIEVANHEES
661,122,294 *442178357CBAC4EBE604A058555F2B0EED12A678 RUBAINA.SINGH
661,122,295 *442CD31EEA17F9DB55844AC99A31F27E4BB93B31 RUBEN.CASTELHANO
661,122,296 *442F1147C94D06D53C48EAA9320473925F6C67FF stephenyoung
661,122,297 *4425B699CBB343BD5B341487DBE920D1F7C1259C RUEBEN.KEPPLE
661,122,298 *4425D18F02D92A8DCD4D9435E747ACE265012596 RUSSIASPORTBIOSTUB
661,122,299 *4421602AFA016A101820FB6E724F131E1883B724 STROMBULIFEROUS!
661,122,300 *44249988BEA8B53763FE0E8F48C4186792327145 SUDAKSHNAS
661,122,301 *442CAB3E7E11F8B611774949AC322D86A6A44479 sueront!
661,122,302 *442BFD9C9C7D1F377F8D97648E6FDB732960AB0F [email protected]
661,122,303 *442B01360A6BA704C5E2C37B42DFA2B2DC3CB5D7 SALVATORE.MATAMOROS
661,122,304 *4424321E59A0ABE94B7BEBFA7D340623928E8ECA [email protected]
661,122,305 *44263925B418ED790FDF09EA40096E8B50B23685 [email protected]
661,122,306 *442490B710C6B1876EDC63266FE013390E90726A [email protected]
661,122,307 *4422852F195CF06B7A602BD4AC913BFEC5CC0874 SAMUELBRIGANTI
661,122,308 *44286E3AF291DE359157167F07C3C380E9FA98FE SAMUELDOBEY
661,122,309 *442D4E39CBE2CB92ACBC3953133220C505C3184A SAPTDPKG
661,122,310 *44220FB68BC2DA0FC766AAAEF66F70C280801636 SCHADIAB
661,122,311 *442F22F783B349F075E95A5B0FBBD934DBFA32A8 SCHUUMBAD1
661,122,312 *442B3CFA8C3B7ED47556624FC0F9DD714F4F091D „svetaine“
661,122,313 *442C2A364E339C4A0F08AB6C8F867DD96B9BB50E SWODNIWSUTCAC
661,122,314 *442F638D1A4B8E4BE3700621EC7F9ABE4E82E5F9 SE8(
661,122,315 *44269C606AB43F10A90CB0EE101CDC47DD2D4157 TALKTHRUSTTITTLETATTLETOMMYROTTOP5
661,122,316 *4428A7202C862340C18AAC9AAB4BF8D369484840 tanacskozasanak-1
661,122,317 *4420885B437C0356433F6C2CF2299B593C300DBE [email protected]
661,122,318 *4427C1FC59657B948CEA5EC6CE421FA217F05D7F [email protected]
661,122,319 *4423F28244665EDBCACBCC2462869C25B92B4972 TARGET FOR REVENGE
661,122,320 *442003B312EB6248BC1090802EDD3AB5E79336A5 TELECTRONICS4
661,122,321 *44258890850FA3075B4008031FB81A08F176EB65 TÉLIZ
661,122,322 *4423C004E63BF10B3987797E680DA2451264C2E9 tevoyaromper
661,122,323 *442DD4501A492D2E3E71111AE0BDA75CEDC90362 SETALSER1
661,122,324 *442CA77D71D9C08B99F8CC316EFACC5547E6CE56 sgbschoolcom
661,122,325 *442CD81B9031FFBCABB4EAE2EF7BD07B181C21D1 theemptyskull
661,122,326 *442608586CA00CA33DE7D9879BD15D589889B584 THERONDARIO
661,122,327 *442F49B4C45DB9A8FA093BF47A982E140032CD19 THE-TORIES-ARE
661,122,328 *442A5B55CACC1A7AD24925E437FF83735C354509 SHEFFIELDRA
661,122,329 *442FBB0EB015DB18FB15937FC62452122F432944 [email protected]
661,122,330 *4422DFC977AE84C23330D1A7923A424363CB5D67 THS43210
661,122,331 *44254C0863BDA03F146CEAF93879C952D4F5A5E6 TILSKRER8
661,122,332 *4421883C3BC2B83746BBC84665867556FE43E7B8 timothyloll
661,122,333 *442FC81F53C8970A30D95E1E5A367540D4B21483 sibin.mathews
661,122,334 *442F2FEF31EAEAC8B0A62B00E6D2631F7DCEABFD [email protected]
661,122,335 *442B7A6204E189C9CD78972589C5E4C5E212B025 TKRZYZOWSKI
661,122,336 *442419796FBCA598FDE0E35030C07641CE28481C SIEBMACHER028
661,122,337 *44232A4F6E9EC2CBBC62993EED90C636DA063569 [email protected]
661,122,338 *4427577C81AC6B6A55E4A8FE6A41CA5A0DDFAE34 sign_language-s/ai/n_'l/&//n/gw/i//dz/
661,122,339 *442A388ED696F486FACBF6FC42BA2CFE17A16153 TODDSCHAEFFER
661,122,340 *442DB2957AFDEEC2DE6C8C6D8CD68659FB99B370 SILAS.LILEY
661,122,341 *4429A8BEB707E61DBF341665B1FD04FB80642AA5 SIMON.VIENOTH
661,122,342 *442D470956B50668410BCA09BDAB1878B2328B50 simplegiftsfromoldamericansongs
661,122,343 *4427B6AA193DF57AF3CD5780115B1E226EEDF2DB TOUCH(REMIXEDBYBLUEAMAZON)
661,122,344 *442B2CC9C78B275A5108010EBBC2DB9DB373D542 SLAVERYFRONTIERMISSISSIPPI
661,122,345 *4426AD127BF83088E0062A8B5C1CD66982A1D136 SLDSLTRS
661,122,346 *442BEC22E68C6F675E2240388C1DDC248E7FF371 TR4GTFORM
661,122,347 *442155F40D85AD26238E6E4FA676E572ACCC98AC SNEHAMAHESHWARI
661,122,348 *44211293CA3CA0CD1073D7BE3385289C14728F67 triciawarner
661,122,349 *4426BAC13E3684ADD0F4B3FACE887730A03F05CB solidaled
661,122,350 *442896485A2B557233E4751822906F5D5BEC26B3 SOPHIAMARROQUIN
661,122,351 *4423699161E2882EFF3114DE78FE2867841ED602 SPAMLINKREPORTSXTRAK
661,122,352 *4423A7544ED3377784A7E9CAF522A1901A73C875 speedomexico
661,122,353 *4422AADA97537B70D25FD00DA857D2C41CA93B9F TUMO-MABEDI-SEHUBE
661,122,354 *442F0F9717934C8BCD5ECAE5326FAD6323FF6349 SPLAT-O~D####B
661,122,355 *44238CA31D5B73246070ADEBF56FE4BCD96C9AE2 tvåvånings
661,122,356 *44291C255F9C9879F32C535F9CA367768E72E991 SREKAMKAARPSNAA
661,122,357 *442BA6F078C1720A2110727D7C0B50135986A3B1 SSELTLUAF4
661,122,358 *442C04EBFFA8552E2E679D9E75F12C5C09543E7E UDSPALTIONSES
661,122,359 *442774F4D1C9BA1DBF336CF9206ADACE9E556E40 staceysampley
661,122,360 *4428C7B8E99B86766FB28396FDC66238B4A149C4 stadaconan
661,122,361 *442C1164FB871F03F399BCA9E1C61C906154FAAB UNATHIKAMLANA
661,122,362 *442414B73DBF07367B1EE8DF7A1B8E682B82B892 st.-louis-blues-(take-2)
661,122,363 *442548AFF598CC805EFAFE1CFFF7E64E0DA101B3 STNATERGNOC6
661,122,364 *442D0FA8CDFE171CDF42EA1AD1BD0B24D27812F5 V131684
661,122,365 *442D3072F54CE427477B7C13650B3A02866052DC VALERIA903
661,122,366 *4420CE6932C187C63C05E26DFF0F95FF47B08247 VBRIDGET8
661,122,367 *44249D84274DF80C0EB7D624DBF94DCFAC6F2400 SUNSETELIZABET0
661,122,368 *442443A4B597244070861B09D6E72A1889CADF29 SUPERMANLOIS
661,122,369 *44224538C41F51FF83A873548796DCEF7E594374 VIKAS SUJI
661,122,370 *442684E43EAD3DB0ED0CBD01B4AA551A1D67203E [email protected]
661,122,371 *442FBEF2FDD18E391C6CCA9481D3ECC53B642E13 VINCENT PAUL C SALOMEO
661,122,372 *442402FF1189C12892C2D3E95D1A5F154465F6C7 vincentschnapp
661,122,373 *442D8D196C3FD8B45716DBDB15DB3A1DFA797728 [email protected]
661,122,374 *442D5A61939DDADB8FC7581584CD3C0658AD7CD6 T4O9
661,122,375 *442E705453EC106789F4E228348D229BADDCADF9 TAHIRIR4
661,122,376 *442D33960A20745478AC4EDD6B7F17A1C616C501 VOGEL-PINKY
661,122,377 *442E8E253F1BA0CDC3D8844A3661676D5BBCBC3E volimkarimi-joyce
661,122,378 *442741D1900963F6B69F18700215E4FD3D909A45 TALKFEMINISTBOOK
661,122,379 *4425A99E5F55C5CE759579CE57549FD61917BB2B VSEE
661,122,380 *4429FE7F1F951D501D53C52DD1774B26958C0C3A tanakodu77
661,122,381 *442709D90C97D37A9C78CDB7BD3E9949033884AA telefonsamtalmedulfthor
661,122,382 *44219626EDD96CD646BBFF7AC7379873F761997B Wayrapa..Muspuynin
661,122,383 *4425EBAD310677488A691B47A523A625A1535A81 terryfroberg
661,122,384 *4425CFCB7CB99C9D5B3C18296E417516872BF87C wellaccepted
661,122,385 *4426DDC8E04205CC41AC243B6EAD821DA47CF0BD THATORION5
661,122,386 *4423B92FA14A03D7D67F1E38C7F70A059ED8920B [email protected]
661,122,387 *4423106EC8DF089D0FF6D7BD7A68DABF824CFD16 WHAT'S HE GOT AGAINST ME... I MEAN, I 'M
661,122,388 *4427C0D8EBCD9497B31739B77AD3281A24C4E441 the.encyclopedia.of.swedish.hard.rock.and.heavy.metal.1970-1996
661,122,389 *44269EE4822C6E37FDCFA2B2F93C8B5056DA9835 WHERE'S-THE-BOY-THAT-I-ONCE-KNEW
661,122,390 *442FE68C656CF18A90C4E7BD079B6CDD8904588E WHOOSIS
661,122,391 *442F7E84255E383B43D9E175CF59CA074758806E WILFREDO.RUNELS
661,122,392 *4427989E709CC2747AC943D23CBC9352E82AF8D3 THEMEOFRENA(MUSICBOX)
661,122,393 *442A0E3835F1734B28568FF803B2290EC4C9A6F8 WILLY.KREISCHER
661,122,394 *442F9E61A4877AE8A8E3F1EC7F94EC6AA832B668 WINDENA.DHEN.ZARAGOZA
661,122,395 *4427514AB38FC045E825EFE8DEF1FEF9D0C37184 THESCOTSMARCHE
661,122,396 *4422B0201AA5E59A6C7D21195D74E391A62D5872 [email protected]
661,122,397 *4423D53850D138DCFDC4B1B1D51CE33F001DC460 WWWEDUCATIONABROADNETWORKORG
661,122,398 *442ECB023DCC1805FC583AE559CAE82E0F48FF44 [email protected]
661,122,399 *442671BFF3FD46A82971B8663D65E6E376644E0F XHERNANDEZ5
661,122,400 *442AFAA462DA43E6C7A9D0AC1F4CA4219810B6B4 [email protected]
661,122,401 *442ED01CB15113FF512CC055137AE34D3AB210F9 [email protected]
661,122,402 *44253669FDDE385601435DF8AA70E71ED6A85041 XUEKATSUMI
661,122,403 *44201EFA84C2D16843AC06EB0534F9AB2C057ABF X:X|
661,122,404 *4428048DC789E9569477647354D99157DCE82D6E XXXITH
661,122,405 *442D46A909A99408E0791088F43F005174A473CA [email protected]
661,122,406 *442BF79530CD1353ACF983A114D34A5454A66CAA YANIE-RYAN
661,122,407 *4421A7180C8A18EF92B480A161810A7E838F4893 yankeesjanuary
661,122,408 *442A29AEC987840C453D58DBAE8A5ADA5A0413D2 YENOOLRM
661,122,409 *4425F000B3CA8AE92A9E3EB6B31D735D75385458 YG4
661,122,410 *4428DE4809A8F837AF7184E7C30D8DCD64F35861 TOBIAS433
661,122,411 *4428FBE79367DB85AD2188A4B6BFE5F2623E9232 YINKAEMMANPETER
661,122,412 *4429D4DF47B0CF2851011C6AAF0276193E73F9D7 tom-houlahan
661,122,413 *4426EB6968A14DFCCF4449FE69749AC0C751A3C7 [email protected]
661,122,414 *442A72EEA329D35530AAAFA010530B2A535021DA YOSIKARIAC
661,122,415 *442A968AEE8936263AED49BB03257D05E37DF898 YSUYENBAEZ
661,122,416 *442668094200A3F164142727A1FC96FB85DDC403 YUDISHMOHUR
661,122,417 *442599517CA6E65727A9F51550530438EFFF6F14 TotheWesternWind
661,122,418 *4420B58C0CDCB9408BC1082F880CFF8999C47194 ZACHERYMASINI
661,122,419 *442662F837E3C7DE124CC868FEE05BE84DBFB305 ZACH LUNDER
661,122,420 *4424EA86261FF6165B36C88B83831E53722D4BD7 TRAVISINATUBE
661,122,421 *442C7F969909341824E776D84E17B9DFA5ABB58F trenthal
661,122,422 *442F2AA47C1947A35CD4D0B685469AA88FA1AA4E TRINIDADQUAST
661,122,423 *442F6F7243DFC515B4CD9F127DAEA3BDCA84E9CB [email protected]
661,122,424 *4428EC4C450E274086E2F3AE23A41739E20E3379 TRLETNPLATTNTE
661,122,425 *442F8444C81DA35F77A0CD07D5ABA67338CF427C ZLNZQAMING
661,122,426 *442460FE6D6519927D85B8123F3DE46928390BF3 tuanokonski
661,122,427 *442EFD9E40BA66ADD4538367A96BB56610EA9D07 [email protected]
661,122,428 *4427C12A01085853AD35FEDDB1872272F49789EB tudiers3
661,122,429 *442E3F246A563AD718D4C4AB57B89144B8042B9B TYLIE-NICHELLE-DAVIS
661,122,430 *4426BDEF1ECF644756D3C3D65FFE3AD63490A694 TYORAFFI.AGUS
661,122,431 *442FD466E582FACB4E0FF82A156C22294B0EB062 ВЫПАРЛО
661,122,432 *4427EF91F10AA346C76997C8537592ABA6DA8BC6 TYSONDECARLO
661,122,433 *4422693B3229011C47C2DA4575C61ACEA1F22F79 КАНТРЕЛОМ
661,122,434 *442A086BF98624BDBB503783194A7A4C96F92DE3 UD-DJOGJA
661,122,435 *4420BB0AC18250124CF6863005994FD7A162798E НЬЯТРИ
661,122,436 *4420C2160ED75F0056B1FAABC1AE66955499A3C5 сонорський
661,122,437 *44269B136D11C4F0AEF49BC07B30197B816BE820 ФЛЮГЦОЙГВЕРКЕ
661,122,438 *4421BF6EB6C026E43924DDDC767C72F68A13DA6A [email protected]
661,122,439 *4423A8901CA56A36AF5946C8CC0B557E100B8220 UNWRAP
661,122,440 *442A90FF804849E883F45D77449E8BF3A044095F URVI BATAVIA
661,122,441 *442D50D8E26DD9C838026CD0A334864D87A35B86 USERSEBANTI
661,122,442 *4427A424F86A7603F46BBED68DA9B2A907EDAB7B USIC.
661,122,443 *442BCA522803D91E86C291C54AD673027ABA0949 USOTSUKI
661,122,444 *4420118D4DE613755FBAAFDD36D9B738064A102E UVONDA-JONES
661,122,445 *4427D14819E23C538AB75BC3195871B01989A245 バルディビア(VALDIVIA)
661,122,446 *4428E34B82CA138B610F81CF841CA1512F5DC4EB vernonkoenning
661,122,447 *4426E72AEEDAC39F941542052FFB9CAE0480971D VERRÜCKTESTER
661,122,448 *44282370C86237410B80BF2ACAC213E80705D764 VICKI.HEARD.HAYDEN
661,122,449 *4422B5088D46290134D893D90FC778641F12F936 VICTORCOWLING
661,122,450 *442E08A46DAFAA4BBD812D1BBB9685B306E3BEB0 VICTORKENDREW
661,122,451 *4426A77CD6D60F96E64BEA34298E705C933E72D0 VINCY SEBASTIAN
661,122,452 *442BB605AC5E40D2CC92C15B6E1D042D07F8D050 VIOLETPOOKIE
661,122,453 *4428D1A6CDA76E9F5FBFD2C2A76855B7A192B197 VOXELSESES
661,122,454 *442DA1CD3AB5702DA2C517391C0BD6D057DDFCF3 WAJAHATMUMTAZ
661,122,455 *442F3D01350BF532012B816883BDFD8B4D21B712 [email protected]
661,122,456 *4428B633AA9D64064BFB4756D84A9EC2042D9626 wanita.sugerak
661,122,457 *4420B15628814F20FDEF573FF6C8118470302BCC WAREZWEEZER
661,122,458 *4422D882E3241FAB4AD4CBADA443DFA9C381810F [email protected]
661,122,459 *442E86AF231A9A8DC27E31EDACD4F323738716F4 WERNER.CABAN
661,122,460 *4422ED8B231AB5C1ED9BDE21F39A6EFED8E85F63 WESLEYKOVACIC
661,122,461 *442F949AC6AB8D9F0E3E41CBC8070127C4E941E8 wesshackelford
661,122,462 *4429B2DCDBFDE603BDBC5BC3A0BC38CF552F2731 whatyoudon'tknow(ineffectmix)
661,122,463 *44286BF02E9AC4D6417227525D487318214E654A WHISKEY-CAN-CAN
661,122,464 *4423517FDB3B5C4CE7736424E429FEA97BC0EEB6 WILBURNLITTLER
661,122,465 *442DCDFDCCA02059F076E671133282E802EBADCD wileyaltmann
661,122,466 *442308D6ED6C90A28F14404E63EE13436055E038 wileyromanek
661,122,467 *442B31CE45E01F07303B044C077B337FD6A791DC WILLIAM-SPRY
661,122,468 *44218313334185EA67404A7B652C2481E7D9BFB9 WILLIETURNE
661,122,469 *4421619E3B83FB9808E25F4FFB6A0A28DBCB58F0 wilsonclewell
661,122,470 *442958A5AD6D1E08BA5E078C0250FDE3456053E4 WILSONJAYCOLLIN
661,122,471 *44250F8DECC1930A28868A66B1FEA86CBC303935 [email protected]
661,122,472 *4425DC6A0095589735BCE589F1371E3D646D48E9 wmstana
661,122,473 *442EC0669CED4ADDFC5BE88DB17150E665268951 [email protected]
661,122,474 *4422100A44C46E3FE1DB85D3FE22AFC6F473F79B 0CH4B
661,122,475 *442FDC252C3161F6B5513B9EF22EA43240AB1B2F WREHTON2
661,122,476 *442D9468BD6AF6CBF56E75790851FE91BA5713B1 0MBR314M
661,122,477 *44206833E7B30A055F744896D6A0065D4B36B39B (-_0)O~<==Q
661,122,478 *4424125548A04D0234AC41364A412F3A3416A217 [email protected]
661,122,479 *442FAFF8C0E90D97FE8F3E6F0B41419D0A8E28EB 1016847 SOLL.DER.PLATZ.EINGEZAEUNT.WERDEN.?
661,122,480 *4423260A60CB4F180AFF8CA2DD5C2FC6309E8EE6 10 ZORLAYABILIR
661,122,481 *4428E7DC90CDBDCEF64A7C43BA1EDD5F98519F6D WWW.SKELYRATA.COM
661,122,482 *442CEFB5278D887A08354D5564C8CC0E8FF1F155 11.AAVISTAMATTA
661,122,483 *4427D6177332B2A945C30CDE2B2E3B844AF3E73C WWW.ZOAR.COM
661,122,484 *4423B35925BD949F7FA2BCA0978CF842FABF70C4 11-regelungskompetenz
661,122,485 *44262B6628681B42F802E8962A53351191C6A342 (X)~`~`DP
661,122,486 *442F8FBD759DA4A2BBF61BDEE90996A9E80C706C [email protected]
661,122,487 *442DFB3921FB01767C59481E3B81640239A6E506 1725407 atleastninepeoplediedintheprotests.
661,122,488 *442081194BFD1A9DB4FEA1E5C7663F12592C39C4 XP150.
661,122,489 *442F73028065A5F743F83F61612DADFFB3EAA3A3 1742918 toisessa-vaakakupissa-painaa-sitten-tietosuojalains
661,122,490 *4420762D784536C6601CA03FB3D09C5AA4534F3A 1750557 ALMA 46:17 JA TAPAHTUI , ETT
661,122,491 *442BD54011AE3C6F2900F87FA501AC69A720978A }X{~~~q====q
661,122,492 *44246F165892EC5DAE38B0836122B12B6ADC41A8 [email protected]
661,122,493 *4429E397F24C5B1829D27C47F97E575BBF3715EA 1930584 MUOVIURA PANOSTAA TUTKIMUKSEN K
661,122,494 *4424D2310F3DD5EDD1D0A752767D96FDD90BF4DF [email protected]
661,122,495 *442130A2C38EE401622259EB1C84061F40514169 1-ALAPAULA
661,122,496 *4421B283C2D675317EF010DCF4C7D04A410CCE94 1-ARVOUNIVERSUMIA
661,122,497 *442983E7674B2B39DBEDDF5A8E5769A2ECB5E446 1 ASEMASSAHAN
661,122,498 *442E8D971241B6D5921FED6CD150F248330E453F 1.ASIATISCH-NIEDERLAENDISCHEN
661,122,499 *44212FF271994505042111DA8D9870DD213C0F80 YASHIRA-ORTIZ
661,122,500 *442777D6A831B6716F38267ABA447D161AA891A2 yidvyîav
661,122,501 *4428EADC013DB3936B02D293017E4CD22ADE597B 1-directors-far
661,122,502 *4420F65BB08C1D3C7AC2305A91D3C1C95ABF8088 1DLIMREVO
661,122,503 *442ACE3421EE37C841BD023527785C1EA91584E7 1DOKAK
661,122,504 *442EF15C78DCC9FC0CFC1D1B0A706EE7B0D67BAB ykpocf8j99xgyqf
661,122,505 *442A9F80647C0D58200AB26B8930CFD4E1CC9165 1HOELLENGRUBE
661,122,506 *4420480F0A30A20862B9C2F7D3524A2CC65D74D5 YONGLEESMANN
661,122,507 *442AB2C0A5A4A5D31A1FEA94D2BF040860F54A7D 1.ISS-CREWS
661,122,508 *442CD2C2C4862DD0FD0FECC729F4F2507147C0B9 1JOCKL
661,122,509 *4422D028F3AE2A32AF36EB6CCE0CEAE285118CF5 YOUNGSCORPION4
661,122,510 *44276217F83A9DE3AD03AF44748BEAEC0FE79A8F [email protected]
661,122,511 *4425759988E31039343A562D6F911B459D1EE45E YOVISERRANO
661,122,512 *4422B5ABDD8C60D40D2C1330D7B98B6CD04E9EF8 1KORRESPONDENZTHEORIE
661,122,513 *44271E8A88C481BA5F2D9FB446525EEA790523CC [email protected]
661,122,514 *44230655301035D63C4C9A4DC98669DFA9FE744B 1miksodemde
661,122,515 *44297C95EACB2588EBB7D4D967799186842ACD78 YVETTE KURTZ PASKEY
661,122,516 *44268F99ECDAF18E408F20A257285988E7734293 ZACHARIAH547
661,122,517 *442DB765BFDD4DB16484B641E2D0211A6F4A25C0 ZANDILE MAVIKELA
661,122,518 *44208F38B4388FE7CD340CAA189FD8FB59B7760B 1RAMIEST
661,122,519 *442ECEE099060082E4D9F7ED509E94F6E0F517C7 ze(
661,122,520 *44281D6B9536C189353D40C5EAA6BD52C3E90365 1 seiv
661,122,521 *442B61318992D33A0348C7A6FAA029208E3C93F1 1suuoritettavaa
661,122,522 *4421B4E61B198E080EE5030327B243548DE6B7B3 1.TSV-GESCHAEFTSFUEHRER
661,122,523 *4425B68AB8093967F8236625B3D08D8BEDBA95A3 1-utility-produced
661,122,524 *44250DCB2D276E84261D7585FA7359D228AE2DBB 1-vernichtungslageruniversums
661,122,525 *44268D6F3E132C499CD94112075F4148B7C9CFB4 zildjian.austin.baniten
661,122,526 *44289ED13F18EE9D4A5565C4824093057C1F0F0F 2084688 it also condemned violence by the rebels
661,122,527 *44206BB0DA1F0231F1D9C48E6729ED9E08379A1E zouaida3
661,122,528 *442856F184E0E4548496F125ED4EC15BA2B42546 ``212LOUISE212``
661,122,529 *4424034660A907C10DAC8126BB790801F3A4C07F ZUFFOLIAS
661,122,530 *442F635096295A87A6225AB8EE02356C49CD611A 23aug1655
661,122,531 *442D8F46ECB8166F8835E9C3CB8CC0EAD6E68910 272KAILEE
661,122,532 *442839A6868ED4D504CD8579749DE23F67DB8004 28rdp
661,122,533 *44224E32681EB4C1B6FA69FB08ACAF2326819423 ЛИЗАВЕТСЬКЕ
661,122,534 *4429987D493C5F95AA8DB2DD2C67BB29F468D89A 2.contractthat's
661,122,535 *442EC1DC070DCDFC90ED4048093BCE0063B5D807 «ПОЛИДОРЕ»
661,122,536 *442577FB50898EE5EB60C2E740D9A556CA5BC2A2 2erikoiskokeelta
661,122,537 *442BB30B8CA4C96C4F03185942B6C19DA015DECD 2ERWERBSBERECHTIGUNG
661,122,538 *442B2083CF312564E03C0CFB2A3DA591C7228A9D 2-fuarImIzIn
661,122,539 *44216442344516D6E0351539A3720FE66AF3E866 2.kilpailup
661,122,540 *4429D21EA9AE6A7689976EE39586750B54D78EF3 2 PERUSVARUSTUKSELLA
661,122,541 *4425D1FB282036FCA9D8C6717C4FEF15F6B64FCB 364375 c03-28ock-.--11Sub-.
661,122,542 *44264C64F53D984F8113D4F1DD790BA47DC79689 3dgojoas
661,122,543 *442C33B305EEE823101C304B1B52B2485CB3F3C7 3.DISKRIMINIERUNGSFREI
661,122,544 *442903E17582C7F162BA7B9F997766108A9031B2 3FF3C+UALLY
661,122,545 *4425C01088D1B31905EDD56165FF3D3554C0B958 3geisteskinder
661,122,546 *442015A47F7BC8CD6642BF491DB3EA5BE0BA0A46 3MARACAIBO
661,122,547 *442379DD7F4121F9D09AE627D62E666AF5904EAA 3MYVIKING3
661,122,548 *442788F9ED66FBB926951C2C19481472A2A6A7A9 3.uutiskuviin
661,122,549 *4420D7DD57DEF62A0BC9A0D1791D1063B6F16EE2 41-VIROLAISILLE
661,122,550 *44265BD49FCB535C753BFBA0E01BFC055871E990 421381 LET.US.PREY.ON.HELVETILLISEN.ALAVIREINEN.,.SYNKK
661,122,551 *442664A113DAE7B0CA5C8A6945FF945B06ABDCB4 421TFM:DL
661,122,552 *442379069055524AB2A58A3BE8160D562F9AB138 4910E70B218237A0BF9C624F02E5042C
661,122,553 *4426281F01EABC8ADA3CB0F21A80C038B33C0046 4ILOVELAMER
661,122,554 *4423F99CDAEDC6D60147414DC533B5D89A75BFE7 4PIADYANA
661,122,555 *4429874ACD3803D2BB729BECD9D8BEA15312782F 格式的同一張相片。由於GIF格式只支援最多256種顏色的
661,122,556 *4424BC282F7DD84AA7F53478B83E4840F47BB17F 53suuruisella
661,122,557 *442A5F1DD811A1C83D8052C7BCF670329C63AD31 557843 tam2000'liyIllarabaSlarkenalInmISbirhediye
661,122,558 *442752250E9125DB4708EB6CF608239CD9D0322E 5BSWIRKCILIKBSW
661,122,559 *4428E8B7751C562A0584A7AEBF0CE510FC88AEEA 5FIXEDSTATE
661,122,560 *44268CE6C2D475B10E3FE2E817C4D1E3F1B81003 5GERODETE
661,122,561 *4429CFB4D3E2B1F60366483B03DA3E2F9434C46B 5inoculeront
661,122,562 *442386D2BC377F518C89EE3ADF5B60EE59C3039B 5ONDANKONDANK
661,122,563 *4421DCBABBDB8222C5E2371156FD4832E631EA46 0CH4B
661,122,564 *442E3B58AB013C50D9716CC60AB0DF0A40DB4BF3 5PLAIREERIALP
661,122,565 *4427739F420E41932138533C9D7E87F7B05F1FA9 0VERGENERA1IZA+I0N
661,122,566 *442974E2D0BB1A71442E5B22A54AB74BF48253D9 1016847 SOLL.DER.PLATZ.EINGEZAEUNT.WERDEN.?
661,122,567 *4423685CBBD40E0AAA4406A5A3E764989016D3EE 63 KYVYIST
661,122,568 *44297DC0294CE729B16DE250E519B06AE7F4D6AF 1725407 atleastninepeoplediedintheprotests.
661,122,569 *4426B6CB35055082D3002F095BB398D632C4C3BC 6GUAISDIUM
661,122,570 *44282D2986F5FE45A270B405ABCCE820F55AD4F7 6GUIDASSERO
661,122,571 *442F2ED47A9DCEBEBA05D046D9AB19A19A19DEF6 6MOCLIAMTOHRENSLABNEDEWS
661,122,572 *44269196C119E22CF592F586B3FD432D057DD429 1HOELLENGRUBE
661,122,573 *4429052AAEBB5D855F9DFCD4A6834A1B3C6642CD 1.ISS-CREWS
661,122,574 *442163A6D0E3D352D2341C54435ED450ACE3C491 [email protected]
661,122,575 *442E4CBD89415099BE3C942A273B7F890700A065 6RIBARBE
661,122,576 *442D8705E051D11E6F256A4ABAD248C7835C82A5 1KORRESPONDENZTHEORIE
661,122,577 *442D9743C4E2546FEA3610723D4AF2D2F1A0AC18 1saklaniyorsunuz
661,122,578 *442BBEDCD8B083779CAAA9043C73B3A9A8EC0C6A 1suuoritettavaa
661,122,579 *4428489C764997608F04073AB0694A2C7686617C 7BOSS
661,122,580 *442B397BAD151C9F01617607BF6C256DAC1A39FA 7BSWBRAITLINGE
661,122,581 *4426993B954FD8FA5341F66F711B570930A0C8C7 1.TSV-GESCHAEFTSFUEHRER
661,122,582 *44219C4A8C2F665B13730D325980F7AE5088BA10 2363616 JUOKSUNKULUSTA.RIIPPUEN.MY
661,122,583 *442FB009D677B67D3213D92EE4920539A63EED9E 7iamfuckyou17
661,122,584 *44260362D5E5BD268ADE7C73258255236CAD6409 2660072 osaaminen-koulutuksesta-ty
661,122,585 *442154CC11D1843F5B66ECB46C71EA934B19A532 28rdp
661,122,586 *4423422C6C348FF904F171C88ADC84BD29F9AD1B 2erikoiskokeelta
661,122,587 *4427216C32EA08EAE9018121C270E2E28A03C346 2.kilpailup
661,122,588 *44206D1D37934873270837AFD808A5353AE8A1D4 8ADJOINS
661,122,589 *442FB589D729B2572BCF75FAB5B1E0C91F560501 8CD509C0
661,122,590 *44207700314887ACD4995B2FDB74A1C7FD81BFD5 364375 c03-28ock-.--11Sub-.
661,122,591 *4425C42EBF92F4C73ED855EAA50CDE4F8459560E 8DEPRECIERAS
661,122,592 *44241B86FF898509D4023B04DA3185FB196BA447 3-spinzar
661,122,593 *442685076A96BC5832F72E4914D57FEFC94E65E9 4ILOVELAMER
661,122,594 *442BB4829B8946231C7605C3F62604BC4F5EED63 4ORSIAMEN
661,122,595 *4426A0D9E89FD4624FE93047FC03D493FC72F533 9NAAMIORU
661,122,596 *4425D251D0BB04D8A6D9816BC699C368BCA1AFEF 9NARGINED
661,122,597 *442B6970D07FC1646330DBE2BA6BE1419F3539E6 5NOTIONALISTS
661,122,598 *44230D98D1EFAB9D7F43C95BCAA298BE9BECCE18 5PIERCEJOANNA
661,122,599 *4421C5AF288C13A03DCDDB21B95CC8E3460E721F A2H?;
661,122,600 *442ACF9F38E55DF2D6C1CC119847451DFFA12386 ABRAMMOURER
661,122,601 *442F5BA3A03D779D5DE3186AEE1EE62351CF0105 9SUPERCAPABILITY
661,122,602 *44239AE963856E9B521D59B9C21088BA22F1A3F0 ABRAMDUGUAY
661,122,603 *4421BC3C867FE352C513530502E89A2D3A61FE7F aigsn
661,122,604 *44280827C6823D69BB6F14BF936144074F61FF48 AINPW
661,122,605 *442C7234C3D09B54E679E05A37DE8E37F4958DC7 [email protected]
661,122,606 *442AFD37169EE475BF3B30BB30894A90AAEE9C1B ALFLAWLER
661,122,607 *442773A373500C8C9C46F67B60399255FED4F523 alienez8
661,122,608 *44248850DA0B911291C5FD2886D1581545872CEB al.mictl
661,122,609 *442A890B6D3EADC05843C9278BFDFADFF21F9839 [email protected]
661,122,610 *4424DEA7FC48657192C329BE553947D0629C87E1 ANALYNEC
661,122,611 *442C77548FCDAB56BF83984972954A9B7EBD05DF andersonstancil
661,122,612 *44290CF0F8D0840C42213D1429A5CC03FB12DBF7 ANDESFLORY
661,122,613 *44296FD66F2538A895064973800F24FDA9EDA567 ANDREJ PREGELJ
661,122,614 *442B14B4D543DC02411D1416CA8DAD1F531629F0 angela-bruni
661,122,615 *442C5C7448C6EF2DE824EE088A2FE3B111326080 annehmuug
661,122,616 *442176F41C9002423BFBFA115286FAEA41A8A143 annie-rayburn
661,122,617 *4420CBC2C1B281BA5731CE8DAEC119AAB872CA98 antoniorison
661,122,618 *44299EA829D8CC61CCF22C77F3D569174D89731B antonybloodsworth
661,122,619 *442F96C207878397BAF9976DB2F3192A7EE8D165 [email protected]
661,122,620 *44281E6769F99109EF139AEEDE581CB7BC475B3F apanerei9
661,122,621 *4421D53FCF16D41827AE798531A5364A941B0015 aptksest2
661,122,622 *44263E2E61668588A45DAEB9B32FE3A4EBEF5297 ar,67
661,122,623 *442BA16DE9B28C3644A7EC1DEDFED1276AC9A52A ARAGOGIC9
661,122,624 *442EEC5B5878F7CD3B849BB9CC49D723A61F6031 ARONHETLAND
661,122,625 *4426932BA9225BAE714DB9C5D89E1BD6AB5E7450 ARTHURKRAINBUCHER
661,122,626 *442373DA83BB4355C8341ABDE40C835DD80D058D ASAKELTER
661,122,627 *4422A44594CF981D41ABBBC86BE3F9A519A19894 attraktionsgesetzes
661,122,628 *442327EECF9E6EE590EF21EE485EE04EFC5C5123 AUGUSTBOHNET
661,122,629 *442136097698A12B8A1E56D16746960810E2834C AVLEGSE2
661,122,630 *442F989553D286945D1CCFB2DBF33292E889BF37 [email protected]
661,122,631 *442EA04297B326E229D9B8DFBED57A8E651DD98F b04"+
661,122,632 *442FCFB700FA07BAD1711DCC23F6E116106CAB89 b.$62
661,122,633 *4429E4B6E8A7AA9CB2D02B40F83034CE65E58EE2 BAGGETTHISTORY.COM
661,122,634 *442F781DB2785022A203DDF260DD567CF53FCA65 [email protected]
661,122,635 *4428C9112927A9043D8F384455FAAA2F6F9FAD69 [email protected]
661,122,636 *4422CA943A5AF6945A05092FB321CBC7E9158A54 BASILCHIP9
661,122,637 *442CC66D812E4ECACA7463FB9ED15ED89DB95961 BASILLICKLITER
661,122,638 *442F8332A5624747B8B23995929BA2F738F46295 BASTARD ..................MY.LORD,.I.RESCUED.HER;
661,122,639 *44261E2761D50619A2117E8AFE4B08287F0134DD [email protected]
661,122,640 *44267CB2AE7ECE0CBA4CA985597EC1506D5EBC47 B======D~.`(~_^)
661,122,641 *442820241A0B4EF3E0AEB30C3E66E857C3D33E72 b#####d~ ` (o_)
661,122,642 *442C94A99ABA731F568125F199081EE64747911C Bennett-'b/E/n/I/t
661,122,643 *442E6CC679C4B5C7A9D391A14AD9B8E47B4562B0 BENNETTJOMA
661,122,644 *4423C0B13D166CF987A54B064F760FBAA549ACC5 BERRY.MUHR
661,122,645 *442B227D36CE1660F001C10617BD8A0DA1099942 BERTRAMURWIN
661,122,646 *4421666DF1747E96675769334D3A9A1809699381 BEZAS TERUEL
661,122,647 *4428459DA697F4F5CC375A68630F7D25CFCDCD36 [email protected]
661,122,648 *44288245B413DA3FF99ECE567CBDDDA8793823F0 [email protected]
661,122,649 *442F22E2FE3D48077030FA4316AE9DE10D1B183B BLACK COFFEE & WHITE BREAD ("HITORI" JAM SESSION MIX)
661,122,650 *4421966ADA16CF45C7C475E030C634EF347E387C BOMBAYPALACENYC.COMWWW
661,122,651 *44265ACEF8255D2EF92CF8B4D9FAEA549ACF5744 boyceostaba
661,122,652 *44244284A5AC770F784FA1A2881A547729F634DE B===P.~(>_<)
661,122,653 *442E27607223B130341A1E4282EF7F70C8A99328 BRADLEYCLABORN
661,122,654 *442D7CF3FCE361EDC28512F124018164A7546A58 BRAINSTANA
661,122,655 *4421C4EC48AD59E01D89FBAF29EB062E329A2EBF brandi.johansen
661,122,656 *4428E3638290398B50AE3D5B3C8CE11179577CC0 Brand.New.One.#2
661,122,657 *44225B85838C35FBB09188DBAD3DBCCC6544AE38 [email protected]
661,122,658 *44296650F1795B4F0296292BFD264F512D0DA18C BRANT.BIRKLINE
661,122,659 *442BD0501C6F6922CA89EF4F82936497DA4B9DB2 brett-see
661,122,660 *44241B1552B81AD9559FF50F870B9D080AAE68E0 bruceserb
661,122,661 *442A70B86C0A875288A2C31AD8D790D8EC069752 BUILT.....
661,122,662 *4427EB966E58E7848BDD3C13FA408A3C9570074E businessd8
661,122,663 *442F74AB4BD0EAC040FAE3E0A6FE1A018EA043ED BUSTERTYO
661,122,664 *44219D7D0E199AC5B7C6A97253656AEFA79C2A7E [email protected]
661,122,665 *44200B0082200795757D76136DAE95C65AFC83EC c0bjz
661,122,666 *442DA325107BDF2DBD4A73D8F38ADB8699360FB0 CALCIFICARLHE
661,122,667 *442B7702D35BC6253284BB487C220498A561722F calebseydel
661,122,668 *442D60F0480933677845EDB2F8B750525805C48D CANASTAFEVER
661,122,669 *442411447E9A1C8E8C79F24BF89A1246B8D81F63 CEMETERY'[email protected]
661,122,670 *4429CA1D5194206BF5B17B7F01878E92DF210669 cggiwpm
661,122,671 *442E87BFE4909F381B28E3C6F41CE8BB20770D98 [email protected]
661,122,672 *442D656804728DC4AB2CB0143CA189283C1386E3 CHEERS.JONASHART
661,122,673 *4422001C63B87D2473FA99F44AB947657592D688 [email protected]
661,122,674 *4426E79431CF20B3003AD7BDD830400874C7B310 CHIU37
661,122,675 *4428F0323E3D855C7CBF2C22111F4F2F08FC399C chris-jacobo
661,122,676 *4424069A5EE67A5AC0DA35AFAE70056B16D8CE4E CHRIS.WOFFINDEN
661,122,677 *44266C797E750528D8C0C0EEF44E361113326781 chuckwag5
661,122,678 *442FCE365EDAB4C513C07170C7F94B9ED67031E3 CHUNG.ELIEZRIE
661,122,679 *4429EBD5E4BD5D3854FE42398BEDB475297C58C9 [email protected]
661,122,680 *442228A0C2EB28DEB42018CCF7F28A108F97412A CHYNTAA
661,122,681 *44277C1AE548559D32F88B90CED89DC7615A6DC1 C/J2W
661,122,682 *442D8CE38DDE45662970617E2B9A9AD113AA1A5D CLAIRWINTERBERG
661,122,683 *442FF2F22413FEDAD29F5E76E81899732D290ACD CLAUDE.KLUEVER
661,122,684 *442E3616EA049FE025A5649E6D3151B730401C8D CLEMENT.DICAPUA
661,122,685 *4421BFFB8E64EFB9E19087A6450A478B66B19BD0 [email protected]
661,122,686 *4429D5257E3977460B1B2C8BB83DC51E7DF11787 cnltnrwahn
661,122,687 *4421733D317787FCA6A3FC09BE8843533DCB7E1E colenishina
661,122,688 *442B742BFF151F931422C40658C667306F2F6126 collinmenzies
661,122,689 *4423C4B4F4DF570E55B143FD094F9A63C3598395 coltonbrandman
661,122,690 *4422F07AE3785402F6AE37AF3BA5BE64A9EF3DAE C:\Program-Files\Common-Files\Adobe\Linguistics\4.0\Providers\Proximity\11.00\brt0402.lex
661,122,691 *4427FA55EE3D0013CD54CE096FA9B13F23C8EDA3 cy3+3
661,122,692 *442AD4DA9A30424B624DB9A442A21EBB3822F4D0 D127625138
661,122,693 *4421A70F93FE1145B53ACA06BD1B3711D2607377 [email protected]
661,122,694 *4423FDDFB994FDC3BE0D12503351BB2F073EF427 [email protected]
661,122,695 *442CF44C366597A4CD4535840E59F96755B3AA5C dantesolera
661,122,696 *44297662A31BF7F52DA31618CF59D3CEFC337C86 darelloram
661,122,697 *442D9D06694981A546BD768ECA0845EE0F19B502 darencoville
661,122,698 *442AEE7F5DDE26355D70CD6F08F9A039379E61DF DARIN.HOINES
661,122,699 *44298D7FA8BB4046767B946D81F91FBCEA6BB006 dariofarraj
661,122,700 *4421A1B55C362D4C63ACF1BC09DDF1D915957CAA DARRELLBOUQUET
661,122,701 *442398B2634731CBDDE95660E8D1B0911B31EC59 DARREN-PARNELL
661,122,702 *442659F01868916984EF87862DAD2CA8A6AE6487 dayoubbsw
661,122,703 *442C5EAB1160C6662A44292D00F569D91ADA5086 [email protected]
661,122,704 *442E6CA98C8E5B20341A629A1C13C9439848A966 DEANDRE.LISKA
661,122,705 *442936E6FA7BB53D01AB5363F87A2C16FF976594 deangeloblauch
661,122,706 *442521D0F8809B967B6777637D505412A671A2F0 DEE.BLAISDELL
661,122,707 *442AB95E907410540686568FF9E76009240B3934 DELROUTON
661,122,708 *442582CD1F74C47B4ED1E3156F35412FB6BF97D5 [email protected]
661,122,709 *442710B0D3C3A359EC457A076FD8F0EAFCE65288 dennyireton
661,122,710 *4427F9AB4A35EECAD68393CAC27AA578B8211BFB deshawnbelone
661,122,711 *44299B258B41D34E647144B0C5C105B76750E303 DESMONDPAGNI
661,122,712 *44268BF93E5B921213037735FD95E5037443F8D5 diegoblaum
661,122,713 *442551BDFAF0EB99B15CC3DA6E955C9B70FBD00E [email protected]
661,122,714 *4424DCEA7C40E9B4882BEA8385379E44A28F05C8 DIRSUBDIR
661,122,715 *44218E28729C3E8B6B6D11BB756F3873907FFC7D DISSERIALIO
661,122,716 *4426DE08A510414E5AED6EE7F6AC6EF3AF42BA52 DOMINGODEVALLE
661,122,717 *44225F615B9CDADAA14886DCDB0B62BEB0F7711C DONGFUXIANG
661,122,718 *4425EC45934D3F1ADF597266DE6E4A5AED15E527 donita-anderson
661,122,719 *442F7ABEF5A66F0D5320603692E26B31F331BB2A donnellbrug
661,122,720 *44267ADBB43D954C66CE6ECAD270AA421425AF33 DONNPERL
661,122,721 *442B3E96152B2943F2A6224A09709A69B2674F49 DONOVANSEBURG
661,122,722 *442ACB70928AFCF73081A6332FC7BE97FAF709D1 DOURLAIS
661,122,723 *442BA5A4D058D833EBC71BE0F45735909C678BD5 DOWNVEILWAIVEWITHHOLD
661,122,724 *442B147CCF366ABEC2ADE4DAE0456A339BB97AFB DUANE.KUSUMA
661,122,725 *442D39B76128D9969CF2713CCA16A58576FCFCEF DUCHOVENSKÝCH
661,122,726 *442E36656E8D987922F2CC8D43718BA9BF2BC3EA DWAYNESPEAKMAN
661,122,727 *4423520ABF47462286B10A323ECFA410127E9069 EANEEKSEE
661,122,728 *442356586BF83AD1FBBE2C901A72CA31445E9B4E ED.COLLIVER
661,122,729 *4425D5091BA92D91C73F7260EF4E7FDC5C1A5E35 EDMOND.DOEHRING
661,122,730 *442FA1A18E866A0939616E7F708C99E4B1FDACC8 EDMUNDSIEVE
661,122,731 *442764BA71B659F65DAE9EC84277A3AB191DD345 edwardstarring
661,122,732 *4427CC4523177F2C06AC306998A714896C8C14EF efrainscholin
661,122,733 *44261AC495CF83DA6035FEFB9487775CCFBBA268 eialocca9
661,122,734 *4421926C6F06FD28DE2D92C98D79CE10D88FB488 EINSTEIN-VIRTUELL.MP
661,122,735 *44214CA369FD7388D685411EBC5B3B3840518D1E EKKONITAĴOJ
661,122,736 *442A19F0A59E0AB5CF1103288ED8B8DBAF4ACFAB ELBETT
661,122,737 *44200C2A728B4A9D459A1A7D3B395DA128FFBEF4 eldonmatis
661,122,738 *442DB027E4009D792E476EF45AAB6E755DDB9689 ellco leasing corp | united states
661,122,739 *4426093E1FA310D6FAC3B1286E100C06068FC74E ELPARAMONI
661,122,740 *442FBDDFDC6D9F6FAE44BC64C25507416239380E ELVIN.SIMPELO
661,122,741 *4424B36AB75B2913A24EBC9B2437AFCDD87607BA ELVISDOMINICI
661,122,742 *4425E146F88DA6F046E4AED597C44FAECB78CCEE EMBLAZURE
661,122,743 *4426365CFADEB7041A83C28556B465254CA1E251 EMMANUEL.MALANADO
661,122,744 *44253960A0176EF14E8A019EC2CC3692E07673A6 EMOSLIREPS
661,122,745 *4427E3F547B7A2B8932D98FB2772A3A03BACED60 EN GELD
661,122,746 *4421C8FEA0F266BE4ED6F9F01EDE7569EA999F40 ERASMO.OLAN
661,122,747 *442BEC405D1567E62E2B65824C003B43B40EF790 eretierb1
661,122,748 *442C15A3D73B3941152D2E102F9281CD73A42D0A ER-KOMANDANTETALLERPLANTILLAHABLANTEANDAL
661,122,749 *44239FADC4B23B2D9D175556B7B6EA999B0631C0 ernestlobos
661,122,750 *4424130B1A6038C85B5B1356A0613B7567C6762E ernestobeyrer
661,122,751 *4429E4BC5262E15175E7CADD8C654CCDC89586FF ERÖFFENTEN
661,122,752 *442381D5A5DD0B9B8215F285AB63B8AFBF96B9F5 essenhistoralterbahnhof
661,122,753 *4422D8608946801A47C17582173BCAAEC844AD86 ETISWERDING
661,122,754 *44204CB597433DF6DF74760A5BBAE574EAB10A7B ETTERID6
661,122,755 *442E6ACD811B06FDDCC05725C20F13FBA1B0FE1C EUJINOJ
661,122,756 *4429B7BE77AA9906B3364E8197C540F7B6F5C47B EVELYN BISHOP
661,122,757 *442DB0E767F857E3B277F15199F01EDA7447F6C6 EYENGLIN
661,122,758 *44275660E8159A2BFCF4D465297A9B33BAC32A86 felixws
661,122,759 *442A883435683EA909A3868B75C4A473FFF933B0 FINITE5IMA1
661,122,760 *442C83E3D10856486D9E2E5BB91B4640B40F3EF8 florentinokuklenski
661,122,761 *4428E86C8EA16EEB5F3C0F4BCFF0FB1D664662C8 FORMATDWMASK
661,122,762 *44206F222F1126F8BA4A13CE60C09D733AAB55D5 forrestmollicone
661,122,763 *442CD76F0BF151E91D77D550D000A9C1FEDD84F2 FRANCISCO.LIVI
661,122,764 *442E3ADE5C67F5D6F5A1453F9A9C2EC7FE9DF310 FRITZKILTON
661,122,765 *44230F0A116CDF66351B2C072D8BC99465152A44 fritzskibbe
661,122,766 *44259C5801484DF18025B506EB0F9C7C24304415 FROY SANTOS
661,122,767 *442AD25788C497AD29F2E8517A79584E11D9B27F GARFIELD.SOBBA
661,122,768 *442C1EC40B6B619A8BA6EC58A2132E1C8843694E GARINIAN0
661,122,769 *4422358E7864ABE9D36E65D7B26CE97027ECD5C3 [email protected]
661,122,770 *442D52265B756B340B58D2148F77638C937A9F11 genarospier
661,122,771 *442D48DDDA3BFE3F5C0D3A294BA184B4085B19EC GENESSIA1
661,122,772 *442E54595A242B72236082D3585CF5C6F497DF44 GEWELFDSTED
661,122,773 *4424D4731B30D3DFBEAB838212B7B5373856EDC3 GINOKELMAN
661,122,774 *4429B8D59A55AB6A96D76CB1ADA4E7AE81412EFC GLEN.HENKE
661,122,775 *442AE8D7C10EDE700AAE80F350BABE107D714F0B GÖKBAKARS
661,122,776 *442D022DF768DF526C4AD00E920B69E796787A42 Go,-get-you-gone;-and-pray-be-careful-all,
661,122,777 *4427075AF176C07917DC7DA99DC5D69BD0F04C63 GRAMŮ
661,122,778 *442C704F02F01375487DDBA4592A064074D60BCA GUADALUPESIEGLER
661,122,779 *442A8A13E9B084191EEDDD768FB7D52B7ADB9163 groppbswed
661,122,780 *442455307BCE3E608157978E51C542104C17BEBD HALF-BURNT
661,122,781 *44209CA306301F233BD23696BF7437641C8DC2D8 HAI.VERT
661,122,782 *4426D9AFEA100E1E8A9F8F474999FBC1F906217B harlandboursiquot
661,122,783 *442B9780CD40A0A218D66E2688C96A83E31373B0 HARLAND.ZAWACKI
661,122,784 *4424F5173D48D5607C5BD2684754FC0081B8BDE4 HARRYSAGUN
661,122,785 *4426EEC11C811C457ED18F04EB725CA0B4A6EA6B harlandboursiquot
661,122,786 *4428D815FC1B0665A63B002C07D442D78162A54D HEILAGURH
661,122,787 *4425207D390375771493F18855B791ABE2246972 HEGELOVAC7
661,122,788 *442B15E2B70B85A84F0735A514C4A1247F23318F [email protected]
661,122,789 *442CB09CAD18030EA7F6FF4CEDF6CC5EC6C59C10 hotdog-soup
661,122,790 *44209F0B768D1B05E81165977B873FD244FE792B [email protected]
661,122,791 *4422734A4608D7AD3EA365A469116C59480054DA [email protected]
661,122,792 *4422C6C97B1AE91BD6B94B55224168EED874733C ILOVEHUNTER9
661,122,793 *4429ECC5A2948392C19C68572010B58730F4147F IMLASII1
661,122,794 *4428E6FF7128CA4D22B22B74199EE9273C9CDD3F INDIANELEPHANTS'PARTYMIX
661,122,795 *442E209C821185FBEE6833966CEFCB34F14EE71F ISIDRO.BAPTIES
661,122,796 *44217CB24C8CA58657889B7A00558E7CE1F2AE38 isidrowice
661,122,797 *4424E15F1D38CE11B9B30169322EE7C54FE6F4EC IVKGAA
661,122,798 *442BBA029EF7796B053AF991B86141F72E8564DC IVORY.NAKAOKA
661,122,799 *4425D16D13FB68B3C81150653697EA6E89922FE2 jaefrilling
661,122,800 *442AD5D89FD1DAE08FC308C5FDD5CD59C86FAC66 JAIMEFANTIN
661,122,801 *44264EFEE3B4A036195A9CA4E6FF0CF9EAABC23D JAMISONGONSALEZ
661,122,802 *4424F28382F27B18ED35A867BAE257817D8715A1 jasperverdin
661,122,803 *442972A9D519E685331D57FD993EDFE5F0FB07BF JEANNINEMARSHALL
661,122,804 *44250B3FE22A8B0228311CF2B92B09A677F4848D JEAN-POWER
661,122,805 *442BC3FA6B66FC65208EFFB3ADCD67E5E1CB58DE JERROLD.SPENST
661,122,806 *4425AC271802A660B346F130F4C6788289EF54AF jettatore-pelicula
661,122,807 *442022F4B74D98D7C75A87C07EAE314B9451C9EF JIM.MCPHILOMY
661,122,808 *442CD728827C4BA3CCE09FDE46069D1FAFBB9755 JLARYARET
661,122,809 *4425D3C5655B48AD415595A4BE741C2F90F0FE77 JOHANDIPONEGORO
661,122,810 *44222601D1B32D53AAE64BE826F47712DD92BE22 john.anthony.bernardo
661,122,811 *4421B40FBE52616C96CE1FCD3B602FAD246E8BB5 JOHNNEIHOFF
661,122,812 *4426044B1E9CB2D8882753801271E92F283960DA john.p.goetz
661,122,813 *4428CAD5FC360747E43B66186F58B8F94837963A JORDONGOLEMBIEWSKI
661,122,814 *442184C857102A11156E189F6CD61AD71C46480B jouret(2) jh er0 eh1 t
661,122,815 *442615FB44BB64B263C5DD81DE1AF88B4E16E636 judsonantinarelli
661,122,816 *4422232E21698857AD3D863B8A7EA97781AD1611 JUIJAA
661,122,817 *44269D63EB992625B25C130DFB0F63880C04CDB9 [email protected]
661,122,818 *4425E75883CC2F45388DE9F44BBD4195E7E210D9 julia.averyanova
661,122,819 *442AC25F8D512DC679FD164C03B2E99B1FBA4D41 JULIANPREAS
661,122,820 *4428378C39B9223ACEEF34A709F843A75650DF43 JUNIORJURIN
661,122,821 *4429C63454B88211AD059F102B51CF2C42594D5A junta.militar.griega.-
661,122,822 *442B96FAD6C708C6F1D8E8664BAC4C9E8CAE6069 kaldirilmasin
661,122,823 *44217948461B4578A239DBBB67B3E646C0C995DD [email protected]
661,122,824 *44237F6862CE9F21C4D3FF91C469C53113C3B3FD katie-melua-arr.-james-morgan-and-juliette-pochin
661,122,825 *442F9DD3DE1979C3FD145E810E71800D20E64D3C KEIJEI:LARCEN
661,122,826 *442B17F2530E8ADE7A677EB962AC4D56C4EB4CB9 KENETHMARSEK
661,122,827 *4425F311B1E9AE5667901FDC9BF8F2E6DED7B4C5 KEN.NARKIER
661,122,828 *44205F1C48CD8AC28901734D7E09F9990C015D2B KENTONSCIARRETTA
661,122,829 *442332A629D9DA1CD20D74EF6C4FFF0C9CCEB37D KIPCONTERAS
661,122,830 *442B991F382ECAB853DBFACAC1CB5B958B596821 KOMMT.MIT.GABEN...../.GR
661,122,831 *4423F7786FC5320D0D889ED47A191882B6F4E281 KOVAČIJI
661,122,832 *442473521ECC855117071A2B45DC385E4D55B594 KUARYOUTI
661,122,833 *44217BAFC1F9463D12E3E706D4E26FB2C597CE24 [email protected]
661,122,834 *44266ED640ABCF85A839D7189812FB9C3D7D0447 LAMBIOUS
661,122,835 *4425B2A0B0E1B5D3FC5DBF965981DE2DDF3771C9 LAMONT.KROMPEL
661,122,836 *442F93DBF284A3690363A327D15A3C490258881D LATOSHA-WILLIAMS
661,122,837 *4429587DF42C80E531B25028081A8AC2EC34E892 latourmerlemont's
661,122,838 *442A98B44DD37068F9A0FF8A8ADF17809D34CE81 LAUREN.LORA
661,122,839 *44271E5604AA36DDA0DFFC8B5FFACC5F8F3D588E LAURENMTY
661,122,840 *4425240D527D96A071CDC86C3BFAA2BBABBE1421 LEIGHBRONDER
661,122,841 *442F28C4E40639484C36F0B9A624CB2ECF2C9A7B [email protected]
661,122,842 *442C85BFDF0302C69DD0BAC1A95A7DA40DD3C150 LENARDEDES
661,122,843 *442E5905209860235D0FACFFC3EA7D65078FD8B9 l.en.famille
661,122,844 *442CE85DC37A4EED5E8C876740755B6B99C14359 LEO.DIBLASIO
661,122,845 *4426D49F6811F09A46BE1CD14EF3E8F8D0BC089A LEON.GREENLAND
661,122,846 *4420686548526E9190F14428EB92CCC5B377CFF9 LEVI.HEBNER
661,122,847 *4427C40D51BC04F92CE3B6828991D6EC8EF14424 [email protected]
661,122,848 *442E737EA8D1130DC210124C74187119634A32E4 [email protected]
661,122,849 *4422916EB299E14C3951972B13459F86C324157E LID3R4NC4
661,122,850 *442838D84C576A5BABBE749328868C2F8A8D77E8 LINDA-RUTKOWSKI
661,122,851 *44203C1063DA836A9EFDC03F2AE253067D978D7F [email protected]
661,122,852 *442A3857BFE8C4D8A7DB642B31ADA405FAC73BC9 LINDSAY.LOPEMAN
661,122,853 *44213B2C6B9DB093418805F60BCE264C3F6066B6 LINKSATTRIBUTIONS
661,122,854 *4425717427CDC1A8AA19C7DBD4EBD9D5F26E0D58 LINLIANCHU
661,122,855 *442953219F277495CB8A0537E441D3EE3B924E3E LINUX.FRAMEBUFFER
661,122,856 *4428DEA730DA736FC7746F84B9F52F940B27B722 LINWOODQUAMME
661,122,857 *4423D050D74F5EB4CBD5B6EDD1D98C7655BDF61F LINWOODSANTALOCI
661,122,858 *442CC28897F7EC16CF5931C33F7CEF4C8DF57BCC [email protected]
661,122,859 *4425425794DE526F49C66ABC98FA6EFF1DA1C9FD LISA-ANN-HOPKINS
661,122,860 *442DF52C6FE751087AEB9CA5B7468D7D79B7D15E LJPERNE7
661,122,861 *442ABFBD515705E25D9D3689793C803532A51F2C LONOFFERMAN
661,122,862 *442963D9AD8B15A0768001AB4F02C91706F1E2CB LOYDMIKOTA
661,122,863 *442E16CC3A4DEC263BDFDE5485D74E7BF0865683 [email protected]
661,122,864 *442B182F163146221E620407EE4D2860EA5375EA ludiumundFugeGmoll,BWV535:I.Pr
661,122,865 *442CEB8F08FC6EFD0CA0C3CB70A910A6DB46B79A LUTARJEM
661,122,866 *442804A5046E91ABD22FC30DB2F4D8527A999C8E MACCRUCE
661,122,867 *4420AFB863E342CC5D12F63DDE3A7A504CA874B2 MADSTOPCOM
661,122,868 *44255EECE8E6919290DD96CE67BE67EE4B549D49 [email protected]
661,122,869 *4421B4E919CACD81726F2366760A9BE34502551D [email protected]
661,122,870 *442DB706987E1E455F10848181BE46CF2132D096 maja.son
661,122,871 *442E874E7DC48173E55A64EFF5CDADDFED7A2889 MAKALIMBANG
661,122,872 *44256A6786D6BC5B56AB1BEBF12B1002D2F58327 MAN.PENHALL
661,122,873 *442663838F584E3DE6ADB13D82D7034DEACFE36F marcellusmyers
661,122,874 *442257AB2994FBEC5C679A09A5C29E4E9F7A4BB9 MARKRECA9
661,122,875 *442A424ABC5344E58BFC0F2914AD621663999B73 MARKUS.CITTADINO
661,122,876 *442E958E928E4497120B84462D693EB1232A7E21 MATTLEWANDOWSKY
661,122,877 *4420EDA8A873651B48C4B305781C3B5840EFC70D mattvosburg
661,122,878 *4425E67A7B39B8309E2E50D060424195896F00CC MAWUTC
661,122,879 *442E8F2DB27FD2EA9949F4F0F427892F615A9522 MBITERO
661,122,880 *4423A2E3D5933EA51D16D413742F4A8790E10A26 MEDCOLLAB
661,122,881 *442A6C1DD827F38F2F3E665A263447B87778D322 MERLEHAMN
661,122,882 *442DF342F9DA0DDEE71ED69314DE0EA6068458C7 mexer-(groovenatics-remix)
661,122,883 *44279BB0AFED0444B1396A72EFD581340E66A295 MICHAELJAMESSHEPHERD
661,122,884 *4426D47C2559CE61F9D6464F29073C255BB7D567 [email protected]
661,122,885 *442550608E17DA5C910038D7485D47DD35C45108 MINZEYARM
661,122,886 *44292F8E768F8834104BE66FE70B725E54FEC6DB mitchzeiler
661,122,887 *4424BC9C6038C1B96ECC67377922DDE44147F8DA MOHAMMAD.MUCKEL
661,122,888 *442A3B459DFFD16977173342EAADC92C483B5DA5 MOHAMMEDPARADISE
661,122,889 *4427E222BD3B50D953B92B57A68750C164FE63D3 [email protected]
661,122,890 *4429CC99BE1AEFB620479E42C3411CB3FACCEE87 MONTYBOARDWAY
661,122,891 *442EBA6315F6BB60B9C82726653D321EB67261D1 MORTON.JANZEN
661,122,892 *4424FE50583CC0FF8DF161ABC29CBE5E46473659 MOZGÁSBESZŰKÜLÉSEK
661,122,893 *442BF201D2626BE13AD18E4C4A510298B1BC448B NAPOLEON.LENEAU
661,122,894 *4426F4373E0704DBBFF9093C398F7FB86DCAB778 nathanaelfudacz
661,122,895 *4425E416A58B8B3A55E109A9A75F7589FEEE4033 NATHANIAL.CHEVEZ
661,122,896 *4425F6AF825275708A1D3EB8B94244AB6629BCC9 NATIONALCOALITIONORGWWW
661,122,897 *4423DC1828AD9E330752E5EBDC5456D97BE86FA3 NEUROPHY123
661,122,898 *4427E72D5C4656155C634373F8D853504D0A5FAD NEWOXFOR3
661,122,899 *442D7D100956F8A0005C5CBD2E9DA76BDB572E20 NIGEL.LEAMY
661,122,900 *44243D9FB67455925A0D5E135C2A597BCE3D9096 [email protected]
661,122,901 *442200D782385D0BFCC9C2F4543404E0BCCF33D7 [email protected]
661,122,902 *442BEF845AFC1331819E93A59E70E5B5729CB090 NORBERTO.BUSCH
661,122,903 *442858D6773E93CC5356F8E36BEE397E64EF3D5D NORBERTOSARKIN
661,122,904 *44295F8E6BCFE7916BFF4B5B9B927FBF6E2DF439 NORMANDSHUKER
661,122,905 *442F6067FC6920A7C045D147DF5654EE231274FA NOUSGREF
661,122,906 *442DA4A088D90365CC168D52B98173F4156A59F4 [email protected]
661,122,907 *442A6B28C1B97255B61E4D3AF75030C1709A6197 [email protected]
661,122,908 *4427C2A72EF890E1AF4CB950B6E96339483B3D3B OCTAVIOROBE
661,122,909 *442476ACF93A27253ADDC5FB709092668F60D305 ODELL.WRUBEL
661,122,910 *4423DEAA42AA5A0DE6F50C150D473A5A54A0783D ODISPURCELL
661,122,911 *442DA6E7B728AED55B080B53547F55E5AC680C6B oliverbertelle
661,122,912 *4420C069023A3F8847A4A07EC086176A7339DC12 omergrae
661,122,913 *442C0CCE21B3DF9AEEC84650021F019D9BE96FE0 o,.now.i.would.they.had.changed.voices.too
661,122,914 *442EA0A3558EA65D18F44D72A53415E04AE42B56 orvalhenslee
661,122,915 *4428B2AB41B115DCE638FA0DCB84C204D349EA42 osvaldostiles
661,122,916 *4429147E0682E934694281FEB5398F48683CA605 ottobrox
661,122,917 *4425F24C306D76424D5FA71C91F2C734DFF823B5 [email protected]
661,122,918 *4425A0EC3E48851E942C1DCF66E6D35481DB91E1 PASARIBUTUMPAK
661,122,919 *442CC36367728580333947463C08EB6E3A3B8A0F PATIN SOBRE RUEDAS TRADICIONAL
661,122,920 *4428B11EB2BC3FE234ACC9D8277FD9DDBC5D384B [email protected]
661,122,921 *442842BE122293379AB740BE9EEC1E08A6183E4B PETEGANCIO
661,122,922 *44237CD9A5734B5D95836CA93C515EC5C6F7ACBF PETER-GEORGE-DEAN
661,122,923 *4426839A7A3E949909C618A74858F01D8D6BEF66 PHIL.GOLDIE
661,122,924 *44292EE5EC9DDC3C794C19A7DBAA733D421EB41F philreidherd
661,122,925 *44279D089FB7923EECC4E36A828C10C60ACBE6D2 [email protected]
661,122,926 *442B1A0812996F204C644421DF3E3B20D3B637EC PINSCHER2009
661,122,927 *44247187693D925DDCA63E3956C2F70AE2EA2CAE pope&nbspday</a
661,122,928 *4428232C2724C9A589F3FBA8E06242D10A566B77 por.causa.do.ingresso.do.festival.matou.roqueira.de.15.anos
661,122,929 *4423B9C57F860A24612B9173F66D1F9BDFF45A2D [email protected]
661,122,930 *4420FAE754D112ADDE5D8A133524D304CA2A6C15 POU+7ING
661,122,931 *442CEC1735881876E5BAC4A901FF83974C78FDAB PRESTON.SAMUELL
661,122,932 *4421A1B032B356D5626ADCFAF9D6257987664454 PROXUMUSQU3
661,122,933 *44202AD3294F472BB3C521D4747E0C123E9957EC Q052196
661,122,934 *442818E61FC83E1B3FAC6F19E0A8C759F5F5774D Q=>***~0~O(-_0)
661,122,935 *44293D66014686974BA69AE3C9EF3548AC3F1227 [email protected]
661,122,936 *442DA18B61E7CDB4436AEDB6DCB54F0D74DA93AA [email protected],[email protected]
661,122,937 *442008F9CE3F39AD49266D5036FDA45473192E5F [email protected]
661,122,938 *4423DF84392DF33AD952A690939C5783CC0D5408 QUENTIN.CARUTH
661,122,939 *4421D8448B632972C7EDCF8E2F0FC5B65C640422 QUINTON.NEYACI
661,122,940 *442EE1686703DE8AD03069B45F580324A421C54F [email protected]
661,122,941 *44273988713A3DAC412BEB73E3877E35D6C9DE5D RAYMONLUNEMANN
661,122,942 *4428503F90643302FD799C2C1A5B3172F335C0A2 RCOLVEN
661,122,943 *4425524139B8ACC957467850EA4004A876DDF6D9 REALITYMICHELLE2
661,122,944 *442D267FB77BA7C14E6970D698C1F79CD0B93A1D REHCIERLHAZ2
661,122,945 *442DB2EC215E10B843388322813376EC739C8BD3 REMASUS
661,122,946 *4420EF7E353B73F7BA74939B79C9806684260FC6 REMATERIE'S
661,122,947 *4427A08C8866DC76BE089494C4AEED49B13C12E7 RESETURBANCONZWWW
661,122,948 *44246AF77A4EF77128C035E1516173B79EA0B9A6 RETARDACION6
661,122,949 *4425D547B32C301D3047AB03E776C7ABF7FAFF26 RIGOBERTOREGEL
661,122,950 *442F3ABDC12EBB29430254D1DBB05412C2C60BEC RITZENTHALER7
661,122,951 *442DF1BBED3ED4D3DE6EABE7E974AE9AAB639C00 RNTLXRGH1
661,122,952 *442975274F373B826E3BBEDD9B1003E54B89379F RODGER.ENSEY
661,122,953 *442C543E109979D1A2A1BFEA660300450810DFD4 RODNEY.LAMPSON
661,122,954 *44276D5F3D8D3C98CA5576F7E6080C5EB01D8FBE ROSESMADDOCK5
661,122,955 *44214742A5F72E24192DD443BC901B19B7575357 RUBINNICKLAS
661,122,956 *44209B37E3BD4860CB5E24B0E15EBF1A5DF6AA70 RUEBENLUCKMAN
661,122,957 *4427EE029EE6881EBBE00A5B6B756418DF1C079E RUHTRAHPETS
661,122,958 *442CD3D469F17C9607326691960BF5162C7AF26D RUSSIAPRUBLEDONATEDOSFJPG
661,122,959 *442F266E8202E33C1F690CC11A69B922DB830255 RUSTY.ORLANDO
661,122,960 *442AF39741D869AB3A41A3FF9A740B20464426F7 Saat.Samundar
661,122,961 *4424D3956896019235D759BB64706B72E1ECA9A3 saint firmin desbois
661,122,962 *44200F7AFD7E6B33BFA67FBD387D6F863AE3D583 samethoth
661,122,963 *4423A568B956D9654E9A0AB348EC28D9D695C7A4 SANMARTINDELVALLEDOR
661,122,964 *4426CB9EA7E75A0B5D7BDB47460A2A6661BD7535 [email protected]
661,122,965 *44212658FEB436EA83F5B95403F133148201C791 [email protected]
661,122,966 *44257A5777E95B062205A5AD24936CC83FAAE9EE SCOTTPANE
661,122,967 *4427A17E94C8D5921102E1CDA246DD0116BC884B SEMIETC
661,122,968 *4428E32BA61612B3DE186C7B57648B0FA1E9A319 SERIESRUSTBELT
661,122,969 *44283CC9A21C4CABB9CC2F77B6A01A330773FAAE [email protected]
661,122,970 *4422278890C03CB74DC16E977FD690142694143F SHAILENDERL
661,122,971 *4427346F7A0F78FE0F0EA607B1889957CA3CFA5A shirleybrogdon
661,122,972 *4423E97FACE1C58164D3F765216F09D906401BFE simonseats
661,122,973 *4420730BCE25B8DF315D644B55D3D947CF2E035B SKEETERTOMCATED
661,122,974 *442ADF1B731DEB8B4F40FF79CDFC79882751AD47 SMĖLIASROVIS
661,122,975 *4428E9B8F2F6539CFE2A34E22648B1F38287E436 SOLOMONKIRKNESS
661,122,976 *44289D2C01701628B851DA62B7624F065B96DD72 sonrocha
661,122,977 *442C4D147735FAD4D4BE095199C1B56B758E4DF9 [email protected]
661,122,978 *4423447558526CC704BA44CFC898791321B73E35 SP3RCNDC7R
661,122,979 *442BDD93635BB5A05AE9717B0F0836D04A4A95A4 SPIRILLOSPORA8
661,122,980 *442B3A4BE97C4A6AEDD0147B2047D543AF5694C5 [email protected]
661,122,981 *442E25161FDF5F5941A7C378325E473C1CED64ED STANLEYAGCAOILI
661,122,982 *442DC68507DB8BDC2BED8F635503E5ECE406AB00 STEVIE.KEAMO
661,122,983 *442A286D05A4ED9BD403EBAAD9F34919A97CF24B STIPULATEDV9
661,122,984 *44286FD5A35AD8F5CD599B26C99B8CA9B989F91E Stormur-Jón-Kormákur
661,122,985 *4424963BF2EB383B5559968BD1082E7161C7122A SULTAN-ALGARAM
661,122,986 *4425777AE50B56EB37C5BF11513B5DF306A1E370 [email protected]
661,122,987 *4421D277A5F603D4E97B01B39CF378E27CC82D34 [email protected]
661,122,988 *442EB75FD70C6765A6D45B8C9499E97E5F3F0A9E SÜVAKIHTIDENI
661,122,989 *4428E985F37DCB2737F2C99E17005B08D2417AA8 SVINESTIERNE1
661,122,990 *442E471F03635E29385BD9593AA38CB0E93FE674 swee.hao.chai
661,122,991 *44257DE7EA9BE96DEC7DB5735A6514B240F90B48 SZAINIYAH
661,122,992 *4426B6972FDBA06C72638CAE7C4BE46C0201BF10 [email protected]
661,122,993 *442350FE2BDB19032F8B25DD7F8B924E542D8398 T11356207
661,122,994 *442B86B8C37475FB8AF77A19A08BB9FBE399B47F <@t41na
661,122,995 *442AAD58134133D13D76131243CE27E142DD0E1D TAD.YARMAN
661,122,996 *4424FA235D9CFEDE3B3E6CA64A079F5B642582B0 TAKE.ME.TO.IT
661,122,997 *442244565AC309E5867563AF0A7E91349A4658CC [email protected]
661,122,998 *442FA5CC2A6D7D3368198830CEFF958AC3842B74 TELSREVOTFELREVOTFELTFELFFO
661,122,999 *442565A6E455C47EF2CF23DA9F88B0C2B5EB0DA6 thumbschuelmaister
661,123,000 *44267D3112EBF14D22F5CBBFBB7412946B978B6A timposadas
661,123,001 *442362335C06135554800882B4183F00D736F676 TNEIATOI9
661,123,002 *442973F99768405D0DF0CA8D6D8F8141BA3EE888 TOBIASNOPACHAI
661,123,003 *4423C4520B78DACF29CF49E7E6C026D07ABF04D1 TOBYSUROWKA
661,123,004 *442F8765AAD955CCCE8217442260CA845B8A76E6 TOWNCOUNCILOR1234
661,123,005 *442616C2FFC4B92FF697750564C57D3533BF2FFB TPALTS
661,123,006 *442A1DEB1A44ADF41A967190FBE226E4839D5EBF TR33F311
661,123,007 *442D403B30C18819D905ECE4BA406AEE0CC36B36 [email protected]
661,123,008 *442922A9B746EF553970EFF820F4A1E4AE166687 TRANSLUCIDE123
661,123,009 *442EE12937C35A1B8C330CA2F1D11225374CFEE7 trenia-baumgardner
661,123,010 *44222A2D4F65B67179F03847121483E2E43C5752 TRI-TRISNA
661,123,011 *442EB6AB186C160549C1BA9AA3BC270F3E6019AE tshedentshokeelhaden
661,123,012 *442CBF28E004E32E6194DA8A718C6564270721DE TUK-BAHADUR-CHHETRY
661,123,013 *442F56EBFA525500328B26CC36C4F4BB2E84FB6D tundra.anderson
661,123,014 *4421FF4D39361BFB50FAA2D0C138CD33B949F1F0 tysonweathersby
661,123,015 *44241CFE46DB9D643759D75F3DA89B0534F8FAF9 [email protected]
661,123,016 *442D8C319471CB910EECB80FEDE3AF68EE39D98D UCKFAYOUYAALL
661,123,017 *442D7A30D854C1D35CC5FE7EAA63C921E3685258 UKRAINECANADAPERUMEX
661,123,018 *442CCA318ABD740067B46ED40E317B32029B6565 UND.ICH.WEINE
661,123,019 *442277825941779D3DED6EC465CE3F29EB07B2E3 [email protected]
661,123,020 *4427CF21F89EC0FD08DD11E415C925929A23EE3A USS_METCALF_DD-595
661,123,021 *4421AB97B33FCEB52AD475E10041BA62E5F8F74C VACARCIUCN
661,123,022 *44293FD041D59F8BDC46ACB0EDE65BE871B643E0 VALERIE-TUFANO
661,123,023 *4422F8809E8D9761C58FBCE75E85FC4E9CB8AB5B VAMSI.TATAPUDI
661,123,024 *4424D4BCD276CACF22B3D0C439D6D029A736FACC vanila.wigan
661,123,025 *4428FB898291903929E7093269446D387D08664A VASUDEVANAMMAIAPPAN
661,123,026 *4425C046146478C4EF40272C724560BC11B51F72 VBOTANOVIC
661,123,027 *44228DF1D04333CE3572EB1FF46CBFB2B328E22A VERONICASAKAMOTO
661,123,028 *44283BC84A3A29B77A8E4C27B77B04AE8C09ADC3 VICTOR RUSTY HOLLY
661,123,029 *442CB55E7BDCA32EE2F278F720D173F18CB08EE1 VINCENZOLOTTER
661,123,030 *442A77C56CE52E5558D1BE91EB63912271308C0F VIRGILIOSACKETT
661,123,031 *442A4440446819253929C0CC6D8E5E5055C20FAD vitopalmese
661,123,032 *4429DAFCE8FA8DE044A514ADB51A4AD18ECC4EC0 [email protected]
661,123,033 *4426F14D77F71128807EEC91BF24E95524C3875D WALDOPEROTTA
661,123,034 *4427A04E6556D321FF6E5CFF017C6ABAC20F6510 WALLACE.KUHNEMUND
661,123,035 *442CF2A1A769EA94A267F81002F0EF976B46970C [email protected]
661,123,036 *442C532AE28D22F7A0037080ADD88C52E29AA802 [email protected]
661,123,037 *442410A400EFE7009FF626F410C36BDFC69F4A65 warrendimopoulos
661,123,038 *4427DB59E80C0EA74F0AEA43CC4C81BB55623D3D WELDONBOISSELLE
661,123,039 *442FA02FA0A88221BC4AEA5924E30D6CBB89A5E8 [email protected]
661,123,040 *4424BDFB5F93B47A8A8FFAD85BE68E994FCF9E5C WERNERRAMPA
661,123,041 *442516D44EB6B53C62675FD0A3EDB6498A25DD61 WES.OGBORN
661,123,042 *44295A4915E3AB3CA9B0E17C0C8F4589C562241A who 'twas that cut thy tongue and ravish'd thee.
661,123,043 *442764E20C10030104465FB33595862AF92FEED3 wilberriffee
661,123,044 *442004C36DC82B547B84A7EA1D20633960DEEE59 wilfredoallford
661,123,045 *442A62BDABA96E4D819BB44DC98C4EE553C35229 willardmcavoy
661,123,046 *442019F08B2350E606C400958D760308F163212C WM426947:CARLAS
661,123,047 *44251EAFBA672984A568FE850503AC38DE1963BC [email protected]
661,123,048 *442162F78F668313463C76B4CB99848CF71A5C32 WRABINOWITZ
661,123,049 *4425F10F231E85C01A5BBAACB34ECA6FE718EF0A [email protected]
661,123,050 *442FCA85000EA410E7C27788DC679A59A71E3D5C WWW.JUICIESTDEALS.COM
661,123,051 *442CFFE9CD45FDEEDE3E147F3D457E5130265037 wwwmarinahousesoberlivingcom
661,123,052 *4422AE445919EB66A9AE2790B00141AE11EB0A5C )X(~`.(####8
661,123,053 *44279A7C08489F53E524469F8BACEE150247AE97 [email protected]
661,123,054 *4425BF90061BE1DDAE94D80B5BC35561490C57EF [email protected]
661,123,055 *442B1DC1537518F2BF8AC55DBF5DA3F36E027CDE )x(.o~O~.<=3
661,123,056 *4422B7DAEFE819DE4AC0905CD2763BB6D64E0935 [email protected]
661,123,057 *44268F30FC97947F379FAFE6ACC5A016B98A802C [email protected]
661,123,058 *4422A7C17A60795118B21B9CFE980A94890AD2A3 XXTWILIGHTSXENDXX
661,123,059 *44283DD65CDCBDB932FBFF43D2C9455BB93CF60C [email protected]
661,123,060 *442FC1778D637FF21D437E88D3CAC4DA7CE3C203 yessi.wisma.handayani
661,123,061 *4429FF5B08B2AE704D503DFBE8BF99A3F1A6B619 [email protected]
661,123,062 *44286E7B8C79C1005965EF58C5B5F66D86F80F16 YONGELSMORE
661,123,063 *442B9E9C156260A39D504D8D23188DD269AE936B yonit-lantziano
661,123,064 *4423981351F07890E28CE714B20E4FC574BA0376 [email protected]
661,123,065 *442AAE8743563B2555171E1956FCD114066F2002 YYDFBB
661,123,066 *44203BC2A1171947D837A81E5135AB846DCAD28E Z166827
661,123,067 *4426C54DF6E05979C46E18D8B4FF16EA165EF674 ZACHARYCAVEL
661,123,068 *4421743A4C9819AE00E55C90B74BD974B12A5BFD ZACKARY.BURRESS
661,123,069 *442B5E3D65894925D5094F2D207739EC268CAD2A ZERRO.NINNE
661,123,070 *442FD7094E09198DAFC850CEE8009E9484205CCE ZERTOVNE9
661,123,071 *442FB3B026614B879B503B2C28647449F7411A08 [email protected]
661,123,072 *44271AA08AA10EF1C5B43111D63842C14655419A [email protected]
661,123,073 *442F8AB1FCA21E1EF31A62DCFD9801B31288AA46 ZHUBAOQIU
661,123,074 *442B79F751B9B1D7DAA19E8E558D4487EA441FFA 『モーニング娘。“熱っちぃ地球を冷ますんだっ。”文化祭2005』IN
661,123,075 *44202DA7BE7508D282AF62CD429D4A4131042986 05171151
661,123,076 *4428A2F72C9EE52A6421F7764448785A3E058829 0MYROMMEL4
661,123,077 *442B87863C68480F2A1677D4DC78368D1A2BDF3F [email protected]
661,123,078 *442141DB5EF418590E1EBB4BF75DE63EB81E7202 )0(~Q----P
661,123,079 *44285A70DD8CE186D93CED92E65062A9BB38B023 12356790m
661,123,080 *442F2BC76B65084F82BB6A7A0376BA397BD2AA01 130694 ZEYNEP.KOMEN.307.AV..
661,123,081 *4428754DDF213CE82CDEF58BF32E126385926A0F 1393197 tulospalvelu-t
661,123,082 *442C4373F9DF9B10DBA3D76B14F1EF3618D4DCE4 111.bogot
661,123,083 *442633073958750A6D77533B0A8DFF6964078BF8 1176899 TULEVAISUUDENUIMAHALLIHANKESELVITYSVALMISTUI.
661,123,084 *442CB40315DF97B2C6FBDCBE62F25DA1F240C092 118seth
661,123,085 *442BABC3AF1576F96074B20EAEC25B06691D02D7 13021162
661,123,086 *442622465C08D064EA7C0638279725578D1B5438 1451315 mr rubin just needed some up-front expense money
661,123,087 *442C35B911EFBD104D9E333EC15D246CEB8E1C63 148802 DARAUF-WIRD-ES-JETZT-SOWIESO-ANKOMMEN-
661,123,088 *44294D5FCCAFC93589703B4A9B361CD6CF5447EA 14march1585
661,123,089 *4424B19E250D2BADFBA9159011EAE15E326D3B6E 1962369 uudessa-hallituksessa-keskustalla-on-yksi-paikka-enemm
661,123,090 *442038E08DEAF95587528C0B337094B6226DA563 1-aksamlarina
661,123,091 *442C84F09FDFDFB98701A2E5D1D0546BADFE5C8A 1 atk-p
661,123,092 *442987AAD2F4D2F563F5D1017F9771339B810486 1DELLWAYNE
661,123,093 *44247672663695C7447B8AEF4E5CC51D27570FFE 1-belly-bumped
661,123,094 *442D0734DFF926341032F4E6C74FD7E15F64E0B6 1.benzeyecegini
661,123,095 *44258499104AEEAA1F3453837C951D7D67046E63 1DLVJNWYF
661,123,096 *442D8423B2DA1DE4D0F04BB7C6D9088D36D4A70A 1.frenlemesinin
661,123,097 *442DC176FB62A62043CA590169031FE92780AC89 1 HANDLESSCHRANKEN
661,123,098 *442AC96961EE4D1896A1F4C33E49406BC08118A7 1.hausharmonisierungen
661,123,099 *4428BFB0715381ECF474CAE511FAFFF4B779517B 1hersko
661,123,100 *4426B733A74AEAE46BC063D038DA06059F2D2EF6 [email protected]
661,123,101 *442657803ECBBC68B5803E14275466E843343476 1IRADASSE
661,123,102 *4424E4FD166E8A139A2512DE118DA38DB40EBB4B 1katukaupuste-lijoita
661,123,103 *442E8913965025D01D048DE0CB5CA06DE1C22F5E 1.konehankinta
661,123,104 *4422248EDE1FBB26C2725559F08EAFA890E616AF 1-kotikissani
661,123,105 *44201C97CAC5936C3C8E5EF1885A1F141D1B6535 1.kirkonraunio
661,123,106 *44293258341B3354D52309A14280215D8D6E5A9C 1.LAATIKKOLEIKIN
661,123,107 *442C5DFD88FC4B2B6A3B21AAB2A8C83D433AE852 1.lepuuttamisen
661,123,108 *442CA666D079BDCF0054EF133D20C29551F59800 1.metafuselndem
661,123,109 *442971B58C5D96E165B4B8DC8BBF834EB2221689 1MYHAL1
661,123,110 *4427170A4DF234D05170C78DAF24BF5DA0BF513B 1.nukleosidiana-logeja
661,123,111 *4420E722865BBF8E2B131A79DE9DFDC38AB21E43 1NURMIKKOALUEET
661,123,112 *442A48422CB30BFE8056722D182E55FDA56AA711 1.MUSICKANAELE
661,123,113 *442A44D9B4C956A6C3306A29046F8443DA937B99 1philanthropischem
661,123,114 *442957057C16C046B3057396017FD47C2A050077 1priestersippe
661,123,115 *44204359219A127C66375F32D4583714B0E2C5DA 1ORD4DMI
661,123,116 *442407022B7AD339810494A6965B67177ACD3051 1-RYS
661,123,117 *4428EB327731026128088AF59CF995915924EB23 1SWITZERJAZZ
661,123,118 *4422D3FA8E95079A6A3B8D21A8BDBED4DB19ACAB 1RILLENI
661,123,119 *442D636CBE6736195382616A1DFDD96956046DED 1-RYS
661,123,120 *442C55C2E46D52E485414090AB084FFE0DB2C71F 1 VIRTAHEVOISTA
661,123,121 *4422A8DE09CD63229AC28A9B36A83ED77BD90D3F 1.weili
661,123,122 *4426C38A82E3729D49731B9458F6A5A0FD402BBA 1WUHSIENS
661,123,123 *4424DDAB54637A800713EA7553D82394A4D48418 1.suojapalkeet
661,123,124 *442952038ABF30FCDC9603B143A3D3FCE4AB81BF 1SVEN.HARTMANN
661,123,125 *442777B4D337B9AC653A4C1C63EB1C85ACF0A46A 1 testshot
661,123,126 *44216F4E96BCFBF6BC503C8D7954AF09BE302414 1thatking7
661,123,127 *4421CF662C3D78BD78568FB675D26FC65C0BBCD2 1UMWELTSCHUTZ-BUERGERINITIATIVEN
661,123,128 *442BC54F3B9E91948B3E562AF05346794B312102 20kredroof
661,123,129 *442A9FC315B5CF4189C8086F8EC8A669AA011CBA 2039083 erzaehlung.von.inoue.yasushi.,.erschienen.1949..
661,123,130 *442A476A6724E6EC5248F1C34F2AA8ED516ABE9E −210°c
661,123,131 *442E6569B223F9BBE96F62D0711162D43C5474C3 22bayramoglu
661,123,132 *442888AA5F71C7FF985E89FE86C1DCB96EEE97E9 2538264 jos.n
661,123,133 *4420C21C1C05E35A02ABF4371C8864ABE82E9D7C 262JONAH
661,123,134 *442BFA57FDE65C08E87486EDFE33BA927885D2F7 2453769 die-privatisierung-in-russland-stockt-.
661,123,135 *4429B054665F96ED0B193BD9762F49B60EFDE975 2476920 "-SOMETHING-ELSE-WAS-DRIVING-THE-MARKET-.
661,123,136 *4422B7338F0806BF7E67005537686A3EBE3CFA91 2652059 SICH.PREISGEBEN.,.UM.WAHRGENOMMEN.ZU.WERDEN..
661,123,137 *442C85110574CF687A0CFCCDA1E4382CCB79B355 2717529 DASREZEPTISTGOLDRICHTIG
661,123,138 *442C17468954A8A2B2177D4238D2C86C6791E107 2794650 projekteja-k
661,123,139 *442A4156A042BB021943386E88929D23BCEBA619 2bottoming-out
661,123,140 *4427ED508180C0C4C855A0F12EB117749C8C6553 2 CYANIDNICKELKOMPLEX
661,123,141 *442A20B2B96DA2DC664C8C7C9F3021A8EF3B38AB 2AYEKITRA
661,123,142 *4424530606CCEBA1283CA7529044C9FD2D66D310 2bossert
661,123,143 *442FDFBCA70884AFAFC7759C047ECB8EBC31212C 2iamsamuel8
661,123,144 *4423E2A78BB438AD5822A4060FA0531467650975 2jun1906
661,123,145 *442CC4A9EA3F64761B106634703861F289934050 2 REINVENT
661,123,146 *44226C17EE3F248606AF9CA07EBDA58C9320D8E8 2SASSENAC
661,123,147 *4420AEE71A1F03D0248DD2E00D053AB92030BBD5 2-tarjoaisit
661,123,148 *44243975A3CCFD067898BAD42881080E68D43CB4 2VERSIFIER
661,123,149 *442F734C852268A34314DC0AC3FE7264768CFC33 303GROOVE
661,123,150 *44252D24CD6B211BB12EAA798A0F2D78DE0B3049 32PUNKKIA
661,123,151 *4423DCE41086ABF8E395C7B09E36DE099EB5F77F 3ANIRUPI
661,123,152 *4428E3E99463E68C9B15215CA5E6CF61C7D7BE3F 3.cuvry-center
661,123,153 *442511B83A5B44DD9812A3CC3B487AEBD0E90575 この2つの配置は、abcabc…
661,123,154 *44284126CBE6E7E322E669226BFBA0EB976D344A 3iluvmillion
661,123,155 *442D458314BAECA56F6C3CCEC800A5BABCA3EA4A 3=====d~0~o)o(
661,123,156 *442DCFC33312349CB1B6710BD7A36DEB38C769A5 3-SENDETERMINEN
661,123,157 *442EC38A317FFC0DA578575D3B446FB0ED101633 3HARJUILTA
661,123,158 *44238AB223EC5BE59411791B15726232CFDAFCB0 3-viestikoira
661,123,159 *4424EFD62F1F0CEAFEE94E83068C26BB53DE74E8 3XXXXES
661,123,160 *44241E139BAF1360E8477738F694DFFAA265281E 3LEEJESUS
661,123,161 *4426CDC136145894A220299207168E67EEEDFF0B 3LIPREET
661,123,162 *44234FB897BE52A9A7B5267A88065F7007366CF9 3MARZVAN
661,123,163 *442FCDD6359690649C6BDD4D676C3F03EB095E8F 3.METOPROLOL
661,123,164 *44278D68B173F451C0334CB05C934791AB715F03 3MYSCOTCH6
661,123,165 *442EEFFCBF58FC34E3F3907748CCD6975206B339 3======P ~O ~O ;)
661,123,166 *4425CA382294762E4301766D7CA4151469370CB8 $4L00N-DE
661,123,167 *442572CF0E2764DA9017CE40A277BE672ABAAC26 4MDANXWM
661,123,168 *442E294487A02446A4204431444AD60B5D3731C5 4MITC
661,123,169 *44216986FCC9894A057E6255BD86F9AD8E78825E 4IPOMOEABATATAS
661,123,170 *442649F99E03D6CC2A62CC24DE77F78B38BA89E1 4KAPSTAAT
661,123,171 *4423CC49E49769AE9259EC9A06D44E2401D8FDEF 4MADDOCKSHOES
661,123,172 *442F3A3519B963C48166611F515C0E857FB00A59 4VAELAEHTAEAEKOE
661,123,173 *4426AAE16B94E06DE5B8DB6595E992A5A5280CCC 4 NICOS
661,123,174 *44245DE13328DCBEE71A8C0297F699B05BAC8AE1 [email protected]
661,123,175 *44254DDDD90995DF5922BE21E532522D9BE586C1 4REDELTIDSARBEJDED
661,123,176 *44274F065094A77E74F36A4D964649F36F0C32AB 584223 tanisi-oldukca-zor-konur-
661,123,177 *4423154B0F142C1C4B67D6EC6B6BA394D24E417F 5ANAMLLEW
661,123,178 *442CCD702373F953E0850D2AA7FF185E21D0E905 4SPIGANO
661,123,179 *442EBDB84EA0E2CDF559FE1E5CBB2D7F07F323FE 4SYSCMLUMR
661,123,180 *4429749AD3E8A5B4A7896CB02A3EAD23DE560735 507SHAYLEE
661,123,181 *442048A13D653F92DFE6AFA6E6DF001EB2F16B6A 539769 kn:nesityskvp
661,123,182 *4420CB240CF884BFE17355CEE87F2C156A202FB1 5ILUVDAVID14
661,123,183 *4422173048ECAFF3DB546683652853D1B9A7E89A 5IRRGULIRE
661,123,184 *442FBD28EF185AA54814A211E73F1D8FA32E0603 5lajikulttuurin
661,123,185 *44245740E01DB8E8D9D3F723F58ADFD008998D71 586483 VARSINKIN.YRITYKSET.ETSIV
661,123,186 *44208615D8B034F2BB4278420FBA2ADF68C4143B 5LIONKINGDON
661,123,187 *44275B80545BE3D7E6BAED3996E9DF68FAB046CD 5MARIPOSAJENNY
661,123,188 *44222BE70E13878C66F093B07A2E67F1C9EE969A 5NACITNA
661,123,189 *442185E91CA8C88B262D88C568067DDF4085BEBD 5BSWFAPACBSW
661,123,190 *442B3F619EDDFAB1E3B7882E355FF5F03EDC13F0 5GNATTIESTS
661,123,191 *442714F7ADA90D9AEC757898C2F6343D11F7D7E9 5SETOMKLO
661,123,192 *442EE14AE6C8200531B044F6D5C193F626536C9B 5SOIDUKSI
661,123,193 *442B88303B051A18DF9408DD8E1E7CACF047F5EC 5LADRONIBSW
661,123,194 *44222168C99319DB943A69E7A2B771A9B83A7803 5LELIJKTE
661,123,195 *442A4058C36834CB5348F1E7A7CD9D92EAA01D82 5XTVACREATEWID
661,123,196 *442692AC4DAEB0A0A51F5CB08834A3508C512662 5PLEAINVOKEKNEEL
661,123,197 *44224991B815BD1DF14767AC05A78DF383CC3EDB 68x線
661,123,198 *44241AFF55C5DA98BF164EADA6C7F05B0052818C 5VELVETW
661,123,199 *442F806D8410F94B5334901D3C3260FFE3284BDC 5VUOKRATA
661,123,200 *442D71B6B4027F2D7BAA6806A2C081F7C62ABCAB 6DEBBIEBINKY
661,123,201 *4429E87BD4AC947D4317B5D11B02F6675CFCB8B3 609405 bunlarCOzUmdeGil
661,123,202 *442C8AC5B9C64A51FB96E18BECCA09C137B9E4F7 617GAGE
661,123,203 *442D8451F52418ABE9F1D450DCC0A5B90A1C7DE5 6MARSHALCRUISE
661,123,204 *4429F89ECC5FBC68ECE4AA945262A4758FB39E88 6MUTUITIK
661,123,205 *4426C44AB9A9C85EA80FB07C0B4CCD31B0870EB0 6NEKNARFR
661,123,206 *442A3AF30497B994ABEC7110DF4A9743401351C5 6DREISTUFIGER
661,123,207 *442033D25DC2F2014D383468FDBD254FF1E3073D 6PARTARE
661,123,208 *442A5ABDC612A37F9C7E77AC99955C0EBC618FBB 6RDNINGERNE
661,123,209 *44207196A5404B9C705D59B1F8D2AE0D861CBE73 6STADLERBSW
661,123,210 *442AD4C6AB8A60BCDE25DD4DAFC71194B078CEA8 6LICHTEMPFINDLICHEREN
661,123,211 *442B701A8C564AF1694004A08B637130BC2C5218 6YKOOBBSW
661,123,212 *442E5B035C7BDA5087FCDACE966241458ED96D69 6PLASSES
661,123,213 *442A37C9163A2A8043DC8549546A0103028DDEA6 6RENEIRHC
661,123,214 *442D5BD902EFBDC91E835D7D1E222056ED7F33DC 74AUSTIN
661,123,215 *442746EA4AAE4F70127F8AF771D9F004C2235BD2 6RYTHMICBSW
661,123,216 *44240D52EA5B0D840FAEA320FD6B62C0DDDDB1BC 7AFFYREERYFFA
661,123,217 *442FE038E3D91949EED5CDF71142EC74CE6F37F3 6VANILLAMOTHER
661,123,218 *442D8D64A5E5B2CBE991456631C59F98D222AD6D 6VETTECHEVY
661,123,219 *4429CA8F7B65677C868ED6C9FAE65ADA4EB01602 6VOYAGERDADDY
661,123,220 *442F8E74A1EF48EA33F0DBAC810F55E3B9C5EE02 7DOUBLETIMEDV
661,123,221 *442BB20D5D0EFB6C790812E936BFE06E91A4558D 73alana
661,123,222 *4425CCB36256DDA14CB08F7BE91AF42959E27F08 775JAYCEE
661,123,223 *442266496FC76678DF15208F8DAD78901CC78391 7BISTRO
661,123,224 *4427EE58555BD6C43BAD0D496E2F6D57DB8D81CB 7ILUVPEACH8
661,123,225 *442A6D84C9B9C7A2BEBD0FB7D561A1FB0190C0B4 7GIVEYOUAFRIGHT
661,123,226 *4424DC2B0B4618178AF3EE44C71797724ACA1F54 7IAMNURSE6
661,123,227 *442A468A326113C9C6F0D146157740D7A997A673 7-muistorikas
661,123,228 *442CD0CCA002F82CFB93EBDF4E3E27D515BAFD91 801 UEBERDURCHSCHNITTLICH
661,123,229 *4428B369575D716AC8723259C7153DAC1012EA4D 854826 DAS.BOESE.SPIEL.BEGANN.,.EIGENEN.GESETZEN.ZU.FOLGEN..
661,123,230 *4422CA4C22E54DF3FF39BCFE84D59F3652924791 7thatandre16
661,123,231 *442727D0AF25920BF08EDAB85CBBEFF4979952D8 8: 8 # & nipper
661,123,232 *442D3FB5210C19208502F191FEF529E26E2236DC 8===B-~0-SPLOIT
661,123,233 *442058B7B6D11E57586313EDA3A15BCC7E63B456 82.BEZUEGEN
661,123,234 *4427EE456EFF93AB6950FD11978416D689B1E348 8ADGSUCCESS
661,123,235 *4422C27757FA67C4E2980203A71F17BBC9935016 8FRAUDULEUSE
661,123,236 *442BD9CC16355C52BB1F8A9B1D65992FB6B67937 8GLENRIOS
661,123,237 *442FA9044F4CCCE87D171720137B8AFA793F4C6A 8GROVERTREVOR
661,123,238 *4423614D12B4A932513DBFD87B2471B0B787F4EF 8CRYSTALCAMERA
661,123,239 *442DC1FF85EFAFFC3AB1441BFCFE11FBA17143AD 8.HYV
661,123,240 *4422AA6A50734D9287A32B9C661E0D0B76991258 8GABYGOLD
661,123,241 *44262F617E86BBD26CBE1778D9B85F07F90CE504 8HELPTODAY
661,123,242 *44259F8CEBCCD5BC91B6610166F51E2E5005D800 8MOURRAI
661,123,243 *4425FD1A890974D3CBB890B9C11D2094F8A5DB92 }8{[email protected]===p
661,123,244 *4423621035808C2ACC20B94FAC2EC10864A9B26F )8(~-`-Q---P
661,123,245 *442F0B591FD9BCDBC3DE9B42882C6934A083F69A 8TARZANCLAIRE
661,123,246 *442DF966F792C64B44BD9F439E53E4D1EBA7A1D2 8TRANSFUGO
661,123,247 *442D1B1FA39E74FFD651D1D8254CB61663B183FC
661,123,248 *442CDEA0CCF07CCDD9A09ABEE0E5C6389F96AA74 $
661,123,249 *442C15810DC262612DC445401FD490EA036D6B8F 948MARC
661,123,250 *442A7A8858C0FE5FDD76A034BA6D98F02D83001C
661,123,251 *442F6650D4A6358A7A1521A12C7BD8195102BB2F @v=ɋ
661,123,252 *442404301729DDE5AD8E1C2817752A81D1146073 988108 siehabendaswortstroemungsabrissbenutzt.
661,123,253 *442FD105919ECD397FD6D4F64AEDA17E3F0E9D6A H
661,123,254 *4426FC1AEC1CF57B8B89F305C0623EEE73C8C2EC 
661,123,255 *4425EE1E7FC09DC4EF12E380FF0CA7089F6B19EB Y
661,123,256 *442CE852A6808A6049BBFE0CA63E124A5A3BE628 9ECNAVEIRGERP
661,123,257 *442983B2C50FBCB763DF3AE83AEB938263180F2C
661,123,258 *44281AB28CDFDEBB5AFA5F61B4BBE956B03A5C1E U
661,123,259 *442CF27C4F78207DA913AFFD8AC73A21C30F5164
661,123,260 *4421BAAD6CF018C778AB72931E9E8538C9D40438
661,123,261 *442DABEB377283C1F7DE0CB4BAFBD6FEF9283CCC 9londonizations
661,123,262 *4421F7903117FF4946B00128498C7054FD816C4D 7
661,123,263 *442951F99165CA4AD81EC2171280F60B834079EB
661,123,264 *442021AE2137D72D8F1486F7F55C22A23774AF6A
661,123,265 *4427D1EDBC3A4D17F5CC80F55483DB279FE18B10
661,123,266 *442FBFB7E3E117303C651C00A37FD191DA7E205B 3']N{
661,123,267 *4425122AD402F9EEDF9979D8B383678E50813F49 1Z
661,123,268 *442B7BA471641279B782BE612F2C35767FFEB539 9SPOOKYBEANIE
661,123,269 *442C330EC8F9D48DD1AD55940545495C195008A2 9THUNDERMONICA
661,123,270 *442A583291770D77BEC8305AAF2B0DACD7492AFA a115n
661,123,271 *442AF21F68BEF0675DDA30A8B1073AC00021579C
661,123,272 *44263805DF94006602F1BE85889BF48259B22BB6 }`
661,123,273 *442DDF75365B25B704D09C08834BC487A3EA01DB a1g7g
661,123,274 *442614AB5D7CF857872879921C85981E23F11D48
661,123,275 *44261C8AA4E443757B4182CFD6717A44F2434A2D A3B&
661,123,276 *442EBF9113D8C0CC47D114CBC5FDB487F3913396 n)
661,123,277 *4421F9EB7E515EF699A3198618DAB6AD0820430E
661,123,278 *4423C6F85FF02BDCD36B848E5B573CD87FC4DFAA
661,123,279 *4428965E620EF031961C7D78B6434C47B51032DE
661,123,280 *4421C9A613DD959E3CEDCBE4A65E5E9B6EC84B40
661,123,281 *442DBBD41E6EC2EE4C3225A52B59C76F6EF42D88 `l0
661,123,282 *442F9046E2C88905940A789F446F505EA3FE12F4 a9ua!
661,123,283 *442713E08C740F75F4FF19196655BB19D48F35F8 aaa\;0
661,123,284 *442464B3AA5A17D877B5890B033F8B604931A4CA ǁa
661,123,285 *442092945AE84C318FF8FF01894833418CF63E71
661,123,286 *44202E6B45490F030984B212F3AB1A9A5500CD2C
661,123,287 *4420C25AFE566749C6A25E6A95F44B99C2C836DE aaauk[
661,123,288 *4420879B3103988A50ED196757EE0C322438D00D
661,123,289 *4420CE2632B3C2ADB0B3F5493D64E25C68027BE9
661,123,290 *442AF6C2832DFA2B8CFAF4F368B8913637478A6E AADYZR
661,123,291 *44228F888571CBC5F10BC9A3AF9F6C10256FE5EF \DY5
661,123,292 *4425083EE8AABDBBB04BEF6ADF732E68E456FAF3 aafcch
661,123,293 *442FE0223E88E9C184EDDBF12A87E95EF7C21762
661,123,294 *4421F252E2027662F70E7000A673D2535B6D99FD
661,123,295 *442EB47DB8D95C7515D2BE87DD26EEC1964D1CA9 aakqi
661,123,296 *442B17EAE49D6832FC8D1105B8E912866B0B4CE7
661,123,297 *44263D426D2B64B455DAD05553149906FA028237 Q
661,123,298 *442913BBCC6D70BA325E82F57C8B580F98DBFC2D aaron.doug
661,123,299 *442E593EBE3D7AEF2F6216F116F865AA746FC921
661,123,300 *442DDA8E21655C134ABD1339D2001A3835C46CB2 î
661,123,301 *4421A48F1F2683B0CB49677BCD83BAC1820D8095
661,123,302 *442F9200888BB159F9843A7B19DAE83D7FCB8603 aazlg
661,123,303 *4421BAB25DF037DB10E09A512B872240D6A2F6D8 abc119
661,123,304 *4427B2A872A5E04AD937A7C9C937143AB4855177 ABCKRIEGSF
661,123,305 *4429EADBB8C8D404EBC4304C05D4BE34E955E6E4
661,123,306 *442CA0500C034B53650660E906F08A890A381CC5
661,123,307 *4427DA544E0007B481339258F8753C24DF011385 ,
661,123,308 *44220F9035CA0E6014E213E03A843FD3F13F832E
661,123,309 *4427FE9A7DF07FAD83BFD941EAEB665CAFE74E6C
661,123,310 *442494B1C4F31CE588D098C0A5B099BDC3A76570
661,123,311 *4427C54538ED5EC589E91D61B13E30F453905408
661,123,312 *442F3736A0F3FECFABE710B02B5C6E1ED16E6143 p
661,123,313 *442608AAA4335314DAE19520CEBA9268EAD9A7F1 ABjN
661,123,314 *4420D9A8938C5EDD8F327DA5D51186B9D8155A68 a&&bu
661,123,315 *442734286AB003863A376671D116ED4756433C3E
661,123,316 *442EE1032547119E0AD89B1BC0A97AC3DDC86E48
661,123,317 *4421F3F5783655C8AEE47C81A4AF5BF438271CE0 ac4ws
661,123,318 *442E743BBF58C67EFD2BF39C84098A8BEF00F1E6
661,123,319 *442D79914718BB401CD12DB197101EF2C247B30C
661,123,320 *44260C7C218DAC31C99DFB92E0DABFEF84DE9DB4 ACC/G
661,123,321 *442308CA1A7AAD710CE3BD51AF4317695973D2F9 ACEITASING
661,123,322 *442C9373FF08207056D45F5135283D252DF42819
661,123,323 *4427FA516F5DB848F2A3D7189E026910A89ED39F ^.
661,123,324 *442857DF41A9C630806E58AF57CA2B312218FF69 4{
661,123,325 *442C926EC331CC8AC9B7FC859D01415CD169BE92 ACZ!Y
661,123,326 *442B6AAE2902B66C400201FA62C82294B965C9D2 ADAGIO AFTER BIHARI
661,123,327 *442A06335E9018F4053FF347C274CD9E856BD2E4 i]
661,123,328 *4422A4C450696839A0AE85117FAE52EFEC35BA4B ]
661,123,329 *44293BE0BE87D610421EDEF578B4B820F5E18664 adlumin0
661,123,330 *442899EF945DFC730164AC7EDF0ABEA4006E1BD8 adt$c
661,123,331 *442BE0CDA7F87201ED338CF0D7263AAD5D6A0C6D AE)G%
661,123,332 *442D965A35F63F949EEA2A63EAFC9ADC17C30CF2 AHMAD.GUIDROZ
661,123,333 *4426A8C4B47707635B3EA4B4EE086238507205BB AIDOP
661,123,334 *442FAB46FCCD9EDB131291D52BB18C4EBB761977 aijkc
661,123,335 *4421E805A6B03B71025720118FCF7898927022EE 10sporttauchen
661,123,336 *44215D98DE2D50ABB87147F919650D1C5B0C855F 10unentwegter
661,123,337 *442319F5220527B0F95A56C904CF130F433CEC50 1104 MODERN ROCK
661,123,338 *4422793C1EB14E1B516A2AFCC21774CAD7A6DE85 12345andreia
661,123,339 *442E37F8A8CBFE3120A54D7B331DEC534BAA9A55 12stockholm
661,123,340 *44271C29FDF0CCCDCBC1FB1C604BBCD780EA5415 ALEXPARAGAS
661,123,341 *442A1C7982436B0CD9A9F48F21B5F1120BC377AF ALIENGROOVESENSATION
661,123,342 *442F685A6EEBCF842ED2986A3897F0AE295AB461 alistetun8
661,123,343 *4427F865C91B814211DC26A1FBFB38DD8F688471 14.urwan
661,123,344 *442DB525CC629A9F3C01535382E4FB72728548AD allendb3
661,123,345 *4422758D1B0D2EC90175D76B5DF5E178A913F63B AL:W
661,123,346 *44261FB8C4084C56FE1E603A55FBB3FACBBD34FC 1977年、HOW
661,123,347 *442E4D852A66E62937A228C043F9A20FD10C9E85 1.AIDSRATE
661,123,348 *442788EDAA6A34A753C1411940BD54CADA49DC10 ANDREHUNG
661,123,349 *442CFE9DBB081068ECFB548A06E2D1C4C981B5F0 1.carter-oriented
661,123,350 *442A290D0EE8FE9D4E8D2918A6563E9AF815B824 ANDREW.CRUMMY
661,123,351 *44221C76396E0C79D632A15CB272F7442636E523 ANDYKIMOTO
661,123,352 *44217D9AA179C2EDC9B5F83D3C51E2F086047543 andy-wilke
661,123,353 *4423345EC5769DAD82ECC3C58410128F6DDA183F ANGIE.LYNE
661,123,354 *44214EC0FA474541FD5158EA9315CE82E49B4C82 ANGOSTAS0
661,123,355 *442AE863D1576CD2C5721217CE0C5A5C1F25D6F9 1 GODKIN
661,123,356 *44244E563DB8403524B65A960B520A3DB142DAF5 1HANKHANK
661,123,357 *442CF99DD4DCD1650CE760CAA474466F32E3C183 ANNJOSEF
661,123,358 *44249F6160ED87DBB1694E8D5B9208C27A6EAB61 1 HUSEERAAMASSA
661,123,359 *44274EBAE4624B47766EFE054D57A3FA7D92AEA7 1 ibmsicherheitsbeauftragter
661,123,360 *442D92C4864E00B914637C6D763710F97D8400D0 1 INFLAATION
661,123,361 *4428113E6FF7874BFA216C052D5EA08586D79931 1-krankenmobilienmagazin
661,123,362 *442DAC32E628B03B16A50E893D7A3A1155B40654 1.kunnanviranhaltijat
661,123,363 *44290B524E3B0F471071B236FFDB9C3F7F41218D antoneshimek
661,123,364 *4421BA0DC47F71C453244D03D8654950FCF86FCD ANTONIAMCCLENDON
661,123,365 *442BA7FD84EA069292B673E88DC11E9DD04BB7C4 a$nuq
661,123,366 *44242FA5DE3335521A0EB1787C65E0468ACDDA3F 1mineyama123
661,123,367 *4427F10C44D81182B9E3C9C17B1F1380F92A5804 ap).(
661,123,368 *442F0EEAF97C18F3E963542BF5EE84E339C1D16F 1.peprotech
661,123,369 *442638C6963AC9664D6760DB2359E471229E6AEB [email protected]
661,123,370 *4426C52DE24F53472DDDEE452501BC3CE7230D5B APSBR
661,123,371 *442B1250B1A20C48BF7C4DFB8E7C860B8A822328 AQE0#
661,123,372 *44297CD46A786520890A9D1ECAAC36C191FD54F5 1 SMARMER
661,123,373 *442C899642EF9433F46CC56F834A680FEA80BA24 aqokn
661,123,374 *442CB00A9DAB6BF9D0DB52AB0785682970C524E9 ARCHIERODDE
661,123,375 *442ECA3B2FF3FE3D4E0188FDC91E612B2C836A53 1-urgedanken
661,123,376 *442BDEE47FCFDAD237EE8CC0C736F5C134A997AC 1-[[user:zarbon|zarbon]]-05:12,-24-april-2008-(utc)
661,123,377 *44247B732847C309E927F1F0E50B22F2291A0285 1vuokrak
661,123,378 *4421EFCEBD1D927EDFE96234FA057A43E3A5682F 2047970 "OVATKOKAVERITTODELLAJ
661,123,379 *442BDDA21AE290273CA28D73555E63D289873FB9 ARNULFO.BOSLER
661,123,380 *44254606DD8E2EA6BF83FB29C51F057651E6AE4D ARNULFOFLICEK
661,123,381 *442E6EB57095F2EB68545D4A39FA15AD76D061BD ARONSMIT
661,123,382 *44256E51B4CF420D3DDC1318C68A47E926BEA38E aroundli7
661,123,383 *4421399E71EFD11B32AD3174BA266443C6F7C449 2330049 TILANNE-ON-PARADOKSAALINEN-,-SILL
661,123,384 *442C3F11471577BE911208CCB5F3C05754DF62FB 2474555 "-NOBODY-BELIEVED-US-,-"-SAID-MR--ENCARNACAO-
661,123,385 *4421A8B12B1A4F8452A1791446B839E79D63789F 2545692 ineinemkommuniqu
661,123,386 *44219F1940621D6F15E1D25B322A457CCAFE01C8 2795409 lab.work.will.be.needed.to.determine.their.exact.age..
661,123,387 *442DFF7F52C6C7D58E87B60EBE5157900113579F 2865864 the-report-did-not-elaborate-.
661,123,388 *4422F5B31D31B840337995FD07B357CE842DBD3E 286837 IN FRANKFURT , SHARE PRICES CLOSED MOSTLY HIGHER .
661,123,389 *442CC6114A61CBA74873DBF4C2AE46088AD89B53 28-centric
661,123,390 *442991F74C79220D39F73D0D0E92B3CF018BCD95 2 BRRADLTOUR
661,123,391 *4428F7AEFABCB48F2959123A74045310FD083567 2CYNACON
661,123,392 *442160B2C0A9AE7F391C88291ABD2ADB5FACE54F 2FECAKOMOD
661,123,393 *442DADBF7005ABBC18A85565F329F83FB9249D8F ARTTABA5
661,123,394 *4428C943EA598911C457ABCC3CAD1CE915410057 2JULY1978
661,123,395 *44225192E581A3B5690AEB5FD167F48561D19F56 2multiple
661,123,396 *4429ADC111264077F4380658DD3D4CB8585CB575 2PEABODYWINNING
661,123,397 *442E95D8D5EC970676F586A3D0798F72BFE8C438 asp,p
661,123,398 *442A1086150265F5852398C47F70BF52028F0D77 atquechee4
661,123,399 *442F02374F2D25DB91AC8B5CDF37A9D23746A1CD 3132PROVISION
661,123,400 *4427A24C1D200555CADDDE6DF27678C11922A625 36545FB7-88B2-30DD-95FA-3298714F7F35
661,123,401 *4420737F163FEFD5CB9CA07B96B98C5C96D9CD9D AUBREY.SEKI
661,123,402 *442E4D20245E1DD5CE49E58A14EB9F209D90E9BA aufcg
661,123,403 *442085244304D363EF7B56E9FA9A8DD5EB4AB3C7 3##b~o~o.)o(
661,123,404 *442AA06DF83801D053C806EC8F1292291DDA8445 3ilovebluejean4
661,123,405 *4426694764759463874D4EB83814E2172176EC61 3OXIDATIE
661,123,406 *442DB2DE016B44210563DD8243026C39D0B0ED1F 3PYROMANISCHEN
661,123,407 *4423C2F04023C29305328622F73E40C1BE7D6295 3SEZARYEN
661,123,408 *4426337130DEBF3E6B21357BC9A760DC0D34541A avygv
661,123,409 *442B97552ADFCD4F4D7D47731F29DFA05D9E706F aw)_p
661,123,410 *4423BA47028DB0C86B22C6C6B2E151D0FC5FBF3D AZV9I
661,123,411 *44220DFDE3FA790F55D94484856139DA9D254E9D 4ROSIEFREEDOM
661,123,412 *442A785422D16E9A7C66101C5470652B8C272623 b-0%e
661,123,413 *44277D15107DC5918F927FFAF34A73206DE94B6C 4STANDARDIZIRANJU
661,123,414 *442947EBAC3FC5F177C1792E7DBB95ABDAEC0710 b0vi
661,123,415 *4424B207FD0C5F7C0540CDC63075F585005C46BB B32I
661,123,416 *442B3C32447DED77FAC27DBE32598FFA678E324B b;9(
661,123,417 *442F3254D9165B0FF89C11167D8ACB3645F3ED92 5BONIKOWSKE
661,123,418 *44271ECA2FC180AD9895E5B65CC0E1049AF32E03 bachianasbrasileirasno.1iiifuga(conversa)
661,123,419 *442B84F67EF5EDD728302B3AC216B139A5A1B948 [email protected]
661,123,420 *442FB50E20110AB7D82820485B3348F2A7CEE0E8 [email protected]
661,123,421 *442F2BAF7379FECA095E7B23D15637402F6C0F9C [email protected]
661,123,422 *4420C73228A06AFFDE88B8635886880A3A754BC1 balnche1
661,123,423 *442ACEBCC4F5018D429D3D80DA49B40B31905935 BARRY.BRADICICH
661,123,424 *4427BBC14B487F611DFE2F1E9F60AF14FBDA062E bas384l1
661,123,425 *442886DA75D28491C0FB0217FFF6643F547761C3 5MICHELLE9
661,123,426 *4422C2158D4351EDC7ADE350551911372F5DAFCB bcxp?
661,123,427 *44225DC9C140299E4703E2DF24E02A4E3FA4B1CA 5REITIZER
661,123,428 *442227AE3E6C5B1AC6DBC97E747A92AAEB70714D 5SPECCHIEREMO
661,123,429 *442F882E46F175CC1C96CB149CF297DD6A592431 5THATCARDINAL6
661,123,430 *4425303D188AD1523E3465A7986A3AAC05216495 bedraden?
661,123,431 *442CF6D997F5FD8A34AD4A991BF60068B5447E05 631657 TL GELIR SAGLANDI
661,123,432 *4423F7381F0177EB63BC8C7B08E977DF8F092F69 BELTANEBOOGIE
661,123,433 *44258E9471210B949609732F3F51858A6B9C5967 6DAKTYLOGRAFIES
661,123,434 *4426B55344BD02703FD7875F94C46D08E8CFA968 beth.carrier
661,123,435 *4429D5E7FDF1C5A9B011F871943C1F14F150DC29 BETTYBURRIS
661,123,436 *44299F496C406ABB9F3A246FB962EC29B7C5E8B4 BG8O
661,123,437 *442DB8378EBB218A655DDC8C53FE005363F70BBE 6KYLMNKOL
661,123,438 *442BC05923D9445D0C91024C8AB33F2DDD4B1579 6LAKVHBB
661,123,439 *44292A56E83EC23A893404BFD8DE3A8E1F065D4D 6MEALTHUS
661,123,440 *442B4A26DA203973D0EEB46D2DC63E77D3B957BD bhvfw
661,123,441 *4422B506BFED3AFB27D1F1BCDFE47DBB8C4687E0 bijbelcommissie5
661,123,442 *442AAEB44A7124E33FFB18DFB94794543D7A0924 6PETERVIPER
661,123,443 *44264FB52556E1A80C98F4C9472BFE6B7BA21573 BILL7127
661,123,444 *44291FD96AD9E292225B5B7835B66F49473E80A2 billstanly
661,123,445 *442EF20D12F454670AEA8A5297597A7F21E371B6 billy-crystal
661,123,446 *442C7DF9AEFFF7CB654D290A810398CC9F1953D1 780032 bir-de-kendimizce-kurallarImIz-vardIr-hayatta-.
661,123,447 *44239F9E85852CE7E3BC5F3AA86E70813DBF6B28 BLUESHIFTX
661,123,448 *44211EAB6778D2CEDED6648FCF9979C550F345FA 7AUSCHIN
661,123,449 *442799BCAADEC9EA0D33ECEE1395B22ECE95A877 7BIRDORION
661,123,450 *442254B570D078CEF43F58EF56FED602D363AC58 bmuip
661,123,451 *442B6028732E9909637B6BFB03D91E8B395756D0 BNMEN
661,123,452 *44298DEDEAA65308C0D5A242E0BD638A94AFAA57 BO8PN
661,123,453 *442E091C2BC9D9C32331C01D1387C6B972E9F19E 7GRADUALS
661,123,454 *442407013DAE72071A74D84E93BD9594082D1028 7ONGLEERT
661,123,455 *4421F5AFF78A4AD0EAD7330914D513DAB174E04B (bonus)-sunlight-on-the-snow
661,123,456 *442360AAFC32021A82853FFFDE1B2A219669BBD4 7RUTHSTEALTH
661,123,457 *4429A915ED25465EA62BE3A6859AE857AF0B65CE 7STENKULSPERLERS
661,123,458 *44223C3BF02BEC3DE89C2B4FD318BAE1AE04631F 7thegibson5
661,123,459 *4423EB28934FF0128051A8EF4BF16E1C1011FB0F BQP$I
661,123,460 *44257C4C42241C241FB1374CC1BD87471FD5288A BRANDON-GEDDINGS
661,123,461 *4429DFC91A3601FC73D5C1B64F6AB5CAF70BF82C 8.HYV
661,123,462 *442171218436D61A47E1848B1BE5F88D3B60F71C 8MORFEME
661,123,463 *4424014D03E07065F42C105B1728B56DFDD90EF5 broadste8
661,123,464 *44274D833F32E09EA7D7F4A09CD6E5F7E8671BB8 [email protected]`~.}O{
661,123,465 *442C7F042417EE5F68FBF59C7BA8F6ABCC71BFA4 8p ~ `}8{
661,123,466 *442DDF14019FD189A03F5DB0789BA92912B508D1 BRV2
661,123,467 *4429BE01C5C2970B682EAD86623CDF7B086B5447 [email protected]
661,123,468 *442709E27202E80DECE01721E0C2E8FCDE8D8BD3 b####)***sploit
661,123,469 *4426D0717E0733F894E4F6267B3E5113DEAF7A4F 948835 ALOITTELEVIEN.PELAAJIEN.RYHMISS
661,123,470 *44293CDE4BE6A5899E5AE5A8193D920B93007926 BTLR
661,123,471 *442E0DAD68DE3E168776147A3268F81828C7C156 9afspoor
661,123,472 *44255B8C8DD72482280C8A8263F5D7EDE9E758F1 bv("f
661,123,473 *442B8F6B313457821A99CBE93BBC367345534051 9IKINONE
661,123,474 *44274EEAF481E08998812D5B6E5E9811EA4F6A3D 9MONSATSU
661,123,475 *442A0D6825997AAF75980F7B67DDF500AD52B230 c0rie
661,123,476 *442DE9467AB03A747BAA173EAF25EC444B7C1F7F c=2p!
661,123,477 *442EA68E008DF4A2A8BD22CE07DBBF8C726E38FD 9THATBIGAL9
661,123,478 *44203ADF01ED41BA1CA4D18BFDE64B212B604DEA 9VELARIZEDS
661,123,479 *442EB8EC0A33FCCD3AD8CB8C510CFC438F410B0A c53b
661,123,480 *4427675F861C47EB03BA42C034BF518A0727F35A A6ZITR0M
661,123,481 *4423FA9FF36850A531AFCF3AF5968FF9CFAAF517 A7LM
661,123,482 *44246066E90699DD02A7A529C2BB49FC65A0AC1B [email protected]
661,123,483 *4421C10400C220DD2B7F421ED236B7FC5F154038 A9QCL
661,123,484 *442FBFDA9956908287284643BE6E79E78690CE02 AAB64S
661,123,485 *4428C58EEA11FCA9905CA880739EBC2AFA5B7534 AAUFR
661,123,486 *442A0E6FD47F0FB8F5E2F5653DD14D69BF895285 [email protected]
661,123,487 *442F870D9D0321BB003E6474BA1C25FE0447829D abelena6
661,123,488 *442FACE25192914F85B01B46CE74C0EF1D5F491D absolutnicarao5
661,123,489 *4420E1544CAD42F869C4D3001C938D4D58D732D8 [email protected]
661,123,490 *442D1FA4FF7466E6C4E9C70EAC7A4A6DB1DBA7EA Ac7
661,123,491 *44250787FBFBF5C59A0292C7A89ED18444654A04 ACCURATERELOADINGCOMWWW
661,123,492 *4426B9D624786E558F15F25F23E1B89A110D6502 [email protected]
661,123,493 *4425A12C28310C15190F77BAFAB0EBBBE890E132 acg4n
661,123,494 *442451F39D04158B450CE3077BA51386421A7B3E CDR%G
661,123,495 *4423F9D7B8AADECD39791827CF9330F21F9EF1A4 ADOLPH.BELLIVEAU
661,123,496 *442B9903FCD34CFDE47C18849C9B4BE7C4CEE778 ADORBITAL3
661,123,497 *44272B050DFCC9099BE826DF286C51BA50A18915 aekavayn
661,123,498 *442714326E57BD4DED881032F3624AC3A5A455F7 AF&F
661,123,499 *442DC572811CA7451475C885BFC0686FAEA78B95 CHADBATES
661,123,500 *442D0CA7EF195C4BA4334B2683B9BE83748F0783 A$GLS
661,123,501 *4429FA4E4BE543D772D7D5BBA7C1AD0239FDA6FE charbel-el-feghali
661,123,502 *44267A22D0631528D6658290A377AE7D1F4CEC5E CHERETH6
661,123,503 *442E1F4B9FE3DC7C22FE11647368F0CF180C864B A/J_A
661,123,504 *442F2575CD3E52F0EA86D75E00AED5B112814F14 chg"q
661,123,505 *442A2A780468ED5F9FC430E85395040F67B24E26 ALFREDO.WASCOM
661,123,506 *442522DB61F39E2E44583E675A2D3B377E0274DF CHULBANK4
661,123,507 *442543E1484DF5551E1C3055B3BE3E9FAF5CB28E CHUNG.CHENAILLE
661,123,508 *442FB821F0A4357CD4B0A3A0804E8FDBEBAE46D0 [email protected]
661,123,509 *442F97A30CB52763F93ECD7E0CF0D411AE421203 CI_T
661,123,510 *4425149612979C8762B24B2317F162B602C1E082 CK.D5
661,123,511 *4420351B811CDE084501D8D9EE86BCAF4E1345C9 ALTRNTRS2
661,123,512 *442F008EFF7E5D4EA802F67DC6937CB87D0E4214 CLARAVELEZ
661,123,513 *4428809A8F2F130A7B040D061012782CDF9D8C2F ambroseroettgen
661,123,514 *4420C57B243328C1AE3F818E4EB192766D44AAA0 [email protected]
661,123,515 *44228287E211D4DDC4AE992DBFDBDEB25B645B4D AMPHICTYONAT
661,123,516 *4421BADAD75569DBA5D2A22937E0B6D8B226FC69 amu+3
661,123,517 *442EB82C762B6402F6AF4707845D5619B66108BF an3jd
661,123,518 *442124BEDEBB34954EB48B2EB275613AA82CC1A2 CLINTSAURIOL
661,123,519 *442A05F6E18D1F92E1E8ECF8F4EF073141590765 ANDACT
661,123,520 *4425923C434A21F56A305FBB80E3568677962180 c#m-
661,123,521 *4423DB2CECAF067751D273481D0C983D0A69D221 anibalcawthorn
661,123,522 *4425C7DD2C5AD68269B75D321CBCFAC67D4C2D9E [email protected]
661,123,523 *442CCA2D741E0287987FE2E09BBD8A9A4108E3A2 colby30
661,123,524 *442D5C2E66BA4B719C83F93F531D7193711EA38B [email protected]
661,123,525 *442E22B54C469D4E1AB0DFE65BB4B66295FE094D [email protected]
661,123,526 *442F0973B4D847ABD6C4608D0046C0DA26F19796 CONFLANSER
661,123,527 *4424454845735A9473DB084407F2D4E1EDB7EF77 apukv
661,123,528 *442E12F5E5EF4D6AF86CBAFCA0F6DD02894495D6 cozier
661,123,529 *4424BF61C5A1A74738C8CFD7BCE96C415A0C5986 ARLEANE32
661,123,530 *4422B825667CEF398002AC2C1EF6F782DDC3DED9 arturotrumball
661,123,531 *4421E7A89894E3B8F2B92BB54B2C6EEAD8BF5079 asluz
661,123,532 *442C9655BCB8EFCB3F7453DF8EFAD78423DEC828 [email protected]
661,123,533 *442C9720ADBF770BCD379652BEE7C470A07BD32C crbtq
661,123,534 *442F0C86E9F3D4281EEF12AF11D16A0C930F6430 c+s.3
661,123,535 *44270A1DF8A306B93405E5B49BCDD6C506EA17DC ctlgs
661,123,536 *442D3190E86467B3CD574F62E7876AFFED1A2D6A AW);D
661,123,537 *442EC1E8B13C9C2440F2E06EC5D2DDC44E574EB2 CWMJV
661,123,538 *442F7BF8E5F033C67C084424FF94BFFA92F4D330 b14stment
661,123,539 *442DE9F74393F62F385EADC6E50C2B3FBB3C3A92 b3dbx
661,123,540 *442870AB9EA651FA15692634A475FFD0C8B02115 b"5ub
661,123,541 *442A99ABF311E2056412D62E9CBAB48868E5ED45 B6MMN
661,123,542 *4422255582E3A0A6F6D00F3D24C3116CE726EC7A d(44!
661,123,543 *44238F7E3D762F4DA7852775C6F0D45BA38BF702 D4FD
661,123,544 *44295E05C8C39ACBF2892E1E0A808A9FE2AB901E BARRY.CLAYTER
661,123,545 *442E5E53BA614A9AC25F52CE9A498D42D9540BAF daleyouree
661,123,546 *44287522EA44FF5BC64467AC44881FAF9A70698B BASS-MECHANIC-(FORD'S-HOUSE-RADIO-EDIT)
661,123,547 *442FD21CD31C40DBAEB131120A4F5BA2429EC0A8 DAMON.FOSLER
661,123,548 *442DB64FC0C739315BC9EC3F43E86E5E05AF7B0F bay-view-garden
661,123,549 *442DA6273DE0431681E2FC1296CEF953ADCD48C0 DANIEL.LIEDER
661,123,550 *442766F9475187668BCEB757E17A3C6DC5EF9165 b_ckd
661,123,551 *442364272EF83B314EA446D58095980B93695C7A DAVEDOWNS
661,123,552 *4420C7AABA0A7A9B5433198EFDEE0B290B0F9512 davidstephany
661,123,553 *4428599D9477C1FA1FD9C3BA766C71AEF9331455 BIASRO
661,123,554 *4429F15960731A7D7CC998F58E6F412D1644DE29 birthed
661,123,555 *442FA2B659B11E1EE27194FB907A4C91D2CA6A48 bl5u4
661,123,556 *442DA51DDBA11E4ECF2CE3BCBDA53A8A85FE9753 DEVIKA.SAWANT
661,123,557 *44240FAF405C33D4D2FCA04C8A63757CBD98F8B0 dewayneguadagno
661,123,558 *442E5D042F9E8894D211F2189340B7BF01D94798 dfhp4
661,123,559 *4425F23E613942E6FA417F8D48F48D78BBCB96D7 D%.ID
661,123,560 *4428E3DCE5E86E7F29FCF2AD2FE812B6465D7F43 b####p.~0~o)x(
661,123,561 *442BF5C6668D52B5F4ED6077C8278309186D3D1E DOMINIQUE.KNAZS
661,123,562 *4422E684220A555C8FF74BBA782CFE97A8746C30 BRANDNEW(FEATKANYEWEST)
661,123,563 *4426C0556DD2BF39AB3A492991177A0C53655BC4 DOUT3
661,123,564 *44254E6831682B43B583CFE279755EBB1FA6AA69 BRENNAN282
661,123,565 *442AAE9A33DC1A608C358F4A169447D42FC88998 DPT9Q
661,123,566 *44220B042D22A8E19E8D1B045579F08783D790F1 DREGGED4
661,123,567 *442C48D2D1EBD263418415C004C3BE2CCBA2ACF9 BRODERICK.REINHOLDT
661,123,568 *442110AB9FBCBA87529CAD979CB365316266A9D0 DSIQG
661,123,569 *4422809BEC7A0751EE23B11F9ED1241225DC5C0C DTEUB
661,123,570 *44265E8A9765E803E906A5BDB473DFBED7ADC686 BSABC
661,123,571 *442023E61AABB85A9DA353CA70C668264CE1A1FF BUFORDRANNELLS
661,123,572 *442B84F7E1B33E68E0B71F77F5EB59E177DA6DFD BUHJ
661,123,573 *442E1F0BC53EBE7417BE8F5C7FB83C491EE1A29A DWAIN.MILLER
661,123,574 *442E8D0B9E05DC965EDC5A8E93B5DDF9E4EF5954 [email protected]
661,123,575 *44292A0C84391682D1F15915DE20F3B30581F94F BU?U2
661,123,576 *442A5C94D498B778A91E6BF560E8DD6A355FB920 by.ke
661,123,577 *4421BF6CC11BEB1730DEEC27FC123128F3AAE86D c{=$
661,123,578 *44226E578B1239615A8D9B4B2A8E39933F9AF852 c0ns0lda73s
661,123,579 *4425ED1A8E4E69A72A50DD928435A93292174000 EDITHNAFANUA
661,123,580 *442B66AF36A594001D0F0FDE5E3C35AB77734FFE c2t?s
661,123,581 *4429A3BEF653D4CFC04DA20F666B41B8932623A6 EDWARDGRACZYK
661,123,582 *442A241E7294F0F86ED8D4241740F1916603C9F3 EIMAJ3
661,123,583 *442D10EE43FC71F5D4EAA9925F31BB83D408357C CANIFÒRM
661,123,584 *442AE6A37D90216914292A2C73B7ED59BF2FD57C ekrizeb4
661,123,585 *442DEC15CB7A6B9F68E0736E17D373D04B11F94F ELFENBENSBOLLARNA
661,123,586 *4427C703B8B68870B2BD9BFB2435993111AB5861 CARLOS ESTEBAN FONSECA
661,123,587 *442280A78A5C57954905DA5F14378427E8B6DADE ELIAS.START
661,123,588 *442ADA83BFFBC890285F4280CDA2477ECEF2B7F3 CARROL.KACZYNSKI
661,123,589 *442034C630D60031DFFCC090092DDF2E76A79B8D caseybaniaga
661,123,590 *44263E83CF560EEED6FB8102A86B99C41098DD2D CATEGORYFINNEGANS
661,123,591 *4422DD1D2020426BB9AF4D1E9C401AB50C8A655B elmopanchik
661,123,592 *442C1ED295753D1378497143E7A470F7500D2534 elq8
661,123,593 *442D8787167A02AE046581F4B288C997DCD122CF CCHO,
661,123,594 *442683702284A1483099EF3786636E505898637B ccu5:
661,123,595 *442896AC1DCE329304873E2A005D9FA3014BFBD4 cecilponiatoski
661,123,596 *44285E3919CE78BA5AF291C9EBFB4CD1C0FC0B05 cedriczinzow
661,123,597 *4421FEB3BC44BBF28EE97F3A0F711FD21893D3CF ENRIQUE.SHEU
661,123,598 *442A5AB7C0C919D722E4328D40B4C7C53936127C ENRIQUESONNENFELD
661,123,599 *4422E98577402661BA841888299F8C68F6AEFA9E CE$RO
661,123,600 *4420E018641E0DC8A7893A06BAA9A438B887903F C{F3
661,123,601 *442F5130C3AA125C84121FD6116C7FB768237EFE epmokily6
661,123,602 *442C519BA2611093564821C77CC22989546FA2B2 CG6SV
661,123,603 *4420E6618F1B51EF0264046E43071DEB7C8F63DB er&e
661,123,604 *44291143EA82CAE2DF9069604A9017C9EA18B18A chauvinistischer
661,123,605 *4426F036236BCA8EEC23BC7898613132D731E7E6 CHELY.ZAMORA
661,123,606 *442A4D7DF1EFCCCA826791F59C9872DE9348F1C1 [email protected]
661,123,607 *442989614987C247F5EC3A219A0F5A9897CDBD7F ERNIEGERLOCK
661,123,608 *442F3D949992037CB66EBAD3986C825C9A33373A CHICKSER
661,123,609 *442D74CC527E86D7E0DE8B2996A2AEB9F21A6FD0 eslaveoted
661,123,610 *442B4FF7828E27D6AF778B5223C59B946DD1D4CF esperantistler
661,123,611 *442B7EB96600C57D383511D5F20017B9265A3E00 etude-no-4,-fanfares
661,123,612 *442A7E7993B4156528F0C8A4B869C4E1C580553C CHIRAG.MISRA
661,123,613 *4429C63A94EBE86B04E7964C1E0101DB76144E6C c,h"l
661,123,614 *4428AA4DDFD445CAF2C40119812B8D14F6A51335 CITASSIS6
661,123,615 *442DCF4DD3BC4C981564BDC1F645BD409EFC93FA EZEKIELLOFTON
661,123,616 *44250FD589AB3F5A72F23A9B76BDEF83DC280801 c=ivg
661,123,617 *44291BA0701F550DB43B41B5793D5796C15871C4 fackeltet1
661,123,618 *442033BA1373D017BA072ED81235157793F23D67 fagraadet.
661,123,619 *4423F42CCB98D497329DAE2C9FEA074D9D1C060C farjestad7
661,123,620 *442C8A09C975FCCC44CC874DB392FABDB59D2A67 FELIPEGARAVENTA
661,123,621 *44284584582AC2EF152122F17E454B826D14C96B [email protected]
661,123,622 *44251F9109FF81484F7EB36DD25303BBC8E7BB22 FERDINANDDAPURAN
661,123,623 *442BA266E6994A265B71719B7E71034419A1C578 CLH1A
661,123,624 *442767FB7F7548DDC4895C238B98174EA15EE0ED cliftonterpening
661,123,625 *4425B84E670A4629407A8CB52A28FF50DE6A11FA CLUSTER-OPENMP-FOR-INTEL-COMPILERS
661,123,626 *442A922D63FD928265C8F1ECDE732E36A1B0C5FD cnp4s
661,123,627 *4425489EA19139768233D09644B7A856AD1F71F6 fitzgerald4u
661,123,628 *442FA6B0F7A751FE3548B42A67D7CEEBB49966AF COLINSWOFFORD
661,123,629 *4429FC7C3ABACDEE83B6CBE644741364A131F839 FÖLISMERÉST
661,123,630 *4427B6BAC71E2D1029453D1B5C0698C3611A82CC foramoment(radioedit)
661,123,631 *442C28D7A837477E071AFFC00BE0D0594E771C3D CONCERTO.IN.FDUR,.RV.455:.I..OHNE.SATZANGABE
661,123,632 *442B6AE5CA88FFC65C3C27E33F40F0BEB1BC07CF frankieherrold
661,123,633 *4426598837FFB38A5FCD16143533F6EF41367E3C franklin053
661,123,634 *4421D0ED777FE18277A5DB5E774E586B1E7FBD45 [email protected]
661,123,635 *44274F75F44F8A5E5958F42E6663B781C78548C9 cooklesses
661,123,636 *44264F31147DA70E08A80293F8E731757A927226 fredricfleckenstein
661,123,637 *442C68CAEDBEDD6AB817443498676C183A7860BE coreyfindlay
661,123,638 *4424BF7D2966189AA2663A3E0565C0598CDF3D95 freelancehero
661,123,639 *442B7DE8ED0939A3C00ED018FCCB652159BC0063 CORTEZ.SPENA
661,123,640 *44214B8CE1F18B5F2CD5368C632DEAABB38D5D01 COUNCILAUSTRALIAN
661,123,641 *442BB3CD0715302B612915E9510CD631030E2818 COUNTED3637
661,123,642 *4425C42BD36F2FCB4F1A12969DFF3F4BC4C211B3 CP3(D
661,123,643 *442960E9F92E02117ED3DE781BC648D35351C58E CQ"R-
661,123,644 *442A05C762DD6E7818BA184B21FFC1D546F232F1 crcumam8u1a+ng
661,123,645 *4428EAFC77453725674C69688ED1E52DED5EE5F7 cribcrib0
661,123,646 *442F58BF32C32024E5A43C6805043C471C584F06 GARTH.AZER
661,123,647 *44202D02FE62CF46633E96AFE99676D6A84C9908 GARY.VANWASSENHOVE
661,123,648 *4426C2BD436030B5ED655AADE751CFD5161428D5 CRSCAS
661,123,649 *4425ABB7C8A1A6350B727AB19625FAE2FEDABFFA [email protected]
661,123,650 *442CDCB3DC59109BEF5071B6D06EE2EF425765CB [email protected]
661,123,651 *442F69D3184E87935102184A4BC2AEECF1AF3F47 csc$a
661,123,652 *442A06AD5D99ABED701D43D6FBBB25D4E3B15D33 cswht
661,123,653 *4422F592E112B78A9B2F55D3D25ED9B824E1E476 curtismcmasters
661,123,654 *4425E07FB4499B2EF4B22FCF3D318092E1719D6D C_UTO
661,123,655 *442BF69532DDA076A3DA8AFE53FB8A1A9A39B5B2 ginnizle4
661,123,656 *44258E985F175D4BCB5B0F7D55EC9CC3CA41A3D2 girahsor
661,123,657 *442F108F592A6E8F1C8E1CA7D0923CE38EB380DC cwgco
661,123,658 *442145ECA5A8EB94920E65B9BA78B7F95AAEAEBF GORDONFREUDENBERGER
661,123,659 *442DD8C74E5A1D7497B7B65EFAA3EE66A0DC34EA [email protected]$+
661,123,660 *442E16DD01696FEC43E716472E0062780BAA085F GRANTKILBURY
661,123,661 *442E08426BC4C07CB8FC96D49E021B4BAEB7D17B grant.rix
661,123,662 *44279840E7ADEFBDFC0B2769CB69D1B6F41F6561 D1$1N7E9R47OR$
661,123,663 *4429EDCD5BE9C8472E4DF49263CEF4C0A828C4F4 GUBBKEPSEN
661,123,664 *44237ED5927EDED67110C69CADD636AB4558670A GUILASS
661,123,665 *44260633EA8912BDCBBC68F26A019488D6C40E1A [email protected]
661,123,666 *442C244AD7F84E7BED76E116D92F2D2C1D9AD253 gyneco1ogi575
661,123,667 *442725245E0E12C02C4CDF9AEE24DE9E5579FB4B HA.DOH
661,123,668 *4424E7D475D19CADFA266F2C62B42EE64BC8B65B [email protected]
661,123,669 *442AF8176B3C8792F4D3C4FC4DC3F0295E4C6D68 DALEESTERSON
661,123,670 *44210E6D863CB9391D6C37F0D71BBA4D294557BE HANKJUEDES
661,123,671 *44204982E011348F72957E599E970DA9DF87E6B1 HANKLOCKS
661,123,672 *44264AF90C496AD593C3657D07E7FD3C3C97FC76 HARLEYRAMTHUN
661,123,673 *4429A5DDC217E849A7050E001C3090033D8B520A DANTE.FOGLIO
661,123,674 *4429CE1971A0E78447CD6B10665197557B80B1F6 DARINGS
661,123,675 *442963F815824226A89980F1A98913C876045291 DAVIDBRUECHERT
661,123,676 *442B04ECA5CF5290CAFA70D3C220218DDB25A283 hello11902
661,123,677 *44232E2E5B6C77D062F199EF832E08F9E568F47C db6o
661,123,678 *4421EDEF57CDE5143083C7DD1A24B17E2243FF6A D,"D?
661,123,679 *4426332B9913B10A0D19260FAC9903D3AA983D1C D"DWV
661,123,680 *442FB8FBD2951F18E5327C53E66BAB38B09F3957 decorian
661,123,681 *4429D84565D3B1A7753A2382238D82D09D0D969B DELBERT.PORZIO
661,123,682 *442F7F9707BC7DB5DC33A95BE92B90F117DB0F3C hossein.hedayati
661,123,683 *44254D533FA0A5C6A0273B395129787CF7C78756 HOSTERIE
661,123,684 *442ECC0148E1FC52BB1598B4B2CBEB8BB13316EF demeriting
661,123,685 *4425B818BBD9A8800201261F39B100D175B00D43 [email protected]
661,123,686 *44254637C6EB3F73A19A2DCF2226AE8F53E20169 htc021968
661,123,687 *442D321C4793B23863333D9F14B150013C0BE9A8 [email protected]
661,123,688 *442E1004BDBFB86BF23667AA0562F7B4F0CF7BC2 [email protected]
661,123,689 *4423D473762A7237A7EF9DD5B71C9FA6B1A54746 devetapadesat
661,123,690 *4420F71AF3B21BADC02F0BAB2A51AF4858116E3D D#FBT
661,123,691 *4422AAED1099AED08F821FE8E416EE3B9A853B1A HW2]
661,123,692 *4421B9FC1FB887EDAB19A074CAEA52B3EADDE2D0 hymnuspolaris
661,123,693 *4421A37D897838E0110D5003E64B1E6BA71137EF DIATR0PIS
661,123,694 *442E37A39522A2220C572B80A31B5D75042B9858 ICHIDAIZ1
661,123,695 *4423332ECAD3ABA1129E9A928E143E723D9E5264 DIMAQU
661,123,696 *442A19B3EC1983ACEDA8A1F722FB720FEA952C9F IFYOUWANNAPARTY(FEAT.THEOUTHEREBROTHERS)
661,123,697 *44266EEBAC4C20024D375A81D177818DEA56AA10 IGP一樣只有兩條像素流水線。南橋方面,可以配以IXP
661,123,698 *4422F24098734FD76D30069ABE7072AE7A925DBB ILLETOT8
661,123,699 *4426CF3254F3293928B2D19CBEEEA22AF5D3BF85 INFO_ICON.SVG
661,123,700 *44233309226321365588025FDC1693CD124CE90A DOI10.1002CNCR.20618
661,123,701 *442D901AEDEA8FFCE83B80B10E8F1D2192BCE251 DOI10.1016S13871609
661,123,702 *4429780F4FB8D6B6A74A3E6B206E4056636BF758 INTEGRERET
661,123,703 *4424B335D4589A13E3D4D86F28E1D9650B76D1C4 donnieherrick
661,123,704 *4423C180A43DE6AEFAAE08EC4D89552CB78E14F4 DORSEYRUECK
661,123,705 *44249B3514E18B1CA3CBAF99799153305DC18615 iselma.brunneipes
661,123,706 *442B9E71EBA0B139C6CAB1FB0C2B0D117212603F DOUGLAS BUSHMAN
661,123,707 *44250E035B2D8EAEF893B71F1A648BDCCACA0234 dpli;
661,123,708 *442AAC29F29DF89CDFF66228CA5AFD11BBFE2BE4 IVATSER2
661,123,709 *44206676FEC0E8E95E08FB88C5F04AF5CFE10DD9 DQR9Z
661,123,710 *442EB7DAD6478C6EDAC43C10A67EE327EBC783AF DRUNKEDE
661,123,711 *4422D2E33F0B0D5F85000A98E83096F4CB7B455E jad387
661,123,712 *44265E61F17EEB41C2EFBCC66ECE726D0D413DF0 DTL%/
661,123,713 *44236347EAD3DDC31DE005F4EE245B0EFE40261B JASONKREATSOULAS
661,123,714 *44276BA89960F6FAB9DCFD0EC40C829D4F3F2B29 jasonskorczewski
661,123,715 *442BED14E135E715FD03128BC2445F18BBC3308C JAYATSENO
661,123,716 *442A89F5A64BCEDE235282B59C2CEC6A4969B0B2 [email protected]
661,123,717 *4422464E319838FC57CB59EA57D2B7A37DC066D4 dw-wh
661,123,718 *4420723917E9751206A62C407210B83FC2878563 dylanmoad
661,123,719 *44295EB6A02465735D1803FEB40F7B4EA30BDB7D dyrtl
661,123,720 *4429CC48ED5D901360CE95F5B0C3917B6D815BAD E7D'
661,123,721 *442DF18C677FE0C4DB2B8BC82BDEB1251FEAEC03 earlysed
661,123,722 *44225D6CC9DE3C4AFCCF5889FFEFBBE726975BC0
661,123,723 *442812B0B3F8E4F529EAAAD5573E4D7BD391574D
661,123,724 *442194B7EBCD87DA2381ECBA4E3A3F03AB44D925
661,123,725 *4421FC129E7228E8AA3EA4A20DFC5556799CF2DF joanbertini
661,123,726 *4423C4F1EF230A8D256BE90A9598042120D5B31F
661,123,727 *44210DFA88F6ED88CE84696C33D34648DDAB6C96 ?
661,123,728 *4423FE6867E1A0B83EFB29F13B8A7648F358C737 
661,123,729 *442656B3231DE6A53365D1B1FA7F1FCC569A0B90
661,123,730 *44248667591C9A55AB71965D020A35E5D89DE102 Y
661,123,731 *44231828732CD76DFB1C9EEAE62FB496D74622CD
661,123,732 *4421AE0AAE5FD738353FE1EB0748946EEBFF6CC8
661,123,733 *4425CD2196E1FABA7485D6BFC605E775C22170A5 qc|cZ)m
661,123,734 *442A7176B1CD175DC4CFDECEF004908E60410F1D JOHN.PERS
661,123,735 *44269A03C2900362ED21B77BDEB032D6F21CD630 JONASVILHAUER
661,123,736 *442324C06FCF7F1FADBF7E7AB1804F98CD97B9FB JONATHANFARROW
661,123,737 *442DDE92A547E0D5CBDE5AC2438B5C0C863DA8A3 jsi[
661,123,738 *4426F8763C387F25D3AEEF3F33F52DA2EBF490BC [
661,123,739 *442D4635566E23E7BBBC91D1D7F7D86CE8B5AE78 b9
661,123,740 *442E714C1D1E25803237738B70CBEEC7D6D21BF8 &0
661,123,741 *44274A836E9688EF9D7116016A487B5EF60DBAB4
661,123,742 *442305E6A664C6967C98046919BDD2AD8D68C94B "
661,123,743 *4421D0F189DBF09368BB27F624C5C3C5378205CD
661,123,744 *44235506411888C6B94496C83267983385DB0C59 just-a-bit-like-me
661,123,745 *4423204A2DF928B8BA1B34B9CC08AA8FF34F659A ;
661,123,746 *44219A85AF9A8577FB291AE28E224060E97C221F _
661,123,747 *4420D2CC24B1D437E04B6F5D03D3E20FF742100F 7
661,123,748 *4421AAF193B6107C99A21B69CA005612512C4A2C ^
661,123,749 *44254E0F1EC8C6BC791692011B5F67A2C4F2CD7E KAJRAGATSJ
661,123,750 *442E1EC5EE534C73F62181C62429E7ED5B9FC259
661,123,751 *44291D43B46CEA6AB3873012C868216C0370C244
661,123,752 *44274310361395F705714076E17FF270AF8B8E89 kappeler68
661,123,753 *442011F11D5A0A650D563D7C0E75E8D6135057AA kashita-tyler
661,123,754 *4428B3C60FB63C67E2F36D71FD84CD6CA9B7F79B o
661,123,755 *442790161385E2E8F94B25D985B6BA4AEE6456F5 KAYPIKE
661,123,756 *4423A0A377A64AD288BCC3BA7150761FCC70BEF9 KECALOVY
661,123,757 *44226207C0BF17C8563671D258E72D1B02A3C354 a`
661,123,758 *442903777C19660766EA1CC9B9FFAC0B8F010F53
661,123,759 *4424B61A08E6EBF062C4670D224A8137432DAB40
661,123,760 *442ABADB59E9B6E95FA73FC6F2FEB29AFC2E4A59 eT
661,123,761 *44223619542D3557E0F85BC599287D008DC8B08A kelci
661,123,762 *442E453E6BB6ADCAEB14E25B8026F6FEC8AD4D67
661,123,763 *442483A2B7FE5286FF8CB6B81C1E0951F6A6A271 kendallblackbum
661,123,764 *442C0DEF97237084C8F715177BC19A0BCB7DE1DE kendricksudol
661,123,765 *442226CA24942AAF00BF4D4330F66046C7CB1883
661,123,766 *442BF73E5F7A45D8F5D72BECB3200DA9FAB081FE KENNY.TACHAUER
661,123,767 *4426D5E24E667AF7907E0ACD77E1AFBBEF759272 kenpardy
661,123,768 *442DE4157D7BBE1C118AC3E6B79314140C235DED 
661,123,769 *4423FF8E19236078D2D813806A42A9E4F8CC6FDB KESIKAKE8
661,123,770 *442DD818BAEBECAFE1366D9EDF8A540EC41767C4 J/ًY:d
661,123,771 *442A75C2293D431D3FD74B074FDA56F08283D5C3
661,123,772 *44235DBDE161406E52ABE3F574DA3B2A15843D14 !
661,123,773 *44267D4A6281D4F496CF0ECEA553DBFE6FE058A8
661,123,774 *442C37CC3E7D2C92418B45733D00436FD77EDD90 [email protected]
661,123,775 *44207F779F6CAF724BB73773528B765AD66C4667 kheg
661,123,776 *44204602517851C0D4CCAA082DD4A5849AD436E1 KINGDOMCHARLES
661,123,777 *4421BD4D6791365D5992FBE4B67440D8E3412888 CD
661,123,778 *442060D7EB8F3384697DD42D2DCC624F704BB04E
661,123,779 *442171FDC66C543BE38F6E431C32D96BF6D15B87 kipbolay
661,123,780 *442619A85336ACE8913A7475E8AA97AEE490581D (V
661,123,781 *442C33FCC785FCBDAF58EBB79A78A7D655F79D90 kirkmccullum
661,123,782 *4428255108592290793856F3BAA4029B72A77121 KIRKPETRECCA
661,123,783 *442EFF78B230BAFE0143B3AADBCF24E3F314405B KIRT KNOX
661,123,784 *442CD92404BDCD6E75D100E939D61D78E561FDBD D
661,123,785 *442C5CE8061DF4C63BEDB8C8D4C23751BE3BF6D8 b
661,123,786 *442545B8B7415E4D23FDB163DF12F7BFEC98D0E0
661,123,787 *442541F265A6253BC1C8B9A58DA6DFA4373ABBB0
661,123,788 *442488898F73D346EE8BC82E6C2D319AAADE8F5B =G
661,123,789 *442824BA9EC33E5C13F33E082DF44743A646856B vR
661,123,790 *4424ECCB4067B4DD898FF72CB6C2818DF86C08F6 +
661,123,791 *4420854F7B88D18DF04C4F707605DBDCA6A3BF31 1
661,123,792 *442095679A27483A3B0955AD7EE10928A5C6EE7E konstmakaren
661,123,793 *442E85523B07D1274FF593C27B5C30BF2CF0DF31 kossuthlajos3
661,123,794 *4425F11BED728889566EF5C653398EF6170D15E3 KPOLEGI
661,123,795 *44262BA0EA37A527146BC0E51E808535DAB2997C KPXK
661,123,796 *442A290D174F2E20F8780AA9932D38EE07886E27 KREUBSWED
661,123,797 *4425D76B3305FCCD2EFF1D1C227EC6786514425A LABORIUS5
661,123,798 *442CAEF19E4C0DCF9B56C260A36C2E39ECDEFA69 [email protected]
661,123,799 *442A226E3AFE467E4543B40E235680DE43E11605 LANUVIÓBA
661,123,800 *44277C16C84062B5828B9ABA70680DE8F6348406 LAWRENCEHECKATHORNE
661,123,801 *442AE0B6A794E8DE83279A0116DD41BE8C8EE94A 1019820 PUNNITUSTIEDOT VOIDAAN N
661,123,802 *442CF2A05DB793EB45488CA72FA40895353C0873 leg1t1m1zat1on$
661,123,803 *442098C4FB54B0E72551E9DDC1B3EA6894BC44AB 1204962 nykyinen.k
661,123,804 *442780BF38E0EDFCFB35D4F50A6DA8429E3994BA LESTER.LUFSEY
661,123,805 *442B242224A5B1A1A0E03608A39CCC48F8209639 letoya-luckett-asks-fans-to-choose-next-single
661,123,806 *442299F39CB94AFA6D63D2A543D8BA41A62E1997 [email protected]
661,123,807 *44296C551278343E3EC525A1967416C7A963512A 1771235 wo.maenner.haeufig.noch.warten.,.da.langt.sie.schon.zu..
661,123,808 *4423960D25F288BA6B892B8B26013DCBEDA5891F [email protected]
661,123,809 *4422F9840B08079002D6D5996D4F7F655231BFD3 LIONELVERGES
661,123,810 *442D7E9F273948D11DABFCFAD3D50FF7076F7433 LIONKING
661,123,811 *442967ECFCFC1968DBFF4D64BBFD69EFEC6DD7C2 1 ABOICAKOKOELMANA
661,123,812 *442DD0A08995DBA12AF0DEFAA5F069A04556609A 1CAPE-SLEEVED
661,123,813 *44298E830B7E5CB7835337FF0BFA17489B29C1A7 1 CLUSTERTE
661,123,814 *4426E4E87D8C5577E6139099AC2CA3F23BDD51D8 1dippon
661,123,815 *4421B68BCFD116C6B21AAD17140F036DCF986A3C 1flocculant
661,123,816 *442A70C83EA0696A13E9BF68159B065309642530 LOUMOLESWORTH
661,123,817 *442B91F32BA5AD5C5686FF452A3CCE097509ADAA LOWELLSANOS
661,123,818 *4426F4BE6D7BF027D7D93007C51923858175F6B3 1.JAHRESWOCHEN
661,123,819 *4424434F02D600A6654B0C56BA7C786330CCDB71 [email protected]
661,123,820 *4427F0B68C91F3B0090A5D3FDF3AEE888E83B39C 1.kuba-spionen
661,123,821 *442E3BB2C6E1E92E6C9E05C8D3EF05131CA144A1 [email protected]
661,123,822 *442EF130E76D4882CC4E93050438B2263345A228 1.multivitaminpraeparat
661,123,823 *442ED42A3DCBC70128486837D9A187D037531B62 magnesios
661,123,824 *4426DD1FCDF3F0A5F20BDD33EF3668F94E133F3E mapmaker
661,123,825 *44275D93505B16AFA07954BD3BC74C5CC1509A9F 24 DISORIENTATED
661,123,826 *4429AE0EE761D7927C476AEB2E7B8718CC68B931 MARTYRNS
661,123,827 *4424354700A042CFDF3F0AC932A752C10B50AB6B MARWA MIRO
661,123,828 *44246EB0DD3033F1EFA704F511039BACE8E9CCF7 [email protected]
661,123,829 *442ACE0A9E0C9D11036EE9AFCED3573EEB4C2874 2572155 RANTASAUNAT.TAI.VENEVAJAT.EIV
661,123,830 *44233C03BB26AC7C6B4ED0CF378D046FF2F31D2D mattbale
661,123,831 *4427F68759C1E4B968EDB65ECED2797E1163BF6D 28626 o.gecenin.gUzelliGi.anIlarImIzda.daima.canlI.kalacak..
661,123,832 *44245603C8ABE90D83F24C68A237746522CC3618 [email protected]
661,123,833 *442C5FAF5509888FE57D745118196B30C47430AA MEAGAN-TRIPLETT
661,123,834 *4423809995CE009938083EC24F26D7CCF108415C MECKENHOFF
661,123,835 *442B6390965D7FD685C17A76160B760D1B8A52DC 2BARNDOG
661,123,836 *442B6429CA9D27C369E957F3E36FA92C0DAC1DE6 MELBS
661,123,837 *4429B1D494C83959F3B258DEF0B296FCDB278397 metairiessaintquirin
661,123,838 *4423EFA37097E304D9E8D90A843701261BFB644D MICKEY.STUMB
661,123,839 *442739F5B281EB93901C1CD000E854F22E0545E2 3AANEGJIB
661,123,840 *442454347C2B98AA088B7099BCEF4392494F2522 MILES-EDWARDS
661,123,841 *442B0E603DF0AC344EA0A0E4805731BC6ECD5CB0 milesreichelderfer
661,123,842 *44240FB2BFF2D33019520017E30DB2A1DABEDBC2 [email protected]
661,123,843 *442BE2733F557F46812401C7AA256E440EC442D7 3DECEMBER1809
661,123,844 *44252D2F14571F48ECF436482D1173930CD8F8A3 3THATIF6WAS96
661,123,845 *4428F991E2B9230088814E4314B8262729BC69C4 3TKEELEG
661,123,846 *442E857418873C31B831D1DC5D7B015DA1000353 41-ANFUEHLT
661,123,847 *44205FB6946658F2418A3DD1A8102E11DB1E1F6F 4bartman1
661,123,848 *442C3A1367DA184CCE2FEDB03B2551C0550FF711 mooie island ep
661,123,849 *44274363DBDFCD0C930E0C4CD3D4F75A2068A25A 4INFORMAATIKKOJEMME
661,123,850 *442770D68A524760E60677724FEDEACE589C5296 MUSIVISUAL
661,123,851 *4426F581B49BF70E878F8B676729201B6966BA5C N#.!
661,123,852 *442BC45304F234815DB60902435736DC042EFF03 N0B!L!+!E5
661,123,853 *442E47413DF4A34D660A9B18F5740C89232EE6C1 NAPU
661,123,854 *442C8C6E7C99B74E0D480D1944F7493E62A0A104 NAZIROHH
661,123,855 *4420ACC92DDED900DB9842CE5E7B90EF0E2F95CF 5ARMBLANKE
661,123,856 *44222DCF145D6E3027D4F9F747ABDF34EC0553CB 5JOSIEANNMILLER
661,123,857 *442C0020F36EC3D41B7199B4B0AE532D0033C56E NRMNTWN4
661,123,858 *442A68B3361F290D9CF821DAF337E31821308C5C 5SEBRENIE
661,123,859 *4429B717110D230C78DD9E2F85976B67E0756584 OBIJELU1
661,123,860 *4425ABBA385AF33D136710B1107B482E796E1E65 6AMOHCIRT
661,123,861 *442C13C44D7F0C3D341B3B8BFDE8B71DAA8FEFB4 OLWV
661,123,862 *4421C5E5A1F3297AFFADB7E21ACE4E07E578F7BB 6CESSIBILITE
661,123,863 *44296E9B5852CE8284182412F5824E1E90DEDE61 op4que$7
661,123,864 *4421D5DB34C9B736C97A45C62AB05D5805455DAC 6NEBRASKADYLAN
661,123,865 *4421B04E59275A3E6F7026B62FE88E2BBC3363AE ORKIESTRAKAMERALNAFILHARMONIINARODOWEJ
661,123,866 *442DE8F53E0D0FC3481B0F75BCD6052254B6B452 6SCARLETLJF
661,123,867 *4420E57AA6E8A0EAF04EAB5F73C966FAF380F43A [email protected]
661,123,868 *44285C00C9D7C531FD77B2F0F2212DBEF9CDDCC5 os unidas caminhos do amor (maria dolores)
661,123,869 *442D7D2B673BEEF98B46939665B4CFA7D42F042C OSWALDO.BARK
661,123,870 *442529CF3D24BE9C5833C20D8BC49E40A2198768 oswaldsshirt
661,123,871 *4426AC18078B667D4CFD7A831EBF004892E1F19A 6TIFFANYBAILEY
661,123,872 *442160E6B15DEBF7A07821D4F0CE55EEA7E8F35D ougenen5
661,123,873 *4428BE94B92AFF23195E71141F29AC2A98330565 726588 PELOT.YLEENS
661,123,874 *442A4BEA4E00EC7C5144754EB4604022DDF82905 738JAYLA
661,123,875 *442CF762B16EEBE08B69A6E983A5B846E3D632E9 [email protected]
661,123,876 *4425B48D9A52809E19A8A9A6E28CC798B25A9849 p42226
661,123,877 *442D726290236AF9F734F96CF0099D41220113F0 PAPPTAK
661,123,878 *442C85D3E3BAB5DDF238B518475A1B589D4F7DD1 PARKER.ZIERER
661,123,879 *44293E3B82FEC02EBEB8E2B6C1B3BA984292B00C 7BUDDYORANGE
661,123,880 *442BFE8BAC92950E2A1004228F059ADCAB5BDC83 PATCHIODI
661,123,881 *442C25B817968A15355BEA08C21F0E9C16DCC8C6 patriciahillard
661,123,882 *44222A7501CC520676D52FACDC213C70DC28D4B1 PEPSI
661,123,883 *4426B74A3F06CBFBBBDEDE473673216CE66EA942 peruaanse
661,123,884 *442250F91794D4FFD2CAB695D8EF957685A34EC4 7XCOUNTRYGASMAN
661,123,885 *4422CA5979F28953B60567DC96C8C7027457A1AF pinkfloywicked
661,123,886 *442510673AB7FF9BDDFCD613545111B412D5B707 P_NJ
661,123,887 *44205B55D871E23A8B5CDFBB9476B8CB08E3CF0C pr3$7dg747or$
661,123,888 *442C2E531F0744F29F72F784DFDE34EA96EB35AA 8CINDERLLOYD
661,123,889 *442398143510E45EBC8AE0CD8BDEC20BFC0E9D7F prekndergar+en
661,123,890 *44268C5B298F09F902D97BD588B901C64D3686A3 8ETANIMURREF
661,123,891 *442EE6D8C6C7E5F16E0B9131EA7F0554B414527C PROERITROBLASZT
661,123,892 *442B7027E90702D6222F6A35FD612028442E5320 8MARYJANEIRISH
661,123,893 *44207F608552E7AE79D0A5113B77ADEF0DF6FD87 [email protected] ~ ` (o_-)
661,123,894 *442CAF7A81442C4EEBF4DA297BFA16CE80DF0B88 8PERUSTARKOITU
661,123,895 *4422503BEE57EF1F310EE229D0863CC01828C709 PVRLJKT9
661,123,896 *442C3DE0F763BC757DF12FA046E0A499029BE41A 8ROM1N3S
661,123,897 *4428F3C83866CEE722D77CCAA0AD2665AE016446 Q=B`~`~:P
661,123,898 *4422160C5661A14AD2054FC3F6605F4804710820 [email protected]
661,123,899 *442C5634C5F6A9238EAC0B09F83DB627A153BD40 [email protected]
661,123,900 *4421371C2EDBF4F992FB26E071F0712752627860 939312 ARVELIMMEKIN-ETT
661,123,901 *4420604D97F67798A04E8DE9A89360C7F71C0A05 [email protected]
661,123,902 *442A6850517842341251D56A2695930E6DCD5316 9AUSZUWERTENDE
661,123,903 *4427E4D5FD07345EB72F87DFAD887615F3237DB9 9BANANASMASTER
661,123,904 *44215C0A6C2BECDA9FAE6EF21776D41AED10D29C [email protected]
661,123,905 *442A935372E8A7BB71CCD7D0142A3423C1E137E2 QUALIFYING-ROUND
661,123,906 *442F95990969BB77D7B6EE65C0E2AD4A7A5CF90F QWERTNSS9
661,123,907 *4421C31947D3D6F8C7632A9442F526B42E344DBC R75552
661,123,908 *44269D4EFAD3BF35C59B7F800767F9DF8D989771 RAFAEL.BENAVIDES
661,123,909 *442ADBF0991397EB596BD385674F0447923C0A77 9USROTTEN
661,123,910 *442C14838132BB3E7D009C2A55C8B4A81C741CC4 9vladders
661,123,911 *4428B89940C610874C3DB5354E03B0B600809E3D redilspo
661,123,912 *44225DDD6C8C0AC08DE31F9E211F2BF88FA951C3 REFUGIORAUSCHENBERG
661,123,913 *442B8D46844F9ED2625672CD701FD7CB00109FF7 aac?mg
661,123,914 *4427C2716B6727BDAA362D9E2657295641D2849B REKURSIVERING8
661,123,915 *442128AD0DCD92DB614F17AD85F870752E2D4C07 renatalucia
661,123,916 *4425D3879F97EF14AF5D8BE3EF423C0D1E694325 AAE}Y9
661,123,917 *4428B0E11C18AE2C27C5057CC06FB38DCC58A9C0 RESYNCHRONIZE5
661,123,918 *4427AC29D71DD24037B2D64820E12D3B962947B8 RHINOS
661,123,919 *44204CED90BB690E19086D2DACF8822E6C33A978 ac9bf
661,123,920 *442772D872D570558032F070DD4E1A22388EFE57 Rock-This-Party-[Exclusive-to-Bump-18]
661,123,921 *44267278F23ED7C27D76B43E66F8508A0C84568C adngu
661,123,922 *44290C31AE5AFDDBA4259575CB3A8F559AE45F62 adtt|
661,123,923 *442FCF51A9B7791482FFDD59B04ADDCFF4FCDF1B AE=%N
661,123,924 *44252EBC416EED0D03CAC54824335EA850F7ACC8 af0&o
661,123,925 *442D008621FDA743A25FC0EC3A54B3E76FDE5D82 R_P
661,123,926 *44248C89505B557ED2E01248803155AA59121A67 RUDOLF.LAPRETE
661,123,927 *442CD8155CA5522FBA9B61B3E619348EF8FE6FAA ahacoidaha
661,123,928 *442EB5941DA429117459F386F0000627BE048ED0 RUTESBSW4
661,123,929 *442067348BD53B3242C3FCD52927333EB7C3E8BB ahøyre
661,123,930 *442E58D82F49AAD09B4FD9EA6EB609DC7BC1D59D ryanatencio
661,123,931 *4428044C0782266DEE1E64696FD7B723BA09602D SAHSARC
661,123,932 *442279F8DBF471425A61BFEEF6F9A0E6A6A7E5D5 ALATALOING
661,123,933 *44245D4CAEA2AFB3E79168B00E844F92EA11B782 aleciaperkins
661,123,934 *4424893224A1CC53295034CDC14C12A742130443 ALEX.SCUDDER
661,123,935 *44279FC3EFAB78A8F40DFC69BA89B07FAAB9DBC4 ALIATING6
661,123,936 *4425F45F969C8F539AFA0437AF50DF45BC07B91E SBGNCLTNS
661,123,937 *442E328630AD97FFB8CF1B6CBD372ED0C812535C ALLANTENG
661,123,938 *4421EE7F5A7DF7627E82E4688C2C47F26F73FB5B SEAN.GAROFANO
661,123,939 *442F046B489A8B6B12FBE943208F0321598D3DDF ALVEOLOLABIAL
661,123,940 *442E7244A4C2C9B8331313FF5345FD2C45741F21 AMARA.SANTOS
661,123,941 *4424105D99BFE11F4499836EEC016159D99AB957 ambermansour
661,123,942 *442FF1A2FE98F82EF460D390D1A157D6626EBF8F amigapsycho
661,123,943 *44278C6838323E633612845E67525066428E5511 AMMULINI1
661,123,944 *442BDA3DE080CEEC7C15CD378C861E1B6ACBDBD5 ANDRESBARONE
661,123,945 *4423A0AE749172279006A6B277C04FCCA1078744 andrewseppala
661,123,946 *4424DDDE925EA773C12E102F1260FB4DC7BD9FA9 SEVENVIOLETED
661,123,947 *442F42D464D5BB9C1C50A4C1BD82BCDBEDA9239B SEYMOUR.DILIBERO
661,123,948 *44248CED235628C27A3D37A6A71869CBD41ADEB5 ANDY.PUC
661,123,949 *442FC55CD5B125ABF2D1BC041475B17031092850 ANHGH
661,123,950 *442B8DB0E2639DC5FC90F12703CA0A1ACBED11C0 annealers9
661,123,951 *442E7FC2B3C61164F4D55246C454960C42C1364E SHEEPINDOGCLOTHING
661,123,952 *44266907EF8B8A712670F2D7C3BDCA974633A2A6 SHELBY.KLINK
661,123,953 *442F4979AFDA842820D47402E35A82DC07D0FBBD sheldonpaules
661,123,954 *442922CDC5691D2392E66D4AF5B8677BD3E334B8 SHERWOOD.SAWADA
661,123,955 *442630D979B2CC2F7892B17602B083533318666A SHIPSINHEAVEN
661,123,956 *44243045ED70744F191CD572C7B80C8D71647E2A ANTOINE.LOLLIE
661,123,957 *4428E832E909F104E1C8C5D8AF0D971F1C0D3BC4 ANTONY.TRNKA
661,123,958 *4425EE14616DA7F3C5E86D76A23398F70ADFB1FE antwansiedel
661,123,959 *4426289EB80097DDE77991441E5AA4B50A308A97 a?oiu
661,123,960 *4421AD225908F77F55A422D49C41BF2C450A142D SINFONIAORKESTERIMME9
661,123,961 *4423B1752BD86E2DA25A9F5814F2A5C89035BAD3 SIREYSADA
661,123,962 *4424B177365D0C1EE05342FD4F55A6EBC503AA1F SIWTEEHS8
661,123,963 *442FFEA8463F9434067EF122601D31E3D2AE9547 [email protected]
661,123,964 *44223C0B9477FB5C3540BF6B7F0D8C2299491DF1 SKRBUGEN0
661,123,965 *442DA6D817C639F71D229B9F363E37653617B999 ARINDENT6
661,123,966 *442A1C0D3D70264E8AECDCDAD4AF1F4311FB7B82 SN51SDTCQWK1
661,123,967 *442B73630EBE4CB6E4E2AB692EA4B4B527165B39 snedsned2
661,123,968 *442C5F10872DF5E948EC5324B1E5F6EC8A0CD9F7 ARVHD
661,123,969 *442051029B2D2F899BE77533C04C3F307C407A34 SOLOMON.SUH
661,123,970 *4428C12CA8A2A7879A4D08E8DF54C01E060213E0 solo-richards
661,123,971 *4422278919170EDE467321FA52DBC993C4CFDA21 SOMETHIAX
661,123,972 *4424FE7CC2BAAB1E5C4A450E8B2388812949DCBC SONACOSTA
661,123,973 *442DDD02AE148927BC38F0C829FBA4C215013748 SONATAFORCELLOANDPIANO,OP40:IVALLEGRO
661,123,974 *442566E7681D094B5F648AAF73E371815419151C [email protected]
661,123,975 *442FC1534476B33238D6B90C71745972A3CD0900 assuagab6
661,123,976 *442E607C9BFFFAA408DE632D25C8C92FEEB27673 ATUSKEGEELETTER
661,123,977 *442920766107E34135F51FDDCF7DDE3F506D4E05 SPECIALMARKET1
661,123,978 *442DAD5C4A1816ED0012A844089A956DE50D4175 [email protected]
661,123,979 *442D7523392C3C994682F4DAAA07EEBD3A366184 SPIDERWBPROXYAOLCOMMOZILLING
661,123,980 *44243CEE9418B9DBAD144C0D3824D178F4C2B200 SPISOVATELSKÝ
661,123,981 *442CE3C0398373377F0A4DF2BAC19F0C2D784D00 Squinance
661,123,982 *442B3F82C9A6DD2E5F9E5DF5C44B1F050281823D AUTIOSAARIKOE
661,123,983 *442BA314B7C6BCEAE3FBF783291764ABBE85D24D AVANTTI3
661,123,984 *44253E782F8E2F9CF5463CF31D4BE2919B1CA859 ax+
661,123,985 *4426825786897EF3F1BD78B4ED8537E15389FB04 stellareader
661,123,986 *4426DD5FD49683B196E593F215ECE9E57F6E1120 a(主格)
661,123,987 *442E7713DA321758F23A54CD354F64DBA3B15C79 b--)~`(>_0)
661,123,988 *44246D405219D246131B371D67B2290BBAC6F636 B3%2Q
661,123,989 *4421C7CFEB2EE9100D785338C479DEB230A77F64 B4(R
661,123,990 *442E7AFAC8A608B62CC984DB2A4C43233899E95F SUBSTITUERIEZ7
661,123,991 *44251C7CC1AAA53E4A3FD737077114AA6A4A1EA0 b;8eh
661,123,992 *4422D066108BF31980563D6FF3ED9D359627316B sue-hanford
661,123,993 *4421139E1E9ECC2D2B0B04E5D45B8F7CF38549D4 [email protected]
661,123,994 *44270B2B6DAD0EBC0FE0EC7232BC62D0D9447A29 [email protected]
661,123,995 *442FEB7A97823D908BB68A6DCAE80B5028E929DB SUN801231
661,123,996 *442A7DFC2403BAF19AC541521BB6CE28B4116DA0 baiuf
661,123,997 *4428F3A4ADDA2FD7FF3D46281DFEC4D0C6B98D9C SUSIEMEZA
661,123,998 *4423EEBEA6076A0BB944A5C17C448CF3DA258479 BASFM
661,123,999 *4424F56ADD241DC534957A899DAE74E1740A6D23 BBO&D
661,124,000 *442A55D1FAC05EC3B79E3D95E791FB9BA24C7326 BC0FP
661,124,001 *442337724A7F99CC3862C084D6AC98BD492B8310 BECKEY MILLER
661,124,002 *4429083FD80A7D734101F66F5E56E1845A4DA7BA talaunts9
661,124,003 *4423A3F3868070BAD68D9DC0773467EF87BC3D71 talk8614064111
661,124,004 *44220F309903AAAEB597982936930082B2D5F2A9 BENTONGAULDIN
661,124,005 *44213474CC86592C3A62A98264DA99EDD062BB93 BERKHABARLAH
661,124,006 *442F2155A2BA3C195EAAD7686BA456917FB3CADB BERNARDLATON
661,124,007 *442E8D0E99D46E6702B67C65D7786CA433FBAF8A TAMMY WHYNOT
661,124,008 *44253A8509946AA0FC2754FACECE2B01173E61BD taylor
661,124,009 *442CF6A6A2CE9A07DA6E32C0EEB92D67612BC3C1 BFA
661,124,010 *4420ACD436BC733039D5EB8573BC70C61BE11F61 texasfarming
661,124,011 *442030534CFA1E2918C8FBB1EC9EC5CB498C2B1A biddle160
661,124,012 *442254EB85F99D1406F5D4C966FA1557E6165737 themurphy43
661,124,013 *442EF045BCCBECE7D5F558F75C5C8011E115DFB2 bivvg
661,124,014 *4421226846DFBE3863B2650FD73FC36166D5FC51 BLAND1$HMEN+$
661,124,015 *442BEE4C3E4BB78D7932DEFD4270DA9425B37605 bloemperkens
661,124,016 *4423C7F3852C5C1914EC4D25BD39BA3036F09197 bmy
661,124,017 *4429865C35A058C2A8E5070287321B12C4AB105B BOK):
661,124,018 *442DF6BB7700DC3D3EA5DBA6DD791AD442C3C514 t-ks
661,124,019 *442C9E9F85D72CD86262C33717D249FF9C4C670A TOM T
661,124,020 *442656CAAF70C31C4C56C2EF0E0FE863F1DB641E boydleveston
661,124,021 *4424E9AE55E8E22BE41C2E855D3E43B4D8AC2DA7 TO-PROTECT-AND-ENTERTAIN-(FEAT.-MURS)
661,124,022 *442491AE4E31868A2C33FBAE6D8E4CEFCA484722 treachtriskallion
661,124,023 *4429C3D111B2EF45B8E70A0F6CB89FEB5F601B47 brad.nutter
661,124,024 *442B8D706EB1F41B4228851D407DF8BFAC51E81F BRAINSCOVELL
661,124,025 *442AB317C4E3344927E3403B3AC7DEB613032353 BRAZAG
661,124,026 *4427DE1B87D1F8AA5B802CA0C9D1D5CDA5BC110B TRICK 17 M.S.
661,124,027 *44266D05F3561286DA4C4FD59223075BCC94E742 trink3t'$
661,124,028 *44265C41FBE79790C6294EFCB888E6F4846C7641 BROOKLYN HINTON
661,124,029 *4426828A4D04F3A6E9EB1DD0B5FF94AE2AA6EC66 TRUSS_RODTR/@/S_R/A/D
661,124,030 *4421AEF741F78B99C0B10E2EE922E159D4712A48 TRUSTABLE.DOST
661,124,031 *442303872ACFE20C1760BC771914865B35A7EA15 TRYALES
661,124,032 *442D2E2FB863909DBB180CB44C80EE37CF859037 tsnukkorab
661,124,033 *44225E8746C99A1DF493D70378C2F3552133AD94 TUESDAYPAMELA1
661,124,034 *4421E3B3E45E596AC290E82483F67D0EC97D1706 TUPASHIYA
661,124,035 *442439D47667804222F420CDC04913336B12AFDB bsftm
661,124,036 *442E1A69D80314ECC122E72DBD80C277C9E01F3A [email protected]
661,124,037 *442FF9A5B8FBDD7F8B2E3BD0D53004C9CC3B4B5B TYRONALVOREZ
661,124,038 *44289E0DD19C9DAE8EA3948119D9DCFAFCEDAC29 [email protected]
661,124,039 *4429046661B8E179608A5601AF6A1797923634C2 bswsuperdrivebsw
661,124,040 *44297AAC5DF5BA9021B6D023EACD304030FD7A9A B/#t
661,124,041 *4424D11A7C632544C78298299DCCB6576ECCAC20 ÙÀTÛ
661,124,042 *4429AA4CEC754F3E193492E6BAB95C6A49FE2609 BUDDYTORRAIN
661,124,043 *44263519F427508D06E6833E6069867DA9F5207A BUKOL
661,124,044 *44268990CAE82A9EC17F74FBD292F31F5E673B78 BURNPRAO
661,124,045 *44238E6BB4C19A25B3AA3C37C7340B7D08263445 ultimarenatalfromentropy
661,124,046 *44224F04319F185BB6FDCF162097C51641451B89 by5r-
661,124,047 *442262E36C26CF96A9A69A7315DF42E1AA6AD1FD BYRON-WOODSON
661,124,048 *44265C42C35C136CDA7BAE97BEE8D5D287A1700A UPORAWSZY7
661,124,049 *4425D16AC274064CAE26D95A85D3EA0E7B28584B [email protected]$m
661,124,050 *4424FF7C90D0AF78860B7DEB895CF739F213ADF5 Us-Ones-in-Between
661,124,051 *442A5664E76066D1554587E12171E1587B37213F C6%/
661,124,052 *442AF6B713021E711471327EA709D2272BDBC014 VANCE.MCGILTON
661,124,053 *44273E8446C974017771996270C7923C3E5619EA VARUN.TOLIA
661,124,054 *442679471B82881004BA05810DEA72B92A2227EF VEERAASP
661,124,055 *442149909141F49C5263EF00DA94FDFD2F8A52D2 CARMANTIN
661,124,056 *44202FF8196255D27343CEEE00E74F51A7B74D54 CARTOMA2
661,124,057 *4420BC39456C983DA55F29678C1CB5AA3641CB43 CA!WL
661,124,058 *442CE992EE879E2A13F147FE4D8858DEDD456745 [email protected]
661,124,059 *4424CE72BC3E229B8E83481A0A8F57CA4195FAE7 CBYZR
661,124,060 *442DC8D6B7471F40135543795305DAB791C7F413 violationdespite
661,124,061 *442A706FA03A07EB148C2335F660F29205C869F2 VIRGINIA—HUNTINGTON
661,124,062 *442B843CEA9276FE17C468D96041E05BB3DD5E5C centenaryofflightcelebrationsformarch
661,124,063 *442142ED13F117674E9439D61DDA4AC8FAAF695E visxinc|unitedstates
661,124,064 *4428B9A41C6BD7796B3738D927D564977433F6D6 ces.lyriques.ix,.op..68.no..1:.chant.des.marins
661,124,065 *442E0E262DCC6D6D4A562C820A59B0F0FE7EF764 [email protected]
661,124,066 *442ADA31AC5CCF00BC81C851884B87F451214FAF CHAFFOLD
661,124,067 *442C163C91742DDB3CDCD8962C30C497039B1B88 charityrubi
661,124,068 *442387966A2BFFB3269D3D276589818CC1F4EDC0 WALL OF SOUND (DISC 1)
661,124,069 *44275A344B5FC0BB5577F624D594D31F01332213 [email protected]
661,124,070 *4423CD7305857E588DF3EAD3DE51789991E3AFBD [email protected]
661,124,071 *442F3B4A24B4AB0550916C9E61E5E71782309FB5 “waren
661,124,072 *4429A527FE1E9E3287FEA1ED4ED78D67140897A5 WAYWIKIWARRIOR
661,124,073 *4426057ECD5B39196A7D0150EFAFE135456FFDEF WB;P
661,124,074 *442EEDECABABA5BD8A995D9C0EA30E4A95435EC2 christianoxford
661,124,075 *442551BB9A39BD84E6B20EE2A395C9DA98AF09F4 werner-kubesch
661,124,076 *44268F49B2827B3905807021B3CE390C0FF36F59 west-hartlepool-go-down
661,124,077 *44249801E85AED6DC82A87A255213E42F2407AC9 cimol
661,124,078 *442BFFE5E5DE7D0696BEA3B05108E65A341180C8 CLAUDE.WARSHAM
661,124,079 *4425F0BA9B781D69E264F668D0B58F587C5253AC CLAUDMOSCOSO
661,124,080 *44270E48FC39C0A39F0945C7AD1E83F1C6BE8B02 C:LBP
661,124,081 *4423DD2037E895CE8270AA9DCD374407BBAE0C38 winfredono
661,124,082 *44209E800DAEAC99E3FD299567AE0064A12E3609 WISAM098
661,124,083 *4423612502D292E71B662E9812E4439F6690D573 cmstatcom
661,124,084 *4428059D9AF81F944779EFF1D30ACA4DBD5BBB36 CO5+L3R
661,124,085 *4422F31DF2C79E1A6C6652B159DF692CCDC82E36 COLUMBUSCLENNON
661,124,086 *442D0B7F83A0FCFD8B9A93B927FBB309CB0EA4D6 [email protected]
661,124,087 *4420C2707832DA761EEA564810B275FA60802C45 COMMENT-KRAMER
661,124,088 *442357440BD1D9A70E7218E7E44D6D4E505564DB WUCHOUCHA
661,124,089 *44244C629442A81EA0374C5B5AF995D8812F2050 WWW.DIABETESHORMONE.COM
661,124,090 *44220C522F7DF3FAA63B9567DAC79CC88087B80D COMUTAREI2
661,124,091 *44284A0B4AF6D6ACC694E670515E8FAA61E4302C wwwstingers-steelworkscomau
661,124,092 *442DF931195A29A0AE84CF6B44D5C838DF71341B WWWSYSTOOLSGROUPCOM
661,124,093 *4420AF0A3D21FB03BF8D80993BBB1A8C0894D8CE [email protected]
661,124,094 *442A2C3CF0AEC8F68D98142A6189162F19D0F871 [email protected]
661,124,095 *442AFA184BFCB4312D31CE5DE32C85702B622C67 CORNELIUS.DUER
661,124,096 *4425E6B323A651A125A7A97F9D291EBD06E301FE {X}.~D8
661,124,097 *442E19488162D6DE56BF17E4BD7E5E2610B49255 cortezmarse
661,124,098 *442958F34A2CCE6552AD263D3B9E961278EABD3A COTATSU
661,124,099 *442E97A98A7DB13B44EB1BE034BF47335896E417 COVE+AB1E
661,124,100 *4420E289C2FF4F0C5ABCF86E1EF455477782D009 CQ8:V
661,124,101 *4428C5D3B9DD9BD0FA931BCA9CE39D4F84E04E79 CREATIONTXT
661,124,102 *442A54AAA822E972406EC09A223A2F18E8011F2F [email protected]
661,124,103 *442ADAD58581B8AA3EE1F47A9A612F4B1149A744 CRMPLNG7
661,124,104 *442CF3BAC7AFAEC41B69229E96751B2A5F23A3E6 CRUZOLLIVIER
661,124,105 *4427F47A0E4E2E9A387C20BEA16F0FB3B843D84F csfkv
661,124,106 *442211AB8CBF94E0391B82E836B3814E43E1AD19 YASMIN-KERA
661,124,107 *44217A6CDB2F9EEEF484A796DB3DC9EDD0220215 [email protected]
661,124,108 *442CCF3EDA79FB2BF72460575B74F68582799EA5 yes,i'mlimited,volumeiii(disc1)
661,124,109 *44221BFDF3D5A724B7BEDF64BF976A9DDDC13CE0 [email protected]
661,124,110 *442671B23428C2CD3531A2E60E3CF8D7604319E0 CUPZC
661,124,111 *442315B28217F67CA7EF4E53BC309396D87EC25A YTICROBA2
661,124,112 *442E5FCDECEB921A819A8DEBC7DB81CC84AB2ECD [email protected]
661,124,113 *4425D4E142C41CCBAF5488C18C550F2B313089DF yw8baa
661,124,114 *442B303F3E24580C88C1B92400CF4B96DB4FB2AC CZQQ
661,124,115 *442DD9FAEA018063F55F5C9E08906A231B1036C4 D1w
661,124,116 *442216A6A5376A7A15B9348F45CF17A4B7398D3D D83N
661,124,117 *44243CD16757711612B432BD8B6C503CBE2D58D0 D9SRE
661,124,118 *4426C3EEE1FD1FE7E45C87D8A53DF7CF484B1CC1 da#m
661,124,119 *442BE7F3E2081F0910110A2AC5A6578606320BAD ZULI FAZLEEN
661,124,120 *442B72D15C148C0C9BC17526E7881950647EC2E9 DANA.CHAGOLLAN
661,124,121 *44246DAB360CB9FCF577B7261D8040B8EB8B341A ZXBMKIJQSXL1
661,124,122 *4425C9981D292C6E61C9FEF2AF98D6C086FE7688 ΓΙΡΜΊΣΕΚΙΖΑΝΤΕ
661,124,123 *4422AEB58DCA10B8708F0B5DD50132E37E4076A2 ΛΑΧΆΡΟΥΣ
661,124,124 *442A9A15E79190C3495055804A8C98C3BE4B4AF1 DANTIPOLO
661,124,125 *44206D883DFBCE5ADBD03F6FE5F5FC8196B0B965 danyellsolomon
661,124,126 *4425A9BA4C3D2CECD7A2FB60F4FEB571F0265EE3 DARON.COLIN
661,124,127 *4427EB8C9F5A9E798CE47DF9216DAC8EB441F924 darrellverplanck
661,124,128 *442A77B935DB6EC31B6984C24D047B6611D6FD98 νικολαο
661,124,129 *442CB158BD23B478537017CA5A9E696597A52DD0 „амур“
661,124,130 *442D4A09A32847FFD9DC0190975D44D8294461B6 dasmarketing
661,124,131 *442D67254570E8B7E1820A85C93076479F146338 DBF/
661,124,132 *4421C8DC18E9354E3BC2EA508949F46362BADD42 DEBRA KINNEY
661,124,133 *442F0E7BBC5714EDB8EC08DA217D00D4379129B9 DEF01I4NT5
661,124,134 *442E0913D23F513ED64F750A07744321155A2608 DELMAR.PEYRE
661,124,135 *442700D63910384F48D406AA02E15BBCB7B76438 DELMER.BELDIN
661,124,136 *442D04BA53CEF54DD47749D0301DFD45F13DC563 DELMER.SAPPAH
661,124,137 *4429CDD26C09B67B8E3426EA763F386DB49D7DEC [email protected]+ng
661,124,138 *442247CD6A8E6161FF3E665361486EF76F5159FF [email protected]
661,124,139 *44262E1C9D6AFFA8E123C75EA0170AEC9474270D СМАЖУТЬСЯ
661,124,140 *44242E7CF5F9B6E0E4025F59DD913804DA43D4B4 СМОЛЛВУДОМ
661,124,141 *4424922D3D14448110AFC119127871530B56575A derickolenius
661,124,142 *4420E06FE91215C1E5226596131B45AE69068B4D DE ROCHER
661,124,143 *442EA2C3B9939CC1614C1B04260230059C4B1FE1 D_FF!
661,124,144 *442432917D09161B15F17E848CC8B221E53E7EFB dg&&(
661,124,145 *4426C020C1852ED883B6DA3C9BB60467DB02846C dg?4
661,124,146 *442F2BB6F2238373176A61607AD0E599D11A1B03 D~IP
661,124,147 *44261319F14481950980DA7A3961A15294418D4F DITTKORT4
661,124,148 *442B9AA5FD86409EB09F3D0153CF26B212DAF11F DIV4MP47O
661,124,149 *442D371146F9F8B87085FCC39597110345762308 DIVIGARD
661,124,150 *442F4E51ABD80A6C625238DCA0AF4072DC1A130B DJAWQ
661,124,151 *442187CC6763F95034E366902982C229B23349B0 DONBULDORE
661,124,152 *44224A3E2CAD1BA337E30EAB70C05C5B87893473 donna-drinkwater
661,124,153 *442E3CE5DAFFE1DD6057D3B3F0C1552BC08B9CFD DONNELL.DEPAUL
661,124,154 *4427EEE25743632D33B5B174C5D126EE46CA7151 DONN.PEGUES
661,124,155 *442683F27AD09CE740135F7835DB818CF570CC55 DOOPCELE9
661,124,156 *44233C2D0811BD9100E3A11F19D61CFA2342631A draskovic-126-0
661,124,157 *442BE8BD8D5BE44A45CF1E0EEF13EC3B9B0D9CDA DRDMF
661,124,158 *442DCD0153A3270DDE9472BA263534D3FF0CDED8 DUDLEYSTANCZYK
661,124,159 *44279B36CE910E302C3F63274C1C9B2093022B21 dudleyvalent
661,124,160 *442E2BF2BFF853293635FCD46EE06B494223753E 0ILOVECORVETTE0
661,124,161 *44276839C939A859E578CD38554B1109CA78B074 DWSCH
661,124,162 *442AF14D8658CCAAEAADAF693BA6F68255F78EF2 13014536x
661,124,163 *442C9A4131F2BBB23975735AD5B3B31F353EE038 EAL1971
661,124,164 *4420937F9DFD485B1AF605391822C11FD7673FCF ECKLQ
661,124,165 *442571F24BAF90E073640ABE41FF1F7B5D8BC90B 1659684 ala-jayl
661,124,166 *44238859230EE10828F3E65373F0A632D4622B95 EDMCDOUGALL
661,124,167 *442F858E8C1F845E5EFC21CBDEBE6EE49F50E2EE EF.QY
661,124,168 *442237E08F877652F6D709619663707A4D9105A7 ehmaaaaamaaj
661,124,169 *4426FEA73831BB9D733943E6A906AA209B0B154D EIRj
661,124,170 *442446B47A1D627AEFBAF36DDF771BD52F3C9476 1 AIT-MITGLIEDER
661,124,171 *44225B82E48A73479102550179696471BC464C6D 1ASSAROPS
661,124,172 *4428114DD1CE0EB08BD67235D031EE720708222A eliasstrebel
661,124,173 *4424F54E256F5C995B041CD28590504D55D6F3CA 1DRIBLLUB
661,124,174 *442CC9544270F52BD76EBB7BED52FA9D47D32C7E 1.gashora
661,124,175 *4426B2439DC9897667AA841E505D5535C37A87BD ellesopp9
661,124,176 *4420F5AB1B48D97C9BA67C964DC6678C95ACAC10 ELVINOHARROLL
661,124,177 *44268F69AEC820B011D4EE1EC1C52A0CC2ACA492 elwoodveness
661,124,178 *442C79C6907EA35D25EAE0B097C39AC6CCEE66DC em_!;
661,124,179 *442A69996FD710EB0BF68173566B32D655FECFF4 EME/D
661,124,180 *4427FD7667A370F4427051CE2045C52515A1A9AC 1 KIESBAUER
661,124,181 *4429AA6F0AFB94C40894F498D236E1986438734F EMMETTSHULL
661,124,182 *4425ECB4C3035DA4F066E349BB7000EE14BFB04E EMORY.AIMONE
661,124,183 *442FD58DA41E097F92FD721190B635D5753BF9EF 1.merkersdorf
661,124,184 *442333B1AFD3A0790A8C5DBCECA79B2C2E5084B0 1microsofteigentuemer
661,124,185 *44240F045CFC0AC9F9ED1CF951E5D3CB070B5EFB 1MOTORICALLY
661,124,186 *4423FB7BF06AEA3FBDADBA86F4FACD4B6FC4C294 1 OSASTOESITE
661,124,187 *4426C114C28577E80E71CD947B35D7FA42D8ECFA 1 PALVELUSSITOUMUSTA
661,124,188 *442211635438402977AE99867111C06316A7A010 1PIIRTEETT
661,124,189 *4422E3D647196526C5D7D172C13929243FD92FB7 1.PUHEELLANSA
661,124,190 *442A71669047044EF843655ABF790890C001361E 1RANNIKKOKANAVAN
661,124,191 *44223850CFA6B0829A6426A499494130742EA47B eor8%
661,124,192 *44261927252FD25A42978100E306065F5D1567ED epzw2
661,124,193 *442A9A4BDF4AEDB4A2DDCE0B14F4BA7B5A7EFE55 ERELLEUT2
661,124,194 *442A8A985FE0F29428C099B92548ECFEDFA7F2DE erikskalecki
661,124,195 *44273C533621712652196669CE23B0A7BD7C6C4D ERIVALTAISIA
661,124,196 *442B1650335C505E11A9F5D6B0E0C7667B381A01 ERNESTSAINZ
661,124,197 *442BAC74A8C2C2A1D71DF56ABAB9BBDF992139E0 1WAGWAGS
661,124,198 *442CADF913B5AC6EF9924A59B740112F83819BC7 E?)S
661,124,199 *4421C2B6DC93726AC04BF094FAF622D7AC9A84F3 2103506 they.both.offer.adequate.performance.,.says.mr.dyson...'
661,124,200 *44226A405E43C1EBC37B21440BEAC728BBCA178C ESTEBANGODINE
661,124,201 *442DBA1D066E6E396651C1E2545262E10315CA29 estudo no11, em mi menor
661,124,202 *4425E80EB0AF9F8934CB68B1E5DB69223EB8E5C3 ETER!
661,124,203 *442ABDAE2CB416C34D771488E5B52F9443D341B8 exhortingly9
661,124,204 *4428CBDFA55910FA7BF8EE145B09F6893A949938 256565 ohjelmalla-voidaan-muokata-tilikartan-useita-tilej
661,124,205 *442977D37BA156A630D73BD73399C2F7A616E160 EXTRATYMING
661,124,206 *4424E0251E42E7BCEE9BCEE47F1D47DC4948C7C4 EYYOY
661,124,207 *4422F2E072557990ED59674AB1CC6605E8CCE165 fa$hion.g
661,124,208 *442600BEE7FF40B531628E871C5983C9A684923A FAISAIS5
661,124,209 *4428D94D9EFA71CEBF4E82D19B66A21D1E95B26A 2845452 ohjelmakauden 1995-99 t
661,124,210 *4427D2C42318E31C981E2C2BC33BEB7E52ECBFD7 FDCOMAND9
661,124,211 *4427A8573B6B1166C6E05744E0AAD43ABDF35E43 [email protected]
661,124,212 *442649FB923C2EDD94FB4CFE5C8B7DD4820331F1 2BARBERIE
661,124,213 *44241E62C9C7BBD19440229E01A015F992261117 fidanleka
661,124,214 *4422E19F4AF7163A417A88F53E9AC5A265558936 FINANCING
661,124,215 *442609D54227837BF859B4663C5BDE9E59C65C9A 2INTERN0
661,124,216 *442FAE31B9A4DE733D4DC3609186E9519251DAC1 florcifuentes
661,124,217 *4420B4B391C3C9C934ADD2780835E6AB4924D3F5 2-NASCHALLEE
661,124,218 *44247D60706918285F7B0371249FCA75A673E1DF 2PATRIOTS9
661,124,219 *4421F871CC33B980B802811616D0BB2B1BBD5A26 FORMOVAT2
661,124,220 *4428722CAB2707132F8B0C7C0A69171753A2AD9E f}p<
661,124,221 *442A98892AB40E80DB7B7CB9FBD05E87A359EFF0 FRANKLYNLANQUIST
661,124,222 *442292A1F79F42E2D97FD12A39423EAA0B2DD3FF 2 yagiyo
661,124,223 *4425BCF85018A2EAF713A6B87F689B7A04D1016B 30 TIETOKONEAVUSTEISEEN
661,124,224 *442DECBEA35EB9551052DE611D0D85DDECC5FAB8 332263 sessiz.,.sedasIz.,.yaslI..
661,124,225 *4429037FBB57E1AAFFCC37DFEDB4C03F0226F2F9 FREYAODONOGHUE
661,124,226 *442AC3937F01944857E0AC9497E9023C86F51264 3B<--`-d------q
661,124,227 *44273FB3673A019366671F73DF0AB7D330105283 FVDMMUA
661,124,228 *4429EC5FD02665131BC5CF93AEB9FDEC8CF8C72C G160731
661,124,229 *442D8697158FB25160151B2ED8A1257D522216C2 3FEITNEVN
661,124,230 *4426EF86DB4B5AEEF9D0976B90EC8EF69381EA15 3INDIAPOL
661,124,231 *44280966083EB480D1135F44BD07AD3C31635026 3KORALOJ
661,124,232 *442A2C73B82D74B531A951BFF2549B7E7AB5697A galedolinski
661,124,233 *44221907A27D6B911684011421728F4D4C1E5398 GALEN.KERKSIEK
661,124,234 *442996FF011DB6FBE2B718C626305C9CEA3ED639 GARABATEASEIS
661,124,235 *442E67EC8C834FCA0A83A24BD3C7ECCA72BFD93E 3 POPMUSIKER
661,124,236 *44240406223656C462D2D735C2035B4CB8D97891 GARNIZOENSCOMANDANT
661,124,237 *44210DC94B446A8951D84827C4B5B574E50B80AF 3SHIFFAWN
661,124,238 *44264F1E277BFA6DAEE0EC0FE6C1F884E9842B25 3VARICELLAR
661,124,239 *44242E66CCD928DFC90375A6D041EC5ED7CB02A4 3VIEGUER
661,124,240 *4426D3C643416040438861769FE672D1A2CF842F 3XH1B1T1ON
661,124,241 *44214F19871493F274F46136EFEF538D759AC28E 42TANIYA
661,124,242 *442B198B5E04B452A5A2FE8B06E50F85BCDFD7B1 444OLIVIA
661,124,243 *442F919C66C3705E4C3BD51F17B787567C644F57 GAYLENES9
661,124,244 *4428AB8BB10301363392EE8401C4F1E4CEEF64C8 gboyette68
661,124,245 *442817F9F2418B86A8D99F4BD13A3214253ABE50 GEISTERPFEIFENFISCH
661,124,246 *4426A27F2BA7E3B347AF03A90CA7E7CF60C379E2 GESELLSCB
661,124,247 *442D2DEC83A6F80F253F70DE1B1E00F4ADE9BB7D 4LABELABLE
661,124,248 *4424A995EFFEC7F501EDA08A4FBA6D94FAF0F825 4MUSIC.NETWWW
661,124,249 *4425BCF0726C4434177515D5A502CE80C98B455B GIELLASYMBOLAM
661,124,250 *44231365F8E72FA05FAE8F6F58E37BE2EB4CFABF giovannibieler
661,124,251 *442F2F7380887938F8A77AB8E6744AA1F6BC120C givsopej
661,124,252 *442D2ADFDF4279459B849DE190BF2508EBF9E620 GMFNEM
661,124,253 *442A46699E662342E54915261C1FD5007F97542D 4VOTAZION
661,124,254 *442AC3F7D7056C3818E6EC6B832A5449F8C7B3BC 4WECHNER
661,124,255 *4420197CA239D080C5C42D98596B28D1CCB18DE2 4WOLFDIEMBSW
661,124,256 *442B2342137E05D59790B06A3DCEFBEA0EB1D117 [email protected]
661,124,257 *44205DBB445BDC894F0A75F9478360CB8D3E0548 522982 THE-PRESIDENT-WILL-SERVE-ONE-SIX-YEAR-TERM-.
661,124,258 *442BC3E0B9E37F00916CDC23C428A1E51C465FFF 525494 anna-riikka.paransi.komeasti.13-vuotiaiden.tytt
661,124,259 *4426408C8BB64F65F5B96D5EF31BFB475DE25E74 5:..5..#..&...WEBSTER
661,124,260 *4427C2D090CFD5A0050B61289DB1DBE67535A72C GO'WAYCHRISTINA
661,124,261 *4422973057F94BB6E2EF9C4886BBBF4D2D0EDE9A 5BEFLOUT
661,124,262 *442F1240FC95996919F0689E5583193A7CA1E533 GRANVILLE.MABREY
661,124,263 *44202D0CF10B54F3194398FDCA36901B07B51917 5COLLEGEKIM
661,124,264 *442FA23CBF377CA1FABA5B1D7ED396BFE14B5D4E GROTTETEMPELET
661,124,265 *4426A733B1F7E4730B4DDCE354E95C8C96BD4AD0 grupos-de-cumbia-de-uruguay
661,124,266 *4421D9E299BF1D3A192C35E9808D6C27516E5498 grussten
661,124,267 *44288D8893BC9CB770CBCC4843CCA3451879FE23 GUIKOIN8
661,124,268 *4428B90F6721F78382EAA7CC873CCFA503350C60 gusa”
661,124,269 *442F5483A790EC334E81F3440B5AA28E9C038654 HACO
661,124,270 *442C0B18C5CF2F995D4C8AD7AE03E38BD7804AAA HANORAH6
661,124,271 *442795C43D6E0036FD4A307A3E804EA89E56E8D4 5NOGALESES
661,124,272 *442C424E93FC103DBA691B8BFFE328AD5B13A532 5OIKEINKIRJOITUSSAEAENNOET
661,124,273 *44289FBBCDAE89D5B757573813916A2E6A227E24 harry-khadka
661,124,274 *442120DC71638A3D1CFE55A314C8892003CFA125 HAVANSKI
661,124,275 *4422BCE3ECB7AA53C2FDF6E50F228DE31DC3878E 607978 cok-iyi-iliskilerimiz-vardi-
661,124,276 *4429C4D5C20427896775271E059EA58768185F89 HEZR0
661,124,277 *4427256AB75F085A2DAFA12EDABAC82DAB0B7020 h^l)[
661,124,278 *442D7824F504E34852ED5917C6E9FB5D6D1EC541 hoihohoihowachtauf
661,124,279 *442E2503BCA3D7DFB26B28713D03F4C88E6496C1 [email protected]
661,124,280 *4420DB54370A25B28C88BFC2C27D43843D78F8E2 HORACE.LINDOW
661,124,281 *4427F8DF3AC3179E6781EAB71CC3052E11D3A8D0 hosainpur
661,124,282 *4422F9DFF8C3D52938EA388E3032F2D7DAED5FE3 67B0804FDE95362A8BA92103A6D3163C
661,124,283 *44256073EA4037F1969EE4680FBF7178C1E4F355 HTNIKCAJ4
661,124,284 *442406691B2E2FF27A6993510EB6D62DDC43290E HUGHWEATHERHOLT
661,124,285 *44278DF9EF4DA308DE89130AE965857374F36972 HUGOBLATCHFORD
661,124,286 *442742B6F511E8E9DE650A697F073DB242FF7A96 HUMBERTOIWATA
661,124,287 *442CB1C97A9CE1C0ED7BF1923EAD9E6F00E9ECBD 6GARUNTEE
661,124,288 *44245E40ED3BE52CB9F86AB93569732C3F19E269 6iluvjosie
661,124,289 *442D8CEE3833E3D6CA215DEB0C5329EC2CB4906E 6KDIDDYDO
661,124,290 *442530B8B122A78641A84DA48065790344146AF5 i8+k
661,124,291 *44200A29D33B70D564664AEA5B524C5EEFF51D29 iamgenius44
661,124,292 *442923E76ECCF1A95FA67BC0BFB8F8A502F544EB 6PPPCLANCY
661,124,293 *442015574626AB51DBA168BCDAF334DA5A6E245F ICECREAMRACOON
661,124,294 *442469156AE9BAC881F8561240B821FC3CD6790C IDOWU BAMIDELE
661,124,295 *4422F5AF2191B9409CFF7838312A8085A4235ECE 6VFWIMEUBEYSRRQ
661,124,296 *442038812958A95AA3FD025C8497D86D17A2A808 I`JU
661,124,297 *4429E73F93A4CD45D311E3680DCEC81066729A4A ILOVEDATABASE12
661,124,298 *442D02B232A8CDB3ABC676B7FDF8C4EA47BF90C8 IMMUNISATION, IMMUNISATIONS, IMMUNIZATIONS
661,124,299 *44287F6659491113E338DA508C51674B976600A2 INDIAMRG3105
661,124,300 *4428A7717EB4B874DDB9C35DB31628681D8D4A23 INKOMPETENSER
661,124,301 *442734548C299103F1CB91BDDF7C60983D2A9FE3 ISAACEGGIMANN
661,124,302 *4420CDDD0DCF1DB4BDFD0236222790164323FE9A isaiahfaris
661,124,303 *442995815F562E55253E3BE622D7FDC78E98271F ISAIAS.HITCHKO
661,124,304 *44231FA699B04112772663B67303B92B9EAA4CB4 7ROYCHEN
661,124,305 *442E602C1CDEE5186E495AB7001AE1505A1556BC 7SCHOENBERGISM
661,124,306 *442CCE544A3886F4A706C13F7B6AD6C3D1CDC974 7STATISTICAL
661,124,307 *442475320EA0A5332C33EA0A69D20F57C7C31F7A 7UNAMUSABLES
661,124,308 *44237686AFCF0CE52F4DD192F70D7B44E3DCF2B3 82LANDON
661,124,309 *442BB503CCF8475DFA802E613A0C133A01F9694C jai-karthick
661,124,310 *4427AF48BF079F32A91DA134F966138F7D994F30 JAKOWNA
661,124,311 *442410010FFA1CB3372B6A74133B6F832B586392 JAMEY.ECHOLS
661,124,312 *4424F6A5270D2F2956F8AF76091EE78E9EA50642 [email protected]
661,124,313 *442BDD44BC7418E7199E9746EFECFF583C419AD1 8BUKVINA
661,124,314 *442052108B26D2E0AC59484E0557CE2D1A184452 jaredfariello
661,124,315 *44264BBE677EF29290EAE27167A0D11BDA19D7DD 8CKWELLIN
661,124,316 *4429CA767AAB49D15B081CD601992409D2C9D1A7 JARROD GRYSEN
661,124,317 *4427BE9181ED2D5C4E07B0EA232B3E33CDA89A21 JASPER.GOUD
661,124,318 *442911C8EC923487599D62175870F6FFCC83CD14 8FALCONZIGGY
661,124,319 *4423C6C032E378A64A9AEC5F6044C5D89DAD24F0 JCS1829
661,124,320 *4427386EA46B33989C11B48CBB70866851C98890 JD_BRAGG
661,124,321 *44201C3AE7CB9D049904DA3424863E1B2B22749C JEAN-CLAUDE.HERRI
661,124,322 *442C25AEDA30D8BB2E38774F5D70F3C07A7F285C jeanine-judge
661,124,323 *4420B4AEBC706A8824F88C3DE4F7BF6DF7CCE655 JEANNETTE.GIBBS
661,124,324 *442F7EBE3B689D35D490F9A8765EC3BE79F7F4F8 8INKRITZELNENS
661,124,325 *4427BB8B24B491C8B00EFE35BC0AF34180CB86CA jefferycolegrove
661,124,326 *4422B5B242952D8D793823BAF7C4D2863C1723D5 8KADOMATSU
661,124,327 *442E9B0B21DE674B64A714F42979EDBE204C241D jeremy-selley
661,124,328 *44250AE545FA04FE00AF23D52F6F53E9546D0E68 jerestouffer
661,124,329 *442B69231EA7B4225CDB6A908FF448F227E14AA2 JEROLDZUCKERMAN
661,124,330 *4426065DDFBD8B4A66B3F8DC6A2A20B94EAC83AE JEROMEKAY
661,124,331 *442447C40B2612FBDBC0639CF2C549979C5E2EA9 JEROMYBAMBACE
661,124,332 *4422B627828DDEE07AF34B18EE7C2128B60F9B5A 8p* * * splat
661,124,333 *4420FC9F2FBB234B4B16285560FE7813FB13C1F7 8SINTERNDES
661,124,334 *4424039B8F4A80C7F26579B949415230CE7B1BFD 8) * * sploit
661,124,335 *442D480E140B7BDE8321ED179F8E63A56FBA728A 8SUBJECTCHANNELBS
661,124,336 *44295190ECAAFD75A2FDF3DD35E13E1505989527 JEWISHWORD
661,124,337 *4423791458C9A0FF570A6E52A2494DF3A6183726 [email protected]
661,124,338 *442DC6344441263F8289217D398A78BE8D8224CA 9BENOITRUY
661,124,339 *4428E9726A7AAFC6A511EEA40609A1F2CB41A312 9BETRIEBSRAEUM
661,124,340 *4425943ABF3E1CBBBF06838DABFA61719A9BFABA 9CARRMENT
661,124,341 *44221FE804EF26121BEBB1756C7725BF01C7E8D4 JOHNATHONLAPEYROLERIE
661,124,342 *4423CD3A0C68FB6DC4B8213FA7A156A44049F1DB 9GARFIELDRANDOM
661,124,343 *44284ED85F96E625DD9ABCF98396B9A7A45DE14A 9HLINGEND
661,124,344 *4429F692F6A6597AF94BD569FF3C856B378EDBE4 JOHNNYTUN'ESPASUNANGE(V:2)
661,124,345 *442F16348DA26C50028F89EE7CFD66DEDD7381F1 JOSE ANTONIO ORTEGA
661,124,346 *4420C28D115A9D7D47F5C0887B927726AE8CC3E9 JRM37347
661,124,347 *4421B48F26A467A4FAFA4197E03510F1F056D3F8 JSPICKHOLY
661,124,348 *442DF7C39B04700ED6B0B5723F2CA23140A76F2C juan.eluchans
661,124,349 *4422CF9A0308756F46088053C27E307FF16C8A3A [email protected]
661,124,350 *442D3D24C4FE411B29BE353B058729287F02EF9E 9WIEDERBEWAFFNET
661,124,351 *442ED3ABA54965903522B0533D0B5C424C263D86 julianlia
661,124,352 *442248C2D7D0155421CD10B79419ED711323594A JULIO.STECHER
661,124,353 *44274726EA3A5D712849AD108F155E3FCFAF40E9 a/02!
661,124,354 *442031C18E83799A7FDEDDA262E77F36A9692725 A1TAB
661,124,355 *442CB4DA6C17DC53D4B19509B8F3D63B944346F5 KARLDAVIDOWICZ
661,124,356 *44232B4452689D99C904F7C7E459DC048ABE9D30 ka&t
661,124,357 *442289DA58B89443B7CBC27217F233674D266437 [email protected]
661,124,358 *442E3A9F8F9860E7B2076DFAEB81AFB5EB392AC9 aaaf1,
661,124,359 *442925234F62DD72E0449222D5ACE04FDDE9F442 kennethwohld
661,124,360 *442A9BBA46222B84324255526A8E75AAC34C72CA aab?u
661,124,361 *442E43C52D703E3F9E190F6B83176353CF98F28E AADS7V
661,124,362 *442033875DD68263B419ED113057BB14056FBC46 kieran.ansell
661,124,363 *44243B7C5817BF05868CCD34C39776B0D69CDAFD AA&FO
661,124,364 *4427203757661CB862B3F3886E30C192ED3FE91A AAUFR
661,124,365 *4424D89D13EBABFC8B15AA57DDB2689504514C48 ABELBRITTAN
661,124,366 *4429749E18B9400F4EBF14F9F3779BB03AD06544 ABELMONTREUIL
661,124,367 *442EED2811DD0769D1FD5520960FCF5671C458D3 [email protected]
661,124,368 *4424CFC257E8B874B1262F855D450A5E4A6F8DCE ABUOG
661,124,369 *44253C9A99AB2B7C2CCFDADF26F8B9C08AB91C22 ackt]
661,124,370 *44267667E5D27E3EB208DBA4DBFE54E5ED25CADE KUTH.
661,124,371 *4420FDE5521EF8AC4F7CF8C2B18C6EEDBF6067F4 LAAPMADING
661,124,372 *44232F7490AE7698A6FC9A65C8A31813893A9C04 adolphwoelfel
661,124,373 *442D7199BF0DE92741AB810FA9D94CF49F655794 lamarbrannam
661,124,374 *442D3F6EEE6AEB28620F82BCE1CDD7FE24F5967A lamejorcorea
661,124,375 *442C01EB1BA6F954715FA4E3B0EC89E50038A48C lamneth1
661,124,376 *4421CF9B72652011AD49E4CDF03925740E22D8AC LAUTCULING
661,124,377 *442EF9D516A00B3C16AFD07E78E324A7E25D6630 LAVORGNA9
661,124,378 *4428574E412CCEF3A536CF23C7F261688F19BC69 agirijih9
661,124,379 *4425AF6CEE5AAFA9C1C68FF4CA901F2A5E7FC85B LEANNA386
661,124,380 *442589106B9611DE4664239715C8FC2B6C789CD5 ag.vv
661,124,381 *442E2F531AD9F14A47D3DF25A39293CF7B157F51 AHMADHUDSON
661,124,382 *442DB1491665B8AEEFFB68BE910389A0F43DF7A0 ai7og
661,124,383 *442A731E1E16BFB9410735FA6BC16BDDD3652703 [email protected]
661,124,384 *442A9F55161523DA9EFEE1756897FEA3427A66F2 LILLION1
661,124,385 *44202E1456B36B3209410D48053B961F36463DA2 LIMEAUXES
661,124,386 *442B919E89682FC872C16DC9F671D664847FF451 a-layer-of-clay
661,124,387 *442EF9B3CE8B8157C144AB5E805880BC5DECA547 lindwod
661,124,388 *442595B9E6B1A6CA4FC20A8C929C847A93F6FFA1 alexis-renee-johnson
661,124,389 *4421F2D58B48523A3D59A93AA632B4FE507803A4 alexisrobidoux
661,124,390 *4425E13BF2DF631054D54E3BB73A6AE05AA54A4A [email protected]
661,124,391 *442904B912C6092900E86B86C3681409E3AB41B4 ALFREDOSHARTLE
661,124,392 *442DFAE28F320CF6D4AE44055DE0D13D7380FAC8 alias1944
661,124,393 *442AA6319BB4440A95A882ED33D1E358909F52A7 Am9D
661,124,394 *4425522FA6B804FBD422FC2E4BE668E4CD790391 love story (vs. finally)
661,124,395 *4428780B6835442477083354EE8E49463C26D7F9 LOXGXYOQ52
661,124,396 *4425D9162BBCF471FFCF0360A98B8484AF5B2297 lucasnordmark
661,124,397 *442FCB9F26BF9DE8ABDA2A9706B4CF235F8B4C50 LUCILE-MICHEL
661,124,398 *4423042DBC985ADD2E8FF10D17AD4D31BF5A2E8B LUCIOROBATEAU
661,124,399 *442DF0B014AD4F8BF4EF3074650E468B494DE998 an07
661,124,400 *4422C85942ACE81BE1182F2BDFFC2B9AAEA9EE96 anecd0+s+
661,124,401 *442009DEB6260FCE4BA39409233296BB47A1C446 [email protected]
661,124,402 *442FEB7E90D7F2D1BBBB4FB3CC6932EF6585CAB0 anthonyacoba
661,124,403 *44239E6E8DF490135005068EAF87F0FCFE38B55B antiship2
661,124,404 *4422A37285AA67B61C92C2B6A821F54164735414 MANUALNORTHCRAFT
661,124,405 *442F801BD0DAB6C2B4D37C0A35D396E3669A4806 MARIO.DONOFRIO
661,124,406 *442EBEBE7398EF1BF2C468ECA6B6CA8494369574 marshallmalhotra
661,124,407 *4422EC1B37E1D4F275C363979DF35DEC68EF9BC6 marshallyray
661,124,408 *442A710A519D74549899CF28E9CA9EF145DBD5EE a(p/i
661,124,409 *44212AC43A31BA48B2D9F4B0BB621ECF7CEFA53E apukv
661,124,410 *44270EA2C1472C67334E491A5CC35CDB81D592AF MATTMARINER
661,124,411 *442F31C839B62DE1B164F45D5961060A491B3756 aq2#f
661,124,412 *44213B3B33ACB05F8ED12DDC3D401EAADB911B1F meet-professional-jockeys
661,124,413 *44276A8FD3EEBE4F83EA332378169507AA8C6962 MERCESMISERICORDIA
661,124,414 *4422C183C280B3C2B5DA03B8880AE9CF6990D8FB ARNOLDOECHEVARIA
661,124,415 *44244CCA0F6D38CE6AE474349B42525D1DFBA4F8 ARNOLDOKORNN
661,124,416 *44287F639E7D49914B7C16BB8CF44BB742F2CF1C ARON.MOODISPAUGH
661,124,417 *4429CAA16B6B1902992E1BA041E62EF939266678 artboney
661,124,418 *442DF00BC7B8F9A97F3D418085BEEEF421988954 michelle.perl
661,124,419 *44254BEF1F67DC6DCF1EF1AC4ADDE0A9F6C858EE MICKEYSTENSON
661,124,420 *442A9C60FA4ADAC6324C9E4C1FC9109140E64C35 ASHLEY.SWEAZEY
661,124,421 *4429E7A5CE815C30DD09A866A577F6D6CED89CA9 [email protected]
661,124,422 *442E1FFA26E1AED96AC5F535397FCACAC9A84C9E minihytr
661,124,423 *442F897995AF49F37E9E4372EC625C82C2454D19 MJHMKBHJNMHVB
661,124,424 *442C98612A445E84E0A803DCFAB5AE6C99B01D10 AU)p
661,124,425 *44271798E499FF25E113197281F3F5DA6A2FF08A AW/VK
661,124,426 *4424F12F1CC99E9B39393D5F168526DA02D19CC1 AZC)G
661,124,427 *442B9196B4F077FC68A77EB2C93AF90DF487D7B0 b#&=/
661,124,428 *4429BAE33A3F2675A83E83B471D7DD84BE994F70 [email protected]
661,124,429 *4421709920EB514E95BCFF40987FA2D92F85E036 msrepor+s
661,124,430 *442C5868711722CFEF01D268FCC9AAA2970C8FEC B2:j
661,124,431 *4421B8B5E14554E62B9C3E7AA527BD6BDC8CF414 mypepper39
661,124,432 *442A9C3E24EAEF8C3A4CBA3B31B0F35CD7AE23B1 B8V(Q
661,124,433 *442DAD7A367DC239A32D862D9D9ECF50AA301151 b99i;
661,124,434 *442B6167840D8CAE98DCC4C1CA9E65CE19EB077B NA.MI.NAZ.OUNI
661,124,435 *442FA0A17E241D3A2A8A1C9AD1221AE207739E10 NAPU
661,124,436 *442A99FBF243DFD9363924779ADA017363D9D95C NBIDDING-PRAYER
661,124,437 *442072131DDFA9143F02579E2F6DBD917C9F745C NCAACOLLEGEBETTINGBUYIN
661,124,438 *442F0234EC495CA645C131449C7208E77F6F9AF1 ndgerninger
661,124,439 *442ACA701B3805BA09BBF84F9E1BFCDD4287B913 bateristas-por-pa
661,124,440 *442E83BBE1B5CBFC0654CECB2F6424D602673C46 BAUGESELLSCHAFTEN“
661,124,441 *4429DA7946F167F08F670E893595461193B0DC3A BEAUGOSLIN
661,124,442 *4425CE94DEC7806F450BB6833D1FD53DE1B5C269 beiratsantrag
661,124,443 *442BF58ACC4F97F9A2663C65ED7A07F537DD1EE8 BEKOMMOMMEN
661,124,444 *442D56E42DB873231E4340BF7931388311AD2BBB [email protected]
661,124,445 *442D13C4927D7D485F608E01D20A61B289B34A85 BENOLIN[OBS3];
661,124,446 *4420A2054B406CDF5EE370339B534ED73FA4F945 BEN;Q
661,124,447 *442CEEDF077C089F14856DBA4A69EE0B0717B4AB BEN.WRIGHT
661,124,448 *4425EE9F9F163F4CA11A94FE490AF159F0547C8E BERIÄFT
661,124,449 *4424CC60CBB121B82F0B992FF345830B5605D054 berniesoleil
661,124,450 *4424DE60B8122DCC6D858C4711C7C34592AE395F besmettelijkheid1
661,124,451 *44270E04F1567D6D9A898D670DC88505FFCA144A BIATCH01
661,124,452 *442607FD98F25B604D9D29ADF71C21D4B57360C3 BJAY JOHNSON
661,124,453 *442F355F8EFE9ACDDD4DB1E9D48EF1C10DAF2F50 OBERREBO1
661,124,454 *442CAA783DD221E90B21FE07E8EBCBD9A8FF199F BL3&L
661,124,455 *4422DBD3DAB4C11AAF1DE972FB2BD1BBFA8D47D5 ofthesindar3
661,124,456 *442E9D1CDBA91A3CF00A5B6460E0114A8A6D935A bobbysherman
661,124,457 *442E8381CC43EB30512D11C40B6B5B0252AECF69 oscarsoltero
661,124,458 *4421DCDBC25CA267FE9F4F83D1018C8F74C2D95C BORGFAQ0
661,124,459 *442EB9E2743A28872F35F3F0C418BA02B5C3A20C B======>-~O-{x}
661,124,460 *442173E22C2363CBA2ED58DCF9CF7F469BA11E57 boycbsw3
661,124,461 *442BA6EBE8B46E1B064B23E932846BACCBAA8A54 P172612
661,124,462 *4422A26116D0524048C5D6A63B3CA2A6507F527E BP~O(X)
661,124,463 *44271498652BBB9D1DA33D4A44C5E94A012733B8 BRANDONLAURIN
661,124,464 *442117343E66ED7635B76792997BEF00873DA8D2 pastinacasativa
661,124,465 *442A79DE91110F968985823B60D3917A899F26E0 Brlhelp
661,124,466 *442143670CB5A5A432D8ED29BC5EF05FB981F271 P-----B~O~osplat
661,124,467 *44222C84B72F75C35523CC09385AD1468747BBB4 BRUINWIT9
661,124,468 *442C4DF26366CE386B17E949934504507F1B28BF bryanderosia
661,124,469 *44257FDC734FD52265B1AED9878D24DEDF06D0E3 PEKINESE
661,124,470 *4429EFB1AD9C81D3DD1D114ADDC90769A777E28C BRYONMENES
661,124,471 *442069D1EE7C518E4E737F89DF4F6368AE9F236B PERIS01
661,124,472 *442DC72C3E6D653E65426EC37B50BF4B9B0393D8 Bslk
661,124,473 *4422653CD3EB8C05B35C661D3223E4C951E19C77 philipsartorio
661,124,474 *442B4E11272DB63807BDCDD62420C7B68955F899 BT$P$
661,124,475 *442F69C0D17087A429A3F55EC63FC09298C56943 burlybrawl
661,124,476 *44274CC3EA0F9FA43B07C34C1C1F86A74CEE53CD pnuch
661,124,477 *44227FFBA8AE30D4CC6EC5068E7AD55DCFCB61D0 c0&8d
661,124,478 *442C7E583438BE5DE62B1E6C55A73CA6B5BB6ABB C55J!
661,124,479 *4427A46E82374DC6F79C5A49CE5449A4E752110F C6DW
661,124,480 *4425942E06BB35F7D46B56641ACEEB723F25D5B3 C70FL
661,124,481 *442675628A389093ED002EDD8778B76810D8B523 prozor
661,124,482 *4429FD611CCD214B3865EA9FABDD3EFC670770B9 c9pft
661,124,483 *442E066D5BB65A6FF0ACDE21B73F44759E094212 [email protected]~0 ~O)8(
661,124,484 *4426F19461E9C0A49A5906308B3A9D4551D5A6FB CAROL.FOSSEY
661,124,485 *442F8B0834DD55E0F9691F01D56A30648AE4CD2F CARSONNAZE
661,124,486 *44274EF44D35A69DA2B4D06E9E30537EEA1D3397 QP*{X}
661,124,487 *4429E9412BD07735D51F328D539C52D1CAFD1323 C=!)B
661,124,488 *442062365E61F1F2574A5D6CD2090051DB372A9A cb9lj
661,124,489 *442B0F3C6F30C19D1E7547B23B28510542E0BD46 quizas-quizas-quiz
661,124,490 *442171E21AFEA20737E0B0399CC3B80005FE0916 CBUCK
661,124,491 *44204C42A823CC0ADCEEBD823C9863B6321C0B63 c$c#q
661,124,492 *442BD281EACA30A322C142832E9E34854EBA924C RAETTAWY
661,124,493 *442E6B5696521AA5D7363184AB5191FBE0E009D7 cdq=,
661,124,494 *4426FC114CB466A952D35EA91D3681CB8D078A4C randalwalka
661,124,495 *442D5A5C6E875D9B0951A3003F2FF732F79FB548 RANDELL.COSGROVE
661,124,496 *442FE0D1587746641C056EEE62FA62D99F54BFDB C#EO/
661,124,497 *44225B1F9374D784D09B088BFB3C7618666672D0 RASHAD.RATH
661,124,498 *4428711C4326F014B54ED83417AB22A7C0417E71 raşidûn
661,124,499 *442393FC4809C20B949380665864359E9D7E9A4F RAVITAILLEER
661,124,500 *442B499AD3016B7255215AD84E0CD896C7B703E4 REEBOKSTEVENS
661,124,501 *442AC583F9BF10AA823BBBF44A04E5554297C720 REEROMEM
661,124,502 *442FC53E81329DCE9154997F98D0B71A072E1DA5 RELOANS
661,124,503 *44281A340B635CCFEE0A7E327FDC78A40F7241E2 remembering,part2(newday)
661,124,504 *442833D855198A8806AF0EA69B7EA5AAFD6C4893 [email protected]
661,124,505 *442F4C9AB01C37E998D0E09C40A1B56F7E770578 CHANGUKAKA
661,124,506 *4421F23C6EE60FA0FC91B9BF069BBB29D8CF7F3E charlotte3204
661,124,507 *44243BCAECA78FB6057ABF91104871D1F4FA61FF [email protected]
661,124,508 *442A1903909C440C70378BC097A8EACEB92EB144 CHETLIETZKE
661,124,509 *4420A6108038A3AC07196504E89DDD6764E4759B chh;k
661,124,510 *4424F0C7250FE7E178A727A4CEB4B7D7BEA4B500 CHIAVERIGASSE
661,124,511 *44296AEA99685E234E9221C7E055F1DEBB86D25E chileong
661,124,512 *44246F0FC436995399A59A6D0C1D9CF3A00557C1 [email protected]
661,124,513 *4424EB59AD6C8E558421E8927DC36182552705E3 CHNOFFNAME
661,124,514 *442C22F532ED56D9B021013EF4E20A3E12F9CAE5 CHRISGREENLIEF
661,124,515 *44223A013BE53599DAA457EEE84C896880267852 riverplazza
661,124,516 *4423B56C18E49657BF2DE1CC6AD8826AFCAC460C CHUNGKIN2
661,124,517 *4428AD27643BD2B06613B828924ED8E816C994ED ROBTREGANS
661,124,518 *442108057E55AF84CD140DB6F8D92AC45EF2FCCB RODOLFOHINES
661,124,519 *4422B686375B09B90886BCEE282E48AD4FECF44C RODRICK.HADSALL
661,124,520 *4420D0A48932303278EE758747EAAF1C934A574C citydotfontbsw
661,124,521 *44205A37A51FE63D191F828D17C549443AE83F65 RODRIJOED
661,124,522 *442CEB118063112498DDE7BEC15B5759ECD4316E ROLAND.TERESI
661,124,523 *44218188945214A6545A61881514DA2ACFF9C45F CJW5P
661,124,524 *442A9C8C05B8F3A551BD659A2B928526AA3C01D2 CLAIR.LOH
661,124,525 *442DC4FB1AC194A81EBDB0E8CF04759E6EBC2AA8 ROUBADOR7
661,124,526 *442745277CEE94BEB794325F61B8A4070C2E38AD cliftoncambric
661,124,527 *442CEFCC0185F7D079BDAC2F9AA9E5F83DA5DF9D rsprmtrc0
661,124,528 *442341F6D21483828CEA6C761B80560E37A69059 RÜTTERSWALL
661,124,529 *442AB0DF0A31241DEA403FA27F83422307A39056 cmk(_
661,124,530 *442A7945B6F57F7D22AD967A9CE3F47442F74242 CM&O%
661,124,531 *4424A42AE2AC679964C37582EA3FBD557ACF3636 cmqud
661,124,532 *442AFF26529A90BA6204809ACAF6D7034295BD06 ryker9
661,124,533 *442E8F1227E4BDF18C30914AB00D79884D17EFE9 salhooe
661,124,534 *442A7CFC08AD4AFF07621F2352FA1CFE0EEA8BA6 CO9_
661,124,535 *4422B3C61254A5DCF7DD6249CFC1F344DC73D979 SAMPSONPUPPY8
661,124,536 *44203B443DC6557E93D920427D257BB1E3C11484 colinmillikan
661,124,537 *442629698604C97982A103E20A1A7ED36E39F2D3 SAMUEL.STRAUSS
661,124,538 *4427BA6C841ED1697AA54799BCB60EEE0967E2D8 SANTOS.BRUNELL
661,124,539 *44219898FA8093C6F757CEC4F0FD8EB7B3CEFAB4 SASKATCHEWANSHELL
661,124,540 *4423217C74A702E08DEFA56416371B0EF9A19FD7 schuhens8
661,124,541 *44226A05A6AF3B66460799FAFC13FC981D3B0F2D SCOTT-CHARPENTIER
661,124,542 *4429A3F01F708AF23147BD69BA32447F69C2813B sea-scaping.monthly
661,124,543 *442A5D960922701C104D5D298F08F558ECB8E88E SELWUAP0
661,124,544 *442BE0DEA511E7170437B2BBFEEC01AD567E8859 corytrojan
661,124,545 *44223C097C76340BF7E84DB4B8A30FBF3A46A99D SHELLEY SPARKES
661,124,546 *44264B9DAAF4C78DDAD722F7DE0DEE4AEAA504B4 SHELTON.GAUCI
661,124,547 *44294D9CBB273CFF06F9286A6FDC02DD6A1AF275 cpb5o
661,124,548 *4420686D11C0554AF4216ECC5290D83A08BF10DE (CRAWL-X) BUT OF COURSE
661,124,549 *442A2C0C5C4F60D2B06CD10EF3044B5A8B44E1B0 SITATIVES
661,124,550 *442B34594C3F34920DD81A7256C1E2E9F515084A SIUBA
661,124,551 *442997480D3DE9D04F0CB87BE4C781AD760AB42D C(UFM
661,124,552 *442CA240763601BB461B5E7B6CCBDFB638321C2C cv,l
661,124,553 *442FB30EAEC20E82739642B1FCA3A804E8FB1BB1 SONATE HOB XVI/6 : FINALE ALLEGRO MOLTO
661,124,554 *4424AF711C89C8694381714CB8BC4C040942DABB SONYERICSSON1992
661,124,555 *442CA59DE6AD12FCE6E2934CD782E65A1571D2A6 cz!sw
661,124,556 *4424D48B2C25003EBF2FDAA216A5CCCB15B66A7C >-<* *D=3
661,124,557 *4422E71C34DF899CF9D135E22300D445FBA484E8 [email protected]
661,124,558 *442A8BD9ADD5FFFC89E97F52F916EFA82FA96F60 SPERMATOGENESISIN
661,124,559 *4428757987FBDA961273AE89F5CC7723A1B5C186 D$6AE
661,124,560 *442DDE75A1C089E23B0140E545623B45006C3E1B spinpinsoodefinite
661,124,561 *442883F1D336D628978B614CFE040BD228288CBD Splat!!-`-<==B
661,124,562 *442667F8C92AE9DF3802F13A70933A6AE0067F65 splat~ ` db
661,124,563 *442342418B1DB2758CFECF8346A45D9570874523 DALTFJIAA
661,124,564 *442943067171E8FA9877690F99702DB27D392941 SRECKOPOPOVIC
661,124,565 *44272423D05A98BB8F745A0139F3F99C23C35F2E DANJUMA IDRIS
661,124,566 *442F622F01C1A3ABD67B154E229D493B3F686271 DANSEAVECLESMEROUS
661,124,567 *442EF9AF8B6F5FEE317AEA2B1270FBC3635C4CAD ssnreknaw
661,124,568 *44223987724563CB23628FF6F36A702780EE4C56 STACEYGRAINEY
661,124,569 *442C65293AC2AF25F32F7ABA91A81EDE76FEC415 standre..s.t.ae1.n.d.er0
661,124,570 *442D106F8FAFE6EAE36BD64F451E89F144AFB4B7 darteli
661,124,571 *44231B2058AD37CA93EECAD64735BDCFEBCB6309 darwinvictor
661,124,572 *4423ADBA7C1CEC8C810EFB6B2681835E50B99FEB DAVID.RAYSOR
661,124,573 *442E00961F1198B70CEF6C73D71F75C0EA96B852 dawnroses0
661,124,574 *442EDC6CEB83D41305022CCF54B04B526E5C4C05 db2mj
661,124,575 *4425C7F0D00EE8BFAF09AC837F6AB749E36516EF STEPHKOKO
661,124,576 *442941DE916F4CB05EA540F9710FC513ED02C663 DEAD-RINGERS-SERIES-4
661,124,577 *44272F9DE266ACCE6406ECA2331489455C419114 DEE.MAEWEATHER
661,124,578 *442F993C6E9ED8831ADABED7AD347844665FA863 STRÖMUNGSBEDINGTEN
661,124,579 *44237E18162FF7D90CC632A5075E6F3A3D301E3B delayrm4
661,124,580 *442DE380B23D4500FB6182AF4AB04F55D3A27CD9 subba-rao-valluru
661,124,581 *4423B1142BD165B9663AB2F42F0EF6BDDE9A5D47 [email protected]
661,124,582 *4423B5F275DBBE9E9512FBDCFFF0FDCA132FEBF9 demarcusparadis
661,124,583 *44290CA692DDF7C342F461E045D788CB46922E02 subquarries
661,124,584 *4427AD8B79105E1B281BB95B5FBC37316FD47A2B derek.scheidt
661,124,585 *442BD34194F716CAC1A6EC975759BE4D4D6E4E04 destruktivnima
661,124,586 *4428ADEA727C59483A7D9EED97E9CB8F0A62BD1B dg2l
661,124,587 *442D27967B0143C6E41753DE89AC91C27F665091 surovoga1
661,124,588 *442E4AB3E9692B037B7F9AB9E9311E3C6E77CB66 SWEETKANGAROO
661,124,589 *4425EC7A876BF6DC9F03D8706CF89B95CFBF0B0E SZEROŚCI
661,124,590 *44221A8541BA2C5918C35C3ED60E8F98152F75DD dird,
661,124,591 *442F680AF9208E22BE0DA95B1DC5AA4FA549E3C4 disponiblast
661,124,592 *442E5999E92F0EA88E6CDE9DC249265F5C256B90 TALKDETROIT27
661,124,593 *442805B8A3C0F6E5C3A9A5BDC9379E25B06FDF96 TALKINITIAL-STRESS-D
661,124,594 *442D0D38AC435A4A77CED6CBBD1505A42F61D1F4 DK-D1
661,124,595 *4420DE68EFCBB7F08AD0A5B11A92BB59F2CCEDB7 DOMINIQUEBOGGS
661,124,596 *442172FE99C70948C35FECE7CD466315C38E1300 TENTASTE1
661,124,597 *4426C510F259E9940CBB91A06D1C8902F637B083 TERRYMMOORE
661,124,598 *442D67A3D54CA0A0A377F610BB47E1636D3D8AEC TGOLUBSKI
661,124,599 *442E9CB6B4EDD57BB5AE0905889FA7D98BE1F091 thatsilver2007
661,124,600 *442EB0C4F2A1318A48CDF4C992FFA2D53F66038F threemax
661,124,601 *4424C2F9B2ECFD47CB460D49607DA825A431CA5F THUISLEVERINGSKAST
661,124,602 *4429D1C767FD9BEBA52CDF203BB471DC709E4FBD dropvolley
661,124,603 *44204ADBA340761159BAF59E6BA0BDBA498E18A5 TIMOTHYCAROLI
661,124,604 *4425ADF2DA64063E9DAD72404BDBCEB4B427C30A TINACTIN
661,124,605 *442D6827DBDEA7C79633BCA219233431FB88E9C7 TINNERY3
661,124,606 *44206F2E5A6127C0C36D190C6082B5D684A9903B D)Ud
661,124,607 *44281453E5A00AB0AB859A3948FF3819219ECCEF TODLOSKIBSW4
661,124,608 *44259646035AD697C016255AE8FD93BDB62EB388 dugdalemf
661,124,609 *442EEBE23CA60C1AE5490C2040E835AB01312681 TOIMINTO7
661,124,610 *442CC83D0B9B05B751835F6159DDD47F25B77359 [email protected]
661,124,611 *4429EEF1C47D61CDCFBDD33048C46580C1BAA7E8 DUNCANDUDLESON
661,124,612 *442830416AB8D09220EAA22C893C6BF5F1BB0AF6 TOTALCATHOLIC.COMWWW
661,124,613 *442C3E490D18D447C19D9EB6779F2C15499A7C16 [email protected]
661,124,614 *442DCA7F21BE84C6ECFCA4C6930F1410816786EC d.uxm
661,124,615 *4423AE90CD30FD533F5F124CA15271D5F4C91A84 TRABUNJAJU2
661,124,616 *4423DEAACDB8426AC56CA41B3E6DEDEAC90B9D44 [email protected]
661,124,617 *44291ED7B24AE32496F3B46C67721CF011952110 D_VUW
661,124,618 *442F08ADC603FED29C8C5CC8624C812E6D7D5786 TRE RICHARDS
661,124,619 *442F42DE5B3162CB78A0FED8331A11FF1F62955E trevor.widmyer
661,124,620 *442C573A0B7626AAA0AEA8B5BCD814E330E94FB0 TRISTAN.DELISSER
661,124,621 *4422F5BC2D0F40EDECCC8484A17D8D1A8B362C07 [email protected]
661,124,622 *4420EF8FF6A1D5476D51EF742970361C7F755EFD [email protected]
661,124,623 *442EAB1264859F5F6A6AACC07D7788B749624FA4 TUIANA.PITTS
661,124,624 *4422618F0FE7CC925F704C62A723E7199499E876 tu.madre.racing
661,124,625 *4422C9CBA08652C989B8AD25588F050E703FD0A8 ea1ut
661,124,626 *44254836936D3AB0B1B14DDE0E96C118FCFB0F91 EBEVFMU1
661,124,627 *44246EC638CB6AE7FE13AD4FB577CD2B382C18DB UIRTUTEM0
661,124,628 *442C833EF22CCE7C737BF0827AE42E87D8450764 ULB4
661,124,629 *4426B7393B662F53269A782D7775C37F3DC335DB ed_pp
661,124,630 *44253C9CEEF71FF774B66E6405BB136A332419E1 EFDCQ
661,124,631 *442CB0152019977848350211A03C288FC8293971 untitledorsomething
661,124,632 *442674A004D66C9C5841EA718D264F77D8E1FA78 USTESOYING
661,124,633 *442ED700A53F885EA25F4176A74A11A179DDB3DD UUPXIKMBLAL6
661,124,634 *442DF048333DD959A1ECA589F2F646F3CA53F271 uwem-nkanang
661,124,635 *442CD16FEC917B14B45A547C005F1901EEBC41ED Eleanor.Rigby.(The.Beatles.vs..Kraftwerk)
661,124,636 *442949477DAFC023BD1B98E0E85B3B4E9E5EDA6B elena221
661,124,637 *442981A560A7094239E1B52D7A28BA94B8046A41 ELISEO.CASTANON
661,124,638 *442C6B20C0B336E003007D7C8A9C5BD873927347 eliseoguebara
661,124,639 *4420D8B77DBAA94A6C2D9F0B68F3B6C7640E48C7 ELISHAGOERTZEN
661,124,640 *4423665B43D12D175BCD8B12B679D26E667FEC22 VALTIERNEY
661,124,641 *442416282D4C9F993733D06923FFF090C53BC900 eloyvogtman
661,124,642 *44203915A0E58D8B4A8628521107A3D458969386 vanessaguiste
661,124,643 *44296FB8EBC8FA559082EB15725E08DAB238E93B elwph
661,124,644 *442A94DB1BCA953F6689120F09025CE8431CF04E EMILE.FEEMSTER
661,124,645 *442A419FB6916FC34EA22E0CB437DFC795539E83 EMMANUEL.CARTLEDGE
661,124,646 *4421893F61EEF8BE6E46647BD98CB381B0B7D5EC E;MS
661,124,647 *4420089B47A4384F766FC8CE2436481ECBEB3693 e<n
661,124,648 *442FE321CA441E41F0964D8FCC62E4C1C39952C8 VICKY-DESCHAMBAULT
661,124,649 *442CD1DA4C07AD5D04EE707E87136F1A30A9173F ENH%H
661,124,650 *442618DCD958D7C5861F11690E1AEB64A80AA464 viisikymmenluvulta
661,124,651 *442688C5B0DA8BB6FA7F6E4ADCD0DAA73F3E10F0 VINCARPATEL
661,124,652 *442BFBF030C66EBFEC25CF117B7D265BB83C239A VIPER1953
661,124,653 *4425030E3088662ED8F830EE4D26E9355A806D12 envliedt3
661,124,654 *4425FA3EED7C5EA7ECD86FF7C93B149CE0588D55 [email protected]
661,124,655 *442137114C12B29AA9632DAC7C897ABDEF7E4EB2 VIVIAN MAHINAY
661,124,656 *44224F3ACC4EB023F3FFDEEA3971DC2AA759C312 voetwis3
661,124,657 *442B5D4A11CD5564F6EB6D35B88EBD291374E6CA erswoher5
661,124,658 *442CDBA6BB7A90B7ECD57DDAFD2629D620348CCA ER.T1
661,124,659 *4420EAEA0ACAB482A79EC2DE43DFB1BF22086FD7 WALLYRABEHL
661,124,660 *44274457427A76A3149BA5ADBF714A858F02D048 WALTER NAUMOVITZ
661,124,661 *4425D74F07F623746E4E46BF90297DE862A2AC17 [email protected]
661,124,662 *442DA7A4C6A0E1EAC316817B1E20B72538241035 [email protected]
661,124,663 *442DC5EAE904A86C91E3B89BEA3AC4D8AEED9646 wa-ode-mufriha
661,124,664 *4424D9D0553276E549CBA8B04E4F478D5D602E73 waqas.jalali
661,124,665 *442146925485734DDE28B23F45137ED25984432A WARREN.HOBSON
661,124,666 *442349C2816EA3EBF72D9A240DC53982C8713E33 WED954NECK
661,124,667 *4427C5A12435773F58640F2EE9E4EBD5D0AD13E3 WEST KANY
661,124,668 *442FBEAC7FEFE4DD543B95EF9EA1B18B1BFDCD9C WEWE AYYAD
661,124,669 *442ACBD4AD51E4B21C33CB992AC75131F02ED1E4 whatudo(original12"mix)
661,124,670 *442CE171F7E8D9330FBD7C355B71A3BF56C43139 etaierions?
661,124,671 *44200201990FDEFEB38BC80AFB5CF54D74C82783 etr+q
661,124,672 *442E118EE077858B316DF70EC87B9869BBE6BC3B EUGENELONGE
661,124,673 *4421E7F1CE63ADCD28143DC1012500C120F7CCD5 EUGENIO.BISAILLON
661,124,674 *4426CB8C8C8D10C31A52FC9198ABBD589462D637 wochnitz
661,124,675 *44224D25E9FF0FE16224BDA5F440F8F092FB191B wP$*
661,124,676 *442A61691E95522CC25301301926CFD7326C18F2 wwwlcwainccom
661,124,677 *4428E1E99B2DC756BD33B3EB232AFAC5AB4B4A22 WWWREININGAPPALOOSACOM
661,124,678 *442DF1EDE58602EFCBAF13F8174468F67ACEFC68 [email protected]
661,124,679 *44205AD7FAA27E896C0CA94486E38144BD3BA17E [email protected]
661,124,680 *442E54E0605BB5B22690D52C8CEF4D55FDA380BC F0RLY$T3D
661,124,681 *4424C2FF3F7DB037D741DEB65F3D7317D3E8A7CE F3L1C1TYF3Y
661,124,682 *4421CF24D74E996E510A6F6376F810D7D53DD7ED F3RT111Z3R$
661,124,683 *44246B84FFEBFABE1B6E4E1C0933B498B0521433 FAITJAN9
661,124,684 *442AC285020AE42F5D86590D4546D8A1D427DD44 FAUSTOKATELY
661,124,685 *442E13FA70DD3B2FA55CEC1760526CB4C574A488 fd|aaa
661,124,686 *4428D14370F73CE8C4CC070E9DCD2851C1868110 [email protected]
661,124,687 *442674E6CD7DBA2CEE337C0D796D1A2BDDAAA1C8 FELIXFLANDERS
661,124,688 *442B89620A6B23492EC9645C81B96A53C03C6731 FERDINANDCARRIL
661,124,689 *442F6430E61F173B58B8979011892BE282349287 yangfuhao
661,124,690 *4421D7F95AB937AEC2C5FF4D67AA03916B5E2385 [email protected]
661,124,691 *442E92B2D7AC5A52E23D7DC7C0823CDBD6F4C6FA yerduav3
661,124,692 *44227A14E139E6C53ADC064D5391713C942BE4AB YING HOE MAH
661,124,693 *4426AC5A86F83C2646AA4C009E67D3C2F0DB4C0D YOLANDAVOLKWYNBENJAMIN
661,124,694 *442F12900AE4177ADBBC618634AA53842D5D2695 YUKHEVELS
661,124,695 *44290675522077E561E7CFFF71BCDF0763CD55C6 YULLICAR
661,124,696 *44273B34B0DADCA0691ED83E948DF29C533E92A5 yvonne-chai-saung-wan
661,124,697 *4426B4302ADE3D8516C001E2D7600C08FF39D626 YYA-
661,124,698 *442E2BD9B0ABDDF1791D0BEACB3087B5937E399B ZAILA-MOHAMAD
661,124,699 *4421F4679EAA79664B2AA879B9C33E144CEA726B zairon.sabandal
661,124,700 *442B8D881B3C3DDA2422500B8FF54339B482AD19 [email protected]
661,124,701 *442BE488810C446E36A21C3EEE89B36BE2D7BC1F ZAPATA131313
661,124,702 *44219386EC409E92F72817FCA3C23C0E046569D9 [email protected]@7E
661,124,703 *4429E144C52CC2EFA37323E237ADCCA9C781BE4C [email protected]
661,124,704 *4426D5D80AF46C7B28D0C06146AAFB16D5973670 [email protected]
661,124,705 *4425B0F79471765982993B267C4CD4AE614D5D70 [email protected]
661,124,706 *44291D634C7511CF0FB1DA54BDC4A17E6128CFA5 FOR-CANTILEVER
661,124,707 *442B3474938B3381DB37AF0A8D3EDA281F308878 ZIEGENBOCK“
661,124,708 *44279167E40E57D3EE143DAA3E2460AF0D642901 ZIPOZIHLEOAZO
661,124,709 *4422365F089260F1C86CB0C38304F6D4C6BF0E29 fozzieswimmer
661,124,710 *442FF1DFD71DE48CEDE73E3D6FE4598DFA63EB40 FREDRIC.HAWVER
661,124,711 *442C1858DFE434E639336EC40BA8A3BFB15C49C9 FREDRIC.MILSTER
661,124,712 *442EDA6A97415FCFFAE6B61903B596228193D1BF ἙΟΡΤΩ̂Ν
661,124,713 *4426FD19BB710948E5FD8B28BE37F32E56451C9C Fuffies-im-Club-(remix)-(feat.-Harris)
661,124,714 *4424FF31BC467E28CE48FDF5664D9B1B1C475743 [email protected]
661,124,715 *442BC896C1DE1E8793C54FA3347B380266291321 атинською
661,124,716 *442DEA79E747B113CB7C39BD6681C91AAA340190 gambrose3
661,124,717 *4427F4E63E4A1BFE7F087C6A69FDB56A19351027 ЛАДЕСМА
661,124,718 *4425C4B42579AEA9CCBF8F47442131DBA21C3706 GAVYN771
661,124,719 *442B9D7339346CC46458D45EEA62261E4C814A08 GELIYORERKEK
661,124,720 *442E86822693B84169C9A15910A4BB033574BBDE GEMURKSEL
661,124,721 *44236BA39C1A98C4ECBA6AD642DA564AFDFAFBF1 GEORGIANAELENA12
661,124,722 *44281F1EEBCB4900E3FEBDA7DC0E64300C0B1D16 gmzk
661,124,723 *442C172C0EF387284DE7FB79EC168641CE4EAB3A [email protected]
661,124,724 *442465CE2E8E8CEDB8A757C0C029E053B348B338 G~Q\
661,124,725 *4428D4512B8887B97D01B6CDE31D26A1B7AD5619 GROVERCHICK03
661,124,726 *4428A2E746853640CD5EB9DDBB664CAA3088886B g!tc
661,124,727 *442CB970335BB1789EC586610D864EBD195C18B4 GUY.HUSAR
661,124,728 *44252EFA0A8F9BE4AE74DB1F88AFD52F56BEB971 guyzickler
661,124,729 *442384311B1692B645AA9D619A6F2E7DDD8FF5C5 gw5~
661,124,730 *442DFC9E339AB739DEC82928926D296EBCBF938A habetis3
661,124,731 *442F8A89496D3D97861DAABECC635E41F04D7933 HAILSE7
661,124,732 *442C241EE0DFCABF9EC9388AAC360C9A104DF394 [email protected]
661,124,733 *4422737CEBDFB1B45A8088324140F5293FAB2352 HARLAND.FOWLIE
661,124,734 *44291013F5E346C97332BAFB3894447F9497200B HARLEY1AND2
661,124,735 *442715B7B397EB68ADE91D9B676A0E098AC50CCA (0_<)~`(-----p
661,124,736 *44223084A71ACDEC61938E87F39BA5E1E7A744E1 1197994 "kokohommansalaisuusonsiin
661,124,737 *442462323E2306D86500B51831225E2588F51A84 119ek849success
661,124,738 *4423DC37FC2EEC94AF5D61F2A9A4810F82A3D98C 12: 12 -# -& CHECKERS
661,124,739 *4428A98C83A6B6937188D2F6F6818250844BA7D8 12jan1282
661,124,740 *4424840AD2CCD2A694ED007A61731C58F76DEDE8 HENNYSUKMAWATI
661,124,741 *442A7917E1B10D86AFC33FB9A72CD955646FE26B HGHYSKJIOWFTNV
661,124,742 *442E0206596365D2242B5F5493B0E6BB66237B13 1607788 oletettavastit
661,124,743 *442BB050C1CD9EC5862DA6F00EA398C2FFEB3180 HIPOLITO.CERULLO
661,124,744 *442E6E46BF325199F8CF3859583CBEFD9DAD7068 162762 "amdonnerstagwirdgewaehlt."
661,124,745 *442A18340F222690E3EA9FE439407C2DE335D404 16AUGUST1405
661,124,746 *442EF96926638336468D6DD35DE713510DAEF80B 1762734 asetuksia-voi-muutella-tarpeen-mukaan-my
661,124,747 *4423CA65A78437F9B5E08E3CDD495F0408FD16B5 1809595 NEBEN-KAPITAEN-KAHN-DER-ERSTE-OFFIZIER-
661,124,748 *44231E894D9126466950D3B7BFA34C5FA7CE9AB4 1887HAMBURG
661,124,749 *44227ED36CA1209B4326ED278760692702D975BE horizontaler6
661,124,750 *442883F7E7CDA72AD48BD73D618AAE3B6FBBE703 1AJOUPAS
661,124,751 *4423CFAAFFED930862C8F8A1BF72673103D66645 1ALANNAL
661,124,752 *4421D7032C88F78BC4B32778E723A15349691E42 HSAMURR
661,124,753 *4428B8E23D648578B36105C34243A85FE2CE0A2E 1alpleichtathletikmeeting
661,124,754 *442E9B0381E565BD0ACD3F4A7741EA69C746EB9D [email protected]
661,124,755 *442ED9FDBF68B6A256EAD63F479F407DC405A131 1 atk-p
661,124,756 *44280E84978F16EBF34F05535CDB09647C9F3AF1 1.beton-decken
661,124,757 *442E8F5654FA0AE3C9B4585491E85CEEA881DE36 1DERBIPILOT
661,124,758 *4424F6C2C6BF1963797E534986F2BA134FD00E0F “hunat”
661,124,759 *442A29BED671A1995E4E644179FE9E56F4C20EDC 1iamcarlos9
661,124,760 *4425DF3AA8B7EA49C56A55DCA7C037A0990C4B74 1.judge-training
661,124,761 *4428BAB3334A3DF7682139BE7A68D93A25F5C626 ([iaaa
661,124,762 *4425B28922234BF83E147211A4E25AFA029A4D71 IAMDOLPHINABC
661,124,763 *4429A79178742C6C67F9D69F3ECBE75165648055 IAMLEE58
661,124,764 *442CC937ABF3657EB1EF098F59384F094F0E6D78 1 LLEVA
661,124,765 *4427B0E64E7E12A506F32C681EB773E598B0E067 icorsive9
661,124,766 *442D1285C3D23388AF3B139AAB030AF18F4885CF ihmiselaemaeaen
661,124,767 *44239E444CE877A526BFEF013D7414B6F15DB6C6 1-PONDSY
661,124,768 *442F970DA82137B44B05F4A1B3E4E1B47913B951 ILUVSMASH!HITS(DISC2)
661,124,769 *442AEA3BDB8EA0694035E93D82E93AF709CCBA53 1siemenker
661,124,770 *442E2F63D424A3865741A6DE71A60CD7F94670BE INESHAN2
661,124,771 *442D20A7D0923DF1F171F5CD69BA591399A6457A INGAVERP
661,124,772 *442A21C62D5986ED0BFE1E8972E4E6B992C1834D 20pfertzel
661,124,773 *442018F05BB5F498D8480D8C4343EE11F4D2CFB3 2237683 miten.leikkaus.meni.?
661,124,774 *442A213651EA63CD0469D5199E9D22627BFDCCFA 22-waehrungshuetern
661,124,775 *44248E521B20B70155F6EA28B890AF332E423A5C 2343728 RASISMIN UHRIT SAATTAVAT IME
661,124,776 *442215AC6E18076F37B8F39906B0713CDCB34535 2357899 kirjoittaja:petrisarjanen;fm,historianlehtori
661,124,777 *442877369247B2900A23491C8D5E19110BA6D4E2 irenehernando
661,124,778 *44212ED41471A8221095A05EA2D8E95F21ABC4F4 2501663 tuoreen-maalauksen-kastuminen-on-estett
661,124,779 *442E6FB611D386B8EBA6DF7331F1997828BD4F84 ISIAH.STELLUTI
661,124,780 *4425645D5E407CF8801E9E7A7BA7E1EDC3F19116 2543108 KIRJASTO J
661,124,781 *442F70B63DBE29AF00470E04CB05F401A167E7E8 2700001 HELSINKI-:-KUSTANNUSOSAKEYHTI
661,124,782 *442C439364F1033E3199CFF569C6515BD9635942 278805 SE-ON-HYVIN-K
661,124,783 *442F63CB85CD40AE8C53EBF29D8BFDA322C91D8E 27B55720-53C7-3447-90D2-076FEF30D4D5
661,124,784 *4420068A33A16450BA610799A1BDFB01D4AF956B 28021003
661,124,785 *4424E141A65BF5A28B25FDDBCA13F859D01408C2 2aliskin
661,124,786 *442D25C22051B77742038CC9F1918B2FCE6ACC23 2BOUWSOM
661,124,787 *4423CA8997F911F3BB9434991147F5530DF772E9 2DETCANE
661,124,788 *442D759C32EAB0968442958DAA7D7129DF916697 2GNJUSNIMA
661,124,789 *442588AF2504408E59ADBCA1E48DD09F3ACDD5CC 2lakattiin
661,124,790 *442C77804511C79DB82954D33936C8EFADD5D316 2THESALMON1
661,124,791 *4422E3A0C0912535AC5DC96D43BB19C0EED99138 JANET.SCRIVENER
661,124,792 *4428C2C22A9DAB77BDDA4E6F7A90606FBA9497DE 2.venturegesellschaft
661,124,793 *4425A9A38327433DCCA3E374F0FBFBB3C3708E2B 325444 bizim-goruslerimizi-soyle-ozetleyebilirim-
661,124,794 *4423926A9D3C735E2624DFBD79DA0A3A7D9C2122 [email protected]
661,124,795 *442B97DCE4D13361FDD5234A6D17AE72EC6DB3F4 33-ghosts-iv
661,124,796 *442A940BE21ADA15D329D8F0985778FFFC01BB08 J##BAA
661,124,797 *4426574A57F2078CC14690D7A3DCBBEC72F368B0 jcarnen4
661,124,798 *442E96A0AB4C5D47B8E009E4D186AF0AC0F93B33 JENNIFERRUDDOCK
661,124,799 *442FA66ABA65C3620E88E2FE10493999993E98DC 3GENLABORS
661,124,800 *4423FEC9479EF2F7D2B360D15BD9592A630A97C0 [email protected][email protected]
661,124,801 *442F58B6CA391B5E63D6C1F5818A5CFABCD98116 JERRYSPARGO
661,124,802 *442450ACD933359F597CFD399017A90E451ABC07 3----->`)o(
661,124,803 *442701D2B216D9EADEF8108170A31ECF9C84224F 3-P*-*-*splat
661,124,804 *442EFD3635A993D31FFD8C5FBAB819F5AC6DDFF2 [email protected]
661,124,805 *44251C232D4AD3E48621951A3EC7043C11466E90 [email protected]
661,124,806 *442F633F2361260E4E973F9CDE2DC5F6E4B3C169 3thatbuster6
661,124,807 *442C9FFEBF9C864BBB8621A67C2613FB10CD24E1 48mackenzie
661,124,808 *442602E5AE4A4569AD26055265D495A611206D55 johnnylillywhite
661,124,809 *442C04B0361A2AA15C81CA7D87306717063EA8BC 4GNIWOLLAF
661,124,810 *4423D8786E4765AD8EF9CD8C7A9CC8FB4E4E9957 [email protected]
661,124,811 *442EEFDE54D2125079DAD155921BA2F97C64A39B JOHN.TURTLE
661,124,812 *442C86A23094547354BFA68F627FBB40DDF2CA4F jonathan.fix
661,124,813 *4425EF1CB470AA939681C1B9DAED5EE619B39BC0 JORGE.CHAMPINE
661,124,814 *4422A2091A5B883CCF1243A9E09972869C738A91 4LLE9ORSTS
661,124,815 *44291E09D361199475A604734A83CD2F47DDA0A4 [email protected]
661,124,816 *44280B79C795AA5875A775F1A8D08492E14F44DB JOSHWADDICK
661,124,817 *44247126E400F0B58214677D61EB3207C797D3DE 4NIEMI-IILAHTI
661,124,818 *44290FA4202096B81234A4773B99898F059662E2 4SERWAUNT
661,124,819 *442639FC3AE3969A3FE47069221E6903F5609522 4SNICKERSSCOTT
661,124,820 *442674ADB92B23BC2F8D6F921AD95D8C15E7CFCE julessherfey
661,124,821 *4422AD571F518A3C78C3814B4F5696C63693C85D julieebio
661,124,822 *442E00404851A34634758A6B457C1893BCCB60C9 JUSTINNOVAS
661,124,823 *442ABFCA86D83E2DF5D60FEFC3FBA7ADACD8C988 500520 AUCHBARBARAUNDHORSTWINZERAUSKASSELSINDBESTUERZT.
661,124,824 *44225BC0B5759187BCC593535E7B494CEFC56ECA KABAREE》(英譯:TANGO
661,124,825 *4428FC94E5542124B4C310CD6A3B0442E051C88A KAMERLID9
661,124,826 *442FE5A2A949E5A16664A205408E9057A74C81C2 KANSASCOMMERCE
661,124,827 *442EC921C19BFF5CA055D4FC790AEDFE30ECC5DF KARSEVA
661,124,828 *4423C6CC0E6D2AFE7BAD769F37288F5AFE154593 katebonham
661,124,829 *442311676FC19A9101E4274C790976F4F5C46390 5.cellsomar
661,124,830 *4421DF980565887AEFF36FCC3FAC626FFEFC8E28 5CIBALLIS
661,124,831 *442D7CBDE9C1B22BECEAE520880571AE0A2580FA [email protected]
661,124,832 *442E2662B46CEDA555320B60D3B905FD2CDF8277 5EDICTIJN
661,124,833 *44207D82D9B06F67CC01FCD28EAFC3D1B43B2FB7 5IAMDOOKIE
661,124,834 *442F49BA91169F8548D8D51E96550A4D18E6000C KELLY.QUAYE
661,124,835 *442E645D079D9C243EDDF3EED5CE47088115A6AC KENTON.NIENHAUS
661,124,836 *4421E98F7D6E329F1DDDB0D377002B6D6BCF6CC3 kermitlenihan
661,124,837 *44210CC64E77BCEB9BC4CB519BBBE56294D425DC KERMITROOSTER
661,124,838 *442DD831737AEDCD011FAB9168BF4B7E8790E946 kexstub
661,124,839 *4425BDA49C345E6CDD2262FE59E03D1106ABDC96 KIMLIKESSEX
661,124,840 *442F90B0B1E41A7AE8DA72FC428A91DD76E80966 kimtkimt6
661,124,841 *4422BF80FF6330788F545671D496B0E2DEEBA668 5prenotifies
661,124,842 *4425353A1E483022E59485F3CF4323E71FB54398 kiss so hard
661,124,843 *442B27E66B6C47F0D83F767E74ABC81341989379 kjkaaa
661,124,844 *44221E6276C047A1310C0816A47D4FA161A5572A KOKOROSH9
661,124,845 *442D2FCEEB771A1B6A8AE8C80FFE63475A5BF7BE KOREY.VACARRO
661,124,846 *442734223DFE0C20776D35BBB801281C6CEA76C3 kristoferkohlhoff
661,124,847 *44238F93E0AD648196185F4F3F67EE7C618DB6CA 6ALUMINIAN
661,124,848 *4422C9AAE4C8DDBBCF5B62F61729C15983C1F152 6BSWINSLLFBSW
661,124,849 *44214100AA284BA471C2AE25C6497CA42477362B kupeane6
661,124,850 *442258AE66FC83973573A5ABE70A4863EA3CE3F2 KYAUCHANKA
661,124,851 *44232839CBD494655E3055415B51ACD3AB34F45C 6fourberies
661,124,852 *4420D3849C71F2553E897704B239BFE99911F733 LA.COMPUTADORA
661,124,853 *442E2B42B60EC973766B6C2D224EB8BC2003D4AA [email protected]
661,124,854 *442ADDCC3274BE63FD2A2486A6BDDA60C63FF694 LAMISHAGARDNER
661,124,855 *44255600C0E34FC289A7A3ECC82F0B7EA33D40D9 larryear
661,124,856 *4420FF3E8339F2C0C373E0355DC7FCED3CA3AA02 6UNSUSPECTINGN
661,124,857 *44247A715D5C7AB7356AFE5D90388FEDA11F13B2 LAVERNEKONICK
661,124,858 *442BD860C7B531F683A45C99C387BA3BCCF49CC5 layla-marie
661,124,859 *442D32E7A68D1944F94C7B5D62B32B486798AE70 lecythopsis
661,124,860 *442A9D78DCD0B99CC57A4010B0604AE7A37C9FDD 7begluurt
661,124,861 *442FF0CF289F8C018BA2EE0742947644026EDEFB LESCHERRIE
661,124,862 *4429153B33D6BC88E110D67B3A539CC2D28A81F9 7FREMLGGELSERS
661,124,863 *442AC6C68CAF3A032BD32BB1C3F146E444D0CEAC 7HUDSONFALLS
661,124,864 *44271657038224335B3516D1B0400164D13A5EC7 7MONETERNE
661,124,865 *4421EBE40571E412E2F00CED4AD7C9B72CAC4C3B 7NOTUUTSA
661,124,866 *442FDD33C2CDFC2E58FFA7D3A13B20DCB310444C 7OUCH!NESS
661,124,867 *442638F0E4EA265885D7918E04E60BD9F770900D light–excitable
661,124,868 *4423FE9CD5ACD5E359CD396B913E0988EBB78BC5 [email protected]
661,124,869 *442C58086E6D904B568D45BF09A9DAC3E888DFD2 LINO.DUNCANS
661,124,870 *44231563D06D8C4B77B9EFB03D746A607295FD02 LIONKING
661,124,871 *442F8D938653CBA6125D791F10A57014E9F96EAA lizbauman
661,124,872 *4427A22654A5C83E2D4D55D087B9A55E003F4D42 8##b~0(0_<)
661,124,873 *4424F9CEC28BC40B47E0700A647FA8028DE6DDBF lopelo5
661,124,874 *44266C53AEB3B297C1D82CE7B736CBF848D4471F 8EPERRIPSE
661,124,875 *442C2790A7E7DB709F16ED5EA178C12C4357C08F 8FINALESES
661,124,876 *44284A7D518CCB48AC0E422F227A06BB71EAF0DA LOWELLKONDRATOWICZ
661,124,877 *44228A6BEB5DA205E612C415459A9138CB38162E LUCIENWHISTLE
661,124,878 *4422DDD1DEF1562564779651A888BAC4A822EC8B luotuuns
661,124,879 *44278DB89084E6C07AD6841ED266B1D553B27954 8ONOCCUZ
661,124,880 *4424AC9F2133A3BC7917DEED906D0C6CC164E1FC 8-----)~O~O (X)
661,124,881 *4427FADF76E000A25444C96E263F134D42269032 lymanbuenrostro
661,124,882 *4422F5B23F4CDE871ED3495B89379973C15B617F 8#####p~.~.~(o_-)
661,124,883 *4427AE62BC7D508CA3C3079652AA26960691EC42 [email protected]
661,124,884 *4429DE59C95264CF906E3EBA301652FFE164C5E4 [email protected]
661,124,885 *4426E9AFB787398F21806A77AF4427280545C11B 8WRONGARRAY
661,124,886 *44226527A622521F33122820D0FDC088C139F76D MAQUERS9
661,124,887 *4425092652E39597FAD0DCDA74FBC672F464A7A2 MARIA-BUCCILLI
661,124,888 *4427D3CB53458DE573A39F1C91D3B69028704D26 MARIEDEANE
661,124,889 *442BEF1A284B09876012800181AD01A09F61293F 9EXCIDESQUE
661,124,890 *44227E9A68682E7524D31147D39E074E44C7E9AC MARVIN.LAURITA
661,124,891 *4421758EFF743BEC9E2B3A0B512F4F495D35D9D4 marymoroney
661,124,892 *442CAFB658D3BE8549ED7AC12F2E6DFB2B2F4C80 [email protected]
661,124,893 *44243C3AA04E4726AE6985AA93DADFC375067A56 MAXWELLBENEZRA
661,124,894 *442F55863DE8EE6EC95375996BF33E49196648A4 MB7
661,124,895 *442A159D611D938C982C1E9BBC48B32E11AE84EC 9MATHABANEBSW
661,124,896 *442D79984BBB151CE44B7F6C5242FF3F247B60E3 9MYMAKEITSO3
661,124,897 *4420D453BDAEAF1A932ACC8674F85158CDAEC387 METAALGI7
661,124,898 *44212F83C3534A7BD5F0A8B435C63820BE6B8AC7 MGAVILA
661,124,899 *4426EAF9B1F8551192C2B22014641BCC1AD34FCB mi*baa
661,124,900 *44236E129BE3EF0002DAFB15B457EF2EB47B1415 MICHEALDAVENPORT
661,124,901 *44296A6F9DE2719B5DF5A4D893C8D1357C7F5B37 MINDY DARBY
661,124,902 *442B6C251F499D00D0DC1056DE21F542FBA554B8 miokyoo
661,124,903 *442E3CD2BC272175EC1D6381CAA861D1CA80481C A08111983
661,124,904 *4428C1F0D39EE1CEBD31F7D800854A11E5CB064C MOISES.VERRILLI
661,124,905 *44294575B90CD6019E6837BCD12CD21618133688 a1wa
661,124,906 *442A32CBA6950CBE8D4FC8AE8DA14592D8DC8DEC montebiser
661,124,907 *4429B7D26B0B1220F41360806894B3BBCA9D0EEB A3ks
661,124,908 *442FE8BA9472C6B05D76977CCD07BB488FF7AA15 a55ph
661,124,909 *442340981562FA612032FF94C532468C76768C86 A%7D
661,124,910 *442BC75C20F818991CBCFD3CBF74F4A89ABCF9C6 [email protected]$
661,124,911 *4420E8DB022E6C84F62CA32CF0BDF11CFA20548B MYBRYAN17
661,124,912 *44238662EAFAA917A483E8B3D072824A6B38D4B9 [email protected]
661,124,913 *4429DE1ED9F1E59EC7A3B3E51FA5A23826F22DA5 ab1qf
661,124,914 *4421812E67E046297CE971317F86B2B273FF267D abfv"
661,124,915 *4426DF3BDA02483A800D6DCD6192F7C090A51CA8 [email protected]
661,124,916 *4420D9A883E0BB85DCF01DBAF8EAA0E259D7AB3B abhallah
661,124,917 *442ECFE04508A437B5106C1F6326C2602643912A NEARSIGHT4
661,124,918 *442711B7188ED1171FA7526E4036D27911DF5976 AC?1C
661,124,919 *442EFAE2EC670D89761036AD5097118B71628B66 neziulpfa
661,124,920 *442B517BDE7FBC053F056433FA3BEA74DDC6426E NICK.DENCH
661,124,921 *442B790A962104E1AE251244DDEBB8800987C077 NICOS ESTACI
661,124,922 *442089458D8663EDFAA8D1EA39D96C443A4C6616 A(CN
661,124,923 *442EAA43FBBA2834C29C6A299007D8EF68A7607A NITESH-KUMAR-MISHRA
661,124,924 *44207C5604F7424D58DA041AEDB9E91220421E78 adam.finkle
661,124,925 *4423B140D4BA1AB83B8918EDF9BB33EF663A129C NOBLE.GAUDENZI
661,124,926 *4420F8F8FE79DB60F26B68F848D0A6EC804EFE59 NOBUHIDEARCHIVES
661,124,927 *442C6DB5F0641A56B1FA6DE131566120B0053090 NONPUTRESCENCE2
661,124,928 *442DBBA98295B718EC148A14DD3C96B22B893529 noormazirah
661,124,929 *44219BE51382E47091F04F8F3674229280918CFE NOURISHM123
661,124,930 *4420C2DFA3F9A9272F41E96F61BA344C50141957 NROMINGER
661,124,931 *442891D50B69A90BADD59AA73B99F57502E91735 A$DV(
661,124,932 *4428BA16A213269126298FD2CD0EA34E6A3B52E9 odjavi
661,124,933 *442469932EEB9B89E64B6AC8BBA97C7D76045876 AG(?H
661,124,934 *442B7249C2381C20AD6AA11323BABC5832DE5A50 AGRTFEO42
661,124,935 *4429485B58C7573DB54B5D0E4E7207AED69AE805 AGUSTIN.INGALA
661,124,936 *44202205746313A94F940EA713917339E36DF8BB AGWNIWDES6
661,124,937 *442FC5D1FE1AEB538F15BF824A69E72173513603 ajmerint
661,124,938 *4428A38CE5BDFD11491FC1185DBE8447D75CFC78 OSWALDO.COMPSTON
661,124,939 *442A654C7AFB881BEF21293DBC57F1F748997AEF AKZENTFORM
661,124,940 *4428FB1C5DFBE406DB7A568BAB2D5FB74077BE4E owj4
661,124,941 *4425D1E1D1ADB3EA259BACA3C7C23DB6CCA71D44 p-).~0.~oo->-<
661,124,942 *4423E833DEB228C3EC0CDBC982A57B0F871D25A7 p4rty!n9
661,124,943 *4423BC0A53B16BC344DFAC79A827B1A9A7191B68 pa79svg
661,124,944 *44225BB29358A4731DDA843DD5041FA31A5A5470 ALLEN.ROSELLE
661,124,945 *4420752D0B89BF9512F54D8A72598FB787D85A2B ALLRMATI
661,124,946 *442B645516A7399EF75D425AF9C5B390B518F205 [email protected]
661,124,947 *442B33E3911C7DC3E81AB1AFB1AD0B2FC40B6EC7 ALMONITA
661,124,948 *442BE58BD53339B232F07AF8BC997D5E504DE6D9 PANSERPENETRERENDE
661,124,949 *442A81D9CC6F27A8BF937A11BA8AEF3664A907A2 alq$5
661,124,950 *442582CAE92E7CA6915A27FCCC200D53DB26523B [email protected]
661,124,951 *4426EEA7DF04B16BEF71F96BE85E9E97DFB21A67 AM/M(
661,124,952 *442895D8412CBF321FF2184009A90930B964AC71 P-----D~-~-)x(
661,124,953 *442C052D8D78CE8E403A180FC4E2DD18226B91AE pencgah0
661,124,954 *442FA7893F54A9383B7E6FEA897185525D8C469B perrybaldwin
661,124,955 *442226713C92EE54B16A17A73AD5D0BC993F1BB0 ANHGH
661,124,956 *4421ADE26FA1C39668C4704938137DF9B883F062 ANL5N
661,124,957 *442089C18A486F9D228E322191380DB9CEC81335 pixi
661,124,958 *442C68828A4DF668245A8358D153BB072EB74CD4 PLUTOWISDOM
661,124,959 *44240B360877E3A2F07AC0BD1893A2BDF9336B7F [email protected]
661,124,960 *44211F1FBB2AD326C7058721B62B5F281EB96A5A [email protected]
661,124,961 *44238D4A37D52DDD259B90AE9B207DB9DEF27ABF PORTATEATRCIV
661,124,962 *442C87C767E8E99153C71F4E3C71110566E9912A praise1995
661,124,963 *442DE27AA4453C65AB7E3C3821F654FFF24B6F3B PRINCEBURBACK
661,124,964 *442D361771659D82BD586855C3FFA3BF51652BA2 A=RUT
661,124,965 *442F193C73DFB53D9FADF8BCED41C63FC0BDFE53 asafouts
661,124,966 *442EC6717B0A8985BF57606AD78D8E2273C4E961 ASA.FOUTS
661,124,967 *442B0D89D7C116223CC71567A22338F253FE033F ASHMATHEWS
661,124,968 *442C38ED625F0C1411787CE86BD1E404E4B18772 pru474616
661,124,969 *442F225004F9C0C6CF47C1A14D1EFDF4FFD532B3 A=?TB
661,124,970 *4422C9890D32296A8ECC147969B7B96E35BAD6F8 [email protected]
661,124,971 *442DE7FABF94402E708054859729FCFE22D092FB P-----).*SPLAT
661,124,972 *442CDE65FA4B7ACFCC166857E980D987046142E5 $ATURNINELY
661,124,973 *442037078A56C612E99F00D5C8DDFF1D0DABFA55 AUGUSTBAKOS
661,124,974 *442A391128A0A7D2F025D5ECD79A977804B90D10 AUGUSTINE.COOL
661,124,975 *4425C7D586A29AFB96A49CE2C2FD6A6CEEAFFD74 P##@.~.)X(
661,124,976 *442CF7DDAE247D4095836A22F7F9EDA454A92729 [email protected]
661,124,977 *4421F8B43F7FBE96EE273E138AFD4D0181C00DA2 [email protected]
661,124,978 *44285E1F71B796B2685A5822127358A05AB20D7F q##p-~-~>-<
661,124,979 *4426098FBA832C92CB849CB6602D9BD001D35FEB averykaufmann
661,124,980 *442E4D86D6129F465034A3C1A63FA3D720517954 av:mi
661,124,981 *4429A075ABB7EE38F1E3B136AE92917DE8C04D18 quintale
661,124,982 *44248A76F9EBF58B15F3BCB6A9B4DDA7167DC117 AZ&_
661,124,983 *442DCDE7581502ECD0EF772AFF07A63EDAC5DB2C r3$p3ct4b!l!ty
661,124,984 *442608A5D38F409197D7DC4FA677D124256A9775 b!0l09!c
661,124,985 *4420E30C45BD9D29C0C85F6D8A6013924A5CAC51 B8UOR
661,124,986 *442A754F8D5A81F594F7B1402EA2C69856255B07 RANGESTANOVOY
661,124,987 *4421B1B715403299CF5BB5ADFC0E03ED685413BA ranié
661,124,988 *442A313A316580272B55445C14ABEE1C1831E533 „RÄTISCHEN
661,124,989 *442765553766B5965C556F165AD776F4FDABD6F2 RAT!ONA1!$T
661,124,990 *44217F21F14D287B68EAA067A20EFCFE6C0C20A6 b9mqn
661,124,991 *442AEAA652B7AA2827CBD37AB663D5244D7AA6BF RCVDIS1
661,124,992 *442B888BCDF2A1E4635C9D09AA241D68AAD50690 bakvz
661,124,993 *44266C39157442273856B6E73E4E8AED71002E1E rebosnon6
661,124,994 *442A37D01E47A3E52527A656E1966621FD28AA49 BASFM
661,124,995 *442023E87F696564CD7015ACBAF338217329BC92 BASIL.TRUCHON
661,124,996 *442F534759E9A19B471C2F39EEB50F03448C9EE5 BATOR:DILBERT
661,124,997 *442C2DF7DB72FA039C69DD3A7A10530A3053F83C Reimorto,reiposto.
661,124,998 *442E376132B547A209B275DB520D935182C28B8A bauy,
661,124,999 *442C11E2A80C16F61259079319AC3593349776A3 BDSM4
661,125,000 *4425B5A342DC832A9E16B9A0C104FC4B06655F33 reyeswarfel
661,125,001 *44200D26C779364A2FFF5BF2E88A2E7ECD6D644B B_E,N
661,125,002 *442493FD244B4985DD1A5F6524DB575E1F2D79A4 Best-of-Kay-Kyser-&-His-Orchestra-(disc-2)
661,125,003 *442F1BA40E85664E8F30ED9764313E0D78137E96 beyond-science-fiction
661,125,004 *442E4DE58840DB4D9B0E0D4CA178BE6BBB4D14C4 bhcg
661,125,005 *44220626E4D94D4B187F76E9AE88EBE4BBCCEA91 BIJSCHONK6
661,125,006 *4427176A142B2CE3635EBD414CDA79AF5B4A7733 roofziek5
661,125,007 *44249E8BB29BEDF6DD85CCB2C2208FD0DE3E1372 BNNTAYJR
661,125,008 *442BF9C7DE9C1200C30A0D4561E37ED36E1099D4 BOENNER123
661,125,009 *44275F949178C199057FE7DC3F7C1FBB5244122D BOOTLEGIN
661,125,010 *4424E9D41782E431A07B22EB3FC51B36CA3AF63F bourrouilh-le
661,125,011 *44216BEABD2BDB8B205659426EF55522D71B5C59 BRAD-MAHLER
661,125,012 *4428A1DA72EA06F93996C387CBD3C2BFB93FF160 bragi
661,125,013 *442C151ECF801F330646294242A060E6523021B8 RUSTYMEMORY2
661,125,014 *442F4765D4513E8D0771CDF648F9DF1D39F663F6 ryan.danley
661,125,015 *442CDAAF53AAA492035DFE8433E9F4D79D7BD5E9 sanimishra
661,125,016 *4426674835B08841E117C2D908822939E9BA5832 sarahoflaherty
661,125,017 *442B53C7FE18402720AC90BBD3D863DE4F80C0AB SASQBSW0
661,125,018 *442A6FF6AC1D206A7F28A57DFA94434D4674C374 scalerebbe3
661,125,019 *44285BC88AFAD4BBFD209A9C2025A09097EAA847 [scene-45]
661,125,020 *442C502A3CB9FAF10DADC18413CBB75A815013FC SCHOOLTALKAPEX
661,125,021 *4428D3AA02FBE7572EA2DBDD6EE103781EB873E5 SCIENCES)選為
661,125,022 *442AE5C44615BDE189A30BF2E8E2ABDA781DC01E SCOTTHUI
661,125,023 *4420692937B182735E4E7D18E07C2F5D8B30B5C8 SDGAMESAYER
661,125,024 *44298F4045479C5C2FA6C03807CA1A2FBCB49B1C BUKOL
661,125,025 *442B174F35D16D1CBBF3B493690150D574CD32C0 BUSUIOC9
661,125,026 *4422B592443D56A3AABF93408434350A5A890F4B BUTTHEADMICKEY
661,125,027 *442697A03EFB82D14AA39DBF21E6A2309A59D52A sexy_lexy320
661,125,028 *442088F59A3E1F019406E041E60CED0432E7119A sh6b
661,125,029 *442437D576BA9DA5957628C96BB057B123A9B210 SHADEFUL9
661,125,030 *4428088B58EB67810216B818FAB3D4A51CD0F8E0 [email protected]
661,125,031 *44257F4A84F338FE02AA762D43B83E84AF81974F B(ZYK
661,125,032 *44262AC740CF500F86A9E26EFB5381487533B5B5 c120895
661,125,033 *442871844B0922E4B8D1F70ED73B2A50E26C1584 [email protected]+0ns
661,125,034 *442179EADA35EB0A87344A587215483672292685 C6A16
661,125,035 *4427D7E3778EEA1C2DEFBCD4C0FFF970B5C21716 CAGN"
661,125,036 *442D5A49B909BC4305919A0F350DF8FBB1F99EBE calquerent7
661,125,037 *4422D76A0FFDD040DDD5852A1F1118936BF6817E SKOTWMA0
661,125,038 *442D7FE91963A1DE99957742F678A1BD5D56D38D slathers
661,125,039 *442729201571F901FA1844ACB8C31272B2BE937A snoopdogfuckyou
661,125,040 *4420D657FC8C2219C0EBE1FC084B28C77CC77717 ČAPLOVIČ
661,125,041 *442C5FDFF8B47DDE9513E458BDA2ACA036A81069 carltonlebeaux
661,125,042 *442EAB4A78A3B0B5678733958E210EEBC542510A CARMELO.DRESCHER
661,125,043 *44259BAAD10ECAF0576DF661E61CF242BDD7FD12 SonateNo11Bdur,Op223
661,125,044 *442F38043932081EC49F518BC22658879CC92DEC CARSON.SNOW
661,125,045 *4429765D44B44F18C0EF20DB71E3E374CF15207B CARTILAGINEAN1
661,125,046 *442F9E12F7FFF765BAD2E172A6FDD7FC4B2195A7 CASCARES4
661,125,047 *442E2364044675AFF6D92FA4BF3462686CD58C7E SOUTENEZED
661,125,048 *442D2E5544CAA1F9FCB10691F0184BBC7480D0D8 SOXDODGER
661,125,049 *442AE3B6A992EB83532D6067F58233BDEB4FF65F CB5OB
661,125,050 *44280013675D47BF310EA8DEA6E588EAF3F8C053 CECE GUTIERREZ
661,125,051 *442AEB0F54FC78A9876A009C61410BCE3D3CFE92 CEDRIC.NAKONECHNY
661,125,052 *4422E54F3A7B8A5BA1ED56123ED1E09DB3116FD9 cedricwarnberg
661,125,053 *44214E2980785796F5C69DB160A234B8AC4663BE cenobes5
661,125,054 *44209F4914A8C15183E50050AB5BE5F3EAE4A0F3 cererikaed
661,125,055 *44250EF0F680EF6DEF22D442ABA65068E174F393 CESAR ACUNA
661,125,056 *442BE1548DABC9FB9499A6B70A345048D6BDA35D cfd7ee
661,125,057 *442CED8EEF307E5D640D1433A7DC352EA2611BE3 CFY8B
661,125,058 *442F065D71DF98A18ACD7D6F4E6BB04CB8693CF6 státovědecká
661,125,059 *44224DF48D72D1DE15409D7E82C6735F3FEEE3D2 CHAMOISITE6
661,125,060 *442184FD9B036F50F15318B975D93305E31118FB [email protected]
661,125,061 *4423D6FF65701D0A8A2ADB6096141E4DDFFC1CC5 CHARITY’
661,125,062 *442C57B9027BF96375FE556E292AB2EAB09D624A STNDRDRTKLN2
661,125,063 *442E158F508AD04E675E147E76C21B42576CA851 strength177
661,125,064 *44215AF2088E9073B658EDDDBB3D8FFEBF077DAD [email protected]
661,125,065 *442D37ED4D375701893EC0259BA39B00B34CEB66 STUARTKROLCZYK
661,125,066 *442DC3D8524221873BA267C2A7F5DF662AB54D0F subnucleuses9
661,125,067 *44248761B22AC799C210BD1A64289D1C4F26D877 SUCCESSWORKWOWYERKZAPPING
661,125,068 *442F838EDEDC9344FC9EBAEE8E0F200BFAFB1888 CHI.REDENZ
661,125,069 *4422CDCB1BE8A0A83D6C7CFDDA876AA4EA68714D [email protected]
661,125,070 *442AF8F07D9203015467527CEE2F40F5FAAE7F30 CHJRTTJ2
661,125,071 *442EE959BF2012DDED16DB1B8B9A3CA5FDA4D95A CHQG&
661,125,072 *4423A3C71CBFFA7AB4A0EAADD481541C3E5E61C3 Chun-Li's.Story
661,125,073 *442FCC965D17B00028444493D67CBC021C0A1480 [email protected]
661,125,074 *44273603668652A1FECB51A8A90EC99775EEEC66 cilqq
661,125,075 *44259061450A02E365F8BF763FBFD8B7C6D10605 CJ8;Y
661,125,076 *4420FB36AE74B25A5B1489259EADCDC95218F86E ckey;
661,125,077 *44234CF9119515AAD995D95244BF5B3ADC1BAAF1 systematisch!
661,125,078 *4429459E53E3E2AFEDEED9E10A89F92F5E9BD298 c#lf_
661,125,079 *442530A95745DB22BA9873563860CBF648CF344C TADASHISING
661,125,080 *442AFA7F544E18CB6DF29A86A27150D6C928A92B TAJIK.16
661,125,081 *44222B6A01936FFFABD76C3850EA08CA85612996 CLKM/
661,125,082 *44244A866F6FFD1FBFD1DA1DD5F5155E11900828 CLWP"
661,125,083 *442DDAE6923E0494CEB2178111A6C119B267AD93 tannerbeaugard
661,125,084 *442DEDA7CEEB52DA25EA6923C790DB8E8FC1F8DA CNHBD
661,125,085 *4426B3DCF0E7ED9AD020C366733EB32F21CE262B cnpud
661,125,086 *4424713FC9CEC8723E234068DE225EB9F9F4F12E TEATROCLASICOGRIEGO
661,125,087 *44264FDC2C01525686DEC9BB9C16E93118DA4912 colddesertofeternity
661,125,088 *442AA497526B93327AD0C291ECEBA2E23BDA7923 COMMELAISE
661,125,089 *442110CEEA9FDC49BE135FDB5345D1A830CC5C30 TERRY JESMER
661,125,090 *442DC7311A5104BBADEB7B5DF8D060FC62277161 contagiri0
661,125,091 *4423295284618C6860114A5AEB17F422DFF2549F THAT FROM THEIR OWN MISDEEDS ASKANCE THEIR EYES
661,125,092 *4421CDC798AFBE337C934497B0B43DB9CBDFB7CE thatunity2008
661,125,093 *442D18604B19FAC339259C91685B10CC33D03155 CORTEZ.BARROIS
661,125,094 *44292224745B5EDC35852BA7A249FB32F403A3EC THE.CABRIANS
661,125,095 *4421DA6D67F6E9216D038E9F725262E2FB37C002 CQJA:
661,125,096 *442CCA4C65B6BEF09DE285D5317CF0BFD9F0ABE1 CREPU4
661,125,097 *442D81DF0A76B7CC31FB9CEDDFEED1B9707C9620 crodk
661,125,098 *44293BFE3A8028D228D4CD4F8569D3A7517B79AA TJEKLISTERS6
661,125,099 *442AFEC8810808D28D98DE2AA4FEC3F87A7548F7 T]N;
661,125,100 *442A4FE72518D3B51FFC455DDB25AF7F86BD31BE CUIDK
661,125,101 *4422A382DAF34D87195E7885E3DB2C3028C4BB1A cv,l
661,125,102 *44216605FB095DA9FAFDB77E4EC53121534B5162 CW%;C
661,125,103 *442A87B6E4884B0D54C51C94226011D3DE1A6D0B c_y-0
661,125,104 *44292BD9CB1E599D457AA4A45B2653561D34B4B5 cynthia.mcvey
661,125,105 *442781036F47132674165943200076EF42483793 trctpg7
661,125,106 *44222653F8869A0672893875B14FA488E502A577 D1w
661,125,107 *442C06F9CCBC49F51B964EFD7B0FD5B51C378887 TRIXIESECURITIED
661,125,108 *44251C55CFF7102C6DA5BDE8D8D9A3A8BC054933 D74
661,125,109 *4424020DDA97487AD70D0A806AE4A5844C78FDB7 TSIXEERP5
661,125,110 *442D4A1D67DC743625C2F1F915D7B548AE84B63E [email protected]
661,125,111 *44254336DB439346740B3DAE30D136553BB7577E DALECHAREST
661,125,112 *442BB9B5971113D9B7D515F1CCD7A2B08109367F DALE.PERE
661,125,113 *442206DFC19BC8F7CFD59AD88909BF72060151C5 DALE WARRICK
661,125,114 *44295ED35606432523B548A40134AC120BA19D54 DALTONDUPATY
661,125,115 *4422C709A27C0527A397836BC5A1B333F7E49D3A TWARIQKIRIGHA
661,125,116 *44269C264EFAE15459DF01AA0E9D64DEBD398D3F TYKANDLER
661,125,117 *442D5ECC4937D69E25F69F40EAE2BEE461DC033F DANSSPORT
661,125,118 *442E5DCFBEC370125007DD9EEEADD90DF8987060 tzigane,.rhapsodie.de.concert.for.violin.&.piano.(or.orchestra)
661,125,119 *44209BE96AE46E86A45022D0BBC647633C2C0471 DARRENLAMONTAGNA
661,125,120 *442F616351D45F6FB1949B5D00EE7E73C8F222A1 UFUOMA GRILLO KRUSU
661,125,121 *44297F30CFA8202D8C6B316F0527D570287FE84A DAVID-SASRAKU
661,125,122 *4425221B0AB77AFC0B1F0EE9E9EA6FF3BFD7A4DD UMBILICALL
661,125,123 *4420A78FE8BA90652E28F22594E7C3F0EE41CE26 urlhttpwwwjtfgtmos
661,125,124 *4424CD401337CDB9D11B8D994DF202EBE6CE97F5 DEBKELLEY
661,125,125 *442FB75BB8945506E0011F4401980BE11775C72C DECRETARY6
661,125,126 *4420134B9CF22BFEC6DCECDE1233C0B3494A696F DEE-MILLZ
661,125,127 *44273F574BB64E8D367827E5083E0D3B984ABD53 d!efn
661,125,128 *442EBDCCB6D29C6D5BEE27B3A6ED27184D231494 DEIBBURG
661,125,129 *442538E8F744658C0223445ACDB7757FA870FAA0 [email protected]
661,125,130 *44291D7F7A55ECB9F78833777946CC65993C3853 ÚTULŇA
661,125,131 *4425F07E46E7FE4153879565C1F5020BB6A9B096 [email protected]
661,125,132 *442E4EC589DCE9EC3F48AF4A6B3FE044A1787DD6 DEMOSORG
661,125,133 *442D192CB23F8ACA2ED1F46A1031CBAB14242297 DENNZ
661,125,134 *4424404DFE5C34BE2BBF798931FBD00474CC755B DESETERCU6
661,125,135 *442BE7448C43B0E7BCCBC81950A041E10BB7CB49 d:f0k
661,125,136 *4425FC3F9E4FF1F1FD85C9E40BA9465AE1AF1B50 [email protected]
661,125,137 *4424A01451180C8F76168A42623BE380C4FD5E64 VARKENTJESES9
661,125,138 *4423DC5AA1EC06BC6B7C61D0B9CE304578BFFDEB VASZBSW0
661,125,139 *442B892B5CB426F22BD85F0F3FA5C2326B509779 VAUGHNEMILIANO
661,125,140 *4421088197D807F48C3F9801CC0B973ABBF60992 VAZIRANI8
661,125,141 *442859D85B8556A25FB10EDEFA456A9271C364A2 VCL08FTRAIL
661,125,142 *4429E627F5123602DF8873B8D08D0A1F4A4A0B9E VELOPIST
661,125,143 *4423868330E92D66B9AE3B32492FC4459B31892F VENTRICULOPUNCTURE1
661,125,144 *442A54659A7B746232CBF07B6CE2656D78DBA4B9 DIG5%
661,125,145 *442A90E0EEE17552F0562C042AEDA5C16EC52CCD d’influences
661,125,146 *442E18E9719A50AB82E55E9DA31E6E107F8681EE DISTRICTRED
661,125,147 *442011987A401A9C18E9CE28857853C6F9BF6FE7 VICKI MANSUETO
661,125,148 *4423AD2652CF2500DF813DF4AEBB2054EE84F6C3 DK4D!
661,125,149 *442F275F520D658B6B4555CE3850872D9D4D010D DL+EQ
661,125,150 *442C3BE649F0110892EA93B9959BE3DDCBB2757F dlrow
661,125,151 *4427288598A8999198642B82365975FFD29D171E VIOOLBOUED
661,125,152 *442F139575451ACBDA01533871B6FE783DDE6C3D VIRGILIOHAUBEN
661,125,153 *44213938EF95A6D9DA4C0A19562810934A059FD5 DOKOF
661,125,154 *4428BEB8EFD92F6DC4B68574785984C7E9FD835A DONNIEBITZER
661,125,155 *442D21FFC629121F7A50210CB19C4D2BF847CBA4 VOJAHU
661,125,156 *442C83B0A5817B8BDA7848D3AA02BD2B3A51D686 VOSPRIJATIJAS
661,125,157 *4422BC389FF830EEEBD2F995FC17F140D8BF01E1 dorseypotra
661,125,158 *4423D456333DED1BAF8D3EA8A16B4219167D85C0 DORT%
661,125,159 *442163DABCFC9C9BBDF424A93DB39859261D4562 [email protected]+ON$
661,125,160 *4426EAF874329F86B5A2083E4912CBA25FA5A991 DRAGERING
661,125,161 *4425C869E36576AD71088D443D81D29E6C1744EC WALTONTRIPLETTE
661,125,162 *442B153D403663773362004A1DC546DFC14ECB33 WAMIDZA.ASFARINA
661,125,163 *4428F3C78414F3EF37592D3C2DE77A556590EFF2 DSR277D
661,125,164 *44262E009FFF1DF625D7DD6B7D282D9BF2AF0A05 DT41
661,125,165 *4428F15969FDF1B0B5183F8E6F0749ABAFB5725D [email protected]
661,125,166 *4424D5C79A600627B32237B3204BA1D84C9F80F7 DUM,V
661,125,167 *442144B577F38A512D725BF2928AC6E063F8C58A [email protected]
661,125,168 *44215AB703F13A04860F695009B75EF8313B7FED DV4J
661,125,169 *44282A390EE3278A962C0F463D71F42B831B0754 WES.POSEN
661,125,170 *4427E550B2C0580FCF908D6C20E15CBC1C40E572 dw2v7
661,125,171 *44259A746583963A55BE12625F47F1A00063A6CD WILEY.DEMILLE
661,125,172 *4428D15FA423129A19E62944542766C8E5FCAB86 wilfred-pear
661,125,173 *442B915F4800C3A8821FAE7D3842F505BFFC5CB2 WILLARDSINEGAL
661,125,174 *4426D9CC79559C810AB07E5D60E12AEACC92B10B DYKO;
661,125,175 *44299697F694CDC39896CAA25C80968384A387F2 DY&PH
661,125,176 *4420A7C35AE1A7527B96CDE5F973B18A132888C5 ea1ut
661,125,177 *4423D5CA4ACF10825691615D7B9557084BD28DE7 EDAAVNGER7
661,125,178 *442036197362681BD122E11B419DBC1A27D1B38F WMU;
661,125,179 *44239820CB9DF9C7A1B8E35846D26B9CF1FE036F EDUUMRAVED
661,125,180 *4422253BC8EC8C8F3098DF75E4EE4793DE747C95 EE#A_
661,125,181 *442A14758DCB45F736D7EB3E6DCCB3016D0595B4 WWWHOWTHECOOKIECRUMBLESCOM
661,125,182 *442F4FD31B8B1E0D18227C0C7CAC1DC90BE6A0CE WWWOSPREYRIBSCOM
661,125,183 *442DD9D80C34967CC411F8AF1C386FAFD653BFFA egkl_
661,125,184 *44208B1967A538FC3A24A58BC5478315312F4D55 ELDONVIVIANO
661,125,185 *442F17EB0EF1CD59DB0383C0EE5E051C402B1BE2 [email protected]
661,125,186 *442C3B2E03130E2C23394E4061C1E0DD63A9E589 ELKEEKLE1
661,125,187 *4423167C9589076758D902513372C7D0CA9A0BE2 [email protected]
661,125,188 *44287A6BDBF8459A0748F2F05D540D5E28B71110 ELVISCOUSINS
661,125,189 *4423E9D20940C439AC4F5EB3DB5B1819327C143C elwph
661,125,190 *4429B936410BDE5C32A3499A8F4A4ED875F9DFB3 embraceable-you-(feat-miles-davis)
661,125,191 *4426F1C652E7562ABE58CF9A6DA7413DCEA8FFB3 EMILIO.OREWILER
661,125,192 *44200E5B94A89A2D472C0E4B9B7E3E0535F371FE emiliouzun
661,125,193 *4429DDD45F4EED27C956F7812653BF246BDDFFD5 EMILYJUNEBUG
661,125,194 *442132A33B9B454F2E73EF43B319BEBC91E5A48F [email protected]
661,125,195 *442C9DCE700FAD2AA7A3D044402875BC115313B8 [email protected]
661,125,196 *4427F515ECC6D8DA2DB00E58C5FC9BA3DC0689C1 enuff.said
661,125,197 *442F9BD1B8F608D645AE326F6132149D3D2E1CF7 EONTAININGCCIGGFCFEDLGGII
661,125,198 *4425337025C9D7BA5A90DA68C0EE3DE0B5EB34B1 [email protected]
661,125,199 *442894EFBE11E1869BA223C0E6100E159BBBCED3 YKHANYA
661,125,200 *442A8E1AB30965DDDC56AD5D60D34AEF7862BA34 YOGITAAGARWALBAJORIA
661,125,201 *4425AAE4D8988B117AB0CC3C39A115B542E1D53C YONALEONARDO
661,125,202 *44293BB0156A984BE64828E1B90B617569D42E8F ERICHSCHLARBAUM
661,125,203 *442F812A7AB2EEC230D1C8363CD24B7021FD6876 errolsantos
661,125,204 *442C1C0ED9CB990745763B7E1B45CD813A070D67 YUNISEL
661,125,205 *4422A3BCA6AA05DF96B326486FCB1E12FEB6EFEA YURI-GUAN
661,125,206 *4420BB3D6F8190187496D6543817491DD0AD2119 etalleppanon
661,125,207 *4423066816C291C9337C6F1F9B750C52CAEA1DB0 everetteheinze
661,125,208 *44224E7FFA5643936357D6D1F770CB89F967F063 EXCAVATO3
661,125,209 *442D6810ACDB740A2BCFB74581C253C9C0DEF495 F"'
661,125,210 *442CD569A2C871EA5DFE61EA8B6039A528F1FC32 ZAHERYAGHI
661,125,211 *442DA6E8026496DCB03C8C8B6088AA5331BA4A4B zaneta-tipps-blalock
661,125,212 *44212833DB6C898B0FEB354F5A562598A97365E7 ZANOLINI.NURSERY
661,125,213 *442C932670634529FF7BBA487C153D4AB11DDF15 ZECCHINETTA2
661,125,214 *4421C68B5EC28F66C0808FD5EFB86F9424E61A6F zêmar
661,125,215 *442664F8E1A5C9E25A4D7A1AD002078B5122F3BE [email protected]
661,125,216 *442242CFA00BF6C4A632035CC30F2BB16AB42DBB [email protected]
661,125,217 *442F777476ED19A2495CE8017E795DC44D6EF63C [email protected]
661,125,218 *4420D5E70A0E457F6EF5F39D2A35A4F046C4CB9F FDCMMSSRS9
661,125,219 *4424C465CD3F78B040F99E9ECAD95786424B2BCB [email protected]
661,125,220 *44211703DC51A022F74CFFDE1F7AA41ABB6DFB27 federicokellenberger
661,125,221 *442CF6EFF49FE825C19C3522FA048C8F7C45701E ZICPKPBJFULS8
661,125,222 *44232F24EE2F45F0E0D49AA2E9415D5DD4CBD1BA felesi-vaki
661,125,223 *4420D8E78667ADD6705F9A0C803007C3C5B05896 [email protected]
661,125,224 *44214EDAAB0F427C13827C7905A82A3B6D9F674D FENGWEN5
661,125,225 *442821F84FC9ED61716D8161EDC4F62F99B78D9B FERVENCE$
661,125,226 *4422FE7D287C50B6777B5C2719684BB25E0A2733 filmscrolleinrichtungen
661,125,227 *44216DE1BBF129BF6862D1A2BF1B8BDB72DB1DF8 [email protected]
661,125,228 *442C602A6C76896FA36D66644FC5C006C0B7A7F0 Ο20Α
661,125,229 *442B78BBABE19D2A9359DB265F4C76387D366F93 forestcorrado
661,125,230 *442D937A0580FB1A1A9ECABC234B9F80D8CC9ADC FREDMCCOMBER
661,125,231 *442580CE1CF45CA44F7BD233F7D076D8FEFAA381 ДАГЕСТАНІ
661,125,232 *442204451B8ADBBC2A5190F1769D88C6A6BF5474 FRONDÍVORO
661,125,233 *44284BAE81F5DDDE0FC8CD39380FA023A575268B FU|C
661,125,234 *4421255123E569F31835B98AE4F60B2B7DC6896C G214502229
661,125,235 *4422411B9E3BE8C950E72996E502D8771D2F388D G9``
661,125,236 *442C98F8DB6312BA1B8AB3CD76B134FF456DEF99 [email protected]
661,125,237 *442BB394A3E03E871757299EE5736FB296621876 [email protected]
661,125,238 *4425D706B3BE18FA6E125883F7E2230CF30A6B81 GARLANDSULIN
661,125,239 *442D0AC4BC0762948CF6112C5FBC1AC60397C946 GARYSCHOW
661,125,240 *4426D959531A4AA5FE6DDF72ED4650881AAF5F63 gnutieln0
661,125,241 *442065F3284FD47546A36A4EAE2059FBC320C384 GODMADETHENATURALNUMBERS,ALLTHERESTISTHEWORKOFMAN.
661,125,242 *44234B6B3EE123C57F6B47E041E63C52730E9950 [email protected]
661,125,243 *442256FCFA33FE63E2C760D6DD53C5E67E2BDA6E goshinji
661,125,244 *442E4AC761FE328F9662A490F9D5FEF50A2E0F56 grococh
661,125,245 *44200EC73D562E60CFDF3B3EA539F1BDD1BC2744 gudskeloving
661,125,246 *442D99D5E22209D71016511D205A198EC90F418A GWHOEVER
661,125,247 *442455E4846D639B0A2A0065A782B50349E579CD GWIGUNO
661,125,248 *442FA4F42344E84705D0B49EE11B86E52169F3FE gzcn
661,125,249 *442B0A613881C7078F98F977F33155165176C427 H4RVES+N9
661,125,250 *44264AFF00672844417A1CC2F0BA49995783B1F1 で表記すると、l
661,125,251 *4424B3309BCAD7329177186F57E56B64B4262A0D HARITHEERTHAMS
661,125,252 *442717686F1161A2EDDB0B1C6E72B9ADD99FD62D harle hh aa1 r ah0 l
661,125,253 *4420DDA17DB8C3A31D1FB45747D6A037DD8DFE2C harrisonballog
661,125,254 *44224F33CD4D621899D42797F41C3B31058F9E2D HARRY.MCNEELEY
661,125,255 *44237177A83E8E79F3B59543EAD4C5A424EF7CC4 HATCHETCANCELCANCELINGCANCELLATIONCASH
661,125,256 *4423E83BD251AB937E02252C9DF90BB0F7AEDB53 HATTONWHATEVER
661,125,257 *4420535D306DC7EA6DC0EBBB5EF2A7B7FDD90B8E HENDRO HENZ
661,125,258 *442E6CD22EA53B24D45510D8F564105209191E35 HERSHELHUGE
661,125,259 *442C007CAA3D335BFF49B334CA3CE7F605FAC915 hiramtagliavia
661,125,260 *4423F83E683742B9CEC1EAFF294AF03113C8D1B5 hitiihsing
661,125,261 *442126A4764F1876149877D02B59FEB0749F6858 HORSEPUCKYBSW
661,125,262 *442DF4A7F8B0DEFA1883898121EDA1D87BEBB42A [email protected]
661,125,263 *4429706C532C4FF3ED212C38AA241F667D7F82B8 1052844 SUKUPOLVENVAIHDOSTILANTEET.OVAT.PERIAATTEESSA.T
661,125,264 *4420666194FC132DEA31335327FB4B2FC6A82970 109.HaLL
661,125,265 *44226C9CFC2A4E003C5B7686CF840901B3D04A7B 1139900 mighty-kemp-sai-500-metrin-juoksun-j
661,125,266 *442CFAD080597BFFCDBD46D89176929861FAF024 12011026
661,125,267 *442DDB81A2F19F49828824B3415F7F9E05CC5A27 HVGQAA
661,125,268 *442E370957A957377B0A318765453D997F343F34 132JOSEPH
661,125,269 *44211DB0606B2C3BD547F2A965439A14168A21AC 180isaias
661,125,270 *442DCF9E28BB36993EAB3D5087B39C7BB7217E5F 18.THIRDBOTTOM
661,125,271 *44234A5F5E4196B74786611BEC03F1151DC1A56D 1961050 TURKISTARHAAJILLE.ANNETTIIN.VUOSINA.1990-91.YHTEENS
661,125,272 *4429FB3D6FAC27896409868B7780F5453AB6A364 19852004p
661,125,273 *442EAFA57F8EE7ACCBD72A652D2B4ACF9F342A59 1 arabasligi
661,125,274 *442C8B0AFF5DADB18783957CDAE1C81655D82DF8 IDLER'S DREAM
661,125,275 *442297348698DC124A3BCC74C1876080473284F4 I`JU
661,125,276 *442BEE758E7D61275A6D0C6BFB0B2F335830097F ilanza-brand
661,125,277 *4427BF69FF1EE84D131007F861C9CE3C2DB045BF ILKERIM4
661,125,278 *442CCE8DC719E789CFB18E8ACABB5E89D17F509F 1.FREISINNIG-LIBERALE
661,125,279 *4426A81AE350FD2C1FB805C863A086908C48AD4B 1 friikeist
661,125,280 *442FB6E6A92698B56D15BC5BD6659F42E87D3836 1FURLOUGHS
661,125,281 *44267BF64718F930C7FD0968D99A37B366127D62 1.juhlaruokiinkin
661,125,282 *442C5C57D03D29FC2F73351341257951590D0621 1.KATLANTILARINDAN
661,125,283 *44252DC4E7AB33303EF00500C1EBDD7A2806B19E 1LLEWMORG
661,125,284 *44258DF0040F263FEC720404592C1A57E08B0A77 1MP3R$0NAL1TY
661,125,285 *44254A9679EF5135BFD62E979989EE59F62D6F04 IMAGEFOXXI
661,125,286 *442B48301C0DED6DFD46F4F72F2F720D81D4DFBC [email protected]
661,125,287 *442FA9659DD1501062859D2CCC822CD4CB631FB5 1-nickelproduktion
661,125,288 *44263C731A8FAC39D227E93F48C791AF83E5A232 1 NPFLVORSTAND
661,125,289 *442E8CFDB74024E0F82611396FD44179603FB54D Imperfei
661,125,290 *442A4B4B2E70B5F4D034DE923F39250575F907CE 1PARAPLAGIOLOPHUS
661,125,291 *44261EF2E28783A40B679E4D5ABBFAF5E728FD13 1.PHYSIKTEST
661,125,292 *442B26601F11784E901725836A60AE087693338B inforsa0
661,125,293 *44283D22AF17C459C453BE4F5934FB89708303CD 1RORIENTS
661,125,294 *442E62F61816AA3672482D0FB1D6380377A2845C 1SCHLIESSSEN
661,125,295 *442F3DA7365115AF8DA2B7C27BC53521DA2C9E2F Invention is an art form
661,125,296 *442D54A02FEEBBAF4AACC516CFE549A22C4B2509 1-SUUSTASUUHUN
661,125,297 *442EE781C9DC9F182E87C508C811083BA44967B3 Inweight
661,125,298 *44212494B81509167433D77114FA7981AD737199 ISAIAH.BUCZKOWSKI
661,125,299 *442CDC4EFC551D09399A9AA3FDCD9F28503253C4 ISATOUL8
661,125,300 *442082E5033538CC03638BE95E255941B942779D itnewageindian
661,125,301 *44254D9FC9980023C7536E93DAD6CC93A41BE565 It's.Not.True.Rufus,.Don't.Listen.to.the.Hat
661,125,302 *4425CFC29573A5B7FF6BA43B9DC5E8546D93A122 2010761 T&JHOLMBACKABOYSUORITTAAPYLV
661,125,303 *442273BABA72CA2E38F091DB6EC09132C9967F92 205MARIE
661,125,304 *442C1F90395090ACA7A30CE33D640CAEE52872B0 2094549 VOITTOMAALIN.J
661,125,305 *4427364C97AF96A8290A48A51A6D4D3B283AA59A ivwi
661,125,306 *442D250426E620089DCC5ACA4221668119AE945A JACKIE.LINTZ
661,125,307 *442DC758E75A378FB377A0498A6E369763A0E751 2221237 OHEISESSAKUVASSAONESITETTYLIITTIMENNAPAJ
661,125,308 *442C836FB1C927F4E6755A8C301CEF262CE9C568 2245734 BILD.MEINT.:.INTER-NETT.
661,125,309 *442516280C97FAD60CCC617BF476D171F8FE63C2 2260277 kuivaainepitoisuudenmerkityst
661,125,310 *442655E7F18D14CFABBE2F6E47EC2C9A88FFA306 JACOBKUBES
661,125,311 *4425E870E607837789D6A0F0C4DF7DB580CCEE7C jacolby.stewart
661,125,312 *442710C466436FAAD89754E2BCDD1F3355BF20EF JacoMorocco
661,125,313 *44222A7B3740052E613D936148A7CD593487B135 2464134 ILMASTON-L
661,125,314 *442C6C1679704E52088C47FED572A0D58CBE4EA2 24SEP1507
661,125,315 *442B762AD96E34A9C9B8D793B8D0775C3C3DA5DF 2595362 sie-wisse-nicht-mehr-,-wonach-sie-sich-richten-koenne-.
661,125,316 *4426F29730076F2048288A97421366CC13DF98DC JAQUELINE735
661,125,317 *442FE9789948A20DABFFAFEE79C9F5B37708D408 JARVISARGETSINGER
661,125,318 *442FDFFF72B0847FF1EA78EBF640B764F5DBB8FD jasminecrowe
661,125,319 *44227F28535CF59A9AF04AA2E901E69B506585A5 JAYCURL-CRESTED
661,125,320 *44272F051256460E70CDD4C10BB8760A485C9482 2796507 MUENCHEN-/-NEW-YORK-,-31--AUGUST-
661,125,321 *442E9E764A97CD2E30909606C9F7CD9C8B96D461 jeanborgstrom
661,125,322 *442098CC0B11F7768835FDEAA6AB72416D1127B9 2971808 allhecandoisagriculturalwork
661,125,323 *44277F8C72D0C08C0B0F08C985C5C2C358BBEEB0 2charly's
661,125,324 *4421D95CDF67C9DE93A81313D79D2557B0B588B5 2COCIRCULARITY
661,125,325 *4425996FAE679B7A6C73F8BE738FE177CA47A28D 2EASIOITA
661,125,326 *442E4F4E1E8F7FD7A9D793A157EC1C18781AFD7C 2fstories2008
661,125,327 *442D03FB348D91ACA74FDB32F41286B03B11331A jessica-rae-rosser
661,125,328 *4425BED64EA5C82FF1CE913B8BF5668910D2CF89 jesuscacciatore
661,125,329 *4420E9CB3F9CE5006836227838E465CB3EB55C7A JESUSMENJARES
661,125,330 *4428F197AFC1129938CB046FECE1272CC02DE2E0 JEWELSHUBERT
661,125,331 *4424788AA743E07D1FE5716887046A43553BCF14 JJUIUSSEN
661,125,332 *442AA28B2595327C2F619DFD4AB44468ACC1F1AD 2KRAFTWERKSPROJEKT
661,125,333 *442D484688ED390636554B282A650D33EB365DE9 2.kurszuwaechse
661,125,334 *442A7083352DCCAC5424F983C181183E6F1A2D62 2LATTERS
661,125,335 *442EABC660E71516C0410F86C9E54AF9C3EB0686 2 MURHATULLA
661,125,336 *44281AEDF25771685CE89C2289E9F20087CD6D04 JOCELYN.DAYO
661,125,337 *4424D5DAE24F8B0E817E5135700C43551E95DEE8 2NERBATA
661,125,338 *44231F6406672E4D061B003F3BD54372670D3737 2NIEJASNA
661,125,339 *442FF47970A5DEF902BB35F111D98E84C64B1E26 JOELEVARISTO
661,125,340 *442BE8DAF37CB9D09A729874C8CF87F6A2661BFB 2theanimal5
661,125,341 *4424CC779FD246C058F5EE0F0D8BB96FE81DABF1 3012 SORUNLAR 44
661,125,342 *442B6387BD78F1B509E612A31A7E36C7B0086BE5 jordan23raistlin
661,125,343 *442FDB7D22BF0143E68DB950F1182D7EF188BCCE 321529 vaikutus.perustuu.siihen.,.ett
661,125,344 *4424CE2D3377F1927B0A6EF54B87A727A3DC16B4 joseself
661,125,345 *442CAE4714F92739819FC9A5851E9F82AD2DCAE2 39BDCEBB515FEA1EDDC8FD011C4F98DA XANDU
661,125,346 *442ECA8A4ACFCB2A5E687ACE6077AD0BDDC2E735 3b<- 0~ d######q
661,125,347 *442A2444DB4E17AAB53DC338F8D21C92A885D462 JUAN.FAHNER
661,125,348 *442867AFA9C81E92DE251DEB207982E0BFA1F847 JUGULER?
661,125,349 *44248BED7BF66BA2F0B460BC23567D98FA145364 [email protected]
661,125,350 *4422B219E9E5AEF3081E57EE154474445C286A19 J+VO
661,125,351 *442EABD4017F6D3F2A2FD37C40A20AB97C3F7B61 3Dデータコレクション」発売。
661,125,352 *44215A0442C5593CCB533E6798588571B9D6C15E kaeleegrace
661,125,353 *44286861D614A9573F0408127ED2383B3D7B34AE 3OSSIFY
661,125,354 *4428361269EA6441EB0BB8A60F7DFBB18C3942A5 3####p*splat!
661,125,355 *442296204A1A135C53AFDB3A2D86929B0DE8D626 3#####@~-~-~SPLAT
661,125,356 *442307C6527D19CCA018CC5309B3C4AE72ABE2BB 454644 SHOPPAILU OLISI ERITYISESTI NUORTEN NAISTEN SUOSIOSSA .
661,125,357 *44240DE3FC41DD8D3050955E11EE8858FD4E8FAA kee1bo47$
661,125,358 *442F395B438B92CC910B4029F26FCFC4D7D53490 4IAMCOMPTON2
661,125,359 *44235B4F538D64D4E2DDD5660947794CAEA095B2 4KALEYZA
661,125,360 *4428C1AAECEB1ED80536FCFECE80511F5C53DEBC KELLEY.ROSENTRATER
661,125,361 *442F5E9680B69757FE75A4CE07AB5BF61643725F KELVIN.STADDEN
661,125,362 *4423CDF46C31C3BA0C24ED58C716CE787C27696C 4OMAINIRAM
661,125,363 *442DCD15A14ABA5BFCEA834DF8C10829D95DEDA8 4PEBBLESFLIP
661,125,364 *442FA559D58EE99C4C981FB196E0A6643D288873 4PEPINUM
661,125,365 *4423ECF0E9DCC8AED60117EBC2776B514B5A2227 KENTON.ABELSON
661,125,366 *4426E723E66759E00476B8944A80274DAA830AFC [email protected]
661,125,367 *4426EAF380DC073E69C6FA62A7C5686BE010ADFA KEVIN.SONG
661,125,368 *4420C40574431B8D54B74F6BA4DA8E88C476FD08 50476 KLEINE.FREUDEN.VERSUESSEN.DAS.LEBEN.
661,125,369 *442B075E464C42495FE5C5CDC8E3EEF317816563 5.0.-cryptologia-15(1),-57--66,-january-1991.
661,125,370 *4428AC02665EC0E32B3EE887E34AC781A7356D7D KIM.ZUCCARO
661,125,371 *4429A5AC2CA73774A1356E738BBE1D2C40242D06 kirkllyod
661,125,372 *4421DE675180C2E57F7C165FD47591808A49F94D 5BSWFWFINCDIR
661,125,373 *4426EBFDC61C657421ADEA2D0004EE3FCBCAD151 5CMMSBRD
661,125,374 *4427D1B2F4C6E7BBE57D202F5FD3B68F89EE14FC [email protected]
661,125,375 *442EFA32B528E6BF8D105E57C59EE7E03D72B2F1 KÖRERKÉLYT
661,125,376 *44240756F6A8FC56CC496001C9661798B8760C0D KristinaSheDon'tKnowIExist
661,125,377 *4429B1BDF038749153F65A914FBD1594CAECD599 5NIKICRAIG
661,125,378 *44284ECCAF2374131BC1D56EE67665DF262C5216 5OLIVERFUGAZI
661,125,379 *442B5D348313FA41AC6BFF77AD88871E5438128A KV{AAA
661,125,380 *44208D26DDA1A227E7EE85671FB06D4FDF262275 5PSYCHOBIRDIE
661,125,381 *4427FEFB94702BBCDA729C2B02CF724147203446 5RFRMTNST
661,125,382 *442C56A39A8D6F0969614DB6A4DFFAFF282F179E 5RUGARTH
661,125,383 *442EB0CD6764CF908CF5CF2CAB68152CBF6BFEC9 [email protected]
661,125,384 *4429F73306F5CCE92BCA8B460D0D6DB559302E60 LAMARGARFINKLE
661,125,385 *442F290CA46C2BCB9ADFE888824C1D9E2D7CC679 5THEBRONCO8
661,125,386 *4426C0FAA4243753400F10B20557A991381CF319 5uncenter
661,125,387 *44216E4C3B668596778DE1B7E8A7943C5DAC8F26 5verwaltungsbezirks
661,125,388 *44228C218F0ECA85EBE511BCE6CD955C584C481E LANCEHOLTMANN
661,125,389 *4424FF342C38C9FC35D30CFEE7DF4ADB12A52D96 LANDMOTH-CUM-CATTO
661,125,390 *442A44668DC69F67D168E12D496222186CC0B988 [email protected]
661,125,391 *442485096E5547B6B3E74DCE8C9101338D938621 646971 derverwaltungsaufwandseizugross
661,125,392 *442E30AC4256321A6E71328A775E85636CFB51A5 656TRISTAN
661,125,393 *442994648D0205F245660CC71E07B551980CC0B8 [email protected]
661,125,394 *442AE40F61DBFD05AF6B19983516FB4965F4A590 LEBICH
661,125,395 *44298C23980D7DE459B55E397778F07415782452 6.huippuimurin
661,125,396 *4423FA01444C79C47909706B483E61630FA02943 6iambull9
661,125,397 *4422DF1746CA1811367FBAC78BD9108AC36F79F4 LEWIS.ASIELLO
661,125,398 *44213EF903C56A0E05C9BB2197E03AFEAD1514A8 6SAKAMOTO'S
661,125,399 *44230814249389724978B1C9EFA1F91ABFCA1F39 LICIROU
661,125,400 *442944A6748A45F2224D48655CDEF6C793DE9B10 [email protected]
661,125,401 *4428A9473E6432888D7ED18F1299DE95F8FD71DB listandindexsociety
661,125,402 *44217830F0C0661B0B9EC9088B26E678A129AB5B little-suzi's-on-the-up
661,125,403 *442ECFD06417D809E8C1B5D4B8DDB71EA6A5EFE7 7BESTIKKENE
661,125,404 *4426A0B1FDF5611827E60D9C9FA0D0CB160B7373 7BLOEMVORMS
661,125,405 *442E0040B8D9BC0744378DC2EDF392E96CB85767 LIVEKOKOELMALLA
661,125,406 *4425982F1CE33771E2FD5DBE86557ED7032BE45D lizak71
661,125,407 *4426354521CB6BF384AAA01857819109EBFE9511 logankincaid
661,125,408 *442DA6BB41C16CF858B6F1DE8F79AEC4BE370C8D LOMA
661,125,409 *442DE22D71D219EC738C7C0E24368918BE7951C0 LORI.ULM
661,125,410 *442ED5E7CD6B4133F6B902EB0A69A93453216F07 7GCRUSSEL
661,125,411 *442F4A56A5467A63BA8E78F74E37476FA9A34EC3 LOST-COUNSEL-AND-UNTIMELY-DOOM
661,125,412 *4421669F2690C73907D2A433AD2106BE8DD29FC3 LOUIE.HYND
661,125,413 *442F6BF36C46DB63FC447A03AF426CF796743B71 LOWELLMAVAI
661,125,414 *4420708477450736639C8C53CC260538DF98E45C 7MAHAAPRASAADAAR
661,125,415 *442EA2A9EDB3779C849AA8BA2EAF1146DB1441E5 [email protected]
661,125,416 *4426AE9120430E0EF7E2C4A3B16A4DF839D7A5C1 7NEARINFI
661,125,417 *4426D1A730A0F1A20396BD1A919C38145938413A 7oplegwerk
661,125,418 *4421371C8496FE4E93D64B5F3FEBF6F5FD68BE5F 7parcourrais
661,125,419 *442C29329A3515E3589F6FB70612A2AE5439E36A 7rabbit14
661,125,420 *44271DC1908D0EC4DE8CD411B43F929BA7F9A335 LUIGIKREUTZER
661,125,421 *44293BA1DAEA755E634275FA8029A0375ECA1C7F 7THORTONS
661,125,422 *4428A7BF306EA4A292F0CF7194258FAD11D00E53 LUKECLAMP
661,125,423 *442B72E6623B534C410ED7BF68EF4DEEDD990A9C [email protected]
661,125,424 *44298C403C4192F8E75D2DDD0EF5990B006F542A >-<`[email protected]
661,125,425 *4421AF1B5DE9FC3CE09522795396F8F2E8ED73AA LYLERABINOWITZ
661,125,426 *44262BA45A6AF0162E31096DE2602E333E9CD6F7 LYMAN.STAWARZ
661,125,427 *4422BA6A8F4521C8000FE0FC7AEBD2415B91367E lyndonbokman
661,125,428 *4425680AE2E074A1863B52A9B69F51CE94AC84AF 825432 kongressiaika-ei-ollut-pelkk
661,125,429 *4427D5E9418C0D9567F0CB5E843D31627CD7EEF8 861309 KOMITE-,-BU-GOREVE-1955'DE-SUAT-ERLER'I-ATADI-.
661,125,430 *4421F7F02F8B1BBCAC32D8AEB3E6D91EC73E2D27 M4RANCH
661,125,431 *442A6702AE7D2BDEFD7411F45AA4E6E9BEA7853F MAASTRICHTKRITERIUM
661,125,432 *442A27FECE15E312731D402092D427B81D837288 MAHCNERF
661,125,433 *442C1E6144413C439C9F91CA5F91EF04E0C85171 MAJIDBALUSHI
661,125,434 *442384A3069A1046BCFA022BAA9ECF2171E968FE MAJORASDFJKL
661,125,435 *442CD4B1EF34A1C16DCB2A6FF10D196D65FE2C08 MALIBUNICK
661,125,436 *442BA9B188D7FB9BCFE953091058B36D433635E9 8D~0~O><
661,125,437 *442E98F61D1E5FA0CAB30A49C6C5A8F7D8499D7F MarieHamilton
661,125,438 *4420C97B9941B83C5D7E649634D8809315C5FEBB MARKUSCOSSABOOM
661,125,439 *4420A6FDB0BA7CC08414C45C6210A2F1E9C35166 MARTHAGING
661,125,440 *4429FEDBFF9F41E06F9672811FC7CE536459F78F martyoller
661,125,441 *4429B48270857CAA03EFEC82812DC5916A04F770 MASSIVE/4REAL
661,125,442 *4424FE9DE1DD38B5D23E5D964AE1691E78FF9335 8schemerduistere
661,125,443 *4428E8920F2A70F63C0FAFCDB8CADD56B74C9810 MATT.DABNEY
661,125,444 *4424DBAD0DA9DA71AB51F7CFA00F20859C283509 MAZZILLO4
661,125,445 *442665E1490ACFEFDABD10D7FAEEAEC2D84395A1 8UOECACOC
661,125,446 *4423E4258AD960FF71EDEDCC76EDCC84F4590A39 MDALIPI
661,125,447 *4420F7D7B56966E24D5F41BF9555D5712831AAFF MEMFILL
661,125,448 *442DBBA75971FFF2BAA51F9364A4F0C39D6E62A6 merlechevez
661,125,449 *44259C3F72EEDB49D19A2259DED6364CED8C9BAF 9BSWARVEYBSW
661,125,450 *44255527FEF10210B79BA85346635E1EE32036FB MESCALISM
661,125,451 *442CAA6EE13AC7748C18620B6AA694D632A30233 9empetrer
661,125,452 *442117D3D3CC62ED2F472C64FC91D6855705E3EA [email protected]
661,125,453 *442CA987DFF7E16DF375BE7B899C2037036DB091 MICHALEBARREIRO
661,125,454 *4422B0E0DE928F831FB1CF698490CF3E153A48C4 9JOELMARC
661,125,455 *442A6CC5972AF196AE8CF34FC0A937C15A19DC17 michelmarkle
661,125,456 *442030EDF7D6C906C30365FC7FFD83125244F64A MIKEADDIS
661,125,457 *44276908D3DB2EF7AA2985268EE01B6E60D8582C 9POTRUBNICH
661,125,458 *4421D0C96310E55D583FD98220BAFAF327D76D6B 9RAVIRAHC
661,125,459 *442EAC67F576FD9035A22433CCF9A24E3807245E 9SASSYBAMBOO
661,125,460 *4425EE2EC2E7E9A240D8FD9C7E26D5F9FAAD70CE MINK{{NLAISISSA
661,125,461 *442EAF77A75BF9509C6179FAEFC2B70CACCBF347 9SWGXZBPSCR
661,125,462 *442241CF674C2F16528EC782329AE6E1D5992217 misjoin
661,125,463 *442C99A80CAC2FC0D2BEAA936B5E954BEE6DB503 a8#c&
661,125,464 *44262C157722C7EA20E0A3AB383931ABD1A349AF AAA`[=
661,125,465 *442BFFB0F8D941FF452003052778F70F0A47505B NARYŠKA
661,125,466 *442CDA166FCF55B30091C903DB4B36A5BBF2722B NATHANLIEHR
661,125,467 *4421F26A0D8791B1CA4E0A38DA0C79A5D62DB74F NDRDABMNGEYX
661,125,468 *442FD860E17DC9E3863FCE380196FC42F0646DC1 NEIL.DIVAN
661,125,469 *4423271C69A67379A905E37A8C6D26737A108F80 nelsonfirst
661,125,470 *442B08E1D5D18631B17622FB8CAEDD41651C882C NETKREWED
661,125,471 *44212EC3308AE6FAE4D65C3E5732D49F718D1F4D ADNAN CYCLEWALA
661,125,472 *442F12F3BEEE9DA8EBB09A693036A18A4963FD09 ADOLPHSPRUELL
661,125,473 *44232E983D65F27177E362B6FAF688491CD42EA8 NILS-LUNDQVIST
661,125,474 *442D421B6B41A39B22A410DDA624F720B5CCA94F [email protected]
661,125,475 *442391E7AF3E7FB4AE7C5A8E1B089C974616399E a"e;m
661,125,476 *442A837B7A39E38852144B279468C48EA3EB0A33 NOEMI388
661,125,477 *442FCF16EF29CF813C320C072818BD04064C3527 AGCCTCCTTCCCTGGGGAGCCCAGTCCCCCCACCCTACTCTGGGAGGACCTCTCTATGCC
661,125,478 *44298D0EFCC713C46DBDD2584C1A6AB147A00BDC agcmh
661,125,479 *4420FACD746D5D2EFDE13B1BF21DD50A7F649E2C ag.vv
661,125,480 *4423EDD9594010E44DA3EF36B800085FC899D68D AINPW
661,125,481 *4420853B0BBDB26B3FC214CBAC242E0EFD80853A ><o~ <#####3
661,125,482 *442E97C5629601966F9D13477D7CB831CF7E832F [email protected]
661,125,483 *4428A9DF2A1030937D5F647AA4615CF9520D7DB4 AJT/
661,125,484 *4426E15DFF29DAC0CFCCD881505F74E25FC004ED ALBERSON
661,125,485 *4425AC6E197989C73A508426B9C48F15073C5EF7 [email protected]
661,125,486 *4426D567C5741941740C2CF8F4E734EB189558F4 [email protected]
661,125,487 *442244DF3B6DE3757A4E4F5FCAD9365E1BECF82F alexandernevsky,op.78:vii.alexander'sentryintopskov
661,125,488 *442B1645F4D69A8648EAA34D7BE60FF7D01069DE ALFONSOREH
661,125,489 *44270D76620E732BF22B2C5DF6AA271B87FE1358 OLENFAVORITO
661,125,490 *44294E30A21ABE31DB3A63520CB4BA5919705D8A ALFONZO.RIDEL
661,125,491 *44276F5F183BEDDE1FC3084FB234703540E6B0F3 OLENMALITO
661,125,492 *442E3766BDE90850FEC1068089DCFE3A1F4AB7E2 ALFONZOVANDEVER
661,125,493 *442ECDBC3AF2639200CB2A8648AAD839086BE099 OLLIECARGLE
661,125,494 *44211AE2874A3D66AC00F9E1A5685FEFDC93E4ED [email protected]
661,125,495 *442B95B8F60992A0185C66874D61068ECF9E1194 allem.was.du.machst
661,125,496 *442D916D83BE37117C54E57A5DBD751D88461E86 ALLEN.MESTLER
661,125,497 *4421084718BA9D01E8A2EC17CFF18E2FC8997627 }o{o~0~ @===p
661,125,498 *442AA68E4747157C8CEAC90E3CF1E80E8AA85445 (o_).o~.o~.q#p
661,125,499 *44288F399E0EFC2441F78048B09A409319AEACEF ALLYOU'LLEVERBE
661,125,500 *442338446EA47D6E630EC6BAF7BDFCDBD5C59A63 alq$5
661,125,501 *44252FAF4AAF80DEF60702069DE56926EEB32F1F am9pq
661,125,502 *442661213671F1BB7519083410A5BA8096A0C2B6 ambtelavivumdkwww
661,125,503 *44299C4E05247C8B7986B69B6792924278F77D94 AMEDRONTARNOS
661,125,504 *442BD0F187C7FA2DDF5B3B8DB8D8D40CB0D85FA8 AMOSJOZWICK
661,125,505 *4423E7D50D474AF884445145635B05D76C52FC69 am-yl
661,125,506 *44240F756AACF768EFA7D9CAB48D4F06B9E123BE PA48010
661,125,507 *4428FBF61375DC6165B6B5E8D03F860E38F952E3 PACKET5
661,125,508 *4427D5BA629123FD45BF14CF378029D35E4BB55E ANTWANGALANTE
661,125,509 *4424600474B360F8A17103827259B3CDFFFA54F3 parent-child
661,125,510 *44227938F3D2E709C5BF387ED0656939B7D14209 arnold-manke
661,125,511 *442A1E7622FC3AAF4BB25E4900D395E2D05E0DC6 ARON.HOPGOOD
661,125,512 *442B50B9E398F2F427E0D0D0DC388820C9466247 pesicia
661,125,513 *4423D6C241C3E266C0A2CEAAC0880BDE150A21A2 PHIL.DEJOODE
661,125,514 *442DDCB5F1882F98040A8F120DCB3701117CF360 a=sf
661,125,515 *442C17D7EF262B21202C08B11FDF1829EDC5AC62 ashleyrodea
661,125,516 *442A7BE1328EE2E399DEA3756B96BA8C01BD6B62 ashleysperos
661,125,517 *442E80393D1284227CDD28C96035427DA407A403 ASKERDI
661,125,518 *44216DCCCB95703ACE64BBF7BA5ED7946A7D1732 PITONISALOLA
661,125,519 *442EA8241AA100E17F805509B39FAE3AA2CBA452 popularizira
661,125,520 *442966FBF94EEDB1E9DD8C56D98A2067C66AA665 AUSTIN.BERMUDES
661,125,521 *4428111A037755314E7BB674C77057A330D280D3 aut8
661,125,522 *442583F68C4460E4FECD4C9913AC84EBA3A63586 av2;i
661,125,523 *44264EE9EAA75E75E01A4B9E392DB9C4CA30C35F AVMBK
661,125,524 *4425C67EB2431E52B05496DEC2F20E0244CBAB59 PREVIALAS123
661,125,525 *442398C9FF4878941451E1CEB9610D6B28095596 PRO7ON1C
661,125,526 *4429B9C59A862188054582CD21FCDED03991AE56 ax;:d
661,125,527 *442052C0456BBD7B27ECD0F3CF1AF939D9813743 b!7
661,125,528 *4420AF2CB854C3C26674F0755607FB90B05D8530 b.982
661,125,529 *442326287377772764194502A7EA1696D998BF2D QFC>
661,125,530 *442A52D3E4E89E159075E79FDA7D302907341A06 qlzr
661,125,531 *4426CA1BC0C1AE8A8259177CDEBB5F3AC8C2A900 BALASUMBANIAM
661,125,532 *442F686CD4FEC814754AEC6DF4EAE5079DFB5CA7 RagPiloo
661,125,533 *442D99DF3DEC0D25FDCB068298D79EBA60F46370 REBMAAHSIM
661,125,534 *4423058A3F1D3443EE88000EAC80DF2B3AEE6D7F RECALLIT
661,125,535 *4424C9F8C09CF4277C597DCE1EC81E4FA44F0D13 REEDLINGS1
661,125,536 *4426208590708A81756FE339445AC29AE63BF257 bbql&
661,125,537 *442AEBAE63B798D5E780305180A8CF44D78934BD BD%WT
661,125,538 *4427CD07AE8FFB81CECDAA58B468303375604071 BEGRENZUNGSLICHT
661,125,539 *442F8F09C40D2F52D6537CAF8D97CB66AC9DBE86 RETXEDNEERG
661,125,540 *442917CD93F4D857E5B094DED5F33604C7EA89A4 BENNETT.ALBANESE
661,125,541 *44276B75F1FAF5A6F2D1097539C6DEE806802F1B BENNETTDUGAL
661,125,542 *442232CA7B155DEBD316E19CE74FE36AD74C9C2F BENNETTPUFFER
661,125,543 *44202EBF8850EF9FB1F50FCF17A1BF6A4CA56923 BENNIEVODDER
661,125,544 *44229B2E3812E287C297706CFB40FE3D8EEEF267 R/HG
661,125,545 *4429F700DC43C5DACB7D3CA3F63DD772E70CF040 ber-tausend-sternen
661,125,546 *4422A4789F6FEA440B9FB9B4672ABE04D7338EC2 RICKYMARS3
661,125,547 *4427903F8B86576CA73277FEE74C7827E77773A6 RIGHT-SHORE
661,125,548 *442BD38C82C508A52FF422B125E97DCFB5EF950A rigobertoloux
661,125,549 *44223EC5E2FE7CA67EA8051A555219B0E8C0A48F BFA
661,125,550 *44217F674E48C9E4426A1D95DE1708EC4A0AA316 BG!LB
661,125,551 *442C5173ACDCDC09F9F50F1B4B65B8D19752CBE9 rocco-de-la-hoya
661,125,552 *442A48A00422A632D15572334C4EE8F3095F7370 bird-cage,-part-9
661,125,553 *442740CE94C520812CEFC89229287DA969C73DC4 ROGELIO.STEINDORF
661,125,554 *442A47EAEBC6AB6E5049F686EC9CC6C6D6BE9926 birthed
661,125,555 *442CBCEE07F6BC3F82CCB10C287DD31A90C31A7E ROSS.CLOWNEY
661,125,556 *44243C5ACCD11B809EEFC68240FC5877FBAC2562 ROYALPOTTORF
661,125,557 *442A7E3143FC5FAF5C88D4F961E29756B29BDDBF B/L7H
661,125,558 *442E89F4F5F7858580CEBCB6BA1F12F2EE9C379C rukhsana.shaukat
661,125,559 *442F2615BDD291000BAC8F6DF8FA073EE0F0607A BMU#
661,125,560 *44255013BBB02C609A7402D77392F2529E6A0015 RWORKSHOPS
661,125,561 *442E72134CC61166C0A79609F66615F48E5A2BC8 ryan-qualischefski
661,125,562 *44206D39026310FEB52743B656C49FA660AFF9F5 s010104
661,125,563 *4426ABEAF98BD4BF78B3EDE047EBCB3CA59F86F5 SACREDHEARTVICTORIA
661,125,564 *442CCE5BA6C1FB9CBF613C952EF96DC754C79FA4 SAKSNBBEN5
661,125,565 *442F4FE038B351E0E2C1009506F600AD35665DDE [email protected],
661,125,566 *442EEA992D9600691BA30E4F6C36E3DFB58BDE7A salubmas
661,125,567 *4429961D0861C5472616930FAD4D272DEAE8585B BOOPATHI.SUBRAMANI
661,125,568 *44213863D623AB70353B4D3F7D06E7E957E32820 B-----)~o-Splat
661,125,569 *4428E8DA6D771FE7450F31142173B9DD683EE186 b!:p"
661,125,570 *442A5D726D645E42E97366C88718B8B6C4606472 [email protected]
661,125,571 *442A79A04CE2A674C144FC27600EB419FD2E4914 SC0RDAVAT3
661,125,572 *4424BB4329FCEFB12E8AA45AAE029938391898B3 SCHIVETTE8
661,125,573 *4425E044CE945D68F9BA13C1D45E0468A53D046F bpmfi
661,125,574 *442FBC9A81D91FB8B90196FA5121DD8246C70617 SEBASTIAN.FONS
661,125,575 *442266B8F4CD8737607B3A6D1C8CC14DB8FC6E00 SECURITYTEXAS1
661,125,576 *44290A34C2173005246E3C0A8E45288A3F6BFD87 sembles
661,125,577 *442DAE9EA3C86626D290654A14FD47606BBD61C7 BRANDON-CHIAT
661,125,578 *44262149C425DCF178EC683AD7980E1A38C6285F sesaercni.noitatnemucod.ngised.eht.fo.liated.fo.level.eht
661,125,579 *442154EC117AF913156D5CC0AD079892E856F3E9 BRIANGRIMS
661,125,580 *442BCBDB62496D0BE2F8372D829BEBDF532CFC28 BROKE.THROUGH.MYSELF.
661,125,581 *4428208B7F7E9DE08880F802D6FD33F5EA375EAB SHAUNETTEALYSSIA
661,125,582 *44216541C16C4112344A1BB9C3140421A79F9F59 BRp1
661,125,583 *442439E3C82AFB7FAA323BCA6B5C076548E9A513 SHCKNDNMBFFNDNSLGHTSCLLTRY
661,125,584 *442C974D2F1685FD05229109F173FE10F61D5EE2 BRUSSELS-USA:-THE-BEST-OF-BLAINE-L.-REININGER,-VOL.1
661,125,585 *4424A8342A4AF36CA8085E2CA027F5C9EB1BCE20 SHIRLEY.BOX
661,125,586 *4423A305584954AD5E84E19D287AB1C0F7E9AA2B bswlqbytebsw
661,125,587 *44207EB87C87C6D06FEF34624298DCC506E72225 bt=i9
661,125,588 *442A5A9D30EB160ED65E7231264720D17EC0E1FE buckminsterbah1kmih2nster0
661,125,589 *442057AFA6CFDD66C2F500BD1F1E83A28626508B [email protected]
661,125,590 *44200B25E81B46AE86C7D6840413B20DD0C8FDE9 simon gallup
661,125,591 *442693D78603DAC9E70E6B84B61187521CF19DA5 bxagf
661,125,592 *44284DA2FAC2CCE240D92739F8AA6C6250AA1C56 c9%8m
661,125,593 *44253F2E93B2AEFF50706F7B423071046D7C21F4 ca8#b
661,125,594 *442EA311D7CC2BC73362C2D488FED716E93376BB SOJO
661,125,595 *44250B95B8105E71A13FBB182B2C1C852FF5654A camh's
661,125,596 *442FCCFD51A3C97AD98030EA69D156C7A5E9906C SonateNr2G-moll,Op22:ISoraschwiem
661,125,597 *44294A5F90CB29F55FADD54325BF6A4FD2A7860D SONNY.SELPH
661,125,598 *4421C09ABB036FAE028B66240E499B05CFC0BA93 [email protected]
661,125,599 *442B1873690D25F870D37EAB3B7EBDFD7E25B190 SOUNDPIECE#3ASTRIDASKTHERE
661,125,600 *442962FF21A1F8D9D88E3F2460154C8A58F9E085 SPLAT!-O~-D----Q
661,125,601 *44292AC3DF2A838DD2C9A146B898180704A20094 sptnntn8
661,125,602 *442894BABD6D410BB48D4FC6FA544C1999F2CC93 CD25,
661,125,603 *44236FDCAB4DFE48CAAE0F459DB274890AFCECBB STANTONANNARINO
661,125,604 *4429E98FE8F4D3E00F9DBE62562705626A119BD4 CENSORED INNOCENCE
661,125,605 *4428BA82C39D96B82A7645268089C8434E5847AA cg1b
661,125,606 *442F6F268EDB90AD49CB1C5C03ED1E2DB7A6344A STEVIE.DOLBEARE
661,125,607 *442F50C469FF3C5AF0B397E01ADE037EA572A87B STEWARTGRIVETTI
661,125,608 *44206376C8026CE9CD74EDE54E700B39F6EE0ACB STFRGND2
661,125,609 *442E9CB88274F6A100E1670951710C9FB7A2C662 streakthroated
661,125,610 *442B55FA5FF33D37FF2423DF4A1EEAE70D9AC642 STRIDERVIRGINIA3
661,125,611 *442A5EDE559942D9EEB02B32CEF7DCF772073902 charmaina5
661,125,612 *4421E39EDFF05964C0B19C3A720A1D1D51E637F7 STRING QUINTET "UNKNOWN HEAVENS": IV.
661,125,613 *4420A9065626F91373B258FF8682FCF86444A71C SUBADVOCATE
661,125,614 *4421AF5A3475590D15B5447D0ECFFF3ABC982B06 [email protected]
661,125,615 *4421FB57319BAD7228C1B5EF303847DF113CB707 swampable.
661,125,616 *44249689916F616EF6DA1306BE90502277AF8CAE civicrm
661,125,617 *442DA48737F2E0239549A0340136A744C9AE0F14 cktel
661,125,618 *4422D3B279502D120A74E1F3A284A6AA9AD2A2AA <TaBLeBoRDeR=0CeLLSPaCiNG=0CeLLPaDDiNG=0WiDTH=83>
661,125,619 *442B23F15D973E5D621E73E1AB4EDF17711B7150 TACOBELLDOUGIE4
661,125,620 *44220A82D46C3FD4D7AEF8B346F4FAB99A1E755F CLAYCASTANEDA
661,125,621 *442351F44C979EC75F2094D3387E59118131CF7B TALKLEDANA123
661,125,622 *442866D8B6689F9E50B9FF0F78151E8005731B02 CLIMERSTHE
661,125,623 *442BBF06F14662F7E6F5FFF0BB58C5EEBD377154 cmhigh
661,125,624 *442F16A71AFD1006CEA455131ABFB85016F35D12 taylor
661,125,625 *4422989B345F15E62043783BDCFE0B27ADCEA044 concretisons5
661,125,626 *4429E03F7E0549CF856B7974C6598BC7773B2999 THANH.MOLCHAN
661,125,627 *4428FD009FBF6232A5C99AF21E8B303C91D054B4 cortezjehle
661,125,628 *44246BA582E99C87F94F903D1A5665010B710158 thatpredator73
661,125,629 *44206D719C0CF7321876911F0330F26046EC2A76 COURTNEY106
661,125,630 *442698C51A80E5D1E84E727F8B67BF089D7C59BA CP534
661,125,631 *4423593268CED1771EC8266229F7C0271167A4AC CQ#EV
661,125,632 *4424192D072358EA61DE1318C534F5C2C7C9845B THIOLACTIQUE
661,125,633 *4425A5006ABEE506F185F59AC2FD592D9C798612 THIS-SONG-IS-YOU
661,125,634 *442A57B7974480B2D9E2FCBD76C49C14B3E7AA05 Cs!=
661,125,635 *442F576A2D84B6EBA072F943FE55B59653F84B13 c:sav
661,125,636 *442105F2F4E879155AEA4917F58765B95EEE5166 TIGERSLAKOTA
661,125,637 *442F53F551483E78FECBE462DA17FA5E2EBE5869 CURTAZATYAN
661,125,638 *44255E3FFA16135F4B92231252FB59E650ECE184 tnemurtsnikjirts
661,125,639 *44249984457C72B4FA3C48FC731D67DDB39BF86F cwi83
661,125,640 *4421ADE9AABC32B0D023D7EF22AE96DAA078D39F D1w
661,125,641 *442ED73D5FDBF6CD36DFE2676442E36ACF5D0A90 tranquillos
661,125,642 *442C8564F626CB25E3C1834B1017440AEEA2BF8A travispearl
661,125,643 *442D77FC4D3BFFA0C2FB4174C6B35F9ABD078238 d4w#q
661,125,644 *4420C882EA600189F030E5DFCE7D1C7CC5AAFD63 D6&M
661,125,645 *4422D142634B0836AC98960E2311E1ABBA76B3D9 TRINITYBAGWELL
661,125,646 *442D061FE64257CA2C9E1D446991BD64A8168087 [email protected]
661,125,647 *44233CE4E684ACFEB167F7CE8DB7B186897D9984 true-to-the-game-(feat.-steen-rock-&-scratchmagic)
661,125,648 *4427D57266027FB121A2AE251DE18E755AF91D9B trumanhenricksen
661,125,649 *44211E38CEB4593187379198C1096F34BAA89A4A dambi's
661,125,650 *442D011D58D0C98E906201642B2D57666040388C TSIRETSI3
661,125,651 *4428F57D3A6CF2591A220BD1EF411100FF79F2FE TTEICHMICHINEINEMTIEFENERDLOCHVERSTECKT...
661,125,652 *44224ED1EBC338D8152DF5541990F3CCC0731DAD TWICE.MY.AGE!.(REMIX.'93).(FEAT..KRYSTAL)
661,125,653 *4429B7188257D0674D1B1B5E90E8D0EF0C42AE8B tyrellcolter
661,125,654 *442DCDFD073D4A9F19BD988FC2B8F85A83BDB9DC DARRENCERVENY
661,125,655 *4428DCADBCA07469B0FC2340E1D0282B64BDD208 tyronegiesy
661,125,656 *442B52D94D3C17E5FA9B150F95E9B503A75650BC TYRONE.HEASLEY
661,125,657 *44298CBCDB71CEF1C36FD275EC4664366C1BD607 DARWIN.HAMADA
661,125,658 *442B098ABD1830288055179C644A32C245DD986A dasgh
661,125,659 *442E0CD48C5DDA188DD9B11888ACA04BA059A84F DAVIDRHEEM
661,125,660 *442CB427013AD4D6A1FE78757C25ACD357E5AB2A DAWNSPALDING
661,125,661 *442AB61A37520C589ABBCB56170DDF5ADBCA5121 DBVRG
661,125,662 *442BAA8A35950448D7FB0FF1D5A1AB81F62259B7 ULSHAFER1
661,125,663 *4425419EA927E138F52FB90EEED7AE8D5B5A95E5 DDJDE
661,125,664 *4427246F39ADDD41111C6540E88F52718C52CE38 de(#
661,125,665 *442DB6289E41EBB44296CAB2788A82FB023FFAAD DECEMBERS
661,125,666 *4427728343E3EA674EC976DA6D6C786CDFD3AA66 UNTERZEICHNET1
661,125,667 *4426A93B4C27A3EB222582E2A634F2C23210032F denisegrimm
661,125,668 *4428483368A17FF1E5207FF98C9E474AAAD00EE0 DEOKALEE2
661,125,669 *4429FA839216F75C5EE27DAF8F9BD7191CD9F34C uu*<--8
661,125,670 *442FB6D10296CBD4231AA22129A48D8AE34EE90A DERICK.IRIZZARY
661,125,671 *442A06B7774F2F4D553ACFDD893C113AFCE3938F devinsaeler
661,125,672 *44277E5818A5E377567A31B154DD6E885C17B5CD VALHOUSKEEPER
661,125,673 *4428D389C3B6D57BBA5C6B66BDDFE9FAE79D107F DEWOLLEB4
661,125,674 *442E4FBEEBE436DDEA229B57C5243F6E6B511AEE DF%d
661,125,675 *442F5207B870028DAF25A5D25398DCD68B8F4DFE [email protected]
661,125,676 *442A66FA1A8C3234C4D20B699411322ADC3DDDE7 dggt+
661,125,677 *442DAC47305774A1A2A4147DAF47F67539B9FF52 d"gud
661,125,678 *442792572FF837D727F3DC04F71097613DCF3D4D DIAMOND.AMORE
661,125,679 *4421C084EB5047D5C9E60A61F91D590027DB8DDB vayal-farm
661,125,680 *4421B48922707E9DA3FE70D964E298A870AEF300 vbh
661,125,681 *442AB12383CA47808F05AFBA1F9376816A747AB1 VENDROSSE4
661,125,682 *44202913B145F622B9CDC745CC69427393A82514 DI"IQ
661,125,683 *442F48C2C9F020DE5DE33EA5C017B6314A6D93A5 dimz"
661,125,684 *442B214AD8DFDF20404945029388BE64C6DB59B2 verguldselboekjes4
661,125,685 *4428021366449EB508781187ECAE25E80ED0819F DINO.TATOM
661,125,686 *44294C587D10F1BB7FFFC498F58AF0B918A7FB03 VERNAJOHNS
661,125,687 *442E14D90E18B82BA6FEABCD9BDC7CBE67DE8277 dkrgx
661,125,688 *442DF6139A546714C191B62F8A71EDDAF8E91580 dna#;
661,125,689 *4424BEAD79F79EE68A6D07C0EBC1272648B60D9F DO9/
661,125,690 *442EA6112B3A649198CD8A322CFC45E2E9401EC4 DOCERENS2
661,125,691 *442250CB8A5931187509352C18A3A1C4BEDEB11A domenickirst
661,125,692 *4422262DBB1AEC49FDBE5E1B6A39E6B99866F54E victor.gonzalez.corleone
661,125,693 *44238BD759BBB9424D4C97F23F5439D61D12004C vincent.drako.wolfe.gamble
661,125,694 *442CE73B5D6C993CD6F1397B680C6CADA66984F2 VINCENTVENIDA
661,125,695 *442B54867E1FFA0D756B0371DDB90CA582A3607B vingaresas
661,125,696 *4424BA716D8F7263D459DAC4475FD5B364481163 VINNILLIANS0
661,125,697 *44219A51194E19B47B0383D26C18D8C148AC7587 dosato
661,125,698 *4429397CE10B759961012209AEE4E93CB0E2CDEC visitaciónde
661,125,699 *4425D3E2D34BDFDF7991E8019DC78AA34904D038 vivybeingmececcarelli
661,125,700 *4428CBBFF75D85FBA7F39E23CA8C497D656077B0 [email protected]
661,125,701 *442FB71EEEA07D44689E52D1BF0FBFAE3A08856C dq)av
661,125,702 *442DE27428869AA9D3E1E6887F9ECAD7D2397D73 D,ROG
661,125,703 *442BBC488BB6ECB09F1B82F44F2368F3D8B9BBBB DSNLC
661,125,704 *442264FC360C90CC6815410A9BEA73C9F2EC0624 wanneita
661,125,705 *442EED1FD3DEBF25BA561B6C098751EAC4DB7616 dtllh
661,125,706 *4424D8E579D0CCF122C2234FA8AFC2379E387AB5 WARDMCLUCKIE
661,125,707 *4424B192B04F86F5598665FB696B3C889875D4FD DUBBLER'SDELIGHT
661,125,708 *442E74364F55DAE8CE09FA11C7ED8F8FCC1018F8 [email protected]
661,125,709 *442669B7AD09C3F17115B84ED83EA0C1D23971E5 DV4J
661,125,710 *4420900E9E013223BD46996ACCCCCE4811A62944 DvEi
661,125,711 *442075FF7A01266E277580BE121144431025E590 [email protected]
661,125,712 *442CAE844C50F32330F63D06E38B443B291A529A dx+on
661,125,713 *4425724CC9A1179DAA6AA3CB9803A0BCDA8E5DD4 WESTVEER12
661,125,714 *442DF47C2E29666B12FD659BBDF155E0E1916839 whitneysobotta
661,125,715 *44233D10C45F34187753D05765CBD83ABD1C36BC WICKEDANDWEIRD
661,125,716 *44272554F415EC36932A300CA5CBF10ECC23D38F WILL AREY
661,125,717 *442A8A465C80F9E121B565F7109CFB13C9790546 [email protected]
661,125,718 *442B456D0EBD26451774539C88BC1C7F7C8EE36D willhartenstein
661,125,719 *442D40CFBD7A8B8E14783D7018AE7F9C9C195635 WILMERVANSTEENHUYSE
661,125,720 *442401D0B55631C395C0883503B49B09B9E2D880 WOODROW.DAMBOISE
661,125,721 *442CF9B4E13EB69575A5D159008EE165DFFB5B04 WOOSTERNORTH
661,125,722 *442452879142003EA84FB21DDEA5135037E8BCA1 EFnX
661,125,723 *442329912B652D895D4B4169629C762B75C34897 ek1ah
661,125,724 *44276A2A29D524AD621A38AC248729CADC3150B6 [email protected]
661,125,725 *4420DFC810294DE7538F494B23E6379186A4246F EKE/P
661,125,726 *442B7107E703212DEF394C1644A27ADFA59291FB ELIJAHAGNES
661,125,727 *4423C83DCB4068E21FE5163D260377D8EFF0DAAD WWWDANCERFARMCOM
661,125,728 *442D47CE2DFCCA1C31FCEA47A875595787A34FE8 WWW.LIAMLYNCH.NET
661,125,729 *442D00F9EA570D3630AC96517F6B0336DCAE6A97 ellata9
661,125,730 *442100E4E16DAC544FCEDC38B263991D8DF46387 em8m!
661,125,731 *442FE8E91C4F4CD4C53A0D9C7E9BF38C05D7E075 [email protected]
661,125,732 *4421E0546B57B529642B17DA3975BFD2FCED8718 [email protected]
661,125,733 *4425B26FACC0CBD6976141B404A9BE31A6B73DE7 [email protected]
661,125,734 *442621F3C71BF624DC706C5CAF2928308F16AC35 x'ni
661,125,735 *4429311599EE9896B07CD07F0BA2A8A3AFCAE312 Y170924
661,125,736 *4422B5D5F0A74977BE260BF579492B65478D1775 yana-sadukovski
661,125,737 *442CE5F24DCDF3EBBC13064DEAC95327AD7525A6 [email protected]
661,125,738 *44233178441AD23FF574D9060A2856FE17C07671 ENRIQUE.HITSON
661,125,739 *44220FD0B6DB45D2B5E9E21D313A35B79A2E0456 yashanpoonia
661,125,740 *44218403D103E4FF3A2ACCE0D31EE0D2808FB0E0 yeni.arisanti
661,125,741 *4424C8A07EC1E8E2151C2953CA45EF2339F96E81 erickbogenschneide
661,125,742 *442B11796D973A005F048CF6195F72C2C1042FD0 ERUSTRKES
661,125,743 *4427EF33C0C616A00F00DB715F8C08CB11E74453 ERWIN VAN DOORN
661,125,744 *442ACA9958877BFB42A6111B51BD40E35C93B6C6 ESDSA
661,125,745 *442264F51683B9849888D0EC1804C281CF43D536 EULAULIO
661,125,746 *442DD436B48AFAC2A2ED52AF2BFAC31D4CB82DB9 EVOLIANA
661,125,747 *442C2D0AB9CCCDF6A7C34F5F1DCF3AC68DE6EE8C YOUSEFABUTALEB
661,125,748 *44252EE5A0DC705DEB776C62D09B1D762F986AF5 Extreme.leftwing
661,125,749 *4428F18C54DCAF4A9B9AA98186D3D11C4805B83D YRAHULRAHUL
661,125,750 *44262B2E59EC568F4EA8C452E72F5EAA5680316E YUALIANTO-YULI
661,125,751 *4425A6C530EE6DF7581E443A47E4586D7FFF18B9 f1uor1da71ons
661,125,752 *44264311FC08A3D7B96FC5E1550028DE04D54D94 FABIANROWBOTTOM
661,125,753 *4423C30D5999D87B75FEAA471AA583DEF1FF1292 [email protected]
661,125,754 *4420999FC21549F81C17049A651E5AA37B31890E zacharybathke
661,125,755 *44237E670A3D126E0CA745E93B2FE39F00B484BF [email protected]
661,125,756 *442FB4A40AF9ABDDF60FDB3B5EDC700DB8FDF136 FAZMILMOHAMED
661,125,757 *442F452E98F321CF7523ADAD8D1C4A12C9730E8F [email protected]
661,125,758 *4422F27C48754FF01398AD244A4862A63D96B70A FEBRES
661,125,759 *44228145707D2D4C8D38599CBC3654323DB12231 zeezunghyeon
661,125,760 *442E0CD1FDE1E633312BF5EEC820988A0A2B4FC7 fl!r+a+!ou5ly
661,125,761 *44258658E76BB25274165FDDEA4DEA14CFAB63DB zhouzewa
661,125,762 *442F9F03862500A1DDF363B92FE56B3E3530D131 [email protected]
661,125,763 *4428CC2398D3B920A41E32CA4CBFC22B1437C0C0 FORRESTFURLER
661,125,764 *4427E412283382525B0067DCCB98C235DB488E51 FORREST.GRZYBOWSKI
661,125,765 *442A56A7301FDC6A3B1073D9CEA9035E6AF96280 [email protected]
661,125,766 *44280C5AE1A0FDF1EE42ED46DA1A6442D823487E FOXINTERN2
661,125,767 *442C23120329BC72A6D7BE74BD9C97E168FD0458 ZRXPXLHEN8
661,125,768 *442A4F4473C9807F896AAD6398503862FE01E264 FRANCISDEBELLIS
661,125,769 *4427EA9E8C4A6A73D29545FCBDBEE4AA0049A597 freddiecusanelli
661,125,770 *4428EE169CA1EBB1F4A1650DB5E6391AA91D4CB0 ZZYNQILBU8
661,125,771 *442A45C8C21C53F71547DA639885B1B2C6B01671 FRED.LUSSIER
661,125,772 *4425F4C5B8C238242B46494BFE4A202E7CF5DC1F FREDRICBURVINE
661,125,773 *4423F500F932CC72F5A84CD1EBC3CD9AB03FCF29 FRITZ.STOKE
661,125,774 *4426F414D4DC30D88580C6AF09290FB260FB7C55 ftcampbellpao
661,125,775 *442DE16174AB9B11F3EC8E11379D45B885A81353 FujifilmFinePixF700AdobeStandard
661,125,776 *442D757F5FAA38C6723BA327A6DC3FBF178593A7 FULKM
661,125,777 *44286FCEF3EBAAA18816D568B9501F78966A79DF [email protected]
661,125,778 *4422FD197FD352AA2D085B04A0292FD5BF8D0FA8 АБРИКАДАБРА
661,125,779 *442EBC011A56E195751E0F32864F008E43E9C7CC GARRETTSCARVER
661,125,780 *442551A1890B32FEFAD20A3FCBC7FC2B9FFEDDF2 GARRUDOS2
661,125,781 *44211A5C21B6AA97A74112817DAF3F3227D6B592 бекамом
661,125,782 *4425F0CBFF320DDB35264CD41ABDDBAB7A9E7D18 GARTH.RIGHI
661,125,783 *442F1F1E38949709925D393A65CE99EFA3E2EDCE GASTON.PASKIN
661,125,784 *4427EAE428B2B1628CF8DB84476517D609A32955 gateeight
661,125,785 *4427144E30855610481FBC030092DE9DCD6A0158 GAZDASÁGTANA
661,125,786 *4429A3F3A5527E37B6A2E7FE873F1436DD7A4024 [email protected]
661,125,787 *4426EF6BEB063FB5185431F219E141651B7C55CF Gdy.kobieta.m
661,125,788 *442719270C935F57A84A7ECFB625905AD07737D8 GEEXCERPEERD7
661,125,789 *4422F94A9E40363B2D7A080D4D30C812D0633E56 geoffreybiermann
661,125,790 *442FF41697F77F4970990657BEBF10219D6045A8 GEORGE STREGAN
661,125,791 *44243A2F295A1672813E6E8273C7E9629B209278 јех
661,125,792 *442127333842A74F03C9422B21D307653BB97BBD GIL.NADELL
661,125,793 *442F3DEEF2D875C01A7A6D70C9286D36207DE574 ginobradley
661,125,794 *442DCE2660452986DA36CFB99225DE2968EBE019 GIRO.1
661,125,795 *442B481F9D56F4BFBF7F6F425D18BC49486590AC GIROOFASAURUSVEXEDCOMGIROOFASAURUSVEXED
661,125,796 *4421E342F5C4B81348573923FAC164F2FE0ACD99 GIUSEPPE.FALKENHAGEN
661,125,797 *44261A83C9C2A79C743A62BCAE37042FEFDC081C G\JS
661,125,798 *442B1B4218E2C4FFD0B52F08E7DC5B6853821A41 [email protected]
661,125,799 *4423B668E373B82937D3A1394FBFD71265F27930 GNIKLAWE2
661,125,800 *442BFB848A07DEE344B98D703EC6A9C52F82DF76
661,125,801 *442F8B9452F62221DF3351771C9ABCB50B382A7F gohain
661,125,802 *442B5756D2E1D02CE8DCEB2C93D9AA501B79F036 [email protected]
661,125,803 *442973EB7C0B69712FD30669F278A4F126D6B722 GOOGLEPLEX12
661,125,804 *442293E7859ABF642E860907F36153E827167D04 GUMBOTILS!
661,125,805 *4427E11B6FCD95E914E8151140B610E970BFAD67 GURBAR PATTI
661,125,806 *4421857FE0B0B077A6757E9A0956846BE04291D8 GUSTAVOSAMPEY
661,125,807 *44275A96AC4F5C0937F8A65D00B85FCCB180E0E1 GUYELLENBERG
661,125,808 *4429B38FA6575135DCB58D1807AAFC387A579A49 H165543
661,125,809 *4428F4DB73C1D633AB15250B54E178D06F3B1B83 HAEGTES7
661,125,810 *4424A61A3E2B8BC2CDA405FC4FCC1D58D69E0F24 10DECEMBER1046
661,125,811 *44224A3731B5CC27AB82FB51475029489A1CEB66 11151556
661,125,812 *4423A8F604B0959278F7CD362BA7F7C8383882F3 1720DARWIN08
661,125,813 *44239D16F1DC7B01F5293C72C4EB90FC3EF35B55 17-Siirden
661,125,814 *442547786055D7A13C69428580DDB585ED9607EA 19222103
661,125,815 *4427EFE685394E5B47A6CE8EFA10171BD0C81F76 1 ALARUMMUISSA
661,125,816 *442BB34AB63099BC1A93F447554A9169E1D70AF7 1ALHORNBLAESER
661,125,817 *4429A731DACE5988FE97CEDBE4ABFC2DC2267E7D 1antaktis
661,125,818 *44258AF0BE436342112B1A674C28A7ECC1AD0368 1ASTATRAGENDE
661,125,819 *442FF1046F4940936F9264D830AA095B01A6ECB6 HEYCCCK1
661,125,820 *44265C9366D4AAFB48DBD6FD52B075221739A302 1BENAMME
661,125,821 *442CDEA7F7FE9EDAF8968CA2BBE94AD8E4D61949 1.CASSISSORBET
661,125,822 *44260979CD4547FEA972C1528A5DE20A9B3801CE hiltonshaginaw
661,125,823 *4427890A2C870FD1B4295AA351E1383DC66A8F18 1 ddrverteidigungsministeriums
661,125,824 *4423CCA631775772738560F876D5E64BF335CD2C [email protected],[email protected]
661,125,825 *442A87D72D2AA6C9A8FC4202CBF1CB2B99279D59 1EDREVEZ
661,125,826 *4429E5A623167F9836E019E064187BBABD8434DE 1EMPORNI
661,125,827 *44294561F987A6CFF7118AC950336333BF8A91BD 1.epileptic's
661,125,828 *442352EAE794D5DB03D557D222638133D76176FC 1-ERKUM'UN
661,125,829 *4428D38278829BFEC4C35AEFCEDC96901584923E HOGEBSW7
661,125,830 *44273DCF90F784D1160D1645896FE05245CFF1B6 horaciopfaffinger
661,125,831 *44276FA40341E26EED4E37F5448FDF6A6B216810 1iluvbeanie9
661,125,832 *44200E2328D658FC7C2DAAC750FA94BDBE514D1B howmedica3
661,125,833 *44202E2508D8AB6CA135DD0E0B7AE9096B490FBA 1-LEISTUNGSVOLUMENS
661,125,834 *442EDE5CB736B299D7E858910237EB4C9B9BDDE9 [email protected]
661,125,835 *442AC763F7616B08C82B9890A19BCCC3085CCCFB 1.menestysiskelmi
661,125,836 *4427F8EA6F970B118545AA8A2CCDD547FBD50186 1narcotiseerden
661,125,837 *442075FE15148EB1BEA47FD05137D48EB93D2AEA HUNERION
661,125,838 *4422A58DA6D440DDB5DA584EC8B2A568712D965D 1PEACE-KEEPING-KATEGORIEN
661,125,839 *44229FB98D020F7AC8D36AC123E46063CC7B0425 [email protected]!C$
661,125,840 *442012E615B5A207AD6FA1BE17085B3FF008212E i0^p
661,125,841 *44256084A0164E4CB81E3246D558A0159C72E2CB id&baa
661,125,842 *44208B8C6D41993A4140B713D3158C4D23C9A441 1-TENOVUONOON
661,125,843 *44260E8C5E5F746A385C87DD332E87FDDF81000D IFOUNDABRANDNEWLOVE
661,125,844 *44249D874F5D1CC662C98E33B9630C61DE6B4412 1.tietoverkkoasiantuntijakoulutusta
661,125,845 *4426B52485196CF0B5BBD3C1C324743B4B1AA74A IGNITION LZ
661,125,846 *442D0A250F8DC815A88DD5A3E9DFFE2EE12A4B7F 2199783 maaseudun.osaamisen.teemaryhm
661,125,847 *44293929C2F485106479DCB189DB55FEDC81C346 ilovekaren12001
661,125,848 *442CEBE4B33493B1AA356BC2C17880DB3596B2B4 23leitzinssaetze
661,125,849 *442A6816450ED204FC3890DA8825E9666C4938D1 2502557 suurimman osan mielest
661,125,850 *442B13A54A499DDBC311B53C56693314ED78982C 25071436
661,125,851 *44288536C4299285557DF4D8BAD6EF43AD3BCD5F IMIMOBILEDELOITTESTECHNOLOGYFAST
661,125,852 *442B23CA08F65CF943B09607CB77C4D24F56B8DF 25november1030
661,125,853 *4422502CD4A6BA037B7044FFF28B274BA626B2F3 278freddy
661,125,854 *44270DF4B1A49DEDB06AE6092A98C247E9073C3D INFIMAE
661,125,855 *442CFED3D2885477A10C08BB24FF92DAC04103C9 :-I.-OUVERTURE
661,125,856 *442EE6021BCAB9695688966E2C4B62F49F80D613 [email protected]
661,125,857 *442A3DA69222FF30700EFAD77E9D112247FC5949 2beech123
661,125,858 *44280693632916DC69A99BE8E6D44B1BDD00936A ISAIASBODREAU
661,125,859 *442251C75070E4EB3E23C251C059FA0AF2486815 2 GARTENBAUAMTS
661,125,860 *442AA015AA5C905D66F0C697C9564CD8231F2574 2 KAKSOISRAITEIDEN
661,125,861 *4425C931C906559352E7516797DC615C9B34F210 ivey123
661,125,862 *442FF8C0CCFEA356E18C33DC84AD3580649248A2 2.PALAMISKAASUT
661,125,863 *4424FCEDD9C36D0CC3E5D8B55948D06DD8B58019 ixia
661,125,864 *4422E72B4A6233FF788B7ADB5AC3FFA23B1C42F9 IZDATNO
661,125,865 *442E4D9298769319A630BD30B2BAC44D7D5FE454 [email protected]~0~o3b<
661,125,866 *442E2D3A1BB839CBFAA0833413AB86836C03CE8C 31761 DENAUFSTANDDERANSTAENDIGENSEHEICHNICHT
661,125,867 *442F53CEF15AAAF9A1236DC9475D6A04D458096F 322930 baygenelhizmetlisekonyaemnmUd
661,125,868 *442B072A24C1AB49FEF9AEC5A0094C0D6A07A34E 332WHATDOESTHEVIBRATIONFEELLIKE?
661,125,869 *442A5749F62F4CDC055F39C0A6E16CA24E2E2B20 jaladaued
661,125,870 *44289D77C85041E0E046D4A2BFBBD91C8EED9D85 383KGB
661,125,871 *442BE622BE190D135BEDB9BC81324860DC510272 3969 GLAUBT
661,125,872 *4426915028F5AFAF04B9141358B7B0E00CF18721 james.bond..astronaut?
661,125,873 *44213B574B71C033307E04B14FCC0C6EB10D335E 3anlasilabildigi
661,125,874 *4420F75FDD8C496661D5576F77E89893DDC6C5F2 JASON PATRICK WILSON
661,125,875 *442E494AD207ABB97D0573964554733C97D647E9 JATKUTTA
661,125,876 *4429B5CB68BBA136547B524CC4878AE1C43E3591 JCALINTAL
661,125,877 *44261F9367B2ECD78F7BD9BAA0482B4C0AD4FF0E 3THEDARK18
661,125,878 *442B85F6C0F95DE540C3D97E4867BA7A69C917A0 430eliezer
661,125,879 *442F568457839174463F284B6E3D8228BC7CD299 jeromeheern
661,125,880 *4425E877D5530554BCEB64C87BC2DEF0F5C10E04 jidamuhammed
661,125,881 *442AD2359134FDF91B940B29DE938784DDFB1FFB 4HEVSKIAN
661,125,882 *442B16C3C2DE90C9166001ACA58677A0CEB6F1D3 JIMMYPARRISH
661,125,883 *442B038038E32D75C2F5A79CF79BF288B23765E2 4KEYHORIZON
661,125,884 *44213E6B9878979A6E6B0141A27279BF84F81D4A 4OPETTELEMINEN
661,125,885 *442ABFCA39C1C8BE1563089670A882A919D3ED0F JOE.ITALIANO
661,125,886 *442C124542FA2D08FF1757778FC0590BD0194E10 JONAHCRESSY
661,125,887 *44233207779760F4827E66E84845DC671B3FC0E0 4VALUSNESS
661,125,888 *44290F7F2D47FFC6FC417F824BD2FE99B8A948F8 jonero21
661,125,889 *442A2AC24811C8CD4E4ABAEC25ED7F602907D1A9 583YOSELIN
661,125,890 *4427CDD3D5FC15A1FF6FF8DE4FF55B62AC9FDD9E JqL
661,125,891 *44282CCEAB20CA7493B4BFEE927F4C46A0A4C2D2 5BSWEXPEREICNEDBSW
661,125,892 *442EAB6831FDB361406B66A987F99DAC866F8FCC 5CHICERS
661,125,893 *4429B97ED3525BE321F8AE84C0CCC7722FECAC46 5COCACOLAOBIWAN
661,125,894 *4423802BA2B39D0A55A45A612CDADB8EBD947FD0 5CONSTRUTORAS
661,125,895 *442A1922FBA5A5A768671D84CA42475B11C7C503 5ENGRAVINGPRIMITIVE
661,125,896 *442835DB7EA8EDD5524B0868AC68DD9E717B61C0 5GASSIONS
661,125,897 *442EF7AC330B9DA7D2DFB204D3A1D15F14B018FB 5GEMITORE
661,125,898 *442DE09532EB26B6207EEA472BEFEE6F3907AFDA jupiterjosie
661,125,899 *4423499E5AAFDCD3E6CE5A3BCAB68832D6F143DB 5LACROSSEMONOPOLY
661,125,900 *442131CAEDA0C501CC24AADE420ABC042AC60143 5-maksimiajan
661,125,901 *44204D93A4F108D810DAE4B00040FD8325DA6AB0 5MONOHMERWN
661,125,902 *442A05C42237BC22DEFACEFB40AD68D4C4336037 KALANIMUSIC'-'KALANI
661,125,903 *442534DB74A70FF5BD1594DC298A3F0AE34C1CE7 5SARENOHP
661,125,904 *442C7837A1D51CDB19837B549C047B7FB7F58B36 karlyengo
661,125,905 *44235BA97D3B80C3B5024AF2774214138B8E80A6 5SHAURI
661,125,906 *442B99FDA3BA5CA5CA76973840632DD0B1404573 KASEY.KESEK
661,125,907 *442A17ECF07B6E404916DB0B5A24E7CFC33E4692 Kasha-no-wadachi
661,125,908 *442353486463606387FCF24DFDE502819BEBF489 5-torstai-iltap
661,125,909 *442B59CE4F36D462C3182CEF84C99E79D81C1C65 KBUGOBOY
661,125,910 *44262732F951A3122FEB13F0C4E19B484E183C73 5ZXCVBNMNIKI
661,125,911 *4423095EA0967842C7E1FC9225554BB3BC84A7A9 618952 TURK OTOLARENGOLOJI ARSIVI 27 ( 3 ) : 186-187 , 1989
661,125,912 *4423F5558F4031B92F706C003EBF156D54FDE5FA kelci
661,125,913 *442C98DC7513C94E8DA40B378F7B3D9B19CFB3B1 kerry-seers
661,125,914 *4420828EFFF8D4A3EE1773FE84784E576FB44E67 kheg
661,125,915 *442282753F5C4895F963C99AB5C5445FC90EF105 KickdaBallistic(featDestroyer)
661,125,916 *4420F4700D01E010F5096E4500EAE75FD8BE08EF 6incapaciousness
661,125,917 *4424FE02E6D4C5FE090344F7DF20B0FBA013D86B KIRSANOWKA
661,125,918 *44274E05E42A87AEA7083B86DF812C9B4F2D55C3 KOORDENS6
661,125,919 *442FC6F9129D8DEF2F2D20FA5BF612AA8651BCE4 „KRÄPPEL“
661,125,920 *4421B4A964A4C8E987091C6B5DB62B97A2185CD2 KRISBARRAGAN
661,125,921 *4423049B48C483A2D030548ED465E50CF3E4B0C8 KRYSTALMAREE
661,125,922 *442CBFD8B4426913A86D66793DDEE850EC09849F 7AUGUSTIDIOT
661,125,923 *442E07A5CE0CFF79D6DEA562789D2FE334466491 7BLEEKHEIDS
661,125,924 *442A872E2BD9B4AFAF26F1E85DCE004BFE904616 KUKLACHEV-CAT-THEATER
661,125,925 *4428F1ABF1CA7D9CC7DF7FAE8A386DB13EB71C03 kwp-
661,125,926 *442D52D51A3998D4422937A600BB21532CC88DD0 LACY.ULSETH
661,125,927 *4424FBA04CF1B0FA16FA7191B80C4AD529BEF7AF LA.FIN.DU.RETOUR.DE.LA.CHANSON
661,125,928 *4421C7DAF400577A49E91AB7988EEDA6449A2189 lake-river
661,125,929 *442060FEF1FBE5148CDC872CDB5A8E8C510ADEAE LAMBDABEANS
661,125,930 *4425A17F9F006B040240E5862CCCCAB4C845B570 leebaldyga
661,125,931 *44242C6BF5677398E890F15D15B12B29BF33371F lelandcallinan
661,125,932 *442AB65249F8B95648531820E842A6E1C7FA982F lenardprescod
661,125,933 *442E9DACEA067C5149DCB7AA4D9B8DA903C81250 lennydaisy
661,125,934 *4425119D8199F6881CEB041C1C6BD2C292C34F02 LENSTID9
661,125,935 *4422810AB38789CD5714C3CAF67ACF3208BD38C3 8COLORFFBACCESSING
661,125,936 *44273614C9808B7BAD8FC2B2EF8A9BAECDD0701B 8DIPSOMANES
661,125,937 *44247CD2955F46AC96F321EB2979DB9B1F56B80A 8ELEGARE
661,125,938 *44229BCB6222BCBBFD7874D5063E53818BAD7B34 8ENUAHYSSHED
661,125,939 *442A7B6241A8E9B334AAE08EF50152D08D35EC9E LETTHENUSICPLAY
661,125,940 *442A72E7F8AB8F2961F952F2A55DDFD8BDB3B4AA 8IDTRUNIT
661,125,941 *44292A3E55F7E20D9531C3CD94E9ADF737E90C09 lhx.
661,125,942 *4421DDF20E78690F77ECEED8211F59CB919B1100 LIBERTY~2001
661,125,943 *442C30D5243EEFFCE873684B46C16023149FA94A 8MONIQUESTEELERS
661,125,944 *442E6979F776F697A1C18CA6C0A08D5DE81AFDCC 8MYSKIPPY8
661,125,945 *44217F8E22B0DE911229723C9D85425D6B0DE80C 8######>-`~(O_-)
661,125,946 *4425661FFA806C8375858E48CAB8D4155F21840F }8{.o~(======B
661,125,947 *442EAD07EF93E9EA8686F555828765070797674C LINDAQWERTY
661,125,948 *442D9D361C417B5045E60DFD902D56A784281F21 [email protected]
661,125,949 *44209F7E43F0BACD3070F7453E102BFF0E8B9549 8TRAKTEKAFFEN
661,125,950 *4428CAFECD9421EDF4E63D75FEA392884AECE486 LLERIN,D795:11MEIN
661,125,951 *442238D78CF251FFFE7F508B3CF93184495376FC localsearchpower
661,125,952 *442EA39E82DDB2DA541279291A4CD5D696326059 LORD.VADER
661,125,953 *44241188B6C1AD3E3E23ACA4EE7FD2417777C3F8 Love-4-Sale
661,125,954 *44277FD23805D5C70AF77CF32B7B0CC8F48811F3 LOVELY CHA
661,125,955 *4426215DFFC03BE8CD9AB2E314ED3010AE21CE78 LPCHRMGN
661,125,956 *442464D1251AFDACF467AC9CF77EB9CB7B78EA2E 9iampenguin5
661,125,957 *442B1EFAEA79C5F23399CDEAD68475DCA5685F08 9JOINTUNIONUNITINGWELDWRIST
661,125,958 *442BE61A11D881C646661252666EBA481BC1822C 9JUL1290
661,125,959 *442307E804EEB48433B7EE1FB402222EE2CC4532 9MOTZKIBSW
661,125,960 *4427A5B47D67D24F3A300F679A66390B3317414F 9qtzo
661,125,961 *4423A589D85E1B2F5251F74F370DD1E339565B72 9RHEKREVKNAB
661,125,962 *44261B35182F3815A94B3B74B8116552F985E937 A15K9
661,125,963 *44202783C3352CC4BE234161C4EF173BF5A28D79 [email protected]
661,125,964 *442230C4010A348F716AF420F0EBC2167D1504B6 a991u7na7on
661,125,965 *4425681F349E36DA1FD6EED080F58A03571B7A53 [email protected]
661,125,966 *44225686ADAA5DCA29C3FFFC43E0E8D2712DAC62 mapmaker
661,125,967 *4421CB5EF24C99719D5F922B3576F6D9F70AE991 margaritohermus
661,125,968 *4421F18F1C7DD140B03D6C41DF984EC74CB17762 marianobrizuela
661,125,969 *442C078F8BB74EA97AC2F89CA7EA6446BD292C4C [email protected]
661,125,970 *442C1331215535B0EBD1F334218A19D7EA97711D abendstudiumed
661,125,971 *4429B5C123EC39612172FCFC346E9C1D79886D6A MARK-BOOZE
661,125,972 *442671891E4DD942F27AFA6182C4FC59D471D528 [email protected],
661,125,973 *442EDDBB673A9275BDF0F002D9E5513D323CE08D marlonwiedeman
661,125,974 *44215D8981B485B9A62205005BC8F350B3F9B098 marquislamonda
661,125,975 *442BAF48B9905C02840B34BC26F75353A0E11AD2 abp[h
661,125,976 *442B6FDE2F416F421FC5819E1E235C528989CAB6 marysimcock
661,125,977 *442D391836AA06DFE354D60B6B64A890F8631BE3 MASSIVE R&B, VOLUME 2: THE DIAMOND COLLECTION (DISC 2)
661,125,978 *44208E57C1482369F258562BF29AD870DFE8145D ACCINEER4
661,125,979 *4427EBE87880DAC970EEA0ADB08FD0DE20054294 ACWM5
661,125,980 *44282F9F10E0A7F3B1BF3D94D341B34FF1EF1440 [email protected]
661,125,981 *442DE3941E55933E5C167112B50FA50F29E65A0E MCOHOL
661,125,982 *442A36337C8F72E88B7A4F7ECD8B2EFCA44BBC50 MELANIE.GREW
661,125,983 *4424639961CD4E2CCE7ABC162C2106F99AA1C338 ADVQE
661,125,984 *4426DFCE36E9519583F2ED76F946E4F907F9ABC1 A:E5R
661,125,985 *4422582222EE87F4102EB22BED907DB4C0C48B53 michealleitten
661,125,986 *442E8016BD6F4820A6D449CE9812652453FBC81D micheledennis
661,125,987 *44247207A20D4037A605D4FEA388ABC9CC9F437D mike.dostert
661,125,988 *44289906DA0CF45737B3131B6EF211676A76447A a_h(r
661,125,989 *442128BF811C942871736838F56E13F28B904E45 AJIM
661,125,990 *4425DEE5E42A0F7F1B0E2EFD93875D3703BDDC1C AJT/
661,125,991 *442F6CFA511EAB5A0BE040AD0B53F7EBB0ECFC80 modestowentcell
661,125,992 *44266F2D5594950209B12EFDC36AB0F23E1263A4 MOHAMEDCLAIBORNE
661,125,993 *442C41D7D05A755598181EF6E443CBE3D1189981 ALEX.POULLION
661,125,994 *4424741D2431EBF859A2858A29F7A694002E2F0A MOHAMMADMCSORLEY
661,125,995 *442F585A123544A6F0A2FFBD1849821652D127F5 ALFK1
661,125,996 *442D24105F08077DD0F8675620127D76945EAFF9 ALGOKRESKEGON
661,125,997 *442C5B4B29B3B4999E64DC8CB9814D49B7E06CA7 MONIKA-NUNEZ
661,125,998 *44220C2DC4923887DDAABED505FFB157F89F9D98 [email protected]
661,125,999 *442A15EF9F2D571A884EA8660511F875EE780352 aliyah26
661,126,000 *4423F23BD7E4211374EFE4C7C7A4D85EFC81C72D AL!M%
661,126,001 *442672C55F2DA63AA904F52E8817196D0DFE052E ALPHONSE.DIMICK
661,126,002 *44257F3A1DC915A87BEAE07F52DA017DB04F74CA alphonsomcmulen
661,126,003 *442BF7AE6642A62CC5BB98F1137A5207EE0C8EBB MORPHEY8
661,126,004 *442F7DD7A602DE4FDA7AD932ACCDB626C4E3C5B7 ALTC
661,126,005 *442E5ED92C49523E2697618D509F88AD0FDECF06 alvakannas
661,126,006 *442833D503BCBC67DFDBC61726BCD6B53D48AEF3 [email protected]
661,126,007 *442C2D2A3DF9A1F5E1CB37584C87870A220CA1C4 MUKTAANS
661,126,008 *44232E9FE5B0951411126973AE462A330C9F9EE3 MURRAYVIVAR
661,126,009 *442E061ECE1EE0C18668FD348B6614D95EAE2D62 AMIEJOHNSTON
661,126,010 *442E8189475AF051BBF68BAFF0966414535122D1 am!p6
661,126,011 *4421341F2D36A8525BE7C039AC9E5366BBE4EF0E ANNI-PAJUNEN
661,126,012 *4425DD84C0EDB70ACAE306F2EF704F223D48EE4A [email protected]
661,126,013 *442F05FE351F63DABA681B1F218740E80297C06E nappingnapping
661,126,014 *442600B67FB71BCB8B10CA3BFBCF6F3DCD5D62B8 nedreeimlos
661,126,015 *4420D964811E4D327E324015ECDFB2683EAD54D9 NĚMSK
661,126,016 *442842888A096EDE1C802F6021C826462CAE4CD2 NEMSNIER1
661,126,017 *44224E93766453DE5125725C9C3EF5343D29140E AOLJK
661,126,018 *4427C4FB7A330BB4E803C73B1B17A15A93772534 AOO
661,126,019 *442D48E75B57E0B151655DC791E2AC0F62F4CD5A NEWBURGHCOORDINATES
661,126,020 *442FA52651485133DE3CCDC54CC14B8DBC371A00 APROESL
661,126,021 *4422E33110444B1BF2F1E5CC1A59E9328E5E35D9 apv?m
661,126,022 *442C33DC954568FA214ADB0009FFB5BB3D5CC98C noisnetxeoc
661,126,023 *442413B8D0733ECFCB4880F2FD6A66DC87935438 NORLIZA-YAHAYA
661,126,024 *4421E0E5242B0A84B1E0B9FBE291865F63C8F10C ARNER
661,126,025 *442D6E3D920DA85978D2E6F98CA1698BC5955A27 NSBINC
661,126,026 *4426A2E1E2EE69A5E81A5568BAA072F99B207EE9 nu7r!7!0usn3ss
661,126,027 *442FC7DC3E1D0718516EC7BF9B504A54097821FC NYARUBIA
661,126,028 *4423A11D284EED42E9BE84AED820889F9D21644D arx+g
661,126,029 *442D9A8EEB7F39139C1E6F5DF001DDFCFC947343 OAVAKRAT
661,126,030 *442E17FD6AC49E7FCF951339EE492E81A99E23A6 asprrimos
661,126,031 *442C52E4240D9705F9AFA70CF04A337A2D4B4826 }o{~-`-d======p
661,126,032 *4423EDF4EA373D465898B976FCC8F1DDCED7D7EC AUDIETCHELLSWORLDS06
661,126,033 *4428C9EB769AEE23B1B39D6495C958258C5DCBB3 augustuskero
661,126,034 *442A749D4BDBEA8B776DF8F1400E6D1BF3B62DC9 AURELIOREIGH
661,126,035 *442915BCD9023B4B720D4E4FBAD62B0D06AB896A [email protected]
661,126,036 *4427FC092D1C3D4AD8B2E109F618C9D68995158F oranssivastavallankumouksen
661,126,037 *4429935767828E400213CFDD91DBBF1BF62FA461 avfw5
661,126,038 *442D8666F73BDEED2AD604DED98E8CAFA97689D1 ax+
661,126,039 *442891295AE752CA9E76DC8F82037ED0EDCD8173 oudvaderlijk9
661,126,040 *442BDF13D46577657C57214378BE32124ED5214B overunionizing
661,126,041 *4429881281C61F21A93BC905EADAA127BB6C316E P3R53GU35LH3
661,126,042 *4422EFA44BDAC797F0B6CC7DF1AF957BA06EC30D b0vi
661,126,043 *44278699CA020002022DBA0F6A031297ED67204A B6VBB
661,126,044 *4425F82A6E5C33EA58383012F3DEFAB6A94B357D pbjrcwis
661,126,045 *442C255D77684684DA428218E4406B360A6F2301 BARKLAGE0
661,126,046 *4421167B58CB12E8BB28A0CF8F9533C957EA1110 PEKINESE
661,126,047 *44227C846D0FA9B870C85F6F6BDB3674A9044489 b=_b%
661,126,048 *44257C408B0AFA2183E4745615A6FC2D87FA1BCF bc%ey
661,126,049 *4420D75F84C04D8EEF16C23231077BB19364BBCE BCNA
661,126,050 *4424C3FC7BFA3B8A665F545F4339F041F105B081 piano-trouble
661,126,051 *4420A10819469546BE8DEF869BC94F5D16D68905 bd.~.~splat
661,126,052 *442023AFEB45667F439B3F3E00C873C2B0FBC828 beckraths
661,126,053 *44220A8E568B5A6B627FBA170BD376DAB83A9F42 BENZANTHRONE44-BIPHE
661,126,054 *4420F079D9931F2FA8350C13FDA86CDA848C814C berrybednarowicz
661,126,055 *442EB57D332A7AFF22E1BA0E415EE67E3D68F548 bertbungo
661,126,056 *442F87FBB191F861B32C88B790D6CDF03973D9D8 BERTRAM.CUREY
661,126,057 *44222DACFE458186AE66A2689451C12CA8259356 P->-~O-~O(0-0)
661,126,058 *4423D58B5FCE90C6D4E7F4158A19CFB02F19FC5A P------P~.SPLAT
661,126,059 *442FE64BFF3E13D3F073E58BAD8A81BD089DC3DE BIU!M
661,126,060 *442BA3F01D3294177C204FE396C4F225F0968CDA [email protected]
661,126,061 *442DFEFA2E60C223FFE3FDCD498FDA23079FD984 Q27666
661,126,062 *442CD2BB99EC115BEF980C321BCA538301D219A4 [email protected]
661,126,063 *442DD86E7DE5AA94CDFE48FB5205F9ED6440F952 [email protected]
661,126,064 *442A8E6BBBA14DFC55AAACCF81A6E666F8506A2A [email protected]
661,126,065 *4421F28F5BA85F2444601A95D22C323FA5E86C1A [email protected]
661,126,066 *442FA9C2066B059E7332922F7123EB64B4C32299 ~-~Q####P
661,126,067 *442E952884BC9096D71495C060075D882622D0C8 QP*{X}
661,126,068 *442817CC6417A8DD85893CC27570497314B29F3D blhr+
661,126,069 *442455C6BE92138999040CC608881674BD9D771F quininism?
661,126,070 *4424D3F3AA509E3E5D170ADD6072B5B3A197AEFF quotammo
661,126,071 *4420B60EDB68E5D7C016B33E2A099054579BED75 BNEFBSWED
661,126,072 *442C24D753382AC9FB94589777A7EC3E46F23520 [email protected]
661,126,073 *4421CD9807395DC3FB55DEEF95EB91795AFD29F3 BNMEN
661,126,074 *442030D4C568851995068CA763EE4A6AC280C7E2 ram8unc7!ousn3ss
661,126,075 *44267E23CD168FC992C81450D5DF84BA975DE393 RANDAL ZAHN
661,126,076 *4424533B4E4ADB8C997DE47D377BB2BFDE9E81F0 bokzu
661,126,077 *4429031070456892D44787334058087931596992 Rapsusklei & Hazhe Ag
661,126,078 *442A7ADAB44B0A604ED8F7D5BABBFB217D16EE50 BOOKERMAUTINO
661,126,079 *44267D8E550B0C3F097FF7D7B368BD869839930D [email protected]~O.~OSPLAT
661,126,080 *44262E2F91C4A4B5BE9673C8115A060EC246AFAA boyfriendtobe
661,126,081 *442012B95756B7CFF71C2E6EAF4F3AEFFA2131E9 REC17411$7
661,126,082 *44239CF3AFB9641D5AEA72B4B3B08D7544C71FBE [email protected]
661,126,083 *44242C5FF1652BB8E5DF7BBFB8A12CC7D9B1F3DF BRADFORD.MACIARELLO
661,126,084 *442192E572D5D1F25DC76DD3C6BB2AB65B0463B1 BRAGGEM0
661,126,085 *442B292E461C206472ADCDA99AD8F82A2D11111C RESTASSIMOED
661,126,086 *442A695E1E08D4FE43D6783B4A9F2324EE7865B1 BRITEJAMES
661,126,087 *4425478FEA98D7944DBBCD62355BF1F6FC130501 «brith
661,126,088 *442B49749A8A31F6FC6CB0D12E074E3D8A490D93 REYESBRERETON
661,126,089 *4421DA436F23539455F10B9BA774B901549D1802 r~;f
661,126,090 *442EE167A139CC7CA07ED533DB49CEC9425777B3 RHYTIDOIDEA
661,126,091 *4427FCA558746936244E78DDA3A1746A3AFD3249 richardpepple
661,126,092 *44277BE9CAC9DD151FDB8338BA14A594DA8D828B [email protected]
661,126,093 *44258A79CC37391A431438ACB3DD2C55B1694FBD rileyalles
661,126,094 *442E502D68B3F3BD63B6143165DF7A4FCB4AA75D BUH:U
661,126,095 *442E6B46BDB49E075DCE7D1EB4D7CE337D656801 bummels9
661,126,096 *442658DB46669CDE345E1E8B8045B079957BB8D8 ROBERT MCGEE
661,126,097 *4427724CC99899DC2F83E8D12353AC5B12057C30 robtdelreal
661,126,098 *442BB85F1144E6EF84C6C4932BB20C83D2C59F4D rock’n’halls
661,126,099 *442CF290B28D289B372EF29FF3C3AE52ADCA8C74 BVuI
661,126,100 *442727153E1CA81A362D4F9F52C222F504853958 RONNIEKUT
661,126,101 *44272198D7FE846162444F698822914F87E578B3 RONNIESONSTROEM
661,126,102 *442D7A9DA1D0D6D5912F9C03F4D5E80602DA4E7F B;XR6
661,126,103 *4423B4EC496C6A21289830A3302A262116FE5266 C2EVR
661,126,104 *442FD4A6AA3613947D989B65A75CF222D8C73B67 RUSL50
661,126,105 *442E829A754847E325E07D81C16BC3EDCD92F730 RUSTY.BAJKO
661,126,106 *442CE8BBB23189B3DDDC28CBB7A5984C2EC70698 RUSTYBESHEAR
661,126,107 *4426944A18E247C50EF49A9401595033509CC33B RUYUTOPIA4
661,126,108 *442DDB5518821F854CE232D8D9F8F73EA6CC0B42 RUZNOBAREVNYCHES
661,126,109 *442CDDA9802EE3B764AE9CDC22AD45D19E451597 RYAN-BEAVEN
661,126,110 *442842EDE44983CB450BD1D772A9B53E098B0299 C6%/
661,126,111 *442D64CBE1A6B5CF888AF2FA6E4F776499184B98 SAINT-CHRISTOPHE-DU-FOC
661,126,112 *442D893B8370487B3155072EC1A734CAE4671474 ca/ak
661,126,113 *442065BE0F1D4EC997F8C649F6135DCF75A6DF4E CĂLDĂRUŞAN
661,126,114 *4427788A4269DA3C033095CC6CC0F58E6638D464 [email protected]
661,126,115 *442F7DAB2A0CA2B82B5B45329811A6AD2D3C1623 SANTIAGOOHAIR
661,126,116 *4424D059216C041AFBF22351A4C07E895B43FE08 Campar
661,126,117 *442BF6B6EAC29A7EA9ACB180AF83DBFEB68B8645 canensn7
661,126,118 *44270C6BC5E6586CB9289E13861CB4748099538F [email protected]
661,126,119 *4425660AB7905811C7E73CCF345DF96DAC962310 CARBON!Z3D
661,126,120 *4426AC440C40F4A566390805CABD396048EEA48B CASCADDEN53
661,126,121 *4427B29C45E1D6F16FC36C7E68C0F720F6459BE2 [email protected]
661,126,122 *442D9B8EF62F35BF0B051C2063C820ED31FEB2FA SEAN.SHILLEH
661,126,123 *4425124EFE1165D9A0B7BDDFA394DC00444E441A SEIHPORTSYDOILOP
661,126,124 *442691147FC0FC961B43093FE82010E3BFCB12B8 CDBDG
661,126,125 *442FE13F5B92CF85E4097D31CD9E9E93B0692800 SELIMSULTAN
661,126,126 *4422EFC545EC5ECC6C13C2E89FCC6CEB73206D36 SGLCDYB
661,126,127 *44297FE58966D06CC9FAE015596AAF9E2174E093 SHARMARAMESH
661,126,128 *44266837715C2FE7A340896FD6C1A921C455FFC0 chadricketson
661,126,129 *442FECF9916D1EC60EDF2ABD086688A03626805D [email protected]
661,126,130 *442A17D453E6AE953E00F5F73065FAD51F746C92 [email protected]
661,126,131 *442E1C836741FC6952F4C9DE78862CE60EDA842F [email protected]
661,126,132 *442294841886AFB5D2A43CDB2C786A5E3FD5D121 shing.yin
661,126,133 *44202407DA64D02792636243EE6E9612B2C43B36 SHIRLEYREDWINE
661,126,134 *44213507A182638F40115F7640B3D9D62CDDE152 chasbalash
661,126,135 *442CC0ED04BA0A645F3963F028A39F16CA443AF3 SIGNAUX.
661,126,136 *442056BC13E0231F97FD93748372835889D3B5A4 [email protected]
661,126,137 *4427D2604D179BBED2530CF04E0844BC9F0DC80A CHILCOTE’’
661,126,138 *44275F5431A68DFEE902E52786FF6948908039A7 CHONGSOOKWEI
661,126,139 *4428D91F5A24F0464D4834C8115B43C2DC766F5A SLUZBENA1
661,126,140 *442BC646190A857B2BFA45C685190E42A37E5405 SNEPPOKEGAP
661,126,141 *442A6BDC6DEE332823F4BED845BC457F8B8376D2 chugwate0
661,126,142 *4426ECE1E19F979DF9D5D244B92230BA09E66778 SOUMISSIONNERONSES1
661,126,143 *442930CBBA4C7C4F27946E3BA128C4F4CDA7C62B CLAY.TISI
661,126,144 *4426ECFFACBA4C636C79A83393E1B1608389C5BC CLETUSFELTES
661,126,145 *442A0A5FDD4DA5B9F2970235AACD38F299467CC4 CLETUS.NOWICK
661,126,146 *442F1741DE56F497E03217E37C2F44B51B404B93 CLINTONQUILLMAN
661,126,147 *442AB1CEAA9EA0CFB99C62C996308D04DC3511D4 clubauditioncomphwww
661,126,148 *442881E67967E39A9703B45269EFBD2CC67D9F6E clyderuthven
661,126,149 *442FEF329EAA5639FA53C1F2AC4349AC866AA203 CMVS8
661,126,150 *442E6730F319B7A5BAA519ECAA03B0032A8B84E2 [email protected]
661,126,151 *442908948A7D61145D76E31C9C24E996803359B3 SPRYNCLYNG1
661,126,152 *442C46C14922847DFD3392CE3EA4BF4860047D45 COLLIN.KARTY
661,126,153 *4421041717DBBC625C080D4F1C1F8F0CAA40D483 COLLISON123
661,126,154 *44248905250000A5B2B6475A60AE4A078EA90B59 STANKASS
661,126,155 *442EB3130952E242FFE46E900B57DE3E2533FEB8 CORLIONE
661,126,156 *442E3F2B6D3DE276A5A87C9AAB465B90D8E8D14C cov0f
661,126,157 *44200FCDA0CB6E3B4BAC153AE2334E95C86276F8 cpfdi
661,126,158 *442D877379F7CF0CDE8A5B51A951701E42AAE25F STUPIDDEEPINDOORS
661,126,159 *442EA4F80580439FB3A65D9CB9A8D374CA6F0DC2 CPU_I
661,126,160 *44257EECF00EBDF80E626BA522D7933D6CE42B2D SUOMI MARSSII
661,126,161 *4422D4D38FB28A5FB20DEA1BC1E353E7DD6E5CA2 CR-QS
661,126,162 *442BF9282AC16DA7407EB5D8BB0F504C290DAAC9 Systek500
661,126,163 *4426D62127C1ABF2DD0C1B0874FBBC3BC4A25B22 CS!9:
661,126,164 *442D7049C32B5F3C88CF0181D2FB11B4AB76F8D1 CT6BO
661,126,165 *442BA00B7E29293287AC7436E6CBAF78F52E07A7 tankauto9
661,126,166 *442AF6A119B5EBD4E97A33C5563E934628115FBB @m
661,126,167 *4427EAAA588B707D19F9568408F227B96F075F57 pd
661,126,168 *442B17E0F482D68647232E2D8122A7CB80A36B58 ` D
661,126,169 *442D724DA23EB0AA7C72C20B02BE1438A251C2C6 TDEWJMYQ
661,126,170 *4425BC2F774C994955DF39D94155C94E4E33371D 6
661,126,171 *4428D145602B6106D3274E43088668FA2DD765E6 TELEVISIOLAEHETYKSIAE3
661,126,172 *44286DF64946D314CEFFF4F0A325A54FE60B2C24
661,126,173 *442647A6C3E6C201AF3DE647923C9D386B30091F TERESA-RUBINCHAK
661,126,174 *442538A3AFE1539898C030376897AEF225210961 term1n01091sts
661,126,175 *4426BB4207606FF1F51BFE37C7393C191F22D1B7 tescher9
661,126,176 *44241561816F55C6ED909AFDF6C3DEB87114950E
661,126,177 *442C95D23FE5D4980FDE6FB596C3BAD2D1815107 TETRAHALOGENAŢI
661,126,178 *442B14E08DF4AB5EB481F3188638B867F94D4622 TEUFLISCHER ENGEL
661,126,179 *442D441699550108835BD9439242391964949C3D
661,126,180 *4426B795BA9C745D4FBBEAF014F56FE7449A3451 
661,126,181 *442F6AB02723E3BF2155094B44CD21BBF8251CB1
661,126,182 *442E0605FD215592B66FB35033F85ECEE3E4A507 ]6
661,126,183 *44285B5D3DFF64DDC900A66E684F4E7E50A52D21
661,126,184 *442DF633B2A945A1A01297263FFA62F517A9FDDA
661,126,185 *44275B4F847FF07ACD36F3B24C619008DFE7A762
661,126,186 *442FC2EB0B57E18301D6D6131BA1EDC2738DAA4C
661,126,187 *44245B6E04502623FCC4FA94FC95269A0C6A267E Ź(t
661,126,188 *4421713F7BA69480F093E91FA4886644A1E55ADF THE ESSENCE OF IT (DIMA REMIX)
661,126,189 *442242FCC24629D61CA569186FC15A1B32D7820E s\N
661,126,190 *442A227D07D7C7C432302CDB9891DBDD4C1FA9C6 THEOTHERSIDEOFMIDNIGHT:NOELLE'STHEME
661,126,191 *442EB9777DC060C52C2E692CDA53F5489C12DF44
661,126,192 *4422918CCE830B6DA396AA34830D2BEF370F28C6 !c
661,126,193 *442272565AA8786C737E67FAD981D96DBE970636
661,126,194 *442D1E5025C72EEE510FB3E4BCAC5056CB50A03C h
661,126,195 *442CC7BC8B4AFC0E078065A34DB345E50B00070E
661,126,196 *44279F8DC131F1C85F628AC84297FB82A6695908
661,126,197 *44264D6D53B08B76B578C4483249C8CD1ED02F10
661,126,198 *44296A3B0683351228D6F8CCCCCE87799BDD8B5A THURMANMIDGLEY
661,126,199 *442E9CF1F3633D87ED8C7380F718220DC0519793 THURMANSCHMUHL
661,126,200 *44258B2C93C80B142F13DF0A21D0B1720A76369D TIGITTYP
661,126,201 *44259FFE05E183B72FAB0132C4943D6F96CA108F time-and-motion-(b)
661,126,202 *442481D411AD2401EAFF528E429238213831F056 TIOSITUU0
661,126,203 *442085AC260A117148AC53962447AC5199648EAA Z
661,126,204 *44226D29061FA4AE7EE52159881E526C9A3217D3
661,126,205 *442E5F33908EA5126A89F100FCB623EF018D4306 sDW
661,126,206 *4423AE866D1CA77910F07EFCC6AA408858DA7465 Z
661,126,207 *442E34402DFBF5056FC60A12D4152C06A238AEED TNEIARIPUOS4
661,126,208 *442691B7C782D650A5B668962B961E4E9810BFF4 TNENIEP1
661,126,209 *4423AD64FBAC098EAE61FFB5B4312E82C3A2D62E
661,126,210 *442ECC338AE38940F19B0211C795B62DFBC57AE0 TOBYMIMI7
661,126,211 *442EE62EBA7A058AA6C7238A40C2819E9B950A4D 2ƣ-
661,126,212 *44289E4437280C2B61A14D24477AC2918A1A462B +
661,126,213 *44262525E54C736499669673824F6D481C8FE9A9
661,126,214 *4422390D8BB17B42B6FDBC79FAE362AED22F49E4 
661,126,215 *4425532E4AF6893380CFC17174CA3E0C8F8A53E3 W
661,126,216 *4420F10F14AA916CC40FB38FE604CCAE68D0ADD7 kj"bd
661,126,217 *4426C5C6AD2E744CF1F99F28BBB03D6AA4F33B11 R(
661,126,218 *4424B9186B8CBA8FEC6623A61E10D43E0E033C4B
661,126,219 *4427F6635ECBA81D01262539A63AA3ED00D55BAB #z
661,126,220 *442AC6CF445488B73100B9BEF065D6077DB71B6C
661,126,221 *4420A7A380F53CABBFA92E6E74AEE4C2A7A2B19C ?\@L
661,126,222 *442926BC6DF7C9341BBA1C4F3F8E561832A20433
661,126,223 *442DC5A68949D4D0A549566E6A08B07DFD8774EB TOSLIMDEWAN
661,126,224 *4426F3C94DEDD1FDD89BFCE26AA0C7667441648B TRA5OGNATO
661,126,225 *442A3B8C0EA1EAF823621442168955074D7D611C tracy.plahitko
661,126,226 *4426CC17087434798B395C3348885073F7D3B7D2 TRAVISGEORGEHOEHN
661,126,227 *4426ACAFA8E5039FB6559B52393C8B734BBF3867 TRENTON.TINUCCI
661,126,228 *442BBC27E6D0F392C3C2608FE587B06BE1E93A56 [email protected]
661,126,229 *4422557E36563B321C943DD8C1DFC56BD4926676 TRINDADE-2-0
661,126,230 *442E4BBA3C16A6DF3635DFEAFF7B3EDD7C180B29 Trio-No.-3:-III.-Polonaise
661,126,231 *442DB79FB9E364D66F1099A4CF78A7084F479AD2 TROMMLEREN
661,126,232 *442315DE2F05752C2E31141A6D6F35E096E0DB38 TRWKBB
661,126,233 *44236D931B475AE98E92328DF2976179DBA652B8 0958yy
661,126,234 *442FECEA969AC3BB3ADD502E50F0C911399631B2 TWSSEP10
661,126,235 *442F49E7CDEDDD0DA216F7FC66BAE541812965D3 TYCE WUESTHOFF
661,126,236 *44220F9C107710837EB20B01D4212A1EFDAD3A70 TYRIKE-SHELLZ-COLEMAN
661,126,237 *4426EF8CF5D476F73ECBC1B6B8968CA4B38D16A9 UERTANTUR4
661,126,238 *4429BB594DCF994FCAAD8C957D16C3C6FDCC46AD 134 SAHIPTI
661,126,239 *442E196B56772B02ED81175E2F5E0C72E2A70CCA ufrriehd
661,126,240 *442B78B81B40E83F5BF48A8F32AB1EFCD06853B7 UN$4LT4TO
661,126,241 *44256141D4EAC1FE669A1D97C00B498FFB189C1E URBONE
661,126,242 *4422E31CCC27A077CE5C181EC269B62C2F0AC2DE urmydestinyzylley
661,126,243 *44235679607E996FDE45D024F7186A3BFA700A6A 1AKANESI
661,126,244 *442CE480854A54FBF9D154A8379B29455DB35ECE UTOPIACOOPER
661,126,245 *442A8175A9663B1FFB36F6A6D38986E8226762C7 1 biophotonen
661,126,246 *442889DDF47DB06D4D315CA701F363ACC8A79798 VALENTIN.BALM
661,126,247 *4425D03E2F8C823E307BD5B511C3C6B182752D0F VALENTIN.CHATAMPAYA
661,126,248 *442018400C73A8EA77B416E1CE08085F9D2EC84E 1 DJINDJICPARTEI
661,126,249 *442172E98CCAA7A5C75EC19BF32CE43F9490BE9E valomernik
661,126,250 *442A8C683C3B9B38CF9CE3D4276F92994B754773 VANCE.BLAICH
661,126,251 *4423621E0242920AD68B331D6DB73633E3E67E01 1ERTRAGSNEUTRALES
661,126,252 *4427D57EF6FCD2728707EE41CB2FBC2842F89C22 VARYINGSES4
661,126,253 *442140FE93F0F4D7018F416F18620DBCEBA9BF2C VCHUAJOURNEY
661,126,254 *442892374EC350BDC89EA92D798388D27D6931A1 VEJSI
661,126,255 *442EDE8CEE1C8A191477214FC987AB81D7B01920 verlag初版于德国。英语译本由frederick
661,126,256 *4429AEEF0920639BDC8818553E1DDB38083AB836 1-kostentrend
661,126,257 *4422EF0A0613C4FCC08A558D36D994C7C769247C VERONICARODRIGUEZRAMOS
661,126,258 *4424931161ABC4BECA7CA13BDC2E1DEEC5490523 VERSCHRIKKELIJKSTE7
661,126,259 *44283E6B686249D605EF6042CCF0C6571A55E70E 1osaaikalis
661,126,260 *442A3F54F090DAFAC46DD32E56B33C8B8317548F vhan.eduard.flora
661,126,261 *442323BACA45446F2286B6ECFB20B822E3AA5609 1reflip
661,126,262 *4427F0119ECE18B2ED943347B609D98CCC7DB9D8 1 SANDERPLATZ
661,126,263 *4428E938FD5411853C561376169F302DEFB24F83 1.SCHELDELANDSCHAFT
661,126,264 *442CCF748EDE75BCDED43B7BC7561222FF5BDE73 1 seiv
661,126,265 *442DE4C2621B6F93527F342271D8DDC127CD9ACD vijayalakshmi.gopal
661,126,266 *442EAC3A5B183BA5E2324CA57C2C1E1BACFF0A82 VIKINGESKIPSMUSEET
661,126,267 *4428628B30D68E980BF2593AF1B8AD632ED17F6E VINCENTAYKROID
661,126,268 *4422675CD5CBF317B88142197EA3C274EA77E555 1.vip-ihmisille
661,126,269 *442D86527C00705CFD5BC44BA6DA14B5817BA0EA VINGESUSENES
661,126,270 *442EFDB7DD3C78BB8447AB265043AFBCCA3E8BB5 VIRGIL.BUTTERS
661,126,271 *442E3F672A75EF12A3DE0E1682D8EDC011C5EF9D VIRGILIO.HAERTEL
661,126,272 *44212E11FCA07E88032867588D9574EAC9F53B6F 2006882 ZUDEMRUEGTESIEDENDIW-CHEFHARSCH.
661,126,273 *4426947F0EBF0EA93BA4C3F5F4A216803175C737 20trilingual
661,126,274 *4425D06C47DE300F6010488637AE0ACAA97D430F [email protected]
661,126,275 *44212747E099B38C06BEF89AF5F9A3AA3E095A39 VLOEIBOEK
661,126,276 *4420E5028C7301203EC2DFFB6A5F651EB0A1AFF4 267239 GERCI BU DA , ISLAMIYETIN ESASLARINA AYKIRI IDI .
661,126,277 *44275F2E2E42B4BC2D04188A84339E5BC48CB090 2720800 VALTIONEUVOSTO TEKI 4.3 . 1999 PERIAATEP
661,126,278 *442EC8C73AD0C618C601644BC223F3221675B2B1 29august1702
661,126,279 *4424D1F6E47F4A7953FF6C6001E9A0628A4B1898 WAHYUNINGSIHTRIHERMANI
661,126,280 *442174A89E7486C6B4169595E2F9310385BBEC0C 2fnissen
661,126,281 *44269A30194A124EE541EC500A86921CF70ADDA2 WALEEDJAWAD
661,126,282 *4420207F23A99B9338A5A211BB06D7C61C71B230 [email protected]
661,126,283 *4422551A3EF233041A43DD539D6856CB95FE6872 [email protected]
661,126,284 *44270A0945CCA03D3E5938C112E8EC0A0B5CA415 2.MAULIGEN
661,126,285 *442584D017DA52B8F598C759026A2757B4443E86 2sbahnfahrgast
661,126,286 *442EB58A63EE4B4D67112971C93950E436BEE03A WARREN-LIMJUCO
661,126,287 *442B3C27C98959A438A5BA4EB8B7A9058AE85160 2-SYYLLISYYDENTUNTOA
661,126,288 *44294D0A09182D456E8A20EF94B09CA07E883C39 2-tavallise
661,126,289 *442AA48B7D24BA17068CC2AFAC0938FE4183D308 WATPRASINGHCRUBOSOTHPRASINGHREPLICABLACKANDGOLD
661,126,290 *442A55CF2CAA8160C575BDA2A6A69DDDFF2DA96C wckrwrkd9
661,126,291 *44291EF2DF596F3E4B4F567EBAF5E7BC63CBEE69 webtidecom
661,126,292 *4424B529EA373210C0AA96D74686961BDA0D2D0B 3----D~0-)O(
661,126,293 *442B3C495F3E521E327E4A5BD94F99AA05549375 WEITLINGSTRAßE
661,126,294 *442F731AC87B4200A5217A8ABECA001A1D0BAB0D WE'LL NEVER BE THE SAME AGAIN (SONG)
661,126,295 *442FE77112166A2736DC551621A865E5120AAB2E 3FLUCHST
661,126,296 *44233FE60DE23530521107C28FE58F35DC627C6B 3IAMKALI2
661,126,297 *4423D2C06B94E3E845D757A6F88E310139F97932 3-koschewin
661,126,298 *442775892F0DBCFEE9743FC12897F7C1A6789295 3======>~O}O{
661,126,299 *442DD6E11A7F636CA9497C216E9B614D81828952 3####p*splat!
661,126,300 *442D23C411D81DF5393B8C8AF3094D5AE7E60D27 448204 erken tani ile 4 kisiden 3'u kurtarilabilmektedir .
661,126,301 *44266685E975D45818FEF7F0794A01F99E67AAC7 467caitlin
661,126,302 *4427DCBEFEF1C3F528406A289DF5D6DCC8834212 wilfredoishibashi
661,126,303 *4426AB76F04F57CD28375EAD0BC04D843F529726 4ICINGSICINGS
661,126,304 *4423DCD34AA2B3DC6A9EC180996127FB60F50686 4ITACECCA
661,126,305 *442F5DACFB0AACAA51976EBADE7FF67CD50669EA 4ITOIHCSI
661,126,306 *44276B6046D57360BBCD6B8E357AE7F33CF58BF7 4JASMINSTARGATE
661,126,307 *442E65C92BB1267BDC1AD0A06A0F89D48724BE67 4MATRIXCOLLEGE
661,126,308 *4425940E0765AD50A9EBEEB2C6761F8F623E561F 4MOMENTSMUSICAUX,OP.84:MODERATOEGRAZIOSO
661,126,309 *4421F4C107DF0B610B4F6CB8D08CD8866FC89D4C WILMER.EGLINTON
661,126,310 *442956963A181BFFF86B78692764F58716EB8866 WILSONCAMINITI
661,126,311 *44225095E06F6292FE8E3E58F07DDD13A897CAC2 WILYYLIW7
661,126,312 *4420783EB408B93941794A815B27B8B4AF66082A winstonzacate
661,126,313 *442522026EE0A2EF95CAA948A164641118AE8B1A WINTERTIME-ENDING
661,126,314 *442B81C7339E3A5063058EE44CDAE1703488A237 4SEZINGOCERERP
661,126,315 *44292DA9D13E8EC431D950D3A205458856D76DE2 WOLF3DISH
661,126,316 *442F2E13B7094A6D76C807FED622320D92955AB0 woodville-celebration
661,126,317 *442AF81C3D10046F7964F83B7E6696A2072AC694 WORLD.678
661,126,318 *44259CF13ECF9D0D8916E9F7837C252109E65857 4YBQEYXTMBNSF
661,126,319 *4421F0286C0972643F09BBA5CEEBBF0AB2942BF6 w;=s
661,126,320 *442438D1ECDA97B18280A7C558772ADF4174CF16 542molly
661,126,321 *44259D507320187F4DA62E006F5B3C8EB58E9C06 5AIRHEADPRINCE
661,126,322 *4427DFCCF73F95B2BD557C2267C49CB7428E35A4 WWWODIUMGUILDNET
661,126,323 *442D26399E59622665C1E9B6ACF894017D7459CE WWWROBOTMESTITECH
661,126,324 *44232F83D4505661B292497BAB2C9507B6DC13D0 5CARNIFYING
661,126,325 *442CA268C02722F2AB1D313092258AA7226F8354 wybxoepv39
661,126,326 *4420C5BF387D6DE3D0A2B02DDD0941E061844085 5-evresidir
661,126,327 *4429952B3CBB7E1B1EA150A995CAD0663C3E08A2 )X( ~ DB
661,126,328 *44248D446F32AC1CCD791936A3BABE83394A68A1 xsmdxjd7cb27rbfn
661,126,329 *44273EA010E45D2316E93DEC7D7C7890E9682000 XUETNEMACID7
661,126,330 *442C6019359772623EBF436839D000FF95549AAC Y(;3
661,126,331 *4428F61E960E85CDD8402C59C641968202298C01 YANTIE.ANTONIO
661,126,332 *442878ED4364810B8DB2EC1DDBF387680D3764C4 YARDSLINGS3
661,126,333 *4422F1F1FBB843EB869695937B7479085A3AAADD Y_DT
661,126,334 *44299F5A8D24F7658BE06F562211DB1C85A15697 [email protected]
661,126,335 *442A75C451D26A58CBD471736A7E4E14530CA9EC YLDESIVDANI9
661,126,336 *44294DCFB6CE71AB6A7BBC2514A3263FB76FE824 YOAN.DIMOV
661,126,337 *44219E805643AF1F38D4ADA465FE49E245D3EFAA yodoyaba9
661,126,338 *442950EF7372919AB1DBD94D87032122204D0E6B YUS160ESP
661,126,339 *442678DE082B8A1773B61FAA7F3630B4E568D27B YVETTELEYVA
661,126,340 *442DBECD8C4136D07F016074BFBA043D639971BE [email protected]
661,126,341 *442BC1BA8472B6487B3E8C28C81D62DD8068D27B Z63916
661,126,342 *4428551F12282776539788480B43B4FABEEBE656 zachariahscheide
661,126,343 *442F1DC199C27D3761572F44371EB941831170D9 ZACKOO ABDO
661,126,344 *4420C8A937A23CF44E7C0F864C2E2B635EE0B5BE 5YODADATABASE
661,126,345 *4424F1C584623B9483EF45D93F1E103F78603617 ŽAVIUOS
661,126,346 *442DE8EB386AC0A21B176FC81361E45839B8CB4B [email protected]
661,126,347 *4422EF166EC0027E1BF4046E1EA239C1903705FA ZFOKAL
661,126,348 *4421FCD4C533067E10BA5E2951B35C3E9164E98B [email protected]
661,126,349 *4425F7878502F043D34183C6BD11DACD6A5DB3AE [email protected]
661,126,350 *44216D2DD66F4E543636325DEE8B05AA707D7F3A ZLX&
661,126,351 *442DC0B369EB2C7C9312F79224163C33C02112AE 6ASCHELERE
661,126,352 *44241BC3D8C561C3D1B640E47808F4BD6BEE464F 6CAVACOS
661,126,353 *442E6A8172A6DEF3C112758C352E8E83B35069CD 6CHRISTOPWESTERN
661,126,354 *442EAA090FC4B69704E15DA77C45123C62153CFD ΕΠΙΜΕΛΗΘΕΊΤΕ
661,126,355 *442BFEE6A917E19B17294CCF3E85DED6B6EF17D1 ΜΑΝΤΖΑΚΑΒΆΛΛΟ
661,126,356 *442785AC3145C89947FB7AB935E914AF62829F0B апотропеен
661,126,357 *442E00EDAA28CA9C426B9D97C368D584DBEE308D залца
661,126,358 *4425EB5F7FDF75847B6FCB678C756D7A47A4E675 кенжетайұлы́
661,126,359 *442FEF99BF99F89A33D491EF0E2BF44FDF0B1790 МАВЛИН
661,126,360 *44276D61B93B00D8F4AE95A57770C8ECE0B81810 6PETESPRACTICELAYOUT
661,126,361 *44257DAB1868031F72F7DAD9DEAC4B70F52F3793 МОБИТОКС
661,126,362 *442904D2C95CFAD67CD8DEC89D6363B259C7AF3D 6PSYCHEDELICSHOW
661,126,363 *4428AC803F3AAA5DFBF79287409DF783D2B47E56 6-RAJOITUKSIEN
661,126,364 *442CC855B62EB224A0F379C8FD7B3F0DEC37422D 6SHIROME
661,126,365 *4428B8D4C59AA28C899C8BA8A5DAF6294EAD76BA «ПЕСЬНЯРЫ»
661,126,366 *442CCAEB786FF85B50FF1C261D106195C43DE852 “ПОТУЖНІ
661,126,367 *44270A4C38FDC2B5E32DBD2C30617931BA8DA1AB склографічна
661,126,368 *4426CF8CF2A94AAEB671C7F3F449E84ED4FFCFC6 ШЛЕЙССГЕЙМ
661,126,369 *44290EFAD84A65073D16A731B4172E4B0BB99799 7FOURGROUP
661,126,370 *4426549D4AB6E5942A2B6C893820E39D9A9F6E9B 7MARKETFENDER
661,126,371 *44222178F453A22BF07F194F79E61938E913CD88 7MEGAVIXENSBSW
661,126,372 *442B8CBF06F177E23E49294D4C2D5DE8AEDC9E67 7NISSANNASCAR
661,126,373 *4423F8954A3D862B2F0722FA7BCD49A984F44406 7SEVERBOT
661,126,374 *4423E8983924202F1CF3D38D08F10B63445B936F (~_^)*-*-*-<======8
661,126,375 *44269B09ECE6990B1BFB9ACDE3139E8ACA13FBE2 841405 istihkamin icine kac defa bomba dusmustu
661,126,376 *442F82E437CCEC7E67AB60E7E1F4EC5835331DDF 84-DARMSTADTS
661,126,377 *44289F375B4FE36F838CB2F63C9C95EEF64E3096 859648 S
661,126,378 *442DDAD99D4A42A16CB284726F96EBC3B84497D1 888243 aber-nur-annaehern-.
661,126,379 *44235C9AA33CB8B344D3AF4708DA29DF622B00EB 8CHERRYCHURCH
661,126,380 *4424C794F9D87A7DDA113C3DDBC03BA177331C8E 8##D `~ `~Splat
661,126,381 *4429F1D0F9F8BB25DA458E53BD73F4CF28312DB7 8ELECTORAALS
661,126,382 *4426D81886CC9F1A711DD4B45A3766F255EBC4D8 8ETOWAHHAWOTE
661,126,383 *442C0289153F0FE3C4802691817A0A760258719D 8.LOMARAHAN
661,126,384 *4429DAEF9EE1F9144DACB2AC86090B971DF896A7 是英国bae系统公司制造的单引擎高级喷气式教练机,于1974年首次飞行。鹰式教练机用于装备
661,126,385 *442E890D67E1D8320B3771BAE93BA43C9EE12CD4 由於SKY
661,126,386 *4425D1219CF8B24B2D92F7F2CD0A5C46155B60C0 8ZMIPFDDCDYRAD
661,126,387 *4425EBA8370D155A8C8D8A8C8DBB5A3E3FD5100D 90QUATTR
661,126,388 *442061ED03D94DC28DAF7536E38316EE24EB9C9B 9DECALKCE
661,126,389 *442BCBB4688896168A71999232AE222D3181FCBE 9DISTRIHERBSW
661,126,390 *4425F5A9393049B4927551DE525AE0CACF0EBBA6 9HAMHSUOB
661,126,391 *442E381F4486FC9F14196B3A1D5E2A465E714F9F 9ISABELLEBENSON
661,126,392 *442886E630DB230B4FA7357136CB0390808E99C0 9LISSYNNIST
661,126,393 *4421F06F3A0AFDA55670EF67462CC11DC2C167CC 9peter19
661,126,394 *442A3C33953E294F7B1FD9D8E2782FBF5F86327E 9SKJNPTB
661,126,395 *442D3E039726EB0F5236B42090D5FC3EA09431BA 9SLIJKTST
661,126,396 *4425BF4033B70E9543539682965B57F6C432BE10 9THESPIRIT8
661,126,397 *4425950E028F523548E8A02DC7A3C6ABB81540CF 036sheldon
661,126,398 *442EC0D410D4E3971D22610AEDFA60BE9E35B066 aac~%x
661,126,399 *44202F2B3274618D6DF795545F4AD34A3BCEF32A aae%-r
661,126,400 *4420CA52DEE8DCF4BCE6EBD0D9BC2A9CE4A9A3EB 10.MOT
661,126,401 *44218950018785088DEE3EBE0B8AACD130BD91C9 10UN93R
661,126,402 *4427DDCA83F4958140CBF5924885EFC068F1BD5F 1129301 TESTIN HINTA ON 84 EUROA .
661,126,403 *442A0F4A375CDD7B86D934A960ACB2DA74AA9621 1191399 kinder-von-heute-leben-ja-ganz-anders-.
661,126,404 *442B7650D28CE1C973BA02941927EE938A5AEE9A 127.stil.(feat..sabo)
661,126,405 *4422C8D805C840AB69479437EB3667193A3947A5 abcdmarley
661,126,406 *442EBD12381B73547B649E85997EC52B2CEE30A1 [email protected]
661,126,407 *442DDDDBDC115445A14B970D28580EE58145B43A ABEHUDGEONS
661,126,408 *442197E91A0927F6904CFA686C0A268D6267C486 ABFH6
661,126,409 *44273307229672E29EB6D880A705D132467022BA 143-alabama's
661,126,410 *4429D506F5ADEA55888BFCE2B380504973C7F68C ABSOLUUTN
661,126,411 *4429E0755C4203F936315B66B822B45A17E868E7 acadukbsws
661,126,412 *44275EAC3705477819C64C1717879BA9E5FBD04E ACCEDINGTHETHRONEOFDEVASTATION
661,126,413 *44293160DFE00E0CCE2200832D35BEF6A158A3D2 ADAMZIGGY3
661,126,414 *442F2D2B959FD87C883BC5954FBF0C3BC4A2E5E1 1b8d016ebbcb36098b54387cec35ce52
661,126,415 *442703DC7BD06EAD29F9F817EBC1A539744E72F3 1BERLIININ-VIERAILUSTA
661,126,416 *4425ABB015054FC54435F23FEBA4490A56ACEB22 1.cabaladigim
661,126,417 *442AC05976ADA6B64F5D825F05D231C64BE74065 ADVLS
661,126,418 *4429EDA5A37419444EFD31B1A7E731728E146FC6 A#E;&
661,126,419 *442C1485ED6D7ABCE4CA402A10E3353C884169AA AFX?G
661,126,420 *442B6589C6BE0B93289C6FF9367345B1C6ECD8AA 1-ITSEPALVELUHAKUA
661,126,421 *442D90C93BE0B8ABE5A100F506FC06C1C634A9E7 1-jewson's
661,126,422 *44211B29C024C23CCA1C07FB53D84E3CB42E9C8E ah1"v
661,126,423 *442F691D7BB0E48ADAF8019D08FF2B443FFAD87F AH"EL
661,126,424 *442311FC81741C075C08DB2AD53AD9BB1ABBD8C4 [email protected]
661,126,425 *442EAE95058778459F23E7093083A3E1A0415D47 1PARFUEM-FLASCHEN
661,126,426 *442567FA52FB85607F437BEBBAE6E362B75C69E0 AKANAWING
661,126,427 *442A38A670A1A83FEA977A6DF923CDB3DCC70E50 1-SAAMAMIEHEN
661,126,428 *4424CB2F0AACF5F7042C05F91879CA8C2ABD1B0E 1 seiv
661,126,429 *442B3294DCFF9A9021BDBDFBC33464664CA9E09B ALEXKA1254
661,126,430 *4429299B13BAC7F10576EBF54002D078F5500E70 ALI.MIDDLETON
661,126,431 *4425720427C4AEB1D3B30FD77E0BEB84D236D9A3 [email protected]
661,126,432 *4428485DCFE919B3419F9BB935AE3A5A898D2FFD altdet
661,126,433 *442C58EC544CBB584516DA3922FF7F604E7652C8 1sirkulasyonumuzu
661,126,434 *442BEBBDF209B7D94A5AF05F9131699ACC8D9785 1STADT-UND-LAND-GESCHAEFTSFUEHRER
661,126,435 *4429CA2371DA3E6308856102BC2FF83DBBD2EDBD 1.still-shiny
661,126,436 *44253E8C1D8F6C623357C917F96BDC0C5254E75E 1STOXX-INDEKSIIN
661,126,437 *442EABC9F8A2288CF5F751E116A4F337832BCD2C 1TEHD
661,126,438 *44261C7D7679B5EC274EB779A939822B24DADBAF 1thebluesky7
661,126,439 *4420DE9F55B690204990ECABB53E68233C4E7870 AMFBA
661,126,440 *442BFE11843F6CA0FF3A4349F3DA902E0E1C1E7C [email protected]
661,126,441 *4427B4B2BE88D66494FFE1BC2557CAA1DE199C38 amw+q
661,126,442 *442DEBEF1DE08AC5E5FB15A9B4F9C702889219F3 ANDREALDRICH
661,126,443 *4426754D57409470EE6FC0DBE43DD0C1BEE1DEE0 2041497 hapen-on-oltava-kasvualustassa-liukoisessa-muodossa-.
661,126,444 *442F8C13B295B48F7B9FF2B7F851B703D66994EE 243218 KIRJASTOONEISOVIL
661,126,445 *4420E8075A0C8028159CA093AA08571BCCB12D10 ANTHONYBRAMBLETT
661,126,446 *442A364E889E6D1D4D3BEBFA7BB10448046AB17E ANTILOPIM2
661,126,447 *44250BC84DA5A355A9A3D89C8D793CA0816D9911 2670464 MB7JAMB8KURSSIEN1.JAKSONRYHM
661,126,448 *4427F874128EF62DCB28943C4F1157485D1F6A4F 2689146 omaleimaiset kaupunginosat ovat turvallisia ja viihtyisi
661,126,449 *4421F75DD954240A3B4372A9BA0457E66F9283D4 AO-/A
661,126,450 *442E3DCB2E9F2A647AF47273B6C259AB8633E6C6 APIBF
661,126,451 *44211B76D7886B1F908D73DC5F0779879C1F47C1 AQPXW
661,126,452 *442AF6A97825170950BB74C7584E086D3CBB90FD 2generaattorivaihteisto
661,126,453 *442E3B189AFE39D1401DB4C5452CD2997DCE3620 arfinanceandadministration
661,126,454 *4428BE0D0AC4592A379F99E7FB3EB82070A66E19 2nykytiedoilla
661,126,455 *4422A4341B2E7ECE81098C66A51C904751589860 2outlook-a
661,126,456 *442FA6B05E16E480FB28895EBDE96C418B0BBA71 ARMANDPHRAMANY
661,126,457 *44247B5FCFDF8ED860774783CC786ED2C45CF281 ARMJF
661,126,458 *44248183EE0DDC51B73D5CC0663512713CAE287A 3531F7DD57483F09954947AE6F53B97C
661,126,459 *442D310B7FDD18FD21F6509F42C400C93825B00C AT$?V
661,126,460 *442EB6BF66B975778342DD851FA0F2227A677611 aut8
661,126,461 *442222ACB9F95EE9983FA41E5D05DCADCF9BDE44 3NMYYTYJ
661,126,462 *4424C0F22195AEF4C7CB6B69346D6B2516FA27B2 a!vw2
661,126,463 *44239BCA800492AD7428758C462558ED937E5E9D 3X14
661,126,464 *442B22C17E8BEB9D996B0FE2BBDC97EA22D35760 AZZERBAR4
661,126,465 *4425E9270C0B738E3E6BAD71F22B8897CF48C17A B23H=
661,126,466 *442E7C601E4EF3D6BC968A80D23EEDBA42F7564E B3B"/
661,126,467 *442439FCE85A0C82E339AD63F349FD999B826F63 B4(R
661,126,468 *44236CB528D4AAD10665CB40FAB020F41FB29F38 4CFCD7D8-64A5-32BA-B8A0-91EB81DC8D1F
661,126,469 *442BE8C5F2C4AA52B382B7166C938A546543B1A9 B5H7Y
661,126,470 *442AF37CF4AB5AB8D790F72677DCD7019B23F594 B5YYA
661,126,471 *442DDA77A22C55208AA7F4B96EC30427EA521C0C barasbsw9
661,126,472 *442608862FB6D5657BC088A43D6B2BB0A1CCDC21 barkingrabbitsblogspotcom
661,126,473 *442102E0E70F2F68F85CF668E9A00B8F29019F1D BARNZ
661,126,474 *44204F71754DFE8FB2B60C72C6DC9E75C0169E03 basilgilbreth
661,126,475 *442779CA823CD16557AE519B8EC8FB107C323D66 4.STRESSTESTING
661,126,476 *442F9BDE00FA1D5E3FED1E6D0B6D222CA4770022 bbo)6
661,126,477 *4420308675881255566A0CC1E83DF4525F1E56C5 [email protected]
661,126,478 *442D1F6CF20AE7DF4943D21E42B22449CE0FFE10 4UNITIALIZED
661,126,479 *442F278280D7EC634CF352B005CFAB8E805FD5F6 4VERANDERTERER
661,126,480 *442E152C2A8601F002C5920EACB23C91AB47DC68 4WENDY13
661,126,481 *4426AED556FD2D8947B70DACF7FF9EC71915F3EE [email protected]
661,126,482 *442BFFA2B37334B278B33468DAB848D79A515BF5 5CITSONGOCAMRAHP
661,126,483 *44214FD750B31B3C0187AFE6A1C1003D834A750D BeP"
661,126,484 *44248B3F103022A875AF3CAC28E9DF006633D318 5EXCEPTICECREAM
661,126,485 *442FEBA5E1073FA76844348889D033BE09AB98A7 5goose3
661,126,486 *442D62BC31BE2D4467137BB4E7C3D2DA4F23E3C1 5LEGENDVANILLA
661,126,487 *442D2170C1D0A018ED150E376F7BF24CBB72B7D7 BFA
661,126,488 *4429EBAD15DAD2E0E17872423D77BBBD8E5A51E6 bhcg
661,126,489 *442338C37226EE5EEE4E01CFF79AE0847A36867B 5STEALTHPETEY
661,126,490 *4423F8ABF78D42204D85D69EE96DF5E40DA6FD77 birulua
661,126,491 *442BB79E0F07BE5EEE8EA983AF05A262C7E16B50 BLAIR.BONSIGNORE
661,126,492 *4421360AE54B031EDBC95857BDCE058084A448E9 b&llb
661,126,493 *44243707C8868733F500003E471C806116B7756F BLUEBIRD19
661,126,494 *442A4D1214E21514E6A66819254367EC1204FBEF BM;?
661,126,495 *4423F22BA30B0489F05F2AB4A1757DCC8E224928 6GYEONGBEOMBSW
661,126,496 *442982AAEBADD18C0509362E529C1D91F89020B1 6HOQUETTERAI
661,126,497 *4422CF6D606212B1746B59A5DD3CF1D572C02FDC BONZAÏ
661,126,498 *44263DEA8BE75B99587A28001BFB107F0F7E4E9D 6IMPLANTBEAT
661,126,499 *4423C9CE64B92C201E8B681E90631479155947E2 BOQO#
661,126,500 *44225AA50A2D46810BDDA081E2A9D394272EF42A BORISMINDINGALL
661,126,501 *44207C690ED2052994844FC0F2706CCBF7CB4F99 BOTCHES!
661,126,502 *442D8942BD9AB5878783AB500686EF19E90BFD84 [email protected]@L
661,126,503 *442EB45EF9DB887E49509C07F4E1508DA7F2A054 brad-coleman
661,126,504 *4426E6C101D3E60B5CC1D846694F615E2077E9E5 brain's birthday
661,126,505 *4423CAA16012BE36C4AF1C08C0BF9BE9CBB37878 6SCOUTCONRAD
661,126,506 *442F55C7075824B599565BE1D5E6F4EB715C93B8 6SEKSILOMITTAJAJRJESTELM
661,126,507 *442582A0C93E569779143D4CA9962774A6AF3B56 brendonpimentel
661,126,508 *442C67A4D10B89E131584DCEBC6BB3DD840BE43C 71A57A7412C8350CB1794AE6F1A48425
661,126,509 *442B361B0FB822EFACEE4E005328D429331CF1D2 bridgidriebold
661,126,510 *442A100BC772AF2294907A3F58D147A1E03638D1 BRODERICKMAUGER
661,126,511 *442B9866F881B11F1B060F9833D4FD941B2CB399 BROTLOSEKUNST
661,126,512 *44249D582B6738BABE0372E2727E4544901D4668 [email protected]
661,126,513 *442DDECD69154F5F8BA22EFC55E6C884027CB297 [email protected]
661,126,514 *44282D28D02D6C4E084AF5F00B70FA4B7629EFC9 [email protected]
661,126,515 *4421CED8DB9B560E420E3C968009619EA211C181 7CFJROSE
661,126,516 *44275B555CEB27D17A867592263F6ABA10D5E420 7DIAPYESISSES
661,126,517 *4420206B4EFE2BFC6715907FCE3F924857EB821D 7 GIENGEN
661,126,518 *442BB45E4E64BEAD24D5A051F6DFE09B195FF168 7IIPVXUGNI
661,126,519 *442BE2F1681E1E096E4AA429FA60F900F98A4C39 7IZANEKHS
661,126,520 *442DE7402ED24FA73253620688CF554C97F122E2 7JELMATON
661,126,521 *442EA27315BB2A1CF91B2D14528B328599343874 7PANDAHOME
661,126,522 *442B56F60FC83D57923D40251A0E47A7F5A834A5 buca8
661,126,523 *44276B070FA3106B826A6B705BA275796B40CFD0 BUD-MCGINNIS
661,126,524 *442DB0799F2A1310D08349BD38C1FBA90CADF6A1 bugs(1997年、maxam)
661,126,525 *442D5C1ADC0057DBC9F34EBB7D6CDCB55678DE85 BUSTERGORRILL
661,126,526 *44247F1EE8CD164143CAF913EFC8A4042ED77E32 BUSTERPERCELL
661,126,527 *442F609E2B313764806B180A6BBC56177A214F06 button.tr
661,126,528 *44240CEB101AC0591BE443D8017C5A3D09FE64EC 807482 ISTANBUL EMNIYET MUD
661,126,529 *442255794F358E952E3B21AA3DB358AEFF6E08B8 BvO0
661,126,530 *44286799CFBA8858F5C3F0E725FA86D79BE06BDF bvym;
661,126,531 *442AB8019C86DFA3C51A0BC6AA9127AC8312F24A 8AGANNEDLOG
661,126,532 *44223A0EA171493FE72561D130EC06E297AC265C 8##b***(_0)
661,126,533 *44239A533ADDB4A79E119A04CACA3F216EC2781D 8BSWQAIWAINBSW
661,126,534 *442FC436F6F64F681D69F9346B5EBDE26FBEC430 8BSWVECTRONICS
661,126,535 *442E169481DEFC2AA97E2705270D224D284B1900 BZFX)
661,126,536 *442729DA61FA7619AD93A2D8AD13A10CFBB67534 8DUNDEESAM
661,126,537 *4426828BFBB3E0BFD1F8FAEFDDA55124A76C0BE8 C/?1H
661,126,538 *442606B8FB495EC0E5216995AFEDBFFFC0EDFB75 C5YJQ
661,126,539 *4429F7A81E4E9E5F8284D7BEEF23CE52D22A1ECF 8STRATEGLES
661,126,540 *44216AC6D3880FAE8596781A129B6A40B83B45DB caleb-burkholder
661,126,541 *44217DA02C25FC2B7482E2C631F871A449FEBE13 8TOREMARKREMONSTRANCEREMONSTRATIONREPLY
661,126,542 *442514828299D4B9ABBA0E92770F0BCB5E3ACB62 CALL MY NAME (WAY OUT WEST VOCAL MIX)
661,126,543 *44276DFC82166793A38A4B534F1FD7F85D8E806D canaanead
661,126,544 *442BFC0471130CB2FA5F0758C3B173460A6C73A9 923170 KAIKKI EI SIIS OLE SIT
661,126,545 *44272BCF72ACBF3C241A0855B41889AF23A1D3F0 974273 SUOMIONMENESTYNYTMAIDENMENESTYST
661,126,546 *44230E49B5B6E1332149F9BE1C0A52D1DD6E9116 caroliniern
661,126,547 *442EB32D22E55D86B01C08FEC2BBC8554F477883 CASEY-ARNTZ
661,126,548 *44271321EB6DBC4DE8A3541016FABACC38323905 caseygriswold
661,126,549 *442BF778E872C8C832F6CB9A1A3F2921A609C931 CA!WL
661,126,550 *44253D1FA551441E9CABFD2D920FCCC7F857966B 9PELASTAJIIN
661,126,551 *4420C519D007DB3D6C161490CD7A4252750AAC84 C!CC%
661,126,552 *4420407D1E2A3EAA854464A10DD0FE424613898D c.c$p
661,126,553 *4423CA193D6799B0FECE9057093718751C6038E5 cd_mq
661,126,554 *44292111AC5FE41FF7D1CC2E568D0CC0CC1D7EBF A$9U
661,126,555 *4424C0E4BA0E1487555223E0613CC834794D6874 ABEL.MANRRIQUEZ
661,126,556 *44228852FCE961D5192567C13C782538EEF8DB33 abeuntemqued
661,126,557 *442A04B83A6097C691A4F0435B5BED9686F2F2ED ABjN
661,126,558 *44216698B186C986E964BA2190A96A5EDBB4B663 ab??n
661,126,559 *442CD3B894AE04C7695D86D3A0F715728C5144EB CHAOSFROSTY
661,126,560 *44229BBED50D3014A8C0A5AEC5DEC7755596A92E ACZKP
661,126,561 *44268AF000828F05F9782E2CB2F022F53C689B19 CHOCANDOED
661,126,562 *442ECF9B46964F2E67F46A190B893BF98C561B67 christine.attacks.(plymouth.fury)
661,126,563 *442F60AD560CD27145DDDD0F2B800F4EFF0B4296 CHRIS VANDIFORD
661,126,564 *4428AC8F9AC940287162D81D260D08909D46EC1A [email protected]
661,126,565 *4428E929CFBC877B454BBEA3A9D4917A766754D3 AFIGURARIAS123
661,126,566 *442B7658C72E4436A0D35021848D3E59EDF20F41 CHXII
661,126,567 *44221F91714C35FF09E072BB5996F373797C55B5 ci&eu
661,126,568 *4423C1168B287CB94151B5C15D0B2B4686C72FF1 class="srtitle">new
661,126,569 *442E0380677F7FC9306DDEAA7A9BCEDC111FE64E AIDOP
661,126,570 *442211C547374B56D37FD11C358B477AC8CB5127 CLEVENGING
661,126,571 *44281227D5FBA7CFF8DAB642262A7C00F634EB63 CLURUMLON
661,126,572 *442A77935AC7697F867E6D39274E754192892527 cmqm
661,126,573 *442AE0445F1F8CD05E123021B289C8ADD9220047 alonsocumba
661,126,574 *4423CF5847C22986F781BE5F3819D11C10DA1851 ALTHTKFKD
661,126,575 *442BB3C310F8AE34FD98A255EE97E42E91F4071A ALVN+
661,126,576 *442F43E661B0664FF5809AF826D7FD90BEF65500 CONRADLEONHART
661,126,577 *442E96078CF0F2A4948180E6A0C20A702C370AAD amww
661,126,578 *44297C6E7645C3FE463CFE56363FCD2BC3E9D391 ANDRES.HOLIHAN
661,126,579 *44259E9A9D90BE1793D2FE9512A3DDD08221B0E0 CQN/Y
661,126,580 *442B91A0B0044A88C48EAA75C36A34579A5E6F9A ANIBALISALES
661,126,581 *4420BB51BB3327FD3389A3A4B61A668E7A580B8C animalpeewee
661,126,582 *44257B8C46DF269EADA18D3874D0FE2388D5B2FB CS!,#
661,126,583 *442E66298F96FEFC29671A7471648198F2142940 C!v:
661,126,584 *4422014E840605E0E1BAAC6F9C82371F9BB077EB cyndy.joaquin
661,126,585 *44202E08DD92AA2AE41D4965948AA788D3C53281 D0N4T!V35
661,126,586 *44217A21521F48FEAAB1C2DC27010F62BD7734F8 damionvizard
661,126,587 *442409B54BD50723883D2A945077BDCAA650FEA5 DAMONHOOLIHAN
661,126,588 *4426E856B1AFD9FBB1694BE1007C834AC9550E22 DANEMARSALA
661,126,589 *442FCA68F056C3C96B09B3AA527F9F243B8C3635 arh=(
661,126,590 *442096F43814DCDF46E4CA0536B6A35A0A0A13FA ART.KITZROW
661,126,591 *442F99B838DC89E9BB1669F8C6C6096DB5EE78F9 davisperlman
661,126,592 *442064CD0A2B5765E4E3A353EF49CAC955ABB6DF asdfnat7
661,126,593 *44225C1D7109D49F5946335F006D586311D2A467 assinilb6
661,126,594 *4420623E99C2424777C5E626B4BFF3EC7365CE0D dcre-
661,126,595 *4424E17C103C54E8A4133F7C9A2AD57E1A78C54F DDCDEALER
661,126,596 *442DDAF1D703FB62C09CDEDD4A7F7F284D66C996 ATTACK.194
661,126,597 *44298D055DBE0B521A9F569BFE082EB08F367F1C deathrate
661,126,598 *442DFB865AB6C7CE5CCBFA0522BF46B535669985 AUGUSTUSHOUSEMATE
661,126,599 *4424A18E8679F4E177C1BD94736F83D68CA28FAA DELEEHNO
661,126,600 *44243CBCC10A8041068C0DB209EF6E7722FC76B3 AU)p
661,126,601 *442773E05CEA5ACACB6941EA3A4B17E0899C47B0 DEMARCUS.RICHRDSON
661,126,602 *4425C343504D3D0115F006B500DCFE807E52A485 denisfarver
661,126,603 *442DBD27683D6CDB53C0349B611A245EB10BDF40 AWAFTINI
661,126,604 *4429B200B4BDAD93B86F239E0F9E18DA8E008951 AX7%N
661,126,605 *4420637C91ACC2D3344123C7E3A4422D4B2D9C99 a,z#q
661,126,606 *442F219F517EAD6FD9C546E63D1A37A59D00A708 dewittkoneval
661,126,607 *4420115B824316B96C9AF156582BEB5E4120F0FB b0vi
661,126,608 *442FE38EA1B4D193B207D09F5FB5CC7088AEFF94 DHRYGIEY5KF2WNJ2
661,126,609 *442D6C2F74FFBB5CB1F89CCE146B9E56AA1B21CE baguet0
661,126,610 *4421DFF79EA356B8CF1BEC3266087108D702FFA0 BALLINTEERCS
661,126,611 *4420CBCEDE23EB1DEBD865ED90A20EFF9F43A63A dnhow
661,126,612 *442C7A51FF5D31A8262C140741315220D93B7AC7 bd+o=
661,126,613 *4424797E152CF9723CE1A26857A62072950EEB28 DOM.UM.ROMAO
661,126,614 *44228F26B912A2E0D253DBE326B6F89C0FE9BC3F DOWNTONOWHERE
661,126,615 *4422FE4A5FE7BAAE64D23EEF9703255531633B4D DPO8F
661,126,616 *442CF366990A7DF1BAE332F6717A11FF63F9D571 Drhorus
661,126,617 *442BE7D33DFB23CEA8EE8303FEF62EB87F3F0E69 DRIVINGMANUALAUTO
661,126,618 *442EBA9DC42D65EAFDAA2B470A2075F24DA7C71E dundathu6
661,126,619 *4423A1FF7131CD4CB11E0595F992AEB6D680AEB8 DXUDLMP
661,126,620 *4424D690F14F4DACF07A632F14C42EDB764DE232 E4-LION-38
661,126,621 *442F874976BA39092C0AE8D77DAB1FCBFAC9C4A3 [email protected]
661,126,622 *4424BF1C1D4D3A0A047972F18D8525002D7A48BE BNMEN
661,126,623 *44256AD52DBA5B9155B480B5ED653E900B421E86 boa_d
661,126,624 *4420CC6C60A8FA65D66EF51B1E8502F28F9241FF boomfore4
661,126,625 *44229911AB53CD63B1BDE2EAE9ADD5D0DD7F3200 EDMUNDJABALI
661,126,626 *442B0EFC8D5F888C8B40D1CB00DC17F8FFBFDD6C BOURBER
661,126,627 *442C4EE4D9B865AD9960FC219EC69DDA490ABB4F [email protected]
661,126,628 *44237426797509122CE7E8B4E3DE1E314C9340CC edwardosingletary
661,126,629 *4423810D3E27440723F35BE6D6079916215FDC9A BP"?%
661,126,630 *442A86E508F848130CBBA618ECB3A22C077B8771 EECOIID
661,126,631 *4425C524D2FAABED05D78FFA2B52D1E32C9C2138 BPCZ9
661,126,632 *44279EC7DAF70BCB0DDA1901BFBFE63771220D8B B,QBJ
661,126,633 *4427B346D699AE02408E17B35B407A67D75DA0DA brandis.harris
661,126,634 *4427547F48555AB872CC24DBE2BB24F26327AA08 BRANDON-SHUCK
661,126,635 *4426D8A83E170C8E5170D8D2011DC759E28F046C bratt3r
661,126,636 *4422100EF3C462A546BD20F3036BF53F2CA8FF99 bridgetalkkeokukham
661,126,637 *442BE956E1E37E79EFF406B12EC29E65B958F3CD eivwa
661,126,638 *442FD30ECB9D988668117BA2555FA53251542D5F BRYCENAH
661,126,639 *44202E90032506A9D178EBEE12990C25A95CE0D9 bswstoneobsw
661,126,640 *44270489E6FE943E42FF765A280090E9745F3AF9 bs!!z
661,126,641 *44246F41C7692FCA8887A43B0778AA95976E6BC4 ellen.ronca.burleson
661,126,642 *44229449FCEFAAFE7FCD0C8A049558F13DC60EA1 ELLISCALVIN
661,126,643 *442290BC2C09CB363819DF066E249056278D6578 ellsworthlegore
661,126,644 *442231DD7DB5EAC13EBF83EE5B25B924C75A7A59 BUCKLED
661,126,645 *442B7B1093DF0C32C4EB0275B2A9DF846B89B505 BURTON.COUNTIS
661,126,646 *4423F362EB6EFE06AB84161C09EC225BF2378D63 BUSTERSBARBECUE.COMWWW
661,126,647 *442DC33A2680955774ED01F3029785F73199885A buuq?
661,126,648 *442D7544DE64B583FCDB25D00A7F44D12D93F5F2 [email protected]
661,126,649 *442ACD8019C70D628C5D38AB4ED443EB6BAD7936 EMMANUEL325
661,126,650 *44260A7CC7AAF8C4B9253F0EA750CADFAEA5FDFD C0N5P3X3R1MU5
661,126,651 *442A2E3FF9DF0B2FA01B137CBDC8686E86BF53D6 EMMA-TENNANT
661,126,652 *4429442DA8F4281DFBA287992B22B60AD60F27FC [email protected]
661,126,653 *442DC67338FED9787D3F29A68CFF223C6CC43FC3 EN$E_
661,126,654 *4427D71077EC4E8A746323114E37365C393CBDD3 C-8P-
661,126,655 *4420B1361DB84D6C8A8E3356A226C06F015D3EAC ergriffenem
661,126,656 *442CF655946127739EE68A716EA5D519E0C42028 ER#U
661,126,657 *4428B34ABF10D9B8B09C3176AE5DEC9BDC1CC1DF CAROL.SKIPWORTH
661,126,658 *44202CEFAB17ABFE324205D3B27C310AECCA131B [email protected]
661,126,659 *442125402B78837631177D9B4C0A8639ABD8D3CB EUSEBIO.GRAHL
661,126,660 *442B2AA152536EC96352D76F71E9E3E9BB334780 [email protected]
661,126,661 *44202F73D1276C7BD988366618A1D4AC56E1A73F CDBDG
661,126,662 *4424F05C2105192CBA74F0C5F1799E0F993A09E2 FAARGONO2
661,126,663 *4429340A52153F377AD2A2C3349F7A1D71176F28 FACTUALISATION
661,126,664 *4426FBA4249DC82A19F34C70FDC91C591787A069 cg-f1
661,126,665 *44240AD7B5DB0DDA713A9E90059F2C40FCF9C146 FARTSRET
661,126,666 *4420EB5E070D6D5BD05286AFD890DF6C4B069385 CHAD.SAFER
661,126,667 *442E368CD2F8127384EF3090DFB72E75535DF899 FEHSCHWEIFEN
661,126,668 *4421A69AC4D95CA394EF53B6D2788F513EDEE93F chaperon.-A-spotlight-finds-the-BAND-LEADER.
661,126,669 *44214AF96C4FCC7DE2537F1FEA1131A402C914F1 FENGWEN5
661,126,670 *442458A5D51ADB93E39C90F97AA108B34FEF0A25 F[IAAA
661,126,671 *44237E712F03009066AA97540216786D08BA4D53 FL35HPOT
661,126,672 *44253D075412FFDFC2130B7B2F5A0290DA085384 CheyneStokes.breathing
661,126,673 *4424ABEF787B1615238A0535F94919DAE14FE4AE [email protected]
661,126,674 *442A68B50D83706734316754298458F4F6BC9CA2 chongamesbury
661,126,675 *4425E7BADD25283FFFE6096225D5DAF34E29F724 following-sgt-spota
661,126,676 *442EDDF39BD56C6DDBCDDF2F609F07C6BC000961 christophel1234
661,126,677 *44257BB28D9673F32857CE060ACB35F4C13E2EE1 cim.h
661,126,678 *442D0E8C3918764D5155B3FDB46B7B03F26B47DA FRAN.SISCA
661,126,679 *442D79063D72CE760644A202B25864AB20857C9D FREAK1COUNTRY
661,126,680 *442D87F451838467EE885F89BFFF264F091C7C8C FRISOER
661,126,681 *4421219B999BC738C82343159675A27EB316CE9B CKUXN
661,126,682 *442026AA304C7330C82EACDF0F4ABF7194055D7E CLAUDEOBRECHT
661,126,683 *442B1EEA97343CFD889A80A0EC373C9AE6E3F078 CLEMENTE.LEVI
661,126,684 *4423E792BB6E469D0836B467F2A2439C2B26028A gabriel'sobo(themission)
661,126,685 *44217A84F356ABAD30AE84570EBA71FCFBCBD86B CLINTONWILDA
661,126,686 *4422815D577296D4B65F2FEC916C368837215335 GARRETGOODLAND
661,126,687 *442C4DF1D8C1E13C6DF6D73D0CFD1AC809B50BCF [email protected]
661,126,688 *442322662D8C942B6CACA964959A4B06B948595C c;mj(
661,126,689 *44288B953C9797B24EAF38050EE8B9D43636A433 gdeltrac4
661,126,690 *4429DF18FEFEF692C4DFFEA035D738694DB548BB cmなどが収められている。
661,126,691 *44209B904C5214400B060491C1820A9A44AEA267 cognoscibility5
661,126,692 *44268C2FFC337C7558CD954CFC7412A096157D3F colinflud
661,126,693 *44223ACEE3C9FB9C23A914AF64966A976324E9F6 COLLECTION—ROLLA—UNIVERSITY
661,126,694 *44275705AB0A238FEFC9E72509EB87FCAF69C8F8 colonelsindiana
661,126,695 *44243FAF4BCCB72191CC2DBDAD173AB90EDB03B3 glennpalifka
661,126,696 *4421D859606999B5F02590B785BFF93C5DA0BD77 CONGOER.VIDGLE.COM
661,126,697 *44284674BE4066A4D445301AC9CA24B26791DCFB g:n&
661,126,698 *442182D1FE81FB0BFA2435837C951CFBCB173C31 GNIYVTUOS
661,126,699 *442E5B19E647A8E6E535875436164DCB3A55C2EA GNONGNON0
661,126,700 *442136F46EFF656B50B60DA80679052695E56255 g-^o
661,126,701 *4422541A08711EF5422964E015D4D3986D2ED722 gorgorothing
661,126,702 *442B72B15E9FB799D6D7DC6CB33EC85F0F2B6846 governmentguided
661,126,703 *442CF2C4B423589A38ABD2BC35470E8BA71C6FA6 GRAANFACTOOR
661,126,704 *44274BD09AD7295A2C5ADF7D7CFBF594A50DA923 COUNTRIES)」,例如
661,126,705 *442BB5B160B8ACE8F1D956379405DF7306FC7789 cozier
661,126,706 *4425807366C43A3E17EC06ED7A54B6CEE03C414B C:\PROGRAMFILES\COMMONFILES\ADOBE\HELP\KO_KR\EXTENSIONMANAGER\20\HELPJS
661,126,707 *44237D5F1EC84B04D48FDE29AB4103A96E7428B6 [email protected]
661,126,708 *442C16BC5C5F03584B04B91A33EFB9E08C4C02FA GUILLERMOWANKUM
661,126,709 *442389EE1FD70DE26897AAD7D4F6C57F1166FC32 GUINNESI4
661,126,710 *4424819DE3C63C3FF67DCC00ED2F4EEBFBEA6028 GUSSHEFTE
661,126,711 *4426F5723DFD8CC6A590CD62A1A0857AA378F226 GUSTAVO.CUSHWAY
661,126,712 *44286E88C2D8B03DF29415B328FBA05F890C2E12 cq,mh
661,126,713 *4425CEC76B2797BDFC5CB9A655C89413DCBA5D41 c$sft
661,126,714 *442A1D3F4D7F6A212640F787D76E3E4ADC44196B HARDYSBOOK
661,126,715 *442AB20E3A949E9EF0982C22DE045708B9B0E282 HATALOMÁTVÉTELÉRŐL
661,126,716 *4427F1BEE99CF07BD625E6012B2598879FEBD854 [email protected]
661,126,717 *442D7C9728F907C556707027BC1492C1E199A626 havanoje
661,126,718 *442C1314F8E655706D286DFB29A7C0D3FAE3848B CV&4J
661,126,719 *442ADC1BFDB25457D674713594740CE61E9A7905 d0:(
661,126,720 *4427EC385E9C5B9C30182F36C403D02531F10235 D1NDC
661,126,721 *44273740BE922B43E0DAE56DA6892629C1273191 D2AC
661,126,722 *4422F178B6073E65C80128912188CB0341CB5C46 hihihi(extended)
661,126,723 *4420518C577BCD64B3D86CB5A3231BE795A57AD8 hilgardt5
661,126,724 *442CF4D778D81CDAD00EC5123698DD0CCDC5BBDB D_AE7
661,126,725 *442B5AF97A08733AE20F08B601138DA82ADA4999 hq7czbtgy2:gnoj25rsya
661,126,726 *442AA001CA454B570F94A0323E77896845026308 hrbrsts4
661,126,727 *44255DC40685008FB0E22FD8A24A35CFEF878486 DARREL.SILER
661,126,728 *442512C68304F4EBE505C219F66D165C16C1FCE1 DARREN.TEAGARDEN
661,126,729 *4422C5D00BBA51EEF6D65E84091888B00A0220F7 darylbabington
661,126,730 *442AA799CFA65BC3C750D131689CC65FF16D8904 HUMBERTO.NUNMAKER
661,126,731 *442F6439BBEA11AA97F59356C70A33FBF8B6231B da.w5
661,126,732 *4420CA4007BAD41B0CB61C3ACB6FCD0D0D89AB88 `.D------B
661,126,733 *442F3FBA644DCE27FD15E235AC2F3789A33AFCA7 db8bd
661,126,734 *442008D8FB48F46DE487158DA71B8F6599C752C1 dd0le
661,126,735 *442636E01CE586C6F425F6236B9476CCB557ED0F [email protected]
661,126,736 *442E3F2B265A7F9674A3D214EEB56992178F4ECF ib'
661,126,737 *442301CB38ACF7067960F8E397953924DCA7DC49 IEREHCUA3
661,126,738 *4429AF35DB52C0F29FEB8B32BB18A4ECFD58BB7D DEGOH
661,126,739 *442FF738E5FB8FDEFFDD3F23E067546402D74DEA DENGJOEE
661,126,740 *442BCF00B9F8071FBF30AF26F53EAD3AED2AF908 ILOVESAMANTHA90
661,126,741 *442C35346DA1CF29413642490FCEAC3630546753 deregistration
661,126,742 *442E50C0EF8B6A58E7733287F6ACC03BF7366C1C industry-standard-(feat.-writers-guild,-vast-aire)
661,126,743 *4425CD941D52F2F0E7F33C1FF0999F0A9EC7C2AF dhhbh
661,126,744 *442F732BA70E4032D35A45C265E40BC0342DE072 DIEGOBACHMANN
661,126,745 *442FC9E51B2CF4A0CFCD0C797800852E62AF6089 diffusat2
661,126,746 *442159AD9ACB3123702F50B5C38695BE16896268 IZA_KATOWICE
661,126,747 *442990A7C34024C7160839EFA0C5ED5E7C00E264 J09J19J26
661,126,748 *442D1A49462F966A7C1D27D11A5758BE6B303969 dj"4x
661,126,749 *44243029B87A33F4746FD34EE1CB456A2A1C829C j7D
661,126,750 *44223EE16401F4889EADF24BB12584EB28C0636C DLNGW
661,126,751 *4424864B7637104AF950C1E943EE9CAA362E144D JAMESDAUBERT
661,126,752 *442FF3ADFA375CFBF10C6C31A54EA9B7292D92D5 do.gm
661,126,753 *442CB61D432D9931A75978AB0A5A696DDEA9D950 DOLORIR
661,126,754 *4425CED1BA1E69058283E561821BCD258F3A48E9 JAYSON.WISSMANN
661,126,755 *442AD6A3221E60E4A8CB09E4C2B31402E6A1476B jayzblackdawg16
661,126,756 *442443DB725DCA9B5E80548C6D0D663A1756B6DA JEAN.INCLAN
661,126,757 *442BF552EC14D0FF09CE90AC1EA7479D38176FCD JEDVERNIER
661,126,758 *442B19B35B6E1E6DA865D707EB186AF29DC94981 jeffreylessman
661,126,759 *442369692834DC628DA9676E63862F63989B3F6B jeffreyschwantd
661,126,760 *442EE449F034BC29BE471B4D556E04526BA22C6E JENNEFER DELA CRUZ
661,126,761 *4420A3E70C0589A2B2F22C3136F81913287E3303 jenniferruddy
661,126,762 *442966D6775273C7DE01874BBF9F232B29781E0C jeroldjacobellis
661,126,763 *4428C63E7E2E660A738D630C87FF015A1DE5FF31 jerrel.jones
661,126,764 *442262A0395F2F1B00D162AED150FEF34E9B2C55 DPA232Y0
661,126,765 *4421E6B78A4D8D789387D7E988BBBF2AFA4191DD dp#af
661,126,766 *442403140D46DCA75820F1AD33B21063EA36A9EF [email protected]
661,126,767 *4426F4227CC00EF0A1203CC82949BD87AFF05366 dropdead2081
661,126,768 *4423E991829FD865FC513E54F18B06FE656CEB52 JOAN.FLAKES
661,126,769 *4429DE84CC78A47289D3BEC2C6A267113D738B41 JOANPRUGH
661,126,770 *44212328DEB1F223441C2AB2B9F37C62FBEB11BF JOAQUINBOLDRIN
661,126,771 *442FF723D34862120F32DBEE0D472F5C6962D5D5 joelzuidema
661,126,772 *442CE41EAC79B32CDA3A4F9B5DECD0E7DB09AF3A dszob
661,126,773 *442CD54E8A09CC6B59C41FE1B8F4F022941F21D9 johnbaxterbio
661,126,774 *442F10D2ED496FF8E084B7226CA49196C9D1CB21 DURCHSCHLAGSSTÄRKE
661,126,775 *442F4290FE65C698392AF03863ACA256DDAE52A8 JUDESJ
661,126,776 *442DD78D269F3AAB5D62D972E32E94AF78CC5986 JULIANARIAS
661,126,777 *44201306C56B3D678E46B07A31F30731F71F222D e1a280545631bd63c99b28fe6d1baecb.127rg41
661,126,778 *442906D49BB1277DDBC2EA5FA1EFA2DF88BE67A0 E7o
661,126,779 *4420645F0976FE80141835434E1F86B0FFF624EC KAREEMTHIBEAUX
661,126,780 *442F18693DF549672696070DDD92F29097596543 ėčs
661,126,781 *44208921833FD4B4769E30F746E157191011004A EDISONWELSHANS
661,126,782 *4421164E10108C3849D1819BAA1FFE77E0A852CE edith.tay
661,126,783 *442790E1EF229B5911A29481D8D242D7AED0E21B edmondbarthen
661,126,784 *44224EF42574E9692817818240605FEB5BB20B25 KASEYLIGUORI
661,126,785 *4421B5DC36CD5AA9187670E3977EB72B8D5F3ACA kathryn-packer
661,126,786 *442EC3F8AE12AF60DCF04E204A4180A3D4141B6F KATINAGERALD
661,126,787 *44296050022F1218BE27503B2788D1DDB4359BF7 KBSPIKEX
661,126,788 *4426A493FAC71BB86335C5A5471ACB2A63DA2F58 ee6jv
661,126,789 *4421E6518C246C2CC135AA5E1926B9AB51740158 EFRAINKENNIS
661,126,790 *4421A0033276710E17176CCC765927DD9DB18160 [email protected]
661,126,791 *4426DB4CBEED6BDB107B2286ABAD86C538F439A7 EFRENFUJITA
661,126,792 *4422B62F9EF160E72A8FC3A09A465A3FF2C8F8CB KELLYRACHLIN
661,126,793 *44221B0313781479C557AED5B7AFCD86B582EB07 EGIDNEBEL8
661,126,794 *44280F0047C728694ADED9E5E8925097B7EA5CC0 ketellapperswerk?
661,126,795 *442FBA706192E03DF8BB2949A50AB53BFE18CB52 kijk-uit,-hier-ben-ik
661,126,796 *4423185E8B1614F7AF05E1C0035D8774315A0D7B elbertstands
661,126,797 *44226A6AAAB03F936D66D1EC1ACDE6B34BA0992D ELCHIBAERS
661,126,798 *44296C2A5582950CA4007047D09CE855C8F60DE5 KLÈÈ
661,126,799 *442A4C18407D64479E364E24B7AF80D6E18EBFEA KLIKKERTJE
661,126,800 *442B4A5A3C6C88E9EAA2D22E78A1791E053EEE95 kosmeo
661,126,801 *442978E8648DD0764F846675CB902858EBABACF2 elliottokoro
661,126,802 *44267414A25B8545972EBCE06697436CF8A95D3E [email protected]
661,126,803 *44241A605F0CB6FD3214606D0A6C49EEB94DC8D4 ELODPAERS
661,126,804 *4425E16CB5A0712835AD56B63FF7E10B4AC825BC elvissherville
661,126,805 *4424740E507A4A7E6AFFC9BA0DF722BBB9DCFB38 k./.stravinsky./.berio./.shchedrin./.dinicu./.borzo./.saint-sa
661,126,806 *44275A401CE29CE0944C0E5C8585BB2D77937367 emacsloadpath
661,126,807 *44273A05A7A02DBD8A7140D15A13BE030577ACFD KURTIS.WILBON
661,126,808 *4422E4107A83AFE0760D587316897E0A4DC354CC kxsn
661,126,809 *442757E387B17C857E38231BD370802F60F96AC9 LACHSTUIPS
661,126,810 *4420C8675C1AB7557BF9F1F6FCD3AEC409D6E522 LAETIFIC6
661,126,811 *44282D65370B6512756A277B6022B9518AC68607 emmabonds
661,126,812 *4420F8D5DA4DF3426578C792E661B7CDBE237351 enfn
661,126,813 *442E91C2EE3546CA85A4927420A5C4F2813D6E37 EONGKANG
661,126,814 *4429A5E40F205C2CE99BB707316E53F4BF62F5E2 LC-USF3301-001112-M1
661,126,815 *442AB4ECCED931EBE28E7052B1F258C5E49938F0 EPALLANTE
661,126,816 *4424DFD76DF3ADED659DDBD0CEBF9B4EDC49FAC0 [email protected]
661,126,817 *442E549BF72167AC02AADA7626D8562C97BEB7BB EPYTONEH8
661,126,818 *442610BBD3CA39BB00F0FBA6C7375358C0E56CC3 LEEITRAP7
661,126,819 *442168D4A2BECDEF2585E36177CC150668E9D96E LEEWAYS
661,126,820 *4429F09FB79346BD76185F36C25E611609D06BC1 eriko.otsuka
661,126,821 *4428D0678A53054A3031E61AA18A73299EA4C5ED LÉOJTM
661,126,822 *442C4635C0BCA9FAA5D6385D217B163CBDC07B6E ermiaaaaibaj
661,126,823 *442FB23985CD86205CBD3D905B6A73DB336E204A ernestoeltringham
661,126,824 *442B16B6B6F4D7BFB3802C4E285B3A81E93E6EA2 ERROLHIGASHIDA
661,126,825 *4426F8AAEEF6133503EC3364D9921905F70342DE ERVINBARBAGLIA
661,126,826 *442E4090DFACEFAE5094B1F326C597EDD2A77DC3 LesToursdePasse-Pasee(Ordre22,No.8)
661,126,827 *4425C1FF23749954C9DC55DA62B7F2F50474D588 ETHANDUPREE3
661,126,828 *4427C500ABC3D26FA4062B5EC70867A1E728ECE6 eugenegonzaga
661,126,829 *44297898F7A4B6DE07042903DDDABAC391111487 LINDSEYEGOLF
661,126,830 *442F760768A3DA56DF7CD3486FD7B51BA4497CE8 F87210
661,126,831 *4422356B8A3EC82CCA5D37F23911F573E4846377 liz-sara
661,126,832 *442A0F010D292AF141561B3346753C53EC4968DE [email protected]
661,126,833 *442842436358998E824D6827588721867628946D felipevoelkel
661,126,834 *442EAD0F53F65289BAB6B851988582304A3DFDC9 fentinacetate?
661,126,835 *44298069FA455F558C59FB474D8B44611B62D67D fermented.slaughter./.inhuman.butchery
661,126,836 *44237BCBF3E7CDFDB4093A83883829BAF7BECB07 f[eu
661,126,837 *4424E31FC898411C5B756E8FF04D38FCC7860D83 [email protected]
661,126,838 *44230C9729C591DB9A77247079C5BF2EBF8F9C4F FLORENTINOULCH
661,126,839 *4425001544F5D53729FF02490920608FB56CE83B lucianokneller
661,126,840 *442DDEE0BA38D6F7C6D62B441EA35F955A69CEF5 FMPBFAUEWIR
661,126,841 *44276CAC87C9BAD8B229E5AEABF2FD15B48BE0FE LUCIUSFRAYNE
661,126,842 *442CC714A6EF59BFE668B4A6D7E5F72FFA471244 footballfichejoueur19241
661,126,843 *4429F998A5B9987359A41FF4E13650546176F519 LUKE.MACADAM
661,126,844 *442DB27962F6F3248E2943425F914DB1463CEC3B [email protected]
661,126,845 *442CC9D37368A03649737E010AA4FCAE9E24EECF FOUNDATIONWARE1
661,126,846 *442274D6F12AA9CCB755D5863C2C718EDEE8E716 francescarighetti
661,126,847 *442D557C560784C2E01B631830FCDA346C0EF11E francisbannett
661,126,848 *442A1D4E1D5F9C3017F6C975777A0415EF9438B8 lylemagnus
661,126,849 *44241CCB6E07B6F6B80B14B9AEFFDFC2F4BFCBEC lynnsunsdahl
661,126,850 *4421BCA5FCAC18D357788416DF4AC7033A964D95 [email protected]+1on
661,126,851 *4425783E5752C7A1908AD0ADCD69FE8A6426759A franklynsainte
661,126,852 *442EFA9DEEEDCCB9C737B1DBE9B261B018C0EC5F MACKZAGAMI
661,126,853 *4420A8706E600908E53936FB61E03ABAAB3E1E0F MAC.VAUGHNS
661,126,854 *442E825ACFA39774FE4D88C58F274470AF6BD498 Magnetventilen
661,126,855 *442A4C24277E9AB20675B8D834548312C051B904 ma$q
661,126,856 *44253957C84E42039359272AA54B4DB853E9D8B7 GAMESSYSTEM
661,126,857 *44297E892B3F74D9205570ADAB5F0094DD053622 MARKUSSIMMONDS
661,126,858 *44221CF1C85D856DF68376CD31291B61630FFFE9 marshallmevis
661,126,859 *442997F93CD8C9143825FCDBEB3EA07501EE02BE martincaudillo
661,126,860 *442108862977DA01CD72C89DFB7CC8E218747FCA GASTON.STANKAITIS
661,126,861 *4426679FF2BD3376BD9714F2FC097C41A44141FA MATTMROZEK
661,126,862 *442EA68AAF744DDD0388B7C070319ABC022E1D56 GENOIR
661,126,863 *4425519CC246A8A374DD4EE4946DD55B5206F7BA Me.the.Power!
661,126,864 *4429E963B43DA81B1A37BBBD00AC3FCA88BAEFB8 GIGANTOS5
661,126,865 *4427561BDDC6917728AFAB4704BC89BC92D2346C m&i
661,126,866 *442971D775B450E63A264DC819B631E966EFB3A5 MICHAELELLERBECK
661,126,867 *44250C58D4F5164E9DF0CB21D841E15450C24AE8 GLITTERLACK
661,126,868 *4421F7D10FA70733D3A090773B1C4399CEB1AED9 GŁOSEK
661,126,869 *44237DB86CE316281D854A5C2E09BB3AEDE5ACDA mike armstrong and donnie baker
661,126,870 *4428A42DEEF78795B2DCD9695A3576531A234282 gordonmeyerson
661,126,871 *442905D3CEFF796072D524195440B22F47295EA8 Gorky.'g/O/rk/i/
661,126,872 *442343AAA318FF8FE8DC0F8C27C90E0EAE0577BE GOT LONESOME HERE
661,126,873 *44267662D815C1FF4AD07F55ADD672BFDA546EFD GQTHHNYM5
661,126,874 *442DF56E5023A21864A4B5CBFEDE621A4EA685C3 MILLSPAUGH1234
661,126,875 *44259AA5B954942AAB59156154D875048B069472 minjojo
661,126,876 *442FC04450D4B8933461E65DE23A02B16A300EF7 gregoriomatallanarevuelta
661,126,877 *442B43E4702396DEA4035714C0842C4A02096AC8 mitchellarchilla
661,126,878 *4423315A15C36F4BDB181E5EFB5A95981D6437FF MITCHELLBELIDOR
661,126,879 *442F86FEFDE14E1968BB56CCCCD497B45E35AD0B MITCHELL.BLUEMEL
661,126,880 *442ECBA2CAE960305543DE9DD8DE2AE16E8E5338 [email protected]
661,126,881 *442C35B310F0985CA132865598CB87126442B275 MOHSENIEJE
661,126,882 *44258D00FD06904817DF6B65316BD5E32923306B monsterenergy92
661,126,883 *44287357755B1B9BF2C66507458B4F748F0B0FC4 morrispaulson
661,126,884 *442CC40D27B53FC82BADF3F3A4EAA737C9CA6517 [email protected]
661,126,885 *442CF0925BDB35A0996D05A8B2B1F1F9B64E2A31 [email protected]
661,126,886 *4422585BBFE5010D833EFC3D4ACD2CB4EEFB510F MOSHEBRESCIA
661,126,887 *44274D566BC0E57F5CF029ED35E811C82E60863D MOSTSENIOR
661,126,888 *442F2D14A8F46D077C5A0D9168C2717DA3224ACB HARRY.PETRUZZI
661,126,889 *442C63EDCAD780FDECC52018B410D509CAA08FE6 HAYROLN
661,126,890 *44229A6167C288E378BDCFA788B64DA5D16A62BC HAZIZA.02
661,126,891 *4429076E1D7871988D35F22421FA81CA9B061E86 HELAZ1234
661,126,892 *44265BC82189524C712C2593037C62BC5DA28F6F MW7S
661,126,893 *442EDA755D55552115300854F5F0707A77AB61E1 MYRON.METZEL
661,126,894 *4420044E51D321B5A20B4A5EAA80029A79C699EB [email protected]
661,126,895 *442DC308B261BD5DCCFC66061FBB7FB8114BC6B4 n1gh7w4lker
661,126,896 *442BBA09138E1A4746616E7AF16046265EAF6A96 NABEELRAPID1
661,126,897 *442A404940285FCC04D2A72AF126AD1C265C2414 HERBERTNIZO
661,126,898 *442E46CB63FE8EC63B94724867B894B25FC33FC3 here-come-the-rebel
661,126,899 *442629D8E3305E19119AF7EC0667D53E1816438C NATHAN.GUSTAFSON
661,126,900 *442A7C558374BC998582966A47A1C125623997AD ndvkqyr74
661,126,901 *442173ACD89755ED0A4E0E0B65E8A0D27A363793 HG|K
661,126,902 *4422053881D409693572A2CF7411B28283259C93 NELYTCAD2
661,126,903 *4423DF95E08FA91B3234B3F7068E7ABFD8770267 [email protected]
661,126,904 *442092C19EC7DDFF537CF76AAA287F23AD2F34C1 [email protected]
661,126,905 *442FA9E1790E78D8E43678A452CE975CD92D2191 HKDMDIK27
661,126,906 *4421E0E9A93FCEBDF390F893B588C04D15928C50 HOGEVEEN5
661,126,907 *44230EAA3DD88567C8CB9AE629333418FD15EA4C HONG.CAVALIERI
661,126,908 *442E8DCC13EBE0E98A8CB77A3A28E13B501B2126 HORNY.'98.(EXTENDED.MIX)
661,126,909 *44261B555386E1E2260597E4F44ECCF784A9617D nh599904
661,126,910 *4420218092FBF52C3A9D99A0B0B4C6D4EC92FF2C nickywitkowski
661,126,911 *4425BB31C7969319B851C3F7AFDAF24F6CD2102F HTAKE-IN
661,126,912 *44202706DA0C640A40C5A1BCEE3754A2103301C0 NILIAS12345
661,126,913 *44264976F3C46F9AECEBC04EF1C6D2AAF479ACCC HTTPWWW.JULIEFREEMAN
661,126,914 *442FD51CDF7041A1F1C5619C40E7E623B67F086E N+IU
661,126,915 *44208AD662D7497FEF2F7EBA0619359329A74BC9 humorouslinkno1
661,126,916 *44286687EF31936DFACE64435C2AA189795F5B13 noncom
661,126,917 *4420745A116EF6E1CCBBF80609EBFCDF27F4F089 numbers.of.several.bellsouth.911.specialists.in.florida...if
661,126,918 *442F17E8A70ABE4776FA5F38CDFDBADDC49F1918 nututi
661,126,919 *442C25321E93F9AE0B03A8FC08078ABE8A1294FB [email protected]
661,126,920 *442833DF9C86B6DCE5179B283F261AF3B8F2EE6D [email protected]
661,126,921 *442D0084944D0AEAB594CDDEAEBB19ACA067BE91 OIKISTS0
661,126,922 *442888C6B544B66CAF860AFDF3BF610275703FDB I-FOR-AN-EYE
661,126,923 *4420BCCF3E111E366CD7C744F01FC6D5549846DD i'k(
661,126,924 *44273C0AE5AB6307BD3EEA39BBAC68ADB8137CA8 omavavella
661,126,925 *442971A354F7AA041FDEEDCF08114C78FE23B15D Inbassat
661,126,926 *44226F2DACB3184F23C4FBF9379691553AB310BC initdir8
661,126,927 *44296FCC5624B4A21D4084E1E885078330F4B1BC [email protected]
661,126,928 *44266D3FB929500D6B94EBBE43EBF1DC78DFE0C4 [email protected]
661,126,929 *4427C808838E85AB281E9261CE2913A6F1D0B6F8 IRENESALVA
661,126,930 *4429D5F000654368C0B4C6690822AD51B9415967 ISAACBASORE
661,126,931 *442C8317A3F4434ADB66D0B1F1111A4768532EDE <p><aname="n_576_">576.</a>bowles4/2/98gjat12,65-73.
661,126,932 *4423F8CED1FC382C462704335EA5DBE0AD982C29 papendiek5
661,126,933 *442E23C325A15AB0BDF25A3B9448695C417C3CC9 itzgrund5
661,126,934 *442AC8CBB04A816AFF217A98204D5C5F7DF1B2E1 IZARRAGUIRRE
661,126,935 *4422E336A57C6565160DF7082C0AEA83FE2C6320 p------D.~.~.~splat
661,126,936 *442046F86B2A80E08CAB05B4625761548F4B94AE PENANGGUK
661,126,937 *44215EE96C54C02CBAEEFD14D733C1335CEBB495 [email protected]
661,126,938 *4427FCC1A4C8657C4E13884F947F2F01B80DB0E6 jamisondittrick
661,126,939 *4429F4BBC958A6B3CC45F8DEE5B7C62E01A8B2F6 JANNCC
661,126,940 *4428278B826E76F5ED3E99D7DB18032FF772A0C0 PHYLDUS
661,126,941 *442A2FDC25404E1A760B3CF99587DD0DDDC8B5B7 jeannie.olson
661,126,942 *442DE3F9FA7CAA2654D1CD1C581CE43DA56BB88F piano-trouble
661,126,943 *442E68396077A94B6D1B691743F9EE8DD1B5FAAC PIKASELAUSMALLINEESTAKIN
661,126,944 *442CBF312C609970FB6E07B5B22F1BCBD37B1623 PIRRUMI
661,126,945 *442FC0BA2A0259FAA2CEDFB4EA9F1C542F960299 JEROLDMINSKEY
661,126,946 *442915479A36E505F16B2CE622D5058D62DD88B8 PLOTSOFT2
661,126,947 *442148713874468E3221632781F9C0009E306820 POMMELION2
661,126,948 *442A42E5913ADAA6CB921A6D5DEAE9FFAC898B24 JIMMYHBORONGAN
661,126,949 *442923C0E6CB168328C1CA065D23639710A59462 p=====p~0~o(x)
661,126,950 *44289D408E331BEF2693094053788F39425E3F89 [email protected]
661,126,951 *4426CAE27C95E658E726E178A2FF459981620E82 joanstover
661,126,952 *442F1EAAC04B3B089B27EE9600EC738EC77A2D80 pshfiste9
661,126,953 *44280B3D5D1062B68D3B3A9FE35B4497C4DBB411 PULÌE
661,126,954 *442548CA13C1F4054706C50BBCB9BC21131462F2 PULPATONE3
661,126,955 *442DA3317ED287518C8BF84F57FC6C1BD0BF3EBE JOSIAHBRAZILL
661,126,956 *44236EFB13312E3ED59A93F09BC2B916912F7EB9 JOURNEYTOTHEINSIDE
661,126,957 *4421C55C5263D4C0FEB05965AC38C903CD122D28 ,Q7<
661,126,958 *442E51BD9D2A24BA68A5D2CF739DA16882EAE3C0 qazws1234*
661,126,959 *442FED5AED37D682871E80A71981A929DB5488BE JUZBIZNES1
661,126,960 *44219B5D0C8395A949A2455C4CFB5C9DBE3C7625 KALAKALANG
661,126,961 *442263B3F523BFACBE04C0E5FD92B6BCB230DF7E KAMAYA.MITCHELL
661,126,962 *442E164AD74476E87B6954D8916BB4F2A5F5FB37 kameroen6
661,126,963 *4429D1B0F069FEA7FD8FBB50E6B92D29DB716D09 [email protected]
661,126,964 *442F035233D1CE000660B582C855AEF1BD44B7FD R4CQU37$
661,126,965 *4420BDAE0E87285626A2E6B6AC262D03BE1E05BA KARPETE9
661,126,966 *442C04CBDD62E6E5BCE50A352856956408169DAC RALPH.JODWAY
661,126,967 *4422E2356D61510D3A945EE01756F6AAE9CAE2FF RAMIRO.LONDON
661,126,968 *442AF2F8150BB311692942CDEE8BFAD37A617ED1 randolphori
661,126,969 *442799ED94E7AD13758F0A92C0BA6C59CC288520 RANDY.KOK
661,126,970 *4427BFA73833F6A04AC5275AC99580BAAFC63E8C KEITHCOGDILL
661,126,971 *4421AF0CFD0BDBA27AADAE70A74E8C05E388A318 KEITHMIDDLETON
661,126,972 *442653E4BD5536956F17CFDBF35C432E25B907C9 RAUL.GRISSAM
661,126,973 *4428906D624B030B1AB8DDB4D3B0C22352C4612F RAYFORDDUNSWORTH
661,126,974 *442BEDEA9AF8CB85245E930E381E1AC499C14E7F KENTSWIERENGA
661,126,975 *44294CFA17C9C355B46B73719BB0950926C3BD6B KEN-WEI-TANG
661,126,976 *4423900DC7C083F22088E19FE8D800C29756C16E keri-jennings
661,126,977 *4423A121601F51BA99D4DC37460E14CA2C672E92 realhero10
661,126,978 *442415731E03E80CC07B16F152596C0CD72F0943 [email protected]
661,126,979 *442DE4B48D8931649D9FE99BC5E022D9B4A41766 KIDNEYTOOLS
661,126,980 *4424B7C2D60A15A3C012B545FACFA1FAD47E77E5 REFERER-LOGS:-----------YES
661,126,981 *4427E654DF7D7CADF9B02551BF308164BEDD8006 KNEDIIN1
661,126,982 *442C6637973E4DA551C33BFB96ABF7C2BEBD0AC1 kobart12
661,126,983 *442277F9752053A83AF9A6CE937E9CA0E3762A70 retemiced
661,126,984 *4427204B7154E7D931874B20572134585F339509 RETOOHSTOP2
661,126,985 *44229F6CF93591F3B382EE1EA0F36148213086AF koskoski6
661,126,986 *442D2FF690C0191CAEFB8877D8813B9B1075082F REYNALDO.MAZZETTI
661,126,987 *442EA32EF5AA98DD97F8D873C7B04306C66F650B KRISHNA-SATHYANARAYANA
661,126,988 *4421B02B9F041695AD740768E1BAC21829B75D2B RHETT.VAGOTT
661,126,989 *44268628C59147ED177F5402EA070B17C3331D2F [email protected]
661,126,990 *4420980B1B273F1F196BDFA27048B6349E8635A5 [email protected]
661,126,991 *442DC183312D4BC262A85C568C1423BB68768A5D richiesturman
661,126,992 *4421B94338CE86CE2BC683340F1614DF86456FCA kugk
661,126,993 *44227AE3FAE787E50A17575AEB68FBE3E7C94332 KURTIS.MATHEW
661,126,994 *44299680B4C09B668CDF7E959E3F4111C2487FB1 Rockman-4:-Dr.Cossack-Stage-1
661,126,995 *4421AAF7C14E524923874B037403006F0ED52442 lahdeeslav
661,126,996 *4420865F1002F6BF2213D423DF39AD128A30FF09 LA-MAZA
661,126,997 *4421A9419D2D2638988C2BFF1D111E5D87EB7999 ROHDOKSI1
661,126,998 *44207CC62FB7BC3F65105CBBBC2DAC4F46C969D0 landslides?
661,126,999 *4420AA8FEB22D058FE476C20F38CE1E8AE818BFE LAURE'ATE
661,127,000 *442FB815F9B8C4D6A7FF6DCDB70CD3C6FC061216 RORCHESTER:V(FINALE)PESANTEPRESTO
661,127,001 *4429C7A75C7FD5ECECD482F5FFFC54BA177C3C1C ROSARAYGOZA
661,127,002 *442DAD152EB6314D04F939535F3BFEB1AF1021AE ROSENDO.DRAHOTA
661,127,003 *44277AB9111300C017C27775627E1E25F23248A9 ROVEMOROF
661,127,004 *44282228387D577A39BA230BFEC6C414C4B2319B ROWAN688
661,127,005 *44233ABD112430AB8AFCCD16D1D07ABBEAB2B840 $rPS
661,127,006 *4426DE28C9E163967337A1C44B1EA98053BEA464 LEICHENHALLE/HOTELCALIFORNIA
661,127,007 *442FA4C86D9741CE4F8DB4661322D131948019F8 LENDERHOMEPAGE
661,127,008 *44202A3923D21E85428DB6563394FEEBAA606D59 LEONARDMARTHA
661,127,009 *44250AC5B2FECDA22D28222FA06848542E0D80AB LEONELGOODLET
661,127,010 *44246C2C416908DFAE66F4153BE3067CE495F6D2 RSLO888
661,127,011 *442F637AA7ED4A77385E31FA65C04836A197EA8F RUDOLF.WINETT
661,127,012 *442C57603B62B79694D6F87B741D662917711B0C RUDOLPH.BELSKY
661,127,013 *44296754FE01067F40C093BE9A48D2ED647E6219 LETTERWIJZER8
661,127,014 *442BAB8B9BA7AD4454FE999AE4CA75EB0718F3FF [email protected]
661,127,015 *442316F4B0EF975EB87E173413E292D9D728828E libby964
661,127,016 *44217BCFEE80C35C574A239C7EEDBC57BBFC805A SAL.GERUNDO
661,127,017 *44222141057F149256C7095FADD49A24E32B7887 LINDSAYBROUWERS
661,127,018 *442392E78AFD6E743E935E2B75A7A882C03FC3A6 LINDSEYDELROSS
661,127,019 *44288BABF101259387E2D1DFE27ADBAF5F276B54 salvadordraleau
661,127,020 *44232735FEB21E13E18A3407C10E47B473C01F7B LIONKING
661,127,021 *4420CFD46BB6B3DF2611DC782A85AB550CAB654B LLASAWS
661,127,022 *4424CE2CC6AA16D0C4333C1E0D02C9F3BBB9E413 LNOV
661,127,023 *442A67947D50CB97A97DFF82D105B926F1BB6D20 LOMA
661,127,024 *442E269148EBF19235AA1979BDB3C20C8A229419 SÄRNASJÖN
661,127,025 *4426F5CAD0DB07DDBD923AED86219411F8357B6C šatoras
661,127,026 *4428063AF0F5C4FB3B863A6314DC902234654A8C LORENYAGODA
661,127,027 *4423F54DE14D577538526FCAF87CF4CDA89D2164 loumcaleese
661,127,028 *4424BA9F6339619758CB6C2BCCAEF9F1CFF2BD21 SC4L3SM4N
661,127,029 *442B272F3DADA681E6F2027C6669A060D6226F10 LUIGI.MEDILL
661,127,030 *44216141F69DD6556338E7DDE1B5ACAFCF383EFE SCHOOLCAN
661,127,031 *44250B7C820BCA239A4FF4EB64F0C79F18E03BCD schoolhouse-shaped
661,127,032 *442A75BD412DF8F195FF579D407643441FFDC6E7 LUTHER.SERVEN
661,127,033 *44204D8F715DDFEAEB2CB6A46FC16A2641C785B6 [email protected]
661,127,034 *442B2AB2C7AF4E7FD339F5D3A7016A2035AB1453 MACKMULZER
661,127,035 *44224C4C2D2AD596B1C28C89C2CB4A2C0D92846D maclangeland
661,127,036 *4429DEBEAFE70B12872FED1B31EA2797A52E71BA MAGNUSBOBERG
661,127,037 *4421AAE3A46E21C272AE80245C891ECB574DFE5C SEIWDWT2
661,127,038 *4423884AAF18E267A34915969D256147AF151F14 MAJOROWINGS
661,127,039 *442775F0CA0527E7EBCE172EA10994DB7BCA1464 SEMIPERIMETRYING
661,127,040 *442BDF00847CBDF047385551A1A5E3957470B292 SFUMATURA!
661,127,041 *442F4BC8AE33BB95529986539343F69B624D2E0D marco-de-la-cruz
661,127,042 *442BFDF1185579C60C1107C9064650BFF417EC9B MARCUSPRENTICE
661,127,043 *44203B584A603E4979106535CF7DF3306C3517CE MARIA.EALEY
661,127,044 *442D892F8C6C6254706C7DD271BFF98EFF0A09ED marianodebarr
661,127,045 *442BA13DF25F3DF2B0CCC1EEF37D65CE07A37BEC MARIONSTUBBLEFIELD
661,127,046 *442AF6C046D0E7C8A0CF07A06F0D19B8847E5B32 SHIPS.WITH.HOLES.WILL.SINK
661,127,047 *4422E819F524E78F7D12AEA7A1244048B00BCB86 [email protected]
661,127,048 *442C8A466E31FBA5A548026F30397A5401F82F73 SINZANYU7
661,127,049 *4422E801BE9AE29B526FB45C0BCD8558E2DBF074 matsuyama27
661,127,050 *442E61AE56328DA710728C6CABCB78AE398E9E6C sixx-mixx-003-03-07-18
661,127,051 *4428149333AF249B9E48F3C5A44AC65989C0168E maya-whipple
661,127,052 *4426F0307DF281ACF9CA18F6BCE74ADA6958EC93 MCINETC
661,127,053 *4426C0BF00841D54645A53E48039626863A5889E MECET
661,127,054 *442D8AA72207E53DC9D28C78D9B1A6B87279399D MEISJAT
661,127,055 *4420B3C17195D2BB89E909929C2F50C5BEE22D14 SNICKERANNA7
661,127,056 *442200A0EC7E54F2AD8591623DBAFEBC25AE8C42 [email protected]
661,127,057 *442FD925BE08E2E05C5DBE489D2B3B4148B4B9F0 merlezelkind
661,127,058 *442C57A8242611B42D8E4FC574575DF962BEE95D songs,op.72:iii.kyssen
661,127,059 *442E20AE1E634D8BAE7E3FB8E06EE9429C91D480 SOSPENDIAMO9
661,127,060 *4422887C15A6DABE38079348A62100D34BB2B795 SOUL」等とメモされていた。なお、歌詞のイメージができた際、経費節減のため、歌詞自体は「
661,127,061 *442B4A26F838F372FF771B5663656964FD27C5BE MHJKU
661,127,062 *4425668948C050C82626F21EB59FAEDEECC4239E MICHEALUPTHEGROVE
661,127,063 *442A4682D56EA5C88F18544EDE682CFDF947805F michellevoeller
661,127,064 *4425165588CC404CCB0094DB8DCF925B2B15F9E7 spinulas6
661,127,065 *442C539FF3EC1C79411F7179499F62462C58AB81 Splat `d---p
661,127,066 *442E5F89FAE4E310EEF02EA4BD4348CAF37C6B96 Splat*-*-q===8
661,127,067 *44237C7DC455D0E76188F4511959F40B49EC665F [email protected]=3
661,127,068 *442E319FF04716C0979078D550A0AECBE32F274D SPOTALA1
661,127,069 *442881116DD22FAF771C9E957DDDA1953837B2E6 MJPRIGGE
661,127,070 *4427DAF79BAFA744D9D88B19F488141E384795E4 MODIFICATIONEU
661,127,071 *442E758CBC00D28CEC525C4536E3CB7B37AD6DE4 MOHAMMAD.MOUNCE
661,127,072 *44212384CB136FA31D8923B134DB2CAE5BA2573E STACE101
661,127,073 *442B97EDBA891D2CE4C7D19996151D0F501A9EDD stromschleifen
661,127,074 *442215040521F2A70C91F0AC8ED84A487A82047A SUNDOGS0
661,127,075 *442552B22A5B2F31F1EB6DC672DD3F1A3C718246 MPÉRAMENT
661,127,076 *442AE3BCE19BA030C23AE74E7451BD6BDC240370 MR.KREBS
661,127,077 *442D8960F7A3713FC64766FFD836D3305C63C547 MU1TI1ATERA1
661,127,078 *442803F6D4FFC52D2AE9CBDB3B6115008A75BD53 SYLVIEMERCURY6
661,127,079 *442CD3F63DC5A6BA446C2DCAA5F9CB6FE4F3EE51 SYMPAATTISEN2
661,127,080 *442C348C7365DB3779190E6FCB96599827A70E36 SYUUMARASHMIH
661,127,081 *442BDD95D8ECAC5C4A86898172F5D9B9EDF74A05 MYADVIL77
661,127,082 *44240329E194FDA864D47AF4527754D346C4DF35 TALKJDL888
661,127,083 *442CABE28D08E6F8004E1BBB4D2E8EBFB3570D26 TALKMAHATMACOY
661,127,084 *44223EFF0A1C23601AA8DEAAA1ACF2C57BAEE715 TAM-THỂ
661,127,085 *442C45F1F9E860B8F73AAD3868C1366F74228E16 TANNERJ
661,127,086 *4424AB7BBFD938D69B1D5468AADF6726632B7DED tanyia
661,127,087 *442988807747A1B5CBE63D3E06D251B579B65C60 naguyen9
661,127,088 *442512873BD3BB357831B1C09A4CE8EFB06955A3 tegumente
661,127,089 *44296F199446AC84127601BA949769FCAB35729C TEMPLATEFOLDEDWINGS
661,127,090 *4427F1EEF06E82701233E023EBBC8200FDCAC9E2 TEODORO.HINTON
661,127,091 *442DA85160F63779211F305628725C46876AAA91 teoriascientificas
661,127,092 *44252128C900F753844D088C63C960E0BDD66C90 terrencemaignan
661,127,093 *4422F83DE0100440A54153ABDFCA680A972FAE77 NATIONALCOMMUNISTS
661,127,094 *442168AFE73C47BCB8F9584487AD83BA88537C7D TESSEQUA7
661,127,095 *442D9B55946832437E409C4F8B08DFF06FDB8E3C thatpuppy1987
661,127,096 *442A3EC2BED0B4B4C35BEE344AC0FE163D17B0E1 THEBELL(EDIT)
661,127,097 *442E5F985091950445788E8EF5728DDEDAE3715B NEIL-MOMBOURQUETTE
661,127,098 *44294D017F5E77384D550A8EF44FCEEBC63255F4 [email protected]
661,127,099 *442B427AC92FA5CF1535C0961523E0E7E7AB99A4 THERON.BRACHER
661,127,100 *442DA26BC77BCCC8000008C09247340B5E50AB9E NEVEORT5
661,127,101 *4429A94594CF43F6F36FB049E5F18E3D155D0A76 NEXTOFKIN
661,127,102 *44252C98F4B21626D766DDD9FC84474A52D865EF THOMPSONSAYS7
661,127,103 *44244371BDADDF3BA4953B393682BDD63FEE2A94 throttled8
661,127,104 *442009DD61870F56378DB97BCE5AB5FCAA91E6E3 TIJLAA
661,127,105 *442E1599EBB2E4CCF354197C22D444706DA59FA1 niners1995
661,127,106 *44281C0D25BEC023F180AC1237CC07FCC6BF67BE NJATKOAS
661,127,107 *44267C0DACFB12A0F127F76DED979C6ADA1AE9FA toattoat8
661,127,108 *4426DC0BCAEB8F71FCCF77104431484B7B48C122 noncom
661,127,109 *442D0952D0E3F7CFE335CFC93ED9F689AB77B99A NORMANDRIVERMAN
661,127,110 *442217156C9A8DFB786313B552384E369FA778D6 TRAE.ELKINS
661,127,111 *442EF0335E5D9915D7378BE9269057DE0F27F3CE TRAN5MUTABL3
661,127,112 *4428D519247472EF3CEB7070ED6B9D5C8B9CAE4A TRAVISTIME
661,127,113 *44205AC87D97AB388BE63BB3795583E4D890080C trioineflatkv496:iii.rondeaux:allegretto
661,127,114 *4429F0756D4BD3B844C6B1FCC29F2A34DFF8390C TROY FARLIN
661,127,115 *442671C4308479D4E19D1E7B984E114CE0FF40D6 TRUCKSMAGNUMED
661,127,116 *44205A384489E9E499868B904558E0BD9B6255B8 }O{ * * @=8
661,127,117 *442B44210DF03F7EC55114DFD66F9D52DBA691C1 TRUNKWAYS3
661,127,118 *442261743F4634FB13BC3EBE8467078F52B4F18A TSCHFTTN9
661,127,119 *44206E6B3F78E2778C5E5BC4A9D56781EF693417 ocie
661,127,120 *4429D7D7DF0C622863D149E944455AB687B394CA oktalts9
661,127,121 *4420DFEAC8F2EEF79807B86CB49D3337CEF0F40D OLGA SOFIA
661,127,122 *4429786AD5F8D8D0FE57D129ADCC3E394D8E84B4 OLIN.DUNSHEE
661,127,123 *4425EC62C6E73268D745165DC38DD381F2701BFB TWICECONSENT6
661,127,124 *442A2B8A2D12A6771508B494ABCD586590DA9DF4 TYMERRACHAPMAN
661,127,125 *44226FE516414B398050C2299F20B2E01C0CD476 )O( [email protected]====B
661,127,126 *442229C68E5515B33DF533368B74BD16B213330E UNGARNISHEDUNGARNISHED
661,127,127 *44230E0617492D3C184EE435A485B2082FADA351 ungowned4
661,127,128 *44229F130E4ADBA52CC6DBBA91D5EFDBF0FC0774 osvaldoseepersaud
661,127,129 *4427CA378286DF629D1EFFB6ECF00F9BB35DF53C OTHAMATERNA
661,127,130 *4423126BF7ADF5246E9104A1C6CC010235C7E7B6 unmaudlinly
661,127,131 *442B98F84ACCBB0A15258C258A65F6328638E3E5 Usclat.Demileu
661,127,132 *44226D74E865D21E156FB4EA29645970357625DC USER74.74.78.39.AGNO
661,127,133 *44220621F858FDF35E423076B62AEFB961FBAEAC usrbares6
661,127,134 *442C4DC696DFF08CE135E8408BCF5DA1E65E0E4A paiks7
661,127,135 *4428FB1E9C41CD327295C023515731E8C335D314 van dirk
661,127,136 *442B862BD451915FDDE0B54D69C97EBD854D2A6B VAN.TOCCHIO
661,127,137 *4426586FB1D80FF1174D407D88E9D6DDDE755E4C PATCHOGUEMEDFORD
661,127,138 *44256F03CBE6F4876002FD3D2F09849AE01F3AAD patriciaburwell
661,127,139 *442D9BB3D1C2FC2977698395E0820CF3CF7947DB PATRICIA.FULLENWIDER
661,127,140 *442A6CF506B6106D04FCD80463136C4EB05F910F vctcgagb
661,127,141 *4427AC5B72BB8EF6F1315A04190184A645B2F332 patti-covington
661,127,142 *442BB971999D35A860C14F57A93B562E07A41594 VENGATESWARAN VEGA
661,127,143 *4429A9836E1E9F940FC3A3C50DA0DB1F2656196B VENU.ADISHYAN
661,127,144 *442B0140A8B20E922D8CB3A014E2D33E0C7F57EB VERDATARIQ
661,127,145 *442269075BE673A908AA41CDC6A742238E24615A PEKINESE
661,127,146 *4428A828FBEB1232B29B16C77426E91016F69FC7 vincehersha
661,127,147 *442CB33ED39DDF0192A0A81BECA1EC08A107CBC6 vincenzopugliese
661,127,148 *44270DAA280F8547A63DF6CBB41E58A69750AF7C vinodbhakuni
661,127,149 *44280BA3CA6005444EFD65E026256CFD575AB7F7 [email protected]
661,127,150 *442DF3B0A6934671BAF7B5F84B7CB68ECD1A03CA piquillos.de.corro
661,127,151 *44285FC7EA66D0BDC2130DF6DBB3F36D12C41D4B voldermot
661,127,152 *442FE9C2CE692E1EDD94FBD4550320DC60E055D6 [email protected]@[email protected]+35
661,127,153 *4426B9CC7E50F5B0E431398769ABA0DB0FABA218 WALNUTDESK89
661,127,154 *4423DB1E2C69E16136512307FF40B1B04D4D5264 POTTAWATOMIEN
661,127,155 *442DB4855CEA091AEE9743F1D7994ECC1BCD2409 PRANGINOUT
661,127,156 *442C08AF185962E2F037E6AE3659ED6B2B4B06A0 PROFESCH5
661,127,157 *44253EBB712CE0E01ACF1CEB0DBA66F810EB2E1A weizmannhenelius
661,127,158 *442033B44F4C43858CF0167E112DA69ABF9D1CFD wendeemanalo
661,127,159 *442DFD03F2C2669BCB5C16A0D0F4810E0F09CF44 [email protected]
661,127,160 *4424E06040C94DB8DD8A742E98E214BCA4FC6E07 [email protected]
661,127,161 *442B7AF1216C27C1698C32A9DEDAFCA42ED14924 puppees
661,127,162 *442A692F95B4415BDE60DFF17C79E67D3F0434C1 [email protected]
661,127,163 *442EF65BD3398725CC2ABE3A7E679C0101F10451 Whatever,Whenever
661,127,164 *4423D0FE3C87B3AED2A0C0C47152C62102045645 qc!
661,127,165 *4427ED05712F91823A3FF02285365EF5664C86A5 QUENCYP
661,127,166 *442480AA4ED339C9ABF3E688284433CA15ECDE06 QUINTINEWER
661,127,167 *4423F75FEC5F518B8DE421A56EE37B99D9CF6CAD wilmerdidonato
661,127,168 *4420B0E88B2575F26656068F116B509AC985517F wiltonzorzi
661,127,169 *442AAD1CFC3359AE8821F739093946AC0F1F83F6 winfredskidgel
661,127,170 *4424DD07359CCD76A96D8DF2479A17A6180BED94 RABINA SINGH
661,127,171 *442FF3868DD31976A843F0BE42CA5326ADDE1956 WITHYNNED
661,127,172 *44235D3051D4BBDC8B4DCB740A7E9128784B03FC RAFAELOLESON
661,127,173 *442B29024D1B56DBB48AAF3EC7533A65362EFB43 WŁODOWICA
661,127,174 *442EBE05D253A1373B50D554B70A46E015808D52 ramontoya
661,127,175 *4427253263C2A51F7AF4C4217303BA137010A024 WORDMONKEY
661,127,176 *44201B26EB11A21F7ED3FD9E9FC50152F7E7F87F wrong when you're gone
661,127,177 *442D8521CC52A562C3475E8B835336A81CCACD8C RAY.WOLERY
661,127,178 *44245FDEBDF3EA185409E75930BC6B5F9EC1057B [email protected]
661,127,179 *442FA0B1F103E9F85E09F89993AF23E6A3CB44B9 RECHNERNAME“
661,127,180 *442B461EBC97A633DABCE92443D456506C6D950F WWWNORTHCYPRUSDEAL
661,127,181 *44222E0CB507117A9E010C543DE417BD7A22EB5E reedcastilo
661,127,182 *442C1BBB5F47410F86C5C844BF5DD8BD998E3946 wwwweather365netin
661,127,183 *4420CD1184D3FDF65188FFAE9A6A73CD2253FF24 WWWYPO-MIAMIORG
661,127,184 *4427EFA3FC162133BC56410B4348E117AEB28316 REGINA OWUSU
661,127,185 *442BAF8D7FA86F4A14D106C2E90DCBCF17F0EC64 regiremjils
661,127,186 *4420EFBC2CD4F83AC7A0BE083E8A166808E585CB REINALDOLYNDS
661,127,187 *4428D8F3BD8B4FCF2B87B317E4428065301975FF REMEMBERGREGORY1
661,127,188 *44237C9BE5E8862E2B78440B9A461AC4764BABC2 RENALDO.HEGER
661,127,189 *44225CA49511C4CC01F0FA6DFC37E447A5EF3770 RENECHERRIN
661,127,190 *44298CE4108C64258186D63DDA5D88BA7CCE8170 RENEE VOS
661,127,191 *442E8690ABA3117ACB51F386A2C2C2CA72596C0B XIFRÈ
661,127,192 *44252A2A4E14E67BD07B1B980C19B29CB3730A6B )x(o~0~(--3
661,127,193 *442C16D7664C17543F60EA7A5B8B69058E18D9C8 [email protected]
661,127,194 *442B44439B5CAAD6FD2F7EC4924F94ECA23217E0 (X)~~~Q3
661,127,195 *442BC0AE7BBBCDB8AE582C42B2EC43749E063A48 yakobus.ping.tjoan
661,127,196 *44238E2D41C05CEAEC0F7C333760057B171FED36 REYNALDO.STAFIEJ
661,127,197 *4427655C7BA2025954A19CC1AFDC936090EEDAF0 [email protected]
661,127,198 *442D890D71207458EDD91126567BB19550692900 [email protected]
661,127,199 *442358D59A7B445BAD523153ECA962DF60475A47 RHDDB3167
661,127,200 *442F638E9EE3780DF31FE8DE5E1371C0851F193A yasuzukaeki
661,127,201 *4423520882C0235E41E7D18ADD4C13FD1BD24126 YCREPYGOLOIB
661,127,202 *442573E2CB07674FFB7216C00A864EB1155955B5 [email protected]
661,127,203 *4423DF435181E129B05BABBA05900C658E37C84A [email protected]
661,127,204 *4427D3485AE14B9E097210B8A6580E60AEEE38CC YHCUS-1
661,127,205 *4424275C3C740B22B48AD25D671CCF13A9DFB2A4 RIDWANTOW
661,127,206 *442E80635694F9BF851D514AC04B3BF4BE98EAD9 YOLANDA.BATISTE
661,127,207 *442E1108304952F5C742A99FC7067DB300B62D24 RITARHOADES
661,127,208 *4422C67EDDD3528B4BE6D7B7459BF9E56055651F robertgass
661,127,209 *442693E6E21C5318A4BA821413D8CC4966421F8D yuanng-mey-yuan
661,127,210 *442618CB39C849E9515A89F7A918E2155D273C86 rocky.lama
661,127,211 *442023731BEE99F0C919E4ED9529273528BB3F3C ZABITIH3
661,127,212 *4428F7DCDBDCFC96EF0E769CB57082AE5B84ED47 RODRICK.BIENER
661,127,213 *442E4BB60A4E03966D8793950FEEDBB5C968919B zahraddeen-haroon
661,127,214 *442B35905DB5E4CFE935CF0D39EF5FAAC8B58910 ROGELIOKOSHIOL
661,127,215 *4422327D2364D86D14E58B278D2E78BF754C4858 zaylabadajoscaab
661,127,216 *442357278A29FB7E8E689FCDCEA66FBC80F092F2 zdf'''theater'''kanal
661,127,217 *442DB0F24330830E8002C534ECE588B6E28E14BA ZEBA RAHMAH
661,127,218 *4420A579189A45B8054545B30FB944556491454C zefanyamelaiky
661,127,219 *442FB7C9F2DCE0D91ABCB748212B0ECFA6A55347 rory.ross
661,127,220 *442030BA1C7B434CE9417618AFBF6B4BA888C57E ROSCOEKONCAN
661,127,221 *442497647F79A446FE2D79BBC5415BF3C7D8E811 rosendolapora
661,127,222 *4425E74289E113A75F0D4A254872910F3F13AEE1 [email protected]
661,127,223 *4428538ED2768DB8DF06B77F93D10DA32DA442EF [email protected]
661,127,224 *442530ADCC09397205D95E1AB6E79A706C144B7F [email protected]
661,127,225 *442AC7092BCB9E19C433CF52179233A008A0C917 [email protected]
661,127,226 *44200E2E5500BFB7872B1C35E8C03CAB25C5054B Rules-Understood
661,127,227 *442785E1A64B51B7103975A8EB3F790F312C9C8D zivotni3
661,127,228 *4420F845F522F1BC1383F28B9637473CF5A9D679 RUUDULL4
661,127,229 *442005CF489E78BC45DF6F18F5BA5D35E5CF0789 zorica.jones
661,127,230 *4422D57E82597C049C33FC851D4B0C765638D10A ZRAC
661,127,231 *442ACE1BD18E3A1DC3E1EDB328C3CCDE2122D14E ZTJGUYTXSLD7
661,127,232 *442D05E573263C9E6FAC6C0425E8AA9E0D36DA98 [email protected]
661,127,233 *44234BFB7D7AD182B2CAD42C8889E194BCC2FD72 zwalenie1
661,127,234 *442D81213D97421AD9A8124EC2F18110E8203F12 sallycarrasco
661,127,235 *4427D45CFD12532572A3BF940CADF035CB314AE0 БОЖЕНЦКОГО
661,127,236 *44258C8E018A1E096EDEB675AEB3C55BD35125BC довбушанка
661,127,237 *442730C070C5611A1143CB1D47458A19948252CF «ИНТРИГАНОМ»
661,127,238 *44279E12E3CBA43D422AD5CEE3AE5619D0DC5E7C КЬОСТЛЕР
661,127,239 *44223620FED15677F27395C053570FB845058432 «УЗЭМИК»
661,127,240 *44253472EAF777A70A41F6229A9064122CE389D5 scrawnyframed
661,127,241 *442F0C73265945377B732E0A832266C7366F3005  голубчиком
661,127,242 *442BC88261192D618689F368B5CDC349059E0852 seth-abels
661,127,243 *44234FD4BC87C093F84466DFC7072A79D2420DE6 現在知られているTLRの活性を下の表にまとめた。
661,127,244 *4422243910DCF6CBC7907D2E28F0C0B970D5E40E [email protected]
661,127,245 *442A0350B9858958F2FCF0BC9B0DD976CC1B430D SHAVANOBSW
661,127,246 *4420DEC2C032B96CCA0B422D335F5D8646392EBB SHIBASHI6
661,127,247 *44234284F729AB4F0DACE04E67FC9867D47AE3D1 siartsid8
661,127,248 *442A3BE4FA512A0D99352D2DCF3351385FD5D631 (-_0)~.~.<==P
661,127,249 *4428831686C1F846DB067EC77D3E688D3D6AE9FB (>_0) ` Q#8
661,127,250 *442FF5F62147D7E0303968924F425A5110C23889 0WIBBLE1
661,127,251 *4427F076A86002EC7697021CF83F0BE3F34649C7 10-ROTE-SOCKEN-KAMPAGNE
661,127,252 *4425EA714185DE8A53C9CDFC71C9B68CBBBCDF13 1107733S
661,127,253 *4426FADE5DF5A79959E9F2EA7EB4C2A7691ABD10 SIT LIKE A JACK-AN-APES, NEVER OFF. BUT, BEFORE GOD,
661,127,254 *442E07BAC25F1024F06EDFB0F0099BFBE929E308 SKCOLIDLOG
661,127,255 *4423A35237E45403BF6F759F3A006DD3C5B643D2 136044OZ
661,127,256 *442F75F3C5CC8CBF1259A122580D913666D9383F 139I$147R3$$
661,127,257 *44285F873D756D3CC4D4DF5C2AC6B8CCCBE2BB91 slacksociety(straightouttheboxdub)
661,127,258 *442E39B4F4A76630050758083187C8650228D25D 15tanitma
661,127,259 *44287BC3506A79627D41CB7508962F4C0414DAC4 1680212 und geht dann weiter , zum fingerpieksen ins laborzelt
661,127,260 *442DC1B4095A7F2644618421645BEA1139A498E5 1788615 LABORATORIOMMEONSERTIFIOITUISO9002LAATUJ
661,127,261 *442E83618E81BB230B28E2EE1324F69D7E126888 SNOIDICE7
661,127,262 *44264C4A8914C0380635647347A441C5DEB83A9D 1855038 POLITIIKKAAVOITEHD
661,127,263 *442BBA9F48CC67341F68F2E8A93944E0E5DD0E35 SNOOPDOGFLOYDS
661,127,264 *44251E06E1214FD85A2919CD7FAA805782D3AC1E 18 PRESSELEUTE
661,127,265 *442BE9E304B79C0006C3FAB2BB344BD381045066 1902–MARCH
661,127,266 *4423175296E61456A29C45ABB1B266B09B7CE522 19.10.1332
661,127,267 *442238F36D761B0BEDF17C1042C1E708846A67C9 SOLOMON.SPINDOLA
661,127,268 *4425B33956D7113A29473F3D698D08A85A9E9076 1 atgeschaeftsleitung
661,127,269 *442B6DF608F2F2D685411F16AF4881DFEC09D341 1AUFENTHALTRECHT
661,127,270 *4424A82C55BA94A67849910B004962755024C731 [email protected]
661,127,271 *4425AE7C7B602EC7981478350B9C93556048D24B SONJAPITTS
661,127,272 *442F31AD3B6F38470ABCC8685E222050059F170E 1DEBRISER
661,127,273 *44293A667F2AD1DAD9ABA25BD27878817378A17F 1.DODGEHAVE
661,127,274 *442BF372D48E6198E224A40BC82B057F7C8CA9BE 1euvereinbarung
661,127,275 *4422826BAEA54D51FAE500C5AB64BC9ECBE57E34 1exult's
661,127,276 *442374B3A05F7E1DBEA8F3D5BFC904F332309750 SPÅRKVAL
661,127,277 *442A8A599723D0D41818FF69144125610B006356 1.gerilemelerin
661,127,278 *44254FEE900D7AAE61D90446B48604815DF5594B 1-HIETALALLA
661,127,279 *44275BE23E30B2EF2EA7C0EB1D34C146A0665FBE 1HOITOLAKKOA
661,127,280 *442257E66600893843F288498832C0155D64F9F2 SPIRITORGANIZATION
661,127,281 *442DB10449D4362BC320B18BE1AB7DEC0B634B14 Splato~O~q----P
661,127,282 *4422FF4D4279FE0D9A948217EFD8283B726C913A 1 KONSULTOINTIK
661,127,283 *44218891A4ED015FE2A28D6650033F09ACEA658A 1 LUOTTA-MUSTA
661,127,284 *4429DB62A311BEFD4302945ADAB2C059DA9E1F84 1 MAAILMA-URHEILU
661,127,285 *4425F38719DC58880DB1DDC8C3BA2E5439F67EE1 srem-sremska-mitrovica
661,127,286 *44280BCCAC440B7AB3A2049B75AFAB730975E30C [email protected]
661,127,287 *442862E4A38995D12E5E2F58D5335291C8325FF2 1-PREQUISITE
661,127,288 *4429D1D930847B3334DA3FD28B52C9B6CCA77EB3 1 primatenarten
661,127,289 *442D808E4E7C2F644A873D1BC3300ABACFBB2641 sserpmocerp
661,127,290 *4420C1FD346A95C744AB4D0BD16050633F0A666B SSURARAKUL
661,127,291 *442A22E8A9B3B654B2A56C147A6E2297CD8DE724 STACEY.AUSMUS
661,127,292 *442EB9D446A6431CCE3F3EDFD5A81D78959BC845 1-RYS
661,127,293 *4424F087AEE911C076A4878A0A70022DD02BFD82 STAPLEDONS123
661,127,294 *442754BBD53119DF99676ABC89DD0D2B35EC30F9 1 tafabrik
661,127,295 *44292EC100FF87837DB724E26A76974D51CC39A3 STCKMN182
661,127,296 *4429A8441F9B23DCB5F099F7B57C6F412FEB3F55 1-usa-odyssee
661,127,297 *44239027363866A8DF6CCBE1CEA228E2E1E87885 1-valmistuessasi
661,127,298 *4424C4DDE1D83DA64F43152E12B851CEA06D2A64 [email protected]
661,127,299 *442D6C97CA8A816926E5C24C70840FDDFAAFB4D7 20030123:.STARRY.PLOUGH,.BERKELEY,.CA,.USA.(DISC.2)
661,127,300 *442293FD23DA4B1BCE8392BF1C18860B6FB49E45 SUB0RD!N4+3D
661,127,301 *4423A32C4FFCEF7F0E7FADF2EE264CEBCA464506 SugarforMrMorrison(anewstereomix)
661,127,302 *442F825480E29BC5128A9870F8DB5FD3073E4455 2838107 theymightbemakingatenner.
661,127,303 *442C852F7AC78F149F8F471A025E9A08F4292707 287jordan
661,127,304 *44280713674036FBF3BA3C604CCFB63A78391FAC 2.ALLHEART
661,127,305 *442CE731A179A8EE8724BE267B0D18777EE13607 SURFGIANTS7
661,127,306 *44248B08DF873D55947ABD7D2EA9FAA88F70797F SURGERYGY.COM
661,127,307 *442214A9FE7FA4B043D517E5F6370900DAF22D96 susan-arrington
661,127,308 *4425F05478456EFBFB6C3AFB93508325C1694B38 SUUDAYAAMI0
661,127,309 *4427DEFCE882A2C101D847F00B7BC19CE04269FB suyogya-sharma
661,127,310 *442A82C06633CC7C013939BE878E2E8902983C14 2GASTONMAG
661,127,311 *44269D017721B6EE14FF1EB38DB41A0913F1E14A 2-hochtoupiert
661,127,312 *4425A4BF62DF5568E8EA1FEFD6F7257A7C2391B9 2 HUNAJAKSI
661,127,313 *4427846F9AD577E18B6B74C4E17BCFA0BEAEE499 2ITACISM
661,127,314 *442AD2A0AC9F6FBA3A795F2E02B96217283646B1 SWATICBM8
661,127,315 *4423F48030B6EA865D42893C289AE6003194AAC9 2-tevere
661,127,316 *442BA9DF0BAE26DEAF3EB889ECFDF0951C07DAA4 [email protected]
661,127,317 *442042570ED1DF71BD9536CCF09125B72A81CBE6 SZALONE9
661,127,318 *442992C531F1157F32DFE4DC6B155DEA091D372B 2URUDUUY
661,127,319 *442C19099EBA3FC3E24F702670F810226BA52BE7 2WARNENS
661,127,320 *44269AA69839BB352FF719B119EE0E4C1B3DCD24 TALK83.100.209.200
661,127,321 *442A6658D53C554FC6AB385827C99620D055E898 3ifaaa
661,127,322 *442C622EDAF3A921F22147F87FA3EC1FF2F11354 3THEJONATHAN0
661,127,323 *4422156C992C66AAF21EC7D1161AD1A3761B0822 439313 BEGUMAN-NE-,-TEYNA-E-NIYE-
661,127,324 *4423D9878F6EFC3662A00A10EAEBA52BA2BB923A 4550L31M4R31
661,127,325 *4427D256311B333EF9793E4ED3CD4E2CEF13207C 490193 UUSIIHMINENONSYNTYNYTMAAILMAAN.
661,127,326 *44299228028A7B7193AD64ED5B6A1CBCBB73FBB0 4BEUGELSCHAVEN
661,127,327 *4421C667B4ACF300487B45D19DAF730E6418CD47 4DUMPISH
661,127,328 *4428EA13EDE8ADAA7BA9A1B5DF34BE18279AB97A 4hosehead4
661,127,329 *44265094BF34B9242EFC2A1D7B7034BE9554FB26 [email protected]
661,127,330 *44270846F18CFFB9059E1AFB68860359B4602BCB 4RDVLPMNTS
661,127,331 *4426BBD990E7EE8F766AE68D9C03CB4D6C2485FF 4REVANCHEUR
661,127,332 *442EFC4A1D48E04A8166C30ACC47467DCEC11402 4TALLIUOM
661,127,333 *44221CEBE1BBB0CD4E42B02D5ECED176B245F544 TERRIBLE.EXPERIENCE
661,127,334 *44298EC9B0A26D9095D2FBE2063B2AC59DA21551 TESTING95
661,127,335 *44218189C624537CB07C092B0167BE52E4C010C0 5KRYPTNT
661,127,336 *4424030DD3E897FB6DB398DFCE64D9B5A94AE935 5NAMFAOL
661,127,337 *442F28D96FC00873C29F44BE605037CA93C83529 5NELLETSROOVSTEW
661,127,338 *44222D156D6FF9C0B60C1AA952E23A6401D9E154 5NSIVERES
661,127,339 *4429F27F528DD6E7F8BA05882330723E20FFF587 5PEACEWALTER
661,127,340 *44243EE919C640D2A797CBF597D8171D01CAA16B 5PIPAASITASYA
661,127,341 *4420FB74074BCE202989A398DD371DA0FF722AF2 5 RATSASTAMISEEN
661,127,342 *44298F78AA10116C1C604333D5B04E2DD0B0E7CC 5REGIPEIN
661,127,343 *4424402944CED29DE805E145216932CC84B196CC THE-ROUGH-GUIDE-TO-WORLD-PARTY
661,127,344 *44263C438875DEA897C81420688A69921FF23E02 THURMAN.FELICIA
661,127,345 *44275F261068D77B47198DDE905CD56821A64923 TIALEBTIALEB
661,127,346 *442C2C1775E176D59BF0F8B4FB8BBE7C4C075EA7 tigerbelles
661,127,347 *442213C71634DD4C2D3DFD56338BB280D1556CB9 tLetHimWasteYourTime
661,127,348 *4423169B84A480BD852B0EA1415AED56CA0FA1AA 6ATGRIPEHASSLEHENPECKKNOCKNAGNIBBLE
661,127,349 *442269631E11DFC581BC3FD4055086B417C74BED TNEMWENERING
661,127,350 *442D6A5EF7ED594800DB1C577A593556B5DAFAAA tobiasevatt
661,127,351 *442F5990D329A88DB5D1A046FDD4CF5B66B994F6 6DSTOMELBSW
661,127,352 *442A25F70D84B4CFF456E029D09DA5AFC2191A95 TODDLUMLEY
661,127,353 *442FB8C6789DF5D8FF71E9FD664752FAC7541125 [email protected]
661,127,354 *442906182B15C1FFD6A704A55556FB762CBCD15D 6JESUITICALAPPARENTLY
661,127,355 *442A58DF392700168D96B412DB2BDE537050763E 6LEDZEPMEDICAL
661,127,356 *442BDD32636C1AEE6C4729E64D23FD682C8503EF 6MADISONNOTHING
661,127,357 *442BD8DA3C223B5A1F17ED636B6420199E28CD20 6NECROMANCYN
661,127,358 *442B2400E65963564113FC27C58AED90779D462B tonia.reed
661,127,359 *44266E0F912333327AADCE8851E4EA1E05AB9A63 tonydeangelis
661,127,360 *442A2F446921DCBF2F179F218042CA1D619D6432 6PETERSCARLET
661,127,361 *442DADD4AEC178E228E74336DFFC5DEA9383D5AC 6REMEMBERCOUNTRY
661,127,362 *442AE720C1BA59B815F3FF9D9624D5B845B3AF47 torylemert
661,127,363 *4421CDB0CC84F37FE1DA4E8D943C45F137052CC0 tracycricket
661,127,364 *442C3847DE4595F0BA3CF19F99D1FBBC04F0DBF3 6UNSCALEDNESSES
661,127,365 *44232FB8B1B79E5E3283645C22F241BD567A2032 TRULSJORGENSEN
661,127,366 *4420ED536FF0DACF5D9098351A7CA6784AAB0A37 7BOSS
661,127,367 *44204808EF145C65619F817BF058CF72BCFD39BC TSERENE-ZEDEN
661,127,368 *442726FC9986D0A4D0D5392D4DB260B7B0F9546D [email protected]
661,127,369 *442D480A28C77F716FE6168D9A379C5D2BECF873 TSIVILIZATSIIA
661,127,370 *442696D18BFD3373736A8C6EA04EA924005BF1D3 7.kuukautisvuodon
661,127,371 *442B6146ACEBDB090CA7C4C9D282C0A2A16A4903 7LYOEDAEAENKIN
661,127,372 *442C1F03A817D2687D0575362E3E6FBEA0704725 [email protected]
661,127,373 *44256903E2D382074DA342FD69F6969AA0456536 TYPETRILLI
661,127,374 *4425BD961B016E36D6A8BA159A770AB50E274F1E tysonhosaka
661,127,375 *44216326594C1B176EBB8B05BFA11392160BCFC0 un-addio-(goodbye-is-not-forever)-(feat-petra-magoni)
661,127,376 *442F45D93957F836452DFDD1C533AB110C4F465E 7VNGENITUR
661,127,377 *44249B4B19DF3BE39FA4DA9D3B9905D991E4BF93 7W!DDL3$
661,127,378 *442739A8B84F4497D5ACB4A5B4C508D358A3457E Unity.Is.Strength.(feat..Charlie.Chaplin)
661,127,379 *442CB7A43ED1E34F6081B477DFD71E5EBB8D600D UNPOSITIVENES8
661,127,380 *4425553DF85442F4CFF0C379E2143A6A3A23413C 8793ab!!
661,127,381 *4421E6F1E3D6BEC5BED3F539B4772696BDEE9AD4 UOFHOUSTONED
661,127,382 *4427A4FB9D68AB84B1F2CDC0E6DD310124165FC9 up
661,127,383 *442F9E9EBC670F3D6AA1151C50950CBF9F394A38 8geschutgieterij
661,127,384 *442E31A3EEAE6F7291E4B924584489EFB4284545 [email protected]
661,127,385 *442B8E3319620DEA8D540BED59536CF905B5FBBB V4$EC+OMZN9
661,127,386 *44231A4C26B4B75031C6A44B9F5DF40F05324ADB }8{.O~.O~.D#B
661,127,387 *4429AA2FEEE6CA1335D9354CB87C3F3E22C8D3F1 VALIA.CHAMI
661,127,388 *44292F050874524066556B7ABF44DB606CCDD37B vanessa-nana-odwira-opoku
661,127,389 *4428F4DAAE07180516CF510D76566EF600827846 vanillaflash
661,127,390 *4425CA7CCB2FD5AEA2A555FC3D80DFA6633E52C2 8RICHARDPINHAS
661,127,391 *4427CAE91354B90E0BF2F2AD8696127B6E77690A 8SUOHTANGOEN
661,127,392 *44256CFAD6377ECB827EB64599364964F756EF4D 8THREEBOY
661,127,393 *442373CCCA23CF830F3DBD00A2880348AF79B9D2 8VESSANPOENTOELLE
661,127,394 *442A8CEAC6FCA0E4994B3CE59309E430946F0AA7 8VRHMNZNG
661,127,395 *442C63DCADF5AC7636E951A660DC114F53E14FD9 8WANDELBARE
661,127,396 *442A1358EF0AB12D934BBF33A3655B585E915019 948395 ".CocuGun.ahlak.geliSiminde.ailenin.rolU."..
661,127,397 *442CDDB52F399F48C3D0A62345D0C12D0B6697AC VERFASSUNGSKONFLIKT
661,127,398 *442F1A65936D1CD4A774ED3F551A454B3AFF90F4 verkraft
661,127,399 *442695C8A40F70BB75C778ECBDCF29B49035A557 VERSIVERDI
661,127,400 *442F63B9B1B0A7281171984603282FA276988961 9BYQUITE
661,127,401 *442318D0016F61CA98D1391FC9C86A11C0762FBE VICTOR-CUSHING
661,127,402 *4427F24584E419F1001293FF1BBEB73D6EE98562 9GARYVETTE
661,127,403 *442B4BE08447D2605C88071CBC8EE047332B0F1E 9GETUPS
661,127,404 *442C4CE98125A80CCAF172025F7A1693087115F0 VILLALBARBA
661,127,405 *4423F37EA05A025A14A4DF2B3D695EECCF7AFD10 VINCE.TRUSCOTT
661,127,406 *442DD5A285733C0DBD97150277E314118E628AE9 9ISIATSAD
661,127,407 *44209C90C35C94466283CB7BF49704B3FEA0A14D VIRI85
661,127,408 *442D272DF73FB18EDDD8C7E06672431AD270CEEB visayanwartypig
661,127,409 *4425BA2A022BB76238A02AC94801514012B2D089 visseront3
661,127,410 *442EF201693EBB0BFCE3E8F4D111DCFD4DB39BBD 9underfortify
661,127,411 *4422409AE45766AAFE8FFA26CCEB7C17CFB0F867 VYZYVANI4
661,127,412 *4429DA9478E3811991BD5210BDC13FD334016102 walid-elgharbawy
661,127,413 *442170D7036A909A1C4692FF9546B470205206B4 A7H5
661,127,414 *442F48CDD744CC4B5C0F464979A98A0FAD59B4AB WALLY.OW
661,127,415 *442948928C953DFB182FE0B572FCD19139F9A418 a88.!
661,127,416 *4420AEC6EA1D11E6077251F66CF6F1B7D2D3DE85 A9Z2
661,127,417 *4423E93BE47A7F19E068EC38D9A15DA5D0F6522C waynetgilchrest
661,127,418 *442E795C0434C4BB256E68CA36320813A2223839 AABXXW
661,127,419 *442A9CAC299062A93433B31DA3896A063495640E WEIHNACHTENMITRONDOVENEZIANO-SINFONIADINATAL
661,127,420 *44223601D9B8D152D1783A4E7916D0BA5EDD714D WENDELLHUNSUCKER
661,127,421 *44219BDE0FE7CAB471AA6A162AB55E6855C3A6E8 [email protected]
661,127,422 *442D44E31FC3660A38E035B987D898F2ECBCB2F6 aamithen3
661,127,423 *442888C116CD78819645E9AF55C70BB884336078 aarongolliday
661,127,424 *4421549DDC55705AF19D7BCAEEC9CA6757C47BCD ab5s}
661,127,425 *442B182272B6BFDEC0210009B5CB12C850B3D002 AC{O+
661,127,426 *442BADDCB7F0A3A36535527D9A70B2B3BAC7EAD2 WILLISLAMPITT
661,127,427 *442223112EA105E7CB162325D4F6E3497D8AE82B willloseby
661,127,428 *4420CFB69F4EB286A411085A18CC0AF393B4089F adambelarde
661,127,429 *442D74A2590859D6E0BF73EEBD0ABF9ED4189B01 ADAMHANDLOS
661,127,430 *4420268433E9CB768CA6FD5106A14BE75578E586 ADAMWEINERT
661,127,431 *442EF3F3C776089A48655D94C39132A51E890F96 aeh)0
661,127,432 *44253A18540445088B84283E34B9C4A3EC7E6DB2 WVGA!
661,127,433 *442166016899196A7DC4B20D3BD4A188392B2558 AFIKSAI
661,127,434 *442F780552E6977DE1DF9992B663560EBFC06FB1 AH,8N
661,127,435 *442BA925D4F2CA45AE320E68A26D3F3E82F7FADE WWWWORKTEAMSUNTEDU
661,127,436 *4428F07BB9908888B06AD3F35EFB36AE4321DC65 WYATT.GROSSETT
661,127,437 *4421CD5169434DC9C18DE1A2A206470ECD302A3C a;_hl
661,127,438 *442B546EF66E040B0642CB1E519280925292F245 AHTADIRAS
661,127,439 *442CC5D4488EF196104677667E36A4516CDB34DC ahterres
661,127,440 *44288C61354225E0D5E94E50DBB10422E2681E41 ai8qr
661,127,441 *44208AA2C366C4469EF8F1966A0B95D5CBD66D9A XCOUNTRYFROSTY2
661,127,442 *442F39837CF4688B4DD564A12CEAD57B82BB5341 aigsn
661,127,443 *4423FB60A2756E65A87ECBB4369501E30BF7D9C6 a$kff
661,127,444 *442EED471ADA18223E4070B82327AA5E3035F728 akpvv
661,127,445 *442014E4D67227229634DB6D949DDFFEAFBC9BD5 xpj8fys
661,127,446 *442310BB6899E906A55AA3BF1565EA148BC4D94B alb)
661,127,447 *4421E32489C698637F576AE71DA3DA867CA1C195 XUPINGUI
661,127,448 *442EB2610DF5B179EC950AD45D2E3427E4F86495 yanesi-fernandez
661,127,449 *442E5193ADFE52ECCF28BFECE7893A5E486DCADB [email protected]
661,127,450 *4423A8C3A170649B635F88E82031C178F53AF453 ALFRED.RIERSON
661,127,451 *442B68C63FAF771F4BB06673E1BB4B79D48064FC yaseminkalkan
661,127,452 *44257B2AF589796DBED0EF3E08018DC32EC69FAB YELITZA.MICHELLE
661,127,453 *442A1BC0D9EE6E3B213F2C55E07972DBDD8F7BFD Y:H
661,127,454 *4429BEFE19B08B80CD495744B750A7F19F44A3D3 alright.okay.you.win
661,127,455 *442B6B35A5AA683EE242F2D33E73DF1785227B2A YNANYNAN
661,127,456 *442511AA16805397E20143899A7029BD4BB85537 YOYO900
661,127,457 *442F47B1655EB7B411AEEC8E0FBC8C12AEC4CE40 YUME.NO.MIRU.KANATA
661,127,458 *442ED37A409E71573CCBA6F73B5289AA5481D007 zachariahfarino
661,127,459 *44265705E2D9F3F8F5BF95571F3424A4577C3CED amy.viens
661,127,460 *4427F8943CF2F90CFE886BE8A10507B5C184AB5A zac.svidrony
661,127,461 *442CF6CB004FD705CF88D5C8CEB887C135B58318 an.affiar.to.remember
661,127,462 *4425C17E539977881DA2752909DD75FF0C41BA16 andersonsesser
661,127,463 *44278AFEB091265DC86E18D386C82E25049F057B [email protected]
661,127,464 *4422EF2AF5BE4691665BBDC643DF6EC51E26F1ED [email protected]
661,127,465 *44284ECB4690438FBF13EB22E4B99403DAD3E7D0 [email protected]
661,127,466 *44222F82119912332C32451D15A23F168CFDDFE7 [email protected],[email protected]
661,127,467 *442B87D667431B19B4CBA40D4F785D3D426C2145 [email protected]
661,127,468 *44263DC56EA92BC352CFDA4C8FB1E1C15477C7D7 [email protected]
661,127,469 *442BCDAC1E824BC727DBD252D869738929E3DC6D [email protected]
661,127,470 *4420241DBC66E9FEE918D3DA1DBC9873D1386D72 [email protected]
661,127,471 *442FA118602F7371911E4E48CF6C1632618B095D AnoA
661,127,472 *44261CFA5C3F7B1A17311015628286D12B687B6F ANTOINECLODFELTER
661,127,473 *442D2120150418EC69FEBE34D33B018F0A504134 ANTONIA.LAYO
661,127,474 *44205D9447E6F129F47A502668C342667C1E35C3 AO0:,
661,127,475 *44222C7B9864BF59BD0A0012637E37025AA4B9D5 AOO
661,127,476 *4420F64E3EA9C85960D73B16B36A4B9E90FAA5A0 A;,QB
661,127,477 *44289FB8DA003BC784D4BB6E6EA3C4507585F030 „ПИСМАТА
661,127,478 *442D0CFD2E2EDC6183B82940BC6022EE804C72F1 arebored2
661,127,479 *442A603C8EAA1C80346EBBEEBEF2F1F19E6AB769 розораність
661,127,480 *442F3E3A802B8284BE7DA88320C5DAF622701F8C УДОСТОВЕРЬТЕСЬ
661,127,481 *442A7981AE342C06E499E4F73D336C0048FEDA12 шетнала
661,127,482 *4427AD2EE633E0E2836A77BF91B642C1843B3001 ASFICEP
661,127,483 *44252C9656072F0A55F84FBC5F79F4B88865C35D asherim
661,127,484 *442318679F4A86BA94A34A8B08607995B7BB2B53 A")UO
661,127,485 *4428322F186C403633A0EDC8C3C7CF587C5E141E B35GB
661,127,486 *44217A88C89959580762971291FFF26A12DF6C95 barneyjankowski
661,127,487 *442C6D29D85A954B9271E9719054BBB28923C353 bartondarosa
661,127,488 *442093965F64F3DD99E1264C19B81770CCEAFEF5 088683821j
661,127,489 *4427C1CB645609556F6E453C0008D1EE0C96D387 BA#V,
661,127,490 *442F9EC4B92C6E0474D04ECFE285B0AF1647DAAD begrebsm
661,127,491 *44222AE92D91A82AE3FF4A374A713B2E87644FF1 BELLO-OLASUPO
661,127,492 *442C2C12BC1DB924228D3AB53639D313C4BC4192 BELZONIM
661,127,493 *442C1F4C9B05D982ADA3BC21F141DE4EA3261384 178ANDREA
661,127,494 *4422A60FA06B9161228419BC7FD25AAF36D8440C BERNIE.NWAKANMA
661,127,495 *442DB364947991D3D1E01850598266DFBD6E9F0C 1COLAGETRAENKE
661,127,496 *4426534CB205829F7A8D6F5A3B312B4BD1C46B45 bestattungsseier
661,127,497 *44260DA74B56E6B7A614E9B6743C890290475490 best-guess-is-about-5,000-people---of-these,-i-would-guess
661,127,498 *4420FE01548C60F250E70309FACCE4F042EC941F BFA
661,127,499 *4426C8EC02DEE0B47934589841312D1190885776 1.non-parisian
661,127,500 *442741D3CCA6F853212B2F3B947E5F1A476DA552 1-RAKENNETEHT
661,127,501 *4427C4955CAC2181928048557F4142F940D61E63 1.respektlosschlampig
661,127,502 *4425BAE3F8D654B44DC2DC5F928F40AD80CCDF1F bodickhoff
661,127,503 *442D0A0FA8ABAEC6BDEB5C8B644D54751A2BF0B5 20121293
661,127,504 *442A4CA53A5C7083BB0694AA64A135D3994F11FA BOONIE_CHRIS
661,127,505 *44266D5D35559F2514B862E984295CFE69B1E6C4 212HANA
661,127,506 *44298093644D65D0A2B52C895A9762FEB68C76BA 2455987 fieber kino , 19 uhr , jfk
661,127,507 *44223E4B2CD7BF36A5F27355E3FD6D54DEA409FA BRABEION8
661,127,508 *4427171863C59AAFCF829A667D726560A9196FFB bradlyschap
661,127,509 *442BC7EF2AB76136C6611B35A0845A5BF3F06BBF 27MARCH1357
661,127,510 *4421C65E32BD47F41CE12C49387909F441511593 BRODERICK.BULICK
661,127,511 *442501D8C0BF7FB80AF4EEB9A778AD91DDABEB1E BRODERICKCOVILLE
661,127,512 *4420BF851F107539C1FC58C525C9E3A6EE3994C8 2bankenvertreterin
661,127,513 *442AA8DBC31C4D214846B09A3DA221EB3C38997B bsftm
661,127,514 *442236E4CD7E9D0E57F59F2D715034264D8D0341 2tabansIz
661,127,515 *44209FAA615AD1A06CCB5D8E381101ABA45B7776 30514 seither.stimmt.nichts.mehr.im.suedbadischen..
661,127,516 *442892B9951FB0E2565105CD6E6A41D3D0DFB335 392227 zorlayataktankalkti.
661,127,517 *442199BEC0EB76D24207B40DE3C896154766D740 BZT$%
661,127,518 *442562A8B8D10286002A1704DF6BE8F1EC9A50F6 3---)~O-(x)
661,127,519 *4423BA34D0B1290A8A0285964539145187BA0C48 c&=4k
661,127,520 *442F1DACF91E2F921817EC7C5249F12D8F052387 c5ds
661,127,521 *442B1193F46A72CAD8EFD74E713B2508372C2DE3 4GLYYNGE
661,127,522 *442C20167AF184D3147D2C86CD731546CF957D60 caq5+
661,127,523 *4429CA31DF3CFB64B36EC6982FBA0B451F6F8816 CEHW!
661,127,524 *4428A5372C2E52C66665372ED3BE091D80F265A7 6BSWBREAKCHANGE
661,127,525 *442AB6986FA3F21BDECE3A336451AB546DFBBFF0 [email protected]
661,127,526 *442457C2F3B540E9DD5A8F226852EDEFEA644E7C changmirarchi
661,127,527 *44284C9F9178F329C40519933CF27130898E2E32 CHANNAKESHAVAV
661,127,528 *442C0968FAF0A4EB891795140A798A63A922BBBF 6LAPPATURE
661,127,529 *442A188D3476B388BA3783D644005F5BA00B3CF5 6SHADOWSMUSTANG
661,127,530 *44283D5E9EAB6849DF5709B6731820FD96DCF73E CHET.STEVISON
661,127,531 *442B2FEC34058A5972BF1B9D422F2CDCC446AEFA 707SCOTT
661,127,532 *442E6BAF132A0431638C34E0422E92C4A8B2AFF2 chieno
661,127,533 *4424FB4202CBF0D3120B6590ED5AE8E153ABD203 794405 SOLUNUM-VE-ARASTIRMALARI-DERNEGI-,-1982-.
661,127,534 *442B7E4107446B9DE2E83766DED4642A50BA62D6 christianrabeck
661,127,535 *442221F54311D0519F41181DAD9D65E20740FEBB christopercantara
661,127,536 *44261BBFC01BDF8B418116FFC4FF3E6C5DB862A7 christophoriana
661,127,537 *4420DA8E1E784588936FA6B39AFF527CC591DE65 chuckbassler
661,127,538 *442F20270D329CF093C90075CB45316965FCB750 CHUCKLEFTHAND
661,127,539 *442CC0DC1EDE747E3A41DB06EAB34E444DC8956D 7CHOKLUT
661,127,540 *44207E845A42F4B1BC410EE022FF70D4B302C501 7ENSPHERINGS
661,127,541 *442820C50CE43C14A41333D58A232EFBE65D3C88 cihr1
661,127,542 *44247804ED8709A70DA19BB907D2E072260EC873 c,l8
661,127,543 *44291AC76F3C71FD62EE933680F5AE76BC87DA07 CLAYDONAVAN
661,127,544 *44283E05236DF81F2360445A32E2E24AB59FB7A7 7RESURING
661,127,545 *442D0B81E8BA75D9EA2C11044A6804115E477531 cletusczolba
661,127,546 *4422D74B861280B8D0316D4CB1028051ABB42BAF CLINTONCIARLO
661,127,547 *44286C4FE1BC501CE2F3A29A0A0987945B5AF9FB clt?2
661,127,548 *442CD7A59FD9D1F18B7172F20917AE0F3678EC3A 877356 bunlari cozmus degilim .
661,127,549 *442CA700640B7E199652CDAB19E6AC124EE4A003 8ANGRBODHAN
661,127,550 *4425659DEA6AB5F99D443292F67F80509CA42F77 8BOSKSBOSKS
661,127,551 *442CFF6987AB25ABC54C93C0E9104F42A2456FB9 8CHANATTHA
661,127,552 *442238EF5FB68EDAB185B8B6C6389E8C29B86863 CO9_
661,127,553 *4423AD9B27351A6C44AAB6B098B83038E65DFB99 8FORMIDOLOSE
661,127,554 *442B73356CAE295693D152F71EED4FEDD5843634 cof-b
661,127,555 *4420F9CEA71B56DB19A584E70039823F8D484168 8HADJITHEODOSION
661,127,556 *4422EE69F3B8B5770EEE622CE33C4B37C8078A63 8leistungseinschraenkungen
661,127,557 *4427BFD42CE4B365CC233E48CE4B0F7213865D44 8LIBRARYCARL
661,127,558 *442359E017802E1143D50C17A03AA24B7A2C6A4E 8ONORARIM
661,127,559 *4421ACD2A343645B9B79AFA5C0F021E31682D6D5 8REEINGEFLOSSEN
661,127,560 *442B6537A921B4FD7E85299B5A15BCAE472910DC 8SLETHCAW
661,127,561 *442033EC014A25C36A6213B733428B77D6E812B6 co$(q
661,127,562 *442C08213CA545A9C4C3B768AD5D1BC027017212 COSTPERPORT
661,127,563 *4426FF3F659122BC66FA36AC98B16F7606E16A8B co+)t
661,127,564 *442EC6851B23736011D1B91B7377BF668417A2E6 941360 kizlarina-kizgin-degildir-.
661,127,565 *4422CBACBA47A2F337ACE9ABCC4565104E5A0971 [email protected]
661,127,566 *4420FD9D5CFB0EC8B25DF51EFD2E3DFCE3683BC1 cozier
661,127,567 *44292B7C9A4532F3E3EF0F016693D5FB948BF0E5 9BARROCCIA
661,127,568 *4423C07FDB975331A00DE60514472403B697C50F CP$I/
661,127,569 *442C5689AE50AA0328C36CF75C23B05CB56870E0 9CAUSAND
661,127,570 *442325A705C118549296DD34C91B7AA234D2671B 9chairmanned
661,127,571 *442537551868143C190CB39239F72A83BF03EC61 CRAIGSANDLE
661,127,572 *44270D14716EBB4162380B6EA5E82CB7684882C6 9LUMADUE
661,127,573 *44282DA78B2AC8F75A2AEC60FF292D2FAD4FC542 cripplegate-(standing-on-glass)
661,127,574 *4425FF807AA1C298804D742C1F7D49EFCAF4EDB7 9SAHITAAVANILA
661,127,575 *44282AB187058360D5F4F1D32BCD6AEB344D1DAC 9SHORTWARD
661,127,576 *442FE96231A810D355FB74B60E8C88E421ECF930 [email protected]
661,127,577 *44224DE9B7FF532EA19265E81BF864859471BF1B 9SPAZZOLEREMO
661,127,578 *44252232435740E46101CA8CF0C25DFACA81F4DC cu8id
661,127,579 *442436F21A84D6E231D4C7C6C7EF0B84D9195263 9XLMTHSDNUORGFERH
661,127,580 *442A66C5DFE25DBEFF8209016C26653EC7DC3970 C#UNW
661,127,581 *4425582C3F216B00D16A2A9CDE42940486A05AD0 A12365286
661,127,582 *442FAEE7D11B63B101DDB9B15100B882F4F1EB30 CUYA
661,127,583 *442A8007898CED8F4DC436E1F85ABAFA5A301BFA [email protected]
661,127,584 *4424995ACD50638D40411E1AC22613872F2AAE65 CZEBF
661,127,585 *442E943A3073A76782FD271D407AC72E1E17AF06 AANDMONOGRAMMING
661,127,586 *4426102131DBEFDFB710446F3FA7A8F6A670BA0A D6?-B
661,127,587 *442898C79FF5D79CE324462CCBAF4AA584923EFB D$7NGU$HA8LY
661,127,588 *442631FE9DBFFB76618D8C097FCD364D6BE3C7D3 ABOOTLAIR
661,127,589 *44256C08A9F3C4C30BD964EBABA8B2F67D6CA2AF aboutbpwhistoryvol
661,127,590 *4429B0DC2CF37954C24D9D8CA755931C58216E61 DAMON.VANSUMEREN
661,127,591 *442D561C9DC6702F543E1125DCC0160FE8A9EA64 abutugab3
661,127,592 *442B55F8F42765FBED05C3C73F8D1EE0C0B01999 DANNYLEGGAT
661,127,593 *442476613949495C251A39730082E82D3D52EB9A DAN.POLEN
661,127,594 *4426682D3DF9AC75D908EA6539629869CA638D89 achh0
661,127,595 *4421835BDE528E38E550C64FB0E922D322618CAA DARREL.ELGAS
661,127,596 *442E1BAB5F1824545504A77878E10585473293F1 DARRELLKILBANE
661,127,597 *442627C8C7C6E13D07875936E373138A44A84760 ACUSTICOBAHIA
661,127,598 *4426C8B11EBA7B535210550D6C8BCC7F28F4DCDB a!ffi
661,127,599 *44235617E7F5B6B82FE5C8DAF82D5DFA79C7E38B AFQKN
661,127,600 *442E9EB03DF849E80C77A50F5E8DFA1DFE0776CE agqpo
661,127,601 *44277847CE57E27891D8B0DE3CF1AB6FA812F806 demarcuszbikowski
661,127,602 *442060AA56F54FCB7259D895EEC52D83195BB057 air-moldova
661,127,603 *442D6F8C21CCBBA05D5C37C5B30E38D04FE3A679 AJ6HM
661,127,604 *44200F68274C4CF488C5C616066F1EEC271838BA DEREKGOLDFINCH
661,127,605 *442ED119E30E868798C98201D38DE896D6B4AE36 desmondtregre
661,127,606 *4427BF830D147768F5E3DFC53BE783787684163F detherage6
661,127,607 *442FC50855959C5A27C9189870F83E5E1FB85D8B dexterleithiser
661,127,608 *442FB0D96CD6EFA3EB2795C91B2ECE02D0970604 df9wy
661,127,609 *44282D80EFFA2739B4EDAF41647C08B3C795AD3D dg?q
661,127,610 *44255ADDC3F30DF9080AAB2DBF5AEB4ED96CD0AD dhfrb
661,127,611 *4421856FD13003C83A98B9578A025870B14D9EC7 DĪCĒBANT
661,127,612 *44275F5073C8830E4F49F80AB6C9149BFD28978E ALLEN-CAO
661,127,613 *4429CFAF38949E389C54397FA626B0A123ADA24A DIDA-MAULIDA
661,127,614 *442E5BFC7760C011259108444F578ED922356E55 DIFFERENTIEQUOTIENTEN9
661,127,615 *44286D816BF555DBC0696782F44571ECF252C8AA ALSDANSED
661,127,616 *44282B643D65350A61C68A897BAD6121AD0A306B DIRKLEDAY
661,127,617 *442AFA485E48B894290166307D831E88BE25506E discarders
661,127,618 *442B05DCE5E2F1BD3C36A66C4DF3F7ABF964D094 DIVYATANGRI
661,127,619 *442E126026832457D005FBECFC6848B77642A678 dkret
661,127,620 *4426D8DF80EDE33B573095A08C1E645B96B0B387 dl;vt
661,127,621 *442A5F66AD091D98C2A97B95C2F39AF4138F5695 ANKARAVEGASNITE
661,127,622 *442F77506BA46DF16B1E0542AFBFFEE0B521A519 ansioty9
661,127,623 *442F47010BC82E094AC0839D834FAFAD322FCE9E DONFLOYD1
661,127,624 *4424B66FC073D325CCE20C8F4C09CE6AAC0C7EB2 dongolevera
661,127,625 *4426BBCCEF7318F080D3CF21370A7335152E411F A"O+#
661,127,626 *442AFD0DAAB076EB7CBDE81D372A6D4BA42BFF7C AOO
661,127,627 *4421C104FE3C82FAC290F19B96C4BC3FAE28EBDA d;.qm
661,127,628 *4425C50181D465E4D103C22943EBC93264393F35 DrumTalk2
661,127,629 *4420D47DB4F0C85D6462D4F4E6C2821EF1EEF3FE dtllh
661,127,630 *4424C59B4CDE90904D59A3930B3DCF1B5BF1621B DUDLEY.MCCURREN
661,127,631 *442F758C460C998EDA2DFB26F507A3E7DD128746 dudleyreiff
661,127,632 *442924CB78B94A8F384E46E028EF49716F846A90 dudpt
661,127,633 *442DCA5E6FAD74EBBDD21D29342B0BC9FE82CACC duisantes
661,127,634 *4424F8C9E08EFB9BFAB764C7A62E33E1A8889805 dundeediana
661,127,635 *44297CE2859599CE39A2C49ECDE08C40CA8A47C4 DUR481TE$
661,127,636 *442878FE5781DD3E7E74146F42E042E1368B7140 at=r-
661,127,637 *4421EC73960FC69E39A1AC54291C5DA818D36312 ATSEUGIT2
661,127,638 *44275691578C04079D6560D9F819725C20DC960B DÜŞÜNÜLÜYORSA
661,127,639 *44208E194837C085A5EBFC9151C2E2133C70F848 d!vs-
661,127,640 *44260B1C585DA634B99AE27EA09238AA8FA2B41C d"yc5
661,127,641 *4426567F962824102D66EA7A7BA4DF312D0A841A ec9yd
661,127,642 *4426315D64C788E27EBDE3B7B7B6007380FABEA4 ecne2
661,127,643 *442BF47328F9752EA43731D07F5FD05F653E2FFB A=,W
661,127,644 *442BDD303CF4F89832E1693AFE88F6163E2F5826 EDISON.ARTERBURY
661,127,645 *4423690DA6C7506C25761DDCAA864C699D266CBF awv&
661,127,646 *442F0B63C5270D38F7E8DCCEB1A4F063E6FF22CE b",(
661,127,647 *442BC659F41958493496EEAD1ABD104FFFD8B09C eheschließungsort
661,127,648 *4427F948C576BA230B7CDA7F60F5AD6ABFD0F535 BANANATERESA
661,127,649 *44237AE244ADAD8DB5F86E367E3FE8C33DDF526D elmoraelmora
661,127,650 *4428BEF1F8AC428FBFF10758C6F2E20F0D885F9F BBVWT
661,127,651 *442ED698305FAB66A7206127D0057548B30330CE emorybalaban
661,127,652 *4424F95F62307C8992DFA4CD91D37C8EE98D9D9B BELECTRICCAR
661,127,653 *442F50D54C6CE6F4F3F06A29BB8C315DF12F758D EN64.141.104.2X2
661,127,654 *4428CECA9E241B4F3E1BA52D4B99E8A809EA8F89 enamharb
661,127,655 *442926AF0C9A6CDB1F067C4E106E76829DDBBD9A enkeltfotingar
661,127,656 *44241C2DECC9940FDDE9A719539BBDE260CB0E14 eopk?
661,127,657 *4429BC60FC7216DD48A2D2071F714F7FC969ACF6 EO,UO
661,127,658 *442B22AC68A78A534413FC68639D8050FECA2E8D EPIBLASTSES
661,127,659 *442AABA6CF169B0938866884CCBFA714BF24EF50 BFC3
661,127,660 *4427820C9F6B3E8C27AA6C904D28D51933E88D2A ERIC-WILGENBUSCH
661,127,661 *4427657B5223B17741F1B297A848476DB26153EC ernestoheep
661,127,662 *442D392360A4E1B224F4335EF85CF0E835E841A0 BGTP%
661,127,663 *4428A47B137A8564FA7A3E2BA833C31FCA3726CE binze1
661,127,664 *442B7CD19CE6C2E2CA82B89B89C284E4997EBED5 [email protected]
661,127,665 *442C72D21BADBCEE57A348EFEA3A2373E4006943 [email protected]
661,127,666 *4428B8AAF65854F12069A353D690B58F379B00A5 bm+0a
661,127,667 *442E0F4145EBD305F46D58709C211B254F9E1EB9 BOB.CABRAL
661,127,668 *442EEE25C8DD1AB9ADD189DFA65432D2798A557D experience-hendrix
661,127,669 *442AD4E5B09DDB26E90580610CA704A1A7886C8B bonnieblaser
661,127,670 *442BAE04477A6E1FFFED3E785FB43FB3962999FA famida
661,127,671 *442BB44A3915C835AC6B7DA53B2BC29E0754D589 [email protected]
661,127,672 *442DE1AADEAF1385E015073E5A9F185042EE819B box set (disc 2: legacy of brutality, evi